Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Polyphosphate kinase 1 (PPK1) is a pathogenesis determinant in Campylobacter jejuni Candon, Heather L. 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0345.pdf [ 5.72MB ]
Metadata
JSON: 831-1.0100732.json
JSON-LD: 831-1.0100732-ld.json
RDF/XML (Pretty): 831-1.0100732-rdf.xml
RDF/JSON: 831-1.0100732-rdf.json
Turtle: 831-1.0100732-turtle.txt
N-Triples: 831-1.0100732-rdf-ntriples.txt
Original Record: 831-1.0100732-source.json
Full Text
831-1.0100732-fulltext.txt
Citation
831-1.0100732.ris

Full Text

POLYPHOSPHATE KINASE 1 (PPK1) is A PATHOGENESIS DETERMINANT IN CAMPYLOBACTER JEJUNI by Heather L. Candon B.Sc., The University of Waterloo, 2004 A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR T H E DEGREE OF M A S T E R OF SCIENCE in The Faculty of Graduate Studies (Microbiology) T H E UNIVERSITY OF BRITISH C O L U M B I A July, 2007 © Heather L. Candon, 2007 A B S T R A C T Campylobacter jejuni (C. jejuni) is the leading cause of bacterial gastroenteritis in the developed world. Despite the prevalence of C. jejuni as a human pathogen, relatively little is known about it's precise pathogenesis mechanisms, particularly in comparison to other well- , studied enteric pathogens like E. coli and Salmonella spp. Altered expression of phosphate genes in a C. jejuni stringent response mutant, together with known correlations between the stringent response, polyphosphate (poly P), and virulence in other- pathogens, led us to investigate the role of poly P in C. jejuni physiology and pathogenesis. All sequenced C. jejuni strains harbour a conserved putative polyphosphate kinase (PPK1) predicted to be principally responsible for poly P synthesis. We generated a targetedppkl deletion mutant (Appkl) in C. jejuni strain 81-176 and found that this mutant, as well as the AspoT stringent response mutant, exhibited low levels of poly P at all growth stages. In contrast, wild-type C. jejuni poly P levels increased significantly as the bacteria transitioned from log to stationary phase. Phenotypic analyses revealed that the Appkl mutant was defective for survival during osmotic shock and low-nutrient stress. However, certain phenotypes associated with ppkl deletion in other bacteria (i.e., motility, oxidative stress) were unaffected in the C. jejuni mutant, which also displayed a surprising increase in biofilm formation. The C. jejuni Appkl mutant was also defective for the virulence-associated phenotype of intra-epithelial cell survival in a tissue culture infection model and exhibited a striking defect in dose-dependent chick colonization. These results indicate that poly P utilization and accumulation contribute significantly to C. jejuni pathogenesis and affect its ability to adapt to specific stresses and stringencies. Furthermore, our study demonstrates that poly P likely plays both similar and unique roles in C. jejuni compared to other bacteria, and that poly P metabolism is linked with stringent response mechanisms in C. jejuni. ii Title Page i Abstract 1 1 Table of Contents iii List of Tables vi List of Figures • ••• vii Abbreviations vm Acknowledgements 1 X Dedication x 1.0. INTRODUCTION 1 1.1. Camplylobacter jejuni: Background 1 1.2. C. jejuni characteristics 1 1.3. Epidemiology 2 1.4. Campylobacteriosis 3 1.4.1. Disease symptoms • 3 1.4.2. Medical sequelae 4 1.4.3. Treatment and control of infection 5 1.5. Transmission and prevention 6 1.6. Molecular mechanisms of C. jejuni pathogenesis 7 1.6.1. Virulence factors 7 1.6.1.1. Motility 7 1.6.1.2. Chemotaxis 8 1.6.1.3. C. jejuni-host cell association and invasion 8 1.6.1.4. pVIR 10 1.6.1.5. Sensing and regulation. 10 1.6.1.6. Toxin production 11 1.6.1.7. Lipopolysaccharide and capsule 12 1.6.1.8. Biofilms... 12 1.6.1.9. C. jejuni stringent response 13 1.7. Bacterial polyphosphate metabolism 16 1.7.1. Interaction of poly P and stringent response in E. coli 17 iii 1.8. Hypothesis 17 2.0. M A T E R I A L S A N D M E T H O D S 18 2.1. Bacterial strains and growth conditions 18 2.2. Construction of C. jejuni 81-176 ppkl targeted deletion mutant 18 2.3. Complementation of ppkl deletion mutant 19 .2.4. Poly P Glassmilk Extraction 20 2.5. Measurement of poly P levels by a Toluidine Blue O assay 20 2.6. Nutrient down-shift survival assay 21 2.7. Osmotic stress survival assay... 21 2.8. Static biofilm formation assay 22 2.9. INT407 cell infection assay for invasion and intracellular survival... 22 2.10. Chick colonization assays 22 2.11. Additional phenotypic assays for which the Appkl mutant was not different from wild-type 24 3.0. R E S U L T S , ... 26 3.1. Introduction and rationale ; 26 3.2. Poly P interacts with the stringent response in C. jejuni 26 3.3. The Appkl is defective for poly P accumulation ...29 3.4. Poly P is critical for C. jejuni survival during nutritional down-shift 33 3.5. Poly P accumulation is required for C. jejuni to survive osmotic shock 35 3.6. The Appkl mutant displays accelerated static biofilm formation 37 3.7. The Appkl mutant is defective for prolonged intracellular survival 39 3.8. The Appkl mutant has reduced colonization capacity in a chick model 41 3.9. Phenotypes for which the Appkl mutant was not different from wild-type.43 4.0. DISCUSSION A N D C O N C L U S I O N S 49 4.1. Future directions 55 Bibliography 57 Appendices.. 70 Appendix A .70 Appendix B 70 iv Appendix C Appendix D L I S T O F T A B L E S Table 1 Phenotypes that were indistinguishable between wild-type and Appkl. vi L I S T O F F I G U R E S Figure 1 At later growth stages, phosphate transport and metabolism genes are disregulated in the AspoT mutant versus wild-type C. jejuni 15 Figure 2 Poly P levels in the AspoT'mutant remain lower than wild-type C. jejuni..28 Figure 3 C. jejuni ppkl and generation of a single insert Appkl disruption strain.. .30 Figure 4 Poly P accumulates in wild-type and ppkl * strains at later growth stages but remains at low levels in the Appkl mutant 32 Figure 5 Poly P is important for C. jejuni survival during nutritional downshift 34 Figure 6 Poly P is required for C. jejuni osmotic stress survival 36 Figure 7 The Appkl mutant exhibits increased static biofilm formation 38 Figure 8 The Appkl mutant is defective for long-term intracellular survival in an epithelial cell model of infection 40 Figure 9 The Appkl mutant exhibited a 7 day, dose dependent defect for chick caecal colonization 42 Figure 10 The Appkl mutant did not have a motility defect in 0.3% and 0.5% agar 44 Figure 11 Wild-type C. jejuni and the Appkl mutant displayed similar oxidative stress sensitivity 45 Figure 12 The Appkl mutant was equally sensitive to the organic acids propionic acid and acetic acid as wild-type 45 Figure 13 The Appkl mutant was not different from wild-type C. jejuni in low iron conditions 46 Figure 14 The Appkl mutant and wild-type C. jejuni grow identically in 0.16 M NaCl in MH broth 46 Figure 15 The Appkl mutant and wild-type C. jejuni grow . identically in MH broth 47 Figure 16 The Appkl mutant and wild-type C. jejuni grow identically under normal atmospheric conditions 47 Figure 17 The Appkl mutant and wild-type C. jejuni grow identically under anaerobic atmospheric conditions 48 vii A B B R E V I A T I O N S Appkl— polyphosphate kinase gene 1 deletion AspoT— spoT gene deletion A530—Absorbance at 530 nm A630—Absorbance at 630 nm ATP— adenosine 5'-triphosphate BHI— brain heart infusion bp— base pair C. coli— Campylobacter coli C. jejuni— Campylobacter jejuni CAT— chloramphenicol acetyltransferase CFUs— colony forming units Cm— chloramphenicol CmR— chloramphenicol resistance dHiO— distilled water DNA— deoxyribonucleic acid E. coli— Escherichia coli GBS— Guillain-Barre syndrome GDP— guanosine diphosphate GITC— guanidine isothiocyanate GTP— guanosine triphosphate H. pylori— Helicobacter pylori INT407— human intestinal 407 LB— Luria-Bertani M— molar MEM— Minimal Essential Media MH— Mueller-Hinton mM— millimolar MOI — multiplicity of infection MOPS— morpholine propane sulfonic acid nmol— nanomolar O D 5 6 0 — optical density at 560 nm O D 6 0 0 — optical density at 600 nm P. aeruginosa— Pseudomonas aeruginosa • Poly P— polyphosphate ppGpp— guanosine tetra-phosphate ppkl— polyphosphate kinase gene 1 PPK1— polyphosphate kinase protein 1 ppkl *— Complemented of ppkl deletion mutant ppk2— polyphosphate kinase gene 2 PPK2— polyphosphate kinase protein 2 PPX— exopolyphosphatase ppx— exopolyphosphatase gene PVC— polyvinyl chloride microtitre r.p.m — revolutions per minute SR— stringent response TBO— Toluidine Blue O V. cholerae — Vibrio cholerae viii A C K N O W L E D G E M E N T S This thesis is the culmination of three years of work in the Department of Microbiology and Immunology at the University of British Columbia, which would not have been possible without the help, advice and support of many. I would like to express my sincere appreciation and thanks to my advisor and mentor, Dr. Erin Gaynor, who encouraged and supported me throughout the duration of my research. Your constructive guidance, knowledge, insight, understanding and enthusiasm are very much appreciated. I have gained so much by being able to work with you. Thank you to my thesis committee Dr. George Spiegelman, Dr. Bill Mohn and Dr. Jim Kronstad. Also, my appreciation to all the members of the Gaynor laboratory, past and present, who made my graduate school experience so enjoyable; particularly Sarah Svensson, who is a good friend, and who was always willing to share a laugh and discuss the peripheral issues. Also, Cres Fraley for insightful discussion and Dr. Brenda Allen at VIDO for performing the chick colonization assays. To my Waterloo friends for the soul food— Kevin Hofstee, Colleen Bator, Kirsty Rennie, Kathleen Waller, Laura Brown, and Jean Yoon. Particularly, a heartfelt thanks to Nicky Potopsingh, my dearest and closest friend. Despite the distance between us, our regular conversations and discussions are a source of great fortitude, happiness and solace for me. Deepest thanks to my family for their unwavering support and strength. Mom and Dad, you always made my education a priority and raised me to strive for happiness above all else. Thank you for the infinite words of wisdom, consoling phone calls, and for believing in me every step of the way. To my fiance Jason George, thank you for your incredible patience and understanding. You have supported me on this long journey as I have forged forward to accomplish my goals. Words cannot describe how grateful I am to have you by my side. Your love and support carried me through some of the roughest times and decisions. ix D E D I C A T I O N To my Tattler- my faithfulfriendandsupporter. x 1.0. I N T R O D U C T I O N 1.1. CAMPLYLOBACTER JEJUNI : B A C K G R O U N D Campylobacter jejuni (C. jejuni) is a Gram-negative, highly motile, microaerophilic, fastidious bacterium, and is now considered the leading cause of human gastroenteritis in the developed world (Altekruse et al, 1999; Skirrow, 1994; Smibert et al, 1974). The genus name Campylobacter is derived from the Greek word meaning 'curved rods'. Although Campylobacter was first observed in 1886 by Escherich in the colons of neonates, it was not until the mid-1970s that Campylobacter was recognized as an important human pathogen (Kist, 1986). First classified as 'Vibriofetus' based on morphology and occurrence in abortive farm animals, Campylobacter fetus was later renamed based on biochemical tests and DNA content (Sebald and Veron, 1963; Smith and Taylor, 1919; Veron, 1973). The first selective isolation of Campylobacter spp. was accomplished in 1968 from the feces of a human diarrheic patient (Dekeyser et al., 1972). The genus Campylobacter belongs to the class s-proteobacteria and is a member of the recently defined family Campylobacteraceae (Vandamme, 2000). Along with Camplyobacter, the Campylobacteraceae family contains the genera Helicobacter, Arcobacter, Wolinella, and Flexispira. At present, the genus Campylobacter contains 14 species including C. jejuni, C. coli, C. fetus, C. lari, C. hyointestinalis, C. upsaliensis, C. helveticus, C. mucosalis, C. concisus, C. curvus, C. rectus, C. showae, C. sputorum, and C. gracilis (Vandamme, 2000). Although several Campylobacter species have been shown to cause gastroenteritis in humans, C. jejuni is the species most frequently implicated in infections (Butzler, 2004). 1.2. C . JEJUNI C H A R A C T E R I S T I C S C. jejuni is a spiral-bacillus shaped bacterium that displays rapid darting motility via two polar flagella. However, upon late stationary phase growth or prolonged exposure to oxygen, cells transition morphologically from spirals to cocci where they maintain a viable but non-1 culturable state before becoming inviable (Rollins and Colwell, 1986). C. jejuni is moderately thermophilic, microaerophilic, capnophilic, and demonstrates fastidious laboratory growth requirements. Growth is optimal at 37°C and 42°C, where the ideal atmosphere is 5% O2, 10% C02, and 85% N 2 (Nachamkin and Barbagallo, 1990; Shane and Montrose, 1985). Campylobacter spp. can vary in length from. 0.5 to 8 um and 0.2 to 0.5 um in width (Sebald and Veron, 1963). C. jejuni, along with other Campylobacteraceae, has a relatively small genome (~1.6 Mbp) with a low guanine and cytosine DNA content ranging from 29 to 37 mol% (Parkhill et al, 2000). The small genome size is perhaps reflected in this organism's requirement for complex growth media and the inability to ferment or oxidize carbohydrates, but instead acquire energy from amino acids or tricarboxylic acid cycle intermediates (Griffiths and Park, 1990; Ketley, 1997; Vandamme, 2000). 1.3. EPIDEMIOLOGY Campylobacter infection is the most common cause of bacterial gastroenteritis in developed countries, affecting more individuals than E. coli 0157:H7, Salmonella spp., and Shigella spp. combined (Altekruse etal, 1999; Blaser etal, 1983; Blaser, 1997; WHO, 2000). Current reports suggest that campylobacteriosis accounts for 5-15% of all diarrheal illnesses worldwide, affecting -1% of the Canadian, U.S., U.K., and Australian populations annually (Adak et al., 2005; NIAID, 2005; Yohannes et al., 2004). C. jejuni is estimated to account for 90% of reported campylobacteriosis cases, 17% of all hospitalizations related to food-borne illnesses in North America, and 5% of food-related deaths (Mead et al, 1999). Human Campylobacter isolates collected from Canadian patients from 1995 to 1999 were 99.4% C. jejuni or C. coli (HealthCanada, 2003). Canadian incidence rates for 2000 were approximately 40 per 100,000 population (CDC, 2003). In developing countries, where infection often goes 2 unreported, the incidence of C. jejuni infection is even higher and represents a major cause of gastroenteritis for travellers from developed countries (Griffiths and Park, 1990; Tauxe, 1992). Interestingly, the incidence of C. jejuni infection in the U.S. is considerably higher during the summer months, with an estimated 80% of cases occurring between May and August (Alios and Blaser, 1995; Alios, 2001; Ketley, 1997). In developing nations infection is endemic and outbreaks are not seasonal (Alios, 2001). C. jejuni can affect all ages, yet infants and young adults are reported to have the highest incidence rate of infection (Alios and Blaser, 1995). In developing countries, C. jejuni predominantly affects young children, while teenagers and adults are usually asymptomatic carriers (Lindblom et al, 1995). While in industrialized countries infections occur primarily in < 1 year of age and during young adulthood at 15-44 years of age, asymptomatic carriage in any age group is rare (Alios, 2001). Interestingly, the demographics of C. jejuni infection is unlike any other enteric pathogen, in that males are more likely to . experience infection than women and the reason for this preponderance is unknown (Friedman, 2001). Death as a result of C. jejuni infection is unusual at 0.05 per 1000 infections (Alios, 2001). 1.4. CAMPYLOBACTERIOSIS 1.4.1. Disease symptoms C. jejuni lives harmlessly in the intestinal microflora of most mammals and birds (Beery et al, 1988). However, upon infecting a human host, C.jejuni invades the intestinal mucosa, interrupts intestinal integrity, and causes profuse watery and/or bloody diarrhea (Butzler and Skirrow, 1979). In humans, the jejunum and ileum are colonized initially followed by infection of the colon (Alios and Blaser, 1995). Experimentation in humans revealed that the infectious dose is as low as 500-800 organisms and infection rate increases with increasing dosage (Black et al, 1988). 