UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Study of lymphocyte development from embryonic stem cells in vitro Tabatabaei-Zavareh, Nooshin 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-268087.pdf [ 9.11MB ]
Metadata
JSON: 831-1.0100552.json
JSON-LD: 831-1.0100552-ld.json
RDF/XML (Pretty): 831-1.0100552-rdf.xml
RDF/JSON: 831-1.0100552-rdf.json
Turtle: 831-1.0100552-turtle.txt
N-Triples: 831-1.0100552-rdf-ntriples.txt
Original Record: 831-1.0100552-source.json
Full Text
831-1.0100552-fulltext.txt
Citation
831-1.0100552.ris

Full Text

STUDY OF LYMPHOCYTE DEVELOPMENT FROM EMBRYONIC STEM CELLS IN VITRO by NOOSHIN TABATABAEI-ZAVAREH M.D., Esfahan University of Medical Sciences, 1994 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Genetics) THE UNIVERSITY OF BRITISH COLUMBIA April 2007 ©Nooshin Tabatabaei-Zavareh, 2007 Abstract Embryonic stem (ES) cells have been shown to differentiate to all hematopoietic lineages. However, lymphocyte development from murine ES cells has not been fully investigated. In this thesis, the developmental pathway of natural killer (NK) lymphocytes from ES cells was investigated, using a multi-step in vitro ES cell differentiation system. ES cells were induced to differentiate into embryoid bodies (EBs). CD34+ EB cells were isolated and cultured on -OP9 stroma with a cocktail of cytokines to generate cells; termed ES-derived hematopoietic progenitors (ES-HPs). EB cell subsets as well as ES-HPs were tested for NK, T, B, and myeloid lineage potentials using lineage specific differentiation cultures. ES-HPs derived from CD34+ EB cells appeared to be heterogeneous and contained NK, T, B and myeloid potentials. At the EB level, lymphoid potential was found in CD34+CD45 EB cell subset, while CD34+CD45+ EB cells had only myeloid but not lymphoid potential. CD34+CD45" EB cells gave rise to CD45 +Mac-rTerl 19" (Lin~) ES-HPs, which were highly enriched for NK progenitors, but also had other lineage potentials. The NK progenitors among ES-HPs lacked CD 122, a marker for NK lineage committed precursors, but they acquire CD 122 as they differentiate along the NK lineage. To further enrich lymphoid progenitors among CD45~ EB cells, EB cell populations were dissected according to several surface markers and tested for myeloid and lymphoid lineage potentials. Hematopoietic progenitors with lymphoid potential in EBs were found to be CD45~CD34+c-kit+CD41+CD31+Flk-1+. As they differentiate in vitro into more mature hematopoietic progenitors, they slowly acquire CD45 and lose Flk-1 and CD41 expression while retaining erythroid/myeloid and lymphoid potentials. This study suggests that hematopoietic progenitors in EBs are similar to immature embryonic hematopoietic stem cells (HSCs) and they differentiate into more mature type HSCs in vitro. Table of contents Abstract 1 1 Table of contents i" List of tables... vi List of figures vii List of abbreviations viii Acknowledgements x Chapter 1: Introduction 1 1.1. Embryonic stem cells and lymphopoiesis 1 1.2. Adult hematopoiesis 2 1.3. Adult lymphopoiesis 4 1.3.1. T cell development 6 1.3.1.1. Notch signals and T cell development 9 1.3.2. B cell development 10 1.3.3. NK cell development 11 1.3.4. Cytokines essential for lymphocyte development 18 1.3.4.1. SCF and Flt3 Ligand: Stem/progenitor cell factors 18 1.3.4.2. IL-7 20 1.3.4.3. IL-15 21 1.4. Ontogeny of hemato/lymphopoietic system 22 1.4.1. Embryonic stage 22 1.4.2. Fetal stage 24 1.4.3. Markers of developing HSCs 28 1.5. Hematopoiesis from ES cells 32 1.6. Factors regulating definitive hematopoietic development 36 1.6.1. Sci 36 1.6.2. Notchl 37 1.6.3. Amll.. 38 1.6.4. Mil 38 1.6.5. Hox genes 39 1.6.6. Cdx genes 39 1.7. Thesis objectives and hypotheses . 40 Chapter 2. Materials and methods 42 2.1. Cell lines 42 2.2. Antibodies 42 2.3. Cell culture 43 2.3.1. ES cell culture 43 2.3.2. ES-HP culture 44 2.3.3. Lineage differentiation cultures 45 2.3.3.1. NK cell culture 45 2.3.3.2. T cell culture 45 2.3.3.3. B cell culture 45 2.3.3.4. Erythroid/Myeloid colony forming 46 2.4. Staining and FACS sorting or analysis 46 2.5. RT-PCR 46 2.6. Southern blot 48 2.7. Limiting dilution analysis 48 Chapter 3: Characterization of developmental pathway of natural killer cells from embryonic stem cells in vitro 50 3.1. Introduction 50 3.2. Results 51 3.2.1. NK and T cell potentials of ES-HPs 51 3.2.2. Heterogeneity of CD34+EB cells: CD34+CD45~EB cells have lymphoid potential 56 3.2.3. NK cell progenitors among ES-HPs derived from CD34+CD45~ EB cells ..59 3.2.4. ES-HPs derived from CD34+CD45~ EB cells have T and B cell potentials 62 3.3. Discussion 66 Chapter 4: Characterization of hematopoietic progenitors with lymphoid and myeloid potentials generated in vitro from embryonic stem cells 70 4.1. Introduction 70 4.2. Results 71 4.2.1. Day-8 CD34+CD45~ EB cells are heterogeneous 71 4.2.2. CD34+CD45"c-kit+CD41+ EB cells have hematopoietic potential 74 4.2.3. Characterization of developmental intermediate progenitors derived from CD34+CD45"c-kit+CD41+ EB cells.... 76 4.2.4. Hematopoietic differentiation of CD45" ES-HPs 79 4.3. Discussion 82 Chapter 5. General discussion 85 5.1. Future work 91 Bibliography 94. v List of tables Table 1.1. Cell surface molecular markers described in this thesis 29 Table 2.1. List of antibodies 42 Table 2.2. List of primers 47 vi List of figures Figure 1.1. The scheme of lymphopoiesis in the adult mouse 17 Figure 1.2. HSCs and their precursors during mouse ontogeny 24 Figure 1.3. Lymphocyte development at fetal stage 27 Figure 3.1. Schematic representation of ES cell differentiation culture 53 Figure 3.2. Lineage potential of ES-HPs generated from CD34+ EBs 54 Figure 3.3. Characterization of NK progenitors within ES-HPs 55 Figure 3.4. Surface marker analysis of EB cells 58 Figure 3.5. CD34+CD45" EB cells contain lymphoid potential while CD34+CD45+ EB cells are committed to myeloid lineage 59 Figure 3.6. Characterization of ES-HP cells derived from CD34+CD45" EBs for surface markers and NK potential 61 Figure 3.7. NK progenitor frequency of ES-HPs derived from CD34+CD45~ EBs 62 Figure 3.8. T cell potential of ES-HPs derived from CD34+CD45" EB cells 64 Figure 3.9. T progenitor frequency of ES-HPs derived from CD34+CD45" EBs .... 65 Figure 3.10. B and myeloid potentials of CD45+Lin" ES-HPs derived from CD34+CD45~ EBs 66 Figure 4.1. Scheme of ES cell culture used in this study for hematopoietic differentiation .. 73 Figure 4.2. Surface expression of hematopoietic markers on day-8 EB cells 74 Figure 4.3. Myeloid and lymphoid potential of CD34+CD45" EB subsets 76 Figure 4.4. Cell surface marker expression of ES-derived hematopoietic progenitors (ES-HPs) derived from CD34+CD45"c-kit+CD41+ EB cells 78 Figure 4.5. Lineage potential of ES-HP subsets 79 Figure 4.6. Characterization of cells derived from CD45~Lin~ ES-HPs after further differentiation in ES-HP culture 81 Figure 5.1. Hematopoietic differentiation of EB cells 93 vii List of abbreviations AGM: aorta, gonads, mesonephros BCR: B cell receptor BFU-E: burst-forming unit-erythroid BL-CFC: blast colony forming cell BM: bone marrow CBF: core biding factor CFU-GEMM: colony forming unit- granulocyte, erythrocyte, monocyte, megakaryocyte CFU-GM: colony-forming unit-granulocyte macrophage CLP: common lymphoid progenitor CMP: common myeloid progenitor D: diversity DAPI: 4'-6-Diamidino-2-phenylindole DC: dendritic cell DL: Delta-like DMEM: Dulbecco's modified eagle's medium DN: double negative dNTP: Deoxyribonucleotide triphosphate DP: double positive DSL: Delta-Serrate-Lag2 EB: embryoid body EGF: epidermal growth factor ELP: earliest lymphocyte progenitor ED: embryonic day ES: embryonic stem ES-HP: embryonic stem cell-derived hematopoietic progenitor ES-NK: ES-derived NK cell ETP: earliest T lineage progenitor FBS: fetal bovine serum FL: fetal' liver Flt3: Fms-like tyrosine kinase 3 Flt3-L: Flt3 ligand FTOC: fetal thymic organ culture GFP: green fluorescent protein GM-CSFR: granulocyte macrophage cell-stimulating factor receptor HES: Hairy/Enhancer of split HPC: hematopoietic progenitor cell HSC: hematopoietic stem cell ICN: intracellular Notch IL: interleukin J: joining Lin: lineage LSK: lineage_Sca-l+c-kit+ LT: long-term MAML:' Masteffnirid-like M-CSF: macrophage-colony stimulating factor M E M : Minimum essential medium eagle MHC: major histocompatibility complex Mil: mixed leukemia lineage MPP: multipotent progenitor M T G : monothioglycerol NK: natural killer NKP: NK precursor OC: ontogenic counterpart OP9 -DL1: OP9 cells expressing Delta-like 1 PCR: polymerase chain reaction PM: Pharmingen P-Sp: para-aortic splanchnopleura RAG-1: recombination-activating gene 1 ^ RT-PCR: reverse transcription polymerase chain reaction SP: single positive Sp: splanchnopleura ST: short-term SCF: stem cell factor TCR: T cell receptor T/NKP: bipotent T/NK progenitor TRAIL: TCF-related apoptosis-inducing ligand V: variable VEGF: vascular endothelial growth factor VH : variable heavy chain YS: yolk sac y c : common y chain Acknowledgements I would like to thank my supervisor Dr. Fumio Takei who made it possible for me to do this work. You have been a great mentor in every step of the way and always encouraging despite the difficulties I encountered during my studies. I learned a lot from you, especially to be patient and to-persevere to accomplish my goals. Thank you to my committee members, Drs. Dixie Mager, Rob McMaster, and Fabio Rossi for their advice and guidance throughout these years. Many thanks to my lab members who helped me with my project in many ways. Motoi taught me many tissue culture techniques. Chelsea and Anastasia helped me with the limiting dilution experiments. Also thank you to other present and past lab members, Linnea, Evette, Valeria, Eva, Emily, Claudia, Tim, Erica, Lisa, Matt, Reza, Carmine, who contributed to my work with helpful discussions and creating a friendly environment in the lab. Your friendship inside and outside the lab made all these years joyful and memorable. I would like to acknowledge the assistance of flow cytometry staff in Terry Fox Laboratory, Gayle, Lindsey, Jaime, Cam and Rick. This work would have not been possible without their expertise. Thank you to my family, especially my parents, for their constant support and encouragement. Most of all, thank you to my husband, Saeed, who has been by my side through all the ups and downs. Thank you for your understanding and support. Finally, thank you to my lovely son, Parsa, who motivates me to work harder. x Chapter 1 : Introduction 1 . 1 . Embryonic stem cells and lymphopoiesis Embryonic stem (ES) cells are totipotent cells originating from the inner cell mass of developing blastocycts. When placed in culture, ES cells retain their totipotential capacity and contribute to the formation of all the tissues after being introduced into the host blastocysts. In addition, ES cells are able to differentiate to various cell types under appropriate conditions in vitro1. The properties of ES cells have made them useful in at least two areas: First, ES cells provide a powerful in vitro model system to address questions in cell and developmental biology. Second, ES cell are a valuable source for cell replacement therapies2. Hematology, in particular, has taken advantage of ES cells as a research and discovery tool to dissect'the process of hematopoiesis (e.g. generation of blood cells from stem cells). The blood-forming potential of ES cells has been shown by multiple studies. Blood lineages including erythroid, myeloid and lymphoid lineages can be produced from ES cells in a predictable fashion1'3"6, however developmental processes from ES cells to blood cells, in particular to lymphocytes, are still unclear. The purpose of this study was to identify the developmental pathway from ES cells to lymphocytes in culture. A multi-step culture system to induce differentiation of ES cells into cells of lymphoid lineage was developed. Using antibodies to cell surface markers, 1 intermediates with lymphoid potential among ES differentiated cells were characterized. Therefore, a lymphocyte developmental pathway was constructed that can be used to study lineage commitment. In addition, this work resulted in isolation of a population of hematopoietic progenitors within differentiated ES cells, which harbor both myeloid and lymphoid potentials, and may be useful in obtaining hematopoietic stem cells (HSCs) for transplantation treatments. I will therefore review the current understanding of hematopoiesis and lymphopoiesis in the adult mouse, followed by the early embryonic and fetal hematopoietic development. Hematolymphoid potential of ES cell subsets will also be reviewed and compared with their counterparts during ontogeny. 1.2. Adult hematopoiesis The hematopoietic system is generated and maintained throughout life through the regulated proliferation and differentiation of hematopoietic stem cells (HSCs). HSCs are clonogenic precursors capable of generating more stem cells, as well as differentiated blood cells. It is well established that hematopoiesis is a stepwise developmental process, in which HSCs lose self-renewal potential and multipotency and give rise to downstream oligopotent and unipotent lineage-restricted progenitors. The lineage commitment is defined as irreversible and gradual loss of developmental potential to other lineages and maturing to a functionally and phenotypically distinct set of progeny. HSCs in mouse bone marrow (BM) have been identified according to cell surface characteristics. These cells are negative for lineage markers (Lin -) and positive for Sca-1 (Ly6A/E), and c-kit receptor tyrosine kinase (receptor for stem cell factor), (referred to as LSK phenotype). The properties of HSCs have been 2 demonstrated by in vitro clonal assays for all major hematolymphoid cell lineages as well as by in vivo transplantation assays. A subset of LSK HSCs (which are CD34~/l0Flt3-) is known as long-term (LT) HSCs, because they give rise to long-term multi-lineage reconstitution and self-renewal in irradiated mice. According to the described model of hematopoiesis, the LT-HSCs initially differentiate into sort-term (ST) HSCs with limited self-renewal activity and subsequently to multipotent progenitors (MPPs) with no detectable self-renewal potential in 7 Q vivo ' . MPPs, which are also included in LSK population, coexpress CD34 and Fms-like tyrosine kinase 3 (Flt3). Flt3+ MPPs have multi-lineage potential; but have lost their megakaryocyte and erythrocyte lineage potentials (Figure l . l ) 1 0 " 1 2 . Multipotent cells (ST-HSCs/MPPs) then pass through the next developmental step and commit to either lymphoid or myeloid lineages. Two kinds of oligolineage-restricted cells: common lymphocyte prpgenitprs (CLPs) and common myeloid progenitors (CMPs) have been found in bone marrow. CLPs (Lin"IL-7Ra+Sca-l ,0c-kit10) are the clonal precursors of the lymphocyte lineage (T lymphocytes, B lymphocytes, and natural killer (NK) cells)13, while CMPs are restricted to the myeloid lineages (granulocytes, monocytes, erythrocytes, and megakaryocytes)14. CLPs and CMPs can be distinguished by two cell surface receptors for cytokines, namely interleukin (IL)-7 receptor and granulocyte macrophage cell-stimulating factor receptor (GM-CSFR). While CMPs express GM-CSFR and do not express IL-7R, CLPs express cell surface IL-7Ra but lack GM-CSFR. 3 1.3. Adult lymphopoiesis Change in chromatin status and gene expression initiates the process of lineage specification, even though it does not always signal a firm commitment to a particular lineage15. Expression of RAG-1 (recombination-activating gene 1) and concomitant rearrangement of antigen receptor genes is the key developmental event specific to lymphocyte lineage16. CLPs are long considered to be the most immature lymphoid-committed progenitors. However, recent studies have identified progenitors upstream of CLPs with lymphoid potential (Figure 1.1). In a study by Igarashi et al, RAG-1/GFP (green fluorescent protein) knock-in mice were used to isolate the earliest lymphocyte progenitors (ELPs), which have activated RAG-1 locus. ELPs were found in a non-self renewing LSK Flt3+CD27+ subset of B M cells. These cells could sustain T, B, and NK cell production, but had minimal potential for myelo-erythroid differentiation17. In addition, cells with similar properties have been described in the bloodstream18. The evidence for a common lineage relationship between ELPs and CLPs was obtained with immunoglobulin DH-JH rearrangement products (i.e. heavy-chain diversity gene segment linked to joining gene segment) in purified ELPs as well as CLPs 1 7 . Consistent with these findings, in transgenic recombination substrate mice, recombination activity (or evidence of previous activity) was found in CLPs, as well as downstream progeny B, T, NK and dendritic (DC) cells. However, RAG expression in CLPs was shown to be regulated by a B cell specific enhancer, Erag, suggesting that CLPs are associated with the B lineage and do not substantially contribute to T cell production in vivo despite a residual T cell potential19. This study supported earlier work by Allman et al. which showed that a defect in hematopoietic cell-specific transcription factor, Ikaros, affects CLP, 4 B and NK lineages, while sparing the T lineage, presenting CLPs as a separate lineage from T cells20: 40% of GFP + cells in Lin"c-kit'° population in RAG-1/GFP mice do not express the CLP marker, IL-7Ra, suggesting lymphocyte progenitors may be heterogeneous with regard to their surface markers21. Kouro et al22 examined Lin"c-kit'° fraction of B M cells, which also includes CLPs, for lineage potentials. Lin"c-kit'° cells included NK and B cell progenitors (pro-lymphocytes), and were depleted of both progenitors in response to estrogen treatment, suggesting a common origin for both lineages. Single cell assays confirmed the presence of B-restricted, NK-restricted and bipotent progenitors in Lin~c-kit'° pro-lymphocytes. However, NK and B differentiation from Lin_c-kit'° cells was shown to follow distinct pathways. For example, while B cell precursors cross an IL-7Roc+ stage, the IL-7R is either not expressed or transiently expressed by developing NK-lineage cells. In addition, cells with B cell potential never displayed CD 122 (IL-2R(3), whereas NK differentiation took place via a CD122+B220+ stage, followed by the CD122+B220~ pathway. Moreover, NK precursors were more estrogen resistant than B cell progenitors. Even though the contribution of Lin"c-kit'° pro-lymphocytes to T lymphopoiesis is not clear, it does seem to represent an 22 important intermediate in B and NK cell development (Figure 1.1) . In an effort to identify the earliest lymphocyte progenitors with T cell potential in bone marrow, a transgenic mice model was developed in which a T-lineage specific pre-TCRa (pTa) promoter directed expression of a hCD25 surface marker. hCD25+c-kif B220+ B M cells were found to be bipotent precursors of T and B cells in clonogenic assays, and efficiently home to the thymus after intravenous injection into recipients. c-kit~B220+ cells could be generated from the CLP cells and were called CLP-2 2 3 . Briefly, one can define the 5 lineage pathway of lymphocyte progenitors as ELP—>CLP/pro-lymphocytes—>CLP-2 (Figure 1.1). O X ' T cell'development T cells developing in the thymus fall into two major categories according to the type of antigen-specific receptors displayed on the surface, ap T cells express the T-cell receptor (TCR) made up of the a and P chains, while the second population of T cells bears a heterodimeric y8TCR. The TCR chains are encoded by gene segments that undergo rearrangement during development. Random recombination of variable (V) TCR gene segments with joining (J) and, in some cases, with diversity (D) gene segments provides the T cell population with a diverse repertoire of TCR molecules such that each T cell expresses a TCR with a single specificity. This enables T cells to distinguish antigens derived from virtually any kind of pathogen, ap T cells produce adaptive immune response in response to infections. One group of ap T cells (CD8 T cells) can differentiate into cytotoxic T cells that lyse infected cells, while a second population of ap T cells known as CD4 T cells activate macrophages or induce B cells for antibody production. CD8 and CD4 ap T cells recognize peptide ligands in combination with major histocompatibility complex (MHC) class I and MHC class II molecules, respectively16. y8 T cells are non-MHC restricted and function in immune responses to infections, immunoregulation and tumor immunosurveilance. They recognize protein (e.g. nonclassical MHC molecules, and heat shock proteins) and non-protein antigens24. In functional T cells, both types of TCR are associated with invariant accessory CD3 molecules (such as CD3y, CD38, CD3e) on the cell surface . aPTCR complex also includes intracytoplasmic CD3^ homodimers. CD3 proteins are involved both in the surface expression of T cell receptors and in signal transmission to the inside of the cells16. The thymus is required for the generation of T cells. However, progenitors are not generated in the thymus and have to enter the thymus from the bone marrow through the bloodstream . Immature T cell progenitors in the thymus are negative for the expression of CD4 and CD8 and referred to as double-negative (DN) cells (these cells are also CD3~). DN cells are heterogeneous and change their phenotype at different stages as they develop along the T lineage pathway (Figure 1.1). CD44+CD25~c-kit+ DN cells represent the earliest precursor stage termed as DN1 stage. DN2 stage is characterized by CD25 expression and initiation of TCR gene rearrangement. DN3 (CD44~CD25+) cells continue rearrangement and express either pre-TCR, consisting of a rearranged TCRp chain and an invariant pre-TCR (pTa) chain, or the y8TCR depending on which gene rearrangements have been successful. Signaling through pre-TCR is required for the progression of DN3 cells to CD4 +CD8 + double-positive (DP) stage in a|3 T cells, which enables cells to activate TCRa rearrangement. Alternatively, signaling via the ySTCR results in commitment of cells to the y8 T lineage. An additional step in ap T cell development is positive and negative selection, which allows the generation of MHC-restricted and self-tolerant single positive (SP) CD8 and SP CD4 T cells1 6'2 5"2 7. Even though specification, which refers to onset of expression of T-lineage genes, occurs at the DN1 and DN2 stages, commitment to the T lineage as defined 7 by loss of alternative choices (B, myeloid, NK and DC) does not happen until- DN3 stage . In addition, within the T lineage, commitment to the yb T lineage appears to occur at least one full stage earlier than that of ap T lineage. TCRy (e.g. Vy2-Jyl) and TCR5 . 1 rearrangements are clearly observed at DN2 stage, while TCR(3 locus is still in the germline form28. Despite the well defined intra-thymic T differentiation, the pathway from B M derived HSC to precursors in thymus is not well characterized. HSCs and downstream progenitor population (including ELP, CLP and CLP-2) have been shown to have T cell potential. The contribution of each progenitor population to the steady-state T cell development is not clear. To better resolve thymic-seeding progenitors, it is conceivable to compare them with their counterparts in the thymus. A study by Allman, et al. showed that the earliest T lineage progenitors (ETPs) among DN1 cells are Lin~c-kit+Sca-l+and develop independently of CLPs, suggesting that progenitors other than CLPs may seed the thymus . A later study reported that ETPs express Flt3, and have B-cell lineage potential . NK, DC and myeloid potential of ETPs have also been reported30'31. Taken together these data suggest that ETPs resemble B M MPPs (LSKFlt3+), and therefore, MPPs may be the progenitors entering the thymus at the times needed (Figure 1.1). On the other hand, an additional B M precursor population with LSKCD62L + (L-selectin)+ phenotype has been identified. LSKCD62L + cells contain robust T progenitor activity with minimal B and myeloid differentiation potential, similar to ETPs. This data suggested that CD62L+ cells selectively home to the thymus and give rise to thymic ETPs, which also express CD62L 3 2. In addition, this study raised the 8 possibility that commitment to the T lineage may happen before contact with the thymic environment. 