Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The regulation of HIV-1 replication by the transcription factors USF1, USF2, and TFII-I (RBF-2) Malcolm, Thomas E. 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-318836.pdf [ 14.86MB ]
Metadata
JSON: 831-1.0100673.json
JSON-LD: 831-1.0100673-ld.json
RDF/XML (Pretty): 831-1.0100673-rdf.xml
RDF/JSON: 831-1.0100673-rdf.json
Turtle: 831-1.0100673-turtle.txt
N-Triples: 831-1.0100673-rdf-ntriples.txt
Original Record: 831-1.0100673-source.json
Full Text
831-1.0100673-fulltext.txt
Citation
831-1.0100673.ris

Full Text

THE REGULATION OF HIV-1 REPLICATION BY THE TRANSCRIPTION FACTORS USF1, USF2, AND TFII-I (RBF-2) by Thomas E. Malcolm B.Sc. University of Victoria, 1999 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Biochemistry and Molecular Biology) THE UNIVERSITY OF BRITISH COLUMBIA October, 2007 © Thomas E. Malcolm, 2007 ABSTRACT Despite efforts to eliminate the HIV-1 virus from infected individuals, the virus persists in a latent chromosomally integrated pool of provirus that evades current drug therapy. Upon cessation of highly active anti-retroviral therapy (HAART), the latent virus begins to replicate resulting in an increased viral titre in the patient's serum, leading to Acquired Immune Deficiency Syndrome (AIDS). A great amount of effort has gone into determining the mechanisms involved in the establishment of viral latency, in order to find targets that can be used in combination with existing therapies to eradicate the virus. In this thesis, I characterize a protein complex that is required for viral replication of integrated virus and therefore has potential as a therapeutic target. The data presented in this thesis identify USF1, USF2, and TFII-I as the proteins that comprise the Ras-response element Binding Factor-2 (RBF-2), which binds constitutively to the Ras-response Factor Binding Elements I and III (RBEI and RBEIII) within the Long Terminal Repeat (LTR) promoter. RBEIII is highly conserved in sequence and position relative to the transcriptional start site. In addition, both RBEIII and RBEI are situated near nucleosomes in the LTR enhancer region. Furthermore, I provide evidence that RBF-2 proteins are modified by phosphorylation in response to T-cell activation. Finally, I demonstrate that mutations in RBEIII that prevent the binding of these factors, as measured by electrophoretic mobility shifting assays, also prevent HIV-1 activation, as observed from stably integrated reporter virus. ii T A B L E O F C O N T E N T S Abstract ii Table of Contents iii List of Tables vii List of Figures vii: List of Abbreviations xi Acknowledgments xv C H A P T E R I Introduction 1 1.1 HIV-1 L T R Ras-Responsive Elements 1 1.2 HIV-1 and the Pathogenesis of AIDS 2 1.2.1 Background, Replication Cycle of HIV-1 2 1.2.2 Viral Structure & Receptor Mediated Infection 3 1.2.3 Conversion of Viral RNA into DNA by Reverse Transcriptase 5 1.2.4 Integration of HIV-1 into the Host Cell Genome 5 1.2.5 Viral protease and posttranslational modification 7 1.3 Regulation of Eukaryotic Transcription 9 1.3.1 Chromatin and Regulation of Eukaryotic Gene Transcription 9 1.3.1.2 Regulation of Nucleosome Positioning 9 1.3.1.3 Regulation of Chromatin by Histone Modification 10 1.3.1.4 Eukaryotic Promoter Structure and Initiation of Transcription 12 1.4 Transcription regulation of integrated HIV-1 pro-virus in T-cells 15 1.4.1 The Regulation of T-cell Response by Cytokines 15 1.4.2 T-cell Receptor (TCR) Engagement and Signal Transduction 16 1.4.3 Nucleosome Phasing and Chromatin Organization on the HIV-1 LTR 18 1.4.4 Structure of the HIV-1 Promoter 18 1.4.5 Eukaryotic Transcription Factors that Regulate HIV-1 Gene Expression 19 1.4.6 Nuclear Factor K B ( N F K B ) 25 1.4.7 Nuclear Factor of Activated T-cells (NFATlc) 26 1.4.8 Ets-1 GABP-a/(31 Transcription Factors 27 1.4.9 Sp-1 Transcription Factor 28 1.4.10Ying Yang-1 (YY1) 29 1.4.11 Upstream Stimulatory Factors 1 and 2 (USF1 and USF2) 30 1.4.12 Transcription Factor II-I (TFII-I) 34 1.5 Objective of this thesis 39 iii C H A P T E R II Materials and Methods 40 2.1 Recombinant Plasmids 40 2.2 Oligonucleotides 41 2.3 Antibodies 41 2.4 Cell Culture 41 2.5 In vivo Labeling of Jurkat T-cells with 3 2 P (Ortho-phosphate) 43 2.6 In vitro Transcription/Translation 43 2.7 Recombinant Baculovirus 44 2.8 Nuclear and Recombinant Protein 44 2.9 Electrophoretic Mobility Shifting Assays and Probe Labeling 45 2.10 DNasel Footprinting 46 2.11 Immunoprecipitations 47 2.12 Nickel Resin Pull-down Assays 48 2.13 Transient Transfections of 293T and Phoenix Kidney Cells 49 2.14 Viral Infections, F A C S , and Stable Cell Lines 50 2.15 Enzyme-Linked ImunnoSorbent Assays (ELISA) and Luciferase Assays 50 C H A P T E R III Results 52 3.1 Identification of the RBF-2 protein subunits 52 3.1.1 Purified RBF-2 is comprised of USF1, USF2, and TFII-I 52 3.1.2 USF1, USF2 and TFII-I antibodies supershift purified RBF-2 specific complex 55 3.1.3 USF1, USF2 and TFII-I antibodies supershift the RBF-2 complex from Jurkat nuclear extracts 58 3.2 RBF-2 can be produced from recombinant USF1, USF2 and TFII-I 61 3.2.1 USF1 and USF2 co-expressed in rabbit reticulocyte lysates form a heterodimer that migrates with the same mobility as RBF-2 from Jurkat nuclear extracts 61 3.2.2 USF binds with an -160 fold higher affinity to a canonical EBox motif relative to the RBEIII sequence 66 3.2.3 USF1 homodimers and USF1/2 heterodimers exhibit enhanced binding to the RBEIII element in the presence of TFII-I 71 3.2.4 TFII-I specifically promotes binding of USF1/2 to RBEIII on LTR templates in footprinting reactions 72 3.3 Mutations in RBEIII that affect TFII-I binding 78 3.3.1 Recombinant TFII-I specifically binds RBEIII in EMS A 78 3.3.2 TFII-I produced in Sf21 insect cells binds to previously defined TFII-I consensus-containing oligonucleotides 81 iv 3.3.3 Nucleotides between -128 to -125 are necessary for binding ofTFII-I , 85 3.3.4 The TFII-I binding site and the RBEIII element are highly conservedin HIV-1 isolates from patients with AIDS 89 3.3.5 Mutations in the RBEIII core and CATC motif are required for TFII-I and USF binding in Jurkat T-cell nuclear extracts 90 3.3.6 USF marginally improves the binding of TFII-I to an RBEIII containing oligonucleotide 95 3.3.7 A point mutation in CATC that prevents binding of TFII-I, also prevents enhancement of USF binding to RBEIII 95 3.4 Mutations in RBEIII that effect USF and TFII-I binding prevent activation of HIV-1 expression in vivo 98 3.4.1 A reporter virus vector for examining HIV-1 LTR mutations 98 3.4.2 Mutations in RBEIII and TFII-I binding sites prevent induction of integrated viral expression 104 3.5 Similar USF and TFII-I interactions occur at the RBEI site 107 3.5.1 Recombinant USF from Sf21 insect cells binds RBEI 107 3.5.2 TFII-I enhances USF binding to RBEI 112 3.6 TFII-I and USF1 protein-protein interactions 115 3.6.1 Recombinant USF1 and TFII-I from Sf21 insect cells co-immunoprecipitate 115 3.6.2 Interaction of TFII-I with USF1 is predominantly mediated by R4 118 3.7 USF and TFII-I bound at RBEIII are necessary for response to T-cell signaling 121 3.7.1 The MAPK pathway is essential for induction of integrated HIV-1 LTR by CD3 cross-linking and stimulation with PMA.. . . 124 3.7.2 Calcineurin-NFAT causes synergistic induction of the LTR with the MAPK pathway 127 3.7.3 RBEIII is constitutively occupied by USF/TFII-I 127 3.7.4 RBF-2 components are phosphorylated in PMA-stimulated Jurkat T cells 130 C H A P T E R IV Discussion 136 4.1 The HIV-1 L T R is responsive to T-cell Signaling 136 4.2 USF and TFII-I are constitutively bound to the HIV-1 L T R and have been shown to interact with chromatin remodeling machinery at other promoters 138 4.3 Spatial conservation of the RBEs on the HIV-1 L T R and their potential role in nucleosome positioning 141 4.4 The role of TFII-I at the RBEIII element 142 4.5 The mechanism for stimulation of DNA binding by TFII-I 144 4.6 Additional factors that bind near RBEIII 145 4.7 Synopsis for activation of chromosomally integrated HIV-1 146 4.8 Future Directions 147 4.9 Conclusion 148 References 149 Appendix I: Experimental Oligonucleotides 170 Appendix II: Plasmids used in this study 175 Appendix III: Sequence alignments for the RBEIII element with the HIV-1 genome 177 vi LIST OF TABLES Table 1. Transcription factors that bind the HIV-1 LTR 22 Table 2. Highly conserved binding sites in the HIV-1 LTR 90 vii LIST O F FIGURES Figure 1. Diagram of a mature HIV-1 virion 4 Figure 2. HIV-1 reverse transcriptase pathway 6 Figure 3. The HIV-1 pathogenic cycle 8 Figure 4. A General model for the regulation of transcriptional initiation in Eukaryotes 14 Figure 5. The T-Cell Receptor (TCR) signalling pathways associated with HIV-1 activation 17 Figure 6. The Organization of the HIV-1 genome and arrangement of transcription factors on the LTR 20 Figure 7. A detailed diagram of the LTR and the locations of transcription factor binding sites 21 Figure 8. Diagram representing USF1 and USF2 protein properties 32 Figure 9. Diagram representing the four spliced variants of TFII-I 37 Figure 10. Purified RBF-2 contains USF1, USF2, and TFII-I 54 Figure 11. Antibodies against USF1, USF2, and TFII-I inhibit DNA binding of purified RBF-2 57 Figure 12. Antibodies against USF1, USF2, and TFII-I inhibit DNA binding of RBF-2 in Jurkat nuclear extracts 60 Figure 13. Recombinant USF1, USF2, and TFII-I expressed in rabbit reticulocyte and Sfl\ insect cells 63 Figure 14. In vitro translated USF1 and USF2 bind RBEIII in vitro 65 viii Figure 15. USF1/USF2 heterodimers produced in insect cells bind specifically to RBEIII in vitro 68 Figure 16. RBEIII is a low-affinity binding site for USF in vitro 70 Figure 17. TFII-I promotes binding of USF1 and USF1/USF2 to RBEIII in vitro 74 Figure 18. TFII-I specifically promotes binding of USF to RBEIII 77 Figure 19. TFII-I expressed in 5/21 insect cells binds to an RBEIII-containing oligonucleotide 80 Figure 20. TFII-I binds immediately 3' of the RBEIII core sequence 83 Figure 21. Four nucleotide base pairs immediately 3' of the RBEIII core element are required for TFII-I binding 87 Figure 22. The binding of endogenous TFII-I from Jurkat nuclear extracts has similar DNA binding specificity, as does recombinant TFII-I 93 Figure 23. USF enhances binding of TFII-I to RBEIII (P3) 97 Figure 24. Mutations that prevent interaction of rTFII-I also prevent enhancement of rUSF binding to RBEIII 100 Figure 25. Diagram of the pTyeGFP reporter viral plasmid 103 Figure 26. TFII-I and RBF-2 bound at RBEIII is necessary for induction of latent viral expression 106 Figure 27. RBEI and RBEIII both bind RBF-2(USF/TFII-I) 109 Figure 28. rUSF produced in Sfll insect cells binds the RBEI element I l l Figure 29. TFII-I enhances the binding of USF on the RBEI element 114 Figure 30. Recombinant USF and TFII-I from insect cells co-immunoprecipitate 117 ix Figure 31. The R4 domain of TFII-I interacts directly with USF1 120 Figure 32. RBEIII is necessary for induction of integrated LTR by T-cell signaling ..123 Figure 33. MAPK7ERK kinase (MEK) inhibitors prevent induction of the wild type HIV-1 LTR by PMA and CD3 crosslinking 126 Figure 34. MAPK and calcineurin-NFAT cause synergistic induction of the LTR 129 Figure 35. RBF-2 (USF1/2 TFII-I) from unstimulated versus stimulated nuclear extracts binds RBEIII 132 Figure 36. USF1, USF2, and TFII-I are phosphorylated in PMA-stimulated T cells... 135 Figure 37. Proposed model for RBF-2 regulation of chromatin structure 140 x LIST OF ABBREVIATIONS AP-1 Activating Protein-1 AdML Adenoviral Major Late AIDS Acquired Immune-Deficiency Syndrome ATP Adenosine 5'-triphosphate b/HLH basic/Helix-Loop-Helix BR Basic Region BSA Bovine Serum Albumin BTK Bruton's Tyrosine Kinase C/EBP-a CAAT/Enhancer Binding Protein-alpha cAMP cyclic Adenosine Monophospahte ChIP Chromatin Immuno-precipitation SIE c-Sis/platelet growth factor-Inducible Element CTD C-Terminal Domain CsA Cyclosporin A DAG Diacyl Glycerol DBP DNA binding protein DMEM Dulbecco's Modified Eagle Medium DMSO Dimethyl Sulphoxide EBox Enhancer Box EMSA Electrophoretic Mobility Shifting Assay ELISA Enzyme-Linked ImunnoSorbent Assays FBS Fetal Bovine Serum GABP-a/(31 GA-Binding Protein-alpha/beta 1 GFP Green Fluorescent Protein GTF General Transcription Factor HAART Highly Active Anti-Retro Viral HAT Histone Acetyl Transferase HDAC Histone Deacetylase HEPES V-2-hydroxyethylpiperazine-N'-2-emanesulfonic acid HIV-1 Human Immunodeficiency Virus-1 IKB Inhibitor of kappa B IKK Inhibitor of Kappa Kinase IL Interleukin INFy Interferon-gamma IP-3 Inositol triphosphate Inr Initiator K unit of relative molecular mass kD kiloDaltons LISB Low-Imidazole Storage Buffer LPS Lipopolysaccharide LTR Long Terminal Repeat LZ Leucine Zipper MOI Multiplicity of Infection MW Molecular Weight xii Mr relative molecular mass (units=K) N F K B Nuclear Factor kappa B NFAT Nuclear Factor of Activated T-cells NFR Nucleosome Free Regions PBV Packed Bead Volume PBS Phosphate Buffered Saline PCV Packed Cell Volume PMA Phorbol 12-Myristate 13-Acetate PMSF Phenylmethylsulfonyl fluoride PIP Phosphatidylinositol 4,5-bisphosphate PIC Pre-Initiation Complex PKC8 Protein Kinase C theta RIPA Radioimmuno-Precipitation Assay Buffer RBE Ras-Responsive factor Binding Element RBF Ras-Responsive Binding Factor RNA Ribonucleic Acid RT Reverse Transcriptase SDS-PAGE Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis SRE Serum Response Element SV40 Simian Virus 40 SMAD S -Mothers Against Decapentaplegic SREBP Sterol Regulatory Element Binding Protein xiii SPvF Serum Response Factor SMAC SupraMolecular Activation Complex TAF TBP-Associated Factor TAR Transactivation Response Tat Transactivator TBC TATA Box Binding Complex TBE Tris-Borate EDTA TBP TATA Box binding Protein TCR T-Cell Receptor TFII-I Transcription Factor II-I TGF-ct Transforming Growth Factor-alpha TNF-a Tumor Necrosis Factor-alpha TSA Trichostatin A USF1 Upstream Stimulatory Factor USR Upstream Stimulatory Region IN Integrase WBSCR11 Willems-Buren Syndrome Complex Region 11 YY1 Ying Yang-1 xiv ACKNOWLEDGMENTS I would like to thank those people who contributed to the completion of this thesis. I thank Ivan Sadowski for many great years in a challenging environment, for allowing me to explore experiments independently, and for giving me the opportunity to expand my scientific knowledge. I thank my committee members Dr. Roger Brownsey and Dr. George Mackie for their support and guidance. I would like to extend my gratitude to all past and present members of the Sadowski Lab that have made this journey both exciting and interesting at times. A special thanks goes my friends Jiguo Chen, Chris Sturgeon, Mike Johnson, Kris Shelswell and Leigh Stickney. Additionally, I thank my good friend Dr. Jacob Hodgson for many hours of thought-provoking discussions on molecular epigenetics and transcription, and "Drosophila versus world" at the Odd Fellows Tea Club. I would also like to wish the current members of the Sadowski lab (in no particular order), Ting Cheng-Su, Jennifer Parent, and Pedro Lorenco all the best luck with their careers in science. On a personal and most important note, I thank my family for their support over the years, and Alana Tiemessen for being there during the best years and trying times. xv CHAPTER I INTRODUCTION 1.1 HIV-1 L T R Ras-Responsive Elements The Human Immunodeficiency Virus-1 (HIV-1) is one of the most thoroughly studied biological particles, for the obvious reason that infected individuals eventually progress to Acquired Immune-Deficiency Syndrome (AIDS) inevitably resulting in death when untreated. When HIV-1 integrates into the chromosomes of infected cells, the resulting pro-virus commandeers the host cell's machinery to regulate both its repression and replication. HIV-1 transcription is regulated by a promoter region known as the 5' long terminal repeat (LTR). Many host cell transcription factors have been shown to bind various sites within the LTR and regulate viral expression in response to cellular signals. In 1996 Bell et al discovered four cz's-elements in the LTR that were required for LTR expression in response to immediate early Ras-signaling, a cascade that occurs upon T-cell receptor (TCR) engagement (Bell et al 1996). These highly conserved elements were termed the Ras-response Factor Binding Elements I-IV (RBEI-IV; see also Figure 6). Since the discovery of the RBEs, a significant effort has gone into identifying and characterizing proteins that bind these sites. Bell et al identified a factor designated the Ras-response element Binding Factor-1 (RBF-1), which binds to RBEII and RBEIV located at -80 to -95 and -151 to -142 respectively. RBF-1 was later shown to be the transcription factors GABPa and GABP(3i, and an unidentified lOOKDa protein. Furthermore, they showed that a different complex binds to both the RBEI and RBEIII sites located at -16 to -25 and -121 to -130, termed RBF-2 (Bell et al 1996). Hereafter, the RBEIII site and the RBF-2 complex became a considerable focus due to the stringent 1 conservation of RBEIII in HIV-1 LTRs from patients with AIDS (Estable et al 1996). Significantly, LTR's with a mutated RBEIII motif invariably have a duplication that preserves both its position relative to the transcriptional start site (Sadowski and Mitchell, 2005) and its sequence, making it one of the most highly conserved elements in the LTR (Estable et al 1996). The RBF-2 complex was purified using an RBEIII oligonucleotide affinity column, but the identity of the subunits in the complex was not determined (Estable et al 1999). The research presented in this thesis identifies the proteins USF1, USF2, and TFII-I, as subunits that minimally comprise the Ras-responsive Binding Factor-2 (RBF-2) complex identified in the initial purification (Estable et al 1999). Additionally, I have also characterized interaction of the RBF-2 subunits with the highly conserved RBEI and RBEIII motifs on the LTR using both in vitro and in vivo biochemical studies. These data disclose the importance of the RBF-2/RBE regulatory motifs in HIV-1 gene regulation. 1.2 HIV-1 and the Pathogenesis of AIDS 1.2.1 Background, Replication Cycle of HIV-1 In 2006, 39.5 million people worldwide had been reported to be living with HIV-1 and/or AIDS, with 4.3 million people infected in the same year alone On average 2.5-3.5 million people die each year from AIDS related disease, and to date approximately 25 million people have died since the virus emerged in 1981 Although many drugs have been discovered that target multiple points in the infection and replication cycle of the virus, they only eliminate serum virus, and fail to eradicate the latent pool of integrated provirus in CD4 positive cells of the immune system (Finzi et al 1997). Even with the advent of Highly Active Anti-Retroviral Therapies (HAART) that 2 exploit combinations of drugs in patient-specialized cocktails (Lima and Montaner 2007), no drug therapy to date targets latent virus. Therefore, patients at best must continue chemotherapy to suppress viral replication. Additionally, the expense of drugs presents a challenge for under-developed countries in sub-Saharan Africa and South-East Asia where 79% of the total infected population resides Understanding the underlying mechanisms of HIV-1 viral latency would, in principle, promote the basis to develop new therapies and improve existing treatments, allowing for complete HAART therapy to eradicate the virus. 1.2.2 V i r a l Structure and Receptor Mediated Infection HIV-1 is a chromosomally integrating retrovirus belonging to the Lentiviridae family (Barre-Sinoussi et al 1983). The virus is a capsid-enveloped, fusogenic particle with the embedded glycoproteins gpl20 and gp41 projecting from its surface. The core of the virus, surrounded by viral capsid protein (p24), contains viral protease, integrase, reverse transcriptase, and two positive sense RNA molecules encoding its genome (Figure 1) (Stevenson et al 2003). Once the virus enters the serum of an infected individual, the gpl20 envelope glycoprotein undergoes conformational changes upon contact with the CD4 receptor on T-helper cells, regulatory T-cells, monocytes, macrophages, and follicular dendritic cells (Kwong et al 1998). The changes in gpl20 conformation expose its variable region 3 (V3) for interaction with the CD4-associated chemokine receptors CCR5 or CXCR4 (Moore et al 1997, Feng et al 1996). Variation in the V3 region determines which co-receptor the virus interacts with (Speck et al 1997). (1) These data were taken from the Avert Worldwide HIV & AIDS Statistics website http://www.avert.org/worldstats.htm 3 Mature HIV-1 Virion Figure 1. Diagram of a mature HIV-1 virion. Abbreviations: gpl20 (surface glycoprotein 120). gp41 (transmembrane glycoprotein 41). CA p24 (gag, capsid protein 24). M A pl7 (gag, membrane matrix-associated protein 17). RT RNH p66 (Reverse Transcriptase Polymerase and RNAse H). IN p32 (Integrase 32). +sRNA (+sense RNA). PR p9 (Protease 9). 4 The interactions of gpl20 with these receptors cause conformational changes in the gp41 glycoprotein that in turn acts as a fusion protein, mediating the viral-host envelope fusion event (Kwong et al 1998). 1.2.3 Conversion of Viral R N A into DNA by Reverse Transcriptase Shortly after the viral envelope fuses with the host cell membrane and releases its contents into the cytoplasm, the +sense viral RNA (vRNA) is converted to DNA by viral reverse transcriptase (RT) (Charneau et al 1994). Binding of cellular L y s tRNA to the retroviral primer-binding site (PBS) initiates the process. A series of DNA elongations along the vRNA template, rearrangements, and vRNA degradations by the viral RNaseH p66 result in a double stranded DNA genome with two flanking LTR regions (Figure 2) (Charneau et al 1994). This highly coordinated process involving RT is prone to generating frequent mutations along the product DNA since RT lacks proof-reading function. The resulting RT-induced mutations in the genome, accompanied with high viral turnover and immunological or drug-related selective pressures, have given rise to strains that are now resistant to current therapies. 1.2.4 Integration of HIV-1 into the Host Cell Genome After the conversion of vRNA into the viral genomic DNA, a Pre-Integration Complex (PIC) forms consisting of viral integrase (IN) and the host cell transcriptional co-factor LEDGF/p75 (Cherepanov et al 2003, Llano et al 2006). LEDGF/p75 has been shown to regulate genes by tethering transcription factors to chromatin. For example, LEGDF/p75 tethers the myc-interacting protein JP02 to condensed chromosomes during mitosis (Maertens et al 2006), and has a defined 80 amino acid v-integrase interaction domain (Cherepanov et al 2004). Once in the nucleus, the PIC is targeted to genes that 5 HIV-1 Reverse Transcriptase Pathway 5' PBS 5 DO tRNA Retroviral RNA R U5 tRNA 3' 5' 3' i i i i n i i R U5 tRNA RU5 5' PBS 5 C L Z 3 ' 9 5' PBS 3'a PBS 3'a PBS 5' 3' 5' yum PBS 3' 3' U3R U5 5' 5' Retroviral DNA 3' U3R U3R ]3 ' I M r U3R 5 ' • 3' U3R 3' U3R U3R U3R J 3' U3R 5' 5' tRNA tRNA tRNA 3' tRNA 5' 3' PBS U3R U5 U3R U5 5' 5' 3' Figure 2. HIV-1 reverse transcriptase pathway. The primer tRNA is lysine encoding. PBS (Primer Binding Site). 6 have been activated by early viral infection (Astrid et al 2002, Corbeil et al 2001). This process is directed by the DNA binding activity and PIC tethering property of LEDGF/p75 (Turlure et al 2006, Ciuffi et al 2006, Llano et al 2006). 1.2.5 Viral Protease and Posttranslational Modification When the virus integrates into the genome, and becomes active due to cellular signal transduction, RNA polymerase II is recruited to the LTR and initiates transcription. The transactivation response (TAR) RNA loop structure forms on the 5' end of the nascent RNA causing RNA Polymerase II to stall. Pol II remains stalled at the TAR loop element until the viral protein Tat (presumably expressed at a basal level) promotes elongation by recruitment of pTEFb, allowing expression of the full HIV genome (Zhu 1997). The full-length mRNA is transcribed and exported from the nucleus by the viral protein Rev (Malim et al 1989). The viral mRNA transcript is spliced to yield gag-pol, env, and a variety of smaller transcripts (Debouck et al 1987, Kohl et al 1988). The gag-pol transcript is translated into a large peptide that is cleaved by viral protease into matrix pl7 and capsid p24 proteins (gag), protease plO, reverse transcriptase p66/p51, and integrase proteins (pol) (Erickson-Viitanen S et al 1989). The premature virus then condenses at the cellular membrane and buds to form a mature virus (Orenstein et al 1988, Harris et al 1989). Figure 3 shows an overview of the complete HIV-1 replication cycle. Since the viral protease is essential for production of functional gene products and therefore functional virus, it has been a focus for drug therapy. HIV protease inhibitors are generally synthetic analogs of the cleavage site FPYP in gag-pol polypeptide sequences (DeBouck et al 1992). Various other points of the HIV-1 replication cycle have been targeted for drug therapy, and include inhibitors of gpl20 7 HIV-1 Replication Figure 3. The HIV-1 replication cycle. fusion, reverse transcriptase, and integrase (Derdeyn et al 2000, Nakasima et al 1986, Yarchoan et al 1986, DeBouck et al 1992 ). 1.3 Regulation of Eukaryotic Transcription Expression of the HIV-1 genome is completely dependent upon the host cell's RNA Polymerase II transcriptional machinery. Therefore a discussion of eukaryotic transcriptional regulatory mechanisms is necessary to introduce the specific mechanisms relating to HIV-1 transcription. Furthermore, because the virus is expressed as a chromosomally integrated form, the LTR is subject to the same influences of chromatin structure as the host cell's genes. 1.3.1 Chromatin and Regulation of Eukaryotic Gene Transcription 1.3.1.2 Regulation of Nucleosome Positioning Higher order chromatin structure, mediated by nucleosomes, contributes to the cellular mechanisms used to repress genes in eukaryotic cells. This process is highly regulated on multiple levels. Nucleosomes interact with naked DNA to form structures where -146 base pairs of DNA are wrapped 1.65 times around a nucleosome consisting of a core of eight histones (H2A, H2B, H3, H4) (Luger et al 1997). In vivo there appear to be several mechanisms for regulating chromatin condensation and nucleosome positioning. One recently discovered form of regulation is the presence of cw-acting barrier elements that create boundaries to the encroachment of condensation (Bing Li et al 2007 West et al 2004). Some proteins known to bind barrier elements include transcription factors such as USF1 and USF2. In yeast, Bernstein et al (2004) showed that most promoters generally have a lower nucleosome density than coding regions. Additionally, Yuan and Rando (2005) showed that most yeast promoters have an 9 approximately 200 base pair exposed region that is flanked by nucleosomes. These regions, termed the nucleosome-free regions (NFRs), have been speculated to be in a relaxed nucleosome state possibly to allow accessibility of large transcription initiation complexes upon activating conditions (Li et al 2007). 1.3.1.3 Regulation of Chromatin by Histone Modification Another form of regulation involves the modification of core nucleosome tails or their globular domains. A multitude of such modifications has been observed, including serine/threonine phosphorylations, lysine acetylation, ubiquitination, methylation, SUMOylation, ADP-ribosylation, and arginine methylations (Bing L i et al 2007). Generally speaking, with the exception of modifications that target nucleosomes for degradation, most of these seem to result in the recruitment of chromatin modifying complexes. Furthermore, the effect of these modifications depends on the location, combination, and type of regulatory complex that is attracted to the modification (Jenuwein et al 2001). Of these modifications, the acetylation of lysine residues has been most thoroughly characterized. Histone acetyltransferases (HATs) catalyze this modification. In humans, HATs are part of the PCAF complex that is recruited to genes by sequence-specific transcription factors, resulting in acetylation of nucleosomes leading to gene accessibility. Once the transcriptional machinery is assembled and transcription initiated, histones ahead of RNA polymerase are acetylated, and disassembled by nucleosomal chaperones such as FACT, Spt6, or Asfl . These same chaperones are believed to reassemble the nucleosome behind the RNA polymerase after it passes by reforming H2A and H2B heterodimers (Schwabish et al 2004). The reassembled nucleosome is then methylated by the Setl methyltransferase that interacts with the C-10 terminal domain (CTD) of the RNA Polymerase (Dehe et al 2005, Pokholok et al 2005). Active genes remain marked by methylation and acetylation allowing multiple passes of RNA Polymerase II machinery. When repressive conditions occur, the methylated H3K36 residue attracts the chromodomain of EaO, which in turn recruits the Rpd3S deacetylase complex (Carrozza et al 2005, Joshi et al 2005, Keogh et al 2005). To ensure gene silencing, this complex deacetylates the histones, allowing for the formation of higher chromatin, and subsequent demethylation depending on the active state of the gene (Carrozza et al 2005). Gene silencing is most likely maintained by the localization of histone deacetylases (HDACs) on silenced promoters. HDAC location and function may be stabilized by the presence of constitutively bound context-dependent transcription factors such as TFII-I and YY1 that directly regulate their function in response to cellular signals (Tussie-Luna et al 2002). The phasing or sliding of nucleosomes by ATP-dependent complexes such as Swi/Snf, recruited by transcriptional activators, can also modulate the accessibility of genes (Cosma et al 1999, Neely et al 2002). Although overcoming the inaccessibility of promoters is a major hurdle for the general transcription machinery, some transcription factors can bind to DNA that is wound around a nucleosome, therefore adding yet another level of complexity in gene expression and its regulation. Taken together, histone modifications and the protein interactions that result, add a level of complexity that has only been appreciated in the past several years. The precise mechanisms by which specific genes are controlled through chromatin organization and modification are still relatively poorly understood. 