3 Clinical manifestations of campylobacteriosis can vary between individuals from asymptomatic to severe gastroenteritis (Blaser, 1997; Butzler and Skirrow, 1979). This dichotomy may be due to variations in strain virulence or host immune response to infection (Ketley, 1997). The incubation period following C. jejuni ingestion is between 1-7 days and is inversely related to dose of infection (Alios et al, 1998; Blaser, 1997). Symptoms are usually self-limiting, lasting for several days and ranging from abdominal cramps, watery and frequently bloody diarrhea, fever, nausea and vomiting. Isolation of C. jejuni from stool is necessary to differentiate sickness from other enteric pathogens (Alios et al, 1998). Continued shedding in feces lasts approximately 1.6 days, and relapse occurs in 20% of campylobacteriosis cases (Fields and Swerdlow, 1999). 1.4.2. Medical sequelae In rare cases, campylobacteriosis has been correlated with a number of other medical sequelae such as reactive arthritis, hemolytic uremic syndrome, and inflammatory bowel disease (Butzler and Skirrow, 1979). Most patients develop inflammation of the ileum or the jejunum, but some patients, particularly young adults, may develop peritonitis from acute appendicitis (Butzler and Skirrow, 1979; Crushell et al, 2004). Direct spread of C. jejuni from the gastrointestinal tract has been linked to complications such as cholecystitis, pancreatitis, and gastrointestinal hemorrhage (Alios, 2001). Infections outside of the gastrointestinal tract can include meningitis, endocarditis, septic arthritis, osteomyelitis, bacteremia and neonatal sepsis (Alios, 2001). Although bacteremia is rare, it is observed in 1% of patients and is more likely to occur in infants, the elderly or immunocompromised hosts (Butzler, 2004). The most notable complication of C. jejuni infection is Guillain-Barre syndrome (GBS), an acute neuromuscular flaccid paralysis (Crushell et al, 2004; Hughes, 2004). It is estimated that 30-40% of GBS patients experienced prior C. jejuni infections (Alios, 1998; Butzler, 2004). 4 GBS symptoms usually manifest 1-3 weeks after convalescence of enteritis symptoms (Butzler, 2004). O-side chain serotyping studies have demonstrated that specific serotypes of C. jejuni are associated with GBS (Konkel et al, 2001). C. jejuni-related GBS cases are currently thought to result from an autoimmune humoral response whereby antibodies produced against C. jejuni lipo-oligosaccharides cross-react with nearly identical structures on peripheral nerve gangliosides (Nachamkin et al, 1998; Nachamkin, 2002). C. jejuni has also been linked to cases of Miller Fisher syndrome, a rare variant of GBS characterized by onset of paralysis of the extraocular muslces and an absence of neurological reflexes (Endtz et al, 2000). 1.4.3. Treatment and control of infection Acute G. jejuni infection is usually self-limiting and resolves with in 1-2 weeks; however, severe, complicated, or systemic infections of immunocompromised hosts generally.require antibiotic therapy to quell infection (Nachamkin et al, 2002). The majority of strains are naturally resistant to antibiotics commonly used against other Gram-negative bacteria; these include trimethoprim, rifampicin and the penicillin family. Antibiotic therapy for C. jejuni infections consists of macrolide or fluoroquinolone treatment with either erythromycin or ciprofloxacin, respectively (Alios, 1998, 2001; Butzler and Skirrow, 1979; Butzler, 2004). Chemotheraputies are also thought to help prevent GBS in healthy individuals. Currently, there is no effective vaccine for the prevention or control of campylobacteriosis, and supportive treatment involves hydration and maintenance of electrolyte balance. At present, there is rapid and widespread emergence of fluoroquinolone-resistant strains, and this is significantly limiting the utility of these drugs. Reports indicate that 90% of C. jejuni isolates from Thailand and other countries are found to be fluoroquinolone-resistant (Nachamkin et al, 2002). This increase in resistance coincides with countries introducing fluoroquinolones into veterinary medicine and the poultry industry for use in food animals (Endtz et al, 1991). 5 Erythromycin is considered the drug of choice in treating C. jejuni as resistant rates remain low (Alios, 2001). 1.5. TRANSMISSION AND PREVENTION Campylobacter spp. are naturally zoonotic and reside commensally in the intestinal mucosa of a wide variety of wild and domestic animals. C. jejuni colonizes the ceca of birds in extremely high numbers (Newell, 2000); consequently, consumption and handling of meat from broiler chickens is a considerable risk factor in transmission (Alios, 2001; Friedman, 2001). C. jejuni is such a prevalent commensal among poultry flocks that up to 98% of commercial chicken and turkey products contain live C. jejuni (Newell, 2000; Willis and Murray, 1997). It has been estimated that a single drop of raw chicken juice may contain hundreds of live organisms (Hood et al, 1988). Other modes of transmission include contact with infected animals or through undercooked food, unpasteurized milk or contaminated water, as was in the case in Walkerton, Ontario, where fecal run-off contaminated clean water supplies leading to a community-wide outbreak of campylobacteriosis (Altekruse et al, 1999; Friedman, 2001). Shedding from avian hosts can contaminate waterways and recreational swimming pools. C. jejuni is able to survive for weeks in environmental waters and is capable of colonizing hosts at temperatures of 37°C or 42°C; a temperature variability that allows for infecting a range of vertebrate hosts (Bereswill and Kist, 2003). Person-to-person spread via fecal-oral transmission is rare, but has occurred among young children with diarrhea in child-care centers (Goossens et al, 1995). Prevention of C. jejuni infections in humans can be accomplished by reducing risk factors for acquisition. Strategies for the control and prevention of poultry colonization at the farm level are considered an important approach to the reduction or elimination of campylobacteriosis in humans. Such strategies include decreasing animals' consumption of antibiotics, disinfection of 6 animal food and water, treatment of manure, and isolation of sick animals (Alios, 2001). Interestingly, studies have found that treatment of carcass wash water with active chlorine, organic acids, sodium chloride, and tri-sodium phosphate seems to reduce C. jejuni contamination (Altekruse et al, 1999). However, proper food preparation, thoroughly cooking poultry and attention to hand hygiene appear to be the most important actions in preventing C. jejuni human infection (Alios, 2001). 1.6. M O L E C U L A R MECHANISMS OF C. JEJUNI PATHOGENSIS 1.6.1. Virulence factors Despite the prevalence of C. jejuni infection, the molecular mechanisms by which C. jejuni causes human disease as well as to adapt to or survive stresses encountered during both in vivo colonization an ex vivo transmission are not well understood, particularly in comparison to other well-studied pathogens such as Escherichia coli, Salmonella spp., and Helicobacter pylori. Our current limited understanding of C. jejuni is largely due to its fastidious growth requirements, interstrain virulence variability, and intractability to genetic manipulation. Moreover, the C. jejuni NCTC11168 genome sequence, published in 2000, revealed that C.jejuni lacks many virulence characteristics and factors found in other bacterial pathogens, such as pathogenicity islands, type III secretion systems and certain stress response factors like RpoS '(Parkhill etal, 2000). 1.6.1.1. Motility As mentioned previously, C. jejuni possesses two polar flagella and exhibits a characteristic rapid darting motility. The sequenced genome of C. jejuni NCTC 11168 highlighted the importance of motility in pathogenesis as a large portion of the genome encodes factors related to flagellum biosynthesis and chemotaxis (Parkhill et al., 2000). The C. jejuni 7 flagellum consists of a basal body, hook, and filament; where the filament is comprised of two adjacent proteins FlaA and FlaB (Crushell et al, 2004). The jlaA gene is expressed at a higher level than flaB (Ketley, 1997). A functional FlaA protein is required for C. jejuni motility and invasion and translocation of polarized cell monolayers in vitro (Fields and Swerdlow, 1999; Grant et al, 1993; Wassenaar et al, 1991). A controversial study in humans highlighted the importance of C. jejuni motility in vivo; volunteers were challenged with a mixture of a motile and non-motile phase-variant of C. jejuni and only motile strains were recovered from fecal samples (Black et al, 1988). Motility is thought to help the bacteria penetrate the mucosal layer of the intestinal epithelium and ultimately invade host cells (Wassenaar and Blaser, 1999). 1.6.1.2. Chemotaxis Chemotaxis is the movement of an organism toward or away from a chemical stimulus. C. jejuni has chemotactic ability and can move up and down a chemical gradient (Ketley, 1997). Chemotaxis is an important virulence determinant in C. jejuni. Studies investigating colonization capacity of a C. jejuni chemotatic mutant found that this function was required for colonizing the intestine of mice (Takata et al, 1992). A number of genes have been identified as being involved in C. jejuni chemotaxis, one in particular being cheY. A C. jejuni chemotactic mutant in the regulatory gene, cheY, resulted in reduced colonization and disease in an animal model of infection (Yao et al., 1997). Conceivably, the reduced virulence of the che Y mutant was due to an inability to move toward the chemoattractant mucin(Hugdahl et al, 1988). 1.6.1.3. C.jejuni-host cell association and invasion In the human host, C. jejuni causes disease by penetrating the intestinal mucosa, and adhering to and invading intestinal epithelial cells. C. jejuni can interact with host cells directly by microtubule-dependent invasion, translocation, or toxin-mediated cell cycle arrest (Bereswill 8 and Kist, 2003; Hu and Kopecko, 1999; Ketley, 1997; Kopecko etal, 2001; Lara-Tejero and Galan, 2000). Furthermore, host cell damage can occur indirectly by C. jejuni eliciting a host immune response (Bereswill and Kist, 2003). C. jejuni has been shown to induce interleukin-8 release from intestinal epithelial cells (Hickey et al, 1999). Human colonic epithelial cells exposed to C. jejuni show altered gene expression, suggesting that C. jejuni induces a host-specific response (Rinella et al, 2006). Damage to the intestinal mucosa and epithelial cell lining can cause persistent inflammation following resolution of infection (Everest et al, 1993; Russell et al, 1993). Several reports have shown that adhesions are critical for C. jejuni colonization. The fibronectin binding protein, CadF, is highly conserved among all C. jejuni isolates and was shown to be involved in host cell adherence and invasion (Konkel et al, 1997; Konkel et al, 1999) . PEB1 is an outer membrane adhesion protein, which is a homolog of Gram-negative amino acid transport systems. A PEB1 C. jejuni mutant displayed decreased adherence and invasion in vitro and reduced colonization in vivo (Pei et al, 1998). Other adhesion proteins include JlpA (jejuni lipoprotein A), major outer membrane protein (MOMP), P95, flagellum, and potentially the lipopolysaccharide and capsule (Jin etal, 2001; Kelle etal, 1998; McSweegan and Walker, 1986; Moser et al, 1992; Moser et al, 1997). The flagella are needed for motility in reaching host cells and establishing contact (Wassenaar et al, 1991). C. jejuni does not appear to produce pili or fimbriae that would assist in colonization (Gaynor et al, 2001; Parkhill et al, 2000) . C. jejuni is often considered an extracellular pathogen, yet it can invade and translocate through polarized monolayers. Invasion and translocation of intestinal epithelial cells in vitro correlates strongly with C. jejuni virulence in vivo (Bacon et al, 2000; Everest et al, 1992; Konkel et al, 1992). Interestingly, 86% of C. jejuni colitis-causing strains were able to translocate across polarized Caco-2 cell monolayers versus 48% of clinical isolates from non-9 inflammatory disease patients (Everest et al, 1992). Upon internalization C. jejuni is often found in vacuoles and in the cytoplasm of invaded epithelial cells and has been shown to survive for up to 36 hours in epithelial cells and 6-7 days in macrophages (Day et al., 2000; Konkel et al., 1992; Russell et al, 1993; Wassenaar et al, 1997). Superoxide dismutase (SodB) and catalase activity (KatA) are known to participate in intramacrophage survival. To date, only the C. jejuni stringent response (SpoT) and Fe2+ iron transporter (FeoB) are known to be involved in long-term survival within epithelial cells (Gaynor et al, 2005; Naikare et al, 2006). Intracellular survival of C. jejuni is thought to be important for disease, immune evasion, relapse, and long-term persistence (De Melo et al, 1989; Russell et al, 1993). 1.6.1.4. pVIR The presence of a pVIR plasmid in a subset of C. jejuni strains appears to correlate with invasiveness in vitro. pVIR is a 37.5 Kb plasmid that contains 54 open reading frames with many genes orthologous to components of a putative type IV secretion system (Bacon et al, 2000; Bacon et al, 2001). Mutations in two putative type IV secretion genes on the pVir plasmid in C. jejuni strain 81-176 resulted in decreased invasion of human intestinal epithelial cells in vitro, in addition to a reduction in natural transformation frequency (Bacon et al, 2000). The presence of the pVIR plasmid in strains of C. jejuni may increase an individuals risk for developing bloody stool; however, the correlation between pVIR and virulence in vivo remains somewhat unclear (Louwen et al., 2006; Tracz et al., 2005). 1.6.1.5. Sensing and Regulation Although C. jejuni has fastidious in vitro nutritional and atmospheric CO2 and O2 requirements, it can survive for long periods in sub-optimal environments, including those outside of its natural zoonotic host. The mechanisms by which C. jejuni navigates its complex 10 stress survival and pathogenesis cycle despite lacking several hallmark stress genes such as the stationary phase sigma factor RpoS, and other stress factors such as CspA and RpoH is intriguing (Park, 2002). Interestingly, the C. jejuni genome contains relatively few regulatory systems to survive and adapt to ex vivo and in vivo environments. The majority of regulatory proteins that have been characterized in C. jejuni include those involved in managing chemotaxis, motility, and heat-shock. Other regulators involved in stress survival include SpoT, required for low nutrient and high oxygen stress (Gaynor et al., 2005), NssR, involved in nitrosative stress survival (Elvers et al., 2005), HspR, response to heatshock (Andersen et al., 2005), PerR, required for oxidative stress (van Vliet et al, 1999), and Fur, for response to low iron conditions (Holmes et al, 2005). The C. jejuni genome contains only three predicted RNA polymerase sigma factors: a , a , a (Eppinger et al, 2004). One mechanism prokaryotes use to adapt to changing environments is two-component transduction systems, a family of proteins that are widely conserved among bacteria (Stock et al., 2000). An extracelluar stimulus interacts with the transmembrane sensor histidine kinase, which alters the cytoplasmic response regulator; thus, resulting in coordinated expression of multiple genes in response to environmental conditions. C. jejuni encodes seven histidine kinase and twelve response regulators. Characterized systems include RacRS, which was required for temperature-dependent growth and colonization of chicks (Markas et al, 1999), DccRS, was required for optimal in vivo colonization (MacKichan et al., 2004), FlgRS, which regulates the fla regulon (Wosten et al., 2004), and finally PhoSR, which is involved in regulating the phosphate regulon in C. jejuni (Wosten et al, 2006). 