Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Exploring the cAMP/PKA pathway in the corn smut pathogen Ustilago maydis through serial analysis of gene… Jabeen, Mehnaz 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0130a.pdf [ 8.19MB ]
Metadata
JSON: 831-1.0100639.json
JSON-LD: 831-1.0100639-ld.json
RDF/XML (Pretty): 831-1.0100639-rdf.xml
RDF/JSON: 831-1.0100639-rdf.json
Turtle: 831-1.0100639-turtle.txt
N-Triples: 831-1.0100639-rdf-ntriples.txt
Original Record: 831-1.0100639-source.json
Full Text
831-1.0100639-fulltext.txt
Citation
831-1.0100639.ris

Full Text

Exploring the cAMP/PKA pathway in the corn smut pathogen Ustilago maydis through Serial Analysis of Gene Expression By M E H N A Z J A B E E N A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENT OF THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Plant Sciences) THE UNIVERSITY OF BRITISH COLUMBIA January 2007 © Mehnaz Jabeen, 2007 A B S T R A C T Ustilago maydis is the causative agent of corn smut disease. The ability of the fungus to switch from budding to filamentous growth is required for pathogenesis. Mating type genes and signaling pathways (cAMP and MAPK) regulate morphogenesis and pathogenesis in U. maydis. A novel protein Hgll appears to be a downstream component of the cAMP pathway that influences cell morphology and sporulation during infection. The focus of this work was to further explore the role of the hgll gene in U. maydis through the construction of Serial Analysis of Gene Expression (SAGE) libraries to compare the transcriptomes of wild type and hgll mutant strains. The SAGE approach provides a quantitative gene expression profile and identifies differentially expressed genes. A key result of the SAGE work was the identification of a number of differentially expressed genes for putative zinc finger proteins in the transcriptome. A hypothetical protein encoded by the cthl (Cystine 3-histidine) gene had similarity to a zinc finger protein. This gene was disrupted to investigate its role in the morphology of U. maydis and in disease progression. Phenotypic characterization of the cthl mutant lead to the conclusion that the gene is required for normal morphology and completion of the life cycle in U. maydis, and that it might also be involved in the regulation of cell division. Overall, this work makes a contribution to our understanding of the cAMP signaling pathway in U. maydis and provides a wealth of expression data for future analysis. ii TABLE OF CONTENTS Abstract ii Table of Contents iii List of Tables v List of Figures vi Acknowledgements vii CHAPTER I: INTRODUCTION 1 1.1 Ustilago maydis 1 1.1.1 The life cycle of Ustilago maydis '. 2 1.1.2 Dimorphism, pathogenesis and mating 5 1.2 An overview of signaling pathways in fungi 6 1.2.1 Molecular mechanisms of signal transduction in Ustilago maydis via the cAMP pathway 7 1.2.2 The MAPK pathway in Ustilago maydis 10 1.2.3 Signaling pathways in Saccharomyces cerevisiae ..' 13 1.2.4 Signaling pathways in Cryptococcus neoformans 16 1.3 The hgll gene of Ustilago maydis - a key target of cAMP signaling 18 1.3.1 The morphological influence of a mutation in the hgll gene 19 1.3.2 Pathogenicity of hgll mutants and in plant response. 19 1.3.3 Role of hgll in signaling 20 1.4 Genome-wide gene expression studies in Ustilago maydis 21 1.5 Sequence of the Ustilago maydis genome .22 1.6 Objectives of this study 23 CHAPTER II: MATERIALS AND METHODS 24 2.1 Strains and growth conditions 24 2.2 RNA and DNA isolation methods 24 2.3 SAGE methodology 27 2.4 SAGE data analysis 28 2.5 RT-PCR (Reverse transcriptase - Polymerase chain reaction) 29 2.6 Double-joint PCR to knock out the cthl gene 31 2.7 Morphological studies of the knock out mutant strains 32 2.7.1 In vitro studies 32 2.7.2 In planta analysis of the cthl knock out mutants 33 2.8 Microscopic studies 33 CHAPTER III: RESULTS 35 3.1 Overview of the Serial Analysis of Gene Expression data 35 iii 3.1.1 Genes with differential expression in the hgl 1 mutant 38 3.1.2 Gene differentially expressed in the wild-type strain library 48 3.2 Confirmation of SAGE expression data 55 3.2.1 RNA blot analysis ....55 3.2.2 Quantitative RT-PCR analysis for SAGE data verification 58 3.3 The Cthl zinc finger protein - functional analysis 65 3.3.1 Reverse genetics approach to knock out the cthl gene 66 3.3.2 Morphological studies of the cthl mutants 71 3.3.3 Mating assay in vitro and in vivo 74 CHAPTER IV: DISCUSSION 80 4.1 Significance of the gene functions identified by SAGE tags from the wild-type and mutant libraries 80 4.1.1 Protein biosynthesis-related genes may affect cell growth and proliferation via cAMP/PKA and TOR pathways 80 4.1.2 Protein catabolism-related genes. 82 4.1.3 Tags related to cellular transport mechanisms, lipids and phosphate 84 4.1.4 Zinc finger proteins and their role in nucleic acid binding, transcription regulation and signal transduction 86 4.1.5 Other GO categories 92 4.2 Identification of cthl and its homologs 93 4.2.1 cthl encodes a conserved sequence. 94 4.2.2 The cthl gene is required for normal morphology and completion of the life cycle in Ustilago maydis 96 4.2.3 Connections between cthl and signaling pathways that influence pathogenicity in U. maydis 97 4.3. Future experiments 98 BIBLIOGRAPHY 100 iv LIST OF TABLES Table 1.1 Components of Ustilago maydis signaling pathways and their morphogenetic and pathogenic significance 12 Table 2.1 Strains of Ustilago maydis used in molecular and morphogenetic studies...24 Table 2.2 Tags selected for amplification of probes for Northern blot analysis 26 Table 2.3 Tags selected for RT-PCR and primers designed for amplification of the PCR product 30 Table 2.4 Primers used to construct the hygromycin cassette for the cthl knock out..32 Table 3.1 Abundance classes for hgll and wild type 36 Table 3.2 Upregulated tags in the hgll library and/or downregulated in wild-type library 39 Table 3.3 Tags with GO (gene ontology) categories based on predicted domain/function 44 Table 3.4 Upregulated tags in the wild-type library and/or downregulated in the hgll library 49 Table 3.5 RT-PCR expression results 63 Table 3.6 Disease indices for wild-type and mutant infections in maize seedlings 77 Table 4.1 Predicted zinc finger proteins with elevated expression in hgll (mutant) and wild-type libraries 89 Table 4.2 Ustilago maydis zinc finger proteins from the Whitehead database 89 L I S T O F F I G U R E S Figure 1.1 Life cycle of Ustilago maydis 3 Figure 1.2 cAMP/PKA pathway in Ustilago maydis 9 Figure 1.3 cAMP/PKA pathway in Saccharomyces cerevisiae 15 Figure 1.4 cAMP/PKA pathway in Cryptococcus neoformans 17 Figure 3.1 Differences and similarities between wild type and hgll libraries 37 Figure 3.2 SAGE data confirmation by Northern blot analysis 57 Figure 3.3 Reverse transcriptase polymerase chain reaction procedure 60 Figure 3.4 RT-PCR results of SAGE data verification 64 Figure 3.5 Application of double joint PCR method to knock out the cthl gene 67 Figure 3.6 Amplified left arm, right arm, marker and knock out construct used to transform the wild-type strains 001 and 002 68 Figure 3.7 Southern blot analysis for cthl mutants 70 Figure 3.8 Morphology of cthl mutants 73 Figure 3.9 charcoal plate mating assay and plant assay 76 Figure 3.10 Colony morphology of wild-type and Acthl 78 Figure 4.1 Proposed model for hgll 90 Figure 4.2 Conserved CCCH-Zf motif showing the Cx 8Cx 5Cx 3H zinc finger ...: 95 ACKNOWLEDGEMENTS I deem it a great honor and privilege to record deep sense of gratitude to Dr. Jim Kronstad for his inspiring guidance throughout my studies at the University of British Columbia. He is so much indebted that words are unable to satisfy his sentiment. I am incredibly grateful for his consistent advise, scholastic enthusiasm, cooperation, and guidance in preparing this manuscript. Gratitude is expressed to the Michael Smith Laboratories and Department of Plant Sciences for providing the facilities for research work and studies. I warmly thank all the committee members for their help and guidance to complete my research and studies. I also want to thank the talented and knowledgeable Kronstad Laboratory members for their help and guidance during my studies and research project. The depth of support I received from my daughter, husband, mother-in-law, father-in-law, my parents and other family members was amazing and I can not thank them enough by writing few words. Their encouragement and support always helped me through the tough times. This thesis is dedicated to my daughter Izzah for her cooperation and patience throughout my studies. My husband also deserves special thanks for his unconditional support, encouragement and help during my studies. vii CHAPTER 1: INTRODUCTION 1.1. Ustilago maydis The basidiomycete fungus Ustilago maydis is member of a group of fungi that includes the mushrooms and many plant pathogens. It belongs to the order Ustilaginales and is pathogenic only on corn and the closely related plant teosinte. Smut fungi are named after the very conspicuous symptoms, black masses of teliospores resembling soot or smut, that they often produce on the host plant. Over 1100 smut species have been recognized in over 50 genera. These infecting more than 4000 plant species in approximately 75 different families (http ://re s2. agr .ca/parc-crapac/summerland/progs/biotech/bakkeren/uresearch rechercheu e.htm). U. maydis is a ubiquitous pathogen of corn and it produces the dramatic symptom of smut galls (also called tumors) on any above ground part of the plant, wherever the pathogen encounters meristematic tissue (Christensen, 1963). Once the disease occurs, it also causes stunting of growth in addition to the formation of tumors on leaves, stem and ears of the plant. In recent years, U maydis has emerged as a most attractive model for plant pathogenic basidiomycetes because of its ability to exist in both haploid and diploid phases, and to be transformed with exogenous DNA (Banuett, 1995; Bolker, 2001). Its yeast-like, saprophytic form can easily be propagated on artificial media (Wang et al. 1998, Gold et al. 1994). However, these so-called yeast-like sporidia are unable to cause disease symptoms when applied to the host plant in pure culture. To cause disease, two compatible sporidia need to mate to form an infectious, filamentous cell type. For U. maydis, conserved signaling pathways are believed to transduce environmental signals such as nutrient availability, the presence of lipids, and acidic pH, as well as pheromone 1 signals from opposite mating type cells (Bolker et al., 1995; Klose et al., 2004; Martinez-Espinoza et al., 2004). Overall, these features of U. maydis make it an attractive experimental organism to investigate the role of signaling in the control of morphogenesis and fungal phytopathogenesis. 1.1.1. The life cycle of U. maydis Ustilago maydis is considered to be a dimorphic fungus, but it actually exhibits three different forms during its life cycle and these are a uninucleate haploid form (sporidia), a dikaryotic filamentous form (obligately parasitic and needs the plant to grow) and a diploid form (in the form of teliospores that only occur within the tumors) (Banuett, 1995; Kahmann et al., 1999). At the start of the life cycle, teliospores undergo germination and meiosis to produce haploid progeny. Once these cells are formed, the most critical event in the life cycle is the switch from saprophytic to parasitic growth which is controlled by two mating type loci (Kahmann et al., 1999). U. maydis contains a tetrapolar mating system which is comprised of a and b loci that are present on separate chromosomes (Bakkeren and Kronstad, 1994). The a locus is biallelic and its specificities al and a2 are specified by idiomorphs of 4.5 kb and 8.0 kb, respectively (Bolker et al., 1992; Froeliger and Leong, 1991; Kronstad and Staben, 1997). The a locus encodes pheromones and pheromone receptors (mfal, mfa2 and pral, pra2) that control the initial recognition events of cell fusion of compatible mating partners (Bolker et al., 1992; Urban et al., 996). 2 Figure 1.1: Life cycle of Ustilago maydis Tumor formation 3 Figure 1.1: In U. maydis, two compatible haploid sporidia of different a and b specificities extend the conjugation tubes as a response to pheromones and produce dikaryotic cells after joining the conjugation tubes. Dikaryotic filaments penetrate into host tissues through wounds and spread as network of hyphae. Eventually tumors are produced which contain large number of black diploid teliospores. The b locus is multiallelic and contains two divergently transcribed genes designated bE and bW. The bE and bW genes encode homeodomain proteins that regulate the expression of genes required for the filamentous growth and pathogenesis of the dikaryon (as described in detail by Kronstad and Staben, 1997). Different specificities for the a and b loci are required for successful mating and host infection. After recognition of mating partners, haploid cells arrest their growth in the G2 phase of the cell cycle (Garcia-Muse et al. 2003; Snetselaar and Cann, 1997), and haploid sporidia initiate pheromone-directed filamentous growth. The compatible interaction and fusion of conjugation tubes results in the production of the dikaryotic form. This dikaryotic filament contains cytoplasm, organelles and nuclei of both sporidia (Steinberg et al., 1998) and enters the plant tissue often times through wounds or stomata. After invading the host, the filaments may proliferate inter- or intra-cellularly. It has been hypothesized that plant signals contribute to the disease progression through maintenance of the dikaryotic state (Banuett. 1995). The fungus causes chlorotic lesions in infected areas, the formation of anthocyanin pigment, necrosis, hyperplasia and hypertrophy of infected organs to result in tumors. Infection by. U. maydis can also inhibit development and lead to stunting of infected plants. A few days after infection, tumors develop in which massive fungal proliferation and the formation of the black-pigmented, diploid teliospores occurs (Bannuet and Herskowitz; 1996). Under natural conditions, tumors predominantly develop on sexual organs (tassels and ears), stems and nodal shoots. 4 Tumors may vary in size from minute pustules to several centimeters in diameter and contain up to 200 billion spores (Basse and Steinberg, 2004). The life cycle of Ustilago maydis is presented in Fig 1.1. 1.1.2. Dimorphism, pathogenesis and mating Fungal pathogenicity often . involves a yeast-to-hypha transition (Sanches-Martinez and Perez-Martin, 2001). Several fungi have the ability to switch between a saprophytic yeast form and a parasitic filamentous form in response to various environmental factors. In the yeast form, proliferation occurs by mitotic division either by budding or fission to produce two independent cells. Two different modes of growth are seen for filament formation, one is pseudohyphal growth which produces chains of attached elongated cells without abscission of cells following cytokinesis. The other mode of filamentous growth results in true hyphae with long continuous tubes of cells and septae that separate each of the nuclei in the tube (Bolker, 2001; Bolker et al., 1995; Sanches-Martinez and Perez-Martin; 2001). Different signals from the environment or a host may trigger the morphogenetic switch, and the ability to switch appears to be an important virulence factor in some fungi (Sanches-Martinez and Perez-Martin, 2001). Although Saccharomyces cerevisiae is a non-pathogenic organism, certain diploid strains of this organism show a switch from budding to pseudohyphal growth upon starvation for nitrogen (Roberts and Fink, 1998). This process serves as a paradigm for dimorphism in other fungi. In contrast, U. maydis exhibits a dimorphic switch from budding to filamentous growth in response to mating, a host plant and environmental conditions. As mentioned above, haploid cells of U. maydis can form filaments in response to nutrient 5 starvation or acidic pH (Martinez-Espinoza et al., 2004), while mating of compatible strains results in the formation of pathogenic dikaryotic hyphae. 1.2. An overview of signaling pathways in fungi Fungal cells employ sophisticated signal transduction programs to sense and respond to the environmental cues that result in changes in cell morphology and physiology. Signaling mechanisms that regulate dimorphism, pathogenicity, fungal proliferation and differentiation include the highly conserved cAMP (cyclic adenosine monophosphate) and MAPK (mitogen activated protein kinase) signaling cascades (Feldbrugge et al., 2004; Lengeler et al., 2000; Kronstad et al., 1998). cAMP regulates morphogenesis and virulence in a wide variety of fungi including the plant pathogens U. maydis, Ustilago hordei, Stagonospora nodorum, Magnaporthe grisea, Colletotrichum trifolii and Fusarium species (Feldbrugge et al., 2004; Lee et al., 2003). The morphogenetic switch as a response to different signals might reflect a conserved mechanism for interactions between fungal pathogens and plant or animal hosts. Among other fungal pathogens, Candida albicans, an opportunistic human pathogen, is able to change its morphology from round budding cells to elongated hyphae or filamentous growth forms. This morphogenetic switching has been implicated in the development of pathogenicity (Dhillon et al., 2003). In both U. maydis and C. albicans, this capacity has been correlated with virulence and in both cases, the above mentioned signal transduction pathways are known to be involved. In filamentous saprophytes, the cAMP pathway appears to play an integral role in vegetative growth and sporulation, with possible connections to mating (Lee et al., 2003). For recognition of environmental cues and to 6 initiate appropriate physiological responses, signal receptors in the cellular machinery include G-protein coupled receptors (GPCRs), ion channels, heterotrimeric G proteins and cell membrane associated enzymes. Among these, GPCRs are known to respond to a wide variety of signals in fungi, as described by Lengeler et al., (2000); Regenfelder et al., (1997); and Simon et al., (1991). The same components can play the same or different roles in different fungi. For example, in 5". cerevisiae, GPA la and GPA2a regulate pheromone (mating) and nutrient (cAMP) signals respectively whereas in the opportunistic human pathogen Cryptococcus neoformans, GPA3a and GPA la are regulatory G-protein subunits in MAPK and cAMP pathways that influence virulence. The signaling pathways for U. maydis and specific model fungi will be discussed below to illustrate the current.level of knowledge about their functions. 1.2.1. Molecular mechanisms of signal transduction in U. maydis via the cAMP pathway The level of cAMP and PKA (Protein kinase A) activity regulates dimorphism in U. maydis (Gold et. al. 1994-b). In general, high PKA activity leads to the budding phenotype while low PKA activity leads to filamentous growth (and thus may be relevant to the infectious form of U. maydis). It is presumed that a transmembrane cell surface receptor exists that senses a specific extracellular signal that transmits into the cell via a heterotrimeric G-protein composed of a, P and y subunits (Regenfelder et al., 1997). The G protein activation as a result of a ligand binding to the receptor involves a GDP to GTP exchange process which results the release of Ga subunit from GPy dimmer. In U. maydis, Ga3 (gpa3), as one of four Ga subunit genes gpal-4, was shown to be required 7 for pheromone response, mating and pathogenesis (Gilman, 1984; 1987; Levitzki and Sinani, 1991; Regenfelder et al., 1997). For U. maydis, cAMP pathway mutants were characterized to understand the complex role of cAMP in morphogenesis, mating and pathogenesis. The gpa3 mutant was isolated by reverse genetics and it displayed constitutive filamentous growth. It was initially hypothesized to play a role in mating pathway by analogy with budding yeast, but cAMP suppression of the filamentous morphology of the gpa3 deletion mutants revealed its role in the cAMP pathway (Kruger et al., 1998). The adenylyl cyclase gene (uacl) was identified through the characterization of constitutively filamentous mutants (Barrett, et al., 1993; Gold et al, 1994). Mutants defective in uacl or gpa3 have similar phenotypes thus providing additional support for a shared role in the cAMP pathway. The ubcl gene encodes a regulatory subunit of PKA (Gold et al. 1994), while adrl encodes a catalytic subunit of PKA (Durrenberger et al. 1998). The ubcl gene was identified by its ability to restore filamentous growth in a uacl mutant background (in a suppressor screen). Mutant strains for the components of the cAMP and MAPK pathways along with their morphologies and the functions of the genes are presented in Table 1.1. In the cAMP pathway, hgll (Durrenberger et al., 2001) and lipl (M. Moniz de Sa, unpublished observations) are proposed to be acting downstream of adrl. It is interesting that the adrl gene has also been identified as playing a role in fungicide resistance (Ramesh et al., 2001). Hgll is proposed to have a regulatory function in the cAMP pathway (Durrenberger et al., 2001). 8 Figure 1.2: cAMP/PKA Pathway in Ustilago maydis. Mfal/2 Plant signals Teliospores and Tumors Filament formation Filament formation Cell fusion and mating 9 1.2.2. The MAPK pathway in Ustilago maydis The pheromone response pathway in U. maydis is regulated by the a and b mating type loci that were described earlier in this chapter. Both the al and a2 specificities of the a locus contain two tightly linked genes, mfa and pra, which encode a secreted pheromone and a G-protein coupled pheromone receptor, respectively (Spellig et al., 1994; Kronstad and Staben, 1997). The multiallelic b locus encodes the proteins that form an active bE/bW heterodimer which activates the transcription factor pfrl to ultimately regulate filamentous growth and pathogenicity. Following cell fusion, the active bE/bW heterodimer also represses gene transcription at the a locus (Romeis et al., 1997; Lengeler et al., 2000). Pheromone binding to its receptor is thought to activate a MAPK signal transduction pathway which is proposed to be similar to the well-characterized pheromone response pathway in S. cerevisiae (Spelling et al., 1994; Lengeler et al., 2000). The cis-acting elements present upstream of the bE and b W genes and the a locus genes (which are responsible for pheromone stimulation) are known as pheromone response elements (PREs); these are thought to be recognized by the HMG domain of the prfl gene product. In the pheromone response pathway, prfl regulates the transcription of pheromone induced genes (Basse and Farfsing, 2006; Hartmann et al., 1996) and is also thought to be downstream of the MAP kinase ubc3/kpp2. Some components of the MAPK pathway such as Ubc4, a MAP kinase kinase kinase (MAPKKK), Ubc5, a MAP kinase kinase (MAPKK), Ubc3, a MAP kinase homolog and Ubc2 fan adaptor protein) were found in a screen for suppressors of the filamentous phenotype of a uacl (adenylyl cyclase) mutant (Andrews et al. 2000; Mayorga and Gold. 1999, 2001; Mayorga and Gold. 1998). The ubc3 gene was also identified by a degenerate PCR approach and 10 termed kpp2, and a MAPKK homolog, Fuz7, was also identified by the similar approach (Muller et al. 1999; Bannuett and Herskowitz. 1994). These results reveal an integration of the MAPK and cAMP pathways (Kronstad and Staben. 1997; Lengeler et al., 2000). Both ubc3 and fuz7 mutants are unable to produce conjugation tubes in response to pheromones and both also are poor in mating as described by Mayorga and Gold, (1999). The ubc3 mutant exhibits a reduced basal level expression of mfal and a loss of induction by pheromone, but these are not observed in fuz7 mutants. Sequence similarities of the ubc2, ubc3, ubc4 and fuz7/ubc5 genes to the pheromone response pathway MAP kinase cascade members of S. cerevisiae, coupled with the direct evidence that mutation in any one of these genes causes suppression of the filamentous uacl mutant, suggests that these four ubc genes are members of a common cascade (Mayorga and Gold, 1998; Mayorga and Gold, 1999; Andrews et al., 2000). The open reading frame of ubc2 encodes several motifs similar to protein-protein interaction domains, some of which*are homologous to the yeast protein Ste5 that is involved in pheromone response (Mayorga and Gold. 2001). A genetic suppression approach with adrl mutants also identified a gene for a small GTP-binding protein (ras2) that is required for budding growth, pathogenicity and mating in U. maydis; this finding indicates that the cAMP pathway has an association with Ras2 signaling (Lee and Kronstad. 