Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

A TCR transgenic model of infection-induced autoimmune psoriasiform skin disease Oble, Darryl 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-317228.pdf [ 32.53MB ]
Metadata
JSON: 831-1.0100527.json
JSON-LD: 831-1.0100527-ld.json
RDF/XML (Pretty): 831-1.0100527-rdf.xml
RDF/JSON: 831-1.0100527-rdf.json
Turtle: 831-1.0100527-turtle.txt
N-Triples: 831-1.0100527-rdf-ntriples.txt
Original Record: 831-1.0100527-source.json
Full Text
831-1.0100527-fulltext.txt
Citation
831-1.0100527.ris

Full Text

A T C R T R A N S G E N I C M O D E L OF I N F E C T I O N - I N D U C E D A U T O I M M U N E P S O R I A S I F O R M S K I N D I S E A S E by D A R R Y L O B L E B . S c , The University of Winnipeg, 1995 B.Sc. , The University of Manitoba, 1999 M . D . , The University of Manitoba, 1999 A THESIS S U B M I T T E D I N P A R T I A L F U L F I L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF D O C T O R OF P H I L O S O P H Y in T H E F A C U L T Y OF G R A D U A T E S T U D I E S (Immunology) T H E U N I V E R S I T Y OF B R I T I S H C O L U M B I A August 2006 © Darryl Oble, 2006 Abstract Psoriasiform skin diseases are a poorly understood group of disorders. Recent data has implicated the immune system with a central role in disease pathogenesis. In this thesis, various T cell populations were studied in a T C R transgenic model of psoriasiform disease, whose abnormal interactions culminate in distinctive psoriasiform pathology. The model is based upon the expression of the transgenic 2C T C R on the H-2 d-expressing D B A / 2 inbred strain (referred to as D 2 C mice). The 2C T C R recognizes a peptide (p2Ca) derived from the ubiquitous mitochondrial protein 2-oxoglutarate dehydrogenase, presented by the M H C class I molecule, L d . In D 2 C mice, expression of the 2C T C R led to a comprehensive depletion of immature T cell progenitors, which express the 2C T C R , and a resultant lymphopenia of mature peripheral T cells. The lymphopenia of C D 8 + cytotoxic and C D 4 + helper T cells predisposes to the"" overgrowth of opportunistic pathogens, resulting in inflammatory skin disease restricted to the sebum rich areas of the skin, resembling the human psoriasiform disease seborrheic dermatitis. In D 2 C mice, there is also a deficiency in T regulatory (T r e g ) cells as a result of slowed thymic output of mature T cells. The reduced T r e g function results in a lymphoproliferation of polyclonal C D 4 + C D 2 5 " cells, many of which home to the aforementioned cutaneous _~ inflammatory sites. This expansion of "helper" cells was likely due to antigenic stimulation, presumably against immunogenic determinants of opportunistic pathogens. Reconstitution of the T r e g compartment by adoptive transfer abrogates the development of psoriasiform pathology and precludes the lymphoproliferation of C D 4 + C D 2 5 " cells. These data suggest that T r e g may downregulate the response of mature cells to ubiquitous commensal organisms as a means to maintain immunological homeostasis. In T C R transgenic mice which express the cognate A g of the transgenic T C R , a large population of transgenic cells exist in the peripheral lymphoid tissues. These cells are anergized i i and fail to respond to stimulation with cognate ligand; however, they express a memory immunophenotype, including the intermediate affinity IL-2 receptor. The expression of this receptor enables these cells to use bystander IL-2 or IL-15 to overcome this inactivation, revealing enhanced functional properties induced by the high-affinity interaction with cognate ligand. These observations suggest that such clonally anergized cells may represent an in vivo autoimmune hazard; and, interestingly, a further consequence of the C D 4 + C D 2 5 " lymphoproliferation in D 2 C mice is the bystander activation of these transgenic T cells. After undergoing acute activation, 2C T cells exacerbate the cutaneous pathology in these animals, a consequence that can be abrogated by the administration of a blocking m A b against the 2C T C R . Interestingly, the combination of immunodeficiency, T r e g lymphopenia, the presence of C D 4 + C D 2 5 " cells capable of undergoing vigorous expansion, and a large population of memory ; phenotype 2C transgenic cells was insufficient to induce disease when D 2 C bone marrow was adoptively transferred to lethally irradiated syngeneic D B A / 2 mice. Examination of these animals revealed that bone marrow transfer did not deplete the skin of DBA/2-derived cutaneous y8 cells. Sentinel intraepithelial y8 lymphocytes have been shown to have an important role in surveying the epithelium for signs of infection and malignancy as well as in maintaining epithelial integrity. The development of these cells is curtailed in D 2 C mice due to the forced expression of the 2C T C R ; however, the persistence of these cells in the aforementioned bone marrow chimeras may have protected these animals from the development of the disease phenotype. While generated D B A / 2 TCR5" A mice did not develop spontaneous disease, the transfer of D 2 C bone marrow to lethally irradiated D B A / 2 T C R 8 7 " recipients successfully transferred the disease phenotype, confirming the importance of these cells in protecting against the development of psoriasiform pathology. This result also demonstrated that a compromised i i i cutaneous barrier is necessary for disease pathogenesis, as disease does not develop when the skin is populated by sentinel intraepithelial lymphocytes. While considerable research efforts have been focused on human psoriasiform disease, a solid understanding of disease pathophysiology is severely lacking. This limited knowledge of psoriasiform disease is highlighted by the ongoing uncertainty of whether these diseases represent primary diseases of the epithelium, or whether these diseases represent tissue specific autoimmunity occurring in normal skin as a result of dysfunctional immunity. One explanation for this failure to understand basic principles of psoriasiform disease pathophysiology can be attributed to the limited numbers of appropriate model systems to carefully study disease. The D 2 C model of psoriasiform disease has been shown to be an accurate model system which has demonstrated that a complex interplay between various immunocytes and epithelium culminates in psoriasiform disease. The insight that the D 2 C model has generated wi l l lead to a better understanding of these poorly characterized psoriasiform conditions. iv Table of Contents Abstract « Table of Contents v List of Tables x List of Figures xi List of Abbreviations xiv Acknowledgements xx Chapter 1: Introduction 1 1.1 The Immune System 1 1.1.1 Innate Immunity 1 1.1.2 Adaptive Immunity 2 1.2 The T Cell Receptor and T Cell Ag Recognition 3 1.3 T Cell Signalling ' 8 1.4 T Cell Development 12 1.5 Tolerance 22 1.6 Psoriasiform Disease 28 1.6.1 Psoriasis 29 1.6.2 Seborrheic Dermatitis 34 1.7 Thesis Goals and Approaches 41 Chapter 2: Materials and Methods 44 v 2.1. Mice 44 2.2 Cell Lines 44 2.3 Reagents 45 2.4 Methods 48 2.5 Data Reproducibility ; 65 2.6 Statistics 65 Chapter 3: Pathological and Clinical Characterization of Cutaneous Disease 66 3.1 Introduction: 66 3.2 Natural History of Disease 67 3.2.1 Gross Pathology of Disease 68 3.2.2 Microscopic Pathology of Disease 70 3.3 Exploring the Role of Fungus in Disease Pathogenesis 73 3.3.1 Antifungal Staining of Diseased Skin 73 3.3.2 Identification of Fungus from Lesional Tissue 75 3.3.3 Effect of Antifungal Treatment on Established Cutaneous Pathology 82 3.3.4 Effect of Antimicrobial Treatment on the Suppression of Cutaneous Pathology 82 3.4 Exploring Genetic Influences on Disease Penetrance 86 3.4.1 Pattern of Inheritance and Strain Susceptibility 86 3.4.2 Adoptive Transfer of Disease 87 3.4.3 D B A / 2 Complement Factor 5 Defects and Disease 91 3.5 Conclusion 93 vi Chapter 4: Immunosuppression and Immune Repertoire Perturbation 97 4.1 Introduction 97 4.2 Characterization of Immune Function in D2C Mice 99 4.2.1 Quantification of Thymocytes and T Cel l Subsets In D 2 C Mice 99 4.2.2 Assaying T Cell-Dependent Humoral Immune Function 101 4.2.3 Characterization of Additional Immunopathological Features O f D 2 C Mice 103 4.2.4 Further Characterization of the C D 4 + T Cel l Subset 106 4.2.4.1 Longitudinal C D 4 + T Cel l Quantification 106 4.2.4.2 Immunophenotype of Expanding C D 4 + T Cells from D 2 C Mice 109 4.3 Immunological Reconstitution of D2C Mice 113 4.3.1 Adoptive Transfer of Syngeneic C D 4 + T Cells to Pre-Diseased D 2 C Mice 113 4.3.2 Passive Immunization of Pre-Diseased D 2 C Mice with Opportunistic Pathogen-Specific Serum IgG 115 4.3.3 Analysis of T r e g Development and Function in D 2 C Mice 117 4.3.4 Adoptive Transfer of Purified, Syngeneic T r e g and C D 4 + C D 2 5 " "Helper" T Cells to Pre-Diseased D 2 C Mice 121 4.3.5 Comparison of D 2 C and FoxP3 Knockout Mice 124 4.4 Dexamethasone Treatment of D2C Mice 127 4.5 Conclusion 128 Chapter 5: Self-Reactive T Cells in Disease Pathophysiology 135 5.1 Introduction: 135 5.2 Self-Reactive Cells in TCR Transgenic Mice 137 v i i 5.2.1 The Expression of the 2C T C R in D 2 C Mice: 137 5.2.2 Characterization of Peripheral 2C Cells in D 2 C Mice : 139 5.3 Involvement of 2C cells in Disease Pathogenesis 146 5.3.1 2C Cells are Necessary for Disease Development 146 5.3.2 T r e g Preclude the Acute Activation of 2C Cells 148 5.3.3 2C Cells are not Sufficient for Disease Development 151 5.4 Conclusion 155 Chapter 6: Cutaneous yS T Lymphocytes and Their Role in Disease Pathophysiology 160 6.1 Introduction _160 6.2 Intraepithelial Lymphocytes in 2C Mice 162 6.2.1 Characterization of IELs in 2C T C R Transgenic and Non-Transgenic Mice on the B6 , D B A / 2 , and Mixed ( B 6 x D B A / 2 ) N i Backgrounds 162 6.2.2 Cutaneous Immunoregulatory Function of 2C IELs in D 2 C Mice 169 6.2.3 Adoptive Transfer of Disease is Associated with the Replacement of Cutaneous y5 T Cells with 2C Lymphocytes 171 6.2.4 Adoptive Transfer of Disease to D B A / 2 TCR5" 7" Mice 176 6.3 Conclusion _181 Chapter 7: Implications of the D2C Model on Contemporary Hypotheses of Psoriasiform Disease Pathogenesis 187 7.1 Introduction 187 vin 7.2 Role of Intrinsic Keratinocyte Defects in Psoriasiform Disease Pathogenesis 187 7.3 Role of Infection in Psoriasiform Disease 189 7.4 Role of the Immune System in Psoriasiform Disease: . 191 7.5 Conclusion 195 Bibliography 197 Appendices 226 ix List of Tables Table 1. Development of Disease in Recombinant Strains 28 Table 2: Antibodies Used 45 Table 3: Primers Used 47 Table 4: Identification of the Fungal Isolates as Candida guilliermondii 77 Table 5. ITS Sequence Data of the Fungal Isolate 79 Table 6. Cutaneous Lymphocyte Subsets in the Various Mouse Strains Studied 176 x List of Figures Figure 1. Summary of T Cel l Development 154 Figure 2. Schematic of the 2C T C R and its Antigen Interactions 19 Figure 3. Gross Pathology of Psoriasis 310 Figure 4. Histopathology of Psoriasis _32 Figure 5. Gross Pathology of Seborrheic Dermatitis 36 Figure 6. Histopathology of Seborrheic Dermatitis 37 Figure 7. Occurrence of Seborrheic Dermatitis in the Context of H I V Infection 40 Figure 8. Gross Pathology of Disease 69 Figure 9. Microscopic Pathology of Disease 721 Figure 10. Antifungal Staining of Lesional Skin 74 Figure 11. Isolation of Fungi from the Lesional Skin of Diseased D 2 C Mice 76 Figure 12. P C R Amplification of the ITS Region of the Unknown Fungal Isolate 78 Figure 13. Fungal-Specific IgG and Relationship to Disease Activity 81 Figure 14. Treatment of Diseased D 2 C Mice with Antifungal Medication 83 Figure 15. Treatment of Pre-Diseased D 2 C Mice with Antimicrobial Agents 84 Figure 16. Strain Susceptibility 88 Figure 17. Backcross Analysis of Disease Penetrance 89 Figure 18. Adoptive Transfer of Disease with Bone Marrow 90 Figure 19. Effect of the D B A / 2 C5 Mutation on the Disease Phenotype in N 2 2 C backcrosses to the D B A / 2 background 92 Figure 20. Evaluation for Lymphopenia and T C R Repertoire Skewing in D 2 C Mice 100 Figure 21. Assessment of T Cell-Dependent Humoral Immune Function in D2C Mice 102 x i Figure 22. Necropsy Observations made on D 2 C Mice 104 Figure 23. Characterization of the C D 4 + T Cel l Number and T C R Chain Usage over the Window of Disease Susceptibility 1087 Figure 24. Immunophenotype of D 2 C C D 4 + T Cells 111 Figure 25. Phenotypic Characteristics of Recovered D 2 C Mice 112 Figure 26. Adoptive Transfer of C D 4 + T Cel l to Pre-Diseased D 2 C Mice 114 Figure 27. Adoptive Transfer of C D 4 + T Cells to Pre-Diseased D 2 C Mice (Continued) 116 Figure 28. Adoptive Transfer of Serum from S3 D 2 C Mice to Pre-Diseased D 2 C Animals 118 Figure 29. Evaluation of C D 4 + C D 2 5 + T Regulatory Cells in D 2 C Mice 120 Figure 30. Effect of the Adoptive Transfer of C D 4 + C D 2 5 + T r e g or C D 4 + C D 2 5 " "Helper" T Cells to Pre-Diseased D 2 C Mice 122 Figure 31. Effect of the Adoptive Transfer of C D 4 + C D 2 5 + T r e g or C D 4 + C D 2 5 " "Helper" T Cells to Pre-Diseased D 2 C Mice (Continued) 123 Figure 32. Scurfy Mouse Cutaneous Histology 125 Figure 33. Additional Immunopathological Features of D 2 C Mice 126 Figure 34. Treatment of Pre-Diseased D 2 C Mice with the Corticosteriod Dexamethasone 129 Figure 35. Treatment of Pre-Diseased D 2 C Mice with the Corticosteriod Dexamethasone (Continued) 130 Figure 36. Expression of the 2C T C R in the Thymus and Peripheral Lymphoid Organs in B 2 C b and D 2 C Mice 138 Figure 37. Immunophenotype of 2C T C R D N T C 140 Figure 38. Functional Characterization of 2C T C R D N T C from Disease-Resistant and Disease-Susceptible Mice 142 xn Figure 39. Determination of whether the Acutely Activated Immunophenotype and Enhanced Functional Properties of 2C D N T C are Cell-Intrinsic or Cell-Extrinsic Characteristics 145 Figure 40. Treatment of D 2 C Mice with a Blocking m A b against the 2C T C R 147 Figure 41. Effect of Previous Interventions on the Activation Status of 2C T C R D N T C in D 2 C Mice 149 Figure 42. Adoptive Transfer of C D 6 9 + 2C T C R D N T C to Recipient D B A / 2 Mice 152 Figure 43. Characterization of the D B A / 2 Rag-1"A Mice 154 Figure 44. Characterization of D 2 C Rag-1"7" Mice 156 Figure 45. Characterization of Cutaneous Intraepithelial Lymphocytes in B6 , D B A / 2 and Mixed ( B 6 x D B A / 2 ) N i Mice With or Without the 2C T C R Transgenes 163 Figure 46. 2C Cells Located within Epithelial Sites 165 Figure 47. Microscopic Examination of Cutaneous Intraepithelial Lymphocyte Density 1687 Figure 48. Correlation of Intraepithelial C D 3 + Cel l Density with Susceptibility to the Development of Cutaneous Pathology 170 Figure 49. Croton O i l Application to Assess Cutaneous Barrier Function 172 Figure 50. Susceptibility of D B A / 2 Recipient Mice to Disease Following Transfer of D 2 C and B 2 C d Bone Marrow 173 Figure 51. Characterization of Cutaneous Intraepithelial Lymphocytes in D B A / 2 Recipients of D 2 C and B 2 C d Bone Marrow 175 Figure 52. Characterization of D B A / 2 T C R o ^ ' M i c e 177 Figure 53. Characterization of D B A / 2 TCR5 _ / " Recipients of D 2 C Bone Marrow 18079 Figure 54. Summary of Factors Contributing to Disease Development 196 x i i i List of Abbreviations 1B2 m A b against the 2C T C R 2C T C R 2C transgenic T cell receptor 2 - M E 2-Mercapto-ethanol 7 A A D 7-Amino-Actinomycin D - a -alpha a- Ant i -a-gal cer Alpha-galactosyl ceremide A b Antibody A g Antigen A I R E Autoimmune regulator gene A P Alkaline phosphatase A P C Antigen-presenting cell A T C C American Type Culture Collection P2M P2 Microglobulin B 2 C b 2C TCR-expressing B6 mouse B 2 C d H - 2 d congenic 2C TCR-expressing B6 B6 C57BL/6 inbred mouse strain B C R B cell receptor B M C Bone marrow chimera bp Base pair B r d U Bromodeoxyuridine B S A Bovine serum albumin xiv B X D Recombinant inbred strains derived from C 5 7 B L / 6 and D B A / 2 crossings. B X D d H - 2 d expressing, recombinant inbred strains derived from C57BL/6 and D B A / 2 crossings C. Candida C Complement C a 2 + , C a ^ Calcium C D Cluster of differentiation C D R Complementarity-determining regions C L I P Class Il-associated invariant-chain peptide C M I Cell-mediated immunity C o n A Concanavalin A cpm Counts per minute, as a measure of radioactivity d Days D Diversity T cell receptor gene segments D 2 C D B A / 2 2C T cell receptor transgenic mouse D A G Diacylglycerol D B A / 2 D B A / 2 inbred mouse strain D C Dendritic cell D E T C Dendritic epidermal T cell Dex Dexamethasone df Degrees of freedom DIC Differential interference contrast D N C D 4 C D 8 " Double negative thymocyte D N A Deoxyribonucleic acid xv D N T C CD4TJD8" Double negative T cell D P C D 4 + C D 8 + Double positive thymocyte d s D N A Double stranded D N A E L I S A Enzyme-linked immunosorbent assay E t O H Ethanol F(Ab) Fragments of antigen binding FACS® Fluorescence activated cell sorter - a registered trademark of B D Pharmig FITC Fluorescein isothiocyanate FoxP3 Forkhead winged helix transcription factor G E F Guanine-nucleotide exchange factor G M S Grocott's Methenamine Silver G P C Gram positive cocci G S K - 3 Glycogen synthase kinase-3 h Hours H A Hyaluronic acid H & E Haematoxylin and Eosin H E L Hen egg lysozyme H R P Horseradish peroxidase H S V Herpes simplex virus H Y T C R H Y transgenic T cell receptor ICOS CD278 IF Immunofluoresence I F N Interferon Ig Immunoglobulin xvi IHC Immunohistochemistry IL Interleukin I M D M Iscove's Modified Dulbecco Medium i.p. Intraperitoneal IP3 Inositol triphosphate ITS Internal Transcribed Spacer i.v. Intravenous J Joining T cell receptor gene segments K G F Keratinocyte growth factor K O Knockout (homozygous -/-) L Ligand 1 Liter L A T Linker of activation in T cells M. Malassezia M " 1 Inverse molarity m A b Monoclonal antibody M A C Membrane attack complex M A P Mitogen activated protein M H C Major histocompatibility complex M I C A / B Major histocompatibility complex class I chain-related A / B min Minutes ul Microliter M t v Mouse mammary tumor provirus N i 2 C (C57BL/6 x D B A / 2 ) N i 2 C mouse xv i i N A P S Nucleic Acid-Protein Service Unit at the University of British Columbia N F A T Nuclear factor of activated T cells N K Natural killer cells N K T Natural killer T cells nm Nanometer O C T Optimal cutting temperature O D Optical density . O V A Ovalbumin p Probability P13K Phosphoinositide-3 kinase p2Ca Peptide L S P F P F D L (single letter amino acid code) P A M P Pathogen related molecular patterns P A S Periodic acid Schiff P B S Phosphate buffered saline P E Phycoerythrin PE-Cy5 Phycoerythrin-cyanin 5; also known as Tri-Color® PIP2 Phopho-inositol pyrophosphate P K C - 9 Protein kinase C-8 PLC-y-1 Phospholipase C-y-1 poly(I:C) Polyinosinic-polycytidylic acid pTp4 Prothymosin-P4 R A E - 1 Retinoic acid early inducible R - E A E Relapsing experimental autoimmune encephalymyelitis xv i i i R B C Red blood cell RI Recombinant inbred strains S Stage of D 2 C psoriaisiform disease S A Streptavidin SD Seborrheic dermatitis SP C D 4 + C D 8 " or C D 4 " C D 8 + Single positive thymocyte spp. species T3.70 m A b against the H Y transgenic T C R - a chain T A P Transporter associated with antigen processing Tc Cytotoxic T cell T C R T cell receptor T H C D 4 + C D 2 5 " T helper cell T M E V Theiler's murine encephalomyelitits virus T N F Tumor necrosis factor T r e g C D 4 + C D 2 5 + T regulatory cell T R I M TCR-interacting molecule Tri-Color® Phycoerythrin-cyanin 5 (PE-Cy5) T S A Tryptic soy agar T S L P Thymic stromal lymphopoietin U Units V Variable region of T cell receptor genes W B C White blood cell Y B C Yeast biochemical card xix Acknowledgements I would like to thank my family for instilling within me the importance of learning and for helping to weather the ups and downs that invariably accompany academic pursuits. M y grandparents, M o l l y , Joseph, and Rose, shared a similar philosophy on learning and were extremely supportive of my academic endevours. Although I never knew my grandpa George, I have been told that he also held education in the highest regard. M y parents, Walter and Joyce, demonstrated an unnatural degree of philanthropy during my impoverished student life. M y brother, George, has also been extremely supportive of both my academic and personal development and has demonstrated amazing patience over the years. I am also indebted to my wonderful wife, Elisabeth, who has endured much hardship during my academic struggles and whose friendship, love and support makes me more complete. I would also like to acknowledge the kind and enduring patience of my Ph.D. supervisor, Dr. Hung-Sia Teh, who is exceptionally supportive of my pursuit of both scientific and clinical training. The training that I acquired in the Teh lab was exceedingly helpful in teaching me about how science works and undoubtedly has been my most rewarding training experience to date. Last of all, I would like to thank my thesis committee members, Drs. Brett Finlay, Fumio Takei and Douglas Waterfield, for their scientific insight, personal support, and understanding of the plight of graduate student life. xx Chapter 1; Introduction 1.1 The Immune System On a daily basis, somatic cells are subjected to wide variety of pathogenic microbes and other environmental insults. Diverse mechanisms have evolved to provide protection against this onslaught. Together, the innate and adaptive immune systems provide a remarkably effective defense against infectious pathogens, non-infectious foreign substances, and other sources of cell stress. 1.1 .1 Innate Immunity The innate immune response provides a general first line of defense able to act against a wide variety of pathogens in a rapid fashion by virtue of its relatively non-specific mode of action. Specific components of innate immunity include physical and chemical defenses such as epithelial barriers and high gastric acidity, respectively, which block the invasion of unwanted material. There are also "humoral" aspects of innate immunity, such as complement and other serum proteins (i.e., C reactive protein), which have an important role in early defense [ 1 ] . Another critical aspect of innate immunity are populations of circulating and non-circulating cells which neutralize invading microorganisms and foreign material by phagocytosis, the release of antibacterial and enzymatic agents as well as the liberation of important paracrine signaling molecules that facilitate the recruitment of other essential cells and mediators of the immune response [ 1 ] . The common feature shared by this diverse group of innate immune effectors is their rapid deployment, which allows for an almost-instantaneous response. This quick utilization of innate immune mechanism can be attributed to the germ-line encoded effector proteins and receptors characteristic of innate immunity as well as the perpetual renewal of large number of ready-to-use innate immune cells and effector molecules [ 1 ] . 1 1.1.2 Adapt ive Immunity Adaptive immunity can be divided into two broad categories, humoral and cellular immunity, based upon the ontogeny of the effector cells as well as the mechanism by which the cells carry out their adaptive function. The antigen receptors of both T and B lymphocytes require the prior rearrangement of receptor gene segments by somatic recombination, resulting in novel receptors possessing a virtually unlimited ability to recognize A g [1]. It is estimated that the mammalian immune system can discriminate approximately 10 1 0 distinct antigenic determinants which is a testament to the diversity of adaptive antigen receptors and their unparalleled role in bodily defense [2]. Because of the vast repertoire of lymphocytes, the frequency of any one given clone is inadequate during the initial stages of a particular antigenic challenge. Therefore a " lag" period, typically 7-10 days after the initial insult [1], occurs in adaptive immunity during which lymphocytes with specific antigen-recognition properties undergo vigorous expansion, increasing in frequency by several orders of magnitude. Once sufficient levels of antigen-specific cells are attained, a focused, powerful immune response can be generated. Humoral immunity is mediated by B lymphocytes, which arise in the bone marrow and which utilize secreted immunoglobulins as effector molecules which recognize the three-dimensional conformation of unprocessed antigens (Ag) without the aid of antigen-presenting molecules [1]. Recognition of specific antigen by the B cell receptor (BCR) , which is a non-secreted, membrane-bound immunoglobulin, in association with important secondary signals, results in B cell activation and the subsequent development into antibody-secreting plasma cells [1]. The second major arm of the adaptive immune system is "cellular immunity" mediated in large part by the T lymphocyte lineage which requires the thymus for development [1]. T cells 2 carry out a variety of functions that are broadly divided into "helper"-based and cytotoxic functions [1]. T helper cells (TH) are essential for the activation of B cells and macrophages by virtue the provision of the C D 4 0 L "second" activation signal to these cells [1]. The absence of this important cellular cooperation is best appreciated by the wide-spread immunodeficiency seen in common variable immunodeficiency where the failure of C D 4 0 L - C D 4 0 signaling results in impaired immunity [3]. Cytotoxic T cells (T c ) are best known for their ability to k i l l viral infected cells through the release of perforin, granzyme and/or Fas/FasL signaling [4, 5]. The importance of Tc cells in anti-viral defense is made obvious by the innumerable ways that viral pathogens attempt to subvert Tc cell recognition of viral A g [6]. Recently it has become apparent that at least some "cytotoxic" T cells have a role in the surveillance against malignant and infected cells as wel l , broadening the immunological function of these cells [7]. 1.2 The T Cell Receptor and T Cell Ag Recognition The T cell receptor (TCR) is the most specific marker of the T cell lineage [1]. The T C R of most "conventional" T cells consists of an a and P chain that form a disulfide-linked, monovalent, non-secreted heterodimer, although rarely, T C R s can consist of a homodimer of T C R p chains [8]. Both the a and P T C R chain possess an amino terminal variable region with homology to the immunoglobulin V region (V), a constant region with homology to the immunoglobulin C region (C), a short hinge region with a cysteine residue that forms the interchain disulfide bond, hydrophobic transmembrane segments, and a short cytoplasmic tail (2-7 amino acids in length) which is associated with TCR-related signalling molecules [9]. The T C R is generated from 52 variable (V) gene segments, 2 diversity (D) gene segments and 13 joining (J) gene segments for the p chain and -70 V and 61 J gene segments for the a chain which randomly associate to form a diverse repertoire of T cell receptors [1,9]. 3 The regions of both the T C R a and P chains encoded by the V gene segments are found on three short, hypervariable loops, known as complementarity-determining regions (CDRs), which together form the antigen binding aspect of the T C R [9]. The junction of the V and D gene segments form the tips of the C D R s and, between these gene segments, non-germline encoded amino acids are randomly added and deleted, resulting in the generation of even greater diversity [1]. The focus of these diversity hot-spots within the area of antigen-recognition ensures the development of a large repertoire of T cells [9]. Thus, the structural diversity of T C R s is due to combinatorial and junctional diversity generated during gene rearrangement together which result in an extremely diverse repertoire of T lymphocytes. The T cell A g receptor is different from that of the B C R in that this heterodimeric transmembrane protein, with rare exception, recognizes short amino acid chains bound to proteinaceous antigen-presenting molecules [1]. This recognition therefore requires the prior digestion of antigenic proteins and the resultant binding of derivative peptides to A g presenting molecules called Major Histocompatibility Complex ( M H C ) molecules, which are an integral component of most T C R ligands [1]. M H C was first recognized in the 1940's by George Snell who, while analysing the rejection of transplanted tumours and other tissue grafts between mice strains, discovered that tissue compatibility was controlled by several closely linked genes within the histocompatibility-2 (H-2) locus [10]. Soon after, homologous genes were found in other mammalian species and were named the major histocompatibility complex [10]. The critical importance of M H C molecules in T cell antigen recognition came with the discovery that T cells are only responsive to their specific peptide A g when presented by se l f -MHC molecules, a phenomenon termed MHC-restriction [11]. Since this sentinel finding, much has been elucidated about the M H C , and recent experimental evidence is revealing fascinating insights about the immunobiology of these molecules. 4 M H C molecules are divided into classical and non-classical types [1]. Classical M H C are highly polymorphic molecules which are further sub-divided into class I and class II subtypes. M H C class I molecules are encoded by three highly polymorphic genes both in mice (K, D , and L) and humans (A, B , C) and are constitutively expressed on virtually all nucleated cells with further upregulation under conditions of inflammation [9]. M H C class I upregulation is induced by cytokines such as interferon-a, -P, and -y ( IFN-a, -p, -y), tumour necrosis factor-a (TNF-a) and lymphotoxin [1]. The fully assembled class I complex consists of an MHC-encoded a chain, a non-MHC encoded P2-microglobulin (p 2 M) sub-unit and a peptide 8-11 amino acids in length [9]. M H C class I molecules are dependent on T A P (transporter associated with antigen processing) and TAP-associated proteins which transport cytoplasmic peptides into the endoplasmic reticulum [1]. The ubiquitous expression pattern and the ability of these molecules to present cytoplasmic A g makes M H C class I molecules critical for the presentation of viral A g by infected cells [1]. Peptide loaded M H C class I molecules are recognized by Tc cells as the non-polymorphic ce3 region of M H C class I molecules is bound by the extracellular Ig domain of both the a- and P-chains of the Tc-expressing C D 8 co-receptor [1], explaining the propensity of Tc cells to defend against viral pathogens [12]. M H C class II molecules are highly polymorphic proteins encoded by two genes in mice (I-A and I-E) and three genes in humans (DR, DP , DQ) [9]. The fully assembled class II complex consists of MHC-encoded a and P chains as well as a peptide, 10-30 amino acids in length. M H C class II molecules are primarily expressed on professional antigen presenting cells (APCs) such as D C , B lymphocytes, and macrophages although the expression of M H C class II molecules is also upregulated by cytokines such as IFN-y [13]. In contrast to M H C class I molecules, nascent M H C class II molecules are prevented from binding peptides in the E R by the class II-associated invariant-chain peptide (CLIP) [1]. Instead, M H C class II molecules are 5 transported to the cell surface in vesicles that fuse with incoming endosomes containing peptide fragments from extracellular pathogens and proteins [1]. The fusion of these vesicles occurs concomitantly with the enzymatic digestion of the clip peptide, allowing derivative peptides of endocytosed proteinaceous A g to bind the M H C class II binding groove [1]. A P C with peptide loaded M H C class II molecules are bound by TH cells, as the two N-terminal Ig-like regions of the T H C D 4 molecule bind to the non-polymorphic p2 domain of M H C class II [9]. The recognition of M H C class II-bearing antigenic ligands by T H cells explains why T H cells are well suited for "helping" the function of professional A P C , through their delivery of a focused C D 4 0 L signal to these cells, and thereby facilitating efficient humoral and cellular immunity [1]. The importance of M H C polymorphisms in these antigen recognition events is that the presentation of identical peptides by allelic variants of M H C creates unique ligands that are recognized by different T cell clones [1]. This additional diversity in T C R ligands makes it more likely that an individual w i l l develop an effective T cell response against a given A g thereby eliminating potential holes in the T cell repertoire. Furthermore, from a population genetic standpoint, one advantage of maintaining these M H C polymorphisms is the insurance that at least some individuals in the population wi l l respond to a novel infectious agent to which the majority of individuals would succumb. While the majority of T cells in lymphoid organs express the ap T C R heterodimer, a small population of T lymphocytes expresses a different set of T cell receptor subunits called y and 8 chains [1]. These y and 8 chains are assembled in a similar fashion as ap T C R chains, undergoing the process of somatic recombination of V , D , and J gene segments [1]; however, there are only 92 V gene segments in y8 T cells compared to the 122 V gene segments in aP cells, which limits the diversity of the y8 T C R [9]. While ap and y8 cells have some common characteristics, a peculiarity of the y8 T C R is that it shares structural features with the B C R . 6 Specifically, the y5 T C R can recognize the three-dimensional shape of Ags as well as recognize non-proteinaceous ligands including inorganic molecules, lipids and unprocessed antigens such as the herpes simplex virus ( H S V ) - l glycoproteins [14]. The unusual A g that are recognized by y8 also includes a diverse group of unconventional A g presenting molecules [15] which have been grouped together as M H C class lb molecules [1]. These non-polymorphic structures, similar to M H C class I molecules, are encoded by genes located within the H-2 loci of murine chromosome 17 and may associate with p 2 M [16]. The M H C class IB molecules are expressed in a variety of cell types, including fibroblasts and epithelial cells and, in some cases, are induced in response to signals of cellular stress such as heat shock, making T cells responsive to these ligands sentinel lymphocytes for cellular stress [1]. While some M H C class IB molecules have been shown to present unconventional A g such as inorganic molecules and lipids, as in the case of the ct-galactosyl ceremide (cc-gal cer) glycolipid presented by C D Id [17], other M H C class lb molecules such as the M H C class I chain-related A / B ( M I C A / B ) molecules in humans and their functional homologues in mice, H60 and R A E - 1 , have no A g presenting function [18]. Instead, some M H C class I B molecules have been shown to be cognate ligands of certain clonal populations of T cells, as seen with the recognition of M I C A and murine homologues by epithelial y8 T cells [15, 18]. Interestingly, the ap T C R s of some C D 4 + and C D 8 + T cells as well as some double negative T cells (DNTC) , which express neither co-receptor molecules, appear to recognize M H C class lb ligands and thus this is not an exclusive property of the y8 T C R . For example, N K T cells which express the canonical V c d 4 V p 8 T C R recognize a-gal cer presented by the M H C class lb molecule C D Id [17]. Therefore the unique synthetic and A g "sampling" pathways, as well as the differing structures of M H C molecules, assign the immunological function of different T cell subsets. 7 1.3 T Cell Signalling A n important outcome of T C R A g recognition is the nucleation of numerous signalling intermediates into a structure, referred to as the immunological synapse, which initiates numerous signal transduction pathways. One of the most proximal events in T C R signalling involves the tyrosine phosphorylation of C D 3 subunits and TCRt , (CD247) which have the Src family tyrosine kinase Fyn constitutively bound [19, 20]. Upon recognition of cognate A g , Fyn is activated by CD45 [20, 21] and Fyn in turn phosphorylates C D 3 and CD247 which are then able to recruit additional molecules to the T C R complex including ZAP-70 [22]. Coordinate binding of T C R and co-receptor facilitates the association of co-receptor-bound Lck with ZAP-70 , resulting in Z A P - 7 0 phosphorylation and activation [20, 22]. ZAP-70 in turn phosphorylates the critical adaptor protein L A T (linker of activation in T cells) [23] which together with SLP-76 and G R B 2 help to recruit phospholipase C - y - l ( P L C - y - l ) [22]. The phosphorylation of PLC -y -1 by I T K activates two distinct signalling pathways which result from the PLC -y -1 mediated hydrolysis of phopho-inositol pyrophosphate (PIP2) to inositol triphosphate (IP3) and diacylglycerol ( D A G ) [22, 24]. IP3 has a critical role in activating the calcineurin pathway, as IP3 receptors cause the release of sequestered calcium (Ca ) which can then bind to calmodulin [1, 24]. The calmodulin-Ca complex activates the serine/threonine phosphatase calcineurin leading to the dephosphorylation of nuclear factor of activated T cells ( N F A T ) , allowing this transcription factor to move into the nucleus and activate gene transcription [1, 24]. D A G formation causes the rapid recruitment and activation of protein kinase C-0 (PKC-9) [22, 25]. Activated P K C - 9 is then able to phosphorylate a number of targets which may include RasGRP, a Ras guanine-nucleotide exchange factor (GEF), thereby facilitating Ras activation [25-27]. Activated P K C - 9 also phosphorylates I K K - P , promoting the formation of the IKKcc / IKKp heterodimer, known as I K K , which in turn phosphorylates the inhibitory protein I K P [27, 28]. 8 IK(3 phosphorylation results in the release of N F K B and its movement into the nucleus where it can influence gene transcription [1, 27]. L A T also recruits the related linker molecules G A D S and G R B 2 which do not have intrinsic kinase activity but which recruit a number of important signalling molecules to the T C R complex, such as the Ras G E F SOS [23]. Once SOS has converted R A S to its active GTP-bound state [29], R A S can in turn recruit and activate proteins of the mitogen activated protein ( M A P ) kinase cascade which culminate in the activation of Fos [1]. TCR-induced c-jun activation increases the transcriptional activity of important genes for T cell activation by its dimerization with Ras-activated Fos to form the AP-1 transcription factor [1]. The activation of c-jun by proximal T C R signalling occurs as a result of the activation of the stress-activated protein (SAP) kinase cascade by Vav [30], following its recruitment to the immunological synapse by SLP-76 [31]. Vav ' s exchange of bound G D P for G T P results in Rac activation, leading to c-Jun activation and dimerization with c-Fos [1, 30, 31]. T C R signalling also leads to the activation of the PI3K pathway [32]. Vav and the T C R -interacting molecule (TRIM) both bind PI3K [33], a signalling molecule which in turn catalyzes the transfer of a phosphate group to PIP2 to form PIP3 [34]. The recruitment of the serine/threonine kinase A k t by PIP3 results in its activation and the subsequent initiation of numerous signalling pathways including the phosphorylation of glycogen synthase kinase-3 (GSK3) resulting in decreased N F A T phosphorylation, and the activation of N F K B by an i l l -defined mechanism [22, 34]. In addition to signals initiated by the T C R directly, additional cell surface receptors contribute to the formation of the immunological synapse and ultimately affect the outcome of T cell stimulation. A number of receptors are suspected to augment T cell activation following T C R engagement including CD27, TNF-ct Rc II (CD 120b), ICOS (CD278), as well as N K G 2 D (CD314) [35-38]; however, most research on T cell co-stimulation has 9 focused on CD28 [39]. CD28 is a transmembrane homodimer consisting of a single immunoglobulin extracellular domain and a cytoplasmic tail that has no intrinsic enzymatic activity, but a number of motifs for the recruitment of signalling intermediates [39-41]. Binding of CD28 to its ligands CD80 and CD86 on mature A P C results in its association with Vav, Gads, Grb2, and PI3K [39-41]. The two signal hypothesis of T cell activation postulated that CD28 activated unique signalling pathways not activated by the T C R ; however, recent evidence suggests that independent CD28 signalling results in the transient expression of only a few genes [39]. Moreover, none of the CD28-induced genes were specific to this signaling pathway, but rather constituted a small subset of those implicated in TCR-signal transduction [39]. However, under physiological conditions, only a few T C R s are ligated at any given time, generating short-lasting, incomplete activation events that do not lead to cell proliferation and differentiation, but rather to T cell inactivation (anergy) or cell death [39, 42]. It is postulated that CD28 engagement strongly amplifies a weak T C R signal by either maintaining Lck in an activated state [39] and/or increasing l ipid raft aggregation [43]. T C R signalling in the absence of co-stimulation results in a state of T cell inactivation called T cell anergy, and different forms of this anergy are associated with characteristic blocks in T C R signalling [42]. Although diverse signalling pathways are activated at the time of T cell activation, it is interesting to note that many of these pathways converge, regulating certain key genes involved in the proliferation and differentiation of T cells [44]. The most critical of these genes is IL-2 which has binding sequences for N K K B , N F A T - 1 , OCT-1 and AP-1 present in its promoter [27, 45]. Examples of this signal integration in IL-2 gene regulation are that the CD28 response element (RE) is necessary for IL-2 gene transcription and the full transcriptional activity of N F A T on the IL-2 gene requires physical association with AP-1 [22,45-47]. 10 Interestingly, autocrine IL-2 signalling itself is pivotal for T cell activation. While IL-2 protein and its message are undetectable in resting T cells, their induction is one of the most rapid consequences of T cell activation [44]. The upregulation of IL-2 is rapidly followed by the upregulation of the high affinity IL-2 receptor, permitting the selective expansion of effector lymphocytes activated by A g [44]. IL-2 is a secreted glycoprotein which is produced almost exclusively by activated T cells [9, 44]. The IL-2 receptor complex consists of three distinct subunits, which are designated I L - 2 R a (CD25), IL-2Rp (CD 122), and IL-2Ry c (CD 132) [9, 48]. C D 132 is constitutively expressed on all T cells while CD25 and C D 122 expression are controlled by exposure to A g [9, 49]. These receptor subunits can be assembled in different ways to create IL-2R with differing affinities for ligand [9, 48]. The expression of CD25 alone is unable to transduce any signal due to its low-affinity for IL-2 (Kj =10-20 nM) and its short cytoplasm tail devoid of necessary signalling motifs, whereas the CD122/CD132 heterodimer forms an intermediate affinity receptor (K<j = 0.5 -2 nM) which is capable of responding to high IL-2 concentrations [9, 50, 51]. The expression of the CD25/CD122/CD132 heterotrimeric IL-2R comprises the high-affinity IL-2 receptor (Kd = 10-75 pM) [9, 50, 51]. Intracellular signals from the IL-2R originate from the CD122 and CD132 subunits, whose cytoplasmic tails contain critical motifs for recruiting important signaling molecules [48, 52]. The binding of IL-2 to the IL-2R complex promotes the catalytic activation of Jakl and Jak3 and the subsequent phosphorylation of important tyrosine residues on C D 122 and C D 132 [48, 52-54]. Phosphorylated tyrosine residues on C D 122 recruit the adaptor protein She and the transcription factor Stat5 [54]. She recruits and activates components of the M A P K and PI3K pathways, whereas Stat5 transactivates a variety of target genes [54]. Although both She- and Stat5-dependent pathways can independently transduce a proliferative signal, these two pathways have distinct roles in regulating other aspects of T cell immunobiology [54]. The importance of IL-2 1 1 signalling in T cell activation is highlighted by the fact that deficiencies in this cytokine or its receptor are associated with defects in immunological functioning assayed in vitro such as the development of cytolytic responses and Ag-specific proliferation [55, 56]. Interestingly, insufficient amounts of this T cell growth factor during T cell activation may also be associated with the development of T cell anergy [57]. Furthermore, the addition of exogenous IL-2 can overcome the proliferative defect in some forms T cell anergy [42]. A complete understanding of IL-2 signalling requires an understanding of IL-15 immunobiology since IL-2 and IL-15 are structurally related and share two out of the three subunits of the heterotrimeric IL-2 receptor (CD 122, C D 132), with the specificity for ligand conferred by their different a chains [53, 58]. Although IL-15R has a broader pattern of expression than IL-2R and consequently a distinct set of biological properties [58-60], the shared usage of C D 122 and C D 132 by these cytokine receptors results in many of the same signal transduction pathways being activated as well as a number of shared functional characteristics [58, 60]. One feature of particular relevance to this thesis is the ability of both IL-2 and IL-15 to activate and drive the proliferation of memory phenotype T cells due to their expression of the intermediate affinity IL-2/IL-15 receptor (CD122/CD132) [60]. A s some forms of anergic T cells are " A g primed" and thereby express the IL-2/IL-15 intermediate affinity receptor [61], these cells are responsive to IL-2 and IL-15 bystander cytokine support [61, 62], which in some cases can bypass the biochemical blockade induced by T cell anergization [42, 63]. 1.4 T Cell Development The vast majority of cells developing within the thymus pass through a series of phenotypically-identifiable stages prior to their emigration from the thymus as mature T lymphocytes [1]. The critical role of the thymic microenvironment in this development is 12 demonstrated by the resultant immunodeficiency seen in athymic nude mice and humans with DiGeorge syndrome [64, 65]. When entering the thymus, the T C R genes of T cell precursor cells are in germ line configuration and most of the surface molecules characteristic of mature T cells are absent, including the C D 4 and C D 8 co-receptor molecules [1]. These double negative (DN) thymocytes are pleuripotent and can give rise to either ap or y5 T cells [1]. D N thymocytes pass through four distinct stages during development as illustrated in Figure 1 [1, 66, 67]. In the C D 4 4 + C D 2 5 + D N 2 stage (pro-T cell), D N A recombinase machinery is initiated and recombination at the P, y, and 5 chain loci occurs [9, 68]. The factors that regulate the commitment of progenitor cells to the a,p vs. y8 lineage are not definitively known, though interactions with the thymic stroma are suspected to influence lineage commitment and a successful rearrangement of y and 5 chain gene segments before the occurrence of a productive p chain gene rearrangement seems to be critical [1,9, 68-72]. The production of a functional P chain gene and the pairing of the P chain with the pre-T a (pTa) receptor subunit forms the pre-TCR [1, 73]. This triggers a maturation program within developing thymocytes known as "P-selection", that prevents further recombination at the p gene locus, known as allelic exclusion [74, 75]. p-selection acts as an important checkpoint in the development of mature aP T cells [1, 74, 75]. Failure to generate a functionally rearranged P chain or competing y and 5 chains at this stage of development results in apoptosis of the developing thymocyte [76]. Following P-selection, cells upregulate both C D 4 and C D 8 becoming "double positive" (DP) thymocytes [1, 9, 77], which re-express gene recombination machinery in order to rearrange T C R a- chain genes [1, 78]. The initiation of T C R cc-chain gene rearrangement ultimately precludes the development along the y5 lineage as this process results 13 A . yd T C e l l D e v e l o p m e n t P r o g e n i t o r S t e m C e l l 0 ap T C e l l D e v e l o p m e n t * 6 DNl D N 2 D N 3 D N 4 y5 T C e l l L E G E N D C D 3 f C D 4 [| C D S | C D 2 5 C D 4 4 L a(3 T C R ff y5 T C R Steps 1 " " Unknown C D 4 C D 8 + D P T h y m o c y t e Mature D N T C N e g a t i v e Se lec t ion H i g h A f f i n i t y 6 I n t e r m e d i a t e ^ A f f i n i t y L o w A f f i n i t y D e a t h by Neg lec t P o s i t i v e Se lec t ion c o n t a i n i n i n g l i g a n d c o n t a i n i n i n g l i g a n d S P C D 4 + T h y m o c y t e 6 # S P C D 8 * T h y m o c y t e R e c o g n i t i o n o f T S L P - ^^N^f c o n d i t i o n e d D C C D 4 + C D 2 5 + T r e g C e l l O Or M a t u r e C D 4 + T C e l l (Source: Adapted from C . A . Janeway et al, [1]) 14 B. Stage of Thymocyte Development Cell Surface Molecule Expression CD44 CD25 CD4 CD8 CD3 T C R p chain pre-TCR ap TCR Progenitors + - - - - - - -DN Thymocytes Stage DN1 + - - - - - - -Stage DN2 (Pro-T Cell) + + - - - - - -Stage DN3 (Pre-T Cell) low + - - + + - -Stage DN4 low - - - + + + -DP Thymoctyes - - + + low + - low SP Thymocytes + - +/- +/- + + - + Mature DN yb+ TCR T Cells (DNTC) + + - - + +/- - -Figure 1. Summary of T Cell Development (A) Schematic detailing the various stages of ab T C R + and gd T C R + thymoctye development within the thymus [1]. (B) The expression o f cell surface molecules is summarized for various stages of thymocyte development [1,81]. 