1.6.1.6. Toxin production C. jejuni produces a cytolethal distending toxin (Cdt), an exotoxin that causes cell cycle arrest in the Gl or G2 phases (Ketley, 1997). Cdt is thought to be a significant contributor to C. 11 jejuni pathogenesis. The cdt genes are commonly present in C. jejuni, although expression varies between strains (Bang et al, 2001).There are three adjacent genes required for Cdt production and activity, CdtA, CdtB and CdtC (Pickett et al, 1994; Pickett et al, 1996). CdtB has been shown to act as a DNase, where CdtA and CdtC interact to form a tripartite complex necessary for CdtB delivery into the cell (Lara-Tejero and Galan, 2001; Lee et al, 2003). C. jejuni human disease has been thought to be a direct result of the bacteria-host cell interaction, where Cdt induces host cell death and inflammatory response (Newell, 2001). 1.6.1.7. Lipooligosaccharide and Capsule The C. jejuni strain NCTC 11168 genome sequence revealed many hypervariable regions related to lipooligosaccharide and surface carbohydrate biosynthesis (Parkhill et al., 2000). C. jejuni has multiple surface structures that contain carbohydrates, such as lipooligosaccharide, TV-linked glycoproteins, capsular polysaccharides, and O-linked glycosylated flagellar proteins (Szymanski et al, 2003; Thibault et al, 2001). Multiple studies have shown that C. jejuni surface carbohydrates and glycosylation pathways play important roles in virulence and stress survival of this organism (Bacon et al, 2001; Guerry et al, 2000; Karlyshev et al, 2005; Szymanski et al, 2003). 1.6.1.8. Biofilms A biofilm is a multicellular layer of bacteria embedded within extracellular polymeric substances that are attached to surfaces (Donlan, 2002). Some speculate that, despite its fastidious growth requirements in vitro, the prevalence of C. jejuni in the environment, and subsequent transmission to humans, is likely due to its ability to form biofilms on a variety of abiotic surfaces (Alter and Scherer, 2006; Reeser et al, 2007; Rollins and Colwell, 1986). Recent reports indicate that P. aeruginosa and H. pylori form biofilms during infection, thus 12 biofilms not only contribute to survival but also pathogenesis in some organisms (Carron et al., 2006; Garcia-Medina et al, 2005). However, the precise role of biofilm formation in C. jejuni in vivo host commensalisms or human infection is still unknown. Various environmental stress conditions such as temperature fluctuation, oxygen tension, and nutritional status directly influence C. jejuni biofilm formation, and both flagella and quorum sensing are required for optimal biofilm formation under laboratory conditions (Reeser et al, 2007). Proteomic analyses of C. jejuni grown planktonically versus in a biofilm demonstrated that biofilm-grown cells exhibited increased protein expression levels involved in motility complex, the filament cap, basal body and the chemotactic protein, CheA. Moreover, enhanced protein expression was noted for general and oxidative stress responses, the adhesions, and proteins involved in biosynthesis and energy generation (Kalmokoff et al, 2006). 1.6.1.9. C. jejuni stringent response The stringent response (SR) is a global stress response system that alters gene expression pathways to facilitate survival during times of stress and stringency, such as nutrient or carbon starvation. In many bacteria, extracellular stress results in a marked increase in the amount of uncharged fRNA molecules that accumulate in the cell. This activates RelA and/or SpoT enzymes to synthesize guanosine tetra-phosphate (ppGpp), the main effector molecule of the SR. ppGpp binds to the P-subunit of RNA polymerase, altering transcription pathways and promoter specificity to allow the cells to survive the stress condition (Chatterji and Ojha, 2001). In general, Gram-negative bacteria have been thought to possess both RelA and SpoT and Gram-positive bacteria a single bifunctional RelA/SpoT (Mittenhuber, 2001). However, recent work from our group and others has shown that C. jejuni, as well as other s- and a-proteobacteria, contain a single bifunctional RelA/SpoT enzyme, in contrast to y-proteobacteria, which harbor two separate proteins (Gaynor et al, 2005). Analysis of a C. jejuni spoT (tsspoT) mutant revealed that 13 the SR was an important pathogenesis factor for specific stress and virulence-related conditions such as stationary phase survival and host cell infection. Microarray analysis of the C. jejuni AspoT SR mutant revealed increased expression of genes regulating inorganic phosphate uptake during stationary phase concurrent with up-regulation of genes involved in heat shock (Fig. 1), suggesting that poly P may play a role in C. jejuni stress survival (Gaynor et al, 2005). Moreover, poly P has been linked to stringent response (SR) mechanisms in the enteric pathogen E. coli (Kuroda et al., 1997; Rao et al., 1998). 14 W T AspoT 1 CJ0613 pstS periplasmic phosphate binding protein CJ0614 psfC put. phosphate ABC transport system permease Cj0638c ppa inorganic pyrophosphatase Cj0639c adk adenylate kinase Cj0509c dpB CLP protease ATP-binding subunit CJ0757 hrcA putative heat shock regulator CJ0758 grpE heat shock protein grpE CJ0759 dnaK heat shock protein dnaK Cj1228c htrA/degP serine protease (protease DO) CJ1220 groES 10 kDchaperonin(cpnlO) CJ1221 groEL 60 kD chaperonin (cpn60) fold difference in RNA levels: <2xl Figure 1. At later growth stages, heat shock and phosphate transport and metabolism genes are disregulated in the AspoT mutant versus wild-type C. jejuni. A C. jejuni DNA microarray demonstrates gene expression profiles for the ppa/adk, pst operons, and C. jejuni heatshock genes as previously described (Gaynor et al, 2005). Samples were collected for RNA microarray analysis at 2, 6, 10, 24 hours. Time is represented by the angled black triangle above the expression profiles. IS 1.7. BACTERIAL POLYPHOSPHATE METABOLISM Polyphosphate (Poly P) is ubiquitous in nature and consists of phosphate residues linked by high-energy phosphoanhydride bonds as in ATP. The ppkl gene is principally responsible for poly P formation in bacteria such as E. coli and encodes a polyphosphate kinase that reversibly forms poly P from the terminal y-phosphate of ATP (Ahn and Kornberg, 1990; Kornberg et al, 1999). Moreover, some bacteria also contain a homolog of ppkl, known as ppkl, which was first identified in Pseudomonas aeruginosa and uses poly P as a donor to convert GDP to GTP but can also function in poly P synthesis (Ishige et al, 2002). Interestingly, not all organisms possess ppk2, for example the highly characterized organism E. coli contains only ppkl (Zhang et al, 2002). C. jejuni, however, contains both ppkl and ppk2 genes (Zhang et al, 2002). An exopolyphosphatase, encoded by the ppx gene, is responsible for the degradation of poly P into phosphate residues in E. coli (Akiyama et al, 1992). Poly P has a multiplicity of functions within bacterial cells. Long chains of poly P can serve as a phosphate reservoir, a chelator of cations (Harold, 1966), a membrane channel for DNA entry (Reusch and Sadoff, 1988), a capsular component (Tinsley et al, 1993; Tinsley and Gotschlich, 1995), apH buffer (Jahid et al, 2006; Pick and Weiss, 1991; Price-Carter et al, 2005) and likely an ATP substitute. Furthermore, in E. coli poly P inhibits RNA degradation, promotes translation fidelity, and activates the Lon-protease complex that degrades specific ribosomal proteins to meet nutritional requirements during starvation (Kuroda et al, 2001). The essential role of poly P formation in bacterial pathogenesis has been established in such pathogens as E. coli, Pseudomonas aeruginosa, Vibrio cholerae, Klebsiella aerogenes, Salmonella enterica serovar Typhimurium, Helicobacter pylori, and Shigella flexneri. In these organisms, poly P formation was shown to be critical for various virulence attributes, including motility, quorum sensing, biofilm formation, and supportive resistance to oxidative, osmotic, 16 heat, alkaline stress, and stationary phase survival (Jahid et al, 2006; Kim et al, 2002; Ogawa et al, 2000; Price-Carter et al, 2005; Rao and Kornberg, 1996; Rashid et al, 2000a; Rashid et al, 2000b; Tan et al, 2005). The importance of poly P in various bacterial phenotypes has been reported, yet the molecular mechanisms and primary and secondary effects of poly P synthesis are still not understood. 1.7.1. Interaction of poly P and the stringent response in E. coli Functional links between the SR and poly P accumulation have been demonstrated in E. coli (Ault-Riche et al, 1998; Kuroda et al, 1997; Kuroda et al, 1999; Rao et al, 1998). In that organism, the SR regulatory molecule ppGpp inhibits poly P hydrolysis by blocking the activity of the PPX exopolyphosphatase, which hydrolyzes poly P into inorganic phosphate monomers. In E. coli SR mutants lacking ppGpp, PPX remains active, resulting in diminished levels of poly P (Kuroda et al, 1997). In E. coli,ppkl andppx are in an operon; thus levels of PPK1 and PPX are also transcriptionally co-regulated. In contrast, ppkl and ppx in C. jejuni and in several other bacteria (Mullan et al., 2002b) are not found in an operon and thus may not be transcriptionally linked. 1.8. HYPOTHESIS Our preliminary data involving microarray analysis of the C. jejuni AspoT mutant, together with work in other organisms, suggested that poly P utilization and accumulation, thus far unstudied in C. jejuni, plays an important role in C. jejuni physiology and pathogenesis and potentially interacts with stringent response mechanisms. 17 2.0. M A T E R I A L S A N D M E T H O D S 2.1. BACTERIAL STRAINS AND GROWTH CONDITIONS All studies were performed using the highly invasive strain, Campylobacter jejuni 81-176 originally isolated from a diarrheic patient (Korlath et al, 1985). The AspoT mutant of this strain was previously described (Gaynor et al, 2005). C. jejuni was routinely cultured on Mueller-Hinton (MH) (Oxoid Ltd, Hampshire, England) agar plates, and growth/survival curves were conducted in MH broth unless otherwise stated (Oxoid Ltd, Hampshire, England). C. jejuni was always grown in media supplemented with 10 ug/ml vancomyocin and 5 ug/ml trimethoprim; chloramphenicol (Cm) was added at 20 ug/ml when required. All bacteria were enumerated on MH agar plates by performing serial 10-fold dilutions, unless otherwise stated. Plates were incubated in a tri-gas incubator (Heraeus), under the following conditions: 6% O2, 12% CO2, at 37°C. Broth culture growth/survival curves were performed using the Oxoid CampyGen system to produce a microaerobic atmosphere of 6% O2, and 12% CO2, and cells were shaken at 200 r.p.m, at 37°C. E. coli strain DH5a was grown on Luria-Bertani (LB) agar or broth, with the addition of 30 ug/ml of Cm as needed, at 37°C under normal atmospheric conditions. Karmali agar was used for growth of C. jejuni for the chick colonization studies. 2.2. CONSTRUCTION OF C . JEJUNI 81-176ppkl TARGETED DELETION MUTANT A polyphosphate kinase (ppkl) gene with 30.1% identity and 50.7% similarity to the ppkl gene in E. coli was identified in the C. jejuni genome using the Blast features of CampyDB (http://campy.bham.ac.uk/(Chaudhuri arid Pallen, 2006). The ppkl gene was PCR-amplified from C. jejuni chromosomal DNA prepared using the Qiagen DNeasy kit (Qiagen Inc., Valencia, CA), with primers PPK1-2 Fp (GCAAATATTTACACCAAGAAAAAGAAC) and PPK1-2 Rp (ATCTGCACTCGATATAAAATAATTTGG), yielding a 1550 bp fragment. The amplified product was cloned into the pGEM-T vector (Promega, Nepean, CA.), which is a suicide plasmid 18 in C. jejuni. Two EcoRl sites located within the ppkl gene were used to remove a 1048 bp fragment. A chlorampehnicol acetyltransferase cassette (cat) was excised from pRY109 (Yao et al, 1993) with EcoRl and ligated into the £coRI-digested pGEM-ppkl vector to create the ppkl::cat knockout construct. Cat cassette insertion was confirmed by restriction digestion and sequencing (Nucleic Acid Protein Service Unit, Vancouver, CA.). This construct was used to naturally transform C. jejuni 81-176 (van Vliet et al, 1998). Transformants were recovered on MH agar plates supplemented with Cm. Clones with proper insertion of the cat cassette into the C. jejuni ppkl gene resulted from a double recombination event with the described construct. Insertional inactivation of the ppkl gene via cat cassette (Appkl) insertion was verified by PCR using PPK1-1 Fp (TGCCCTTAGCGTTATAAAAAGTATAAA) and PPK1-1 Rp (AATTTTCGGTCATTTTTGATAGTGTAG) primers that are external to the ppkl gene and the region originally amplified (Appendix). Sequencing also verified a single chromosomal insertion of the cat cassette into the ppkl gene (Appendix). 2.3. COMPLEMENTATION OF Appkl DELETION MUTANT Generation of a re-constituted wild-type strain of C. jejuni, designated ppkl * was achieved via natural transformation of the intact full length Appkl mutant with the ppkl gene in pGEM-T. Serial 10-fold dilutions of naturally transformed Appkl mutant were spread on MH plates, harvested after 2 hours, plated on MH plates supplemented with 0.17 M NaCl, and incubated for 48 hours at 37°C in a tri-gas incubator. Individual colonies were selected and purified on MH agar containing 10 ug/ml of vancomyocin and 5 ug/ml trimethoprim. Colonies were tested for sensitivity to chloramphenicol by plating on MH agar plates containing 20 ug/mL of chloramphenicol. Colonies representing putative re-constituted wild-type strains were confirmed using PCR with the PPK1-1 primer set and sequence analysis of 18 bona fide recombinants, represented by ppkl *. 19 2.4. P O L Y P GLASSMILK EXTRACTION Extraction of poly P from C. jejuni cells and binding to glassmilk was performed as described by Ault-Riche et al, 1998. C. jejuni cultures were grown in MH broth to mid-log phase, and then diluted to" 0.05 ODeooto initiate the time course experiment. Cells were harvested after 2, 10 and 24 hours by pelleting 1 mL in a table top centrifuge, at 6000 r.p.m. for 10 minutes. All pellets were processed immediately for poly P assays. To each pellet 500 uL of prewarmed at 95°C 4 M guanidine isothiocyanate (GITC)-500 mM Tris-HCl, pH 7.0 (GITC lysis buffer) was added. Tubes were vortexed, incubated for 5 minutes in a 95°C heating block, and sonicated briefly; a 10 uL sample was removed for total protein estimation using a Coomassie Plus Protein Assay Reagent (Pierce) with bovine serum albumin as the standard. Each sample and all bovine serum albumin standards were treated with Compat-Able Protein Assay Kit (Pierce). To each tube 30 uL of 10% sodium dodecyl sulfate, 500 uL of 95% ethanol, and 5 uL of Glassmilk. Tubes were vortexed and centrifuged briefly to pellet the glassmilk, which was then resuspended in 500 uL of ice cold New Wash Buffer (5 mM Tris-HCl [pH 7.5], 50 mM NaCl, 5 mM EDTA, 50% ethanol) by vortexing and re-pelleted; washing was repeating two additional times. The washed pellet was resuspended in 50 uL of 50 mM Tris-HCl (pH 7.4)-10 mM MgCl2-20 ug each of DNase and RNase per ml and incubated at 37°C for 10 minutes. The pellet was washed with 150 uL of 4 M GITC lysis buffer and 150 uL of 95% ethanol and then twice in New Wash Buffer. Poly P was eluted from the Glassmilk pellet with 50 uL of 50 mM Tris-HCl (pH 8.0) at 95°C for 2 minutes, followed by two additional elutions. 2.5. MEASUREMENT OF POLY P LEVELS BY A TOLUIDINE B L U E O ASSAY A standard curve was determined by the addition of 100 uL of a known concentration of Phosphorus Standard (Sigma-Aldrich, Oakville, CA.) sample that had been serially diluted (1:10) 20 in 900 uL (64, 32, 16, 8, 4 nmol poly P) of a Toluidine Blue O (TBO) (Sigma-Aldrich, Oakville, GA.) dye solution consisting of 6 mg/mL of TBO in 40 mM of acetic acid. After the addition to TBO, all samples (standard curve and C. jejuni time course samples) were incubated at room temperature for 15 minutes. Absorbance at 630 nm and 530 nm levels were assessed spectrophotometrically and used to generate an A 5 3 0 / A 6 3 0 ratio; poly P binding to TBO results in a shift in TBO absorbance from 630 nm to 530 nm. All C. jejuni extracted samples of poly P were measured identically to the standard curve, and poly P levels were expressed in nmol of poly P and per milligrams of total cellular protein, as measured via Bradford analysis (Pierce Scientific). 2.6. NUTRIENT DOWNSHIFT SURVIVAL C. jejuni were grown microaerobically at 37°C in MH broth to mid-log phase overnight, collected by centrifugation at 6000 r.p.m. for 10 minutes, and washed twice with Minimal Essential Media (MEM) with Earle's salts and L-Glutamine (Difco, USA) or in MOPS-MGS media/Bacteria were re-suspended in MEM or MOPS-MGS and diluted to an O D 6 0 0 of 0.05. Cultures were placed under microaerobic conditions at 37°C, shaking at 200 r.p.m. Colony forming units (CFUs) were measured over time by plating on MH agar plates. 