11 1.3.1.4 Eukaryotic Promoter Structure and Initiation of Transcription Promoters that drive genes encoding proteins are activated through a series of steps that result in the recruitment of RNA Polymerase II (Pol II) that transcribes DNA into messenger RNA (mRNA). A typical eukaryotic promoter consists of core promoter elements and upstream binding sites for multiple sequence-specific transcription factors, each unique in their ability to respond to different signaling pathways. The core promoter generally consists of a consensus TATA Box upstream of an initiator element (Inr). Base pair variations and the presence or absence of either the TATA Box or Inr, further diversifies the core promoter of various genes. When the promoter region is free from chromatin structure and a gene becomes activated, an orchestrated series of complex recruitments occurs. For the most part, sequence-specific transcriptional activators function by recruiting general transcription factors (GTFs) and coactivator complexes to target genes. The current view suggests that transcriptional activators first recruit TFIID, consisting of TBP and the TAFs. (Zawel et al 1992, Buratowski et al 1994, and Flores et al 1992). This process is a key initial event, assisted by the DNA bending properties of the general transcription factors (GTF) TFII-A and TF1I-B (Lagrange et al 1996, Hahn et al 1995) (Figure 4A). The resulting complex is termed the Pre-Initiation Complex (PIC) (Figure 4B). At this point, recruitment of Mediator by transcriptional activators (Figure 4C) is also accompanied by its interaction with the unphosphorylated CTD of the RNA Pol II holoenzyme, which then binds the PIC and transcription is initiated (Figure 4D). 12 Figure 4. A General model for the regulation of transcriptional initiation in Eukaryotes. (A) The recruitment of TFII-D (black and gray complex) to the TATA box, is assisted by TFII-A (black) and TFII-B (black). Activator proteins that are bound to their Upstream Activating Sequences (UAS) or enhancer elements are shown in blue. (B) TATA box bound TFII-D/TFII-A/TFII-B (TATA Box Protein - TBP) forms the pre-initiation complex (PIC) and activator proteins recruit the TRAP/mediator complex (red and silver). (C) The RNA Polymerase II Holoenzyme (green) is then recruited to the PIC by the activator/TRAP/mediator complex resulting in the dissociation of the MED/srb (red) module from the TRAP/mediator. (D) Activation of transcription. 13 1.4 Transcription Regulation of Integrated HIV-1 pro-virus in T-cells 1.4.1 The Regulation of T-cell Response by Cytokines Activation of T-cells is critical for the immune response to destroy cells that have been infected with pathogens. T-cell activation involves the firing of numerous signaling cascades leading to the production of cytokines such as Interleukin-2 (IL-2), Interleukin-4 (IL-4) and Tumor Necrosis Factor-a (TNF-a). IL-2 secreted from activated T-cells binds to receptors on neighboring T-cells, resulting in activation of the JAK/Stat, Ras/MAPK, and PI 3-kinase/Akt signaling modules (Stern et al 1986, Benczik et al 2004), causing the expression of genes leading to the exponential proliferation and survival of antigen-selected T-cells (Beading et al 2002). IL-4 also causes the up-regulation of MHC class II production and antibody class switching to IgE in B-cells (Yokota et al 1986). TNF-a is expressed initially as an integral membrane protein that is cleaved on the extra-cellular side of the cytoplasmic membrane by the metalloprotease TNF-a converting enzyme (TACE) (Black et al 1997). Upon its release, TNF-a binds to the TNF Receptor-1 (TNFR-1) causing N F K B activation and subsequent T-cell proliferation (Habetswallner et al 1988). These three examples of regulation by cytokines only scratch the surface of the immune response, but offer a general model for explaining the immune cell proliferative effects of neutralizing pathogens. The proliferation and localization of high numbers of immunological cells at the site of pathogen infection gives HIV-1 the opportunity to efficiently infect new cells because expression of its own genes is induced in parallel with the T-cell response. 15 1.4.2 T-cell Receptor (TCR) Engagement and Signal Transduction When the TCR engages the peptide-Major Histocompatibility Complexes (MHC) on antigen presenting cells (APCs), conformational changes in its CD3/CD4 transmembrane protein subunits initiate and guide the formation of the supramolecular activation complex (SMAC) (Grakoui et al 1999). The SMAC consists of the TCR, intracellular signaling proteins, and the clustering of lipid rafts (Xavier et al 1999). Formation of the SMAC complex promotes activation of the tyrosine kinases Lck and Zap70 thereby initiating the signaling cascade (Altman et al 2000). One target is phospholipase-Cy (PLCy) which in its active state hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP) into the secondary messengers diacylglycerol (DAG) and inositol triphosphate (IP-3) (Altman et al 1990). Each of these second messengers then activates separate pathways that have specific transcriptional targets (Figure 5). The second messenger IP-3 acts to mobilize intracellular calcium (Ca2+) that in turn activates the phosphatase calcineurin (Rao et al 1997). Calcineurin de-phosphorylates cytosolic NFAT, allowing it to enter the nucleus and bind its appropriate cz's-elements on target genes (Figure 5) (Brooks et al 2003, Huang et al 2004). The second messenger DAG is pivotal to the regulation of both the N F K B and Ras/Raf/MEK/ERK kinase pathways (Figure 5) (Werlen et al 1998). In the N F K B pathway, the Inhibitor of Kappa Kinase (IKK) is released from PKC0 that has been activated by DAG, resulting in the phosphorylation of the Inhibitor of K B ( I K B ) protein. I K B normally binds to and prevents nuclear localization of N F K B . This phosphorylation event instigates degradation of I K B , thereby releasing N F K B for nuclear translocation to its target genes (Figure 5) (Steffan et al 1995, Vertegaal et al 2000, Trushin et al 1999). 16 T-cell Receptor Signalling Figure 5. The T-Cell Receptor (TCR) signalling pathways associated with HIV-1 activation. A DAG also activates the classical Ras/Raf/MEK/ERK pathway that regulates numerous transcription factors including API and Ets-l/GABP (Werlen et al 1998). 1.4.3 Nucleosome Phasing and Chromatin Organization on the HIV-1 L T R HIV-1 is at the mercy of the host cell's chromatin because it integrates into the host chromosome. Verdin et al (1993) initially described the organization of nucleosomes on the HIV-1 LTR under high and low rates of transcription. Soon after, the Martin group showed the precise positions of two nucleosomes (NucC and NucA) that flank the enhancer region of integrated LTRs in CD4-positive HeLa cells (Kharroubi et al 1996 and 1998). Interestingly, the RBEIII and RBEI sites, identified for their requirement for Ras-response on the LTR lie adjacent to these nucleosome positions suggesting a positional or barrier role for the RBF-2 complex. The implications of these observations will be discussed in detail later in this thesis. 1.4.4 Structure of the HIV-1 Promoter Transcription of the HIV-1 genome initiates within the 5' promoter region termed the Long Terminal Repeat (LTR). Three regions define the LTR: the Unique 3' Region (U3R), the Repeat region (R), and the Unique 5' Region (U5R). The U3R region extends from -453 to +1 (relative to the transcriptional start site) and contains the TATA Box binding element (-28 to -24) and consensus sites for many host cell transcriptional activators. The R region encompasses +1 and +97, and contains the transcriptional start site, and sequence encoding TAR RNA. Additionally, the U3 Region/Repeat junction is flanked by the Inr element. The U5R region is further downstream and lies between +97 and +139 relative to the transcriptional start site. This region encodes the continuing viral RNA strand, and plays an important role in tRNA priming during the reverse 18 transcription process described earlier (Figure 2). Mutations occur uniformly throughout the promoter and along the entire genome during the RT reaction; however, in most patients that progress to AIDS the N F K B , Spl, TATA, and RBEI/III consensus sites are highly conserved (Figure 6). 1.4.5 Eukaryotic Transcription Factors that Regulate HIV-1 Gene Expression The HIV-1 LTR is littered with potential binding sites for a number of eukaryotic transcription factors (Figure 7). Transcription of the HIV-1 genome is completely dependent upon host cell factors, and a tremendous amount of effort has gone into delineating the role that these various factors play in the HIV-1 life cycle. The eukaryotic transcription factors that regulate HIV-1 replication can be classified into those that activate or repress transcription, and those that seem to be context-dependent. Transcriptional activators generally bind to the promoter regions of genes and stimulate transcription by recruiting the RNA polymerase machinery and chromatin modifying complexes either directly or indirectly through mediator complexes (Naar et al 1999, Boyer et al 1999, Rachez et al 1999, see Figure 4). Transcriptional repressors promote the formation of heterochromatin by recruiting histone deacetylation enzymes and other chromatin-organizing complexes, therefore making genes inaccessible to the transcriptional machinery (Thiel et al 2004). Context dependent transcription factors can be involved in activation or repression depending on their environment or modification (Alvarez et al 2003). Context-dependent transcription factors may have their own activation and repression domains, or may depend on protein-protein interactions with other trans-acting or repressive proteins (Alvarez et al 2003). 19 The HIV-1 Genome 5 ' L T R M A C A n C A tat 1 • P R IT R T ™ G p l i O G p 4 1 • pol Vpr Vpu env Vif 3 ' L T R o -453 R B F 2 R B F 2 9n +1 R B E III / -120 \ A C T G C T G A C A T C R B E III R B E I U 5 R B E III/I Ras-responsive Binding Element RBF-2 Ras-responsive Binding Factor 2 Figure 6. The Organization of the HIV-1 genome and association of transcription factors with the LTR. The HIV-1 LTR U S F G A B P / ^ A ~f\ ATGACCCTGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGA I I I I I I I I I I -220 -210 -200 -190 -180 -170 -160 -150 -140 -130 RBF-2 N F K B 1 ^ " A A A A A A A A A ACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCA I I I I I I I I -110 -100 -90 -80 -70 -60 -50 -40 -120 RBF-2 CTF C^PSII-BFT) GATGCTGCATATAAGCAGCTGCTTTTTGCCTGTACT GGGTCTCTCTGGTTAGACCAGATTTGAGCCTGGGAGCTCTCTGGCTAA TBP +20 I +30 +40 TAFs TFII-I Figure 7. A detailed diagram of the LTR and the locations of relevant transcription factor binding sites. Below, I briefly discuss transcription factors that have been shown to have a significant effect on HIV-1 transcription in vivo, but for the sake of completeness a full list of potential factors that have been shown to bind to the LTR is provided in Table 1. Most of the factors listed in Table 1 bind to HIV-1 LTR regions that are either poorly conserved or LTR's that have not been stably integrated into the host cell genome. Table 1. Transcription factors that bind to the HIV-1 LTR Transcription Factor Molecular Mass Chromosome Position L T R Position Effect on HIV-1 transcription reference AP4 64 KDa 7q36.1 Binds EBox 3' of TATA box ? Ou et al 1994 A T F 29 KDa 12ql3.12 5'ofEts site Activation Tanaka et al 2003 C/EBPp7IL-6 28.5 KDa 8qll.21 Basal level activation Henderson et al 1995 c-fos 41 KDa 14q24.3 Predicted site near 5' end of LTR Activation (JNK pathway) Franza et al1988 Chen and Rapp et al 2000 E47 (TCF-3) 68 KDa 19pl3.3 Binds EBox 3'of TATA box ? Ou et al 1994 Zhang et al1992 Ets-1 54 and 68 KDa llq24.3 Binds Ets sites overlapping N F K B sites Activation Holxmeist er etal 1993, Seth etal1993 Ets-2 56 KDa 21q22.2 Binds Ets sites overlapping N F K B sites Activation Hodge et al1996 Fli-1 51 KDa llq24.3 Binds Ets sites overlapping N F K B sites Repression Hodge et al1996 22 Transcription Factor Molecular Mass Chromosome Position L T R Position Effect on HIV-1 transcription reference GABP-ct 60 KDa 21q21.3 Binds Ets sites overlapping N F K B sites Activation (Ras-responsive) Flory et al 1996 LBP1 58-68 KDa 3p23 Inr Repression. Prevents TFII-D binding TATA box Kato et al 1991 ILF 69 KDa 17q25.3 -283 to -195 Repression Li et al 1991a GABP-p l 53 KDa 15q21.2 Bind N F K B sites Activation (Ras-responsive) Flory et al 1996 GATA -3 48 KDa 10pl4 Binds multiple sites in LTR Activation Yang and Engel et al 1993 Jun-B 36 KDa 19pl3.13 Predicted site near 5' end of LTR Activation (INK pathway) Franza et al 1988 Chen and Rapp et al 2000 Sheridan LEF1 44 KDa 4q25 Activation/ chromat in regulation et al 1995b, Waterman et ai 1991 N F A T c l 101 KDa 18q23 -90 to -104 Activation via N F K B sites (calcineurin/TCR) Kinoshita etal 1997 N F K B 105 KDa 4q24 -90 to -104 Activator (responsive to the PKC/TNF-a pathways) Baltimore et al 1997, Griffin et al 1989, Roulston etal 1995 Spl 81 KDa 12ql3.13 -77 to -45 basal level activator (MAPK/stress) Harrich et a/1989 Sp3 82 KDa 2q31.1 -77 to -45 Repression Majello et al 1994 Sp4 82 KDa 7pl5.3 -77 to -45 Activation via Spl sites Majello et al 1994 T3R Between N F K B and Spl sites Thyroid response element Desai-Yajnik et al 1993 23 Transcription Factor Molecular Mass Chromosome Position L T R Position Effect on HIV-1 transcription reference TBP 38 KDa 6q27 TATA box Basal activation and Tat activation Berkhout et al 1992; Veschamb re et al 1995, Zeichner et al 1991 TDP-43 43 KDa TAR RNA Repression Ou et al 1995 TFII-I 115-125KDa 7qll.23 -125 and Inr Chromatin regulation. Activator/repressor Montano et al 1996, Roy et al 1991 TFE3 80 KDa Xp 11.22 Distal U3R EBox Activation via synergy with N F K B p65 Pazin et al 1995; Sheridan et al 1995b T M F 123 KDa 3pl4.1 TATA box Repression Garcia et al1992 USF1 43 KDa lq23.3 -129 and-166 Chromatin regulation. Activator/repressor West et al 2004 USF2 44 KDa 19ql3.12 -129 and-166 Chromatin regulation. Activator/repressor West et al 2004 YY1 68 KDa 14q32.2 +1 to+10 (Inr) Repression Margolis et al 1994 Viral Tat* 9-11 KDa HIV genome TAR* RNA Pol II release from TAR Muesing 1987 • Tat binds the nascent TAR RNA stem loop. 24 1.4.6 Nuclear Factor K B ( N F K B ) The NFKB/Rel family of transcriptional activators is regulated by TNF-a, bacterial lipopolysaccharide (LPS), phorbol ester (PMA), and the interleukins 1 and 2 (IL1/2) (Israel et al 1989, Briskin et al 1990, Suzan et al 1991, Sperisen et al 1995). N F K B is sequestered in the cytoplasm of dormant T-cells by the I K B family of proteins. Upon stimulation by one of the cytokines or pharmacological reagents mentioned above, a signal cascade results in the phosphorylation and subsequent ubiquitin-mediated degradation of I K B . The nuclear localization sequence previously buried in the N F K B protein becomes exposed and the protein becomes translocated to the nucleus where it activates numerous genes (DiDonato et al 1997, Mattiloi et al 2004). N F K B is an important transcriptional activator of the immunoglobulin light chain genes via the K-enhancer in B-cells (Kawakami et al 1988). It has also been identified as an activator of the Simian Virus 40 (SV40) (Sassone-Corsi et al 1985), Cytomegalovirus (CMV) (Boshart et al 1985), and ^-microglobulin (Kimura et al 1986) promoters. In 1989 Griffin et al identified N F K B as a potential regulator of HIV-1 expression via its interaction with highly conserved K-enhancer sequences in the LTR region (-90 to -104 see Figure 7 and Table 1). Three years later its role as an activator of HIV-1 expression was confirmed by Kawakami and Roeder using a series of template reporter constructs in HeLa cell nuclear extracts (Kawakami et al 1988). Since these pioneering experiments, intense research has revealed multiple subunits (RelA p65, RelB p62, c-Rel p69, p50, p52) of the Rei family of proteins that are capable of comprising various forms of the N F K B heterodimer. Additionally, each subunit may have characteristic interactions with other transcription factors, allowing this 2 5 family of activators to regulate multiple genes under differing conditions (Bouwmeester et al 2004). For example, the RelA p65 and p50 subunits have been shown to interact with Activating Protein-1 (AP-1) (Boise et al 1993) and Ets proteins, respectively, to form an "enhancon node" involved in regulating many cell types of the hematopoietic differentiation lineage (Lopez-Rodriguez et al 1999). The subunits most commonly found in the N F K B heterodimer bound to the K-enhancer motifs (GGGACTTTCC), located at -81 to -90 and -5 to -105 in the HIV-1 LTR (Figure 7), are RelA p65 and p50. The DNA binding affinity of the p50 subunit is enhanced by phosphorylation and its interaction with RelA p65 (Hou et al 2003, Guan et al 2005, Kushner et al 1999, L i et al 1994). 1.4.7 Nuclear Factor of Activated T-cells (NFATlc) Members of the NFAT family respond to TCR engagement and activate the IL-2 gene (Durand et al 1988, Shaw et al 1988). Identification of the NFAT binding site on the IL-2 promoter led to the discovery of homologous binding sites in the upstream enhancer region of the HIV-1 LTR between nucleotides -216 to -254 (Markovitz et al 1992). Several groups studied the upstream enhancer sites and found that deletions in these putative binding sites had no effect on HIV-1 gene expression in response to T-cell activation with phorbol ester or TCR cross linking (Shaw et al 1988, Greene et al 1990, Lu et al 1990, Tong et al 1990, Markovitz et al 1992). It was not until the mid-1990's when Ets proteins were found bound to the NFAT site on the IL-2 promoter (Thompson et al 1992), and several groups reported interactions between Ets, N F K B , and NFAT (Cockerill et al 1993, Masuda et al 1993, Cockerill et al 1995) did Kinoshita and Nolan explore the possibility that NFAT may be binding to K-enhancer regions in the HIV-1 LTR. They confirmed that NFAT positively regulates HIV-1 expression through the K -26 enhancer motifs in response to calcium signaling as well as synergistically with the N F K B response. Subsequently, the crystal structure of NFATlc bound to this region was determined (Griffin et al 2003). These data have clarified a common misconception in the literature that NFAT regulates HIV-1 transcription from the upstream LTR enhancer region between -216 and -254 (Green et al 1990, Shaw et al 1988, Tong-Starksen et al 1990). Furthermore, Markovitz and Nabel constructed mutations in these putative upstream sites and found no effect on viral replication (Markovitz et al 1992). The roles of both NFAT and N F K B regarding signal responsive transcription are often confused (Manninen et al 2000), due to the fact that NFAT binds to the same sequence at the kappa elements as N F K B (Griffin et al 2003). Although both factors bind to the same sequence, evidence is emerging that NFAT acts downstream of the calcineurin-dependent pathway, and is unaffected by NFKB-dependent signaling (Manninen et al 2002). 1.4.8 Ets-l/GABP-a/pi Transcription Factors Transcription factors in the Ets family are common targets of the PTK/Ras/Raf pathway and regulate transcription of multiple genes, as well as HIV-1. Dominant-negative Ets mutants inhibit Ras-mediated transformation of NIH3T3 cells (Wasylyk et al 1994). The Ets family of transcription factors includes the ternary complex factor (TCF) subfamily, Elk-1, SAP1, G A B P - a / B l , and Net (ERP/SAP-2). These members and others generally require at least one additional transcription factor partner to regulate transcription in response to PTK-dependent signals (Galang et al 1994) For example, Elk-1 and SAP1 interact with the Serum Response Factor (SRF) in response to Ras signaling to regulate growth factor responsive genes (Hill, Treismann et al 1995). Additionally, activation of the polyoma enhancer by v-src and v-ras requires interaction 27 of Etsl or Ets2 with AP-1 (Wasylyk et al 1990). GABP, an Ets DNA binding domain transcription factor, was also shown to respond to PTK/Ras/Raf signaling (Flory et al 1996 and Ouyang et al 1996) and binding sites for GABP-a/fH are embedded within the N F K B / N F A T I C sites in the HIV-1 LTR enhancer region (-90 to -104, Figure 7). Bell et al (1996) and Estable et al (1998) showed that GABP-ct/pl proteins bind these sites from T-cell extracts, and comprise RBF-1. 1.4.9 Sp-1 Transcription Factor The human Spl transcription factor is an 81 KDa protein involved in the activation of many genes. Deficiencies in Spl/TAFII130 interactions have been linked to transcriptional disruption of specific genes, thereby leading to diseases such as Huntingtons chorea (Dunah et al 2002). Spl is a unique transcription factor in that it can be O-glycosylated, a modification that protects the protein from proteosome degradation (Han and Kudlow et al 1997) and causes reduced DNA binding activity. In a low glucose environment Spl has been shown to become deglycosylated at up to eight sites, thus implicating this modification as a nutritional sensor causing down-regulation of the house keeping genes it regulates (Chang et al 2000). The activation of Spl not only depends on nutritional stress pathways, but also on the abundance of the secondary messenger cAMP, which regulates the glycosyltransferase that is responsible for Spl glycosylation. The significance of this modification in relation to HIV-1 transcription is not clear, although one may speculate that the virus utilizes modified Spl activation pathways as an opportunity to replicate. Similar to the promoter in the gene for transforming growth factor-a (TGF-a), three Spl binding sites exist in the HIV-1 LTR (Jones and Tjian et al 1986), located immediately 3' of the N F K B sites from -77 to -45 in relation to the 28 transcription start site (+1) (Figure 7). Mutations in these sites were shown to prevent Spl binding and cause a 10-fold decrease in transcriptional efficiency. No other human transcription factors have been identified that interact with Spl on the HIV-1 LTR. However, potential candidates discovered in the yeast two-hybrid system (Gunther et al 2000) and the previously characterized interactions between Spl, USF (Ge et al 2003) and TFII-I (Abdelrahim et al 2005), might aid in activation of HIV-1 viral replication. Additionally, the HIV-1 viral protein Vpr has been shown to interact with Spl on the LTR and regulate immediate early responses to viral activation. The interaction of Vpr with Spl also gives the virus potential to influence the activation or repression of cellular genes of the host cell, which may perhaps benefit its replication. 1.4.10 Y i n g Yang-1 (YY1) The ubiquitously expressed 45KDa protein Ying Yang-1 (YY1) was originally cloned by Shi et al (1991) and identified as a general repressor of transcription. Of note, YY1 can also activate genes depending on its phosphorylation state and interaction partners. YY1 has two DNA binding zinc finger domains, and recruits either HDAC1 or HDAC3 under repressive conditions depending on the promoter (He et al 2002, Coull et al 2000, Yang et al 1997). Originally, YY1 was thought to preferentially bind sequences near the transcription start site (+1 to +10) of genes (Shi et al 1991, Coull et al 2000). However, examples of promoters with upstream YY1 repressive sites, such as the rat xanthine oxidase (Clark et al 1998), the human INFy promoter (Ye et al 1996) and the HIV-1 LTR (Romerio et al 1997) have surfaced. YY1 binds near the start site (between -10 and +25) on the HIV-1 LTR (Figure 7), in cooperation with the protein LSF, where it imposes a repressive effect. Repression of viral expression is mediated by recruitment of 29 HDAC1 (Coull et al 2000). YY1 also indirectly inhibits the HIV-1 life cycle through repression of the CXCR4 co-receptor gene in T-cells. Additionally, I have recently discovered that YY1 binds to a region immediately 3' of the RBEIII element (Malcolm et al 2005, this thesis). 1.4.11 Upstream Stimulatory Factors 1 and 2 (USF1 and USF2) Sawadogo et al (1985) originally identified the USF1 transcription factor as a 43 KDa activator that binds to the near-palindromic enhancer sequence GGCCACGTGACC (EBox) in the adenovirus major late promoter. Shortly after, USF2 was discovered as a 44KDa peptide capable of binding the same sequence that co-purified with USF1 from HeLa cell nuclear extracts (Sawadogo et al 1988). Since then, USF has been shown to repress and activate a myriad of genes in a context-dependent manner. The USF1 and USF2 proteins each contain a homologous basic region (BR) and leucine zipper (LZ) motif that is responsible for DNA binding. Sandwiched between these regions, each protein has a helix-loop-helix/leucine zipper domain (b/HLH/LZ) that allows them to dimerize with one another and other proteins (Ferre-d'Amare et al 1994) (Figure 8). As well, each protein has an N-terminal trans-activating domain called the Upstream Stimulatory Region (USR). USF2 has an additional activation domain between its N -terminus and Upstream Stimulatory Region (USR) critical for regulating genes lacking initiator elements in their promoters (Luo and Sawadogo et al 1996). USF1 and USF2 are transcribed from genes at locus lq23.3 on chromosome 1 and locus 19ql3.12 on chromosome 12 respectively. Each gene is ubiquitously expressed in all tissues (Sirito et 30 Figure 8. Established functional domains of USF1 and USF2. From the N-terminus to the C-terminus, each protein contains an Upstream Regulatory (USR) region, a Basic Region (BR), a helix-loop-helix (HLH) domain, and a Leucine Zipper (LZ) domain. The BR, HLH, and LZ domains of each protein is required for Enhancer Box (EBox) DNA binding. USF2 is 44KDa and USF1 is 43KDa. The relative size of each domain is not to scale. 31 Upstream Stimulatory Factors EBox DBD USF2 44KDa N USR 1 HLH 190 229 250 285 346 to USF1 43KDa N I 159 193 213 250 310 Sawadogo & Roeder, Cell. 1985. Figure 8. al 1994) and the proteins mainly exist as USF1/USF2 heterodimers, with a minor fraction of USF1 homodimers, and an even smaller amount of USF2 homodimers (Sirito et al 1994, Viollet etal 1996). USF negatively regulates trophoblast differentiation by inhibiting aromatase p450 expression from the CYP19 gene (Jiang et al 2005). As an activator, USF regulates genes involved melanin production (Galibert et al 2001), immunoglobulin XI expression (Chang et al 1992), p53 suppressor expression (Reisman et al 1993) and a variety of genes involved in the production of insulin (Read et al 1993), glucose homeostasis (Moore et al 2002), and fatty acid mobilization from adipocytes (Smih et al 2002). The activation of the fatty acid synthase gene by USF involves synergy with the transcriptional activator SREBP-lc, and pre-adipocyte differentiation itself is regulated by USF via expression of the C/EBP-a gene (Kim et al 2007). The wide array of gene regulation and protein interactions attributed to USF illustrates its importance in human disorders such as hyperlipidemia, obesity, diabetes and heart disease (Moore et al 2002, Pajukanta et al 2004,). Although USF has been shown to activate and repress various genes, the exact mechanisms for these functions have yet to be fully defined. The dual nature of USF function may be attributed to protein modifications such as phosphorylation (Galibert et al 2001, Malcolm et al 2005), truncated spliced variants (Viollet et al 1996, Shoulders et al 2004, Pajunkanta et al 2004) and interactions with additional factors (Malcolm et al 2005). To date, evidence for recruitment of general transcriptional machinery such as RNA PolII by USF has yet to surface. However, evidence that USF may regulate 33 chromatin structure and gene accessibility has emerged from several groups. In 2004, West and Felsenfeld defined a role for USF in the regulation of chromatin condensation from the 5' HS4 barrier region in the chicken 6-globin promoter (West et al 2004). USF bound to the EBox motif in the footprint IV region of the barrier region recruits histone-modifying enzymes (histone acetyltransferases-HATs) under activating conditions, and prevents nucleosome-mediated chromatin condensation from encroaching into the enhancer region. Importantly, this group also pointed out that the recruitment of histone acetylating complexes by USF only opens the promoter for activation but is not sufficient to activate the gene. The positioning of USF on the HIV-1 LTR, the significance of its interaction with TFII-I (described below), and their roles in activation and repression constitute the major focus of this thesis. 1.4.12 Transcription Factor 11-1 (TFII-I) In the past few years TFII-I has become a heavily studied transcription factor and is emerging as a dynamic protein with multiple critical functions associated with transcriptional activation and repression relating to cell cycle progression, cellular differentiation, embryonic development and disease progression. Roy et al (1991) originally defined TFII-I as a positive regulator that interacts with USF on the pyrimidine rich initiator (Inr) sequence of the adenovirus major late promoter. Since then TFII-I has been shown to regulate an emerging array of human genes by binding to initiator sequences or upstream regulatory elements in their promoter regions. For example, TFII-I binds to the upstream regulatory region of the c-fos promoter (Kim et al 1998), the Inr elements of the TATA-less V6 (Cheriyath et al 2000) and KDR/flK (Wu et al 2000) promoters, and the vascular endothelial growth factor receptor-2 promoter (Jackson et al 34 2000). In addition to human genes, some viruses have adapted strategies to hijack the regulatory properties of TFII-I. Viral gene regulation by TFII-I has been documented from the LTR promoters of the Rous Sarcoma Virus (Mobley et al 2000) and HIV-1 (this thesis). The discovery of four TFII-I isoforms has revealed additional complexity (Perez-Juardo et al 1998). The shortest isoform of TFII-I, termed TFII-IA, is a spliced variant of 957 amino acids that lacks residues encoded from exons A and B of the full length gene, located at locus 7ql 1.23 on chromosome 7. The 977 amino acid a and 978 amino acid (3 isoforms of TFII-I each contain additional amino acids encoded from exon A and exon B, respectively. The longest 988 amino acid y isoform of TFII-I contains the amino acids encoded from both exons A and B (Figure 9). Each isoform can form complexes with one another through the N-terminal leucine zipper motif in various combinations (Cheriyath et al 2000). Although each isoform has similar sub-cellular distributions in COS cells, and identical DNA binding properties, varying heterocomplex arrangements leads to differential activation of similar reporter genes (Cheriyath et al 2000). For example, the TFII-IA and TFII-ip isoforms were shown to regulate the c-fos gene in an antagonistic fashion in murine fibroblasts in response to growth factor signaling (Hakre et al 2006). In unstimulated fibroblasts, the TFII-I(3 isoform is localized to the nucleus and bound at the c-fos promoter, thereby preventing its activation. Upon growth factor stimulation TFII-I (3 is released from the promoter and exported from the nucleus, only to be replaced by the TFII-IA isoform that is imported to the nucleus, binds to the promoter at the same region and causes activation of transcription (Hakre et al 2006). In my studies with recombinant TFII-I, the TFII-IA isoform was used throughout this thesis, and from this point will be 35 Figure 9. The four spliced variants of TFII-I. Al l spliced variants (A, a, (3, y) contain 6 I-repeat domains (R), 2 Nuclear Localization Sequences (NLS 1/2), and a Basic Region (BR) on the N-terminal side of the R3 domain. The TFII-I a isoform has additional amino acids from exon A (EA). TFII-I (3 has additional amino acids from exon B (EB). TFII-I y has additional amino acids from both exons A and B (EA and EB). The TFII-I variants A, a, 6, y are 957aa, 977aa, 978aa, and 998aa in length respectively. 