15 in the "looping out" of 8 chain gene segments which are embedded within the oc-chain gene loci [1, 79, 80]. The pairing of the nascent a-chains with the T C R p chain enables D P thymocytes to audition for further development through the recognition self-peptide/MHC complexes on thymic cortical epithelial cells [1, 82, 83]. A weak recognition of self-Ag on thymic cortical epithelial cells results in a slow death (death by neglect) of D P thymocytes [1, 84, 85]. However this "death by neglect" can be circumvented i f additional rearrangements of T C R a chain gene segments change the A g specificity of the T C R , enabling the cell to undergo a subsequent "auditioning" process [1, 82]. Thymocytes which recognize self-Ag on thymic cortical epithelial cells with high avidity are induced to undergo rapid cell death termed "negative selection" [1, 85]. Only D P thymocytes whose T C R recognize thymic epithelial self-Ag with intermediate strength are selected for further development into mature T cells (positive selection) [1, 83, 86]. Although the selection for moderate self-reactivity limits the maximal diversity of the T C R repertoire, this narrowing of the T C R spectrum ensures that frankly auto-reactive cells are eliminated and that only cells that w i l l be capable of responding to an insult w i l l be allowed to progress. The decision of positively selected D P thymocytes to become C D 4 + or C D 8 + single positive (SP) thymocytes occurs as a result of the Ag-recognizing properties of the T C R [1, 77, 84]. Initially it was thought that a random downregulation of one of the co-receptors occurred independently of the T C R s ability to recognize peptide in association with class I or class II M H C [84, 87, 88]. While some evidence from M H C knockout mice supports this "stochastic" model of lineage commitment [87], evidence from T C R transgenic mice favors an "instructive" model whereby the coordinate binding of the T C R and the appropriate co-receptor molecule to the same M H C molecule commits DP cells to develop along the "correct" T cell lineage [89]. Recent evidence has suggested that the strength of T C R signaling may also modulate this lineage 16 commitment decision [90]. Nevertheless the Ag-recognizing properties of a given aP T C R are paramount for the developmental decisions of D P thymocytes. Recently it has been demonstrated that CD4 SP cells can undergo a second round of "selection" to form C D 4 + C D 2 5 + regulatory T cells (T r e g ) [91]. The development of T r e g involves the expression of thymic stomal lymphopoietin (TSLP) by Hassall's corpuscles which activate thymic CD1 l c positive D C to express high levels of CD80 and CD86 [91]. T S L P conditioned D C in turn induce the proliferation and differentiation of C D 4 + C D 2 5 + F o x P 3 + T r e g from CD4 + CD8"CD25" precursor cells, with the induction of the transcription factor FoxP3 being a critical event in the ontogeny of these cells [91]. This T r e g induction is dependent upon the presence of M H C class II, CD80, CD86 as well as IL-2 and its receptor subunits, and appears to represent a second "positive selection" event in the development of this cell subset [91, 92]. While the details of ccp T cell development have been extensively studied, y5 development (Fig. 1) is less well understood [68]. It is known that some y8 T lymphocytes proceed along a unique developmental pathway [93, 94]. For example, unlike aP T cell development, no pre-TCR is formed in y8 T cells although the y chain can infrequently pair with p T a , committing to the aP T cell lineage [68, 95]. Developing y8 T cells do not upregulate the C D 4 or C D 8 co-receptors, with most y8 T cells maintaining their D N immunophenotype throughout development [14]. Similarly, y8 T cells do not seem to conform to the processes of positive and negative selection [96, 97] and, although y8 T cell development occurs primarily within the thymus, a thymic-independent pathway of development may also exist [98]. A n interesting feature of y8 T cell development is that subsets of these cells are formed early in development, and leave the thymus in "organ specific" waves before the initiation of conventional T cell development [93]. The first wave of these cells, occurring on days 14-17 of 17 murine embryogenesis, expresses the invariant Vy3V81 y§ T C R and homes to the skin where they form essentially a monoclonal population [93]. Due to their peculiar branching pattern of cellular processes reaching between adjacent keratinocytes, these cells are known as dendritic epidermal T cells (DETCs) , and represent 95-100% of murine epidermal lymphocytes [99, 100]. The Ag-specificity of V81 TCR-expressing epithelial lymphocytes in humans is for M I C A / B M H C class lb ligands [101] and it is assumed that murine Vy3V81 cells bind to the M I C A / B functional homologues R A E - 1 and A60 [102]. The rigorous thymic selection of canonical Vy3V81 cells facilitates their colonization of the skin by inducing an epidermal-homing phenotype [94]. The importance of this invariant T C R in D E T C development has been demonstrated in V Y 3 " a mice using the anti-idiotypic Vy3V81 m A b 17D1 [103]. In these mice, y5 D E T C utilizing substitute V y chains were present and, surprisingly, were still recognized by the 17D1 mAb, suggesting that a specific A g binding specificity was being selected for [103]. Given that some of the normal dynamics of T cell development are altered in T C R transgenic mice, an in depth understanding of how normal processes are altered in these invaluable research tools is essential. In T C R transgenic mice, productively rearranged T C R chain genes are expressed under the control of the T cell specific Lck promoter [104, 105]. A n example of a T C R transgenic system and one which is critical to this thesis is the 2C transgenic T C R [106, 107]. The 2C T C R consists of the V a 3 . 1 and V p 8 . 2 T C R chains [108] which recognize the p2Ca peptide ( L S P F P F D L ) that is naturally processed and derived from the mitochondrial protein 2-oxoglutarate dehydrogenase [109, 110]. This M H C class I restricted T C R , as shown in Figure 2, is positively selected by an intermediate affinity interaction with p2Ca/H-2K b (3 x 103 M - l ) and negatively selected by a high affinity recognition of p2Ca/H-2L d ( 2 x l 0 6 M - l ) [107]. On the H-2 S background, the 2C T C R does not recognize any ligand with significant affinity, resulting in the "neglect" of 2C T C R + D P thymocytes that are forced to 18 Antigen Presenting Cell 2C T C R + Cell (Source: Adapted from C. A . Janeway et al, [1]) Figure 2. Schematic of the 2 C T C R and its Antigen Interactions The 2C T C R recognizes the p2Ca peptide when presented by the class I M H C molecules K b and L d [107, 110]. The 2C T C R consists of the Va3.1 and Vp8.2 chains [108]. Note the higher affinity of the 2C T C R for the p2Ca-L d ligand [107]. 19 rearrange endogenous T C R genes for continued development [107]. In the H - 2 b background, the positive selection of 2C DP thymocytes results in the generation of a large population of 2C TCR-expressing C D 8 SP thymocytes and peripheral cells [107]. In H-2 S mice, no CD8 SP thymocytes or peripheral cells expressing the 2C T C R are appreciated as 2C TCR-expressing D P thymocytes fail to be positively selected in this background [107]. Similarly, in H - 2 d mice, no 2C-expressing C D 8 SP thymocytes or peripheral cells are seen as 2C TCR-expressing D P cells are swiftly deleted in these animals [107]. This comprehensive deletion of D P cells has important consequences for the development of other lineages as well since D P thymocytes are the progenitors of C D 4 , C D 8 and some specialized T cell subsets [1]. For example, the development of C D 4 cells from D P thymocytes in T C R transgenic mice occurs either by the pairing of a newly rearranged T C R a gene product with the Pig T C R chain [82], or by the pairing of newly rearranged T C R a and T C R p gene products following the deletion of T C R transgenes [111]. Development of these C D 4 cells is understandably perturbed by the massive negative selection of D P cells expressing a strongly self-reactive T C R since both of these steps leading to C D 4 T cell commitment take place at the D P thymocyte level [1, 83]. Furthermore, as C D 4 + C D 2 5 + T r e g cells are derived from the C D 4 SP thymocyte pool [91], a dearth of D P thymocytes also severely impacts the development of this important T cell subset. Another interesting feature of T C R transgenic mice is the production of a population of mature lymphocytes which express high levels of the transgenic T C R a and P chains but do not express either the C D 4 or CD8 co-receptor molecules, and are thus referred to as D N T C [63, 107]. These cells appear to ignore the normal "rules" of thymic selection and are produced at the same rate in T C R Tg mice on positive, negative and non-selecting backgrounds [63, 107]. For example, in 2C mice, these cells are found in approximately the same numbers on H - 2 b , H - 2 d , and H-2 S backgrounds [107, 112]. One hypothesis about the ontogeny of these cells is that they 20 may represent yS cells which have been forced to express an alternative receptor, i.e., y8 T cells incognito [97]. The failure of most of these cells to express a y8 T C R may not exclude their commitment to this lineage since it is theorized that dedication to y8 development may occur before the expression of a functional T C R and that surrogate T C R s may support this development [97, 113]. Therefore a cell committed to the y8 lineage wi l l not be affected by the forced expression of a Tg T C R regardless of the prevailing positive, negative, or non-selecting thymic environment [107, 112, 113]. Furthermore, such a cell w i l l not attempt to create a new T C R with more optimal A g recognizing properties, which is consistent with the germline configuration of T C R a chain genes in T C R Tg D N T C [97]. Additional support for the y8 theory of T C R Tg D N T C ontogeny is that circulating y8 T cells are not found in T C R Tg animals [97] and that, in some T C R transgenic mice, cutaneous T cells can co-express the Tg T C R and a yS T C R [113]. This later finding is explained in part by the kinetics of y8 T cell development [93, 113]. Cutaneous y8 T cells develop on day 14-17 of embryogenesis, before the development of other T cell subsets [93], and presumably these cells can successfully rearrange endogenous y and 8 chain genes before the forced expression of the Tg cq3 T C R [113]. In systems where the Tg T C R is "switched on" earlier, due to differences in transgene integration sites and/or construct design [114], no such cutaneous y8 T cells are observed and only T C R Tg cells with y8-like properties are found within the skin [113]. The ability of these T C R Tg cells to home to the skin and acquire some y8 T cell attributes was likely imprinted during commitment to the y8 lineage [97, 113]. Although the evidence of T C R Tg D N T C belonging to the y8 T cell lineage is somewhat convincing [97, 113], ot|3 D N T C are known to exist in wildtype animals and humans and these cells represent approximately 1-5% of circulating C D 3 + cells [115, 116]. These non-Tg D N T C 21 are similarly insensitive to T cell selection pressures [117, 118] and are characterized by the early rearrangement of the T C R a chain genes under the control of the E delta enhancer element [119]. This population of D N T C in non-Tg mice and humans appears to possess many of the same functional properties as D N T C in T C R Tg mice [115, 116], and thus the process of transgenesis may serve to enrich this population of cells [119]. Regardless of the ontogeny of T C R Tg D N T C , T C R transgenic mice have great utility for the study of T cell tolerance, as large numbers of mature cells in the periphery which recognize self-antigen with high affinity can be generated [107]. Many studies using the 2C system have successfully taken advantage of this population confirming the usefulness of these cells in tolerance research [61-63, 115, 120, 121]. 1.5 Tolerance The ability of the thymus to generate a diverse repertoire of T cells is critical for bodily defense; however, it also results in the production of receptors with specificity for self and thus an equally important role of the thymus is contributing to the maintenance of self tolerance [1]. A major tolerogenic mechanism ensuring tolerance to self is the intrathymic deletion of self-reactive T cells during negative selection, a process referred to as central deletion [1, 83]. The dilemma of how the thymus can control autoreactivity against "non-thymic" proteins was solved by the discovery of the "autoimmune regulator" (AIRE) transcription factor, which regulates expression of "heterotopic proteins" in the medullary epithelial cells of the thymus [122]. Central deletion is best appreciated in T C R Tg mice with a T C R specific for self-Ag [107, 123] In these animals, the comprehensive depletion of D P cells results in a very hypocellular thymus and a slow export of mature C D 4 + and C D 8 + T cells to the periphery [123]. A failure of this central tolerance can be seen when the A I R E gene is mutated and the expression of "peripheral proteins" 22 in the thymi is silenced [122]. This results in spontaneous autoimmunity involving the ovaries, testis, retina and stomach, which in humans is called the autoimmune polyglandular syndrome type 1 [122, 124]. Another mechanism by which the thymus contributes to self-tolerance is the generation of T cells with immunoregulatory function [125, 126]. Two such populations with potent immunoregulatory function and which are critical to this thesis are the C D 4 + C D 2 5 + T r e g and the Vy3V81 y 5 T cells. C D 4 + C D 2 5 + T r e g have been shown to be particularly important in immune regulation and abrogating the development of autoimmunity in a number of disease models [127, 128]. Both "natural" T r e g , developing in the thymus after exposure to self-Ag [91], and "induced" T r e g , which develop in the periphery after exposure to exogenous A g , have been described [129, 130]. These suppressor cells have been shown to inhibit the proliferation and cytokine production of T cells through direct cell-cell interactions, although "suppressor" cytokines such as IL-10 and TGF - P may also contribute to these cells regulatory behavior [125]. FoxP3" A , IL-2" A , CD25" A , and CD122~ /"mice, all of which are naturally deficient in T r e g cells [131-133], as well as wildtype animals which have been depleted of T r e g [125, 134] develop widespread autoimmune disease including colitis, gastritis, insulin-dependent autoimmune diabetes, and thyroiditis [125, 131-134], which can be abrogated by the adoptive transfer of T r e g cells from syngeneic wild-type mice [125]. FoxP3 mutations in humans are associated with a similar condition termed I P E X (immune dysfunction, polyendocrinopathy, enteropathy, x-linked) [135]. In addition to a reduced absolute number of T r e g , a reduced functionality of T r e g may also predispose individuals to autoimmune disease [136, 137]. For example, T r e g from patients with multiple sclerosis, psoriasis, and autoimmune polyglandular syndrome type II have all been demonstrated to 23 possess a significantly decreased suppressor function when compared with cells from healthy donors [136-138]. Another cell type which has been shown to possess critical regulatory properties is V 8 1 -expressing y5 D E T C [126]. D E T C have a non-redundant role in regulating cutaneous inflammation by liberating the anti-chemotactic factor prothymosin P4 (pTp4) which inhibits the migration of inflammatory cells to the skin [139, 140]. Under normal circumstances, neutrophils are uncommon residents of the skin and it is speculated that D E T C prevent neutrophil entry into the epithelium by virtue of the high basal rate of IEL pTp4 production [141]; a hypothesis that is consistent with the spontaneous neutrophilic dermatitis and profound neutrophilic inflammatory reactions characteristic of T C R y8 knockout mice [139, 142, 143]. While the thymus plays a critical role in maintaining immunological tolerance, other thymus-independent mechanisms of this regulation exist [1, 144, 145]. For example, the sequestration of self-Ag within immunologically-privileged sites, such as the brain, eye, testis, or amniotic sac, can preclude autoimmunity despite the existence of circulating autoreactive T cells against these structures [145]. Similarly, the immune system can also remain ignorant of self-components produced at very low levels or which are not efficiently presented by M H C [146]. The induction of peripheral deletion is yet another mechanism by which self-tolerance is maintained [1, 144]. Such peripheral deletion occurs when an activated T cell upregulates the Fas receptor (CD95) rendering it susceptible to "activation induced cell death" (AICD) which occurs upon the binding of Fas to its receptor-ligand pair FasL (CD 178) [147]. The importance of this mechanism of tolerance is illustrated by the lymphoproliferative disease which occurs in the absence of Fas or FasL [148, 149]. Although the exposure to self-Ag in the periphery may result in deletion, autoreactive cells may also persist indefinitely in the body in a functionally compromised state which has 24 been termed T cell anergy [42]. Different forms of anergy have been described which are characterized by differing pathways of induction, possibilities of reversal, associated signalling defects, and functional properties of the anergic cells [42]. Adaptive anergy represents a generalized state of unresponsiveness, with suppression of most cytokines including IL-2 [42]. This form of anergy cannot by reversed by the provision of exogenous cytokine, but the adaptive anergic state typically dissipates after the removal of cognate A g [42]. The biochemical defect of adaptive anergy involves a profound defect in mobilizing calcium, with preserved Ras pathway function [42]. Clonally anergized cells are characterized by an impairment of IL-2 production and proliferation [42]; however, the Ag-experienced immunophenotype of these cells, including the expression of the intermediate affinity IL-2/IL-15R, enables these cells to use an exogenous source of IL-2 or IL-15 to drive their activation and proliferation [150, 151]. Despite the inability of these cells to proliferate in the absence of bystander cytokine support, these cells often have a memory-like enhancement of functional properties such as enhanced cytotoxicity and the ability to secrete IFN-y immediately ex vivo without a prior period of stimulation [151, 152], which led to the previous terminology "split-anergy" [153]. The biochemical defect associated with clonal anergy is the failure to activate Ras [42]; however, the finding that exogeneous cytokine support can bypass this biochemical block suggests that this mode of maintaining peripheral tolerance is imperfect and may pose an autoimmune hazard [42]. In addition to the adaptive and clonal forms of T cell anergy, multiple hybrid forms of T cell inactivation have been described [42]. For example, the T cell anergy described in the 2C model exhibits features of both of these paradigms [61, 63, 107, 120]. In H - 2 d 2C mice, only the selection-independent D N T C express the clonotypic 2C T C R outside of the thymus, as 2C TCR-expressing D P thymocytes are comprehensively deleted [107]; however, the 2C T C R D N T C which are insensitive to thymic selection pressures are found to 25 persist in the periphery of these animals in large numbers [63, 107]. The constant exposure of these cells to the high affinity self-Ag, p2Ca-L d , bestows upon the 2C D N T C an Ag-experienced immunophenotype, characterized by high levels of the memory markers CD44, L y 6 C , and C D 122 [61-63]. These cells are also equipped with enhanced functional properties being able to synthesize IFN-y and k i l l cognate ligand-expressing targets immediately ex vivo without a period of prior priming [61]. The same population of cells from H - 2 b 2C mice possess a naive immunophenotype and functional properties [61, 63]. Stimulation of the memory phenotype 2C D N T C from H - 2 d 2C mice with A g A P C together with a source of exogenous cytokine resulted in the upregulation of activation markers and revealed these cells to have a higher basal level of proliferation and a reduced activation threshold relative to the equivalent population of cells from H - 2 b 2C mice [120]. Though, when stimulated without a source of exogenous cytokine, the H - 2 d 2C D N T C failed to make IL-2 at both the message [61, 62] and protein level [63] and were unable to proliferate even when challenged with high dose A g [63, 120]. Interestingly, this apparent clonal anergy was not associated with defects in Ras activation, but rather with deficient CD247, ZAP-70 , and L A T phosphorylation as well as impairment in calcium mobilization, typical of adaptive anergy [120]. This constellation of findings in anergic 2C D N T C has features of both clonal and adaptive anergization and thus is an example of hybrid anergy. Consistent with the anergization of the 2C D N T C , it was found that in H - 2 d 2C mice, these cells do not stain significantly for the acute activation marker CD69 [61]. Furthermore, although these animals possess enormous numbers of 2C cells which recognize self-Ag with high affinity, no obvious autoimmunity is observable in these animals [106]. Presumably the expression of cognate self-ligand by non-professional A P C s , devoid of adequate co-stimulatory ligands in a non-inflamed milieu, induces this anergization. However, the significant number of 26 Ag-experienced self-reactive cells, capable of using bystander cytokine support, raises the concern that such cells may pose an autoimmune hazard in vivo especially since physiological levels of IL-15, released indirectly by viral infection or by injection of polyinosinic-polycytidylic acid (poly(I:C)), can cause memory phenotype T cells, with irrelevant Ag-specificity, to proliferate in vivo [154, 155]. Animal models of autoimmune disease have demonstrated that the presence of large numbers of anergized cells, can predispose to the development of severe immunopathology and frank autoimmunity [156, 157]. However these studies have also shown that a high frequency of strongly self-reactive cells together with systemic inflammation is rarely sufficient for the induction of clinically apparent autoimmune disease [156]. A n important determinant in the development of autoimmune disease is the presence of "target tissue", or localized inflammation, which is crucial for the on-going recruitment and activation of inflammatory cells to the site of immunopathology [156]. The importance of target tissue inflammation is highlighted by the finding that high concentrations of tissue cytokine can promote the development of localized autoimmunity [158-161]. [160, 161] For example, the transgenic expression of IFN-y in the pancreas induces T cell-mediated autoimmune diabetes as well as the loss of tolerance to normal islets [158, 162] while the injection of IFN-gamma into the skin of those predisposed to psoriasis results in the development of typical psoriatic lesions [159]. Interestingly the development of target tissue inflammation and subsequent autoimmunity has been associated with a number of immune system defects [163], as the use of less effective immune tactics leads to exaggerated, prolonged immune responses with high levels of inflammation [163]. Therefore it was hypothesized that anergic cells in the 2C system could contribute to immunopathology in H-2 d-expressing hosts predisposed to the development of localized inflammation. 27 Interestingly, Delaney et al. found that backcrossing of the 2C T C R to certain H - 2 d -expressing B X D recombinant inbred strains resulted in the spontaneous development of psoriasiform skin disease (Table 1) [164]. Examination of the immunophenotype of the 2C D N T C in these animals revealed these cells to be acutely activated [164], indicating that the anergization of the 2C D N T C may have failed, resulting in autoimmune pathology with resemblance to the human T-cell mediated autoimmune skin disease psoriasis [164]. Table 1. Development of Disease in Recombinant Strains BXD Strain Disease Incidence Disease Severity 1 5/6 +++++ 5 N / A * ++ 6 N / A * ++ 9 5/15 ++ 11 5/10 + 12 0/3 -16 1/4 " + 18 4/8 ++++ 22 3/12 +++ 24 N / A * +++ 25 3/15 + 27 0/5 -30 2/3 +++ 31 2/17 + 32 0/10 -* Note: Typographical errors (Source: J .R.C. Delaney, [164]) 1.6 Psoriasiform Disease Psoriasiform diseases are a family of cutaneous disorders which share certain core histological features such as a thickened epidermal layer (acanthosis), impaired maturation (parakeratosis), elongation of the epidermal rete ridges, papillary dermal edema with ectactic 28 vessels, and exocytosis of neutrophils into the epidermis [165, 166]. This constellation of histological findings represents a non-specific reaction pattern that occurs in a handful of conditions including psoriasis, seborrheic dermatitis (SD), and in chronic forms of other dermatosis [165, 166]; however, the two major diseases within this family are the related conditions psoriasis and SD. 1.6.1 Psoriasis Psoriasis is a common relapsing inflammatory skin disease, affecting 1-3% of Caucasians [165, 167]. Early onset psoriasis occurs in teenagers and young adults (16-22 years) whereas late onset psoriasis occurs in late-middle age (57-60 years) [165, 168]. The sudden onset of psoriasis at any age or the worsening of preexisting psoriasis may suggest a severe impairment in immune function, such as A I D S where a statistically significant increase in the incidence of psoriasis is seen [169, 170]. The condition is characterized by inflamed, symmetrical, erythematous plaques with silvery white scale [165, 166, 171]. There are several morphological variants of psoriasis, the most common of which is Psoriasis vulgaris or typical "plaque psoriasis" which is characterized by chronic scaling papules and plaques over the elbows, knees, scalp, chest, nails, and lower back (Fig. 3) [165, 166, 171]. However, plaques can be widely scattered and are often found in areas subjected to frequent trauma, an observation referred to as the Koebner phenomenon [165, 166, 171]. Rarer variants of this condition include guttate psoriasis, palmoplanter pustular psoriasis and inverse psoriasis, each of which has a distinctive clinical appearance [165, 166, 171]. Extra-cutaneous features of disease are also frequently observed in psoriatic patients, with 5-40% of patients developing psoriatic arthritis [171, 172] and with 25-100% developing structural nail abnormalities [165, 171]. In addition to the typical psoriasiform changes (Fig. 4), 29 Figure 3 . Gross Pathology of Psoriasis Psoriatic lesions are characterized by sharply defined erythematous plaques covered with silvery scale. Typical plaque psoriasis involves the trunk (A), the knees (B), and other parts of the body subjected to pressure or trauma, such as the knuckles (C). The tendency for typical psoriatic pathology to occur at sites of trauma is called the Koebner phenomenon, which can be reproduced experimentally (D, E) . Another typical feature of psoriatic lesions is the Auspitz sign which is the tendency for bleeding to occur when scales are removed (F). Plaque psoriasis has a great predilection for the head and neck region, particularly the scalp and the external auditory canal (G , H ) . Psoriatic lesions often have an annular configuration (I, J). Another typical feature of psoriasis is dystrophic nail changes such as pitting and onycolysis ( K , L ) . Other morphological variants of psoriasis include napkin psoriasis (M) , palmoplanar psoriasis (B, N , O) , pustular psoriasis (P) and guttate psoriasis (Q). 31 (Source: A - University o f Iowa - Dermatology, 1995; B - °DermAtlas , www.dermatlas.org) Figure 4 . Histopathology of Psoriasis (A) Psoriatic skin is characterized by hyperparakeratosis (h), variable acanthosis (a), club-like elongations of the rete ridges (r), and dilated vessels in the edematous dermal papillae (p). (B) So called "squirting" of dermal papillae results in characteristic intraepithelial Munro microabscesses (m), which are one of the cardinal histological features of active psoriasis. 32 psoriasis is characterized by such histological features as marked thinning of the suprapapillary plates of the epidermis, loss of the granular cell layer, and neutrophilic collections within the epidermis called Munro microabscesses [166, 167]. Despite the thousands of papers written on psoriasis, the pathophysiology of psoriasis is still poorly understood. One of the first treatments for psoriasis contained the dithranol anthralin, which is still a mainstay of psoriasis treatment [173, 174]. Later treatments were based on combining coal or anthralin with U V light (Goeckerman regimen) [174, 175]. These modalities may work by reducing the hyperproliferation of keratinocytes by a variety of mechanisms [173, 176, 177], which was thought at this time to be the primary etiological factor in disease pathophysiology [178]. Later studies demonstrated that the mitotic rate of basilar keratinocytes in psoriasis is indeed markedly increased, with the keratinocyte transit time reduced from the normal 27 to 4 days [165, 179, 180]. Topical corticosteroids and systemic treatments like the folic acid antagonist methotrexate were subsequently introduced in the 1950's, and were thought to have a similar effect upon keratinocyte hyperproliferation [181, 182]. During the 1980's, it was discovered that immunosuppressants such as Cyclosporine were an effective treatment of psoriasis, the first indication that this condition might represent a disorder of the immune system rather than a cell-intrinsic disease of the keratinocyte [178, 181, 183]. Within the last decade, elegant experimentation has further supported the autoimmune etiology of psoriasis [184-186], leading to new "biologic" agents such as the CD2-binding, L F A - 3 - I g fusion protein Alefacept, which targets activated/memory T cells, and the CD1 la-binding molecule Efalizumab, which decreases T-cell activation and migration, that are dramatically effective at mitigating disease [171, 187, 188]. Nevertheless the dispute about whether psoriasis represents a T-cell mediated autoimmune disease or a primary proliferative disease of the skin still exists, as only recently, 33 typical psoriatic changes were induced by the deletion of epidermal JunB [189], supporting the previously held belief that epidermal alterations are sufficient to initiate psoriasis [190, 191]. There are additional factors that are believed to have a role in psoriasiform disease; however, currently there is insufficient evidence to definitively implicate them with a role in disease pathogenesis. For example, it has recently been shown that T r e g are functionally impaired in psoriasis patients [137] and T r e g-deficient mice develop psoriasiform skin changes [192]. Infection may also play a role in the pathogenesis of psoriasis; for example, the onset of guttate psoriasis is often preceded by Streptococcal pharyngitis [193]. Similarly, opportunistic pathogens such as Malassezia furfur are suspected to have a role in disease pathogenesis [194, 195]. These organisms have been implicated in triggering psoriatic scalp lesions [196], and scalp psoriasis has been reported to respond to therapy with ketaconazole [197]. Furthermore, the application of opportunistic pathogens on the skin can experimentally induce typical psoriatic plaques in some experimental systems [198]. The infectious component of psoriasiform disease pathogenesis may be linked to the recently described M I C A 5.1 mutation that results in a truncated molecule incapable of alerting sentinel lymphocytes about keratinocyte infection, which has been associated with human psoriasis [199, 200]. Other poorly studied, yet suspected triggers of psoriasis, include: alcohol, sunburns, weather changes, stress, diet, allergies, mechanical trauma, and the abrupt discontinuation of medications or the initiation of new medications such as lithium or systemic corticosteroids [165, 201, 202]. 1.6.2 S e b o r r h e i c D e r m a t i t i s SD is a chronic medical condition afflicting approximately 1-5% of otherwise healthy individuals [203-205]. The prevalence of this disease is dramatically higher amongst immunocompromised patients, particularly H I V positive individuals, in whom the reported 34 incidence of disease ranges from 30-80% [169, 206]. While infantile SD is limited to the first year of life [207], the presentation of typical SD is rare before puberty, with disease preferentially affecting males in two age cohorts: young males with disease beginning during adolescence and late-middle aged males [165, 205]. A severe, explosive onset of disease occurring at any age may be associated with H I V infection [169, 206, 208]. The term "seborrheic dermatitis" encompasses a heterogeneous group of related disorders [165, 205]. Classical SD is a papulosquamous disorder characterized by well-defined and symmetrical patches of greasy erythematous scale affecting areas of the body richly populated with sebaceous glands (Fig. 5), such as the scalp, face, trunk, sternal region and groin [165, 202, 205]. The lesions of SD, particularly lesions involving the scalp, sometimes resemble those of psoriasis and therefore the term sebopsoriasis or seborriasis is sometimes used [165, 209]. However, significant differences in the distribution and morphology of psoriatic and SD lesions makes this an easy distinction in most cases [165]. Other variants of disease include infantile SD, which is a term used to describe a variety of skin disorders including cradle cap, diaper dermatitis, and Leiner's disease [205, 207, 210, 211] as well as AIDS-associated SD which is a more inflammatory and recalcitrant variant of disease [169, 205, 206]. Histologically, SD is characterized by folliculocentric scale-crusts consisting of mounds of parakeratotic squames mixed with pyknotic neutrophilic debris and prominent globules of plasma situated near follicular ostia (Fig. 6) [165, 166, 212]. Intercellular edema (spongiosis) is seen in the infundibular epithelium as well as in the surface epidermis, especially in the vicinity of nascent scale-crusts [166, 212]. Papillary dermal edema and ectasia of superficial dermal vessels are other features of disease [166, 212]. Chronic SD lesions become less spongiotic and more acanthotic over time, making the histological distinction from psoriasis more difficult [166, 212]. 35 (Source: A - cDermAtlas, www.dermatlas.org; B - Association of American Family Physicians) Figure 5. Gross Pathology of Seborrheic Dermatitis Seborrheic Dermatitis is characterized by yellowish-red, greasy scale-crusts (A) or fine white scales (B) overlying erythematous skin. SD has a very distinctive tissue distribution, occurring in areas richly populated by sebaceous glands such as the scalp, T-zone of the face, presternal area, and perigenital region (C) [165, 202, 205]. 36 (Source: D . E . Elder et al, [212]) Figure 6. Histopathology of Seborrheic Dermatitis Histologically, SD is characterized by mounds of hyperparakeratosis, overlying acanthotic epidermis in a folliculocentric distribution. Edematous dermal papillae containing widely dilated dermal blood vessels are a prominent histological feature. A perivascular lymphohistiocytic infiltrate often accompanies these other changes. 37 espite its long history and the existence of a sizeable research interest, a detailed understanding of SD disease pathophysiology is lacking [205, 213]. More than a century ago, opportunistic fungi were identified in lesional SD skin, which initiated the speculation that fungal pathogens played an active role in disease [194, 203]. Shortly thereafter, it was found that these fungal organisms, the recently taxonomically revised Malassezia spp. [214-216], represented normal inhabitants of the skin [194, 203, 217], casting doubt upon this initial speculation and leading to the belief that SD was a hyperproliferative disease of the skin caused by an intrinsic defect of the keratinocyte [203, 205]. This view prevailed for much of the twentieth century [203, 217] and was supported by the effective treatment of SD by selenium sulfide and zinc pyrithione which were known to possess anti-proliferative properties [203, 218]. However, recognition of the intrinsic antifungal properties of these compounds [203] and the introduction of newer antifungal agents with potent activity against Malassezia reawakened interest in the fungal theory of SD pathophysiology [203, 217]. Similarly, treatment studies have demonstrated that disease remission is associated with a reduction in the number of these organisms on the skin and that recolonization with antifungal-resistant strains of Malassezia leads to treatment-resistant SD [203]. Furthermore, recently employed shave biopsy sampling techniques have demonstrated that an increased amount of Malassezia exists on lesional skin [219] and that a correlation exists between the number of fungi on the skin and the severity of SD [203, 220]. Furthermore, given the tropism of lipophilic Malassezia for oily skin [194, 203], the fungal hypothesis of disease is supported by the relative confinement of SD to areas enriched in sebaceous glands [165, 166, 203, 205]. Moreover, the onset of disease at puberty, when the sebaceous glands become active due to an increase in circulating androgens [194, 203, 205, 221], and during the neonatal period, when circulating maternal progestins stimulate neonatal sebaceous glands [221, 222], demonstrates the central role of seborrhea in this condition. 38 Conditions characterized by increased seborrhea, such as Parkinson's disease [223] and chronic debilitation [224], are associated with a higher incidence of SD [194, 203, 205, 225] and, moreover, disease can be treated by reducing sebaceous gland activity with retinoids [203, 225]. Although these studies seemingly support a role for opportunistic fungal pathogens in SD pathophysiology, several peculiar findings continue to perplex the understanding of this disease. For example, it is known that some asymptomatic individuals harbour enormous numbers of Malassezia on the skin and yet never develop SD [203], suggesting that the number of yeast cells on the skin is only important for those with an inherent susceptibility to disease. The high prevalence of SD amongst A I D S patients [169, 170, 206] suggests that immune deficiency can predispose to disease. SD is the most common cutaneous inflammatory disorder associated with H I V infection (Fig. 7) [169] and is an important clinical marker of A I D S [169, 170, 208]. Other immune defects have also been associated with SD, including an inherited deficiency in the 5 t h component of complement, which has been implicated in Leiner's disease, the inflammatory form of infantile SD [210, 211]. Presumably, these deficits impair the clearance of opportunistic fungal pathogens from the skin resulting in prolonged keratinocyte infection and subsequent pronounced cutaneous inflammation. This is supported by the observation that lesional SD skin expresses increased levels of inflammatory cytokines [226, 227] and of the stress ligand M I C A [227]. Interestingly, SD is also associated with systemic immune activation and the circulation of activated immune cells [228], including N K cells which have been shown to accumulate in lesional skin [226]. The possibility that some of these cells may be activated non-specifically by bystander cytokine and that SD pathophysiology may have an autoimmune component is both intriguing and consistent with the observation that SD responds to immunosuppressive medication [181]. Nevertheless, these divergent findings in SD continue to perplex the 39 A HIV- & AIDS-Associated Conditions Percentage Observed Seborrheic dermatitis 34 Oral candidiasis 27 Xerosis 19 Drug eruptions 14 Pruritic popular eruption 9 Acne 8 Folliculitis 8 Condyloma acuminate 7 Herpes zoster 7 Tinea versicolor 6 Scabies 6 Prurigo 6 Diffuse alopecia 5 Skin hyperpigmentation 5 Staphylococcal folliculitis 5 Herpes simplex 5 Abscesses 5 B Normal E E b. IV a. in <u s. 8 xz a. E H «» Q O 500 H 200 —i a i s a g .y " t o O JC 1 ^ o 0) >• 01 o w w o N « uigari mpet a. > <» c o a ra < X c o O (A «t 3 c 3 CO o Pruri £ Pruri Years After Onset of HIV Infection Figure 7. Occurrence of Seborrheic Dermatitis in the Context of HIV Infection (A) The most frequent dermatological diagnoses in H I V patients are summarized. The percentage of H I V patients, in one series, afflicted with each disorder is shown [169]. (B) A graphical representation of the degree of CD4 T cell lymphopenia at which various AIDS-related cutaneous diseases occur [208]. 40 understanding of disease pathogenesis, highlighting the need for additional studies to clarify the pathophysiology of this condition. 1.7 Thesis Goals and Approaches The hypothesis tested in this thesis was that the D 2 C mouse represents an accurate animal model of human psoriasiform disease and that the interplay between a number of lymphocyte subsets culminates in psoriasiform pathology. The primary goal of Chapter 3 was to characterize the clinical and histological aspects of disease in order to best determine the human pathological equivalent of the D 2 C disease phenotype. D 2 C mice were extensively studied with a careful evaluation of the kinetics of disease, severity of disease, and other clinical aspects of the disease phenotype. Disease was also xtensively evaluated through a comprehensive histological analysis of all major organ systems. Through these initial approaches, it was determined that an overgrowth of opportunistic cutaneous pathogens was a feature of D 2 C disease. To further investigate this observation, various methods were employed to reveal the identity of the opportunistic pathogens involved, after which appropriate antimicrobial agents were administered to D 2 C mice in the attempt to treat disease. The results of these initial studies demonstrated that the disease phenotype of D 2 C mice most closely resembled the human psoriasiform disease seborrheic dermatitis. The last approach of this chapter was to test whether genetic mutations known to be associated with SD were also a feature of the D 2 C model. The primary goal of Chapter 4 was to investigate the involvement of immunocompromise in D 2 C disease pathophysiology. To first address this possibility, thymocytes and peripheral lymphocyte subsets were quantitated, followed by functional assessments of normal immune function. The findings that D 2 C mice were severely immunocompromised and that the 41 phenotype in these mice resembled AIDS-related SD lead to the investigation of additional parallels between the D 2 C phenotype and A I D S . Various immune reconstitution experiments were then performed in an attempt to treat disease. A 2 n d goal of this chapter was to determine whether perturbations in the normal repertoire of T cell subsets co-existed with and/or contributed to immunocompromise in D 2 C mice. Given the superficial similarity between the cutaneous disease phenotype seen in T r e g deficient FoxP3 K O mice and D 2 C animals, the effect of transgenesis on the development of T r e g was investigated in D 2 C mice. Furthermore, it was sought whether the adoptive transfer of D B A / 2 T r e g could abrogate disease development. The primary goal of Chapter 5 was to investigate whether a population of clonally-anergized self-specific cells in D 2 C mice contributed to disease pathophysiology and, i f so, how this element of disease pathophysiology related to other disease susceptibility factors. To first address this goal, thymocytes and peripheral lymphocytes from D 2 C mice were immunophenotyped for the expression of the 2C T C R as well as for markers of Ag-experience and T cell activation. Given the presence of acutely activated, Ag-experienced 2C cells, with enhanced functional properties in D 2 C mice, a blocking m A b against the 2C T C R was administered to see i f 2C cells were necessary for the disease phenotype. The demonstrated necessity of 2C cells in the model system led to the testing of whether these cells were sufficient for disease through adoptive transfer experiments and the generation of lymphocyte-deficient 2C mice. The primary goal of Chapter 6 was to determine whether T C R transgenesis perturbed the development of sentinel cutaneous y5 lymphocytes and the possible effect of this upon disease pathophysiology. To first address this goal, cutaneous lymphocytes from 2C mice were immunophenotyped for the expression of the y8 T C R . The finding that the epidermis of D 2 C mice was deficient in y8-cells directed subsequent studies on whether skin from 2C mice formed 42 a functional barrier or whether this important role was compromised in these animals. To further address this goal and to elucidate a poorly-understood aspect of the model, it was investigated whether the failure of D 2 C bone marrow to transfer disease to D B A / 2 recipients resulted from a persistence of recipient-derived y8 cells in the chimeric epidermis. To address this possibility, D B A / 2 y8 K O mice were created and, together with wild-type D B A / 2 mice, these animals were used as recipients for D 2 C bone marrow, which confirmed the role of y8 dysfunction in the D 2 C model. 43 Chapter 2; Materials and Methods 2.1. M i c e Breeders for 2C T C R transgenic mice [107] were kindly provided by Dr. Denis Loh (then at Howard Hughes Medical Institute, Washington University, St. Louis, M O ) . C57BL/6 (B6), D B A / 2 , B A L B / C , and H - 2 d congenic B6 ( B 6 . C - H - 2 d / B B Y ) mice, and breeders for F O X P 3 hemizygous K O , Rag-1 7", and T C R 5"A mice were obtained from the Jackson Laboratory (Bar Harbor, M E ) . The 2C T C R transgenes were bred from the B6 background to the H-2 d-expressing B A L B / C , D B A / 2 , and H - 2 d congenic B6 backgrounds, and assessed for disease development at each backcross generation. The Rag-1 and T C R - 8 mutations were partially backcrossed from the B6 to the D B A / 2 background (6 backcross generations and 5 backcross generations, respectively). A l l animals were maintained in microisolator cages in the animal facility of the Department of Microbiology and Immunology at U B C and the Thier Building animal facility at the Massachussetts General Hospital, and received acidified water and autoclaved food according to guidelines set by the Canadian Council on Animal Care. 2.2 C e l l Lines The T A P deficient cell line T 2 - L d was created by transfection of the human (TxB) hybridoma T2 with the murine L d M H C class I molecule [63, 229]. T 2 - L d cells were a kind gift from Dr. Peter Cresswell (Howard Hughes Medical Institute, Yale University, New Haven, CT) . A20 cells (TIB-208, American Type Culture Collection, Manassas, V A ) are B A L B / c derived, and thus H - 2 d expressing, B cell lymphoma cells. 44 2 .3 Reagen t s 2 .3 .1 Pep t ides The p2Ca ( L S P F P F D L ) peptide [230] was synthesized at U B C ' s Nucleic Acid-Protein Service (NAPS) Unit. 2 . 3 . 2 A n t i b o d i e s a n d S t a i n i n g Reagents A l l antibodies used in immunohistochemistry (IHC), flow cytometry (FACS®), and enzyme-linked immunosorbent assays (ELISAs) , and immunofluoresence (IF) are listed in Table 2. Unless otherwise indicated, the listed reagents were used for FACS®. T a b l e 2 : A n t i b o d i e s U s e d A n t i b o d y P r o d u c t / C l o n e # S o u r c e 2C T C R ( F A C S & adoptive transfer) 1B2 H . Eisen, M.I .T. , Boston, M A [231] 7 A A D Cat# 129935 Calbiochem, San Diego, C A Bromodeoxyuridine B44 B D Pharmingen, San Diego, C A C D 3 145.2C11 B D Pharmingen C D 3 Bio (IHC) 145.2C11 B D Pharmingen C D 4 ( F A C S ) GK1.5 B D Pharmingen C D 4 (IHC) RM4-5 B D Pharmingen C D 8 a 53.67 B D Pharmingen CD8p 53.58 American Type Culture Collection ( A T C C ) , Manassas, V A CD1 l b /Mac-1 M l / 7 0 B D Pharmingen CD25 7D4 B D Pharmingen CD25 PC61.5.3 Cedarlane, Hornby, O N CD69 H1.2F3 Cedarlane CD43 effector glycoform 1B11 B D Pharmingen CD44 IM7.8.1 Cedarlane C D 6 2 L M E L - 1 4 B D Pharmingen C D 122 T M - p l B D Pharmingen goat F(Ab')2 anti-mouse Ig (IF) 1012-02 Southern Biotech, Birmingham, A L 45 Ant ibody Product/Clone # Source goat F(Ab')2 anti-mouse Ig 1012-01 Southern Biotech ( E L I S A capture mAb) goat-ct-mouse IgG A P (ELISA) 1030-04 Southern Biotech goat a-rat IgG H R P (IHC) S3050-05 Southern Biotech H-2 K b D b HB51 A T C C H Y T C R (adoptive transfer) T3.70 H.S. Teh, U B C , Vancouver, B C IFN-y ( E L I S A capture mAb) R4-6A2 eBioscience, San Diego, C A IFN-y ( E L I S A detection mAb) X M G 1 . 2 eBioscience NK1.1 PK136 B D Pharmingen N K G 2 D C X 5 B D Pharmingen Streptavidin-FITC 554057 B D Pharmingen Streptavidin-PE 554061 B D Pharmingen Streptavidin-PE-Cy5 C L C S A 1 0 0 6 Cedarlane Streptavidin-AP (ELISA) 7100-04 Southern Biotech Streptavidin-HRP (IHC) 7100-05 Southern Biotech Thy-1.2 (T cell depletion) Jlj .10 A T C C Vp2 T C R B20.6 B D Pharmingen Vp4 T C R K T 4 B D Pharmingen Pan-Vp8 T C R chains F23.1 B D Pharmingen [232] Vp8.2 T C R M R 5 - 2 B D Pharmingen VP8.3 T C R 1B3.3 B D Pharmingen VplOb T C R B21.5 B D Pharmingen V P 1 3 T C R M R I 2-3 B D Pharmingen V P 1 4 T C R 14-2 B D Pharmingen Vy3 y5 T C R 536 B D Pharmingen Pan-y8 T C R G L 3 B D Pharmingen 46 2.3.3 Primers Primers were synthesized at either the N A P S Unit at the University of British Columbia or the D N A core facility at the Massachusetts General Hospital. Table 3: Primers Used Primer Pairs Sequence 2C T C R (250 bp)/HY T C R [123] V p 8.2: 5 ' - A G A T A T C C C T G A T G G A T A C A A G G C - 3' Jp 2.5: 5 - C T A A C A C G A G G A G C C G A G T G C C T G - 3' T C R 8"A [233] I M R 1 3 - N E O Forward: 5 ' -CTT G G G T G G A G A G G C T A T T C - 3 ' I M R 1 4 - N E O Reverse: 5 ' - A G G T G A G A T G A C A G G A G A T C - 3 ' IMR15-TCR-8 Forward: 5 ' - C A A A T G T T G C T T G T C T G G T G - 3 ' IMR16-TCR-8 Reverse: 5 ' -GTC A G T C G A G T G C A C A G T TT-3 ' Rag-r7" [234] IMR189-NEO: 5 ' - T G G A T G T G G A A T G T G T G C G A G - 3 ' IMR1746-WT: 5 ' - G A G G T T C C G C T A C G A C T C T G - 3 ' IMR3104-Common W T : 5 ' - C C G G A C A A G T T T T T C A T C G T - 3 ' F O X P 3 [235] IMR1571 W T forward: 5 ' - C T C A G G C C T C A A T G G A C A A G - 3' IMR1572 Mutant Forward: 5 ' - T C A G G C C T C A A T G G A C A A A A - 3 ' IMR1573 Reverse Common: 5 ' - C A T C G G A T A A G G G T G G C A T A - 3 ' C5 [123] Forward: 5' - C C A T C T G T C T C C A G A T G A A T A T G T - 3' Reverse: 5' - A T A A T G G G A G T C A T C T G C G T T T - 3' ITS [236] ITS1: 5'- T C C G T A G G T G A A C C T G C G - 3' ITS3: 5'- G C A T C G A T G A A G A A C G C A G C - 3 ' ITS4: 5 ' - T C C T C C G C T T A T T G A T A T G C - 3 ' 2.3.4 Cytokines Murine IL-2 was obtained from the spent media of cultured IL-2 gene-transfected X63/0 cells as previously described [237]. The concentration of IL-2 in this culture media was determined in a cytokine E L I S A using the IL-2 specific mAbs JES6-1A12 (capture mAb, B D Pharmingen) and JES6-5H4 (detection mAb, B D Pharmingen) and recombinant murine IL-2 (550069, B D Pharmingen) as previously described [238, 239]. 47 2.4 Methods 2.4.1 Genotyping of Mice Mice were genotyped by either P C R or FACS®. P C R based genotyping was performed on ear punch D N A using the primers listed in Table 2. For the 2C T C R reaction, a 250-bp band is amplified from 2C T C R transgenic animals while amplification of non-transgenic control D N A results in a faint smear. FACS® based genotyping was performed on heparanized tail vein blood which was centifuged over histopaque 1077 (Sigma, St. Louis, M O ) for the collection of interface cells. 2C TCR-transgenic mice were genotyped using the 1B2 mAb. Identification of H - 2 b expressing mice was performed using the HB51 mAb. Rag-1"7" mice as well as D2C R a g - T were sometimes genotyped by demonstrating a lack of circulating B-lymphocytes using the goat FITC-labeled, F(Ab ' ) 2 anti-mouse lg (1012-02). 2.4.2 Photographs Photographs were taken using a Nikon CoolPix 990 or Canon PowerShot S400 Digital E L P H camera. 2.4.3 Disease Scoring Disease has been arbitrarily divided into 4 stages: stage 0 (SO), no disease; stage 1 (SI), minimal peri-ocular erythema and edema; stage 2 (S2), major periocular swelling +/- l id fusion with little contiguous spread to surrounding tissue; stage 3 (S3), S2 features plus significant spread to contiguous tissues. This manner of scoring was found to be extremely reproducible, even amongst those inexperienced with the model system. 