Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The effects of dietary molybdenum and sulfur on serum copper concentrations, growth and reproductive… Robinson, Julie A. 1991

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1991_A1 R62.pdf [ 11.79MB ]
Metadata
JSON: 831-1.0100628.json
JSON-LD: 831-1.0100628-ld.json
RDF/XML (Pretty): 831-1.0100628-rdf.xml
RDF/JSON: 831-1.0100628-rdf.json
Turtle: 831-1.0100628-turtle.txt
N-Triples: 831-1.0100628-rdf-ntriples.txt
Original Record: 831-1.0100628-source.json
Full Text
831-1.0100628-fulltext.txt
Citation
831-1.0100628.ris

Full Text

CHARACTERIZATION OF A RAS AND A RAS-RELATED GENE AND THEIR DEVELOPMENTAL EXPRESSION IN THE CELLULAR SLIME MOULD DICTYOSTELIUM DISCOIDEUM By STEPHEN MARK ROBBINS B.Sc. (Hons), York University, 1985  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY  in THE FACULTY OF GRADUATE STUDIES (Department of Microbiology)  We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA JANUARY 1991 © Stephen Mark Robbins, 1991  In presenting this  thesis  degree at the University  in partial  fulfilment  of British Columbia,  of the requirements  for an advanced  I agree that the Library shall make it  freely available for reference and study. I further agree that permission for extensive copying  of this thesis for scholarly  department  or by his or  purposes may be granted by the head of my  her representatives.  It  is  understood  that  publication of this thesis for financial gain shall not be allowed without permission.  Department of  MICROBIOLOGY  The University of British Columbia Vancouver, Canada D  a t e  DE-6 (2/88)  MARCH  6, 19 91  copying or my written  ABSTRACT  Although it was previously reported that Dictyostelium discoideum possessed a single ras gene (Ddras) that was maximally expressed during the pseudoplasmodial stage of development, a second ras gene (DdrasG), has been isolated and characterized. It encodes a protein that is similar to the protein encoded by Ddras and the human ras proteins. However, in contrast to Ddras, the DdrasG gene was only expressed during growth and early development. The two ras proteins may fulfill different functions: the DdrasG protein having a role during cell growth and the Ddras protein having a role in signal transduction during multicellular development. However, the expression of the DdrasG gene throughout development did not appear to have a detrimental effect on differentiation. Although other eukaryotic organisms possess more than one ras gene, D. discoideum is thus far unique in expressing different ras genes at different stages of development.  Ras genes are members of a largeras-relatedmultigene family that has been found in a wide variety of organisms. Aras-relatedgene was isolated from D.  discoideum that hybridized to both the Ddras and DdrasG genes under low, but not under high stringency conditions. The predicted amino acid sequence shows a high degree of sequence identity with the human rap proteins and thus has been designated Ddrapl. During vegetative and early development a single 1.1 kb mRNA was present, but by aggregation this transcript was no longer detected and two new transcripts of 1.0 and 1.3 kb were observed and were present throughout the remainder of development. The maximum levels of the Ddrapl specific mRNAs appeared during aggregation and culmination, developmental stages where the levels of DdrasG and Ddras messages were declining. The reciprocal nature of the Ddrapl gene expression with respect to that of the two ras genes ii  suggests the possibility that the  ras  and  rap  gene products in  D. discoideum  antagonistic roles. Antibodies that are specific for the Ddras, DdrasG and D d r a p l proteins have been generated and can be used to help elucidate the biological functions of the individual proteins.  iii  have  TABLE OF CONTENTS Pages ii iv ix x xiii xv xvi  Abstract Table of Contents List of Tables List of Figures List of Abbreviations Acknowledgements Dedication CHAPTER 1 1.0 GENERAL INTRODUCTION 1.1 Oncogenes 1.2 Ras genes 1.2.1 Ras genes and cancer 1.2.2 Primary structure and evolutionary conservation of the ras genes 1.2.3 Structural and biochemical properties of the ras proteins 1.2.4 Molecular model for ras protein activation 1.3 Physiological function of the ras proteins in yeast 1.4 Physological function of the ras proteins in higher eukaryotes 1.4.1 The involvement of ras proteins in cellular proliferation and differentiation 1.4.2 Ras proteins and signal transduction 1.5 Ras gene superfamily  1.6 Dictyostelium discoideum  1.6.1 Life Cycle 1.6.2 Signal transduction in D. discoideum  1.6.3 Control of gene expression in D. discoideum 1.6.4 Ras-related genes in D. discoideum  iv  1 1 1 2 2 3 4 9 10 11 11 12 17  20 20 22 26 29  CHAPTER 2 2.0 MATERIALS AND METHODS 2.1 Materials 2.2 Growth and development of D. discoideum 2.2.1 Growth 2.2.2 Synchronous growth 2.2.3 Development 2.2.4 Separation of prestalk and prespore cells 2.2.5 Differentiation in shake suspension 2.3 Isolation of nucleic acids from D. discoideum 2.3.1 DNA 2.3.2 RNA 2.4 Isolation of cDNA and genomic DNA clones 2.4.1 Isolation of the DdrasG cDNAs 2.4.2 Isolation of the Ddrapl cDNAs  2.5  2.6 2.7  2.8 2.9  2.10 2.11  2.4.3 Isolation of DdrasG genomic clone Sequence determination of DNA and RNA 2.5.1 DNA sequencing 2.5.2 RNA sequencing Primer extension analysis Southern and Northern blot analyses 2.7.1 Southern blots 2.7.2 Northern blots In vitro translation and immunoprecipitation Preparation of antisera with predetermined specificity to variable regions of the Ddras, DdrasG and Ddrapl proteins Preparation of antisera directed to Ddras, DdrasG and Ddrapl glutathione S-transferase fusion proteins Immunoblot analysis of the Ddras, DdrasG and Ddrapl specific antisera  v  pages 31 31 31 31 31 32 32 33 33 34 34 34 35 35 36 37 38 38 39 40 41 41 41 42  43 45 46  CHAPTER 3 3.0 EVIDENCE FOR ADDITIONAL RAS-RELATED GENES  IN D. DISCOIDEUM  pages 49  49  3.1 Introduction 3.2 Results 3.2.1 In vitro translation of D. discoideum mRNA from various stages of development 3.2.2 Analysis of ras mRNA using the Ddras cDNA under conditions of high and low stringency 3.2.3 Analysis of genomic DNA using Ddras-cl under conditions of low stringency 3.3 Discussion  CHAPTER 4 4.0 ISOLATION AND CHARACTERIZATION OF A SECOND RAS  49 50 50 50 52 55 57  GENE FROM D. DISCOIDEUM 4.1 Introduction 4.2 Results 4.2.1 Isolation ofras-relatedcDNAs 4.2.2 Sequence analysis of the c3, c l l , and c23 cDNA clones 4.2.3 Southern blot analysis of the DdrasG gene 4.2.4 Developmental expression of DdrasG 4.2.5 Cell cycle expression of DdrasG 4.3 Discussion  57 57 57 57  CHAPTER 5 5.0 ISOLATION AND CHARACTERIZATION OF THE GENOMIC SEQUENCES CORRESPONDING TO THE DdrasG GENE 5.1 Introduction 5.2 Results 5.2.1 Isolation and sequencing of the DdrasG genomic sequences 5.2.2 Determination of the 5' end of the DdrasG mRNA 5.3 Discussion  79  vi  60 67 69 71 74  79 79 80 80 83 89  pages  CHAPTER 6 6.0 ABERRANT EXPRESSION OF THE DdrasG GENE IN THE AXENIC STRAIN, AX-2 6.1 Introduction 6.2 Results 6.2.1 Expression of DdrasG in different D. discoideum strains 6.2.2 The effects of cAMP on DdrasG expression in Ax-2 6.3 Discussion  92 92  93 96 98  CHAPTER 7 7.0 ISOLATION AND CHARACTERIZATION OF A MEMBER OF THE RAS GENE SUPERFAMILY, Ddrapl, FROM D. DISCOIDEUM 100 7.1 Introduction 100 7.2 Results 7.2.1 Isolation of cDNA clones related to the ras gene super family 7.2.2 Sequence analysis of the ras-related cDNA clones 7.2.3 Developmental expression of the Ddrapl gene 7.2.4 Control of Ddrapl expression 7.3 Discussion CHAPTER 8 8.0 DETECTION OF THE Ddras, DdrasG AND Ddrapl ENCODED PRODUCTS 8.1 Introduction 8.2 Results 8.2.1 Preparation of antisera which recognize peptides corresponding to the Ddras, DdrasG and Ddrapl variable regions 8.2.2 Preparation of antisera to the Ddras, DdrasG and Ddrapl recombinant proteins 8.3 Discussion  vii  100 100 102 106 110 112  117 117 118  118 121 126  CHAPTER 9 9.0 GENERAL DISCUSSION 9.1 Correlation between ras protein levels and ras gene expression during D. discoideum development 9.2 Cell-type specific expression of the Ddras gene 9.3 Evolutionary conservation of the ras and rap proteins 9.4 Ras and ras-related gene function in D. discoideum REFERENCES  pages 129 129 130 132 134 139  viii  LIST OF TABLES pages Table 1.  The ras protein superfamily  Table 2.  Percentage of amino acid conservation within the ras and rap protein families  ix  18  133  LIST OF FIGURES pages Figure 1. Figure 2. Figure 3. Figure 4. Figure 5.  Schematic representation of the strucural and functional domains defined within the ras proteins. A proposed model for the role of the mammalian ras proteins in signal transduction.  13  The life cycle of the cellular slime mould  Dicytostelium discoideum.  21  Model of cAMP-mediated signal transduction pathways D. discoideum cells.  23  In vitro translation of mRNA isolated from D. discoideum V12-M2 cells at various stages of development  Figure 6.  6  51  Northern blot analysis of Ddras mRNA expression during D. discoideum development.  53  Figure 7.  Southern blot analysis with the Ddras cDNA.  Figure 8.  Cross-hybridization between the c3, cll and c23 cDNA  Figure 9.  clones and the Ddras-cl cDNA Sequencing strategy for DdrasG using three independent cDNA clones, DdrasG-c3, DdrasG-cll and DdrasG-c23.  61  Nucleotide sequence of the DdrasG coding region and comparison with that of the one previously published for Ddras.  63  Comparison of the derived amino acid sequence of the DdrasG protein with the sequence of the other D. discoideum ras protein (Ddras), the three human ras proteins (Ki-ras2, Ha-rasl and N-ras), a Drosophila ras protein (Dras), and the yeast RAS proteins (Yerasl and Yeras2).  65  Figure 10.  Figure 11.  Figure 12.  Southern blot analysis of the D. discoideum ras genes.  Figure 13.  Northern blot analysis of Ddras and DdrasG gene expression during D. discoideum growth and development  x  54 59  68  70  pages  Figure 14.  The expression of DdrasG and the ras-related gene, Ddrapl during synchronous cell growth  Figure 15.  Partial restriction map and sequencing strategy for the DdrasG genomic clone, DdrasG-g5.2.  81  Nucleotide sequence of the DdrasG genomic clone including 5' and 3' flanking sequences  84  Determination of the DdrasG transcription initiation sites by primer extension analysis.  87  Figure 16. Figure 17. Figure 18. Figure 19. Figure 20. Figure 21. Figure 22. Figure 23.  Figure 24. Figure 25.  The expression of DdrasG mRNA during the development of the D. discoideum strains NC4 and Ax-2.  94  The expression of DdrasG, M4-1, D19 and Ddras mRNAs during development of strain Ax-2.  95  The effect of cAMP pulses on the expression of DdrasG in shake suspension cultures of Ax-2.  97  Southern blot analysis of the D. discoideum  Ddrapl gene.  101  Nucleotide and derived amino acid sequences of the Ddrapl gene.  103  Comparison of the derived amino acid sequence of theD. discoideum rap protein (Ddrapl) with the predicted sequences of the Ddras, DdrasG and human raplA proteins.  104  Expression of DdrasG, Ddras and Ddrapl during D. discoideum development  107  Developmental expression of Ddrapl during the development of D. discoideum strain, V12-M2.  108  Figure 26.  Expression of Ddrapl in prestalk and prespore cells.  Figure 27.  The effect of cAMP on the expression of Ddrapl in shake suspension cultures of strain V12-M2.  Figure 28.  72  Schematic structures of the Ddras, DdrasG and Ddrapl sequences expressed as GST fusion proteins in E. coli. xi  109  Ill  119  Figure 29.  Figure 30.  Figure 31.  Immunoblot analysis with the antisera generated to peptides corresponding to the variable regions of the Ddras, DdrasG and Ddrapl proteins.  pages 122  Immunoblot analysis with the antisera generated to the Ddras, DdrasG and Ddrapl bacterial recombinant proteins.  124  Heterogeneity of prestalk cells in the pseudoplasmodium.  131  xii  LIST O F A B B R E V I A T I O N S A  absorbance, optical density  ATP  adenosine 5'-triphosphate  bp  base pairs  cAMP  adenosine 3 ' , 5' -monophosphate  cDNA  complementary deoxyribonucleic acid  C-terminal  carboxy-terminal region of a protein  DEAE  diethylaminoethyl  dNTP  deoxyribonucleotide triphosphates (dATP, d T T P , d G T P , dCTP)  DNA  deoxyribonucleic acid  EDTA  disodium ethylene diaminetetraacetic acid  IPTG  isopropyl-f3-D-thiogalactopyranoside  kb  kilobases  kd  kilodaltons  (iCi  micro-Curies  (ig  micrograms  ul  microliters  mM  millimolar  M  molar  mRNA  messenger ribonucleic acid  M  apparent molecular weight  r  Pipes  piperazine-N, N' -bis(2-ethanesulfonic acid)  RNA  ribonucleic acid  xiii  SDS  sodium dodecyl sulfate  Tris  tri(hydroxymethyl)aminomethane  vol  volume  wt/vol  weight by volume  xiv  ACKNOWLEDGEMENTS I am grateful to a great many people for making my studies at U.B.C. so enjoyable and exciting. Specifically I would like to express my sincerest appreciation to my supervisor Dr. Gerry Weeks who has consistently provided invaluable advice, support, guidance and friendship throughout the duration of this thesis. He has provided an ideal situation for me to learn and grow as a scientist. I would also like to express my gratitude to the members of my supervisory committee, Drs. George Spiegelman, Frank Tufaro and Rob McMaster for their advice and constructive criticisms. I would like to thank all members of the Weeks' lab for their support and informative discussions. Special thanks go to Linda Kwong and Meenal Khosla for the enjoyable collaborations. Finally, I would like to express my deepest appreciation to my wife Carolyn for her patience, understanding, love, and encouragement throughout this entire thesis.  xv  T would, like- to dedicate  tfiis thesis to m y w i f e  C a r o l y n , a n d to m y parents  their  constant  Pat  and  Stuart, for  love, s u p p o r t cmcC e n c o u r a g e m e n t .  xvi  1  CHAPTER 1  1.0 GENERAL INTRODUCTION  1.1 Oncogenes  Oncogenic retroviruses are in the family of viruses that contain an RNA genome and an RNA-dependent DNA polymerase. Almost all oncogenic retroviruses fall into two classes with regard to their efficiency and ability to transform cells. One group, the acutely oncogenic retroviruses contains a viral oncogene which is responsible for the rapid induction of tumours in animals and the efficient transformation of cells in culture. The other subclass does not contain a viral oncogene, lacks the ability to transform cells in vitro, but can cause tumourgenesis after a long latent period that appears to require a multistep process (for review see; Varmus, 1988). The study of oncogenic retroviruses was enormously enhanced when it was discovered that viral oncogenes arose by the transduction of genetic loci from genomes of vertebrate cells (for review see; Bishop, 1983; Varmus, 1984; Bishop, 1987). Viral oncogenes exhibit a high degree of sequence conservation with their cellular counterparts, referred to as proto-oncogenes, but often contain mutations which at least in part are responsible for their oncogenic potential. The cellular proto-oncogenes are sometimes targets for somatic mutations or aberrant expression which can lead to malignancy. Although the intrinsic biochemical properties of most oncogenes have been identified, their physiological functions and the metabolic pathways which they influence remain largely unknown. The same is true for the functions of the protooncogenes although evidence supports the general premise that they are  2 important regulators of normal cell growth and development (for review see; Bishop, 1987). Oncogenes can be categorized into at least six classes based on the proteins that they encode: growth factors (e.g., sis), growth factor receptors (e.g., neu,  erbA,fms, kit, and mas), tyrosine protein kinases (e.g.,src, fps and abl), cytoplasmic serine and/or threonine kinases (e.g., mos and raf), guanosine triphosphate binding proteins (e.g., ras) and nuclear transcription factors (e.g.,  myc, myb, fos and jun). The proteins encoded by the oncogenes have a diverse range of biochemical functions that appear to be associated with signal transduction events that originate from the cell surface and end at the level of gene expression (for review see; Varmus, 1984; Bishop, 1987; Storms and Bose, 1989). 1.2 Ras genes 1.2.1 Ras genes and cancer Of the 40 or so cellular oncogenes that have been described to date the ras genes have attracted considerable attention because of their strong association with carcinogenesis. In keeping with current nomenclature the gene will be referred to as ras and the gene product as ras, except when describing  Saccharomyces cerevisiae which will be designated by the normal yeast capital letter nomenclature (RAS for the gene and RAS for the gene product). The ras genes were first described as the transforming genes of the Harvey and Kirsten murine sarcoma viruses. Both viruses cause a wide range of tumours including carcinomas, sarcomas and leukemias. The two viral oncogenes were generated by the transduction of two highly related cellular genes, now referred to as the Harvey (H-ras) or Kirsten (K-ras) genes (Ellis, et al, 1980; Andersen, et al, 1981).  3  In addition human cells contain a third ras gene (N-ras) for which there is no known viral counterpart (Hall, et ah, 1983; Shimizu, et ah, 1983; Taparowsky, et  ah, 1983). Overall about 30% of all human tumours thus far analyzed at the molecular level contain a mutated ras proto-oncogene that is capable of neoplastic transformation of NIH3T3 cells upon gene transfer (Barbacid, 1987). Mutated ras genes can be found in a variety of tumours with the highest incidences found in myeloid leukemia, thyroid tumours and in adenocarcinomas of the pancreas, colon and lung (Bos, 1989). In addition, the tumours from carcinogen treated animals often contain mutated ras genes (Barbacid, 1987). The direct involvement of ras genes in neoplasia has recently been demonstrated in transgenic mice bearing a mutated ras gene (Andres, et ah, 1987; Quaife, et ah, 1987). The transgenic mice developed tumours that were dependent on the spatial and temporal specificity of the specific promoters used to regulate the expression of the mutated ras gene, indicating that ras genes have a major role during the early stages of tumour formation.  1.2.2 Primary structure and evolutionary conservation of the ras genes In addition to the three active ras genes, H-ras-1, K-ras-2 and N-ras (Chang, et  ah, 1982b; Hall, et ah, 1983; McGrath, et ah, 1983; Shimizu, et ah, 1983; Taparowsky, et ah, 1983), two related pseudogenes, H-ras-2 and K-ros-1 have been identified in the human genome (Chang, et ah, 1982b; McGrath, et ah, 1983). The H-ras-1 and N-ras genes encode 189 amino acid proteins, while the K-ras-2 gene either encodes 189 or 188 amino acid proteins depending on the alternative use of two fourth exons (Capon, et ah, 1983; McGrath, et ah, 1983). The three different human ras genes encode proteins of 21,000 M (p21) and are r  approximately 85% conserved at the amino acid level (Barbacid, 1987).  4 The ras genes have been highly conserved throughout eukaryotic evolution. In addition to humans, ras genes have been identified in many other vertebrates including rat, dog, horse, chicken and goldfish (Nemoto, et al, 1986; Barbacid, 1987). Highly related sequences have also been found in a number of invertebrate species including Drosophila melanogaster (Neuman-Silberberg, et  al, 1984; Mozer, et al, 1985; Brock, 1987), the mollusk Aplysia (Swanson, et al, 1986), in both the budding yeast Saccharomyces cerevisiae (Defeo-Jones, et al, 1983; Powers, et al, 1984) and the fission yeast Schizosaccharomyces pombe (Fukui and Kaziro, 1985) and the cellular slime mould Dictyostelium  discoideum (Reymond, et al, 1984). Most of the ras genes encode proteins of similar size to the 21 kd (p21) mammalian ras proteins with the exception of the  RAS1 and RAS2 yeast genes, which encode proteins of 40 kd and 41 kd respectively. This widespread phylogenetic conservation of the ras genes suggests that they perform some general cellular function essential to all eukaryotes. 1.2.3 Structural and biochemical properties of the ras proteins The ras genes encode biochemically and structurally similar proteins that bind guanine nucleotides (Shih, et al, 1980), exhibit an intrinsic GTPase activity (Gibbs, et al, 1984; McGrath, et al, 1984; Sweet, et al, 1984) and are associated with the inner surface of the plasma membrane (Willingham, et al, 1980; Shih,  et al, 1982). These biochemical properties closely resemble those of the G proteins that are involved in mediation of signal transduction in a variety of systems (Gilman, 1987), and thus by analogy it has been postulated that the ras proteins regulate a signal transduction pathway (Hurley, et al, 1984). Comparison of the amino acid structure of the ras proteins with other GTP binding proteins such as bacterial elongation factor, transducin and the a-  5  subunit of G proteins demonstrated that they contain three consensus sequence elements with distinct spacings between them (Dever, et al, 1987). These common domains were considered to confer the ability of the proteins to bind guanine nucleotides. In addition to the three consensus sequence elements the ras proteins contain a fourth domain that is also required for nucleotide binding. The importance of the four domains (amino acids 10-16, 57-62, 116-119 and 143-147) in guanine nucleotide binding in the mammalian ras proteins has been demonstrated by both random and site-directed mutagenesis (Feig, et al, 1986; Willumsen, et al, 1986; Clanton, et al, 1987; Feig, et al, 1987) (Figure 1). From the muational analyses it was established that amino acids 10-16 and 57-62 influence the binding and hydrolysis of GTP, whereas mutations in amino acids 116-119 only resulted in reduced binding affinities. X-ray crystallography has suggested that the fourth domain (amino acids 143-147), unique for the ras family of proteins is involved in the formation of the nucleotide binding pocket (McCormick, et al, 1985; de Vos, et al, 1988). The oncogenic ras proteins require correct plasma membrane localization for transformation activity (Willumsen, et al, 1984a; Lacal, et al, 1988; Buss, et al, 1989; Schafer, et al, 1989; Mendola and Backer, 1990). For localization to the plasma membrane, the ras proteins undergo a series of complex posttranslational modifications that require the conserved CAAX motif (C= cysteine, A= any aliphatic amino acid, X= any amino acid) located at the C-terminus of all ras proteins (Figure 1). The first series of modifications require the addition of a polyisoprenoid, probably a 15 carbon farnesyl moiety to the cysteine residue, the removal of the terminal three amino acids by proteolysis and methyl esterfication of the new C-terminal cysteine (Casey, et al, 1989; Gutierrez, et al, 1989; Hancock, et al, 1989). These modifications are not sufficient for plasma  6 Figure 1. Schematic representation of the structural and functional domains defined within the ras proteins. The numbers indicate the amino acid residues defining the boundaries of the domains represented. See text for details.  1° GTP/GDP binding  10  16  57  m  62  B  116 119  143  147  Effector domain 32 Y13-259 antibody binding site  40  W  63  73  •  Membrane attachment  186  189  Variable regions 122  132  167  185  —]  8 membrane localization since other proteins such as the lamins contain the CAAX motif, undergo similar modifications but are localized to the nucleus within the cell (Holtz, et al, 1989). Although the farnesyl moiety increases the hydrophobicity of the ras proteins a further signal is required for targeting to the plasma membrane. The N-ras and H-ras proteins require the addition of palmitic acid at a cysteine residue near the C-terminus (Hancock, et al, 1989), whereas a region rich in basic amino acids provides the additional signal for the K-ras protein (Hancock, et al, 1990). Mutant ras proteins lacking the cysteine residue at amino acid 186 are not localized to the plasma membrane suggesting that all processing is dependent on the initial isoprenylation step (Willumsen,  et al, 1984b). There are two other regions that are highly conserved amongst the ras proteins of phylogenetically diverse organisms (Figure 1). The region encompassing amino acids 63-73 forms the recognition sequence for the rasspecific monoclonal antibody, Y13-259, which is a diagnostic probe for the ras proteins (Furth, et al, 1982; Sigal, et al, 1986). In addition structure/function studies have identified amino acid 32-40 as being critical for biological activity (Sigal, et al, 1986; Willumsen, et al, 1986; Stone, et al, 1988). Mutations of the nucleotides encoding this region disrupt biological activity of the proteins but do not affect the membrane localization or binding of guanine nucleotides. This region often referred to as the effector region, may interact with putative effector molecule(s). Recently a GTPase activating protein (GAP) has been identified which may represent a potential effector target for the ras proteins (Trahey and McCormick, 1987; Gibbs, et al, 1988; Trahey, et al, 1988). The GAP molecule stimulates the GTPase activity of the ras proteins by more than 100 fold (Trahey and McCormick, 1987; Gibbs, et al, 1988). Mutations in the effector region that inhibit the biological activity of the ras proteins were found to not  respond to GAP stimulation of the intrinsic GTPase activity, suggesting that the interaction between GAP and the ras proteins is within the effector region of the ras proteins (Adari, et al, 1988; Cales, et al, 1988; McCormick, 1989). In addition antibodies that recognize the effector region of the ras proteins block the interaction with GAP (Rey, et al, 1989). 1.2.4. Molecular model for ras protein activation Oncogenic ras proteins are often described as activated ras proteins because of their ability to transform cells. The biological activation of the ras proteins can occur by at least two mechanisms which are both consistent with the G-protein hypothesis of ras function. Point mutations at codons 12,13, 59 or 61 of the ras protein result in an activated protein that can transform a variety of cell types (Barbacid, 1987; Bos, 1989). These mutations block the ability of GAP to stimulate the GTPase activity of the activated ras protein resulting in a protein that is in a constitutively active GTP-bound state (Trahey and McCormick, 1987; Vogel, et al, 1988). The increased expression of a normal ras gene can also produce the transformed phenotype (Chang, et al, 1982a; Santos, et al, 1983), presumably by increasing the levels of the active GTP-bound form of the ras protein. The overexpression of GAP can inhibit the morphological transformation of NLH3T3 cells that have increased ras expression, presumably by keeping the ras protein in an inactive GDP-bound configuration (Zhang, et  al, 1990a). The GTP-bound form of the ras protein is required to promote neoplastic transformation of fibroblasts (Barbacid, 1987), maturation of Xenopus oocytes (Birchemeier, et al, 1985) and differentiation of PC12 cells (Bar-Sagi and Feramisco, 1985; Satoh, et al, 1987). In addition, mutants that preferentially bind GDP have a dominant negative effect on growth in mammalian cells and  10 S. cerevisiae (Feig and Cooper, 1988; Powers, et al, 1989; Cai, et al, 1990). Normally the ras proteins are predominantly in an inactive GDP-bound form. When an appropriate signal is recognized they are activated by the exchange of GDP for GTP, which stimulates a signal to a downstream effector(s). The active GTP-bound form of the protein is a transient intermediate since the biological activity of GAP cycles the protein back to the inactive GDP-bound state. 1.3 Physiological function of the ras proteins in yeast.  Genetic and biochemical analyses show that S. cerevisiae RAS1 and RAS2 genes regulate intracellular levels of cAMP by acting as positive regulators of adenylyl cyclase (Broek, et al, 1985; Toda, et al, 1985; Tamanoi, 1988). The RAS1 and RAS2 gene products appear to be biologically equivalent, although differential translational and transcriptional control mechanisms determine under what physiological conditions each will be expressed (Breviario, et al, 1986; Breviario, et al, 1988). The CDC25 gene product is involved in the regulation of the cAMP pathway in yeast by acting upstream of RAS (Broek, et  al, 1987; Robinson, et al, 1987). The CDC25 gene is believed to encode a nucleotide exchange factor that regulates the amount of GTP bound to the ras protein. It remains to be determined if the RAS protein activates adenylyl cyclase directly or through an intermediary protein such as the adenylyl cyclaseassociated protein (Field, et al, 1990). Recently two genes, IRA1 and IRA2, have been identified that function upstream of the RAS genes (Tanaka, et al, 1990a; Tanaka, et al, 1990b). The IRA1 and IRA2 gene products are similar to mammalian GAP and may be involved in the down-regulation of the yeast RAS proteins (Tanaka, et al, 1990a; Tanaka, et al, 1990b). Indeed, mammalian GAP can replace IRA function when expressed in S. cerevisiae (Ballester, et al,  11 1989; Tanaka, et al, 1990a). Although the major function of RAS in S. cerevisiae is to regulate cAMP metabolism, there is also genetic and biochemical data to suggest that the RAS proteins regulate other signalling pathways (Toda, et al, 1987; Field, et al, 1990). 1.4 Physiological function of ras proteins in higher eukaryotes  1.4.1 The involvement of ras proteins in cellular proliferation and differentiation The mammalian ras genes are expressed in both immature dividing cells as well as certain differentiated cell types (Furth, et al, 1987), indicating that they may have a role in both cellular proliferation and differentiation. The ability of the activated ras proteins to cause morphological transformation and unregulated growth control suggests that they are involved in the transmission of mitogenic signals. The microinjection of ras proteins into quiescent NLH3T3 cells stimulated DNA synthesis (Feramisco, et al, 1984; Stacey and Kung, 1984). In accordance with these results, microinjection of the ras-specific monoclonal antibody, Yl3-259 blocked DNA synthesis in fibroblasts stimulated by growth factors (Mulcahy, et al, 1985; Kung, et al, 1986). Furthermore, the Y13-259 antibody was able to block the proliferative signal from a wide variety of growth factors suggesting that the ras proteins transduce mitogenic signals that originate from a number of different cell surface receptors and membrane associated proteins (Smith, et al, 1986; Yu, et al, 1988). In addition, the ras proteins appear to be involved in the differentiation of certain cell types. Activated ras genes can induce the terminal differentiation of the PC12 rat pheochromocytoma cell line, as evidenced by neurite outgrowth (Spandidos and Wilkie, 1984; Bar-Sagi and Feramisco, 1985; Noda, et al, 1985;  Satoh, et al, 1987; Sassone, et al, 1989). Nerve growth factor (NGF) and cAMP are both able to induce the differentiation process but they act through independent pathways. The microinjection of Yl3-259 inhibits differentiation mediated by NGF but not by cAMP suggesting that the ras proteins may participate in the transduction of the NGF signal (Hagag, et al, 1986). The ras proteins also promote the survival and fiber outgrowth of cultured embryonic neurons (Borasio, et al, 1989). Induction of a differentiated phenotype by ras proteins has also been observed in a number of other cell types, suggesting that the ras proteins may fulfill a specialized role in cell type determination (for review see; Auersperg and Roskelley, 1990). Whether ras proteins have an effect upon differentiation or proliferation appears to be dependent upon the cell type and its differentiated state. 1.4.2 Ras proteins and signal transduction Although the mammalian ras proteins can stimulate yeast adenylyl cyclase activity (Broek, et al, 1985; DeFeo-Jones, et al, 1985) it does not appear that their endogenous function is to regulate this activity (Beckner, et al, 1985) and the search for an alternative function for ras proteins in mammalian cells is currently a very active area of investigation. A synopsis of the current proposals for the role of ras proteins in signal transduction is shown schematically in Figure 2. Attempts have been made to characterize the upstream components of the ras signal transduction pathway that control the active GTP-bound state of the ras proteins. The amount of ras-GTP increases in cells that are treated with platelet derived growth factor (PDGF) or epidermal growth factor and in transformed cells carrying oncogene products with tyrosine kinase activity (Satoh, et al, 1990a; Satoh, et al, 1990b). These results suggest that receptors  1 3  Figure 2. A proposed model for the role of the mammalian ras proteins in signal transduction. U p o n stimulation by the appropriate mitogenic signal ras protein exchanges G D P for G T P by the interaction with a specific nucleotideexchange factor. The active membrane bound ras protein interacts with target molecules that result in pleiotropic cellular effects including cell growth and differentiation. The signal is turned off when G A P stimulates the intrinsic GTPase activity to convert ras-GTP to ras-GDP. The activity of G A P is negatively regulated by phospholipids that are produced as a consequence of mitogenic stimulation and by a specific GTPase inhibiting protein. G A P may also act as a downstream target for the activated ras protein, but it is probably not the only target molecule and therefore may not mediate all of the cellular effects. In activated ras transformed cells the GTP-associated form of the protein is favoured. See text for specific details.  