Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of lipid signaling and metabolism in morphogenesis and pathogenesis of the fungal pathogen Ustilago… Klose, Jana 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-267400.pdf [ 21.47MB ]
Metadata
JSON: 831-1.0100597.json
JSON-LD: 831-1.0100597-ld.json
RDF/XML (Pretty): 831-1.0100597-rdf.xml
RDF/JSON: 831-1.0100597-rdf.json
Turtle: 831-1.0100597-turtle.txt
N-Triples: 831-1.0100597-rdf-ntriples.txt
Original Record: 831-1.0100597-source.json
Full Text
831-1.0100597-fulltext.txt
Citation
831-1.0100597.ris

Full Text

THE ROLE OF LIPID SIGNALING AND METABOLISM IN MORPHOGENESIS AND PATHOGENESIS OF THE FUNGAL PATHOGEN USTILAGOMAYDIS by JANA KLOSE A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE RQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Microbiology) THE UNIVERSITY OF BRITISH COLUMBIA December 2006 © Jana Klose, 2006 ABSTRACT The phytopathogenic fungus  Ustilago  maydis  is obligately dependent on infection  of maize to complete the sexual phase of  its life  cycle. Mating interactions between budding cells establish an infectious  filamentous  cell type that invades the host, induces tumors, and forms  teliospores. The yeast-to-filamentous  morphological transition is regulated by cAMP and MAPK signaling pathways known to control the pathogenic development in the host. The signals influencing  this transition during infection  have not yet been identified.  In this study, we demonstrated that lipids triggered the dimorphic switch to promote a filamentous phenotype resembling the infectious  filaments  found  in planta,  which was dependent on cAMP and Ras/MAPK signaling. In addition, low levels of  lipids (4nM) induced the response suggesting that they are acting as ligands to trigger the morphological change. Overall, lipids may represent one of  the signals that promotes and maintains filamentation  of the fungus  in the host. To explore potential metabolic and signaling roles of  lipids in morphogenesis and pathogenesis, we deleted genes encoding enzymes in the P-oxidation of  fatty  acids (mfe2, peroxisomal multifunctional  enzyme; hadl,  mitochondrial 3-hydroxyacyl-CoA dehydrogenase) and a phospholipase A2 {lip2).  Loss of  mfe2  blocked extensive proliferation of  fungal  filaments  in planta,  delayed sporulation and reduced virulence. Loss of  hadl resulted in attenuation of  disease symptoms and impaired teliospore germination. These findings  suggest that mitochondrial P-oxidation may be crucial during teliospore germination and initial stages of  in planta  fungal  development, and that peroxisomal P-oxidation may be required during later stages of  in planta  development. In addition, Mfe2  and Hadl were specifically  required for  the filamentation  induced by linoleic and myristic acid, respectively. Overall, lipids represent an important carbon source during biotrophic growth, and lipid utilization by U.  maydis  may influence  additional aspects of  infection  (i.e., signal perception or host defense).  Loss of  lip2 resulted in more severe symptom development and more rapid teliospore maturation during infection.  The Lip2 function  might be important during fungus-host interactions to limit premature development of  disease symptoms prior to sporulation. In summary, this work contributes to the emerging idea that lipid metabolism and signaling are important for  biotrophic interactions between plants and fungal  pathogens. TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iii LIST OF TABLES vii LIST OF FIGURES viii LIST OF ABBREVIATIONS x ACKNOWLEDGEMENTS xii CO-AUTHORSHIP STATEMENT xiii 1. INTRODUCTION 1 1.1. Plant infection  and fungal  biotrophy 1 1.2. Morphogenesis and pathogenesis in Ustilago  maydis  3 1.2.1. The biotrophic life  style of  U.  maydis  3 1.2.2. Disease symptoms caused by U.  maydis  5 1.2.3. Early infection  stages 7 1.2.4. Proliferation  and differentiation  in the plant host 9 1.2.5. Regulation of  morphogenesis and pathogenesis in U.  maydis  12 1.2.6. Mating 12 1.2.7. MAP kinase signaling 16 1.2.8. cAMP signaling pathway 17 1.2.9. Crosstalk between the cAMP and MAPK signaling pathways 18 1.3. Lipid signaling in fungal  pathogens 19 1.3.1. Lipids and early stages of  fungal  development 20 1.3.2. Lipids in development and sporogenesis in fungi  20 1.3.3. Cellular lipids and fungal  dimorphism 22 1.4. Lipid metabolism in fungal  pathogenesis 22 1.4.1. P-oxidation of  fatty  acids 26 1.4.1.1. P-oxidation systems in mammalian cells 28 1.4.1.2. P-oxidation in Saccharomyces  cerevisiae 30 1.4.1.3. Induction of  the peroxisomal p-oxidation system 31 1.4.1.4. Substrates and enzymatic reactions of  peroxisomal p-oxidation 31 1.4.1.5. Fatty acid transport 32 1.4.2. Hydrolytic enzymes: Phospholipases and Lipases 33 1.4.2.1. Phospholipases 33 1.4.2.2. Triglyceride lipases 35 1.4.2.3. Lipid modifying  enzymes 36 1.5. Rationale and Aims of  this Study 37 1.5.1. Hypotheses 37 1.5.2. Research objectives 38 1.5.3. Significance  39 1.6. References  40 2. LIPID-INDUCED FILAMENTOUS GROWTH IN USTILAGO  MAYDIS  59 2.1. Introduction 59 2.2. Results 61 2.2.1. Growth on triglycerides promotes a filamentous  morphology 61 2.2.2. Fatty acids supplied as tweens promote filamentous  growth 62 2.2.3. Invasive filamentous  growth occurs on solid medium supplemented with fatty  acids 67 2.2.4. Components of  two signaling pathways are required for  the response to lipids 69 2.2.5. Glucose suppression of  the filamentous  growth response 70 2.2.6. The morphology of  lipid-induced filaments  resembles in vivo filaments  71 2.2.7. Triglycerol lipase activity is found  in lipid-grown cultures 73 2.3. Discussion 75 2.3.1. Lipid-induced filaments  resembled the cells found  in plant tissue 75 2.3.2. Role of  the nutrient-sensing cAMP pathway in morphogenesis 76 2.3.3. Glucose suppression suggests a metabolic component for  lipid-induced filamentation  77 2.3.4. Could a lipid signal act through the Ras/MAPK pathway? 78 2.3.5. Lipid signaling in fungi  79 2.3.6. Summary 80 2.4. Material and Methods 80 2.4.1. Strains and growth conditions 80 2.4.2. Invasion assay 81 2.4.3. Microscopy, staining, and photography 81 2.4.4. Triglycerol lipase assay 81 2.5. Tables 82 2.6. References  83 3. THE MULTIFUNCTIONAL P-OXIDATION ENZYME IS REQUIRED FOR FULL SYMPTOM DEVELOPMENT BY THE BIOTROPHIC MAIZE PATHOGEN USTILA  GO MA  YDIS  90 3.1. Introduction ; 90 3.2. Results 93 3.2.1. Identification  of  genes encoding peroxisomal P-oxidation enzymes 93 3.2.2. Induction of  mfe2  gene expression by fatty  acids 94 3.2.3. Targeted deletion of  the mfe2  gene 97 3.2.4. Growth and Filamentation on Long Chain Fatty Acids (LCFA) 97 3.2.5. Growth and Filamentation on Very Long Chain Fatty Acids (VLCFA) 100 3.2.6. Growth and Filamentation on Short Chain Fatty Acids (SCFA) and Medium Chain Fatty Acids (MCFA) 101 3.2.7. Cellular Lipid Accumulation Is Influenced  by Loss of  Peroxisomal p-oxidation 101 3.2.8. Mfe2  Is Not Required for  the Production of  Mating Filaments 105 3.2.9. Loss of  mfe2  Results in Attenuation of  Virulence during Plant Infection  105 3.2.10. mfe2  mutant strains do not proliferate  extensively in planta  107 3.2.11. Deletion oimfe2  Delays Teliospore Development within Tumor Tissue 109 3.3. Discussion I l l 3.3.1. Fungal Phytopathogenesis and Lipid Utilization I l l 3.3.2. Possible Roles for  Lipid Signaling in Fungal Morphogenesis and Plant Defense  114 3.4. Materials and Methods 116 3.4.1. Growth Conditions 116 3.4.2. Strains, Deletion Constructs and Transformation  Procedures 117 3.4.3. RNA Isolation and Northern Analysis 118 3.4.4. Sequence Analysis 118 3.4.5. Microscopy and Staining Procedures 118 3.4.6. Lipid Extraction and Fatty Acid Analysis 119 3.4.7. Mating and Virulence Assays 120 3.4.8. Accession Numbers 120 3.5. Tables 121 3.6. References  123 4. HAD1 IS REQUIRED FOR TELIOSPORE GERMINATION AND MAY PLAY A ROLE IN EARLY STAGES OF IN  PLANTA  FUNGAL DEVELOPMENT IN USTILAGO  MAYDIS  131 4.1. Introduction 131 4.2. Results 133 4.2.1. hadl  transcript levels are regulated by growth in fatty  acids 135 4.2.2. Generation of  hadl  mutant strains 138 4.2.3. Deletion of  hadl  eliminated growth on short-chain and medium-chain fatty  acids 138 4.2.4. Myristic acid does not induce filamentation  in hadl  mutants 140 4.2.5. Intracellular lipid accumulation in hadl  mutants 142 4.2.6. Deletion of  hadl  does not impair mating ability in U.  maydis  142 4.2.7. hadl  mutants have reduced virulence in maize seedlings 145 4.2.8. Hadl is required for  teliospore germination 146 4.3. Discussion 147 4.4. Material and Methods 152 4.4.1. Growth conditions 152 4.4.2. Strains, deletion constructs and transformation  procedures 153 4.4.3. RNA isolation and northern analysis 154 4.4.4. Sequence analysis 155 4.4.5. Mating and pathogenicity assays 155 4.4.6. Teliospore isolation and germination... 155 4.4.7. Microscopic analysis 156 4.4.8. Accession Numbers 156 4.5. Tables 157 4.6. References  158 5. PHOSPHOLIPASE A2 ATTENUATES THE DISEASE SYMPTOM DEVELOPMENT DURING INFECTION OF USTILAGO  MAYDIS  164 5.1. Introduction 164 5.2. Results 168 5.2.1. Genes coding for  putative phospholipases 168 5.2.2. Iip2  gene identification  in the U.  maydis  genome 169 5.2.3. Construction of  lip2 mutants 169 5.2.4. Iip2  mutants respond to fatty  acids by growing filaments  170 5.2.5. Lip2 is not required during the early stages of  pathogenic development including mating and penetration 172 5.2.6. Deletion of  lip2 results in more severe disease symptom development in maize seedlings 175 5.2.7. Deletion of  lip2 enhances teliospore development 176 5.3. Discussion 177 5.4. Materials and Methods 181 5.4.1. Media and Growth Conditions 181 5.4.2. DNA Manipulations 182 5.4.3. Strains 182 5.4.4. Sequence Analysis 183 5.4.5. Microscopic Analysis 183 5.4.6. Virulence Assays 183 5.4.7. In  planta  Phenotypic Analysis 184 5.4.8. Teliospore Isolation and Germination 184 5.4.9. Accession Numbers 185 5.5. Tables 186 5.6. References  187 6. DISCUSSION 192 6.1. The role of  lipids in plant-fungal  interactions 192 6.2. Lipids as a novel signal in fungal  morphogenesis 192 6.3. The role of  P-oxidation in the pathogenesis of  U.  maydis  194 6.4. Future perspectives 197 6.5. References  202 LIST OF TABLES Table 2.1 Strains used in this study 82 Table 3.1 Fatty acid profiles  of  total internal lipids extracted from  U.  maydis  wild-type (a2b2) and mfe2  mutant (Amfe2  a2b2) strains grown either on glucose or oleic acida 121 Table 3.2 Pathogenicity of  mfe2  mutants" 122 Table 4.1 Pathogenicity of  hadl  mutants0 157 Table 5.1 Pathogenicity of  lip2 mutants0 186 LIST OF FIGURES Figure 1.1 Disease symptoms caused by U.  maydis  6 Figure 1.2 The life  cycle of  U.  maydis  8 Figure 1.3 Signaling networks in U.  maydis  13 Figure 1.4 A dikaryotic filament  produced during the mating reaction between haploid cells of  U.  maydis  15 Figure 1.5 P-oxidation of  fatty  acids 27 Figure 1.6 Enzymes of  peroxisomal and mitochondrial P-oxidation systems in higher eukaryotes 29 Figure 2.1 Morphological response of  U.  maydis  strains to triglycerides, fatty  acids, and glucose 63 Figure 2.2 Cellular morphology of  U.  maydis  wild-type strains in the presence of fatty  acids 65 Figure 2.3 Morphological response of  U,  maydis  to various concentrations of  fatty  acids 66 Figure 2.4 Invasive hyphal growth of  U.  maydis  induced by fatty  acids 68 Figure 2.5 In  vitro filaments  of  U.  maydis  induced by fatty  acids 72 Figure 2.6 The extracellular lipase activity in cultures of  U.  maydis  during the response to fatty  acids 74 Figure 3.1 Organization of  the peroxisomal multifunctional  enzymes (type 2) 95 Figure 3.2 RNA blot analysis of  mfe2  transcript levels in the presence of  fatty  acids 96 Figure 3.3 Morphology and growth of  mfe2  mutant strains on fatty  acids differing  in carbon chain length and saturation state 98 Figure 3.4 Intracellular lipids in U.  maydis  103 Figure 3.5 Mating filaments  produced by compatible mfe2  mutant strains during mating 106 Figure 3.6 Hyphal morphology in planta  108 Figure 3.7 Teliospore production of  mfe2  mutants is compromised in mature tumors 110 Figure 4.1 Sequence alignment of  the U.  maydis  Hadl polypeptide with 3-hydroxyacyl-CoA dehydrogenases (HADs) from  different  organisms 136 Figure 4.2 Transcript levels for  the hadl  gene in cells grown in fatty  acids that differ  in their chain length 137 Figure 4.3 Targeted gene deletion of  the U.  maydis  hadl  gene 139 Figure 4.4 Cellular growth of  hadl  mutants on short and medium chain fatty  acids 141 Figure 4.5 Fatty acid-induced filamentation  in hadl  mutant strains 143 Figure 4.6 Intracellular lipid accumulation in hadl  mutant strains 144 Figure 4.7 Hadl is required for  teliospore germination 148 Figure 5.1 Sites of  action of  various phospholipases 166 Figure 5.2 Targeted gene deletion of  lip2 gene in U.  maydis  171 Figure 5.3 Cellular morphology in response to oils and fatty  acids 173 Figure 5.4 Response of  lip2 mutants to mating 174 Figure 5.5 Teliospore development on floral  tissue by wild-type strains and lip2 mutants 178 Figure 5.6 Teliospore germination in lip2 mutants 179 Figure 6.1 Potential roles of  p-oxidation during U.  maydis  infection  201 LIST OF ABBREVIATIONS aa amino acid ABC ATP biding cassette AC adenylyl cyclase ATP adenosine triphosphate BLAST Basic Local Alignment Search Tool C Celsius cAMP cyclic adenosine mono-phosphate CM complete medium CoA coenzyme A DAG diacylglycerol DIC differential  interference  contrast HAD 3-hydroxyacyl-CoA dehydrogenase hr hour hyg hygromycin JA jasmonic acid kb kilobase pair LCFA long-chain fatty  acids LDS linoleate diol synthase MAPK mitogen activated kinase MCFA medium-chain fatty  acids uL microliter mL milliliter nat nourseothricin ORF open reading frame PAFAH platelet-activated factor_acylhydrolase PC phosphatidylcholine PCR polymerase chain reaction PDA potato dextrose agar PDB potato dextrose broth PI phosphatidylinositol PKA protein kinase A PLA1 phospholipase A1 PLA2 phospholipase A2 PLB phospholipase B PLC phospholipase C PLD phospholipase D PRE pheromone response element rpm revolutions per minute SA salicylic acid SAGE Serial Analysis of  Gene Expression SAR systemic acquired resistance SCFA short-chain fatty  acids TCA trichloric acid TGL triglyceride lipase TEM transmission electron microscopy VLCFA very long-chain fatty  acids ACKNOWLEDGEMENTS This work would not have been possible without the help and supervision of Dr. James Kronstad. I am grateful  for  all of  his guidance and support, which has been paramount in my scientific  achievement. I am also thankful  for  the useful  advise and criticism provided by my committee members, Drs. Gerry Weeks, Xin Lee, and Brian Ellis. I am appreciative for  advice and insight from  members of  the Kronstad Lab, Drs. Nancy Lee, Tian Lian, Cletus D'Souza, and Guanggan Hu for  scientific  advice and technical help, and Drs. Sarah Kidd and Kristin Tangen for  their friendships  that have made my time at UBC fun.  I would also like to acknowledge Drs. Chris Keeling, Elaine Humphrey, and Kim Rensing for  technical assistance and Drs. Lacey Samuels, Vesna Katavic, and Ljerka Kunst for  helpful  discussions. Most importantly I would like to thank my mother and father  that have always encouraged my learning and intellectual development, and my sister for  her great support in my life.  Finally, I would like to thank my husband, Lukas Klose, for  his great support and encouragement in my professional development, and the love and happiness he has brought into my life. During my doctoral work, I was generously supported by the following  fellowships: Natural Sciences and Engineering Research Council of  Canada Fellowship University of  British Columbia Graduate Student Fellowship CO-AUTHORSHIP STATEMENT The work presented herein is the culmination of  research from  2001 to 2006. Below is the list of  papers that have been published/accepted/in preparation as a result of this work, and the contribution made by the candidate: Chapter 2 Klose, J., Moniz de Sa, M. M., and Kronstad, J. W. (2004). Lipid-induced filamentous  growth in Ustilago  maydis.  Mol Microbiol 52, 823-35. The candidate is responsible for  all of  the work completed in this chapter. The second author has made the initial observation that plant oils trigger filamentation  in U. maydis,  on which the work described in this paper is based. The writing of  the manuscript was completed by Dr. Kronstad, who acted as a supervisor for  this project, and the candidate. Chapter 3 Klose, J., and Kronstad, J. W. (2006). The multifunctional  beta-oxidation enzyme is required for  full  symptom development by the biotrophic maize pathogen Ustilago  maydis.  Eukaryot Cell 22, 22. (on-line early) The work detailed in this chapter was completed solely by the candidate. The writing of  the manuscript was completed by Dr. Kronstad, who acted as a supervisor for this project, and the candidate. Chapter 4 Klose, J., and Kronstad, J. W. Hadl is required for  teliospore germination and may play a role in early stages of  in planta  fungal  development in U.  maydis  (in preparation) The work detailed in this chapter was completed solely by the candidate. The writing of  the manuscript is being completed by Dr. Kronstad, who acted as a supervisor for  this project, and the candidate. Chapter 5 Klose, J., and Kronstad, J. W. Phospholipase A2 attenuates the disease symptom development during infection  of  U.  maydis  (in preparation) The work detailed in this chapter was completed solely by the candidate. The writing of  the manuscript is being completed by Dr. Kronstad, who acted as a supervisor for  this project, and the candidate. 1. INTRODUCTION 1.1. Plant infection  and fungal  biotrophy Biotrophic pathogens such as the maize smut fungus  Ustilago  maydis  must grow on their hosts to propagate and cause disease. This interaction is typified  by an intimate relationship in which host cells stay alive while metabolites are redirected to feed  the pathogen. Biotrophic interfaces  are formed  in symbiotic and parasitic plant-fungal interactions. They result from  coordinated developmental programs in both partners and represent specialized platforms  for  the exchange of  information  and nutritional metabolites. Three types of  biotrophy can be distinguished: obligate, semi-obligate and hemi-obligate biotrophy. Semi-obligate biotrophic fungi  such as U.  maydis  develop a biotrophic relationship with their host that lasts for  nearly all the life  cycle of  the fungus. Often,  an early phase of  the life  cycle takes place outside of  a host and the life  cycle continues only if  a host plant is available to the fungus.  Hemiobligate-biotrophic fungal pathogens have an initial biotrophic phase that is followed  by a necrotrophic phase, in which the fungus  kills the host plant cells and feeds  off  the dead tissue. Much of  what we know about biotrophic fungi  and their metabolism comes from  the studies on hemi-obligate biotrophs such as Cladosporium  fulvum  (Thomma et al., 2005), Magnaporthe grisea (Talbot, 2003), and Mycosphaerella  graminicola  (Palmer and Skinner, 2002). Much less is known about the obligate biotrophs, such as the rust fungi  or powdery mildews, which only grow in association with host plants. Biotrophic relationships are also established in symbiotic host-fungus  interactions involving mycorrhizal fungi  (Bago and Becard, 2002). Successful  colonization of  host tissues by biotrophic pathogens depends on their ability to utilize the available nutrient sources offered  by plants as well as on their ability to penetrate plants and evade defensive  mechanisms. Biotrophic fungi  form  specialized infectious  structures to achieve critical stages during pathogenesis, including attachment, host recognition, penetration, proliferation  and nutrition, which are controlled by complex regulatory pathways (Kahmann and Basse, 2001; Lee et al., 2003). Some of  the early observations of  morphological changes that take place during fungal  infection  were described as early as 1899 by the botanist Anton deBary (1866). He observed that plant parasitic fungi  alter their hyphal morphology in response to structural and physiological features  of  the host surface  soon after  germination. The early stages of  infection,  such as adhesion, appressorium (i.e., a round melanized penetration structure) formation  and penetration (reviewed for  several plant pathogenic fungi  in Hardham, 2001; Tucker and Talbot, 2001) ensure reliable infection  while causing minimal damage to the host cells. At this stage, pathogenic fungi  undergo various morphological changes to assist in penetration of  a plant cell surface.  For example, in rust fungi,  the tip of  dikaryotic germ tube can follow  topographical features  of  the plant cuticle to find  stomatal openings where they enter host tissue (Staples and Hoch, 1997.). Similarly, chemical signals such as leaf  alcohols can also contribute to the unique recognition system between a fungus and a host plant surface  (Collins et al., 2001). In a phytopathogen Colletotrichum gloeosporioides,  plant surface  waxes act as signals that trigger germination and appressorium formation  (Kolattukudy et al., 1995). In other fungi  such as M.  grisea, host surface  and rapid mobilization of  lipid and/or carbohydrate reserves influence  the appressorium formation,  which differentiates  from  the end of  a fungal  germ tube after spore germination on a plant surface.  After  the penetration of  plant epidermal cells, biotrophic fungi  must establish themselves within host tissue and access nutrients from the host. Biotrophic fungi  use different  strategies to gain access to host nutrients. The biotrophic life  style is achieved in many ways: intercellular (C. fulvum)',  subcuticular (Venturia  inaequalis)',  inter- and intracellular (Claviceps  purpurea, U.  maydis)', extracellular with haustoria within epidermal cells (powdery mildews); and intercellular with haustoria (i.e., feeding  structures) within parenchyma cells (rust fungi  and downy mildews). As mentioned, hemiobligate biotrophic fungi  (M grisea, Phytophtora infestans,  Colletotrichum  spp.) grow initially as biotrophs and switch to necrotrophic growth later in development. Very little is known about fungal  nutritional requirements during their biotrophic phase. There is some evidence that phytopathogens can metabolize all the major substrates in vitro (Bailey et al., 2000; Jennings and Lysek, 1996; Lehtinen, 1993; Murphy and Walton, 1996; Noeldner et al., 1994). However, it is difficult  to assess nutritional requirements during biotrophic host-fungus  interactions, especially those of  obligate pathogens, because they cannot be grown in culture. Because these fungi  can grow only in association with a plant, the regulation of  nutrient assimilation and associated enzymes must be dependent on factors  or signals produced by the plant. Recently, genomic studies have indicated that the obligate biotroph Blumeria graminis (powdery mildew) expresses genes required for  glycogen breakdown, glycolysis, lipolysis, (3-oxidation and the TCA cycle (Both et al., 2005; Thomas et al., 2002; Thomas et al., 2001). Targeting potential weakness in fungal  metabolism may lead to a discovery of  new antifungal  strategies. Successful  biotrophic interactions between a fungus  and its host also require the ability of  a fungus  to bypass the plant defense  mechanisms. Plants are resistant to the majority of  potential pathogens that they are in constant contact with, due to the inability of  the pathogen to avoid recognition or to suppress plant defense.  The infectious structures such as appressoria, penetration hyphae and infection  hyphae are formed  to invade the plant with minimal damage to the host cells. To establish compatibility with the host, controlled secretion and distinct interface  layers appear to be essential (Hahn and Mendgen, 2001). Highly developed infectious  structures, limited secretory activity (especially of  lytic enzymes), carbohydrate-rich and protein-containing interfacial  layers that separate fungal  and plant plasma membranes, and long-term suppression of  host defense  are the hallmarks of  biotrophic fungi.  Properties such as the production of toxins, the elaboration of  cell wall degrading enzymes, specialized structures for  host penetration, specific  signal transduction components and avirulence genes are also well characterized as pathogenicity factors  in these systems (Idnurm and Howlett, 2001) 1.2. Morphogenesis and pathogenesis in Ustilago  maydis 1.2.1. The biotrophic life  style of  U.  maydis U.  maydis  displays dimorphic growth alternating between a budding haploid form and a filamentous  dikaryon that results from  the mating of  two haploid cells. This morphological transition corresponds to a change from  saprophytic to pathogenic development. U.  maydis  is a semi-obligate parasite because the haploid form  can be propagated on artificial  media, but the fungus  requires plant tissue for  proliferation  and sporulation after  the formation  of  the filamentous  dikaryon. Upon host infection,  U. maydis  induces the production of  large tumors that provide an optimal environment for massive hyphal proliferation,  differentiation  of  sporogenic hyphae and karyogamy, and finally  production of  darkly pigmented diploid teliospores. It has been hypothesized that the establishment of  the biotrophic phase in the U. maydisfhost  plant interaction involves redirection of  host metabolism to the site of  fungal growth. The intimate relationship between U.  maydis  and its host implies that the fungus has evolved highly specialized mechanisms to recognize and adapt to its particular host. It is generally accepted that U.  maydis  is not systemically distributed but that it is localized to meristematic areas of  the plant (Christensen, 1963). The regulation of developmental processes of  the fungus  during infection  is poorly understood, and host signals involved in these processes are still unknown. In addition, DNA array analyses have been conducted to identify  fungal  genes that are expressed during fungal  growth in the plant (Kamper et al., 2006). Preliminary data indicate that a set of  more than 500 fungal  genes is plant regulated. This set includes genes encoding for  potential transporters for  sugars and amino acids, which is likely to reflect  the adaptation of  U. maydis  to the conditions in the plant apoplast. The analysis of  these genes may provide important insights into nutrient acquisition during the pathogenic phase. Recently, the analysis of  the available genome sequence revealed that the number of  secreted proteins that could serve as effector  proteins during the establishment of  the fungus/host  interface  is significantly  smaller than in other phytopathogenic fungi (Kamper et al., in press). A very high percentage of  the secreted proteins are U.  maydis-specific  at the sequence level and many of  the respective genes are arranged in gene clusters of  three to 23 genes. Knockout mutants generated for  the genes in these clusters revealed a dramatic reduction in virulence and, in one case, mutants were hypervirulent because they caused more pronounced and earlier disease symptoms than the parental wild-type strains. Microscopic observations showed that the mutants arrest at discrete stages of  biotrophic growth and many are deficient  in tumor formation.  Therefore,  the secreted proteins are required at different  stages of  fungal  development within plant tissue and could be the long sought-after  effectors  for  establishment of  biotrophy. In addition, U.  maydis  seems to be poorly equipped with the cell wall degrading enzymes often  used by phytopathogens to attack their hosts (Kamper et al., in press). These enzymes may be used by U.  maydis  only to penetrate plant cells but not to provide for nutrients during biotrophic growth. This may reflect  a specific  strategy to minimize host damage during infection,  which may help to avoid plant defense  responses that are often triggered by cell wall fragments  (Mohnen and Hahn, 1993). One of  the unresolved questions in the U.  maydis/maize  interaction is how the fungus  evades plant defense  responses during its intimate contact with the host. The current hypothesis is that this occurs either by detoxification  of  reactive oxygen species produced by the host or from  active suppression of  defense  responses. It has also been proposed that U.  maydis  escapes induction of  a classical host defense  due to its extensive proliferative  capacity (Basse, 2005). Changes in transcript levels of  maize genes related to metabolism and development have been characterized during U.  maydis  infection (Basse, 2005). Another unresolved question is what are the nutritional requirements of U.  maydis  during its biotrophic phase. Very little is known about the ability of  U.  maydis to utilize nutrients provided by a plant during infection. 1.2.2. Disease symptoms caused by U.  maydis U.  maydis  is a member of  a group of  smut fungi  that infect  a large number of dicotyledonous and monocotyledonous plants, including some of  the world's major cereal crops, reducing yield and causing severe economic losses (Martinez-Espinoza et al., 2002; Agrios, 1988; Christensen, 1963). In general, smut fungi  have narrow host range and an individual Ustilago  species often  infect  only closely related plant species. For example, U.  maydis  infects  only maize (Zea mays) and its close relative teosinte (Euchlena  mexicana). A hallmark of  the maize smut disease is the formation  of  large tumors, which develop on all aerial parts of  the plant, leading to stunted growth and significant  reduction in crop yield (Christensen, 1963) (Figure 1.1). Early disease symptoms of  infected  maize {Zea  mays) plants are chlorosis (yellowing of  tissue), the formation  of  anthocyanin pigment, and stunted growth (Figure 1.1 A and B). Tumor formation  is associated with plant cell enlargement and proliferation that takes place later during disease development (Callow and Ling, 1973; Snetselaar and Mims, 1994). Figure 1.1 Disease symptoms caused by U.  nuiyilis. (A) Chlorosis or the yellowing of  green leaf  tissue is the first  sign of  infection.  (B) Anthocyanin (purple) pigmentation (white arrow) on leaf  tissue develops during early stages of  infection  and tumors also develop on leaves (black arrow). (C) Large tumors near the base of  a plant. (D) Tumors produced on developing ears of  mature maize plants. Although U.  maydis  can infect  any part of  the plant, the ears of  mature maize plants are the prime sites of  infection  (Figure 1.1B, C and D). In maize seedlings, the fungus  tends to infect  meristematic tissue at the base of  the second leaf,  which becomes neoplastic (Callow and Ling, 1973). The whole third leaf  may become so heavily infected  that it fails  to unroll. Although infection  may be localized to centers of meristematic activity, chlorosis develops in regions of  the plant in the absence of  fungal hyphae (Callow and Ling, 1973). In the infected  cob, the fungus  literally replaces the normal kernels with large distorted tumor cells. These tumors, often  called galls, are made up of  enlarged cells of  the infected  plant within which the filamentous  cells of  the fungus  proliferate  and eventually differentiate  into black spores. The galls are at first enclosed in a silvery white membrane. As they mature, the membrane breaks and a black, powdery mass of  spores is exposed. The spores give the cob a burned, scorched appearance. The name Ustilago  comes from  the Latin word ustilare  (to burn). Tumors on the leaves and tassels usually appear as very small galls that eventually become hard and dry. 1.2.3. Early infection  stages As described above, U.  maydis  is a biotrophic pathogen that depends on living plant cells to complete its life  cycle (Figure 1.2). Pathogenic development is initiated by the filamentous  dikaryon that results from  fusion  of  two compatible haploid cells (IN) (Martinez-Espinoza et al., 1993; Snetselaar and Mims, 1992, 1993). The haploid, non-pathogenic, cells are cigar-shaped, and daughter cells arise by budding (Christensen, 1963; Banuett, 1992). Haploid budding can continue indefinitely  as long as nutrients are available. Upon receiving a pheromone signal from  a mating partner, the budding haploid cells form  conjugation hyphae, which start growing towards each other, and eventually fuse  at their tips. The resulting dikaryon (N+N) exhibits filamentous  growth. On the plant surface,  the dikaryon differentiates  and forms  appressorium-like structures that allow direct penetration of  the cuticle, presumably aided by lytic enzymes (Snetselaar and Mims, 1993). c c o> Mating Yeast cells (IN) A Meiosis Dikaryon (N+N) Infection Tumor formation Teliospores (2N) Filamentous dikaryon (N+N) Figure 1.2 The life  cycle of  U.  maydis. Saprophytic haploid cells (IN) are non-pathogenic and grow by budding. A pathogenic dikaryon (N + N) results from  fusion  of  two compatible haploid cells and has a filamentous  morphology. After  infection  of  the plant, tumor formation  is induced and fungal  filaments  differentiate  within the tumors to eventually generate teliospores (2N). The diploid spores undergo meiosis to form  haploid sporidia. Maintenance of  parasitic growth is dependent on the presence of  the host (Zea mays). The appressorium in U.  maydis  is not a very prominent structure and differs substantially from  the true appressorium (i.e., rounded melanized structures) formed  by M.  grisea and Colletotrichum  graminicola  where entry occurs by mechanical force  after build-up of  enormous turgor pressure within their appressorium that penetrates plant surface  by mechanical force  (Bechinger et al., 1999; de Jong et al., 1997). The U.  maydis appressorium is not melanized and can be seen only as a swelling of  the hyphal tip that is not sealed off  from  the hyphae by a septum prior to penetration (Snetselaar and Mims, 1993). It is not yet clear whether plant entry for  U.  maydis  is dependent on lytic enzymes. The fungus  produces fibrous  material between the appressorium-like swelling and the host cell wall, and this may indicate the production of  adhesion matrix that may contain lytic enzymes (Snetselaar and Mims, 1993). The fungal  entry into the host may also occur through wounds or through host stomata (Banuett and Herskowitz, 1996). During penetration, the plasma membrane of  the host invaginates and surrounds the infection  hyphae, shielding the fungus  from  direct contact with the host cytoplasm (Snetselaar and Mims, 1994.; Snetselaar and Mims, 1992; Banuett and Herskowitz, 1996). Following penetration, U.  maydis  grows intracellularly and develops an extensive interaction zone around the infecting  hyphae. The establishment of  an interaction zone between the plant and fungal  membranes is though to be associated with extensive membrane recycling and accumulation of  secreted material (Bauer et al., 1997). In contrast, many obligate biotrophic pathogens such as rusts form  specialized infection structures (haustoria) that invade host cells without breaching the plant cell plasma membrane; these structures then engage in the acquisition of  nutrients and may deliver proteins (Birch et al., 2006; Mendgen and Hahn, 2002). In addition, there is no typical host defense  response to U.  maydis  during the early stages of  infection  and the infected plant tissue remains alive until late in the infection  process when fungal  proliferation occurs mostly intercellularly (Snetselaar and Mims, 1993). 1.2.4. Proliferation  and differentiation  in the plant host The dikaryotic filament  (hypha) is the pathogenic form  in U.  maydis  and consists of  elongated cylindrical cells separated by septa containing two nuclei (one from  each parent: N+N) (Figure 1.2). In the early stages after  penetration, the dikaryotic filament continues rapid, unbranched growth. Only the growing tip of  the filament  contains cytoplasm whereas the older compartments lack cytoplasm and collapse (Snetselaar and Mims, 1992; Banuett and Herskowitz, 1996). Growth at this stage of  infection  is mostly intracellular. Three days post infection  (p.i.), the fungus  starts growing extensively by producing highly branched hyphae that are filled  with cytoplasm (Knowles, 1898; Mills and Kotze, 1981; Sleumer, 1932; Snetselaar and Mims, 1992). The source that triggers the switch in growth mode is presently unknown, and it corresponds with the beginning of  tumor development (approximately five  days p.i.). In later stages, hyphal branching increases and occurs at closer intervals. The branched fungal  hyphae are surrounded by mucilaginous material. The tips of  many hyphae have a lobed appearance, which may be a consequence of  the extensive formation  of  short branches. At this stage, fragmentation of  fungal  hyphae into segments takes place. Large masses of  rounded cells are present as well as cells with other unusual morphologies (e.g., triangular, almond-shaped and peanut-shaped) (Banuett and Herskowitz, 1996). These cells are all embedded in mucilaginous material and many of  the rounded cells appear to be in different  stages of teliospore maturation. Nuclear fusion  (karyogamy) may occur at this stage. Mature teliospores (2N) are surrounded by a yellow-brown cell wall at first,  which turns later dark brown or black (melanized) (Banuett and Herskowitz, 1994; Snetselaar and Mims, 1993, 1994, 1992). Thus, the tumors develop a dark colour as masses of  teliospores mature inside them. Sporulation is a key event for  dissemination of  smut disease and teliospores are produced in great numbers (2.5 to 6 billion spores per gram of  tumor tissue) during infection  (Banuett and Herskowitz, 1996; Christensen, 1963; Ramberg and McLaughlin, 1980). On the plant surface,  teliospores germinate and produce short filament  (promycelium) forming  a basidium in which meiosis takes place. Four nuclei then migrate into individual basidiospore cells (sporidia) that grow by polar budding and exhibit yeast-like morphology. Secondary sporidia produced in nature by budding have been proposed to be the primary infectious  agents (Alexopoulos et al., 1996). Many events in the development of  U.  maydis  that are observed in planta  do not occur in culture. The differences  in fungal  behaviour in planta  and in culture have led to conclusion that the plant provides crucial components and/or signaling molecules that trigger different  aspects of  fungal  development. For example, extensive branching of infection  hyphae, formation  of  cross walls (septa) within hyphae, development of  branch primordia resembling clamp connections, random hyphal collapse, prolonged growth of the dikaryon, nuclear fusion  in the dikaryon, and teliospore production take place exclusively within host tissue (Banuett and Herskowitz, 1989, Banuett, 1994, 1996; Day and Anagnostakis, 1971; Holliday, 1961; Snetselaar and Mims, 1994.). So far  it has not been possible to generate the infectious  structures in vitro, which may indicate the need for  certain plant signals or surface  cues that need to be recognized to trigger this differentiation.  The regulatory processes of  the developmental program within the host plant leading to teliospore formation  are poorly understood, and the signals that may be endogenous or provided by the plant are still unknown. It has been proposed that the stage-specific  expression of  genes during development is achieved by interplay between repression during saprophytic growth and expression during the specific  stage of biotrophic growth in the plant (Basse et al., 2002). The identification  of  host-derived signals influencing  specific  stages of  fungal  development is a challenging aspect of  U. maydis  virulence that has received relatively little attention. It has been shown that U.  maydis-induced  tumor formation  is essentially confined to immature tissue at the base of  developing leaves and ears (Wenzler and Meins, 1987). Tissue at the base of  developing leaves is composed of  dividing and expanding meristematic cells (Smith et al., 2001; Sylvester et al., 1990). Tumors result from abnormal division and enlargement of  host cells while the hyphae rapidly proliferate between host cells. Within the tumor, the fungal  cells are often  embedded in parenchymatous, thin-walled host cells, which lack plastids (Callow and Ling, 1973). There is some molecular evidence that U.  maydis  has the capacity to extend the undifferentiated  state of  infected  tissue (Basse, 2005). U.  maydis  clearly induces dramatic proliferation  of  plant tissue and this may occur perhaps either through the production of  small inducer molecules, or secretion of  fungal  effector  proteins. It has been shown, for  example, that phytohormones known to stimulate plant cell growth (e.g., auxins) are produced by U.  maydis  in culture (Wolf,  1952). Wolf  (1952) observed increased levels of  auxin in tumor tissue but clear experimental evidence linking auxin production by U.  maydis  to tumor development is still lacking. For example, mutants deleted in two genes implicated in the common IAA pathway that catalyzes the production of  auxin from  indole-3-acetaldehyde had no defect  in pathogenicity (Basse et al., 1996). 1.2.5. Regulation of  morphogenesis and pathogenesis in U.  maydis As mentioned, U.  maydis  displays a dimorphic switch alternating between budding and filamentous  morphology. This morphological switch plays a critical role in pathogenicity because only the filamentous  dikaryon can infect  the host plant. Therefore dimorphism is a clear component of  the disease process. The filamentous  phenotype has been used to identify  several genes involved in the regulation of  morphogenesis, and to examine the link between morphogenesis and pathogenesis in U.  maydis  (Barrett et al., 1993; Brachmann et al., 2001; Durrenberger et al., 1998, 2001; Gold et al., 1994; Lee and Kronstad, 2002). This approach identified  two conserved signal transduction pathways, the cyclic AMP/ protein kinase A (PKA) pathway and the Ras/mitogen-activated protein kinase (MAPK) pathway, that are now known to regulate morphological changes during fungal  development and to influence  the virulence of  U.  maydis  (Figure 1.3). The MAPK pathway may also control some aspects of  mating in U.  maydis  as described below. It is thought that if  there is perception of  plant molecules that influence  fungal  development and disease progression, such signals are likely to be transmitted via the conserved pathways. The cAMP and MAPK pathways related to the yeast pheromone signal transduction cascade also play important roles in morphogenesis and pathogenic development in other pathogenic fungi  (D'Souza and Heitman, 2001; Kronstad et al., 1998). 1.2.6. Mating Fusion of  compatible haploid cells is the first  event required to generate the pathogenic cell type of  U.  maydis,  and this process is initiated by mating-type-specific lipopeptide pheromones that are secreted and perceived by cells of  opposite mating type. U.  maydis  belongs to a group of  heterothallic fungi  that are self-incompatible  and only capable of  mating with compatible mating partners. plant and environment ? pheromones Budding growth Filamentous grow th and Virulence Figure 1.3 Signaling networks in U.  maydis. The cAMP/PKA signaling pathway (left)  and the Ras/MAPK (pheromone response) signaling pathway (right) regulate mating, morphogenesis and virulence. AC = adenylyl cyclase; PKA-R = the regulatory subunit of  PKA; PKA-C = catalytic subunit of  PKA. These fungi  have two or more mating types and the sexual reproduction can occur only when individuals of  different  mating types interact. In U.  maydis,  the sexual life cycle is governed by a tetrapolar mating system consisting of  the a and b mating type loci (Kronstad and Staben, 1997). Haploid cells are able to fuse  and form  a stable dikaryon only if  they carry genes with different  specificities  at both the a and b mating-type loci. Cell recognition, conjugation tube formation  and cell fusion  are controlled by the a locus having two alleles al and a2, which encode pheromones and pheromone receptors similar to those in S. cerevisiae (Banuett and Herskowitz, 1989; Bolker et al., 1992; Puhalla, 1969; Rowell, 1955; Snetselaar et al., 1996; Spellig et al., 1994). Upon pheromone stimulation, cells arrest budding growth and start the formation  of conjugation tubes (Snetselaar and Mims, 1992; Spellig et al., 1994), which grow towards each other following  a pheromone gradient and which eventually fuse  (Snetselaar et al., 1996). Once cell fusion  has taken place, heterozygosity at the b locus is required for  the production of  a stable dikaryon and for  pathogenicity. This locus is multi-allelic and encodes two homeodomain-containing proteins (bE and bW). After  cell fusion,  these proteins interact to produce a heterodimeric complex only when the proteins are encoded by different  alleles (Gillissen et al., 1992; Kamper et al., 1995; Yee and Kronstad, 1993). The b protein heterodimer is thought to act as a master switch to initiate filamentous growth and subsequent pathogenic development by regulating the transcription of  a set of target genes that directly or indirectly govern morphogenesis and pathogenicity, and completion of  life  cycle (Gillissen et al., 1992; Kamper et al., 1995; Bolker et al., 1995; Kronstad and Leong, 1989; Schulz et al., 1990). In addition, the b protein heterodimer appears to repress the expression of  pheromones and pheromone receptors (Laity et al., 1995). In culture, sexually compatible haploid strains are able to mate and produce dikaryotic hyphae (Figure 1.4). The combination of  the compatible strains is infectious when inoculated into a host plant. In contrast, the dikaryotic hyphae are short-lived and eventually die when left  on artificial  medium (Holliday, 1974; Puhalla, 1968). Figure 1.4 A dikaryotic filament  produced during the mating reaction between haploid cells of  U.  maydis. Upon pheromone signal exchange, haploid cells of  opposite mating type form conjugation tubes and these eventually fuse  to produce infectious  dikaryotic filaments. Compatible haploid sporidia shown here were grown on fatty  acid-containing medium (palmitate) to observe mating reaction. The image was taken using differential interference  contrast optics (DIC). 1.2.7. MAP kinase signaling Upon the exchange of  pheromones between the compatible haploid cells, the pheromones bind to cognate seven-transmembrane domain receptors (Pral/2) and activate downstream signaling cascades, such as a MAPK cascade. This leads to expression of  a large number of  genes mediated by the pheromone response factor  (Prfl) that binds to pheromone response elements (PRE) present in promoter regions (e.g., in the a and b mating type genes) (Hartmann et al., 1996); (Urban et al., 1996). Mutants defective  in Prfl  are sterile because of  their inability to perceive and produce pheromones. The main role of  Prfl  seems to be the induction of  mating type genes. Finally, pheromones and pheromone receptors are not required for  filamentous  growth during the biotrophic phase. Therefore,  it has been argued that signals from  the host environment act as alternative inducers of  the MAPK pathway (Banuett and Herskowitz, 1996). The MAPK cascade consists of  the MAPK kinase kinase Ubc4/ Kpp4 (Andrews et al., 2000; Muller et al., 2003), the MAPK kinase Fuz7/Ubc5 (Andrews et al., 2000; Banuett and Herskowitz, 1994) and the MAPK Ubc3/Kpp2 (Mayorga and Gold, 1999); (Muller et al., 2003). Mutations in any of  the MAPK pathway components result in faulty  pheromone signaling (Hartmann et al., 1996). In addition, Ubc3 is required for tumor induction (Mayorga and Gold, 1999) and Ubc2 is required for  full  symptom development during host infection  (Mayorga and Gold, 2001). The ubc2, ubc3, ubc4 and fuz7  genes were all identified  using a morphological screen in which complementation of suppressor mutations resulted in the restoration of  filamentous  growth to yeast-like suppressors of  the filamentous  growth of  a mutant deficient  in the gene encoding for adenylyl cyclase (uacl;  (Andrews et al., 2000; Gold et al., 1994;Mayorga and Gold, 2001). The ubc4, fuz7  and ubc3 genes were also isolated in independent studies and called kpp4, ubc5 and kpp2,  respectively (Muller et al., 1999; Andrews et al., 2000; Muller et al., 2003). The MAPK module has been shown to also regulate 6-dependent filament  formation  (Fuz7), cuticle penetration (Brachmann et al., 2003), appressorium-like structure formation  (Muller et al., 2003) and cell cycle regulation (Garrido et al., 2004). This is in addition to the regulation of  the transcriptional response to pheromone, conjugation tube formation  and cell fusion  (Ubc4, Fuz7 and Ubc3). Complementation of  a suppressor mutation of  the adrl  mutant (defective  in the catalytic subunit of  PKA) identified  the ras2 gene, which encodes a member of  the Ras family  of  small GTP-binding proteins (Lee and Kronstad, 2002). Ras2 has been shown to influence  the MAPK pathway and to regulate morphogenesis, pathogenesis and mating. U.  maydis  possesses a second Ras protein, Rasl, which is proposed to effect  the cAMP pathway (Muller et al., 2003). 1.2.8. cAMP signaling pathway The cAMP/PKA signaling pathway is a key regulator of  the dimorphic switch and pathogenic development in U.  maydis.  From the analysis of  mutants defective  in cAMP/PKA signaling, it is apparent that a regulated cAMP pathway is essential for penetration, proliferation  in plant tissue, tumor induction and teliospore production. An active cAMP pathway appears to be crucial for  entry into the plant because strains deficient  in either the Ga subunit of  a heterotrimeric G protein (Gpa3; Regenfelder  et al., 1997), adenylyl cyclase (Uacl; Barrett et al., 1993), or the catalytic subunit of  PKA (Adrl; Durrenberger et al., 1998) fail  to produce any disease symptoms (Durrenberger et al., 1998; Regenfelder  et al., 1997). Mutants lacking the regulatory subunit of  PKA (Ubcl) display constitutive PKA activity and proliferate  in plant tissue, but fail  to produce tumors (Gold et al., 1997). Mutants with a constitutively active gpa3 allele also show reduced proliferation  and do not produce teliospores, but still induce tumors (Kruger et al., 1998). Strains deleted in hgll  produce tumors but spore formation  is abolished (Durrenberger et al., 2001). Hgll is a protein with unknown function  that appears to be a direct target of  PKA, and is thought to act as a negative regulator of budding growth and pigment production. It may also be an activator of  filamentous growth and teliospore formation  (Durrenberger et al., 2001). The initial discovery of  a role for  the cAMP pathway in U.  maydis  came from  the identification  of  the uacl gene for  adenylyl cyclase in a genetic screen using ultraviolet light (UV) to mutagenize cells and isolate constitutively filamentous  mutants (Barrett et al., 1993; Gold et al., 1994). Subsequently, ubcl was identified  as a suppressor of  the constitutive filamentous  phenotype of  the uacl mutants (Gold et al., 1997). The ubcl mutants exhibit a multi-budding phenotype in which daughter cells remain attached to mother cells to form  rosette-like clusters (Gold et al., 1994). The hgll  gene was isolated in a suppressor mutant screen that was designed to identify  downstream targets of  the cAMP pathway. The hgll  gene was identified  through a complementation of  one suppressor mutation that resulted in the restoration of  filamentous  growth to a yeast-like adrl  suppressor mutant (Durrenberger et al., 2001). Two genes encoding PKA catalytic subunits in U.  maydis  (adrl  and ukal)  were cloned by PCR amplification  using degenerate primers. Mutants defective  in adrl.  exhibit a constitutive filamentous phenotype and are avirulent. In contrast, the deletion of  ukal  had only a minor influence on morphogenesis and virulence. That is, the ukal  mutants are predominantly yeast-like and are still able to cause disease in maize. In general, all conditions that lower cAMP levels, such as mutations in gpa3 or uacl, or conditions that reflect  this situation in terms of  PKA activity (mutation of  adrl)  result in filamentous  growth (Durrenberger et al., 1998; Gold et al., 1994; Regenfelder  et al., 1997). Contrary to this, conditions that lead to constitutive activation of  the pathway, and therefore  high PKA activity, such as deletion of  ubcl encoding the regulatory subunit of the PKA, lead to a budding phenotype (Gold et al., 1997). Taken together, these findings show that cAMP levels are responsible for  the dimorphic switch, as well as virulence and cytokinesis, and temporal regulation of  the cAMP pathway appears to be critical for  the completion of  the life  cycle. 