48 2.4.4 Ear Thickness Determination Ear pinna thickness was measured using a Mitutoyo pocket thickness gage (Long Island Indicator Service, New York, N Y ) . 2.4.5 Histology Tissue was fixed in 10% bufferred formalin (Fisher Scientific, Agawam, M A ) and processed for permanent paraffin embedding on a Leica A S P 300 tissue processor (Leica Microsystems Inc., Bannockburn, IL). Paraffin sections were stained with Haematoxylin and Eosin ( H & E ) using a Leica Autostainer X L (Leica Microsystems Inc.). Grocott's Methenamine Silver (GMS) and Periodic A c i d Schiff (PAS) staining was performed on a Ventana Nexes Special Stainer (Ventana Medical Systems Inc., Tucson, A Z ) . Unfixed tissue was cryo-embedded in optimal cutting temperature (O.C.T.) compound (Sakura Fintek Inc., Torrance, C A ) for immunohistochemistry. 2.4.6 Immunohistochemistry on Frozen Tissue Frozen sections were cut, fixed in acetone for 10 min at -20 °C and then air-dried. Immunohistochemistry was performed as per standard techniques [240]. In brief, the slides were blocked for endogenous peroxidase activity using 3% H2O2 in P B S for 10 min. Following removal of the H2O2 and P B S washing, the slides were blocked with 5% mouse serum and 5% B S A in PBS-Tween for 1 h at 37°C, before being stained with the primary mAb for 1 h at 37°C. For biotinylated primary A b , S A - H R P (7100-05, Southern Biotech) was used as a secondary reagent. For unlabeled primary A b , HRP-labeled goat a-rat IgG polyclonal A b (S3050-05, Southern Biotech) was used as a secondary reagent. Secondary reagents were applied for 1 h at 49 37°C. The Vector*' Nova Red H R P immuno-histochemistry kit (Vector Labs, Burlington, C A ) was used to develop the staining for 15 min. The sections were then counterstained with haematoxylin. 2.4.7 Culture of Fungal Isolates from Lesional Skin Swabs from the external auditory meatus or rostral skin scrapings made with a sterile #10 scapel blade were used to inoculate Pityrosporum media ( A T C C culture medium #1110 and 1072), supplemented with or without 0.4 mg/ml of cyclohexamide (Sigma) and 0.05 mg/ml chloramphenicol (Sigma). Plates were cultured for 1-2 weeks at 24°-37°C. Colonies isolated on Pityrosporum media were tested for their ability to grow on lipid-enriched as well as standard Sabouraud's dextrose agar (BD Diagnostics, Sparks, M D ) under these same conditions. The most frequently isolated organisms were also tested for growth on corn meal and bird seed agar (BD Diagnostics) and were identified to species level using Vitek yeast biochemical cards (Vitek Systems, Biomerieux, France) according to manufacturer's instructions. 2.4.8 Genotyping of Fungal Isolates D N A from two representative colonies of the most abundantly isolated fungi was obtained by zymolase digestion and used for P C R amplification with the universal fungal, internal transcribed spacer primers, ITS1 and ITS4 as well as ITS 3 and ITS4, as previously described [236]. To definitively characterize the isolate, the ITS region from these isolates was sequenced with the ITS1 and ITS4 primers. 2.4.9 DNA Extraction from Paraffin-Embedded Tissue for PCR Amplication of the ITS Region 50 For P C R on paraffin-embedded samples, tissue was scraped from multiple "blank" slides with a sterile #10 scalpel blade and transferred to a microcentrifuge tube. 200-ul of xylene (Sigma) was added, mixed by inversion, heated for 15 min at 37°C, and subsequently centrifuged. The supernatant was removed, and a fresh 200-ul aliquot of xylene was added to the pelleted tissue for a second paraffin extraction. The pellet was washed twice with 1.0 ml of 100% ethanol to remove residual xylene. The ethanol was removed by centrifugation, and the pelleted tissue was air dried. D N A extraction from the pellet was performed by a standard P K digestion technique [241]. 2.4.10 Fungal specific E L I S A This assay was carried out as previously described [242]. Briefly, Candida guilliermondii yeast grown for 2 days on Sabouraud's Dextrose agar were disaggregated and washed in P B S . The cells were resuspended in carbonate-bicarbonate buffer at 10 7 cells/ml and used to coat Immulon plates (Dynatech Laboratories Inc., Indianapolis, IN) for 2 hours at 37° C. After blocking with 1% B S A in P B S for 2 h at 37° C, serum samples were diluted in blocking solution and incubated for 2 h. Bound IgG was detected by incubating 100 ul of alkaline phosphatase (AP) conjugated goat-a-mouse IgG (1030-04, Southern Biotech) for 45 min at room temperature. A P activity was detected by incubation with 100 pi of p-nitrophenyl phosphate (Sigma) at a concentration of 1 mg/ml. The colorimetric assay was analyzed at 405 nm on a Spectra M a x 250 plate reader (Molecular Devices, Sunnyvale, C A ) . Serum was collected from D 2 C mice at various stages of disease pathogenesis as well as from various control mice, by either tail vein bleeding or the collection of blood from the thoracic cavity following cervical dislocation of animals at the time of sacrifice. 51 2.4.11 Fungal Growth Inhibition Assays Circular pieces of Whatman paper (Fisher Scientific, Ottawa, ON) , 0.5 cm in diameter, were soaked in a 2 mg/ml solution of fluconazole (Pfizer, QC) and placed on plates of Sabouraud dextrose agar freshly inoculated with fungi. 2.4.12 Fluconazole Administration to Actively Diseased D2C Mice Fifty-day old severely diseased D 2 C mice were treated once daily for 9 d with i.p. injections of fluconazole (12 mg/kg) or P B S (n=4 animals per group). Animals were considered to be convalescing at the first observation of new hair growth on rostral skin, and were photographed weekly. Following the treatment period, animals were sacrificed for necroscopic examination. 2.4.13 Fluconazole Administration to Pre-diseased D2C Mice 10-day old pre-diseased D 2 C mice were treated once daily for 6 weeks with i.p. injections of fluconazole (12 mg/kg) or PBS (n=4 animals per group). Animals were monitored daily for the development of disease and were photographed weekly. Following the treatment period, animals were sacrificed for necroscopic examination. 2.4.14 Bacterial Culture from D2C Skin Rostral skin scrapings made with a sterile #10 scapel blade were used to inoculate tryptic soy agar (TSA) plates (BD Diagnostics) which were cultured at 24-37°C. 52 2.4.15 Gram Positive Cocci IgG ELISA Gram positive cocci (GPC) isolated from the rostral skin of diseased D 2 C mice were grown on T S A plates and used as a capture reagent to detect GPC-specific serum IgG. IgG was detected as previously described for Candida guilliermondii. 2.4.16 Combined Fluconazole/Levofloxacin Administration to Pre-diseased D2C Mice 10-day old pre-diseased D 2 C mice were treated once daily for 6 weeks with i.p. injections of fluconazole (12 mg/kg) and levofloxacin (lOg/kg) or P B S (n=4 animals per group). Animals were monitored daily for the development of disease and were photographed weekly. Following the treatment period, animals were sacrificed for necroscopic examination. 2.4.17 Adoptive Transfer of Bone Marrow Following sacrifice, the humeri and femurs of donor mice were exposed, and bone marrow was expressed with P B S injected from a 26-gauge needle. The marrow was depleted of mature T cells using the j l j .10 m A b ( A T C C ) and L o w - T o x - M rabbit complement (Cedarlane) according to company specifications. 1 x 10 7 T cell depleted bone marrow cells were injected by tail vein into irradiated (1150 rads) recipients ranging in age from 21 - 50 d of age. In each experiment at least 4 animals were present in each recipient group and all recipients were age matched. Use of the a -H-2 b m A b HB51 ( A T C C ) by FACS® was employed for some donor-recipient combinations to ensure engraftment and depletion of recipient cells. 2.4.18 Genotyping Alleles of the 5th Component of Complement (C5) A 328-330 bp fragment of the C5 gene, containing the 2 bp deletion known to induce C5 deficiency [243] was amplified using the primers described in Table X . This mutation, occurring 53 in C5 deficient strains, disrupts a Hind III restriction site and, as such, digestion of the resulting amplicons with Hind III (Life Technologies, Burlington, Canada) was used to genotype the animals. C5 sufficient strains have a 211 and 119 bp band while deficient animals have a single 328 bp band. Animals heterozygous for the C5 alleles possess all three bands. 2.4.19 I so l a t i on o f L y m p h o i d O r g a n s a n d I m m u n o p h e n o t y p i n g : Lymph nodes (LN) , thymi and spleen were harvested from mice sacrificed by cervical dislocation or carbon dioxide asphixyation. Single cell suspensions were produced by standard techniques [239]. Briefly, lymphoid organs suspended in R P M I 1640 media (GibcoBRL, Burlington, ON) supplemented with 2% Fetal Bovine Serum (FBS, Sigma) were ground through a steel sieve followed by a centrifugation step. The pellet was gently washed to resuspend lymphocytes and subsequently discarded to dispose of adherent cells. The resultant cell suspension was centrifuged and the pellet was resuspended in I media (Iscoves D M E M supplemented with 10% (v/v) heat inactivated F B S , 100 U of penicillin G/ml , 100 pg of streptomycin/ml and 5 x 10"5 M 2-ME) . For splenic preparations in particular, a R B C lysis step was performed that consisted of resuspending the cell pellet in R B C lysis buffer (Cat # 00-4333, eBioscience) for 5 minutes prior to resuspension in I media. The concentration of the resulting cell suspensions were determined with a hemocytometer and 1-2 x 10 6 lymphocytes/well were seeded in round bottom, 96-well FACS® plates. Cells were stained with a mixture of m A b in 100 pl of FACS® buffer (PBS with 2% FBS) for 15 minutes on ice. Cells were then pelleted by centrifugation and washed with FACS® media, prior to a second incubation step with secondary staining reagents. Following a final wash, cells were resuspended in FACS® buffer and analysed with a FACScan® flow cytometer and CELLQues t software (BD Biosciences, Immunocytometry Systems, San Jose, C A ) . 54 2.4.20 H e n E g g L y s o z y m e ( H E L ) I m m u n i z a t i o n a n d H E L E L I S A H E L (Sigma) was diluted in P B S and emulsified with an equal volume of titermax (Sigma). 0.1 ml of the emulsified A g (50 \xg H E L ) was administered i.p. After 10 days, serum was collected from immunized animals by tail vein nicking. Immulon plates were coated with 100 ul of H E L at a concentration of 0.5 ug/ml in 50 mm carbonate- buffer (pH 9.6). Plates were blocked as described previously. Serial dilutions of serum in blocking buffer, ranging from 1:50 - 1:3200 were then incubated in the blocked plate for 1 h at 37°C. Detection of bound IgG was then performed with 1030-04 (Southern Biotech) as previously described. 2.4.21 M o u s e N e c r o p s y For most experimental animals, vital organs including kidney, liver, stomach, small and large intestine, heart, skin, thymus, spleen, L N , and lung were routinely harvested and photographed. Portions of the material were saved frozen for IHC, fixed in glutaraldehyde for E M , processed for flow cytometry and fixed in formalin for permanent parafin embedded sections. Microbiological cultures and blood samples were also procured at the time of sacrifice. 55 2.4.22 Assessment of Total Serum IgG Immulon plates were coated with 100 ul of goat F(Ab')2 anti-mouse Ig (1012-01, Southern Biotech) at a concentration of 4 pg/ml in carbonate buffer. Blocking, serum sample incubations, and detection of bound IgG with 1030-04 (Southern Biotech) was performed as described above. The murine I g G l mAb 1B2 was used to develop a standard curve. 2.4.23 CD4 Counts A n aliquot of heparinized tail vein blood was diluted in R B C lysis buffer, after which the total W B C count was determined using a hemocytometer. The remaining blood was centrifuged over histopaque (Sigma) for the collection of interface cells. Staining of interface cells with GK1.5 (BD Biosciences), and 145.2C11 (BD Pharmingen) and analysis by flow cytometry was performed to identify the percentage of W B C that were C D 4 + T cells. 2.4.24 Analysis of BrdU Incorporation Mice were fed B r d U (Sigma) in their drinking water (0.8 mg/ml) for 10 days before being sacrificed and assayed by flow cytometry for B r d U incorporation by lymphocytes as previously described [63]. Briefly, single cell preparations were generated and surface stained in the usual fashion. Cells were resuspended in 0.15M N a C l and 1.2 ml of E t O H was added slowly in a drop-wise fashion followed by a 30 min incubation. Cells were then washed with F A C S buffer and subsequently incubated for 30 min in 1 ml of a 1% paraformaldehyde and 0.05% Tween 10 solution. The cells were then pelleted and incubated in 1 ml of D N A s e solution, consisting of 0.15M N a C l , 4 .2mM M g C l , and 100 Kunitz units/ml D N A s e (Qiagen, Mississauga, ON), for 30 minutes at 25°. The cells were then transferred from FACS® tubes to a 96 well FACS® plate, 56 washed with F A C S media and stained with anti-BrdU-FITC (B44, B D Biosciences) for 30 min on ice. The cells were then washed and analyzed on a FACScan® flow cytometer. 2.4.25 Adoptive Transfer of Purified CD4+ T Cells Single cell suspensions of D B A / 2 L N cells were prepared using standard techniques. Purified C D 4 + T cells were obtained by incubating L N cells with biotinylated GK1.5 (BD Pharmingen) and subsequently with Streptavidin-conjugated magnetic microbeads (Miltenyi Biotec, Auburn, C A ) before being applied to a M A C S Separation Column (Miltenyi Biotec). This procedure yields > 95% purity of C D 4 + T cells. 2 x 10 7 purified C D 4 + T cells in 0.5 ml P B S were administered by tail vein to 25-day old pre-diseased D 2 C recipients. Control animals received an i.v. injection of P B S (n = 4 animals per group in each of three separate experiments). Animals were monitored daily for the development of disease and were photographed weekly. Following the treatment period, animals were sacrificed for necroscopic examination. 2.4.26 Adoptive Serum Transfer to Prediseased D2C Mice Serum from S3 D 2 C mice was collected and tested for the presence of a-Candida A b as previously described. Serum with high titers of a-fungal A b was pooled. The resultant pooled serum had an IgG concentration of 13 mg/ml which was diluted with P B S to a concentration of 2 mg IgG/ml. 0.5 ml of this diluted serum was administered IP, twice weekly to 20-d old pre-diseased D 2 C recipients. Age-matched control animals received biweekly injections of the I g G l T3.70 control A b . Animals were monitored daily for the development of disease and were photographed weekly. Following the treatment period, animals were sacrificed for necroscopic examination. 57 2.4.27 T r e g Suppression Assay Suppression assays were performed as described [244]. Briefly, 2 x 10 4 D B A / 2 C D 8 + T cells as responders were stuimulated with 8 x 10 4 irradiated A P C ( D B A / 2 splenocytes) and a 2 pg/ml concentration of Con A , in the presence of various number of C D 4 + C D 2 5 + T r e g that resulted in a 1:1, 2:1, 4:1, 8:1, and 1:0 responder:supressor ratio. Cells were cultured in U-bottom 96-well plates and grown in 200 pL of Iscove's Modified Dulbecco's Medium ( I M D M ) supplemented with 5 x 10"5 M 2 - M E , 10% F C S , 100 U/ml of penicillin G and 100 pg/ml of streptomycin (all from Life Technologies). The cells were pulsed with 50 pl of ( 3H)thymidine (20 pCi /ml , Perkin-Elmer, Boston, M A ) 8 h before the end of the 72 h assay period. T r e g cells were purified from L N by first depleting C D 8 + T cells, macrophages, and B lymphocytes by incubation of the cell suspension with the 53.58 (BD Pharmingen) and Mac-1 (BD Pharmingen) mAbs. Following a wash step, the cells were incubated at room temperature for 40 min in PBS:I-media (1:1) with 50 pl of M-450 sheep anti-mouse IgG Dyna beads (Dynal, Oslo, Norway) per 10 cells. The cells were then immediately applied to a magnetic column (Dynal), which resulted in the negative selection of unwanted cells. The resultant population of non-magnetized, predominantly CD4 cells was then stained with a biotinylated a-CD25 (PC61) mAb and subsequently with streptavidin-conjugated magnetic microbeads (Miltenyi Biotec) before being applied to a M A C S Separation Column (Miltenyi Biotec). This procedure yields > 95% purity of C D 4 + C D 2 5 + T cells as assessed by FACS® analysis using the a-CD25 m A b 7D4 (BD Pharmingen) and the a -CD4 m A b GK1.5 ( B D Pharmingen). C D 8 T cells were purified by incubating L N cells with biotinylated 53.67 (BD Pharmingen) and subsequently with Streptavidin-conjugated magnetic microbeads (Miltenyi Biotec) before being applied to a M A C S Separation Column (Miltenyi Biotec). This procedure 58 yields > 95% purity of C D 8 + T cells as determined by FACS® analysis using the ct-CD3 m A b 145.2C11 (BD Pharmingen) and the a -CD8 m A b 53.58 ( A T C C ) . For the isolation of A P C s , splenocyte cell suspensions were prepared in the usual fashion and red blood cells were lysed as previously described. The cells were resuspended in P B S and y-irradiated with 2000 rads. 2.4.28 Adoptive Transfer of Purified CD4+CD25+ T r e g Cells to Prediseased D2C Mice C D 4 + C D 2 5 + T r e g were purified as described above. 1-2 x 10 6 purified C D 4 + C D 2 5 + T cells in 0.5 ml P B S were administered by tail vein to 15-day old pre-diseased D 2 C recipients. Age matched control animals received an i.v. injection of P B S (n = 4 animals per group in each of three separate experiments). Animals were monitored daily for the development of disease and were photographed weekly. Following the treatment period, animals were sacrificed for necroscopic examination. 2.4.29 Adoptive Transfer of Purified CD4+CD25 T Cells to Prediseased D2C Mice C D 4 + C D 2 5 " "helper" (T H ) T cells were purified from L N by depleting C D 4 + C D 2 5 + T r e g , C D 8 T cells, macrophages, and B lymphocytes by incubation of the cell suspension with the PC61 (Cedarlane), 53.58 ( A T C C ) and Mac-1 (BD Pharmingen) mAbs and subsequently with M -450 sheep anti-mouse IgG Dyna beads (Dynal) as previously described. The negative selection of unwanted cells routinely yielded > 95% purity of C D 4 + C D 2 5 " T cells as assessed by FACS® analysis using the a-CD25 mAb 7D4 (BD Pharmingen) and the ot-CD4 mAb GK1.5 (BD Pharmingen). 1-2 x 10 7 purified C D 4 + C D 2 5 " T cells in 0.5 ml PBS were administered by tail vein to 15-day old pre-diseased D 2 C recipients. Age matched control animals received an i.v. injection of P B S (n = 4 animals per group in each of three separate experiments). Animals were 59 monitored daily for the development of disease and were photographed weekly. Following the treatment period, animals were sacrificed for necroscopic examination. 2.4.30 ELISA for Quantitating a-Double stranded DNA (dsDNA) Immunon plates were incubated with 50 pi of a 50 ug/ml solution of polylysine in distilled water at 37° C for 1 h. Following three P B S washes, 50 ul of a 10 ug/ml solution of d s D N A (Sigma) was incubated in the plate for 1 h at 37 °C. Blocking, diluted serum sample incubations, and detection of bound IgG with 1030-04 (Southern Biotech) was performed as described above. 2.4.31 Immunofluorescence Microscopy of Kidney Sections Frozen tissue sections of D 2 C and control kidney were fixed in acetone for 10 min at -20 °C and then air-dried. Immunofluorescence was performed as per standard techniques [239]. In brief, the slides were blocked for non-specific binding with 5% mouse serum and 5% B S A in PBS-Tween for 1 h at 37°C, before being incubated with FITC-labeled, goat F(Ab ')2 anti-mouse Ig (1012-02, Southern Biotech). Following the application of anti-fade solution (VectaShield, Vector Labs), tissue sections were examined under a Zeiss fluorescence microscope (Carl Zeiss Microimaging Inc., Thornwood, N Y ) . 2.4.32 Dexamethasone Administration Pre-diseased 15 d-old D 2 C mice received daily i.p. injections of 10 ug dexamethasone or the P B S vehicle control for a study period of 3 weeks (n = 4 animals per group in each of three separate experiments). Animals were monitored daily for the development of disease and were 60 photographed weekly. Following the treatment period, animals were sacrificed for necroscopic examination. 2.4.33 7 A A D Based Method for Identifying Apoptotic/Pre-Apoptotic Cells Cell suspensions were prepared in the usual fashion and prepared for FACS®. 7 A A D (1:100 dilution) together with other staining reagents, were diluted in FACS® media. The staining solution was added to pelleted cells, and incubated for 15 min on ice. The cells were washed 3 times, followed by a fixation step with 200 pl of 4% paraformaldehyde for 15 min on ice. The fixed samples were then added to 200 pl of FACS® buffer and analyzed on the flow cytometer with 7 A A D measured in the F L 3 channel. 2.4.34 Purification of 2 C DNTC CD4"CD8"2C + D N T C were purified from a standard L N cell suspension by depleting C D 4 + T cells, C D 8 + T cells, macrophages, and B lymphocytes [63]. To deplete these subsets, the cell suspension was incubated with the GK1.5 ( B D Pharmingen), 53.67 ( B D Pharmingen) and Mac-1 (BD Pharmingen) mAbs, and subsequently with M-450 sheep anti-mouse IgG Dyna beads (Dynal) as described above. This procedure yielded between a 70-95% pure population of 1B2 + D N T C as assessed by staining with the a-2C T C R m A b 1B2 (Eisen, MIT) . Lower yields were characteristic of actively diseased D 2 C mice where large numbers of contaminating non-lymphoid, Mac-1 + ce l l s were often present. 2.4.35 Immediate Ex Vivo CTL Assay Effector 2C T C R D N T C were purified from the L N of various 2C mice as described above. A20 target cells ( A T C C ) expressing physiological levels of the 2C cognate ligand were 61 radio-labeled by incubating 1 x 10 6 pelleted cells with 0.1 ml of 5 1 Cr-sodium chromate (1 mCi /ml , Amersham Pharmacia Biotech, Quebec, Canada) and subsequently mixed with various ratios of effectors (1 x 10 4 targets/well). The cells were briefly centrifuged together and incubated in 200 ul of I M D M in 96-well, U-bottom plates. After an 18-h incubation, supernatants were collected and counted. A l l assays were performed in quadruplicate. Percent specific lysis was calculated as shown: % release = 100% x (cpm (experimental well) - cpm (spontaneous release)) (cpm (maximum release) - cpm (spontaneous release)) 2.4.36 IFN-y ELISA 2C T C R + D N T C were purified from the indicated 2C mice as described above and previously . 1x10 s 2C cells were stimulated with l x l 0 5 mitomycin C-treated (Sigma) A20 cells and 20 U/ml IL-2. After 40 h of stimulation, tissue culture supernatant was collected for subsequent analysis. Immulon plates were coated with 100 ul of the IFN-y capture antibody R4-6A2 (eBioscience) at a concentration of 4 ng/ml in 50 m M carbonate-bicarbonate buffer (pH 9.6). Various supernatent dilutions were incubated in the plate following a standard blocking step. Bound IFN-y was detected by 100 ul of the biotinylated detection antibody X M G 1 . 2 (1 pg/ml, eBioscience) and a subsequent incubation with 100 (al of S A - A P (1:2000, Southern Biotech) for 45 min at room temperature. A P activity was assayed by a Spectra M a x 250 plate reader (Molecular Devices, Sunnyvale, C A ) following incubation with 100 pi of a 1 mg/ml solution of p-nitrophenyl phosphate (Sigma). Recombinant IFN-y (eBioscience) was used to develop a standard curve. 62 2.4.37 T 2 - L d Proliferation Assay 2C T C R + D N T C were purified from the indicated 2C animals as descibed above. 1 x 10 4 2C cells were stimulated with 5 x 10 4 mitomycin C (Sigma) treated T 2 - L d cells loaded with 0, 0.01, 0.1, 1, and 10 p M p2Ca peptide (synthesized at the U B C N A P S Unit) ± 20 U / m l IL-2, (the preparation of which was described previously [63]). The assay was performed in U-bottom 96-well plates in 200 p L of I M D M supplemented with 5 x 10"5 M 2 - M E , 10% F C S , 100 U / m l of penicillin G and 100 pg/ml of streptomycin (all from Life Technologies). The cells were pulsed with 50 pl of ( 3H)thymidine (20 pCi /ml , Perkin-Elmer, Boston, M A ) 8 h before the end of the 72 h assay period. A l l conditions were performed in quadruplicate. 2.4.38 Treatment of D 2 C Mice with a Blocking a-Clonotypic mAb against the 2C TCR Shortly before weaning, 400 pg of the a-2C T C R I g G l m A b 1B2 (H. Eisen, MIT) , was administered by tail vein to pre-diseased D 2 C mice. Age-matched control animals received 400 pg of the isotype-matched control m A b T3.70 (eBioscience, San Diego CA)(n = 4 animals / group in each of 3 experiments). The 0.5 ml injections were delivered i.p. every 6 d and were not associated with any sign of distress. Animals were monitored daily for the development of disease and were photographed weekly. Following the treatment period, animals were sacrificed for necroscopic examination. 2.4.39 Purification and Adoptive Transfer of 2C DNTC D N T C were purified from the L N of 2-4 month old S2-S3 D 2 C donors as described above. 5x10 6 C D 6 9 + 2C cells in 0.5 ml P B S was administered by tail vein into irradiated (550 rads) D B A / 2 recipient mice. 63 2.4.40 Collection of Epidermal T Cells for Flow Cytometry Skin was shaved and treated with a depilatory cream (Nair, Church and Dwight Company Inc., Princeton, NJ) . Ful l thickness skin was removed, and vigorously scraped to remove subcutaneous fat. The skin was then incubated dermal side down in a solution of dispase type II (6 mg/ml, Roche Diagnostics, Indianapolis, IN) and 0.001% (w/v) D N A s e (Sigma) in P B S or a solution of C a + + - Mg + + -free P B S (1 m M E D T A , 1 m M D T T ) for one hour at 37°C [245]. The epidermis was then isolated using jewellers forceps and a disscecting microscope. The epidermal cells were disaggregated by vigorous pipetting in C a + + and M g + + free media and subsequent grinding through a steel sieve. The resulting single cell suspension was applied over a histopaque (Sigma) cushion and centrifuged to enrich for interface cutaneous IEL. 2.4.41 Collection of Epidermal Sheets for Quantitating the Density of Cutaneous IEL Skin from the indicated animals was shaved and treated with a depilatory cream. After vigourous scraping to remove subcutaneous fat the skin was floated dermal side down in a solution of ammonium thiocynate ( N H 4 S C N , Sigma) for 20 minutes at 37°C. The intact epidermis was isolated using jeweller's forceps and a dissecting microscope and transferred to a positively charged slide, dermal side up. Epidermal sheets were washed in P B S and fixed for 10 minutes in acetone at -20°C before being air-dried for one hour. Epidermal sheets from all mice were then stained with a biotinylated a -CD3 m A b (145.2C11, B D Pharmingen) by a standard immunhistochemical protocol as previously described. The average number of C D 3 + cells in ten, 40x microscopic fields of the epidermal sheets was determined using an Olympus B H - 2 microscope. 64 2.4.42 Croton Oil Administration Fur in the lower dorsal region was trimmed with scissors as close to the skin as possible without causing epidermal injury. A cotton swab was used to liberally apply a 2% croton oil in acetone solution over a 0.75 x 0.75 cm region of "trimmed", dorsal skin. Mice were observed daily for the development of erythema and cutaneous ulceration. Five days post-application, mice were euthanized and skin samples were collected for standard histological processing. 2.5 Data Reproducibility For all of the data presented herein, results are representative of at least 3 individual experiments. 2.6 Statistics Student's 2 tailed t tests were used for the statistical analysis of data. 65 Chapter 3: Pathological and Clinical Characterization of Cutaneous Disease 3.1 Introduction: Given Delaney et al.'s observation that disease in D 2 C mice was psoriasiform in nature [164], the first efforts on this model sought to characterize the spontaneous disease in these animals and to ascertain whether the pattern of cutaneous disease was indeed psoriasiform. Furthermore, the comparison of D 2 C disease features to those of known human psoriasiform entities was undertaken in order to address whether this novel animal model represented a reliable model of human disease. Interestingly, disease in D 2 C mice was indeed psoriasiform; however, rather than resembling psoriasis as described in an earlier report [164], disease was remarkable similar to SD. The impressive similarities in the natural history of murine D 2 C and human SD disease, as well as gross and microscopic pathology, provided the impetus to investigate the involvement of fungi in D 2 C disease pathogenesis. Similar to that seen in SD, an increased burden of fungi is present in lesional D2C skin and the treatment of these animals with antifungal agents can mitigate established disease. Molecular genotyping of the most frequent fungal isolate revealed this organism to be Candida guilliermondii, against which D 2 C mice were found to have high titers of serum IgG. Further studies demonstrated that, in addition to C. guilliermondii, there is an increased burden of, and an elevated titer of specific serum IgG to, other organisms on the skin of D 2 C mice, including gram positive cocci. The addition of wide spectrum antibiotic treatment to the antifungal regimen was even more efficacious at treating disease, although the concurrent administration of these agents was unable to completely abrogate the development of disease. The apparent susceptibility of D 2 C mice to infection suggested that immune defects from the D B A / 2 background controlled disease penetrance. To investigate this possibility, we 66 determined which inbred strains were susceptible to disease and the pattern of disease inheritance in backcrosses from disease-resistant to disease-susceptible backgrounds. The result of backcrossing studies suggested that as few as one gene or a closely linked group of genes was responsible for disease penetrance. To see i f this candidate factor was intrinsic to the hematopoietic system, bone marrow chimera studies were performed, the results of which suggested that the candidate susceptibility factor was not bone marrow derived as marrow from disease-resistant 2C mice could transfer disease to wi ld type D B A / 2 recipients. Since complement factor 5 (C5) deficiency has been associated with some forms of SD [210, 211], it was hypothesized that the known deficiency of C5 in D B A / 2 mice [243] was this non-hematopoietic defect. To address this possibility, a P C R / R F L P assay was used to correlate the C5 genotype with the penetrance of disease in (B6xDBA/2)N22C backcrosses. While the C5 mutation was found to modulate the disease phenotype, it was neither necessary nor sufficient for disease. Furthermore, the finding that both genetic influences as well as environmental factors, such as hygiene, influenced the severity of disease suggested that disease had a more complex mode of inheritance. The generation and characterization of the D 2 C model of psoriasiform disease represents an important advancement in the field of inflammatory skin disease as few spontaneous animal models with truly representative features are available to study the pathogenesis of psoriasiform disease. 3.2 Natura l His tory of Disease The expression of the 2C transgenic T cell receptor on the D B A / 2 genetic background (D2C) leads to the development of spontaneous inflammatory skin disease. Disease occurs around the time of sexual maturity (32-38 days) [245], 1-2 weeks after weaning, with males 67 tending to develop disease earlier and more severely than female siblings [123, 164]. The course of disease is chronic with periodic flares, corresponding to deteriorations in the hygienic state of the cage bedding [123]. Recovery from cutaneous disease begins at -70 days of age after which only subtle disease, i f any, persists [123]. After the establishment of remission, animals are resistant to recurrent disease [123]. Diseased mice are observed to scratch intensely at rostral skin, suggesting associated pruritus, though it has not been addressed whether this scratching is simply an epiphenomenon or whether it plays an active role in disease pathogenesis. 3.2.1 Gross Pathology of Disease Disease in D 2 C mice occurs in a distinctive distribution involving primarily the ears, rostrum and perineum. Although disease is often extremely inflammatory, only rarely does it extend beyond these "seborrheic areas" to cause generalized erythrodermic dermatitis [123]. The gross appearance of lesional skin is dependent upon the chronicity of disease. Acute disease invariably begins in the periocular region with ill-defined erythema [123]. This initial blepharitis is later accompanied by prominent periocular edema that typically results in entropion and pronounced serous exudate, which forms yellow-brown crusts that can seal the l id margins [123]. Rarely, purulent conjunctivitis can occur [123]. No vesicles or pustules are obviously present; however, occasional inflammatory papules can be appreciated [123]. Although acute skin disease initially has indistinct margins, the subsequent development of lesional alopecia sharply marginates disease (Fig. 8A) [123]. Ear disease is a prominent feature of acute pathology and can precede other grossly apparent signs of disease (Fig. 8B) [123], Ear pathology can become quite severe, resulting in large concretions of hyperkeratotic crusted debris occluding the external ear canal (Fig. 8C) [123]. Ear disease in these animals typically extends into the external auditory meatus, rather 68 Stage 0 Stage 1 ^0 Stage 2 Stage 3 0.6 C/5 </) CD ckn S 0.4 1 E r— 0.2 ro UJ D2C Figure 8. Gross Pathology of Disease D B A / 2 (A) D2C gross pathological changes were arbitrarily divided into 4 stages: stage 0, no disease; stage 1, minimal periocular disease; stage 2, major periocular swelling ± l id fusion with little contiguous spread to surrounding tissue; and stage 3, stage 2 features plus significant spread to contiguous tissue. (B) Pre-diseased 21-day old D2C mice and age matched D B A / 2 controls were assayed for ear thickness. The difference in ear thickness was found to be statistically significant (p < 0.05). (C) Ear disease in a S3 D 2 C mouse is shown. Note the concretion o f hyperkeratotic debris occluding the external auditory meatus. 69 than out from it, and rarely involves the entire length of the canal [123]. In more chronic lesions, the prominent swelling and serous crusting of acute disease are replaced by thickening of the skin and the appearance of fine white scale [123]. This lichenified appearance precedes convalescence, the onset of which is marked by a further reduction of swelling, the return of dermatoglyphic skin ridges, and the regrowth of hair [123]. To facilitate objective scoring of the disease course, cutaneous signs of disease have been arbitrarily divided into 4 stages: Stage 0 (SO), no disease; Stage 1 (SI), minimal periocular erythema and edema; Stage 2 (S2), major periocular swelling ± l id fusion with little contiguous spread to surrounding tissue; and Stage 3 (S3), S2 features plus significant spread to contiguous tissue (Fig. 8A) [123]. Intriguingly, the clinical findings in D 2 C mice are remarkably similar to those of the human psoriasiform condition SD. 3.2.2 Microscopic Pathology of Disease The microscopic features of D 2 C inflammatory skin disease are variable and dependent upon the clinical stage of disease [123]. Compared to normal murine skin (Fig. 9A) , lesional tissue from acutely affected animals is characterized by: neutrophilic abscesses within the follicles and contiguous epidermis (Fig. 9B); dilated vessels within edematous dermal papilla (Fig. 9C); and, spongiosis of the follicular infundibulum, adjacent to foci of follicular inflammation (Fig. 9C) [123]. The neutrophilic abscesses coalesce into mounds of pyknotic neutrophilic debris and, together with prominent globules of eosinophilic serum and compact parakeratotic squames, form the mound-like scale-crusts that are situated near the ostia of hair follicles (Fig. 9D, E) [123]. Chronic lesions, which clinically have a lichenified appearance, demonstrate epidermal thickening from the typical 1-2 cell layer thickness in normal murine skin (Fig. 9A) to greater than 10 cell layers, with finger-like projections of acanthotic epidermis 70 71 Figure 9. Microscopic Pathology of Disease (A) Normal epidermis (e) consists of 1-2 cell layers overlaying a non-inflamed dermis (d) containing plentiful adnexal structures (f = hair follicle; g = sebaceous gland). (B) The primary histological lesion is a neutrophilic abscess (na) in the superficial follicle (f). (C) Neutrophilic abscesses (na) are often situated adjacent to spongiotic (s) epidermis and edematous dermal papilla containing dilated blood vessels (v). (D) The neutrophilic abscesses (na) coalesce into perifollicular mounds (m) of pyknotic neutrophilic debris. (E) Sub-acute lesions are characterized by primary and secondary histological changes. Mounds of follicular debris (m) co-exist with acanthotic epidermis (a) and a multifocal coalescing inflammatory infiltrate (i) that is often concentrated around damaged follicles (*). (F) Chronically lesional skin is depleted of epidermal adnexa and has moderate acanthosis (a) coexisting with a dense dermal infiltrate (i). (F, G) Keratinacious debris (k) released from damaged adnexa is often present in the dermis of chronic lesions and is surrounded by a dense inflammatory infiltrate (i). (H) Ear pathology has similar histological features with mounds of debris (m) situated in a follicular distribution. (I) Acetone-fixed frozen tissue sections of D 2 C and D B A / 2 rostral skin were incubated with a rodent a -CD4 mAb (RM4-5). The HRP-labeled goat anti-mouse IgG and the Vector® Nova Red H R P immunohistochemistry kit were used to develop the staining. 72 extending into the dermis (Fig. 9E) [123]. A dense infiltrate of mixed inflammatory cells surrounding glands and hair follicles is another feature of chronic pathology (Fig. 9E-H). The extent of this pyogranulomatous inflammation is largely dependent upon the integrity of the adnexal structures since keratinacious debris released from damaged glands and follicles is often at the center of such inflammatory foci (Fig. 9E-H) [123]. Immunohistochemical staining of the skin reveals that the mixed inflammatory infiltrate of lesional skin contains a large number of T lymphocytes (Fig. 91), many of which express the CD4 co-receptor molecule. This histological pattern is most consistent with those findings seen in the human psoriasiform disorder SD which further supports the similarity between the D 2 C model and human SD. 3.3 Exploring the Role of Fungus in Disease Pathogenesis 3.3.1 Antifungal Staining of Diseased Skin Overgrowth with opportunistic basidiomycetes fungi of the Malassezia genus is a feature of SD pathophysiology [219]. Given the known susceptibility of D B A / 2 mice to fungal infection [246, 247] and the SD-like pathology of D 2 C mice, it was investigated whether fungal overgrowth is a feature of D 2 C disease pathogenesis. While no positively stained structures were apparent in non-lesional skin from diseased animals or from D B A / 2 controls (Fig. 10A), numerous small ovoid clustered structures, with pale centers, were consistently seen within the superficial layers of keratin and within neutrophilic abscesses of D 2 C lesional tissue (Fig. 10B-I) [123]. GMS-stained structures between orthokeratotic bundles of keratin are sometimes seen to invade into deeper levels of the epidermis (Fig. 10E-G) [123]. However, no dermal invasion or mycelial shift was appreciated in any of the lesional skin sections [123]. Although fungal overgrowth is a feature of SD, the habitat of these opportunistic fungal pathogens is often lost during tissue processing for microscopy. Normally the direct visualization of such overgrowth 73 Figure 10. Antifungal Staining of Lesional Skin (A) Non-lesional epidermis (e) does not stain with G M S ; however, G M S stains dermal connective tissue (c). (B) Finely speckled staining with G M S (*) is frequently observed in lesional epidermis and surrounding follicular abscesses (na). (C) High-powered views of lesional skin demonstrate small round G M S stained structures (*) in the epidermis below a hyperkeratotic (hk) mounds and (D) within neutrophilic abscesses (na). (E) Intact G M S stained structures (*) can be found between the orthokeratotic bundles of keratin within the stratum corneum and (F, G ) infrequently can be seen invading into deeper layers of the skin from this superficial local. (H, I) Small structures (*) clustered together around keratinocytes (k) from lesional skin also stain with P A S . Note the P A S positive globules of serum (g) within the neutrophilic abscess (na) and nascent scale-crusts. 74 involves staining skin scraping or transparent tape used to "desquamate" superficial layers of the epidermis [203]. The appreciation of this fungal overgrowth in D 2 C mice without these specialized techniques suggests that it is likely a very significant feature of this animal model. 3.3.2 Identification of Fungus from Lesional Tissue To address the significance of the positive fungal staining in D 2 C lesional skin, skin scrapings were obtained from lesional rostral and external auditory meatal skin as well as non-involved skin from both diseased and control mice. This material was plated on Sabouraud's dextrose agar, lipid-enriched Sabouraud's dextrose agar, Pityrosporum media I ( A T C C media #1072), and Pityrosporum media II ( A T C C media #1110), both with and without inhibitors (cyclohexamide and chloramphenicol) at 25°C, 37°C and 40°C. Fungi were only routinely recoverable from S3 D 2 C animals and approximately 90% of the isolated colonies were soft and round with a ruffled peripheral collarette and a central dimple. These smooth, glistening white-to-tan colonies developed a yellowish discoloration over time (Fig. 11 A ) . These colonies consisted of ellipsoidal yeast containing a single uni-polar, broad-based bud (Fig. 1 IB) . The aforementioned isolates grew on all media described above and showed no tendency to filament in vitro (Fig. 11C, D). Representative samples isolated from separate animals were characterized by standard morphological appearance, culture characteristics, and biochemical methods (Table 4). 75 Figure 1 1 . Isolation of Fungi from the Lesional Skin of Diseased D 2 C Mice Skin scrapings from D 2 C and D B A / 2 control mice were inoculated on lipid enriched Sabouraud's dextrose agar containing cyclohexamide and chloramphenicol at 37°C. Fungi were only routinely recoverable from S3 D2C animals. (A) Approximately 90% of the isolated colonies were round with a ruffled peripheral collarette and a central dimple. These colonies developed a yellowish discoloration over time. (B- 40x) These colonies consisted of ellipsoidal yeast containing broad-based, uni-polar buds. The yeasts showed no tendency to filament in vitro. (C - 40x, D- lOOx) Corresponding differential interference contrast (DIC) images of the yeasts. 76 Table 4 : Identification of the Fungal Isolates as Candida guilliermondii Identification Test Results . P A S Stain: Small bottle-shaped yeast cells Fatty Acids Required for Growth: None - growth on Sabouraud's dextrose agar Germ Tube: Negative Growth at 25°C: Positive Growth at 37°C: Positive Growth at 40°C: Positive Cyclohexamide Resistance: Positive Corn Meal Agar: N o Chlamydospores; N o Pseudohyphae Bi rd Seed Agar: Negative Vitek Yeast Biochemical card (VI303): Candida guilliermondii These data were consistent with the preliminary identification of these organisms as a Candida species rather than Malassezia, as good growth was seen at 25°C and the constricted junction between the bud and mother cell is more indicative of the Candida genus [248]. To further classify this common-most isolated organism, P C R amplification using the universal fungal primers ITS1 and ITS4 (Fig. 12) as well as ITS3 and ITS4 [236] resulted in bands of approximately 600 bp and 380 bp, respectively. Based upon the size of these amplicons, the lipid-independent species of Malassezia (M. pacyhdermatitis) was excluded since this organism yields products of 800 bp and 330 bp with these primer pairs, respectively [236]. Based upon published amplicon sizes using both sets of these primers, the closest match of amplicon sizes were with Candida guilliermondii (603/378) and Pichia anomala (615/375). To definitively identify this isolate, the ITS region was amplified and sequenced to reveal 100% identity with Candida guilliermondii (Table 5). 77 ITS1 iiriiiini - > IT33 Mtiiici 5 S S rC.hA 26S fOHA ITS1 ITSS B 800 bp 600 bp 400 bp 200 bp 100 bp ITS4 primer > / F i g u r e 1 2 . P C R A m p l i f i c a t i o n o f the I T S R e g i o n o f the U n k n o w n F u n g a l Isolate ( A ) The ITS1-ITS4 primer pair amplifies the intervening 5.8S r D N A sequence and the adjacent ITS1 and ITS2 regions while the ITS3-ITS4 primer pair amplifies a large portion of the 5.8S r D N A sequence and the adjacent ITS2 region [236]. (B ) D N A was obtained from the common-most cutaneous isolate from D 2 C mice, identified as Candida guilliermondii by the Vitek Y B C , and from a known Malassezia pachydermatis isolate. Purified M. pachydermatis D N A was also obtained from A T C C . D N A samples were amplified using the universal fungal primers ITS1 and ITS4. The sizes of the resultant amplicons were compared with the known sizes of these fragments in various fungal species [236]. 78 T a b l e 5. I T S Sequence D a t a o f the F u n g a l Isolate Unknown sample Known Candida i 518 atacwagaaatatcccgccacaccattcaacgagttgciaeaaaectaatacattgagagg 6 0 I I I I I I I I I I I I I I I I I I I I I I1 I I I I I I I I I I IMMI1I I I I I I I I I I I I I I I I I I I ! ataccagaaatatcccgccacaccat tcaacgagt tggataaacctaatacat tgagagg guilliermondii 61 ecgacagcac ta tc tag tac tacccatgccaatac t t t t caagcaaacgcc tagtccgac 458 l l l l l l l l l l l l l l l l l l l l l l i m i l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l t cgacagcac ta tc tag tac taccca tgccaa tac t t t t caagcaaacgcc tag tccgac 121 taagagtatcactcaataccaaacccgggggtttgagagagaaatgacgctcaaacaggc 398 l l l l l M I N I M I I I I I I M I i l l l l l l l l l l l i l f i M U M ! I IMI IM M i l l ! taagagtatcactcaat.accaaacocgggggtttgagagagaaatgacgcteaaacaggc 181 atgecctct .ggaataccagagggcgcaatgtgcgttcaaagattcgatgattcacgaaaa 338 1111111111111111111111111M i 1111111111111 < 11 i 111111111111111 atgccctctggaataccagagggcgcaatgtgcgtecaaagattcgatgattcacgaaaa 241 Cctgcaat tca ta t tac t ta tcgcac . t t cgc tgcg t t c t t ca tcgacgcgagaaccaaga 278 II1IIII1M M11II1IIIIIIIIIIII111M1II1 II II IIII II 1 II 1 II II 1 II 1 t c tgcaat teat aCtac t ta tcgcaC. t t cgc tgcg t tc t t oat cgaCgcgagaaccaaga 301 g a t c c g t t g t t g a a a g t t t t g a a g a t t a a t t c a a a a t t t g a c t a a c t g t a a a a a t a a t t a 218 M i l l I IMI IM I IMI IM 111111111111111111! 11111111 M 1111111111 g a t c c g t t g t t g a a a g t t t t g a a g a t t a a t t c a a a a t t t g a c t a a c t g t a a a a a t a a t t a 361 aat tgcg t t t tg t taaacc tc tggcccaaccca tc tc taggccaaaccaaagcaaga 417 158 1II IE 1II111 M 1II1II111111M1IIII111M111II11II111II111111 aat tg tg t t t tg t taaacc tc tggcccaacc ta tc tc taggccaaaccaaagcaaga 102 Identification: Candida guilliermondii (417/417; 100% identity) Candida spp. have long been considered opportunistic pathogens and C. guilliermondii has been implicated in several human diseases [249-252], including cutaneous candidiasis [253]. Furthermore, C guilliermondii has been shown to cause cutaneous candidiasis in veterinary populations [254]. Moreover, some forms of SD may also be attributable to the overgrowth of Candida spp. and thus these organisms may have relevance for human psoriasiform disease [205, 255, 256]. Interestingly, Malassezia spp. have not previously been isolated from rodents [257], 79 and thus the failure to isolate these commensal organisms from the skin of D 2 C mice may reflect their genuine inability to colonize murine skin. Given the possible failure of Malassezia spp. to colonize rodent skin, it is possible that other organisms may contribute to the induction of psoriasiform pathology in rodentia. Nevertheless, the unique distribution of disease and the clinical and histological similarities to Ma/ossez/a-associated conditions suggested that the commonly isolated Candida guilliermondii may not have been the pathogenic organism. To ascertain whether other fungal species were present on the skin, an attempt was made to amplify the ITS sequence from paraffin-embedded lesional tissue; however, no fungal-specific sequences were amplified by this methodology (data not shown). Although this data is consistent with the absence of other fungal pathogens on the skin, the failure to amplify the C. guilliermondii ITS sequence argues that technical difficulties with this assay precluded the investigation of this question. Future studies using this assay to amplify the ITS sequence from fresh unprocessed tissue could help to clarify this question further; and, therefore, the current results have not completely ruled out the possibility that Malassezia fungi are present in these animals and have a role in disease pathophysiology. To assess the significance of the overgrowth of C. guilliermondii seen in D 2 C mice and to see i f this opportunistic pathogen overgrowth had elicited an immune response, D 2 C mice at different stages of disease were assayed for fungal-specific serum IgG using a standard E L I S A protocol with fungal cells used as the capture reagent [242]. These data demonstrated that severely diseased (S3) D 2 C mice had a 4,100-fold elevation in the level of fungal specific IgG relative to age matched D B A / 2 control mice (Fig. 13 A ) . Furthermore, analysis of fungal A b titers in D 2 C mice at various stages of disease revealed that the titer of fungal-specific serum IgG positively correlated with the degree of cutaneous pathology (Fig. 13B). 80 A 0.20 n m S O o 0.15 J 0.10 J 0.05 J 1 1 1 DBA/2 (B6xDBA/2) N ,2C S3 D2C Convalescent D2C 0.25 0.20 B .o* H <«*• 0.10 C: m o 0.1,5 0.05 • • • t • S1 S2 S3 D2C Stage of Disease Convalescent F i g u r e 13. F u n g a l - S p e c i f i c I g G a n d R e l a t i o n s h i p to Disease A c t i v i t y ( A ) Serum was collected from tail vein blood from the indicated animals. Immulon E L I S A plates were coated with a l x l 0 7 cells/ml concentration of pure Candida guilliermondii suspended in carbonate buffer. Serum dilutions were incubated and bound-IgG was detected with alkaline phosphatase (AP) conjugated, goat ct-mouse IgG and the A P substrate p-nitrophenyl phosphate (n = 10 animals per group). (B ) Candida guilliermondii-specific serum IgG was detected as described above for D 2 C mice at various stages of disease pathogenesis. 