ACTIVATION SIGNAL  INACTIVE  Activation Signal -ve effect) phospholipids GTPase inhibiting protein  t CELLULAR EFFECTS including Cell Growth Cellular differentiation  (Growth Factors) (Tyrosine kinases) (Oncogenes)  15 with tyrosine kinase activity may transduce a mitogenic signal via the ras proteins. Recently it has been demonstrated that the stimulation of T lymphocytes through the antigen receptor results in a rapid increase in the amount of ras-GTP (Downward, et al, 1990a). The identification of nucleotide exchange factors that may act as positive regulators of ras-GTP levels may be involved in the transduction of mitogenic signals. Recently several mammalian proteins, ras guanine nucleotide exchange factor (rGEF), rasexchange promoting protein (REP) and ras-guanine nucleotide-releasing factor (GRF), have been identified that promote the exchange of guanine nucleotides on the ras proteins and thus may be analogous to the yeast CDC25 gene product (Downward, et al, 1990b; Huang, et al, 1990; Wolfman and Macara, 1990). It is not known whether the three factors represent identical proteins. Very little is known about the control of the nucleotide exchange factors, however it is conceivable that their regulation is dependent on an activation signal. GAP can act as a negative regulator of ras protein activity by greatly stimulating the endogenous GTPase activity of the protein and may be involved in the transduction of mitogenic signals by returning the protein to the inactive GDP-bound state. After stimulation of mammalian cells with a variety of growth factors and oncogene products, GAP is phosphorylated on tyrosine residues (Molloy, et al, 1989; Ellis, et al, 1990). GAP has also been shown to physically associate with activated PDGF receptors (Kaplan, et al, 1990; Kazlauskas, et al, 1990). The significance of these protein-protein interactions and the tyrosine phosphorylation of GAP is unknown, but it is conceivable that tyrosine kinases modulate ras activity through GAP by a yet to be determined mechanism. Phospholipids produced in cells as a consequence of mitogenic stimulation are able to inhibit GAP activity (Tsai, et al, 1989; Yu, et al, 1990), as well as increase the activity of a GTPase inhibiting protein (Tsai, et al, 1990).  16 The interaction of lipids with these two regulatory proteins would tend to increase the biological activity of the ras proteins by favouring the association with GTP. In fibroblasts the overexpression of GAP suppresses neoplastic transformation induced by the ras proteins suggesting that GAP is a principal regulator of ras activity (Zhang, et al, 1990a). Furthermore the increase in rasGTP upon activation of the T lymphocytes appears to be due to an inactivation of GAP activity (Downward, et al, 1990a). The determination of downstream effects of ras signal transduction has been difficult because of the pleiotropic effects associated with ras transformation. Since cellular transformation and cellular proliferation are accompanied by the rapid metabolism of phosphatidylinositol it has been suggested that ras proteins regulate phospholipase C (PLC) activity. PLC hydrolyzes phosphatidylinositol 4,5-bisphosphate  (PIP2)  to generate two second messengers, inositol 1,4,5-  triphosphate (IP3) and 1,2-diacylgylcerol (DAG). DAG activates protein kinase C, and I P 3 mediates the release of calcium from intracellular stores (Berridge, 1987). These second messengers are critical regulators of cellular proliferation (Berridge, 1987). Several groups have looked for changes in phosphatidylinositide (PI) turnover in activated ras transformed cells, but the results have been inconsistent. Some groups have reported elevated levels of I P 3 , whereas others have observed no changes in PI turnover (Fleischman, et al, 1986; Wakelam, et al, 1986; Seuwen, et al, 1988). However, a consistent observation has been that ras transformation is associated with elevated levels of DAG (Fleischman, et al, 1986; Lacal, et al, 1987a; Lacal, et al, 1987c; Wolfman and Macara, 1987; Wilkison, et al, 1989) and the subsequent activation of protein kinase C is necessary for the stimulation of DNA synthesis by ras proteins (Lacal, et al, 1987b; Lloyd, et al, 1989). Recent data suggests that the ras proteins specifically regulate an alternative pathway for the generation of DAG  17 (Lacal, et al, 1987c; Price, et al, 1989; Lacal, 1990), most probably by the activation of a phosphatidylcholine (PC) hydrolyzing PLC (Diaz-Laviada, et al, 1990). In agreement, PC hydrolysis yields DAG molecular species that are distinct from those that originate from PI degradation (Bocckino, et al, 1985; Pessin, et al, 1990) and the fatty acid composition of DAG from ras transformants differs from that of cells with an increased PI turnover (Moscat, et al, 1989). Interestingly, protein kinase C is not required for ras-induced morphological transformation suggesting that the activated ras proteins are involved in the transmission of more than one signal (Lloyd, et al, 1989). In addition to being an upstream negative regulator of ras protein activity, other evidence suggests that GAP may act as a downstream target (McCormick, 1989; Hall, 1990). Mutations in the effector region (amino acids 32-40) of the ras proteins prevent neoplastic transformation and also prevent the protein from interacting with GAP (Adari, et al, 1988; Cales, et al, 1988). Furthermore, it has been demonstrated that ras-GTP prevents the coupling of a G protein to the M 2 muscarinic acetylcholine receptor. This effect is prevented by GAP specific antibodies and ras antibodies that are known to block the interaction between GAP and the ras proteins, suggesting that GAP is necessary for the ras protein to act in this system (Yatani, et al, 1990). The idea that GAP can act as a downstream target of ras in some systems is intriguing but it is unlikely that GAP is the sole target molecule for ras mediated signal transduction (Hall, 1990). 1.5 Ras gene superfamily  It is now evident that ras genes are part of a much larger superfamily and members of this superfamily have been found in a variety of organisms (Table 1) (Chardin, 1988; Sanders, 1990). Many of these genes were identified because  TABLE 1. The ras protein superfamily Ras family Mammalian Other ScRASl H-ras ScRAS2  N-ras  SpRAS Dras Ddras  R-ras ralA ralB a b  Rho family Mammalian Other rhoA ScRHOl  b  K-ras  DdrasG Dras2  Rap family Mammalian Other Dras3 raplA raplB Ddrapl rap2A rap2B  a  3  ScRSRl  rhoB  racl rac2  sequences described in this thesis also called Krevl and smg21  Abbreviations: Sc, Saccharomyces cerevisiae; Sp, Schizosaccharomyces pombe; D, Drosophila melanogaster; Dd, Dictyostelium discoideum Was adapted from Downward (1990)  ScRH02  rhoC ScCDC42  Rab family Mammalian Other rablA ScYPTl rablB  ScSEC4  rab2 rab3A rab3B rab4  DdSASl DdSAS2  rab5 rab6 rab7 BRL-ras  they hybridize with nucleotide sequences derived fromrasgenes or because their encoded products bind GTP. Theseras-relatedGTP-binding proteins appear to be involved in a wide range of biological processes. The major sequence conservation within the superfamily is the preservation of the four domains implicated in the binding of guanine nucleotides (Chardin, 1988; Sanders, 1990). There are additional regions of conservation and the individual members of the ras gene superfamily vary in the amount of this additional identity. The ral, R-ras and rap proteins are more closely related to the ras proteins with approximately 50% amino acid identity, whereas the rho, rac, and rab proteins have approximately 30% identity. The function of the ral, R-ras and rap proteins is not known. However, it is interesting to note that the overexpression of the raplA protein can morphologically revert the transformed phenotype associated with rastransformed cells (Kitayama, et al., 1989). Experiments with the rho protein family in both yeast and mammalian cells suggest that they are involved in regulating some aspect of the cytoskeletal network that affects cell shape (Madaule, et al, 1987; Paterson, et al., 1990). The mammalian rab family of proteins are similar to the yeast YPT1 and SEC4 proteins. Genetic evidence demonstrates that the yeast YPT1 and SEC4 genes are essential genes involved in intracellular vesicle transport (Salmien and Novick, 1987; Segev, et al, 1988). Since the rab genes can complement YPT1 deletions in yeast it is proposed that the rab protein family regulate intracellular trafficking of vesicles (Segev, et al, 1988). The analysis of both the rho and rab protein families illustrates the diverse functions of the ras protein superfamily within eukaryotic cells.  20  1.6 Dictyostelium discoideum 1.6.1 Life Cycle The cellular slime mould Dictyostelium discoideum is a useful developmental system for examining various aspects of signal transduction during cellular proliferation and differentiation. In this simple eukaryotic organism cell division and differentiation are mutually exclusive. The vegetative amoebae feed on bacteria and divide by binary fission as long as a bacterial food source is available. Upon starvation cell division ceases and a relatively simple developmental process occurs (Figure 3) (Loomis, 1975). With the onset of starvation, a few cells begin to secrete spontaneously the chemoattractant cAMP, attracting other cells which then gain the capacity to relay a synchronous pulse of cAMP. Cells adhere to one another by means of cell adhesion molecules forming aggregates of approximately 10^ cells. Each aggregate forms a single 'tip' and elongates to form a pseudoplasmodium which then behaves as an organized multicellular individual and migrates over the substratum until conditions favour the formation of the final fruiting body. Within the migrating pseudoplasmodium differentiation into distinct prestalk cells at the anterior region and prespore cells at the posterior region become discernible. The final fruiting body consists of a sorus of mature spores, supported off the substratum by a fibrous stalk comprised of vacuolated stalk cells.  21 Figure 3. The life cycle of the cellular slime mould Dictyosteliutn discoideum. The stages of development are shown along with the times (hours) at which they occur after the onset of starvation. In the pseudoplasmodium, cell differentiation takes place into either pre-stalk cells in the anterior region or pre-spore cells in the posterior region. After approximately 24 hours the final fruiting body is formed and consists of a sorus of mature spores that are supported by a fibrous stalk comprised of stalk cells.  22 1.6.2. Signal transduction in D. discoideum Differentiation in D. discoideum represents the simplest form of developmental regulation in that the original amoebae differentiate into either stalk cells or spore cells. The differentiation process is dependent upon G protein mediated signal transduction pathways which have a striking similarity to the signal transduction systems in higher organisms (Firtel, et al, 1989). Signal transduction pathways regulate chemotaxis, aggregation and gene expression during the development of D. discoideum. During aggregation cells respond chemotactically towards extracellular cAMP. The cAMP interacts with specific cell surface receptors which activate two well defined intracellular signal transduction processes (Figure 4) (Janssens and Van Haastert, 1987; Newell, et al, 1987; Firtel, et al, 1989). Kinetic analysis has determined that there are two classes of cAMP cell surface receptors defined by a fast or slow rate of dissociation of cAMP (Janssens and Van Haastert, 1987). The interaction of cAMP with the fast dissociating receptors (RA) transiently activates adenylyl cyclase resulting in the synthesis and secretion of a pulse of cAMP into the extracellular medium. The secreted cAMP binds to the cell surface receptors on a nearby cell, which in turn pulse cAMP hence relaying the signal away from the initial cAMP secreting cell. This relay ensures the outward propagation of a wave of cAMP (Gerisch, 1987; Janssens and Van Haastert, 1987). The slow dissociating class of receptors (RB) are coupled to the chemotactic response. The chemotactic response involves the activation of guanylyl cyclase resulting in a transient 5 to 10 fold increase in intracellular cGMP levels and in a 2 to 3 fold increase in IP3 levels suggesting an involvement of phospholipase C (Janssens and Van Haastert, 1987; Newell, et al, 1987; Newell, et al, 1988). Chemotaxis results in the inward movement of the cells towards an aggregation  23 Figure 4. Model of cAMP-mediated signal transduction pathways in D. discoideum cells. cAMP binds to two forms of the cell surface cAMP receptor, R A and R B , that activate the signal relay pathway and the chemotaxis pathway respectively. The signal relay pathway is linked to a yet to be identified G protein and GRP (an associated protein) which act to stimulate adenylyl cyclase (AdCy) activity and the susbsequent secretion of cAMP. The receptor mediated activation of the chemotactic pathway is linked via the Ga2 protein, resulting in an increase in IP3 levels and the subsequent mobilization of C a stores and increases in cGMP levels due to an activation of guanylyl cyclase (GuCy). Both of these intracellular messengers are involved in actin and myosin polymerization, resulting in chemotaxis. Both pathways appear to be involved in the regulation of certain classes of genes. The dashed arrow indicates the requirment of the chemotactic pathway for the actvation of the adenylyl cyclase pathway. The Frigid A mutants are defective in the chemotactic pathway and the Synag 7 mutants are defective in the signal relay pathway. See text for the specific details on the two pathways and the appropriate references. The Figure has been adapted from one appearing in a recent review (Van Haastert, 1990). 2+  in  signal relay  •-?  AdCy —  ;  5- c A M P ^ —  > function ?  gene expression  DAG »LC-^  >  IP,  2-1Ca"  > actin  •V ,  polymerization GuCy-  ->c(JMP.  5'AMP I'DE  5'GMP  /  — 5 » myosin  L  •> chemotaxis  center. Both cAMP-mediated responses become adapted upon binding of cAMP in that they no longer respond to a cAMP signal (Janssens and Van Haastert, 1987; Small, et al, 1987). Developmentally regulated cell surface and membrane bound forms of cAMP phosphodiesterase degrade the extracellular cAMP and the lowered cAMP concentration results in the return of the cAMP receptor to the active state so that it can then respond once more to cAMP (Janssens and Van Haastert, 1987; Kessin, 1988). The phosphorylation and dephosphorylation of the cAMP receptor is probably essential in the adaptation and de-adaptation responses, respectively (Knox, et al, 1986; Vaughan and Devreotes, 1988). This overall process ensures the outward propagation of a pulsatile cAMP signal transmitted every 6-7 minutes, whereas the pulsatile chemotactic response results in the inward movement of the cells towards the aggregation center. A gene encoding a cAMP receptor has been cloned and the deduced amino acid sequence suggests that it has seven transmembrane-spanning regions, a structural motif similar to other G protein linked receptors such as rhodopsin and the [3-adrenergic receptor (Klein, et al, 1988; Saxe, et al, 1988). The Cterminal region of the cAMP receptor contains multiple stretches of serine residues which are the proposed sites of ligand-induced phosphorylation (Klein,  et al, 1987; Klein, et al, 1988; Devreotes, 1989). The cAMP receptor is essential to development since D. discoideum cells expressing an antisense cAMP receptor mRNA do not enter the developmental program (Klein, et al, 1988; Sun, et al, 1990). Several genes have been isolated that share a high degree of sequence identity to the cAMP receptor and thus may encode other cAMP receptor proteins (Devreotes, 1989; Saxe, et al, 1990). Biochemical, genetic and molecular evidence indicate that both R A and R B classes of cAMP receptor are regulated by heterotrimeric G proteins (Van Haastert, et al, 1986; Van Haastert, et al, 1987b; Snaar-Jagalska, et al, 1988). At  26 present it is not known whether the different classes of cAMP cell surface receptors are products of different genes and/or whether they are coupled to different G proteins. Several putative G protein oc-subunits have been cloned from D. discoideum (Kumagai, et al, 1989; Pupillo, et al, 1989). The Ga2 protein is coupled to the slow dissociating receptors (RB) that activate phospholipase C and guanylyl cyclase (Figure 4) (Firtel, et al, 1989; Kumagai, et  al, 1989). Mutations in the Frigid A complementation group are within the Ga2 gene or result in reduced expression of Gcc2 and result in strains that do not aggregate, do not respond chemotactically towards cAMP, and do not relay the cAMP signal (Coukell, et al, 1983; Firtel, et al, 1989; Kumagai, et al, 1989). Since the Frigid A strains do not relay the cAMP signal, the Goc2 protein may also be involved in the activation of adenylyl cyclase (Coukell, et al, 1983). However, since non-hydrolyzable analogues of GTP are able to stimulate adenylyl cyclase in isolated membranes from the Frigid A strains, the direct activation of the signal relay pathway appears to involve an additional as yet unidentified G protein (Kesbeke, et al, 1988; Snaar-Jagalska, et al, 1988; Firtel, et al, 1989).  1.6.3. Control of gene expression in D. discoideum In addition to being the chemoattractant during aggregation, cAMP regulates the expression of a number of genes throughout development. During early development a class of genes are induced in response to pulses of cAMP including genes that encode proteins essential in the aggregation process, such as the cAMP receptor, Ga2, D2 (a serine esterase) and gp80 (cell surface adhesion molecule) (Gerisch, 1987; Firtel, et al, 1989). Synag 7 mutants which are defective in the receptor-mediated activation of adenylyl cyclase show a normal expression of the cAMP pulse induced genes. These genes are not expressed in strains carrying a mutation in the Frigid A complementation group which are  27 defective in the chemotactic signal transduction pathway suggesting that cAMP pulse-induced gene expression is mediated through the slow dissociating cAMP receptors, and thus is tightly linked to chemotaxis (Figure 4) (Kimmel, 1987; Mann, et al, 1988; Firtel, et al, 1989; Ma and Siu, 1990). However, recent studies suggest that a novel cAMP receptor that is pharmacologically distinct from the cell surface chemotactic cAMP receptor is involved in gp80 regulation (Ma and Siu, 1990). It remains to be determined whether this novel cAMP receptor regulates the expression of other cAMP induced genes. In addition to inducing gene expression early in development there appear to be at least two classes of genes that are inactivated during early development in response to pulses of cAMP. The K5 gene is induced shortly after the initiation of starvation and is repressed during aggregation in response to pulsatile cAMP (Mann and Firtel, 1987). It appears that the cAMP-mediated repression of this gene is also mediated through the chemotactic signal transduction pathway (Mann, et al, 1988). In contrast, the M4-1 gene is expressed during vegetative growth and then repressed during aggregation in response to pulsatile cAMP (Kimmel and Carlisle, 1986). The repression of this gene appears to be mediated by the signal relay response pathway, requiring the activation of adenylyl cyclase (Kimmel, 1987). During multicellular development cAMP is also the agent that regulates the expression of a number of prestalk and prespore enriched mRNAs. However, in contrast to the cAMP pulse-induced genes, the induction of post-aggregative mRNAs require the continuous presence of high concentrations of cAMP (Chung, et al, 1981). Pharmacological studies with cAMP analogues show that exogenous cAMP regulates these genes by acting through proteins with the same specificity as the cell surface cAMP receptor (Schaap and Van Driel, 1985; Haribabu and Dottin, 1986; Oyama and Blumberg, 1986). The high  concentrations of cAMP which can induce post-aggregative gene expression provide conditions which adapt the receptor-mediated responses that regulate early gene expression. These observations suggest the possibility that postaggregative gene expression is mediated through a cAMP cell surface receptor that is not sensitive to adaptation. The recent discovery of multiple cAMP receptor genes that are expressed during multicellular development now raises the question of which cell surface receptor transduces the signal (Devreotes, 1989; Saxe, et al, 1990). Interestingly, these putative cAMP receptor genes encode proteins that do not contain potential phosphorylation sites and thus are presumably not subject to adaptation (Saxe, et al, 1990). Inhibition of the activation of adenylyl cyclase has no discernible effect on post-aggregative gene expression suggesting that intracellular messengers other than cAMP modulate the expression of these genes (Schaap, et al, 1986; Kimmel, 1987). Binding of cAMP to the cell surface receptor results in the elevation of IP3 levels and the subsequent mobilization of intracellular calcium (Europe-Finner and Newell, 1986; Europe-Finner and Newell, 1987; Newell, et  al, 1988; Van Haastert, et al, 1989). Both prestalk and prespore genes can be induced by DAG and IP3 suggesting that protein kinase C and/or calcium may be the second messengers that regulate the expression of these genes (Kimmel and Eisen, 1988; Ginsburg and Kimmel, 1989). However, lithium, which inhibits cAMP-stimulated IP3 formation and various calcium antagonists have a more pronounced inhibitory effect on the expression of the prespore genes suggesting that different signal transduction systems are utilized for cAMP receptormediated accumulation of prestalk and prespore mRNAs (Schaap, et al, 1986; Blumberg, et al, 1988; Pavlovic, et al, 1988; Van Lookeren Campagne, et al, 1988; Blumberg, et al, 1989; Peters, et al, 1989). The mechanism by which these  29 potential second messengers modulate cAMP induced gene expression is not yet known. 1.6.4 Ras-related genes in D. discoideum. Evidence for ras genes and their encoded products in D. discoideum has come from two independent laboratories. Firtel and co-workers isolated a gene (Ddras) that was preferentially expressed in the prestalk cells during the pseudoplasmodial stage of development. DNA sequence analysis revealed that the deduced amino acid sequence of the Ddras protein has approximately 65% identity to the mammalian ras proteins (Reymond, et al, 1984). The Ddras gene encoded two mRNAs (0.9 and 1.2 kb) that were differentially expressed during D. discoideum development. The 1.2 kb mRNA was detected at low levels in vegetative cells and disappeared rapidly upon the initiation of development. At the end of aggregation both mRNAs were detected reaching maximal levels during the pseudoplasmodial stage of development (Reymond, et al, 1984). The expression of the 1.2 kb mRNA was induced by cAMP, a property characteristic of other prestalk enriched genes (Mehdy, et al, 1983). Southern blot analysis suggested that there was only a single ras gene in D. discoideum. In previous studies from the Weeks' laboratory, a major protein of 23,000 M  r  (p23) was specifically immunoprecipitated from D. discoideum cell free extracts using the ras-specific monoclonal antibody, Y13-259 (Pawson and Weeks, 1984; Pawson, et al, 1985). The relative rates of p23 synthesis were maximal during vegetative growth and early development with a sharp decline thereafter. However there was a small burst of synthesis during the pseudoplasmodial stage of development (Pawson and Weeks, 1984; Pawson, et al, 1985). There was no specific degradation of p23 during differentiation suggesting that the decrease in synthesis of the ras protein was responsible for the reduction of p23 levels  that occured (Weeks and Pawson, 1987). In addition to p23 a minor protein of 24,000 M (p24) was also immunoprecipitated with the Yl3-259 antibody from r  cell extracts of both vegetative and pseudoplasmodial cells (Pawson, et al, 1985; Weeks and Pawson, 1987). There was no evidence for a precursor-product relationship between p23 and p24 suggesting the possibility that they are distinct gene products (Weeks and Pawson, 1987). Both p23 and p24 appeared to be membrane associated like the mammalian ras proteins (Weeks, et al, 1987). The Ddras gene was maximally expressed during the pseudoplasmodial stage of development, whereas in contrast, there was a maximum level of in vivo ras protein synthesis in vegetative and early differentiating cells. The aim of this thesis was to explain these discrepancies and to try to understand more about the role of the ras genes in D. discoideum development.  CHAPTER 2  2.0 MATERIALS AND METHODS 2.1 Materials  All restriction endonucleases and modifying enzymes were purchased from BRL (Burlington, Ont. Canada) and all other chemicals were from either BDH (Vancouver, B.C., Canada) or Sigma Chemical Company (St. Louis, Mo. USA) unless otherwise specified in the text. All X-ray film XRP or XAR-5 was from Kodak, Canada. The oligonucleotides used were synthesized chemically on an Applied Biosystems 380A DNA synthesizer by T. Atkinson (Department of Biochemistry, U.B.C.).  2.2 Growth and development of D. discoideum 2.2.1 Growth D. discoideum wild type strains, V12-M2 and NC4 were maintained on nutrient agar (SM agar plates: 10 g glucose, 10 g neutralized bacteriological peptone (Oxoid), 1 g yeast extract (Oxoid), 1.0 g MgS04-7H20,1.55 g NaH2P04-H20,1.0 g K2HPO4 and 20 g bacto-agar (Difco) per liter of deionized H2O) in association with Enterobacter aerogenes. To produce a confluent lawn of vegetative D. discoideum cells, spores were innoculated into a fresh culture of E. aerogenes and 0.3 ml aliquots were plated on SM agar plates and incubated at 22°C for approximately 48 hours. Basic stock cultures of the axenic D. discoideum strain, Ax-2 were also maintained on lawns of E. aerogenes.. For axenic growth, spores were  32 innoculated into HL5 medium (15.4 g glucose, 14.3 neutralized bacteriological peptone (Oxoid), 7.0 g yeast extract (Oxoid), 0.96 g Na2HPC»4-7H20 and 0.49 g K2H2PO4 per liter of deionized H2O, pH 6.8) and the cultures were shaken at 100 rev/min at 22°C (Watts and Ashworth, 1970). Exponentially growing cells at a density of 2-4 x 10 cells/ml were passaged by an approximately 100 fold dilution 6  into fresh HL5 medium. Under these conditions cells grew with a generation time of 8-9 hours. The axenic cells were passaged for approximately 1 month at which point fresh spores from the stock plates were used to innoculate HL5 medium.  2.2.2 Synchronous growth Ax-2 cells were grown in HL5 medium to stationary phase (1.8-2.0 x 10  7  cells/ml). After approximately 12-16 hours in stationary phase, the cells were harvested by centrifugation at 700xg and washed once in HL5 media. The cells were then diluted in fresh HL5 media to a cell density of 1 X 10° cells/ml and incubated under normal growth conditions (Soil, et al, 1976; Jimenez, et al, 1986). Cell number was monitored by haemocytometer counting.  2.2.3 Development To initiate in vivo development of V12-M2 and NC4, the vegetative amoebae were separated from the bacteria by four low speed centrifugations (700xg for 3 minutes) using potassium phosphate buffer (KK2 buffer: 0.45 g K2HPO4 and 2.4 g KH2PO4 per liter of deionized H2O resulting in solution containing 20 mM phosphate at pH 6.0). The washed cells were resuspended in KK2 buffer and 10 cells were plated onto 4.0 cm membrane filters (Millipore, 8  Corp) resting on support pads saturated with KK2 buffer. The cells were incubated in a humid chamber at 22°C for the times indicated in the text. In  1  33 some experiments Bonner's salts (10 mM NaCI, 10 mM KC1 and 2.0 mM CaCl2) (Bonner, 1947) was used instead of KK2 buffer without any appreciable effect on development. For development of the Ax-2 strain, cells were grown axenically to a cell density of 2-4 x 10 cells/ml and then harvested by centrifugation at 700xg for 3 6  minutes. The cells were then washed twice in Bonner's salts and 2 x 10 cells 7  were plated on filters resting on support pads saturated with Bonner's salts.  2.2.4 Separation of prestalk and prespore cells The separation of prestalk and prespore cells was performed using either the continous Percoll gradient method of Ratner and Borth (1983) or a modification of this method utilizing a Percoll step gradient (Kwong, et al., 1988). For both methods, pseudoplasmodia of the V12-M2 strain were obtained by allowing vegetative cells to differentiate for 16 hours on the surface of 2% non-nutrient agar plates, containing 5% Bonner's salts (Bonner, 1947). The pseudoplasmodia were harvested and filtered through a fine nylon mesh to remove undifferentiated cells and the prestalk and prespore cells were isolated as described in detail elsewhere (Kwong, et al., 1990). 2.2.5 Differentiation in shake suspension To initiate in vitro differentiation in suspension, vegetative V12-M2 cells were separated from the bacteria as described above. Washed cells were suspended at 5 x 10 cells/ml in KK2 buffer and subjected to gyratory shaking at 7  250 rev/min. For cAMP pulse conditions, cAMP was added manually to a final concentration of 25 nM every 5 minutes for the length of the experiment. For continuous cAMP conditions, cells were shaken in the presence of 500 uM cAMP with additional cAMP added to a concentration of 100 |iM every hour.  34 Samples were collected at the times indicate in the appropriate Figure legends. All of these samples were prepared in collaboration with M. Khosla and are described elsewhere (Khosla, et al, 1990). 2.3 Isolation of nucleic acids from D. discoideum  2.3.1 DNA To isolate genomic DNA, Ax-2 cells were grown to a cell density of 8 x 10  6  cells/ml and then harvested as described above. The nuclei were isolated as described by Cocucci and Sussman (1970) and the genomic DNA was extracted as descibed by Maniatis et al, (1982).  2.3.2 RNA Total RNA was isolated by a modification of a previously published procedure (Birnboim, 1988). Briefly, approximately 10 cells were resuspended 8  in 4 mis of RES-1 buffer (0.5 M LiCl, 1 M urea, 1% SDS, 20 mM sodium citrate, 2.5 mM frans-l,2-diaminocyclohexane-N,N,N',N'-tetra-acetic acid, pH 6.8) to lyse the cells. Proteinase K was added to a final concentration of 50 ug/ml and the mixture was incubated at 50°C for 30 minutes. The lysate was extracted twice with an equal volume of phenol/chloroform (1:1) and the aqueous phase was then ethanol precipitated. After ethanol precipitation, the pellet containing both RNA and DNA was resuspended in 500 ul of RES-1 buffer. The RNA was selectively precipitated by the addition of an equal volume of 5 M LiCl/95% ethanol (3/2) and the mixture was stored overnight at 4°C to allow complete precipitation. The supernatant was removed after centrifugation for 15 minutes in a microfuge and the pellet was washed several times with 75% ethanol to remove traces of LiCl. The extraction of total RNA from separated prestalk and  prespore cells was as described above except the volumes were reduced proportionally to the number of cells isolated. For some experiments polyadenylated RNA was isolated by oligo d(T) cellulose chromatography (Aviv and Leder, 1972) as described by Maniatis et al, (1982). RNA pellets were resuspended in diethylpyrocarbonate treated water, and the concentration of RNA was determined by A26O spectrophotometry analysis. 2.4 Isolation of cDNA and genomic DNA clones  2.4.1 Isolation of the DdrasG cDNAs To isolate the ras-related cDNAs a A,gtlO cDNA library prepared from mRNA isolated from growing cells of D. discoideum, kindly donated by Drs S. Rosejohn and W. Rowekamp, was plated (200,000 plaques) using the bacterial strain NM514 and blotted onto nitrocellulose filters as described by Maniatis et al, (1982). The filters were prehybridized for 2-4 hours at 37«C in 30% formamide, 5X Denhardt's solution (IX Denhardt's solution is 0.02% Ficoll, 0.02% bovine serum albumin, 0.02% polyvinylpyrrolidone), 5X SSC (IX SSC is 0.15 M NaCI, 0.015 M sodium citrate), 50mM sodium phosphate buffer, pH 6.5, 0.5% SDS and 250 |ig/ml of denatured salmon sperm DNA. The filters were then hybridized for 16 hours at 37°C in a solution containing 30% formamide, 5X SSC, IX Denhardt's solution, 20 mM sodium phosphate buffer, pH 6.5, 0.5% SDS and approximately 3 x 10 cpm/ml of Ddros-cl insert that had been labelled using [a6  32  P]dCTP (3000 Ci/mmol; ICN Pharmaceuticals Inc.) the random primer method  (Feinberg and Vogelstein, 1983). All DNA fragments used for labelling were isolated on DEAE membranes (Schleicher & Schuell, NA45) according to the manufacturer's recommendations. The labelled probes were separated from unincorporated nucleotides by passage through a Sephadex G-25 spun column  (Maniatis, et al, 1982), heat-denatured for 5 minutes, quenched on ice and then added to the hybridization solution. The filters were washed twice (30 minutes per wash) in 30% formamide, 3X SSC, 0.1% SDS at 37°C and then used to expose X-ray film for 12 hours. The filters were then washed twice (30 minutes per wash) in 40% formamide, 2X SSC, 0.1% SDS at 37°C and used to re-expose X-ray film for an additional 12 hours. Approximately 100 plaques that hybridized after the initial washes but failed to or showed reduced signals after the second higher stringency washes were selected and plaque purified by two additional rounds of screening. The original screening of the library was done by Dr. G. Weeks in the laboratory of Dr. J.G. Williams (I.C.R.F. England) and the plaques were then brought back to U.B.C.. DNA was isolated from liquid lysates of 11 of the X,gtl0 recombinant phage using DEAE Sephacel (Pharmacia) chromatography (Helms, et al, 1987). The purified DNA was digested with EcoRl, separated on an agarose gel and then transferred to a nitrocellulose membrane (see Southern analysis). The filter was hybridized with the Ddras-cl probe as described above. Three of the recombinant cDNA clones (DdrasG-c3, DdrasG-cll and DdrosG-c23) were selected for further analysis since they had the strongest hybridization signal under the low stringency conditions. Characterization and analysis of these clones is described in Chapter 4. 