2.7. OSMOTIC STRESS SURVIVAL C. jejuni strains were grown to mid-log phase, serially diluted (1:10), and spotted onto MH agar plates containing 0.17 M NaCl to assess single colony growth. Survival during osmotic stress was also tested in shaking liquid cultures by growing bacterial strains to mid-log phase in MH and diluting to 0.05 OD6oo in MH broth +/- 0.25 M NaCl and/or Brain Heart Infusion broth. CFUs were assayed. 21 2.8. STATIC BIOFILM FORMATION Biofilm formation was assayed as described previously (O'Toole, 1998). Briefly, cells were grown microaerobically in MH broth at 37°C to log phase overnight and diluted to O D 6 0 0 of 0.20 and 0.02. 100 uL aliquots were added to 96-well polyvinyl chloride plates and incubated at 37°C. Static biofilm formation as measured by surface-associated bacteria was assessed by adding 25 uL of a 1% crystal violet solution in ethanol, incubation for 15 minutes at room temperature, and washing 3x with distilled water (Kolter, 2000). To quantify biofilm formation, 150 uL of 80% dimethyl sulfoxide was added to each PVC well, covered, and incubated 24 hours at room temperature. A 1:10 dilution in 80% DMSO of each well was measured at OD56o to quantify the amount of biofilm stained by crystal violet. 2.9. I N T 4 0 7 C E L L INFECTION ASSAY FOR INVASION AND INTRACELLULAR SURVIVAL Human intestinal 407 (INT407) cells were seeded to semi-confluence (~1 x 105 cells/well) and confluence (-5.5 x 105 cells/well) in 24 well plates approximately 16 hours prior to infection assays. C. jejuni strains were inoculated at OD6oo=0.001 into MH broth culture and grown overnight to mid-log phase. Bacteria were pelleted at 6000 r.p.m. for 10 minutes, washed twice with MEM, and diluted to 0.002 OD600 in MEM. Bacterial suspensions in MEM (1 mL) were used to infect tissue culture cells at a multiplicity of infection (MOI) of-100 and -20, respectively (-107 bacteria/ ml). All experiments were performed in triplicate. Following three hours of infection in a 5.0% CO2 incubator, bacteria in MEM were removed from the wells and cells were washed 2x with MEM. To all wells, 1 mL of MEM containing 150 ug/mL of gentamicin was added to kill remaining extracellular bacteria. After two hours, wells were washed 2x with MEM. To assay invasion, 1 mL of dH20 was added to some of the wells, and INT407 cells were disrupted by lysis with a 27G syringe. Invaded bacteria were assayed by serial dilution and plating on MH agar. Samples for assaying intracellular survival were covered with 22 MEM with 3% Fetal Bovine Serum and the addition of 10 ug/mL of gentamicin to halt bacterial growth if cell lysis occurred. After 23-24 hours of incubation, intracellular survival was assayed as described for invasion samples. 2.10. CHICK COLONIZATION ASSAYS Colonization of one-day-old chicks was performed essentially as described previously (Carrillo et al, 2004). Briefly, broiler chicks were obtained from a local hatchery in Saskatchewan on the day of hatch. Five chicks were euthanized and their cecal contents cultured for Campylobacter. The remaining birds were randomly assigned into groups of 10 birds and provided with feed and water ad libitum. Birds were cared for in accordance to guidelines of the Canadian Council for Animal Care. Birds were orally challenged with the indicated strain (wild-type or Appkl mutant) and dose (1.5xl05, 1.5xl06, and 1.5xl07 CFUs) of C. jejuni in 0.5 ml of MH broth, based on previous experiments to determine the optimal dose of our wild-type strain. Inocula for challenge experiments were produced by harvesting cells grown for 18 h under microaerophilic conditions at 37°C into cold MH broth, diluting to the indicated concentration in MH broth, and maintaining on ice until immediately before use. Viable cell counts were determined by plating serial dilutions onto MH agar (Becton, Dickinson and Company, USA). Birds were maintained for seven days after challenge and. then were euthanized by cervical dislocation. Caeca were aseptically collected for qualitative as well as quantitative assessment of colonization. Colonization of the birds was monitored by culturing cecal contents, after appropriate dilutions were made in MH broth, on Karmali agar (Bacto, USA) under ^ microaerophilic conditions at 42°C. 23 2.11. ADDITIONAL PHENOTYPIC ASSAYS FOR WHICH THE Appkl MUTANT WAS NOT DIFFERENT FROM WILD-TYPE Motility— C. jejuni strains were grown microaerobically in MH broth at 37°C to log phase overnight and OD600 were read. In vitro motility assays were preformed by diluting cells to OD600 of 0.02 or 0.1 and stabbing the appropriate volume of each strain into MH agar plates that contained 0.3% or 0.5% agar, respectively. Migration of the cells from the point of inoculation was analyzed following 24 hours of incubation at 37°C. Oxidative sensitivity— Cells were grown microaerobically in MH broth at 37°C to log phase overnight and diluted to OD600 of 0.05 and 100 ul of each strain was evenly spread on a MH agar plate. Whatman filter paper disks were autoclaved and moistened with 10 ul of 3% H2O2. Disks were placed on the cell lawns and incubated at 37°C for 24 hours prior to analysis of growth inhibition. The zone of growth-inhibition surrounding the disk was measured to determine sensitivity. Survival in organic acids— C. jejuni were grown microaerobically at 37°C in MH broth to mid-log phase overnight, collected by centrifugation at 6000 r.p.m. for 10 minutes. Bacteria were re-suspended in MH broth with the appropriate organic acid and diluted to an OD600 of 0.05 in MH broth containing either 9mM propionic acid or 22mM acetic acid. Cultures were placed under microaerobic conditions at 37°C, shaking at 200 r.p.m. CFUs for survival in organic acids were measured over time by plating on MH agar plates. Low iron conditions— C. jejuni strains were grown microaerobically in MH broth at 37°C to log phase overnight and diluted to O D 6 0 0 of 0.05 and 100 ul of each strain was evenly spread on a MH agar plate. Disks containing sterile desferal (Fe3+) and dipyridyl (Fe2+) at 40 mM concentrations were placed on the cell lawns and incubated at 37°C for 24 hours prior to analysis of growth inhibition. The zone of growth-inhibition surrounding the disk was measured to determine sensitivity. 24 MH broth— C. jejuni were grown microaerobically at 37°C in MH broth to mid-log phase overnight. Bacteria were diluted to an OD6oo of 0.05. Cultures were placed under microaerobic conditions at 37°C, shaking at 200 r.p.m. CFUs were measured over time by plating on MH agar plates. Aerobic survival— C. jejuni was grown as described above and diluted to an O D 6 0 0 of 0.05. Cultures were placed under aerobic atmospheric conditions at 37°C, shaking at 200 r.p.m. CFUs were measured over time by plating on MH agar plates. Anaerobic survival— Strains were grown as described above and diluted to an OD600 of 0.05. Cultures were placed under anaerobic conditions, using an Anaero-GasPak from Oxoid, at 37°C, shaking at 200 r.p.m. CFUs were measured over time by plating on MH agar plates. Osmotic stress— Survival during osmotic stress was also tested in shaking liquid cultures by growing bacterial strains to mid-log phase in MH and diluting to 0.05 OD600 in MH broth +/-0.16 M or +/- 0.3 M NaCl. CFUs were assayed over time. Calcofluor white— To assay calcofluor white fluorescence, bacteria were grown overnight in shaking broth cultures to mid-log phase. Cells were diluted to OD600 of 0.05. Bacteria were streaked out on Brain Heart Infusion broth plates (Difco) containing 0.02% calcofluor white. Plates were grown under 37°C microaerobic conditions for 24 hours and transferred to 42°C anaerobic conditions for an additional 24 hours. All calcofluor white incubations were preformed in the dark. Calcofluor white reactivity was visualized as fluorescence under long-wave UV light. 25 3.0. R E S U L T S 3.1. INTRODUCTION AND RATIONALE Poly P's importance in basic processes and bacterial pathogenesis has been established in organisms such as E. coli, P. aeruginosa, and V. cholerae. Tangible links have also been drawn between the SR and poly P in several of the abovementioned pathogens. A wild-type versus AspoTmicroarray experiment (Gaynor et al, 2005) led us to query a possible involvement of poly P in C. jejuni pathogenesis and a putative connection with the S R (Fig. 1). C. jejuni harbours homologs of several genes potentially involved in poly P metabolism, one of which, ppkl (polyphosphate kinase), was predicted to be responsible for the bulk of poly P production. To test this, the ppkl gene was disrupted in the highly invasive C. jejuni strain 81-176. The ppkl deletion mutant (Appkl) was subjected to specific stresses to compare its growth, survival, invasiveness and commensal colonization to that of wild-type. 3.2. P O L Y P INTERACTS WITH THE STRINGENT RESPONSE IN C. JEJUNI Poly P levels in wild-type and the AspoT mutant strains were determined in shaking broth cultures harvested at various stages of growth (Fig. 2A, B). Poly P was extracted following cell lysis by binding to glassmilk and measured using the metachromatic dye, TBO. Poly P binds TBO, resulting in an absorbance shift from 630 nm to 530 nm; the 530 nm/630 nm ratio thus reflects the amount of poly P in a given sample (Mullan et al, 2002a). A standard curve was determined by the addition of a known concentration of phosphorus standard to TBO and plotting phosphorus concentrations versus the absorbance ratio. Poly P levels in C. jejuni samples are expressed as nmol of poly P and normalized to milligrams of total cellular protein. In wild-type C. jejuni, poly P levels were significantly higher than those of the AspoT, with levels peaking in stationary phase at 33.8 nmol poly P/mg of total protein. The AspoT mutant exhibited poly P levels that were also significantly lower than wild-type at both 10 and 24 26 hours (p-value < 0.05), with the largest difference (~3.2-fold) again observed in stationary phase. Furthermore, wild-type, AspoT exhibited similar growth profiles by CFU/ml (Fig. 2A) analyses. 27 Figure 2. Poly P levels in the AspoT mutant remain lower than wild-type C. jejuni. (A) Wild-type (WT) C. jejuni 81-176 (black squares), and the AspoT" mutant (open circle) were grown microaerobically in shaking broth culture to early log phase and diluted to 0.05 O D 6 0 0 per ml. Cultures (1ml) were harvested at 2, 10 and 24 hours and assayed for CFU/ml, and (B) intracellular poly P levels versus total cellular protein. Triplicate samples were harvested and assayed for each time point. Statistical significance (student's /-testp-va\ue < 0.05) is represented by an asterisk (*). n=3 28 3.3. T H E Appkl MUTANT IS DEFECTIVE FOR POLY P ACCUMULATION All three sequenced C. jejuni strains harbour a ppkl gene (Fig. 3 A) encoding a putative polyphosphate kinase (PPK1) with significant sequence identity to that in other bacteria. The predicted C. jejuni amino acid sequence exhibits 45.4%, 36.2%, and 30.1%o identity to PPK1 in Helicobacter pylori, P. aeruginosa, and E. coli, respectively. Moreover, two highly conserved histidine residues, required for PPK1 activity in E. coli, are also conserved at H427 and H580 in the C. jejuni 81-176 strain. In S\-176,ppkl appears to be a single-gene operon, and microarray data from multiple gene expression experiments indicate that ppkl is transcribed independently of neighbouring genes (Fouts et al, 2005; Gaynor et al, 2004; Gaynor et al, 2005; Hofreuter et al, 2006; MacKichan et al, 2004; Parkhill et al, 2000). To explore the role of poly P in C. jejuni 81-176, -50% of the ppkl gene was deleted, including the codons for the conserved His residues, and replaced with a cat cassette (Fig. 3B). PCR and sequence analysis demonstrated a single CmR insert in the ppkl gene (Appendix A, B). To ensure that observed phenotypes were attributed to ppkl, a reconstituted wild-type strain was generated by homologous recombination of a wild-type copy of ppkl into the Appkl strain ppklv.cat locus as described in Experimental Procedures. The resulting reconstituted wild-type strain was designated ppkl * and was verified by PCR and sequence analysis (Appendix C, D). 29 A nrfA nrfH PPk1 ruvB amaA C. jejuni W -176 « H E « » » nrfA nrfH p p k 1 ruvB amaA C. jejuni 11168 + C.yey'un/RM1221 « < > rai/B ama^ A B nr/tt HATT-/ pp/c7" Cnf ruvB amaA A — • — • Figure 3. C. jejuni ppkl and generation of a single insert Appkl disruption strain. (A) Genomic location of the ppkl gene is conserved among the sequenced and annotated strains C. jejuni 81-176, C. jejuni 11168 and C. jejuni RM1221. MUMer alignment was performed using CampyDB gene viewer (Chaudhuri and Pallen, 2006). The diagram shows the region encompassing bases of 1265972-1286763 C. jejuni 81-176, and the equivalent region encompassing bases of 12872174-1302173 of CyejwwNCTC11168 and 1434899-1457437 C. jejuni RM1221. Hypothetical proteins are represented by an asterisk (*), and genes with no predicted orthologues are coloured grey. (B) The approximate site of the CmR-marked insertion-deletion mutation generated in C. jejuni 81-176 ppkl is shown. The resultant mutant strain was designated Appkl. 30 Poly P levels in wild-type, the Appkl mutant, and ppkl * strains were determined in shaking broth cultures harvested at various stages of growth. Poly P was extracted following cell lysis by binding to glassmilk and measured using TBO. The standard curve was used to determine levels of poly P accumulation. Poly P levels in C. jejuni samples are expressed as nmol of poly P and normalized to milligrams of total cellular protein. The poly P assay confirmed that the ppkl gene is responsible for the majority of C. jejuni poly P synthesis (Fig. 4B). Poly P levels were significantly higher in wild-type C. jejuni than those of the Appkl mutant. The Appkl mutant exhibited significantly lower levels of poly P at both 10 and 24 hours (p-value < 0.05), with the largest difference (-3.8 fold) observed at the 24-hour stationary phase time point. The complemented ppkl * strain displayed similar levels of poly P compared to wild-type at all time points assayed. Furthermore, wild-type, Appkl, and ppkl * exhibited identical growth profiles by CFU/ml (Fig. 4A) analyses. 31 A 10H 10H 1 1 1 r— 1 1 0 5 10 15 20 25 30 Time (hours) Figure 4. Poly P accumulates in wild-type and ppkl * strains at later growth stages but remains at low levels in the Appkl mutant. Wild-type (WT) Q 81-176 (black squares), Appkl mutant (grey triangle), and the complemented strain ppkl * (star) were grown microaerobically in shaking broth culture to early log phase and diluted to 0.05 ODeoo per ml. (A) Cultures (1ml) were harvested at 2, 10 and 24 hours and assayed for CFU/ml, and (B) intracellular poly P levels versus total cellular protein. Triplicate samples were harvested and assayed for each time point. Statistical significance (student's Mest/>value < 0.05) is represented by an asterisk (*). n=5. 32 3.4. P O L Y P IS CRITICAL FOR C. JEJUNI SURVIVAL DURING NUTRITIONAL DOWN-SHIFT To simulate a nutritionally poor milieu, wild-type, Appkl, and ppkl * strains were subjected to starvation conditions by a downshift from rich MH broth to nutrient-poor Minimum Essential Medium and assayed for CFUs/ml over a 9 hour (Fig. 5A) and 55 hour (Fig. 5B) time course. The Appkl mutant exhibited defects in adaptation to survival during low nutrient stress versus wild-type in early adaptation time-points assayed from 5-10 hours. The most pronounced effect of nutrient down-shift was seen after 5 hours in Fig. 5B, at which time culturability of the mutant dropped -250 fold relative to the wild-type and ppkl * strains. Survival was also assessed in another limited-nutrient media, MOPS-MGS buffered media (Mendrygal and Gonzalez, 2000) without phosphate (Fig. 5C). As expected, the Appkl mutant showed a considerable defect in survival at later time points assayed; however, the differences were not as pronounced as those in MEM. These data demonstrate that the Appkl strain exhibits nutrient down-shift tolerance defects in two different minimal media. 