81 3.3.3 Effect of Antifungal Treatment on Established Cutaneous Pathology The presence of fungal material in the primary histological lesion of D 2 C histopathology suggested that fungi might be playing an active role in disease pathogenesis. Imidazole antifungal agents have excellent activity in the skin [258] and fluconazole has been shown to be highly effective in the treatment of SD and related Malassezia associated conditions [203, 204, 217], as well as murine Candidiasis [259]. Moreover, pure cultures of C. guilliermondii isolated from the lesional skin of D 2 C mice were inhibited with discs impregnanted with a 2 mg/ml solution of fluconazole (data not shown). To see whether the D 2 C disease phenotype could be mitigated by the administration of fluconazole, severely diseased D 2 C mice were randomly divided into two groups for treatment with either fluconazole or a vehicle control. Using an established dosing strategy for azole-responsive murine fungal infections [259], the majority of clinical disease in S3 animals was reversed after a nine day course of fluconazole (Fig. 14A, B) [123]. The condition of PBS-treated animals remained unchanged or deteriorated (Fig. 14A, B) [123]. Importantly, the clinical resolution of disease in fluconazole-treated animals was associated with the mitigation of the typical D 2 C histological changes and a reduction of P A S staining in tissue sections taken from previously lesional skin (Fig. 14C) [123]. 3.3.4 Effect of Antimicrobial Treatment on the Suppression of Cutaneous Pathology To see whether antifungal therapy could abrogate the development of the D 2 C disease phenotype, fluconazole was administered to prediseased D 2 C mice beginning at 10 days of age (Fig. 15A). Interestingly, while disease appeared to be kinetically-impaired and less inflammatory than disease in PBS-treated D2C mice, some fluconazole treated animals still developed the full disease phenotype (SO = 20%; SI = 30%; S2 = 30%; S3 = 20%). Rostral skin from these animals appeared to be less inflamed and had less alopecia than littermate P B S -82 o N < CO CO CL B (/) CO CD Day 0 Day 3 * • 4 S r j i o m t i v • • • • H K M H H H B H Day 6 Day 9 100 80 60 40 20 a • • " P B S • • A z o l e i A r 0 3 6 Days H&E P A S Figure 14. Treatment of Diseased D 2 C M i c e with Antifungal Medicat ion (A) Acutely i l l (S3) D2C mice with severe pathological changes were treated for 10 days with PBS or fluconazole (azole). (B) Recovery of mice was monitored over the 10-day treatment period. Mice were considered to be disease-free when hair regrowth began over lesional rostral skin. (C) Representative histological sections stained with H & E and P A S are shown. Note the punctuate epidermal P A S staining (*) in the P B S control skin, which underlies a large mound of debris (m) that also stains prominently with PAS due to the inclusion of serum. S3 A PBS Fluconazole Fluconazole + Levofloxacin PBS Azole Azole+ DBA/2 D2C Levofloxacin Figure 15. Treatment of Pre-Diseased D 2 C M i c e wi th Ant imic rob ia l Agents (A) Pre-diseased 10-day old D 2 C mice received daily i.p. injections of P B S , fluconazole (azole) or a combination of fluconazole and levofloxacin for a period of 3 weeks. Mice were monitored during the treatment period for the development of disease. Representative photographs and histological sections stained with H & E are shown. (B) The effectiveness of the treatments at preventing disease was quantified by observing and grading resultant pathology (n=5 animals per treatment group). (C) Immulon E L I S A plates were coated with gram positive cocci (GPC) isolated from lesional D 2 C skin. Serum dilutions from the indicated mice were incubated and bound IgG was detected with alkaline phosphatase (AP) conjugated, goat a-mouse IgG and the A P substrate p-nitrophenyl phosphate (n=5 animals per group). 84 control animals (Fig. 15 A , B) , suggesting that the elimination of fungi was important for halting the progression to a more severe disease phenotype. Current dogma about cutaneous fungi in SD holds that inflammation directed against the causative microorganism is most severe after the initiation of dermatitis [204]. Consistent with this current understanding, the highest titers of Candida-specific IgG in D 2 C mice occurs during peak symptomatology (S3) (Fig. 13B). The reduced titer of fungal specific serum IgG in convalescent D 2 C animals (Fig. 13B), likely reflected the ability of an intact epithelial barrier to preclude the invasion of opportunistic pathogens, and the subsequent immunization with microbial A g . Another explanation for the failure of antifungal medication to completely abrogate the development of disease is the development of fluconazole-resistance. Consistent with this possibility, P A S stained histological sections from long-term fluconazole treated animals sometimes reveals PAS-positive structures within lesional tissue, suggesting that animals were re-colonized with antifungal-resistant strains or new fungal organisms with intrinsic resistance (data not shown). The emergence of azole-resistant Candida spp. after long-term treatment is a significant problem in clinical medicine and fluconazole has been shown to increase resistance in Candida spp. by a variety of mechanisms [260, 261]. The addition of further anti-fungal agents to fluconazole treated mice may therefore have an additive effect on suppressing the disease phenotype. It is also known that there is a marked increase of Staphylococci spp. in lesional skin of SD patients [207, 242, 262] and that Staphylococci species have a synergistic relationship with cutaneous fungi [263, 264]. Consistent with these findings in SD patients, lesional skin from D 2 C mice was found to have a greater burden of clustered gram-positive cocci, presumably of the Staphylococci spp. (data not shown), and a greatly increased titer of serum IgG against these organisms (Fig. 15C) relative to non-transgenic D B A / 2 control mice . 85 To address whether a reduced burden of both cutaneous fungi and bacteria would be adequate to protect against the development of spontaneous disease, both fluconazole and levofloxacin were administered to pre-diseased D 2 C animals (Fig. 15A, B) . Levofloxacin, the optically active form of ofloxacin, is a broad spectrum fluoroquinolone antibiotic with activity against most gram positive and gram negative bacteria, and is not associated with the emergence of resistant staphylococci organisms as seen with other fluoroquinolones [265]. Relative to animals treated with fluconazole alone, these mice had a slightly less severe disease phenotype (SO = 20%; SI = 40%; S2 = 40%; S3 = 0%) but were still capable of developing moderate pathology (Fig. 15A, B) . However, the failure to eliminate all organisms may explain the inability of combined fluconazole/levofloxacin therapy to suppress the development of disease. For example, the addition of levofloxacin to the fluconazole treatment regimen does not address the development of azole-resistant fungal pathogens. Moreover, while the combination of fluconazole and levofloxacin cover a wide spectrum of microorganisms, the addition of further broad-spectrum agents, to both target "uncovered" organisms and reduce the development of resistance, may be sufficient to abrogate the development of disease. Therefore, while the possibility that microorganisms initiate disease cannot be completely excluded by this data, the development of germ-free D 2 C mice would unequivocally address the role of microorganisms in disease initiation. 3.4 Exploring Genetic Influences on Disease Penetrance 3.4.1 Pattern of Inheritance and Strain Susceptibility To investigate the genetic susceptibility factors that predispose to disease, the 2C T C R transgenes were backcrossed to various H - 2 b - and H - 2 d -expressing inbred strains. B 6 b 2C (B2C b ) , H - 2 d congenic B 6 d 2C (B2C d ) , ( B 6 b x D B A / 2 ) N i 2 C b / d , and ( B 6 d x D B A / 2 ) N , 2 C d animals 86 were found to be resistant to disease while B A L B / c 2C (H-2 d) mice developed a mitigated disease phenotype (< 50% of B A L B / c 2C mice have clinical disease, n=10) (Fig. 16) [123]. Previously, the 2C transgenes were backcrossed to the H-2 d-expressing B 6 x D B A / 2 ( B X D ) recombinant inbred (RI) strains [164]. It was found that B X D RI strains 1, 5, 6, 9, 11, 16, 18, 22, 24, 25, 30, and 31 developed disease whereas strains 12, 27, and 30 were resistant to transgene-mediated pathology (Table 1) [164]. To further evaluate the contribution of the D B A / 2 genetic background to disease development, the frequency and severity of disease development in successive backcrosses from the B6 to the D B A / 2 background was determined. While B 6 b and ( B 6 b x D B A / 2 ) N , 2 C b / d ( N i 2 C ) mice are resistant to disease (n > 100), approximately 50% of N 2 2 C (n = 50) animals, and 100% of N 3 2 C (n = 25) and further D B A / 2 2C backcrosses, develop variable degrees of spontaneous cutaneous pathology (Fig. 17) [123]. While only 2C T C R -expressing animals develop disease, there was no difference in the incidence or severity of disease in H - 2 b / d and H - 2 d / d N2 D B A / 2 2C backcrosses, indicating that an increased dose of the cognate A g is not a factor in disease pathogenesis (data not shown) [123]. The extent of disease in successive backcrosses to the D B A / 2 genetic background became progressively worse, up to approximately the 4 t h backcross generation at which point the typical D 2 C pattern of disease penetrance was established (Fig. 17) [123]. This pattern of inheritance is consistent with as few as one susceptibility factor, or a group of closely linked genes, controlling disease penetrance. 3.4.2 Adoptive Transfer of Disease To determine whether the D B A / 2 susceptibility factor(s) were of hematopoietic origin, T cell depleted bone marrow from D 2 C mice was adoptively transferred to lethally irradiated non-transgenic B 6 d recipients. Interestingly, none of these recipient mice developed gross pathological changes or histological evidence of disease (Fig. 18A, B) [123]. To ensure that the 87 B 2 C d B 2 C b Figure 16. Strain Susceptibility B6 2C (B2C b ) , B6 H - 2 d congenic 2C ( B 2 C d ) , and ( B 6 x D B A / 2 ) N i 2 C b / d (N , 2 C ) mice are resistant to disease. B A L B / c 2C mice develop a mitigated form of disease with low penetrance. 88 Figure 17. Backcross Analysis of Disease Penetrance Disease incidence and severity was monitored in successive backcrosses of the 2C T C R transgenes from the B6 background (B2C b ) to the D B A / 2 background (D2C). 89 A D 2 C -» B 6 d B M C B 2 C d ^ D B A / 2 B M C B Figure 18. Adoptive Transfer of Disease with Bone M a r r o w (A) Bone marrow from pre-diseased D2C animals was adoptively transferred to lethally irradiated, non-transgenic B 6 d recipients while bone marrow from B 2 C d animals was adoptively transferred to lethally rradiated non-transgenic D B A / 2 recipients. Representative gross and microscopic anatomy of the rostral skin is shown. Data is representative of 20 animals analyzed per group. (B) Graphical demonstration of disease development in the resultant bone marrow chimeras ( B M C ) . 90 recipient's hematopoietic systems were in fact donor-derived, ( B 6 b x D B A / 2 ) N i b / d mice were also used as recipients. Upon reconstitution, ( B 6 b x D B A / 2 ) N i b / d recipients circulating peripheral blood lymphocytes fail to stain with the anti-H-2 b mAb HB51 indicating that the recipient hematopoietic system had been replaced by the donor graft [123]. These results indicated that the D B A / 2 defect(s) could be non-hematopoietic and that disease might be transferred to non-transgenic D B A / 2 recipients with marrow from disease-resistant B 2 C d mice. Strikingly 100% of the D B A / 2 recipients of B 2 C d bone marrow developed the disease phenotype with gross and microscopic features indistinguishable to those of D 2 C mice (Fig. 18A, B) [123]. However, the penetrance and severity of disease in these bone marrow chimeras ( B M C ) was slightly less (SO = 0%; SI = 40%; S2 = 35%; S3 = 25%) than in unmanipulated D 2 C mice, indicating that some D B A / 2 hematopoietic factors may have a role in pathogenesis [123]. However, the increased age of the bone marrow recipients may have also modulated the degree of disease severity since the age of disease development in these animals was greater than the age that natural disease occurs in "wild-type" D 2 C mice. 3.4.3 D B A / 2 C o m p l e m e n t F a c t o r 5 Defects a n d Disease The striking resemblance between D 2 C and human SD pathology [123] and the known role of complement deficiency in some forms of SD suggested that the natural deficiency in the fifth component of complement (C5) in D B A / 2 mice [243], which is known to predispose to fungal infections [246, 247], might play a role in D 2 C disease pathogenesis. The mitigated phenotype observed in C5-sufficient B A L B / c 2C (H-2 d) mice [123] provided further support for this hypothesis. To test this possibility, a P C R - R F L P based assay was used to determine i f the segregation pattern of the deficient D B A / 2 C5 allele was similar to the pattern of disease inheritance in (B6xDBA/2)N22C backcrosses (Fig. 19A). This analysis revealed that C 5 -91 Q 100%-80%-60%-40% -20% -C5 HIND III C5 + / - C5"7-F i g u r e 19. Ef fec t o f the D B A / 2 C 5 M u t a t i o n on the Disease P h e n o t y p e i n N 2 2 C backcrosses to the D B A / 2 b a c k g r o u n d ( A ) A 328-330 bp sequence of the C5 (5 t h component of complement) gene encompassing a polymorphic H I N D III restriction site was amplified from B6 (C5 + / + ) , ( B 6 x D B A / 2 ) N , (C5 + /"), and D B A / 2 mice (CS'^and subsequently digested with H I N D III. C 5 + / + mice have a 211 and a 119 bp band while C5"~ mice have a single 328 bp band. C5 + / " mice possess all three bands. (B ) N 2 2 C backcrosses to the D B A / 2 background were genotyped by the above mentioned approach for C5 sufficiency. These results were compared to the extent of clinical disease in these animals to ascertain whether C5 deficiency was associated with a worse disease phenotype in N 2 2 C backcrosses. 92 deficient (C5"") N 2 2 C animals had a slightly worse phenotype relative to C5-sufficient animals, suggesting that C5 deficiency may modulate disease expression (Fig. 19B) [123]. However, several C5 sufficient N 2 2 C mice developed advanced pathology and many N 2 2 C mice homozygous for the defective D B A / 2 copy of the C5 gene were completely asymptomatic (Fig. 19B), demonstrating that this defect is neither necessary nor sufficient for disease [123]. 3.5 Conclusion The histological and gross pathological findings in D 2 C mice are strikingly similar to those observed in human seborrheic dermatitis but not human psoriasis [123, 165]. Although the initial work on this model suggested that one, or a closely linked group of non-hematopoietic genes, may control disease penetrance, it became clear with further experimentation that multiple genetic and environmental influences probably play a role in disease pathogenesis. Similarly, while the bone marrow transfer experiments isolated the suspected D B A / 2 defect to the non-hematopoietic compartment, the reduced severity of disease seen in B 2 C d -» D B A / 2 B M C may indicate that some of the D B A / 2 factors affecting disease penetrance may in fact be hematopoietic. Multiple candidate gene loci were investigated in an attempt to understand the pathophysiology of disease. The finding that the known D B A / 2 deficiency in C5 was a factor contributing to disease pathogenesis was not unexpected as defects in human C5 are associated with a severe inflammatory form of SD termed Leiner's disease [210, 211]. Furthermore, studies on lesional skin from SD patients have demonstrated the deposition of complement around Malassezia [219]. Complement is known to be important in the defense against fungi as both the classical and alternate pathways are activated to opsonize fungal pathogens [1, 266]. Serum antibody and mannan-binding lectin, which is directed against fungal cell wall determinants, can 93 both initiate the classical complement cascade [1, 266]. The absence of sialic acid on fungal cell wall zymosan also promotes the precipitation of spontaneously formed C3b which initiates the alternate complement cascade [1, 267-272]. These pathways of complement activation converge at the production of C3b, which promotes opsonization and serves as a nidus for further complement activation, namely formation of the C5 convertase complex [1]. These pathways also result in the generation of the anaphylatoxins C3a and C5a [1] and it has been shown that fungi in the stratum corneum increase vascular permeability, as well as promote the trans-epidermal chemotaxis, adherence and degranulation of leukocytes by generating C5a [266, 273]. The activation of complement also results in the generation of the M A C which forms transmembrane channels on the target membrane, resulting in target cell lysis [1]. Not surprisingly, deficiencies in complement predispose towards fungal infections, explaining the infectious susceptibility of C 5-deficient D B A / 2 mice to fungal pathogens [246, 247]. While the D B A / 2 defect in complement was found only to modulate disease severity, it is likely that this defect contributed to the overgrowth of cutaneous fungal pathogens which is a component of disease pathophysiology. Several other candidate genes were also explored but were not found to predispose to disease. For example, comparison of the pattern of disease penetrance in 2C-expressing B X D d RI strains with the approximately 1,650 chromosomal markers that are fully genotyped between the B X D strains [274, 275] revealed a candidate locus controlling disease penetrance at position 16.4 c M of chromosome 17. Situated within this chromosomal region is the gene for the anti-apoptotic serine threonine kinase, Pim-1 [275, 276]. Interestingly, the phenotype of Pirn-1 K O mice [277] is similar to the known phenotypic abnormalities of the D B A / 2 inbred strain [278], including microcytic anemia and no grossly apparent immune defects. Moreover, restriction-fragment length polymorphisms exist between P im-1 d B6 mice and P im-1 b B A L B / c and D B A / 2 94 mice [276], and D B A / 2 CD8 cells were found to have a severe impairment of cell survival relative to B6 cells following T C R stimulation (data not shown). However, no difference in the level of the Pim-1 protein or the downstream anti-apoptotic molecule bcl2 was identified between B6 and D B A / 2 C D 8 cells in this assay (data not shown), thereby casting doubt upon the possible involvement of this factor in disease pathogenesis. Another candidate locus that was investigated for possible involvement in the D 2 C model is the known defects within portions of the D B A / 2 " N K complex" on murine chromosome 6 [279, 280] which encodes numerous receptors involved in "tuning" the activation threshold of N K cells and T lymphocytes [281]. Given Delaney's observation that in certain B X D 2C mice the self-reactive, 2C TCR-expressing D N T C were acutely activated [164], it was explored whether defects in these N K receptors resulted in the reactivation of these anergized cells thereby contributing to disease pathogenesis. 2C T C R + cells in cognate Ag-expressing backgrounds upregulate inhibitory receptors (data not shown), presumably to adjust their activation status following chronic exposure to self-antigen, and therefore deficiencies of these inhibitory receptors might predispose to T cell mediated autoimmune disease. Nevertheless, the penetrance of disease in (B6xDBA/2)N22C backcrosses to the D B A / 2 background did not correlate with the loss of expression of these receptors as assayed by flow cytometry using the a - N K l . l m A b PK136, demonstrating that the deletion of the N K complex was neither necessary nor sufficient for the full disease phenotype (data not shown). The data presented herein clearly demonstrates that opportunistic pathogens play a significant role in propagating disease pathogenesis and that the deficiency in C5 (Fig. 19) and other unknown genetic factors, which likely have a role in microbial defence, increases the susceptibility of D 2 C mice to disease. These findings are consistent with the observation that less sanitary conditions are correlated with more severe disease in these animals [123]. While the 95 data thus far suggests that the involvement of opportunistic pathogens in disease pathogenesis occurs after the disruption of the cutaneous barrier, the development of massive titers of a-fungal A b preceding disease convalescence (Fig. 13) may indicate that the development of protective humoral immunity may contribute to disease remission. It is known that the inflammatory SD occurring in the context of Leiner's disease happens in the 2 n d to 4 t h month of life [210, 211], during the physiological window of hypogammaglobulinemia when maternal IgG levels drop below a critical protective level [282, 283]. Remission in these children, which occurs as a result of maturation of humoral immunity [210], is analogous to the development of pathogen specific humoral immunity in D 2 C mice (Fig. 13). Moreover cell-mediated immunity has a known role in the defense against superficial fungal infections [284, 285] and the high incidence of SD in H I V patients [169, 170, 206] suggests that T cell adaptive immunity maintains opportunistic pathogens in a commensal state . Although the frequency of opportunistic pathogen-specific T cells has not yet been determined in D 2 C mice, the finding of massive numbers of C D 4 T cells in the dermis of lesional skin (Fig. 9) suggests that cell-mediated immunity against opportunistic pathogens is important in this model system. It was therefore hypothesized that pre-diseased D 2 C mice possess deficits in immune function that, together with environmental and additional genetic factors, predispose to opportunistic infection and the D 2 C phenotype. Furthermore, the onset of convalescence in these animals may be associated with the maturation of immune function or the induction of compensatory immune mechanisms. These possibilities provided the impetus to study whether disease pathophysiology of the D 2 C mouse involved profound immunodeficiency including immunocompromising effects of T C R transgenesis. 96 Chapter 4: Immunosuppression and Immune Repertoire Perturbation 4.1 Introduction Based on the established role of infection in D 2 C pathophysiology, it was hypothesized that immunocompromise induced by the strongly negatively-selecting 2C system synergized with D B A / 2 genetic defects and environmental conditions to cause the D 2 C phenotype. To first address this hypothesis, we gauged the extent of immunocompromise in pre-diseased D 2 C mice by quantifying T cell subsets and by vaccinating with a T cell-dependent antigen. These results demonstrated that D 2 C mice are remarkably immunocompromised with a severe lymphopenia and major repertoire skewing of T cells [123]. A profound humoral immunocompromise was found to coexist with dysregulated B cell functioning in these mice [123], despite a quantitatively normal B cell compartment [164]. These immunological impairments are similar to changes seen in human A I D S and, interestingly, D 2 C mice were found to possess additional pathological changes [123] frequently observed in A I D S such as lymphoid organomegaly, gastrointestinal dysfunction, and hypergammaglobulinemia [286, 287]. Serial T cell immunophenotyping of D 2 C mice revealed that active disease is associated with a massive expansion of CD4 T cells and disease convalescence was found to spontaneously occur when the concentration of C D 4 T cells reached a critical threshold level [123] . This threshold level of circulating C D 4 T cells is remarkably similar to the C D 4 count at which A I D S patients become susceptible to SD [208]. It was therefore hypothesized that restoration of the C D 4 compartment would protect D 2 C mice from disease. Consistent with this belief, D 2 C recipients of syngeneic D B A / 2 C D 4 + T cells were found to be resistant to development of disease and fully capable of mounting a humoral immune response [123]. To see i f the provision of T cell help to make protective antibody was the mechanism of disease protection, pre-diseased D 2 C mice were passively immunized with serum from severely diseased D 2 C animals that are known to contain 97 high titers of opportunistic pathogen-specific antibodies. However, this treatment was found to provide only marginal protection, and therefore it was hypothesized that the mechanism by which transferred C D 4 + cells protected against disease was the restoration of T cell immunoregulation by the provision of C D 4 + C D 2 5 + T r e g cells. This hypothesis was substantiated by fractionated C D 4 + T cell transfer experiments where purified T r e g were found to abrogate the disease phenotype without restoring humoral immune function. Whereas, while purified C D 4 + C D 2 5 " cells were able to correct humoral dysfunction, these cells actually exacerbated the disease phenotype. The obvious similarities between the D 2 C model and FoxP3-deficient mice warranted a further comparison of these model systems, which revealed that the cutaneous pathology in FoxP3-deficient mice was psoriasiform in nature and that D 2 C mice shared additional phenotypic changes with FoxP3-deficient mice, including the presence of circulating auto-antibodies and glomerulonephritis. Given the important role of dysregulated C D 4 + C D 2 5 " T cell expansion resulting from a lymphopenia of T r e g in disease pathogenesis, it was theorized that the treatment with corticosteroids would abrogate disease due to the effect of these drugs on inhibiting C D 4 + C D 2 5 " T cell signalling and cytokine production [288, 289] while augmenting T r e g functioning [289]. Not surprisingly, it was found that treatment with the corticosteroid dexamethasone (Dex) had essentially the same effect as the transfer of purified T r e g , further supporting the hypothesis that the lymphopenia of this specialized T cell population has a paramount role in D 2 C disease pathogenesis. 98 4.2 Characterization of Immune Function in D2C Mice 4.2.1 Quantification of Thymocytes and T Cell Subsets In D2C Mice The expression of the 2C T C R in the H-2 d-expressing D B A / 2 background induces a massive central deletion that results in a 10-fold reduction in the total number of thymocytes (3 .8xl0 6 vs. 3 .8xl0 7 , p < .05) and a 500-fold reduction in D P thymocytes (6 .1xl0 4 vs. 3 .2xl0 7 , p < .05) compared to D B A / 2 controls (Fig. 20A) [123]. The D 2 C thymus was also characterized by a marked reduction of C D 8 + and C D 4 + SP cells relative to non-transgenic controls (Fig. 20A) [123]. A peripheral T cell lymphopenia in D 2 C mice reflects the negatively selecting thymic environment with a 5-30-fold reduction in total lymphoid C D 4 + T cells accompanying a 10-20-fold reduction in total lymphoid C D 8 + T cells (Fig. 20B) [123]. These peripheral T cell anomalies seem to reflect a reduced thymic output of mature T cells as this lymphopenia is most pronounced in younger mice [123]. To see i f the forced expression of the 2C T C R transgenes affected the T cell diversity in these animals, D 2 C and age-matched D B A / 2 mice were assayed for T C R p chain usage. Although all developing T lymphocytes are forced to express the ajg and Prg chains in T C R Tg mice, recombination of endogenous T C R chain genes results in the development of non-Tg T cells. DP thymocytes expressing the Tg T C R may give rise to non-Tg T cells either by the rearrangement of endogenous T C R a chain genes, forming an endogenous T C R a chain that pairs with the pT g chain [82], or following the deletion of both the ayg and P i g T C R transgenes and the subsequent rearrangement of endogenous T C R chain genes [111]. The small population of D P thymocytes in which this later phenomenon occurs is unrestricted in its capacity to use T C R a and P chain gene segments. Therefore C D 4 + cells in 2C mice would be predicted to be both positive and negative for the 2C T C R V P chain (Vp8.2). Not surprisingly, significant numbers of C D 4 + cells utilizing the V p 2 , V p 4 , Vp8.2, Vp8.3 , VB10.5, V p l 3 , and V p l 4 T C R p 99 A. Z3 B. Q O ! £ C. 100% n O 80% -I + 3 60% ^ o o v 40% o> m c § 20% -I Qi Q. DBA/2 8 8 % i f . y • * • . • . i • '•• * 1—i i I I IH |—i i ma|—i i ma | — i i i n * | CD8 42%; 2 6 % . f _ D2C Q O 3% • " i v 1 : " -•.v»\H_l I ' I ' I I K S 1 "1 CD8 * CD8 1 r T l BBL 6%. -3 % CD8 • DBA/2 (10 days ) • D2C (10 d ay s ) Vp 2 V p 4 Vf^ 8.2 Vp 8 3 V p 10 5 Vp 13 Vp 14 Figure 2 0 . Evaluat ion for Lymphopenia and T C R Repertoire Skewing in D 2 C M i c e (A, B) Thymi and lymph nodes were collected from the indicated animals. Single cell preps, made from the harvested organs, were stained as shown and analyzed by flow cytometry. Dot plots are gated on live cells. (C) The spleen was collected from 10-day old D2C and D B A / 2 mice and evaluated for V p T C R chain expression by C D 4 + T cells using FACS®. The percentage of the total C D 4 + T cell count expressing each of the seven V P T C R chains utilized by D B A / 2 mice is shown. 100 chains, which are not clonally eliminated due to the proviral inserts of mouse mammary tumor virus (Mtv) strains in the D B A / 2 genome [290, 291], were identified in D B A / 2 mice of all ages, including 10-day old pups (Fig. 20C). However, the V p analysis of C D 4 + cells from 10-day old D 2 C mice detected the expression of few V P chains with 88% + 13% of cells found to be V p 8 . 2 + , indicating significant repertoire skewing (Fig. 20C). These data clearly demonstrate that T cell lymphopenia and significant T C R repertoire skewing occur as a result of T C R transgenesis in D 2 C mice. To see i f these effects had important consequences, the physiological significance of these changes became the next focus of this work. 4.2.2 Assaying T Cell-Dependent H u m o r a l Immune Function The colonization of D2C mice by an increased density of opportunistic pathogens (Fig. 10) suggested that the aforementioned T cell lymphopenia and repertoire skewing had important effects on immune function. As B cell development in D 2 C mice is not obviously perturbed [164], immunization with T cell-dependent A g assays for the frequency of Ag-specific T lymphocytes. To address whether the T cell lymphopenia and repertoire skewing observed in D 2 C mice resulted in a physiologically important impairment in immune function, the T cell-dependent A g hen egg lysozyme (HEL) was used to immunize 40-day old D 2 C and syngeneic, age-matched D B A / 2 littermates. Following immunization, D B A / 2 but not D 2 C mice mounted a strong humoral response (Fig. 21) [123]. These data, together with the known role of infection in D 2 C disease pathogenesis, suggested that a compromised ability to make protective antiserum predisposed to infection. 101 1 2 4 8 16 32 Serum Dilution (x100) F i g u r e 21. Asses smen t o f T C e l l - D e p e n d e n t H u m o r a l I m m u n e F u n c t i o n i n D2C M i c e Forty-day old, diseased D 2 C and age-matched D B A / 2 control mice were immunized with the T cell-dependent A g hen egg lysozyme (HEL) . Ten days post-immunization, tail vein blood was collected and assayed for HEL-specific IgG by E L I S A . 102 4.2.3 C h a r a c t e r i z a t i o n o f A d d i t i o n a l I m m u n o p a t h o l o g i c a l Fea tu re s O f D 2 C M i c e Given the immunodeficiency of D 2 C mice demonstrated by the H E L immunization studies, additional evidence of immunodeficiency was sought in these animals. These studies revealed that D 2 C mice possessed a number of pathological changes similar to those observed in human A I D S , intimating that profound immunocompromise may exist in D 2 C mice. For example, D 2 C mice develop variable degrees of lymphoid organomegaly which is positively correlated with the extent of cutaneous disease (Fig. 22A, B) [123]. Relative to control animals (Fig. 22C), D 2 C splenic parenchyma is characterized by a disorganized pattern of follicular hyperplasia and an increased number of multinucleated giant cells and tingible body macrophages, forming a prominent "starry sky" pattern (Fig. 22D). Although D 2 C lymphadenopathy occurs in a generalized distribution, enlargement of the cervical and upper extremity nodes which drain diseased skin tends to be most pronounced. Such enlargement typically occurs secondary to an expansion of the medullary cords, consisting primarily of lymphocytes with plasmacytoid morphology (Fig. 22E-G), or an infiltration of epitheloid histiocytes, and Langhans giant cells which efface the normal lymphoid architecture (Fig. 22E, H-J). D 2 C mice also develop intermittent diarrhea (Fig. 22K) associated with a non-specific pattern of intestinal inflammation, characterized by increased numbers of lymphocytes in the lamina propria and prominent lymphoid aggregates (Fig. 22L). The presence of massive hypergammaglobulinemia (Fig. 22M) in D 2 C mice indicates that B-cel l hyperactivity is also a feature of disease [123]. The coexistence of this B-cel l hyperactivity with humoral immune dysfunction most likely indicates a dysregulation of B cells. This constellation of pathological findings in D 2 C mice, including susceptibility to the development of psoriasiform skin disease, is similar to the pathology of human A I D S [169, 170, 208, 286, 287]. Given the similarities between D 2 C pathology and human A I D S , further experiments were directed towards examining 103 104 F i g u r e 22. N e c r o p s y O b s e r v a t i o n s m a d e o n D2C M i c e (A) Lymph nodes and (B) spleens were harvested from the indicated animals. Representative photographs are shown. ( C ) Control D B A / 2 spleen with normal lymphoid follicles (f). (D) D 2 C splenic parenchyma is characterized by a disorganized pattern of follicular hyperplasia. ( E , F ) D 2 C L N enlargement occurs secondary to expansion of the medullary cords (mc) which consist primarily of lymphocytes with plasmacytoid morphology (G). ( E , H , I, J) Enlargement of the L N can also be secondary to a diffuse infiltration of histocytes (his) which may take the form of Langhans giant cells ( L G C ) or diffuse sheets of epitheloid histocytes (ehis). ( K ) Photograph of loose stool which occurs intermittently in diseased D 2 C mice. (L) The histopathology of D 2 C intestine is characterized by a pronounced increase in the cellularity (c) of the lamina propria, and an increased number of interepithelial lymphocytes. Prominent lymphoid aggregates (la) are also a commonly observed feature of the D 2 C small intestine. ( M ) Serum from the indicated animals was collected at 40-days of age for the determination of serum IgG concentration by E L I S A (n=10 animals per group). 105 the C D 4 T cell compartment in D 2 C mice as a disruption of these cells is a critical feature of H I V infection. 4.2.4 Further Characterization of the CD4+ T Cell Subset 4.2.4.1 Longitudinal CD4+ T Cell Quantification The significant lymphopenia of C D 4 + cells in D 2 C mice, accompanied by the development of inflammatory SD-like disease, is seemingly analogous to the occurrence of SD in A I D S when the C D 4 + T cell count falls below 400-500 cells/mm 3 [208]. To see i f a similar relationship between the C D 4 + T cell level and susceptibility to disease existed in D 2 C mice, peripheral blood from age-matched D 2 C and D B A / 2 mice was obtained for C D 4 + quantification. A t 20 days of age, shortly before the onset of pubescence [245], when animals become susceptible to disease, D 2 C mice had nearly 30-fold lower levels of peripheral blood C D 4 + T cells than age-matched controls (66 ± 3 5 vs. 1724 ± 443 cells/mm 3; Fig. 23A) [123], and were found to have T C R repertoire skewing (data not shown) similar to that observed in 10-day old D 2 C mice (Fig. 20C). Interestingly, examination of older D 2 C mice revealed variable increases in the number of circulating C D 4 + cells and it was hypothesized that spontaneous disease convalescence in D 2 C mice might occur as a result of the acquisition of a protective number of C D 4 + T cells. Consistent with this possibility, serial C D 4 + cell quantification in D 2 C and age-matched D B A / 2 mice revealed that over the window of disease susceptibility, between 20- and 75-days of age, peripheral blood C D 4 + T cells in D 2 C mice had expanded over 400% (Fig. 23B) while the C D 4 + T cells from D B A / 2 control animals had expanded a meager 28% over this same time period (347 ± 7 1 vs. 2205 ± 568 cells/mm 3 , respectively) [123]. Complete disease remission occurred when C D 4 + T cells had accumulated to between 400-1000 cells/mm 3 which occurred shortly after the onset of convalescence (Fig. 23C). 106 2 5 0 0 B £ 2 0 0 0 E - ,1500 in 2 1 0 0 0 u 5 0 0 500% g g M O 0 % • - CH 3 0 0 % C D °> m § Q 2 0 0 % ° 100% HE-i D B A / 2 D2C 3000 E E 20O0 a> o 3 1000 o D DBA/2 D2C 1 D2C-30% DBA/2 - 2 % DBA/2 Convalescent D2C BrdU 6 0 % 1 40% 1 Q O o 30% 1 i 2 0 % ^  o « 10% H 0_ • DBA/2 (80 days) • D2C (80 days) m Vp 2 V p 4 V p 8 2 Vp 8 3 Vp 10.5 Vp 13 Vp 14 F 2 0 % of C D 4 * cells 0% of C D 4 + cells 1 4 % of C D 4 + cells 1 0 % of C D 4 + cells © o ! 1 m Vp 14 DBA/2 (10 d) o • H i Vp 14 D2C (10 d) • i • ! Vp 1 4 DBA/2 (80 d) • i •""•I >" Vp 1 4 D2C (80 d) 107 Figure 23. Characterization of the CD4 T Cell Number and TCR Chain Usage over the Window of Disease Susceptibility (A) Tail vein blood was collected from the indicated 20-day old mice. The C D 4 cell count was determined by performing a complete blood count using a hemocytometer and by immunophenotyping peripheral blood leukocytes by FACS®. (B) Tail vein blood was collected from the indicated mice at 20- and 75-days of age. The C D 4 count was performed as previously described. The percent change in the concentration of circulating C D 4 cells is plotted. (C) C D 4 counts on convalescent D 2 C and age-matched D B A / 2 mice were obtained as previously described. (D) L N were harvested from 50-day old, S3 D 2 C mice and age-matched D B A / 2 controls who were administered a 10-day pulse of the nucleoside analogue B r d U . Cells were analyzed by flow cytometry for the incorporation of B r d U . Histogram plots are gated on live C D 4 + T cells. (E) L N were collected from 80-day old D 2 C and D B A / 2 mice and evaluated for Vp T C R chain expression of C D 4 + T cells by FACS®. The percentage of the total C D 4 + T cell count expressing each of the seven VP T C R chains is shown. (F) Spleen (10-day old mice) and L N (80-day old mice) cells from D B A / 2 and D 2 C mice were stained with an a-CD4 mAb and a m A b recognizing the representative T C R VP chain VP 14. Dot plots are gated on live cells. 108 To better demonstrate the extent of CD4+ T cell peripheral expansion in D2C mice, a 10-day course of BrdU was administered to 40-day old D2C mice and age-matched DBA/2 controls. Consistent with previous studies [292], this short administration of BrdU labeled negligible numbers of peripheral CD4 + T cells from non-transgenic mice while 30% of the CD4+ T cells from D2C mice incorporated this marker, indicating that a massive peripheral T cell expansion was occurring (Fig. 23D) [123]. To see if this expansion riad an effect on the CD4 + T cell TCR repertoire skewing observed in young D2C mice, L N cells from 80-day old D2C mice and age-matched DBA/2 controls were obtained to examine CD4+ VP TCR chain usage. In these convalescent D2C animals, a more balanced expression pattern of VP chains was observed with no statistically significant difference in the percentage of total CD4 cells expressing any of the non-Vp8.2 TCR VP chains (Fig. 23E). Nevertheless, the percentage of CD4 cells expressing the TCR Tg VP8.2 chain was still significantly greater in convalescent D2C mice relative to age-matched DBA/2 controls (Fig. 23E), perhaps reflecting the ongoing thymic emigration of primarily Vp8.2+ CD4 cells. This relative reduction in VP8.2+ CD4 cells with age likely reflects the peripheral expansion of CD4 + cells which had deleted both TCR Tg during development since the thymic contribution of CD4 cells to the periphery consists of almost entirely Vp8.2+ CD4 cells (Fig. 20C). Nevertheless, these data show that the profound CD4 lymphopenia and highly skewed TCR repertoire normalizes over time and that this change is associated with the induction of disease convalescence in D2C mice. i 4.2.4.2 I m m u n o p h e n o t y p e o f E x p a n d i n g C D 4 + T C e l l s f r o m D 2 C M i c e It has been shown that in the absence of thymic output, mature T cells can divide spontaneously in the periphery of lymphopenic hosts; a phenomenon termed homeostatic ! 109 proliferation [293]. Cells undergoing homeostatic proliferation are known to masquerade as memory T cells expressing markers typically associated with A g experience; however, such cells I I are actually in a state of partial activation possessing an immunophenotype distinct from naive, activated, and memory T cells characterized by high levels of the memory markers CD44 and C D 122 without down-regulation of C D 6 2 L or the upregulation of the acute activation marker CD69 [294]. ; To address the possibility that the massive C D 4 + expansion in D 2 C mice was occurring as a result of homeostatic expansion, L N cells from 50-day old D B A / 2 and D 2 C mice were i assayed by flow cytometry for the expression of CD44, C D 6 2 L and CD69. A s anticipated, the vast majority of C D 4 + T cells from D B A / 2 mice expressed an immunophenotype typical of naive cells being CD44 1 0 , CD69", and C D 6 2 L h i . In S3 D 2 C mice, the majority of C D 4 + T cells were C D 4 4 h i , C D 6 9 + , and C D 6 2 L 1 0 (Fig. 24A) indicating that the proliferation of these cells was A g -driven rather than from homeostatic expansion to f i l l a lymphopenic environment [123]. Presumably this Ag-driven expansion was driven in part by opportunistic pathogens and that the acquisition of adequate numbers ;of A g specific T cells is an important milestone preceding disease convalescence. Consistent with this interpretation, examination of C D 4 + T cells from recovered D 2 C animals (Fig. 24B) demonstrated that these cells possessed an Ag-experienced but non-acutely activated immuriophentype ( C D 4 4 h l g h , C D 6 2 L 1 0 , CD69"). These data suggest that the C D 4 population was no longer undergoing Ag-driven expansion, presumably due to the acquisition of a protective frequency of Ag-specific cells. The finding that these convalescent mice, whose cutaneous and other immunopathological features of disease were in remission (Fig. 25A-C) , still failed to respond to H E L immunization (Fig. 25D) indicated that despite the I I significant reconstitution of CD4: T cell numbers (Fig. 23C), and the apparent normalization of i T C R diversity (Fig. 23E), these animals had persistent severe immunodeficiency with numerous ; 110 A CD62L CD69 Figure 24. Immunophenotype of D 2 C C D 4 + T Cells (A) L N were harvested from 50-day old, S3 D2C mice and age-matched D B A / 2 controls. Single cell preps were stained with the designated markers and analyzed by flow cytometry. Histogram plots are gated on live C D 4 + T cells. (B) L N were harvested from 80-day old recovered D 2 C mice and age-matched D B A / 2 controls. Single cell preps were stained with the designated markers and analyzed by flow cytometry. Histogram plots are gated on live C D 4 + T cells. I l l Serum Dilution (xlOO) Figure 25. Phenotypic Characteristics of Recovered D 2 C M i c e (A) Gross photograph from a recovered D2C mouse and representative histology from previously lesional rostral skin are shown. (B) Representative photographs of recovered D 2 C and age-matched D B A / 2 lymphoid organs. (C) Total serum IgG is shown for D B A / 2 and recovered D 2 C mice (the difference in serum IgG concentration between these groups was not found to be statistically significant). (D) Recovered D2C and age-matched D B A / 2 mice were immunized with H E L and assayed for HEL-specific IgG as previously described. 112 holes in their immunological repertoire. This finding argued against a slow but diverse thymic reconstitution of the periphery, resulting in an adequate frequency of all T cell clones, including those recognizing unusual foreign A g such as H E L . Rather this data strongly supported the conclusion that the C D 4 + T cell accumulation in D 2 C mice occurred as a result of the oligoclonal expansion of Ag-specific T cells against opportunistic pathogens. Since these mice are not likely exposed to avian lysozyme (HEL) before immunization, it is doubtful that the exceedingly infrequent population of HEL-specific T cells would have participated in the C D 4 + T cell expansion. i These data strengthen the parallel between disease in D 2 C mice and AIDS-related SD where an inadequate C D 4 + T cell concentration renders H I V patients susceptible to opportunistic infections, and treatment with C D 4 + cell- boosting H A A R T therapy cures them of opportunistic infections [295]. Based upon these similarities, it was hypothesized that the provision of an adequate population of C D 4 + T cells would protect D 2 C mice from disease. 4.3 Immunological Reconstitution of D2C Mice 4.3.1 Adoptive Transfer of Syngeneic CD4+ T Cells to Pre-Diseased D2C Mice To determine i f the observed expansion of C D 4 + T cells was responsible for D 2 C disease convalescence, syngeneic D B A / 2 C D 4 + T cells were adoptively transferred to pre-diseased D 2 C mice in attempt to abrogate disease development. C D 4 + T cell recipient mice were completely resistant to the development of disease (100% SO, n = 12) while D 2 C recipients of P B S developed typical pathological changes (Fig. 26A, B) [123]. Sections taken from the skin of C D 4 + T cell recipients were devoid of any microscopic evidence of disease and were indistinguishable from D B A / 2 skin sections (Fig. 26C) [123]. Other phenotypic abnormalities such as the development of lymphadenopathy and splenomegaly were also ameliorated by this 113 Week 1 Week 2 Week 3 Week 4 Q O CO CQ Q_ St -V Figure 26. Adoptive Transfer of C D 4 + T C e l l to Pre-Diseased D 2 C M i c e (A) 25-day old, pre-diseased D 2 C mice received 2x10 7 syngeneic D B A / 2 C D 4 + T cells or PBS . Representative photographs are shown. (B) The effectiveness of the cell transfer was quantitated by observing for and grading resultant disease. (C) Rostral skin sections from C D 4 + T cell and PBS-treated D2C mice are shown. 114 cell transfer (Fig. 27A) [123]. Although the transfer reconstituted D 2 C recipients with a functional humoral immune system enabling these animals to respond to immunization with H E L (Fig. 27B), this maneuver only partially corrected the hypergammaglobunemia typical of D 2 C mice (Fig. 27C) [123]. While this reduction in serum IgG was found to be statistically significant (p < 0.05) relative to PBS-treated D2C animals, the concentration of serum IgG in D 2 C recipients of C D 4 + T cells was markedly higher than in age-matched D B A / 2 controls [123]. The complete abrogation of this hypergammglobulinemia defect may have necessitated an earlier transfer of C D 4 + cells because B cell dysregulation in these animals likely begins at an earlier age while the transfer of the C D 4 + T cells occurred at 25-days of life [123]. These data confirm the hypothesized role of C D 4 lymphopenia in the development of D 2 C psoriasiform pathology and lend further support for the proposed parallels drawn between D 2 C mice and A I D S related SD. Given the results of earlier experimentation, we hypothesized that the mechanism by which the restored CD4 T cell compartment protected against disease was by reconstituting cell-mediated immunity (CMI) and the provision of T cell help for the generation of protective anti-serum. 4.3.2 Passive Immunization of Pre-Diseased D2C Mice with Opportunistic Pathogen-Specific Serum IgG Given the high titer of pathogen-specific IgG in S3 D 2 C mice immediately preceding disease convalescence (Fig. 13),' a possible mechanism by which D 2 C mice become resistant to i disease is the generation of pathogen-specific, protective humoral immunity. This protective antiserum likely reduces the antigenic burden of opportunistic pathogens on the skin, thereby reducing the concentration of microbial A g to which opportunistic pathogen-specific T cells can respond. The findings that convalescent D 2 C mice have less P A S positive material on the skin 115 A D2C Recipients of CD4 D2C Recipients of P B S Spleen LN B 1.6 1.2 0.8 C O 0.4 0 * P UJ o x c < D B A / 2 Contro ls D 2 C Recip ients of C D 4 • D 2 C Recipients of P B S E E O o> E C O 5 I 4 3 J I 1 2 4 8 16 32 Serum Dilution (x100) DBA/2 D2C D2C Controls Recipients Recipients of CD4 of P B S Figure 27. Adoptive Transfer of C D 4 + T Cells to Pre-Diseased D 2 C M i c e (Continued) (A) Representative pictures of lymphoid organs harvested from D 2 C recipients of syngeneic CD4 T cells and PBS . (B) D 2 C recipients of syngeneic C D 4 T cells and P B S , together with D B A / 2 control animals, were immunized with the T cell-dependent A g H E L . Ten days post-immunization, serum was collected and assayed for the presence of ant i -HEL specific IgG by E L I S A . (C) Serum was collected from D B A / 2 controls as well as D 2 C recipients of syngeneic CD4 T cells and P B S . The concentration of serum IgG was determined by E L I S A . 116 (data not shown) and that the C D 4 + cells in these animals are no longer acutely activated (Fig. 24B) are consistent with this interpretation. A s D 2 C recipients of syngeneic C D 4 + cells were fully capable of responding to a H E L immunization (Fig. 27B) [123], these animals would be expected to efficiently mount pathogen specific protective antiserum in response to microbial invasion, explaining their resistance to disease. To test this hypothesis, serum from S3 D 2 C mice containing high titers of pathogen-specific IgG, was administered to pre-diseased D 2 C mice. Interestingly, despite the enormous amount of serum IgG transferred, this supraphysiologic level of IgG (up to 4 mg IgG/week) resulted in only a moderate mitigation of the disease phenotype (Fig. 28). The failure of passive immunization to provide a level of protection equal to that of the syngeneic C D 4 + T cell transfer could be explained by the inability to "cover" microbial agents to which the donor animals had not been exposed. However, this possibility is not likely since the donor serum was pooled over many months from dozens of diseased animals, all of which were housed in conditions identical to that of the recipient mice. Instead, these data suggest that the protective effect of the syngeneic i cell transfer may have resulted from the provision of critical C D 4 + regulatory cells. 