Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigating the role of bilirubin system in experimental autoimmune encephalomyelitis and characterizing… Liu, Yingru 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
831-ubc_2007-318188.pdf [ 11.44MB ]
Metadata
JSON: 831-1.0100656.json
JSON-LD: 831-1.0100656-ld.json
RDF/XML (Pretty): 831-1.0100656-rdf.xml
RDF/JSON: 831-1.0100656-rdf.json
Turtle: 831-1.0100656-turtle.txt
N-Triples: 831-1.0100656-rdf-ntriples.txt
Original Record: 831-1.0100656-source.json
Full Text
831-1.0100656-fulltext.txt
Citation
831-1.0100656.ris

Full Text

I N V E S T I G A T I N G T H E R O L E O F B I L I R U B I N S Y S T E M I N E X P E R I M E N T A L A U T O I M M U N E E N C E P H A L O M Y E L I T I S A N D C H A R A C T E R I Z I N G I T A S A N O V E L S T R A T E G Y F O R T R E A T M E N T by YINGRU LIU M. Sc. University of British Columbia, 2003 B.Med., Beijing Medical University, 1990 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Neuroscience) THE UNIVERSITY OF BRITISH COLUMBIA August 2007 © Yingru Liu, 2007 A B S T R A C T Experimental autoimmune encephalomyelitis (EAE) is a T cell-mediated autoimmune inflammatory disease of the CNS that serves as a model for the human demyelinating disease, multiple sclerosis. Multiple factors, including free radicals, complement and antibodies, play an important pathogenic role in this disease. Bilirubin, an endogenous product of heme degradation in mammals, was once considered a toxic waste product, but is in recent decades recognized as a potent antioxidant of physiological importance. It has also been demonstrated that bilirubin may possess immunomodulatory and anti-inflammatory properties due to its high lipophilia and its direct interaction with inflammatory cell membranes. We hypothesized that bilirubin could play a protective role in EAE and might represent a novel effective target for the treatment of this disease. First, we demonstrated that during EAE, both heme oxygenase-1 and biliverdin reductase (BVR), which catalyze heme catabolism and generate bilirubin, were strongly induced in the inflamed lesions, and the concentration of bilirubin was subsequently increased. Bilirubin as a potent antioxidant suppressed EAE effectively. Histological examination showed that if administered before the onset of clinical EAE, bilirubin protected the integrity of the blood-brain barrier (BBB) from free radical-induced permeability changes such that cell invasion and the resulting pathology were minimized. If administered after the onset of disease, bilirubin penetrated the already compromised BBB, scavenged the free radicals that are directly responsible for CNS tissue damage, and promoted recovery of the animals. In contrast, depletion of endogenously produced bilirubin dramatically worsened EAE. ii Our results further revealed that bi l i rubin was not only an antioxidant, but also a powerful immunomodulatory agent. B i l i rub in exerted its potent immunosuppressive activity both in vitro and in v ivo in the treatment o f E A E . The strong immunosuppressive effects o f bi l i rubin could not be attributed to its antioxidant property. B i l i rub in significantly inhibited both antigen-specific and polyclonal T cel l responses. B i l i rub in suppressed T cel l proliferation through multifaceted actions, including its inhibitory effects on T C R signal ing, costimulator activities, and immune transcription factors activation. In v ivo , the protective effect o f bi l i rubin treatment in E A E was associated with changes in the antigen-specific autoimmune response. B i l i rub in treatment impaired the ability o f antigen-specific T cells to induce E A E by adoptive transfer, whi le other similar strong antioxidants completely lacked this effect. Recent studies show that B V R can physiological ly regenerate bi l i rubin in a catalytic cycle. Compared with bi l i rubin, B V R is soluble and nontoxic. We surmised that B V R might prove to be a novel , safer strategy for treatment. Our results demonstrated that B V R ameliorated both c l in ical and pathological signs o f E A E more eff iciently than traditional antioxidant enzymes. Interestingly, B V R achieved its, strong therapeutic effects without signif icantly increasing the biological concentration o f b i l i rubin, which is cytotoxic at high levels. In summary, we demonstrate that bi l i rubin possesses mult iple physio logical functions and plays an important protective role in E A E . These data indicate its potential in the treatment o f mult iple sclerosis and other stress or immune-mediated diseases. i i i TABLE OF CONTENTS ABSTRACT » T A B L E OF CONTENTS. . . . . iv LIST OF TABLES ix LIST OF FIGURES x ABBREVIATIONS .xii A C K N O W L E D G E M E N T S , xv CO-AUTHORSHIP STATEMENT xvi Chapter 1 G E N E R A L INTRODUCTION 1 1.1. MULTIPLE SCLEROSIS 1 1.2. ANIMAL MODELS OF MULTIPLE SCLEROSIS 8 1.2.1. Theiler's Murine Encephalomyelitis Virus (TMEV) Infection 9 1.2.2. Experimental Autoimmune Encephalomyelitis (EAE) ..12 1.3. PATHOGENESIS OF EAE 17 1.4. ANTIOXIDANT SYSTEMS OF THE ORGANISMS 22 1.5. BILIRUBIN SYSTEM 24 1.5.1. Heme oxygenase (HO) 25 1.5.2. Biliverdin reductase (BVR).. 29 1.5.3. Bilirubin 31 1.5.4. CO and iron.... 35 1.6. HYPOTHESIS AND EXPERIMENTAL OBJECTIVES . 36 1.7. REFERENCES • 39 iv C h a p t e r 2: B I L I R U B I N A S A P O T E N T A N T I O X I D A N T S U P P R E S S E S E A E : I M P L I C A T I O N S F O R T H E R O L E O F O X I D A T I V E S T R E S S I N T H E D E V E L O P M E N T O F M U L T I P L E S C L E R O S I S 70 •2.1. INTRODUCTION ........71 2.2. MATERIALS AND METHODS 73 2.2.1. Induction of acute and chronic EAE 73 2.2.2. Treatment Regimen 74 2.2.3. Tissue preparation and histopathological studies 75 2.2.4. Immunohistochemistry 75 2.2.5. Assessment of the effect of bilirubin on the BBB permeability 76 2.2.6. Primary culture of oligodendrocytes ...77 2.2.7. In vitro assessment of the cytoprotective action of bilirubin against oxidative stress in primary oligodendrocyte cultures 78 2.2.8. Statistical analysis 78 2.3. RESULTS 79 2.3.1. Effect of bilirubin treatment on EAE 79 2.3.2. Histopathological and immunohistological findings 83 2.3.3. Effect of bilirubin treatment on the BBB permeability changes in EAE 86 2.3.4. Evidence of antioxidant activity of bilirubin in EAE ....88 2.3.5. Cytoprotective action of bilirubin against oxidative stress in vitro 89 2.4. DISCUSSION 89 2.5. REFERENCES 96 v C h a p t e r 3: B I L I R U B I N E X E R T S I T S P O W E R F U L I M M U N O S U P P R E S S I V E E F F E C T B O T H I N V I T R O A N D I N T H E T R E A T M E N T O F E A E . 101 3.1. INTRODUCTION .102 3.2. MATERIALS AND METHODS .103 3.2.1. EAE induction and treatments 103 3.2.2. Proliferation assays..... 105 3.2.3. Cytokine enzyme-linked immunosorbent assays (ELISA) 106 3.2.4. Flow cytometry 106 3.2.5. Real-time RT-PCR 106 3.2.6. Cell viability and apoptosis assays 107 3.2.7. Nuclear protein extraction and electrophoretic mobility shift assay 107 3.2.8. Western blotting assays 108 3.2.9. Bilirubin assay 108 3.2.10. Morphological techniques and histopathological studies 108 3.2.11. Statistical analysis 109 3.3. RESULTS 110 3.3.1. Bilirubin inhibits T cell proliferation 110 3.3.2. High levels of bilirubin induce apoptosis in reactive T cells 113 3.3.3. Bilirubin does not induce immune deviation or expansion of several regulatory T cell types 115 3.3.4. Bilirubin suppresses costimulatory molecule activities 117 3.3.5. Bilirubin inhibits N F - K B activation 119 3.3.6. Bilirubin inhibits the activation-induced expression of class II MHC molecule vi in APCs 122 3.3.7. Bilirubin suppresses experimental autoimmune encephalomyelitis in SJL/J mice • 124 3.3.8. Bilirubin treatment does not caus neural cell damage in the CNS 131 3.4. DISCUSSON 133 3.5. REFERENCES. ..." 139 Chapter 4: T R E A T M E N T OF E A E B Y T H E N E W A G E N T : B I L I V E R D I N REDUCTASE 144 4.1. INTRODUCTION 145 4.2. MATERIALS AND METHODS 146 4.2.1. Induction of EAE and histological studies ; 146 4.2.2. Intrathecal injection and treatment regimen 147 4.2.3. Cell culture and viability measurements 148 4.2.4. RNA interference and antioxidant enzyme activity inhibition 149 4.2.5. Western blotting and enzyme assays 149 4.2.6. Measurement of intracellular reactive oxygen species (ROS) ....150 4.2.7. Hemolysis and antibody-dependent cell-mediated cytotoxicity (ADCC) Assays ..150 4.2.8. Statistical analysis 151 4.3. RESULTS 152 4.3.1. Induction of BVR in EAE 152 4.3.2. Effects of BVR vs. traditional antioxidant enzyme treatments on EAE 152 4.3.3. Cytoprotective effect of BVR against oxidative stress in vitro.: ...156 vii 4.3.4. Effects of bilirubin vs. GSH on hemolytic activity of complement 160 4.3.5. Actions of bilirubin vs. GSH against ADCC activities of lymphocytes 160 4.4. DISCUSSION 163 4.5. REFERENCES 167 Chapter 5: GENERAL DISCUSSION 170 5.1. SUMMARY AND DISCUSSION 170 5.2. CAUTION AND FUTURE DIRECTIONS 179 5.3. REFERENCES 182 APPENDICES 187 viii LIST OF TABLES Table 1.1. Comparison between Multiple Sclerosis and EAE 17 Table 3.1. Effects of bilirubin vs GSH and a-tocopherol treatment on active and adoptive transfer EAE in SJL/J mice 125 Table 4.1. Effects of BVR vs. traditional antioxidant enzymes treatments on EAE in Lewis rats 154 Table 4.2. Effects of bilirubin vs. GSH on the antibody-dependent cell-mediated cytotoxic activities of lymphocytes 162 ix LIST O F FIGURES Figure 1.1. MS prevalence (per 105) in several Canadian locations 2 Figure 1.2. Clinical course of acute EAE and chronic relapsing EAE (CREAE) 14 Figure 1.3. Heme catabolism and generation of bilirubin 24 Figure 1.4. A model for redox cycle of bilirubin conferred by BVR 30 Figure 2.1. Effects of hemin, and inducer of HO-1, and tin mesoporphyrin (SnMP), an inhibitor of HO-1, on EAE in Lewis rats 72 Figure 2.2. Effects of bilirubin vs. dexamethasone (dex) treatments in the prevention of clinical EAE 80 Figure 2.3. Effects of bilirubin vs. dexamethasone (dex) treatments on clinical signs of ongoing EAE 82 Figure 2.4. Effects of bilirubin vs. dexamethasone (dex) treatment on inflammation, cytokine production and oxidative damage in spinal cord lesions in ongoing EAE 84 Figure 2.5. Effect of bilirubin treatment on BBB permeability changes in EAE 87 Figure 2.6. Protective effects of bilirubin vs. a-tocopherol on H202-induced toxicity on primary cultures of oligodendrocytes 90 Figure 3.1. Bilirubin inhibits antigen-specific and polyclonal T cell proliferation ...111 Figure 3.2. High levels of bilirubin induce apoptosis in reactive T cells 114 Figure 3.3. Bilirubin does not induce immune deviation or expansion of several regulatory T cell types 116 Figure 3.4. Bilirubin suppresses inducible expression of costimulatory molecules...! 18 Figure 3.5. Bilirubin inhibits N F - K B activation 121 Figure 3.6. Bilirubin inhibits activation-induced class II MHC expression in APCs..l23 Figure 3.7. Effect of bilirubin treatment on EAE 128 Figure 3.8. Treatment with bilirubin does not cause neural cell damage in the C N S ...132 Figure 4.1. Induction of BVR in EAE 153 Figure 4.2. Effect of BVR treatment on oxidative damage and bilirubin concentration 157 Figure 4.3. Effects of depletion of BVR vs. traditional antioxidant enzymes activities in SH-SY5Y cells on ROS production, sensitivity to oxidative stress, and cell viability ...159 Fig. 4.4. Effects of bilirubin vs. GSH on hemolytic activity of complement in the classical pathway 161 xi ABBREVIATIONS NO nitric oxide o2' superoxide anion OH hydroxyl radical 3-AT 3-amino-l,2,4-triazole ABC avidin-biotin complex ADCC antibody-dependent cell-mediated toxicity APC antigen presenting cell BBB blood-brain barrier BVR biliverdin reductase BSO L-Buthionine-sulfoximine CFA complete Freund's adjuvant CIITA class II transactivator CNS central nervous system CO carbon monoxide ConA concanavalin A . CREAE chronic relapsing experimental autoimmune encephalomyelitis CSF cerebrospinal fluid DAB 3,3'-diaminobenzidine DAI day after immunization DDC diethyldithiocarbamate EAE experimental autoimmune encephalomyelitis Fe iron GPX glutathione peroxidase GSH glutathione H2DCF 2',7'-Dichlorodihydrofluorescein diacetate HE staining hematoxylin-eosin staining HLA human leukocyte antigen H 2 0 2 hydrogen peroxide HO heme oxygenase I K B inhibitor of K B ICAM intercellular adhesion molecule IFN interferon IL interleukin iNOS inducible nitric oxide synthase LSSC lumbrosacral spinal cord •• LT lymphotoxin MBP myelin basic protein MHC major histocompatibility complex MMP matrix metal loproteases MOG myelin oligodendroglia glycoprotein MS multiple sclerosis MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide N F - K B nuclear factor K B ONOO" peroxynitrite PBMC peripheral blood mononuclear cell PLP proteolipid protein PPMS primary progressive multiple sclerosis RNAi RNA interference RNS reactive nitrogen species RRMS relapsing-remitting multiple sclerosis ROS reactive oxygen species SnMP tin mesoporphyrin SOD superoxide dismutase STAT signal transducer and activator of transcription TCPOBOP l,4-Bis[2-(3,5-dichloropyridyloxy)]benzene TCR T-cell receptor TMEV Theiler's murine encephalomyelitis virus TNF tumor necrosis factor VCAM vascular cell adhesion molecule ZnPP zinc proporphyrin ACKNOWLEDGEMENTS I wish to express my deep gratitude to my supervisor, Dr. Max Cynader, for his guidance, understanding and encouragement throughout. I will always appreciate the generous gifts of his advice, tolerance, and continuous support. I sincerely thank my supervisory committee members, Dr. Joel Oger, Dr. Lome Kastrukoff, and Dr. Wolfram Tetzlaff for their time, constructive criticism, helpful discussion and valuable suggestions. I owe a great debt of gratitude to my comprehensive examination committee members, Dr. Steven Vincent and Dr. Weihong Song, and my university examiners, Dr. Hung-Sia Teh and Dr. Timothy Murphy, for their time to review my proposal and my thesis and their valuable questions. I also sincerely thank Bing Zhu and Liqing Luo for their help with the EAE model and many other important experimental techniques, Jie Liu in Dr. Tetalaff s lab for his assistance with the intrathecal injection, and Tariq Aziz in Dr. Oger's lab for his help with the experiments of human T cell proliferation. I also enjoy the inspiring and-pleasant discussion with them. Last but not least, I would like to express my appreciation to my wife Ping for her assistance with my experiments, and for providing me with encouragement and support all the time. 1 highly treasure the fun and the pleasure my family give me over the years. My sons, Alex and Eric, make our life colorful and make my PhD study an enjoyable and great time. xv CO-AUTHORSHIP STATEMENT I played a central role in all the work included in Chapter 2, 3 and 4.1 established the research programs and designed all the experiments with consultation of my supervisors, Dr. Max Cynader and Dr. Donald Paty. I performed more than 90% of the experiments for the studies in Chapter 2, 3 and 4. I did all data analyses. All three manuscripts were written by me with consultation of my supervisors. For the work in Chapter 2, Bing Zhu, Liqing Luo, and Ping Li offered the assistance with EAE models. Xuefeng Wang offered the assistance with primary oligodendrocyte cultures. For the work in Chapter 3, Ping Li helped with design of experiments, the proliferation assays, real-time RT-PCR, and Western blot assays. Jie Lu helped with electrophoretic mobility shift assays. Dr. Joel Oger helped with human T cell proliferation assays. Dr. Wolfram Tetzlaff helped with EAE models. For the work in Chapter 4, Jie Liu offered assistance with the intrathecal injections of biliverdin reductase, and Dr. Wolfram Tetzlaff helped with EAE models. xvi CHAPTER 1: GENERAL INTRODUCTION 1.1. MULTIPLE SCLEROSIS Multiple sclerosis (MS), is an inflammatory demyelinating disease of the central nervous system (CNS), and is a common cause of disability in young adults (Paty and Ebers, 1998; Frohman et al., 2006). The first reported case of MS in the medical literature is attributed to Charles Proper Ollivier in his 1824 monograph (Ollivier, 1824). The first description of the pathology of demyelinating plaques was made by Carswell in 1838 and by Cruveilhier (1842) around the same period. The physician responsible for establishing MS as a clinical pathologic entity was Jean Martin Charcot at the Salpetriere in Paris in 1860s. From then on, MS became recognized in neurological clinics. By the beginning of the 20th century, a disease only a few years earlier meriting individual case reports had became one of the most common reasons for admission to a neurological ward. Now, MS is recognized throughout the world, with around 2 million affected individuals, including 300,000 - 350,000 individuals in North America (Conlon et al., 1999; Compston, 2005). These crude statistics conceal the harsh reality of a frightening and potentially disabling disease for young adults. Although MS has been studied for many years, its cause has remained elusive, and up to now no definitive therapy is available for this disease. Incidence and clinical features. MS has an incidence of about 2 per 100,000 every year, prevalence of around 30 per 100,000, and lifetime risk of 1 in 1,000 (Warren et al., 2001). The prevalence of MS varies considerably around the world. Kurtzke 1 94.0 Figure 1.1. MS prevalence (per 10s) in several Canadian locations: British Columbia (1982); Saskatoon, Saskatchewan (1977); London, Ontario (1984); and Newfoundland (1985), and in one American location: Rochester, Minnesota (1985). (Adapted from Multiple Sclerosis, Edited by Donald W. Paty and George C. Ebers, 1998) (1975) classified M S prevalence rates into "high-", "medium-", and "low-" risk groups. Rates greater than 30 per 100,000 population (now mostly 50 to 120) characterize high-risk areas, such as northern and central Europe, Italy, northern United States, Canada (Fig. 1.1), southern Australia, and New Zealand. Medium-risk areas (prevalence between 5 and 29 per 100,000 population) include southern Europe, southern United States, northern Australia, and northernmost Scandinavia. Low-risk areas (prevalence less than 5 per 100,000 population) include Asia, Africa, the Caribbean, and Mexico. M S affects women more frequently than men (Orton et al., 2006). The onset usually occurs between the ages of 20 and 40, rarely before the age of 15 or after 50 (Sadovnick and Ebers, 1993; Cook, 2006). 80% of patients begin with relapsing-remitting M S (RRMS), which is characterized by discrete clinical "attacks" or "relapses" followed by subsequent improvement (Compston and Coles, 2002). Most R R M S patients eventually develop secondary progressive M S (SPMS), where there is progressive deterioration with or 2 without occasional relapses. About 20% patients have primary progressive MS (PPMS) characterized by progressive course from onset without relapses or remissions. MS is extremely variable insofar as the neurological symptoms and degree of disability are concerned. The most common symptoms include sensory disturbances, unilateral optic neuritis, diplopia, Lhermitte's sign, limb weakness, clumsiness, gait ataxia, and neurogenic bladder and bowel symptoms. Eventually, cognitive impairment, depression, dysarthria, dysphagia, vertigo, progressive quadriparesis and sensory loss, ataxic tremors, pain, sexual dysfunction, and other manifestations of CNS dysfunction may become troublesome (Paty and Ebers, 1998). 50% of patients with MS need help walking within 15 years after the onset of disease (Cook, 2006). Environment and genetics. The possible etiologies are suggested by the results of epidemiological studies, and from a large body of laboratory investigations. The world geographic distribution of MS may provide a clue to environmental determinants. MS is rare in tropical and subtropical areas. Within temperate zones, disease rates increase with increasing latitude both in the Northern and Southern Hemispheres (Kurtzke, 1980; Olek, 2005). A north-south prevalence gradient has been detected in Europe, the United States, Japan, Australia, and New Zealand (Paty and Ebers, 1998). The geographic differences in prevalence may be explained by environmental factors such as nutrition or exposure to different infectious agents. The apparent change in the frequency of MS among people who migrate to and from high-prevalence areas before puberty is another factor that has been presented to support the existence of an environmental factor (Olek, 2005). Further evidence stems from the analysis of " MS epidemics", in particular, that on the Faroe Islands, where MS was unknown until 1940 and broke out shortly after British soldiers 3 landed on its shores (Kurtzke and Hyllested, 1979). The appearance of cases in the vicinity of the British camps has been interpreted as indicating that an unknown pathogen, possibly a virus, had been brought to the island by the troops. Parallels to infectious demyelination have further supported the idea that transmissible agents might be the cause of MS. Besides their possible role as risk factor in the etiology of MS, viral and bacterial infections have also been implicated as triggers of acute attacks in relapsing-remitting MS (Andersen et al., 1993; Rapp et al., 1995). In fact, strong interest in an infectious etiology has repeatedly emerged since Pierre Marie in 1884 first proposed that MS often starts as an infectious process (Marie, 1884). During the past century, more than a dozen viruses have been suggested to be associated with MS, including rabies, herpes simplex, scrapie, measles, simian virus V, coronaviruses, retroviruses, and recently human herpes virus 6 (HHV-6) (Paty and Ebers, 1998; Olek, 2005). However, none of these claims has stood the test of time. Despite many attempts, an infectious agent has not been identified in MS. The issue of environmental determinants as a factor for development of MS remains unresolved. Although the finding of different prevalence rates of MS in relationship to latitude generally has been thought to reflect environmental factor, genetic differences of the populations living in these areas may also contribute (Ebers, 1983; Cook, 2006). Evidence that genetic factors have a substantial effect on susceptibility to MS is unequivocal. Caucasian populations show considerably higher prevalence than other ethnic groups sharing the same environment (Kurtzke et al., 1979; Cook, 2006). Japanese and other oriental people retain their relatively low susceptibility after immigrating to North America (Kurtzke, 1985). In a number of small ethnic groups, including Yakuts, 4 Inuit, New Zealand Maoris that live in high-prevalence areas, MS is not observed at all (Waksman and Reynolds, 1984). Further evidence for the contribution of genetic factors to the pathogenesis of MS comes from family and twin studies. First-degree relatives have a 20-fold increased risk of developing MS compared with the population background (Sadovnick and Ebers, 1993; Ebers, 2005). Nonrelated children adopted into MS families, however, retain the population-based risk of developing the disease, supporting the importance of genetics in MS susceptibility (Ebers et al., 1995). The concordance rate for MS in monozygotic twins is 25%-30%, in contrast to 3%-5% concordance between dizygotic twins and non-twin siblings and a population risk of 0.1%-0.4% (Sadovnick et al., 1996). Because the rate is considerably lower than 100%, it is believed that MS, like other autoimmune diseases, is not determined by a single gene but rather several genes that jointly contribute to susceptibility. The candidate genes include human leukocyte antigen (HLA), and possibly T-cell receptor (TCR), myelin basic protein (MBP), immunoglobulin (Ig), and tumor necrosis factor (TNF) genes (Fukazawa et al., 2000). Pathology and pathogenesis. The pathological hallmark of MS is inflammation, demyelination with various degrees of axonal damage, and gliosis (Paty and Ebers, 1998; Frohman et al., 2006). Inflammatory cells are typically perivascular in location, but they may diffusely infiltrate the parenchyma. The composition of the inflammatory infiltrate varies depending on the stage of demyelination activity. In general, the inflammatory process in MS lesions is dominated by T-lymphocytes and activated macrophages or microglia cells and is associated with the expression of histocompatibility antigens, adhesion molecules and chemokines, which apparently are instrumental in initiation and 5 propagation of this process (Frohman et al., 2006). Despite the similarities in the inflammatory reactions, recent studies have revealed a profound heterogeneity in the pathologic features of MS. It has been shown that MS lesions segregate into four patterns of demyelination: pattern I, macrophage-associated demyelination; pattern II, antibody/complement-associated demyelination; pattern III, distal dying-back oligodendrogliopathy; pattern IV, primary oligodendrocyte degeneration (Lucchinetti et al., 2005). In pattern I lesions, the demyelinating process occurs in the presence of the T-cells and activated macrophages or micorglia cells. This suggests that demyelination and tissue injury is mainly mediated by the cytotoxic machinery of T cells and toxic products, produced by activated phagocytes. Pattern II exhibits the same basic inflammatory process as pattern I. In addition, however, myelin sheaths, which are in the process of dissolution, are coated with immunoglobulins (Prineas and Graham, 1981) and activated complement (Storch et al., 1998). In these lesions, antibodies against myelin oligodendrocyte glycoprotein or other surface components of the myelin sheath appear to be involved in demyelination. Although pattern III lesions also occur on the background of profound inflammation, the activation of macrophages and microglia appears to be less pronounced or different compared to that in the above described patterns of demyelination. Recent work indicates that hypoxia-like tissue injury may contribute to the pathogenesis of inflammatory white matter damage in such lesions (Lassmann, 2003). Pattern IV lesions also contain macrophages and T lymphocytes. However, a minor inflammatory reaction is associated with much more extensive demyelination, oligodendrocyte death and tissue injury. It is suggested, but so far unproven, that in these patients tissue damage is augmented by a particular, genetically determined susceptibility 6 of the target tissue for immune mediated injury (Giess et al., 2002; Linker et al., 2002). Compared with pattern I and II lesions, pattern III and IV lesions are infrequent in the MS population. Although MS predominantly affects the CNS myelin, axons within the demyelinated plaques are also affected, although to a much lower degree than myelin sheaths (Ferguson et al., 1997). Inflammation and demyelination within the lesions results in the impairment of nerve fibre conductivity. However, conductivity can be restored when toxic inflammatory mediators are cleared from the lesion, when sodium channels of demyelinated axons are redistributed or when the fibres are repaired by remyelination (Waxman, 2006). Thus, in principle, the functional deficit induced by inflammation and demyelination is reversible. In contrast, the destruction of axons and neurons, once past the threshold of compensation, may be the major determinant of permanent disability in MS. MS lesions may occurs anywhere within the white matter but favor the periventricular regions, optic nerves, brain stem, cerebellum, and spinal cord (Noseworthy et al., 2000). The pathology of the MS lesion suggests that MS is an immunopathological disease. It is now widely believed that an autoimmune response is involved in the pathogenesis of MS. Further evidence for the possible autoimmune nature of MS derives from its clinical course, female predominance, response to immunosuppressive therapies, association with HLA genes, and parallels with an animal model, experimental autoimmune encephalomyelitis (EAE) (Paty and Ebers, 1998). However, a definite autoimmune etiology for MS has not been unequivocally demonstrated. It seems from a large number of epidemiological, demographic, genetic and immunological studies that MS is a complex disease that has multiple etiologies, and that genetic, environmental and other factors interact to produce the disease. 7 Despite our inability to identify the cause of MS, our understanding of events involved in the evolution of the MS lesions is increasing. Recent research has focused on the inflammatory response that is detectable in the CNS of patients with MS to clarify the nature of the local immunopathological response and the possible targets. This, in turn, has led to a number of innovative therapies of MS, which target the processes involved in lesion development, rather than the precise cause of the disease. Over the past century, animal models of MS have proved extremely useful for investigating the pathophysiological phenomena observed in MS in the human, and are also used to develop'new treatments for this disease. Several therapies approved for treatment of MS were developed preclinically based on their success in treating various MS models, including Theiler's murine encephalomyelitis virus (TMEV) infection and EAE (Steinman, 1999; Steinman and Zamvil, 2006). 1.2. ANIMAL MODELS OF MULTIPLE SCLEROSIS Due to the fact that the aetiology of MS has not yet been established, various MS animal models have been developed applying immunologic, virologic, toxic and genetic parameters in order to understand the pathogenesis of this major demyelinating disease. Viral and autoimmune models have been developed to investigate the virologic and immunologic features of MS. In some genetic models, the use of transgenic technology to over-express or prevent expression of genes encoding molecules related to inflammation has allowed direct examination of their role in the experimental demyelinating disease 8 (Owens et al., 2001). Of the large body of MS animal models, TMEV infection and EAE are considered among the best ones. This is based on the extensive similarities among TMEV infection, EAE and MS in the clinical and histopathological features (Gold et al., 2006), similar genetic susceptibility shared by TMEV infection (Lipton and Melvold, 1984; Rodriguez et al., 1991), EAE (Bernard, 1976; Villarroya et al., 1990) and MS (Fukazawa et al., 2000), and much evidence suggesting the viral (Kurtzke and Hyllested, 1979) and autoimmune etiology for MS (Freedman, 2006). In the last few decades, studies conducted with these two animal models of MS have provided insight into the immunopathological response and mechanisms of myelin destruction characteristic of that in MS (Steinman and Zamvil, 2006). 1.2.1. Theiler's Murine Encephalomyelitis Virus (TMEV) Infection TMEV model was first documented in the 1930s. In 1934, TMEV was isolated by Max Theiler (1934) from the CNS of mice with spontaneous flaccid paralysis of the hind limbs. It is a cardiovirus in the family Picornaviridae (Pevear et al., 1987). Based on different biological and pathological properties, TMEV strains are divided into two subgroups. The first subgroup, consisting of GDVII and FA viruses, is highly virulent and causes an acute fatal polioencephalomyelitis in animals (Theiler, 1937). The second one, called TO group, including the Daniels (DA) and BeAn, produced in susceptible strains of mice a biphasic disease of the CNS, resulting in inflammatory demyelination (Lipton, 1975, 1980). Among inbred mouse strains, there is a spectrum of susceptibility to the development of TMEV-induced demyelinating disease after infection (Lipton and Dal Canto, 1979). Strains such as SJL/J and DBA/1 are highly susceptible. Several 9 specific gene loci have been identified as being involved in differential susceptibility (Oleszak et al., 2004): the class I major histocompatibility complex (MHC) locus H-2D (Clatch et al., 1985; Patick et al., 1990), the Tmevd-1 locus on chromosome 3 (Melvold et al., 1990), and the Tmevd-2 locus on chromosome 6 (Melvold et al., 1987). In most susceptible strains acute disease appears less than 2 weeks after virus inoculation, and is not always clinically apparent (Lipton, 1975; Oleszak et al., 2004). 3-5 weeks after infection, mice develop late chronic demyelinating disease with clinical signs from a mild waddling gait to frank spastic hind limb paralysis and urinary incontinence. Both acute and chronic diseases depend on the strain, sex (Kappel et al., 1990), and age of the mouse (Steiner et al., 1984), as well as dose and strain of virus. Histopathological findings following TMEV infection with TO subgroup are consistent with a biphasic disease. During the acute phase, virus replicates predominantly within neurons of the hypothalamus, brain stem, and spinal cord (Rodriguez et al., 1983; Oleszak et al., 2004). Infection of white matter, meninges, choroid plexus or ependyma is not found. Little demyelination or parenchymal inflammation is observed in the acute phase, even in mice susceptible to the late phase. Therefore, the early phase of TMEV infection resembles acute polio virus-induced encephalomyelitis with paralysis due to cytolytic infection of motor neurons (Daniels et al., 1952). In contrast, in the chronic phase, inflammation and demyelination increase in the white matter of the spinal cord. Lesions are most common in the lateral columns of the thoracic region and the largest may encompass the majority of the white matter (Dal Canto and Lipton, 1975). Lesions are characterized by the presence of lymphoid infiltrates and large numbers of macrophages that quickly invade the spinal cord columns (Dal Canto and Lipton, 1977). 10 Two potential mechanisms have been proposed to explain the cause of demyelination in TMEV infection. Observations that would favor a direct effect of virus include: (1) persistence of infectious virus in the CNS for prolonged periods of time albeit at low titers during the chronic phase (Lipton and Dal Canto, 1976, 1976). (2) Co-localization of demyelinating lesions with areas of ongoing CNS infection as determined by in situ hybridization and immunochemistry (Brahic et al., 1984; Chamorro et al., 1986). (3) Studies indicating that nude mice infected with DA strains of TMEV develop demyelination after lytic infection of oligodendrocytes in the presence of rising titers of virus and in the absence of functional T cells (Roos and Wollmann, 1984; Rosenthal et al., 1986). Other observations would favor an immune-mediated mechanism: (1) CNS infiltrates in the chronic phase of TMEV infection are composed mainly of macrophages and T cells (Clatch et al., 1990). (2) Clinical symptoms in many susceptible mice with TMEV infection show a good correlation with the T cell infiltration, rather than the CNS viral titers (Tsunoda et al., 1996). (3) Treatment of infected mice with antithymocyte serum or cyclophosphamide diminishes mononuclear cell infiltration and demyelination (Lipton and Dal Canto, 1976). (4) Susceptibility is controlled by the MHC gene in many mouse strains (Oleszak et al., 2004; Brahic et al., 2005). The similarity of pathological alterations in TMEV-induced demyelinating disease and EAE, the classical model for autoimmune demyelination, suggested initially that demyelination in TMEV infection could follow a process of secondary anti-myelin autosensitization, thus resulting in a virally induced EAE-like model. However, recent evidence indicates that this is not the case. For example, in myelinating and myelinated organotypic cultures, while EAE sera and cells inhibited myelination and were able to demyelinate organotypic culture, no 11 effect was noted with sera and cells from TMEV-infected animals (Barbano and Dal Canto, 1984). Demyelination could not be initiated by transfer of either serum or lymphoid cells from TMEV-infected donors to naive syngenic recipients (Barbano and Dal Canto, 1984). These studies strongly suggest that demyelination in TMEV infection is not due to an EAE-like mechanism. 1.2.2. Experimental Autoimmune Encephalomyelitis (EAE) EAE is the most intensively studied animal model of MS, and many believe the best (Gold et al., 2006). Interestingly, it was started at the same period as TMEV model. The first time that EAE was induced was in 1933 when Rivers et al. observed a paralysis accompanied by demyelination in monkeys given repeated intramuscular injections of rabbit brain extract (River et al., 1933). From then on, this model has evolved considerably, and a number of new developments have made'it increasingly relevant to MS. EAE can be produced in a variety of animal species using different CNS antigen preparations, including whole spinal cord (Brown and McFarlin, 1981), myelin basic protein (MBP) (Fritz and McFarlin, 1989), proteolipid protein (PLP) (Trotter et al., 1987), and peptides of these proteins (Martin et al., 1992). With the development of complete Freund's adjuvant, EAE can be induced in susceptible animals following a single injection of CNS antigen emulsified in the adjuvant (Morgan, 1946; Kabat et al., 1947). In 1960, passive transfer of EAE by lymphocytes was introduced by Paterson (1960). From that time, passive transfer of EAE has been achieved by injection of activated encephalitogenic T cells, obtained from sensitized animals, and is now known as "passive or adoptive EAE". 