2.4.2 Isolation of the Ddrapl cDNA clones Following the identification of the DdrasG cDNAs, 44 of the originally isolated plaques that hybridized to the Ddras-cl cDNA under low stringency conditions were analyzed to determine if they represented other ras-related genes. DNA was isolated from liquid phage lysates using DEAE sephacel chromatography (Helms, et al, 1987) and digested with EcoRI. The resulting fragments were size fractionated by electrophoresis through 0.8% agarose gels  37 and transferred to nitrocellulose filters (see Southern blot analysis). The filters were prehybridized and hybridized with randomly primed DdrasG-c3 insert as described above. The filters were then washed under low stringency conditions; two times 20 minutes in 2X SSC, 0.1% SDS at 50°C. After exposure to X-ray film for 12-16 hours the filters were then washed under high stringency conditions; two times 20 minutes in 0.1X SSC, 0.1% SDS and re-exposed to X-ray film. The filters were then reprobed with the Ddras-cl cDNA and washed using an identical protocol. One clone c51 hybridized to both the DdrasG-c3 and Ddras-cl cDNAs under low but not under high stringency conditions and was selected for further study (a summer student, V. Suttorp helped with the analysis of the 44 recombinant phage). The c51 clone (Ddrap-c51) was used to isolate five additional Ddrapl cDNA clones under the high stringency conditions from a Xgtll cDNA library, prepared from mRNA from D. discoideum cells at 3-4 hours of development (kindly provided by Dr. P. Devreotes).  2.4.3 Isolation of DdrasG genomic clone The isolation of the genomic clones was done in collaboration with Dr. J.G. Williams' laboratory (ICRF, England). Purified DdrasG-c3 insert was sent to Dr. Williams where it was labelled and used to screen a genomic library (Pears, et  al, 1985) prepared from total nuclear DNA, partially cleaved with Sau3A to give an average size of 5kb and ligated into the BamHl site of the pBR322 plasmid derivative, pAT153 (Maniatis, et al, 1982). The ampicillin resistant colonies were screened by the modified method of Grunstein and Hogness (1975) as described in Maniatis et al, (1982). The genomic library was stored between nitrocellulose filters in the presence of glycerol at -70°C (J. Williams, personal communication). Ten regions of the filters that hybridized to the DdrasG-c3 cDNA were cut out of the master storage filters and sent to us at U.B.C.. The  38 filters containing the potential DdrasG genomic clones were diluted in LB medium (10 g Bacto-tryptone (Difco), 10 g NaCl and 5 g yeast extract (Difco) per liter of H 2 O ) and plated as single colonies on LB agar (LB plus 1.2% Bacto-agar (Difco)) containing 50 ug/ml of ampicillin and screened with the DdrasG-c3 cDNA as above. Eight of the ten potential positives clones hybridized to the DdrasG-c3 under high stringency conditions. Partial restriction maps of the eight clones were obtained by digestion with a wide range of enzymes and separation by agarose gel electrophoresis. The DdrasG genomic clones were analyzed by Southern blot analysis (see Southern blot analysis) using the DdrasG-c3 cDNA and an oligonucleotide (oligonucleotide a) complementary to the 5' end of the coding region of the DdrasG gene (Figure 16). The oligonucleotide was end-labelled using T4 polynucleotide kinase and [y- PjATP 32  (7,000 Ci/mmole; ICN Pharmaceuticals Inc.) and used to hybridize the Southern blots containing the genomic clones using the conditions described by Maniatis  et al, (1982). The filters were washed four times (five minutes per wash) in 6X SSC, 0.1% SDS at 42°C and used to expose X-ray film for an appropriate period of time. 2.5 Sequence determination of DNA and RNA  2.5.1 DNA sequencing DNA from the DdrasG and Ddrapl ^.gtlO and A,gtll recombinant phages was isolated from liquid lysates, digested with EcoRI and then subcloned into M13mpl8 (Yanisch-Perron, et al, 1985) in both orientations. Three restriction fragments of the DdrasG genomic clone (DdrasG-g5.2) were purified by preparative gel electrophoresis using DEAE membranes and subcloned into M13mpl8 or the Bluescript vector (Stratagene, La Jolla, USA) (Figure 15). The  39 600 bp EcoBI fragment was cloned into M13mpl8 in both orientations. The 2.2 kb Acc I and the 1.8 kb Bglll/EcoRI fragments were cloned into the Bluescript vector. From each clone smaller subclones containing shorter inserts were generated using the exonuclease III (Boehringer Manheim, Montreal, Canada) unidirectional digestion technique (Henikoff, 1984). Subclones containing inserts that differed in size by approximately 250 bp were selected for sequencing. Single stranded DNA was isolated from each of the M13mpl8 subclones (Messing, 1983) and from the various Bluescript recombinant clones using the VCS-M13 helper phage (Stratagene, La Jolla, USA) following the manufacturer's protocol. Approximately 0.5-1.0 ng of purified single stranded DNA or denatured double stranded DNA was sequenced using modified T7 polymerase (Sequenase, United States Biochemical Corp, Ohio, USA) following the manufacturer's protocol with [oc- S]dATP (1000 Ci/mmol; NEN Dupont, 35  Boston, USA) using either the M13 universal primer or specific oligonucleotides from known sequences as primers. The sequencing mixtures were analyzed on 6% denaturing (7M urea) polyacrylamide gels , following electrophoresis the gels were dried and used to expose X-ray film for 24-48 hours. The sequences obtained were recorded, aligned and analyzed using either the DNA strider program or PC Gene with help from J. Hewitt, Dr. R. McMaster and Dr. D. Theilmann.  2.5.2 RNA sequencing The 5' end of the coding region of the Ddrapl gene was obtained by sequencing the mRNA directly by a dideoxy RNA sequencing technique (Geliebter, et al, 1986; Geliebter, 1988). Briefly, total RNA (10 |ig) isolated from vegetative D. discoideum cells was annealed with 50 ng of end-labelled oligonucleotide complementary to nucleotides 84-107 (5-  40 ATACCTTGAACAAATTGCACAGTC-3') (Figure 22) of the Ddrapl gene at 45°C. The mixture was sequenced using 5 units of avian myeloblastosis virus (AMV) reverse transcriptase at 45°C and then analyzed by electrophoresis on a 6% denaturing polyacrylamide gel. The 24 base oligonucleotide used for RNA sequence analysis was separated from incomplete products by electrophoresis on a 15% denaturing polyacrylamide gel, located by UV-shadowing and extracted from the gel by the crush and soak method (Atkinson and Smith, 1984). 2.6 Primer extension analysis  To map the sites of transcription initiation for DdrasG, two oligonucleotide primers were synthesized that were complementary to nucleotides 1 to +30 +  (oligonucleotide a; 5' - ACC A AC AAT A ACT AATTTGT ATTCTGTC AT-3') and "19 to +4 (oligonucleotide b; 5'-TC ATTTTTTT A A ATT AAG ATCTG-3') of the DdrasG transcription unit (Figure 16). Approximately 100,000-300,000 cpm of end-labeled primer was incubated with 2 ug of mRNA isolated from vegetative, aggregative or pseudoplasmodial cells in a 5 ul reaction mixture containing 0.4 M NaCl, 40 mM PIPES (pH 6.8) and 1 mM EDTA for 90 minutes at 50°C. The annealed primer reaction mixture was diluted 1:10 into primer extension buffer (50 mM Tris-HCl pH 7.6, 60 mM KC1,10 mM MgCb, 1 mM of each dNTP, 1 mM DTT, 1 unit/ul RNasin (Promega, Madison, Wi. USA) and 50 ug/ml actinomycin D (Sigma, St. Louis, USA) and was extended with either 5 units of AMV reverse transcriptase or with 100 units of modified murine leukemia virus reverse transcriptase (Superscript) per 50 ul reaction for 60 minutes at 42°C (Tsang, et al, 1982), and the extension products were separated by electrophoresis on 6% denaturing polyacrylamide gels.  41 2.7 Southern and Northern blot analyses 2.7.1 Southern blots D. discoideum genomic DNA was digested to completion with various enzymes according to the manufacturer's specifications and size fractionated by agarose gel electrophoresis in IX TBE buffer (0.089 M Tris, 0.089 M boric acid and 2 mM EDTA). Following electrophoresis the gels were denatured by soaking in 1.5 M NaCI, 0.5 M NaOH for 30 minutes, followed by neutralization in 1.5 M NaCI, 0.5 M Tris-HCl pH 7.5 for 30 minutes and then transferred to nitrocellulose membranes (Schleicher and Schuell, 0.45 |im) overnight in 20X SSC by passive diffusion (Maniatis, et al, 1982). The filters were baked for 2 hours at 80°C and then prehybridized and hybridized using the conditions described under clone isolation. After hybridization for approximately 16 hours with the desired probe the filters were washed twice (5 minutes per wash) in 2X SSC, 0.1% SDS at room temperature and then washed twice (20 minutes per wash) in 2X SSC, 0.1% SDS at 50°C to provide low stringency conditions. After the filters were used to expose X-ray film, they were washed under high stringency conditions, twice (20 minutes per wash) in 0.1X SSC, 0.1% SDS at 65°C and were then used to re-expose X-ray film. To reprobe the Southern blot filters they were washed for 20 minutes in 50 mM NaOH and then neutralized with several changes of 10 mM Tris-HCl (pH 7.5), 50 mM NaCI. The filters were then prehybridized and hybridized with the desired probe as described above.  2.7.2 Northern blots RNA samples for Northern blot analysis were adjusted to 50% formamide, 40 mM 3-(N-Morpholino)propanesulfonic acid pH 7.0, 10 mM sodium acetate, 1 mM EDTA and 6% formaldehyde, heat denatured for 10 minutes at 65°C and  42 then size fractionated on 1.25% formaldehyde-agarose gels (Lehrach, et al, 1977). For visualization, 1 ul of a 1 mg/ml stock solution of ethidium bromide was added to each RNA sample before heating. The gels were washed several times in deionized water and then transferred to nitrocellulose membranes overnight in the presence of 20X SSC. The filters were prehybridized and hybridized using the conditions described under clone isolation, except that the prehybridization and hybridization buffers also contained 30 ug/ml polyadenylic acid. The filters were then washed under the desired conditions as described for the Southern blots. Before reprobing, Northern blots were washed twice in 30% formamide, 0.1X SSC, 0.1% SDS at 65°C. To determine whether the Northern blots contained equal amounts of RNA they were probed with the IG7 cDNA, which detects a mRNA expressed constitutively during D. discoideum differentiation (Jermyn, et al, 1987). 2.8 In vitro translation and immunoprecipitation Samples of polyadenylated mRNA (0.5 ug) were translated by mRNA dependent rabbit reticulocyte lysate prepared by the method of Pelham and Jackson (Pelham and Jackson, 1976). The S-methionine translation products 35  were immunoprecipitated with theras-specificmonoclonal antibody, Y13-259 (Furth, et al, 1982), and the precipitates electrophoresed on a 10% SDSpolyacrylamide gel as described in detail elsewhere (Pawson, et al, 1985).  43 2.9 Preparation of antisera with predetermined specificity to variable regions of the Ddras, DdrasG and Ddrapl proteins  Three peptides were synthesized that corresponded to the deduced Cterminal variable regions of the Ddras, DdrasG and Ddrapl proteins (Figures 11 and 24) by the peptide synthesis group at the University of Victoria. These peptides (Ddras ' , DdrasG " 170 184  172  186  and Ddrapl " ) were coupled to the 169  183  carrier protein keyhole limpet hemocyanin (KLH) through the cysteine residue of the peptides usingra-maleimidobenzoyl-N-hydroxysuccinimideester (Pierce Biochemicals) (Lerner, et ah, 1981). Briefly, 5 mg of each peptide was coupled to 3 mg of KLH-MBS in phosphate buffered saline (PBS: 8.0 g NaCI, 0.2 g KC1, 0.2 g KH2PO4, 2.17 g Na2HP04-7H20, per liter of H2O, pH 7.5) by stirring at room temperature for 3 hours. The mixture was passed through Sephadex-G75 and eluted with PBS to remove unreacted peptide, KLH recovery was monitored by A28O  a n  d the peak fractions were pooled.  New Zealand White rabbits (9-10 weeks old) were injected subcutaneously with 0.5 mgs of each of the peptide-KLH conjugate mixed 1:1 with complete Freund's adjuvant. Each rabbit received additional subcutaneous injections using 0.5 mgs of the appropriate peptide conjugate mixed 1:1 with incomplete Freund's adjuvant on days 14 and 28 (Lerner, et ah, 1981). Serum was collected from each of the rabbits 10 days after the innoculation on day 28. The antisera from the three rabbits were tested for their specificity by a standard enzymelinked immunosorbent assay using microtiter plates coated with each of the peptides (10 ng) (Bizub, et ah, 1987). The plates were incubated with 2-fold serial dilutions of each of the serum samples and the amount of bound antibody was determined with alkaline phosphatase labelled goat anti-rabbit IgG antibody (Bio-Rad Laboratories, Mississauga, Canada), using disodium p-nitrophenyl  phosphate (Sigma, St. Louis, USA) as a substrate. Once it was determined that the rabbits had developed an immune response to each of the peptides they were boosted for a final time on day 56 by subcutaneous injections as described above and the rabbits were sacrificed on day 70-72. The serum was collected and stored at -70°C. The peptide specific antibodies were purified from the antisera by peptide affinity chromatography according to the manufacturer's protocol. The Ddras " , DdrasG * 170  184  172  186  and D d r a p l  169-183  specific peptides (4 mg) were each  coupled to 2 mis of activated thiol-sepharose 4B (Pharmacia, Montreal, Canada) in PBS pH 7.2 for 48 hours at room temperature with gentle agitation. Each of the peptide conjugated resins were passed through Bio-Rad disposable columns and the eluate was monitored at A210 to determine the amount of bound peptide. Approximately 80% of each of the peptides bound to the resin. The columns were precycled with 5 bed volumes of 0.1 M glycine pH 2.5 and reequilibrated with 5 bed volumes of PBS pH 7.2. The three rabbit antisera (antiDdras " , anti-DdrasG 170  184  172-186  and anti-Ddrapl " ) were passed through a 169  183  0.22 um filter and then added to its respective peptide column. The columns were capped, rocked gently for 4 hours at room temperature and then washed with 10 bed volumes of PBS pH 7.2. The bound antibodies were eluted with 0.1 M glycine pH 2.5, 0.15 M NaCl and collected in 0.5 ml fractions. Each of the fractions was neutralized immediately by the addition of 50 ul of 1 M Tris-HCl pH 8.0. The fractions were monitored at A28O  a n  d the peak fractions were  pooled and dialyzed against PBS pH 7.2 overnight at 4°C.  45 2.10 Preparation of antisera directed to Ddras, DdrasG and Ddrapl glutathione Stransferase fusion proteins  A set of pGEX based vectors (Smith and Johnson, 1988) were designed that expressed the Ddras, Ddras " , DdrasG and Ddrapl cDNAs as glutathione S60  187  transferase (GST) fusion proteins in E. coli. Each of the cDNAs were cloned in the appropriate reading frame into the pGEX vectors as shown in Figure 28 and the correct constructions were verified by restriction endonuclease mapping and sequence analysis of the fusion junction (in collaboration with R. Pachal). The GST-Ddras " , GST-DdrasG and GST-Ddrapl fusion proteins were purified by 60  187  a modification of a previously published procedure (Koland, et al, 1990). Cultures containing E. coli cells harbouring each of the pGEX-Ddras " 60  187  pGEX-  DdrasG and pGEX-Ddrapl vectors were grown to late log-phase in 500 mis of LB medium supplemented with 100 ug/ml of ampicillin at 37°C. Fusion protein expression was induced by the addition of IPTG to a final concentration of 1 mM. The pGEX-DdrasG and pGEX-Ddrapl expressing cells were harvested by centrifugation at 4,500xg for 10 minutes 2 hours later. The pGEX-Ddras " 60  187  expressing cells were harvested after a 4 hour incubation at room temperature following induction, since the GST-Ddras fusion protein was found to be more stable under these conditions (R. Pachal, unpublished observations). The cells were resuspended in 10 mis of buffer A (50 mM Tris-HCl pH 7.5, 0.5 mM EDTA, 300 mM NaCl, 5 mM DTT, 1 mM PMSF and 1 mg/ml lysozyme) and incubated for 10 minutes on ice. Triton X-100 was added to a final concentration of 1%, the suspension sonicated for 15 seconds and then incubated on ice for an additional 5 minutes. The suspension was then centrifuged for 15 minutes at 15,000xg. The high speed supernatant was then mixed with 2 ml of reduced glutathioneagarose (Sigma, St. Louis, USA) in buffer B (20 mM Hepes pH 7.4, 25mM NaCl,  46 0.05% Triton X-100,10% gylcerol (v/v)) and rocked gently for 1 hour at 4°C. The mixture was collected in a Bio-Rad 10 ml disposable column and washed with 5 mis of buffer B. The recombinant proteins were eluted with 5 succesive 0.5 ml volumes of buffer B supplemented with 5 mM reduced-glutathione (Sigma) and fractions containing significant protein concentrations were pooled and frozen at -70°C. The pooled fractions contained predominantly the recombinant fusion proteins as assayed by SDS-polyacrylamide gel electrophoresis (PAGE). Approximately 100 |ig of each of the three recombinant GST fusion proteins was mixed 1:1 with complete Freund's adjuvant and injected into New Zealand White rabbits subcutaneously. The injection schedule was identical to the peptide conjugate immunizations except complete Freund's adjuvant was used during each injection. The antibodies directed to the GST portion of the fusion protein were adsorbed from each of the antisera by incubation with purified GST coupled to glutathione-agarose. Similarily antibodies that recognized more than one of the recombinant proteins were removed by adsorption with the appropriate recombinant proteins coupled to glutathione agarose. Briefly, the GST-Ddras  60-187  antisera (10 mis) was incubated with glutathione-agarose beads  coupled to the GST, GST-DdrasG and GST-Ddrapl fusion proteins (1 ml of each) and rocked gently overnight at 4°C. Similar protocols were used for the GSTDdrasG and Ddrapl antisera. The various antisera were then collected after centrifugation at 700xg and stored at -70°C.  2.11 Immunoblot analysis of the Ddras, DdrasG and Ddrapl specific antisera  The specificity of the various polyclonal antisera was determined by immunoblot analysis with the recombinant GST fusion proteins. Crude lysates of E. coli cultures carrying the recombinant plasmids, pGEX-Ddras, pGEX-  DdrasG, pGEX-Ddrapl and the parental pGEX plasmid were prepared after induction for 60 minutes with 1 mM IFTG at 37°C. The bacterial cells were harvested and the samples were heated at 90°C for 3 minutes in SDS sample buffer (2% SDS, 5% 2-mercaptoethanol, 10 mM Tris-HCl (pH 6.8), 10% glycerol [vol/vol], 0.001% Bromophenol blue) and then subjected to electrophoresis using the SDS-polyacrylamide, discontinous buffer system described by Laemmli (1970). The vertical gels contained a 4.5% polyacrylamide stacking gel and usually a 10% resolving gel, prepared from a stock solution of 29.2% wt/vol of acrylamide and 0.8% wt/vol of N-N'-bis-methylene acrylamide. The separating gel buffer consisted of 0.375 M Tris-HCl (pH 8.8) and 0.1% SDS and the stacking gel buffer contained 0.125 M Tris-HCl (pH 6.8) and 0.1% SDS. Both the separating and stacking gels were polymerized by the addition of 0.1% ammonium persulfate and 0.01% N,N,N ',N'-tetamethyl-ethylenediamine. The electrophoresis buffer (pH 8.3) contained 0.025 M Tris, 0.192 M glycine and 0.1% SDS. The solubilized protein samples were subjected to electrophoresis at 100 volts through the stacking gel and 130 volts through the separating gel. Prestained molecular weight standards (Bio-Rad Laboratories, Mississauga, Canada) were also electrophoresed for molecular weight determinations. After electrophoresis, the separated proteins were electroblotted onto nitrocellulose (Schleicher & Schuell, 0.45 um) or Immobilon-P membranes (Millipore, Mississauga, Canada) for 1 hour at 90 volts in prechilled transfer buffer (20% methanol, 192 mM glycine, 25 mM Tris) (Towbin, et al., 1979). The filters were reacted with the rabbit polyclonal antisera using the following protocols. The filters were blocked in TBS (50 mM Tris-HCl, 150 mM NaCl, pH 7.5) containing 0.5% Tween 20 and either 10% fetal calf serum or 5% non-fat dry milk for at least 1 hour at room temperature. The filters were then rinsed in wash buffer (TBS, 0.5% Tween 20) and then incubated with the desired  antibody solution (see appropriate Figure legends for dilutions) in TBS containing 0.5% Tween 20 and either 1% fetal calf serum or 0.5% non-fat dry milk for 1 hour at room temperature or for 16 hours at 4°C. The blots were then washed 4 times for 5 minutes each in wash buffer. Two detection systems were used. The washed blots were then incubated with an alkaline phosphatase conjugated goat anti-rabbit secondary antibody (Bio-Rad) diluted at 1:3000 in TBS/0.5% Tween 20 for 1 hour at room temperature. The blots were then washed as described previously and then developed for alkaline phosphatase activity in 100 mM Tris-HCl (pH 9.5), 100 mM NaCI, 50 mM MgCl , 0.16 mg/ml 2  5'bromo-4'chloro-3'indoyl phosphate and 0.33 mg/ml Nitro Blue Tetrazolium for approximately 5-15 minutes. Alternatively, the washed blots were incubated with a horseradish peroxidase donkey anti-rabbit secondary antibody diluted to 1:30,000 in TBS containing 0.5% Tween 20 and 1% non-fat dry milk for 1 hour at room temperature. The blots were then washed as before and developed with the enhanced chemiluminescence (ECL) Western blotting detection system (Amersham, Oakville, Canada) according to the manufacturer's specifications. The blots were then exposed to X-ray film for 1 minute. The detection method used is indicated in the appropriate figure legends.  CHAPTER 3 3.0 EVIDENCE FOR ADDITIONAL RAS-RELATED GENES IN D. DISCOIDEUM  3.1 Introduction As stated in the general introduction Southern blot analysis of genomic DNA indicated that D. discoideum possessed a single ras gene, Ddras. The Ddras gene was predominantly expressed in pseudoplasmodial cells, although a small amount of Ddras mRNA was also detected in vegetative cells (Reymond, et al, 1984). In contrast, the maximal levels of ras protein was found in vegetative and early developing cells (Pawson and Weeks, 1984; Pawson, et al, 1985; Weeks and Pawson, 1987). One explanation is that the vegetative Ddras mRNA is extremely unstable but efficiently translated. Alternatively the high rates of ras protein synthesis in vegetative cells might be an artifact of the in vivo labelling technique. However, it is possible that like most other eukaryotic organisms, D.  discoideum has multiple ras genes. The experiments described in this chapter suggest the possibility that there are additional ras-related genes within the D discoideum genome that could account for the differences in the expression of the Ddras mRNAs and ras protein synthesis during development.  50  3.2 Results 3.2.1 In vitro translation of D. discoideum mRNA from various stages of development To address the concern that the high rates of ras protein synthesis were artifacts of the labelling procedure, polyadenylated mRNA was isolated from vegetative cells and from cells at various stages of development. The resulting mRNA was in vitro translated using the rabbit reticulocyte lysate system (Pelham and Jackson, 1976) and the resulting translation products were immunoprecipitated with the Y13-259 monoclonal antibody (Furth, et al, 1982). Considerably more ras protein was translated from vegetative and early developmental mRNA relative to that from the subsequent stages of differentiation (Figure 5). These results more closely resemble the developmental pattern of the in vivo ras protein synthesis, however, the marked increase in ras protein synthesis during the pseudoplasmodial stage was more pronounced in vivo than in vitro. These results suggest that either the mRNA detected by the Ddras cDNA (Ddras-cl) is translated more efficiently in vegetative cells than in pseudoplasmodial stage cells, or that the vegetative and early developing cells contain an additional mRNA species expressed from a differentras-relatedgene.  3.2.2 Analysis of ras mRNA using the Ddras cDNA under conditions of high and low stringency Samples from the same preparations of mRNA used in the in vitro translation study were subjected to Northern blot analysis to determine if the Ddras-cl cDNA could detect an additional ras mRNA species from vegetative  5 1 Figure 5. In vitro translation of mRNA isolated from D.discoideum V12-M2 cells at various stages of development. Messenger RNA (0.5 Lig) from the indicated developmental times (hours) was translated in a messengerdependent rabbit reticulocyte lysate. The synthesized products were immunoprecipitated with the ras specific monoclonal antibody, Y13-259, and the immunoprecipitates were analyzed by electrophoresis using a 10% polyacrylamide gel. Lane C represents the products of in vitro translation in the absence of mRNA. The gel was treated with En Hance (NEN), dried and used to expose X-ray film for 5 days. Molecular weight standards (kd) are indicated by the small arrows and the large arrow indicates the position of the ras protein ( 23/p24). 3  P  C O  66>*  4  8  12 16  cells under low stringency conditions. When Northern blots containing mRNA isolated from various stages during development were hybridized with the Ddras-cl probe under conditions of high stringency (Figure 6a), the results confirmed the previously published analysis of Reymond et al, (1984). However, when the same Northern blot filter was probed under low stringency conditions considerably more vegetative mRNA was detected, but there was no substantial increase in the amount of pseudoplasmodial mRNA detected (Figure 6b). The background signal on the blots remained relatively low and no other bands were apparent at low stringency. Since the relative intensities of the pseudoplasmodial mRNAs were not significantly altered under the low stringency conditions, the increased hybridization to the vegetative messages suggested the presence of a specific ras mRNA(s) in vegetative cells that is not encoded by the previously characterized Ddras gene. 3.2.3 Analysis of genomic DNA using Ddras-cl under conditions of low stringency Since additional ras mRNA species were detected in RNA samples isolated from vegetative cells using Ddras-cl under low stringency conditions, a Southern blot analysis of D. discoideum DNA should reveal evidence for additional ras genes if probed under the appropriate low stringency conditions. A Southern blot of D. discoideum genomic DNA, that had been digested with the restriction endonucleases EcoRI or Hzndlll was probed with Ddras-cl cDNA. Under high stringency conditions the Ddras-cl cDNA probe detected a genomic fragment of 5.5 kb when the DNA was digested with EcoRI and a 7.0 kb fragment when digested with HindUL. These bands corresponded to those described by Reymond et al, (1984). However, under low stringency conditions  53 Figure 6. Northern blot analysis of Ddras mRNA expression during D. discoideum development. Samples (5 ug) of the same mRNA used in the experiment described in Figure 5 were separated on a 1.25% formaldehydeagarose gel, transferred to nitrocellulose and then probed with randomly labelled Ddras-cl cDNA. The filter was washed under (A) high stringency conditions and (B) low stringency conditions (see Materials and Methods). The arrows indicate the positions and approximate sizes (kb) of the two mRNA species. The Ddras-cl cDNA was kindly provided by Drs. C. Reymond and R. Firtel.  54 Figure 7. Southern blot analysis with the Ddras cDNA. Genomic DNA (5 (ig), from strain Ax-2, was digested with either EcoRI (lane E) or HindTH (lane H), size-fractionated by electrophoresis on a 0.8% agarose gel and then transferred to nitrocellulose. The filter was probed under low stringency conditions with labelled Ddras-cl. The large arrows indicate the positions of strongly hybridizing fragments that were also detected under high stringency conditions. The small arrows indicate the positions of weakly hybridizing fragments.  E  H  • • •  4  •  4  •  •  •  55  several additional weakly hybridizing fragments were detected, suggesting the existence of multipleras-relatedsequences in D. discoideum (Figure 7). 3.3 Discussion  The results described above suggest the possibilty that the high level of ras protein synthesis observed in vegetative cells is due to arasgene, distinct from Ddras and might explain why Reymond et al, (1984) found the expression of Ddras mRNA to be so variable in vegetative cells. When Reymond et al, (1984) probed Southern blots of D. discoideum genomic DNA with Ddras-cl under high stringency conditions only single genomic fragments were observed with enzymes that did not cut within the portion of the gene complementary to the probe. When the Southern blots were probed with a 3.2 kb genomic clone that contained the Ddras gene the same hybridizing fragments were observed plus a number of weakly hybridizing fragments (Reymond, et al, 1984). The authors suggested that these weakly hybridizing bands could be attributed to a sequence in the genomic clone that has sequence similarity to a repeated sequence in the D. discoideum genome. This possibility was reasonable since the non-coding regions of D. discoideum genes contain long stretches of adenine and thymine nucleotide residues (Kimmel and Firtel, 1983). However, when the Ddras cDNA was used to probe Southern blots under low stringency conditions at least five weakly hybridizing bands were detected in addition to the cognate gene (Figure 7). These weakly hybridizing bands could representrasgenes that have a sufficiently divergent nucleotide sequence to prevent hybridization under high stringency conditions or alternatively, represent less related members of the ras gene superfamily that have been isolated from other organisms (Chardin, 1988).  Since the Ddras-cl cDNA corresponds to the more divergent C-terminal half of the ras-related proteins, it is more likely that the additional fragments represent highly related ras genes. In addition, vegetative cells contain a mRNA that was efficiently translated into ras protein specifically immunoprecipitated by the ras specific monoclonal antibody Y13-259 (Figure 5). The fact that the Y13-259 monoclonal antibody is very specific for ras proteins (Furth, et al, 1982) further suggests that that at least one of the weakly hybridizing genomic fragments represents a highly related ras gene.  57 CHAPTER 4 4.0 ISOLATION AND CHARACTERIZATION OF A SECOND RAS GENE FROM D. DISCOIDEUM 4.1 Introduction  The data presented in the previous chapter suggested that there was at least one additional ras gene in D. discoideum that could be detected by the Ddras cDNA under low stringency conditions. In this chapter the isolation and characterization of cDNAs corresponding to a second ras gene from D.  discoideum is described. 4.2 Results  4.2.1 Isolation of ras-related cDNAs Since the Y13-259 monoclonal antibody is very specific for the ras proteins (Furth, et al, 1982), this antibody could have been used to screen a cDNA expression library constructed from vegetative cell mRNA. However, although the antibody immunoprecipitated the ras proteins from D. discoideum cell-free extracts (Pawson and Weeks, 1984; Pawson, et al, 1985), many additional proteins were also detected (Figure 5). The antibody also detected many crossreacting proteins when used to probe Western blots of vegetative cell lysates. A similar result was obtained when the Yl3-259 antibody was used to probe S.  cerevisiae cell lysates by Western blot analysis (R. Deschenes personal communication). These results indicated that the Y13-259 antibody would have been insufficiently specific to screen a cDNA expression library.  