33 ioH—[—i—i i i—i—r—i—i—i 0 1 2 3 4 5 6 7 8 9 10 Time (hours) iu T 1 1 1 1 1 1 0 10 20 30 40 50 60 Time (hours) Figure 5. Poly P is important for C. jejuni survival during nutritional downshift. WT (black square), Appkl (grey triangle), and ppkl * (star) were grown in MH broth to mid-log phase. Cells were subjected to nutritional downshift by centrifugation followed by resuspension to 0.05 OD600 in (A and B) minimum essential media or (C) MOPS-buffered media. n=5. 34 3.5. P O L Y P A C C U M U L A T I O N IS R E Q U I R E D F O R C. JEJUNI TO S U R V I V E O S M O T I C S H O C K To test survival under osmotic stress, strains were grown to mid-log phase, shifted to MH broth with or without NaCl added to 0.25 M, and CFU/mL were enumerated at time points indicated (Fig. 6A). During osmotic shock, both the wild-type and the Appkl mutant strains ceased growth at 5 hours in MH broth. After 24 hours, Appkl survival levels were > 10-fold lower than wild-type. By 72 hours, the Appkl mutant CFU/ml were > 1000-fold lower than wild-type levels. Wild-type and Appkl grow identically in MH broth without the addition of salt (Fig. 6A); levels less than 0.25 M NaCl did not inhibit survival of wild-type or Appkl strains (data not shown). Moreover, a nutrient and salt rich media, Brain Heart Infusion broth, also decreased Appkl mutant survival at later time points compared to wild-type. The ability of single bacteria to grow into colonies during continuous osmotic stress was tested by growing wild-type, Appkl, and ppkl * strains to mid-log phase in salt-free broth, then serially diluting and spotting the bacteria onto MH plates containing 0.17 M NaCl. Under these conditions, the Appkl mutant was significantly defective for growth compared to wild-type and ppkl * strains (Fig. 6B); all strains grew identically on MH agar without added salt (data not shown). 35 A B - • - WT MH + 0.25 M NaCl -A- Appkl MH + 0.25 M NaCl — B — WT MH —h-Appkl MH T 1 1 1 1 1 0 10 20 30 40 50 60 70 80 90 Time (hours) WT Appkl ppkl* Figure 6. Poly P is required for C. jejuni osmotic stress survival. C. jejuni 81-176 wild-type and Appkl strains were grown to mid-log phase and shifted to M H broth +/- 0.25 M NaCl (A). Growth/survival was monitored by CFU/ml plate counts. (B) Wild-type, Appkl, and ppkl * strains were grown to mid-log phase in M H broth and serially diluted (1:10) from 2xl0 5 - to 2x10* CFU/ml and spotted onto 0.17 M Nacl M H agar plates. Growth was assessed after days 48 hours under microaerobic conditions. n=4. 36 3.6. T H E Appkl MUTANT DISPLAYS ACCELERATED STATIC BIOFILM FORMATION Biofilm formation contributes to bacterial virulence, colonization, environmental survival, and antibiotic resistance. Poly P has been shown to be essential for biofilm formation in several bacteria, including P. aeruginosa (Rashid et al., 2000b). The role of poly P in C. jejuni biofilm formation was assayed by growing standing broth cultures of C. jejuni wild-type, Appkl, and ppkl * strains in polyvinyl chloride microtitre (PVC) plates from starting OD600 levels of 0.02 and 0.20. Biofilm formation at the air-liquid interface and on the sides of the PVC plates wells were assayed by staining the wells with a crystal violet solution; in this assay, increased crystal violet staining correlates with increased biofilm production (O'Toole and Kolter, 1998). After two days, wild-type C. jejuni bacteria formed a faint biofilm at the air liquid interface for both starting doses, while the Appkl mutant demonstrated a statistically significant (student's t-test p-value <0.05) increase in the amount of static biofilms at both the air-liquid interface as well as on the bottom and sides of the well compared to wild-type for both inoculating doses (Fig. 7A, B). The Appkl mutant also exhibited a dose-dependent biofilm phenotype: the higher inoculating dose of Appkl yielded a statistically significant (student's/- test p-value O.05) increase in biofilm formation compared to the lower inoculating dose of Appkl, whereas a similar phenomenon was not observed for wild-type (Fig. 7B). After three days, wild-type and Appkl biofilm densities were approximately equal (data not shown). Consistent with our other observations, ppkl * exhibited wild-type biofilm formation levels (Fig. 7A, B). 37 A B 0.020 0.200 Starting O D 6 0 0 Figure 7. The Appkl mutant exhibits increased static biofilm formation. 96-well PVC plates were inoculated with C. jejuni in MH broth at O D 6 0 0 0.02 and 0.20. At 48 hours, the biofilms were qualitatively observed by crystal violet staining. (A) Representative wells from the OD600 0.02 inoculation are shown for wild-type, Appkl, and ppkl *. (B) Biofilm formation was quantified by addition of 80% DMSO to each crystal violet stained well, followed by O D 5 7 0 absorbance measurements of solubilized crystal violet. Statistical significance (student's t-test/>-value < 0.05) is represented by an asterisk (*). n=4. 38 3.7. T H E Appkl MUTANT IS DEFECTIVE FOR PROLONGED INTRACELLULAR SURVIVAL To assay the virulence-associated phenotypes of invasion and intracellular survival, wild-type, Appkl, and ppkl * strains were allowed to infect INT407 cells at an MOI of-20 or -100, respectively, for three hours. Gentamicin was added to all wells to kill extracellular bacteria, after which cells were assayed for invasion as well as both short-term and long-term term intracellular survival, after 2h and 18h IC (MOI -20) or 2h and 19h IC (MOI -100), respectively. Wild-type and the Appkl mutant exhibited similar invasion survival profiles (Fig. 8A and B). However, the Appkl mutant was reproducibly defective for longer-term (18h and 19h IC) intracellular survival, exhibiting a statistically significant (student's Mest/rvalue < 0.05), greater than 100-fold defect compared to the wild-type intracellular survival profile. The complemented ppkl * strain survival was similar to wild-type. All strains used survived equally well in MEM at the 3 hour time point, showed identical gentamicin susceptibility, and were fully resistant to dH20-syringe lysis (data not shown). 39 2h IC B 10 3 - | 1 1 1 1 1 0 5 10 15 20 25 i T ime ( h o u r s ) Figure 8. The Appkl mutant is defective for long-term intracellular survival in an epithelial cell model of infection. WT (black square), Appkl (grey triangle), and ppkl * (star) were grown to mid-log phase in MH broth. At the zero time point, semiconfluent or confluent monolayers of INT407 cells were inoculated with bacteria at an MOI -100 (A) and -20 (B), respectively. After 3 hours, the cells were washed, and gentamicin was added at 150 ug/ ml to all wells for 2 hours to kill extracellular bacteria. Gentamicin was washed from the cells at 5 hours, and invaded intracellular (IC) bacteria were harvested and plated for enumeration (inv). To all remaining wells, fresh media containing 5 ug/ ml of gentamicin and 3% fetal bovine serum were added. After an additional 2 hours (2h IC) or 18-19 hours (18h or 19h IC) of incubation, cells were washed, and surviving intracellular bacteria were harvested. All time points taken were performed in triplicate and error bars are shown. n=3. 40 3.8. T H E Appkl MUTANT EXHIBITS A DOSE-DEPENDENT CHICK COLONIZATION DEFECT To assess the role of poly P in commensal colonization, 1-day-old chicks were infected with wild-type and Appkl strains at increasing inoculation levels (1.5xl05, 1.5xl06, and 1.5xl07 CFUs/infection). Chicks were sacrificed after 7 days and caecal contents assayed for viable C. jejuni. Wild-type exhibited colonization levels greater than 1.79xl08CFU/g of caecal content at all inoculating doses, with nearly all infected chicks colonized to high levels (Fig. 9). However, the Appkl mutant colonization levels were dependent upon inoculating dose. Strikingly, at an inoculating dose of 1.5xl05 CFU, no Appkl bacteria were recovered from any chick infected. The intermediate dose of the Appkl mutant (1.5xl06 CFU/ 0.5 ml) resulted in colonization of 8 out of 10 chicks. The highest dose of the Appkl mutant (1.5xl07 CFU/ 0.5 ml) yielded colonization of all chicks, at levels similar to wild-type C. jejuni, with a mean concentration of Q 6.79x10 CFU per g of caecal content. 41 c c o o 75 u Q) u •4— o E (0 Q> Q. U_ O 10 1 0 - i 109-| 108 107 106 105 104 103 102 g 10 W T A A * A j A A • A A T Appkl v v vv T ^ ^ spfi* ^ ^ ^ Dose Figure 9. The Appkl mutant exhibited a 7 day, dose dependent defect for chick caecal colonization. Chicks were challenged orally with C. jejuni 81-176 wild-type (black triangles) and the Appkl mutant (open inverted triangles), using doses of 1.5xl05,1.5xl06,1.5xl07 CFU in 0.5 ml of broth. After seven days post infection, chicks were sacrificed, and bacterial colonization of caeca was determined by plating on Karmali agar. Levels of colonization at specific doses are expressed as CFU per gram of caecal content. The detection limited was 40 CFUs. Each data symbol represents CFUs recovered from an individual chick. The geometric mean of bacterial concentration recovered is represented by a bar for each dosage. n=l. 42 3.9. PHENOTYPES FOR WHICH T H E Appkl MUTANT WAS NOT DIFFERENT FROM WILD-TYPE Poly P specific phenotypes seen in other Appk mutant organisms were test in the C. jejuni Appk mutant. A number of phenotypes that were present in other Appk mutant organisms were not observed in the C. jejuni Appk mutant. These phenotypes included: motility, oxidative stress, organic acid survival, survival under low iron conditions, and survival under normal atmospheric (aerobic) and anaerobic conditions, calcofluor white fluorescence, and serum sensitivity. Table 1: Phenotypes that were indistinguishable between wild-type and Appkl PHENOTYPE TESTED WILD-TYPE Appkl - •„ FIGURE Motility: 0.3% agar Motile Motile • Fig. 10 0.5% agar Motile Motile Oxidative sensitivity 41 mm zone of inhibition 41 mm zone of inhibition Fig. 11 Organic acids survival: 9 mM propionic acid No difference Fig.12 22 mM acetic acid No difference Low iron conditions: desferal (Fe3+) 17 mm zone of inhibition 17 mm zone of inhibition Fig. 13 dipyridyl (Fe2+) 29 mm zone of inhibition 29 mm zone of inhibition MH Broth No difference in growth and survival Fig. 14 Aerobic Survival No difference Fig. 15 Calcofluor white fluorescence No difference N/A 43 PHENOTYPE TESTED WILD-TYPE Appkl FIGURE Anaerobic survival No difference Fig. 16 Low level osmotic shock: 0.16MNaCl No difference Fig. 17 Serum Sensitivity: 10% human serum, 80' exposure No difference N/A Figure 10. The Appkl mutant did not have a motility defect in 0.3% and 0.5% agar. 44 Figure 11. Wild-type C. jejuni and the Appkl mutant displayed similar oxidative stress sensitivity. Time (hours) Figure 12. The Appkl mutant was equally sensitive to the organic acids propionic acid and acetic acid as wild-type. AA= acetic acid; PA=propionic acid. 45 Figure 13. The Appkl mutant was not different from wild-type C. jejuni low iron conditions. Figure 14. The Appkl mutant and wild-type C. jejuni grew identically in MH broth. 46 Time (hours) Figure 15. The Appkl mutant and wild-type C. jejuni grow identically under normal atmospheric conditions. Time (hours) Figure 16. The Appkl mutant and wild-type C. jejuni grow identically under anaerobic atmospheric conditions. 47 Figure 17. The Appkl mutant and wild-type C. jejuni grow identically in 0.16 M NaCl in MH broth. 48 4.0. D I S C U S S I O N In this study, we have established that poly P accumulation in C. jejuni is important for survival of low nutrient and osmotic shock stresses, biofilm formation, and transmission. Furthermore, C. jejuni poly P was also identified as crucial for the virulence-related phenotype of intracellular survival in a human epithelial cell culture model of infection and for low dose-dependent colonization of chicks. To our knowledge, this is the first study demonstrating the importance of poly P in C. jejuni biology and pathogenesis. The poly P molecule has been hypothesized as playing multiple functions in the bacterial cell. Poly P accumulation in bacteria is generally characterized by low levels during exponential phase growth, followed by a significant increase during stationary phase or during the onset of stress (Fuhs, 1975; Kornberg, 1995). Our wild-type C. jejuni strain exhibited this phenomenon, where poly P levels peaked during stationary phase (Fig. 4). In contrast, the C. jejuni Appkl mutant was unable to attain these levels (Fig. 4). The low basal level of poly P observed could be due to other mechanisms involved in acquiring or synthesizing poly P. For instance, C. jejuni harbours homologs of genes involved in phosphate uptake and possible alternate means of poly P metabolism, such as a high affinity phosphate uptake (psf) operon and a gene encoding a conserved putative PPK2 enzyme (Fouts et al, 2005; Hofreuter et al, 2006; Parkhill et al, 2000; Zhang et al, 2002). The PPK2 enzyme was first identified in P. aeruginosa, where it was to shown to generate poly P preferentially from GTP in a reversible reaction, as opposed to the PPK1 synthesis of poly P preferentially from ATP (Ishige et al, 2002; Zhang et al, 2002). However, similar poly P levels at the 2 h time point may also be due to subculture 'carry-over' from the mid-log phase inoculum (Fig. 2, 4). Our data demonstrate that poly P is important for the transmission-related phenotypes of low-nutrient stress survival, osmotic stress survival, and biofilm formation. C. jejuni's ability to survive in nutritionally poor environments is particularly critical during conditions such as 49 waterborne transmission, which despite the organism's fastidious laboratory culture requirements, is a major source of larger-scale C. jejuni outbreaks (Auld et al, 2004; Friedman, 2001; Schuster et al, 2005). Our low-nutrient nutrient stress observations (Fig. 5) are consistent with studies of ppkl mutants in E. coli and other organisms, which also exhibit reduced survival following starvation (Kim et al, 2002; McMeechan et al, 2007; Tan et al, 2005; Tinsley and Gotschlich, 1995). A mechanistic model to explain this has been developed from work in E. coli, where nutrient downshift causes an immediate upsurge in poly P, which in turn complexes with and activates the ATP-dependent Lon protease to selectively degrade free ribosomal proteins, liberating amino acids to meet the nutritional requirements of the cell (Kuroda et al, 1997). A similar phenomenon could be occurring in C. jejuni and would explain the decreased survival of the Appkl mutant under nutrient deprivation conditions. Osmotic shock experiments suggest that C. jejuni's requirement for poly P in both growth and survival during osmotic stress is most acutely required when (a) the organism must grow from isolated single bacteria into colonies (Fig. 6B), and (b) during later growth stages (Fig. 6A), where poly P levels were shown to rise dramatically in wild-type but not the Appkl mutant (Fig. 4B). A number of enteric pathogens lacking ppkl are also less tolerant of osmotic stress than the parental wild type strains; this includes E. coli, Salmonella spp., and V. cholerae (Jahid et al, 2006; McMeechan et al, 2007; Rao and Kornberg, 1996). The decreased salt stress survival of the Appkl mutant in later growth stages and in isolated bacteria may also be explained by the discovery that poly P affects mRNA stability by means of the RNA degradosome (Blum et al., 1997); more recently, poly P was also found to interact with ribosomes in promoting translation fidelity (Mclnerney et al., 2006). Also, studies in Salmonella spp. indicate that poly P may play a role in ATP homeostatsis, particularly in stationary phase (McMeechan et al, 2007). In contrast to the osmotic shock and low nutrient data, and in marked contrast to poly P mutants in other bacteria, the C. jejuni Appkl mutant appeared to accelerate abiotic surface 50 attachment and biofilm development versus wild-type (Fig. 7 A, B), with no obvious differences in planktonic growth rate (Fig. 4A, 14). The role of poly P in biofilm formation was first studied in P. aeruginosa, where a Appkl mutant was defective for motility, biofilm maturation and quorum sensing (Rashid et al, 2000b). Likewise, poly P was also required by V. cholerae, Bacillus cereus and Porphyromonas gingivalis for motility and biofilm formation (Chen et al., 2002; Rashid and Kornberg, 2000; Shi et al, 2004). Biofilm formation is thought to protect bacteria from adverse environmental conditions and is considered an important virulence factor. Environmental