2002). The analysis also revealed that Ras2 promotes filamentous growth through the MAP kinase cascade and regulates mfal pheromone gene transcription. The ras2 mutants are unable to induce aerial hyphae formation when co-spotted with compatible ras2 strains, indicating that these mutants are defective in cell fusion and/or filamentous growth after fusion (Lee and Kronstad. 2002). 11 Table 1.1: Components of Ustilago maydis signaling pathways and their morphogenetic and pathogenic significance. Strain/gene/ mutant (developed) Component of pathway Morphology Function of gene In Vitro In Plant Wild type Budding Filaments, tumor and teliospores \gpa3 (PCR amplification by using Ga degenerate primers) cAMP G protein Filamentous growth Mating defect Signal receptor A ubcl (restored budding to A uacl in the presence of cAMP) Regulatory subunit of PKA Multiple budding No tumors, no teliospores Affect proliferation in plant tissue A hgll (suppressor of A adrl) cAMP Budding Tumors, no teliospores Required for teliospore formation \adrl (PCR amplification by using PKA degenerate primers) Catalytic subunit of PKA Filamentous No symptoms Essential for infection of plant tissue. Impairment in mating A ubc4/kpp4 (Suppressor of A uacl) MAPKKK Reduced cell fusion No filaments, no appressoria produced Required for conjugation tube formation A ubc5/fuz71 (Suppressor of A uacl) MAPKK Reduced cell fusion No filament formation Required for conjugation tube formation A ubc3/kpp2 (Suppressor of A uacl) MAPK Reduced cell fusion Reduced filamentation and virulence, no appressoria Required for conjugation tube formation A uacl (PCR amplification by using PKA degenerate primers) Adenylyl cyclase/ cAMP Filamentous Anthocyanin production Essential for infection of plant tissue Apr// (PCR amplification by using HMG degenerate primers) HMG-box transcription factor/ Mating pathway sterile Required for transcription of a and b genes, not required for conjugation tube formation A ras2 (suppressor mutant of A adrl) Small G protein/ Mating pathway Rounded cells, Filamentous when overexpressed No symptoms Defective, attenuated pheromone production and perception A mfal/2 Pheromone precursor/ Mating pathway Sterile Essential for sensing mating partner A pral/2 Pheromone receptor/ Mating pathway Sterile Essential for pheromone perception 12 As mentioned above, the MAP kinase module activates the downstream transcription factor prfl which contains several phosphorylation sites for both MAP kinases and PKA, and the gene is regulated posttranscriptionally by both pathways (Hartmann et al. 1999; Basse and Farfsing, 2006). Thus, Prfl represents a key regulatory function for integrating the pathways. Both these pathways and their interconnections are shown in Figure 1.2. The cAMP and mating pathways are known to share the same Ga-subunit, Gpa3p (Kahmann and Basse. 1997; Kronstad et al., 1998; Regenfelder et al., 1997). 1.2.3. Signaling pathways in Saccharomyces cerevisiae A key role of the cAMP pathway in budding yeast is nutrient sensing and the regulation of growth processes to enter into mitosis, meiosis or pseudohyphal differentiation. Nitrogen starvation induces pseudohyphal differentiation in diploid S. cerevisiae cells (Gimeno et al. 1992, Guillermond, 1920) and both the cAMP and MAP kinase signaling cascades work in parallel to regulate pseudohyphal differentiation (Lorenz et al., 2000; Mosch et al., 1999). Pseudohyphal growth in S. cerevisiae is characterized by unipolar budding, incomplete cell separation, cell elongation and invasive growth (Gimeno et al, 1992; Kron, 1997; Liu et al., 1996). The major components of the cAMP pathway in budding yeast are presented in Fig. 3. Two G-proteins, Ras2 and Gpa2 stimulate pseudohyphal differentiation via the cAMP pathway but Gpa2 is not involved in the MAP kinase pathway; Ras2 is able to activate the mating pathway as well. The cAMP pathway components include Gprl (G-protein coupled receptor), adenylyl cyclase and the regulatory (Bcyl) and catalytic (Tpkl, Tpk2 and 13 Tpk3) subunits of PKA (Ansari et al., 1999; Kubler et al, 1997; Pan and Heitman, 1999; Robertson and Fink, 1998; Xue et al., 1998). The PKA pathway activates pseudohyphal growth through the transcriptional regulation of Flo 11 by the transcription factors Flo8 and Sfll (D'Souza and Heitman, 2001; Pan and Heitman, 1999; Rupp et al., 1999). The MAP kinase pathway that is required for mating in haploid yeast cells in response to pheromones and for filamentous growth in diploid cells is activated by the G-protein Ras2 and Cdc42 (Mosch and Fink, 1997; Mosch et al., 1996). Components of MAP kinase cascade responsible for filamentous growth include the Ste20, Stell, Ste7 and Kssl kinases, and the Stel2 transcription factor. The Tecl transcription factor forms a heterodimer with Stel2 to regulate expression of the cell surface flocculin Flol 1 which is required for filamentation and agar invasion (Gavrias et al., 1996; Lo and Dranginis, 1998; Madhani and Fink, 1998). Floll appears to be a key target of the pathway and flol Imutants lack pseudohyphal filament formation (Lo and Dranginis, 1998). Farl is a Stel2-dependent and pheromone-induced gene that is a negatively-acting component of the mating pathway in terms of controlling cell cycle arrest. The expression of Flol 1 is regulated by both pathways. In addition G-protein Ras2 activates mating and cAMP pathways in S. cerevisiae (Mosch et al., 1999). However, Farl protein is a multifunctional regulator and it is known to also stimulate polarized growth of cell towards its mating partner (Bardwell, 2005; Saito and Tatebayashi, 2004). 14 Figure 1.3: cAMP/PKA Pathway in Saccharomyces cerevisiae. Glucose Unipolar Budding Cell elongation Cell adhesion, Agar invasion Pseudohyphal differentiation 15 Another pathway that contains a MAP kinase cascade in yeast is the HOG (High Osmolarity Glycerol) MAPK pathway that transduces a high osmolarity signal when cells are exposed to hyperosmotic conditions. As a stress response, cells produce various small molecules such as glycerol that increase the total intracellular solute concentration, thereby provide osmotic stabilization. Once the cells are adapted to the altered conditions, the HOG signaling machinery is deactivated (Patrick et al., 2004). 1.2.4. Signaling pathways in Cryptococcus neoformans Cryptococcus neoformans is a human pathogen fungus that is also a member of the basidiomycete group of fungi like U. maydis. In contrast to U. maydis, it has a bipolar mating system like some smut fungi (e.g., Ustilago hordei). Haploid strains of C. neoformans with the MATa mating type are capable of haploid fruiting, a process that involved a switch from budding to filamentous growth and sporulation (Wickes et al., 1996). Thus there are also similarities with the morphological switch that occurs during mating in U. maydis; fusion of budding haploid cells after pheromone exchange results in a filamentous dikaryon. The key signal transduction pathways for controlling morphogenesis in C. neoformans are conserved with other fungi but it is thought that there is a pathogen-specific adaptation for specialized roles depending on host cues. In particular, the cAMP-PKA pathway is important for morphogenesis and virulence. 16 Figure 1.4: cAMP/PKA Pathway in Cryptococcus neoformans. Filamentation, mating and virulence (Capsue/melanin/37°C) The pathway includes Gpal, a Ga protein, that transduces extracellular changes in nutrient concentration via the cAMP pathway, while Rasl influences both the cAMP and MAPK pathways. Gpal serves as a signaling element for capsule induction (a major virulence factor) in response to iron limitation but not in response to nitrogen or glucose starvation, which shows that it can sense diverse environmental signals. Other components of the cAMP pathway include adenylyl cyclase (Cacl) and Pkrl and Pkal, which are the regulatory and catalytic subunits of PKA, respectively (Asplaugh et al., 2002; D'Souza et al., 2001; Waugh et al., 2002). Mating pathway components include Gpbl (G protein p subunit), a MAP kinase homolog Cpkl and a transcription factor that is related to Stel2 in S. cerevisiae (Lengeler, 2000). 1.3. The hgll gene of U. maydis - a key target of cAMP signaling The hgll gene was identified in an attempt to find additional downstream components of the cAMP pathway through the collection and characterization of suppressor mutations that restored budding growth to the otherwise filamentous adrl mutant. Complementation of one of these mutations led to identification of the hgll gene (Durrenberger et al., 2001). Hgll is thought to act as a repressor of budding growth and in vitro experiments indicate that Hgll serves as a target for phosphorylation by PKA. In addition, hgll mutants constructed by targeted gene deletion are severely compromised in their ability to form melanized teliospores during infection so the gene is required for the morphogenetic switch and sporulation. The predicted sequence of 612 amino acids was not found to be homologous to any known sequences when searched for similarity by BLAST (Altschul, 1997). However, structural properties of the predicted sequence were 18 found to be similar to F I 0 8 and Sfll of S. cerevisiae, which as mention are known regulatory proteins that respond to the cAMP pathway (Fujita et al., 1989; Kobayashi et al., 1996). 1.3.1. The morphological influence of a mutation in the hgll gene. The hgll mutant strains exhibit smaller cell size as compared to wild-type cells. Wild-type cells have an average length of Hum whereas hgll cells in the adrl mutant background have an average length of 7.5 um (measurements were made on 100 cells) (Durrenberger et al., 2001). Colony size for the mutant was also smaller compared to wild-type colonies. Another distinguishing feature of hgll mutant strains was the production of a yellow compound(s) in the supernatant of culture media. Though the chemical nature of the yellow pigment is not known, it is possible that it could affect the plant host because of the larger tumor formation observed for hgll mutant strains (see below). 1.3.2. Pathogenicity of hgll mutants and in plant response The co-inoculation of mating compatible strains carrying different a and b loci and the hgll mutation resulted in an attenuated mating reaction on charcoal medium plates (Durrenberger et al, 2001; standard mating medium as described by Holliday, 1974). Formation of colonies covered with aerialhyphae (a 'fuz' reaction) is an indicator of subsequent pathogenicity on corn plants. On the basis of the results of the mating assay, corn seedlings were inoculated with hgll strains of opposite mating type and disease severity was found to be closely similar to wild type disease symptoms. These 19 findings suggested that this gene is not required for infection, proliferation in the plant and tumor induction. But closer inspection of tumors revealed the absence of the mature melanized teliospores which are characteristic of the disease caused by wild-type strains. This result showed that the hgll gene is required for sporulation in host tissue. In addition, observations on infections of the ears of mature plants suggested that loss of hgll function resulted in larger tumors, although this affect has not yet been quantified (Durrenberger et al, 2001). 1.3.3. Role of hgll in signaling The adrl gene encodes the majority of PKA activity in U. maydis (Durrenberger et al., 1998). As mentioned above, a defect in adrl results in constitutive filamentous growth in culture, and budding growth is restored by a mutation in hgll. PKA may regulate, directly or indirectly, the activity of Hgll protein to influence the switch between budding and filamentous growth. In addition, the level of Hgll protein may be positively regulated via the activation of hgll gene transcription during mating. One aspect of the model proposed by Durrenberger et al, 2001 suggested that Hgll protein negatively influences budding growth and pigment production. The hgll gene is also required for teliospore formation, and one possibility is that Hgll protein negatively regulates the expression of an activity that blocks sporulation. The possibility that Hgll protein may have a positive influence on filamentous growth and sporulation was also proposed as an alternative model (Durrenberger et al, 2001). 20 1.4. Genome-wide gene expression studies in Ustilago maydis The processes regulated by the cAMP and MAPK pathways in U. maydis still need to be explored in detail to generate a comprehensive view of targets of the cAMP/PKA and mating pathways. Recently a comparative transcriptome analysis was done by Larraya et al., (2005) for a wild-type strain and mutant strains defective in the regulatory (ubcl) or catalytic (adrl) subunits of PKA. The SAGE (Serial analysis of gene expression) technique was used to generate 10-14 bp tags that represent individual transcripts and large scale sequencing was done to determine the frequency of occurrence of these tags to measure the transcript levels. Genes with varied transcript levels were found depending on the status of PKA activity (high in the ubcl mutant and low in the adrl mutant). Many ribosomal genes were also found with different transcript levels along with the genes encoding metabolic and mating type genes. The ubcl mutant displayed elevated transcript levels for genes involved in phosphate acquisition and storage, thus revealing a connection between cAMP and phosphate metabolism. Elevated phosphate levels in culture media also enhanced the filamentous growth of wild-type cells in response to lipids, a finding consistent with PKA regulation of morphogenesis in U. maydis (Larraya et al., 2005). The group of J. Kamper in Marburg, Germany has also been using Affymetrix arrays to analyze gene expression in U. maydis. This work has focused on identifying genes controlled by the mating type regulators, by the cAMP pathway and by the MAPK pathway. Although this work has been described at conferences, no publications have appeared that report the results. 21 1.5. Sequence of the U. maydis genome The U. maydis genome for strain 521 consists of a 10X whole genome shot gun assembly that was released in 2004 by the Whitehead Institute Centre for Genome Research (WICGR) and Bayer Crop Science (http://www.broad.mit.edu/annotation/genome/ustilago maydis/Home.html). The sequence data comprises 17.4 Mb in 28 contigs that cover 23 chromosomes and 6522 genes. A more complete annotation is still required for comprehensive analysis of gene functions and pathways in U. maydis but the sequence represents a tremendous resource for studying pathogenesis and gene expression. The MIPS Ustilago maydis Genome Database (http://mips.gsf.de/genre/proj/ustilago/) has recently presented information on the molecular structures and functional networks encoded by the entirely sequenced genome by manually processing all the contigs (comprising 19.7 Mb). The underlying sequence is the initial release of the high quality draft sequence of the Broad Institute but 1505 gene models from an independent gene set prepared by MIPS were added after the initial release of the sequencing data. These genes are integrated to the MIPS database because they are different from the Broad's gene set. Overall, the genome sequence provided the background information for the SAGE project described by Larraya et al. (2005) and for the SAGE analysis described in this thesis. Expressed sequence tags (ESTs) for U maydis are also available at the Cogeme database (http://cbr-rbc.nrc-cnrc. gc. ca/servi ces/co geme/). 22 1.6. Objectives of this study During recent years, genomic databases for different organisms have developed very rapidly and have made it possible to explore sequences and functions of genes of interest. In the work described in this thesis, the SAGE approach was to establish a view of the transcript levels in a wild-type strain in comparison with an hgll mutant strain. Because hgll was proposed to be a putative downstream regulatory component in the cAMP pathway, it was interesting to investigate this gene further to dissect the cAMP pathway in more detail in U. maydis. The first objective of the project was to compare the expression levels of these strains through the construction of SAGE libraries. The SAGE approach was used because it gives a quantitative gene expression profile without the prerequisite of a hybridization probe for each transcript (as would be needed with microarrays) and the availability of genome databases facilitated analysis of the data to link the expression data for various interesting genes to their predicted functions. The second objective of the research was to validate the expression of the genes identified by SAGE using RNA blot hybridization and real time PCR. The final objective was to select one or more genes of interest from the SAGE results, and to use reverse genetic approaches to further characterize the roles of these genes. This objective was achieved by knocking out the cthl (Cystine 3-histidine) gene encoding a putative zinc finger protein in strains of both mating type backgrounds. The role of this gene in mating and pathogenicity was then investigated using the knock out mutants. Overall, this work makes a contribution to our understanding of the cAMP signaling pathway in U. maydis and provides a wealth of expression data for future analysis. 23 CHAPTER 2: MATERIALS AND METHODS 2.1. Strains and growth conditions The U. maydis strains used in the present study are listed in Table 2.1. Table 2.1: S t ra ins Starin Genotype Phenotype on PDA Developed by 002/521 albl Budding Holliday, R. 1974 001/518 a2b2 Budding Holliday,R. 1974 hgll/30\0 A cthl::Hyg albl Budding Durrenberger et al. 2001 Cthl-12 A cthl::Hyg albl Budding Present study Cthl-15 A hgllr.Hyg a2b2 Budding Present study For SAGE library construction, 5 ml of potato dextrose broth (PDB; Difco) media were inoculated with 002/521 and hgll/30\0 and grown overnight at 30°C in a gyratory shaker (250 rpm). These cultures were used to inoculate 250 ml of PDB medium that was grown overnight in a shaking incubator at 30°C to obtain 1.5 x 107 cells per ml. A hemocytometer chamber was used to count the cells. Cells were harvested by centrifugation at 7500 rpm for 10 minutes at 4°C and frozen immediately on dry ice. These cells were further lyophilized (freeze dried) at -20°C overnight and used for RNA isolation. 2.2. RNA and DNA isolation methods Total RNA from wild-type (521/002) and mutant (hgll) strains was isolated from the lyophilized cells by resuspending the cells in 15 ml of TRIZOL (Invitrogen) extraction buffer following the manufacturer's recommendations. Total RNA was checked for quality by examining ribosomal RNA bands on an agarose gel. Ribosomal RNA bands were visualized by staining with ethidium bromide. In general, ribosomal 24 RNA constitutes about 80-85% of total RNA and about 15-20% transfer RNA is present, while only 1-5% of the total is messenger RNA. For Northern blot analysis, a total of 10 ug RNA/lane was loaded on a formaldehyde gel and transferred to H+ nylon membrane overnight according to the protocol described by Sambrook et al. (1989). Hybridization probes for Northern blot analysis to verify SAGE expression data were amplified by PCR 32 from genomic DNA using the primers listed in Table 2.2 and labeled with an P and an oligonucleotide labeling kit (Amersham Pharmacia Biotech, Inc.). Primers for amplification of hybridization probes were designed by using the Invitrogen online primer designing tool known as "Oligoperfect designer" (http://www.invitrogen.com/content.cfm?pageid=9716'). The labeled probes were hybridized to the membrane containing total RNA. Phosphoimager screens were scanned to view the expression results. Genomic DNA was isolated following the protocol by Durrenberger et al., (2001) for Southern blot analysis to confirm the mutants. Eight mutants for each mating type were selected for analysis. The genomic DNA sequence was evaluated to find unique restriction sites and the DNA was cut with the JVgoMIV restriction enzyme to generate 6.5 kb and 7.8 kb fragments of the wild-type and mutant genes, respectively. Southern blots were hybridized and processed using the protocol of Sambrook et al., (1989). The so-called right arm (RA) sequence that was amplified for knocking out cthl was used as probe for hybridization (see Chapter 3 Figure 3.3). 25 Table 2.2: Tags selected for amplification of probes for Northern blot analysis Gene Tag hgll wt MUMDB** gene# Related Domain Gene length(nt) Organism Primers for Probes primer length Amplicon size (bp) TCTCGCTTTT 14 1 UM05176 Hypothetical protein (TMS_TDE) 1674 Ustilago maydis 5TCATCGTCGTTGGTTTGGTA3' 5'GGTCGACTCTCGTTCAAAGC3' 20 20 532 CCAATGAATA 46 85 UM00495 Hmp1 715 Ustilago maydis 5'GCTGGTACCGTCAAGGAGAC3' 5'CAATGGTCGATGACCAAACA3' 20 20 398 ATGGCGGCAT 8 24 UM03880 conserved hypothetical protein 1279 Ustilago maydis 5'GGCAAGAATCAGGAGCAGTC3' 5'CGTTGGGATTTGAATCAACC3' 20 20 198 * Tag frequencies have been normalized to the size of the smaller library for comparison (wild-type, 13867 tags). ** MUMDB, MIPS Ustilago maydis database (http://mips.gsf.de/genre/proj/ustilago/). 26 2 . 3 . SAGE methodology The SAGE method described by Velculescu et al., (1995) and also available at www.sagenet.org was used for library construction. Total RNA was used to isolate Poly (A+) RNA by using an mRNA synthesis kit (Qiagen; catalogue No: 70042). Poly (A+) RNA was further converted to double stranded cDNA by using an Invtrogen kit (Superscript II RT; Cat No: 18064-014) and biotinylated oligo dT (dT )8) to further construct libraries of 10-14 nt SAGE tags. cDNA was cleaved with Malll (NEB; Cat. No: 125S) and streptavidin beads (Dynal; Cat No: 112.05) were used to bind 3' fragments and linkers containing BsmF\ (NEB; Cat No: 572S) restriction site were ligated to 5' ends. At this point, BsmFl enzyme was used to release the tags from the streptavidin beads (Dynal). Here an extra purification step was performed to remove linkers, and tags were ligated to form ditags which were amplified through PCR under optimized conditions. Twenty six PCR cycles were used to amplify ditags, these ditags were concatamerized and cloned into pZero 1.0 vector at Sphl (Invitrogen; Cat No: 15413.06) site using pZero cloning kit (Invitrogen; Cat No: K2500-01). Colony PCR was performed by using Ml3 forward and Ml3 reverse primers to screen the colonies for insert size analysis and to determine the percentage of non-recombinants. Sequencing was performed by the Genome Sciences Centre by BigDye primer cycle sequencing and analyzed on ABI PRISM 3700 DNA analyzer. Fourteen base pair tags were extracted from the vector clipped sequence. In the present study, only tags with >99% predicted sequence accuracy were used and method of Audic and Calverie (1997) was used to determine statistical differences for tag abundance between two libraries. 