1.3.1-1- Notch signals and T cell development The Notch pathway regulates developmental choices and cellular differentiation across species. Notch regulation is mediated through a conserved signaling pathway in which transmembrane Notch receptors undergo sequential proteolytic cleavage followed by nuclear translocation of the intracellular domain and activation of transcription. There are four mammalian Notch receptors. The extracellular portion of Notch contains tandem epidermal growth factor (EGF-like) repeats, which binds the extracellular domain of DSL ligands (Delta-Serrate-Lag2). Mammals have two Serrate-like ligand (Jagged 1 and 2) and three Delta-like ligands (DL-1, -3 and -4). The intracellular domain of Notch (ICN, intracellular Notch) consists of domains involved in signal transduction and protein stability including the R A M domain!, ankyrin repeats and PEST domains. Ligand binding results in two cleavage events that dissociate ICN from the membrane. The first cleavage occurs extracellularly and uses metalloprotease, while the second happens within the transmembrane domain and is y-secretase dependent, y-secretase inhibitors block Notch signaling. ICN travels to the nucleus, where it binds the helix-loop-helix transcription factor CSL/RBP-J via its R A M and ankyrin repeat domains. Ankyrin repeats of ICN also interact with Mastermind-like proteins (MAMLs), which recruit transcriptional coactivators. Notch signaling activates transcription of a bHLH-type transcriptional repressor, known as Hairy/Enhancer of split (HES), which 33 inhibits transcription of HES target genes. Other tissue specific targets have been proposed . 9 During lymphoid development, signaling through Notch plays an important role in T cell fate determination. It has been reported that the inactivation of Notch signals in hematopoietic progenitors selectively blocks T cell differentiation with an excess of B cells in the thymus. Conversely, HSCs with constitutive active Notchl adopt T cell fate and lose B cell potential. Relevant to thymopoiesis is Notchl and Delta-like family members. Absence of Notchl results in complete suppression of T cell development, indicating a lack of compensation by other Notch family members. Also, expression of the Delta-like family (DL-1 or DL-4) of Notch ligands in B M as well as thymic stromal cells is sufficient to induce the differentiation of hematopoietic progenitors, even embryonic stem cells, into the T cell lineage in vitro12'33'34. This data supports a model for T lymphopoiesis in which incoming multipotent progenitors first encounter Delta-like ligands in the thymus, which in turn triggers Notch signaling and specification to the T lineage. In fact, T specification of ETPs and suppression 29 35 of B cell potential are mediated through the Notch pathway^ • . 1.3.2. B cell development B cells, the other players of adaptive immunity, recognize antigens derived from a great variety of pathogens with their antigen-specific receptors, termed the B cell receptor (BCR). The'BCR'is composed of two immunoglobulin (Ig) heavy chains and two immunoglobulin light chains. Each BCR has a single specificity and is produced through two series of gene rearrangements, one for each receptor-chain locus. The secreted form of BCR is the antibody proteins, which are produced by terminally differentiated B cells, plasma cells. The secretion of antibodies, which provides the humoral immune response, is the main effector function of 10 B cells16. B cells develop in bone marrow from HSCs. The stages of B cell development are defined by the sequential rearrangement and expression of immunoglobulin genes as well as the cell surface expression of protein markers for the B cell lineage (Figure 1.1). The earliest B linage cells are known as pre-pro-B cells and express the B cell lineage marker B220 but lack other lineage markers including CD19. B220 expression is not restricted to the B lineage as some cells in the NK cell lineage also express this molecule. Most pre-pro B cells have not initiated rearrangements. Recent data have shown that pre-pro B cells are heterogeneous and generate other cell types such as NK, T and DC cells. B cell precursors undergo D H - J H rearrangement, followed by heavy chain variable (VH) to D J H rearrangement at pro-B cell stage. This stage is also accompanied by the expression of CD 19 which serves to characterize all later B lineage cells. Productive rearrangement of V D J H leads to the expression of the p heavy chain which is expressed on the cell surface in combination with a surrogate light chain to form the pre-B cell receptor. Expression of the pre-B cell receptor is the hallmark of the pre-B cell stage, and occurs prior to the rearrangement and expression of the light chain. Subsequently, immature B cells that express IgM but not IgD are generated16'36'37. 1.3.3. N K cell development Natural killer (NK) cells are large granular lymphocytes that play a significant role in innate immunity . These cells are important in eliminating viruses and possibly other pathogens during the initial phase of infections, before an adaptive immune response begins. They also contribute to immune responses against cancer cells, and transplanted allogenic bone marrow cells. Immunization or pre-activation of NK cells is not a requirement for NK cell 11 responses . The major effector mechanisms employed by NK cells are direct killing of infected cells or tumor cells and cytokine production. Target killing is mainly mediated through the exocytosis of granules containing perforin and granzyme. NK cells can also induce cell death via FasL and TNF-related apoptosis-inducing ligand (TRAIL) 4 0. Besides direct cytotoxicity against aberrant target cells, NK cells are also responsible for the regulation of adaptive immune responses and the action of other innate cells, such as macrophages, through cytokine production41. Interaction between NK and DC cells also regulates innate and adaptive immune responses42. Unlike T or B cells, NK cells do not express antigen-specific receptors that are the end product of somatic gene rearrangements. Instead, they use an intricate system of co-expression of multiple receptors in various combinations to distinguish aberrant target cells from normal cells. The NK receptor repertoire consists of activating and inhibitory receptors that interact with several ligands on target cells. Inhibitory receptors, which recognize self MHC class I molecules on normal cells and deliver negative signals to NK cells, protect normal host cells from being lysed by NK cells, thus ensuring self-tolerance. Cells that lack sufficient MHC class I expression as a result of infection, transformation or mutation are susceptible to NK killing. Activating receptors, upon ligation, send stimulating signals. These receptors enable NK cells to respond to microbial products or molecules that are induced upon stress or transformation. The balance between stimulating and inhibitory signals governs the fate of NK-target cell interactions. The murine NK receptors that regulate NK cell functions mostly belong to two families of C-type lectin-like receptors, Ly49 homodimers and CD94/NKG2 heterodimers. These receptors are expressed in a clonal 12 fashion on overlapping subsets of mature NK cells . However, some NK receptors are uniformly expressed among NK cells. Examples of these receptors are activating NKG2D 4 7 , and NK1.1 receptors (in the C57BL/6 strain of mice)48, as well as integrins, such as Mac-1 and DX5 4 9 . NK cell development depends on the bone marrow environment. Indeed, bone marrow ablation by 8 9 SR 5 0 or by oestradiol51 results in NK cell deficiencies. A similar defect is observed in osteopetrotic animals51. NK cell development from B M precursors has only recently been examined. NK lineage committed precursors (NKPs) that differentiate into NK cells but not other hematopoietic cells have been identified in adult mouse B M by the surface phenotype of Lin"CD122+(Figure l . l ) 5 2 . CD 122 is the p subunit of IL-15R, a cytokine receptor chain shared by IL-2R and IL-15R . These two receptors are dependent on signaling through a third subunit, known as common y chain (yc)54. NKPs lack many cell-surface receptors for mature NK cells (NK1.1, DX5, and Ly49 receptors) and do not show any lytic activity or cytokine production52. Williams et al. demonstrated that culture of HSCs in the presence of cytokines such as stem cell factor (SCF), Flt3 ligand (Flt3-L), IL-7, and IL-6 generates CD1227" cells that presumably are NKPs. These cells give rise to NK cells in response to IL-155 5. Collectively, this data indicates that the acquisition of CD122 by NKPs, marks their commitment to the NK lineage56. Even though the stages of NKP differentiation from HSCs are still unclear, the developmental processes from NKPs to mature NK cells in B M have been described in detail. As for B and T lymphocytes, stages of NK cell maturation can be defined according to 13 the expression pattern of cell surface molecules and functional characteristics (Figure 1.1). The first developmental stage represents CD122^Kl .rDX5" NKPs 4 9 . Further characterization of these cells by Vosshenrich et al.51 showed that they are yc+, but CD25 (IL-2Ra) negative with a subset expressing IL-7Ra, c-kit, and Flt3. It was also shown that NKG2D is expressed at this stage57, while the earlier studies reported its expression at stage II4 9. Acquisition of NK-lineage markers; N K l . l h l (high expression), DX510 (low expression), and CD94/NKG2 receptors occurs at the stage II of development. The stage II cells resemble mature fetal/neonatal NK cell which lack Ly49 receptors. These cells also express the integrin a v + and are Mac-l loCD43 loc-kit~. Developing NK cells acquire Ly49 receptors and become c-kit+ while in transit through stage III. This step is then followed by an upregulation of DX5 and extensive proliferation of NK cells in B M in stage IV. The proliferation of NK cells is slowed and they upregulate Mac-1 and CD43 as they mature in the final step. These mature NK cells are capable of proliferation in response to pathogens and exhibit full functional competence, including natural killing and an ability to secrete cytokines49. B M is often considered as the main site for generating mature NK cells in the adult, as all introduced developmental intermediates including ELPs, CLPs, NKPs and immature NK cells are found in BM. The finding of bipotent T/NKPs in adult thymus suggested the existence of other types of NK precursors and possibly pathways contributing to the NK cell pool3 0. Moreover, recent studies have provided evidence for a thymic-dependent pathway of NK cell development. Vosshenrich et al.58 demonstrated that thymic NK cells are unique, as in contrast to BM-derived splenic NK cells, most of them are IL-7Ra+, and express Gata-3, the transcription factor essential for the development of the earliest T cell progenitors in the thymus . The generation of thymic NK cells was IL-7 dependent, while B M NK cell development is not58. The IL-7Ra+ NK cells were represented as a sizeable proportion (15-30%) in lymph nodes compared to other tissues, suggesting the possible export of thymic NK cells to lymphoid organs. The engraftment ofRag2~/~ recipient mice with thymus from Tcra~f~ mice confirmed selective homing of thymic NK cells to the lymph nodes. Gata3 ' hematopoietic precursors did not generate IL-7Ra + NK cells in the thymus and lymph node. From these observations, they conclude that IL-7Roc+ NK cells develop infrathymically from, perhaps early T cell precursors, in a process dependent on Gata-3, and are exported to the peripheral lymphoid tissues. Functional characteristics of thymic and lymph node NK cells differed from splenic NK cells. These cells showed higher cytokine production and lower cytotoxicity58. The work by Veinotte et al. also confirmed the contribution of thymic pathway in generation of NK cells. They showed that TCRy genes are rearranged in at least half of thymic NK cells, but in a very small fraction of B M NK cells (less than 5%), suggesting that a subpopulation of NK cells derives from thymic T/NK bipotential precursors60. They proposed that the thymic NK cells develop from DN2 cell stage since this is the stage when TCRy rearrangement initiates . Studies of human NK cell development have also indicated an involvement of tissues other than B M in the generation of at least subsets of NK cells. Initially, the NK potential was noted in human BM-derived CD34+ hematopoietic progenitor cells (HPC) cultured with IL-2 and IL-15 in liquid cultures or in combination with stromal cells, suggesting the existence of aNKP population among CD34+ HPCs 6 1" 6 4. However, CD122 expression on freshly isolated CD34+ HPCs was undetectable by flow cytometry, making it difficult to identify a human 15 equivalent of NKPs, even.though CD122+ NKPs were generated in in vitro cultures " . Human NK cells-are characterized as CD3~CD56+ cells and can be divided into two subsets. One subset, defined by CD56 d , m has potent cytolytic functions, with little ability to produce cytokines. The other subset, CD56 b r , g h t has poor cytolytic properties but are potent cytokine producers66. Currently, the developmental relationship between these two subsets is unclear. A recent report from the Caligiuri laboratory has discovered a novel CD34dimCD45RA+integrin a 4 p7 h l hematopoietic precursor in human lymph node which differentiates to CD56 b r i g h t NK cells. These cells were located in the T cell-rich regions of human lymph nodes near CD56 b r i g h t NK cells64. A follow up study showed that all developmental intermediates spanning from CD34 progenitors to C D 5 6 b r i g h t N K c e U s can be found in lymph nodes65. NK cell differentiation in lymph node progressed through four consecutive stages: stage 1, CD34+c-kif~CD94~; stage 2, CD34+c-kit+CD94"; stage 3, CD34"c-kit+CD94"; stage 4, CD34~c-kit+/~CD94+. NK receptors were not expressed at stage 1, but were progressively acquired throughout the next developmental stages. A high-density expression of CD56 was observed within stage 4, and was associated with the acquisition of capacities for both cytotoxicity and cytokine production. Surface expression of CD 122 was first detected at stage 3. B cell potential was absent in all stages, whereas T and DC potentials were seen in stage 1 and 2 but not in stage 3 and 4. Therefore, commitment to the NK lineage seems to occur at stage 3 of development, when CD 122 appears. Nevertheless, the ability to respond to IL-15 begins at stage 2 of differentiation, which correlates with CD 122 mRNA expression at this stage65. 16 Mature NK cells: rCD122 +NK1 .1 +DX5l h iD94/NKG2 + Cytotoxicity11' IFNy h i LMac-1 h i CD43 h i c -k i t + / -Ly49 + Expansion: f C D 1 2 2 + N K 1 . 1 + D X 5 h i C D 9 4 / N K G 2 + Dto IFNy'° Cyto xicity1 0 , l o CD43 l o c-k i t + Ly49 + • M H C c l a s s I receptor acquisition CD122 +NK1.1 +DX5'°CD94/NKG2) Mac-1 l o a v h i CD43 l o c-k i t + Ly49 + CD122 + NK1 .1 + DX5 l 0 CD94 /NKG2 + Mac-1 l oa. h iCD43 1 0 CD122 + NK1 .1 -DX5"NKG2D + / Bone marrow Thymus T cell development Figure 1.1. The scheme of lymphopoiesis in the adult mouse. 17 Figurel.l. The scheme of lymphopoiesis in the adult mouse. Progenitors with lymphoid potential including MPPs, ELPs, CLPs, CLP-2 cells and pro-lymphocytes (Pro-L) are continuously generated from HSCs in BM. NK and B lineage derive from CLPs, Pro-L, or possibly CLP-2 cells, while T lineage arise from progenitors upstream CLPs such as MPPs and ELPs, which express Flt3 and/or CD62L. CLP-2 cells derived from CLPs also efficiently generate T cells. Steps for individual lymphocyte lineage differentiation have been illustrated: Differentiation of NK lineage-committed precursor (NKP) to mature NK cells in B M involves 5 stages, each defined by indicated surface markers. B cell development proceeds from less mature pre-pro B cells to immature B cells. Gene rearrangements associated with each stage are shown below the relevant stage. The earliest T lineage progenitors (ETPs) in thymus are also Flt3+CD62L+. These cells, which fall into DN1 category of thymic progenitors, undergo differentiation into following steps marked by differential expression of CD44, CD25, CD4 and CD8. TCR rearrangements take place from DN2 stage onwards. Figure is from Ref.12>25'35'37>49'67. 1.3.4. Cytokines essential for lymphocyte development 1.3.4.1. SCF and Flt3 Ligand: Stem/progenitor cell factors c-kit ligand (SCF) and Flt3-ligand (Flt3-L) interact with receptor tyrosine kinases known as c-kit and Flt3, respectively. Flt3 and c-kit are expressed by HSCs, ELPs, CLPs, and NKPs as well as various subsets of lineage-committed cells including those for B, T, NK, erythroid, megakaryocyte and mast cells 5 6 , 6 8. SCF and Flt3-L have synergistic interactions with each other or with other early acting cytokines to exert their hematopoietic activities, although they also play distinct roles in the differentiation process of discrete cell lineages. SCF is critical for maintenance and self-renewal of HSCs, whereas both SCF and Flt3-L are essential for optimal production of mature hematopoietic cells from HSCs 6 8. In addition, c-kit and Flt3 receptors are known to be required for the early events in hematopoiesis, as it is evidenced from the reduction of hematopoietic precursors, including CLPs, in the absence of signaling through either receptor69'70. This defect becomes more severe when both c-kit and 18 Flt3 are inactivated71. While c-kit is redundant in B and T cell development in fetal, neonatal and young mice, it is indispensable in adult mice. The number of pro-B cells and pro-T (DN2). prpgenitprs are severely reduced in adult c-kit mutant mice6 9'7 2. Mice lacking Flt3 or Flt3-L manifest deficiencies in B cell precursors71'73. In competitive repopulation experiments, Flt3_/~ stem cells fail to reconstitute the hematopoietic system, particularly the T-lymphoid lineage71. A severe reduction in ETP number but only a small reduction in more differentiated thymocytes has been reported in F13L_ /_ mice2 9'7 0. By contrast, NK cell development is only mildly affected with defective c-kit or Flt3-L signaling73'74. The absolute number of NKPs is normal in c-kit mutants and only slightly reduced in Flt3-L mice ' . These observations have lead to the conclusion that c-kit and Flt3-L play a role in lymphocyte developmental pathway at the transition from HSCs to CLP, since the generation of CLPs is dependent on both receptors signaling69'70. In fact, SCF and Flt3-L may promote CLP survival and/or expansion. However, it is not clear whether developing NK cells traverse through CLP stage, as NKPs develop without either receptor. Since a functional redundancy between these two receptors has been suggested, analysis of NK cells in double-mutant mice may reveal the role of these receptors in NK cell commitment. In vitro studies have indicated that SCF and Flt3-L may have influence on individual lymphoid lineage differentiation pathways. The in vitro differentiation of T cells has been made possible by a recently developed OP9-DL1 (OP9 cells expressing Notch ligand Delta-like-1) culture system which could replace the fetal thymic organ cultures (FTOC) to assess the effect of cytokines in T cell proliferation and differentiation77. In the presence of Flt3-L arid iL-7," progenitors derived from embryonic stem cells78, fetal liver77 or adult thymus78 19 differentiate into T cells on OP9-DL1 stroma. Also, c-kit and IL-7 signaling induce in vitro proliferation and differentiation of DN1 and DN2 cells along the T lineage pathway79. Flt3-L synergizes with IL-7 to stimulate the growth of B cell progenitors80. Stimulating mouse and human HSCs with SCF and Ft3L renders them responsive to IL-15, which in turn promotes NK cell differentiation55'63. 1.3.4.2. IL-7 The receptor for IL-7 consists of two chains: IL-7Ra and yc. The importance of IL-7 in lymphocyte development has been shown by IL-7 and IL-7Ra-deficient mice. In these mice, the development of B and T cells (including y8 T cells) has been severely compromised, even though pre-pro-B and pro-T cells are still produced. Most NK cells develop normally in IL-Th and IL-7a~ /_ mice. However, a unique subset of NK cells that is thymus-derived and expresses IL-7R, is deficient in IL-7_/~ mice3 7'5 8'8 1"8 5. Further studies have revealed that signals delivered through IL-7 receptor mediate gene rearrangement events in the irnnximoglobulin heavy chain (IgH) and TCR-y loci 8 6 ' 8 7 . In a stromal-free culture system, IL-7R signaling is sufficient to specify B cell fate in CLPs, confirming a central role for IL-7 in O Q B cell development . IL-7 seems to play an important role in survival and proliferation of B and T cell precursors through induction of anti-apoptotic factors such as Bcl2 or M c l l 8 9 - 9 1 20 1.3.4.3. IL-15 IL-15 is a critical cytokine for NK cell development. IL-15 binds to the IL-15R complex, which is composed of lL-2/IL-15Rp (CD 122), IL-15Roc, and the yc 9 2. IL-15 and IL-15Ra-deficient mice exhibit NK cell deficiencies, as well as deficiencies in NKT cells, intestinal epithelial cells, and memory CD8 + T cells9 3'9 4, yc mutations/absence cause similar defects in NK cell development, although these defects are accompanied by X-linked severe combined immune deficiency95"98. Overall, these data suggest an essential role for IL-15 in NK cell generation. Further investigations showed that the commitment to the NK lineage does not occur through yc-dependent cytokine stimulation, since NKPs exist in normal numbers in yc-deficient mice. Conversely, IL-15 functions in subsequent stages of NK differentiation by maintaining normal numbers of immature and mature NK cells57. IL-15 signaling acts on the upstream of the anti-apoptotic factor Bcl-2. Normal numbers of NK cells are obtained in IL-2Rp-deficient mice through the overexpression of Bcl-2 9 9. Bcl-2 transgenic NK cells persist after adoptive transfer in IL-15 deficient hosts100'101. Collectively, these data implicate IL-15 in the survival and proliferation of developing NK cells. A candidate downstream target of IL-15 signaling has been proposed through studies of human NK cells. The expression of Ets-1, a winged helix-turn-helix transcription factor, increases in response to signaling via IL-2 and IL-15. The exact role of Ets-1 in NK function and the target genes regulated by Ets-1 is yet to be determined102. However, lack of Ets-1 only impairs NK cell numbers and their cytolytic activity without affecting T and B cells, suggesting an essential role for Ets-1 in NK cell development103. 