1.2.9. Crosstalk between the cAMP and MAPK signaling pathways There appears to be an intimate connection between cAMP and MAP kinase signaling in U.  maydis  (Figure 1.3). When genetic screens were conducted to identify additional players in signaling pathways using the filamentous  phenotype of  uacl or adrl mutants (i.e., defective  in cAMP signaling) to identify  suppressors, these turned out to be mutations in all four  components of  the pheromone MAP kinase cascade and ras2. (Andrews et al., 2000; Lee and Kronstad, 2002; Mayorga and Gold, 1998, 1999, 2001). In light of  these results, there may be other signals that lead to activation of  the MAP kinase cascade other than pheromones. This result is the foundation  for  naming the components of  the MAP kinase cascade as ubc genes for  Ustilago  bypass of  cyclase. The general view to emerge from  these studies is that the components from  the MAP kinase pathway induce filamentation  while the cAMP/PKA pathway represses this morphological transition. At present, it is not entirely clear at which level(s) these opposing effects  operate. Perhaps co-regulation of  the cAMP and MAPK signaling networks is involved in sensing specific  plant signals that trigger discrete stages of pathogenic development. The cAMP signaling pathway is also necessary for  pheromone response, and putative phosphorylation sites have been predicted for  both MAPK and PKA in the polypeptide sequence of  the Prfl  transcription factor  (Hartmann et al., 1996). Furthermore, signaling via the cAMP pathway appears to influence  pheromone expression via Prfl  at both the transcriptional and translational levels (Hartmann et al., 1996). In addition, the gpa3 mutants were unable to induce pheromone expression when mixed with compatible strains (Regenfelder  et al., 1997). Kruger et al. (1998) showed an increased pheromone gene expression in ubcl mutants and wild-type cells grown in the presence of  exogenous cAMP. Thus, an interplay between cAMP levels and MAPK signaling may influence  pheromone signaling. 1.3. Lipid signaling in fungal  pathogens The characterization of  the cAMP and MAPK pathways in U.  maydis  provides a framework  and a set of  mutants for  further  investigation of  the role of  signaling functions in fungal  phytopathogenesis. This includes the search for  environmental, nutritional or host factors  that trigger morphological transitions as a key aspect of  pathogenesis. In this context, a role for  lipids in morphogenesis and development has been identified  in a limited number of  fungi,  including U.  maydis  as described in this thesis (Chapter 2 and Klose et al., 2004). Therefore,  the following  sections provide background information  to summarize what is known about connections between lipids, signaling and pathogenesis in fungi. 1.3.1. Lipids and early stages of  fungal  development Plant surface  lipids (waxes) have been reported to provide signals in plant-fungus interactions and are thought to induce pathogenic development in fungi  (Macko, 1981; Podila et al., 1993). For example, cutin monomers of  avocado contain inducers and inhibitors of  germination and appressorium formation  required in the initial stages of infection  by C. gloeosporioides  (Kolattukudy et al., 1995; Podila et al., 1993). The balance between these activities may be responsible for  the selective signaling by the host wax as a component of  host recognition. Appressorium formation  was most strongly initiated in response to long-chain fatty  alcohols (C24 or longer) present in the host wax, and waxes from  non-host plants failed  to induce appressorium formation  in C. gloeosporioides.  This suggests that the effect  of  the surface  lipids vary with fungal species. Fungal storage lipids also appear to play an important role in the early developmental processes of  pathogenic fungi,  such as the formation  of  appressoria (Thines et al., 2000). Specifically,  it has been shown that PKA signaling is involved in the mobilization of  the storage compounds, such as lipids and glycogen, during the production of  infectious  structures that are critical for  penetration of  the host cells in the plant pathogen M.  grisea (Thines et al., 2000). 1.3.2. Lipids in development and sporogenesis in fungi Lipids have been shown to regulate reproductive development in several fungi. Linoleic acid in particular has a sporogenic effect  in Alternaria,  Aspergillus,  Neurospora and Sclerotinia  (reviewed in Calvo et al., 2001). In general, unsaturated long-chain fatty acids (LCFA; e.g., oleic and linoleic acid) and their derivatives (e.g., oxygenated linoleic and oleic acids called oxylipins) are reported to be important for  the sexual development of  filamentous  fungi.  In Aspergillus  spp., fatty  acid stimulation of  sporulation is dependent on fatty  acid chain length and the presence of  double bonds, and oleic and linoleic acids have the greatest stimulatory effect  (Calvo et al., 2001). In Neurospora crassa, extensive changes in fatty  acid metabolism correlate with several events during sexual development (Goodrich-Tanrikulu et al., 1998). In this case, the availability of oleic and linoleic acids dictates the fate  of  development in N.  crassa. Specifically,  oleic acid is the predominant fatty  acid found  in sexual structures, whereas linoleic acid is the predominant fatty  acid in asexual tissues. One of  the first  extracellular signals described to regulate sexual and asexual spore development in filamentous  fungi  was psi (precocious sexual inducer) factor  characterized in Aspergillus  nidulans  (Calvo et al., 2001). Psi factors  are oleic, linoleic and linolenic acid-derived oxylipins that act as signaling molecules to influence  growth and spore development in A. nidulans  (Calvo et al., 2001; Champe et al., 1987; Mazur et al., 1990). Certain species of  oxylipins are generated from  enzymatic reactions catalyzed by lipoxygenase or dioxygenase enzymes in fungi  (Herman, 1998; Noverr et al., 2003). In A. nidulans,  deletion of  genes encoding oxylipin-generating dioxygenases (ppoA,  ppoB and ppoC) influenced  the expression of transcription factors  required for  meiotic and mitotic sporulation processes (Tsitsigiannis et al., 2004a; Tsitsigiannis et al., 2005b; Tsitsigiannis et al., 2004b). Similar oxylipins are also produced by other fungi,  such as Gaeumannomyces graminis, Fusarium oxysporum and Saccharomycopsis  spp. (Brodowsky et al., 1992; Nakayama et al., 1996; Sebolai et al., 2005; Su et al., 1995; Su and Oliw, 1996). For example, in G. graminis, the linoleate diol synthase (LDS) has been characterized that produces psiBa (8-hydroxylinoleic acid or 8-HODE) that has an effect  on development (Brodowsky et al., 1992; Su et al., 1995; Su and Oliw, 1996). Recently, the cAMP-regulated sspl gene encoding a protein abundantly expressed in mature teliospores of  U.  maydis  was identified  and it shares similarity with LDS and prostaglandin G/H synthases (cyclooxygenases) from  mammals (Huber et al., 2002). It is thought that Sspl plays a role in the mobilization of  storage lipids, probably as part of  teliospore maturation in U. maydis.  The fungal  pathogens of  humans, Candida  albicans and Cryptococcus neoformans,  are able to convert exogenously supplied as well as endogenously produced arachidonic acid into bioactive prostaglandins (modified  lipids: oxygenated unsaturated cyclic fatty  acids) which strongly enhance both cell viability and filamentation  capacity (Noverr etal., 2001,2002). 1.3.3. Cellular lipids and fungal  dimorphism The human fungal  pathogen C. albicans is a well-characterized model for  fungal dimorphism and some information  is available on the role of  lipids. For example, differences  in membrane composition/properties were observed between yeast and mycelial forms  of  the fungus.  A comparison of  lipids of  purified  plasma membranes revealed that the composition of  the plasma membrane of  C. albicans resembles that of other eukaryotes (Marriott, 1975). An increase in linoleic acid in all membrane phospholipids correlated with elongation of  germ tubes during conversion of  yeast to mycelium form  (Yamada, 1986). Higher levels of  polyunsaturated fatty  acids were observed in mycelial lipids compared to yeast lipids (Yano et al., 1982). Overall, the mycelial lipids are poorer in sterols than the yeast lipids, but are richer in complex lipids that contain sterols such as sterylglycosides and esterified  steryl glycosides (Ghannoum et al., 1986). The observed fluctuation  of  fatty  acids, sterols and sterol-containing complex lipids in the yeast and mycelial forms  suggest a possible role of  cellular lipids in the dimorphic behaviour of  C. albicans. 1.4. Lipid metabolism in fungal  pathogenesis To understand fungal  infection,  it is important to understand the requirements of pathogenic fungi  to access various nutrients to optimize morphological and metabolic differentiation  while growing in vivo. Recent findings  on pathogen nutritional requirements and the mechanisms by which they acquire nutrients from  their host during infection  indicate that primary metabolism (as expected) plays a significant  role in virulence and disease development (Both et al., 2005; Lorenz et al., 2004; and reviewed in (Solomon et al., 2003). In particular, several genome-wide studies of  gene expression patterns reveal important roles for  lipid metabolism during fungal  infections.  For example, microarray data reveal a fascinating  pattern of  coordinate regulation of  genes encoding enzymes involved in primary metabolism at different  stages in the life  cycle of a plant pathogen B. graminis (Both et al., 2005). These include enzymes involved in lipid catabolism that are highly expressed in early stages of  infection  but that show decreased expression in later stages. Storage lipids in conidia of  B. graminis are used during penetration and colonization of  the host plant and then again later in the life  cycle when new conidia are formed.  Previously, expressed sequence tags (ESTs) and serial analysis of  gene expression (SAGE) have also shown that lipid catabolism is important throughout the germination and penetration stages of  infection  of  B. graminis (Thomas et al., 2002; Thomas et al., 2001). Recently, the expression patterns identified  from  a microarray experiment suggest a cell-specific  difference  in nutrient acquisition and cell metabolism in U.  maydis  (Babu et al., 2005). Specifically,  the peroxisomal multifunctional  enzyme (designated by the authors as fox2)  is upregulated during the filamentous  growth compared to budding cell growth in culture. Also, in the microarray experiment fox2  is upregulated in both dikaryotic and diploid state of  the filamentous cells. Note that this gene is the subject of  chapter 3 of  this thesis and is designated as mfe2  in this work. Furthermore, transcriptome profiles  of  the human pathogenic fungus C. albicans revealed regulation of  metabolic pathways involved in utilization of alternative carbon sources upon phagocytosis by macrophages, specifically  by reprogramming metabolism to produce glucose (Lorenz et al., 2004). The data suggest that the acetyl coenzyme A (acetyl-CoA) derived from  breakdown of  fatty  acids via p-oxidation is used via the glyoxylate cycle to produce glucose. The glyoxylate cycle has been shown to play a role in virulence of  many pathogens, including the fungal  plant pathogens Leptosphaeria maculans (Idnurm and Howlett, 2002), M.  grisea (Wang et al., 2003) and Stagonospora  nodorum  (Solomon et al., 2004), the bacterial plant pathogen Rhodococcus  fascians  (Vereecke et al., 2002), and the human pathogens Mycobacterium tuberculosis  (McKinney et al., 2000) and C. albicans (Lorenz and Fink, 2001). Furthermore, peroxisomal metabolic function  is essential for  plant infection  during the penetration stage in the fungal  pathogen Colletotrichum  lagenarium  (Kimura et al., 2001). Specifically,  the generation of  a targeted mutation in the gene PEX6  required for peroxisomal biogenesis, where enzymes for  P-oxidation of  fatty  acids reside, impairs peroxisomal metabolism and leads to the loss of  pathogenicity. Taken together, these studies suggest that lipid metabolism may be important during plant-fungus  interactions that lead to a successful  infection. Different  aspects of  lipid metabolism may be important for  fungal  pathogens during specific  stages of  infection.  In the initial stages before  penetration, the fungus depends on stored sources of  carbon, which possibly include glycogen, trehalose, sugar alcohols and lipids (Jennings and Lysek, 1996; Thines et al., 2000; Weber et al., 2001). Recent analyses show that lipid catabolism is critical during early stages of  infection, such as germination, production of  infectious  structures (i.e., appressoria formation)  and penetration (Bowyer et al., 2000; Kimura et al., 2001; Thines et al., 2000; Weber et al., 2001). During later stages of  fungal  development in the plant, when fungi  extensively proliferate  within host tissues, lipolysis may not play as important of  a role (reviewed in Solomon et al., 2003). After  penetration, sugars from  the host (e.g., sucrose) are available and may become the main energy source. It has been proposed that fungal metabolism throughout the infection  process can be divided into three phases, where the first  phase involves lipid catabolism during germination and penetration and the second phase involves glycolysis during invasion of  host tissue (reviewed in Solomon et al., 2003). The third phase occurs late in infection  during sporogenesis, when the host tissues are increasingly incapacitated by the pathogen and the fungus  begins to produce spores for  dissemination. At this late stage, nutrients are likely to be depleted and this could lead to starvation of  the pathogen as one aspect for  signaling sporulation (Solomon et al., 2003). However, nutrient availability during this stage has not yet been studied. It has been shown that utilization of  plant host lipids is of  great importance to some fungal  pathogens. In the bunt fungi  (Tilletia  spp.), which are closely related to U. maydis,  host plant lipids were shown to be of  primary importance in the metabolism of hyphae and spores. Histochemical studies of  Tilletia  carries (common bunt of  wheat) developing in young infected  wheat seeds revealed that lipids were the first  host compounds utilized by pathogenic hyphae that produced teliospores (Grove, 1973). A. flavus  was also shown to preferentially  target lipid bodies (i.e., stored plant lipids) rather than starch for  degradation during infection  when grown in living corn kernels (Smart et al., 1990). However, in corn-kernel stimulating medium, A. flavus  simultaneously hydrolyzed starch and lipids (Mellon et al., 2005), suggesting that preference  for  lipids may be influence  by the nutritional composition of  a substrate. A plant fungal  pathogen, Plasmodiophora  brassicae, utilizes lipids as temporary carbon sources synthesized from precursors extracted from  the host plant, and accumulates a large number of  lipid bodies after  it enters its Brassica host plant cytoplasm during infection  (Williams et al., 1968; Keen and Williams, 1969). Furthermore, a variety of  studies indicate that fungal pathogens can alter host lipid content or metabolism during infection.  For example, changes in total fatty  acids composition of  kidney bean plant {Phaseolus  vulgaris)  were reported at different  stages of  infection  with rust fungus  Uromyces  phaseoli (Schnipper and Mirocha, 1970). Schmidt (1932) provided microscopic evidence of  lipid accumulation adjacent to infection  hyphae during infection  of  sugar-beet leaves. Taken together, these studies indicate that the utilization of  lipids as alternative carbon sources plays an important role in microbial pathogenesis. Lipids also play a role in fungal  plant pathogenesis because of  their involvement in host defense.  Unsaturated fatty  acids have lately emerged as important players in diverse biological processes in plants (Kachroo et al., 2001, 2003; Laxalt and Munnik, 2002; Lee et al., 1997; Li et al., 2003; Maldonado et al., 2002; Piffanelli  and Murphy, 1999; Ryu and Wang, 1998; Shanklin and Cahoon, 1998; Weber, 2002). They serve as substrates for  biosynthesis of  oxidized lipids and also regulate the activity of  enzymes involved in the generation of  signal molecules to activate plant defense  responses. Specifically,  fatty  acids play an important role in modulating signaling between salicylic acid (SA)- and jasmonic acid (JA)-dependent defense  pathways against pathogens (Kachroo et al., 2003). Biotrophic fungi  may escape plant defense  mechanisms by bypassing or repressing the activation of  programmed cell death initiated by jasmonic acid signaling and defense  responses by the salicylic acid-dependent pathway. Recent studies have uncovered an important role for  lipids also in the activation of  systemic acquired resistance (SAR ) (Maldonado et al., 2002; Nandi et al., 2004). Interestingly, the P-oxidation pathway in plants has been proposed to be involved in the specific modification  of  fatty  acid signaling molecules of  the octadecanoic pathway during the formation  of  jasmonic acid from  linolenic acid (Wasternack and Parthier, 1887). Microarray analysis revealed induction of  p-oxidation genes in the model plant Arabidopsis  thaliana,  in local and also in distal tissue, during infection  with Alternaria brassicicola  (Schenk et al., 2000). Therefore,  it has been hypothesized that P-oxidation in plants may be playing a role in mediating plant-pathogen interactions. 1.4.1. P-oxidation of  fatty  acids Depending on the metabolic demands of  a cell, fatty  acids are either converted to triglycerides and membrane phospholipids, or oxidized for  energy production. The cellular fatty  acid degradation into acetyl-CoA occurs via the p-oxidation pathway. The p-oxidation of  fatty  acids is a metabolic process providing electrons to the respiratory chain and thus energy for  a cell. It is a complex process occurring inside mitochondria or peroxisomes and must be carefully  regulated depending on the other sources of  energy (i.e., carbohydrate and amino acid catabolism). The consequences of  dysfunction  in P-oxidation can cause severe health problems in humans. Thus understanding the basic mechanisms of  the process is of  great relevance and the P-oxidation systems in animals have been well characterized, both biochemically and molecularly (reviewed in Kunau et al., 1995; Eaton et al., 1996; Hashimoto, 1996; Hiltunen et al., 1996; Mannaerts and van Veldhoven, 1996). The process of  P-oxidation is common to all eukaryotic and prokaryotic organisms. There are two major systems of  P-oxidation, mitochondrial and peroxisomal. Plants and fungi  are able to completely degrade fatty  acids within their peroxisomes (Kunau et al., 1988; Tolbert, 1981), while animals require an additional mitochondrial P-oxidation system because the peroxisomal system seems to function  only to provide a chain-shortening activity (Kunau et al., 1988; Lazarow and De Duve, 1976; Mannaerts and Debeer, 1982; Tolbert, 1981). The discovery of  a peroxisomal system of  P-oxidation was first  made in plants (Cooper and Beevers, 1969). p-oxidation results in the complete degradation of  fatty  acids by the sequential removal of  2 carbon units in each fatty  acid oxidation cycle, resulting in the formation  of acetyl-CoA (Figure 1.5). Fatty acids inside the cell must be activated initially by fatty acyl-CoA synthetase, which ligates CoA to a free  fatty  acid (Black and DiRusso, 2003). There are four  individual enzymatic reactions of  p-oxidation, each catalyzed by a separate enzyme: acyl-CoA dehydrogenase in mitochondria and acyl-CoA oxidase in peroxisomes, enoyl-CoA hydratase, hydroxyacyl-CoA dehydrogenase, and acyl-CoA acetyltransferase  (thiolase). 1. dehydrogenation F A D ^ f a d h 2 — 1 acyl-CoA dehydrogenase 2. hydration enoyl-CoA hydratase 3. dehydrogenation N A D -NADH+H" J hydroxyacyl- CoA 1 dehydrogenase 4. thiolytic cleavage 1 acyl-CoA CoA-SH' I a c e t y j t r a n s f e r a s e • (thiolase) acetyl-CoA + acyl-CoA Figure 1.5 P-oxidation of  fatty  acids. Fatty acids are oxidized via the P-oxidation process in which fatty  acid chains are degraded to acetyl CoA by sequential removal of  two carbon units in each fatty  acid oxidation cycle. There are four  individual reactions of  P-oxidation and each is catalyzed by a separate enzyme: (i) acyl CoA-dehydrogenase in mitochondria or acyl-CoA oxidase in peroxisomes, (ii) enoyl-CoA hydratase, (iii) hydroxy acyl-CoA dehydrogenase, and (iv) acyl-CoA transferase  (thiolase). Additional enzymes are needed for  complete oxidation of  unsaturated and odd-carbon fatty  acids: enoyl-CoA isomerase, propionyl-CoA carboxylase, methylmalonyl-CoA racemase, and methylmalonyl-CoA mutase. 1.4.1.1. P-oxidation systems in mammalian cells There are major differences  among different  P-oxidation systems including substrate specificities,  subcellular compartmentalization, and enzyme architecture. This is well represented in the variety of  P-oxidation strategies found  in mammalian systems (Figure 1.6). P-oxidation occurs in both mitochondria and peroxisomes. There are two mitochondrial p-oxidation systems. One is a membrane-associated pathway that shortens long-chain fatty  acids for  the second, soluble, short-chain specific  pathway (Kunau et al., 1995). These pathways also differ  in enzyme architecture. The short-chain pathway consists of  four  individual enzymes, while in the long-chain pathways the second to fourth  steps are catalyzed by a trifunctional  enzyme (Uchida et al., 1992). Electrons removed during mitochondrial P-oxidation are passed to oxygen via the electron transport chain, contributing to ATP formation  (Frerman, 1988). There are also two different  P-oxidation pathways in peroxisomes of  mammalian cells (reviewed in Hashimoto, 2000; Wanders et al., 2001). Two separate multifunctional  enzymes with different  substrate specificities  and stereochemistry catalyze the second and third steps in each pathway. The mammalian multifunctional  proteins prefer  medium-, long- and very long-chain acyl-CoA esters (Jiang et al., 1996; Malila et al., 1993). Electrons removed during peroxisomal P-oxidation are transferred  to oxygen, generating H2O2, which requires catalase activity for  detoxification.  In addition, the mammalian peroxisomal P-oxidation process has two different  acyl-CoA oxidases that catalyze the first  step (Casteels et al., 1990) and that exhibit different  substrate specificities.  Mammalian oxidases preferentially  react with medium-, long-, and very long-chain acyl-CoA esters and cannot accept short-chain substrates such as butyryl-CoA (C4) (Vanhove et al., 1991). peroxisome mitochondrion Oxidase H Multifunctional enzyme 1 (MFE1) & Thiolase > Oxidase U Multifunctional enzyme 2 (MFE2) iv Thiolase Acyl-CoA dehydrosenase $ Hydratase G Hydroxyacyl-CoA dehydrogenase Thiolase Acyl-CoA dehydrogenase a Tri functional Enzyme (TFP) Figure 1.6 Enzymes of  peroxisomal and mitochondrial P-oxidation systems in higher eukaryotes. In peroxisomes, oxidases differ  in their substrate specificities.  Multifunctional  enzymes possess enoyl-CoA hydratase and hydroxyacyl-CoA dehydrogenase activities where type 1 enzymes (MFE1) catalyze oxidation of  branched- and straight-chain fatty  acids and type 2 enzymes (MFE2) catalyze only straight-chain fatty  acids. In mitochondria, two independent pathways have been characterized: the first  pathway degrades medium- and short-chain fatty  acids in mitochondrial matrix via four  individual enzymatic steps, and the second pathway consisting of  acyl-CoA dehydrogenases and trifunctional  protein (TFP) degrades long-chain fatty  acids. Two peroxisomal 3-ketoacyl-CoA thiolases are known to catalyze the third step and these include the classical thiolase (Miyazawa et al., 1981) and a thiolase that is part of  the sterol carrier protein SCPx (Seedorf  et al., 1994). Both thiolases have overlapping activities. 1.4.1.2. P-oxidation in Saccharomyces cerevisiae P-oxidation in lower eukaryotes and prokaryotes has been found  to occur via pathways similar to those described above for  mammals. It has been shown that P-oxidation occurs exclusively in the peroxisomes of  the yeasts such as S. cerevisiae, Yarrowia  lipolytica,  and C. tropicalis  (Hiltunen et al., 1992; Kunau et al., 1988; Kurihara et al., 1992; Smith et al., 2000). In general, the peroxisomes in the yeast fungi  contain the full  complement of  enzymatic machinery to completely degrade fatty  acids. These findings  led to the idea that fungi  lack mitochondrial p-oxidation. However, recently Maggio-Hall and Keller (2004) have shown that the filamentous  fungus  A. nidulans possesses both mitochondrial and peroxisomal P-oxidation systems. S. cerevisiae is able to grow on fatty  acids as a sole carbon source. The growth on fatty  acids induces transcriptional up-regulation of  genes encoding enzymes of  the P-oxidation pathway (Veenhuis et al., 1987). This response is additionally accompanied by a remarkable proliferation  of  the peroxisomal compartment (De Duve and Baudhuin, 1966). S. cerevisiae is able to degrade both saturated and unsaturated fatty  acids . Enzymes involved in P-oxidation are synthesized in the cytoplasm and then imported into the matrix of  the peroxisome in an evolutionary conserved manner that is dependent on a subset of  peroxins and on cw-acting peroxisomal targeting signals (PTSs). There are three PTSs found  in the peroxisomal proteins in yeast: PTS1 (a carboxyl-terminal tripeptide of  the sequence SKL or a conserved variant of  this sequence), PTS2 (found  at or near the amino termini), and PTS3 (conserved sequence repeats found anywhere within the protein sequence) (de Hoop and Ab, 1992; Kamiryo et al., 1989; Purdue and Lazarow, 1994; Small et al., 1988). 1.4.1.3. Induction of  the peroxisomal P-oxidation system In S.  cerevisiae, the transcription factors  Pip2 and Oafl  regulate the induction of genes encoding peroxisomal proteins (Karpichev and Small, 1998), particularly the genes involved in P-oxidation of  fatty  acids. The promoter sequences of  these genes contain a positive czs-acting element called an oleate response element (ORE) that mediates the induction of  these genes by fatty  acids in the medium. It has been demonstrated that Pip2 and Oafl  interact with each other and form  a heterodimer that binds ORE (Karpichev and Small, 1998; Rottensteiner et al., 1996); this protein is required for  fatty  acid-induced peroxisomal proliferation  and for  regulating the expression of  proteins required for  P-oxidation of  fatty  acids. 1.4.1.4. Substrates and enzymatic reactions of  peroxisomal P-oxidation S. cerevisiae is able use a variety of  different  saturated and unsaturated long-chain fatty  acids as a sole carbon source for  growth (van Roermund et al., 2003). These include palmitic acid (CI6:0), oleic acid (CI8:1), linoleic acid (CI8:2), and linolenic acid (CI8:2). Saturated medium-chain fatty  acids, including lauric acid (C12:0) are also substrates for  P-oxidation (i.e., can be oxidized) but appear lethal to yeast when used as a sole carbon source, although myristic acid (CI4:0) can be used as a sole carbon source. Short-chain fatty  acids such as octanoic acid (C8:0) are also lethal. In addition, very long-chain fatty  acids (VLCFA), such as arachidonic acid (C20:4), eicosapentaenoic acid (C20:5) and docosahexaenoic acid (C22:6) can serve as a sole carbon source. Although some VLCFA (i.e., C24:0 and C26:0) can be oxidized by S. cerevisiae, they cannot be used as a sole carbon source for  growth. The process of  P-oxidation of  fatty  acids in yeast follows  the same set of enzymatic reactions as found  in mitochondria and peroxisomes from  higher eukaryotes. The first  step involves the introduction of  a double bond between the alpha and beta carbon atoms of  activated fatty  acids catalyzed by acyl-CoA oxidase, which is encoded only by a single gene (FOX1  or POX1)  in S. cerevisiae (Dmochowska et al., 1990). Foxl is the ortholog of  the human acyl-CoA oxidase 1 (Luo et al., 1996). The second and third reactions in P-oxidation are catalyzed by a multifunctional  enzyme (Fox2) with both 2-enoyl-CoA hydratase activity and 3-hydroxyacyl-CoA dehydrogenase activity (Hiltunen et al., 1992). The final  step of  peroxisomal P-oxidation is catalyzed by a single 3-ketoacyl-CoA thiolase (Fox3 or Potl) (Igual et al., 1991). This enzyme catalyzes a thiolytic cleavege of  3-ketoacyl-CoA esters into a C2-shortened acyl-CoA and acetyl-CoA. The expression of  the P-oxidation enzymes is strongly induced by fatty  acids (Einerhand et al., 1991). S. cerevisiae can oxidize both cis- and trans- unsaturated fatty  acids. Saturated and unsaturated fatty  acids with a trans double bond at the even-numbered position are direct substrates for  the classical P-oxidation pathway. However, unsaturated fatty  acids with trans and cis double bonds at odd-numbered positions or cis double bonds at even positions require the participation of  additional enzymes during oxidation (reviewed in Trotter, 2001). 1.4.1.5. Fatty acid transport Import of  fatty  acids from  the growth medium involves passive diffusion  across the cell membrane in combination with an active, protein-mediated component that includes proteins of  the fatty  acid transport protein (FATP) family.  The protein encoded by the yeast gene FAT1,  a homologue of  the mammalian adipocyte fatty  acid transporter protein FATP, was proposed to function  as a fatty  acid transporter protein (Faergeman et al., 1997; Schaffer  and Lodish, 1994). Five additional genes {FAA1-4  and FAT2) encoding proteins with similarity to acyl-CoA synthetases have been described (Johnson et al., 1994). The Faal and Faa4 are present in cytosol and are required for  activation of imported exogenous fatty  acids (Duronio et al., 1992; Johnson et al., 1994). FAA2  and FA A3 encode for  acyl-CoA synthetases that can only access fatty  acids synthesized within the cell (Knoll et al., 1993). There are two different  routes for  transport of  the substrates for  p-oxidation into the peroxisome (Hettema et al., 1996). First, fatty  acids such as MCFA enter peroxisomes as free  fatty  acids and are subsequently activated by Faa2, the peroxisomal acyl-CoA synthetase. Secondly, fatty  acids can enter peroxisomes as activated CoA esters via Pxal-Pxa2 proteins (which comprise the two halves of  an ABC transporter) (Hettema et al., 1996; Shani et al., 1995). The activation occurs outside peroxisomes catalyzed by extra-peroxisomal synthetases. This pathway is required to transport activated LCFA (Hettema et al., 1996). P-oxidation products can be transported from  peroxisomes to mitochondria via two different  pathways (van Roermund et al., 1995). One is via the glyoxylate cycle to enter gluconeogenesis for  production of glucose, and another via the carnitine transport pathway to enter mitochondria and subsequently the TCA cycle to produce energy (van Roermund et al., 1995). 1.4.2. Hydrolytic enzymes: Phospholipases and Lipases In the context of  lipid metabolism, secreted extracellular lipolytic enzymes have been documented as important virulence factors  in some fungal  pathogens (Chen et al., 1997; Hube, 1998; Ibrahim et al., 1995; Leidich et al., 1998; Saffer  et al., 1989; Walker et al., 1983). Pathogenic fungi  are known to secrete various hydrolytic enzymes such as proteinases, phospholipases and lipases that are involved in various signaling events regulated by integrated cellular networks. These enzymes are thought to contribute to fungal  pathogenesis by disrupting host cell walls, membranes, and extracellular matrices assisting in cell penetration upon infection  and tissue invasion. 1.4.2.1. Phospholipases Phospholipases are a group of  enzymes that share the ability to hydrolyze one or more ester linkages in glycerophospholipids. Different  phospholipases have the ability to cleave a specific  ester bond, therefore  they were named with letters A, B, C, and D to indicate the specific  bond targeted in the phospholipid molecule (Figure 5.1). Phospholipases are often  found  in association with membranes and may play a role in intracellular signaling pathways. Several plant and human pathogenic fungi  produce phospholipid-hydrolyzing enzymes during host invasion (Cox et al., 2001; Ghannoum, 2000; Nespoulous et al., 1999). Also, phospholipase activity has been proposed to contribute to pathogenicity of  bacterial and some fungal  pathogens (Ghannoum, 2000; Leidich et al., 1998). Phospholipase Al and A2 Phospholipase Al (PLA1) hydrolyzes the fatty  acyl ester bond at the sn-1 position of  the glycerol moiety of  phospholipids, while phospholipase A2 (PLA2) removes the fatty  acid at the sn-2 position. The action of  PLA1 and PLA2 results in the accumulation of  free  fatty  acids and 2-acyl lysophospholipid or 1-acyl lysophospholipid, respectively. Cytosolic PLA2 associates with natural membranes in response to physiological increases in Ca2+ and selectively hydrolyses arachidonyl phospholipids. This enzymatic activity often  initiates signal transduction and is regulated by the state of  cell activation. In addition, PLA2 activity releases arachidic acid from  membranes in mammalian cells, which serves as a signaling molecule for  cell-to-cell communication. Platelet-activating factor  acetylhydrolase (PAF-AH), a subfamily  of  PLA2, are responsible for  inactivation of  platelet-activating factor  through cleavage of  an acetyl group (i.e., at the second position of  glycerol in bioactive phospholipids) releasing lyso derivatives of  phospholipid substrates and short fatty  acids. Phospholipase B Phospholipase B (PLB; synonyms: lysophospholipase, lysophospholipase-transacylase) refers  to an enzyme that can remove both sn-1 and sn-2 fatty  acids. PLB has both hydrolase (fatty  acid release) and lysophospholipasetransacylase (LPTA) activities. The hydrolase activity allows the enzyme to cleave fatty  acids from  both phospholipids (PLB activity) and lysophospholipids (Lyso-PL activity), while the transacylase activity allows the enzyme to produce phospholipid by transferring  a free fatty  acid to a lysophospholipid. PLBs contribute the virulence of  the pathogenic yeast C. albicans and C. neoformans  (Cox et al., 2001; Ghannoum, 2000; Leidich et al., 1998). Phospholipase C Phospholipase C (PLC) hydrolyzes the phosphodiester bond in the phospholipid backbone to yield 1,2-diacylglycerol and phospholipids depending on the specific phospholipid species involved. The products of  PLC activities are involved in intracellular signaling processes or serve as sensors for  the membrane status of  a cell, thus affecting  and regulating important cellular processes in eukaryotic cells (Van Leeuwen et al., 2004; Wera et al., 2001; Wang, 2004). The action of  the phosphatidylinositol-specific  PLC enzymes that catalyze the conversion of phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) produces two well-characterized second messengers, inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) . It has been suggested that plants and fungi  have PLC signaling mechanisms that are different from  animals, generating IP6 and phosphatidic acid (PA) as messengers instead of  IP3 and DAG (Meijer and Munnik, 2003). Microbial infection  in plants is known to result in the activation of  plant PLC and the production of  PA that serves as a signaling molecule. Phospholipase D Phospholipase D (PLD) enzymes catalyze the hydrolysis of  phosphatidylcholine (PC) and are involved in membrane trafficking  and cytoskeletal reorganization. PLD catalyzes hydrolysis of  phospholipids to yield PA, which stimulates various cellular processes. As an example, the PLD encoded by the gene PLD1/SP014  in budding yeast is essential for  meiosis, suggesting that formation  of  PA is involved in this form  of cellular differentiation  (Rose et al., 1995). Some studies suggest a role for  this enzyme activity in intracellular membrane traffic.  For example, Siddhanta A and Shields D (1998) showed that the accumulation of  PA as a product of  catalysis by PLD is a key process in the regulation of  vesicle budding from  the trans-Golgi compartment. 1.4.2.2. Triglyceride lipases Triglyceride lipases (TGL) are lipolytic enzymes that hydrolyze ester linkages of triglycerides yielding fatty  acids and glycerol. The lipase active site, the most conserved region in all these proteins is centered around a serine residue, which participates with a histidine residue and an aspartic acid residue in a charge relay system. These lipases are expressed and secreted during the infection  cycle of  some pathogens. In particular, C. albicans has a large number of  TGLs (at least 10 genes), possibly reflecting  broad lipolytic activity, which may contribute to the persistence and virulence of  C. albicans in human tissue (Hube et al., 2000). The expression of  the lipase genes was detected in media containing triglycerides as the sole carbon source and many of  these genes were expressed during the yeast-to-hyphal transition (Fu et al., 1997; Hube et al., 2000). Other authors suggested that candidal species (C. albicans) considered to be more pathogenic had higher levels of  lipase activity compared to less pathogenic ones (Ogawa et al., 1992). During early phases of  pathogenic growth, the plant pathogen Botrytis  cinerea produces a lipase that is essential for  the infection  of  tomato leaves (Commenil et al., 1995). Another plant pathogen, Alternaria  brassicicola,  produces a spore surface-bound lipase while in contact with leaf  surface  waxes. The lipase activity is thought to contribute to spore adhesion and penetration of  the plant surface  (Berto et al., 1999). Recently, genetic studies have linked lipase production to virulence of  Fusarium graminearum  in wheat and maize (Voigt et al., 2005). Other lipolytic enzymes known as cutinases are postulated to aid in the degradation of  cutin, a hydroxy fatty  acid polyester that is a major structural component of  the plant cuticle (Kolattukudy, 1970; also see section 1.3.1. Lipids and early stages of  fungal  development, above). In fact,  cutinases are thought to be important in the invasion of  plants by phytopathogenic fungi  such as Erisyphae graminis, Ascochyta rabiei and others (Kolattukudy et al., 1995; Munoz and Bailey, 1998 and reviewed in Rogers et al., 1994). In addition, lipases may also allow pathogenic fungi  to utilize host cell macromolecules as a source of  nutrients (Salyers and Whitt, 1994). 1.4.2.3. Lipid modifying  enzymes Lipid modifying  enzymes such as cyclooxygenases (COX) or lipoxygenases (LOX) play an important role in the formation  of  biologically active fatty  acid derivatives (oxygenated signaling lipids or oxylipins). These lipids called eicosanoids are derived via the arachidonate cascade in animals. The eicosanoids include prostaglandins (PG), thromboxanes (TX) and leukotrienes. The arachidonic cascade is initiated by release of free  arachidonate by activation of  PLC and DAG lipase or PLA2 followed  by oxidation by cyclooxygenase or lipoxygenase. Oxidation of  arachidonate to a hydroperoxide by LOX or COX is the first  committed step in eicosanoid formation.  Higher plants have a linolenate cascade that generally resembles the arachidonate cascade leading to formation of  jasmonic acid, which can be converted into methyl jasmonate, known to be involved in plant defense  responses to pathogen attacks. Oxylipin production in fungi  is ubiquitous and appears to play a role in fungal development and virulence. For example, the human pathogenic yeast C. albicans and C. neoformans  are able to produce modified  lipids called prostaglandins, which strongly enhance both cell viability and filamentation  capacity (Deva et al., 2000, 2001; Noverr et al., 2001, 2003). The genes ippoA, ppoB and ppoC) from  A. nidulans  encoding for oxylipin-generating dioxygenases similar to mammalian cyclooxygenases are required for  the production of  oxylipins known as psi factors  that influence  spore development in this fungus  (Hornsten et al., 1999; Huher et al., 2002; Tsitsigiannis et al., 2004a, 2004b, 2005b). In addition, sspl from  U.  maydis  and Ldsl  (linoleate diol synthase) from  the wheat pathogen Gaumannomyces graminis have also been proposed to have similar functions  to mammalian cyclooxygenases. (for  the effect  of  these proteins on fungal development see the section 4.2. Lipids in development and sporogenesis in fungi, above). 1.5. Rationale and Aims of  this Study At the start of  this thesis work, relatively little was know about the U.  maydis  — maize interaction in terms of  the role of  environmental signals or nutritional factors during infection.  No signals, provided by the host plant or the environment, were known that would trigger the morphological transition between the budding non-infectious  cell type and the filamentous  infectious  form.  In addition, very little was known about the nutritional requirements of  U.  maydis  and other biotrophic fungi,  and the contribution of host plants to this intriguing relationship. 1.5.1. Hypotheses The hypotheses of  this work are based on the initial discovery that lipids, particularly plant oils, induced filaments  in U.  maydis  that resembled the infectious  cell type required to cause disease. The hypotheses state that: (I) fatty  acids are signaling molecules that induce filamentous  growth in U.  maydis  with participation of  the cAMP/PKA and Ras/MAPK cell signaling pathways known to regulate morphogenesis and pathogenicity in U.  maydis;  and (II) the fatty  acid-induced genes that influence  the filamentous  growth response may contribute to virulence of  U.  maydis. 1.5.2. Research objectives Objective 1. The first  objective was to phenotypically characterize the lipid induction of  filamentous  growth in U.  maydis.  The specific  goals were to examine the ability of  different  lipids and fatty  acids to cause the dimorphic transition, to characterize the properties of  the resulting filaments,  and to determine whether components of  the cAMP and MAPK signaling pathways were required (Chapter 2). Objective 2. The second objective was to perform  targeted gene disruption of candidate genes involved in fatty  acid metabolism to investigate their roles in lipid-induced filamentation  and host infection.  These studies focused  on genes encoding a peroxisomal multifunctional  enzyme (mfe2),  a mitochondrial 3-hydroxyacyl-CoA dehydrogenase (hadl), and a phospholipase A2 (lip2) with the following  goals: Peroxisomal multifunctional  P-oxidation enzyme (mfe2) One major goal was to generate mutants that could not use fatty  acids as a carbon source and to determine whether this type of  mutant could still grow in plant tissue to cause disease. A gene for  peroxisomal p-oxidation was selected for  detailed analysis (Chapter 3). Mitochondrial 3-hydroxyacyl-CoA dehydrogenase (hadl) A second goal was to test a candidate gene for  a putative mitochondrial P-oxidation function  for  a role in filamentous  growth and virulence (Chapter 4). Phospholipase A2 (lip2) Phospholipases are emerging as a potential class of  novel virulence factors  in pathogenic fungi  and annotation of  the genome sequence revealed several candidates. The lip2 gene was selected because previous work in the laboratory suggested that expression of  a PLA2 gene might be influenced  by the cAMP pathway. (Chapter 5). 1.5.3. Significance Generally, the significance  of  this research comes from  the identification  and characterization of  a new chemical signal provided by fatty  acids that triggers the morphological transition producing the infection  filaments  known to be essential for  the pathogenicity of  U.  maydis,  and involves the conserved signaling pathways known to play a role in virulence of  a number of  fungi.  The phenotypic analysis of  mutant strains deleted in carefully  selected genes expected to play a role in lipid/fatty  acid metabolism provides a way to examine the role of  lipid metabolism during morphological transitions and pathogenic development in U.  maydis.  Overall, this research provides a framework to address the role of  lipids in plant-fungal  interactions and to understand the importance of  lipid signaling and metabolism in fungal  development and infection. 1.6. References Agrios, G. N. (1988). Plant Pathology (San Diego: Academic Press, Inc). Alexopoulos, C. J., Mims, C. W., and Blackwell, M. (1996). Introductory Mycology.: New York: Wiley.). Andrews, D. L., Egan, J. D., Mayorga, M. E., and Gold, S. E. (2000). The Ustilago  maydis  ubc4 and ubc5 genes encode members of  a MAP kinase cascade required for  filamentous  growth. Mol Plant Microbe Interact. 13, 781-6. Babu, M. R., Choffe,  K., and Saville, B. J. (2005). Differential  gene expression in filamentous  cells of  Ustilago  maydis.  Curr Genet. 47, 316-33. Bago, B., and Becard, G. (2002). Bases of  the obligate biotrophy of  arbuscular mycorhizal fungi.  In Mycorrhizal technology in agriculture., S. H. Gianinazzi, J. M. Schiiepp, Barea and K. Haselwandter, eds. (Basel, Switzerland: Birkhauser Verlag), pp. 33-48. Bailey, A., Mueller, E., and Bowyer, P. (2000). Ornithine decarboxylase of Stagonospora  (Septoria)  nodorum  is required for  virulence toward wheat. J Biol Chem. 275, 14242-7. Banuett, F. (1992). Ustilago  maydis,  the delightful  blight. Trends Genet 8, 174-80. Banuett, F., and Herskowitz, I. (1989). Different  a alleles are necessary for maintenance of  filamentous  growth but not for  meiosis. Proc Natl Acad Sci U S A 86, 5878-5882. Banuett, F., and Herskowitz, I. (1996). Discrete developmental stages during teliospore formation  in the corn smut fungus,  Ustilago  maydis.  Development. 122, 2965-76. Banuett, F., and Herskowitz, I. (1994). Identification  offuz7,  a Ustilago  maydis MEK/MAPKK homolog required for  a-locus-dependent and -independent steps in the fungal  life  cycle. Genes Dev. 8, 1367-78. Barrett, K. J., Gold, S. E., and Kronstad, J. W. (1993). Identification  and complementation of  a mutation to constitutive filamentous  growth in Ustilago  maydis. Mol Plant Microbe Interact. 6, 274-83. Basse, C. W. (2005). Dissecting defense-related  and developmental transcriptional responses of  maize during Ustilago  maydis  infection  and subsequent tumor formation.  Plant Physiol. 138, 1774-84. Basse, C. W., Kolb, S., and Kahmann, R. (2002). A maize-specifically  expressed gene cluster in Ustilago  maydis.  Mol Microbiol 43, 75-93. Basse, C. W., Lottspeich, F., Steglich, W., and Kahmann, R. (1996). Two potential indole-3-acetaldehyde dehydrogenases in the phytopathogenie fungus  Ustilago maydis.  Eur J Biochem 242, 648-56. Bauer, R., Oberwinkler, F., and Vanky, K. (1997). Ultrastructural markers and systematics in smut fungi  and allied taxa. Can J Bot 75, 1273-1314. Bechinger, C., Giebel, K. F., Schnell, M., Leiderer, P., Deising, H. B., and Bastmeyer, M. (1999). Optical measurements of  invasive forces  exerted by appressoria of a plant pathogenic fungus.  Science. 285, 1896-9. Berto, P., Commenil, P., Belingheri, L., and Dehorter, B. (1999). Occurrence of  a lipase in spores of  Alternaria  brassicicola  with a crucial role in the infection  of cauliflower  leaves. FEMS Microbiol Lett. 180, 183-9. Birch, P. R., Rehmany, A. P., Pritchard, L., Kamoun, S., and Beynon, J. L. (2006). Trafficking  arms: oomycete effectors  enter host plant cells. Trends Microbiol. 14, 8-11. Black, P. N., and DiRusso, C. C. (2003). Transmembrane movement of exogenous long-chain fatty  acids: proteins, enzymes, and vectorial esterification. Microbiol Mol Biol Rev. 67,  454-72, table of  contents. Bolker, M., Bohnert, H. U., Braun, K. H., Gorl, J., and Kahmann, R. (1995). Tagging pathogenicity genes in Ustilago  maydis  by restriction enzyme- mediated integration (REMI). Mol Gen Genet 248, 547-52. Bolker, M., Urban, M., and Kahmann, R. (1992). The a mating type locus of  U. maydis  specifies  cell signaling components. Cell 68, 441-50. Both, M., Csukai, M., Stumpf,  M. P., and Spanu, P. D. (2005). Gene expression profiles  of  Blumeria graminis indicate dynamic changes to primary metabolism during development of  an obligate biotrophic pathogen. Plant Cell. 17, 2107-22. Bowyer, P., Mueller, E., and Lucas, J. (2000). Use of  an isocitrate lyase promoter-GFP fusion  to monitor carbon metabolism of  the plant pathogen Tapesia  yallundae during infection  of  wheat. Molecular Plant Pathology 1, 253-262. Brachmann, A., Schirawski, J., Muller, P., and Kahmann, R. (2003). An unusual MAP kinase is required for  efficient  penetration of  the plant surface  by Ustilago  maydis. EMBOJ. 22, 2199-210. Brachmann, A., Weinzierl, G., Kamper, J., and Kahmann, R. (2001). Identification  of  genes in the bW/bE regulatory cascade in Ustilago  maydis.  Mol Microbiol. 42, 1047-63. Brodowsky, I. D., Hamberg, M., and Oliw, E. H. (1992). A linoleic acid (8R)-dioxygenase and hydroperoxide isomerase of  the fungus  Gaeumannomyces graminis. Biosynthesis of  (8R)-hydroxylinoleic acid and (7S,8S)-dihydroxylinoleic acid from  (8R)-hydroperoxylinoleic acid. J Biol Chem. 267,  14738-45. Callow, J. A., and Ling, I. T. (1973). Histology of  neoplasms and chlorotic lesions in maize seedlings following  the injection of  sporidia of  Ustilago  maydis  (DC) Corda. Physiological Plant Pathology 3, 489-494. Calvo, A. M., Gardner, H. W., and Keller, N. P. (2001). Genetic connection between fatty  acid metabolism and sporulation in Aspergillus  nidulans.  J Biol Chem. 276, 25766-74. Casteels, M., Schepers, L., Van Veldhoven, P. P., and Mannaerts, G. P. (1990). Separate peroxisomal acyl-CoA oxidases for  fatty  acids and trihydroxycoprostanic acid in human liver. Biochem Soc Trans 18, 1003-1004. Champe, S. P., Rao, P., and Chang, A. (1987). An endogenous inducer of  sexual development in Aspergillus  nidulans.  J Gen Microbiol. 133, 1383-7. Chen, S. C., Muller, M., Zhou, J. Z., Wright, L. C., and Sorrell, T. C. (1997). Phospholipase activity in Cryptococcus  neoformans:  a new virulence factor?  J Infect  Dis. 775,414-20. Christensen, J. J. (1963). Corn smut induced by Ustilago  maydis.  Amer Phytopathol Soc Monogr 2. Collins, T. J., Moerschbacher, B. M., and Read, N. D. (2001). Synergistic induction of  wheat stem rust appressoria by chemical and topographical signals. Physiol Mol Plant Pathol 58, 259-266. Commenil, P., Belingheri, L., Sancholle, M., and Dehorter, B. (1995). Purification and properties of  an extracellular lipase from  the fungus  Botrytis  cinerea. Lipids. 30, 351-6. Cooper, T. G., and Beevers, H. J. (1969). Beta-oxidation in glyoxysomes from castor bean endosperm. J Biol Chem 224, 3514-3520. Cox, G. M., McDade, H. C., Chen, S. C., Tucker, S. C., Gottfredsson,  M., Wright, L. C., Sorrell, T. C., Leidich, S. D., Casadevall, A., Ghannoum, M. A., and Perfect,  J. R. (2001). Extracellular phospholipase activity is a virulence factor  for  Cryptococcus neoformans.  Mol Microbiol 39, 166-75. Day, P. R., and Anagnostakis, S. L. (1971). Corn smut dikaryon in culture. Nat New Biol 231, 19-20. De Duve, C., and Baudhuin, P. (1966). Peroxisomes (microbodies and related particles). Physiol Rev. 46, 323-57. de Hoop, M. J., and Ab, G. (1992). Import of  proteins into peroxisomes and other microbodies. Biochem J. 286, 657-69. de Jong, J. C., McCormack, B. J., Smirnoff,  N., and Talbot, N. J. (1997). Glycerol generates turgor in rice blast. Nature 389, 244-245. deBary, A. (1866). Morphologie und Physiologie der Pilze, Flechten und Myxomyeten., W. Engelmann, ed. (Leipzig: Kingdom of  Saxony). Deva, R., Ciccoli, R., Schewe, T., Kock, J. L., and Nigam, S. (2000). Arachidonic acid stimulates cell growth and forms  a novel oxygenated metabolite in Candida albicans. Biochim Biophys Acta. 1486, 299-311. Dmochowska, A., Dignard, D., Maleszka, R., and Thomas, D. Y. (1990). Structure and transcriptional control of  the Saccharomyces  cerevisiae POX1 gene encoding acyl-coenzyme A oxidase. Gene 88, 247-252. D'Souza, C. A., and Heitman, J. (2001). Conserved cAMP signaling cascades regulate fungal  development and virulence. FEMS Microbiol Rev 25, 349-64. Duronio, R. J., Knoll, L. J., and Gordon, J. I. (1992). Isolation of a Saccharomyces  cerevisiae long chain fatty  acyl: Co A synthetase gene (FAA1) and assessment of  its role in protein Nmyristoylation. J Cell Biol 117, 515-529. Durrenberger, F., Laidlaw, R. D., and Kronstad, J. W. (2001). The hgll  gene is required for  dimorphism and teliospore formation  in the fungal  pathogen Ustilago maydis.  Mol Microbiol. 41, 337-48. Durrenberger, F., Wong, K., and Kronstad, J. W. (1998). Identification  of  a cAMP-dependent protein kinase catalytic subunit required for  virulence and morphogenesis in Ustilago  maydis.  Proc Natl Acad Sci USA. 95, 5684-9. Eaton, S., Bartlett, K., and Pourfarzam,  M. (1996). Mammalian mitochondrial beta-oxidation. Biochem J 320, 345-357. Einerhand, A. W., Voorn-Brouwer, T. M., Erdmann, R., Kunau, W. H., and Tabak, H. F. (1991). Regulation of  transcription of  the gene coding for  peroxisomal 3-oxoacyl-CoA thiolase of  Saccharomyces  cerevisiae. Eur J Biochem 200, 113-122. Faergeman, N. J., DiRusso, C. C., Elberger, A., Knudsen, J., and Black, P. N. (1997). Disruption of  the Saccharomyces  cerevisiae homologue to the murine fatty  acid transport protein impairs uptake and growth on long-chain fatty  acids. J Biol Chem 272, 8531-8538. Frerman, F. E. (1988). Acyl-CoA dehydrogenases, electron transfer  flavoprotein and electron transfer  flavoprotein  dehydrogenase. Biochem Soc Trans. 