27 2.4. SAGE data analysis Tag to sequence mapping was done by using U. maydis SAGE data available at the BC Genome Sciences Centre website. Identified sequences were selected two kb up and downstream of the particular tag sequence and were further used to BLAST against MIPS (Munich Information Centre for Protein Sequences; http ://mips. gsf.de/genre/proj/ustilago/) and NCBI (National Centre for Biotechnology Information; http://www.ncbi.nih.gov/index.htmD databases to find sequences with significant similarities to the query sequences. Preliminary tag assignments to predicted genes were also based on the EST hits found for tags at Cogeme (Consortium for the functional genomics of microbial eukaryotes) database (Soanes and Talbot, 2006; Soanes et al., 2002; http://cbr-rbc.nrc-cnrc.gc.ca/servdces/cogeme/). Tags with significant EST hits were further annotated to achieve a better understanding of related genes and their predicted functions with associated domains found as significant BLAST hits at the NCBI non-redundant database. For the hgll library, about 50 tags out of 150 tags were selected for characterization and these are presented in Table 3.2 along with the preliminary gene designation and related domains. The table also presents significant BLAST results, percent identity, percent similarity and e-values. In some cases, more than one tag showed the same gene assignment and that may be indicative of different splicing events or differences in poly(A) site use. 28 2.5. RT-PCR (Reverse transcriptase - Polymerase chain reaction) To verify the SAGE expression data for selected genes, two-step RT-PCR was performed. Total RNA from wild-type (002/albl) and Ahgll:±ygBr (3010/aiW) was isolated as described above. A total of 5 ug for each of the strains was used to synthesize first strand cDNA by using an Invitrogen kit, cat. No. 11904-018 (Superscript first strand synthesis system for RT-PCR). For the RT-PCR reaction, the quantitect SYBR green PCR kit (Qiagen; Cat.No. 204143) was used. Primers were designed by using software in the package "Vector NTI". To eliminate the possibility of generating false positive PCR fragments from contaminating genomic DNA, primer sequences were designed to span intron regions following manufacturer's instructions, as genomic sequence data was available. Tags selected for this analysis along with the primers designed are listed in Table 2.3. Polymerase chain reactions Were performed on a DNA engine opticon system (MJ Research Inc, MA, USA). Cycle threshold values were averaged from at least 3 replicates for each sample. 29 Table 2.3: Tags selected for RT-PCR and primers designed for amplification of the PCR product Tag tag frequencies* hgll WT MUMDB gene** No. Predicted domain No. of exons length in nt Primers Length Amplicon (nt) size CCAGCCCACA 96 TTGTATGGTT CGGCTCTTCC TCTCGCTTTT 20 19 GATGCTTTTT 14 14 1 UM03945 ABC transporter 0 UM05773 GATA zinc finger 0 UM01950 Glycosyl hydrolase 0 UM01649 CCCH zinc finger 1 UM05176 TMS1 GAAGGCAGAG 12 0 UM06414 • Polyketide synthases TGAAGGAATG 10 1 UM05698 Ser/thr protein kinase CGACCAATAG 10 0 UM03342 FHA domain CACACGCACA 4 48 CTTTTGTAAC 4 26 GCACCCATCT 0 24 Internal control UM05577 PHD zinc finger UM01636 DHHC zinc finger UM01051 mdr transporter UM05715 Actin 1 2448 5'AGGACTCAAATTGGCTCGCAC3' 21 139 5'AGTTTGATGACATTGCGCCG3' 20 1 1590 5'ACCACAGAACCAGCTCAAGTCGAAC3' 25 197 5TTGTTGGCCGCATTCGTAGC3' 20 1 1176 5'AGCTCCTGCACAATGAAGATCG3' 22 127 5TCGAAGAGCGCATACAGAGC3' 20 2 1324 5'GCTACTACGGAGATCGATGTC3' 21 149 5'CAGTAGCCATTGAATCGAGG3' 20 3 1674 5'ATCCGTAGCCAGCTCATGTGTTG3' 23 140 5'GCGCGTCAAGGCAGAATATG3' 20 1 6366 5TATCCTCCCCTCGTCAGCCATATC3' 24 132 5'AAGACAATCACGGAAGCGCG3' 20 1 2253 5'ACACGCCCTCTCATCAGATTCG3' 22 144 5TCCACTTTTTGTCCTTGCCG3' 20 1 3339 5'ATACAAACCTCGCACATCCGTC3' 22 148 5'CGGAACATGCGACCAATAGC3' 20 1 3693 5'CAAAGGTTATAGCTGGACGTGCG3' 23 148 5'CTGATGCCTTGGCTGATTGG3' 20 3 1958 5'GCCGAACTCGAACATCTGCATTTGGTC3' 27 196 5'AATGACCGACACAGTTGGCG3' 20 1 1647 5'CTGGCTCAATGTCATCTCCTCG3' 22 110 5'CAAAGAGAAAGACAGCGGCG3' 20 1 1605 5TATACGGAGGCGACGAGATCAAC3' 23 144 5'CGGCAATAGCATCATCGGTG3' 20 * Tag frequencies have been normalized to the size of the smaller library for comparison (wild-type, 13867 tags). ** MUMDB, MIPS Ustilago maydis database (http://mips.gsf.de/genre/proj/ustilago/). 30 2.6. Double-joint PCR to knock out the cthl gene The genomic sequence of gene UM01649 (hypothetical protein) for the cthl gene was obtained from the MIPS database. To knock out this gene, the double-joint PCR approach was used as described by Yu et al., (2004); this is a modification of the overlap PCR procedure described by Davidson et al. (2002). Mutants were generated in both wild-type background strains (002/521: albl and 001/518: a2b2) to establish mating compatible pairs lacking the cthl gene (allele designated cthl:: hygBr). The primers were designed by using Vector NTI software and were used to amplify left arm (LA), right arm (RA) and marker (M) sequences from genomic DNA or a plasmid (for the hygBr gene) in the first round of PCR (presented in Table 2.4). All three components were amplified separately and were put together in a 1:2.7:1 molar ratio for a second cycle of PCR amplification. Nested primers designed within the LA and RA were used for amplification of a 3558 bp long marker cassette in the third round PCR. Transformation of wild-type strains (both backgrounds) was done by using biolistic transformation method (Finer et al., 1992; Sanford et al., 1993). A total of about >80 transformants for 002/521 (albl) and >100 transformants for 001/518 (a2b2) were obtained when grown on complete medium plates containing hygromycin (Invitrogen) at a concentration of 250 microgram/ml. Colony PCR was performed for sixteen selected clones for each of the strain types by using primers outside of the construct and within the hygromycin marker, and eight transformants for each strain with homologous replacement of the wild type allele were further confirmed by Southern blot analysis. 31 Table 2.4: Primers used to construct the hygromycin cassette for the cthl knock out. PCR product CCCH-Hyg Primer sequence length size Primerl (P1) Primer3 (P3)* 5'ACTCGCGGTTCTGAGCAACT3' 5TAGCACACGACTCACATCCAGCTTCAGATCGAGCCTAA3' 20 38 836(LA) Primer2 (P2)* Primer5 (P5)* 5TTAGGCTCGATCTGAAGCTGGATGTGAGTCGTGTGCTA3' 5'AAGAATACGACGAGGGGGCGAGATCAGCGATTGAAGCACAGT3' 38 42 2695 (M) Primer4 (P4)* Primer6 (P6) 5'ACTGTGCTTCAATCGCTGATCTCGCCCCCTCGTCGTATTCTT3' 5'CGATTTGCGTCGAGTGCCAT3' 42 20 852 (RA) Nested CTH-F (P7) Nested CTH-R (P8) 5'AAAGAGGCCAGGGAATCGAATCG3' 5'CCACATACATGCATTCACACCAGC3' 23 24 3558 * Sequence presented in pink and blue for P2, P3, P4 and P5 are the complementary marker sequences which join during the 2nd PCR cycle to produce KO construct. 2.7. Morphological studies of the knock out mutant strains 2.7.1. In vitro studies Haploid strains of 002/521 (albl), 001/518 (a2b2), Acthl::hygBr albl and Acthl ::hygBT a2b2 were grown overnight in the PDB (potato dextrose broth) medium in a shaking incubator at 30°C. These strains were used to perform plate mating assay by combining 5 ul drops in the following mixtures: 001 (a2b2) x 002 (albl), 001 (a2b2) x Acthl ::hygBr albl, Acthl :±ygBT a2b2 x 002 (albl) and Acthl ::hygBT a2b2 x Acthl::hygBr albl. Mating assays were performed on complete medium plates containing activated charcoal as described by Holliday (1974). These plates were incubated in a 30°C incubator for 72 hours. Overnight cultures of haploid cells were also used for microscopic analysis to observe the morphologies of the mutant cells as compared to the wild-type strains. 32 2.7.2. In planta analysis of the cthl knock out mutants Cultures for 002/521 (albl), 001/518 (a2b2), Acthl::hygBr albl and Jc^7::hygBr a2b2 were grown in PDB (potato dextrose broth) medium overnight in a shaking incubator at 30°C and were mixed in four different combinations: 001 (a2b2) x 002 (albl), 001 (a2b2) x Acthl::hygBT albl, Acthl ::hygBr a2b2 x 002 (albl) and Acthl::hygBr a2b2 x Acthl::hygBr albl (to a final concentration of lxlO 6 cells/ml). One-week old corn seedlings of the Golden Bantam variety were grown in the greenhouse and were inoculated with the mating cultures through the stem by injecting culture into the seedlings until a drop of inoculum appeared at the plant tip. Data were recorded for disease severity after two weeks of inoculation. Disease ratings are scored for infected plants as follows: 0, no disease; 1, anthocyanin production; 2, leaf tumors; 3, small stem tumors; 4, large stem tumors; and 5, death. The numbers of plants from three individual experiments were pooled for each cross and approximately 100 plants for each cross were scored for disease. 2.8. Microscopic studies Haploid cultures grown in PDB medium as explained above were used for microscopic analysis. For nuclear staining, DAPI (4', 6'-diamidino-2-phenylindole; Sigma) was used at a concentration of 0.1 mg/ml and haploid cells from the overnight grown culture were observed on Zeiss axioplan fluorescent microscope under UV fluorescence. For nuclear staining, 1 ml of each of the cell cultures was centrifuged in a microcentrifuge for one minute at maximum speed at room temperature and resuspended in 100 pi of DAPI (100 ug/ml). Cells resuspended in DAPI were incubated for 10 33 minutes at room temperature and washed three times in sterile dl-fjO. They were then viewed for DAPI stained nuclei under UV fluorescence with a Zeiss axioplan microscope. Both the calcofluor and DAPI stained celis were observed by differential interference contrast (DIC) as well. Two weeks after inoculation, the tumors from the infected plants were isolated and sections of the tumors for 001 (a2b2) x 002 (albl) and Acthl::hygBr a2b2 x Acthl ::hygBr albl inoculated plants were placed in a drop of water and observed with the Zeiss axioplan microscope. 34 CHAPTER 3 : RESULTS 3.1. Overview of the Serial Analysis of Gene Expression data The initial objective of this project was to use the technique of Serial Analysis of Gene Expression (SAGE) to compare the transcriptomes of a wild type strain and a strain defective in the hgll gene. As described in Chapter 1, hgll encodes a putative regulatory protein that is downstream of protein kinase A and that influences morphogenesis and sporulation. The SAGE technique developed by Velculescu et al. (1995, 1997) generates short tags representing specific transcripts and these tags can be used to identify the corresponding genes by database searching. A count of the frequency of occurrence of each tag provides a measure of transcript abundance. This technique does not require prior knowledge of the complete genomic sequence and it is possible to generate transcriptome data and analyze SAGE tags for subsequent tag-to-gene mapping once genomic or EST sequence information becomes available. To apply the SAGE method for this project, total RNA was isolated from wild-type and hgll mutant strains and used to construct libraries of 10-14 nt SAGE tags. The total tag numbers for hgll and wild type libraries were 28418 and 13867, respectively. For hgll, 7813 tags occurred once and 5,902 tags occurred more than once, whereas for the wild-type strain, 3207 tags occurred only once and 1594 tags were found to occur more than once in the transcriptome data. These numbers provide an approximation of the total number of genes expressed for the different strains of U. maydis, although it is generally difficult to estimate gene numbers from SAGE data (Stern et al. 2003). For comparison, 6522 genes have been annotated using the U. maydis genomic sequence (MIPS database). A summary of the SAGE tags for both libraries including total number of tags and tags found under different abundance 35 classes is presented in Table 3.1. Data shown in the table reflect Phred scores that provide a 99% probability that each tag sequence is correct. It is interesting that the two libraries have 1.68% and 3.62% differential expression for upregulated tags in the wild-type and mutant strain libraries, respectively, indicating a considerable amount of differential gene expression as a result of loss of hgll. Quantitative profiles for the transcriptome data are discussed in the next section of this chapter. Differentially expressed tags for the two libraries are graphically presented in Figure 3.1. The graph was generated by using Discovery Space software which was developed by BC Genome Sciences Centre for the analysis of SAGE data. The green dots in the graph are representative of differentially expressed tags while blue dots (tags) show similar levels between the libraries. The top 150 tags from each library were selected for annotation and 300 tags that matched gene sequences were analyzed further. Table 3.1: Abundance classes for hgll and wild type SAGE libraries Characteristic WT hgll Total no. of tags* 13867 28418 Tag families No. (%) of singletons No. (%) with 2-9 tags No. (%) with 10-99 tags No. (%) with > 100 tags Total no. of tags 3207 (66.79) 1353 (28.18) 235 (4.89) 6(0.12) 4801 7813 (69) 3088 (27.27) 412 (3.6) 9 (0.08) 11322 Differentially expressed genes (P< 0.01) Upregulated in WT library Upregulated in hgll library 257(1.68%) 552(3.62%) * Ninety-nine percent probability that each tag is correct. 36 Figure 3.1: Differences and similarities between wild type and hgll libraries hgll mutant vs wild type 5.0 1e01 5.0 1e02 U. maydis hgll mutant Total: 15266 Note: Blue Green dots represent differentially expressed tags. The figure above shows an image from the Scatter Plot generated by using the discovery space software (version 3.1.1; 2003). Each point represents a particular tag sequence and its location indicates the relative expression of the given tag. The points in blue represent those tags that are similarly expressed. The blue green points along x-axis are those tags that are upregulated in hgll library and the points in the same color along y-axis represent upregulated tags in wild-type library. These upregulated tags from both libraries have been selected and used for further analysis. 37 3.1.1. Genes with differential expression in the hgll mutant The initial analysis of the SAGE data involved identifying the genes that were represented by each differentially expressed tag. Tag to sequence mapping was done by using the U. maydis SAGE database available at the BC Genome Sciences Centre website and using EXCEL spreadsheets to store the data. Tag sequences were used in BLASTN searches with genomic sequence (Broad Institute) and the sequences two kb upstream and downstream of the particular tag sequence were selected for further BLASTN analysis against the MIPS and NCBI databases for finding hits with significant similarities to the query sequences. Preliminary tag assignments to predicted genes were also based on the EST hits found for tags at the Cogeme (Consortium for the functional genomics of microbial eukaryotes) database (Soanes and Talbot, 2006; Soanes et al., 2002; http://cbr-rbc.nrc-cnrc. gc.ca/services/cogeme/). Tags with significant EST hits were further annotated to achieve a better understanding of the genes and their predicted functions, including a characterization of associated domains found to be significant by BLAST with the NCBI non-redundant database. For the hgll library, 50 out of 150 tags were selected and these are presented in Table 3.2 along with the preliminary gene designations and related domains. The table also presents the most significant BLAST hits, along with the corresponding percent identity, percent similarity and e-values. 38 Table 3.2: Upregulated tags in the hgll library and/or downregulated in the wild-type library. Normalized frequencies* MUMDB' hgl gene % % Tag sequence 1 WT number p-value*** Preliminary gene designation related Domain Blast Hit at NCBI**** E-value ID Sim CCAGCCCACA 96 1 UM03945 8.85E-33 related to Peroximal ABC transporter 1 ABC_ATPase Cryptococcus neoformans AAW41159.1 0 48 61 AGGATCACCG 56 0 UM01646 2.84E-20 probable replication licensing factor MCM4 MCM minichromosome maintenance Aspergillus fumigatus EAL93201.1| 0 49 65 TATGGTGCTT 53 1 UM05736 7.67E-18 Conserved hypothetical protein Asp Aspartyl protease Cryptococcus neoformans AAW46352.1 2.00E-29 27 43 CCCAACTCGG 32 0 UM02605 5.46E-12 hypothetical protein PHD zinc finger Cryptococcus neoformans AAW42860.1 7.00E-05 27 41 TCGCCAGATT 32 0 UM00046 8.13E-12 related to flavin oxidoreductase oxidoreducase_FNM Deinococcus geothermalis ZP_00396988.1 2.00E-76 45 57 GCGGCGTCGT 28 0 UM00029 1.95E-10 probable myo-inositol oxygenase DUF706 family of unknown proteins Cryptococcus neoformans AAN85573.1 e-106 57 71 ATTGAGATGG 25 0 UM00270 1.42E-09 putative protein No significant hits CCACCTGACT 24 0 No hit 3.15E-09 Putative chitin synthase enzyme chitin synthase 1,2 Agaricus bisporus CAB96110 0 61 74 TAACTCAAGA 24 0 UM02091 4.69E-09 probable MRF1 - peptide chain release factor, mitochondrial PrfA. Protein chain release factor A Magnetospirillum magnetotacticum ZP_00052537.1 2.00E-56 40 59 CACCACATTC 23 1 UM05609 1.74E-07 hypothetical protein Arabaidopsis thaliana NP_191203.2| 8.00E-11 27 40 TTCTGGCAGA 22 0 UM05981 1.55E-08 probable TP01 - Vacuolar polyamine-H+ antiporter sugar (and other) transporter Zygosaccharomyces bailii CAD56485.1 3.00E-63 35 51 TATTAGCACA 21 0 UM05311 5.09E-08 hypothetical protein No significant hits GCATTGCTTG 20 0 UM03502 7.58E-08 related to DIA4 - strong similarity to seryl-tRNA synthetases Seryl-tRNA synthetase (SerRS) class II core catalytic domain. Arabaidopsis thaliana AAM67511.1 3.00E-68 35 50 TTGTATGGTT 20 0 UM05773 1.13E-07 Hypothetical protein GATA zinc finger Neurospora crassa CAD21376.1 8.00E-16 64 72 ACATTTCCGA 20 0 UM04075 1.13E-07 hypothetical protein No significant hits CGGCAGAGCC 20 0 UM05260 1.68E-07 related to inorganic phosphate . transporter sugar (and other) transporter Thermoplasma volcanium NP 110642.1 8.00E-31 29 45 39 Table 3.2 ~ Continued CGGCTCTTCC 19 0 UM01950 2.50E-07 conserved hypothetical protein Glycosyl Hydrolase Family Aspergillus fumigatus e-103 51 65 88 EAL84434.1 AGCACTGCAC 17 0 UM05671 1.22E-06 related to acetylornithine ArgD, Aspergillus fumigatus 1.00E- 45 63 aminotransferase precursor Ornithine/acetylornithine EAL93541.1 105 aminotransferase GAGTCCAAGT 17 0 UM05773 1.22E-06 hypothetical protein GATA zinc finger Neurospora crassa 8.00E-16 64 72 CAD21376.1 ACACGTCTGG. 17 0 UM05627 1.82E-06 probable xanthine phosphoribosyl Predicted Saccharomyces 6.00E-35 42 58 transferase phosphoribosyltransferases cerevisiae NPJ510687.1 ACTGCCAGAA 16 0 UM01826 4.03E-06 Hypothetical protein No significant hits GCAACCTCGT 15 0 UM00352 6.00E-06 conserved hypothetical protein UPF0061, unknown protein Schizosaccharomyces 3.00E-67 40 60 pombe CAB11255.1 ACTTCGTCCG 14 0 UM00372 1.33E-05 probable SPF1 - P-type ATPase - Cation transport ATPase Saccharomyces 0 49 66 unknown function cerevisiae NP_010883.1 GATGCTTTTT 14 0 UM01649 1.33E-05 Hypothetical protein CCCH Zinc finger protein Pan troglodytes 4.00E-12 28 45 XP_510026.1 TCTCGCTTTT 14 1 UM05176 1.44E-04 related to TMS1 protein TMS.TDE . Homo sapiens. 4.00E-45 28 43 CAB09783.1 CACATTCTTT 14 0 UM05994 1.98E-05 hypothetical protein WD40 Schizosaccharomyces 3.00E-10 31 48 pombe T41156 TATCGTATCC 14 1 UM05430 2.08E-04 Hypothetical protein No significant hits No significant hits GCTTCCATCA 13 0 UM01699 2.94E-05 conserved hypothetical protein No significant hits CAGGTGCATC 13 0 UM01699 4.38E-05 conserved hypothetical protein AGTAACGATG 12 0 UM02358 6.51 E-05 related to SYP1/YCR030C FCH, Fes/CIP4 homology Cryptococcus 6.00E-47 22 38 domain neoformans CNK00960 AACCTCAATG 12 0 UM02612 6.51 E-05 probable vacuolar sorting protein Sec1 family. Magnaporthe grisea 1.00E-89 38 56 (hbrA) AAX07696.1 GAAGGCAGAG 12 0 UM06414 6.51 E-05 related to Conidial green pigment polyketide synthases (PKSs) Emericella nidulans 1.00E-68 25 43 synthase Q03149 40 Table 3.2 -- Continued CTTTCTTCTC 12 0 UM06434 6.51 E-05 conserved hypothetical protein Cryptococcus 1.00E-21 23 39 neoformans AAW45659.1 GGTATCCTTG " 12 0 UM05818 9.69E-05 related to saccharopine reductase Saccharopine • Filobasidiella 0 54 69 dehydrogenase. neoformans AAK83327.1 GCTGCGAAAA 12 0 UM05804 9.69E-05 Hypothetical protein C2H2 Zinc finger No significant hits TTGATGTCTT 11 0 UM04677 1.44E-04 conserved hypothetical protein No significant hits TGAAGGAATG 10 1 UM05698 0.002621 probable ser/thr protein kinase Serine/Threonine protein Saccharomyces 9.00E- 43 58 682 kinases, catalytic domain; cerevisiae CAA42256.2 122 Phosphotransferases. CGACCAATAG 10 0 UM03342 3.19E-04 conserved hypothetical protein Forkhead associated domain Saccharomyces 2.00E-40 44 64 (FHA); nuclear signaling cerevisiae DAA05593.1 domain TGGATGTGGA 10 0 UM00877 3.19E-04 related to HMT1 - hnRNP arginine Predicted RNA methylase Arabidopsis thaliana 8.00E-51 38 56 N-methyltransferase NPJ99713.2 TTTGTGGAAT 10 0 UM05182 3.19E-04 Hypothetical protein HSF DNA binding domain Saccharomyces 7.00E-21 39 55 cerevisiae CAA96777.1 * Tag frequencies have been normalized to the size of the smaller library for comparison (wild-type, 13867 tags). * MUMDB, MIPS Ustilago maydis database (http://mips.gsf.de/genre/proj/ustilago/). ** Statistical significance of the differential tag frequencies between libraries. ***NCBI, National centre for biotechnology information (http://www.ncbi.nlm.nih.gov/). 41 The tags that did not match to either the Ustilago EST or genomic database may have a sequencing error in the tag or may be due to incomplete genomic or EST sequence data, or the tags may span an intron position and therefore not match the genomic sequence (Larraya et al. 2005). Tags with differential expression levels between the two libraries were divided into different categories on the basis of their predicted protein functions and these are presented in Table 3.3. A total of 94 tags from both libraries were placed under 17 different GO (gene ontology) terms. This analysis did not include tags with unknown or uncharacterized protein functions. This classification after gene identification was according to the controlled vocabulary determined by the Gene Ontology (GO) Consortium (Joslyn et al., 2004; Khan et al., 2003; Lomax, 2005; Stanley et al., 2006). In the hgll library, a number of tags were found to match genes related to cellular transport: for example, ABC transporter, sugar transporter, inorganic phosphate transporter, flavin oxidoreductase, vacuolar polyamine -H+ antiporter, WD40 domain and probable vacuolar sorting protein. The ABC trabsporter identified by tag CATGCCAGCCCACA (peroximal transporter) is interesting because other work in our laboratory has implicated peroxisome function in virulence (Klose and Kronstad; Manuscript submitted). Recent genome-sequencing data and a wealth of biochemical and molecular genetic investigations have revealed the occurrence of dozens of families of primary and secondary transporters in fungi. Two such families have been found to occur ubiquitously in all classifications of living organisms. These are the ATP-binding cassette (ABC) superfamily and the major facilitator superfamily (MFS). ABC transporters are a large family of proteins involved in the transport of a wide variety of different compounds, like sugars, ions, peptides and more complex organic molecules. 42 The nucleotide binding domain shows the highest similarity between all members of the family. (Georjoun et al. 2001). ABC family permeases are in general multicomponent, primary active transporters, capable of transporting both small molecules and macromolecules in response to ATP hydrolysis. The MFS transporters are single polypeptide secondary carriers that are capable only of transporting small solutes in response to chemiosmotic ion gradients. Among other fungi, Fusarium graminearum and Neurospora crassa were found as orthologs with significant similarity to the Ustilago ABC transporter protein sequence. Another interesting tag (CATGAACCTCAATG) matched a gene related to a probable vacuolar sorting protein with similarity to Seel-like molecules that have been implicated in a variety of eukaryotic vesicle transport processes including neurotransmitter release by exocytosis (Halachmi and Lev, 1996). Other important categories for genes identified in the SAGE data were related to nucleic acid binding, transcription regulation and signal transduction. For example, several hypothetical proteins showed sequence similarity to zinc finger proteins. These predicted zinc finger domains included PHD, GATA, CCCH and C2H2 domains, while other nucleic acid binding domains included a HSF-DNA binding domain/protein that was highly expressed in the mutant library. Zinc finger proteins are known to be common in transcription factors and to be involved in the interaction of nucleic acids and proteins. Some genes were also found that were related to the amino acid biosynthesis, carbohydrate metabolism and catabolism, and fatty acid biosynthesis, as listed in Table 3.3. 