21 1.4. Ontogeny of hemato/lymphopoietic system 1.4.1. Embryonic stage The first hematopoietic cells observed in the mouse embryo are erythroid cells emerging from yolk sac (YS) blood islands at embryonic day 7 (ED7). These cells are nucleated and express embryonic hemoglobin (s and (3H1). This first wave of erythropoiesis in the YS is known as primitive wave, as opposed to the production of definitive erythrocytes, which are enucleated and express adult forms of hemoglobin ((3-major and a). Primitive erythropoiesis in the YS is associated with production of macrophage and megakaryocyte lineages104. A second wave of definitive erythroid progenitors has been detected in the YS beginning at ED8.25. These progenitors seed the liver where they begin to mature. The YS also provides multiple committed myeloid progenitors including mast cell progenitor, granulocyte-macrophage progenitors and megakaryocyte progenitors during the definitive phase of hematopoieisis105. Characterization of hematopoietic progenitors in the YS have indicated that the primitive erythroid as well as definitive hematopoietic progenitors express CD41 as an early marker (Figure 1.2)106'107. The definitive myeloerythroid progenitors also express c-kit, but lack the pan-hematopoietic marker CD45 (Ptprc; protein tyrosine phosphatase 108 * receptor C), even though they turn on CD45 during their progressive maturation . Despite the abundant production of myeloerythroid progenitors in the YS, YS cells cannot generate lymphoid progeny109'110, and lymphoid progenitors previously detected in the YS have been obtained from the YS after the establishment of circulation and could have originated in intra-embryonic sites 1 0 4' 1 0 7' 1". Precirculation YS cells may need a maturation step to acquire 22 the properties of adult definitive HSCs. Conditioning of YS cells such as injecting into the liver of newborn mice or co-culturing with A G M stromal cells provides them with log-term reconstitution potential in the adult1 1 2 - 1 1 4. The earliest HSCs, which are able to generate long-term multilineage engraftment in the adult recipient, have been identified in the intra-embryonic sites, known as splanchnopleura (Sp), as early as ED7.5 before the onset of circulation110. Para-aortic splanchnopleura (P-Sp), which comprises the dorsal aorta and surrounding splanchnic mesoderm (ED8.5-10), also displays hematopoietic progenitor activity 1 1 5 1 1 6. After ED10, P-Sp region which develops to the aorta, gonads, and mesonephros, is called AGM. A G M is the source of definitive HSCs 1 1 7 ' 1 1 8 . The A G M region does not support expansion and differentiation of hematopoietic progenitors. These AGM-derived HSCs are thought to colonize the fetal liver and ultimately bone marrow to provide long-term adult hematopoiesis105'119. HSCs isolated from A G M exhibit a phenotype that is characteristics of immature HSCs (e.g. CD41+c-kit+CD45~CD31+AA4.1+ (CD93)120, or CD34 +c-kit + 1 2 1 ' 1 2 2) (Figure 1.2). 23 Primitive streak Yolk Sac A G M Fetal liver . . E D 7 r 7 . 5 . , E D 8 . 2 5 - 1 0 . 5 E D 1 0 . 5 - 1 1 E D 1 1 . 5 - 1 6 . 5 F l k - 1 + S c l + Hemangioblast C D 4 1 + c - k i t + C D 4 5 " HP C D 3 4 + C D 4 1 + c -k i t + CD45" , C D 3 1 + A A 4 . 1 + HSC C D 3 4 + M a c - 1 + AA4 .1 + c -k i t + C D 4 5 + HSC Speci f icat ion Emergence Emergence Maturation Expans ion Figure 1.2. HSCs and their precursors during mouse ontogeny Hematopoietic potential is specified initially in mouse primitive streak in hemangioblasts. Hemangioblasts are thought to be the precursors of YS hematopoietic progenitors (HP) and A G M HSCs. Markers attributed to HSCs in each location are displayed. While YS and A G M generates HSCs de novo, FL is site of HSC expansion and differentiation. Figure is adapted from Mikkola et a/.1 1 1 1.4.2. Fetal stage Although fetal liver (FL) is the main site of hematopoiesis in the fetus, it does not produce HSCs de novo, and has to be seeded by circulating hematopoietic cells. FL is first seeded by hematopoietic progenitors from YS at ED9.5-10.5, followed by HSCs derived from A G M and placenta beginning at EDI 1.5. After ED 12.5, the FL becomes the main fetal organ for HSC expansion and differentiation. HSCs expand rapidly by ED15.5-16.5, after which the expansion is slowed. FL hematopoiesis changes according to the needs of the fetus. At earlier stages, proerythroblasts reflective of definitive erythropoiesis are dominant, whereas myeloid and lymphoid progenitors accumulate later on 1 1 1. FL HSCs differ from adult HSCs in the cell surface marker expression. For example, unlike adult HSCs, FL HSCs express CD34 and lineage markers such as the monocyte/macrophage marker Mac-1 (CD1 lb) and B cell marker AA4.1 (Figure 1.2)121'123'124. These differences might be related to the difference in cell-cycle 24 status between FL and adult HSCs. FL HSCs are actively cycling, whereas most HSCs in adult B M are quiescent. Both intrinsic and environmental factors are attributed to the observed differences between adult and fetal HSCs 1 1 1. FL is rich in intermediateprogenitors derived from the first waves of stem cell differentiation. These intermediate progenitors are also distinct from the multipotent and committed precursors described in adult stage. The developmental potential of FL cells has been investigated with a novel multilineage progenitor assay. In this assay, unipotent progenitors (p)-T and p-B, but not bipotent p-T/B were detected in IL-7R+ population of FL cells, which corresponds to BM-derived CLPs. T cell precursors are enriched at ED 12, while B cell precursors predominate on EDM. Moreover, P-T and p-B are generated through the intermediate p-myeloid/T and p-myeloid/B stages (Figure 1.3) . CLP-like precursors with myeloid differentiation potential have also been reported by other groups126. These observations lead to the conclusion that the dichotomy between lymphoid and myeloid lineages as seenin adult does not hold true in fetal development. Committed B cell precursors have been identified in FL at ED 12. These cells also retain the ability to differentiate to macrophages, confirming that commitment to lymphoid precursors in FL does not result in loss of macrophage differentiation potential127'128. The first CD19+ B 1 00 cells become apparent in FL by EDM , after which developing B cells accumulate in a fashion similar to adult B cell development, although later stages only appear closer to birth1 3 0. Some differences exist between adult and fetal B lymphopoiesis. For instance, CD5 + B I B cells, with a unique repertoire of immunoglobulin VH genes, are prevalent during fetal 25 life . In addition, while IL-7 is essential for B cell development in adult mice, it is dispensable for fetal B cell development129. Since the number of T cell precursors in FL declines between ED 12 and ED 14, and this temporally coincides with the appearance of T cell precursors in blood, it has been proposed that T cell precursors migrate from the FL to fetal thymus through bloodstream during this time period132. DN1 cells first appear in the thymus at ED12, followed by a successive generation of DN2, DN3 and DN4 cells over the next 3 days. The number of T cell precursors increase dramatically by ED 15. This increase is due to both expansion and import of cells from F L 1 2 9 . A bipotent T/NK progenitor (T/NKP), which has the Lin~c-kit + NKl.l + phenotype, has been detected in fetal thymus133. Further reports have shown that the DN1 and DN2 populations contain bipotent T/NKPs, which produce p-NK and p-T. CD122+ NK-lineage committed progenitors (NKP) were identified within CD44XD25 DN cells (Figure 1.3)134'135. Prethymic T cell precursors in EDI5 FL have been identified as Lin~B220loc-kit+CD 19" (Figure 1.3). These cells that comprise 70% of total T cell progenitor activity in FL are also restricted to T and NK lineage and do not exhibit B or myeloid lineage potentials as shown in a limiting dilution fetal thymic organ culture (FTOC) assay. When injected into Rag2~/~ YC~'~ mice, they reconstitute the NK and T cell compartments, but not B-cell or myeloid' cbmparMehts136'. These results indicate that commitment to the T/NK lineage and loss of B cell potential can occur before thymic entry. Bipotent T/NKPs that display a CLP-type phenotype (Lin~c-kit+IL-7R+) have also been found in fetal blood between EDI 1 to 1 ^7 E D M (Figure 1.3) . The conclusion from these data is that contact with thymic stroma to induce Notch signaling, as needed in the adult, is not a prerequisite for commitment to the T 26 cell lineage in fetal environment. The first thymic immigrants residing in the mesenchymal region of the EDI 1 fetal thymic anlage have been shown to express similar surface markers to fetal blood T/NKPs and are restricted to T, NK and DC lineages, suggesting a selective colonization of T/NKPs to thymic anlage138. Furthermore, it has been shown that Notch signaling is riot activated in precursors located in perithymic mesenchyme, yet they have already lost B cell potential and committed to the T lineage139'140. Hence, these data strongly suggest that Notch signaling is not involved in determining T cell versus B cell fate during the first wave of thymic colonization. Nonetheless, Notch signaling is required for induction I O C and maintenance T cell specification and differentiation at both the DN1 and DN2 stages . Fetal liver Fetal blood Fetal thymus Figure 1.3. Lymphocyte development at fetal stage Bipotent T/NK cell progenitors (T/NKP) are isolated from fetal liver, blood, and thymus. A bipotent T/B stage could not be found, but p-myeloid/B (p-M/B), p-M/T and unipotent p-B, and p-T are present in fetal liver. Revised from Tabatabaei et al.u and Katsura1 5. 27 As with fetal B cells, fetal T cells are less dependent on IL-7R signaling to develop, since all major thymocyte subpopulations are generated, though in reduced numbers, in IL-7R _ / _ animals. A similar situation to BI category of B cells also exists for Vy3 + y8 T cells. These cells originate more frequently from FL stem cells than from adult B M HSCs 1 3 1 . Evidence suggests that there are differences between fetal and adult NK cell development. From studies of fetal bipotent T/NKPs, it appears that fetal NK cells share a close developmental pathway with T cells, whereas a common precursor for B and NK cells seems to be more relevant in adult BM. In addition to progenitor differences, fetal and neonatal NK cells are phenotypically distinct from adult NK cells such that they lack surface expression of Ly49 receptors normally present on adult NK cells1 4 2. In contrast, the majority of fetal NK cells express a member of Ly49 family, Ly49E, which is almost absent on adult NK cells1 4 3. 1.4.3. Markers of developing HSCs Developmental stages of HSC differentiation have been identified using cell surface markers. These markers which have been mentioned throughout this thesis are listed in Table 1.1. CD41 is the first marker used for separation of committed hematopoietic progenitors from other mesodermal cell types in early embryo (Figure 1.2)111. CD41 (GPIIb), an allb integrin, is an adhesion molecule restricted to cells of megakaryocyte lineage in the adult. However, a number of studies have demonstrated the expression of CD41 on hematopoietic progenitors of YS, AGM, fetal liver and adult bone marrow106 1 4 4 " 1 4 7 . Yet, it appears that CD41 expression is more limited to early hematopoiesis, as it gradually declines in the fetal liver 28 stage106'108. Moreover, adult HSCs do not express CD41 1 4 8 . Conversely, CD45 the panhematoppietic marker, is absent on immature HSCs and appears by EDI 1.5122. At this stage, an additional marker of adult HSCs, Sca-1, is also upregulated . Several markers that are not restricted to hematopoietic cells are consistently expressed by both immature and mature fetal HSCs. These markers include CD34, CD31 (PECAM-1), and c-kit 1 2 1 ' 1 4 9 ' 1 5 0. CD34 is a sialomucin expressed on cells of the hematopoietic and the endothelial lineages throughout murine ontogeny151. Mice deficient in CD34 have decreased numbers of YS and 152 • * • FL hematopoietic precursors, while adult hematopoiesis is less affected . This is consistent with the expression pattern of CD34 on fetal and adult HSCs. CD34 expression on HSCs is downregulated by 10 weeks of mouse development153. Table 1.1. Cell surface molecular markers described in this thesis Marker Description/ Family relationship Cell types expressing the marker Biological function Sca-1 (Ly6A/E) Phosphatidylinositol-anchored protein, encoded by a member of interferon-inducible Ly6 family of genes HSCs, MPPs, ELPs in adult B M 8 , 6 7 , H S C s in fetal liver 1 2 3, subsets of B, T, myeloid, and non-hematopoietic l ineages 1 5 4 " 1 5 6 c-kit (CD117) Tyrosine receptor kinase HSCs, C L P s and Pro-L s 6 7 , subpopulation of hematopietic cells, germ cells, melanocytes 6 Growth-promoting and survival factor for hematopoietic stem/progenitors 6 8 ' 1 5 7 CD34 Sialmucin Endothelial cells, hematopoietic progenitors in mouse, H S C s in human 1 5 8 Binds CD62L and plays a role in adhesion in endothelial cells; also involved in adhesion and homing of hematopoietic progeni tors 1 5 8 1 5 9 Flt3 Tyrosine kinase receptor Hematopoietic progenitors (MPPs, ELP, C L P , E T P s ) 1 2 Growth promoting and survival factor for lymphoid •i. 68 70 progenitors • IL-7Ra (CD127) Cytokine chain receptor forIL-7 C L P s , early T and B progenitors 1 6 0 Plays a role in development, survival and proliferation of B and T cell precursors 1 6 0 Marker Description/ Family relationship Cell types expressing the marker Biological function C D 2 7 T N F receptor Medul la ry thymocytes , T, N K and s o m e B c e l l s 1 6 B inds C D 7 0 ; a co-s t imula tor for T and B c e l l s 1 6 C D 1 2 2 (IL-2 R p ) Cy tok ine cha in receptor f o r l L - 2 a n d IL-15 N K l ineage, rest ing T cel l subse ts , s o m e B cel l l i n e s 1 6 Involved in N K cel l deve lopmen t v ia interact ion with I L - 1 5 1 4 1 , ac t iva tes N K ce l ls through binding I L - 2 1 6 1 B 2 2 0 ( C D 4 5 R ) Ty ros ine phospha tase , B ce l l spec i f i c form of C D 4 5 B ce l ls , s o m e N K l i n e a g e 3 6 Func t ions in s igna l ing through B C R 1 6 a p T C R ant igen receptor a p T ce l ls R e c o g n i z e s ant igen in a comp lex with M H C m o l e c u l e s 1 6 C D 4 Immunoglobul in T H 1 and T H 2 T ce l ls , monocy tes , m a r o p h a g e s 1 6 Co- recep to r for M H C c l a s s II m o l e c u l e s 1 6 C D 8 Immunoglobul in Cyto tox ic T ce l ls Co - recep to r for M H C c l a s s I m o l e c u l e s 1 6 C D 3 Immunoglobul in T ce l ls A s s o c i a t e d with the T C R ; n e c e s s a r y for ce l l su r face e x p r e s s i o n and s igna l t ransduct ion by the T C R 1 6 C D 4 4 Link protein Leukocy tes , erythrocytes B i n d s hya lu ron ic ac id , med ia tes leukocy te a d h e s i o n 1 6 C D 2 5 (IL-2 R a ) Cy tok ine cha in receptor Ac t iva ted T ce l ls , B ce l ls , and monocy tes In combina t ion with I L -2RP and yc b inds IL-2, (IL-2 is T cel l growth factor) Y.5 T C R An t igen receptor yS T ce l ls R e c o g n i z e s protein a n d nonprote in l i g a n d s 2 4 C D 6 2 L (L-select in) C- type lectin B, T .and N K ce l ls , monocy tes Leukocy te a d h e s i o n mo lecu le , b inds C D 3 4 , G l y C A M , med ia tes roll ing on the e n d o t h e l i u m 1 6 C D 1 9 . • • Immunoglobul in B ce l ls Co - recep to r for B c e l l s 1 " N K G 2 D C- type lectin N K ce l ls , subse t of T ce l ls F o r m s homod imers ; N K st imulat ing receptor impl icated in immunity aga ins t v i ruses and t u m o r s 1 6 2 NK1 .1 ( N K R -P 1 C ) C- type lectin N K ce l ls , subse t of T ce l ls N K ce l l st imulat ing r e c e p t o r 1 6 2 D X 5 ( C D 4 9 b ) a 2 Integrin N K ce l ls C D 4 9 b b inds co l l agen or laminin, its funct ion in N K ce l ls is u n k n o w n 1 6 3 Mac-1 ( C D 1 1 b ) Integrin a Mye lo id and N K ce l l s A s s o c i a t e s with C D 1 8 ; b inds C D 5 4 , c o m p l e m e n t c o m p o n e n t and ext race l lu lar ma t r i x 1 6 L y 4 9 C- type lectin N K ce l ls , subse t of memory T ce l ls Ac t i va tes or inhibits N K ce l l s b a s e d on the type of r e c e p t o r 1 6 2 30 Marker Description/ Family relationship Cell types expressing the marker Biological function C D 9 4 C- type lectin T-ce l l subse ts , N K c e l l s 1 6 A s s o c i a t e s with N K G 2 A / C / E receptors to form N K receptors , p lays a role in act ivat ion or inhibit ion of N K c e l l s 4 3 N K G 2 A / C / E C- type lectin N K ce l ls , s u b s e t s of T ce l ls A s s o c i a t e s with C D 9 4 , ac t iva tes or inhibits N K cytotoxici ty d e p e n d i n g on the type of N K G 2 receptors ( A / C / E ) 4 3 N K R P 1 A ( C D 1 6 1 ) C- type lectin N K ce l ls , T ce l ls R e g u l a t e s N K cy to tox ic i ty 1 6 G r a n z y m e B S e r i n e pro te inase N K ce l ls , cytotoxic T c e l l s 1 6 4 Involved in cy to lys is by tr iggering a p o p t o s i s 4 0 C D 4 3 (Leukos ia l in ) Muc in Leukocy tes , excep t rest ing B ce l ls An t i - adhes i ve role due to its ex tended s t r uc tu re 1 6 C D 5 6 Immunoglobul in H u m a n N K c e l l s 6 6 Isoform of h u m a n neura l -ce l l adhes ion mo lecu le ( N C A M ) , adhes ion m o l e c u l e 1 , 6 6 C D 4 5 R A Isoform of C D 4 5 B ce l ls , T cel l s u b s e t s (naive T cel ls) , monocy tes S e e C D 4 5 Integrin a 4 p 7 Fetal lymphoid t i ssue inducer (LTi) ce l ls , human N K progeni tors in lymph n o d e s A d h e s i o n (a4(37), Involved in hematopo ies i s , deve lopmen t of p lacen ta , heart (a4) , and gut l ymphocy tes ( (J7) 1 6 5 C o m m o n y cha in (yc) ( C D 1 3 2 ) Cy tok ine cha in receptor used by IL-2, IL-4 IL-7, IL-9, IL-15, I L - 2 1 5 7 B ce l ls , T ce l ls , N K cel ls , mas t ce l ls , neu t roph i l s 1 6 Essen t i a l for deve lopmen t of T, B a n d N K c e l l s 9 7 ' 9 8 C D 4 5 ( leukocyte c o m m o n ant igen, L C A ) Ty ros ine phospha tase , mult iple i so forms result ing f rom alternat ive sp l ic ing A l l hematopo ie t ic ce l ls , excep t platelets and e ry th rocy tes 1 1 A u g m e n t s s igna l ing through B C R and T C R 1 6 C D 3 1 ( P E C A M - 1 ) Immunoglobul in Monocy tes , platelets, g ranu locy tes , T cel l subse ts , endothel ia l ce l ls A d h e s i o n mo lecu le , med ia tes both leukocy te -endothe l ia l and endothe l ia l -endothe l ia l i n te rac t i ons 1 6 A A 4 . 1 ( C D 9 3 ) Ear ly B ce l l progeni tors, fetal l iver ce l ls , endothel ia l ce l ls , neutrophi ls, m o n o c y t e s 1 6 3 6 1 2 4 unknown C D 4 1 (GPIIb) a Integrin Plate lets , megakaryocy tes , embryon ic hematopoie t ic p r o g e n i t o r s 1 6 , 1 1 1 a l l b integrin, a s s o c i a t e s with C D 6 1 to form GPI Ib , med ia tes platelet funct ions: b inds f ibr inogen, f ibronect in, von wi l lebrand factor, a n d t h r o m b o s p o n d i n 1 6 C D 5 S c a v e n g e r receptor Thymocy tes , T ce l ls , subse t of B c e l l s 1 6 Poss ib l y negat ive regulator of B C R 3 6 Flk-1 ( V E G F - Ty ros ine k inase receptor Ex t raembryon ic and B i n d s V E G F , p lays a role in 31 Marker' - Description/ Family relationship Cell types expressing the marker Biological function R2) embryon ic m e s o d e r m , endothel ia l ce l ls hemang iob las ts hematopo ies i s a n d • • 166 167 v a s c u l o g e n e s i s V E - c a d h e r i n ( C D 1 4 4 ) C a d h e r i n Endothe l ia l ce l ls O r g a n i z e s a d h e r e n s junct ion in endothe l ia l c e l l s 1 6 T e r 1 1 9 G lycopho r i n A Erythroid l i n e a g e 1 b B Erythroid l ineage marke r Gr-1 GPI - l i nked protein Mye lo id l ineage (granulocytes) Mye lo id l ineage m a r k e r 1 b a 1.5. Hematopoiesis from ES cells Doetschman et al. initially noted the hematopoietic potential of ES cells differentiated in suspension cultures. In these cultures, ES cells formed cystic multilayered structures, known as embryoid bodies (EB), which resembled the egg-cylinder-stage embryos, and developed hemoglobihized blood islands in a reproducible fashion170. A sequential development of hematopoietic precursors in EB was observed. Primitive erythroid precursors appear first by day 4 of differentiation. Shortly afterwards, precursors of macrophage and definitive erythroid lineage arise, followed by bipotential neutrophil, macrophages, multilineage precursors, and finally mast cell precursors. The time course of EB blood cell development as well as the growth factor responsiveness of the EB-derived hematopoietic precursors suggests that these early cells are more similar to blood precursors of embryonic YS and early FL than those in the adult B M 1 7 1 . The ES/EB differentiation system has been used to investigate the developmental precursors to the hematopoietic lineage by dissecting EB cell populations prior to the initiation of hematopoietic development. Keller and colleagues identified a population of cells in day-3 32 EB, which is able to form blast colonies in methylcellulose culture in response to vascular endothelial growth factor (VEGF) (designated as blast-colony-forming cell, BL-CFC). Cells from these blast colonies were replated into other conditions, and were shown to be capable of differentiating into both primitive and definitive erythroid and myeloid hematopoietic precursors, as well as into endothelial cells. These studies supported the notion that the hematopoietic and the endothelial lineage share a common ancestor termed hemangioblast172'173. Comparable BL-CFC displaying hematopoietic and vascular endothelial potential was found in the posterior region of the primitive streak of ED7-ED7.5 mouse embryos, thereby providing evidence for the in vivo existence of hemangioblast (Figure 1.2)174. BL-CFC in both mouse embryo and EB co-express Flk-1 and Sci 1 7 4 " 1 7 6 . Gene-targeting studies have demonstrated that Flk-1 and Sci play an important role in hematopoietic and endothelial cell development. Flk-1 is a receptor tyrosine kinase that is stimulated by VEGF 1 6 7 . Mice deficient in Flk-1 shows defects in the blood vessels and yolk sac blood-islands177. In chimeric aggregation experiments between Flk-1~'~ ES cells and wild type embryos, Flk-1~'~ ES cells fail to contribute to primitive and definitive hematopoiesis or vasculogenesis178. Homozygous mutations in Sci, a basic helix-loop-helix transcription 179 180 factor, causes death at around ED 10.5 due to defective embryonic hematopoiesis ' . An analysis of chimeric mice derived from Scf^ ES cells demonstrated that Sci is required for definitive hematopoietic development181 as well as endothelial cell development166 1 8 2 . Scf^ ES cells are unable to give rise to hemangioblast-derived blast colonies . The aforementioned data is in agreement with a role for both Flk-1 and Sci in hemangioblast formation. Using knock-in ES cells carrying a non-functional human CD4 gene in one allele of Sci, Chung et al. showed that hemangioblasts within days 2.75-3 EBs co-express Flk-1 33 and Sci. As they further differentiate, these cells downregulate Flk-1 expression to become Flk-l~Scl+ cells. Only hematopoietic cells, but no endothelial cells, developed from Flk-rSc l + cells1 7 6. Endothelial cells were generated from Flk-1+Scl+ and Flk-1+Scl~ cell populations. The conclusion from these observations is that commitment to the hematopoietic lineage is accompanied by loss of Flk-1 expression and maintenance of Sci expression. Mikkola et al. presented CD41 as the marker indicating divergence of definitive hematopoietic precursors from the hemangioblasts during EB differentiation, since endothelial cells only developed from CD4T cells. In this study, erythroid and myeloid precursors were enriched in CD41+c-kit+CD45~ fraction in day-6 EBs, while the lymphoid potential of this population was not tested108. The phenotype described for hematopoietic progenitors from EBs is similar to embryonic HSCs. However, it is unclear whether these cells represent YS or AGM-derived hematopoietic precursors. Several groups have reported the potential to repopulate irradiated adult mice with cells differentiated from ES cells in vitro. One study demonstrated that ES cells after at least 4 days of EB differentiation obtain repopulating capacity, as assessed by PCR 12 weeks after transplantation184. Another study documented transient lymphoid reconstitution in Rag-F;~ mice injected with CD45+, AA4.1 + , B22(T cells from day-15 EBs 1 8 5 . Very low lymphoid repopulation in immunodeficient SCID neonates has also been reported with day-11 to day-13 EB cells . In both studies, EB cells used for engraftment had been differentiated long beyond the time point at which the hematopoietic lineage is initially specified. Thus, even though blood formation in early EBs recapitulates yolk sac hematopoiesis, the later stages 34 may represent AGM-type. hematopoietic differentiation, which includes lymphopoiesis. Moreover; c-kit+CD45+ cells taken from day-7 to day-10 EBs differentiated in a cocktail of 187 cytokines were shown to contribute to lymphomyeloid engraftment in irradiated mice . This latter experiment has not been reproduced, and adult repopulation with ES-derived cells still remains a big challenge. As with YS HSCs, the difficulty of engraftment with ES/EB HSCs may reflect their immaturity. The molecular mechanisms responsible for directing HSCs differentiation from ES cells have not been defined112. However, genetic modifications of EB inn 1OQ cells with the oncoprotein Bcr/Abl , the activated form of its signaling target Stat5 , and the homeobox proteins HoxB4 1 9 0, and Cdx41 9 1 have resulted in reproducible multilineage hematopoietic repopulation in irradiated adult recipients. Nakano ei al. showed that co-culture with OP9 stromal line allows the generation of lymphohematopoietic progenitors from ES cells192. OP9 stromal cells were generated from newborn calvaria of op/op mice that are deficient in macrophage colony-stimulating factor (M-CSF) 1 9 3 ' 1 9 4 . Unlike other stromal cell lines which preferentially support monocyte-macrophage generation from ES cells, M-CSF deficient OP9 cells promoted lymphoid differentiation192. Furthermore, B and T cells were efficiently generated from ES cells using ES/OP9 co-culture195'196. In these studies, the intermediate hematopoietic progenitors were not identified. Nakayama et al. reported that CD34+ cells from day-6 to 7 of EBs differentiate into B and NK cells when co-cultured with OP9 stroma. These cells also had myeloid differentiation potential197. They also demonstrated that erythro-myeloid CFCs and lymphoid progenitors are enriched in CD34+CD3l'° and CD34+CD45~ fractions, respectively198. The enrichment for both myeloid and lymphoid progenitors in the same population was not 35 shown. Since, both OP9 co-culture system and conventional EB system are used for the formation of hematopoietic cells from ES cells, Zhang e al. compared hematopoietic development from ES cells in these two systems. While similar kinetics of Sci and Flk-1 expression was observed in both methods, OP9 culture promoted development of endothelial (Flkl+VE-cadherin+) cells, whereas CD45+ and Terl 19+ hematopoietic cells preferentially developed within EBs 1 9 9 . Using the EB system, Lian et al. devised a multi-step differentiation culture to recapitulate NK cell development from hematopoietic precursors. In this model, ES cells were induced to form EBs. CD34+ cells from day-8 EBs were cultured on OP9 with SCF, Flt3-L, IL-7 and IL-6 to differentiate into cells of hematopoietic lineage. In a final step, these cells became NK cells in presence of IL-2 and IL-15 2 0 0. 