16, 416-8. Fu, Y., Ibrahim, A. S., Fonzi, W., Zhou, X., Ramos, C. F., and Ghannoum, M. A. (1997). Cloning and characterization of  a gene (LIP1)  which encodes a lipase from  the pathogenic yeast Candida  albicans. Microbiology. 143, 331-40. Garrido, E., Voss, U., Muller, P., Castillo-Lluva, S., Kahmann, R., and Perez-Martin, J. (2004). The induction of  sexual development and virulence in the smut fungus Ustilago  maydis  depends on Crkl, a novel MAPK protein. Genes Dev. 18, 3117-30. Ghannoum, M. A. (2000). Potential role of  phospholipases in virulence and fungal  pathogenesis. Clin Microbiol Rev 13, 122-43, table of  contents. Ghannoum, M. A., Janini, G., Khamis, L., and Radwan, S. S. (1986). Dimorphism-associated variations in the lipid composition of  Candida  albicans. J Gen Microbiol. 132, 2367-75. Gillissen, B., Bergemann, J., Sandmann, C., Schroeer, B., Bolker, M., and Kahmann, R. (1992). A two-component regulatory system for  self/non-self  recognition in Ustilago  maydis.  Cell 68, 647-57. Gold, S., Duncan, G., Barrett, K., and Kronstad, J. (1994). cAMP regulates morphogenesis in the fungal  pathogen Ustilago  maydis.  Genes Dev. 8, 2805-16. Gold, S. E., Brogdon, S. M., Mayorga, M. E., and Kronstad, J. W. (1997). The Ustilago  maydis  regulatory subunit of  a cAMP-dependent protein kinase is required for gall formation  in maize. Plant Cell. 9, 1585-94. Goodrich-Tanrikulu, M., Howe, K., Stafford,  A., and Nelson, M. A. (1998). Changes in fatty  acid composition of  Neurospora  crassa accompany sexual development and ascospore germination. Microbiology. 144, 1713-20. Gottlich, E., de Hoog, G. S., Yoshida, S., Takeo, K., Nishimura, K., and Miyaji, M. (1995). Cell-surface  hydrophobicity and lipolysis as essential factors  in human tinea nigra. Mycoses. 38, 489-94. Grove, M. D. (1973). Light and electron microscopy investigation of  developing wheat caryopsis infected  by Tilletia.  (Provo. Utah.: BrighamYoung Univ.). Hahn, M., and Mendgen, K. (2001). Signal and nutrient exchange at biotrophic plant-fungus  interfaces.  Curr Opin Plant Biol. 4, 322-7. Hardham, A. J. (2001). Cell biology of  fungal  infection  of  plants. In The Mycota: Biology of  the Fungal Cell., R. J. Howard and N. A. R. Gow, eds.: Springer-Verlag), pp. 91-124. Hartmann, H. A., Kahmann, R., and Bolker, M. (1996). The pheromone response factor  coordinates filamentous  growth and pathogenicity in Ustilago  maydis.  EMBO J. 15, 1632-41. Hashimoto, T. (2000). Peroxisomal beta-oxidation enzymes. Cell Biochem Biophys. 32, 63-72. Hashimoto, T. (1996). Peroxisomal beta-oxidation: enzymology and molecular biology. Ann N Y Acad Sci. 804, 86-98. Herman, R. P. (1998). Oxylipin production and action in fungi  and related organisms. In Eicosanoids and Related Compounds in Plants and Animals., A. F. Rowley, H. Kuhn and T. Schewe, eds. (Princeton, NJ: Princeton University Press.), pp. 115-130. Hettema, E. H., van Roermund, C. W. T., Distel, B., van Den, B. M., Vilela, C., and Rodrigues-Pousada, C. (1996). The ABC transporter proteins Patl and Pat2 are required for  import of  long-chain fatty  acids into peroxisomes of  Saccharomyces cerevisiae. EMBO J 15, 3813-3822. Hiltunen, J. K., Filppula, S. A., Koivuranta, K. T., Siivari, K., Qin, Y. M., and Hayrinen, H. M. (1996). Peroxisomal beta-oxidation and polyunsaturated fatty  acids. Ann N Y Acad Sci. 804, 116-28. Hiltunen, J. K., Wenzel, B., Beyer, A., Erdmann, R., Fossa, A., and Kunau, W. H. (1992). Peroxisomal multifunctional  beta-oxidation protein of  Saccharomyces  cerevisiae. Molecular analysis of  the fox2  gene and gene product. J Biol Chem. 267,  6646-53. Holliday, R. (1961). The genetics of  Ustilago  maydis.  Genet. Res. Cambridge Soc 2, 204-230. Holliday, R. (1974). Ustilago  maydis.  In Handbook of  Genetics, R. C. King, ed. (New York: Plenum Press), pp. 575-595. Hornsten, L., Su, C., Osbourn, A. E., Garosi, P., Hellman, U., Wernstedt, C., and Oliw, E. H. (1999). Cloning of  linoleate diol synthase reveals homology with prostaglandin H synthases. J Biol Chem. 274, 28219-24. Hube, B. (1998). Possible role of  secreted proteinases in Candida  albicans infections.  Rev Iberoam Micol 15, 65-68. Hube, B., Stehr, F., Bossenz, M., Mazur, A., Kretschmar, M., and Schafer,  W. (2000). Secreted lipases of  Candida  albicans: cloning, characterisation and expression analysis of  a new gene family  with at least ten members. Arch Microbiol. 174, 362-74. Huber, S. M., Lottspeich, F., and Kamper, J. (2002). A gene that encodes a product with similarity to dioxygenases is highly expressed in teliospores of  Ustilago maydis.  Mol Genet Genomics 267,  757-71. Huber, S. M., Lottspeich, F., and Kamper, J. (2002). A gene that encodes a product with similarity to dioxygenases is highly expressed in teliospores of  Ustilago maydis.  Mol Genet Genomics 267,  757-71. Ibrahim, A. S., Mirbod, F., Filler, S. G., Banno, Y., Cole, G. T., Kitajima, Y., Edwards, J. E., Jr., Nozawa, Y., and Ghannoum, M. A. (1995). Evidence implicating phospholipase as a virulence factor  of  Candida  albicans. Infect  Immun. 63, 1993-8. Idnurm, A., and Howlett, B. J. (2002). Isocitrate lyase is essential for pathogenicity of  the fungus  Leptosphaeria maculans to canola (Brassica napus). Eukaryot Cell. 1, 719-24. Idnurm, A., and Howlett, B. J. (2001). Pathogenicity genes of  phytopathogenic fungi.  Mol Plant Pathol 2, 229-240. Igual, J. C., Matallana, E., Gonzalez-Bosch, C., Franco, L., and Perez-Ortin, J. E. (1991). A new glucose-repressible gene identified  from  the analysis of  chromatin structure in deletion mutants of  yeast SUC2  locus. Yeast 7, 379-389. Jennings, D. H., and Lysek, G. (1996). Fungal Biology: Understanding the Fungal Lifestyle.  (Oxford,  UK: BIOS Scientific  Publishers.). Jiang, L. L., Kobayashi, A., Matsuura, H., Fukushima, H., and Hashimoto, T. (1996). Purification  and properties of  human D-3-hydroxyacyl-CoA dehydratase: medium-chain enoyl-CoA hydratase is D-3-hydroxyacyl-CoA dehydratase. J Biochem (Tokyo) 120, 624-632. Johnson, D. R., Knoll, L. J., Levin, D. E., and Gordon, J. I. (1994). Saccharomyces  cerevisiae contains four  fatty  acid activation (FAA) genes: an assessment of  their role in regulating protein N-myristoylation and cellular lipid metabolism. J Cell Biol 127, 751-762. Kachroo, A., Lapchyk, L., Fukushige, H., Hildebrand, D., Klessig, D., and Kachroo, P. (2003). Plastidial fatty  acid signaling modulates salicylic acid- and jasmonic acid-mediated defense  pathways in the Arabidopsis ssi2 mutant. Plant Cell. 15, 2952-65. Kachroo, P., Shanklin, J., Shah, J., Whittle, E. J., and Klessig, D. F. (2001). A fatty  acid desaturase modulates the activation of  defense  signaling pathways in plants. Proc Natl Acad Sci U S A . 98, 9448-53. Kahmann, R., and Basse, C. (2001). Fungal gene expression during pathogenesis-related development and host plant colonization. Curr Opin Microbiol. 4, 374-80. Kamiryo, T., Sakasegawa, Y., and Tan, H. (1989). Expression and transport of Candida  tropicalis  peroxisomal acyl-coenzyme A oxidase in the yeast Candida  maltosa. Agric Biol Chem. 53, 179-186. Kamper, J., Kahmann, R., Bolker, M., Li-Jun Ma, L., Brefort,  T., Saville, B. J., Banuett, F., Kronstad, J. W., Gold, S. E., Muller, O., Perlin, M. H., Wosten, H. A. B., deVries, R., Ruiz-Herrera, J., Reynaga-Pena, C. G., Snetselaar, K., McCannl, M., Perez-Martin, J., Feldbriigge, M., Basse, C. W., Steinberg, G., Ibeas, J. I., Holloman, W., Guzman, P., Farman, M., Stajich, J. E., Sentandreu, R., Gonzalez-Prietro, J. M., Kennell, J. C., Molina, L., Schirawski, J., Mendoza-Mendoza, A., Greilinger, D., Miinch, K., Rossel, M., Scherer, M., Vranes, M., Ladendorf,  O., Vincon, V., Fuchs, U., Sandrock, B., Meng, S., Ho, E. C. H., Cahill, M. J., K. J. Boyce, Klose, J., Klosterman, S. J., Deelstra, H. J., Ortiz-Castellanos, L., Li, W., Sanchez-Alonso, P., Schreier, P. H., Hauser-Hahn, I., Vaupel, M., Koopmann, E., Friedrich, G., Voss, H., Schluter, T., Margolis, J., Piatt, D., Swimmer, C., Gnirke, A., Chen, F., Vysotskaia, V., Mannhaupt, G., Giildener, U., Miinsterkotter, M., Haase, D., Oesterheld, M., Mewes, H., Mauceli, E. W., DeCaprio, D., Wade, C. M., Butler, J., Young, S., Jaffe,  D. D., Calvo, S., Nusbaum, C., Galagan, J., and Birren, B. W. (2006). Insights from  the genome of  the biotrophic fungal  plant pathogen Ustilago  maydis.  Nature 444, 97-101. Kamper, J., Reichmann, M., Romeis, T., Bolker, M., and Kahmann, R. (1995). Multiallelic recognition: nonself-dependent  dimerization of  the bE and bW homeodomain proteins in Ustilago  maydis.  Cell 81, 73-83. Karpichev, I. V., and Small, G. M. (1998). Global regulatory functions  of  Oaflp and Pip2p (Oaf2p),  transcription factors  that regulate genes encoding peroxisomal proteins in Saccharomyces  cerevisiae. Mol Cell Biol 18, 6560-6570. Keen, N. T., and Williams, P. H. (1969). Synthesis and degradation of  starch and lipids following  infection  of  cabbage by Plasmodiophora  brassicae. Phytopathology 59, 778. Kimura, A., Takano, Y., Furusawa, I., and Okuno, T. (2001). Peroxisomal metabolic function  is required for  appressorium-mediated plant infection  by Colletotrichum  lagenarium.  Plant Cell. 13, 1945-57. Klose, J., Moniz de Sa, M. M., and Kronstad, J. W. (2004). Lipid-induced filamentous  growth in Ustilago  maydis.  Mol Microbiol 52, 823-35. Knoll, L. J., Johnson, D. R., and Gordon, J. I. (1993). Biochemical studies of  three Saccharomyces  cerevisiae acyl-CoA synthetases, Faalp, Faa2p and Faa3p. J Biol Chem 269, 16348-16356. Knowles, E. L. (1898). A study of  the abnormal structures induced by Ustilago zeae mays. J. Mycol., 14-50. Kolattukudy, P. E. (1970). Biosynthesis of  a lipid polymer, cutin: the structural component of  plant cuticle. Biochem Biophys Res Commun 41, 299-305. Kolattukudy, P. E., Rogers, L. M., Li, D., Hwang, C. S., and Flaishman, M. A. (1995). Surface  signaling in pathogenesis. Proc Natl Acad Sci U S A . 92, 4080-7. Kronstad, J., De Maria, A. D., Funnell, D., Laidlaw, R. D., Lee, N., de Sa, M. M., and Ramesh, M. (1998). Signaling via cAMP in fungi:  interconnections with mitogen-activated protein kinase pathways. Arch Microbiol 170, 395-404. Kronstad, J. W., and Leong, S. A. (1989). Isolation of  two alleles of  the b locus of Ustilago  maydis.  Proc Natl Acad Sci U S A 86, 978-82. Kronstad, J. W., and Staben, C. (1997). Mating type in filamentous  fungi.  Annu Rev Genet 31, 245-76. Kruger, J., Loubradou, G., Regenfelder,  E., Hartmann, A., and Kahmann, R. (1998). Crosstalk between cAMP and pheromone signalling pathways in Ustilago maydis.  Mol Gen Genet. 260, 193-8. Kunau, W. H., Buhne, S., de la Garza, M., Kionka, C., Mateblowski, M., Schultz-Borchard, U., and Thieringer, R. (1988). Comparative enzymology of  beta-oxidation. Biochem Soc Trans. 16, 418-20. Kunau, W. H., Dommes, V., and Schulz, H. (1995). beta-oxidation of  fatty  acids in mitochondria, peroxisomes, and bacteria: a century of  continued progress. Prog Lipid Res. 34, 267-342. Kurihara, T., Ueda, M., Okada, H., Kamasawa, N., Naito, N., Osumi, M., and Tanaka, A. (1992). Beta-oxidation of  butyrate, the short-chain-length fatty  acid, occurs in peroxisomes in the yeast Candida  tropicalis.  J Biochem (Tokyo). Ill,  783-7. Laity, C., Giasson, L., Campbell, R., and Kronstad, J. (1995). Heterozygosity at the b mating-type locus attenuates fusion  in Ustilago  maydis.  Curr Genet 27, 451-9. Laxalt, A. M., and Munnik, T. (2002). Phospholipid signalling in plant defence. Curr Opin Plant Biol. 5, 332-8. Lazarow, P. B., and De Duve, C. (1976). A fatty  acyl-CoA oxidizing system in rat liver peroxisomes; enhancement by clofibrate,  a hypolipidemic drug. Proc Natl Acad Sci USA. 73, 2043-6. Lee, N., D'Souza, C. A., and Kronstad, J. W. (2003). Of  smuts, blasts, mildews, and blights: cAMP signaling in phytopathogenic fungi.  Annu Rev Phytopathol. 41, 399-427. Lee, N., and Kronstad, J. W. (2002). ras2 Controls morphogenesis, pheromone response, and pathogenicity in the fungal  pathogen Ustilago  maydis.  Eukaryot Cell. 1, 954-66. Lee, S., Suh, S., Kim, S., Crain, R. C., Kwak, J. M., Nam, H. G., and Lee, Y. (1997). Systemic elevation of  phosphatidic acid and lysophospholipid levels in wounded plants. The Plant J 12, 547-556. Lehtinen, U. (1993). Plant cell wall degrading enzymes of  Septoria  nodorum. Physiol Mol Plant Pathol 43, 121-134. Leidich, S. D., Ibrahim, A. S., Fu, Y., Koul, A., Jessup, C., Vitullo, J., Fonzi, W., Mirbod, F., Nakashima, S., Nozawa, Y., and Ghannoum, M. A. (1998). Cloning and disruption of  caPLBl, a phospholipase B gene involved in the pathogenicity of  Candida albicans. J Biol Chem. 273, 26078-86. Li, C., Liu, G., Xu, C., Lee, G. I., Bauer, P., Ling, H. Q., Ganal, M. W., and Howe, G. A. (2003). The tomato suppressor of  prosystemin-mediated responses2 gene encodes a fatty  acid desaturase required for  the biosynthesis of  jasmonic acid and the production of  a systemic wound signal for  defense  gene expression. Plant Cell. 15, 1646-61. Lorenz, M. C., Bender, J. A., and Fink, G. R. (2004). Transcriptional response of Candida  albicans upon internalization by macrophages. Eukaryot Cell. 3, 1076-87. Lorenz, M. C., and Fink, G. R. (2001). The glyoxylate cycle is required for  fungal virulence. Nature 412, 83-6. Luo, Y., Karpichev, I. V., Kohanski, R. A., and Small, G. M. (1996). Purification, identification  and properties of  a Saccharomyces  cerevisiae oleate-activated upstream activating sequence-binding protein that is involved in the activation of  POX1.  J Biol Chem 271, 12068-12075. Macko, V. (1981). Inhibitors and stimulants of  spore germination and infection structure formation  in fungi.  In The fungal  spore morphogenetic controls., G. Turian and H. R. Holh, eds. (New York, N.Y.: Academic Press), pp. 565-584. Maggio-Hall, L. A., and Keller, N. P. (2004). Mitochondrial beta-oxidation in Aspergillus  nidulans.  Mol Microbiol. 54, 1173-85. Maldonado, A. M., Doerner, P., Dixon, R. A., Lamb, C. J., and Cameron, R. K. (2002). A putative lipid transfer  protein involved in systemic resistance signalling in Arabidopsis. Nature. 419, 399-403. Malila, L. H., Siivari, K. M., Makela, M. J., Jalonen, J. E., Latipaa, P. M., and Kunau, W. H. (1993). Enzymes converting D-3-hydroxyacyl-CoA to trans-2-enoyl-CoA. Microsomal and peroxisomal isoenzymes in rat liver. J Biol Chem 268, 21578-21585. Mannaerts, G. P., and Debeer, L. J. (1982). Mitochondrial and peroxisomal beta-oxidation of  fatty  acids in rat liver. Ann N Y Acad Sci. 386, 30-9. Mannaerts, G. P., and van Veldhoven, P. P. (1996). Functions and organization of peroxisomal beta-oxidation. Ann N Y Acad Sci. 804, 99-115. Marriott, M. S. (1975). Isolation and chemical characterization of  plasma membranes froorm  the yeast and mycelial forms  of  Candida  albica. J Gen Microbiol 86, 115. Martinez-Espinoza, A. D., Garcia-Pedrajas, M. D., and Gold, S. E. (2002). The Ustilaginales  as plant pests and modiel systems. Fungal Genet Biol 35, 1-20. Martinez-Espinoza, A. D., Gerhardt, S. A., and Sherwood, J. E. (1993). Morphological and mutational analysis of  mating in Ustilago  hordei.  Exp Mycol 17, 200-214. Mayorga, M. E., and Gold, S. E. (1998). Characterization and molecular genetic complementation of  mutants affecting  dimorphism in the fungus  Ustilago  maydis.  Fungal Genet Biol 24, 364-76. Mayorga, M. E., and Gold, S. E. (1999). A MAP kinase encoded by the ubc3 gene of  Ustilago  maydis  is required for  filamentous  growth and full  virulence. Mol Microbiol. 34, 485-97. Mayorga, M. E., and Gold, S. E. (2001). The ubc2 gene of  Ustilago  maydis encodes a putative novel adaptor protein required for  filamentous  growth, pheromone response and virulence. Mol Microbiol 41, 1365-79. Mazur, P., Meyers, H. V., and Nakanishi, K. (1990). Structural elucidation of sporogenic fatty  acid metabolites from  Aspergillus  nidulans.  Tetrahedron Lett 31, 3837-3840. McKinney, J. D., Honer zu Bentrup, K., Munoz-Elias, E. J., Miczak, A., Chen, B., Chan, W. T., Swenson, D., Sacchettini, J. C., Jacobs, W. R., Jr., and Russell, D. G. (2000). Persistence of  Mycobacterium  tuberculosis  in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase. Nature. 406, 735-8. Meijer, H. J., and Munnik, T. (2003). Phospholipid-based signaling in plants. Annu Rev Plant Biol. 54, 265-306. Mellon, J. E., Dowd, M. K., and Cotty, P. J. (2005). Substrate utilization by Aspergillus  flavus  in inoculated whole corn kernels and isolated tissues. J Agric Food Chem, 2351-2357. Mendgen, K., and Hahn, M. (2002). Plant infection  and the establishment of fungal  biotrophy. Trends Plant Sci. 7, 352-6. Mills, L. J., and Kotze, J. M. (1981). Scanning electron microscopy of  the germination, growth and infection  of  Ustilago  maydis  on maize. Phytopath.  Z.,  21-27. Miyazawa, S., Furuta, S., Osumi, T., Hashimoto, T., and Ui, N. (1981). Properties of  peroxisomal 3-ketoacyl-coA thiolase from  rat liver. J Biochem (Tokyo) 90, 511-519. Mohnen, D., and Hahn, M. G. (1993). Cell wall carbohydrates as signals in plants. Semin Cell Biol. 4, 93-102. Muller, P., Aichinger, C., Feldbrugge, M., and Kahmann, R. (1999). The MAP kinase kpp2  regulates mating and pathogenic development in Ustilago  maydis.  Mol Microbiol 34, 1007-17. Muller, P., Weinzierl, G., Brachmann, A., Feldbrugge, M., and Kahmann, R. (2003). Mating and pathogenic development of  the Smut fungus  Ustilago  maydis  are regulated by one mitogen-activated protein kinase cascade. Eukaryot Cell. 2, 1187-99. Munoz, C. I., and Bailey, A. M. (1998). A cutinase-encoding gene from Phytophthora  capsici isolated by differential-display  RT-PCR. Curr Genet 33, 225-30. Murphy, J. M., and Walton, J. D. (1996). Three extracellular proteases from Cochliobolus  carbonum: cloning and targeted disruption of  ALP1. Mol Plant Microbe Interact. 9, 290-7. Nakayama, N., Takemae, A., and Shoun, H. (1996). Cytochrome P450foxy,  a catalytically self-sufficient  fatty  acid hydroxylase of  the fungus  Fusarium  oxysporum. J Biochem (Tokyo). 119, 435-40. Nandi, A., Welti, R., and Shah, J. (2004). The Arabidopsis  thaliana dihydroxyacetone phosphate reductase gene SUPPRESSSOR  OF FATTY  ACID DESATURASE  DEFICIENCY  1 is required for  glycerolipid metabolism and for  the activation of  systemic acquired resistance. Plant Cell. 16, 465-77. Nespoulous, C., Gaudemer, O., Huet, J. C., and Pernollet, J. C. (1999). Characterization of  elicitin-like phospholipases isolated from  Phytophthora  capsici culture filtrate.  FEBS Lett 452, 400-6. Noeldner, P. K. M., Coleman, M. J., Faulks, R., and Oliver, R. P. (1994). Purification  and characterization of  mannitol dehydrogenase from  the fungal  tomato pathogen Cladosporium  fulvum  (syn. Fulvia fulva).  Physiol Mol Plant Pathol 45, 281— 289. Noverr, M. C., Erb-Downward, J. R., and Huffhagle,  G. B. (2003). Production of eicosanoids and other oxylipins by pathogenic eukaryotic microbes. Clin Microbiol Rev 16, 517-533. Noverr, M. C., Phare, S. M., Toews, G. B., Coffey,  M. J., and Huffnagle,  G. B. (2001). Pathogenic yeasts Cryptococcus  neoformans  and Candida  albicans produce immunomodulatory prostaglandins. Infect  Immun. 69, 2957-63. Noverr, M. C., Toews, G. B., and Huffnagle,  G. B. (2002). Production of prostaglandins and leukotrienes by pathogenic fungi.  Infect  Immun. 70, 400-2. Odds, F. C. (1994). Candida  species and virulence. ASM News 60, 313-318. Ogawa, H., Nozawa, Y., Rojanavanich, V., Tsuboi, R., Yoshiike, T., Banno, Y., Takahashi, M., Nombela, C., Herreros, E., Garcia-Saez, M. I., and et al. (1992). Fungal enzymes in the pathogenesis of  fungal  infections.  J Med Vet Mycol 30, 189-96. Palmer, C., and Skinner, W. (2002). Mycosphaerella  graminicola:  latent infection,  crop devastation and genomics. Mol Plant Pathol 3, 63-70. Piffanelli,  P., and Murphy, D. J. (1999). Lipid accumulation and related gene expression in gametophytic and sporophytic anther tissues. In Fertilization in Higher Plants: Molecular and Cytological Aspects., M. Cresti, G. Cai and A. Moscatelli, eds. (Berlin: Springer), pp. 23-45. Podila, G. K., Rogers, L. M., and Kolattukudy, P. E. (1993). Chemical Signals from  Avocado Surface  Wax Trigger Germination and Appressorium Formation in Colletotrichum  gloeosporioides.  Plant Physiol. 103, 267-272. Puhalla, J. E. (1968). Compatibility reactions on solid medium and interstrain inhibition in Ustilago  maydis.  Genetics 60, 461-74. Puhalla, J. E. (1969). The formation  of  diploids of  Ustilago  maydis  on agar medium. Phytopathology 59, 1771-2. Purdue, P. E., and Lazarow, P. B. (1994). Peroxisomal biogenesis: multiple pathways of  protein import. J Biol Chem. 269, 30065-8. Ramberg, J. E., and McLaughlin, D. J. (1980). Ultrastructural study of promycelial development and basidiospore initiation in Ustilago  maydis.  Can. J. Bot., 1548-1561. Regenfelder,  E., Spellig, T., Hartmann, A., Lauenstein, S., Bolker, M., and Kahmann, R. (1997). G proteins in Ustilago  maydis:  transmission of  multiple signals? EMBO J. 16, 1934-42. Rogers, L. M., Flaishman, M. A., and Kolattukudy, P. E. (1994). Cutinase gene disruption in Fusarium  solani f  sp pisi decreases its virulence on pea. Plant Cell 6, 935-45. Rose, K., Rudge, S. A., Frohman, M. A., Morris, A. J., and Engebrecht, J. (1995). Phospholipase D signaling is essential for  meiosis. Proc Natl Acad Sci U S A. 92, 12151-5. Rottensteiner, H., Kal, A. J., Filipits, M., Binder, M., Hamilton, B., and Tabak, H. F. (1996). Pip2p: a transcriptional regulator of  peroxisome proliferation  in the yeast Saccharomyces  cerevisiae. EMBO J 15, 2924-2934. Rowell, J. B. (1955). Functional role of  compatibility factors  and an in vitro test for  sexual compatibility with haploid lines of  Ustilago  zeae. Phytopathology 45, 370-374. Ryu, S. B., and Wang, X. (1998). Increase in free  linolenic and linoleic acids associated with phospholipase D-mediated hydrolysis of  phospholipids in wounded castor bean leaves. Biochim Biophys Acta. 1393, 193-202. Saffer,  L. D., Long Krug, S. A., and Schwartzman, J. D. (1989). The role of phospholipase in host cell penetration by Toxoplasma  gondii.  Am J Trop Med Hyg. 40, 145-9. Salyers, A. A., and Whitt, D. D. (1994). Bacterial Pathogenesis: a Molecular Approach. (Washington, DC: American Society for  Microbiology). Schaffer,  J. E., and Lodish, H. F. (1994). Expression cloning and characterization of  a novel adipocyte long chain fatty  acid transport protein. Cell 79, 427^436. Schenk, P. M., Kazan, K., Wilson, I., Anderson, J. P., Richmond, T., Somerville, S. C., and Manners, J. M. (2000). Coordinated plant defense  responses in Arabidopsis revealed by microarray analysis. Proc Natl Acad Sci U S A . 97, 11655-60. Schmidt, E. W. (1932). Uber eine pathologische Fettbildung im Zuckerrubenblatt. Ber Deutch Bot Ges 50, 472. Schnipper, A. L., and Mirocha, C. J. (1970). Change in fatty  acid content of fungus-host  tissue during pathogenesis of  Uromyces  phaseoli typica in Phaseolus vulgaris.  Phytopathology 60, 377. Schulz, B., Banuett, F., Dahl, M., Schlesinger, R., Schafer,  W., Martin, T., Herskowitz, I., and Kahmann, R. (1990). The b alleles of  Ustilago  maydis,  whose combinations program pathogenic development, code for  polypeptides containing a homeodomain-related motif.  Cell 60, 295-306. Sebolai, O. M., Kock, J. L. F., Pohl, C. H., Botes, P. J., Strauss, C. J., Van Wyk, P. W. J., and Nigam, S. (2005). The presence of  3-hydroxy oxylipins on the ascospore surfaces  of  some species representing Saccharomycopsis  schidnning.  Can J Microbiol 57, 605-612. Seedorf,  U., Brysch, P., Engel, T., Schrage, K., and Assmann, G. (1994). Sterol carrier protein X is peroxisomal 3-oxoacyl coenzyme A thiolase with intrinsic sterol carrier and lipid transfer  activity. J Biol Chem 269, 21277-21283. Shani, N., Watkins, P. A., and Valle, D. (1995) PXA1, a possible Saccharomyces cerevisiae ortholog of  the human adrenoleukodystrophy gene. Proc Natl Acad Sci USA 92, 6012-6016. Shanklin, J., and Cahoon, E. B. (1998). Desaturation and Related Modifications  of Fatty Acids 1. Annu Rev Plant Physiol Plant Mol Biol. 49, 611-641. Siddhanta, A., and Shields, D. (1998). Secretory vesicle budding from  the trans-Golgi network is mediated by phosphatidic acid levels. J Biol Chem. 273, 17995-8. Sleumer, H. O. (1932). Uber Sexualitat und Zytologie von Ustilago  zeae (Beckm.) Unger. Zeitsch.  Bot, 210-263. Small, G. M., Szabo, L. J., and Lazarow, P. B. (1988). Acyl-CoA oxidase contains two targeting sequences each of  which can mediate protein import into peroxisomes. EMBO J. 7, 1167-73. Smart, M. G., Wicklow, D. T., and Caldwell, R. W. (1990). Pathogenesis in Aspergillus  ear rot of  maize: light microscopy of  fungal  spread from  wounds. Phytopathology 80, 1287-1294. Smith, J. J., Brown, T. W., Eitzen, G. A., and Rachubinski, R. A. (2000). Regulation of  peroxisome size and number by fatty  acid beta -oxidation in the yeast Yarrowia  lipolytica.  J Biol Chem. 275, 20168-78. Smith, L. G., Gerttula, S. M., Han, S., and Levy, J. (2001). Tangledl: a microtubule binding protein required for  the spatial control of  cytokinesis in maize. J Cell Biol. 752,231-6. Snetselaar, K. M., Bolker, M., and Kahmann, R. (1996). Ustilago  maydis  Mating Hyphae Orient Their Growth toward Pheromone Sources. Fungal Genet Biol 20, 299-312. Snetselaar, K. M., and Mims, C. W. (1993). Infection  of  maize stigmas by Ustilago  maydis'.  light and electron microscopy. Phytopathology, 843-850. Snetselaar, K. M., and Mims, C. W. (1994.). Light and electron microscopy of Ustilago  maydis  hyphae in maize. Mycological Research, 347-355. Snetselaar, K. M., and Mims, C. W. (1992). Sporidial fusion  and infection  of maize seedlings by the smut fungus  Ustilago  maydis.  Mycologia 84, 193-203. Solomon, P. S., Lee, R. C., Wilson, T. J., and Oliver, R. P. (2004). Pathogenicity of  Stagonospora  nodorum  requires malate synthase. Mol Microbiol. 53, 1065-73. Solomon, P. S., Tan, K., and Oliver, R. P. (2003). The nutrient supply of pathogenic fungi;  a fertile  field  for  study. Molecular Plant Pathology 4, 203-210. Spellig, T., Bolker, M., Lottspeich, F., Frank, R. W., and Kahmann, R. (1994). Pheromones trigger filamentous  growth in Ustilago  maydis.  EMBO J 13, 1620-7. Spellig, T., Regenfelder,  E., Reichmann, M., Schauwecker, F., Bohlmann, R., Urban, M., Bolker, M., Kamper, J., and Kahmann, R. (1994). Control of  mating and development in Ustilago  maydis.  Antonie Van Leeuwenhoek 65, 191-7. Staples, R. C., and Hoch, H. C. (1997.). Physical and chemical cues for  spore germination and appressorium formation  by fungal  pathogens. In Mycota: Plant relationships. Part A., G. Carroll and P. Tudzynski, eds.: Springer Verlag), pp. 27-40. Su, C., Brodowsky, I. D., and Oliw, E. H. (1995). Studies on linoleic acid 8R-dioxygenase and hydroperoxide isomerase of  the fungus  Gaeumannomyces graminis. Lipids. 30, 43-50. Su, C., and Oliw, E. H. (1996). Purification  and characterization of  linoleate 8-dioxygenase from  the fungus  Gaeumannomyces graminis as a novel hemoprotein. J Biol Chem 271, 14112-14118. Sylvester, A. W., Cande, W. Z., and Freeling, M. (1990). Division and differentiation  during normal and liguleless-1 maize leaf  development. Development. 110, 985-1000. Talbot, N. J. (2003). On the trail of  a cereal killer: Exploring the biology of Magnaporthe  grisea. Annu Rev Microbiol. 57, 177-202. Thines, E., Weber, R. W., and Talbot, N. J. (2000). MAP kinase and protein kinase A-dependent mobilization of  triacylglycerol and glycogen during appressorium turgor generation by Magnaporthe  grisea. Plant Cell. 12, 1703-18. Thomas, S. W., Glaring, M. A., Rasmussen, S. W., Kinane, J. T., and Oliver, R. P. (2002). Transcript profiling  in the barley mildew pathogen Blumeria graminis by serial analysis of  gene expression (SAGE). Mol Plant Microbe Interact. 15, 847-56. Thomas, S. W., Rasmussen, S. W., Glaring, M. A., Rouster, J. A., Christiansen, S. K., and Oliver, R. P. (2001). Gene identification  in the obligate fungal  pathogen Blumeria graminis by expressed sequence tag analysis. Fungal Genet Biol. 33, 195-211. Thomma, B. P. H. J., Van Esse, H. P., Crous, P. W., and De Wit, P. J. G. M. (2005). Cladosporium  fulvum  (syn. Passalora fulva),  a highly specialized plant pathogen as a model for  functional  studies on plant pathogenic Mycosphaerellaceae. Mol Plant Pathol 6, 379-393(15). Tolbert, N. E. (1981). Metabolic pathways in peroxisomes and glyoxysomes. Annu Rev Biochem. 50, 133-57. Trotter, P. J. (2001). The genetics of  fatty  acid metabolism in Saccharomyces cerevisiae. Annu Rev Nutr. 21, 97-119. Tsitsigiannis, D. I., Kowieski, T. M., Zarnowski, R., and Keller, N. P. (2004a). Endogenous lipogenic regulators of  spore balance in Aspergillus  nidulans.  Eukaryot Cell. 3, 1398-411. Tsitsigiannis, D. I., Kowieski, T. M., Zarnowski, R., and Keller, N. P. (2005b). Three putative oxylipin biosynthetic genes integrate sexual and asexual development in Aspergillus  nidulans.  Microbiology. 151, 1809-21. Tsitsigiannis, D. I., Zarnowski, R., and Keller, N. P. (2004b). The lipid body protein, PpoA, coordinates sexual and asexual sporulation in Aspergillus  nidulans.  J Biol Chem. 279, 11344-53. Epub 2003 Dec 29. Tucker, S. L., and Talbot, N. J. (2001). Surface  attachment and pre-penetration stage development by plant pathogenic fungi.  Annu Rev Phytopathol. 39, 385-417. Uchida, Y., Izai, K., Orii, T., and Hashimoto, T. (1992). Novel fatty  acid beta-oxidation enzymes in rat liver mitochondria. II. Purification  and properties of  enoyl-coenzyme A (CoA) hydratase/3-hydroxyacyl-CoA dehydrogenase/3-ketoacyl-Co A thiolase trifunctional  protein. J Biol Chem. 267,  1034-41. Urban, M., Kahmann, R., and Bolker, M. (1996). Identification  of  the pheromone response element in Ustilago  maydis.  Mol Gen Genet 251, 31-7. Van Leeuwen, W., Okresz, L., Bogre, L., and Munnik , T. (2004). Learning the lipid language of  plant signalling. Trends Plant Sci 9, 378-384. van Roermund, C. W., Elgersma, Y., Singh, N., Wanders, R. J., and Tabak, H. F. (1995). The membrane of  peroxisomes in Saccharomyces  cerevisiae is impermeable to NAD(H) and acetyl-CoA under in vivo conditions. Embo J. 14, 3480-6. van Roermund, C. W., Waterham, H. R., Ijlst, L., and Wanders, R. J. (2003). Fatty acid metabolism in Saccharomyces  cerevisiae. Cell Mol Life  Sci. 60, 1838-51. Vanhove, G., Van Veldhoven, P. P., Vanhoutte, F., Parmentier, G., Eyssen, H. J., and Mannaerts, G. P. (1991). Mitochondrial and peroxisomal beta oxidation of  the branched chain fatty  acid 2- methylpalmitate in rat liver. J Biol Chem 266,  24670-24675. Veenhuis, M., Mateblowski, M., Kunau, W. H., and Harder, W. (1987). Proliferation  of  microbodies in Saccharomyces  cerevisiae. Yeast. 3, 77-84. Vereecke, D., Cornelis, K., Temmerman, W., Jaziri, M., Van Montagu, M., Holsters, M., and Goethals, K. (2002). Chromosomal locus that affects  pathogenicity of Rhodococcus  fascians.  J Bacteriol. 184, 1112-20. Voigt, C. A., Schafer,  W., and Salomon, S. (2005). A secreted lipase of  Fusarium graminearum  is a virulence factor  required for  infection  of  cereals. Plant J. 42, 364-75. Walker, D. H., Firth, W. T., Ballard, J. G., and Hegarty, B. C. (1983). Role of phospholipase-associated penetration mechanism in cell injury by Rickettsia  rickettsii. Infect  Immun. 40, 840-2. Wanders, R. J., Vreken, P., Ferdinandusse, S., Jansen, G. A., Waterham, H. R., van Roermund, C. W., and Van Grunsven, E. G. (2001). Peroxisomal fatty  acid alpha-and beta-oxidation in humans: enzymology, peroxisomal metabolite transporters and peroxisomal diseases. Biochem Soc Trans. 29, 250-67. Wang, X. (2004). Lipid signaling. Curr Opin Plant Biol. 7, 329-36. Wang, Z. Y., Thornton, C. R., Kershaw, M. J., Debao, L., and Talbot, N. J. (2003). The glyoxylate cycle is required for  temporal regulation of  virulence by the plant pathogenic fungus  Magnaporthe  grisea. Mol Microbiol. 47, 1601-12. Wasternack, C., and Parthier, B. (1887). Jasmonate-signalled plant gene expression. Trends Plant Sci 2, 302-308. Weber, H. (2002). Fatty acid-derived signals in plants. Trends Plant Sci. 7, 217-24. Weber, R. W., Wakley, G. E., and Pitt, D. (1999). Histochemical and ultrastructural characterization of  vacuoles and spherosomes as components of  the lytic system in hyphae of  the fungus  Botrytis  cinerea. Histochem J. 31, 293-301. Weber, R. W., Wakley, G. E., Thines, E., and Talbot, N. J. (2001). The vacuole as central element of  the lytic system and sink for  lipid droplets in maturing appressoria of Magnaporthe  grisea. Protoplasma. 216, 101-12. Wenzler, H., and Meins, F. (1987). Persistent changes in the proliferative  capacity of  maize leaf  tissues induced by Ustilago  infection.  Physiol Mol Plant Pathol 30, 309-319. Wera, S., Bergsma, J. C., and Thevelein, J. M. (2001). Phosphoinositides in yeast: genetically tractable signalling. FEMS Yeast Res. 1, 9-13. Williams, P. H., Keen, N. T., Strandberg, J. O., and McNabola, S. S. (1968). Metabolite synthesis and degradation during club root development in cabbage hypocotyls. Phytopathology 58, 921. Wolf,  F. T. (1952). The production of  indoleacetic acid by Ustilago  zea, and its possible significance  in tumor formation.  Proc Nat Acad Sci USA., 106-111. Yamada, T. (1986). Biochemical studies on the mechanism for  dimorphism of fungal  cell membrane alterations during conversion of  yeast to mycelium in Candida albicans. Acta Sch Med Univ Gifu  34, 15. Yano, K. T., Yamada, Y., Banno, T., and Sekiye, T. N., Y. (1982). Modification of  lipid composition in a dimorphic fungus  Candida  albicans during yeast cell to hypha transformation.  Jpn J Med Mycol 15, 159. Yee, A. R., and Kronstad, J. W. (1993). Construction of  chimeric alleles with altered specificity  at the b incompatibility locus of  Ustilago  maydis.  Proc Natl Acad Sci U S A 90, 664-8. 2. LIPID-INDUCED FILAMENTOUS GROWTH IN USTILAGO MAYDIS 1 2.1. Introduction Many plant pathogenic fungi  are capable of  altering their morphology to form infection-specific  cell types to allow penetration and growth within plant tissues; this differentiation  appears to be tightly controlled by signals from  the host environment (Dean, 1997; Kronstad et al., 1998; Lee et al., 2003; Xu and Hamer, 1996). The identification  of  these signals and the pathways required for  their recognition is an important challenge in understanding fungal  pathogenesis. The basidiomycete fungus Ustilago  maydis  provides an experimental opportunity to investigate signaling in response to the host because this pathogen is obligately biotrophic only during a portion of  its life  cycle. U.  maydis  undergoes a dimorphic transition from  a yeast-like, nonpathogenic cell type to a filamentous  pathogenic form  that is capable of  colonizing maize tissue and inducing tumors. Infection  of  the host by U.  maydis  is an obligate part of  the life  cycle and entails several steps: (i) the exchange of  pheromone signals between compatible haploid cells and the formation  of  conjugation tubes; (ii) fusion  of  cells to form  a dikaryon that penetrates the plant surface;  (iii) filamentous  growth of  the dikaryon in planta;  (4) differentiation  of  the dikaryotic hyphae into diploid teliospores (Banuett and Herskowitz, 1996; Snetselaar and Mims, 1994). These spores are surrounded by an echinulated and melanized cell wall, and are produced in large numbers during infection (Banuett and Herskowitz, 1996; Christensen, 1963). The obligate relationship between U.  maydis  and maize suggests that the fungus has evolved highly specialized mechanisms to recognize and adapt to the host environment. The regulation of  developmental processes within the host is poorly understood, and host signals involved in the interaction are still unknown. Some features of  infection  hyphae observed in planta  do not occur in vitro and these include extensive branching of  hyphae, development of  branch primordia resembling clamp connections, 1 A version of  this chapter has been published. Klose, J., Moniz de Sa, M. M., and J. W. Kronstad. 2004. Lipid-induced filamentous  growth in Ustilago  maydis.  Mol Microbiol 52:823-35. and random collapse of  hyphal compartments compared to the hyphal collapse at sites distal to the growing tip in culture (Banuett and Herskowitz, 1996; Day and Anagnostakis, 1971; Snetselaar and Mims, 1994). In addition, prolonged growth of  the filamentous  dikaryon and teliospore development have not been observed in culture (Banuett and Herskowitz, 1996; Day and Anagnostakis, 1971). These observations suggest that the plant supplies crucial nutrients and/or signaling molecules that promote filamentation  and sporogenesis. It has been proposed that the stage-specific  expression of  genes during development is achieved by repression of  these genes during saprophytic growth and induction during biotrophic growth in the plant (Basse et al., 2000). Evidence for  in vitro progression of  the fungus  through the sexual cycle was obtained by growing U.  maydis  on embryonic maize cell cultures; although the components of  the embryonic culture that promoted sexual development were not identified.  (Ruiz-Herrera etal.,  1999). The identification  of  U.  maydis  mutants that are constitutively filamentous  or defective  for  the filamentous  phenotype led to the characterization of  several genes encoding components of  signaling pathways that influence  pathogenicity (Barrett et al., 1993; Brachmann et al., 2001; Durrenberger et al., 1998; Durrenberger et al., 2001; Gold et al., 1994; Lee and Kronstad, 2002). Specifically,  components of  two signal transduction pathways were identified:  the cyclic AMP/ protein kinase A (PKA) pathway and a Ras/mitogen-activated protein kinase (MAPK) pathway. Mutations in components of  the cAMP signaling pathway influence  sexual as well as pathogenic development. Strains deficient  in either the Ga subunit of  a heterotrimeric G protein (Gpa3; (Regenfelder  et al., 1997), adenylyl cyclase (Uacl; Gold et al., 1994), or the catalytic subunit of  PKA (Adrl; (Durrenberger et al., 1998) are constitutively filamentous  and are unable to cause disease symptoms. Mutants deficient  in the regulatory subunit of  PKA (Ubcl) display constitutive PKA activity, proliferate  in plant tissue, but fail  to produce tumors (Gold et al., 1997). Several components of  the pheromone response (Ras/MAPK) pathway have also been identified  including Ubc4 (MAPKKK), Fuz7 (MAPKK), Kpp2/Ubc3 (MAPK), and the pheromone response factor  Prfl  (Andrews et al., 2000; Banuett and Herskowitz, 1994; Hartmann et al., 1996; Mayorga and Gold, 1999). Mutations in any of  the MAPK pathway components result in faulty  pheromone signaling. Additional components of  the pathways have been identified  by suppressor screens; complementation of  one suppressor mutation restored filamentous  growth to a yeast-like adrl  suppressor mutant and identified  the hgll  gene (Durrenberger et al., 2001). Hgll is thought to be a negative regulator of  budding growth and an infectious dikaryon deficient  for  Hgll is defective  in teliospore formation.  Complementation of another suppressor mutation of  the adrl  phenotype identified  the ras2 gene, which encodes a member of  the Ras family  of  small GTP-binding proteins (Lee and Kronstad, 2002). In U.  maydis,  Ras2 regulates morphogenesis, pathogenesis and mating. Given the role of  the cAMP and MAPK signaling networks in the regulation of  filamentous  growth, a hallmark aspect of  U.  maydis  biotrophy, they may be involved in sensing specific  plant signals that trigger discrete stages of  pathogenic development. Characterization of  signaling mutants with morphological defects  revealed that growth with lipids (e.g., corn oil) as the sole carbon source resulted in a dimorphic transition in U.  maydis.  In this report, I demonstrate that the signal transduction pathways known to regulate mating and virulence are involved in the response to lipids. Specifically,  I found  that mutants with defects  in components of  the cAMP/PKA pathway or the Ras/MAPK pathway failed  to respond to triglycerides and fatty  acids. In addition, I show that the ability to respond is suppressed by glucose and that U.  maydis  exhibits an extracellular triglycerol lipase activity during growth on lipids. These results reveal a previously uncharacterized signal that influences  the morphogenesis of  U.  maydis  and suggest that utilization of  fatty  acids as a carbon source is an important aspect of  the ability of  the fungus  to undergo morphological changes. This discovery may have broad relevance for  understanding metabolic aspects of  the interactions between plants and fungal  pathogens. 2.2. Results 2.2.1. Growth on triglycerides promotes a filamentous  morphology Wild-type haploid cells of  U.  maydis  generally exhibit yeast-like (budding) growth in standard culture medium that contains glucose as the carbon source (Holliday, 1974). In contrast, I found  that haploid strains displayed a filamentous  cellular morphology in liquid medium supplemented with 1% corn oil as the sole source of carbon (Figure 2.1). Standard laboratory strains of  two different  mating types (521, albl and 518, a2b2) (Kronstad and Leong, 1989) both displayed the same response and started to produce hyphae after  12 hours of  incubation. Hyphal formation  was observed for approximately 50% of  the cells in the population after  5 days of  growth. A diploid strain (dl32, alci2 blb2) was also grown in medium with corn oil and found  to switch from budding to filamentous  growth (Figure 2.1). Diploid strains of  U.  maydis  that are heterozygous at the a and b mating-type loci are similar to the infectious  dikaryon in their ability to cause disease symptoms, although diploids are pathogenic in the absence of mating. However, unlike dikaryons, diploid strains are capable of  saprophytic growth in culture and resemble haploid strains in their budding growth on glucose-containing medium (Day and Anagnostakis, 1971; Holliday, 1974; Kronstad and Leong, 1989; Puhalla, 1968) (Figure 2.1) Haploid wild-type strains were also grown in liquid medium supplemented with a pure triglyceride (trilinolein) as a sole carbon source. As expected, the strains produced filaments  suggesting that the filamentous  growth response to corn oil was due to the presence of  triglycerides rather than minor contaminants in the oil (data not shown). In addition, other plant-derived triglycerides, including sunflower,  canola and olive oil triggered the morphological change in both haploid and diploid cells (data not shown). Overall, our results indicate a novel influence  of  triglycerides on the dimorphic transition in U.  maydis. 2.2.2. Fatty acids supplied as tweens promote filamentous  growth Corn oil is a mixture of  triglycerides that contain various fatty  acids esterified  to glycerol. It is possible that the fatty  acid components could be responsible for  the filamentous  growth response and that the fatty  acids could display specificity  because of differences  in their saturation state and carbon chain length. As an initial examination of the role of  fatty  acids, I grew cells in liquid medium supplemented with one of  four combinations of  fatty  acids supplied as soluble tweens. glucose corn oil glucose + oil palmitate haploid WT v , --£ diploid WT ~~'r i ' j f r ' ^ ^ M A ubcl i' % J±j i h m w Migll / SL . u Aras2 m 11 r / Afuz7 - Proa j 19 > V - r * • , . i / / Aubc3 V v B Aprfl y \ M w. Figure 2.1 Morphological response of  U.  maydis  strains to triglycerides, fatty  acids, and glucose. The strains were examined after  5 days of  growth in liquid MM with 1% glucose, 1% com oil (mixed triglycerides), both 1% glucose and 1% com oil, and 1% tween 40 (palmitate). Scale bar, lOfjm. The various combinations represented a selection of  the fatty  acids of  different carbon chain length and saturation state that are typically found  in plants (lauric 12:0, stearic 18:0, palmitic 16:0, oleic 18:1, linoleic 18:2 and linolenic 18:3 acid). U.  maydis responded to all of  these conditions by growing with a filamentous  morphology indicating that no specificity  was present at this level of  analysis (Figure 2.1 and 2.2). To confirm  that fatty  acids are responsible for  the morphological changes, both haploid and diploid wild-type cells were grown in medium supplemented with pure fatty  acids (palmitic, oleic and linoleic). As expected, the production of  filaments  was observed in response to the fatty  acids (Figure 2.2 and data not shown). However, filaments  of  the haploid strain (518) were short, and some resembled pseudohyphae (Figure 2.2), compared to the diploid strain (dl32) that produced a large network of  long filaments. These results indicate that fatty  acids promote the induction of  filamentous  growth. I also noted that provision of  1% glycerol as the carbon source triggered filamentous  growth although the extent of  growth was reduced compared to the medium with tweens (not shown). Therefore,  U.  maydis  may respond to each component of  triglycerides and other non-carbohydrate carbon sources may influence  morphogenesis. The production of filaments  in glycerol may reflect  a general response to less preferred  carbon sources. The wild-type cells grew well in lipids added to a concentration of  1 % (corn oil or tweens) although higher cell densities were obtained for  cultures in media with tweens (data not shown). This was possibly due to better availability because of  the higher solubility of  tweens compared with the oil. To investigate the possible metabolic and signaling influences  of  lipids on filamentous  growth, I grew haploid and diploid wild-type cells in liquid medium supplemented with a range of  concentrations of  tween 40. Hyphal formation  was observed in cultures containing concentrations as low as 0.01% (approximately 800 nM palmitic acid) (Figure 2.3). However, the cells did not grow well in lower concentrations of  tween 40, and this may have impaired their ability to respond (Figure 2.3). To examine the response at lower tween concentrations in a situation where growth could occur, I added arabinose (a non-repressing five-carbon  sugar) to the medium with each of  the concentrations of  tween 40. oleate + linoleate oleate + linolenate laurate haploid WT diploid WT B linoleic acid Figure 2.2 Cellular morphology of  U.  maydis  wild-type strains in the presence of fatty  acids. Haploid and diploid wild-type strains were grown for  5 day in liquid MM supplemented with (A) 1% tween solutions containing saturated (palmitate and laurate) or unsaturated (oleate+linoleate and oleate+linolenate) fatty  acids, and (B) 1% pure fatty  acid (linoleic acid). Scale bar, 10|jm. A arabinose tween 40 1% 1% 0.01% 0 005% 0 00005% 0 % tween 40 Figure 2.3 Morphological response of  U.  maydis  to various concentrations of  fatty  acids. Haploid wild-type strain was grown in liquid MM supplemented with various concentrations of  tween 40 (palmitate) either alone or with 0.5% arabinose to allow sufficient  growth. (A) Morphological response at four representative concentrations of tween 40 shown to demonstrate the range of  responses. Cells in medium supplemented with arabinose only were grown for  a control. Scale bar, 10p.m. (B) Growth measurements at OD6OO. The mean values and standard deviations (bars) of  the measurements from  three independent experiments are given. Strikingly, the production of  filaments  was observed in the arabinose cultures grown in much lower concentrations of  tween 40 compared with cultures grown in the same concentrations without arabinose (Figure 2.3). Specifically,  filaments  were observed at concentrations down to 0.00005%, representing approximately 4 nM of palmitic acid in the medium. Altogether, these results suggest that fatty  acids provide a carbon source and a chemical signal that promotes filament  formation. 2.2.3. Invasive filamentous  growth occurs on solid medium supplemented with fatty  acids I also investigated the growth of  haploid and diploid strains on agar medium supplemented with palmitic acid as the carbon source (added as tween 40). Within 48 hrs, the cells had started to invade the agar by producing distinct invasive filaments (Figure 2.4). Branching of  the invasive filaments  inside the agar was clearly evident and in this regard resembled infection  hyphae in planta  (data not shown). Invasive filaments were not observed for  strains on agar medium supplemented with glucose as the carbon source after  washing the cells off  the surface  (Figure 2.4). It is possible that the invasive growth was triggered in response to the fatty  acids or the hydrophobicity of  the solid medium. I also noticed that crystals formed  inside the fatty  acid-containing agar, but not the glucose medium (Figure 2.4). These crystals may result from  metabolism of  the fatty acids or diffusible  compounds released in the presence of  fatty  acids. U.  maydis  is known to secrete glycolipids termed ustilagic acids when grown in oils (Boothroyd B, 1956; Fluharty and O'Brien, 1969; Lemieux RU, 1951; Spoeckner S, 1999). Ustilagic acid forms  crystals similar to those seen on the fatty  acid-containing agar plates. Overall, these observations demonstrate the ability of  U.  maydis  to produce invasive hyphae in the presence of  fatty  acids. glucose tween 40 before  washing after  washing Figure 2.4 Invasive hyphal growth of  U.  maydis  induced by fatty  acids. Haploid wild-type cells were grown on solid medium supplemented with 1% tween 40 (palmitate) or 1% glucose for  5 days. Cellular morphology on glucose- and fatty  acid-containing medium is shown before  washing the cells off  the surface  (top panel). After washing the plate, cells that have invaded the medium are visible only on the fatty  acid-containing plate (bottom panel). 2.2.4. Components of  two signaling pathways are required for  the response to lipids The cAMP/PKA pathway and a MAPK signaling pathway are known to influence filamentous  growth and virulence in U.  maydis  (Kronstad et al., 1998); (Durrenberger et al., 1998) (Lee and Kronstad, 2002); (Spellig et al., 1994). I therefore  tested mutants with defects  in these pathways for  their ability to respond to triglycerides (corn oil) and fatty  acids (palmitate as tween 40) (Figure 2.1) as well as pure triglyceride (trilinolein) (data not shown). Mutants with low PKA activity, such as those with defects  in adenylyl cyclase (uacl)  or the catalytic subunit of  cAMP-dependent PICA (adrl),  grow with a constitutively filamentous  phenotype. Growth with lipids in the culture medium did not affect  the filamentous  phenotype of  these mutants (data not shown). Previous work correlated low PKA activity with filamentous  growth (Durrenberger et al., 1998; Gold et al., 1994). Consistent with these observations, the ubcl mutant defective  in the regulatory subunit of  cAMP-dependent PKA (with high PKA activity) did not produce filaments  in response to either triglycerides or fatty  acids (Figure 2.1) suggesting that the unregulated PKA activity in this mutant prevented the morphological response. A mutant with a defect  in the hgll  gene also did not form  filaments  on the lipid medium (Figure 2.1). The hgll  gene is thought to encode a regulatory protein downstream of  PKA that functions  to negatively regulate budding (Durrenberger et al., 2001). All of  the strains were also tested for  the response to other fatty  acids supplemented as tween 20, 80 or 85, and they responded in the same manner as observed in the medium with palmitate (tween 40) (data not shown). Mutants with defects  in the components of  the Ras/MAPK pathway were also tested for  their ability to respond to lipids. This pathway is interconnected with the cAMP pathway and plays a role in the filamentous  growth response to mating pheromone (e.g., formation  of  conjugation tubes) as well as filamentous  growth in planta  (Andrews et al., 2000; Kruger et al., 1998; Mayorga and Gold, 1998, 1999). I found  that mutations in ras2, fuz7  (encoding a MAPKK) and ubc3 (encoding a MAPK) all blocked the filamentous  growth response to lipids and that only the mutant defective  in the pheromone response transcription factor  (encoded by prfl  gene) formed  filaments  in the presence of  corn oil and palmitate (Figure 2.1). Therefore,  the Prfl  protein that is required for  the transcription of  genes involved in mating was not required for  the filamentous  growth response to lipids. The same responses to fatty  acids found  in the medium with palmitate (tween 40) were also observed in media supplemented with other tweens (tween 20, 80 and 85) as a sole carbon source (data not shown). Our results indicate that the signal(s) triggering filament  production in response to lipids may be transduced by Ras2 via a MAP kinase cascade that includes Fuz7 and Ubc3. Epistasis experiments indicate that Ras2 is upstream of  Fuz7 and Ubc3 (Lee and Kronstad, 2002). Overall, our findings  establish a connection between the filamentation  response to lipids and the U.  maydis  cAMP and Ras/MAPK signaling networks that are known to function in pheromone response, filamentous  growth in host tissue, and virulence. 