36 37 referred to as simply TFII-I. In addition to the four isoforms, there are several additional TFII-I-related family members with a similar I-repeat structure. These include MusTRDl/BEN, GTF2IRD1/GTF3, and WBSCR11, all of which are encoded by the genes that map to the same chromosomal region as TFII-I. Deletions of these genes have been strongly correlated with Willems-Buren Syndrome (Perez Jurado et al 1998). GTF2IRD1/GTF3 has recently been shown to regulate the HOXc8, Goosecoid and Troponin-Isiow genes, based on the specific DNA binding properties of a domain that is similar as that in TFII-I (Vullhorst et al 2005, Thompson et al 2007). The structure of TFII-I includes six basic 90 amino acid helix-loop-helix I-repeat domains that have been implicated in protein-protein and protein-DNA interactions (Cheriyath et al 2001). Two nuclear localization sequences and a basic region (BR) preceding the R-2 I-repeat domain were also described (Figure 9). Besides inter-protein complex formation among its isoforms, TFII-I has the ability to bind proteins that cause cytoplasmic sequestering, transcriptional activation or repression, and chromatin remodeling through its I-repeat domains, suggesting its involvement in diverse levels of gene regulation. In B-cells, TFII-I is sequestered in the cytoplasm by its interaction with Bruton's Tyrosine Kinase (BTK) (Novina et al 1999). Upon B-cell immunoglobulin receptor crosslinking, a phosphorylation cascade causes its release from BTK and subsequent localization to the nucleus where it regulates the expression of immunoglobulin genes (Novina et al 1999). TFII-I has also been shown interact with a plethora of transcription factors including USF1 (Roy et al 1991), Phoxl and SRF (Grueneberg et al 1997), SMAD2 and SMAD3 (Wakefield et al 2002) and N F K B 38 p50/p65 (Ashworth et al 2006) to differentially regulate genes. The fact that TFII-I interacts with USF and has been shown to localize to nuclear dots in regions of high chromatin structure (Tussie-Luna et al 2002) is interesting. In these regions TFII-I was shown to directly interact with histone deacteylase-3 (HDAC-3) and mediate repression. Repression is relieved when cell signals cause activation of the SUMOlation pathway protein PIASxB, causing disruption of the TFII-I/HDAC3 interaction (Tussie-Luna et al 2002). Like USF, there is no evidence to date suggesting that TFII-I directly recruits the general transcriptional machinery, but may instead modulate chromatin structure and act as a scaffolding protein that recruits transcriptional activators. 1.5 Objective of this Thesis Great progress in understanding transcription and gene regulation has been made over the past few decades. Viruses such as HIV-1 offer an invaluable tool for studying eukaryotic transcriptional mechanisms, due to the fact that they exploit the host cell's machinery for their own propagation. Additionally, the discovery of mechanisms that govern their replication can lead to potential treatments for the disease they cause. The purpose of this thesis was to identify the protein components that comprise RBF-2 (USF1, USF2, and TFII-I), characterize their interactions with RBEI and RBEIII, and determine their transcriptional role in vivo when bound to the LTR. 39 CHAPTER II MATERIALS AND METHODS 2.1 Recombinant Plasmids The baculovirus-based expression plasmids used in this thesis are summarized in Appendix 2 and were produced from the pFasbacl plasmid (Gibco-BRL). The 6xHis TFII-I HA insert was amplified from plasmid p816 (pGEX2T TFII-I), with primers TM015 and TM017 and cloned into BamHI and Xbal restriction sites of pFasbacl. The pFasbacl vectors with the USF1 and USF2 inserts (pJC31 and pJC32 respectively) were constructed by Dr. Jiguo Chen. The TFII-I domains R2, R3, R4, R5, and R6 were PCR amplified from p3208 (pTM008-TFII-I) with primers oTM225/oTM241, oTM227/oTM242, oTM229/oTM243, oTM231/oTM244, and oTM233/oTM245 respectively. Each of the domain fragments were digested with BamHI and Xhol restriction enzymes and cloned into pET30a (Invitrogen) to form plasmids pTM052 (R2), pTM053 (R3), pTM054 (R4), pTM055 (R5), and pTM056 (R6). pLAI and pTYeGFP were obtained from the NIH AIDS Reagent Program. The wild type HIV LTR was PCR amplified from pLAI using the primers oTM237 and oTM238 containing EcoRI and Kpnl restriction sites respectively and cloned into pTYeGFP to form pTM3234. The same fragment was also cloned into pBluescript (Invitrogen) forming plasmid pTM3235 that was used for site directed mutagenesis. Site directed mutatgenesis was used to generate the RBEIII (ACTGCACT) and the TFII-I binding site point mutants (CAAC) within the LTR regions using primers oTM273/oTM274 and oTM277/oTM278 respectively with the Quikchange protocol from Stratagene. The resulting mutant LTR plasmids were named pTM3257 and pTM3258 and 40 the mutations were confirmed using Big Dye Terminator sequencing on an ABI 310 capillary instrument with primer oTM292. The resulting mutant LTR fragments were subcloned using EcoRI and Kpnl into pTYeGFP to generate plasmids pTM059 and pTM060. The pGEX2T vectors p817 (TFII-I R2R3), p818 (TFII-I R4R5), p819 (TFII-I R6) and p816 (full TFII-I) were a generous gift from Dr. Robert Roeder (Rockefeller University New York, NY). 2.2 Oligonucleotides Oligonucleotides were synthesized using Applied Biosystems 391 and 394 DNA and RNA synthesizers. For EMSA, oligonucleotides were annealed at a final concentration of 100u.M in New England Biolabs (NEB) buffer 2 (lOmM Tris-HCl, lOmM MgCl 2 , 50mM NaCl, ImM DTT, pH 7.9) at 100°C for 5 minutes then cooled slowly to room temperature over 10 hours. The sequences of all oligonucleotides used in this study are presented in Appendix 1. 2.3 Antibodies Antibodies against GST-TFII-I and GST-TFII-I domains R2-R3, R4-R5, and R6 were prepared by immunizing rabbits and mice. ct-USFl, o>USF2, a-c-fos, a-JunB, a-N F K | 3 , a-LEF, a - Y Y l , a-c-Myc, a-XBP, a-SRF, a-STAT, a-XBP, a-LexA, a-Ku70 and a-ERKl antibodies were acquired from Santa Cruz Biotechnology. a-Non-O, and a-PSF antibodies were a generous gift from Philip Tucker. a-CDK8 antibodies were made by Chris Nelson of our laboratory. 2.4 Cell Culture Jurkat T-cells, and Jurkat-Tat T-cells were obtained from the NIH AIDS Reagent Program. Human Kidney 293T, and Sfl\ insect cells were obtained from the American 41 Type Culture Collection (ATCC). The Jurkat T-cells were grown in 1640 RPMI + 10% Fetal Bovine Serum (FBS) supplemented with Penicillin (lOOU/ml) and Streptomycin (lOOmg/ml), and maintained at 37°C with a 5% C 0 2 environment in a humidified incubator. The Jurkat wild type and mutant LTR luciferase reporter T-cells, Jurkat-Tat wild type and mutant LTR p24 capsid reporter T-cells, and the Jurkat-Tat T-cells were maintained under the same conditions, except that 800 ug/ml G-418 was added to the media. The Human Kidney 293T cells were grown in Dulbecco's Modified Eagle Medium (DMEM) + 10% FBS (Gibco-BRL) supplemented with Penicillin (lOOU/ml) and Streptomycin (lOOmg/ml), and maintained at 37°C with a 5% C 0 2 environment in a humidified incubator. 5/21 insect cells were grown in TC-100 Insect Media + 10% FBS (Gibco-BRL) and maintained at 27°C. Stimulation of Jurkat T-cells by CD3 crosslinking was performed in 96 well plates (Nunc), which were pre-coated with 1.5u,g C305 anti-CD3 antibodies (Cell Signaling Upstate, NY) in lx PBS for 2 hours at 37°C and then washed three times with lx PBS. 2.4xl0 5 Jurkat T-cells bearing the wild type and mutant integrated LTR-luciferase reporter constructs were added per well and the plates incubated at 37°C for the specified times prior to measuring luciferase activity. T-cells were stimulated with 50ng/ml phorbol-12-myristate-13-acetate (Sigma), 25ng/ml Ionomycin (Sigma), ImM tumor necrosis factor-a (Calbiochem) and 50ng/ml trichostatin A (Sigma) for the indicated time. The MEK inhibitors PD98059 (Calbiochem) or U0126 (Calbiochem) were added to T-cells at the indicated concentrations 1 hour prior to stimulation, and cyclosporin A (Sigma) at 3uM 15 minutes prior to stimulation. 42 2.5 In vivo Labeling of Jurkat T-cells with [JZP] orthophosphate Jurkat T-cells were grown to a density of 7.0 x 107 per 75ml culture flask then washed twice in 40ml of phosphate depleted Dulbeco's Modified Eagle Media (DMEM) (Gibco). The cells were re-suspended and incubated in the same media for 2 hours at 37°C in 5.0 atm C0 2 . 0.1 mCi of [32P] orthophosphate (ICN) was added per ml and the cells incubated for a total of 3 hours. Phorbol 12-myristate 13-acetate (PMA) was added 1 hour prior to harvesting the cells. Cells were lysed in 450u.l RIPA buffer (1% NP-40, 1% sodium deoxycholate, 0.1% SDS, 0.15M NaCl, 50mM Tris pH 7.2) with phosphatase inhibitor (ImM sodium vanadate), and protease inhibitor cocktail (Sigma). The lysates were then pre-cleared with 20ul magnetic protein G beads (Dynabead) equilibrated in lx radioimmuno-precipitation (RIPA) buffer at 4°C for 30 minutes. 5u.g of the appropriate antibody was then added to each extract and incubated for 2 hours on ice. 20ud of magnetic protein G beads were then added and incubated for 2 hours at 4°C with nutation. The immuno-precipitations were then washed 4x with lx RIPA buffer, before resuspension in 2xSDS-PAGE loading buffer for gel analysis. The USF1 and TFII-I bands were identified and excised from dried denaturing polyacrylamide gels, and analyzed by tryptic phosphopeptide mapping (Boyle 1991). 2.6 In vitro Transcription-Translation In vitro transcription/translation expression of USF1, USF2, and all TFII-I domains were carried out using the TNT7 PCR fragment rabbit reticulocyte expression system from Promega. USF1 and USF2 PCR products were amplified with primers 0 T M I O 6 (containing a T7 RNA polymerase promoter) and oIS381 (containing a T7 and 43 Flag tagged terminator sequence) from plasmids pJC31 and pJC32. The TFII-I domains R2, R3, R4, R5, and R6 were amplified from pTM52 (R2), pTM53 (R3), pTM54 (R4), pTM55 (R5), and pTM56 (R6) to produce fragments encoding each domain plus 10 flanking amino acid residues (Vullhorst et al 2005) using primers oTM315 and oTM316. Reactions contained 500ng of purified PCR template, 20ul of rabbit reticulocyte lysate, 2ul 3 5S (lmCi stock), 2ul of lU/ul T7 RNA polymerase, 5ul of lmM -Met amino acid mix, in a final volume of 40ul DNA/RNA nuclease free ddFbO. The reactions were incubated at 30°C for 90 minutes and analyzed on 12.5% sodium dodecyl-sulphate (SDS) denaturing gels, run at 200V for 1 hour, dried and exposed for up to 3 days on Biomax film (Kodak). 2.7 Recombinant Baculovirus USF1, USF2, and TFII-I PCR fragments were cloned into the pFastbac donor plasmid, and transformed into DHlOBac E.coli as per the Invitrogen Bac-to-Bac Expressions System manual. The recombinant bacmid DNA was transfected into 75% confluent 5/21 insect cells in six well plates. Virus was titred by plaque assay, expanded, and used to infect 5/21 insect cells that were 80% confluent in 75cm2 culture flasks at a multiplicity of infection (MOI) of ~10. The cells were then incubated for three days at 27°C with the virus, at which point crude protein was collected as described below. 2.8 Nuclear Extracts and Recombinant Protein 5/21 insect cells infected for 3 days with USF1, USF2 and TFII-I baculovirus in 25ml flasks were collected and washed 3x in lxPBS. The cells were then lysed in 0.3 PCV of buffer C (20mM HEPES pH 7.9, 20% [v/v] glycerol, 420mM KCI, 1.5mM MgCl 2 , 0.2mM EDTA, 0.5mM DTT, 0.5mM PMSF) and 0.7 PCV buffer D (20mM 44 HEPES pH 7.9, 20% [v/v] glycerol, 0.2mM EDTA, 0.5mM DTT, 0.5mM PMSF) by passing through a 27 1/2 gauge needle 10 times with a syringe. The resulting lysate was cleared by centrifugation at 13,000 rpm for 15 minutes at 4°C. Jurkat T-cells were grown to -2.0 x 10 cells in 75cm culture flasks and nuclear extracts were prepared using the microscale protocol, initially describe by (Li et al). The cells were collected and washed 3x in lxPBS. The cell pellet was re-suspended in two packed cell volumes (PCV) of 4°C buffer A (lOmM HEPES pH 7.9, lOmM KCI, 1.5mM MgCL;, 0.5mM DTT), and passed gently 10 times through a 27 1/2 gauge needle on ice to extract the nuclei. The nuclei were collected by pulse centrifugation at 13,000 rpm for 8 seconds at 4°C. The supernatant was removed and the nuclear pellet was collected after the addition of 0.6 PCV of buffer C (20mM HEPES pH 7.9, 20% [v/v] glycerol, 420mM KCI, 1.5mM MgCl 2 , 0.2mM EDTA, 0.5mM DTT, 0.5mM PMSF) and incubated on ice for 15 minutes. Buffer D (20mM HEPES pH 7.9, 20% [v/v] glycerol, 0.2mM EDTA, 0.5mM DTT, 0.5mM PMSF) was then added to one equivalent volume, and the resulting lysate was clarified by centrifugation at 13,000 rpm for 15 minutes at 4°C. The supernatant was then aliquoted into 6A\x\ volumes, flash frozen in liquid nitrogen, and stored at -80°C for future use. 2.9 Electrophoretic Mobility Shifting Assays and Probe Labeling Oligonucleotide probes were labeled for 15 minutes at room temperature with 3 2 P dNTP's and 2U of the end-filling Klenow fragment of E.coli DNA Polymerase I in buffer 2 (NEB). The unincorporated label was removed using Sephadex G-50 spin columns from Pharmacia. ~5u.g of Jurkat nuclear extract was incubated on ice for 30 minutes with lu.g dldC, and 120ng BSA (NEB) in EMSA binding buffer (20mM HEPES pH 7.9, 45 lOOmM KC1, and 5mM MgCl 2). Each reaction was then incubated with lpmol of 3 2 P labeled oligonucleotide probe at room temperature for 30 minutes in a total volume of 20(0,1, before resolving on 4.5% non-denaturing polyacrylamide gels at 200V for 3 hours in 0.5x TBE (Tris-borate EDTA) and 1% glycerol. TFII-I and USF protein expressed in 5/21 insect cells was incubated as crude extracts with 120ng/ml BSA (NEB) in EMS A binding buffer for 20 minutes on ice. Each reaction was then incubated with lpmol of 3 2 P labeled oligonucleotide probe at room temperature for 20 minutes in a total volume of 20ul The TFII-I/DNA and USF/TFII-I/DNA complexes were resolved on 4.5% non-denaturing polyacrylamide gels at 200V for 5 hours in 0.5x TBE (Tris-borate EDTA) and 1% glycerol. The USF/DNA complexes were resolved at 200V for 4 hours. Al l EMSA were repeated at least in triplicate using independently expressed protein. 2 . 1 0 DNasel Footprinting The LTR region flanking the RBEIII site was amplified with primers oTM122 containing an Ascl restriction site and oTM123 with an Xbal restriction site (Appendix 1). The DNA was cut with Ascl , and the bottom strand was end-labeled with ct-32P (dATP, dTTP dGTP, dCTP) and the Klenow fragment of E.coli DNA polymerase 1 (NEB). Unincorporated label was removed using a Sephadex G-50 spin column (Pharmacia) and then digested with Xbal to minimize non-specific end-labeling. The labeled fragment was then subjected to Phenol:Chloroform extraction and 95% ethanol precipitation. The precipitated fragment was re-suspended in 2xTAE loading buffer (Tris-acetate EDTA pH 7.9) and purified on a 6% non-denaturing polyacrylamide gel. The labeled bands were excised, and cleaned using NACS pre-Pac polyacrylamide 46 removal columns, and then re-suspended in nuclease free ddH 20. -35,000 cpm was added to each protein/DNA binding reaction. USF and TFII-I protein was added at the appropriate concentration and the binding reactions were incubated on ice for 30 minutes prior to DNasel addition. 5ul of 0.5U/ml DNasel in DNasel dilution buffer (0.15M NaCl, lmM CaCl 2, and 50% glycerol in 10ml water) was added to each reaction and the samples incubated for 30 seconds at room temperature. 61ul DNasel stop solution (0.2M NaCl, 20mM EDTA, 0.1% SDS, 250ng/u.l tRNA, 10u,g/u.l proteinase K) was added to the reactions and the samples were then incubated at 42°C for 1 hour. Each reaction was extracted with Phenol:Chloroform and precipitated with 95% EtOH. Radioactivity in the pellets were measured in a Beckman LS 3801 scintillation counter and each sample was then re-suspended in Sequence Loading Buffer (0.2mg/ml bromophenol blue and xylene blue, 25mM EDTA in 90% deionized formamide) and heated at 100°C for 2 minutes then transferred on ice for 2 minutes. ~25,000 cpm were loaded per lane onto 8% polyacrylamide urea gels (25.2g Urea, 6ml lOx TBE, 12ml 38:2 acrylamide:bis acrylamide, 21ml of ddH20) and run at 2000V for 1 hour. The gels were dried and exposed to Biomax film (Kodak). Al l DNasel footprints were repeated at least in triplicate using independently expressed protein. 2.11 Immunoprecipitations USF1 and TFII-I expressed either individually or co-expressed in 5/21 insect cells were immunoprecipitated from crude extracts using protein-G sepharose beads (Pharmacia). 2ml slurry of protein G sepharose beads were washed three times in lx PBS and equilibrated in 934ul lxTE (Tris-EDTA pH 8.0) buffer and 66ul of lOmg/ml BSA. lOOul of the appropriate cell extract was added to 900ul of immunoprecipitation dilution 47 buffer (lOmM Tris pH 8.0, ImM EDTA, 0.5mM EGTA, 167mM NaCl). 80ul of the equilibrated protein G sepharose beads were added to each immunoprecipitate sample and incubated at 4°C for 1 hour to pre-clear non-specific interactions. The beads were then removed by pulse-centrifugation at 2,000 rpm using Micro Bio-spin Chromatography Columns (BioRad). 5u,g of USF 1 and TFII-I antibodies were added to the appropriate supernatant and incubated for 16 hours at 4°C with nutation. 20ul of the protein G-sepharose beads were then added to each sample and the mixtures incubated for 2 hours at 4°C with nutation. The beads were then collected by centrifugation for 1 minute at 3,000 rpm and washed for 30 minutes each in low salt wash buffer (200mM NaCl, 20mM Tris pH 8.0, 2mM EDTA, 1% Triton-X 100, and 0.1% sodium dodecyl-sulphate), and high salt wash buffer (500mM NaCl, 20mM Tris pH 8.0, 2mM EDTA, 1% Triton-X 100, and 0.1% sodium dodecyl-sulphate). The beads were then washed for 5 minutes at 4°C in LiCl buffer (0.25M LiCl, lOmM Tris pH 8.0, ImM EDTA, 1% NP-40, 1% deoxycholate), followed by two washes in TE pH 8.0 buffer. 50u.l of 2x SDS buffer was then added to the beads, the samples were vortexed briefly, and boiled for 10 minutes at 100°C prior to analysis by western blot. 2.12 Nickel Resin Pull-down Assays In vitro translated 6x Histidine tagged TFII-I domains and USF proteins expressed independently in vitro, were added together and incubated for 30 minutes on ice to allow complex formation. A 50% slurry of nickel beads (Qiagen) was prepared by washing three times in lx PBS buffer, and equilibrating in 10 packed bead volumes (PBV) of low-imidazole storage buffer (LISB) (50mM NaH 2P0 4 , 300mM NaCl, lOmM imidazole, adjusted to pH 8.0). 50ul of the equilibrated beads were added to 25u.l of the 48 rabbit reticulocyte mixtures with the appropriate proteins, and nutated for 1 hour at 4°C. The reticulocyte-bead slurry was then micro-centrifuged at 6,000 rpm and the supernatant discarded. The bead pellet was then washed 3x with imidazole wash buffer (50mM NaH 2P0 4, 300mM NaCl, 20mM imidazole, adjusted to pH 8.0). After the 20mM imidazole washes, the beads were then resuspended in 2ml of Low-salt washing solution (200mM NaCl and 1% Triton-X 100 in 100ml of lxPBS) and incubated for 30 minutes at 4°C with constant nutation. The supernatant was discarded after collecting the beads, which were resuspended in 2ml of a High-salt washing solution (500mM NaCl and 1% Triton-X 100 in 100ml of lxPBS) and incubated for 30 minutes at 4°C with constant nutation. Interacting proteins were then eluted from the beads with 30u,l 50mM imidazole elution buffer (50mM NaH 2P0 4, 300mM NaCl, 250mM imidazole, 0.05% Tween-20, adjusted to pH 8.0), and analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) followed by autoradiography. 2.13 Transient Transfections of 293T and Phoenix Kidney Cells Human 293T Kidney cells were grown in DMEM with 10% FBS, to 60% confluency in 6 well plates at 37°C with a 5% C 0 2 environment in a humidified incubator. The cells were washed 2x with fresh media prior to calcium phosphate transient transfection. 5u.g of gag/pol packaging plasmid pIOX576, 5u.g of Rev plasmid pIOX577, 0.5u.g of Tat expression plasmid p2213, 3u,g of VSV-g coat protein plasmid pIOX578, and 2u.g of appropriate p24 reporter plasmid pTy-eGFP was added to 450ul of ddH20 and 50ul of 2.5M CaCl 2 then mixed with bubbling agitation to 500ul of sterile 2x HeBS (0.28M NaCl, 50mM HEPES, 1.5mM Na 2P0 4 , pH to 7.05) for 25 seconds and incubated at room temperature for 20 minutes. The resulting DNA-calcium phosphate 49 buffer was then added to sub-confluent cells that were pre-treated with 1.0 pl/ml of 50mM chloroquine. The calcium phosphate transfection mix was incubated on the cells for 8 hours before being removed. The cells were then very gently washed three times with lx PBS solution prior to the addition of 1ml DMEM + 10% FBS. Viral supernatant was collected 48 hours post-transfection. 2.14 Viral Infections, F A C S , and Stable Cell Lines Viral supernatant collected from transiently transfected human kidney 293T cells was added to either Jurkat T-cells or Jurkat-Tat T-cells that were pre-treated for 5 minutes with 1.0 jxl/ml of 5mg/ml polybrene. The cells were then spinoculated at 3,000 rpm for 30 minutes in a Heraeus Labofuge 400 swinging bucket centrifuge. The infected cells were checked for Green Fluorescent Protein (GFP) expression after 24 hours. The wild-type and mutant reporter infected T-cell pools were allowed to grow for several days, before Fluorescent Activated Cell Sorting into 96 well plates for isolates of individual clones (Andy Johnson, FACS facility, Biomedical Research Centre-BRC). 2.15 Enzyme-Linked ImunnoSorbent Assays (ELISA) and Luciferase Assays HIV-1 p24 capsid protein sandwich Enzyme-Linked ImunnoSorbent Assays were performed in 96 well plates that were pre-treated with ct-p24 antibodies from the NIH AIDS Reagent Program. Jurkat T-cells with integrated LTR-p24 reporter constructs were grown in 75cm2 culture flasks to a cell density of -2.0 x 106 prior to induction with PMA (25ng/ml) and Ionomycin (lu,M) for 24 hours. The cells were collected and washed 3x with lxPBS buffer. The cells were then resuspended in 200ul of lxPBS with 20pl of Sigma protease inhibitor cocktail (PIC). The samples were then pulse sonicated on ice for 10 seconds on setting 4 of a Mandel Ultrasonic Processor. After sonication, 20ul of 50 10%Triton X-100 was added to the lysed cells and the extracts were incubated at 37°C for 1 hour. The cell extracts were then cleared by centrifugation for 5 minutes at 13,000 rpm. 50pl of cleared lysate was then added to each well, and the remainder of the protocol was followed without changes as per the NIH AIDS p24 Capture Kit Manual. Jurkat T-cell lines containing wild type and mutant RBEIII LTRs linked to luciferase reporter constructs were grown to a density of -2.0 x 106 cells per 30ml RPMI-1640 supplemented with 10%FBS. To measure expression of LTR-luciferase reporter constructs the cells were collected after the appropriate treatment and washed twice with cold lx PBS. The final pellet was resuspended in 100ul of lx luciferase lysis buffer (Promega) and incubated at room temperature for 15 minutes prior to centrifugation at 13,000 rpm for 5 minutes. 10u.l of each clarified lysate was added to 50ul of luciferase substrate (Promega) in a 96 well plate format. Luciferase activity was determined on a Turner Designs Luminometer. Luciferase results represent averages from assays performed on at least three independent cell cultures. 51 C H A P T E R III R E S U L T S 3.1 Identification of the RBF-2 protein subunits 3.1.1 Purified RBF-2 is comprised of USF1, USF2, and TFII-I RBF-2 was originally identified as a complex from Jurkat T-cell nuclear extracts that binds the RBEIII element in Electrophoretic Mobility Shifting Assays (EMSA) (Bell et al 1996). As mentioned above, RBEIII was identified for its requirement for Ras-responsive transcription of the HIV-1 LTR, and is one of the most highly conserved cis elements in LTRs of HIV-1 from AIDS patients. When I started this project, RBF-2 had been purified from Jurkat T-cell nuclear extracts by Heparin Agarose chromatography, Mono-Q ion exchange, poly dl-dC fractionation, and RBEIII mutant and RBEIII wild type affinity chromatography (diagram, Figure 10A). Estable et al (1999) showed by silver staining that the final RBEIII wild type affinity fraction contained five peptides. Each peptide in the final fraction was subject to mass spectrometric analysis; however, no relevant proteins were identified from these experiments, most likely due to inadequate sample mass. I started to identify the protein subunits from the purified fraction after following-up on a tip that recombinant USF1 had the ability to bind an RBEIII-containing oligonucleotide in competition assays with an EBox element (Estable and Roeder). Dr. Roeder further suggested that TFII-I may also bind RBEIII, since they had previously shown that USF1 and TFII-I had the ability to interact with one another at the Inr element of the Adenovirus Major Late promoter (Roy et al 1991). Based on this information, I confirmed the presence of USF 1, TFII-I, as well as USF2 in the final fraction from the 52 Figure 10. Purified RBF-2 contains USF1, USF2, and TFII-I. (A) Purification schematic for the RBF-2 complex (Estable JBS 1999) from Jurkat T-cell nuclear extracts. (B) Samples from the purification of RBF-2 were analyzed by immunoblot. Jurkat T-cell nuclear extracts (lane 1) contained all of the factors analyzed. The nuclear extracts were then fractionated on heparin agarose (lane 2), Mono-Q ion exchange (lane 3), poly dldC fractionation (not shown), RBEIII mutant oligonucleotide affinity (not shown), and wild type RBEIII oligonucleotide affinity columns containing low-salt flow-through (FT) lanes 4 and 5; 100 mM KC1 wash (WI), lane 6; 200 mM KC1 wash (W4), lane 7; 400 mM KC1 elution, lane 8). 53 A B T-ceII Nuclear Extract 0.1M 0.1M Pellet 2.0M Heparin AgarosefHA] l .OM Mono-Q Ion-exchange[MQ] Supernatant R B E III mutant column *BE III W T column RBF-2 TFII-I USF1 USF2 cfos JunB myc YY1 E R K Non-O PSF S T A T SRF Identification & Confirmation Schematic drawing from Estable et al 1999 Figure 10. Final Elution N E H A M Q F l F2 WI W4 E 1 2 3 4 5 6 7 Jurkat Nuclear Extract 125 K D a 43 KDa 44 KDa 41 K D a 36 KDa 49 K D a 45 KDa 44 KDa 55 K D a 100 K D a 87 K D a 52 KDa RBEIII wild type oligonucleotide affinity column using immunoblots (Figure 10B, lane 8). Importantly, TFII-I, USF1, and USF2 were the only proteins retained throughout the purification to the final fraction compared to c-fos, JunB, myc, YY1, ERK, Non-o, PSF, STAT, and SRF, none of which could be detected in the final fraction. The other two peptides in the final purified RBF-2 preparation that have yet to be identified have molecular masses of lOOKDa and 70KDa, and the significance of these for RBEIII/RBF-2 function is not understood at present. 3.1.2 USF1, USF2 and TFII-I antibodies supershift purified RBF-2 specific complex Once USF1, USF2, and TFII-I were identified as components of the purified complex, (Figure 10B), Dr. Jiguo Chen and I examined whether these purified factors retained DNA binding capability in EMSA and whether binding was sensitive to antibodies against these factors (Figure 11, data from Dr. Jiguo Chen). In Figure 11, a probe encompassing the RBEIII core sequence (ACTGCTGA) from the HIV-1 wild type LTR sequence (derived from pLAI), was labeled with 3 2 P and incubated with the purified complex prior to EMSA analysis. One pre-dominant band appeared in this analysis (Figure 11, lanes 1, 3, 7-15). This band was eliminated in the presence of unlabeled competing wild type RBEIII oligonucleotide, in 100-fold molar excess (Figure 11, lane 2). An oligonucleotide, P3M, containing mutations in the RBEIII core element (Bell et al 1996), used in the purification of the complex to eliminate non-specific binding proteins, did not compete for binding of the purified RBF-2 (Figure 11, lane 3). This observation is consistent with previous data defining the specificity of RBF-2 (Bell et al 1996, Estable et al 1999). Importantly, antibodies against USF1, USF2, and TFII-I prevented the complex from binding to the probe (Figure 11, lanes 4-6), consistent with the observation 55 Figure 11. Antibodies against USF1, USF2, and TFII-I inhibit DNA binding of purified RBF-2. (A) Sequences of RBEIII (P3-wt) probe and competing P3M (mutant) oligonucleotide used in the EMSA (see the Electrophoretic Mobility Shifting Assays and probe labeling section in the Materials and Methods on page 45). The location of the RBEIII element is boxed and the mutations in the P3M oligonucleotide are indicated in lowercase bold letters. (B) Purified RBF-2 was analyzed by EMSA with the P3 oligonucleotide probe. Unlabeled competitor P3 (lane 2) or P3M (lane 3) oligonucleotide was added at 100-fold molar excess. Antibodies against the indicated proteins (top) were added to the binding reactions after the addition of oligonucleotide probe (lanes 4 to 15). The migration of RBF-2 is indicated (left). EMSA conducted by Dr. Jiguo Chen. 56 A B RBF-2 RBEIII (P3) GATCCTTCAAGA ACTGCTGA CATCGAGCTTTCTC P3M GATCCTTCAAGA ACTGC a c t CATCGAGCTTTCTC H N M GQ. QO £ S P P C « 8 8 » 8 • I I I • I • I 8 8 8 8 8 8 8 8 RBEIII Probe (P3) U n b o u n d probe 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Figure 11. that the complex is comprised of at least all three proteins. In contrast, antibodies against a series of unrelated transcription factors and signaling proteins had no effect on the formation of RBF-2 (Figure 11, lanes 7-15). 3.1.3 USF1, USF2 and TFII-I antibodies supershift the RBF-2 complex from Jurkat nuclear extracts To determine if TFII-I, USF1, and USF2 comprise RBF-2 from Jurkat T-cell nuclear extracts, antibodies recognizing these proteins were added to EMSA reactions (Figure 12). As with the purified complex, RBF-2 from Jurkat nuclear extract is sensitive to competitor wild type RBEIII but not mutant RBEIII oligonucleotides (Figure 12, lanes 2 and 3, respectively). When a-USFl and a-USF2 antibodies are added to the binding reactions, the RBF-2 specific complex (indicated with arrow) becomes super-shifted as indicated by the formation of slower migrating complexes in the gel (asterisk), with a corresponding diminishment of the RBF-2 complex (Figure 12, lanes 4 and 5, respectively). The addition of a-TFII-I antibodies (Figure 12, lane 6) prevents the binding of RBF-2 to the RBEIII probe, but does not produce a supershift. Such an effect can occur when an antibody binds to a protein complex and prevents its interaction with DNA. Several other bands appear to be similarly affected by TFII-I antibodies, suggesting that TFII-I may be bound to the RBEIII containing oligonucleotide separately from RBF-2 (Figure 12, lane 6, and labeled on left side of gel). Interestingly, YY1 antibodies supershift a faster migrating complex that is also affected by TFII-I antibodies (Figure 12, lane 7), suggesting that YY1 may also bind near the RBEIII sequence. The interactions with the USF, TFII-I and YY1 antibodies are specific, because antibodies 58 Figure 12. Antibodies against USF1, USF2, and TFII-I inhibit DNA binding of RBF-2 in Jurkat nuclear extracts. (A) Sequences of RBEIII the (P3-wt) probe and P3M (mutant) oligonucleotides used in the EMSA (as described in legend of Figure 11). The location of the RBEIII element is boxed and the mutations in the P3M oligonucleotide are indicated in lowercase bold letters. (B) Jurkat nuclear extracts were analyzed by EMSA with the P3 oligonucleotide probe. In (A), unlabeled competitor P3 (lane 2), and P3M (lane 3) was added at a 100-fold molar excess. (B). Antibodies against the indicated proteins (top) were added to the binding reactions (lanes 4 to 14). In addition to RBF-2, antibodies against YY1 and TFII-I supershift or inhibit binding of two faster migrating protein species (indicated with arrows). A non-specific band sensitive to competition with both P3-wt and P3M (mutant) oligonucleotides is also indicated (ns). 