4.3.3 Analysis of T r e g Development and Funct ion in D2C M i c e A n absence of T r e g in FoxP3 K O mice results in massive C D 4 + T cell expansion, as well as severe skin disease [296, 297]. Furthermore the transfer of purified C D 4 + C D 4 5 R B h l cells to severe combined immunodeficieht (SCID) mice, a technique to create severe T r e g lymphopenia in recipient animals, results in psoriasiform skin disease [192]. These data suggest that T r e g lymphopenia or dysfunction could predispose to psoriasiform disease and, based upon the low thymic output of mature CD4 cells from the D 2 C thymus, it was anticipated that T r e g development would be proportionally reduced in these animals. However, it was also plausible 117 F i g u r e 28. A d o p t i v e T r a n s f e r o f S e r u m f r o m S3 D 2 C M i c e to P r e - D i s e a s e d D 2 C A n i m a l s ( A ) Serum from S3 D 2 C mice, shown to have high titers of opportunistic pathogen-specific IgG, was pooled and injected into pre-diseased D 2 C mice. Twice-weekly, mice received 0.5-1.0 ml of diluted serum containing 2 mg/ml of IgG. Age-matched control D 2 C animals received twice-weekly injections of the T3.70 control mAb. Representative photographs are shown. (B) The extent of clinical disease was monitored over the three week study period and the summarized results are shown. ( C ) Representative histological sections are shown of rostral skin harvested from serum-treated mice and T3.70-treated control mice. 118 that D 2 C mice were totally deficient in T r e g cells as a result of T C R transgenesis interrupting T r e g ontogeny. Examination of L N from young D 2 C mice revealed the presence of a normal frequency of typical C D 4 d i m C D 2 5 b r i g h t T r e g relative to D B A / 2 mice but, given the severe lymphopenia of C D 4 + T cells, the absolute number of T r e g cells was extremely low (data not shown). However, when D 2 C T r e g were purified and used in a well-described suppression assay [131], T r e g from D 2 C mice performed identically to those from age-matched D B A / 2 animals at suppressing the proliferation of conventional CD8 cells (Fig. 29A). These data argued against the abrogated development of T r e g predisposing to disease; however, it was reasoned that a lymphopenia of T r e g resulting from the slow thymic production of mature C D 4 + cells, would be insufficient to control the massive peripheral expansion of conventional C D 4 + "helper" T cells whose development was similarly hampered by severe thymic negative selection. Examination of convalescent D2C mice for the presence of T r e g revealed that relative to age-matched D B A / 2 control mice, T r e g constituted a higher proportion of total C D 4 + cells (Fig. 29B), although the absolute number of T r e g was still reduced (data not shown). Increased frequencies of T r e g have been observed in a variety of inflammatory diseases including atopic dermatitis [298], where an expansion of these cells occurs presumably to dampen inflammatory processes. Therefore the relative increase of T r e g in convalescent D 2 C mice may have helped to abrogate the further expansion of conventional C D 4 + cells and thereby may have induced disease remission. It was therefore reasoned that the selective restoration of the T r e g compartment by a fractionated C D 4 + T cell transfer would be sufficient to protect pre-diseased D 2 C mice from the development of the D 2 C disease phenotype. 119 50 _ 40 30 C O O CL 20 o 10 0 Suppressor Assay DBA/2 1:1 2:1 4 : 1 8:1 Responder : Suppressor Ratio 1 : 0 B L O CN Q O DBA/2 ••' • CD.1*CD25* .';!K3al . : ; S ^ V ' ,etM1CD25" ^ ^ ^ ^ J i easing D2C CD4 tCD25. t T ^ C e t e Acttvafted CD4'C025" Hetper T Cats R«stf>9 CD4 CD4 F i g u r e 29 . E v a l u a t i o n o f C D 4 + C D 2 5 + T R e g u l a t o r y C e l l s i n D 2 C M i c e (A) Responder D B A / 2 C D 8 + T cells were stimulated for 72 hours with ConA in the presence of irradiated antigen presenting cells. Varying numbers of D B A / 2 or D2C C D 4 + C D 2 5 + T r e g were also present at the indicated ratios. Cells were pulsed with tritiated thymidine for the final 8 hours of culture. (B) L N were collected from the indicated animals and prepared for FACS®. Cells were stained as shown (note: D 2 C L N cells were enriched for C D 4 + T cells by first depleting B lymphocytes and macrophages). Dot plots are gated on live cells. 120 4.3.4 Adoptive Transfer of Purified, Syngeneic T r e g and CD4+CD25" "Helper" T Cells to Pre-Diseased D2C Mice The increased frequency of T r e g in convalescent D 2 C mice suggested that these cells may have played an important role in inducing disease remission. Furthermore, this data was also consistent with the possibility that the effectiveness of adoptively transferred D B A / 2 C D 4 + cells at abrogating disease (Fig. 26, 27) was attributable to the restoration of the T r e g population. Alternatively, the provision of a balanced repertoire of C D 4 + cells by this C D 4 + T cell transfer, and therefore the transfer of normal cellular immunity to pre-diseased D 2 C mice, was also a possible explanation for the disease resistance of these recipients. To dissect out which possible mechanism protected recipient D 2 C mice from disease, syngeneic D B A / 2 C D 4 + T cells were fractionated into C D 4 + C D 2 5 " "helper" T cells and C D 4 + C D 2 5 + T r e g (Fig. 30A) and transferred to separate groups of pre-diseased D 2 C mice (Fig. 3 OB, C). The recipients of purified C D 4 + C D 2 5 " cells received 1-2x10 cells, approximately the same number of cells that were transferred in the unfractionated C D 4 + transfer experiment (Fig. 26, 27). Despite having a balanced C D 4 + repertoire with diverse V P chain usage, these CD4 + CD25~ cell recipients experienced an accentuation of the disease phenotype and an acceleration of disease pathogenesis relative to the control recipients of P B S (Fig. 30B, C). Additionally, these recipients were noted to have a more pronounced cutaneous C D 4 + T cell infiltration and a greater degree of polyclonal gammopathy (Fig. 31A-C). Consistent with previous results which discounted the role of protective A b as a prime mechanism of disease protection (Fig. 28), the restored ability of these C D 4 + C D 2 5 " cell recipients to mount a T cell dependent humoral immune response did not correlate with disease resistance (Fig. 3ID) . These data supported the hypothesis that the provision of T r e g and not a large population of diverse "helper" cells was the mechanism by which unfractionated C D 4 + cells protected from disease. Consistent with this suspicion, T r e g recipients experienced a 121 F i g u r e 30. Ef fec t o f the A d o p t i v e T r a n s f e r o f C D 4 + C D 2 5 + T r e g o r C D 4 + C D 2 5 " H e l p e r " T C e l l s to P re -D i sea sed D 2 C M i c e ( A ) Purified C D 4 + T cells from D B A / 2 mice were fractionated into C D 4 + C D 2 5 + T regulatory (T r e g ) and C D 4 + C D 2 5 " "helper" T cell populations. (B) A graphical representation of disease activity in D 2 C recipients of P B S , C D 4 + C D 2 5 + T r e g , and C D 4 + C D 2 5 " "helper" T cells is shown. ( C ) Representative photographs of gross pathology are shown. 122 B PBS CD4 + CD25-T cells Treg Cells F i g u r e 3 1 . Ef fec t o f the A d o p t i v e T r a n s f e r o f C D 4 + C D 2 5 + T r e g o r C D 4 + C D 2 5 " " H e l p e r " T C e l l s to P r e - D i s e a s e d D 2 C M i c e ( C o n t i n u e d ) ( A ) Representative photomicrographs of H&E-stained sections of rostral skin from mice in the specified experimental groups are shown. (B ) Acetone-fixed, frozen tissue sections from the rostral skin of mice in the indicated experimental groups were incubated with a rat ot-CD4 mAb. HRP-labeled, goat a-rat IgG and the Vector® Nova Red H R P immunohistochemistry kit were used to develop the staining. Representative photomicrographs are shown. ( C ) The concentration of serum IgG in the indicated experimental groups was determined by E L I S A . (D) P B S , C D 4 + C D 2 5 + T r e g , and C D 4 + C D 2 5 " "helper" T cell recipients were immunized with H E L and assayed for HEL-specific IgG by E L I S A . 123 complete abrogation of the cutaneous disease phenotype (Fig. 30B, C), with normal cutaneous histological findings devoid of the prolific cutaneous C D 4 + cell infiltration characteristic of disease (Fig. 31 A , B) . T r e g recipients, which received the cell transfer earlier than the unfractionated C D 4 + recipients described previously (Fig. 26, 27), had levels of serum IgG equivalent to D B A / 2 animals, indicating that the transfer of T r e g precluded the B cell dysregulation normally seen in D 2 C animals (Fig. 31C). While the provision of T r e g prevented polyclonal gammopathy, the recipients of these cells were completely unresponsive to H E L immunization (Fig. 3 ID), providing further evidence against a protective role of humoral immunity in this condition, and demonstrating unequivocally that the restoration of humoral responsiveness (Fig. 27B) was not the mechanism by which the unfractionated C D 4 + cell transfer protected against disease. These data suggested that the FoxP3-deficient and D 2 C model systems might share a related immunophysiology, which necessitated a closer comparison of these animals. 4.3.5 Compar ison of D 2 C and FoxP3 Knockout M i c e With the knowledge that T r e g lymphopenia predisposes D 2 C mice to cutaneous disease, these animals were studied further to detect abnormalities known to occur in other T r e g-deficient model systems. A complete T r e g deficiency occurs in FoxP3 K O mice and these animals are known to develop scales and crusts on the eyelids, ears, and tail in association with a number of other inflammatory changes [299, 300]. Histopathological examination of the skin from FoxP3 K O mice demonstrated that the cutaneous pathology in these animals was clearly psoriasiform (Fig. 32) suggesting that T r e g deficiency may be a key factor in psoriasiform pathophysiology. In addition to cutaneous disease, FoxP3 K O mice are known to develop chronic gastrointestinal disease, lymphoid organomegaly, anemia, and marked polyclonal B cell activation resulting in 124 Figure 32. Scurfy Mouse Cutaneous Histology Photomicrographs of representative H & E and PAS-stained histological sections from affected FoxP3 hemizygous male mice (Scurfy) and age- and sex-matched B 6 control mice are shown. Note the punctate PAS-positivity (PAS+) underlying the perifollicular mounds (m) of parakeratotic debris. 125 D2C DBA/2 D2C Kidney DBA/2 Kidney Figure 33. Addi t iona l Immunopathological Features of D 2 C M i c e (A) Polylysine-treated, Immunon E L I S A plates were coated with 50 pl of a 10 pg/ml solution of dsDNA. Various dilutions of serum from the indicated animals were incubated in the plate and bound IgG was detected with AP-conjugated, goat a-mouse IgG. (B) Acetone-fixed frozen sections of D2C and D B A / 2 kidney were incubated with FITC-labeled, goat F(Ab')2 a-mouse lg . Tissue sections were examined under a Zeiss fluorescence microscope. Representative glomeruli are shown. 126 hypergammaglobulinemia [299, 301], conditions from which D 2 C mice are also known to suffer (Fig. 22) [123] . Given that T r e g have also been shown to protect against glomerulonephritis [302], it was tested whether the lymphopenia of these cells in D 2 C mice was associated with circulating immune complexes and glomerulonephritis. These studies revealed that D2C mice, but not age-matched D B A / 2 control animals, had large titers of anti-dsDNA antibodies (Fig. 33A), and that D2C kidneys demonstrated membranous glomerular deposits which were not apparent in control sections (Fig. 33B). Therefore while differences between D 2 C and FoxP3 K O mice exist, such as the distribution and severity of cutaneous disease, many pathological changes are shared by these model systems, highlighting the critical role of C D 4 + C D 2 5 + T r e g cells in D2C disease pathophysiology. 4.4 Dexamethasone Treatment of D 2 C M i c e Corticosteroids are powerful immunosuppressant medications which dampen immunological functioning by multiple mechanisms which include inhibiting the release or synthesis of: cytokines; complement components; platelet activating factor; and eicosanoids, as well as directly antagonizing T cell signalling pathways [288, 303-305]. Interestingly, while corticosteroids have been shown to preclude the survival [306] and expansion of naive "helper" CD4 T cells by inhibiting T C R signal transduction [288], these agents do not antagonize the survival or functioning of T r e g cells [289]. In fact the relative frequency of T r e g is increased in steroid-treated animals due to the reduced susceptibility of T r e g to glucocorticoid-induced apoptosis [289]. Therefore another mechanism by which corticosteroids dampen immunoresponsiveness is by increasing the relative frequency of T r e g . It was therefore hypothesized that treatment with the corticosteroid dexamethasone (Dex) might have a favorable outcome similar to that observed in D2C recipients of purified T r e g . To address this possibility, 127 this possibility, pre-diseased D 2 C mice were treated with a previously demonstrated effective dose of Dex [307]. Dex-treated animals were protected against the development of the disease phenotype while PBS-treated control D 2 C mice developed typical gross and histological manifestations of disease (Fig 34). This protection from disease was associated with a massive reduction in the total number of C D 4 + cells as well as considerable atrophy of the lymphoid organs in Dex-treated, but not PBS-treated, D 2 C mice (Fig 35A, B) . Dex treatment had the added effect of precluding the polyclonal gammopathy and generation of auto-antibodies that are typical of D 2 C mice (Fig. 35C, D). These findings are consistent with the known efficacy of corticosteroids in the treatment of human psoriasiform disease [171, 204] and therefore it is tempting to speculate that the effectiveness of corticosteroids in the treatment of psoriasiform disease may in part be the result of shifting the balance in the ratio of T r e g to "helper T cel l" [289]. 4.5 Conclusion Current dogma states that the adaptive immune system maintains opportunistic fungal pathogens in a commensal state and that waning immunity predisposes to the induction of SD [169, 206]. This premise is supported by the known role of cell-mediated immunity in the defense against superficial fungal infections [284, 285] and that impairments in cell-mediated immunity, as occurs in H I V [169, 206, 208], predispose to the development of SD. However, most studies of cellular immunity in SD have either demonstrated an increased reactivity to Malassezia relative to control patients or no difference between patients and controls [194]. Furthermore, while impaired helper T cell function would result in functional defects in humoral immunity, studies have not demonstrated significant differences in pathogen-specific antibody levels between SD patients and controls [194, 308]. In fact, studies have shown that antibodies 128 CO LTJ C L x 9 a B 100% 75% 50% 25% Day 0 Day 7 Day 14 Day 21 ... • ^ H K M H l H B H H I I i H i '.a -PBS Dex PBS Dex Figure 34. Treatment of Pre-Diseased D 2 C M i c e with the Corticosteriod Dexamethasone (A) Pre-diseased D 2 C mice received daily i.p. injections of 10 ug of dexamethasone or the P B S vehicle control for a study period of 3 weeks (n=4 animals per group). Representative gross photographs are shown. (B) The effectiveness of the drug treatment was quantified by observing and grading resulting disease. (C) Representative H&E-stained histological sections of the skin are shown. 129 1.5, o 2 to] 3 § 0 . 5 o o O o Z. 20" E B> 16-E O o> E ? v CO ra o 12-4H B Spleen LN PBS Dex Dexamethasone -treated D2C D DBA/2 PBS-treated D2C PBS Dexamethasone PBS Dexamethasone F i g u r e 35. T r e a t m e n t o f P re -D i sea sed D 2 C M i c e w i t h the C o r t i c o s t e r i o d D e x a m e t h a s o n e ( C o n t i n u e d ) (A) L N were collected from dexamethasone- and PBS-treated D2C mice. Total C D 4 + T cell counts were determined using a hemocytometer and T cell immunophenotyping as previously described. (B ) Representative lymphoid organs from dexamethasone- and PBS-treated D2C mice and from an age-matched D B A / 2 control animal are shown. ( C , D ) The concentration of total serum IgG and the concentration of cc-dsDNA in the dexamethasone- and PBS-treated animals was determined by E L I S A as previously described. 130 against these organisms are ubiquitously found in both those with and without a past history of skin disease [309]. Moreover, while some authors report that abnormally high levels of Malassezia can exist on the skin of A I D S patients (Schechtman) [205, 206], others report that an overgrowth of Malassezia in A I D S is found in only a minority of cases [205]. These findings appear inconsistent with a simple "susceptibility to infection" model, likely reflecting a more complex disease pathophysiology. One concept which has, until recently [137], been conspicuously absent from current models of psoriasiform pathophysiology is the role of immunoregulation. The data described herein, which helps to reconcile some of the inconsistencies of psoriasiform pathophysiology, suggests that a relative deficiency of T r e g may tip the balance between immunotolerance and the generation of Ag-specific immunity. While immunocompromise is not sufficient on its own to result in spontaneous psoriasiform disease, a deficiency of T r e g , in a setting of T cell lymphopenia appears to strongly, predilect to this cutaneous reaction pattern. The mechanism by which these factors synergistically create psoriasiform pathology likely involves the expansion of conventional helper cells against opportunistic organisms following their release from T r e g mediated regulation. It is not surprising that such a combination of factors would arise in the setting of H I V infection as both helper T cells [310] and T r e g [311] are targets for the H I V virus. However, given the expression of additional H I V co-receptors (CCR5) by T r e g [311], these cells are exquisitely vulnerable to HIV-mediated attack [311,312] and thus H I V infection likely results in an immunodeficient state with a relative deficiency of T r e g . Results from emerging studies support this hypothesis, and indicate that T r e g function is impaired in A I D S [313] and that these cells are more comprehensively depleted by the H I V virus [311,312]. This interpretation also predicts that the effective mitigation of A I D S immunopathology through H A A R T [314] may work by inducing a rapid recovery in T r e g number rather than a correction of the overall 131 CD4 count. Therefore, in A I D S , the routine monitoring of T r e g may be equally, i f not more, important than the total C D 4 count for following disease course and assessing a patient's susceptibility to immunopathology. While these data have obvious implications for the treatment of AIDS-related illnesses, an understanding of the complex relationship between T r e g and conventional C D 4 + "helper" T cells may illuminate the mechanism by which the body maintains tolerance to the normal microbial flora. Such insights into the mechanism of commensalism would have a broad impact on a number of diverse human disease processes. Having proposed that opportunistic pathogen-specific C D 4 + "helper" T cells were important in disease pathogenesis, the hypothesis that a significant contribution of the C D 4 + T i cell expansion was directed against C. guilliermondii was tested. To address this question, the M H C class II- and H-2 d-expressing A20 B cell line was pulsed with a sonicate of C. guilliermondii and used to stimulate C D 4 + cells from D B A / 2 and D 2 C mice. Under these stimulation conditions D2C-deriyed C D 4 + cells consistently incorporated more tritiated thymidine and had a higher frequency of "blasting" cells relative to DBA/2-derived cells. Although the results of these experiments were not statistically significant, in part due to the high standard deviation of the results,,the data was encouraging. It is anticipated that the use of more appropriate A P C , such as mature D C , w i l l show that convalescing D 2 C mice have a significantly increased number of T cells specific for opportunistic pathogens relative to age-matched D B A / 2 mice. While the dysregulated expansion of T cells was in part the result of impaired T r e g functioning, the mechanism by which the serum hypergammaglobulinemia occurred was not actively investigated; though, the finding of auto-antibodies in D 2 C mice suggested that this represented a polyclonal B cell activation. It is possible that the severely lymphopenic CD8 compartment in D 2 C mice predisposed to viral pathogens, which are known to cause polyclonal 132 B cell stimulation [315]; howevef, the failure of serology to identify any viral infection in D 2 C I mice to date (data not shown) and the full penetrance of the phenotypic abnormalities in D 2 C i mice (Fig. 17) makes this less likely. Furthermore, at the time of disease convalescence, when serum lg levels are dramatically jfalling (Fig. 23), the CD8 cell compartment remains severely j lymphopenic, having expanded only minimally over the window of disease susceptibility (data not shown). Alternatively, this B cell dysregulation may also have resulted from a lymphopenia of C D 4 + cells, since the polyclonal B cell activation of human A I D S has been shown to be inversely proportional to the C D ^ count [316]. In murine A I D S ( M A I D S ) , i hypergammaglobulinemia is known to result from aberrant interactions between B cells and C D 4 + T cells [317], and thus dysregulation of rapidly expanding D 2 C C D 4 + cells may also contribute to this polyclonal gammopathy. Nevertheless, a role for C D 4 T cell dysfunction in this B cell abnormality is supported by a temporal association between the normalization of the C D 4 T cell compartment and the return of near-normal serum IgG levels. Although the pathology resulting from T r e g deficiency in D 2 C transgenic mice was found to be similar to that of T r e g-deficient FoxP3 K O mice, clear differences in the cutaneous phenotype exist between these tvyo model systems. In D 2 C mice disease occurs in the "seborrheic" areas of the skin and is characterized by erythematous and edematous skin predominantly over the rostrum that invariably results in lesional alopecia; whereas in FoxP3 K O mice, skin from all body regions) becomes thickened and taut, with crusted areas predominantly ! located over the tail and ears which not uncommonly results in auto-amputation of these j structures [299]. The unique tissue distribution of disease in D 2 C mice is suspected to occur as a result of D B A / 2 susceptibility fabtors predisposing to overgrowth with opportunistic pathogens, including lipophilic fungi which have a tropism for the seborrheic areas of the skin. FoxP3 K O mice, which are on a B6 genetic background, do not share these D B A / 2 factors, and therefore it 133 is not surprising that their disease does not conform to the " D 2 C " pattern. Furthermore FoxP3 K O mice are not lymphopenic of CD4 helper cells as thymic development of conventional T cells is not perturbed in these animals [318]. A further distinction between the D 2 C and FoxP3 K O model systems is that D 2 C mice possess a large population of clonally anergized self-reactive cells responsive to bystander IL-2 and IL-15 [61, 63, 120]. Delaney showed that these cells were acutely activated in disease-susceptible, 2C TCR-expressing B X D d RI strains [164] and therefore the possibility that these self-reactive cells are involved in disease pathogenesis is conceivable since studies have shown that the bystander activation of cells with an irrelevant A g specificity can be an autoimmune hazard in vivo [156, 157, 319]. These previous studies also highlighted the necessity of target tissue inflammation in bystander activation mediated localized autoimmune disease [156]. Given the marked inflammation of the rostral skin in D 2 C mice (Fig. 9) and the evidence of smoldering infection with opportunistic pathogens (Fig. 10), it is likely that sufficient target tissue inflammation exists in the skin of D 2 C mice to activate the self-• reactive cells. Intriguingly, novel treatments of psoriasis which non-specifically target memory phenotype cells have been shown to successfully mitigate disease [185]. Similarly, the non-specific recruitment of large numbers of N K lymphocytes to the skin is a frequent finding in SD [226]. Thus, the recruitment andbystander activation of memory phenotype lymphocytes may represent an important step in the pathophysiology of psoriasiform disease. Therefore, the possible involvement of clonally anergized, self-reactive 2C cells in D 2 C disease pathophysiology was studied further. 134 Chapter 5; Self-Reactive T Cells in Disease Pathophysiology 5.1 Introduction: Previous work on the D 2 C model clearly demonstrated that T r e g lymphopenia and a resultant dysregulated expansion of "helper" T cells was necessary for disease pathogenesis. While the results of this previous work were important for the understanding of psoriasiform disease, these data did not definitively explain the mechanism by which disease develops in D 2 C mice. A n interesting feature of T C R transgenic mice, which has not yet been studied in D 2 C disease pathogenesis, is the development of a large number of potentially self-reactive cells which are insensitive to negative selection. These cells become clonally anergized when they develop in a background expressing the cognate ligand for the Tg T C R , and thus T C R Tg mice have proven to be excellent tools for the study of T cell anergy [63, 120]. However the reversibility of this inactivation by exogenous cytokine [61, 120] suggests that these cells may pose an autoimmune hazard in vivo. Therefore, it is tempting to speculate that the 2C cells in D 2 C mice may be contributing to disease following their bystander activation. To first investigate the role of self-reactive 2C cells in D 2 C pathophysiology, the thymus and lymphoid organs from D 2 C mice were assayed by flow cytometry to determine whether the pattern of expression of the 2C T C R in D 2 C mice was similar to that of previously characterized H-2 d-expressing 2C animals [63,; 107]. These data demonstrated that, similar to that seen for other H-2 d-expressing 2C mice, the 2C T C R is expressed only upon a population of selection-independent CD4"CD8" D N T C in the thymus and peripheral lymphoid organs. The 2C cells in the D 2 C peripheral lymphoid organs expressed a similar level of the memory markers C D 122 and CD44 as 2C cells from previously described H-2 d-expressing 2C mice [61-63]; however, in contrast to the 2C cells from these other animals, D 2 C 2C cells were also found to be acutely activated [164] with vastly enhanced functional properties. The extent of the acute activation and enhanced functional properties were positively correlated with the severity of clinical disease. Proliferation assays and the results of cell transfer experiments revealed that this acute activation of the self reactive cells was a cell extrinsic process influenced by undefined recipient factors. To see whether 2C TCR-expressing cells were necessary for disease development, a blocking monoclonal antibody directed against the transgenic 2C T C R was administered to pre-diseased D 2 C mice. The abrogation of all but infrequent S1 disease by this treatment confirmed the hypothesis that 2C cells have an important role in disease pathogenesis. Given this new understanding of D 2 C pathophysiology, 2C cells in D 2 C recipients of T r e g were assayed for evidence of acute activation, which demonstrated that the activation of 2C cells occurs downstream of the dysregulated expansion of CD4 cells. Since the acute activation of 2C cells is a terminal event in disease pathogenesis, CD69-expressing 2C cells from S3 D 2 C mice were transferred to D B A / 2 recipients to determine whether activated 2C cells were sufficient for disease pathogenesis. The failure of 2C cells to cause disease in these immunocompetent recipient mice with diverse T cell repertoires demonstrated that the C D 6 9 + 2C cells were insufficient for disease. To eliminate the protective effect of this diverse T cell repertoire, the Rag-1"7" mutation was backcrossed to the D B A / 2 background, to create D B A / 2 Rag-1"A mice. The disease resistance of D B A / 2 ' Rag- Y1' mice demonstrated that severe immunocompromise coexisting with D B A / 2 susceptibility factors was insufficient for disease. Furthermore, the subsequent generation of ,D2C Rag 7 " mice, which were resistant to disease, supported the premise that 2C cells are not sufficient for disease. These data suggest that the previously described dysregulated C D 4 cells likely interact with the self-reactive 2C cells in D 2 C mice, resulting in the subsequent autoimmune exacerbation of cutaneous disease. 136 5.2 Self-Reactive Cells in TCR Transgenic Mice 5.2.1 The Expression of the 2 C T C R in D 2 C Mice: To first explore the role of 2C cells in disease pathogenesis the thymus and peripheral lymphoid organs were assayed for cells expressing the 2C transgenic receptor using the anti-2C idiotypic m A b 1B2. In H - 2 b 2C mice, large populations of 2C T C R expressing D P and mature i C D 8 + SP thymocytes are present in the thymus (Fig. 36); however, in the thymus of the H - 2 d 2C mice, the 2C receptor is expressed only upon D N T C [107]. These thymic immunophenotypes reflect the positive selection of the 2C T C R by physiological levels of p2Ca-K b and the negative selection of this receptor by p2Ca-L d [107, 320]. The pattern of 2C T C R expression in the D 2 C thymus (Fig. 36) was similar to that of other H - 2 d expressing backgrounds such as B 2 C d and (B6xDBA/2)N[2C mice [63, 107]. There was no significant difference in the thymic cellularity between young, age-matched D 2 C and (B6xDBA/2)Nj2C mice indicating that a greater dose of cognate ligand and D B A / 2 genetic factors did not influence thymic selection (data not shown). In diseased D 2 C animals, the thymic cellularity was approximately half that of age-matched ( B 6 x D B A / 2 ) N , 2 C mice ( 3.2 x 10 6 + 0.66 cells total vs. 5.5 x 10 6 ± 1.3 cells total, respectively; n=4 animals per group), most likely reflecting the sensitivity of thymocytes to stress hormones [321]. Next, the expression of the 2C T C R in the peripheral lymphoid organs was assayed. In positively selecting 2C mice (H-2 b), expression of the 2C T C R in peripheral T cells is divided between the positively selected C D 8 + T cells and the selection-independent D N T C [63, 107] whereas, in H - 2 d expressing 2C mice, the peripheral expression of the 2C T C R is restricted to the selection-independent D N T C [63, 107], reflecting the negative selection of 2C TCR-bearing D P thymocytes (Fig. 36). The pattern of 2C T C R expression in the periphery of D 2 C mice (Fig. 36) was similar to that described for other H-2 d-expressing 2C mice [63, 107], and no significant ! 137 Thymi and L N were collected from the indicated animals. Single cell preps were stained with the ct-2C T C R m A b 1B2 and with the CD8-specific mAb 53.67 and analyzed by FACS®. Representative dot plots, gated on live cells, are shown. 138 difference was seen in the number or distribution of 2C cells between young age-matched D 2 C and B 2 C d or ( B 6 x D B A / 2 ) N i 2 C mice (data not shown). However, in diseased D 2 C mice, a significant reduction in the number of peripheral 2C cells was observed relative to age-matched ( B 6 x D B A / 2 ) N i 2 C animals (2.4x10 6 vs. 1.0 x 10 7 respectively, 10 df, p<0.001). This reduction of 2C cells was associated with a significant, 60% increase in the percentage of pre-apoptotic and apoptotic ( 7 A A D + ) 2C cell in the periphery of S3 D 2 C mice relative to ( B 6 x D B A / 2 ) N , 2 C animals (46.3% vs. 29.2% respectively, 6 df, p<0.02). 5.2.2 C h a r a c t e r i z a t i o n o f P e r i p h e r a l 2C C e l l s i n D 2 C M i c e : Previously it was found that peripheral 2C cells in some 2C T C R transgenic B X D d recombinant inbred strains were acutely activated, as evidenced by the expression of CD69 [164]. To see whether 2C cells were acutely activated in D 2 C mice and to further characterize their immunophenotype, L N cells from D 2 C , B 2 C d , B 2 C b , and ( B 6 x D B A / 2 ) N i 2 C animals were assayed by flow cytometry. The chronic exposure of 2C cells to high affinity A g in H - 2 d -expressing backgrounds bestows upon these cells a memory-like immunophenotype, characterized by the expression of high levels of the memory markers CD44 and C D 122 [61-63] as well as a slightly increased expression of the CD43 effector glycoform [61] as relative to 2C cells in low affinity Ag-expressiiig B 2 C b mice (Fig. 37). 2C cells in D 2 C mice have similar elevations of the memory markers CD44 and C D 122, but a much higher level of the CD43 effector glycoform relative to the same cells in B 2 C d and (B6xDBA/2)N!2C mice (Fig. 37). Consistent with the results from B X D d recombinant inbred 2C mice [164], variable numbers of 2C cells in D 2 C mice also express the acute activation marker CD69 (Fig. 37). While the memory immunophenotype of D 2 C 2C cells had no relationship with disease activity, the expression of high levels of CD69 and the CD43 effector glycoform were strongly correlated 139 C D 4 4 C D 1 2 2 Figure 37. Immunophenotype of 2C T C R D N T C L N were collected from the indicated animals, prepared for FACS® and stained with the indicated markers. Representative histograms are gated on live 2 C T C R D N T C . 140 with disease severity, being most highly expressed on cells from S3 D 2 C animals (data not ! shown). Moreover, in pre-diseased and recovered D 2 C mice, CD69-expressing 2C cells are rare, I and the expression of the CD43 effector glycoform on 2C cells from these animals is equivalent to that seen in ( B 6 x D B A / 2 ) N i 2 C mice (data not shown). Previously, the Ag-experienced 2C cells from ( B 6 x D B A / 2 ) N i 2 C mice were demonstrated to possess enhanced functional properties relative to the same population of cells from low affinity Ag-expressing B 2 C b animals [61, 120]. Acutely activated 2C cells from D 2 C mice were tested to see i f their activated immunophenotype was associated with even greater enhancements of these functional properties. The modest increase in the expression of the CD43 effector glycoform in 2C cells from ( B 6 x D B A / 2 ) N , 2 C mice relative to 2C cells from B 2 C b animals (Fig. 37) is associated with a slightly increased ability to k i l l L d transfected cell lines I pulsed with high concentration of the p2Ca peptide [61]. However, when these same effector cells were tested for their ability Jto k i l l BALB/c-der ived A20 cells expressing physiological levels of the cognate ligand p2Ca-L d , no significant difference in ki l l ing was appreciated (data not shown). When 2C cells from S3 D 2 C mice, which express high levels of the CD43 effector glycoform, were used as effector cells in this assay, they were shown to have a 3-4-fold increased ability to k i l l A20 cells relative to 2C cells from either B 2 C b or ( B 6 x D B A / 2 ) N , 2 C mice (Fig. 38A). The increased capability of 2C cells from S3 D 2 C mice to k i l l A20 target cells may be attributable to an increased level of N K G 2 D found on these cells (Fig. 38B). N K G 2 D is a known activating/cytotoxic receptor that has a specificity for stress ligands [322, 323] which the A20 cell line is known to express [324, 325]. In a prior report, 2C cells from (B6xDBA/2)Nj2C mice were shown by intracellular FACS® to have an enhanced ability to secrete IFN-y immediately ex vivo relative to 2C cells b from B 2 C mice, following brief T C R stimulation [61]. Although this supraphysiological 141 Figure 38. Functional Characterization of 2C T C R D N T C from Disease-Resistant and Disease-Susceptible Mice (A) 2C T C R D N T C cells were purified by negative selection using a magnetic column (Dynel). Purified 2C T C R D N T C from diseased D 2 C and disease-resistant B 2 C d mice were incubated with 5 1 Cr-labeled A20 target cells at the indicated effectontarget (E:T) ratios. Data is representative of 5 individual experiments where each data point was done in quadruplicate. (B) L N were collected from the indicated animals, prepared for FACS® and stained with an o c -N K G 2 D mAb. Representative histograms gated on live 2C T C R + D N T C are shown. (C) Purified 2C T C R D N T C from diseased D 2 C and disease-resistant B 2 C d mice were stimulated in vitro with A20 cells for 40 hours, after which culture supernatant was collected for IFN-y E L I S A . Culture supernatant IFN-y was detected by E L I S A using the IFN-y-specific capture and detections mAbs R4-6A2 and X M G 1 . 2 , respectively. Recombinant IFN-y was used to generate a standard curve and shown data is representative of 4 individual experiments. (D) Purified 2C T C R D N T C from B 2 C d and diseased D2C mice were stimulated with T 2 - L d cells, 20 U / m l IL-2, and the indicated concentrations of the p2Ca peptide in a standard proliferation assay. The cells were pulsed with 50 pl of ( 3H)thymidine (20 pCi/ml) eight hours before the end of the 72-hour assay period. Data is representative of 5 individual experiments where each data point is done in quadruplicate. 142 stimulation with p2Ca-pulsed, Ld-transfected cells demonstrated a greater propensity of A g experienced 2C cells to liberate this inflammatory cytokine, it is unlikely that a T C R signal of this magnitude would ever be encountered in vivo, and thus this functional attribute is of questionable biological significance. Therefore, 2C cells from B 2 C b mice, (B6xDBA/2)N]2C mice, and S3 D 2 C mice were stimulated immediately ex vivo with A20 cells to see whether functional differences in this effector function were appreciable after more physiologic doses of stimulation. Consistent with the^killing data, no significant difference was observed between 2C cells from B 2 C b and ( B 6 x D B A / 2 ) N i 2 C mice (data not shown); however, 2C cells from S3 D 2 C mice produced a 10-20-fold greater amount of IFN-y relative to the 2C cells from these other strains (Fig. 38C). Next, standard proliferation assays were used to test the hypothesis that the activated immunophenotype and enhanced functional properties of 2C cells from D 2 C mice resulted from a failure of clonal anergy and/or an increased self-reactivity of these cells. When 2C cells from S3 D 2 C mice were stimulated with p2Ca-L d-expressing A P C , it was found that these cells were still dependent on bystander cytokine support for their proliferation, as they failed to proliferate in the absence of supplemental cytokine (data not shown). While this data indicated that the anergization to self-Ag had been preserved, A g stimulation of these cells in the presence of IL-2 or IL-15 was performed to determine whether these cells exhibited enhanced self-reactivity. Previously, clonally anergized 2C cells from (B6xDBA/2)N]2C mice were shown to have a reduced threshold of activation and greater proliferative potential relative to 2C cells from B 2 C b mice when exogenous IL-2 or IL-15 was supplied to the culture medium [61, 63, 120]. When 2C cells from S3 D 2 C mice were stimulated under these same conditions, these cells were found to have an even greater proliferative potential with a higher basal proliferation rate and reduced activation threshold relative to 2C cells from (B6xDBA/2)N-2C mice (Fig. 38D). 143 The enhanced effector functions of 2C cells from S3 D 2 C mice were observed to correlate with the extent of cellular activation as measured by the percentage of 2C cells expressing the acute activation marker CD69. 2C cells derived from pre-diseased or convalescent D 2 C mice rarely expressed CD69 and were found to perform equivalently to 2C cells from ( B 6 x D B A / 2 ) N i 2 C animals in the aforementioned assays of T cell function (data not shown). This data argued against a cell intrinsic increase in self-reactivity in 2C cells and therefore it was concluded that the enhanced effector functioning of 2C cells from diseased D 2 C mice was attributable to a heightened activation state induced by cell extrinsic factors. Furthermore, it was hypothesized that, regardless of donor strain, 2C D N T C adoptively transferred to the D B A / 2 background would assume the immunophenotype and functional attributes typical of 2C cells developing naturally in D 2 C mice. To test this hypothesis, T cell-depleted bone marrow from D2C and (B6xDBA/2)N-2C mice was adoptively transferred to i . . . ( B 6 x D B A / 2 ) N i and D B A / 2 recipients respectively. H-2 congenic B 2 C donor mice and B6 recipient animals were also employed, in lieu of (B6xDBA/2)N]2C donors and ( B 6 x D B A / 2 ) N i recipients respectively, to eliminate the effect of H-2 incompatibility; however, this substitution had no effect upon the outcome of the studies. B 6 d or ( B 6 x D B A / 2 ) N i recipients of D 2 C marrow (Fig. 18) were found to have a thymus and peripheral lymphoid compartment equivalent to ( B 6 x D B A / 2 ) N ' 2 C mice (data not shown). Furthermore the D2C-derived 2C cells in these animals were indistinguishable from 2C cells derived from (B6xDBA/2)N]2C mice, with respect to their CD44 + CD122 + CD69" immunophenotype (Fig. 39A), and their reduced ability to k i l l targets bearing physiological levels of p2Ca-L d (Fig. 39B) or liberate IFN-y following A g stimulation (Fig. 39C). Presumably B6-derived, protective factors in these chimeras precluded the acute activation of the 2C cells by providing a less-inflammatory milieu for their development. 144 Figure 39. Determination of whether the Acutely Activated Immunophenotype and Enhanced Functional Properties of 2 C DNTC are Cell-Intrinsic or Cell-Extrinsic Characteristics (A) D 2 C bone marrow was adoptively transferred to lethally irradiated, non-transgenic B 6 d recipients while bone marrow from B 2 C d animals was adoptively transferred to lethally irradiated, non-transgenic D B A / 2 recipients (n=10 animals per group). L N collected from the bone marrow chimeras ( B M C ) were processed for flow cytometry and stained with mAbs against CD69 and the 2C T C R (1B2). 2C T C R D N T C from B 2 C d mice were used as a negative control. Representative histograms are gated on live 1B2 + cells. (B) Purified 2C T C R D N T C from the B M C and from wild-type D 2 C and B 2 C d mice were incubated with 5 l Cr-labeled A20 target cells at the indicated effectontarget (E:T) ratios. Data is representative of 3 experiments where each data point was done in quadruplicate. (C) Purified 2C D N T C from the indicated animals were stimulated with A20 cells and subsequently culture supernatant was assayed for IFN-y by E L I S A as previously described. Data is representative of 3 experiments where each data point was done in quadruplicate. 145 2C cells from diseased D B A / 2 recipients of ( B 6 x D B A / 2 ) N i 2 C or B 2 C d bone marrow (Fig. 18) possessed an acutely activated C D 6 9 + immunophenotype (Fig. 39A), and had enhanced effector functions as evidenced by enhanced cytolytic activity (Fig. 39B), and an increased ability to produce IFN-y (Fig. 39C). These cells were indistinguishable from 2C cells derived from unmanipulated D 2 C mice, supporting the hypothesis that the enhanced effector functioning of 2C cells in unmanipulated D 2 C mice is not a cell-intrinsic phenomenon but rather a reflection of the ambient inflammatory milieu to which the cells are exposed. 5.3 Involvement of 2C cells in Disease Pathogenesis 5.3.1 2C Cells are Necessary for Disease Development The acute activation and enhanced functional properties of the 2C cells in D 2 C mice were consistent with the hypothesis that the presence of anergized cells may pose an autoimmune hazard in vivo and that these cells have an active role in disease pathogenesis. However, it was equally plausible that the bystander activation of the CD122-expressing 2C cells might represent an inconsequential epiphenomenon. Therefore, more definitive evidence for the direct involvement of the 2C cells in disease pathogenesis was sought. To determine whether the 2C T C R + T cells were responsible for mediating the immunopathological changes in the D 2 C mouse, disease-susceptible mice were treated with the anti-clonotypic m A b 1B2 which blocks the 2C T C R recognition of cognate A g [326]. 1B2-treated D 2 C mice were resistant to all but infrequent SI disease, characterized histologically by focal areas of moderate acanthosis, while animals treated with the isotype-matched control mAb T3.70 [89] developed typical pathological changes (Fig. 40A-C) . In order to understand the mechanism of this mAb suppression, 2C T C R T cells recovered from treated animals were immunophenotyped. Since a saturating concentration of the anti-clonotypic 1B2 m A b was 146 B Day 0 Day 6 Day 12 Day 18 DBA/2 162-lreated T3 70-1realed 1 B 2 / D 2 C T 3 . 7 0 / D 2 C E T3.70-treated D2C 1B2-treated D2C CO £ v 2C O f y ' c e l l s CO CM ' 3 H ' :-Wiri2 2 C + cells \*3r '• 1B2 T3 CD69 CD 122 CD122 Figure 40. Treatment of D 2 C Mice with a Block ing m A b against the 2 C T C R (A) Pre-diseased D2C mice were treated weekly with 400 pg of the blocking anti-2C-TCR m A b 1B2 or the isotype-matched control mAb T3.70. Representative photographs are shown (n=4 animals per group in each of 3 experiments). (B) Rostral skin from D 2 C mice, treated with either the 1B2 or T3.70 mAb, and from a D B A / 2 control animal was collected and processed routinely for histological analysis.- Representative H&E-stained photomicrographs are shown. (C) Treatment effectiveness was quantified by observing and grading resulting disease. (D) To identify 2C cells, an a-CD122 m A b ( T M - p l ) and a m A b against the p chain of the 2C T C R (F23.1, pan-Vp 8 mAb) were employed due to saturation of the 2C T C R with the 1B2 mAb. L N cells were stained with an a -CD69 m A b (H1.2F3) to evaluate 2C cell acute activation. Histograms are gated on live C D 1 2 2 + F23.1 + cells. (E) CD122 vs. F23.1 dot plots of L N cells from lB2-treated and T3.70-treated mice are shown. Dot plots are gated on live cells. Note the downregulation of the T C R P chain (F23.1) in lB2-treated mice. 147 administered, it was not possible to identify 2C T C R + cells with this reagent. Instead, 2C cells were quantified by staining L N cells for the expression of CD122 ( T M . p i ) and the 2C T C R VP8.2 chain (F23.1) [327] since bound 1B2 mAb does not inhibit binding of the Vp8 .2-specif ic mAb F23.1 [328] and virtually all V p 8 . 2 + C D 1 2 2 + cells in H - 2 d 2 C mice express the 2C T C R (data not shown). The 1B2 mAb treatment precluded the acute activation of the F23 .1 + CD122 + cells in D 2 C mice as measured by FACS®-based CD69 staining (Fig. 40D) and prevented their depletion, which typically occurs during disease pathogenesis (9 .0xl0 6 in lB2-treated D 2 C mice vs. 2.84 x 10 6 in T3.70- treated D 2 C mice, 6 df, p,<0.001). Furthermore, treatment with 1B2 reduced the intensity of V p 8 . 2 expression by an order of magnitude, as assayed by FACS® using F23.1 staining (Fig. 40E). Therefore the therapeutic effect of the 1B2 m A b likely involves the down-modulation of the 2C T C R , resulting from T C R cross-linking in vivo and, furthermore, by blocking the interaction of this down-regulated receptor with cognate tissue A g . These data highlight the necessary role of cognate A g recognition by the 2C T C R in disease pathogenesis, which supports the hypothesis that 2C cells have a direct role in disease. 5.3.2 T r e g Preclude the Acute Act ivat ion of 2 C Cells Based on the ability of the blocking mAb 1B2 to abrogate 2C cell activation and disease development, it was hypothesized that previous interventions which mitigated the disease phenotype worked via controlling 2C cell activation. Serum transferred from S3 D 2 C animals to pre-diseased D 2 C mice had only! a mild effect on the phenotype of disease (Fig. 28), suggesting that this treatment failed to prevent 2C cell activation. As expected, flow cytometric evaluation of peripheral lymphocytes from serum and vehicle control-treated mice revealed that this intervention only slightly reduced the percentage of 2C cells activated in vivo (Fig. 41 A ) . While these data suggest that high titers of opportunistic pathogen IgG can slightly modulate the 148 F i g u r e 4 1 . Ef fec t o f P r e v i o u s In te rven t ions on the A c t i v a t i o n Sta tus o f 2 C T C R D N T C i n D 2 C M i c e ( A ) Pre-diseased D2C mice were treated with twice-weekly injections of 0.5-1.0 ml of diluted S3 D2C serum containing 2 mg/ml IgG as previously described. Control animals received twice-weekly injections of the irrelevant IgGl mAb (T3.70, anti-idiotypic m A b of the H Y T C R ) . After four weeks of treatment, CD69 expression on 2C T C R D N T C was assayed by flow cytometry. Histograms are gated on live 2C cells. (B) Pre-diseased D2C recipients of unfractionated D B A / 2 C D 4 T cells or PBS were sacrificed four weeks post-cell transfer. L N were harvested, prepared for flow cytometry, and stained with the ct-2C T C R mAb (1B2) and a m A b against CD69 (H1.2F3). Histograms are gated on live 1B2 cells. ( C ) l - 2 x l 0 6 C D 4 + C D 2 5 + T r e g cells, l - 2 x l 0 7 C D 4 + C D 2 5 " "helper" T cells or PBS was transferred to pre-diseased D2C mice. Four weeks post-transfer, animals were sacrificed and CD69 expression on 2C T C R D N T C was assayed by flow cytometry. Histograms are gated on live 1B2 cells. (D) Pre-diseased D2C mice were treated daily with 0.5 ml of a 20 ug/ml solution of dexamethasone in P B S or 0.5 ml o f the P B S dilutent alone. Four weeks post-treatment, animals were sacrificed and CD69 expression on 2C T C R D N T C was assayed by flow cytometry. Histograms are gated on live 1B2 cells. 149 disease phenotype, it is clear that even this supraphysiological level of antiserum cannot preclude 2C cell bystander activation, presumably due to the inability to sufficiently influence the inflammatory milieu of these animals. The hypothesis that 2C cell activation occurs proximally to the development of severe skin disease predicted that both the unfractionated D B A / 2 C D 4 cell transfers (Fig. 26, 27) and purified D B A / 2 T r e g cell transfers (Fig. 30, 31), which completely abrogated disease, would be associated with CD69" 2C cells. As shown in Figures 41B and 41C, both of these cell transfer experiments did in fact abrogate the acute activation of the 2C cells whereas the recipients of T r eg-depleted D B A / 2 C D 4 + C D 2 5 " cells, who developed a kinetically-enhanced course of disease (Fig. 30B, C), possessed an extensive population of C D 6 9 + 2C cells (Fig. 41C). The finding that these latter recipients of D B A / 2 CD4 + CD25" T cells had fewer C D 6 9 + 2C cells than littermate control D 2 C animals (Fig. 41C) is likely attributable to the faster disease kinetics in these i animals rather than any protection afforded by the transfer of C D 4 + C D 2 5 " cells since, at the time of analysis, the recipients of CD4 + CD25" cells were undergoing disease convalescence while control D 2 C mice were developing peak pathological changes (Fig. 30B). It is likely that immunophenotyping these animals at early time points would have demonstrated greater activation of the 2C cells relativeto unmanipulated D2C mice. D2C recipients of Dex were also protected against the development of disease which was associated with a massive reduction in L N cellularity relative to PBS-treated D 2 C animals (6.8 + 3 x 10 5 cells vs. 5.1 ± 2 . 