2.2.5. Glucose suppression of  the filamentous  growth response Most microorganisms can utilize a variety of  carbon sources, but glucose is often preferred  and metabolized first  (Carlson, 1999; Ullmann, 1996). Because glucose repression is well known in fungi,  I was interested in determining whether the presence of  glucose would interfere  with triglyceride-induced filamentous  growth. The response to corn oil in liquid medium was compared to the response to glucose alone, and to corn oil and glucose together for  wild-type strains and strains defective  in components of  the cAMP/PKA and Ras/MAPK pathways. All of  the strains exhibited the budding phenotype when grown in glucose medium (Figure 2.1). Suppression of  filamentous growth was observed in the liquid medium with both corn oil and glucose for  all of  the haploid and diploid wild-type strains, and for  the signaling pathway mutants that responded to lipids (Figure 2.1). In addition, the growth rate of  the wild-type cells in corn oil medium was similar to that in glucose medium as a sole carbon source (data not shown). I also studied the effects  of  other sugars (sucrose, fructose  and L-(+)-arabinose) on the filamentous  growth response. The same strains that were used for  the glucose suppression study were grown in liquid medium supplemented with corn oil with sucrose, fructose  or arabinose. Sucrose suppressed the formation  of  filaments,  exhibiting the same effect  on the response as glucose. The cells grown with corn oil in the presence of fructose  or arabinose responded by switching from  budding to filamentous  growth (data not shown and Figure 2.3, respectively). However, partial suppression of  the filamentous growth response was observed in the cultures with fructose.  These results reinforce  the idea that carbon source can have a major influence  on morphogenesis in U.  maydis. 2.2.6. The morphology of  lipid-induced filaments  resembles in vivo filaments The morphology of  the fatty  acid-induced filaments  was examined more closely to determine whether they share features  with the dikaryotic or diploid filaments observed in planta  during the infection  process. The morphological features  of  the latter two cell types are indistinguishable during growth in the host (Banuett and Herskowitz, 1996). For comparison, I grew the diploid strain dl32 in liquid medium supplemented with palmitic acid (tween 40). The fatty  acid-induced filaments  produced in vitro were long and showed both extensive branching and septum formation  (Figure 2.5A and B), features  that are typical for  filaments  observed in planta  (see Figure 2 of  Banuett and Herskowitz, 1996 and Figures 5 and 6 of  Snetselaar and Mims, 1994). The hyphal branches arose at irregular intervals and at various angles to the main filaments.  Cross walls were clearly visible and were observed separating the branches from  the main hyphae and the individual cylindrical cells within the hyphae (Figure 2.5A and B). These features  were confirmed  by calcofluor  staining (Figure 2.5B). Hyphal collapse is also a typical feature  of  growth in planta.  For the in vitro filaments,  the hyphal collapse occurred randomly in different  parts of  the hyphae to generate both thick (filled  with cytoplasm) and thread-like (lacking cytoplasm) segments (Figure 2.5A and B). Hyphal collapse is also known to occur for  dikaryotic cells in culture; however, in this situation, generally only hyphal tips contain cytoplasm but the rest of  the hyphal cells are empty (Banuett and Herskowitz, 1996; Day and Anagnostakis, 1971; Snetselaar and Mims, 1992). Branch primordia with an associated Y-shaped septum that separates the primordium from  the main hypha were also observed for  the in vitro grown filaments  (Figure 2.5B). These structures are similar to the clamp connections of  other basidiomycetes that participate in maintaining the dikaryotic stage (Banuett and Herskowitz, 1996), and therefore  were previously named as clamp-like structures. extensive branching branch primordia crosswalls (septa) hyphal collapse branch clamp-like structure crosswalk (septa) collapsed hypha with Y-shaped septum Figure 2.5 In  vitro filaments  of  U.  maydis  induced by fatty  acids. Diploid wild-type cells were grown in liquid MM supplemented with 1% tween 40 (palmitate) as a sole carbon source for  5 days. (A) DIC images illustrating the morphologies of  the in vitro filaments  revealed the presence of  the hyphal features  typical for  in planta  filaments  (white arrows). The photographs are representative images of filaments  from  6 independent experiments. The scale bar, 10|am. (B) Staining with calcofluor  white to analyze septum formation  within the filaments  confirmed  the branching, and presence of  septa and clam-like structures. Scale bar, 5 (am. For comparison collapsed hyphae (ch) and hyphae with cytoplasm (h) are shown. Given that all of  the characteristics described above are typical for  the filaments formed  in the plant during infection,  and the hyphal branching and clamp-like structures form  only in planta  (Banuett and Herskowitz, 1996; Snetselaar and Mims, 1994), our results suggest that the fatty  acids in the culture medium may reflect  one of  the nutritional conditions that the fungus  encounters in the plant. These conditions may contribute to fungal  ramification  by promoting the development of  highly branched filaments, although the host environment is of  course more complex and other factors  such as contact with host cells may have an important influence  on the fungus  (Podila et al., 1993). 2.2.7. Triglycerol lipase activity is found  in lipid-grown cultures Lipases are thought to play a role in virulence during fungal  infections  by assisting in cell penetration, tissue colonization, and by allowing fungal  catabolism of host lipids (Berto et al., 1999; Commenil et al., 1995; Gottlich et al., 1995; Weber et al., 1999). I anticipated that U.  maydis  would secrete extracellular lipase during growth on corn oil and that the lipase activity might be regulated by the signaling pathways that control filamentous  growth. To examine these possibilities, the culture supernatants of various strains grown in triglyceride or tween-containing media were examined for extracellular lipolytic activity. As expected, lipase activity was detected in culture supernatants obtained from  the haploid and diploid wild-type strains and the fatty  acid-responsive mutant strains (e.g.,  prfl  mutant) grown in liquid minimal medium with tween 40 (palmitate) (Figure 2.6). Interestingly, the mutant strains that did not respond to lipids (including the ubcl, hgll,  ras2, fuz7  and ubc3 mutants) also exhibited lipase activity (Figure 2.6), but the activity was lower than in wild-type strains and the fatty  acid-responding mutants. The non-responding strains were still able to grow in the presence of  fatty  acids, possibly due to a low level of  lipolytic activity that enables them to use the fatty  acids as a carbon source. The ubcl mutant that is defective  in the regulatory subunit of  PKA grew poorly, did not form  filaments  on lipid-containing medium (corn oil and tween 40) and exhibited very low levels of  lipase activity in the culture supernatants (Figure 2.6). control C rugpsa haploid diploid Auacl tsadrl  Aubcl Migll  hfuzl  bprfl w t wr Figure 2.6 The extracellular lipase activity in cultures of  U.  maydis  during the response to fatty  acids. The graph represents specific  enzyme activity in culture supernatants of  haploid and diploid wild-type strains, and mutants defective  in the cAMP and MAPK signaling pathway grown in medium with tween 40 (palmitate) as the sole carbon source. The control sample does not contain a source of  extracellular lipase (negative control). The enzyme activity of  lipase from  C. rugosa (Sigma) was used as a positive control. The bar charts show the mean and standard deviation from  three independent experiments. Note that ubcl mutant grows poorly in lipid medium. For example, in a representative experiment the ubcl mutant recorded on OD6OO of  0.7 compared to the wild-type strain value of  2.7. These results suggest that cAMP signaling may be involved in the ability to use oils as a carbon source and that the gene(s) encoding the lipase activity may be regulated by PKA. In general, these results suggested that secreted lipases may contribute to the response of  the fungus  to triglycerides and fatty  acids, and may ultimately contribute to virulence. 2.3. Discussion The ability to switch between budding and filamentous  growth is well documented in several fungal  pathogens of  plants and animals including U.  maydis, Ophiostoma (Ceratocystis)  ulmi, Histoplasma  capsulata,  Blastomyces dermatitidis,  and Candida  albicans (Gold et al., 1994; Kronstad and Staben, 1997; Lengeler et al., 2000; Madhani et al., 1997; Maresca and Kobayashi, 2000; Medoff,  1987; Wang and Heitman, 1999). Morphogenesis is known to be associated with virulence in some of  these fungi (e.g. C. albicans',  Lo et al., 1997) and in some cases the environmental signals that influence  dimorphism have been identified  (e.g., N-acetylglucosamine (Singh et al., 2001), serum (Feng et al., 1999) and farnesoic  acid (Oh et al., 2001) for  C. albicans). Our observation that triglycerides or fatty  acids promote the dimorphic transition in U. maydis  is intriguing because the filamentous  cell type is the biotrophic, obligately parasitic phase of  the life  cycle. This phase coincides with the sexual development of  the fungus  because it is initiated by mating and results in the formation  of  the diploid teliospores that are capable of  meiosis. The hypothesis that arises from  our results is that the response to lipids could be an important component of  the infection  process and that the morphological adaptation to lipids as a carbon source may reflect  one of  the nutritional conditions that the fungus  encounters in the plant. This hypothesis is supported by our observations that the signaling components known to control virulence are also required for  the lipid response and that the in vitro and in vivo filaments  share morphological similarities. 2.3.1. Lipid-induced filaments  resembled the cells found  in plant tissue. I found  that the filaments  produced in response to lipids displayed characteristics typical of  the filaments  that develop during infection;  in particular, I observed branching and clamp-like structures that were previously thought to occur only in planta  (Banuett and Herskowitz, 1996; Snetselaar and Mims, 1994). The branching is thought to contribute to the extensive hyphal proliferation  observed within the tumor tissue in advance of  teliospore formation  and branching has been proposed as an indicator of  the response to a plant signal (Banuett and Herskowitz, 1996). Other features  of  the infectious  filaments  such as branched hyphae with visible crosswalls, and collapsed hyphal sections were also observed on solid medium with lipids. The cells on solid medium also demonstrated the ability to invade the substrate in response to the presence of  lipids and this may be relevant to the ability of  the filaments  to invade host tissue during infection. 2.3.2. Role of  the nutrient-sensing cAMP pathway in morphogenesis The cAMP pathway in other fungi  and in mammals plays a key role in nutrient sensing and metabolism. For example, the cAMP pathway is a major glucose-signaling pathway in Saccharomyces  cerevisiae, and plays a central role in the control of metabolism and proliferation  (Rolland et al., 2001). Also, filamentation  induced by a nitrogen limitation in S. cerevisiae is controlled by the cAMP pathway (Gimeno et al., 1992; Gimeno and Fink, 1994; Lorenz et al., 2000). In our study, a connection between the response to lipids and cAMP signaling came from  the observation that the ubcl mutant (defective  in the regulatory subunit of  PKA) grew poorly in lipids (corn oil and tween 40) and did not respond morphologically. The mutant also did not exhibit lipase activity in the culture supernatants from  growth medium with Tween 40. These results suggest that cAMP signaling is involved in the ability to use oils as a carbon source. It is possible that the ubcl mutant may not produce lipases or may not be able to activate lipases as a result of  high unregulated PKA activity in the mutant. This finding  suggests that the lipase gene(s) lies downstream of  the PKA, although other explanations are possible such as an indirect influence  of  PKA on fatty  acid metabolism, a direct influence on other metabolic enzymes or other metabolic defects.  A role for  the cAMP pathway is further  indicated by the finding  that a downstream target of  PKA, the hgll  gene product (Durrenberger et al., 2001), was also required for  the morphological response and showed reduced lipase activity compared with wild-type cells. One model for  the behavior of  U.  maydis  is that growth on a lipid carbon source results in reduced levels of  cAMP, low PKA activity and filamentous  growth. Certainly, a correlation between low PKA activity and filamentous  growth have been well established (Durrenberger et al., 1998; Gold and Kronstad, 1994). Interestingly, ubcl mutants fail  to respond to lipids, but they are filamentous  as dikaryons in the plant, although the cells do not proliferate  as extensively as the wild-type dikaryon and do not induce tumors. Perhaps these observations indicate a separation of  perception of  a signal indicating the presence of  a host, as determined by the MAPK pathway, and evaluation of the nutritional status as perceived by the cAMP pathway (Gold et al., 1997). In this scenario, the early stages of  filamentous  growth such as mating and invasion might be controlled by the MAPK pathway; later stages such as branching and ramification  in host tissue could be regulated by the cAMP pathway to allow fungal  proliferation  prior to tumor formation.  Additionally, the utilization of  lipid carbon sources might allow the fungus  to proliferate  in host tumor cells after  carbohydrates have been exhausted (in preparation for  sporulation). Unfortunately,  little is known about lipid metabolism and carbon source utilization by U.  maydis  during the biotrophic stage of  its life  cycle. In this context, the cAMP-regulated sspl gene was recently found  to be abundantly expressed in mature teliospores of  U.  maydis;  this gene encodes a protein with similarity to linoleate diol synthase (LDS) and prostaglandin G/H synthases (cyclooxygenases) from  mammals (Huber et al., 2002). It is thought that Sspl plays a role in the mobilization of  storage lipids to ensure teliospore maturation. A connection between cAMP signaling and the degradation of  lipid reserves during appressorium formation  has also been demonstrated for  the rice blast fungus  Magnaporthe  grisea (Thines et al., 2000). 2.3.3. Glucose suppression suggests a metabolic component for  lipid-induced filamentation I found  that glucose and other sugars such as sucrose suppressed the switch from budding to filamentous  growth in response to triglycerides and fatty  acids. This result was not surprising because glucose is known to repress the transcription of  many genes in fungi.  For example, the FOX1  gene, which encodes an acyl-CoA oxidase involved in the P-oxidation of  fatty  acids, is repressed by glucose in S. cerevisiae (Stanway et al., 1995). Also, low glucose-medium induces increased activity for  the SNF1  (sucrose-non-fermenting)  protein kinase in S. cerevisiae. Snfl  is responsible for  the derepression of many glucose-repressed genes and the kinase is known to inactivate the key enzyme (acetyl-CoA carboxylase) involved in fatty  acid biosynthesis (Woods et al., 1994). This glucose-regulated repression of  genes involved in P-oxidation of  fatty  acids and fatty  acid biosynthesis may contribute to an efficient  utilization of  glucose. The presence of glucose also inhibits the expression of  the LIP1  gene that encodes a lipase in C. albicans (Fu et al., 1997). For U.  maydis,  the presence of  lipids and the absence of  glucose were required for  filamentous  growth. If  the lipid response is relevant to growth in planta, then the timing of  utilization of  different  carbon sources may be important and may contribute to development of  specialized nutritional interfaces  between the invading hyphae and the host cells (Hahn and Mendgen, 2001). Bhaskaran et al., (1991) found that host extracts contain a glycoprotein (presumably from  the plant cell wall) that triggers filamentous  growth in another smut fungus,  Sporisorium  reilianum. Interestingly, glucose also inhibited this response. 2.3.4. Could a lipid signal act through the Ras/MAPK pathway? Both the cAMP/PKA and the Ras/MAP kinase pathway are known to regulate pathogenesis in U.  maydis.  However, the roles of  the cAMP-dependent and MAP kinase pathways appear to be antagonistic with respect to filamentous  growth (Kriiger et al., 1998). The activated Ras/MAP kinase pathway stimulates production of  filaments  (Lee and Kronstad, 2002), but high PKA activity is associated with budding growth (Diirrenberger et al., 1998; Gold et al., 1994). Given the role for  cAMP and PKA in the response to nutrients, it may be the case that the Ras/MAPK pathway functions  to perceive lipids as signals. A similar interconnection of  the two pathways occurs in S. cerevisiae to control pseudohyphal growth (Mosch et al., 1999; Rupp et al., 1999; Lorenz and Heitman, 1997; D'Souza and Heitman, 2001; Lengeler et al., 2000). To examine the possibility that lipids may represent a signal as well as a carbon source for  U.  maydis,  I tested the response of  the fungus  to decreasing levels of  tween 40 in the presence and absence of  arabinose as a supplementary carbon source. I found  that a low level of  tween (approximately 4 nM) prompted a response, suggesting that lipids may represent signaling ligands as well as a carbon source. I speculate that the lipid signal may be transduced at least in part via the components of  the Ras/MAPK pathway because I found  that mutants lacking the ras2,fuz7,  and ubc3 genes did not respond to triglycerides or fatty  acids. The transcription factor  Prfl  proved to be not essential for  the morphological response to lipids suggesting that a different  transcription factor(s)  is involved. 2.3.5. Lipid signaling in fungi A role for  lipids in morphogenesis has been described in several fungi.  For example, plant surface  lipids (waxes) have been reported to provide signals for  plant-fungus  interactions and are thought to induce pathogenic development in fungi  including Colletotrichum  species (Podila et al., 1993; Macko, 1981). Kolattukudy et al., (1995) reported that plant surface  lipids contain both inducers and inhibitors that influence  spore germination and appressorium formation  required for  infection.  In addition, several studies indicate that modified  fatty  acids or related lipids are important for  sexual and asexual development in filamentous  fungi  (Nukina and . 1981; Goodrich-Tanrikulu et al., 1998). For example, linoleic acid and its derivatives were found  to play a role in spore formation  for  several fungal  species (Calvo et al., 1999; Hyeon, 1976; Katayama, 1978; Rai, 1967). Fatty acid signaling molecules called psi factors  (hydroxylated linoleic acid) influence  growth, spore formation  and aflatoxin  production in Aspergillus  nidulans (Champe et al., 1987; Mazur, 1991). Recently, oleic acid-derived psi factors  were also found  to affect  the asexual to sexual spore ratio in A. nidulans  (Calvo et al., 2001). Plant-derived fatty  acids (hydroperoxylinoleic acids) also contribute to spore development in Aspergillus  spp. (Calvo et al., 1999). Finally, the human pathogenic fungi  C. albicans and Cryptococcus  neoformans  produce prostaglandins (oxygenated unsaturated cyclic fatty  acids) by conversion of  exogenously supplied as well as endogenously produced arachidonic acid; the prostaglandins enhance both cell viability and filamentation capacity for  C. albicans (Noverr et al., 2001). These studies highlight the additional possibility that derivatives of  fatty  acids, perhaps generated by fungal  activities, could serve as signaling molecules. 2.3.6. Summary In summary, we found  that U.  maydis  forms  filaments  in culture in response to lipids. We believe that this finding  may be relevant to infection  of  the plant because the components of  two signaling pathways required for  pathogenesis are also needed for  the response to lipids. Furthermore, the morphological features  of  the filaments  formed  in vitro resemble those of  the infectious  dikaryon observed in planta.  We believe that lipid metabolism is important for  the response because we observed suppression in the presence of  glucose. In addition, the low level of  lipids required for  the response suggests that they are acting as ligands to trigger the morphological change. These novel observations may have general implications for  understanding both the regulation of fungal  dimorphism and the pathogenesis of  biotrophic fungi. 2.4. Material and Methods 2.4.1. Strains and growth conditions U.  maydis  strains used in this study are listed in Table 2.1. The strains were grown at on potato dextrose agar or broth (Difco),  or in liquid minimal medium (MM) (Holliday, 1974) supplemented with lipids. These included 1% vegetable oil (corn, olive, canola or sunflower),  or 1% trilinolein (Sigma) as triglyceride sources, and 1% tween (polyethylene sorbitans of  fatty  acids) 20, 40, 80 or 85 (Sigma) or 1% linoleic acid, oleic or palmitic acid (Sigma), as fatty  acid sources. The tweens have the following compositions: tween 20 (containing mainly lauric, myristic and palmitic acid), tween 40 (palmitic, stearic and oleic acid), tween 80 (oleic, linoleic, and palmitic acid) and tween 85 (oleic, linolenic and palmitic acid). Other carbon sources added to liquid MM included 1% glucose, 1% sucrose, 1% fructose  or 0.5% and 1% arabinose (Sigma). Filament production was assayed in the following  tween 40 concentrations: 1% (representing approximately 80 (J.M of  palmitic acid in the medium), 0.5% (40 |JM), 0.25% (20 pM), 0.1% (8 pM), 0.05% (4pM), 0.025% (2 pM), 0.01% (800 nM), 0.005% (400 nM), 0.001% (80 nM), 0.0005% (40 nM), 0.0001% (8 nM), and 0.00005% (4 nM). The same range was also used in the presence of  0.5% arabinose. In the standard assay for  filamentous  growth, 5 mL of  liquid MM was inoculated with 106 cells and incubated for  five  days at 30°C with shaking. Cell growth in liquid MM was monitored by measuring absorbance at OD6OO. 2.4.2. Invasion assay To characterize filamentous  growth on solid medium, 105 cells were plated on MM containing 1.5% agar and supplemented with 1% tween 40 or 1% glucose. The plates were photographed and than screened for  invasive filamentous  cells by washing the plate surface  with running water as described (Palecek P. Sean, 2001) after  1, 3, and 5 days of  growth at 30°C. The remaining cells that had invaded the agar were photographed. 2.4.3. Microscopy, staining, and photography Cells were examined with a Zeiss Axioplan 2 Fluorescent microscope. Bright field,  differential  interference  microscopy (DIC), and fluorescent  images were captured with a DVC camera and processed electronically with Northern Eclipse imaging software.  A Nikon dissecting microscope was used at 10X magnification  to record invasive filamentous  growth on solid MM supplemented with tween 40. Photographs were obtained with a Nikon Coolpix 990 digital camera and processed with Adobe Photoshop 7. To visualize septa, filaments  from  the liquid medium were incubated in a 10-ml preparation of  calcofluor  white (Fluorescent brightener28; Sigma, 20 fig/ml)  for  15 min. 2.4.4. Triglycerol lipase assay The activity of  extracellular triglycerol lipase in cultures grown in MM supplemented with 1% tween 40 was determined by a turbidimetric enzyme assay (von Tigerstrom and Stelmaschuk, 1989). The supernatant obtained by centrifugation  of cultures at 13,200 rpm for  15 min was used as a source of  the extracellular lipase activity. A standard reaction contained 300 pL of  supernatant added to 2% (v/v) Tween 20 in 20 mM Tris-HCl (3.6 mL), pH 8.0, and 120 mM CaCl2 (0.1 mL). The mixture was incubated for  30 min at 37°C. The lipase activity is expressed in units per mg protein of  a culture supernatant. Protein concentrations were determined using a protein assay kit (BioRad). Purified  lipase from  Candida  rugosa (Sigma) was employed as a positive control. 2.5. Tables Table 2.1 Strains used in this study Strain Genotype Reference 518 (001) a2 b2 (Kronstad and Leong, 1989) 521 (002) al bl (Kronstad and Leong, 1989) 33 alblAuacl (Gold et al., 1994) al bl Aadrl  phlecf (Durrenberger et al., 1998) 111 al bl Aubcl-1 (Gold et al., 1994) 3011 al bl Ahgll  hygr (Durrenberger et al., 2001) 6 al bl Aras2-2 hygr (Lee and Kronstad, 2002) FBI-26 al bl Afuz7  hygr (Banuett and Herskowitz, 1994) FB2A ubc3 al bl Aubc3 naf (Mayorga and Gold, 1999) UM0407 al bl Aprfl  phleor (Kohno, De Maria, and Lee, unpublished data) dl32 al/a2  bl/b2 (Kronstad and Leong, 1989) 2.6. References Andrews, D.L., Egan, J.D., Mayorga, M.E., and Gold, S.E. (2000) The Ustilago maydis  ubc4 and ubc5 genes encode members of  a MAP kinase cascade required for filamentous  growth. Mol  Plant  Microbe  Interact  13: 781-786. Banuett, F., and Herskowitz, I. (1994) Identification  offuz7,  a Ustilago  maydis MEK/MAPKK homolog required for  a-locus-dependent and -independent steps in the fungal  life  cycle. Genes Dev 8: 1367-1378. Banuett, F., and Herskowitz, I. (1996) Discrete developmental stages during teliospore formation  in the corn smut fungus,  Ustilago  maydis.  Development  122: 2965-2976. Barrett, K.J., Gold, S.E., and Kronstad, J.W. (1993) Identification  and complementation of  a mutation to constitutive filamentous  growth in Ustilago  maydis. Mol  Plant  Microbe  Interact  6: 274-283. Basse, C.W., Stumpferl,  S., and Kahmann, R. (2000) Characterization of  a Ustilago  maydis  gene specifically  induced during the biotrophic phase: evidence for negative as well as positive regulation. Mol  Cell  Biol 20: 329-339. Berto, P., Commenil, P., Belingheri, L., and Dehorter, B. (1999) Occurrence of  a lipase in spores of  Alternaria  brassicicola  with a crucial role in the infection  of cauliflower  leaves. FEMS  Microbiol  Lett  180: 183-189. Bhaskaran, S., Smith, R.H., and Frederiksen, A. (1991) A factor  that promotes mycelial development in Sporosorium  reilianum in vitro. Bot Gaz 152: 453-459. Boothroyd B, T.J., Haskins RH (1956) Biochemistry of  the ustilaginales. XII. Characterization of  extracellular glycolipids produced by Ustilago  sp. Can J  Biochem Physiol: 10-14. Brachmann, A., Weinzierl, G., Kamper, J., and Kahmann, R. (2001) Identification of  genes in the bW/bE regulatory cascade in Ustilago  maydis.  Mol  Microbiol  42: 1047-1063. Calvo, A.M., Hinze, L.L., Gardner, H.W., and Keller, N.P. (1999) Sporogenic effect  of  polyunsaturated fatty  acids on development of  Aspergillus  spp. Appl Environ Microbiol  65: 3668-3673. Calvo, A.M., Gardner, H.W., and Keller, N.P. (2001) Genetic connection between fatty  acid metabolism and sporulation in Aspergillus  nidulans.  J  Biol Chem 276: 25766-25774. Carlson, M. (1999) Glucose repression in yeast. Curr  Opin Microbiol  2: 202-207. Champe, S.P., Rao, P., and Chang, A. (1987) An endogenous inducer of  sexual development in Aspergillus  nidulans.  J  Gen Microbiol  133: 1383-1387. Christensen, J.J. (1963) Corn smut induced by Ustilago  maydis.  Amer Phytopathol  Soc Monogr  2. Commenil, P., Belingheri, L., Sancholle, M., and Dehorter, B. (1995) Purification and properties of  an extracellular lipase from  the fungus  Botrytis  cinerea. Lipids  30: 351-356. Day, P.R., and Anagnostakis, S.L. (1971) Corn smut dikaryon in culture. Nat  New Biol 231: 19-20. Dean, R.A. (1997) Signal pathways and appressorium morphogenesis. Annu. Rev. Phytopathol.  35: 211-234. D'Souza, C.A., and Heitman, J. (2001) Conserved cAMP signaling cascades regulate fungal  development and virulence. FEMS  Microbiol  Rev 25: 349-364. Durrenberger, F., Wong, K., and Kronstad, J.W. (1998) Identification  of  a cAMP-dependent protein kinase catalytic subunit required for  virulence and morphogenesis in Ustilago  maydis.  Proc Natl  Acad  Sci USA  95: 5684-5689. Durrenberger, F., Laidlaw, R.D., and Kronstad, J.W. (2001) The hgll  gene is required for  dimorphism and teliospore formation  in the fungal  pathogen Ustilago maydis.  Mol  Microbiol  41: 337-348. Feng, Q., Summers, E., Guo, B., and Fink, G. (1999) Ras signaling is required for serum-induced hyphal differentiation  in Candida  albicans. JBacteriol  181: 6339-6346. Fluharty, A.L., and O'Brien, J.S. (1969) A mannose- and erythritol-containing glycolipid from  Ustilago  maydis.  Biochemistry 8: 2627-2632. Fu, Y., Ibrahim, A.S., Fonzi, W., Zhou, X., Ramos, C.F., and Ghannoum, M.A. (1997) Cloning and characterization of  a gene (LIP1) which encodes a lipase from  the pathogenic yeast Candida  albicans. Microbiology  143 ( Pt 2): 331-340. Gimeno, C.J., Ljungdahl, P.O., Styles, C.A., and Fink, G.R. (1992) Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous  growth: regulation by starvation and RAS. Cell  68: 1077-1090. Gimeno, C.J., and Fink, G.R. (1994) Induction of  pseudohyphal growth by overexpression of  PHD1,  a Saccharomyces  cerevisiae gene related to transcriptional regulators of  fungal  development. Mol  Cell  Biol 14: 2100-2112. Gold, S., Duncan, G., Barrett, K., and Kronstad, J. (1994) cAMP regulates morphogenesis in the fungal  pathogen Ustilago  maydis.  Genes Dev 8: 2805-2816. Gold, S.E., and Kronstad, J.W. (1994) Disruption of  two genes for  chitin synthase in the phytopathogenic fungus  Ustilago  maydis.  Mol  Microbiol  11: 897-902. Gold, S.E., Brogdon, S.M., Mayorga, M.E., and Kronstad, J.W. (1997) The Ustilago  maydis  regulatory subunit of  a cAMP-dependent protein kinase is required for gall formation  in maize. Plant  Cell  9: 1585-1594. Goodrich-Tanrikulu, M., Howe, K., Stafford,  A., and Nelson, M.A. (1998) Changes in fatty  acid composition of  Neurospora  crassa accompany sexual development and ascospore germination. Microbiology  144: 1713-1720.1713-1720. Gottlich, E., de Hoog, G.S., Yoshida, S., Takeo, K., Nishimura, K., and Miyaji, M. (1995) Cell-surface  hydrophobicity and lipolysis as essential factors  in human tinea nigra. Mycoses  38: 489-494. Hahn, M., and Mendgen, K. (2001) Signal and nutrient exchange at biotrophic plant-fungus  interfaces.  Curr  Opin Plant  Biol 4: 322-327. Hartmann, H.A., Kahmann, R., and Bolker, M. (1996) The pheromone response factor  coordinates filamentous  growth and pathogenicity in Ustilago  maydis.  EMBO  J15: 1632-1641. Holliday, R. (1974) Ustilago  maydis.  In  Handbook  of  Genetics. Vol. 1. King, R.C. (ed). New York: Plenum, pp. 575-595. Huber, S.M., Lottspeich, F., and Kamper, J. (2002) A gene that encodes a product with similarity to dioxygenases is highly expressed in teliospores of  Ustilago  maydis. Mol  Genet Genomics 267: 757-771. Hyeon, B. (1976) Chemical studies on the factors  controlling sporulation of  fungi. . Chem. Regul.  Plants:  69-76. Katayama, M., and S. Marumo (1978) R(2)-glycerol monolinoleate, a minor sporogenic substance of  Sclerotinia  fructicola.  Agric. Biol. Chem.'.  1431-1433. Kolattukudy, P.E., Rogers, L.M., Li, D., Hwang, C.S., and Flaishman, M.A. (1995) Surface  signaling in pathogenesis. Proc Natl  Acad  Sci USA  92: 4080-4087. Kronstad, J., De Maria, A.D., Funnell, D., Laidlaw, R.D., Lee, N., de Sa, M.M., and Ramesh, M. (1998) Signaling via cAMP in fungi:  interconnections with mitogen-activated protein kinase pathways. Arch Microbiol  170: 395-404. Kronstad, J.W., and Leong, S.A. (1989) Isolation of  two alleles of  the b locus of Ustilago  maydis.  Proc Natl  Acad  Sci USA  86: 978-982. Kronstad, J.W., and Staben, C. (1997) Mating type in filamentous  fungi.  Annu Rev Genet 31: 245-276. Kriiger, J., Loubradou, G., Regenfelder,  E., Hartmann, A., and Kahmann, R. (1998) Crosstalk between cAMP and pheromone signalling pathways in Ustilago  maydis. Mol  Gen Genet 260: 193-198. Lee, N., and Kronstad, J.W. (2002) ras2 controls morphogenesis, pheromone response and pathogenicity in the fungal  pathogen Ustilago  maydis.  Eukaryotic  Cell  1: 954-966. Lee, N., D'Souza, C.A., and Kronstad, J.W. (2003) Of  Smuts, Blasts, Mildews, and Blights:cAMP Signaling in Phytopathogenic Fungi. Annu Rev Phytopathol  41: 399-427. Lemieux RU, T.J., Brice C, Haskins RH (1951) Biochemistry of  the ustilaginales. II. Isolation and partial characterization of  ustilagic acid. Can J  Biochem Physiol: 409-414. Lengeler, K.B., Davidson, R.C., D'Souza, C., Harashima, T., Shen, W.C., Wang, P., Pan, X., Waugh, M., and Heitman, J. (2000) Signal transduction cascades regulating fungal  development and virulence. Microbiol  Mol  Biol Rev 64: 746-785. Lo, H.J., Kohler, J.R., DiDomenico, B., Loebenberg, D., Cacciapuoti, A., and Fink, G.R. (1997) Nonfilamentous  C. albicans mutants are avirulent. Cell  90: 939-949. Lorenz, M.C., and Heitman, J. (1997) Yeast pseudohyphal growth is regulated by GPA2, a G protein alpha homolog. EMBO  J16:  7008-7018. Lorenz, M.C., Pan, X., Harashima, T., Cardenas, M.E., Xue, Y., Hirsch, J.P., and Heitman, J. (2000) The G protein-coupled receptor gprl is a nutrient sensor that regulates pseudohyphal differentiation  in Saccharomyces  cerevisiae. Genetics 154: 609-622. Macko, V. (1981) the Fungal Spore Morphogenetic Controls. Turian, G.a.H., HR (ed): Academic, New York, pp. 565-584. Madhani, H.D., Styles, C.A., and Fink, G.R. (1997) MAP kinases with distinct inhibitory functions  impart signaling specificity  during yeast differentiation.  Cell  91: 673-684. Maresca, B., and Kobayashi, G.S. (2000) Dimorphism in Histoplasma  capsulatum and Blastomyces dermatitidis.  Contrib  Microbiol  5: 201-216. Mayorga, M.E., and Gold, S.E. (1998) Characterization and molecular genetic complementation of  mutants affecting  dimorphism in the fungus  Ustilago  maydis.  Fungal Genet Biol 24: 364-376. Mayorga, M.E., and Gold, S.E. (1999) A MAP kinase encoded by the ubcS  gene of  Ustilago  maydis  is required for  filamentous  growth and full  virulence. Mol  Microbiol 34: 485-497. Mazur, P., K. Nakanishi, A. A. E. El-Zayat, and S. P. Champe. (1991) Structure and synthesis of  sporogenic psi factors  from  Aspergillus  nidulans.  J.  Chem. Soc. Chem. Commun. . 1486-1487. Medoff,  G., A. Painter and G. S. Kobayashi. (1987) Mycelial to yeast phase transitions of  the dimorphic fungi  Blastomyces dermatitidis  and Paracoccidiodes brasiliensis. J.  Bacteriol.:  4055-4060. Mosch, H.U., Kubler, E., Krappmann, S., Fink, G.R., and Braus, G.H. (1999) Crosstalk between the Ras2p-controlled mitogen-activated protein kinase and cAMP pathways during invasive growth of  Saccharomyces  cerevisiae. Mol  Biol Cell  10: 1325-1335. Noverr, M.C., Phare, S.M., Toews, G.B., Coffey,  M.J., and Huffnagle,  G.B. (2001) Pathogenic yeasts Cryptococcus  neoformans  and Candida  albicans produce immunomodulatory prostaglandins. Infect  Immun  69: 2957-2963. Nukina, M., Sassa, T., Ikeda, M., Takahasi, K. & Toyota, S. , and . (1981) Linoleic acid enhances perithecial production in Neurospora  crassa. Agric Biol Chem: 2371-2373. Oh, K.B., Miyazawa, H., Naito, T., and Matsuoka, H. (2001) Purification  and characterization of  an autoregulatory substance capable of  regulating the morphological transition in Candida  albicans. Proc Natl  Acad  Sci USA  98: 4664-4668. Palecek P. Sean, P.S.A., Kron J. Stephen (2001) Genetic control of  cell adhesion, polarity, and invasive growth in Saccharomyces  cerevisiae. In Bioingineering  Conference ASME  2001. Vol. 50: ASME, pp. 657-658. Podila, G.K., Rogers, L.M., and Kolattukudy, P.E. (1993) Chemical Signals from Avocado Surface  Wax Trigger Germination and Appressorium Formation in Colletotrichum  gloeosporioides.  Plant  Physiol 103: 267-272. Puhalla, J.E. (1968) Compatibility reactions on solid medium and interstrain inhibition in Ustilago  maydis.  Genetics 60: 461-474. Rai, J.N., J. P. Tewari, and A. K. Sinha. (1967) Effect  of  environmental conditions on sclerotia and cleistothecial production in Aspergillus.  . Mycopathol.  Mycol. Appl.: 209-224. Regenfelder,  E., Spellig, T., Hartmann, A., Lauenstein, S., Bolker, M., and Kahmann, R. (1997) G proteins in Ustilago  maydis:  transmission of  multiple signals? EMBO  J16:  1934-1942. Rolland, F., Winderickx, J., and Thevelein, J.M. (2001) Glucose-sensing mechanisms in eukaryotic cells. Trends  Biochem Sci  26: 310-317. Ruiz-Herrera, J., Leon-Ramirez, C., Cabrera-Ponce, J.L., Martinez-Espinoza, A.D., and Herrera-Estrella, L. (1999) Completion of  the sexual cycle and demonstration of  genetic recombination in Ustilago  maydis  in vitro. Mol  Gen Genet 262: 468-472. Rupp, S., Summers, E., Lo, H.J., Madhani, H., and Fink, G. (1999) MAP kinase and cAMP filamentation  signaling pathways converge on the unusually large promoter of the yeast FLOll  gene. EMBO  J18:  1257-1269. Singh, P., Ghosh, S., and Datta, A. (2001) Attenuation of  virulence and changes in morphology in Candida  albicans by disruption of  the N-acetylglucosamine catabolic pathway. Infect  Immun  69: 7898-7903. Snetselaar, K.M., and Mims, C.W. (1992) Sporidial fusion  and infection  of  maize seedlings by the smut fungus  Ustilago  maydis.  Mycologia  84: 193-203. Snetselaar, K.M., and Mims, C.W. (1994) Light and electron microscopy of Ustilago  maydis  hyphae in maize. My  col Res 98: 347-355. Spellig, T., Regenfelder,  E., Reichmann, M., Schauwecker, F., Bohlmann, R., Urban, M., Bolker, M., Kamper, J., and Kahmann, R. (1994) Control of  mating and development in Ustilago  maydis.  Antonie Van  Leeuwenhoek  65: 191-197. Spoeckner S, W.V., Nimtz M, Lang S (1999) Glycolipids of  the smut fungus Ustilago  maydis  from  cultivation on renewable resources. Appl Microbiol  Biotechnol:  33-39. Stanway, C.A., Gibbs, J.M., and Berardi, E. (1995) Expression of  the FOX1 gene of  Saccharomyces  cerevisiae is regulated by carbon source, but not by the known glucose repression genes. Curr  Genet 27: 404-408. Thines, E., Weber, R.W., and Talbot, N.J. (2000) MAP kinase and protein kinase A-dependent mobilization of  triacylglycerol and glycogen during appressorium turgor generation by Magnaporthe  grisea. Plant  Cell  12: 1703-1718. Ullmann, A. (1996) Catabolite repression: a story without end. Res Microbiol 147: 455-458. von Tigerstrom, R.G., and Stelmaschuk, S. (1989) The use of  Tween 20 in a sensitive turbidimetric assay of  lipolytic enzymes. Can J  Microbiol  35: 511-514. Wang, P., and Heitman, J. (1999) Signal transduction cascades regulating mating, filamentation,  and virulence in Cryptococcus  neoformans.  Curr  Opin Microbiol  2: 358-362. Weber, H., Chetelat, A., Caldelari, D., and Farmer, E.E. (1999) Divinyl ether fatty acid synthesis in late blight-diseased potato leaves. Plant  Cell  11: 485-494. Woods, A., Munday, M.R., Scott, J., Yang, X., Carlson, M., and Carling, D. (1994) Yeast SNF1 is functionally  related to mammalian AMP-activated protein kinase and regulates acetyl-CoA carboxylase in vivo. J  Biol Chem 269: 19509-19515. Xu, J.R., and Hamer, J.E. (1996) MAP kinase and cAMP signaling regulate infection  structure formation  and pathogenic growth in the rice blast fungus  Magnaporthe grisea. Genes Dev. 10: 2696-2706. 3. THE MULTIFUNCTIONAL p-OXIDATION ENZYME IS REQUIRED FOR FULL SYMPTOM DEVELOPMENT BY THE BIOTROPHIC MAIZE PATHOGEN USTILAGO  MAYDIS 2 3.1. Introduction Ustilago  maydis  causes a common smut disease on maize (Zea  mays) that can result in an economically significant  reduction in yield (Pataky, 1991; Pataky, 1990). Sexual development of  the fungus  is tightly interconnected with infection,  and involves several morphological transitions (Banuett and Herskowitz, 1996). The key transition for initial infection  and for  subsequent colonization of  the plant is the production of  the filamentous  dikaryon. This cell type is established upon recognition between compatible haploid cells by pheromone exchange leading to the formation  of  conjugation tubes known as mating filaments  that initially grow on the plant surface.  Subsequently, these cells fuse  to form  a dikaryotic filament,  which is capable of  invading host tissue. The mating filaments  and the dikaryotic filaments  prior to penetration are straight filaments that do not branch. Once in the plant, the fungus  proliferates  extensively to produce a large network of  branched filaments.  Mating and filamentation  are controlled by conserved cAMP/protein kinase A (PKA) and mitogen activated protein kinase (MAPK) signaling cascades; these control distinct stages of  the disease process by largely unknown mechanisms (Andrews et al., 2000; Banuett and Herskowitz, 1994; Barrett et al., 1993; Brachmann et al., 2001; Durrenberger et al., 2001; Durrenberger et al., 1998; Gold et al., 1994; Gold et al., 1997; Hartmann et al., 1996; Lee and Kronstad, 2002; Mayorga and Gold, 1999). Recently, we showed that lipids and fatty  acids induce filamentation  in U.  maydis  (Klose et al., 2004). This response may be relevant to infection  because the components of  the PKA and MAPK signaling networks are required for  both the dimorphic transition and the response to lipids. Additionally, the 2 A version of  this chapter has been accepted for  publication. Klose, J., and J. W. Kronstad. 2006. The Multifunctional  beta-oxidation Enzyme Is Required for  Full Symptom Development by the Biotrophic Maize Pathogen Ustilago  maydis.  Eukaryot Cell 22, 22. (on-line early) morphological features  of  the lipid-induced filaments  formed  in vitro resembled those of the infectious  dikaryon observed in planta. U.  maydis  is an obligate biotrophic pathogen during the sexual phase of  its life cycle. Infectious  filaments  initially invade epidermal cells and grow intracellularly surrounded by the intact host cell plasma membrane (Snetselaar and Mims, 1994; Snetselaar and Mims, 1992). At this stage, early disease symptoms such as chlorosis and anthocyanin pigmentation are visible on infected  maize plants. Later in development, filaments  grow mostly intercellularly around cells of  the vascular bundle (Snetselaar and Mims, 1994.). Following penetration and proliferation,  the fungus  induces tumors in which the cells exhibit extensive branching, hyphal fragmentation  and the formation  of melanized teliospores (i.e., sexual spores). The fungal  cells in tumor tissue are embedded in thin-walled parenchymatous plant cells, which have been shown to lack plastids (Callow and Ling, 1973). To date, little is known about fungal  genes that control or are required for  development in the plant, or about host signals that may contribute to pathogen development. It is clear that the biotrophic fungal  life  style requires an intimate relationship with the plant because the host cells remain alive while metabolites are redirected to feed  the pathogen. In this regard, U.  maydis  establishes long lasting interactions with maize, often  without causing any visible damage to invaded cells and without provoking a defense  response (Banuett and Herskowitz, 1996; Snetselaar and Mims, 1993). Therefore  it must have strategies to overcome resistance, either by masking its intrusion, suppressing host defense,  and/or inducing specific  host genes for the establishment of  biotrophy. It has been shown, that drastic changes in transcript levels of  maize genes related to metabolism and development occur during U.  maydis infection  (Basse, 2005). In general, it seems likely that sensing the nutritional state of  the host environment during biotrophic growth is critical for  disease development by U. maydis. Our previous work indicated that lipids act as signals and as carbon sources to promote filamentous  growth in culture for  U.  maydis  (Klose et al., 2004). Given the relationship between filamentous  growth and pathogenesis for  U.  maydis,  and the abundance of  lipids in plant tissue, it is possible that lipids are also important signals and/or carbon sources during maize infection.  I have shown that U.  maydis  secretes lipase activity in culture to break down lipids (Klose et al., 2004), and assuming that this activity is expressed during infection,  the released fatty  acids could be further  degraded via P-oxidation, a process by which fatty  acids are broken down to acetyl-CoA by sequential removal of  two carbon units in each oxidation cycle. A relationship between peroxisomal metabolic function  and phytopathogenesis has been previously tested in the hemibiotrophic fungus  Colletotrichum  lagenarium  (Kimura et al., 2001). In this fungus, disruption of  a gene for  peroxisome biogenesis resulted in a defect  in appressorium-mediated plant infection  but the mutant retained the ability for  invasive growth in planta. In addition, analysis of  the transcriptome of  the obligate biotrophic fungus  Blumeria graminis at different  stages in the life  cycle revealed coordinate regulation of  enzymes involved in primary metabolism, including lipid degradation enzymes (Both et al., 2005). However, in this case, the fungus  appears to use lipids stored in conidia to fuel colonization of  host tissue via appressorium formation,  and storage lipids are regenerated during growth in the host. These studies leave open the question of  whether P-oxidation is required for  successful  infection  by obligate fungal  biotrophs. P-oxidation could also contribute to the production of  modified  fatty  acids that are known to influence development in fungi.  For example, oleic acid and linoleic acid, and their derivatives, influence  growth and spore formation  in filamentous  fungi  (Calvo et al., 2001; Champe et al., 1987). In this study, I made use of  the fact  that U.  maydis  is obligately biotrophic during the sexual stage of  its life  cycle but can also be cultured in the laboratory as a saprophyte. These properties allowed us to compare the contribution of  peroxisomal P-oxidation to fungal  morphogenesis and growth in culture with the requirement for  this process during biotrophic infection.  Specifically,  I constructed and characterized U.  maydis  mutants lacking the mfe2  gene that encodes the multifunctional  enzyme for  the second and third steps in peroxisomal p-oxidation. I found  that the mfe2  gene was required for  the switch to filamentous  growth on some but not all fatty  acids, and that it was needed for  growth on long chain fatty  acids in culture. Inoculations of  seedlings and developing ears with the mutants resulted in fewer  tumors and delayed sporulation, indicating that mfe2  was necessary for  full  symptom development. Overall, these results suggest that lipids represent an important but not essential carbon source during biotrophic growth and raise the possibility that lipid utilization by U.  maydis  may influence  additional aspects of infection  such as signal perception or host defense. 3.2. Results 3.2.1. Identification  of  genes encoding peroxisomal P-oxidation enzymes As an initial step to characterize the role of  P-oxidation in U.  maydis pathogenesis, the sequences of  the enzymes involved in the process in S. cerevisiae were used to identify  homologs in the U.  maydis  genomic sequence, recently completed at the Broad Institute (with annotation at the Munich Information  Center for  Protein Sequences, MIPS). The first  committed step in peroxisomal P-oxidation is catalyzed by acyl-CoA oxidase (ACOX), a unique marker enzyme for  non-mitochondrial p-oxidation in eukaryotic cells (Kunau et al., 1995). There are five  U.  maydis  genes (Um04324, Um02208, Um01966, Um02028, and Um04833) predicted to encode acyl CoA oxidases (homologs of  the yeast protein Pox 1/Fox 1). The second and third steps in P-oxidation are catalyzed by a multifunctional  enzyme that is encoded by FOX2  (CAA82079) in S. cerevisiae (Hiltunen et al., 1992). U.  maydis  has one homolog encoded by a gene designated mfe2  (Uml0038; multifunctional  enzyme type 2). The Mfe2  protein shows 47% identity and 63% similarity to the yeast Fox2 protein over 721 amino acids. The fourth  enzymatic reaction is catalyzed by 3-ketoacyl CoA thiolase and there are three homologs (Um03571, Um01090 and Um02715) with similarity to the yeast protein Fox3. Because a single gene (mfe2)  was found  to encode the second and third steps, this gene was chosen for  subsequent deletion to generate mutants that would be unable to utilize fatty  acids as a carbon source. Such mutants would allow an investigation of  whether lipid metabolism had an influence  on fatty  acid-induced filamentation  and virulence in U. maydis. The mfe2  gene encoded a predicted polypeptide of  911 amino acids with a duplicated region for  the two dehydrogenase domains in the first  half  of  the protein (PFOO106/IPR002198; amino acid regions 19 to 249 and 326 to 499) (Figure 3.1). A separate hydratase domain (PF01575/IPR002539) was present in the C-terminal region. It is possible that the dehydrogenase domains may contribute to different  substrate specificities;  for  example, the first  domain is most active with long- and medium-chain substrates, and the second domain with short chain substrates in S. cerevisiae (Qin et al., 1999). The C-terminal domain encoding the 2-enoyl-CoA hydratase 2 is common to all multifunctional  enzymes of  the MFE 2-type (Figure 3.1). The mammalian peroxisomal Mfe2  enzyme contains only one dehydrogenase domain with broad substrate specificity (both long- and short-chain substrates) (Novikov et al., 1994) (Figure 3.1 A). At least three types of  peroxisomal targeting sequences (PTSs) direct proteins to peroxisomes in yeast including PTS1 and PTS2, and a third type that has not been well characterized (de Hoop and Ab, 1992; Purdue and Lazarow, 1994). For example, some of  the acyl-CoA oxidases in C. albicans or S. cerevisiae do not possess PTS1 or PTS2 and may be targeted to peroxisomes by either of  two internal, redundant sequences (Kamiryo et al., 1989; Small et al., 1988). Neither PTS1 nor PTS2 were found  in the U.  maydis  Mfe2 sequence and the enzyme may possess the third type of  PTS. In addition to the high amino acid sequence identity of  Mfe2  to the yeast Fox2 protein, BLAST analysis confirmed  sequence similarity to other characterized peroxisomal multifunctional enzymes from  the following  fungi:  Candida  tropicalis  (P22414, 47% identity) (Moreno de la Garza et al., 1985), Neurospora  crassa (CAA56355, 54% identity) (Fossa et al., 1995), Yarrowia  lipolytica  (AAF82684, 55% identity) (Smith et al., 2000), and Glomus mosseae (Q9UVH9, 53% identity) (Requena et al., 1999) (Figure 3.IB). 3.2.2. Induction of  mfe2  gene expression by fatty  acids Fatty acids induce expression of  the genes/enzymes involved in p-oxidation and transcription of  the corresponding genes is subject to glucose repression in yeast (Veenhuis et al., 1987, Stanway et al., 1995, Kunau and Hartig, 1992, Luo et al., 1996). I established that the mfe2  gene fits  this pattern because RNA blot analysis revealed that transcript levels were relatively high upon growth in medium with oleic acid (CI8:1) or linoleic acid (CI8:2) as the sole carbon source (Figure 3.2). Transcript levels were lower in cells grown on these fatty  acids in the presence of  glucose, and in cells grown on glucose as the sole carbon source. These results indicate that mfe2  transcription is influenced  by carbon source as expected for  a P-oxidation function. A U.  maydis  MFE2 H D - 1 H D - 2 H 2 S. cerevisiae F0X2 H D - 1 H D - 2 H 2 human MFE2 H D - 1 H 2 DSIHA 113 CAR CANTR 116 JAFA SACCE 117 tsg NEUCR 115 CAG YARLI 120 HUMAN 116 I BySBBpj JB Jj 1 I s BISAAGlYGNFGQflNYSAAmLVGP LlKig KAg !WS LAJ tSj RgsJgHC; EgljXL! ewlvB SAENKgV SSAMILTIM HD-2 USTHA CANTR i ffi SACCE l m HEUCR l ffi YARLI I DSIHA 118 M CANTS 117 VEKQF SACCE 119 S js HEUCR 116 YARLI 116 M S H2 1 ras{ 1 T _ 1 VjpGRi i g i igpypvsMfl iPEMSBNMM WSPjJSDjW] JniQq 1 jU§lpg^ TDTgSiJ| ! Ffi 'FHARRVLQQ3ADNDVSR Affljj FgHSj ggETSj KM 3j r|i| BlKlVLA PYEELli mm NtVKA AfJjNfi AHVJI PgNM 1H gftjKM RGAJFL AKPJY JSDDTIV §s-vyv| 5-Sl S-P.IKi gogcGAgE fpi [KP^jAGj pBsjjf JsB Figure 3.1 Organization of  the peroxisomal multifunctional  enzymes (type 2). (A) Organization of  the catalytic domains of  U.  maydis,  S. cerevisiae and human peroxisomal Mfe2 enzymes. (B) Sequence alignment of  the conserved catalytic domains from  the U.  maydis  Mfe2 protein with fungal,  (C.  tropicalis  (CANTR, P22414), S. cerevisiae (SACCE, CAA82079), N.  crassa (NEUCR, CAA56355) and Y.  lipolytica  (YARLI, AAF82684)), and human (P51659) homologs. (HD) = (3/?)