Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The roles of BEL1-like proteins in organ morphogenesis in Arabidopsis thaliana Kumar, Ravi 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
831-ubc_2007-267448.pdf [ 26.48MB ]
Metadata
JSON: 831-1.0100541.json
JSON-LD: 831-1.0100541-ld.json
RDF/XML (Pretty): 831-1.0100541-rdf.xml
RDF/JSON: 831-1.0100541-rdf.json
Turtle: 831-1.0100541-turtle.txt
N-Triples: 831-1.0100541-rdf-ntriples.txt
Original Record: 831-1.0100541-source.json
Full Text
831-1.0100541-fulltext.txt
Citation
831-1.0100541.ris

Full Text

THE ROLES OF BEL1-LIKE PROTEINS IN ORGAN MORPHOGENESIS IN ARABIDOPSIS THAU AN A by RAVI KUMAR M.Phil., University of Delhi, 2000 M.Sc, University of Delhi, 1999 B.Sc, University of Delhi, 1997 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Botany) THE UNIVERSITY OF BRITISH COLUMBIA December 2006 © Ravi Kumar, 2006 ii ABSTRACT Plant organs originate in distinct temporal and spatial arrangements as primordial outgrowths from meristematic regions. The study of how this process is regulated is of great significance to both developmental biologists and plant breeders. Several genes encoding proteins that regulate meristem function and the subsequent layout of shoot and root architecture have been identified by mutation. For example, STM and BP are members of the KNOX class of regulatory proteins and are involved in meristem function (STM) and inflorescence architecture (BP). In Arabidopsis, the BEL1—like TALE homeodomain (BLH) protein family consists of 13 members that form heterodimeric complexes with KNOX homeodomain proteins including STM and BP. Loss of function of BEL1 results in malformed ovules and female sterility but other organs do not seem to be affected. Northern blots and in-situ hybridization experiments have shown that BEL1 is expressed in the stem, sepals, embryo and the shoot/inflorescence apical meristem. The BEL1 expression outside the ovules is an indication that it might also have functions outside the ovule. The lack of bell mutant phenotypes in regions other than the ovule is probably due to functional overlaps with other BLH proteins, since many of these proteins overlap in expression with BEL1 and also have similar interacting partners. During my PhD research I have functionally characterized two additional BLH genes, SAWTOOTH1 (SAW1) and SAWTOOTH2 (SAW2) and tested their relationship to BELL I was able to determine that the loss of SAW function causes increased growth in the leaf margins whereas overexpression of SAW1 in the plants caused decreased growth due to both reduced cell expansion as well as cell division. Molecular and genetic analyses revealed that the SAW proteins function in part by repressing BP (and perhaps other Class I KNOX genes) expression in the leaves. Ill TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iii LIST OF TABLES v LIST OF FIGURES vi ABBREVIATIONS viii NOMENCLATURE x ACKNOWLEDGMENTS xi CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW / 1.1. Vegetative shoot development 3 1 . 1 . 1 . S t r u c t u r e o f t h e s h o o t a p i c a l m e r i s t e m 5 1 . 1 . 2 . E s t a b l i s h m e n t o f t h e s h o o t a p i c a l m e r i s t e m 6 1 . 1 . 3 . M a i n t e n a n c e o f s h o o t a p i c a l m e r i s t e m i d e n t i t y a n d f u n c t i o n 9 1 . 1 . 4 . I n i t i a t i o n o f l a t e r a l o r g a n s : W h e n a n d w h e r e a r e l e a v e s i n i t i a t e d ? 1 2 1 . 1 . 5 . A d a x i a l - a b a x i a l i d e n t i t y i n l e a v e s 1 6 1 . 1 . 6 . L e a f d e v e l o p m e n t i n t h e p r o x i m o d i s t a l a n d m e d i o l a t e r a l a x i s 1 9 1 . 1 . 7 . L e a f m a r g i n d e v e l o p m e n t 2 3 1.2. Homeodomain proteins 29 1 . 2 . 1 . S t r u c t u r e o f h o m e o d o m a i n p r o t e i n s 2 9 1 . 2 . 2 . T A L E h o m e o d o m a i n p r o t e i n s i n p l a n t s a n d a n i m a l s 3 1 1 . 2 . 3 . K N O X f a m i l y o f h o m e o d o m a i n p r o t e i n s 3 2 1 . 2 . 4 . B E L L f a m i l y o f h o m e o d o m a i n p r o t e i n s 3 5 1 . 2 . 5 . E v o l u t i o n a r y r e l a t i o n s h i p s o f t h e T A L E h o m e o d o m a i n p r o t e i n s 3 6 1 . 2 . 6 . I n t e r a c t i o n s o f t h e h o m e o d o m a i n p r o t e i n s 3 9 1 . 2 . 7 . H o m e o d o m a i n p r o t e i n - D N A i n t e r a c t i o n s : 4 1 1 . 2 . 8 . S u b c e l l u l a r l o c a l i z a t i o n o f t h e h o m e o d o m a i n p r o t e i n s 4 4 1 . 3 . 1 . T h e s i s o b j e c t i v e s 4 9 CHAPTER 2 : MATERIALS AND METHODS 51 2.1 Bioinformatics 51 2 . 1 . 1 . P r o t e i n a l i g n m e n t s 5 1 2 . 1 . 2 . A l i g n m e n t o f p r o m o t e r e l e m e n t s ( i n c l u d i n g 5 ' U n t r a n s l a t e d r e g i o n ( U T R ) ) 5 2 2 . 1 . 3 . P r e d i c t i o n o f n u c l e a r l o c a l i z a t i o n 5 2 2.2 General Arabidopsis Methodologies 52 2 . 2 . 1 . G r o w t h c o n d i t i o n s 5 2 2 . 1 . 3 . P l a n t m a t e r i a l 5 3 2 . 1 . 4 . P l a n t t r a n s f o r m a t i o n . . 5 4 2.3. Analysis of Gene Expression 55 2 . 3 . 1 . S e m i - q u a n t i t a t i v e r e v e r s e t r a n s c r i p t a s e ( R T ) P C R 5 5 2 . 3 . 2 . G U S a n a l y s i s 5 6 2.4. Functional analysis of SAW1 and SAW2 59 2 . 4 . 1 . T I L L I N G ( T a r g e t i n g I n d u c e d L o c a l L e s i o n s I N G e n o m e s ) 5 9 iv 2.4.2. T-DNA insertions 61 2.4.3. RNAi 62 2.5. Complementation of sawl saw2 with a SAW2 genomic fragment 64 2.6. Characterization of mutant phenotypes 65 CHAPTER 3 : RESULTS 66 3.1. Phylogenetic analysis of the BLH family of homeodomain proteins 66 3.2 SAW1 and SAW2 are paraiogous genes 70 3.2.1. SA WI and SA W2 are products of recent chromosomal duplication 70 3.2.2. SAW1 and SAW2 share sequence similarity at the 5'UTR 72 3.2.3. SAW1 and SAW2 are co-expressed at many developmental stages and in many stress responses 72 3.3. Analyses of SA WI, SA W2 and BEL1 gene expression 75 3.3.1. Virtual northerns show that SAW1, SAW2 and BEL1 are expressed in numerous organs in the plant 75 3.2.2. Comparison of the expression patterns of the three genes by RT-PCR 77 3.2.3. Examination of the expression in different tissues using promoter:GUS fusions 78 3.3. Functional analysis of SAW1 and SAW2 81 3.3.1. An attempt to generate RNA mediated interference (RNAi) to generate SA WI and SA W2 silenced lines 81 3.3.2. SAW1 and SAW2 loss-of-firnction and reduced expression lines 81 3.3.2. Saw double mutants have altered leaf morphology 84 3.3.3. Evidence that the observed phenotypes are linked to SAW1 and SAW2 loci 87 3.4. Genetic interactions with other genes: BEL1, BP (GUS), and AS1 90 3.4.1. Saw phenotypes are not enhanced by bell 90 3.4.2. BP is ectopically expressed in the leaves of saw2 sawl double mutants 90 3.4.3. SAW1 and SAW2 function synergistically with AS1 to control leaf margin development 93 3.5. Phenotypic characterization of 35S:SAW1 plants 96 3.5.1. 35S.SAW1 plants are severely reduced in size 96 3.5.3. Cell elongation and probably cell division is reduced in stems of 35S:SAW1 plants 97 3.5.2. Floral abnormalities are seen in the 35S:SAW1 plants 98 CHAPTER 4 : DISCUSSION 101 4.1. SAW proteins are negative regulators of growth 101 4.2. SAW is a negative regulator of BP 102 4.3. SAW and KNOX interactions 104 4.4. Altered vegetative phase transition in the sawl saw2 double mutants? 107 4.5. Functional redundancy in BEL1 and SAW proteins 108 CHAPTER 5 : SUMMARY AND FUTURE DIRECTIONS 112 LITERATURE CITED 116 V LIST OF TABLES Table 1.1 Prediction of subcellular localization of BLH and KNOX proteins using PSORT 47 Table 2.1 Composition of AT medium 53 Table 2.2 List of mutant alleles ordered from ABRC 54 Table 2.3 Primers and PCR conditions used for RT-PCR 55 Table 2.4 Primers used to amplify promoter fragments to generate PromotenGUS constructs 56 Table 2.5 CAPS and dCAPS markers used to track EMS mutations in TILLING lines. 60 Table 2.6 Forward and reverse primers used for Salk line genotyping 61 Table 2.7 Primers used to amplify and facilitate cloning of BEL1 and SAW1 DNA for RNAi 62 Table 3.1 Summary of the BLH gene family in Arabidopsis 67 Table 3.2 A list of paralogous genes found in the duplicated region that includes SAW1 and SAW2 70 Table 3.3 PRIMe search results for genes coexpressed with SAW2 73 Table 3.4 Saw1 and Saw2 mutants obtained by TILLING and T-DNA insertion 83 Table 3.5 Serration length and flowering time in wild type and saw mutants 86 Table 3.6 Serrations on the seventh leaf of different allele combinations of saw mutants 87 Table 3.7 Cell size and cell number of stem epidermal cells in wild type and 35S:SAW1 plants 97 LIST OF FIGURES Figure 1.1 Scanning electron micrograph of a shoot apex 4 Figure 1.2 Organization of the shoot apical meristem 6 Figure 1.3 Auxin distribution and the establishment of apical basal polarity during embryogenesis 7 Figure 1.4 Establishment of the shoot apical meristem during embryogenesis 8 Figure 1.5 Maintenance of stem cell homestasis in SAM 10 Figure 1.6 Maintenance of meristem identity 12 Figure 1.7 Gene expression changes observed during different stages of organ initiation 15 Figure 1.8 Distribution of adaxial-abaxial identity factors in the shoot apex 19 Figure 1.9 Leaf blade development 21 Figure 1.10 Some of the variations in leaf shapes 23 Figure 1.11 Guttation observed in strawberry leaves 24 Figure 1.12 Homeodomain structure 30 Figure 1.13 General features of KNOX and BLH homeodomain proteins 32 Figure 1.14 Neighbour joining phylogram of the members of the Arabidopsis BEL and KNOX families of homeodomain proteins 34 Figure 1.15 Evolution of the TALE homeodomain proteins ...38 Figure 1.16 Complementation of bell mutant by 35S:SAW1 49 Figure 2.1 T-DNA regions of the Promoter:GUS constructs 57 Figure 2.2 T-DNA regions of the RNAi constructs 63 Figure 2.3 T-DNA region of the SAW2 genomic DNA construct 64 Figure 3.1 Conserved domains in the BLH proteins 68 Figure 3.2 A maximum likelihood phylogram of the 13 members of the BEL1-like homeodomain (BLH) protein family 69 Figure 3.3 SAW1 and SAW2 are found in regions of chromosomal duplication 71 Figure 3.4 Three conserved regions found in the 5' UTR of SAW1 and SAW2 genes.72 Figure 3.5 Correlation of SAW1 and SAW2 expression patterns 74 Figure 3.6 Relative abundance of SAW1, SAW2 and BEL1 transcripts 76 Figure 3.7 RT-PCR analysis of BEL1, SAW1 and SAW2 77 Figure 3.8 Expression analysis of SAW and BEL1 genes: Ovules 78 Figure 3.9 Expression analysis of SAW and BEL1 genes: Flowers 79 Figure 3.10 Expression analysis of SAW and BEL1 genes: Leaves and cotyledons...80 Figure 3.11 Saw loss of function mutants 83 Figure 3.12 SAW affects leaf margin development 85 Figure 3.13 Increased leaf serrations in saw mutants 86 Figure 3.14 Complementation of sawl saw2 double mutants by a SAW2 genomic DNA fragment 89 Figure 3.15 BP is misexpressed in leaf margins of saw double mutants 91 Figure 3.16 Increased BP:GUS activity in stems of sawl saw2 double mutants 92 Figure 3.17 Phenotypes of saw1-1 saw2-1 as1 triple mutants 94 Figure 3.18 Leaf serrations in sawl saw2 as1 triple mutants 95 Figure 3.19 Semiquantitative RT PCR analysis of SAW1 95 Figure 3.20 Phenotypes of 35S:SAW1: Shoot morphology 97 Figure 3.21 Phenotypes of 35S:SAW1: Floral morphology 99 vii Figure 3.22 35S:SAW1 plants are defective in anther dehiscence and pollen development 100 Figure 4.1 35S:SAW1 suppresses the as1 leaf phenotype 103 Figure 4.2 Models describing fates of duplicate genes 111 ABBREVIATIONS viii 3'UTR untranslated region at the 3' end of a gene 35S Cauliflower mosaic virus 35S (constitutive) promoter 5'UTR untranslated region at 5' end of a gene aa amino acid(s) ABRC Arabidopsis Biological Resource Center AN ANGUSTIFLIA ANT Aintegumenta AS1 ASYMMETRIC LEAVES 1 AT, At Arabidopsis thaliana ATH1 ARABIDOPSIS THALIANA HOMEODOMAIN PROTEIN 1 BEL1 BELLI BLAST Basic Local Alignment Search tool BLH BEL1-like homeodomain (protein/gene) BLR BELLRINGER BOP BLADE-ON-PETIOLE BP BREVIPEDICELLUS bp DNA base pairs CaMV35S Cauliflower mosaic virus 35S (constitutive) promoter CAPS cleaved amplified polymorphic sequence cDNA complementary DNA reverse transcribed from messenger RNA (mRNA) CIN CINCINNATA CLV CLAVATA CODDLE Codons Optimized for Detection of Deleterious Lesions Col Arabidopsis Columbia ecotype dCAPS derived cleaved amplified polymorphic sequence DNA deoxyribonucleic acid EDTA ethylene diamine tetracetic acid EMS Ethyl Methanesulfonate EST expressed sequence tag EXD Extradenticle FLC FLOWERING LOCUS C GAPC glyceraldehydes-3-phosphate dehydrogenase C (cytosolic form) GUS ^-glucuronidase HTH Homothorax JAG JAGGED kb kilo bases (1000 base pairs) KNAT Knotted 1 -like (protein/gene) of Arabidopsis thaliana KNOX Knotted 1 -like homeobox (protein/gene) LB Luria-Bertani bacterial growth medium forumulation LEP LEAFY PETIOLE Ler Arabidopsis, Landsberg erecta ecotype MDH1 MALUS DOMESTICA HOMEODOMAIN PROTEIN 1 MEIS Myeloid ectropic viral integration site MIPS Munich information centre for protein sequences mRNA messenger RNA MU 4-methyl-umbelliferone ix MUG 4-methyl-umbelliferone glucoside NCBI National Center for Biotechnology Information OC organizing centre ORF open reading frame PAR Photsynthetically active radiation PBX Pre-B cell homeobox PCR polymerase chain reaction PEG polyethylene glycol PHAN PHANTASTICA PHB PHABULOSA PHB Phabulosa PHV PHAVOLUTA PHV Phavoluta PIN1 PINFORMED 1 PNF POUNDFOOLISH PREP1 PBX regulating protein 1 PRIMe Platform for Riken metabolomics PSORT Prediction of protein sorting signals in localization sites in amino acid sequences REV REVOLUTA RNA ribonucleic acid RNAi RNA mediated interference ROT ROTUNDIFOLIA RT-PCR reverse-transcriptase PCR s second(s) SAM Shoot apical meristem SAW SAWTOOTH SE SERRATE SEM scanning electron microscopy STM SHOOTMERISTEMLESS TAE Tris acetate EDTA buffer TALE Three amino acid loop extension TAIR The Arabidopsis Information Resource; http://Arabidopsis.org/ TCP TEOSINTE-BRANCHED, CYCLOIDEA, PCC (protein family) TE Tris EDTA buffer TGIF TG interacting factor Tris 2-amino-2-hyd roxymethyl-1,3-propaned iol WT wild-type WUS WUSHEL X-gluc 5-bromo-4-chloro-3-indolyl-p-D-glucuronide X NOMENCLATURE Throughout the thesis, standard Arabidopsis nomenclature (Meinke and Koornneef, 1997) has been used. The following is a brief overview of the naming rules: All the Arabidopsis mutants, genes and proteins are identified with a 3-letter symbol corresponding to the full name. Genes (wild type alleles) are italicized and capitalized (Example: SAWTOOTH1 and SAW1) Proteins are capitalized and non-italicized (Example: SAWTOOTH 1 and SAW1) Mutant alleles are lowercase, italicized (Example: sawtoothl and sawl) If multiple alleles exist, then the mutant name is followed by a hyphen and the allele designation (Example: saw1-1, saw1-2, saw1-124e5 etc.) Mutant phenotypes are initial capital and non-italicized (Example: Sawl) Multiple mutants are indicated with a space separating each individual mutant symbol (Example: sawl saw2 double mutant) ACKNOWLEDGMENTS xi I would first like to thank my father, R.V. Subramanian, who has always kindled my scientific reasoning and encouraged me towards a higher academic goal. I gratefully acknowledge Dr. George Haughn, my research supervisor who has provided me with lots of advice, strong guidance as well as flexibility to help me shape this project into its current form. I thank my committee members Dr. Joerg Bohlmann, Dr. Carl Douglas and Dr. Jim Kronstad for regular and timely feedback into my research progress. Thanks also to Tanya, my wife and colleague who is my inspiration and constant support. Past and present members of the Haughn and Dr. Ljerka Kunst's lab have been crucial in creating a positive working atmosphere and provided helpful discussions and protocols, and I am grateful for their contributions. I am indebted to the efficient and friendly Botany Office and technical staff for their help with many practical matters that help keep the research moving. I would also like to acknowledge the financial support given by Dr. George Haughn through research assistantships, the Botany Department through teaching assistantships, and UBC for tuition scholarships and a University Graduate Fellowship. CHAPTER 1 : INTRODUCTION AND LITERATURE REVIEW 1 Living organisms are able to carry out a variety of functions required for their survival and multiplication. One of the fundamental questions in biology is how multicellular organisms acquire organs and tissues of distinct functions, all originally developing from single-celled zygotes. Development involves a series of interdependent events that direct growth (cell division and cell elongation), functional specialization (differentiation) and formation of organs (morphogenesis). It is influenced by various environmental factors (biotic and abiotic) and endogenous cues. Each developmental step involves a multitude of decisions and functions, which are mediated by thousands of structural and functional proteins. These proteins in turn are temporally and spatially regulated by master proteins that ensure that the development is controlled and coordinated. Transcription factors are the master switches that control the transcription of a subset of genes, thereby indirectly regulating protein synthesis. Transcription factor complexes are trans-acting protein complexes that bind cis elements (neighbouring elements in the same linear DNA sequence) of genes and either cause or prevent their transcription. The cis elements include the promoter elements immediately upstream to the gene; enhancers/repressors that can influence gene expression in an orientation and position independent manner; insulators that prevent cis acting elements from participating by obstructing chromosome looping; and anti-insulators that allow long range trans-factor-dependent enhancer-promoter interactions to occur by bypassing insulators (Akbari et al., 2006; Brasset and Vaury, 2005; Muller, 2000). One set of transcription factors includes the general transcriptional activation factors, which are involved in the recruitment of RNA polymerase and the initiation and continuation of transcription. These are the constituents of the basal transcription apparatus. Another set of transcription factors includes site-specific DNA binding transcription factors that are mainly classified on the basis of conserved DNA binding domains. They are involved in the differential regulation processes and selectively activate or repress target genes. Transcription factors interact with the DNA elements and with each other and prevent or bring about the recruitment of RNA polymerases and other associated factors (Ptashne and Gann, 1997). Chromatin remodelling enzymes and factors involved in RNA splicing may so be recruited by transcription factors (Hertel et al., 1997; Peterson 2 and Logie, 2000). The transcription factors often form multimeric complexes with each other and the DNA (Chen, 1999). A single transcription factor can regulate more than one set of genes by interacting with different combinations of transcription factors. These multiple interactions allow for thousands of possible regulatory networks to be established. In the study of plant development, Arabidopsis thaliana is a useful genetic tool owing to its small size, short reproductive cycle and low complexity of the genome (Meinke et al., 1998). Sequencing the Arabidopsis genome (Arabidopsis Genome Initiative, 2000) has revealed that there are 26,751 protein coding genes and 838 non-coding RNA genes (TAIR6, unpublished records available at the website: http://Arabidopsis.org/portals/genAnnotation/gene_structural_annotation/ annotation_data.jsp). An estimated 1968 of these genes are transcription factors (lida et al., 2005). Mutant analyses of many of these factors have revealed that they have important roles in plant development. This thesis focuses on the phenotypic characterization of two such transcription factors, SAW1 and SAW2, both of which belong to the BEL1 family of homeodomain (BLH) transcription factors. The loss of SAWTOOTH function in the plant affects the leaf morphogenesis and the gain of function of SAW1 results in plants with reduced growth. In this chapter of the thesis, I will review the current knowledge of shoot development and homeodomain proteins in plants, as it is relevant to understanding many aspects of this thesis. I will end this chapter by presenting my research goals and thesis objectives. 3 1.1. Vegetative shoot development Embryogenesis in mammals and a majority of other animals (with certain exceptions such as insects and reptiles which undergo metamorphosis) results in an individual with almost the full complement of organs as an adult organism. The rest of the development is mainly growth and acquisition of reproductive capability. In higher plants however, the seed, which is the product of embryogenesis, germinates to form to a seedling, which has a very simplified structure consisting of two cotyledons surrounding the apical meristem, a radicle or seedling root, and a hypocotyl that connects the apex to the root. The full complexity of a mature plant is achieved by the capacity of certain cells in regions called meristems to generate different organs and tissues in response to various endogenous and environmental signals. The term meristem is from a Greek word for divided or divisible and was coined by the Swiss botanist Carl Willhelm von Nageli to distinguish between regions contributing to organogenesis from those involved in secondary or cambial growth (Scofield and Murray, 2006b). Plant organs are initiated from two major meristematic regions: the root apical meristem which gives rise to the root system and the shoot apical meristem (SAM) from which leaves, stem and flowers are formed. Development of lateral organs such as leaves is closely tied with meristem function and its maintenance. Crosstalk between lateral organ identity genes and meristem identity/function genes enables the differentiation of lateral organs without compromising meristematic function. Many of the growth and differentiation programs of leaves are established at the same time as leaf initiation. Leaves are dorsiventrally flattened structures that exhibit asymmetric growth along adaxial-abaxial and proximal-distal axes (Figure 1.1). The leaves have evolved an asymmetric distribution of cells along the adaxial-abaxial axis as it allows better gas exchange and light harvesting. Leaves have a petiole in the proximal end and a blade on the distal end. Elongated petioles are observed when Arabidopsis plants are subjected to low light conditions, indicating that the petioles might be involved in shade avoidance and possibly in orienting the leaf blade towards a light source (Tsukaya, 2005) The shoot apical meristem in Arabidopsis initially generates leaves but undergoes a transition to produce flowers during the reproductive phase. Light, availability of nutrients and many other environmental factors affect the meristematic 4 potential. However, it is the endogenous factors that interpret these environmental situations and elicit the required functions. Mutant screens for defects in organogenesis and meristem function have identified many of the genes that are involved in controlling meristem activity and organ development. The individual phenotypes of these mutants and the study of their genetic interactions with each other have allowed us to explore various interdependent steps involved in shoot development. Figure 1 . 1 Scanning electron micrograph of a shoot apex. Leaves originating from the shoot apical meristem have an adaxial-abaxial polarity that is determined collectively by factors from the SAM and the developing leaf. The leaf differentiates in a proximal distal axis to develop a petiole and a blade respectively. The leaf growth in the medial - lateral axis gives the leaf its dorsiventrally flattened shape. SAM function and leaf initiation as well as leaf development will be discussed in this literature review. (From: Byrne, 2005) Two major questions are addressed in this section of the literature review. The first question is how the shoot apical meristem is capable of continuously generating lateral organs without losing its identity. The second question is how a leaf achieves its mature form after being initiated from the meristem. 5 1.1.1. Structure of the shoot apical meristem The shoot apical meristem (SAM) contains a small population of cells that are maintained in an undifferentiated state. The meristematic cells are kept undifferentiated indefinitely in the main shoots of plants such as Arabidopsis and Antirrhinum that have an indeterminate primary axis. These cells are pluripotent and have the capacity to form various tissues and organs. During the vegetative phase, the Arabidopsis SAM initiates radially arranged (rosette) leaves and later on, the same meristematic cells generate flowers. This type of organ initiation is referred to as monopodial growth (Schmitz and Theres, 1999). Shoot apical meristems of dicots like Arabidopsis are made of three layers of cells: L1, L2 and L3 (Steeves and Sussex, 1989). The L1 and L2 layers are also referred to as the tunica and the L3 layer is the corpus (Schmidt, 1924). Both L1 and L2 are single celled layers and remain clonally distinct as only anticlinal (perpendicular to the adjacent layer) cell divisions occur in tunica layers (Satina et al., 1940). Anticlinal, periclinal as well as some irregular divisions occur in the L3 layer. The cell divisions in the L1 layer give rise to the epidermis of the lateral organs. Mesophyll precursors and the germ cells of the male and female gametophytes are derived from the L2 layer (Fletcher, 2002). The L3 layer is involved in production of the vasculature (Doerner, 2000). In addition to the layered arrangement, three radial functional domains can be identified in the SAM: the central zone, the peripheral zone and the rib zone (Figure 1.2). The peripheral region produces lateral organs such as leaves and flowers. The rib zone or the basal region is required for the production of the plant stem (Bowman and Eshed, 2000). The central zone hosts the slowly dividing pluripotent stem cells which constantly supply undifferentiated cells to the peripheral regions for organogenesis (Steeves and Sussex, 1989). 6 Figure 1.2 Organization of the shoot apical meristem Medial longitudinal section through the shoot apex showing the shoot apical meristem and the initiating leaves. The sections have been artificially coloured to depict the different structural and functional regions, (a) The three different functional zones in the S A M . C Z = Central zone; PZ= Proximal zone; RZ = Rib zone. The darker region in the right P Z is leaf anlagen, a group of cells destined to become leaf primordia. An already initiated and developing leaf is visible mid left (shaded brown), (b) The three cell layers L1, L2 and L3 that form the tunica (L1 and L2) and the corpus (L3) of the lateral organs. (From Bowman and Eshed, 2000. Copyright (2000), Elsevier Ltd. Reprinted with permission from Elsevier) 1.1.2. Establishment of the shoot apical meristem The shoot and root (apical and basal) polarity is established in the first cell division of embryogenesis (Mansfield and Briarty, 1991). Several mutant analyses have shown that the plant hormone auxin is required for establishment of this apical-basal polarity. Three embryo patterning mutants: monopteros (mp), bodenlos (bdl) and gnom (gn) (Berleth and Jurgens, 1993; Hamann et al., 1999; Mayer et al., 1993) fail to initiate basal structures. MP, BDL and GNOM proteins have been found to be components of the auxin response and transport and therefore are required to facilitate auxin-mediated cellular differentiations (Busch et al., 1996; Hamann et al., 2002; Hardtke and Berleth, 1998). Friml and co-workers (Friml et al., 2003) have demonstrated that the apical-basal polarity in the embryo is established by differential distribution of auxin during embryogenesis (Figure 1.3). In contrast to the phenotypes of mp, bdl and gn, the topless (tpl) mutant exhibits conversion of the apical region into roots (Long et al., 2002). During the transition stages from the 32-celled globular 7 embryo to the heart stage embryo, the protein TOPLESS (TPL) prevents the root identity genes from being expressed in the top half of the embryo and therefore is required for maintaining the apical identity (Long et al., 2006). Ovule First c 2-cell d 32-cdl 0 S « i l « g dhrtsion pro&rnbryo glotatiar embryo Figure 1.3 Auxin distribution and the establishment of apical basal polarity during embryogenesis (a) The egg cell is found hosted in the ovule of the plant, (b) After fertilization, there is an unequal cell division which results in a larger basal cell and a smaller apical cell. According to Friml and coworkers, 2003, the basal cell starts producing auxin and PIN-FORMED (PIN) proteins mediate the auxin efflux (moving out) from the basal cell to the apical cell, thereby establishing a gradient, (c) The movement of auxin correlates with the horizontal division of the basal cell and the vertical division of the apical cell that forms the 2-celled proembryo. (d) The direction of auxin efflux is reversed around the 32-cell stage and this is required for establishment of the hypophysis that eventually forms the root system in the seedling. (From Kepinski and Leyser, 2003. Reprinted with permission from Macmillan Publishers Ltd. Copyright (2003). Although a distinct SAM structure is seen only in a heart- stage embryo, markers of SAM identity and function, SHOOTMERISTEMLESS (STM) and WUSCHEL (WUS) can be detected in the apex as early as the 16-cell stage of embryogenesis (Long et al., 2002; Mayer et al., 1998). This shows that a framework for constructing the SAM is laid out in early embryogenesis. Figure 1.4 shows the embryo localization of various proteins that are known to function in root and leaf development, and in maintenance and function of the shoot apical meristem (Jurgens, 2001). The fact that these proteins are expressed even during embryo development shows that the positioning of these proteins is crucial not only for the functioning of these regions, but also for establishing and maintaining the structural identity of these regions. This idea is further supported 8 by the observation of embryo defects in mutants of various genes involved in leaf development and meristem function. i 1 AIML1 I 1 STM C D REV f-~) ASLANT.REV O SCR f P \ M S . M \ I (gp Cl.VJ. STM f~1 ASI. ANT. HI.. VAB3 O SHR. ZI.IJPMI C D ANT. ASI. HI. (H§C«.VI.STM 1 WL.YAM Figure 1.4 Establishment of the shoot apical meristem during embryogenesis. A, B and C are globular, transition-stage and heart stage embryos respectively. Only the apical half of the heart stage embryo is shown. Colour coding is used to show the expression of each gene or genes (refer to the colour code). SHOOTMERISTEMLESS (STM) and WUSCHEL (WUS) are genes that govern meristem identity and function and are present in the central region of the developing meristem. WUS expression is restricted in the heart stage embryo to a few cells in the central zone by the action of CLAVATA proteins CLV3 and CLV1. REVOLUTA (REV) is an adaxial identity gene is required foe establishment of meristem. It is also seen in the adaxial side of the cotyledon primordia. YABBY3 (YAB3) and FILAMENTOUS FLOWER (FIL) are abaxial identity genes that are expressed in the abaxial side of cotyledon primordia where they are specifying abaxial fates. Lateral organ specific genes, AINTEGUMENTA (ANT) and ASYMMERTIC LEAVES 1 (AS1) are also established during embryogenesis in cells destined to make the cotyledons. Early expression of lateral organ identity genes ensures that the meristem gene STM can be turned off in the regions making the cotyledon. The genes SHORTROOT (SHR) and SCARECROW (SCR) are involved in establishment of root apical meristem. (From: Jurgens, 2001. Reprinted with permission from Macmillan Publishers Ltd. Copyright (2001). Additional shoot meristems, axillary meristems, are initiated on the adaxial side of leaf bases. Their presence can be used as a marker of adaxial cell identity. Axillary meristems are formed in all directions at the base of leaves of dominant mutants of phabulosa (phb) that exhibits adaxialized, filamentous leaves (McConnell and Barton, 1998). Loss-of-function mutants of REVOLUTA (REV), a gene similar to phabulosa, lack axillary meristems at the base of leaves which exhibit a partial loss of adaxial identity (Talbert et al., 1995). Both REV and PHV genes are expressed in the embryonic meristem and rev mutants show reduced meristem function (McConnell et al., 2001; Sussex, 1955; Talbert et al., 1995). Triple mutants which lack PHV, REV and 9 the related protein PHABULOSA (PHB) fail to make a SAM and have abaxialised cotyledons (Emery et al., 2003). These data collectively indicate that adaxial cell fate is required for establishment of SAM and the overlapping functions of PHV, PHB and REV contribute to the adaxial cell identity in the developing embryo. 