1 x 10 6 cells, respectively) which included a significantly reduced number of CD4 T cells (5.8 + 2.1 x 10 4 vs. 9.9 ± 2.5 x 10 5 cells, respectively) and 2C cells (2.8 ± 1.4 x 10 5 vs. 1.1 + 0.4 x 10 6 cells, respectively). Interestingly, while the majority of 2C cells were CD69" in these animals, some 2C cells were found to be C D 6 9 + (Fig. 4ID). The failure of disease development in these mice, despite some 2C cell activation, could result from a number 150 of factors, including a reduction in the frequency of 2C cells below a critical threshold necessary i for the induction of clinically significant bystander damage, or a Dex-induced biochemical block precluding the acquisition of full effector functioning of the 2C cells. More research on the effects of Dex upon 2C cells as well as T r e g in D 2 C mice wi l l be necessary to determine the mechanism by which Dex protects against the development of the disease phenotype. 5.3.3 2C Cells are not Sufficient for Disease Development Since the protection from disease afforded by the administration of 1B2 demonstrated the necessity of 2C cells in D 2 C pathogenesis, acutely activated 2C cells were transferred to D B A / 2 recipients to determine i f these cells were sufficient for lesion development. Lightly irradiated D B A / 2 mice received 5 x l 0 6 purified C D 6 9 + 2C cells from S3 D 2 C donors (Fig. 42A). Three months post-cell transfer, these cells were still present in large numbers with an average of 2.43 + 0.5 x 10 6 2C cells being recovered from each recipient. Despite the persistence of these cells in the disease susceptible D B A / 2 background, the 2C cells lost their acutely activated immunophenotype (Fig. 42A) and recipient animals remained free of gross disease or psoriasiform histopathology (Fig. 42B, C). Given the number of 2C cells recovered from these recipients, it is unlikely that disease resistance could be explained solely by an inadequate transfer of 2C cells. Rather the disease resistance of these recipients is best explained by the failure to deplete critical cell populations which occurs in D 2 C mice as a result of T C R transgenesis. Although the administration of 550 rads facilitated the engraftment of the donor cells by clearing some space in the peripheral lymphoid compartment, a rapid replenishment of the lymphoid compartment due to the unperturbed thymic development in these animals would have quickly reversed the temporary lymphopenia induced by this measure. Furthermore, the recipient C D 4 + T cell repertoire was a diverse one, without skewing of V p chain usage or T r e g 151 post-transfer pre-transfer q—i i J • • f | CD69 DBA/2 Recipient of CD69 + 2C cells 1 if ' Rostral Skin from DBA/2 Recipient Figure 42. Adoptive Transfer of C D 6 9 + 2 C T C R D N T C to Recipient D B A / 2 M i c e (A) C D 6 9 + 2C D N T C were purified from S3 D2C mice as previously described and transferred to lightly irradiated (550 rads) D B A / 2 recipient mice (5 x 10 6 C D 6 9 + 2C cells per mouse, n=5). Three months post-cell transfer, recipient mice were sacrificed and L N were collected and processed for flow cytometry. Representative histograms demonstrating CD69 expression on 2C D N T C before cell transfer and on the same cell population recovered from recipient mice are shown. Histograms are gated on live 2C cells. (B) Representative gross photograph of a recipient D B A / 2 mouse. (C) Representative H & E histology of rostral skin from a recipient D B A / 2 mouse. 152 lymphopenia as occurs in D 2 C mice. Other T cell populations, whose ontogeny is known to be disrupted by T C R transgenesis such as y5 T cells, would similarly be unaffected in these recipients. Therefore these immunocompetent recipients would not respond to cutaneous insults with the same prolonged inflammatory response and subsequent development of target tissue inflammation. This is consistent with the current dogma that prolonged inflammation is necessary to drive bystander stimulation-mediated autoimmune exacerbations of disease [156, 163]. Such cytokine enriched environments may promote the activation of anergized T cells as well as self-reactive T cell clones with low avidity for A g by bypassing biochemical blocks or reducing the activation threshold of these cells, respectively. Therefore this data demonstrates that other effects of transgenesis; such as the induction of T cell lymphopenia and skewing of the T cell repertoire, likely have a necessary role in disease pathogenesis. To address the contribution of these other factors in disease pathogenesis, D 2 C mice homozygous for the Rag-1 K O mutation were created by interbreeding D 2 C mice with D B A / 2 Rag-1"7" animals. D B A / 2 Rag-1"7" animals are deficient in all B and T cells since the R a g - l 7 " mutation precludes V ( D ) J rearrangement and thereby impairs lymphocyte development [234]. D B A / 2 Rag-1"A mice were completely resistant to the development of gross or microscopic D 2 C pathology (Fig. 43A), despite being severely immunocompromised as evidenced by the absence of circulating serum lg (Fig. 43C). The disease resistance of these animals is not unexpected as both self-reactive 2C cells and dysregulated C D 4 T cells, which these animals lack, were previously shown to be critical for disease pathogenesis. Furthermore, other immunologically-devastating mutations on the "susceptible" B A L B / c background, such as the severe combined immunodeficiency (SCID) and Nu /Nu (nude) mutations, do not have an observable cutaneous phenotype [329]. Therefore, these data confirm that overwhelming susceptibility to infection is j insufficient for disease. D 2 C Rag-1"7" mice were similarly resistant to disease while age-matched 153 DBA/2 R a g - 1 + / - DBA/2 Rag-1 §5 o o (0 O G to O 0) £ cn o o TO ra C L O N B DBA/2 Rag-1 ^ DBA/2 DBA/2 Rag-1-Z- R a g - 1 + / " Figure 4 3 . Characterization of the DBA/2 Rag-1"" M i c e (A) The Rag-1"7" mutation was backcrossed from the B6 to the D B A / 2 background for 6 generations. Representative gross and microscopic images of D B A / 2 Rag-1"7" and littermate D B A / 2 Rag-l + 7"mice are shown. (B) Tail vein blood from D B A / 2 Rag-1"7" and littermate D B A / 2 Rag-1 + /" mice was stained with a goat a-mouse Ig Fitc A b and analyzed by flow cytometry to assay for circulating B lymphocytes to confirm PCR-based genotyping results. The dot plots are gated on live cells. (C) Serum was collected from D B A / 2 Rag-1"7" and littermate D B A / 2 Rag-1 + /" mice and assayed by E L I S A for serum IgG. 154 D 2 C Rag-1 " littermate controls; developed the typical D 2 C disease phenotype (Fig. 44A). D 2 C Rag-1"7" mice are deficient in all jbut 2C TCR-expressing lymphocytes (Fig. 44B, C), and thus have a similar level of immunocompromise as D B A / 2 Rag-1"7" animals. Given the absence of a dysregulated population of C D 4 + T cells, the disease resistance of D 2 C Rag-1"7" mice was predicted by the results of previous experimentation. Unexpectedly, while the majority of 2C cells derived from D 2 C Rag-1"7" mice were CD69", a variable but significant population of 2C cells in these animals was CD69 r t"(Fig. 44C). This result is consistent with the ability of mediators other than C D 4 T cell-derived IL-2 to cause bystander activation of the 2C cells, such as IL-15 [61, 62]. While this data demonstrates that it is likely that IL-15 derived from infected epithelium and other sources of inflammatory cytokines may also contribute to the bystander activation of 2C cells (Fig. 44C); these sources do not predispose animals to the development of clinically-relevant autoimmune disease, and perhaps may reflect additional roles of dysregulated C D 4 T cells in disease pathogenesis. The conclusion from these findings is that 2C transgenesis has a multitude of effects which are critical for disease pathogenesis. Although the production of self-reactive cells is important for disease, the generation of an environment lymphopenic of both conventional C D 4 "helper" T cells and C D 4 + C D 2 5 + T r e g is equally critical. The resultant dysregulated expansion of the "helper" T cell population in some way synergizes with the self-reactive 2C cells to cause organ-specific autoimmune disease. 5 . 4 Conclusion While a number of different T C R transgenic model system of spontaneous skin inflammation have been recently generated [330-332], D 2 C mice differ from these other systems in that the cutaneous pathological changes in these other models are seen extensively, often 155 B D2CRag-1 + / - D2C Rag-1"/- C a-IgG a-IgG CD69 Figure 44. Characterization of D 2 C Rag-1"7" M i c e (A) D 2 C Rag-1 7 " mice were created by mating D 2 C mice with D B A / 2 Rag-1 7" mice. Representative gross and cutaneous microscopic images of D 2 C Rag-1 7 " and littermate D2C Rag-1 + /" mice are shown. (B) Tail vein blood from D2C Rag-1 7" and littermate D2C Rag-1 + /" mice was stained with a goat a-mouse lg A b and analyzed by flow cytometry to assay for circulating B lymphocytes to confirm PCR-based genotyping results. The dot plots are gated on live cells. (C) L N from D2C Rag-1""and littermate D2C Rag- l + / "mice were harvested, prepared for flow cytometry, and stained with the a-2C T C R m A b 1B2 and a m A b against CD69 (H1.2F3). Histograms are gated on live 1B2 + cells . 156 leading to the development of a lethal wasting disease with pathology more closely resembling i graft versus host disease [330-332], whereas the waxing/waning, milder, and uniquely distributed cutaneous pathology of the D2C mice is limited to the seborrheic regions of the skin and has a psoriasiform pattern [123]. The different morphological changes and differing pathophysiologies of these model systems clearly demonstrate the uniqueness of the D 2 C model, studies on which w i l l generate novel insights into the poorly understood psoriasiform conditions. The data described herein demonstrate that the bystander activation of 2C cells occurs distal to the dysregulated expansion of C D 4 T cells, as precluding this C D 4 expansion by the provision of T r e g abrogates the acute activation of the 2C cells (Fig. 41C) without correcting the immunocompromised state of these recipients (Fig. 3 ID). This suggests that the activation of 2C cells likely represents a terminal effector mechanism in the generation of disease. These data have also demonstrated the source of the cytokine support fueling the bystander activation and the subsequent autoimmune exacerbation of disease. Both IL-2 and IL-15 have been shown to be capable o f causing bystander stimulation in vitro [61, 62]; however, these results suggest that CD4-derived cytokines are the dominant source of this bystander cytokine support (Fig. 44C). Although the skin from immunodeficient D 2 C Rag-1 7" animals would be expected to produce abundant amounts of IL-15 in response to infection [333], only a minority of 2C cells in these disease resistant animals expressed high levels of CD69 (Fig. 44C). This suggests that while other sources of cytokine can cause limited 2C cell bystander activation, only T cell-derived IL-2 or other C D 4 + effects are capable of predisposing to the D 2 C disease phenotype. To further investigate the effect of CD4 + CD25" T cell expansion and the subsequent liberation of T cell-derived IL-2 on the disease phenotype, it is planned to transfer C D 4 + C D 2 5 " cells to non-transgenic D B A / 2 Rag-1 7 " mice as well as D2C Rag-1 7" mice. The development of disease in the D 2 C Rag-1 7 " but not the D B A / 2 Rag-1 7 " recipients would provide further evidence for a role of 157 self-reactive 2C cells i n disease pathogenesis, while demonstrating that C D 4 T cell dysregulation is not sufficient for lesion development. Although it is likely that the cutaneous pathology in D 2 C mice is largely the result of inflammatory cytokines causing the bystander stimulation of memory phenotype self-reactive cells, these data also indicate thai the recognition of A g by the 2C T C R is critically important for this process. While the A g recognition by such terminal effector cells may be envisioned to focus the resultant immune response upon specified targets, the cognate A g of 2C cells in D 2 C mice is expressed systemically [110]. Therefore the peculiar distribution of disease caused by 2C cells in D 2 C mice seems inconsistent with a TCR-directed mechanism. However, the possibility that the target inflammation induced by the overgrowth of opportunistic pathogens was associated with an upregulation of epithelial stress ligands may reconcile this discrepancy as 2C cells in diseased D 2 C mice were found to express high levels of the stress ligand receptor N K G 2 D (Fig. 38B). A s the ligation of N K G 2 D has been shown to trigger cytotoxic T cell responses [322], it is possible that the expression of stress ligands by lesional tissue may thereby direct the subsequent immunopathological onslaught. While the recognition of A g by T C R may simply be a permissive step in this effector response, the interruption of T C R signaling may abrogate this effector functioning and thereby inhibit the development of autoimmune disease. A s "normal" mice and humans possess populations of circulating memory phenotype cells that express N K G 2 D [334], this mechanism may represent a real autoimmune threat in the presence of sufficient target tissue inflammation. The mechanism by which 2C cells induce psoriasiform lesions is likely related to the propensity of these cells to liberate IFN-y [61], since this cytokine has been shown to have an important role in the generation of psoriasiform disease [159, 335]. Interestingly, the administration of a blocking mAb against IFN-y in a pilot experiment was found to have a 158 mitigating effect upon disease, (data not shown), and the development of D 2 C IFN-y K O mice is in progress to definitively address the role of this cytokine in D 2 C pathophysiology. It is also planned to collect 2C cells from dexamethasone-treated mice, as well as D2C-Rag-r / _ mice to determine i f the self-reactive 2C cells in these animals, some of which were found to upregulate the acute activation marker CD69, were functionally impaired with respect to the liberation of IFN-y. While the results of these studies provided a solid basis for the understanding of psoriasiform pathophysiology in D 2 C mice, the resultant model was unable to explain certain observations, namely the confusing results of bone marrow chimera experiments. For example, while the finding that B 2 C d bone marrow could transfer disease to D B A / 2 recipients was explained by the necessity of D B A / 2 non-hematopoitic factors for disease pathogenesis, the failure of D 2 C bone marrow to transfer disease to D B A / 2 recipients was perplexing. A promising avenue of research which may reconcile these unexplained observations wi l l be the investigation of the cutaneous immune network in these animals. The suspicion that derangements in cutaneous immunity may be involved in D 2 C disease pathogenesis was based upon the finding of significant differences in the composition of cutaneous lymphocytes between disease resistant and disease susceptible bone marrow chimeras. This fortuitous data suggested that the loss of sentinel cutaneous y5 lymphocytes might contribute to the susceptibility to disease. Given that the y8 K O mutation on certain "weak" backgrounds is known to result in spontaneous cutaneous inflammation [126, 139], the likelihood of this hypothesis was considered sufficiently possible to warrant the investigation of y8 T cells in D 2 C pathophysiology. 159 Chapter 6; Cutaneous y5 T Lymphocytes and Their Role in Disease Pathophysiology 6.1 Introduction One of the skin's first lines of defense is a population of y5 TCR-expressing intraepithelial lymphocytes (IEL), which have been shown to play a major role in the maintenance of the epidermal barrier as well as the regulation of cutaneous inflammation [126]. Cutaneous y8 IELs can respond quickly [126] to k i l l epithelial cells that are stressed by infection [336-338] or by transformation [322, 336, 339], without the delay necessary for the expansion of rare cognate antigen-specific clones that occurs in conventional adaptive immune responses [1]. y5 IELs perform "innate" surveillance [126] by virtue of their constitutively-expressed stress ligand receptor, N K G 2 D [340], and their canonical Vy3V51 T C R [341] which together coordinately bind to separate epitopes on stress ligands [15, 342]. In multiple murine TCR5" 7" models, mice develop spontaneous cutaneous inflammation [139] and/or exaggerated immunopathology in response to epithelial insults [142, 143]. The similarities between these other model systems and D 2 C mice suggested that a natural deficiency of such sentinel cutaneous lymphocytes might underlie disease pathophysiology in the D 2 C model system. To first investigate the hypothesis that an impairment in cutaneous y5 cells played a role in disease, the immunophenotype of IELs was ascertained in various 2C transgenic and non-transgenic animals. Interestingly; no cutaneous y5 T cells were found in any 2C-expressing animals, all of which possessed a cutaneous compartment occupied almost exclusively by 2C TCR-expressing lymphocytes. These intraepidermal 2C cells had a dendritic morphology analogous to cutaneous y8 cells and were found in roughly the same concentration as y5 cells in normal murine epidermis. Interestingly, the frequency of intraepidermal lymphocytes on the D B A / 2 background, both 2C cehs in D 2 C mice and y8 cells in D B A / 2 mice, was much reduced 160 relative to intraepidermal lymphocytes in B 2 C and B6 mice, respectively. On a mixed ( B 6 x D B A / 2 ) N i background, the frequency of IELs for both 2C and non-2C animals was equal to that of B 2 C and B6 mice, respectively, indicating that the low frequency of cutaneous IEL in the D B A / 2 background did not follow an autosomal dominant inheritance pattern. Rather, transgenic and non-transgenic N 2 backcrosses to the D B A / 2 background had approximately equal numbers of animals possessing the B6-like and DBA/2- l ike frequency of intraepidermal lymphocytes, indicating a possible autosomal recessive mode of inheritance. Intriguingly, the pattern of inheritance of the low IEL phenotype was somewhat similar to the pattern of disease penetrance N 2 2 C D B A / 2 backcrosses. To see i f this low frequency of intraepidermal lymphocytes correlated with disease susceptibility in N 2 2 C backcrosses to the D B A / 2 background, this parameter was assayed in N 2 2 C backcrosses being followed for the development of cutaneous pathology. Interestingly, N 2 2 C backcrosses possessing lower levels of 2C IELs were found to be less 1 susceptible than littermates possessing higher number of 2C IELs, suggesting that the lower number of 2C IELs did not predispose these animals to disease. Rather, this data lent further support to the important role of the self-reactive 2C cell in disease pathogenesis. The conclusion that the 2C IEL were not protective was supported by the finding that 2C mice, from all backgrounds, had an impairment in their cutaneous barrier function equal to that of TCR8" / _ mice, as assayed by the application of the cutaneous irritant croton oi l . These data suggested that T C R transgenesis rendered these animals deficient in cutaneous immunosurveillance functioning. Given this new understanding, the seemingly discordant bone marrow transplant results were re-investigated with respect to this new parameter. The finding that B 2 C d bone marrow but not D 2 C bone marrow could transfer disease to lethally irradiated D B A / 2 recipients was correlated with a preserved population of cutaneous y5 sentinel cells in recipients of D 2 C marrow, whereas, in D B A / 2 recipients of B 2 C d marrow, the epidermis was inhabited almost exclusively by 2C T C R -161 bearing T cells. To further address the role of y8 T cell deficiency in disease pathogenesis, the TCR8" 7" mutation was backcrossed from the B6 to the D B A / 2 background. D B A / 2 TCR8"" mice were completely devoid of any features of the D 2 C phenotype; however, when these mice were used as recipients of D 2 C bone marrow, the resulting chimeric animals developed typical features of D 2 C disease. Analysis of the epidermis from these animals revealed that, in contrast to y8 + /" recipients, these animals were deficient in cutaneous y8 T cells and replete with i cutaneous 2C cells. The analysis; of peripheral 2C cell activation in these aforementioned experiments also revealed that disruption of the cutaneous barrier is a proximal event in disease pathogenesis which is necessary for the subsequent development of bystander stimulation of the 2C D N T C . 6.2 Intraepithelial Lymphocytes in 2C Mice 6.2.1 Characterization of IELs in 2C T C R Transgenic and Non-Transgenic Mice on the B6, DBA/2, and Mixed (B6xDBA /2)N- Backgrounds To address the role of cutaneous y8 T cells in the model, flow cytometry was performed on cell suspensions prepared from the epidermal sheets of 2C-expressing and non-transgenic B6 , D B A / 2 and mixed ( B 6 x D B A / 2 ) N i mice to assay for the presence of y8 T cells and 2C cells. As expected, the epidermis from B6^ D B A / 2 and mixed ( B 6 x D B A / 2 ) N i mice lacked 2C cells and the vast majority of cutaneous IEL in these animals were yS T cells, expressing the canonical Vy3V81 T C R (Fig. 45). Surprisingly, a sizable reduction of y8 T cells was observed in D B A / 2 mice relative to B6 and ( B 6 x D B A / 2 ) N i animals (Fig. 45). Such an observation is not entirely unexpected as a reduction in the frequency of cutaneous y8 IEL is known to occur in several inbred strains including B A L B / c mice [343]. Although the observation that different inbred strains can harbour different frequencies of cutaneous IEL is intriguing, its relevance to disease 162 F i g u r e 45. C h a r a c t e r i z a t i o n o f C u t a n e o u s I n t r a e p i t h e l i a l L y m p h o c y t e s i n B6 , D B A / 2 a n d M i x e d (B6xDBA /2)Ni M i c e W i t h o r W i t h o u t the 2C T C R Transgenes Epidermal cell suspensions from the specified animals were prepared using dispase digestion, dissection with jeweler's forceps under a dissecting microscope, and disaggregation of the epidermis by grinding through a steel seive. Cells were stained with the a-2C T C R mAb 1B2 and a pan-y5 T C R m A b (GL3). Representative dot plots are gated on live lymphocytes. Note: numbers indicate percentage of total cutaneous cells (non-enriched sample). 163 pathogenesis is unclear. Next, the frequency and immunophenotype of cutaneous IEL in B6 , D B A / 2 , and mixed I ( B 6 x D B A / 2 ) N i mice expressing; the 2C T C R transgenes was assayed by flow cytometry. In 2C-expressing animals, no cutaneous y8 T cells were appreciated in any of the backgrounds while all of the ccP-expressing cells within the epidermis of these animals expressed the 2C receptor (Fig. 45). Furthermore, D 2 C mice were observed to have a reduced number of cutaneous 2C IELs relative to B 2 C and ( B 6 x D B A / 2 ) N | 2 C animals, analogous to that seen with non-transgenic animals (Fig. 45). The replacement of cutaneous y8 cells by Tg T C R cells has been described previously, with the completeness of this process determined by the timing of the Tg T C R expression in the thymus [113]. The complete absence of y8 cells suggested that the 2C T C R was expressed before day 14 of development, after which V y 3 V S l ontogeny begins [93]. Immunohistochemical analysis of the skin from B 2 C , ( B 6 x D B A / 2 ) N i 2 C , and D 2 C mice using the 2C TCR-specific m A b 1B2 revealed that 2C cells assume a dendritic arrangement with fine branching processes reaching between adjacent keratinocytes, a configuration seen with cutaneous y8 T cells (Fig. 46A). 1B2 immunohistochemical staining of the gut from these same animals also revealed large numbers of 2C IELs and 2C lamina propria cells (Fig. 46B). These data suggested that all IEL populations in 2C mice express the 2C T C R while the development of dendritic morphology in cutaneoiis IELs may signify that these cells are behaving like their cutaneous yS counterparts. However, previous studies have demonstrated that T C R transgenic mice with a complete replacement of cutaneous y8 cells with Tg T cells are akin to TCR8 _ / " mice [344]. These studies demonstrated that the failure to express the canonical Vy3V81 T C R , which coordinately binds to stress ligands together with the stress ligand receptor N K G 2 D [15, 342], impairs the ability of these cells to perform their normal immunosurveillance duties [344]. ; 164 hair shaft within follicle surface-lining epidermis .dermis intraepithelial 2C cells f • M / • H E _ V \ H ' i sebacceous — j -gland intraepithelial 2C cells epidermal appendage sebacceous gland Figure 46. 2C Cells Located within Epi thel ia l Sites (A) Acetone-fixed frozen tissue sections of (B6xDBA/2)N-2C mouse skin were stained with the biotinylated a-2C T C R m A b 1B2. HRP-labeled Streptavidin and the Vector® Nova Red H R P immunohistochemistry kit were used to develop the staining. Representative photomicrographs are shown. (B) Acetone-fixed frozen tissue sections from the small intestine of ( B 6 x D B A / 2 ) N i 2 C mice were stained with 1B2 as described above. Representative photomicrographs are shown. 165 Nevertheless, other studies have demonstrated that cutaneous IELs expressing a T C R other than the canonical Vy3V51 receptor may also behave like typical D E T C [345]. Therefore, although these data indicate that expression of the 2C T C R transgenes abrogated the normal development of cutaneous y8 IEL , this neither \ supports nor refutes the possibility that 2C TCR-expressing IELs are capable of protecting against cutaneous insults. Interestingly, B A L B / c mice, which are also known to develop spontaneous inflammatory skin disease when expressing the 2C T C R , share with D B A / 2 mice a lymphopenia of cutaneous IEL [343]. This observation suggested that this cutaneous IEL "defect" might represent an important factor in disease pathogenesis. To determine i f this lymphopenia of cutaneous IEL on the D B A / 2 background was involved in controlling disease penetrance, the inheritance pattern of this phenotype was first ascertained by quantifying the number of lymphocytes in anti-CD3-stained epidermal sheets by immunohistochemistry. As previously seen by FACS® analysis, the frequency of C D 3 positive cells in the skin of D B A / 2 and D 2 C mice was considerably lower than in B6 and B 2 C mice respectively while the equivalent number of cutaneous IELs in B6 and ( B 6 x D B A / 2 ) N i mice as well as in B 2 C and (B6xDBA/2)N]2C mice was once again appreciated (Fig. 47A, B) . In the second backcross generation, equal numbers of N 2 2 C mice had high levels (B6-like) and low levels (DBA/2,-like) of cutaneous 2C cells (Fig. 47C). These data were consistent with an autosomal recessive pattern of inheritance of this phenotype and, interestingly, this was similar to the pattern of disease penetrance in N 2 2 C backcrosses to the D B A / 2 background. Given this similar inheritance pattern and the important immunosurveillance role of cutaneous IELs, it was hypothesized that a reduced frequency of cutaneous IEL might confer an increased susceptibility to disease. To determine i f a correlation existed between the frequency of 2C IEL and the susceptibility to disease, these parameters were compared in ( B 6 x D B A / 2 ) N 2 2 C 166 D2C Transgenic (B6xDBA/2)N 12C w a r n DBA/2 Non-Transgenic ( B 6 x D E W 2 ) N B Irt 2 0 I J "EL » 15 U J « o f 10 I f i i 5 ^ 75% i i 5 0 % S i 8 5 25% V CL B6 f f • Non-transgenic • 2C transgenic (B6xDBA/2)N 1 r h T DBA/2 • (B6xDBA/2)N 2 • (B6xDBA/2)N 22C 0-6 7-14 C D 3 + Epidermal Cells / HPF 167 Figure 47. Microscopic Examination of Cutaneous Intraepithelial Lymphocyte Density (A) Shaved skin from the indicated animals was floated dermal side down in a solution of ammonium thiocynate, followed by the manual separation of the intact epidermis. Epidermal sheets were acetone-fixed and stained with a biotinylated m A b against C D 3 (145.2C11). H R P -labeled Streptavidin and the Vector® Nova Red H R P immunohistochemistry kit were used to develop the staining. Representative photomicrographs are shown. (B) Epidermal sheets were collected and stained as described above. The number of C D 3 + intraepidermal T cells in epidermal sheets was quantified per high power field (HPF) for both 2C transgenic and non-transgenic animals on the B6, D B A / 2 and mixed ( B 6 x D B A / 2 ) N i background (n=4 animals per group). Data is demonstrated in bar graph format. (C) Epidermal sheets were collected and stained as described above. The number of C D 3 + intraepidermal T cells in epidermal sheets was quantified per H P F for both 2C transgenic and non-transgenic (B6xDBA/2)N2 backcrosses to the D B A / 2 background (n>10 animals per group). The number of intraepidermal C D 3 + T cells per H P F was arbitrarily divided into a "low" group (0-6) and a "high" group (7-14). Data is presented as the percentage of animals within each group in bar graph format. 168 backcrosses to the D B A / 2 background (Fig. 48). Interestingly, (B6xDBA/2)N22C mice having the highest concentration of cutaneous 2C cells were found to have the most severe disease, while animals with the fewest 2C cells were more resistant to the development of disease and possessed a milder disease phenotype (Fig. 48). Contrary to what would be expected for a population of sentinel lymphocytes, these data suggest that an increased frequency of 2C cells in the skin is not more protective, further supporting the notion that transgenic lymphocytes cannot perform the surveillance functions of normal y8 cells. Rather, these data seems to suggest that having a higher percentage of self-reactive cells in the skin is a risk factor for the development of increased cutaneous pathology, which is not unexpected especially given the known role of the self-reactive 2C cells in disease pathogenesis (Fig. 40). 6.2.2 C u t a n e o u s I m m u n o r e g u l a t o r y F u n c t i o n o f 2 C I E L s i n D 2 C M i c e Since the specialized immunosurveillance properties of y8 T cells such as wound healing and keratinocyte growth factor ( K G F ) liberation are believed to be dependent upon the presence of the Vy3V51 y8 T C R [344], it is suspected that transgenic mice devoid of yS cells may be akin to yS K O mice [344]. The finding that a high frequency of 2C IELs was not more protective than a lower frequency of these cells in ( B 6 x D B A / 2 ) N 2 2 C animals seems to assert this belief. However, given the possibility that cutaneous 2C I E L may represent yS cells incognito [97, 113], it is conceivable that these cells may still afford some protection to these animals. While the 2C receptor would not be expected to recognize M H C class IB stress ligands, the constitutive expression of the stress ligand receptor N K G 2 D by cutaneous IEL [340] may impart some immunosurveillance function to the 2C IELs. To address whether the 2C cells in the skin of 2C mice behave as sentinel lymphocytes, TCRS - / " , 2C, and wildtype control mice were challenged with an application of a 2% croton oil 169 S2 CO $ s i • so 55 A 0 4 8 12 16 C D 3 + Epidermal Cells / HPF 0 - 6 7 - 1 4 C D 3 + Epidermal Cells / HPF F i g u r e 48. C o r r e l a t i o n o f I n t r a e p i t h e l i a l C D 3 + C e l l D e n s i t y w i t h S u s c e p t i b i l i t y to the D e v e l o p m e n t o f C u t a n e o u s P a t h o l o g y (A) Epidermal sheets were collected from dorsal skin and stained as described previously. The number of C D 3 + intraepidermal T cells in epidermal sheets was quantified per H P F for ( B 6 x D B A / 2 ) N 2 2 C backcrosses to the D B A / 2 background (n=20 animals). The number of intraepidermal C D 3 + T cells per H P F was arbitrarily divided into a "low" group (0-6) and a "high" group (7-14). Prior to skin harvest for this analysis, animals had been observed daily for the development of disease, which was graded according to the previously described scale. Data is presented as a scatterplot demonstrating the relationship between the density of C D 3 + IEL and susceptibility to disease. (B) This same data is presented in bar graph format. 170 solution [346]. In normal animals, a 2% solution of this cutaneous irritant causes local erythema, which peaks within 2-3 days after application and thereafter resolves [347]. However, in TCR8" A mice, the application of croton oil results in a more profound and prolonged cutaneous inflammatory response [139] due to an impaired cutaneous barrier and an absence of cutaneous immunoregulatory function in these mice [139, 344]. Consistent with the literature, both B6 and D B A / 2 wildtype mice were resistant to lesion development (Fig. 49), while TCR8" 7" mice developed ulcerated cutaneous defects. Interestingly, croton oil painting of both B 2 C d and D 2 C mice resulted in the development of lesions similar to those observed on TCR8~ A animals (Fig. 49). These results indicate that, at least in this irritant assay, neither a high (B2C d ) nor a low (D2C) frequency of cutaneous 2C IELs are capable of maintaining a normal barrier function or repelling circulating inflammatory cells, functions previously ascribed to cutaneous yS I E L [139, 344]. These data are therefore consistent with those previous studies proclaiming that T C R transgenic animals lacking Vy3V81 T cells in the skin are akin to TCR8 _ / " mice [344]. Furthermore, the replacement of these immunoregulatory cells with self-reactive 2C lymphocytes, capable of undergoing bystander stimulation, imparts to these mice a strong susceptibility to the development of spontaneous, localized autoimmune disease. 6.2.3 Adoptive Transfer of Disease is Associated with the Replacement of Cutaneous yS T Cells with 2 C Lymphocytes With the knowledge that 2C mice were akin to TCR8 _ / " animals and that 2C cells in the skin exacerbated rather than protected from disease, an attempt to understand the results of previous adoptive transfer experiment was made. The finding that ( B 6 x D B A / 2 ) N i 2 C and B 2 C d , but not D 2 C , bone marrow could adoptively transfer disease to D B A / 2 recipient mice was particularly perplexing (Fig. 50A, B) , especially since all of these resulting chimeric animals had 171 F i g u r e 49. C r o t o n O i l A p p l i c a t i o n to Assess C u t a n e o u s B a r r i e r F u n c t i o n A 2% croton oil in acetone solution was applied with a cotton swab to the trimmed dorsal trunk of indicated mice (n=5 animals per group). Five days post-application, mice were euthanized and the extent of gross disease was documented. Representative H&E-stained histological sections taken from the croton o i l application area are shown. 172 A D2C-> DBA/2 BMC B2Cd-> DBA/2 BMC D B A / 2 B M C D B A / 2 B M C C D 6 9 Figure 50. Susceptibility of D B A / 2 Recipient M i c e to Disease Fol lowing Transfer of D 2 C and B 2 C d Bone M a r r o w (A) Lethally irradiated (1150 rads) D B A / 2 mice were transplanted with T cell-depleted bone marrow from either D 2 C or B 2 C d donor animals (n=4 animals in each of three individual experiments). Representative gross and microscopic photographs are shown. (B) The effectiveness of the bone marrow transplant in transferring disease was quantified by observing and grading resultant disease in the indicated bone marrow chimeras ( B M C ) . The data is summarized in bar graph format. (C) Three months post-transplant, L N were harvested from the indicated B M C , prepared for flow cytometry, and stained with mAbs against the 2C T C R (1B2) and CD69 (H1.2F3). Representative histograms are gated on live 1B2 + cells. 173 nearly indistinguishable hematopoietic systems upon reconstitution (data not shown). Given the similar thymic and peripheral lymphoid compartments in these chimeric animals (data not shown), an evaluation of the cutaneous immune network was undertaken to determine whether differences in the skin could account for the differing susceptibility of these chimeric animals to disease (Fig. 51 A ) . This possibility was plausible given the incomplete reconstitution of skin immune cells following bone marrow transplant. For example, skin dendritic cells may not be cleared by the y-irradiation used to prepare recipients for a bone marrow transfer, as this generally requires U V irradiation [348], and cutaneous IEL may'be replenished by a radio-resistant precursor within the thymus [349], thwarting the colonization of the skin by donor-derived cells. Examination of the skin of disease-susceptible D B A / 2 recipients of B 2 C d or (B6xDBA/2)N-2C bone marrow by flow cytometry revealed that more than two-thirds of the cutaneous IEL were 2C cells with the remainder expressing the canonical Vy3V81 T C R (Fig. 51 A , B ; Table 6), while the epidermis of disease-resistant D B A / 2 recipients of D 2 C bone marrow was populated almost exclusively by Vy3V81 y8 T cells (Fig. 51 A , B ; Table 6). As the 2C hematopoietic system does not support the development of y8 T cells (Fig. 45), these cutaneous y8 sentinels had to have been derived from the D B A / 2 recipients. This fortuitous discovery argued in favour of the possibility that replacement of the immunoregulatory y8 cutaneous IEL with self-reactive 2C lymphocytes was a critical factor in disease pathogenesis. 174 A B2Cd —• DBA/2 BMC D2C —• DBA/2 BMC B B2Cd —• DBA/2 BMC D2C —• DBA/2 BMC 1B2 (Anti-2C TCR) 1B2 (Anti-2C TCR) F i g u r e 5 1 . C h a r a c t e r i z a t i o n o f C u t a n e o u s I n t r a e p i t h e l i a l L y m p h o c y t e s i n D B A / 2 R e c i p i e n t s o f D 2 C a n d B 2 C d B o n e M a r r o w ( A ) Acetone-fixed frozen tissue sections from the dorsal trunk skin of indicated bone marrow chimeras ( B M C ) were incubated with the biotinylated ct-2C T C R m A b (1B2). HRP-labeled Streptavidin and the Vector® Nova Red H R P immunohistochemistry (IHC) kit were used to develop the staining. Representative photomicrographs are shown. (B ) Epidermis from indicated B M C animals was separated from underlying dermis using jeweler's forceps and a dissecting microscope after incubation in a solution of dispase type II. Epidermal cells were disaggregated by vigorous pipetting and straining through a steel sieve. The cells were stained with 1B2 and a pan-y5 T C R m A b (GL3). Representative dot plots are gated on live cells. Note: numbers indicate percentage of total cutaneous lymphocytes. 175 Table 6. Cutaneous Lymphocyte Subsets in the Various Mouse Strains Studied yS+ DETC (Relative %) 2C + DETC (Relative %) Subjects Developing Disease D B A / 2 100%+ 0% 0% ± 0% 0% D 2 C 0% ± 0% 100% ± 0 % 100% B 2 C d bone marrow -> B 6 d recipient 91.5% ± 6 % 8.5% + 6 % 0% B 2 C d bone marrow -> D B A / 2 recipient 27.9% ± 3% 72.1% ± 3 % 100% D 2 C bone marrow -> B 6 d recipient 99.3% ± 0% 0.7% ± 0% 0% D 2 C bone marrow -> D B A / 2 recipient 92.1% ± 4 % 7.9% ± 4% 0% D 2 C D N T C -» D B A / 2 recipient 100% ± 0 % 0% ± 0% 0% 6.2.4 Adoptive Transfer of Disease to DBA/2 TCR5 Mice Based on the suspected importance of y8 lymphopenia in the D 2 C model system and the development of spontaneous skin inflammation in TCR8" A mutant mice on some inbred strains, it was of interest to see whether the expression of the TCR8 - / " mutation on the D B A / 2 background would be associated with the development of spontaneous skin inflammation. In order to test the sufficiency of y8 lymphopenia for development of the D 2 C disease phenotype, the TCR8" A mutation was partially backcrossed from the B6 to the D B A / 2 background (5 backcross generations). The resultant D B A / 2 TCR8 _ / " mice remained disease-free and were indistinguishable from D B A / 2 T C R S + / " littermates (Fig. 52A, B) . Furthermore there was no microscopic evidence of subclinical disease (Fig. 52A), or other features of D 2 C pathology such as hypergammaglobulinemia (Fig. 52C). These findings were not unexpected since D B A / 2 TCR8" A mice are not lymphopenic of conventional lymphocytes nor do these animals have a deficiency of C D 4 + C D 2 5 + T r e g , and thus these animals do not experience the massive dysregulated expansion of T lymphocytes typical of unmanipulated D 2 C animals. Furthermore, 176 DBA/2 TCRS + /" DBA/2TCR(S-/-o 0_ w tn o k_ C D O o "co o 1i2 I C 32 CO B 100% 80% 60% 40% 20% • S3 • S2 • S1 • so 350 g 300 q> 250 3 O 200 - 150 5 100 co 50 DBA/2 TCR6+/-DBA/2 TCR6-/-DBA/2 TCR6+/-DBA/2 TCRcS"/-Figure 52. Characterization of D B A / 2 T C R 5 M i c e (A) B 6 b TCR8~ A mice were backcrossed 5 generations to the D B A / 2 background. Representative gross photographs of a D B A / 2 yd''' mouse and a D B A / 2 y5 + /" littermate control mouse are shown. Representative photomicrographs o f rostral skin from a D B A / 2 yd'1' mouse and a D B A / 2 y 8 + A littermate control mouse are shown. (B) The extent of clinical disease in D B A / 2 TCR8" A and D B A / 2 T C R 8 + A littermate controls was monitored and depicted in the shown bar graph (n=25 animals per group). (C) Serum was collected from D B A / 2 TCR8" A and D B A / 2 TCR8 + / " littermate controls and assayed by E L I S A for serum IgG as previously described. 177 these animals do not have large populations of circulating and intraepithelial self-reactive 2C lymphocytes. Therefore, despite the importance of y5 dysfunction in the model system, a lymphopenia of cutaneous yS IELs is not sufficient for the induction of spontaneous psoriasiform disease. Given the purported role of yS T cells in the disease resistance of D B A / 2 recipients of D 2 C bone marrow (Fig. 50, 51; Table 6), it was hypothesized that D 2 C bone marrow could adoptively transfer the disease phenotype to D B A / 2 TCR5 _ / " mice. In these chimeric mice, no radio-resistant thymic precursor cells would be able to successfully compete with donor-derived 2C lymphocytes for epithelial colonization. Therefore D 2 C bone marrow was adoptively transferred to littermate T C R 5 + / " and TCR8 _ /~ mice. D B A / 2 TCR8 _ / " recipients developed a moderate disease phenotype characterized by S1-S2 cutaneous pathology and typical psoriasiform histopathology while T C R 8 + / " recipients remained free from disease (Fig. 53A, B) . Furthermore, the majority of 2C cells in D B A / 2 TCR8" / _ recipients of D 2 C marrow were acutely activated, expressing high levels of CD69 while only a small minority of 2C cells were acutely activated in T C R 8 + / " recipients (Fig. 53C). The lesser phenotype of these D B A / 2 TCR8" A recipients (Fig. 53B), relative to "wildtype" D 2 C mice (Fig. 17) or D B A / 2 recipients of B 2 C d bone marrow (Fig. 18B, 50B), could be attributable in part to the incomplete backcrossing of the T C R 8 mutation to the D B A / 2 background, as only five backcrosses were performed. Therefore, it is plausible that residual B6 genes may have precluded the generation of the full disease phenotype. Other considerations such as the age of the recipient mice as well as the prevailing housing conditions may have also impacted upon the ultimate disease phenotype of these chimeras. Nevertheless the spontaneous disease development in D B A / 2 TCR8" A but not D B A / 2 T C R S + / " bone marrow chimeras demonstrated the necessity of cutaneous y8 lymphopenia in D 2 C 178 D 2 C - D B A / 2 T C R 8 + / " BMC D 2 C - D B A / 2 JCR6'f' BMC B • S3 • S2 • so D 2 C D B A / 2 D2C-*>DBA/2 TCRS+ /" BMC TCRa"7" BMC I TCR<>+/~ BMC D 2 C - * DBA/2 TCRft"7" BMC CD69 D2C->DBA/2TCR8 + / " BMC D2C-* DBA/2 TCR8'/~BMC 1B2 1 7 9 Figure 53. Characterization of DBA/2 TCR5 Recipients of D2C Bone Marrow (A) Lethally irradiated (1150 rads) D B A / 2 TCR5" 7" and littermate control D B A / 2 T C R 8 + / " mice were transplanted with T cell-depleted D 2 C bone marrow (n=4 animals per group). Ten weeks post-transfer, animals were sacrificed for necroscopic examination. Representative gross and microscopic photographs of the rostral skin are shown. (B) The effectiveness of disease transfer with D 2 C bone marrow to D B A / 2 T C R 8 + / " and D B A / 2 TCR8 _ / " recipients was quantified by observing and grading resultant disease in the indicated bone marrow chimeras ( B M C ) . The data is summarized in bar graph format. (C) Ten weeks post-transplant, L N were harvested from the indicated B M C , processed for flow cytometry, and stained with mAbs against the 2C T C R (1B2) and CD69 (H1.2F3). Representative histograms are gated on live 1B2 + cells. (D) Epidermis from indicated B M C animals was separated from underlying dermis using jeweler's forceps and a dissecting microscope after incubation in a solution of dispase type II. Epidermal cells were disaggregated by vigorous pipetting and straining through a steel sieve: The cells were stained with 1B2 and a pan-y8 T C R mAb (GL3). Representative dot plots are gated on live cells. Note: numbers indicate percentage of total cutaneous lymphocytes. 180 psoriasiform pathology (Fig. 53). Future studies on these chimeric mice w i l l focus upon whether an intact cutaneous barrier in D B A / 2 recipients of D 2 C bone marrow, maintained by a resident population of y8 T cells, prevented the microbial Ag-specific expansion of CD4 T cells, relative to the D B A / 2 TCRS" 7 " recipients of D 2 C bone marrow in which this expansion would be predicted to occur. Such a finding would demonstrate that the disruption of the cutaneous barrier occurs proximal to the dysregulated C D 4 T cell expansion and thus represents the proximal-most defect in disease pathogenesis. 6.3 Conclusion Despite the implication of cutaneous opportunistic pathogens, a population of self-reactive 2C cells, and a dysregulated expansion of C D 4 + C D 2 5 " T cells in D 2 C disease pathogenesis, these elements alone were insufficient for disease as demonstrated by the failed adoptive transfer of disease to D B A / 2 recipients by D 2 C bone marrow. The data presented in this chapter demonstrates an important collaborative role for cutaneous y8 T cell lymphopenia in disease pathogenesis, which is necessary (Fig. 53) but not sufficient (Fig. 52) for disease development. It is not surprising that cutaneous y8 T cells, or rather a lack there of, was found to have a role in D 2 C disease pathogenesis as these cells are known to have a critical role in the immunosurveillance against cutaneous infection, the immunoregulation of inflammatory cells, and the general homeostasis of the skin. These critical functions of cutaneous y8 T cells, made a possible defect in these important sentinel lymphocytes a potentially unifying factor in disease pathogenesis worthy of further investigation. As opportunistic pathogen overgrowth represents a component of SD disease pathogenesis [203, 219], the finding that stress ligands are upregulated in the lesional skin of SD 181 patients is not unexpected [227]. Normally, the recognition of such stress ligands by the coordinate binding by the V y 3 V S l T C R and the N K G 2 D receptor on sentinel cutaneous y8 T cells [15, 342] would activate these cells to perform essential functions aimed at restoring cutaneous homeostasis [344]. For example, the y5 T cell recognition of stressed cells [322, 323] would result in the apoptotic death of infected keratinocytes [336], thereby abrogating the profound release of preformed and newly synthesized inflammatory mediators from keratinocytes [350]. Moreover, the release of the anti-chemotactic factor pTf34 and the upregulation of more potent splice variants of this factor by activated y8 T cells [139, 140] would repel circulating inflammatory cells, preventing their exocytosis into the skin [139], while the secretion of K G F by y8 T cells would result in the proliferation and maturation of the epidermis [344], restoring the cutaneous barrier against pathogen invasion. Given the results of these D 2 C studies and the findings in human psoriasiform studies of high cytokine concentrations [167, 226, 351], prominent inflammatory cell infiltration [167, 228], and an impaired cutaneous barrier in lesional skin [167, 352], it is tempting to speculate that an impairment in the stress ligand/sentinel y8-T cell axis may exist in psoriasiform disease. This hypothesis is made even more intriguing by the known association between psoriasis susceptibility and the 5.1 allelic variant of the M I C A molecule [199, 200], which is characterized by a naked transmembrane protein deficient in its extracellular "signalling" domain that results from a premature stop codon. Therefore it is possible that an impaired recognition of stressed keratinocytes in psoriasiform disease and the subsequent failure to activate sentinel y8 T cells may result in the persistence of stressed cells and a chronic outpouring of inflammatory cytokines which orchestrate a massive exocytosis of inflammatory cells into the skin, including those capable of undergoing bystander stimulation and upregulating N K G 2 D receptor. 