-hydroxyacyl-CoA dehydrogenase domain, (H2) = 2-enoyl-CoA hydratase 2 domain. A a2b2 Amfe2  a2b2 glucose oleate linoleate oleate +glucose linoleate +glucose oleate linoleate wW-  • « * « * « * * * ft* mm mfe2 rRNA Figure 3.2 RNA blot analysis of  mfe2  transcript levels in the presence of  fatty  acids. (A) Total RNA was isolated from  the wild-type (albl)  cells grown in the minimal medium containing either glucose, fatty  acid, or fatty  acid and glucose. Total RNA was also isolated from  the Amfe2  a2b2 cells grown in the minimal medium containing fatty acids. The RNA blot was hybridized with a probe for  the mfe2  gene. (B) The RNA blot stained with 0.04% methylene blue to show total RNA loading. 3.2.3. Targeted deletion of  the mfe2  gene To investigate the role of  P-oxidation during the growth of  U.  maydis  in culture and in planta,  I performed  a targeted gene deletion by replacing the entire open reading frame  of  mfe2  with a 3.8 kb gene cassette conferring  resistance to the antibiotic hygromycin B. The deletion vector was introduced into two U.  maydis  wild-type strains of  opposite mating type (albl  and a2b2) to allow subsequent analysis of  mating and virulence. Deletion of  the gene was confirmed  by colony PCR and Southern blot analysis (not shown) and two independent mutants in each strain were used for  subsequent experiments. RNA blot analysis revealed the absence of  the mfe2  transcript in the mutants thereby confirming  complete gene inactivation (Figure 3.2). 3.2.4. Growth and Filamentation on Long Chain Fatty Acids (LCFA) I initially characterized the ability of  the mfe2  mutants to undergo a morphological transition from  budding to filamentous  growth in the presence of  lipids and fatty  acids. Palmitic (C16:0), oleic (C18:l) and linoleic (C18:2) acids were chosen for  this study because our previous analysis demonstrated that wild-type strains respond to these fatty  acids (Klose et al., 2004), and these are also the most abundant fatty  acids present in maize plants (Watson, 2003; Watson, 1987). As expected, the wild-type strains grew as filaments  in the presence of  all of  the LCFA tested and in the presence of corn oil (Figure 3.3A). The mutant strains responded to corn oil, palmitic acid and oleic acid by switching from  budding to filamentous  growth thus indicating that the mfe2  gene was not generally required for  fatty  acid-induced filamentation  (Figure 3.3A). This observation suggests that it is possible to separate the utilization of  fatty  acids as a carbon source from  their function  as signaling molecules in the filamentous  response. However, the mutants did not respond morphologically to linoleic acid thus raising the possibility that specific  fatty  acids may contribute to the production of  signals that influence filamentous  growth. A glucose corn oil palmitate oleate linoleate a2b2 Amfe2  a2b2 arachidate arachidonate erucidate caproate la urate mvristate \ 1 9 1 !"; , V ; - " * • . B • i -i / (/ • j • # -— / t 1 M.  ^rnrnm & • • V / / / r 1 \ ^ B • r ^ p? B i ^ ' ^ l l l \ jr~ H \ i \ # 5r v B a2b2 A mfe2  a2b2 palmitate © O oleate 50 x 40 1 30 J 20 % = 10 40 X 30 "Z I 20 u I 10 0 40 X 30 •X. Z 20 | 10 0 40 « *30 X. "Z Z 20 im V •S10 z 0 glucose corn oil palmitate oleate linoleate I erucidate arachidate arachidonate caproate laurate myristate Figure 3.3 Morphology and growth of  mfe2  mutant strains on fatty  acids differing in carbon chain length and saturation state. (A) Cellular morphology of  the wild-type (a2b2)  and mutant (Amfe2  a2b2) strains in response to glucose, lipids (com oil), LCFA (palmitic, oleic, and linoleic), VLCFA (erucic, arachidic and arachidonic), SCFA (caproic) and MCFA (lauric and myristic). The cells were visualized by differential  interference  contrast optics (DIC, left)  and by epifluorescence  after  staining cell walls with calcofluor  (right). (B) The ability of  the wild-type and mutant strains to grow on fatty  acid-containing agar medium. The cells were spotted in decreasing concentration from  106 to 102. All the agar plates contain tergitol to facilitate  the solubility of  the fatty  acids. (C) Total number of  the wild-type (a2b2,  black bars) and mutant (Amfe2  a2b2, white bars) cells in culture supplemented with glucose, com oil, and fatty  acids as a sole carbon source. The bars represent the average number of  cells from  3 independent experiments. In addition to the general filamentation  response, differences  in the morphologies of  the wild-type cells were observed in the presence of  different  LCFA (Figure 3.3A). Wild-type cells grown in oleic acid developed large rounded central cells with long branched filaments  emerging from  the center. Interestingly, the oleic acid-grown cultures of  the wild-type cells were also pigmented with a dark brown to black color (data not shown). Wild-type cells grown on linoleic acid developed an extensive network of  robust and branched filaments  with many rounded cells. Some of  these cells had lobed ends and resembled the filaments  observed in the early stages of  sporulation in plant tissue (Banuett and Herskowitz, 1996). In palmitic acid, the wild-type cells grew as long straight hyphae that resembled the straight mating filaments  and the infectious  dikaryotic filaments  that form  before  and after  the fusion  of  compatible strains, respectively. Furthermore, these hyphae produced very few  branches, a phenotype observed only on palmitic acid. Overall, these results support the idea that long chain, unsaturated fatty acids may be important in promoting branching in wild-type cells and thus may contribute to extensive proliferation  during growth in plant tissue. Our findings  in culture suggest that linoleic acid may be particularly important in this role. The mfe2  mutants were also tested for  their ability to utilize fatty  acids by growing the cells on fatty  acid-containing agar medium supplemented with LCFA (palmitic, oleic and linoleic) and in a liquid medium supplemented with triglycerols (corn oil) and LCFA (palmitic, oleic and linoleic acids) as the sole carbon source (Figure 3.3B and C). The mutants were able to grow on corn oil (Figure 3.3C). This was not surprising because the triglycerols consist of  fatty  acids esterified  to a glycerol backbone, and U.  maydis  is known to be able to use glycerol as a carbon source (Klose et al., 2004). The wild-type strains grew well on corn oil, oleic acid and linoleic acid when compared to glucose (Figure 3.3C). The mutant strains were unable to efficiently  utilize oleic and linoleic acids as a carbon source, although a low level of  residual growth was observed for  both of  these fatty  acids when grown in liquid medium (Figure 3.3C). The mutants grew poorly on palmitic acid, although the growth of  the wild-type strain was also reduced suggesting that U.  maydis  generally does not efficiently  utilize this fatty  acid. In addition, the mutant strains failed  to grow on all of  the LCFA tested when spotted in a range of  cell concentrations on fatty  acid-containing agar plates (Figure 3.3B). In contrast, the wild-type strain grew well on corn oil, oleic and linoleic acid when compared to growth on glucose (Figure 3.3C). Overall, I conclude that loss of  mfe2 results in growth defects  on LCFA as expected for  strains with a defect  in P-oxidation. 3.2.5. Growth and Filamentation on Very Long Chain Fatty Acids (VLCFA) Fungi require peroxisomal P-oxidation to break down VLCFA and I therefore investigated the ability of  these fatty  acids to induce filamentation  in mfe2  mutants. The wild-type and mutant strains were inoculated into medium with one of  the following  fatty acids as a sole carbon source: arachidic (C20:0), arachidonic (C20:4), and erucic (C22:l). All of  these VLCFA induced filamentous  growth in the wild-type strains, although the filaments  in arachidonic acid had a slightly different  appearance with primarily short branching cells (Figure 3.3A). In contrast, none of  the VLCFA induced filamentation  in the mfe2  mutants. These mutants failed  to grow on VLCFA, and the wild-type strain also showed poor growth on arachidic and arachidonic acids, but not erucic acid (Figure 3.3C). In addition, jasmonic acid was also tested for  the ability to induce filamentation, however it completely abolished the growth of  both the wild-type and mutant cells (data not shown). I also noted that both the wild-type and mutant strains produced extracellular needle-like crystal structures in the medium with erucic acid (data not shown). These crystals could be glycolipids, because U.  maydis  is known to produce extracellular glycolipids called ustilipids (Boothroyd et al., 1956; Hewald et al., 2005; Lemieux et al., 1951) that are visible as needle-like precipitates. Interestingly, similar long needle-like crystals were also observed when wild-type strains were grown in the medium supplemented with both oleic and linoleic acids, but not in the medium containing either one of  these fatty  acids alone (data not shown). Taken together, these observations suggest that the fungus  may need peroxisomal P-oxidation to break down VLCFA to produce shorter fatty  acyl chains or to contribute to the production of  putative modified  fatty  acids that might promote filamentous  growth. 3.2.6. Growth and Filamentation on Short Chain Fatty Acids (SCFA) and Medium Chain Fatty Acids (MCFA) The ability of  SCFA, caproic acid (C6:0) or MCFA, lauric (CI2:0) and myristic (C14:0) acids to induce filamentation  was also examined (Figure 3.3A). The wild-type strain responded by growing as short distorted branched cells in all of  the SCFA and in lauric acid, but produced long branched filaments  in myristic acid. Intriguingly, the mfe2 mutants did not display a filamentous  response to any of  these fatty  acids, except myristic acid. I also explored the ability of  the mfe2  mutants to grow on SCFA and MCFA and found  that these carbon sources supported only a limited growth for  both the wild-type and mutant strains (Figure 3.3C). SCFA and MCFA have previously been shown to inhibit growth in some fungi  (Maggio-Hall and Keller, 2004). Growth was not completely abolished but was limited to approximately four  cell doublings. These results suggest the existence of  another utilization pathway (e.g., mitochondrial P-oxidation) or residual growth on stored lipids. 3.2.7. Cellular Lipid Accumulation Is Influenced  by Loss of  Peroxisomal p-oxidation The loss of  Mfe2  function  clearly alters the growth and filamentation  response of U.  maydis  to different  fatty  acids. A defect  in the homologous gene, FOX2,  in S. cerevisiae mutants also alters lipid body production. I therefore  used Nile red to observe and compare the accumulation of  lipid bodies in the wild-type and mutant cells grown on glucose, as well as on inducing (myristic, oleic) or non-inducing (linoleic) fatty  acids. The yeast-like cells grown on glucose produced four  to six large lipid bodies in the wild-type cells, and two to four  large and some small lipid bodies in the mutant cells (Figure 3.4A). Overall, the accumulation pattern of  the lipid bodies appeared to be unaffected  in the mfe2  mutants grown on glucose. The lipid bodies varied in size and number in the fatty  acid-induced filamentous  cells depending on the fatty  acid present in the growth medium. Specifically,  the lipid bodies were very small and numerous in both wild-type and mutant cells on myristic acid (Figure 3.4A). This result suggests that both cell types accumulate and store myristic acid in lipid bodies that have structural differences compared with those formed  in glucose-grown cells. The oleic acid-induced filaments  of wild-type cells contained large lipid bodies in the central cells, and only diffuse fluorescence  in the filaments  branching from  these cells (Figure 3.4A). In contrast, the lipid bodies in the mutant cells on oleic acid were dispersed and visible as small intensely stained droplets throughout the short branched cells (Figure 3.4A). A more striking difference  was observed for  the cells grown on linoleic acid. In this case, the wild-type filaments  were filled  with numerous large and small lipid bodies throughout their entire length, but the mutant cells did not produce lipid bodies and did not change their morphology (Figure 3.4A). Only a diffuse  fluorescence  was observed within the yeast-like cells of  the mutant. (Figure3. 4A). The ability of  cells to respond to fatty  acids (e.g., oleic acid) by forming  filaments in comparison to the yeast-like cells found  on glucose is particularly interesting and may be relevant to the filamentous  growth observed in planta.  I therefore  performed  a more detailed comparison of  the lipid accumulation in the different  morphological types by electron microscopy and by chemical analysis. I examined the mfe2  mutants by TEM to compare the size and numbers of  the lipid bodies with those in wild-type strains (Figure 3.4B). I found  that very few  lipid bodies were observed in the yeast-like wild-type cells grown on glucose, while the mfe2  mutant cells appeared to produce more and larger lipid bodies in this medium (Figure 3.4B). In contrast, the lipid bodies in the oleic acid-induced wild-type filaments  were more easily identified  and were often  found  in clusters (Figure 3.4B). glucose myristate oleate linoleate a2b2 kmfe2 a2b2 * t 1 / ** -r -i \x v--. v y i s •.»« -u y t , 7 * v t V V \ \ \ / \ v! \ \ \ \ % a2b2 bmfe2  a2b2 glucose oleate glucose oleate Figure 3.4 Intracellular lipids in U.  maydis. (A) Cellular lipid accumulation in U.  maydis  wild-type and mfel  mutant strains grown on glucose and various fatty  acids. The wild-type and mfel  mutant strains were grown in minimal medium supplemented with either glucose, myristic (CI 4:0), oleic (CI 8:1), or linoleic acid (CI 8:2) as a sole carbon source. The internal lipids accumulated in lipid bodies were stained using the lipid-specific  fluorescent  dye Nile red, and visualized using epifluorescence.  The fungal  cells produced large (arrowhead) to small (arrow) lipid bodies that varied in number depending on carbon source. Scalebar= 10|im. (B) An abundance of  lipid bodies produced in the mfel  mutant strain grown on oleic acid as a sole carbon source. TEM observation of  lipid bodies in wild-type cells (a2b2) and mfel  mutant (Amfe2  albl)  cells grown on glucose and oleic acid. Cells were grown on glucose medium overnight and than transfen'ed  into oleic acid medium. After  18 hr, the oleic acid-grown cells were fixed  and processed for  TEM. Scale bar = 500 nm. (L) = Lipid body. There was a striking difference  in the accumulation of  the lipid bodies in the mfe2 mutant strain grown on oleic acid compared to the wild-type strain (Figure 3.4B). The numerous lipid bodies almost completely filled  the mutant cells. Therefore,  these cells appeared to accumulate but not metabolize the exogenous fatty  acids from  the medium as expected for  cells defective  in P-oxidation. Total internal lipids were also extracted from  wild-type and mfe2  mutant cells grown either on glucose or oleic acid to examine whether the mfe2  deletion alters intracellular lipid composition and to evaluate potential changes in fatty  acid composition during fatty  acid-induced filamentation.  The extracted internal lipids were converted to methyl esters, and analyzed using gas chromatography to determine fatty  acid species in the different  cell types. This analysis revealed differences  in total abundance of  fatty acids between the wild-type and the mfe2  mutant cellular lipids (Table 3.1). Specifically, more linoleic (CI8:2) than oleic (CI8:1) acid was found  in wild-type and mutant yeast-like cells grown on glucose. Oleic acid was the predominant fatty  acid in filamentous cells from  oleic acid medium, accounting for  79% of  total fatty  acids in the wild-type and 90% in the mfe2  mutant cells. Strikingly, linoleic acid comprised only 9% of  total fatty acids in the oleic acid-grown mutant cells. The mutant accumulated oleic acid in higher levels relative to linoleic acid than did the wild-type strain. The ratio between oleic and linoleic acid in the mutant cells was 10:1 compared to 4:1 in the wild-type cells. This finding  correlates with the structural data showing an excessive accumulation of  lipid bodies in mfe2  mutants grown on oleic acid (Figure 3.4B). One possibility is that the mutant is unable to breakdown oleic acid available in the environment, but it is still able to accumulate the fatty  acid to excessive amounts compared to the wild-type cells. The yeast-like cells grown on glucose contained more linoleic acid compared to the filamentous  cells grown on oleic acid, which contained higher levels of  endogenous oleic acid. Moreover, both glucose-grown wild-type and mutant strains, which exhibit yeast-like morphology, accumulated more saturated palmitic acid (CI6:0) compared to oleic acid-grown cells, accounting for  23% of  total lipids in the wild-type cells and 17% in the mutant cells. Palmitic acid was found  only in trace amounts in the oleic acid-induced filamentous  cells. Taken together, these comparisons indicate that the mfe2  mutants are different  from  wild-type cells in terms of  their accumulation of  lipid bodies and their fatty acid composition when grown on oleic acid. These differences  and the growth defects  of the mutant on fatty  acids raised the possibility that the mutants would have reduced growth during infection.  I addressed this possibility in inoculation experiments with both vegetative tissue (seedlings) and floral  tissue (developing ears), as described in the following  sections. 3.2.8. Mfe2  Is Not Required for  the Production of  Mating Filaments U.  maydis  must mate to produce the filaments  required to infect  plant tissue. The mating filaments  are easily visualized on charcoal-containing agar plates where they generate white, fuzzy  colonies in contrast to the smooth colonies produced by haploid yeast-like strains (Banuett and Herskowitz, 1994). The mfe2  mutants produced white, aerial hyphae during mating thus indicating a positive mating reaction (Figure 3.5A). The mating filaments  were scraped from  the surface  of  the plate and examined microscopically. The mating filaments  produced from  the mixture of  compatible mfe2 mutant strains did not exhibit any differences  in cellular morphology with respect to the wild-type strains (Figure 3.5B). The filamentous  morphology resembled that of  wild type in that they were straight with collapsed hyphal compartments. The cells at the growing tips were elongated with visible chitin accumulation (Figure 3.5B). Overall, mating is unaffected  in mfe2  mutants suggesting that p-oxidation does not play an essential role in the formation  of  the infectious  cell type. 3.2.9. Loss of  mfe2  Results in Attenuation of  Virulence during Plant Infection The inoculation of  corn seedlings with compatible wild-type and mfe2  mutant strains revealed that the mutants were clearly attenuated for  virulence, although mild disease symptoms were observed (Table 3.2). The mutants were still able to induce tumors on leaves and basal parts of  the plant stems, and to produce teliospores. However, only 27% of  the plants infected  with the mixture of  compatible mfe2  mutant strains developed tumors, compared to 88% of  the plants infected  with the compatible wild-type strains (Table 3.2). Amfe2  albl X Amfe2  a2b2 albl Amfe2  albl albl &mfe2  albl a2b2 a2b2 bmfe2  a2b2 \mfe2  a2b2 Figure 3.5 Mating filaments  produced by compatible mfe2  mutant strains during mating. (A) Mating test of  wild-type (albl  and albl)  and mfe2  mutant strains. Each strain wa spotted on charcoal-containing medium, and the compatible strains were mixed in the center c the plate to assess the mating reaction. The positive mating reaction is represented by th production of  white filaments  that are visible on the dark medium. (B) Dikaryotic filament fonned  by a cross of  the wild-type and mfel  mutant strains on charcoal-containing medium afte 48 hrs. Both wild-type and mutant strains produced unbranched mating and dikaryotic filament with collapsed sections of  hyphal cells. The images were captured using DIC optics (left  panel or epifluorescence  (right panel) to visualize calcofluor-stained  cell walls. Scale bar= 10 pm. A large proportion (73%) of  the plants infected  with the mutant strains developed only chlorosis and anthocyanin pigmentation. I also tried to remediate the virulence defect  by including 1.5% or 3% glucose with the inoculum as a way to potentially bypass nutritional defects  in the mutant strains. This treatment did not change the outcome in terms of  the severity of  disease symptoms (data not shown). However, it is unclear whether the glucose would persist for  a sufficient  time and in the proper location to support all stages of  fungal  growth during infection.  The teliospores produced in tumors of  the plants infected  with the mfe2  mutants were also tested for  their ability to germinate and no obvious difference  was found  compared to spores from  the wild type inoculations (data not shown). These data suggest that P-oxidation is not essential for  U.  maydis  to complete the life  cycle in planta,  but it is required for  robust growth of  the fungus  in the host and the development of  full  disease symptoms. 3.2.10. mfe2  mutant strains do not proliferate  extensively in planta Given the virulence defect  in mfe2  mutants, I investigated the importance of  the mfe2  gene during the initial penetration and subsequent proliferation  of  the infectious filaments  in planta.  Epidermal peels from  maize leaves infected  with the compatible wild-type and mfe2  mutant strains were collected at one, four  and seven days post-inoculation, and stained with calcofluor  for  visualization of  fungal  cells. Straight mating filaments  and the infectious  dikaryotic filaments  that result from  compatible mating reactions were observed on the surface  of  the maize leaves of  both wild type and mutant infections  one day after  inoculation. Many of  the wild-type, dikaryotic filaments  had entered the plant epidermis, mostly through stomata. In contrast, the dikaryotic filaments  of  the mutant had not yet penetrated the epidermal layer at this stage. After  four  days post inoculation, many of  the mutant filaments  had penetrated the plant tissue and had started to grow inside the plant tissue; however, no obvious branching of  the filaments  was visible. At this time, the wild-type filaments  showed extensive growth within the plant cells and many branched hyphal growing tips were observed (Figure 3.6A). After  seven days post inoculation, a large network of  the mutant filaments  was observed within the plant cells. However, no obvious branching of  the invading filaments  was observed (Figure 3.6C). albl  X  a2b2 Amfe2  albl  X  Amfe2  a2b2 Figure 3.6 Hyphal morphology in planta. (A) Wild-type filaments  growing within plant tissue 7 days after  inoculation with compatible wild-type strains (albl  X a2bl). The filaments  branched (arrowheads), and could penetrate epidemial cells through a stoma (arrow). The tip of  the penetrating hypha is out of  the focal  plane. (B) Yeast-like cells of  compatible mfe2  mutant strains on the epidemial surface  of  a maize leaf.  Some of  the cells were elongated and started to produce conjugation tubes (ct) possibly in response to a mating partner. The cells often  clustered around stomata, and once a dikaryotic filament  was fonned,  it sometimes penetrated through the stomata (arrow). (C) mfe2  filament growing within plant tissue. The mutant filaments  were often  observed on the epidemial surface  or within plant tissue without branching, exhibiting typical straight mating-like hyphal morphology. Epidemial peels from  maize leaves were examined using DIC (top panel) and epifluorescence (bottom panel) to visualize the calcofluor-stained  cells. Scale bar = 10 pin. Many yeast-like cells of  the mutant strains were still found  on the epidermal surface,  often  clustered around stomata (Figure 3.6B). In contrast, the wild-type infection resulted in large networks of  filamentous  cells that were extensively branched. These results suggest that deletion of  mfe2  reduced the ability of  the fungus  to produce the highly branched filaments  that are crucial for  fungal  proliferation  in host tissue. 3.2.11. Deletion of  mfe2  Delays Teliospore Development within Tumor Tissue U.  maydis  infects  any above ground part of  the plant and symptoms are particularly dramatic in developing ears of  mature plants. To examine the virulence defect  seen in young seedlings more closely, I infected  developing ears of  two to three month old plants with compatible wild-type and mutant strains. The plants infected  with the mutants showed a delay in symptom formation  that was consistent with the defect seen in infected  seedlings (Figure 3.7). The individual kernels of  cobs infected  with wild-type strains had developed into large black tumors containing an abundance of mature, melanized teliospores by 14 days after  inoculation (a total of  13 cobs with tumors were collected in three independent experiments) (Figure 3.7A, B and C). In contrast, the cobs infected  with the mutant strains were white and cross sections of  these tumors indicated that they contained only immature spores (a total of  12 cobs with tumors were collected in three independent experiments) (Figure 3.7A, B and C). Specifically,  the fungus  within the tumors was found  in several of  the stages of  development that occur prior to maturation of  teliospores (Banuett and Herskowitz, 1996). These stages included bloated hyphae with lobed hyphal tips embedded within a mucilaginous matrix (appearing approximately 7-8 days postinoculation in wild-type cross), fragmentation  of sporogenic hyphae producing individual fragments  containing cells in the process of rounding (appearing approximately 9 days postinoculation in wild-type cross), cells with different  morphologies that are in the process of  forming  teliospores and immature teliospores which are not yet melanized (appearing approximately 12 days postinoculation in wild-type cross) (Figure 3.7C). Amfe2  albl  X  Amfe2  a2b2 alb I  Xa2b2 Amfe2  albl  XAmfe2  a2b2 tumors produced by the cross of  mfel  mutant strains. (B) Subset of tumors collected from mature maize plants 14 days postinoculation. All mfel mutant tumors were white in appearance and contained sporogenic hyphae indicating that fungal  development was not yet complete. (C) The cross section of  the tumors shown in (A). The wild type "black" tumors were tilled with melanized teliospores. The mutant "white" tumors were filled  mostly with sporogenic hyphae and immature sexual spores that were not yet melanized, and therefore  have not completed development. Scale bar = 10 (am. Figure 3.7 Teliospore production of  iufe2  mutants is compromised in mature tumors. (A) Tumors collected from infected  mature maize plants 14 days postinoculation. The cross of  compatible wild-type strains resulted in production of  mature tumors in 14-day period in contrast to the immature B albl  X  a2b2 albl  Xa2b2 Amfe2  albl  X  Amfel  a2b2 The development of  teliospores by the mutant strains were also examined at 20 days after  inoculation to assess whether spores would eventually form  at wild-type levels. A high proportion of  melanized teliospores were observed within the 20-day old tumor tissue indicating that the mutants were delayed in their development compared to the wild-type strains. These observations support the conclusion that the loss of  mfe2 influences  the pathogenic development of  U.  maydis. 3.3. Discussion I have shown in this report that deletion of  the mfe2  gene encoding a multifunctional  P-oxidation enzyme influences  both the morphological response to fatty acids and the growth of  U.  maydis  on these substrates. Furthermore, loss of  mfe2  altered lipid accumulation and fatty  acid composition within mutant cells. These observations on cells grown in culture established a foundation  to examine growth of  the mutant in the host and I observed attenuated virulence in both maize seedlings and developing ears. The simplest explanation is that the defect  in virulence results from  a metabolic deficiency  that prevents proper utilization of  host nutrients and therefore  delays extensive proliferation  in planta.  However, it is also possible that specific  fatty  acids present in the host play a signaling role that is important for  successful  infection-related  development (e.g., filamentation)  for  U.  maydis.  A defect  in lipid metabolism in the pathogen could interfere  with the processing of  these putative signals. Additionally, fungal  lipid metabolism might influence  plant lipid signaling and indirectly interfere  with or promote a defense  response that alters filamentous  proliferation.  As discussed below, these results have implications for  understanding fungal  biotrophy with respect to nutritional requirements, pathogen perception of  the host environment and plant defense. 3.3.1. Fungal Phytopathogenesis and Lipid Utilization Evidence from  several phytopathogenic fungi  indicates that lipid metabolism is critical during the early stages of  infection  that involve spore germination, production of infection  structures (i.e., appressoria formation),  and penetration. For example, lipid droplets move to the appressorium following  germination of  conidia in M.  grisea, and degradation in the vacuole appears to contribute to the glycerol accumulation required for generating turgor pressure during penetration (Thines et al., 2000). A similar mobilization and utilization of  lipid reserves may occur in Colletotrichum  species (Barbosa et al., 2006). For the biotrophic fungus  Blumeria graminis, microarray data also indicate that genes for  lipid catabolism are highly expressed during early stages of infection  and decrease in expression in later stages (Both et al., 2005). Consistently, storage lipids in conidia of  B. graminis are used during penetration and colonization of the host and reaccumulate later in the life  cycle when new conidia are formed. Transcriptome analyses also indicate that lipid catabolism is important throughout the germination and penetration stages of  infection  of  B. graminis (Thomas et al., 2002; Thomas et al., 2001). In a genetic test of  the role of  peroxisomal function  in fungal phytopathogenesis, Kimura et al., (2001) showed that loss of  peroxisomal function through mutation of  the clapex6  gene resulted in a defect  in appressorial penetration by C. lagenarium.  However, the fungus  was still able to proliferate  in the host when introduced through wounds, suggesting that lipid catabolism was not required for invasive growth. This pathogen displays biotrophy early in infection  with a subsequent switch to necrotrophic growth that may overcome the requirement for  peroxisomal function.  Although the importance of  P-oxidation in phytopathogenesis has not been studied in detail, accumulating evidence supports the importance of  the glyoxylate cycle that produces glucose from  the acetyl-CoA that results from  the breakdown of  fatty  acids. Specifically,  the glyoxylate cycle is required for  full  virulence in the phytopathogenic fungi  Tapesia  yallundae,  Leptosphaeria maculans, M.  grisea and Stagonospora nodorum,  and the human fungal  pathogen C. albicans (Bowyer et al., 2000; Idnurm and Howlett, 2002; Lorenz et al., 2004; Lorenz and Fink, 2001; Solomon et al., 2004; Wang et al., 2003). Furthermore, enzymes for  lipid degradation, including secreted lipases, also contribute to virulence in some phytopathogens such as Botrytis  cinerea, Alternaria brassicicola  and Fusarium  graminearum  (Berto et al., 1999; Commenil et al., 1995; Voigt et al., 2005). In contrast to the situation in other phytopathogens, peroxisomal P-oxidation appears to be less important during the early stages of  disease development in U.  maydis. Specifically,  the processes of  teliospore germination, haploid cell mating to form  the infectious  cell type, and plant surface  penetration, were unaffected  in the mfe2  mutants. U. maydis  also differs  from  many other well-studied phytopathogenic fungi  in that it does not produce true appressoria (i.e., rounded, melanized structures), but instead produces appressorium-like swellings at the tips of  infectious  dikaryons to penetrate the plant surface.  U.  maydis  also does not make obvious haustoria to acquire nutrients from  the host (Snetselaar and Mims, 1993; Snetselaar and Mims, 1994). In contrast, our analysis indicated that loss of  mfe2  influenced  later stages of  disease development, including extensive proliferation  of  branched hyphae and sporulation in planta.  U.  maydis  generally infects  actively growing meristematic tissue in maize, resulting in tumors that are often found  in the immature, expanding tissue at the base of  the leaf  (Callow and Ling, 1973; Wenzler and Meins, 1987). Glycolipids and phospholipids would potentially be available to the fungus  in this tissue and these generally contain the following  fatty  acids: CI6:0, C18:0, C18:l, C18:2, and C18:3 (Hawke et al., 1974; Leech et al., 1973). Traces of  C14:0, C16:l and C20:0 are also found.  Fatty acids are synthesized in plastids in developing plant tissue, and the amount of  lipid increases in parallel with plastid development in green developing maize leaves (Leech et al., 1973; Moore and Troyer, 1983). A similar fatty  acid composition is also found  in maize kernels (Hsing et al., 1993; Ratcliff  et al., 1993). It is not yet clear whether U.  maydis  would have access to these lipids during infection  and tumor formation.  Upon infection,  the fungus  initially grows intracellularly in epidermal cells, parenchyma cells and cells of  the vascular bundles. Later, the fungus  grows mostly intercellularly as highly branched hyphae, some of  which protrude into plant cells (Snetselaar and Mims, 1994.). Banuett and Herskowitz (1996) also described the proliferation  of  hyphae within host cells with the eventual rupture of  the cells during sporulation. In general, examination of  tumor sections reveals aggregates of  fungal  hyphae in the process of  sporulation surrounded by hypertrophied host cells that appear mainly empty (Snetselaar and Mims, 1994.). Callow and Ling (1973) also reported that plastids and starch disappear during tumor formation,  leaving empty host cells around areas of abundant sporulation. The lipid composition of  the tumor tissue on maize ears has actually been characterized in some detail because these galls are an edible delicacy in Mexico (known as cuitlacoche or "corn truffle").  Based on nutritional analysis, LCFA are abundant components of  cuitlacoche, particularly oleic and linoleic acid followed  by linolenic and palmitic acid (Hawke et al., 1974; Valverde and Paredes-Lopez, 1993; Vanegas et al., 1995). Oleic, linoleic and palmitic acid are also known to be predominant fatty  acid species in teliospores of  U.  maydis  (Gunasekaran et al., 1972). Of  course, tumor tissue represents a mixture of  plant and fungal  material and it is therefore  difficult  to separate the relative contributions to fatty  acid content. 3.3.2. Possible Roles for  Lipid Signaling in Fungal Morphogenesis and Plant Defense Part of  our investigation into the role of  mfe2  considered the question of  whether a defect  in fatty  acid metabolism would influence  the morphological transition leading to infectious  hyphae. This question was motivated by our previous observations that exogenous lipids trigger the dimorphic switch from  budding to hyphal growth in culture (Klose et al., 2004). Notably, I found  that mfe2  was required for  filamentation  in response to some but not all fatty  acids. For example, palmitic acid (CI6:0) triggered the formation  of  unbranched hyphae that resembled the mating filaments  and the initial infectious  dikaryons that usually form  on a leaf  surface  during early stages of  infection. Oleic acid and linoleic acid induced highly branched filaments  in wild-type cells but the mfe2  mutants formed  filaments  with very short branches on oleic acid and did not respond morphologically to linoleic acid. Unlike wild-type strains, growth of  the mutants was limited on both fatty  acids. These results suggests that exogenous linoleic acid may have a specific  signaling role, either directly or after  processing, to form  derivatives such as oxylipins. Precedent for  the regulation of  fungal  morphogenesis by fatty  acids and oxylipins comes from  studies on sporulation, secondary metabolite production and sexual development in filamentous  fungi  (Goodrich-Tanrikulu et al., 1998; Kock et al., 2003; Tsitsigiannis and Keller, 2006; Tsitsigiannis et al., 2005a; Tsitsigiannis et al., 2005b; Tsitsigiannis et al., 2005c; Tsitsigiannis et al., 2004a; Tsitsigiannis et al., 2004b). For example, the influence  of  oxylipins has been studied in detail in Aspergillus  nidulans,  and it has been shown that hydroxylated oleic, linoleic and linolenic acids constitute an endogenous mixture of  oxylipin hormones (psi factors)  that control the timing and balance of  meiotic and mitotic spore development (Calvo et al., 2001; Champe et al., 1987; Tsitsigiannis et al., 2005a; Tsitsigiannis et al., 2004a; Tsitsigiannis et al., 2005b; Tsitsigiannis et al., 2005c; Tsitsigiannis et al., 2004b). More recent work revealed that mutants defective  in the fatty  acid oxygenases for  psi factor  production (ppo  genes) had reduced production of  the mycotoxin sterigmatocystin, reduced peanut seed colonization, and increased penicillin production (Tsitsigiannis and Keller, 2006). With regard to potential oxylipin metabolism, a polypeptide (Sspl) with similarity to linoleate diol synthase has been found  to be abundant in U.  maydis  teliospores, and a function  in the mobilization of  storage lipids has been proposed (Huber et al., 2002). However, deletion of  the sspl gene does not result in an obvious phenotype. It is possible that U.  maydis responds to derivatives of  fatty  acids, and that mfe2  and p-oxidation may be required to produce specific  intermediates that are further  modified  to produce signaling lipid/fatty acid molecules. It may also be the case that the loss of  mfe2  has an indirect affect  on morphogenesis by influencing  cellular fatty  acid composition as demonstrated by our chemical analyses. Clearly, further  investigation of  the specificity  of  signaling among fatty  acids and derivatives such as oxylipins is needed. The mfe2  mutation impaired symptom development during infection  but did not completely abolish fungal  growth within the plant. In general, biotrophic fungi  like U. maydis  evade plant defense  mechanisms by camouflage  or by suppression, or actively defend  themselves by mechanisms such a detoxification  of  host metabolites (Schulze-Lefert  and Panstruga, 2003). It is possible that an enhanced defense  response occurs upon infection  by mfe2  mutants because of  the altered chemical environment caused by the metabolic defect  in the pathogen. That is, a change in lipid composition or signaling could trigger a defense  response through activation of  jasmonic acid signaling and the defense  responses of  the salicylic acid-dependent pathway. Lipids clearly have an impact on the plant defense  response through a variety of  mechanisms (Shah, 2005). For example, fatty  acids play an important role in modulating signaling between the salicylic acid (SA)- and jasmonic acid (JA)-dependent defense  pathways and recent studies have uncovered an important role for  lipids also in the activation of  systemic acquired resistance (Kachroo et al., 2003; Maldonado et al., 2002; Nandi et al., 2004). In general, little is known about the defense  response of  maize to infection  by U.  maydis.  Basse (2005) recently described transcriptional changes for  maize genes related to metabolism and development in response to U.  maydis  infection,  as well as putative defense responses of  the host. Evidence was obtained to suggest that U.  maydis  is capable of suppressing a defense  response based on the observation that a weakly proliferative mutant triggered expression of  the pathogenesis related gene PR-1. These observations suggest that it may be informative  to examine defense-related  gene expression during infection  with mfe2  mutants, although I favor  the hypothesis that a nutritional defect results in reduced growth in planta. In summary, I have demonstrated the importance of  a P-oxidation function  for growth on fatty  acids in culture and for  biotrophic infection.  However, many additional questions remain about the importance of  lipid metabolism in U.  maydis  during infection including the potential role of  lipases, the extent of  lipid utilization and the specificity  of potential signals from  fatty  acids and their derivatives. In addition, the genome sequence suggests that the fungus  may also have a mitochondrial P-oxidation system and the contribution of  this system to infection  remains to be explored. 3.4. Materials and Methods 3.4.1. Growth Conditions U.  maydis  strains were grown overnight at 30°C on both potato dextrose agar or broth (PDA or PDB; Difco),  or complete medium (CM) (Holliday, 1974). For selection of  transformants,  250 micrograms of  hygromycin B per mL was added to CM. To characterize the morphological response and to determine growth rate in lipids and fatty acids, 1X106 mL"1 of  PDB -grown overnight cells were washed with sterile water and added to 5 mL of  minimal medium (MM) (Holliday, 1974) or spotted in a range of  cell concentrations on MM agar supplemented with one of  the following  carbon sources: glucose, corn oil, butyric, caproic, lauric, myristic, oleic, linoleic, erucic, arachidic, arachidonic, or jasmonic acid; all added to a concentration of  1%. (all fatty  acids were purchased from  Sigma). The cells were grown at 30°C for  5 days with (liquid MM) or without (MM agar) shaking at 250 rpm. The growth of  wild-type and mutant strains was determined by cell counts with a hemacytometer. 3.4.2. Strains, Deletion Constructs and Transformation  Procedures The DNA sequence of  the mfe2  gene (Um00150) was originally obtained from  the U.  maydis  genomic sequence at Broad Institute (http://www.broad.mit.edu/annotation/fungi/ustilago_maydis/ ). Additional sequence information  (Uml0038) came from  the MIPS's U.  maydis  genome annotation project (http://mips.gsf.de/genre/proj/ustilago/ ). A PCR overlap strategy was used to generate the Amye2::hygBr deletion construct (Davidson et al., 2002). The Am/e2::hygB' was designed to delete the entire open reading frame  of  the mfe2  gene. From genomic DNA, a 655 bp 5'flanking  region and a 550 bp 3' flanking  region were amplified  using primers MFE2P1 (5' - AGTTTCGAGTCGGTGCGT-3') and MFE2P2 (5'-AACTGTGCTTCAATCGCTGCGGTATGCGGCTGTGAGTTGA-3'), and primers MFE2P5 (5' -TAGCACACGACTCACATCTGCGAGTGCATGGTGGTGAGAT-3') and MFE2P6 (5'-TGAGCGTTGCAATCGTGA-3'), respectively. The 2.7kb hygromycin resistance marker was amplified  using primers MFE2P3 (5'-TC AACTC AC AGCCGCATACCGCAGCGATTGAAGC AC AGTT-3') and MFE2P4 (5' - ATCTC ACC ACC ATGC ACTCGC AGATGTGAGTCGTGTGCTA-3') from  the plasmid DNA pIC19RHL. The three fragments  were combined by an overlapping PCR reaction using primers MFE2P1 and MFE2P6. The 4 kb overlap PCR product generated the Am/e2::hygBr construct, which was cloned into pCR2.1 (Invitrogen). The plasmid containing the deletion construct was transformed  into E. coli strain DH10B (Bethesda Research Laboratories). The deletion strains, albl  Amfe2\\hygB'  and a2b2 Amfe2::hygB r were generated by biolistic transformation  (Toffaletti  et al., 1993) of  albl  (521) and a2b2 (518) strains (Holliday, 1961). Transformants  were screened by colony PCR using a U.  maydis-specific  primer outside the construct MFE2CR (5'-TCTCGCACCAATCAATCCTG 3') and Ayg5-specific  primer HYGBL (5' -ATCAGTTCGGAGACGCTG-3'). Gene deletion was also confirmed  by DNA blot analysis using genomic DNA and blots prepared and hybridized by standard methods (Sambrook et al., 1989). Two independent deletion mutants in each wild-type strain were selected for  all subsequent phenotypic analyses to confirm  that the deleted gene is responsible for  the observed phenotypes. Representative data from  analyses of  all of  the deletion strains is shown in the results section of  this chapter. 3.4.3. RNA Isolation and Northern Analysis Cells were grown overnight in 5 mL MM supplemented with glucose (1%) and transferred  to MM supplemented with either caproic, oleic or linoleic acid (all added to 1%) and grown at 30°C at 250 rpm for  6 hrs. RNA was isolated as described previously (Schmitt et al., 1990). RNA blot preparation and hybridization was performed  using standard methods (Sambrook et al., 1989). PCR was used to amplify  the 150 bp DNA fragment  as a hybridization probe using primers MFE2NP1 (5'-AGAGCACCGTCTTCATTCG-3') and MFE2NP2 (5'-TGTGAAGCGCACCTTGATG-3'). The probe was labeled with 3 2P by random priming (ReadiPrime™ II Oligolabeling kit, Amersham Pharmacia Biotech). 3.4.4. Sequence Analysis Gene prediction, protein alignments and sequence analysis were done using the programs BLAST (Altschul et al., 1997), CLUSTAL W (Thompson et al., 1994), and Pfam  (Bateman et al., 2002). 3.4.5. Microscopy and Staining Procedures Fluorescent brightener 28 Calcofluor  white (Sigma, F3543) was used to visualize cell walls and 1 pL of  a 20 pg/mL solution was added directly to 5 pL of  cell culture spotted on a slide. Nile Red (Sigma N3013) was used to visualize lipid bodies by adding lpL of  a O.lmg/mL solution in 100% acetone directly to 5 pL of  cell culture, incubated for  5 minutes and observed using a FITC filter.  Nile red stains intracellular lipids that localize in lipid bodies (Kimura et al., 2004). Fungal proliferation  in a plant tissue was observed in epidermal peels generated from  maize leaves at one, four,  and seven days post inoculation. The thin layers of  plant cells were placed on a 30 pL drop of  water with 3 pL of  Fluorescent brightener 28 calcofluor  white (Sigma, F3543) for  microscopic observation. Cross sections of  tumor tissue collected from  infected  mature plants 14 and 20 days post inoculation were generated using a razor blade. The cross sections were placed on a 30 pL drop of  water with 3 pL of  Fluorescent brightener 28 calcofluor  white (Sigma, F3543) for  microscopic analysis. Cells were observed using a Zeiss Axioplan 2 fluorescence  microscope with differential  interference  contrast (DIC) optics or UV fluorescence  to observe cells stained with Calcofluor  or Nile Red. Images were captured with a DVC camera and processed with Northern Eclipse imaging software  and Adobe Photoshop 7. For electron microscopy, cells were prefixed  by the addition of  glutaraldehyde (2.5%) to cultures grown for  18 hr either on glucose (1%) or oleic acid (1%) with shaking at 250 rpm. The cells were harvested by centrifugation  for  10 min at 16,100 X g at 20°C, resuspended in 50 mM phosphate buffer  (pH 6.8) containing 3% glutaraldehyde to an ODeoo of  10, and fixed  for  24 h at room temperature. For specific  lipid staining, the cells were post-fixed  with 2% OsC>4 in 200 mM imidazole buffer  (pH 7.5) for  1 h. After washing with 100 mM imidazole buffer  (pH 7.5), the cells were dehydrated in a graded ethanol series in the following  order: 50, 70, 90, and 100% (vol/vol). For transmission electron microscopy (TEM), the cells were embedded in Spurs resin and 70-nm-thick sections were cut with a Leica Ultracut E ultramicrotome, and stained with 2% uranyl acetate for  14 minutes and lead citrate for  seven minutes. Sections were mounted on 200-mesh grids and examined with a Hitachi H7600 TEM. A random sample of  cells was examined in three separate cultures from  each type of  medium. 3.4.6. Lipid Extraction and Fatty Acid Analysis Cells were grown in 50 mL MM supplemented either with glucose (1%) or oleic acid (1%) at 30°C at 250 rpm for  5 days. The cells were harvested by centrifugation  and washed twice with hexane (Sigma, H9379). To extract the intracellular lipids, the cells were sonicated and 2 mL methanolic-KOH was added to saponify  lipids for  2hr at 80°C, and then washed by adding 1 mL water and 2 mL hexane. 400 pL concentrated HC1 and 2 mL hexane were added to the bottom phase to extract free  fatty  acids (FFA). Heptadecanoic acid (CI7:0) (Sigma, H3500) was added to the extracted lipids as an internal standard. FFA were converted into fatty  acid methyl esters (FAME) by adding diazomethanol and incubating at room temperature for  4 hr. The FAME were analyzed by gas chromatography mass spectrometer (GC/MS) Agilent Technologies 5975 Inert XL MS Detector with 6890N GC and 7683 B Series autosampler equipped with a capillary GC column Agilent HP-5MS 5% phenyl methyl siloxane. 3.4.7. Mating and Virulence Assays Strains were tested for  their ability to mate by the production of  white aerial hyphae during mating reactions on charcoal-containing CM (Holliday, 1974). For virulence assays, mating cultures of  1X107 cells mL"1 (grown on PDB overnight at 30°C with shaking at 250 rpm) generated by crossing the strains in the following  combinations was used to infect  maize plants: 521 (albl)  X 518 (a2b2),  521 (albl)  X a2b2 Amfe2::hygB r, 518 (a2b2)  X albl  Amfe2::hygB''  and albl  Amfe2::hygB r X  a2b2 Amfe2::hygB r. For seedling infections,  one-week-old maize plants (Golden Bantam) were inoculated by injecting approximately 100 pL of  mating cultures per plant. After  14 days, plants were scored for  disease symptoms using the following  ratings: (1) chlorosis and pigment production; (2) small leaf  tumors; (3) small stem tumors; (4) large stem tumors; and (5) plant death. Approximately 100 plants for  each combination of  strains were scored for  disease symptoms. For mature plant infections,  two to three-month-old maize plants were inoculated by injecting approximately 2 mL of  mating cultures into the silk channels of  developing cobs. The infections  were repeated four  times. The production of  teliospore within tumors was examined after  14 and 20 days. 3.4.8. Accession Numbers Sequence data from  this article can be found  in the EMBL Nucleotide Sequence Submission (EMBL), http://www.ebi.ac.uk, and GenBank, National Center for Biotechnology Information  (GenBank), http: //www.ncbi.nlm.nih.gov, data libraries under accession number XP 756297. 3.5. Tables Table 3.1 Fatty acid profiles  of  total internal lipids extracted from  U.  maydis  wild-type (a2b2) and mfe2  mutant (Amfe2  a2b2) strains grown either on glucose or oleic acid" a2b2 Amfe2  a2b2 Glucose Oleic acid Glucose Oleic acid Fatty acid" % b 1 SD % b ± SD % b ± SD % b ± SD C14:0 1 ± 0.2 n/dc t e n/d° C16:0 23 1 0.5 t e 17 ±2.1 t e C16:l 1 ±0.0 1 ±0.5 1 ±0.5 1 ±0.0 C18:0 5 ± 1.3 t e 4 ±0.5 t e C18:l 29 ±2.4 79 ±3.3 20 ±3.8 90 ±0.2 C18:2 42 ±3.0 20 ±5.0 57 ±4.3 9± 1.7 C20:0 t e t e t e n/db a The table shows data from  three independent experiments. b % of  total fatty  acids c Not detected d Internal lipids were extracted from  cells grown in minimal medium supplemented with appropriate carbon source for  20 hrs. Fatty acids were analyzed by gas chromatography. e Found in trace amounts Table 3.2 Pathogenicity of  mfe2  mutants" Cross or strain No. of  plants producing anthocyanin No. of plants with tumors Total no. of plants infected % of  plants with tumors Disease score b albl  X a2b2 12 87 99 88 3.7 albl  X Amfe2  a2b2 16 95 106 90 3.4 Amfe2  albl  X a2b2 10 82 92 89 3.6 Amfe2  albl  X Amfe2  a2b2 75 28 103 27 1.2 a Table shows combined data from  four  independent experiments. The pattern of  the disease symptom development shown in the table is representative of  a pattern observed in each independent experiment. b The disease score is calculated as the sum of  disease symptoms ratings divided by the total number of  infected  plants scored for  symptoms. 3.6. References Altschul, S. F., Madden, T. L., Schaffer,  A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of  protein database search programs. Nucleic Acids Res. 25, 3389-402. Andrews, D. L., Egan, J. D., Mayorga, M. E., and Gold, S. E. (2000). The Ustilago  maydis  ubc4 and ubc5 genes encode members of  a MAP kinase cascade required for  filamentous  growth. Mol Plant Microbe Interact. 13, 781-6. Banuett, F., and Herskowitz, I. (1996). Discrete developmental stages during teliospore formation  in the corn smut fungus,  Ustilago  maydis.  Development. 122, 2965-76. Banuett, F., and Herskowitz, I. (1994). Identification  offuz7,  a Ustilago  maydis MEK/MAPKK homolog required for  a-locus-dependent and -independent steps in the fungal  life  cycle. Genes Dev. 8, 1367-78. Barbosa, A. C., Carmo, A. E., Graf,  L., Tomaz, R., Souza, C. F., Mendes, J., Randi, M. A., Buchi, D., and Schadeck, R. J. (2006). Morphology and lipid body and vacuole dynamics during secondary conidia formation  in Colletotrichum  acutatum:  laser scanning confocal  analysis. Can J Microbiol. 52, 117-24. Barrett, K. J., Gold, S. E., and Kronstad, J. W. (1993). Identification  and complementation of  a mutation to constitutive filamentous  growth in Ustilago  maydis. Mol Plant Microbe Interact. 6, 274-83. Basse, C. W. (2005). Dissecting defense-related  and developmental transcriptional responses of  maize during Ustilago  maydis  infection  and subsequent tumor formation.  