1.6. Factors regulating definitive hematopoietic development As previously explained, definitive hematopoiesis refers to the development of all lineages other than primitive erythroid and encompasses definitive erythroid, myeloid, and lymphoid lineages105. The genes known to specify blood fate in the embryo are discussed. 1.6.1. Sci Sci is a transcription factor, which can be used to track early hematopoietic commitment199. Sci null EBs do not form BL-CFC hemangioblasts183; instead they form blast-like colonies 36 with endothelial but not hematopoietic potential175. Knockout studies have shown that lack of Sci impairs hematopoietic development, while endothelial cells can still develop, indicating a pivotal role for Sci in hematopoietic commitment but not in the early stage of vasculogenesis. Sci expression extends from all hemogenic embryonic tissues to adult HSCs . However, the deletion of Sci from adult B M has no effect on HSC engraftment, self-renewal, and differentiation into myeloid and lymphoid lineages, and only proper differentiation to erythroid and myeloid lineages is impaired. This indicates that the sustained expression of Sci is not essential for HCS functions112'201. Sci interacts with other transcription factors such as Lmo2 and Gata-2112. 1.6.2. Notch! The Notch receptors regulate a wide range of developmental processes including hematopoiesis. YS primitive hematopoiesis occurs normally in the absence of Notchl, but in vivo definitive repopulating potential of Notchl^' cells derived from P-Sp is severely impaired. Furthermore, preventing Notch signaling by y-secretase inhibitors abolishes in vitro hematopoietic activity from P-Sp explants (ED9.5) but not from A G M explants (ED10.5). Therefore, Notchl regulates definitive hematopoiesis during a narrow time window possibly around P-Sp stage, and is not required at the later stages of hematopoietic development112. Interactions with other key factors, such as Sci, Amll and Mil need to be discovered. Adult HSCs self-renewal is promoted by ligand-mediated Notch stimulation, or expression of constitutively active forms of Notch33. 37 1.6.3. Aml l The Amll (Runxl/Cbfa) gene encodes the DNA-binding subunit of a transcription factor of the core binding factor (CBF) family202. Targeting studies have demonstrated that Amll is essential for the establishment of the definitive but not primitive hematopoiesis. AmU~'~ embryos reveal intact primitive YS hematopoiesis but die at ED 12 - 13 2 0 3 , 2 0 4 . Before death, the liver rudiment is devoid of all definitive erythroid, myeloid, and megakaryocyte cells but contains primitive erythrocytes, indicating a complete block in the development of definitive hematopoietic potential. AmT'~ ES cells were also unable to differentiate into definitive hematopoietic cells2 0 3. Amll hemizygous mouse display a milder phenotype, suggesting a gene dosage effect in the process of definitive hematopoiesis112'205. While reducing HSC activity in the A G M region, haploinsufficiency of Amll causes an earlier appearance of HSCs in the normal position in A G M and also in Y S 2 0 6 . Amll is expressed in precursors with hemangioblast properties in EBs. Consistent with the in vivo findings, AmU~/~ EBs give rise to normal numbers of primitive erythroid colonies but are unable to differentiate to definitive hematopoietic lineages207. Haploinsufficiency of Amll in EBs causes the acceleration of ~) OR mesodermal commitment and hemangioblast development . 1.6.4. Mi l The Mil (All-l/Hrxl) gene is disrupted in leukemic cells displaying both lymphoid and myeloid differentiation programs (mixed lineage leukemia), suggesting the involvement of an early progenitor. The requirement for Mil in definitive hematopoiesis was shown in 38 Rag2~~ ~ chimeric animals reconstituted with Mil" ~ or heterozygous ES cells. In adult chimeric animals, Mil-deficient cells could not generate lymphocytes. Analysis of fetal chimeras showed a deficiency in fetal liver HSC/progenitor populations, which is preceded by a reduction of HSC activity in AGM. Mil is thought to regulate Hox genes ' . 1.6.5. Hox genes Homeobox-cbntaining Hox genes are believed to be the target of signaling pathways involved in anteroposterior (AP) patterning and mesoderm specification during development. Hox genes show an overlapping and graded expression pattern along the AP axis, and possibly direct the position of tissue formation112. Several Hox genes are expressed in definitive HSCs but not in YS, including HoxB3, B4, A4 and A 5 2 1 0 ' 2 1 1 . Overexpression of HoxB4 in adult B M enhances hematopoietic repopulation without inducing leukemia or interrupting normal hematopoietic differentiation. Hox B4 seems to regulate self-renewal of definitive HSCs 2 1 2 . Moreover, Hox B4 increases the formation of mixed hematopoietic colonies from ES cells in vitro213. Finally, ectopic expression of HoxB4 in ES cells and YS hematopoietic progenitors confers definitive lympho-myeloid engraftment potential190. 1.6.6. Cdx genes Cdx genes are the target of morphogens, such as retinoic acid, fibroblast growth factor, and Wnt family members, which mediate positional patterning, and are thought to convey positional information from these pathways to the Hox gene family112. Genetic analysis in the 39 zebrafish has elucidated a link between Cdx genes, Hox genes and hematopoiesis. Cdx4 was shown to be mutated in Kgg zebrafish mutants, which display a defect in hematopoiesis, abnormal anterposterior patterning and aberrant Hox gene expression. The hematopoietic deficiency could be rescued by overexpression of HoxB7a and HaxA9a, but not Sci, indicating that the Cdx regulation of Hox genes make the posterior mesoderm competent for blood development. Ectopic expression of Cdx4 promotes hematopoietic colony formation of ES cells during EB development214. In addition, expression of several hematopoietic genes, including Sci, Amll , and Gatal is reduced in Cdx4 null zebrafish, whereas overexpression of Cdx4 results in ectopic blood formation and upregulation of HoxB4 2 1 4. Furthermore, overexpression of Cdx4 during early EB development was shown to enhance lymphomyeloid engraftment potential of ES-derived hematopoietic progenitors191. Therefore, it seems that a genetic pathway involving Cdx and Hox genes plays an essential role in specification of definitive hematopoiesis in the EB system. 1.7. Thesis objectives and hypotheses The main objective of my thesis was to study the differentiation pathway of lymphocytes, in particular NK cells from ES cells. Even though it is possible to derive lymphocytes from ES cells, the developmental pathway leading to lymphocytes and the intermediate progenitors along the pathway have not been described. Since the EB system is more efficient in hematopoiesis than other methods of hematopoietic differentiation from ES cells, this method was chosen to identify lymphocyte precursors from ES cells. The culture system developed by Lian et al.200 was modified and used to characterize NK cell progenitors at different steps 40 in development and the relationship between the NK and other hematopoietic lineages was examined. My hypotheses were that: 1) Co-culture with OP9 and cytokines induces development of NK progenitors from CD34+ EB cells. 2) These NK progenitors may have other lymphoid potentials similar to CLPs or bipotent T/NKPs. 3) CD34+ EB cells are heterogeneous and may include non-hematopoietic lineages. The following objectives were formulated to test these hypotheses: 1) to identify NK intermediate progenitors within cells differentiated from CD34+ EB on OP9 by testing NK potential of various populations at different time points in limiting dilution assays. 2) to test other lineage potentials of these NK progenitors in in vitro lineage-specific cultures. 3) to purify hematopoietic progenitors in CD34+ EB population using cell surface markers. 41 Chapter 2. Materials and methods 2.1. Cell lines OP9 cells were obtained from RIKEN (Tokyo, Japan). OP9 cells transduced with Delta-like 1 and green fluorescent protein (OP9-DL1) were kind gift from Dr. J-C Zuniga Pflucker (Toronto, Canada). RI ES cell line (129/SvJ strain) was provided by Dr. RK Humphries (Vancouver, Canada). OP9 and OP9-DL1 cells were cultured in Minimum essential medium eagle, alpha modification with nucleosides (aMEM) with 10% FBS (HyClone), penicillin, and streptomycin. 2.2. Antibodies Antibodies used in this thesis are listed in Table 2.1. Table 2.1. List of antibodies Antibody Clone Animal Isotype Conjugate Company NKG2A/C/E 20d5 mouse Rat IgG 2 a, K biotin PM CD94 18d3 mouse Rat IgG 2 a, K biotin PM NKG2D C7 mouse Ar Ham IqG biotin Biolegend CD3s 145-2C11 mouse Ar Ham IgGl, K biotin PM CD8a (LY-2) 53-6.7 mouse Rat IgG 2 a, K PE Boehringer CD4 GK1.5 mouse Rat IgG 2 b, K biotin PM gamma-delta TCR GL3 mouse Ar Ham IgG2, K biotin PM TCR beta chain H57-597 mouse Ar Ham IgG2, XI biotin PM CD44 1M7 mouse Rat IgG 2 b, K biotin PM CD25 (IL-2 R alpha chain) 3C7 mouse Rat IgG 2 b, K PE PM CD19 1D3 mouse Rat IgG 2 a, K biotin PM ; *••B220 RA3-6B2 mouse Rat IgG 2 a, K biotin homemade Mac-1 M1/70 mouse Rat IgG 2 b, K biotin homemade Gr-1 RB6-8C5 mouse Rat IgG 2 b, K biotin homemade TER-119 Ter-119 mouse Rat IgG 2 b, K biotin PM CD127 (IL-7R alpha chain) A7R34 mouse Rat IgG 2 a, K biotin eBioscience 42 Antibody Clone Animal Isotype Conjugate Company C D 1 2 2 (IL-2R beta chain) TM-31 m o u s e Rat IgG 2b, K P E P M c o m m o n g a m m a cha in s ' " - - ' (yc) - T U G m 2 m o u s e Rat IgG 2b, K biotin P M C D 4 5 . 2 (Ly5.2) m o u s e mouse IqG 2 a purif ied h o m e m a d e C D 4 5 . 2 (Ly5.2) m o u s e mouse IqG 2 a F I T C h o m e m a d e C D 4 5 30-F11 m o u s e Rat IgG 2 b , K . A P C P M C D 3 4 R A M 34 m o u s e Rat IgG 2 a , K biotin e B i o s c i e n c e C D 3 4 R A M 34 m o u s e Rat IgG 2 a , K F I T C P M Flk-1 A v a s 12a1 m o u s e Rat IgG 2 a , K P E P M c-kit 2 B 8 m o u s e Rat IgG 2 b , K P E - C Y 7 P M c-kit 2 B 8 m o u s e Rat IgG 2 b , K biotin P M S c a - 1 ( Ly6A /E ) E 1 3 - 1 6 1 . 7 m o u s e Rat IgG a , K P E P M C D 3 1 M E C - 1 3 . 3 m o u s e Rat IgG 2 a , k biotin P M C D 3 1 M E C - 1 3 . 3 m o u s e Rat IgG 2 a , k purif ied P M C D 4 1 M W R e g 3 0 m o u s e Rat I g G l , k F I T C P M Streptav id in (SA) F I T C P M St reptav id in ( S A ) A P C P M Streptav id in ( S A ) P E P M Streptav id in ( S A ) P E - T e x a s R e d P M G o a t an t i -mouse IgG Alexa Flour 647 Molecular Probes G o a t anti-fat IgG Alexa Flour 647 Molecular Probes PM: Pharmingeh 2.3. Cell culture 2.3.1. ES cell culture The ES cell line R l was maintained on gelatin-coated tissue culture flasks in Dulbecco's modified Eagle's medium (with 4500 mg D-glucose/L) (DMEM) containing 15% FBS, 2 mM L-glutamine, 0.1 mM nonessential amino acids (StemCell Technologies, Vancouver, Canada), 1,000 U/ml leukemia inhibitory factor (Chemicon International, Temecula, CA) and 100 uM monothioglycerol (MTG) (Sigma-Aldrich, Oakville, Canada)200. Two days before initiation of differentiation, ES cells were passaged in Iscove's modified Dulbecco's medium (IMDM) supplemented with the same reagents used in the maintenance medium. On the day 43 of differentiation, cells were harvested, resuspended at 1,500-2,500 cells/ml in the differentiation medium consisting of IMDM, 15% FBS, 1% methylcellulose, 2 mM L-glutamine, 150 uM MTG, 50 ng/ml mouse stem cell factor (SCF), 30 ng/ml mouse IL-3, and 30 ng/ml human IL-6, and 1 ml of the cell suspension was dispensed into 35 mm petri dish (StemCell Technologies, Vancouver, Canada) ' . The cells were incubated at 37°C and 5% C Q 2 for 8 days for EB formation. EB cells were then harvested, trypsinized and made into single-cell suspension by passing them through a 21-gauge IVi-inch needle three times. Subsequently, the cells were stained with biotinylated anti-CD34 followed by streptavidin-PE and FITC conjugated anti-CD45.2 or purified CD45.2 followed by Alexa Flour 647-conjugated goat anti-mouse IgG, and sorted on FACSVantage™ SE (BD Biosciences, San Jose, CA) for isolation of CD34+, CD34+CD45~ and CD34+CD45+ EB cells. In other experiments, to fractionate CD34+CD45~ EBs according to c-kit and CD41 expression, EB cells were stained with biotinylated anti-CD34 followed by streptavidin-PE-Texas Red, APC-conjugated anti-CD45, PE-Cy7-conjugated anti-c-kit and FITC-conjugated anti-CD41 mAbs and sorted into CD34+CD45~c-kit+CD41+, CD34+CD45"c-kif CD41", CD34+CD45~c-kit+CD41", and CD34+CD45"c-kit"CD41+fractions. Sorted EB cells were then either directly transferred into lineage differentiation cultures or into ES-HP culture (see below). 2.3.2. ES-HP culture Sorted EB cells were seeded onto OP9 stroma in 24-well plates at a concentration of 4xl0 4 cells/well and cultured for 7 days in ccMEM with 5% FBS, 30 ng/ml human IL-6,4 ng/ml mouse IL-7,40 ng/ml mouse SCF, 100 ng/ml human Flt3-L and 100 uM MTG (Stem Cell Technologies) to generate ES-HPs 2 0 0. After the first 3-4 days of incubation, half the media 44 was replaced, with fresh medium containing the same cytokines. ES-HPs were harvested on day 7 by vigorous pipetting, washed, and passed through a 45 pm filter. Cells were then stained for FACS analysis or sorted and transferred into lineage differentiation cultures. 2.3.3. Lineage differentiation cultures OP9 and OP9-DL1 cells used in lineage differentiation cultures were cultured for 2 days in 24 well plates to pre-form stroma layers. Cells to be tested for lineage-specific differentiation were plated onto the pre-formed stroma and cultured. If the culture period was longer than one week, stromal cells were replaced with the new cells. To do so, cells were harvested by pipetting, passed through 45 pm filter, and mixed with new media and plated on new pre-formed stroma. 2.3.3.1. NK cell culture EB cells or ES-HPs were plated on OP9 layers in OP9 media containing 1,000 U/ml human IL-2 (PeproTech, Rock Hill, NJ) and 5 ng/ml human IL-15 (StemCell Technologies)200. Cells were cultured for 7-14 days before FACS analysis. 2.3.3.2. T cell culture EB or ES-HP cells were seeded onto OP9-DL1 stroma with 5ng/ml IL-7, and 10 ng/ml Flt3-L and cultured for 8-14 days. After this period, media was removed from the culture and replaced with media containing Flt3-L and 1 ng/ml TL_777>215>216. Cells were cultured for additional'2-6'days and harvested for FACS analysis or RNA extraction. 2.3.3.3. B cell culture To show the B cell potential of EB cells, EB cells were cultured on OP9 with 5 ng/ml IL-7, 10 ng/ml Flt3-L and 1,000 U/ml IL-2 for 7-8 days. At this time, cells were transferred onto 45 fresh 0P9 with only IL-7 and Flt3-L and cultured for additional 6-7 days . For differentiation of ES-HPs into B cells, ES-HP cells were cultured on OP9 stroma with 5 ng/ml IL-7 and 10 ng/ml Flt3-L for one week195. 2.3.3.4. Erythroid/Myeloid colony forming To test the myeloid colony forming capacity of EB or ES-HP cells, cells were resuspended in IMDM, transferred onto Methocult™ GF M3434 media (StemCell Technologies) at the density of 1000/plate or 5000/plate in duplicate and cultured for 7 - 14 days. The numbers of all colonies including erythroid burst-forming units (BFU-E), granulocyte-macrophage colonies (CFU-GM/CFU-G/CFU-M), and erythrocyte-containing mixed colony-forming units (CFU-GEMM) were scored. 2.4. Staining and F A C S sorting or analysis Cells were first preincubated with 2.4G2 hybridoma supernatant or human y globulin (Sigma-Aldrich) to block Fc-receptors, and then stained with mAbs. All incubations were performed on ice for 30 minutes. Propidium iodide (at the final concentration of 5 ug/ml) or 4'-6-Diamidino-2-phenylindole (DAPI) (at the final concentration of 100 ng/ml) was added to stain dead cells. Stained cells were analysed on a FACSCalibur (BD Biosciences, San Jose, CA) with CellQuest Pro software (BD Biosciances). Cell sorting was carried out on a FACSVantage™ SE (BD Biosciences). 2.5. R T - P C R RNA from bulk cells was isolated with QIAGEN's RNeasy® Mini Kit and reverse transcribed into cDNA using QIAGEN's Omniscript Reverse Transcription kit. For samples 46 from limiting dilution cultures, cells in 96-well plates were lysed with 50 ul guanidinium isothiocyanate solution, RNA was isolated (as described210) and reverse transcribed using a 18-mer oligo(dT) primer (1 ug/ul) (New England BioLabs, Pickering, OT) and Superscript™ II (Invitrogen, Carlsbad, CA). Aliquots (1/5) of cDNA thus generated were used in PCR reaction. Forward primers from TCR Vy2, 3, 4, and 5, and reverse primer from the TCRy constant region have been described 6 0 . The primer sequences are listed in Table 2.2. The 50ul reaction volume contained 5ul of lOx PCR buffer, 1.5 pi of 50mM MgCb, 1 pi of lOmM dNTPs, 1 pi of each 10 um forward and reverse primers, and 0.5 pi of 5 U/ul Taq DNA polymerase. The PCR thermocycling conditions for TCRy RT-PCR were as follows: 5 min at 96°C followed by 40 cycles of 96°C for 15 s, 50°C for 40 s, 72°C for 1 min, and a final 10 min extension at 72°. The following condition was used for granzyme B RT-PCR: 1 min at 94°C followed by 40 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s. 18 pi of PCR products from bulk cultures were mixed with 2 pi of lOx loading buffer and analyzed on 1.2% agarose gel. Table 2.2. List of primers R T - P C R : Vy2: CCTTGGAGGAAGAAGACGA Vy3: CATCGGATGAAGCCACGTA Vy4: AGTGACAGAAGAGGACACG Vy5: CGATTCTGCTCTGTACTACT C-region: CTTATGGAGATTTGTTTCAGC Granzyme B(5'): CAAAGGCAGGGGAGATCATC Granzyme B(3'): CTCTTCAGCTTTAGCAGCATG 0038(5'): GCCTCAGAAGCATGATAAGC CD3s(3'): AGACTGCTCTCTGATTCAGG RAG-1(5'): TGCAGACATTCTAGCACTCTGG RAG-1(3'): ACATCTGCCTTCACGTCGAT GAPDH(5'): TCAACGACCCCTTCATTGACCTC 47 R T - P C R : _ _ GAPDH(3'): AGACTCCACGACATACTCAGCAC . Oligonucleotide probe: JyLTGCAAATACCTTGTGAAAACCTGAG 2.6. Southern blot The gel from TCRy RT-PCR from bulk cultures was alkaline blotted to ZetaProbe membranes (Bio-Rad, Hercules, CA). In limiting dilution experiments, the entire TCRy PCR products from individual wells were transferred onto ZetaProbe membranes using Bio-Dot® Microfiltration apparatus (Bio-Rad) according to manufacturer's protocol. The membrane was probed with biotin-labeled oligonucleotides and visualized by North2South® Chemiluminescent Nucleic Acid hybridization and Detection Kit (Pierce, Rockford, IL). The 3.', end of .oligonucleotide was labeled with biotin-14-dATP according to the manufacturer's (Invitrogen) protocol. The probe sequence is shown in Table 2.2. 2.7. Limiting dilution analysis OP9 and OP9-DL1 cells were X-ray irradiated (30Gy) and cultured for 2 days in 96 well plates to pre-form stroma layers. Limiting numbers of cells were deposited into 96-well plates containing the pre-established stroma using the CloneCyt Plus option of FACSVantage™ SE cell sorter. To determine NK progenitor frequency, cells were cultured for 10-12 days on OP9 stroma in IL-2 and IL-15. For T progenitor frequency, cells were cultured on OP9-DL1 stroma with 5 ng/ml IL-7 and 10 ng/ml Flt3-L for 10-12 days. Cells were then cultured with 1 ng/ml IL-7 for additional 3-5 days. After this culture period, RNA was isolated from cells as described in RT-PCR section. RNA thus generated was reverse 48 transcribed into cDNA and used in PCR reaction. The presence of NK cells was confirmed by granzyme B RT-PCR (Table 1.1). Since y8 T cell lineage seems to arise earlier than ap T cells during T cell development28, TCRy RT-PCR was used to detect cells of T lineage. The Cyl cluster of the TCRy locus, which contains four Vy2, 3,4 and 5 segments, is frequently rearranged to JyT segment and expressed as Vy2/3/4/5-JylCyl products by the fetal and/or adult y8 T cells2 1 7. Therefore, a mixture of Vy2, 3, 4, and 5 primers was paired with a reverse primer from TCRy constant region (a sequence shared by Cyl, 2, and 4)6 0. Rearranged TCRy transcripts were detected by southern blotting using a probe to Jyl. Progenitor frequency was determined using Poisson statistics and the method of maximum likelihood using L-Calc™ software (StemCell Technologies). 49 Chapter 3: Characterization of developmental pathway of natural killer cells from embryonic stem cells in vitro1 3.1. Introduction The NK cell developmental pathway includes the formation of committed NKPs from multipotent progenitors. Currently, a number of intermediate progenitors derived from HSCs are thought to generate CD122+ NKPs. These progenitors include CLPs or Lin~c-kit'° pro-lymphocytes in the adult and bipotent T/NKPs in the fetus. In the ES cell differentiation model used by Nakayama et al.191', it was shown that CD34+ hematopoietic progenitors from EB cells give rise to NK and B cells. However, the developmental stages and intermediate progenitors were not characterized. Furthermore, using a multi-step culture system, Lian et al.200 showed that the first stage of NK development from CD34+ EB cells involves differentiation on OP9 stroma with SCF, Flt3-L, IL-7 and IL-6 cytokines, which generates cells we called ES-derived hematopoietic progenitors (ES-HPs). In the second step, ES-HPs gave rise to cells of NK lineage. No other lymphocytes were generated in this culture system. In this study, the ES cell culture system was used to determine the differentiation pathway from ES cells to NK cells. CD34+ EB cells were isolated and differentiated into ES-HPs. These ES-HPs had NK, T, and very low myeloid potentials. Further characterization of CD34+ EBs showed that NK and T potentials were contained in a CD45" subset, whereas 'A version of this chapter has been published. Tabatabaei-Zavareh N, Vlasova A, Greenwood CP, Takei F. Characterization of developmental pathway of natural killer cells from embryonic stem cells in vitro. PLoS ONE. 2007;2:e232. 50 CD45 EB cells had myeloid but not lymphoid potential. Limiting dilution analysis of ES-HPs generated from CD34+CD45~ EB cells showed that CD45 +Mac-rTerl 1" ES-HPs are highly enriched for NK progenitors but they also had T, B and myeloid potentials. 