182 Given the possible impairment in immunosurveillance by cutaneous y8-T cells in patients with psoriasiform disease, it is likely that these individuals have a lower resistance to microbial challenge, which is consistent with the known role of opportunistic infection in SD pathophysiology. It is therefore not surprising that disease is aggravated by conditions favoring greater microbial colonization, such as the presence of damp, oily skin [165, 204]. These observations are not unlike what is observed in D 2 C mice where disease was found to be aggravated by unhygienic conditions [123]. A similar phenomenon was observed in a related model of cutaneous inflammation which involves the expression of the T C R d~'~ mutation on the F V B background [139], where it was found that mice can be made resistant to disease by being housed individually in ventilated cages. These housing conditions in which continuous airflow lowers the ambient humidity, reduces the levels of irritants and diminishes the potential for enhanced microbial colonization of the skin [126] would likely have a similar effect upon D 2 C disease since this condition is known to involve microbial overgrowth (Fig. 10). Although the current unavailability of reagents procludes this investigation, it is predicted that lesional skin in D 2 C mice wi l l be shown to have an increased expression of stress ligands. This finding would suggest that opportunistic infection of rostral skin with lipophilic organisms induces susceptibility to a localized autoimmune attack from NKG2D-expressing effector cells by causing a prolonged expression of epithelial stress ligands. The disruption of the cutaneous barrier and the increased colonization by opportunistic organisms in D 2 C mice likely results in a greater load of microbial A g presented in the draining lymph nodes, which in part drives the massive C D 4 expansion occurring in these mice (Fig. 23B, D). Although D 2 C Rag-1"A mice are deficient in y8 cells and have a slightly higher burden of opportunistic pathogens on the skin as assessed by histology (data not shown), these animals were resistant to disease (Fig. 44A) due to their deficiency of C D 4 + C D 2 5 " T cells. Future 183 experiments are planned to see whether the adoptive transfer of C D 4 + C D 2 5 " T cells w i l l restore the disease susceptibility of D 2 C Rag-1 7" mice. To further implicate the lymphopenia of y8 T cells in the model system, it is also planned to transfer D B A / 2 Vy3V51 T cells to D 2 C Rag-1 7" recipient mice prior to the administration of C D 4 + C D 2 5 " T cells. It is expected that the transferred y5 T cells w i l l abrogate disease development in these recipient animals by restoring the epidermal barrier, thereby precluding the delivery of microbial A g and the subsequent dysregulated expansion of C D 4 + T cells. The conclusion that cutaneous y5 T cell deficiency was critical for disease pathogenesis was first suggested by the results of bone marrow chimera studies (Fig. 53). This fortuitous observation is strongly indebted to a peculiarity of IEL homing which exists between inbred stains. Why B 2 C d but not D 2 C bone marrow was able to seed the recipient epidermis with 2C cells may somehow be related to the different frequencies of IEL in these inbred mouse strains (Fig. 45), as has been seen in other inbred strains [343]. The data suggest that given the same background genes, an IEL with the canonical Vy3V51 can outcompete cells with an "incorrect" receptor for epidermal colonization (Table 6). However, the data also suggests that the homing potential of D B A / 2 cells to the epidermis is so "impaired" that a cell expressing an incorrect T C R (ie., the 2C T C R ) can outcompete a D B A / 2 Vy3V51 cell for epidermal residence i f derived from a background with more favourable homing properties, for example the B6 background (Table 6). A cursory investigation of this D B A / 2 skin homing impairment included an assay for the expression of the integrin C D 103, which has been shown to be critical for lymphocyte residence in epithelial compartments [353]. While previous studies demonstrated that deficiencies in this receptor predisposed to inflammatory skin disease in certain mouse models [354], D B A / 2 Vy3V51 T cells were shown to express high levels of CD103 (data not shown). Nevertheless, the ill-defined D B A / 2 "impairment" in cutaneous y5 homing or survival was not 184 identified nor was this found to be of any physiological significance, as the lower concentration of cutaneous y5 cells in the D B A / 2 recipients of D 2 C marrow was fully capable of suppressing the entire disease phenotype. The greater understanding of the cutaneous immune network afforded by the aforementioned bone marrow chimera experiments was also instrumental in interpreting the results of previous experimentation. For example, the transfer of peripheral lymphoid C D 6 9 + 2C cells to irradiated D B A / 2 mice was unsuccessful in the adoptive transfer of the disease phenotype, demonstrating that 2C cells were not sufficient for disease (Fig. 42). The disease resistance in these recipient animals was attributed to a lack of T cell lymphopenia and CD4 repertoire skewing, and a bountiful T r e g population. Although these factors are known to be important for disease development, examination of the skin of these recipients demonstrated a full complement of Vy3V51 cells and a complete absence of 2C IEL (Table 6). Therefore, even i f these, animals were rendered immunodeficient and lymphopenic of T r e g by concomitant experimental manipulations, these recipients would be resistant to disease as a result of a full complement of cutaneous sentinel yS T cells. The failure of the donor 2C cells to colonize the skin (Table 6) likely reflects the fact that skin homing requires the requisite developmental programming of IEL precursors in the thymus [349], an education not received by the peripheral 2C T cells used as donor lymphocytes in this experiment. Although these data are exciting and may potentially contribute to our understanding of human psoriasiform disease, several discrepancies between murine and human cutaneous anatomy may limit the application of this data. Specifically, the epidermis of murine skin is only a few cell layers thick while human epidermis is significantly thicker (8-10 cell layers thick) providing a more formidable barrier to opportunistic pathogens [202]. However the lesional skin of D 2 C mice appears to conform to the typical psoriasiform reaction pattern observed in human 185 psoriasiform diseases (Fig. 4, 6, 9), indicating that the morphological differences in the skin between these species may be less applicable to this model system. Another obvious difference between murine and human skin is the lymphocyte subsets residing within the epidermis. While y5 T cells comprise the principal cutaneous lymphocyte population in murine skin (>95% of all T cells) [341, 355], human skin has a more heterogeneous population of cells with only a minority of cells expressing a V81 T C R [356]. Given the unique monoclonal population of y8-T cells in murine skin, the generalization of cutaneous findings in murine model systems to other organisms is a valid concern. However, the y8 T cell population in human epithelia is known to respond to the stress-induced expression of M I C A [15] and therefore these cells likely behave similarly to their murine counterparts. Therefore, even after due consideration of these differences in cutaneous architecture and immunity, this reliable disease model w i l l still undoubtedly contribute to our understanding of human psoriasiform disease. The innumerable parallels between human SD and D 2 C inflammatory skin disease suggest that an impairment in cutaneous y8 function may be a central defect in SD pathophysiology. Emerging studies on human psoriasiform disease support this possibility [199, 200, 227] which w i l l need to be confirmed by additional research. The ability of the D2C model to direct relevant experimentation on human psoriasiform disease, and to serve as a reliable tool for in-depth study of disease pathophysiology, exemplifies the utility of this unique model system. 186 Chapter 7: Implications of the D2C Model on Contemporary Hypotheses of Psoriasiform Disease Pathogenesis 7.1 Introduction The psoriasiform diseases are amongst the earliest diseases documented, as Hippocrates wrote about psoriasis [191] and ancient Egyptians used sap from the sycamore tree and extracts from the fig to treat such lesions [357, 358]. Despite the long history of these diseases, and over twenty thousand research publications to date, no clear consensus about disease pathophysiology has emerged with a divergent group of hypotheses including infection [193, 195], autoimmunity [178, 359], and a primary hyperproliferative disorder of the skin [189, 190] all considered to be facets of disease pathogenesis. The initial work with D 2 C mice has demonstrated that this model is an accurate representation of the human psoriasiform disease SD, and this work has already contributed to the understanding of how the various aspects of SD disease pathogenesis fit together in this complex skin disorder. The impact of the D 2 C model on the various theories of disease pathogenesis in psoraisiform disorders w i l l be discussed in turn. 7.2 Role of Intrinsic Keratinocyte Defects in Psoriasiform Disease Pathogenesis It was first theorized that the hyperproliferation of keratinocytes was the primary etiological factor in psoriasiform disease pathophysiology [178], leading to the introduction of anti-proliferative treatments such as selenium sulfide and zinc pyrithione [218] as well as anthralin, which inactivates enzymes associated with cell proliferation [176]. Psoralens became a mainstay of treatment in the 1970's when they were found, in association with U V irradiation, to interfere with D N A synthesis [175, 358]. The success of these treatments reinforced the belief that psoriasiform diseases were hyperproliferative disorders, and subsequent treatments popularized in the 1970's included methotrexate [182] and hydroxyurea [360], both of which are 187 known to inhibit keratinocyte proliferation [359, 360]. More recently, systemic and topical retinoids were added to the armamentarium of psoriasiform treatments [361], which have been shown to reduce keratinocyte proliferation by inhibiting D N A synthesis [362]. A l l of these treatments remain in use today [181, 361]; however, recognition of alternate mechanisms of action for these therapies has led to new insights into the mechanism of psoriasiform diseases. For example, both selenium sulfide and zinc pyrithione have been shown to possess anti-fungal properties [203, 363], implicating a role for opportunistic pathogens in psoriasiform disease. Similarly, anthralins have subsequently been shown to possess anti-inflammatory activity, such as the upregulation of the IL-10 receptor on cultured keratinocytes [364], which has shifted the focus of psoriasiform research primarily towards the role of immunity in disease pathogenesis. While methotrexate and hydroxyurea reduce keratinocyte proliferation [359, 360], these systemic therapies have also been shown to have a profound effect on inflammatory cells [359, 365]. For example, the effect of hydroxyurea on inhibiting ribonucleoside diphosphate reductase [366] is particularly toxic to activated T cells [365], which is consistent with the possibility that keratinocyte proliferation in psoriasiform disease may be a secondary response to the presence of activated T cells [178, 185]. Similarly the effect of systemic retinoids on treating disease may be more directly related to the effect of these drugs on inducing apoptosis in T cells [367], with the reduction of keratinocyte proliferation being a secondary effect. These observations have caused a major change in the thinking about psoriasiform disease with a recent emphasis on the role of autoimmune disease and/or an aberrant immune responses against benign epidermal commensal organisms taking central stage. However, this changing paradigm is not unanimously accepted as new evidence supporting the idea that psoriasis is a primary disease of the keratinocyte is still emerging [189-191] . For example, in psoriatic lesions, epidermal keratinocytes have reduced expression of JunB, a gene localized in the psoriasis susceptibility region PSORS6, and the 188 inducible epidermal deletion of JunB and its functional partner c-Jun in mice leads to a psoriasiform disease phenotype [189]. While studies in the D 2 C mouse support the new paradigm of psoriasiform pathogenesis, with strong evidence in favor of a dysregulated interaction between several T cell populations culminating in disease, these data do not definitively exclude the possibility that a primary keratinocyte disorder is also a feature of the disease model. Although the ability to adoptively transfer the disease phenotype to D B A / 2 recipients by B 2 C d or ( B 6 x D B A / 2 ) N i 2 C bone marrow (Fig. 18, 50) was originally interpreted as reflecting a requirement for D B A / 2 non-hematopoietic factors, this data was later complicated by the realization that the variability of disease transfer was in part attributable to the ability to transfer cutaneous y5 lymphocytes between various strains (Fig. 51, Table 6). While disease was never transferred to a "disease-resistant" background such as non-transgenic B 6 d or ( B 6 x D B A / 2 ) N i mice, this failure likely reflected an inability to eliminate recipient derived cutaneous y8 lymphocytes. Future experiments which address this issue wi l l be pursued to determine whether D B A / 2 skin is in fact uniquely susceptible to psoriasiform pathology, perhaps reflecting a primary defect of the keratinocyte. 7.3 Role of Infection in Psoriasiform Disease Despite the initial demonstration of the presence of opportunistic fungi in lesional SD skin, early investigators could find no relationship between these organisms and disease pathogenesis [194, 203, 205], However, the effective treatment of SD with azole antifungal agents [203, 363], and the resultant reduction in the number of Malassezia on the skin [368], clearly established a relationship between opportunistic pathogens and SD. Furthermore, a greater understanding of fungal biology has illustrated why these lipophilic organisms are trophic for "seborrheic areas" of the body [204, 369, 370], and how the direct fixation of complement 189 [194] and the liberation of both free fatty acids and arachidonic acid [194, 370, 371] by these organisms results in considerable cutaneous inflammation. Despite this evidence, it is unclear as to why "normal" numbers of these pathogens can initiate an inflammatory reaction in susceptible individuals whereas those with an inherent resistance to disease can tolerate large burdens of these organisms on the skin [203, 205, 372]. These findings suggest that SD patients may be predisposed towards infection with these organisms or an aberrant immune response against them. The finding that the development of SD is associated with both complement deficiencies [210, 211] as well as A I D S [206, 208] supports this hypothesis; however, the susceptibility to SD in seemingly immunocompetent individuals may also be the result of subtle, unrecognized immunodeficiency. The finding that the skin of SD patients is characterized by the expression of high levels of M I C A stress ligands [227] suggests that an impairment in the recognition and elimination of infected keratinocytes from the skin by sentinel yS T cells may be one form of this unrecognized immunodeficiency. Evidence from the D 2 C model demonstrates that, while complement deficiency (Fig. 19) and AIDS-l ike CD4 lymphopenia (Fig. 26, 27) have a role in disease pathogenesis, a defect in cutaneous y5 T cell function is a critically important facet of psoriasiform pathophysiology (Fig. 53). Interestingly, in the related psoriasiform disease psoriasis, a mutation in M I C A that results in a truncated stress ligand devoid of an extracellular component has been linked to psoriasis susceptibility [199, 200]. Such defects in the yS-stress ligand pathway would not only predispose to overgrowth by opportunistic pathogens but would also result in the failure to activate sentinel cutaneous y8 lymphocytes, and thereby the failure to maintain a protective cutaneous barrier by K G F production [344]. Furthermore, a reduced output of pTpM from activated y5 cells in stressed skin [140] would fail to repel circulating memory phenotype cells [139] which, upon bystander stimulation, upregulate N K G 2 D [373] and thus have the ability to unleash an immunological assault upon stress ligand-bearing keratinocytes 190 [322]. Since these circulating cells are not equipped to fight disease in the delicate epithelial environment, the resulting immune responses tend to be prolonged and inefficient [139, 163]. Interestingly, the formation of typical psoriasiform lesions in response to mild trauma in psoriasis (koebnerization) as well as the considerable exocytosis of neutrophils into the epidermis in SD and psoriasis [165, 166, 221] may be a manifestation of this impaired pTp4 production. Therefore, the failure of y5 IEL to recognize cutaneous infection would result in inflammation attributable to: the microbial colonization itself; the prolonged release of pre-formed, inflammatory mediators from stressed keratinocytes; and the failure to exclude circulating inflammatory cells which exacerbate the cutaneous inflammation. Therefore, infection arising in a background of a variety of immunodeficient states likely has a role in most cases of SD. Given the recent recognition of epithelial y8 T cell subsets and their specialized functions, as well as the unfolding understanding of stress ligand biology, it is not surprising that defective y5 T cell function and/or stress ligand immunobiology have not yet been widely recognized in SD. 7.4 R o l e o f the I m m u n e S y s t e m i n P s o r i a s i f o r m Disease : Much like many of the so-called "anti-proliferative" drugs used to treat psoriasiform disease were found to have antimicrobial effects, many drugs in the armamentarium of psoriasiform disease treatment have been shown to have anti-inflammatory properties. For example, recent studies have shown that anthralins [364], fumaric acid esters (FAE) [374], as well as vitamin D3 and its analogs [375] stimulate expression of IL-10 and/or its receptor, while phototherapy with U V B irradiation has been shown to result in a significant depletion of T cells from psoriatic lesions [359, 376]. Although retinoid-based therapies such as targretin have been 191 shown to suppress keratinocyte proliferation [377], these agents also work by inducing T cell apoptosis [367] and facilitating the upregulation of retinoic acid inducible stress ligands [378] that are recognized by sentinel V51 IEL [15, 342]. Glucocorticoids, which have strong efficacy in the treatment of psoriasiform disease [171, 205], have been shown to possess both anti-inflammatory and immunosuppressive activities including their ability to abrogate the proliferation of T cells and inhibit inflammatory cytokine gene transcription [181]. Moreover, some azole antifungal treatments, some of which were instrumental in supporting the fungal theory of SD pathogenesis [203], have been shown to have potent antinflammatory activity [363, 379]. These findings have contributed to the belief that the immune system may be the central orchestrator of disease pathogenesis in psoriasiform disease, with keratinocyte hyperproliferation occurring secondary to T cell activation [178]. Such an interpretation is consistent with the findings that activated T cells are a major component of psoriasiform inflammation [228, 380] and the effective treatment of psoriasiform diseases with the calcineurin-inhibiting immunosuppressants [213, 359] involves the inhibition of T-lymphocyte signal transduction, IL-2 transcription, and the expression of IL-2R on T cells [381]. These findings in human psoriasiform disease are consistent with data from the D 2 C mouse where the administration of dexamethasone to pre-diseased D 2 C mice protected against the development of the disease phenotype (Fig. 34) and was associated with a massive reduction in the total number of T cells (Fig. 35). The implication of immune dysfunction in psoriasiform disease pathogenesis has led to the production of numerous targeted "biologic" therapies, mostly in the form of monoclonal A b which block critical immunological pathways or deplete critical lymphocyte populations [359, 382, 383]. For example, etanercept (soluble TNF-oc receptor) as well as infliximab (humanized m A b against TNF-oc) block the effect of T N F - a [359, 382, 383]. Daclizumab and Basiliximab, 192 mAbs against CD25, block IL-2 from interacting with IL-2R on T cells [359, 382, 383] while Efaluzimab, a m A b against the CD1 l a subunit of L F A - 1 , has been shown to block the interaction of L F A - 1 and I C A M - 1 and subsequently mitigate disease by decreasing T-cell activation and migration [359, 382]. Numerous other mAbs have been developed to block T cell activation including: Siplizumab, an m A b against C D 2 that blocks C D 2 / L F A - 3 interaction [359, 383]; OKTcdr4a, a humanized anti-CD4 IgG4 m A b that inhibits A P C / T cell interaction [359, 382, 383]; and Galiximab a mAb against CD80 that blocks the provision of co-stimulatory molecules [359, 382-384]. A number of biologic agents such as the CD2-binding, LFA-3 - Ig fusion protein Alefacept and the diphtheria toxin-IL-2 fusion protein O N T A K have been shown to deplete activated/memory phenotype cells in psoriasis [185, 359, 382]. Although none of these agents are specific enough to implicate one particular subset of lymphocytes in lesion development, data from the D 2 C model suggests that NKG2D-expresssing, IFN-y-secreting, memory phenotype T cells can contribute non-specifically to an ongoing inflammatory response though the process of bystander T cell activation (Fig. 37, 38, 40). Interestingly, histochemical studies on SD have demonstrated that an irritant-like, target tissue inflammation that occurs in this condition, can in fact result in an increased number of non-specific, memory phenotype lymphocytes ( N K 1 + C D 1 6 + N K cells) in SD lesional tissue [226]. The results from the D 2 C model suggest that disease resolution in these animals occurs after the established of sufficient T cell regulatory control. Since convalescent D 2 C mice have a persistent defect in cutaneous y8-Tcells, these data also suggest that C D 4 + C D 2 5 + T r e g c a n compensate for this IEL deficiency. Interestingly, tolerization to ubiquitous commensal organisms has been shown to be dependent upon the function of IL-10-secreting T r e g [385, 386]. While IFN-y is consistently upregulated in psoriasiform disease [167, 387] and shown experimentally to be sufficient for lesion development in genetically susceptible individuals 193 [159], IL-10 which is a known downregulator of IFN-y expression [387], together with its receptor (IL-10R) are consistently deficient in psoriasiform lesions [167, 387, 388]. Furthermore, a polymorphism in the IL-10 promoter is associated with the familial form of psoriasis [389]. This deficiency of IL-10 in human psoriasiform diseases [387] would be expected to result in a more stimulating milieu for T lymphocytes since IL-10's anti-inflammatory functions include the induction of Ag-specific regulatory T cells [390, 391], reducing the expression of M H C class II [392, 393] and co-stimulator molecules [394], suppressing IL-2 transcription [387, 395] as well as contributing to T cell anergy [387, 396]. The invasion of opportunistic pathogens into such an environment would likely be associated with a vigorous, Ag-specific C D 4 T cell response against microbial A g ; and not surprisingly a massive influx of CD4 T cells is present in the lesional skin of D 2 C mice (Fig. 91) as well as in lesional skin from SD patients [228]. Results from the D 2 C mouse suggest that these CD4 cells play a pivotal role in psoriasiform disease pathogenesis as D2C mice devoid of C D 4 + C D 2 5 " "helper" T cells are resistant to disease (Fig. 44). The products of this T cell expansion, while initially harmful due to massive cytokine liberation, i.e., copious cytokine liberation, may eventually afford mild protection against disease as a result of partially-protective A b production (Fig. 28); however, convalescence in these animals only occurs after T cell regulatory control has been established. Therefore it is tempting to speculate that a defect in IL-10 secreting T r e g is a critical feature of human psoriasisiform disease pathogenesis. Such a prediction is consistent with the known ability of corticosteroids, which are highly effective in the treatment of psoriasiform disease [171, 205], to increase the relative number of T r e g [289], and the results of recent studies, which have demonstrated T r e g dysfunction to be a feature of psoriasiform disease [137]. 194 7.5 Conclusion After more than two millennia, an understanding of psoriasiform disease remains elusive and, with each insight gained, new questions arise. This illustrates the critical importance of a reliable animal model to test new hypotheses as well as potential treatments. The D 2 C model of psoriasiform disease clearly fits the current understanding of human psoriasiform diseases and demonstrates how a susceptibility to infection, development of target tissue inflammation, dysregulated T cell expansion due to defects in T r e g function, and cytokine-mediated bystander stimulation are intertwined in these complex disease processes (Fig. 54). 195 H - 2 d Haplotype Ubiquitous Mitochondrial Protein p 2 C a peptide DBA/2 High affinity interaction No CD8 DP Depletion T Unknown Effect Empty MHC II compartment Reduced Thymic Export of CD4T cells r Treg lymphopenia /D4 1 n T cell lymphopenia Reduced T Helper function 1 Decreased cellular immunity Reduced II cell help to B cells Impaired macrophage function B cell dysregulation T Polyclonal fiypergamma-globulemia I | Minimally protective] Impaired humoral immunity 2C TCR Transgenesis General ton of DNTC Induction of Ag-experienced immuno-phenotype, enabling DNTC to undergo bystander activation DBA/2 infection susceptibility factors Impaired cutaneous homeostasis abnormal barrier) m paired surveillance for infected cells Cutaneous infection (Stress Ligand* Massive proliferation & cutaneous •accumulation of CD4'CD25- T cells Increased IL-2 production Increased IL-15 product on 1 Acute Activation of DNTC (Upregulation of NKG2D) Precludes development ofyfi cells No cutaneous sentinel cells Impaired epithelial barrier Cutaneous Phenotype Figure 54. Summary of Factors Contributing to Disease Development A schematic demonstrating the various components of disease pathophysiology is shown. 196 Bibliography 1. Janeway, C. A . , P. Travers, M . Walport, and J. D . Capra. 1999. Immunobiology: The Immune System in Health and Disease. 4 t h Ed . Elsevier Science, N e w York, N Y . 2. Goldsby, R. A . , T. J. Kindt, and B . A . Osborne. 2000. Kuby Immunology. 5 t h Ed . W . H . Freeman, New York, N Y . 3. Farrington, M . , L . S. Grosmaire, S. Nonoyama, S. H . Fischer, D . Hollenbaugh, J. A . Ledbetter, R. J. Noelle, A . Aruffo, and H . D . Ochs. 1994. CD40 ligand expression is defective in a subset of patients with common variable immunodeficiency. Proc Natl Acad Sci USA 91:1099. 4. Shresta, S., C. T. Pham, D . A . Thomas, T. A . Graubert, and T. J. Ley. 1998. How do cytotoxic lymphocytes k i l l their targets? Curr Opin Immunol 10:581. 5. Ford, M . S., K . J. Young, Z . Zhang, P. S. Ohashi, and L . Zhang. 2002. The immune regulatory function of lymphoproliferative double negative T cells in vitro and in vivo. J Exp Med 196:261. 6. Oldstone, M . B . 1997. H o w viruses escape from cytotoxic T lymphocytes: molecular parameters and players. Virology 234:179. I. Dhanji, S., and H . S. Teh. 2003. IL-2-activated C D 8 + C D 4 4 h i g h cells express both adaptive and innate immune system receptors and demonstrate specificity for syngeneic tumor cells. J Immunol 171:3442. 8. Takahashi, I., H . Iijima, R. Katashima, M . Itakura, and H . Kiyono. 1999. Clonal Expansion of C D 4 + T C R p p + T Cells in TCRa-Cha in - Deficient Mice by Gut-Derived Antigens. J Immunol 162:1843. 9. Abbas, A . K . , A . H . Lichtman, and J. S. Pober. 2000. Cellular and Molecular Immunology. 4 t h Ed. W . B . Saunders, Philadelphia, P A . 10. McDevitt , H . O. 2000. Discovering the role of the major histocompatibility complex in the immune response. Annu Rev Immunol 18:1. I I . Zinkernagel, R. M . , and P. C. Doherty. 1997. The discovery of M H C restriction. Immunol Today 18:14. 12. van Leeuwen, E . M . , G . J. de Bree, I. J. ten Berge, and R. A . van Lier. 2006. Human virus-specific C D 8 + T cells: diversity specialists. Immunol Rev 211:225. 13. Collins, T., A . J. Korman, C. T. Wake, J. M . Boss, D . J. Kappes, W . Fiers, K . A . Ault , M . A . Gimbrone, Jr., J. L . Strominger, and J. S. Pober. 1984. Immune interferon activates multiple class II major histocompatibility complex genes and the associated invariant chain gene in human endothelial cells and dermal fibroblasts. Proc Natl Acad Sci USA 81:4917. 197 14. Hayday, A . C. 2000. y5 cells: A right time and a right place for a conserved third way of protection. Annu Rev Immunol 18:975. 15. W u , J., V . Groh, and T. Spies. 2002. T Cel l Antigen Receptor Engagement and Specificity in the Recognition of Stress-Inducible M H C Class I-Related Chains by Human Epithelial yS T Cells. J Immunol 169:1236. 16. Kumanovics, A . , T. Takada, and K . Fischer Lindahl. 2003. Genomic Organization of the Mammalian M H C . Annu Rev Immunol 21:629. 17. Kronenberg, M . 2005. Toward an understanding of N K T cell biology: progress and paradoxes. Annu Rev Immunol 23:877. 18. Groh, V . , A . Steinle, S. Bauer, and T. Spies. 1998. Recognition of Stress-Induced M H C Molecules by Intestinal Epithelial y8 T Cells. Science 279:1737. 19. Timson Gauen, L . K . , A . N . Kong, L . E . Samelson, and A . S. Shaw. 1992. p59 f y n tyrosine kinase associates with multiple T-cell receptor subunits through its unique amino-terminal domain. Mol Cell Biol 12:5438. 20. Palacios, E . H . , and A . Weiss. 2004. Function of the Src-family kinases, Lck and Fyn, in T-cell development and activation. Oncogene 23:7990. 21. Mustelin, T., S. Rahmouni, N . Bottini, and A . Alonso. 2003. Role of protein tyrosine phosphatases in T cell activation. Immunol Rev 191:139. 22. Huang, Y . , and R. L . Wange. 2004. T cell receptor signaling: beyond complex complexes. J Biol Chem 279:28827. 23. Wange, R. L . 2000. L A T , the Linker for Activation of T cells: A Bridge Between T Cel l -Specific and General Signaling Pathways. Sci STKE 2000:RE1; pi. 24. Berg, L . J., L . D . Finkelstein, J. A . Lucas, and P. L . Schwartzberg. 2005. Tec family kinases in T lymphocyte development and function. Annu Rev Immunol 23:549. 25. Altman, A . , and M . Vil la lba. 2003. Protein kinase C-9 (PKCG): it's all about location, location, location. Immunol Rev 192:53. 26. Ebinu, J. O., S. L . Stang, C. Teixeira, D . A . Bottorff, J. Hooton, P. M . Blumberg, M . Barry, R. C. Bleakley, H . L . Ostergaard, and J. C. Stone. 2000. RasGRP links T-cell receptor signaling to Ras. Blood 95:3199. 27. Altman, A . , N . Isakov, and G . Baier. 2000. Protein kinase C-0: a new essential superstar on the T-cell stage. Immunology Today 21:567. 28. Coudronniere, N., M . Vil lalba, N . Englund, and A . Altman. 2000. N F - K B activation induced by T cell receptor/CD28 costimulation is mediated by protein kinase C-0. Proc Natl Acad Sci USA 97:3394. 198 29. Clements, J. L . , N . J. Boerth, J. R. Lee, and G . A . Koretzky. 1999. Integration of T cell receptor-dependent signaling pathways by adapter proteins. Annu Rev Immunol 17:89. 30. Crespo, P., X . R. Bustelo, D . S. Aaronson, O. A . Coso, M . Lopez-Barahona, M . Barbacid, and J. S. Gutkind. 1996. Rac-1 dependent stimulation of the J N K / S A P K signaling pathway by Vav. Oncogene 13:455. 31. Tybulewicz, V . L . 2005. Vav-family proteins in T-cell signalling. Current Opinion in Immunology 17:267. 32. Okkenhaug, K . , and B . Vanhaesebroeck. 2003. PI3K in lymphocyte development, differentiation and activation. Nat Rev Immunol 3:317. 33. Okkenhaug, K . , and B . Vanhaesebroeck. 2003. PI3K-signalling in B - and T-cells: insights from gene-targeted mice. Biochem Soc Trans 31:270. 34. Kane, L . P., and A . Weiss. 2003. The PI-3 kinase/Akt pathway and T cell activation: pleiotropic pathways downstream of PIP3. Immunol Rev 192:7. 35. K i m , E . Y . , and H.-S. Teh. 2004. Critical Role of T N F Receptor Type-2 (p75) as a Costimulator for IL-2 Induction and T Cel l Survival: A Functional L ink to CD28. J Immunol 173:4500. 36. Watts, T. H . 2005. TOF/TNFR family members in costimulation of T cell responses. Annu Rev Immunol 23:23. 37. Watanabe, M . , S. Watanabe, Y . Hara, Y . Harada, M . Kubo, K . Tanabe, H . Toma, and R. Abe. 2005. ICOS-Mediated Costimulation on Th2 Differentiation Is Achieved by the Enhancement of IL-4 Receptor-Mediated Signaling. J Immunol 174:1989. 38. Markiewicz, M . A . , L . N . Carayannopoulos, O. V . Naidenko, K . Matsui, W. R. Burack, E . L . Wise, D . H . Fremont, P. M . Al len , W . M . Yokoyama, M . Colonna, and A . S. Shaw. 2005. Costimulation through N K G 2 D Enhances Murine C D 8 + C T L Function: Similarities and Differences between N K G 2 D and CD28 Costimulation. J Immunol 175:2825. 39. Acuto, O., and F. Michel . 2003. CD28-mediated co-stimulation: a quantitative support for T C R signalling. Nat Rev Immunol 3:939. 40. Appleman, L . J., A . A . F. L . van Puijenbroek, K . M . Shu, L . M . Nadler, and V . A . Boussiotis. 2002. CD28 Costimulation Mediates Down-Regulation of p27 k i p l and Cel l Cycle Progression by Activation of the P I 3 K / P K B Signaling Pathway in Primary Human T Cells. J Immunol 168:2729. 41. Raab, M . , Y . Cai , S. Bunnell, S. Heyeck, L . Berg, and C. Rudd. 1995. p56 L c k and p59 F y n Regulate CD28 Binding to Phosphatidylinositol 3-Kinase, Growth Factor Receptor-Bound Protein G R B - 2 , and T Cell-Specific Protein-Tyrosine Kinase ITK: Implications for T-Cel l Costimulation. PNAS 92:8891. 42. Schwartz, R. H . 2003. T cell anergy. Annu Rev Immunol 21:305. 199 43. Vio la , A . , S. Schroeder, Y . Sakakibara, and A . Lanzavecchia. 1999. T lymphocyte costimulation mediated by reorganization of membrane microdomains. Science 283:680. 44. Gaffen, S. L . 2001. Signaling Domains of the Interleukin-2 Receptor. Cytokine 14:63. 45. Jain, J., C. Loh, and A . Rao. 1995. Transcriptional regulation of the IL-2 gene. Curr Opin Immunol 7:333. 46. Tao, L . , S. Wadsworth, J. Mercer, C. Mueller, K . Lynn, J. Siekierka, and A . August. 2002. Opposing roles of serine/threonine kinases M E K K 1 and L O K in regulating the CD28 responsive element in T-cells. Biochem J. 363:175. 47. Shapiro, V . S., K . E . Truitt, J. B . Imboden, and A . Weiss. 1997. CD28 mediates transcriptional upregulation of the interleukin-2 (IL-2) promoter through a composite element containing the C D 2 8 R E and N F - I L - 2 B AP-1 sites. Mol Cell Biol 17:4051. 48. Ellery, J. M . , and P. J. Nicholls. 2002. Alternate signalling pathways from the interleukin-2 receptor. Cytokine Growth Factor Rev 13:27. 49. Perola, O., A . Ripatti, and J. Pelkonen. 2000. T-lymphocyte subpopulations do not express identical combinations of interleukin-2 receptor chains in the early phase of their activation and proliferation. Scand J Immunol 52:123. 50. Gaffen, S. L . , and K . D . L i u . 2004. Overview of interleukin-2 function, production and clinical applications. Cytokine 28:109. 51. Allouche, M . , Y . Sahraoui, Y . Augery-Bourget, M . Perrakis, C. Jasmin, and V . Georgoulias. 1990. Interleukin 2 receptors. LeukRes 14:699. 52. Ellery, J. M . , S. J. Kempshall, and P. J. Nicholls. 2000. Activation of the interleukin-2 receptor: a possible role for tyrsoine phosphatases. Cell signalling 12:367. 53. Benczik, M . , and S. L . Gaffen. 2004. The Interlekin (IL)-2 Family Cytokines: Survival and Proliferation Signaling Pathways in T Lymphocytes. Immunol Invest 33:109. 54. Moon, J. J., and B . H . Nelson. 2001. Phosphatidylinositol 3-Kinase Potentiates, but Does Not Trigger, T Cel l Proliferation Mediated by the IL-2 Receptor. J Immunol 167:2714. 55. Kundig, T. M . , H . Schorle, M . F. Bachmann, H . Hengartner, R. M . Zinkernagel, and I. Horak. 1993. Immune responses in interleukin-2-deficient mice. Science 262:1059. 56. Steiger, J., P. W . Nickerson, W. Steurer, M . Moscovitch-Lopatin, and T. B . Strom. 1995. IL-2 knockout recipient mice reject islet cell allografts. J Immunol 155:489. 57. DeSilva, D . R., K . B . Urdahl, and M . K . Jenkins. 1991. Clonal anergy is induced in vitro by T cell receptor occupancy in the absence of proliferation. J Immunol 147:3261. 58. DiSanto, J. P. 1997. Cytokines: shared receptors, distinct functions. Curr Biol 7:R424. 200 59. Gi r i , J. G. , M . Ahdieh, J. Eisenman, K . Shanebeck, K . Grabstein, S. Kumaki , A . Namen, L . S. Park, D . Cosman, and D . Anderson. 1994. Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15. Embo J 13:2822. 60. Waldmann, T. A . , S. Dubois, and Y . Tagaya. 2001. Contrasting roles of IL-2 and IL-15 in the life and death of lymphocytes: implications for immunotherapy. Immunity 14:105. 61. Priatel, J. J., O. Utting, and H.-S. Teh. 2001. TCR/Self-Antigen Interactions Drive Double-Negative T Cel l Peripheral Expansion and Differentiation into Suppressor Cells. J Immunol 167:6188. 62. Utting, O., J. J. Priatel, S. J. Teh, and H.-S. Teh. 2001. p59 f y n (Fyn) promotes the survival of anergic CD4TJD8" ap T C R + cells but negatively regulates their proliferation response to antigen stimulation. J Immunol 166:1540. 63. Caveno, J., Y . Zhang, B . Motyka, S. J. Teh, and H.-S. Teh. 1999. Functional similarity and differences between selection-independent CD4"CD8" aP T cells and positively selected C D 8 T cells expressing the same T C R and the induction of anergy in CD4TJD8" aP T cells in antigen-expressing mice. J Immunol 163:1222. 64. Pelleitier, M . , and S. Montplaisir. 1975. The nude mouse: a model of deficient T-cell function. Methods Achiev Exp Pathol 7:149. 65. Gershwin, M . E . 1977. DiGeorge syndrome: Congenital thymic hypoplasia. Animal model: Congenitally athymic (nude) mouse. Am J Pathol 89:809. 66. Godfrey, D . , J. Kennedy, T. Suda, and A . Zlotnik. 1993. A developmental pathway involving four phenotypically and functionally distinct subsets of CD3"CD4"CD8" triple-negative adult mouse thymocytes defined by CD44 and CD25 expression. J Immunol 150:4244. 67. Lind , E . F., S. E . Prockop, H . E . Porritt, and H . T. Petrie. 2001. Mapping Precursor Movement through the Postnatal Thymus Reveals Specific Microenvironments Supporting Defined Stages of Early Lymphoid Development. J. Exp. Med. 194:127. 68. Hayday, A . C , D . F. Barber, N . Douglas, and E . S. Hoffman. 1999. Signals involved in y§ T cell versus a,p T cell lineage committment. Semin Immunol 11:239. 69. Robey, E . , and B . J. Fowlkes. 1998. The ap versus y8 T-cell lineage choice. Curr Opin Immunol 10:181. 70. Dudley, E . C , M . Girardi, M . J. Owen, and A . C. Hayday. 1995. ap and y8 T cells can share a late common precursor. Curr Biol 5:659. 71. von Boehmer, H . , M . Bonneville, I. Ishida, S. Ryser, G . Lincoln, R. T. Smith, H . Ki sh i , B . Scott, P. Kisielow, and S. Tonegawa. 1988. Early expression of a T-cell receptor P-chain transgene suppresses rearrangement of the Vy4 gene segment. Proc Natl Acad Sci USA 85:9729. 201 72. Fenton, R. G. , P. Marrack, J. W . Kappler, O. Kanagawa, and J. G . Seidman. 1988. Isotypic exclusion of y8 T cell receptors in transgenic mice bearing a rearranged P-chain gene. Science 241.1089. 73. Groettrup, M . , K . Ungewiss, O. Azogui , R. Palacois, M . J. Owen, A . C. Hayday, and H . von Boehmer. 1993. A novel disulfide-linked heterodimer on pre-T cells consists of the T cell receptor p chain and a 33 kd glycoprotein. Cell 75:283. 74. Fehling, H . J., and H . von Boehmer. 1997. Early ap T cell development in the thymus of normal and genetically altered mice. Curr Opin Immunol 9:263. 75. Godfrey, D . I., and A . Zlotnik. 1993. Control points in early T-cell development. Immunol Today 14:547. 76. Falk, I., G . Nerz, I. Haidl , A . Krotkova, and K . Eichmann. 2001. Immature thymocytes that fail to express T C R P and/or TCRyS proteins die by apoptotic cell death in the CD44" CD25" (DN4) subset. Eur J Immunol 31:3308. 11. Kersh, G . J., and S. M . Hedrick. 1995. Role of T C R specificity in C D 4 versus CD8 lineage commitment. J Immunol 154:1057. 78. Petrie, R. J., and J. P. Deans. 2002. Colocalization of the B Cel l Receptor and CD20 Followed by Activation-Dependent Dissociation in Distinct L ip id Rafts. J Immunol 169:2886. 79. Takeshita, S., M . Toda, and H . Yamagishi. 1989. Excision products of the T cell receptor gene support a progressive rearrangement model of the a/8 locus. Embo J 8:3261. 80. Lindsten, T., B . J. Fowlkes, L . E . Samelson, M . M . Davis, and Y . H . Chien. 1987. Transient rearrangements of the T cell antigen receptor alpha locus in early thymocytes. J Exp Med 166:761. 81. Shortman, K . , and L . Wu . 1996. Early T lymphocyte progenitors. Annu Rev Immunol 14:29. 82. Petrie, H . T., F. Livak, D . G . Schatz, I. N . Crispe, and K . Shortman. 1993. Multiple Rearrangements in T C R Alpha Chain Genes Maximize the Production of Useful Thymocytes. J Exp Med 178:615. 83. Robey, E . , and B . J. Fowlkes. 1994. Selective events in T cell development. Annu Rev Immunol 12:675. 84. von Boehmer, H . 2000. T-cell lineage fate: Instructed by receptor signals? Curr Biol 10.R642. 85. Minter, L . M . , and B . A . Osborne. 2003. Cel l death in the thymus~it's all a matter of contacts. Semin Immunol 15:135. 202 86. Ashton-Rickardt, P. G. , A . Bandeira, J. R. Delaney, L . Van Kaer, H . P. Pircher, R. M . Zinkernagel, and S. Tonegawa. 1994. Evidence for a differential avidity model of T cell selection in the thymus. Cell 76:651. 87. Chan, S. H . , D . Cosgrove, C. Waltzinger, C. Benoist, and D. Mathis. 1993. Another view of the selective model of thymocyte selection. Cell 73:225. 88. Singer, A . , R. Bosselut, and A . Bhandoola. 1999. Signals involved in C D 4 / C D 8 lineage commitment: Current concepts and potential mechanisms. Semin Immunol 11:273. 89. Teh, H . S., P. Kisielow, B . Scott, H . Kish i , Y . Uematsu, H . Bluthmann, and H . von Boehmer. 1988. Thymic major histocompatibility complex antigens and the aP T-cell receptor determine the C D 4 / C D 8 phenotype of T cells. Nature 335:229. 90. Yasutomo, K . , C. Doyle, L . Miele , and R. N . Germain. 2000. The duration of antigen receptor signaling determines C D 4 + versus C D 8 + T-cell lineage fate. Nature 404:506. 91. Watanabe, N . , Y . - H . Wang, H . K . Lee, T. Ito, Y . - H . Wang, W . Cao, and Y . - J . L i u . 2005. HassaU's corpuscles instruct dendritic cells to induce C D 4 + C D 2 5 + regulatory T cells in human thymus. Nature 436:1181. 92. Tai , X . , M . Cowan, L . Feigenbaum, and A . Singer. 2005. CD28 costimulation of developing thymocytes induces Foxp3 expression and regulatory T cell differentiation independently of interleukin 2. Nat Immunol 6:152. 93. Boismenu, R., and W . L . Havran. 1998. Short Analytical Review: y§ T cells in host defencse and epithelial cell biology. Clin Immunol Immunopathol 86:121. 94. Xiong, N . , C . Kang, and D . H . Raulet. 2004. Positive Selection of Dendritic Epidermal yS T Cel l Precursors in the Fetal Thymus Determines Expression of Skin-Homing Receptors. Immunity 21:121. 95. Kang, J., H . J. Fehling, C. Laplace, M . Malissen, D . Cado, and D . H . Raulet. 1998. T cell receptor y gene regulatory sequences prevent the function of a novel T C R y / p T a pre-T cell receptor. Immunity 8:713. 96. Schweighoffer, E . , and B . J. Fowlkes. 1996. Positive selection is not required for thymic maturation of transgenic gamma delta T cells. J Exp Med 183:2033. 97. Bruno, L . , H . J. Fehling, and H . von Boehmer. 1996. The ap T Cel l Receptor Can Replace the y5 Receptor in the Development of y5 Lineage Cells. Immunity 5:343. 98. Pardoll, D . M . , B . J. Fowlkes, A . M . Lew, W . L . Maloy, M . A . Weston, J. A . Bluestone, R. H . Schwartz, J. E . Coligan, and A . M . Kruisbeek. 1988. Thymus-dependent and thymus-independent developmental pathways for peripheral T cell receptor-y8-bearing lymphocytes. J Immunol 140:4091. 99. Al l i son , J. P., and W. L . Havran. 1991. The Immunobiology of T Cells with Invariant y5 Antigen Receptors. Annu Rev Immunol 9:679. 203 100. Tigelaar, R. E . , J. M . Lewis, and P. R. Bergstresser. 1990. T C R y8 + dendritic epidermal T cells as constituents of skin-associated lymphoid tissue. J Invest Dermatol 94:58S. 101. Wu , J., V . Groh, and T. Spies. 2002. T Cel l Antigen Receptor Engagement and Specificity in the Recognition of Stress-Inducible M H C Class I-Related Chains by Human Epithelial y5 T Cells. J Immunol 169:1236. 102. Havran, W . L . , Y . H . Chien, and J. P. Al l ison. 1991. Recognition of self antigens by skin-derived T cells with invariant gamma delta antigen receptors. Science 252:1430. 103. Mal l ick-Wood, C. A . , J. M . Lewis, L . I. Richie, M . J. Owen, R. E . Tigelaar, and A . C. Hayday. 1998. Conservation of T cell receptor confirmation in epidermal y8 cells with disrupted primary V v gene usage. Science 279:1729. 104. Wild in , R., A . Garvin, S. Pawar, D . Lewis, K . Abraham, K . Forbush, S. Ziegler, J. Al len , and R. Perlmutter. 1991. Developmental regulation of lck gene expression in T lymphocytes. J. Exp. Med. 173:383. 105. Wild in , R., H . Wang, K . Forbush, and R. Perlmutter. 1995. Functional dissection of the murine lck distal promoter. J Immunol 155:1286. 106. Sha, W . C , C. A . Nelson, R. D . Newberry, D . M . Kranz, J. H . Russell, and D . Y . Loh. 1988. Selective Expression of an Antigen Receptor on CD8-Bearing T Lymphocytes in Transgenic Mice . Nature 335:271. 107. Sha, W . C , C. A . Nelson, R. D . Newberry, D . M . Kranz, J. H . Russell, and D . Y . Loh . 1988. Positive and Negative Selection of an Antigen Receptor on T Cells in Transgenic Mice . Nature 336:73. 108. Kieke, M . C , E . V . Shusta, E . T. Boder, L . Teyton, K . D . Wittrup, and T. Krahl. 1999. Selection of Functional T Cel l Receptor Mutants from a Yeast Surface-Display Library. Proc Natl Acad Sci USA 96:5651. 109. Sykulev, Y . , A . Brunmark, M . Jackson, P. Cohen, A . Peterson, and H . N . Eisen. 1994. Kinetics and Affinity of Reactions between an Antigen-Specific T Cel l Receptor and Peptide-MHC Complexes. Immunity 1:15. 110. Udaka, K . , T. J. Tsomides, P. Walden, N . Fukusen, and H . N . Eisen. 1993. A Ubiquitous Protein is the Source of Naturally Occurring Peptides that are Recognized by a C D 8 + T-Cel l Clone. Proc Natl Acad Sci USA 90:11272. 111. Bluthmann, H . , P. Kisielow, Y . Uematsu, M . Malissen, P. Krimpenfort, A . Berns, H . von Boehmer, and M . Steinmetz. 1988. T-cell-specific deletion of T-cell receptor transgenes allows functional rearrangement of endogenous a- and P-genes. Nature 334:156. 112. Russell, J. H . , P. Meleedy-Rey, D . E . McCul ley , W . C. Sha, C. A . Nelson, and D . Y . Loh. 1990. Evidence for CD8-Independent T Cel l Maturation in Transgenic Mice . J Immunol 144:3318. 204 113. Terrence, K . , C. P. Pavlovich, E . O. Matechak, and B . J. Fowlkes. 2000. Premature expression of T cell receptor (TCR) a p suppresses TCRy5 gene rearrangement but permits development of y5 lineage T cells. J Exp Med 192:537. 114. Day, C. D . , E . Lee, J. Kobayashi, L . D . Holappa, H . Albert, and D . W . Ow. 2000. Transgene integration into the same chromosome location can produce alleles that express at a predictable level, or alleles that are differentially silenced. Genes Dev. 14:2869. 115. Zhang, Z . X . , L . Yang, K . J. Young, B . DuTemple, and L . Zhang. 2000. Identification of a previously unknown antigen-specific regulatory T cell and its mechanism of suppression. Nat Med 6:782. 116. Zhang, Z . X . , K . Young, and L . Zhang. 2001. CD3 + CD4"CD8" a p - T C R + T cell as immune regulatory cell. J Mol Med 79:419. 117. Schulz, R., A . Parkes, E . Mizoguchi , A . Bhan, and S. Koyasu. 1996. Development of C D 4 " C D 8 " a p T C R + N K l . l + T lymphocytes: thymic selection by self antigen. J Immunol 157:4379. 118. Strober, S., L . Cheng, D . Zeng, R. Palathumpat, S. Dejbakhsh-Jones, P. Huie, and R. Sibley. 1996. Double negative ( C D 4 C D 8 " a p + ) T cells which promote tolerance induction and regulate autoimmunity. Immunol Rev 149:217. 119. Aifantis, I., C. H . Bassing, A . I. Garbe, K . Sawai, F. W . Al t , and H . V o n Boehmer. 2003. The E5 enhancer controls the generation of CD4"CD8" aPTCR-expressing T cells that can give rise to different lineages of a p T cells. J Exp Med 203:1543. 120. Utting, O., S. J. Teh, and H.-S. Teh. 2000. A population of in vivo anergized T cells with a lower activation threshold for the induction of CD25 exhibit differential requirements in mobilization of intracellular calcium and mitogen-activated protein kinase activation. J Immunol 164:2281. 121. Utting, O., S.-J. Teh, and H.-S. Teh. 1998. T Cells Expressing Receptors of Different Affinity for Antigen Ligands Reveal a Unique Role for p59 f y n in T Cel l Development and Optimal Stimulation of T Cells by Antigen. J Immunol 160:5410. 122. Anderson, M . S., E . S. Venanzi, L . Kle in , Z . Chen, S. P. Berzins, S. J. Turley, H . von Boehmer, R. Bronson, A . Dierich, C. Benoist, and D . Mathis. 2002. Projection of an immunological self shadow within the thymus by the Aire protein. Science 298:1395. 123. Oble, D . A . , E . Collett, M . Hsieh, M . Ambjorn, J. Law, J. Dutz, and H . S. Teh. 2005. A novel T cell receptor transgenic animal model of seborrheic dermatitis-like skin disease. J Invest Dermatol 124:151. 124. Su, M . A . , and M . S. Anderson. 2004. Aire: A n update. Curr Opin Immunol 16:746. 205 125. Sakaguchi, S., R. Setoguchi, H . Yagi , and T. Nomura. 2006. Naturally arising Foxp3-expressing C D 2 5 + C D 4 + regulatory T cells in self-tolerance and autoimmune disease. Curr Top Microbiol Immunol 305:51. 126. Hayday, A . , and R. Tigelaar. 2003. Immunoregulation in the tissues by yS T cells. Nat Rev Immunol 3:233. 127. Baecher-Allan, C , and D . A . Hafler. 2004. Suppressor T Cells in Human Diseases. J Exp Med 200:273. 128. Paust, S., and H . Cantor. 2005. Regulatory T cells and autoimmune disease. Immunol Rev 204:195. 129. Liang, S., P. Alard, Y . Zhao, S. Parnell, S. L . Clark, and M . M . Kosiewicz. 2005. Conversion of C D 4 + C D 2 5 " cells into C D 4 + C D 2 5 + regulatory T cells in vivo requires B7 costimulation, but not the thymus. J Exp Med 201:127. 130. Chen, W. , W . Jin, N . Hardegen, K . J. Le i , L . L i , N . Marinos, G . McGrady, and S. M . Wahl. 2003. Conversion of peripheral C D 4 + C D 2 5 " naive T cells to C D 4 + C D 2 5 + regulatory T cells by TGF-beta induction of transcription factor FoxP3. J Exp Med 198:1875. 131. Khattri, R., T. Cox, S. A . Yasayko, and F. Ramsdell. 2003. A n essential role for Scurfin in C D 4 + C D 2 5 + T regulatory cells. Nat Immunol 4:337. 132. Bayer, A . L . , A . Y u , D . Adeegbe, and T. R. Malek. 2005. Essential role for interleukin-2 for C D 4 + C D 2 5 + T regulatory cell development during the neonatal period. J. Exp. Med. 201:769. 133. Almeida, A . R. M . , N . Legrand, M . Papiernik, and A . A . Freitas. 2002. Homeostasis of Peripheral C D 4 + T Cells: I L - 2 R a and IL-2 Shape a Population of Regulatory Cells That Controls C D 4 + T Cel l Numbers. J Immunol 169:4850. 134. Sakaguchi, S., and N . Sakaguchi. 1989. Organ-specific autoimmune disease induced in mice by elimination of T cell subsets. V . Neonatal administration of cyclosporin A causes autoimmune disease. J Immunol 142:471. 135. Bennett, C , J. Christie, F. Ramsdell, M . E . Brunkow, P. J. Ferguson, L . Whitesell, T. E . Kel ly , F. T. Saulsbury, P. F. Chance, and H . D . Ochs. 2001. The immune dysregulation, polyendocrinopathy, enteropathy, X-l inked syndrome (IPEX) is caused by mutations of F O X P 3 . Nat Genet 27:20. 136. Viglietta, V . , C. Baecher-Allan, H . L . Weiner, and D . A . Hafler. 2004. Loss of functional suppression by CD4 + CD25 + regulatory T cells in patients with multiple sclerosis. J Exp Med 199:971. 137. Sugiyama, H . , R. Gyulai , E . Toichi, E . Garaczi, S. Shimada, S. R. Stevens, T. S. McCormick, and K . D . Cooper. 2005. Dysfunctional Blood and Target Tissue 206 CD4 CD25 l g Regulatory T Cells in Psoriasis: Mechanism Underlying Unrestrained Pathogenic Effector T Cel l Proliferation. J Immunol 174:164. 138. Kriegel, M . A . , T. Lohmann, C. Gabler, N . Blank, J. R. Kalden, and H . M . Lorenz. 2004. Defective suppressor function of human CD4 + CD25 + regulatory T cells in autoimmune polyglandular syndrome type II. J Exp Med 199:1285. 139. Girardi, M . , J. Lewis, E . Glusac, R. B . Filler, L . Geng, A . C. Hayday, and R. E . Tigelaar. 2002. Resident skin-specific y5 T cells provide local, non-redunant regulation of cutaneous inflammation. J Exp Med 195:855. 140. Girardi, M . , M . A. Sherling, R. B . Filler, J. Shires, E . Theodoridis, A . C. Hayday, and R. E . Tigelaar. 2003. Anti-inflammatory effects in the skin of thymosin-p4 splice-variants. Immunology 109:1. 141. Shires, J., E . Theodoridis, and A . C. Hayday. 2001. Biological insights into T C R y 5 + and T C R a p + intraepithelial lymphocytes provided by serial analysis of gene expression ( S A G E ) . Immunity 15:419. 