Plant Physiol. 138, 1774-84. Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S. R., Griffiths-Jones,  S., Howe, K. L., Marshall, M., and Sonnhammer, E. L. (2002). The Pfam protein families  database. Nucleic Acids Res. 30, 276-80. Berto, P., Commenil, P., Belingheri, L., and Dehorter, B. (1999). Occurrence of  a lipase in spores of  Alternaria  brassicicola  with a crucial role in the infection  of cauliflower  leaves. FEMS Microbiol Lett. 180, 183-9. Boothroyd, B., Thorn, J. A., and Haskins, R. H. (1956). Biochemistry of  the ustilaginales. XII. Characterization of  extracellular glycolipids produced by Ustilago  sp. Can J Biochem Physiol. 34, 10-4. Both, M., Csukai, M., Stumpf,  M. P., and Spanu, P. D. (2005). Gene expression profiles  of  Blumeria graminis indicate dynamic changes to primary metabolism during development of  an obligate biotrophic pathogen. Plant Cell. 17, 2107-22. Bowyer, P., Mueller, E., and Lucas, J. (2000). Use of  an isocitrate lyase promoter-GFP fusion  to monitor carbon metabolism of  the plant pathogen Tapesia  yallundae during infection  of  wheat. Molecular Plant Pathology 1, 253-262. Brachmann, A., Weinzierl, G., Kamper, J., and Kahmann, R. (2001). Identification  of  genes in the bW/bE regulatory cascade in Ustilago  maydis.  Mol Microbiol. 42, 1047-63. Callow, J. A., and Ling, I. T. (1973). Histology of  neoplasms and chlorotic lesions in maize seedlings following  the injection of  sporidia of  Ustilago  maydis  (DC) Corda. Physiological Plant Pathology 3, 489-494. Calvo, A. M., Gardner, H. W., and Keller, N. P. (2001). Genetic connection between fatty  acid metabolism and sporulation in Aspergillus  nidulans.  J Biol Chem. 276, 25766-74. Champe, S. P., Rao, P., and Chang, A. (1987). An endogenous inducer of  sexual development in Aspergillus  nidulans.  J Gen Microbiol. 133, 1383-7. Commenil, P., Belingheri, L., Sancholle, M., and Dehorter, B. (1995). Purification and properties of  an extracellular lipase from  the fungus  Botrytis  cinerea. Lipids. 30, 351-6. Davidson, R. C., Blankenship, J. R., Kraus, P. R., de Jesus Berrios, M., Hull, C. M., D'Souza, C., Wang, P., and Heitman, J. (2002). A PCR-based strategy to generate integrative targeting alleles with large regions of  homology. Microbiology. 148, 2607-15. de Hoop, M. J., and Ab, G. (1992). Import of  proteins into peroxisomes and other microbodies. Biochem J. 286, 657-69. Durrenberger, F., Laidlaw, R. D., and Kronstad, J. W. (2001). The hgll  gene is required for  dimorphism and teliospore formation  in the fungal  pathogen Ustilago maydis.  Mol Microbiol. 41, 337-48. Durrenberger, F., Wong, K., and Kronstad, J. W. (1998). Identification  of  a cAMP-dependent protein kinase catalytic subunit required for  virulence and morphogenesis in Ustilago  maydis.  Proc Natl Acad Sci USA. 95, 5684-9. Fossa, A., Beyer, A., Pfitzner,  E., Wenzel, B., and Kunau, W. H. (1995). Molecular cloning, sequencing and sequence analysis of  the fox-2  gene of  Neurospora crassa encoding the multifunctional  beta-oxidation protein. Mol Gen Genet. 247, 95-104. Gold, S., Duncan, G., Barrett, K., and Kronstad, J. (1994). cAMP regulates morphogenesis in the fungal  pathogen Ustilago  maydis.  Genes Dev. 8, 2805-16. Gold, S. E., Brogdon, S. M., Mayorga, M. E., and Kronstad, J. W. (1997). The Ustilago  maydis  regulatory subunit of  a cAMP-dependent protein kinase is required for gall formation  in maize. Plant Cell. 9, 1585-94. Goodrich-Tanrikulu, M., Howe, K, Stafford,  A., and Nelson, M. A. (1998). Changes in fatty  acid composition of  Neurospora  crassa accompany sexual development and ascospore germination. Microbiology. 144, 1713-20. Gunasekaran, M., Bushnell, J. L., and Weber, D. J. (1972). Comparative studies on lipid components of  Ustilago  bullata  and Ustilago  maydis  spores. Res Commun Chem Pathol Pharmacol. 3, 621-8. Hartmann, H. A., Kahmann, R., and Bolker, M. (1996). The pheromone response factor  coordinates filamentous  growth and pathogenicity in Ustilago  maydis.  Embo J. 15, 1632-41. Hawke, J. C., Rumsby, M. G., and Leech, R. M. (1974). Lipid Biosynthesis in Green Leaves of  Developing Maize. Anal Biochem 53, 555-561. Hewald, S., Josephs, K, and Bolker, M. (2005). Genetic analysis of  biosurfactant production in Ustilago  maydis.  Appl Environ Microbiol. 71, 3033-40. Hiltunen, J. K, Wenzel, B., Beyer, A., Erdmann, R., Fossa, A., and Kunau, W. H. (1992). Peroxisomal multifunctional  beta-oxidation protein of  Saccharomyces  cerevisiae. Molecular analysis of  the fox2  gene and gene product. J Biol Chem. 267,  6646-53. Holliday, R. (1961). The genetics of  Ustilago  maydis.  Genet. Res. Cambridge Soc 2, 204-230. Holliday, R. (1974). Ustilago  maydis.  In Handbook of  Genetics, R. C. King, ed. (New York: Plenum Press), pp. 575-595. Hsing, Y. C., Widholm, J: M., and Rinne, R. W. (1993). Lipid metabolism in maize tissue-culture. J. Plant Physiol 142, 360-365. Huber, S. M., Lottspeich, F., and Kamper, J. (2002). A gene that encodes a product with similarity to dioxygenases is highly expressed in teliospores of  Ustilago maydis.  Mol Genet Genomics 267,  757-71. Idnurm, A., and Howlett, B. J. (2002). Isocitrate lyase is essential for pathogenicity of  the fungus  Leptosphaeria maculans to canola {Brassica  napus). Eukaryot Cell. 1, 719-24. Kachroo, A., Lapchyk, L., Fukushige, H., Hildebrand, D., Klessig, D., and Kachroo, P. (2003). Plastidial fatty  acid signaling modulates salicylic acid- and jasmonic acid-mediated defense  pathways in the Arabidopsis ssi2 mutant. Plant Cell. 15, 2952-65. Epub 2003 Nov 13. Kamiryo, T., Sakasegawa, Y., and Tan, H. (1989). Expression and transport of Candida  tropicalis  peroxisomal acyl-coenzyme A oxidase in the yeast Candida  maltosa. Agric Biol Chem. 53, 179-186. Kimura, A., Takano, Y., Furusawa, I., and Okuno, T. (2001). Peroxisomal metabolic function  is required for  appressorium-mediated plant infection  by Colletotrichum  lagenarium.  Plant Cell. 13, 1945-57. Kimura, K., Yamaoka, M., and Kamisaka, Y. (2004). Rapid estimation of  lipids in oleaginous fungi  and yeasts using Nile red fluorescence.  J Microbiol Methods. 56, 331-8. Klose, J., Moniz de Sa, M. M., and Kronstad, J. W. (2004). Lipid-induced filamentous  growth in Ustilago  maydis.  Mol Microbiol 52, 823-35. Kock, J. L., Strauss, C. J., Pohl, C. H., and Nigam, S. (2003). The distribution of 3-hydroxy oxylipins in fungi.  Prostaglandins Other Lipid Mediat. 71, 85-96. Kunau, W. H., Dommes, V., and Schulz, H. (1995). beta-oxidation of  fatty  acids in mitochondria, peroxisomes, and bacteria: a century of  continued progress. Prog Lipid Res. 34, 267-342. Kunau, W. H., and Hartig, A. (1992). Peroxisome biogenesis in Saccharomyces cerevisiae. Antonie Van Leeuwenhoek. 62, 63-78. Lee, N., and Kronstad, J. W. (2002). ras2 Controls morphogenesis, pheromone response, and pathogenicity in the fungal  pathogen Ustilago  maydis.  Eukaryot Cell. 1, 954-66. Leech, R. M., Rumsby, M. G., and Thomson, W. W. (1973). Plastid Differentiation,  Acyl Lipid, and Fatty Acid Changes in Developing Green Maize Leaves. Plant Physiol 53, 240-245. Lemieux, R. U., Thorn, J. A., Brice, C., and Haskins, R. H. (1951). Biochemistry of  the ustilaginales. II. Isolation and partial characterization of  ustilagic acid. Can J Chem. 29, 409-14. Lorenz, M. C., Bender, J. A., and Fink, G. R. (2004). Transcriptional response of Candida  albicans upon internalization by macrophages. Eukaryot Cell. 3, 1076-87. Lorenz, M. C., and Fink, G. R. (2001). The glyoxylate cycle is required for  fungal virulence. Nature 412, 83-6. Luo, Y., Karpichev, I. V., Kohanski, R. A., and Small, G. M. (1996). Purification, identification,  and properties of  a Saccharomyces  cerevisiae oleate-activated upstream activating sequence-binding protein that is involved in the activation of  POX1.  J Biol Chem. 271, 12068-75. Maggio-Hall, L. A., and Keller, N. P. (2004). Mitochondrial beta-oxidation in Aspergillus  nidulans.  Mol Microbiol. 54, 1173-85. Maldonado, A. M., Doerner, P., Dixon, R. A., Lamb, C. J., and Cameron, R. K. (2002). A putative lipid transfer  protein involved in systemic resistance signalling in Arabidopsis. Nature. 419, 399-403. Mayorga, M. E., and Gold, S. E. (1999). A MAP kinase encoded by the ubc3 gene of  Ustilago  maydis  is required for  filamentous  growth and full  virulence. Mol Microbiol. 34, 485-97. Moore, T. S., and Troyer, G. D. (1983). Phospholipids and metabolism. In Biosynthesis and function  of  plant lipids, W. W. Thomson, B. J. Mudd and M. Gibbs, eds. (Rockeville, Md: American Soc. of  Plant Physiologists). Moreno de la Garza, M., Schultz-Borchard, U., Crabb, J. W., and Kunau, W. H. (1985). Peroxisomal beta-oxidation system of  Candida  tropicalis.  Purification  of  a multifunctional  protein possessing enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase and 3-hydroxyacyl-CoA epimerase activities. Eur J Biochem. 148, 285-91. Nandi, A., Welti, R., and Shah, J. (2004). The Arabidopsis thaliana dihydroxyacetone phosphate reductase gene SUPPRESSSOR OF FATTY ACID DESATURASE DEFICIENCY 1 is required for  glycerolipid metabolism and for  the activation of  systemic acquired resistance. Plant Cell. 16, A6S-11. Novikov, D. K, Vanhove, G. F., Carchon, H., Asselberghs, S., Eyssen, H. J., Van Veldhoven, P. P., and Mannaerts, G. P. (1994). Peroxisomal beta-oxidation. Purification of  four  novel 3-hydroxyacyl-CoA dehydrogenases from  rat liver peroxisomes. J Biol Chem. 269, 27125-35. Pataky, J. K. (1991). Production of  cuitlacoche (Ustilago  maydis  (DS) Corda) on sweet corn. HortSci 26, 1374-1377. Pataky, J. K. (1990). Production of  huitlacoche, Ustilago  maydis.  Phytopathol 80, 1044. Purdue, P. E., and Lazarow, P. B. (1994). Peroxisomal biogenesis: multiple pathways of  protein import. J Biol Chem. 269, 30065-8. Qin, Y. M., Marttila, M. S., Haapalainen, A. M., Siivari, K. M., Glumoff,  T., and Hiltunen, J. K. (1999). Yeast peroxisomal multifunctional  enzyme: (3R)-hydroxyacyl-CoA dehydrogenase domains A and B are required for  optimal growth on oleic acid. J Biol Chem. 274, 28619-25. Ratcliff,  S. L., Wilson, D. O. J., Knott, E. A., and Mohan, S. K. (1993). Free fatty acids in shrunken-2 sweet corn seed. Crop Sci 33, 871-873. Requena, N., Fuller, P., and Franken, P. (1999). Molecular characterization of GmFOX2,  an evolutionarily highly conserved gene from  the mycorrhizal fungus  Glomus mosseae, down-regulated during interaction with rhizobacteria. Mol Plant Microbe Interact. 12, 934-42. Sambrook, J. E., Fritsch, F., and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd Edition (New York: Cold Spring Harbor Laboratory Press). Schmitt, M. E., Brown, T. A., and Trumpower, B. L. (1990). A rapid and simple method for  preparation of  RNA from  Saccharomyces  cerevisiae. Nucleic Acids Res. 18, 3091-2. Schulze-Lefert,  P., and Panstruga, R. (2003). Establishment of  biotrophy by parasitic fungi  and reprogramming of  host cells for  disease resistance. Annu Rev Phytopathol 41, 641-67. Shah, J. (2005). Lipids, lipases, and lipid-modifying  enzymes in plant disease resistance. Annu Rev Phytopathol. 43, 229-60. Small, G. M., Szabo, L. J., and Lazarow, P. B. (1988). Acyl-CoA oxidase contains two targeting sequences each of  which can mediate protein import into peroxisomes. EMBO J. 7, 1167-73. Smith, J. J., Brown, T. W., Eitzen, G. A., and Rachubinski, R. A. (2000). Regulation of  peroxisome size and number by fatty  acid beta -oxidation in the yeast Yarrowia  lipolytica.  J Biol Chem. 275, 20168-78. Snetselaar, K. M., and Mims, C. W. (1993). Infection  of  maize stigmas by Ustilago  maydis:  light and electron microscopy. Phytopathology, 843-850. Snetselaar, K. M., and Mims, C. W. (1994.). Light and electron microscopy of Ustilago  maydis  hyphae in maize. Mycological Research, 347-355. Snetselaar, K. M., and Mims, C. W. (1992). Sporidial fusion  and infection  of maize seedlings by the smut fungus  Ustilago  maydis.  Mycologia 84, 193-203. Solomon, P. S., Lee, R. C., Wilson, T. J., and Oliver, R. P. (2004). Pathogenicity of  Stagonospora  nodorum  requires malate synthase. Mol Microbiol. 53, 1065-73. Stanway, C. A., Gibbs, J. M., and Berardi, E. (1995). Expression of  the FOX1 gene of  Saccharomyces  cerevisiae is regulated by carbon source, but not by the known glucose repression genes. Curr Genet. 27, 404-408. Thines, E., Weber, R. W., and Talbot, N. J. (2000). MAP kinase and protein kinase A-dependent mobilization of  triacylglycerol and glycogen during appressorium turgor generation by Magnaporthe  grisea. Plant Cell. 12, 1703-18. Thomas, S. W., Glaring, M. A., Rasmussen, S. W., Kinane, J. T., and Oliver, R. P. (2002). Transcript profiling  in the barley mildew pathogen Blumeria graminis by serial analysis of  gene expression (SAGE). Mol Plant Microbe Interact. 15, 847-56. . Thomas, S. W., Rasmussen, S. W., Glaring, M. A., Rouster, J. A., Christiansen, S. K., and Oliver, R. P. (2001). Gene identification  in the obligate fungal  pathogen Blumeria graminis by expressed sequence tag analysis. Fungal Genet Biol. 33, 195-211. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of  progressive multiple sequence alignment through sequence weighting, position-specific  gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-80. Toffaletti,  D. L., Rude, T. H., Johnston, S. A., Durack, D. T., and Perfect,  J. R. (1993). Gene transfer  in Cryptococcus  neoformans  by use of  biolistic delivery of  DNA. J Bacteriol. 175, 1405-11. Tsitsigiannis, D. I., Bok, J. W., Andes, D., Nielsen, K. F., Frisvad, J. C., and Keller, N. P. (2005a). Aspergillus  cyclooxygenase-like enzymes are associated with prostaglandin production and virulence. Infect  Immun. 73, 4548-59. Tsitsigiannis, D. I., and Keller, N. P. (2006). Oxylipins act as determinants of natural product biosynthesis and seed colonization in Aspergillus  nidulans.  Mol Microbiol. 59, 882-92. Tsitsigiannis, D. I., Kowieski, T. M., Zarnowski, R., and Keller, N. P. (2004a). Endogenous lipogenic regulators of  spore balance in Aspergillus  nidulans.  Eukaryot Cell. 3, 1398-411. Tsitsigiannis, D. I., Kowieski, T. M., Zarnowski, R., and Keller, N. P. (2005b). Three putative oxylipin biosynthetic genes integrate sexual and asexual development in Aspergillus  nidulans.  Microbiology. 151, 1809-21. Tsitsigiannis, D. I., Kunze, S., Willis, D. K, Feussner, I., and Keller, N. P. (2005c). Aspergillus  infection  inhibits the expression of  peanut 13S-HPODE-forming seed lipoxygenases. Mol Plant Microbe Interact. 18, 1081-9. Tsitsigiannis, D. I., Zarnowski, R., and Keller, N. P. (2004b). The lipid body protein, PpoA, coordinates sexual and asexual sporulation in Aspergillus  nidulans.  J Biol Chem. 279, 11344-53. Epub 2003 Dec 29. Valverde, M. E., and Paredes-Lopez, O. (1993). Production and evaluation of some food  properties of  huitlacoche (Ustilago  maydis).  Food Biotechnology (New York) 7,207-219. Vanegas, P. E., Valverde, M. E., Paredes-Lopez, O., and Pataky, J. K. (1995). Production of  the edible fungus  huitlacoche (Ustilago  maydis):  Effect  of  maize genotype on chemical composition. Journal of  Fermentation and Bioengineering 80, 104-106. Veenhuis, M., Mateblowski, M., Kunau, W. H., and Harder, W. (1987). Proliferation  of  microbodies in Saccharomyces  cerevisiae. Yeast. 3, 77-84. Voigt, C. A., Schafer,  W., and Salomon, S. (2005). A secreted lipase of  Fusarium graminearum  is a virulence factor  required for  infection  of  cereals. Plant J. 42, 364-75. Wang, Z. Y., Thornton, C. R., Kershaw, M. J., Debao, L., and Talbot, N. J. (2003). The glyoxylate cycle is required for  temporal regulation of  virulence by the plant pathogenic fungus  Magnaporthe  grisea. Mol Microbiol. 47, 1601-12. Watson, S. A. (2003). Description, development, structure and composition of  the corn kernel. In Corn: Chemistry and Technology, P. J. White and L. A. Johnson, eds. (St. Paul, MN: Amer Assoc of  Cereal Chemists.), pp. 69 - 101. Watson, S. A. (1987). Structure and composition. In Corn chemistry and technology, S. A. Watson and P. E. Ramsted, eds. (St. Paul, MN: Amer. Assoc. of  Cereal Chemists). Wenzler, H., and Meins, F. (1987). Persistent changes in the proliferative  capacity of  maize leaf  tissues induced by Ustilago  infection.  Physiol Mol Plant Pathol 30, 309-319. 4. HAD1 IS REQUIRED FOR TELIOSPORE GERMINATION AND MAY PLAY A ROLE IN EARLY STAGES OF IN  PLANTA FUNGAL DEVELOPMENT IN USTILAGO  MAYDIS 4.1. Introduction The phytopathogen Ustilago  maydis  is an excellent experimental organism to study plant-microbe interactions. Specifically,  the fungus  provides a genetically tractable system to investigate the relationship between metabolism and pathogenic development in a biotrophic fungus.  This is because the early stages of  fungal  development can be initiated in culture where two haploid yeast-like cells of  compatible mating type are able to exchange pheromone signals and mate to produce a dikaryotic filament  capable of infecting  host tissue (Banuett and Herskowitz, 1989; Bolker et al., 1995; Gillissen et al., 1992; Holliday, 1974; Kamper et al., 1995; Kronstad and Staben, 1997; Puhalla, 1969; Snetselaar et al., 1996). After  penetration, the fungus  is completely dependent on the host plant, maize (Zea mays), for  further  development and completion of  its life  cycle. Several morphological changes take place during fungal  development within host tissue that cannot be achieved in culture, with the main change being the formation  of  a filamentous  cell type that is capable of  sustained proliferation  (Banuett and Herskowitz, 1996) Snetselaar and Mims, 1992, 1994). Once inside a host, U.  maydis  induces tumor production, and the fungal  filaments  exhibit highly branched filamentous  growth and extensive proliferation  within the tumor tissue. Within the tumors, the fungus  literally replaces the contents of  plant cells with its own biomass. By the end of  the life  cycle, the filaments  differentiate  to produce diploid spores and the tumors are covered with only a thin layer of  plant cell walls. These features  of  morphogenesis and pathogenicity in U. maydis  are governed by well conserved signaling pathways including the cAMP/protein kinase A (PKA) pathway and the mitogen-activated protein kinase (MAPK) cascade (Andrews et al., 2000; Banuett and Herskowitz, 1994; Barrett et al., 1993; Durrenberger et al., 2001; Durrenberger et al., 1998; Gold et al., 1994; Gold et al., 1997; Hartmann et al., 1996; Mayorga and Gold, 1999). The nutrient rich environment of  host cells supports extensive proliferation  of  U. maydis  during the course of  an infection,  but the nutritional requirements of  the fungus  in planta  are still not understood. Previously, we reported that U.  maydis  can utilize lipids as a sole carbon source (Klose et al., 2004). Consistent with this observation, triglyceride lipase activity was detected in culture, and it was found  that a PKA mutant that is unable to respond to fatty  acids also exhibits less extracellular triglyceride lipase activity (Klose et al., 2004). Intriguingly, the P-oxidation pathway in peroxisomes of  U.  maydis  is required for  full  symptom development and therefore  contributes to the virulence of  the fungus  (Klose and Kronstad, 2006). Specifically,  a mutation in the gene mfe2  encoding the multifunctional  P-oxidation enzyme reduced in planta  proliferation  and tumor production leading to attenuated virulence. Furthermore, lipids in the form  of triglycerides or fatty  acids serve not only as carbon sources for  U.  maydis,  but also as signals to initiate yeast-to-filamentous  growth transition needed for  invading plant tissue (Klose et al., 2004). The breakdown of  fatty  acids is important in the metabolism, development, and pathogenicity of  fungi.  For example, Aspergillus  spp. were shown to utilize lipids as growth substrates (Kawasaki et al., 1995; Maggio-Hall and Keller, 2004; Mellon et al., 2002), and lipase activity was linked to virulence in Aspergillus  spp. and Fusarium gramineum (Voigt et al., 2005). Lipid catabolism occurs via the P-oxidation pathway in which fatty  acids are oxidized by a series of  enzyme steps releasing acetyl-CoA and an acyl-CoA shortened by two carbons, which can undergo additional cycles of  P-oxidation. In general, mammalian p-oxidation of  long-chain fatty  acids occurs predominantly in peroxisomes, while medium- and short-chain fatty  acids undergo p-oxidation in the mitochondria (reviewed in Eaton et al., 1996; Wanders et al., 2001). In contrast, in Saccharomyces  cerevisiae and other yeasts, fatty  acids are metabolized entirely in peroxisomes (reviewed in (Hiltunen et al., 2003). Recently Maggio-Hall and Keller (2004) presented evidence that the filamentous  fungus  A. nidulans  has both peroxisomal and mitochondrial p-oxidation systems. In mitochondria, typically four  individual reactions take place for  p-oxidation, each catalyzed by a separate enzyme. However, it has been shown that there is a second, long-chain P-oxidation pathway in the mitochondria of  mammals, where the second and third steps are catalyzed by a 'trifunctional  enzyme' (Uchida et al., 1992). In general, electrons removed during oxidation are passed to oxygen via the electron transport chain, yielding ATP (Frerman, 1988). In addition, mitochondrial P-oxidation disorders in humans have only been recognized relatively recently and these produce a diverse array of  clinical presentations, often  resulting in death (Coates and Tanaka, 1992; Wood, 1999). Mouse models for short-chain acyl-CoA dehydrogenase (SCAD) and 3-hydroxyacyl-CoA dehydrogenase (HAD) deficiencies  have been described (Guerra et al, 1998; O'Brien et al., 2000). In this study, I show that U.  maydis,  in contrast to S. cerevisiae, possesses mitochondrial p-oxidation, based on the prediction of  genes for  mitochondrial enzymes in the U.  maydis  genome and the characterization of  the mitochondrial 3-hydroxyacyl-CoA dehydrogenase (hadl).  Because of  the requirement for  peroxisomal P-oxidation in the virulence of  U.  maydis  (Klose and Kronstad, 2006), the mitochondrial P-oxidation gene hadl  was characterized to explore further  the importance of  the P-oxidation during developmental stages of  the fungus  in the plant host. It was found  that the mutation in hadl  gene that blocks mitochondrial P -oxidation resulted in severe attenuation of  disease symptoms in maize seedlings. Additionally, the ability of  teliospores, collected from  the mutant infection  of  the host plant, to germinate was impaired. The mutation in hadl  also resulted in an inability to grow on short-chain (SCFA) and medium-chain fatty  acids (MCFA) as expected. Fungal growth also was attenuated after  the addition of  arabinose into the fatty  acid medium even for  the wild-type strains, suggesting that these fatty  acids inhibited the growth of  U.  maydis.  Overall, this study has relevance for  understanding metabolic aspects of  the interactions between plants and fungal  pathogens. 4.2. Results The U.  maydis  genome possesses genes encoding putative mitochondrial P-oxidation enzymes It has been proposed that P-oxidation in yeast fungi,  such as S. cerevisiae, Yarrowia  lipolytica  and Candida  tropicalis  takes place exclusively in peroxisomes (Hiltunen et al., 1992; Kunau et al., 1995; Kurihara et al., 1992; Smith et al., 2000). Intriguingly, the analysis of  the genome sequence performed  as part of  this study revealed that U.  maydis  has candidate genes encoding the monofunctional  enzymes thought to be involved in the p-oxidation of  fatty  acids in mitochondria. These genes were predicted to be present based on a strong similarity to known proteins involved in mitochondrial P-oxidation in mammalian systems. Specifically,  there were five  genes (Um01466, Um10665, Um06185, Um01049 and Um00694) predicted to encode the acyl-CoA dehydrogenase known to catalyze the first  step in mitochondrial p-oxidation in mammalian systems. Interestingly, six genes (Um04973 and Um01433, Um02097, Um03071, Um02762 and Um03158) were predicted to encode the enoyl-CoA hydratase catalyzing the second reaction. One gene (Um01099) was predicted to encode 3-hydroxyacyl-CoA dehydrogenase (HAD), the enzyme catalyzing the third reaction, and three genes (Um03298, Um01843 and Um03571) were predicted to encode 3-ketoacyl-CoA thiolase, the enzyme catalyzing the last reaction of  mitochondrial p-oxidation. In addition, no homologs to the putative U.  maydis  mitochondrial p-oxidation enzymes were found  in a search of  the S.  cerevisiae genome. This agrees with previous findings  that P-oxidation occurs exclusively in the peroxisomes of  S. cerevisiae (Hiltunen et al., 1992). However, there were homologs found  in the filamentous  fungi  A. nidulans  and Neurospora  crassa. The predicted mitochondrial monofunctional  enzymes present in the genome suggest that U.  maydis  possesses both peroxisomal and mitochondrial P-oxidation. The gene (hadl)  predicted to encode 3-hydroxyacyl-CoA dehydrogenase in the genome was chosen for  subsequent study to investigate the importance of  the mitochondrial P-oxidation in morphogenesis and pathogenesis of  U.  maydis.  Choosing hadl  for  the study, the only gene predicted to encode HAD in the genome, avoided potential problems with redundancy that might occur with the multiple genes encoding other enzymes in the mitochondrial P-oxidation pathway. Originally, the amino acid sequence of  the human 3-hydroxyacyl-CoA dehydrogenase enzyme (Q16836) was used to identify  the hadl  gene in U.  maydis  genome (http://www.broad.mit.edu/annotation/genome/ustilago_maydis). The closest fungal homologue of  Hadl was a predicted protein in Cryptococcus  neoformans  (EAL19129, 54% identity and 71% similarity), and the closest homologues from  organisms other than fungi  were characterized proteins in C. elegans  (NP509584, 50% identity and 66% similarity) and human (Q16836, 53.3% identity and 66% similarity). Overall, the HAD proteins are highly conserved in their amino acid sequence throughout different  species (Figure 4.1). The hadl  gene of  U.  maydis  encodes a 344 amino acid (aa) protein comprised of  only one exon. In general, 3-hydroxyacyl-CoA dehydrogenase is an enzyme with a double-domain structure (Birktoft  et al., 1987). The amino-terminal domain (3HCDH_N; pfam  02737), which comprises approximately the first  200 residues (from  39 to 232 aa in the predicted U.  maydis  polypeptide sequence), is responsible for binding the NAD cofactor.  The carboxyl-terminal domain (3HCDH; pfam  00725) comprises the remaining 105 residues (from  234 to 338 aa in the predicted U.  maydis polypeptide sequence). Target IP was used to identify  a predicted signal peptide at the amino-terminus that could function  to localize the protein to the mitochondrion (Emanuelsson et al., 2000). 4.2.1. hadl  transcript levels are regulated by growth in fatty  acids To explore the role of  the hadl  gene in U.  maydis,  and its potential function  in fatty  acid metabolism, I examined hadl  transcript levels during growth of  the fungus  on various fatty  acids and glucose. The expression of  hadl  in fatty  acids was assessed using Northern analysis (Figure 4.2). Specifically,  transcription of  hadl  was induced by growth in short-chain caproic acid (C6) and medium-chain myristic acid (CI4) as expected. Interestingly, growth in long-chain oleic acid (CI8:1) or linoleic acid (CI8:2) also induced transcription of  hadl  at comparable levels to the transcription induced by caproic and myristic acid. These LCFA have also been shown to induce transcription of the multifunctional  enzyme (mfe2)  in peroxisomes (Klose and Kronstad, 2006). Thus, LCFA in U.  maydis  might be first  oxidized in peroxisomes to shorten the chains, and then transported to mitochondria for  further  processing to produce energy, as shown in mammalian systems. Furthermore, growth in all of  the fatty  acids tested resulted in higher hadl  transcript levels in the wild-type strain relative to the cells grown on glucose (Figure 4.2). Overall, these results indicate that hadl  transcription is regulated by fatty acids independent of  their carbon-chain length. J  J  V)  V)  J  J Stf  a a. a. o. o. u n « S » h A o. o. o. P. tn h o> o « S> B. 2 fc.  I <C << J J K >0,0, X 5 X X u o u CI I I X  I I M H W 0 O (3 O J B "" 3 8 § O M W as o S? J 1-5 J 6 ID ^ WEE >} ri >1 ~ ~ Go-FT rSrSJSft u !S X o • 3 fi 4J • 3 w c. o c. _>. o Q. •o ee S a I ee ec •_ o o J= "3 c - QJ O w 3 e _5o Is o u Z -cr o tZ3 I" 3 W) iZ Q m •w t/5 Sj Nj »5 ee | § i/ SX) 0 a w - 3 aj jC JS E— a1 •3 < O u c c o <U p cl -o <u 1-. to Q. O O C3 £ <U o -o c co in cy cr <u -a co <L> C/5 <D O co £ o o v© CI 00 vo o c 03 n-00 ^ On O ITi T3 j l> co <u c o -G H <N 00 rn CN < < -3-s <L> >> -O <u op To £ co en <L> CO o <u -o o '5 <D a. o co c« (L) £ N R— n 1= & § X § X § X hadl rRNA Figure 4.2 Transcript levels for  the hadl  gene in cells grown in fatty  acids that differ  in their chain length. Total RNA was isolated from  wild-type cells (strain 518; alhl)  grown in glucose or one of  the fatty  acids: caproic, myristic, oleic or linoleic, (A) The RNA blot hybridized with hadl  probe. (B) RNA blot stained with 0.04% methylene blue to reveal the rRNA bands and demonstrate equal loading of  the lanes. 4.2.2. Generation of  hadl  mutant strains To investigate the function  of  hadl,  a targeted gene deletion was performed  in which the complete coding region of  the hadl  gene (1035 nt) was replaced with a 1.8 kb nourseothricin gene cassette (Figure 4.3A, and Materials and Methods). The gene deletion construct was initially introduced into the a2b2 wild-type strain (518) of  U. maydis.  The nourseothricin-resistant transformants  were selected and analyzed by colony PCR (data not shown) and Southern blot (Figure 4.3B). The wild-type hadl  allele was present on a 4 kb Clal  Sacl  restriction enzyme fragment,  while the gene deletion was confirmed  by the presence of  a 5 kb Clal  Sacl  fragment.  The deletion of  hadl  in the albl  wild-type strain (521) of  the opposite mating type was generated by the sexual cross of  the albl  wild-type strain with the a2b2 hadl::naf  strain in corn seedlings. The haploid progeny from  the germinated diploid teliospores produced from  the cross were analyzed for  their mating types and for  deletion of  hadl.  The nourseothricin-resistant colonies were selected and first  analyzed by mating to identify  strains with the albl mating type and next by Southern blot (Figure 4.3B and data not shown). Overall, eight mutants in each mating type (albl  and a2b2) were collected from  total of  55 nourseothricin resistant colonies that were selected for  further  analysis. For the albl strain, the wild-type hadl  allele was present on a 8 kb Clal  Ndel  fragment  and the deletion was confirmed  by the presence of  a 2 kb Clal  Ndel  fragment  (Figure 4.3B). Two independent deletion mutants in the a2b2 strain and three mutants in the albl  mating-type strains from  the sexual cross were selected for  all subsequent phenotypic analyses. 4.2.3. Deletion of  hadl  eliminated growth on short-chain and medium-chain fatty  acids The hadl  gene was predicted to encode HAD enzyme activity that would be required for  growth on short-chain and medium chain fatty  acids. Therefore,  the strains deleted in hadl  were assessed for  their ability to grow in medium supplemented with short-chain (SCFA, caproic acid), medium-chain (MCFA, lauric and myristic acids) and also long-chain (LCFA; oleic acid) fatty  acids as a sole carbon source (Figure 4.4A). Clal left  arm right arm Sacl  Ndel left  arm probe Ndel nourseothricin right arm B Clal  Sacl a2b2 Clal  Ndel albl WT 28 3 4 - 1 1 WT 24 31 41 8 kb 5 kb 4 kb 2 kb Figure 4.3 Targeted gene deletion of  the U.  maydis  luull  gene. (A) Restriction map showing the orientation of  the hadl  locus and the structure of  the deletion construct. The ~1 kb coding region of  hadl  (red arrow) was replaced with a 1.8 kb nourseothricin resistance cassette (blue arrow) generated using overlap PCR (Davidson et al., 2002). The left  and right amis represent 5' and 3' flanking  regions surrounding the hadl  gene. (B) DNA blot analysis of  hadl:.  sai transformants.  Genomic DNA was prepared from  the wild-type strains albl  and a2b2 and the deletion strains (number 28 and 34 in a2b2, and 24,31 and 41 in albl)  in both genetic backgrounds. Strains were analyzed using Clal!Sacl  and ClaVNdel  restriction enzymes in the a2b2 and albl  strain backgrounds, respectively. The blot was hybridized with a 600 bp PCR-amplified probe whose position is indicated in (A). Homologous integration of  the deletion construct is indicated by the hybridization of  a 5 kb and 2kb fragment  in a2b2 and albl,  respectively, and the absence of  a signal for  4 kb (in albl)  and 8 kb (in albl)  wild-type fragments. As expected, the mutation in this gene resulted in an inability to grow on SCFA and MCFA. Specifically,  the mutant strains did not grow on caproic, lauric or myristic acid. The mutants also exhibited reduced growth on oleic acid but grew well on non-fatty acid carbon sources, such as glucose or arabinose (Figure 4.4B). Interestingly, caproic and lauric, but not myristic fatty  acids also limited the growth of  the wild-type strains, probably due to an inhibitory effect  on growth. To further  explore the possible inhibition of  growth by SCFA and MCFA, I measured the growth of  the wild-type and mutant strains in arabinose minimal medium supplemented with caproic, lauric or myristic acid (i.e., fatty  acids of  differing  chain length) (Figure 4.4B). While addition of  myristic acid into the arabinose medium supported additional growth of  the wild-type strain, the addition of  caproic or lauric acids attenuated the growth of  the wild-type strains, again indicating that these fatty  acids inhibited the growth of  U.  maydis.  The mutant strains were unable to grow on any of these fatty  acids even in the presence of  arabinose indicating that growth was completely inhibited. Caproic and lauric acids were previously found  to inhibit the growth of  A. nidulans  (Maggio-Hall and Keller, 2004). 4.2.4. Myristic acid does not induce filamentation  in hadl  mutants Previously, we showed that fatty  acids can serve as signaling molecules to trigger the dimorphic switch from  budding to filamentous  growth in U.  maydis  (Klose et al., 2004). To determine whether mitochondrial P-oxidation plays a role in this transition, the hadl  mutants were assessed for  their ability to respond morphologically to fatty  acids (Figure 4.5). The wild-type and mutant strains were grown in minimal medium supplemented with SCFA (caproic acid), MCFA (lauric or myristic acids) or LCFA (oleic acid) as a sole carbon source. In addition, non-fatty  acid carbon sources, such as glucose or arabinose, were also added to the minimal medium as a sole carbon source for  a control. As expected, both the wild-type and mutant strains exhibited budding growth in glucose or arabinose medium. Interestingly, while the hadl  mutants produced wild-type-like filaments  in LCFA (data not shown), they did not respond by filamentous  growth to SCFA or MSFA (Figure 4.5). 30 <D O tM O 20 a> £ P C 10 B o 60 50 X <D o 40 u- 30 caproate laurate myristate oleate j d 2 0 c 10 glc arb caproate laurate myristate + arb + arb +arb Figure 4.4 Cellular growth of  hadl  mutants on short and medium chain fatty  acids. (A) The total numbers of  the wild-type (a2h2,  black bars) and mutant (Ahadl  u2h2. white bars) cells is shown for  cultures supplemented with fatty  acids differing  in their carbon chain length: SCFA (caproate), MCFA (laurate and myristate) or LCFA (oleate) as a sole carbon source. (B) 11 maydis  growth inhibition by SCFA and MCFA. The total numbers are shown for  cells grown in glucose or arabinose as a sole carbon source, or the fatty  acids together with arabinose. The bars represent the average number of  cells from  thr ee independent experiments based on cell counts at day five. The lack of  a response on caproic, lauric or myristic acid may be due to the inability of  the hadl  mutants to grow on these fatty  acids. To ensure that the lack of  a response in these fatty  acids is a due to growth limitation, arabinose (i.e., representing a non-repressing sugar) was added into the medium containing fatty  acids. Interestingly, in the presence of arabinose, the mutants responded to caproic and lauric, but not myristic fatty  acid by growing as filaments  (Figure 4.5). Therefore,  the hadl  gene is not required for  the morphological transition in caproic and lauric acid, however it is required specifically  for the response to myristic acid. Interestingly, selective response to specific  fatty  acids depending on their chain length and saturation state was previously observed for  the mutants defective  in peroxisomal P-oxidation in U.  maydis  (Klose and Kronstad, 2006). 4.2.5. Intracellular lipid accumulation in hadl  mutants To explore whether mitochondrial P-oxidation would influence  the distribution of intracellular lipids, I compared the accumulation of  lipid bodies within cells of  the wild-type and the mutant strains grown on SCFA (caproic acid) and MCFA (myristic acid) as a sole carbon source. The accumulation of  internal lipids in lipid bodies was determined by staining the cells with Nile red (Figure 4.6). Large numbers of  lipid bodies accumulated in wild-type cells grown on both caproic and myristic acids. The lipid bodies were visible throughout the entire cells and varied in size depending on the fatty acid chain length. Particularly, cells grown on caproic acid produced large lipid bodies and cells on myristic acid produced small bodies. In contrast, the mutant strains produced very few  small lipid bodies when grown on caproic acid. Interestingly, only a diffused  fluorescence  and no accumulation of  lipid bodies was detected in the mutants grown on myristic acid, which correlates with their inability to respond to this fatty  acid. 4.2.6. Deletion of  hadl  does not impair mating ability in U.  maydis To determine the effect  of  the hadl  deletion on mating, hadl  mutants were co-spotted with either compatible wild-type strains (albl  and a2b2) or compatible mutant strains (A hadl  albl  and A hadl  a2b2) on charcoal-containing mating medium. glucose arabinose caproate caproate + arabinose laurate laurate + arabinose myristate myristate + arabinose Figure 4.5 Fatty acid-induced filamentation  in hadl  mutant strains. Cellular morphology is shown for  the wild-type (ci2b2)  and mutant (Ahadl  a2h2) strains in response to glucose, arabinose and SCFA (caproate) and MCFA (laurate and myristate) with or without arabinose. The cells were visualized by differential  interference  contrast optics (DIC, left)  and by epifluorescence  after  staining cell walls with calcofluor  (right). Scale bar = 10 pni. caproate myristate a2b2 \ A hadl a2b2 Figure 4.6 Intracel lular lipid accumulat ion in hadl  mu tan t strains. U.  maydis  wild-type (a2h2) and mutant (Ahadl  a2b2) strains grown on SCFA (caproate) or MCFA (myristate) as a sole carbon source. The internal lipids accumulated in lipid bodies were stained using the lipid-specific  fluorescent  dye Nile red and visualized using epifluorescence.  The fungal  cells produced large (arrowhead) to small (arrow) lipid bodies that varied in number depending on carbon source. Scale bar = 10 (.tm. Mating filaments,  visible as white aerial hyphae growing on the agar surface, were produced when the mutants were co-spotted with the wild-type cells, indicating a positive mating reaction (data not shown). These mating reactions were comparable to those observed when compatible wild-type strains were mated. The hadl  mutants were also able to produce aerial hyphae when co-spotted with compatible hadl  mutant strain, indicating that hadl  was not required for  mating. The morphology of  filaments  produced during the mating reaction of  compatible hadl  mutants was also assessed to investigate whether hadl  influences  morphogenesis during the early stages of  dikaryon production. The aerial hyphae were scrapped off  the surface  of  the mating plates and analyzed microscopically. No differences  in the morphology of  the cells from  the compatible mutant mating reaction were observed when compared to the cells from  the compatible wild-type mating reaction (data not shown). In both cases, the cells were found  in different  stages known to take places during mating reaction of  U.  maydis.  Particularly, the filamentous  dikaryon, conjugation tubes and some budding cells were observed. Overall, these results show that Hadl was not required for  cell fusion  and production of  initial dikaryotic filaments  capable of  infecting plant tissue. 4.2.7. hadl  mutants have reduced virulence in maize seedlings Typical disease symptoms in a plant inoculated with U.  maydis  begin with chlorosis and anthocyanin pigment production followed  by tumor production. To assess the role of  hadl  in pathogenicity, the hadl  mutants were inoculated in combination with compatible wild-type strains (e.g., Ahadl  albl  X a2b2 and albl  X Ahadl  a2b2) or as mixtures of  compatible hadl  mutant strains {Ahadl  albl  X Ahadl  a2b2) into maize seedlings (Table 4.1). Given the positive mating ability of  the hadl  mutants, I expected the mutants to cause disease on maize seedlings. However, I observed that the deletion of  hadl  resulted in reduced virulence. Specifically,  the hadl  mutants were still able to infect  the seedlings and induce tumors, but the size of  tumors and the frequency  of  tumor production were reduced. For example, only approximately 20% of  the mutant-inoculated plants developed tumors compared to 90% of  the plants that developed tumors when inoculated with wild-type strains. (Table 4.1) Strikingly, a dramatic reduction in the incidence of  death in the plants infected  with the mutants was also observed when compared to the wild-type infections.  In parallel with the reduction in plant death, the number of  plants with no symptoms also increased. Interestingly, in many cases plants exhibited only chlorosis, and no further  symptoms such as the anthocyanin pigmentation that takes place prior to tumor production were observed. While the hadl  mutants were still able to cause full  range of  the disease symptoms, the decrease in tumor induction and the incidence of  plant death is intriguing. Furthermore, the deletion in hadl  resulted in reduced virulence even when the hadl  mutants were inoculated with compatible wild-type strains (A hadl  albl  X a2b2 and albl  X A hadl  a2b2). In these cases, approximately 60% of  the plants produced tumors, which reflects  a 30% reduction in tumor incidence when compared to the wild-type inoculations. This suggests that the deletion of  only one allele is enough to cause the virulence defect  (haploinsufficiency) and that both alleles are necessary for  full  activity of  the hadl  gene product during fungal development in planta.  These findings  provide evidence that mitochondrial P-oxidation may be crucial during specific  stages of  in planta  fungal  development for  U.  maydis. 4.2.8. Hadl is required for  teliospore germination The ability of  a teliospore to undergo germination is crucial for  U.  maydis  to initiate an infection  and begin sexual development. The germination of  the diploid spore gives rise to haploid sporidia, that are able to recognize a mating partner upon the exchange of  pheromone signals, and to produce conjugation tubes. The conjugation tubes eventually fuse  to produce the infectious  dikaryon able to penetrate plant tissue and thus initiate plant infection.  Thus, no infection  can take place without germination of teliospores. Therefore,  I investigated whether the deletion of  hadl  affects  spore germination. Teliospores were collected from  tumors developed on infected  maize seedlings and were incubated to allow germination. The germination of  teliospores was determined microscopically after  16 hrs and 24 hrs of  incubation. To evaluate the ability of  teliospore to germinate, the whole area of  a microscope slide containing agar with incubated teliospores collected from  the mutant tumors was examined in three separate occasions for  each experiment. Germination of  teliospores from  the wild-type cross (i.e., wild-type tumors) was observed after  16 hrs of  incubation, but only a small number of  the teliospores had started germinating (Figure 4.7). Furthermore, mature melanized teliospores were isolated in large numbers from  the wild-type tumors. In contrast, teliospores collected from  plants inoculated with the hadl  mutants (i.e., mutant tumors) did not germinate even after  24 hrs of  incubation (Figure 4.7). The teliospores were incubated for  additional 24 hr to confirm  that the germination was not just delayed. Even after  48 hr, there was no germination observed in the hadl  mutant teliospores (data not shown). 300 teliospores were counted to assess the germintation from  each cross in three independent samples. The cross sections of  tumors from  maize seedlings infected  with hadl  mutants indicated reduced number of  mature teliospores (data not shown). There were relatively few  mature teliospores isolated from  the tumors from  the mutant infections  and most of  the teliospores were still not fully  developed at the time of  harvest. These results suggest that the mitochondrial P-oxidation function  is required for successful  teliospore germination. However, more experiments are underway to precisely quantify  the germination ability of  teliospores produced from  the hadl  mutant infections. 4.3. Discussion In this study I show, based on the genome sequence analysis, that U.  maydis possesses a mitochondrial P-oxidation system, and I characterized the hadl  gene that is predicted to encode a mitochondrial 3-hydroxyacyl-CoA hydratase. As expected, hadl  was required for  growth on short-chain and medium-chain fatty  acids, and hadl  transcript levels were regulated by fatty  acids, hadl  was required specifically  for  myristic acid-induced filamentation  and accumulation of  lipid bodies during growth on this fatty  acid. For pathogenicity, hadl  was not required for  the initial production of  the infectious  dikaryon during mating, but was required for  disease symptom development in maize seedlings and germination of  teliospores. Specifically,  deletion of  hadl  results in a dramatic reduction in the incidence of  death in plants and an increase in plants with no symptoms. 16 hrs 24 hrs 16 hrs 24 hrs a2b2 Ahadl  a2b2 Figure 4.7 Hadl is required for  teliospore germination. Teliospores were harvested 14 days after  inoculation of  maize seedlings with the wild-type (albl  X albl)  and mutant (Ahadl  albl  X Abaci/  albl)  crosses. A germinating teliospore (i.e., black with thick outer layer that does not stain with calcofluor)  is shown from the wild-type cross. The spore has an extended promycelium from  which haploid progeny are generated (i.e., stained with calcofluor)  after  16- and 24-hr incubation period. A teliospore from  the mutant cross did not germinate even after  24 hrs of  incubation. The cells were visualized by differential  interference  contrast optics (DIC, top panel) and by epifluorescence  after  staining cell walls with calcofluor  (bottom panel). Scale bar = 10 jam These findings  provide evidence that the mitochondrial P-oxidation may be crucial during teliospore germination and important during initial stages of  in planta fungal  development in U.  maydis. It has been proposed that fungal  P-oxidation takes place solely in peroxisomes because all P-oxidation activities are carried out in peroxisomes in S. cerevisiae and other yeasts such as C. tropicalis  and Y.  lipolytica  (reviewed in Trotter, 2001). However, genome analysis revealed that U.  maydis  has candidate genes encoding enzymes of  both peroxisomal and mitochondrial P-oxidation. For the mitochondrial system, there appear to be multiple genes encoding monofunctional  acyl-CoA dehydrogenases, enoyl-CoA hydratases and thiolases (catalyzing the first,  second and fourth  reactions, respectively), and only one copy of  the 3-hydroxyacyl-CoA dehydrogenase (Hadl). Based on genetic analysis, the Hadl enzyme appears to be capable of  oxidizing short- and medium-chain fatty  acids. While deletion of  hadl  resulted in a restricted growth on long-chain fatty acids (oleic acid, CI 8), the capacity of  this pathway to actually degrade substrates as long as oleic acid remains to be determined. Some 3-hydroxyacyl-CoA dehydrogenases in mammals are active on a wide range of  fatty  acids (short- to long-chain) (Fong and Schulz, 1977; Liang et al., 2001). Baltazar et al. (1999) suspected the presence of  P-oxidation in mitochondrion in A. niger. However, it has only just recently been demonstrated that A. nidulans  is capable of  both peroxisomal and mitochondrial P-oxidation (Maggio-Hall and Keller, 2004). Previously, I described the construction and analysis of  mutants defective  in the peroxisomal P-oxidation multifunctional  enzyme Mfe2  in U.  maydis  (Klose and Kronstad, 2006; and Chapter 3 in this thesis). Taken together, the phenotypes of  the mitochondrial and peroxisomal P-oxidation pathway mutants in U.  maydis  grown on fatty acids of  differing  chain lengths suggest that both pathways work together to accomplish full  growth on these carbon sources. While the function  of  the Mfe2-dependent  pathway appears essential only for  very long-chain fatty  acids (Klose and Kronstad, 2006) and the Hadl-dependent pathway appears to be necessary for  short- and medium-chain fatty acids, both pathways seem to play a role in catabolism of  long- chain fatty  acids. Peroxisomal P-oxidation in mammals functions  primarily to shorten very long fatty  acids (C22 or higher) and a variety of  branched-chain fatty  acids encountered in the diet (reviewed in Wanders et al., 2001), and little activity is exhibited toward short-chain acyl-CoAs in vitro (Vanhove et al., 1993) In addition, medium length acyl-CoAs are transported from  the peroxisome to the mitochondrion (reviewed in Ramsay, 2000). Such cooperative functions  of  p-oxidation systems leading to the ability to metabolize a range of  different  fatty  acids may also exist in U.  maydis.  In conclusion, based on the predicted genes for  mitochondrial enzymes in the U.  maydis  genome and the evidence that the mitochondrial P-oxidation exists in other fungi,  as demonstrated recently in A. nidulans  (Maggio-Hall and Keller, 2004), I propose that U.  maydis  contains both peroxisomal and mitochondrial P-oxidation. Deletion of  the hadl  gene revealed the importance of  mitochondrial P-oxidation in pathogenicity of  U.  maydis.  The hadl  gene was required for  full  symptom development in planta  and germination of  teliospores in vitro. The first  stage of  the life  cycle of  a phytopathogenie fungus  is generally the germination of  a spore and the development of structures required for  host penetration. Because of  the paucity of  external nutrient sources on the plant surface,  fungi  must rely on endogenous storage compounds as a source of energy. Deletion of  hadl  completely abolished teliospore germination and pathogenicity tests showed that the number of  plants that developed disease symptoms was significantly decreased. The lack of  symptom development could indicate a defect  early during the penetration stage. In U.  maydis,  the appressoria-like structures (i.e., swellings at the tip of the infectious  dikaryon) penetrate through the plant surface  and a functional  interface between the fungus  and the host is established (Snetselaar and Mims, 1993, 1994). It has been proposed that lipid catabolism is critical during early stages of  fungal  development (reviewed in Solomon et al., 2003). Some of  the evidence comes from  genomic studies in Blumeria graminis showing that lipid catabolism persists throughout the germination and penetration phases. It has also been shown that glyoxylate cycle in T.  yalundae  and M. grisea, and peroxisome biogenesis in Colletotrichum  lagenarium,  are important during the penetration phase (Bowyer et al., 2000; Kimura et al., 2001; Wang et al., 2003). Both of these processes probably involve peroxisomal P-oxidation of  fatty  acids. Interestingly, our studies on peroxisomal P-oxidation in U.  maydis  suggest that this pathway is important during later phases of  fungal  development, such as in planta  proliferation  and teliospore differentiation  (Klose and Kronstad, 2006). Based on this study mitochondrial P-oxidation function  seems to be important during the early infectious  phases, which involve germination and perhaps penetration of  host tissue. This would allow U.  maydis  to metabolize alternative carbon sources such as fungal  storage lipids for  germination, and to utilize fungal  storage lipids for  infection-related  morphological development (penetration). During plant infection  with hadl  mutants, the size of  tumors and the rate of  tumor production were reduced, and many plants exhibited only chlorosis and no further symptom development. The reduction in symptom development could indicate a defect in the early events of  penetration, but also in the establishment of  infection  such that less severe symptoms developed. Many biotrophic fungi  develop specialized feeding structures (haustoria) used for  the uptake of  nutrients and, potentially, signal exchange during infection  (Birch et al., 2006; Mendgen and Hahn, 2002). U.  maydis  lacks such structures, but a prolonged interaction zone is established during the initial intracellular growth of  infecting  hyphae (Snetselaar and Mims, 1992, 1994). During this time, the translocation of  various compounds into the host may take place that may be necessary to initiate and/or establish prolonged filamentous  growth within plant tissue. Therefore,  it is possible that U.  maydis  must rely on stored intracellular lipids (i.e., lipid catabolism) to produce such compounds and to provide basic metabolic needs at least during the initial phase of  growth in the plant. In addition, cross sections of  tumors from  maize seedlings infected  with hadl  mutants indicated reduced number of  mature teliospores, suggesting that Hadl may play a role during teliospore differentiation.  