3.2. Results 3.2.1. N K and T cell potentials of ES-HPs The previously described ES cell culture system200 was slightly modified and used in this study (depicted in Figure 3.1). Briefly, R l ES cells were cultured in methyl cellulose for 8 days for EB formation. CD34+ EB cells were sorted and cultured on OP9 stromal cells with SCF, Flt3-L, IL-7 and IL-6 for 7 days. As previously reported200, the cells generated in this culture, termed ES-HPs, further differentiated into NK cells upon co-culturing with OP9 in the presence of IL-2 and IL-15. Typically, from 4xl0 4 EB cells, 105 ES-HP cells were generated per well. From those ES-HP cells, 5><105 NK cells were produced per well. The NK cells derived from ES cells (ES-NK cells) expressed CD94, NKG2A/C/E receptors on the surface as well as granzyme B transcripts (Figure 3.2A, Figure 3.3D). It has previously shown that similar to fetal NK cells, ES-NK cells lack Ly49 expression but express NKRP1A (CD161) mRNA and are capable of differentially killing some tumor cell lines and MHC class I-deficient lymphoblasts200. To test whether ES-HPs have potential for the T cell lineage, they were co-cultured with OP9-DL1 cells, which promotes T cell differentiation from progenitors218, in the presence of IL-7 and Flt3-L for 8-12 days. RT-PCR analysis of the resultant cells showed the expression of rearranged TCRy mRNA as well as CD3s and RAG1 mRNA (Figure 3.2B, C). Rearranged TCRy mRNA was undetectable in ES-derived NK cells 51 (Figure 3.2B, bottom row). Moreover, flow cytometric analysis showed the surface expression of TCRP and TCRy (Figure 3.2D). Thus, ES-HPs included T cell progenitors. ES-HPs were also tested for the myeloid differentiation potential by in vitro colony forming cell assays. The ES-HP population contained very low frequency of erythroid/myeloid colony forming cells (Figure 3.2E). To further characterize lymphoid progenitors among the ES-HP population, we analyzed the expression of markers associated with B M lymphoid progenitors. Flow cytometric analysis showed that most ES-HPs expressed c-kit whereas only very small fractions expressed IL-7Ra (CD 127), common y chain (yc, CD 132), IL-2Ra (CD25) and IL-2Rp (CD 122) (Figure 3.3A). Furthermore, only 10% of ES-HPs expressed CD45, suggesting that the majority of the ES-HPs are non-hematopoietic or mature erythroid cells. As expected, cells expressing IL-7Roc and yc were enriched in the CD45+ subset of ES-HPs (Figure 3.3B). Limiting dilution culture analysis for NK progenitors showed that on average 0.5% (1 in 202) of the bulk ES-HPs differentiate into NK cells. As expected, NK progenitors were more enriched in CD45+ ES-HPs (1 in 53 or 1.9%) than in CD45" ES-HPs (1 in 286) (Figure 3.3C,D). 52 Differentiation Culture (SCF, IL-3, IL-6) Differentiation Culture (IL-6, IL-7 OP9 stroma S C F , Flt3-L) IL-2, IL-15 E S cell C D 3 4 + EB i FR —• 1 Cell sorting OP9-DL1 stroma IL-7, Flt3-L Figure 3.1. Schematic representation of ES cell differentiation culture. ES culture system to generate ES-HPs is illustrated. ES cells are induced to form EBs in methylcellulose. CD34+ EB cells are sorted and cultured for one week with OP9 stroma in the presence of indicated cytokines to generate ES-HP cells. ES-HPs are cultured on OP9 stroma with IL-2 and IL-15 for NK cell differentiation or on OP9-DL1 stroma with IL-7 and Flt3-L for T cell differentiation. 53 A B TCR(3 E Expt. No. CD34 + EB ES-HP 1 2.3/1000 5 /1000 2 5.9/1000 10.6/1000 Figure 3.2. Lineage potential of ES-HPs generated from CD34 EBs. ES-HPs derived from CD34+ EB cells were incubated in NK and T culture as described in Figure 3.1. (A) NK cells generated from ES-HPs were stained for the indicated receptors and analyzed by flow cytometry. Filled histograms show staining with the appropriate mAbs and open histograms show isotype-matched control antibody staining. Percentages of positively stained cells over the control staining are shown. Dead cells were stained with propidium iodide and gated out. Residual OP9 cells were also gated out by their high scatter profile. (B) RNA was isolated from 2xl0 5 bulk T cells and 2x106 bulk NK cells derived from ES-HPs (ES-T and ES-NK, respectively) and converted into cDNAs. Aliquots (1/30) of cDNAs were subjected to PCR for rearranged TCRy genes. The PCR products were blotted and hybridized to a Jyl probe. Thymocytes were used as positive control for rearranged Vy2 and Vy3 TCR mRNA (top) and Vy2 TCR mRNA (bottom). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RT-PCR was also used as control. (C) cDNA was generated from ES-T cells as in (B). One microlitre of undiluted, 1/10 and 1/100 diluted cDNA was subjected to PCR for CD3s and RAG-1. OP9 cells were used as negative control. (D) ES-T cells were harvested on day 7, stained for TCRyS and TCRp" and analyzed using a flow cytometer as in (A). OP9-DL1 cells expressed green fluorescent protein and were gated out by green fluorescence. (E) One thousand CD34+ EBs and ES-HP cells were plated in methylcellulose media for myeloid and erythroid colony formation and the total number of myeloid and erythroid colonies were counted as described in materials and methods. 54 A C Figure 3.3. Characterization of NK progenitors within ES-HPs. (A) ES-HP cells derived from CD34+ EBs were stained for the indicated markers and analyzed by flow cytometry as in Figure 3.2A. (B) ES-HPs were co-stained with anti-CD45.2 and IL-7Ra mAbs (left panel), or anti-CD45.2 and yc mAbs (right panel) and analyzed by flow cytometry. CD45 positive cells were gated and analyzed for the expression of indicated receptors. (C) Irradiated OP9 cells were cultured for 2 days in 96 well plates. ES-HPs were stained with anti-CD45.2 mAb and CD45+ and CD45" ES-HPs were sorted by FACS into the wells with pre-formed OP9 stroma layers. For CD45+ ES-HPs, 10, 30 and 100 cells per well were sorted into 12 wells each. For CD45" and bulk ES-HPs, 30, 100 and 300 cells per well were sorted into 12 wells each. After culturing with appropriate cytokines for NK cell differentiation, cells in individual wells were harvested and analyzed for the presence of NK cells by granzyme B RT-PCR. Statistical analysis was performed using L-Calc™ software. The results are means ± SD of three independent experiments, except for bulk ES-HPs, which is average of two experiments. (D) One example of RT-PCR for granzyme B expression in limiting dilution experiments is shown. cDNA is from sorted CD45+ ES-HPs cultured in NK condition as in (C). Specificity of RT-PCR products was confirmed by size and southern hybridization to granzyme B-specific oligo probe. 55 3.2.2. Heterogeneity of CD34 + E B cells: CD34 +CD45 E B cells have lymphoid potential The above results showed that the ES-HP population was very heterogeneous, containing hematopoietic and possibly non-hematopoietic (e.g. endothelial) cells, and the frequency of NK progenitors among ES-HPs was low. To determine whether this is due to heterogeneity of CD34+ EB cell population that gave rise to ES-HPs, we analyzed the expression of various hematopoietic cell markers on CD34+ EB cells (Figure 3.4A). Large fractions of CD34+ cells expressed the hematopoietic progenitor-associated markers c-kit (65%) and Sca-1 (35%), and almost all expressed CD31, a marker for endothelial cells2 1 9 and erythroid progenitors150. No significant levels of IL-7Ra (CD 127) and mature hematopoietic lineage markers, including Mac-1, Gr-1, Terl 19, B220, CD19, CD3 and CD8 were detected on CD34+ EB cells. Approximately 15-25% of CD34+ EB cells expressed the pan-leukocyte marker CD45. We fractionated CD34+ EB cells into CD45+and CD45~ subsets by FACS sorting and analyzed for myeloid/erythroid and lymphoid potentials. Both populations contained comparable frequencies of myeloid/erythroid colony forming cells (Figure 3.5 A). When they were cultured on OP9 stroma in the presence of SCF, Flt3-L, IL-7 and IL-6 for 7 days to generate ES-HPs and examined for the myeloid potential, the frequency of myeloid/erythroid colony forming cells in CD45+ EB-derived ES-HPs was significantly higher than that of CD34+CD45" EB-derived cells. However, CD45+ EB cells or those cultured for ES-HP generation did not differentiate into NK, T or B cells upon co-culturing with OP9 or OP9-D L T hi the presence of appropriate cytokines (see materials and methods). In contrast, CD34+CD45~ EB cells cultured under the same conditions differentiated into NK and T cells (Figure,3.5B, C). Limiting dilution analysis showed that on average 1 in 633 CD34+CD45~ 56 EB cells differentiated into NK cells, while frequency of T progenitors was 1 in 1266 (Figure 3.5D). No NK or T cell progenitors were detected among CD45+ EB cells by limiting dilution analysis (data not shown). These results indicate that lymphoid potential is contained in the CD45~CD34+ EB cell population whereas CD45+ EB cells have erythroid/myeloid but not lymphoid potential. Analysis of Mac-1 expression on CD34+ EB cells showed that in contrast to CD45" subset, CD45+ subsets are Mac-1+, suggesting that the latter are committed myeloid precursors (Figure 3.4B). 57 a u , i ft IB)11 i l i a ) i IIIB| .111 10° 101 102 103 10 CD31 io u 101 io 2 103 104 c-kit 1 ! 4 1 - • • < ' ! » : ' . V 2 H ' W l B I " 1 10u 10' 10^  10J 10H Sca-1 0.1 0.2 co CJ o o • o. • 6 . t -1.6 -1 ^ ' i t 18 i o ° io1 102 i o 3 io' IL-7Ra 10° 101 10* Lin 103 10' 4 - 101 102 103 10"1 CD45 B o • CO o • o o • 1 i •• 1 2 B P 9 8 l | ' \ r h i . | i i n . CO o • . '^ 75 25 10u 10' 10^  10^  10' CD34 10" 101 10^  10° 10"1 CD45 *2 Figure 3.4. Surface marker analysis of EB cells. (A) EBs were harvested on day 8 and single cell suspension was prepared. Cells were stained with anti-CD34 mAb together with mAb to the indicated markers and analyzed by flow cytometry. (B) CD34+CD45" (left) and CD45+ EB cells (right) in (A) were gated and anlaysed for Mac-1 expression. 58 A B 60j CD45- CD45 + CD45" CD45 + EB EB EB- EB-Derived Derived ES-HP ES-HPs c progenitors progenitors Figure 3.5. CD34 +CD45 E B cells contain lymphoid potential while CD34 + CD45 + E B cells are committed to myeloid lineage. (A) CD34+CD45~ and CD45+ EB cells were isolated by FACS sorting and cultured to generate ES-HPs. The sorted EB cells and the ES-HPs generated from them were plated for myeloid and erythroid colony formation as in Figure 3.2E. (B) CD34+CD45~ EB cells were directly cultured on OP9 stroma with IL-2 and IL-15 for NK cell differentiation. Cells were harvested after 2 weeks, stained for NK markers and analyzed by flow cytometry. (C) CD34+CD45~ EB cells were directly cultured onto OP9-DL1 stroma with proper cytokines for T cell differentiation for 3 weeks. Expression of T cell markers was analyzed by flow cytometry. (D) Limiting numbers (100, 300 and 1,000 cells per well) of CD34+CD45" EB cells were sorted into each well of 96 well plates. For NK progenitor assays, wells contained OP9 stroma, IL-2, and IL-15. For T progenitor assays, wells contained OP9-DL1 cells, IL-7 and Flt3-L as described in materials and methods. NK cells were detected by granzyme B RT-PCR and T cells detected by TCRy RT-PCR followed by southern blotting. The number of progenitors in 1000 plated cells was calculated as in Figure 3.3C. 3.2.3. N K cell progenitors among ES-HPs derived from CD34 +CD45" E B cells The above results showed CD34+CD45~ EB cells have lymphoid potentials but the frequencies of NK and T cell progenitors were rather low. Therefore, we generated ES-HPs 59 from CD34+CD45~ EB cells and analyzed them for cell surface marker expression and lymphoid differentiation potentials. Flow cytometric analysis showed that the cells generated in vitro from CD34+CD45~ EB cells were again heterogeneous and included large fractions expressing c-kit, Sca-1, and CD31 whereas IL-7R was almost undetectable. Cells expressing the erythroid marker Terl 19 and the myeloid cell marker Mac-1 (CD1 lb, CD 18) were also detected (Figure 3.6A). Only 13% of the cells were CD45+, which included cells co-expressing c-kit and Sca-1 and those expressing Mac-1 and/or Terl 19 (Figure 3.6B). NK potential of ES-HPs generated from CD34+CD45~ EB cells was first tested by bulk cultures. NK cells expressing CD94 and NKG2A/C/E were readily generated in cultures on OP9 stroma (data not shown). Limiting dilution analysis showed that NK progenitors are highly enriched in the CD45+Lin~ (Mac-TTerl 19") subset of ES-HPs. In three experiments, the frequency of NK progenitors in this population was on average about 10% (1 in 10), ranging from 14% (1 in 7) to 4% (1 in 24) in three experiments (Figure 3.7), which is comparable to the frequency of NK progenitors in the B M NKP (Lin CD 122 ) population , whereas the NK progenitor frequency of the bulk ES-HP population was on average 0.4% (1 in 230). As the CD45+Lin~ subset is about 5% of the total ES-HP population, most NK progenitors seemed enriched in this subset of ES-HPs. However, CD45+Lin~ ES-HPs were different from BM-derived NKPs, as they do not express detectable level of IL-2R(3 (CD 122) (Figure 3.6B, right panel). When CD45+LhT ES-HPs were sorted and cultured with IL-2 and IL-15 for three days, IL-2Rp was detected on the cultured cells (Figure 3.6C). CD45+Lin" ES-HP cells became mature CD94+ and NKG2A/C/E + NK cells after one week in the NK differentiation culture (Figure 3.6D). 60 to 0 101 i o 2 i o 3 i o 4 10° To H o 2 ' " I O 3 " 1 ^ i"o° To1Vo^ io3 io4 io° l ' 101 102 103 i o 4 c-kit Sca-1 CD31 IL-7Ra 10° 101 102 103 104 10° 101 102 10 IO4 10° 101 102 103 104 10° 10 102 10 10 Gr-1 Terl 19 Mac-1 B a u Vi 30 22 48^ 2 10° 101 10-' W 10 Mac-1 + Terl 19 D 10° 101 IO2 103 104 IL-2RP 66% IL-7Ra 10" 101 10* 10"* 10*1 CD94 10° io' 102 103 W NKG2A/C/E Figure 3.6. Characterization of ES-HP cells derived from CD34+CD45 EBs for surface markers and NK potential. (A) ES-HP cells derived from CD34+CD45~ EB cells were stained with mAbs to indicated markers and analysed by flow cytometry. (B) ES-HP cells were co-stained with anti-CD45, c-kit andiSca-1 mAbs. Cells were then gated on CD45+ and analyzed for the expression of c-kit and Sca-1 (left panel). ES-HP cells were stained with a combination of purified anti-CD45.2 mAb followed by Alexa Flour 647-goat anti-mouse IgG, and biotinylated anti-Mac-1 and Terl 19 mAbs followed by streptavidin-PE (middle panel). CD45 +Mac-rTerl 19" cells were gated and analyzed for the expression of IL-2RJ3 (right panel). (C) CD45+Lin" ES-HPs were sorted and cultured on OP9 stroma with IL-2 and IL-15. After 3 days, cells were harvested and subjected to flow cytometry analysis after staining with anti-IL-2Rp and anti-IL-7Ra. (D) Cells in (C) are analysed for the expression of NK markers after one week. 61 16 CD45+ Mac-1 "Terl 19" ES-HPs Bulk ES-HPs Figure 3.7. NK progenitor frequency of ES-HPs derived from CD34+CD45 EBs. The bulk and sorted CD45+Lin~ ES-HP cells were analyzed for NK progenitor frequency by limiting dilution cultures as in Figure 3.3C. For the former 30, 100 and 300 cells per well and for the latter 3, 10 and 30 cells per well were plated. The results are mean ± SD of three independent experiments. 3.2.4. ES-HPs derived from CD34+CD45" EB cells have T and B cell potentials To test whether ES-HPs derived from CD34XD45" EB cells have T cell differentiation potential; they were cultured on OP9-DL1 stromal cells in the presence of IL-7 and Flt3-L. We first analyzed the expression of CD44 and CD25 at different time points during the culture (Figure 3.8A) as these markers are commonly used to define the early steps of immature double negative (DN, CD4XD8") thymocyte differentiation25. The cells initially resembled the most immature thymocyte population DN1 (CD4XD8XD44XD25 - ) . After one week of culture, some (-8%) of the cells acquired CD25 and resembled DN2 (CD4XD8XD44XD25 + ) thymocytes. After two weeks, the level of CD44 on DN2-like cells decreased and they resembled DN3 (CD4XD8XD44XD25 + ) thymocytes. Prolonged culture did not induce a further differentiation into the DN4 (CD4XD8XD44XD25") population. Although CD44XD25" cells were detected early in the cultures (week one and two), they seemed to directly derive from the DNl-like cells without going through the DN2 62 and DN3 stages. Very few cells expressing CD4, CD8 or CD3 were generated in this culture (data not shown). It appeared that T cell development from ES-HPs was impaired at the transition from DN3 to DN4. This may be due to a high dose of IL-7, which has been reported to block differentiation of adult progenitors into T cells 2 1 5 ' 2 1 6. Therefore, after 8-14 days of culture, IL-7 concentration was reduced to 1 ng/ml, and the cells were cultured for an additional 4-6 days with OP9-DL1 cells. Cells expressing CD4, CD8 and the TCR were detected in the low-dose IL-7 culture (Figure 3.8B, C). However, the expression levels of CD4 and CD8 were significantly lower than those on thymocytes (data not shown), and very few double positive (CD4+CD8+) and single positive (CD4+CD8~ and CD4~CD8+) cells were generated. Limiting dilution analysis showed that the frequency of T cell progenitors was approximately 0.3% (1 in 297) in the bulk ES-HP population and 0.9% (1 in 115) in the CD45+Lin" subset of ES-HPs (Figure 3.9). Thus, T cell progenitors were enriched in the CD45+Lin~ subset, which contained most of the NK progenitors. However, the CD45+LhT subset was about 5% of the bulk ES-HPs while the enrichment of T cell progenitors was only about three fold, suggesting that T cell progenitors were also contained in other subsets of ES-HPs. 63 Figure 3.8. T cell potential of ES-HPs derived from CD34+CD45 EB cells. (A) CD34+CD45" EB cells were sorted and cultured with OP9 and cytokines to generate ES-HPs. They were then cultured on OP9-DL1 stroma with cytokines for T cell differentiation. At different time points, cells were harvested and stained for CD44 and CD25 and analyzed using a flow cytometer. The numbers show the percentages of cells in the quadrants. (B) ES-HP cells were cultured for T cell differentiation for 8 days with 5 ng/ml IL-7 as in (A). On day 8, IL-7 concentration was reduced to 1 ng/ml and cells were cultured for an additional 6 days. Cells were harvested and analyzed by flow cytometry for CD4 and CD8 expression. (C) ES-HP cells were cultured for T cell differentiation with 5 ng/ml IL-7 for 2 weeks and an additional 4 days with 1 ng/ml IL-7, stained for TCRy8 and TCR(3 and analyzed using a flow cytometer. 64 A Figure 3.9. T progenitor frequency of ES-HPs derived from CD34+CD45 EBs. (A) ES-HPs were generated from CD34+CD45~ EB cells as described in materials and methods. The bulk and sorted CD45+Lin~ ES-HP cells were analyzed for T progenitor frequency by limiting dilution cultures as in Figure 3.5D, except that 30, 100, 300 and 900 cells per well for bulk and 3, 10, 30 and 100 cells per well for CD45+Lin~ cells were plated. The results are average of two independent experiments. (B) Southern blot of TCRy RT-PCR of CD45+Lin~ ES-HPs created in one of two cloning assays in (A) is shown. The number of cells used in each well with their corresponding location in the blot are as follows: 3 cells/well: A1-A8, B1-B4; 10 cells/well:A'l-A'8, B ' l -B'4; 30 cells/well: B5-B8, C1-C8; 100 cells/well: D1-D8, E1-E4; positive controls (thymocytes): B'6, B'8, E6; negative controls (OP9-DL1 cells): B'7, E5. Pictures of two blots are separated by a line. To test the B cell potential of ES-HPs, CD45+Lin" ES-HPs were sorted and cultured on OP9 with IL-7 and Flt3-L for one week. B cells were detected in the culture by the expression of B220 and CD 19 (Figure 3.1 OA). Therefore, CD45+Lin~ ES-HPs contained B cell potential. To test whether these cells also have myeloid differentiation potential, sorted CD45+Lin~ ES-65 HPs were transferred into methylcellulose for myeloid colony formation. On average, 5.7% of CD45 +Lin _ ES-HPs formed erythro/myeloid colonies (Figure 3.1 OB). These results indicate that ES-HPs have NK, T, B and myeloid/erythroid potentials. Figure 3.10. B and myeloid potentials of CD45 +Lin ES-HPs derived from CD34+CD45 EBs. (A) CD45+Lin" ES-HPs were sorted and cultured on OP9 cells with IL-7 and Flt3-L for B cell generation. After one week, cells were harvested and analysed for the expression of B220 and CD 19 by flow cytometry. (B) One thousand sorted CD45+Lin~ ES-HPs were transferred into myeloid differentiation media as in Figure3.2E. The number of myeloid and erythroid colonies were scored. 3.3. Discussion We have characterized NK cell progenitors at various stages of development from ES cells in vitro. The most immature progenitors with NK cell potential are found among EB cells expressing CD34 but not the pan-leukocyte marker CD45. When cultured on OP9 stroma in the presence of IL-7, IL-6, Flt3-L and SCF, CD34+CD45~ EB cells differentiate into a heterogeneous cell population, termed ES-HP (ES cell-derived hematopoietic progenitors). Among ES-HPs, NK cell progenitors are highly enriched in a subpopulation expressing CD45 but not the mature erythroid and myeloid cell lineage markers Terl 19 and Mac-1. 66 Thus, CD34+CD45~ immature hematopoietic progenitors in EBs differentiate into more mature CD45+ NK progenitors in this culture. Since CD34+CD45" EB cells are heterogeneous, the relationship between NK progenitors in the EB cell population and those among ES-HPs is still unclear. However, the difference in CD45 expression indicates that N K progenitors among ES-HPs are not products of simple amplification of NK progenitors in EB but rather they are differentiation products derived from immature hematopoietic progenitors in EBs. The overall ES-HP cell population is rather heterogeneous and contains myeloid and erythroid cells at various stages of development as well as CD45~Lin~ cells, which mostly includes immature hematopoietic progenitors (see next chapter). Most, if not all, NK progenitors are in the CD45+Liri~ (Terl 19"Mac-l") subset. The frequency of NK progenitors in this subset, as determined by limiting dilution assay, is about 10%, which is comparable to that of adult mouse B M NKPs defined by CD 122 Lin . However, there are some differences between NKP in B M and those in ES-HPs. Most notably, B M NKPs express CD122 5 2 whereas it is undetectable on those among ES-HPs (Figure3.6B, right panel). It is likely that NK progenitors at the ES-HP stage are more immature than B M NKPs. CD122" NK progenitors, which mature into CD122+ progenitors, have been found in human lymph nodes as well 6 5. As expected, NK progenitors in the ES-HP population rapidly acquire CD 122 during their maturation to NK cells (Figure 3.6C). 67 Although CD45+Lirf ES-HPs also include T cell progenitors, it is still unclear whether ES-HPs include bipotent T/NK progenitors. Both T and NK cells are generated in bulk cultures to induce differentiation of CD45+LhT ES-HPs into T cells. However, the results with limiting dilution analysis show that the frequency of T cell progenitors among CD45+Lin~ ES-HPs is low-(less than 1%). Our attempt to determine the frequency of progenitors that give rise to both NK and T cells by limiting dilution assays have resulted in very variable frequencies (data not shown). One of the difficulties in determining T cell progenitor frequency in this study is that most T cell progenitors do not differentiate into mature T cells expressing the TCR, CD3, CD4 or CD8 in our cultures as their differentiation is blocked at the DN2 stage before TCRy gene rearrangement, which was used to detect T cells in the limiting dilution analysis. Thus, the frequency of T cell progenitors is likely very much underestimated in this study, making it difficult to detect bipotent T/NK progenitors. Nevertheless, this study has shown that CD45+Lin~ ES-HPs include both NK and T cell progenitors. We also showed that CD45+Lin~ ES-HPs have B cell and myeloid potentials. Thus, CD45+Lin~ ES-HPs likely comprise of multiple committed progenitors. However, it is also possible that CD45+Lin~ ES-HPs include multi-potent hematopoietic progenitors which are downstream progeny of CD45 - progenitors. Our study has also shown that CD34+ EB cells are rather heterogeneous and include both CD45+ and CD45" cells. Although the relationship between these two subsets of CD34+ EB cells is still unclear, the former includes erythroid/myeloid colony forming cells but no lymphoid progenitors whereas the latter has both myeloid/erythroid and lymphoid potentials. 