The fact that the Ddras cDNA detected additional bands on genomic Southern blots and a large amount of ras message in vegetative cells under low, but not under high stringency conditions suggested an alternative screening procedure. Recombinant cDNA clones isolated from a cDNA library made from vegetative cell mRNA that hybridized at low stringency but not under high stringency conditions should represent additional ras-related genes. This screening procedure was initiated by Dr. G. Weeks while he was visiting Dr. J. G. Williams' laboratory (Imperial Cancer Research Fund, England). A  XgtlO cDNA library prepared from mRNA isolated from growing cells of D. discoideum, (kindly provided by Drs. S. Rosejohn and W. Rowekamp, Heidelberg, Germany) was screened with the Ddras-cl clone under low stringency conditions. Approximately 100 clones were isolated that hybridized when the filters were washed under low stringency conditions but failed or showed a reduced hybridization signal when washed under high stringency conditions (see Materials and Methods). These XgtlO isolates were then brought back to U.B.C. where they were plaque purified and rescreened with the Ddras-cl clone under low stringency conditions. Several recombinant phage with the strongest hybridization signals were selected. DNA from several of the recombinant phage and the Ddras-cl cDNA clone were digested with EcoRI, separated on an agarose gel and then transferred to a nitrocellulose membrane. The resulting filter was then hybridized with the Ddras-cl clone under both low and high stringency conditions. The Ddras-cl clone hybridized under both low and high stringency conditions, as expected, whereas the A,gtl0 recombinant clones only hybridized under low stringency conditions. Three of the ^gtlO recombinant phage (c3, cll and c23) were selected for further analyses.  59 Figure 8. Cross-hybridization between the c3, c l l and c23 cDNA clones and the Ddras-cl cDNA. The c3, cll, c23, Ddras-cl and yeast RAS1 cDNA inserts were isolated and equal concentrations (25 ng) were size-fractionated by electrophoresis on agarose gels (lanes 1-5, respectively). The DNA was transferred to nitrocellulose membranes, and the filters were hybridized with either randomly labelled (a) Ddras-cl, (b) c3, (c) cll or (d) c23 cDNAs. (A) The filters were washed under low stringency conditions and used to expose X-ray film for 1 hour. (B) The filters were then washed under high stringency conditions and used to expose X-ray film for 4 hours (see Materials and Methods for the wash conditions).  1 2 3 4 5 a  1 2 3 4 5 b  To address the question of whether the c3, c l l and c23 cDNA clones represented the same gene, the ability of the individual clones to cross-hybridize to each other was tested. Four Southern blots containing equal concentrations of the c3, c l l , c23, Ddras-cl and Yeast RAS1 cDNAs were hybridized with either the c3 clone, c l l clone, c23 clone or Ddras-cl clone (Figure 8). The blots were washed both under low stringency (Figure 8A) and under high stringency conditions (Figure 8B). With the exception of the yeast RAS1 cDNA all of the clones hybridized under low stringency conditions irrespective of the cDNA that they were probed with (Figure 8A) confirming the previous results and indicating that they were closely related genes. The c3, c l l and c23 cDNAs hybridized to each other even under high stringency conditions (Figure 8B) suggesting that they were derived from the same mRNA and thus represented the same gene. Interestingly, only the c3, c l l and c23 detected the yeast RAS1 cDNA providing further evidence that they represented an additional ras gene (Figure 8A). 4.2.2 Sequence analysis of the c3, c l l and c23 cDNA clones Purified DNA from the three recombinant phages was subcloned into the M13 phage and the sequence was determined by the dideoxy chain termination method (Sanger, et al, 1977) using modified T7 polymerase (Sequenase, United States Biochemical, Cleveland, Ohio). Sequence analysis revealed that all three clones were derived from the same gene confirming the cross-hybridization data. The strategy used to derive the sequence of the entire coding region of the gene is shown in Figure 9. The c3 cDNA was digested with Hindlll yielding a 500 bp fragment which was then subcloned into M13mpl8 to allow the complete sequencing of both strands. The nucleotide sequences of the three clones were  61 Figure 9. Sequencing strategy for DdrasG using three independent cDNA clones, DdrasG-c3, DdrasG-cll and DdrasG-c23. DdrasG-c3a is a subcloned fragment of DdrasG-c3 obtained after cleavage at a Hmfl*III restriction site. Arrowed lines indicate the direction and length of the portions of each clone that was sequenced. The hatched bar represents the single open reading frame within the DdrasG gene. The region complementary to the synthetic oligonucleotide (nucleotides 300-320) that was used for confirmation of the nucleotide sequence is marked with an asterisk.  ~7—r  J- J- J-  r r r 7  7-7-  DdrasG-c3  DdrasG-c3a B9BB  DdrasG-c11 DdrasG-c23  100 bps  62 aligned to yield a total sequence of 907 nucleotides. The overlapping sequences of the three clones were identical suggesting that there were no sequence anomalies during the synthesis of the cDNAs. There was a single open reading frame of 570 bps and the approximately 800 bp c3 cDNA clone contained the entire coding region of the gene. The AUG intiating codon is preceded by a stretch of six adenine nucleotides which is common for many D. discoideum genes (Kimmel and Firtel, 1983). The coding region terminates with a UAA codon, the most preferred stop codon used in D. discoideum genes (Sharp and Devine, 1989). The 3' end of the c3 cDNA contained a long stretch of adenine nucleotides which could potentially represent the poly A tail, although noncoding regions of D. discoideum genes often contain long homopolymer stretches of adenine nucleotides. The nucleotide sequence of the coding region of the isolated cDNAs is shown in Figure 10 along with the previously published sequence of Ddras. There are numerous nucleotide differences along the entire length of the gene, suggesting that the two cDNAs were not derived from the alternative splicing of a single ras gene. The deduced amino acid sequence of the newly isolated gene is presented in Figure 11 and compared to the amino acid sequences of other ras proteins. The high degree of sequence conservation in comparison with other ras proteins established that the new gene is a novel ras gene, the second isolated from D. discoideum. This new gene was designated DdrasG for reasons that will become evident later in this chapter. The protein encoded by the DdrasG gene is 82% conserved relative to the Ddras encoded product. The DdrasG protein shows a slightly higher degree of identity with the human ras proteins than does the Ddras protein (Figure 11, Table 2). The Ddras protein is 65% conserved relative to the three human ras proteins whereas DdrasG is 69% conserved.  63 Figure 10. Nucleotide sequence of the DdrasG coding region and comparison with that of the one previously published for Ddras (Reymond, et a/., 1984). The nucleotides are numbered relative to the start of the coding sequence. Differences in nucleotides between the two genes are denoted with an asterisk. Spaces have been introduced into the Ddras sequence to maximize alignment. The DdrasG sequence has been deposited in the EMBL/GenBank data base (accession no. J04160).  DdrasG ATGACAGAATACAAATTAGTTATTGTTGGTGGTGGTGGTGTCGGTAAAAGTGCCTTAACC 60 * * * * * Ddras ATGACAGAATATAAATTAGTTATTGTAGGTGGTGGTGGTGTTGGTAAAAGTGCATTAACA 6 0 DdrasG ATTCAATTAATCCAAAACCATTTCATTGATGAATACGATCCAACTATCGAAGATTCATAC 12 0 * * * * * * *** * Ddras ATTCAATTAATTCAAAATCATTTTATTGATGAATATGATCCAACAATTGAAGATAGTTAT 12 0 DdrasG AGAAAACAAGTTACCATTGATGAAGAAACTTGTTTATTAGATATTTTAGATACTGCTGGT 18 0 * * * * * * Ddras CGTAAACAAGTTTCAATTGATGATGAAACTTGTTTATTAGATATTTTAGATACTGCAGGT 180 DdrasG CAAGAGGAATACTCTGCAATGAGAGACCAATATATGAGAACTGGTCAAGGTTTCCTTTGT *** * * ** * Ddras CAAGAGGAATATAGTGCAATGAGAGATCAATATATGAGAACTGGTCAAGGATTTTTATGT  24 0 24 0  DdrasG GTCTACTCTATCACTTCAAGATCATCATTTGATGAAATTGCATCATTCCGTGAACAAATT 3 00 * * * * * * ** * Ddras GTTTATTCAATTACATCAAGATCATCATATGATGAAATTGCATCATTTAGAGAACAAATT 3 00 DdrasG CTTAGAGTTAAGGATAAGGATAGAGTACCAATGATTGTCGTTGGTAACAAATGCGATTTG * * * * * * * * * * * Ddras CTAAGAGTTAAAGACAAAGATAGAGTACCATTGATTTTGGTTGGTAATAAAGCAGATTTG  3 60 3 60  DdrasG GAATCTGATCGTCAAGTCACAACTGGTGAAGGTCAAGATTTAGCAAAATCCTTCGGTAGT 420 *** * * ******* ** * **** ******** Ddras GATCATGAACGTCAAGTTAGTGTAAATGAAGGTCAAGAACTTGCAAAGGATTCATTGTCC 420 DdrasG CCATTCCTTGAAACCTCTGCCAAGATTCGTGTCAACGTTGAGGAAGCTTTCTATTCACTC 4 8 0 * * ** * * * * * ** * * * * * * * * * * Ddras TTTCATGAGTCATCTGCTAAAAGTAGAATTAATGTTGAAGAGGCATTTTACTCTTTA 477 DdrasG GTACGTGAAATCAGAAAAGACCTCAAGGGTGACTCTAAACCAGAAAAAGGCAAGAAGAAG ~~~ * * * * * ***** *** ** *** * * Ddras GTTCGTGAAATTAGAAAAGAACTAAAAGGTGATCAATCAAGTGGCAAAGCTCAAAAAAAG  54 0  DdrasG AGACCATTAAAAGCTTGTACTCTTTTATAA ***** **** Ddras AAAAAACAA TGTTTAATTTTATAA  57 0  53 7  561  65 Figure 11. Comparison of the derived amino acid sequence of the DdrasG protein with the sequences of the other D. discoideum ras protein (Ddras), the three human ras proteins (Ki-ras2, Ha-rasl and N-ras), a Drosophila ras protein (Dras), and the yeast RAS proteins (Yerasl andYeras2). The DdrasG protein is numbered and the other ras proteins are aligned relative to it, with gaps inserted to maximize identity. A dash indicates identity with the DdrasG protein and only the amino acids that differ are indicated. The two series of dots represent the positions of additional residues present in the yeast RAS proteins. The triangle indicates the conserved cysteine residue, which is posttranslationally modified. The circles in the region 137-145 indicate amino acids conserved between the DdrasG protein and the human ras proteins but differ in the Ddras protein. Solid circles indicate identity, while the open circle indicates chemical similarity. The sequence of the ras gene products have been taken from the following publications (Capon, et al, 1983; McGrath, et ah, 1983; Neuman-Silberberg, et ah, 1984; Powers, et ah, 1984; Reymond, et ah, 1984). Amino acid are identified by the single letter code as follows: A, alanine; C, cysteine; D, aspartic acid; E, glutamic acid; F, phenylalanine; G, glycine; H , histidine; I, isoleucine; K, lysine; L, leucine; M, methionine; N, asparagine; P, proline; Q, glutamine; R, arginine; S, serine; T, threonine; V, valine; W, tryptophan; Y, tyrosine.  DdxA_.G  10  20  30  M T E Y K L V I V G G G G V G K S A L T I Q L I Q N H F I D E Y D P T I E D  Ddxaa  _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _  c-Ki-taa.2  - - - - - - - V - - A - - - - - - - - - -  1  - - - - - - V - - - - - - - - -  c-Ha-xaal - - - - - _ - v - - A - - - - - - - - - - - - - - - - - v - - - - - - - - c-N-xaa. - - - - - - - v - - A - - - - - - - - - - - - — Dxaa - - - - - _ - v - - p - - - - - - - - - - - - - - - - - v - - - - - - - - Yexaal ...IR - I - V _ _ _ _ _ SY -V -G Yeraa2 ...IR I - V _ _ _ _ _ _ _  ___v--------:  F  T  DdxaaG Ddxaa c-Ki-j___.2 c-Ha-xaal c-N-xaa Dxaa Yexaal Yeraa2 DdxaaG Ddxaa C-Ki-£a_.2  40  50  60  - - - - - - V - - G - - - - - - - - - - - - - - - - - - - - - - - - - - - E  _ - _ - - _ v - - G - - - - - - - - -- - - - - - - -- - - -- -- -- -E _ - _ _ - _ V - - G - - - - - - - - - - - - - - - - - - - - - - - - - - - E - -- - - - R s - - G --------------------------E — -v D K V S I - E E V  D - V S I -  80  90  100  N - E  110  _ _ _ _ _ _ _ _ _ _ _ _ _ Y - - - - - - - - - - - - - - - - - - - - L - L - - - - - F A - N N T K - - E D - H H Y - - - - K - - " - - S E D - - - V L - - - - - F A - N N T K - - E D - H Q Y - - - - K - - - - S - D - - - V L -  - - - - - F A - N N T K - - A D - N L Y - - - - K - - - - S - D - - - V L -  - - - L - F A - N - A K - - E D - G T Y - - - - K H - - - A E E - - - V L A  Yexaal Yex_l_.2  - - - L - - - V - - - N - - - - L L - Y Y Q - - Q - - - - S - Y I - V V - - - - L - - - V - - - N - - - - L L - Y Y Q - - Q - - - - S - Y I - V V - -  120  130  •  •  •  •  O  150  G N K C D L E S D R Q V T T G E G Q D L A K S F G S P F L E T S A K I R  V  - - - A - - D H E - - - S V N - - - E - - - D S L - - - - - p _ _ _ _ _ - _ _ Y - I  I Q  S  - - - - - -  A  A  p _ _ _ _ _ _  A  S  T  _ T  K  E  S  R  Q  _  T  _  D  _  K  N  _  N  N  E  T  W  _  D  Q  Q  A  A  -  Q A  R  A R  H  E  -  V  -  R  -  Y  -  _ _ _ _ y _  E  -  -  Q  Y  -  I  I I  -  - H - S - - - S - I - - - - - T -  -  Y  _ _ Y  I  I  -  -  -  -  _ _ _ _ _  I  -  -  -  -  -  T  T  T  -  Q  _  Q  -  M  - - - - - - - N E - - - S Y E D - L R - - - Q L N A - - - - - - - - Q A I N - - - S - - - N E K - - S Y Q A - L . N M - - Q M N A - - - - - - - - Q A I N  160  DdxaaG Ddxaa  - E - -  G F L C V Y S I T S R S S F D E I A S F R E Q I L R V K D K D R V P M I V V  D_aa  c-Ha-xaal  70  _ - - - _ _ s - - D - - - - - - - - - - - - - - - - - - - - - - - - - -  C-N-_aa  c-N-xaa Dxaa Yexaal Ye_a_.2  V  S Y R K Q V T I D E E T C L L D I L D T A G Q E E Y S A M R D Q Y M R T G Q  c-Ha-xaal  DdxaaG Ddxaa C-Ki-xaa2  S  170  180  N V E E A F Y S L V R E I R K D L K G D S K P E K G K K K R P - L K A - - - - - - - - -  C-Ki-_a_2  -  ' - - - - - E - - - - Q S S G - A Q - - K K Q  R - D D - - - T - - - - - - - H K E K M - - D G - K - - - K S - T K  c-Ha-iaai  G - - D - - - T - - - - - - Q H K L R K L N - P D E S G P G C M S C K G - - D - - - T - - - - - - Q Y R M K K L N S S D D G T N G C M G L P  C-N-xaa  G - D D - - - T - - - - - - - - K D N K G R R G R K M N - P N C R F K  Dx__t Yexaal  - - D - - - - - - I - L V - D - G G K Y N S M N R Q L D N T N E I R D . . .  Yetaa2  - - - - - - - T - - - - - - Q Y R L K K I S K - E K T P G C V K I K K . . .  189 DdxaaG C T LL Ddxaa -L i c-Ki-xaa.2 - V I M c-Ha-xaa2 - v - s c-N-xaa - v vM Dxaa - K MYexaal - l i e *exa_.2 - I I S T  Both of the D. discoideum ras proteins show a higher degree of amino acid conservation with the human ras proteins than with the two yeast ras proteins (Figure 11, Table 2). Over the first 81 amino acids DdrasG differed from Ddras, H-rasl and yeast RAS2 by only 2, 6, and 16 amino acids respectively, thus confirming the strong evolutionary conservation of the N-terminal region of all ras proteins (Figure 11). The C-terminal region of the ras proteins are more highly diverged and the DdrasG and Ddras proteins are only 59% identical over the last 100 amino acids. As would be expected, this is a significantly higher degree of conservation than is observed when the sequence is compared to that of ras proteins from other organisms. The DdrasG protein contains the characteristic cysteine residue four amino acids from the extreme C-terminus which in the mammalian and yeast ras proteins is involved in anchoring the proteins to the inner surface of the plasma membrane (Figure 11). 4.2.3 Southern blot analysis of the DdrasG gene To re-evaluate the number of ras genes in D. discoideum, Southern blots of genomic DNA, digested with enzymes that did not cleave within the coding region of either the Ddras and DdrasG genes, were probed with both the Ddrascl and DdrasG-c3 cDNAs. Under high stringency conditions the cDNAs detected single, unique fragments indicating that they had been derived from different genes that are present in a single copy within the D. discoideum haploid genome (Figure 12B). The Ddras gene detected a 3.2 kb EcoEI-Bglll genomic restriction fragment as previously published (Reymond, et al., 1984), whereas the DdrasG gene detected an approximately 8.0 kb EcoRI-Bglll genomic restriction fragment. When hybridized under low stringency conditions the Ddras and DdrasG cDNA clones hybridized to their cognate genes, cross-  68 Figure 12. Southern blot analysis of the D. discoideum ras genes. Genomic DNA (5 ug) from the Ax-2 strain was digested with BglTL (lane 1), EcoRI (lane 2) and Bglll/EcoRI (lane 3), electrophoresed on a 0.8% agarose gel, and then transferred to nitrocellulose. The filter was probed with labelled DdrasG-c3 (a) or Ddras-cl (b) inserts and the filters were washed under low stringency conditions (A) and then under high stringency conditions (B). The filters were used to expose X-ray film for 12 hours. Molecular sizes (kb) are shown in the middle.  69 hybridized to one another, and also hybridized weakly to a number of other fragments (Figure 12A). These weakly hybridizing bands observed under low stringency conditions may represent other ras genes and/or D. discoideum homologues of the ras gene superfamily. 4.2.4. Developmental expression of DdrasG To examine the developmental expression of the DdrasG gene, V12-M2 cells grown on bacteria were plated on filters to initiate development. Filters were harvested at 0, 4, 8,12,16 and 20 hours after the onset of development and polyadenylated RNA was isolated. The RNA samples were size fractionated on formaldehyde-agarose gels, transferred to nitrocellulose membranes and then probed with the DdrasG-c3 or Ddras-cl clones. As shown in Figure 13A two transcripts of approximately 1.2 and 0.9 kb were detected with the Ddras-cl probe under the high stringency conditions used in the Southern analysis. Both mRNAs start to accumulate subsequent to multicellular aggregation (8 hours) reaching maximal levels during the pseudoplasmodial stage of development (12-14 hours). When the same RNA samples were analyzed with the DdrasG cDNA a single mRNA of approximately 1.2 kbs was observed (Figure 13B). The DdrasG transcript was expressed during vegetative growth (0 hours) and during early development (4 hours), with an abrupt drop in transcript levels thereafter. The developmental expression accounts for the gene designation DdrasG  (Dictyostelium discoideum ras gene expressed during Growth). Depending on the stringency of the hybridization conditions there was a low level of crosshybridization of the Ddras and DdrasG genes, which was not surprising given their high degree of sequence identity. Reymond et al, (1984) suggested that the Ddras gene was expressed in vegetative cells on the basis of their Northern blot analysis. In addition, they reported the vegetative mRNA levels as being highly  70 Figure 13. Northern blot analysis of Ddras and DdrasG gene expression during D. discoideum growth and development. Poly(A) R N A (5 ug) from each of the indicated times after the onset of differentiation (hours) was separated on a 1.25% formaldehyde-agarose gel, transferred to nitrocellulose, and probed with Ddras-cl (A) or DdrasG-c3 (B). The filters were washed under high stringency conditions and used to expose X-ray film for 16 hours. The approximate sizes (kb) of the mRNAs are indicated next to the arrowheads. +  A  0 4 8 12 16 1.2 0.9  B  variable. From the result presented in Figure 13 the vegetative ras-specific mRNA observed by Reymond et al., (1984) was probably derived from the DdrasG gene. Such variability could have been the result of inconsistent levels of cross-hybridization due to slight changes in probe length and hybridization conditions, which is consistent with this interpretation.  4.2.5. Cell cycle expression of DdrasG Amoebae of the axenic strains of D. discoideum grow and divide in nutrient media in the absence of bacteria with a doubling time of approximately 8-9 hours (Watts and Ash worth, 1970). To determine whether DdrasG gene expression was cell cycle regulated the axenic strain, Ax-2, was grown under conditions which induce synchronous cell growth. The Ax-2 cells were grown in axenic medium until they reached stationary phase (2.0 x 10 cells/ml). The 7  cells were maintained in the growth media at stationary phase for an additional 14 hours at which time they were diluted in fresh axenic medium to a cell density of 1 x 10° cells/ml. Samples were collected and counted at 0, 2, 4, 5, 6, 7, and 8 hours after the dilution and total RNA was extracted. After dilution in fresh media, there was a 4-5 hour lag before the cells divided as was shown previously (Figure 14A) (Soil, et al., 1976; Jimenez, et al., 1986). Northern blots of the RNA samples were probed with the DdrasG cDNA under high stringency conditions. Although the ethidium bromide stained formaldehyde gel shown in Figure 14B reveals that different amounts of each RNA sample was loaded it is clear that the level of DdrasG mRNA did not alter significantly throughout the cell cycle (Figure 14). In agreement with the interpretation that the Ddras gene was not expressed during vegetative growth the Ddras-cl cDNA did not detect any mRNA when used to probe the Northern blot presented in Figure 14 (data not shown).  72 Figure 14. The expression of DdrasG and the ras-related gene, Ddrapl during synchronous cell growth. (A) Ax-2 cells were grown in axenic media to stationary phase and then diluted to a cell density of 1.1 x 10 cells/ml (0 hours) and the cell number was determined at the times indicated (hours) by haemocytometer counting. The cell number plotted represents the average from two cell counts. (B and C) Total RNA was isolated from cells at the indicated times (hours) and subjected to Northern blot analysis. The filter was hybridized with either (B) DdrasG-c3 or (C) Ddrapl-c51 under high stringency conditions. The panel above each the Northern blots (B and C) shows the ethidium bromide stained gels before transfer to nitrocellulose. After removal of the hybridized probe, the filters were hybridized with Ddras-cl but no mRNA was detected. 6  4.3 Discussion  Evidence has been presented for the existence of a second D. discoideum ras gene, DdrasG. Most other eukaryotic organisms possess more than one ras gene (Barbacid, 1987) and therefore D. discoideum is no exception. Both the Ddras and DdrasG proteins have features that are characteristic of other ras proteins (Figure 11). The amino half of the two proteins are over 90% conserved but the carboxyl region is variable with the exception of the tetrapeptide sequence at the extreme terminus. Both proteins contain the four highly conserved domains (amino acids 10-16, 57-62, 116-119, 143-147) that in mammalian ras proteins are associated with guanine nucleotide binding and GTPase activity (Figure 11) (Feig, et al, 1986; Willumsen, et al, 1986; Clanton, et al, 1987; Feig, et al, 1987). When the Ddras and DdrasG cDNAs were expressed in a bacterial expression system the two proteins were able to bind guanine nucleotides specifically (R. Pachal, unpublished observations) and thus it is not unreasonable to assume that the endogenous proteins also bind guanine nucleotides. In addition the D.  discoideum ras proteins contain the effector domain (amino acids 32-40) which in mammalian proteins is believed to interact with the GTPase activating molecule (GAP) which modulates the GTPase activity of the ras proteins (Adari,  et al, 1988; Cales, et al, 1988). The presence of the effector domain suggests the possible existence of a GAP-like molecule in D. discoideum. The mammalian ras proteins are attached to the inner surface of the plasma membrane. In order for the ras proteins to attach to the plasma membrane there is a series of post-translational modifications which involve the conserved tetrapeptide sequence at the C-terminus (described in the General Introduction). Both the vegetative and pseudoplasmodial proteins are attached to the plasma membrane and appear to be acylated (Weeks, et al, 1987). Both  75 the Ddras and DdrasG proteins have the conserved tetrapeptide sequence at the C-terminus which may be required for similar post-translational modifications. However, neither the Ddras or DdrasG proteins contain a cysteine residue in a position analogous to the one in the mammalian H-ras and N-ras proteins which is palmityolyated (Hancock, et al, 1989). They do however, contain a stretch of basic amino acids similar to that found in the K-ras gene product and this may be sufficient for membrane localization (Hancock, et al, 1990). The DdrasG and Ddras genes are present as single copies within the D.  discoideum haploid genome. The two genes cross-hybridize with each other under low stringency (Figures 8 and 12) presumably because of the high degree of nucleotide sequence identity (Figure 10). The DdrasG gene cross-hybridized more efficiently with Ddras and with other weakly hybridizing fragments on Southern blots (Figure 12). This can be explained by the fact that the DdrasG cDNA encodes the complete protein and therefore includes the more conserved 5' end of the coding region of the gene, whereas the Ddras cDNA does not start until nucleotide 180 of the coding sequence and the 3' sequences are more divergent (Figures 10 and 11). Clearly, the Ddras and DdrasG genes show quite distinct patterns of expression. The Ddras gene was only expressed subsequent to multicellular aggregation, while the DdrasG gene was expressed during growth and early development. The ras proteins encoded by the two genes are identical between amino acids 63-73, the region recognized by the Yl3-259 monoclonal antibody (Sigal, et al, 1986). Using this antibody in D. discoideum cell-free extracts, ras protein was detected during growth and its concentration was found to decline during development (Weeks and Pawson, 1987). The rate of ras protein synthesis also declined during early aggregation but increased transiently during the pseudoplasmodial formation (Pawson and Weeks, 1984; Pawson, et al,  76 1985). The combined expression of the Ddras and DdrasG genes could account for this protein accumulation pattern, but this does not preclude the possibility that there are other ras-related genes that encode immunologically crossreacting proteins. Although other eukaryotic organisms possess more than one ras gene, D.  discoideum is thus far unique in expressing two genes at distinct stages of development. The Ddras gene was expressed at the pseudoplasmodial stage of development as two mRNA species of 1.2 and 0.9 kb which are enriched in the prestalk cell population (Figure 13) (Reymond, et al, 1984). Induction of the 1.2 kb mRNA occurs precociously under in vitro conditions in response to the addition of cAMP. In contrast, the DdrasG gene was expressed as a single mRNA species of 1.2 kb during growth and early development (Figure 13). The amount of DdrasG mRNA increased approximately 2 fold during the first 2-3 hours of development and then declined, reaching negligible levels by the aggregation stage of development (Khosla, et al., 1990). The decline in DdrasG mRNA level required a developmentally-regulated gene product since it does not occur when the cells are differentiated in the presence of the protein synthesis inhibitor, cycloheximide. During differentiation in shake suspension DdrasG mRNA levels did not decline, unless the cells were treated with pulses of cAMP (Khosla, et al, 1990). These results suggested that the decline in DdrasG mRNA level during aggregation is a response of the cAMP relay system to pulses of cAMP. Consistent with this conclusion was the finding that the decrease in the DdrasG mRNA levels did not occur when the pulses of cAMP were applied in the presence of caffeine, an inhibitor of the cAMP signal relay response (Khosla, et al, 1990). The differential response of the Ddras and DdrasG genes to cAMP would ensure that the two genes are not expressed at the same time during development.  The differential expression of the two ras genes during D. discoideum development may reflect a requirement for the different ras proteins during growth and development. The DdrasG protein is slightly more conserved to the human ras protein than is the Ddras protein (Figure 11, Table 2). There is a region between residues 137 to 145 where the two D. discodieum ras proteins are diverged and where the DdrasG protein has a higher degree of identity with the proteins encoded by the human ras genes. Structure/function studies have shown that residues 143 to 147 form part of the guanine-base binding site of the mammalian ras proteins, and mutations in this region reduce the binding affinity for GTP (McGrath, et al, 1984; McCormick, et al, 1985; de Vos, et al, 1988). The amino acids adjoining this loop might, therefore, influence the precise function of the ras proteins. It is possible that this region is more diverged between the DdrasG and Ddras proteins because the two proteins regulate different signalling pathways; the DdrasG protein having a role in cell growth and the Ddras protein having a role in cellular differentiation. However, it is possible that as is the case in yeast the two D. discoideum ras genes perform identical functions during both growth and development. The expression of the DdrasG gene did not appear to be regulated during the cell cycle (Figure 14B). Recently Whitbread and Katz have isolated a D.  discoideum mutant that requires a factor for vegetative growth (unpublished observations). When this mutant was grown under the non-permissive conditions and then treated with the purified growth factor to induce cellular proliferation the DdrasG mRNA levels were not altered at any time after the addition of the growth factor (Whitbread, Katz and Robbins, unpublished observations). Although the DdrasG mRNA levels were not affected during the cell cycle or during the transition from quiescence to proliferation, it does not  78 preclude the possibility that the DdrasG protein is involved in control of cell growth. The mammalian ras proteins appear to play a role in regulating cellular proliferation. The microinjection of the Yl3-259 monoclonal antibody blocks the mitogenic response of NLH3T3 cells to serum stimulation (Mulcahy, et ah, 1985). The injection of the antibody at different stages of the cell cycle revealed that the ras proteins were required just prior to the intiation of the S phase after which point cells are committed to complete the cell cycle (Yu, et al, 1990). In addition trans-dominant ras-inhibitory mutant proteins (a change from Ser-17 to Asn-17 in the H-ras protein) with a preferential affinity for GDP have been found to block the mitogenic response of NIH 3T3 cells to serum stimulation (Feig and Cooper, 1988). The mammalian ras proteins appear to have a general role in growth control since the microinjection of the antibodies or the dominant inhibitory H-ras Asn-17 mutant protein block the mitogenic stimulation of a wide variety of growth factors (Cai, et al, 1990; Yu et al, 1990).  CHAPTER 5 5.0 ISOLATION AND CHARACTERIZATION OF THE GENOMIC SEQUENCES CORRESPONDING TO THE DdrasG GENE 5.1 Introduction  In view of the fact that ras genes appear to encode essential gene products, the mechanisms controlling their expression are likely to be important. The yeast  RAS1 and RAS2 genes are essential for cell growth (Kataoka, et al, 1984). The two genes are differentially expressed under a wide variety of culture conditions, but conditions that result in low amounts of the RAS gene products do not allow cell growth (Breviario, et al, 1986; Breviario, et al, 1988). It has also been shown that the experimental induction of elevated levels of ras proteins can result in the transformation of certain mammalian cell types (Chang, et al, 1982a). The differential response of the D. discoideum Ddras and DdrasG genes to cAMP would ensure that the two genes are not expressed at the same time during development. To begin to understand the molecular mechanisms controlling ras gene expression in D. discoideum it was important to analyze the genomic structure of the two genes.  80 5.2 Results 5.2.1 Isolation and sequencing of the DdrasG genomic sequences The Southern blot analysis of D. discoideum genomic DNA indicated that the DdrasG gene was present in a single copy within the genome (Figure 12). In order to isolate the DdrasG genomic sequences, purified insert from the DdrasG c3 cDNA clone was used to screen a genomic library containing D. discoideum Ax-2 nuclear DNA that was partially digested with Sau3A to give an average size of 5 kb (see Materials and Methods). Eight positive clones were isolated, plasmid DNA was prepared and was digested with a number of restriction enzymes. The DNA was size fractionated on agarose gels and analyzed by Southern blot analysis. The Southern blot of the DdrasG genomic clones was hybridized with an oligonucleotide derived from the 5' end of the coding region of the gene to determine which of the genomic clones contained the 5' end of the DdrasG gene. Only one of the eight clones, DdrasG-g5.2 hybridized to both the cDNA and the oligonucleotide and was selected for further analyses. A partial restriction map (Figure 15) of the genomic clone was consistent with the Southern blot analysis of the DdrasG gene suggesting that genomic fragment was not rearranged, a problem that has been encountered previously when D .  