142. D'Souza, C. D. , A . M . Cooper, A . A . Frank, R. J. Mazzaccaro, B . R. Bloom, and I. M . Orme. 1997. A n anti-inflammatory role for y8 T lymphocytes in acquired immunity to Mycobacterium tuberculosis. J Immunol 158:1217. 143. Fu, Y . X . , C. E . Roark, K . Kel ly , D . Drevets, P. Campbell, R. O'Brien, and W . Born. 1994. Immune protection and control of inflammatory tissue necrosis by y5 T cells. J Immunol 153:3101. 144. Abbas, A . K . , J. Lohr, B . Knoechel, and V . Nagabhushanam. 2004. T cell tolerance and autoimmunity. Autoimmun Rev 3:471. 145. Ferguson, T. A . , D . R. Green, and T. S. Griffith. 2002. Cel l death and immune privilege. Int Rev Immunol 21:153. 146. Mil ler , J. F. A . P., and W. R. Heath. 1993. Self-ignorance in the peripheral T-cell pool. Immunol Rev 133:131. 147. Green, D . R., N . Droin, and M . Pinkoski. 2003. Activation-induced cell death in T cells. Immunol Rev 193:70. 148. Karray, S., C. Kress, S. Cuvellier, C . Hue-Beauvais, D . Damotte, C. Babinet, and M . Levi-Strauss. 2004. Complete loss of Fas ligand gene causes massive lymphoproliferation and early death, indicating a residual activity of gld allele. J Immunol 172:2118. 149. Adachi, M . , S. Suematsu, T. Kondo, J. Ogasawara, T. Tanaka, N . Yoshida, and S. Nagata. 1995. Targeted mutation in the Fas gene causes hyperplasia in peripheral lymphoid organs and liver. Nat Genet 11:294. 150. Appleman, L . J., and V . A . Boussiotis. 2003. T cell anergy and costimulation. Immunol Rev 192:161. 207 151. Shrikant, P., and M . F. Mescher. 1999. Control of Syngeneic Tumor Growth by Activation of C D 8 + T Cells: Efficacy Is Limited by Migration Away from the Site and Induction of Nonresponsiveness. J Immunol 162:2858. 152. Deems, M . J., R. M . Ked l , and M . F. Mescher. 1999. C D 8 + T Cells Become Nonresponsive (Anergic) Following Activation in the Presence of Costimulation. J Immunol 163:102. 153. Often, G . R., and R. N . Germain. 1991. Split Anergy in C 8 + T Cel l : Receptor-Dependent Cytolysis in the Absence of Interleukin-2 Production. Science 251:1228. 154. Judge, A . D . , X . Zhang, H . Fujii , C. D . Surh, and J. Sprent. 2002. Interleukin 15 controls both proliferation and survival of a subset of memory-phenotype C D 8 + T cells. J Exp Med 196:935. 155. Tough, D . F., P. Borrow, and J. Sprent. 1996. Induction of bystander T cell proliferation by viruses and type I interferon in vivo. Science 272:1947. 156. Horwitz, M . S., L . M . Bradley, J. Harbertson, T. Krahl , and N . Sarvetnick. 1998. Diabetes induced by Coxsackie virus: Initiation by bystander damage and not molecular mimicry. Nat Med 4:781. 157. Panoutsakopoulou, V . , M . E . Sanchirico, K . M . Huster, M . Jansson, F. Granucci, D . J. Shim, K . W . Wucherpfennig, and H . Cantor. 2001. Analysis of the relationship between viral infection and autoimmune disease. Immunity 15:137. 158. Sarvetnick, N . , J. Shizuru, D . Liggitt, L . Martin, B . Mclntyre, A . Gregory, T. Parslow, and T. Stewart. 1990. Loss of pancreatic islet tolerance induced by beta-cell expression of interferon-y. Nature 346:844. 159. Fierlbeck, G . , G . Rassner, and C. Muller. 1990. Psoriasis induced at the injection site of recombinant interferon-y. Results of immunohistologic investigations. Arch Dermatol 126:351. 160. Akassoglou, K . , P. K . , G . Kontogeorgos, and G . Koll ias . 1997. Astrocyte-specific but not neuron-specific transmembrane T N F triggers inflammation and degeneration in the central nervous system of transgenic mice. J Immunol 158:438. 161. Horwitz, M . S., C. F. Evans, D. B . McGavern, M . Rodriguez, and M . B . Oldstone. 1997. Primary demyelination in transgenic mice expressing interferon-y. Nat Med 3:1037. 162. Sarvetnick, N . , D . Liggitt, S. L . Pitts, S. E . Hansen, and T. Stewart. 1988. Insulin-dependent diabetes mellitus induced in transgenic mice by ectopic expression of class I M H C and interferon-y. Cell 52:773. 163. Arkwright, P. D . , M . Abinun, and A . J. Cant. 2002. Autoimmunity in human primary immunodeficiency diseases. Blood 99:2694. 208 164. Delaney, J. R. C. 1999. A T cell receptor transgenic approach to the study of thymocyte development and autoimmune disease. Massachusetts Institute of Technology, Cambridge, M A . 165. Fitzpatrick, T. B . , R. A . Johson, K . Wolff, M . K . Polano, and D . Suurmond. 1997. Color Atlas and Synopsis of Clinical Dermatology: Common and Serious Diseases. 3 r d Ed. M c G r a w - H i l l , New York, N Y . th 166. Mehregan, A . H . , and K . Hashimoto. 1991. Pinkus' Guide to Dermatohistopathology. 5 Ed . Appleton & Lange, Norwalk, C T . 167. Nickoloff, B . J., and F. O. Nestle. 2004. Recent insights into the immunopathogenesis of psoriasis provide new therapeutic opportunities. J Clin Invest 113:1664. 168. Henseler, T., and E . Christophers. 1985. Psoriasis of early and late onset: characterization of two types of psoriasis vulgaris. J Am Acad Dermatol 13:450. 169. Munoz-Perez, M . A . , A . Rodriguez-Pichardo, F. Camacho, and M . A . Colmenero. 1998. Dermatological findings correlated with CD4 lymphocyte counts in a prospective 3 year study of 1161 patients with human immunodeficiency virus disease predominantly acquired through intravenous drug abuse. Br J Dermatol 139:33. 170. Rigopoulos, D . , V . Paparizos, and A . Katsambas. 2004. Cutaneous markers of H I V infection. Clinics in Dermatology 22:487. 171. Lebwohl, M . 2003. Psoriasis. Lancet 361:1197. 172. Gordon, K . B . , and E . M . Ruderman. 2006. The treatment of psoriasis and psoriatic arthritis: an interdisciplinary approach. J Am Acad Dermatol 54:S85. 173. Ashton, R. E . , P. Andre, N . J. Lowe, and M . Whitefield. 1983. Anthralin: historical and current perspectives. J Am Acad Dermatol 9:173. 174. Lebwohl, M . , P. T. Ting, and J. Y . M . Koo . 2005. Psoriasis treatment: traditional therapy. Ann Rheum Dis 64.H83. 175. Lebwohl, M . , and S. A l i . 2001. Treatment of psoriasis. Part 1. Topical therapy and phototherapy. J Am Acad Dermatol 45:487. 176. Muller , K . 1997. Antipsoriatic and proinflammatory action of anthralin: Implications for the role of oxygen radicals. Biochem Pharmacol 53:1215. 177. Arbiser, J. L . , B . Govindarajan, T. E . Battle, R. Lynch, D . A . Frank, M . Ushio-Fukai, B . N . Perry, D . F. Stern, G . T. Bowden, A . L i u , E . Kle in , P. J. Kolodziejski, N . T. Eissa, C. F. Hossain, and D . G . Nagle. 2006. Carbazole is a naturally occurring inhibitor of angiogenesis and inflammation isolated from antipsoriatic coal tar. J Invest Dermatol 126:1396. 178. Bos, J. D . , and M . A . De Rie. 1999. The pathogenesis of psoriasis: immunological facts and speculations. Immunol Today 20:40. 209 179. Van Scott, E . J., and T. M . Ekel . 1963. Kinetics of hyperplasia in psoriasis. Arch Dermatol 88:373. 180. Weinstein, G . D . , J. L . McCullough, and P. Ross. 1984. Cel l proliferation in normal epidermis. J Invest Dermatol 82:623. 181. Sauder, D . N . 2004. Mechanism of action and emerging role of immune response modifier therapy in dermatologic conditions. JCutan Med Surg 8 Suppl 3:3. 182. Weinstein, G . D . 1977. Methotrexate. Ann Intern Med 86:199. 183. Wong, R. L . , C. M . Winslow, and K . D . Cooper. 1993. The mechanisms of action of cyclosporin A in the treatment of psoriasis. Immunol Today 14:69. 184. Boyman, O., H . P. Hefti, C. Conrad, B . J. Nickoloff, M . Suter, and F. O. Nestle. 2004. Spontaneous Development of Psoriasis in a New Animal Model Shows an Essential Role for Resident T Cells and Tumor Necrosis Factor-a. J. Exp. Med. 199:731. 185. Gottlieb, S. L . , P. Gilleaudeau, R. Johnson, L . Estes, T. G . Woodworm, A . B . Gottlieb, and J. G . Krueger. 1995. Response of psoriasis to a lymphocyte-selective toxin (DAB389IL-2) suggests a primary immune, but not keratinocyte, pathogenic basis. Nat Med 1:442. 186. Chow, S., C. Rizzo, L . Ravitskiy, and A . A . Sinha. 2005. The of T cells in cutaneous autoimmune disease. Autoimmunity 38:303. 187. Krueger, G . G . 2002. Selective targeting of T cell subsets: focus on alefacept - a remittive therapy for psoriasis. Expert Opin Biol Ther 2:431. 188. Jullien, D . , J. C. Prinz, R. G . Langley, I. Caro, W. Dummer, A . Joshi, R. Dedrick, and P. Natta. 2004. T-cell modulation for the treatment of chronic plaque psoriasis with efalizumab (Raptiva): mechanisms of action. Dermatology 208:297. 189. Zenz, R., R. Eferl, L . Kenner, L . Florin, L . Hummerich, D . Mehic, H . Scheuch, P. Angel, E . Tschachler, and E . F. Wagner. 2005. Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins. Nature 437:369. 190. Zenz, R., and E . F. Wagner. 2005. Jun signalling in the epidermis: From development defects to psoriasis and skin tumors. Int J Biochem Cell Biol 38:1043. 191. Nickoloff, B . J. 2006. Keratinocytes regain momentum as instigators of cutaneous inflammation. Trends Mol Med 12:102. 192. Davenport, C. M . , H . A . McAdams, J. Kou , K . Masciol i , C . Eichman, L . Healy, J. Peterson, S. Murphy, D . Coppola, and A . Truneh. 2002. Inhibition of pro-inflammatory cytokine generation by C T L A 4 - I g in the skin and colon of mice adoptively transplanted with C D 4 5 R B h ' C D 4 + T cells correlates with suppression of psoriasis and colitis. International Immunopharmacology 2:653. 210 193. Leung, D . Y . , J. B . Travers, R. Giorno, D . A . Norris, R. Skinner, J. Ael ion, L . V . Kazemi, M . H . K i m , A . E . Trumble, M . Kotb, and et al. 1995. Evidence for a streptococcal superantigen-driven process in acute guttate psoriasis. J Clin Invest 96:2106. 194. Ashbee, H . R., and E . G . Evans. 2002. Immunology of Disease Associated with Malassezia Species. Clin Microbiol Rev 15:21. 195. Baroni, A . , I. Paoletti, E . Ruocco, M . Agozzino, M . A . Tufano, and G . Donnarumma. 2004. Possible Role of Malassezia furfur in Psoriasis: Modulation of the T G F - p i , Integrin and HSP70 Expression in Human Keratinocytes and in the Skin of Psoriasis-Affected Patients. JCutan Pathol 31:35. 196. Baroni, A . , M . Orlando, G . Donnarumma, P. Farro, M . R. Iovene, M . A . Tufano, and E . Buommino. 2005. Toll-like receptor 2 (TLR2) mediates intracellular signalling in human keratinocytes in response to Malassezia furfur. Arch Dermatol Res.l. 197. Rosenberg, E . W. , and P. W. Belew. 1982. Improvement of psoriasis of the scalp with ketoconazole. Arch Dermatol 118:370. 198. Rosenberg, E . W. , P. Belew, and G . Bale. 1980. Effect of topical applications of heavy suspensions of killed Malassezia ovalis on rabbit skin. Mycopathologia 72:147. 199. Cheng, L . , S. Z . Zhang, C. Y . Xiao, Y . P. Hou, L . L i , H . C. Luo, H . Y . Jiang, and W . Q. Zuo. 2000. The A5.1 allele of the M H C Class I chain-related gene A is associated with psoriasis vulgaris in Chinese. Br J Dermatol 143:321. 200. Choi , H . B . , H . Han, J. I. Youn, T. Y . K i m , and T. G . K i m . 2000. M I C A 5.1 allele is a susceptibility marker for psoriasis in the Korean population. Tissue Antigens 56:548. 201. Naldi , L . , L . Peli , F. Parazzini, and C. F. Carrel. 2001. Family history of psoriasis, stressful life events, and recent infectious disease are risk factors for a first episode of acute guttate psoriasis: Results of a case-control study. Journal of the American Academy of Dermatology 44:433. 202. Hunter, J. A . A . , J. A . Savin, and M . V . Dahl. 1989. Clinical Dermatology. 2 n d Ed. Blackwell Science, Cambridge, M A . 203. Bergbrant, I. M . 1995. Seborrheic Dermatitis and Pityrosporum Yeasts. Curr Top Med Mycol 6:95. 204. Faergemann, J. 1998. Pityrosporum Infections. Blackwell Science, Maiden, M A . 205. Gupta, A . K . , and R. Bluhm. 2004. Seborrheic Dermatitis. J Eur Acad Dermatol Venereol 18:13. 206. Groisser, D . , E . J. Bottone, and M . Lebwohl. 1989. Association of Pityrosporum Orbiculare (Malassezia furfur) with Seborrheic Dermatitis in Patients with Acquired Immunodeficiency Syndrom (AIDS). J Am Acad Dermatol 20:770. 211 207. Gupta, A . K . , and A . R. Skinner. 2004. Management of diaper dermatitis. Int J Dermatol 43:830. 208. Conant, M . A . 1994. The A I D S Epidemic. J Am Acad Dermatol 3LS47. 209. Nakayama, J. 2000. Four cases of sebopsoriasis or seborrheic dermatatis of the face and scalp successfully treated with la-24(R)-dihydroxyhcholecalciferol (tacalcitol) cream. Eur J Dermatol 10:528. 210. Evans, D . I., A . Holzel , and H . MacFarlane. 1977. Yeast Opsonization Defect and Immunoglobulin Deficiency in Severe Infantile Dermatitis (Leiner's Disease). Arch Dis Child 52:691. 211. Jacobs, J . , and M . Mi l le r . 1972. Fatal familial Leiner's disease: A deficiency of the opsonic activity of serum complement. Pediatrics 49:225. 212. Elder, D . E . , and W . F. Lever. 1997. Lever's Histopathology of the Skin. 8 t h Ed. Lippincott-Raven, Philadelphia, P A . 213. Schwartz, R. A . , C . A . Janusz, and C. K . Janniger. 2006. Seborrheic dermatitis: an overview. Am Fam Physician 74:125. 214. Gueho, E . , and S. A . Meyer. 1989. A reevaluation of the genus Malassezia by means of genome comparison. Antonie Van Leeuwenhoek 55:245. 215. Guillot, J., and E . Gueho. 1995. The diversity of Malassezia yeasts confirmed by r R N A sequence and nuclear D N A comparisons. Antonie Van Leeuwenhoek 67:297. 216. Guillot, J., E . Gueho, and R. Chermette. 1995. Confirmation of the nomenclatural status of Malassezia pachydermatis. Antonie Van Leeuwenhoek 67:173. 217. Gupta, A . K . , and R. Bluhm. 2004. Seborrheic Dermatitis. J Eur Acad Dermatol Venereol 18:13. 218. Kligman, A . M . , and J. J. Leyden. 1983. Serborrheic dermatitis. Semin Dermatol 2:57. 219. Pierard-Franchimont, C , J. E . Arrese, and G. E . Pierard. 1995. Immunohistochemical Aspects of the Link Between Malassezia ovalis and Seborrheic Dermatitis. J Eur Acad Dermatol Venereol 4:14. 220. Heng, M . C , C. L . Henderson, D. C. Barker, and G . Haberfelde. 1990. Correlation of Pityosporum ovale density with clinical severity of seborrheic dermatitis as assessed by a simplified technique. J Am Acad Dermatol 23:82. 221. Rook, A . , D . I. Wilkinson, F. J. G . Ebling, R. H . Champion, and J. L . Burton. 1992. Textbook of Dermatology. 4 t h Ed . Blackwell Scientific Publications, Oxford, U . K . 222. Henderson, C. A . , J. Taylor, and W . J. Cunliffe. 2000. Sebum excretion rates in mothers and neonates. Br J Dermatol 142:110. 212 223. Binder, R. L . , and F. J. Jonelis. 1983. Seborrheic dermatitis in neuroleptic-induced parkinsonism. Arch Dermatol 119:473. 224. Wilson, C. L . , and M . Walshe. 1988. Incidence of seobrrhoeic dermatitis in spinal injury patients. Br J Dermatol 119.48S. 225. Cowley, N . C , P. M . Farr, and S. Shuster. 1990. The permissive effect of sebum in seborrhoeic dermatitis: an explanation of the rash in neurological disorders. Br J Dermatol 122:71. 226. Faergemann, J., I. M . Bergbrant, M . Dohse, A . Scott, and G . Westgate. 2001. Seborrhoeic dermatitis and Pityrosporum (Malassezia) folliculitis: Characterization of inflammatory cells and mediators in the skin by immunohistochemistry. Br J Dermatol 144:549. 227. Molinero, L . L . , M . Gruber, J. Leoni, and A . Woscoff. 2003. Up-Regulated Expression of M I C A and Proinflammatory Cytokines in Skin Biopsies from Patients with Seborrhoeic Dermatitis. Clin Immunol 106:50. 228. Bergbrant, I. M . , S. Johansson, D. Robbins, A . Scheynius, J. Faergemann, and T. Soderstrom. 1991. A n immunological study in patients with seborrhoeic dermatitis. Clin Exp Dermatol 16:331. 229. Alexander, J., J. A . Payne, R. Murray, J. A . Frelinger, and P. Cresswell. 1989. Differential transport requirements of H L A and Ff-2 class I glycoproteins. Immunogenetics 29:380. 230. Udaka, K . , T. J. Tsomides, and H . N . Eisen. 1992. A naturally occurring peptide recognized by alloreactive C D 8 + cytotoxic T lymphocytes in association with a class I M H C protein. Cell 69:989. 231. Behlke, M . A . , T. J. Henkel, S. J. Anderson, N . C. Lan, L . Hood, V . L . Braciale, and D . Y . Loh. 1987. Expression of a murine polyclonal T cell receptor marker correlates with the use of specific members of the V beta 8 gene segment subfamily. J Exp Med 165:257. 232. Oble, D . A . , and H . S. Teh. 2001. Tight skin mouse subcutaneous hypertrophy can occur in the absence of alphabeta T cell receptor-bearing lymphocytes. J Rheumatol 28:1852. 233. Itohara, S., P. Mombaerts, J. Lafaille, J. Iacomini, A . Nelson, A . R. Clarke, M . L . Hooper, A . Farr, and S. Tonegawa. 1993. T cell receptor delta gene mutant mice: independent generation of ap T cells and programmed rearrangements of y§ T C R genes. Cell 72:337. 234. Mombaerts, P., J. Iacomini, R. S. Johnson, K . Herrup, S. Tonegawa, and V . E . Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68:869. 235. Clark, L . B . , M . W. Appleby, M . E . Brunkow, J. E . Wilkinson, S. F. Ziegler, and F. Ramsdell. 1999. Cellular and molecular characterization of the scurfy mouse mutant. J Immunol 162:2546. 213 236. Fujita, S. I., Y . Senda, S. Nakaguchi, and T. Hashimoto. 2001. Multiplex P C R using internal transcribed spacer 1 and 2 regions for rapid detection and identification of yeast strains. J Clin Microbiol 39:3617. 237. Karasuyama, H . , and F. Melchers. 1988. Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4 or 5, using modified c D N A expression vectors. Eur J Immunol 18:97. 238. Chun, S., M . Daheshia, N . A . Kuk l in , and B . T. Rouse. 1998. Modulation of viral immunoinflammatory responses with cytokine D N A administered by different routes. J Virol 72:5545. 239. Ernst, D . , S. Chambers, E . Chronopoulou, J. El ia , J. Ember, Z . Huang, F.-J . Luan, H . Maecker, G . Q i , H . Sepulveda, S. Sasaki, J.-P. Shih, B . - Y . Wei , K . Willmann, J. Wilson, and E . L . Morgan. 2003. Techniques for Immune Function Analysis: Application Handbook. 1 s t Ed . B D Biosciences, San Diego, C A . 240. Pharmingen. 2006. Immunohistochemistry Protocols: Preparation and Staining of Frozen Tissue Sections, V o l . 2006. B D Biosciences, San Diego, C A . 241. Ren, P., S. Sridhar, and V . Chaturvedi. 2004. Use of Paraffin-Embedded Tissue for Identification of Saccharomyces cerevisiae in a Baker's Lung Nodule by Fungal P C R and Nucleotide Sequencing. J. Clin. Microbiol. 42:2840. 242. Bergbrant, I. M . , S. Johansson, D . Robbins, K . Bengtsson, J. Faergemann, A . Scheynius, and T. Soderstrom. 1991. The evaluation of various methods and antigens for the detection of antibodies against Pityrosporum ovale in patients with seborrhoeic dermatitis. Clin Exp Dermatol 16:339. 243. Wetsel, R. A . , D . T. Fleischer, and D . L . Haviland. 1990. Deficiency of the Murine Fifth Complement Component (C5): A 2-Base Pair Gene Deletion in a 5'-Exon. J Biol Chem 265:2435. 244. Gavin, M . A . , S. R. Clarke, E . Negrou, A . Gallegos, and A . Rudensky. 2002. Homeostasis and anergy of C D 4 + C D 2 5 + suppressor T cells in vivo. Nat Immunol 3:33. 245. Whittingham, D . G. , and K . J. Wood. 1983. Reproductive Physiology. Academic Press, New York, N Y . 246. Hector, R. F. , E . Yee, and M . S. Collins. 1990. Use of D B A / 2 n Mice in Models of Systemic Candidiasis and Pulmonary and Systemic Aspergillosis. Infect Immun 58:1476. 247. Ashman, R. B . , J. M . Papadimitriou, A . Fulurija, K . E . Drysdale, C. S. Farah, O. Naidoo, and T. Gotjamanos. 2003. Role of complement C5 and T lymphocytes in pathogenesis of disseminated and mucosal candidiasis in susceptible D B A / 2 mice. Microb Pathog 34:103. 248. Murray, P. R., E . J. Baron, J. H . Jorgensen, M . A . Pfaller, and R. H . Yolken. 1999. Manual of Clinical Microbiology. lx Ed. A S M Press, Washington, D C . 214 249. Puerto, J. L . , P. Garcia-Martos, A . Saldarreaga, J. Ruiz-Aragon, R. Garcia-Agudo, and S. Aoufi . 2002. First report of urinary tract infection due to Pichia ohmeri. Eur J Clin Microbiol Infect Dis 21:630. 250. Pfaller, M . A . , and D . J. Diekema. 2004. Rare and emerging opportunistic fungal pathogens: Concern for resistance beyond Candida albicans and Aspergillus fumigatus. J Clin Microbiol 42:4419. 251. Girmenia, C , G . Pizzarelli, F. Cristini, F. Barchiesi, E . Spreghini, G . Scalise, and P. Martino. 2006. Candida guilliermondii fungemia in patients with hematologic malignancies. J Clin Microbiol 44:2458. 252. Ainbinder, D . J., V . C. Parmley, T. H . Mader, and M . L . Nelson. 1998. Infectious crystalline keratopathy caused by Candida guilliermondii. Am J Ophthalmol 125:723. 253. Booth, L . V . , A . L . Collins, J. A . Lowes, and M . Radford. 1988. Skin rash associated with Candida guilliermondii. Med Pediatr Oncol 16:295. 254. Mueller, R. S., S. V . Bettenay, and M . Shipstone. 2002. Cutaneous candidiasis in a dog caused by Candida guilliermondii. Vet Rec 150:728. 255. Leyden, J. J., and A . M . Kligman. 1978. The role of microorganisms in diaper dermatitis. Arch Dermatol 114:56. 256. Oranje, A . P., T. van Joost, E . C. van Reede, V . D . Vuzevski , G . Dzoljic-Danilovic, F. J. ten Kate, and E . Stolz. 1986. Infantile seborrheic dermatitis. Morphological and immunopathological study. Dermatologica 172:191. 257. Guillot, J., J. Chermette, and E . Gueho. 1994. Prevalence du Genre Malassezia chez les Mammiferes. J Mycol Med 4. 258. Faergemann, J., and H . Laufen. 1993. Levels of Fluconazole in Serum, Stratum Corneum, Epidermis-Dermis (without Stratum Corneum) and Eccrine Sweat. Clin Exp Dermatol 18:102. 259. Louie, A . , G . L . Drusano, and P. Banerjee. 1998. Pharmacodynamics of Fluconazole in a Murine Model of Systemic Candidiasis. Antimicrob Agents Chemother 42:1105. 260. Bennett, J. E . , K . Izumikawa, and K . A . Marr. 2004. Mechanism of increased fluconazole resistance in Candida glabrata during prophylaxis. Antimicrob Agents Chemother 48:1773. 261. Kakeya, H . , T. Miyazaki , and S. Kohno. 2003. Azole resistance in Candida spp. Nippon Ishinkin Gakkai Zashhi 44:739. 262. Noble, W . C , and R. R. Davies. 1965. Studies on the Dispersal of Staphylococci. J Clin Pathol 18:16. 263. Kiss , G . R., S. Radvanyi, and G . Szigeti. 1996. Characteristics of Malassezia pachydermatis strains isolated from canine otitis externa. Mycoses 39:313. 215 264. Matousek, J. L . , K . L . Campbell, I. Kakoma, P. F. Solter, and D . J. Schaeffer. 2003. Evaluation of the effect of p H on in vitro growth of Malassezia pachydermatis. Can J Vet Res 67:56. 265. Kang, S. L . , M . J. Rybak, B . J. McGrath, G. W . Kaatz, and S. M . Seo. 1994. Pharmacodynamics of Levofloxain, Ofloxacin, and Ciprofloxacin, Alone and in Combination with Rifampin, against Methicillin-Susceptible and -Resistant Staphylococcus aureus in an in vitro Infection Model . Antimicrob Agents Chemother 38:2702. 266. Kozel , T. R. 1996. Activation of the Complement System by Pathogenic Fungi. Clin Microbial Rev 9:34. 267. Edwards, M . , D . Kasper, H . Jennings, C. Baker, and A . Nicholson-Weller. 1982. Capsular sialic acid prevents activation of the alternative complement pathway by type III, group B Streptococci. J Immunol 128:1278. 268. Fearon, D . T. 1978. Regulation by membrane sialic acid of piH-dependent decay-dissociation of amplification C3 convertase of the alternative complement pathway. Proc Natl Acad Sci USA 75:1971. 269. Kazatchkine, M . D . , D . T. Fearon, and K . F. Austen. 1979. Human alternative complement pathway: membrane-associated sialic acid regulates the competition between B and p i H for cell-bound C3b. J Immunol 122:75. 270. Pangburn, M . K . , and H . J. Muller-Eberhard. 1978. Complement C3 convertase: cell surface restriction of b l H control and generation of restriction on neuraminidase-treated cells. Proc Natl Acad Sci USA 75:2416. 271. Austen, K . F., and D . T. Fearon. 1979. A molecular basis of activation of the alternative pathway of human complement. Adv Exp Med Biol 120B:3. 212. Kazatchkine, M . , D . Fearon, J. Silbert, and K . Austen. 1979. Surface-associated heparin inhibits zymosan-induced activation of the human alternative complement pathway by augmenting the regulatory action of the control proteins on particle-bound C3b. J. Exp. Med. 150:1202. 273. Tagami, H . , K . Kudoh, and H . Takematsu. 1989. Inflammation and Immunity in Dermatophytosis. Dermatologica 179:1. 21 A. Crabbe, J. C , J. K . Belknap, K . J. Buck, and P. Metten. 1994. Use of recombinant inbred strains for studying genetic determinants of responses to alcohol. Alcohol Alcohol Suppl 2:67. 275. Mouse Genome Informatics Web Site, M . G . I. The Jackson Laboratory. Bar Harbor, M E . www.informatics.jax.org. 216. Nadeau, J. H . , and S. J. Phillips. 1987. The Putative Oncogene Pim-1 in the Mouse: Its Linkage and Variation Among t Haplotypes. Genetics 117:533. 216 277. Laird, P. W. , N . M . van der Lugt, A . Clarke, J. Domen, K . Linders, J. McWhi r , A . Berns, and M . Hooper. 1993. In vivo analysis of Pim-1 deficiency. Nucleic Acids Res 21:4750. 278. Mouse Phenom Database, M . P. D . The Jackson Laboratory. Bar Harbour, M E . www.j ax. org/phenome. 279. Vance, R. E . , A . M . Jamieson, D . Cado, and D . H . Raulet. 2002. Implications of CD94 deficiency and monoallelic N K G 2 A expression for natural killer cell development and repertoire formation. Proc Natl Acad Sci USA 99:868. 280. Giorda, R., E . P. Weisberg, T. K . Ip, and M . Trucco. 1992. Genomic structure and strain-specific expression of the natural killer cell receptor N K R - P 1 . J Immunol 149:1957. 281. Moretta, L . , and A . Moretta. 2004. Unravelling natural killer cell function: triggering and inhibitory human N K receptors. Embo J 23:255. 282. Behrman, R. E . , R. Kliegman, and H . B . Jenson. 2000. Nelson Textbook of Pediatrics. 16 t h Ed . W . B . Saunders Company, Philadelphia, P A . 283. Beers, M . H . , and R. Berkow. 1999. The Merck Manual of Diagnosis and Therapy. Section 19. Pediatrics. 17 t h Ed. John Wiley & Sons, Hoboken, N J . 284. Wagner, D . , and P. Sohnle. 1995. Cutaneous defenses against dermatophytes and yeasts. Clin. Microbiol. Rev. 8:317. 285. Casadevall, A . , A . Cassone, F. Bistoni, J. E . Cutler, W . Magliani, J. W . Murphy, L . Polonelli, and L . Romani. 1998. Antibody and/or cell-mediated immunity, protective mechanisms in fungal disease: an ongoing dilemma or an unnecessary dispute? Med My col 36 Suppl 1:95. 286. Mindel , A . , and M . Tenant-Flowers. 2001. A B C of A I D S : Natural History and Management of Early H I V Infection. BMJ 322:1290. 287. Pahwa, S. 1989. Intravenous Immune Globulin in Patients with Acquired Immune Deficiency Syndrome. J Allergy Clin Immunol 84:625. 288. Baus, E . , F. Andris, P. M . Dubois, J. Urbain, and O. Leo. 1996. Dexamethasone inhibits the early steps of antigen receptor signaling in activated T lymphocytes. J Immunol 156:4555. 289. Chen, X . , T. Murakami, J. J. Oppenheim, and O. M . Howard. 2004. Differential response of murine C D 4 + C D 2 5 + and C D 4 + C D 2 5 " T cells to dexamethasone-induced cell death. Eur J Immunol 34:859. 290. Dyson, P. J., A . M . Knight, S. Fairchild, E . Simpson, and K . Tomonari. 1991. Genes encoding ligands for deletion of V p i 1 T cells cosegregate with mammary tumour virus genomes. Nature 349:531. 217 291. Simpson, E . , K . Takacs, and D . M . Altmann. 1994. Thymic repertoire selection by superantigens: presentation by human and mouse M H C molecules. Thymus 23:1. 292. Tough, D . F., S. Sun, X . Zhang, and J. Sprent. 1999. Stimulation of Naive and Memory T Cells by Cytokines. Immunol Rev 170:39. 293. Marleau, A . M . , and N . Sarvetnick. 2005. T cell homeostasis in tolerance and immunity. J Leukoc Biol 78:575. 294. Goldrath, A . W. , L . Y . Bogatzki, and M . J. Bevan. 2000. Naive T Cells Transiently Acquire a Memory-Like Phenotype during Homeostasis-Driven Proliferation. J Exp Med 192:557. 295. Dunic, I., S. Vesic, and D . J. Jevtovic. 2004. Oral Candidiasis and Seborrheic Dermatitis in HIV-induced Patients on Highly Active Antiretroviral Therapy. HIV MID 5:50. 296. Blair, P. J., S. J. Bultman, J. C. Haas, B . T. Rouse, J. E . Wilkinson, and V . L . Godfrey. 1994. C D 4 + C D 8 " T cells are the effector cells in disease pathogenesis in the scurfy (sf) mouse. J Immunol 153:3764. 297. Brunkow, M . E . , E . W . Jeffery, K . A . Hjerrild, B . Paeper, L . B . Clark, S. A . Yasayko, J. E . Wilkinson, D . Galas, S. F. Ziegler, and F. Ramsdell. 2001. Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat Genet 27:68. 298. Ou, L . S., E . Goleva, C. Hal l , and D . Y . Leung. 2004. T regulatory cells in atopic dermatitis and subversion of their activity by superantigens. J Allergy Clin Immunol 113:756. 299. Godfrey, V . L . , J. E . Wilkinson, and L . B . Russell. 1991. X-l inked lymphoreticular disease in the scurfy (sf) mutant mouse. Am J Pathol 138:1379. 300. Fontenot, J. D . , M . A . Gavin, and A . Y . Rudensky. 2003. FoxP3 programs the development and function of C D 4 + C D 2 5 + regulatory T cells. Nat Immunol 4:330. 301. Kanangat, S., P. Blair, R. Reddy, M . Daheshia, V . Godfrey, B . T. Rouse, E . Wilkinson, and M . Deheshia. 1996. Disease in the scurfy (sf) mouse is associated with overexpression of cytokine genes. Eur J Immunol 26:161. 302. Wolf, D . , K . Hochegger, A . M . Wolf, H . F. Rumpold, G . Gastl, H . Ti lg , G . Mayer, E . Gunsilius, and A . R. Rosenkranz. 2005. CD4 + CD25 + Regula tory T Cells Inhibit Experimental Anti-Glomerular Basement Membrane Glomerulonephritis in Mice . J Am Soc Nephrol 16:1360. 303. Boumpas, D . T., F. Paliogianni, E . D . Anastassiou, and J. E . Balow. 1991. Glucocorticosteroid action on the immune system: molecular and cellular aspects. Clin Exp Rheumatol 9:413. 218 304. Okumura, K . K . , N . Sagawa, Y . Ihara, F. Kobayashi, H . Itoh, and T. M o r i . 1997. Cortisol and TGF - P inhibit secretion of platelet-activating factor-acetylhydrolase in a monocyte-macrophage model system. Mol Hum Reprod 3:927. 305. Packard, B . D . , and J. M . Weiler. 1983. Steroids inhibit activation of the alternative-amplification pathway of complement. Infect Immun 40:1011. 306. Ernst, B . , D . S. Lee, J. M . Chang, J. Sprent, and C. D . Surh. 1999. The peptide ligands mediating positive selection in the thymus control T cell survival and homeostatic proliferation in the periphery. Immunity 11:173. 307. Bullard, D . C , K . Scharffetter-Kochanek, M . J. McArthur, J. G . Chosay, M . E . McBride, C. A . Montgomery, and A . L . Beaudet. 1996. A polygenic mouse model of psoriasiform skin disease in CD18-deficient mice. PNAS 93:2116. 308. Parry, M . E . , and G . R. Sharpe. 1998. Seborrhoeic dermatitis is not caused by an altered immune response to Malassezia yeast. Br J Dermatol 139:254. 309. Bergbrant, I. M . 1991. Seborrhoeic dermatitis and Pityrosporum ovale: cultural, immunological and clinical studies. Acta Derm Venereol Suppl (Stockh) 167:1. 310. Douek, D . C. 2003. Disrupting T-cell homeostasis: how HIV-1 infection causes disease. AIDS Rev 5:172. 311. Oswald-Richter, K . , S. M . Gr i l l , N . Shariat, M . Leelawong, M . S. Sundrud, D . W. Haas, and D . Unutmaz. 2004. H I V infection of naturally occurring and genetically reprogrammed human regulatory T-cells. PLoS Biol 2:El98. 312. Apo i l , P. A . , B . Puissant, F. Roubinet, M . Abbal , P. Massip, and A . Blancher. 2005. FoxP3 m R N A levels are decreased in peripheral blood C D 4 + lymphocytes from H I V -positive patients. JAcquir Immune Defic Syndr 39:381. 313. Tsunemi, S., T. Iswaski, T. Imado, S. Higasa, E . Kakishita, T. Shirasaka, and H . Sano. 2005. Relationship of C D 4 + C D 2 5 + regulatory T cells to immune status in HIV-infected patients. AIDS 19:879. 314. Verheggen, R. 2003. Immune restoration in patients with H I V infection: H A A R T and beyond. J Assoc Nurses AIDS Care 14:76. 315. Hunziker, L . , M . Recher, A . J. Macpherson, A . Ciurea, S. Freigang, H . Hengartner, and R. M . Zinkernagel. 2003. Hypergammaglobulinemia and autoantibody induction mechanisms in viral infections. Nat Immunol 4:343. 316. Shirai, A . , M . Cosentino, S. F. Leitman-Klinman, and D . M . Klinman. 1992. Human immunodeficiency virus infection induces both polyclonal and virus-specific B cell activation. J Clin Invest 89:561. 219 317. Harris, D . P., S. Koch , L . M . Mullen, and S. L . Swain. 2001. B Cel l Immunodeficiency Fails to Develop in CD4-Deficient Mice Infected with B M 5 : Murine A I D S as a Multistep Disease. J Immunol 166:6041. 318. Khattri, R., D . Kasprowicz, T. Cox, M . Mortrud, M . W. Appleby, M . E . Brunkow, S. F. Ziegler, and F. Ramsdell. 2001. The Amount of Scurfin Protein Determines Peripheral T Cel l Number and Responsiveness. J Immunol 167:6312. 319. Deshpande, S. P., S. Lee, M . Zheng, B . Song, D . Knipe, J. A . Kapp, and B . T. Rouse. 2001. Herpes Simplex Virus-Induced Keratitis: Evaluation of the Role of Molecular Mimicry in Lesion Pathogenesis. J. Virol. 75:3077. 320. Motyka, B . , and H.-S. Teh. 1998. Naturally Occuring L o w Affinity Peptide/MHC Class I Ligands can Mediate Negative Selection and T Cel l Activation. J Immunol 160:77. 321. Ashwell , J. D . , F. W . L u , and M . S. Vacchio. 2000. Glucocorticoids in T cell development and function. Annu Rev Immunol 18:309. 322. Bauer, S., V . Groh, J. Wu , A . Steinle, J. H . Phillips, L . L . Lanier, and T. Spies. 1999. Activation of N K cells and T cells by N K G 2 D , a receptor for stress-inducible M I C A . Science 285:727. 323. Steinle, A . , P. L i , D . L . Morris, V . Groh, L . L . Lanier, R. K . Strong, and T. Spies. 2001. Interactions of human N K G 2 D with its ligands M I C A , M I C B , and homologs of the mouse R A E - 1 protein family. Immunogenetics 53:279. 324. Adam, C , S. K ing , T. Allgeier, H . Braumuller, C. Luking, J. Mysliwietz, A . Kriegeskorte, D . H . Busch, M . Rocken, and R. Mocikat. 2005. D C - N K cell cross talk as a novel C D 4 + T-cell-independent pathway for antitumor C T L induction. Blood 106:338. 325. Diefenbach, A . , A . M . Jamieson, S. D . L i u , N . Shastri, and D . H . Raulet. 2000. Ligands for the murine N K G 2 D receptor: expression by tumor cells and activation of N K cells and macrophages. Nat Immunol 1:119. 326. Kranz, D . M . , D . H . Sherman, M . V . Sitkovsky, M . S. Pasternack, and H . N . Eisen. 1984. Immunoprecipitation of cell surface structures of cloned cytotoxic T lymphocytes by clone-specific antisera. Proc Natl Acad Sci USA 81:573. 327. Staerz, U . D . , H . G . Rammensee, J. D . Benedetto, and M . J. Bevan. 1985. Characterization of a murine monoclonal antibody specific for an allotypic determinant on T cell antigen receptor. J Immunol 134:3994. 328. Manning, T. C , C. J. Schlueter, T. C. Brodnicki, E . A . Parke, J. A . Speir, K . C. Garcia, L . Teyton, I. A . Wilson, and D . M . Kranz. 1998. Alanine scanning mutagenesis of an ap T cell receptor: Mapping the energy of antigen recognition. Immunity 8:413. 329. Custer, R. P., G . C. Bosma, and M . J. Bosma. 1985. Severe combined immunodeficiency (SCID) in the mouse. Pathology, reconstitution, neoplasms. Am J Pathol 120:464. 220 330. Azukizawa, H . , H . Kosaka, S. Sano, W . R. Heath, I. Takahashi, X . H . Gao, Y . Sumikawa, M . Okabe, K . Yoshikawa, and S. Itami. 2003. Induction of T-cell-mediated skin disease specific for antigen transgenically expressed in keratinocytes. Eur J Immunol 33:1879. 331. McGarg i l l , M . A . , D . Mayerova, H . E . Stefanski, B . Koehn, E . A . Parke, S. C. Jameson, A . Panoskaltsis-Mortari, and K . A . Hogquist. 2002. A Spontaneous CD8 T Cel l -Dependent Autoimmune Disease to an Antigen Expressed Under the Human Keratin 14 Promoter. J Immunol 169:2141. 332. Fan, L . , B . W . Busser, T. Q. Lifsted, D . L o , and T. M . Laufer. 2003. Antigen presentation by keratinocytes directs autoimmune skin disease. PNAS 100:3386. 333. Mclnnes, I. B . , and J. A . Gracie. 2004. Interleukin-15: a new cytokine target for the treatment of inflammatory disease. Curr Opin Pharmacol 4:392. 334. McMahon, C. W. , and D . H . Raulet. 2001. Expression and function of N K cell receptors in CD8+ T cells. Curr Opin Immunol 13:465. 335. Carroll, J. M . , T. Crompton, J. P. Seery, and F. M . Watt. 1997. Transgenic mice expressing IFN-gamma in the epidermis have eczema, hair hypopigmentation, and hair loss. J Invest Dermatol 108:412. 336. Gonzalez, S., V . Groh, and T. Spies. 2006. Immunobiology of human N K G 2 D and its ligands. Curr Top Microbiol Immunol 298:121. 337. Groh, V . , R. Rhinehart, J. Randolph-Habecker, M . S. Topp, S. R. Riddell , and T. Spies. 2001. Costimulation of C D 8 a p T cells by N K G 2 D via engagement by M I C induced on virus-infected cells. Nat Immunol 2:255. 338. Das, H . , V . Groh, C. Ku i j l , M . Sugita, C. T. Morita, T. Spies, and J. F. Bukowski. 2001. M I C A engagement by human Vy2V82 T cells enhances their antigen-dependent effector function. Immunity 15:83. 339. Girardi, M . , D . E . Oppenheim, C. R. Steele, J. M . Lewis, E . Glusac, R. Filler, P. Hobby, B . Sutton, R. E . Tigelaar, and A . C. Hayday. 2001. Regulation of cutaneous malignancy by y8 T cells. Science 294:605. 340. Jamieson, A . M . , A . Diefenbach, C. W. McMahon , N . Xiong , J. R. Carlyle, and D . H . Raulet. 2002. The Role of the N K G 2 D Immunoreceptor in Immune Cel l Activation and Natural K i l l i ng . Immunity 17:19. 341. Asarnow, D . M . , A . Kuzie l , M . Bonyhadi, R. E . Tigelaar, P. W . Tucker, and J. P. All ison. 1988. Limited diversity of y5 antigen receptor genes of Thy-1 + dendritic epidermal cells. Cell 55:837. 342. L i , J. Q., L . X . Cu i , and W. He. 2005. Distinct Pattern of Human V51 y8 T Cells Recognizing M I C A . Cell Mol Immunol 2:253. 221 343. Lee, H . C , K . Tomiyama, S. K . Y e , K . Kawai , and K . Ikuta. 2002. Seeding of dendritic epidermal T cells in the neonatal skin is reduced in 129 strain of mice. Immunol Lett 81:211. 344. Jameson, J., K . Ugarte, N . Chen, P. Yachi , E . Fuchs, R. Boismenu, and W . L . Havran. 2002. A role for skin yS T cells in wound repair. Science 296:747. 345. Hara, H . , K . Kishihara, G . Matsuzaki, H . Takimoto, T. Tsukiyama, R. E . Tigelaar, and K . Nomoto. 2000. Development of dendritic epidermal T cells with a skewed diversity of gammadelta T C R s in Vdeltal-deficient mice. J Immunol 165:3695. 346. Patrick, E . , H . I. Maibach, and A . Burkhalter. 1985. Mechanisms of chemically induced skin irritation. I. Studies of time course, dose response, and components of inflammation in the laboratory mouse. Toxicol Appl Pharmacol 81:476. 347. Kaminski , M . J., P. R. Bergstresser, and A . Takashima. 1993. In vivo activation of mouse dendritic epidermal T cells in sites of contact dermatitis. Eur J Immunol 23:1715. 348. Krueger, G . G. , and M . Emam. 1984. Biology of Langerhans Cells: Analysis by Experiments to Deplete Langerhans Cells from Human Skin. J Invest Dermatol 82:613. 349. Hayakawa, J., N . Moriya , and T. Shiohara. 1996. Adult thymus contains dendritic epidermal T cell precursors that home to the epidermis in irradiated, but no in normal, mice. Cell Immunol 175:190. 350. Albanesi, C , C. Scarponi, M . L . Giustizieri, and G . Girolomoni. 2005. Keratinocytes in inflammatory skin diseases. Curr Drug Targets Inflamm Allergy 4:329. 351. Asadullah, K . , W . - D . Docke, H . - D . Vo lk , and W. Sterry. 1999. The pathophysiological role of cytokines in psoriasis. Drugs Today 35:913. 352. Madison, K . C. 2003. Barrier Function of the Skin: "La Raison d'Etre" of the Epidermis. J Invest Dermatol 121:231. 353. Schon, M . P., M . Schon, C. M . Parker, and I. R. Williams. 2002. Dendritic epidermal T cells (DETC) are diminished in integrin aE(CD103)-deficient mice. J Invest Dermatol 119:190. 354. Schon, M . P., M . Schon, H . B . Warren, J. P. Donohue, and C. M . Parker. 2000. Cutaneous Inflammatory Disorder in Integrin OCE (CD103)-Deficient Mice . J Immunol 165:6583. 355. Lewis, J. M . , M . Girardi, S. J. Roberts, D . B . S, A . C. Hayday, and R. E . Tigelaar. 2006. Selection of the cutaneous intraepithelial y8 + T cell repertoire by a thymic stromal determinant. Nat Immunol 7:843. 356. Bos, J. D . , M . B . Teunissen, I. Cairo, S. R. Krieg, M . L . Kapsenberg, P. K . Das, and J. Borst. 1990. T-cell receptor gamma delta bearing cells in normal human skin. J Invest Dermatol 94:37. 222 357. E l Zawahry, M . 1977. The Egyptian sycamore tree: its use in dermatology. Int J Dermatol 16:853. 358. Pathak, M . A . , and T. B . Fitzpatrick. 1992. The evolution of photochemotherapy with psoralens and U V A ( P U V A ) : 2000 B C to 1992 A D . JPhotochem Photobiol B 14:3. 359. Galadari, I., M . O. Sharif, and H . Galadari. 2005. Psoriasis: a fresh look. Clinics in Dermatology 23:491. 360. Smith, C. H . 1999. Use of hydroxyurea in psoriasis. Clin Exp Dermatol 24:2. 361. Gottlieb, A . B . 2005. Therapeutic options in the treatment of psoriasis and atopic dermatitis. J Am Acad Dermatol 53.S3. 362. Yuspa, S. H . , and C. C. Harris. 1974. Altered differentiation of mouse epidermal cells treated with retinyl acetate in vitro. Exp Cell Res 86:95. 363. Gupta, A . K . , K . N ico l , and R. Batra. 2004. Role of antifungal agents in the treatment of seborrheic dermatitis. Am J Clin Dermatol 5:417. 364. Farkas, A . , L . Kemeny, B . J. Szony, Z . Bata-Csorgo, A . Pivarcsi, M . Kiss , M . Szell, K . A . , and A . Dobozy. 2001. Dithranol upregulates IL-10 receptors on the cultured human keratinocyte cell line HaCaT. Inflamm Res 50:44. 365. Weinberg, A . 2001. In vitro hydroxyurea decreases T h l cell-mediated immunity. Clin Diagn Lab Immunol 8:702. 366. Yarbro, J. W . 1992. Mechanism of action of hydroxyurea. Semin Oncol 19:1. 367. Szondy, Z . , U . Reichert, and L . Fesus. 1998. Retinoic acids regulate apoptosis of T lymphocytes through an interplay between R A R and R X R receptors. Cell Death Differ 5:4. 368. Skinner, R. B . , Jr., P. W . Noah, R. M . Taylor, M . D . Zanolli , S. West, J. D . Guin, and E . W . Rosenberg. 1985. Double-blind treatment of seborrheic dermatitis with 2% ketoconazole cream. J Am Acad Dermatol 12:852. 369. Leeming, J. P., F. H . Notman, and K . T. Holland. 1989. The distribution and ecology of Malassezia furfur and cutaneous bacteria on human skin. J Appl Bacteriol 67:47. 370. Plotkin, L . , I. Mathov, L . Squiquera, and J. Leoni. 1998. Arachidonic acid released from epithelial cells by Malassezia furfur phospholipase A(2): a potential pathophysiologic mechanism. Mycologia 90:163. 371. Ran, Y . , T. Yoshiike, and H . Ogawa. 1993. Lipase of Malassezia furfur, some properties and their relationship to cell growth. J Med Vet My col 31:77. 372. Bergbrant, I. M . , and J. Faergemann. 1988. Variations of Pityrosporum orbiculare in middle-aged and elderly individuals. Acta Derm Venereol 68:537. 223 373. Meresse, B . , Z . Chen, C. Ciszewski, M . Tretiakova, G . Bhagat, T. N . Krausz, D . H . Raulet, L . L . Lanier, V . Groh, T. Spies, E . C. Ebert, P. H . Green, and B . Jabri. 2004. Coordinated induction by IL 15 o f a TCR-independent N K G 2 D signaling pathway converts C T L into lymphokine-activated killer cells in celiac disease. Immunity 21:357. 374. Ockenfels, H . M . , T. Schultewolter, G . Ockenfels, R. Funk, and M . Goos. 1998. The antipsoriatic agent dimethylfumarate immunomodulates T-cell cytokine secretion and inhibits cytokines of the psoriatic cytokine network. Br J Dermatol 139:390. 375. van Etten, E . , and C . Mathieu. 2005. Immunoregulation by 1,25-dihydroxyvitamin D 3 : basic concepts. J Steroid Biochem Mol Biol 97:93. 376. Coven, T. R., I. B . Walters, I. Cardinale, and J. G . Krueger. 1999. PUVA-induced lymphocyte apoptosis: mechanism of action in psoriasis. Photodermatol Photoimmunol Photomed 15:22. 377. Duvic, M . , S. Nagpal, A . T. Asano, and R. A . Chandraratna. 1997. Molecular mechanisms of tazarotene action in psoriasis. J Am Acad Dermatol 37:S18. 378. Cerwenka, A . , A . B . Bakker, T. McClanahan, J. Wagner, J. Wu , J. H . Phillips, and L . L . Lanier. 2000. Retinoic acid early inducible genes define a ligand family for the activating N K G 2 D receptor in mice. Immunity 12:721. 379. Rosen, T., B . J. Schell, and I. Orengo. 1997. Anti-inflammatory activity o f antifungal preparations. Int J Dermatol 36:788. 380. Prinz, J. C. 2003. The role of T cells in psoriasis. J Eur Acad Dermatol Venereol 17:257. 381. Baksh, S., and S. J. Burakoff. 2000. The role of calcineurin in lymphocyte activation. Semin Immunol 12:405. 382. Gottlieb, A . B . , and J. D . Bos. 2002. Recombinantly engineered human proteins: transforming the treatment of psoriasis. Clin Immunol 105:105. 383. Cather, J. C , and W. Abramovits. 2003. Investigational therapies for psoriasis. J Am Acad Dermatol 49.S133. 384. Gottlieb, A . B . , S. Kang, K . G . Linden, M . Lebwohl, A . Menter, A . A . Abdulghani, M . Goldfarb, N . Chieffo, and M . C. Totoritis. 2004. Evaluation of safety and clinical activity of multiple doses of the anti-CD80 monoclonal antibody, galiximab, in patients with moderate to severe plaque psoriasis. Clin Immunol 111:28. 385. Izcue, A . , J. L . Coombes, and F. Powrie. 2006. Regulatory T cells suppress systemic and mucosal immune activation to control intestinal inflammation. Immunol Rev 212:256. 386. Asseman, C , S. Fowler, and F. Powrie. 2000. Control of experimental inflammatory bowel disease by regulatory T cells. AmJRespir Crit Care Med 162.S185. 224 387. Weiss, E . , A . J. Mamelak, S. L a Morgia, B . Wang, C. Feliciani, A . Tul l i , and D . N . Sauder. 2004. The role of interleukin 10 in the pathogenesis and potential treatment of skin diseases. J Am Acad Dermatol 50:657. 388. Miche l , G . , A . Mirmohammadsadegh, E . Olasz, B . Jarzebska-Deussen, A . Muschen, L . Kemeny, H . F. Abts, and T. Ruzicka. 1997. Demonstration and functional analysis of IL-10 receptors in human epidermal cells: decreased expression in psoriatic skin, down-modulation by IL-8, and up-regulation by an antipsoriatic glucocorticosteroid in normal cultured keratinocytes. J Immunol 159:6291. 389. Asadullah, K . , J. Eskdale, A . Wiese, G . Gallagher, M . Friedrich, and W. Sterry. 2001. Interleukin-10 promoter polymorphism in psoriasis. J Invest Dermatol 116:975. 390. Levings, M . K . , R. Sangregorio, F. Galbiati, S. Squadrone, R. de Waal Malefyt, and M . G. Roncarolo. 2001. I F N - a and IL-10 induce the differentiation of human type 1 T regulatory cells. J Immunol 166:5530. 391. Zheng, S. G . , J. H . Wang, J. D . Gray, H . Soucier, and D . A . Horwitz. 2004. Natural and Induced C D 4 + C D 2 5 + Cells Educate C D 4 + C D 2 5 " Cells to Develop Suppressive Activity: The Role of IL-2, T G F - p , and IL-10. J Immunol 172:5213. 392. de Waal Malefyt, R., J. Abrams, B . Bennett, C . G . Figdor, and J. E . de Vries. 1991. Interleukin-10 (IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exp Med 174:1209. 393. de Waal Malefyt, R., J. Haanen, H . Spits, M . Roncarolo, A . te Velde, C. Figdor, K . Johnson, R. Kastelein, H . Yssel , and J. de Vries. 1991. Interleukin-10 (IL-10) and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class II major histocompatibility complex expression. J. Exp. Med. 174:915. 394. Willems, F. , A . Marchant, J. P. Delvil le, C . Gerard, A . Delvaux, T. Velu , M . de Boer, and M . Goldman. 1994. Interleukin-10 inhibits B7 and intercellular adhesion molecule-1 expression on human monocytes. Eur J Immunol 24:1007. 395. de Vries, J. E . 1995. Immunosuppressive and anti-inflammatory properties of interleukin 10. Ann Med 27:537. 396. Steinbrink, K . , H . Jonuleit, G . Muller, G . Schuler, J. Knop, and A . H . Enk. 1999. Interleukin-10-treated human dendritic cells induce a melanoma-antigen-specific anergy in CD8(+) T cells resulting in a failure to lyse tumor cells. Blood 93:1634. 225 Appendices Appendix 1: Contributions of Others Scientific research often requires teamwork and collaborations to be successful. In this appendix, these contributions are outlined. In all of the colloborations detailed below, I played a significant role in some or all of the following: experimental design, data collection, data analysis, and data presentation. Furthermore, under the supervision of Dr. Hung-Sia Teh, I was responsible for overseeing and managing the many facets of the project. Overall The following Teh lab technicians provided superb technical assistance throughout the course of these studies: Edward K i m , Becky Dineson, and especially Soo-Jeet Teh. Chapter 3 A l l experiments were done by myself at U B C , with the exception of the following: • The identification of fungal isolates by initial ITS amplification was performed by Dr. Shelley Rankin (Assistant Professor, University of Pennsylvania, U S A ) . • The Vitek Yeast Biochemical card identification and ITS sequence analysis were performed by Dr. Koich i Makimura (Associate Professor, Teikyo University Institute of Medical Mycology, Japan). • A n attempt at ITS sequencing of D N A extracted from paraffin-embedded tissue was performed by Dr. Jacques Guillot (Professor, Ecole Nationale Veterinaire d'Alfort, France). 226 Chapter 4 A U B C project student, Mindy Hsieh, assisted with the fractionated C D 4 + T cell transfer experiments as well as the dexamethasone treatment studies. A U B C undergraduate project student, Lina Tang, played a major role in the acquisition and analysis of T C R V p repertoire studies as well as lg E L I S A experiments. A volunteer, Elisabeth Collett, assisted with many of the experiments and had an integral role in genotyping mice and the analysis of FACS® data. Chapter 5 A volunteer, Elisabeth Collett, played a major role in genotyping and assaying both the D B A / 2 Rag-17" and D 2 C Rag-17" mice. Chapter 6 U B C undergraduate project students, Malene Ambjorn and Jenny Law, assisted with the cutaneous IEL analysis, D E T C density experiments, and bone marrow chimeric studies. 227 Appendix 2: List of Publications Journal Articles - Published Oble D A and Teh H-S. 2001. Tight skin mouse subcutaneous hypertrophy can occur in the absence of aP T C R Bearing Lymphocytes. J Rheumatol. 28(8): 1852-5. Dhanji S, Teh SJ, Oble D , Priatel JJ, and Teh H-S. 2004. Self-reactive memory-phenotype CD8 T cells exhibit both MHC-restricted and non-MHC restricted cytotoxicity: A Role for the T Cel l Receptor and Natural Ki l l e r Cel l Receptors. Blood. 104(7):2116-23. Oble D A . Burton L , Maxwel l K , Hassard T, and Nathaniel E J . 2004. A comparison of thyroxine-and polyamine-mediated enhancement of rat facial nerve regeneration. Exp Neurol. 189(1):105-11. Oble D A . Collett E , Hsieh M , Ambjorn M , Law J, Dutz JP, and Teh H-S. 2005. A novel T cell receptor transgenic animal model of seborrheic dermatitis-like skin disease. J Invest Dermatol. 124(l):151-9. Abstracts Does the immune system have a role in the development of the T S K phenotype? 2000. American Association of Immunologists & the Clinical Immunology Society Joint Annual Meeting (Seattle, U S A ) . Poster Presentation. F A S E B abstract number 150.35. Infection induced by-stander stimulation as a mechanism of organ specific autoimmunity. 2002. 3 r d International Congress on Autoimmunity (Geneva, Switzerland). 10 minute oral presentation. Autoimmune Skin Disease Is Downregulated by C D 4 + C D 2 5 + Regulatory T Cells. 2005. Scientific Advisory Committee Symposium (Boston, U S A ) . Poster Presentation. A T C R Transgenic Model of Autoimmune Psoriasiform Skin Disease. 2005. Canadian Society for Immunology 18 t h Annual Spring Meeting (Whistler, Canada). Poster Presentation. A Transgenic Model of Autoimmune Psoriasiform Skin Disease. 2005. Massachusetts General Hospital Clinical Research Day (Boston, U S A ) . Poster presentation. A n t i - C T L A - 4 Induced Pathological Changes of the Gastrointestinal Tract. 2006. Annual Meeting of the American Association of Immunologists (Boston, U S A ) . Poster Presentation. 228 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100527/manifest

Comment

Related Items