12 Although EAE can be induced in various animal species, it has been found inducible only in susceptible strains, according to diverse modalities (Swanborg, 1995). Susceptibility also depends on other contributing factors, such as age (Funjinami and Paterson, 1977), sex (Yu and Whitacre, 2004) and even commercial source of the animals. EAE susceptibility has been shown to be under genetic control in rats, mice, guinea pigs, and rabbits (Bernard, 1976; Geczy et al., 1984; Villarroya et al., 1990). The susceptible strains in the most-used species because of their high level of reproducibility are female SJL/J and PL/J mice (Fritz et al, 1983), and Lewis rat (Gasser et al., 1975). Genetic susceptibility in EAE is linked to the immune system through the T-cell response to a particular encephalitogenic epitope dependent upon the T-cell receptor (TCR) repertoire and MHC class II restricting elements available to the responder strain of animal (Swanborg, 1995; Yu and Whitacre, 2004). For example, the response of Lewis rats to MBP epitope 68-86 is restricted by RT-1B (the rat homologue of murine I-A), and the T cells preferentially use Va2:Vp8 in their TCR (Burns et al., 1989; Chluba et al., 1989), whereas the response of Lewis rats to MBP epitope 87-99 is restricted by RT-1D (the homologue of I-E) with utilization of diverse T cell V region gene products (Offner et al., 1989; Sun et al., 1992). Similar genetic associations have also been reported in populations with a high incidence of MS where HLA class II DR genes, the human homologue of I-E, are over-represented (Kantarci and Wingerchuk, 2006). Like MS, the clinical course of EAE can be quite variable. Acute EAE, normally produced in the Lewis rat, presents as a monophasic disease, characterized by inflammatory foci in the CNS, with limited demyelination (Bernard et al., 1992). Chronic relapsing EAE (CREAE), usually induced in the DA rat and mice, presents as a chronic 13 relapsing and remitting disease, which is characterized by both massive inflammation and demyelination in the CNS (Bernard et al., 1992). These clinical variations of EAE have served as animal models for the different clinical courses observed in individual patients A. Days after immunization 0 5 :TO: s& 20' % l o m. m 1 i t i > i i t « t i i i i i i t i i l i t I I I 1 1 1 1 t t t i t t t t l B . Days after immunization 0 '.'5: 1,0 15 20: -25 30 35; 40 i ^ i r H i i r t l ^ i ^ n m i l Figure 1.2. Clinical course of acute E A E and chronic relapsing E A E (CREAE). Figure A shows a typical pattern of recovery from acute EAE. The severity of clinical symptoms peaks around Day 15, the animal then recovers completely without treatment by Day 18-20. Figure B shows a typical pattern of clinical symptoms from CREAE. The severity of symptoms peaks around Day 15, the animal then recovers completely but a relapse of symptoms occurs at Day 23-25. • 14 with MS. Acute EAE offer the advantage of predictable time of onset and uniform severity of disease. Most animals spontaneously recover (Swanborg, 1988). CREAE resembles MS in human closely. However, a disadvantage is the relative resistance of mice to EAE, which is reflected in variable incidence and time of onset. In acute EAE, the clinical signs begin 10-12 days after immunization (Huitinga et al., 1995) (Fig. 1.2A). The clinical presentation is characterized by a waddling gait, rapidly progressing to ataxia, hind limb weakness, paralysis, and urinary incontinence. Most animals recover by 18-20 days postimmunization. In CREAE, the following relapse can be expected after 3-4 weeks of induction. More remissions and relapses may follow, although less predictably than the first relapse (Huitinga et al., 1995) (Fig. 1.2B). Pathological alterations of acute and chronic EAE reflect many of the features seen in MS. Inflammatory infiltrates precede white matter changes and consist of lymphoid infiltrates in meninges, perivascular spaces, and eventually the parenchyma itself. Macrophages are numerous, although rarely as numerous as in TMEV infection in SJL/J mice (Traugott et al., 1986; Lyman et al., 1989; Engelhardt, 2006). Correspondence with clinical evidence of remitting-relapsing activity is generally good, but pathological changes often precede the clinical presentation of signs by a few days. During the remitting phase of the disease, inflammation subsides and glial processes take much of the space left behind them. Remyelinating activity has been observed in CREAE lesions (Raine et al., 1984). The cytokine pattern displayed by encephalitogenic T cells in the CNS of EAE is similar as in MS, which is composed of IL-1, INF-y, TNF-a, and IL-2 etc (Noronha and Arnason, 1996). T cell receptor rearrangements indicative of T cells reactive to myelin can even be detected in demyelinating areas from spinal cords of mice 15 with EAE (Steinman, 1996). Similarly, antibody responses to MBP and to myelin oligodendroglia glycoprotein (MOG) can be detected at the site of vesiculating myelin in EAE brain (Warren et al., 1995; Genain et al., 1999). Overwhelming evidence demonstrates that EAE is T cell-mediated autoimmune disease. Different from TMEV infection, the driving antigen in EAE is clearly derived from myelin itself. Such encephalitogenic antigens include MBP (Fritz and McFarlin, 1989; Goverman et al., 1993), PLP (Sobel et al., 1994), and MOG (Amor et al., 1994). It was Kabat (1946, 1947) who first suggested that EAE may have an autoimmune etiology and that the appropriate autoantigen was located in the white matter. He shrewdly observed that injection of fetal CNS tissue (before myelination) did not cause EAE. In addition, adoptive transfer of EAE by MBP-specific T cells unequivocally demonstrates that encephalitogenic T cells play a critical pathogenic role in EAE. In summary, the clinical, immunopathological, and histopathological features of EAE resemble those seen in MS patients (Table 1.1). Thus, the experimental disease has been widely utilized as a model with which to gain insight into the mechanisms underlying its human counterpart. Since it is becoming increasingly convincing that an autoimmune process is involved in the pathogenesis of MS, and due to the extensive characterization, detailed knowledge of the encephalitogenic epitopes on multiple myelin proteins in EAE, and the relative ease of induction, I employed this model of MS in my studies. In addition, as mentioned above, EAE can be induced in a variety of species and strains of animals. In general, I used chronic relapsing EAE model induced in SJL/J mice for histopathological studies since it resembles MS closely and offers an excellent model with which to investigate the mechanisms that underlie the induction and remission 16 Table 1.1 Comparison between Multiple Sclerosis and E A E MS EAE Clinical Presentation Relapses and remissions present present Paralysis present present Ataxia present present Visual impairment present present Genetics MHC-linked susceptibility yes yes Females more susceptible yes yes Patholoav in Lesions T cells reactive to myelin present present Antibodies to myelin present present a-4 integrin, complement present present TNF-a, IFN-Y present present Demyelination present present, mild Axonal dystrophy present present Theraov IFN-y, systemic worsens cures anti-TNF-a, systemic worsens cures IL-4 transduced T cells not done cures TNF-a transduced T cells not done worsens Copaxone improves cures IFN-P improves improves phases of the disease. I have chosen acute EAE induced in Lewis rats for evaluating the effects of treatments since, in comparison to chronic EAE, acute EAE offers the advantage of predictable time of onset and uniform severity of disease. Most animals spontaneously recover. It was commonly used for assessing the effects of new therapies in many previous studies. 1.3. PATHOGENESIS OF E A E It is now well accepted that EAE is an autoimmune disease characterized by perivascular CD4+ T cell and mononuclear cell inflammation in the CNS (Swanborg, 1988; Raine, 1994). Although its pathogenesis is not fully understood, we have seen 17 tremendous progress in the studies of the immune response in this disease. A widely accepted view of the process involved in EAE lesions reveals that T cells, macrophages, immunoglobulin, and complement play a role in pathogenesis. Adhesion molecules, cytokines, chemokines, and metalloproteases are critical participants in the development of the inflammatory response in the brain and spinal cord (Stuerzebecher and Martin, 2000). Initially, autoreactive myelin-specific CD4+ T cells are activated in the periphery following immunization with MBP or other myelin antigen in complete Freund's adjuvant (Miller and Shevach, 1998; Engelhardt, 2006). Interferon-gamma (IFN-y), tumor necrosis factor-alpha (TNF-a), and other cytokines released in the inflammatory response, can induce the cerebrovascular endothelial cells to express vascular cell adhesion molecule (VCAM), intercellular adhesion molecule (ICAM), and major MHC class II molecules (Washington et al., 1994). Once the blood-brain barrier (BBB) is inflamed, ICAM/Iymphocyte function-associated antigen-1 (LFA-1) and VCAM/very late antigen-4 (VLA-4, expressed by T lymphocytes) interactions, in conjunction with other factors such as CD4-MHC class II binding, allow autoreactive T cell diapedesis and entry.into the CNS (Baron et al., 1993; Steffen et al., 1994; Romanic et al., 1997). Penetration of the T cells into the CNS parenchyma is enhanced by increased activity of endogenous matrix metalloproteases (MMP) responsible for the breakdown of extracellular matrix material (Yong et al., 1998). Within the CNS, autoreactive T cells may be activated further by recognizing myelin antigen presented by resident microglia, astrocytes, or blood-derived monocytic cells in the context of MHC class II (Stuerzebecher and Martin, 2000). These T cells, and the associated antigen presenting 18 cells, then release proinflammatory cytokines (known as Thl type cytokine) and chemotactic factors that lead to activation of the endothelium and resident glial cells, resulting in the recruitment of additional lymphocytes and monocytes to sites of inflammation (Olsson, 1995; Steinman, 1996). On the other aspect, cytokines characteristic of Th2-type responses, such as interleukin-4 (IL-4) and interleukin (IL-10), as well as transforming growth factor p (TGF-P), are thought to participate in recovery from the inflammatory events by down-regulating the activated state of endothelial cells, and lymphocytes (Miller and Karpus, 1994; Olsson, 1995). It is thought that encephalitogenic CD4+ T cells are pivotal to disease expression through the production of cytokines that promote inflammation and activate secondary inflammatory cells such as macrophage. Included in the cytokines produced by these T cells are lymphotoxin (LT), TNF-ct, and IFN-y (Miller and Karpus, 1994). These substances can result in direct nervous cell injury (Selmaj and Raine, 1988; Selmaj et al., 1991), promote cell-mediated demyelination (Zajicek et al., 1992), and. activate macrophages, astrocytes, and microglia, which in turn express TNF-a in active lesions (Farrar and Schreiber, 1993). IFN-y promotes the induction of MHC in glial cells, allowing them to potentially present antigens (Welsh et al., 1993). IFN-y can also induce Fas receptor expression on oligodendrocytes. This result contributes to CD4+ lymphocyte-mediated oligodendrocyte destruction by Fas/Fas ligand interactions (Pouly et al., 2000). Although CD4+ T cells are essential for the production of EAE, most evidence indicates that additional mechanisms are necessary for disease. Because oligodendrocytes in vivo do not express MHC class II molecules, it is unlikely that they are directly killed 19 by encephalitogenic CD4+ T cells (Suzumura et al., 1986; Grenier et al., 1989). Recent studies have shown that cytotoxic CD8+ T cells responses can be induced by various myelin peptides presented in the context of MHC class I, and that these T cells produce TNF-a, IFN-y, and other potentially toxic factors such as perforin and granzyme (Tsuchida et al., 1994). Since oligodendrocytes can be induced by cytokines to express MHC class I antigens, CD8+ T cells could initiate myelin loss in the lesion (Grenier et al., 1989; Tsuchida et al., 1994). B cells, demyelinating antibodies, and complements also have a role in EAE pathogenesis (Warren and Catz, 1992; Piddlesden et al., 1993; Wucherpfennig et al., 1997). Antibodies directed against myelin constituents can cause demyelination by several means. These include antibody-dependent cell-mediated toxicity (ADCC) (Brosnan et al., 1977); release of cytokines through Fc receptor stimulation on macrophages, natural killers, or mast cells (Raine and Scheinberg, 1988; Stangel and Compston, 2001); myelin opsonization, or complement activation (Hartung and Rieckmann, 1997). In addition, in immune reactions mediated by CD4+ T cells in EAE, recruitment and activation of macrophages plays an important role. Recent evidence suggests that, apart from their antigen-presenting function, macrophages and their products, free radicals, have a pivotal role in the final effector phase of EAE (Benveniste, 1997). Consistent with this is the observation that deletion of macrophages can protect animals against EAE (Huitinga et al., 1990), and that the presence of chemokines involved in macrophage recruitment correlates with disease expression (Berman et al., 1996). Furthermore, that macrophages represent the final common pathway for myelin removal and degradation is generally accepted (Smith, 2001). Activated macrophages release many factors that are 20 toxic for neurons and oligodendrocytes, among which free radicals are important ones (Klegeris and McGeer, 1994). In recent years, increasing evidence demonstrates that oxidative stress plays an important role in the pathogenesis of MS and EAE. First, it has been shown that the CNS, notably the oligodendrocyte, is extremely vulnerable to oxidative damage due to many risk factors, including a high iron content, extensive elaborations of membranes, and relatively low levels of antioxidant defenses (Smith et al., 1999; HoIIensworth et al., 2000). Second, there is convincing evidence to demonstrate that oxidative stress is a prominent feature of inflammatory demyelinating disease. Free radicals are produced massively both in EAE and MS (Smith et al., 1999). In the center and edge of active EAE lesions, the presence of both ROS and RNS has been clearly documented, strongly implicating a role for these volatile oxidants in lesion formation (Guy et al., 1993; Ruuls et al., 1995). It has also been indicated that free radicals play an important role in the pathogenesis of disruption of the BBB in EAE (Guy et al., 1994; Merrill and Murphy, 1997), and that these factors are required for the phagocytosis of myelin by macrophages (van der Goes etal., 1998). The use of several antioxidants has proved effective in the treatment of EAE (Ruuls et al., 1995; Zhao et al., 1996). Free radicals of primary concern are the superoxide anion (CV), hydroxyl radical (OH), hydrogen peroxide (H2O2), peroxyl radical (ROO), nitric oxide (NO), and peroxynitrite (ONOO"). Free radicals can damage the CNS by various cellular effects, including lipoperoxidation, DNA oxidation and protein oxidation (Vladimirova et al., 1998; Gate et al., 1999; Lu etal., 2000). 21 1 .4. A N T I O X I D A N T S Y S T E M S O F T H E O R G A N I S M S Oxidative stress is an unavoidable consequence of life in an oxygen-rich atmosphere. Free radical production occurs continuously in all cells as part of normal cellular function (Halliwell and Gutteridge, 1999). However, excess free radical production originating from endogenous or exogenous sources might play a role in many diseases. Oxidative injury is increasingly recognized as an important pathological factor in a wide variety of human diseases, including many neurological disorders, such as cerebrovascular disease, mitochondrial disorders, amyotrophic lateral sclerosis, Huntington's disease, Alzheimer's disease, and epilepsy (Delanty and Dichter, 1998). Organisms employ a multitude of antioxidant systems to defend against the deleterious effects of oxidative stress. These systems can be divided into four main groups: antioxidant enzymes, transition metal binding protein, heat shock proteins,, and small molecule antioxidants (Halliwell and Gutteridge, 1999). (1) Antioxidant enzymes catalytically remove free radicals and other "reactive species". Examples are superoxide dismutase (SOD), catalase, and glutathione peroxidase (GPX). SOD catalyze the dismutation of 02": 202" + 2H4 -» H 2 0 2 + 02. The toxic product H 2 0 2 is usually removed in mammalian cells by catalase and GPX. Both catalase and GPX detoxify H 2 0 2 by reducing it to water and oxygen (Halliwell and Gutteridge, 1999). These enzymes are present in almost all cell types, indicating a universal requirement of them for organisms (Halliwell and Gutteridge, 1999). (2) Transition metal binding proteins, including ferritin, transferrin, lactoferrin, and caeruloplasmin, act as a crucial component of the antioxidant defense system by sequestering iron and copper so that they 22 are not available to drive the formation of the hydroxyl radical (Gutteridge and Stocks, 1981; Halliwell and Gutteridge, 1984, 1990; Harrison and Arosio, 1996). (3) Heat shock proteins are evolutionarily highly conserved molecules classified according to molecular weight that occur in most cell types and that are expressed usually as a protective mechanism by cells in response to heat shock and stress (Young, 1990). These proteins act to preserve, or recover the function of other proteins during and after stress (Kaufmann, 1994). (4) In addition, organisms contain a complex mixture of small molecule antioxidants. These low-molecular-mass agents can directly react with free radicals and disarm them (Ozben and North Atlantic Treaty Organization. Scientific Affairs Division., 1998). Examples are glutathione (GSH), a-tocopherol, bilirubin, and uric acid. Some low-molecular-mass antioxidants come from the diet, especially ascorbic acid and a-tocopherol. There is an intimate relationship between nutrition and antioxidant defense (Halliwell and Gutteridge, 1999). The constituent antioxidant defenses are often overwhelmed in free radical-induced diseases. Many enzymes and proteins comprising these protective systems are inducible under conditions of oxidative stress adaptation, in which the expression of over 40 mammalian genes is upregulated (Davies, 2000). Among these a key induced activity is HO-1. For example, it was confirmed in IMR-90 and HeLa cells by Northern blot analysis that the NO-mediated induction of heme oxygenase-1 (HO-1) is much more substantial than of many other antioxidant enzymes and proteins, such as a tyrosine/threonine phosphatase (CLlOO/MKP-1) and manganese containing SOD (Marquis and Demple, 1998). HO-1/bilirubin system is now considered to be one of the 23 most powerful cellular defensive mechanisms against oxidative stress and other pathological process due to many of its properties, which I will discuss in the following. 1.5. BILIRUBIN SYSTEM Bilirubin is the final product of heme catabolism as heme oxygenase (HO) cleaves heme to form equimolar quantities of carbon monoxide (CO), iron, and biliverdin (Tenhunen et al., 1968) (Fig. 1.3). In mammals, biliverdin is subsequently reduced by biliverdin reductase (BVR) to bilirubin (Kikuchi and Yoshida, 1983; Kirkby and Adin, 2006) (Fig. 1.3). Although it has been known for more than a hundred years that bile pigments are the products of the physiological degradation of heme, it is only 40 years since the enzymes responsible for this metabolic process were first recognized. co :trorv NADP Heme Oxygenase Heme -#- Biliverdin o, N A D P H NADPH NADH NADP N A R : Biliverdin Reductase Bilirubin Figure 1.3. Heme catabolism and generation of bilirubin. Scheme of catalytic conversion of heme into bilirubin, carbon monoxide (CO), and iron. 24 1.5.1. Heme oxygenase (HO) Heme oxygenase is the rate-limiting enzyme in the catabolism of heme. It was originally identified in 1968 and 1969 by Tenhunen et al. in a series of papers where they characterized the enzyme HO as well as its cellular localization (Tenhunen et al., 1968, 1969). To date, three isoforms of HO, HO-1, HO-2, and HO-3, have been reported (Maines, 1988; McCoubrey et al., 1992; McCoubrey et al., 1997). They are products of different genes (Maines, 1999). HO-1 is a 32-kDa protein that is inducible by numerous stimuli, and has been shown to be identical to heat shock protein 32 (Ryter et al., 2006). HO-2, a 36-kDa protein, is constitutively active but unresponsive to any of the inducers of HO-1 (Shibahara et al., 1993; McCoubrey and Maines, 1994). It exists primarily in the brain and testes. HO-3, a recently cloned gene product 33-kDa in size, is nearly devoid of catalytic capability and may function chiefly as a heme-sensing or a heme-binding protein (McCoubrey et al., 1997). Its property awaits further characterization. The HO system was initially considered only as enzymes for degradation of the heme and production of toxic waste products. However, in the past decades, concomitant with the discovery of the essential role of another toxic gas, NO, for generation of cGMP, there has been an explosion of new information regarding these enzymes. It is believed that the HO enzyme reaction is physiologically significant because HO degrades the pro-oxidant heme and produces bilirubin, a potent antioxidant, CO, a transmitter, and iron, which have important regulatory and protective functions of their own (Llesuy and Tomaro, 1994; Weiss et al., 1994; Maines, 1997). It has been shown that HO-1 plays a key role in the response of cells and organisms to oxidative stress and that its second 25 form, HO-2, has physiological functions in the brain (Chen et al., 2005; Maines and Gibbs, 2005). Constituent HO, HO-2, predominates under normal physiological conditions. It is widely expressed in endothelium and neurons, with high concentrations in the brain and testes, where its distribution closely parallels that of soluble guanylate cyclase (Zakhary et al., 1996). HO-2 is crucial to the normal functioning and cellular homeostasis in the CNS and other systems (Maines, 2000). This would involve its generating products, particularly the CO that is of importance to signal transduction. For example, HO inhibitors prevent induction of long-term potentiation in the CAI region of hippocampal slices (Hawkins et al., 1994). HO-2 mutant mice were reported to show decreased responsiveness to electrical field stimulation (Zakhary et al., 1997). Recent evidence also favors a neuroprotective role for HO-2. Oxygen toxicity in brain culture is markedly augmented in HO-2"'" mice (Dore et al., 1999). Augmented neurotoxicity is associated with a selective increase in apoptotic death and is rescued by HO-2 transfection (Dore et al., 2000). HO-2"/_ animals also display greatly increased neural damage after middle cerebral artery occlusion (Dore et al., 1999). Inducible HO (HO-1). Whereas HO-2 regulates normal physiological cell function, HO-1 is induced in response to tissue injury and has been the focus of considerable interest in recent years. With the exception of the spleen where senescent erythrocytes are destroyed and HO-1 expression is constitutively high, under physiological conditions HO-1 expression is low (Braggins et al., 1986). However, in response to numerous stress stimuli, HO-1 is highly inducible in various cells and tissues (Maines, 1999). In the CNS, the protein is primarily expressed at high levels in the glial cell population and 26 macrophages in response to stress (Ewing et al., 1992). HO-1 is induced by heme and also by a variety of non-heme products such as: ultraviolet irradiation (Ossola and Tomaro, 1998), heavy metals (Eyssen-Hernandez et al., 1996), inflammatory cytokines (Terry et al., 1998), endotoxin (Carraway et al., 1998), heat shock (Shibahara et al., 1987), oxidative stress (Keyse and Tyrrell, 1989), hypoxia (Lee et al., 1997) and hyperoxia (Lee et al., 1996). One common feature of these inducers is their capacity to generate free radicals, which not only demonstrates that HO-1 can be induced by agents causing oxidative stress but also supports, the speculation that HO-1 functions as a cytoprotective molecule against oxidative stress. Indeed, ample evidence currently supports the notion that HO-1 represents a powerful endogenous defensive mechanism against oxidative stress in vitro and in vivo. The important function of HO-1 has been confirmed by observations in a series of studies. For example, it has been shown that induction of HO-1 protects endothelial cells from oxidant-mediated injury (Motterlini et al., 2000). This cytoprotective effect is considerably attenuated by tin protoporphyrin IX, an inhibitor of HO activity. Cultured cells from HO-1 knockout mice are highly susceptible to heme- or hydrogen peroxide-mediated toxicity (Poss and Tonegawa, 1997). In addition, exposure of HO-1-deficient mice to endotoxin results in increased hepatocellular necrosis and in higher mortality from endotoxic shock as compared to control animals (Poss and Tonegawa, 1997). A recent report demonstrating the first identified case of HO-1-deficient human patient lends additional support to the evolving paradigm that HO-1 serves to provide cytoprotection against oxidative stress (Yachie et al., 1999). This patient exhibits growth retardation, anemia, and increased sensitivity to oxidative damage. 27 Recent studies demonstrate that, in addition to antioxidant property, HO-1 possesses many other physiological activities, and the cytoprotective effect of HO-1 is due not only to degradation of the pro-oxidant heme but also to the multiple function of the catalytic by-products (iron/ferritin, CO, and bilirubin), which will be detailed below. HO-1 is induced in a number of experimental injuries and diseases of various organs, including carrageenin-induced pleurisy (Willis et al., 1996), congestive heart failure (Raju et al., 1999), kidney reperfusion injury (Raju and Maines, 1996), caerulein-induced pancreatitis (Sato et al., 1997), atherosclerotic lesions (Juan et al., 2001), traumatic brain injury (Fukuda et al., 1996), cerebral hemorrhage (Matz et al., 1997), ischemic stroke (Takizawa et al., 1998), and neurodegenerative diseases (Pappolla et al., 1998; Riedl et al., 1999). It has been demonstrated that activation of the endogenous HO-1 gene may be protective against the deleterious effects of stress-mediated injury in various pathological conditions. For example, Takizawa et al. have shown in vivo that induction of HO-1 by hemin protects cortical neurons against transient forebrain ischemia, whereas specific inhibition of HO enzyme activity by tin-mesoporphyrin IX tends to decrease viable neurons in the cortex (Takizawa et al., 1998). Similarly, a carrageenin-induced complement-dependent pleurisy is attenuated by induction of HO-1 activity, while inhibition of HO-1 activity potentiates this inflammatory response (Willis et al., 1996). Others have shown that HO-1 inhibits the development of atherosclerosis in apolipoprotein E-deficient mice (Juan et al., 2001). Also, recent studied demonstrated that HO-1 induction attenuates the experimental Parkinson's disease (Riedl et al., 1999; Yoo et al., 2003). These observations provide strong evidence that HO-1 plays an important protective role in a wide variety of diseases. 28 1.5.2. Biliverdin reductase (BVR) Nearly four decades ago, an NADH-dependent enzyme that converts biliverdin to bilirubin was described (Singleton and Laster, 1965). Later this enzyme was defined as an NADPH-dependent reductase (Tenhunen et al., 1970). A decade later, the enzyme, known as "biliverdin reductase" (BVR) was obtained in homogenous form and its unique dual pH/cofactor activity profile was revealed (Kutty and Maines, 1981). The reductase activity is NADH dependent at acidic pH, whereas NADPH is used in the basic range. The enzyme is highly conserved in its primary structure and biochemical properties as revealed by molecular characterization of human and rat protein, and has been identified as a zinc metalioprotein (Fakhrai and Maines, 1992; Maines et al., 1996). BVR is the product of a single-copy gene that, in the rats, consists of seven exons and six introns (McCoubrey et al., 1995). The ~1.6-kb transcript is expressed sparingly in organs such as the testis and the thymus but abundantly in others such as the kidney, spleen, liver, and brain (McCoubrey et al., 1995). The promoter region of the human and rat genes contain consensus sequence elements associated with regulation of transcriptional activity, and responses to hyperthermia (Ewing et al., 1993; McCoubrey et al., 1995). In addition to hyperthermia, heme, cytokines and LPS induce BVR transcription (Maines et al., 2001). BVR is activated by phosphorylation, and this is increased by LPS oxidative stress and free radicals (Lerner-Marmarosh et al., 2005). Regulation of HO-1 by means of reductase and transcriptional activities may serve as a paradigm for gene regulation of oxidative-response gene expression by BVR. The first direct link between BVR and HO-1 response was provided by a study that demonstrated nuclear localization of BVR in rat kidneys in response to inducers of HO-1, such as 29 bromobenzene and bacterial LPS (Maines et al., 2001). BVR nuclear localization is an active process and requires an intact nuclear localization signal (Maines et al., 2001). Gene-array analysis suggests that ho-1 and activating transcription factor (ATF-2)/cAMP response element (CRE) are controlled by BVR (Kravets et al., 2004). BVR is a bzip-type transcription factor that binds in dimeric form to AP-1 sites. Activation of AP-1 is the key event in oxidative stress response of ho-1 and other stress proteins (Shaulian et al., 2000). HO-1 is an early-response oxidative-stress gene. BVR is also activated by oxidants (Maines et al., 2001; Salim et al., 2001; Miralem et al., 2005). Accelerated rate of conversion of biliverdin to bilirubin, i.e., inactivation of biliverdin, allows for induction of ho-1 expression and increased heme-degradation activity (Kutty and Maines, 1984). A direct link between BVR and the ho-1 oxidative-stress response became evident by attenuated responses of ho-1 to superoxide anion and arsenite in cells treated with antisense BVR or small interference (si) BVR (Kutty and Maines, 1984; Miralem et al., 2005). heme Fig. 1.4. A model for redox cycle of bilirubin conferred by BVR. HO control the total levels of biliyerdin/bilirubin. BVR keeps the linear tetrapyrroie in the reduced form. 30 Importantly, recent data indicate that BVR physiologically regenerates bilirubin in a catalytic cycle whereby bilirubin, acting as an antioxidant, is itself oxidized to biliverdin and then recycled back to bilirubin by BVR (Baranano et al., 2002) (Fig. 1.4). The intrinsic amplification properties of enzymes can significantly augment the antioxidant effects of bilirubin. Remarkably, as little as 10 nanomolar bilirubin can protect cultures from the oxidant stress of 10,000 times higher concentrations of hydrogen peroxide (Dore et al., 1999). Such a cycle would represent an elegant force on the part of nature, making use of bilirubin's antioxidant capacity but ensuring that tissues had low endogenous levels of bilirubin, as the micromolar levels necessary for direct antioxidant actions would be toxic. Several parallels can be drawn between the bilirubin cycle and the cycling of GSH, the principal endogenous intracellular small molecular antioxidant. However, GSH recycling involves a peroxidase and a reductase, as well as distinct enzymes for synthesizing the antioxidant (Halliwell and Gutteridge, 1999). In contrast, bilirubin is oxidized directly to biliverdin without the apparent need of a peroxidase. The evidence indicates that BVR may cycle bilirubin at a much higher rate. In addition, different from HO-1, which also generates prooxidative iron and may have negative effects, BVR catalyzes the reduction of biliverdin and a redox cycle that produces a single end product, the potent antioxidant, bilirubin. 1.5.3. Bilirubin Bilirubin is widely known as an end-product of heme degradation. It is a lipophilic linear tetrapyrrole, abundant in mammalian serum. In adults, -250-350 mg of bilirubin are produced daily, and the normal plasma concentration of unconjugated bilirubin is 31 between 5 and 20 uM (Kirkby and Adin, 2006). Under physiological conditions, bilirubin is found in blood bound to plasma albumin, which transports it to the liver. In the liver, bilirubin dissociates from albumin and spontaneously diffuses through phospholipid bilayers into hepatocytes. Within the hepatocyte, bilirubin is bound to cytosolic proteins and glucuronic acid is attached to one or both of the propionic side chains of bilirubin by the microsomal enzyme bilirubin uridine-diphosphate glucuronosyltransferase (UDPGT), forming water-soluble bilirubin monoglucuronide and diglucuronide, which are then excreted into the bile and eliminated from the body (Kapitulnik, 2004; Kirkby and Adin, 2006). Bilirubin is a mysterious substance. It belongs to a large group of compounds, "bile pigment", that are widely distributed in the animal as well as in the vegetable kingdom. However, while bile pigments of plants (phycobilins, phytochrome) are known to play important biological roles (Ostrow, 1986), and those occurring in invertebrates appear to show physiological functions (With, 1968), bile pigments of higher vertebrates, mostly bilirubin, have long been considered cytotoxic waste products that need to be excreted. Bilirubin in high concentrations is neurotoxic and is the cause of the CNS damage in kernicterus (Hansen, 2002). Mitochondria may be a major target for bilirubin neurotoxicity (Kapitulnik, 2004). Bilirubin inhibits mitochondrial enzymes and can interfere with DNA and protein synthesis (Chuniaud et al., 1996; Ostrow et al., 2003). Additional mechanisms of bilirubin neurotoxicity include its widespread inhibitory effects on protein phosphorylation (Hansen et al., 1996), and its direct interaction with nerve cell membranes, which increases membrane permeability and decrease lipid and 32 protein order (Rodrigues et al., 2002). Phototherapy has been widely used for decades to treat newborn babies with jaundice. However, during the last few decades, a number of intriguing biochemical properties of bilirubin, particularly as an antioxidant, have been recognized, and there is now strong evidence for beneficial role that bilirubin plays in the body. Bilirubin has been demonstrated to be a potent antioxidant in vitro. Bilirubin, at micromolar concentrations, efficiently scavenges superoxide and peroxyl radicals, either in homogeneous solutions or in multilamellar liposomes (Stocker et al., 1987). It has also been shown that bilirubin can scavenge peroxynitrite, an extremely potent and stable oxidant formed by the interaction of nitric oxide (NO) and superoxide anion, and NO has been revealed as an inducer of HO-1 expression (Minetti et al., 1998; Kaur et al., 2003). Bilirubin can strongly suppresses oxidation, especially under pathological conditions (Stocker et al., 1987). Some studies indicate that bilirubin also possesses many other biological effects. For example, although not receiving proper attention, early data have suggested that bilirubin may alter the function of many important compartments of immune system: neutrophil chemotaxis (Miler et al., 1981), humoral, antibody immunity (Nejedla, 1970), and non-specific immunity, i.e. phagocytosis (Thong et al., 1977). Other biological actions of bilirubin include its anti-inflammatory and anti-mutagenic properties (Marilena, 1997; Hayashi et al., 1999). Clinical studies also indicate that bilirubin plays a protective role against various diseases. Several epidemiological studies have found that bilirubin levels are inversely associated with coronary artery disease and mortality from myocardial infarction (Djousse et al., 2001). The incidence of ischemic diseases in middle-aged individuals with Gilbert's Syndrome is reduced > 5-fold compared with the 33 general population (Vitek et al., 2002). High serum bilirubin concentrations have also been associated with decreased cancer mortality (Temme et al., 2001), resolution of asthma symptoms (Ohrui et al., 2003), and a decreased incidence of retinopathy of prematurity (Heyman et al., 1989). All this evidence indicates that bilirubin is much more than a simple endogenous waste product. It possesses multiple physiological activities, and has functional significance. It is believed that bilirubin represents the crucial mediator for the cytoprotective function of HO-1. Although, as I will discuss following, CO is also functionally important, in many experimental models in which administering CO had no significant effect, giving bilirubin had the same effect, or even a more-salutary effect, than expressing HO-1. For example, Hayashi et al (1999) showed that leukocyte adhesion and rolling were inhibited in the HO-1-induced rats compared with control rats. Inhibition of HO-1 expression using zinc protoporphyrin reversed these findings. However, further supplementation of bilirubin, but not CO, again prevented leukocyte adhesion. In a dextran sodium sulfate (DSS)-induced inflammatory bowel disease model, the disease process (diarrhea, bloody stools and weight loss) intensified during 7 days after starting DSS. Inducing HO-1 significantly postponed these disease manifestations but did not markedly suppress them. Giving biliverdin/bilirubin led to the complete absence of diarrhea and blood loss during the 7 days, whereas administration of CO or desferoxamine alone had no obvious effects (Berberat et al., 2005). 