43 Table 3.3: Tags with GO (gene ontology) categories based on predicted domain/function. *No. of ~ tags Function and % tag hah wt Predicted domain Species E-value "/.Identity Simila Protein biosynthesis TAACTCAAGA 24 0 PrfA..Protein chain release factor Magnetospirillum 2.00E-56 40 59 A magnetotacftcum GCATTGCTTG 20 0 Seryl-tRNA synthetase (SerRS) Arabaidopsis thaliana 3.00E-68 35 50 class II core catalytic domain. CGTCAGACCG 0 170 translation elongation factor 1a Schizophyllum commune 0 88 92 GGCTTCGGTC 6 96 L_10e ribosomal protein Cryptococcus 2.00E-109 74 85 neoformans TTGGTCATCT 5 93 Ribosomal L7Ae Cryptococcus 7.00E49 75 86 neoformans CCCAAACCCT 5 70 Putative ribosomal protein L35 Cryptococcus 2.00E-30 67 80 neoformans AATCACGAAT 0 53 Ribosomal S_28e Schizosaccharomyces 1.00E-17 81 92 pombe CCGGCAAACC 0 53 Ribosomal protein L39 Candida albicans 7.00E-17 77 86 GCTTGCGACC 6 47 Eukaryotic initiation factor 5A Candida albicans 1.00E-67 78 94 hypusine, DNA-binding OB fold.. ATTCCTGGCC 0 43 Ribosomal protein S21e Chaetomium globosum 6.00E-29 67 83 CBS 148 ACAGGATTTG 1 42 60s ribosomal protein L11, Cryptococcus 2.00E-68 79 87 putative neoformans ACCAGCGATT 4 42 elongation factor 1-beta-like Magnaporthe grisea 2.00E48 55 69 protein GAGCAGATGA 1 42 rpl5-2 Schizosaccharomyces 5.00E-109 70 81 GAGCGCCCGT pombe 3 42 AER052Wp, Ribosomal protein Ashbya gossypii A TCC 8.00E-20 69 85 S14 10895 TCACATACTT 1 42 40S ribosomal protein S18 Chaetomium globosum 2.00E-49 73 84 CBS 148.51 CGTCTCGCCT 4 39 ribosomal L10 protein Cryptococcus 2.00E-96 75 88 neoformans TCGATGCTAG 2 38 Ribosomal protein L19 Crassostrea gigas 1.00E-43 67 79 ATCTGCATCC 3 38 TRASH, metallochaperone-like Schizosaccharomyces 2.00E-39 60 80 domain pombe TACGATACTA 3 37 Ribosomal protein L19e, Crassostrea gigas 1.00E44 67 79 eukaryotic CTTCTTACCC 0 36 elongation factor 1-gamma 2 Aspergillus fumigatus 3.00E-67 42 55 Af293 TTACCGAATA 3 35 40S ribosomal protein S14 Aspergillus nidulans 4.00E-39 81 90 FGSCA4 AACCAAAATG 2 35 EF1G, Elongation factor 1 Aspergillus fumigatus 2.00E-67 42 55 ACAAAGTGAT gamma 1 32 ribosomal protein S9 homolog Schizosaccharomyces 7.00E-78 91 96 CACATCAATC pombe 0 32 rpl21-2 Schizosaccharomyces 8.00E-56 70 80 pombe TAAACCCCCT 2 30 60S ribosomal protein L7 Chaetomium globosum 4.00E-65 67 82 TATTCTTTCT 3 28 ADL127Cp, ribosomal protein L2 Ashbya gossypii A TCC 8.00E-107 73 85 C-terminal domain 10895 ATCGTCTCGT 0 27 putative ribosomal protein S19 Pleurotus ostreatus 3.00E-49 71 80 CACAACGGTG 0 27 ribosomal protein L32 homolog Schizosaccharomyces 3.00E-47 72 86 pombe TTTCGGCCAT 2 27 Ribosomal protein L22 Rattus norvegicus 2.00E-32 52 69 TTGCCGTTTG 0 26 Protein component of the large Saccharomyces 3.00E-61 65 79 (60S) ribosomal subunit cerevisiae 44 Table 3.3— Continued CAATCTAAGC 1 24 ribosomal protein L14 Eremothecium gossypii 2.00E-23 52 68 GGTAACTTCT 0 24 Ribosomal protein S2 Xanthophyllomyces 7.00E-95 77 86 dendrorhous TTCTGTCCTT 0 24 ribosomal protein L9, putative Arabidopsis thaliana 1.00E-44 54 72 CTCTACCCCT 0 22 60S ribosomal protein L33-A Chaetomium globosum 1.00E-32 66 79 GACTCCAAGT 0 21 40S ribosomal protein S13 Agaricus bisporus 2.00E-67 84 91 ACTGCAACCC 2 20 large subunit ribosomal protein L3 Aspergillus fumigatus 1.00E-177 76 88 CAATCCATCT 2 20 ribosomal protein S9 Aspergillus fumigatus 1.00E-52 78 88 Af293 CCATCCTTTC 0 20 40S ribosomal protein S18 Coccidioides immitis RS 6.00E-64 76 90 TCTCTCAGAT 0 20 60S ribosomal protein L12 Sus scrofa 6.00E-59 79 91 Protein Catabolism TATGGTGCTT 53 1 Asp Aspartyl protease Cryptococcus 2.00E-29 27 43 neoformans CAGCAGGCGC 3 27 probable RPN2 - 26S proteasome Aspergillus fumigatus 0 44 64 regulatory subunit CAAAGCAATT 3 20 related to carboxypeptidase Candida albicans 2.00E-103 44 59 Transport CCAGCCCACA 96 1 probable peroxisomal half ABC Cryptococcus 0 48 61 transporter neoformans TCGCCAGATT 32 0 related to flavin oxidoreductase Deinococcus 2.00E-76 45 57 geothermalis TTCTGGCAGA 22 0 probable TP01 - Vacuolar Zygosaccharomyces 3.00E-63 35 51 polyamine-H+ antiporter bailii CGGCAGAGCC 20 0 related to inorganic phosphate Thermoplasma 8.00E-31 29 45 transporter volcanium ACTTCGTCCG 14 0 Cation transport ATPase Saccharomyces 0 49 66 cerevisiae CACATTCTTT 14 0 WD 40 Schizosaccharomyces 3.00E-10 31 48 pombe AACCTCAATG 12 0 probable vacuolar sorting protein Magnaporthe grisea 1.00E-89 38 56 (hbrA) TGGATGTGGA 10 0 related to HMT1 - hnRNP arginine Arabidopsis thaliana 8.00E-51 38 56 N-methyltransferase TTCGGCAAGG 21 172 probable ADP, ATP carrier protein Chlamydomonas 8.00E-117 76 84 reinhardtii ATGCAATGAT 7 74 related to ubiquinol-cytochrome-c Saccharomyces 8.00E-97 69 82 reductase cerevisiae TGATTGACTC 2 48 Chromate transporter Rhodopseudomonas 2.00E-17 33 55 palustris TGCGGTGGTA 0 44 F1 ATP synthase beta subunit, Schizosaccharomyces 0 81 88 nucleotide-binding domain pombe TTCTTCGACA 1 27 Dor1 -like family Drosophila 2.00E-16 22 41 pseudoobscura GAAATGCGAC 2 26 Hrfl family. Heavy metal Aspergillus fumigatus 3.00E-58 42 56 resistance factorl GCACCCATCT 0 24 probable mfs-multidrug-resistance Aspergillus fumigatus 1.00E-77 37 55 transporter ATGAAATGAC 3 21 related to Amiloride resistance Aspergillus fumigatus 3.00E44 31 49 protein carl 45 Table 3.3- Continued Cell cycle and DNA processing AGGATCACCG 56 0 probable replication licensing Aspergillus fumigatus 0 49 65 factor MCM4 CGACCAATAG 10 0 Forkhead associated domain(FHA) Saccharomyces 2.00E-40 44 64 cerevisiae TCATATTTGA 7 170 probable tryptophan-tRNA ligase Danio rerio 2.00E-145 62 79 Nucleic acid binding CCCAACTCGG 32 0 PHD Zinc finger Cryptococcus 7.00E45 27 41 neoformans TTGTATGGTT 20 0 GATA Zinc finger Neurospora crassa 8.00E-16 64 72 GATGCTTTTT 14 0 CCCH Zinc finger Pan troglodytes 4.00E-12 28 45 GCTGCGAAAA 12 0 C2H2 Zinc finger No significant hits •TAAACTTCCC 0 55 APSES domain. Cryptococcus 4.00E-17 44 65 neoformans CACCGTCTCT 3 41 Hypothetical protein, 3'-5' Homo sapiens 2.00E-16 32 50 exonuclease GAATAACAGA 9 41 Reverse transcriptase (RNA- Tetraodon nigroviridis 1.00E-64 23 42 dependent DNA polymerase) AAAATTGCCG 0 25 probable zuotin Schizosaccharomyces 1.00E-66 55 68 TTTTTAGGCC pombe 1 22 probable dead-box protein abstrakt Arabidopsis thaliana 1.00E-180 62 77 Regulation of transcription TTTGTGGAAT 10 0 HSF DNA binding domain Saccharomyces 7.00E-21 39 55 cerevisiae CACACGCACA 4 48 PHD zinc finger, BAH domain Cryptococcus 2.00E-45 40 59 neoformans GATGTCCTTG 16 31 GATA zinc finger, DNA binding Emericella nidulans 1.00E-36 24 41 domain CTTTTGTAAC 4 26 DHHC zinc finger domain, also Aspergillus fumigatus 3.00E-39 33 47 known as NEW1 CAAAATTTGA 0 20 WD40 domain Aspergillus fumigatus 7.00E-30 30 48 Signal transduction TGAAGGAATG 10 1 probable ser/thr protein kinase Saccharomyces 9.00E-122 43 58 cerevisiae GCGCTTGTTG 5 64 probable PH081 - cyclin- Neurospora crassa 3.00E-112 38 54 dependent kinase inhibitor ATGGCGGCAT 8 24 protein ser/thre kinase activity, Arabidopsis thaliana 4.00E-13 26 45 phospholipase activity Cellular respiration ATGTCAACCT 1 56 F1_ATPase_alpha, F1 ATP Cryptococcus 0 81 89 synthase alpha, central domain neoformans CTCGATTGGG 0 51 F1 ATP synthase beta subunit, Coccidioides immitis 0 82 89 nucleotide-binding domain RS Response to stress TACTCGTATC 7 44 hsp70 Schizosaccharomyces 0 82 91 TACCATATTC pombe 2 25 Heat shock protein 80 Neurospora crassa 1.00E-119 64 81 46 Table 3.3 Continued Amino acid biosynthesis AGCACTGCAC 17 0 GGTATCCTTG AACCAGCGTC 12 0 0 28 Carbohydrate metabolism TTGATGTCAA 21 1 GCCTACGCTG 24 0 related to acetylornithine aminotransferase precursor related to saccharopine reductase Glutamine synthetase, catalytic domain 2-oxoacid dehydrogenases acyltransferase (catalytic domain), malate dehydrogenase, NAD-dependent Aspergillus fumigatus 1.00E-105 45 63 Filobasidiella 0 54 69 neoformans Amanita muscaria 2.00E-161 75 86 Strongylocentrotus 3.00E-12 37 53 purpuratus Aspergillus fumigatus 6.00E-92 60 73 Af293 Carbohydrate catabolism CGGCTCTTCC 19 0 Glycosyl Hydrolase Family 88 Aspergillus fumigatus e-103 51 65 Nucleotide metabolism ACACGTCTGG 17 0 Predicted phosphoribosyltransferases Saccharomyces cerevisiae 6.00E-35 42 58 Fatty acid biosynthesis GAAGGCAGAG 12 0 related to Conidial green pigment Emericella nidulans synthase 1.00E-68 25 43 Cellular metabolism CCCCAAAAAA 19 102 conserved hypothetical protein, Pseudomonas putida short chain dehydrogenase 3.00E-27 34 49 Heavy metal binding CGAAAGCAAA 3 32 probable serine/threonine protein Schizosaccharomyces 8.00E-130 77 88 phosphatase ppel pombe DNA replication GGCGAGACGC 0 23 related to TOF1 - topoisomerase Aspergillus nidulans I interacting factor 1 CAGCCAGCTG 0 20 Nucleosome assembly protein Daniorerio (NAP). * Tag frequencies have been normalized to the size of the smaller library for comparison (wild-type, 13867 tags). 2.00E-39 24 40 1.00E-18 29 48 47 3.1.2. Gene differentially expressed in the wild-type strain library The wild-type library yielded a smaller number of tags compared to the mutant library, and the expressed tag numbers were therefore normalized to the size of the wild-type library to predict the actual expression differences between the two transcriptomes. Tags for the wild-type library were also assigned to different GO categories based on their functions to build a GO table (Table 3.3). The wild-type library produced a large number of tags that matched genes encoding ribosomal proteins (RP) and these were found to be less abundant in the SAGE data from the hgll mutant. These results are in accordance with results from other Ustilago SAGE libraries constructed in our laboratory (Larraya et al., 2005). Overall, several genes were predicted to be involved in ribosome biogenesis (ribosomal proteins, translation initiation factor and translation elongation factor) and had elevated transcripts in the wild-type libary. Recently in budding yeast, RP genes were found to be regulated by transcription factors that were responsive to both the cAMP and TOR pathways (Schmelzle et al. 2004; Zurita-Martinez and Cardenas, 2005). 48 Table 3.4: Upregulated tags in wild type library and/or downregulated in hgll library. Normalized frequencies Tag WT hgll MUMDB gene NO. p-value Preliminary gene designation related Domain Blast hit (NCBI) E-value % Identi ty % Simila rity TTCGGCAAGG 172 21 UM00919 6.07E-60 probable ADP, ATP carrier protein mitochondrial carrier protein Chlamydomonas reinhardtii 8.00E-117 76 84 (ADP/ATP translocase) CAA46311.1 TCATATTTGA 170 7 UM03798 2.00E-72 probable tryptophan-tRNA ligase Tryptophanyl-tRNA Danio rerio AAH49526.1 2.00E-145 62 79 synthetase (TrpRS) catalytic core domain CGTCAGACCG 170 0 • UM00924 3.68E-81 probable translation elongation translation elongation factor Schizophyllum commune 0 88 92 factor eEF-1 alpha chain 1a (CAA94399.1) AAAGTGTGGC 118 10 UM05244 1.31E-37 hypothetical protein • Cryptosporidium hominis 1.00E-30 74 74 EAL34999 CCCCAAAAM 102 19 UM04288 1.27E-31 conserved hypothetical protein short chain dehydrogenase Pseudomonas putida 3.00E-27 34 49 AAN68489.1 GGCTTCGGTC 96 6 UM06055 3.48E-33 Ribosomal L_10e LJOe ribosomal protein Cryptococcus neoformans 2.00E-109 74 85 (AAW44457.1) TTGGTCATCT 93 5 UM01318 3.16E-34 probable 40S ribosomal protein Ribosomal L7Ae Cryptococcus neoformans 7.00E49 75 86 S12 (AAW42305.1) CCAATGAATA 85 46 UM00495 5.91E-14 conserved hypothetical protein Domain of unknown Debaryomyces hanseni\ 3.00E-19 41 55 ' function DUF CAG89680.1 AATCCAAGTT 76 3 UM03285 2.64E-33 conserved hypothetical protein TBC.Domain in Tre-2, Mus musculus NP_666064.2 9.00E-26 25 41 BUB2p, and Cdc16p. Probable Rab-GAPs ATGCAATGAT 74 7 UM04631 2.38E-28 related to ubiquinol-cytochrome-c Cytochrome C1 family Saccharomyces cerevisiae 8.00E-97 69 82 reductase cytochrome d precursor CAA99258.1 CCCAAACCCT 70 5 UM11625 1.60E-23 probable ribosomal protein L35 Putative ribosomal protein Cryptococcus neoformans 2.00E-30 67 80 L35 . (AAW41280.1) GCGCTTGTTG 64 5 UM02860 1.16E-25 probable Nuc-2 protein ANK. ankyrin repeats Neurospora crassa CAD70463.1 3.00E-112 38 54 GCCAACGCCG 60 6 UM03725 5.61 E-23 hypothetical protein No significant hits ATGTCAACCT 56 1 UM10213 5.36E-24 probable H-Mransporting ATP F1_ATPase_alpha, F1 ATP Cryptococcus neoformans 0 81 89 synthase alpha chain, mitochondrial synthase alpha, central domain (44109.1) 49 Table 3.4. Continued TAMCTTCCC 55 0 UM04024 1.53E-27 hypothetical protein APSES domain. Cryptococcus 4.00E-17 44 65 neofbrmansAAW41565.1 AGAGAAGAGT 53 2 UM05146 1.01E-23 putative protein No significant hits AATCACGAAT 53 0 UM11202 5.32E-25 probable 40s ribosomal protein Ribosomal S_28e Schizosaccharomyces 1.00E-17 81 92 s28 pombe(CAA94635.1) CCGGCAAACC 53 0 UM10182 5.32E-25 probable 60S ribosomal protein Ribosomal protein L39 Candida albicans 7.00E-17 77 ' 86 L39 (AAK60140.1) CTCGATTGGG 51 0 UM10397 1.33E-25 probable ATP2 - F1F0-ATPase F1 ATP synthase beta Coccidioides immitis RS 0 82 89 complex, F1 beta subunit subunit, nucleotide-binding (EAS30795.1) domain GCCGAAGAGG 49 1 UM11517 9.02E-21 conserved hypothetical protein Strongylocentrotus . 3.00E-12 37 53 purpuratus (XP_790510.1) CACACGCACA 48 4 UM05577 2.34E-19 conserved hypothetical protein PHD zinc finger. BAH, Bromo Cryptococcus neoformans 2.00E45 40 59 adjacent homology domain AAN75722.2| TGATTGACTC 48 2 UM02213 2.21 E-21 conserved hypothetical protein Chromate transporter Rhodopseudomonas 2.00E-17 33 55 palustris NP_945938.1 GCTTGCGACC 47 6 UM02450 1.54E-13 probable HYP2 - translation Eukaryotic initiation factor 5A Candida albicans 1.00E-67 78 94 initiation factor elF5A. hypusine, DNA-binding OB fnlri (AAD10697.1) TCTACAGCAG 45 5 UM02319 3.62E-17 hypothetical protein IUIU.. Debaryomyces hansenii 3.00E-05 23 44 CAG87950.1 TACTCGTATC 44 7 UM03791 2.91 E-15 Ums2 HEAT SHOCK 70 KD hsp70 Schizosaccharomyces 0 82 91 PROTEIN 2 pombe BAA25322.1 TGCGGTGGTA 44 0 UM03191 3.25E-22 probable ATP2 - F1F0-ATPase F1 ATP synthase beta Schizosaccharomyces 0 81 88 complex, F1 beta subunit subunit, nucleotide-binding pombe CAB60704.1 domain ATTCCTGGCC 43 0 UM11716 9.91E-22 probable 40s ribosomal protein Ribosomal protein S21e Chaetomium globosum 6.00E-29 67 83 s21 CBS 148 (EAQ93794.1) ACAGGATTTG 42 1 UM11526 1.38E-18 probable RPL11B - ribosomal 60s ribosomal protein L11, Cryptococcus neoformans 2.00E-68 79 87 protein L11 putative (AAW45899.1) ACCAGCGATT 42 4 UM01189 3.45E-13 probable EFB1 - translation elongation factor 1-beta-like Magnaporthe 2.00E48 55 69 elongation factor eEF1 beta protein grisea(AAX07632.1) GAGCAGATGA 42 1 UM11536 1.38E-18 probable RPL5 - 60S large rpl5-2 Schizosaccharomyces 5.00E-109 70 81 subunit ribosomal protein L5.e pombe(CAA20691.1) GAGCGCCCGT 42 3 UM11499 4.17E-15 probable RPS29B - ribosomal AER052Wp, Ribosomal Ashbya gossypii ATCC 8.00E-20 69 85 protein S29.e.B protein S14 10895 (AAS52736.1) 50 Table 3.4. Continued TCACATACTT 42 1 UM11261 1.38E-18 probable RPS17B - ribosomal protein 40S ribosomal protein S18 Chaetomium globosum 2.00E49 73 84 S17.e.B CBS148.51(EAQ87338.1) CACCGTCTCT 41 3 UM00869 4.11E-17 hypothetical protein 3'-5' exonuclease Homo sapiens 2.00E-16 32 50 AAR05448.1 GAATAACAGA 41 9 UM06265 872E-13 related to Retrovirus-related POL RVT. Reverse Tetraodon nigroviridis 1.00E-64 23 42 polyprotein transcriptase (RNA- BAC82607.1 dependent DNA polymerase) GTTGCAACGG 41 1 UM06266 2.69E-19 hypothetical protein No significant hits GATAACTGTG 40 20 UM06266 8.02E-08 hypothetical protein No significant hits CGTCTCGCCT 39 4 UM10842 1.48E-12 probable RPL10 - 60S large subunit ribosomal L10 protein Cryptococcus neoformans 2.00E-96 75 88 ribosomal protein L10 (XP_569162.1) ATCTGCATCC 38 3 UM10625 2.11E-13 probable ribosomal protein L24.e.A, TRASH, Schizosaccharomyces 2.00E-39 60 80 cytosolic metallochaperone-like pombe (CAA20919.1) domain CTTTTCTGTA 38 4 UM01104 1.37E-11 conserved hypothetical protein general transcription factor Schizosaccharomyces 1.00E-20 32 50 spTFIIE beta subunit pombe (BAD74159.1) TCGATGCTAG 38 2 UM01634 6.91 E-15 probable RPL19B - 60S large subunit Ribosomal protein L19 Crassostrea gigas 1.00E-43 67 79 ribosomal protein L19.e (CAD91441.1) CATTCACACT 37 1 UM10573 2.68E-15 probable 60s ribosomal protein L7 60S ribosomal protein L7 Chaetomium globosum 4.00E-65 67 82 subunit (AAY86760.1) TACGATACTA 37 3 UM01634 2.68E-15 probable RPL19B - 60S large subunit Ribosomal protein L19e, Crassostrea gigas 1.00E44 67 79 ribosomal protein L19.e eukaryotic CAD91441.1 ACTCACAGTC 36 3 UM02361 6.32E-12 related to ATPase inhibitor, predicted protein Coccidioides immitis RS 7.00E-11 36 59 mitochondrial precursor (EAS33512.1) CTTCTTACCC 36 0 UM02442 6.28E-17 related to translation elongation factor elongation factor 1-gamma Aspergillus fumigatus 3:00E-67 42 55 eEF1, gamma chain 2 Af293 (XP_747621) TTACCGAATA 35 3 UM10360 3.88E-12 probable 40S Ribosomal protein S14 40S ribosomal protein S14 Aspergillus nidulans FGSC 4.00E-39 81 90 A4 (XP_663564.1) AACCAAAATG 35 2 UM02442 2.41E-15 related to translation elongation factor EF1G, Elongation factor 1 Aspergillus fumigatus 2.00E-67 42 55 eEF1, gamma chain gamma EAL85583.1 TAATCCCACT 35 2 UM00545 2.41 E-15 hypothetical protein No significant hits CGAAAGCAAA 32 3 UM02445 4.75E-13 probable serine/threonine protein PP2Ac. Protein Schizosaccharomyces 8.00E-130 77 88 phosphatase ppel phosphatase 2A pombe CAA79358.1 homologues, catalytic domain 51 Table 3.4. Continued CGTAAAMGC 32 9 UM06266 3.00E-09 hypothetical protein - No significant hits ACAAAGTGAT ' 32 1 UM02353 5.81E-14 probable to 40S ribosomal protein S9 ribosomal protein S9 Schizosaccharomyces 7.00E-78 91 96 homolog pombe (BAA82319.1) CACATCAATC 32 0 UM10127 4.87E-15 probable 60s ribosomal protein L21-A rpl21-2 Schizosaccharomyces 8.00E-56 70 80 pombe (CAB93015.1) TAAACCCCCT 30 2 UM10573 2.22E-11 probable 60s ribosomal protein L7 60S ribosomal protein L7 Chaetomium globosum 4.00E-65 67 82 subunit (AAY86760.1) GATGTCCTTG 31 16 UM04252 3.25E-06 related to hypercellular protein GATA zinc finger. DNA Emericella nidulans 1.00E-36 24 41 (hypa),conserved hypothetical protein, binding domain, related to AAP04416.1 "transcription factor scgata-6 AACCAGCGTC 28 0 UM11098 1.82E-14 probable GLN1 - glutamate-ammonia Glutamine synthetase, Amanita muscaria 2.00E-161 75 86 ligase catalytic domain (CAD22045.1) TATTCTTTCT 28 3 UM11233 3.00E-09 probable RPL2A - ribosomal protein ADL127Cp, ribosomal Ashbya gossypii ATCC 8.00E-107 73 85 L8.e protein L2 C-terminal 10895 (AAS51793.1) domain TCGCGCACCC 28 4 UM00020 3.34E-08 related to 26S proteasome regulatory hypothetical protein Cryptococcus neoformans 2.00E-34 46 59 subunit RPN11 CNBA2630 (EAL23616.1) CAGCAGGCGC 27 3 UM04786 7.95E-11 probable RPN2 - 26S proteasome Proteasome/cyclosome Aspergillus fumigatus 0 44 64 regulatory subunit repeat EAL89940.1 TTCTTCGACA 27 1 UM03238 1.10E-12 conserved hypothetical protein Dor1 -like family Drosophila pseudoobscura 2.00E-16 22 41 EAL33872.1 ATCGTCTCGT 27 0 UM11551 5.54E-14 probable RPS19B - ribosomal protein putative ribosomal protein Pleurotus ostreatus 3.00E-49 71 80 S19.e, cytosolic S19 (CAD10794.1) CACAACGGTG 27 0 UM10621 5.54E-14 probable 60S ribosomal protein L32 ribosomal protein L32 Schizosaccharomyces 3.00E-47 72 86 homolog pombe (BAA19212.1) GACTCCAAGT 21 0 UM00658 7.03E-10 probable 40s ribosomal protein S13.e 40S ribosomal protein S13 Agaricus bisporus 2.00E-67 84 91 (CAA64365.1) ATGAAATGAC 21 3 UM05452 3.31 E-08 related to Amiloride resistance protein sugar transporter Aspergillus fumigatus 3.00E44 31 49 carl EAL91937.1 TTGATGTCAA 21 1 UM01517 7.03E-10 probable KGD2 - dihydrolipoyl 2-oxoacid dehydrogenases Aspergillus fumigatus 4.00E-92 76 88 transsuccinylase component of the acyltransferase (catalytic EAL93026.1 alpha-ketoglutarate dehydrogenase domain). complex CAAAATTTGA" 20 0 UM00675 1.36E-10 conserved hypothetical protein WD40 domain Aspergillus fumigatus 7.00E-30 30 48 EAL89073.1 CAAAGCAATT 20 3 UM01886 8.92E-08 related to carboxypeptidase Peptidase S10. Serine Candida albicans 2.00E-103 44 59 carboxypeptidase. AAA34326.2 52 Table 3.4. Continued CAGCCAGCTG 20 0 UM04761 1.36E-10 conserved hypothetical protein Nucleosome assembly DaniorerioAAQ97849.1 1.00E-18 29 48 protein (NAP). GCGAAGCGCT 20 1 UM04882 2.05E-09 related to UV-induced protein u vi 15 No significant hits ACTGCAACCC 20 2 UM11103 3.83E-07 probable RPL3 - 60s ribosomal large subunit ribosomal Aspergillus fumigatus 1.00E-177 76 88 protein 13 protein L3 (AAM43909.1) CAATCCATCT 20 2 UM10114 3.83E-07 probable 40S ribosomal protein ribosomal protein S9 Aspergillus fumigatus Af293 1.00E-52 78 88 S16 (XP_755383.1) CCATCCTTTC 20 0 UM01060 1.36E-10 probable RPS18A - ribosomal 40S ribosomal protein S18 Coccidioides immitis RS 6.00E-64 76 90 protein S18.e.c4 (EAS37460.1) TCTCTCAGAT 20 0 UM10147 2.05E-09 probable 60S ribosomal protein 60S ribosomal protein L12 Sus scrofa (AAS55903.1) 6.00E-59 79 91 U2 * Tag frequencies have been normalized to the size of the smaller library for comparison (wild-type, 13867 tags). ** MUMDB, MIPS Ustilago maydis database (http://mips.gsf.de/genre/proj/ustilago/). *** Statistical significance of the differential tag frequencies between libraries. ****NCBI, National centre for biotechnology information (http://www.ncbi.nlm.nih.gov/). 53 Tags that may be potentially related to signaling pathways identify genes encoding zinc finger domains. In the wild-type library, genes with PHD and GATA zinc finger domains were found as in the mutant library but analysis showed that these are different genes in the Ustilago genome. The transcript for the DHHC zinc finger protein found elevated in wild-type library is similar to a gene known as NEW1 (Bartel et al. 1999). The function of this domain is unknown, but it has been predicted to be involved in protein-protein or protein-DNA interactions (Putilina et al. 1999). Zinc finger domains are found in many transcription factors, regulatory proteins, and other proteins that interact with DNA, RNA or other proteins. Other than zinc finger proteins, differentially expressed genes in the wild-type library and assigned to be related to nucleic acid binding, transcription regulation and signal transduction encoded an APSES domain, an RNA-dependent DNA polymerase, a probable zuotin, a probable dead-box protein and a probable PH081 (Cyclin dependent kinase inhibitor). There were eight different tags corresponding to the genes encoding proteins related to cellular transport mechanisms. There are a large number of molecules that are exported or imported through the active or passive transport including electron transport, inorganic phosphate transport, sugar transport and amino acid transport. Carrier protein found upregulated in expression in the wild-type library included an ADP, ATP carrier protein (Kuan and Saier 1993) while the identified cytochrome-c reductase is involved in electron transport (Bechmann et al. 1992). Another category that showed higher gene expression for this library was stress-response related proteins. These included heat shock proteins that are known to promote cell survival under stress conditions. This category of proteins may be considered house 54 keeping genes (like ribosomal genes) and it is interesting that such categories are found highly expressed in wild-type compared to the hgll mutant library. 