biofilms have also been proposed as a likely mechanism by which C. jejuni. survives hostile environments and overcomes its fastidious survival requirements, thereby contributing significantly to its worldwide prevalence (Dykes et al, 2003; Kalmokoff et al, 2006). We have recently found that the C. jejuni SR mutant also exhibits increased biofilm formation (McLennan, 2007). As with Appkl, this is contrary to observations in other bacteria, where loss of the SR typically leads to decreased biofilm formation. An ensuing hypothesis is that in C. jejuni, both the SR mutant and Appkl may be constantly stressed, resulting in activation of alternative stress response pathways that may be distinct from those found in y-proteobacteria (see rpoS discussion below) and which in turn accelerate conversion to a protective biofilm state. We have also identified clear roles for poly P in both virulence- and colonization-related attributes of C. jejuni. Intra-epithelial cell survival is thought to be important for C. jejuni immune and chemotherapeutic evasion, in addition to damage, relapse and persistence in the human host (Day et al, 2000; De Melo et al, 1989; Kiehlbauch et al, 1985; Russell et al, 1993). Although it represents an important virulence phenotype, little is known about this aspect of C. jejuni pathogenesis. PPK1 is now the third C. jejuni factor, in addition to SpoT and the ferrous iron Fe2+ transporter FeoB (Naikare et al., 2006), shown to be required for extended intracellular survival in epithelial cells (Fig. 8 A, B). Previous cell biology-based work suggested 51 that C. jejuni resides in a vacuole or vacuole-like compartment following cell internalization (Hu and Kopecko, 1999; Hu et al, 2006). Notably, a requirement for SpoT, FeoB, and PPK1 in intracellular survival also supports this hypothesis. Vacuoles are typically low-nutrient, low-iron, environments (O'Riordan and Portnoy, 2002). The SR is induced in such an environment, which would also be expected to require FeoB for iron uptake when the extracellular concentration has been reduced. Poly P's importance in low nutrient survival is consistent with this and likely provides a mechanistic explanation for the Appkl intracellular survival defect. A S. Typhimurium Appkl mutant also displayed an invasion and long-term intracellular survival defect in HEp-2 epithelial cells (Kim et al, 2002). The only other study investigating a role for poly P in Campylobacter spp. showed that a C. coli UA585 Appkl mutant was equally sensitive to macrophage killing as wild-type, and that PPK1 was not involved in protection against oxygen radicals in macrophage cells (Wassenaar et al, 1997). However, poly P was shown to be important for macrophage survival of S. Typhimurium (Kim et al, 2002). The importance of poly P accumulation in vivo has been shown in various pathogens, including Salmonella spp. and P. aeruginosa, and for colonization of certain strains of H. pylori (Ayraud et al, 2003; McMeechan et al, 2007; Rashid et al, 2000b; Tan et al, 2005). Chickens are a natural zoonotic reservoir for C. jejuni, and contamination of commercial broiler flocks is thought to account for the majority of human C. jejuni infections (Lee and Newell, 2006). Interestingly, the C. jejuni Appkl mutant exhibited a dose-dependent colonization defect in chicks, with no chicks colonized to any detectable level at a ~105 CFU inocula, whereas the same dose of wild-type colonized to 107-109 cfu/g cecal content (Fig. 9). Although 105 CFU is the lowest dose used in our studies, wild-type C. jejuni 81-176 colonizes chicks well at doses as low as 10 CFU (MacKichan et al, 2004); thus, this is a significant colonization defect for a fully motile C. jejuni mutant (Fig. 10). The Appkl mutant hyper-biofilm formation phenotype also appears to be dose-dependent (Fig. 7). One hypothesis to explain the dose-dependent 52 colonization for the Appkl mutant is that at low doses, the mutant is primarily planktonic and significantly more susceptible than wild-type to in vivo stresses. As dose increases, biofilm formation is accelerated in the mutant versus wild-type, protecting Appkl during the initial (or later) stages of colonization. Recent reports indicate that several bacteria, including P. aeruginosa and H. pylori, form biofilms during infection (Carron et al., 2006; Garcia-Medina et al, 2005). Although such studies have not yet been conducted for C. jejuni, it is interesting to note that the C. jejuni SR mutant, which also exhibits certain planktonic sensitivities yet forms highly exaggerated biofilms, is fully colonization-competent in both chicks and mice (Gaynor et al, 2005; McLennan, 2007). Poly P clearly affects certain conserved phenotypes in all (or most) bacteria studied, while other phenotypes are much more species-specific. In most bacteria, poly P-deficient mutants are unable to express rpoS, and this has been proposed as the reason for certain Appkl mutant phenotypes (Fraley et al, 2007; Shiba et al, 1997). One study has shown that poly P levels in P. aeruginosa were not involved in modulating rpoS expression levels (Bertani et al., 2003). However, this is not true for all pseudomonads, as the root colonizer P. chlor or aphis poly P-depleted mutant demonstrated decreased rpoS expression at all growth phases (Kim et al., 2007). C. jejuni lacks rpoS, which may account for some of the surprising phenotypic differences between the C. jejuni Appkl mutant and other Appkl mutant organisms such as E. coli and P. aeruginosa. A double knockout of ppkl and ppk2 may be necessary to severely deplete cellular poly P. However, a single ppkl deletion sufficiently induced motility defects in both P. aeruginosa, and V. cholerae, each of which harbor both ppkl and ppk2 (Ogawa et al., 2000; Rashid and Kornberg, 2000), while the C. jejuni Appkl mutant was fully motile. There is also conflicting evidence as to whether the phosphate (pho) regulon regulates ppkl expression in various bacteria (Gavigan et al, 1999). C. jejuni was recently shown to harbour a PhoSR two-component signal transduction system which, like PhoBR in E. coli, controls numerous 53 phosphate acquisition genes via binding to promoter pho box regions (Wosten et al, 2006). The C. jejuni ppkl gene does not appear to be under the molecular control of the pho regulon, as neither a 'traditional' pho box (Wosten etal, 2006) nor the recently identified PhoSR consensus binding sequence are found upstream of the ppkl gene, and ppkl was not reported as down-regulated in a AphoR mutant. Functional and regulatory links between the SR and poly P accumulation have been demonstrated in E. coli (Ault-Riche et al, 1998; Kuroda et al, 1997; Kuroda et al, 1999; Rao et al, 1998). In that organism, ppGpp inhibits poly P hydrolysis by blocking the activity of the PPX exopolyphosphatase. In E. coli SR mutants lacking ppGpp, PPX remains active, resulting in diminished levels of poly P (Kuroda et al, 1997). Consistent with this, we observed diminished levels of poly P in the C. jejuni AspoT mutant (Fig. 2B), suggesting that this mechanism of poly P regulation may be conserved between C. jejuni and E. coli. However, in E. coli, ppkl andppx are in an operon; thus levels of PPK1 and PPX are also transcriptionally co-regulated. In contrast, ppkl and ppx in C. jejuni and in several other bacteria (Mullan et al., 2002b) are not found in an operon and thus may not be transcriptionally linked. Thus, as with the pho regulation described above, this aspect of poly P modulation may also differ significantly from E. coli. In summary, this study demonstrates the importance of poly P in C. jejuni transmission, colonization, and infection of host cells, and has established that poly P likely interacts with SR mechanisms in C. jejuni. Future work exploring the downstream molecular effects of poly P in C. jejuni should lend significant additional insight into mechanisms allowing C. jejuni to remain such a prevalent human pathogen. 54 4.1. Future Directions It is now known that poly P plays multifactorial roles in C. jejuni pathogenesis and that it intersects with the SR. However, much more can be learned about poly P and its role in pathogenesis via further investigation of the genes responsible for its metabolism, the down stream effects it exerts on C. jejuni, and the connection between poly P and the SR. C. jejuni harbours two enzymes involved in poly P synthesis: PPK1, which generates poly P from ATP, and PPK2, which primarily converts GDP to GTP, but can also synthesize poly P (Ishige et al, 2002; Zhang et al., 2002). The C. jejuni Appkl mutant demonstrated a significant deficit in poly P accumulation, yet low basal levels poly P remained at all time-points tested. Thus, to completely abrogate poly P synthesis a double ppkl and ppk2 mutant may be necessary to determine further phenotypes relating to virulence and survival that are controlled by poly P metabolism. C. jejuni appears to harbour a gene homologous to an exopolyphosphatase, known as ppx. The creation of a Appx mutant strain will allow the examination of poly P overexpression in C. jejuni and may lead to novel observations regarding poly P metabolism and its role in pathogenesis. Conceivably, overproduction of poly P in C. jejuni may increase colonization capacity, as was seen in an poly P over-expressing strain of Helicobacter pylori (Ayfaud et al, 2003). To date, nothing is known regarding the downstream molecular effects of poly P synthesis in C. jejuni. In other bacterial, poly P is known to play a role in ATP homeostasis, protein synthesis, and mRNA levels. To explore the downstream effects of altered poly P levels in C. jejuni, intracellular ATP levels over various growth phases in wild-type versus the Appkl mutant could be tested via an ATP bioluminescence assay, as used in assessing a Salmonella spp. Appkl mutant (McMeechan et al, 2007). Moreover, polysome levels should be monitored in the Appkl mutant versus wild-type. Furthermore, transcriptional profiling through microarray analysis experiments may reveal global gene expression changes incurred as a result of deleting 55 ' ppkl and would be valuable in analyzing gene expression differences between the Appkl mutant and wild-type. No poly P-related microarray experiments have ever been published. Thus, these studies will likely yield novel information regarding C. jejuni and poly P in metabolism in other organisms. We have demonstrated a connection between poly P accumulation and the SR in C. jejuni. In E. coli, nutrient downshift leads to the activation of the SR and the accumulation of ppGpp, which inhibits the hydrolysis of poly P; thus, poly P accumulates and complexes with and activates the ATP-dependent Lon protease to degrade free ribosomal proteins, meeting the nutritional requirements of the bacteria cell (Kuroda et al, 1997). Therefore, to elucidate the precise role in the E. coli proposed model of poly P metabolism a lon protease mutant would assist in determining the role of poly P in ribosomal protein degradation. These future experiments will be very informative and yield new data regarding C. jejuni pathogenesis, connections with the SR, and poly P metabolism in other bacteria. 56 BIBLIOGRAPHY Adak, G.K., Meakins, S.M., Yip, H., Lopman, B.A., and O'Brien, S.J. (2005) Disease risks from foods, England and Wales, 1996-2000. Emerg Infect Dis 11: 365-372. Ann, K., and Kornberg, A. (1990) Polyphosphate kinase from Escherichia coli. Purification and demonstration of a phosphoenzyme intermediate. J Biol Chem 265: 11734-11739. Akiyama, M., Crooke, E., and Kornberg, A. (1992) The polyphosphate kinase gene of Escherichia coli. Isolation and sequence of the ppk gene and membrane location of the protein. J Biol Chem 267: 22556-22561. Alios, B.M., and Blaser, M.J. (1995) Campylobacter jejuni and the expanding spectrum of related infections. Clin Infect Dis 20: 1092-1099; quiz 1100-1091. Alios, B.M. (1998) Campylobacter jejuni infection as a cause of the Guillain-Barre syndrome. Infect Dis Clin North Am 12: 173-184. Alios, B.M., Lippy, F.T., Carlsen, A., Washburn, R.G., and Blaser, M.J. (1998) Campylobacter jejuni strains from patients with Guillain-Barre syndrome. Emerg Infect Dis 4: 263-268. Alios, B.M. (2001) Campylobacter jejuni Infections: update on emerging issues and trends. Clin Infect Dis 32: 1201-1206. Altekruse, S.F., Stern, N.J., Fields, P.L, and Swerdlow, D.L. (1999) Campylobacter jejuni-an emerging foodborne pathogen. Emerg Infect Dis 5: 28-35. Alter, T., and Scherer, K. (2006) Stress response of Campylobacter spp. and its role in food processing. J Vet Med B Infect Dis Vet Public Health 53: 351-357. Andersen, M.T., Brondsted, L., Pearson, B.M., Mulholland, F., Parker, M., Pin, C, Wells, J.M., and Ingmer, H. (2005) Diverse roles for HspR in Campylobacter jejuni revealed by the proteome, transcriptome and phenotypic characterization of an hspR mutant. Microbiology 151: 905-915. Auld, PL, Maclver, D., and Klaassen, J. (2004) Heavy rainfall and waterborne disease outbreaks: the Walkerton example. J Toxicol Environ Health A 61: 1879-1887. Ault-Riche, D., Fraley, CD., Tzeng, CM., and Kornberg, A. (1998) Novel assay reveals multiple pathways regulating stress-induced accumulations of inorganic polyphosphate in Escherichia coli. JBacteriol 180: 1841-1847. Ayraud, S., Janvier, B., Salaun, L., and Fauchere, J.L. (2003) Modification in the ppk gene of Helicobacter pylori during single and multiple experimental murine infections. Infect Immun 71: 1733-1739. Bacon, D.J., Aim, R.A., Burr, D.H., Hu, L., Kopecko, D.J., Ewing, CP., Trust, T.J., and Guerry, P. (2000) Involvement of a plasmid in virulence of Campylobacter jejuni 81-176. Infect Immun 68: 4384-4390. 57 Bacon, D.J., Szymanski, CM., Burr, D.H., Silver, R.P., Aim, R.A., and Guerry, P. (2001) A phase-variable capsule is involved in virulence of Campylobacter jejuni 81-176. Mol Microbiol 40: 769-777. Bang, D.D., Scheutz, F., Ahrens, P., Pedersen, K., Blom, J., and Madsen, M. (2001) Prevalence of cytolethal distending toxin (cdt) genes and CDT production in Campylobacter spp. isolated from Danish broilers. J Med Microbiol 50: 1087-1094. Beery, J.T., Hugdahl, M.B., and Doyle, M.P. (1988) Colonization of gastrointestinal tracts of chicks by Campylobacter jejuni. Appl Environ Microbiol 54: 2365-2370. -Bereswill, S., and Kist, M. (2003) Recent developments in Campylobacter pathogenesis. Curr Opin Infect Dis 16: 487-491. Bertani, I., Sevo, M., Kojic, M., and Venturi, V. (2003) Role of GacA, LasI, Rhll, Ppk, PsrA, Vfr and ClpXP in the regulation of the stationary-phase sigma factor rpoS/RpoS in Pseudomonas. Arch Microbiol 180: 264-271. Black, R.E., Levine, M.M., Clements, M.L., Hughes, T.P., and Blaser, M.J. (1988) Experimental Campylobacter jejuni infection in humans. J Infect Dis 157: 472-479. Blaser, M.J., Wells, J.G., Feldman, R.A., Pollard, R.A., and Allen, J.R. (1983) Campylobacter enteritis in the United States. A multicenter study. Ann Intern Med 98: 360-365. Blaser, M.J. (1997) Epidemiologic and clinical features of Campylobacter jejuni infections. J Infect Dis 176 Suppl 2: S103-105. Blum, E., Py, B., Carpousis, A.J., and Higgins, C.F. (1997) Polyphosphate kinase is a component of the Escherichia coli RNA degradosome. Mol Microbiol 26: 387-398. Butzler, J.P., and Skirrow, M.B. (1979) Campylobacter enteritis. Acta Paediatr Belg 32: 89-94. Butzler, J.P. (2004) Campylobacter, from obscurity to celebrity. Clin Microbiol Infect 10: 868-876. Carrillo, CD., Taboada, E., Nash, J.H., Lanthier, P., Kelly, J., Lau, PC, Verhulp, R., Mykytczuk, O., Sy, J., Findlay, W.A., Amoako, K., Gomis, S., Willson, P., Austin, J.W., Potter, A., Babiuk, L., Allan, B., and Szymanski, CM. (2004) Genome-wide expression analyses of Campylobacter jejuni NCTC11168 reveals coordinate regulation of motility and virulence by flhA. J Biol Chem 279: 20327-20338. Carron, M.A., Tran, V.R., Sugawa, C, and Coticchia, J.M. (2006) Identification of Helicobacter pylori biofilms in human gastric mucosa. J Gastrointest Surg 10: 712-717. CDC (2003) In Health Canada. Vol. 2004: Centre for Infectious Disease Prevention and Control. Chatterji, D., and Ojha, A.K. (2001) Revisiting the stringent response, ppGpp and starvation signaling. Curr Opin Microbiol 4: 160-165. Chaudhuri, R.R., and Pallen, M.J. (2006) xBASE, a collection of online databases for bacterial comparative genomics. Nucleic Acids Res 34: D335-337. 