34 1.5.4. CO and iron Like bilirubin, until recently, CO was regarded solely as a toxic. However, increasing evidence indicates that CO has also functional significance, and serves a clear physiological role in cellular defense. HO-derived CO has been recognized to be an important cellular messenger with various physiological functions (Marilena, 1997; Kim et al., 2006). The signaling functions of CO resemble that of the signaling gas NO. In contrast to NO, however, which forms peroxynitrite with superoxide, CO does not form radicals. In the CNS, there is evidence that CO is involved in long-term potentiation (Stevens and Wang, 1993; Zhuo et al., 1998), which plays a key role in memory and learning. CO generated from HO can regulate vasomotor tone by promoting vasorelaxation (Morita and Kourembanas, 1995; Snyder et al., 1998), and has been implicated in the control of cerebral blood flow in the brain, a tissue with a great capacity to generate CO from HO-2 (Montecot et al., 1998). A number of studies have analyzed the specific effects of CO on the inflammatory response. First, CO prevents platelet activation and aggregation, thereby suppressing thrombosis and the pro-inflammatory response stimulated by activated platelets (Brune and Ullrich, 1987). CO has been demonstrated to modulate the inflammatory pathway in a variety of experimental models, reducing the production of inflammatory cytokines, while increasing the production of anti-inflammatory cytokine (IL-10) through interaction with MAPK pathways (Otterbein et al., 2000; Pae et al., 2004). Additionally, CO has been shown to decrease IL-6 production in vivo through the JNK pathway in response to sepsis (Morse et al., 2003). Along with the generation of CO and bilirubin, iron is also liberated from the degradation of heme. Free iron is an extremely prooxidative molecule, primarily through 35 its role in the Fenton reaction (Halliwell and Gutteridge, 1999). It has been suggested that coinduction of ferritin, a protein that could sequester the redox-active iron, may counteract iron release (Balla et al., 1992). Whereas no cytoprotective properties of free iron have been described, the induction of HO-1 has been linked to the upregulation of ferritin (Nath et al., 1992). Furthermore, overexpression of HO-1 also lead to the rapid expression of an ATPase pump that actively removes intracellular iron from the cell (Ferris et al., 1999; Baranano et al., 2000; Donovan et al., 2000). All these mechanisms limit intracellular iron content and prevent iron generated by HO from damaging cells. 1.6. HYPOTHESIS AND EXPERIMENTAL OBJECTIVES Bilirubin is insoluble, and must be glucuronidated before being excreted in the bile. If bilirubin had no functional importance, why should mammals have evolved BVR to convert biliverdin, a water-soluble and nontoxic easily excretable waste product, into bilirubin, a substance that is unexcretable, neurotoxic, seeds gallstones and has to be further metabolized for disposal? Even under extreme hemolytic conditions, when large quantities of biliverdin are produced, it remains undetectable in plasma; yet bilirubin accumulates. Based on all the above data, I made the hypotheses below: 1) Bilirubin possesses multiple physiological activities, and has functional significance. Although bilirubin at very high concentrations is toxic, bilirubin at physiological levels or physiological hyperbilirubinemia may represent an endogenous factor in mammals to defend against diseases. 36 2) Since oxidative stress as well as immunopathological factors is important in the etiology of EAE, I hypothesize that bilirubin plays an important protective role in this disease. Experimental objectives: Although it had been shown that HO-1 was protective against a host of different diseases, by 2001, no studies had reported the expression of HO-1 in EAE, and the role of bilirubin system in EAE remained unknown. My Master degree work was the first to demonstrate the important protective role of heme oxygenase-1 in an animal model of multiple sclerosis (Liu et al., 2001). The overall goal of my PhD study is to further examine the potential protective effect of bilirubin system on EAE, and to explore it as a novel strategy for treatment in human diseases such as multiple sclerosis: 1) In the present research, I will further investigate the actions of the bilirubin system in EAE. As I discussed above, since the cytoprotective function of HO-1 is mainly due to the effect of bilirubin, my PhD study focuses more on the latter. Although many in vitro studies have shown that bilirubin is a strong antioxidant, its physiological role in vivo remains to be elucidated. At first, I will investigate whether bilirubin as a potent antioxidant can suppress EAE. 2) At present, most studies about the physiological functions of bilirubin focus on its antioxidant action. Its effects in other fields are not explored. Therefore, I will also examine other important biological activities of bilirubin, especially the immunomodulatory property. 37 3) It is noteworthy that bilirubin may have a dual role in vivo. On the one hand, bilirubin has functional significance, and may defend against the development of disease. On the other hand, high levels of bilirubin are unexcretable and potentially cytotoxic. Although animal biles (Niu Huang) have long been used in traditional oriental medicine for therapy of many diseases including bronchitis, asthma and hypersensitivities, its utility in the clinic is still limited. Since BVR can regenerate bilirubin in a catalytic cycle, and it may amplify the action of bilirubin without significantly increasing the concentration of bilirubin, I will further explore this enzyme as a novel, safer, and more practical strategy for the treatment of EAE/MS and other stress or immune-mediated diseases. 38 1.7. REFERENCES: Amor S, Groome N, Linington C, Morris MM, Dornmair K, Gardinier MV, Matthieu JM, Baker D (1994) Identification of epitopes of myelin oligodendrocyte glycoprotein for the induction of experimental allergic encephalomyelitis in SJL and Biozzi AB/H mice. J Immunol 153:4349-4356. Andersen O, Lygner PE, Bergstrom T, Andersson M, Vahlne A (1993) Viral infections trigger multiple sclerosis relapses: a prospective seroepidemiological study. J Neurol 240:417-422. Balla G, Jacob HS, Balla J, Rosenberg M, Nath K, Apple F, Eaton JW, Vercellotti GM (1992) Ferritin: a cytoprotective antioxidant strategem of endothelium. J Biol Chem 267:18148-18153. Baranano DE, Rao M, Ferris CD, Snyder SH (2002) Biliverdin reductase: a major physiologic cytoprotectant. Proc Natl Acad Sci U S A 99:16093-16098. Baranano DE, Wolosker H, Bae BI, Barrow RK, Snyder SH, Ferris CD (2000) A mammalian iron ATPase induced by iron. JBiol Chem 275:15166-15173. Barbano RL, Dal Canto MC (1984) Serum and cells from Theiler's virus-infected mice fail to injure myelinating cultures or to produce in vivo transfer of disease. The pathogenesis of Theiler's virus-induced demyelination appears to differ from that of EAE. J Neurol Sci 66:283-293. Baron JL, Madri JA, Ruddle NH, Hashim G, Janeway CA, Jr. (1993) Surface expression of alpha 4 integrin by CD4 T cells is required for their entry into brain parenchyma. J Exp Med 177:57-68. 39 Benveniste EN (1997) Role of macrophages/microglia in multiple sclerosis and experimental allergic encephalomyelitis. J Mol Med 75:165-173. Berberat PO, YI AR, Yamashita K, Warny MM, Csizmadia E, Robson SC, Bach FH (2005) Heme oxygenase-1-generated biliverdin ameliorates experimental murine colitis. Inflamm Bowel Dis 11:350-359. Berman JW, Guida MP, Warren J, Amat J, Brosnan CF (1996) Localization of monocyte chemoattractant peptide-1 expression in the central nervous system in experimental autoimmune encephalomyelitis and trauma in the rat. J Immunol 156:3017-3023. Bernard CC (1976) Experimental autoimmune encephalomyelitis in mice: genetic control of susceptibility. J Immunogenet 3:263-274. Bernard CC, Mandel T, Mackay IR (1992) Experimental models of human autoimmune disease: Overview and prototypes. In: Rose NR, Mackay IR ed. The Autoimmune Disease II, pp 47-106. San Diego: Academic Press. Braggins PE, Trakshel GM, Kutty RK, Maines MD (1986) Characterization of two heme oxygenase isoforms in rat spleen: comparison with the hematin-induced and constitutive isoforms of the liver. Biochem Biophys Res Commun 141:528-533. Brahic M, Haase AT, Cash E (1984) Simultaneous in situ detection of viral RNA and antigens. Proc Natl Acad Sci U S A 81:5445-5448. Brahic M, Bureau JF, Michiels T (2005) The genetics of the persistent infection and demyelinating disease caused by Theiler's virus. Annu Rev Microbiol 59:279-298. 40 Brosnan CF, Stoner GL, Bloom BR, Wisniewski HM (1977) Studies on demyelination by activated lymphocytes in the rabbit eye. II. Antibody-dependent cell-mediated demyelination. J Immunol 118:2103-2110. Brown AM, McFarlin DE (1981) Relapsing experimental allergic encephalomyelitis in the SJL/J mouse. Lab Invest 45:278-284. Brune B, Ullrich V (1987) Inhibition of platelet aggregation by carbon monoxide is mediated by activation of guanylate cyclase. Mol Pharmacol 32:497-504. Burns FR, Li XB, Shen N, Offner H, Chou YK, Vandenbark AA, Heber-Katz E (1989) Both rat and mouse T cell receptors specific for the encephalitogenic determinant of myelin basic protein use similar V alpha and V beta chain genes even though the major histocompatibility complex and encephalitogenic determinants being recognized are different. J Exp Med 169:27-39. Carraway MS, Ghio AJ, Taylor JL, Piantadosi CA (1998) Induction of ferritin and heme oxygenase-1 by endotoxin in the lung. Am J Physiol 275:L583-592. Carswell R (1838) Pathologic Anatomy: Illustrations of Elementary Forms of Disease. London: Longman. Chamorro M, Aubert C, Brahic M (1986) Demyelinating lesions due to Theiler's virus are associated with ongoing central nervous system infection. J Virol 57:992-997. Charcot JM (1868) Seance du 14 mars. Cr Soc Biol (Paris) 20: 13-14. Chen J, Tu Y, Connolly EC, Ronnett GV (2005) Heme oxygenase-2 protects against glutathione depletion-induced neuronal apoptosis mediated by bilirubin and cyclic GMP. Curr Neurovasc Res 2:121-131. 41 Chluba J, Steeg C, Becker A, Wekerle H, Epplen JT (1989) T cell receptor beta chain usage in myelin basic protein-specific rat T lymphocytes. Eur J Immunol 19:279-284. Chuniaud L, Dessante M, Chantoux F, Blondeau JP, Francon J, Trivin F (1996) Cytotoxicity of bilirubin for human fibroblasts and rat astrocytes in culture. Effect of the ratio of bilirubin to serum albumin. Clin Chim Acta 256:103-114. Clatch RJ, Melvold RW, Miller SD, Lipton HL (1985) Theiler's murine, encephalomyelitis virus (TMEV)-induced demyelinating disease in mice is influenced by the H-2D region: correlation with TEMV- specific delayed-type hypersensitivity. J Immunol 135:1408-1414. Clatch RJ, Miller SD, Metzner R, Dal Canto MC, Lipton HL (1990) Monocytes/macrophages isolated from the mouse central nervous system contain infectious Theiler's murine encephalomyelitis virus (TMEV). Virology 176:244-254. Compston A (2005) McAlpine's multiple sclerosis, 4th Edition. Sydney; Edinburgh; New York: Elsevier/Churchill Livingstone. Compston A, Coles A (2002) Multiple sclerosis. Lancet 359:1221-1231. Conlon P, Oksenberg JR, Zhang J, Steinman L (1999) The immunobiology of multiple sclerosis: an autoimmune disease of the central nervous system. Neurobiol Dis 6:149-166. Cook SD (2006) Handbook of multiple sclerosis, 4th Edition. New York: Taylor & Francis. Cruveilhier J (1842) Anatomie pathologique du corps humain. Paris: JB Bailliere. 42 Dal Canto MC, Lipton HL (1975) Primary demyelination in Theiler's virus infection. An ultrastructural study. Lab Invest 33:626-637. Dal Canto MC, Lipton HL (1977) Multiple sclerosis. Animal model:Theiler's virus infection in mice. Am J Pathol 88:497-500. Daniels JB, Pappenheimer A M , Richardson S (1952) Observations on encephalomyelitis of mice (DA strain). J Exp Med 96:517-525. Davies KJ (2000) Oxidative stress, antioxidant defenses, and damage removal, repair, and replacement systems. IUBMB Life 50:279-289. Delanty N , Dichter M A (1998) Oxidative injury in the nervous system. Acta Neurol Scand 98:145-153. Djousse L, Levy D, Cupples LA, Evans JC, D'Agostino RB, Ellison RC (2001) Total serum bilirubin and risk of cardiovascular disease in the Framingham offspring study. Am J Cardiol 87:1196-1200; A l 194, 1197. Donovan A, Brownlie A, Zhou Y, Shepard J, Pratt SJ, Moynihan J, Paw BH, Drejer A, Barut B, Zapata A, Law TC, Brugnara C, Lux SE, Pinkus GS, Pinkus JL, Kingsley PD, Palis J, Fleming MD, Andrews NC, Zon LI (2000) Positional cloning of zebrafish ferroportinl identifies a conserved vertebrate iron exporter. Nature 403:776-781. Dore S, Takahashi M , Ferris CD, Zakhary R, Hester LD, Guastella D, Snyder SH (1999) Bilirubin, formed by activation of heme oxygenase-2, protects neurons against oxidative stress injury. Proc Natl Acad Sci U S A 96:2445-2450. Dore S, Goto S, Sampei K, Blackshaw S, Hester LD, Ingi T, Sawa A, Traystman RJ, Koehler RC, Snyder SH (2000) Heme oxygenase-2 acts to prevent neuronal death 43 in brain cultures and following transient cerebral ischemia. Neuroscience 99:587-592. Dore S, Sampei K, Goto S, Alkayed NJ, Guastella D, Blackshaw S, Gallagher M, Traystman RJ, Hum PD, Koehler RC, Snyder SH (1999) Heme oxygenase-2 is neuroprotective in cerebral ischemia. Mol Med 5:656-663. Ebers GC (1983) Genetic factors in multiple sclerosis. Neurol Clin 1:645-654. Ebers GC (2005) A twin consensus in MS. Mult Scler 11:497-499. Ebers GC, Sadovnick AD, Risch NJ (1995) A genetic basis for familial aggregation in multiple sclerosis. Canadian Collaborative Study Group. Nature 377:150-151. Engelhardt B (2006) Regulation of immune cell entry into the central nervous system. Results Probl Cell Differ 43:259-280. Ewing JF, Haber SN, Maines MD (1992) Normal and heat-induced patterns of expression of heme oxygenase-1 (HSP32) in rat brain: hyperthermia causes rapid induction of mRNA and protein. J Neurochem 58:1140-1149. Ewing JF, Weber CM, Maines MD (1993) Biliverdin reductase is heat resistant and coexpressed with constitutive and heat shock forms of heme oxygenase in brain. J Neurochem 61:1015-1023. Eyssen-Hernandez R, Ladoux A, Frelin C (1996) Differential regulation of cardiac heme oxygenase-1 and vascular endothelial growth factor mRNA expressions by hemin, heavy metals, heat shock and anoxia. FEBS Lett 382:229-233. Fakhrai H, Maines MD (1992) Expression and characterization of a cDNA for rat kidney biliverdin reductase. Evidence suggesting the liver and kidney enzymes are the same transcript product. J Biol Chem 267:4023-4029. 44 Farrar MA, Schreiber RD (1993) The molecular cell biology of interferon-gamma and its receptor. Annu Rev Immunol 11:571-611. Ferguson B, Matyszak MK, Esiri MM, Perry VH (1997) Axonal damage in acute multiple sclerosis lesions. Brain 120:393-399. Ferris CD, Jaffrey SR, Sawa A, Takahashi M, Brady SD, Barrow RK, Tysoe SA, Wolosker H, Baranano DE, Dore S, Poss KD, Snyder SH (1999) Haem oxygenase-1 prevents cell death by regulating celjular iron. Nat Cell Biol 1:152-157. Freedman MS (2006) Multiple sclerosis and demyelinating diseases. Philadelphia, Pa.; London: Lippincott Williams & Wilkins. Fritz RB, McFarlin DE (1989) Encephalitogenic epitopes of myelin basic protein. Chem Immunol 46:101-125. Fritz RB, Chou CH, McFarlin DE (1983) Induction of experimental allergic encephalomyelitis in PL/J and (SJL/J x PL/J)F1 mice by myelin basic protein and its peptides: localization of a second encephalitogenic determinant. J Immunol 130:191-194. Frohman EM, Racke MK, Raine CS (2006) Multiple sclerosis~the plaque and its pathogenesis. N Engl J Med 354:942-955. Fukazawa T, Sasaki H, Kikuchi S, Hamada T, Tashiro K (2000) Genetics of multiple sclerosis. Biomed Pharmacother 54:103-106. Fukuda K, Richmon JD, Sato M, Sharp FR, Panter SS, Noble LJ (1996) Induction of heme oxygenase-1 (HO-1) in glia after traumatic brain injury. Brain Res 736:68-75. 45 Funjinami RS, Paterson PY (1977) Induction of experimental allergic encephalomyelitis in suckling Lewis rats: role of age and type of sensitizing neuroantigen. J Immunol 119:1634-1638. Gasser DL, Palm J, Gonatas NK (1975) Genetic control of susceptibility to experimental allergic encephalomyelitis and the Ag-B locus of rats. J Immunol 115:431-433. Gate L, Paul J, Ba GN, Tew KD, Tapiero H (1999) Oxidative stress induced in pathologies: the role of antioxidants. Biomed Pharmacother 53:169-180. Geczy CL, Roberts IM, Meyer P, Bernard CC (1984) Susceptibility and resistance to experimental autoimmune encephalomyelitis and neuritis in the guinea pig correlate with the induction of procoagulant and anticoagulant activities. J Immunol 133:3026-3036. Genain CP, Cannella B, Hauser SL, Raine CS (1999) Identification of autoantibodies associated with myelin damage in multiple sclerosis. Nat Med 5:170-175. Giess R, Maurer M, Linker R, Gold R, Warmuth-Metz M, Toyka KV, Sendtner M, Rieckmann P (2002) Association of a null mutation in the CNTF gene with early onset of multiple sclerosis. Arch Neurol 59:407-409. Gold R, Linington C, Lassmann H (2006) Understanding pathogenesis and therapy of multiple sclerosis via animal models: 70 years of merits and culprits in experimental autoimmune encephalomyelitis research. Brain 129:1953-1971. Goverman J, Woods A, Larson L, Weiner LP, Hood L, Zaller DM (1993) Transgenic mice that express a myelin basic protein-specific T cell receptor develop spontaneous autoimmunity. Cell 72:551-560. 46 Grenier Y, Ruijs TC, Robitaille Y, Olivier A, Antel JP (1989) Immunohistochemical studies of adult human glial cells. J Neuroimmunol 21:103-115. Gutteridge JM, Stocks J (1981) Caeruloplasmin: physiological and pathological perspectives. Crit Rev Clin Lab Sci 14:257-329. Guy J, Ellis EA, Mames R, Rao NA (1993) Role of hydrogen peroxide in experimental optic neuritis. A serial quantitative ultrastructural study. Ophthalmic Res 25:253-264. Guy J, McGorray S, Fitzsimmons J, Beck B, Rao NA (1994) Disruption of the blood-brain barrier in experimental optic neuritis: immunocytochemical co-localization of H202 and extravasated serum albumin. Invest Ophthalmol Vis Sci 35:1114-1123. Halliwell B, Gutteridge JM (1984) Oxygen toxicity, oxygen radicals, transition metals and disease. Biochem J 219:1-14. Halliwell B, Gutteridge JM (1990) The antioxidants of human extracellular fluids. Arch Biochem Biophys 280:1-8. Halliwell B, Gutteridge JMC (1999) Free radicals in biology and medicine, 3rd Edition. Oxford, England: Oxford University Press. Hansen TW (2002) Kernicterus: an international perspective. Semin Neonatol 7:103-109. Hansen TW, Mathiesen SB, Walaas SI (1996) Bilirubin has widespread inhibitory effects on protein phosphorylation. Pediatr Res 39:1072-1077. Harrison PM, Arosio P (1996) The ferritins: molecular properties, iron storage function and cellular regulation. Biochim Biophys Acta 1275:161-203. 47 Hartung HP, Rieckmann P (1997) Pathogenesis of immune-mediated demyelination in the CNS. J Neural Transm Suppl 50:173-181. Hawkins RD, Zhuo M, Arancio O (1994) Nitric oxide and carbon monoxide as possible retrograde messengers in hippocampal long-term potentiation. J Neurobiol 25:652-665. Hayashi S, Takamiya R, Yamaguchi T, Matsumoto K, Tojo SJ, Tamatani T, Kitajima M, Makino N, Ishimura Y, Suematsu M (1999) Induction of heme oxygenase-1 suppresses venular leukocyte adhesion elicited by oxidative stress: role of bilirubin generated by the enzyme. Circ Res 85:663-671. Heyman E, Ohlsson A, Girschek P (1989) Retinopathy of prematurity and bilirubin. N Engl J Med 320:256. Hollensworth SB, Shen C, Sim JE, Spitz DR, Wilson GL, LeDoux SP (2000) Glial cell type-specific responses to menadione-induced oxidative stress. Free Radic Biol Med 28:1161-1174. Huitinga I, van Rooijen N, de Groot CJ, Uitdehaag BM, Dijkstra CD (1990) Suppression of experimental allergic encephalomyelitis in Lewis rats after elimination of macrophages. J Exp Med 172:1025-1033. Huitinga I, Ruuls SR, Jung S, Van Rooijen N, Hartung HP, Dijkstra CD (1995) Macrophages in T cell line-mediated, demyelinating, and chronic relapsing experimental autoimmune encephalomyelitis in Lewis rats. Clin Exp Immunol 100:344-351. Immenschuh S, Ramadori G (2000) Gene regulation of heme oxygenase-1 as a therapeutic target. Biochem Pharmacol 60:1121-1128. 48 Juan SH, Lee TS, Tseng KW, Liou JY, Shyue SK, Wu KK, Chau LY (2001) Adenovirus-mediated heme oxygenase-1 gene transfer inhibits the development of atherosclerosis in apolipoprotein E-deficient mice. Circulation 104:1519-1525. Kabat EA, Wolf A, Bezer AE (1946) The rapid production of acute disseminated encephalomyelitis in Rhesus monkeys by infection of brain tissue with adjuvants. Science 104:362-363. Kabat EA, Wolf A, Bezer AE (1947) The rapid production of acute disseminated encephalomyelitis in rhesus /monkeys by injection of heterologous and homologous brain tissue with adjuvants. J Exp Med 85:117-130. Kantarci O, Wingerchuk D (2006) Epidemiology and natural history of multiple sclerosis: new insights. Curr Opin Neurol 19:248-254. Kapitulnik J (2004) Bilirubin: an endogenous product of heme degradation with both cytotoxic and cytoprotective properties. Mol Pharmacol 66:773-779. Kappel CA, Melvold RW, Kim BS (1990) Influence of sex on susceptibility in the Theiler's murine encephalomyelitis virus model for multiple sclerosis. J Neuroimmunol 29:15-19. Kaufmann SH (1994) Heat shock proteins and autoimmunity: a critical appraisal. Int Arch Allergy Immunol 103:317-322. Kaur H, Hughes MN, Green CJ, Naughton P, Foresti R, Motterlini R (2003) Interaction of bilirubin and biliverdin with reactive nitrogen species. FEBS Lett 543:113-119. Keyse SM, Tyrrell RM (1989) Heme oxygenase is the major 32-kDa stress protein induced in human skin fibroblasts by UVA radiation, hydrogen peroxide, and sodium arsenite. Proc Natl Acad Sci U S A 86:99-103. 49 Kikuchi G, Yoshida T (1983) Function and induction of the microsomal heme oxygenase. Mol Cell Biochem 54:163-183. Kim HP, Ryter SW, Choi AM (2006) CO as a cellular signaling molecule. Annu Rev Pharmacol Toxicol 46:411-449. Kirkby KA, Adin CA (2006) Products of heme oxygenase and their potential therapeutic applications. Am J Physiol Renal Physiol 290:F563-571. Klegeris A, McGeer PL (1994) Rat brain microglia and peritoneal macrophages show similar responses to respiratory burst stimulants. J Neuroimmunol 53:83-90. Kravets A, Hu Z, Miralem T, Torno MD, Maines MD (2004) Biliverdin reductase, a novel regulator for induction of activating transcription factor-2 and heme oxygenase-1. J Biol Chem 279:19916-19923. Kurtzke JF (1975) A reassessment of the distribution of multiple sclerosis. Part one. Acta Neurol Scand 51:110-136. Kurtzke JF (1980) Geographic distribution of multiple sclerosis: An update with special reference to Europe and the Mediterranean region. Acta Neurol Scand 62:65-80. Kurtzke JF, Hyllested K (1979) Multiple sclerosis in the Faroe Islands: I. Clinical and epidemiological features. Ann Neurol 5:6-21. Kurtzke JF, Beebe GW, Norman JE, Jr. (1979) Epidemiology of multiple sclerosis in U.S. veterans: 1. Race, sex, and geographic distribution. Neurology 29:1228-1235. Kurtzke JF (1985) Epidemiology of multiple sclerosis. In: Vinken PJ, Bruyn GW, Klawans HL ed. Handbook of clinical neurology. Demyelinating diseases, pp 259-287. New York: Elsevier Science Publisher. 50 Kutty RX, Maines MD (1981) Purification and characterization of biliverdin reductase from rat liver. J Biol Chem 256:3956-3962. Kutty RK, Maines MD (1984) Hepatic heme metabolism: possible role of biliverdin in the regulation of heme oxygenase activity. Biochem Biophys Res Commun 122:40-46. Lassmann H (2003) Hypoxia-like tissue injury as a component of multiple sclerosis lesions. J Neurol Sci 206:187-191. Lee PJ, Alam J, Sylvester SL, Inamdar N, Otterbein L, Choi AM (1996) Regulation of heme oxygenase-1 expression in vivo and in vitro in hyperoxic lung injury. Am J Respir Cell Mol Biol 14:556-568. Lee PJ, Jiang BH, Chin BY, Iyer NV, Alam J, Semenza GL, Choi AM (1997) Hypoxia-inducible factor-1 mediates transcriptional activation of the heme oxygenase-1 gene in response to.hypoxia. J Biol Chem 272:5375-5381. Lerner-Marmarosh N, Shen J, Torno MD, Kravets A, Hu Z, Maines MD (2005) Human biliverdin reductase: a member of the insulin receptor substrate family with serine/threonine/tyrosine kinase activity. Proc Natl Acad Sci U S A 102:7109-7114. Linker RA, Maurer M, Gaupp S, Martini R, Holtmann B, Giess R, Rieckmann P, Lassmann H, Toyka KV, Sendtner M, Gold R (2002) CNTF is a major protective factor in demyelinating CNS disease: a neurotrophic cytokine as modulator in neuroinflammation. Nat Med 8:620-624. Lipton HL (1975) Theiler's virus infection in mice: an unusual biphasic disease process leading to demyelination. Infect Immun 11:1147-1155. 51 Lipton HL (1980) Persistent Theiler's murine encephalomyelitis virus infection in mice depends on plaque size. J Gen Virol 46:169-177. Lipton HL, Dal Canto MC (1976) Theiler's virus-induced demyelination: prevention by immunosuppression. Science 192:62-64. Lipton HL, Dal Canto MC (1976) Chronic neurologic disease in Theiler's virus infection of SJL/J mice. J Neurol Sci 30:201-207. Lipton HL, Dal Canto MC (1979) Susceptibility of inbred mice to chronic central nervous system infection by Theiler's murine encephalomyelitis virus. Infect Immun 26:369-374. Lipton HL, Melvold R (1984) Genetic analysis of susceptibility to Theiler's virus-induced demyelinating disease in mice. J Immunol 132:1821-1825. Liu Y, Zhu B, Luo L, Li P, Paty DW, Cynader MS (2001) Heme oxygenase-1 plays an important protective role in experimental autoimmune encephalomyelitis. Neuroreport 12:1841-1845. Llesuy SF, Tomaro ML (1994) Heme oxygenase and oxidative stress. Evidence of involvement of bilirubin as physiological protector against oxidative damage. Biochim Biophys Acta 1223:9-14. Lu F, Selak M, O'Connor J, Croul S, Lorenzana C, Butunoi C, Kalman B (2000) Oxidative damage to mitochondrial DNA and activity of mitochondrial enzymes in chronic active lesions of multiple sclerosis. J Neurol Sci 177:95-103. Lucchinetti CF, Parisi J, Bruck W (2005) The pathology of multiple sclerosis. Neurol Clin 23:77-105, vi. 52 Lyman WD, Abrams GA, Raine CS (1989) Experimental autoimmune encephalomyelitis: isolation and characterization of inflammatory cells from the central nervous system. J Neuroimmunol 25:195-201. MaCarron RM, Tanaka M, Spatz M (1990) Class II major histocompatibility complex antigen expression in central nervous system: microglia, astrocytes and endothelial cells. In: Johansson BB, Owman CO, Widmer H, ed. Pathophysiology of the blood-brain barrier, pp 467-484. Amsterdam/New York: Elsevier Science Publishers. Maines MD (1988) Heme oxygenase: function, multiplicity, regulatory mechanisms, and clinical applications. Faseb J 2:2557-2568. Maines MD (1997) The heme oxygenase system: a regulator of second messenger gases. Annu Rev Pharmacol Toxicol 37:517-554. Maines MD (1999) Characterization and regulation of heme oxygenase isozymes at the molecular level. In: Maines MD ed. Heme Oxygenase: Clinical Application and Functions, pp 109-144. Boca Raton: CRC Press. Maines MD (2000) The heme oxygenase system and its functions in the brain. Cell Mol Biol (Noisy-le-grand) 46:573-585. Maines MD, Gibbs PE (2005) 30 some years of heme oxygenase: from a "molecular wrecking ball" to a "mesmerizing" trigger of cellular events. Biochem Biophys Res Commun 338:568-577. Maines MD, Polevoda BV, Huang TJ, McCoubrey WK, Jr. (1996) Human biliverdin IXalpha reductase is a zinc-metalloprotein. Characterization of purified and Escherichia coli expressed enzymes. Eur J Biochem 235:372-381. 53 Maines MD, Ewing JF, Huang TJ, Panahian N (2001) Nuclear localization of biliverdin reductase in the rat kidney: response to nephrotoxins that induce heme oxygenase-1. J Pharmacol Exp Ther 296:1091-1097. Marie P (1884) Sclerose en plaques et maladie infecteuses. Prog Med 12: 287-289. Marilena G (1997) New physiological importance of two classic residual products: carbon monoxide and bilirubin. Biochem Mol Med 61:136-142. Marquis JC, Demple B (1998) Complex genetic response of human cells to sublethal levels of pure nitric oxide. Cancer Res 58:3435-3440. Martin R, McFarland HF, McFarlin DE (1992) Immunological aspects of demyelinating diseases. Annu Rev Immunol 10:153-187. Martyn C (1991) Epidemiology. In: Matthews WB ed. McAlpine's Multiple Sclerosis, pp 3-40. Edingburgh: Chruchill Livingstone. Matz PG, Weinstein PR, Sharp FR (1997) Heme oxygenase-1 and heat shock protein 70 induction in glia and neurons throughout rat brain after experimental intracerebral hemorrhage. Neurosurgery 40:152-160; discussion 160-152. McCoubrey WK, Jr., Maines MD (1994) The structure, organization and differential expression of the gene encoding rat heme oxygenase-2. Gene 139:155-161. McCoubrey WK, Jr., Ewing JF, Maines MD (1992) Human heme oxygenase-2: characterization and expression of a full- length cDNA and evidence suggesting that the two HO-2 transcripts may differ by choice of polyadenylation signal. Arch Biochem Biophys 295:13-20. 54 McCoubrey WK, Jr., Cooklis MA, Maines MD (1995) The structure, organization and differential expression of the rat gene encoding biliverdin reductase. Gene 160:235-240. McCoubrey WK, Jr., Eke B, Maines MD (1995) Multiple transcripts encoding heme oxygenase-2 in rat testis: developmental and cell-specific regulation of transcripts and protein. Biol Reprod 53:1330-1338. McCoubrey WK, Jr., Huang TJ, Maines MD (1997) Isolation and characterization of a cDNA from the rat brain that encodes hemoprotein heme oxygenase-3. Eur J Biochem 247:725-732. Melvold RW, Jokinen DM, Knobler RL, Lipton HL (1987) Variations in genetic control of susceptibility to Theiler's murine encephalomyelitis virus (TMEV)-induced demyelinating disease. I. Differences between susceptible SJL/J and resistant BALB/c strains map near the T cell beta-chain constant gene on chromosome 6. J Immunol 138:1429-1433. Melvold RW, Jokinen DM, Miller SD, Dal Canto MC, Lipton HL (1990) Identification of a locus on mouse chromosome 3 involved in differential susceptibility to Theiler's murine encephalomyelitis virus- induced demyelinating disease. J Virol 64:686-690. Merrill JE, Murphy SP (1997) Inflammatory events at the blood brain barrier: regulation of adhesion molecules, cytokines, and chemokines by reactive nitrogen and oxygen species. Brain Behav Immun 11:245-263. 55 Miler I, Vondracek J, Hromadkova L (1981) Bilirubin inhibits the chemotactic activity of human polymorphonuclear leukocytes in vitro. Folia Microbiol (Praha) 26:413-416. Miller SD, Karpus WJ (1994) The immunopathogenesis and regulation of T-cell-mediated demyelinating diseases. Immunol Today 15:356-361. Miller SD, Shevach EM (1998) Immunoregulation of experimental autoimmune encephalomyelitis: editorial overview. Res Immunol 149:753-759. Minetti M, Mallozzi C, Di Stasi AM, Pietraforte D (1998) Bilirubin is an effective antioxidant of peroxynitrite-mediated protein oxidation in human blood plasma. Arch Biochem Biophys 352:165-174. Miralem T, Hu Z, Torno MD, Lelli KM, Maines MD (2005) Small interference RNA-mediated gene silencing of human biliverdin reductase, but not that of heme oxygenase-1, attenuates arsenite-mediated induction of the oxygenase and increases apoptosis in 293A kidney cells. J Biol Chem 280:17084-17092. Montecot C, Seylaz J, Pinard E (1998) Carbon monoxide regulates cerebral blood flow in epileptic seizures but not in hypercapnia. Neuroreport 9:2341-2346. Morgan IM (1946) Allergic encephalomyelitis in monkeys in response to injection of normal monkey cord. J Bacteriol 51:614-615. Morita T, Kourembanas S (1995) Endothelial cell expression of vasoconstrictors and growth factors is regulated by smooth muscle cell-derived carbon monoxide. J Clin Invest 96:2676-2682. 56 Morse D, Pischke SE, Zhou Z, Davis RJ, Flavell RA, Loop rT, Otterbein SL, Otterbein LE, Choi A M (2003) Suppression of inflammatory cytokine production by carbon monoxide involves the JNK pathway and AP-1. J Biol Chem 278:36993-36998. Motterlini R, Foresti R, Bassi R, Green CJ (2000) Curcumin, an antioxidant and anti-inflammatory agent, induces heme oxygenase-1 and protects endothelial cells against oxidative stress. Free Radic Biol Med 28:1303-1312. Nath K A , Balla G, Vercellotti GM, Balla J, Jacob HS, Levitt MD, Rosenberg ME (1992) Induction of heme oxygenase is a rapid, protective response in rhabdomyolysis in the rat. J Clin Invest 90:267-270. Nejedla Z (1970) The development of immunological factors in infants with hyperbilirubinemia. Pediatrics 45:102-104. Noronha A, Arnason B (1996) Demyelinating diseases. In: Rich RR ed. Clinical immunology, principles and practice, pp 1364-1376. Mosby: Year Book Incorporation. Noseworthy JH, Lucchinetti C, Rodriguez M„ Weinshenker BG (2000) Multiple sclerosis. N Engl J Med 343:938-952. Offner H, Hashim GA, Celnik B, Galang A, L i X B , Burns FR, Shen N , Heber-Katz E, Vandenbark A A (1989) T cell determinants of myelin basic protein include a unique encephalitogenic I-E-restricted epitope for Lewis rats. J Exp Med 170:355-367. Ohrui T, Yasuda H, Yamaya M , Matsui T, Sasaki H (2003) Transient relief of asthma symptoms during jaundice: a possible beneficial role of bilirubin. Tohoku J Exp Med 199:193-196. 57 Olek MJ (2005) Multiple sclerosis: etiology, diagnosis, and new treatment strategies. Totowa, N.J.: Humana Press. Oleszak EL, Chang JR, Friedman H, Katsetos CD, Platsoucas CD (2004) Theiler's virus infection: a model for multiple sclerosis. Clin Microbiol Rev 17:174-207. Ollivier CP (1824) De la moelle epiniere et de ses maladies. Paris: Crevot. Olsson T (1995) Critical influences of the cytokine orchestration on the outcome of myelin antigen-specific T-cell autoimmunity in experimental autoimmune encephalomyelitis and multiple sclerosis. Immunol Rev 144:245-268. Orton SM, Herrera BM, Yee IM, Valdar W, Ramagopalan SV, Sadovnick AD, Ebers GC (2006) Sex ratio of multiple sclerosis in Canada: a longitudinal study. Lancet Neurol 5:932-936. Ossola JO, Tomaro ML (1998) Heme oxygenase induction by UVA radiation. A response to oxidative stress in rat liver. Int J Biochem Cell Biol 30:285-292. Ostrow JD (1986) Bile pigments and jaundice: molecular, metabolic, and medical aspects. New York: Dekker. Ostrow JD, Pascolo L, Shapiro SM, Tiribelli C (2003) New concepts in bilirubin encephalopathy. Eur J Clin Invest 33:988-997. Otterbein LE, Bach FH, Alam J, Soares M, Tao Lu H, Wysk M, Davis RJ, Flavell RA, Choi AM (2000) Carbon monoxide has anti-inflammatory effects involving the mitogen-activated protein kinase pathway. Nat Med 6:422-428. Owens T, Wekerle H, Antel J (2001) Genetic models for CNS inflammation. Nat Med 7:161-166. 58 Pae HO, Oh GS, Choi BM, Chae SC, Kim YM, Chung KR, Chung HT (2004) Carbon monoxide produced by heme oxygenase-1 suppresses T cell proliferation via inhibition of IL-2 production. J Immunol 172:4744-4751. Pappolla MA, Chyan YJ, Omar RA, Hsiao K, Perry G, Smith MA, Bozner P (1998) Evidence of oxidative stress and in vivo neurotoxicity of beta-amyloid in a transgenic mouse model of Alzheimer's disease: a chronic oxidative paradigm for testing antioxidant therapies in vivo. Am J Pathol 152:871-877. Paterson PY (1960) Transfer of allergic encephalomyelitis in rats by means of lymph node cells. J Exp Med 111:119-136. Patick AK, Pease LR, David CS, Rodriguez M (1990) Major histocompatibility complex-conferred resistance to Theiler's virus-induced demyelinating disease is inherited as a dominant trait in BIO congenic mice. J Virol 64:5570-5576. Paty DW, Ebers GC (1998) Multiple sclerosis. Philadelphia: F.A. Davis. Pevear DC, Calenoff M, Rozhon E, Lipton HL (1987) Analysis of the complete nucleotide sequence of the picornavirus Theiler's murine encephalomyelitis virus indicates that it is closely related to cardioviruses. J Virol 61:1507-1516. Piddlesden SJ, Lassmann H, Zimprich F, Morgan BP, Linington C (1993) The demyelinating potential of antibodies to myelin oligodendrocyte glycoprotein is related to their ability to fix complement. Am J Pathol 143:555-564. Poss KD, Tonegawa S (1997) Reduced stress defense in heme oxygenase 1-deficient cells. Proc Natl Acad Sci U S A 94:10925-10930. 59 Pouly S, Becher B, Blain M, Antel JP (2000) Interferon-gamma modulates human oligodendrocyte susceptibility to Fas- mediated apoptosis. J Neuropathol Exp Neurol 59:280-286. Prineas JW, Graham JS (1981) Multiple sclerosis: capping of surface immunoglobulin G on macrophages engaged in myelin breakdown. Ann Neurol 10:149-158. Raine CS (1994) The Dale E. McFarlin Memorial Lecture: the immunology of the multiple sclerosis lesion. Ann Neurol 36 Suppl:S61-72. Raine CS, Scheinberg LC (1988) On the immunopathology of plaque development and repair in multiple sclerosis. J Neuroimmunol 20:189-201. Raine CS, Mokhtarian F, McFarlin DE (1984) Adoptively transferred chronic relapsing experimental autoimmune encephalomyelitis in the mouse. Neuropathologic analysis. Lab Invest 51:534-546. Raju VS, Maines MD (1996) Renal ischemia/reperfusion up-regulates heme oxygenase-1 (HSP32) expression and increases cGMP in rat heart. J Pharmacol Exp Ther 277:1814-1822. Raju VS, Imai N, Liang CS (1999) Chamber-specific regulation of heme oxygenase-1 (heat shock protein 32) in right-sided congestive heart failure. J Mol Cell Cardiol 31:1581-1589. Rapp NS, Gilroy J, Lerner AM (1995) Role of bacterial infection in exacerbation of multiple sclerosis. Am J Phys Med Rehabil 74:415-418. Riedl AG, Watts PM, Brown CT, Jenner P (1999) P450 and heme oxygenase enzymes in the basal ganglia and their roles in Parkinson's disease. Adv Neurol 80:271-286. 