3.2. Confirmation of SAGE expression data 3.2.1. RNA blot analysis There are several methods that can be used for the confirmation of the SAGE expression data including Northern RNA blot analysis and real time RT-PCR methodology (Alwine et al., 1977; Wang et al, 1989). RNA blot analysis is the most widely used method to study and confirm RNA expression levels for different genes, but it requires the use of radioactive isotopes and relatively large amounts of total RNA, and it can also be time consuming. Three genes were selected on the basis of their varying tag expression levels in the wild-type and mutant libraries to confirm the SAGE data by RNA blot analysis. Primers for amplification of hybridization probes were designed by using the Invitrogen online primer designing tool known as "Oligoperfect designer" (http://www.invitrogen.corn/content.cfm?pageid=9716) (Table 2.2 in chapter 2). The gene for Hmpl, a cruciform DNA recognition protein, was used as a control because it was already confirmed to be differentially expressed in previous SAGE studies in our laboratory (Larraya et al., 2005). It is interesting that same tag was identified at elevated levels in the UBC1 and ADR1 libraries when compared to a wild-type library (Larraya et al, 2005), but the analysis described here revealed that it was elevated in wild-type compared to the hgll library. Probes for RNA blot hybridization were amplified by PCR and their amplicon sizes were confirmed by agarose gel electrophoresis; this step also confirmed the amplification of single bands without any non-specific contamination. 55 Figure 3.2 presents the results of the RNA blot analysis that indicated the transcripts for the hmpl gene and the UM03880 gene are elevated in the wild-type strain and the transcript for the UM05176 gene is elevated in the hgll mutant. Although the RNA blot analysis was not quantitative, these results are in general agreement with the SAGE expression data. For example, the SAGE data indicated that the transcript level for UM05176 was 14 fold higher in the hgll mutant versus wild-type and the level for UM03880 was 3 fold higher in the wild type strain. Visual inspection of the hybridization data supports this pattern of expression. 56 Figure 3.2: SAGE data confirmation by RNA blot analysis. hgll WT 4 » # t a t rRNA Hmpl UM00496 (46:85) Cruciform DNA recognition protein Hypothetical protein UM05176(14:1) (Predicted domain TMS1) Conserved hypothetical protein UM03880(8:24) Figure 3.2: SAGE data verification by RNA blot analysis. The figure shows equal loading of the RNA as indicated by the bands of the large and small subunits of rRNA. Hybridization with the cruciform DNA recognition protein (UM00496), tumor differential expression protein (UM05176) and a hypothetical protein (UM03880) was observed when the blots were exposed to phosphor imaging screens overnight and the screens were scanned for the signal detection to observe the expression intensities of the specific genes in the total RNA. 57 3.2.2. Quantitative RT-PCR analysis for S A G E data verification Additional selected genes were subjected to quantitative RT-PCR analysis for comparison with SAGE data to verify differential expression. The quantitative RT-PCR (Reverse transcriptase- polymerase chain reaction) method was developed by Wang et al. in 1989 and this technique is commonly used to examine RNA expression (Willard et al. 1999). Quantitative RT-PCR is exquisitely sensitive and therefore permits the analysis of gene expression from very small amounts of starting RNA (Marisa et al., 2005). Moreover, this approach can be applied to a large number of samples in the same experiment. The RT-PCR technique is based on the collection of amplification data throughout the PCR process as it occurs, thus combining amplification and detection into a single step. Product detection is achieved using fluorescent chemistries that correlate PCR product concentration to fluorescence intensity (Higuchi et al. 1993). Reactions are characterized by the point in time (or PCR cycle) where the target amplification is first detected. This value is usually referred to as the cycle threshold (G) that represents the time at which fluorescence intensity is greater than background fluorescence. The greater the quantity of target RNA in the starting material, the faster a significant increase in fluorescent signal will appear and this will yield a lower G (Heid, 1996). PCR is quite robust and predictable in theory, but variations in reaction components, cycling conditions, and priming during the early stages of the reaction can cause large changes in the amount of amplified product obtained (Bustin, 2000). RT-PCR can be performed as a one-step or two-step reaction. In the present study, two-step RT-PCR was used. A simple outline of the RT-PCR procedure is presented in Figure 3.3. Two-step real-time PCR separates the reverse transcription 58 reaction from the real-time PCR assay and allows several different real-time PCR assays to be performed on dilutions of a single cDNA preparation. Because reverse transcription can be highly variable in terms of reaction efficiency (Mannhalter et al. 2000), it is possible to use dilutions from the same cDNA template to ensure consistent reaction assays with the same amount of template, even if assays are performed at different times. A two-step protocol is preferred when using a DNA binding dye such as SYBR Green I because interference due to primer-dimers can be eliminated through the manipulation of melting temperatures (Tms) (Vandesompele et al. 2002). However, the two-step protocol can still have problems with DNA contamination as with other PCR-based techniques (Marisa and Juan, 2005). 59 Figure 3.3: The reverse transcriptase polymerase chain reaction. RT-PCR Total RNA isolation I Reverse Transcription(RT) I cDNA synthesis I Polymerase Chain Reaction Traditional: Restriction digestion Gel electrophoresis Quantification Discrimination and quantification (fluorescent dyes), monitored contineously Figure 3.3: Reverse transcriptase polymerase chain reaction starts with the initial step to isolate total RNA from the cells and complementary DNA (cDNA) synthesis in a two-step RT-PCR system. A further reverse transcription step using Oligo dT primers is followed by the PCR reaction. In quantitative RT-PCR, a nucleic acid binding fluorescent dye (for example SYBR green) is used for the detection of the amplified PCR product every cycle during the reaction process. Continuous monitoring of the amount of amplified PCR product shows the record of the cycle threshold values that are required to amplify a detectable amount in minimum number of cycles. This depends on the number of copies of a transcript present in the cDNA at the begining of the reaction. The figure also present the traditional procedure to quantitate the amount of DNA which includes restriction digestion and gel electrophoresis before quantitation. 60 For the present analysis, the comparative Ct method was used (Livak and Schmittgen, 200.1). This method does not require a standard curve and PCR product sizes are kept small (less than 150 bp). Tags selected for this analysis along with the designed primers are presented in Materials and Methods and the results are presented in Table 3.5. Figure 3.4. shows a graphic presentation of the data for the fold difference with reference to the internal control (normalized to 1); this analysis allows a comparison of the expression by taking into consideration the Ct (cycle threshold) values for each transcript. For the validation of the RT-PCR results, each sample was run in triplicate in each experiment with inclusion of an internal control (actin). Initially the internal control did show some differences in expression level for the wild-type and mutant when a measured amount of cDNA was used for amplification. Further nanospec quantitation was used to calculate equal number of molecules of actin for wild-type and hglll cDNA to use for PCR reactions. Some differences in actin amplification were still observed which could be due to experimental error or represent the higher copy number of actin in the template and variation due to pipetting during sample preparation. The control was standardized to 1 and further used to calculate fold differences. In general, differences were found in the cycle threshold (Ct) values that were required to amplify detectable amount of target sequences. The results reflect the general trend of expression found with the SAGE data, although the same fold differences in expression were not always found by RT-PCR (Table 3.5 and Figure 3.4). Among the tags selected for this analysis, only the ABC transporter (UM03945) (found to be elevated in the mutant SAGE library), was found to display the reverse expression profile by RT-PCR. That is, it was expected to require a 61 lower Ct value for hgll cDNA amplification of the target but this was not confirmed by RT-PCR. All other tags followed the expected expression patterns. Tags selected for this RT-PCR analysis included two genes for zinc finger proteins from each of the two libraries (GATA; UM 05773 and CTH; UM01649 from the mutant and PHD; UM05577 and DHHC; UM01636 from the wild-type transcriptome). Other tags selected were for UM01950 (conserved hypothetical protein predicted to be a glycosyl hydrolase), polyketide synthase (UM01664), serine/threonine protein kinase (UM05698) and forkhead associated domain protein(UM03342). 62 Table 3.5: RT-PCR expression results R1*** R2 R3 C(T)**** Cf_D C(T) Fold difference Tag MUMDB gene No.** Predicted domain WT hgh WT hgll WT hgll # of cycles differences Ct.target/Ct.calibrator Uprequlated in hqh C C A G C C C A C A A UM03945 A B C transporter 22.78 24.28 22.15 23.48 23.78 25.17 1.41 5.22 T T G T A T G G T T UM05773 G A T A zinc finger 23.21 22.47 24.78 22.64 23.19 20.45 1.87 6.93 C G G C T C T T C C UM01950 Glycosyl hydrolase 21.91 20.19 23.57 20.24 23.23 20.02 2.75 10.18 G A T G C I 11 t T UM01649 C C C H zinc finger 34.35 32.92 33.09 32.08 30.81 28.75 1.5 5.55 T C T C G C M M . UM05176 TMS1 22.24 21.29 23.35 21.5 23.45 21.23 1.67 6.18 G A A G G C A G A G UM06414 Polyketide synthases 21.93 18.43 22 18.92 22.63 .19.74 3.16 11.70 T G A A G G A A T G UM05698 Ser/thr protein kinase 24.9 23.9 25.06 22.56 24.24 21.77 1.99 7.37 C G A C C A A T A G UM03342 F H A domain 19.22 19.04 21.02 19.33 22.12 19.4 1.53 5.66 Uprequlated in wild tvoe C A C A C G C A C A UM05577 P H D zinc finger 23.38 25.04 24.89 25.59 23.53 24.94 1.26 4.66 CI I I I G T A A C UM01636 D H H C zinc finger 21.36 22.35 19.33 22.85 19.24 20.95 2.07 7.66 G C A C C C A T C T UM01051 mdr transporter 25.42 26.95 25.25 26.84 19.91 22.21 1.81 6.70 *lnternal control UM05715 Actin 23.69 23.38 23.21 22.99 23.67 23.38 0.27 1 * Internal control or calibrator normalized to 1 for comparison of reference genes ** MUMDB, MIPS Ustilago maydis database (http://mips.Rsf.de/genre/proi/ustilago/) *** Replicates o f the experiment. Each samples run in triplicate three times * * * * Cycle threshold. Exponential phase o f RT-PCR where amount o f fluorescence is significantly higher than background levels A Tag presented in red was not in accordance with the SAGE expression results Figure 3.4: RT-PCR results of SAGE data verification • Ct difference • fold difference Cycle threshold and fold differences are shown in the figure for twelve different genes including actin as the internal control (UM05715). Fold differences were calculated on the basis of the cycle threshold values recorded during the amplification of the target genes for both wild-type and mutant libraries. 6 4 3.3. The Cthl zinc finger protein - functional analysis An important outcome of the SAGE analysis was the identification of several candidate regulatory proteins that appeared be differentially transcribed when the hgll mutant transcriptome was compared with that of the wild-type strain. In particular, a number of genes encoding putative zinc finger proteins were identified and it was of interest to functionally test the role of one or more of these genes in the morphogenesis and pathogenesis of U. maydis. In this regard, the cthl gene encoding a candidate zinc finger protein (UM01649) was selected for further analysis. Zinc finger domains are thought to be involved in DNA-binding and different types are recognized depending on the positions of the cysteine residues. The Cthl protein of U. maydis is predicted to contain a zinc finger domain of the CCCH type (C-x8-C-x5-C-x3-H where x is a variable amino acid). Similar zinc finger proteins from eukaryotes are involved in cell cycle or growth phase-related regulation, and in the regulation of mRNA turnover and splicing. For example, human TIS1 I B (butyrate response factor 1) is a probable regulatory protein involved in regulating the response to growth factors; the mouse TTP growth factor-inducible nuclear protein is thought to have the same function (Johnson et al., 2000). The mouse TTP protein is known to be induced by growth factors. Another protein containing this domain is the human splicing factor U2AF 35 kD subunit, which plays a critical role in both constitutive and enhancer-dependent splicing by mediating essential protein-protein interactions and protein-RNA interactions required for 3' splice site selection. It has been shown that different CCCH zinc finger proteins interact with the 3' untranslated region of various mRNA molecules (Carballo et al., 1998; Lai et al. 1999). This type of zinc finger is very often present in two copies. The CCCH zinc finger proteins were first 65 identified in differential screens for mRNAs that are rapidly induced following growth factor treatment of mammalian cells. The best studied members of this class are TTP, also known as Tisl 1, Nup475 or ZFP36 (DuBois et al., 1990, Hall, 2005; Lai et al., 1990; Ma and Hershman, 1991; Thompson et al., 1996). These proteins bind to AU-rich elements of tumor necrosis factor a mRNA, resulting in the destabilization of the mRNA (Blackshear, 2002; Brown, 2005). There are six CTH-type zinc finger proteins encoded the Ustilago genome; these are all annotated as hypothetical proteins and all have strong similarity to the Cthl zinc finger. The Cthl zinc finger protein (UM01649) selected for this study has the orthologs CTH1 (ydrl51c) and 7757/ (ylrl36c) in Saccharomyces cerevisiae. In yeast, CTH1 overexpression causes delayed entry of cell cultures into exponential growth, and a decrease in final cell density. Removal of the zinc finger domain of Cthlp by truncation or deletion completely reverses the overexpression induced slow growth phenotype (Thompson et al., 1996). 77577 in yeast is an alias of CTH2 and encodes an mRNA-binding protein expressed during iron starvation; this protein binds to a sequence element in the 3'-untranslated regions of specific mRNAs to mediate their degradation and it is involved in iron homeostasis (Thomson et al., 1996; Puig et al. 2005). . 3.3,1. Reverse genetics approach to knock out the cthl gene. To characterize the function of any gene function, a useful approach is to disrupt or over-express the gene and to examine subsequent phenotypes. To study the function of cthl in Ustilago, the gene was deleted by using overlap PCR approach (Chaveroche et al., 2000; Davidson et al., 2002). 66 Figure 3.5: Application of double joint PCR method to knock out cthl zinc finger. 5' L A Cthl R A ~ 1 Kb 1.3 Kb 1 Kb I L A Hygromycin R A 5'Flanking region Hygromycin Marker < • < 5 ~3^I?lanki n g region 1 Kb 2.7 Kb 1 Kb 1 L A Hygromycin R A 8 Hygromycin cassette amplified with nested primers ~ 3.5 Kb In the first round of PCR, primers 1 and 3 were used to amplify the so-called left arm, primers 4 and 6 were used for the right arm and primers 2 and 5 were used for amplification of Hygromycin marker sequence (Table 3.6). In the second round all the components were put together to construct a cassette because primers 2, 3, 4 and 5 have the appropriate flanking sequences for the marker, and the left arm (LA) and right arm (RA). The ratio for LA : Marker : RA used in the second round of PCR of this experiment was 1:3:1 as reported to be effective for joining all three components of the cassette by Yu et al. (2004). In the third round of PCR, nested primers 7 and 8 (which are designed outside the marker and inside the LA and RA) were used for the amplification of the final product. 67 Figure 3.6: Amplified left arm, right arm, marker and knock out construct that was used to transform wild-type strains 001 and 002. LA RA M KO 3.5 Kb LA: left arm, RA: right arm, M: marker and KO: knock-out construct consists of marker, LA, RA flanking regions of cthl. 2ul of the PCR amplified product for each of the LA, RA and M were loaded on a mini agarose gel and was run for one hour at 80 volts. Hygromycin marker was used in this study. Ethidium bromide stained DNA bands were observed under UV light and images captured by using a gel doc system. 68 This approach has recently been modified to establish a double joint PCR strategy (Yu et al., 2004), and it has been used successfully for gene manipulations in many filamentous fungi. This technique has also been successfully used in our laboratory to knock out genes in Cryptococcus neoformans and U. maydis (Boyce et al. 2005). U. maydis is amenable to homologous recombination with transforming DNA and the overlap PCR method of gene deletion therefore works well for gene manipulation in this fungus. This method has also been effectively used for gene manipulations in three other filamentous fungal species, Aspergillus nidulans, Aspergillus fumigatus, and Fusarium graminearum (Yu et al., 2004). The DNA sequence of cthl (UM01649) was selected with one Kb of upstream and downstream flanking regions. An overview of the double joint PCR procedure is laid out in Figure 3.5. All the PCR products were confirmed for the correct sizes and the absence of non-specific bands by agarose gel electrophoresis as shown in the images in Figure 3.6. Note that the final PCR reaction generated non-specific products and these were eliminated by gel purification of the band of interest. The marker cassette constructed by the method described above was used to transform wild-type strains of the compatible mating types albl and a2b2 by biolistic transformation (Finer et al., 1992; Sanford et al., 1993). Initially, the resulting transformants were screened for growth on complete medium (CM) plates containing hygromycin. Antibiotic resistant clones were then transferred to fresh medium and genomic DNA was isolated from the selected mutants for evaluation by colony PCR and Southern blot analysis. The goal was to confirm the structure of the integrated DNA in the transformed cells and to determine whether any were mutants that contained the transforming DNA in place of the wild-type allele. 69 Figure 3.7: Southern blot analysis for cthl mutants. A. Restriction map showing the 6 .5 Kb fragment of wild-type genomic DNA cut by NgoMIV. ~ 6.5 Kb fragment 8500 1 1 *DrdI *NaeI ! *AgeI ' *EagI *NgoMIV *EagI B s t X I *AgeI *NruI P c i l #Eco0109I P c i l BsrGI ECO0109I l i f e I Ncol I I Ncol Ahdl BsrGI *NruI n-Fel A l e l DrdI *NaeI *NgoMIV BstXI 70 For Southern blot analysis, the genomic DNA of the candidate mutants and the wild-type strain was digested with the NgoMYV restriction enzyme to generate fragments of about 7.8 Kb and 6.5 Kb, respectively. The restriction map of the wild-type locus and the hybridization results are shown in Figure 3.7. It was clear from the Southern blot that mutant clones 2, 5, 6, 7 and 8 of the a2b2 (strain 001) wild-type background, and all 8 of the albl (strain 002) background clones have the expected 7.8 kb fragments detected by the hybridization probe. This analysis therefore confirmed these strains as true mutants and these were subsequently used for a charcoal plate mating assay and a plant assay to visualize the mating response and extent of infection and virulence caused by the mutants when compared to the wild-type strains. 3.3.2. Morphological studies of the cthl mutants Mutant strains were grown on PDA plates and PDB media and evaluated microscopically for morphological changes. Phenotypes might be predicted based on observations in other fungi. For example, the CTH zinc finger protein in Schizosaccharomyces pombe, encoded by zfsl, is required to prevent septum formation and exit from mitosis if the mitotic spindle is not assembled (Beltraminelli et al., 1999). Another study in fission yeast reported that disruption of zfsl was not lethal but conferred deficiency in mating and sporulation. Activation of transcription in response to the mating pheromone signaling was also greatly reduced in the z/s7-disrupted cells (Kanoh et al., 1995). Observations from budding and fission yeast for the CTH zinc finger proteins and other homologs like TTP/TIS11 proteins indicate that these proteins might also influence regulatory pathways that regulate survival, differentiation or proliferation (Johnson et al., 2000). In our study, the cthl mutant cells 71 under the microscope displayed a clustered morphology where elongated cells failed to differentiate properly. The cellular morphology of the cthl mutants is shown in Figure 3.8. Haploid cells for both strains were observed under the microscope after growing in PDB media for 24 hours and mutant cells were found to have a changed morphology in that they grew as branched hyphae that clumped together when compared to the single, yeast-like wild-type cells. Therefore, Acthl cells have a defect in morphology. 72 Figure 3.8: Morphology of Acthl mutants. Wild-type (A) and Acthl (B) haploid strains were grown overnight in PDB medium and stained to visualize cell walls (CAL) or nuclei (DAPI). (A) DIC and DAPI staining of wild-type cells showing nuclei of the haploid cells. (B) Cells of the Acthl mutant have an abnormal morphology resulting from defective division. Cells also appear branched and clumped arresting growth at Gl-phase. Some cells also display an increase in chitin staining and uneven chitin distribution. Cells of the Acthl mutant are multinucleate. Images were captured using DIC or epifluorescence to observe nuclei (DAPI). The bar is 10 microns in each photograph. Clump formation of the cells increase when grown for 48 and 72 hours. Cells showing defect during cytokinesis and arresting their growth at Gl-phase. 73 3.3.3. Mating assays in vitro and in planta To investigate the mating in compatible cthl mutant strains, strains of opposite mating types were combined on charcoal plates and evaluated for the filamentous growth and fuzzy colony appearance indicative of successful mating. By this assay, the deletion of cthl did not have a significant effect on the ability of the mutant cells to mate with either wild-type mating partner 521 (albl) or 518 (a2b2). In addition, no dramatic differences in mating were observed when cthl deletion strains of opposite mating types were combined on mating medium, although there was minor reduction in fiizziness of the mating colonies on the charcoal plates (Fig 3.9). These results indicate that cthl does not play any significant role in the establishment of filaments during mating. CTH-type zinc finger protein homologs are proposed to influence regulatory pathways that regulate survival, differentiation or proliferation (Johnson et al., 2000). Therefore it seemed possible that cthl deficient strains might be altered in differentiation and sporulation in U. maydis. To examine the role of cthl for morphological changes in planta during maize infection, one-week-old maize plants were inoculated with mating mixtures of the wild-type strains 518 (a2b2) and 521 (albl) or the A cthl a2b2 and A cthl albl mutants. In maize infected with a wild-type cross and with the mixture of cthl mutants (Acthl a2b2 with A cthl albl mutants), fungal growth was observed in plant epidermal cells (data not shown). The large stem tumors were also isolated from the plants and sections of tumors were viewed under microscope to observe teliospores formation. The tumor cell examination showed teliospore formation in infections with wild type strains, while there were no teliospores produced in plants inoculated with the A cthl mating mixture. These results suggest that cthl plays a role in determining the morphology 74 of the infectious, filamentous dikaryon that proliferates in host tissue. The altered morphology may account for the lack of teliospore formation. Maize seedling infections were performed in three replications and approximately 100 plants in total were scored for disease ratings. The results for the seedling inoculations are presented in Table 3.6. The extent of infection represented by the disease index calculations showed a decrease for the mutant combination compared to the wild-type infection, in agreement with the microscopic results. Therefore, mutants deficient in the cthl zinc finger gene are unable to cause full disease symptoms. The cthl gene was found to have elevated transcripts in the Ahgll library,_and hgll is thought to be a component of the cAMP signaling pathway with a role in teliospore formation (Durrenberger et al., 2000). It is possible that cthl is also involved in the cAMP signaling pathway and it may contribute to the sporulation defect of the hgll mutant. 