1.1.3. Maintenance of shoot apical meristem identity and function Three sets of factors are at work in governing SAM function. The first includes factors that ensure replenishment of cells used up during organogenesis and for maintaining stem cell potential (Scofield and Murray, 2006a). A second set of factors maintain meristem identity by preventing differentiation of the whole meristem into a lateral organ. Finally, there are factors that allow lateral organ primordia to be established by utilizing cells from the proximal zone of the meristem. Meristem function is the product of combined actions of all these factors. The stem cells in the central zone are always in homeostasis. In other words, the same numbers of cells are maintained by replacing the cells utilized for organogenesis by newly synthesized cells. The transcription factor WUSCHEL (WUS) plays an important role in maintaining stem cell homeostasis. WUS is expressed in few cells in the L3 (tunica) layer of the central zone that are collectively called the organizing centre (Haecker et al., 2004; Mayer et al., 1998). The expression of WUS is regulated by the action of a chromatin remodelling ATPase called SPLAYED (Kwon et al., 2005). Loss of WUS function results in a severely reduced number of cells in the central zone which results in sporadic initiation of lateral organs and an altered phyllotaxy (Laux et al., 1996). The stem cells in a wuschel mutant often differentiate without producing lateral organs. This indicates that WUS is required for specification of stem cell identity in all the central zone cells (Laux et al., 1996). WUSCHEL expression is restricted to the organizing centre (OC) by a feedback regulatory loop involving the CLAVATA proteins (Figure 1.5., Brand et al., 2000; Schoof et al., 2000). Loss of function of any of the three CLAVATA genes results in enlarged meristems due to an increased number of cells; these enlarged meristems produce more lateral organs than found in the WT (Clark et al., 1993; Clark et al., 1995; Kayes and Clark, 1998). WUS is expressed in a broader domain in the clavata mutants than in WT plants, indicating the importance of CLAVATA proteins in regulating the activity of WUS. The three CLAVATA proteins 10 CLV1, CLV2 and CLV3 are components of a signal transduction pathway that represses WUS expression in the cells overlying the OC (Brand et al., 2000; Schoof et al., 2000). Although various experiments indicate that CLV3 activation requires expression of WUS (reviewed in Brand et al., 2002), it is still not clear how the signal from WUS (which is expressed in the OC) reaches the T1 layer where CLV3 is expressed. A recent study indicates that the plant hormone cytokinin might be involved in WUS mediated activation of CLV3 (Figure 1.5., Leibfried et al., 2005). CLV3 moves out of the T1 layer and acts as a ligand for the membrane bound LRR (Leucine rich repeat) receptor kinase CLV1 which is found bound to another LRR receptor kinase, CLV2 (Clark et al., 1997; Jeong et al., 1999; Lenhard and Laux, 2003; Trotochaud et al., 2000). The binding induces a signalling cascade that is probably involved in the repression of WUS expression (Trotochaud et al., 1999). Figure 1.5 Maintenance of stem cell homestasis in SAM. The coloured region is the central zone of the SAM. L1, L2 and L3 are the three SAM layers that form the tunica (L1 and L2) and corpus (L3). Green arrows indicate activation pathways and red lines indicate inhibitory pathways. The stem cell homeostasis is maintained by means of an autoregulatory pathway. WUSCHEL (WUS) is expressed in the organizing centre (OC, shaded pink) When the amount of stem cells decreases by being utilized for organogenesis, WUS expression domain transiently increases and inhibits ARABIDOPSIS RESPONSE REGULATORS (ARRs). ARR inhibition probably derepresses synthesis of Cytokinins (CK). The cytokinins induce cell division in the stem cells. The stem cell division activates CLAVATA3 (CLV3), which then moves to the L2/L3 layers and binds to the CLV1/CLV2 complex, starting a signaling cascade that results in inhibition of WUS expression in the stem cell layers. . WUS expression in the OC requires the protein SPLAYED (SYD). HANABA TARANU (HAN) is also involved in restricting WUS expression to the OC in a CLV independent pathway (Zhao et al., 2004). (Model based on:Doerner, 2006; Leibfried et al., 2005; adapted from: Williams and Fletcher, 2005) 11 While WUSCHEL and CLAVATA proteins are required to regulate meristem size, the Class 1 KNOX transcription factor protein SHOOTMERISTEMLESS and its orthologs KNOTTED1 in maize and LeT6 in tomato are required for maintaining meristem identity (Kessler and Sinha, 2004; Long et al., 1996). Strong stm mutant seedlings exhibit fusion of cotyledons at their base and lack an organized SAM, making them incapable of producing lateral organs (Barton and Poethig, 1993). The lack of a meristem becomes obvious during embryogenesis itself, indicating that the STM function is required even during formation of the SAM (Long et al., 1996). Weaker stm mutants such as stm-2 irregularly initiate lateral organs and even the stem cells in central zone are consumed during this organogenesis (Clark et al., 1996). Therefore STM is required for both SAM formation and for meristem identity. STM is expressed in both central and peripheral regions of the SAM, but is excluded from the leaf anlagen (a group of founder cells at the site of initiation) and primordia (Figure 1.6, Long et al., 1996; Long and Barton, 1998). BREVIPEDICELLUS (BP), another KNOX protein similar to STM, is also expressed in the peripheral zone and in the rib zone of the SAM and is excluded from the leaf primordia (Lincoln et al., 1994). STM maintains the meristem cells in an undifferentiated state by repressing the function of ASYMMETRIC LEAVES 1 (AS1), a myb domain containing transcription factor that is required for normal leaf development (Byrne et al., 2000). In turn, AS1 suppresses the expression of STM and the related KNOX genes BP, KNAT2 and KNAT6 in the leaves (Ori et al., 2000; Semiarti et al., 2001). The Stm phenotype is suppressed in as1 stm double mutants, indicating that STM maintains meristem identity in part by suppressing lateral organ genes such as AS1 (Byrne et al., 2000). Genetic analysis has also revealed that BP is involved in the rescue of the meristem defect in the as1 stm double mutant. A bp as1 stm triple mutant is not able to rescue the Stm phenotype (Byrne et al., 2002) indicating that BP is required to maintain meristem identity in an as1 stm background. Loss of KNAT6 function also enhances a weak stm phenotype indicating that a functionally redundant mechanism exists to prevent loss of meristem identity (Belles-Boix etal., 2006). 12 | PHAB+PNH PHAB+PNH +AS1 PHAB P2 :, YAB+AS1 \ PHAB+PNH W +YAB+AS1 AS1 YAB Figure 1.6 Maintenance of meristem identity. The Class 1 knox protein S T M is expressed in the S A M but excluded from the leaf primordia. AS1, PHAB, PNH and YAB are genes involved in governing the adaxial-abaxial cell fates of the developing leaf (PHAB and PNH are required for adaxial identity and Y A B genes maintain abaxial identity). STM maintains meristem identity in part by preventing AS1 and YAB from functioning or being expressed in the S A M . In turn, Y A B and AS1 are maintain lateral organ identity by suppressing the expression/function of knox genes STM, BP and KNAT2. (From: Veit, 2004. Copyright (2004), Elsevier Ltd. Reprinted with permission from Elsevier) 1.1.4. Initiation of lateral organs: When and where are leaves initiated? The pattern of arrangement of lateral organs around the primary axis is called phyllotaxy. Lateral organs in Arabidopsis are initiated in distinct geometric arrangements and in very predictable manner. In Arabidopsis and other plants where the leaves and flowers exhibit a spiral arrangement, the angle of divergence between two adjacent leaves is approximately 137.5° (Steeves and Sussex, 1989) and are characterized by the Fibonacci numbers (reviewed in: Mitchison, 1977). Maintaining phyllotaxy requires that the lateral organs be initiated at regular intervals. Various surgical experiments have demonstrated that the removal of leaf primordia from the shoot apex or destruction of a lateral organ anlagen (founder cells) shifts the next primordia towards the incision point (reviewed in Steeves and Sussex, 1989). This 13 indicates that there may be lateral organ-derived signals that contribute to specification of the position of the next leaf primordia and hence regulate phyllotaxy. Another contributing factor might be the availability of meristematic cells to initiate an organ. New cells have to be created for replacement of the cells recruited during the prior organogenesis. Perhaps there is a threshold level of cells that have to be positioned in the peripheral zone to trigger the initiation of lateral organ primordia. In support of this hypothesis, clavata mutants exhibit an increased stem cell proliferation and also in increase in the number of lateral organs initiated (Clark et al., 1993; Clark et al., 1995; Kayes and Clark, 1998). Live cell imaging experiments have shown that the cells in the central zone take 36-72 hours to double in number whereas the cells involved in lateral organ initiation divide faster (18-36 hours, Reddy et al., 2004). Therefore the supply of cells from the central zone might be one of the factors governing the timing of lateral organ initiation and therefore, phyllotaxy. The plant hormone auxin is also one of the key players in coordinating leaf initiation. Treatment of the leaf apex with chemical inhibitors of auxins have shown to retard leaf initiation and exogenous application of auxins on the meristem cause early initiation of leaves, indicating that auxin might be the trigger for leaf initiation (Okada et al., 1991; Reinhardt et al., 2000; Reinhardt et al., 2003). By studying the distribution of the auxin efflux protein PINFORMED 1 (PIN1) in the meristems of wild-type and organ formation mutants such as monopteros and pinoid, Reinhardt and coworkers (Reinhardt et al., 2003) have established the mechanism by which auxin controls leaf initiation and phyllotaxy. Auxin moves radially upwards from the basal parts to the shoot apex via the epidermis and the outer cells of the meristem. At the meristem tip, if the auxin flow encounters lateral organ primordia, then auxin flows into them, thereby preventing further movement of auxin towards the center of the meristem. The auxin flow that does not encounter a lateral organ primordia reaches the meristem tip, on which side the founder cells are established (Reinhardt et al., 2003). Many developmental genes are either activated or repressed at different stages of leaf initiation ( 14 Figure 1.7). The KNAT (KNOX) genes required for meristem identity and function are turned off during the establishment of the founder cells by the lateral organ specific proteins such as ASYMMETRIC LEAVES ! At the same time, auxin efflux proteins such as PIN1 (PINFORMED 1) and auxin efflux proteins such as AUX1 are expressed. These processes occur in pre-founder cells where organ differentiation/ programming events have not yet been specified (Carraro et al., 2006). Various organ identity and organ polarity genes begin to be expressed in the founder cells (organ primordia). LEAFY is expressed in the floral primordia and where it specifies floral identity (Schultz and Haughn, 1991; Weigel et al., 1992). AINTEGUMENTA is also expressed in the founder cells where it promotes outgrowth of the organ primordia (Elliott et al., 1996). The CUP-SHAPED COTYLEDON (CUC) genes as well as their regulator PINOID (PID) are expressed in the organ primordia and are required to specify the organ boundary (Furutani et al., 2004). PIN1 is required for expression of LFY, ANT and CUC in the founder cells (Vernoux et al., 2000), indicating that auxin might play a role in inducing these genes. The organ polarity is established by the action of adaxial identity genes PHABULOSA (PHB), PHAVOLUTA (PHV) and REVOLUTA (REV) and abaxial identity specifying YABBY and KANADI genes. The expression of these genes quickly resolves to adaxial and abaxial ends of the developing organ primordia and dorsiventrality is established at the adaxial-abaxial boundary. Figure removed due to copyright restrictions. The figure description is given below and is the figure 1 of the cited reference. Figure 1.7 Gene expression changes observed during different stages of organ initiation. Initation of lateral organs occurs in three phases. The first involves the establishment of a region for organ formation (Pre-founder cells or anlagen). This is achieved by the action of the plant hormone auxin and requires the auxin efflux protein PIN1 and auxin influx protein AUX1 that are expressed in these cells. The second phase (Founder cells/ organ primordia) involves the suppression of meristem identity genes and the establishment of organ identity. The third phase (Outgrowth/Polarity) involves the establishment of organ polarity, dorsiventrality and expansion/outgrowth of the newly formed organ. (From: Carrara et al., 2006) 16 1.1.5. Adaxial-abaxial identity in leaves In Arabidopsis leaves (Columbia ecotype), the first four initiated leaves (referred to as juvenile leaves) lack trichomes or epidermal hairs on the abaxial side (Telfer et al., 1997) but have trichomes on the adaxial side. Also, the leaves are darker green in colour in the adaxial side than on the abaxial side. Within the leaves, the mesophyll layer on the adaxial side is made of tightly packed palisade (columnar) cells that have abundant chloroplasts whereas the abaxial side mesophyll cells consist of the loosely packed spongy cells. The adaxial surface also has fewer stomata than the abaxial surface (Xu et al., 2003). The vascular tissue in Arabidopsis leaves (Columbia ecotype) also exhibits adaxial-abaxial polarity in which the xylem tissue involved in water and mineral transport is always positioned to the adaxial side of the phloem that transports sugars and other metabolites (Bowman, 2000). The adaxial-abaxial polarity is advantageous to the plants as the two sides have specialized functions: the adaxial side which faces the sun is mainly involved in photosynthesis and phloem loading and the abaxial tissue is mainly involved in gas exchange. Wardlaw in 1949 had reported that inhibitory signals coming from the SAM retard growth on the adaxial side of a developing leaf and dissimilar growth leads to dorsiventrality (Steeves and Sussex, 1989). Many experiments have shown that in the absence of SAM-derived signals, the default pathway leads to abaxialised organs, indicating that the abaxial fate is the default for differentiating cells. A leaf anlagen that is surgically separated from the SAM differentiates into a radially symmetric abaxialised structure instead of achieving a dorsiventrally flattened shape (Sussex, 1955, reviewed in Steeves and Sussex, 1989). This indicates that factors derived from the SAM contribute to the establishment of adaxial-abaxial polarity in lateral organs. However, leaf primordia surgically separated from the meristem differentiate into radial structures but soon attain dorsiventral symmetry (Steeves, 1962, reviewed in Steeves and Sussex, 1989). This indicates that factors within the leaf primordia are sufficient to attain adaxial-abaxial polarity. From these experiments, we can conclude that the adaxial-abaxial identity of leaves is established during the phase between formation of the leaf anlagen and differentiation of the leaf primordia. Initial cell fate depends on some SAM derived factors but later on the leaf primordia is self-sufficient in regulating differentiation. 17 Multiple genes are involved in specifying leaf polarity. The first gene to be found to be involved in leaf polarity was the Antirrhinum (Snapdragon) gene PHANTASTICA (PHAN). Phan mutants have abaxialised radially symmetric leaves instead of dorsiventrality flattened leaves (Waites and Hudson, 1995). Dorsiventral projections were observed when temperature sensitive alleles were grown in permissive conditions, indicating that both adaxial and abaxial regions (and probably signalling between these regions) were required to attain a dorsiventral symmetry (Waites and Hudson, 1995). The phan mutant therefore develops radially symmetric organs as there is an absence of adaxial signals, as was observed in the surgical experiments described earlier. PHANTASTICA is a MYB-domain containing transcription factor (Waites et al., 1998) whose ortholog in Arabidopsis is ASYMMETRIC LEAVES 1 (Byrne et al., 2000). As1 mutants have distorted leaves, with the severe alleles having radial petioles and lotus-shaped leaves (Sun et al., 2002). Loss of function mutants of ASYMMETRIC LEAVES 2 (AS2) also exhibit similar leaf phenotypes (Ori et al., 2000; Semiarti et al., 2001; Serrano-Cartagena et al., 1999). AS2 gene was cloned and found to be a leucine zipper protein (Iwakawa et al., 2002). The similar phenotypes of as1 and as2 indicate that the two proteins might be functioning in a common pathway (Lin et al., 2003; Xu et al., 2003). Unlike the Antirrhinum phan mutant, the Arabidopsis as1 mutant does not exhibit any severe adaxial-abaxial polarity defects. In Arabidopsis, it is the members of YAB BY and KANADI gene families that specify abaxial fates (Eshed et al., 1999; Eshed et al., 2001; Kerstetter et al., 2001; Sawa et al., 1999; Siegfried et al., 1999; Villanueva et al., 1999). Gain of function of members of the YABBY gene family results in abaxial tissues developing on the adaxial side (Sawa et al., 1999; Siegfried et al., 1999) (Eshed et al., 1999). Both KANADI and YABBY family members exhibit functional redundancy, making it hard to find a complete loss of function phenotype. Triple mutants that lacked three of the KANADI genes showed almost complete adaxialization of leaves giving them a nearly radially symmetrical shape (Eshed et al., 2004). Quaternary mutants including mutants of both YABBY and KANADI families exhibited an even more severe adaxialization (Eshed et al., 2004) confirming that YABBY and KANADI proteins are required to maintain abaxial fate in leaf development. Several genes involved in adaxial identity in lateral organs have also been identified in Arabidopsis. These are the Arabidopsis homeodomain-zipper III (HD-ZIP 18 III) class of transcription factors, PHABULOSA (PHB) AND PHAVOLUTA (PHV) and the related protein REVOLUTA (REV) (McConnell et al., 2001; Talbert et al., 1995). They are expressed in the adaxial side of the leaves (Figure 1.8., McConnell et al., 2001; Otsuga et al., 2001) where they specify adaxial cell fates. Semidominant mutants of phabulosa (phb-1d) and phavoluta (phv-1d) have adaxialized lateral organs that are filamentous and radially symmetrical (McConnell and Barton, 1998). In these dominant phb-1d and phv-1d mutants, PHV and PHB expression extends to the abaxial side of the developing lateral organ. This abaxial expression of PHB and PHV in the dominant mutants probably programs the abaxial side of the organ to accept an adaxial identity (McConnell et al., 2001). The phb-1d, phv-1d, and a rev dominant mutations map to a domain of the protein that is similar to mammalian sterol/lipid binding (START) domains (McConnell et al., 2001; Ponting and Aravind, 1999). The presence of this domain in these genes led to the speculation that a sterol-like ligand might be able to bind to the sterol/lipid binding domain and activate/repress PHB/PHV/REV protein function. However, another mechanism involving non-coding regulatory RNA molecules called micro RNAs (miRNAs) has now been found to be the more likely means of regulation of PHB/PHV/REV. MiRNAs are widespread in the Arabidopsis genome and regulate gene expression through post transcriptional gene silencing caused by mRNA degradation or repression of translation (Bartel, 2004). They can also cause transcriptional repression by inducing methylation of the target gene (Bao et al., 2004a; Jover-Gil et al., 2005). Two micro RNAs (miRNAs), miRNA 165/166 have sequences complementary to the START domain of PHS-like genes, indicating that the PHS-like genes might be targets for miRNA mediated regulation in the abaxial side of lateral organs (Rhoades et al., 2002). This hypothesis is supported by studies showing that miRNA 165/166 can cause degradation of PHB-like genes in vitro (Mallory et al., 2004; Tang et al., 2003). Interestingly, PHB mRNA is not degraded in the phb-1d allele (Tang et al., 2003). Since all mutations identified in the dominant phb-1d and phv-1d mutants were mapped to the START domains (McConnell et al., 2001), the mutations might be causing mismatches that prevent the micro RNAs from binding efficiently to the mRNA and targeting the mutant genes for degradation. Thus the adaxialization phenotype of phv-ld and pho-1d could be attributed to a lack of miRNA 165/166 mediated regulation. 19 3 j t>JXtti! i xylem Ofess MIND-Zip K A N A D r Figure 1.8 Distribution of adaxial-abaxial identity factors in the shoot apex. Adaxial side is shown by the black line and the abaxial side is shaded grey. In the wild-type Arabidopsis leaf, xylem (x) is always positioned adaxial to the phloem tissue (p). Class III HD-ZIP genes, REVOLUTA, PHAVOLUTA and PHABULOSA that specify adaxial fate are expressed in the adaxial side of the developing leaf, and in the SAM, maintenance of adaxial fate is necessary for S A M function. The expression of HD-ZIP genes is downregulated in the abaxial side of the leaf by micro RNAs 165/166, which are in turn, expressed in the abaxial side of the leaves(Kidner and Martienssen, 2004). It is not clear if the miRNA 165 is expressed in the lateral organ anlage. However, high accumulation of miRNAs at the base of the leaf primordia (*), prior to the expression in theleaf primordia leads to the speculation that the miRNA molecules might be moving up the adaxial side of the leaf rather than being expressed there (Juarez et al., 2004). Genes belonging to the YABBY and KANADI families are expressed in the lateral organ anlage as well as the abaxial side of the developing lateral organs where they specify abaxial cell fates (Eshed et al., 2004). (From: Bowman, 2004. Reprinted with permission of Wiley-Liss Inc. a subsidiary of John Wiley & Sons, Inc. Copyright (2004)) 1.1.6. Leaf development in the proximodistal and mediolateral axis Arabidopsis rosette leaves can be morphologically divided along the proximal distal axis into a blade and a petiole. The blade is the dorsiventrally flattened and expanded part of the leaf (leaf blade) and is the main centre for photosynthesis and gas exchange. The petiole is a narrow, almost radial structure and is involved in shade avoidance and in orienting the leaves for optimal light capture (Tsukaya et al., 2002). Arabidopsis rosette leaves exhibit heteroblasty, where the first 2-4 leaves (juvenile leaves) are of a different shape than the other rosette leaves (Tsukaya et al., 2000). 20 The adult leaves in Arabidopsis Columbia ecotype are larger, with elliptical leaf blades and show trichomes (glandular epidermal hairs) on the adaxial as well as abaxial surfaces, whereas juvenile leaves have trichomes only on their adaxial surfaces (Telfer et al., 1997). After initiation, all leaves have to grow and differentiate along both lengthwise (proxiodistal) and width-wise (mediolateral) axes to acquire their final shapes. 1.1.6.1. Factors controlling blade growth Unlike the shoot apical meristem, Arabidopsis leaves are determinate organs that stop growing after a certain time period. As previously mentioned, the establishment of adaxial-abaxial polarity is essential for subsequent growth of leaves into dorsiventrally flattened structures. After the formation of the leaf primordium, leaf growth initially proceeds through marginal cell division by means of short lived marginal meristems, but quickly progresses towards cell division throughout the leaf primordium by means of plate meristems (Figure 1.9, Donnelly et al., 1999). Later an arrest front is established which moves from the leaf tip to the base, arresting cell divisions along its way, thus allowing for cell expansion and differentiation (Donnelly et al., 1999). However, dispersed meristemoids continue cell division to establish stomatal and vascular cells (Donnelly et al., 1999; Larkin et al., 1997) indicating that growth (cell division and expansion) and differentiation occur side by side during leaf development. A number of genes involved in controlling leaf growth have been identified. The cincinnata (cin) mutant of Antirrhinum has large leaves with crinkled blades and negative curvature due to increased growth in the leaf margins compared to the central regions (Nath et al., 2003). The differential growth has been attributed to an altered progression of the arrest front which allows more marginal cell division than central cell division (Nath et al., 2003). CIN is a member of the TCP (named after maize Teosinte branched, Antirrhinum protein Cycloidea, and rice PCC proteins) family of transcription factors that participate in various developmental events and are found in many plant species, including Arabidopsis (Cubas et al., 1999). Palatnik and coworkers found that the Arabidopsis TCP4, the ortholog of the Antirrhinum CIN protein, was developmental^ regulated by the activity of the JAW1 micro RNA. Overexpression of the JAW1 miRNA resulted in cin like phenotypes by interfering with TCP4 function 21 (Palatnik et al., 2003). This indicates that TCP-regulated leaf growth might be a conserved mechanism amongst higher plants. Figure removed due to copyright restrictions. The figure description is given below and is the figure 1 of the cited reference. Figure 1.9 Leaf blade development Marginal meristems (M) and plate meristems (p) cause cell divisions (dots represent cell proliferation) in the leaf primordia, increasing the length and width of leaf blades. Later, an arrest front develops and gradually moves towards the base of the leaf, stopping most of the cell divisions and making way for cell expansion and differentiation events. (From: Tsukaya, 2005) PEAPOD is another gene that affects leaf shape by regulating the second arrest front that controls division in the meristemoid cells (White, 2006). Like the cin mutants, peapod mutants have increased leaf curvature; however, their negative curvature is due to increased blade, rather than margin, growth (White, 2006). In Arabidopsis leaves, several different factors are involved in maintaining the ratio of the leaf length to the leaf width, referred to as the leaf index (Tsukaya, 2002). Angustifolia (An) and Rotundifolia (Rot) mutants show defects in cell division and cell elongation. An3 mutants have narrow leaves and have fewer cells due to decreased plate meristem activity, indicating that AN3 is required for cell proliferation along both the proximodistal and the mediolateral axis (Horiguchi et al., 2005). Rot4 mutants however, show a decrease in cell numbers mainly in the proximodistal axis (Narita et al., 2004). Both An3 and Rot4 mutants have reduced cell numbers, but their cell sizes remain largely unchanged. In contrast, an and rot3 mutants show decreases in cell 22 size along the mediolateral and the proximodistal axis respectively, without affecting the cell numbers (Kim et al., 2002; Tsuge et al., 1996). 1.1.6.2. Factors affecting petiole development As noted earlier, the leaf can be divided into a proximal petiole and a distal blade. Petioles are present in all of the rosette leaves of Arabidopsis, but are absent from the cauline (inflorescence) leaves. The petiole is probably established by the suppression of blade formation in the proximal half of the developing leaf primordium. LEAFY PETIOLE (LEP), an AP2-like transcription factor identified by activation tagging, induces formation of leaf-like structures from the petiole when it is overexpressed (van der Graaff et al., 2000). The leaves of lep mutants, however, do not show a phenotype. Petioles with blade-like outgrowths are also seen in loss of function mutants of the BLADE-ON-PETIOLE genes BOP1 and BOP2 and in dominant negative bop1 lines (Ha et.al., 2003; Ha et al., 2004; Hepworth et al., 2005; Norberg et al., 2005). The functionally redundant BOP1 and BOP2 proteins maintain the petiole identity by preventing meristem-specific Classl KNOX proteins from being expressed in the petiole, as well as by preventing differentiation of the petiole into dorsiventrally flattened blade-like structures (Ha et al., 2003; Ha et al., 2004; Hepworth et al., 2005). Overexpression of Arabidopsis JAGGED gene, a zinc finger-containing putative transcriptional repressor also caused petioles to acquire blade-like features (Ohno et al., 2004). JAG is only expressed in the blade of wild-type leaves (Ohno et al., 2004). Interestingly, JAG is also expressed in the petioles of the bop1 bop2 double mutants, indicating that the BOP genes are required to restrict the domain of JAG and the related JGL (JAGGED LIKE) expression in leaves (Hepworth et al., 2005; Norberg et al., 2005). 23 1.1.7. Leaf margin development The leaf margin is one of the most important contributors to leaf shape. Figure 1.10 highlights some of the variations found in leaf shape that are determined by the type of margin. Leaves can be broadly classified as simple and compound leaves. Simple leaves have one leaf blade that is directly attached to the petiole. Their margins can be entire (smooth margins), serrate (toothed) or lobed (very deep indentations of margins reaching more than % of the distance from the margin to the midvein). In compound leaves, multiple blades (leaflets) are attached either directly to the pedicel (palmate leaf) or each of the leaflets has a petiole-like structure called a rachis which connects to the petiole (palmate leaves, Leaf Architecture Working Group, 1999). Figure 1.10 Some of the variations in leaf shapes. Simple leaves can have entire, serrated or lobed margins. Compound leaves can be pinnately or palmately compound. The pinnately compound leaves have leaflets attached to petiole extensions referred to as rachis. The palmately lobed leaves have leaflets arising from the tip of the petiole. (From: Kessler and Sinha, 2004. Copyright (2004), Elsevier Ltd. Reprinted with permission from Elsevier) 24 1.1.7.1. Advantages of having lobes, serrations and compound leaves Many lines of evidence suggest that leaves with lobed and toothed margins, as well as compound leaves, have adaptive advantages. The teeth and lobes may act as deterrents to herbivory (Brown and Lawton, 1991). Also serrated/lobed deciduous plants are better suited for colder climates as they are more efficient in photosynthesis in early leaf development and gain a competitive advantage during formation of new leaves after overwintering (BakerBrosh and Peet, 1997; Royer and Wilf, 2006). Serrations in the leaf margins might also aid in guttation by increasing the perimeter Figure 1.11). Guttation is a process by which plants extrude water and solutes when transpiration is limited, and is mediated by specialized structures present in the leaf margins called hydathodes (Candela et al., 1999). The hydathodes are connected to the vascular tissue and to a stomata-like structure present at the leaf margins (Candela et al., 1999). Hydathodes are positioned in the leaf margins at the tips of marginal teeth or serrations (Candela et al., 1999). Figure 1.11 Guttation observed in strawberry leaves. Guttation is performed by hydathodes that are positioned at the tips of serrations, where the veins meet the leaf margins. The leaf serrations increase the surface area and enable the exudates to accumulate in small spherical droplets. The low surface tension of the spherical droplets probably allows them to roll down the leaf, without hindering light harvesting. Photo taken by: Noah Elhardt (http://en.wikipedia.org/ wiki/lmage:Guttation_ne.jpg) 25 1.1.7.2. Development of leaf serrations/lobes in simple leaves The leaves of wild type Arabidopsis plants of Columbia ecotype have moderate serrations, with the number of serrations increasing with leaf number. Some of the other ecotypes such as Yo-0 and R1-0 have highly serrated leaf margins (Barth et al., 2002). This indicates that genetic variations even within a species can lead to an increase in leaf serrations. Intraspecific variations give adaptive advantages to the prevailing local environment conditions. The existence of leaf margin variations within Arabidopsis indicates that an entire or moderately serrated leaf can be changed rapidly to a highly serrated leaf, probably by just altering the expression of few genes; maybe even a single gene. Several genes have been identified in Arabidopsis that affect either the number of serrations or the depth of serrations, or both. Ectopic expression of the Class 1 KNOX genes BP, KNAT6 or KNAT2 induces moderate to severe lobing in Arabidopsis leaves (Chuck et al., 1996; Lincoln et al., 1994; Pautot et al., 2001). Ectopic meristems are seen in severe BP/KNAT1 overexpression lines on the adaxial sides of the clefts in the lobes (Chuck et al., 1996). These ectopic meristems also express the meristem function and maintenance gene STM (Chuck et al., 1996). Additionally, asymmetric leaves 1 (as1), as2 and pickle (pkl) mutants have increased leaf. serrations/lobes and show ectopic expression of several Class 1 KNOX genes: BP, KNAT2, KNAT6 and/or STM (Byrne et al., 2000; Ori et al., 2000; Semiarti et al., 2001). AS1 and Class 1 KNOX genes maintain expressions in mutually exclusive regions in WT plants, with AS1 in the lateral organs and organ primordia and the KNOX genes in the meristematic region. The function of AS2, a lateral organ boundary gene, is essential to maintain these distinct expression domains (Iwakawa et al., 2002; Lin et al., 2003). . Unlike as1 mutants where the lobe depth is increased but the number of lobes remains the same as in WT, (Tsukaya and Uchimiya, 1997), weak alleles of the serrate (se) mutant have increased serration numbers and increased depth of serrations (Groot and Meicenheimer, 2000; Tsukaya and Uchimiya, 1997). The SERRATE protein has sequence similarities to zinc finger containing proteins that regulate transcription by chromatin modification (Prigge and Wagner, 2001). However, recent evidence suggests that SERRATE might be working in the cytosol as a component of an miRNA processing machinery (Yang et al., 2006b). Serrate mutants exhibit an accelerated transition from a juvenile phase to an adult phase, thereby acquiring adult leaf 26 characteristics early (Clarke et al., 1999). Since serrations in Arabidopsis leaves increase with leaf number (Candela et al., 1999), Tsukaya and Uchimiya suggest the phase transition itself may be causing the increased leaf serrations evidenced in the se mutants (Tsukaya and Uchimiya, 1997). However, Groot and Meichenheimer show that both depth and number of serrations are significantly more in se, and that accelerated phase transition alone cannot account for the serrated phenotype (Groot and Meicenheimer, 2000). The se mutants alone don't show any misexpression of Class 1 KNOX genes; however, in an as1 mutant they show an enhanced domain of BP misexpression along with an enhancement of the as1 leaf phenotype (Oh et al., 2000). SERRATE limits the ability of the leaf tissue to respond to KNOX action by controlling the miRNA165 and 166 dependant regulation of the adaxial identity gene PHB (Grigg et al., 2005; Yang et al., 2006b) Like as1 mutants, jagged mutants of Arabidopsis show deeper leaf serrations but the number of serrations is comparable to wildtype (Dinneny et al., 2004; Ohno et al., 2004). JAGGED is a zinc finger protein containing a putative transcriptional repressor (Dinneny et al., 2004; Ohno et al., 2004). In contrast to the ectopic meristem-like qualities attained by the leaf margins in the as1 mutants, the serrations of the jagged mutant leaves has been attributed to fewer cells in the leaf blade due to a fast moving arrest front that reduces cell cycling in the mutant leaves (Dinneny et al., 2004). Cell expansion in leaf margins occurs based on the leaf blade expansion (Donnelly et al., 1999). If the leaf blade is small, either because of fewer cells or less cell expansion, there is less marginal expansion. Recent findings indicate that the meristemoid-mediated cell division involved in the establishment of vasculature and stomates is regulated by a different arrest front than the one which stops cell divisions in leaf blade (White, 2006). It could be that the timing of this second arrest front is not affected in the jagged mutants. In that case, the growth of the leaf margins would be less overall due to the fewer blade cells, but still be normal at the hydathodes, the points of vascular contacts with the leaf margin as the vascular development would be normal. It would be interesting to investigate this possibility by examination of the development and distribution of stomata and vasculature in the jagged mutants. CDK (Cyclin-dependant kinase) inhibitors regulate cyclin-mediated cell division in plants and animals (Sherr and Roberts, 1999). Interestingly, overexpressors of ACK1, an Arabidopsis CDK inhibitor, exhibit reduced cell cycling and exhibit a leaf serration phenotype similar to jaggedl (Han et al., 2005). This indicates that cell 27 division plays in important role in shaping the leaf margins, and it is even possible that differential regulation of cell division might play a role in generating serrations, in a mechanism independent of KNOX action. This might explain how serrations can develop in wild-type Arabidopsis plants in the absence of Class 1 KNOX gene expression in the leaves. 