60 Rivers TM, Sprunt DH, Berry GP (1933) Observations on attempts to produce acute disseminated encephalomyelitis in monkeys. J Exp Med 58:39-53. Rodrigues CM, Sola S, Castro RE, Laires PA, Brites D, Moura JJ (2002) Perturbation of membrane dynamics in nerve cells as an early event during bilirubin-induced apoptosis. J Lipid Res 43:885-894. Rodriguez M, Leibowitz JL, Lampert PW (1983) Persistent infection of oligodendrocytes in Theiler's virus-induced encephalomyelitis. Ann Neurol 13:426-433. Rodriguez M, Nickerson C, Patick AK, David CS (1991) Expression of human HLA-B27 transgene alters susceptibility to murine Theiler's virus-induced demyelination. J Immunol 146:2596-2602. Romanic AM, Graesser D, Baron JL, Visintin I, Janeway CA, Jr., Madri JA (1997) T cell adhesion to endothelial cells and extracellular matrix is modulated upon transendothelial cell migration. Lab Invest 76:11-23. Roos RP, Wollmann R (1984) DA strain of Theiler's murine encephalomyelitis virus induces demyelination in nude mice. Ann Neurol 15:494-499. Rosenthal A, Fujinami RS, Lampert PW (1986) Mechanism of Theiler's virus-induced demyelination in nude mice. Lab Invest 54:515-522. Ruuls SR, Bauer J, Sontrop K, Huitinga I, t Hart BA, Dijkstra CD (1995) Reactive oxygen species are involved in the pathogenesis of experimental allergic encephalomyelitis in Lewis rats. J Neurdimmunol 56:207-217. Ryter SW, Alam J, Choi AM (2006) Heme oxygenase-1/carbon monoxide: from basic science to therapeutic applications. Physiol Rev 86:583-650. 61 Sadovnick AD, Ebers GC (1993) Epidemiology of multiple sclerosis: a critical overview. Can J Neurol Sci 20:17-29. Sadovnick AD, Ebers GC, Dyment DA, Risch NJ (1996) Evidence for genetic basis of multiple sclerosis. The Canadian Collaborative Study Group. Lancet 347:1728-1730. Salim M, Brown-Kipphut BA, Maines MD (2001) Human biliverdin reductase is autophosphorylated, and phosphorylation is required for bilirubin formation. J Biol Chem 276:10929-10934. Sato H, Siow RC, Bartlett S, Taketani S, Ishii T, Bannai S, Mann GE (1997) Expression of stress proteins heme oxygenase-1 and -2 in acute pancreatitis and pancreatic islet betaTC3 and acinar AR42J cells. FEBS Lett 405:219-223. Selmaj K, Raine CS, Farooq M, Norton WT, Brosnan CF (1991) Cytokine cytotoxicity against oligodendrocytes. Apoptosis induced by lymphotoxin. J Immunol 147:1522-1529. Selmaj KW, Raine CS (1988) Tumor necrosis factor mediates myelin and oligodendrocyte damage in vitro. Ann Neurol 23:339-346. Shaulian E, Schreiber M, Piu F, Beeche M, Wagner EF, Karin M (2000) The mammalian UV response: c-Jun induction is required for exit from p53-imposed growth arrest. Cell 103:897-907. Shibahara S, Muller RM, Taguchi H (1987) Transcriptional control of rat heme oxygenase by heat shock. J Biol Chem 262:12889-12892. 62 Shibahara S, Yoshizawa M, Suzuki H, Takeda K, Meguro K, Endo K (1993) Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation. J Biochem (Tokyo) 113:214-218. Singleton JW, Laster L (1965) Biliverdin reductase of guinea pig liver. J Biol Chem 240:4780-4789. Smith KJ, Kapoor R, Felts PA (1999) Demyelination: the role of reactive oxygen and nitrogen species. Brain Pathol 9:69-92. Smith ME (2001) Phagocytic properties of microglia in vitro: implications for a role in multiple sclerosis and EAE. Microsc Res Tech 54:81-94. Snyder SH, Jaffrey SR, Zakhary R (1998) Nitric oxide and carbon monoxide: parallel roles as neural messengers. Brain Res Brain Res Rev 26:167-175. Sobel RA, Greer JM, Kuchroo VK (1994) Minireview: autoimmune responses to myelin proteolipid protein. Neurochem Res 19:915-921. Stangel M, Compston A (2001) Polyclonal immunoglobulins (IVIg) modulate nitric oxide production and microglial functions in vitro via Fc receptors. J Neuroimmunol 112:63-71. Steffen BJ, Butcher EC, Engelhardt B (1994) Evidence for involvement of ICAM-1 and VCAM-1 in lymphocyte interaction with endothelium in experimental autoimmune encephalomyelitis in the central nervous system in the SJL/J mouse. Am J Pathol 145:189-201. Steiner CM, Rozhon EJ, Lipton HL (1984) Relationship between host age and persistence of Theiler's virus in the central nervous system of mice. Infect Immun 43:432-434. 63 Steinman L (1996) A few autoreactive cells in an autoimmune infiltrate control a vast population of nonspecific cells: a tale of smart bombs and the infantry. Proc Natl Acad Sci U S A 93:2253-2256. Steinman L (1999) Assessment of animal models for MS and demyelinating disease in the design of rational therapy. Neuron 24:511-514. Steinman L, Zamvil SS (2006) How to successfully apply animal studies in experimental allergic encephalomyelitis to research on multiple sclerosis. Ann Neurol 60:12-21. Stevens CF, Wang Y (1993) Reversal of long-term potentiation by inhibitors of haem oxygenase. Nature 364:147-149. Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames BN (1987) Bilirubin is an antioxidant of possible physiological importance. Science 235:1043-1046. Storch MK, Piddlesden S, Haltia M, Iivanainen M, Morgan P, Lassmann H (1998) Multiple sclerosis: in situ evidence for antibody- and complement-mediated demyelination. Ann Neurol 43:465-471. Stuerzebecher S, Martin R (2000) Neuroimmunology of multiple sclerosis and experimental allergic encephalomyelitis. Neuroimaging Clin N Am 10:649-( 668,vii-viii. Sun D, Gold DP, Smith L, Brostoff S, Coleclough C (1992) Characterization of rat encephalitogenic T cells bearing non-V beta 8 T cell receptors. Eur J Immunol 22:591-594. 64 Suzumura A, Silberberg DH, Lisak RP (1986) The expression of MHC antigens on oligodendrocytes: induction of polymorphic H-2 expression by. lymphokines. J Neuroimmunol 11:179-190. Swanborg RH (1988) Experimental allergic encephalomyelitis. Methods Enzymol . 162:413-421. Swanborg RH (1995) Experimental autoimmune encephalomyelitis in rodents as a model for human demyelinating disease. Clin Immunol Immunopathol 77:4-13. Takizawa S, Hirabayashi H, Matsushima K, Tokuoka K, Shinohara Y (1998) Induction of heme oxygenase protein protects neurons in cortex and striatum, but not in hippocampus, against transient forebrain ischemia. J Cereb Blood Flow Metab 18:559-569. Temme EH, Zhang J, Schouten EG, Kesteloot H (2001) Serum bilirubin and 10-year mortality risk in a Belgian population. Cancer Causes Control 12:887-894. Tenhunen R, Marver HS, Schmid R (1968) The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase. Proc Natl Acad Sci U S A 61:748-755. Tenhunen R, Marver HS, Schmid R (1969) Microsomal heme oxygenase. Characterization of the enzyme. J Biol Chem 244:6388-6394. Tenhunen R, Ross ME, Marver HS, Schmid R (1970) Reduced nicotinamide-adenine dinucleotide phosphate dependent biliverdin reductase: partial purification and characterization. Biochemistry 9:298-303. Terry CM, Clikeman JA, Hoidal JR, Callahan KS (1998) Effect of tumor necrosis factor-alpha and interleukin-1 alpha on heme oxygenase-1 expression in human endothelial cells. Am J Physiol 274:H883-891. 65 Theiler M (1934) Spontaneous encephalomyelitis of mice: A new virus disease. Science 80:122-123. Theiler M (1937) Spontaneous encephalomyelitis of mice: A new virus disease. J Exp Med 65:705-710. Thong YH, Ferrante A, Ness D (1977) Neutrophil phagocytic and bactericidal dysfunction induced by bilirubin. Aust Paediatr J 13:287-289. Traugott U, McFarlin DE, Raine CS (1986) Immunopathology of the lesion in chronic i relapsing experimental autoimmune encephalomyelitis in the mouse. Cell Immunol 99:395-410. Trotter JL, Clark HB, Collins KG, Wegeschiede CL, Scarpellini JD (1987) Myelin proteolipid protein induces demyelinating disease in mice. J Neurol Sci 79:173-188. Tsuchida T, Parker KC, Turner RV, McFarland HF, Coligan JE, Biddison WE (1994) Autoreactive CD8+ T-cell responses to.human myelin protein-derived peptides. Proc Natl Acad Sci U S A 91:10859-10863. Tsunoda I, Iwasaki Y, Terunuma H, Sako K, Ohara Y (1996) A comparative study of acute and chronic diseases induced by two subgroups of Theiler's murine encephalomyelitis virus. Acta Neuropathol 91:595-602. van der Goes A, Brouwer J, Hoekstra K, Roos D, van den Berg TK, Dijkstra CD (1998) Reactive oxygen species are required for the phagocytosis of myelin by macrophages. J Neuroimmunol 92:67-75. 66 Villarroya H, Dalix AM, Paraut M, Oriol R (1990) Differential susceptibility to experimental allergic encephalomyelitis (EAE) in genetically defined A+ and A-rabbits. Autoimmunity 6:47-60. Vitek L, Jirsa M, Brodanova M, Kalab M, Marecek Z, Danzig V, Novotny L, Kotal P (2002) Gilbert syndrome and ischemic heart disease: a protective effect of elevated bilirubin levels. Atherosclerosis 160:449-456. Vladimirova O, O'Connor J, Cahill A, Alder H, Butunoi C, Kalman B (1998) Oxidative damage to DNA in plaques of MS brains. Mult Scler 4:413-418. Waksman BH, Reynolds WE (1984) Multiple sclerosis as a disease of immune regulation. Proc Soc Exp Biol Med 175:282-294. Warren KG, Catz I (1992) Purification of primary antibodies of the myelin basic protein antibody cascade from multiple sclerosis patients. Immunoreactivity studies with homologous and heterologous antigens. Clin Invest Med 15:18-29. Warren KG, Catz I, Steinman L (1995) Fine specificity of the antibody response to myelin basic protein in the central nervous system in multiple sclerosis: the minimal B-cell epitope and a model of its features. Proc Natl Acad Sci U S A 92:11061-11065. Warren S, Warren KG, World Health Organization. (2001) Multiple sclerosis. Geneva: World Health Organization. Washington R, Burton J, Todd RF, 3rd, Newman W, Dragovic L, Dore-Duffy P (1994) Expression of immunologically relevant endothelial cell activation antigens on isolated central nervous system microvessels from patients with multiple sclerosis. Ann Neurol 3 5:89-97. 67 Waxman SG (2006) Axonal conduction and injury in multiple sclerosis: the role of sodium channels. Nat Rev Neurosci 7:932-941. Weiss G, Werner-Felmayer G, Werner ER, Grunewald K, Wachter H, Hentze MW (1994) Iron regulates nitric oxide synthase activity by controlling nuclear transcription. J Exp Med 180:969-976. Welsh J, Sapatino B, Rosenbaum B, Smith R, Linthicum S (1993) Correlation between susceptibility to demyelination and interferon- gamma induction of major histocompatibility complex class II antigens on murine cerebrovascular endothelial cells. J Neuroimmunol 48:91-97. Willis D, Moore AR, Frederick R, Willoughby DA (1996) Heme oxygenase: a novel target for the modulation of the inflammatory response. Nat Med 2:87-90. With TK (1968) Bile pigments; chemical, biological, and clinical aspects. New York.: Academic Press. Wucherpfennig KW, Catz I, Hausmann S, Strominger JL, Steinman L, Warren KG (1997) Recognition of the immunodominant myelin basic protein peptide by autoantibodies and HLA-DR2-restricted T cell clones from multiple sclerosis patients. Identity of key contact residues in the B-cell and T-cell epitopes. J Clin Invest 100:1114-1122. Yachie A, Niida Y, Wada T, Igarashi N, Kaneda H, Toma T, Ohta K, Kasahara Y, Koizumi S (1999) Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. J Clin Invest 103:129-135. Yong VW, Krekoski CA, Forsyth PA, Bell R, Edwards DR (1998) Matrix metalloproteinases and diseases of the CNS. Trends Neurosci 21:75-80. 68 Yoo MS, Chun HS, Son JJ, DeGiorgio LA, Kim DJ, Peng C, Son JH (2003) Oxidative stress regulated genes in nigral dopaminergic neuronal cells: correlation with the known pathology in Parkinson's disease. Brain Res Mol Brain Res 110:76-84. Young RA (1990) Stress proteins and immunology. Annu Rev Immunol 8:401-420. Yu CY, Whitacre CC (2004) Sex, MHC and complement C4 in autoimmune diseases. Trends Immunol 25:694-699. Zajicek JP, Wing M, Scolding NJ, Compston DA (1992) Interactions between oligodendrocytes and microglia. A major role for complement and tumour necrosis factor in oligodendrocyte adherence and killing. Brain 115:1611-1631. Zakhary R, Gaine SP, Dinerman JL, Ruat M, Flavahan NA, Snyder SH (1996) Heme oxygenase 2: endothelial and neuronal localization and role in endothelium-dependent relaxation. Proc Natl Acad Sci U S A 93:795-798. Zakhary R, Poss KD, Jaffrey SR, Ferris CD, Tonegawa S, Snyder SH (1997) Targeted gene deletion of heme oxygenase 2 reveals neural role for carbon monoxide. Proc Natl Acad Sci U S A 94:14848-14853. Zhao W, Tilton RG, Corbett JA, McDaniel ML, Misko TP, Williamson JR, Cross AH, Hickey WF (1996) Experimental allergic encephalomyelitis in the rat is inhibited by aminoguanidine, an inhibitor of nitric oxide synthase. J Neuroimmunol 64:123-133. Zhuo M, Laitinen JT, Li XC, Hawkins RD (1998) On the respective roles of nitric oxide and carbon monoxide in long- term potentiation in the hippocampus. Learn Mem 5:467-480. 69 CHAPTER 2: BILIRUBIN AS A POTENT ANTIOXIDANT SUPPRESSES EXPERIMENTAL AUTOIMMUNE ENCEPHALOMYELITIS: IMPLICATIONS FOR THE ROLE OF OXIDATIVE STRESS IN THE DEVELOPMENT OF MULTIPLE SCLEROSIS1 1 A version of this chapter has been published. Liu Y, Zhu B, Wang X, Luo L, Li P, Paty DW, Cynader MS. (2003) Bilirubin as a potent antioxidant suppresses experimental autoimmune encephalomyelitis: implications for the role of oxidative stress in the development of multiple sclerosis. J Neuroimmunol. 139(1-2):27-35. 70 2.1. I N T R O D U C T I O N M S is believed to be a T cell-mediated autoimmune inflammatory disease o f the central nervous system ( C N S ) (Raine, 1994). Despite the progress in recent years, a therapy that halts the disease is not yet available. E A E shares simi lar neuropathology and immunologic dysfunctions with M S , and serves as an animal model o f this disease. The pathology o f E A E is characterized by the loss o f blood-brain barrier ( B B B ) integrity, C D 4 + T cel l and macrophage infdtration o f C N S , and demyelination with various degrees o f axonal damage (Mart in and McFar land , 1995; Ferguson et a l . , 1997). The pathogenic T cells initiate a cascade o f proinflammatory cytokines, wh ich activate microgl ia, recruit additional inflammatory cells including macrophages, and lead to the disease (Raine, 1994; Mart in and McFar land , 1995). Al though it is becoming increasingly clear that C D 4 + T cells play a central role in the induction o f E A E , the exact sequence o f events as wel l as the molecular mediators o f myel in destruction is not completely understood. Increasing evidence shows that oxidative stress plays an important role in the pathogenesis o f M S / E A E , and that it contributes directly to C N S damage (Benveniste, 1997). It has been shown that C N S cells, notably oligodendrocytes and neurons, are highly vulnerable to oxidative damage (Smith et al . , 1999; Hol lensworth et a l . , 2000). Free radicals are produced massively both in M S and E A E (Smith et a l . , 1999). Their consequence, the oxidative damage to membrane l ipids, proteins and D N A o f cells has been demonstrated in M S and E A E lesions (Toshniwal and Zar l ing, 1992; V lad imi rova et al. , 1998; L u et a l . , 2000). It has also been indicated that free radicals are required for the phagocytosis o f myel in by macrophages (van der Goes et a l . , 1998), wh ich represents the 71 final pathway for myelin removal and degradation. Recently, we demonstrated that heme oxygenase-1, a potent endogenous antioxidant enzyme, was induced and played an important protective role in EAE (Liu et al., 2001) (Fig. 2.1). Although the targeted induction of heme oxygenase-1 overexpression by hemin was only partially effective in the treatment of this disease, the inhibition of this enzyme by tin mesoporphyrin was fatal to all the treated rats. This result suggested that oxidative stress plays an important role in the development of EAE, and that antioxidant treatment might prove to be an effective therapy for EAE. Days after immunization Fig. 2.1. Effects of hemin, and inducer of HO-1, and tin mesoporphyrin (SnMP), an inhibitor of HO-1, on EAE in Lewis rats. In recent years, bilirubin has been demonstrated to be a powerful antioxidant substance in vitro. Bilirubin and its serum albumin complex are superoxide scavengers and peroxyl radical-trapping antioxidants (Marilena, 1997). Bilirubin suppresses oxidation more strongly than many other antioxidants, including a-tocopherol (Vitamin E), SOD, and catalase, especially under pathological conditions (Stocker et al., 1987; Wu 72 et al., 1991). However, when I started this study in 2000, it had never been used for treatment in vivo. In this study, we demonstrate that bilirubin significantly reduces the clinical signs of E A E when administered both before and after the onset of the disease. Furthermore, we show that free radicals play an important role in the etiology of E A E , and may represent the final effectors of demyelination. 2.2. MATERIALS AND METHODS 2.2.1. Induction of acute and chronic E A E Male Lewis rats with body weights between 175 and 200 g and female D A rats with body weights between 150 and 175 g were purchased from Charles River Laboratories (Laval, Canada). A l l studies were approved by the Animal Care Committee of the University of British Columbia. Acute E A E was induced in Lewis rats by a single subcutaneous injection in the abdomen with 50 ug guinea pig myelin basic protein (MBP) (Sigma, Saint Louis, M O ) emulsified in 100 ul complete Freund's adjuvant (Sigma) containing 10 mg/ml heat-inactivated Mycobacterium tuberculosis H37Ra (Difco, Detroit, MI). Chronic E A E was elicited in D A rats using a similar method except that the rats were immunized with 50 mg homogenized Guinea Pig (Charles River Laboratories) spinal cord emulsified in the same complete Freund's adjuvant containing Mycobacterium tuberculosis H37Ra. The immunization protocols resulted in E A E induction in 100% of the rats. The rats were monitored daily after immunization. Clinical E A E was scored in a double-blind fashion as: 0, normal; 1, tail limpness; 2, hind limb paraparesis with clumsy gait; 3, hind limb paralysis; 4, tetraplegia; 5, moribund. 73 2.2.2. Treatment Regimen In both acute and chronic EAE paradigms, rats were divided into seven groups; fifteen rats were included per treatment group. In acute EAE, one group served as vehicle-treated control, four groups were treated with 5 mg/lOOg, 10 mg/lOOg and 20 mg/lOOg bilirubin (Biochem, La Jolla, CA) or with 4 mg/kg dexamethasone (Sigma), respectively once daily for 9 days starting from 7 days after immunization (DAI) (before the onset of EAE). In chronic EAE, rats were treated with the same regime but for 17 days starting from 7 DAI. In both paradigms, two additional groups were treated with 20 mg/lOOg bilirubin or with 4 mg/kg dexamethasone, respectively once daily for 5 days starting from the onset of symptoms. In addition, six untreated rats were included in each paradigm to exclude the possibility that vehicle treatment may influence the course of disease. Bilirubin was dissolved in 0.1 N NaOH and adjusted to pH 7.4 with 1 N HCI before use, and administered by i.p. injection. Water-soluble dexamethasone was dissolved in saline and administered by s.c. injection. Control rats received injections with the same volume of saline on the same schedule. In each group, eight rats chosen randomly were followed for the full clinical course investigation, and the remaining 7 rats were sacrificed at peak of their illness for histopathological and immunohistochemical studies. Bilirubin or dexamethasone-treated rats with attenuated clinical EAE were sacrificed at the same time point. 74 2 .2 .3 . T i s s u e p r e p a r a t i o n a n d h i s t o p a t h o l o g i c a l s t u d i e s Rats were euthanized and perfused transcardially with 4% paraformaldehyde in 0.1 M PBS. The lumbosacral spinal cords were immediately removed, embedded in Tissue-Tek and frozen with 2-methylbutane at -80C. Serial sections were cut at 10 um on a Reichert-Jung 2800 Frigocut cryostat. The sections were stained with hematoxylin-eosin for histopathological examination. The severity of inflammation in the spinal cord sections was graded in a double-blind fashion as follows: 0, no inflammation; 1, mild meningeal inflammation and/or rare parenchymal infdtration; 2, moderate meningitis, sub-meningeal infiltration and small scattered perivascular infiltration; 3, severe meningitis, parenchymal infiltration and/or multiple perivascular infdtration; 4, foci of necrosis and/or neutrophilic infdtration. 2.2.4. I m m u n o h i s t o c h e m i s t r y The slides were air-dried and then immersed in acetone for 10 minutes. After two 5 minutes washes in 0.1 M PBS, the sections were immersed in 0.6% H2O2 for 10 minutes to block endogenous peroxidase, and then incubated in 5% normal serum for 30 minutes. Then the sections were incubated overnight at 4 C with the following antibodies: goat anti-8-isoprostane (Oxford Biomedical Research, Oxford, MI) at 1:400 dilution; rabbit anti-tumor necrosis factor-a (anti-TNF-a) (Santa Cruz Biotechnology, Santa Cruz, CA) at 1:200; goat anti-interferon-y (anti-IFN-y) (Santa Cruz Biotechnology) at 1:150; goat anti-interleukin-10 (anti-IL-10) (Santa Cruz Biotechnology) at 1:150; and antibodies against macrophage differentiation antigen EDI (Accurate, Westbury, NY), T cell differentiation antigen W3/W13 (Accurate) for analyses of inflammatory cell composition in lesions. 75 After three washes in PBS on the next day, the sections were incubated with secondary antibodies for 1 hour, followed by exposure to the avidin-biotin complex (Vector, Burlingame, CA). The bound antibodies were visualized with 3,3'-diaminobenzidine (Sigma) and H2O2. 2.2.5. Assessment of the effect of bilirubin on the BBB permeability BBB permeability was assessed by measuring Na-fluorescein uptake into the spinal cord using a method modified from Trout et al (1986). Five DA rats were analyzed in each of 5 groups, including the normal, EAE, EAE with bilirubin treatment at a dose of 20 mg/lOOg once daily for 1, 2, and 4 days, respectively starting from the onset of clinical signs. Under anesthesia, rats received 0.5 ml of 10% Na-fluorescein (Pfaltz and Bauer, Waterbury, CT) in PBS intravenously. After 20 minutes to allow for circulation of the Na-fluorescein, approximately 2 ml of blood was collected from the heart and the animals were perfused transcardially with 0.1 M PBS. Spinal cord tissue was removed and homogenized in 3 ml of cold 7.5% trichloroacetic acid and centrifuged at 10,000 g for 10 minutes to remove insoluble precipitates. After addition of 0.5 ml of 5 N NaOH, the supernatants were analyzed for fluorescence at an excitation wavelength of 485 nm and an emission wavelength of 530 nm in a Cytofluor Fluorimeter. Freshly prepared standards were used to calculate the Na-fluorescein content of the samples in u.g. Serum levels of Na-fluorescein were similarly determined. Na-fluorescence uptake into spinal cord tissue is expressed as (ug of fluorescein/mg protein)/(ug of fluorescein/ul blood) to normalize values for blood levels of the dye at the time of tissue collection. 76 2.2.6. Primary culture of oligodendrocytes Primary cultures of oligodendrocytes were prepared using the procedures described by DeVellis and Cole (1992). In brief, cerebral hemispheres were harvested from 2-day-old newborn Long-Evans rats (Charles River Laboratories), and the meninges were completely removed. The tissue was then minced quickly and disaggregated with 0.25% trypsin (Sigma) and 0.1 mg/ml DNase (Sigma) for 10 minutes. Then 1 ml of ice-cold fetal bovine serum (FBS) (Sigma) was added to inactivate the trypsin activity. The cell suspension was centrifuged, and resuspended in Minimum Essential Medium (MEM) (Sigma) supplemented with 10% FBS and 2mM L-glutamine (Sigma). After two washes with fresh medium, the cells were plated into poly-L-lysine (Sigma) precoated 75 cm2 plastic flasks at a high density of 2 x 105 cells/cm2. The cultures were incubated at 37°C in a humidified atmosphere of 5% C O 2 and 95% air. The medium was changed twice a week. The cells were then cultured for 7-9 days to confluence. At the end of the culture period, the flasks were tightly sealed and shaken at 200 rpm at 37°C for 6 hours. The supernatant was discarded, and fresh medium added. Then the flasks were shaken for an additional 18 hours to release the oligodendrocyte progenitors into the medium. The medium was filtered through a cell strainer with 40 um size pores. Progenitors were collected by centrifugation at 2000 rpm for 3 minutes. The cells were resuspended with fresh medium, and 5 x 10s cells in a volume of 0.5 ml were plated into each well in 35 mm culture dishes. As determined by immunostaining with antigalactocerebroside antibody, more than 95% of cells isolated by this replating procedure were oligodendrocytes (data not shown). Cultures were allowed to mature for at least 7 days before being used for experiments. The medium was changed twice a week. 77 2.2.7. In vitro assessment of the cytoprotective action of bilirubin against oxidative stress in primary oligodendrocyte cultures The protective action of bilirubin against oxidative stress was compared with that of another powerful antioxidant, a-tocopherol (Sigma). Oligodendrocyte cultures, 7 days after the replating process, were used for experiments. Bilirubin and a-tocopherol were freshly dissolved in 0.1 N NaOH and 100% ethanol respectively, and diluted with MEM containing 20% FBS to different concentrations (50 nM, 20 uM and 0.1 mM). The cultures were pretreated with the antioxidants for 2 hours and exposed to 75 u.M H2O2 for 30 minutes and then washed. The cultures were then maintained in fresh medium for an additional 6 hours period in the presence of the active antioxidants. Cell viability was measured using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) colorimetric assay. All experiments were repeated with at least three separate batches of cultures. 2.2.8. Statistical analysis All data are expressed as mean ± s.e.m. Data on the effect of bilirubin and dexamethasone treatments were analyzed using two-way ANOVA, and data on cell culture experiments were analyzed using one-way ANOVA with Fisher's PLSD post hoc tests for multiple comparisons in each case. Data on the effect of bilirubin treatment on the BBB permeability in EAE were analyzed using one-tailed Mann-Whitney test, p < 0.05 was considered statistically significant. 78 2.3. RESULTS 2.3.1. Effect of bilirubin treatment on E A E In each group, eight rats chosen randomly were followed for the full clinical course until 45 DAI. The immunization protocols resulted in EAE induction in all animals. In both acute and chronic EAE models, vehicle treatments showed no influence on the course or severity of disease. In the acute EAE model, all control Lewis rats developed monophasic EAE at 10-11 DAI. The severity of symptoms peaked at around 13 DAI. The rats then recovered completely without treatment by 17-18 DAI (Fig. 2.2. A). In chronic EAE model, the onset of the first attack of EAE was slightly earlier than in the acute EAE model, and all DA rats showed relapse of clinical signs at around 20 DAL The course of the chronic EAE lasted about two weeks (Fig. 2.2. B). All control rats suffered complete hind limb paralysis at the peak of disease. By contrast, as shown in Fig. 2.2. A and B respectively, bilirubin suppressed both acute and chronic EAE significantly (F(3,504) = 231.16,/? < 0.001; F(3,756) ='603.85,/? < 0.001, respectively). Analysis of treatment with different doses of bilirubin beginning on 7 DAI showed that as little as one dose of 5 mg/lOOg per day of bilirubin could delay the onset of EAE (p < 0.001 for both acute and chronic EAE). A daily dose of 10 mg/lOOg of bilirubin significantly ameliorated the clinical signs (p < 0.001 for both acute and chronic EAE). Furthermore, bilirubin treatment with daily doses of 20 mg/lOOg completely prevented acute EAE (p < 0.001). In chronic EAE, only 3 out of 8 DA rats receiving the high dose bilirubin treatment showed 2 degree clinical signs of EAE with much shorter duration of illness than controls 79 - o - Control (n=8) Days after immunization Fig. 2.2. Effects of bilirubin vs. dexamethasone (dex) treatments in the prevention of clinical E A E . (A) Effects on acute EAE. (B) Effects on chronic EAE. In acute EAE, four groups of Lewis rats were treated with 5 mg/lOOg, 10 mg/lOOg and 20 mg/lOOg bilirubin or with 4 mg/kg dexamethasone respectively once daily by i.p. or s.c. injections from day 7 through 15 after immunization (arrows). In chronic EAE, DA rats were treated with the same regime but from 7 until 23 days after immunization (arrows). In both cases, control rats received vehicle injections of equal volume on the same schedules. Clinical scores are presented as the mean ± s.e.m. Data on the effects of bilirubin and dexamethasone treatments were analyzed using two-way ANOVA followed by Fisher's PLSD post hoc tests. 80 (p < 0.001). The therapeutic effect of bilirubin was long-lasting after treatment ceased (Fig. 2.2. A, B). We next attempted to treat animals already exhibiting clinical signs of EAE to determine whether bilirubin could prevent disease progression. Treatment was started within 6 hours of the onset of symptoms and continued for 5 days (Fig. 2.3). The results clearly show that bilirubin at a dose of 20mg/100g once daily halted both acute and chronic EAE progression efficaciously and maintained the EAE disease severity at 1 degree in all treated rats (F(l,252) = 332.51,p < 0.001, Fig. 2.3. A; F(l,378) = 974.31,/? < 0.001, Fig. 2.3. B, respectively). The treated rats then recovered completely within 3-4 days. The effect of treatment in this case was also long-lasting. Moreover, five days of bilirubin treatment begun at onset of disease prevented the relapse of chronic EAE in 4 of 8 treated DA rats (Fig. 2.3. B). The therapeutic effect of bilirubin in EAE was observed without notable side effects. We then compared the effect of bilirubin treatment on EAE with steroid treatment, which is the most commonly used therapy for MS in the clinic (Paty and Ebers, 1998). Similar to its effect on MS, dexamethasone treatment before and after onset of disease was very effective in reversing the acute symptoms of EAE (F(l,252) = 8.09,/? < 0.01, Fig. 2.2. A; F(l,378) = 274.06,/? < 0.001, Fig. 2.2. B; F(l,252) = 141.99,/? < 0.001, Fig. 2.3. A; F(l,378) = 8.86,/? < 0.01, Fig. 2.3. B). However, it did not improve the long-term course of disease. In comparison to bilirubin, the therapeutic effect of dexamethasone was not long-lasting. Four to six days after the treatment ceased, all treated rats developed severe EAE (Fig. 2.2 and 2.3). One dexamethasone-treated Lewis rat and 2 81 A Days after immunization B 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 Days after immunization Fig. 2.3. Effects of bilirubin vs. dexamethasone (dex) treatments on clinical signs of ongoing E A E . (A) Effects on acute EAE. (B) Effects on chronic EAE. Treatments were started within 6 hours of the onset of symptoms with 20 mg/lOOg bilirubin or 4 mg/kg dexamethasone once daily and continued for 5 days (arrows). Control rats received vehicle treatments on the same schedules. Clinical scores are presented as the mean ± s.e.m. Data on the effects of bilirubin and dexamethasone treatments were analyzed using two-way ANOVA followed by Fisher's PLSD post hoc tests. 82 DA rats in our study developed progressive EAE without remission of clinical signs until the end of experiments. 2.3.2. Histopathological and immunohistological findings To assess whether bilirubin improved the disability in EAE because of its anti-inflammatory or immunosuppressive activities, we examined inflammatory infiltration and expression of cytokines in EAE lesions in all groups. Rats were sacrificed for histological studies at the time when control rats reached the peak of illness (1-2 days after the onset of EAE). It is well known that dexamethasone is a strong immunosuppressive agent that modulates cell activation, inhibits the access of leukocytes to the site of inflammation, and induces apoptosis of lymphoid cells (Fauci, 1978). Therefore, as expected, in all dexamethasone-treated rats, there was no obvious inflammation in the spinal cords. Even after the development of EAE, a single subcutaneous injection of dexamethasone could markedly reduce the degree of infiltrates in lesions within 24 hours (Fig. 2.4. C). In the rats receiving bilirubin treatment with daily doses of 20 mg/lOOg from before the onset of EAE, few or mild cellular lesions were observed. The Lewis and DA rats in these groups had lower average grades of CNS inflammation (1.2 ± 0.4, n = 7; 1.3 ± 0.5, n = 7, respectively) compared with the control rats (2.7 ± 0.3, n = 7; 3.0 ± 0.2, n = 7, respectively) (p < 0.001). However, surprisingly, in one case, obvious inflammation similar to controls occurred even when no clinical illness was noted. In contrast, all Lewis and DA rats receiving bilirubin treatment beginning at the onset of disease had similar extensive inflammation in their spinal cords (2.5 ± 0.3, n = 7; 2.8 ± 0.2, n = 7, 83 Fig. 2.4. Effects of bilirubin vs. dexamethasone (dex) treatment on inflammation, cytokine production and oxidative damage in spinal cord lesions in ongoing E A E . Rats were treated with 20 mg/lOOg bilirubin or with 4 mg/kg dexamethasone once daily starting from the onset of symptoms. One to two days later, rats were euthanized for histological studies at the time when control rats reached the peak of clinical EAE. Normal rats were euthanized at the same time point. Spinal cord sections from normal (A, E, 1, M, Q), vehicle-treated (B, F, J, N, R, clinical grade 3), dexamethasone-treated (C, G, K, O, S, clinical grade 1) and bilirubin-treated rats (D, H, L, P, T, clinical grade 1) were examined for inflammation (A-D) (Scale bar = 100 um), TNF-a expression (E-H) (Scale bar = 50 jun), IFN-y (I-L) (Scale bar = 50 um), IL-10 (M-P) (Scale bar = 50 um) and oxidative damage in lesions (Q-T) (Scale bar = 50 um), respectively. Inflammatory infiltrates were examined by hematoxylin-eosin staining. The cytokine expression was detected by immunohistochemical studies using anti-TNF-a, anti-IFN-y and anti-IL-10 antibody, respectively. The oxidative status of spinal cords was also detected by immunohistochemical studies using an antibody against 8-isoprostane, an important product of lipid peroxidation. 84 Normal E A E EAE/Dex EAE/Bilirubin " JPJBS •.-'••Vi fe-:rv '. iv • •' E F - > : ' « * * . » ' G . ' " ^  > Y _^«, ~ El* 1 K J : — r - • -M N 0 p Q S T 85 respectively) as did control rats although their clinical symptoms were much less pronounced (Fig. 2.4. D vs. control B). Subsequent immunohistochemical studies showed that the populations of T cells and macrophages in the lesions in these groups were the same as in control groups. Moreover, the infiltrating inflammatory cells produced normal levels of TNF-a (Fig. 2.4. H) and IFN-y (Fig. 2.4. L) as did controls (Fig. 2.4. F and J, respectively), showing that they were in an activated state. One important anti-inflammatory cytokine, IL-10, was also examined by immunohistochemical studies for expression within the CNS. The results showed that bilirubin treatment did not enhance the expression of IL-10 (Fig. 2.4. P vs. control N). Our results clearly indicate that, unlike dexamethasone, the beneficial clinical effects of bilirubin, especially when administered after the onset of EAE/cannot be contributed to anti-inflammatory or immunosuppressive actions. 2.3.3. Effect of bilirubin treatment on the BBB permeability changes in E A E The significant amelioration of inflammatory signs in the spinal cords of rats with treatment beginning before the onset of EAE suggests that bilirubin may interfere with the invasion of inflammatory cells into CNS. Since oxidative stress plays an important role in the pathogenesis of disruption of the BBB in EAE (Guy et al., 1994; Merrill and Murphy, 1997), we speculated that this finding was, at least, partially because bilirubin protected the BBB from free radical-induced permeability changes. Our results demonstrate that this is indeed the case. As shown in Fig. 2.5, the disruption of the BBB occurs during active EAE. The uptake of Na-fluorescein into the spinal cord was 86 Fig. 2.5. Effect of bilirubin treatment on BBB permeability changes in EAE. The BBB permeability was assessed by measuring Na-fluorescein uptake into spinal cord tissues of examined rats. Na-fluorescein uptake is expressed as (ug of fluorescein/mg protein)/(ug of fluorescein/ul blood). Five DA rats were analyzed in each of 5 groups, including the normal (open bar), EAE (black bar, clinical grade 3 at analysis), EAE with bilirubin treatment at a dose of 20 mg/lOOg once daily for 1 day (hatched bar, clinical grade 1 at analysis), 2 days (reversely hatched bar, clinical grade 1 at analysis), and for 4 days from the onset of disease (gray bar, clinical grade 0 at analysis). Data are means ± s.e.m. Statistical comparison was made using one-tailed Mann-Whitney test. # P<0.01 vs. normal; * PO.01 vs. control EAE group. significantly higher in rats with EAE compared with normal rats (p < 0.01). Four days of bilirubin treatment after the onset of symptoms suppressed the BBB leakage. The uptake of Na-fluorescein into the spinal cord was significantly lower in this group compared with the untreated group with EAE (p < 0.01). However, one to two days of bilirubin treatment after onset of symptoms did not suppress the BBB disruption significantly, although the uptake of Na-fluorescein into the spinal cord in these groups was slightly lower than in the control group with EAE (Fig. 2.5). 