75 Figure 3.9: Mating assay 001(a2b2) 001(a2b2) Acthl (001) Acthl(OOl) 002(albl) Acthl(002) 002(albl) Acthl (002) B albl xa2b2 Tumor tissue with teliospores Acthl (001 )x Acthl (002) tumor section with infection hyphae Acthl(001)x Acthl (002) tumor tissue with no teliospores Plant Assay Figure 3.9: (A) The charcoal plate mating assay shows white fuzzy colonies for all wild-type and mutant mating combinations. (B) Plant infection assay producing teliospores for the wild-type (albl x a2b2) mating combination. In tumor tissues for the mutant combination, teliospore formation was arrested at the hyphae stage of disease development. Arrow heads show infection hyphae; no teliospore formation was observed in tumor tissues. Scale bars = 1 Oum Table 3.6: Disease indices for wild-type and mutant infections in maize seedlings No. of plants with disease rating8 No of cell Total for no. of Disease Cross inoculation 0 1 2 3 4 5 plants index 007 x002 106 8 52 21 14 26 18 141 2.36 Acthl(001) x 002 106 18 41 10 8 13 13 104 1.83 001 x Acthl(002) 106 13 42 9 2 13 7 86 1.76 Acthl (001) x Acthl (002) 106 11 53 10 5 7 8 94 1.5 a Disease ratings are as follows: 0, no disease; 1, anthocyanin production; 2, leaf tumors; 3, small stem tumors; 4, large stem tumors; and 5, death. The numbers of plants from three individual experiments are pooled for each cross and approximately 100 plants for each cross were scored for disease. 77 Figure 3.10: C o l o n y m o r p h o l o g y o f w i l d - t y p e and Acthl strains. 78 Figure 3 . 1 0 : A and B shows the haploid colony morphology on PDA (potato dextrose agar) media plates for wild-type and Acthl respectively. Wild-type colonies have smooth edges while mutant shows irregular and filamentous morphology near colony edges. Scale bars = 10 um. C represents the mating colony morphologies. Wild-type combination produce smooth and round colonies while mutants combined on charcoal plate produce a zig-zag colony morphology i-e., irregular edges of colonies. Colonies are shown at 2x magnification. Colony morphology is shown in Figure 3.10 to demonstrate that haploid colonies of Acthl have abberant morphology. The Acthl strain produced colonies with irregular edges as compared to the wild-type colonies with round and smooth edges. Along with haploid colonies, mating colonies that resulted from the 001 x 002 and Acthl 001 x Acthl 002 combinations also display different morphology that corresponds to the cellular morphology shown earlier in this chapter. The colonies produced irregular edges with cells at the periphery appearing as elongated hyphae. Overall, these results indicate that cthl transcript levels are influenced by the hgll gene. They also indicate that cthl gene plays a role in morphogenesis and virulence. 79 C H A P T E R 4: DISCUSSION In the present study, SAGE experiments were designed to investigate the effect of hgll mutation through evaluating differential expression of the Ustilago transcriptome. The transcriptome data revealed differences in transcript abundance of genes related to different functional categories including protein metabolism, cellular transport, DNA binding, transcription regulation, signal transduction, stress response and fatty acid biosynthesis. A number of tags were found that identified genes potentially involved in or related to the signaling mechanisms/pathways in this phytopathogen. These findings are discussed below in terms of possible relevance to U. maydis biology, although it is realized that transcriptional changes alone may not directly reflect functional significance. However, the transcriptome analysis is valuable for generating hypotheses for subsequent testing. A closer inspection of the data focused on genes for several zinc finger proteins that could be related to the regulation of signaling via cAMP and ultimately influence host penetration, virulence gene expression and proliferation in the host. The functional analysis of one of these genes; cthl, confirmed its importance in the morphogenesis and virulence of U. maydis. 4.1. Significance of the gene functions identified by SAGE tags from the wild-type and mutant libraries 4.1.1. Protein biosynthesis-related genes may affect cell growth and proliferation via cAMP/PKA and TOR pathways One initial discovery from the transcriptome analysis was that the SAGE tags in the wild-type library was notably enriched (relative to the mutant library) with transcripts 80 associated with protein biosynthesis (e.g., transcripts encoding ribosomal proteins). SAGE analysis for S. cerevisiae also revealed that mRNAs for ribosomal proteins represented many of the most abundant transcripts (Velculescu, et al., 1997). Several studies with S. cerevisiae indicate that ribosome biosynthesis consumes most of the cellular energy and several factors such as nitrogen regulate the production of ribosomal proteins via the TOR signaling pathway (Cardenas et al., 1999; Martin et al., 2004; Schneper et al., 2004; Shamji et al., 2000). Tor and cAMP-PKA have been characterized as evolutionarily conserved signal cascades that couple nitrogen and carbon source availability, respectively, to regulate diverse cell responses that ultimately lead to cell growth and proliferation. However, the TOR signaling pathway appears to have a minor role in nitrogen signaling in Aspergillus nidulans, so there may be differences in the importance of the pathway in different fungi (Fitzgibbon et al., 2005). In budding yeast, a connection between the TOR and cAMP/PKA pathways has been found to activate stress responsive genes as well as ribosome biosynthetic genes, although these genes are also responsive to both carbon and nitrogen sources through independent chromatin modifying activities (Schneper et al., 2004). Both the TOR and cAMP-PKA pathways act early in the Gl phase to regulate growth, cell cycle progression, entry into GO and pseudohyphal differentiation in yeast (Barbet et al., 1996; Broach, 1991; Cutler et al., 2001; Heitman et al., 1991; Lorenz and Heitman, 1997; Pedruzzi et al., 2003; Thevelein, 1994; Zaragoza et al., 1998; Zurita-Martinez and Cartenas, 2005). Schmelzle et al., (2004) proposed that PKA functions downstream of TOR while according to Zurita-Martinez and Cartenas (2005) these two pathways work in parallel to activate the transcription of ribosomal protein genes. In the current project, the wild-type library 81 showed a large number of upregulated tags for genes related to protein biosynthesis/ribosomal proteins as compared to the hgll mutant library. Because hgll is proposed to be a regulatory component of the cAMP/PKA pathway, these results suggest similarities to the yeast studies. That is, these results (Table 3.3) may suggest that the hgll mutant strain lacks the ability to properly transduce a cAMP pathway signal resulting in a deficiency in ribosomal protein gene expression. Thus, findings related to the cAMP and TOR pathways in S. cerevisiae appear to be conserved in U. maydis, at least with respect to the expression of protein biosynthesis-related genes. A similar conclusion was reached by Larraya et al. (2005) in the SAGE analysis of PKA mutants in U. maydis. 4.1.2. Protein catabolism-related genes The transcriptome analysis also revealed some tags that identified genes encoding proteins related to protein degradation. For example, abundant tags were present for a gene encoding a putative aspartyl protease in the mutant library and this may suggest differences in proteolysis activity in hgll cells (see Table 3.4). This type of protease is related to pepsins, cathepsins, and renins. S. cerevisiae has served as a eukaryotic model organism to study the functions of regulatory proteases and considerable work has been done on proteases in other eukaryotic species including, for example, humans (Wise et al., 1991), the fission yeast Schizosacchoromyces pombe (Davey et al., 1994), and even U. maydis (Park et al., 1994). In pathogenic microorganisms extracellular proteases may participate in interactions with host cells and in morphogenesis. For example, two cell surface proteases in Candida albicans were described by Albrecht at al., (2006) that 82 function in cell surface integrity (important for interactions with epithelial cells) and cell separation during budding. Facultative pathogens may secrete proteases that have more general and much broader effects, and that play important roles in both saprophytic growth and infection (Albrecht et al., 2006). The intracellular proteinase PumAi has been characterized in U. maydis (Mercado-Flores et al., 2005). The biochemical characteristics of PumAi are similar to other fungal intracellular aspartyl proteinases, and are probably associated with the dimorphic yeast-mycelium transition (Mercado-Flores et al., 2005). Another tag for a gene encoding a putative carboxypeptidase (UM01886) was upregulated in the wild-type library; this protein is related to the family of the enzymes that use serine in their catalytic site and that are ubiquitous, being found in viruses, bacteria and eukaryotes. This group of serine peptidases belongs to family S10 and, in S. cerevisiae, the secreted protease carboxypeptidase Y is member of this family of enzymes (Rawling and Barretts, 1994). Perhaps U. maydis produces these types of enzymes for invasion into host tissue, although specific experiments will be needed with wild type and hgll strains to examine protease activity during infection. Genes for proteases were also found in SAGE libraries from C. neoformans and were suggested to be an important for the survival of the fungus in the host (Steen et al., 2003). As mentioned, U. maydis is related to Cryptococcus (both are basidiomycetes) and several types of tags/genes were found to be similar among the SAGE libraries of these fungal pathogens. More detailed comparisons are needed to further examine conserved patterns of regulation (e.g., shared cAMP pathway targets) in these fungi. 83 4.1.3. Tags related to cellular transport mechanisms, lipids and phosphate Both the wild-type and the mutant libraries contained tags that matched genes encoding putative cellular transport functions (Table 3.3). For example, in the mutant library, genes for transport proteins included those involved in fatty acid transport, electron transport, sugar transport, inorganic phosphate transport, vacuolar transport and RNA transport. In the mutant library, a tag associated to peroxisomal ABC transporter (UM03945; CATGCCAGCCCACA) was found to be elevated. Over 100 families of transporters have now been recognized and classified, and the ABC superfamily and MFS account for nearly half of the solute transporters encoded within the genomes of microorganisms. The peroxisomal membrane forms a permeability barrier for a wide variety of metabolites involved in fatty acid beta-oxidation. To communicate with the cytoplasm and mitochondria, peroxisomes need dedicated proteins to transport such hydrophilic molecules across their membranes. In S. cerevisiae the PALI gene product shares a high degree of amino acid sequence identity with two human proteins, adrenoleukodystrophy protein and peroxisomal membrane protein (70 kD), which are both presumptive ATP-binding cassette transporters thought to be constituents of the peroxisomal membrane (Swartzman et al., 1996). Work done by Klose etal., (2004) in our laboratory showed that fatty acids induce filamentation in U. maydis and the hyphal cells resemble the infectious filaments observed in planta. Recently Klose and Kronstad (2006; manuscript submitted) characterized Mfe2 (the multifunctional P oxidation enzyme) catalyzing the second and third reactions in P-oxidation of fatty acids in peroxisomes. They tested whether Mfe2 has a metabolic role related to lipids in the 84 morphological transition and in pathogenic development in host tissue. The gene turned out to be required for full symptom development. It is also known that in various fungal pathogens lipid metabolism is important to generate turgor pressure in the hyphal tip to penetrate into the host (Thines et al., 2000). The putative peroxisomal transporter found in the hgll library might be involved in lipid transport. It also may have a connection to the lipid induced filamentous growth in Ustilago (Klose et al., 2004) and might have a role in dimorphic transition related to hyphal proliferation in the host. The expression of the gene may also be relevant to the PKA and MAPK signaling pathways because these signaling cascades are required both for dimorphic transition and the response to lipids. Inorganic phosphate transporters belong to the major facilitator super family (MFS) of transporter proteins that are single-polypeptide secondary carriers capable of transporting small solutes. Tag CATGCGGCAGAGCC associated to gene UM05260 was found to be related to inorganic phosphate transport. A previous study in our laboratory by Larraya et al., (2005) identified elevated tags related to phosphate metabolism under high PKA activity, which indicates a link between PKA and phosphate metabolism in U: maydis. It was proposed that phosphate may also be acting as a nutrient signal in this phytopathogen. Another study by Hornby et al., (2004) showed increased pseudohyphal growth in Candida albicans under high phosphate conditons and this is in agreement with the findings in U. maydis which suggests enhanced filamentation under elevated phosphate conditions when lipids were used as a carbon source (Larraya et al., 2005). The SAGE findings here further reinforce the connections between phosphate metabolism, morphogenesis and cAMP signaling. 85 Vacuolar protein sorting machinery (Dorl like family; gene UM03238) is highly conserved between yeast and higher eukaryotes (Bonagelino et al. 2002). In S. cerevisiae, vacuolar transport chaperone (Vtc4) is required for the fusion of inorganic phosphate (Pi)-containing vesicles to the vacuolar membrane for subsequent storage in the vacuole in the form of polyphosphates (Giots et al., 2003). It was also shown that Pho84p and Pho87p permeases respond to the polyphosphates and acts along with glucose to activate the PKA pathway (Giots et al., 2003). In U. maydis it was previously shown that the Aubcl mutant had defects in polyP accumulation in the vacuole (Larraya et al., 2005) while recently Boyce et al, (2006; in press) proposed that Vtc4 in U. maydis influences polyphosphate storage, morphogenesis and virulence through PKA regulation. 4.1.4. Zinc finger proteins and their role in nucleic acid binding, transcription regulation and signal transduction Zinc finger domains are nucleic acid-binding protein features first identified in the Xenopus laevis transcription factor TFIIIA (Klug and Rhodes, 1987). These domains have since been found in numerous nucleic acid-binding proteins. They have the ability to bind to both RNA and DNA, and it has been suggested that the zinc finger may thus represent the original nucleic acid binding domain. It has also been suggested that a Zn-centred domain could be used in protein-protein interactions. Many classes of zinc fingers are recognized and they are classified according to the number and positions of the histidine and cysteine residues involved in the zinc atom coordination. For example, in the first class to be characterized, called C2H2, the first pair of zinc coordinating residues are cysteines, while the second pair are histidines (Boehm et al., 1997). Zinc 86 finger proteins are among the most common proteins encoded by eukaryotic genomes (Laity et al., 2001). Their functions include DNA recognition, RNA packaging, transcriptional activation, regulation of apoptosis, protein folding and assembly, and lipid binding (Laity et al., 2001). At least 14 different classes of zinc finger proteins are well characterized (Matthews et al., 2002). In both SAGE libraries, a number of tags identified genes with sequence similarity to genes for different zinc finger proteins. For ease of reference, these tags have been collected together in one table presented here (Table 4.1). Tags for the zinc finger proteins with the PHD and GATA domains were found in both libraries, but these represented different genes. There are a number of genes for different zinc finger type proteins reported in the Whitehead database for U. maydis and an overview of the copy number predicted to be present in the genome for each zinc-finger type found in the SAGE data is presented in Table 4.2. The PHD zinc finger found in the mutant library (gene UM02605) is a C4HC3 zinc-finger-like motif found in nuclear proteins and is thought to be involved in chromatin-mediated transcriptional regulation. The PHD finger motif is reminiscent of, but distinct from, the C3HC4 type RING finger. The function of this domain is not yet known but it is predicted to be involved in protein-protein interactions and be important for the assembly or activity of multicomponent complexes involved in transcriptional activation or repression. Similar to the RING finger and the LIM domain, the PHD finger is thought to bind two zinc ions (Aasland et al., 1995). The other gene encoding a PHD zinc finger protein and elevated in wild-type library (gene UM05577) has homology to the BAH (bromo-adjacent homology) domain. Although its function is also well established, the BAH domain appears to act as a protein-protein 87 interaction module specialized in gene silencing and might play a role in DNA methylation, replication and transcriptional regulation (Callebaut et al., 1999). Similarly, different genes for GATA zinc finger proteins are present in the libraries. These are genes UM05773 and UM04252 in the mutant and wild type libraries, respectively. Two different tags for UM05773 were identified in the mutant library and this may indicated different splicing events for the same gene. There are eight related genes in the GATA-like category reported in the database, as shown in Table 4.2. Only one out of eight genes is characterized and is known as URBS1 (UM01050.1), a regulator of siderophore biosynthesis (An et al. 1997; Voisard et. al. 1993). The DNA-binding domains of eukaryotic GATA factors have a four-cysteine Zn finger and an adjacent basic region. Fungal GATA factors regulate nitrogen metabolism, light induction, siderophore biosynthesis and mating-type switching. In fungi, interactions with other factors have been found to influence promoter binding specificity for GATA proteins (Klug, 1999; Laity et al., 2001; Scazzocchio, 2000). The gene for the DHHC zinc finger domain (also called the NEW1 or zf-DHHC domain) that was identified in the SAGE data (tag CATGCTTTTGTAAC, six times higher in the wild-type vs. the mutant library) is found in a large family of membrane proteins in many organisms ranging from unicellular eukaryotes to humans (Putilina et al., 1999). The function of this domain is unknown, but it has been predicted to be involved in protein-protein or protein-DNA interactions and may have palmitoyltransferase activity (Lobo et al., 2002). 88 Table 4.1: Predicted Zinc finger proteins with elevated expression in hgll (mutant) and wild-type libraries ' Gene frequencies * Predicted Tag hgll WT Tag to gene assignment BLAST result (NCBI)** E-value domain Upregulated in hgll CCCAACTCGG 32 0 Hypothetical protein (UM 02605) Cryptococcus neoformans 7.00E-05 PHD zinc finger AAW42860.1 TTGTATGGTT 20 0 Hypothetical protein (UM 05773) Neurospora crassa 8.00E-16 GATA Zinc finger CAD21376.1 GAGTCCAAGT 17 0 Hypothetical protein (UM 05773) Neurospora crassa 8.00E-16 » CAD21376.1 GATGCTTTTT 14 0 Hypothetical protein (UM 01649) Pan troglodytes 4.00E-12 CCCH Zinc XP_510026.1 finger domain GCTGCGAAAA 12 0 Hypothetical protein (UM 05804) No significant hits C2H2 Zinc finger Upregulate in wild-type CACACGCACA 4 48 Hypothetical protein (UM 05577) Cryptococcus neoformans 2.00E45 PHD Zinc finger, AAN75722.2 BAH domain. GATGTCCTTG 16 31 Hypothetical protein (UM 04252) Emericella nidulans 1.00E-36 GATA Zinc finger AAP04416.1 CTTTTGTAAC 4 26 Hypothetical protein (UM 01636) Aspergillus fumigatus 3.00E-39 DHHCZinc EAL85347.1 finger domain. * Tag frequencies have been normalized to the size of the smaller library for comparison (wild-type, 13867 tags). **NCBI, National centre for biotechnology information ("http://vvww.ncbi.nlm.nih.gov/). Table 4.2: * Ustilago maydis zinc finger proteins in the Whitehead database. Zinc finqer tvoe Genes in database zf-C2H2 Zinc finger, C2H2 type 23 zf-CCCH Zinc finger C-x8-C-x5-C-x3-H type (and similar). 6 zf-DHHC DHHC zinc finger domain 5 zf-PHD PHD finger 12 zf-GATA G A T A Zinc finger 8 * Whitehead Ustilago maydis database (http://www.broad.mit.edu/annotation/genome/ustilago mavdis/Home.htnil) 89 Figure 4.1: Proposed model for hgll Z i n c f i n g e r Z i n c f i n g e r p r o t e i n p r o t e i n Z i n c f i n g e r p r o t e i n DNA-bindinsz RNA-bindinii Protein- prote in Transcription interactions regulation For example, the DHHC-CRD motif is found in a large, diverse family of proteins that have been implicated in palmitoyl transfer during protein lipidation as reported by Gleason et al. (2006). The presence of five genes for zinc finger proteins in the mutant transcriptome suggests that these proteins may be playing a crucial role in the cAMP signaling pathway downstream of Hgll. Hgll has already been proposed to be a cAMP pathway component that acts downstream of adrl (the catalytic subunit of PKA) based on epistasis and in vitro phosphorylation experiments (Durrenberger et al., 2001). Zinc finger proteins might be working downstream of Hgll as probable transcription factors or interacting with other signaling components because the zinc finger proteins, in addition to their role 90 as a DNA-binding module, are known to mediate proteimproteiri and proteimlipid interactions (Matthews et al., 2002). A possible connection with lipids would be intriguing because of the known influence of lipids on morphogenesis in U. maydis (Klose et al., 2004). The different types of zinc finger proteins found in the libraries likely have a variety of functions given the various possible binding activities; they may be facilitating multiple intermolecular interactions among downstream targets of the signaling pathways and influencing transcription of downstream target genes. Further investigations are required to validate these predictions and explore the functions of these genes In addition to the zinc finger proteins, other potential regulatory proteins such as the APSES domain protein, zuotin and a dead-box protein are categorized as nucleic acid binding proteins and were found among the wild-type upregulated genes. The APSES domain is a DNA-binding domain and is found in several yeast proteins involved in transcriptional regulation. These proteins often also contain an ankyrin domain for cell cylcle regulatory transcription (Iyer et al., 2002). The APSES domain is also known to regulate morphogenesis and metabolism in Candida albicans (Doedt et al., 2004). The transcript for the ankyrin repeat protein (UM02860) was found with elevated expression in wild-type library. This repeat is one of the most common protein-protein interaction motifs in nature, and is found in proteins of diverse function such as transcriptional initiators, cell-cycle regulators, cytoskeletal proteins, ion transporters and signal transducers. Zhang et al., (1992) found that zuotin is a putative Z-DNA binding protein in yeast. DEAH box helicases are involved in unwinding nucleic acids and in various aspects of RNA metabolism, including nuclear transcription, pre mRNA splicing, 91 ribosome biogenesis, nucleocytoplasmic transport, translation, RNA decay and organellar gene expression (de la Cruz et al., 1999). These functions related to the nucleic acid binding proteins might indicate that these proteins could be involved in cellular signaling and potentially interact with zinc finger proteins in U. maydis. In the future, protein-protein interaction assays could be performed among the proteins identified by SAGE to learn more about their specific functions in U. maydis. 