However, because of  the decreased number of  plants that developed symptoms during infections,  the low number of  mature teliospores may just reflect  the defect  of  the hadl  mutants during the early stages of  infection,  thus influencing  the subsequent stages of  fungal  development. In addition, Hadl was not required for  cell fusion  and production of  initial dikaryotic filament  capable of  infecting  plant tissue. Thus the mutants may have a specific  defect during the early stages of  growth in planta. It is intriguing that hadl  mutant infections  resulted in a dramatic decrease in the incidence of  plant death. The reduction in plant death could indicate that host defense reactions may be successful  in limiting the fungal  growth of  hadl  mutants, perhaps due to less vigorous growth during infection.  Alternatively, an enhanced defense  response could occur upon infection  by hadl  mutants because of  the altered chemical environment caused by the metabolic defect  in the pathogen. Similar phenotypes were also observed during infections  by mfe2  mutants defective  in peroxisomal p-oxidation (Klose and Kronstad, 2006). It is possible that Hadl may play a role in allowing U.  maydis  to bypass or suppress plant defense  reactions or reprogram the metabolism of  the host to allocate resources to the fungus  during the initial stages of  infections.  Recently, Basse (2005) has demonstrated that U.  maydis  is capable of  suppressing a defense  response in maize based on the observation that a weakly proliferative  mutant triggered expression of  the pathogenesis related gene PR-1. In summary, this study addressed the role of  the mitochondrial p-oxidation of fatty  acids in plant-fungal  interactions to contribute to our understanding of  the role that lipid metabolism may play in the virulence of  phytopathogenic fungi.  Mitochondrial P-oxidation appears to be crucial during teliospore germination, penetration and initial stages of  in planta  fungal  development in U.  maydis.  Additional experiments, such as the generation of  double mutants deleted in both mitochondrial and peroxisomal P-oxidation will be helpful  to further  understand the importance of  P-oxidation in virulence of  U. maydis. 4.4. Material and Methods 4.4.1. Growth conditions Fungal strains were grown in potato dextrose broth (PDB), potato dextrose agar (PDA), or on complete medium agar (CM) as described previously (Holliday, 1974). To characterize the morphological response and to quantitate growth in fatty  acids, 1X106 ml/1 of  PDB -grown overnight cells were washed once with sterile water and added to 5 mL of  minimal medium (MM; Holliday, 1974) supplemented with glucose, caproic, lauric, myristic or oleic acid (Sigma) as a sole carbon source (all added to a concentration of  1%). The cells were grown at 30°C for  5 days with shaking at 250 rpm. The extent of growth was determined by cell counts with a hemacytometer. Transformants  were initially grown on double complete medium (DCM) with 1 M sorbitol and then streaked onto CM agar containing 100 (ig mL"1 nourseothricin (Werner Bio Agents) for  antibiotic selection. Escherichia coli strain DH10B (Bethesda Research Laboratories) was used for transformation  by electroporation and was grown as previously described (Sambrook et al., 1989). 4.4.2. Strains, deletion constructs and transformation  procedures The DNA sequence of  the hadl  gene (Um01099) was originally obtained from the U.  maydis  genomic sequence that was completed at the Broad Institute (http://www.broad.mit.edu/annotation/fungi/ustilago_maydis/ ). Recently, the Munich Institute for  Protein Sequences (MIPS) completed a U.  maydis  genome annotation project and the annotated version of  the hadl  gene can now be found  at http://mips.gsf.de/genre/proj/ustilago/ . The Ahadl::sat r deletion construct was generated using a PCR overlap strategy (Davidson et al., 2002) and was designed to include 0.6 kb of genomic sequence of  the 5' upstream sequence (left  arm) and 1 kb of  the 3' downstream (right arm) sequence from  the hadl  gene surrounding a nourseothricin selectable marker (satl;  Gold, Gold et al., 1994) to ensure a complete deletion of  the coding region. The left arm and right arms were amplified  using primers Hadl PI (5'-CTGCTTGTGCGCTTGACATT-3') and HadlP2 (5'-AACTGTGCTTCAATCGCTGCCCAGCGTCCAATGATTGTGA'-3') and primers HadlP5 (5' -TTGC AGAACTCGCTGGT AGTCGCTATCCTTCTGATCGTCT-3') and HadlP6 (5'-GGTGTTGGAGTGCAGGTAAT-3'), respectively. The 1.8 kb nourseothricin resistance marker was amplified  from  the plasmid pSatll2 using primers HadlP3 (5'-TCACAATCATTGGACGCTGGGCAGCGATTGAAGCACAGTT-3') and HadlP4 (5'-AGACGATCAGAAGGATAGCGACTACCAGCGAGTTCTGCA-3'). The three fragments  were combined by an overlapping PCR reaction using nested primers HadlPl" (5' -CTGCTTGTGCGCTTGAC ATT-3') and HadlP6n (5'-GGAGTGCAGGTAATCACGAA-3'). The 3.4 kb overlap PCR product generated the Ahadl:\saf  construct, which was cloned into pCR2.1 (Invitrogen) generating pCRHadl. The pCRHadl plasmid containing the deletion construct was transformed  into E. coli strain DH10B (Bethesda Research Laboratories). The deletion strains a2b2 Ahadl  v.saf  and albl  Ahadlv.saf  were generated by biolistic transformation  (Toffaletti  et al., 1993) of  strain 518 (mating type a2b2; (Holliday, 1961) and by a sexual cross with strain 521 (albl)  (Holliday, 1961). For the sexual cross, teliospores harvested from  maize seedlings inoculated with the cross of  the albl  X a2b2 strains were extracted from  tumor tissue and 200 p,L of  the teliospore extract was streaked on PDA and incubated at 30°C for  24 hrs. To select for  A hadl  v.saf deletion strains, the haploid progeny were grown on CM agar containing nourseothricin. To determine mating type of  the A hadl  v.saf  progeny, the strains were tested for  their ability to mate with albl  and a2b2 strains. Transformants  and deletion strains from  the sexual cross were screened by colony PCR using a U.  maydis-specific  primer Hadl PI outside the construct (5'- CTGCTTGTGCGCTTGACATT -3') and a satl-specific  primer PSatT (5'-GCTTCCGAAGATGGCTCTGT-3'). Gene deletion was also confirmed  by Southern blot analysis. Two independent deletion mutants in the a2b2 strain and three mutants in the albl  mating-type strains from  the sexual cross were selected for  all subsequent phenotypic analyses to confirm  that the deleted gene is responsible for  the observed phenotypes. Representative data from  analyses of  all of  the deletion strains is shown in the results section of  this chapter. Gel electrophoresis, restriction enzyme digestion and DNA blot hybridization were performed  using standard procedures (Sambrook et al., 1989). 4.4.3. RNA isolation and northern analysis Fungal cells were grown overnight in 5 mL MM supplemented with glucose (1%) and transferred  to MM supplemented with either glucose, caproic, myristic, oleic or linoleic acid (all added to 1%) and grown at 30°C at 250 rpm for  6 hrs. RNA was isolated as described previously (Schmitt et al., 1990). PCR was used to amplify  a 455 bp DNA fragment  spanning from  109 bp to 564 bp in the exon of  the hadl  gene as a hybridization probe using primers HadlFw (5'-CAGAACAAGGACGTGCAGAA-3') and HadlRv (5' -GTGGAAGCCTCCGAATAGTTs-3'). The probe was labeled with 3 2P by random priming (ReadiPrime™ II Oligolabeling kit, Amersham Pharmacia Biotech). Standard procedures were followed  for  RNA blot preparation and hybridization (Sambrook et al., 1989). 4.4.4. Sequence analysis Gene prediction, protein alignments and sequence analysis were done using the programs BLAST (Altschul et al., 1997), CLUSTAL W (Thompson et al., 1994), Pfam (Bateman et al., 2002), SignalP s3.0 (Bendtsen et al., 2004) and TargetP 1.1 (Emanuelsson et al., 2000). 4.4.5. Mating and pathogenicity assays Fungal cells were spotted on double complete medium with 1% activated charcoal (DCM-C) for  mating tests (Day and Anagnostakis, 1971; Holliday, 1974). Strains were tested for  the production of  aerial hyphae during mating reactions as previously described (Day and Anagnostakis, 1971). For U.  maydis  pathogenicity assays, 7-day old maize seedlings were inoculated, and disease symptoms were evaluated as described (Kronstad and Leong, 1989). The pathogenicity tests were performed  using the following  strain combinations: 521 (albl)  X 518 (a2b2),  521 (albl)  X a2b2 Ahadwsatf,  518 (a2b2)  X albl  A hadwsatf  and albl  A hadv.satf  X a2b2 A had::satl r, where two independent hadl  mutants in a2b2 background (28-land 34-1) and three hadl  mutants in albl background (24-2, 31-2 and 41-2; generated from  the sexual cross) were used to inoculate the seedlings. Approximately 100 plants for  each combination of  strains were scored for disease symptoms in three independent experiments. 4.4.6. Teliospore isolation and germination Teliospores were isolated from  tumors collected from  inoculated maize seedlings 14 days post inoculation. Tumors were first  sterilized in 10% bleach for  30 seconds and washed twice in sterile dH20. Sterilized tumors were ground in 20ml of  1.5% CuS04.5H20 using sterile mortar and pestle. Ground tumor tissue (containing teliospores) was filtered  through cheesecloth and incubated overnight at room temperature. Teliospore suspensions were centrifuged  and washed twice in sterile dH20, and 200p.l of  the suspension was spread on PDA plates (containing a microscope slide) and incubated at 30°C for  approximately 16 to 24 hrs. The microscope slide was cut out from  the agar and l(il of  a 20 |ag mL"1 solution of  fluorescent  brightener 28 Calcofluor White (F3543, Sigma) diluted in 5|il of  sterile dH20 was placed directly on a coverslip prior to observations. Germination of  teliospores was observed at two time points, at 16 and 24 hrs. Teliospores were isolated from  two independent experiments and germination was observed in three separate experiments. 4.4.7. Microscopic analysis Cell walls were visualized by staining with lp,l fluorescent  brightener 28 Calcofluor  White (20 |ag mL"1; F3543, Sigma) added directly to 5pl of  cell culture on a microscope slide. To observe the production of  mating filaments,  filaments  were scraped off  of  mating medium and resuspended in sdH20 plus 1 (iL of  a 20 jag mL"1 fluorescent brightener 28 Calcofluor  White (F3543, Sigma). Lipid bodies within yeast-like and filamentous  cells grown in fatty  acids were visualized by staining with a Nile Red solution (O.lmg mL"1 in 100% acetone) (N3013; Sigma) by adding 1 jaL directly to 5pl cell culture on a microscope slide followed  by observation using a FITC filter  (excitation at 450-490 nm). Cells were observed using a Zeiss Axioplan 2 fluorescence  microscope with differential  interference  contrast (DIC) optics or UV fluorescence  to observe cells stained with Calcofluor.  Images were captured with a DVC camera and processed with Northern Eclipse imaging software  and Adobe Photoshop 7. 4.4.8. Accession Numbers Sequence data from  this chapter can be found  in the EMBL Nucleotide Sequence Submission (EMBL), http://www.ebi.ac.uk, and GenBank, National Center for Biotechnology Information  (GenBank), http: //www.ncbi.nlm.nih.gov, data libraries under accession number XP757246. U.  maydis  gene numbers described above refer  to the MIPS database. 4.5. Tables Table 4.1 Pathogenicity of  hadl  mutants" Cross or strain No. of  plants producing anthocyanin No. of  plants with tumors Total no. of plants infected % of  plants with tumors Disease score* albl  X  a2b2 12 103 115 90 3.9 albl X  Ahadl  a2b2 # 34 44 64 108 59 2.7 Ahadl  albl  # 24 Xa2b2 37 55 92 60 2.7 Ahadl  albl  # 31 Xa2b2 46 70 116 60 2.6 Ahadl  albl  # 41 Xa2b2 44 60 104 58 2.5 Ahadl  albl  # 24 69 18 87 21 1.6 X  Ahadl  a2b2 # 34 Ahadl  albl  # 31 89 24 113 21 1.3 X  Ahadl  a2b2 # 34 Ahadl  albl  # 41 X  Ahadl  a2b2 # 34 87 22 109 20 1.5 0 Table shows combined data from  three independent experiments. The pattern of  the disease symptom development shown in the table is representative of  a pattern observed in each independent experiment. b The disease score is calculated as the sum of  disease symptoms ratings divided by the total number of  infected  plants scored for  symptoms. 4.6. References Altschul, S. F., Madden, T. L., Schaffer,  A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of  protein database search programs. Nucleic Acids Res. 25, 3389-402. Andrews, D. L., Egan, J. D., Mayorga, M. E., and Gold, S. E. (2000). The Ustilago  maydis  ubc4 and ubc5 genes encode members of  a MAP kinase cascade required for  filamentous  growth. Mol Plant Microbe Interact. 13, 781-6. Baltazar, M. F., Dickinson, F. M., and Ratledge, C. (1999). Oxidation of  medium-chain acyl-CoA esters by extracts of  Aspergillus  niger: enzymology and characterization of  intermediates by HPLC. Microbiology. 145, 271-8. Banuett, F., and Herskowitz, I. (1989). Different  a alleles are necessary for maintenance of  filamentous  growth but not for  meiosis. Proc Natl Acad Sci U S A 86, 5878-5882. Banuett, F., and Herskowitz, I. (1996). Discrete developmental stages during teliospore formation  in the corn smut fungus,  Ustilago  maydis.  Development. 122, 2965-76. Banuett, F., and Herskowitz, I. (1994). Identification  of  fuz7,  a Ustilago  maydis MEK/MAPKK homolog required for  a-locus-dependent and -independent steps in the fungal  life  cycle. Genes Dev. 8, 1367-78. Barrett, K. J., Gold, S. E., and Kronstad, J. W. (1993). Identification  and complementation of  a mutation to constitutive filamentous  growth in Ustilago  maydis. Mol Plant Microbe Interact. 6, 274-83. Basse, C. W. (2005). Dissecting defense-related  and developmental transcriptional responses of  maize during Ustilago  maydis  infection  and subsequent tumor formation.  Plant Physiol. 138, 1774-84. Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S. R., Griffiths-Jones,  S., Howe, K. L., Marshall, M., and Sonnhammer, E. L. (2002). The Pfam protein families  database. Nucleic Acids Res. 30, 276-80. Bendtsen, J. D., Nielsen, H., von Heijne, G., and Brunak, S. (2004). Improved prediction of  signal peptides: SignalP 3.0. J Mol Biol. 340, 783-95. Birch, P. R., Rehmany, A. P., Pritchard, L., Kamoun, S., and Beynon, J. L. (2006). Trafficking  arms: oomycete effectors  enter host plant cells. Trends Microbiol. 14, 8-11. Epub 2005 Dec 13. Birktoft,  J. J., Holden, H. M., Hamlin, R., Xuong, N. H., and Banaszak, L. J. (1987). Structure of  L-3-hydroxyacyl-coenzyme A dehydrogenase: preliminary chain tracing at 2.8-A resolution. Proc Natl Acad Sci U S A . 84, 8262-6. Bolker, M., Bohnert, H. U., Braun, K. H., Gorl, J., and Kahmann, R. (1995). Tagging pathogenicity genes in Ustilago  maydis  by restriction enzyme- mediated integration (REMI). Mol Gen Genet 248, 547-52. Bowyer, P., Mueller, E., and Lucas, J. (2000). Use of  an isocitrate lyase promoter-GFP fusion  to monitor carbon metabolism of  the plant pathogen Tapesia  yallundae during infection  of  wheat. Molecular Plant Pathology 1, 253-262. Coates, P. M., and Tanaka, K. (1992). Molecular basis of  mitochondrial fatty  acid oxidation defects.  J Lipid Res. 33, 1099-110. Davidson, R. C., Blankenship, J. R., Kraus, P. R., de Jesus Berrios, M., Hull, C. M., D'Souza, C., Wang, P., and Heitman, J. (2002). A PCR-based strategy to generate integrative targeting alleles with large regions of  homology. Microbiology. 148, 2607-15. Day, P. R., and Anagnostakis, S. L. (1971). Corn smut dikaryon in culture. Nat New Biol 231, 19-20. Durrenberger, F., Laidlaw, R. D., and Kronstad, J. W. (2001). The hgll  gene is required for  dimorphism and teliospore formation  in the fungal  pathogen Ustilago maydis.  Mol Microbiol. 41, 337-48. Durrenberger, F., Wong, K., and Kronstad, J. W. (1998). Identification  of  a cAMP-dependent protein kinase catalytic subunit required for  virulence and morphogenesis in Ustilago  maydis.  Proc Natl Acad Sci U S A . 95, 5684-9. Eaton, S., Bartlett, K., and Pourfarzam,  M. (1996). Mammalian mitochondrial beta-oxidation. Biochem J 320, 345-357. Emanuelsson, O., Nielsen, H., Brunak, S., and von Heijne, G. (2000). Predicting subcellular localization of  proteins based on their N-terminal amino acid sequence. J Mol Biol. 300, 1005-16. Fong, J. C., and Schulz, H. (1977). Purification  and properties of  pig heart crotonase and the'presence of  short chain and long chain enoyl coenzyme A hydratases in pig and guinea pig tissues. J Biol Chem. 252, 542-7. Gillissen, B., Bergemann, J., Sandmann, C., Schroeer, B., Bolker, M., and Kahmann, R. (1992). A two-component regulatory system for  self/non-self  recognition in Ustilago  maydis.  Cell 68, 647-57. Gold, S., Duncan, G., Barrett, K., and Kronstad, J. (1994). cAMP regulates morphogenesis in the fungal  pathogen Ustilago  maydis.  Genes Dev. 8, 2805-16. Gold, S. E., Brogdon, S. M., Mayorga, M. E., and Kronstad, J. W. (1997). The Ustilago  maydis  regulatory subunit of  a cAMP-dependent protein kinase is required for gall formation  in maize. Plant Cell. 9, 1585-94. Guerra, C., Koza, R. A., Walsh, K, Kurtz, D. M., Wood, P. A., and Kozak, L. P. (1998). Abnormal nonshivering thermogenesis in mice with inherited defects  of  fatty  acid oxidation. J Clin Invest. 102, 1724-31. Hartmann, H. A., Kahmann, R., and Bolker, M. (1996). The pheromone response factor  coordinates filamentous  growth and pathogenicity in Ustilago  maydis.  EMBO J. 15, 1632-41. Hiltunen, J. K, Mursula, A. M., Rottensteiner, H., Wierenga, R. K, Kastaniotis, A. J., and Gurvitz, A. (2003). The biochemistry of  peroxisomal beta-oxidation in the yeast Saccharomyces  cerevisiae. FEMS Microbiol Rev. 27, 35-64. Hiltunen, J. K, Wenzel, B., Beyer, A., Erdmann, R., Fossa, A., and Kunau, W. H. (1992). Peroxisomal multifunctional  beta-oxidation protein of  Saccharomyces  cerevisiae. Molecular analysis of  the fox2  gene and gene product. J Biol Chem. 267,  6646-53. Holliday, R. (1961). The genetics of  Ustilago  maydis.  Genet. Res. Cambridge Soc 2, 204-230. Holliday, R. (1974). Ustilago  maydis.  In Handbook of  Genetics, R. C. King, ed. (New York: Plenum Press), pp. 575-595. Kamper, J., Reichmann, M., Romeis, T., Bolker, M., and Kahmann, R. (1995). Multiallelic recognition: nonself-dependent  dimerization of  the bE and bW homeodomain proteins in Ustilago  maydis.  Cell 81, 73-83. Kawasaki, L., Farres, A., and Aguirre, J. (1995). Aspergillus  nidulans  mutants affected  in acetate metabolism isolated as lipid nonutilizers. Exp Mycol. 19, 81-5. Kimura, A., Takano, Y., Furusawa, I., and Okuno, T. (2001). Peroxisomal metabolic function  is required for  appressorium-mediated plant infection  by Colletotrichum  lagenarium.  Plant Cell. 13, 1945-57. Klose, J., and Kronstad, J. W. (2006). The Multifunctional  {beta}-oxidation Enzyme Is Required for  Full Symptom Development by the Biotrophic Maize Pathogen Ustilago  maydis.  Eukaryot Cell 22, 22. Klose, J., Moniz de Sa, M. M., and Kronstad, J. W. (2004). Lipid-induced filamentous  growth in Ustilago  maydis.  Mol Microbiol 52, 823-35. Kronstad, J. W., and Leong, S. A. (1989). Isolation of  two alleles of  the b locus of Ustilago  maydis.  Proc Natl Acad Sci U S A 86, 978-82. Kronstad, J. W., and Staben, C. (1997). Mating type in filamentous  fungi.  Annu Rev Genet 31, 245-76. Kunau, W. H., Dommes, V., and Schulz, H. (1995). beta-oxidation of  fatty  acids in mitochondria, peroxisomes, and bacteria: a century of  continued progress. Prog Lipid Res. 34, 267-342. Kurihara, T., Ueda, M., Okada, H., Kamasawa, N., Naito, N., Osumi, M., and Tanaka, A. (1992). Beta-oxidation of  butyrate, the short-chain-length fatty  acid, occurs in peroxisomes in the yeast Candida  tropicalis.  J Biochem (Tokyo). Ill,  783-7. Liang, X., Le, W., Zhang, D., and Schulz, H. (2001). Impact of  the intramitochondrial enzyme organization on fatty  acid oxidation. Biochem Soc Trans. 29, 279-82. Maggio-Hall, L. A., and Keller, N. P. (2004). Mitochondrial beta-oxidation in Aspergillus  nidulans.  Mol Microbiol. 54, 1173-85. Mayorga, M. E., and Gold, S. E. (1999). A MAP kinase encoded by the ubc3 gene of  Ustilago  maydis  is required for  filamentous  growth and full  virulence. Mol Microbiol. 34, 485-97. Mellon, J. E., Dowd, M. K., and Cotty, P. J. (2002). Time Course Study of Substrate Utilization by Aspergillus  flavus  in Medium Simulating Corn (Zea  mays) Kernels. J. Agric. Food Chem. 50, 648-652. Mendgen, K., and Hahn, M. (2002). Plant infection  and the establishment of fungal  biotrophy. Trends Plant Sci. 7, 352-6. O'Brien, L. K., Sims, H. F., Bennett, M. J., and Strauss, A. W. (2000). A mouse model for  medium and short chain L-3-hydroxyacyl-CoA dehydrogenase deficiency.  J Inherit  Metab  Dis, 127. Puhalla, J. E. (1969). The formation  of  diploids of  Ustilago  maydis  on agar medium. Phytopathology 59, 1771-2. Ramsay, R. R. (2000). The carnitine acyl transferases:  modulators of  acyl-CoA-dependent reactions. Biochem Soc Trans. 28, 182-6. Sambrook, J. E., Fritsch, F., and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd Edition (New York: Cold Spring Harbor Laboratory Press). Schmitt, M. E., Brown, T. A., and Trumpower, B. L. (1990). A rapid and simple method for  preparation of  RNA from  Saccharomyces  cerevisiae. Nucleic Acids Res. 18, 3091-2. Smith, J. J., Brown, T. W., Eitzen, G. A., and Rachubinski, R. A. (2000). Regulation of  peroxisome size and number by fatty  acid beta -oxidation in the yeast Yarrowia lipolytica.  J Biol Chem. 275, 20168-78. Snetselaar, K. M., Bolker, M, and Kahmann, R. (1996). Ustilago  maydis  Mating Hyphae Orient Their Growth toward Pheromone Sources. Fungal Genet Biol 20, 299-312. Snetselaar, K. M., and Mims, C. W. (1993). Infection  of  maize stigmas by Ustilago  maydis:  light and electron microscopy. Phytopathology, 843-850. Snetselaar, K. M., and Mims, C. W. (1994.). Light and electron microscopy of Ustilago  maydis  hyphae in maize. Mycological Research, 347-355. Snetselaar, K. M., and Mims, C. W. (1992). Sporidial fusion  and infection  of maize seedlings by the smut fungus  Ustilago  maydis.  Mycologia 84, 193-203. Solomon, P. S., Tan, K, and Oliver, R. P. (2003). The nutrient supply of pathogenic fungi;  a fertile  field  for  study. Molecular Plant Pathology 4, 203-210. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of  progressive multiple sequence alignment through sequence weighting, position-specific  gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-80. Toffaletti,  D. L., Rude, T. H., Johnston, S. A., Durack, D. T., and Perfect,  J. R. (1993). Gene transfer  in Cryptococcus  neoformans  by use of  biolistic delivery of  DNA. J Bacteriol. 175, 1405-11. Trotter, P. J. (2001). The genetics of  fatty  acid metabolism in Saccharomyces cerevisiae. Annu Rev Nutr. 21, 97-119. Uchida, Y., Izai, K, Orii, T., and Hashimoto, T. (1992). Novel fatty  acid beta-oxidation enzymes in rat liver mitochondria. II. Purification  and properties of  enoyl-coenzyme A (CoA) hydratase/3-hydroxyacyl-CoA dehydrogenase/3-ketoacyl-Co A thiolase trifunctional  protein. J Biol Chem. 267,  1034-41. Vanhove, G. F., Van Veldhoven, P. P., Fransen, M., Denis, S., Eyssen, H. J., Wanders, R. J., and Mannaerts, G. P. (1993). The CoA esters of  2-methyl-branched chain fatty  acids and of  the bile acid intermediates di- and trihydroxycoprostanic acids are oxidized by one single peroxisomal branched chain acyl-CoA oxidase in human liver and kidney. J Biol Chem. 268, 10335-44. Voigt, C. A., Schafer,  W., and Salomon, S. (2005). A secreted lipase of  Fusarium graminearum  is a virulence factor  required for  infection  of  cereals. Plant J. 42, 364-75. Wanders, R. J., Vreken, P., Ferdinandusse, S., Jansen, G. A., Waterham, H. R., van Roermund, C. W., and Van Grunsven, E. G. (2001). Peroxisomal fatty  acid alpha-and beta-oxidation in humans: enzymology, peroxisomal metabolite transporters and peroxisomal diseases. Biochem Soc Trans. 29, 250-67. Wang, Z. Y., Thornton, C. R., Kershaw, M. J., Debao, L., and Talbot, N. J. (2003). The glyoxylate cycle is required for  temporal regulation of  virulence by the plant pathogenic fungus  Magnaporthe  grisea. Mol Microbiol. 47, 1601-12. Wood, P. A. (1999). Defects  in mitochondrial beta-oxidation of  fatty  acids. Curr Opin Lipidol. 10, 107-12. 5. PHOSPHOLIPASE A2 ATTENUATES THE DISEASE SYMPTOM DEVELOPMENT DURING INFECTION OF USTILAGO  MAYDIS 5.1. Introduction Ustilago  maydis  is a biotrophic fungal  pathogen that requires a host plant to sporulate and complete its life  cycle. The plant tissue provides both nutrients and signals for  fungal  growth and development. Recent analysis revealed that the U.  maydis  genome possesses genes encoding for  secreted proteins that cluster together and that, in many cases, are Ustilago-specific  (Kamper et al., 2006). Mutations in some of  these genes cause changes in virulence. Therefore,  it has been proposed that these genes may have evolved to function  in specific  aspects of  the biotrophic life  style. A variety of  secreted proteins, such as hydrolytic enzymes (proteases, phospholipases and lipases) have been shown to contribute to the virulence of  many pathogenic microorganisms (Chen et al., 1997a; Chen et al., 1997b; Hube, 1998; Hube et al., 2000; Ibrahim et al., 1995; Leidich et al., 1998; Saffer  et al., 1989; Walker et al., 1983). Extracellular phospholipases, secreted during the course of  infection,  are believed to be virulence factors  for  many pathogenic bacteria and protozoa such as Clostridia species, Listeria monocytogenes, Pseudomonas  species, Staphylococcus  aureus, Mycobacterium  tuberculosis  and Toxoplasma  gondii  (reviewed in Ghannoum, 2000). There is some evidence supporting a role for  extracellular phospholipases as virulence factors  in experimental fungal  infections.  For example, the human pathogenic fungus Cryptoccocus  neoformans  secretes a phospholipase enzyme that demonstrates phospholipase B (PLB), lysophospholipase hydrolase and lysophospholipase transacylase activities, and that has been proposed to be a virulence factor  for  the fungus  (Chen et al., 1997a, 1997b; Cox et al., 2001). The role of  extracellular phospholipase as a potential virulence factor  has also been demonstrated for  other pathogenic fungi,  including Candida  albicans (Leidich et al., 1998). Because phospholipases are secreted, it has been postulated that these enzymes assist in the penetration of  phospholipid-rich host barriers such as membranes. Invasion of  host cells by most pathogens requires penetration and damage, of  the cell membrane, which is mediated by either physical or enzymatic means, or a combination of  both. Phospholipases such as the pH-activated phospholipase A2 of Helicobacter  pylori  (Berstad et al., 2002) are likely to be involved in the membrane disruption processes (Waite, 1996), because phospholipids represent one of  the major chemical constituents of  the host cell envelope. However, it is still unclear how extracellular phospholipases serve as virulence factors  in fungal  infections. Phospholipases are a diverse group of  lipolytic enzymes that share the ability to hydrolyze one or more ester linkages in phospholipids. Although all phospholipases target phospholipids as substrates, they vary in the site of  action on the phospholipid molecule, their function  and mode of  action, and their regulation (Waite, 1996). Phospholipases were given identifying  letters A, B, C, and D to indicate the specific  bond targeted in the phospholipid molecule (Figure 5.1). Phospholipases function  in various roles ranging from  the digestion of  nutrients to the formation  of  bioactive molecules. This diversity of  function  indicates that phospholipases can serve auxiliary functions  (e.g. in virulence), and can be critical to central cellular processes. For example, the continual remodeling of  cell membranes requires the action of  one or more phospholipases (Schmiel and Miller, 1999). I initiated a project to examine the role of  genes encoding phospholipases as part of  a larger program to explore the involvement of  lipid metabolism in the lipid-induced filamentous  response (Klose et al., 2004) and virulence in U.  maydis.  Previously, one of the phospholipase A2 genes, lipl,  was identified  in our group in a subtractive hybridization screen as being highly expressed in a strain mutated in hgll  (Mario Moniz de Sa, unpublished). Hgll is thought to be a direct target of  PKA that is required for mating, and is thought to act as a negative regulator of  budding growth (Durrenberger et al., 2001). Deletion of  lipl  has a negative influence  on filamentous  growth during mating, demonstrated by the fact  that the hgll  lipl  double mutants restored the ability of hgll  mutants to mate. There is evidence in other fungi  that fatty  acid products of phospholipase A2 activity influence  the activity of  adenylyl cyclase (AC) (Resnick and Tomaska, 1994). Therefore,  Lipl may function  in a feedback  loop to regulate AC by maintaining high cAMP levels to promote budding growth. However, the lipl  mutants caused disease symptoms at the wild-type levels (Mario Moniz de Sa, unpublished). PLB PLA1 Xh Q , H2C - o - C - R R - C - O - C - H q H X - O - P - O - X ti- t PLA2 PLC PLD Figure 5.1 Sites of  action of  various phospholipases. The arrows show ester bonds that are cleaved by specific  phospholipases depending their site of  action. PLA1 = phospholipase Al; PLA2 = phospholipase A2; PLB = phospholipase B; PLC = phospholipase C; PLD = phospholipase D. Phospholipase A2 (PLA2) hydrolyses the fatty  acyl ester bond at the sn-2 position of  the glycerol moiety (Figure 5.1). The action of  PLA2 results in the accumulation of free  fatty  acids and 1-acyl lysophospholipid. PLA2 plays an important role in signal transduction in mammals, in particular in generation of  proinflammatory  mediators such as prostaglandins and leukotrienes, and in membrane remodeling. Several subtypes of mammalian PLA2 have been described. These are divided in four  main groups according to their function,  localization, and calcium dependency. Cytosolic phospholipase A2 associates with natural membranes in response to physiological increases in Ca2+, and selectively hydrolyses arachidonyl phospholipids to initiate cell-to-cell signaling (van den Berg et al., 1995). This enzymatic activity cleaves off  arachidic acid from  the membranes in mammalian cells, often  initiates signal transduction, and is regulated by the state of  the cell activation. Platelet-activating factor  acetylhydrolase (PAF-AH), a subfamily  of  phospholipase A2, is responsible for  inactivation of  platelet-activating factor  through cleavage of  an acetyl group (i.e., at the second position of  glycerol in bioactive phospholipids), releasing lyso derivatives of  phospholipid substrates and short fatty  acids (Dennis, 1997; Derewenda and Derewenda, 1998). In animal systems, several structurally unrelated types of  PLA2 have been described (Dennis et al., 1995). The release of  arachidonic acid leading to the synthesis of  inflammatory  lipid mediators (eicosanoids) requires the activity of  different  PLA2 isoforms  in distinct cell types (Balboa et al., 1996). In plants, there is indirect evidence for  the coordinated involvement of  three types of  phospholipases (A, C and D) in defense  signaling (Chapman, 1998; Munnik et al., 1998). Activation of  PLA2 has been shown in response to auxin (Paul et al., 1998), wounding (Narvaez-Vasquez et al., 1999) and elicitors. In addition, soybean cells have also been found  to respond to treatment with bacterial and fungal  elicitors by PLA2 activation (Chandra et al., 1996). Secreted and membrane-bound PLA2 activity has also been described in bacteria, fungi  and protozoa (Ghannoum, 2000; Matoba et al., 2002; Waite, 1996), and reported to be related to pathogenesis in some microorganisms (Schaller et al., 2005). In this study, I describe the relevance of  one gene encoding a putative phospholipase A2 (Lip2, predicted to belong to the PAF-AH family)  to the virulence of U.  maydis.  I found  that deletion of  lip2 increases the virulence of  the fungus.  Infection with the mutant resulted in the enhanced production of  disease symptoms in both seedlings and mature maize plants. In addition, the mutation in lip2 did not impair mating reactions, or the ability of  the teliospores to germinate. Lip2 was also not required for  the filamentation  of  cells that is triggered by lipids. 5.2. Results 5.2.1. Genes coding for  putative phospholipases To explore the possible role of  phospholipases in virulence of  U.  maydis,  I first annotated the available genomic sequence for  the presence of  specific  types of phospholipase enzymes potentially secreted by the fungus.  There were two putative phospholipase Al (PLA1) genes, Um 02255 and Um05659, in the genome and both are of  the phosphatidic acid-preferring  PLA1 (PA-PLA1) type. PA-PLA1 specifically hydrolyzes phosphatidic acid and contains the DDHD domain (PF02862). Interestingly, there was no match in the genome to PLA1 (EC 3.1.1.32), the acyl hydrolase enzymes with broad substrate specificity.  One gene for  a putative cytosolic phospholipase A2 (PLA2; EC3.1.1.4)) (Um05871) and two genes for  putative platelet activating factor hydrolases (PAF) (Um00133 and Um01927) were found  in the genome. This enzyme contains a lysophospholipase (lpl) catalytic domain and a C2 domain (Pfam00168). One gene, Um01035, was predicted to code for  a putative phospholipase B (PLB; (synonyms: lysophospholipase, lysophospholipase-transacylase)) enzyme (EC3.1.1.5) based on a strong similarity to PLB proteins from  S. cerevisiae, C. neoformans,  N.  crassa and S. pombe. It contained a predicted lysophospholipase catalytic domain. There are other putative lysophospholipases (Lyso-PLB) in the genome but these lack the lysophospholipase domain. The predicted genes include Um00130 with an esterase/lipase/thioesterase domain and a phospholipase/carboxylesterase domain, Um02599 with an esterase/lipase/thioesterase domain, and Um01007 with ankyrin and asparaginase/glutaminase domains. There are two putative genes predicted to encode for  phospholipase C (PLC), Um02982 and Um01865 (Meldrum et al., 1991). They both contain the PLC catalytic domain X and Y, two regions that together form  a TIM barrel-like structure containing the active site residues. The Um02982 gene also contains the EF-hand calcium-binding motif,  where calcium binding leads to the activation or inactivation of  target proteins (Rhee and Choi, 1992a, 1992b). Three potential phospholipase D (PLD) genes were found  in the genome (Um00370, Um01120, and Um06066) and all contain the PLD/transphosphatidylase domain. Um00370 has strong similarity to the S. cerevisiae SP014  gene (responsible for meiosis and spore formation)  (Ella et al., 1996; Rose et al., 1995; Waksman et al., 1996). The SP014-Hke PLD enzyme is highly conserved among fungal  species. UmOl 120 has high similarity to phosphatidylglycerophosphate (PG-P) synthase PEL1/PGS1 from  S. cerevisiae. PG-P synthase catalyzes the synthesis of  PG-P from  CDP-diacylglycerol and ^"-glycerol 3-phosphate in the biosynthesis of  cardiolipin (CL) (Chang et al., 1998). Um06066 encodes a conserved hypothetical protein with no significant  homology to other proteins. 5.2.2. Iip2  gene identification  in the U.  maydis  genome The amino acid sequence of  the previously characterized lipl  gene (Mario Moniz de Sa, unpublished) was originally used to search for  other possible PLA2 genes in the genome. Based on the genome analysis, the lip2 gene was predicted to encode the second platelet-activating factor  acetylhydrolase PLA2. Lipl and Lip2 proteins share 32% identity and 46.6% similarity. The lip2 gene encodes a predicted polypeptide of  829 amino acids, consisting of  only one exon with one putative domain (amino acids 48 to 344) for  platelet-activating factor  acetylhydrolase plasma/intracellular isoform  II (PAF-AH_p_II) at the N-terminus, and a predicted hydrolase fold  (HAD superfamily)  at the C-terminus (amino acids 502 to 698). Lip2 protein shows highest sequence similarity to a hypothetical protein in the fungus  Gibberella  zeae (26% identity and 44% similarity, accession number XP_380370). 5.2.3. Construction of  Iip2 mutants A targeted gene deletion strategy was used to delete the coding region of  the lip2 gene by replacing the entire open reading frame  with a 3.8 kb gene cassette conferring resistance to the antibiotic hygromycin B. Deletion of  the gene was confirmed  by colony PCR and Southern blot analysis (Figure 5.2). Two independent restriction enzyme digests (Ndel  and Sail)  and two different  probes (probeL and probeR) were used to verify a lip2 deletion allele. The wild-type lipl  allele was present on a 3.1 kb Sail  restriction enzyme fragment  and a 5.3 kb Ndel  fragment,  while the gene deletion was confirmed  by the presence of  a 2.7 kb Sail  fragment  and a 1.6 kb Ndel  fragment.  The deletion of  lipl was performed  in two wild-type strains of  opposite mating types (al  bl and al bl) to allow mating and pathogenicity analysis to investigate the role of  PLA2 in virulence (see Materials and Methods). Two independent mutant strains from  each mating background were selected and used for  subsequent phenotypic analyses. 5.2.4. Iip2  mutants respond to fatty  acids by growing filaments We have previously shown that lipids and specifically  fatty  acids trigger the dimorphic switch from  budding to filamentous  growth in U.  maydis  wild-type strains (Klose et al., 2004). This fatty  acid-induced filamentation  is dependent on the functions of  both the cAMP/PKA and MAP kinase signaling pathways. Therefore,  I wanted to determine whether the lip2 gene plays a role in filamentous  growth induced by fatty acids, and thus whether the phospholipase A2 activity contributes to the dimorphic switch. Mutant strains deleted in lip2 were grown in a liquid minimal medium supplemented with glucose, corn oil, palmitic acid or oleic acid as a sole carbon source (Figure 5.3). As expected, the mutant cells exhibited yeast-like budding phenotype when grown in glucose medium. However, when grown in a presence of  either of  the lipid or fatty  acid carbon sources, the cells underwent the morphological transition from  budding to filamentous  growth. Therefore,  the phospholipase A2 enzyme encoded by lip2 does not seem to play a role in morphogenesis in U.  maydis  in response to lipids and fatty acids. Ndel  Sail  Sail left  arm . , Ndel right arm left  arm probe L hygromycin right arm B Sail albl a2b2 'WT 3 6 12 13 14 15" WT 5 6 8 9 10 20 1 • • • Ndel albl  a2b2 'WT 3 6 12 13 14 15" WT 5 6 8 9 10 201 -3.1 kb •2.7 kb — 5.3 kb 1.6 kb Figure 5.2 Targeted gene deletion of  lip2 gene in U.  maydis. (A) Schematic representation and restriction enzyme maps of  the wild-type Hp2  locus and the deletion construct. The deletion constaict contains a 2.7 kb hygromycin resistance replacing the 2.5 kb coding region of  lip2 and the right and left  arms of  lip2 generated using PCR overlap (Davidson et al., 2002). The left  and right arms represent the 5' flanking  region and the 3' flanking  region of  the lip2 gene. (B) DNA gel blot analysis of  lip2::naf  transformants. Genomic DNA from  the wild-type strains 518 (a2b2) and 521 (albl)  (labeled as WT), the lip2::naf  mutant transformants  (3, 6,12, 13,14,15, 16 in albl;  5, 6, 9,10, 20 in a2b2), and the ectopic integration transformant  8 (in a2b2), was digested with either Sail  (top) or Ndel  (bottom) and processed for  gel blot analysis. The appearance of  a band size of  2.7 kb in the Sail  digest and 1.6 kb in the Ndel  digest was diagnostic of  the correct gene replacement event. The wild-type lip2 allele is present on a 3.1 kb Sail  restriction enzyme fragment  and a 5.3 kb Ndel  fragment. 5.2.5. Lip2 is not required during the early stages of  pathogenic development including mating and penetration Mating of  compatible haploid cells takes place on the plant surface  during the initiation of  infection.  During the mating reaction, the haploid cells produce conjugation tubes that grow between the mating partners and eventually fuse  to form  the infectious dikaryon. The dikaryotic filament  penetrates the plant surface  and invades host tissue. To determine whether lip2 plays a role in the initial stages of  infection,  I performed mating and penetration analyses. For mating reactions, the strains of  opposite mating type were mixed on charcoal-containing agar plates (Figure 5.4). A positive mating reaction is indicated by the presence of  a white colony appearance due to aerial hyphae production on the surface  during mating (Figure 5.4A). The lip2 mutants were able to mate when tested with compatible wild-type mating partners (albl  and a2b2) and also when combined with other lip2 deletion strains of  the opposite mating type (tdip2  albl and bdip2  a2b2). Therefore,  mating was unaffected  in lip2 mutants. Microscopic observations of  the mating filaments  were also performed  to determine whether the mutation had an effect  on morphology or the rate of  filament  production during mating (Figure 5.4B). The wild-type strains produced many long unbranched filaments, conjugation tubes, and some cells remained yeast-like. Similar cellular morphologies were observed in the mutant mixtures: filaments,  conjugation tubes, and yeast-like cells. a2b2 Alip2  a2b2 Figure 5.3 Cellular morphology in response to oils and fatty  acids. Wild-type and Iip2 mutant strains were grown on minimal medium supplemented with glucose, corn oil, palmitic or oleic acid as sole carbon source. The cells were visualized by differential  interference  contrast optics (DIC). Scale bar = 10 |im. glucose corn oil palmitate oleate Mip2  albl\ albl  X a2b2 a2b2 Alip2  a2b2 a2b2 /Slip2  a2b2 Figure 5.4 Response of  lip2  mutan t s to mating. (A) Colony morphology resulting from  the mating reaction on charcoal-containing agar. The reaction between wild-type strains 518 (albl)  and 521 (a2b2)  in the center shows the white aerial hyphal growth indicative of  a positive mating reaction. Mating reactions between compatible wild-type and mutant strains and compatible mutant strains resulted in positive mating reactions similar to wild-type. (B) Cellular morphology of  the mating filaments  produced during wild-type and mutant mating interactions. The Iip2  mutants produced mating filaments  similar to wild-type strains. The cells were visualized by differential  interference  contrast optics (DIC). Scale bar = 10 pm. Therefore,  the deletion of  lip2 did not influence  the morphological transitions during mating under these experimental conditions. To investigate whether lip2 plays a role in the penetration phase during infection, microscopic observations of  epidermal peals from  infected  leaves were performed  (see Materials and Methods). The leaves were infected  with mating cultures of  the wild-type or the lip2 mutant strains of  opposite mating type. Five days after  infection,  filaments produced from  the wild-type cross could be observed penetrating plant surface  and colonizing host tissue (data not shown). A mixture of  yeast-like cells was also found  on the plant surface  and some of  these produced conjugation tubes. There was no defect  in the ability to penetrate the leaf  surface  observed in the leaves infected  with the lip2 mutant strains. Overall, the mutant cells were found  in similar stages of  development as the wild-type cells: penetrating filaments,  yeast-like cells with conjugation tubes and some yeast-like cell on the plant surface.  These results suggest that lip2 is not required for  penetration. Taken together, I can conclude (at least from  this type of  analysis) that Lip2 does not play a role in the early stages of  infection. 5.2.6. Deletion of  lip2  results in more severe disease symptom development in maize seedlings After  successful  tissue colonization by U.  maydis,  the first  disease symptoms to appear on leaves and stems include chlorosis and anthocyanin pigmentation. Later, tumors are produced and can develop on all above ground plant parts. The fungus proliferates  vigorously within the tumor tissue, and the fungal  filamentous  cells eventually differentiate  to produce spores. Tumors vary greatly in size between infected plants. The most prominent tumors are produced at the base of  a stem and these eventually cause the death of  the plant. Because the lip2 gene seemed to have no effect on the initial stages of  fungal  growth during infection,  I further  investigated whether the lip2 influences  hyphal proliferation  and disease symptom development during later stages of  infection.  Seven-day old maize plants were inoculated with 106 mL"1 cells in a mixture of  wild-type (albl  and a2b2), of  wild-type and mutant (albl  and bdip2  a2b2, and hdip2 albl  and a2b2), or mutant strains (Alip2 albl  and Alip2 a2b2). Plants were scored for disease symptoms two weeks after  inoculation (Table 5.1). The infected  plants were scored by judging the severity of  specific  symptoms and assigning a numerical rating. A disease index was calculated based on these ratings. The number of  plants with and without tumors was also scored (Table 5.1). Surprisingly, the disease index was higher in plants infected  with compatible lip2 mutant strains compared with the mixture of  wild-type strains (Table 5.1). Interestingly, the disease index was also higher for  the plants infected  with the mixture of  wild-type and mutant strains. The mutants were able to cause development of  all the symptoms typical for  the wild-type infections  in maize seedlings. However, significantly  higher numbers of  dead plants and plants with large stem tumors were observed for  all those infected  with the cell mixtures that included lip2 mutant strains. To confirm  the development of  more severe disease symptoms, I inoculated maize seedlings with a lower number of  lip2 mutant cells (105 mL"1). The lower inoculum would usually decrease the symptom development in wild-type infections  and, therefore,  allow a more accurate evaluation of  the difference  between the wild-type and mutant infections.  As expected, the disease indices were also increased when the plants were infected  with the lower concentration of  a mating mixture containing lip2 mutant strains or a mixture containing a lip2 mutant strain and wild-type strains (Table 5.1). Therefore,  it appears that the deletion of  lip2 leads to a hypervirulent phenotype, which results in an increased production of  large stem tumors, and eventually death of  the plants. The increase in plant death could indicate a lack of  a precise regulation of  the biotrophic development of  the fungus  (e.g., fungal  proliferation  or sporulation) such that more severe symptoms developed. That is, the Lip2 protein may be required to regulate fungal  development at a specific  phase/phases during infection  to promote proper disease progression. 5.2.7. Deletion of  lip2  enhances teliospore development In nature, U.  maydis  preferentially  infects  developing ears of  mature maize plants. Instead of  kernels, tumors develop that are filled  with proliferating  dikaryotic filaments. The filaments  eventually differentiate  into diploid teliospores. To examine whether lip2 is required for  sporulation and teliospore production, two to three-month old maize plants were inoculated by injecting compatible mating mixtures directly into the silk channels of developing ears. The mating mixtures contained wild-type (albl  and a2b2), wild-type and mutant (albl  and Alip2 a2b2 and Alip2 albl  and a2b2), or mutant strains (Alip2 albl  and tdip2  a2b2). Teliospore development was observed 10 and 14 days after inoculation (Figure 5.5 and data not shown). After  10 days, the wild-type tumors were white/gray in appearance and cross sections of  the tumor tissue revealed cells in various stages of  development including branched hyphae with lobbed ends, fragmented  hyphae with different  cellular morphologies and immature teliospores (data not shown). In contrast, the mutant tumors were visibly darker in appearance (i.e., some of  the tumors were completely black) and contained teliospores in different  stages of  maturation with some sections entirely filled  with mature melanized teliospores, and some fragmented hyphae (data not shown). After  14 days, most of  the wild-type tumors were black and filled  with mostly mature melanized teliospores with echinulated surfaces,  and the mutant tumors were completely black and dried up with ruptured plant cell membranes; these contained masses of  mature teliospores (Figure 5.5A and B). Furthermore, teliospores isolated from  plants infected  with the lip2 mutant mating culture showed no differences in germination compared to wild-type spores (Figure 5.6). These observations suggest that lip2 deletion enhances spore development. Overall, these results confirm  that Lip2 is important during fungal  development. 5.3. Discussion Phospholipases have been shown to influence  virulence in a variety of  bacterial and fungal  pathogens of  plants and humans (Nespoulous et al., 1999; Cox et al., 2001; Ghannoum, 2000). Here I show that deletion of  lip2 gene encoding a putative PAF-like PLA2 results in more severe symptom development and increased teliospore maturation. The hypervirulent phenotype suggests that Lip2 protein may attenuate fungal proliferation  and/or sporulation. This might be important during biotrophic interactions between the fungus  and the host to prevent premature development of  disease symptoms. A connection between the PLA2 activity and adenylyl cyclase regulation has been shown in S. cerevisiae, where products of  PLA2 activity, in particular fatty  acids, stimulate adenylyl cyclase (Resnick and Tomaska, 1994). albl X a2b2 Mip2  albl X Mip2  a2b2 Figure 5.5 Teliospore development on floral  tissue by wild-type strains and Iip2 mutants. (A) Tumors were collected from  infected  ears of  maize after  14 days of  infection with the wild-type {albl  X albl)  or the lipl  mutant (A/ipl  albl  X Alipl  albl)  cells. The mutant tumors were visibly darker and dried up in appearance with ruptured cell membranes compared to wild-type tumors. (B) Cross sections of  the wild-type and lipl  mutant tumor tissue showing mature teliospores. In mutant tumor tissue, only mature melanized teliospores with echinulated surfaces  were observed in contrast to wild-type tumors where teliospores were found  in different  stages of  maturation. The teliospores were visualized by differential interference  contrast optics (D1C). Scale bar = 10 pm. Figure 5.6 Teliospore germination in Up2  mutants. Harvested teliospores from  the tumor tissue developed on maize seedlings 14 days after inoculation with the wild-type (albl  X  a2b2) or the lip2 mutant (A/ip2  albl  X AIip2  albl) cells were incubated for  germination. Germinating teliospores are black with a thick outer layer (i.e., that does not stain with calcofluor)  with an extended promycelium from  which haploid progeny are generated (i.e., stained with calcofluor)  after  a 16-hr incubation period. The teliospores were visualized by differential  interference  contrast optics (DIC, top panel) and by epifluorescence  after  staining cell walls with calcofluor  (bottom panel). Scale bar = 10 (am. It is possible therefore  that Lip2 could regulate adenylyl cyclase activity in U. maydis,  and thus regulate cAMP levels in cells during infection.  In U.  maydis,  high cAMP levels promote budding growth and low cAMP levels promote filamentous growth. This regulation might be important to keep the disease symptoms in check during the biotrophic phase of  U.  maydis  life  cycle, so that the plant growth stays unaffected  and the fungus  can complete its life  cycle. In addition, a second product of  PLA2 activity, lysophospholipid, inhibits glucan synthase activity in S. cerevisiae (Ko et al., 1994). Glucan synthase is a membrane bound protein involved in biosynthesis of  cell wall glucan (major cell wall component). PLA2 cleaves off  the acyl group in membrane phospholipids and in some specific bioactive phospholipids resulting in mobilization of  arachidonic acid and production of oxylipins (signaling lipids). Oxylipins comprise a family  of  oxygenated fatty  acid-derived signaling molecules that have several biological activities in animals, plants, and fungi.  