2.3.4. Evidence of antioxidant activity of bilirubin in E A E Lipid peroxidation is one of the best established endogenous indicators of reactive oxygen species (ROS) action in vivo. In recent years, one product of lipid peroxidation, 8-isoprostane, has been considered a sensitive and reliable marker of oxidative stress (Morrow et al., 1990). In this study, we detected the free radical damage in EAE by determining the level and the localization of 8-isoprostane in spinal lesions. Immunohistochemical studies demonstrated that 8-isoprostane reactivity was absent in the spinal cords of normal Lewis and DA rats (Fig. 2.4. Q). By contrast, both acute and chronic EAE induced intense immunostaining for 8-isoprostane in the spinal cord plaques (Fig. 2.4. R). Most of the staining was observed in the white matter of spinal cords. In rats treated with bilirubin after the onset of EAE, there was little 8-isoprostane staining in the lesions although the inflammatory infiltrates were extensive with normal production of TNF-a and IFN-y (Fig. 2.4. T). These results further indicate that bilirubin acts mainly as an antioxidant in the treatment of EAE, when administered after the onset of disease. 88 2.3.5. Cytoprotective action of bilirubin against oxidative stress in vitro To confirm the strong antioxidant activities of bilirubin, we compared the action of bilirubin against oxidative stress with another antioxidant, a-tocopherol, which is regarded as a potent antioxidant defender against lipid peroxidation (Stocker et al., 1987). The two agents were tested at three concentrations: 50 nM, 20 uM and 0.1 mM. As shown in Fig. 2. 6, without protection, oligodendrocytes were extremely sensitive to oxidative injury. Seventy-five uM H2O2 killed more than 90% of oligodendrocytes within 30 minutes. Both bilirubin and a-tocopherol protected oligodendrocytes from H2O2-induced toxicity to a significant degree (F(3,l 16) = 102.37,p < 0.001; F(3,l 16) = 121.43, p < 0.001, respectively). The two antioxidants were similarly protective and achieved their maximal effects respectively at 20 uM. Interestingly, bilirubin at much lower concentration (50 nM) almost reached its maximal activity, while a-tocopherol at the same concentration showed no cell protection. However, the cytoprotective effect of bilirubin diminished at higher concentration (0.1 mM) presumably because higher levels of bilirubin are themselves cytotoxic. This is suggested by the diminished oligodendrocyte survival of control cultures treated with 0.1 mM bilirubin for 6 hours (p < 0.001, Fig. 2. 6). 2.4. DISCUSSION Our results show that bilirubin is very effective in the treatment of EAE, especially in halting further signs of ongoing disease. The therapeutic effect of bilirubin treatment is 89 Fig. 2.6. Protective effects of bilirubin vs. a-tocopherol on HiCh-induced toxicity on primary cultures of oligodendrocytes. Cells were incubated with 75 uM H2O2 for 30 minutes in the presence of increasing concentrations of bilirubin or a-tocopherol and then maintained in fresh medium for an additional 6 hours period in the presence of the active antioxidants. Control cultures were not treated with H202. Cell viability was measured using the MTT assay. For analyses of the effect of bilirubin alone on the oligodendrocytes, cells were incubated with increasing concentrations of bilirubin for 6 hours and then measured for viability. Experiments were repeated with at least three separate batches of cultures. Data are means ± s.e.m. expressed as percentages of control values. Statistical comparison was made using one-way ANOVA followed by Fisher's PLSD post hoc tests. # PO.01 vs. control; * P<0.01 vs. H2O2 group without treatment. long-lasting, and it improves the long-term course of EAE much more successfully than dexamethasone treatment, which is the most commonly used therapy for MS in the clinic. The inhibition of oxidative damage formation but not of inflammatory infdtrates or of cytokine expression in spinal cord lesions during ongoing EAE implies that bilirubin does not function by modulating immune responsiveness, and acts mainly as an antioxidant in treatment of EAE at this therapeutic regime. On the other hand, the diminution of inflammation in rats that began receiving treatment prior to the onset of clinical signs suggests that bilirubin interferes with the invasion of inflammatory cells into CNS tissue because it protects the BBB from ROS-induced permeability changes. However, in some cases, diminished or severe inflammation in the lesions still occurred, which suggests that other pathological factors also contribute to the BBB disruption in EAE (Merrill and Murphy, 1997). Based on our findings, we consider that bilirubin acts at two levels in the treatment of EAE: 1) If administered before the onset of clinical EAE, bilirubin protects the integrity of the BBB from ROS-induced permeability changes such that cell invasion and the resulting pathology is minimized. 2) If administered after the onset of disease, bilirubin penetrates the already compromised BBB, scavenges the ROS that are directly responsible for CNS tissue damage, and promotes recovery of the animals. That bilirubin interferes with the development of EAE at two levels, especially at the effector phase of the disease, may account for its strong long-term therapeutic effect. Bilirubin is regarded today as a potent antioxidant substance in vitro and may also be a very effective physiological antioxidant in vivo (Marilena, 1997). Bilirubin has shown higher superoxide scavenging activities than many other antioxidants (Stocker et al., 1987; Wu et al., 1991). In our studies, bilirubin was found to suppress oxidation more 91 efficiently than another powerful antioxidant, a-tocopherol, especially at low concentrations. Considering that only very low quantities of the drug could be delivered to the lesion sites in the spinal cords, we think this may be the reason that bilirubin was much more effective in treatment of EAE in our studies than other previously studied antioxidants, including a-tocopherol, SOD, and catalase (Kryzhanovskii et al., 1984; Ruuls et al., 1995). Recent observations suggest that bilirubin at low concentrations exerts its potent cytoprotective effects by redox cycling (Baranano and Snyder, 2001). Bilirubin that acts as an antioxidant is thereby itself oxidized to biliverdin, which is also an active antioxidant (Elbirt and Bonkovsky, 1999). The high tissue levels of biliverdin reductase then reduce the biliverdin back to bilirubin. Snyder and Baranano (2001) have been able to demonstrate this process utilizing mixtures of the key chemicals and enzymes. Although it is thought that the action of bilirubin is mainly related to its antioxidant effects, it should be noted that bilirubin also possesses some other activities. For example, it has been shown that bilirubin inhibits complement cascade reactions, and protects cells from complement-mediated injury in vitro (Arriaga et al., 1999). It has also been shown that bilirubin may alter the function of various cells of the immune system (Vetvicka et al., 1985). We cannot exclude the possibility that these activities of bilirubin may also be involved in its suppression of EAE, especially when administered before the onset of clinical signs. Further studies are in progress. The factors involved in the formation of plaques in EAE and MS still remain undefined. Our studies suggest that ROS play an important role in this process. One interesting observation is that all rats receiving bilirubin treatment after the onset of EAE showed similar extensive inflammation in lesions as did controls although the clinical 92 signs were significantly ameliorated. Moreover, the infiltrated inflammatory cells were in an activated state. In contrast, the clinical signs of EAE were well correlated with the severity of oxidative injury in the spinal cords, indicating the importance of oxidative stress as a direct pathogenetic factor leading to this disease. Our results are consistent with some previous findings in this area. In recent years, although the importance of T cells and cytokines as central players in the initiation of EAE has been extensively documented, increasing evidence suggests that free radicals may play an essential role in the final effector pathway of EAE. First, it has been shown that CNS cells, notably oligodendrocytes and neurons, are extremely sensitive to oxidative damage due to many risk factors, including their active oxidative metabolism, a high iron content, and relatively low levels of antioxidant defenses (Smith et al., 1999; Hollensworth et al., 2000). Second, there is convincing evidence to show that free radical production is a prominent feature of EAE and MS (Smith et al., 1999). In the center and at the edges of active EAE lesions, the presence of both ROS and reactive nitrogen species (RNS) has been clearly documented, implicating a role for these volatile oxidants in lesion formation (Guy et al., 1993; Ruuls et al., 1995). Similarly, Hooper et al. (1997) demonstrated that monocytes expressing inducible nitric oxide synthase were concentrated in regions immediately surrounding the plaque areas of post mortem brain tissue from patients with MS. Their data suggest that activated macrophages cause these lesions through the production of peroxynitrate, a potent toxic intermediate formed by the combination of nitric oxide and superoxide. Free radicals can damage the lipids, proteins and nucleic acids of cells and mitochondria, potentially causing cell death (Gate et al., 1999). Recently, Lu et al. (2000) demonstrated that oxidative damage to mitochondrial 93 macromolecules including the respiratory chain enzymes, may interfere with the energy metabolism of cells and contribute to neurodegeneration and axonal loss in MS plaques, which is the major determinant of permanent disability in this disease (Ferguson et al., 1997). All this evidence indicates that oxidative stress plays an important role in the autoimmune effector phase of EAE and MS. There are currently three main strategies for the treatment of MS. (1) General immunosuppressive drug treatments, including corticosteroids, mitoxantrone and azathioprine, constitute the most frequent therapy used. Although their effects in reversing the acute symptoms are well known, their side effects have precluded their long-term use (Paty and Ebers, 1998). Recently, concern has emerged about their long-term adverse effects on the disease. For example, one study showed that neonatal glucocorticoid treatment of rats increased the incidence and severity of EAE in adult life (Bakker et al., 2000). (2) Antigen-specific immunosuppressive drugs and treatments are in development. Examples include feeding of CNS antigens like myelin, T cell vaccination, and intravenous administration of immunoglobulins. The major obstacle to these approaches is that autoantigenic epitopes and T cell receptor peptide sequences may differ between MS patients, and even within a single MS patient at different stages of the disease (McRae et al., 1995). (3) Cytokine-related therapies are in development and have shown some promise. For example, interferon-p1 has proven efficacious in the relapsing/remitting form of MS. One limitation of these approaches is that patients may develop antibodies to the exogenously administered proteins and neutralize their effects. While most current attempts to treat MS have focused on the development of strategies that target the T cells and the cytokines, our results suggest that antioxidant 94 treatments may represent an effective therapy in MS to prevent the development of the disease, either alone or in combination with other current available therapies. Since antioxidants act at the postinduction effector stage of this disease, they should be useful in reducing neurological disability and neuronal injury in MS regardless of its etiology. Unfortunately, in recent years, the use of antioxidant therapies in EAE and MS has resulted only in mixed success (Kryzhanovskii et al., 1984; Ruuls et al., 1995). We think that this is partially due to the limitations of the antioxidants available at present. For example, SOD and catalase have a short circulating half-life, antigenicity and large sizes, which limits cell permeability (Patel and Day, 1999). Ascorbic acid (Vitamin C) and a-tocopherol are not potent enough especially at low concentrations. Further development of more powerful antioxidants would be of value to the treatment of MS. Bilirubin, the end product of heme catabolism in mammals, is generally regarded as a potentially cytotoxic waste product that needs to be excreted. However, recent data support the view that bilirubin also serves as a physiological antioxidant in human plasma (Stocker et al., 1987). We show here that this natural biological product might have clinical utility in the treatment of MS. 95 2.5. REFERENCES: Arriaga SM, Mottino AD, Almara AM (1999) Inhibitory effect of bilirubin on complement-mediated hemolysis. Biochim Biophys Acta 1473:329-336. Bakker JM, Kavelaars A, Kamphuis PJ, Cobelens PM, van Vugt HH, van Bel F, Heijnen CJ (2000) Neonatal dexamethasone treatment increases susceptibility to experimental autoimmune disease in adult rats. J Immunol 165:5932-5937. v. Baranano DE, Snyder SH (2001) Neural roles for heme oxygenase: contrasts to nitric oxide synthase. Proc Natl Acad Sci U S A 98:10996-11002. Benveniste EN (1997) Role of macrophages/microglia in multiple sclerosis and experimental allergic encephalomyelitis. J Mol Med 75:165-173. DeVellis EN, Cole R (1992) Astrocyte and oligodendrocyte cultures. In: Fedoroff S, Richardson A (Eds.), Protocols for Neural Cell Culture, vol 5. The Human Press, Totowa, pp. 65-79. Elbirt KK, Bonkovsky HL (1999) Heme oxygenase: recent advances in understanding its regulation and role. Proc Assoc Am Physicians 111:438-447. Fauci AS (1978) Mechanisms of the immunosuppressive and anti-inflammatory effects of glucocorticosteroids. J Immunopharmacol 1:1-25. Ferguson B, Matyszak MK, Esiri MM, Perry VH (1997) Axonal damage in acute multiple sclerosis lesions. Brain 120 (Pt 3):393-399. Gate L, Paul J, Ba GN, Tew KD, Tapiero H (1999) Oxidative stress induced in pathologies: the role of antioxidants. Biomed Pharmacother 53:169-180. 96 Guy J, Ellis EA, Mames R, Rao NA (1993) Role of hydrogen peroxide in experimental optic neuritis. A serial quantitative ultrastructural study. Ophthalmic Res 25:253-264. Guy J, McGorray S, Fitzsimmons J, Beck B, Rao NA (1994) Disruption of the blood-brain barrier in experimental optic neuritis: immunocytochemical co-localization of H202 and extravasated serum albumin. Invest Ophthalmol Vis Sci 35:1114-1123. Hollensworth SB, Shen C, Sim JE, Spitz DR, Wilson GL, LeDoux SP (2000) Glial cell type-specific responses to menadione-induced oxidative stress. Free Radic Biol Med 28:1161-1174. Hooper DC, Bagasra O, Marini JC, Zborek A, Ohnishi ST, Kean R, Champion JM, Sarker AB, Bobroski L, Farber JL, Akaike T, Maeda H, Koprowski H (1997) Prevention of experimental allergic encephalomyelitis by targeting nitric oxide and peroxynitrite: implications for the treatment of multiple sclerosis. Proc Natl Acad Sci U S A 94:2528-2533. Kryzhanovskii GN, Vilkov GA, Stepanenko EM (1984) [Protective action of antioxidant preparations on the development of experimental allergic encephalomyelitis in guinea pigs]. Biull Eksp Biol Med 98:527-530. Liu Y, Zhu B, Luo L, Li P, Paty DW, Cynader MS (2001) Heme oxygenase-1 plays an important protective role in experimental autoimmune encephalomyelitis. Neuroreport 12:1841-1845. 97 Lu F, Selak M, O'Connor J, Croul S, Lorenzana C, Butunoi C, Kalman B (2000) Oxidative damage to mitochondrial DNA and activity of mitochondrial enzymes in chronic active lesions of multiple sclerosis. J Neurol Sci 177:95-103. Marilena G (1997) New physiological importance of two classic residual products: carbon monoxide and bilirubin. Biochem Mol Med 61:136-142. Martin R, McFarland HF (1995) Immunological aspects of experimental allergic encephalomyelitis and multiple sclerosis. Crit Rev Clin Lab Sci 32:121-182. McRae BL, Vanderlugt CL, Dal Canto MC, Miller SD (1995) Functional evidence for epitope spreading in the relapsing pathology of experimental autoimmune encephalomyelitis. J Exp Med 182:75-85. Merrill JE, Murphy SP (1997) Inflammatory events at the blood brain barrier: regulation of adhesion molecules, cytokines, and chemokines by reactive nitrogen and oxygen species. Brain Behav Immun 11:245-263. Morrow JD, Hill KE, Burk RF, Nammour TM, Badr KF, Roberts LJ, 2nd (1990) A series of prostaglandin F2-like compounds are produced in vivo in humans by a non-cyclooxygenase, free radical-catalyzed mechanism. Proc Natl Acad Sci U S A 87:9383-9387. Patel M, Day BJ (1999) Metalloporphyrin class of therapeutic catalytic antioxidants. Trends Pharmacol Sci 20:359-364. Paty DW, Ebers GC (1998) Multiple sclerosis. Philadelphia: F.A. Davis. Raine CS (1994) The Dale E. McFarlin Memorial Lecture: the immunology of the multiple sclerosis lesion. Ann Neurol 36:S61-72. 98 Ruuls SR, Bauer J, Sontrop K, Huitinga I, t Hart BA, Dijkstra CD (1995) Reactive oxygen species are involved in the pathogenesis of experimental allergic encephalomyelitis in Lewis rats. J Neuroimmunol 56:207-217. Smith KJ, Kapoor R, Felts PA (1999) Demyelination: the role of reactive oxygen and nitrogen species. Brain Pathol 9:69-92. Snyder SH, Baranano DE (2001) Heme oxygenase: a font of multiple messengers. Neuropsychopharmacology 25:294-298. Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames BN (1987) Bilirubin is an antioxidant of possible physiological importance. Science 235:1043-1046. Toshniwal PK, Zarling EJ (1992) Evidence for increased lipid peroxidation in multiple sclerosis. Neurochem Res 17:205-207. Trout JJ, Koenig H, Goldstone AD, Lu CY (1986) Blood-brain barrier breakdown by cold injury. Polyamine signals mediate acute stimulation of endocytosis, vesicular transport, and microvillus formation in rat cerebral capillaries. Lab Invest 55:622-631. van der Goes A, Brouwer J, Hoekstra K, Roos D, van den Berg TK, Dijkstra CD (1998) Reactive oxygen species are required for the phagocytosis of myelin by macrophages. J Neuroimmunol 92:67-75. Vetvicka V, Miler I, Sima P, Taborsky L, Fornusek L (1985) The effect of bilirubin on the Fc receptor expression and phagocytic activity of mouse peritoneal macrophages. Folia Microbiol 30:373-380. Vladimirova O, O'Connor J, Cahill A, Alder H, Butunoi C, Kalman B (1998) Oxidative damage to DNA in plaques of MS brains. Mult Scler 4:413-418. 99 Wu TW, Carey D, Wu J, Sugiyama H (1991) The cytoprotective effects of bilirubin and biliverdin on rat hepatocytes and human erythrocytes and the impact of albumin. Biochem Cell Biol 69:828-834. 100 CHAPTER 3: BILIRUBIN EXERTS ITS POWERFUL IMMUNOSUPPRESSIVE EFFECT BOTH IN VITRO AND IN THE TREATMENT OF EXPERIMENTAL AUTOIMMUNE ENCEPHALOMYELITIS1 1 A version of this chapter has been submitted for publication in Journal of Clinical Investigation. Liu Y, Li P, Lu J, Xiong W, Oger J, Tetzlaff W, Cynader MS. Bilirubin induces immunologic tolerance through its multifaceted actions and suppresses experimental autoimmune encephalomyelitis. 101 3 . 1 . I N T R O D U C T I O N Bilirubin, an abundant bile pigment in mammalian serum, was once considered a toxic waste product. During the last few decades, however, beneficial properties of bilirubin, mainly as an antioxidant, have been identified that begin to elucidate its physiological role (Stocker et al., 1987; Kapitulnik, 2004). Most current studies on the physiological functions of bilirubin focus on its antioxidant effects. However, increasing evidence suggests that bilirubin possesses multiple biological activities, including potential immunomodulatory properties (Kirkby and Adin, 2006). The effects of bilirubin on the functions of cells of the immune system were first observed more than three decades ago. For example, early in 1970 Nejedla (1970) reported that hyperbilirubinemia exerted a suppressive effect on antibody formation in newborn infants. Although the data did not prove that bilirubin was the sole factor responsible for this depression, they supported the hypothesis that bilirubin played an important role in the development of the immune system. Haga et al (1996) demonstrated that bilirubin decreased interleukin-2 (IL-2) production in human lymphocytes. In addition, Vetvicka et al (1985) showed that bilirubin could influence the expression of Fc receptors in macrophages. They hypothesized that bilirubin was capable of regulating immune functions due to its high lipophilia and its direct interaction with cell membranes. However, in contrast to its well-established antioxidant action, the immunomodulatory activities of bilirubin have not been widely explored. Data concerning the mechanisms underlying the potential immunosuppressive actions of bilirubin are lacking. 102 Bilirubin is insoluble, and must be glucuronidated before being excreted in the bile. Given that biliverdin is a water-soluble, nontoxic, easily excretable product, and is also a powerful antioxidant, the reasons why, in mammals, biliverdin is reduced to the unexcretable and potentially cytotoxic bilirubin remain obscure. In the present study, I investigate the immunomodulatory properties of bilirubin. The results demonstrate that bilirubin inhibits both antigen-specific and polyclonal T cell responses significantly. The potent immunosuppressive effects of bilirubin cannot be attributed to its antioxidant activity. Bilirubin directly influences immune responses. Likely related to its potent immunosuppressive activity, bilirubin suppresses T cell proliferation through multifaceted actions, including its inhibitory effects on costimulator activities, immune transcription factors activation, and inducible MHC class II expression. In addition, we showed that the bilirubin system is strongly induced in experimental autoimmune encephalomyelitis (EAE). Exogenous bilirubin supplementation significantly ameliorated EAE in SJL/J mice. Interestingly, depletion of endogenously produced bilirubin dramatically deteriorated this disease. These data show that bilirubin is a molecule of immunologic significance, and may represent an important factor in mammals to protect against autoimmunity. 3.2. MATERIALS AND METHODS 3.2.1. E A E induction and treatments SJL/J mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Lewis rats were purchased from Charles River Laboratories (Laval, Canada). A l l animal care 103 procedures were performed according to protocols approved by the Animal Care Committee of the University of British Columbia. To induce chronic EAE, 6-8 week old female SJL/J mice were immunized s.c. with 150 iig proteolipid protein peptide 139-151 (PLP139.151, UBC, Canada) emulsified in complete Freund's adjuvant (Difco, Detroit, MI). On the day of immunization and 2 days after, the mice were injected i.p. with 200 ng of pertusis toxin (List Biological Laboratories, Campbell, CA). To induce adoptive transfer EAE, inguinal lymph nodes were collected from these mice on day 10-12 postimmunization, and single cell suspension was prepared and cultured at a concentration of 5 * 106 cells/ml in complete RPMI 1640 medium (RPMI 1640 supplemented with 10% FBS, 2mM L-glutamine and 50 uM 2-ME) (Invitrogen, Ontario, Canada) with 50 itg/ml PLP139.151. After 4 days of culture, cells were harvested and 2 x 107 viable cells were injected i.p. into naive female SJL/J mice. To induce acute EAE, male Lewis rats with body weight between 175 and 200 g were immunized s.c. with 50 jag guinea pig myelin basic protein (Sigma, Saint Louis, MO) emulsified in complete Freund's adjuvant. Animals were observed daily after immunization. Clinical EAE was scored as follows: 0, no signs; 1, limp tail; 2, partial paralysis of hind limbs; 3, complete paralysis of hind limbs; 4, paralysis of fore and hind limbs; 5, moribund. In the chronic EAE paradigm, groups of mice were treated with bilirubin (Calbiochem, La Jolla, CA) vs glutathione (GSH, Sigma) and a-tocopherol (Sigma) at increasing doses as indicated for 15 days beginning 6 days after immunization (DAI). Two additional groups were treated with high doses of bilirubin and a-tocopherol, respectively for 15 days starting from the onset of symptoms. In the acute EAE paradigm, two groups of rats were treated with zinc protoporphyrin (ZnPP) (Frontier Scientific, Logan, UT) and TCPOBOP (Calbiochem), 104 respectively for 10 days from 6 D A I . B i l i rub in and Z n P P were dissolved in 0.1 N N a O H and adjusted to p H 7.4 wi th 1 N H C I before use. G S H was dissolved in saline, a -tocopherol was dissolved in ethanol and diluted by saline before use. T C P O B O P was dissolved in D M S O and diluted by saline before use. A l l the treatments were administered by i.p. injection. Control groups received injections with the same volume o f vehicle on the same schedule. 3.2.2. Proliferation assays To analyze antigen-specific T cel l proliferation, the lymph nodes were obtained from S J L / J mice immunized 10-12 days previously with PLPBSMSI . T cel ls were purif ied through the use o f nylon-wool fiber columns (Wako Chemicals , R ichmond, V A ) . Puri f ied T cells (5 x 10 5 /wel l) were then cultured in 96-wel l tissue culture plates in complete R P M I 1640 medium. Cel ls were stimulated with PLP139.151 in the presence o f antigen presenting cells ( A P C s , irradiated splenocytes) with different concentrations o f bi l i rubin or other antioxidants. Af ter 72 h o f stimulation, cells were pulsed with [ 3 H]thymidine (0.5 uCi /wel l ) , and 16 h later, thymidine incorporation was measured using a l iquid scintil lation beta counter. In some cases, whole PLP- immune spleen cel ls were used for proliferation assays. To analyze polyclonal T cel l proliferation, purif ied T cells were isolated from the spleens o f S J L / J mice. The cells (5 x 10 5 /wel l ) were then cultured in ant i -CD3 m A b precoated 96-wel l plates ( B D Biosciences, Ontario, Canada) with or without soluble ant i -CD28 m A b (1 pg/ml , B D Biosciences) in the presence o f different concentrations o f bi l i rubin or other antioxidants. Ce l l proliferation was also determined by [ 3H]thymidine incorporation after 72 h stimulation. Human P B M C polyclonal 105 proliferation assays were performed according to a similar protocol. Blood was collected from healthy donors in accordance with local ethics committee standards, and P B M C s were isolated by Ficoll-Hypaque density gradient centrifugation. 3.2.3. Cytokine enzyme-linked immunosorbent assays (ELISA) SJL/J mice T cells and PLP-specific T cells were stimulated as described above. Culture supernatants were collected 48 h later, and interferon-gamma (IFN-y), interleukin-2 (IL-2), IL-4, and IL-10 levels were measured in triplicate using commercially available ELISA kits (BD Biosciences). 3.2.4. Flow cytometry Monoclonal antibodies against CD3, CD4, C D 19, CD25, CD28, C T L A - 4 , B7-1, B7-2, I-A p , annexin V conjugated with FITC or PE, and propidium iodide (PI) were all purchased from B D Biosciences. Cultured cells were washed with staining buffer. Cells were then incubated with the indicated mAbs in staining buffer for 30 min on ice, washed twice, and analyzed on a FACSCaliber cytometer. 3.2.5. Real-time RT-PCR Total cellular R N A was isolated with TRIzol reagent (Invitrogen). R N A was transcribed to c D N A using random hexamer primers (Invitrogen). Real-time RT-PCR was performed in an A B I Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, C A ) using S Y B R Green PCR Core Reagents (Applied Biosystems). The primers used are as follows: FoxP3, 5 ' - G G C C C T T C T C C A G G A C A G A - 3 ' , 5'-106 GCTGATCATGGCTGGGTTGT-3'; CIITA, 5'-CAAGTCCCTGAAGGATGTGGA-3', 5'-ACGTCCATCACCCGGAGGGAC-3'; actin, 5'-GTGGGCCGCTCTAGGCACCAA-3', 5'-CTCTTTGATGTCACGCACGATTTC-3'. Relative quantification of target genes was analyzed based on a comparative C T method as suggested by Applied Biosystems. 3.2.6. Cell viability and apoptosis assays Cell viability was measured using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) colorimetric assay. After the indicated treatments, 5 mg/ml MTT was added to cell cultures at 1/10 dilution. After incubation at 37°C for 3 h, the media was careful removed, and the purple crystals were dissolved in isopropanol. The viability was determined by measuring the absorbance at 570 nm. For detection of apoptosis, after washing in PBS, the cell pellets were resuspended in binding buffer containing annexin V-FITC and PI for 20 min at room temperature. The samples were analyzed in the flow cytometer within 1 h. 3.2.7. Nuclear protein extraction and electrophoretic mobility shift assay (EMSA) Nuclear extracts were prepared using a nuclear extraction kit (Panomics, Redwood City, CA), according to the manufacture's protocol. For EMSA, the N F - K B consensus oligonucleotide probe double strand (5'-AGTTG AGGGG ACTTTCCC AGG-3') (Promega, Madison, WI) was labeled with [32P]ATP. 4 ug nuclear extracts were used for each binding reaction in gel shift binding buffer with P-labeled N F - K B consensus oligonucleotide. The samples were analyzed by electrophoresis on 4% acrylamide gels. The gels were dried and exposed to X-ray film. Double-stranded mutated oligonucleotide 107 (5'-AGTTGAGGCGACTTTCCCAGG-3') was used to verify the specificity of N F - K B binding to DNA. 3.2.8. Western blotting assays Nuclear and cytoplasmic protein extracts were prepared using the nuclear extraction kit mentioned above. Total cell protein extracts were prepared with lysis buffer. Equal amounts of protein were separated on SDS-PAGE and transferred to nitrocellulose membranes. Standard immunostaining was carried out using the ECL chemiluminescence technique. Anti-NF-KB (Stressgen, Ann Arbor, MI), anti-phosphoIicB (Stressgen), and anti-phosphoSTAT-1 (Cell Signaling Technology, Beverly, MA) Abs were used at 1:1000 to 1:2000 dilutions. 3.2.9. Bilirubin assay Blood was drawn from SJL/J mice at various time points after bilirubin injections. Serum bilirubin concentration was measured using a bilirubin assay kit (Wako Diagnostics, Richmond, VA). 3.2.10. Morphological techniques and histopathological studies Animals were euthanized by C O 2 asphyxiation and perfused transcardially with 4% paraformaldehyde in 0.1 M PBS. The lumbosacral spinal cords were immediately removed, embedded in Tissue-Tek, and frozen at -80°C. Serial transverse sections were cut on a Frigocut cryostat. The sections were stained with hematoxylin-eosin to assess inflammation. The severity of inflammation in each section was graded as follows: 0, no 108 inflammation; 1, mild meningeal inflammation and/or rare parenchymal infdtration; 2, moderate meningitis, sub-meningeal infiltration, and small scattered perivascular infdtration; 3, severe meningitis, parenchymal infiltration and/or multiple perivascular infiltration; 4, foci of necrosis and/or neutrophilic infdtration. For luxol fast blue staining, slides were stained overnight at 55°C in 0.1% solvent blue 38 (Sigma). Differentiation and counterstaining were carried out with lithium carbonate and cresyl echt violet solution. Immunostaining were performed following the established protocols. Anti-CD3, anti-Mac 3, anti-neurofilament, anti-Rip Ab, and anti-GFAP Abs were purchased from Serotec (Oxford, England), BD Biosciences (Ontario, Canada), Chemicon (Temecula, CA), Iowa State Hybridoma Bank (Iowa City, I A), and Santa Cruz Biotechnology (Santa Cruz, CA), respectively. Anti-HO-1 and anti-BVR were purchased from Stressgen. Anti-p-APP Ab was purchased from Zymed Laboratories (San Francisco, CA). Anti-bilirubin (24G7) mAb was purchased from Shino-Test (Tokyo, Japan). The numbers of positively stained neurons (neurofilament1"), oligodendrocytes (Rip+), and astrocytes (GFAP+) were quantitated in the spinal cord sections. 3.2.11. Statistical analysis Data are presented in mean ± S.E.M. Data on the effect of various treatments on EAE were analyzed using two-way ANOVA with Fisher's PLSD post hoc tests for multiple comparisons. Two-sample t tests were used to compare the mean values between two groups. Values of p < 0.05 were considered statistically significant. 109 3.3. RESULTS 3.3.1. Bilirubin inhibits T cell proliferation To examine the potential immunomodulatory properties of bilirubin, we investigated the effect of bilirubin on the proliferative responses of PLP-specific and naive SJL/J T cells following stimulation with PLP139.151, anti-CD3 mAb with or without anti-CD28, or concanavalin A (ConA) as indicated. We first assessed cytotoxicity of bilirubin to ensure that all the concentrations of bilirubin we used were nontoxic. Cultures of unstimulated PLP-specific or naive SJL/J T cells incubated with bilirubin at concentrations up to 200 luiM did not show reduced cell viability over 3 d as evaluated by MTT assay (Fig. 3.1 A). Since in humans, the normal plasma level of bilirubin is approximately 20 uM, and levels as high as 170 uM in neonates are still considered physiological jaundice (Dennery et al., 2001; Ostrow et al., 2003), we chose concentrations of bilirubin between 20 and 150 uM for the present study. As shown in Fig. 3.1, bilirubin significantly inhibited both antigen-specific and polyclonal T cell responses. Interestingly, the inhibitory effect of bilirubin was stronger on the PLP-specific T cell proliferative response than on T cell proliferation activated with CD3 or ConA (Fig. 3.1 B). Comparable inhibitory effects were observed when T cells were stimulated with CD3 alone or with CD3 plus CD28 (Fig. 3.1 B). The inhibitory effect of bilirubin was dose-dependent, with concentrations higher than 50 uM significantly suppressing T cell responses in all cases (Fig. 3.1 C). To ascertain whether the immunosuppressive actions of bilirubin were of general importance for multiple cell types, similar experiments were performed on human PBMCs. The results showed that bilirubin also inhibited human T cell proliferation effectively (Fig. 3.1 D). 110 Figure 3 . 1 . Bilirubin inhibits antigen-specific and polyclonal T cell proliferation. (A) Assessment of the potential cytotoxicity of bilirubin to T cells. Unstimulated PLP-immune or naive SJL/J T cells were cultured for 3 d in the presence or absence of increasing concentrations of bilirubin. Cell viability was measured by MTT assay. (B) For antigen-specific T cell proliferation analysis, PLP-specific T cells were stimulated with the indicated concentrations of PLP139. 151 plus APCs in the presence or absence of 1 0 0 uM bilirubin. For polyclonal T cell proliferation analysis, naive SJL/J T cells were stimulated with the indicated concentrations of Con A or anti-CD3 mAb with or without soluble anti-CD28 mAb ( 1 ug/ml) in the presence or absence of 1 0 0 uM bilirubin. (C) Dose-dependent inhibition of T cell proliferative response by bilirubin. PLP-specific T cells were stimulated with 5 0 uM PLP139.151 plus APCs in the presence of the indicated concentrations of bilirubin. Naive SJL/J T cells were stimulated with 1 ug/ml anti-CD3 mAb or with 1 ug/ml Con A in the presence of the indicated concentrations of bilirubin. (D) Human PBMCs were stimulated with 1 ug/ml anti-CD3 mAb or with 1 ug/ml Con A in the presence of the indicated concentrations of bilirubin. ( E ) The effects of GSH, a-tocopherol, and conjugated bilirubin on PLP-specific and polyclonal T cell proliferation. All data shown are representative of four independent experiments. * p < 0 . 0 1 vs control. I l l A 140 i >* o 120 = 100 TO o 80 • > o 60 ~a> o 40 O sS 20, 0 J _ Naive T cells • Unstimulated PLP-specific T cells B 80 o 60 X ¥ 4 0 140 <*- 120 ° 100 * 80 60 40 20 0 I 0 50 100 150 200 Bilirubin treatment (pM) • control • bilirubin 100 pM * * 100 80 60 40 20 0 25 50 P L P ug/ml 100 • control C bilirubin 100 pM • control J bilirubin 100 pM * —• CL O 160 tr 140 o 120 " 100 80 60 40 20 0 0.1 1 10 An t i -CD3 ug/ml • control • bilirubin 100 uM rh 0.1 1 10 Anti-CD3 ug/ml + anti-CD28 1 ug/ml 0.5 1 C o n A ug/ml _ PLP 50 ug/ml D • anti-CD3 mAb 1 ug/ml • Con A 1 ug/ml • anti-CD3 1 ug/ml G Con A 1 ug/ml 200 " o 150 £ 100 I 50 E Q-0 20 50 100 Bilirubin pg/ml • PLP 50 pg/ml • anti-CD3 mAb 1 pg/ml • Con A 1 pg/ml 150 150 ° 100 50 0 0 100 1,000 5,000 G S H pg/ml • PLP 50 ug/mJ anti-Cra mAb 1 pg/ml • Con A 1 pg/ml r i l 0 50 100 200 Conjugated bilirubin pg/ml ) 20 50 100 150 Bilirubin pg/ml • PLP 50 ug/ml • anti-CD3 mAb 1 pg/ml • Con A 1 pg/ml 0 100 1,000 5,000 a-tocopherol pg/ml t o Since several previous studies had demonstrated that reactive oxygen species (ROS) were able to promote the proliferation and growth of some cell types (Taille et al., 2003; Nakao et al., 2004), and bilirubin is an efficient radical scavenger, we then examined whether the antiproliferative actions of bilirubin observed above were attributable to its well-known antioxidant activity. The effects of several other powerful antioxidants on T cell proliferation were examined, including glutathione (GSH), another important endogenous antioxidant in mammals; a-tocopherol, also a potent lipophilic antioxidant; and conjugated bilirubin. Our results clearly showed that none of them inhibited T cell responses to any degree even at much higher concentrations (Fig. 3.1 E). The data suggest that bilirubin possesses an important immunosuppressive effect in addition to its other biological functions. 3.3.2. High levels of bilirubin induce apoptosis in reactive T cells Inhibition of T cell proliferation after stimulation with bilirubin treatment could be due to either cellular unresponsiveness or depletion of responder cells (Abbas, 2003). We next determined if bilirubin could induce the responder T cell deletion. Purified SJL/J T ' cells were stimulated with anti-CD3 for 72 h in the presence of different concentrations of bilirubin. Annexin V/PI staining was used to detect T cell apoptosis and death. The results demonstrated that incubation of activated T cells with bilirubin at a high concentration of 200 uM resulted in higher percentages of apoptotic cells (Fig. 3.2). However, bilirubin at lower concentrations did not strongly induce responder T cell apoptosis. The level of apoptotic cells changed less than 10% in cultures incubated with 150 uM bilirubin, although the proliferative response was reduced by more than 65% 113 Figure 3.2. High levels of bilirubin induce apoptosis in reactive T cells. Naive SJL/J T cells were stimulated with 1 |ig/ml anti-CD3 for 72 h in the presence of different concentrations of bilirubin. T cell apoptosis and death was detected by annexin V/PI staining and analyzed by flow cytometry. Results from one representative out of four independent experiments are shown. 