1.1.7.3. Development of compound leaves Two hypotheses have been put forward to explain how development of compound leaves could be compared to the formation of simple leaves. According to Kaplan, compound leaves and simple leaves are initiated in the same way, with the leaflets formed later by subdivision of the leaf (as cited by Champagne and Sinha, 2004). Sattler and Rutishauser (as cited by Champagne and Sinha, 2004), however, propose that compound leaves are modular, with each module having both leaf and shoot potential. Either way, all the factors required for leaf initiation and polarity would be similar in simple and compound leaves. However, since leaf initiation requires meristem function, the second proposal would require meristem-specific genes to be expressed or recruited into the leaf primordia for the establishment of leaflet primordia. Various studies in compound-leaved plants such as tomato and pea have shown that orthologs of the Arabidopsis Class 1 KNOX gene, STM, play an important role in compound leaf development. In Arabidopsis, Class 1 KNOX genes and AS1 negatively regulate each other and maintain their expression in distinct domains, with the KNOX genes in the meristem and AS1 in the lateral organ primordia and lateral organs. However, in tomato the AS1 homolog LePHAN and the STM homolog LeT6 expression domains overlap in the leaf primordium and the SAM (Kim et al., 2003b). It is possible that LeT6 meristematic activity is required to establish leaflet primordia and that is why LeT6 is expressed in the leaf primordia. LePHAN would be required to tightly control LeT6 function by restricting its expression to specific sites in the leaf primordia. This hypothesis is supported by the homozygous (Me/Me) and heterozygous (Me/+) tomato mouse ears mutant phenotype. The me mutants are LeT6 overexpressors. The heterozygous Me/+ had decreased levels of LePHAN and increased levels of LeT6, and an increased number of leaflets (Kim et al., 2003b). The decrease in the expression of LePHAN probably allows LeT6 to establish more leaflet primordia that 28 would result in an increase in number of leaflets initiated. RNAi mediated suppression of an S7M-like gene in Cardamine hirsuta, a plant related to Arabidopsis, results conversion of compound leaves into simple leaves (Hay and Tsiantis, 2006). These results suggest that KNOX proteins play a crucial role in establishing compound leaves in many plant species. In peas, however, the Arabidopsis LEAFY ortholog UNIFOLIATA (UNI) is the gene that participates in compound leaf formation. LEAFY in Arabidopsis is required for establishment of floral meristems (Schultz and Haughn, 1991; Weigel et al., 1992). Wild type pea leaves have around three pairs of distal leaflets and 4 pairs of tendrils proximal to the leaflets and finally end with a tendril (Champagne and Sinha, 2004). Uni mutants have leaves ranging from single leaf to a trifoliate leaf (DeMason and Schmidt, 2001; Hoferetal., 1997). Compound leaves in seed plants have polyphyletic origins (Zimmerman, 1952, reviewed in Bharathan and Sinha, 2001). That is, there are multiple origins of compound leaves in different families of plants. These different origins might have allowed different mechanisms of compound leaf formation to develop, some using KNOX-mediated development and others using LEAFY-mediated development of compound leaves. Although lobe and serration formation in simple leaves and leaflet formation in compound leaves have similarities, none of the mutants obtained in simple leaf species have shown a complete conversion of a simple leaf into a compound leaf. This suggests that some other factor(s) required for compound leaf formation exist in plants, perhaps eluding mutant screens due functional redundancy. It could be that the SAW homeodomain-containing transcription factors described in this thesis have a role in the transition from simple to compound leaf shapes. 29 1.2. Homeodomain proteins Site-specific DNA-binding transcription factors can be subdivided based on sequence similarity of the DNA binding domains. One large subdivision of transcription factors is the homeodomain proteins. They have a conserved DNA binding domain called the homeodomain, named for the fact that mutations in the first such gene identified (Drosophila Bithorax) resulted in a homeotic (out of place) developmental mutant phenotype where specific segments of the Drosophila body were replaced by a different body segment (Gehring, 1987). Most homeodomains have a conserved region of 60 amino acids. The 180bp DNA sequence that codes for this domain is called a homeobox. The homeodomain functions by directly interacting with conserved sequences in the target DNA and with other proteins, collectively functioning to activate or repress the gene (Gehring et al., 1994). The homeodomain proteins can be further subdivided on the basis of the presence of extra amino acids within the homeodomain. Homeodomain proteins with more than 60aa are referred to as atypical homeodomain proteins. One such atypical group of homeodomain proteins is the TALE (three amino acid loop extension) superclass of homeodomain proteins. These proteins are present in both plants and animals and are important cofactors of other regulators (Burglin, 1997). Since SAW proteins characterized in this thesis belong to the TALE superclass of homeodomain proteins, this section of the literature review focuses on the various properties of homeodomain proteins, with the major focus on the TALE homeodomain proteins. 1.2.1. Structure of homeodomain proteins An alignment of the homeodomain protein sequences reveals that out of the 60 amino acids of the homeodomain, at least 7 amino acids are present in the same position in almost 95% of the proteins (Gehring et al., 1994). These include Leu16, Phe20, Trp48, Phe49, which are a part of a hydrophobic core, and Arg5, Asn5l and Arg53, which are directly involved in DNA binding. The homeodomain in these proteins form three a helices (Figure 1.12). The amino acids residues 10-21 form the first helix, which is followed by a connecting loop of five residues. The 30 second helix (28-38) is connected to the third helix by a small loop consisting of three amino acids; collectively forming a helix-turn-helix motif. The third helix, which governs DNA specificity, has been found to interact with the major groove of the DNA and the loop between the first and second helices interacts with the DNA backbone (Gehring et al., 1994). The remaining amino acids along with the C-terminal arm may form another helix in some proteins and may be involved in conferring stability to the DNA-protein complex (Piper et al., 1999). The whole homeodomain interacts with the target DNA molecule. The amino acids 1-9 of the homeodomain generally form a flexible N-terminal arm in free state. This N-terminal arm makes contact with the bases in the minor groove and this DNA binding stabilizes its structure (Gehring et al., 1994). Figure 1.12 Homeodomain structure The image shows a 3D reconstruction of the ANTENNAPEDIA homeodomain protein interacting with DNA. See text for details. (Image taken from: http://www.biozentrum.unibas.ch/ gehring/gehring_pictures.html#; Billeter et al., 1993) The TALE superclass of homeodomain proteins differ from the other homeodomain proteins in the presence of an extra three amino acids between helices 1 and 2 (Bertolino et al., 1995). These three amino acids are involved in the 31 interaction of TALE proteins with some members of the HOX class of homeodomain proteins. The HOX proteins interact with the three amino acids via a hexapeptide sequence present 5-50 amino acids N-terminal to the homeodomain (Jabet et al., 1999; Piper et al., 1999). 1.2.2. TALE homeodomain proteins in plants and animals The homeodomain proteins are classified mainly based upon their sequence similarities. The HOX homeodomain proteins form the major group of homeodomain proteins in animals and show conservation in the arrangement of their genes in the chromosome (chromosomal clustering) and hence, are also classified by this criterion (Gehring et al., 1994). However, HOX proteins are not present in plants. In Arabidopsis, there are 101 genes that code for homeodomain proteins (lida et al., 2005). They belong to structurally and functionally distinct families which include the BLH (BEL1 like homeodomain), KNOX (Knottedl like homeobox), WOX (WUSCHEL like homeobx), HD-ZIP (Homeodomain- basic Leucine zipper) and GLABRA 2 (GL2) families (Chan et al., 1998). Of these proteins, the members of BLH and KNOX families belong to the TALE superclass of homeodomain proteins. BLH and KNOX proteins are unique to plants and have been identified in a wide variety of vascular plant species. BLH and KNOX proteins are similar to animal TALE homeodomain proteins in having sequence conservations and the three amino acid loop extension in the homeodomain, as well as a conserved region in the amino terminus. Figure 1.13 shows a sketch of the major domains present in KNOX and BLH proteins. The amino acids sequence PYP (Proline, Tyrosine and Proline) is the TALE extension in the majority of BLH and KNOX proteins. The BLH and KNOX proteins share significant sequence similarities in the homeodomain region but differ greatly in the N terminal regions of the proteins. The KNOX proteins have a KNOX (MEINOX) domain, and an ELK domain that is conserved in all the members of KNOX family (Burglin, 1997; also see page 36). The ELK domain has 24 amino acids that form two short helices (Vollbrecht et al., 1991). The MEINOX domain forms an amphipathic helix having 9-13 turns, with most of the conserved residues on one face of the helix (Bharathan et al., 1997). The BLH proteins have a conserved SKY domain and a BELL domain upstream to the 32 homeodomain (Bellaoui et al., 2001; Burglin, 1997). The VSLTLGL box is a conserved sequence of unknown function present in some of the BLH proteins, but absent from others (Chen et al., 2003). The conserved SKY and BELL domains of BLH proteins and the conserved MEINOX domain of KNOX proteins are required for the heterodimerization of the BLH and KNOX proteins (see page 40 for details). |/r\inY Homeodoma in W N V A MEINOX Domain ELK I If i n PYP BLH Homeodoma in SKY doma in BELL domain I II m VSLTLGL box Figure 1.13 General features of KNOX and BLH homeodomain proteins. See text for details (Diagram modified from: Chen et al., 2003). Based on structural similarity, the TALE superclass of homeodomain proteins can be split into subclasses: PBC, MEIS, IRO and TGIF in animals, KNOX and BLH in plants (Burglin, 1997; also see page 36). The PBC (PBX + CEH20) family includes the vertebrate PBX proteins, Caenorhabditis elegans CEH20 and the Drosophila EXD. These proteins show conservation within the homeodomain and also two conserved regions in the N-terminal region of the protein. These domains are referred to as PBC-A and PBC-B. The MEIS family of the TALE homeodomain proteins is made of the vertebrate MEIS1-3 and the PREP1/pKNOX, C. elegans CEH25 and the Drosophila HTH protein (Toresson et al., 2000). The N terminal MEIS domain and the N terminal KNOX domain share significant homologies and they are therefore commonly referred to as the MEINOX domain (Burglin, 1998) 1.2.3. KNOX family of homeodomain proteins The maize KNOTTED1 was the first homeodomain protein to be discovered in plants (Vollbrecht et al., 1991). Since its discovery, KNOX proteins have been identified in a wide variety of vascular plant species (Bharathan et al., 2002; Sano et al., 2005). The seven Knotted-like proteins in Arabidopsis thaliana (KNATs) are 33 classified based upon their sequence similarities and expression patterns into Class 1 and Class 2 (Kerstetter et al., 1994). Class 1 KNOX proteins include STM, BP, KNAT2 and KNAT6 while KNAT3, KNAT5 and KNAT7 belong to class 2 (Figure 1.14). Members of the class 1 KNOX proteins are mainly expressed in the shoot apex and loss of function of STM, BP and KNAT6 affect meristem function (discussed in page 11). In addition to the redundant meristem function of BP, loss of BP function also causes defects in stem growth. Bp mutants have reduced internode elongation and have downward pointing flowers due to improper growth of the pedicels or floral stems (Douglas et al., 2002; Venglat et al., 2002). Knat2 and knatS loss of function mutants do not show any obvious shoot phenotypes (Belles-Boix et al., 2006; Hamant et al., 2002). Since KNAT6 and KNAT2 proteins have strong sequence similarities (Figure 1.14), it is possible that the phenotypes are not visible in single mutants due to functional redundancy. Functions of Class 2 knox proteins are however, not clear. Plants overexpressing Class 1 KNOX genes BP, KNAT2 and KNAT6 have lobed leaves (discussed in page 25). Plants overexpressing a recombinant protein having the BP C-terminus fused to the KNAT3 N-terminus showed a BP overexpression phenotype, indicating that the C-terminal end including ELK domain and homeodomain can confer functional specificity (Serikawa and Zambryski, 1997). 34 WUS Figure 1.14 Neighbour joining phylogram of the members of the Arabidopsis BEL and KNOX families of homeodomain proteins. Bootstrap values are indicated at the branch points (max 100). The W U S C H E L (WUS) homeodomain protein has been used as an outgroup. Note that the BEL and K N O X proteins form distinct groups. C lass 1 and Class 2 K N O X proteins are outlined by the purple and blue boxes respectively. Green box highlights the BLH proteins. See methods (chapter 2) for more details. 35 1.2.4. BELL family of homeodomain proteins There are 13 BLH (BEL1-like homeodomain proteins) in Arabidopsis (Roeder et al., 2003; Smith et al., 2004; this study). BEL1 is the first member to be functionally characterized. BEL1 is involved in ovule development. The wild type ovules are made of three layers of sporophytic tissue surrounding an embryo sac: nucellus, inner integument and outer integument. The bell mutants have a disorganised mass of cells in place of the integuments, leaving the developing nucellus exposed; giving the ovule a Bell shaped appearance. Also, embryo sacs don't develop in the bell mutant and it is therefore female sterile (Modrusan et al., 1994; Ray et al., 1994; Robinson-Beers et al., 1992). The Arabidopsis BEL1 protein interacts with KNOX proteins (Bellaoui et al, 2000; Hackbusch et al. 2005); however no KNOX dependent BEL1 function has been reported so far (See page 40 for mechanism of BLH-KNOX interactions). The BLH protein, ATH1, is involved in floral induction. ATH1 has light responsive elements in its promoter region and transcription of ATH1 is induced by light (Quaedvlieg et al., 1995). Ath1 loss of function mutants is early flowering and the gain of function results in delayed flowering (Rutjens et al., 2006). Overexpression of the ATH in ryegrass delayed flowering (van der Valk et al., 2004) an important trait to engineer since the vegetative parts of this perennial forage plant has higher nutritive properties. Similar to ATH1, overexpression of BLH3 also results in late flowering (Cole etal.,2006) The Arabidopsis BEL1-like homeodomain protein (BLH) BELLRINGER (BLR; also called PENNYWISE, REPLUMLESS, VAAMANA) and its paralog POUNDFOOLISH (PNF) are required for proper inflorescence development (Bao et al., 2004b; Bhatt et al., 2004; Byrne et al., 2003; Roeder et al., 2003; Smith et al., 2004; Smith and Hake, 2003). The blr mutant inflorescence exhibits altered phyllotaxy, has shortened internodes and irregular internode elongation. BLR is also required for development of replum: a structure involved in fruit maturation (Roeder et al., 2003) Pnf single mutants don't show any phenotype, but pny blr double mutants fail to flower (Smith et al., 2004). Interestingly, a pnf/+ heterozygote can enhance the blr inflorescence defects, indicating a functional conservation (Kanrar et al., 2006). BLR and PNF interact with the KNOX proteins, BP and STM (Bhatt et al., 2004; Byrne et al., 2003; Kanrar et al., 2006; Smith and Hake, 2003). Several experiments have 36 demonstrated the biological significance of these interactions. As noted earlier, bp mutants have reduced internode growth. Double mutants of blr bp enhance the bp internode phenotype (Byrne et al., 2003; Smith and Hake, 2003) and the phenotype is more severe in a pnf/+ background (Kanrar et al., 2006). These results indicate that the BLR and PNF are required for BP mediated stem formation. Loss of STM function in plants abolishes the shoot apical (Barton and Poethig, 1993; Long et al., 1996). However, weaker alleles of stm exhibit reduced meristematic activity and produce abnormal lateral organs (Clark et al., 1996). Loss of BLR/PNF function in a weak stm background enhances the stm loss of function, indicating that BLR and PNF are required for the STM mediated meristem maintenance and function (Byrne et al, 2003; Kanrar etal, 2006). Besides the five BLH proteins described here and the two SAW proteins whose function will be presented in this thesis, little is known about the functions of the other BLH proteins. 1.2.5. Evolutionary relationships of the TALE homeodomain proteins The TALE superclass of homeodomain proteins has been found in both plants and animals. The proteins of this superclass are characterized by the presence of three extra amino acids in the homeodomain region, between the helices 1 and 2 (Bertolino et al., 1995). In plants, the KNOX proteins have been found in dicots, monocots, gymnosperms and algae (Reiser et al., 2000). In animals, two groups of TALE proteins, PBC and MEIS have been found to interact with each other and this interaction is required for regulation of many developmental events. DNA sequence analysis reveals that there is a significant conservation between the MEIS domains of the MEIS proteins and the KNOX domains of the KNOX proteins (Burglin, 1997), and therefore, this domain is collectively called MEINOX. MEINOX domain and the PBC domains also exhibit a significant conservation (Burglin, 1998). In fact, a comparison of all the TALE proteins reveals a certain degree of conservation, indicating that all the TALE proteins may have a common ancestor (From: Bharathan et al., 1997; Burglin, 1997; Burglin, 1998). The common ancestor, may have had HOX-like interacting partners as the three extra amino acids present between the helices I and II are required for interaction with HOX proteins (Piper et al., 1999). If this was 37 the case, animals retained the HOX genes and hence also retain the conserved TALE three amino acids. But it is very intriguing that plants lack HOX proteins and yet retain TALE proteins having the extra three amino acids. It is possible that the three amino acid extension in plant TALE proteins may have some yet unknown function. Perhaps there are certain proteins other than the HOX that interact with the TALE proteins (Burglin, 1998). Interactions amongst the TALE proteins have been well documented in both animals and plants. In Arabidopsis, members of the KNOX family, can interact with the BEL1-like homeodomain proteins (Bellaoui et al., 2001; Bhatt et al., 2004; Byrne et al., 2003; Hackbusch et al., 2005; Kanrar et al., 2006; Muller et al., 2001; Smith and Hake, 2003). However, the absence of interacting partner like HOX and the fact that the plant and animal TALE proteins show a lot of d ivergence when compared with other c l asses of homeodomain proteins (ie HOX) indicates that the plant and animal TALE proteins might have different ancestors (Kappen, 2000). Another possibi l i ty is that there could have been more than one type of TALE homeodomain protein in the ancestors, and animals and plants chose different TALE ancestors during their evolut ion. The introduction of novel interacting partners or the conservat ion of the exist ing partners probably had a select ive effect on the TALE homeodomain proteins (Figure 1.15). 38 P l a n t s A n i m a l s MEINOX TALE HO Typical H3 Figure 1.15 Evolution of the TALE homeodomain proteins. Plant and animal TALE homeodomain proteins have possibly evolved separately from a common ancestor (Burglin, 1997). The ancestral TALE proteins which interact with each other must have diverged in sequence in plants and animals. The KNOX and MEIS proteins still maintain the conserved MEINOX domain. However, different selection pressures (probably the lack of HOX protein in plants) have led to the evolution of distinct PBC domains in animal PBC proteins and BELL and SKY domains in plan BLH proteins (From: Bellaoui et al., 2001) Copyright © 2006, The Plant Cell Online by the American Society of Plant Biologists). 39 1.2.6. Interactions of the homeodomain proteins Although the homeodomain proteins are few in number, they bring about the controlled regulation of a wide variety of genes. Besides the homeodomain that is required for DNA recognition and binding, certain other domains are present which are involved in governing the protein-protein interactions. Thus, a homeodomain protein can interact with other transcription factors to act in a combinatorial manner to regulate gene expression (Chen, 1999). The multitude of interactions which can occur may impart diverse functions. A homeodomain that has a role of an activator in one complex can be repressive in another. In fact, the homeodomain proteins have been shown to interact not only amongst themselves, but also with other transcription factors. In yeast, homeodomain proteins MATa2 and MATal interact with a MADS-box transcription factor MCM1 and this combinatorial control regulates gene activation or repression of various genes depending on the yeast cell type (Johnson, 1995). The homeoprotein HOXB7 can interact with N F K B and kBa family of transcription factors involved in the regulation of various immune responses in mammals (Chariot et al., 1999a). Interestingly, HOXB7 has also been shown to interact with CBP, a protein having histone acetyltransferase activity (Hata, 1996) and results in its increased transactivating potential. This is either because the chromatin is more assessable in the presence of CBP or because the CBP protein recruits other transcriptional factors and the basal transcriptional apparatus as well (Chariot et al., 1999b). It has also been shown that homeodomain proteins can directly interact with the general transcription factors (Zhang et al., 1996; Zhu and Kuziora, 1996) 1.2.6.1. TALE-HOX interactions in animals: A lot of information has been obtained about the interaction of TALE superclass of homeodomain proteins with other proteins and with the DNA. In mammals and arthropods, it has been shown that they can interact with the HOX homeodomain proteins. The HOX proteins of the paralog groups 1 to 8 interact with the PBC class of TALE proteins with a conserved hexapeptide motif # Y/F D/P W M K\R, # being any hydrophobic residue (Chang et al., 1996; Khorasanizadeh and Rastinejad, 1999; Knoepfler et al., 1999). This conserved sequence is located N-40 terminal to the homeodomain and is separated from it by a less conserved 5-53 amino acid sequence. The structural analysis of complexes formed between HOXB1 and PBX1 (Piper et al., 1999), and that of UBX and EXD (Passner et al., 1999) reveal that the three extra amino acids present in the homeodomain of the TALE proteins are essential for interaction with HOX proteins. The dimerization of the HOX proteins with the PBC proteins occurs with the insertion of the HOX hexapeptide motif into the cavity formed by the three extra amino acids. Deletion or substitution in either the hexapeptide of HOX or in the three amino acids of the PBC proteins results in a failure of the two proteins to bind cooperatively (Johnson, 1995; Lu and Kamps, 1996; Peltenburg and Murre, 1997). 1.2.6.2. Interactions amongst the TALE proteins in animals: The proteins belonging to the TALE superclass have been found to interact and hence regulate the activity of each other. This is critical as many of these proteins can also function independently and their interaction with other proteins can inhibit, increase the binding specificity, or even modify their binding properties. A majority of the known interactions involves the PBC class of proteins. MEIS proteins can interact with PBC proteins. In Drosophila, the MEIS homologue, HTH is required for the import of EXD (A PBX homologue) into the nucleus (Jaw et al., 2000; Pai et al., 1998). Not only does this show that HTH can interact with EXD, but it also indicates that EXD function can be post-translationally regulated. In addition, PBX1 can interact with two of the MEIS family TALE proteins, MEIS1 and pKNOX1\PREP1 (Berthelsen et al., 1998a; Knoepfler et al., 1997). The interaction is through a conserved region, N-terminal to the homeodomain, called the PBC-A domain (Knoepfler et al., 1999). A chimeric oncogene formed by the fusion E2A and PBX1 encodes a fusion protein that lacks the first 89 amino acids of the PBX protein. This protein fails to bind to MEIS and hence supports the fact that the N-terminal region is required for interaction with MEIS (Chang et al., 1997). There are two conserved domains amino terminus to the homeodomain in the MEIS homeodomain proteins and they are called MEIS1 (HR1) and MEIS2 (HR2) (Berthelsen et al., 1998b; Burglin, 1997). Both the domains are required for interaction with the PBC proteins (Berthelsen et al., 1998c; Knoepfler et al., 1997). The MEIS1, MEIS2 and the PBC domains show a certain degree of sequence 41 conservation with the plant KNOX proteins and are collectively referred to as the MEINOX domain (Burglin, 1997). 1.2.6.3. Interactions in the TALE proteins in plants: BLH-KNOX interactions In the absence of HOX proteins in plants, the protein-protein interactions observed plant TALE homeodomain proteins are largely between members of the BLH and KNOX protein families. BLH-KNOX interactions have been observed in many plant species, including Arabidopsis, barley, potato and maize. Studies of BLH and KNOX interactions in barley and Arabidopsis indicate that the conserved SKY and BELL domain of the BLH proteins and the MEINOX domain of KNOX proteins are essential for BLH-KNOX interactions (Bellaoui et al., 2001; Muller et al., 2001). Exclusion of the SKY domain reduced the binding efficiency by more than 50% as was also evidenced in interactions of the potato KNOX protein POTH1 and the BLH protein. StBEL5 (Chen et al., 2003). The requirement of the MEINOX domain of KNOX proteins and N-terminal sequences BLH proteins for KNOX-BLH interactions was also shown for maize KNOX protein, KNOTTED1 and KIP (Knotted Interacting Protein- a maize BLH protein) interactions (Smith et al., 2002). Many members of BLH and KNOX families also interact with the ovate family of proteins (OFPs; Hackbusch et al., 2005). OFPs are found associated with cytoskeleton and can regulate subcellular localization of the interacting BLH and KNOX proteins (Hackbusch et al., 2005). BELL and KNOX proteins exhibit specificity in interactions. The Arabidopsis BEL1 protein interacts with STM, BP and KNAT5, but not with KNAT3 (Bellaoui et al., 2001). Similarly, BLR exhibits strong interactions with STM, BP and KNAT6, weak interactions with KNAT2, and does not interact with KNAT3 and KNAT5 (Bhatt et al., 2004; Smith and Hake, 2003). Perhaps there are slight differences in the interaction domains that alter the specificity of the interactions. 1.2.7. Homeodomain protein-DNA interactions: The homeodomain proteins regulate genes involved in various processes by direct interaction with DNA sequences present near the genes. There is considerable information available about the DNA sites recognized by the homeodomain proteins. 42 However, the data observed by in vitro assays are not always consistent with the specificity with which homeodomain proteins bind in vivo. For example the HOX proteins are able to bind in vitro to any sequence containing the consensus TNTAT(G/T)(G/A) (Mann, 1995). Since all the HOX proteins can bind to this consensus sequence in vitro and yet have many different functions in vivo, it is clear that this sequence is not sufficient for conferring HOX binding specificity. Rather, the in vivo specificity depends on the interaction with other proteins (cofactors) and also by the DNA sequences present adjacent to the core sequence (Vigano et al., 1998; White et al., 2000). 1.2.7.1. Homeodomain protein-DNA interactions in Animals The PBX TALE homeodomain proteins and the HOX homeodomain proteins bind adjacent sequences (half-sites) in a DNA element. The interaction of the two proteins stabilizes the HOX-DNA interaction (Vandijk et al., 1995). The cooperative binding of PBX and HOX is greatly influenced by position and orientation of the two half sites. In the element TGATTAAT, the PBX binds to 5' TGAT and HOX binds to 3' TAAT, on the DNA (Lu and Kamps, 1996). The N-terminal arm of the HOX protein makes contact with the minor groove of DNA and the third helix of the PBX protein contacts the major groove of the DNA. DNA binding experiments with PBX and MEIS have shown that PBX binds to 5' half-site consisting of TGAT/C, but unlike HOX, MEIS can bind to a 3' half site of TGAT/C, GGAC or TGGC (Knoepfler et al., 1997). MEIS however, fails to bind to 3' TAAT and TTAT sequences which are recognized by HOX and hence, shows a different DNA specificity. In both the complexes (PBX-HOX-DNA and PBX-MEIS-DNA), PBX is always at the 5' end. The complex formed by PBX-PREP1 also shows a specific interaction with the 5' TGACAG target sequence (Berthelsen et al., 1998b). 1.2.7.2. Antagonistic interactions in animal TALE proteins Although most of the TALE protein-DNA interactions involve a cooperative binding for activation or repression, some regulatory functions involve antagonistic activities of these transcription factors. The two TALE proteins MEIS2 and TGIF can bind to the same consensus sequence in a gene encoding a dopamine 43 receptor (Yang et al., 2000). Their binding is to opposite strands and in opposite orientations to a consensus sequence: 5'ACT3'. The binding of MEIS2 activates transcription of the gene whereas TGIF binding represses it. It is proposed that the transcriptional state of the gene is dependent upon the relative concentrations of the two TALE proteins in a given tissue/developmental stage (Yang et al., 2000). Antagonistic interactions of TALE proteins have not been reported in plants, but the phenotypes and the genetic interactions observed in the saw mutants that I have characterized do point towards such a process occurring in plants. This possible interaction will be discussed in Chapter 4. 