discoideum genomic sequences are cloned. The strategy used to determine the nucleotide sequence of the DdrasG genomic clone is outlined in Figure 15. The clone was digested into three restriction fragments and subcloned into either M13mpl8 or Bluescript (Stratagene, La Jolla, USA). Two sets of unidirectional deletion series were performed on the subclones which contained the 2.2 kbAccl fragment and the 1.8 kb EcoRI /Bglll fragment in order to sequence the 5' and 3' flanking regions of the gene respectively (Figure 15). The sequence was determined on single  81 Figure 15. Partial restriction map and sequencing strategy for the DdrasG genomic clone, DdrasG-g5.2. The DdrasG-g5.2 genomic clone was isolated from a genomic library that had been constructed with Sau3A partially digested D. discoideum nuclear DNA ligated into the BaraHI site of pAT153 (see Materials and Methods). The box at the top of the Figure is a schematic representation of the DdrasG-g5.2 clone. The black boxes represent translated sequences, open boxes represent non-coding sequences and the hatched boxes are the pATI 53 plasmid sequences. Only restriction sites that are relevant to the construction of the various subclones are shown (Abbreviations: A, AccI; E, EcoRI; B, Bg/II). The BaraHI/Sau3 A (Ba*) represents the cloning junction between the plasmid and D. discoideum sequences. The numbers below the boxed lines represent the nucleotide positions of enzyme sites, +1 indicates the location of the first nucleotide of the DdrasG coding sequence. Three subclones designated by the lines between the vertical bars, (a, b, c) were constructed; the 2.2 kb Accl fragment and the 1.8 kb Bglll/EcoRI fragment were cloned into Bluescript and the 600 bp Accl /EcoRI fragment was cloned into M13mpl8 in both orientations. Two series of unidirectional deletions were generated using exonuclease LTI for the 2.2 Accl fragment and the 1.8 Bglll/EcoRI fragment. The size and direction of the deletions are represented by the remainder of the lines between the vertical bars. The arrowed lines indicate the direction and length of the portions of each clone that was sequenced. Lines with multiple arrowheads indicate sequence determinations using oligonucleotides complementary to determined sequences.  Ba*  E  B  -1543  +1  Ba  +359  2.2 kb Accl fragment  4  +1380  Accl deletion #1 Accl deletion #2 Accl deletion #3 Accl deletion #4  1.8 kb Bglll/EcoRI fragment Bglll/EcoRI deletion #1 Bglll/EcoRI deletion #2 600 bp Accl/EcoRI fragment  ^  •  pAT153 plasmid sequences  D. discoideum non-coding sequences D. discoideum DdrasG coding sequence  E  83 stranded DNA or denatured double stranded DNA by the dideoxy chain termination method (Sanger, et al., 1977) using modified T7 polymerase (Sequenase, United States Biochemical Corp, Ohio, USA). The nucleotide sequence of the DdrasG genomic clone is shown in Figure 16 . The genomic clone isolated contained 1.6 kb of 5' upstream sequences presumably containing the promoter and regulatory sequences. The non-coding sequences contained over 85% adenine/thymine nucleotide residues which is consistent with all of the intervening sequences thus far sequenced in D.  discoideum. Within the coding region of the DdrasG gene there is a single 121 bp intron. Although D. discoideum introns are much shorter than most other eukaryotic introns they possess the conserved GT and AG dinucleotides at the extreme 5' and 3' boundaries respectively. 5.2.2 Determination of the 5' end of the DdrasG mRNA The DdrasG gene was transcribed as a single 1.2 kb mRNA during vegetative growth and early development (Figure 13). Two oligonucleotides complementary to a portion of the deduced DdrasG mRNA were used in primer extension analysis to determine the site(s) of transcription initiation. The oligonucleotide (b) sequence that was chosen was sufficiently divergent from the Ddras gene to prevent the extension of any Ddras mRNA present in the sample. Three extension products of similar size were consistently obtained when vegetative mRNA from V12-M2 cells was used (Figure 17). When these products were analyzed next to a set of dideoxy chain termination reactions performed using the same oligonucleotide and a DNA template encompassing the 5' flanking sequences of the DdrasG gene, the sites of transcription initiation could be located. The three primer extension products were mapped to 219, 220 and 234 bps upstream from the AUG initiating codon (Figure 16).  8  Figure 16. Nucleotide sequence of the DdrasG genomic clone, including 5' and 3' flanking sequences. The 5', 3* and intervening nucleotide sequences are designated by small letters and the coding region of the DdrasG is in capital letters. The numbering of the nucleotides starts with the first nucleotide of the coding region. The boxed sequences represent potential regulatory sequences that are described in the text. A potential polyadenylation signal is indicated by. a double underline. The arrowheads indicate transcription initiation sites for the DdrasG mRNA as determined by primer extension analysis using two oligonucleotide primers (a and b). The location of the oligonucleotide primers within the DdrasG genomic clone are underlined and designated.  10  1  20  |  30  1  40  |  50  |  60  a t c g c t t a a c tgaaaaaaca g c g t a g t a t g  aaatcggaaa a t c t t t t t g t  tttttatcat  -1480  aattgtcaac aattattttt catttgaaat  a t t t t g c c c a c a t c c g t g t g attgaaaaaa  -1420  aaaaaaataa taaaaatgag g g a a t a t t t t  tgggagttta taaatcttgg taattgataa  -1360  g a t t a t t a t a ataaacaaga  aatcgtgggg gagagaattc t g a a t t t t t a  -1300  g t a t a a g t t a t t t g a a a a a a aaaaaaaata  aaaaataaaa caaaaaaaat aaaataaaat  -1240  aaaataaaaa t c t t t g g a t t t g t c t g t a a t  c c t t t t t a a a ataaaactac g t a g t t t t a t  -1180  tgccaactcg cattgtttat t t a t t t a t t t  tttttttttt  tttttttcta  cttaaatttt  -1120  tttggattta t t t t t t g t t t  ttttttttat  tcttctattt  ttttacactt  -1060  ttttatttt.t  attttttttt  t t t t t t c t a a gtaatcaaac  -1000  tatttttttt  tttttttttg  tattatataa attttttttt  aaagatttta c a t t t t t t t t ttattgaatg  a a t t t c g a a t aaaaaaaaaa a a g a t a t t t t  -940  attaaatttg tctatttaat tttttgtata  aaaaaaaata a t a a a a a a t t tt-cgaaaaaa  -880  aaaaaatata aaaaattttt tcaaagattg  agtggtgcaa a a a t a g a t t t t c t a a a a c t a  -820  tttttattat  t a t c a a t t g t acaaataaaa acaaaaataa  -760  tattattatt  tatcattaat ttcaatatct  -700  t t a a a a g t a t gtaggaactt t t t t t t t t t t  c a t a c t t a t a c a t t t a a a a a aataaaaata  -640  aaaataaaaa t t t c a a a a a t a a a a a g t t t t  a a a t t t a t t t ataaataaaa t a t a t a t t t a  -580  a a t t a t t t a t t t a t a a a t a a aaataataaa  atttttattt  gtataaagaa aaaaaaaaaa  -520  aaataaaaaa aaaaataaag t a g t g a t a a a  aaaaaaataa aaaaaaaata aaaaaaaata  -460  tatattcaaa agtcattttt tgtccataac  tttttttttt  -400  tttaaacttt  tttttttttt  aaaacaaaaa  aacaaataat t t a a a a t g t a  ttgccacaaa aaaatctaca  85 Figure 16 (cont). Nucleotide sequence of the DdrasG genomic clone.  c a t g c g t t a a c t g c c a c t g g aggatacatg  aacattataa taaataacgg  tttaaaaaat  -340  ctatattttt  caattttttt ttattttttt  tattttttat tttttttttt ttattttttt  -280  ttttttttca  a a a a a t t t t t taaaaaaact  tttttttttt  ttttcttttc  -220  cacacacaca  aaacaacaat  atcactacat  t t t a t t t a t t attataaaat c c g c a t t t t t  -160  tggcattcgc aacaccccct aatcgttttt  ttatataatt tttaaatttt atataattaa  -100  a c t g t a a t a t a t t a a c a a c c cacacaaaaa  aaaaaaaaaa aaccaaatca  aattataaaa  -40  cccacacata t t t a t a t a t a acagatctta  a t t t a a a a a a ATGACAGAAT ACAAATTAGT  20  TATTGTTGGT GGTGGTGGTG  TCGGTAAAAG  : b TGCCTTAACC ATTCAATTAA TCCAAgtatg  80  t a t t a t a t t t taaaaataaa  aaaagataaa  taaaataaaa  a a a a t t a t c a caagataaga  140  ataaaatatt a a t t t t t t t t  tttttttttt  t t t a t t a t t a aaaaagAACC  200  a  aagaaattaa  ttttttattt  ATTTCATTGA TGAATACGAT CCAACTATCG  AAGATTCATA CAGAAAACAA  GTTACCATTG  260  ATGAAGAAAC  ATACTGCTGG TCAAGAGGAA  TACTCTGCAA  320  TGAGAGACCA ATATATGAGA ACTGGTCAAG - GTTTCCTTTG TGTCTACTCT ATCACTTCAA  400  GATCATCATT TGATGAAATT GCATCATTCC  GTGAACAAAT  TCTTAGAGTT AAGGATAAGG  460  ATAGAGTACC AATGATTGTC GTTGGTAACA  AATGCGATTT GGAATCTGAT CGTCAAGTCA  520  CAACTGGTGA AGGTCAAGAT  TTAGCAAAAT  CCTTCGGTAG TCCATTCCTT GAAACCTCTG  600  CCAAGATTCG TGTCAACGTT GAGGAAGCTT  TCTATTCACT CGTACGTGAA ATCAGAAAAG  660  ACCTCAAGGG TGACTCTAAA CCAGAAAAAG  GCAAGAAGAA  GAGACCATTA AAAGCTTGTA  720  CTCTTTTATA A a c a a a c t t t t t c t c a c c a a  aaaaaaaaaa aaaaaacccg a t t a t a a a a a  800  aaaaaaaata a t a a t t t a t t a a a c a t t t t a  gagagtaaat t a g a a a t a a t  aattcaacta  860  atttttttaa taaattatct ttatttattt  tttaaaaggg  tcaaaaaaaa aaaaaaaaaa  920  aaatcaaatc 10  TTGTTTATTA GATATTTTAG  agatcaat |  20  938 I  30  |  40  I  50  |  60  86 The same three extension products were observed when vegetative mRNA from Ax-2 cells was used in the analysis (Figure 17). In addition, three extension products mapped to the same positions within the DdrasG genomic clone when a second downstream oligonucleotide (a) was used as a primer (Figure 17). These results confirmed that transcription of the DdrasG mRNA initiates at three distinct sites. In agreement with the developmental expression of the DdrasG gene (Figure 13) no extension products were observed when mRNA isolated from pseudoplasmodial stage cells was used as template for the primer extension reactions (Figure 17). The 5' non-coding region of the DdrasG mRNA appears to be colinear with the genomic sequence. The DdrosG-c23 cDNA clone contained 137 bps of 5' non-coding sequence that was identical to that of the genomic clone. Within the remaining 97 bps of 5' non-coding sequence, there were no GT or AG dinucleotides which would indicate intron boundaries. These results suggest that the entire 234 bps of the 5' non-coding sequence of the DdrasG mRNA is completely colinear with the genomic clone. The 3' end of the DdrasG transcript was not mapped in this study. There is a potential polyadenylation recognition sequence in the 3' non-coding region, but it remains to be determined if it is utilized. The DdrasG-c3 cDNA clone contained a long stretch of adenine nucleotides 170 bps downstream from the TAA termination codon, but these sequences are colinear with the genomic clone suggesting that the end of the transcript is further downstream.  87 Figure 17. Determination of the DdrasG transcription initiation sites by primer extension analysis. Two oligonucleotide primers (a) and (b) that were complementary to overlapping sequences of the DdrasG gene (Figure 16) were end-labelled, annealed with mRNA (2|ig) and extended with AMV reverse transcriptase. The (a) oligonucleotide primer was used to extend V12-M2 mRNA isolated from (lane 1) vegetative and (lane 2) pseudoplasmodial cells. Primer extension reactions with oligonucleotide (b) were carried out with (lane 3) mRNA from V12-M2 vegetative cells, (lane 4) mRNA from Ax-2 vegetative cells, (lane 5) mRNA from V12-M2 aggregating cells and (lane 6) mRNA from V12-M2 pseudoplasmodial cells. The DdrasG-g5.2 (2.2 Accl) genomic subclone (see Figure 15) was sequenced (T,G,C,A) with either the (a) oligonucleotide or (b) oligonucleotide as primers. Part of the nucleotide sequence of the DdrasG sequence is shown, the arrowheads mark the sites of transcription initiation. The more intense primer extended product is actually two products that can be distinguished by a shorter exposure.  88  89 5.3 Discussion A genomic clone was isolated that contained the DdrasG gene. Comparison of the genomic sequence with that of the DdrasG cDNA indicated that the DdrasG gene contains a single intron (Figure 16), whereas the highly related Ddras gene contains three introns (Reymond, et ah, 1984). The location of the first intron in Ddras corresponds to the exact position of the single intron in DdrasG. However, the sequence and size of the introns are not strictly conserved. The conserved position of the intron suggests that the gene duplication event resulting in the Ddras and DdrasG genes probably occurred after the insertion of the first intron. The other two introns might have been added to the Ddras gene or deleted from the DdrasG gene depending on the structure of the ancestral gene. As is the case for many eukaryotic genes that are transcribed by RNA polymerase II, D. discoideum genes usually contain a conserved sequence, the TATA box located 25-35 bps upstream from the site of transcription initiation. In addition, D. discoideum promoters usually contain a stretch of thymine residues located just downstream from the TATA box (Kimmel and Firtel, 1983). The DdrasG gene does contain a stretch of thymine residues upstream from the initiation of transcription but does not contain the TATA box sequences (Figure 16). Interestingly, the promoter regions of the mammalian K-  ras, N-ras and H-ras genes also lack the characteristic TATA box (McGrath, et ah, 1983; Hall and Brown, 1985; Ishii, et ah, 1985). In addition the mammalian ras genes possess multiple transcription initiation sites and multiple copies of the hexanucleotide sequence CCGCCC (GC box) or its inverted complement, that have been shown to bind the transcription factor SP1 (Ishii, et ah, 1986; Damante, et ah, 1987; Hoffman, et ah, 1987; Honkawa, et ah, 1987). It has been  90 suggested that these sequences are involved in the regulation of growth control genes and they are required for the transcription of the H-ras gene (Ishii, et al, 1986). Primer extension analysis demonstrated that the DdrasG gene contains multiple transcription intiation sites (Figure 17). There is also a fairly GC rich region located approximately 150 bps upstream from the transcription initiation sites, however, it does not contain the GC box consensus sequence. These sequences may be required for the regulation of DdrasG gene expression, however, a transcription factor analogous to SP1 has not yet been identified in D. discoideum. Regulatory sequences have also been found in the first (Spandidos and Pintzas, 1988) and fourth (Cohen and Levinson, 1988; Cohen, et  al, 1989) introns of the H-ras gene. It will be interesting to determine whether there are sequences within the introns that play a role in the transcriptional regulation of the Ddras and DdrasG genes. Our laboratory has demonstrated that the levels of DdrasG mRNA decline in response to pulses of cAMP (Khosla, et al, 1990). Molecular analysis has identified the cis-acting sequences required for the induction of a number of cAMP regulated D. discoideum genes (Pears and Williams, 1987; Datta and Firtel, 1988; Pears and Williams, 1988; Pavlovic, et al, 1989), as well as a developmentally regulated trans-acting factor that controls the expression of the cAMP-inducible early prestalk genes (Hjorth, et al, 1989; Hjorth, et al, 1990). However, little information is known about the molecular requirements for the down regulation in response to cAMP. Recently Vauti et al, (Vauti, et al, 1990) have used a promoter analysis vector to define a 79 bp element within the discoidin Iy promoter that is necessary for the down regulation of gene expression in response to cAMP. It does not appear that the DdrasG promoter has this 79 bp element but a sequence comparison is very difficult because of the  91 high content of adenine and thymine nucleotides within the 5' flanking sequences and it is not known which portions of the sequence within the 79 bp element are required for the proper regulation. More genes that are negatively regulated in response to cAMP will need to be analyzed to determine if there are conserved regulatory sequences. Sequences responsible for the regulation and expression of a number of D.  discoideum genes have been delineated to within the first 1 kb of 5' flanking sequences. Previous results indicated that 550 bps of the 5' flanking region of the Ddras gene confers the proper temporal and spatial regulation when fused to a reporter gene (Reymond, et al, 1985). With the isolation of the DdrasG genomic clone that contains over 1 kb of 5' upstream sequences it should be possible to define the sequence elements required for the proper regulation of the DdrasG gene. The DdrasG promoter and putative regulatory sequences are now being used to express an activated DdrasG gene in D. discoideum to examine the effect on the developmental phenotype (R. Thiery, studies in progress).  92 CHAPTER 6 6.0 ABERRANT EXPRESSION OF THE DdrasG GENE IN THE AXENIC STRAIN, AX-2  6.1 Introduction  DdrasG mRNA levels decline in response to pulses of cAMP (Khosla, et al., 1990) in a manner similar to that of the previously described M4-1 gene (Kimmel and Carlisle, 1986; Kimmel, 1987). In contrast, Ddras gene expression is induced by cAMP (Reymond, et al., 1984; Reymond, et al., 1985). The differential expression of the two ras genes to cAMP would ensure that they are not expressed at the same time during normal development. The two ras proteins may fulfill different functions; DdrasG having a regulatory role in cellular proliferation and Ddras a role in signal transduction at the pseudoplasmodial stage of development. However, since the predicted amino acid sequences of the two proteins are very similar (Figure 11), they might compete for the same regulatory molecule(s) and their simultaneous presence during development might be detrimental to the differentiation process. A DNA-mediated transformation system has been used to introduce multiple copies of particular genes into the D. discoideum axenic strains (Nellen, et al., 1984; Nellen and Firtel, 1985; Early and Wlliams, 1987). One way to investigate if the continued expression of the DdrasG gene might impair development would be to transform D. discoideum with the DdrasG gene under the control of a constitutive promoter. However, during preliminary experiments it was found that DdrasG mRNA levels did not decline during the development of the  93 axenic strain, Ax-2, providing a situation in which both D. discoideum ras genes were expressed at the same time during development. 6.2 Results  6.2.1 Expression of DdrasG in different D. discoideum strains In the D. discoideum wild type strain, V12-M2, the DdrasG gene was expressed in vegetative cells and then declined to negligible levels by the aggregation stage of development (6-8 hours in strain V12-M2) (Figure 13). Before the onset of this decline there was a transient increase in the expression during the first 2-3 hours of development (Khosla, et al., 1990). In contrast, in the axenic strain Ax-2, there was a gradual increase in expression over the first 8 hours of development. The levels of DdrasG mRNA then declined slightly but remained at least at vegetative levels throughout the remainder of development (Figure 18). This result suggested the possibility that DdrasG developmental expression is different for the two wild type strains, V12-M2 and NC4, the parental strain of Ax-2. The developmental expression of the DdrasG gene was therefore examined in the NC4 wild type strain and it was found that its expression was analogous to that observed in the V12-M2 strain (Figure 18). The transient increase and subsequent decline of the DdrasG mRNA levels in the NC4 strain were slightly delayed relative to that observed with the strain V12-M2, but this probably reflects the more rapid development of the latter strain. Thus the aberrant expression appeared to be unique to the Ax-2 strain. Since the Ax-2 strain used in these studies had been maintained for a number of years in the Weeks' laboratory, an Ax-2 strain was obtained from Dr. B. Coukell (York University, Toronto). The new Ax-2 strain exhibited the same abnormal developmental expression of DdrasG.  94 Figure 18. The expression of DdrasG mRNA during the development of the D. discoideum strains NC4 and Ax-2. Total RNA (20 (ig) from each of the indicated times after the onset of differentiation (hours) of both NC4 and AX2 was separated on 1.25% formaldehyde-agarose gels, transferred to nitrocellulose, and probed with DdrasG-c3. The filters were washed under high stringency conditions (see Materials and Methods) and used to expose X-ray film for 16 hours.  > X ro  O  95 Figure 19. The expression of DdrasG, M4-1, D19 and Ddras mRNAs during development of strain Ax-2. A Northern blot of the Ax-2 RNA samples described in Figure 18 was probed with the DdrasG, M4-1, D19 and Ddras cDNA clones as indicated and washed under high stringency conditions. The same Northern blot filter was used for each of the hybridizations. The M4-1 and D19 cDNAs were kindly provided by Dr A. Kimmel and Dr. H. Lodish respectively.  0  2  4  6  8 10 12 14 16 18 20 22 24  96 The expression of other developmentally regulated genes was analyzed to determine if the abnormal gene expression in Ax-2 was confined to DdrasG. The expression of D19 and Ddras, two genes which are expressed during the post-aggregative development was normal (Figure 19) (Reymond, et al, 1984; Early, et al, 1988). More significantly, the expression of M4-1, a gene that like DdrasG is repressed by pulses of cAMP was also normal (Figure 19) (Kimmel and Carlisle, 1986; Kimmel, 1987).  6.2.2 The effects of cAMP on DdrasG expression in Ax-2 The decline in DdrasG mRNA levels in the V12-M2 strain was shown to be mediated by pulsatile cAMP (Khosla, et al, 1990). The defective expression of this gene in the Ax-2 strain might be due to either the generation of cAMP pulses or in the response to cAMP. To test these possibilities Ax-2 cells were shaken in the presence or absence of pulses of cAMP under the same conditions in which the DdrasG mRNA levels declined in the wild type strain, V12-M2 (Khosla, et al, 1990). The levels of DdrasG mRNA were not significantly altered in response to the pulses of cAMP (Figure 20), suggesting that the defect in DdrasG expression was due to a defect in some aspect of the cAMP response rather than in the generation of the cAMP signal. There did appear to be an increase in the levels of DdrasG mRNA in shake suspension relative to vegetative cells however the significance of this observation remains to be determined (Figure 20).  97 Figure 20. The effect of cAMP pulses on the expression of DdrasG in shake suspension cultures of Ax-2. Ax-2 cells were grown axenically to a cell density of 2 x 10 cells/ml, washed and resuspended in K K 2 buffer, pH 6.0 at a density of 5 x 10 cells/ml. Suspensions were shaken at 250 rev/min in the absence (-) or presence (+) of pulses of cAMP to a final concentration of 25 nM. Pulses of cAMP were applied manually every 5 minutes. Total RNA was extracted at the times indicated (hours) and subjected to Northern blot analysis using the DdrasG-c3 cDNA as a probe. 6  6  I  +  ro  I + I + I 00  + I  +  98 6.3 Discussion The experiments described in this chapter were performed to address the question of whether the continued expression of the DdrasG gene throughout development demonstrated an aberrant phenotype. It was found that DdrasG was expressed throughout development in the axenic strain, Ax-2. This abnormal expression appeared to be unique to the DdrasG gene since the expression of other developmentally regulated genes was normal (Figure 19). The aberrant expression of the DdrasG gene did not have a major deleterious effect on differentiation. Although the DdrasG mRNA was present throughout development, the presence of the DdrasG protein has yet to be analyzed. The only unusual developmental phenotype of the Ax-2 strain was a smaller aggregate size when compared to the wild type strain plated at the same cell density. In addition the development of the Ax-2 strain was aberrant at higher cell densities. It is premature to conclude that these abnormal developmental phenotypes are due to the abnormal expression of DdrasG, since the axenic strains probably have multiple mutations (Cox, et al, 1990). The converse experiment has been performed with the Ddras gene. When another axenic strain, Ax-3 was transformed with multiple copies of the Ddras gene, Ddras mRNA was detected in vegetative cells and there was no adverse effects on growth or early development (Reymond, et al, 1985; Reymond, et al, 1986). These experiments suggest that the simultaneous presence of the Ddras and DdrasG gene products does not have an adverse effect on either growth or differentiation. It is possible that the level of the DdrasG protein expressed in pseudoplasmodial cells was insufficient to effect the differentiation process. Strains are now being developed that dramatically overexpress the DdrasG  99 protein by transforming the axenic strains with multiple copies of the DdrasG gene under the control of a constitutive promoter (R. Thiery, studies in progress). The decline in DdrasG mRNA levels in response to pulses of cAMP is at least superficially similar to the repression of the M4-1 gene (Kimmel and Carlisle, 1986). Furthermore, neither gene is repressed by pulses of cAMP in the presence of caffeine (Kimmel, 1987; Khosla, et al, 1990), a known inhibitor of the cAMP relay system (Brenner and Thorns, 1984). This suggests that in both cases repression requires a transient increase in the intracellular cAMP concentration or some other component involved in this branch of the signal relay system. However, while the expression of the M4-1 was repressed normally in the axenic strain Ax-2, DdrasG mRNA levels did not decline during development. In addition DdrasG mRNA levels did not decline when cells were developed in the presence of pulses of cAMP. These results imply that the molecular mechanisms involved in the down regulation in response to cAMP are different for the two genes. At present, it is not possible to determine whether the defect in DdrasG expression in Ax-2 is in the initial response to cAMP or further downstream from the signal. Since the response of the two genes to pulses of cAMP is otherwise so similar, the latter alternative is favoured with different downstream regulatory molecules responsible for the repression of transcription of the two genes. The Synag7 mutant strains that are defective in adenylyl cyclase activation (see General Introduction) may be useful in elucidating the molecular mechanisms responsible for the decline in DdrasG mRNA levels in response to cAMP.  100  CHAPTER 7 7.0 ISOLATION AND CHARACTERIZATION OF A MEMBER OF THE RAS GENE SUPERFAMILY, Ddrapl. FROM D. DISCOIDEUM  7.1 Introduction When Southern blots of D. discoideum genomic DNA were hybridized with the Ddras and DdrasG cDNAs under conditions of low stringency, the cDNAs hybridized to both genes and also hybridized to a number of other genomic fragments (Figure 12). These results suggested the possiblity that as in other eukaryotic organisms, the D. discoideum genome contains homologues of the ras gene superfamily. In this chapter the isolation and characterization of a D.  discoideum gene that is highly conserved relative to the human rap genes is described.  7.2 Results  7.2.1 Isolation of cDNA clones related to the ras gene superfamily A large number of clones were isolated from the vegetative XgtlO cDNA library that hybridized weakly to the Ddras-cl probe under low stringency conditions (see Chapter 4). These clones were then hybridized with the DdrasGc3 cDNA under conditions of both low and high stringency. One clone, c51, was selected since it hybridized to both Ddras-cl and DdrasG-c3 under low stringency conditions but failed to hybridize to either under high stringency conditions. This clone was used to isolate five additional clones under high stringency  10 Figure 21. Southern blot analysis of the D. discoideum Ddrapl gene. Genomic DNA (5 |ig) isolated from Ax-2 cells was digested with Bglll (lane 1), EcoRI (lane 2) and Bglll/EcoRI (lane 3), electrophoresed on a 0.8% agarose gel and then transferred to nitrocellulose. The filter was hybridized with the Ddrapl -c51 cDNA and washed using the previously described high stringency conditions. Molecular weight sizes (kb) are shown on the right.  1  2 3  •  -«21.2  -5.0  -2.0  -0.95  102 conditions from a Xgtll cDNA library, prepared from mRNA isolated from cells at 3-4 hours of development (kindly provided by Dr. P. Devreotes). When the isolated cDNA clones were used to probe a Southern blot of D. discoideum genomic DNA they all hybridized to the same genomic fragments indicating that they were derived from the same gene. The Southern blot analysis suggested that the c51 clone was present in a single copy within the haploid genome (Figure 21). The genomic fragments that hybridized to the isolated cDNA clones corresponded to one of the weakly hybridizing fragments that had been previously observed when the Ddras and DdrasG cDNA clones were used under low stringency conditions (Figure 12). Two genomic fragments hybridized to the c51 cDNA clone when the genomic DNA was digested with  Bglll or with EcoRI/Bglll (Figure 21 lanes 1 and 3) because there is a Bglll restriction site within the gene. 7.2.2 Sequence analysis of the ras-related cDNA clones DNA from the six cDNA clones was subcloned into M13mpl8 in both orientations and single stranded DNA from each was sequenced by the dideoxy chain termination method. Sequence analysis confirmed that all six cDNA clones were derived from the same mRNA and thus represented the same gene. In order to completely sequence both strands of the c51 clone it was further subcloned by digesting the DNA with EcoRI and Bglll and the resulting fragments were then subcloned into M13mpl8 and M13mpl9 that had been digested with EcoRI and BaraHl. The recombinant clones did not contain an initiating methionine, terminating at or before an internal EcoRI site that was probably not protected during the synthesis of the cDNAs. The remaining 5' sequence was obtained by sequencing RNA isolated from vegetative cells with a synthetic oligonucleotide that was complementary to the 5' end of the  103 Figure 22. Nucleotide and derived amino acid sequences of the Ddrapl gene. The numbers on the left indicate nucleotide positions in the sequence and the numbers on the right indicate the amino acid positions. The synthetic nucleotide that was used to complete the 5' sequence is complementary to nucleotides 89 to 107. The amino acids are represented by the single letter code (see figure 11). The Ddrapl sequence has been deposited in the EMBL/GenBank data base (accession no. X54291).  1  61  121  181  241  301  3 61  421  481  541  GAATATATATTATAAACCAGATGCCTCTTAGAGAA.TTCAAAATCGTCGTTTTAGGTTCAG M P . L R E F K I V V L G S G  14  GTGGTGTAGGTAAATCTGCTTTGACTGTGCAATTTGTTCAAGGTATTTTTGTTGAAAAGT G V G K S A L T V Q F V Q G I F V E K Y  34  ACGATCCJ^CCATCG7^GATTCCTACAGAAAA(^GTCGAAGTTGATAGCAATCAATGCA D P T I E D S Y R K Q V E V D S N Q C M  54  TGTTAGAAATTTTAGATACAGCTGGTACTGAACAATTTACTGCAATGAGAGATCTTTACA L E I L D T A G T E Q F T A M R D L Y M  74  TGAAAAATGGTCAAGGTTTTGTTTTAGTATATTCAATCATTTCAAACTCCACTTTTAACG K N G Q G F V L V Y S I I S N S T F N E  94  AGTTACCAGATCTCCGTGAACAAATTCTCAGAGTTAAGGATTGTGAAGATGTTCCAATGG L P D L R E Q I L R V K D C E D V P M V  114  TTCTTGTTGGTAACAAATGCGATCTCCACGACCAACGTGTTATTAGCACAGAACAAGGTG L V G N K C D L H D Q R V I S T E Q G E  134  AAGAACTCGCTCGTAAATTTGGTGATTGTTACTTTTTAGAAGCATCTGCCAAGAATAAAG E L A R K F G D C Y F L E A S A K N K V  154  TTAATGTTGAACAAATTTTCTATAACTTAATCCGTCAAATCAACCGTAAAAACCCAGTTG N V E Q I F Y N L I R Q I . N R K N P V G  174  GTCCJACCAAGCAAAGCTAAATCAAAATGTGCTTTATTGTAAACAATCCATCAACTCTCCA P  601 661  P  S  K  A  K  S  K  C  A  L  L  .  .  ACACCCTTCCATACTCACCCACCCATTTCAAATGTAACAATTGAAAAACAGAAAAAAA?A AAAAAAAAAAACAGAAAAAAAAAAA  187  104 Figure 23. Comparison of the derived amino acid sequence of the D. discoideum rap protein (Ddrapl) with the predicted sequences of the Ddras (Reymond, et al, 1984), DdrasG (this thesis) and the human raplA proteins (Pizon, et al, 1988a). The sequences are aligned relative to Ddrapl but the numbers correspond to the amino acid positions in the human raplA sequence. A dash indicates identity with the Ddrapl and only amino acids that differ are indicated by the single letter amino acid code (Figure 11). Gaps have been inserted to maximize the identity between the sequences. The four guanine nucleotide binding domains that are characteristic for the ras protein superfamily (Chardin, 1988; Sanders, 1990) have been boxed and the variant threonine residue at position 61 is marked by an asterisk.  105  R E F - - Y T - Y T - Y  K I V V L G - L - - - - L - I V I V - L  31  SG G V G K S A L T V Q F V Q G I F V E K  Ddrapl raplA DdrasG Ddras  M P L M M M  Ddrapl raplA DdrasG Ddras  Y DP T I E D S Y R K Q V E V D S C T I - E S I - D  Ddrapl raplA DdrasG Ddras  T A M R D L Y M K N G Q G F V L V Y A S Q RT L C S Q RT LC  Ddrapl raplA DdrasG Ddras  E Q I L R V K D C  Ddrapl raplA DdrasG Ddras Ddrapl raplA DdrasG Ddras  G -  E DV P M V - - - - - I K D R - - - I K D R - - L I  E E LA R K F G D C Y F L Q N — Q W C N A Q D — K S -' - S P K DSL S H Q  -  Q I N R K N - - T E - R K D L E - R K E L  --  I  -  -  P V G - - E K G D K G D  P K S Q  --  E -  P S K A K K K P K K P E K G S G K A  -  - - - - - - - - - - - -  -- - - - - - -  G - - - - - - - -- - I - L I - N H - i D E G - - - - - - - -I -L I -N H-i DE  6' N Q C M L E I L D T A G T E Q F Q E T - L - D - - - - - - Q - E Y E T - L - D - - - - - - -2L - E Y 97 SI I S N S T F N E L P D L R TAQ D-Q T - R - S - D - I A S ' F T - R - S Y D - I A S F -  L V G N K CD L H - - _ _ _ _ _ - E V - E A - - D - -  D Q -' E S D H E  RV I - - V - Q V - Q V  130  s T E Q  G K - T - G E - V N E  A S A K N K V NV E Q I F Y N L S S I N E - D T I R E A - - S E A - - S S s R I  - -- -- --  -  - -- -  S K C A K S - -L K - K R P L K A -X -L Q K K K Q  -  --  L L  - •- -  I -  163  I V V V  R -  106 incomplete cDNA. The nucleotide sequence and the deduced amino acid sequence from the single open reading frame are shown in Figure 22. The sequence presented does not contain the entire 5' non-coding region of the gene because the RNA sequencing could not be resolved past the indicated end. Recently a cDNA clone from a vegetative library has been isolated that extends past the initiating methionine and its sequence confirms the one obtained by sequencing the RNA (J. Daniel, P. Rebstein, unpublished observations). The deduced amino acid sequence contains the four domains that are common to the ras family of proteins, but there are considerable differences relative to the two D. discoideum ras proteins (Figure 23). The Ddras and DdrasG proteins are only 52% and 55% identical to the predicted amino acid sequence, respectively, whereas the the human raplA protein is 76% identical. These results suggest that the isolated gene represents the D. discoideum homologue for the human rap protein and thus the gene has been designated  Ddrapl. 