1 14 (Fig. 3.1). Bilirubin at the concentrations of 100 uM or 50 uM did not increase apoptosis in the activated T cells (data not shown), but at the same concentrations still significantly inhibited the proliferative response (Fig. 3.1). These results demonstrate that although cell death may contribute to immunologic tolerance induced by bilirubin, bilirubin also causes anergy in reactive T cells, especially at physiological concentrations. Similar results were observed for the effects of bilirubin on the antigen-specific T cell responses activated with PLP139.151 (data not shown). 3.3.3. Bilirubin does not induce immune deviation or expansion of several regulatory T cell types To further elucidate the mechanisms underlying T cell suppression by bilirubin, we then investigated whether bilirubin had effects on Th cell differentiation. Cytokine secretion was measured in PLP-specific T cells after stimulation with 50 ug/ml PLP139.151 for 48 h in the presence of APCs. As shown in Fig. 3.3 A, the production of Thl cytokines, including IL-2 and IFN-y, was strongly suppressed by bilirubin in a dose-dependent manner. The production of Th2 cytokines, including IL-4 and IL-10, was also decreased by bilirubin treatment, suggesting that bilirubin does not lead to a skewing of immune responses from a Thl cell to a Th2 cell response. The reduced production of IL-10 by activated PLP-specific T cells after treatment also indicates that bilirubin does not induce IL-10-producing T reg 1 cells. Similar results were observed for the effects of bilirubin on polyclonal T cell responses activated with CD 3 or ConA (data not shown). We next asked whether bilirubin favors the development of CD4+CD25+ regulatory T 115 g u n 2 E c 8 -i 6 -ag I 2 §• 0 B 300 IIL-2 D IFN-y IL-4 • IL-10 l_ • J_ Hi * 0 50 100 150 Bilirubin treatment (uM) 1 ( J, 1 t f 1 t f 10< N o s i m u l a t i o n 1 2 . 8 % 1 0 ° 1 0 ' 10" it? 10* 30C P L P 0 50 100 150 Bilirubin treatment (uM) P L P + B i l i r u b i n n z S 5 Q. E S £ 1 £ £ ro ~ <D o „ a. o Bilirubin (uM) 0 Stimulated 5 0 + h n 1 0 0 1 5 0 + + Figure 3.3. Bilirubin does not induce immune deviation or expansion of several regulatory T cell types. (A) PLP-specific T cells were stimulated with 50 uM PLP139.151 in the presence of APCs with the indicated concentrations of bilirubin. After 48 h culture, supernatants were collected and IFN-y, IL-2, IL-4, and IL-10 levels were measured by ELISA. * p < 0.01 vs control. (B) PLP-specific T cells were stimulated with 50 u,M PLP139.151 in the presence of APCs with or without 150 uM bilirubin. The surface expression of CD25 on control and bilirubin-treated T cells after 48 h stimulation was analyzed by flow cytometry with gating on live CD4+ T cells. (C) Total cellular RNA extracts were made from PLP-specific T cells after 72 h stimulation in the presence or absence of bilirubin. Foxp3 mRNA levels in the cell extracts were measured by real-time RT-PCR. The levels of FoxP3 mRNAs were normalized to actin mRNA levels, which is set at 1.0 for naive cells. All results are relative expression levels to the untreated control. All data shown are representative of four independent experiments. 1 cells, which is another crucial mechanism to maintain immunologic tolerance (Sakaguchi, 2005). Flow cytometric analyses showed that bilirubin did not promote generation of CD4+CD25+ regulatory T cells (Fig. 3.3 B). The percentage of PLP-specific CD4+ T cells expressing CD25 following PLP139.151 stimulation with bilirubin treatment was not increased when compared with control treatments. Since CD25 is not an exclusive marker of regulatory T cells, we further examined the expression level of Foxp3, a transcription factor associated with the regulatory function of CD4+CD25+ T cells (Fontenot et al., 2003; Khattri et al., 2003), in PLP-specific CD4+ T cells after TCR stimulation with or without bilirubin treatment. Again, bilirubin did not increase Foxp3 mRNA expression levels in the activated T cells (Fig. 3.3 C). 3.3.4. Bilirubin suppresses costimulatory molecule activities T cell activation requires two distinct signals. One signal is delivered through the interaction of the antigen-specific T cell receptor (TCR) with MHC molecules expressed on APCs, while the other is received from interactions with costimulatory molecules. T cells that receive a TCR stimulus without adequate costimulation are rendered anergic (Harding et al., 1992; Gimmi et al., 1993). We then asked whether bilirubin induced anergy in reactive T cells by downregulating costimulator activities. PLP-immune spleen cells were activated with PLP139.151 in the presence or absence of bilirubin. CD28, CTLA-4, B7-1, and B7-2 expression was measured by flow cytometry after 48 h of culture. As shown in Fig. 3.4 A, bilirubin at 150 uM inhibited the activation-induced expression of CD28 and B7-2 by more than 50%. B7-1 activity after stimulation was also decreased by bilirubin treatment but was less pronounced (41 ± 8%, p < 0.05). Further studies 117 F i g u r e 3.4. B i l i r u b i n s u p p r e s s e s i n d u c i b l e e x p r e s s i o n o f c o s t i m u l a t o r y m o l e c u l e s . (A) PLP-immune spleen cells were activated with 50 uM PLP139.151 in the presence or absence of 150 uM bilirubin. CD28, CTLA-4, B7-1, and B7-2 expression was measured by flow cytometry after 48 h of culture. CD28 and CTLA-4 was analyzed with gating on live T cells. (B) PLP-specific T cells were stimulated for 72 h with 50 uM PLP139.151 in the presence of APCs with or without 150 uM bilirubin treatment. After two rounds of stimulation under the same conditions, the cells were washed, counted, and same number of control or bilirubin-treated PLP-specific T cell lines were rechallenged with PLP139.151 for 24 h in the absence of bilirubin. Cell proliferation was determined by [ HJthymidine incorporation and IFN-y in the supernatants was measured by ELISA. For both (A) and (B), results from one representative out of four independent experiments are shown. * p < 0.01 vs control. suggested that the results were not due to the change of cellular composition after bilirubin treatment since bilirubin did not significantly change the percentages of cell subpopulations in the cultures, including CD4+, CD8+, CDllb +, CDllc + and CD19+ groups (data not shown). However, bilirubin did not alter the expression of CTLA-4 by activated T cells, which indicates that the effect of bilirubin on the costimulatory activity is specific. These data also provide the evidence that our findings are not a general phenomenon related to suppression of protein synthesis after bilirubin treatment. However, we observed that the effects of bilirubin at low concentrations in this respect are not strong. For example, the costimulatory molecule activities following stimulation with 50 u,M bilirubin treatment were not significantly different from controls although the means were slightly lower (data not shown). Since bilirubin can suppress costimulatory activity and induce anergy, we then investigated whether bilirubin renders the treated T cells incapable of re-responding to the antigen. PLP-specific T cells were stimulated for 72 h with PLP139.151 in the presence of APCs with or without bilirubin treatment. After one to two rounds of stimulation under the same conditions, the cells were washed, counted, and same number of control or bilirubin-treated PLP-specific T cells were rechallenged with PLP139.151 for 24 h in the absence of bilirubin. Consistent with the above results, bilirubin treatment induced a state of hyporesponsiveness in PLP-specific T cells. Both proliferation and IFN-y production were significantly inhibited (Fig. 3.4 B). 3.3.5. Bilirubin inhibits N F - K B activation Bilirubin appears able to act directly on T cells since proliferation of purified T cells in response to anti-CD3 mAb plus anti-CD28 mAb co-stimulation, which stimulates T 119 cells in an APC independent manner, was also significantly suppressed (Fig. 3.1). To further understand the potential mechanisms through which bilirubin regulates T cell immune response, we examined the impact of bilirubin treatment on N F - K B , which is a key transcription factor involved in TCR-mediated signaling (Kuo and Leiden, 1999). Purified mouse T cells were stimulated with anti-CD3 and anti-CD28 mAb for 24 h with or without 150 uM bilirubin. Nuclear, cytoplasmic and total cell protein extracts were subsequently prepared for Western blotting assays and EMSA. Western blotting studies showed that the level of N F - K B in the nucleus was dramatically decreased in the bilirubin-treated T cells (Fig. 3.5 A). The decreased level of N F - K B in the nucleus of bilirubin-treated T cells was not due to an overall suppression of N F - K B in these cells, since no significant difference was observed for total N F - K B level after bilirubin treatment. The results suggest that bilirubin interferes with N F - K B nuclear translocaton following activation. In resting cells, N F - K B dimers are in the cytoplasm in an inactive state, bound to the inhibitor of K B ( I K B ) . Upon T cell activation, N F - K B is translocated into nucleus after disassociating from phosphorylated I K B (Baeuerle and Henkel, 1994; Abbas, 2003). Since bilirubin has widespread inhibitory effects on protein phosphorylation (Hansen et al., 1996; Taille et al., 2003), we hypothesized that bilirubin might interfere with I K B degradation by inhibiting its phosphorylation. Our results demonstrated that this is indeed the case. As shown in Fig. 3.5 B, bilirubin markedly suppressed activation-induced I K B phosphorylation. Consequently, the DNA binding activity of N F - K B was inhibited by bilirubin treatment (Fig. 3.5 C). Furthermore, our in vitro experiments indicated that 120 B anti-CD3 / anti-CD28 Bilirubin N F - K B + + + + + Total cell lysate Cytoplasmic Nuclear extract extract anti-CD3 / + + anti-CD28 + Bilirubin «- p-lKB 150 + + anti-CD3/anti-CD28 + - Homo-competitor + Mutated-competitor 0 0 Bilirubin (uM) Conju-bilirubin (pM) D l p ^ N F - K B ^ + + 0 0 0 50 100 0 50 100 0 0 Figure 3.5. Bilirubin inhibits NF-KB activation. (A) Purified SJL/J mouse T cells were stimulated with 1 u.g/ml anti-CD3 and 1 ug/ml anti-CD28 mAb for 24 h in the presence or absence of 150 u.M bilirubin. Nuclear, cytoplasmic, and total cell protein extracts were subsequently prepared for Western blotting assays and EMSA. The protein levels of N F - K B in nuclear, cytoplasmic, and total cell extracts were measured by Western blotting assays. (B) After 4 h of culture, the levels of activation-induced IKB phosphorylation were measured in total cell protein extracts by Western blotting assays with anti-plKB antibody. (C) Nuclear N F - K B DNA binding activity was examined by EMSA after 24 h of culture. The specificity of DNA binding was confirmed by homologous and mutated oligonucleotide competition. (D) To investigate whether bilirubin can directly inhibit the binding of N F - K B to DNA, T cells were stimulated with anti-CD3/anti-CD28 without bilirubin treatment. Nuclear extracts were prepared and then incubated with bilirubin vs conjugated bilirubin. EMSA was then preformed as in (C). For each case, results are representative of three independent experiments. 121 bilirubin could also directly interfere with the binding of N F - K B to DNA, while conjugated bilirubin was devoid of this activity (Fig. 3.5 D). 3.3.6. Bilirubin inhibits the activation-induced expression of class II M H C molecule in APCs It is noteworthy that the inhibitory effects of bilirubin were strongest on antigen-specific T cell proliferative response (Fig. 3.1 B), in which APCs play an important role. We considered that bilirubin might also influence the expression of class II MHC molecule in APCs. PLP-immune spleen cells were activated with PLP139.151 in the presence or absence of bilirubin. Class II MHC expression was detected by anti-I-Ap mAb after 48 h of culture. During the immune responses, the expression of class II MHC was significantly increased in APCs (Fig. 3.6 A). Treatment with 150 uM bilirubin significantly suppressed activation-induced upregulation of this molecule (Fig. 3.6 A). Addition of IFN-y (50 U/ml) 24 h after bilirubin treatment did not overcome the suppression mediated by bilirubin (Fig. 3.6 A). The data suggest that the inhibitory effect of bilirubin on inducible expression of class II MHC was not simply due to the decreased production of IFN-y after the treatment. Therefore, high levels of bilirubin can also affect TCR signaling. Class II transactivator (CIITA) is cell-specific, cytokine-inducible, and differentiation-specific transcription factor that is the master regulator of MHC II gene expression (Rohn et al., 1996; Ting and Trowsdale, 2002). To assess whether the suppressive effect of bilirubin on MHC II expression was due to reduced CIITA transcription, specific mRNA was analyzed by RT-PCR. As expected, bilirubin 122 A No stimulation 500 PLP 10 10; 10 o PLP+Bilirubin o 300 10s 10' 10* 10* 10* PLP+INF-y+Bilirubin B § 05 <C CL fZ <B < tu o a : 1 * * L i i J PLP Bilirubin P-STAT-1 + + Bilirubin (MM) 0 0 50 100 150 Stimulated - + + + + Figure 3 . 6 . Bilirubin inhibits activation-induced class II MHC expression in APCs. (A) PLP-immune spleen cells were activated with 50 uM PLP139 .151 in the presence or absence of 150 uM bilirubin. After 48 h of culture, class II MHC expression was analyzed by flow cytometry with anti-I-Ap mAb. In one group, IFN-y (50 U/ml) was added 24 h after bilirubin treatment. (B) After 24 h of culture, total cellular RNA was isolated using TRIzol reagent. Transcript levels of CIITA were detected by RT-PCR. (C) After 4 h of culture, total cell protein extracts were prepared with lysis buffer. The levels of activation-induced STAT-1 phosphorylation were measured by Western blotting assays with anti-pSTAT-1 antibody. For each case, results from one representative out of three independent experiments are shown. 123 significantly inhibited CIITA induction at the mRNA level (Fig. 3.6 B). Because IFN-y-induced CIITA gene activation is phosphoSTAT-1-dependent (Piskurich et al., 1999; Ting and Trowsdale, 2002), the effect of bilirubin on activation-induced STAT-1 phosphorylation was also evaluated. Western blotting assays demonstrated that bilirubin could also suppress Stat-1 phosphorylation (Fig. 3.6 C). 3.3.7. Bilirubin suppresses experimental autoimmune encephalomyelitis in S J L / J mice To determine whether bilirubin also exerts immunomodulatory effects in vivo, we explored the therapeutic effect of bilirubin in EAE, a T cell-mediated autoimmune inflammatory disease of the central nervous system (CNS) (Raine, 1994). Chronic EAE was induced in female SJL/J mice. From 6 to 21 DAI, animals were treated with bilirubin vs other potent antioxidants (GSH and a-tocopherol) twice daily at increasing doses until maximal effects were achieved but without notable side effects in each case. Most of the control-treated mice developed severe EAE starting at 9 to 10 DAI. Symptoms peaked at 13-18 DAI. The animals temporarily recovered around 35 DAI, after which relapsing-remitting signs developed. Treatment with bilirubin successfully prevented the development of chronic EAE (Table 3.1). The highest dose of 100 mg/kg twice daily of bilirubin delayed the onset of EAE and substantially ameliorated the clinical signs. The therapeutic effect of bilirubin was long lasting. Symptoms did not rebound after treatment ceased. In addition, the second, more chronic phase was also significantly suppressed. To "mimic" realistic therapeutic circumstances, bilirubin treatment was started from onset of symptoms. As shown in Table 3.1, bilirubin at this stage effectively halted disease 124 Table 3.1. Effect on active EAE: Chronic EAE was induced in SJL/J mice. Animals were treated with bilirubin vs a-tocopherol or GSH twice daily from before (a from 6 to 21 DAI) or starting from (b 15 days from disease onset day) the onset of clinical EAE at increasing doses until maximal effects were achieved but without notable side effects in each case. Inflammation was assessed by hematoxylin-eosin staining. The severity of inflammation was graded as described in MATERIALS AND METHODS. Animals were sacrificed for histological studies at the time when control animals reached the peak of illness. Relapse is defined as an increase of at least one grade in clinical score maintained for at least 2 days after remission or as severe disease without remission. Effect on adoptive transfer EAE: PLP-immune T cells were isolated from EAE mice with vehicle, bilirubin or a-tocopherol treatments starting from before the onset of symptoms. Adoptive transfer EAE was induced as described in MATERIALS AND METHODS. Cumulative score is the sum of all daily clinical scores. Data regarding the onset and duration of illness were obtained only from animals that developed clinical EAE. Data are presented in mean ± S.E.M. Statistical comparison was made using two-sample t tests. * p < 0.05 vs control. 125 Table 3.1 Effects of bilirubin vs GSH and a-tocopherol treatment on active and adoptive transfer E A E in SJL/J mice ON ACTIVE EAE Groups Acute disease (from 0 to 35 DAI) Primary relapse (from 35 to 65 DAI) Second and more relapse (from 65 to 100 DAI) Incidence Onset (DAI) Duration of illness Maximum clinical score Histological grade Incidence Maximum clinical score Cumulative clinical score Nontreated 7/8 10.7±0.7 15.0 ± 1.2 • 2.2 ±0.3 2.7 ± 0.2 (n=6) N/A N/A N/A Control-treated0 8/8 10.5 ±0.5 15.4 ± 1.3 2.3 ±0.2 2.6 ± 0.2 (n=6) 7/8 2.0 ±0.3 38.7 ± 8.2 Bilirubin" 2=<2.5 mg/lOOg/d i.p. 7/8 11.0 ±0.7 13.4± 1.7 2.0 ±0.4 N/A N/A N/A N/A 2x5 mg/lOOg/d i.p. 5/8 15.4 ±1.3* 12.4 ± 1.6 1.1 ±0.4* N/A -N/A N/A N/A 2x10 mg/lOOg/d i.p. 4/8 16.5 ± 1.4* 9.7 ± 1.8* 0.8 ±0.4* 1.1 ±0.5* (n=6) 4/8 0.8 ±0.3* 18.7±5.9* GSH" 2x5 mg/lOOg/d i.p. 7/8 10.4 ±0.6 14.3 ± 1.5 2.1 ±0.4 N/A N/A N/A N/A 2x10 mg/lOOg/d i.p. 8/8 10.2 ±0.5 14.8 ± 1.8 2.2 ±0.2 N/A N/A N/A N/A 2x20 mg/lOOg/d i.p. 8/8 9.9 ±0.6 16.0 ±2.0 2.5 ±0.3 2.8±0.3(n=6) 8/8 2.1 ±0.4 43.7 ±9.0 VitE" 2x5 mg/lOOg/d i.p. 7/8 11.0±0.8 13.6 ± 1.7 2.1 ±0.4 N/A N/A N/A N/A 2x10 mg/lOOg/d i.p. 8/8 10.5 ±0.6 15.1 ± 1.6 2.2 ±0.2 N/A N/A N/A N/A 2x20 mg/lOOg/d i.p. 6/8 11.8 ± 1.0 12.3 ± 1.5 1.5 ± 0.3* 1.8 ±0.4* (n=6) 8/8 1.9 ±0.2 40.2 ±7.2 Control-treated" ' 8/8 10.8 ±0.6 15.0 ± 1.4 ^ 2.6 ±0.4 N/A 8/8 2.4 ±0.3 42.5 ±6.6 Bilirubin" 2*10 mg/lOOg/d i.p. 8/8 10.4 ±0.4 10.7 ± 1.3* 1.6 ±0.2* N/A 5/8 1.2 ±0.4* 23.8 ±6.0* VitEb 2x20 mg/lOOg/d i.p. 8/8 10.6±0.S 15.0 ±1.4 2.3 ±0.3 N/A 7/8 2.3 ±0.4 43.8 ±4.0 ON ADOPTIVE TRANSFER EAE Control-treated 7/8 ' 8.1 ±0 6 11.6± 1.0 2.1 ±0.3 N/A 678 1.6 ±0.4 : 35.0 ±5.3 Bilirubin-treated 5/8 10.6±0.7* 8.4±0.9* 1.1 ±0.4* N/A 3/8 0.8 ±0.4* 17.5 ± 6.3* VitE-treated 8/8 8.5±0.7 11.9 ±1.1 2.0±0.3 N/A 6/8 1.5 ±0.3 .31.8 ± 7.6 ro progression. Moreover, bilirubin treatment during the first clinical episode decreased the relapse of chronic EAE. To confirm that the therapeutic effect was due to the entrance of bilirubin into the animal blood, we measured mice serum bilirubin levels after a single 100 mg/kg bilirubin injection. Basal serum bilirubin concentrations in the untreated mice were below detection level. Upon bilirubin administration, serum bilirubin peaked at 51.6 ± 12.6 u.M at 30 min, decreased to 26.7 ± 7.8 uM after 4 h, and returned to basal levels after 8 h. The concentration of bilirubin in the CNS was also increased after these treatments as detected by immunohistochemical studies (Fig. 3.7 A). No significant effect was observed at a low dose of 25 mg/kg twice daily of bilirubin, whereas 50 mg/kg twice daily showed an intermediate effect. We did not observe significant effect of GSH treatment on EAE even with higher doses (Table 3.1). a-tocopherol at the highest dose only slightly reduced the symptoms of EAE, and its maximal effect was much weaker than that observed with bilirubin treatment. Pathological examinations were performed in animals that were treated with vehicle solution, and also those treated with bilirubin or a-tocopherol at the highest doses beginning from before the onset of symptoms. All control-treated mice at peak EAE developed severe inflammation in the spinal cord lesions with an average histological grade 2.6 ± 0.2. In mice that were treated with bilirubin and that developed mild EAE, the degree of inflammation in the lesions was also much milder, correlating well with the alleviated EAE symptoms (Table 3.1). However, the inflammatory grade in a-tocopherol-treated mice was only slightly decreased when compared with control animals (Table 3.1). Overall, bilirubin delayed the onset and alleviated the severity of EAE much more efficiently than treatment with a-tocopherol, although many previous studies, including 127 Figure 3.7. Effect of bilirubin treatment on EAE. (A) The effects of bilirubin vs. GSH and a-tocopherol treatments on chronic and adoptive transfer EAE in SJL/J mice are detailed in Table 1. The concentration of bilirubin in the spinal cords was detected by immunohistochemical study with specific bilirubin antibody. Results from one representative donor out of four are shown. Scale bar = 30 um. (B) Spleens were removed on 12 DAI from EAE mice with vehicle, bilirubin (2x10 mg/lOOg/day) or a-tocopherol (2x20 mg/lOOg/day) treatments starting from before the onset of symptoms. PLP-specific T cells were restimulated with 50 uM PLP139.151 for 72 h to determine their proliferation and cytokine production. Results from one representative out of four independent experiments are shown. * p < 0.01 vs control. (C) Acute EAE was induced in Lewis rats. The expression of HO-1 and BVR in the spinal cords on 12 DAI was detected by immunohistochemical study with specific antibodies. Scale bars for both HO-1 and BVR staining = 30 pm. Groups of animals were treated with vehicle solutions, ZnPP, and TCPOBOP respectively as indicated. (D) Inflammation and bilirubin concentrations in the spinal cord lesions on 12 DAI were compared among control, ZnPP and TCPOBOP-treated EAE rats. Results from one representative donor out of three in each case are shown. Scale bar for HE staining = 50 pm. Scale bar for bilirubin immunohistochemistry = 30 pm. Data were analyzed using two-way ANOVA with Fisher's PLSD post hoc tests for multiple comparisons. 128 129 ours, have demonstrated that they are similarly potent antioxidants (Machlin and Bendich, 1987; Liu et al., 2003). Therefore, the results here suggest that bilirubin's efficacy in vivo is not solely due to its antioxidant effect. To define the mechanisms of the in vivo effects of bilirubin, spleens were removed from bilirubin, a-tocopherol, or control-treated mice on 12 DAI, and PLP-specific T cells were restimulated with PLP139.151 in the presence of APCs for 72 h to determine their proliferation and cytokine production. As shown in Fig. 3.7 B, the proliferation capacity of cells derived from bilirubin-treated animals, was clearly reduced when compared with control-treated mice. Also, IFN-y and IL-2 production was significantly decreased. IL-4 and IL-10 levels were also very low. However, T cells derived from a-tocopherol-treated cells were comparable to controls in both proliferative capacity and cytokine production when rechallenged with PLP139.151 (Fig. 3.7 B). In addition, PLP-immune T cells isolated from bilirubin-treated mice were much less efficient than control PLP-immune T cells in transferring EAE to naive mice (Table 3.1). In contrast, treatment with a-tocopherol did not reduce the efficacy of PLP-immune T cells in inducing passive EAE but resulted in the usual form of adoptively transferred EAE despite it could still inhibit the active EAE (Table 3.1). All these data indicate that bilirubin, in addition to its established antioxidant activity, also functions as a strong immunomodulator in vivo. Finally, we asked whether bilirubin represents an important endogenous factor in animals to defend against this autoimmune disease. In comparison to chronic EAE, the acute EAE in Lewis rats offers the advantage of a predictable time of onset and uniform severity of disease. Most rats spontaneously recover completely. Therefore, it is commonly used for evaluating the effects of new therapies especially when the treatments 130 are expected to deteriorate the disease. First, we examined bilirubin system activity in EAE. The results showed that, during EAE, both HO-1 and BVR were strongly induced in the spinal cord lesions, and the concentration of bilirubin was subsequently increased (Fig. 3.7 C and D). We first treated acute EAE in Lewis rats with ZnPP, a specific inhibitor of the bilirubin-producing enzyme, heme oxygenase-1. ZnPP markedly exacerbated acute EAE (Fig. 3.7 C, F(l, 126) = 186.19,/? < 0.01). In contrast to controls, many ZnPP -treated rats never recovered from disease and developed tetraplegia before euthanasia, and some died of severe EAE. Since inhibition of heme oxygenase-1 can also affect the production of another immunomodulator, carbon monoxide (Bach, 2005; Kirkby and Adin, 2006), we further tried to treat acute EAE with TCPOBOP, a potent activator of bilirubin clearance. Similar therapeutic effects were observed (Fig. 3.7 C, F(], 126) = 175.28,/? < 0.01). Interestingly, immunohistochemical analyses showed that both treatments decreased bilirubin concentrations in the spinal cord lesions, even though the inflammatory infiltrates were extensive (Fig. 3.7 D). In order to exclude any toxicity of ZnPP and TCPOBOP, we administered ZnPP or TCPOBOP daily on the same schedule to normal Lewis rats. No adverse reactions were observed. 3.3.8. Bilirubin treatment does not cause neural cell damage in the CNS Since bilirubin is potentially neurotoxic, we examined the potential CNS cytotoxicity of administered bilirubin, even though the bilirubin-treated mice appeared normal in behavior. Histological studies were performed in LSSC of 100 mg/kg bilirubin-treated mice without EAE symptoms vs normal mice. Morphological examination and quantitation of positively stained neurons (neurofilament"*"), oligodendrocytes (Rip+), and astrocytes (GFAP+) in LSSC sections from bilirubin-treated animals revealed no 131 Figure 3.8. Treatment with bilirubin does not cause neural cell damage in the CNS. ( A ) T o examine the potential cytotoxicity o f administered bi l i rubin i n the C N S , L S S C sections were obtained from normal mice and bilirubin-treated mice without E A E symptoms. The total numbers o f positively stained neurons (neurofilament), oligodendrocytes ( R i p ^ , and astrocytes ( G F A P + ) were counted from nine levels o f L S S C . (B) A x o n a l pathology was examined by immunohistochemical studies with A n t i - p - A P P A b . M y e l i n structure was shown by luxol fast blue staining. Results from one representative donor out o f three are shown in each case. Scale bar for both luxol fast blue staining = 20 urn; Scale bar for p - A P P immunohistochemical staining = 30 um. 132 significant differences from normal animals (Fig. 3.8 A). In addition, in tissues obtained from bilirubin-treated mice, immunohistochemical studies with Anti-0-APP Ab did not show axonal pathology (Fig. 3.8 B), and luxol fast blue staining showed intact myelin structure (Fig. 3.8 B). In conclusion, no toxic effect in spinal cord neural cells was observed after bilirubin treatment. 3.4. DISCUSSON In the present study, we analyzed the immunomodulatory effects of bilirubin, a bile pigment that is abundant in mammalian tissues and serum. Our results clearly showed that bilirubin represents a molecule of immunologic importance. Bilirubin has a powerful suppressive effect on both antigen-specific and polyclonal T cell responses. Bilirubin suppresses T cell reactivity through multiple mechanisms, including inhibition of TCR signaling, downregulation of costimulatory activity, suppression of immune transcription factor activation, and induction of reactive T cell apoptosis when used at high concentrations. By inhibiting activation-induced expression of class II MHC molecules in APCs, it may affect antigen presentation to CD4+ T cells, therefore impair subsequent T cell response. In reactive T cells, bilirubin can causes anergy via its inhibitory effects on costimulatory signaling. The effect of bilirubin on the expression of the key costimulators is specific. It significantly suppresses the upregulation of CD28, B7-1 and B7-2 upon activation, but does not alter the expression of CTLA-4 by reactive T cells. The data also provide the evidence that our findings are not a general phenomenon related to reduction of protein synthesis after bilirubin treatment. In addition, bilirubin can directly interfere 133 with immune transcription factor ( N F - K B ) activation as proliferation of purified T cells in response to anti-CD3 mAb plus anti-CD28 costimulation, which stimulates T cells in an APC independent manner, was also significantly suppressed. Furthermore, in vitro data suggest that bilirubin may also directly block the binding of N F - K B to DNA. Bilirubin has widespread inhibitory effects on protein phosphorylation (Hansen et al., 1996; Taille et al., 2003), which may contribute to its neurotoxicity at high concentrations. It has been shown that bilirubin inhibits protein kinase C, cAMP-dependent, cGMP-dependent, and Ca2+-calmodulin-dependent protein kinases with concentrations ranging from 20 to 125 pM (Sano et al., 1985; Hansen et al., 1996). These kinases initiate and regulate various signal transduction processes including those involved in immune response (Ting and Trowsdale, 2002; Abbas, 2003). Our results demonstrate that suppression of protein phosphorylation also represents an important mechanism by which bilirubin exerts its powerful immunosuppressive effects. Bilirubin can strongly inhibit inducible Stat-1 and I K B phophorylation, which are the prerequisites for CIITA and N F - K B activation, respectively (Baeuerle and Henkel, 1994; Piskurich et al., 1999). Through these effects, bilirubin suppresses class II MHC expression and T cell reactivity. The mechanisms by which bilirubin downregulated activation-induced CD28, B7-1 and B7-2 expression were not thoroughly explored in this study partially because the regulation of these molecules expression is not well established. It is reasonable to hypothesize that similar mechanisms may be involved. In addition, as regards the effects of bilirubin on surface receptors, its direct interaction with cell membranes should also be taken into account since bilirubin can be associated intimately with cell membranes due to its lipophilic nature (Baranano et al., 2002; Ostrow et al., 2004). Bilirubin may bind to 134 cell membranes and thus interfere by a hitherto unknown mechanism with various receptors, involved in the immune reactivity of these cells. For example, Vetvicka's data suggested that binding of bilirubin to the macrophage membrane changed the lipid environment of the plasma membrane, which in turn significantly influenced the expression of some Fc receptors (Kyoizumi et al., 1981; Vetvicka et al., 1985). The action of bilirubin in this respect should be further analyzed and will be the topic of a different study. Only free unconjugated bilirubin can easily enter cells by passive diffusion. One may speculate that this lipophilic property is essential to the effects of bilirubin on both membrane-associated molecules and immune transcription factors. Indeed, consistent with all above findings, our results demonstrated that water-soluble conjugated bilirubin is devoid of immunomodulatory activity although it remains a powerful antioxidant (Wu et al., 1996; Granato et al., 2003). However, it is noteworthy that most of the effects of bilirubin described above were only marginal at low concentrations, for example, at 50 pM, even though at the same concentration, it still significantly inhibited T cell proliferation. It seems that the potent immunosuppressive effect of bilirubin is a consequence of combined activities. Other unidentified mechanisms may also be involved. Further study is required to define a broader spectrum of bilirubin's immunomodulatory actions. Our data indicate that bilirubin directly suppresses T cell response, rather than via the induction of active immunosuppression or immune deviation from a Thl toward a Th2-like response. Bilirubin did not increase the generation of CD4+CD25+ regulatory T cells. The reduced production of IL-10 by reactive T cells after treatment also indicated that bilirubin did not induce IL-10-producing T reg 1 cells. While bilirubin could strongly 135 inhibit Thl cell response, the therapeutic effect was not associated with a shift to Th2 cell polarization. Our results are consistent with previous findings. As we mentioned earlier, high levels of bilirubin can impair the formation of various antibodies in infants (Nejedla, 1970). In recent years, it has also been demonstrated that bilirubin can protect against Th2-associated diseases. For example, Ohrui reported a case of significant relief of asthma symptoms during jaundice (Ohrui et al., 2003). All these data suggest that bilirubin may not enhance Th2 cell immune response. Furthermore, we demonstrate that bilirubin also acts as an immunosuppressant in vivo and inhibits EAE. Bilirubin prevented EAE effectively, and was also active in the therapeutic setting. It halted disease progression even when administered after the onset of clinical EAE. More importantly, in contrast to the traditional immunosuppressive agents such as dexamethasone and cyclosporine A, the therapeutic effect of bilirubin was long-lasting after treatment ceased, and it improved the long-term course of chronic EAE successfully. Analyses of animals with EAE showed that the clinical protection afforded by bilirubin was associated with changes in the PLP-specific autoimmune response. Studies of T cell responses in the spleens demonstrated a clear reduction of antigen-specific proliferation in the bilirubin-treated animals, accompanied by significantly decreased production of both Thl and Th2 cytokines, including IFN-y, IL-2, IL-4, and IL-10. Moreover, bilirubin treatment impaired the ability of PLP-immune T cells to induce EAE by adoptive transfer. In contrast, a-tocopherol did not cause a change in T cell immune function although it could still inhibit clinical EAE as an antioxidant. Therefore, we provide convincing evidence that bilirubin functions as an immunomodulatory agent both in vitro and in vivo. In addition, bilirubin proves to be an 136 important endogenous factor in the animals to defend against this autoimmune disease. Treatment of EAE with ZnPP or TCPOBOP, which inhibits the production of bilirubin and activate its clearance respectively, was fatal to most of the treated animals. The severity of clinical signs was exacerbated severely at the peak period of disease. However, contrary to our expectation, neither ZnPP nor TCPOBOP advanced the onset of EAE. Previous experiments, including ours, have observed that bilirubin system activity substantially increases as EAE progresses, but is not induced at high levels at the early stages of disease (Schluesener and Seid, 2000). We consider that the bilirubin system plays a more important role as the disease progresses to its peak period. This may explain why in our experiments the detrimental effect of ZnPP and TCPOBOP treatments did not reach its maximum until peak EAE. Interestingly, our data indicate that the strong immunosuppressive effect of bilirubin cannot be attributed to its antioxidant activity. Previous studies have demonstrated that ROS play an important role in the proliferation of some types of cell, such as airway and vascular muscle cells (Taille et al., 2003; Ollinger et al., 2005). In certain circumstances, ROS can induce proinflammatory cytokine expression (Li et al., 2004). However, our results suggest that free radicals do not play an essential role in T cell proliferative responses, as several other powerful antioxidants could not mimic the effect of bilirubin to any degree, including conjugated bilirubin, GSH, and a-tocopherol, another potent lipophilic antioxidant. Considering that biliverdin is a nontoxic easily excretable product, and is also a good antioxidant (Wu et al., 1991), why should mammals have evolved biliverdin reductase to convert biliverdin to bilirubin is not well understood. One hypothesis holds that bilirubin can enter the cells more readily than biliverdin. However, 137 the low intracellular concentrations of bilirubin under physiological conditions (about 20 nM, <0.1% the levels of GSH), and the fact that GSH represents the principal intracellular small molecule antioxidant do not support this hypothesis (Baranano et al., 2002). Based on all the above data, it is tempting to speculate that bilirubin may also represent an important endogenous factor in mammals to defend against autoimmunity. In recent decades, the recognition of bilirubin has been transformed from that of a waste product without beneficial effects, to that of a biologically important antioxidant with a wide range of protective actions. Increasing evidence has suggested that bilirubin plays an important protective role in a variety of diseases. Epidemiological studies have found that serum bilirubin levels are inversely related to atherosclerosis and carotid plaque formation (Novotny and Vitek, 2003). Individuals with Gilbert's syndrome have a decreased incidence of ischemic heart disease (Vitek et al., 2002). Patients with longstanding amyotrophic lateral sclerosis have lower bilirubin levels (Ilzecka and Stelmasiak, 2003). Here we demonstrate that bilirubin is an important immunomodulator of functional significance, and these data underline the therapeutic potential of this molecule in multiple sclerosis and other autoimmune diseases. 