58 Chen, W., Palmer, R.J., and Kuramitsu, H.K. (2002) Role of polyphosphate kinase in biofilm formation by Porphyromonas gingivalis. Infect Immun 70: 4708-4715. Crushell, E., Harry, S., Sharif, F., and Bourke, B. (2004) Enteric Campylobacter: purging its secrets? Pediatr Res 55: 3-12. Day, W.A., Jr., Sajecki, J.L., Pitts, T.M., and Joens, L.A. (2000) Role of catalase in Campylobacter jejuni intracellular survival. Infect Immun 68: 6337-6345. De Melo, M.A., Gabbiani, G., and Pechere, J.C. (1989) Cellular events and intracellular survival of Campylobacter jejuni during infection of HEp-2 cells. Infect Immun 57: 2214-2222. Dekeyser, P., Gossuin-Detrain, M., Butzler, J.P., and Sternon, J. (1972) Acute enteritis due to related vibrio: first positive stool cultures. J Infect Dis 125: 390-392. Donlan, R.M. (2002) Biofilms: microbial life on surfaces. Emerg Infect Dis 8: 881-890. Dykes, G.A., Sampathkumar, B., and Korber, D.R. (2003) Planktonic or biofilm growth affects survival, hydrophobicity and protein expression patterns of a pathogenic Campylobacter jejuni strain. Int J Food Microbiol 89: 1-10. Elvers, K.T., Turner, S.M., Wainwright, L.M., Marsden, G., Hinds, J., Cole, J.A., Poole, R.K., Penn, C.W., and Park, S.F. (2005) NssR, a member of the Crp-Fnr superfamily from Campylobacter jejuni, regulates a nitrosative stress-responsive regulon that includes both a single-domain and a truncated haemoglobin. Mol Microbiol 57: 735-750. Endtz, H.P., Ruijs, G.J., van Klingeren, B., Jansen, W.H., van der Reyden, T., and Mouton, R.P. (1991) Quinolone resistance in Campylobacter isolated from man and poultry following the introduction of fluoroquinolones in veterinary medicine. J Antimicrob Chemother 27: 199-208. Endtz, H.P., Ang, C.W., van Den Braak, N., Duim, B., Rigter, A., Price, L.J., Woodward, D.L., Rodgers, F.G., Johnson, W.M., Wagenaar, J.A., Jacobs, B.C., Verbrugh, H.A., and van Belkum, A. (2000) Molecular characterization of Campylobacter jejuni from patients with Guillain-Barre and Miller Fisher syndromes. J Clin Microbiol 38: 2297-2301. Eppinger, M., Baar, C, Raddatz, G., Huson, D.H., and Schuster, S.C. (2004) Comparative analysis of four Campylobacterales.1 Nat Rev Microbiol 2: 872-885. Everest, P.H., Goossens, H., Butzler, J.P., Lloyd, D., Kjiutton, S., Ketley, J.M., and Williams, P.H. (1992) Differentiated Caco-2 cells as a model for enteric invasion by Campylobacter jejuni and C. coli. J Med Microbiol 37: 319-325. Everest, P.H., Goossens, H., Sibbons, P., Lloyd, D.R., Knutton, S., Leece, R., Ketley, J.M., and Williams, P.H. (1993) Pathological changes in the rabbit ileal loop model caused by Campylobacter jejuni from human colitis. J Med Microbiol 38: 316-321. Fields, P.I., and Swerdlow, D.L. (1999) Campylobacter jejuni. Clin Lab Med 19: 489-504, v. Fours, D.E., Mongodin, E.F., Mandrell, R.E., Miller, W.G., Rasko, D.A., Ravel, J., Brinkac, L.M., DeBoy, R.T., Parker, C.T., Daugherty, S.C, Dodson, R.J., Durkin, A.S., Madupu, 59 R., Sullivan, S.A., Shetty, J.U., Ayodeji, M.A. , Shvartsbeyn, A. , Schatz, M.C. , Badger, J.H., Fraser, C M . , and Nelson, K .E . (2005) Major structural differences and novel potential virulence mechanisms from the genomes of multiple Campylobacter species. PLoSBiol3:e\5. Fraley, C D . , Rashid, M.H. , Lee, S.S., Gottschalk, R., Harrison, J., Wood, P.J., Brown, M.R., and Kornberg, A. (2007) A polyphosphate kinase 1 (ppkl) mutant of Pseudomonas aeruginosa exhibits multiple ultrastructural and functional defects. Proc Natl Acad Sci U 5 ^ 104:3526-3531. Friedman, C.R., Neimann, J., Wegener, H . C , Tauxe, R.V. (2001) Epidemiology of Campylobacter jejuni infections in the United States and other industrialized nations. In Campylobacter. 2d ed. Nachamkin, I., Blaser, M.J. (ed). Washington, D . C : A S M Press, pp. 121-138. Fuhs, G.W., Chen, M . (1975) Microbiological basis of phosphate removal in the ativated sludge process for the treatment of wastewater. Microb Ecol 2: 119-138. Garcia-Medina, R., Dunne, W.M. , Singh, P.K., and Brody, S.L. (2005) Pseudomonas aeruginosa acquires biofilm-like properties within airway epithelial cells. Infect Immun 73: 8298-8305. Gavigan, J.A., Marshall, L . M . , and Dobson, A.D. (1999) Regulation of polyphosphate kinase gene expression in Acinetobacter baumannii 252. Microbiology 145 ( Pt 10): 2931-2937. Gaynor, E.C., Ghori, N . , and Falkow, S. (2001) Bile-induced 'pili' in Campylobacter jejuni are bacteria-independent artifacts of the culture medium. Mol Microbiol 39: 1546-1549. Gaynor, E . C , Cawthraw, S., Manning, G., MacKichan, J.K., Falkow, S., and Newell, D.G. (2004) The genome-sequenced variant of Campylobacter jejuni N C T C 11168 and the original clonal clinical isolate differ markedly in colonization, gene expression, and virulence-associated phenotypes. JBacteriol 186: 503-517. Gaynor, E . C , Wells, D.H., MacKichan, J.K., and Falkow, S. (2005) The Campylobacter jejuni stringent response controls specific stress survival and virulence-associated phenotypes. Mol Microbiol 56: 8-27. Goossens, H., Giesendorf, B.A. , Vandamme, P., Vlaes, L., Van den Borre, C , Koeken, A. , Quint, W.G., Blomme, W., Hanicq, P., Koster, D.S., and et al. (1995) Investigation of an outbreak of Campylobacter upsaliensis in day care centers in Brussels: analysis of relationships among isolates by phenotypic and genotypic typing methods. J Infect Dis 172: 1298-1305. Grant, C . C , Konkel, M.E. , Cieplak, W., Jr., and Tompkins, L.S. (1993) Role of flagella in adherence, internalization, and translocation of Campylobacter jejuni in nonpolarized and polarized epithelial cell cultures. Infect Immun 61: 1764-1771. Griffiths, P.L., and Park, R.W. (1990) Campylobacters associated with human diarrhoeal disease. JAppl Bacteriol 69: 281-301. 60 Guerry, P., Ewing, CP., Hickey, T.E., Prendergast, M.M., and Moran, A.P. (2000) Sialylation of lipooligosaccharide cores affects immunogenicity and serum resistance of Campylobacter jejuni. Infect Immun 68: 6656-6662. Harold, F.M. (1966) Inorganic polyphosphates in biology: structure, metabolism and function. Bacteriol Rev 30: 772-794. HealthCanada (2003) Canadian Integrated Surveillance Report: Salmonella, Campylobacter, pathogenic E. coli and Shigella, from 1996 to 1999. In Canada Communicable Disease Report. Vol. 29S1. Hickey, T.E., Baqar, S., Bourgeois, A.L., Ewing, CP., and Guerry, P. (1999) Campylobacter jejuni-stimulated secretion of interleukin-8 by INT407 cells. Infect Immun 67: 88-93. Hofreuter, D., Tsai, J., Watson, R.O., Novik, V., Altaian, B., Benitez, M., Clark, C, Perbost, C, Jarvie, T., Du, L., and Galan, J.E. (2006) Unique features of a highly pathogenic Campylobacter jejuni strain. Infect Immun 74: 4694-4707. Holmes, K., Mulholland, F., Pearson, B.M., Pin, C, McNicholl-Kennedy, J., Ketley, J.M., and Wells, J.M. (2005) Campylobacter jejuni gene expression in response to iron limitation and the role of Fur. Microbiology 151: 243-257. Hood, A.M., Pearson, A.D., and Shahamat, M. (1988) The extent of surface contamination of retailed chickens with Campylobacter jejuni serogroups. Epidemiol Infect 100: 17-25. Hu, L., and Kopecko, D.J. (1999) Campylobacter jejuni 81-176 associates with microtubules and dynein during invasion of human intestinal cells. Infect Immun 67: 4171-4182. Hu, L., McDaniel, J.P., and Kopecko, D.J. (2006) Signal transduction events involved in human epithelial cell invasion by Campylobacter jejuni 81-176. Microb Pathog 40: 91-100. Hugdahl, M.B., Beery, J.T., and Doyle, M.P. (1988) Chemotactic behavior of Campylobacter jejuni. Infect Immun 56: 1560-1566. Hughes, R. (2004) Campylobacter jejuni in Guillain-Barre syndrome. Lancet Neurol 3: 644. Ishige, K., Zhang, H., and Kornberg, A. (2002) Polyphosphate kinase (PPK2), a potent, polyphosphate-driven generator of GTP. Proc Natl Acad Sci USA 99: 16684-16688. Jahid, I.K., Silva, A.J., and Benitez, J.A. (2006) Polyphosphate stores enhance the ability of Vibrio cholerae to overcome environmental stresses in a low-phosphate environment. Appl Environ Microbiol 72: 7043-7049. Jin, S., Joe, A., Lynett, J., Hani, E.K., Sherman, P., and Chan, V.L. (2001) JlpA, a novel surface-exposed lipoprotein specific to Campylobacter jejuni, mediates adherence to host epithelial cells. Mol Microbiol 39: 1225-1236. Kalmokoff, M., Lanthier, P., Tremblay, T.L., Foss, M., Lau, P.C, Sanders, G., Austin, J., Kelly, J., and Szymanski, CM. (2006) Proteomic analysis of Campylobacter jejuni 11168 biofilms reveals a role for the motility complex in biofilm formation. J Bacteriol 188: 4312-4320. 61 Karlyshev, A.V., Champion, O.L., Churcher, C, Brisson, J.R., Jarrell, H.C., Gilbert, M., Brochu, D., St Michael, F., Li, J., Wakarchuk, W.W., Goodhead, I., Sanders, M., Stevens, K., White, B., Parkhill, J., Wren, B.W., and Szymanski, CM. (2005) Analysis of Campylobacter jejuni capsular loci reveals multiple mechanisms for the generation of structural diversity and the ability to form complex heptoses. Mol Microbiol 55: 90-103. Kelle, K., Pages, J.M., and Bolla, J.M. (1998) A putative adhesin gene cloned from Campylobacter jejuni. Res Microbiol 149: 723-733. Ketley, J.M. (1997) Pathogenesis of enteric infection by Campylobacter. Microbiology 143 (Pt 1): 5-21. Kiehlbauch, J.A., Albach, R.A., Baum, L.L., and Chang, K.P. (1985) Phagocytosis of Campylobacter jejuni and its intracellular survival in mononuclear phagocytes. Infect Immun 48: 446-451. Kim, H.J., Yang, K.Y., Cho, B.H., Kim, K.Y., Lee, M.C, Kim, Y.H., Anderson, A.J., and Kim, Y.C (2007) Transcript Accumulation from the rpoS Gene Encoding a Stationary-Phase Sigma Factor in Pseudomonas chlororaphis Strain 06 Is Regulated by the Polyphosphate Kinase Gene. Curr Microbiol. Kim, K.S., Rao, N.N., Fraley, CD., and Kornberg, A. (2002) Inorganic polyphosphate is essential for long-term survival and virulence factors in Shigella and Salmonella spp. Proc Natl Acad Sci USA 99: 7675-7680. Kist, M. (1986) [Who discovered Campylobacter jejuni/coli? A review of hitherto disregarded literature]. Zentralbl Bakteriol Mikrobiol Hyg [A] 261: 177-186. Konkel, M.E., Corwin, M.D., Joens, L.A., and Cieplak, W. (1992) Factors that influence the interaction of Campylobacter jejuni with cultured mammalian cells. J Med Microbiol 37: 30-37. Konkel, M.E., Garvis, SC., Tipton, S.L., Anderson, D.E., Jr., and Cieplak, W., Jr. (1997) Identification and molecular cloning of a gene encoding a fibronectin-binding protein (CadF) from Campylobacter jejuni. Mol Microbiol 24: 953-963. Konkel, M.E., Kim, B.J., Rivera-Amill, V., and Garvis, SC. (1999) Bacterial secreted proteins are required for the internaliztion of Campylobacter jejuni into cultured mammalian cells. Mol Microbiol 32: 691 -701. Konkel, M.E., Monteville, M.R., Rivera-Amill, V., and Joens, L.A. (2001) The pathogenesis of Campylobacter jejuni-mediated enteritis. Curr Issues Intest Microbiol 2: 55-71. Kopecko, D.J., Hu, L., and Zaal, K.J. (2001) Campylobacter jejuni—microtubule-dependent invasion. Trends Microbiol 9: 389-396. Korlath, J.A., Osterholm, M.T., Judy, L.A., Forfang, JC, and Robinson, R.A. (1985) A point-source outbreak of campylobacteriosis associated with consumption of raw milk. J Infect Dis 152: 592-596. 62 Kornberg, A. (1995) Inorganic polyphosphate: toward making a forgotten polymer unforgettable. JBacteriol 111: 491-496. Kornberg, A., Rao, N.N., and Ault-Riche, D. (1999) Inorganic polyphosphate: a molecule of many functions. Annu Rev Biochem 68: 89-125. Kuroda, A., Murphy, H., Cashel, M., and Kornberg, A. (1997) Guanosine tetra- and pentaphosphate promote accumulation of inorganic polyphosphate in Escherichia coli. J Biol Chem 272: 21240-21243. Kuroda, A., Tanaka, S., Ikeda, T., Kato, J., Takiguchi, N., and Ohtake, H. (1999) Inorganic polyphosphate kinase is required to stimulate protein degradation and for adaptation to amino acid starvation in Escherichia coli. Proc Natl Acad Sci USA 96: 14264-14269. Kuroda, A., Nomura, K., Ohtomo, R., Kato, J., Ikeda, T., Takiguchi, N., Ohtake, H., and Kornberg, A. (2001) Role of inorganic polyphosphate in promoting ribosomal protein degradation by the Lon protease in E. coli. Science 293: 705-708. Lara-Tejero, M., and Galan, J.E. (2000) A bacterial toxin that controls cell cycle progression as a deoxyribonuclease I-like protein. Science 290: 354-357. Lara-Tejero, M., and Galan, J.E. (2001) CdtA, CdtB, and CdtC form a tripartite complex that is required for cytolethal distending toxin activity. Infect Immun 69: 4358-4365. Lee, M.D., and Newell, D.G. (2006) Campylobacter in poultry: filling an ecological niche. Avian Dis 50: 1-9. Lee, R.B., Hassane, D.C., Cottle, D.L., and Pickett, CL. (2003) Interactions of Campylobacter jejuni cytolethal distending toxin subunits CdtA and CdtC with HeLa cells. Infect Immun 71:4883-4890. Lindblom, G.B., Ahren, C, Changalucha, J., Gabone, R., Kaijser, B., Nilsson, L.A., Sjogren, E., Svennerholm, A.M., and Temu, M. (1995) Campylobacter jejuni/coli and enterotoxigenic Escherichia coli (ETEC) in faeces from children and adults in Tanzania. Scand J Infect Dis 21: 589-593. Louwen, R.P., van Belkum, A., Wagenaar, J.A., Doorduyn, Y., Achterberg, R., and Endtz, H.P. (2006) Lack of association between the presence of the pVir plasmid and bloody diarrhea in Campylobacter jejuni enteritis. J Clin Microbiol 44: 1867-1868. MacKichan, J.K., Gaynor, E.C., Chang, C, Cawthraw, S., Newell, D.G., Miller, J.F., and Falkow, S. (2004) The Campylobacter jejuni dccRS two-component system is required for optimal in vivo colonization but is dispensable for in vitro growth. Mol Microbiol 54: 1269-1286. Markas, A.M., Chatterjee, S., Wren, B.W., Newell, D.G., and Ketley, J.M. (1999) A novel Campylobacter jejuni two-component regulatory system important for temperature-dependent growth and colonization. J Bacteriol 181: 3298-3302. 63 Mclnemey, P., Mizutani, T., and Shiba, T. (2006) Inorganic polyphosphate interacts with ribosomes and promotes translation fidelity in vitro and in vivo. Mol Microbiol 60: 438-447. McLennan, M.M., Ringoir, D.D., Frirdich, E., Svensson, S.L., Wells, D.H., Jarrell, H., Szymanski, CM., and Gaynor, E.C. (2007) Campylobacter jejuni biofilms utilize a calcofluor white-reactive exopolysaccharide that is up-regulated in a stringent response mutant. J Bacteriol. McMeechan, A., Lovell, M.A., Cogan, T.A., Marston, K.L., Humphrey, T.J., and Barrow, P.A. (2007) Inactivation of ppk differentially affects virulence and disrupts ATP homeostasis in Salmonella enterica serovars Typhimurium and Gallinarum. Res Microbiol 158: 79-85. McSweegan, E., and Walker, R.I. (1986) Identification and characterization of two . Campylobacter jejuni adhesins for cellular and mucous substrates. Infect Immun 53: 141-148. Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C, Griffin, P.M., and Tauxe, R.V. (1999) Food-related illness and death in the United States. Emerg Infect Dis 5: 607-625. Mendrygal, K.E., and Gonzalez, J.E. (2000) Environmental regulation of exopolysaccharide production in Sinorhizobium meliloti. J Bacteriol 182: 599-606. Mittenhuber, G. (2001) Comparative genomics and evolution of genes encoding bacterial (p)ppGpp synthetases/hydrolases (the Rel, RelA and SpoT proteins). J Mol Microbiol Biotechnol 3: 585-600. Moser, I., Schroder, W.F., and Hellmann, E. (1992) In vitro binding of Campylobacter jejuni/coli outer membrane preparations to INT 407 cell membranes. Med Microbiol Immunol 180: 289-303. Moser, I., Schroeder, W., and Salnikow, J. (1997) Campylobacter jejuni major outer membrane protein and a 59-kDa protein are involved in binding to fibronectin and INT 407 cell membranes. FEMS Microbiol Lett 157: 233-238. Mullan, A., Quinn, J.P., and McGrath, J.W. (2002a) A nonradioactive method for the assay of polyphosphate kinase activity and its application in the study of polyphosphate metabolism in Burkholderia cepacia. Anal Biochem 308: 294-299. Mullan, A., Quinn, J.P., and McGrath, J.W. (2002b) Enhanced phosphate uptake and polyphosphate accumulation in Burkholderia cepacia grown under low pH conditions. Microb Ecol 44: 69-77. Nachamkin, I., and Barbagallo, S. (1990) Culture confirmation of Campylobacter spp. by latex agglutination. J Clin Microbiol 28: 817-818. Nachamkin, I., Alios, B.M., and Ho, T. (1998) Campylobacter species and Guillain-Barre syndrome. Clin Microbiol Rev 11: 555-567. Nachamkin, I. (2002) Chronic effects of Campylobacter infection. Microbes Infect 4: 399-403. 