Mammalian oxylipins, including the prostaglandins, mediate many immune and inflammation  responses in animals. Prostaglandins production by pathogenic microbes is also theorized to play a role in pathogenesis (Noverr et al., 2001, 2002). Tsitsigiannis et al (2005a) proposed that oxylipins produced by Aspergillus  nidulans  may serve as factors that modulate fungal  development to contribute to resistance to host defenses.  It is possible that PLA2 activity may directly or indirectly contribute to the weak plant defense  response observed during U.  maydis  infection.  Oxidized lipid-derived molecules have been shown to play significant  roles in inducible plant defense  responses against microbial pathogens. The synthesis of  these oxylipins was hypothesized to be initiated by the phospholipase A2-mediated release of  unsaturated fatty  acids from  membrane lipids, because linoleic and linolenic acids, the precursors of  most oxylipins, dominate the sn-2 position in plant phospholipids (Blee, 1998; Dhondt et al., 2000). Perhaps U. maydis,  by secreting its own PLA2, may mimic production of  a plant PLA2 that cleaves off  linoleic or linolenic acids from  plant cell membranes, and thus may influence  the plant defense  response. Therefore,  the linoleic or linolenic acids normally released from the membrane upon the plant PLA2 activity would not get mobilized and no induction of subsequent signaling pathways that lead to a plant defense  response would be initiated. However, this theory is highly speculative and clues to functions  and mechanisms of PLA2 during host infection  must be further  investigated, perhaps by conducting a study to examine PLA2 activity during infection. Many lipids and lipid-derived products that are generated by phospholipases acting on phospholipids present in the host are implicated as mediators and second messengers in signal transduction. Therefore,  Lip2 could also contribute to production of signaling lipids that provide important signals necessary for  developmental changes during U.  maydis  infection. Further experiments are needed to assess the connection of  cAMP signaling and PFA-like PLA2 in U.  maydis  and the role of  this PLA2 in establishment of  biotrophic interactions with the host (including a possible role in bypassing plant defense  response). For example, experiments could be conducted to determine lip2 expression in strains deleted in components of  cAMP/PKA pathway, such as the ubcl, adrl  and hgll  mutants. Also generation of  mutant strains deleted in both lipl  and lip2 will allow a more detailed exploration of  the role of  these genes in virulence. Complete elimination of  PLA2 activity may result in enhanced pathogenicity in other stages during infection,  such as mating or penetration phase. Overall, the results presented in this chapter indicate that U. maydis  PLA2 plays a role in virulence, specifically  by attenuating the disease symptom development during infection.  This work therefore  strengthens the emerging idea that lipid metabolism and signaling are important for  biotrophic interactions of  fungi  with plant hosts. 5.4. Materials and Methods 5.4.1. Media and Growth Conditions U.  maydis  strains were grown according to standard conditions (Holliday, 1974). Analysis of  lipid-induced filamentation  was performed  by inoculating 1 x 106 cells in minimal medium supplemented with either glucose, corn oil, palmitic acid or oleic acid (added to a concentration of  1%) and growing strains overnight at 30°C. Mating tests were performed  by co-spotting compatible strains on double complete medium containing activated charcoal (1%) as previously described (Holliday, 1974). 5.4.2. DNA Manipulations All DNA manipulations, such as small-scale plasmid preparations, restriction enzyme digests and Southern blot analysis, were performed  according to standard protocols (Sambrook et al., 1989). Plasmid DNA was isolated using the Eppendorf  fast plasmid mini kit and genomic DNA was isolated as previously described (Wang et al., 1988). The sequence of  lip2 was obtained from  the U.  maydis  genomic sequence at http://mips.gsf.de/genre/proj/ustilago/  (gene number Um01927). The knock out construct, lip2::hygBR, was generated by using a PCR overlap strategy (Davidson et al., 2002), and was designed to include 0.6 kb of  the 5' upstream region (left  arm) and 1 kb of  the 3' downstream region (right arm) from  the lip2 gene surrounding a hygromycin selectable marker to ensure a full  deletion of  the coding region. Primers Lip2Pl (5' CAGTCGCTCTCTCTTCTTCT 3') and Lip2P2 (5' AACTGTGCTTCAATCGCTGCGATGAAGTGGCAGACGAGAA 3') and primers lip2P5 (5' TAGCACACGACTCACATCTGGCGTAGCATCGAGAGCAACA 3') and Lip2P6 (5' AAGGCGAGAAGCGGCGAAGA 3') were used to amplify  the left  arm and right ann, respectively, from  genomic DNA. Primers Lip2P3 (5' TTCTCGTCTGCCACTTCATCGCAGCGATTGAAGCACAGTT 3') and Lip2P4 (5' TGTTGCTCTCGATGCTACGCCAGATGTGAGTCGTGTGCTA 3') amplified  a 2.7 kb hygromycin resistance marker region from  pIC19RHL. The Up2::hygB R construct was generated as the 3.9kb overlap PCR product by PCR using the three PCR fragments  as templates and the primers Lip2Pln (5' GCTCTCTCTTCTTCTCGCAA 3') and Lip2P6n (5' CGAGAAGCGGCGAAGAAGAA 3'). The generated construct was ligated into pCR2.1 (TOPO-TA; Invitrogen) and transformed  into E. coli DH10B cells (Bethesda Research Laboratories). 5.4.3. Strains The deletion strains, Hp2::hygB R albl  and lip2::hygBR a2b2, were generated by transformation  of  wild-type strains a2b2 (518) and albl  (521) of  opposite mating type using biolistic transformation  method (Toffaletti  et al., 1993). Transformants  were selected on double complete medium with 1M sorbitol and 250|ig/ml hygromycin B, and purified by restreaking for  single colonies on complete medium plates containing 150pg/ml hygromycin B. Transformants  were screened by colony PCR using a U.  maydis-specific primer outside the construct Lip2L (5' GAGGACGGCGTCGAACTGAT 3') and a hygB-specific  primer HYGBL (5'-ATC AGT TCG GAG ACG CTG-3'). Gene deletion was confirmed  by Southern blot. Two independent deletion mutants in each wild-type strain were selected for  all subsequent phenotypic analyses to confirm  that the deleted gene is responsible for  the observed phenotypes. Representative data from  analyses of  all of  the deletion strains is shown in the results section of  this chapter. 5.4.4. Sequence Analysis Gene prediction, protein alignments and sequence analysis were done using the programs BLAST (Altschul et al., 1997), CLUSTAL W (Thompson et al., 1994), and Pfam  (Bateman et al., 2002), respectively. 5.4.5. Microscopic Analysis For cell wall staining, 1 pi of  a 20 pg mL"1 solution of  fluorescent  brightener 28 Calcofluor  White (F3543, Sigma) was added directly to 5 pi of  cell culture on a slide. To observe the production of  mating filaments,  cells were scraped off  of  mating medium and resuspended in sdH20 with 1 pL of  a 20 pg mL"1 fluorescent  brightener 28 Calcofluor White (F3543, Sigma). Cells were observed using a Zeiss Axioplan 2 fluorescence microscope with differential  interference  contrast (DIC) optics or UV fluorescence  to observe cells stained with Calcofluor.  Images were captured with a DVC camera and processed with Northern Eclipse imaging software  and Adobe Photoshop 7. 5.4.6. Virulence Assays Strains albl  (521), a2b2 (518), Up2::hygB R albl  and lip2::hygBR a2b2 were grown in PDB medium with overnight shaking at 250 rpm at 30°C. Mating cultures generated by crossing the strains in the following  combinations were used to infect  maize seedlings: 521 {albl)  X 518 (a2b2), 521 (albl)  X a2b2 Alip2::hygBR, 518 (a2b2)  X albl  Alip2::hygBR and albl  Alip2::hygBR X a2b2 Alip2::hygBR. For seedling infections, one-week-old maize plants (Golden Bantam) grown in a greenhouse were inoculated by injecting approximately 100 pL of  1X106 or 1X107 cells mL"1 of  mating cultures per plant. After  14 days, plants were scored for  disease symptoms using the following  rating scheme: 1 =chlorosis and pigment production; 2 = small leaf  tumors; 3 = small stem tumors; 4 = large stem tumors; and 5 = plant death. Approximately 100 plants for  each combination of  strains were scored for  disease symptoms. For mature plant infections, two to three-month-old maize plants were inoculated by injecting approximately 2 mL of 1X106 cells mL"1 of  mating cultures into the silk channels of  developing cobs. The infections  in seedlings and mature plants were repeated three times. The production of teliospores within tumors was examined after  10 and 14 days. 5.4.7. In  planta  Phenotypic Analysis Epidermal peals, the thin surface  layer of  plant leaf  tissue, from  5-day old infected leaves were placed on a 30 pL drop of  water with 3 pL (20 pg mL"1) of  Fluorescent brightener 28 calcofluor  white (Sigma, F3543) for  microscopic observation. Cross sections of  tumor tissue collected from  infected  mature plants at 10 and 14 days post inoculation were generated using a razor blade. The cross sections were placed on a 30 pL drop of  water with 3 pL (20 pg mL"1) of  Fluorescent brightener 28 calcofluor  white (Sigma, F3543) for  microscopic analysis. 5.4.8. Teliospore Isolation and Germination Teliospores were isolated from  tumors collected 14 days post inoculation (described above). Whole tumors were sterilized in 10% bleach for  30 seconds, washed twice in sterile dH20, and ground in 20ml of  1.5% CuS04.5H20 using sterile mortar and pestle. Ground tumor tissue containing teliospores was filtered  through cheesecloth and incubated overnight at room temperature for  sterilization. Teliospore suspensions were centrifuged,  washed twice in sterile dH20, and 200pl of  the teliospore suspension was incubated on PDA plates containing a microscope slide submerged in the agar. The plates were incubated at 30°C for  approximately 16 to 18 hrs. The microscopic slide was cut out from  the agar and 1^1 of  a 20 |ig mL"1 fluorescent  brightener 28 Calcofluor  White (F3543, Sigma) diluted in 5 jal of  sterile dH20 was placed directly on a coverslip prior to observations. Teliospores were isolated from  three independent experiments and germination was observed in three separate experiments. 5.4.9. Accession Numbers The sequence data for  this work can be found  in the EMBL Nucleotide Sequence Submission (EMBL), http://www.ebi.ac.uk, and GenBank, National Center for Biotechnology Information  (GenBank), http: //www.ncbi.nlm.nih.gov, data libraries under accession number XP 758074 5.5. Tables Table 5.1 Pathogenicity of  lip2  mutants" Cross or strain Inoculums (No. of cells) No. of  plants producing anthocyanin No. of plants with tumors Total no. of plants infected %of plants with tumors Disease scoreb albl  X a2b2 106 16 72 88 82 3.7 albl X Alip2  a2b2 106 5 71 74 96 4.3 Alip2  albl X a2b2 106 5 70 75 93 4.3 Alip2  alb X Alip2  a2b2 106 6 87 93 94 4.4 albl  X a2b2 105 33 35 68 51 2.1 albl X Alip2  a2b2 105 21 45 66 68 3.3 Alip2  albl X a2b2 105 15 49 64 77 3.6 Alip2  alb X Alip2  a2b2 105 20 46 66 70 3.5 a Table shows combined data from  three independent experiments using 1 x 106 cells, and two independent experiments using 1 x 105 cells. The pattern of  the disease symptom development shown in the table is representative of  a pattern observed in each independent experiment. b The disease score is calculated as the sum of  disease symptoms ratings divided by the total number of  infected  plants scored for  symptoms. 5.6. References Altschul, S. F., Madden, T. L., Schaffer,  A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of  protein database search programs. Nucleic Acids Res. 25, 3389-402. Balboa, M. A., Balsinde, J., Winstead, M. V., Tischfield,  J. A., and Dennis, E. A. (1996). Novel group V phospholipase A2 involved in arachidonic acid mobilization in murine P388D1 macrophages. J Biol Chem. 271, 32381-4. Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S. R., Griffiths-Jones,  S., Howe, K. L., Marshall, M., and Sonnhammer, E. L. (2002). The Pfam protein families  database. Nucleic Acids Res. 30, 276-80. Berstad, A. E., Berstad, K., and Berstad, A. (2002). PH-activated phospholipase A2: an important mucosal barrier breaker in peptic ulcer disease. Scand J Gastroenterol. 37, 738-42. Blee, E. (1998). Phytooxylipins and plant defense  reactions. Prog Lipid Res. 37, 33-72. Chandra, S., Heinstein, P. F., and Low, P. S. (1996). Activation of  Phospholipase A by Plant Defense  Elicitors. Plant Physiol. 110, 979-986. Chang, S. C., Heacock, P. N., Clancey, C. J., and Dowhan, W. (1998). The PEL1 gene (renamed PGS1) encodes the phosphatidyl glycero-phosphate synthase of Saccharomyces  cerevisiae. J Biol Chem. 273, 9829-36. Chapman, K. D. (1998). Phospholipase activity during plant growth and development and in response to environmental stress. Trends in Plant Science 3, 419-426. Chen, S. C., Muller, M., Zhou, J. Z., Wright, L. C., and Sorrell, T. C. (1997). Phospholipase activity in Cryptococcus  neoformans:  a new virulence factor?  J Infect  Dis. 775,414-20. Chen, S. C., Wright, L. C., Santangelo, R. T., Muller, M., Moran, V. R., Kuchel, P. W., and Sorrell, T. C. (1997). Identification  of  extracellular phospholipase B, lysophospholipase, and acyltransferase  produced by Cryptococcus  neoformans.  Infect Immun. 65, 405-11. Cox, G. M., McDade, H. C., Chen, S. C., Tucker, S. C., Gottfredsson,  M., Wright, L. C., Sorrell, T. C., Leidich, S. D., Casadevall, A., Ghannoum, M. A., and Perfect,  J. R. (2001). Extracellular phospholipase activity is a virulence factor  for  Cryptococcus neoformans.  Mol Microbiol 39, 166-75. Davidson, R. C., Blankenship, J. R., Kraus, P. R., de Jesus Berrios, M., Hull, C. M., D'Souza, C., Wang, P., and Heitman, J. (2002). A PCR-based strategy to generate integrative targeting alleles with large regions of  homology. Microbiology. 148, 2607-15. Dennis, E. A. (1997). The growing phospholipase A2 superfamily  of  signal transduction enzymes. Trends Biochem Sci. 22, 1-2. Dennis, E. A., Ackermann, E. J., Deems, R. A., and Reynolds, L. J. (1995). Multiple forms  of  phospholipase A2 in macrophages capable of  arachidonic acid release for  eicosanoid biosynthesis. Adv Prostaglandin Thromboxane Leukot Res. 23, 75-80. Derewenda, Z. S., and Derewenda, U. (1998). The structure and function  of platelet-activating factor  acetylhydrolases. Cell Mol Life  Sci. 54, 446-55. Dhondt, S., Geoffroy,  P., Stelmach, B. A., Legrand, M., and Heitz, T. (2000). Soluble phospholipase A2 activity is induced before  oxylipin accumulation in tobacco mosaic virus-infected  tobacco leaves and is contributed by patatin-like enzymes. Plant J. 23, 431-40. Durrenberger, F., Laidlaw, R. D., and Kronstad, J. W. (2001). The hgll gene is required for  dimorphism and teliospore formation  in the fungal  pathogen Ustilago maydis.  Mol Microbiol. 41, 337-48. Ella, K. M., Dolan, J. W., Qi, C., and Meier, K. E. (1996). Characterization of Saccharomyces  cerevisiae deficient  in expression of  phospholipase D. Biochem J. 314, 15-9. Ghannoum, M. A. (2000). Potential role of  phospholipases in virulence and fungal  pathogenesis. Clin Microbiol Rev 13, 122-43, table of  contents. Holliday, R. (1974). Ustilago  maydis.  In Handbook of  Genetics, R. C. King, ed. (New York: Plenum Press), pp. 575-595. Hube, B. (1998). Possible role of  secreted proteinases in Candida  albicans infections.  Rev Iberoam Micol 15, 65-68. Hube, B., Stehr, F., Bossenz, M., Mazur, A., Kretschmar, M., and Schafer,  W. (2000). Secreted lipases of  Candida  albicans',  cloning, characterisation and expression analysis of  a new gene family  with at least ten members. Arch Microbiol. 174, 362-14. Ibrahim, A. S., Mirbod, F., Filler, S. G., Banno, Y., Cole, G. T., Kitajima, Y., Edwards, J. E., Jr., Nozawa, Y., and Ghannoum, M. A. (1995). Evidence implicating phospholipase as a virulence factor  of  Candida  albicans. Infect  Immun. 63, 1993-8. Kamper, J., Kahmann, R., Bolker, M., Li-Jun Ma, L., Brefort,  T., Saville, B. J., Banuett, F., Kronstad, J. W., Gold, S. E., Muller, O., Perlin, M. H., Wosten, H. A. B., deVries, R., Ruiz-Herrera, J., Reynaga-Pena, C. G., Snetselaar, K., McCannl, M., Perez-Martin, J., Feldbrugge, M., Basse, C. W., Steinberg, G., Ibeas, J. I., Holloman, W., Guzman, P., Farman, M., Stajich, J. E., Sentandreu, R., Gonzalez-Prietro, J. M., Kennell, J. C., Molina, L., Sehirawski, J., Mendoza-Mendoza, A., Greilinger, D., Munch, K., Rossel, M., Scherer, M., Vranes, M., Ladendorf,  O., Vincon, V., Fuchs, U., Sandrock, B., Meng, S., Ho, E. C. H., Cahill, M. J., K. J. Boyce, Klose, J., Klosterman, S. J., Deelstra, H. J., Ortiz-Castellanos, L., Li, W., Sanehez-Alonso, P., Schreier, P. H., Hauser-Hahn, I., Vaupel, M., Koopmann, E., Friedrich, G., Voss, H., Schliiter, T., Margolis, J., Piatt, D., Swimmer, C., Gnirke, A., Chen, F., Vysotskaia, V., Mannhaupt, G., Giildener, U., Miinsterkotter, M., Haase, D., Oesterheld, M., Mewes, H., Mauceli, E. W., DeCaprio, D., Wade, C. M., Butler, J., Young, S., Jaffe,  D. D., Calvo, S., Nusbaum, C., Galagan, J., and Birren, B. W. (in press). Insights from  the genome of  the biotrophic fungal  plant pathogen Ustilago  maydis.  Nature. Klose, J., Moniz de Sa, M. M., and Kronstad, J. W. (2004). Lipid-induced filamentous  growth in Ustilago  maydis.  Mol Microbiol 52, 823-35. Ko, Y. T., Frost, D. J., Ho, C. T., Ludescher, R. D., and Wasserman, B, P. (1994). Inhibition of  yeast (l,3)-beta-glucan synthase by phospholipase A2 and its reaction products. Biochim Biophys Acta. 1193, 31-40. Leidich, S. D., Ibrahim, A. S., Fu, Y., Koul, A., Jessup, C., Vitullo, J., Fonzi, W., Mirbod, F., Nakashima, S., Nozawa, Y., and Ghannoum, M. A. (1998). Cloning and disruption of  caPLBl, a phospholipase B gene involved in the pathogenicity of  Candida albicans. J Biol Chem. 273, 26078-86. Matoba, Y., Katsube, Y., and Sugiyama, M. (2002). The crystal structure of prokaryotic phospholipase A2. J Biol Chem. 277,  20059-69. Meldrum, E., Parker, P. J., and Carozzi, A. (1991). The Ptdlns-PLC superfamily and signal transduction. Biochim Biophys Acta. 1092, 49-71. Munnik, T., Irvine, R. F., and Musgrave, A. (1998). Phospholipid signalling in plants. Biochim Biophys Acta. 1389, 222-72. Narvaez-Vasquez, J., Florin-Christensen, J., and Ryan, C. A. (1999). Positional specificity  of  a phospholipase A activity induced by wounding, systemin, and oligosaccharide elicitors in tomato leaves. Plant Cell. 11, 2249-60. Nespoulous, C., Gaudemer, O., Huet, J. C., and Pernollet,- J. C. (1999). Characterization of  elicitin-like phospholipases isolated from  Phytophthora  capsici culture filtrate.  FEBS Lett 452, 400-6. Noverr, M. C., Phare, S. M., Toews, G. B., Coffey,  M. J., and Huffnagle,  G. B. (2001). Pathogenic yeasts Cryptococcus  neoformans  and Candida  albicans produce immunomodulatory prostaglandins. Infect  Immun. 69, 2957-63. Noverr, M. C., Toews, G. B., and Huffnagle,  G. B. (2002). Production of prostaglandins and leukotrienes by pathogenic fungi.  Infect  Immun. 70, 400-2. Paul, R., Hoik, A., and Scherer, G. F. E. (1998). Fatty acids and lysophospholipids as potential second messengers in auxin action: rapid activation of phospholipase A2 activity by auxin in suspension-cultured parsley and soybean cells. Plant J  16, 601-611. Resnick, R. J., and Tomaska, L. (1994). Stimulation of  yeast adenylyl cyclase activity by lysophospholipids and fatty  acids. Implications for  the regulation of Ras/effector  function  by lipids. J Biol Chem. 269, 32336-41. Rhee, S. G., and Choi, K. D. (1992). Multiple forms  of  phospholipase C isozymes and their activation mechanisms. Adv Second Messenger Phosphoprotein Res. 26, 35-61. Rhee, S. G., and Choi, K. D. (1992). Regulation of  inositol phospholipid-specific phospholipase C isozymes. J Biol Chem. 267,  12393-6. Rose, K., Rudge, S. A., Frohman, M. A., Morris, A. J., and Engebrecht, J. (1995). Phospholipase D signaling is essential for  meiosis. Proc Natl Acad Sci U S A. 92, 12151-5. Saffer,  L. D., Long Krug, S. A., and Schwartzman, J. D. (1989). The role of phospholipase in host cell penetration by Toxoplasma  gondii.  Am J Trop Med Hyg. 40, 145-9. Sambrook, J. E., Fritsch, F., and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd Edition (New York: Cold Spring Harbor Laboratory Press). Schaller, M., Borelli, C., Korting, H. C., and Hube, B. (2005). Hydrolytic enzymes as virulence factors  of  Candida  albicans. Mycoses 48, 365-377. Schmiel, D. H., and Miller, V. L. (1999). Bacterial phospholipases and pathogenesis. Microbes Infect.  1, 1103-12. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of  progressive multiple sequence alignment through sequence weighting, position-specific  gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-80. Toffaletti,  D. L., Rude, T. H., Johnston, S. A., Durack, D. T., and Perfect,  J. R. (1993). Gene transfer  in Cryptococcus  neoformans  by use of  biolistic delivery of  DNA. J Bacteriol. 175, 1405-11. Tsitsigiannis, D. I., Bok, J. W., Andes, D., Nielsen, K. F., Frisvad, J. C., and Keller, N. P. (2005a). Aspergillus  cyclooxygenase-like enzymes are associated with prostaglandin production and virulence. Infect  Immun. 73, 4548-59. van den Berg, B., Tessari, M., de Haas, G. H., Verheij, H. M., Boelens, R., and Kaptein, R. (1995). Solution structure of  porcine pancreatic phospholipase A2. Embo J. 14, 4123-31. Waite, M. (1996). Phospholipases. In Biochemistry of  Lipids, Lipoproteins and Membranes., D. E. Vance and J. Vance, eds. (Amsterdam: Elsevier), pp. 211-236. Waksman, M., Eli, Y., Liscovitch, M., and Gerst, J. E. (1996). Identification  and characterization of  a gene encoding phospholipase D activity in yeast. J Biol Chem. 271, 2361-4. Walker, D. H., Firth, W. T., Ballard, J. G., and Hegarty, B. C. (1983). Role of phospholipase-associated penetration mechanism in cell injury by Rickettsia  rickettsii. Infect  Immun. 40, 840-2. Wang, J., Holden, D. W., and Leong, S. A. (1988). Gene transfer  system for  the phytopathogenic fungus  Ustilago  maydis.  Proc Natl Acad Sci U S A 85, 865-9. 6. DISCUSSION 6.1. The role of  lipids in plant-fungal  interactions U.  maydis  has emerged as an important model for  plant pathogenic basidiomycetous fungi,  a large group of  pathogens that cause smut and rust diseases of plants. U.  maydis  is also an important model for  developing an understanding of  various aspects of  biotrophic parasitism. In the past, efforts  in the research community led to the identification  of  some of  the key players in signaling pathways that regulate mating, morphogenesis and pathogenicity in U.  maydis.  However, not much research has been done to characterize processes occurring once the fungus  is in contact with the host plant. To date, little is known about fungal  genes that control or are required for  development in the plant, and even less is known about host signals that may contribute to pathogen development. Nutritional requirements of  the fungus  during biotrophic growth, which coincide with infection,  are only just now being explored. The complexity of  the maize-Ustilago  relationship and the obligate nature of  part of  the fungal  life  cycle have made it difficult  to study the factors  required for  pathogenic interactions directly. Alternative strategies are therefore  necessary to investigate U.  maydis  pathogenesis. One of  the approaches is to use fungal  cells undergoing infection-related  morphological changes in culture (e.g., yeast-to-hyphal transition). These studies are based on the assumption that the genes expressed during the morphological changes would also be expressed during infection  in plants. In the work described in this thesis, yeast-to-hyphal morphological changes associated with pathogenesis were used to identify  and characterize novel signals contributing to morphogenesis in U.  maydis.  Furthermore, the available U.  maydis genomic sequence allowed for  selection and subsequent targeted gene deletion of candidate genes to characterize the role of  lipid metabolism and signaling in the pathogenesis of  the fungus. 6.2. Lipids as a novel signal in fungal  morphogenesis As described in Chapter 2, part of  this work resulted in a characterization of  a novel lipid-related signal that influences  morphogenesis of  U.  maydis.  Specifically,  corn and other plant oils, and fatty  acids serve both as carbon sources and as signals to initiate filamentous  growth that resembles the morphology of  dikaryotic cells necessary for  the infection  of  host tissue. Levels of  lipids as low as 4 nM of  palmitic acid induced filamentous  growth. Such a low concentration represents an insignificant  nutrient source but is comparable with bioactive concentrations for  other fungal  signals including non-peptidyl fungal  sex hormones such as antheridiol or trisporic acid (Gooday, 1983) or surface  wax extracts (Podila et al., 1993). For example, the wax extract from  avocado at approximately 10 nM was sufficient  to induce spore germination and appressorium formation  in C. gloeosporioides,  and this process appears to involve cAMP signaling pathway (Kim et al., 2001). I speculate that lipid signals may be transduced at least in part via the Ras/MAPK pathway in U.  maydis  because I found  that mutants lacking the components of  this pathway did not respond to lipids by filamentous  growth. Both the cAMP/PKA and Ras/MAPK pathways are known to regulate morphogenesis and pathogenesis in U.  maydis.  However, the roles of  the pathways appear to be antagonistic with respect to filamentous  growth (Kruger et al., 1998). The activated Ras/MAPK pathway stimulates production of  filaments  (Lee and Kronstad, 2002), but high PKA activity is associated with budding growth (Durrenberger et al., 1998; Gold et al., 1994). Interestingly, both pathways were required for  the lipid-induced filamentous  growth. Perhaps the MAPK pathway determines perception of  a signal indicating the presence of a host, and evaluation of  the nutritional status is perceived via the cAMP pathway. A similar interconnection of  the two pathways occurs in S. cerevisiae to control pseudohyphal growth (Lorenz and Heitman, 1997; Mosch et al., 1999; Rupp et al., 1999). Studies in other fungi  on the role of  lipids in morphogenesis highlight the possibility that derivatives of  fatty  acids, perhaps generated by fungal  activities, could serve as signaling molecules. For example, reproductive development (i.e., sporogenesis) of  filamentous  fungi  has been shown to be influenced  by perception of  oxylipins (Calvo et al., 1999; Goodrich-Tanrikulu et al., 1998; Katayama and Marumo, 1978; Nukina et al., 1981; Rai et al., 1967; Tsitsigiannis et al., 2005b). In addition, oxylipins have been shown to play a role in fungal  pathogenesis (Deva et al., 2001, 2000; Noverr et al., 2001, 2002). For example, enhanced prostaglandin production during fungal  infection  in C. albicans and C. neoformans  appears to promote fungal  colonization and chronic infection in humans. These fungi  are able to produce the prostaglandins de  novo or via conversion of  exogenous arachidonic acid (Noverr et al., 2001, 2002). PLA2 is known to cleave off the acyl group in some specific  biolipids resulting in mobilization of  arachidonic acid and production of  signaling lipids such as oxylipins. Deletion of  a gene encoding a putative PLA2 (lip2)  in U.  maydis  (Chapter 5) enhanced disease symptom development and increased spore germination. This suggests that Lip2 may contribute to production of signaling lipids that provide important signals necessary for  developmental changes during U.  maydis  infection.  In S. cerevisiae, products of  PLA2 activity (i.e., fatty  acids) stimulate adenylyl cyclase (Resnick and Tomaska, 1994). Therefore,  one could speculate that Lip2 may help to regulate fungal  proliferation  by influencing  cAMP levels via adenylyl cyclase and that this process might maintain a balance between proliferation  and disease symptom induction during the biotrophic phase for  U.  maydis.  One could also imagine that U.  maydis  is capable of  modifying  host lipids to generate signals that support filamentous  growth of  the fungus  during infection.  This potential role of  PLA2 in generating endogenous lipid signals during the pathogenic growth of  U.  maydis  adds another level of  complexity to the role of  lipid signaling. 6.3. The role of  P-oxidation in the pathogenesis of  U.  maydis The nutritional sources available to biotrophic fungi  during infection  may play a specific  role in allowing growth and progression of  life  cycle in planta  that is otherwise impossible to achieve in culture. One could imagine that several tightly controlled levels of  regulation exist for  metabolic genes during fungal  growth in planta,  and that this regulation leads to a controlled progression of  the fungal  life  cycle during host invasion. One possibility is that these fungi  acquire the competence to regulate their metabolic genes in response to specific  signals from  the host plants (e.g., plant lipids). The experimental data described in this thesis (Chapter 2) suggested that fatty  acids serve as a carbon source for  growth and/or as signaling molecules important for  morphogenesis. The presence of  lipids and absence of  glucose were required for  filamentous  growth in U. maydis  (Chapter 2; Klose et al., 2004). The glucose suppression in particular suggests that there is a metabolic component for  lipid-induced filamentation.  If  the lipid response is relevant to growth in planta,  then the timing of  utilization of  different  carbon sources may be important, and specialized interfaces  may develop between hyphae and the host cells. Certainly these interfaces  in the form  of  haustorial feeding  structures are well described in other biotrophic fungal  pathogens (Birch et al., 2006; Mendgen and Hahn, 2002). The work in Chapters 3 and 4 of  this thesis described a targeted gene deletion approach to generate mutants impaired in their ability to utilize fatty  acids as a way to separate the contributions of  carbon source utilization from  signaling. That is, the work addressed the question whether the fatty  acid-induced morphological change was due to a nutritional signal or a developmental signal? Therefore,  genes encoding enzymes in peroxisomal and mitochondrial P-oxidation of  fatty  acids (mfe2  and hadl,  respectively) were deleted and characterized to assess the role of  lipid metabolism in lipid-induced morphological transition and virulence in U.  maydis.  What emerges from  this study is that the P-oxidation enzymes appear to be required for  morphological changes induced by specific  fatty  acids, however they are not essential for  lipid utilization during infection. This suggests that lipid utilization in biotrophic fungi  may affect  various phases of infection  such as, for  example, perception of  the host plant environment or host defense. It is interesting that U.  maydis  appears to possess a mitochondrial P-oxidation system because previous work in yeast concluded that this system was not present in fungi  (Chapter 4; Klose and Kronstad, 2006). Deletion of  the peroxisomal and the mitochondrial P-oxidation genes revealed that both pathways work together to allow metabolism of  a range of  different  fatty  acids in U.  maydis.  Intriguingly, the two P-oxidation systems were required during specific  stages of  the U.  maydis  life  cycle during infection.  Neither P-oxidation system was required for  cell fusion  and initial formation of  the infectious  dikaryon that results from  mating reactions between compatible haploid sporidia. Thus mating is independent of  the P-oxidation functions  as defined  by mfe2  and hadl.  The mitochondrial P-oxidation system seems to be important in early stages of infection,  which involve teliospore germination, penetration of  a plant surface  and establishment of  infection.  Possibly, mitochondrial P-oxidation allows utilization of alternative carbon sources during early infectious  stages when available nutrients are limited, and/or allows utilization of  intracellular fungal  lipids for  infection-related morphological development (e.g., penetration). The peroxisomal P-oxidation system appears to play an important role in the later stages of  development, which involve extensive proliferation  in infected  host tissue and sporulation. Thus, peroxisomal P-oxidation may be important specifically  in the degradation of  plant lipids to provide energy to allow extensive proliferation.  The activity of  this catabolic system might also alter the metabolic profile  of  intracellular fungal  lipids to coordinate developmental changes during infection  (e.g., sporulation). The individual developmental stages of  U. maydis  are outlined and the requirements for  both Mfe2  and Hadl enzymes are presented in the model (Figure 6.1) to summarize potential roles of  p-oxidation during U.  maydis infection. In summary, three possible roles for  p-oxidation systems in U.  maydis morphogenesis and pathogenesis may be concluded from  the research presented in this thesis. One possible role is to provide the fungus  with the ability to metabolize alternative carbon sources such as fungal  storage lipids during early stages of  infection (mitochondrial P-oxidation) and plant lipids to maintain the extensive proliferation  during later stages of  infection  when the host tissue is depleted of  nutrients (peroxisomal p-oxidation). A second possible role is that P-oxidation functions  alter the metabolic profile  of  intracellular lipids to coordinate the infection-related  morphological changes or to provide substrates for  production of  signaling lipids that play a role in morphogenesis. The evidence for  the hypothesized signaling role is based on the observations that both Hadl and Mfe2  were required for  the filamentation  response to specific  fatty  acids depending on the saturation and carbon chain length of  the fatty  acid. Therefore,  these fatty  acids may play a specific  signaling role either directly or indirectly after  processing to form  derivatives such as oxylipins. In addition, the P-oxidation function  may also have an indirect effect  on morphogenesis by altering composition of  intracellular fatty acids. A third possible role for  P-oxidation in U.  maydis  may be an influence  on plant lipid signaling that may indirectly interfere  with a defense  response to alter penetration and/or filamentous  proliferation.  Little is known about the defense  response of  maize to infection  by U.  maydis.  Recently, Basse (2005) demonstrated that U.  maydis  is capable of  suppressing a defense  response in maize. During biotrophic interactions, highly regulated secretory activities are required from  both the fungus  and the host to form  the interface  layers that contribute in an unknown way to the maintenance of  compatibility and to the lack of  host defense  mechanisms (Hahn and Mendgen, 2001; Moerschacher et al., 1999). Perhaps the P-oxidation genes are regulated in response to specific  signals from  the host plants and thus contribute to the formation  of  the interface  layers between the fungus  and maize and the suppression of  defense  responses. In summary, the research presented in this thesis reveals the critical importance of basic metabolic pathways involving lipids in the development of  a fungal  disease, not only by providing energy for  growth but also by providing substrates for  production of potential signaling compounds. 6.4. Future perspectives The work described in this thesis provides a framework  to address the role of lipids in plant-fungal  interactions. These novel observations may have general implications for  understanding fungal  biotrophy with respect to nutritional requirements, pathogen perception of  the host environment and plant defense.  There are many exciting possibilities for  future  work, such as further  investigation of  the signaling aspects and the interaction with the host during U.  maydis  infection,  and a list of  possible follow-up experiments is presented below. 1) Examination of  the regulation of  lip2  and possible connections between PLA2 and cAMP signaling It would be informative  to examine the expression of  the lip2 gene in mutants deleted for  components of  the PKA/cAMP signaling pathway known to regulate morphogenesis and pathogenesis. This could potentially reveal a connection between Lip2 and cAMP signaling and give clues to support a possible role of  Lip2 in regulating adenylyl cyclase activity and thus cAMP levels during infection.  The regulation of adenylyl cyclase by the products of  PLA2 activity is suggested based on studies in S. cerevisiae (Resnick and Tomaska, 1994). Using these studies as a guide, one could also examine adenylyl cyclase activity in extracts of  wild type and mutant (e.g., Iip2  mutants) cells. In addition, lip2 gene expression could be assessed in fungal  cells in tumor tissue to determine whether the gene might play a role in infection. 2) The dissection of  the U.  maydis  response to lipid signals using a mutant screen Mutagenesis and complementation of  mutations can be applied as a non-biased approach to discover genes that are important for  lipid-induced morphological changes. Characterization of  mutant strains that are no longer responding to lipids may reveal whether the morphological response to lipids is relevant to fungal  development in planta, and therefore  important in fungal  pathogenesis. In addition, this could identify  key components required in plant-pathogen interactions. A screen for  mutants unable to respond to fatty  acids by filamentation  has been initiated and a total of  40 mutants in a a2b2 strain and 54 in a albl  strain were collected. (Klose and Kronstad, unpublished). Based on the differences  in the cellular and colony morphology of  the yeast-like mutants, they were separated into eight categories; one hyperfrlamentous  mutant was also found. The mutants are now ready to be transformed  with a cosmid library in an attempt to clone the genes that are defective  in these mutants by complementation. The follow-up  work on the characterization of  the complementing gene(s) may lead to the exciting discovery of  factors  important for  biotrophic growth of  U.  maydis,  and perhaps reveal some key functions  involved in plant-pathogen interactions. 3) Whole genome approaches to identify  genes involved in lipid-induced filamentation To identify  genes involved in morphological changes in response to lipids, genomic approach such as transcript profiling  may be used. That is, one could use the recently completed genome sequence and tools such as Serial Analysis of  Gene Expression (SAGE) and microarray analysis to compare, for  example, the transcripts of the wild-type strain grown under filament-inducing  conditions in the presence of  fatty acids with glucose-grown cells. This comparison would likely reveal genes encoding factors  important to initiate and maintain filamentation  and metabolic functions  for fungal  proliferation  on the different  carbon sources. In addition, the transcripts of  fatty acid-induced filamentous  cells of  the mfe2  or hadl  mutant strains could be compared with the mutant cells grown in non-inducing fatty  acids. This could result in identification  of  genes for  proteins important for  processing or production of  signaling lipid molecules that influence  morphological changes in U.  maydis.  In addition, such comparisons may also shed additional light on signal transduction pathways and regulatory elements involved in lipid sensing and lipid-induced morphogenesis. Candidate genes could than be tested for  their role in morphogenesis and virulence by constructing deletion mutants and testing these for  their ability to undergo morphological changes in the presence of  various fatty  acids, to proliferate  in planta,  and to induce disease symptoms. 4) Genetic and biochemical studies to explore a role of  oxylipins in the induction of  morphological and developmental responses in U.  maydis. The analysis of  types of  lipids that trigger filamentation  in U.  maydis  has not been exhaustive and one could propose testing other compounds (e.g., oxylipins) for  activity. Additionally, the targeted mutation of  genes required for  oxylipin biosynthesis such as lipoxygenases may elucidate the involvement of  oxylipins in pathogenesis of  U.  maydis. For example, mutation in such genes in A. nidulans  influences  the transcription of  genes governing sporulation and secondary metabolism (Tsitsigiannis and Keller, 2006; Tsitsigiannis et al., 2004a, 2005b). Therefore,  lipoxygenase genes could influence  fungal development of  U.  maydis  during infection.  In addition, endogenous fungal  oxylipins have been successfully  isolated from  several fungal  genera (Brodowsky et al., 1992; Nakayama et al., 1996; Su and Oliw, 1996). Therefore,  such compounds could potentially be isolated from  U.  maydis  and tested for  their ability to influence morphogenesis. In addition, not only endogenous fungal  oxylipins, but also plant-derived oxylipins have been shown to influence  sporulation and secondary metabolism in Aspergillus  spp. (Burow et al., 1997; Calvo et al., 1999). Furthermore, fungal colonization leads to changes in levels in bioactive oxylipins by activating or repressing seed lipoxygenase gene expression (Burow et al., 2000; Tsitsigiannis et al., 2005a). Therefore,  plant oxylipins extracted from  maize plants could be tested for  their ability to induce developmental responses of  U.  maydis.  The in vitro tests could include the filament  production in the presence of  oxylipins with an assessment of  the ability to produce branched filaments,  clamp-like structures, hyphal septa, and the ability to sporulate. These studies may reveal a possible role of  plant or fungal  oxylipins in regulating the morphogenesis and therefore  pathogenesis of  U.  maydis. 5) Examination of  the defense  response of  maize to U.  maydis  infection  and the role of  lipid metabolism in this process. Assays for  plant defense  responses such as the deposition of  callose upon penetration, the formation  of  reactive oxygen species (ROS), or the expression of pathogenesis related (PR) genes could be performed  in parallel with observations of phenotypic responses in the host to infections  with the wild-type and the P-oxidation mutant strains of  U.  maydis.  Some biotrophic fungi  such as powdery mildew fungi  elicit callose deposition and the extracellular generation of  reactive oxygen species in host plants (Huckelhoven and Kogel, 2003; Thordal-Christensen et al., 1997). However, rust fungi,  which are closely related to U.  maydis,  often  cause no detectable plant defense responses to cell wall penetration, and data suggest that this lack of  a plant reaction is due to active suppression by the fungus  (Heath, 1998; Skalamera et al., 1997). Therefore, these experiments would initially test whether there are detectable plant defense responses to the wild-type strains of  U.  maydis.  Then the difference  in plant defenses between the infections  with wild-type strains and p-oxidation mutants could be determined. Such observations might provide insight into whether p-oxidation contributes to suppression of  defense  responses during infection.  Some defense responses can be visualized using microscopy after  specific  treatments. For example, callose deposition can be detected on the plant wall as fluorescent  tissue when stained with aniline blue. To assess the formation  of  ROS, 3,3'-diaminobenzidine-tetrahydrochloride (DAB) can be injected into leaves to visualize H 2 0 2 or nitroblue tetrazolium (NBT) can be used to detect superoxide (02~) generation. The expression of maize pathogenicity related gene PR-1 can also be analyzed (e.g., by RT-PCR) to investigate the plant defense  response during infections  with wild type or mutant strains (e.g., mfe2  and hadl).  Maize cultivars resistant to U.  maydis  could also be used for comparisons, although very little is known about the mechanisms of  resistance. Furthermore, the cuticle of  a leaf,  which is the mechanical barrier that the plants protect themselves from  invasion by pathogens, can be removed to further  assess the ability of the strains to bypass/suppress the plant defense  response. Finally, plants also use secondary metabolites to protect themselves against pathogens and there are three main classes of  that could be tested for  an influence  on U.  maydis:  phenolics, nitrogen based compounds and terpenes. Thus, one might consider testing such compounds for  their influence  on the growth and morphology of  wild type strains and the P-oxidation mutants, especially the hadl  mutant, which appears to be defective  in penetration of  plant tissue and establishment in planta. a o • -H -M u Fungal development Germination Mating Penetration In  planta  proliferation Sporulation Role for mfe2 no no no partial partial Role for had 1 yes no partial ? ? Figure 6.1 Potential roles of  P - o x i d a t i o n during U.  maydis  infection. A summary of  requirements for  the peroxisomal (Mfe2)  and the mitochondrial (Hadl) P-oxidation enzymes during individual developmental stages of  U.  maydis. 6.5. References Basse, C. W. (2005). Dissecting defense-related  and developmental transcriptional responses of  maize during Ustilago  maydis  infection  and subsequent tumor formation.  Plant Physiol. 138, 1774-84. Birch, P. R., Rehmany, A. P., Pritchard, L., Kamoun, S., and Beynon, J. L. (2006). Trafficking  arms: oomycete effectors  enter host plant cells. Trends Microbiol. 14, 8-11. Epub 2005 Dec 13. Brodowsky, I. D., Hamberg, M., and Oliw, E. H. (1992). A linoleic acid (8R)-dioxygenase and hydroperoxide isomerase of  the fungus  Gaeumannomyces graminis. Biosynthesis of  (8R)-hydroxylinoleic acid and (7S,8S)-dihydroxylinoleic acid from  (8R)-hydroperoxylinoleic acid. J Biol Chem. 267,  14738-45. Burow, G. B., Gardner, H. W., and Keller, N. P. (2000). A peanut seed lipoxygenase responsive to Aspergillus  colonization. Plant Mol Biol 42, 689-701. Burow, G. B., Nesbitt, T. C., Dunlap, J., and Keller, N. P. (1997). Seed lipoxygenase products modulate Aspergillus  mycotoxin biosynthesis. Mol Plant-Microbe Interact 10, 380-387. Calvo, A. M., Hinze, L. L., Gardner, H. W., and Keller, N. P. (1999). Sporogenic effect  of  polyunsaturated fatty  acids on development of  Aspergillus  spp. Appl Environ Microbiol. 65, 3668-73. Deva, R., Ciccoli, R., Kock, L., and Nigam, S. (2001). Involvement of  aspirin-sensitive oxylipins in vulvovaginal candidiasis. FEMS Microbiol Lett. 198, 37-43. Deva, R., Ciccoli, R., Schewe, T., Kock, J. L., and Nigam, S. (2000). Arachidonic acid stimulates cell growth and forms  a novel oxygenated metabolite in Candida albicans. Biochim Biophys Acta. 1486, 299-311. Durrenberger, F., Wong, K, and Kronstad, J. W. (1998). Identification  of  a cAMP-dependent protein kinase catalytic subunit required for  virulence and morphogenesis in Ustilago  maydis.  Proc Natl Acad Sci USA. 95, 5684-9. Gold, S., Duncan, G., Barrett, K, and Kronstad, J. (1994). cAMP regulates morphogenesis in the fungal  pathogen Ustilago  maydis.  Genes Dev. 8, 2805-16. Gooday, G. W. (1983). Hormones and sexuality in fungi.  In Secondary Metabolism and Differentiation  in Fungi., J. W. Bennett and A. Ciegler, eds. (New York: Marcel Dekker, Inc.), pp. 239-266. Goodrich-Tanrikulu, M., Howe, K., Stafford,  A., and Nelson, M. A. (1998). Changes in fatty  acid composition of  Neurospora  crassa accompany sexual development and ascospore germination. Microbiology. 144, 1713-20. Hahn, M., and Mendgen, K. (2001). Signal and nutrient exchange at biotrophic plant-fungus  interfaces.  Curr Opin Plant Biol. 4, 322-7. Heath, M. C. (1998). Involvement of  reactive oxygen species in the response of resistant (hypersensitive) or susceptible cowpeas to the cowpea rust fungus.  New Phytologist 138, 251-263. Huckelhoven, R., and Kogel, K. H. (2003). Reactive oxygen intermediates in plant-microbe interactions: who is who in powdery mildew resistance? Planta. 216, 891-902. Katayama, M., and Marumo, S. (1978). R(2)-glycerol monolinoleate, a minor sporogenic substance of  Sclerotinia fructicola.  Agric Biol Chem 42, 1431-1433. Kim, Y. S., Lee, H. H., Ko, M. K., Song, C. E., Bae, C. Y., Lee, H. Y., and Oh, B.-J. (2001). Inhibition of  fungal  appressorium formation  by pepper (Capsicum annuum) esterase. Mol Plant-Microbe Interact 14, 80-85. Klose, J., and Kronstad, J. W. (2006). The Multifunctional  beta-oxidation enzyme is required for  full  symptom development by the biotrophic maize pathogen Ustilago maydis.  Eukaryot Cell 22, 22. Klose, J., Moniz de Sa, M. M., and Kronstad, J. W. (2004). Lipid-induced filamentous  growth in Ustilago  maydis.  Mol Microbiol 52, 823-35. Kruger, J., Loubradou, G., Regenfelder,  E., Hartmann, A., and Kahmann, R. (1998). Crosstalk between cAMP and pheromone signalling pathways in Ustilago maydis.  Mol Gen Genet. 260, 193-8. Lee, N., and Kronstad, J. W. (2002). ras2 Controls morphogenesis, pheromone response, and pathogenicity in the fungal  pathogen Ustilago  maydis.  Eukaryot Cell. 1, 954-66. Lorenz, M. C., and Heitman, J. (1997). Yeast pseudohyphal growth is regulated by GPA2, a G protein alpha homolog. EMBO J 16, 7008-18. Mendgen, K., and Hahn, M. (2002). Plant infection  and the establishment of fungal  biotrophy. Trends Plant Sci. 7, 352-6. Moerschacher, B., Mierau, M., Graener, B., Noll, U., and Mort, A. (1999). Small oligomers of  galacturonic acid are endogenous suppressors of  disease resistance reactions in wheat leaves. J Exp Bot 50, 605-612. Mosch, H. U., Kubler, E., Krappmann, S., Fink, G. R., and Braus, G. H. (1999). Crosstalk between the Ras2p-controlled mitogen-activated protein kinase and cAMP pathways during invasive growth of  Saccharomyces  cerevisiae. Mol Biol Cell 10, 1325-35. Nakayama, N., Takemae, A., and Shoun, H. (1996). Cytochrome P450foxy,  a catalytically self-sufficient  fatty  acid hydroxylase of  the fungus  Fusarium  oxysporum. J Biochem (Tokyo). 119, 435-40. Noverr, M. C., Phare, S. M., Toews, G. B., Coffey,  M. J., and Huffnagle,  G. B. (2001). Pathogenic yeasts Cryptococcus  neoformans  and Candida  albicans produce immunomodulatory prostaglandins. Infect  Immun. 69, 2957-63. Noverr, M. C., Toews, G. B., and Huffnagle,  G. B. (2002).. Production of prostaglandins and leukotrienes by pathogenic fungi.  Infect  Immun. 70, 400-2. Nukina, M., Sassa, T., Ikeda, M., Takahasi, K., and Toyota, S. (1981). Linoleic acid enhances perithecial production in Neurospora  crassa. Agric Biol Chem 45, 2371— 2373. Podila, G. K., Rogers, L. M., and Kolattukudy, P. E. (1993). Chemical Signals from  Avocado Surface  Wax Trigger Germination and Appressorium Formation in Colletotrichum  gloeosporioides.  Plant Physiol. 103, 267-272. Rai, J. N., Tewari, J. P., and Sinha, A. K. (1967). Effects  of  environmental conditions on sclerotia and cleistothecial production in Aspergillus.  Mycopathol Mycol Appl 31, 209-224. Resnick, R. J., and Tomaska, L. (1994). Stimulation of  yeast adenylyl cyclase activity by lysophospholipids and fatty  acids. Implications for  the regulation of Ras/effector  function  by lipids. J Biol Chem. 269, 32336-41. Rupp, S., Summers, E., Lo, H. J., Madhani, H., and Fink, G. (1999). MAP kinase and cAMP filamentation  signaling pathways converge on the unusually large promoter of the yeast FLOll  gene. EMBO J 18, 1257-69. Skalamera, D., Jibodh, S., and Heath, M. C. (1997). Callose deposition during the interaction between cowpea (Vigna  unguiculata)  and the monokaryotic stage of  the cowpea rust fungus  (Uromyces  vignae). New Phytologist 136, 511-524. Su, C., and Oliw, E. H. (1996). Purification  and characterization of  linoleate 8-dioxygenase from  the fungus  Gaeumannomyces graminis as a novel hemoprotein. J Biol Chem 271, 14112-14118. Thordal-Christensen, H., Zhang, Z., Wei, Y., and Collinge, D. (1997). Subcellular localization of  H202 in plants: H202 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. Plant J 11, 1187-1194. Tsitsigiannis, D. I., Bok, J. W., Andes, D., Nielsen, K. F., Frisvad, J. C., and Keller, N. P. (2005a). Aspergillus  cyclooxygenase-like enzymes are associated with prostaglandin production and virulence. Infect  Immun. 73, 4548-59. Tsitsigiannis, D. I., and Keller, N. P. (2006). Oxylipins act as determinants of natural product biosynthesis and seed colonization in Aspergillus  nidulans.  Mol Microbiol. 59, 882-92. Tsitsigiannis, D. I., Kowieski, T. M., Zarnowski, R., and Keller, N. P. (2004a). Endogenous lipogenic regulators of  spore balance in Aspergillus  nidulans.  Eukaryot Cell. 5,1398-411. Tsitsigiannis, D. I., Kowieski, T. M., Zarnowski, R., and Keller, N. P. (2005b). Three putative oxylipin biosynthetic genes integrate sexual and asexual development in Aspergillus  nidulans.  Microbiology. 151, 1809-21. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100597/manifest

Comment

Related Items