7.2.3 Developmental expression of the Ddrapl gene To determine the developmental expression of the Ddrapl gene, Northern blots of RNA isolated from various times during D. discoideum development were hybridized with the Ddrapl-c51 cDNA clone. A complex pattern of Ddrapl specific mRNA expression was observed (Figures 24 and 25). The amount of mRNA that hybridized to the Ddrapl cDNA changed dramatically during development reaching maximal levels at the aggregation stage (8-10 hours) and during culmination (18-22 hours). During vegetative growth and early development a single 1.1 kb transcript was observed, but late in aggregation there were two transcripts of 1.0 and 1.3 kb (Figures 24 and 25).  Figure 24. Expression of DdrasG, Ddras and Ddrapl during D. Discoideum development. Messenger RNA (5 jig) isolated from V12-M2 cells at the indicated time points after the onset of differentiation was subjected to Northern blot analysis as described previously. The filter was hybridized, as indicated, with the DdrasG-c3, Ddras-cl and Ddrapl-c51 cDNA probes under high stringency conditions (see Materials and Methods).  0  4  8  14 16 20  DdrasG  Ddras  Ddrapl  I  —  •  .  108 Figure 25. Developmental expression of Ddrapl during the development of D. discoideum strain, V12-M2. Total RNA (20 ug) isolated at the indicated times (hours) from two independent experiments was subjected to Northern blot analysis and hybridized with the Ddrapl-c51 cDNA probe using high stringency wash conditions. 0 hour and 18 hour samples were electrophoresed side by side to allow direct size comparison. The single 0 hour mRNA was approximately 1.1 kb and the two 18 hour mRNAs were approximately 1.0 and 1.3 kb.  o  ro  m  m •  O) 09 o  fo  00 ro o  ro ro ro  109 Figure 26. Expression of Ddrapl in prestalk and prespore cells. Pseudoplasmodia of the V12-M2 strain were obtained by differentiation on 2% non-nutrient agar plates. The prestalk and prespore cells were separated using either (A) continuous Percoll gradients or (B) a Percoll step gradient (see Materials and Methods). Total RNA was extracted from the isolated prestalk cells (lanes 1 and 3) and prespore cells (lanes 2 and 4). RNA (20 ug) and was subjected to Northern blot analysis and hybridized with the Ddrapl-c51 cDNA clone as a probe.  A 1 2  B 3  4  110 Both transcripts declined in quantity during pseudoplasmodial formation and then increased during culmination. There did not appear to be an enrichment of Ddrapl mRNA in prestalk or prespore cells (Figure 26). All three mRNAs appear to be derived from the Ddrapl gene since they all hybridized to the cDNA under high stringency conditions, but the possibility that the Northern blot hybridizations represent the sum of more than one highly related rap gene can not be totally ruled out. The three transcripts might be generated from the same gene by the use of alternate promoters, differential splicing or modifications of the 3' terminus of the Ddrapl mRNA. Low stringency Southern blots with the Ddrapl cDNA revealed an additional band which may represent a second rap gene or an additional member of the ras gene superfamily.  7.2.4 Control of Ddrapl expression The Ddrapl gene was expressed as a single 1.1 kb transcript in vegetative cells. The expression of the Ddrapl gene during vegetative growth was not apparently affected by the position of the cells within the cell cycle, as was the case for the DdrasG mRNA (Figure 14). In order to investigate the factors involved in the expression of the Ddrapl mRNAs during D. discoideum development, cells were shaken in suspension in the absence of nutrients and RNA samples were isolated at various times (in collaboration with M. Khosla). When shake suspension cultures were incubated in the presence of continuous cAMP, the 1.3 kb mRNA was expressed at 8 hours of development (Figure 27). It is interesting to note that the Ddras 1.2 kb mRNA, but not the 0.9 kb Ddras mRNA was induced in response to cAMP, suggesting that the 1.0 and 1.1 kb Ddrapl mRNAs are not under cAMP regulation. These results suggest the possibility that the 1.0 and 1.1 kb mRNAs  111 Figure 27. The effect of cAMP on the expression of Ddrapl in shake suspension cultures of strain V12-M2. V12-M2 cells were separated from the bacteria and resuspended in K K 2 buffer, pH 6.0 to a density of 5 x 10 cells/ml; and shaken at 250 rev/min in the absence (-) or presence (+) of 500 uM cAMP with additional cAMP added to a concentration of 100 uM every hour. Total RNA was extracted at the times indicated (hours) and subjected to Northern blot analysis (20ug) using the Ddrapl -c51 cDNA as a probe. 6  112 are actually the same transcripts and the size difference that is observed late in development could be due to a change in the length of the poly A tail. Alterations in the length of the poly A tails of certain mRNAs have been reported during D. discoideum development, and these may result in a change in mRNA stability (Margolskee and Lodish, 1980; Shapiro, et al, 1988), or in the initiation of protein synthesis (Palatnik, et al, 1984; Manrow, et al, 1988). The significance of the alteration in Ddrapl transcript size during development remains to be elucidated.  7.3 Discussion  A cDNA clone, Ddrapl, was isolated from D. discoideum that hybridized to the Ddras and DdrasG cDNAs under low but not under high stringency conditions. The predicted amino acid sequence of the Ddrapl protein has a high degree of identity with the Drosophila Dras3 protein (Schejter and Shilo, 1985) and the human rap proteins (Kawata, et al, 1988; Pizon, et al, 1988a; Pizon, et  al, 1988b; Kitayama, et al, 1989; Farrell, et al, 1990; Ohmstede, et al, 1990). Despite the wide evolutionary divergance the Ddrapl protein shares 60% and 76% amino acid identities with the Dras3 and human raplA proteins respectively (Figure 23, Table 2). The conservation of the rap proteins between humans and D. discoideum, is even higher than that between the ras proteins of these species, suggesting that the rap proteins are an evolutionarily conserved branch of the ras-related family and thus may perform an essential function(s) in all eukaryotic organisms. Despite an otherwise high level of sequence conservation within the Nterminal portion, the D. discoideum protein differs from the human rap proteins at the extreme amino terminus in that it is two amino acids longer. To  113 date there have been four rap homologues isolated in human cells (raplA also called Krev-1 or smg 21, raplB, rap2A and rap2B) which all share a high degree of overall sequence conservation and the same initiation sequence (Kawata, et  al, 1988; Pizon, et al, 1988a; Pizon, et al, 1988b; Kitayama, et al, 1989; Farrell, et al, 1990; Ohmstede, et al, 1990). Although only a single rap gene has been identified thus far in D. discoideum low stringency Southern blots suggest the possibility that there may be an additional rap gene or a highly related sequence. The rap and ras proteins share several structural properties. They have molecular weights of approximately 21,000 daltons and have similar biochemical properties (Kawata, et al, 1988; Quilliam, et al, 1990). The rap proteins contain the four non-contiguous domains that are involved in binding of guanine nucleotides to the ras proteins (Figure 23). The conservation of the amino acid sequences within these four domains as well as their identical spatial distribution within the rap proteins suggest that these proteins are also able to bind guanine nucleotides. Recently, Quilliam et al, (1990) have demonstrated that the guanine nucleotide binding properties of the human raplA protein are similar to the human ras proteins. In addition when the D.  discoideum Ddrapl gene was expressed in a bacterial expression system, it was also able to bind guanine nucleotides (R. Pachal, unpublished observations). Within one of the four domains associated with guanine nucleotide binding, the human, Drosophila and D. discoideum rap genes encode a threonine at position 61, instead of the customary glutamine found in all other ras-related proteins (Figure 23). The rap proteins are the first members of the ras-related proteins to exhibit such a change. This difference is of major interest since virtually any amino acid substitution at position 61 in the human H-ras protein is correlated with the ability to transform cell lines (Der, et al, 1986).  114 In addition to the guanine nucleotide binding domains, the putative effector region encompassing amino acids 32-40 is strictly conserved within the ras and rap proteins (Figure 23). This region has been shown to be essential for biological activity of the ras oncoproteins and is the site within the protein that interacts with GAP (Sigal, et al, 1986; Willumsen, et al, 1986; Trahey and McCormick, 1987; Stone, et al, 1988; Trahey, et al, 1988). The rap proteins also have the consensus Cys-A-A-X tetrapeptide sequence at their C-terminus and may therefore undergo similar post-translational modifications in order to be attached to the inner surface of the plasma membrane (see General Introduction) (Figure 23). The human rap proteins were found to be abundant in human platelet membranes (Ohmori, et al, 1989) and in the particulate fractions of a wide range of other tissues (Kim, et al, 1990). The rapl(A and B) proteins are released from platelet membranes after phosphorylation by cAMP-dependent protein kinase (Hoshijima, et al, 1988; Nagata, et al, 1989; Siess, et al, 1990). This putative regulatory event has not been observed for any of the ras proteins although the K-ras protein has a potential phosphorylation site close to the carboxyl end of the protein. The Ddrapl gene exhibits a complex pattern of gene expression during D.  discoideum development (Figures 24 and 25). The level of Ddrapl mRNA changed dramatically during development reaching maximal levels at the aggregation stage, declining through the pseudoplasmodial stage and then peaking again during culmination. There were no other examples of this type of developmental regulation when it was first observed but recently another D.  discoideum gene , 5G was reported to exhibit a similar biphasic developmental expression (Corney, et al, 1990). It remains to be determined whether 5G is a ras-related gene. When the developmental expression of the Ddrapl gene was compared to that of the two D. discoideum ras genes, DdrasG and Ddras an  115 interesting relationship was apparent (Figure 24). The maximum levels of  Ddrapl specific mRNA were detected during D. discoideum developmental at stages where the levels of the DdrasG and Ddras mRNAs were declining. Although there is no direct evidence for the function of the Ddrapl protein in D. discoideum, the reciprocal nature of Ddrapl gene expression with respect to the two ras genes suggests the possibility that the ras and rap gene products have antagonistic roles. Furthermore, the biphasic pattern of expression suggests the possibility that the Ddrapl protein antagonizes both the DdrasG and Ddras gene products. Although a direct antagonistic interaction between the ras and rap gene products has been suggested (Kitayama, et al, 1989; Kitayama, et al, 1990; Zhang,  et al, 1990b), the precise function of the rap proteins in mammalian cells remains unknown. Overexpression of the human raplA (K-revl) gene induced morphological reversion of a cell line transformed by an activated ras gene (Kitayama, et al, 1989). The reverted cell line still expressed the activated ras gene suggesting that the rap gene product might interfere with some aspect of the ras pathway. The region encompassing the effector domain is required for rap suppression suggesting the possibility that the rap protein competes with the ras oncoprotein for GAP and blocks downstream signalling (Freeh, et al, 1990; Hata, et al, 1990; Zhang, et al, 1990b). The rap protein can interact with the ras specific GAP but its GTPase activity is not stimulated (Freeh, et al, 1990; Hata, et  al, 1990), due to the presence of the threonine residue at position 61 of the raplA protein (Hart and Marshall, 1990). Although this provides a molecular mechanism to account for the ability of the rap proteins to revert ras tranformed cells, it is probably an oversimplification because rap specific GAP proteins have been identified that can stimulate rap GTPase activity (Kikuchi, et al, 1989;  116 Ueda, et al, 1989). It is possible, therefore, that the ras and rap proteins interact with different target molecules which modify mutually antagonistic pathways. A specialized function of the human rap proteins has recently been suggested since the rapl proteins were found in the plasma membrane of neutrophils in association with the molecular complex for superoxide generation (Quinn, et  al, 1989). However it remains to be determined whether the rap proteins are involved in the assembly of this complex upon stimulation of the neutrophils.  117 CHAPTER 8  8.0 DETECTION OF THE Ddras, DdrasG AND Ddrapl ENCODED PRODUCTS  8.1 Introduction Although the precise roles for the members of the ras gene superfamily remain unknown it appears that the gene products perform diverse functions (Downward, 1990; Hall, 1990). To evaluate the specific function of each of the D.  discoideum ras and ras-related proteins it is essential to discriminate between each of the closely related gene products. The Y13-259 monoclonal antibody recognition sequence has been mapped to a highly conserved domain of the human ras proteins encompassing amino acids 63-73 (Sigal, et al, 1986). This domain is conserved in both the Ddras and DdrasG proteins but not the Ddrapl protein (Figure 23), suggesting that the ras proteins immunoprecipitated from D.  discoideum cell free extracts could have been products from either of the two ras genes. Since the Yl3-259 antibody is not able to discriminate between the Ddras and DdrasG proteins it is important to generate specifc antisera to recognize each of the encoded products. Although the amino acid sequences of three of the D. discoideum ras-related proteins, Ddras, DdrasG and Ddrapl are highly conserved, there are two short variable regions (Figure 23). The most significant differences among the proteins are confined to a short stretch of amino acids located just upstream from the Cterminus. Two procedures were used to generate a series of antisera which react uniquely with the Ddras , DdrasG and Ddrapl gene products. The antisera were obtained by immunizations with either synthetic peptides corresponding to the  118 unique C-terminal amino acid sequences or with recombinant proteins purified from bacteria expressing each of the three genes. 8.2 Results  8.2.1 Preparation of antisera which recognize peptides corresponding to the Ddras, DdrasG and Ddrapl variable regions Peptides based on nucleic acid sequence analysis have been successfully used in the development of antibodies with predetermined specificity (Lerner, 1982). This strategy has been used to generate antisera that interact specifically with the effector region of the ras proteins (Rey, et al., 1989) and to generate antisera unique for the human H-ras and K-ras gene products (Srivastava, et al., 1985; Bizub, et al., 1987). Figure 23 shows the deduced amino acid sequences of the Ddras, DdrasG and Ddrapl proteins. The synthetic peptides which were used corresponded to 15 amino acids within the variable domain of each of the proteins, Ddras " , DdrasG " 170  184  172  186  and Ddrapl 9- 3. The individual peptides 16  18  were coupled to the carrier protein, keyhole limpet hemocyanin through the Cterminal cysteine residue of all three peptides and used to immunize rabbits. The preparation and purification of each of the antisera is described under Materials and Methods. The antisera obtained from the rabbits were titrated in an enzyme linked immunosorbent assay using the purified peptides as the antigen. Each of the antisera was specific for the corresponding peptide used in the immunizations. The antisera were tested for reactivity with extracts from bacteria that had expressed each of the Ddras, DdrasG and Ddrapl cDNAs as fusion proteins. The three cDNAs were incorporated into the pGEX plasmid expression vectors, which include the coding sequences of the Schistosoma japonicun glutathione S-  119 Figure 28. Schematic structures of the Ddras, DdrasG and Ddrapl sequences expressed as GST fusion proteins in E. coli. The boxes represent the GST recombinant proteins that were constructed, the numbers correspond to the amino acids of the Ddras, DdrasG and Ddrapl proteins that were expressed. (A) The pGEX-Ddras " construction expresses a fusion protein encoding amino acids 60-187 of the Ddras protein; an approximately 800 bp Pstl /EcoRI Ddras genomic fragment was isolated, blunt ends were generated by digesting with mung bean nuclease (Maniatis, et al., 1982) and ligated into the Smal site of pGEX3X (Smith and Johnson, 1988). (B) The pGEX-Ddras plasmid was constructed by R. Pachal. A Dral fragment containing the entire Ddras coding region was ligated into the Smal site of pGEX-2T. (C) The pGEX-DdrasG plasmid which expressed the entire DdrasG coding sequence was also constructed by R. Pachal. A 700 bp Dral fragment was isolated from the DdrasG-c3 cDNA and subcloned into the Smal site of pGEX-2T. (D) The pGEX-Ddrapl construction encodes amino acids 6 to 187. The Ddrapl-c51 cDNA was subcloned into the EcoRI site of pGEX-lN. The nucleotide sequences and corresponding amino acids at the junction of the recombinant pGEX constructions are shown. The various constructions were confirmed by restriction mapping and the plasmid junctions were verified by sequence analysis (R. Pachal). 60  187  120  A.pGEX-Ddras  60-187  Gly l i e Pro Gly Gin Glu GGG ATC CCC GGT CAA GAG  187  B.pGEX-Ddras  GST  Ddras  Ddras  GST  G l y l i e P r o Lys L y s Met Thr G l u GGG ATC CCC AAA AAA ATG ACA GAA  189  C.pGEX-DdrasG  GST  DdrasG  G l y l i e Pro L y s Lys Met Thr G l u GGG ATC CCC AAA AAA ATG ACA GAA  187  D.pGEX-Ddrapl  Ddrapl  1  I  Asp Pro Arg G l u Phe Lys GAT CCC CGG GAA TTC AAA  121 transferase (GST) gene under control of the tac promoter (Smith and Johnson, 1988). The cDNAs were fused to the GST gene in the correct reading frame (Figure 28) which upon induction with IPTG synthesized fusion proteins consisting of the 27.5 kd GST domain and either a Ddras, DdrasG or Ddrapl domain. The Ddras  170  "  184  antiserum only detected the GST-  Ddras recombinant protein (approximately 48 kd), the DdrasG " 172  186  antiserum  only detected the GST-DdrasG recombinant protein (approximately 49 kd) and the Ddrapl  169  "  183  antiserum only recognized the GST-Ddrapl recombinant protein  (approximately 47 kd) when used in an immunoblot analysis (Figure 29). Although the antisera generated were specific for each of the recombinant proteins they were very weak reactions and did not detect any specific proteins when immunoblots of D. discoideum cell extracts were incubated with the various antisera. 8.2.2 Preparation of antisera to the Ddras, DdrasG and Ddrapl recombinant proteins A second approach was used to obtain antisera specific for each of the D.  discoideum ras-related proteins. The GST-Ddras (amino acids 60-187), GSTDdrasG and GST-Ddrapl fusion proteins were purified to near homogeneity by glutathione-agarose affinity chromatography (see Materials and Methods). Each of the purified recombinant proteins was used to immunize rabbits (see Materials and Methods). The antisera obtained from the rabbits were tested for reactivity with each of the recombinant proteins by immunoblot analysis. The antisera cross-reacted with the GST protein, each of the recombinant proteins and a few other bacterial proteins. The cross-reacting antibodies within each of the antisera were removed by absorption with purified recombinant fusion proteins coupled to glutathione-agarose. The antisera generated to the GST-Ddras " 60  187  fusion  122 Figure 29. Immunoblot analysis with the antisera generated to peptides corresponding to the variable regions of the Ddras, DdrasG and Ddrapl proteins. Crude lysates (25 ug) of E. coli cultures containing the GST-Ddrapl (lanes 1), GSTDdrasG (lanes 2), GST-Ddras (lanes 3) and GST (lanes 4) proteins were subjected to SDS-PAGE, and then transferred to nitrocellulose membranes (see Materials and Methods). The blots were incubated with 1/100 dilutions of: (A) Ddras " antisera, (B) DdrasG " antisera and (C) D d r a p l " antisera. The blots were then incubated with goat anti-rabbit antibody conjugated to alkaline phosphatase and bound antibody was detected using BCIP/NBT (see Materials and Methods). The arrowheads on the right indicate the size and position of the molecular weight standards (kd). 170  172  186  169  183  184  124 Figure 30. Immunoblot analysis with the antisera generated to the Ddras, DdrasG and Ddrapl bacterial recombinant proteins. Crude lysates (25 (ig) of E. coli cultures containing the GST-Ddras (lanes 1), GST-DdrasG (lanes 2), GSTDdrapl (lanes 3) and GST (lanes 4) proteins were subjected to SDS-PAGE, and transferred to nitrocellulose membranes (see Materials and Methods). The blots were incubated with 1/5000 dilutions of: (A) GST-Ddras ' antisera, (B) GSTDdrasG antisera and (C) GST-Ddrapl antisera. They were then incubated with donkey anti-rabbit antibody conjugated to horseradish peroxidase and bound antibody was detected using the ECL detection system (see Materials and Methods). The arrowheads indicate the size and position of the molecular weight standards (kd). 60 187  1 2  3  4  -<106 -«80 -«49.5 -«32.5  1 2  3  4  B  1 2  3  4  126 protein was incubated with both the GST-DdrasG and GST-Ddrapl recombinant proteins. Similarly, the GST-DdrasG antisera was incubated with the GST-Ddras and GST-Ddrapl recombinant proteins and the Ddrapl antisera was incubated with both the GST-Ddras and GST-DdrasG fusion proteins. The purified antisera was then used to probe blots of bacterial extracts containing each of the recombinant fusion proteins. As can be seen in Figure 30 the D d r a s  60-187  antisera  specifically recognized the GST-Ddras fusion protein. The DdrasG antisera recognized the GST-DdrasG recombinant protein as well as the GST-Ddras recombinant protein (Figure 30). The Ddrapl antisera detected the GST-Ddrapl recombinant protein and weakly detected the GST-Ddras and GST recombinant (27.5 kd) proteins (Figure 30). The DdrasG antisera cross-reacted with the Ddras recombinant protein suggesting that the antibodies that recognized a common epitope in the two proteins were not removed during the adsorption with the recombinant proteins. This antisera will be adsorbed again with the GST-Ddras fusion protein to try to remove more of the cross-reacting antibodies (M. Khosla, studies in progress). Each of the antisera reacted with a few additional bacterial proteins that were common to all samples. This was probably due to contaminating bacterial proteins in the purified recombinant protein preparation used for the immunizations. These antibodies are sensitive enough to detect their corresponding proteins in D. discoideum extracts by immunoblot analysis (Robbins and Khosla, studies in progress).  8.3 Discussion  A series of polyclonal antibodies have been prepared that recognize the Ddras, DdrasG and Ddrapl proteins. To maximize selectivity, rabbits were immunized with peptides corresponding to the C-terminal sequences, the regions of the  127 proteins with the highest variability. The purified antibodies were specific for each of the proteins when assayed by immunoblot analysis with bacterial lysates that expressed the Ddras, DdrasG and Ddrapl cDNAs (Figure 29). However, the antisera were insufficiently sensitive to detect the corresponding proteins from D.  discoideum cell extracts, increasing the antibody concentrations only resulted in an increased background on the immunoblots. It is possible that the antibodies cannot recognize the endogenous proteins since the peptides corresponded to the region of the proteins that may be post-translationally modified, whereas the bacterial recombinant proteins would not be expected to undergo the processing events. Antibodies were also prepared against purified recombinant proteins. The Ddras, DdrasG and Ddrapl cDNAs were expressed in E. coli as proteins fused to the bacterial GST protein. To generate specific antibodies for each of the gene products, each antiserum was incubated with the other recombinant proteins to remove antibodies that recognize common epitopes (see Results). The antisera were characterized in terms of their specificity of reaction with each of the recombinant proteins (Figure 30). Each of the antisera detected the appropriate recombinant protein used for immunization. In addition, the DdrasG antiserum also cross-reacted with the GST-Ddras recombinant protein and the Ddrapl antiserum weakly detected the Ddras recombinant protein. The Ddras antiserum was raised to a GST fusion protein that only contained amino acids 60-187 of the Ddras protein, a region that is more highly diverged between the Ddras and DdrasG proteins (Figure 11). This might explain the higher specificity of the Ddras antiserum. The recognition of the mammalian ras proteins by specific antibodies has been a useful tool to characterize the biochemical properties and functional domains of the ras proteins as well as the subcellular localization (Barbacid, 1987). In  128 addition, antibodies have been used to assess ras protein levels in normal and malignant tissues (Hand, et al, 1984; Bizub, et al, 1987). The antibodies generated in this study are specific for each of the Ddras, DdrasG and Ddrapl encoded products and should be useful for determining some of the biochemical and functional properties of the ras and rap proteins in D. discoideum. Recently a DNA-mediated transformation system for D. discoideum has been developed and has been used to assess the biological function of a number of gene products (Nellen, et al, 1984; Nellen and Firtel, 1985; Early and Wlliams, 1987). D.  discoideum transformant strains that have altered expression of the DdrasG and Ddrapl genes are being developed to determine their effect on growth and development (M. Khosla, R. Thiery and P. Rebstein, studies in progress). The specific Ddras, DdrasG and Ddrapl antisera will be essential to define the levels of the respective proteins within the various transformants. In addition the antibodies may be used to select transformants that are overexpressing or have a reduced expression of either of the Ddras, DdrasG or Ddrapl proteins, a procedure that has been used successfully to isolate ot-actinin and gp80 transformants (Wallraff, et al, 1986; Witke, et al, 1987; Faix, et al, 1990). The ability to discriminate between each of the Ddras, DdrasG and Ddrapl encoded products should be useful in defining their specific roles during growth and differentiation  of D. discodieum.  129 CHAPTER 9 9.0 GENERAL DISCUSSION  9.1 Correlation between ras protein levels and ras gene expression during D.  dsicoideum development At the outset of this work a single ras gene, Ddras, had been isolated from the cellular slime mould, Dictyostelium discoideum. The Ddras gene was maximally expressed during the pseudoplasmodial stage of development (Reymond, et ah, 1984). In contrast maximal rates of in vivo ras protein synthesis were observed in vegetative and early developing cells although there was a small burst of synthesis in pseudoplasmodial cells (Pawson and Weeks, 1984; Pawson, et ah, 1985; Weeks and Pawson, 1987). In agreement with these results a polyclonal antiserum raised to a fusion protein of the E. coli (3galactosidase and part of the amino acid sequence of the Ddras protein recognized proteins in vegetative cells and throughout aggregation with protein levels gradually diminishing late in development (Reymond, et ah, 1984). The isolation of second ras gene, DdrasG, explains the discrepancies between the expression of the Ddras mRNA and the ras protein synthesis observed during D. discoideum development. In the wild type strains the DdrasG gene was only expressed during vegetative growth and early development, whereas the Ddras gene was maximally expressed at the pseudoplasmodial stage of development (Figures 13 and 24). The Ddras and DdrasG gene products are highly conserved and both contain the recognition sequence of the ras specific monoclonal antibody, Y13-259 (Figure 11). Therefore, the combined expression of the DdrasG and Ddras genes can account for the changes in the ras protein  130 synthesis that are observed during the differentiation process (Pawson and Weeks, 1984; Pawson, et al, 1985), although this does not preclude the possibility that there may be additional ras-related sequences that remain to be discovered. Furthermore, the high degree of sequence similarities between the two proteins suggests that the polyclonal antisera directed against the Ddras protein would also detect the DdrasG protein and thus explain the observations of Reymond et  al, (1984). 9.2 Cell-type specific expression of the Ddras gene  It was initially shown that the Ddras mRNA was enriched in the prestalk cell population (Reymond, et al, 1984) and this result has subsequently been confirmed (Jermyn, et al, 1987). In contrast, ras protein synthesis only occured in the prespore cell population (Weeks and Pawson, 1987). In these latter experiments the prestalk and prespore cells were separated by a modification of the Ratner and Borth (1981) Percoll gradient technique. It was subsequently found that the modified procedure yielded a prespore fraction contaminated with a subpopulation of prestalk cells (Kwong, et al, 1990) (Figure 31). This contaminating subpopulation of prestalk cells expressed the prestalk specific gene pDd63 and Ddras but does not express the prestalk specific gene, pDd56, suggesting that the Ddras gene is expressed in a subset of the prestalk cells (Kwong, et al, 1990). In keeping with the nomenclature established by Williams and co-workers the higher density fraction of the prestalk cells expressing the Ddras and pDd63 genes are the pstA cells and the low density prestalk cells that express both pDd63 and pDd56 are the pstB cells (Figure 31) (Jermyn, et al, 1989; Williams, et al, 1989). Using D. discoideum cells that express a Ddras/lacZ fusion the pattern of Ddras expression could be localized to a subset of prestalk  13 Figure 31. Heterogeneity of prestalk cells in the pseudoplasmodium. (A) A summary of the Percoll gradient results showing the location of the pstA and pstB cells in (a) continous Percoll gradients and (b) in the Percoll step gradients. (B) The location of the pstA cells and pstB cells within the migrating •pseudoplasmodium. The pstA cells express the pDd63 and Ddras mRNAs, pstB cells express pDd56 mRNA and the pstO cells located in the zone between the prestalk region and the prespore region do not express either the pDd56 or pDd63 genes. Part of the Figure, (B) was adapted from Jermyn and Williams (1989).  pstB pstA  psp  r ^ ^ l  Willi  B PstA /  PstB  132 cells within the prestalk zone of the pseudoplasmodium (Esch and Firtel, personal communication), thus confirming the cell separation results. This is not the first evidence for heterogeneity within the prestalk cell population. It has been shown recently that different areas of the prestalk region express different genes (Gomer, et ah, 1986) and that the prestalk cells can be functionally divided on their basis for requirements for in vitro stalk cell formation (Kwong, et ah, 1988). The expression of the Ddras gene in a subset of prestalk cells provides further evidence for the heterogeneity within the prestalk zone of the developing pseudoplasmodium. However, the morphological significance of the heterogeneity within the prestalk region remains to be determined. 9.3 Evolutionary conservation of the ras and rap proteins  The ras protein superfamily is highly conserved throughout eukaryotic evolution, suggesting that they encode essential functions in all eukaryotes. The D. discoideum Ddras and DdrasG proteins show a higher degree of sequence identity to the human ras proteins identity than the yeast proteins do (Table 2). In addition the Ddrapl protein has 76% identity to the human rapl proteins whereas the yeast homologue, RSR1 (Bender and Pringle, 1989) shows a much lower sequence similarity (Table 2). Comparison of the amino acid sequences of the ras, rap, and other evolutionary conserved proteins indicate that D.  discoideum is more closely related to mammals than is yeast and that D. discoideum diverged from the line leading to metazoa at about the same time of plant and animal divergence (Loomis and Smith, 1990). This is in contrast to the previous analysis based on the nucleotide sequence of 18S rRNA, which indicated that D. discoideum represented one of the earliest branches from the  133 TABLE 2. Percentage of amino acid conservation within the ras and rap protein families A. Percentage of amino acid identity between the ras protein family  H-ras Drasl Ddras DdrasG ScRASl ScRAS2  H-ras  Drasl  Ddras  DdrasG  ScRASl  100  75 100  65 61 100  69 63 82 100  60 54 59 60 100  3  ScRAS2  a  60 57 61 61 79 100  percentage identity was calculated over the 189 amino acid domain common to the ras protein family and does not include the d o m a i n unique for the Sc proteins  a  A m i n o acid identities were calculated using the sequences shown i n figure 11.  