138 3.5. R E F E R E N C E S : Abbas AK (2003) Cellular and molecular immunology, 5th Edition. Philadelphia: Saunders. Bach FH (2005) Heme oxygenase-1: a therapeutic amplification runnel. Faseb J 19:1216-1219. Baeuerle PA, Henkel T (1994) Function and activation of NF-kappa B in the immune system. Annu Rev Immunol 12:141-179. Baranano DE, Rao M, Ferris CD, Snyder SH (2002) Biliverdin reductase: a major physiologic cytoprotectant. Proc Natl Acad Sci U S A 99:16093-16098. Dennery PA, Seidman DS, Stevenson DK (2001) Neonatal hyperbilirubinemia.-N Engl J Med 344:581-590. Fontenot JD, Gavin MA, Rudensky AY (2003) Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol 4:330-336. Gimmi CD, Freeman GJ, Gribben JG, Gray G, Nadler LM (1993) Human T-cell clonal anergy is induced by antigen presentation in the absence of B7 costimulation. Proc Natl Acad Sci IJ S A 90:6586-6590. Granato A, Gores G, Vilei MT, Tolando R, Ferraresso C, Muraca M (2003) Bilirubin inhibits bile acid induced apoptosis in rat hepatocytes. Gut 52:1774-1778. Haga Y, Tempero MA, Kay D, Zetterman RK (1996) Intracellular accumulation of unconjugated bilirubin inhibits phytohemagglutin-induced proliferation and interleukin-2 production of human lymphocytes. Dig Dis Sci 41:1468-1474. 139 Hansen TW, Mathiesen SB, Walaas SI (1996) Bilirubin has widespread inhibitory effects on protein phosphorylation. Pediatr Res 39:1072-1077. Harding FA, McArthur JG, Gross JA, Raulet DH, Allison JP (1992) CD28-mediated signalling co-stimulates murine T cells and prevents induction of anergy in T-cell clones. Nature 356:607-609. Ilzecka J, Stelmasiak Z (2003) Serum bilirubin concentration in patients with amyotrophic lateral sclerosis. Clin Neurol Neurosurg 105:237-240. Kapitulnik J (2004) Bilirubin: an endogenous product of heme degradation with both cytotoxic and cytoprotective properties. Mol Pharmacol 66:773-779. Khattri R, Cox T, Yasayko SA, Ramsdell F (2003) An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat Immunol 4:337-342. Kirkby KA, Adin CA (2006) Products of heme oxygenase and their potential therapeutic applications. Am J Physiol Renal Physiol 290:F563-571. Kuo CT, Leiden JM (1999) Transcriptional regulation of T lymphocyte development and function. Annu Rev Immunol 17:149-187. Kyoizumi S, Kannagi R, Masuda T (1981) Membrane expression of Fc-receptors in cultured leukemic cell lines. I. Induction of Fc-receptor in undifferentiated types of cells after passive modulation of lipid viscosity. J Immunol 127:2252-2256. Li X, Chen H, Epstein PN (2004) Metallothionein protects islets from hypoxia and extends islet graft survival by scavenging most kinds of reactive oxygen species. J Biol Chem 279:765-771. Liu Y, Zhu B, Wang X, Luo L, Li P, Paty DW, Cynader MS (2003) Bilirubin as a potent antioxidant suppresses experimental autoimmune encephalomyelitis: implications 140 for the role of oxidative stress in the development of multiple sclerosis. J Neuroimmunol 139:27-35. Machlin LJ, Bendich A (1987) Free radical tissue damage: protective role of antioxidant nutrients. Faseb J 1:441-445: Maines MD (2000) The heme oxygenase system and its functions in the brain. Cell Mol Biol (Noisy-le-grand) 46:573-585. Nakao A, Otterbein LE, Overhaus M, Sarady JK, Tsung A, Kimizuka K, Nalesnik MA, Kaizu T, Uchiyama T, Liu F, Murase N, Bauer AJ, Bach FH (2004) Biliverdin protects the functional integrity of a transplanted syngeneic small bowel. Gastroenterology 137:595-606. Nejedla Z (1970) The development of immunological factors in infants with hyperbilirubinemia. Pediatrics 45:102-104. Novotny L, Vitek L (2003) Inverse relationship between serum bilirubin and atherosclerosis in men: a meta-analysis of published studies. Exp Biol Med (Maywood) 228:568-571. Ohrui T, Yasuda H, Yamaya M, Matsui T, Sasaki H (2003) Transient relief of asthma symptoms during jaundice: a possible beneficial role of bilirubin. Tohoku J Exp Med 199:193-196. * Ollinger R, Bilban M, Erat A, Froio A, McDaid J, Tyagi S, Csizmadia E, Graca-Souza AV, Liloia A, Soares MP, Otterbein LE, Usheva A, Yamashita K, Bach FH (2005) Bilirubin: a natural inhibitor of vascular smooth muscle cell proliferation. Circulation 112:1030-1039. 141 Ostrow JD, Pascolo L, Shapiro SM, Tiribelli C (2003) New concepts in bilirubin encephalopathy. Eur J Clin Invest 33:988-997. Ostrow JD, Pascolo L, Brites D, Tiribelli C (2004) Molecular basis of bilirubin-induced neurotoxicity. Trends Mol Med 10:65-70. Piskurich JF, Linhoff MW, Wang Y, Ting JP (1999) Two distinct gamma interferon-inducible promoters of the major histocompatibility complex class II transactivator gene are differentially regulated by STAT1, interferon regulatory factor 1, and transforming growth factor beta. Mol Cell Biol 19:431-440. Raine CS (1994) The Dale E. McFarlin Memorial Lecture: the immunology of the multiple sclerosis lesion. Ann Neurol 36 Suppl:S61-72. Rohn WM, Lee YJ, Benveniste EN (1996) Regulation of class II MHC expression. Crit Rev Immunol 16:311-330. Sakaguchi S (2005) Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self. Nat Immunol 6:345-352. Sano K, Nakamura H, Matsuo T (1985) Mode of inhibitory action of bilirubin on protein kinase C. Pediatr Res 19:587-590. Schluesener HJ, Seid K (2000) Heme oxygenase-1 in lesions of rat experimental autoimmune encephalomyelitis and neuritis. J Neuroimmunol 110:114-120. Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames BN (1987) Bilirubin is an antioxidant of possible physiological importance. Science 235:1043-1046. Taille C, Almolki A, Benhamed M, Zedda C, Megret J, Berger P, Leseche G, Fadel E, Yamaguchi T, Marthan R, Aubier M, Boczkowski J (2003) Heme oxygenase 142 inhibits human airway smooth muscle proliferation via a bilirubin-dependent modulation of ERK1/2 phosphorylation. J Biol Chem 278:27160-27168. Tenhunen R, Marver HS, Schmid R (1968) The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase. Proc Natl Acad Sci U S A 61:748-755. Ting JP, Trowsdale J (2002) Genetic control of MHC class II expression. Cell 109 Suppl:S21-33. Vetvicka V, Miler I, Sima P, Taborsky L, Fornusek L (1985) The effect of bilirubin on the Fc receptor expression and phagocytic activity of mouse peritoneal macrophages. Folia Microbiol (Praha) 30:373-380. Vitek L, Jirsa M, Brodanova M, Kalab M, Marecek Z, Danzig V, Novotny L, Kotal P (2002) Gilbert syndrome and ischemic heart disease: a protective effect of elevated bilirubin levels. Atherosclerosis 160:449-456. Wu TW, Carey D, Wu J, Sugiyama H (1991) The cytoprotective effects of bilirubin and biliverdin on rat hepatocytes and human erythrocytes and the impact of albumin. . Biochem Cell Biol 69:828-834. Wu TW, Fung KP, Wu J, Yang CC, Weisel RD (1996) Antioxidation of human low density lipoprotein by unconjugated and conjugated bilirubins. Biochem Pharmacol 51:859-862. 143 C H A P T E R 4: T R E A T M E N T O F E X P E R I M E N T A L A U T O I M M U N E E N C E P H A L O M Y E L I T I S B Y T H E N E W A G E N T : B IL IVERDIN R E D U C T A S E 1 1 A version of this chapter has been published. Liu Y, Liu J, Tetzlaff W, Paty DW, Cynader MS. (2006) Biliverdin reductase, a major physiologic cytoprotectant, suppresses experimental autoimmune encephalomyelitis. Free Radic Biol Med. 40(6):960-7. 144 4 .1. INTRODUCTION As I demonstrated in Chapter 2 and Chapter 3, bilirubin acts as a powerful antioxidant and a potent immunosuppressant both in vitro and in vivo. Due to its multiple biological functions, bilirubin prevented both acute and chronic EAE effectively, and could also halt further signs of ongoing disease. The strong therapeutic effect of bilirubin in EAE was observed without notable side effects. Interestingly, the therapeutic effect of bilirubin treatment was long lasting, and it improved the long-term course of EAE much more successfully than the treatment with a traditional immunosuppressant, dexamethasone. All these data indicate that bilirubin may represent a new effective strategy for the treatment of MS and other stress or immune-mediated diseases. Indeed, animal biles (Niu HuangX-have long been used in traditional Chinese medicine for therapy of many diseases including bronchitis, asthma and hypersensitivities. Unfortunately, for multiple biological reasons, such as its insolubility and its toxicity at high concentrations, the utility of bilirubin in the clinic is still limited. Alternative strategies or molecular engineering may be considered. Recent studies show that the potent physiologic antioxidant actions of bilirubin reflect an amplification cycle whereby bilirubin, acting as an antioxidant, is itself oxidized to biliverdin and then recycled back to bilirubin by biliverdin reductase (BVR) (Baranano et al, 2002). Compared with* bilirubin, BVR is water-soluble and nontoxic. Since BVR physiologically regenerates bilirubin in a catalytic cycle, and bilirubin represents one of the most abundant endogenous antioxidants in mammalian serum and tissues, I hypothesized that BVR might serve as a new useful pharmacological target for the 145 treatment of diseases, in which oxidative stress plays an important pathological role, such as MS/EAE. In this study, we demonstrate that treatment with BVR ameliorates both clinical and pathological signs of EAE more efficiently than treatments with traditional antioxidant enzymes. In vitro, interference with cellular BVR activity by siRNA elicits greater increases in reactive oxygen species and cell death than interference with the activities of other antioxidant enzymes. Further studies suggest that BVR exerts potent cytoprotective effect by the multifactorial functions of its only end product bilirubin, including anti-complement activity, and an activity that inhibits antibody-dependent cell-mediated cytotoxicity of lymphocytes. Interestingly, BVR regenerates bilirubin and amplifies its action in a redox cycle without significantly increasing the biological concentration of bilirubin, which is cytotoxic at high levels. 4.2. M A T E R I A L S A N D M E T H O D S 4.2.1. Induction of E A E and histological studies Male Lewis rats with body weights around 200 g were purchased from Charles River Laboratories (Laval, Canada). All studies were approved by the Animal Care Committee of the University of British Columbia. EAE was induced in Lewis rats by a single subcutaneous injection in the abdomen with 50 pg guinea pig myelin basic protein (MBP) (Sigma, Saint Louis, MO, USA) emulsified in 100 pi complete Freund's adjuvant (Sigma) containing 10 mg/ml heat-inactivated Mycobacterium tuberculosis H37Ra (Difco, Detroit, MI, USA). The rats were monitored daily after immunization. Clinical EAE was scored in a double-blind fashion as: 0, normal; 1, tail limpness; 2, hind limb 146 paraparesis with clumsy gait; 3, hind limb paralysis; 4, tetraplegia; 5, moribund. For histological studies, rats were euthanized and perfused transcardially with 4% paraformaldehyde in 0.1 M phosphate buffered saline (PBS). The lumbosacral spinal cords were immediately removed, embedded in Tissue-Tek, and frozen with 2-methylbutane at -80 C. Serial sections were cut at 10 pm on a Reichert-Jung 2800 Frigocut cryostat. The sections were stained with hematoxylin-eosin for histopathological examination. The severity of inflammation was graded in a double-blind fashion as follows: 0, no inflammation; 1, mild meningeal inflammation and/or rare parenchymal infiltration; 2, moderate meningitis, sub-meningeal infiltration, and small scattered perivascular infiltration; 3, severe meningitis, parenchymal infiltration and/or multiple perivascular infiltration; 4, foci of necrosis and/or neutrophilic infiltration (Cao et al., 2000). Immunostaining was performed following the established protocol (Liu et al., 2003). Rabbit anti-BVR (StressGen, Victoria, Canada) and rabbit anti-bilirubin (Cocalico, Reamstown, PA, USA) were used at 1:500 dilution. An antibody against 8-isoporstane (Oxford Biomedical Research, Oxford, MI, USA) at 1:400 was used for analyses of oxidative damage in lesions. For double-immunostaining, sections were incubated first with anti-BVR followed by antibodies against macrophage differentiation antigen EDI (Accurate, Westbury, NY, USA), astrocyte antigen GFAP (Accurate) or neurofilaments (Sternberger, Lutherville, MD, USA). 4.2.2. Intrathecal injection and treatment regimen Four-week osmotic minipumps (Alzet, Cupertino, CA, USA) were each filled with 200 pi artificial cerebrospinal fluid (aCSF) supplemented with 20 pg gentamicin. The 147 pumps were connected to a 5-cm PE-10 polyethylene tube (ReCathCo, Allison Park, PA, USA). To implant the pumps, a small opening was made in the atlanto-occipital membrane overlying the cisterna magna, and the 5-cm tube was inserted caudally into the subarachnoid space. The minipumps were then embedded subcutaneously between the scapulae. On the fifth day after surgery, rats were immunized with MBP. From 8 to 12 days after immunization (DAI), freshly prepared antioxidant enzymes were delivered intrathecally once daily through the polyethylene tube using a Hamilton microsyringe. The minipump was then reconnected to keep the tube clear. Three groups of rats were treated with BVR (StressGen) at different doses that, from low to high, were 2.5 pg/day, 10 pg/day, and 40 pg/day, respectively. Animals were treated with SOD (Sigma), catalase (Sigma), glutathione (GSH) reductase (Sigma), or HO-1 (StressGen) with the same regime at increasing doses until maximal effects were achieved. All the antioxidant enzymes were dissolved in aCSF supplemented with 80 p.g/100 pi rat albumin and 10 pg/100 pi gentamicin. For control injections, the solution was the same, only without the enzymatic treatment. Since BVR from StressGen was prepared in TE buffer (0.01 M Tris-HCl, 1 mM EDTA), another group of rats were treated with TE buffer as a control. 4.2.3. Cell culture and viability measurements SH-SY5Y human neuroblastoma cells (ATCC, Manassas, VA, USA) were cultured in DMEM (Invitrogen, Ontario, Canada) supplemented with 10% fetal bovine serum and glutamine. Cells were plated into 24-well plates at a density of 50,000 cells/well. The cultures were incubated at 37 C in a humidified atmosphere of 5% C O 2 and 95% air. 148 After the indicated treatments, cell viability was measured using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) colorimetric assay. 4.2.4. R N A interference and antioxidant enzyme activity inhibition RNA interference (RNAi) of the BVR transcript was performed as described in earlier work (Elbashir et al., 2001). Briefly, small RNAi duplexes (Dharmacon, Lafayette, CO, USA) were targeted to the human BVR transcript (GAGGUGGAGGUCGCCUAUAUU). Mock RNAi duplexes (Dharmacon) were targeted to unrelated genes, whose sequences were not found in the human EST database (UACCCCAUGGCAUUGUCAUUU). RNA oligonucleotides were transfected into SH-SY5Y cells at 30-50% confluency by using oligofectamine (Invitrogen) according to the manufacturer's instructions. SOD, catalase and HO-1 activities were suppressed by the specific inhibitors, diethyldithiocarbamate (DDC) (Sigma), 3-amino-l,2,4-triazole (3-AT) (Sigma), and tin-mesoporphyrin (SnMP) (Porphyrin Product, Logan, UT) respectively. Intracellular GSH levels were reduced with L-Buthionine-sulfoximine (BSO) (Sigma), an irreversible inhibitor of GSH synthesis. 4.2.5. Western blotting and enzyme assays BVR protein expression in SH-SY5Y cells was examined by western blotting analyses 48 hours after transfection with RNAi. Transfected cells grown in 24-well plates were trypsinized and harvested in SDS sample buffer. Equal amounts of total protein were separated on 12.5% polyacrylamide gels and transferred to nitrocellulose membranes. Standard immunostaining was carried out using the ECL chemiluminescence 149 technique (Amersham Pharmacia, Quebec, Canada). Rabbit anti-BVR antibody was used at 1:1,000 dilution. Biliverdin reductase activity was assayed in reactions containing 50 mM Tris (pH 8.7), 100 pM NADPH (Sigma), 10 pM biliverdin (Porphyrin Products), and cell lysate. The reaction was started by addition of lysate, mixed, and maintained at 37°C for 1-2 hours. The rate of reaction was determined by monitoring the change in absorbance at 453 nm in a spectrophotometer. SOD, catalase, HO-1 activities and GSH level in SH-SY5Y cells were determined as described previously (Aebi, 1984; Nowell et al., 1998; Sasaki et al., 2000; Senft et al., 2000). 4 . 2 . 6 . M e a s u r e m e n t o f i n t r a c e l l u l a r r e a c t i v e o x y g e n s p e c i e s ( R O S ) Intracellular ROS levels were measured using 2',7'-Dichlorodihydrofluorescein diacetate (H2DCF, Sigma). H2DCF is a nonfluorescent compound that is loaded into cells as a cell-permeable ester. On cleavage by intracellular esterases, it can be oxidized to a fluorescent product by ROS. For the SH-SY5Y cultures, cells were incubated with 5 pM H2DCF for 30 minutes at 37°C. The cultures were washed three times with PBS, trypsinized, and resuspended in Opti-MEM (Invitrogen). The rate of oxidation of the dye for 10,000 cells was measured in a spectrometer with excitation at 488 nm and emission at 525 nm. 4 . 2 . 7 . H e m o l y s i s a n d a n t i b o d y - d e p e n d e n t c e l l - m e d i a t e d c y t o t o x i c i t y ( A D C C ) A s s a y s The effect of bilirubin (Sigma) on complement-induced hemolysis in the classical pathway was evaluated. Human complement serum (Sigma) at 1:100 dilution was incubated with antibody-sensitized sheep erythrocytes (Sigma) at a concentration of 108 150 cells/ml in gelatin/veronal-buffered saline with Ca 2 + and Mg^+ in the absence or presence of different concentrations of bilirubin (12.5 u.M, 25 pM, 50 uJVl, and 100 L I M ) or GSH (12.5 L I M , 25 (J.M, 5.0 yiM, 100 uM, and 1 mM) for one hour at 37°C with constant shaking. The hemolytic reaction was stopped with ice cold NaCl and after centrifugation at 2000 rpm for 5 minutes, the absorbance of the supernatants was measured at 410 nm. Hemolysis (%) was determined by comparison with the absorbance of erythrocytes completely lysed by distilled water. The effect of bilirubin on ADCC activities of lymphocytes was assessed as described previously using 51Cr-labeled human red blood cells (RBC) as target cells (Coligan, 2001). Rabbit anti-human RBC antibody (Accurate Chemicals, Westbury, NY) treated or untreated 51Cr-labeled RBC were mixed with lymphocytes in plastic tubes in the absence or presence of different concentrations of bilirubin (50 uM, 100 u.M, and 150 uM) or GSH (50 uM, 100 jaM, 150 uM, and 1 mM). The percentage lysis was calculated using the formula: % lysis = (experimental cpm -spontaneous cpm)/(control cpm - spontaneous cpm) x 100. 4.2.8. Statistical analysis All data are presented as mean ± SEM. Data on the effects of antioxidant enzyme treatments and cell'culture experiments were analyzed using two-sample t tests. Data on anti-complement and antibody-dependent cell-mediated cytotoxicity assays were analyzed using ANOVA with Fisher's PLSD post hoc tests for multiple comparisons./? < 0.05 was considered statistically significant. 151 4 . 3 . R E S U L T S 4 . 3 . 1 . I n d u c t i o n o f B V R i n E A E In all six control rats with clinical EAE, a marked increase in BVR immunoreactivity was observed in the inflamed lesions of the spinal cords when compared with normal tissue (Fig. 4.1). BVR was present in both white and gray matter of the spinal cord. Double-staining immunohistochemical analyses showed that BVR was expressed in diverse cell populations, including astrocytes, neurons, and the infiltrating inflammatory cells including macrophages (data not shown). BVR activity was detected from the onset of EAE symptoms to the peak of illness (Fig. 4.IB and C). Even after cessation of the clinical signs of disease, BVR expression was still found in slowly resolving lesions (Fig. 4.ID). Since BVR physiologically regenerates bilirubin, and bilirubin represents a potent endogenous antioxidant (Baranano et al., 2002), these results suggest that BVR may play an important protective role in EAE. 4 . 3 . 2 . E f f e c t s o f B V R v s . t r a d i t i o n a l a n t i o x i d a n t e n z y m e t r e a t m e n t s o n E A E We then tried treatment of EAE with BVR, and compared its effect with that of several traditional antioxidant enzymes, including SOD, catalase, GSH reductase, and HO-1. The results with the various treatment protocols are summarized in Table 4.1. All non-treated and control-treated rats developed severe EAE starting from 10-11 DAI. Symptoms peaked at around 13 DAI. The animals then recovered completely without treatment by 17-18 DAI. Vehicle treatments including TE buffer treatment showed no influence on the course or severity of disease. In contrast, BVR, catalase, and HO-1 all 152 Fig. 4.1. Induction of BVR in E A E . The expression of BVR in the inflamed lesions of spinal cords was detected by immunohistochemical studies. BVR activity is significantly increased in EAE from the onset (B) to the peak of illness (C) when compared with normal tissue (A). Even after cessation of clinical disease, a high level of BVR expression is still present in the resolving lesions (D) . Scale bar for A-D = 50 pm. 1 Table 4.1. Effects of BVR vs. tradit ional antioxidant enzymes treatments on E A E in Lewis rats Duration Maximum Histological Groups Onset (DAI) of illness clinical score grade Nontreated 10.0 ± 0 . 2 (8) 7.0 ± 0 . 2 (8) • 3.0 ±0 .1 (8) 2.6 ± 0.2 (6) Control - treated 9.8 ± 0 . 3 (10) 7.1 ± 0 . 2 ( 1 0 ) 2.9 + 0.2(10) 2.7 ±0 .1 (6) TE buffer - treated 9,7 ± 0.4 (6) 7.0 ±0 .3 (6) 2.7 ± 0.4 (6) N/A BVR 2.5 ug/day i.t. 11.3 ± 0 . 3 (8)* 6.5 ± 0 . 4 (8) 2.8 ± 0 . 2 (8) N/A 10 ug/day i.t. 12.3 + 0.5(8)* 5.5 ± 0 . 4 (8)* 1.5 ± 0 . 2 (8)* 1.6 ±0 .3 (6)' 40 ng/day i.t. 12.5 + 0.6(4)* 5.4 ±0 .3 (4)* 1.5 ± 0 . 3 (4)* N/A HO-1 2.5 ug/day i.t. 11.1 ± 0 . 3 (8)' 6.7 ±0 .3 (8) 2.8 ± 0.2 (8) N/A 10 ug/day i.t. 11.3 ± 0 . 3 (8)** 6.4 ± 0.3 (8)** 2.1 ± 0 . 2 (8)** 1.7 ± 0 . 2 (6)' 40 u,g/day i.t. 11.5 ± 0 . 6 (4)' 6.4 ± 0 . 2 (4)'* 2.0 ± 0.4 (4)' N/A GR 10 ug/day i.t. 10.2 ± 0 . 4 (8) 6.9 ±0 .3 (8) 2.9 ± 0 . 2 (8) N/A 40 u.g/day i.t. 10.7 ± 0 . 4 (8)'* 6.8 ± 0 . 4 (8)*. 2.6 ± 0.4 (8)* 2.3 ± 0 . 4 (6) 160 p.g/day i.t. 10.7 ± 0 . 5 (8)* 6.8 ± 0 . 4 (8)* 2.7 ± 0.4 (8)* N/A Cat 10 ug/day i.t. 11.2 ± 0 . 2 (8)* 6.4 ± 0.3(8)' 2.9 ± 0 . 2 (8) N/A 40 ug/day i.t. 11.4 ± 0 . 4 (8)* 6.3 ±0 .3 (8)** 2.1 ±0 .2 (8 ) '* 1.7 ± 0 . 3 ( 6 ) ' 160 ug/day i.t. 11.4 ± 0 . 3 (8)* 6.3 ± 0 . 4 (8)* . 2.1 ±0 .1 (8)** N/A SOD 10 ug/day i.t. 10.1 ± 0 . 2 (8) 7.0 ± 0.2 (8) 3.1 ±0 .1 (8) N/A 40 ug/day i.t. 10.0 ± 0 . 3 (8)* 7.1 ± 0 . 2 (8)* 2.9 ± 0 . 2 (8)" 2.5 ± 0 . 2 (6)* 160 ug/day i.t. 10.2 + 0.4 (8)* 7.0 ±0 .3 (8)* . 3.0 ± 0 . 2 (8)* N/A Table 4.1. Rats in all groups were immunized with MBP as described in Materials and Methods, and were observed until 30 DAI. Freshly prepared antioxidant enzymes were given once daily by intrathecal injection from 8 to 12 DAI. Control rats received vehicle or TE buffer injections of equal volume. Data are presented as mean ± s.e.m. Number in parentheses indicates the number of rats studied. Statistical comparison was made using two-sample t tests. BVR suppresses EAE more efficiently than traditional antioxidant enzymes. * p < 0.05 vs. control; #p<0.05 vs. BVR-treated group. 154 suppressed EAE significantly. However, in our experiments, we did not observe significant effects of SOD or GSH reductase treatment on EAE even with higher doses (Table 4.1). Analysis of treatment with different doses of BVR between 8 and 12 DAI demonstrated that as little as one dose of 2.5 M-g/day of BVR could delay the onset of EAE (p < 0.01). A daily dose of 10 \xg of BVR significantly ameliorated the clinical signs (p < 0.01), and almost reached its maximal treatment effect on EAE. BVR treatment with further increased dose of 40 u-g/day did not reduce disease progression more successfully. Similar results were observed for the treatments with catalase or HO-1 with the same therapeutic regime (Table 4.1). However, statistical analyses clearly show that BVR treatment delayed the onset, reduced the duration, and ameliorated the severity of clinical EAE more efficiently than did treatments with the traditional antioxidant enzymes. Some of BVR-treated rats showed only minor difficulty in tail movement for several days. The therapeutic effects of BVR in EAE were observed without notable side effects. Pathological examinations were performed in animals that were treated with control solution, and also those treated with antioxidant enzymes at moderate doses (Table 4.1). All control-treated rats at peak EAE developed severe inflammation in the spinal cord lesions with average histological grade 2.7 ± 0.1. In rats that were treated with BVR, catalase, or HO-1 and that developed mild EAE, the degree of inflammation in the lesions was also milder, correlating well with the alleviated EAE symptoms. However, there was no significant difference in inflammatory grade between SOD or GSH reductase-treated and control groups. To assess whether BVR improved the disability in EAE because of its antioxidant activity, we examined the free radical damage in lesions by determining the level of 8-isoprostane, which has been considered as a sensitive and reliable marker 155 of lipid peroxidation. Immunohistological studies demonstrated that in comparison to the control group, there was significantly less 8-isoprostane staining in the spinal lesions in BVR-treated rats with mild EAE (Fig. 4.2B vs. A). The results suggest that BVR acts as an antioxidant in the treatment of EAE. Since BVR regenerates bilirubin in a redox cycle, we considered that BVR might amplify the action of bilirubin without significantly increasing the concentration of bilirubin. Our results demonstrate that this is indeed the case. In immunohistological studies, no significantly higher bilirubin concentration was observed in spinal cords of BVR-treated rats when compared with the control rats (Fig. 4.2Dvs. C). 4.3.3. Cytoprotective effect of BVR against oxidative stress in vitro To confirm the strong antioxidant effect of BVR, we compared the activity of BVR against free radicals in SH-SY5Y cell cultures with the traditional antioxidant systems mentioned above. We used RNAi to deplete SH-SY5Y cells of BVR, leading to 85-90% reduction in BVR expression (Fig. 4.3A) and catalytic activity 48 hours after transfection. During the same period, the specific inhibitors DDC at 10 pM, 3-AT at 10 mM and SnMP at 75 pM were shown to suppress > 90% of SOD, catalase,. and HO-1 activity respectively. Intracellular GSH level was reduced > 95% by BSO at 2.5 mM. If BVR represents an important physiologic antioxidant, its depletion should influence ROS levels. Indeed, SH-SY5Y cells deficient in BVR manifested significantly increased ROS levels measured by H2DCF (Fig. 4.3B), resembling the earlier observations (Baranano et al., 2002). 3-AT and BSO treatments of SH-SY5Y cells also led to increases in ROS 156 Fig. 4.2. Effect of BVR treatment on oxidative damage and bilirubin concentration. The oxidative damage in spinal cord lesions of vehicle-treated (A) and BVR-treated EAE rats (B) was examined by immunohistochemical studies using an antibody against 8-isoprostane, an important product of lipid peroxidation. The bilirubin concentration in spinal cords of vehicle-treated (C) and BVR-treated EAE rats (D) was also examined by immunohistochemical studies using an antibody against bilirubin. BVR effectively reduces oxidative injury in lesions while it does not significantly increase the concentration of bilirubin. Scale bar for A-B = 50 pm. Scale bar for C-D = 50 pm. 157 concentration, but less than the augmentation produced by BVR depletion {p < 0.05 for each case). Unexpectedly, inhibition of HO-1 activity in SH-SY5Y cell cultures resulted in a slight decrease in ROS concentration. We further exposed SH-SY5Y cells to additional oxidative stress induced by 200 L I M H2O2. The results showed that BVR depletion increased the sensitivity of the cells to H202-elicited cell death to a greater extent than did interference with the traditional antioxidant systems (Fig. 4.3C). To ascertain whether the antioxidant actions of endogenous BVR physiologically protect cells, we monitored the viability of SH-SY5Y cells 96 hours after transfection with RNAi for BVR. As indicated in Fig. 4.3D, depletion of BVR reduced cell viability by > 60%, substantially more than the results produced by BSO, 3-AT, DDC and SnMP treatments (p < 0.01 for each case). Similar to bilirubin, GSH is also considered a.major physiological antioxidant in vivo (Meister, 1994). Although as shown above, BVR depletion resulted in higher tissue levels of ROS and rendered the cells a little more sensitive to oxidative challenge than GSH depletion, it should be noted that the differences were not comparable to the substantial differences in cell viability-reduction they caused under same conditions (Fig. 4.3B and C vs. D). In recent years, accumulating evidence, including ours just shown in previous chapters, suggestes that bilirubin, in addition to its strong antioxidant effect, also possesses other beneficial effects, such as the immunomodulatory actions (Vetvicka et al., 1991). We considered that BVR might also exert its powerful cytoprotective effect by multiple functions of its only end product, bilirubin. Since other pathologic factors, such as complement and autoantibodies, also play an important role in the final effector stages 158 Fig. 4.3. Effects of depletion of BVR vs. traditional antioxidant enzymes activities in SH-SY5Y cells on ROS production, sensitivity to oxidative stress, and cell viability. BVR was depleted by RNAi; SOD, catalase and HO-1 activities were inhibited by DDC, 3-AT, and SnMP respectively; Intracellular GSH was reduced by BSO. (A) Expression of the BVR protein is significantly decreased 48 hours after transfection with BVR RNAi. (B) Intracellular ROS levels are higher in SH-SY5Y cells deficient in BVR activity than in traditional antioxidant systems activities. ROS levels were measured using H 2 D C F . (C) Cells deficient in BVR or GSH are more sensitive to an oxidative challenge than cells deficient in SOD, catalase or HO-1 activities. Thirty-six hours after transfection, the cells were treated with H2O2 and cell survival was measured after 24 hours of H2O2 incubation. (D) Cells depleted of BVR are markedly less viable 96 hours after transfection. Statistical comparison was made using two-sample / tests. * p < 0.01 vs. control; # p < 0.05 vs. BVR RNAi group. 159 of EAE, we chose to examine anti-complement and anti-ADCC activities of bilirubin in comparison with GSH. 4.3.4. E f f e c t s o f b i l i r u b i n v s . G S H o n h e m o l y t i c a c t i v i t y o f c o m p l e m e n t The two agents were tested at increasing concentrations below the toxic dosage. A dose-response inhibition of complement-dependent hemolysis in the classical pathway was observed in the presence of bilirubin (F(4,35) - 136.88,/? < 0.01, Fig. 4.4). Bilirubin at a low concentration of 50 p.M almost achieved its maximal effect, and efficaciously reversed hemolysis induced by complement (p < 0.01). Spectrometric analysis confirmed the intactness of bilirubin in the mixtures exhibiting inhibition, suggesting that the anti-complement action of bilirubin was not due to the presence of its breakdown products. There was also a slight inhibition of complement-dependent hemolysis by GSH at high concentration, 1 mM (p < 0.05). However, the effect was much less than that observed with bilirubin even at much lower concentrations. 4.3.5. A c t i o n s o f b i l i r u b i n v s . G S H a g a i n s t A D C C a c t i v i t i e s o f l y m p h o c y t e s The effects of bilirubin vs. GSH on ADCC were examined using 51Cr-labeled human RBC as target cells, and the results are summarized in Table 4.2. Treatment with bilirubin resulted in a dose-dependent decrease of ADCC activities of lymphocytes (F(3,28) = 18.81, p < 0.01), with concentrations higher than 50 oM significantly inhibiting ADCC activity. The results were in sharp contrast to those observed with reduced GSH at the same concentrations. No significant inhibitory effect of GSH on ADCC was found even at much higher concentration, 1 mM. 160 100 -c nd 80 • 0 CL Q) "O </) 60 -C 0 O 40 -E E CD (U CL .c 20 -E o O 0 -Treatment concentration (ixM) F i g . 4.4. E f f e c t s o f b i l i r u b i n v s . G S H o n h e m o l y t i c a c t i v i t y o f c o m p l e m e n t i n t h e c l a s s i c a l p a t h w a y . Antibody-sensitized sheep erythrocytes were lysed with diluted human complement serum in the presence of bilirubin or GSH. Analysis of variance (ANOVA) indicated that bilirubin suppresses complement-dependent hemolysis significantly more effectively than GSH (F(8, 63) = 98.23,p < 0.01). * /? < 0.01 vs. control. 161 Table 4.2. Effects of bilirubin vs. GSH on the antibody-dependent cell-mediated cytotoxic activities of lymphocytes Samples Concentrations % Lysis of control value Control 100.0 ±5.4 Bilirubin 50 uM 88.8 + 4.5 100 uM 66.2 + 3.5* 150 uM 56.8 ±5.9* GSH . 50 uM 98.9 ±3.5 100 pM 102.9 ±6.7 150 ixM 103.7 ±4.8 1 mM 96.6 ±3.7 Table 4.2. The effects of bilirubin vs. GSH on ADCC activities of lymphocytes were performed using 51Cr-labeled human red blood cells (RBC) as target cells. Data are presented as mean ± s.e.m. One-factor ANOVA revealed the significant inhibitory effect of bilirubin (F(3,28) = 18.81, p < 0.01), but not GSH, on ADCC activities of lymphocytes. * p < 0.01 vs. control. 162 4.4. DISCUSSION Our results clearly showed that BVR is strongly expressed in EAE. Treatment with BVR suppressed EAE more efficiently than treatments with traditional antioxidant enzymes, including SOD, catalase, GSH reductase and HO-1, some of which are commonly used in the clinic. Histopathological studies demonstrated that oxidative injury is a prominent feature of this demyelinating disease, and that the treatment effect of BVR was related to its antioxidant action. Interestingly, BVR reduced the free radical damage in lesions without significantly increasing the biological concentration of bilirubin, which is cytotoxic at high levels. In our studies, SOD or GSH reductase treatment did not show significant effects on EAE. Since SOD does not protect against H2O2 toxicity, this result suggests a role for H2O2 in the pathogenesis of EAE. The inefficacy of GSH reductase treatment may suggest the need for many other enzymes for GSH recycling. The potent antioxidant activity of BVR was confirmed in vitro in SH-S Y5 Y cell cultures. Disruption of cellular BVR activity elicited significantly more increases in ROS and cell death than disruption of SOD, catalase, or GSH activities. Contrary to our expectation, inhibition of HO-1 activity actually resulted in a decrease in ROS concentration. Similar results were observed previously (Dennery et al., 1997). It is well known that HO catalyzes heme degradation, generating biliverdin, carbon monoxide, and iron (Tenhunen et al., 1968). Free iron is cytotoxic via the production of hydroxyl radical by Fenton chemistry, perhaps abrogating the beneficial effects of bilirubin (Dennery et al., 1997). Although the coinduction of ferritin may counteract iron release, this reaction does not always accompany HO-1 induction, especially under in vitro conditions (Dennery et al., 1997). 