59 A B o RBF-2 - • TFII-I - • ns — • YY1/TFII-I RBEIII (P3) GATCCTTCAAGA ACTGCTGA CATCGAGCTTTCTC P3M GATCCTTCAAGA ACTGC a c t CATCGAGCTTTCTC 1-H m P PQ © 55 33 p i >* M j s i • I I I i i i i i I I RBEIII Probe (P3) Jurkat Nuclear Extract Unbound probe 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Panel A Panel B Figure 12. that recognize LEF, c-fos, JunB, ERK, myc, Ku70 and SRF (Figure 12, lanes 8-14) had no effect on complexes formed with the RBEIII probe. 3.2 RBF-2 can be produced from recombinant USF1, USF2 and TFII-I 3.2.1 USF1 and USF2 co-expressed in rabbit reticulocyte lysates form a heterodimer that migrates with the same mobility as RBF-2 from Jurkat nuclear extracts In an attempt to reconstitute RBF-2 in vitro, templates containing a T7 promoter and Kozak consensus start site, and the full USF1 and USF2 open reading frames were subjected to coupled transcription-translation separately or simultaneously in rabbit reticulocyte lysates (see in vitro transcription-translation section on page 42). An immunoblot showing each of the in vitro translated USF1 and USF2 protein products is shown in Figure 13A. Recombinant USF1 and USF2 proteins produced in vitro, separately or cotranslated, were incubated with wild-type RBEIII probe and analyzed by EMSA with a wild type RBEIII probe (denoted as SSC in Figure 14). USF1 and USF2 each form complexes with the probe, with the USF2 complex migrating more slowly than USF1 (Figure 14, lanes 2 and 4). Furthermore, these complexes reacted with a-USFl and ci-USF2 antibodies respectively, to form supershifted complexes (denoted as SSC in Figure 14, lanes 3 and 5). When USF1 and USF2 were co-translated, a complex with intermediate mobility was formed (Figure 14, lane 6) that was reactive with both cc-USFl and a-USF2 antibodies (Figure 14, lanes 7 and 8), suggesting that co-translation leads to the formation of a heterodimer. These data are consistent with USF 1/2 heterodimer formation on EBox motifs reported by Sawadogo et al (1994). As expected, a-TFII-I antibodies added to the co-translated USF binding reaction had no effect (Figure 14, lane 8). Next, I compared the migration of in vitro translated USF heterodimer to that of RBF-61 Figure 13. Recombinant USF1, USF2, and TFII-I expressed in rabbit reticulocyte and 5/21 insect cells. Refer to the in vitro transcription-translation, recombinant baculovirus, and nuclear extracts and recombinant protein sections in the Materials and Methods on pages 43 and 44. (A) Immunodetection of USF 1 or USF2 proteins expressed in rabbit reticulocyte lysates from templates (T) containing T7 promoters in lane 1, but not in reticulocyte lysates that lack template (-T) in lane 2. (B) Immunodetection of USF 1-flag, USF2-HA, and 6xHis TFII-I HA tagged recombinant proteins from extracts of 5/21 insect cells infected (I) with the appropriate baculovirus (lane 1). Samples in lane 2 contained extracts from uninfected (UI) cells. 62 A B Immuno-blot reticulocyte a -USFl a-USF2 1 2 Figure 13. Immuno-blot 5/21 Extract I UI a- TFII-I a -USFl a-USF2 1 2 Figure 14. In vitro translated USF1 and USF2 bind RBEIII in vitro. Refer to the Electrophoretic Mobility Shifting Assays and probe labeling section in the Materials and Methods on page 45. RBF-2 can be produced as a USF1/USF2 heterodimer. USF1 and USF2 were produced by translation in vitro, either separately (lanes 2 and 3 and lanes 4 and 5, respectively) or by cotranslation (lanes 6 to 9), and were assayed for binding to a labeled P3 oligonucleotide. For comparison, Jurkat nuclear extracts were analyzed with the same probe (lanes 10 to 15). Binding reaction mixtures contained a 100-fold molar excess of unlabeled P3 (lane 11) or P3M (lane 12) oligonucleotide, or antibodies against USF1 (lanes 3, 7, and 13), USF2 (lanes 5, 8, and 14), or TFII-I (lanes 9 and 15). The migration of USF1 and USF2 homodimers, USF1/USF2 heterodimers, and RBF-2 is indicated by arrows in the left margin. Lanes 6 to 9 and 10 to 13 are identical gels but were exposed for 5 or 1 h, respectively. 64 Reticulocyte Jurkat N.E. O N USF1 USF2 S S C H S S C H USF2 -> USF1/2 ^ USF1 _ + fe P 8 + rs fe cc P fe fe a LTJ C/3 U, P P H 8 8 8 8 - - + + + + + + + + + + 4 II 1 2 3 4 5 6 7 8 9 RBEIII Probe (P3) 5 Hour exposure RBF-2 6 7 8 9 10 11 12 13 14 15 1 Hour exposure Figure 14. 2 from Jurkat T-cell nuclear extracts. Surprisingly, the USF 1/2 heterodimers migrate identically with RBF-2 (Figure 14, compare lanes 6 and 10 of the 1 hour exposure). Data in previous figures shows that a-TFII-I antibodies prevent the formation of the RBF-2/RBEIII complex from Jurkat T-cells and prevent binding of purified RBF-2, but do not affect binding of in vitro translated USF 1/2.1 demonstrate below that binding of USF 1/2 heterodimers to RBEIII is stimulated by TFII-I protein, and that this effect can be prevented with antibodies against TFII-I. 3.2.2 USF binds with an -160 fold higher affinity to a canonical EBox motif relative to the RBEIII sequence In order to study the binding properties of USF1 and USF2 in more detail, recombinant baculoviruses expressing each of these and TFII-I were constructed (see the recombinant baculovirus section in the Materials and Methods on page 43) (Figure 13B). Insect cells were co-infected with the USF1 and USF2 baculovirus, protein extracts were incubated with the RBEIII probe, and then analyzed using EMSA (Figure 15). As expected, protein complexes similar to those observed with the in vitro translated templates were produced. A combination of USF2 homodimers, USF1 and USF2 heterodimers, and USF1 homodimers formed a distinct triple band pattern (Figure 15, lanes 2-9). When a-USFl antibodies were added to the reaction, the middle band containing the heterodimer, and the lower band containing the USF1 homodimer supershifted (Figure 15, lane 9). Similarly, a-USF2 antibodies supershift the middle band containing the heterodimer and the top band containing the USF2 homodimer (Figure 15, lane 10). Importantly, binding of recombinant USF1 and USF2 was sensitive to the addition of unlabeled wild type RBEIII oligonucleotide, but not RBEIII mutant (P3M) 66 Figure 15. USF1/USF2 heterodimers produced in insect cells bind specifically to RBEIII in vitro. USF1 and USF2 coexpressed in insect cells (see the recombinant baculovirus section in the Materials and Methods on page 44) were assayed for binding to the RBEIII P3 oligonucleotide probe (see the Electrophoretic Mobility Shifting Assay and probe labeling section in the Materials and Methods on page 45). Binding reaction mixtures contained 0 to 100 pM total USF protein (lanes 1 to 8) or a 100 pM concentration of total USF protein (lanes 9 to 12) or a lysate from uninfected 5/21 cells (lane 13). Antibodies against USF1 (lane 9), USF2 (lane 10), and the competitor oligonucleotide P3 (lane 11) or P3M (lane 12) were added to the binding reactions. 67 89 C G 1 / 3 C as 3 oc as as >rj *55 as as h- s» N» o n era' c Figure 16. RBEIII is a low-affinity binding site for USF in vitro. (A) Sequences of RBEIII (P3) probe and EBox oligonucleotide used in the EMSA. (B) EMS As were performed with 50 pmol USF1 and USF2, produced by coinfection of 5/21 cells, and a labeled oligonucleotide P3 probe (lanes 1 to 9) or EBox probe (lanes 10 to 18) (see the recombinant baculovirus and Electrophoretic Mobility Shifting Assay and probe labeling section in the Materials and Methods on pages 44 and 45). An unlabeled EBox competitor oligonucleotide was added at a 12.5- or 25-fold (lanes 4 and 5) or 25-, 50-, or 100-fold molar excess (lanes 13 to 15). The RBEIII oligonucleotide P3 competitor was added in a 25-, 50-, or 100-fold molar excess (lanes 7 to 9 and 16 to 18). Antibodies against USF2 or USF1 were included in lanes 1 and 2, respectively. (C) Competition experiments by EMSA with coexpressed USF1 and USF2 and a labeled RBEIII oligonucleotide P3 probe. Binding reactions contained 50 pmol USF1/USF2 and an unlabeled RBEIII P3 competitor ( O , • , and A ) or EBox competitor (•, • , and A ) oligonucleotide at the indicated molar excess (x axis). The amounts of probe bound to USF1 ( • and • ) , USF2 ( • and A ) , and the USF1/USF2 heterodimer ( • and O ) were quantified from phosphorimaging scans and presented as the proportions of probe bound in the sample without competitor. Inset, expanded view of data for EBox competitor from 0 to 0.8-fold molar excess. 69 A RBEIII (P3) G A T C C T T C A A G A A C T G C T G A C A T C G A G C T T T C T C EBox C T A G A A A G A C A C G T G A C A T C G A G C T T T C T C C A A G C 1 0 0 o B Competitor rs EBox fe fe GQ Ifl P P RBEIII Competitor ^ EBox RBEIII USF2 USF1/2 USF1 USF RBEIII Probe (P3) E-Box probe i 5 0 in 2 0 EC 01 EC 1 0 Figure 16. USF1 USF2 USF1/2 RBEIII • A O T 1 1 1 1 1 0 5 1 0 1 5 2 0 2 5 Molar Excess Competitor oligonucleotide, demonstrating the sequence specificity previously observed for RBF-2 (Figure 15, lanes 11 and 12). USF1 and USF2 have been shown to bind with high affinity to a canonical EBox sequence (CACGTG) (Sawadogo et al 1985). To compare binding of USF 1 and USF2 to the RBEIII sequence relative to an EBox, competition assays with a consensus EBox oligonucleotide were conducted (Figure 16). The interaction of USF with the RBEIII oligonucleotide was considerably weaker than binding to a consensus EBox, as an unlabeled EBox competitor oligonucleotide was found to compete for binding of USF proteins to the RBEIII element more avidly than the WT RBEIII oligonucleotide (Figure 16B, compare lanes 4 and 5 to lanes 7 to 9). Conversely, an unlabeled RBEIII oligonucleotide was not as efficient at competing for binding to an EBox probe (Figure 16A, lanes 16 to 18). Competition titration experiments indicated that USF binds approximately 160-fold less efficiently to an RBEIII oligonucleotide than to a consensus E-box-containing oligonucleotide (Figure 16C). Thus, although recombinant USF proteins are capable of binding the RBEIII element in vitro, their affinity for this element is significantly less than that for a canonical EBox element. 3.2.3 USF1 homodimers and USF1/2 heterodimers exhibit enhanced binding to the RBEIII element in the presence of TFII-I To determine the role of TFII-I in RBF-2/USF function for binding to RBEIII, recombinant TFII-I was added to binding reactions containing USF and RBEIII probe. In these experiments I did not observe a larger complex consisting of all three proteins but instead, the addition of TFII-I was found to enhance the binding of USF to the RBEIII probe (Figure 17). This is similar to a previous observation that TFII-I has the ability to 71 promote the formation of a larger complex between SRF and Phoxl heterodimers on the Serum Response Element (SRE) without itself becoming part of a stable complex (Grueneberg et al 1997). TFII-I was found to cause an approximately 200-fold increase in binding of USF 1 to the RBEIII oligonucleotide (Figure 17, compare lanes 1 through 9). Note that both a-USF and a-Flag antibodies cause a supershift of recombinant USF 1-flag protein (Figure 17, lane 11). a-TFII-I antibodies caused a slight decrease in USF1 binding (Figure 17, lane 12). This is likely a direct effect due to the loss of TFII-I activity, rather than antibody cross reactivity (Roy et al 1991). Unlike that seen for USF1, addition of TFII-I had no effect on the binding of USF2 to the RBEIII oligonucleotide probe (Figure 17, Panel B, lanes 1-9). Additionally, when TFII-I was added to extracts from cells co-infected with USF1 and USF2 baculovirus, the binding of USF1 homodimers and USF 1/2 heterodimers to the RBEIII oligonucleotide probe was enhanced significantly, suggesting that enhancement must be mediated primarily through a USF1/TFII-I interaction (Figure 17, Panel C, lanes 1-7). A slight enhancement occurs to the USF2 band from the co-infected extract, in contrast to USF2 produced on its own. When the amount of bound RBEIII probe vs. molar ratio of TFII-I/USF is displayed graphically, one can estimate that there is an approximately 200-fold increase in USF1 homodimer and USF 1/2 heterodimer binding to the RBEIII sequence in the presence of TFII-I (Figure 17 D). 3.2.4 TFII-I specifically promotes binding of USF 1/2 to RBEIII on L T R templates in footprinting reactions To examine the interaction of USF 1/2 and the effect of TFII-I with the RBEIII region of the LTR in more detail, I used DNasel footprinting reactions with a pLAI HIV-72 Figure 17. TFII-I promotes binding of USF1 and USF1/USF2 to RBEIII in vitro. For all binding reaction conditions see the Electrophoretic Mobility Shifting Assays and probe labeling section in the Materials and Methods on page 45. (A) EMSA binding reactions with the labeled RBEIII oligonucleotide P3 were performed with 5 pmol USF 1-Flag and TFII-I at increasing concentrations (0 to 10 pmol, lanes 1 to 9) or with 10 pmol TFII-I (lanes 11 to 14). Binding reactions contained antibodies against USF1 (lane 10), the Flag epitope (lane 11), or TFII-I (lane 12) or an unlabeled P3 (lane 13) or P3M (lane 14) oligonucleotide. (B) EMSA binding reactions with the RBEIII oligonucleotide P3 probe were performed with 5 pmol USF2 and either 0 to 10 pmol (lanes 1 to 9) or 10 pmol (lanes 10 to 14) TFII-I. Binding reactions contained antibodies against USF2 (lane 10) or TFII-I (lane 11) or an unlabeled P3 (lane 12) or P3M (lane 13) oligonucleotide. (C) EMSA reactions with 10 pmol coexpressed USF1 and USF2 and the RBEIII oligonucleotide P3 probe contained 0 to 10 pmol TFII-I (lanes 1 to 6) or 5 pmol TFII-I (lanes 7 to 10). Binding reactions contained antibodies against USF1 (lane 8), USF2 (lane 9), or TFII-I (lane 10). (D) EMSA reactions were performed as described for (A) to (C). The relative amounts of RBEIII probe bound to USF 1/2 heterodimers (less the contribution of signal from the binding of TFII-I [O]), USF1 ( • and • ) , and USF2 ( A and A ) were quantified from phosphorimager scans. Reactions contained the indicated molar ratios of TFII-I/total USF protein (x axis) and 10 pmol coexpressed USF1/USF2 (O, • , and A ) or 5 pmol USF1 (•) or USF2 (A). 73 i n a a a + + PP 1 1 —i—i ! 1 1. i i : O a 3 2 i - o pvnog aqo*d III3SH ww&roi i n a a n + + I-IMI-» + + + + 6C — f i QC H ON oo r-so VS m I - I U X - » o — 00 4 4 4 DC £ &C O N 00 so s sx o 0. 74 1 LTR template and recombinant USF and TFII-I (Figure 18). This LTR also contains the canonical upstream EBox element (-160 from the transcriptional start site, Figure 7), in addition to the RBEIII element. USF1, USF2, and USF 1/2 heterodimers added on their own to binding reactions produce nearly identical footprinting patterns (Figure 18, lanes 3, 4, and 5 respectively). In these reactions I observed protection of the upstream EBox element, but not of RBEIII, consistent with previous results demonstrating the significantly higher affinity of USF for an EBox. Additionally, the binding of USF 1, USF2 and USF 1/2 heterodimers produces DNasel-hypersensitive sites flanking the EBox, indicating that these proteins must be causing an alteration in the DNA conformation, perhaps a bend. TFII-I protein added on its own to the binding reactions did not protect a specific region of the LTR (Figure 18, lane 9). However, addition of TFII-I to reactions containing USF 1/2 heterodimers causes the appearance of an additional protected region, representing the RBEIII core consensus element (ACTGCTGA) (Figure 18, lanes 6-8). Protection of the RBEIII element in these reactions also corresponds with the appearance of flanking DNasel hypersensitive sites, similar to that observed with binding of USF to the canonical EBox element. These results also confirm that USF interacts directly with the highly conserved core RBEIII sequence (ACTGCTGA), rather than flanking DNA, a conclusion that cannot be drawn from the EMSA experiments on their own. Based on these data, I can conclude that TFII-I specifically promotes binding of USF directly to the ACTGCTGA core RBEIII element, without itself forming a sufficiently strong interaction on the LTR to produce a footprint. These results are consistent with the previous experiments demonstrating that TFII-I enhances binding of 75 Figure 18. Dependence of binding of USF to RBEIII on TFII-I. Footprinting reactions (as described in the DNasel footprinting section in the Materials and Methods on page 46) contained HIV-1 LTR DNA template (lane 2) and -lOOpmol of USF 1 and USF2 homodimers and USF 1/2 heterodimers expressed in Sfll insect cells (lanes 3-8). TFII-I was added at ~25pmol (lane 6), -50 pmol (lane 7), or -lOOpmol (lane 8 and 9). An insect cell extract containing the yeast transcription factor Tecl expressed from baculovirus was used as a control in lane 10. The location of the EBox and RBEIII motifs were determined by comparing the Maxam-Gilbert G + A chemical cleavage pattern of the same template in lane 1 with naked template in lane 2. DNasel hypersensitive regions and USF footprints are indicated with vertical bars on the right side of the gel. 76 LL USF 1/2 to the RBEIII element, and support a view that RBF-2 occupies the highly conserved RBEIII element as a consequence of USF/TFII-I interaction. 3.3 Mutations in RBEIII that affect TFII-I binding 3.3.1 Recombinant TFII-I specifically binds RBEIII in E M S A In EMSA reactions using RBEIII oligonucleotide probes and Jurkat nuclear extracts, I typically observe a complex that migrates slightly faster than RBF-2, which is sensitive to antibodies against TFII-I, but does not have the same DNA binding specificity as RBF-2 (Figure 12). I surmise that this complex represents interaction of TFII-I with the RBEIII oligonucleotide probe. However, in initial EMSA experiments with recombinant TFII-I produced in insect cells, I was unable to reproduce this complex because of a co-migrating non-specific band. Nevertheless, when TFII-I/RBEIII complexes were resolved for an additional two hours in non-denaturing gels, I was able to separate the faster migrating, non-specific protein/RBEIII complex from a complex that is specifically sensitive to TFII-I antibodies (Figure 19, lane 2). a-TFII-I antibody added to these reactions causes a 10-fold decrease in this complex (indicated TFII-I) but not the non-specific band (Figure 19, lane 4, ns). Furthermore, this TFII-I/RBEIII complex is not produced in reactions containing USF1 and USF2 protein alone (Figure 19, lane 3), and the addition of a-USFl and o>USF2 antibodies in combination to TFII-I and RBEIII also had no effect (Figure 19, lane 5). To further show that this complex represents TFII-I/RBEIII, an uninfected 5/21 insect cell extract was compared to a reaction containing 4x the concentration of a TFII-I containing extract (Figure 19, Panel B, compare lanes 6 and 7). In the control extract without TFII-I, only the faster migrating non-specific protein/RBEIII complex is observed (Figure 19, lane 7). In contrast, a 78 Figure 19. TFII-I expressed in 5/21 insect cells binds to an RBEIII-containing oligonucleotide. (A). Extracts from insect cells expressing TFII-I (lanes 2, 4 and 5) or USF 1/2 heterodimers (lane 3) were incubated with labeled RBEIII oligonucleotide and analyzed by EMSA (as described in the Electrophoretic Mobility Shifting Assay and probe labeling section of the Materials and Methods on page 45). Products were resolved for 5 hours at 200 volts in non-denaturing gels. Antibodies against TFII-I (lane 4) or USF1 and USF2 (lane 5) were added to the binding reactions. The reaction in lane 1 contained no added protein extract. (B). EMSA reactions were performed using a labeled RBEIII oligonucleotide probe, an uninfected 5/21 cell extract (lane 7), or an extract from 5/21 cells expressing TFII-I (lane 6) added at 4x the concentration shown in lanes 2, 4 and 5 of (A). The migration of TFII-I, USF1, USF2 and an insect cell protein that produces a non-specific band (n.s.) are indicated with arrows. 79 08 2 era' e '^ 1 G CC ? s H ± ,H * i s a U W CC M 2 r ^ r S i NH 4xTFII-I 5/21 extract e cr TO a d d 13 significantly larger amount of the slower migrating species is observed in the reaction containing excess TFII-I (Figure 19, lane 6). These results show that TFII-I expressed in insect cells using baculovirus can bind to an RBEIII oligonucleotide probe in vitro. This allowed me to identify sequences that may specifically be required for this interaction. 3.3.2 TFII-I produced in Sf21 insect cells binds to previously defined TFII-I consensus-containing oligonucleotides Although TFII-I was initially described as a protein that formed complexes with the initiator of the AdML promoter, there has been some controversy as to what sequences this protein is capable of binding specifically. Furthermore, at least one group has suggested that TFII-I family member proteins might be capable of binding to multiple different specific sequences, an ability that may be conferred by the multiple I-repeats (Thompson et al 2007) (Figure 9). To examine whether binding of TFII-I to oligonucleotides bearing the RBEIII element involved the previously defined DNA binding function for this factor, I determined whether this interaction could be competed by oligonucleotides containing previously defined TFII-I binding sites. Accordingly, unlabeled oligonucleotides containing the AdML and TSSC promoter initiator elements (Manzano-Winkler eUal 1996) were able to compete for binding of RBEIII as efficiently as the unlabeled RBEIII oligonucleotide itself (Figure 20B, compare lanes 3 and 10 with lane 2). Furthermore, oligonucleotides containing two defined TFII-I binding sites within the serum response element (SRE) (Gilman et al 1997) and serum inducible factor binding element (SIE) (Hayes et al 1987) of the c-Fos promoter, were also capable of competing with the RBEIII oligonucleotide for binding of TFII-I (Figure 20B, lanes 8 and 9), although somewhat less efficiently. These results indicate that interaction of 81 Figure 20. TFII-I binds immediately 3' of the RBEIII core sequence. (A). TFII-I binding consensus sites from Clark and Chalkley, Nucleic Acids Research 1998 (Bold), and Roy and Roeder 1991 Nature (Bold) are shown. Sequence analysis of the RBEIII(P3) oligonucleotide probe (#1) revealed two potential TFII-I binding sites (grey and black bold). The sequence on the 5' side of the core RBEIII motif resembles the Y Y Y Y T/A CAAN T/G T/G G/C Y consensus defined by Chalkley. The sequence on the 3' side of the core RBEIII motif resembles the Y Y A N T/A Y Y consensus defined by Roeder. (B). Oligonucleotides used for competitions in EMSA. Oligonucleotides #6-#10 contain previously characterized TFII-I binding sites from the adenovirus major late initiator, the c-fos serum response element (SRE), the c-fos c-sis-platelet-derived growth factor-inducible factor (SIE) binding element, and the TSSC initiator respectively (as in (A)). The RBEIII and EBox core sequences are highlighted in red and blue respectively. Recombinant TFII-I from Sfl\ insect cells was incubated with RBEIII oligonucleotide probe (lanes 1-10, 12) and the oligonucleotides from (A) were added in 100-fold excess to the reaction as indicated above (lanes 2-10). USF protein was added to the reaction in lane 11 for migration reference, and a-TFII-I antibodies were added in lane 12 to confirm TFII-I specificity. The reactions conditions are described in the Electrophoretic Mobility Shifting Assay and probe labeling section of the Materials and Methods on page 45 82 Y Y Y Y T / A C A A N T / G T / G G / C Y Chalkley et al Nuc Acids Res., 1998 Y Y A N T / A Y Y Roy et al Nature, 1991 1. R B E I I I A A T T C T T C A A G A A C T G C T G A C A T C G A G C T T T C T C 2. R B E I I I Core A A T T A C T G C T G A C A 3 EBox Core A A T T A T C A C G T G G C A 4. R B E I I I 5' A A A T T A C T G C T G A C A T C G A G C T T T C T C 5. R B E I I I 3' A A A T T C T T C A A G A A C T G C T G A 6. A d M L A A T T T A C A G G A T G T C T C A C A C T C T C T A C A T C T G 7. c-fos S R E A A T T T A C A G G A T G T C C A T A T T A G G A C A T C T 8. c-fos S I E A A T T G C C G G C G A G C A G T T C C C G T C A A T C C C T C 9. T S S C inr A A T T T A A A C G C C A T T T T A C C A T T C A C C A C A T T G G T Figure 2OA. 2. RBEIII 3. RBEIII Core 4. EBox Core 5. RBEIII 5' A 6. RBEIII 3' A 7. AdML 8. c-fos SRE 9. c-fos SIE 10. TSSC Inr AATTCTTCAAGAACTGCTGACATCGAGCTTTCTC AATTACTGCTGACA AATTATCACGTGGCA AATTACTGCTGACATCGAGCTTTCTC AATTCTTCAAGAACTGCTGA AATTTACAGGATGTCTCACACTCTCTACATCTG AATTTACAGGATGTCCATATTAGGACATCT AATTGCCGGCGAGCAGTTCCCGTCAATCCCTC A ATTT A A A CG CC ATTTT A CC ATTC ACC A C ATTGGT Competitor a o a TFII-I-tm e § 1 o U 73 S-O U M o if) « y w - H — a E-a a w a .O a y H to HQ to H RBEIII (P3) Probe 1 m USF2 USF USF1 1 2 3 4 5 6 7 8 9 10 11 12 Figure 20B. TFII-I with the RBEIII oligonucleotide must involve its DNA binding activity for which there are proposed consensus recognition sequences (Chalkley, Roy, Figure 20A). In examining this region of the HIV-1 LTR more carefully I noted that a sequence similar to the TFII-I binding site defined by Chalkley et al is present on the 5' side of the ACTGCTGA motif. Likewise, a sequence resembling the TFII-I binding site defined by Roy et al is present on the 3' side of the motif. To determine whether either of these potential sites is responsible for interaction of TFII-I with RBEIII-containing oligonucleotides, competitor oligonucleotides with deletions of either potential flanking site (Figure 20A) were used in EMSA reactions (Figure 20B). I found that deletion of the 3' end of the RBEIII-containing oligonucleotide prevented competition for binding to the labeled RBEIII probe (Figure 20B, lane 7), but not the oligonucleotide containing a deletion of the 5' end (lane 6). Based on these observations, I conclude that residues 3' of the RBEIII core, encompassing a sequence related to previously defined elements are required for a stable interaction with TFII-I in EMSA. 3.3.3 Nucleotides between -128 to -125 immediately 3' of the core RBEIII sequence are necessary for binding of TFII-I The observation that TFII-I binds 3' of the RBEIII core, allowed me to define which bases were required for this interaction. I examined this by using oligonucleotides with four base pair substitutions and point mutations across this region for competition EMSA experiments (Figure 21). Oligonucleotide oTMG, containing a four base pair mutation (CATC^GTAG) immediately 3' of the ACTGCTGA motif (Figure 21A), prevented competition for TFII-I with wild type RBEIII (Figure 2IB, lane 4). Furthermore, a T-»A point mutation within the CATC sequence (oligonucleotide 85 Figure 21. Four nucleotide base pairs immediately 3' of the RBEIII core element are required for TFII-I binding. (A) List of oligonucleotides containing mutations 3' of the RBEIII core element that were used to determine the requirement for TFII-I binding on the RBEIII(P3) oligonucleotide probe. (B) -lOOpmol of TFII-I was added to each reaction. In lane 1, rTFII-I was mixed with labeled RBEIII(P3) oligonucleotide probe in the absence of competitor. The competitor oligonucleotides RBEIII(P3), RBEIID'A, and oTMG containing four base pair mutations from CATC -> GTAG were added in a 100-fold excess in lanes 2-4. In lanes 5-12 competitor oligonucleotides containing point mutations 3' relative to the RBEIII core element were added in 100-fold excess. Oligonucleotides with asterices above them signify ones harboring mutations that prevent TFII-I binding. The TFII-I specific band is labeled with an arrow on the left side of the gel. 86 A 5. RBEIII 3 'A A A T T C T T C A A G A A C T G C T G A P3 RBEIII G A T C C T T C A A G A A C T G C T G A C A T C G A G C T T T CTC oTM*G G T A G i i oTMK oTML T oTM*M A T oTMN G T oTMO G T oTMP A T oTMQ A t oTMR A Figure 21A. 5. RBEIII 3'A AATTCTTCAAGAACTGCTGA P3 RBEIII GATCCTTCAAGAACTGCTGACATCGAGCTTTCTC o T M * G GATCCTTCAAGAACTGCTGAGTAGGAGCTTTCTC o T M K GATCCTTCAAGAACTGCTGAGATCGAGCTTTCTC o T M L GATCCTTCAAGAACTGCTGACTTCGAGCTTTCTC o T M * M GATCCTTCAAGAACTGCTGACAACGAGCTTTCTC o T M N GATCCTTCAAGAACTGCTGACATGGAGCTTTCTC o T M O GATCCTTCAAGAACTGCTGACATCGAGGTTTCTC oTMP GATCCTTCAAGAACTGCTGACATCGAGCATTCTC o T M Q GATCCTTCAAGAACTGCTGACATCGAGCTATCTC o T M R GATCCTTCAAGAACTGCTGACATCGAGCTTACTC B ft < Probe P3 RBEIII 1-H HH H H HH _ ^ 8 B s * Competitor • © OQ CQ H § S 2 G K L M N O P Q R TFII-I — • | ^ ^ 1 2 3 4 5 6 7 8 9 10 11 12 Figure 2IB. oTMM) also prevented competition for binding of TFII-I, although to a much smaller extent than the four base pair mutation (Figure 2 IB, lane 7). In contrast, none of the other single nucleotide substitutions of the RBEIII oligonucleotide prevented competition for TFII-I binding (Figure 21B, lanes 8-12). 3.3.4 The TFII-I binding site flanking RBEIII is highly conserved in HIV-1 isolates from patients with AIDS RBEIII and the site required for TFII-I binding (CTTCAAGA /4CrGCrGrJCATCGAGCTTTCTO was aligned with 200 HIV-1 genomic sequences isolated from patients with AIDS from the HIV sequence database1. These results are presented in detail in Appendix 3, and summarized in Table 4. The RBEIII element was conserved in 93% of the isolates (Malcolm et al 2005), and the nucleotides required for a perfect match for TFII-I binding were conserved in 99.5% of the isolates. Only one isolate in the database had the C A T C - * C A A C mutation in this sequence; however, the database does not include information on this patient's progress to AIDS. Therefore, I am unable to draw a conclusion regarding this observation. The RBEIII and immediate flanking CATC sites are comparable in conservation to other highly conserved elements in the LTR region, including the N F K B / N F A T elements at -90 and -104, the Spl sites and TATA Box. The upstream EBox that is included in the footprinting studies of Figure 18 (pLAI) is poorly conserved in viral isolates (30%), which is consistent with previous analysis. 1 http://www.hiv.lanl.gov/content/hiv-db/mainpage.html 89 Table 2. Highly conserved binding sites in the HIV-1 LTR Factor Consensus Location (a) Frequency % (b) TBP TATAA -28 81 Spl GGGCGG -55, -65, -79 74 N F K B GGGACTTTCC -90,-104 99 RBF-2 ACTGCTGA -129 93 TFII-I C T G A C A T C -125 99.5 RBF-2+TFII-I ACTGCTGACATC -125 92.5 USF CACGTG -166 30 (a) Location of element in relation to the transcriptional start site. (b) Frequency is the percentage of HIV-1 sequences that contained the perfect consensus element at the location indicated in the adjacent column. 