68 Since CD34+CD45+ EB cells express Mac-1 (Figure 3.4B), it is possible that these cells are myeloid precursors that have derived from CD45" EB cells generated earlier in the EBs. CD45+ macrophage precursors have been described during early embryonic development in A G M region120. On the other hand, CD45" EB cells resemble precursors found in P-Sp and A G M region which generate lymphocytes and also lack CD45 1 0 7 ' 1 2 0 . This work demonstrates, for the first time, a differentiation pathway in which these cells acquire CD45 during ES-HP stage before subsequent differentiation to individual hematopoietic lineages. It will be interesting to compare the reconstitution capacity of CD45" EBs and that of CD45+Lin ES-HPs. While EB cells have been shown to reconstitute adult B M only by overexpression of HoxB4]9° and/or Cdx4m, CD45+ ES-HPs may be developmentally closer to adult HSCs and give rise to mUltilineage engraftment without a need for genetic manipulation. 69 Chapter 4: Characterization of hematopoietic progenitors with lymphoid and myeloid potentials generated i n v i t r o from embryonic stem cells2 4.1. Introduction A number of groups including our group have reported the hematopoietic potential of CD34+ EB cells 1 9 7 ' 1 9 8 ' 2 0 0 . The results in my previous chapter showed that CD34+ EBs are quite heterogeneous and can be divided into two subsets based on the pan-leukocyte marker CD45. CD34+CD45+ cells in day-8 EBs have erythroid/myeloid but not lymphoid potential, whereas the CD34+CD45~ EB cells have both. CD34 is found on non-hematopoietic lineages including endothelial cells1 5 1. CD34+ cells arise from ES-derived Flk-1 + endothelial progenitors220. For the purposes of HSC transplantation treatments, it is important to distinguish hematopoietic progenitors with lymphoid potential (definitive hematopoietic progenitors) within CD34+CD45~ EBs. CD41 and c-kit have been used to identify progenitors with definitive hematopoietic potential in EBs . The work in this chapter was initiated based on the hypothesis that CD34+CD45~ EBs should contain CD41+c-kit+ subsets that bear the myeloid/lymphoid progenitors. Differential expression of CD41 and c-kit on CD34+CD45~ EB cells elucidated four fractions in this subset. Using cell separation strategies, four different fractions (namely double positive, single positive and double-negative) were isolated and tested for erythroid/myeloid and 2 A version of this chapter has been submitted for publication. Tabatabaei-Zavareh N and Takei F. Characterization of hematopoietic progenitors with lymphoid potential generated in vitro from embryonic stem cells. 70 lymphoid potentials. As expected, erythroid/myeloid and lymphoid progenitors were only found in double positive fraction. CD34+CD45"c-kit+CD41+ EBs were further characterized and also differentiated into ES-HPs (as described in chapter 3). The hematopoietic potential of various ES-HP subpopulations was also examined in vitro. 4.2. Results 4.2.1. Day-8 CD34+CD45~ E B cells are heterogeneous The culture system used in this study to induce differentiation of ES cells to hematopoietic cells is delineated in Figure 4.1. In the first step, ES cells differentiated to form EBs. EB cell subsets were isolated by cell sorting and cultured with OP9 stroma and a cytokine cocktail for hematopoietic differentiation, which resulted in a heterogeneous cell population we termed ES-HPs. ES-HP subsets were isolated by cell sorting and cultured for further differentiation. Cells at each step were analyzed by flow cytometry, and individual subpopulations were sorted and tested for differentiation into myeloid/erythroid, NK, T and B cells. Previously, we determined that CD34+CD45~ EB subsets contain lymphoid as well as myeloid precursors. In this study, we further dissected the CD34+CD45~ cell population in day-8 EBs. At this stage, all CD34+ EB cells expressed CD31 and 6% of total EB cells were CD34+CD45~ (Figure 4.2A). We first analyzed expression of several hematopoietic progenitor markers including Flk-1, c-kit (CD117) and CD41 on CD34+CD45~ EB cells. Flk-1 has been shown to be expressed by hemangioblasts, the common progenitors of 71 hematopoietic and endothelial lineages. Hemangioblasts are identified in mouse ED7.5 embryos as well as in day 2.5 to 3.5 EBs as blast colony-forming cells (BL-CFCs)' 6 6. The majority (approximately 70%) of CD34+CD45~ EB cells expressed high level of Flk-1 while some expressed low level (Figure 4.2A). Similarly, most (-80%) CD34+CD45" EB cells expressed high level of c-kit. As the expression patterns of c-kit and Flk-1 among CD34+CD45~ EB cells were similar, staining for the combination of c-kit and Flk-1 did not reveal distinct subsets. The majority of them were c-kit +Flk-l + and only minor single positive and double negative populations were detected. On the other hand, combination of c-kit and CD41 divided CD34+CD45~ EB cells into four subsets, namely double positive, single positive and double negative. Our attempt to further dissect the double positive subset by Flk-1 expression was not successful as most of the cells expressed Flk-1 (Figure 4.2B). 72 Differentiat ion Cu l tu re ( S C F , IL-3, IL-6) E S ce l l Differentiation Cu l tu re (IL-6, IL-7 S C F , Fl t3-L) C D 3 4 + C D 4 5 -F R • —• ==l C e l l sort ing c-k i t + C D 4 1 + subse t Differentiat ion Cu l tu re (IL-6, IL-7 S C F , Fl t3-L) Hematopo ie t i c ce l l s •Ery thro id /myelo id co lony a s s a y • N K cel l differentiation •T cell differentiation • B cel l differentiation Figure 4.1. Scheme of ES cell culture used in this study for hematopoietic differentiation ES cells were cultured in methylcellulose to induce EB formation. CD34+CD45~c-kit+CD41+ EBs were sorted and cultured for one week with OP9 stroma in the presence of indicated cytokines to generate ES-HP cells. ES-HPs were sorted into CD45+Mac-1/Terl 19~ (Lin -) and CD45~Lin~ subsets and cultured in lineage differentiation cultures for erythroid/myeloid, NK, T and B lineages as described in materials and methods. Sorted CD45~Lin~ ES-HPs were also incubated on OP9 stroma with the same cytokines used for the primary ES-HP differentiation for one week before FACS analysis. 73 CD34 ^ Ftk-1 Figure 4.2. Surface expression of hematopoietic markers on day-8 EB cells. (A) EB cells were harvested at day 8 of differentiation and stained with biotinylated anti-CD34 followed by streptavidin-PE-Texas Red, APC-anti-CD45, FITC-anti-CD41, PE-Cy7-anti-c-kit and PE-anti-Flk-1 mAbs. Cells were analysed on FACSVantage (Diva). Dead cells were stained with 4'-6-Diamidino-2-phenylindole (DAPI) and gated out. CD34+CD45~ cells were gated (left, upper panel) and analysed for the expression of c-kit and Flk-1 (right upper panel), and c-kit and CD41 (right lower panel). Numbers show percentages of cells in the quadrants or in the gates. For analysis of CD34 and CD31 expression, cells were stained with anti-CD34 and anti-CD31 mAbs and analysed by a FACSCalibur flow cytometer (left lower panel). (B) CD34+CD45"c-kit+CD41+ cells were gated in (A) (R3 gate) and analysed for Flk-1 expression. The x-axis shows forward scatter whereas the y-axis shows fluorescence intensity. 4.2.2. CD34+CD45"c-kit+CD41+ EB cells have hematopoietic potential CD34+CD45" EB cells as well as the individual subsets identified by c-kit and CD41 expression were sorted and cultured in methylcellulose for erythroid and myeloid colony 74 formation (Figure 4.3 A). Clonogenic erythroid/myeloid progenitor activity was enriched more than three fold in CD34+CD45"c-kit+CD41+ EB cell subset as compared with the whole CD34+CD45" EB cell population. Since the CD41+c-kit+ population is about 31% of CD34+CD45~ EB cells, most erythroid/myeloid colony forming cells seemed to be contained in the CD41+c-kit+ subset. We also examined the lymphoid potential of various EB subsets (Figure 4.3B). For B and NK cell differentiation, cells were cultured on OP9 stroma, while OP9-DL1 cells were used to induce T cell differentiation (see chapter 2). CD34+CD45 c-kit+CD41+ EB cells generated B, NK and T cells, while the other subsets did not generate any lymphoid cells with the exception of c-kit+CD4T population, which generated small number of lymphocytes in vitro (Figure 4.3B and data not shown). These results indicate that both myeidid and lymphoid potentials are enriched in the c-kit+CD41+ subset of CD34+CD45~ EB cells. 75 CD34 +CD45~ CD34+CD45" c-kit +CD41 + c-kit+CD41" TCR(3 T C R p Figure 4:3. Myeloid and lymphoid potential of CD34+CD45 EB subsets. (A) CD34+CD45~ EB cells were sorted according to expression of c-kit and CD41. Myeloid differentiation cultures were initiated with 5000 sorted EB cells. Erythroid and myeloid colonies were enumerated as described in chapter 2. (B) Sorted EB cells were cultured in B, NK and T differentiation conditions (see chapter 2), stained for CD 19 for B cells, NKG2D for NK cells and TCRy8 and TCRp for T cells and analysed by a flow cytometer. Percentages indicate the frequencies of positively stained cells over the control staining. 4.2.3. Characterization of developmental intermediate progenitors derived from CD34+CD45"c-kit+CD41+ EB cells In order to further study the developmental stages leading to the generation of hematopoietic cells from EB cells, CD34+CD45~c-kit+CD41+ EB cells were purified and cultured on OP9 stroma with ILT7, Flt3-L, SCF and IL-6 for differentiation along the hematopoietic lineage 76 for 1 week. The cells thus generated, termed ES-derived hematopoietic progenitors (ES-HPs), were harvested and analyzed for expression of the pan-hematopoietic marker CD45, the myeloid cell marker Mac-1 and the erythroid marker Terl 19. Approximately 25% of ES-HPs expressed CD45 (Figure 4.4). CD45+ cells included Mac-1+ and some Terl 19+ cells but were negative for other lineage markers (data not shown). The majority of CD45+ ES-HPs retained expression of CD34, c-kit, CD41 and CD31 suggesting that they were mostly hematopoietic progenitors. The majority of CD45~ ES-HPs also retained CD34, c-kit and CD41 expression and very few expressed Mac-1 or Terl 19. However, some of them lost hematopoietic progenitor-associated markers. In particular, Flk-1 was expressed on only 23% of CD457 ES-HPs as compared to 70% of CD34+CD45_c-kit+CD41+ EB cells being Flk-1+. Thus, ES-HPs derived from CD34+CD45~c-kit+CD41+ EB cells were rather heterogeneous and included CD45+ hematopoietic cells at different levels of development along the hematopoietic lineages as well as CD45~ cells, which were also heterogeneous with respect to expression of CD34, c-kit, CD41 and Flk-1. Most Erythroid/myeloid potential as determined by in vitro colony forming cell assay was found among CD45+Lin~ ES-HPs (Figure 4.5A). The frequency of the colony forming cells among this subset of ES-HPs was almost 7% and significantly higher than that among CD34+CD45~c-kit+CD41+ EB cells whereas erythroid/myeloid potential of CD4'5"Lin" ES-HPs was "similar to that of the original EB cells they derived from. CD45+Lin" (Figure 4.5B, C) and CD45~Lin" (Figure 4.5D, E) ES-HPs also showed NK and T cell potentials. There was no obvious difference between the two subsets of ES-HPs in their potentials for NK and T cells, although it was not a quantitative assay. On the other hand, B cell potential of ES-77 HPs seemed rather low as very few (2.5 ± 2%, n=4) CD19+ cells were generated in B cell differentiation "cultures (data not shown). However, CD45~Lin~ ES-HPs generated more (5%, n=3) CD19+ cells, when incubated on OP9 with SCF, Flt3-L, IL-7 and IL-6 (Figure 4.6), while less than 1% CD19+ cells were generated from CD45+Lin~ ES-HPs under same conditions (data not shown). Therefore, CD45~Lin~ ES-HPs seem to have higher B cell potential than CD45+Lin~ ES-HPs. Figure 4.4. Cell surface marker expression of ES-derived hematopoietic progenitors (ES-HPs) derived from CD34+CD45~c-kit+CD41+ EB cells. CD34+CD45 rc-kit+CD41+EB cells were sorted and incubated on OP9 stroma with cytokines for 7 days to generate ES-HPs. Cells were then harvested and co-stained with anti-CD45 and indicated markers and analysed by flow cytometry. Numbers show the percentage of cells in the quadrants. 78 ESHP ESHP N K G 2 A / C / E TCRy5+p Figure 4,5. Lineage potential of ES-HP subsets. ES-HPs generated as in Figure 4.1 were stained for CD45, Mac-1 and Terl 19 and sorted into CD45+Mac-1/Terl 19" (Lin") and CD45"Lnf cells. (A) CD45+Lin~ and CD45~Lin" ES-HPs were sorted and plated for erythroid and myeloid colony formation as in Figure 4.3A. CD45+LhT ES-HPs (B and C) and CD45~Lin~ ES-HPs (D and E) were cultured for NK (B and D) and T cell (C and E) differentiation and analysed for NKG2A/C/E expression for NK cells and TCRyoVTCRp expression for T cells by flow cytometry. 4.2.4. Hematopoietic differentiation of CD45" ES-HPs The above results showed that the majority of ES-HPs generated from CD34+CD45~c-kit+CD41+ EB cells were CD45" and many of them had similar phenotype to that of 79 progenitors in EBs. Since EB cells were thought to include hemangioblasts, it was possible that CD45 - ES-HPs might be products of EB cell differentiation into non-hematopoietic cell lineages. To test whether they are immature hematopoietic progenitors or non-hematopoietic cells, CD45~Mac-rTerl 19" (Lin~) ES-HPs were sorted and cultured in a secondary ES-HP differentiation culture comprised of OP9 stroma and cytokines identical to the primary ES-HP cultures. After one week, the cells were harvested and analyzed by flow cytometry (Figure 4.6). Approximately 80% of the cells recovered from the secondary cultures were CD45+ and the majority expressed the erythroid and myeloid lineage-specific markers Mac-1 and Terl 19, respectively. Some (25%) expressed the granulocyte marker Gr-1. Small numbers of B cells (CD19+), and NK cells (I1-2R(3+, NKG2A/C/E +) were also detected. Interestingly, the expression of CD34 and c-kit on both CD45+ and CD45" secondary ES-HPs was similar to that of the original CD45"Lin~ primary ES-HPs whereas CD41 was significantly down-regulated. These results showed that CD45" cells in the primary ES-HP cultures were immature hematopoietic cells. 80 Gr-1 CD3e CD 19 Figure 4.6. Characterization of cells derived from CD45 Lin ES-HPs after further differentiation in ES-HP culture. CD45~LirT ES-HP cells were generated and sorted as in Figure 4.1 and cultured in a secondary ES-HP culture on OP9 stroma with IL-6, IL-7, Flt3-L and SCF. After one week, cells were harvested and analysed for the indicated markers by flow cytometry as in Figure 4.3B and Figure 4.4. 81 4.3. Discussion In this study, we have generated in vitro multiple hematopoietic progenitors with myeloid and lymphoid potentials from ES cells. The most immature hematopoietic progenitors in our cultures are found among CD34+ cells in day-8 EBs, which have been known to contain hematopoietic progenitors. In the previous chapter, CD34+ cells in day-8 EBs were divided into CD45+ and CD45" populations, and it was found that the former has erythroid/myeloid but not lymphoid potential whereas the latter has both. Here, the CD34+CD45" EB cell population were further dissected into four subsets based on the expression of c-kit and CD41. The results indicated that erythroid/myeloid as well as T, B and NK cell potentials are mostly confined among c-kit+CD41+CD34+CD45" EB cells. Although CD34+CD45~c-kit+CD41~ EB cells seem to have some lymphoid potential, generation of T, B and N K cells from these EB cells in vitro is significantly less efficient than that from the c-kit+CD41+ subset. It should also be noted that the method to determine lymphoid potential in this study is not quantitative. Moreover, the CD41+ and CD41" EB cell populations are not well separated, and it is possible that the lymphoid potential of the CD41~ population may be due to contamination-of GD41+ cells. CD34+CD45"c-kit+CD41+ EB cells are CD31 + and mostly Flk-1+. Separation of CD34+CD45~c-kit+CD41+ EB cells into Flk-1 h i and Flk-11 0 subpopulations did not have much effect on erythroid/myeloid or lymphoid potential (data not shown). Thus, the most immature hematopoietic progenitors with erythroid/myeloid and lymphoid potential in day-8 EBs have the phenotype of CD34+CD45~c-kit+CD41+Flk-1+CD31+. The expression of Flk-1, the vascular endothelial growth factor receptor, suggests 82 that they may have potential for the endothelial cell lineage. However, their endothelial potential was'not tested, and whether these EB cells include hemangioblasts. is unknown. HSCs have been previously shown to express different surface markers depending on their location and their stage of development. CD41 is expressed by primitive HSCs, but downregulated by HSCs during the transition to fetal liver stage1 0 6 , 1 0 8'1 2 2, and adult HSCs lack CD41 expression148. In addition, CD41 expression precedes CD45 expression in early hematopoiesis108. The phenotype of EB cells in this study is in total agreement with that of embryonic hematopoietic progenitors described in these studies. Since the hematopoietic progenitors in day-8 EBs in our study have lymphoid potential, they differ from yolk sac '* " +122 hematopoietic progenitors. AGM-derived HSCs have been defined as CD34 as well as CD45- / l oc-kit+CD41+CD31+AA4.1+ 1 2 0, which is very similar to the progenitors expressing CD31, CD34, CD41 and c-kit in EBs in our study. However, they differ in Flk-1 expression. In contrast to EB-derived hematopoietic progenitors, AGM-HSCs lack Flk-1 expression. This suggests that hematopoietic progenitors in day 8 EBs are more immature than ED 10.5 A G M -HSCs, since the former still express the marker of early hemangioblasts. We assume that these EBs correspond to endothelial like lymphohematopoietic progenitors isolated from caudal half of ED9.5 embryo, which encompass P-Sp region221. Culturing CD34+CD45~c-kit+CD41+ EB cells with OP9 stroma and cytokines results in a heterogeneous cell population we termed ES-HPs, some of which express CD45, Mac-1 and/or Terl 19 while the majority remains CD34+CD45"c-kit+CD41+. CD34+CD45"c-kit+CD41+ES-HPs resemble the original EB population in phenotype and lineage potential. 83 However, the majority of these ES-HPs have lost Flk-1 expression. It has been reported that Flk-1 expression is downregulated after hemangioblast stage, and precursors committed only to the hematopoietic lineage are F l k - r 1 6 6 ' 1 7 6 . Thus, the expression of Flk-1 on day-8 CD34+CD45"c-kit+CD41+ EB cells suggests that they may still retain endothelial potential while loss of Flk-1 on ES-HPs suggests that the EB cells become fully committed for the hematopoietic lineage as they differentiate into ES-HPs. In addition, CD41 expression is differentially regulated during EB differentiation. Most cells derived from CD45~Lin~ ES-HPs down-regulate CD41 surface expression, while most of the cells at this stage still express c-kit. The finding of hematopoietic progenitors with lymphoid and myeloid potential is important for identification of HSCs with long-term repopulating capacities in adult recipients. Only genetic modification of EBs has resulted in reproducible engraftment in irradiated adult recipients, which reflects their state of immaturity112. Our current study shows that EB cells differentiate in vitro into hematopoietic progenitors that are similar to adult hematopoietic progenitors in phenotype (expression of CD45 and loss of CD41 and Flk-1) 1 1 1. It remains to be determined whether ES-HPs, which appear to be more mature than hematopoietic progenitors in EBs, have in vivo repopulating capacity. 84 Chapter 5. General discussion Presented in this thesis is a novel developmental pathway of lymphocyte differentiation from ES cells in vitro (depicted in Figure 5.1). This pathway entails lymphocyte progenitors at different stages of development. Each examined progenitor population represents the known in vivo developmental precursors during ontogeny. The earliest lymphocyte progenitors were found among day 8 EB cells with the surface marker expression of CD34+CD45~c-kit +CD41 +Flk-l +CD31 +. These progenitors, which also contain erythroid/myeloid potential are developmentally immature and close to ED9.5 hematopoietic progenitors derived from caudal half of embryo, with the phenotype of VE-cadherin+Flk-l+CD31+CD34+CD45 - 2 2 1. The EB hematopoietic precursors undergo differentiation subsequent to co-culture with OP9 cells and form heterogeneous cell population we termed ES-HPs. ES-HPs consist of mature lineage positive cells (Mac-1+Terl 19+) and immature lineage negative cells, of which a minor fraction is CD45+. It was demonstrated that CD45+Lin~ ES-HPs derived from CD34+CD45~ EBs are the most immediate NK progenitors along the pathway to NK lineage. The analyses of CD45~Lin" ES-HPs derived from CD34+CD45"c-kit+CD41+ EB cells indicated that these cells are immature hematopoietic progenitors comparable to the EB progenitor population. However, loss of Flk-1 expression by these cells places them at the same developmental stage as ED10.5 AGM-derived HSCs 1 2 0. The important observation in this model of EB differentiation was step-wise phenotypic changes as EB cells differentiate on OP9 in ES-HP cultures (Figure 5.1). The most significant change during differentiation of EBs is the acquisition of CD45 by ES-HPs. This 85 change is accompanied by increase in potential for all lineages except B lineage. CD45 Lin ES-HPs derived from CD34+CD45_ contained the highest frequency of NK progenitors (1 in 10), T progenitors (1 in 115), and erythroid/myeloid progenitors (1 in 17.5) as compared with bulk ESHP (1 in 230 for NK, 1 in 297 for T, and 1 in 92 for myeloid progenitors) or EB populations (1 in 633 for NK, 1 in 1266 for T, and 1 in 222 for myeloid progenitors). CD45+Lin~ ES-HPs may include multiple committed progenitors, and/or multipotent and bipotent progenitors. High frequency of NK and myeloid progenitors among CD45+Lin~ ES-HPs implies the existence of a bipotent NK/myeloid precursor, which is expected with respect to identification of other myeloid/lymphoid precursors in the fetus129. Since the expression of CD45 on HSCs is first seen on EDI 1.5 A G M cells1 2 2, CD45+Lin~ ES-HPs might be counterparts to these progenitors (Figure 5.1). Limiting dilution analysis of CD45+Lin~ ES-HPs for B cell progenitor frequency was not performed; however, when we compared the B cell generation from EBs and ES-HPs in chapter 3, we always detected higher number of B cells from CD34+CD45~c-kit+CD41+EBs. It is likely that B cells develop from a.separate population within CD34+CD45~c-kit+CD41+ EBs, which lose their potential in ES-HP culture. These results are in accordance with the defined scheme of B and T cell development before birth. Evidence has been provided that CLP-type progenitors do not exist during prenatal life, instead bipotent T/NKPs are abundant. This implies a dissociation of the B lineage from more immature hematopoietic precursors before birth. This is in direct contrast to postnatal life in which B cells develop from a more differentiated hematopoietic progenitor like CLPs. 86 The next phenotypic changes are consecutive downregulation of Flk-1 and CD41 (Figure 5.1). Flk-1 expression diminishes early after the primary ES-HP culture (Figure 4.4) whereas CD41 expression continues until after the secondary ES-HP culture though at half frequency of original EBs (Figure 4.6). While loss of Flk-1 has been linked with loss of endothelial potential and commitment to hematopoietic lineage176, CD41 expression serves as a marker for hematopoietic restricted progenitors106,108. CD41 is a target gene of Sci transcription factor108, which is essential for blood formation. In the absence of Sci, no blood cell * * * 181 2 2 2 J development occurs in vivo in chimera mice or in vitro in embryoid bodies ' . Our study also showed that CD41 is present on hematopoietic progenitors from day 8 EBs, but its expression decreases with differentiation toward more mature hematopoietic cells. Otani et al. analysed expression of CD41 on primitive erythroid progenitors from ES cells and found that CD41 + are precursors to CD41+Terl 19+ erythroid progenitors, which further differentiate to CD41~Terl 19+ erythroblasts223. It is possible that CD41 expression is maintained in transition to each lineage, but is eventually lost except in megakaryocyte lineage. Our results reveal the characteristics of various CD34+ EB subpopulations. Of great interest is CD45+ EB'subset. Here, this subset was defined as Mac-1+ myeloid precursors. Lymphoid progenitors in EBs were CD45". Multiple studies have documented lack of CD45 expression on definitive hematopoietic progenitors111. Burt