64 Nachamkin, I., Ung, H., and Li, M. (2002) Increasing fluoroquinolone resistance in Campylobacter jejuni, Pennsylvania, USA,1982-2001. Emerg Infect Dis 8: 1501-1503. Naikare, H., Palyada, K., Panciera, R., Marlow, D., and Stintzi, A. (2006) Major role for FeoB in Campylobacter jejuni ferrous iron acquisition, gut colonization, and intracellular survival. Infect Immun 74: 5433-5444. Newell, D.G. (2001) Animal models of Campylobacter jejuni colonization and disease and the lessons to be learned from similar Helicobacter pylori models. Symp Ser Soc Appl Microbiol: 57S-67S. Newell, D.G., Wagenaar, J.A. (2000) Poultry infections and their control at the farm level. In Campylobacter. Nachamkin, I., Blaser, M.J. (ed). Washington, D.C.: ASM Press, pp. 497-509. NIAID (2005) in Health Matters. Vol. 2007 National Institute of Health, Bethesda, MD: http://www.niaid.nih.giv/factsheets/foodborneis.htm. Ogawa, N., Tzeng, CM., Fraley, CD., and Kornberg, A. (2000) Inorganic polyphosphate in Vibrio cholerae: genetic, biochemical, and physiologic features. J Bacteriol 182: 6687-6693. O'Riordan, M., and Portnoy, D.A. (2002) The host cytosol: front-line or home front? Trends Microbiol 10: 361-364. O'Toole, G.A., and Kolter, R. (1998) Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple,'convergent signalling pathways: a genetic analysis. Mol Microbiol 28: 449-461. Park, S.F. (2002) The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. Int J Food Microbiol 74: 177-188. Parkhill, J., Wren, B.W., Mungall, K., Ketley, J.M., Churcher, C, Basham, D., Chillingworth, T., 1 Davies, R.M., Feltwell, T., Holroyd, S., Jagels, K., Karlyshev, A.V., Moule, S., Pallen, M.J., Penn, C.W., Quail, M.A., Rajandream, M.A., Rutherford, K.M., van Vliet, A.H., Whitehead, S., and Barrell, BC. (2000) The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403: 665-668. Pei, Z., Burucoa, C, Grignon, B., Baqar, S., Huang, X.Z., Kopecko, D.J., Bourgeois, A.L., Fauchere, J.L., and Blaser, M.J. (1998) Mutation in the pebl A locus of Campylobacter jejuni reduces interactions with epithelial cells and intestinal colonization of mice. Infect Immun 66:938-943. Pick, U., and Weiss, M. (1991) Polyphosphate Hydrolysis within Acidic Vacuoles in Response to Amine-Induced Alkaline Stress in the Halotolerant Alga Dunaliella salina. Plant Physiol 97: 1234-1240. Pickett, C.L., Cottle, D.L., Pesci, E C , and Bikah, G. (1994) Cloning, sequencing, and expression of the Escherichia coli cytolethal distending toxin genes. Infect Immun 62: 1046-1051. 65 Pickett, C.L., Pesci, E.C, Cottle, D.L., Russell, G., Erdem, A.N., and Zeytin, H. (1996) Prevalence of cytolethal distending toxin production in Campylobacter jejuni and relatedness of Campylobacter sp. cdtB gene. Infect Immun 64: 2070-2078. Price-Carter, M., Fazzio, T.G., Vallbona, E.I., and Roth, J.R. (2005) Polyphosphate kinase protects Salmonella enterica from weak organic acid stress. J Bacteriol 187: 3088-3099. Rao, N.N., and Kornberg, A. (1996) Inorganic polyphosphate supports resistance and survival of stationary-phase Escherichia coli. J Bacteriol 178: 1394-1400. Rao, N.N., Liu, S., and Kornberg, A. (1998) Inorganic polyphosphate in Escherichia coli: the phosphate regulon and the stringent response. J Bacteriol 180: 2186-2193. Rashid, M.H., and Kornberg, A. (2000) Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 97: 4885-4890. Rashid, M.H., Rao, N.N., and Kornberg, A. (2000a) Inorganic polyphosphate is required for motility of bacterial pathogens. J Bacteriol 182: 225-227. Rashid, M.H., Rumbaugh, K., Passador, L., Davies, D.G., Hamood, A.N., Iglewski, B.H., and Kornberg, A. (2000b) Polyphosphate kinase is essential for biofilm development, quorum sensing, and virulence of Pseudomonas aeruginosa. Proc Natl Acad Sci U SA 91: 9636-9641. Reeser, R.J., Medler, R.T., Billington, S.J., Jost, B.H., and Joens, L.A. (2007) Characterization of Campylobacter jejuni biofilms under defined growth conditions. Appl Environ Microbiol. Reusch, R.N., and Sadoff, H.L. (1988) Putative structure and functions of a poly-beta-hydroxybutyrate/calcium polyphosphate channel in bacterial plasma membranes. Proc Natl Acad Sci USA 85: 4176-4180. Rinella, E.S., Eversley, CD., Carroll, I.M., Andrus, J.M., Threadgill, D.W., and Threadgill, D.S. (2006) Human epithelial-specific response to pathogenic Campylobacter jejuni. FEMS Microbiol Lett 262: 236-243. Rollins, D.M., and Colwell, R.R. (1986) Viable but nonculturable stage of Campylobacter jejuni and its role in survival in the natural aquatic environment. Appl Environ Microbiol 52: 531.538. Russell, R.G., O'Donnoghue, M., Blake, D.C, Jr., Zulty, J., and DeTolla, L.J. (1993) Early colonic damage and invasion of Campylobacter jejuni in experimentally challenged infant Macaca mulatta. J Infect Dis 168: 210-215. Schuster, C.J., Ellis, A.G., Robertson, W.J., Charron, D.F., Aramini, J.J., Marshall, B.J., and Medeiros, D.T. (2005) Infectious disease outbreaks related to drinking water in Canada, 1974-2001. Can J Public Health 96: 254-258. Sebald, M., and Veron, M. (1963) [Base DNA Content and Classification of Vibrios.]. Ann Inst Pasteur (Paris) 105: 897-910. 66 Shane, S.M., and Montrose, M.S. (1985) The occurrence and significance of Campylobacter jejuni in man and animals. Vet Res Commun 9: 167-198. Shi, X., Rao, N.N., and Kornberg, A. (2004) Inorganic polyphosphate in Bacillus cereus: motility, biofilm formation, and sporulation. Proc Natl Acad Sci USA 101: 17061-17065. Shiba, T., Tsutsumi, K., Yano, H., Ihara, Y., Kameda, A., Tanaka, K., Takahashi, H., Munekata, M., Rao, N.N., and Kornberg, A. (1997) Inorganic polyphosphate and the induction of rpoS expression. Proc Natl Acad Sci U SA 94: 11210-11215. Skirrow, M.B. (1994) Diseases due to Campylobacter, Helicobacter and related bacteria. J Comp Pathol 111: 113-149. Smibert, M., N.E., B., Gibbons, T., Cowan, J.G., J., H., R.G.E., L., G.F., M., W., N.A., Y., R.R., and Stanier (1974) Bergey's Manual of Determinative Bacteriology. 8th ed. Baltimore, NJ, USA.: Williams and Wilkins. Smith, T., and Taylor, M.S. (1919) Some morphological and biological characters of the spirilla (Vibrio fetus, n. sp. ) associated with disease of the fetal membranes in cattle. J. Exp. Med. 30: 299-311. Stock, A.M., Robinson, V.L., and Goudreau, P.N. (2000) Two-component signal transduction. Annu Rev Biochem 69: 183-215. Szymanski, CM., Logan, S.M., Linton, D., and Wren, B.W. (2003) Campylobacter-^  tale of two protein glycosylation systems. Trends Microbiol 11: 233-238. Takata, T., Fujimoto, S., and Amako, K. (1992) Isolation of nonchemotactic mutants of Campylobacter jejuni and their colonization of the mouse intestinal tract. Infect Immun 60: 3596-3600. Tan, S., Fraley, CD., Zhang, M., Dailidiene, D., Kornberg, A., and Berg, D.E. (2005) Diverse phenotypes resulting from polyphosphate kinase gene (ppkl) inactivation in different strains of Helicobacter pylori. J Bacteriol 187: 7687-7695. Tauxe, R.V. (1992) Epidemiology of Campylobacter jejuni infections in the United States and other industrialized nations. Washington, D.C: ASM Press. Thibault, P., Logan, S.M., Kelly, J.F., Brisson, J.R., Ewing, CP., Trust, T.J., and Guerry, P. (2001) Identification of the carbohydrate moieties and glycosylation motifs in Campylobacter jejuni flagellin. J Biol Chem 276: 34862-34870. Tinsley, C.R., Manjula, B.N., and Gotschlich, E.C. (1993) Purification and characterization of polyphosphate kinase from Neisseria meningitidis. Infect Immun 61: 3703-3710. Tinsley, C.R., and Gotschlich, E.C: (1995) Cloning and characterization of the meningococcal polyphosphate kinase gene: production of polyphosphate synthesis mutants. Infect Immun 63: 1624-1630. 67 Tracz, D.M., Keelan, M., Ahmed-Bentley, J., Gibreel, A., Kowalewska-Grochowska, K., and Taylor, D.E. (2005) pVir and bloody diarrhea in Campylobacter jejuni enteritis. Emerg Infect Dis 11: 838-843. van Vliet, A.H., Baillon, M.L., Perm, C.W., and Ketley, J.M. (1999) Campylobacter jejuni contains two fur homologs: characterization of iron-responsive regulation of peroxide stress defense genes by the PerR repressor. J Bacteriol 181: 6371-6376. Vandamme, P. (2000) Microbiology of Campylobacter infections: taxonomy of the family Campylobacteracea. In Campylobacter. Nachamkin, I., Blaser, M.J. (ed). Washington, D.C: ASM Press, pp. 3-26. Veron, M.C, R. (1973) Taxonomic study of the genus Campylobacter Sebald and Ve! ron and designation of the neotype strain for the type species Campylobacter fetus (Smith and Taylor) Sebald and Veron. Int J Syst Bacteriol 23: 122±134. Wassenaar, T.M., Bleumink-Pluym, N.M., and van der Zeijst, B.A. (1991) Inactivation of Campylobacter jejuni flagellin genes by homologous recombination demonstrates that flaA but not flaB is required for invasion. Embo J10: 2055-2061. Wassenaar, T.M., Engelskirchen, M., Park, S., and Lastovica, A. (1997) Differential uptake and killing potential of Campylobacter jejuni by human peripheral monocytes/macrophages. Med Microbiol Immunol (Bed) 186: 139-144. Wassenaar, T.M., and Blaser, M.J. (1999) Pathophysiology of Campylobacter jejuni infections of humans. Microbes Infect 1: 1023-1033. WHO (2000) Copenhagen, Denmark. Willis, W.L., and Murray, C. (1997) Campylobacter jejuni seasonal recovery observations of retail market broilers. Poult Sci 76: 314-317. Wosten, M.M., Wagenaar, J.A., and van Putten, J.P. (2004) The FlgS/FlgR two-component signal transduction system regulates the fla regulon in Campylobacter jejuni. J Biol Chem 279: 16214-16222. Wosten, M.M., Parker, C.T., van Mourik, A., Guilhabert, M.R., van Dijk, L., and van Putten, J.P. (2006) The Campylobacter jejuni PhosS/PhosR operon represents a non-classical phosphate-sensitive two-component system. Mol Microbiol 62: 278-291. Yao, R., Aim, R.A., Trust, T.J., and Guerry, P. (1993) Construction of new Campylobacter cloning vectors and a new mutational cat cassette. Gene 130: 127-130. Yao, R., Burr, D.H., and Guerry, P. (1997) CheY-mediated modulation of Campylobacter jejuni virulence. Mol Microbiol 23: 1021 -1031. 68 Yohannes, K., Roche, P., Blumer, C, Spencer, J., Milton, A., Bunn, C, Gidding, H., Kirk, M., and Della-Porta, T. (2004) Australia's notifiable diseases status, 2002: Annual report of the National Notifiable Diseases Surveillance System. Commun Dis Intell 28: 6-68. Zhang, H., Ishige, K., and Kornberg, A. (2002) A polyphosphate kinase (PPK2) widely conserved in bacteria. Proc Natl Acad Sci USA 99: 16678-16683. 69 APPENDICES Appendix A Insertional inactivation of the ppkl gene via cat cassette insertion. Insertion was verified by PCR using PPKl-comp Fp (CGGGATCCTGCCCTTAGCGTTATAAAAAGTATAAA) and are external to the ppkl gene. WT= wild-type C. jejuni 81-176; Appkl= inactivated ppkl gene with cat cassette insertion. The wild-type C. jejuni band generates a 2.3 Kb PCR product and the Appkl mutant PCR product is 2.0 Kb. 70 Appendix B Sequence analysis with the PPK1-1 Fp and subsequent ClustalW alignment of C. jejuni 81-176 ppkl::cat with cat cassette verified insertional inactivation of the ppkl gene. PPK1-1 aaacaacttatctttttcactagcggttaaaatttgcgataaagcgcatcctgaacttgt cat PPK1-1 aaaaTttggaatgattagaattcagctgctcggcggtgttcctttccaagttaattgcgt cat gcggtgttcctttccaagttaattgcgt totototototototototototttotototototototototototototototo PPK1-1 gatatagattgaaaagtggatagatttatgatatagtggatagatttatgatataatgag cat gatatagattgaaaagtggatagatttatgatatagtggatagatttatgatataatgag totototototototototototototototototototototototototototototototototototototototototototototototototototototototototototo PPK1-1 ttatcaacaaatcggaatttacggaggataaatgatgcaattcacaaagattgatataaa c a t ttatcaacaaatcggaatttacggaggataaatgatgcaattcacaaagattgatataaa totototototototototototototototototototototototototototototototototototototototototototototototototototototototototototo PPK1-1 taattggacacgaaaagagtatttcgaccactattttggc-atacgccctgcacatatag cat taattggacacgaaaagagtatttcgaccactattttggcaatacgccctgcacatatag totototototototototototototototototototototototototototototototototototototoitto toittotoittotototototototototototottto PPK1-1 tatgacggttaaactccaatatttctaagttgaaaaaagatggaaaaaatttatccccaa cat tatgacggtaaaact-cgatatttctaagttgaaaaaggatggaaaaaagttatacccaa totototott to tototo to totototott to to toto totototott to to to to to toto to It to to to tttttott totototott PPK1-1 ctcttttatattggagtatcaacgatcatcaatccgacatgaaaaattcaggaccgcctt cat ctcttttata-tggagttacaacgatcatcaat-cgacatgaagagttcaggaccgcatt tototttototo toto toto totototototo to to to to to It to to toto to to to to to to to to to to to to to to tototototototototototo toto PPK1-1 aaatgaaaacggaaaggtaggcgttttttcaaaaaatgctgccttgcttcccagtttttt cat agatgaaaacggacaggtaggcgttttttc-agaaatgctgccttgctacacagtttttc to tototototototototototo to to to to to to to to to to to to to to to to to tototototototototototototototo to totototototototo PPK1-1 aaaaaggaacc • cat ataaggaaactgaaaccttttcgagtatttggactgagtttacagcagactatactgagt to toto to to to to PPK1-1 c a t ttcttcagaactatcaaaaggatatagacgcttttggtgaacgaatgggaatgtccgcaa 71 Appendix C Colonies representing putative re-constituted wild-type strains were confirmed using P C R with the PPK1-1 primer set WT= wild-type C. jejuni 81-176; Appkl= inactivated ppkl gene with cat cassette insertion; ppkl *=reconstituted wild-type C. jejuni. Wild-type and ppkl * generate a 2.6 Kb PCR product when amplified with PPK1-1 primer set. The ppkl mutant PCR is 2.4 Kb. IS •K S B : 72 Appendix D Sequence analysis with the PPK1-2 Fp and subsequent ClustalW alignment of C. jejuni 81-176 ppkl gene and the ppkl * recombinant sequence verified complementation. P P K l - 2 GCCATACGCAAATATTTACACCAAGAAAAAGAACTTTTGGAGCGTTATTTTAATGAAATC ppkl* • • ABINNNTTCTTGGGG- — T A T T T T A — T G A A T C * * * * * * * ******* **** P P K l - 2 ACAAGT GAAT TAGAAAAAGAAAAT CTTTTCATAAAACATTATGAGAATT TAGATGAAAAT ppkl* ACAAGTGAAT TAGAAAAAGAAAATCTTTTCATAAAACATTATGAGAATT TAGATGAAAAT * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 TTAAAACAAAAATGTGATGAGTATTTTTTCTCTAATATTTTTCCTGTTATTGTTCCAATA ppkl* TTAAAACAAAAATGTGATGAGTATTTTTTCTCTAATATTTTTCCTGTTATTGTTCCAATA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 GCTGTTGATGCTACTCACCCTTTTCCGCATTTAAACAACTTATCTTTTTCACTAGCGGTT ppkl* GCTGTTGATGCTACTCACCCTTTTCCGCATTTAAACAACTTATCTTTTTCACTAGCGGTT * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 AAAATTTGCGATAAAGCGCATCCTGAACTTGTAAAATTTGGAATGATTAGAATTCCAAGA ppkl* AAAATTTGCGATAAAGCGCATCCTGAACTTGTAAAATTTGGAATGATTAGAATTCCAAGA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 GTTTTACCTCGTTTTTATGAAGTAAGTGCAAATATTTATGTTCCTATAGAAAGTATAGTC ppkl* GTTTTACCTCGTTTTTATGAAGGAAGTGCAAATATTTATGTTCCTATAGAAAGTATAGTC * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 CATCAACACGCAGAAGAAATTTTTCCAGGCTATAAACTCTTAGCTTCAGCAGCATTTAGA ppkl* CATCAACACGCAGAAGAAATTTTTCCAGGCTATAAACTCTTAGCTTCAGCAGCATTTAGA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 GT GAC TAGAAAT GCAGATAT GG TAATAGAAGAG GAAGAAGCTGATGAT T T TATGATGAT T ppkl* GT GACTAGAAATGCAGATATGGTAATAGAAGAGGAAGAAGCTGATGAT T T TATGATGAT T * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 TTAGAACAAGGCTTGAAGCTTCGCAGAAAAGGAGCTTTTGTAAGATTGCAAATTCAAAAA ppkl* TTAGAACAAGGCTTGAAGCTTCGCAGAAAAGGAGCTTTTGTAAGATTGCAAATTCAAAAA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 GATGCAGATGAGCAAATCGTAGAATTTCTTAATACTCACATGAAAATTTTTCATAAAGAT ppkl* GATGCAGATGAGCAAATCGTAGAATTTCTTAATACTCACATGAAAATTTTTCATAAAGAT * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 GTTTATGAATATTCTATTTTACTCAATCTCCCTAGCCTTTGGCAAATCGCAGGAAATAAA ppkl* GTTTATGAATATTCTATTTTACTCAATCTCCCTAGCCTTTGGCAAATCGCAGGAAATAAA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 ACCTTTACGCATCTTTTAAGCCCACTTTACACGCCTAAAACTTTACCACCTTTTGATGAG ppkl* ACCTTTACGCATCTNTTAAGCCCACTTTACACGCCTAAAACTTTACCACCTTTTGATGAG ************** ********************************************* P P K l - 2 AATTTATCTATTTTTGATGCTGTAGAAAAAGAAGATATACTCATTATACAACCTTTTGAA ppkl* AAT TTATCTATTTTTGATGCTGAAGAAAAAGAAGATATACTCAT TATACAACCTTTTGAA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * P P K l - 2 AGTTTTGATCCAGTTTATAAATTTATCAAAGAAGCAAGCAAAGATCCTGAAGTAATTTCC 73 ppkl* AGTTTTGATCCAGTTTATAAATTTATCAAAGAAGCA-GCAAAGATCCTGAAGTAATTTCC * * * * * * * * * * * *.* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * PPK1-2 ATAAGAATGACACTTTATAGAGTTGAAAAAAATTCCAATATAGTTCAAGCTTTAATTGAT ppkl* ATAAGAATGACACTTTATAGAGTTGAAAAAAATTCAAATATAGTTCAA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * 74 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100732/manifest

Comment

Related Items