3.3.5 Mutations in the RBEIII core and flanking C A T C sequence are required for TFII-I and USF binding in Jurkat T-cell nuclear extracts To ensure that recombinant proteins accurately represent the activity of endogenous USF and TFII-I protein, the series of mutant oligonucleotides shown in Figure 22A was used in competition assays with Jurkat T-cell nuclear extracts (Figure 22B). Jurkat nuclear extracts incubated with the RBEIII oligonucleotide probe form a distinct five-band pattern in EMSA. The slowest migrating band represents RBF-2 (USF 1/2 heterodimer), with TFII-I and YY1 forming faster migrating complexes, as determined using antibody supershifts as shown earlier. Mutations in the RBEIII core sequence in oligonucleotide P3M prevent competition for the USF heterodimer (top band), but not the TFII-I or YY1 complexes (Figure 22B, lane 3). These data are consistent with results using recombinant USF and TFII-I, and illustrate that residues outside the RBEIII core are required for TFII-I binding. Deletion of the 3' end of the wild type RBEIII oligonucleotide probe not only prevents competition for endogenous TFII-I 90 but also the USF1/2 heterodimer (Figure 22B, lane 4). This observation is consistent with the finding that USF from nuclear extracts is sensitive to the addition of a-TFII-I antibody, which prevents the binding of TFII-I to RBEIII (Figure 12). Conversely, mutations in the 5' half of the wild type RBEIII oligonucleotide do not affect competition for TFII-I or USF1/2 binding (Figure 22B, Panel 1, lanes 5-9), consistent with the fact that bases immediately 3' of the ACTGCTGA core RBEIII element are required for binding of TFII-I. Oligonucleotides oTMG and oTMM, bearing mutations that prevent recombinant TFII-I binding, also prevent competition for endogenous TFII-I and USF binding in Jurkat nuclear extracts (Figure 22B, lanes 11 and 16). As with the four base pair oligonucleotide, loss of TFII-I binding most likely causes the loss of enhancement of USF binding to RBEIII, a non-canonical EBox. These results demonstrate that endogenous USF and TFII-I in Jurkat T-cells have the same DNA binding specificities for sequences on the RBEIII oligonucleotide as do the recombinant proteins. The fastest migrating complex from Jurkat nuclear extract bound to the wild type RBEIII oligonucleotide is likely YY1, because antibodies against YY1 cause its supershift (Figure 12, lane 7). I have not examined the DNA binding specificity of this protein in detail, but interestingly, the oligonucleotide oTML, bearing a single nucleotide substitution immediately flanking RBEIII prevents competition for binding to YY1, partially prevents competition for TFII-I, but readily competes for USF binding (Figure 22B, lane 15). In contrast, oligonucleotides oTMF, oTMG, oTMK and oTMM do not compete for any of these proteins (Figure 22B lanes 10, 11, 14, and 16). This may indicate that YY1 binds a sequence flanking the RBEIII element, and that this nucleotide is critical for this interaction. Furthermore, mutations that prevent interaction of TFII-I 91 Figure 22. The binding specificity of endogenous TFII-I from Jurkat nuclear extracts. (A). Oligonucleotide competitors with indicating mutations relative to the wild type RJ3EIII(P3) oligonucleotide probe as indicated. (B). EMSA reactions contain equivalent amounts of Jurkat nuclear extract and labeled RBEIII(P3) probe. Lane 1 contains no competing oligonucleotide, and lanes 2-21 contain a 100-fold molar excess of the competitor oligonucleotide (indicated above) as shown in (A). 92 A 5. RBEIII 3'A A A T T C T T C A A G A A C T G C T G A P3M G A T C C T T C A A G A A C T G C a c t A T C G A G C T T T C T C RBEIII(P3) G A T C C T T C A A G A A C T G C T G A C A T C G A G C T T T C T C oTMA G oTMB oTMC oTMD oTME oTMF TTT - A A G T T T T T C T T T T — A C C A T T T A C G T T T T — A C T G T T T T oTMG G T A G oTMH. oTMI -T T T T C T C G T T T T 4 G A G Figure 22A. (P3) GATCCTTCAAGAACTGCTGACATCGAGCTTTCTC RBEIII 3'A AATTCTTCAAGAACTGCTGA (P3M) GATCCTTCAAGAACTGCACTCATCGAGCTTTCTC o T M A GATCGTTCAAGAACTGCTGACATCGAGCTTTCTC oTMB GATCCAAGAAGAACTGCTGACATCGAGCTTTCTC o T M C GATCCTTCTTCAACTGCTGACATCGAGCTTTCTC oTMD GATCCTTCAAACCATGCTGACATCGAGCTTTCTC o T M E GATCCTTCAAGAACACGTGACATCGAGCTTTCTC o T M F GATCCTTCAAGAACTGCACTGATCGAGCTTTCTC o T M G GATCCTTCAAGAACTGCTGAGTAGGAGCTTTCTC o T M H GATCCTTCAAGAACTGCTGACATCCTCGTTTCTC oTMI GATCCTTCAAGAACTGCTGACATCGAGCTTAGAG o T M K GATCCTTCAAGAACTGCTGAGATCGAGCTTTCTC o T M L GATCCTTCAAGAACTGCTGACTTCGAGCTTTCTC o T M M GATCCTTCAAGAACTGCTGACAACGAGCTTTCTC o T M N GATCCTTCAAGAACTGCTGACATGGAGCTTTCTC o T M O GATCCTTCAAGAACTGCTGACATCGAGGTTTCTC oTMP GATCCTTCAAGAACTGCTGACATCGAGCATTCTC o T M Q GATCCTTCAAGAACTGCTGACATCGAGCTATCTC oTMR GATCCTTCAAGAACTGCTGACATCGAGCTTACTC B PH < Competitor a W § w B m ft « 3' point mutants G H I K L M N O P Q R RBF2 (USF) T F H YY1 Free Probe " • • n ^ - ns ^ P ^ ^ ^^^V ^ ^ ^ i i H Jurkat N E Probe RBEIII(P3) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1617 18 19 20 21 Figure 22B. with the wild type RBEIII oligonucleotide also invariably prevent the appearance of the YY1 complex (Figure 22B, lanes 4, 10, 11, 14 and 16). These results may indicate that TFII-I may also stimulate binding of YY1 from nuclear extracts to this oligonucleotide, as it does for USF 1/2. This would be consistent with previous observations, which indicate that TFII-I can promote binding and complex formation for a variety of transcription factors. 3.3.6 USF marginally improves the binding of TFII-I to an RBEIII containing oligonucleotide Since TFII-I promotes USF binding to RBEIII, I wanted to test if the converse was also true. Increasing amounts of recombinant USF were added to reactions containing recombinant TFII-I and the RBEIII oligonucleotide probe (Figure 23, Panel A, lanes 1-8). In this experiment I found that the amount of bound recombinant TFII-I could be enhanced with increased amounts of USF (Figure 23, lanes 6-8). This enhancement may only be noticeable in higher amounts of USF, due to the possibility of TFII-I having a higher dissociation constant on the RBEIII oligonucleotide than USF. I can conclude that this observation is specific, since recombinant Tecl, also expressed in 5/21 insect cells, does not produce a similar result (Figure 23, Panel B, lanes 1-8). This result shows that USF and TFII-I may interact cooperatively near the RBEIII element. 3.3.7 A point mutation in C A T C that prevents binding of TFII-I, also prevents enhancement of USF binding to RBEIII The point mutation that prevents interaction of recombinant TFII-I and TFII-I from Jurkat T-cell nuclear extracts with the RBEIII oligonucleotide (shown above) also prevents binding of USF (Figure 22). This likely indicates that the stimulatory effect of 95 Figure 23. USF enhances binding of TFII-I to RBEIII(P3). (A). ~25pmol recombinant TFII-I was added to EMSA binding reactions with lpmol RBEIII (lanes 1-8). 3pmol-200pmol USF1 was added to the binding reaction in lanes 2-8. (B). EMSA reactions containing ~25pmol recombinant TFII-I (lanes 1-8), are incubated with Sfl\ insect cell extracts containing 3-200 pmol recombinant Tecl (lanes 2-8). The arrows on the left of each gel in (A) and (B) indicate the TFII-I and USF specific bands. 96 rTFII-I constant ~25pmoI • • Figure 23. TFII-I on USF binding must require specific interaction of TFII-I near the RBEIII element. To examine this possibility in more detail, I determined whether this mutation would also prevent recombinant TFII-I from stimulating binding of recombinant USF protein in vitro (Figure 24). Oligonucleotide oTMM containing a point mutation in the flanking TFII-I binding site (CATC-»CTTC) was used as a probe, and compared to binding reactions with wild type RBEIII probe (Figure 24, lanes 1-16). USF on its own was able to bind the mutated oligonucleotide (Figure 24, lanes 4-8), although not as strongly as to RBEIII (Figure 24, lanes 1-4). In the presence of TFII-I, enhancement of USF binding on oligonucleotide oTMM was not observed (Figure 24, lanes 13-16), compared to the enhancement observed on the wild type RBEIII probe (Figure 24, lanes 9-12). Oligonucleotide oTMM does not appear to form hairpin loops or improper self-annealing when analyzed by Mac-DNAsis computer software, suggesting that TFII-I binding to this site is essential for stimulation of USF binding to the RBEIII core element. 3.4 Mutations in RBEIII that effect USF and TFII-I binding prevent activation of HIV-1 expression in vivo 3.4.1 A reporter virus vector for examining HIV-1 L T R mutations To examine the effect of mutations that prevent binding of TFII-I and USF to the RBEIII site on expression from the LTR in vivo, I used a replication-defective reporter virus vector (Figure 25). The vector is derived from the self-inactivated lentiviral vector pTYeGFP, and contains the HIV-1 5' end encoding p24 gag and part of Pol, including the rev-responsive element, but the env-nef region is deleted and replaced with an internal EF1 promoter expressing eGFP. The enhancerless, self-inactivating 3' LTR in this construct was replaced with the wild type pLAI LTR, or LTRs bearing mutations of the 98 Figure 24. Mutations that prevent interaction of rTFII-I also prevent enhancement of rUSF binding to RBEIII. EMSA reactions were performed with 6.25 (lanes 9-16), 12.5 (lanes 2 and 6), 25 (lanes 3 and 7) 50 (lanes 4 and 8) pmol recombinant USF protein and labeled P3 oligonucleotide (lanes 1-4, and 9-12) or mutant oTMM (lanes 5-8, and 13-16) oligonucleotide probe (the reactions conditions are described in the Electrophoretic Mobility Shifting Assay and probe labeling section of the Materials and Methods on page 45). Lanes 1 and 5 contain no added protein. To examine enhancement of USF binding, 25 (lanes 9 and 14), 50 (lanes 10 and 15) and 100 (lanes 11 and 16) pmol recombinant TFII-I was added to the binding reactions. The rUSF specific bands are labeled with arrows on the left side of each gel, and the rTFII-I specific bands are labeled on the right side of the gel in Panel 2. The labeled probe is indicated under each group of lanes. 99 RBEIII(P3) G A T C C T T C A A G A A C T G C T G A C A T C G A G C T T T C T C o T M L G A T C C T T C A A G A A C T G C T G A C T T C G A G C T T T C T C USF ~6.25pmoI o o USF2 USF USF1 d t f l ^ ^ <- TFII-I * <- ns 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Probe Probe Probe Probe RBEIII o T M M RBEIII oTM M Figure 24. RBEIII or TFII-I recognition sequences (Figure 25A, line ii). The advantage of this system is that it mimics viral integration into chromosomes, and stable cell lines can be easily selected by sorting for expression from the internal Green Fluorescent Protein (GFP) reporter. Virus is produced by co-transfecting 293T kidney cells with the reporter virus plasmid, and separate plasmids encoding VSV-g receptor, gag/pol, rev, and Tat. This allows packaging of the reporter virus, and infection into Jurkat T-cells. As with full length HIV-1 (Figure 2) the 3' U3 region of the viral RNA produces the 5' LTR in the integrated pro virus, and therefore mutations must be made in the 3' LTR of the plasmid. Virus produced from vectors containing the wild type LTR, the enhancerless self-inactivating vector, or LTRs with mutations in RBEIII or the TFII-I binding site were produced and used to infect Jurkat T-cells. T-cells with integrated virus were identified by expression of GFP, and photographed with a fluorescent microscope (Figure 25B). Individual clones were isolated by FACS, and expanded for further examination. 101 Figure 25. Diagram of the pTy-eGFP reporter virus plasmid. (A). The vector produces the substituted HIV-1 mRNA genome from the CMV promoter. The 3' end of Pol through the Nef coding sequence of HIV-1 has been replaced with an ElF-ct promoter expressing eGFP. i.) The original pTy eGFP plasmid bears a deletion of the enhancer region in the 3' LTR that causes self-inactivation upon integration, ii.) The enhancerless LTR was replaced with wild type or mutated LTRs. (B). A photo showing Jurkat T-cells expressing the GFP after selection by FACS. 102 A p24 Capsid eGFP C M V 3'AU3R w WT/Mutants p24 Capsid eGFP C M V Packaging Virus collection T-cell infection \ f R T Pathway and Integration WT/Mutants C ' T ' I ' l l w p24 Capsid eGFP 5 L 1 K E l F a 3' L T R ^ Selection of individual clones by F A C S Figure 25. 3.4.2 Mutations in RBEIII and TFII-I binding sites prevent induction of integrated viral expression Clones isolated from infection with the wild type HIV-1 LTR reporter virus typically induced p24 expression 4-8 fold in response to 24 hours treatment with PMA/Ionomycin (Figure 26, Panel A). In contrast, GFP positive clones produced from the reporter virus bearing the U3 enhancer deletion, representing the self-inactivating vector, did not produce any p24 in response to PMA/Ionomycin. Furthermore, these clones typically produce a lower basal signal of p24 gag antigen in untreated cells than do cells infected with the wild type LTR virus (Figure 26, Panel B). Interestingly, Jurkat clones infected with the RBEIII mutant LTR and the TFII-I L mutant LTR were also unresponsive to treatment. Indeed, cells treated with PMA/Ionomycin generally produced less p24 than untreated cells (Figure 26, Panels C and D). Additionally, it is evident that for both of these mutant LTRs, the basal level of p24 gag antigen expression was approximately 2-fold higher than observed for cells infected with the wild type LTR virus. These observations are consistent with the view that TFII-I and USF bound at the RBEIII and flanking sequence are necessary for induction of latent viral expression in response to T-cell signals. Furthermore, the finding that mutant LTRs in clones 1-3 (Figure 26C) produce a higher basal signal than wild type in unstimulated cells is consistent with previous observations using LTR reporter genes integrated by transfection (Chen et al 2005). It is possible that factors bound to RBEIII may be involved in repression of transcription from the LTR in unstimulated cells. 104 F i g u r e 2 6 . Binding of TFII-I and USF1/2 at RBEIII is necessary for induction of latent viral expression. Jurkat T-cell lines were infected with wild type HIV-1 LTR and mutant reporter viruses (see text and Figure 25A) (see the viral infections, FACS, and stable cell lines section in the Materials and Methods on page 50). FACS was used to select individual GFP-expressing clones. Cells with activation levels comparable to the U3 deleted controls were omitted. Cells were left unstimulated (open bars) or stimulated with PMA/Ionomycin for 24 hours, prior to assaying p24 gag expression by ELISA (described in the ELISA and luciferase assays section in the Materials and Methods on page 50). Cells were infected with the wild type HIV-1 LTR virus (Panel A), the U3R deletion HIV-1 LTR virus (Panel B), or virus containing the ACTGCACTCATC mutations of RBEIII (Panel C) or the point mutation required for TFII-I binding (ACTGCTGACAAC) (Panel D). The p24 capsid ELISA results represent averages from assays performed on at least three independent cell cultures and the bars represent the percent-fold induction of p24 capsid reporter (measured at an O.D. of 650) with sample standard deviation represented by +/- error bars. 105 Panel A WT LTR Jurkat-Tat Stable Cell Lines Panel B U3RA Mutant LTR Jurkat-Tat Stable Cell Lines o Q o • Untreated • PMA/lono Panel C RBEIII LTR Jurkat-Tat Stable Cell Lines o ir; Q O i 0 . 9 0 . 8 0 . 7 0 . 6 0 . 5 0 . 4 0 . 3 0 . 2 0 . 1 0 • Untreated • PMA/lono l r i n m mri rm n n , 1 2 3 4 5 6 7 8 Clone Panel D TFII-I L Mutant LTR Jurkat-Tat Stable Cell Lines i - i ) . 9 -o } . 8 -IT) ) . 7 -\D Q « ) . 6 -O ( ) . 5 -1.4 -a , i ) . 3 -) . 2 -( ).l -0 -• Untreated • PMA/lono i r L . l V f V r i . r l . Clone I -j 0 . 9 -0 . 8 -0 . 7 -o >r, 0 . 6 -Q 0 . 5 -O 0 . 4 -Tf 0 . 3 -a 0 . 2 -Figure 26. o.i o • Untreated • PMA/lono l l V l V n . iVlVri . rh , 4 5 Clone 3.5 USF and TFII-I interact at the RBEI site near the core promoter Bell et al (1996) identified a sequence at -20 in the U3 region of the 5'LTR that was required for response to Ras signaling, termed the Ras-responsive Binding Element I (RBEI). Furthermore, RBEI was shown to compete with RBEIII for binding of RBF-2 from Jurkat T-cell nuclear extracts (Bell et al 1996). This is illustrated with Jurkat nuclear extracts using the wild type RBEIII oligonucleotide probe (Figure 27, lane 3). Additionally, the binding of both USF and TFII-I, but not YY1, was observed on the RBEI oligonucleotide probe incubated with Jurkat nuclear extracts (Figure 27, lanes 4-6). The USF and TFII-I complexes formed with RBEI probe can be competed by both unlabeled RBEIII and RBEI oligonucleotides (Figure 27, lanes 5 and 6), confirming the previous results, which suggested that these represent the same factor. The RBEIII oligonucleotide does not compete for binding of the TBC, which is consistent with previous experiments indicating that this slower migrating complex recognizes the HIV-1 TATA element immediately flanking RBEI (Figure 27). Interestingly, the band previously characterized as a non-specific complex bound to the RBEIII oligonucleotide probe was able to specifically bind RBEI. The implications of this result are not yet understood. 3.5.1 Recombinant USF binds RBEI To determine if RBEI is capable of binding recombinant USF from insect cells, EMSA was conducted in parallel with reactions using RBEIII probe (Figure 28). As previously described, recombinant USF forms three distinct bands that represent USF2 homodimers, USF 1/2 heterodimers, and USF1 homodimers, as determined by supershifting with antibodies (Figure 28, lanes 1-6). Unlabeled RBEI competes as 107 Figure 27. RBEI and RBEIII both bind RBF-2(USF/TFII-I). EMSA was performed with Jurkat nuclear extracts and labeled wild type RBEIII probe (lanes 1-3) or wild type RBEI probe (lanes 4-6) (see the Electrophoretic Mobility Shifting Assay and probe labeling section in the Materials and Methods on pages 45). Lanes 1 and 4 have no competing oligonucleotide. Lanes 2 and 5 contain 100-fold molar excess of unlabeled wild type RBEIII(P3) competitor and lanes 3 and 6 each contain 100-fold molar excess of unlabeled wild type RBEI competitor. RBF-2 (USF) and TFII-I containing complexes are indicated on the left side of the gel, and the TATA Box Binding Complex (TBC) is indicated with arrows on the right side of the gel. 108 RBEIII(P3) probe G A T C C T T C A A G A A C T G C T G A C A T C G A G C T T T C T C RBEI probe A A T T A T G C T G C A T A T A A G C A G C T G C T T T T T G C C T G T A C T T A T A Box RBEI Jurkat Nuclear Extract Probe RBEIII Probe RBEI Competitor RBF-2(USF) TFII-I YY1 T B C ns 1 2 3 4 5 6 Figure 27. Figure 28. Recombinant USF produced in 5721 insect cells binds the RBEI element. EMSA reactions (see the Electrophoretic Mobility Shifting Assay and probe labeling section in the Materials and Methods on pages 45) were performed with 5/21 extracts expressing USF1 and USF2, and labeled RBEIII probe (Lanes 1-6), or labeled RBEI probe (lanes 7-12). Lanes 2-4 and lanes 8-10 each contain 100-fold molar excess of unlabeled RBEIII(P3), P3M and RBEI oligonucleotide respectively. 200 u.g of a-flag antibody was added in lanes 5 and 11, and 200jxg of ot-USF2 antibody was added to reactions in lanes 6 and 12. Lanes 1 and 7 do not contain competitor or antibody. The USF complexes are indicated with arrows on the left side of the gel. 110 RBEIII RBEIII(P3) probe G A T C C T T C A A G A A C T G C T G A C A T C G A G C T T T C T C RBEI probe A A T T A T G C T G C A T A T A A G C A G C T G C T T T T T G C C T G T A C T RBEI Competitor USF2 USF USFl-flag SfL\ insect cell rUSF a n n S f ^ a N » h tffe 8 a « P M Pi 8 8 ns 1 2 3 4 5 6 7 8 9 10 11 12 Probe RBEIII Probe RBEI Figure 28. efficiently for recombinant USF binding, as does unlabeled RBEIII competitor (Figure 28, compare lanes 2 and 4). A similar but less intense pattern of bands was formed by recombinant USF with labeled RBEI oligonucleotide probe. These complexes could be competed by both unlabeled RBEIII and RBEI oligonucleotides (Figure 28, lanes 8 and 10), similar to the results with RBEIII as probe. Furthermore, the lower and middle band, representing USF 1-flag and USF1/USF2 heterodimers could be supershifted with anti-flag antibodies (Figure 28, lane 11) and both the middle and upper band representing USF 1/2 heterodimers and USF2 respectively, could be supershifted with anti-USF2 antibodies (Figure 28, lane 12). Thus, I can conclude that USF is also capable of binding RBEI, which confirms the previous prediction that RBEI and RBEIII are bound by an identical factor (Bell et al 1996). 3.5.2 TFII-I enhances binding of USF to RBEI After determining that USF could bind RBEI, I examined the possibility that TFII-I may enhance binding of USF to RBEI, as is the case with RBEIII (Figure 29). I found that TFII-I at a 10-fold molar excess caused a modest (2-3 x) enhancement of USF binding (Figure 29, lanes 2-7), but to a lesser extent than observed in previous experiments with RBEIII. This difference may be attributed to the fact that RBEI contains a canonical EBox motif (GCAGCTGC) and therefore, USF likely binds more efficiently to this site on its own. Similar to the result with RBEIII, the addition of a-HA antibodies recognizing the HA-tagged rTFII-I inhibits binding of recombinant TFII-I and also diminishes the enhancement of recombinant USF binding to RBEIII to a marginal level (Figure 29, lane 11). Additionally, a three base pair deletion of the RBEI core (AGCAGCTGC^AxxxGCTGC) prevented competition for recombinant USF, but not 112 Figure 29. TFII-I enhances the binding of USF to the RBEI element. EMSA reactions (see the Electrophoretic Mobility Shifting Assay and probe labeling section in the Materials and Methods on pages 45) were performed with ~6.25pmol recombinant USF protein produced in Sfll insect cells (lanes 1-7 and lanes 9-13), and labeled RBEI probe. TFII-I was added to the binding reactions at 3pmol (lane 2), 6pmol (lane 3), 12pmol (lane 4), 25pmol (lane 5), 50pmol (lane 6) or lOOpmol (lanes 7-13). 200u.g of cc-flag, a-USF2, and ct-HA antibody was added to the reactions in lanes 9, 10, and 11 to supershift the flag-tagged rUSFl, rUSF2, and HA-tagged rTFII-I protein complexes respectively. The reactions in lanes 11 and 12 contain a 100-fold molar excess to probe of unlabeled RBEI wild type or RBEIm mutant oligonucleotide, respectively. The USF and TFII-I complexes are labeled with arrows on the left side of the gel. 113 RBEIII(P3) RBEI RBEIm G A T C C T T C A A G A A C T G C T G A C A T C G A G C T T T C T C A A T T A T G C T G C A T A T A A G C A G C T G C T T T T T G C C T G T A C T A A T T A T G C T G C A T A T A A G C A G C T T T T T G C C T G T A C T USF constant ~6.25pmol USF ~6.25pmoI TFII-I -lOOpmol pmol-H TFII-I 0 3 6 12 25 50 100 H rs ^f1 M H M W W 1 2 3 4 5 6 7 8 9 10 11 12 13 Probe RBEI Figure 29. TFII-I (Figure 29, lane 13). This suggests that TFII-I binds outside the core RBEI (CAGCTG) sequence in a fashion similar to RBEIII. 3.6 Interaction between TFII-I and USF1 proteins 3.6.1 Recombinant USF1 and TFII-I from Sf21 insect cells co-immunoprecipitate TFII-I promotes the binding of USF1 and USF1/2 heterodimers to the RBEIII element and to a lesser extent RBEI. For RBEIII, this effect seems to require a specific interaction between TFII-I and DNA sequences immediately flanking the RBEIII core element. Additionally, in order to promote interaction of USF with DNA, it would also be expected that there should be a specific interaction between these proteins. Consistent with this prediction, Roy et al (1991) described an interaction between USF1 and TFII-I from HeLa cells as assessed by EMSA. Furthermore, USF1 expressed as an epitope-tagged fusion protein in Jurkat T-cells co-immunoprecipitated with TFII-I (Chen et al 2005). To examine this in more detail, I determined whether recombinant USF1 and TFII-I could also interact as detected by co-immunoprecipitation (Figure 30). Interaction was observed between recombinant USF1 and TFII-I that were mixed together, then immunoprecipitated with a-TFII-I antibodies (Figure 30, Panel A, lane 3, TFII-I and USF gels), as seen by an increased amount of USF 1 recovered in the co-immunoprecipitation (Figure 30, lane 3) as compared to control reactions which did not have TFII-I (lane 5) or a-TFII-I antibodies (lane 4). The high amount of background USF1 is most likely caused by non-specific interaction of recombinant USF1 with the Sepharose beads rather than a-TFII-I antibody, because equivalent amounts of background protein are observed in the absence of antibody (Figure 30, compare lanes 1 and 4). The non-specific binding of USF1 to the Sepharose beads was minimized by the addition of BSA blocking reagent 115 Figure 30. Recombinant USF1 and TFII-I from insect cells co-immunoprecipitate. Extracts from insect cells producing recombinant USF1 and TFII-I were mixed together as indicated above, and immunoprecipitated with antibodies against TFII-I (lanes 1-3) or without antibody (lane 4) followed by absorption to protein sepharose G beads (as described in the immunoprecipitations section in the Materials and Methods on page 47). Recovered proteins were separated and detected by immunoblot with anti-TFII-I (upper panel) or anti-USFl (Lower panel) antibodies. An equivalent amount of protein that was used in the immunoprecipitation assays was loaded as an input control sample with both proteins in lane 6 116 Co-Immunoprecipitates Figure 30. prior to immunoprecipitation, followed by low (200mM) and high (500mM) NaCl salt washes. In combination with previous observations, I can conclude that recombinant USF 1 and TFII-I from Sfl 1 insect cells interact, and that this interaction may promote binding of USF with RBEIII. 3.6.2 Interaction of TFII-I with USF1 is predominantly mediated by R4 TFII-I contains six direct I-repeat domains with similarity to an HLH motif (Figure 9, and Figure 31 A). These have been proposed to be involved in mediating interactions with other transcription factors or DNA elements. To examine the possibility that interaction between TFII-I and USF1 involves a specific I-repeat, I produced each of these using in vitro transcription and translation in rabbit reticulocyte lysates from PCR templates containing a T7 RNA polymerase promoter with an integrated Kozak start site preceding a 6xhistidine tag sequence, and assayed their interaction with in vitro translated USF protein from the same system. USF1, USF2 and all of the I-repeat domains of TFII-I (except RI, because of consistently poor translation), could be produced in vitro as S-labeled protein (Figure 3 IB, Panel A, lanes 1-8). Of note, each reaction contained a doublet possibly due to an internally translated protein that lacks the 6xhistidine tag. Nonetheless, only one translation product was observed after the nickel beads pull-downs (discussed below). To measure interaction, labeled USF1 and USF2 were added independently to approximately equivalent amounts of each 6xhistidine-tagged R-domain protein (Figure 3IB, Panel B, lanes 1-7). The R-domain proteins, plus associated USF protein were then recovered using nickel bead pull-down assays (Figure 3IB, Panels C, lanes 8-13). In these experiments, I found that USF1 was recovered with the R4 domain of TFII-I 118 Figure 31. The R4 domain of TFII-I interacts directly with USF1. (A). A schematic diagram of TFII-I and its R-domains. The black lines represent PCR-amplified regions, spanning each domain. (B). 3 5S labeled USF1, USF2 and the 6xHis tagged TFII-I I-repeat domains R2-R6 were expressed in rabbit reticulocyte lysate from PCR templates by in vitro transcription/translation (lanes 2-8) (see the in vitro transcription-translation section in the Materials and Methods on page 43). Lane 1 contains no PCR template. (C). USF1 (left) or USF2 (right) and 6x histidine-tagged TFII-I domains R2-R6 were mixed together in lanes 2-6 (upper panels, input). In lane 1, USF1 (left) or USF2 (right) were added on its own, and in lane 7, reticulocyte lysate lacking a PCR template was added as a negative control. The 6xhistidine-tagged R-domain protein was recovered by nickel resin pull-down (see the nickel resin pull-down assays section in the Materials and Methods on page 48), and proteins resolved on SDS-PAGE gels (lower panel). A third of the R2 domain input and a tenth of the R3-R6 domain input was loaded relative to the nickel pull-downs, to ensure equivalent loading for interaction analysis. Lane 13 represents reactions containing USF1 (left) or USF2 (right) without the addition of R-domain protein. 119 A TFII-I A N 1 g j I I g j I R 4 B I II 957aa B S to • TFII-I I-repeats £ 3 S R2 R3 R4 R5 R6 C USF2 3 5 S SDS USF1 Translation USF1 template R-domains 1 2 3 S 4 5 6 7 8 USF2 template to OT3 USF1-R-Domains-N n t vi >4r p K K 05 PJ5 rt z ^^^^ZZT*!! Input 1 2 3 4 5 6 7 to C E so «N r<i n- I D o & rt rt rt rt rt USF2 "R-Domains 1 2 3 4 5 6 7 TS S3 S 2 rt USF1 R-Domains-rt rt « 8 9 10 11 12 13 Nickel Pull-downs 2 rt vs rt «•» 8 9 10 i i R-Domains Figure 31. (Figure 3 IB, Panel C, lane 10 left), but not with any of the other domains. Furthermore, no interaction between any of the R-domains and USF2 was observed (Figure 3 IB, Panel C, lanes 8-13 right), suggesting that an interaction between TFII-I R4 and USF1 may contribute to enhancement of USF binding, consistent with the observation that TFII-I promotes interaction of USF1, but not USF2 to RBEIII. In support of this notion, no interaction was observed between TFII-I and USF2 by co-immunoprecipitation from Jurkat T-cells with USF2 antibody (see below). Based on these and earlier observations, I can conclude that enhancement of USF on RBEIII is most likely mediated through an interaction with USF1 and TFII-I, but not USF2 and TFII-I. Furthermore, interaction between USF1 and TFII-I depends predominantly on the R4 domain of TFII-I. 3.7 USF and TFII-I bound at RBEIII are necessary for response to T-cell signaling I observe that integrated mutant RBEIII LTRs produce higher basal expression than the wild type (Figure 32A, Untreated), but both the wild type and RBEIII mutant LTRs are induced to comparable levels upon stimulation with TNFct, which causes activation of N F K B (Figure 32A, TNFa) (Ozes et al 1999). In contrast, the RBEIII mutation prevents induction in response to T-cell receptor crosslinking (TCR), which mimics engagement of the receptor during antigen presentation (Figure 3 2A) (Barat et al 2002). The LTR can be induced to maximal levels by treatment with PMA and ionomycin, which stimulate the RAS-MAPK and calcineurin-NFAT pathways, in combination with the histone deacetylase inhibitor trichostatin A (TSA) (El Kharroubi et al 1998). Interestingly, we observed that unlike the wild type LTR, the integrated RBEIII mutant LTR is unresponsive to such treatment (Figure 32A), implying that USF/TFII-I 121 Figure 32. RBEIII is necessary for induction of integrated LTR-luciferase reporter constructs by T-cell signaling. (A). Representative Jurkat T-cell lines bearing integrated wild type (WT LTR, open bars) or RBEIII mutant LTR (RBEIIImut LTR, solid bars)-luciferase reporter genes (Chen et al 2005) were left untreated, or stimulated with a combination of PMA/TSA/Ionomycin, TCR cross-linking by a-CD3 antibodies, or TNF-a (see the cell culture section in the Materials and Methods on page 41). (B). PMA, but not ionomycin, can induce the wild type integrated HIV-1 LTR. Jurkat cells bearing the integrated wild type LTR-luciferase reporter were treated with combinations of PMA, Ionomycin and TSA as indicated below. Activities were measured using a microplate luminometer. These luciferase results represent averages from assays performed on at least three independent cell cultures and the bars represent the percent-fold induction of luciferase reporter with sample standard deviation represented by +/- error bars. Cells were harvested 4 hours post treatment for measurement of luciferase activity (see the ELISA and luciferase assays section in the Materials and Methods on page 50). 