et al. reported lymphoid potential of CD45+ cells from day 7-10 EBs in in vivo transplantation experiments187. This report is in contrast to our study. One explanation is that they have used later stage EBs, which may contain more mature CD45+ HSCs. The other possibility is that since they had isolated CD45+ cells by sorting, the sorted cells may have been contaminated with other CD45~ / l0 fractions, which 87 have lymphoid potential. Finally, the lymphoid potential of CD45+ EBs may be too low to be detected in our in vitro assays, but is assessable by in vivo assays. On the other hand, CD45+ committed macrophage precursors have been described in embryonic hemogenic sites such as A G M , which may have resulted from CD45" HSCs 1 2 0. Likewise, CD45+ EB cells in our study may represent in situ differentiation of precursors to lineage-restricted progenitors. With regard to CD34+CD45~c-kif~CD41+ EB cells, we speculated that they could be erythroid progenitors. The number of Terl 19+ erythroid cells among ES-HPs derived from CD34+CD45~ EB cells are consistently higher than those derived from CD34+CD45~c-kit+CD41+ cells (10-24% versus 3%). Therefore, it is likely that erythroid potential in the CD34+CD45~ EB cell population is contained in subsets lacking expression of c-kit or CD41, particularly c-kit _ / l oCD41+ subset. Erythroid precursors in ES/OP9 co-culture system are CD41 + 2 2 3 . CD41 + EB cell subset may have been formed at a transitional stage in erythropoiesis. Since their colony forming potential is not substantial, they may be in a more mature stage of erythroid differentiation. Since CD45+Lin~ ES-HPs derived from EBs display a more mature phenotype and bear all NK, T, B and myeloid lineage potentials, we determined the frequency of myeloid, NK and T progenitors among these cells. The results show that these cells are enriched for NK potential (one in 10 CD45+Lin" ES-HPs give rise to NK cells). This NK potential is similar to that of BM-derived NKPs. However, we did not detect CD122 expression on ES-HPs (Figure 3.6) and (Figure 5.1). CD 122 expression on human NKPs has been difficult to demonstrate, even though CD34 ; HPCs cultured with IL-2, IL-15 or SCF and Flt3-L produce NKPs 6 3 ' 7 6 . In vivo 88 stages of NK differentiation from progenitors in lymph node has shown that committed CD122+ NKPs derive from uncommitted CD122 - precursors at stage III of differentiation65. We also showed that CD 122 appears on NK progenitors in ES-HPs with IL-2 and IL-15 (Figure 5.1). Also, CD45+Lin~NKPs in ES-HPs have other lineage potentials and are not restricted to NK lineage. This data suggests that these progenitors are still immature and need signaling via IL-2 and/or IL-15 to upregulate this receptor. Analysis of NK cells generated from ES cells suggests that ES-derived NK (ES-NK) cells resemble fetal NK cells in phenotype and function. ES-NK cells express CD94/NKG2 but not Ly49 receptors. They are differentially cytotoxic against MHC class I-deficient target cells2 0 0. This data confirms the notion that ES cell culture system recapitulates fetal NK cell development. T cell differentiation from EBs appeared to follow the same developmental pathway as NK lineage. The frequency of T cell precursors increases almost 4 fold as CD34+CD45~ EB cells differentiate into ES-HPs (Figure 5.1). Therefore, a T cell developmental intermediate may be generated in ES-HP culture. However, the enrichment of T cell progenitors in CD45+LuT ES-HP fraction compared to bulk population was much less than that of NK progenitors (three fold versus 25 fold). Nevertheless, these results show that T progenitors co-exist with NK progenitors in the same cell population. Clonal assays using OP9-DL1 cells have shown that fetal DN1 and DN2 cells contain bipotent T/NKPs. These assays showed that NK and T cell potential can be simultaneously explored on this cell line 1 3 5. However, we could not detect bipotent T/NKPs in CD45+Lin~ ES-HPs on OP9-DL1 stromal cells in limiting dilution 89 experiments, despite the fact that both NK and T cells could be generated in bulk cultures. This could be due to the very low frequency of these progenitors in ES-HP population. Alternatively, defective T cell differentiation on OP9-DL1 cells may have resulted in the observed low frequency of T progenitors and consequently T/NKPs. Analysis of T cell differentiation from CLPs on OP9-DL1 cells by Porritt et al have revealed a block in DN3/DN4 transition224. The block in T cell development on OP9-DL1 cells was also reported from other adult hematopoietic progenitors, but not from fetal thymic progenitors. It was thought that IL-7 used in these cultures may inhibit differentiation of adult progenitors to CD4 and/or CD8 T cells 2 1 5 ' 2 1 6. We also reduced IL-7 concentration in the T culture; and were able to detect TCR +, CD4 + and CD8 + T cells. However, percentage of TCR + cells was very variable in different experiments, making it impossible to detect bipotent T/NKPs in OP9-DL1 co-culture. It is also likely that T cell progenitors from ES-HPs are more immature than DN thymic progenitors and need further differentiation beyond the time point when we performed our analysis. Unfortunately, in clonal assays cells die after 2 week of culture and we were not able to extend the culture period beyond that. The most significant outcome of this thesis research is the identification of hematopoietic progenitors with lymphoid potential generated in vitro from ES cells. Although previous studies have shown that mature B, NK and T cells can be generated from ES cells in vitro, the progenitors for those have not been characterized. Lymphopoiesis signifies definitive hematopoietic progenitors, which could be used in transplantation treatments. Thus far, ES cell progeny can repopulate adult recipient mice, only after they are differentiated on stromal cell lines2 2 5 or transduced with genes to induce definitive hematopoietic potential112. We 90 have demonstrated that the progeny of EB cells (ES-HPs) possess more definitive hematopoietic properties and will be valuable to compare their in vivo repopulating capacity with that of EBs. Several factors play a role in triggering definitive hematopoietic developmental program. These factors include Cdx and Hox family members, as well as Amll , Mil , and Notch family members. Both Amll and Mil specify definitive hematopoiesis at or before the A G M stage, whereas Notchl is critical for HSC genesis in P-Sp region, and is dispensable afterward112. The in vitro ES differentiation culture will allow us to further explore the role of these factors in the induction of definitive hematopoiesis in the EB system. 5.1. Future work Future studies will focus on analysis of in vivo hematopoietic repopulation using described hematopoietic progenitors derived from ES cells. In these experiments, the type of recipient mice and route of transplantation are important for successful engraftement. For example, Rag2~/~yc~/~ immunodeficient mice that lack NK cells are preferred as recipients, because ES derived progenitors have low-intermediate level of MHC class I molecules and could be destroyed by NK cells1 1 2. Also, intrafemural injection has resulted in better engraftment compared to intravenous injection, which may improve homing efficiency of ES derived progenitors112. Besides transplantation of self-renewing HSCs, the use of more differentiated progenitors such as NKPs or mature immune cells has certain advantages. These cells could potentially be exploited in areas of infectious diseases, cancer and B M transplantation41. One interesting example of clinical application of NK cells is in B M transplantation for leukemia 91 patients. While T cells may cause graft-versus-host disease, NK cells generated from transplanted bone marrow may generate anti-leukemia effects without causing graft-vs-host disease141'226. Hematopoietic differentiation of mouse ES cells has set the stage for studies of human ES cell development to hematopoietic cells. Many genetic and malignant diseases of bone marrow is cured by HSC transplantation; and therefore,, a protocol to generate hematopoietic progenitors from human ES cells which reconstitute adult recipients will be very beneficial. The current sources of reconstituting HSCs for clinical therapy including human BM, mobilized peripheral blood and umbilical cord blood are limited due to lack of well-matched donors. Deriving HSCs or hematopoietic progenitors from human ES cells could provide unlimited source of these cells in transplantation treatments. Similar to mouse ES cells, human ES cells can differentiate into hematopoietic cells by both co-culture with stromal cells and formation of EBs. Early hematopoietic precursors during human EB formation have been identified as CD45~CD31+Flk-1+CD34+. These cells contain bipotent precursors for hematopoietic and endothelial lineages similar to hemangioblasts. They are also able to minimally contribute to hematopoiesis after transplantation into immunodeficient recipient animals227. Our analyses of hematopoietic development from mouse ES cells could be extrapolated into human ES cell system to isolate progenitors with robust myelolymphoid potential capable of multilineage hematopoietic engraftment in recipients. 92 OC: E D 1 1 . 5 A G M OC: E D 9 . 5 P - S p C D 3 4 + C D 4 5 " c - k i t + C D 4 1 + C D 3 1 + F l k - 1 + EB Potential: N K : 1 in 6 3 3 * T: 1 in 1266* B: +++ Mye lo id : 1 in"65 S C F , Flt3LJ IL-7 , IL-6 Lin-CD45 + CD34+CD31 + CD41 + Flk-r CD122" ES-HP Potential: N K : 1 in 10* T: 1 in 115* B: + Mye lo id : 1 in 14 OC: E D 1 0 . 5 A G M L i n - C D 4 5 " C D 3 4 + C D 3 1 + C D 4 1 + F l k - 1 + / " ES-HP Potential: N K : 1 in 286* T: + B: ++ Mye lo id : in 100 IL-2, IL-15 C D 1 2 2 4 S C F , Fl t3L, IL -7 , IL -6 C D 4 1 lo/-Figure 5.1. Hematopoietic differentiation of EB cells. EBs differentiate into hematopoietic progenitors (ES-HPs) in presence of the indicated cytokines. Markers that change during differentiation are demonstrated. Transferring ES-HPs into other conditions generates hematopoietic cells. The quantitative hematopoietic lineage potential of each population is shown below it, except for the B lineage. The number of (+) for B potential refers to the estimated yield of B cells from each population. (*) indicates that limiting dilution assay has been performed on cells derived from CD34+CD45 EBs. Ontogenic counterparts (OC) for each subset have been proposed. 93 Bibliography 1. Keller GM. In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol. 1995;7:862-869. 2. Daley GQ, Goodell MA, Snyder EY. Realistic prospects for stem cell therapeutics. Hematology Am Soc Hematol Educ Program. 2003:398-418. 3. de Pooter RF, Cho SK, Zuniga-Pflucker JC. In vitro generation of lymphocytes from embryonic stem cells. Methods Mol Biol. 2005;290:135-147. 4. Daley GQ. From embryos to embryoid bodies: generating blood from embryonic stem cells. Ann N Y Acad Sci. 2003;996:122-131. 5. Carotta S, Pilat S, Mairhofer A, et al. Directed differentiation and mass cultivation of pure erythroid progenitors from mouse embryonic stem cells. Blood. 2004;104:1873-1880. 6. Lieber JG, Webb S, Suratt BT, et al. The in vitro production and characterization of neutrophils from embryonic stem cells. Blood. 2004;103:852-859. 7. Weissman IL. Stem cells: units of development, units of regeneration, and units in evolution. Cell. 2000;100:157-168. 8. Weissman IL, Anderson DJ, Gage F. Stem and progenitor cells: origins, phenotypes, lineage commitments, and transdifferentiations. Annu Rev Cell Dev Biol. 2001;17:387-403. 9. Kondo M , Wagers AJ, Manz MG, et al. Biology of hematopoietic stem cells and progenitors: implications for clinical application. Annu Rev Immunol. 2003;21:759-806. 10. Adolfsson J, Borge OJ, Bryder D, et al. Upregulation of Flt3 expression within the bone marrow Lin(-)Scal(+)c-kit(+) stem cell compartment is accompanied by loss of self-renewal capacity. Immunity. 2001;15:659-669. 11. Adolfsson J, Mansson R, Buza-Vidas N , et al. Identification of Flt3+ lympho-myeloid stem cells lacking erythro-megakaryocytic potential a revised road map for adult blood lineage commitment. Cell. 2005;121:295-306. 12. Bhandoola A, Sambandam A. From stem cell to T cell: one route or many? Nat Rev Immunol. 2006;6:117-126. 13. Kondo.M, Weissman IL, Akashi K. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell. 1997;91:661-672. 94 14. Akashi K, Traver D, Miyamoto T, Weissman IL. A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature. 2000;404:193-197. 15. Rothenberg EV. Stepwise specification of lymphocyte developmental lineages. Curr Opin Genet Dev. 2000;10:370-379. 16. Janeway CA, Travers P, Walport M , Schomchik M . Immunobiology. New York: Garland Science; 2005. 17. Igarashi H, Gregory SC, Yokota T, Sakaguchi N , Kincade PW. Transcription from the RAG1 locus marks the earliest lymphocyte progenitors in bone marrow. Immunity. 2002;17:117-130. 18. Schwarz BA, Bhandoola A. Circulating hematopoietic progenitors with T lineage, potential. Nat Immunol. 2004;5:953-960. 19. Borghesi L, Hsu LY, Miller JP, et al. B lineage-specific regulation of V(D)J recombinase activity is established in common lymphoid progenitors. J Exp Med. 2004;199:491-502. 20. Allman D, Sambandam A, Kim S, et al. Thymopoiesis independent of common lymphoid progenitors. Nat Immunol. 2003;4:168-174. 21. Hirose J, Kouro T, Igarashi H, Yokota T, Sakaguchi N , Kincade PW. A developing picture of lymphopoiesis in bone marrow. Immunol Rev. 2002;189:28-40. 22. Kouro T, Kumar V, Kincade PW. Relationships between early B- and NK-lineage lymphocyte precursors in bone marrow. Blood. 2002;100:3672-3680. 23. Martin CH, Aifantis I, Scimone ML, et al. Efficient thymic immigration of B220+ lymphoid-restricted bone marrow cells with T precursor potential. Nat Immunol. 2003;4:866-873. 24. Carding SR, Egan PJ. Gammadelta T cells: functional plasticity and heterogeneity. Nat Rev Immunol. 2002;2:336-345. 25. Ceredig R, Rolink T. A positive look at double-negative thymocytes. Nat Rev Immunol. 2002;2:888-897. 26. Rothenberg EV, Taghon T. Molecular genetics of T cell development. Annu Rev Immunol. 2005;23:601-649. 95 27. Michie A M , Zuniga-Pflucker JC. Regulation of thymocyte differentiation: pre-TCR signals and beta-selection. Semin Immunol. 2002;14:311-323. 28. Livak F, Tourigny M , Schatz DG, Petrie HT. Characterization of TCR gene rearrangements during adult murine T cell development. J Immunol. 1999;162:2575-2580. 29. Sambandam A, Maillard I, Zediak VP, et al. Notch signaling controls the generation and differentiation of early T lineage progenitors. Nat Immunol. 2005;6:663-670. 30. Balciunaite G, Ceredig R, Rolink AG. The earliest subpopulation of mouse thymocytes contains potent T, significant macrophage, and natural killer cell but no B-lymphocyte potential. Blood. 2005;105:1930-1936. 31. Lu M , Tayu R, Ikawa T, et al. The earliest thymic progenitors in adults are restricted to T, NK, and dendritic cell lineage and have a potential to form more diverse TCRbeta chains than fetal progenitors. J Immunol. 2005;175:5848-5856. 32. Perry SS, Wang H, Pierce LJ, Yang A M , Tsai S, Spangrude GJ. L-selectin defines a bone marrow analog to the thymic early T-lineage progenitor. Blood. 2004;103:2990-2996. 33. Maillard I, Fang T, Pear WS. Regulation of lymphoid development, differentiation, and function by the Notch pathway. Annu Rev Immunol. 2005;23:945-974. 34. ; Mohtashairii M , Zuniga-Pflucker JC. Three-dimensional architecture of the thymus is required to maintain delta-like expression necessary for inducing T cell development. J Immunol. 2006;176:730-734. 35. Wu L. T lineage progenitors: the earliest steps en route to T lymphocytes. Curr Opin Immunol. 2006;18:121-126. 36. Hardy RR, Hayakawa K. B cell development pathways. Annu Rev Immunol. 2001;19:595-621. 37. Nagasawa T. Microenvironmental niches in the bone marrow required for B-cell development. Nat Rev Immunol. 2006;6:107-116. 38. Parham P. Innate immunity: The unsung heroes. Nature. 2003;423:20. 39. "' Yokoyariia WM, Kim S, French AR. The dynamic life of natural killer cells. Annu Rev Immunol. 2004;22:405-429. 40. Smyth MJ, Cretney E, Kelly JM, et al. Activation of NK cell cytotoxicity. Mol Immunol1. 2005;42:501-510. 96 41. Moretta A, Bottino C, Mingari MC, Biassoni R, Moretta L. What is a natural killer cell? Nat Immunol. 2002;3:6-8. 42. Degli-Esposti MA, Smyth MJ. Close encounters of different kinds: dendritic cells and NK cells take centre stage. Nat Rev Immunol. 2005;5:112-124. 43. Raulet DH, Vance RE, McMahon CW. Regulation of the natural killer cell receptor repertoire. Annu Rev Immunol. 2001;19:291-330. 44. Natarajan K, Dimasi N , Wang J, Mariuzza RA, Margulies DH. Structure and function of natural killer cell receptors: multiple molecular solutions to self, nonself discrimination. Annu Rev Immunol. 2002;20:853-885. 45. Vivier E, Biron CA. Immunology. A pathogen receptor on natural killer cells. Science. 2002;296:1248-1249. 46. Medzhitov R, Janeway CA, Jr. Decoding the patterns of self and nonself by the innate immune system. Science. 2002;296:298-300. 47. Diefenbach A, Raulet DH. Strategies for target cell recognition by natural killer cells. Immunol Rev. 2001;181:170-184. 48. Kim S, Iizuka K, Aguila HL, Weissman IL, Yokoyama WM. In vivo natural killer cell activities revealed by natural killer cell-deficient mice. Proc Natl Acad Sci U S A . 2000;97:2731-2736. . 49. Kim S, Iizuka K, Kang HS, et al. In vivo developmental stages in murine natural killer cell maturation. Nat Immunol. 2002;3:523-528. 50. . .Kumar V, Ben-Ezra J, Bennett M , Sonnenfeld G. Natural killer cells in mice treated with 89strontium: normal target-binding cell numbers but inability to kill even after interferon administration. J Immunol. 1979;123:1832-1838. 51. Seaman WE, Gindhart TD, Greenspan JS, Blackman MA, Talal N . Natural killer cells, bone, and the bone marrow: studies in estrogen-treated mice and in congenitally osteopetrotic (mi/mi) mice. J Immunol. 1979;122:2541-2547. 52. Rosmaraki EE, Douagi I, Roth C, Colucci F, Cumano A, Di Santo JP. Identification of committed NK cell progenitors in adult murine bone marrow. Eur J Immunol. 2001;31:1900-1909. 97 53. Giri JG, Ahdieh M , Eisenman J, et al. Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15. Embo J. 1994;13:2822-2830. 54. Vosshenrich CA, Di Santo JP. Interleukin signaling. Curr Biol. 2002;12:R760-763. 55. Williams NS, Moore TA, Schatzle JD, et al. Generation of lytic natural killer 1.1+, Ly-49- cells from multipotential murine bone marrow progenitors in a stroma-free culture: definition of cytokine requirements and developmental intermediates. J Exp Med. 1997;186:1609-1614. 56. Colucci F, Caligiuri MA, Di Santo JP. What does it take to make a natural killer? Nat Rev Immunol. 2003;3:413-425. 57. "' Vosshenrich C A, Ranson T, Samson SI, et al. Roles for common cytokine receptor gamma-chain-dependent cytokines in the generation, differentiation, and maturation of NK cell precursors and peripheral NK cells in vivo. J Immunol. 2005;174:1213-1221. 58. ' Vosshenrich CA, Garcia-Ojeda ME, Samson-Villeger SI, et al. A thymic pathway of mouse natural killer cell development characterized by expression of GATA-3 and CD 127. Nat Immunol. 2006;7:1217-1224. 59. Hendriks RW, Nawijn MC, Engel JD, van Doorninck H, Grosveld F, Karis A. Expression of the transcription factor GATA-3 is required for the development of the earliest T cell progenitors and correlates with stages of cellular proliferation in the thymus. Eur J Immunol. 1999;29:1912-1918. 60. Veinotte LL, Greenwood CP, Mohammadi N , Parachoniak CA, Takei F. Expression of rearranged TCRgamma genes in natural killer cells suggests a minor thymus-dependent pathway of lineage commitment. Blood. 2006;107:2673-2679. 61. ••• Miller JS, Alley KA, McGlave P. Differentiation of natural killer (NK) cells from human primitive marrow progenitors in a stroma-based long-term culture system: identification of a CD34+7+ NK progenitor. Blood. 1994;83:2594-2601. 62. ; Mrozek E, Anderson P, Caligiuri MA. Role of interleukin-15 in the development of human CD56+ natural killer cells from CD34+ hematopoietic progenitor cells. Blood. 1996;87:2632-2640. 98 63. . Yu H, Fehniger TA, Fuchshuber P, et al. Flt3 ligand promotes the generation of a distinct CD34(+) human natural killer cell progenitor that responds to interleukin-15. Blood. 1998;92:3647-3657. 64. Freud. AG, Becknell B, Roychowdhury S, et al. A human CD34(+) subset resides in lymph nodes and differentiates into CD56bright natural killer cells. Immunity. 2005;22:295-304. 65. Freud AG, Yokohama A, Becknell B, et al. Evidence for discrete stages of human natural killer cell differentiation in vivo. J Exp Med. 2006;203:1033-1043. 66. Farag SS, Caligiuri MA. Human natural killer cell development and biology. Blood Rev. 2006;20:123-137. 67. Pelayo R, Weiner R, Perry SS, et al. Lymphoid progenitors and primary routes to becoming cells of the immune system. Curr Opin Immunol. 2005;17:100-107. 68. Lyman SD, Jacobsen SE. c-kit ligand and Flt3 ligand: stem/progenitor cell factors with overlapping yet distinct activities. Blood. 1998;91:1101-1134. 69. Waskow C, Paul S, Haller C, Gassmann M , Rodewald H. Viable c-Kit(W/W) mutants reveal pivotal role for c-kit in the maintenance of lymphopoiesis. Immunity. 2002; 17:277-288. 70. Sitnicka E, Bryder D, Theilgaard-Monch K, Buza-Vidas N , Adolfsson J, Jacobsen SE. Key role of flt3 ligand in regulation of the common lymphoid progenitor but not in maintenance of the hematopoietic stem cell pool. Immunity. 2002;17:463-472. 71. Mackarehtschian K, Hardin JD, Moore KA, Boast S, Goff SP, Lemischka IR. Targeted disruption of the flk2/flt3 gene leads to deficiencies in primitive hematopoietic progenitors. Immunity. 1995;3:147-161. 72. Agosti V, Corbacioglu S, Ehlers I, et al. Critical role for Kit-mediated Src kinase but not PI 3-kinase signaling in pro T and pro B cell development. J Exp Med. 2004; 199:867-878. 73. McKenna HJ, Stocking KL, Miller RE, et al. Mice lacking flt3 ligand have deficient hematopoiesis affecting hematopoietic progenitor cells, dendritic cells, and natural killer cells. Blood. 2000;95:3489-3497. 99 74. Colucci F, Di Santo JP. The receptor tyrosine kinase c-kit provides a critical signal for survival, expansion, and maturation of mouse natural killer cells. Blood. 2000;95:984-991. 75. Waskow C, Rodewald HR. Lymphocyte development in neonatal and adult c-Kit-deficient (c-KitW/W) mice. Adv Exp Med Biol. 2002;512:1-10. 76i < Di Santo JP. Natural killer cell developmental pathways: a question of balance. Annu Rev Immunol. 2006;24:257-286. 77. Schmitt TM, Zuniga-Pflucker JC. Induction of T cell development from hematopoietic progenitor cells by delta-like-1 in vitro. Immunity. 2002;17:749-756. 78. Schmitt TM, de Pooter RF, Gronski MA, Cho SK, Ohashi PS, Zuniga-Pflucker JC. Induction of T cell development and establishment of T cell competence from embryonic stem cells differentiated in vitro. Nat Immunol. 2004;5:410-417. 79. Massa S, Balciunaite G, Ceredig R, Rolink AG. Critical role for c-kit (CD 117) in T cell lineage commitment and early thymocyte development in vitro. Eur J Immunol. 2006;36:526-532. 80. Hunte BE, Hudak S, Campbell D, Xu Y, Rennick D. flk2/flt3 ligand is a potent cofactor for the growth of primitive B cell progenitors. J Immunol. 1996;156:489-496. 81. von Freeden-Jeffry U, Vieira P, Lucian LA, McNeil T, Burdach SE, Murray R. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J Exp Med. 1995;181:1519-1526. 82. Peschon JJ, Morrissey PJ, Grabstein KH, et al. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J Exp Med. 1994;180:1955-1960. 83. Moore TA, von Freeden-Jeffry U, Murray R, Zlotnik A. Inhibition of gamma delta T cell development and early thymocyte maturation in IL-7 -/- mice. J Immunol. 1996;157:2366-2373. 84. He YW, Malek TR. Interleukin-7 receptor alpha is essential for the development of gamma delta + T cells, but not natural killer cells. J Exp Med. 1996;184:289-293. 85. Kondo M , Scherer DC, King AG, Manz MG, Weissman IL. Lymphocyte development from hematopoietic stem cells. Curr Opin Genet Dev. 2001 ;11:520-526. 100 86. Corcoran AE, Riddell A, Krooshoop D, Venkitaraman AR. Impaired immunoglobulin gene rearrangement in mice lacking the IL-7 receptor. Nature. 