1.2.7.3. Homeodomain protein-DNA interactions in Plants The first clues to DNA binding specificities came from gel retardation assays that indicated that the Hordeum vulgare Knotted-like protein could bind to DNA elements having one to three copies of the sequence TGAC (Krusell et al., 1997). The maize KNOX proteins KNOTTED1 (KN1) and the BLH protein KIP (KNOTTED1 interacting protein) have been shown to bind to a motif containing TGAC (Smith et al., 2002). Interestingly the KN1-KIP heterodimers bind with more efficiency than the individual proteins, indicating that cooperative binding is preferable (Smith et al., 2002). Since the animal PBX and MEIS TALE proteins also recognize and bind to TGAC (reviewed earlier), we can conclude that the mechanism TALE homeodomain-DNA interaction is conserved. This hypothesis is supported by the fact that the sequence and positioning of the 5 amino acids that make contacts with the DNA are conserved in plants (as observed for ATH1) and animals (Viola and Gonzalez, 2006). Overexpression of potato KNOX protein POTH1 and the BLH protein StBEL5 enhanced tuber formation and show an decreased levels of the biologically active forms of the plant gibberellic acids (GAs; Chen et al., 2003). POTH1 and StBEL5 have been shown to bind directly-to the GA oxidase promoter at adjacent TGAC sites, and their cooperative binding might downregulate GA oxidase mediated GA synthesis in potato (Chen et al., 2004) 44 1.2.8. Subcellular localization of the homeodomain proteins Transcription factors, like most other cellular proteins, are synthesized by the protein synthesis machinery in the cytosol. The nuclear import of these proteins is mediated by the nuclear localization signal (Hessabi et al., 1999) carried by the protein. The NLS may be a simple one composed of a short stretch of basic amino acids or a bipartite one, which has two basic amino acid sequences interspersed by a 10 amino acid spacer (Kaffman and O'Shea, 1999). Two proteins, importin a and importin P, act as a cytoplasmic receptor. They recognize the NLS and bind to the protein. Then the whole complex is translocated into the nucleus through a nuclear pore complex (NPC) followed by the dissociation of the complex to release the protein (Mattaj and Englmeier, 1998). 1.2.8.1. Nuclear localization signals in homeodomain proteins The homeodomain proteins generally have at least one NLS, mostly within the homeodomain region. There are, however some homeodomain proteins that have the NLS located outside the homeodomain region. The mushroom Coprinus cinereus homeodomain protein, HD1 is of this type (Spit et al., 1998). Some homeodomain proteins may have more than one NLS. For example, the mammalian homeodomain proteins belonging to the NK2 family have two NLS at each ends of the homeodomain. The NLS at the N-terminus was a simple type, but the distal NLS was found to be complex, probably because it is overlapping with the recognition helix (helix-3) of the homeodomain (Hessabi et al., 2000). Similarly, PDX1, a pancreatic homeodomain protein, also has a NLS in the third helix of the homeodomain (Hessabi et al., 1999). For many of the transcription factors, including the homeodomain proteins, the NLS not only acts as a means of entry into the nucleus, but also serves for regulation of its function, by controlling its subcellular localization. Some homeodomain proteins lack the NLS. One such homeodomain protein is the Coprinus cinereus HD2, involved in the mating type determination. The import of HD2 is through heterodimerization with a related protein, HD1. This homeodomain protein contains two bipartite NLS outside the homeodomain. The HD1 can also independently translocate across the nuclear membrane. Deletion of one of the NLS results in the cytosolic localization of both the proteins. However, when the NLS was added to 45 the HD2 protein (which lacks NLS), both HD1 and HD2 were translocated (Spit et al., 1998). These results show that the failure of the two proteins to enter the nucleus is a consequence of the absence of the NLS and not because of a defect in the protein due to deletion. These results also indicate that heterodimerization is essential for nuclear localization of HD1. It is very interesting to note that it is the heterodimer that is required for the regulation. Here, one protein is totally dependent on the other for its nuclear localization and in this case, dimerization serves as a mechanism for regulating the function of the heterodimer. Also, the fact that HD1 alone can be imported suggests that it can have a function independent of HD2. Indeed, in yeast, the HD1 homolog MATa2 can perform regulation of haploid specific genes independent of its interacting homeoprotein partner MATal (Johnson, 1995). 1.2.8.2. Nuclear export signals Another kind of subcellular localization is dependent on the presence of nuclear export signals (NES) in transcription factors. The NES consists of a leucine-rich amino acid sequence (Wen et al., 1995). The PBC class TALE homeodomain proteins are dependent on their functional partners, the MEIS proteins for nuclear import (Abu-Shaar et al., 1999; Berthelsen et al., 1999; Pai et al., 1998; Saleh et al., 2000). The Drosophila EXD is a member of the PBC class of TALE homeodomain proteins and it interacts with HTH, a MEIS homeodomain protein. Although EXD has a NLS, it also has a NES that is stronger than its NLS. In the absence of an interacting partner, it is exported out of the nucleus (Jaw et al., 2000). However, when HTH is present, EXD binds to HTH and this covers the NES, thereby preventing its export (Abu-Shaar et al., 1999). 1.2.8.3. Subcellular localization of plant TALE homeodomain proteins Much evidence suggests that the dimerization of BLH and KNOX homeodomain proteins is required for nuclear import of one or both of the partners. The Arabidopsis proteins STM and BLR interact with each other (Bhatt et al., 2004; Hackbusch et al., 2005). Mutations in either STM or BLR results in failure of the partner from being imported into the nucleus (Bhatt et al., 2004; Cole et al., 2006). The Arabidopsis ovate family of proteins (OFPs) interact with the BLH and KNOX family of proteins regulate their ability to enter the nucleus (Hackbusch et al, 2005). Perhaps the OFPs proteins 46 act as mediators of interaction by sequestering partners for interaction. Alternatively, since BLH and KNOX proteins have multiple interacting partners (Bellaoui et al., 2001; Hackbusch et al., 2005), the OFPs proteins might be regulating specificity of interactions by binding to only specific partners and excluding the others. I used the PSORT program (Nakai and Horton, 1999) to predict the subcellular localization of the BLH and KNOX proteins and found some very interesting results. All of the 8 KNOX proteins were predicted to be nuclear localized (indicating that they had a predicted NLS) but of the 13 BLH proteins, only BEL1 and BLR were predicted to be nuclear localized (Table 1.1). This result indicates that most of the BLH proteins lack a predictable NLS and are probably dependent on their KNOX partners or some other factors for nuclear import. In the maize KNOX protein, KNOTTED! two NLS could be predicted in the ELK domain and the ELK domain was found to be required for nuclear localization (Meisel and Lam, 1996). Since the ELK domain is conserved amongst all the KNOX proteins, it might be involved in nuclear import of all the KNOX proteins. Although nuclear localization of BEL1 has been verified and an NLS has been predicted in the BEL1 protein, the requirement of the NLS for nuclear import has not been verified (Reiser et al., 1995). Table 1.1 Prediction of subcellular localization of BLH and KNOX proteins using PSORT Numbers indicate the probability of localization in that region of the cells. Probability of less than 0.3 has not been included. PSORT PROTEIN PREDICTION Nucleus Cytoplasm Other BEL1 0.98 SAW1 0.65 SAW2 0.45 0.3 Ath1 0.65 BLH1 0.45 BLH10 0.65 BLH11 0 . 3 l 0.33 BLH3 0.45 BLH5 0.45 0.46 BLH6 0.45 BLH7 0.45 BLR 0.88 PNF 0.45 STM 0.7 BP 0.7 KNAT2 0.7 KNAT3 0.3 0.2 KNAT4 0.6 KNAT5 0.6 KNAT6 0.7 KNAT7 0.6 48 1.3. Research goal Bell mutants lack functional ovules and are female sterile, implying a role for BEL1 gene in ovule development (Modrusan et al., 1994; Ray et al., 1994; Robinson-Beers et al., 1992). Although the bell mutant exhibits only an ovule phenotype, BEL1 is expressed in various other organs (Reiser et al., 1995), suggesting a possible function of BEL1 outside the ovule. The lack of non-ovular phenotypes in the bell mutant indicates that the loss of BEL1 function outside the ovule might be masked by the function of other genes that are able to perform functions similar to that of BELL The primary goal of this research was to functionally characterize proteins that function similarly to the BEL1 homeodomain protein and to test their functional overlap with BELL As mentioned earlier in this chapter, there are 13 proteins in the BLH family. Of the 12 BLH proteins besides BEL1, the two proteins SAWTOOTH 1 (SAW1) and SAWTOOTH2 (SAW2) were identified as the best candidates for this analysis for a number of reasons. Firstly the amino acid sequences of SAW1 and SAW2 are most similar to that of BEL1, and SAW1 and SAW2 are very similar to each other (Figure 1.14). Conservation of protein sequences over the course of evolution might indirectly suggest a conservation of function. This is because the regions of the transcription factor that have retained similar amino acids might be regions that specify specific functions (interactions with other proteins, site specific DNA binding, activation/repression etc). If the sequence were altered, the function would be disrupted with deleterious consequences to the organism, if the function was essential. The more functionally divergent the proteins become, the less selection pressure there is on these amino acid sequences. Secondly, northern blots (Pidkowich, 2001) and in situ hybridization experiments (Kushalappa, unpublished results) in the Haughn laboratory indicate that BEL1 and SAW1 overlap in expression in a number of organs including root, stem and leaf, but only BEL1 is expressed in the ovules. The overlap in expression patterns suggests that these proteins might have redundant functions in these organs. Thus, the lack of non-ovular phenotypes in the bell mutant might be the consequence of functionally redundant proteins working alongside BEL1 in non-ovular tissues. Therefore, loss of BEL1 function outside the ovule might only be visible in bell sawl double or even bell sawl saw2 triple mutants. 49 Furthermore, yeast two-hybrid assays indicate that both BEL1 and SAW1 interact with the same subset of KNOX proteins (Hackbusch et al., 2005). As described earlier in the literature review, interaction between BLH and KNOX family of proteins is required for regulation of various aspects of plant morphogenesis. Therefore interaction with same KNOX proteins allows us to speculate that these two BLH proteins share common regulatory functions. Finally, when a transgenic line constitutively expressing SAW1 was crossed into the be/7 mutant by Dr. Kumuda Kushalappa, the bell phenotype was rescued (Figure 1.16). This indicates that SAW1 can replace BEL1 function in the ovule if it is ectopically expressed in that organ, showing that the two proteins have very similar and likely overlapping functions. Figure 1.16 Complementation of bell mutant by 35S:SAW1. (A) wild type ovule, (B) bell-3, (C) 35S:SAW1 and (D) 35S:SAW1 bell-3. Note that the lack of integument growth in bell (B) is restored when 35S:SAW1 is introduced into beh Size bars=50(am (Kushalappa and Haughn, unpublished results) 1.3.1. Thesis objectives Major developmental functions have been demonstrated for a few of the BLH family proteins; however, information on the biological roles of most of the family 50 members is lacking. My major contribution has been to begin to address this lack by elucidating functions of SAW1 and SAW2 in leaf development. My work also suggests that they may function partially through a novel, negative regulatory interaction with KNOX proteins. I have accomplished this using a systematic investigation of SAW1 and SAW2, with the following specific objectives: 1.3.1.1. Use of in silico and expression analysis to predict domains of unique and overlapping functions in SAW1, SAW2 and BEL1 The BEL1 and SAW1 expression data previously generated in our laboratory have not been comprehensive enough to properly predict tissues in which there may be functional redundancy. Additionally, we have little data on the expression pattern of SAW2. I have used RT-PCR and promoter-GUS fusions of the three genes to fill in the gaps in the expression data for SAW1 and BEL1, and to determine SAW2 expression patterns. I used these data as a guide in looking for phenotypes in the single and double saw mutants. 1.3.1.2. Identification of SAW1 and SAW2 function using reverse genetic analyses To examine SAW1 and SAW2 functions in plant development, I looked for lesions in these genes by searching the sequence-indexed Salk Institute database of T-DNA insertion lines to find insertions in or near the SAW1 and SAW2 genes; and by TILLING an EMS-mutagenized population to find point mutations in these genes. I also attempted to artificially generate transcriptional knock-downs of the genes using RNAi. I examined the single mutants for developmental defects, and when no phenotype was evident, I looked for phenotypes in sawl saw2 double mutants. 1.3.1.3. Genetic interactions of SAW genes with BEL1, AS1 and BP Since SAW1 and SAW2 were predicted to have overlapping functions with BEL1, I also generated a bell sawl saw2 triple mutant and examined it for additional phenotypes. In addition, since BEL1 and SAW1 were both found to interact with BP in yeast, and AS1 has ectopic domains of BP expression, I generated triple mutants with these genes to examine their genetic interactions in planta. CHAPTER 2 : MATERIALS AND METHODS 51 2.1 Bioinformatics 2.1.1. Protein alignments Twelve BLH family proteins were identified by Mark Pidkowich in the Haughn laboratory and the amino acid sequences were reported in his PhD thesis (Pidkowich, 2001). I identified the 13 t h member of the BEL1 family using BLAST (Basic Local Alignment Search Tool, Altschul et al., 1990) to query the non-redundant protein database for Arabidopsis thaliana at the National Centre for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/blast). The amino acid sequences for the BLH and KNOX proteins were downloaded from the MIPS (Munich information centre for protein sequences) for Arabidopsis thaliana Database (MATDB; http://mips.gsf.de/proj/thal/ db/search/search_frame.html). For full-length protein alignments, amino acid sequences of the13 BLH proteins, 8 KNOX proteins and WUSCHEL (outgroup control) were first assembled into local databases using BioEdit (Hall, 1999, http://www.mbio.ncsu.edu/BioEdit/bioedit.html). In order to make the neighbour joining (NJ) phylogram, the amino acid sequences were aligned using the ClustalX program (Thompson et al., 1994; Thompson et al., 1997) with default alignment parameters except for the protein matrix. For this, I used BLOSUM62 (Henikoff and Henikoff, 1992) since this matrix works better for sequences with low homology (Eddy, 2004). ClustalX was then used to create an NJ tree with 100 bootstrap trials. The tree that was generated was visualized as a phylogram using TreeView (Page, R.; http://taxonomy.zoology.gla.ac.uk/rod/treeview .html), and the tree was realigned with WUS specified as the outlier. The tree was exported as an enhanced meta file (emf) and converted into jpeg format using IrfanView (Skiljan, I; http://www.irfanview.com/), before being imported into Microsoft Word (Microsoft Corporation). To construct the phylogram based on the maximum likelihood method (Felsenstein, 1981), the BLH amino acid sequences were first aligned with ClustalX as described above and imported into Bioedit for editing. Three highly conserved regions were identified (Figure 3.1) and these regions were selected for further analysis. The alignment of the conserved sequences was bootstrapped 1000 times using SEQBOOT 52 (Felsenstein, J. 2005; from PHYLIP version 3.6., distributed by the author. Department of Genome Sciences, University of Washington, Seattle.) The program Phyml (Guindon et al., 2005; Guindon and Gascuel, 2003) was then used to generate a maximum likelihood-based tree. The tree was visualized using Treeview and processed with IrfanView and Photoshop (Adobe Systems Incorporated, Mountain View, CA), where the bootstrap values were converted to 100 and added to the tree branches. 2.1.2. Alignment of promoter elements (including 5' Untranslated region (UTR)) Two kb of DNA upstream of the SAW1 and SAW2 translational starts were obtained from the Arabidopsis BAC sequences ATAP22 and F27L4, respectively, via MATDB (The promoters were aligned using ClustalX with default parameters and manually adjusted by sliding the blocks, without deleting or adding bases. 2.1.3. Prediction of nuclear localization The amino acid sequences for KNOX and BLH proteins were analysed for subcellular localization signals using PSORT (Prediction of protein sorting signals and localization sites in amino acid sequences) (Nakai and Horton,'1999). Other methods of nuclear localization are partly or wholly based on homologies with other proteins of known subcellular localization (For example, its been established that BEL1 is nuclear localized and therefore other similar proteins also must be nuclear localized) and therefore were excluded for this analysis. 2.2 General Arabidopsis Methodologies 2.2.1. Growth conditions Seeds were sown on culture plates containing AT-agar medium (Somerville and Ogren, 1982) or directly on soil (Sunshine Mix 5, Sungro horticulture, Seba beach, AB) supplemented with AT medium (Table 2.1). The seeds were stratified at 4°C for 3-4 days. The seeds sown on plates were germinated in continuous light at 20°C for 7-9 53 days and then transplanted into soil. Either 8-inch pots or 72-well potting trays were used for growing the plants. Growth chambers were maintained at 20°C with continuous light (90-120 uEin PAR) for all experiments. Table 2.1 Composition of AT medium. The macro- and micronutrients and agar (5 g/L) were added to water. After adjusting the volume, the medium was autoclaved and poured into culture plates after cooling to 55°C. Any antibiotic or herbicide that was used for selection was directly added to the culture plates at the time of pouring of media. Agar was omitted during preparation of AT medium for soil supplementation. Macronutrient Concentration (mM) K N 0 3 K H 2 P 0 4 M g S 0 4 C a ( N 0 3 ) 2 FeEDTA 5 2.5 2 2 0.05 Micronutrient Concentration (uM) H 3 B O 3 70 Mrv4H 2 0 14 C u S 0 4 0.5 Z n S 0 4 7 H 2 0 1 N a M o 0 4 2 H 2 0 0.2 NaCI 10 C o C I 2 6 H 2 0 0.01 2.1.3. Plant material The Arabidopsis ecotypes Columbia 0 (col-0), col-2, col with erecta mutation (col er105) and Landsberg erecta were used as WT controls in phenotypic screens and other experiments for the mutants and transgenics, in accordance with their genetic backgrounds. BP:GUS was a gift from Sarah Hake (Ori et al., 2000). All Salk insertion lines, TILLING lines and the as1-1 mutant were ordered from the Arabidopsis Biological Resource Center (ABRC, Columbus, OH; see Table 2.2 for details). 54 Table 2.2 List of mutant alleles ordered from A B R C Mutant allele Seed stock number as1-1 Saw1-1 Saw1-2 CS87673 CS88597 CS85764 CS3374 SALK_009120 Saw1-138g8 Saw1-96h3 Saw1-107e9 CS86582 Saw2-1 S A L K 121117 Saw2-2 S A L K 149402 2.1.4. Plant transformation Plants were transformed using the Agrobacterium tumefaciens-med'iated floral dip method (Clough and Bent, 1998). The plants were grown in 8-inch pots at a density of 6-8 plants per pot. When the plants had bolted, the primary bolts were cut off. The plants were used for transformation when the secondary bolts had at least a few open flowers. Single colonies of Agrobacterium strains containing the binary vector with the transgene construct were inoculated into 25 mL of LB (Luria-Bertani) medium and cultured at 28 °C overnight. 5 mL of the overnight culture was then used to inoculate 250 mL of LB broth in 1 L flasks that were then incubated on a shaker for approximately 24 hours at room temperature. The Agrobacterium cultures were transferred to sterile centrifuge tubes and spun for 20 minutes at 4 °C at 4 000 rpm in a Beckmann J2-21 centrifuge with a JA14 rotor at 5000rpm (~3000g). The supernatant was discarded and the pellet was resuspended by pipetting in a solution containing 5% (w/v) sucrose and 0.05% (v/v) Silwet L-77 (Lehle Seeds, Round Rock TX). The resuspended Agrobacterium suspension was transferred to open, shallow containers a little larger in diameter than the pots. The pots were inverted into the solution, taking care not to dislodge the soil, and the inflorescences were dipped into the suspension such that most of the flowers and the shoot apices were coated with the Agrobacterium. The pots were kept in trays covered with plastic bags overnight (to maintain high humidity) after which they were returned to the growth chambers. The seeds were harvested upon maturity and grown on AT-Agar culture plates containing the appropriate selection agent. Depending on the transgenic construct, the selection agent was glufosinate (25 mg/L), hygromycin (50 mg/L) or kanamycin (50 mg/L). 55 2.3. Analysis of Gene Expression 2.3.1. Semi-quantitative reverse transcriptase (RT) PCR RNA was extracted from healthy tissues using the Trizol - isopropanol method according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). RNA concentration was quantified using a spectrophotometer to measure absorbance at 260 nm. After quantification, 1 pg of total RNA was used for first-strand cDNA synthesis by Superscript II reverse transcriptase according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). Template concentrations and PCR cycle number were optimized for all fragments amplified, in order to equalize cDNA concentrations in the samples and to avoid saturation of DNA amplification. The primers were designed for RT such that their predicted Tm was at least 60C and that they flanked an intron (to differentiate between cDNA and genomic DNA amplification; see Table 2.3). General PCR conditions were 94°C for 3 minutes, followed by the number of cycles optimized for the particular primer pair (see Table 2.3) of denaturation at 94°C for 15 s; annealing at 56°C for 30 s; and extension at 72C for 30 s. PCR products were resolved by electrophoresis in a 1.2% agarose-TAE gel containing 5 ug/mL of ethidium bromide and visualized and photographed using the Alphalmager 1220 UV transilluminator equipped with a digital camera. Table 2.3 Primers and P C R conditions used for R T - P C R Gene Forward primer Reverse primer Number of cycles BEL1 5'UTR C A C A A G T C A C C A C A G C A A C A T G C T T G A A T C T G T C C C A C A A 30 SAW1 5'UTR C G G A G C C A A T T C T T C T A A C G T C G C A G T A A T G G T T G T A C C G 30 SAW1 Homeodomain C A G C G G G A A T C T C T T C T T C C T G G A I I I I G T G C T C T T G T C G 30 SAW2 5'UTR C C A T T G G A G G G A T C T A C A C G A T C C C C T A G A A G C T C A C A G C 30 ACT8 T G T G A C A A T G G T A C T G G A A T G G T T G G A T T G T G C T T C A T C A C C 24 G A P C T G G G G A G A C A T T C T T G C T G G A T G G G C T T G T G T G T G I M G 24 56 2.3.2. GUS analysis 2.3.2.1. Generation of Promoter:GUS constructs For all constructs made during this project, PCR fragments were amplified using Expand High-Fidelity polymerase (Roche Molecular Biochemicals, Mannheim, Germany; according to the manufacturer's protocol) from col-2 genomic DNA isolated using the Dellaporta method (Dellaporta et al. 1983). For the promoter-GUS constructs, the promoter regions of BEL1, SAW1 and SAW2 including the 5' UTR were amplified using gene specific primers (Table 2.4). The BEL1 promoter was cloned into pCR 2.1 blunt (Invitrogen, Carlsbad, CA), then introduced into pBAR1 (a gift from Ben Holt and Doug Boyes of the Dangl Laboratory, University of North Carolina) containing GUS that I had subcloned from pBI101 (Clontech Laboratories, Palo Alto, CA) (Figure 2.1A). SAW1 and SAW2 promoters were cloned into pENTRIA (Invitrogen, Carlsbad, CA) and then subcloned into pGWB3 (a gift from Tsuyoshi Nakagawa, Research Institute of Molecular Genetics, Shimane University, Japan) by the Gateway LR recombination reaction (Invitrogen, Carlsbad, CA) according to the manufacturer's directions (Figure 2.1 B and C). Sandro Pastorelli, an undergraduate student under my supervision, helped to make the SAW1:GUS and SAW2:GUS constructs as well as the SAW2 genomic construct (see below). Table 2.4 P r imers u s e d to amplify promoter f ragments to genera te P r o m o t e r : G U S constructs. T h e restriction e n d o n u c l e a s e s that c leave the restriction sites that h a v e b e e n a d d e d to the primers have b e e n listed. Gene Forward primer Restriction Site Reverse primer Restriction site Ampli f ied fragment length (bp) BEL1 _ _ _ _ _ C A A T C T C T T T C A C G T A C T G T G C G mm _ _ _ H _ T G T C T C T C A A G A A T T G A A A A C C C BamH1 2070 SAW1 SAW2 T T A G T C G A C A A A G A T T C C C Sai l Xhot Xho1 2052 3022 A C A T G G T G T C A T T A T _ _ _ _ _ p T G C A A C C A C C A T T G A A G A G A T C A A T A C T T C A A T C A T T A T C T C G A G C A A A G C T C T T G G A T C C T G T A A G 57 A P B A R 1 -BEL1:GUS T-DNA region BamH\ Sad RB Nos-T GUS (1200bp) HindU EcoR\ ! LB Nos-T BAR Nos-P >-BEL1Pr (2070bp) B pG\NB3-SAW1:GUS T-DNA region Xhol Sail Hin6 III RB Nos-P NPTII Nos-T-1 SAWIPr(2052 bp) LB CaMV 35S HPT "-Nos-T •-Nos-T GUS pGWB3-SAW2:GUS T-DNA region Eco Rl Hin6 II RB Nos-P NPTII Nos-T SAWIPr (3022 bp) LB CaMV 35S HPT Nos-T L-Nos-T GUSJ Figure 2.1 T-DNA regions of the Promoter:GUS constructs 2KB promoter regions were cloned for both BEL1 (A) and SAW1 (B) constructs, but a 3KB region was used for SAW2 (C). Glufosinate resistance is conferred by the expression of BAR in pBAR1 (A). Plants transformed with B and C can be selected with wither Kanamycin or Hygromycin (resistance conferred by: NPTII, Neomycin phosphor transferase and HPT, hygromycin phosphor transferase respectively. 58 2.3.2.2. GUS histochemical assay GUS histochemical assays were done on freshly isolated plant organs or whole seedlings using a protocol that was adapted for staining Arabidopsis (Sieburth and Meyerowitz, 1997). Harvested tissues or whole seedlings were immersed in 90% acetone and incubated on ice for 15-20 minutes. Acetone was removed and the samples were washed with rinse solution (50mM phosphate buffer, pH 7.0; 0.5 mM potassium ferricyanide and 0.5 mM potassium ferrocyanide). After the rinse solution was removed, staining solution (rinse solution + 1 mg/mL 5-bromo-4-chloro-3-indolyl-|3-D-glucuronide (X-gluc, Rose Scientific, Edmonton, Canada; (Jefferson et al., 1987)) and 0.1% Triton-X-100) was added and the samples were incubated at 37 °C for 2 hours to overnight. The reaction was stopped by removal of the assay buffer, and the samples were processed for whole mounts or for sectioning. a) Whole mounts: Stained tissues were destained by incubation in 70% ethanol overnight at room temperature. The destained samples were either directly viewed under a light microscope (Zeiss Axioskop II microscope, Zeiss, Jena, Germany) or incubated in clearing solution (Chloral hydrate:Glycerol:Water, 8:3:1 w:v:v; composition kindly provided by Jim Mattsson) for 1 hour to 4 days depending on the organ being cleared (ovules start clearing within an hour and leaves take 2-4 days) and photographed under the compound microscope or dissecting photomicroscope. b) Resin embedding and sectioning: The stained samples were fixed with 3% glutaraldehyde (Canemco, Lachine, Quebec, Canada) in 0.5 M sodium phosphate buffer at 4 °C overnight, then dehydrated through an ethanol series and embedded in Technovit 8100 resin based on manufacturer's instructions (Heraeus Kulzer. Electron Microscopy Sciences, distributor). Embedded tissue was sectioned using a glass microtome. Sections were spread on glass slides and mounted with Entellan (Merck). The samples were then visualized under a light microscope and photographed using a SPOT digital camera (Diagnostic Instruments Inc.). The photographs were processed using Adobe Photoshop (Adobe Systems Inc.). 2.3.1.4 GUS fluorometric assay Stem internodes (the first two internodes from the base) and the inflorescence apex (including the region from inflorescence meristem to the first open flower) from 5 59 week old wild type (Col-0), BP:GUS Col-0 and BP:GUS saw1saw2 plants were separately harvested and homogenized in microcentrifuge tubes in protein extraction buffer (50 mM phosphate buffer, pH 7.0; 10 mM p-mercaptoethanol; 10 mM Na2EDTA; 0.1% sodium lauryl sarcosine; 0.1% Triton-X-100; (Jefferson et al., 1987)). The samples were centrifuged to pellet the cell debris and the supernatant was transferred into fresh tubes. The protein concentration of the supernatants was quantified against a BSA standard curve using the BioRad protein microassay according to the manufacturer's instructions (Bio-Rad Laboratories, Hercules, CA). The GUS assay was done in a 96 well plate and was started by addition of 20 u.L of the crude protein extract to a solution of 1 mM 4-methylumbelliferone-glucuronide (MUG; Rose Scientific, Edmonton, Canada) in extraction buffer. The reaction was maintained at 37 °C. The concentration of the hydrolysis product, 4-methylumbelliferone (MU), in each aliquot was measured using a Finstruments Fluoroskan plate reader (Thermo Electron/Labsystems, OY, Finland; excitation at 365+7nm; emission at 460+15 nm) at 0 hours, 30 minutes and 1 hour and was reported as absolute fluorescence units. The amount of MU produced was determined by comparing each sample's absolute fluorescence with an MU standard curve. To determine the rates of MUG hydrolysis for different transgenic lines, the slopes of the linear portions of the curves were determined; these values were standardized to the protein concentrations of the extracts. The rate of MU production per microgram of protein was used as a measure of GUS activity. 2.4. Functional analysis of SAW1 and SAW2 2.4.1. TILLING (Targeting Induced Local Lesions IN Genomes) TILLING involves the targeted screening of EMS (Ethyl Methanesulfonate) mutagenized plant population (see Gilchrist and Haughn, 2005 for a recent review). The initial screening was carried out by the Seattle TILLING Project ((Seattle, WA), McCallum et al., 2000; Till et al., 2003). Briefly, DNA was extracted from M2 plants of an EMS- mutagenized population and pools of 8 samples were made. Individual DNA pools were used for PCR-amplification of the target gene with fluorescently tagged primers, followed by CEL1 digestion of the PCR product. EMS causes C\G to T\A 60 transitions, which cause mismatches when mutated DNA is annealed with normal DNA. CEL1 detects mismatched DNA and cleaves it at that point. The digested DNA was melted, reannealed, and resolved on a vertical slab gel and fluorescence was used to detect the sizes of the fragments. The pools with shorter fragments have plants with the mutation of interest. The process was continued to identify individual lines from pools containing mutants. The PCR fragments amplified from individual mutant lines were sequenced and the TILLING center provides the mutant sequence and the ABRC seed stock number for the mutant line. I designed primers for regions of the SAW1 gene that were predicted to yield the maximum number of mutations upon single basepair changes. This prediction was done using the CODDLE program (Codons Optimized for Detection of Deleterious Lesions; http://www.proweb.orq/input). I submitted the primer sequences to the Arabidopsis TILLING center (http://tillinq.fhcrc.orq:9366/), and ordered the mutant lines identified for SAWL I sequenced each of the mutant alleles obtained to confirm the lesion, and isolated homozygous lines using CAPS and dCAPS markers (Table 2.5). I screened the homozygous lines for morphological phenotypes, and outcrossed each line that exhibited a visible phenotype to the parental col-er105 line to evaluate the segregation of the phenotype with the sawl polymorphism. Table 2.5 C A P S and d C A P S markers used to track E M S mutations in TILLING lines. P C R fragments were amplified using Taq polymerase (Invitrogen) with 35 cycles of denaturation at 94 °C, annealing at 56 °C, and extension at 72 °C, then digested using the enzyme specified, and resolved by electrophoresis in a 3% TAE-agarose gel. Mutant allele Forward Primer Reverse Primer Enzyme WT fragment length(s) Mutant fragment length(s) saw1-2 cagaagcaagagcatcaaagg tggtgatgttgagaagaattagc Msel 101,597 101,159, 438 saw-105e7 cagaagcaagagcatcaaagg tggtgatgttgagaagaattagc Mnll 386 129,166 saw-138g8 cagaagcaagagcatcaaagg tggtgatgttgagaagaattagc BseRI 183,515 698 saw-96h3 (dCAPS) cgccatgcagttattcttga ggtgatgttgatgtggaagctgatg catc Taq I 29,165 194 61 2.4.2. T-DNA insertions T-DNA is a DNA fragment that is transferred into plants by Agrobacterium. It incorporates randomly into the genomic DNA and may cause a mutation if it disrupts a gene sequence or transcription unit. The Salk Institute has a searchable database (http://signal.salk.edu) of flanking-sequence-tagged lines from T-DNA-mutagenized populations generated by themselves as well as by several other groups. The T-DNA insertion sites of these lines have been identified by sequencing the genomic DNA flanking the insertion. Specific genes of interest can be queried for the presence of T-DNA insertions and if there is a hit, the Arabidopsis line with the insertion can be obtained from the ABRC. Seeds supplied by the ABRC are T3-generation in which the insertion is segregating. I searched for insertions in SAW1 and SAW2 and found 3 lines that might disrupt these genes. I ordered the lines from the ABRC and used PCR-based genotyping to identify plants that were homozygous for the insertions. To genotype the plants, DNA was isolated from fresh leaves using the Edwards method (Edwards et al., 1991). PCR using genomic DNA-specific forward and reverse primers (Table 2.6) amplifies fragments where there is no insertion, and the T-DNA-specific LBb1 primer (5' gcgtggaccgcttgctgcaact 3') was used with the reverse primer to amplify fragments where there is an insertion. Homozygous lines were propagated and visually screened for morphological phenotypes. Table 2.6 Forward and reverse primers used for Salk line genotyping Mutant allele Salk designation Forward primer Reverse primer saw1-1 SALK_009120 cgtgcgtttcatcaaatgggt tgaaatgggtttgggtgataaa saw2-1 S A L K J 2 1 1 1 7 tcttggtatcaatgcattatggt ttttgtgtcacgcgtttggtg saw2-2 S A L K J 49402 aatggatgaagaagccgccat tctctgcaactccaaggtacttcc 62 2.4.3. RNAi An attempt was made to silence BEL1 and SAW1 using RNAi. I made constructs for these genes by inserting PCR amplified DNA sequences (that were unique to the genes) into pKANNIBAL (a gift from Peter Waterhouse; (Wesley et al., 2001)) in the forward and reverse directions as described in the article by Wesley et al., 2001 (Wesley et al., 2001). The RNAi construct was then excised from pKANNIBAL and introduced into the binary vector, pART27 (Gleave, 1992) for plant transformation Figure 2.2). Transgenic seedlings were selected on kanamycin. Those transformed with the BEL1 RNAi construct were screened for the BeM phenotype, and those transformed with the SAW1 RNAi construct were visually screened for morphological phenotypes. Table 2.7 Primers used to amplify and facilitate cloning of BEL1 and SAW1 DNA for RNAi Two restriction sites have been added to each primer to allow a two step cloning of the fragments in opposite sides of the intron sequence in the pKANNIBAL vector (see Figure 1.1 for the final orientation of the inserts in the T-DNA). First cloning step was done using the enzymes marked in green and the subsequent cloning step was done with the enzymes marked in red. Gene Forward primer Restriction Sites Reverse primer Restriction sites Amplif ied fragment length (bp) gtgaHHfctcgagccacgtggtg acgtttcct act^Botcgagccgagagaga gagctctgga aat^^Htggtacctgagctcccatca aattcc aatMfegtaccttgaagatacctcc ttggtg BEL1 SAW1 1 Kpn 1 mM Kpn 1 209 186 B pART27-S4 W1Rm\ T-DNA region Figure 2.2 T-DNA regions of the RNAi constructs A DNA fragment that included the CaMV35S promoter, gene fragments in opposite orientations separated by an intron sequence and the Ocs terminator sequence was excised from pKANNIBAL using Not I enzyme and subcloned into the Not I site in pART27. NPT II that confers kanamycin resistance enabled selection of transgenic plants. 