122 to 1>J S "I rt Luciferase Activity % Fold Induction ^ 6" > o © © © © 1 I J 1 + I 3 Luciferase Activity % Fold Induction © i © © HH s ID 2 r 3 H g SO E bound at RBEIII is necessary for response to stimulation of the RAS-MAPK and calcineurin-NFAT pathways. The wild type LTR can be induced approximately 5-fold by treatment with PMA alone, but is unresponsive to separate treatment with either ionomycin or TSA, or with ionomycin in combination with TSA (Figure 32B). Treatment with PMA in combination with either ionomocyin or TSA produces an intermediate level of expression, which supports the view that these agonists stimulate parallel pathways for induction of RBEIII-dependent expression from the HIV-1 LTR. 3.7.1 The M A P K pathway is essential for induction of integrated HIV-1 L T R by CD3 cross-linking and stimulation with P M A Carol Chang and myself compared induction kinetics of the integrated wild type LTR by treatment with PMA and crosslinking with antibodies against CD3 (TCRy/e), and found that although PMA caused more robust expression overall, both produced maximal induction at approximately 4-8 hours post treatment (Figure 33A). In T-cells, PMA causes activation of the RAS-MAPK pathway through RAS-GRP (Ebinu et al 1998, Marais et al 1998), but can additionally activate N F K B through PKC9 (Isakov et al 2002, Coudronniere et al 2000). Induction of the wild type LTR by PMA and CD3 crosslinking appears to depend mainly on RAS- MAPK pathway, because both were inhibited in a dose-dependent manner by PD98059 and U0126, small molecule inhibitors of the MAP/ERK Kinases (MEK) (Figure 33B and 33C). U0126 completely blocks induction by PMA at 40 uM, and by CD3 crosslinking at 120 u.M. These results support the view that activation of the RAS-MAPK pathway is critical for induction of latently integrated LTR (Brooks et al 2003, Yang et al 1999), and consistent with the fact that RBEIII was 124 Figure 33. MAPK/ERK kinase (MEK) inhibitors prevent induction of the wild type HIV-1 LTR by PMA and CD3 crosslinking. (A). Jurkat cells bearing the wild type LTR-luciferase reporter (see the cell culture section in the Materials and Methods on page 41) were stimulated (O) or subjected to TCR crosslinking with a-CD3 antibodies (• ) for the indicated times prior to harvesting cells and measurement of luciferase activity (see the cell culture section in the Materials and Methods on page 41). (B) and (C). Wild type LTR-luciferase Jurkat cells were pre-treated with the indicated concentration of MEK inhibitors PD98059 (•) or U0126 (•), and then stimulated with PMA (B) or CD3 crosslinking (C) for four hours prior to measuring luciferase activity. These luciferase results represent averages from assays performed on at least three independent cell cultures and the bars represent the fold induction of luciferase reporter with sample standard deviation represented by +/- error bars. 125 921 originally identified by its requirement for response of the LTR to oncogenic v-Ha-Ras (Bell et al 1996). 3.7.2 Calcineurin-NFAT causes synergistic induction of L T R with M A P K pathway Dephosphorylation of NFAT by calcineurin allows translocation to the nucleus to enable activation of responsive genes. Carol Chang and I found that activation of calcineurin-NFAT by ionomycin alone has no effect on expression of the luciferase reporter from the integrated wild type LTR (Figure 32B, Figure 34, Ion). However, co-stimulation of cells bearing the wild type LTR with PMA in combination with ionomycin produces a synergistic response, which can be blocked by the calcineurin inhibitor cyclosporin A (CsA) (Figure 34). Induction of the LTR-luciferase reporter by PMA/ ionomycin is limited to approximately 8-fold in cells treated with PD98059 in combination with CsA (Figure 34). This residual induction in the presence of both inhibitors likely reflects the extent that PMA activates N F K B through PKC6 (Coudronniere et al 2000). These results demonstrate the parallel pathways downstream of the T-cell receptor that contribute to induction of the integrated HIV-1 LTR to produce the transition from a repressed latent state. Of these, the MAPK pathway is essential for induction by PMA and engagement of the T-cell receptor. 3.7.3 RBEIII is constitutively occupied by USF/ TFII-I Having established that induction of the integrated LTR requires RBEIII, I examined whether occupancy of this site was affected by signals produced by treatment with PMA and/ or ionomcyin. For this purpose, nuclear extracts prepared from Jurkat T-cells stimulated with PMA or ionomycin were used in EMSA with an oligonucleotide probe spanning the RBEIII element as in previous experiments. I found that PMA and 127 Figure 34. MAPK and calcineurin-NFAT cause synergistic induction of the LTR. Wild type LTR-luciferase Jurkat cells were stimulated with 50ng/ml PMA and/or 25ng/ml Ionomycin in the presence of the inhibitors PD98059 (100u.M) and cyclosporin A (CsA) (3u,M) (see the cell culture section in the Materials and Methods on page 41). Cells were harvested 4 hours post-stimulation for measurement of luciferase activity (see the ELISA and luciferase assays section in the Materials and Methods on page 50). These luciferase results represent averages from assays performed on at least three independent cell cultures and the bars represent the percent-fold induction of luciferase reporter with sample standard deviation represented by +/- error bars. 128 Figure 34. 129 ionomycin produced a small but consistent increase in the USF and TFII-I-specific complexes with the RBEIII oligonucleotide after 4 and 8 hours post treatment (Figure 35A, lanes 4-9). Additionally, cells treated with ionomycin for 24 hours, alone or in combination with PMA (Figure 35A, lanes 11 and 12), were found to produce significantly more USF 1/2 heterodimer and TFII-I-specific complexes. This appears to be a consequence of accumulation of USF 1 protein, since a significantly greater amount of USF1 can be detected in these extracts by immunoblotting (Figure 35B, lanes 9 and 10). In contrast, expression levels of USF2 and TFII-I remain constant until at least 48 hours post treatment (Figure 35B). I have not determined the mechanism for accumulation of USF1 under these conditions, nor have I established a significance of this effect for the synergistic response of the LTR to PMA. However, because the levels of USF1 appear to parallel the USF 1/2 heterodimer and TFII-I DNA binding activities in these extracts, it seems USF1 may be the limiting factor for formation of these complexes in the Jurkat T-cell line. 3.7.4 RBF-2 components are phosphorylated in PMA-stimulated Jurkat T-cells USF1, USF2, and TFII-I are components of RBF-2 and are required for induction of the integrated HIV-1 LTR in response to PMA treatment. Accordingly, I observed the phosphorylation of USF 1, and TFII-I in response to PMA treatment in Jurkat cells, as determined by metabolic labeling (Figure 36A, lane 2, USF1 3 2 P and TFII-I 3 2P). An analysis of the labeled proteins from PMA-treated cells indicated that both proteins are phosphorylated at three independent sites (Figure 36B, Panels A and B). USF2 is phosphorylated in unstimulated Jurkat cells (Figure 36A, lane 1, USF2 3 2P) and becomes hyperphosphorylated in response to PMA treatment (Figure 36A, lane 2, USF2 P). 130 Figure 35. RBF-2 (USF1/2 TFII-I) from unstimulated and stimulated nuclear extracts binds RBEIII. (A) . Nuclear extracts were prepared from unstimulated Jurkat cells (lanes 1-3), or cells stimulated with PMA (P; lanes 4, 7, 10, 13) Ionomycin (I; lanes 5, 8, 11, 14), or both PMA and Ionomycin (P/I; lanes 6, 9, 12, 15) for the indicated times. EMSA was performed with labeled wild type RBEIII probe and ~5u.g of Jurkat nuclear extract (see the nuclear extracts and recombinant protein and Electrophoretic Mobility Shifting Assays and probe labeling sections in the Materials and Methods on pages 44 and 45). 20-fold molar excess unlabeled wild type RBEIII or RBEIII mutant competitor oligonucleotide was added to the binding reactions in lanes 2 and 3, respectively. The positions of complexes containing USF1/2, TFII-I and YY1 are indicated with arrows. (B) . Nuclear extracts described in (A) were analyzed by immunoblotting with antibodies against TFII-I, USF-1, USF-2 and actin. 131 A Treatment Z e r o 4 h o u r 8 h o u r 24 h o u r 48 h o u r RBEI11(P3) Probe B a w 3 s ° 2 2 § 9 « ^ § ? e ai a. a- — — o ^ M o ^ o a. a. .2 a- a- £ a. «*« «M * b» trf U S F T F I I - I ns T F I I - I / Y Y 1 ns ns 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 4 hr 8 hr 24 h r 48 h r 0 P I I/P P I 1/P P I I/P P I I/P a - T F I I - I a - U S F l a - U S F 2 a - A c t i n T F I I - I 1 2 5 K D a U S F 1 4 4 K D a U S F 2 4 5 K D a A c t i n 4 2 K D a 1 2 3 4 5 6 7 8 9 10 11 12 13 Figure 35 . Phosphopeptide analysis indicated that USF2 contains five tryptic phosphopeptides and that PMA treatment causes the appearance of two novel phosphopeptides (6 and 7) (Figure 36B, Panels D and E). We observed an additional labeled protein of approximately 120KDa in immunoprecipitates of USF1, but not USF2, from PMA-treated Jurkat cells (Figure 36A, lane 2, "*"). This protein appears to be TFII-I, as it generated an identical two-dimensional phosphopeptide fingerprint to that of TFII-I (Figure 36B, Panel C). Thus, all of the factors identified as components of RBF-2 become phosphorylated in response to the stimulation of Jurkat T cells with PMA, which is consistent with a role in regulating the response of HIV-1 to T-cell activation signals. 133 Figure 36. USF1, USF2, and TFII-I are phosphorylated in PMA-stimulated T cells. (A) Jurkat cells were labeled with [32P] orthophosphate (see the in vivo labeling of Jurkat T-cells with [32P] ortho-phosphate section in the Materials and Methods on page 43), and USF1 (top), USF2 (center), or TFII-I (bottom) was recovered by immunoprecipitation from unstimulated cells (lane 1) or cells treated with PMA for 1 hour (lane 2). The migration of labeled USF1 (USF1 32P), USF2 (USF2 32P), and TFII-I (TFII-I 32P) is indicated with arrows. The band indicated with an asterisk from USF1 immunoprecipitates was found to represent labeled TFII-I (not shown). Parallel unlabeled samples were analyzed by immunoblotting with antibodies against USF1 (a-USFl WB), USF2 (a-USF2 WB), TFII-I (a-TFII-I WB), or Actin (a-Actin WB). (B) Labeled USF1 +PMA (top left) and TFII-I +PMA (top right), the 125KDa band that co-immunoprecipitated with a-USFl (middle left), and USF2 -PMA (bottom left) and USF2 +PMA (bottom right) all from Jurkat T-cells were digested with trypsin, and phosphopeptides were analyzed by 2D 32 fingerprinting (see reference in the in vivo labeling of Jurkat T-cells with [ P] ortho-phosphate section in the Materials and Methods on page 43). The origin is labeled with a red circle on the bottom right hand corner of each map, and phosphopeptides observed in either unstimulated or stimulated cells are numbered (1 to 3). 134 TFII-I +PMA USF 1 +PMA Figure 36. ° r i § i n ° r i g i n CHAPTER IV DISCUSSION 4.1 The HIV-1 LTR is responsive to T-cell Signaling Upon infection by HIV, a small population of CD4 positive cells establishes a dormant pool of provirus that is unaffected by current Highly Active Anti-Retroviral Therapy (HAART). By understanding the mechanisms that control latency, and those that cause activation of the virus in response to cell signaling it may be possible to develop therapeutic strategies to purge this latent population. Engagement of the T-cell receptor activates several pathways through the transmembrane receptor-tethered kinases Lck and Zap 70 that produce downstream effects on HIV-1 replication. Phospholipase C-y (PLC-y) is pivotal in this process, positioned at the top of a pyramid of pathways that affect the Ras-MAPK, calcineurin, and protein kinase C-0 (PKC-0) directed pathways (Figure 5). Each pathway has been shown to target various transcriptional activators including GABP/Ets, NFAT, and N F K B respectively, whose roles have been well defined in controlling transcription of many genes. For example, GABPa/61 and Ets-1 have been shown to co-localize to the rat prolactin promoter at an upstream Ets-binding/Pit-1 site (EBS/P) and a downstream basal transcriptional element (BTE) to regulate prolactin expression in response to oncogenic Ras-signaling (Schweppe et al 2001). GABP also regulates development by binding the distal promoter of the homeobox gene Rhox5 (MacLean et al 2005), and binds the dyad symmetry element (DSE) to positively regulate IL-2 production in response to PTK/Ras/Raf signaling (Hoffmeyer et al 1998). N F K B , first discovered by David Baltimore's group as a protein that interacts with an 11-base pair sequence (kappa 136 element) in the immunoglobulin light chain enhancer in B-cells (Lenardo et al 1989 a and b), has since been shown to regulate numerous genes involved in the T-cell response by PKC6 signaling in the presence of pathogens. N F K B is essential for the production of cytokines that promote immune responses, including TNF-a, and IL-2 (Collart et al 1990 Cross et al 1989). Additionally, the NFAT transcription factors have also been shown to regulate genes involved in immune response, including IL-2 (Shaw et al 1988). NFAT transcriptional activators are responsive to calcineurin signaling upon activation in T-lymphocytes. Considering that each of these transcriptional activators is the target of signaling pathways in T-cells, and promote immune responses by positively regulating cytokine production, it is perhaps no surprise HIV-1 has acquired strategies to utilize these factors for its own replication. HIV-1 has kappa elements in its enhancer region that have been shown to bind both NFAT and N F K B (Kinoshita et al 1997). Additionally, GABP/Ets sites (RBEII) are buried within the kappa elements and have been shown to interact with GABPa/61 in Jurkat nuclear extracts (Estable et al 1998). Mutations in RBEII have been shown to prevent LTR transcription in response to Ras-signaling as assayed by transiently transfected LTR-reporter templates (Bell et al 1996). Although these factors are essential for HIV-1 replication, viral isolates lacking the kappa elements have been identified (Zhang et al 1997). This suggests that additional factors must also be required to promote LTR-directed transcription of HIV-1. We have shown that mutations in the highly conserved RBEIII element that prevent binding of USF and TFII-I, impair LTR responsiveness to MAPK signaling in T-cells after treatment with PMA or TCR crosslinking (Figures 32 and 34) (Malcolm et al 2005). These data provide additional 137 support to the fact that RBEIII was originally identified as one of four elements necessary for response of the LTR to co-transfected v-Ha-Ras expression plasmids (Bell et al 1996). Activation driven by the wild type HIV-1 LTR was not observed in T-cells treated with ionomycin alone, which causes nuclear translocation of NFAT by activating calcineurin. However, when ionomycin is added simultaneously with PMA, a synergistic response is observed (Figure 34), suggesting RBF-2(USF/TFII-I) is directly involved in MAPK signaling at least. Until now, USF has not been implicated as a target for Ras-MAPK signal transduction however, TFII-I has been shown to mediate response of the c-Fos promoter to growth factor signal transduction (Kim et al 2001). To date, no viral isolates with mutations in the RBEIII site have been found in patients with AIDS. 4.2 USF and TFII-I are constitutively bound to the HIV-1 L T R and have been shown to interact with chromatin remodeling machinery at other promoters Using ChIP analysis, Jiguo Chen from our laboratory showed that USF1, USF2 and TFII-I are constitutively bound to the HIV-1 LTR at the RBEIII element in both unstimulated and stimulated Jurkat T-cells (Malcolm et al 2005). In support of this observation, the work presented here indicates that USF1, USF2, and TFII-I bind constitutively in Jurkat nuclear extracts from both unstimulated and stimulated cells. Additionally, I have shown that each of these proteins is modified by phosphorylation in response to T-cell activation (Figure 36). TFII-I is known to interact with HDAC3 and the SUMOylation factor PIASxP, implicating this transcription factor in the regulation of chromatin structure (Tussie-Luna et al 2002). As well, USF heterodimers have also been shown to interact with chromatin remodeling histone acetyltransferases (HATs) at the chicken (3-globin barrier element (West et al 2004). Taking these observations into 138 consideration, and the fact that USF and TFII-I (RBF-2) interact at specific and conserved positions on the HIV-1 LTR at RBEI and RBEIII, and undergo modifications during the T-cell response, I propose that RBF-2 regulates re-organization of chromatin in response to T-cell activation to allow trans-activation by the signal responsive factors NFAT, N F K B , GABP/Ets, and Spl. In resting T-cells proviral transcription is repressed. During latency, it is possible that RBF-2 in its unphosphorylated state is bound to the RBEIII and RBEI elements and is involved in the recruitment of factors that promote the formation of repressive chromatin such as HDACs. In this repressed state, it is likely that the binding sites for transcription factors that bind the U3R enhancer region between the RBEIII/RBEI sites of the LTR, including NFAT, N F K B , GABP/Ets and Spl, would be inaccessible. This view is supported by the fact that N F K B (Niederman et al 1992), N F A T (Cicala et al 2006, Ranjbar et al 2006), and Spl (McAllister et al 2000, Nonnemacher et al 2004) only become bound to the LTR after T-cell activation, whereas the RBF-2 components are constitutively bound to the LTR (Malcolm et al 2005). Phosphorylation of TFII-I in response to T-cell signaling may cause the dissociation of TFII-I with HDAC by PIASxP that was observed by Tussie-Luna et al (2002 a and b). Additionally, phosphorylation of USF1 and the hyperphosphorylation of USF2 under activating conditions may enable HAT recruitment thus promoting chromatin relaxation and LTR accessibility for transcriptional activators (Figure 37). 139 Ras/Ionomycin Signaling RBF - 2 /RBEI I I ^ / \ ^ R B F - 2 / R B E I A v a l USF/HAT mediated acetylation S s t l *Q A A A Activators ( N F K B , N F A T , Spl, GABP/Ets) 3' Transcriptional Activation Figure 37. Proposed model for RBF-2 regulation of chromatin structure 4.3 Spatial conservation of the RBEs on the HIV-1 L T R and their potential role in nucleosome positioning Signaling pathways leading to the activation of genes often involve a highly complex series of events involving reorganization of chromatin, to allow binding of transcriptional activating proteins that can recruit the general transcriptional machinery (Tsukiyama et al 1997). HIV is susceptible to the same types of regulation because it integrates into the host chromosome. Provirus in the repressed latent state has two regions known to be covered by nucleosomes (el Kharroubi et al 1996). The enhancer and core promoter regions of the LTR lie between these nucleosomes (NucA and NucC) in this state (Figure 37). Upon host cell activation and induction of viral expression, the 3' half of U3R, including the entire enhancer region, the R region, U5 and the gag leader sequences all become nucleosome-free as observed by sensitivity to micrococcal nuclease and restriction endonucleases (el Kharroubi et al 1996 and 1998). Based on restriction endonuclease sensitivity, NucA and NucC are predicted to be relatively close to the positions flanking the RBEIII and RBEI elements, respectively (Figure 37). NucA is positioned on the LTR near an Aval restriction site (-154) that is located 24 base pairs upstream of the RBEIII element (Figure 37)..Similarly, nucleosome C (NucC) is positioned near the Sstl restriction endonuclease site (+29) approximately 44 base pairs downstream of the core RBEI site (GCAGCTGC). The RBEIII and RBEI elements, each shown in this study to be bound by USF and TFII-I, are positioned at -16 to -25 and -117 to -130 in relation to the transcriptional start site (Bell et al 1996). These elements are highly conserved not only in sequence (Table 2 and Appendix 1), but also in relation to their position relative to the 141 transcriptional start site and with one another. It has been previously observed, that mutations in RBEIII are invariably accompanied by duplications that restore both the sequence and relative position of the element (Estable et al 1998). I have re-examined these data, and I noticed as well, that each of these re-arranged LTRs also conserves the CATC sequence that I have shown to be required for interaction with TFII-I. This supports the view that the RBEIII core element plus the flanking TFII-I recognition sequence must be necessary for viral pathology. The RBEIII and RBEI elements flank the enhancer region and the core promoter. The highly conserved nature of these elements, their close proximity to phased nucleosomes, and the fact that USF and TFII-I associate with nucleosome acetylation and deacetylation complexes suggests they may contribute to nucleosome phasing and/or chromatin organization of the HIV-1 LTR. Consistent with this possibility we found that mutations in the RBEIII or adjacent TFII-I binding site consistently cause higher basal level expression of integrated LTRs than wild type in unstimulated T-cells, but fail to activate in response to PMA and Ionomycin (Figure 34) (Malcolm et al 2005). 4.4 The role of TFII-I at the R B E I I I element My results implicate an important and previously unrecognized role for TFII-I in the regulation of transcription from the HIV-1 LTR. To date, like USF, there is no evidence that TFII-I is capable of directly recruiting the RNA PolII transcriptional machinery, which suggests TFII-I does not fit into the classical definition of a transcriptional activator. TFII-I interacts with protein kinases in the cytoplasm (Kim et al 2000), has various isoforms with alternate functions (Roy et al 2001, and 2006), interacts with chromatin remodeling machinery (Tussie-Luna et al 2002), and promotes the 142 formation of complexes on DNA (Malcolm et al 2005, Grueneburg et al 1997, Stasyk et al 2005). These complex interactions may be attributed to its relatively simple organization as a scaffolding protein capable of numerous different interactions, and its propensity to interact semi-specifically with DNA sequences, and specifically with several highly conserved sequence motifs (Vullhorst et al 2005, Thompson et al 2007, Clark et al 1998). The I-repeats, with slight differences in sequence, may provide TFII-I with a broad spectrum of interacting capability. One property of TFII-I that I have examined in this thesis is its capacity to promote binding of transcription factors onto non-canonical or low-affinity binding sites. USF1 and USF2 form a heterodimer when co-translated that readily binds to a consensus EBox present in many promoters (Sirito et al 1994). An EBox consensus exists in the HIV-1 LTR at position -161 to -166, but this site is conserved in only 30% of HIV-1 isolates from AIDS patients and therefore does not likely contribute to efficiency of the viral replication cycle. Nevertheless, USF bound at this position appears to have a repressive effect on transiently transfected LTR templates (Lu et al 1990). The effect of this EBox on chromosomally integrated LTRs has not been addressed, but is likely to be small because NucA is positioned directly over this site. It is curious that a non-canonical low-affinity EBox and TFII-I binding site are highly conserved at the RBEIII site, whereas a consensus high-affinity EBox further upstream is not. This implies that the combination of USF and TFII-I binding at this position is required, rather than just USF alone. Cooperative interactions between proteins with cis elements are commonly employed for developmental decisions in both prokaryotes and eukaryotes (Ptashne 2003). Cooperation between USF and the multifunctional TFII-I protein may provide 143 mechanisms for the utilization of multiple signals at the RBEIII site that would otherwise be impossible with USF alone. In support of these data, a similar strategy used by Adenovirus has been observed, where the Adenoviral DNA binding protein (DBP) has been shown to enhance the binding of USF to the non-canonical major late promoter (MLP) region of the virus by interactions with USF1 and DNA, thereby increasing viral expression under appropriate conditions (Zijderveld et al 1994). In this thesis I have shown that the binding of TFII-I immediately 3' of the core RBEIII element is also essential for the efficient binding of USF (Figure 24). I also believe the enhancement of USF binding to the RBEIII and RBEI elements is due to a combination of TFII-I mediated interactions with DNA and USF1 of the USF heterodimer, perhaps involving interaction with the R4 domain of TFII-I. 4.5 The mechanism for stimulation of DNA binding by TFII-I My data provides evidence of TFII-I binding somewhat specifically near the RBEIII core at nucleotides CATC. Under the experimental conditions used, I have not seen a direct interaction between TFII-I and USF2, suggesting that the USF-TFII-I interaction is mainly mediated through USF1. I have confirmed a direct interaction between rUSFl and rTFII-I, most likely mediated through the R4 domain of TFII-I. Taking into account the close proximity of the TFII-I binding site with the USF heterodimer binding site, it is likely a combination of these interactions that contributes to recruitment of USF to RBEIII. Once USF is bound to RBEIII, its dissociation rate must be slow enough to allow it to persist in EMSA, even though TFII-I and USF do not remain associated as a terniary complex. The DNase hypersensitivity observed in LTR footprints is likely mediated by USF once it is bound to RBEIII, because similar 144 hypersensitivity is observed when USF alone is bound to the upstream canonical EBox motif. These data are consistent with DNA hypersensitivity patterns on various promoters when USF binds to a canonical EBox (d'Adda di Fagagna et al 1995). Of note, as TFII-I is added to USF1, DNasel hypersensitivity decreases at the EBox site (see Figure 18). The implications of this are not clear because the overall protection of the EBox site in all lanes is consistently saturated. At the RBEIII site, where protection is only apparent in the presence of TFII-I, an additional strong hypersensitive region 3' to the RBEIII core is observed, most likely caused by a combination of TFII-I/DNA and TFII-I/USF interactions. In the yeast PFY1 promoter, a constitutively active house-keeping gene, the multi-functional enhancer binding protein REB1 binds to its canonic dAdT site, resulting in strong DNA bending that prevents the packaging of nucleosomes into the enhancer region gap (Angermayr et al 2003). Based on the increased hypersensitivity observed at RBEIII, it is possible that USF and TFII-I binding might directly influence nucleosome positioning in a manner similar to Reblp. 4.6 A d d i t i o n a l factors that b i n d near R B E I I I Taken together, the DNA binding properties of TFII-I and its protein interaction with USF, the cooperative binding of these three factors at the RBEIII site and the high conservation of these sequences on HIV-1 LTRs from AIDS patients, suggest that these features are essential for HIV-1 replication. Additional proteins that interact with USF and TFII-I at RBEIII may be required for nucleosome positioning and the establishment of latency. Consistent with this possibility, two additional proteins co-purified with the USF/TFII-I complex in oligonucleotide affinity chromatography (Estable et al 1999). Furthermore, using a modified yeast two-hybrid assay, I showed that TFII-I interacts with 145 TIFl-a, a 116KDa protein that contains bromodomain motifs characteristic of chromatin modifying proteins (Seeler et al 2001). TIFl-a has been shown to interact with DNA at the euchromatin level, as well as histones H3 and H4, to position chromatin regulators to their cognate location on nucleosomal DNA (Remboutsika et al 2002). If this interaction can be documented in vivo, this would further support the idea that TFII-I may be a key regulator of chromatin structure on the HIV-1 LTR and other promoters. To my surprise, the YY1 protein, known to bind primarily Inr sequences of many genes, was observed to bind near RBEIII (Figure 12). Based on competition EMSA with Jurkat T-cell nuclear extracts, I can conclude it binds immediately downstream of the RBEIII core element and its binding also appears to be influenced by TFII-I (Figure 23). Although little is known about YY1 at this site, its presence offers an intriguing model for repression and may be important for maintaining nucleosome position, as well as preventing transcriptional activators from binding downstream. The fact that I do not observe YY1 binding on the RBEI oligonucleotide simply means that the probe did not extend into the initiator region, which includes the YY1 consensus (Margolis et al 1994). This YY1 binding site is approximately 16 base pairs downstream of RBEI and approximately 19 base pair upstream from NucC (El Kharroubi et al 1998). Nonetheless, the fact that YY1 is situated near RBF-2 at RBEI is intriguing because these same factors cluster at RBEIII, suggesting that their positions relative to nucleosomes within the enhancer region of the LTR may be major factors required for viral replication. 4.7 Synopsis for activation of chromosomally integrated H I V - 1 The activation of integrated provirus, and subsequent expression of viral progeny requires a complex interplay between transcriptional activators and repressors, chromatin 146 remodeling machinery, nucleosome positioning, and RNA polymerase II holoenzyme recruitment. T-cell receptor engagement with an antigen-presenting cell triggers a cascade of events, for which the integrated provirus has adapted strategies to promote replication. The Ras-MAPK signaling pathway that targets RBF-2 is critical for viral expression. USF and TFII-I become phosphorylated, which might lead to relief of repression and allow opening of the promoter/enhancer, most likely mediated by the recruitment of HATs (Figure 37). This chain of events allows signal responsive transcriptional activators to bind the enhancer region, resulting in the recruitment of Swi/Snf complexes enabling reversed nucleosome phasing and initiation of transcription by recruitment of mediator and RNA Pol II holoenzyme. Furthermore, viral Tat-mediated recruitment of pTEFb/CDK9 relieves holoenzyme stalling at the TAR loop structure to allow elongation of viral transcripts. 