B. Percentage of amino acid identity beween the rap protein family  raplA rap2A Dras3 Ddrapl ScRSRl  raplA  rap2A  Dras3  Ddrapl  ScRSRl  100  61 100  67 50 100  76 55. 60 100  46 48 51 46 100  -  •  A m i n o acid identities were calculated f r o m the sequences presented i n P i z o n et el., (1988), Bender and Pringle (1989) and figure 23.  A b b r e v i a t i o n s : D , Drosophila melanogaster; D d , Dictyostelium Sc, Saccharomyces cercvisiae.  discoideum;  134 mainstream of eukaryotic evolution (McCarroll, et al, 1983). It has been suggested that nucleotide sequence comparisons are misleading in D.  discoideum because of the unusually high adenine /thymine nucleotide content within the genome and that the comparison of amino acid sequences are a more reliable indicator of phylogenetic comparisons (Loomis and Smith, 1990). The main function of the ras proteins in S. cerevisiae is to control GTPstimulated adenylyl cyclase activity (Broek, et al, 1985; Toda, et al, 1985). Even though the human ras proteins can complement S. cerevisiae ras function (Broek, et al, 1985; DeFeo-Jones, et al, 1985; Kataoka, et al, 1985) it does not appear that the endogenous function of mammalian ras proteins is to regulate adenylyl cyclase activity (Beckner, et al, 1985). The possibility that D.  discoideum is evolutionary closer to higher eukaryotes than yeast argues strongly in favour of examining the physiological functions of the ras and rasrelated proteins in D. discoideum. 9.4 Ras and ras-related gene function in D. discoideum The expression of the RAS genes in S. cerevisiae is essential (Toda, et al, 1985) and it has been proposed that ras gene expression in mammalian cells might also be essential. There are also indications as to the essential nature of  ras gene expression in D. discoideum. Transformation of D. discoideum cells with the Ddras (Reymond, et al, 1985) or DdrasG (M. Khosla, studies in progress) genes in the antisense orientations appears to be lethal, but it remains to be determined if the expression of either one or both of the genes is required for cell viability. The Ddras gene product does not appear to regulate adenylyl cyclase activity or intracellular cAMP levels in D. dsicoideum, but there is evidence to suggest  135 that it is involved in cAMP transmembrane signal transduction. In D.  discoideum, cAMP signal transduction involves two pathways, one controlling the the signal relay response and one controlling the chemotactic response (Figure 4) (see General Introduction). D. discoideum transformants that overexpress an activated Ddras gene (amino acid 12 changed from glycine to threonine) display an aberrant morphogenesis leading to multiple tipped aggregates that do not form the final fruiting bodies (Reymond, et al, 1986). It was found that the activity of the adenylyl cyclase relay pathway was unaffected in the Ddras  Thr12  transformants but the ability to produce cGMP in response to  chemotactic stimuli was reduced, presumably due to an enhanced desensitization, suggesting that the aberrant phenotype may be due to impaired regulation of the chemotactic response (Van Haastert, et al, 1987a). The Ddras  Tnr12  transformants have a reduction in the number of cAMP receptors  suggesting that the Ddras protein is involved in the down-regulation of the cAMP receptor (Luderus, et al, 1988). There is evidence that guanylyl cyclase regulation in D. discoideum is coupled to the inositol pathway (see General Introduction). The Ddras  Tnr12  transformants show a three to five fold increase  in the basal levels of IP3 and inositol hexakisphosphate (IP6) (Europe-Finner, et  al, 1988). These results suggest the possibility that the Ddras gene product regulates the activation of an as yet undetected phospholipase C, which may in turn regulate the desensitization of guanylyl cyclase. However, it was recently proposed that the increase in IP3 levels can be explained by an increased conversion of phosphatidyl inositol (Ptdlns) to phosphatidyl inositol phosphate, as a result of the regulation of Ptdlns kinase activity (Van der Kaay, et al, 1990). An increase in Ptdlns kinase activity has been observed in ras-transformed fibroblasts (Huang, et al, 1988). However, an increased in vitro activity of Ptdlns  136 kinase was not detected in extracts of the Ddras  Thr12  transformants (Van der  Kaay, et al, 1990). It should be noted that in the above studies the effects of the activated Ddras gene product on signal transduction were performed on early aggregation stage cells. Since the Ddras gene is not expressed at this stage (Figures 13,19 and 24), the activated Ddras protein might be interfering with some other G protein rather than the normal Ddras protein. This argument suggests the possibility that the Ddras protein is not involved in cAMP mediated signal transduction during aggregation. However, since the Ddras gene is expressed in prestalk cells at the pseudoplasmodial stage, it is conceivable that the gene product is involved with a specific cAMP receptor that has specialized function in prestalk cells. The existence of cAMP receptor genes that are preferentially expressed at the pseudoplasmodial stage of development has recently been reported (Saxe, et  al, 1990). The DdrasG and Ddras genes are expressed at different times during D.  discoideum development (Figures 13 and 24) and thus the two proteins might perform different functions: DdrasG having a role in cellular proliferation and Ddras a role in signal transduction at the multicellular stage of development. DdrasG expression is repressed by cAMP, whereas the Ddras gene is induced by cAMP, a differential regulation that would ensure that the two gene products were not expressed at the same time during development. It was found that the DdrasG gene was expressed throughout development in the axenic strain Ax-2, providing a situation in which both ras genes were expressed at the pseudoplasmodial stage of development (Figure 18). Since the axenic strain develops normally, it does not appear that the continued expression of the DdrasG gene has a deleterious effect on development.  137 The DdrasG protein is probably linked to an as yet, unidentified signal transduction pathway during cell growth and/or early development of D.  discoideum. Two signal transduction pathways in which DdrasG could potentially interact have been identified in vegetative cells. Vegetative amoebae chemotactically respond to folic acid which is secreted by the bacterial food source (Janssens and Van Haastert, 1987; Kessin, 1988). Upon the initiation of development the cells become less responsive to folic acid and gain responsiveness to cAMP. The signal transduction pathways involved in the responses to cAMP and folic acid have a number of similarities but they involve different cell surface receptors and distinct G proteins (De Wit and Van Haastert, 1985; Kesbeke, et al, 1990). If the Ddras gene product is involved in the down regulation of a specific cAMP receptor it is possible that the DdrasG protein is coupled to the folic acid signal transduction pathway. Mutants have been isolated that do not respond chemotactically to folic acid but respond normally to cAMP (Segall, et al, 1988) and they may be important in addressing the possible association of the DdrasG protein with the folic acid signal transduction pathway. However, failure to respond to folic acid is not a lethal event and the possible involvement of the DdrasG protein in this pathway is not consistent with the idea that the ras gene products are essential. The other possibility is that the DdrasG protein is involved in transduction of mitogenic signals controlling cellular proliferation. The mitogenic signals that control cellular proliferation in D. discoideum remain largely unknown. However, the isolation of a specific growth factor has been recently reported and this growth factor may transduce a signal through the DdrasG protein to stimulate cellular proliferation (Whitbread and Katz, personal communication). The function of the Ddrapl protein in D. discoideum is also unknown. One of the interesting features of the human raplA protein is that it can suppress the  138 transformed phenotype associated with an activated ras gene in NIH 3T3 cells (Kitayama, et al, 1989; Kitayama, et al, 1990; Zhang, et al, 1990b). The Ddrapl gene is maximally expressed during the developmental stages where the levels of the DdrasG and Ddras messages are declining (Figure 24). The reciprocal nature of Ddrapl gene expression with respect to that of the two ras genes suggests the possibility that the ras and rap gene products in D. discoideum also have antagonistic roles. Furthermore, the biphasic pattern of Ddrapl expression suggests the possibility that the Ddrapl protein antagonizes both the Ddras and DdrasG gene products. It will be interesting to determine if the mutant phenotype of the activated Ddras transformants will be suppressed by overexpression of the Ddrapl gene. In addition to DdrasG, Ddras and Ddrapl two other ras-related genes, SAS1 and SAS2 have thus far been identified in D. discoideum (Saxe and Kimmel, 1988; Saxe and Kimmel, 1990). The encoded products of the SAS1 and SAS2 genes have similar sequences to those of the yeast YPT and SEC4 genes, which have been shown to be involved in GTP stimulated intracellular protein transport (Salmien and Novick, 1987; Goud, et al, 1988; Segev, et al, 1988), and the D. discoideum gene products may perform analogous functions. Although a great deal is known about the three-dimensional structure and biochemical properties of the ras proteins the molecular mechanisms by which they control cellular proliferation and cellular differentiation remain to be determined. The elucidation of the function of the D. discoideum ras and rasrelated proteins during growth and differentiation will hopefully provide an increased understanding into the role of the ras gene superfamily in normal and malignant mammalian cells.  139 REFERENCES Adari, H., Lowy, D. R., Willumsen, B. M., Der, C. J. and McCormick, F. (1988). Guanosine triphosphatase activating protein (GAP) interacts with the p21 ras effector binding domain. Science 240: 518-521. Andersen, P. R., Devare, S. G., Tronick, S. R., Ellis, R. W., Aaronson, S. A. and Scolnick, E. M. (1981). Generation of Balb-MuSv and Ha-MuSv by type C virus transduction of homologous transforming genes from different species. Cell 26: 129-134. Andres, A., Schoenenberger, C , Groner, B., Hennighausen, L., LeMeur, M. and Gerlinger, P. (1987). Ha-ras oncogene expression directed by a milk protein gene promoter: tissue specificity, hormonal regulation, and tumor induction in transgenic mice. Proc. Natl. Acad. Sci. USA 84: 1299-1303. Atkinson, T. and Smith, M. (1984). Solid phase synthesis of oligodeoxyribonucleotides by the phosphite triester method. Oligonucleotide synthesis: A practical approach, 35-91, IRL Press, Washington, D.C. Auersperg, N. and Roskelley, C. (1990). Retroviral oncogenes: interrelationships between neoplastic transformation and cellular differentiation. CRC Critical Reviews in Oncogenesis (in press) Aviv, H. and Leder, P. (1972). Purification of biologically active globin messenger RNA by chromotography on oligothymidylic acid-cellulose. Proc. Natl. Acad. Sci. USA 69:1408-1412. Ballester, R., Michaeli, T., Ferguson, K., Xu, H.-P., McCormick, F. and Wigler, M. (1989). Genetic analysis of mammalian GAP expressed in yeast. Cell 59: 681-686. Bar-Sagi, D. and Feramisco, J. R. (1985). Microinjection of the ras oncogene protein into PC12 cells induces morphological differentiation. Cell 42: 841-848. Barbacid, M. (1987). ras genes. Annu. Rev. Biochem. 56: 779-827. Beckner, S. K., Hattori, S. and Shih, T. Y. (1985). The ras oncogene product is not a regulatory component of adenylate cyclase. Nature 317: 71-72. Bender, A. and Pringle, J. R. (1989). Multicopy suppression of the cdc24 budding defect in yeast by CDC42 and three newly identified genes including the rasrelated gene RSR1. Proc. Natl. Acad. Sci. USA 86: 9976-9980.  140 Berridge, M. J. (1987). Inositol trisphosphate and diacylglycerol: two interacting second messengers. Annu. Rev. Biochem. 56: 159-193. Birchemeier, C , Broek, D. and Wigler, M. (1985). ras proteins can induce meiosis in Xenopus oocytes. Cell 43: 615-621. Birnboim, H. C. (1988). Rapid extraction of high molecular weight RNA from cultured cells and granulocytes for Northern analysis,. Nucleic Acids Res. 161: 1487-1497. Bishop, J. M. (1983). Cellular oncogenes and retroviruses. Annu. Rev. Biochem. 52: 301-354. Bishop, J. M. (1987). The molecular genetics of cancer. Science 235: 301-305. Bizub, D., Heimer, E. P., Felix, A., Chizzonite, R., Wood, A., Skalka, A. M., Slater, D., Aldrich, T. H. and Furth, M. E. (1987). Antisera to the variable region of ras oncogene proteins, and specific detection of H-ras expression in an experimental model of chemical carcinogenesis. Oncogene 1: 131-142. Blumberg, D. D., Comer, J. F. and Higinbotham, K. G. (1988). A Ca -dependent signal transduction system participates in coupling expression of some cAMPdependent prespore genes to the cell surface receptor. Dev. Genet. 9: 359-369. 2+  Blumberg, D. D., Comer, J. F. and Walton, E. M. (1989). C a antagonists distinguish different requirements for cAMP-mediated gene expression in the cellular slime mold, Dictyostelium discoideum. Differentiation 41: 14-21. + +  Bocckino, S. B., Blackmore, P. F. and Exton, J. H. (1985). Stimulation of 1,2diacylglycerol accumulation in hepatocytes by vasopressin, epinephrine and angiotensin II. J. Biol..Chem. 260: 14201-14207. Bonner, J. T. (1947). Evidence for the formation of cell aggregates by chemotaxis in the development of the cellular slime mold Dictyostelium discoideum. J. Exp. Zool. 106:1-26. Borasio, G. D., John, J., Wittinghofer, A., Barde, Y. A., Sendtner, M. and Heumann, R. (1989). ras p21 protein promotes survival and fiber outgrowth of cultured embryonic neurons. Neuron 2: 1087-96. Bos, J. L. (1989). ras oncogenes in human cancer: A review. Cancer Res. 49: 46824689. Brenner, M. and Thorns, S. D. (1984). Caffeine blocks activation of cyclic AMP synthesis in Dictyostelium discoideum. Dev. Biol. 101: 136-146.  141 Breviario, D., Hinnebusch, A., Cannon, J. and Tatchell, K. (1986). Carbon source regulation of RAS1 expression in Saccharomyces cerevisiae and the phenotypes of ras2-negative cells. Proc. Natl. Acad. Sci. USA 83: 4152-4156. Breviario, D., Hinnebusch, A. G. and Dhar, R. (1988). Multiple regulatory mechanisms control the expression of the RAS1 and RAS2 genes of Saccharomyces cerevisiae. EMBO J. 7: 1805-1813. Brock, H. W. (1987). Sequence and genomic structure of ras homologues dmras85d and dm-ras64b of Drosophila melanogaster. Gene 51: 129-138. Broek, D., Samily, N., Fasabo, O., Fujiyama, A., Tamanoi, F., Northup, J. and Wigler, M. (1985). Differential activation of yeast adenylate cyclase by wild-type and mutatnt ras proteins. Cell 41: 763-770. Broek, D., Toda, T., Michaeli, T., Levin, L., Birchmeier, C , Zoller, M., Powers, S. and Wigler, M. (1987). The Saccharomyces cerevisiae CDC25 gene product regulates the RAS-adenylate cyclase pathway. Cell 48: 789-800. Buss, J. E., Solski, P. A., Schaeffer, J. P., MacDonald, M. J. and Der, C. J. (1989). Activation of the cellular proto-oncogene product p21c-ras by addition of a myristylation signal. Science 243: 1600-1603. Cai, H., Szeberenyi, J. and Cooper, G. M. (1990). Effect of a dominant inhibitory Ha-ras mutation on mitogenic signal transduction in NIH 3T3 cells. Mol. Cell. Biol. 10:5314-5323. Cales, C , Hancock, J. F., Marshall, C. J. and Hall, A. (1988). The cytoplasmic protein GAP is implicated as the target for regulation by the ras gene product. Nature 332: 548-551. Capon, D. J., Seeburg, P. H., McGrath, J. P., Hayflick, J. S., Edman, U., Levinson, A. D. and Goeddel, D. V. (1983). Activation of Ki-ras 2 gene in the human colon and lung carcinomas by two different point mutations. Nature 304: 507-513. Casey, P. J., Solski, P. A., Der, C. J. and Buss, J. (1989). P21 is modified by a farnesyl isoprenoid. Proc. Natl. Acad. Sci. USA 86: 1167-1177. rflS  Chang, E. H., Furth, M. E., Scolnick, E. M. and Lowy, D. R. (1982a). Tumorigenic transformation of mammalian cells induced by a normal human gene homologous to the oncogene of Harvey murine sarcoma virus. Nature 297: 479-483. Chang, E. H., Gonda, M. A., Ellis, R. W., Scolnick, E. M. and Lowy, D. R. (1982b). Human genome contains four genes homologous to transforming genes of Harvey and Kirsten murine sarcoma viruses. Proc. Natl. Acad. Sci. USA 79: 4848-4852.  142 Chardin, P. (1988). The ras superfamily proteins. Biochimie 70: 865-868. Chung, S., Landfear, S. M., Blumberg, D. D., Cohen, N. S. and Lodish, H. F. (1981). Synthesis and stability of developmentally regulated Dictyostelium mRNAs are affected by cell-cell contact and cAMP. Cell 24: 785-797. Clanton, D. J., Lu, Y., Blair, D. G. and Shih, T. Y. (1987). Structural significance of the GTP-binding domain of ras p21 studied by site directed mutagenesis. Mol. Cell. Biol. 7: 3092-3097. Cocucci, S. M. and Sussman, M. (1970). RNA in cytoplasmic and nuclear fractions of cellular slime mold amebas. J. Cell Biol. 45: 399-407. Cohen, J. B., Broz, S. D. and Levinson, A. D. (1989). Expression of the H-ras proto-oncogene is controlled by alternative splicing. Cell 58: 461-472. Cohen, J. B. and Levinson, A. D. (1988). A point mutation in the last intron responsible for increased expression and transforming activity of the c-Ha-ras oncogene. Nature 334: 119-124. Corney, A. J., Richards, A. J., Phillpots, T. and Hames, B. D. (1990). Developmental regulation of cell-type-enriched mRNAs in Dictyostelium discoideum. Mol. Microbiol. 4: 613-623. Coukell, M. B., Lappano, S. and Cameron, A. M. (1983). Isolation and characterization of cAMP unresponsive (frigid) aggregation-deficient mutants of Dictyostelium discoideum. Dev. Genet. 3: 283-297. Cox, E. C , Vocke, C. D., Walster, S., Gregg, K. Y. and Bain, E. S. (1990). Electrophoretic karyotype for Dictyostelium discoideum. Proc. Natl. Acad. Sci. USA 87:8247-8251. Damante, G., Filetti, S. and Rapoport, B. (1987). Nucleotide sequence and characterization of the 5' flanking region of the Ha-ras protooncogene. Proc. Natl. Acad. Sci. USA 84: 774-778. Datta, S. and Firtel, R. A. (1988). An 80-bp cis-acting regulatory region controls cAMP and development regulation of a prestalk gene in Dictyostelium. Genes Dev. 2:294-304. de Vos, A. M., Tong, L., Milburn, M. V., Matias, P. M., Jancarik, J., Noguchi, S., Nishimura, S., Miura, K., Ohtsuka, E. S. and Kim, S.-H. (1988). Threedimensional structure of an oncogene protein: catalytic domain of human c-Hras p21. Science 239:888-893.  143 De Wit, R. J. W. and Van Haastert, P. J. M. (1985). Binding of folates to Dictyostelium discoideum cells. Demonstration of five classes of binding sites and their interconversion. Biochim. Biophys. Acta. 814: 199-213. Defeo-Jones, D., Scolnick, E. M., Koller, R. and Dhar, R. (1983). ras-related gene sequences identified and isolated from Saccharomyces cerevisiae. Nature 306: 707-709. DeFeo-Jones, D., Tatchell, K., Robinson, L. C , Sigal, I. S., Vass, W. C , Lowy, D. R. and Scolnick, E. M. (1985). Mammalian and yeast ras gene products: biological function in their heterologous systems. Science 228: 179-184. Der, C. J., Finkel, T. and Cooper, G. M. (1986). Biological and biochemical properties of human rasH genes mutated at codon 61. Cell 44:167-176. Dever, T. E., Glynias, M. J. and Merrick, W. C. (1987). GTP-binding domain: three consensus sequence elements with distinct spacing. Proc. Natl. Acad. Sci. USA 84:1814-1818. Devreotes, P. (1989). Dictyostelium discoideum: a model system for cell-cell interactions in development. Science 245: 1054-1058. Diaz-Laviada, I., Larrodera, P., Diaz-Meco, M., Cornet, M. E., Guddal, P. H., Johansen, T. and Moscat, J. (1990). Evidence for a role of phosphatidylcholinehydrolysing phospholipase C in the regulation of protein kinase C by ras and src oncogenes. EMBO J. 9: 3907-3912. Downward, J. (1990). The ras superfamily of small GTP-binding proteins. Trends in Biochem. Sci. 15: 469-472. Downward, J., Graves, J. D., Warne, P. H., Rayter, S. and Cantrell, D. A. (1990a). Stimulation of p21 upon T-cell activation. Nature 346: 719-723. ras  Downward, J., Riehl, R, Wu, L. and Weinberg, R. A. (1990b). Identification of a nucleotide exchange-promoting activity for p21 . Proc. Natl. Acad. Sci. USA 87: 5998-6002. ras  Early, A. E., Williams, J. G., Meyer, H. E., Por, S. B., Smith, E., Williams, K. L. and Gooley, A. A. (1988). Structural characterization of Dictyostelium discoideum prespore-specific gene D19 and of its product, cell surface glycoprotein PsA. Mol. Cell. Biol. 8: 3458-3466. Early, A. E. and Wlliams, J. G. (1987). Two vectors which facilitate gene manipulation and a simplified transformation procedure for Dictyostelium discoideum. Gene 59: 99-106.  144 Ellis, C , Moran, M., McCormick, F. and Pawson, T. (1990). Phosphorylation of GAP and GAP-associated proteins by transforming and mitogenic tyrosine kinases. Nature 343: 377-381. Ellis, R. W., DeFeo, D., Maryak, J. M., Young, H. A., Shih, T. Y., Chang, E. H., Lowy, D. R. and Scolnick, E. M. (1980). Dual evolutionary origin for the rat genetic sequences of Harvey murine sarcoma virus. J. Virol. 36: 408-420. Europe-Finner, G. and Newell, P. (1987). Cyclic AMP stimulates accumulation of inositol trisphosphate in Dictyostelium. J. Cell Sci. 87: 221. Europe-Finner, G. N., Luderus, M. E. E., Small, N. V., Vandriel, R., Reymond, C. D., Firtel, R. A. and Newell, P. C. (1988). Mutant ras gene induces elevated levels of inositol tris-phosphates and hexakisphosphates in Dictyostelium. J. Cell. Sci. 89:13-20. Europe-Finner, G. N. and Newell, P. C. (1986). Inositol 1,4,5-trisphosphate induces calcium release from a non-mitochondrial pool in amebas of Dictyostelium. Biochim. Biophys. Acta. 887: 335-340. Faix, J., Gerisch, G. and Noegel, A. A. (1990). Constitutive overexpression of the contact site A glycoprotein enables growth-phase cells of Dictyostelium discoideum to aggregate. EMBO J. 9: 2709-2716. Farrell, F. X., Ohmstede, C , Reep, B. R. and Lapetina, E. G. (1990). cDNA sequence of a new ras-related gene (rap2b) isolated from human platelets with sequence homology to rap2. Nucleic Acids Res. 18: 4281. Feig, L. A. and Cooper, G. M. (1988). Inhibition of NIH3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP. Mol. Cell. Biol. 8: 32353243. Feig, L. A., Corbley, M., Pan, B.-T., Roberts, T. M. and Cooper, G. M. (1987). Structure/function analysis of ras using random mutagenesis coupled with functional screening assays. Mol. Cell. Endocrinol. 1: 127-136. Feig, L. A., Pan, B., Roberts, T. M. and Cooper, G. M. (1986). Isolation of ras GTPbinding mutants using an in situ colony-binding assay. Proc. Natl. Acad. Sci. USA 83:4607-4611. Feinberg, A. P. and Vogelstein, B. (1983). A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13. Feramisco, J. R., Gross, M., Kamata, I., Rosenberg, M. and Sweet, R. W. (1984). Microinjection of the oncogene form of the human H-ras (T-24) protein results in rapid proliferation of quiescent cells. Cell 38: 109-117.  145 Field, J., Vojtek, A., Ballester, R., Bolger, G., Colicelli, J., Ferguson, K., Gerst, J., Kataoka, T., Michaeli, T., Powers, S., Riggs, M., Rodgers, L., Wieland, I., Wheland, B. and Wigler, M. (1990). Cloning and charcterization of CAP, the S. cerevisiae gene encoding the 70 kd adenylyl cyclase-associated protein. Cell 61: 319-327. Firtel, R. A., van Haastert, P. J. M., Kimmel, A. R. and Devreotes, P. N. (1989). G protein linked signal transduction pathways in development: Dictyostelium as an experimental system. Cell 58: 235-239. Fleischman, L. F., Chahwala, S. B. and Cantley, L. (1986). JRas-transformed cells: altered levels of phosphatidylinositol-4,5-bisphosphate and catabolites. Science 231:407-410. Freeh, M., John, J., Pizon, V., Chardin, P., Tavitian, A., Clark, R., McCormick, F. and Wittinghofer, A. (1990). Inhibition of GTPase activating protein stimulation of ras-p21 GTPase by the Krev-1 gene product. Science 249:169-171. Fukui, Y. and Kaziro, Y. (1985). Molecular cloning and sequence analysis of a ras gene from Schizosaccharomyces pombe. EMBO J. 4: 687-692. Furth, M. E., Aldrich, T. H. and Cordon-Cardo, C. (1987). Expression of ras protooncogene proteins in normal human tissues. Oncogene 1: 47-58. Furth, M. E., Davis, L. J., Fleurdelys, B. and Scolnick, E. M. (1982). Monoclonal antibodies to the p21 products of the transforming gene of Harvey murine sarcoma virus and of the cellular ras gene family. J. Virol. 43: 294-304. Geliebter, J. (1988). Dideoxynucleotide sequencing of RNA and uncloned cDNA. BRL Focus 9:5-8. Geliebter, J., Zeff, R. A., Melvold, R. W. and Nathenson, S. G. (1986). Mitotic recombination in germ cells generated two major histocompatibility complex mutant genes shown to be identical by RNA sequence analysis: Kp ^ and bm6 3371-3375. m  K  P r o c  N a t l  A c a d  S c i U  S  A 8 3 :  Gerisch, G. (1987). Cyclic AMP and other signals controlling cell development and differentiation in Dictyostelium. Annu. Rev. Biochem. 56: 853-879. Gibbs, J. B., Schaber, M. D., Allard, W. J., Sigal, I. S. and Scolnick, E. M. (1988). Purification of ras GTPase activating protein from bovine brain. Proc. Natl. Acad. Sci. USA 85: 5026-5030.  146 Gibbs, J. B., Sigal, I. S., Poe, M. and Scolnick, E. M. (1984). Intrinsic GTPase activity distinguishes normal and oncogenic ras p21 molecules. Proc. Natl. Acad. Sci. USA 81:5704-5708. Gilman, A. G. (1987). G proteins: Transducers of receptor-generated signals. Annu. Rev. Biochem. 56: 615-649. Ginsburg, G. and Kimmel, A. R. (1989). Inositol trisphosphate and diacylglycerol can differentially modulate gene expression in Dictyostelium. Proc. Natl. Acad. Sci. USA 86:9332-9336. Gomer, R. H., Datta, S. and Firtel, R. A. (1986). Cellular and subcellular distribution of a cAMP-regulated prestalk protein and prespore protein in Dictyostelium discoideum: a study on the ontogeny of prestalk and prespore cells. J. Cell Biol. 103:1999-2015. Goud, B., Salminen, A., Walworth, N. C. and Novick, P. J. (1988). A GTPbinding protein required for secretion rapidly associates with secretory vesicles and the plasma membrane in yeast. Cell 53: 753-768. Grunstein, M. and Hogness, D. (1975). Colony hybridization: a method for the isolation of cloned DNAs that contain a specific gene. Proc. Natl. Acad. Sci. USA 72: 3961-3964. Gutierrez, L., Magee, A. I., Marshall, C. J. and Hancock, J. F. (1989). Posttranslational processing of p21 is two-step and involves carboxyl-methylation and carboxy-terminal proteolysis. EMBO J. 8:1093-1098. ras  Hagag, N., Halegoua, S. and Viola, M. (1986). Inhibition of growth factorinduced differentiation of PC12 cells by microinjection of antibody to ras p21. Nature 319:680-682. Hall, A. (1990). ras and GAP- Who's Controlling Whom? Cell 61: 921-923. Hall, A. and Brown, R. (1985). Human N-ras: cDNA cloning and gene structure. Nucleic Acids Res. 13: 5255-5268. Hall, A., Marshall, C. J., Spurr, N. K. and Weiss, R. A. (1983). Identification of a transforming gene in two human sarcoma lines as a new member of the ras gene family located on chromosome 1. Nature 303: 396-400. Hall, H. (1990). The cellular functions of small GTP-binding proteins. Science 249: 635-640. Hancock, J. F., Magee, A. I., Childs, J. E. and Marshall, C. J. (1989). All ras proteins are polyisoprenylated but only some are palmitoylated. Cell 57: 1167-1177.  147 Hancock, J. F., Paterson, H. and Marshall, C. J. (1990). A polybasic domain or palmitoylation is required in addition to the CAAX motif to localize p21 to the plasma membrane. Cell 63: 133-139. ras  Hand, P. H., Thor, A., Wunderlich, D., Muraro, R., Caruso, A. and Schlom, J. (1984). Monoclonal antibodies of predetermined specificity detect activated ras gene expression in human mammary and colon carcinomas. Proc. Natl. Acad. Sci. USA 81:5227-5231. Haribabu, B. and Dottin, R. P. (1986). Pharmacological characterization of cyclic AMP receptors mediating gene regulation in Dictyostelium discoideum. Mol. Cell. Biol. 6: 2402-2408. Hart, P. A. and Marshall, C. J. (1990). Amino acid 61 is a determinant of sensitivity of rap proteins to the ras GTPase activating protein. Oncogene 5: 1099-1101. Hata, Y., Kikuchi, A., Sasaki, T., Schaber, M. D., Gibbs, J. B. and Takai, Y. (1990). Inhibition of the ras p21 GTPase-activating protein-stimulated GTPase activity of c-Ha-ras p21 by smg p21 having the same putative effector domain as ras p21s. J. Biol. Chem. 265: 7101-7107. Helms, C , Dutchik, J. E. and Olson, M. V. (1987). A X DNA protocol based on purification of phage on DEAE-cellulose. Meth. Enzymol. 153: 69-82. Henikoff, S. (1984). Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28: 351-359. Hjorth, A. L., Khanna, N. C. and Firtel, R. A. (1989). A trans-acting factor required for cAMP-induced gene expression in Dictyostelium is regulated developmentally and induced by cAMP. Genes Dev. 3: 747-759. Hjorth, A. L., Pears, C , Williams, J. G. and Firtel, R. A. (1990). A developmentally regulated trans-acting factor recognizes dissimilar G/C-rich elements controlling a class of cAMP-inducible Dictyostelium genes. Genes Dev. 4: 419-432. Hoffman, E. K., Trusko, S. P., Freeman, N. and George, D. L. (1987). Structural and functional characterization of the promoter region of the mouse c-Ki-r„s gene. Mol. Cell. Biol. 7: 2592-2596. Holtz, D., Tanaka, R. A., Hartwig, J. and McKeon, F. (1989). The CaaX motif of lamin A functions in conjunction with the nuclear localization signal to target assembly to the nuclear envelope. Cell 59: 969-977.  148 Honkawa, H., Masahashi, W., Hashimoto, S. and Hashimoto-Gotoh, T. (1987). Identification of the principal promoter sequence of the c-H-ras transforming oncogene: deletion analysis of the 5'-flanking region by focus formation assay. Mol. Cell. Biol. 7: 2933-2940. Hoshijima, M., Kikuchi, A., Kawata, M., Ohmori, T., Hashimoto, E., Yamamura, H. and Takai, Y. (1988). Phosphorylation by cyclic AMP-dependent protein kinase of a human platelet Mr 22,000 GTP-binding protein (smg 21) having the same putative effector domain as the ras gene products. Biochem. Biophys. Res. Commun. 157: 851-860. Huang, M., Chida, K., Kamata, N., Nose, K., Kato, M., Homma, Y., Takenawa, T. and Kuroki, T. (1988). Enhancement of inositol phospholipid metabolism and activation of protein kinase Cras-transformedrat fibroblasts. J. Biol. Chem. 263: 17975-17980. Huang, Y. K., Kung, H.-F. and Kamata, T. (1990). Purification of a factor capable of stimulating the guanine nucleotide exchange reaction of ras proteins and its effect on ras-related small molecular mass G proteins. Proc. Natl. Acad. Sci. USA 87: 8008-8012. Hurley, J. B., Simon, M. I., Teplow, D. B., Robishaw, J. D. and Gilman, A. G. (1984). Homologies between signal transducing G proteins and ras gene products. Science 226: 860-862. Ishii, S., Kadonaga, J. T., Tjian, R., Brady, J. N., Merlino, G. T. and Pastan, I. (1986). Binding of the Spl transcription factor by the human Harvey ras 1 protooncogene promoter. Science 232: 1410-1413. Ishii, S., Merlino, G. T. and Pastan, I. (1985). Promoter region of the human Harvey ras proto-oncogene: similarity to the EGF receptor proto-oncogene promoter. Science 230: 1378-1381. Janssens, P. M. W. and Van Haastert, P. J. M. (1987). Molecular basis of transmembrane signal transduction in Dictyostelium discoideum. Microbiol. Rev. 51:396-418. Jermyn, K. A., Berks, M., Kay, R. R. and Williams, J. G. (1987). Two distinct classes of prestalk-enriched mRNA sequences in Dictyostelium discoideum. Development 100: 745-755. Jermyn, K. A., Duffy, K. T. and Williams, J. G. (1989). A new anatomy of the prestalk zone in Dictyostelium. Nature 340: 144-6. Jimenez, B., Fernandez-Renart, M. and Pestana, A. (1986). Changes in the plasma membrane ATPase activity in relationship to cell proliferation in Dictyostelium. Biochem. Biophys. Res. Comm. 141: 1092-1098.  149 Kaplan, D. R., Morrison, D. K., Wong, G., McCormick, F. and Williams, L. T. (1990). PDGF B-receptor stimulates tyrosine phosphorylation of GAP and association of GAP with a signaling complex. Cell 61: 125-133. Kataoka, T., Powers, S., Cameron, S., Fasano, O., Goldfarb, M., Broach, J. and Wigler, M. (1985). Functional homology of mammalian and yeast ras genes. Cell 40:19-26. Kataoka, T., Powers, S., McGill, C , Fasano, O., Strathern, J., Broach, J. and Wigler, M. (1984). Genetic analysis of yeast RAS1 and RAS2 genes. Cell 37: 437445. Kawata, M., Matsui, Y., Kondo, J., Hishida, T., Teranishi, Y. and Takai, Y. (1988). A novel small molecular weight GTP-binding protein with the same putative effector domain as the ras proteins in bovine brain membranes- purification, determination of primary structure, and characterization. J. Biol. Chem. 263: 18965-18971. Kazlauskas, A., Ellis, C , Pawson, T. and Cooper, J. A. (1990). Binding of GAP to activated PDGF receptors. Science 247:1578-81. Kesbeke, F., Snaar-Jagalska, B.E. and Van Haastert, P. J. M. (1988). Signal transduction in Dictyostelium fgd A mutants with a defective interaction between surface cAMP receptors and a GTP-binding regulatory protein. J. Cell Biol. 107:521-528. Kesbeke, F., Van Haastert, P. J. M., De Wit, R. J. W. and Snaar-Jagalska, B. E. (1990). Chemotaxis to cyclic AMP and folic acid is mediated by different G proteins in Dictyostelium discoideum. J. Cell Sci. 96: 669-673. Kessin, R. H. (1988). Genetics of early Dictyostelium discoideum development. Microbiol. Rev. 52: 29-49. Khosla, M., Robbins, S. M., Spiegelman, G. B. and Weeks, G. (1990). Regulation of DdrasG gene expression during Dictyostelium development. Mol. Cell. Biol. 10: 918-922. Kikuchi, A., Sasaki, S., Araki, S., Hata, Y. and Takai, Y. (1989). Purification anad characterization of bovine brain cytosol of two GTPase activating proteins specific for smg p21, a GTP-binding protein having the same effector domain as c-ros p21s. J. Biol. Chem. 264: 9133-9136. Kim, S., Mizoguchi, A., Kikuchi, A. and Takai, Y. (1990). Tissue and subcellular distributions of the smg-21 /rapl /Krev-1 proteins which are partly distinct from those of c-ras p21s. Mol. Cell. Biol. 10: 2645-2652.  