4.1.5. Other GO categories A few tags were found that identified genes associated with cellular respiration and the stress response. Genes involved with cellular respiration were found to be more highly expressed in the wild-type library compared to the mutant library. For example, abundant tags for a gene encoding a putative ATP synthase subunit were found in wild-type library. The abundance of this tag may indicate differences in the process of cellular respiration and energy requirements between the wild-type and mutant cells. For the stress response, tags for genes encoding putative heat shock proteins 70 and 80 (UM03791, UM02170) were found to be abundant in the wild-type transcriptome. Heat shock proteins are produced in response to stress and are thought to promote cell survival (Garrido et al., 2001; Paracellier et al., 2003). The U. maydis hsp70 genes have been shown to be required for thermotolerance (Holden et al., 1989). Further categories containing abundant tags in the mutant library included genes for amino acid biosynthesis, carbohydrate metabolism/catabolism and fatty acid biosynthesis. For example, the U. maydis gene UM06414 encodes a predicted polyketide synthase (PKS; Staunton and Weissman, 2001), with elevated transcripts in the hgll 92 mutant library. Fungal polyketides are a diverse group of secondary metabolites that include important drugs, pigments, and mycotoxins. Fungal type I polyketide synthases (PKS) are multidomain enzymes with similarity to multidomain fatty acid synthases. (Schumann and Hertweck, 2006). Wild-type library tags were found at higher expression levels for cellular metabolism, heavy metal binding and DNA replication functions. Finally, tags for a probable PH081 gene and for serine/threonine kinases were assigned with the GO term "signal transduction" (Table 3.3). Pho81 (UM02860) is highly similar to the Nuc2 protein of N. crassa and to the Pho81p (cyclin dependent protein kinase inhibitor) of S. cerevisiae. It also directly binds to the G- protein beta subunit and inhibits transduction of the mating pheromone signal (Spain et al., 1995). This finding may indicate additional connections between cAMP signaling, phosphate sensing cell cycle and G-protein signaling in U. maydis. 4.2. Identification of cthl and its homologs The cthl gene was identified as having an upregulated tag in the mutant SAGE library. Specifically, the tag was found at 14 copies compared to no copies in the wild-type library. The cthl sequence (UM01649; hypothetical protein) showed similarity to the Cthlp of S. cerevisiae (Thompson et al., 1996), Tristetrapolin/TISl 1 in mammals (Johnson et al., 2000), ERF-1 in Homo sapiens (Barnard et al., 1993) and zfsl in Schizosaccharomyces pombe (Wood et al., 2002). The U. maydis genome contains six genes encoding proteins that show similarity to CCCH domain proteins. As mentioned earlier, zinc finger domains are thought to be involved in DNA-binding, and exist in different types depending on the positions of the cysteine residues. 93 Proteins containing zinc finger domains of the C-x8-C-x5-C-x3-H type (CCCH) include zinc finger proteins involved in cell cycle or growth phase-related regulation. For example, the human TIS1 IB (butyrate response factor 1) is a probable regulatory protein involved in regulating the response to growth factors, and the mouse TTP growth factor-inducible nuclear protein has the same function. The mouse TTP protein is known to be induced by growth factors (Ma and Herschman, 1991). Another protein containing this domain is the human splicing factor U2AF 35 kD subunit, which plays a critical role in both constitutive and enhancer-dependent splicing by mediating essential protein-protein interactions and protein-RNA interactions required for 3' splice site selection. It has also been shown that different CCCH zinc finger proteins interact with the 3' untranslated region of various mRNA (Carballo et al., 1998; Lai et al., 1999). Interestingly Ustilago has a CCCH-type zinc finger protein family size more similar to the ascomycete S. cerevisiae than to the basidiomycete C. neoformans (Austin et al., 2004). 4.2.1. cthl encodes a conserved sequence The hypothetical protein product of cthl (UM01649) containing a CCCH domain protein that is 409 amino acids long and the gene is located on chromosome three in strain 002/521. In budding yeast, overexpression of the CTH genes or one of the related mammalian genes, tris-tetraprolin (TTP), caused delayed entry of cell cultures into exponential growth, and a decrease in final cell density. Removal of the Zf domain of Cthlp by truncation or deletion completely reversed this slow growth phenotype, indicating that it was mediated through this highly conserved structural motif (Thompson et al., 1996). The CCCH Zf protein in mouse (TTP/Nup475/TISl 1) is also well-studied 94 Figure 4.2: Conserved CCCH-Zf motif showing C x 8 C x 5 C x 3 H zinc finger CTH U. maydis (xp_757796) CTH1 S. cerevisiae(NP_0W435) TIS11B M. musculus (P23950) TIS11A H. Sapiens (P26651) 311.[1].YKTEICRNW .[1] 2 04.[1].YKTELCESF .[1] 114.[1].YKTELCRPF .[1] 103.[1].YKTELCRTF .[1] . EKGFCYYGDRCQFAHGE 338 . IKGYCKYGNKCQFAHGL 231 . ENGACKYGDKCQFAHGI 141 . ESGRCRYGAKCQFAHGL 13 0 Glycine (G), Proline (P), Small and hydrophobic (A,V,L,I,M,F,W), Hydroxyl and amine amino acids (S,T,N,Q), Charged amino-acids (D,E,R,K), Histidine and tyrosine (H,Y) 95 4.2.2. The cthl gene is required for normal morphology and completion of the life cycle in Ustilago maydis Mutants defective in cthl exhibit a clustered cell morphology when haploid cells are grown in PDB medium- The cells contained multiple nuclei, and this phenotype is suggestive of defective cell division. There are many processes in fungi that could lead to this type of phenotype. For example, a defect in the sep3 gene encoding a septin causes altered cell morphology and separation in U maydis (Boyce et al., 2005). Additionally, the clusters of cells are reminiscent of the mutants defective in components of the cAMP pathway including gpa3, uacl and adrl. The phenotype might also result from an influence on the cell cycle and the regulation of septation. - For example, in Schizosaccharomyces pombe, cdcl6 is required to limit the cell to forming a single division septum per cell cycle; the heat-sensitive loss-of-function mutant cdcl6-116 completes mitosis, and then undergoes multiple rounds of septum formation without cell cleavage. The cdcl6 protein is a homologue of S. cerevisiae BUB2p, and has also been implicated in the spindle assembly checkpoint function in S. pombe (Beltraminelli et al., 1999). The genetic interactions of the S. pombe zfsl gene (encoding a CCCH protein) with genes regulating septum formation suggest that it may also be a modulator of the signal transduction network controlling the onset of septum formation and exit from mitosis (Beltramineli et al., 1999). In another study in fission yeast, disruption of zfsl conferred deficiency in mating and sporulation (Kanoh et al., 1995). In U. maydis, haploid cthl mutant cells appear to have a deficiency in proper division that results in clustering of the cells. Therefore, the information on the zfsl in S. pombe may be particularly relevant. The observation that plants inoculated with mutant combinations of 96 compatible strains produced tumors but did not produce any teliospores also suggests that cthl plays an important role in development, perhaps in connection with completion of the life cycle. It is interesting that in the parasite Trypanosoma brucei, the CCCH domain genes tbZFPl and tbZFP2 each contain only one zinc finger like the U. maydis Cthl protein in the present study, and involved in life cycle regulation and differentiation (Hendriks etal., 2001). 4.2.3. Connections between cthl and signaling pathways that influence pathogenicity in U. maydis It is already well established that the cAMP and mating pathways are essential for morphogenesis and pathogenesis in U. maydis (Bannuett, 1995; Bannuett and Herskowitz, 1994; Basse and Steinberg, 2004; D'Souza and Heitman, 2001; Durrenberger et al., 1998; Gold et al., 1997; Gold et al; 1994-b; Harashima and Heitman, 2005; Kronstad et al., 1998; Kruger et al., 1998; Lee et al., 2003). The SAGE results presented in this thesis reveal a possible connection between cthl, hgll and other zinc finger proteins as downstream elements of the cAMP pathway which ultimately affect the morphology and pathogenicity in this pathogen. Clearly, further experimentation is needed to validate the predictions of the SAGE data but the findings so far with cthl indicate that the' approach is valid. Specifically, SAGE was used to identify cthl as a regulated gene and subsequent functional analysis confirmed a role for the gene in morphogenesis and virulence in maize. It is possible that the Cthl protein may be a transcription factor or bind to a transcription factor to participate in regulation via cAMP signaling to control dimorphism. Evidence has been found in S. pombe that activation of transcription in response to the mating pheromone signaling was greatly reduced in zfsT 97 disrupted cells. The mating deficiency of the zfsl disruptant was suppressed partially by overexpression of either gpal, rasl, byrl, or byr2, which are involved in the transmission of the pheromone signal. Thus zfsl is involved in the mating pheromone signaling pathway (Kanoh et al., 1995). In this context, Durrenberger et al., (2001) found that hgll transcript levels are influenced by mating in U. maydis. To determine the role of cthl in the pheromone signaling pathway in U. maydis, a mating plate assay was performed by combining cthl disrupted mutants of opposite mating types. These strains did produce reduced filamentation/fuzziness compared with the wild-type combination, although the differences were not dramatic. In S. cerevisiae, the function of Cthl is binding to a specific DNA sequence to modulate transcription (Thompson et al., 1996). A related CCCH domain gene, CTH2, is involved with iron homeostasis including the regulation of the level, transport and metabolism of iron ions (Thompson et al., 1996). This finding raises the possibility that cthl in U. maydis might participate in post-transcriptional regulation. Post-transcriptional regulation involves the control of mRNA stability by AU rich elements (AREs) in the 3' UTR (untranslated regions) (Cramer et al., 2001; Proudfoot et al., 2002). Human TTP binds to AU-rich elements within the 3'UTR of target mRNA and induces RNA degradation (Blackshear et al., 2003; Lai et al., 1999). 4.3. Future experiments The work presented here describes transcriptional changes associated with loss of hgll and reveals that cthl in U. maydis may be essential for several different functions including morphogenesis, cell differentiation, life cycle completion and interaction with other components in the PKA and pheromone pathways. There are a large number of 98 further experiments that could be performed. In particular, the disruption of many of the other genes encoding zinc finger domain proteins should be a priority, especially given the success in discovering a phenotype for cthl mutants. Besides the zinc finger proteins, interesting candidate genes for functional analysis include the forkhead associated domain, gene PH081, the candidate lipid transporter gene, and other ABC transporter genes. Regarding cthl, the subcellular localization of the Cthl zinc finger protein would be interesting to discover. It has been reported that TIS11 (human CCCH zinc finger homolog) is subject to constant nucleocytoplasmic shuttling due to its NLS (nuclear localization signal) and NES (nuclear export signal). This implies that interplay between the NLS and NES determines the subcellular localization of TIS11 (Murata et al., 2002). To determine subcellular localization of Cthl in Ustilago, immunofluorescent staining or GFP fusion experiments can be performed. Such experiments may confirm the proposed nuclear and cytoplasmic localization of this protein. Subsequent experiments could explore potential transcriptional or post-transcriptional targets and mechanisms of cthl function. 99 BIBLIOGRAPHY 1. Aasland R, Gibson TJ, Stewart AF. 1995. The PHD finger: implications for chromatin-mediated transcriptional regulation. Trends Biochem Sci. 1995 Feb;20(2):56-9. 2. Albrecht A, Felk A, Pichova I, Naglik JR, Schaller M, de Groot P, Maccallum D, Odds FC, Schafer W, Klis F, Monod M, Hube B. 2006. Glycosylphosphatidylinositol-anchored proteases of Candida albicans target proteins necessary for both cellular processes and host-pathogen interactions. J Biol Chem. 13;281(2):688-94. 3. Alspaugh JA, Pukkila-Worley R, Harashima T, Cavallo LM, Funnell D, Cox GM, Perfect JR, Kronstad JW, Heitman J. 2002. Adenylyl cyclase functions downstream of the Galpha protein Gpal and controls mating and pathogenicity of Cryptococcus neoformans. Eukaryot Cell. l(l):75-84. 4. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-3402 5. Alwine, J.C, D.J. Kemp and G.R. Stark. 1977. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl- paper and hybridization with DNA probes. Proc. Natl. Acad. Sci. USA 74:5350-5354. 6. An Z, Zhao Q, McEvoy J, Yuan WM, Markley JL, Leong SA. 1997. The second finger of Urbsl is required for iron-mediated repression of sidl in Ustilago maydis. Proc Natl Acad Sci U S A . 27;94(11):5882-7. 7. Andrews DL, Egan JD, Mayorga ME, Gold SE. 2000. The Ustilago maydis ubc4 and ubc5 genes encode members of a MAP kinase cascade required for filamentous growth. Mol. Plant Microbe Interact. 13:781-6 8. Ansari, K., S. Martin, M. Farkasovsky, I. M. Ehbrecht, and H. Kuntzel. 1999. Phospholipase C binds to the receptor-like GPR1 protein and controls pseudohyphal differentiation in Saccharomyces cerevisiae. J. Biol. Chem. 274:30052-30058 9. Audic, S., and J. M. Claverie. 1997. The significance of digital gene expression profiles. Genome Res. 7:986-995 10. Austin R, Provart NJ, Sacadura NT, Nugent KG, Babu M, Saville BJ. 2004. A comparative genomic analysis of ESTs from Ustilago maydis. Funct Integr Genomics. 4(4):207-18. 100 11. Bakkeren G, Kronstad JW. 1994. Linkage of mating-type loci distinguishes bipolar from tetrapolar mating in basidiomycetous smut fungi. Proc Natl Acad Sci U S A . 91(15):7085-9. 12. Banuett F. 1995. Genetics of Ustilago maydis, a fungal pathogen that induces tumors in maize. Annu Rev Genet. 1995;29:179-208. 13. Banuett F, Herskowitz I. 1994. Identification of fuz7, a Ustilago maydis MEK/MAPKK homolog required for a-locus-dependent and -independent steps in the fungal life cycle. Genes Dev. 8(12): 1367-78. 14. Banuett F, Herskowitz I. 1996. Discrete developmental stages during teliospore formation in the corn smut fungus, Ustilago maydis. Development. 122(10):2965-76. 15. Barbet, N. C , U. Schneider, S. B. Helliwell, I. Stansfield, M. F. Tuite, arid M. N. Hall. 1996. TOR controls translation initiation and early Gi progression in yeast. Mol. Biol. Cell 7:25-42. 16. Bardwell L. 2005. A walk-through of the yeast mating pheromone response pathway. Peptides. 26(2):339-50. 17. Barrett KJ, Gold SE, Kronstad JW. 1993. Identification and complementation of a mutation to constitutive filamentous growth in Ustilago maydis. Mol. Plant Microbe Interact. 6:274-83 18. Barrels DJ, Mitchell DA, Dong X, Deschenes RJ. 1999. Erf2, a novel gene product that affects the localization and palmitoylation of Ras2 in Saccharomyces cerevisiae. Mol Cell Biol. 19(10):6775-87. 19. Basse CW and Steinberg G 2004. Pathogen profile: Ustilago maydis, model system for analysis of the molecular basis of fungal pathogenicity. Molecular Plant Pathology 5: 83:92. 20. Basse CW and Farfsing JW. 2006. Promoters and their regulation in Ustilago maydis and other phytopathogenic fungi. FEMS Microbiol Lett. 254(2):208-16. 21. Bechmann G . , Schulte U . , Weiss H. 1992. Mitochondrial ubiquinol-cytochrome c oxidoreductase. Molecular mechanisms in bioenergetics. 22. Beltraminelli N, Murone M, Simanis V. 1999. The S. pombe zfsl gene is required to prevent septation if mitotic progression is inhibited. J Cell Sci. 112 Pt 18:3103-14. 23. Blackshear PJ. 2002. Tristetraprolin and other CCCH tandem zinc finger proteins in the regulation of mRNA turnover, Biochem Soc Trans 30, pp. 945-952. 101 24. Boehm S, Frishman D, Mewes HW. 1997. Variations of the C2H2 zinc finger motif in the yeast genome and classification of yeast zinc finger proteins. Nucleic Acids Res. 25: (1997) 25. Bolker M., Urban M., Kahmann R. 1992. The a mating type locus of U. maydis specifies cell signaling components. Cell 68:441-450. 26. Bolker M. 2001. Ustilago maydis-a valuable model system for the study of fungal dimorphism and virulence. Microbiology. 147(Pt 6):1395-401. 27. Bolker, M., S. Genin, C. Lehmler, and R. Kahmann. 1995. Genetic regulation of mating and dimorphism in Ustilago maydis. Can. J. Bot. 73:320-325. 28. Bonangelino CJ, Chavez EM, Bonifacino JS. 2002. Genomic Screen for Vacuolar Protein Sorting Genes in Saccharomyces cerevisiae. Mol Biol Cell. 13(7): 2486-2501 29. Boyce KJ, Chang H, D'Souza CA, Kronstad JW. 2005. An Ustilago maydis septin is required for filamentous growth in culture and for full symptom development on maize. Eukaryot Cell. 2005 Dec;4(12):2044-56. 30. Boyce KJ, Kretschmer M and Kronstad JW. (Manuscript submitted). The vtc4 gene influences polyphosphate storage, morphogenesis and virulence in the maize pathogen Ustilago maydis. 31. Broach, J. R. 1991. RAS genes in Saccharomyces cerevisiae: signal transduction in search of a pathway. Trends Genet. 7:28-33. 32. Brown RS. 2005. Zinc finger proteins: getting a grip on RNA. Curr Opin Struct Biol. 15(l):94-8. 33. Bustin, S.A. 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25:169-193. 34. Callebaut I, Courvalin JC, Mornon JP. 1999. The BAH (bromo-adjacent homology) domain: a link between DNA methylation, replication and transcriptional regulation. FEBS Lett. 5;446(l):189-93. 35. Carballo E, Lai WS, Blackshear PJ. 1998. Feedback inhibition of macrophage tumor necrosis factor-alpha production by tristetraprolin. Science. 14;281(5379):1001-5. 36. Cardenas, M. E., N. S. Cutler, M. C. Lorenz, C. J. Di Como, and J. Heitman. 1999. The TOR signaling cascade regulates gene expression in response to nutrients. Genes Dev. 13:3271-3279. 102 37. Chaveroche MK, Ghigo JM and d'Enfert C. 2000. A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans, Nucleic Acids Res. 28, p. E97. 38. Christensen JJ. 1963. Corn smut induced by Ustilago maydis. Am. Phytopathol. Soc. Monogr. 2 39. Cramer P, Srebrow A, Kadener S, Werbajh S, de la Mata M, Melen G, Nogues G and Kornblihtt AR. 2001. Coordination between transcription and pre-mRNA processing. FEBSLett., 498, 179-182. 40. Cutler, N. S., X. Pan, J. Heitman, and M. E. Cardenas. 2001. The TOR signal transduction cascade controls cellular differentiation in response to nutrients. Mol. Biol. Cell 12:4103-4113. 41. Davey, J., Davis, K., Imai, Y., Yamamoto, M., and Matthews, G. (1994) Isolation and characterization of krp, a dibasic endopeptidase required for cell viability in the fission yeast Schizosaccharomyces pombe. EMBO J. 13, 5910-5921 42. Davidson RC, Blankenship JR, Kraus PR, de Jesus Berrios M, Hull CM, D'Souza C, Wang P and Heitman J. 2002. A PCR-based strategy to generate integrative targeting alleles with large regions of homology, Microbiology 148, pp. 2607-2615. 43. de la Cruz J, Kressler D, Linder P; Trends Biochem Sci 1999. Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. 24:192-198. 44. Dhillon NK, Sharma S, Khuller GK. 2003. Signaling through protein kinases and transcriptional regulators in Candida albicans. Crit Rev Microbiol. 29(3):259-75. -? 45. Doedt T, Krishnamurthy S, Bockmuhl DP, Tebarth B, Stempel C, Russell CL, Brown AJ, Ernst JF. 2004. APSES proteins regulate morphogenesis and metabolism in Candida albicans. Mol Biol Cell. 15(7):3167-80. 46. DuBois RN, McLane MW, Ryder K, Lau LF and Nathans D. 1990. A growth factor-inducible nuclear protein with a novel Cys/ His repetitive sequence. J. Biol. Chem. 265, pp. 19185-19191 47. D'Souza CA, Heitman J. 2001. Conserved cAMP signaling cascades regulate fungal development and virulence. FEMS Microbiol. Rev. 25:349-64 48. D'Souza CA, Alspaugh JA, Yue C, Harashima T, Cox GM, Perfect JR, Heitman J. 2001. Cyclic AMP-dependent protein kinase controls virulence of the fungal pathogen Cryptococcus neoformans. Mol Cell Biol. 21(9):3179-91. 103 49. Durrenberger F, Laidlaw RD, Kronstad JW. 2001. The hgll gene is required for dimorphism and teliospore formation in the fungal pathogen Ustilago maydis. Mol Microbiol. 41(2):337-48. 50. Durrenberger F, Wong K, Kronstad JW. 1998. Identification of a cAMP-dependent protein kinase catalytic subunit required for virulence and morphogenesis in Ustilago maydis. Proc Natl Acad Sci U S A . 95(10):5684-9. 51. Feldbrugge M, Kamper J, Steinberg G, Kahmann R. 2004. Regulation of mating and pathogenic development in Ustilago maydis. Curr Opin Microbiol. 7(6):666-72. 52. Finer JJ, Vain P, Jones MW, McMullen MD (1992) Development of the particle inflow gun for DNA delivery to plant cells. Plant Cell Rep 11:232-238 53. Fitzgibbon GJ, Morozov IY, Jones MG, Caddick MX. 2005. Genetic analysis of the TOR pathway in Aspergillus nidulans. Eukaryot Cell. 4(9): 1595-8. 54. Froeliger E, Leong SA. 1991. The a mating type alleles of Ustilago maydis are idiomorphs. Gene 100:113-22. 55. Fujita, A., Kikuchi, Y., Kuhara, S., Misumi, Y., Matsumoto, S., Kobayashi, H. 1989. Domains of the SFL1 protein of yeasts are homologous to Myc oncoproteins or yeast heat-shock transcription factor. Gene 85: 321-328 56. Garrido, C , S. Gurbuxani, L. Ravagnan, and G. Kroemer. 2001. Heat shock proteins: endogenous modulators of apoptotic cell death. Biochem. Biophys. Res. Commun. 286:433-442 57. Geourjon C, Orelle C, Steinfels E, Blanchet C, Deleage G, Di Pietro A, Jault JM. 2001. A common mechanism for ATP hydrolysis in ABC transporter and helicase superfamilies. Trends Biochem Sci. 26(9):539-44. 58. Giots, F., Donaton, M.C.V., and J.M. Thevelein. 2003. Inorganic phosphate is sensed by specific phosphate carriers and acts in concert with glucose as a nutrient signal for activation of the protein kinase A pathway in the yeast Saccharomyces cerevisiae. Mol. Microbiol. 47: 1163-1181. 59. Gilman AG. 1984. G proteins and dual control of adenylate cyclase. Cell 36:577-79 60. Gilman AG. 1987. G proteins: transducers of receptor-generated signals. Annu. Rev. Biochem. 56:615-49 61. Gimeno CJ, Ljungdahl PO, Styles CA and Fink GR. 1992. Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth regulation by starvation and RAS. Cell 68, pp. 1077-1090. 104 62. Gleason EJ, Lindsey WC, Kroft TL, Singson AW, L'hernault SW. 2006. spe-10 encodes a DHHC-CRD zinc-finger membrane protein required for endoplasmic reticulum/Golgi membrane morphogenesis during Caenorhabditis elegans spermatogenesis. Genetics. 172(1): 145-58. 63. Guillermond, A. (1920) The yeasts. John Wiley and Sons, New York. 64. Gold SE, Bakkeren G, Davies JE, Kronstad JW. 1994. Three selectable markers for transformation of Ustilago maydis. 142:225-230. 65. Gold SE, Duncan G, Barrett K, Kronstad J. 1994(b). cAMP regulates morphogenesis in the fungal pathogen Ustilago maydis. Genes Dev. 8:2805-16 66. Gold SE, Brogdon SM, Mayorga ME, Kronstad JW. 1997. The Ustilago maydis regulatory subunit of a cAMP-dependent protein kinase is required for gall formation in maize. Plant Cell. 9(9): 1585-94. 67. Garcia-Muse T, Steinberg G, Perez-Martin J: 2003. Pheromone induced G2 arrest in the phytopathogenic fungus Ustilago maydis. Eukaryot Cell 2:494-500. 68. Gavrias, V., A. Andrianopoulos, C. J. Gimeno, and W. W. Timberlake. 1996. Saccharomyces cerevisiae TEC1 is required for pseudohyphal growth. Mol. Microbiol. 