64 2.5. Complementation of sawl saw2 with a SAW2 genomic fragment I used Expand High-Fidelity polymerase (Roche) to amplify a WT genomic fragment containing the SAW2 coding sequence (including introns), as well as 3000 kb of the 5' and 1000 kb of the 3' sequence, using the primers 5' TTCGCGGCCGCTGCTATTTCAAGGACGTGAGC 3' and 5' CTAGCGGCCGCAT TGTGACTTATTGGCGCTTTCC 3'. Genomic DNA isolated from leaves of wild type plants was used as a template and was isolated using the method of Dellaporta et al, 1983 (Dellaporta et al., 1983). The PCR conditions included 45 cycles with annealing at 56 °C and a 6 minute extension at 72 °C. I cloned the fragment directly into pART27 binary vector (Gleave, 1992), and then transformed it into sawl saw2 double mutant plants. I evaluated selected transformants for complementation of the mutant phenotypes. pART27-SAW2 Genomic T-DNA region Not I—v / Not\ RJI I TTC-LB LacZ (fragment)-- I SAW2 Genomic fragment (7987 bp)- 1 1 "-Nos-T •-NPTII Nos-P LacZ (fragment) Figure 2.3 T-DNA region of the SAW2 genomic DNA construct. The 8kb SAW2 genomic DNA sequence was amplified and cloned directly into pART27 into the Not 1 site. NPT II that confers kanamycin resistance enabled selection of transgenic plants. 65 2.6. Characterization of mutant phenotypes All macroscopic photos were taken using a Nikon CoolPix camera (Nikon, Dusseldorf, Germany). Micrographs were taken using a dissection or compound microscope equipped with Spot digital camera and Northern Eclipse software. Adobe Photoshop (Adobe, Mountain View, CA) was used for image processing and the creation of montages. To measure lengths of leaf serrations, leaves were scanned using a Canoscan 8400DF scanner (Canon Inc., Tokyo, Japan). Scanned images were converted to grey-scale and threshold was adjusted to include only the leaves. Measurements were made using ImageJ software (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, http://rsb.info.nih.gov/ij/, 1997-2006) calibrated with a scanned ruler. To evaluate cells of the 35S:SAW1 plants, epidermis was peeled from the bottom 3 internodes of stems of 5-week-old plants, mounted in 50% glycerol on glass slides. Cell counts and measurements were made using phase-contrast optics of a compound light microscope. CHAPTER 3 : RESULTS 66 3.1. Phylogenetic analysis of the BLH family of homeodomain proteins In Arabidopsis, there are twelve TALE homeobox genes closely related in sequence to BEL1 including BLH1-7,10,11 (for BEL1-LIKE HOMEODOMAIN) BELLRINGER (BLR), POUND-FOOLISH (PNF) and ATH1 (this study; (Becker et al., 2002; Bellaoui et al., 2001; Byrne et al., 2003; Cole et al., 2006; Hackbusch et al., 2005; Quaedvlieg et al., 1995; Reiser et al., 1995; Roeder et al., 2003; Smith et al., 2004; Smith and Hake, 2003). As mentioned in the literature review (page 35) and summarized in Table 3.1, functions for several of the family members have been deduced by studies of mutants and of overexpression lines. The BLH proteins share at least three regions of sequence similarity: the DNA-binding homeodomain and the BEL and SKY domains involved in BLH interactions with KNOX TALE homeodomain proteins (Becker et al., 2002; Bellaoui et al., 2001). As we can see in Figure 1.14, BLH proteins are grouped together in a branch distinct from the KNOX genes. Phylogenetic analysis of this gene family (Figure 1.14; Becker et al., 2002) indicates that the genes with the highest sequence similarity to BEL1 are two genes formerly referred to as BLH2 and BLH4, (Becker et al., 2002; Bellaoui et al., 2001) that I designate SAWTOOTH1 (SAW1) and SAWTOOTH2 (SAW1), respectively, based on their leaf phenotype (see below). Since many of the branches of the N J tree presented in the literature review (Figure 1.14) did not have sufficient bootstrap support, I constructed another phylogentic tree based on the maximum likelihood method (Felsenstein, 1981; Kishino et al., 1990) using an amino acid alignment including only the three conserved domains of the BLH family (Figure 3.1) as the template. This tree gives better support to many of the branches, including the grouping of SAW1 and SAW2 with BEL1 (Figure 3.2). Since the protein is more closely related to SAW1 and SAW2 than to the other BLH proteins (Figure 3.2; 73% and 72% protein sequence similarity respectively), I focused my thesis research on the reverse genetic analysis of SAW1 and SAW2 as the proteins most likely to have overlapping functions with BEL1. 67 Table 3.1 Summary of the BLH gene family in Arabidopsis Gene AGI Number Paralog ESTs/cDNAs reported Mutant Phenotype Reference ATH1 At4g32980 Yes Early flowering observed in ath1 mutant. Late flowering phenotype observed in overexpressors of ATH1. (Rutjens et al., 2006; van der Valk et al., 2004) BEL1 At5g41410 Yes Female sterile due to lack of an embryo sac and improper integument development in the ovules. (Modrusan et al., 1994; Reiser et al., 1995; Robinson-Beers et at, 1992) BLH1 At2g35940 Yes No data SAW1 (BLH2) At4g36870 SAW2 Yes Defects in leaf morphogenesis in sawl saw2 double mutants This thesis BLH3 At1g75410 BLH10 Yes Early flowering when BLH3 is overexpressed (Cole et al., 2006) SAW2 (BLH4) At2g23760 SAW1 Yes Defects in leaf morphogenesis in sawl saw2 double mutants This thesis BLH5 At2g27220 Yes No data BLH6 At4g34610 BLH7 Yes No data BLH7 At2g 16400 BLH6 No* No data PNF At2g27990 BLR Yes pnf pny double mutants fail to flower (Smith et al., 2004) BLR/ PNY/ RPU VAM At5g02030 P N F Yes Defects in inflorescence architecture and fruit maturation (Bao et al., 2004b; Bhatt et al., 2004; Byrne et al., 2003; Roeder et al., 2003; Smith and Hake, 2003)3) BLH10 At1g 19700 BLH3 Yes No data BLH11 At1g75430 BLH3 No* No data *No recorded cDNA or E S T submission, but expression changes observed in tissues in various microarray experiments that were analysed through Genevestigator (Zimmermann et al., 2004) A SR/KY domain N B E L L domain Homeodomain B BELL Domain B E L l SAW1 SAW2 ATH1 B L H 5 BLH1 P N F B L R B L H 1 1 B L H 3 B L H 1 0 B L H 7 B L H 6 Homeodomain B E L l SAW1 SAW2 ATH1 B L H 5 B L H 1 P N F B L R BLH11 B L H 3 B L H 1 0 B L H 7 B L H 6 Figure 3.1 Conserved domains in the BLH proteins. A. Graphical depiction of a BLH protein showing the relative positions of the conserved domains. B. Protein sequence alignment of the 13 BLH proteins showing the conservation of amino acids in the SR /KY , BELL and homeodomain regions. The identical amino acids are shaded black and the similar amino acids are shaded grey. 69 • B L H 1 74 91 ATH1 BLH5 94 B L H 1 1 69 88 ' ^BLH3 B L H 7 BLH6 I R P N F 1 0 0 BLR — BEL1 86 SAW 1 S A W 2 Figure 3.2 A maximum likelihood phylogram of the 13 members of the BEL1-like homeodomain (BLH) protein family. Bootstrap values are shown at the branch points. 70 3.2 SAW1 and SAW2 are paralogous genes 3.2.1. SAW1 and SAW2 are products of recent chromosomal duplication SAW1 and SAW2 proteins share 87% amino acid identity and are located on chromosomes 4 and 2, respectively (Figure 3.3A). The chromosomal regions surrounding SAW1 and SAW2 share extensive sequence similarity (Table 3.2; Figure 3.3; Blanc et al, 2003) suggesting that SAW1 and SAW2 arose from segmental chromosomal duplication of one of the two loci. According to Blanc et al. (2003), the region belongs to an extensive and relatively recent duplication event that occurred around 24-40 mya (million years ago), prior to the divergence of Arabidopsis from Brassica species. Almost 70-90% (80 MB) of the Arabidopsis genome is covered by these duplicated regions (Blanc et al., 2003; Bowers et al., 2003; Simillion et al., 2002). An estimated 70% of the duplicated genes have become single copy genes due to chromosomal rearrangements and deletions (Blanc et al., 2003). Therefore the duplicated genes are interspersed with single copy genes and pseudogenes. The high sequence identity between SAW1 and SAW2, as well as their chromosomal locations in this duplicated region, suggest that they are products of this chromosomal duplication event. Table 3.2 A list of paralogous genes found in the duplicated region that includes SAW1 and SAW2. Gene Paralog Description Exp Identity Similarity At2g23630 At4g37160 pectinesterase like protein 3.8E-192 78% 87% At2g23680 At4g37220 cold acclimation protein homolog 1.0E-33 44% 63% At2g23690 At4g37240 unknown/putative protein 1.0E-28 59% 66% BEL1-like homeobox proteins (SAW2 and At2g23760 At4g36870 2 9E-114 61% 70% At2g23790 At4g36820 hypothetical/putative protein 8.4E-100 66% 80% At2g23800 At4g36810 geranylgeranyl pyrophosphate synthase 1.2E-101 72% 86% The genes were identified using the web-based software available at http://wolfe.qen.tcd.ie/athal/index.html (Blanc et al., 2003). Various single copy genes occurring in the region due to deletions and chromosomal rearrangements have not been included. 71 SAW2 Chr 2, 20.36MB Chr 4, 19.20 MB B SAWl 16.8 16.83 Mb Figure 3.3 SAW1 and SAW2 are found in regions of chromosomal duplication. A. Graphical map of chromosomes 2 and 4 of Arabidopsis. Maroon boxes highlight the homologous regions in the two chromosomes that include SAW2 and SAW1 genes. The size of the chromosomes is shown in MB (Mega base pairs). B. Close-up of the homologous regions showing the duplicated genes. The interspersed single copy genes have not been shown. Red boxes highlight the locations of SAW2 and SAW1 in chromosomes 2 (top) and 4 (bottom) respectively. The graphical output was generated using the duplicated blocks finder at http://wolfe.qen.tcd.ie/athal/index.html (Blanc et al., 2003). 3.2.2. SAW1 and SAW2 share sequence similarity at the 5'UTR 72 Since SAW1 and SAW2 exhibit a high degree of sequence similarity, it is possible that the two genes share similar functions and exhibit similar expression patterns. Indeed, a comparison of the regions upstream to the translational start sites of SAW1 and SAW2 genes shows three conserved regions in the 5' untranslated region (Figure 3.4), indicating that they might have common transcriptional and post-transcriptional regulatory elements. SAWl AAAAAAACAGCGTAAGACCTAGTT -197 to -140 SAW2 AGAAAAACTGTATAATACCTAGTT + ****** -k *** * * -k k * * -k -k SAWl AAAAGGAGAGTCCAGAAAAAGAAAGCGAGAAAGAGAG -344 to -308 SAW2 AAAAGAGTACT CAAGAAAAAGAAAGCTAGAGAGAGAG ***** -k * + -k * -k k -k * -k * k -k -k * -k k-k-k ****** SAWl AACCAACTAATAAAGAAGATTGGTGGGCTAAAAAGGGTGACGAAGAAGAAAGAAGAGTGACCTCT -521 to -457 SAW2 AAAAAAATATTAAAGAAGATTGGTGGGTTAAAAAGGGAGGCGATGAAGAAAGAACAGCGACCTCT ** ** **.***************** ********* * *** ********** ** ******* Figure 3.4 Three conserved regions found in the 5' UTR of SAW1 and SAW2 genes. Identical residues are marked by * . Numerical values indicate distance upstream of the translational start site (0). 3.2.3. SAW1 and SAW2 are co-expressed at many developmental stages and in many stress responses Results of a PRIMe (Platform for Riken metabolomics) microarray co-expression gene search ( h t t p : / / p r i m e . g s c . r i k e n . j p / ) with either SAW1 or SAW2 identifies the other as the best co-expression match, suggesting that the two genes might have common regulatory elements controlling their expression. Pearson's correlation coefficient (r2) is a measurement of how closely related the expression profiles of two genes are based on multiple microarray results. A correlation coefficient of 1 indicates that a pair of genes has identical expression profiles. When SAW2 was used to search tissue- and development-specific microarray data using the PRIMe search tool, SAW1 was picked up as the coexpressed gene with an r2 of 0.79 (Table 3.3). An r2 of 0.68 was found for the database including 1388 experiments at AtGenExpress (http://www.uni-tuebingen.de/plantphys/AFGN/atgenex.htm). These microarrays include development-, 73 hormone-, and stress-related microarray experiments. These data indicate that SAW1 and SAW2 respond similarly to many environmental and developmental cues. Table 3.3 PRIMe search results for genes coexpressed with SAW2 Source Gene Target Gene Pearson's Correlation Coefficient* SAW2 SAW2 1 SAW2 SAW1 0.789 Co-expression gene search performed at: http://prime.psc.riken.jp/?action=coexpression_index. Calculated from 237 microarray experiments that studied tissue and development specific gene expression. Gene Correlator (Zimmermann et al., 2004) was used to find the individual occurrences of SAW1 and SAW2 in 963 wild type specific microarray experiment data available through AtGenExpress. As visualized in Figure 3.5, both genes are expressed in most of the experiments (red points), and there are a few experiments in which neither gene is expressed (green points). Interestingly, there are many experiments where SAW2, but not SAW1, is expressed (blue points), but no experiment where only SAW1 is expressed. A closer look at the experiments represented by the blue points indicates that most of these experiments were performed in root tissues, hinting that SAW1 in roots might be lower than the threshold or that it may not be expressed in the roots. The coexpression data adds support to the hypothesis that the two paralogous genes SAW1 and SAW2 are functionally redundant, as they seem to be expressed in overlapping domains. This would complicate genetic and reverse-genetic screens as the function of one could mask the loss of function of the other. 74 Pearson's correlation coefficient: 1^=0.742 Genecorrelator Log2(n) adjusted 2.58 • • • • i 267298_atIHT2G23768 • both present . both absent • only SAW2 present • only SAW1 present Figure 3.5 Correlation of SAW1 and SAW2 expression patterns SAW1 is plotted on the Y-axis and SAW2 is plotted on the X-axis. Values in the axes indicate Log2(n) signal intensity. Each point represents the results of one microarray experiment. The plot was generated by scanning 963 microarray experiments submitted to AtGenExpress using Gene correlator (https://www.aenevestiaator.ethz.ch/at/index.php?paqe=2) (Zimmermann et al., 2004) 75 3.3. Analyses of SAW1, SAW2 and BEL1 gene expression 3.3.1. Virtual northerns show that SAW1, SAW2 and BEL1 are expressed in numerous organs in the plant The publicly available data from several microarray experiments have led to the development of many data mining programs. The Digital Northern program included in the Genevestigator package queries selected microarray experiments to find the expression of the gene(s) of interest (Zimmermann et al., 2004). I used the Digital Northern software to look at the expression of SAW1, SAW2 and BELL I chose data from 144 microarray studies posted on AtGenExpress (http://www.uni-tuebingen.de/plantphys/AFGN/atgenex.htm) by the Weigel laboratory (Schmid et al, 2005) and Weisshaar laboratory (unpublished) for my analysis. In these experiments, Affymetrix ATH1 chips with 22 000 spots (each spot representing a probe set with DNA sequences specific to a particular gene or to a control) were hybridized with tissue- or organ-specific cDNA. The data retrieved by Digital Northern showed the absolute intensities of SAW1, SAW2 and BEL1 in each experiment. Since each experiment differs from the others by various parameters, the signal intensities are not comparable between experiments. To make the data comparable, I normalized the signal intensities of each of the genes with the signal of ACTIN8, a constitutively expressed gene (An et al., 1996). I also normalized the samples using GAPC, another constitutively expressed gene, and obtained similar values (except in seeds, where there seems to be a reduction in GAPC expression). A comparison of relative abundance of SAW1, SAW2 and BEL1 transcripts in some of the tissues (normalized to ACTIN8) is shown in Figure 3.6. All three genes seem to be expressed in almost all the stages of development, albeit in varying amounts. Transcripts are most abundant in the reproductive tissues, petals, sepals and siliques. BEL1 is also highly expressed in stage 12 carpels. BEL1 is involved in integument development in stage 12 carpels (Modrusan et al., 1994) and has been shown to be expressed in the ovules in this stage (Reiser et al., 1995). It is interesting to note that SAW2 expression is higher than that of SAW1 in most of the tissues examined. This might be a result of differential hybridization of the SAW1 and SAW2 probesets. However, it is interesting to note that SAW2 transcripts might really be more abundant than SAW1 transcripts; this is a 76 feature common to many functionally redundant gene pairs where one gene shows higher expression than the other (Duarte et al., 2006). B CD O c ra T3 c ra CD > _ CD 9 0 8 0 7 0 6 0 5 0 4 0 3 0 2 0 1 0 0 MBEL1 • SAW1 DSAW2 i s 6S? .£* ^ ^ Kf v V CO o c TO T3 C 3 n TO CO > re CO or 500 450 400 350 300 250 4 200 150 100 -| 50 0 Hi A im J> A? ^ <f+ ^ ^ ^ ^ * * * * * ^ o N - x ^ -a - P . -o. A<a Ae e^> Ae> e^. .cP ^ ^ ^ fP" X* 1 # ^ (SY HBEL1 • SAW1 • SAW2 Figure 3.6 Relative abundance of SAW1, SAW2 and BEL1 transcripts. Data from 144 microarray studies posted on AtGenExpress (http://www.uni-tuebingen.de/plantphys/AFGN/atgenex.htm) by the Weigel laboratory (Schmid et al, 2005) and Weisshaar laboratory (unpublished) and analyzed using Genevestigator: Digital Northern (Zimmermann et al. 2004) A. Vegetative tissues; B. Reproductive tissues. Stage 12 organs are in closed, immature flowers. Stage 15 flowers are mature flowers post anthesis (Smyth et al., 1990). Absolute signal intensity values were normalized with ACTIN8 signal intensities and relative abundance was calculated by taking the mean normalized value as 100. Normalization using GAPC also yielded similar results. 77 3.2.2. Comparison of the expression patterns of the three genes by RT-PCR Semi-quantitative reverse transcriptase (RT) PCR was used to compare the expression of SAW1, SAW2 and BEL1 in vegetative and reproductive tissues. The results of the RT-PCR indicate that SAW1, SAW2 and BEL1 are expressed in all of the tissues that were assayed (Figure 3.7), consistent with the virtual northern results (Figure 3.6). As was suggested by the virtual northerns the expression of all three genes was low in the roots. Also, SAW1 expression was lower than SAW2 expression in both root and silique samples, as was observed in the virtual northern output. However, contrary to the digital northern results, the expression of SAW1 seemed to be higher than that of SAW2 in seedling, leaf and stem samples. The efficiencies of the PCR amplification of the different genes might account for such differences; this question could be resolved by performing a real time PCR wherein the output can be analysed for amplification efficiencies. BELl\ 30 Cycles SAW1~ SAW2 ACT8 30 Cycles 30 Cycles 23 Cycles Figure 3.7 R T - P C R analysis of BEL1, SAW1 and SAW2 RNA was extracted from roots of 7 day old seedlings; whole 7 day old seedlings; rosette leaves (6,7 and 8) of 4 week old plants; and stems, inflorescences and immature siliques of 5 week old plants. ACTIN8 was used as a loading control. 78 3.2.3. Examination of the expression in different tissues using promoter:GUS fusions Although northern blots and in situ hybridizations done previously in the Haughn laboratory have produced some information regarding BEL1 and SAW1 expression patterns at the tissue and cell-specific levels, nothing was known about SAW2 expression patterns. As mentioned in the previous section, RT-PCR confirmed that SAW2 is expressed in the same tissues as SAWL To further confirm and extend the expression pattern found by RT-PCR, in situ hybridization and in silico analysis, I used the GUS reporter system. The GUS (p-glucuronidase) reporter gene, driven by the BEL1, SAW1 and SAW2 promoters, was transformed into plants. The standard GUS histochemical assay (Jefferson et al., 1987) was used to detect cells expressing GUS in the transgenic plants. Approximately 72 selected transformants were assayed for GUS activity. In all the three promoter:GUS constructs, more than 80% of the transformed lines that tested positive for GUS expression showed consistant expression in leaves, stems and flowers. Lines belonging to this category were chosen for detailed expression analysis. Unlike BELL (Bellaoui et al., 2001; Reiser et al., 1995) (Figure 1.8A), SAW1 and SAW2 were not expressed in developing ovules (Figure 1.8 B and C) and therefore would be unable to substitute for BEL1 function in ovule development. This is consistent with the fact that mutation of BEL1 results in an ovule mutant phenotype (Reiser et al., 1995). Figure 3.8 Expression analysis of SAW and BEL1 genes: Ovules A. Immature ovules showing BELL.GUS activity. B. SAWLGUS expression in whole mount gynoecia. Gynoecia have been split open to reveal the mature ovules (Green arrow). Red arrow indicates the style. C. SAW2:GUS expression in whole mount gynoecia. One of the gynoecia was split open to reveal the immature ovules (Purple arrow). Red arrow indicates the style. 79 In contrast, the expression domains of BEL1, SAW1 and SAW2 overlapped extensively outside the ovule. In flowers, all three genes were expressed in the sepals. SAW1 and SAW2, but not BEL1, were expressed in the anther filament (af), style (st) and transmitting tract (tt) (Figure 3.9B and C), while only BEL1 was expressed in the ovary walls (green arrow) and at the base of the flower (receptacle). SAW1 showed a unique, but faint, expression in the petals. Figure 3.9 Expression analysis of SAW and BEL1 genes: Flowers Whole mounts of flowers showing A. BEL1:GUS, B. SAW1:GUS and C. SAW2:GUS activity. Green arrow indicates the GtVS.expression in the carpel wall, af, anther filament; pe, petal; se, sepal; st, style; tt, transmitting tract. In developing leaves, BELV.GUS was localized to the adaxial side (Figure 3.10D), similar to the adaxial expression observed for SAW1 in leaf in situ hybridization experiments (Figure 3.10E; Kushalappa and Haughn, unpublished results) and for SAW2 in the cotyledons of a developing embryo (Figure 3.1 OF). SAW1 was also found to be expressed in the adaxial side of developing sepals (Pidkowich, 2001), suggesting a role for these genes in the development of lateral organ asymmetry. SAW1, SAW2 and BEL1 were all expressed in mature leaves, with a more uniform adaxial/abaxial distribution. BEL1 expression is fairly uniform throughout the mature leaf; however, SAW1 and SAW2 show higher expression in vasculature and hydathodes in comparison to the mesophyll and epidermal cells (Figure 3.10A,B and C), BEL1, SAW1 and SAW2 expression patterns also overlapped in the stem, pedicel, root and embryo (data not shown). 80 Figure 3.10 Expression analysis of SAWand BEL1 genes: Leaves and cotyledons Whole mounts of fifth leaves of 3 week old plants showing A. BEL1:GUS, B. SAW1:GUS and C. SAW2:GUS activity respectively. Arrows identify expression in hydathodes. D. Longitudinal section through the vegetative apex of a 7-day old seedling showing adaxial expression of BELV.GUS. E. Cross section through the vegetative apex showing in situ localization of SAW1 in the adaxial side of developing leaves (Kushalappa and Haughn, unpublished results). F. Whole mount of a developing embryo showing SAW2:GUS in the adaxial side of the cotyledon (Blue arrow). 81 3.3. Functional analysis of SAW1 and SAW2 3.3.1. An attempt to generate RNA mediated interference (RNAi) to generate SAW1 and SAW2 silenced lines RNAi is a powerful tool that utilizes host-derived mechanisms to induce gene silencing by targeted degradation of gene transcripts, thereby repressing the function of the target gene. I used the pKANNIBAL-based RNAi-inducing system (Wesley et al., 2001) to generate SAW1 constructs for silencing in plants. A 200 bp gene-specific DNA fragment was used for the RNAi constructs. A BEL1 RNAi construct was also made to use as a positive control as the BeH female sterility phenotype is very obvious. The effectiveness of the BeH mutant phenocopy in plants transformed with this construct was used to measure the efficiency of silencing. The RNAi constructs were transformed into wild type plants. For each of the two RNAi constructs, I screened 72 kanamycin-resistant T-i plants for visible phenotypic defects, but all of them looked normal. Even the plants transformed with the 8EL7-RNAi construct did not show the known ovule phenotype, indicating that the BEL1 gene was not being silenced. To test the silencing of the SAW1 gene, I checked its transcript levels in the leaves of S/\H/7-RNAi lines using RT-PCR. None of the 12 transformants tested showed a significant reduction of SAW1 transcripts. Since functional redundancy was suspected, one the loss-of-function T-DNA insertional lines that had been identified for SAW2 (see below), was used as a background to further test the SAW7-RNAi construct. Saw2-1 was transformed with the SAW1-RNAI construct, and the transformants were screened for the double mutant phenotypes described below. As before, no phenotypes were detected in the selected transformants. 3.3.2. SAW1 and SAW2 loss-of-function and reduced expression lines To learn more about the functions of SAW1 and SAW2 in planta, we examined sawl and saw2 mutant alleles obtained through the Salk collection of T-DNA insertion lines (Alonso et al., 2003) and by screening EMS-mutagenized plants by TILLING (Colbert et al., 2001; McCallum et al., 2000; Till et al., 2004). Table 3.4 lists the 82 mutants identified for SAW1 and SAW2. Figure 3.11 shows the positions of insertion or mutation in the genes for some of these alleles. One T-DNA insertion was found in the SAW1 gene; this line was designated the saw 1-1 allele. The T-DNA in this allele was inserted into the third intron that separates the two exons that code for the homeodomain region. For SAW2, two insertions were found, designated saw2-1 and saw2-2. The saw2-1 line has an insertion in the first intron, and saw2-2 has an insertion in the first exon of the SAW2 gene. RT-PCR was used to examine transcript abundance in the sawl and saw2 T-DNA insertion lines. The SAW1 transcript was reduced in the saw1-1 mutant in comparison to the WT level (Figure 3.11). However, no reduction in SAW1 transcripts was observed when a primer pair specific to the 5' UTR was used. This indicates that the majority of the transcripts produced in the saw1-1 mutant are probably truncated at the homeodomain. Since the saw1-1 T-DNA insertional line still has detectable full-length SAW1 transcripts, this allele might be hypomorphic. However, since the full-length transcript level is very low in this line, it may still have a severely reduced SAW1 function. In constrast, neither the saw2-1 nor the saw2-2 insertional allele had any detectable full-length transcripts (Figure 3.11); thus, they are likely to be null mutant alleles. In addition to the saw1-1 T-DNA insertional allele, several sawl alleles were identified by TILLING. These have missense mutations that result in non-conservative amino acid substitutions that could alter the function of the encoded protein. All mutant alleles segregated in F2 populations as expected for single nuclear loci (data not shown). However, despite the predicted deleterious effects of the different mutations to the expression or protein function of the affected genes, no obvious morphological defects in the shoot segregated with any of the alleles examined under our normal growth conditions. 83 Table 3.4 Sawl and Saw2 mutants obtained by TILLING and T-DNA insertion Gene Allele Type of mutation Single mutant phenotype Double mutant phenotype SAW1 Saw1-1 Insertion in intron No Yes Point; E249K* SAW1 Saw1-2 Glutamate -^Lysine No Yes Point; E118K SAW1 Saw1-138g8 Glutamate —^Lysine No No Point; S192F SAW1 Saw1-96h3 Serine -^Phenylalanine No Not tested Point; P161S SAW1 Saw1-105e7 Proline —>Serine No No SAW2 Saw2-1 Insertion in first intron No* Yes SAW2 Saw2-2 Insertion in first exon No* Yes The mutants identified by TILLING were EMS-induced point mutations. # Indicates the amino acid change resulting from the mutation. For example E249K means E (glutamate) is changed to K (lysine) at amino acid 249 of the SAW1 protein. *Similar to that of the double mutant, but the phenotype is very weak and often indistinguishable from wildtype. A SAW1 SAW2 saw 1-2 EMS (E249K) saw1-1 T-DNA insert saw2-2 saw2-1 T-DNA insert T-DNA insert SAW2 GAPC Figure 3.11 Saw loss of function mutants A. Graphical representations of the transcribed regions of SAW1 and SAW2 genes. Black, white, and grey boxes indicate exons, introns, and untranslated regions, respectively. The position of mutation/insertion in each mutant allele is marked by a triangle. . B. RT-PCR analysis of SAW1 and SAW2 expression in wild type (col) and saw mutants. The 5 t h and 6 t h leaves were harvested from 4-week old plants for RNA extraction and cDNA synthesis, (a) SAW1 expression is considerably reduced in saw1-1 compared to wild type. GAPC (cytosolic-glyceraldehyde-3-phosphate dehydrogenase) was used as a loading control. SAW1, 35 cycles; GAPC, 28 cycles, (b) There is no detectable SAW2 expression in the leaves of saw2-1 mutants, but SAW2 is detected in wild type leaves. SAW2, 35 cycles; GAPC, 25 cycles. 84 3.3.2. Saw double mutants have altered leaf morphology Since SAW1 and SAW2 are products of chromosomal duplication (Figure 3.3) and have very similar expression profiles, I suspected that the lack of visible defects in the single mutants might be because of functional redundancy and decided to examine saw1-1 saw2-1 double mutants. I crossed saw1-1 with saw2-1 and genotyped individual F2 progeny using PCR to assay the presence of WT or mutant amplified fragments. All saw1-1 saw2-1 double mutants, unlike the single mutants, had a distinct mutant phenotype characterized by increased serrations in leaf margins and revolute leaves with abaxially curled margins (Figure 3.12). In a wild type leaf, SAW1 and SAW2 exhibit strong expression in the region that includes the hydathodes, which are markers for leaf serration, indicating that the domain specific expression of the SAW genes correlates with the observed loss of function phenotypes. After seeing the double mutant phenotype, I noticed that the saw2 single mutants also had slightly revolute margins, but the phenotype was not as obvious as in the double mutant. The single saw2-1 mutants also showed a slight increase in serration length and numbers. The serrations observed were most prominent in the seventh and subsequent leaves initiated; these leaves have a sawtooth appearance, hence the genes were designated as SAWTOOTH (SAW1 and SAW2). The double mutants had significantly more and deeper serrations than wild type or the single mutants (Table 3.5). Also the number of serrations increased with leaf number (Figure 3.13). Plants heterozygous for either of the two mutations and homozygous for the other also exhibited serrations (less prominent than those of the double mutants), indicating that this phenotype is dosage-dependant (data not shown). In addition to the leaf margin defects, saw1-1 saw2-1 double mutant leaves are darker green in colour and the third and fourth leaves of the double mutant are more elongated than the wild type leaves of the same stage. The plants produce more leaves than wild type and their flowering is delayed by 2-3 days in our continuous light growth conditions (Table 3.5). 