150 Kimmel, A. R. (1987). Different molecular mechanisms of cAMP regulation of gene expression during Dictyostelium development. Dev. Biol. 122: 163-171. Kimmel, A. R. and Carlisle, B. (1986). A gene expressed in undifferentiated vegetative Dictyostelium is repressed by developmental pulses of cAMP and reinduced during dedifferentiation. Proc. Natl. Acad. Sci. USA 83: 2506-2510. Kimmel, A. R. and Eisen, M. (1988). Regulation of gene expression by the intracellular second messengers LP3 and diacylglycerol. Dev. Genet. 9: 351-358. Kimmel, A. R. and Firtel, R. A. (1983). Sequence organization in Dictyostelium: unique structure at the 5-ends of protein coding genes. Nucleic Acids Res. 11: 541-552. Kitayama, H., Matsuzaki, T., Ikawa, Y. and Noda, M. (1990). Genetic analysis of the Kirsten-ras-revertant 1 gene: potentiation of its tumor suppressor activity by specific point mutations. Proc. Natl. Acad. Sci. USA 87: 4284-4288. Kitayama, H., Sugimoto, Y., Matsuzaki, T., Ikawa, Y. and Noda, M. (1989). A rasrelated gene with transformation suppressor activity. Cell 56: 77-84. Klein, P., Vaughan, R., Borleis, J. and Devreotes, P. (1987). The surface cyclic AMP receptor in Dictyostelium. Levels of ligand-induced phosphorylation, solubilization, identification of primary transcript and developmental regulation of expression. J. Biol. Chem. 262: 358-364. Klein, P. S., Sun, T. J., Saxe, C. I., Kimmel, A. R., Johnson, R. L. and Devreotes, P. N. (1988). A chemoattractant receptor controls development in Dictyostelium discoideum. Science 241: 1467-1472. Knox, B. E., Devreotes, P. N., Goldbeter, A. and Segel, L. A. (1986). A molecular mechanism for sensory adaptation based on ligand-induced receptor modification. Proc. Natl. Acad. Sci. USA 83: 2345-2349. Koland, J. G., O'Brien, K. M. and Cerione, R. A. (1990). Expression of epidermal growth factor receptor sequences as E.coli fusion proteins: applications in the study of tyrosine kinase function. Biochem. Biophys. Res. Commun. 166: 90100. Kumagai, A., Pupillo, M., Gundersen, R., Miake, L. R., Devreotes, P. N. and Firtel, R. A. (1989). Regulation and function of Get protein subunits in Dictyostelium. Cell 57: 265-275. Kung, H.-F., Smith, M. R., Bekesi, E., Manne, V. and Stacey, D. W. (1986). Reversal of transformed phenotype by monoclonal antibodies against Ha-ras p21 proteins. Exp. Cell Res. 162: 363-371.  151 Kwong, L., Sobolewski, A., Atkinson, L. and Weeks, G. (1988). Stalk cell formation in monolayers from isolated prestalk and prespore cells of Dictyostelium discoideum; evidence for two populations of prestalk cells. Development 104: 121-127. Kwong, L., Xie, Y., Daniel, J., Robbins, S. M. and Weeks, G. (1990). A Dictyostelium morphogen that is essential for stalk cell formation is generated by a subpopulation of prestalk cells. Development 110: 303-310. Lacal, J. C. (1990). Diacylglycerol production in Xenopus laevis oocytes after microinjection of p21 proteins is a consequence of activation of phosphatidylcholine metabolism. Mol. Cell. Biol. 10: 333-340. ras  Lacal, J. C , de la Pena, P., Moscat, J., Garcia-Barreno, P., Anderson, P. S. and Aaronson, S. A. (1987a). Rapid stimulation of diacylglycerol production in Xenopus oocytes by microinjection of H-ras p21. Science 238: 533-536. Lacal, J. C , Fleming, T. P., Warren, H. S., Blumberg, P. M. and Aaronson, S. A. (1987b). Involvement of functional protein kinase C in the mitogenic response to the H-ras oncogene product. Mol. Cell. Biol. 7: 4146-4149. Lacal, J. C , Moscat, J. and Aaronson, S. A. (1987c). Novel source of 1,2diacylglycerol elevated in cells transformed by Ha-ras oncogene. Nature 330: 269-272. Lacal, P. M., Pennington, C. Y. and Lacal, J. C. (1988). Transforming activity of ras proteins translocated to the plasma membrane by a myristylation sequence from the src gene product. Oncogene 1: 533-538. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227: 680-685. Lehrach, H., Diamond, D., Wozney, J. M. and Boedtker, H. (1977). RNA molecular weight determinations by gel electrophoresis under denaturing conditions, a critical examination. Biochemistry 16: 4743-4751. Lerner, R. A. (1982). Tapping the immunological repertoire to produce antibodies with predetermined specificity. Nature 299: 592-596. Lerner, R. A., Green, N., Alexander, H., Liu, F. T., Sutcliffe, J. G. and Shinnick, T. M. (1981). Chemically synthesized peptides predicted from the nucleotide sequence of the hepatitis B virus genome elicit antibodies reactive with the native envelope of Dane particles. Proc. Natl. Acad. Sci. USA 78: 3403-3407.  152 Lloyd, A. C , Paterson, H. F., Morris, J. D. H., Hall, A. and Marshall, C. J. (1989). p21^" -induced morphological transformation and increases in c-myc expression are independent of functional protein kinase C. EMBO J. 8: 10991104. rflS  Loomis, W. F. (1975). Dictyostelium discoideum. A developmental system. Academic Press, Inc., New York Loomis, W. F. and Smith, D. W. (1990). Molecular phylogeny of Dictyostelium discoideum by protein sequence comparison. Proc. Natl. Acad. Sci. USA 87: 9093-9097. Luderus, M. E. E., Reymond, C. D., Van Haastert, P. J. M. and Van Driel, R. (1988). Expression of a mutated ras gene in Dictyostelium discoideum alters the binding of cyclic AMP to its chemotactic receptor. J. Cell. Sci. 90: 701-706. Ma, P. C.-C. and Siu, C.-H. (1990). A pharmacologically distinct cyclic AMP receptor is responsible for the regulation of gp80 expression in Dictyostelium discoideum. Mol. Cell. Biol. 10: 3297-3306. Madaule, P., Axel, R. and Myers, A. M. (1987). Characterization of two members of the rho gene family from the yeast Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 84: 779-783. Maniatis, T., Fritsch, E. F. and Sambrook, J. (1982). Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Mann, S. K. O. and Firtel, R. A. (1987). Cyclic AMP regulation of early gene expression in Dictyostelium discoideum: mediation via the cell surface cyclic AMP receptor. Mol. Cell. Biol. 7: 458-469. Mann, S. K. O., Pinko, C. and Firtel, R. A. (1988). cAMP regulation of early gene expression in signal transduction mutants of Dictyostelium. Dev. Biol. 130: 294303. Manrow, R. E., Shapiro, R. A., Herrick, D., Steel, L. F., Blinder, D. and Jacobson, A. (1988). Regulation of mRNA stability and the poly (A) problem in Dictyostelium discoideum. Deve. Genet. 9: 403-419. Margolskee, J. P. and Lodish, H. F. (1980). Half-lives of messenger RNA species during growth and differentiation of Dictyostelium discoideum. Dev. Biol. 74: 37-49. McCarroll, R., Olsen, G. J., Stahl, Y. D., Woese, C. R. and Sogin, M. L. (1983). Nucleotide sequence of the Dictyostelium discoideum small-subunit ribosomal ribonucleic acid inferred from the gene sequence: evolutionary implications. Biochemistry 22: 5858-5868.  153 McCormick, F. (1989). ras GTPase activating protein: Signal transmitter and signal terminator. Cell 56: 5-8. McCormick, F., Clark, B. F., laTour, T.F.M., Kjeldgoard, M., Norskov-Lauritsen, L. and Nyborg, J. (1985). A model for the tertiary structure of p21, the product of the ras oncogene. Science 230: 78-82. McGrath, J. P., Capon, D. J., Goeddel, D. V. and Levinson, A. D. (1984). Comparative biochemical properties of normal and activated human ras p21 protein. Nature 310: 644-649. McGrath, J. P., Capon, D. J., Smith, D. H., Chen, E. Y., Seebury, P. H., Goeddel, D. V. and Levinson, A. D. (1983). Structure and organization of the human Ki-ras proto-oncogene and a related processed pseudogene. Nature 304: 501-506. Mehdy, M. C , Ratner, D. and Firtel, R. A. (1983). Induction and modulation of cell-type-specific gene expression in Dictyostelium. Cell 32: 763-771. Mendola, C. E. and Backer, J. M. (1990). Lovastatin blocks N-ras oncogeneinduced neuronal differentiation. Cell Growth Differ. 1: 499-502. Messing, J. (1983). New M13 vectors for cloning. Meth. Enzymol. 101: 20-78. Molloy, C. J., Bottaro, D. P., Fleming, T. P., Marshall, M. S., Gibbs, J. B. and Aaronson, S. A. (1989). PDGF induction of tyrosine phosphorylation of GTPase activating protein. Nature 342: 711-714. Moscat, J., Fleming, T. P., Molloy, C. J., Lopez-Barahona, M. and Aaronson, S. A. (1989). The calcium signal for Balb/MK keratinocyte terminal differentiation induces sustained alterations in phosphoinositide metabolism without detectable protein kinase C activation. J. Biol. Chem. 264: 11228-11235. Mozer, B., Marlor, R., Parkhurst, S. and Corces, V. (1985). Characterization and developmental expression of a Drosophila ras oncogene. Mol. Cell. Biol. 5: 885889. Mulcahy, L. S., Smith, M. R. and Stacey, D. W. (1985). Requirements for ras proto-oncogene function during serum-stimulated growth of NIH3T3 cells. Nature 313:241-243. Nagata, K., Nagao, S. and Nozawa, Y. (1989). Low Mr GTP-binding proteins in human platelets: cyclic AMP-dependent protein kinase phosphorylates m22KG in membrane but not in c21KG in cytosol. Biochem. Biophys. Res. Communun. 160: 235-242.  154 Nellen, W. and Firtel, R. A. (1985). High-copy number transformants and cotransformation in Dictyostelium. Gene 39: 155-163. Nellen, W., Silan, C. and Firtel, R. A. (1984). DNA-mediated transformation in Dictyostelium discoideum: regulated expression of an actin gene fusion. Mol. Cell. Biol. 4: 2890-2898. Nemoto, N., Kodama, K.-L, Tazawa, A., Masahito, P. and Ishikawa, T. (1986). Extensive sequence homology of the goldfish ras gene to mammalian ras genes. Differentiation 32: 17-23. Neuman-Silberberg, F. S., Schejter, E., Hoffmann, F. M. and Shilo, B. Z. (1984). The Drosophila melanogaster ras oncogenes: structure and nucleotide sequence. Cell 37:1027-1033. Newell, P. C , Europe-Finner, G. N. and Small, N. V. (1987). Signal transduction during amoebal chemotaxis of Dictyostelium discoideum. Microbiol. Sci. 4: 5-11. Newell, P. C , G.N., E.-F., Small, N. V. and Liu, G. (1988). Inositol phosphates, Gproteins and ras genes involved in chemotactic signal transduction of Dictyostelium. J. Cell Sci. 89: 123-127. Noda, M., Ko, M., Ogura, A., Liu, D.-G., Amano, T., Takano, T. and Ikawa, Y. (1985). Sarcoma viruses carrying ras oncogenes induced differentiationassociated properties in a neuronal cell line. Nature 318: 73-75. Ohmori, T., Kikuchi, A., Yamamoto, K., Kim, S. and Takai, Y. (1989). Small molecular weight GTP-binding proteins in human platelet membranes. J. Biol. Chem. 264: 1877-1881. Ohmstede, C , Farrell, F. X., Reep, B. R., Clemetson, K. J. and Lapetina, E. G. (1990). RAP2B: A RAS-related GTP-binding protein from platelets. Proc. Natl. Acad. Sci. USA 87: 6527-6531. Oyama, M. and Blumberg, D. D. (1986). Interaction of cAMP with the cell-surface receptor induces cell-type-specific mRNA accumulation in Dictyostelium discoideum. Proc. Natl. Acad. Sci. USA 83: 4819-4823. Palatnik, C. M., Wilkins, C. and Jacobson, A. (1984). Translational control during early Dictyostelium development: possible involvement of poly(A) sequences. Cell 36:1017-1025. Paterson, H. F., Self, A. J., Garrett, M. D., Just, I., Aktories, K. and Hall, A. (1990). Microinjection of recombinant p21 ^° induces rapid changes in cell morphology. J. Cell Biol. I l l : 1001-1007. r  155 Pavlovic, J., Haribabu, B. and Dottin, R. P. (1988). Transmembrane signal transduction regulates gene expression in Dictyostelium discoideum. Dev. Genet. 9:371-382. Pavlovic, J., Haribabu, B. and Dottin, R. P. (1989). Identification of a signal transduction response sequence element necessary for induction of a Dictyostelium discoideum gene by extracellular cyclic AMP. Mol. Cell. Biol. 9: 4660-4669. Pawson, T., Amiel, T., Hinze, E., Auersperg, N., Neave, N., Sobolewski, A. and Weeks, G. (1985). Regulation of a ras-related protein during development of Dictyostelium discoideum. Mol. Cell. Biol. 5: 33-39. Pawson, T. and Weeks, G. (1984). Expression ofras-encodedproteins in relation to cell growth and differentiation. In (Bishop, J.M., Rowley, J. and Greaves, M eds.) Genes and Cancer, Alan R. Liss, New York, 461-470. Pears, C. J., Mahbubani, H. M. and Williams, J. G. (1985). Characterization of two highly diverged but developmentally co-regulated cysteine proteinase genes in Dictyostelium discoideum. Nucleic Acids Res. 13: 8853-8866. Pears, C. J. and Williams, J. G. (1987). Identification of a DNA-sequence element required for efficient expression of a developmentally regulated and cAMPinducible gene of Dictyostelium discoideum. EMBO J. 6: 195-200. Pears, C. J. and Williams, J. G. (1988). Multiple copies of a G-rich element upstream of a cAMP-inducible Dictyostelium gene are necessary but not sufficient for efficient gene expression. Nucleic Acids Res. 16: 8467-8486. Pelham, H. R. B. and Jackson, R. J. (1976). An efficient mRNA-dependent translation system from reticulocyte lysates. Eur. J. Biochem. 67: 247-256. Pessin, M. S., Baldassare, J. J. and Raben, D. M. (1990). Molecular species analysis of mitogen-stimulated 1,2-diglycerides in fibroblasts: Comparison of athrombin, epidermal growth factor, and platelet-derived growth factor. J. Biol. Chem. 265:7959-7966. Peters, D. J. M., Van Lookeren Campagne, M. M., Van Haastert, P. J. M., Spek, W. and Schaap, P. (1989). Lithium ions induce prestalk-associated gene expression and inhibit prespore gene expression in Dictyostelium discoideum. J. Cell Sci. 93: 205-210. Pizon, V., Chardin, P., Lerosey, I., Olofsson, B. and Tavitian, A. (1988a). Human cDNAs rapl and rap2 homologous to the Drosophila gene Dras3 encode proteins closely related to ras in the 'effector' region. Oncogene 3: 201-204.  156 Pizon, V., Lerosey, I, Chardin, P. and Tavitian, A. (1988b). Nucleotide sequence of a human cDNA encoding aras-relatedprotein (raplB). Nucleic Acids Res. 16: 7719. Powers, S., Kataoka, T., Fasano, O., Goldfarb, M., Strathern, J., Broach, J. and Wigler, M. (1984). Genes in S. cerevisiae encoding proteins with domains homologous to the mammalianrasproteins. Cell 36: 607-612. Powers, S., O'Neill, K. and Wigler, M. (1989). Dominant yeast and mammalian RAS mutants that interfere with the CDC25-dependent activation of wild-type RAS in Saccharomyces cerevisiae. Mol. Cell. Biol. 9: 390-395. Price, B. D., Morris, J. D. H., Marshall, C. J. and Hall, A. (1989). Stimulation of phosphatidylcholine hydrolysis, diacylglycerol release, and arachidonic acid production by oncogenic ras is a consequence of protein kinase C activation. J. Biol. Chem. 264: 16638-16643. Pupillo, M., Kumagai, A., Pitt, G. S., Firtel, R. A. and Devreotes, P. N. (1989). Multiple a subunits of guanine nucleotide-binding proteins in Dictyostelium. Proc. Natl. Acad. Sci. USA 86: 4892-4896. Quaife, C. J., Pinkert, C. A., Ornitz, D. M., Palmiter, R. D. and Brinster, R. L. (1987). Pancreatic neoplasia induced byrasexpression in acinar cells of transgenic mice. Cell 48:1023-1034. Quilliam, L. A., Der, C. J., Clark, R., O'Rourke, E. C , Zhang, K., McCormick, F. and Bokoch, G. M. (1990). Biochemical characterization of baculovirus-expressed raplA/Krev-1 and its regulation by GTPase-activating proteins. Mol. Cell. Biol. 10: 2901-2908. Quinn, M. T., Parkos, C. A., Walker, L., Orkin, S. H., Dinauer, M. C. and Jesaitis, A. J. (1989). Association of a Ras-related protein with cytochrome b of human neutrophils. Nature 342: 198-200. Ratner, D. and Borth, W. (1983). Comparison of differentiating Dictyostelium discoideum cell types separated by an improved method of density gradient centrifugation. Exp. Cell. Res. 143:1-13. Rey, I., Soubigou, P., Debussche, L., David, C , Morgat, A., Bost, P. E., Mayaux, J. F. and Tocque, B. (1989). Antibodies to synthetic peptide from the residue 33 to 42 domain of c-Ha-ras p21 block reconstitution of the protein with different effectors. Mol. Cell. Biol. 9: 3904-3910. Reymond, C. D., Gomer, R. H., Mehdy, M. C. and Firtel, R. A. (1984). Developmental regulation of a Dictyostelium gene encoding a protein homologous to mammalianrasprotein. Cell 39: 141-148.  157 Reymond, C. D., Gomer, R. H., Nellen, W., Theibert, A., Devreotes, P. and Firtel, R. A. (1986). Phenotypic changes induced by a mutated ras gene during the development of Dictyostelium transformants. Nature 323: 340-343. Reymond, C. D., Nellen, W. and Firtel, R. A. (1985). Regulated expression of ras gene constructs in Dictyostelium transformants. Proc. Natl. Acad. Sci. USA 82: 7005-7009. Robinson, L. C., Gibbs, J. B., Marshall, M. S., Sigal, I. S. and Tatchell, K. (1987). CDC25: a component of the ras-adenylate cyclase pathway in Saccharomyces cerevisiae. Science 235: 1218-1221. Salmien, A. and Novick, P. J. (1987). A ras-like protein is required for a postGolgi event in yeast secretion. Cell 49: 527-538. Sanders, D. A. (1990). A guide to low molecular weight GTPases. Cell Growth Diff. 1:251-258. Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467. Santos, E., Reddy, E. P., Pulciani, S., Feldmann, R. J. and Barbacid, M. (1983). Spontaneous activation of a human proto-oncogene. Proc. Natl. Acad. Sci. USA 80: 4679-4682. Sassone, C. P., Der, C. J. and Verma, I. M. (1989). ras-induced neuronal differentiation of PC12 cells: possible involvement of fos and jun. Mol. Cell. Biol. 9:3174-3183. Satoh, T., Endo, M., Nakafuku, M., Akiyama, T., Yamamoto, T. and Kaziro, Y. (1990a). Accumulation of p21 GTP in response to stimulation with epidermal growth factor and oncogene products with tyrosine kinase activity. Proc. Natl. Acad. Sci. USA 87: 7926-7929. raS-  Satoh, T., Endo, M., Nakafuku, M., Nakamura, S. and Kaziro, Y. (1990b). Platelet derived growth factor stimulates formation of active p21 GTP complex in Swiss mouse 3T3 cells. Proc. Natl. Acad. Sci. USA 87: 5993-5997. ras  Satoh, T., Nakamura, S. and Kaziro, Y. (1987). Induction of neurite formation in PCI 2 cells by microinjection of proto-oncogenic Ha-ras protein preincubated with guanosine-5'-0-(3-thiotriphosphate). Mol. Cell. Biol. 7: 4553-4556. Saxe, C. L. ILL, Johnson, R., Devreotes, P. N. and Kimmel, A. R. (1990). Distinct temporal and spatial patterns of expression for the multiple cAMP receptor genes. Dev. Genet, (in press)  158 Saxe, C. L. III., Klein, P., Sun, T. J., Kimmel, A. R. and Devreotes, P. N. (1988). Structure and expression of the cAMP cell-surface receptor. Dev. Genet. 9: 227235. Saxe, S. A. and Kimmel, A. R. (1988). Genes encoding novel GTP-binding proteins in Dictyostelium. Dev. Genet. 9: 259-265. Saxe, S. A. and Kimmel, A. R. (1990). SAS1 and SAS2, GTP-binding protein genes in Dictyostelium discoideum with sequence similarities to essential genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 10: 2367-2378. Schaap, P. and Van Driel, R. (1985). Induction of post-aggregative differentiation in Dictyostelium discoideum by cAMP - evidence of involvement of the cell surface cAMP receptor. Exp. Cell Res. 159: 388-398. Schaap, P., Van Lookeren Campagne, M. M., Van Driel, R., Spek, W., Van Haastert, P. J. M. and Pinas, J. (1986). Post-aggregative differentiation induction by cyclic AMP Dictyostelium: intracellular transduction pathway and requirement for additional stimuli. Dev. Biol. 118: 52-63. Schafer, W. R., Kim, R., Sterne, R., Thorner, J., Kim, S. H. and Rine, J. (1989). Genetic and pharmacological suppression of oncogenic mutations in RAS genes of yeast and humans. Science 245: 379-385. Schejter, E. D. and Shilo, B.-Z. (1985). Characterization of the functional domains of p21 ras by use of chimeric genes. EMBO J. 4: 407-412. Segall, J. E., Bominaar, A. A., Wallraff, E. and De Wit, R. J. W. (1988). Analysis of a Dictyostelium chemotaxis mutant with altered chemoattractant binding. J. Cell Sci. 91:479-489. Segev, N., Mulholland, J. and Botstein, D. (1988). The yeast GTP-binding YPT1 protein and a mammalian counterpart are associated with the secretory machinery. Cell 52: 915-924. Seuwen, K., Lagarde, A. and Pouyssegur, J. (1988). Deregulation of hamster fibroblast proliferation by mutated ras oncogenes is not mediated by constitutive activation of phosphoinositide-specific phospholipase C. EMBO J. 7: 161-168. Shapiro, R. A., Herrick, D., Manrow, R. E., Blinder, D. and Jacobson, A. (1988). Determinants of mRNA stability in Dictyostelium discoideum amoebae: differences in poly(A) tail length, ribosome loading, and mRNA size cannot account for the heterogeneity of mRNA decay rates. Mol. Cell. Biol. 8: 1957-1969. Sharp, P. M. and Devine, K. M. (1989). Codon usage and gene expression level in Dictyostelium discoideum: highly expressed genes do 'prefer' optimal codons. Nucl. Acids Res. 17: 5029-5039.  159 Shih, T. Y., Papageorge, A. G., Stokes, P. E., Weeks, M. O. and Scolnick, E. M. (1980). Guanine nucleotide binding and autophosphorylating activities associated with the p21 protein Harvey murine sarcoma virus. Nature 287: 686-691. src  Shih, T. Y., Weeks, M. O., Gruss, P., Dahr, R., Oroszlan, S. and Scolnick, E. M. (1982). Identification of a precursor in the biosynthesis of the p21 transforming protein of Harvey murine sarcoma virus. J. Virol. 42: 253-261. Shimizu, K., Goldfarb, M., Suard, Y., Perucho, M., Li, Y., Kamata, T., Feramisco, J., Stavnezer, E., Fogh, J. and Wigler, M. H. (1983). Three human transforming genes are related to the viral ras oncogenes. Proc. Natl. Acad. Sci. USA 80: 21122116. Siess, W., Winegar, D. A. and Lapetina, E. G. (1990). RAP1-B is phosphorylated by protein kinase A in human platelets. Biochem. Biophys. Res. Communun. 170: 944-950. Sigal, I. S., Gibbs, J. B., D'Alonzo, J. S. and Scolnick, E. M. (1986). Identification of effector residues and a neutralizing epitope of Ha-ras-encoded p21. Proc. Natl. Acad. Sci. USA 83: 4725-4729. Small, N. V., Europe-Finner, G. N. and Newell, P. C. (1987). Adaptation to chemotactic cyclic AMP signals in Dictyostelium involves the G-protein. J. Cell Sci. 88:537-545. Smith, D. B. and Johnson, K. S. (1988). Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67: 31-40. Smith, M. R., DeGubicibus, S. J. and Stacey, D. W. (1986). Requirement of c-ras proteins during viral oncogene transformation. Nature 320: 540-543. Snaar-Jagalska, B. E., Kesbeke, F. and Van Haastert, P. J. M. (1988). G-proteins in the signal transduction pathways of Dictyostelium discoideum. Dev. Genet. 9: 215-226. Soil, D. R., Yarger, J. and Mirick, M. (1976). Stationary phase and the cell cycle of Dictyostelium discoideum in liquid nutrient medium. J. Cell Sci. 20: 513-523. Spandidos, D. A. and Pintzas, A. (1988). Differential potency and trans-activation of normal and mutant T24 human H-ras 1 gene promoters. FEBS lett. 232: 269274. Spandidos, D. A. and Wilkie, N. M. (1984). Malignant transformation of early passage rodent cell's by a single mutated human oncogene. Nature 310: 469-475.  160 Srivastava, S. K Lacal, J. C , Reynolds, S. H. and Aaronson, S. A. (1985). Antibody of predetermined specificity to a carboxy-terminal region of H-ras gene products inhibits their guanine nucleotide-binding function. Mol. Cell. Biol. 5: 3316-3319. v  Stacey, D. W. and Kung, H. F. (1984). Transformation of NIH3T3 cells by microinjection of Ha-ras p21 protein. Nature 310: 508-511. Stone, J. C Vass, W. C , Willumsen, B. M. and Lowy, D. R. (1988). p21-ras effector domain mutants constructed by "cassette" mutagenesis. Mol. Cell. Biol. 8: 3565-3569. v  Storms, R. W. and Bose, H. R. (1989). Viral oncogenes and signal transduction. Virus Res. 12:251-282. Sun, T. J., Van Haastert, P. J. M. and Devreotes, P. N. (1990). Surface cAMP receptors mediate multiple responses during development in Dictyostelium: evidenced by antisense mutagenesis. J. Cell. Biol. 110: 1549-1554. Swanson, M. E., Elste, A. M., Greenburg, S. M., Schwartz, J. H., Aldrich, T. H. and Furth, M. E. (1986). Abundant expression ofrasproteins in Aplysia neurons. J. Cell Biol. 103:485-492. Sweet, R. W., Yokoyama, S., Kamata, T., Feramisco, J. R., Rosenberg, M. and Gross, M. (1984). The product of ras is a GTPase and the T24 oncogenic mutant is deficient in this activity. Nature 311: 273-275. Tamanoi, F. (1988). Yeast ras genes. Biochem. Biophys. Acta 948: 1-15. Tanaka, K., Nakafuku, M., Satoh, T., Marshall, M. S., Gibbs, J. B., Mastumoto, K., Kaziro, Y. and Toh-e, A. (1990a). S. cerevisiae genes IRA1 and IRA2 encode proteins that may be functionally equivalent to mammalianrasGTPase activating protein. Cell 60: 803-807.  Tanaka, K., Nakafuku, M., Tamanoi, F., Kaziro, Y., Matsumoto, K. and Toh-e, A. (1990b). IRA2, a second gene of Saccharomyces cerevisiae that encodes a protein with a domain homologous to mammalianrasGTPase-activating protein. Mol. Cell. Biol. 10: 4303-4313. Taparowsky, E., Shimizu, K., Goldfarb, M. and Wigler, M. (1983). Structure and activation of the human N-ras gene. Cell 34: 581-586. Toda, T., Cameron, S., Sass, P., Zoller, M. and Wigler, M. (1987). Three different genes in Saccharomyces cerevisiae encode the catalytic subunits of the cyclic AMP-dependent protein kinase. Cell 50: 277-288.  161 Toda, T., Uno, I., Ishikawa, T., Powers, S., Kataoka, T., Broek, D., Cameron, S., Broach, J. B., Matsumoto, K. and Wigler, M. (1985). In yeast RAS proteins are controlling elements of adenylate cyclase. Cell 40: 27-36. Towbin, H., Staehelin, T. and Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proc. Natl. Acad. Sci. USA 79: 4350-4354. Trahey, M. and McCormick, F. (1987). A cytoplasmic protein stimulates normal N-ras p21 GTPase, but does not affect oncogenic mutants. Science 238: 542-545. Trahey, M., Wong, G., Halenbeck, R., Rubinfeld, B., Martin, G. A., Ladner, M., Long, C. M., Crosier, W. J., Watt, K., Koths, K. and McCormick, F. (1988). Molecular cloning of two types of GAP complementary DNA from human placenta. Science 242:1697-1700. Tsai, M.-H., Yu, C.-L. and Stacey, D. W. (1990). A cytoplasmic protein inhibits the GTPase activity of H-Ras in a phospholipid-dependent manner. Science 250: 982-985. Tsai, M. H., Yu, C. L., Wei, F. S. and Stacey, D. W. (1989). The effect of GTPase activating upon ras is inhibited by mitogenically responsive lipids. Science 243: 522-526. Tsang, A. S., Mahbubani, H. and Williams, J. G. (1982). Cell-type-specific actin mRNA populations in Dictyostelium discoideum. Cell 31: 375-382. Ueda, T., Kikuchi, A., Ohga, N., Yamamoto, J. and Takai, Y. (1989). GTPase activating proteins for the smg-21 GTP-binding protein having the same effector domain as the ras proteins in human platelets. Biochem. Biophys. Res. Commun. 159: 1411-9. Van der Kaay, J., Draijer, R. and Van Haastert, P. J. M. (1990). Increased conversion of phosphatidylinositol to phosphatidylinositol phosphate in Dictyostelium cells expressing a mutated ras gene. Proc. Natl. Acad. Sci. USA 87: 9197-9201. Van Haastert, P. J. M. (1990). Signal transduction and the control of development in Dictyostelium discoideum. Seminars in Developmental Biology 1:159-167. Van Haastert, P. J. M., De Vries, M. J., Penning, L. C , Roovers, E., Van der Kaay, J., Erneux, C. and Van Lookeren Campagne, M. M. (1989). Chemoattractant and guanosine 5'-[gamma-thio] triphosphate induce the accumulation of inositol 1,4,5-trisphosphate in Dictyostelium cells that are labeled with [^Hjinositol by electroporation. Biochem. J. 258: 577-586.  162 Van Haastert, P. J. M., De Wit, R. J. W., Janssens, P. M. W., Kesbeke, F. and DeGoede, J. (1986). G-protein mediated interconversions of cell surface cAMP receptors and their involvement in excitation and desensitization of guanylatecyclase in Dictyostelium discoideum. J. Biol. Chem. 261: 6904-6911. Van Haastert, P. J. M., Kesbeke, F., Reymond, C. D., Firtel, R. A., Luderus, E. and Van Driel, R. (1987a). Aberrant transmembrane signal transduction in Dictyostelium cells expressing a mutated ras gene. Proc. Natl. Acad. Sci. USA 84: 4905-4909. Van Haastert, P. J. M., Snaar-Jagalska, B. E. and Janssens, P. M. W. (1987b). The regulation of adenylate-cyclase by guanine-nucleotides in Dictyostelium discoideum membranes. Eur. J. Biochem. 162: 251-258. Van Lookeren Campagne, M. M., Wang, M., Spek, W., Peters, D. and Schaap, P. (1988). Lithium respecifies cyclic AMP-induced cell-type specific gene expression in Dictyostelium. Dev. Genet. 9: 589-596. Varmus, H. (1988). Retroviruses. Science 240: 1427-1435. Varmus, H. E. (1984). The molecular genetics of cellular oncogenes. Annu. Rev. Genet. 18:553-612. Vaughan, R. A. and Devreotes, P. N. (1988). Ligand-induced phosphorylation of the cAMP receptor from Dictyostelium discoideum. J. Biol. Chem. 263: 1453814543. Vauti, F., Morandini, P., Blusch, J., Sachse, A. and Nellen, W. (1990). Regulation of the discoidin Iy gene in Dictyostelium discoideum: identification of the individual promoter elements mediating induction of transcription and repression by cyclic AMP. Mol. Cell. Biol. 10: 4080-4088. Vogel, U. S., Dixon, R. A. F., Schaber, M. D., Diehl, R. E., Marshall, M. S., Scolnick, E. M., Sigal, I. S. and Gibbs, J. B. (1988). Cloning of bovine GAP and its interaction with oncogenic ras p21. Nature 335: 90-93. Wakelam, M. J. O., Davies, S., Houslay, M. D., McKay, I., Marshall, C. J. and Hall, A. (1986). Normal p 2 1 couples bombesin and other growth factor receptors to inositol phosphate production. Nature 323: 173-176. N-ras  Wallraff, E., Schleicher, M., Modersitzki, M., Rieger, D., Isenberg, G. and Gerisch, G. (1986). Selection of Dictyostelium mutants defective in cytoskeletal proteins: use of an antibody that binds to the ends of alpha-actinin rods. EMBO J. 5: 61-67.  163 Watts, D. J. and Ashworth, J. M. (1970). Growth of myxamoebae of the cellular slime mould Dictyostelium discoideum in axenic medium. Biochem. J. 119: 171-174. Weeks, G., Lima, A. F. and Pawson, T. (1987). Aras-encodedprotein in Dictyostelium discoideum is acylated and membrane-associated. Mol. Microbiol. 1: 347-354. Weeks, G. and Pawson, T. (1987). The synthesis and degradation of ras-related gene products during growth and differentiation in Dictyostelium discoideum. Differentiation 33: 207-213. Wilkison, W. O., Sandgren, E. P., Palmiter, R. D., Brinster, R. L. and Bell, R. M. (1989). Elevation of 1,2-diacylglycerol inras-transformedneonatal liver and pancreas of transgenic mice. Oncogene 4: 625-628. Williams, J. G., Duffy, K. T., Lane, D. P., McRobbie, S. J., Harwood, A. J., Traynor, D. T., Kay, R. R. and Jermyn, K. A. (1989). Origins of the prestalk-prespore pattern in Dictyostelium development. Cell 59: 1157-1163. Willingham, M. C , Pastan, I, Shih, T. Y. and Scolnick, E. M. (1980). Localization of the src gene product of the Harvey strain of MSV to the plasma membrane of transformed cells by electron microscopic immunocytochemistry. Cell 19: 10051014. Willumsen, B. M., Christensen, A., Hubbert, N. L., Papageorge, A. G. and Lowy, D. R. (1984a). The p21rasC-terminus is required for transformation and membrane association. Nature 310: 583-586. Willumsen, B. M., Norris, K., Papageorge, A. G., Hubbert, N. L. and LOwy, D. R. (1984b). Harvey murine sarcoma virus p21 ras protein: Biological and biochemical significance of the cysteine nearest the carboxy terminus. EMBO J. 3: 2581-2585. Willumsen, B. M., Papageorge, A. G., Kung, H., Bekesi, E., Robins, T., Johnsen, M., Vass, W. C. and Lowy, D. R. (1986). Mutational analysis of arascatalytic domain. Mol. Cell. Biol. 6: 2646-2654. Witke, W., Nellen, W. and Noegel, A. (1987). Homologous recombination in the Dictyostelium a-actinin gene leads to an altered mRNA and lack of the protein. EMBO J. 6: 4143-4148. Wolfman, A. and Macara, I. G. (1987). Elevated levels of diacylglycerol and decreased phorbol ester sensitivity inras-transformedfibroblasts. Nature 325: 359-361.  164 Wolfman, A. and Macara, I. G. (1990). A cytosolic protein catalyzes the release of GDP from p21ras. Science 248: 67-9. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33:103-119. Yatani, A., Okabe, K., Polakis, P., Halenback, R., McCormick, F. and Brown, A. M. (1990). ras p21 and GAP inhibit coupling of muscarinic receptors to atrial K channels. Cell 61: 769-776.  +  Yu, C.-L., Tsai, M.-H. and Stacey, D. W. (1988). Cellular ras activity and phospholipid metabolism. Cell 52: 63-71. Yu, C.-L., Tsai, M.-H. and Stacey, D. W. (1990). Serum stimulation of NIH3T3 cells induces the production of lipids able to inhibit GTPase-activating protein activity. Mol. Cell. Biol. 10: 6683-6689. Zhang, K., DeClue, J. E., Vass, W. C , Papageorge, A. G., McCormick, F. and Lowy, D. R. (1990a). Suppression of c-ras transformation by GTPase-activating protein. Nature 346: 754-756. Zhang, K., Noda, M., Vass, W. C , Papageorge, A. G. and Lowy, D. R. (1990b). Identification of Small Clusters of Divergent Amino Acids That Mediate the Opposing Effects of ras and Krev-1. Science 249: 162-165.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100628/manifest

Comment

Related Items