19:1255-1263 69. Halachmi N . , Lev Z. 1996. The Seel family: a novel family of proteins involved in synaptic transmission and general secretion. J. Neurochem. 66 70. Hall TM. 2005. Multiple modes of RNA recognition by zinc finger proteins. Curr Opin Struct Biol. 2005 Jun;15(3):367-73. 71. Harashima T, Heitman J: 2002. The Ga protein Gpa2 controls yeast differentiation by interacting with kelch repeat proteins that mimic Gb subunits. Mol Cell 2002,10:163-173. 72. Harashima T, Heitman .). 2005. Galpha subunit Gpa2 recruits kelch repeat subunits that inhibit receptor-G protein coupling during cAMP-induced dimorphic transitions in Saccharomyces cerevisiae. Mol Biol Cell. 16(10):4557-71. 73. Hartmann HA, Kahmann R, Bolker M. 1996. The pheromone response factor coordinates filamentous growth and pathogenicity in Ustilago maydis. EMBO J. 15(7):1632-41. 74. Hartmann HA, Kruger J, Lottspeich F, Kahmann R. 1999. Environmental signals controlling sexual development of the corn Smut fungus Ustilago maydis through the transcriptional regulator Prfl. Plant Cell. 11(7): 1293-306. 105 75. Heitman, J., N. R. Mowa, and M. N. Hall. 1991. Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 253:905-909. 76. Hendriks EF, Robinson DR, Hinkins M and Matthews KR. 2001. A novel CCCH protein which modulates differentiation of Trypanosoma brucei to its procyclic form. EMBO J. 20:6700-6711. 77. Higuchi, R, C. Fockler, G. Dollinger, and R. Watson. 1993. Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology (NY) 11:1026-1030. 78. Heid, C.A., J. Stevens, K.J. Livak, and P.M. Williams. 1996. Real time quantitative PCR. Genome Res. (5:986-994. 79. Holden DW, Kronstad JW, Leong SA. 1989. Mutation in a heat-regulated hsp70 gene of Ustilago maydis. EMBO J. 8(7): 1927-34. 80. Holliday, R. 1961. The genetics of Ustilago maydis. Genet. Res. 2:204-230. 81. Holliday, R. 1974. Ustilago maydis, In Handbook of genetics. In R. C. King (ed.), Handbook of genetics, Vol. 1. Plenum, New York, N. Y. 82. Hornby, J. M., R. Dumitru, and K. W. Nickerson. 2004. High phosphate (up to 600 mM) induces pseudohyphal development in five wild type Candida albicans. J. Microbiol. Methods 56:119-124. 83. H u d s o n B P , Martinez-Yamout MA, Dyson HJ, Wright PE. 2004. Recognition of the mRNA AU-rich element by the zinc finger domain of TIS1 ld. Nat Struct Mol Biol. ll(3):257-64. 84. Iyer LM, Koonin EV, Aravind L. 2002. Extensive domain shuffling in transcription regulators of DNA viruses and implications for the origin of fungal APSES transcription factors. Genome Biol. 3(3): 0012. 85. Johnson BA, Geha M and Blackwell TK. 2000. Similar but distinct effects of the tristetrapolin/TISl 1 immediate-early proteins on cell survival. Oncogene. 19:1657-1664. 86. Joslyn CA, Mniszewski SM, Fulmer A, Heaton G. 2004. The gene ontology categorizer. Bioinformatics. 20 Suppl 1: II69-1177. 87. Kahmann R and Basse C. 1997. Signaling and development in pathogenic fungi - new strategies for plant protection? Trends in Plant Science 2, 366-368 88. Kahmann R, Basse C, Feldbrugge M. 1999. Fungal-plant signalling in the Ustilago maydis-maizQ pathosystem. Curr Opin Microbiol. 2(6):647-50. 106 89. Kannbley U, Kapinya K, Dirnagl U and Trendelenburg G. 2003. Improved Protocol for SAGE Tag-to-Gene Allocation. BioTechniques Vol. 34, No. 6: pp 1212-1219 90. Kanoh J, Sugimoto A, Yamamoto M. 1995. Schizosaccharomyces pombe zfsl+ encoding a zinc-finger protein functions in the mating pheromone recognition pathway. Mol Biol Cell. 6(9): 1185-95. 91. K a y s , A. M., and K. A. Borkovich. 2004. Signal transduction pathways mediated by heterotrimeric G proteins, p. 175-207. In R. Brambl and G. A. Marzluf (ed.), The mycota III. Springer-Verlag, Berlin, Germany. 92. Khan S, Situ G, Decker K, Schmidt CJ. 2003. GoFigure: Automated Gene Ontology(TM) annotation. Bioinformatics. 19: 2484-2485. 93. Klug,A. (1999) Zinc finger peptides for the regulation of gene expression. J. Mol. Biol., 293:215-218. 94. Klug A, Rhodes D. 1987. 'Zinc fingers': A novel protein motif for nucleic acid recognition. Trends Biochem. Sci. 12: (1987) 95. Klose J and Kronstad JW. 2006 (In press). The multifunctional P-oxidation enzyme is required for full symptom development by the biotrophic maize pathogen Ustilago maydis 96. Klose J, de Sa MM, Kronstad JW. 2004. Lipid-induced filamentous growth in Ustilago maydis. Mol Microbiol. 52(3):823-35. 97. Kobayashi, O., Suda, H., Ohtani, T., Sone, H. 1996. Molecular cloning and analysis of the dominant flocculation gene FL08 from Saccharomyces cerevisiae. Mol Gen Genet 251: 707-715 98. Kronstad JW, Staben C. 1997. Mating type in filamentous fungi. Annu Rev Genet. 31:245-76. 99. Kronstad J, De Maria AD, Funnell D, Laidlaw RD, Lee N, de Sa MM, Ramesh M. 1998. Signaling via cAMP in fungi: interconnections with mitogen-activated protein kinase pathways. Arch Microbiol. 170(6):395-404. 100. Kron, SJ. 1997. Filamentous growth in budding yeast. Trends Microbiol. 5:450-4. 101. Kriiger J, Loubradou G, Regenfelder E, Hartmann A, Kahmann R. 1998. Crosstalk between cAMP and pheromone signalling pathways in Ustilago maydis. Mol. Gen. Genet. 260:193-98 102. Kuan J . , Saier Jr M.H. 1993. Expansion of the mitochondrial carrier family. Res. Microbiol. 144: 671-2 107 103. Kuan J . , Saier Jr M.H. 1993-a. The mitochondrial carrier family of transport proteins: structural, functional, and evolutionary relationships. Crit. Rev. Biochem. Mol. Biol. 28: 209-33 104. Kiibler, E., H. U. Mosch, S. Rupp, and M. P. Lisanti. 1997. Gpa2p, a G-protein alpha-subunit, regulates growth and pseudohyphal development in Saccharomyces cerevisiae via a cAMP-dependent mechanism. J. Biol. Chem. 272:20321-20323 105. Laity JH, Lee BM, Wright PE. 2001. Zinc finger proteins: new insights into structural and functional diversity. Curr Opin Struct Biol. 1 l(l):39-46. 106. Lai WS, Carballo E, Strum JR, Kennington EA, Phillips RS, Blackshear PJ. 1999. Evidence that tristetraprolin binds to AU-rich elements and promotes the deadenylation and destabilization of tumor necrosis factor alpha mRNA. Mol Cell Biol. 19(6):4311-23. 107. Lai WS, Stumpo DJ and Blackshear PJ. 1990. Rapid insulin-stimulated accumulation of an mRNA encoding a proline-rich protein. J. Biol. Chem. 265, pp. 16556-16563. 108. Larraya LM, Boyce KJ, So A, Steen BR, Jones S, Marra M, Kronstad JW. 2005. Serial Analysis of Gene Expression Reveals Conserved Links between Protein Kinase A, Ribosome Biogenesis, and Phosphate Metabolism in Ustilago maydis. Eukaryot Cell. 4(12): 2029-2043. 109. Lee N, D'Souza CA, Kronstad JW. 2003. Of smuts, blasts, mildews, and blights: cAMP signaling in phytopathogenic fungi. Annu Rev Phytopathol. 41:399-427. 110. Lee N, Kronstad JW. 2002. ras2 controls morphogenesis, pheromone response and pathogenicity in the fungal pathogen Ustilago maydis. Eukaryot. Cell 1:954-66 111. Lengeler, K. B., R. C. Davidson, C. D'Souza, T. Harashima, W. C. Shen, P. Wang, X. Pan, M. Waugh, and J. Heitman. 2000. Signal transduction cascades regulating fungal development and virulence. Microbiol. Mol. Biol. Rev. 64:746-785. 112. Levitzki A, Bar-Sinai A. 1991. The regulation of adenylyl cyclase by receptor-operated G proteins. Pharmacol. Ther. 50:271-83 113. Limjindaponi T, Khalaf RA, F o n z i WA. 2003. Nitrogen metabolism and virulence of Candida albicans require the GATA-type transcriptional activator encoded by GAT1. Mol Microbiol. 50(3):993-1004. 108 114. Livak, K.J. and T.D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402-408. 115. Lobo S, Greentree WK, Linder ME, Deschenes RJ. 2002. Identification of a Ras palmitoyltransferase in Saccharomyces cerevisiae. J Biol Chem 277:41268-41273. 116. Liu, H., Styles, CA. and Fink, GR. 1996. Saccharomyces cerevisiae S288C has a mutation in Flo8, a gene required for filamentous growth. Genetics. 144: 967-78. 117. Lo, W.-S., and A. M. Dranginis. 1998. The cell surface flocculin FloII is required for pseudohyphae formation and invasion by Saccharomyces cerevisiae. Mol. Biol. Cell 9:161-171 118. Lorenz MC and Heitman J. 1997. Yeast pseudohyphal growth is regulated by GPA2, a G protein a homolog. EMBO J. 16:7008-7018. 119. Lorenz MC, Pan X, Harashima T, Cardenas ME, Xue Y, Hirsch JP, Heitman J. 2000. The G protein-coupled receptor gprl is a nutrient sensor that regulates pseudohyphal differentiation in Saccharomyces cerevisiae. Genetics. 154(2):609-22. 120. Lomax J, The Gene Ontology Consortium. 2005. Get ready to GO! A biologist's guide to the Gene Ontology. Brief Bioinform. 6: 298-304. 121. Ma Q and Herschman HR. 1991. A corrected sequence for the predicted protein from the mitogen-inducible TIS11 primary response gene. Oncogene 6; pp. 1277-1278. 122. Madhani, H. D., and G. R. Fink. 1997. Combinatorial control required for the specificity of yeast MAPK signaling. Science 275:1314-1317 123. Madhani HD, Fink GR. 1998. The riddle of MAP kinase signaling specificity. Trends Genet. 14(4):151-5. 124. Mannhalter, C , D. Koizar, and G. Mitterbauer. 2000. Evaluation of RNA isolation methods and reference genes for RT-PCR analyses of rare target RNA. Clin. Chem. Lab. Med. 35:171-177. 125. Marisa L. Wong and Juan F. Medrano. 2005. Real-time PCR for mRNA quantitation. BioTechniques Vol. 39, No. 1: pp 75-85 126. Martinez-Espinoza AD, Ruiz-Herrera J, Leon-Ramirez CG, Gold SE. 2004. MAP kinase and cAMP signaling pathways modulate the pH-induced yeast-to-109 mycelium dimorphic transition in the corn smut fungus Ustilago maydis. Curr Microbiol. 49(4):274-81. 127. Martin DE, Soulard A, Hall MN.2004. TOR regulates ribosomal protein gene expression via PKA and the Forkhead transcription factor FHL1. Cell. 2004 Dec 29; 119(7):969-79. 128. Marino, J.H., P. Cook, and K.S. Miller. 2003. Accurate and statistically verified quantification of relative mRNA abundances using SYBR Green I and real-time RT-PCR. J. Immunol. Methods 2^ 5:291-306. 129. Matthews JM, Sunde M. 2002. Zinc fingers—folds for many occasions. IUBMB Life. 54(6):351-5. 130. Mayorga ME, Gold SE. 1998. Characterization and molecular genetic complementation of mutants affecting dimorphism in the fungus Ustilago maydis. Fungal Genet Biol. 24(3):364-76. 131. Mayorga ME, Gold SE. 1999. A MAP kinase encoded by the ubc3 gene of Ustilago maydis is required for filamentous growth and full virulence. Mol Microbiol. 34(3):485-97. 132. Mayorga ME, Gold SE. 2001. The ubcl gene of Ustilago maydis encodes a putative novel adaptor protein required for filamentous growth, pheromone response and virulence. Mol. Microbiol. 41:1365—79 133. Mercado-Flores Y, Trejo-Aguilar A, Ramirez-Zavala B, Villa-Tanaca L, Hernandez-Rodriguez C. 2005. Purification and characterization of an intracellular aspartyl acid proteinase (pumAi) from Ustilago maydis. Can J Microbiol. 51(2):171-5. 134. Mosch, H.-U., and G. R. Fink. 1997. Dissection of filamentous growth by transposon mutagenesis in Saccharomyces cerevisiae. Genetics 145:671-684 135. Mosch, H.-U., R. L. Roberts, and G. R. Fink. 1996. Ras2 signals via the Cdc42/Ste20/mitogen-activated protein kinase module to induce filamentous growth in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 93:5352-5356 136. Mosch HU, Kubler E, Krappmann S, Fink GR, Braus GH. 1999. Crosstalk between the Ras2p-controlled mitogen-activated protein kinase and cAMP pathways during invasive growth of Saccharomyces cerevisiae. Mol Biol Cell. 10(5):1325-35. 137. Muller P, Aichinger C, Feldbrugge M, Kahmann R. 1999. The MAP kinase kpp2 regulates mating and pathogenic development in Ustilago maydis. Mol Microbiol. 1999 Dec;34(5):1007-17. 110 138. Murata T, Yoshino Y, Morita N, Kaneda N. 2002. Identification of nuclear import and export signals within the structure of the zinc finger protein TIS11. Biochem Biophys Res Commun. 293(4): 1242-7. 139. Pan, X., and J. Heitman. 1999. Cyclic AMP-dependent protein kinase regulates pseudohyphal differentiation in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:4874-4887 140. Pao SS, Paulsen IT and Saier Jr MH. 1998. Major facilitator superfamily. Microbiol. Mol. Biol. Rev. 62: 1-34 141. Parcellier, A., S. Gurbuxani, E. Schmitt, E. Solary, and C. Garrido. 2003. Heat shock proteins, cellular chaperones that modulate mitochondrial cell death pathways. Biochem. Biophys. Res. Commun. 304:505-512. 142. Park, C. M., Bruenn, J. A., Ganesa, C , Flurkey, W. F., Bozarth, R. F., and Koltin, Y. (1994) The Ustilago maydis virally encoded KP1 killer toxin. Mol Microbiol. 20(5):957-63. Mol. Microbiol. 11, 155-164 143. Patrick JW, Daniel RB and Jeremy T. 2004. When the stress of your environment makes you go HOG wild. Science. 144. Pedruzzi, I., F. Dubouloz, E. Cameroni, V. Wanke, J. Roosen, J. Winderickx, and C. De Virgilio. 2003. TOR and PKA signaling pathways converge on the protein kinase Riml5 to control entry into Go. Mol. Cell 12:1607-1613. 145. Proudfoot NJ, Furger A and Dye MJ. 2002. Integrating mRNA processing with transcription. Cell, 108, 501-512. 146. Puig S, Askeland E, Thiele DJ. 2005. Coordinated remodeling of cellular metabolism during iron deficiency through targeted mRNA degradation. Cell. 14;120(1):99-110. 147. Putilina T, Wong P, Gentleman S. 1999. The DHHC domain: a new highly conserved cysteine-rich motif. Mol Cell Biochem. 195:219-226. 148. Ramesh MA, Laidlaw RD, Durrenberger F, Orth AB, Kronstad JW. 2001. The cAMP signal transduction pathway mediates resistance to dicarboximide and aromatic hydrocarbon fungicides in Ustilago maydis. Fungal Genet Biol. 32(3): 183-93. 149. Rawlings N.D., Barrett A.J. 1994. Families of serine peptidases. Meth. Enzymol. 244:19-61 111 150. Regenfelder E, Spellig T, Hartmann A, Lauenstein S, Bolker M, Kahmann R. 1997. G proteins in Ustilago maydis: transmission of multiple signals? EMBOJ. 16:1934-42 151. Richard C. Barnard, John C. Pascall, Kenneth D. Brown, Ian A. McKay, Norman S. Williams, and Stephen A. Bustin. 1993. Coding sequence of ERF-1, the human homologue of Tisl lb/cMGl, members of the Tisl 1 family of early response genes Nucl. Acids Res. 21: 3580 152. Robertson, L. S., and G. R. Fink. 1998. The three yeast A kinases have specific signaling functions in pseudohyphal growth. Proc. Natl. Acad. Sci. USA 95:13783-13787 153. Romeis T, Kamper J, Kahmann R. 1997. Single-chain fusions of two unrelated homeodomain proteins trigger pathogenicity in Ustilago maydis. Proc Natl Acad Sci U S A. 94(4): 1230-1234. 154. Rupp, S., E. Summers, H. Lo, H. Madhani, and G. Fink. 1999. MAP kinase and cAMP filamentation signaling pathways converage on the unusually large promoter of the yeast FLOll gene. EMBO J. 18:1257-1269 155. Saito H, Tatebayashi K. 2004. Regulation of the osmoregulatory HOG MAPK cascade in yeast. J Biochem (Tokyo). 136(3):267-72. 156. Sambrook J, Fritsch EF and Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. 157. Sanchez-Martinez C, Perez-Martin J. 2001. Dimorphism in fungal pathogens: Candida albicans and Ustilago maydissimilav inputs, different outputs. Curr Opin Microbiol. (2):214-21. 158. Sanford JC, Smith FD, Russell JA (1993) Optimizing the biolistic process for different biological applications. Methods Enzymol 217:483-509 159. Scazzocchio C. 2000. The fungal GATA factors. Curr Opin Microbiol. 3(2): 126-31. 160. Schneper L, Duvel K, Broach JR. 2004. Sense and sensibility: nutritional response and signal integration in yeast. Curr Opin Microbiol. 2004 Dec;7(6):624-30. 161. Schmelzle, T., T. Beck, D. E. Martin, and M. N. Hall. 2004. Activation of the i RAS/cyclic AMP pathway suppresses a TOR deficiency in yeast. Mol. Cell. Biol. 24:338-351. 162. Schumann J, Hertweck C. 2006. Advances in cloning, functional analysis and heterologous expression of fungal polyketide synthase genes. J Biotechnol. May 19; [Epub ahead of print] 112 163. Shamji, A. F„ F. G. Kuruvilla, and S. L. Schreiber. 2000. Partitioning the transcriptional program induced by rapamycin among the effectors of the Tor proteins. Curr. Biol. 10:1574-1581. 164. Simon MI, Strathmann MP, Gautam N. 1991. Diversity of G proteins in signal transduction. Science 252:802-8 165. Smith TF, Gaitatzes C, Saxena K, Neer EJ. 1999. The WD repeat: a common architecture for diverse functions. Trends Biochem Sci. 24(5): 181-5. 166. Soanes, D.M., Talbot, N.J. (2006) Comparative genomic analysis of phytopathogenic fungi using expressed sequence tag (EST) collections. Molecular Plant Pathology 7:61 -70. 167. Soanes, D.M., Skinner, W., Keon, J., Hargreaves, J., Talbot, N.J. (2002) Genomics of phytopathogenic fungi and the development of bioinformatic resources. Molecular Plant-Microbe Interactions 15: 421-427 168. Snetselaar, K.M. and McCann, M.P. 1997 Using microdensitometry to correlate cell morphology with the nuclear cycle in Ustilago maydis. Mycologia, 89, 689-697. 169. Spain BH, Koo D, Ramakrishnan M, Dzudzor B, Colicelli J. 1995. Truncated forms of a novel yeast protein suppress the lethality of a G protein alpha subunit deficiency by interacting with the beta subunit. J Biol Chem 270:25435-25444. 170. Spellig T, Regenfelder E, Reichmann M, Schauwecker F, Bohlmann R, Urban M, Bolker M, Kamper J, Kahmann R. 1994. Control of mating and development in Ustilago maydis. Antonie Van Leeuwenhoek. 65(3): 191-7. 171. Stanley SM, Bailey TL, Mattick JS. 2006. GONOME: measuring correlations between gene ontology terms and genomic positions. BMC Bioinformatics. 7: 94. 172. Staunton J, Weissman KJ. 2001. Polyketide biosynthesis: a millennium review. Nat Prod Rep. 18(4):380-416. 173. Steen BR, Zuyderduyn S, Toffaletti DL, Marra M, Jones SJ, Perfect JR, Kronstad J. 2003. Cryptococcus neoformans gene expression during experimental cryptococcal meningitis. Eukaryot Cell. 2(6): 1336-49. 174. Steinberg G, Schliwa M, Lehmler C, Bolker M, Kahmann R, Mcintosh JR. 1998. Kinesin from the plant pathogenic fungus Ustilago maydis is involved in vacuole formation and cytoplasmic migration. J Cell Sci. I l l ( Pt 15):2235-46. 113 175. Stern, M. D., S. V. Anisimov, and K. R. Boheler. 2003. Can transcriptome size be estimated from SAGE catalogs? Bioinformatics 19:443-448. 176. Swartzman EE, Viswanathan MN, Thorner J. 1996. The PALI gene product is a peroxisomal ATP-binding cassette transporter in the yeast Saccharomyces cerevisiae. J Cell Biol. 1996 Feb;132(4):549-63. 177. Tacahashi Y, Helmling S, Moore CL. 2003. Functional dissection of the zinc finger and flanking domains of the Ythl cleavage/polyadenylation factor. Nucleic Acids Res. 31(6): 1744-52. 178. Thevelein JM. 1994. Signal transduction in yeast. Yeast 10:1753-1790. 179. Thines E, Weber RW, Talbot NJ. 2000. MAP kinase and protein kinase A-dependent mobilization of triacylglycerol and glycogen during appressorium turgor generation by Magnaporthe grisea. Plant Cell. 12(9): 1703-18. 180. Thompson MJ, Lai WS, Taylor GA, Blackshear PJ. 1996. Cloning and characterization of two yeast genes encoding members of the CCCH class of zinc finger proteins: zinc finger-mediated impairment of cell growth. Gene. 1996 Oct 3;174(2):225-33. 181. Urban M, Kahmann R, Bolker M. 1996. Identification of the pheromone response element in Ustilago maydis. Mol Gen Genet. 24;251(l):31-7. 182. Vandesompele, J., A. De Paepe, and F. Speleman. 2002. Elimination of primer-dimer artifacts and genomic coamplification using a two-step SYBR green I real-time RT-PCR. Anal. Biochem. 303:95-98. 183. Varnum BC, Ma QF, Chi TH, Fletcher B and Herschman HR. 1991. The TIS11 primary response gene is a member of a gene family that encodes proteins with a highly conserved sequence containing an unusual Cys-His repeat. Mol. Cell. Biol. 11 (1991), pp. 1754-1758. 184. Velculescu, V. E., Zhang, L., Vogelstein, B., and Kinzler, K. W. (1995). Serial Analysis Of Gene Expression. Science 270, 484-487. 185. Velculescu, V. E., Zhang, L., Zhou, W., Vogelstein, J., Basrai, M. A., Bassett, D. E., Hieter, P., Vogelstein, B., and Kinzler, K. W. (1997). Characterization of the yeast transcriptome. Cell 88.243-251 186. Voisard C . , Wang J . , McEvoy J.L., Xu P., Leong S.A. 1993. urbsl, a gene regulating siderophore biosynthesis in Ustilago maydis, encodes a protein similar to the erythroid transcription factor GATA-1. Mol. Cell. Biol. 13: 7091-100 114 187. Wang J, Holden DW, Leong SA 1998. Gene transfer system for the phytopathogenic fungus Ustilago maydis. Proc Natl Acad Sci USA 85:865-869. 188. Wang, A.M., M.V. Doyle and D.F. Mark. 1989. Quantitation of mRNA by the polymerase chain reaction [published erratum appears in Proc. Natl. Acad. Sci. USA 1990. 57:2865]. Proc. Natl. Acad. Sci. USA 56:9717-9721. 189. Waugh MS, Nichols CB, DeCesare CM, Cox GM, Heitman J, Alspaugh JA. 2002. Rasl and Ras2 contribute shared and unique roles in physiology and virulence of Cryptococcus neoformans. Microbiology. 148(Pt 1): 191-201. 190. Whyte J.R., Munro S. 2001. The Sec34/35 Golgi transport complex is related to the exocyst, defining a family of complexes involved in multiple steps of membrane traffic. Dev. Cell 1: 527-537 191. Wickes BL, Mayorga ME, Edman U, Edman JC. 1996. Dimorphism and haploid fruiting in Cryptococcus neoformans: association with the alpha-mating type. Proc Natl Acad Sci U S A . 93(14):7327-31. 192. Willard M. Freeman, Stephen J. Walker and Kent E. Vrana. 1999. Quantitative RT-PCR: Pitfalls and Potential. BioTechniques Vol. 26, No. 1: pp 112-125 193. Williams RE, Bruce NC. 2002. "New uses for an Old Enzyme'-the Old Yellow Enzyme family of flavoenzymes. Microbiology. 148(Pt 6): 1607-14. 194. Wise, R. J., Barr, P. J., Wong, P. A., Kiefer, M. C , Brake, A. J., and Kaufman, R. J. (1990). Expression of a Human Proprotein Processing Enzyme: Correct Cleavage of the von Willebrand Factor Precursor at a Paired Basic Amino Acid Site Proc. Natl. Acad. Sci. U. S. A. 87, 9378-9382 195. Wood V, Gwilliam R, Rajandream MA, Lyne M, Lyne R, Stewart A, Sgouros J, Peat N, Hayles J, Baker S, Basham D, Bowman S, Brooks K, Brown D, Brown S, Chillingworth T, Churcher C, Collins M, Connor R, Cronin A, Davis P, Feltwell T, Fraser A, Gentles S, Goble A, Hamlin N, Harris D, Hidalgo J, Hodgson G, Holroyd S, Hornsby T, Howarth S, Huckle EJ, Hunt S, Jagels K, James K, Jones L, Jones M, Leather S, McDonald S, McLean J, Mooney P, Moule S, Mungall K, Murphy L, Niblett D, Odell C, Oliver K, O'Neil S, Pearson D, Quail MA, Rabbinowitsch E, Rutherford K, Rutter S, Saunders D, Seeger K, Sharp S, Skelton J, Simmonds M, Squares R, Squares S, Stevens K, Taylor K, Taylor RG, Tivey A, Walsh S, Warren T, Whitehead S, Woodward J, Volckaert G, Aert R, Robben J, Grymonprez B, Weltjens I, Vanstreels E, Rieger M, Schafer M, Muller-Auer S, Gabel C, Fuchs M, Dusterhoft A, Fritzc C, Holzer E, Moestl D, Hilbert H, Borzym K, Langer I, Beck A, Lehrach H, Reinhardt R, Po'hl TM, Eger P, Zimmermann W, Wedler H, Wambutt R, Purnelle B, Goffeau A, Cadieu E, Dreano S, Gloux S, Lelaure V, Mottier 115 S, Galibert F, Aves SJ, Xiang Z, Hunt C, Moore K, Hurst SM, Lucas M, Rochet M, Gaillardin C, Tallada VA, Garzon A, Thode G, Daga RR, Cruzado L, Jimenez J, Sanchez M, del Rey F, Benito J, Dominguez A, Revuelta JL, Moreno S, Armstrong J, Forsburg SL, Cerutti L, Lowe T, McCombie WR, Paulsen I, Potashkin J, Shpakovski GV, Ussery D, Barrell BG, Nurse P. 2002. The genome sequence of Schizosaccharomyces pombe. Nature. 415(6874):8,71-80. 196. Xue, Y., M. Batlle, and J. P. Hirsch. 1998. GPR1 encodes a putative G protein-coupled receptor that associates with the Gpa2p Ga subunit and functions in a Ras-independent pathway. EMBO J. 17:1996-2007 197. Yu JH, Hamari Z, Han KH, Seo JA, Reyes-Dominguez Y, Scazzocchio C. 2004. Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet Biol. 41(11):973-81. 198. Zaragoza, D., A. Ghavidel, J. Heitman, and M. C. Schultz. 1998. Rapamycin induces the Go program of transcriptional repression in yeast by interfering with the TOR signaling pathway. Mol. Cell. Biol. 18:4463-4470. 199. Zhang S, Lockshin C, Herbert A, Winter E, Rich A. 1992. Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae. EMBO J. 11(10):3787-96. 200. Zurita-Martinez, S. A., and M. E. Cardenas. 2005. Tor and cyclic AMP-protein kinase A: two parallel pathways regulating expression of genes required for cell growth. Eukaryot. Cell 4:63-71. 116 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100639/manifest

Comment

Related Items