85 Figure 3.12 SAW affects leaf margin development. (A) 4 week old plants of a) Col, b) saw1-1, c) saw2-1 and d) saw1-1 saw2-1. Arrow points to a leaf with serrated margins. (B) Leaf margins of saw 1-1 saw2-1 double mutants are more revolute than WT leaf margins, as shown by an abaxial view of the eighth leaf of 4-week old wild type (left) and saw1-1 saw2-1 (right) plants. (C) The difference in the length of leaf serrations is more pronounced in older plants, as shown by an adaxial view of the ninth leaf of five-week old wild-type (left) and saw1-1 saw2-1 plants (right). (D) A comparison of the leaves of 4-week old wild type (top) and saw2-1 saw1-1 (bottom). Saw1-1 saw2-1 double mutants had more serrations than WT from the seventh leaf onward. The fourth leaf of the double mutant was longer and more ovate than fourth wild type leaf. 86 Table 3.5 Serration length and flowering time in wild type and saw mutants Average serration length (mm)* n Days to bolting n Number of rosette leaves at bolting n wild type 0.54 ± 0.039 a 17 26.14 ± 0 . 2 7 a 9 7 . 9 5 ± 0 . 1 9 a 9 saw1-1 0.75 ± 0.074 a° 9 25.66 ± 0.2 a 9 7.92 ± 0 .27 a 9 saw2-1 0.86 ±0.071° 11 26.25 ± 0.45 a 9 8.08 ± 0.2 a 9 saw1-1 saw2-1 1.31 ±0 .073° 21 29.95 ±0 .35° 12 10.36 ±0 .22° 12 Values are mean ± S E . # serrations were measured in the seventh leaf of 4 week old plants, a, b and c in each column denote significant differences (ANOVA, P=0.05). Means with the same letters are not significantly different. 18 16 to 14 c o '•5 12 CD S — 0 CO CD E 3 10 8 6 - J — 4 5 6 7 8 Leaf Number 10 11 12 • Wt s sawl-1 A saw2-1 « sawl-1 sav&-1 Figure 3.13 Increased leaf serrations in saw mutants Scatter plot showing the number of serrations for each leaf of 5 week old wild-type (wt), saw1-1, saw2-1 and saw1-1 saw2-1 plants. Serrations were counted only on the rosette leaves that had been initiated prior to bolting. Points represent means + S E from 9, 9, 9, and 12 plants, respectively. Similar results were obtained in two additional experimental replicates.. 87 3.3.3. Evidence that the observed phenotypes are linked to SAW1 and SAW2 loci 3.3.3.1. The Saw leaf phenotypes cosegregate with the SAW genes Co-segregation of the phenotype with the mutant genes was analysed using PCR-based genotyping. 72 plants of the segregating F2 progeny of the cross between saw1-1 and saw2-1 were genotyped. The mutant alleles showed proper Mendelian segregation of the two genes and all five double mutants obtained were late flowering and exhibited more serrations than the other F2 progeny of the cross. 3.3.3.2. Multiple allele combinations exhibit similar phenotypes To further confirm that the Saw phenotype is caused by lesions in the SAW genes, I made crosses to produce different allele combinations of sawl saw2 double mutants and examined them for the mutant phenotype. Although 2 of the 3 sawl EMS alleles tested failed to produce the double mutant phenotype, one EMS allele, designated saw1-2, did make a double mutant with the same phenotype as that of saw1-1. Saw double mutants carrying different sawl and saw2 allele combinations (saw1-1 saw2-1; saw1-2 saw2-1 and saw1-1, saw2-2) had similar phenotypes (Table 3.6). The serrations detected in saw1-2 saw2-1 double mutants were, however, smaller and fewer in number than those observed for saw1-1 saw2-1, yet significantly higher than wild type, indicating that saw1-2 might be a weaker allele. The saw1-1 saw2-2 double mutants also showed delayed flowering and increased leaf numbers. These data collectively suggest that the observed phenotypes are linked to the SAW1 and SAW2 loci. Table 3.6 Serrations on the seventh leaf of different allele combinations of saw mutants Wild-type saw1-1 saw2-1 saw1-2saw2-1 saw1-1 saw2-2 Average number of 5 . 5 ± 0 i 3 8 » 9.8 ± 0 3 7 ° 9.7 ± 0 4 1 b 1 0 2 ± 0 2 4 b serrations Values are mean ± S E ; n = 12. a and b denote significant differences (ANOVA, P=0.05). Means with the same letters are not significantly different. 88 3.3.3.3. A SAW2 genomic fragment can complement the sawtooth mutant phenotype To demonstrate that the saw mutant phenotype was linked to the lesion in the SA W genes, I transformed the saw1-1 saw2-1 double mutant with a genomic fragment containing the SAW2 gene and examined the transformed lines recovered for complementation of the mutant phenotype. 19 out of 28 transformants recovered showed a significant reduction in the number of leaf serrations ( Figure 3.14). Since the phenotype is dosage-dependent, both the number of copies inserted and the position of insertion may influence the phenotype in the transformants. This might account for the presence of some transformants with serrated margins comparable to those of the saw double mutants. 8 9 A 3 saw2-1 saw1-1 col saw2-1 saw1-1 saw2-1 saw1-1 Z empty vector S A W 2 genomic control fragment B re a> 1 4 saw2-1 saw1-1 col saw2-1 saw1-1 saw2-1 saw1-1 empty vector S A W 2 genomic control fragment Figure 3.14 C o m p l e m e n t a t i o n of sawl saw2 double mutants by a SAW2 g e n o m i c D N A fragment. A . N u m b e r of serrat ions o n the seventh leaf of sawl saw2 mutants, W T , a n d mutants t ransformed with the empty vector or with the SAW2 g e n o m i c fragment. E a c h bar represents serrat ions found for an individual plant ( independent transformant, for the t ransgenic plants). B. A v e r a g e of n u m b e r of serrat ions on the seventh leaves of controls a n d transformants. Error bars indicate s tandard deviat ion. 90 3.4. Genetic interactions with other genes: BEL1, BP (GUS), and AS1 3.4.1. Saw phenotypes are not enhanced by bell Since BEL1 and the SAW proteins are very similar in structure, expression and interaction pattern, a triple mutant was generated with saw1-1 saw2-1 and be/7-7 to check for potential genetic redundancy or interaction. The progeny of a selfed F2 plant that was homozygous for saw7-7 and saw2-1 and heterozygous for be/7-7 (be/7-7 is female sterile) were screened for triple mutants. The triple mutants identified showed an additive phenotype including both be/7-7 like ovule defects and serrated leaves similar to those of the saw1-1 saw2-1 double mutant. This result suggests that the functions of BEL1 and SAW proteins are non-overlapping; and thus that these proteins are not functionally redundant in tissues where their expression overlaps. Alternatively, further functional redundancy might be masked by other as yet uncharacterized redundant protein(s). 3.4.2. BP is ectopically expressed in the leaves of sawl sawl double mutants The leaf serrations of the saw1-1 saw2-1 double mutants look similar to those found in the leaves of weak BP overexpression lines (Chuck et al., 1996). BP expression is repressed in wild-type leaves (Byrne, 2000). In order to determine whether there is a change in BP expression in the saw7-7 saw2-1 double mutants, I introduced a BP:GUS transgene (Oh et al., 2000) into a saw7-7 saw2-1 double mutant background by crossing the appropriate lines and screening the F2 population. BP:GUS expression was detected in the hydathodes (present at the tips of the serrations) of the saw1-1 saw2-1 double mutants (Figure 3.15) but not in wild type leaves. The intensity of GUS expression was roughly proportional to the size of the serration in the leaf margin (Figure 3.15D). BP:GUS expression was also observed in secondary serrations found in ninth leaf onwards (Figure 3.15D, arrow). Besides the ectopic BP:GUS expression in the leaf, MUG fluorometric assays (see methods) revealed increased BP:GUS expression in the inflorescence and stem internodes in the double mutant (Figure 3.16). This suggests that there might be a general derepression of BP (and perhaps other KNOX genes) in the absence of SAW1 and SAW2. 91 Figure 3.15 BP is misexpressed in leaf margins of saw double mutants. A. Whole mounts of BP:GUS col (left) and BP:GUS saw1-1 saw2-1 (right) leaves assayed for G U S activity. Arrow indicates the BP:GUS expression localized in the hydathodes. B. and C. Higher magnification darkfield images. (A): (B) BP:GUS col and (C) BP:GUS saw1-1 saw2-1 D. Darkfield image of a whole mount of the 9th leaf of a 4 week old BP:GUS saw1-1 saw2-1 plant assayed for G U S activity. Arrow points out BP:GUS expression in a secondary serration. 92 c 'si o L_ a. * 2 3 35 30 25 20 E 15 i 10 to « 5 o E Q. 0 C o l , inflo B P : G U S co l , inflo B P : G U S s a w l saw2, inflo C o l , s tem B P : G U S co l , s tem B P : G U S s a w l saw2, stem Figure 3.16 Increased BP:GUS activity in stems of sawl saw2 double mutants Protein was extracted from inflorescence apex and stem of Wild type (Col), BP:GUS in Col and BP:GUS in saw1saw2. Protein extract was used to assay BP:GUS activity by a M U G assay. Bars indicate the means + S D from 2 replicates each including 2 Col, 5 BP:GUS in Col, and 6 BP:GUS sawl saw2 samples. 93 3.4.3. SAW1 and SAW2 function synergistically with AS1 to control leaf margin development The as1 mutant of Arabidopsis exhibits lobing of the leaves and misexpression of BP and other related KNOX genes (Byrne et al., 2000; Semiarti et al., 2001; Tsukaya and Uchimiya, 1997). Like the sawl saw2 double mutant serrations, the number of lobes in the as1 mutant increases with the leaf number (Oh et al., 2000). To determine whether there is any interaction between SAW1, SAW2 and AS1, I constructed the sawl saw2 as1 triple mutant. The leaves (fifth leaf and higher) of saw1-1 saw2-1 as1-1 triple mutants exhibited more numerous lobes/serrations than as1 and also had deeper sinuses than either as1 or the saw1-1 saw2-1 double mutants (Figure 3.17). Although the triple mutant had more lobes than are found in as1 single mutants, the lobes were fewer in number than the serrations found in saw1-1 saw2-1 double mutants (Figure 3.18) . To determine whether the as1 phenotype is a consequence of SAW1 downregulation, I did an RT-PCR analysis of SAW1 expression in wild type and as1 leaves. I did not detect any reduction in SAW1 expression in the as1 mutant (Figure 3.19) . Therefore, AS1 and SAW1 must be functioning in parallel pathways to repress BP expression. The synergistic effects observed in the triple mutant also favour the hypothesis that the functions controlled by SAW1 and SAW2 are relatively independent of that controlled by AS1. Figure 3.17 Phenotypes of saw1-1 saw2-1 as1 triple mutants. A. Rosette leaves of 5 week old plants, (a) Wild type, (b) saw1-1 saw2-1, (c) as1 and (d) saw1-1 saw2-1 as1. The inflorescence has been removed from (b). B. A comparison of the leaves of 6-week old as1 (top) and saw1-1 saw2-1 asf(bottom). The top row of each panel has the rosette leaves formed prior to bolting. The bottom row rosette leaves are the ones formed after bolting (marked by the presence of secondary inflorescences in their axils). Size bar = 5 mm 95 • col a saw1saw2 A as 1 • saw1saw2as1 Figure 3.18 Leaf serrations in sawl saw2 as1 triple mutants Scatter plot showing the number of serrations for each leaf of 5 week old wild-type (col), saw1-1 saw2-1, as1 and saw1-1 saw2-1 as1 plants. Serrations were counted only on the rosette leaves that had been initiated prior to bolting. Points represent means + S E of 11, 8, 8 and 16 plants, respectively. Similar results were obtained in a second trial of the experiment. SAW1 SAW1 B S B B m 30 Cycles ACT8 1 23 Cycles Figure 3.19 Semiquantitative RT P C R analysis of SAW1 RNA was extracted from leaves of 4 week old plants of Columbia (Col), Landsberg erecta (Ler), asymmetric leaves 1 (as1) and asymmetric leaves 2 (as2). ACTIN8 has been used as a loading control. 96 3.5. Phenotypic characterization of 35S:SAW1 plants Former members of the Haughn laboratory (Dietmute Godt and Kumuda Kushalappa) overexpressed SAW1 by placing it under the control of the strong constitutive CaMV 35S promoter. Of 100 transformants that they recovered, fifteen showed similar morphological phenotypes. I went on to characterize the morphological defects in 35S:SAW1 plants. All aspects of the phenotype segregated together with the T-DNA and RNA blot analysis confirmed that the selected lines had a much higher level of SAW1 transcript than wild type (Kushalappa and Haughn, unpublished results). Taken together these data suggest that the phenotype is due to overexpression or ectopic expression of SAWL 3.5.1. 35S:SAW1 plants are severely reduced in size 35S.SAW1 shoots were significantly smaller than those of wild type (Figure 3.20). Mature leaves were smaller and rounder than those of WT plants. They were also either flat or curved toward the adaxial side; unlike wild type leaves that are slightly curved toward the abaxial side (Figure 3.20A) or the saw mutant that has revolute leaves (Figure 3.12). This phenotype suggests defects in the ab- adaxial polarity of 35S:SAWL Comparison of the cell types of the 35S:SAW1 ab- and adaxial leaf surfaces with those of wild type showed no obvious differences, indicating that the polarity defects were due primarily to differences in ad-abaxial growth rather than to defects in cell identity. About 5% of 35S:SAW1 plants also showed an acute bend in the inflorescence stem (Figure 3.20D, inset) suggesting a defect in meristem function. 97 Figure 3.20 Phenotypes of 35S:SAW1: Shoot morphology A. and B. 2.5 week old plants;(A) wild-type and (B) 35S:SAW1. Size bar = 5mm C. A comparison of the leaves of 3-week old wild-type (top) and SSS.SAW. Size bar = 2 cm D. Four-week old wild-type (left) and 35S:SAW1 (right) plants. Inset shows the fishbone-like growth defects observed in ~ 5% of the inflorescences (including coflorescences). Size bar = 2 cm. 3.5.3. Cell elongation and probably cell division is reduced in stems of 35S.SAW1 plants Internodal length of the of the inflorescence stem was significantly shorter than wild type and measurements of stem epidermal cell length indicated that the growth defect was due to both a decrease in cell size and number (Figure 3.20D, Table 3.7). Table 3.7 Cell size and cell number of stem epidermal cells in wild type and 35S:SAW1 plants Average cell length (mm) Length of internode (mm) Estimated number of cells in one internode n wild type 0.25 ± 0 .006 a 1 8 . 9 ± 0 . 7 a 74 6 35S:SAW1 0 . 1 4 ± 0 . 0 0 3 b 8 . 5 ± 0 . 5 b 64 9 Values are mean ± S E . a and b in each column denote significant differences (Student's t-Test, P=0.05). Means with the same letters are not significantly different. ' 98 3.5.2. Floral abnormalities are seen in the 35S.SAW1 plants The flowers of 35S:SAW1 plants also showed morphological defects (Figure 3.21). The number of organs in the second and third whorls was consistently less than wild type (Figure 3.21 A and B) and organ fusions were not uncommon (Figure 3.21A e,f), similar to the weak stm-2 allele that also exhibits a reduction in organ number and organ fusions in the second and third whorls (Clark et al., 1996). Like the leaves, floral organs were smaller than those of wild type. Petals were sometimes bent and pistils had an irregular bumpy appearance likely due to growth suppression in the silique valves (Figure 3.21A(c)). Finally, 35S:SAW1 plants were sterile due in part to reduced pollen development in the anther and a decrease in stamen length that prevented self-fertilization. A close examination of the anthers of 35S:SAW1 revealed that the developing pollen grains were arranged compactly and stayed clumped even when they were dissected out of the anthers (Figure 3.22). However, hand pollination of 35S:SAW1 pistils with their own pollen produced viable seed. Taken together, the overall small size of the 35S:SAW1 plants, the reduced cell elongation and division in their stems, and the reduction of organ number and organ fusions in their flowers suggest that SAW1 can act as a negative regulator of growth throughout the plant. 9 9 A B sepals petals stamens carpels • wt D35S:SAW1 tinyl 035S:SAW1 tiny4 Figure 3.21 Phenotypes of 35S:SAW1: Floral morphology A. Organ defects in 35S:SAW1 flowers (a) and (b) Stage 13 flowers of wild-type and 35S:SAW1 plants. Note that there are only 3 petals in this 35S:SAW1 flower. (c) Gynoecia of stage 13 flowers of wild-type (left) and 35S:SAW1 plants (right). (d) , (e) and (f) Floral organ defects observed in some of the 35S:SAW1 flowers. (d) Petal showing distal folding. (e) Stamen-carpel fusion (f) Petal-stamen fusion. Size bar = 1 mm in all the panels. B. Floral organ numbers in wild type and 35S:SAW1. Average number of sepals, petals, stamens and carpels observed in wild type, and progeny of two independent transformed lines, tiny 1 and tiny4 (n = 52, 23 and 33, respectively). Error bars indicate the standard error of the mean. 100 Figure 3.22 35S:SAW1 plants are defect ive in anther d e h i s c e n c e a n d pollen d e v e l o p m e n t A . Wi ld type and B. 35S:SAW1 anthers from stage 14 f lowers. T h e pollen inside the 35S:SAW1 anther lobe is c o m p a c t . C. Wi ld type and D. 35S:SAW1 pollen grains. T h e 35S:SAW1 pol len gra ins had to be d issected out of the anther lobe. CHAPTER 4: DISCUSSION 101 4.1. SAW proteins are negative regulators of growth Loss and gain of function mutant phenotypes suggest that a major role of SAW1 and SAW2 is to negatively regulate growth. SAW1 and SAW2 are expressed in the adaxial domain of the lateral organs early in development. Sawl saw2 loss-of-function lines have revolute/downward curling margins suggesting an increase in the adaxial to abaxial growth of the leaf. Conversely, 35S:SAW1 leaves are either flat or slightly curved toward the adaxial side suggesting a decrease in adaxial to abaxial growth. In addition, 35S:SAW1 leaves were substantially reduced in overall size with a phenotype similar to plants overexpressing ROT4, a gene that regulates polar cell proliferation in leaves (Narita et al., 2004). Taken together, these data suggest that SAW function limits growth on the adaxial side of a developing leaf early in development, perhaps to promote curvature of the leaf over the meristem until leaf blade expansion. SAW1 and SAW2 are expressed in the hydathode regions of mature Arabidopsis leaves. Mild serrations occur naturally in wild type Arabidopsis plants and typically occur at hydathodes although a visible serration is not found at every hydathode (Candela et al., 1999; Tsukaya and Uchimiya, 1997). Saw double mutants have increased numbers and sizes of serrations corresponding to the positions of the hydathodes in leaf margins of wild type leaves, while 35S:SAW1 leaves have no obvious leaf serrations. These data suggest that one role of the SAW proteins is to limit growth at the hydathodes thus limiting serration in the Arabidopsis leaf margin. That the serration is due to increased growth at the hydathode is supported by the ectopic expression of the Class 1 KNOX gene BP at hydathodes in sawl saw2 double mutants (see also below). In addition to the specific effects of SAW function on leaves, constitutive expression of SAW1 appears to negatively regulate growth throughout the plant. The sizes of the stems and all lateral organs are reduced in 35S:SAW1 plants. 35S:SAW1 floral organ abnormalities involving a decrease in organ number and organ fusions suggest defects in maintaining appropriate growth within the meristem. It is noteworthy that a floral phenotype analogous to that of 35S:SAW1 observed in the weak Stm-2 mutant has been ascribed to the reduced size of the meristem (Clark et al. 1996). 102 Given the ability of the SAW proteins to negatively regulate BP, it is possible that SAW1, ectopically expressed in the meristem, interferes with STM function as well, leading to meristematic defects. SAW1 and/or SAW2 are expressed in a number of organs for which there is no obvious phenotype in the sawl saw2 double mutant. These include petals, cotyledons, styles, and roots. It is possible that redundancy with other BLH genes obscures SAW function in these organs. Alternatively, it is possible that both sawl alleles obtained for this study are hypomorphic, and a stronger allele could have additional phenotypes. Thus, determination of the roles of the SAW genes in these organs awaits further genetic analysis. 4.2. SAW is a negative regulator of BP Several lines of evidence indicate that SAW proteins act at least in part by negatively regulating BP. First, BP is misexpressed in saw leaves at the regions marked by hydathodes (Figure 3.5). Second, 35S:SAW1 is able to reverse the BP-associated leaf lobing observed in as1 mutants and decrease ectopic BP expression in as1 leaves (Figure 4.1, Kushalappa and Haughn, unpublished results). Third, SAW1 and SAW2 are expressed in the dorsiventrally flattened organs such as leaf and sepal while BP and STM are excluded from these organs (Figure 3.9; figure 3.10; Pidkowich, 2001). Arabidopsis BP protein has been associated with the promotion of growth. Loss of BP function in bp mutant plants results in a shortened inflorescence shoot and pedicels (Douglas et al, 2002; Venglat et al., 2002), indicating that BP is involved in proper elongation of stems. Arabidopsis plants transformed with 35S.BP exhibit leaf phenotypes of increased serrations and/or lobing as well as the establishment of ectopic meristems in the leaf margins (Lincoln et al, 1994; Chuck et al, 1996). Indeed, some of the weaker 35S:BP lines resemble sawl saw2 mutants, suggesting that ectopic expression of BP is sufficient to promote serration in the saw mutants. In support of this hypothesis, there seems to be a positive correlation between serration length and the size of the BP expression domain in the sawl saw2 leaves (Figure 3.15). Therefore, it is possible that the SAW proteins control growth by directly suppressing BP in specific domains of lateral organs. In the absence of SAW function, localized BP expression may promote growth resulting in serrated, revolute leaves. 103 Interestingly, an STM-like protein in Cardamine hirsuta promotes compound leaf formation in wild type plants by prolonging the duration of cell division in specific regions of the leaf primordia (Hay and Tsiantis, 2006). Since STM is closely related to BP, it is possible that BP mediated cell divisions are causing the leaf phenotypes in saw mutants. Alternatively, BP expression might be establishing a meristematic region where STM and other Class 1 KNOX genes are expressed. Figure 4.1 35S:SAW1 suppresses the as1 leaf phenotype Four-week old plants. A. wild-type, B. 35S:SAW1, C. as1 and D. 35S:SAW1 as1. Note the difference between leaf shapes of as1 (C) and 35SSAW1 as1 (D) plants. The leaves of the 35S:SAW1 as1 plants have wildtype shape, but of 35S:SAW1 size. Size bar = 10 mm The genetic crosses and initial screening was done by Dr. Kumuda Kushalappa in the Haughn laboratory. I took the photographs. Multiple Classl KNOX genes are also misexpressed in the leaves of the as1 mutant (Ori et al., 2000; Semiarti et al., 2001). As1 [Asymmetric leaves 1) mutants 104 have leaves with irregular, lobed blades (Figure 4.1C, Tsukaya and Uchimiya, 1997). One of the well characterized functions of AS1 involves suppression of Class 1 KNOX expression in the leaves (Byrne et al., 2000; Ori et al., 2000). In turn, the meristem maintenance and function protein STM prevents AS1 from functioning in the meristem (Byrne et al., 2000). Analysis of sawl saw2 as! triple mutants revealed that they interact synergistically, as evidenced by the broadened leaf serrations. The triple mutants have more lobes and longer serrations than as1 single mutants. Although the serrations observed in the triple mutant are longer than the ones found in saw double mutants, there are fewer of them. One reason for this is that the as1 mutant has fewer hydathodes than wild type and hence can't make as many serrations/lobes (Tsukaya and Uchimiya, 1997). Another possibility is that the longer serrations have been formed at the expense of the serration number. Such an inverse correlation between serration length and serration number has been observed in a comparison of different species of Begonia (Mclellan and Dengler, 1995). Some of the leaves in as1 also have leaflet-like structures originating from the base. The occurrence of these leaflet-like structures is also increased in the triple mutant leaves. The observed phenotypes suggest that AS1 and SAW proteins might function mainly in distinct domains, but have some overlaps that are revealed when both AS1 and SAW function is lost. The loss of both functions resulted in an increased region of disruption, perhaps involving a broader domain of BP and other KNOX misexpression. 4.3. SAW and KNOX interactions Protein-protein interactions amongst members of the BELL and KNOX families have been well documented (Bellaoui et al., 2001; Hackbusch et al., 2005; Muller et al., 2001; Smith et al., 2002). As described earlier in the literature review, BP and the BLH protein BLR/PNYA/AN interact to positively regulate inflorescence growth (Bhatt et al., 2004; Smith and Hake, 2003). Similarly, BLR/PNY and the paralogous protein PNF positively interact with STM to control meristem function (Byrne et al., 2003; Kanrar et al., 2006). For the SAW proteins it has been shown that both SAW1 and SAW2 interact with BP in yeast two-hybrid assays (Kushalappa and Haughn, unpublished results; Hackbusch et al., 2005). However, genetic and molecular analyses have 105 revealed that the SAW proteins negatively regulate BP expression and function (Figure 3.15; Kushalappa and Haughn, unpublished results). Furthermore, SAW and BP are mostly expressed in mutually exclusive domains. BELL and KNOX proteins are DNA-binding transcription factors. Several lines of evidence suggest that heterodimerization amongst members of these families is required for DNA binding and nuclear localization (Bhatt et al., 2004; Cole et al., 2006). Based on my data, I hypothesize that SAW and BP interactions are required for negative regulation of BP function. The SAW-BP heterodimer might act as a repressor of BP expression. Alternatively, the regulation might be a result of BP being sequestered by SAW proteins and hence unable to interact with BLR/PNYA/AN and PNF proteins. This hypothesis would assume that BLR-BP complexes are activators of BP expression. Thus, the titres of competing BLH proteins in a given cell and/or tissue might decide the fate of BP-derived functions in the tissue. KNOX proteins have shown to move across cell-layers in the meristem (Kim et al., 2003a; Kim et al., 2005) Long-range transport of KNOX transcripts via the phloem has also been reported (Kim et al., 2005; Kim et al., 2001). SAW proteins might repress the function of KNOX proteins trafficked into an inappropriate domain. Another possible mechanism of opposition of BP and SAW action is that they compete for the same promoter sites, with BP activating growth-promoting genes and SAW1 antagonizing this function. As described earlier in the literature review, BLH and KNOX proteins have been shown to bind to adjacent TGAC sites of promoter elements in potato to cooperatively regulate GA biosynthesis (Chen et al., 2004). Since both BLH and KNOX recognize the same DNA elements, they could compete for the same DNA binding site. Such a competing role has been described in mammals, where the MEIS2 proteins and the PREP proteins compete for the same site to either activate or repress a gene coding for a dopamine receptor (Yang et al., 2000). MEIS and KNOX proteins are similar to each other and both have a conserved MEINOX domain (Burglin, 1997). Interestingly, although PREP-like proteins are absent in plants, a BLAST search of Arabidopsis proteins with PREP as the query retrieved SAW1 and SAW2 proteins in the top 3 hits (BLH5 was the top hit), with the rest of the hits showing less similarity (data not shown) It is interesting to note that BP, SAW1 and SAW2 are expressed in the stems. My results indicate that BP:GUS expression in stems of saw double mutants is more 106 than double that found in wild type stems, indicating that SAW1 is required even in stems for regulation of BP. BP is expressed in the stem cortex in wild type plants (Venglat et al, 2002). It is yet to be determined whether SAW1 and SAW2 are expressed in the same domain in the stem as BP or in different domains. It is possible that BP and SAW genes are expressed in mutually exclusive domains of the stem, as in other organs, and that the BP domain increases in the saw mutants (due to the loss of SAW-mediated repression). Alternatively, the SAW genes and BP might be expressed in overlapping domains and it is the availability or ratio of SAW proteins to BLR and PNF proteins that governs BP function. The Arabidopsis ovate family of proteins (OFPs) interact with the BEL1 and KNOX family of proteins and regulate their ability to enter the nucleus (Hackbusch et al, 2005). It may be significant that although the OFPs interact with SAW1 and SAW2 proteins (BLH2 and BLH4 respectively in Hackbusch et al, 2005), OFPs do not interact with PNF and BLR/PNY (BLH8 and BLH9 in Hackbusch et al, 2005). Consistent with this, BLH1, which interacts with AtOFPI, was colocalized with AtOFPI in the cytosol but BLH7, which does not interact with AtOFPI, was nuclear-localized (Hackbusch et al., 2005). This preferential interaction with OFPs might result in a cytosolic sequestration of SAW proteins in stems, allowing BLR and PNF to interact with BP. The sequestration is probably reversible, allowing SAW proteins to be released at later stages of stem development. Although much of the SAW loss of function and overexpression phenotypes observed seem to involve negative regulation of Class 1 KNOX function, the 35S:SAW1 leaf phenotype is seems to be independent of regulation of Classl KNOX function. As noted earlier, the heterodimerization of BELL and KNOX proteins is required for DNA binding. However, none of the Class 1 KNOX genes (STM, BP, KNAT2 and KNAT6) is expressed in the leaf (Lincoln et al., 1994; Ori et al., 2000; Semiarti et al., 2001). KNAT5 is one of the KNOX proteins that interact with SAW1 in yeast (Kushalappa and Haughn, unpublished results). Interestingly, KNAT5 is expressed in the leaves (Serikawa et al, 1996). It is possible that the SAW1 leaf overexpression phenotype is a consequence of KNAT5 down regulation. Alternatively, KNAT5, whose function is unknown, might be the coregulator that is required for SAW action in the leaf. 107 4.4. Altered vegetative phase transition in the sawl saw2 double mutants? The sawl saw2 double mutants have serrated, revolute leaf margins and the first four leaves are more elongated than those in wild type (Figure 3.12). These characteristics resemble those found in mutants defective in vegetative phase transition. All plants, during their life cycle, undergo three phase transitions that are accompanied by distinct morphological changes (Poethig, 1990). The most obvious phase transition is the one from the vegetative to reproductive phase that is characterized by a major reprogramming of the meristematic functions to accommodate production of reproductive organs. The less distinct is the juvenile to adult phase transition during vegetative development. In Arabidopsis, the vegetative phase transition is characterized by increase in leaf size, increased hydathode numbers and development of trichomes in the abaxial side of the leaf (Berardini et al., 2001; Telfer et al., 1997). Various genes have been found to be involved in regulating phase transitions. Altered phase change has been observed in both plants and animals when certain microRNAs are misexpressed or in mutants defective in miRNA biosynthesis/ regulation (Wu and Poethig, 2006). In Arabidopsis, mutations in RNA DEPENDENT RNA POLYMERASE 6 (RDR6), SUPRESSOR OF GENE SILENCING 3 (SGS3) and ZIPPY/ARGONAUTE7 (AG07) and AG01 accelerated transition to adult phase along with increased serrations and downward curling of the leaf margins (Hunter et al., 2003; Peragine et al., 2004; Vazquez et al., 2004; Yang et al., 2006a). These proteins are involved in biosynthesis and processing of miRNAs. Similar to sawl saw2 mutants, mutations in these proteins also cause leaf defects and enhance as1 leaf phenotype (Xu et al., 2006; Yang et al., 2006a). Also, BP and KNAT2 are ectopically expressed in the leaves of agol mutants (Yang et al., 2006a). The auxin response factors ETTIN/ARF3 and ARF4 promote the transition to the adult phase. Arf3 and arf4 mutants have a prolonged juvenile phase (Hunter et al., 2006). Interestingly, ARF3 and ARF4 by tasiR-ARF, a trans acting siRNA which in turn requires AG07 for its function (Fahlgren et al., 2006; Hunter et al., 2006). Overexpression of ARF3 and ARF4 resulted in plants with lobed leaves and accelerated transition to the adult phase. It will be interesting to find out if there is 108 misexpression of KNOX genes in these overexpressors and if the expression of the saw genes is altered in the mutants and overexpressors. The hypomorphic se-1 mutant of Arabidopsis also shows increased number and length of serrations and an accelerated progression to the adult vegetative phase (see Chapter 1, page 25). Since like saw mutants, se-1 can also enhance as1 leaf phenotype, it is possible that SAW and SE work by similar mechanisms. However, se differs from saw in many aspects. Firstly, unlike saw double mutants, strong se-2 and se-3 mutants have leaves curving adaxially rather than abaxially (Grigg et al., 2005). Second, there is no misexpression of KNOX genes in the serrate mutant (Grigg et al., 2005; Ori et al., 2000). Thirdly, the flowering time in serrate mutant is unaltered in comparison to wild type (Clarke et al., 1999; Prigge and Wagner, 2001) whereas flowering is slightly delayed in the sawl saw2 double mutant (Table 3.5). Since the hypomorphic se-1 allele exhibits early transition from the juvenile to the adult phase, fewer leaves are formed prior to bolting (Clarke et al., 1999; Prigge and Wagner, 2001). Although the early leaves of sawl saw2 double mutants have some of the adult leaf characteristics (more elongated), the number of leaves initiated prior to bolting is significantly higher than wild type (Table 3.5). Nevertheless, it will be intriguing to study if sawl saw2 double mutants also exhibit a clear defect in transition from juvenile to adult phase of vegetative development. 