163 Therefore, it is conceivable that there may be circumstances under which HO-1 is not beneficial or even be detrimental. GSH occurs at millimolar concentrations in most tissues and is generally regarded as a major intracellular antioxidant (Meister, 1994). In our experiments, although BVR depletion resulted in higher tissue levels of ROS and rendered the cells a little more sensitive to oxidative challenge than GSH depletion, the differences were not comparable to the substantial differences in cell viability reduction they caused under same conditions. Further studies indicate that bilirubin differs from GSH in that bilirubin has additional strong cytoprotective effects, including anti-complement activity, and an activity that inhibits ADCC. Since in pathological conditions, many other factors, such as complement, also contribute to cell apoptosis, we believe that these results may explain the especially strong protective effects of the bilirubin system observed in our studies. Based on our findings, we consider that BVR exerts its powerful cytoprotective effects by multifactorial functions of its end product, bilirubin. First, bilirubin is an important physiologic antioxidant in mammalian tissues, accounting for the majority of the antioxidant activity of mammalian serum. The redox cycle catalyzed by BVR can amplify the antioxidant action of bilirubin to a great extent. Second, in many pathological conditions, such as EAE, in which multiple factors contribute to the pathogenesis, other beneficial activities of bilirubin, including its anti-complement and immunosuppressive effects, may also be involved in BVR suppression of disease. Organisms employ a multitude of antioxidant mechanisms to defend against ROS (Halliwell and Gutteridge, 1999). For instance, SOD and catalase together convert superoxide to water (Halliwell and Gutteridge, 1999). Transition metal binding proteins, 164 including ferritin and transferrin, act as an important component of the antioxidant system by sequestering iron and copper so that they are not available to drive the formation of hydroxyl radicals (Halliwell and Gutteridge, 1984; Harrison and Arosio, 1996). Heat shock proteins are expressed as a protective mechanism by cells in response to heat shock and stress (Young, 1990). Organisms also contain a complex mixture of small molecule antioxidants, such as bilirubin, GSH and a-tocopherol, which directly react with free radicals and quench their propagation (Halliwell and Gutteridge, 1989). Our results indicate that the BVR/bilirubin system is an important member of these mechanisms. Several striking characteristics can be highlighted for BVR/bilirubin system in comparison with other antioxidant systems. For example, (1) in contrast to many other antioxidants, bilirubin possesses multiple beneficial effects as indicated above in addition to its strong antioxidant activity. (2) Different from HO-1, which can have protective or negative effects, BVR catalyzes the reduction of biliverdin and a redox cycle that produces a single end product, the potent antioxidant, bilirubin. (3) The bilirubin redox cycle and the cycling of GSH resemble each other in many aspects. However, there are also some noticeable differences between the two systems. First, BVR activity is abundant in all tissues. Second, GSH recycling involves a peroxidase and a reductase, as well as distinct enzymes for synthesizing the antioxidant (Halliwell and Gutteridge, 1999). In contrast, bilirubin is oxidized directly to biliverdin without the apparent need of a peroxidase, although the existence of such a peroxidase cannot be altogether discounted (Baranano et al., 2002). All this evidence suggests that bilirubin may cycle at a much higher rate than GSH and promote a more rapid and higher capacity response. (4) In addition, bilirubin, which is highly lipophilic, is associated intimately with cell 165 membranes, where it might prevent lipid peroxidation and protect membrane proteins (Vetvicka et al., 1991; Baranano et al., 2002). The direct interaction of bilirubin molecules with cell membranes may also account for its strong anti-complement and immunosuppressive actions. Bilirubin has long been regarded as a cytotoxic metabolic waste product that needs to be excreted. However, recent decades have witnessed a burgeoning of interest in its physiological significance. In mammals, after HO catalyzes heme catabolism, biliverdin is readily reduced by BVR to bilirubin, although biliverdin would seem to be an appropriate end product of the pathway, nontoxic and being easily excreted (McDonagh, 2001; Baranano et al., 2002). Thus, this reduction product and the enzyme that produces it may be physiologically important. Indeed, increasing in vivo evidence suggests that bilirubin plays a key role to protect against a variety of diseases. A prospective cohort study has found that total bilirubin levels are inversely related to cardiovascular diseases (Djousse et al., 2001). Patients with Gilbert's syndrome, in which defective bilirubin conjugation results in an asymptomatic hyperbilirubinemia, have a decreased incidence of ischemic heart disease (Vitek et al., 2002). Additionally, cancer mortality is inversely associated with bilirubin concentrations (Temme et al., 2001). Unfortunately, for multiple biological reasons, such as its insolubility and its toxicity at high concentrations, the utility of bilirubin in the clinic is limited. Alternative strategies or molecular engineering may be considered. Since BVR is a soluble cytoplasmic enzyme, and is abundant in various cells and tissues, our studies suggest that BVR may represent an attractive target for therapeutic intervention in multiple sclerosis and many other stress or immune-related diseases. 166 4.5. R E F E R E N C E S : Aebi H (1984) Catalase in vitro. Methods Enzymol 105:121-126. Baranano DE, Rao M , Ferris CD, Snyder SH (2002) Biliverdin reductase: a major physiologic cytoprotectant. Proc Natl Acad Sci U S A 99:16093-16098. Cao L , Sun D, Cruz T, Moscarello M A , Ludwin SK, Whitaker JN (2000) Inhibition of experimental allergic encephalomyelitis in the Lewis rat by paclitaxel. J Neuroimmunol 108:103-111. Coligan JE (2001) Current protocols in immunology. [New York]: Wiley. Dennery PA, Sridhar KJ , Lee CS, Wong HE, Shokoohi V , Rodgers PA, Spitz DR (1997) Heme oxygenase-mediated resistance to oxygen toxicity in hamster fibroblasts. J Biol Chem 272:14937-14942. Djousse L, Levy D, Cupples L A , Evans JC, D'Agostino RB, Ellison RC (2001) Total serum bilirubin and risk of cardiovascular disease in the Framingham offspring study. A m J Cardiol 87:1196-1200; A l 194, 1197. Elbashir SM, Harborth J, Lendeckel W, Yalcin A , Weber K, Tuschl T (2001) Duplexes of 21-nucleotide RMAs mediate RNA interference in cultured mammalian cells. Nature 411:494-498. Halliwell B, Gutteridge J M (1984) Oxygen toxicity, oxygen radicals, transition metals and disease. Biochem J 219:1-14. Halliwell B, Gutteridge JMC (1989) Free radicals in biology and medicine, 2nd Edition. Oxford New York: Clarendon Press; Oxford University Press. 167 Halliwell B, Gutteridge JMC (1999) Free radicals in biology and medicine, 3rd Edition. Oxford, England: Oxford University Press. Harrison PM, Arosio P (1996) The ferritins: molecular properties, iron storage function and cellular regulation. Biochim Biophys Acta 1275:161-203. Liu Y, Zhu B, Wang X, Luo L, Li P, Paty DW, Cynader MS (2003) Bilirubin as a potent antioxidant suppresses experimental autoimmune encephalomyelitis: implications for the role of oxidative stress in the development of multiple sclerosis. J Neuroimmunol 139:27-35. McDonagh AF (2001) Turning green to gold. Nat Struct Biol 8:198-200. Meister A (1994) Glutathione-ascorbic acid antioxidant system in animals. J Biol Chem 269:9397-9400. Nowell SA, Leakey JE, Warren JF, Lang NP, Frame LT (1998) Identification of enzymes responsible for the metabolism of heme in human platelets. J Biol Chem 273:33342-33346. Sasaki H, Akamatsu H, Horio T (2000) Protective role of copper, zinc superoxide dismutase against UVB-induced injury of the human keratinocyte cell line HaCaT. J Invest Dermatol 114:502-507. Senft AP, Dalton TP, Shertzer HG (2000) Determining glutathione and glutathione disulfide using the fluorescence probe o-phthalaldehyde. Anal Biochem 280:80-86.. Temme EH, Zhang J, Schouten EG, Kesteloot H (2001) Serum bilirubin and 10-year mortality risk in a Belgian population. Cancer Causes Control 12:887-894. 168 Tenhunen R, Marver HS, Schmid R (1968) The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase. Proc Natl Acad Sci U S A 61:748-755. Vetvicka V, Sima P, Miler I, Bilej M (1991) The immunosuppressive effects of bilirubin. Folia Microbiol (Praha) 36:112-119. Vitek L, Jirsa M, Brodanova M, Kalab M, Marecek Z, Danzig V, Novotny L, Kotal P (2002) Gilbert syndrome and ischemic heart disease: a protective effect of elevated bilirubin levels. Atherosclerosis 160:449-456. Young RA (1990) Stress proteins and immunology. Annu Rev Immunol 8:401-420. 169 C H A P T E R 5: G E N E R A L DISCUSSION 5.1. S U M M A R Y A N D DISCUSSION The reputation of bilirubin has been transformed from that of a toxin responsible for jaundice with no beneficial effects, to that of a biologically important antioxidant with a wide range of protective actions. Although it is well known that bilirubin is a powerful antioxidant substance in vitro, my study is one of the first to demonstrate that bilirubin also functions as an effective physiological antioxidant in vivo, and defends against diseases. The results clearly show that bilirubin system plays an important protective role in EAE, in which oxidative stress contributes significantly to the pathogenesis. During EAE, both HO-1 and BVR are strongly induced in the spinal cord lesions, and the concentration of bilirubin is subsequently increased. Administration of bilirubin could completely prevent acute EAE. More significantly, bilirubin was very effective in halting further signs of ongoing EAE, when given after the onset of disease. The therapeutic effect of bilirubin was long lasting. Disease did not rebound after treatment ceased. In chronic EAE, bilirubin treatment during the first clinical episode could also significantly decrease the relapse of chronic disease. Bilirubin suppressed EAE much more efficiently than many other powerful antioxidants (Kryzhanovskii et al., 1984; Ruuls et al., 1995), partially due to its stronger effect to inhibit oxidation, especially at very low concentration. Bilirubin as a powerful antioxidant can interfere with the development of EAE at multiple levels. For example, it protects the integrity of the BBB from free radical-170 induced permeability changes and prevents the inflammatory cells entry to the CNS. In the CNS, it scavenges free radicals that are directly responsible for CNS tissue damage, and promotes recovery of the disease. Although, as my later data showed, bilirubin is also a potent immunomodulator, within the first 24 hours after administration from the onset of clinical EAE, bilirubin mainly acted as an antioxidant. At this time point, bilirubin prevented disease progression efficaciously, but did not alter the inflammatory infiltrates or cytokine expression in spinal cord lesions. However, it significantly alleviated oxidative damage in the CNS, and the clinical signs of EAE correlated well with the severity of oxidative injury in the lesions, rather than the degree of inflammation and the level of cytokine expression. This unexpected result suggests that free radicals play an essential role in the final effector stages of EAE, though the importance of T cells and cytokines as central players in the initiation of EAE has been extensively documented. Therefore, antioxidant therapies may have potential for the treatment of MS. Since antioxidants act at the post-induction effector stage of this disease, they should be useful in reducing neurological disability and neuronal injury in MS regardless of its etiology. Considering biliverdin is a water-soluble, nontoxic easily excreted product, and is also a powerful antioxidant, why should mammals have evolved the energetically expensive, potentially toxic, and apparently unnecessary capacity to reduce biliverdin to bilirubin? Indeed, in.birds, reptiles, and amphibians, biliverdin is the predominant end product of heme degradation (Dolphin, 1978). One hypothesis holds that bilirubin can cross the placenta and thus transfer from the fetal to maternal circulation more readily than biliverdin (Schmid, 1976). However, the fetus expresses a distinct BVR, BVRB, 171 with different isomer specificity. Thus, the predominant bilirubin isomer in the early fetus is bilirubin IXp, whereas the adult, which expresses BVRA, produces bilirubin IXa exclusively (Blumenthal et al., 1980; Yamaguchi et al., 1994; Yamaguchi and Nakajima, 1995). Accordingly, the adult BVR could not have evolved for fetal needs. Another explanation is that bilirubin is lipophilic and can easily enter the cells to protect cytoplasmic constituents against free radical damage. However, under physiological condition, many mechanisms have been evolved to keep intracellular bilirubin concentration very low (~20 nM, <0.1% the levels of GSH) (Baranano et al., 2002). It has been suggested that free bilirubin is a substrate for P-glycoprotein, which is a member of the ATP-binding family of membrane transporters (Watchko et al., 1998). Its main function is the energy-dependent cellular efflux of lipophilic substrates (Watchko et al., 1998; Hansen, 2000). Intracellular bilirubin levels may be diminished also by oxidation, conjugation and binding to cytosolic proteins (Ostrow et al., 2003). For example, in the liver, unconjugated bilirubin is oxidized by the microsomal mixed function monoxygenases, CYP1A1 and CYP1A2 (Kapitulnik and Gonzalez, 1993). Binding of conjugated bilirubin to cytosolic glutathione-S-transferases can also limit the intracellular bilirubin concentration (Zucker et al., 1995). In contrast, GSH occurs at millimolar concentrations in most tissues and is generally regarded as the principal endogenous intracellular small molecule antioxidant cytoprotectant (Halliwell and Gutteridge, 1999). All the evidence does not support this hypothesis. While most of the interest in bilirubin as a potential therapeutic lies in its antioxidant properties, my study is the first to systematically explore its immunomodulatory activities. The data demonstrate that bilirubin, in addition to its antioxidant action, also 172 possesses powerful immunosuppressive effect, and may represent an important endogenous factor in mammals to protect against autoimmunity. Importantly, the immunosuppressive effect of bilirubin is not attributable to its antioxidant activity/ Bilirubin can inhibit both nonspecific immunity, such as complement-induced cell damage, and specific immunity, such as ADCC activity of lymphocytes and antigen-specific T cell response. The principal mechanism of immunologic tolerance induced by bilirubin is anergy. However, since the present study actually focus on the effect of bilirubin on peripheral tolerance, we cannot exclude the possibility that different mechanisms may be involved in its effect on central tolerance. It has been shown that lymphocytes at distinct stages may be differently sensitive to the same reagent. For example, dexamethasone inhibits aCD3-mediated T cell blast transformation and promotes cell death to a much higher extent in cord blood mononuclear cells from neonates than in peripheral blood mononuclear cells from adults (Orlikowsky et al., 2005). Thus, it is possible that bilirubin may induce central tolerance by different mechanisms, i.e. by deletion or even by induction of regulatory lymphocytes. Further studies are in progress. Likely related to its potent immunosuppressive activity, bilirubin suppresses T cell response through multiple mechanisms, including inhibition of TCR signaling, downregulation of costimulatory activity, and suppression of immune transcription factor activation. Since in immune response, deficiency in costimulatory and immune transcription factor activities can render T cells anergic and incapable of responding.to the antigen (Abbas, 2003), I consider that this might be among the mechanisms, by which bilirubin efficiently decreased the relapse of chronic EAE. Interestingly, as for its 173 neurotoxicity, suppression of protein phosphorylation and interference with cell membrane receptor function also represent the important mechanisms through that bilirubin inhibits T cell reactivity (Vetvicka et al., 1985; Hansen et al., 1996; Taille et al., 2003). The direct interaction of bilirubin molecules with cell membranes may also account for its strong anti-complement action. The lipophilic property seems essential to the effects of bilirubin on both membrane-associated molecules and immune transcription factors. Interestingly, the data indicate that water-soluble conjugated bilirubin is devoid of immunomodulatory activity although it remains a powerful antioxidant (Wu et al., 1996; Granato et al., 2003). In addition, the results show that, in comparison to dexamethasone, bilirubin is a "slow" immunosuppressant. It is well known that dexamethasone is a strong immunosuppressive agent that modulates cell activation, and also induced apoptosis of lymphoid cells (Fauci, 1978). Therefore, as demonstrated in Chapter 2, even after the development of EAE, a single subcutaneous injection of dexamethasone could markedly reduce the degree of inflammatory infiltrates in lesions with 24 hours. By contrast, in vivo, bilirubin works as an antioxidant first, and more time is needed for it to exert its powerful immunosuppressive effect. Based on all above findings, I consider that bilirubin suppresses EAE at multiple steps: (1) In the periphery, it inhibits antigen-specific T cell reactivity and induces immunologic self-tolerance. (2) Due to its potent antioxidant and immunosuppressive activities, bilirubin protects the BBB from free radical/cytokine-induced permeability changes such that the inflammatory cell invasion and the pathology are limited. (3) Within the CNS, bilirubin inhibits the autoreactive T cell response again when they 174 encounter myelin antigen. Subsequently, the recruitment of additional lymphocytes and monocytes to sites of inflammation is minimized. In addition, in the final effector stages of EAE, bilirubin acts against the actions of free radicals, complement, and autoantibodies, which are directly responsible for CNS tissue injury (Raine, 1994). In comparison to many other immunosuppressive agents, one advantage of bilirubin is that it possesses multiple biological functions, including the antioxidant and anti-complement activities. That bilirubin prevents the development of EAE at multiple levels may account for its strong long-term therapeutic effect. Since MS is a process of chronic relapsing demyelination in the CNS resulting in progressive clinical neurologic impairment (Paty and Ebers, 1998), it is more important for a treatment to improve the long-term course of disease, rather than only inhibit the acute symptoms. Importantly, bilirubin prevents the relapse of chronic EAE much more successfully than traditional immunosuppressants, including dexamethasone. In my study, the strong therapeutic effect of bilirubin in EAE was observed without notable side effects. Bilirubin treatment did not cause neural cell damage in the CNS. Although bilirubin at very high levels is cytotoxic, there is a wide range of concentrations (50 ~ 100 %m ) within which bilirubin is nontoxic, but can function efficiently both as an antioxidant and as an immunomodulatory agent. In full-term newborns, plasma bilirubin levels up to 170 $m are still considered physiological jaundice (Cohen, 2006). Gilbert's syndrome patients with high bilirubin concentrations can live a normal lifestyle without any treatment (Radu and Atsmon, 2001). People may speculate that even higher levels maintained over a short period for therapy could be quite safe. Therefore, in the future, it 175 is totally possible for bilirubin to achieve maximal effect in the treatment of diseases without causing neural or other type cell damage. Up to now no definitive therapy is available for MS. At present, interferon-p is the mainstream for therapy of this disease in the clinic. It has proved effective in the relapsing-remitting form of MS (Ann Marrie and Rudick, 2006). However, patients may develop antibodies to the exogenously administered protein and neutralize its effect (Ann Marrie and Rudick, 2006). The common use of interferon-P is also limited by the high expense. By comparison, my study indicates that bilirubin, a relatively cheap and small molecule existing natural product, may represent a novel effective strategy for the treatment of MS and other stress or immune-mediated diseases. Indeed, traditional oriental medicine prizes highly the medicinal properties of animal biles (known as Niu Huang). They have long been used for therapy of many diseases. Unfortunately, the clinical utility of bilirubin is still limited due to many biological reasons. One disadvantage of bilirubin is its low aqueous solubility. At present, bilirubin is generally dissolved in weak basic solution. The solution is then adjusted to pH 7.4 for in vivo use. In my study, I found that after administered by i.p. injections, a significant proportion of bilirubin accumulated in the peritoneum. Another problem is that although as I showed above, bilirubin at concentrations between 50 ~ 100 im is not cytotoxic, like other general immunosuppressive agents, bilirubin at these concentrations may still cause side effects. For example, increased susceptibility to infection has been observed in hyperbilirubinemic patients (Pearlman et al., 1980). Septic complications have been major problems in the management of patients with obstructive jaundice and neonatal 176 jaundice (Holman et al, 1979; Armstrong et al., 1984). Therefore, development of alternative strategies would be of value. Four years ago, Baranano et al found that the potent physiological antioxidant action of bilirubin is due to an amplification cycle whereby bilirubin, acting as an antioxidant, is itself oxidized to biliverdin and then recycled back to bilirubin by BVR (Baranano et al., 2002). In other words, BVR can regenerate bilirubin in a catalytic cycle, which may constitute the principal physiological function of bilirubin. At present, it remains unclear whether a similar cycle exists when bilirubin acts as an immunosuppressive or as an anti-complement agent. However, since oxidative stress is a fundamental mechanism underlying a host of different diseases, including EAE and MS, the major problem is whether, under pathological conditions, endogenous BVR would suffice to reduce newly formed biliverdin back to bilirubin. My study, for the first time, characterizes BVR as a new useful pharmacological target for therapeutic intervention in diseases. The results showed that treatment with BVR ameliorated both clinical and pathological signs of EAE more efficiently than treatments with traditional antioxidant enzymes. Interestingly, BVR amplifies the action of bilirubin without significantly increasing the biological concentration of bilirubin. Since BVR is water-soluble and nontoxic, these data clearly indicate that BVR may serve as an attractive target for the treatment of MS and other diseases. Because bilirubin is abundant in serum, and bilirubin can inhibit EAE in both induction and effector phases of disease, I believe that systemic administration of BVR by i.v. or i.m. injection would suppress EAE even more effectively. Unfortunately, for this study, I could only try to treat EAE with BVR by intrathecal infusion. Systemic administration of BVR was not tried due to the high expense. Different from catalase and 177 SOD, which have been commercially available from many companies for long time and are now relatively cheap, BVR is only recently available from Stressgen and is quite expensive. At present, similar effective doses of BVR as those of catalase and SOD will cost more than one thousand dollars per day per animal. However, further studies in this respect in the future would be meaningful. The following conclusions can be drawn from the experiments: 1) Bilirubin represents a very effective physiological antioxidant in vivo, and plays a protective role in EAE. Since oxidative stress is important in the etiology of MS, and it contributes directly to CNS tissue damage, bilirubin as a potent antioxidant would be useful in reducing neuronal injury and neurological disability in this disease. 2) Importantly, bilirubin, in addition to its well-known antioxidant property, also possesses powerful immunosuppressive activities, and may represent an important endogenous factor in mammals to protect against autoimmunity. These data indicate its potential for the treatment of MS and other autoimmune disorders. 3) BVR physiologically regenerates bilirubin in a catalytic cycle, and can amplify the actions of bilirubin without significantly increasing the biological concentration of bilirubin. Since BVR is water-soluble and is relatively innocuous, it may serve as a novel effective pharmacological target for therapeutic intervention in MS and other diseases. BVR may render the bilirubin system a safer and more practical strategy for treatment in a clinical setting. 178 5.2. CAUTION AND FUTURE DIRECTIONS Human MS and rodent EAE. As described in chapter INTRODUCTION, E A E is the most intensively studied animal model of MS, and many believe the best (Paty, 1998). Over the past century, this induced animal model has proved extremely useful for studying the spontaneous, and at present etiologically undefined, human disease MS. Several therapies approved for treatment of MS were developed preclinically based on their success in treating E A E (Steinman, 1999). One promising therapeutic approach to come out of the E A E model is Copaxone, a synthetic polymer analog of MBP, which has been successful in reducing the relapse rate in MS in clinical trials and is currently approved for treatment of MS (Arnon, 1996). IFN-P was demonstrated to be effective both clinically in relapsing remitting MS and in E A E , though in the treatment of E A E severe relapses were seen when IFN-P was discontinued (Ruuls et al., 1996). However, to say that E A E is rodent MS is certainly an open question. The central unresolved issue bearing on the utility of E A E as an object of study is the fact that human MS is spontaneous, progressive, long lasting, and generally terminal, while E A E is induced, and in most cases is acute, self-limiting, and not fatal. In E A E model, the immune inducing compound is directly taken from the CNS, which is most probably not the case in MS, for which the influence of environmental factors has been evidenced by epidemiologic studies (Kurtzke, 1980) and occurrence of relapses has been linked to infections (Andersen et al., 1993; Rapp et al., 1995). Though E A E has many features that reflect what is known about the pathophysiology of MS, there are many differences between the pathology of E A E and MS (Petry et al , 2000). For example, axonal loss and 179 gliosis, which are common features in MS, are uncommon in E A E , and remyelination is much better in E A E than in MS. Therefore, extrapolations must be made with caution when predicting what might happen in MS, based on results obtained in the E A E model. For example, as shown in Table 1.1, there is discrepancy between the results with inhibition of TNF-a in E A E versus MS. A clinical trial was performed to test the efficacy of inhibition of TNF-a in MS. Results showed that treatments with monoclonal anti-TNF antibody and soluble TNF receptor actually exacerbated disease (van Oosten et al., 1996), and the trial was halted while in progress. Paradoxically, in E A E systemic administration of anti-TNF-a antibody protects from paralysis (Korner et al., 1997; Wildbaum and Karin, 1999). So far, the development of the approved MS drug, Copaxone, based on its efficacy in E A E and the success of IFN-P in treating E A E must be balanced with the failures of anti-TNF-a in MS, after its successful use in various models of E A E . It is important to remember that caution must be practiced in extrapolating finding from E A E to MS. Future directions. In the future, I would like to do more work on the role of bilirubin system in the human disease MS. For example, i f post mortem CNS tissue from patients with MS is available, I will study the expression of HO-l/BVRTbilirubin in the lesions of MS. If bilirubin system proves to be strongly induced in MS as in E A E , it would support "an opinion that bilirubin system may also have an important role in human disease MS. Furthermore, I would like to study HO-l/BVR/bilirubin expression in the peripheral blood cells collected from MS patients and investigate the correlation between the bilirubin system activity and the disease course. In addition, sb long as relevant data are 180 available, epidemiological studies would also be meaningful. If we can find that high plasma bilirubin levels are correlated with a reduced risk of MS, and bilirubin system activities have beneficial effects on the course of MS, these results would further support the conclusion of the present study. On the other hand, since EAE and MS are believed to be T cell-medicated autoimmune inflammatory diseases, the present study focuses on the actions of bilirubin on T lymphocyte reactivity. However, increasing evidence has demonstrated that bilirubin also affects B lymphocyte activity. For example, bilirubin could suppress antibodies formation (Nejedla, 1970). It has been shown that the clinical and biochemical signs of systemic lupus erythematosus were improving when jaundice developed (Moroni et al., 1997). Ohrui et al reported a case of complete resolution of persistent difficult-to-control asthma in accordance with increased levels of serum bilirubin (Ohrui et al., 2003). Therefore, in the future, I would like to investigate the effects of bilirubin system on B cell function, which represents another principal compartment of the immune system. 181 5.3. REFERENCE: Abbas AK (2003) Cellular and molecular immunology, 5th Edition. Philadelphia: Saunders. Andersen O, Lygner PE, Bergstrom T, Andersson M, Vahlne A (1993) Viral infections trigger multiple sclerosis relapses: a prospective seroepidemiological study. J Neurol 240:417-422. Ann Marrie R, Rudick RA (2006) Drug Insight: interferon treatment in multiple sclerosis. Nat Clin Pract Neurol 2:34-44. Armstrong CP, Dixon JM, Taylor TV, Davies GC (1984) Surgical experience of deeply jaundiced patients with bile duct obstruction. Br J Surg 71:234-238. Arnon R (1996) The development of Cop 1 (Copaxone), an innovative drug for the treatment of multiple sclerosis: personal reflections. Immunol Lett 50:1-15. Baranano DE, Rao M, Ferris CD, Snyder SH (2002) Biliverdin reductase: a major physiologic cytoprotectant. Proc Natl Acad Sci U S A 99:16093-16098. Blumenthal SG, Stucker T, Rasmussen RD, Ikeda RM, Ruebner BH, Bergstrom DE, Hanson FW (1980) Changes in bilirubins in human prenatal development. Biochem J 186:693-700. Cohen SM (2006) Jaundice in the full-term newborn. Pediatr Nurs 32:202-208. Dolphin D (1978) The Porphyrins. New York: Academic Press. Fauci AS (1978) Mechanisms of the immunosuppressive and anti-inflammatory effects of glucocorticosteroids. J Immunopharmacol 1:1-25. 182 Granato A, Gores G, Vilei MT, Tolando R, Ferraresso C, Muraca M (2003) Bilirubin inhibits bile acid induced apoptosis in rat hepatocytes. Gut 52:1774-1778. Halliwell B, Gutteridge JMC (1999) Free radicals in biology and medicine, 3rd Edition. Oxford ; New York: Oxford University Press. Hansen TW (2000) Bilirubin oxidation in brain. Mol Genet Metab 71:411-417. Hansen TW, Mathiesen SB, Walaas SI (1996) Bilirubin has widespread inhibitory effects on protein phosphorylation. Pediatr Res 39:1072-1077. Holman JM, Jr., Rikkers LF, Moody FG (1979) Sepsis in the management of complicated biliary disorders. Am J Surg 138:809-813. Kapitulnik J, Gonzalez FJ (1993) Marked endogenous activation of the CYP1A1 and CYP1A2 genes in the congenitally jaundiced Gunn rat. Mol Pharmacol 43:722-725. Korner H, Lemckert FA, Chaudhri G, Etteldorf S, Sedgwick JD-(1997) Tumor necrosis factor blockade in actively induced experimental autoimmune encephalomyelitis prevents clinical disease despite activated T cell infiltration to the central nervous system. Eur J Immunol 27:1973-1981. Kryzhanovskii GN, Vilkov GA, Stepanenko EM (1984) [Protective action of antioxidant preparations on the development of experimental allergic encephalomyelitis in guinea pigs]. Biull Eksp Biol Med 98:527-530. Kurtzke JF (1980) Geographic distribution of multiple sclerosis: An update with special reference to Europe and the Mediterranean region. Acta Neurol Scand 62:65-80. 183 Moroni G, Maccario M, Fargion S, Ponticelli C (1997) Severe and prolonged jaundice in a lupus nephritis patient treated with cyclophosphamide. Nephrol Dial Transplant 12:793-796. Nejedla Z (1970) The development of immunological factors in infants with hyperbilirubinemia. Pediatrics 45:102-104. Ohrui T, Yasuda H, Yamaya M, Matsui T, Sasaki H (2003) Transient relief of asthma symptoms during jaundice: a possible beneficial role of bilirubin. Tohoku J Exp Med 199:193-196. Orlikowsky TW, Dannecker GE, Spring B, Eichner M, Hoffmann MK, Poets CF (2005) Effect of dexamethasone on B7 regulation and T cell activation in neonates and adults. Pediatr Res 57:656-661. Ostrow JD, Pascolo L, Shapiro SM, Tiribelli C (2003) New concepts in bilirubin encephalopathy. Eur J Clin Invest 33:988-997. Paty DW, Ebers GC (1998) Multiple sclerosis. Philadelphia: F.A. Davis. Pearlman MA, Gartner LM, Lee K, Eidelman AI, Morecki R, Horoupian DS (1980) The association of kernicterus with bacterial infection in the newborn. Pediatrics 65:26-29. Petry KG, Boullerne AI, Pousset F, Brochet B, Caille JM, Dousset V (2000) Experimental allergic encephalomyelitis animal models for analyzing features of multiple sclerosis. Pathol Biol (Paris) 48:47-53. Radu P, Atsmon J (2001) Gilbert's syndrome—clinical and pharmacological implications. IsrMed Assoc J 3:593-598. 184 Raine CS (1994) The Dale E. McFarlin Memorial Lecture: the immunology of the multiple sclerosis lesion. Ann Neurol 36:S61-72. Rapp NS, Gilroy J, Lerner AM (1995) Role of bacterial infection in exacerbation of multiple sclerosis. Am J Phys Med Rehabil 74:415-418. Ruuls SR, Bauer J, Sontrop K, Huitinga I, t Hart BA, Dijkstra CD (1995) Reactive oxygen species are involved in the pathogenesis of experimental allergic encephalomyelitis in Lewis rats. J Neuroimmunol 56:207-217. Ruuls SR, de Labie MC, Weber KS, Botman CA, Groenestein RJ, Dijkstra CD, Olsson T, van der Meide PH (1996) The length of treatment determines whether IFN-beta prevents or aggravates experimental autoimmune encephalomyelitis in Lewis rats. J Immunol 157:5721-5731. Schmid R (1976) The distinguished lecture: Pyrrolic victories. Trans Assoc Am Physicians 89:64-76. Steinman L (1999) Assessment of animal models for MS and demyelinating disease in the design of rational therapy. Neuron 24:511-514. Taille C, Almolki A, Benhamed M, Zedda C, Megret J, Berger P, Leseche G, Fadel E, Yamaguchi T, Marthan R, Aubier M, Boczkowski J (2003) Heme oxygenase inhibits human airway smooth muscle proliferation via a bilirubin-dependent modulation of ERK1/2 phosphorylation. J Biol Chem 278:27160-27168. van Oosten BW, Barkhof F, Truyen L, Boringa JB, Bertelsmann FW, von Blomberg BM, Woody JN, Hartung HP, Polman CH (1996) Increased MRI activity and immune activation in two multiple sclerosis patients treated with the monoclonal anti-tumor necrosis factor antibody cA2. Neurology 47:1531-1534. 185 Vetvicka V, Miler I, Sima P, Taborsky L, Fornusek L (1985) The effect of bilirubin on the Fc receptor expression and phagocytic activity of mouse peritoneal macrophages. Folia Microbiol (Praha) 30:373-380. Watchko JF, Daood MJ, Hansen TW (1998) Brain bilirubin content is increased in P-glycoprotein-deficient transgenic null mutant mice. Pediatr Res 44:763-766. Wildbaum G, Karin N (1999) Augmentation of natural immunity to a pro-inflammatory cytokine (TNF-alpha) by targeted DNA vaccine confers long-lasting resistance to experimental autoimmune encephalomyelitis. Gene Ther 6:1128-1138. Wu TW, Fung KP, Wu J, Yang CC, Weisel RD (1996) Antioxidation of human low density lipoprotein by unconjugated and conjugated bilirubins. Biochem Pharmacol 51:859-862. Yamaguchi T, Nakajima H (1995) Changes in the composition of bilirubin-IX isomers during human prenatal development. Eur J Biochem 233:467-472. Yamaguchi T, Komoda Y, Nakajima H (1994) Biliverdin-IX alpha reductase and biliverdin-IX beta reductase from human liver. Purification and characterization. J Biol Chem 269:24343-24348. Zucker SD, Goessling W, Ransil BJ, Gollan JL (1995) Influence of glutathione S-transferase B (ligandin) on the intermembrane transfer of bilirubin. Implications for the intracellular transport of nonsubstrate ligands in hepatocytes. J Clin Invest 96:1927-1935. 186 A P P E N D I C E S UBC RESEARCH ETHICS BOARD CERTIFICATES OF APPROVAL U B G w T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A A N I M A L C A R E CERTIF ICATE: Application Number: AOO-0153 Investigator or Course Director: Max S. Cynader Department: Brain Research Centre Animals: Lewis rats 150 D A rats 150 Guinea Pigs 20 Start Pate: Approval Date: 2000-06-01 Funding Sources: Funding Agency: Project Title: Multiole Sclerosis Society of Canada The potential protective role of heme oxygenase-1/bilirubin in acute and chronic relapsing model of"multiple sclerosis Funding Agency: ProjectTitle: Canadian Institutes of Health Research The potential protective role of heme oxygenase-[/bilirubin in acute and chronic relapsing model of multiple sclerosis: Unfunded title: h/a The Animal Care Committee has examined and approved the use of animals for the above experimental project. This certificate is valid foi* one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures. Annual review is required by the C C A C and some granting agencies. A copy of this certificate must be displayed in your animal facility. Office of Research Services and Administration 102,6190 Agronomy Road* Vancouver, B C V 6 T I Z 3 Phone: 604^27-5111 Fax: 604-822-5093 187 U B C T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A w A N I M A L C A R E C E R T I F I C A T E Application Number: A 0 4 - 0 155 Investigator or Course Director; Maxff.^Cynader. Department:,Brain Research Centre Animals: M i c e SJ 1.200 L e w i s rats 120 D A rats 120 Guinea P igs 20 Start Date: Approval Date: 2004-05-01 Fu nding; Sources: Funding Agency:: Project Title: M u l t i p l e Sclerosis Society o f Canada The protective role o f bi l iverdin reductase in acute and chronic relapsing experimental autoimmuneencephaidit iyel it is Funding Agency: Project Title: Canadian Institutes o f Health Research The protective r o l e o f bi l iverdin reductase in acute and chronic relapsing experimental autoimmune encephalomyelitis Unfunded title: n/a The Animal Care Committee has examined and approved the use of animals for the above experimental project. This certificate is valid for one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures. Annual review is required by the C C A C and some granting agencies. A copy of this certificate must be displayed in your animal facility. Office of Research Services and Administration 102* 6190 Agronomy Road* Vancouver, B C V 6 T 1 Z 3 Phone: 604^827-5111 Fax: 604-822-5093 188 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0100656/manifest

Comment

Related Items