4.8 Future Directions Ever since the discovery that nucleosomes are specifically positioned on the HIV-1 LTR in the repressed state (Verdin et al 1993, El Kharroubi et al 1996), a considerable amount of research has been focused on identifying factors that regulate nucleosome movement and chromatin structure. Given the position of RBF-2 (USF/TFII-I) in relation to nucleosomes NucC and NucA on the LTR, and the growing evidence that its subunits interact with chromatin remodeling machinery, it is most likely that RBF-2 regulates activation of viral replication through nucleosome modification. Determining the specific protein interactions of the RBF-2 subunits that influence chromatin organization, and how these are altered under activating conditions, will be an important future direction for understanding RBF-2 function. PTK/Ras/Raf activation of HIV-1 transcription is 147 prevented by mutations in USF and TFII-I binding sites in the LTR, even in the presence of TSA, which promotes open chromatin by inhibiting HDACs. One might expect these mutations to prevent nucleosome phasing or modification involved in the critical recruitment of factors leading to activation. Additionally, defining how the USF/TFII-I phosphorylation states affect nucleosome modification and viral activation will also be important as this model evolves. 4.9 Conclusion A plethora of transcription factors bind to and regulate the HIV-1 LTR (Table 1). Some factors are constitutively bound while others are recruited under inducing conditions. The RBF-2 complex is constitutively bound at two sites and is critical for viral replication: it is the immediate early ignition mechanism for response to T-cell activation. Based on the flanking position of the RBF-2 complex in relation to the enhancer and core promoter, and the fact that nucleosomes are positioned adjacent to the RBEIII and RBEI sequences, it is likely the complex modulates the accessibility of activator binding sites through nucleosome modification pathways. Additionally the binding of USF to the highly conserved position of RBEIII is modulated by the function of TFII-I. This model takes into account growing data in the fields of biochemistry and molecular epigenetics that identify USF and TFII-I as partners each capable of interactions with chromatin remodeling complexes. 148 5. R E F E R E N C E S Abdelrahim M , Liu S, Safe S. (2005) Induction of endoplasmic reticulum-induced stress genes in Panc-1 pancreatic cancer cells is dependent on Sp proteins. J Biol Chem. 280(16):16508-16513. Adkins MW, Howar SR, Tyler JK. (2004) Chromatin disassembly mediated by the histone chaperone Asfl is essential for transcriptional activation of the yeast PH05 and PH08 genes. Mol Cell. 14(5):657-666. Altman A, Mustelin T, Coggeshall K M . (1990) T lymphocyte activation: a biological model of signal transduction. Crit Rev Immunol. 10(4):347-391 Altman A, Isakov N, Baier G. (2000) Protein kinase Ctheta: a new essential superstar on the T-cell stage. Immunol Today. 21(ll):567-573. Alvarez M , Rhodes SJ, Bidwell JP. (2003) Context-dependent transcription: all politics is local. Gene. 313:43-57. Angermayr M , Oechsner U, Bandlow W. (2003) Reblp-dependent DNA bending effects nucleosome positioning and constitutive transcription at the yeast profilin promoter. J Biol Chem. 278(20): 17918-17926. Ashworth T, Roy AL. (2007) Cutting Edge: TFII-I controls B cell proliferation via regulating NF-kappaB. J Immunol. 178(5):2631-2635. Barat C, Tremblay MJ. (2002) Engagement of CD43 enhances human immunodeficiency virus type 1 transcriptional activity and virus production that is induced upon TCR/CD3 stimulation. J Biol Chem. 277(32) :28714-28724. Barre-Sinoussi F, Chermann JC, Rey F, Nugeyre MT, Chamaret S, Gruest J, Dauguet C, Axler-Blin C, Vezinet-Brun F, Rouzioux C, Rozenbaum W, Montagnier L. (1983) Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science. 220(4599):868-871. Benczik M , Gaffen SL. (2004) The interleukin (IL)-2 family cytokines: survival and proliferation signaling pathways in T lymphocytes.Immunol Invest. 33(2): 109-142. Bell B, Sadowski I. (1996) Ras-responsiveness of the HIV-1 LTR requires RBF-1 and RBF-2 binding sites. Oncogene. 13(12):2687-2697. Berkhout B, Jeang KT. (1992) Functional roles for the TATA promoter and enhancers in basal and Tat-induced expression of the human immunodeficiency virus type 1 long terminal repeat. J Virol. 66(1): 139-149. 149 Bernstein BE, Liu CL, Humphrey EL, Perlstein EO, Schreiber SL. (2004) Global nucleosome occupancy in yeast. Genome Biol. (9):R62. Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF, Castner BJ, Stocking KL, Reddy P, Srinivasan S, Nelson N , Boiani N , Schooley KA, Gerhart M , Davis R, Fitzner JN, Johnson RS, Paxton RJ, March CJ, Cerretti DP. (1997) A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature. 385(6618) :729-733. Boise LH, Petryniak B, Mao X, June CH, Wang CY, Lindsten T, Bravo R, Kovary K, Leiden JM, Thompson CB. (1993) The NFAT-1 DNA binding complex in activated T cells contains Fra-1 and JunB. Mol Cell Biol. 13(3): 1911-1919. Boshart M , Weber F, Jahn G, Dorsch-Hasler K, Fleckenstein B, Schaffner W. (1985) A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell. 41(2):521-530. Bouwmeester T, Bauch A, Ruffner H, Angrand PO, Bergamini G, Croughton K, Cruciat C, Eberhard D, Gagneur J, Ghidelli S, Hopf C, Huhse B, Mangano R, Michon A M , Schirle M , Schlegl J, Schwab M , Stein MA, Bauer A, Casari G, Drewes G, Gavin AC, Jackson DB, Joberty G, Neubauer G, Rick J, Kuster B, Superti-Furga G. (2004) A physical and functional map of the human TNF-alpha/NF-kappa B signal transduction pathway. Nat Cell Biol. 6(2):97-105. Boyer TG, Martin ME, Lees E, Ricciardi RP, Berk AJ. (1999) Mammalian Srb/Mediator complex is targeted by adenovirus E1A protein. Nature. 399(6733):276-279. Boyle WJ, van der Geer P, Hunter T. (1991) Phosphopeptide mapping and phosphoamino acid analysis by two-dimensional separation on thin-layer cellulose plates. Methods Enzymol. 201:110-149. Briskin M, Damore M, Law R, Lee G, Kincade PW, Sibley CH, Kuehl M , Wall R. (1990) Lipopolysaccharide-unresponsive mutant pre-B-cell lines blocked in NF-kappa B activation. Mol Cell Biol. 1 0 ( l ) : 4 2 2 - 4 2 5 . Brooks DG, Arlen PA, Gao L, Kitchen CM, Zack JA. (2003) Identification of T cell-signaling pathways that stimulate latent HIV in primary cells. Proc Natl Acad Sci U S A . 100(22):12955-12960. Buratowski S. (1994) The basics of basal transcription by RNA polymerase II. Cell. 77(1):1-3. Carrozza MJ, L i B, Florens L, Suganuma T, Swanson SK, Lee KK, Shia WJ, Anderson S, Yates J, Washburn MP, Workman JL. (2005) Histone H3 methylation by Set2 directs deacetylation of coding regions by Rpd3S to suppress spurious intragenic transcription. Cell. 123(4):581-592. 150 Chang CC, Sakashita N , Ornvold K, Lee O, Chang ET, Dong R, Lin S, Lee CY, Strom SC, Kashyap R, Fung JJ, Farese RV Jr, Patoiseau JF, Delhon A, Chang TY (2000). Immunological quantitation and localization of ACAT-1 and ACAT-2 in human liver and small intestine. Biol Chem. 275(36):28083-28092. Chang LA, Smith T, Pognonec P, Roeder RG, Murialdo H. (1992) Identification of USF as the ubiquitous murine factor that binds to and stimulates transcription from the immunoglobulin lambda 2-chain promoter. Nucleic Acids Res. 20(2):287-293. Chang LJ, Urlacher V, Iwakuma T, Cui Y, Zucali J. (1999) Efficacy and safety analyses of a recombinant human immunodeficiency virus type 1 derived vector system. Gene Ther.6(5):715-728. Charneau P, Mirambeau G, Roux P, Paulous S, Buc H, Clavel F. (1994) HIV-1 reverse transcription. A termination step at the center of the genome. J Mol Biol. 241(5):651-662. Chen BK, Feinberg MB, Baltimore D. (1997) The kappaB sites in the human immunodeficiency virus type 1 long terminal repeat enhance virus replication yet are not absolutely required for viral growth. J Virol. 71(7):5495-5504. Chen P, Flory E, Avots A, Jordan BW, Kirchhoff F, Ludwig S, Rapp UR. (2000) Transactivation of naturally occurring HIV-1 long terminal repeats by the JNK signaling pathway. The most frequent naturally occurring length polymorphism sequence introduces a novel binding site for AP-1 factors. J Biol Chem. 275(27):203 82-20390. Cherepanov P, Maertens G, Proost P, Devreese B, Van Beeumen J, Engelborghs Y, De Clercq E, Debyser Z. (2003) HIV-1 integrase forms stable tetramers and associates with LEDGF/p75 protein in human cells. J Biol Chem. 278(1):372-381. Cherepanov P, Devroe E, Silver PA, Engelman A. (2004) Identification of an evolutionarily conserved domain in human lens epithelium-derived growth factor/transcriptional co-activator p75 (LEDGF/p75) that binds HIV-1 integrase. J Biol Chem. 279(47):48883-48892. Cheriyath V, Roy A L . (2000) Alternatively spliced isoforms of TFII-I. Complex formation, nuclear translocation, and differential gene regulation. J Biol Chem. 275(34):26300-26308. Cheriyath V, Roy AL. (2001) Structure-function analysis of TFII-I. Roles of the N -terminal end, basic region, and I-repeats. J Biol Chem. 276(ll):8377-8383. Cicala C, Arthos J, Censoplano N , Cruz C, Chung E, Martinelli E, Lempicki RA, Natarajan V, VanRyk D, Daucher M , Fauci AS. (2006) HIV-1 gpl20 induces NFAT nuclear translocation in resting CD4+ T-cells. Virology. 345(1): 105-114. 151 Ciuffi A, Bushman FD. (2006) Retroviral DNA integration: HIV and the role of LEDGF/p75. Trends Genet. 22(7):388-395. Clark MP, Chow CW, Rinaldo JE, Chalkley R. (1998) Correct usage of multiple transcription initiation sites and C/EBP-dependent transcription activation of the rat XDH/XO TATA-less promoter requires downstream elements located in the coding region of the gene. Nucleic Acids Res. 26(7): 1801-1806. Cockerill PN, Shannon MF, Bert AG, Ryan GR, Vadas MA. (1993) The granulocyte-macrophage colony-stimulating factor/interleukin 3 locus is regulated by an inducible cyclosporin A-sensitive enhancer. Proc Natl Acad Sci U S A . 90(6):2466-2470. Cockerill GW, Bert AG, Ryan GR, Gamble JR, Vadas MA, Cockerill PN. (1995) Regulation of granulocyte-macrophage colony-stimulating factor and E-selectin expression in endothelial cells by cyclosporin A and the T-cell transcription factor NFAT. Blood. 86(7):2689-2698. Collart MA, Baeuerle P, Vassalli P. (1990) Regulation of tumor necrosis factor alpha transcription in macrophages: involvement of four kappa B-like motifs and of constitutive and inducible forms of NF-kappa B. Mol Cell Biol. 10(4): 1498-1506. Corbeil J, Sheeter D, Genini D, Rought S, Leoni L, Du P, Ferguson M , Masys DR, Welsh JB, Fink JL, Sasik R, Huang D, Drenkow J, Richman DD, Gingeras T. (2001) Temporal gene regulation during HIV-1 infection of human CD4+ T cells. Genome Res. 11(7): 1198-1204. Cosma MP, Tanaka T, Nasmyth K. (1999) Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter. Cell. 97(3):299-311. Coudronniere N , Villalba M , Englund N , Altman A. (2000) NF-kappa B activation induced by T cell receptor/CD28 costimulation is mediated by protein kinase C-theta. Proc Natl Acad Sci U S A . 97(7):3394-3399. Coull JJ, Romerio F, Sun JM, Volker JL, Galvin K M , Davie JR, Shi Y, Hansen U, Margolis DM. (2000) The human factors YY1 and LSF repress the human immunodeficiency virus type 1 long terminal repeat via recruitment of histone deacetylase 1. J Virol. 74(15):6790-6799. Cross SL, Halden NF, Lenardo MJ, Leonard WJ. (1989) Functionally distinct NF-kappa B binding sites in the immunoglobulin kappa and IL-2 receptor alpha chain genes. Science. 244(4903):466-469. d'Adda di Fagagna F, Marzio G, Gutierrez MI, Kang LY, Falaschi A, Giacca M . (1995) Molecular and functional interactions of transcription factor USF with the long terminal repeat of human immunodeficiency virus type 1. J Virol. 69(5):2765-2775. 152 Debouck C, Gorniak JG, Strickler JE, Meek TD, Metcalf BW, Rosenberg M . (1987) Human immunodeficiency virus protease expressed in Escherichia coli exhibits autoprocessing and specific maturation of the gag precursor. Proc Natl Acad Sci U S A . 84(24):8903-8906. Debouck C. The HIV-1 protease as a therapeutic target for AIDS. (1992) AIDS Res Hum Retroviruses. 8(2):153-164. Dehe PM, Pamblanco M , Luciano P, Lebrun R, Moinier D, Sendra R, Verreault A, Tordera V, Geli V. (2005) Histone H3 lysine 4 mono-methylation does not require ubiquitination of histone H2B. J Mol Biol. 353(3):477-484. Desai-Yajnik V, Samuels HH. (1993) The NF-kappa B and Spl motifs of the human immunodeficiency virus type 1 long terminal repeat function as novel thyroid hormone response elements. Mol Cell Biol. 13(8):5057-5069. DiDonato JA, Hayakawa M , Rothwarf DM, Zandi E, Karin M . (1997) A cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB. Nature. 388(6642):548-554. Dunah AW, Jeong H, Griffin A, Kim Y M , Standaert DG, Hersch SM, Mouradian M M , Young AB, Tanese N , Krainc D. (2002) Spl and TAFII130 transcriptional activity disrupted in early Huntington's disease. Science. 296(5576):2238-2243. Durand DB, Shaw JP, Bush MR, Replogle RE, Belagaje R, Crabtree GR. (1988) Characterization of antigen receptor response elements within the interleukin-2 enhancer. Mol Cell Biol. 8(4):1715-1724. Ebinu JO, Bottorff DA, Chan EY, Stang SL, Dunn RJ, Stone JC. (1998) RasGRP, a Ras guanyl nucleotide- releasing protein with calcium- and diacylglycerol-binding motifs. Science. 280(5366): 1082-1086. El Kharroubi A, Martin MA. (1996) cis-acting sequences located downstream of the human immunodeficiency virus type 1 promoter affect its chromatin structure and transcriptional activity. Mol Cell Biol. 16(6):2958-2966. El Kharroubi A, Piras G, Zensen R, Martin MA. (1998) Transcriptional activation of the integrated chromatin-associated human immunodeficiency virus type 1 promoter. Mol Cell Biol. 18(5):2535-2544. Erickson-Viitanen S, Manfredi J, Viitanen P, Tribe DE, Tritch R, Hutchison CA 3rd, Loeb DD, Swanstrom R. (1989) Cleavage of HIV-1 gag polyprotein synthesized in vitro: sequential cleavage by the viral protease. AIDS Res Hum Retroviruses. 5(6):577-591. 153 Estable MC, Bell B, Hirst M , Sadowski I. (1998) Naturally occurring human immunodeficiency virus type 1 long terminal repeats have a frequently observed duplication that binds RBF 2 and represses transcription. J Virol. 72(8):6465-6474. Estable MC, Hirst M , Bell B, O'Shaughnessy MV, Sadowski I. (1999) Purification of RBF-2, a transcription factor with specificity for the most conserved cis-element of naturally occurring HIV-1 LTRs. J Biomed Sci. 6(5):320-332. Feng Y, Broder CC, Kennedy PE, Berger EA. (1996) HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science. 272(5263):872-877. Ferre-D'Amare AR, Pognonec P, Roeder RG, Burley SK. (1994) Structure and function of the b/HLH/Z domain of USF. EMBO J. 13(1): 180-189. Finzi D, Hermankova M , Pierson T, Carruth L M , Buck C, Chaisson RE, Quinn TC, Chadwick K, Margolick J, Brookmeyer R, Gallant J, Markowitz M , Ho DD, Richman DD, Siliciano RF. (1997) Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science. 278(5341): 1295-1300. Flores O, Lu H, Reinberg D. (1992) Factors involved in specific transcription by mammalian RNA polymerase II. Identification and characterization of factor IIH. J Biol Chem. 267(4):2786-2793. Flory E, Hoffmeyer A, Smola U, Rapp UR, Bruder JT. (1996) Raf-1 kinase targets GA-binding protein in transcriptional regulation of the human immunodeficiency virus type 1 promoter. J Virol. 70(4):2260-2268. Franza BR Jr, Rauscher FJ 3rd, Josephs SF, Curran T. (1988) The Fos complex and Fos-related antigens recognize sequence elements that contain AP-1 binding sites. Science. 239(4844): 1150-1153. Galang CK, Der CJ, Hauser CA. (1994) Oncogenic Ras can induce transcriptional activation through a variety of promoter elements, including tandem c-Ets-2 binding sites. Oncogene. 9(10):2913-2921. Galibert MD, Carreira S, Goding CR. (2001) The Usf-1 transcription factor is a novel target for the stress-responsive p38 kinase and mediates UV-induced Tyrosinase expression. EMBO J. 20(17):5022-5031. Garcia JA, Ou SH, Wu F, Lusis AJ, Sparkes RS, Gaynor RB. (1992) Cloning and chromosomal mapping of a human immunodeficiency virus 1 "TATA" element modulatory factor. Proc Natl Acad Sci U S A . 89(20):9372-9376. 154 Ge Y, Jensen TL, Matherly LH, Taub JW. (2003) Physical and functional interactions between USF and Spl proteins regulate human deoxycytidine kinase promoter activity. J Biol Chem. 278(50):49901-49910. Grakoui A, Bromley SK, Sumen C, Davis MM, Shaw AS, Allen PM, Dustin ML. (1999) The immunological synapse: a molecular machine controlling T cell activation. Science. 285(5425):221-227. Greene WC. (1990) Regulation of HIV-1 gene expression. Annu Rev Immunol. 8:453-475. Griffin GE, Leung K, Folks TM, Kunkel S, Nabel GJ. (1989) Activation of HIV gene expression during monocyte differentiation by induction of NF-kappa B. Nature. 339(6219):70-73. Giffin MJ, Stroud JC, Bates DL, von Koenig KD, Hardin J, Chen L. (2003) Structure of NFAT1 bound as a dimer to the HIV-1 LTR kappa B element. Nat Struct Biol. 10(10):800-806. Grueneberg DA, Henry RW, Brauer A, Novina CD, Cheriyath V, Roy AL, Gilman M . (1997) A multifunctional DNA-binding protein that promotes the formation of serum response factor/homeodomain complexes: identity to TFII-I. Genes Dev. 11(19):2482-2493. Guan H, Hou S, Ricciardi RP. (2005) DNA binding of repressor nuclear factor-kappaB p50/p50 depends on phosphorylation of Ser337 by the protein kinase A catalytic subunit. J Biol Chem. 280(ll):9957-9962. Gunther M, Laithier M , Brison O. (2000) A set of proteins interacting with transcription factor Spl identified in a two-hybrid screening. Mol Cell Biochem. 210(1-2): 131-142. Habetswallner D, Pelosi E, Bulgarini D, Camagna A, Samoggia P, Montesoro E, Giannella G, Lazzaro D, Isacchi G, Testa U. (1988) Activation and proliferation of normal resting human T lymphocytes in serum-free culture: role of IL-4 and IL-6. Immunology. 65(3):357-364. Hakre S, Tussie-Luna MI, Ashworth T, Novina CD, Settleman J, Sharp PA, Roy AL. (2006) Opposing functions of TFII-I spliced isoforms in growth factor-induced gene expression. Mol Cell. 24(2):301-308. Han I, Kudlow JE. (1997) Reduced O glycosylation of Spl is associated with increased proteasome susceptibility. Mol Cell Biol. 17(5):2550-2558. Harrich D, Garcia J, Wu F, Mitsuyasu R, Gonazalez J, Gaynor R. (1989) Role of Spl-binding domains in in vivo transcriptional regulation of the human immunodeficiency virus type 1 long terminal repeat. J Virol. 63(6):2585-2591. 155 Hayes, T.E., A .M. Kitchen, and B.H. Cochran. (1987) Inducible binding of a factor to the c-fos regulatory region. Proc. Natl. Acad. Sci. 84: 1272-1276 He G, Margolis DM. (2002) Counterregulation of chromatin deacetylation and histone deacetylase occupancy at the integrated promoter of human immunodeficiency virus type 1 (HIV-1) by the HIV-1 repressor YY1 and HIV-1 activator Tat. Mol Cell Biol. 22(9):2965-2973. Henderson AJ, Zou X, Calame KL. (1995) C/EBP proteins activate transcription from the human immunodeficiency virus type 1 long terminal repeat in macrophages/monocytes. J Virol. 69(9):5337-5344. Hill CS, Treisman R. (1995) Transcriptional regulation by extracellular signals: mechanisms and specificity. Cell. 80(2): 199-211. Hodge DR, Robinson L, Watson D, Lautenberger J, Zhang X K , Venanzoni M , Seth A. (1996) Interaction of ETS-1 and ERGB/FLI-1 proteins with DNA is modulated by spacing between multiple binding sites as well as phosphorylation. Oncogene. 12(1):11-18. Hoffmeyer A, Avots A, Flory E, Weber CK, Serfling E, Rapp UR. (1998) The GABP-responsive element of the interleukin-2 enhancer is regulated by JNK/SAPK-activating pathways in T lymphocytes. J Biol Chem. 273(17): 10112-10119. Hogan PG, Chen L, Nardone J, Rao A. (2003) Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev. 17(18):2205-2232. Holzmeister J, Ludewig B, Pauli G, Simon D. (1993) Sequence specific binding of the transcription factor c-Etsl to the human immunodeficiency virus type I long terminal repeat. Biochem Biophys Res Commun. 197(3):1229-1233. Hoover T, Mikovits J, Court D, Liu YL, Kung HF, Raziuddin. (1996) A nuclear matrix-specific factor that binds a specific segment of the negative regulatory element (NRE) of HIV-1 LTR and inhibits NF-kappa(B) activity. Nucleic Acids Res. 24(10): 1895-1900. Hou S, Guan H, Ricciardi RP. (2003) Phosphorylation of serine 337 of NF-kappaB p50 is critical for DNA binding. J Biol Chem. 278(46):45994-45998. Huang Y, Wange RL. (2004) T cell receptor signaling: beyond complex complexes. J Biol Chem. 279(28):28827-28830. Isakov N , Altman A. (2002) Protein kinase C(theta) in T cell activation. Annu Rev Immunol. 20:761-794. 156 Kang JJ, Auble DT, Ranish JA, Hahn S. (1995) Mol Cell Biol. Analysis of the yeast transcription factor TFIIA: distinct functional regions and a polymerase II-specific role in basal and activated transcription. 15(3): 1234-1243. Kim DW, Cochran BH. (2001) JAK2 activates TFII-I and regulates its interaction with extracellular signal-regulated kinase. Mol Cell Biol. 21(10):3387-3397. Kushner DB, Ricciardi RP. (1999) Reduced phosphorylation of p50 is responsible for diminished NF-kappaB binding to the major histocompatibility complex class I enhancer in adenovirus type 12-transformed cells. Mol Cell Biol. 19(3):2169-2179. Israel A, Le Bail O, Hatat D, Piette J, Kieran M , Logeat F, Wallach D, Fellous M , Kourilsky P. (1989) TNF stimulates expression of mouse MHC class I genes by inducing an NF kappa B-like enhancer binding activity which displaces constitutive factors. EMBO J. 8(12):3793-3800. Jackson V N , Zammit VA, Price NT. (2000) Identification of positive and negative determinants of malonyl-CoA sensitivity and carnitine affinity within the amino termini of rat liver- and muscle-type carnitine palmitoyltransferase I. J Biol Chem. 275(49):38410-38416. Jenuwein T, Allis CD. (2001) Translating the histone code. Science. 293(5532): 1074-1080. Jiang B, Mendelson CR. (2005) 02 enhancement of human trophoblast differentiation and hCYP19 (aromatase) gene expression are mediated by proteasomal degradation of USF1 and USF2. Mol Cell Biol. 25(20):8824-8833. Jones KA, Kadonaga JT, Luciw PA, Tjian R. (1986) Activation of the AIDS retrovirus promoter by the cellular transcription factor, Spl. Science. 232(4751):755-759. Joshi AA, Struhl K. (2005) Eaf3 chromodomain interaction with methylated H3-K36 links histone deacetylation to Pol II elongation.Mol Cell. 20(6):971-978. Kato H, Horikoshi M , Roeder RG. (1991) Repression of HIV-1 transcription by a cellular protein. Science. 251(5000):1476-1479. Kawakami K, Scheidereit C, Roeder RG. (1988) Identification and purification of a human immunoglobulin-enhancer-binding protein (NF-kappa B) that activates transcription from a human immunodeficiency virus type 1 promoter in vitro. Proc Natl Acad Sci U S A . 85(13):4700-4704. Keogh MC, Kurdistani SK, Morris SA, Aim SH, Podolny V, Collins SR, Schuldiner M , Chin K, Punna T, Thompson NJ, Boone C, Emili A, Weissman JS, Hughes TR, Strahl BD, Grunstein M , Greenblatt JF, Buratowski S, Krogan NJ. (2005) Cotranscriptional set2 157 methylation of histone H3 lysine 36 recruits a repressive Rpd3 complex. Cell. 123(4):593-605. Kim DW, Cheriyath V, Roy AL, Cochran BH. (1998) TFII-I enhances activation of the c-fos promoter through interactions with upstream elements. Mol Cell Biol. 18(6):3310-3320. Kim JW, Monila H, Pandey A, Lane MD. (2007) Upstream stimulatory factors regulate the C/EBP alpha gene during differentiation of 3T3-L1 preadipocytes. Biochem Biophys Res Commun. 354(2):517-521. Kimura A, Israel A, Le Bail O, Kourilsky P. (1986) Detailed analysis of the mouse H-2Kb promoter: enhancer-like sequences and their role in the regulation of class I gene expression. Cell. 44(2):261-272. Kinoshita S, Su L, Amano M, Timmerman LA, Kaneshima H, Nolan GP. (1997) The T cell activation factor NF-ATc positively regulates HIV-1 replication and gene expression in T cells. Immunity. 6(3):235-244. Kinoshita S, Chen BK, Kaneshima H, Nolan GP. (1998) Host control of HIV-1 parasitism in T cells by the nuclear factor of activated T cells. Cell. 95(5):595-604. Kohl NE, Emini EA, Schleif WA, Davis LJ, Heimbach JC, Dixon RA, Scolnick EM, Sigal IS. (1988) Active human immunodeficiency virus protease is required for viral infectivity. Proc Natl Acad Sci U S A . 85(13):4686-4690. Koleske AJ, Young RA. (1995) The RNA polymerase II holoenzyme and its implications for gene regulation. Trends Biochem Sci. 20(3): 113-6. Kurdistani SK, Tavazoie S, Grunstein M . (2004) Mapping global histone acetylation patterns to gene expression. Cell. 117(6):721-733. Kwong PD, Wyatt R, Robinson J, Sweet RW, Sodroski J, Hendrickson WA. (1998) Structure of an HIV gpl20 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature. 393(6686):648-659. Laemmli UK. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227(5259):680-685. Lagrange T, Kim TK, Orphanides G, Ebright YW, Ebright RH, Reinberg D. (1996) High-resolution mapping of nucleoprotein complexes by site-specific protein-DNA photocrosslinking: organization of the human TBP-TFIIA-TFIIB-DNA quaternary complex. Proc Natl Acad Sci U S A . 93(20):10620-10625. 158 Lenardo MJ, Staudt L, Robbins P, Kuang A, Mulligan RC, Baltimore D. (1989) Repression of the IgH enhancer in teratocarcinoma cells associated with a novel octamer factor. Science. 243(4890):544-546.a Lenardo MJ, Kuang A, Gifford A, Baltimore D. (1989) Purified bovine NF-kappa B recognizes regulatory sequences in multiple genes expressed during activation of T- and B-lymphocytes. Haematol Blood Transfus. 32:411-415.b L i B, Carey M , Workman JL. (2007) The role of chromatin during transcription. Cell. 128(4):707-719. L i C, Lai CF, Sigman DS, Gaynor RB. (1991) Cloning of a cellular factor, interleukin binding factor, that binds to NFAT-like motifs in the human immunodeficiency virus long terminal repeat. Proc Natl Acad Sci U S A . 88(17):7739-7743. Li CC, Dai RM, Chen E, Longo DL. (1994) Phosphorylation of NF-KBl-p50 is involved in NF-kappa B activation and stable DNA binding. J Biol Chem. 269(48):30089-30092. L i YC, Ross J, Scheppler JA, Franza BR. (1991) An in vitro transcription analysis of early responses of the human immunodeficiency virus type 1 long terminal repeat to different transcriptional activators. Mol Cell Biol. 11(4):1883-1893. Lima VD, Hogg RS, Harrigan PR, Moore D, Yip B, Wood E, Montaner JS. (2007) Continued improvement in survival among HIV-infected individuals with newer forms of highly active antiretroviral therapy. AIDS. 21(6):685-692. Llano M , Saenz DT, Meehan A, Wongthida P, Peretz M , Walker WH, Teo W, Poeschla E M . (2006) An essential role for LEDGF/p75 in HIV integration. Science. 314(5798):461-464. Lopez-Rodriguez C, Aramburu J, Rakeman AS, Rao A. (1999) NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. Proc Natl Acad Sci U S A. 96(13):7214-7219. Luger K, Mader AW, Richmond RK, Sargent DF, Richmond TJ. (1997) Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389(6648):251-260. Luo X , Sawadogo M . (1996) Functional domains of the transcription factor USF2: atypical nuclear localization signals and context-dependent transcriptional activation domains. Mol Cell Biol. 16(4):1367-1375. Lu YC, Touzjian N , Stenzel M , Dorfman T, Sodroski JG, Haseltine WA. (1990) Identification of cis-acting repressive sequences within the negative regulatory element of human immunodeficiency virus type 1. J Virol. 64(10):5226-5229. 159 Lu X, Welsh TM, Peterlin BM. (1993) The human immunodeficiency vims type 1 long terminal repeat specifies two different transcription complexes, only one of which is regulated by Tat. J Virol. 67(4): 1752-1760. MacLean JA, Rao MK, Doyle K M , Richards JS, Wilkinson MF. (2005) Regulation of the Rhox5 homeobox gene in primary granulosa cells: preovulatory expression and dependence on SP1/SP3 and GABP. Biol Reprod. 73(6): 1126-1134. Maertens GN, Cherepanov P, Engelman A. (2006) Transcriptional co-activator p75 binds and tethers the Myc-interacting protein JP02 to chromatin. Cell Sci. 119(Pt 12):2563-2571. Majello B, De Luca P, Hagen G, Suske G, Lania L. (1994) Different members of the Spl multigene family exert opposite transcriptional regulation of the long terminal repeat of HIV-1. Nucleic Acids Res. 22(23):4914-4921. Malcolm T, Chen J, Estable MC, Roeder RG, Sadowski I. (2005) TFII-I regulates induction of chromosomally integrated human immunodeficiency virus type 1 long terminal repeat in cooperation with USF. J Virol. 79(7):4396-43406. Malcolm T, Chen J, Chang C, Sadowski I. (2007) Induction of chromosomally integrated HIV-1 LTR requires RBF-2 (USF/TFII-I) and RAS/MAPK signaling. Virus Genes. 35(2):215-223. Malim MH, Hauber J, Le SY, Maizel JV, Cullen BR. (1989) The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature. 338(6212):254-257. Manninen A, Renkema GH, Saksela K. (2000) Synergistic activation of NFAT by HIV-1 nef and the Ras/MAPK pathway. J Biol Chem. 275(22):16513-16517. Manzano-Winkler B, Novina CD, Roy AL. (1996) Additions and Corrections to TFII-I is required for transcription of the naturally TATA-less but initiator-containing Vbeta promoter. J Biol Chem. 271(28): 16982. Manzano-Winkler B, Novina CD, Roy AL. (1996) TFII is required for transcription of the naturally TATA-less but initiator-containing Vbeta promoter. J Biol Chem. 271(20):12076-12081. Marais R, Light Y, Mason C, Paterson H, Olson MF, Marshall CJ. (1998) Requirement of Ras-GTP-Raf complexes for activation of Raf-1 by protein kinase C. Science. 280(5360): 109-112. Margolis DM, Somasundaran M , Green MR. (1994) Human transcription factor YY1 represses human immunodeficiency virus type 1 transcription and virion production. J Virol. 68(2):905-910. 160 Markovitz DM, Smith MJ, Hilfinger J, Hannibal MC, Petryniak B, Nabel GJ. (1992) Activation of the human immunodeficiency virus type 2 enhancer is dependent on purine box and kappa B regulatory elements. J Virol. 66(9):5479-5484. Masuda ES, Tokumitsu H, Tsuboi A, Shlomai J, Hung P, Arai K, Arai N. (1993) The granulocyte-macrophage colony-stimulating factor promoter cis-acting element CLEO mediates induction signals in T cells and is recognized by factors related to API and NFAT. Mol Cell Biol. 13(12):7399-7407. Mattioli I, Sebald A, Bucher C, Charles RP, Nakano H, Doi T, Kracht M , Schmitz ML. (2004) Transient and selective NF-kappa B p65 serine 536 phosphorylation induced by T cell costimulation is mediated by I kappa B kinase beta and controls the kinetics of p65 nuclear import. J Immunol. 172(10):6336-6344. McAllister JJ, Phillips D, Millhouse S, Conner J, Hogan T, Ross HL, Wigdahl B. (2000) Analysis of the HIV-1 LTR NF-kappaB-proximal Sp site III: evidence for cell type-specific gene regulation and viral replication. Virology. 274(2):262-277. Mobley CM, Sealy L. (2000) The Rous sarcoma virus long terminal repeat promoter is regulated by TFII-I. J Virol. 