4.5. Functional redundancy in BEL1 and SAW proteins The lack of individual phenotypes in the sawl and saw2 and presence of a phenotype in the double mutant showed that SAW1 and SAW2 have redundant functions in Arabidopsis. This is not without precedent. Functional redundancy is a common occurrence in both plants and animals where the inactivation of one gene does not have any phenotypic consequence because another functionally redundant gene compensates for its loss. Functional redundancy has been well characterized in many Arabidopsis gene families. The Arabidopsis genes APETALA1, CAULIFLOWER and FRUITFULL redundantly to specify floral meristem identity (Ferrandiz et al., 2000a; Kempin et al., 1995). However, APETALA1 is also involved in specifying the outer two whorls of floral organs and FRUITFULL is involved in the differentiation of the fruit valves (Ferrandiz et al., 2000b), indicating that these genes also have independent 109 functions. There are also gene families that exhibit complete redundancy. In the SHATTERPROOF gene family, double mutants (mutations in two different genes) produce indehiscent fruits (Liljegren et al., 2000) and in the SEPALLATA gene family, triple mutants produce flowers with sepals in all the whorls (Pelaz et al., 2000). In both of these families, a single mutation in any of the genes fails to produce any phenotypic change. The majority of the functionally redundant genes are products of segmental duplications, which are large-scale duplications of the chromosome (Krakauer and Nowak, 1999). At least three independent chromosomal duplication events can be detected in Arabidopsis; they have occurred over a period of - 300 million years (Bowers et al., 2003). In Arabidopsis, almost 80-90% of the genome consists of duplicated chromosomal regions (Bowers et al., 2003; Simillion et al., 2002). Although most of the duplicated genes have reverted back to single functional copy genes (Arabidopsis Genome Initiative, 2000; Blanc et al., 2003), some of the gene pairs have been retained with both paralogous genes remaining functional. The occurrence of functional redundancy seems to be a paradox since evolution should have favoured the loss of all but one of the redundant genes. However, many studies have pointed out that some redundant proteins can benefit the organism by allowing more flexibility in adaptation. Therefore, many duplicated genes fully or partially retain their functions. Many theoretical and experimental studies support models based on the assumption that duplicated genes have undergone one of three fates: a) nonfunctionalization, where function of one of the gene pair is lost; b) neofunctionalization, where gene pairs have partially diverged and acquired novel functions or expression patterns; and c) subfunctionalization, where the genes have diverged such that each gene has retained different subsets of the ancestral gene function or expression (Duarte et al., 2006; Force et al., 1999; Hughes, 1994). Therefore, most of the duplicated genes are only partially redundant; with each being indispensable for some functions (Nowak et al., 1997). SAW1 and SAW2 are paralogous genes that are present in regions duplicated between Arabidopsis chromosomes 2 and 4. My analysis of microarray data suggests that although SAW1 and SAW2 are coexpressed in most of the tissues in various developmental stages, SAW1 is not expressed as highly as SAW2. However, this differential expression needs to be verified using quantitative real time PCR, as the 110 probe sets used in microarray experiments might have different binding efficiencies. It has been found that changes in expression are the first step towards divergence in gene function amongst duplicated genes (Adams et al., 2003). If that is the case, the functionally redundant SAW proteins are in a process of subfunctionalization, pseudogenization or neofunctionalization. The SAW proteins are most similar (in amino acid sequence) to the BEL1 protein, have overlapping expression patterns and interact with similar set of KNOX proteins. Moreover, the bell mutant phenotype can be complemented by 35S:SAW1 (Figure 1.16). However, sawl saw2 bell triple mutants have an additive phenotype, indicating that BEL1 is not required for the observed SAW functions. This result was surprising as SAW proteins can perform BEL1 functions when introduced into the ovule. Since BEL1, SAW1 and SAW2 overlap in expression in the leaves, these three proteins could also have overlapping functions in the leaves. Since bell did not change the Sawl Saw2 leaf phenotype, there could be other BLH proteins that mask any functions common to SAW1, SAW2 and BELL An understanding of BEL1 function outside the ovule must therefore await further analysis. It is also possible that BEL1 has diverged sufficiently from SAW1 and SAW2 to retain its ovule function and has lost other functions because of redundancy. In support of this hypothesis, 35S:BEL1 does not have any observable changes outside the ovule (Hepworth and Haughn, unpublished results). 111 (a) Redundancy OOO annu Neotactionalizatton 0001 e v. Redundancy h Pseudogenization 00011 «1 NeofunctionaNzation Pseudogenization ooo-i 1 Neofunctionalizatron (coding) Neofuncttonalization (regulatory) Subfunctionalization (partial redundancy) •0+55 § Regulatory subfunotion 0 Gain of regulatory subfunction 0 Loss of regulatory subfunction Coding function Gain of coding function Loss of coding function + Gain-oMunction mutation - Loss-of-function mutation Neofu nctionaSization and/or subfunctionalization Subfunctionalization (complete) Neofunctionalization and/or subfunctionalization OOtOi Current Opinio?! in Plant Biology Figure 4.2 Models describing fates of duplicate genes The thicker arrows point to the preferred (most commonly observed) gene fates. (a). The classical model. One of the duplicated genes either gains a novel function or is completely lost through silencing or mutations. .(b) A composite model based on theoretical and experimental understandings of gene duplication. See text for more details. (From: Moore and Purugganan, 2005. Copyright (2005), Elsevier Ltd. Reprinted with permission from Elsevier) CHAPTER 5 : SUMMARY AND FUTURE DIRECTIONS 112 Arabidopsis leaves are determinate structures that stop growing upon maturity. In this study, I have characterized two functionally redundant proteins, SAW1 and SAW2, whose function is to repress growth during leaf morphogenesis. The double mutants of the two BEL1-like homeodomain (BLH) proteins have more and bigger leaf serrations, revolute leaf margins, and exhibit a slight delay in flowering. Overexpression of SAW1 results in reduced plant growth and meristematic defects that are evident in the inflorescence and flowers. Genetic analysis showed that SAW1 and SAW2 function synergistically with AS1 to control leaf margin development. In addition, analysis of sawl saw2 interaction with bp has revealed that SAW genes repress BP expression and function in the leaves, which is probably a factor controlling the growth of serrations. My results indicate that leaf serrations in sawl saw2 double mutants are more numerous as well as bigger. One function of SAW1 and SAW2 is to repress the formation of serrations in leaves since wild-type plants (Columbia-0 ecotype) also have mild serrations. Therefore, the loss of SAW1 and SAW2 function in the mutants probably results in the enhancement of pre-existing serrations. Serrations are extensions of leaf margins which occur around the hydathodes (Candela et al., 1999). Therefore there should be a hydathode for each visible serration. However, serrations are not visible at all of the hydathodes in wild type and mutant leaves (Tsukaya and Uchimiya, 1997). Thus it is unclear whether saw mutants have more serrations than wild type plants due to increased hydathode number or due to more serrations being visible at pre-existing hydathodes. This can be determined by using hydathode-specific markers like the #1-35-38 GUS reporter used by Tsukaya and Uchimiya to look at leaf margin development (Tsukaya and Uchimiya, 1997). If this reporter were crossed into the saw double mutant, hydathode and serration placement could be followed in comparison to wild-type plants. As discussed earlier, ectopic expression of BP has a role in increasing the size of serrations. It would be useful to determine whether a bp sawl saw2 triple mutant has wild type looking leaves. This would demonstrate that only BP is involved in one or all the Saw leaf phenotypes. However, it is also possible that.elimination of bp function 113 will not affect the sawl saw2 phenotype, analogous to the lack of leaf phenotypes found in as1 bp double mutants (Byrne et al., 2000) due to the misexpression of redundant Class 1 KNOX genes such as KNAT2, KNAT6 or STM. The publicly available GUS reporter constructs for these genes could be crossed into the sawl saw2 double mutants to test for ectopic leaf expression of these other KNOX genes in the double mutant leaves. Sawl saw2 as1 triple mutant leaves are highly dissected and often have leaflets with petiole-like structures. Although further histological experiments must be conducted to test the nature of these "leaflets", it is possible that the increased BP misexpression in these triple mutants is transforming the simple leaves into more complex structures. KNOX proteins are involved in establishment of compound leaves in many plants. In plants with simple leaves like Arabidopsis, AS1 inhibits expression of Classl KNOX genes in leaf primordia. However, the AS1 orthologs in these plants with compound leaves fail to do so. In many compound leaves, STM-like KNOX genes are expressed in distinct domains in the leaf primordia where they promote formation of leaflets (see Chapter 1, page 27). The mechanism might involve exclusion of S/AI/V-like genes from the leaves of these plants. This can be tested by measuring the expression of S/W-like genes in the leaves of other species. Saw mutants have serrated leaves with revolute margins, whereas 35S:SAW1 plants have small leaves; this suggests that SAW genes are growth inhibitors. As mentioned in Chapter 1 (page 20), ROT4 inhibits cell proliferation while JAG promotes cell proliferation. It would be interesting to determine whether the expression of these genes is altered in the saw mutants and 35S:SAW1 overexpressors. This would reveal whether ROT4 and JAG are in the same regulatory pathway as the £4l/l/genes. Ectopic KNOX expression in the leaves has also been correlated with an increased accumulation of cytokinins, plant hormones that increase cell division and delay senescence, phenotypes that have also been observed in plants that have ectopic KNOX expression (Frugis et al., 2001; Ori et al., 1999). The saw mutant leaves stay greener than wild type plants for a longer period, and therefore might have a delay in senescence. However this phenotype is yet to be quantified properly and characterized using senescence-specific markers. BP misexpression in saw leaves might be enhancing cytokinin-mediated cell proliferation activities. Increased cytokinin activity can be assayed by monitoring expression of genes involved in cytokinin 114 response or biosynthesis as has been done in previous experiments (Jasinski et al., 2005; Takei et al., 2001). My results indicate that saw double mutants are late flowering in continuous light conditions (Table 3.5). It should be determined whether the sawl saw2 double mutants also show delayed flowering in long day and short day conditions. Overexpression of the BLH protein ATH1 delays flowering and ath1 mutants flower early (Rutjens et al., 2006; van der Valk et al., 2004). Increased levels of the floral repressor, FLC (FLOWERING LOCUS C) was also observed in ath1 mutants (Rutjens et al., 2006). These data suggest that both ATH1 and SAW proteins antagonize the transition to flowering. Analysing the genetic interactions of sawl saw2 and athl, as well as monitoring expression levels of FLC and its activator, FRIGIDA, might give us clues to understanding SAW-mediated control of flowering. Although SAW genes are expressed in many parts of the plant, only leaf phenotypes are visible in the saw double mutants. The saw7 alleles tested so far {saw1-1 and saw1-2) might be hypomorphic (weaker) alleles, as saw1-1 still has a little SAW1 expression and saw1-2, which has a point mutation, shows weaker phenotypes than saw1-1. A search for a stronger sawl mutant might be required to determine SAW functions more completely. SAW1 and SAW2 are functionally redundant genes that are found in chromosomal regions that have "recently duplicated". The recent duplications in Arabidopsis are estimated to have occurred around 24 to 40 million years ago prior to the divergence of Arabidopsis from Brassica rapa (Blanc et al., 2003). Owing to the recent duplications SAW1 and SAW2 show significant overlaps in gene expressions. However, microarray results indicate that SAW2 is expressed in higher amounts than SAW1 (discussed in page 108). The differential expression of the two genes should be verified by quantitative real time PCR. Differential expression is most likely the first step towards divergence in function of two genes (Adams et al., 2003). . Therefore SAW1 and SAW2 might be newly evolving paralogous genes. It is also possible that the two genes are still in early stages of functional specialization in Arabidopsis but have already acquired distinct expression/functional domains (subfunctionalization) or new expression/ functional domains (neofunctionalization) in other diploid species in the Brassicaceae (Mustard family). Identifying the SAW1 and SAW2 like proteins in 115 other diploid members of Brassicaceae and analysing their expression profiles might shed some light on this question. During the course of my thesis research, I have elucidated the function of SAW1 and SAW2 in leaf development. SAW proteins function in part through a synergistic interaction with AS1 and by negative regulation of BP expression in the leaves. Future research along the lines I have suggested may reveal additional functions and mechanisms of action of the SAW genes. 116 LITERATURE CITED Abu-Shaar, M., Ryoo, H.D., and Mann, R.S. (1999). Control of the nuclear localization of Extradenticle by competing nuclear import and export signals. Genes & Development 13, 935-945. Adams, K.L., Cronn, R., Percifield, R., and Wendel, J.F. (2003). Genes duplicated by polyploidy show unequal contributions to the transcriptome and organ-specific reciprocal silencing. Proceedings of the National Academy of Sciences of the United States of America 100, 4649-4654. Akbari, O.S., Bousum, A., Bae, E., and Drewell, R.A. (2006). Unraveling cis-regulatory mechanisms at the abdominal-A and Abdominal-B genes in the Drosophila bithorax complex. Developmental Biology 293, 294-304. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. (1990). Basic Local Alignment Search Tool. Journal of Molecular Biology 215, 403-410. An, Y.Q., McDowell, J.M., Huang, S.R., McKinney, E.C., Chambliss, S., and Meagher, R.B. (1996). Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant Journal 10, 107-121. Arabidopsis Genome Initiative (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796-815. BakerBrosh, K.F., and Peet, R.K. (1997). The ecological significance of lobed and toothed leaves in temperate forest trees. Ecology 78,1250-1255. Bao, N., Lye, K.W., and Barton, M.K. (2004a). MicroRNA binding sites in Arabidopsis class IIIHD-ZIP mRNAs are required for methylation of the template chromosome. Developmental Cell 7, 653-662. Bao, X., Franks, R.G., Levin, J.Z., and Liu, Z. (2004b). Repression of AGAMOUS by BELLRINGER in floral and inflorescence meristems. Plant Cell 16, 1478-1489. Bartel, D.P. (2004). MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 116, 281-297. Barth, S., Melchinger, A.E., and Lubberstedt, T. (2002). Genetic diversity in Arabidopsis thaliana L. Heynh. investigated by cleaved amplified polymorphic sequence (CAPS) and inter-simple sequence repeat (ISSR) markers. Molecular Ecology 11, 495-505. Barton, M.K., and Poethig, R.S. (1993). Formation of the shoot apical meristem in Arabidopsis thaliana: An analysis of development in the wild type and in the shoot meristemless mutant. Development 119, 823-831. Becker, A., Bey, M., Burglin, T.R., Saedler, H., and Theissen, G. (2002). Ancestry and diversity of BEL1-like homeobox genes revealed by gymnosperm ( Gnetum gnemon) homologs. Dev.Genes Evol. 212, 452-457. 117 Bellaoui, M., Pidkowich, M.S., Samach, A., Kushalappa, K., Kohalmi, S.E., Modrusan, Z., Crosby, W.L., and Haughn, G.W. (2001). The Arabidopsis BELLI and KNOX TALE homeodomain proteins interact through a domain conserved between plants and animals. Plant Cell 13, 2455-2470. Belles-Boix, E., Hamant, O., Witiak, S.M., Morin, H., Traas, J. , and Pautot, V. (2006). KNAT6: An Arabidopsis Homeobox Gene Involved in Meristem Activity and Organ Separation. Plant Cell 18, 1900-1907. Berardini, T.Z., Bollman, K., Sun, H., and Scott Poethig, R. (2001). Regulation of Vegetative Phase Change in Arabidopsis thaliana by Cyclophilin 40. Science 291, 2405-2407. Berleth, T., and Jurgens, G. (1993). The Role of the Monopteros Gene in Organizing the Basal Body Region of the Arabidopsis Embryo. Development 118, 575-587. Berthelsen, J . , Kilstrup-Nielsen, C , Blasi, F., Mavilio, F., and Zappavigna, V. (1999). The subcellular localization of PBX1 and EXD proteins depends on nuclear import and export signals and is modulated by association with PREP1 and HTH. Genes & Development 13, 946-953. Berthelsen, J . , Viggiano, L., Schulz, H., Ferretti, E., Consalez, G.G., Rocchi, M., and Blasi, F. (1998a). PKNOX1, a gene encoding PREP1, a new regulator of PBX activity, maps on human chromosome 21q22.3 and murine chromosome 17B/C. Genomics 47, 323-324. Berthelsen, J. , Zappavigna, V., Ferretti, E., Mavilio, F., and Blasi, F. (1998b). The novel homeoprotein Prepl modulates Pbx-Hox protein cooperativity. Embo Journal 17, 1434-1445. Berthelsen, J. , Zappavigna, V., Mavilio, F., and Blasi, F. (1998c). Prepl, a novel functional partner of Pbx proteins. Embo Journal 17, 1423-1433. Bertolino, E., Reimund, B., WildtPerinic, D., and Clerc, R.G. (1995). A novel homeobox protein which recognizes a TGT core and functionally interferes with a retinoid-responsive motif. Journal of Biological Chemistry 270, 31178-31188. Bharathan, G., Goliber, T.E., Moore, C , Kessler, S., Pham, T., and Sinha, N.R. (2002). Homologies in leaf form inferred from KNOXI gene expression during development. Science 296, 1858-1860. Bharathan, G., Janssen, B.J., Kellogg, E.A., and Sinha, N. (1997). Did homeodomain proteins duplicate before the origin of angiosperms, fungi, and metazoa? Proceedings of the National Academy of Sciences of the United States of America 94, 13749-13753. Bharathan, G., and Sinha, N.R. (2001). The regulation of compound leaf development. Plant Physiol. 127, 1533-1538. 118 Bhatt, A.M., Etchells, J.P., Canales, C , Lagodienko, A., and Dickinson, H. (2004). VAAMANA-a BEL1-like homeodomain protein, interacts with KNOX proteins BP and STM and regulates inflorescence stem growth in Arabidopsis. Gene 328, 103-111. Billeter, M., Qian, Y.Q., Otting, G., Muller, M., Gehring, W., and Wuthrich, K. (1993). Determination of the Nuclear-Magnetic-Resonance Solution Structure of An Antennapedia Homeodomain-Dna Complex. Journal of Molecular Biology 234, 1084-1094. Blanc, G., Hokamp, K., and Wolfe, K.H. (2003). A recent polyploidy superimposed on older large-scale duplications in the Arabidopsis genome. Genome Res. 13, 137-144. Bowers, J.E., Chapman, B.A., Rong, J. , and Paterson, A.H. (2003). Unravelling angiosperm genome evolution by phylogenetic analysis of chromosomal duplication events. Nature 422, 433-438. Bowman, J.L. (2000). Axial patterning in leaves and other lateral organs. Curr.Opin.Genet.Dev. 10, 399-404. Bowman, J.L. (2004). Class III HD-Zip gene regulation, the golden fleece of ARGONAUTE activity? Bioessays 26, 938-942. Bowman, J.L., and Eshed, Y. (2000). Formation and maintenance of the shoot apical meristem. Trends Plant Sci. 5, 110-115. Brand, U., Fletcher, J.C., Hobe, M., Meyerowitz, E.M., and Simon, R. (2000). Dependence of stem cell fate in Arabidopsis on a feedback loop regulated by CLV3 activity. Science 289, 617-619. Brand, U., Grunewald, M., Hobe, M., and Simon, R. (2002). Regulation of CLV3 expression by two homeobox genes in Arabidopsis. Plant Physiol 129, 565-575. Brasset, E., and Vaury, C. (2005). Insulators are fundamental components of the eukaryotic genomes. Heredity 94, 571-576. Brown, V.K., and Lawton, J.H. (1991). Herbivory and the Evolution of Leaf Size and Shape. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 333, 265-272. Burglin, T.R. (1997). Analysis of TALE superclass homeobox genes (ME|S, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals. Nucleic Acids Res. 25, 4173-4180. Burglin, T.R. (1998). The PBC domain contains a MEINOX domain: coevolution of Hox and TALE homeobox genes? Dev.Genes Evol. 208,113-116. Busch, M., Mayer, U., and Jurgens, G. (1996). Molecular analysis of the Arabidopsis pattern formation gene GNOM: Gene structure and intragenic complementation. Molecular & General Genetics 250, 681-691. 119 Byrne, M.E. (2005). Shoot development-genetic interactions in the meristem. Biochem.Soc.Trans. 33, 1499-1501. Byrne, M.E., Barley, R., Curtis, M., Arroyo, J.M., Dunham, M., Hudson, A., and Martienssen, R.A. (2000). Asymmetric leavesl mediates leaf patterning and stem cell function in Arabidopsis. Nature 408, 967-971. Byrne, M.E., Groover, A.T., Fontana, J.R., and Martienssen, R.A. (2003). Phyllotactic pattern and stem cell fate are determined by the Arabidopsis homeobox gene BELLRINGER. Development 130, 3941-3950. Byrne, M.E., Simorowski, J. , and Martienssen, R.A. (2002). ASYMMETRIC LEAVES1 reveals knox gene redundancy in Arabidopsis. Development 129, 1957-1965. Candela, H., Martinez-Laborda, A., and Micol, J.L. (1999). Venation pattern formation in Arabidopsis thaliana vegetative leaves. Developmental Biology 205, 205-216. Carraro, N., Peaucelle, A., Laufs, P., and Traas, J . (2006). Cell differentiation and organ initiation at the shoot apical meristem. Plant Molecular Biology 60, 811-826. Champagne, C , and Sinha, N. (2004). Compound leaves: equal to the sum of their parts? Development 131, 4401-4412. Chan, R.L., Gago, G.M., Palena, C M . , and Gonzalez, D.H. (1998). Homeoboxes in plant development. Biochimica et Biophysica Acta-Gene Structure and Expression 1442, 1-19. Chang, C P . , Brocchieri, L , Shen, W.F., Largman, C , and Cleary, M.L. (1996). Pbx modulation of Hox homeodomain amino-terminal arms establishes different DNA-binding specificities across the Hox locus. Molecular and Cellular Biology 16, 1734-1745. Chang, C P . , Jacobs, Y., Nakamura, T., Jenkins, N.A., Copeland, N.G., and Cleary, M.L. (1997). Meis proteins are major in vivo DNA binding partners for wild-type but not chimeric Pbx proteins. Molecular and Cellular Biology 17, 5679-5687. Chariot, A., Princen, F., Gielen, J. , Merville, M.P., Franzoso, G., Brown, K., Siebenlist, U., and Bours, V. (1999a). I kappa B-alpha enhances transactivation by the HOXB7 homeodomain-containing protein. Journal of Biological Chemistry 274, 5318-5325. Chariot, A., van Lint, C , Chapelier, M., Gielen, J . , Merville, M.P., and Bours, V. (1999b). CBP and histone deacetylase inhibition enhance the transactivation potential of the HOXB7 homeodomain-containing protein. Oncogene 18, 4007-4014. Chen, H., Banerjee, A.K., and Hannapel, D.J. (2004). The tandem complex of BEL and KNOX partners is required for transcriptional repression of ga20ox1. Plant Journal 38, 276-284. 120 Chen, H., Rosin, F.M., Prat, S., and Hannapel, D.J. (2003). Interacting transcription factors from the three-amino acid loop extension superclass regulate tuber formation. Plant Physiol. 132, 1391-1404. Chen, L. (1999). Combinatorial gene regulation by eukaryotic transcription factors. Curr.Opin.Struct.Biol. 9, 48-55. Chuck, G., Lincoln, C , and Hake, S. (1996). KNAT1 induces lobed leaves with ectopic meristems when overexpressed in Arabidopsis. Plant Cell 8,1277-1289. Clark, S.E., Jacobsen, S.E., Levin, J.Z., and Meyerowitz, E.M. (1996). The CLAVATA and SHOOT MERISTEMLESS loci competitively regulate meristem activity in Arabidopsis. Development 122, 1567-1575. Clark, S.E., Running, M.P., and Meyerowitz, E.M. (1993). Clavatal, A Regulator of Meristem and Flower Development in Arabidopsis. Development 119, 397-418. Clark, S.E., Running, M.P., and Meyerowitz, E.M. (1995). Clavata3 Is A Specific Regulator of Shoot and Floral Meristem Development Affecting the Same Processes As Clavatal Development 121, 2057-2067. Clark, S.E., Williams, R.W., and Meyerowitz, E.M. (1997). The CLAVATA1 gene encodes a putative receptor kinase that controls shoot and floral meristem size in Arabidopsis. Cell 89, 575-585. Clarke, J.H., Tack, D., Findlay, K., Van Montagu, M., and Van Lijsebettens, M. (1999). The SERRATE locus controls the formation of the early juvenile leaves and phase length in Arabidopsis. Plant J. 20, 493-501. Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal 16, 735-743. Colbert, T., Till, B.J., Tompa, R., Reynolds, S., Steine, M.N., Yeung, A.T., McCallum, C M . , Comai, L., and Henikoff, S. (2001). High-throughput screening for induced point mutations. Plant Physiol. 126, 480-484. Cole, M., Nolte, C , and Werr, W. (2006). Nuclear import of the transcription factor SHOOT MERISTEMLESS depends on heterodimerization with BLH proteins expressed in discrete sub-domains of the shoot apical meristem of Arabidopsis thaliana. Nucleic Acids Res. 34, 1281-1292. Cubas, P., Lauter, N., Doebley, J. , and Coen, E. (1999). The TCP domain: a motif found in proteins regulating plant growth and development. Plant Journal 18, 215-222. Dellaporta, S.L., Wood, J . , and Hicks, J.B. (1983). A plant DNA minipreparation: Version II. Plant Mol.Biol.Reports 1,19-21. DeMason, D.A., and Schmidt, R.J. (2001). Roles of the uni gene in shoot and leaf development of pea (Pisum sativum): Phenotypic characterization and leaf 121 development in the uni and uni-tac mutants. International Journal of Plant Sciences 162,1033-1051. Dinneny, J.R., Yadegari, R., Fischer, R.L., Yanofsky, M.F., and Weigel, D. (2004). The role of JAGGED in shaping lateral organs. Development 131,1101-1110. Doerner, P. (2000). Plant stem cells: the only constant thing is change. Curr.Biol. 10, R826-R829. Doerner, P. (2006). Plant meristems: The fiendish SU DOKU of stem-cell maintenance. Current Biology 16, R199-R201. Donnelly, P.M., Bonetta, D., Tsukaya, H., Dengler, R.E., and Dengler, N.G. (1999). Cell cycling and cell enlargement in developing leaves of Arabidopsis. Developmental Biology 215, 407-419. Douglas, S.J., Chuck, G., Dengler, R.E., Pelecanda, L , and Riggs, C D . (2002). KNAT1 and ERECTA regulate inflorescence architecture in Arabidopsis. Plant Cell 14, 547-558. Duarte, J.M., Cui, L.Y., Wall, P.K., Zhang, Q., Zhang, X.H., Leebens-Mack, J. , Ma, H., Altman, N., and dePamphilis, C.W. (2006). Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. Molecular Biology and Evolution 23, 469-478. Eddy, S.R. (2004). Where did the BLOSUM62 alignment score matrix come from? Nature Biotechnology 22, 1035-1036. Edwards, K., Johnstone, C , and Thompson, C. (1991). A Simple and Rapid Method for the Preparation of Plant Genomic Dna for Per Analysis. Nucl.Acids Res. 19, 1349. Elliott, R . C , Betzner, A.S., Huttner, E., Oakes, M.P., Tucker, W.Q., Gerentes, D., Perez, P., and Smyth, D.R. (1996). AINTEGUMENTA, an APETAI_A2-like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth. Plant Cell 8, 155-168. Emery, J.F., Floyd, S.K., Alvarez, J. , Eshed, Y., Hawker, N.P., Izhaki, A., Baum, S.F., and Bowman, J.L. (2003). Radial patterning of Arabidopsis shoots by class IIIHD-ZIP and KANADI genes. Current Biology 13, 1768-1774. Eshed, Y., Baum, S.F., and Bowman, J.L. (1999). Distinct mechanisms promote polarity establishment in carpels of Arabidopsis. Cell 99, 199-209. Eshed, Y., Baum, S.F., Perea, J.V., and Bowman, J.L. (2001). Establishment of polarity in lateral organs of plants. Curr.Biol. 11, 1251-1260. Eshed, Y., Izhaki, A., Baum, S.F., Floyd, S.K., and Bowman, J.L. (2004). Asymmetric leaf development and blade expansion in Arabidopsis are mediated by KANADI and YABBY activities. Development 131, 2997-3006. 122 Fahlgren, N., Montgomery, T.A., Howell, M.D., Allen, E., Dvorak, S.K., Alexander, A.L., and Carrington, J.C. (2006). Regulation of Auxin Response Factor3 by Tas3 Ta-Sirna Affects Developmental Timing and Patterning in Arabidopsis. Current Biology 16, 939-944. Felsenstein, J . (1981). Evolutionary Trees from Dna-Sequences - A Maximum-Likelihood Approach. Journal MoI.Evol. 17, 368-376. Ferrandiz, C , Gu, Q., Martienssen, R., and Yanofsky, M.F. (2000a). Redundant regulation of meristem identity and plant architecture by FRUITFULL, APETALA1 and CAULIFLOWER. Development 127, 725-734. Ferrandiz, C , Liljegren, S.J., and Yanofsky, M.F. (2000b). Negative regulation of the SHATTERPROOF genes by FRUITFULL during Arabidopsis fruit development. Science 289, 436-438. Fletcher, J.C. (2002). Shoot and floral meristem maintenance in arabidopsis. Annual Review of Plant Biology 53, 45-66. Force, A., Lynch, M., Pickett, F.B., Amores, A., Yan, Y.L., and Postlethwait, J . (1999). Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151, 1531-1545. Friml, J. , Vieten, A., Sauer, M., Weijers, D., Schwarz, H., Hamann, T., Offringa, R., and Jurgens, G. (2003). Efflux-dependent auxin gradients establish the apical-basal axis of Arabidopsis. Nature 426, 147-153. Frugis, G., Giannino, D., Mele, G., Nicolodi, C , Chiappetta, A., Bitonti, M.B., Innocenti, A.M., Dewitte, W., Van Onckelen, H., and Mariotti, D. (2001). Overexpression of KNAT1 in lettuce shifts leaf determinate growth to a shoot-like indeterminate growth associated with an accumulation of isopentenyl-type cytokinins. Plant Physiol 126, 1370-1380. Furutani, M., Vernoux, T., Traas, J. , Kato, T., Tasaka, M., and Aida, M. (2004). PIN-FORMED1 and PINOID regulate boundary formation and cotyledon development in Arabidopsis embryogenesis. Development 131, 5021-5030. Gehring, W.J. (1987). Homeo boxes in the study of development. Science 236, 1245-1252. Gehring, W.J., Affolter, M., and Burglin, T. (1994). Homeodomain Proteins. Annual Review of Biochemistry 63, 487-526. Gilchrist, E.J., and Haughn, G.W. (2005). TILLING without a plough: a new method with applications for reverse genetics. Current Opinion in Plant Biology 8, 211-215. Gleave, A.P. (1992). A Versatile Binary Vector System with A T-Dna Organizational-Structure Conducive to Efficient Integration of Cloned Dna Into the Plant Genome. Plant Mol.Biol. 20, 1203-1207. 123 Grigg, S.P., Canales, C , Hay, A., and Tsiantis, M. (2005). SERRATE coordinates shoot meristem function and leaf axial patterning in Arabidopsis. Nature 437, 1022-1026. Groot, E.P., and Meicenheimer, R.D. (2000). Comparison of leaf plastochron index and allometric analyses of tooth development in Arabidopsis thaliana. Journal of Plant Growth Regulation 19, 77-89. Guindon, S., and Gascuel, O. (2003). A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52, 696-704. Guindon, S., Lethiec, F., Duroux, P., and Gascuel, O. (2005). PHYML Online - a web server for fast maximum likelihood-based phylogenetic inference. Nucleic Acids Res. 33, W557-W559. Ha, C M . , Jun, J.H., Nam, H.G., and Fletcher, J.C. (2004). BLADE-ON-PETIOLE1 encodes a BTB/POZ domain protein required for leaf morphogenesis in Arabidopsis thaliana. Plant and Cell Physiology 45, 1361-1370. Ha, C M . , Kim, G.T., Kim, B.C., Jun, J.H., Soh, M.S., Ueno, Y., Machida, Y., Tsukaya, H., and Nam, H.G. (2003). The BLADE-ON-PETIOLE 1 gene controls leaf pattern formation through the modulation of meristematic activity in Arabidopsis. Development 130, 161-172. Hackbusch, J . , Richter, K., Muller, J. , Salamini, F., and Uhrig, J.F. (2005). A central role of Arabidopsis thaliana ovate family proteins in networking and subcellular localization of 3-aa loop extension homeodomain proteins. Proc.Natl.Acad.Sci.U.S.A 102,4908-4912. Haecker, A., Gross-Hardt, R., Geiges, B., Sarkar, A., Breuninger, H., Herrmann, M., and Laux, T. (2004). Expression dynamics of WOX genes mark cell fate decisions during early embryonic patterning in Arabidopsis thaliana. Development 131, 657-668. Hall, T. A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl.Acids.Symp.Ser. 41, 95-98. 1999. Ref Type: Journal (Full) Hamann, T., Benkova, E., Baurle, I., Kientz, M., and Jurgens, G. (2002). The Arabidopsis BODENLOS gene encodes an auxin response protein inhibiting MONOPTEROS-mediated embryo patterning. Genes & Development 16,1610-1615. Hamann, T., Mayer, U., and Jurgens, G. (1999). The auxin-insensitive bodenlos mutation affects primary root formation and apical-basal patterning in the Arabidopsis embryo. Development 126,1387-1395. Hamant, O., Nogue, F., Belles-Boix, E., Jublot, D., Grandjean, O., Traas, J. , and Pautot, V. (2002). The KNAT2 homeodomain protein interacts with ethylene and cytokinin signaling. Plant Physiol 130, 657-665. 124 Han, W., Rhee, H.I., Cho, J.W., Ku, M.S.B., Song, P.S., and Wang, M.H. (2005). Overexpression of Arabidopsis ACK1 alters leaf morphology and retards growth and development. Biochemical and Biophysical Research Communications 330, 887-890. Hardtke, C.S., and Berleth, T. (1998). The Arabidopsis gene MONOPTEROS encodes a transcription factor mediating embryo axis formation and vascular development. Embo Journal 17, 1405-1411. Hata, R. (1996). Where am I? How a cell recognizes its positional information during morphogenesis. Cell Biology International 20, 59-65. Hay, A., and Tsiantis, M. (2006). The genetic basis for differences in leaf form between Arabidopsis thaliana and its wild relative Cardamine hirsuta. Nat.Genet. 