1998;391:904-907. 87. Durum SK, Candeias S, Nakajima H, et al. Interleukin 7 receptor control of T cell receptor gamma gene rearrangement: role of receptor-associated chains and locus accessibility. J Exp Med. 1998;188:2233-2241. 88. Miller JP, Izon D, DeMuth W, Gerstein R, Bhandoola A, Allman D. The earliest step in B lineage differentiation from common lymphoid progenitors is critically dependent upon interleukin 7. J Exp Med. 2002;196:705-711. 89. Opferman JT, Letai A, Beard C, Sorcinelli MD, Ong CC, Korsmeyer SJ. Development and maintenance of B and T lymphocytes requires antiapoptotic MCL-1. Nature. 2003;426:671-676. 90. Maraskovsky E, O'Reilly LA, Teepe M , Corcoran L M , Peschon JJ, Strasser A. Bcl-2 can rescue T lymphocyte development in interleukin-7 receptor-deficient mice but not in mutant rag-1-/-mice. Cell. 1997;89:1011-1019. 91. von Freeden-Jeffry U, Solvason N , Howard M , Murray R. The earliest T lineage-committed cells depend on IL-7 for Bcl-2 expression and normal cell cycle progression. Immunity. 1997;7:147-154. 92. Waldmann TA, Tagaya Y. The multifaceted regulation of interleukin-15 expression and the role of this cytokine in NK cell differentiation and host response to intracellular pathogens. Annu Rev Immunol. 1999;17:19-49. 93. Lodolce JP, Boone DL, Chai S, et al. IL-15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation. Immunity. 1998;9:669-676. 94. Kennedy MK, Glaccum M , Brown SN, et al. Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice. J Exp Med. 2000;191:771-780. 95. Tassara C, Pepper AE, Puck JM. Intronic point mutation in the IL2RG gene causing X-linked severe combined immunodeficiency. Hum Mol Genet. 1995;4:1693-1695. 96. ; Pepper AE, Buckley RH, Small TN, Puck JM. Two mutational hotspots in the interleukin-2 receptor gamma chain gene causing human X-linked severe combined immunodeficiency. Am J Hum Genet. 1995;57:564-571. 101 97. Cao X, Shores EW, Hu-Li J, et al. Defective lymphoid development in mice lacking expression of the common cytokine receptor gamma chain. Immunity. 1995;2:223-238. 98. DiSanto JP, Muller W, Guy-Grand D, Fischer A, Rajewsky K. Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor gamma chain. Proc Natl Acad Sci U S A . 1995;92:377-381.. 99. Minagawa M , Watanabe H, Miyaji C, et al. Enforced expression of Bcl-2 restores the number of NK cells, but does not rescue the impaired development of NKT cells or intraepithelial lymphocytes, in IL-2/IL-15 receptor beta-chain-deficient mice. J Immunol. 2002;169:4153-4160. 100. Cooper MA, Bush JE, Fehniger TA, et al. In vivo evidence for a dependence on interleukin 15 for survival of natural killer cells. Blood. 2002;100:3633-3638. 101. Ranson T, Vosshenrich CA, Corcuff E, Richard O, Muller W, Di Santo JP. IL-15 is an essential mediator of peripheral NK-cell homeostasis. Blood. 2003;101:4887-4893. 102. Grund EM, Spyropoulos DD, Watson DK, Muise-Helmericks RC. Interleukins 2 and 15 regujate Etsl expression via ERK1/2 and MNK1 in human natural killer cells. J Biol Chem. 2005;280:4772-4778. 103. Barton K, Muthusamy N , Fischer C, et al. The Ets-1 transcription factor is required for the development of natural killer cells in mice. Immunity. 1998;9:555-563. 104. Godin I, Cumano A. The hare and the tortoise: an embryonic haematopoietic race. Nat Rev Immunol. 2002;2:593-604. 105. McGrath KE, Palis J. Hematopoiesis in the yolk sac: more than meets the eye. Exp Hematol. 2005;33:1021-1028. 106. Ferkowicz MJ, Starr M, Xie X, et al. CD41 expression defines the onset of primitive and definitive hematopoiesis in the murine embryo. Development. 2003;130:4393-4403. 107. Yokota T, Huang J, Tavian M , et al. Tracing the first waves of lymphopoiesis in mice. Development. 2006;133:2041-2051. 108. Mikkola HK, Fujiwara Y, Schlaeger TM, Traver D, Orkin SH. Expression of CD41 marks the initiation of definitive hematopoiesis in the mouse embryo. Blood. 2003;101:508-516. 102 109. Cumano A, Dieterlen-Lievre F, Godin I. Lymphoid potential, probed before circulation in mouse, is restricted to caudal intraembryonic splanchnopleura. Cell. 1996;86:907-916. 110. Cumano A, Ferraz JC, Klaine M , Di Santo JP, Godin I. Intraembryonic, but not yolk sac hematopoietic precursors, isolated before circulation, provide long-term multilineage recpnstitutipn. Immunity. 2001;15:477-485. 111. Mikkola HK, Orkin SH. The journey of developing hematopoietic stem cells. Development. 2006;133:3733-3744. 112. Lengerke C, Daley GQ. Patterning definitive hematopoietic stem cells from embryonic stem cells. Exp Hematol. 2005;33:971-979. 113. Yoder MC, Hiatt K. Engraftment of embryonic hematopoietic cells in conditioned newborn recipients. Blood. 1997;89:2176-2183. 114. Matsuoka S, Tsuji K, Hisakawa H, et al. Generation of definitive hematopoietic stem cells from murine early yolk sac and paraaortic splanchnopleures by aorta-gonad-mesonephros region-derived stromal cells. Blood. 2001;98:6-12. 115. Godin I, Dieterlen-Lievre F, Cumano A. Emergence of multipotent hemopoietic cells in the yolk sac and paraaortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitus. Proc Natl Acad Sci U S A . 1995;92:773-777. 116. Godin I, Garcia-Porrero JA, Dieterlen-Lievre F, Cumano A. Stem cell emergence and hemopoietic activity are incompatible in mouse intraembryonic sites. J Exp Med. 1999;190:43-52. . 117. Muller A M , Medvinsky A, Strouboulis J, Grosveld F, Dzierzak E. Development of hematopoietic stem cell activity in the mouse embryo. Immunity. 1994;1:291-301. 118. Medvinsky A, Dzierzak E. Definitive hematopoiesis is autonomously initiated by the A G M region. Cell. 1996;86:897-906. 119. Jaffredo T, Nottingham W, Liddiard K, Bollerot K, Pouget C, de Bruijn M . From hemangioblast to hematopoietic stem cell: an endothelial connection? Exp Hematol. 2005;33:1029-1040. 103 120. Beftrahd JY, Giroux S, Golub R, et al. Characterization of purified intraembryonic hematopoietic stem cells as a tool to define their site of origin. Proc Natl Acad Sci U S A . 2005;102:134-139. 121. Sanchez MJ, Holmes A, Miles C, Dzierzak E. Characterization of the first definitive hematopoietic stem cells in the A G M and liver of the mouse embryo. Immunity. 1996;5:513-525. 122. Matsubara A, Iwama A, Yamazaki S, et al. Endomucin, a CD34-like sialomucin, marks hematopoietic stem cells throughout development. J Exp Med. 2005;202:1483-1492. 123. Morrison SJ, Hemmati HD, Wandycz A M , Weissman IL. The purification and characterization of fetal liver hematopoietic stem cells. Proc Natl Acad Sci U S A . 1995;92:10302-10306. 124. - Rebel VI, Miller CL, Thombury GR, Dragowska WH, Eaves CJ, Lansdorp PM. A comparison of long-term repopulating hematopoietic stem cells in fetal liver and adult bone marrow from the mouse. Exp Hematol. 1996;24:638-648. 125. Katsura Y. Redefinition of lymphoid progenitors. Nat Rev Immunol. 2002;2:127-132. 126. Mebius RE, Miyamoto T, Christensen J, et al. The fetal liver counterpart of adult common lymphoid progenitors gives rise to all lymphoid lineages, CD45+CD4+CD3- cells, as well as macrophages. J Immunol. 2001;166:6593-6601. 127. Kawamoto H, Ikawa T, Ohmura K, Fujimoto S, Katsura Y. T cell progenitors emerge earlier than B cell progenitors in the murine fetal liver. Immunity. 2000;12:441-450. 128. Cumano A, Paige CJ, Iscove NN, Brady G. Bipotential precursors of B cells and macrophages in murine fetal liver. Nature. 1992;356:612-615. 129. Douagi I, Vieira P, Cumano A. Lymphocyte commitment during embryonic development, in the mouse. Semin Immunol. 2002;14:361-369. 130. Hardy RR, Li YS, Allman D, Asano M , Gui M , Hayakawa K. B-cell commitment, development and selection. Immunol Rev. 2000;175:23-32.. 131. Kincade PW, Owen JJ, Igarashi H, Kouro T, Yokota T, Rossi MI. Nature or nurture? Steady-state lymphocyte formation in adults does not recapitulate ontogeny. Immunol Rev. 2002;187:116-125. 104 132. MacDonald HR, Radtke F, Wilson A. T cell fate specification and alphabeta/gammadelta lineage commitment. Curr Opin Immunol. 2001;13:219-224. 133. Michie A M , Carlyle JR, Schmitt TM, et al. Clonal characterization of a bipotent T cell and NK cell progenitor in the mouse fetal thymus. J Immunol. 2000;164:1730-1733. 134. Ikawa T, Kawamoto H, Fujimoto S, Katsura Y. Commitment of common T/Natural killer (NK) progenitors to unipotent T and NK progenitors in the murine fetal thymus revealed by a single progenitor assay. J Exp Med. 1999;190:1617-1626. 135. Schmitt TM, Ciofani M , Petrie HT, Zuniga-Pflucker JC. Maintenance of T cell specification and differentiation requires recurrent notch receptor-ligand interactions. J Exp Med. 2004;200:469-479. 136. Douagi I, Colucci F, Di Santo JP, Cumano A. Identification of the earliest prethymic bipotent T/NK progenitor in murine fetal liver. Blood. 2002;99:463-471. 137. Ikawa T, Masuda K, Lu M , Minato N, Katsura Y, Kawamoto H. Identification of the earliest prethymic T-cell progenitors in murine fetal blood. Blood. 2004;103:530-537. 138. Masuda K, Itoi M , Amagai T, Minato N, Katsura Y, Kawamoto H. Thymic anlage is colonized by progenitors restricted to T, NK, and dendritic cell lineages. J Immunol. 2005;174:2525-2532. 139. Harm.an BC, Jenkinson WE, Parnell SM, Rossi SW, Jenkinson EJ, Anderson G. T/B lineage choice occurs prior to intrathymic Notch signaling. Blood. 2005;106:886-892. 140. Jenkinson EJ, Jenkinson WE, Rossi SW, Anderson G. The thymus and T-cell commitment: the right niche for Notch? Nat Rev Immunol. 2006;6:551-555. 141. Tabatabaei-Zavareh N , Veinotte LL, Takei F. Altered Immunoregulation and Human Disease (ed. Gorczynski RM). Kerala, India: Research Signpost; 2005;33-59. 142. Fraser KP, Gays F, Robinson JH, et al. NK cells developing in vitro from fetal mouse progenitors express at least one member of the Ly49 family that is acquired in a time-dependent and stochastic manner independently of CD94 and NKG2. Eur J Immunol. 2002;32:868-878. 143. Van Beneden K, Stevenaert F, De Creus A, et al. Expression of Ly49E and CD94/NKG2 on fetal and adult NK cells. J Immunol. 2001;166:4302-4311. 105 144. Corbel C, Salaun J. Alphallb integrin expression during development of the murine hemopoietic system. Dev Biol. 2002;243:301-311. 145. Corbel C, Vaigot P, Salaun J. (alpha)IIb Integrin, a novel marker for hemopoietic progenitor cells. Int J Dev Biol. 2005;49:279-284. 146. Mitjavila-Garcia MT, Cailleret M , Godin I, et al. Expression of CD41 on hematopoietic progenitors derived from embryonic hematopoietic cells. Development. 2002;129:2003-2013. 147. Emambokus NR, Frampton J. The glycoprotein lib molecule is expressed on early murine hematopoietic progenitors and regulates their numbers in sites of hematopoiesis. Immunity. 2003;19:33-45. 148. Kiel MJ, Yilmaz OH, Iwashita T, Yilmaz OH, Terhorst C, Morrison SJ. SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell. 2005;121:1109-1121. 149. Yoder MC, Hiatt K, Dutt P, Mukherjee P, Bodine DM, Orlic D. Characterization of definitive lymphohematopoietic stem cells in the day 9 murine yolk sac. Immunity. 1997;7:335-344. 150. Baumann CI, Bailey AS, Li W, Ferkowicz MJ, Yoder MC, Fleming WH. PEC AM-1 is expressed on hematopoietic stem cells throughout ontogeny and identifies a population of erythroid progenitors. Blood. 2004;104:1010-1016. 151. Young PE, Baumhueter S, Lasky LA. The sialomucin CD34 is expressed on hematopoietic cells and blood vessels during murine development. Blood. 1995;85:96-105. 152. Cheng J, Baumhueter S, Cacalano G, et al. Hematopoietic defects in mice lacking the sialomucin CD34. Blood. 1996;87:479-490. 153. Ogawa M , Tajima F, Ito T, Sato T, Laver JH, Deguchi T. CD34 expression by murine hematopoietic stem cells. Developmental changes and kinetic alterations. Ann N Y Acad Sci. 2001;938:139-145. 154. Aihara Y, Buhring HJ, Aihara M , Klein J. An attempt to produce "pre-T" cell hybridomas and to identify their antigens. Eur J Immunol. 1986;16:1391-1399. 106 155. . van de Rijn M , Heimfeld S, Spangrude GJ, Weissman IL. Mouse hematopoietic stem-cell antigen Sca-1 is a member of the Ly-6 antigen family. Proc Natl Acad Sci U S A. 1989;86:4634-4638. 156. Spangrude GJ, Aihara Y, Weissman IL, Klein J. The stem cell antigens Sca-1 and Sca-2 subdivide thymic and peripheral T lymphocytes into unique subsets. J Immunol. 1988;141:3697-3707. 157. Domen J, Weissman IL. Hematopoietic stem cells need two signals to prevent apoptosis; BCL-2 can provide one of these, Kitl/c-Kit signaling the other. J Exp Med. 2000;192:1707-1718. 158. Osawa M , Hanada K, Hamada H, Nakauchi H. Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem cell. Science. 1996;273:242-245. 159. Gangenahalli GU, Singh VK, Verma YK, et al. Hematopoietic stem cell antigen CD34: role in adhesion or homing. Stem Cells Dev. 2006;15:305-313. 160. Laiosa CV, Stadtfeld M , Graf T. Determinants of lymphoid-myeloid lineage diversification. Annu Rev Immunol. 2006;24:705-738. 161. Williams NS, Klem J, Puzanov IJ, et al. Natural killer cell differentiation: insights from knockout and transgenic mouse models and in vitro systems. Immunol Rev. 1998;165:47-61. 162. Lanier LL. NK cell recognition. Annu Rev Immunol. 2005;23:225-274. 163. Arase H, Saito T, Phillips JH, Lanier LL. Cutting edge: the mouse NK cell-associated antigen recognized by DX5 monoclonal antibody is CD49b (alpha 2 integrin, very late antigen-2). J Immunol. 2001;167:1141-1144. 164. Smyth MJ, Trapani JA. Granzymes: exogenous proteinases that induce target cell apoptosis. Immunol Today. 1995;16:202-206. 165. Hynes,RO. Integrins: bidirectional, allosteric signaling machines. Cell. 2002;110:673-687. 166. Park C, Ma YD, Choi K. Evidence for the hemangioblast. Exp Hematol. 2005;33:965-970. 107 167. Millauer B, Wizigmanri-Voos S, Schnurch H, et al. High affinity VEGF binding and developmental expression suggest Flk-1 as a major regulator of vasculogenesis and angiogenesis. Cell. 1993;72:835-846. 168. Kina T, Ikuta K, Takayama E, et al. The monoclonal antibody TER-119 recognizes a molecule associated with glycophorin A and specifically marks the late stages of murine erythroid lineage. Br J Haematol. 2000;109:280-287. 169. Fleming TJ, Fleming ML, Malek TR. Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow. RB6-8C5 mAb to granulocyte-differentiation antigen (Gr-1) detects members of the Ly-6 family. J Immunol. 1993;151:2399-2408. 170. Doetschman TC, Eistetter H, Katz M , Schmidt W, Kemler R. The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J Embryol Exp Morphol. 1985;87:27-45. 171. Keller G, Kennedy M , Papayannopoulou T, Wiles MV. Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol. 1993;13:473-486. 172. Kennedy M , Firpo M , Choi K, et al. A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature. 1997;386:488-493. 173. Choi K, Kennedy M , Kazarov A, Papadimitriou JC, Keller G. A common precursor for hematopoietic and endothelial cells. Development. 1998;125:725-732. 174. Huber TL, Kouskoff V, Fehling HJ, Palis J, Keller G. Haemangioblast commitment is initiated in the primitive streak of the mouse embryo. Nature. 2004;432:625-630. 175. Faloon P, Arentson E, Kazarov A, et al. Basic fibroblast growth factor positively regulates hematopoietic development. Development. 2000;127:1931-1941. 176. Chung YS, Zhang WJ, Arentson E, Kingsley PD, Palis J, Choi K. Lineage analysis of the hemangioblast as defined by FLK1 and SCL expression. Development. 2002; 129:5511-5520. 177. Shalaby F, Rossant J, Yamaguchi TP, et al. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 1995;376:62-66. 178. Shalaby F, Ho J, Stanford WL, et al. A requirement for Flkl in primitive and definitive hematopoiesis and vasculogenesis. Cell. 1997;89:981-990. 108 179. Robb L, Lyons I, Li R, et al. Absence of yolk sac hematopoiesis from mice with a targeted disruption of the sci gene. Proc Natl Acad Sci U S A . 1995;92:7075-7079. 180. Shivdasani RA, Mayer EL, Orkin SH. Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-l/SCL. Nature. 1995;373:432-434. 181. Robb L, Elwood NJ, Elefanty AG, et al. The sci gene product is required for the generation of all hematopoietic lineages in the adult mouse. Embo J. 1996;15:4123-4129. 182. Visvader JE, Fujiwara Y, Orkin SH. Unsuspected role for the T-cell leukemia protein SCL/tal-1 in vascular development. Genes Dev. 1998;12:473-479. 183. Robertson SM, Kennedy M , Shannon JM, Keller G. A transitional stage in the commitment of mesoderm to hematopoiesis requiring the transcription factor SCL/tal-1. Development. 2000;127:2447-2459. 184. Hole N , Graham GJ, Menzel U, Ansell JD. A limited temporal window for the derivation of multilineage repopulating hematopoietic progenitors during embryonal stem cell differentiation in vitro. Blood. 1996;88:1266-1276. 185. Potocnik AJ, Kohler H, Eichmann K. Hemato-lymphoid in vivo reconstitution potential of subpopulations derived from in vitro differentiated embryonic stem cells. Proc Natl Acad Sci U S A . 1997;94:10295-10300. 186. Muller A M , Dzierzak EA. ES cells have only a limited lymphopoietic potential after adoptive transfer into mouse recipients. Development. 1993;118:1343-1351. 187. Burt RK, Verda L, Kim DA, Oyama Y, Luo K, Link C. Embryonic stem cells as an alternate marrow donor source: engraftment without graft-versus-host disease. J Exp Med. 2004;199:895-904. 188. Perlingeiro RC, Kyba M , Daley GQ. Clonal analysis of differentiating embryonic stem-cells reveals a hematopoietic progenitor with primitive erythroid and adult lymphoid-myeloid potential. Development. 2001;128:4597-4604. 189. Kyba M , Perlingeiro RC, Hoover RR, Lu CW, Pierce J, Daley GQ. Enhanced hematopoietic differentiation of embryonic stem cells conditionally expressing Stat5. Proc Natl Acad Sci U S A. 2003; 100 Suppl 1:11904-11910. 109 190. Kyba M , Perlingeiro RC, Daley GQ. HoxB4 confers definitive lymphoid-myeloid engraftment potential on embryonic stem cell and yolk sac hematopoietic progenitors. Cell. 2002';r09:29-37. 191. Wang Y, Yates F, Naveiras O, Ernst P, Daley GQ. Embryonic stem cell-derived hematopoietic stem cells. Proc Natl Acad Sci U S A . 2005;102:19081-19086. 192. Nakano T, Kodama H, Hdnjo T. Generation of lymphohematopoietic cells from embryonic stem cells in culture. Science. 1994;265:1098-1101. 193. Kodama H, Nose M , Niida S, Nishikawa S, Nishikawa S. Involvement of the c-kit receptor in the adhesion of hematopoietic stem cells to stromal cells. Exp Hematol. 1994;22:979-984. 194. Yoshida H, Hayashi S, Kunisada T, et al. The murine mutation osteopetrosis is in the coding region of the macrophage colony stimulating factor gene. Nature. 1990;345:442-444. 195. Cho SK, Webber TD, Carlyle JR, Nakano T, Lewis SM, Zuniga-Pflucker JC. Functional characterization of B lymphocytes generated in vitro from embryonic stem cells. Proc Natl Acad Sci U S A . 1999;96:9797-9802. 196: -de Pooter RF, Cho SK, Carlyle JR, Zuniga-Pflucker JC. In vitro generation of T lymphocytes from embryonic stem cell-derived prehematopoietic progenitors. Blood. 2003;102:1649-1653. 197. Nakayama N, Fang I, Elliott G. Natural killer and B-lymphoid potential in CD34+ cells derived from embryonic stem cells differentiated in the presence of vascular endothelial growth factor. Blood. 1998;91:2283-2295. 198. Nakayama N, Lee J, Chiu L. Vascular endothelial growth factor synergistically enhances bone morphogenetic protein-4-dependent lymphohematopoietic cell generation from embryonic stem cells in vitro. Blood. 2000;95:2275-2283. 199. Zhang WJ, Park C, Arentson E, Choi K. Modulation of hematopoietic and endothelial cell differentiation from mouse embryonic stem cells by different culture conditions. Blood. 2005;105:111-114. 200. Lian RH, Maeda M , Lohwasser S, et al. Orderly and nonstochastic acquisition of GD94/NKG2 receptors by developing NK cells derived from embryonic stem cells in vitro. J Immunol. 2002;168:4980-4987. , .'i • • • • • . • 110 201. Mikkola HK, Klintman J, Yang H, et al. Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene. Nature. 2003;421:547-551. 202. Kagoshima H, Shigesada K, Satake M , et al. The Runt domain identifies a new family of heteromeric transcriptional regulators. Trends Genet. 1993;9:338-341. 203. Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell. 1996;84:321-330. 204. Wang Q, Stacy T, Binder M , Marin-Padilla M , Sharpe AH, Speck NA. Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc Natl Acad Sci U S A . 1996;93:3444-3449. 205. North TE, de Bruijn MF, Stacy T, et al. Runxl expression marks long-term repopulating hematopoietic stem cells in the midgestation mouse embryo. Immunity. 2002;16:661-672. 206. Cai Z, de Bruijn M , Ma X, et al. Haploinsufficiency of AML1 affects the temporal and spatial generation of hematopoietic stem cells in the mouse embryo. Immunity. 2000;13:423-431. 207. Lacaud G, Gore L, Kennedy M , et al. Runxl is essential for hematopoietic commitment at the hemangioblast stage of development in vitro. Blood. 2002;100:458-466. 208. Lacaud G, Kouskoff V, Trumble A, Schwantz S, Keller G. Haploinsufficiency of Runxl results in the acceleration of mesodermal development and hemangioblast specification-upon in vitro differentiation of ES cells. Blood. 2004;103:886-889. 209. Ernst P, Fisher JK, Avery W, Wade S, Foy D, Korsmeyer SJ. Definitive hematopoiesis requires the mixed-lineage leukemia gene. Dev Cell. 2004;6:437-443. 210. Sauvageau G, Lansdorp PM, Eaves CJ, et al. Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells. Proc Natl Acad Sci U S A . 1994;91:12223-12227. 211. McGrath KE, Palis J. Expression of homeobox genes, including an insulin promoting factor, in the murine yolk sac at the time of hematopoietic initiation. Mol Reprod Dev. 1997;48:145-153. I l l 212. Sauvageau G, Thorsteinsdottir TJ, Eaves CJ, et al. Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev. 1995;9:1753-1765. 213. Helgason CD, Sauvageau G, Lawrence HJ, Largman C, Humphries RK. Overexpression of HOXB4 enhances the hematopoietic potential of embryonic stem cells differentiated in vitro. Blood. 1996;87:2740-2749. 214. Davidson AJ, Ernst P, Wang Y, et al. cdx4 mutants fail to specify blood progenitors and can be rescued by multiple hox genes. Nature. 2003;425:300-306. 215. Balciunaite G, Ceredig R, Fehling HJ, Zuniga-Pflucker JC, Rolink AG. The role of Notch and IL-7 signaling in early thymocyte proliferation and differentiation. Eur J Immunol. 2005;35:1292-1300. 216. Huang J, Garrett KP, Pelayo R, Zuniga-Pflucker JC, Petrie HT, Kincade PW. Propensity of adult lymphoid progenitors to progress to DN2/3 stage thymocytes with Notch receptor ligation. J Immunol..2005;175:4858-4865. 217. Raulet DH. The structure, function, and molecular genetics of the gamma/delta T cell receptor. Annu Rev Immunol. 1989;7:175-207. 218. Zuniga-Pflucker JC. T-cell development made simple. Nat Rev Immunol. 2004;4:67-72. 219. Newman PJ. The role of PEC AM-1 in vascular cell biology. Ann N Y Acad Sci. 1994;714:165-174. 220. Hirashima M , Kataoka H, Nishikawa S, Matsuyoshi N , Nishikawa S. Maturation of embryonic stem cells into endothelial cells in an in vitro model of vasculogenesis. Blood. 1999;93:1253-1263. 221. Nishikawa SI, Nishikawa S, Kawamoto H, et al. In vitro generation of lymphohematopoietic cells from endothelial cells purified from murine embryos. Immunity. 1998;8:761-769.. 222. Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell. 1996;86:47-57. 112 223. Otani T, Inoue T, Tsuji-Takayama K, et al. Progenitor analysis of primitive erythropoiesis generated from in vitro culture of embryonic stem cells. Exp Hematol. 2005;33:632-640. 224. Porritt HE, Rumfelt LL, Tabrizifard S, Schmitt TM, Zuniga-Pflucker JC, Petrie HT. Heterogeneity among DN1 prothymocytes reveals multiple progenitors with different capacities to generate T cell and non-T cell lineages. Immunity. 2004;20:735-745. 225. Palacios R, Golunski E, Samaridis J. In vitro generation of hematopoietic stem cells from an embryonic stem cell line. Proc Natl Acad Sci U S A. 1995;92:7530-7534. 226. Farag SS, Fehniger TA, Ruggeri L, Velardi A, Caligiuri MA. Natural killer cell receptors: new biology and insights into the graft-versus-leukemia effect. Blood. 2002;100:1935-1947. 227. Wang L, Menendez P, Cerdan C, Bhatia M . Hematopoietic development from human embryonic stem cell lines. Exp Hematol. 2005;33:987-996. 113 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100552/manifest

Comment

Related Items