74(14):6511-6519. Montano MA, Kripke K, Norina CD, Achacoso P, Herzenberg LA, Roy AL, Nolan GP. (1996) NF-kappa B homodimer binding within the HIV-1 initiator region and interactions with TFII-I. Proc Natl Acad Sci U S A . 93(22): 12376-12381. Moore JP. (1997) Coreceptors: implications for HIV pathogenesis and therapy. Science. 276(5309):51-2. Moore AL, Roe MW, Melnick RF, Lidofsky SD. (2002) Calcium mobilization evoked by hepatocellular swelling is linked to activation of phospholipase Cgamma. J Biol Chem. 277(37):34030-34035. Muesing MA, Smith DH, Capon DJ. (1987) Regulation of mRNA accumulation by a human immunodeficiency virus trans-activator protein. Cell. 48(4):691-701. Naar A M , Beaurang PA, Zhou S, Abraham S, Solomon W, Tjian R. (1999) Composite co-activator ARC mediates chromatin-directed transcriptional activation. Nature. 398(6730):828-832. Nakashima H, Matsui T, Harada S, Kobayashi N , Matsuda A, Ueda T, Yamamoto N . (1986) Inhibition of replication and cytopathic effect of human T cell lymphotropic virus type III/lymphadenopathy-associated virus by 3'-azido-3'-deoxythymidine in vitro. Antimicrob Agents Chemother. (6): 93 3-93 7. 161 Neely KE, Hassan AH, Brown CE, Howe L, Workman JL. (2002) Transcription activator interactions with multiple SWI/SNF subunits. Mol Cell Biol. 22(6):1615-1625. Niederman TM, Garcia JV, Hastings WR, Luria S, Ratner L. (1992) Human immunodeficiency virus type 1 Nef protein inhibits NF-kappa B induction in human T cells. J Virol. 66(10):6213-6219. Nonnemacher MR, Irish BP, Liu Y, Mauger D, Wigdahl B. (2004) Specific sequence configurations of HIV-1 LTR G/C box array result in altered recruitment of Sp isoforms and correlate with disease progression. J Neuroimmunol. 157(l-2):39-47. Novina CD, Kumar S, Bajpai U, Cheriyath V, Zhang K, Pillai S, Wortis HH, Roy AL. (1999) Regulation of nuclear localization and transcriptional activity of TFII-I by Bruton's tyrosine kinase. Mol Cell Biol. 19(7):5014-5024. Orenstein JM, Meltzer MS, Phipps T, Gendelman HE. (1988) Cytoplasmic assembly and accumulation of human immunodeficiency virus types 1 and 2 in recombinant human colony-stimulating factor-1-treated human monocytes: an ultrastructural study. J Virol. 62(8):2578-2586. Ou SH, Garcia-Martinez LF, Paulssen EJ, Gaynor RB. (1994) Role of flanking E box motifs in human immunodeficiency virus type 1 TATA element function. J Virol. 68(11) :7188-7199. Ou SH, Wu F, Harrich D, Garcia-Martinez LF, Gaynor RB. (1995) Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immunodeficiency virus type 1 TAR DNA sequence motifs. J Virol. 69(6):3584-3596. Ouyang L, Jacob KK, Stanley FM. (1996) GABP mediates insulin-increased prolactin gene transcription. J Biol Chem. 271(18): 10425-10428. Ozes ON, Mayo LD, Gustin JA, Pfeffer SR, Pfeffer L M , Donner DB. (1999) NF-kappaB activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature. 401(6748):82-85. Pajukanta P, Lilja HE, Sinsheimer JS, Cantor RM, Lusis AJ, Gentile M , Duan XJ, Soro-Paavonen A, Naukkarinen J, Saarela J, Laakso M , Ehnholm C, Taskinen MR, Peltonen L. (2004) Familial combined hyperlipidemia is associated with upstream transcription factor 1 (USF1). Nat Genet. 36(4):371-376. Parada CA, Yoon JB, Roeder RG. (1995) A novel LBP-1 -mediated restriction of HIV-1 transcription at the level of elongation in vitro. J Biol Chem. 270(5):2274-2283. Parrott C, Seidner T, Duh E, Leonard J, Theodore TS, Buckler-White A, Martin MA, Rabson A B J Virol. (1991) Variable role of the long terminal repeat Spl-binding sites in human immunodeficiency virus replication in T lymphocytes. 65(3): 1414-1419. 162 Pazin MJ, Sheridan PL, Cannon K, Cao Z, Keck JG, Kadonaga JT, Jones KA. (1996) NF-kappa B-mediated chromatin reconfiguration and transcriptional activation of the HIV-1 enhancer in vitro. Genes Dev. 10(l):37-49. Perez Jurado LA, Wang YK, Peoples R, Coloma A, Cruces J, Francke U. (1998) A duplicated gene in the breakpoint regions of the 7ql 1.23 Williams-Beuren syndrome deletion encodes the initiator binding protein TFII-I and BAP-135, a phosphorylation target of BTK. Hum Mol Genet. 7(3):325-334. Pokholok DK, Harbison CT, Levine S, Cole M , Hannett NM, Lee TI, Bell GW, Walker K, Rolfe PA, Herbolsheimer E, Zeitlinger J, Lewitter F, Gifford DK, Young RA. (2005) Genome-wide map of nucleosome acetylation and methylation in yeast. Cell. 122(4):517-527. Ptashne, M . 2003. Regulated recruitment and cooperativity in the design of biological regulatory systems. Philos. Trans. Ser. A 361:1223-1234. Rachez C, Lemon BD, Suldan Z, Bromleigh V, Gamble M , Naar A M , Erdjument-Bromage H, Tempst P, Freedman LP. (1999) Ligand-dependent transcription activation by nuclear receptors requires the DRIP complex. Nature. 398(6730):824-828. Remboutsika E, Yamamoto K, Harbers M, Schmutz M . (2002) The bromodomain mediates transcriptional intermediary factor 1 alpha -nucleosome interactions. J Biol Chem. 277(52):50318-50325. Ranjbar S, Tsytsykova A V , Lee SK, Rajsbaum R, Falvo JV, Lieberman J, Shankar P, Goldfeld AE. (2006) NFAT5 regulates HIV-1 in primary monocytes via a highly conserved long terminal repeat site. PLoS Pathog. 2(12): 130. Rao A, Luo C, Hogan PG. (1997) Transcription factors of the NFAT family: regulation and function. Annu Rev Immunol. 707-747. Reisman D, Rotter V. (1993) The helix-loop-helix containing transcription factor USF binds to and transactivates the promoter of the p53 tumor suppressor gene. Nucleic Acids Res. 21(2):345-350. Romerio F, Gabriel MN, Margolis DM. (1997) Repression of human immunodeficiency virus type 1 through the novel cooperation of human factors YY1 and LSF. J Virol. 71(12):9375-9382. Roulston A, Lin R, Beauparlant P, Wainberg MA, Hiscott J. (1995) Regulation of human immunodeficiency virus type 1 and cytokine gene expression in myeloid cells by NF kappa B/Rel transcription factors. Microbiol Rev. 59(3):481-505. 163 Roy AL, Meisterernst M , Pognonec P, Roeder RG. (1991) Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature. 354(6350):245-248. Sassone-Corsi P, Wildeman A, Chambon P. (1985) A trans-acting factor is responsible for the simian virus 40 enhancer activity in vitro. Nature. 313(6002):458-463. Sawadogo M , Roeder RG. (1985) Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell. 43(1): 165-175. Sawadogo M . (1988) Multiple forms of the human gene-specific transcription factor USF. II. DNA binding properties and transcriptional activity of the purified HeLa USF. J Biol Chem. 263(24): 11994-12001. Sawadogo M , Van Dyke MW, Gregor PD, Roeder RG. (1988) Multiple forms of the human gene-specific transcription factor USF. I. Complete purification and identification of USF from HeLa cell nuclei. J Biol Chem. 263(24): 11985-11993. Schweppe RE, Gutierrez-Hartmann A. (2001) Pituitary Ets-1 and GABP bind to the growth factor regulatory sites of the rat prolactin promoter. Nucleic Acids Res. 29(5):1251-1260. Schroder AR, Shinn P, Chen H, Berry C, Ecker JR, Bushman F. (2002) HIV-1 integration in the human genome favors active genes and local hotspots. Cell. 110(4):521-529. Schwabish MA, Struhl K. (2004) Evidence for eviction and rapid deposition of histones upon transcriptional elongation by RNA polymerase II. Mol Cell Biol. 24(23): 10111-10117. Seeler JS, Muchardt C, Suessle A, Gaynor RB. (1994) Transcription factor PRDII-BF1 activates human immunodeficiency virus type 1 gene expression. J Virol. 68(2): 1002-1009. Seeler JS, Marchio A, Losson R, Desterro JM, Hay RT, Chambon P, Dejean A. (2001) Common properties of nuclear body protein SP100 and TIF1 alpha chromatin factor: role of SUMO modification. Mol Cell Biol. 21(10):3314-3324. Seth A, Hodge DR, Thompson DM, Robinson L, Panayiotakis A, Watson DK, Papas TS. (1993) ETS family proteins activate transcription from HIV-1 long terminal repeat. AIDS Res Hum Retroviruses. 9(10): 1017-10123. Shaw JP, Utz PJ, Durand DB, Toole JJ, Emmel EA, Crabtree GR. (1988) Identification of a putative regulator of early T cell activation genes. Science. 241(4862):202-205. 164 Sheridan PL, Sheline CT, Cannon K, Voz ML, Pazin MJ, Kadonaga JT, Jones KA. (1995) Activation of the HIV-1 enhancer by the LEF-1 HMG protein on nucleosome-assembled DNA in vitro. Genes Dev. 9(17):2090-2104. Shi Y, Seto E, Chang LS, Shenk T. (1991) Transcriptional repression by YY1, a human GLI-Kriippel-related protein, and relief of repression by adenovirus E l A protein. Cell. 67(2):377-388. Sirito M , Lin Q, Maity T, Sawadogo M . (1994) Ubiquitous expression of the 43- and 44-kDa forms of transcription factor USF in mammalian cells. Nucleic Acids Res. 22(3):427-33. Smih F, Rouet P, Lucas S, Mairal A, Sengenes C, Lafontan M , Vaulont S, Casado M , Langin D. (2002) Transcriptional regulation of adipocyte hormone-sensitive lipase by glucose. Diabetes. 51(2):293-300. Speck RF, Wehrly K, Piatt EJ, Atchison RE, Charo IF, Kabat D, Chesebro B, Goldsmith MA. (1997) Selective employment of chemokine receptors as human immunodeficiency virus type 1 coreceptors determined by individual amino acids within the envelope V3 loop. J Virol. 71(9):7136-7139. Sperisen P, Wang SM, Soldaini E, Pla M , Rusterholz C, Bucher P, Corthesy P, Reichenbach P, Nabholz M . (1995) Mouse interleukin-2 receptor alpha gene expression. Interleukin-1 and interleukin-2 control transcription via distinct cis-acting elements. J Biol Chem. 270(18): 10743-10753. Steffan NM, Bren GD, Frantz B, Tocci MJ, O'Neill EA, Paya CV. (1995) Regulation of IkB alpha phosphorylation by PKC- and Ca(2+)-dependent signal transduction pathways. J Immunol. 155(10):4685-4691. Stern JB, Smith KA. Science. (1986) Interleukin-2 induction of T-cell G l progression and c-myb expression. Nature medicine review. 233(4760) :203-206. Suzan M , Salaun D, Neuveut C, Spire B, Hirsch I, Le Bouteiller P, Querat G, Sire J. (1991) Induction of NF-KB during monocyte differentiation by HIV type 1 infection. J. Immunol. 146(l):377-383. Tanaka J, Ishida T, Choi BI, Yasuda J, Watanabe T, Iwakura Y. (2003) Latent HIV-1 reactivation in transgenic mice requires cell cycle -dependent demethylation of CREB/ATF sites in the LTR. AIDS. 17(2): 167-175. Thiel G, Lietz M, Hohl M. (2004) How mammalian transcriptional repressors work. Eur J Biochem. 271(14):2855-2862. Thompson CB, Wang CY, Ho IC, Bohjanen PR, Petryniak B, June CH, Miesfeldt S, Zhang L, Nabel GJ, Karpinski B, et al. (1992) cis-acting sequences required for inducible 165 interleukin-2 enhancer function bind a novel Ets-related protein, Elf-1. Mol Cell Biol. 12(3):1043-1053. Thompson PD, Webb M , Beckett W, Hinsley T, Jowitt T, Sharrocks AD, Tassabehji M . (2007) GTF2IRD1 regulates transcription by binding an evolutionarily conserved DNA motif'GUCE'. FEBS Lett. 581(6):1233-1242. Tong-Starkesen SE, Luciw PA, Peterlin BM. (1989) Signaling through T lymphocyte surface proteins, TCR/CD3 and CD28, activates the HIV-1 long terminal repeat. J Immunol. 142(2):702-707. Trushin SA, Pennington KN, Algeciras-Schimnich A, Paya CV. (1999) Protein kinase C and calcineurin synergize to activate IkappaB kinase and NF-kappaB in T lymphocytes. J Biol Chem. 274(33):22923-22931. Tsukiyama T, Wu C. (1997) Chromatin remodeling and transcription. Curr Opin Genet Dev. 7(2): 182-191. Turlure F, Maertens G, Rahman S, Cherepanov P, Engelman A. (2006) A tripartite DNA-binding element, comprised of the nuclear localization signal and two AT-hook motifs, mediates the association of LEDGF/p75 with chromatin in vivo. Nucleic Acids Res. 34(5):1653-1675. Tussie-Luna MI, Bayarsaihan D, Seto E, Ruddle FH, Roy AL. (2002) Physical and functional interactions of histone deacetylase 3 with TFII-I family proteins and PIASxbeta. Proc Natl Acad Sci U S A . 99(20): 12807-12812a. Tussie-Luna MI, Michel B, Hakre S, Roy AL. (2002) The SUMO ubiquitin-protein isopeptide ligase family member Mizl/PIASxbeta /Siz2 is a transcriptional cofactor for TFII-I. J Biol Chem. 277(45):43185-43193b. Verdin E, Paras P, Van Lint C. (1993) Chromatin disruption in the promoter of human immunodeficiency virus type 1 during transcriptional activation. EMBO J 12(12):4900. Vertegaal AC, Kuiperij HB, Yamaoka S, Courtois G, van der Eb AJ, Zantema A. (2000) Protein kinase C-alpha is an upstream activator of the IkappaB kinase complex in the TPA signal transduction pathway to NF-kappaB in U20S cells. Cell Signal. 12(11-12):759-768. Veschambre P, Simard P, Jalinot P. (1995) Evidence for functional interaction between the HIV-1 Tat transactivator and the TATA box binding protein in vivo. J Mol Biol. 250(2):169-180. Viollet B, Lefrancois-Martinez A M , Henrion A, Kahn A, Raymondjean M , Martinez A. (1996) Immunochemical characterization and transacting properties of upstream stimulatory factor isoforms. J Biol Chem. 271(3):1405-1415. 166 Vullhorst D, Buonanno A. (2005) Multiple GTF2I-like repeats of general transcription factor 3 exhibit DNA binding properties. Evidence for a common origin as a sequence-specific DNA interaction module. J Biol Chem. 280(36):31722-31731. Wagner, B.J., T.E. Hayes, C.J. Hoban, and B.H. Cochran. (1990) The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter. EMBO J. 9: 4477-4484 Wakefield L M , Piek E, Bottinger EP. (2001) TGF-beta signaling in mammary gland development and tumorigenesis. J Mammary Gland Biol Neoplasia. 6(l):67-82. Wasylyk B, Wasylyk C, Flores P, Begue A, Leprince D, Stehelin D. (1990) The c-ets proto-oncogenes encode transcription factors that cooperate with c-Fos and c-Jun for transcriptional activation. Nature. 346(6280): 191-193. Wasylyk C, Maira SM, Sobieszczuk P, Wasylyk B. (1994) Reversion of Ras transformed cells by Ets transdominant mutants. Oncogene. 9(12):3665-3673. Waterman ML, Jones K A . (1990) Purification of TCF-1 alpha, a T-cell-specific transcription factor that activates the T-cell receptor C alpha gene enhancer in a context-dependent manner. New Biol. 2(7):621-636. Werlen G, Jacinto E, Xia Y, Karin M . (1998) Calcineurin preferentially synergizes with PKC-theta to activate JNK and IL-2 promoter in T lymphocytes. EMBO J. 17(11):3101-3111. West AG, Huang S, Gaszner M , Lift MD, Felsenfeld G. (2004) Recruitment of histone modifications by USF proteins at a vertebrate barrier element. Mol Cell. 16(3):453-463. Wu Y, Patterson C. (1999) The human KDR/flk-1 gene contains a functional initiator element that is bound and transactivated by TFII-I. J Biol Chem. 274(5):3207-3214. Xavier R, Seed B. (1999) Membrane compartmentation and the response to antigen. Curr Opin Immunol. ll(3):265-269. Yang BS, Hauser CA, Henkel G, Colman MS, Van Beveren C, Stacey KJ, Hume DA, Maki RA, Ostrowski MC. (1996) Ras-mediated phosphorylation of a conserved threonine residue enhances the transactivation activities of c-Etsl and c-Ets2. Mol Cell Biol. 16(2):538-547. Yang WM, Yao YL, Sun JM, Davie JR, Seto E. (1997) Isolation and characterization of cDNAs corresponding to an additional member of the human histone deacetylase gene family. J Biol Chem. 272(44):28001-28007. 167 Yang X, Chen Y, Gabuzda D. (1999) ERK MAP kinase links cytokine signals to activation of latent HIV-1 infection by stimulating a cooperative interaction of AP-1 and NF-kappaB.J Biol Chem. 274(39):27981-27988. Yang YA, Tang B, Robinson G, Hennighausen L, Brodie SG, Deng CX, Wakefield L M . (2002) Smad3 in the mammary epithelium has a nonredundant role in the induction of apoptosis, but not in the regulation of proliferation or differentiation by transforming growth factor-beta. Cell Growth Differ. 13(3): 123-130. Yang Z, Engel JD. (1993) Human T cell transcription factor GATA-3 stimulates HIV-1 expression.Nucleic Acids Res. 21(12):2831-2836. Yarchoan R, Klecker RW, Weinhold KJ, Markham PD, Lyerly HK, Durack DT, Gelmann E, Lehrman SN, Blum RM, Barry DW. (1986) Administration of 3'-azido-3' deoxythymidine, an inhibitor of HTLV-III/LAV replication, to patients with AIDS or AIDS-related complex. Lancet. (8481):575-580. Ye J, Xu RH, Taylor-Papadimitriou J, Pitha PM. (1996) Spl binding plays a critical role in Erb-B2- and v-ras-mediated downregulation of alpha2-integrin expression in human mammary epithelial cells. Mol Cell Biol. 16(11):6178-6189. Ye J, Cippitelli M , Dorman L, Ortaldo JR, Young HA. (1996) The nuclear factor YY1 suppresses the human gamma interferon promoter through two mechanisms: inhibition of API binding and activation of a silencer element. Mol Cell Biol. 16(9):4744-4753. Ye J, Zhang X, Dong Z. (1996) Characterization of the human granulocyte-macrophage colony-stimulating factor gene promoter: an API complex and an Spl-related complex transactivate the promoter activity that is suppressed by a YY1 complex. Mol Cell Biol. 16(1):157-167. Yokota T, Otsuka T, Mosmann T, Banchereau J, DeFrance T, Blanchard D, De Vries JE, Lee F, Arai K. (1986) Isolation and characterization of a human interleukin cDNA clone, homologous to mouse B-cell stimulatory factor 1, that expresses B-cell- and T-cell-stimulating activities. Proc Natl Acad Sci U S A . 83(16):5894-5898. Yoon JB, L i G, Roeder RG. (1994) Characterization of a family of related cellular transcription factors which can modulate human immunodeficiency virus type 1 transcription in vitro. Mol Cell Biol. 14(3): 1776-1785. Yuan GC, Liu YJ, Dion MF, Slack MD, Wu LF, Altschuler SJ, Rando OJ. (2005) Genome-scale identification of nucleosome positions in S. cerevisiae. Science. 309(5734):626-630. Zawel L, Reinberg D. (1992) Advances in RNA polymerase II transcription. Curr Opin Cell Biol. 4(3):488-495. 168 Zeichner SL, Kim JY, Alwine JC. (1991) Linker-scanning mutational analysis of the transcriptional activity of the human immunodeficiency virus type 1 long terminal repeat. J Virol. 65(5):2436-2444. Zhang L, Huang Y, Yuan H, Chen BK, Ip J, Ho DD. (1997) Identification of a replication-competent pathogenic human immunodeficiency virus type 1 with a duplication in the TCF-1 alpha region but lacking NF-kappaB binding sites. J Virol. 71(2):1651-1656. Zhu Y, Pe'ery T, Peng J, Ramanathan Y, Marshall N , Marshall T, Amendt B, Mathews MB, Price DH. (1997) Transcription elongation factor P-TEFb is required for HIV-1 tat transactivation in vitro. Genes Dev. (20):2622-2632. Zijderveld DC, d'Adda di Fagagna F, Giacca M, Timmers HT, van der Vliet PC. (1994) Stimulation of the adenovirus major late promoter in vitro by transcription factor USF is enhanced by the adenovirus DNA binding protein. J Virol. 68(12):8288-8295. 169 6. Appendix I: Experimental Oligonucleotides Name of Oligonucleotide Sequence of Oligonucleotide P3C RBEIII GATCCTTCAAGAACTGCTGACATCGAGCTTTCTC GAAGTTCTTGACGACTGTAGCTCGAAAGAGCTAG P3CM RBEIIIm GATCCTTCAAGAACTGC act CATCGAGCTTTCTC GAAGTTCTTGACG tga GTAGCTCGAAAGAGCTAG TM RBEIII 3'A AATTCTTCAAGAACTGCTGA GAAGTTCTTGACGACTTTAA TM RBEIII 5' A AATTACTGCTGACATCGAGCTTTCTC TGACGACTGTAGCTCGAAAGAGTTAA RBEIII Core AATTAACTGCTGACA TTGACGACTGTTTAA EBox Core AATTATCACGTGGCA TAGTGCACCGTTTAA RBEI AATTATGCTGCATATAAGCAGCTGCTTTTTGCCTGTACT TACGACGTATATTCGTCGACGAAAAACGGACATGATTAA RBEIm AATTATGCTGCATATAAGCAGCTTTTTGCCTGTACT TACGACGTATATTCGTCGAAAAACGGACATGATTAA AdML AATTTACAGGATGTCTCACACTCTCTACATCTG ATGTCCTACAGAGTGTGAGAGATGTAGACTTAA c-fos SRE AATTTACAGGATGTCCATATTAGGACATCT ATGTCCTACAGGTATAATCCTGTAGATTAA pmi2 SRE AATTTACAGGATGTGGATATTACCACATCTG ATGTCCTACACCTATAATGGTGTAGACTTAA c-fos SIE AATTGCCGGCGAGCAGTTCCCGTCAATCCCTC CGGCCGCTCGTCAAGGGCAGTTAGGGAGTTAA m67 SIE AATTGCCGGCGAGCATTTCCCGTAAATCCCTC CGGCCGCTCGTAAAGGGCATTTAGGGAGTTAA 170 Name of Oligonucleotide Sequence of Oligonucleotide TSSC Inr AATTTAAACGCCATTTTACCATTCACCACATTGGT ATTTGCGGTAAAATGGTAAGTGGTGTAACCATTAA oTM A GATC g TTCAAAGACTGCTGACATCGAGCTTTCTC c AAGTTTCTGACGACTGTAGCTCGAAAGAGCTAG oTMB GATCC aag AAAGACTGCTGACATCGAGCTTTCTC G ttc TTTCTGACGACTGTAGCTCAAAGAGCTAG oTMC GATCCTTC ttc GACTGCTGACATCGAGCTTTCTC GAAG aag CTGACGACTGTAGCTCGAAAGAGCTAG oTMD GATCCTTCAA acca TGCTGACATCGAGCTTTCTC GAAGTT tggt ACGACTGTAGCTCGAAAGAGCTAG oTME GATCCTTCAAAGAC acg TGACATCGAGCTTTCTC GAAGTTTCTG tgc AGTGTAGCTCGAAAGAGCTAG oTMF GATCCTTCAAAGACTGC actg ATCGAGCTTTCTC GAAGTTTCTGACG tgac TAGCTCGAAAGAGCTAG oTMG GATCCTTCAAAGACTGCTGA gtag GAGCTTTCTC GAAGTTTCTGACGACT catc CTCGAAAGAGCTAG oTMH GATCCTTCAAAGACTGCTGACATC ctcg TTTCTC GAAGTTTCTGACGACTGTA gage AAAGAGCTAG oTMI GATCCTTCAAAGACTGCTGACATCGAGCTT agag GAAGTTTCTGACGACTGTAGCTCGAA tctc CTAG oTMK GATCCTTCAAGAACTGCTGA g ATCGAGCTTTCTC GAAGTTCTTGACGACT c TAGCTCGAAAGAGCTAG oTML GATCCTTCAAGAACTGCTGAC t TCGAGCTTTCTC GAAGTTCTTGACGACTG a AGCTCGAAAGAGCTAG o T M M GATCCTTCAAGAACTGCTGACA a CGAGCTTTCTC GAAGTTCTTGACGACTGT t GCTCGAAAGAGCTAG oTMN GATCCTTCAAGAACTGCTGACAT g GAGCTTTCTC GAAGTTCTTGACGACTGT A c CTCGAAAGAGCTAG 171 Name of Oligonucleotide Sequence of Oligonucleotide oTMO GATCCTTCAAGAACTGCTGACATCGAG g TTTCTC GAAGTTCTTGACGACTGTAGCTC c AAAGAGCTAG oTMP GATCCTTCAAGAACTGCTGACATCGAGC a TTCTC GAAGTTCTTGACGACTGTAGCTCG t AAGAGCTAG oTMQ GATCCTTCAAGAACTGCTGACATCGAGCT a TCTC GAAGTTCTTGACGACTGTAGCTCGA t AGAGCTAG oTMR GATCCTTCAAGAACTGCTGACATCGAGCTT a CTC GAAGTTCTTGACGACTGTAGCTCGAA t GAGCTAG TM106 For T7 BAC USF 1/2 CCCTCGAGTAATACGACTCACTATAGGGAGTCATACCGTCCC ACCAT BAC REV OIS381 TTATGTTTCAGGTTCAGGGGGAGGTGTGGGA TM015For His TFII-I CCCGGGATCCCCATGGCCGTCGACCATCACCATCACCATCAT ATGGCCCAAGTTGCAATGTCC TM017Rev HA TFII-I GCTCTAGAGCTTACAGCGACGCATAGTCAGGAACATCGTATG GGTACCACGTGGGGTCTGGTTCTTG TM122 For pLAI fp AGGCGCGCCTCCCTGAGAGAGAAGTG TM123 Rev pLAI fp GCTCTAGAGCAGAGAGCTCCCAGGCTCA TM124 Rev pLAI Int fp GCTCTAGAGCCTCCCCAGTCCCGCCC TM223 For RI TFII-I CGCGGATCCGCGATGAGTGTAGATGCTGTA TM239 Rev RI TFII-I CCGCTCGAGCGGTTAACCACCTACATGCTTCTT TM225 For R2 TFII-I CGCGGATCCGCGTTCGAGAAATGGAATGCT 172 Name of Oligonucleotide Sequence of Oligonucleotide TM241 Rev R2 TFII-I CCGCTCGAGCGGTTAATCTTCACGTGTTGAATT TM227 For R3 TFII-I CGCGGATCCGCGAAGGAAGAATGGTATGCC TM242 Rev R3 TFII-I CCGCTCGAGCGGTTAAACTTCAGTGGTACTGTG TM229 For R4 TFII-I CGCGGATCCGCGAAAGAAGATTGGAATGTC TM243 Rev R4 TFII-I CCGCTCGAGCGGTTACCCAGGAGGCAAGTAGGA TM231 For R5 TFII-I CGCGGATCCGCGTTTGAGGCCTGGAATGCC TM244 Rev R5 TFII-I CCGCTCGAGCGGTTAGCTCTCCTTAATCGCCGT TM233 For R6 TFII-I CGCGGATCCGCGAGACTCTCGAAAGTTGAA TM245 Rev R6 TFII-I CCGCTCGAGCGGTTACAGCTGGTTATTAATCAC TM273 + SDM RBEIII CTTCAAGAACTGC act CATCGAGCTTGCTAC TM274 - SDM RBEIII GTAGCAAGCTCGATG agt GCAGTTCTTGAAG TM277 + SDM TFII-I pmut CAAGAACTGCTGACA a CGAGCTTGCTACAAG TM278 - SDM TFII-I pmut CTTGTAGCAAGCTCG a TGTCAGCAGTTCTTG TM315For T7 pET30a AGATCGATCTCGATCCCG 173 Name of Oligonucleotid Sequence of Oligonucleotide e TMS 16 Rev pET30a CAAAAAACCCCTCAAGAC TM329 Rev TFII-I I-repeat ATCTCAGTGGTGGTGGTGGTGGTGCTCGAGCGGT TM330 For TFII-I I-repeat GGAATTCCGCCACCATGGGGCCGCCGTTGTTGAGGTTGGTGCA CCATCATCATCATCATTCTTCTGG TM331 For dsRed GCACGCAGGTTCTCCGGCCGCTTAATTAGTAACTTCACCATGGC CTCCTC TM332 Rev dsRed CCATCGATGGCTACAGGAACAGGTGGTGG 174 7. Appendix II. Plasmids used in this study. Name Description pTM005 Yeast vector expressing GAL4 DNA-binding domain fused to TFII-I with a VP 16 fusion. Used in RTA two-hybrid screen pTM008 6xHis TFII-I HA Fastbacl Baculoviral vector pJC031 USF 1-Flag Fastbacl Baculoviral vector pJC032 USF2-Flag Fastbacl Baculoviral vector pTM3234 Wild type pLAI LTR subcloned into pTy-eGFP reporter construct for integrated stable cell lines pTM3235 Wild type pLAI LTR subcloned into pBluescript KII. Used for generation of LTR mutants with site-directed mutagenesis pTM3257 pTM3235 mutagenesis plasmid, pLAI HIV-1 LTR with the ACT mutation in the RBEIII site pTM3258 pTM3235 mutagenesis plasmid, pLAI HIV-1 LTR with a mutation in the putative TFII-I binding site pTM3259 RBEIII ACT mutant pLAI LTR subcloned into pTy-eGFP reporter construct for integrated stable cell lines pTM3260 RBEIII TFII-I point mutant oTML pLAI LTR subcloned into pTy-eGFP reporter construct for integrated stable cell lines RSV Tat 2213 HIV-1 Tat encoding plasmid with RSV promoter for retroviral transfection IOX 576 HIV-1 gag-pol encoding plasmid for retroviral transfection IOX 577 HIV-1 Rev encoding plasmid for retroviral transfection 175 Name Description IOX 578 Vsv-g encoding plasmid for retroviral transfection pTM3252 R2 domain of TFII-I subcloned into pET30a. Used for PCR amplification of templates for in vitro translation pTM3253 R3 domain of TFII-I subcloned into pET30a. Used for PCR amplification of templates for in vitro translation pTM3254 R4 domain of TFII-I subcloned into pET30a. Used for PCR amplification of templates for in vitro translation pTM3255 R5 domain of TFII-I subcloned into pET30a. Used for PCR amplification of templates for in vitro translation pTM3256 R6 domain of TFII-I subcloned into pET30a. Used for PCR amplification of templates for in vitro translation pGex2T 816 Plasmid encoding full length TFII-I delta fused to GST. Used in purification and antibody production pGex2T 817 Plasmid encoding the R2-R3 domains of TFII-I delta fused to GST. Used in purification and antibody production pGex2T 818 Plasmid encoding the R4-R5 domains of TFII-I delta fused to GST. Used in purification and antibody production P Gex2T 819 Plasmid encoding the R6 domain of TFII-I delta fused to GST. Used in purification and antibody production 176 8. Appendix III. Sequence alignments for the RBEIII element with the HIV-1 genome. Accession# Sequence Alignment RBEIII pLAI DQ336092 AY835771 AY835771 DD153311 DD153311 DD153312 DD153312 AX032749 AX032749 CS272319 CS272319 BD238372 BD238372 AF063184 AF063161 AF102209 AF003887 AF003887 AY353941 U26942 AY353928 AY353929 AY353931 AY353933 AY353936 AY353937 AY353940 AY353942 AY353943 AY353945 AY353947 AY353948 AY353949 AY353950 AY353954 AY353955 K03455 K03455 K02013 AF033819 NC_001802 M19921 M19921 AF003888 AF003888 DQ336075 BD298114 BD410064 AX316202 AF063164 A07867 AX772015 AY167123 U24479 U24478 U24474 U24472 U24471 U24470 U24469 cacgtggcccgagagctgcatccggagtacttcaagaactgctgacatcgagcttgctac 60 218 9387 288 9363 288 9363 288 9363 288 9363 288 9363 288 288 288 217 9393 288 230 8741 229 230 230 230 230 230 230 230 229 230 230 230 230 230 229 231 9373 288 8966 8919 8919 9363 288 267 9372 215 8729 288 288 288 8930 288 8857 161 161 161 161 161 161 161 .—,— " 1 — t . . . . t . . . . t . . . . 1 t . . . . t . . . . t . . . . j . . . . i t . . . . 1. . . . . I- .. . 1.... 1 1 1 1 ! 1 i 1 i I 1 1" ' ' " | 1. . . . . . .a 1 . . . : ! j , t . . . . t . . . . ! •h . . . t . . . ,t... 1 t ; . . i t . . . It... t . . . L . . 277 9446 347 9422 347 9422 347 9422 347 9422 347 9422 347 347 347 276 9452 347 289 8800 288 289 289 289 289 289 289 289 288 289 289 289 289 289 288 290 9432 347 9025 8978 8978 9422 347 326 9431 274 8788 347 347 347 8989 347 8916 220 220 220 220 220 220 220 177 Accession# Sequence Alignment RBEIII U24468 U24467 U24466 U24480 AY353932 AY353952 U44443 X01762 X01762 A X 0 7 8 3 0 7 U12055 U 1 2 0 5 5 M15654 D86068 D86068 K02083 K02083 D 8 6 0 6 9 D86069 M15653 M11840 A04321 S72421 M33914 DQ336074 AY835754 AY835754 AY835775 A Y 8 3 5 7 7 5 CQ767331 CQ767337 B D 1 2 4 1 4 4 U 2 4 4 7 3 U44460 U44454 K02011 A F 0 7 0 5 2 1 AF070521 S64870 A Y 8 3 5 7 5 8 A Y 8 3 5 7 5 8 A Y 8 3 5 7 6 5 A Y 8 3 5 7 6 5 DD207211 AF063185 A F 0 6 3 1 6 0 E 1 2 7 9 3 AY376256 U44453 AF219704 AF219705 AF219709 AF219708 DQ848557 M64759 DQ336081 U 8 0 5 2 8 U80522 U80511 AF019397 AY851684 AY851671 AY835779 AY835779 A Y 8 3 5 7 8 0 A Y 8 3 5 7 8 0 AY835777 AY835777 AY835778 AY835778 161 161 161 161 230 230 672 9402 288 8729 9252 306 288 9415 297 9408 288 288 2040 8930 288 288 215 9342 288 9376 288 191 191 191 161 672 672 3359 9353 288 519 9411 288 9342 288 288 288 288 288 310 672 577 575 577 577 288 477 197 120 120 120 98 208 184 9351 288 9318 288 9357 288 9357 288 ; t . . . 220 I t . . . 220 ; t . . . 220 -h 220 289 289 731 9461 347 8788 t . . . 9311 t . . . 365 : . . a 1 8787 1 9465 i 347 . ! t . . . 9474 . t . . . 356 t . . . 9467 ft. . . 347 . . . a j 347 t . . . 2 0 9 9 8989 347 347 . . . a \ . . : . 274 t . . . 9401 t . . . 347 t . . . 9435 t . . . 347 . . t . t . . 132 t . . . ! . . . . t . . 132 t . . l . . . t . . 132 V . . . 220 731 731 i- 3418 i 9412 t . . . 347 . . t . . . . . t. . 578 t . . . 9470 t . . . 347 t . . . 9401 t . . . 347 . . t . t . . 347 t . . . 347 t. . . 347 . . t . . . . . 4-.. . 347 369 7 31 t . . . 636 t . . . 634 t . . . 636 ' t... fi3fi ] 347 1 53fi t . . . 256 J t . . . 179 t . . . 179 t . . . 179 t . . . 157 t . . . 267 t . . . 2 4 3 . . . t . . . t . . . 9410 t . . . 347 . . . t . . . t . . . 9377 t . . . 347 t . . . 9416 t . . . 347 __ - . .an t . . . 9416 • ag. t . . . . 347 178 Accession# AF019396 AF063163 AF256211 AF256211 M93259 M93259 AY331286 AY260806 U43107 AY353953 U44455 AF219787 AF219788 AF219791 AF219807 AF219811 AF219706 U63632 L32865 AY851679 AY851670 AF462703 AY331285 U73094 DQ336082 DQ336084 DQ336085 DQ848469 U80532 U80523 U80520 U80516 AY851668 AY970948 AY970948 AY835772 AY835770 AY835748 AY835748 U81474 CQ767316 BD124143 AF063179 AF063177 AF063155 AY444310 AF256207 AF256207 AF256206 AF256206 AF256205 AF256205 U72111 U72102 AF102210 M93258 M93258 AY610991 AY376261 X57466 X57465 U44471 U44448 U44447 AF219694 AF219789 AF219790 AF219808 AF219810 AF219812 Sequence Alignment RBEIII 103 . . . a 288 9367 . . . a 288 . . . a 9366 288 8596 . . . a 634 . . t . 788 . . . a 231 672 . . . a 586 . . . a 586 . . . a 586 . . . a 577 . . . a 577 . . . a 575 .a .a.aa a. .a.aa a. . a. aa a. .ct. .a a. .a a. a a. 8692 a. 287 225 . . . a a. 160 . . . a a. 574 . . . a a 8596 . . . a a. 174 216 216 216 288 120 120 120 120 201 9353 208 288 288 9282 288 120 191 191 291 288 288 580 . .t. . .t. .at. .at. . .t. . .t. . .t. . .t. . .t. a. . . .a a. .a a. .a a a. .a a. .a a. .a a. .a a. .a a. a. ,a a. 9399 . . . a a a. 288 . . . a a a. 9399 . . . a a a. 288 . . . a a a. 9367 . . . a a. 288 . . .a a. 140 a. 140 a a. 217 . . . a a. 9361 a. 285 233 310 235 235 131 672 672 574 586 577 577 576 577 .ag. .ag. . .g. .ag. .t .t. . . .t. . . .t. . . .t. . . .t. . . .t. . . .a.e. .t. . . .t. . . . t . . . .t. . . .t. . . .ag. .ag. .ag. . .g. . . t . .g . . . t . . . . . . t . . . . . .t . .t . .t . .t . .t . .t . .t . .t . .t . . t . . . . . .t . .t . . t . . . . . .t . .t . .t .at .at .at .at .at .at . .t . .t . .t . .t . .t . .t . .t . .t . .t .a . . . t . t. t. t. .a . . . t . t. 162 347 9426 347 9425 347 8655 693 847 290 731 645 645 645 636 636 634 8751 346 284 219 633 8655 233 275 275 275 347 179 179 179 179 260 9412 267 347 347 9341 347 179 132 132 350 347 347 639 9458 347 9458 347 9426 347 199 199 276 9420 344 292 369 176 176 190 731 731 633 645 636 636 635 636 179 Accession^ AF219820 AF219821 AF219822 AF219823 AF219824 AF219691 AF219695 AF219707 K 0 2 0 0 7 K 0 2 0 0 7 U81456 U73101 AY857174 AY444309 D Q 8 8 6 0 3 6 DD334642 DQ848490 DQ848489 DQ848487 D Q 8 4 8 4 8 6 D Q 8 4 8 4 8 5 D Q 8 4 8 4 8 4 DQ848481 D Q 8 4 8 4 8 0 DQ848479 DQ848478 DQ848477 DQ848517 Sequence Alignment R B E I I I 577 577 577 577 576 574 574 578 9390 . . . a . 289 . . . a . 120 . . . a . 169 . . . a a. 8664 . . . a a. 384 a 8615 a 288 . . . a a...ag. .a a a. . . .g. .a a a. . . .g. .a a a. . . .g. .a a a. . . .g. .a a a. . . .g. .a a a. . . .g. .a a a. . . .g. .a a a. . . .g. .a a a. . . .g. .a a a. . . -g. a a. . . .g. .a t a a .ag. .ag. . .g. . .g. . .g. 2 8 8 2 8 8 2 8 8 2 8 8 2 8 8 2 8 8 2 8 8 2 8 8 2 8 8 2 8 8 2 8 8 2 8 8 . a.ct. . . . t t . .g. . . . . t . . g . . . . . t . . g . . . . . t . . g . t . .g. . . . . t . . g . t . .g. . . . . t . . g . t . .g. t . .g. .a . . t . .g . t 636 636 636 636 635 633 633 637 9449 348 179 228 8723 443 8674 347 347 347 347 347 347 347 347 347 347 347 347 347 180 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0100673/manifest

Comment

Related Items