38, 942-947. Henikoff, S., and Henikoff, J.G. (1992). Amino-Acid Substitution Matrices from Protein Blocks. Proc.Natl.Acad.Sci.il.S.A 89,10915-10919. Hepworth, S.R., Zhang, Y.L., Mckim, S., Li, X., and Haughn, G. (2005). BLADE-ON-PETIOLE-dependent signaling controls leaf and floral patterning in Arabidopsis. Plant Cell 17, 1434-1448. Hertel, K.J., Lynch, K.W., and Maniatis, T. (1997). Common themes in the function of transcription and splicing enhancers. Current Opinion in Cell Biology 9, 350-357. Hessabi, B., Schmidt, I., and Walther, R. (2000). The homeodomain of Nkx2.2 carries two cooperatively acting nuclear localization signals. Biochemical and Biophysical Research Communications 270, 695-700. Hessabi, B., Ziegler, P., Schmidt, I., Hessabi, C , and Walther, R. (1999). The nuclear localization signal (NLS) of PDX-1 is part of the homeodomain and represents a novel type of NLS. European Journal of Biochemistry 263, 170-177. Hofer, J. , Turner, L., Hellens, R., Ambrose, M., Matthews, P., Michael, A., and Ellis, N. (1997). UNIFOLIATA regulates leaf and flower morphogenesis in pea. Current Biology 7, 581-587. Horiguchi, G., Kim, G.T., and Tsukaya, H. (2005). The transcription factor AtGRF5 and the transcription coactivator AN3 regulate cell proliferation in leaf primordia of Arabidopsis thaliana. Plant Journal 43, 68-78. Hughes, A.L. (1994). The Evolution of Functionally Novel Proteins After Gene Duplication. Proceedings of the Royal Society of London Series B-Biological Sciences 256, 119-124. Hunter, C , Willmann, M.R., Wu, G., Yoshikawa, M., de la Luz Gutierrez-Nava, and Poethig, R.S. (2006). Trans-acting siRNA-mediated repression of ETTIN and ARF4 regulates heteroblasty in Arabidopsis. Development 133, 2973-2981. 125 Hunter, C , Sun, H., and Poethig, R.S. (2003). The Arabidopsis Heterochronic Gene ZIPPY Is an ARGONAUTE Family Member. Current Biology 13, 1734-1739. lida, K., Seki, M., Sakurai, T., Satou, M., Akiyama, K., Toyoda, T., Konagaya, A., and Shinozaki, K. (2005). RARTF: Database and Tools for Complete Sets of Arabidopsis Transcription Factors. DNA Res 12, 247-256. Iwakawa, H., Ueno, Y., Semiarti, E., Onouchi, H., Kojima, S., Tsukaya, H., Hasebe, M., Soma, T., Ikezaki, M., Machida, C , and Machida, Y. (2002). The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana, required for formation of a symmetric flat leaf lamina, encodes a member of a novel family of proteins characterized by cysteine repeats and a leucine zipper. Plant Cell Physiol 43, 467-478. Jabet, C , Gitti, R., Summers, M.F., and Wolberger, C. (1999). NMR studies of the Pbx1 TALE homeodomain protein free in solution and bound to DNA: Proposal for a mechanism of HoxB1-Pbx1-DMA complex assembly. Journal of Molecular Biology 291, 521-530. Jasinski, S., Piazza, P., Craft, J. , Hay, A., Woolley, L., Rieu, I., Phillips, A., Hedden, P., and Tsiantis, M. (2005). KNOX action in Arabidopsis is mediated by coordinate regulation of cytokinin and gibberellin activities. Curr.Biol. 15, 1560-1565. Jaw, T.J., You, L.R., Knoepfler, P.S., Yao, L.C., Pai, C.Y., Tang, C.Y., Chang, L.P., Berthelsen, J . , Blasi, F., Kamps, M.P., and Sun, Y.H. (2000). Direct interaction of two homeoproteins, Homothorax and Extradenticle, is essential for EXD nuclear localization and function. Mechanisms of Development 91, 279-291. Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6, 3901-3907. Jeong, S., Trotochaud, A.E., and Clark, S.E. (1999). The Arabidopsis CLAVATA2 gene encodes a receptor-like protein required for the stability of the CLAVATA1 receptor-like kinase. Plant Cell 11,1925-1933. Johnson, A.D. (1995). Molecular Mechanisms of Cell-Type Determination in Budding Yeast. Current Opinion in Genetics & Development 5, 552-558. Jover-Gil, S., Candela, H., and Ponce, M.R. (2005). Plant microRNAs and development. International Journal of Developmental Biology 49, 733-744. Juarez, M.T., Kui, J.S., Thomas, J. , Heller, B.A., and Timmermans, M.C. (2004). microRNA-mediated repression of rolled leafl specifies maize leaf polarity. Nature 428, 84-88. Jurgens, G. (2001). Apical-basal pattern formation in Arabidopsis embryogenesis. Embo Journal 20, 3609-3616. Kaffman, A., and O'Shea, E.K. (1999). Regulation of nuclear localization: A key to a door. Annual Review of Cell and Developmental Biology 15, 291-339. 126 Kanrar, S., Onguka, O., and Smith, H.M. (2006). Arabidopsis inflorescence architecture requires the activities of KNOX-BELL homeodomain heterodimers. Planta 224, 1163-1173. Kappen, C. (2000). The homeodomain: an ancient evolutionary motif in animals and plants. Computers & Chemistry 24, 95-103. Kayes, J.M., and Clark, S.E. (1998). CLAVATA2, a regulator of meristem and organ development in Arabidopsis. Development 125, 3843-3851. Kempin, S.A., Savidge, B., and Yanofsky, M.F. (1995). Molecular basis of the cauliflower phenotype in Arabidopsis. Science 267, 522-525. Kepinski, S., and Leyser, O. (2003). Plant development - An axis of auxin. Nature 426, 132-135. Kerstetter, R., Vollbrecht, E., Lowe, B., Veit, B., Yamaguchi, J . , and Hake, S. (1994). Sequence analysis and expression patterns divide the maize knotted 1-like homeobox genes into two classes. Plant Cell 6,1877-1887. Kerstetter, R.A., Bollman, K., Taylor, R.A., Bomblies, K., and Poethig, R.S. (2001). KANADI regulates organ polarity in Arabidopsis. Nature 411, 706-709. Kessler, S., and Sinha, N. (2004). Shaping up: the genetic control of leaf shape. Current Opinion in Plant Biology 7, 65-72. Khorasanizadeh, S., and Rastinejad, F. (1999). Transcription factors: The right combination for the DNA lock. Current Biology 9, R456-R458. Kidner, C.A., and Martienssen, R.A. (2004). Spatially restricted microRNA directs leaf polarity through ARGONAUTE1. Nature 428, 81-84. Kim, G.T., Shoda, K., Tsuge, T., Cho, K.H., Uchimiya, H., Yokoyama, R., Nishitani, K., and Tsukaya, H. (2002). The ANGUSTIFOLIA gene of Arabidopsis, a plant CtBP gene, regulates leaf-cell expansion, the arrangement of cortical microtubules in leaf cells and expression of a gene involved in cell-wall formation. Embo Journal 21, 1267-1279. Kim, J.Y., Rim, Y., Wang, L., and Jackson, D. (2005). A novel cell-to-cell trafficking assay indicates that the KNOX homeodomain is necessary and sufficient for intercellular protein and mRNA trafficking. Genes & Development 19, 788-793. Kim, J.Y., Yuan, Z., and Jackson, D. (2003a). Developmental regulation and significance of KNOX protein trafficking in Arabidopsis. Development 130, 4351-4362. Kim, M., Canio, W., Kessler, S., and Sinha, N. (2001). Developmental changes due to long-distance movement of a homeobox fusion transcript in tomato. Science 293, 287-289. 127 Kim, M., Pham, T., Hamidi, A., McCormick, S., Kuzoff, R.K., and Sinha, N. (2003b). Reduced leaf complexity in tomato wiry mutants suggests a role for PHAN and KNOX genes in generating compound leaves. Development 130, 4405-4415. Kishino, H., Miyata, T., and Hasegawa, M. (1990). Maximum-Likelihood Inference of Protein Phylogeny and the Origin of Chloroplasts. Journal of Molecular Evolution 31, 151-160. Knoepfler, P.S., Bergstrom, D.A., Uetsuki, T., Dac-Korytko, I., Sun, Y.H., Wright, W.E., Tapscott, S.J., and Kamps, M.P. (1999). A conserved motif N-terminal to the DNA-binding domains of myogenic bHLH transcription factors mediates cooperative DNA binding with Pbx-Meis1/Prep1. Nucl.Acids Res. 27, 3752-3761. Knoepfler, P.S., Calvo, K.R., Chen, H.M., Antonarakis, S.E., and Kamps, M.P. (1997). Meisl and pKnoxl bind DNA cooperatively with Pbx1 utilizing an interaction surface disrupted in oncoprotein E2a-Pbx1. Proceedings of the National Academy of Sciences of the United States of America 94, 14553-14558. Krakauer, D.C., and Nowak, M.A. (1999). Evolutionary preservation of redundant duplicated genes. Seminars in Cell & Developmental Biology 10, 555-559. Krusell, L., Rasmussen, I., and Gausing, K. (1997). DNA binding sites recognised in vitro by a knotted class 1 homeodomain protein encoded by the hooded gene, k, in barley (Hordeum vulgare). Febs Letters 408, 25-29. Kwon, C.S., Chen, C.B., and Wagner, D. (2005). WUSCHEL is a primary target for transcriptional regulation by SPLAYED in dynamic control of stem cell fate in Arabidopsis. Genes & Development 19, 992-1003. Larkin, J.C., Marks, M.D., Nadeau, J . , and Sack, F. (1997). Epidermal cell fate and patterning in leaves. Plant Cell 9, 1109-1120. Laux, T., Mayer, K.F.X., Berger, J. , and Jurgens, G. (1996). The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 122, 87-96. Leaf Architecture Working Group (1999) Manual of leaf architechture Morphological description and categorization of dicotyledonous and net-veined monocotyledonous angiosperms. Washington DC: Smithsonian Institution. Leibfried, A., To, J.P.C., Busch, W., Stehling, S., Kehle, A., Demar, M., Kieber, J.J., and Lohmann, J.U. (2005). WUSCHEL controls meristem function by direct regulation of cytokinin-inducible response regulators. Nature 438, 1172-1175. . Lenhard, M., and Laux, T. (2003). Stem cell homeostasis in the Arabidopsis shoot meristem is regulated by intercellular movement of CLAVATA3 and its sequestration by CLAVATA1. Development 130, 3163-3173. Liljegren, S.J., Ditta, G.S., Eshed, Y., Savidge, B., Bowman, J.L., and Yanofsky, M.F. (2000). SHATTERPROOF MADS-box genes control seed dispersal in Arabidopsis. Nature 404, 766-770. 128 Lin, W.C., Shuai, B., and Springer, P.S. (2003). The Arabidopsis LATERAL ORGAN BOUNDARIES-Domain Gene ASYMMETRIC LEAVES2 Functions in the Repression of KNOX Gene Expression and in Adaxial-Abaxial Patterning. Plant Cell 15, 2241-2252. Lincoln, C , Long, J . , Yamaguchi, J . , Serikawa, K., and Hake, S. (1994). A knottedl-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6, 1859-1876. Long, J.A., and Barton, M.K. (1998). The development of apical embryonic pattern in Arabidopsis. Development 125, 3027-3035. Long, J.A., Moan, E.I., Medford, J.I., and Barton, M.K. (1996). A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379, 66-69. Long, J.A., Ohno, C , Smith, Z.R., and Meyerowitz, E.M. (2006). TOPLESS regulates apical embryonic fate in Arabidopsis. Science 312, 1520-1523. Long, J.A., Woody, S., Poethig, S., Meyerowitz, E.M., and Barton, M.K. (2002). Transformation of shoots into roots in Arabidopsis embryos mutant at the TOPLESS locus. Development 129, 2797-2806. Lu, Q., and Kamps, M.P. (1996). Structural determinants within Pbx1 that mediate cooperative DNA binding with pentapeptide-containing Hox proteins: Proposal for a model of a Pbx1-Hox-DNA complex. Molecular and Cellular Biology 16, 1632-1640. Mallory, A.C., Reinhart, B.J., Jones-Rhoades, M.W., Tang, G.L., Zamore, P.D., Barton, M.K., and Bartel, D.P. (2004). MicroRNA control of PHABULOSA in leaf development: importance of pairing to the microRNA 5 ' region. Embo Journal 23, 3356-3364. Mann, R.S. (1995). The Specificity of Homeotic Gene-Function. Bioessays 17, 855-863. Mansfield, S.G., and Briarty, L.G. (1991). Early Embryogenesis in Arabidopsis-Thaliana .2. the Developing Embryo. Canadian Journal of Botany-Revue Canadienne de Botanique 69,461-476. Mattaj, I.W., and Englmeier, L. (1998). Nucleocytoplasmic transport: The soluble phase. Annual Review of Biochemistry 67, 265-306. Mayer, K.F., Schoof, H., Haecker, A., Lenhard, M., Jurgens, G., and Laux, T. (1998). Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell 95, 805-815. Mayer, U., Buttner, G., and Jurgens, G. (1993). Apical-Basal Pattern-Formation in the Arabidopsis Embryo - Studies on the Role of the Gnom Gene. Development 117, 149-162. 129 McCallum, C M . , Comai, L , Greene, E.A., and Henikoff, S. (2000). Targeting induced local lesions in genomes (TILLING) for plant functional genomics. Plant Physiol. 123,439-442. McConnell, J.R., and Barton, M.K. (1998). Leaf polarity and meristem formation in Arabidopsis. Development 125, 2935-2942. McConnell, J.R., Emery, J. , Eshed, Y., Bao, N., Bowman, J . , and Barton, M.K. (2001). Role of PHABULOSA and PHAVOLUTA in determining radial patterning in shoots. Nature 411, 709-713. Mclellan, T., and Dengler, N. (1995). Pattern and Form in Repeated Elements in the Development of Simple Leaves of Begonia Dregei. International Journal of Plant Sciences 156, 581-589. Meinke, D., and Koornneef, M. (1997). Community standards: A new series of guidelines for plant science - Community standards for Arabidopsis genetics. Plant Journal 12, 247-253. Meinke, D.W., Cherry, J.M., Dean, C , Rounsley, S.D., and Koornneef, M. (1998). Arabidopsis thaliana: A model plant for genome analysis. Science 282, 662-+. Meisel, L., and Lam, E. (1996). The conserved ELK-homeodomain of KNOTTED-1 contains two regions that signal nuclear localization. Plant Molecular Biology 30, 1-14. Mitchison, G.J. (1977). Phyllotaxis and Fibonacci Series. Science 196, 270-275. Modrusan, Z., Reiser, L., Feldmann, K.A., Fischer, R.L., and Haughn, G.W. (1994). Homeotic Transformation of Ovules into Carpel-like Structures in Arabidopsis. Plant Cell 6, 333-349. Moore, R . C , and Purugganan, M.D. (2005). The evolutionary dynamics of plant duplicate genes. Current Opinion in Plant Biology 8, 122-128. Muller, J . (2000). Transcriptional control: The benefits of selective insulation. Current Biology 10, R241-R244. Muller, J. , Wang, Y., Franzen, R., Santi, L., Salamini, F., and Rohde, W. (2001). In vitro interactions between barley TALE homeodomain proteins suggest a role for protein-protein associations in the regulation of Knox gene function. Plant J. 27, 13-23. Nakai, K., and Horton, P. (1999). PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem.Sci. 24, 34-36. Narita, N.N., Moore, S., Horiguchi, G., Kubo, M., Demura, T., Fukuda, H., Goodrich, J., and Tsukaya, H. (2004). Overexpression of a novel small peptide ROTUNDIFOLIA4 decreases cell proliferation and alters leaf shape in Arabidopsis thaliana. Plant Journal 38, 699-713. 130 Nath, U., Crawford, B.C.W., Carpenter, R., and Coen, E. (2003). Genetic control of surface curvature. Science 299, 1404-1407. Norberg, M., Holmlund, M., and Nilsson, O. (2005). The BLADE ONPETIOLE genes act redundantly to control the growth and development of lateral organs. Development 132, 2203-2213. Nowak, M.A., Boerlijst, M.C., Cooke, J . , and Smith, J.M. (1997). Evolution of genetic redundancy. Nature 388, 167-171. Ohno, C.K., Reddy, G.V., Heisler, M.G., and Meyerowitz, E.M. (2004). The Arabidopsis JAGGED gene encodes a zinc finger protein that promotes leaf tissue development. Development 131, 1111-1122. Okada, K., Ueda, J . , Komaki, M.K., Bell, C.J., and Shimura, Y. (1991). Requirement of the Auxin Polar Transport-System in Early Stages of Arabidopsis Floral Bud Formation. Plant Cell 3, 677-684. Ori, N., Eshed, Y., Chuck, G., Bowman, J.L., and Hake, S. (2000). Mechanisms that control knox gene expression in the Arabidopsis shoot. Development 127, 5523-5532. Ori, N., Juarez, M.T., Jackson, D., Yamaguchi, J . , Banowetz, G.M., and Hake, S. (1999). Leaf Senescence Is Delayed in Tobacco Plants Expressing the Maize Homeobox Gene knotted 1 under the Control of a Senescence-Activated Promoter. Plant Cell 11, 1073-1080. Otsuga, D., DeGuzman, B., Prigge, M.J., Drews, G.N., and Clark, S.E. (2001). REVOLUTA regulates meristem initiation at lateral positions. Plant J. 25, 223-236. Pai, C.Y., Kuo, T.S., Jaw, T.J., Kurant, E., Chen, C.T., Bessarab, D.A., Salzberg, A., and Sun, Y.H. (1998). The Homothorax homeoprotein activates the nuclear localization of another homeoprotein, Extradenticle, and suppresses eye development in Drosophila. Genes & Development 12, 435-446. Palatnik, J.F., Allen, E., Wu, X., Schommer, C , Schwab, R., Carrington, J . C , and Weigel, D. (2003). Control of leaf morphogenesis by microRNAs. Nature. Passner, J.M., Ryoo, H.D., Shen, L.Y., Mann, R.S., and Aggarwal, A.K. (1999). Structure of a DNA-bound Ultrabithorax-Extradenticle homeodomain complex. Nature 397,714-719. Pautot, V., Dockx, J. , Hamant, O., Kronenberger, J . , Grandjean, O., Jublot, D., and Traas, J . (2001). KNAT2: evidence for a link between knotted-like genes and carpel development. Plant Cell 13, 1719-1734. Pelaz, S., Ditta, G.S., Baumann, E., Wisman, E., and Yanofsky, M.F. (2000). B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature 405, 200-203. 131 Peltenburg, L.T.C., and Murre, C. (1997). Specific residues in the Pbx homeodomain differentially modulate the DNA-binding activity of Hox and Engrailed proteins. Development 124, 1089-1098. Peragine, A., Yoshikawa, M., Wu, G., Albrecht, H.L., and Poethig, R.S. (2004). SGS3 and SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting siRNAs in Arabidopsis. Genes and Development 18, 2368-2379. Peterson, C.L., and Logie, C. (2000). Recruitment of chromatin remodeling machines. Journal of Cellular Biochemistry 78, 179-185. Pidkowich, M. S. Interactions between members of two homeodomain protein families in Arabidopsis thaliana. 2001. Vancouver, University of British Columbia. Ref Type: Thesis/Dissertation Piper, D.E., Batchelor, A.H., Chang, C P . , Cleary, M.L., and Wolberger, C. (1999). Structure of a HoxB1-Pbx1 heterodimer bound to DNA: Role of the hexapeptide and a fourth homeodomain helix in complex formation. Cell 96, 587-597. Poethig, R.S. (1990). Phase-Change and the Regulation of Shoot Morphogenesis in Plants. Science 250, 923-930. Ponting, C P . , and Aravind, L. (1999). START: a lipid binding domain in StAR, HD-ZIP and signalling proteins. Trends in Biochemical Sciences 24, 130-132. Prigge, M.J., and Wagner, D.R. (2001). The arabidopsis serrate gene encodes a zinc-finger protein required for normal shoot development. Plant Cell 13, 1263-1279. Ptashne, M., and Gann, A. (1997). Transcriptional activation by recruitment. Nature 386, 569-577. Quaedvlieg, N., Dockx, J . , Rook, F., Weisbeek, P., and Smeekens, S. (1995). The homeobox gene ATH1 of Arabidopsis is derepressed in the photomorphogenic mutants cop1 and detl. Plant Cell 7, 117-129. Ray, A., Robinson-Beers, K., Ray, S., Baker, S .C , Lang, J.D., Preuss, D., Milligan, S.B., and Gasser, C S . (1994). Arabidopsis floral homeotic gene BELL (BEL1) controls ovule development through negative regulation of AGAMOUS gene (AG). Proc.Natl.Acad.Sci.U.S.A 91, 5761-5765. Reddy, G.V., Heisler, M.G., Ehrhardt, D.W., and Meyerowitz, E.M. (2004). Real-time lineage analysis reveals oriented cell divisions associated with morphogenesis at the shoot apex of Arabidopsis thaliana. Development 131, 4225-4237. Reinhardt, D., Mandel, T., and Kuhlemeier, C. (2000). Auxin regulates the initiation and radial position of plant lateral organs. Plant Cell 12, 507-518. 132 Reinhardt, D., Pesce, E.R., Stieger, P., Mandel, T., Baltensperger, K., Bennett, M., Traas, J. , Friml, J . , and Kuhlemeier, C. (2003). Regulation of phyllotaxis by polar auxin transport. Nature 426, 255-260. Reiser, L , Modrusan, Z., Margossian, L., Samach, A., Ohad, N., Haughn, G.W., and Fischer, R.L. (1995). The BELLI gene encodes a homeodomain protein involved in pattern formation in the Arabidopsis ovule primordium. Cell 83, 735-742. Reiser, L., Sanchez-Baracaldo, P., and Hake, S. (2000). Knots in the family tree: evolutionary relationships and functions of knox homeobox genes. Plant Moi.Biol. 42, 151-166. Rhoades, M.W., Reinhart, B.J., Lim, L.P., Burge, C.B., B arte I, B., and Barrel, D.P. (2002). Prediction of plant microRNA targets. Cell 110, 513-520. Robinson-Beers, K., Pruitt, R.E., and Gasser, C S . (1992). Ovule Development in Wild-Type Arabidopsis and Two Female-Sterile Mutants. Plant Cell 4, 1237-1249. Roeder, A.H., Ferrandiz, C , and Yanofsky, M.F. (2003). The Role of the REPLUMLESS Homeodomain: Protein in Patterning the Arabidopsis Fruit. Current Biology 13, 1630-1635. Royer, D.L., and Wilf, P. (2006). Why do toothed leaves correlate with cold climates? Gas exchange at leaf margins provides new insights into a classic paleotemperature proxy. International Journal of Plant Sciences 167, 11-18. Rutjens, B., Brand, B., Smeekens, S., and Proveniers, M. The Arabidopsis TALE homeobox gene ATH1 controls flowering time by regulating FLC Levels. Abstract 165. 2006. 17th International Conference on Arabidopsis Research. Ref Type: Conference Proceeding Saleh, M., Huang, H., Green, N .C, and Featherstone, M.S. (2000): A conformational change in PBX1A is necessary for its nuclear localization. Experimental Cell Research 260, 105-115. Sano, R., Juarez, C M . , Hass, B., Sakakibara, K., Ito, M., Banks, J.A., and Hasebe, M. (2005). KNOX homeobox genes potentially have similar function in both diploid unicellular and multicellular meristems, but not in haploid meristems. Evolution & Development 7, 69-78. Satina, S., Blakeslee, A.F., and Avery, A.G. (1940). Demonstration of the three germ layers in the shoot apex of Datura by means of induced polyploidy in periclinal chimeras. Am.J.Bot. 27, 895-905. Sawa, S., Watanabe, K., Goto, K., Kanaya, E., Morita, E.H., and Okada, K. (1999). FILAMENTOUS FLOWER, a meristem and organ identity gene of Arabidopsis, encodes a protein with a zinc finger and HMG-related domains. Genes & Development 13,1079-1088. 133 Schmidt, A. (1924). Histologische Studien an Phanerogamen Vegetationspunkten. Bot.Arch., 345-404. Schmitz, G., and Theres, K. (1999). Genetic control of branching in Arabidopsis and tomato. Curr.Opin.Plant Biol. 2, 51-55. Schoof, H., Lenhard, M., Haecker, A., Mayer, K.F., Jurgens, G., and Laux, T. (2000) . The stem cell population of Arabidopsis shoot meristems in maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell 100, 635-644. Schultz, E.A., and Haughn, G.W. (1991). LEAFY, a Homeotic Gene That Regulates Inflorescence Development in Arabidopsis. Plant Cell 3, 771-781. Scofield, S., and Murray, J.A.H. (2006a). KNOX gene function in plant stem cell niches. Plant Molecular Biology 60, 929-946. Scofield, S., and Murray, J.A.H. (2006b). The evolving concept of the meristem. Plant Molecular Biology 60, V-vii. Semiarti, E., Ueno, Y., Tsukaya, H., Iwakawa, H., Machida, C , and Machida, Y. (2001) . The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana regulates formation of a symmetric lamina, establishment of venation and repression of meristem-related homeobox genes in leaves. Development 128, 1771-1783. Serikawa, K.A., and Zambryski, P.C. (1997). Domain exchanges between KNAT3 and KNAT1 suggest specificity of the kn1-like homeodomains requires sequences outside of the third helix and N-terminal arm of the homeodomain. Plant J. 11, 863-869. Serrano-Cartagena, J . , Robles, P., Ponce, M.R., and Micol, J.L. (1999). Genetic analysis of leaf form mutants from the Arabidopsis Information Service collection. Molecular and General Genetics 261, 725-739. Sherr, C.J., and Roberts, J.M. (1999). CDK inhibitors: Positive and negative regulators of G1-phase progression. Genes and Development 13, 1501-1512. Sieburth, L.E., and Meyerowitz, E.M. (1997). Molecular dissection of the AGAMOUS control region shows that cis elements for spatial regulation are located intragenically. Plant Cell 9, 355-365. Siegfried, K.R., Eshed, Y., Baum, S.F., Otsuga, D., Drews, G.N., and Bowman, J.L. (1999). Members of the YABBY gene family specify abaxial cell fate in Arabidopsis. Development 126, 4117-4128. Simillion, C , Vandepoele, K., Van Montagu, M.C.E., Zabeau, M., and Van de Peer, Y. (2002). The hidden duplication past of Arabidopsisthaliana: PNAS 99, 13627-13632. Smith, H.M., Boschke, I., and Hake, S. (2002). Selective interaction of plant homeodomain proteins mediates high DNA-binding affinity. Proc.Natl.Acad.Sci.U.S.A 99, 9579-9584. 134 Smith, H.M., Campbell, B.C., and Hake, S. (2004). Competence to respond to floral inductive signals requires the homeobox genes PENNYWISE and POUND-FOOLISH. Curr.Biol. 14,812-817. Smith, H.M., and Hake, S. (2003). The interaction of two homeobox genes, BREVIPEDICELLUS and PENNYWISE, regulates internode patterning in the Arabidopsis inflorescence. Plant Cell 15,1717-1727. Smyth, D.R., Bowman, J.L., and Meyerowitz, E.M. (1990). Early flower development in Arabidopsis. Plant Cell 2, 755-767. Somerville.C.R. and Ogren.W.L. (1982) Isolation of photorespiration mutants in Arabidopsis thaliana. In M Edelman, RB Hallick, NH Chua, eds, Methods in Chloroplast Biology. Elsevier Biomedical Press: New York. Spit, A., Hyland, R.H., Mellor, E.J.C., and Casselton, L.A. (1998). A role for heterodimerization in nuclear localization of a homeodomain protein. Proceedings of the National Academy of Sciences of the United States of America 95, 6228-6233. Steeves.T.A. (1962) Morphogenesis in isolated fern leaves. In Regeneration, 20th Growth Symposium, D.Rudnick, ed (New York: Ronald), pp. 117-151. Steeves.T.A. and Sussex,I.M. (1989) Patterns in plant development. Cambridge Cambridgeshire: Cambridge University Press. Sun, Y., Zhou, Q., Zhang, W., Fu, Y., and Huang, H. (2002). ASYMMETRIC LEAVES1, an Arabidopsis gene that is involved in the control of cell differentiation in leaves. Planta 214, 694-702. Sussex, I.M. (1955). Morphogenesis in Solanum tuberosum L.: Experimental investigation of leaf dorsiventrality and orientation in the juvenile shoot. Phytomorphology 5, 286-300. Takei, K., Sakakibara, H., and Sugiyama, T. (2001). Identification of Genes Encoding Adenylate Isopentenyltransferase, a Cytokinin Biosynthesis Enzyme, in Arabidopsis thaliana. Journal of Biological Chemistry 276, 26405-26410. Talbert, P.B., Adler, H.T., Parks, D.W., and Comai, L. (1995). The REVOLUTA gene is necessary for apical meristem development and for limiting cell divisions in the leaves and stems of Arabidopsis thaliana. Development 121, 2723-2735. Tang, G.L., Reinhart, B.J., Bartel, D.P., and Zamore, P.D. (2003). A biochemical framework for RNA silencing in plants. Genes & Development 17, 49-63. Telfer, A., Bollman, K.M., and Poethig, R.S. (1997). Phase change and the regulation of trichome distribution in Arabidopsis thaliana. Development 124, 645-654. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl.Acids Res. 25, 4876-4882. 135 Thompson, J.D., Higgins, D.G., and Gibson, T J . (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673-4680. Till, B.J., Burtner, C , Comai, L , and Henikoff, S. (2004). Mismatch cleavage by single-strand specific nucleases. Nucleic Acids Research 32, 2632-2641. Till, B.J., Reynolds, S.H., Greene, E.A., Codomo, C.A., Enns, L.C., Johnson, J.E., Burtner, C , Odden, A.R., Young, K., Taylor, N.E., Henikoff, J.G., Comai, L , and Henikoff, S. (2003). Large-scale discovery of induced point mutations with high-throughput TILLING. Genome Research 13, 524-530. Toresson, H., Parmar, M., and Campbell, K. (2000). Expression of Meis and Pbx genes and their protein products in the developing telencephalon: implications for regional differentiation. Mechanisms of Development 94, 183-187. Trotochaud, A.E. , Hao, T., Wu, G., Yang, Z.B., and Clark, S.E. (1999). The CLAVATA1 receptor-like kinase requires CLAVATA3 for its assembly into a signaling complex that includes KAPP and a Rho-related protein. Plant Cell 11, 393-405. Trotochaud, A.E., Jeong, S., and Clark, S.E. (2000). CLAVATA3, a multimeric ligand for the C LA VAT A1 receptor-kinase. Science 289, 613-617. Tsuge, T., Tsukaya, H., and Uchimiya, H. (1996). Two independent and polarized processes of cell elongation regulate leaf blade expansion in Arabidopsis thaliana (L) Heynh. Development 122, 1589-1600. Tsukaya, H. (2002). The leaf index: Heteroblasty, natural variation, and the genetic control of polar processes of leaf expansion. Plant and Cell Physiology 43, 372-378. Tsukaya, H. (2005). Leaf shape: genetic controls and environmental factors. International Journal of Developmental Biology 49, 547-555. Tsukaya, H., Kozuka, T., and Kim, G.T. (2002). Genetic control of petiole length in Arabidopsis thaliana. Plant and Cell Physiology 43, 1221-1228. Tsukaya, H., Shoda, K., Kim, G.T., and Uchimiya, H. (2000). Heteroblasty in Arabidopsis thaliana (L.) Heynh. Planta 210, 536-542. Tsukaya, H., and Uchimiya, H. (1997). Genetic analyses of the formation of the serrated margin of leaf blades in Arabidopsis: combination of a mutational analysis of leaf morphogenesis with the characterization of a specific marker gene expressed in hydathodes and stipules. Moi.Gen.Genet. 256, 231-238. van der Graaff, E., Dulk-Ras, A., Hooykaas, P.J.J., and Keller, B. (2000). Activation tagging of the LEAFY PETIOLE gene affects leaf petiole development in Arabidopsis thaliana. Development 127, 4971-4980. 136 van der Valk, P., Pertijs, J.H., Lamers, J.T.W.H., van Dun, C.M.P., and Smeekens, J.C.M. (2004). Late heading of perennial ryegrass caused by introducing an Arabidopsis homeobox gene. Plant Breeding 123, 531-535. Vandijk, M.A., Peltenburg, L.T.C., and Murre, C. (1995). Hox Gene-Products Modulate the Dna-Binding Activity of Pbx1 and Pbx2. Mechanisms of Development 52, 99-108. Vazquez, F., Vaucheret, H., Rajagopalan, R., Lepers, C , Gasciolli, V., Mallory, A.C., Hilbert, J.L., Bartel, D.P., and Crete, P. (2004). Endogenous trans-Acting siRNAs Regulate the Accumulation of Arabidopsis mRNAs. Molecular Cell 16, 69-79. Veit, B. (2004). Determination of cell fate in apical meristems. Current Opinion in Plant Biology 7, 57-64. Venglat, S.P., Dumonceaux, T., Rozwadowski, K., Parnell, L., Babic, V., Keller, W., Martienssen, R., Selvaraj, G., and Datla, R. (2002). The homeobox gene BREVIPEDICELLUS is a key regulator of inflorescence architecture in Arabidopsis. Proc.Natl.Acad.Sci.U.S.A 99, 4730-4735. Vernoux, T., Kronenberger, J . , Grandjean, O., Laufs, P., and Traas, J . (2000). PIN-FORMED 1 regulates cell fate at the periphery of the shoot apical meristem. Development 127, 5157-5165. Vigano, M.A., Di Rocco, G., Zappavigna, V., and Mavilio, F. (1998). Definition of the transcriptional activation domains of three human HOX proteins depends on the DNA-binding context. Molecular and Cellular Biology 18, 6201-6212. Villanueva, J.M., Broadhvest, J . , Hauser, B.A., Meister, R.J., Schneitz, K., and Gasser, C S . (1999). INNER NO OUTER regulates abaxial- adaxial patterning in Arabidopsis ovules. Genes Dev. 13, 3160-3169. Viola, I.L., and Gonzalez, D.H. (2006). Interaction of the BELL-like protein ATH1 with DNA: role of homeodomain residue 54 in specifying the different binding properties of BELL and KNOX proteins. Biological Chemistry 387, 31-40. Vollbrecht, E., Veit, B., Sinha, N., and Hake, S. (1991). The Developmental Gene Knotted-1 Is A Member of A Maize Homeobox Gene Family. Nature 350, 241-243. Waites, R., and Hudson, A. (1995). Phantastica - A Gene Required for Dorsoventrality of Leaves in Antirrhinum-Majus. Development 121, 2143-2154. Waites, R., Selvadurai, H.R., Oliver, I.R., and Hudson, A. (1998). The PHANTASTICA gene encodes a MYB transcription factor involved in growth and dorsoventrality of lateral organs in Antirrhinum. Cell 93, 779-789. Weigel, D., Alvarez, J . , Smyth, D.R., Yanofsky, M.F., and Meyerowitz, E.M. (1992). LEAFY controls floral meristem identity in Arabidopsis. Cell 69, 843-859. 137 Wen, W., Meinkoth, J.L., Tsien, R.Y., and Taylor, S.S. (1995). Identification of A Signal for Rapid Export of Proteins from the Nucleus. Cell 82, 463-473. Wesley, S.V., Helliwell, C.A., Smith, N.A., Wang, M.B., Rouse, D.T., Liu, Q., Gooding, P.S., Singh, S.P., Abbott, D., Stoutjesdijk, P.A., Robinson, S.P., Gleave, A.P., Green, A.G., and Waterhouse, P.M. (2001). Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J. 27, 581-590. White, D.W. (2006). PEAPOD regulates lamina size and curvature in Arabidopsis. Proc.Natl.Acad.Sci.U.S.A. 103, 13238-13243. White, R.A.H., Aspland, S.E., Brookman, J.J., Clayton, L., and Sproat, G. (2000). The design and analysis of a homeotic response element. Mechanisms of Development 91, 217-226. Williams, L., and Fletcher, J.C. (2005). Stem cell regulation in the Arabidopsis shoot apical meristem. Current Opinion in Plant Biology 8, 582-586. Wu, G., and Poethig, R.S. (2006). Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3. Development 133, 3539-3547. Xu, L., Xu, Y., Dong, A., Sun, Y., Pi, L., Xu, Y., and Huang, H. (2003). Novel as1 and as2 defects in leaf adaxial-abaxial polarity reveal the requirement for ASYMMETRIC LEAVES1 and 2 and ERECTA functions in specifying leaf adaxial identity. Development 130, 4097-4107. Xu, L., Yang, L., Pi, L.M., Liu, Q.L., Ling, Q.H., Wang, H., Poethig, R.S., and Huang, H. (2006). Genetic interaction between the AS1-AS2 and RDR6-SGS3-AG07 pathways for leaf morphogenesis. Plant and Cell Physiology 47, 853-863. Yang, L., Huang, W., Wang, H., Cai, R., Xu, Y., and Huang, H. (2006a). Characterizations of a hypomorphic argonautel mutant reveal novel AG01 functions in Arabidopsis lateral organ development. Plant Moi.Biol. 61, 63-78. Yang, L., Liu, Z.Q., Lu, F., Dong, A.W., and Huang, H. (2006b). SERRATE is a novel nuclear regulator in primary microRNA processing in Arabidopsis. Plant Journal 47, 841-850. Yang, Y., Hwang, C.K., D'Souza, U.M., Lee, S.H., Junn, E., and Mouradian, M.M. (2000). Three-amino acid extension loop homeodomain proteins Meis2 and TGIF differentially regulate transcription. Journal of Biological Chemistry 275, 20734-20741. Zhang, H.L., Catron, K.M., and AbateShen, C. (1996). A role for the Msx-1 homeodomain in transcriptional regulation: Residues in the N-terminal arm mediate TATA binding protein interaction and transcriptional repression. Proceedings of the National Academy of Sciences of the United States of America 93,1764-1769. Zhao, Y.X., Medrano, L., Ohashi, K., Fletcher, J.C, Yu, H., Sakai, H., and Meyerowitz, E.M. (2004). HANABA TARANU is a GATA transcription factor that 138 regulates shoot apical meristem and flower development in Arabidopsis. Plant Cell 16, 2586-2600. Zhu, A.H., and Kuziora, M.A. (1996). Homeodomain interaction with the beta subunit of the general transcription factor TFIIE. Journal of Biological Chemistry 271, 20993-20996. Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., and Gruissem, W. (2004). GENEVESTIGATOR. Arabidopsis Microarray Database and Analysis Toolbox. Plant Physiol. 136, 2621-2632. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0100541/manifest

Comment

Related Items