Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Ex vivo expansion of hematopoietic stem cells for use in nonmyeloablative transplantation Bakovic, Silvia 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-317310.pdf [ 17.01MB ]
Metadata
JSON: 831-1.0100525.json
JSON-LD: 831-1.0100525-ld.json
RDF/XML (Pretty): 831-1.0100525-rdf.xml
RDF/JSON: 831-1.0100525-rdf.json
Turtle: 831-1.0100525-turtle.txt
N-Triples: 831-1.0100525-rdf-ntriples.txt
Original Record: 831-1.0100525-source.json
Full Text
831-1.0100525-fulltext.txt
Citation
831-1.0100525.ris

Full Text

EX VIVO E X P A N S I O N O F HEMATOPOIETIC S T E M C E L L S F O R U S E IN NONMYELOABLATIVE TRANSPLANTATION  by  SILVIA BAKOVIC  B . S c , Universita' degli Studi di Torino, 1999  A THESIS SUBMITTED IN PARTIAL FULFILLMENT O F THE REQUIRMENTS FOR THE D E G R E E OF  DOCTOR OF PHILOSOPHY  in  T H E F A C U L T Y O F G R A D U A T E STUDIES (Medical Genetics)  T H E UNIVERSITY O F BRITISH C O L U M B I A  July 2007  © Silvia Bakovic, 2007  ABSTRACT Hematopoietic stem cell transplantation (HSCT) is used to treat a wide range of hematologic and non-hematologic disorders. Recently, interest has grown in the potential of autologous H S C T coupled to gene therapy for the treatment of genetic blood disorders as a way of avoiding the severe immunologic reactions associated with allogeneic H S C T . However, the remaining risks in using myeloablative conditioning regimens to allow relatively small numbers of transplanted H S C s to be transplanted greatly limit the applicability of this approach. Nonmyeloablative regimens would be an appealing alternative but necessitate the generation of large numbers of genetically corrected H S C s to achieve therapeutic levels of chimerism. In this thesis I have explored the potential of forced overexpression of homeobox genes as a strategy to obtain the degree of H S C expansion required. In a first series of experiments, I found that HOXB4 and NUPHOX  transduced and expanded H S C s maintain the ability of  fresh H S C s to produce sustained, high level, polyclonal, lympho-myeloid chimerism when transplanted into mice given 2-2.5 Gy. I then tested the therapeutic efficacy of ex vivo expanded H S C s in nonmyeloablated mice with severe R-thalassemia caused by the homozygous deletion of the fj-major globin gene (P-MDD). The results of these experiments showed that this approach could produce a dramatic improvement in the hematocrit,  hemoglobin and R B C morphology  and ultimately  the  cure of  the  thalassemic phenotype that was not achievable in recipients of equivalent numbers of unmanipulated B M cells or of cells transplanted immediately after transduction. Again, the cured mice displayed a sustained, high level of polyclonal chimerism. Together these data provide "proof of principle" of the curative potential of ex vivo expanded  ii  HSCs  in  a  conditioning.  preclinical  model  of  ^-thalassemia treated with  nonmyeloablative  TABLE OF CONTENTS T I T L E ABSTRACT T A B L E O F C O N T E N T S L I S T O F T A B L E S LIST OF FIGURES ABBREVIATIONS ACKNOWLEDGMENTS  i ii i v v i i viii x xii  CHAPTER 1 INTRODUCTION 1 1.1 Thesis overview 1 1.2 Hematopoiesis and the importance of HSCs 2 1.2.1 Developmental organization of hematopoiesis 2 1.2.2 Proof of the existence of HSCs 5 1.2.3 Phenotypic and functional characterization of HSCs 7 1 . 2 . 4 D i f f e r e n ts o u r c e s o f H S C 11 1 . 3 H S C T 1 2 1 . 3 . 1H S C T a n d G e n e t h e r a p y 1 3 1.3.2 Movement towards nonmyeloablative conditioning 14 1.3.3 Nonmyeloablative BMT: lessons from studies of mice 16 1.3.4 p-thalassemia and Sickle celldisease in humans 20 1.3.5 p-thalassemia 21 1.3.6 Sickle celldisease 22 1 . 3 . 7 C o n v e n t i o n a l m a n a g e m e n t o f p - t h a l a s s e m i aa n d S C D 22 1.3.8 Genetic treatment of p-thalassemia 23 1.3.9 A murine model of P-thalassemia major 25 1.4 Approaches to achievingHSC selectionand expansion 26 1 . 4 . 1 H S C s i n vivo s e l e c t i o n s t r a t e g i e s 1.4.2 Extrinsicregulatorsof HSC self-renewal 29 1.4.3 Intrinsicregulators of HSC self-renewal 31 1 . 4 . 4 H S C i n vitro e x p a n s i o n s t r a t e g i e s 1 . 5 p - t h a l a s s e m i a a n d S C D a s a m o d e l t o t e s t t h e p o t e n t i a lo f H S C e x p a n s i o n a n d nonmyeloablative conditioning 42 1.6 Thesis objectives 43 C H A P T E R 2 M A T E R I A L A N D M E T H O D S 2.1 Retroviralvectors 2.2 Generation of retrovirus 2.3 Mice 2.4 Transduction of primary murine bone marrow cells,in vitroculture of hematopoietic cellsand transplantation 2.5 In vivo repopulation 2 . 5 C F C a s s a y , i n v i t r oe x p a n s i o n o f m y e l o i d c o l o n i e s a n d c l o n a l i t ya n a l y s i s 2 . 6 C R U a s s a y 2.7 Hematologic parameters 2 . 8 I d e n t i f i c a t i o no f r e t r o v i r a li n t e g r a t i o n s i t e s  4 5 45 45 46 46 47 48 4 8 49 49 iv  2.9 Western blot analysis  51  CHAPTER 3 E N H A N C E D R E P O P U L A T I O N O F S U B L E T H A L L Y CONDITIONED MICE USING EX VIVO E X P A N D E D H O X B 4 - T R A N S D U C E D H E M A T O P O I E T I C STEM CELLS .52 3.1 Introduction 53 3.2 Results 55 3.2.1 Donor chimerism and transplant cell dose in recipients given nonmyeloablative conditioning and unmanipulated B M cells ...55 3.2.2 Transplantation of in vitro expanded /-/OXB4-transduced H S C s following nonmeyloabative conditioning yields sustained, high level donor chimerism ...56 3.2.3 Highly polyclonal donor chimerism in mice transplanted with expanded HOXB4-transduced H S C s following nonmeyloabative conditioning 62 3.2.4 Expanded H S C s contribute to high level chimerism in the B M in addition to the P B 66 3.3 Discussion 67 CHAPTER 4 E N H A N C E D EX VIVO E X P A N S O N O F H S C s A N D I M P R O V E D C H I M E R I S M IN N O N M Y E L O A B L A T E D MICE USING NUP98-HOX F U S I O N GENES 72 4.1 Introduction 72 4.2 Results ...73 4.2.1 Ex vivo expansion of H S C s using NUP98-HOXB4 or NUP98-HOXA10 for transplantation in nonmyeloablated recipients 73 4.2.2 Assessment of the H S C expanding potential of a fusion of NUP98 and only the homeodomain of HOXA10 77 4.2.3 The progeny of limiting numbers of NUP98-HOXA10hd-trar\sduced HSCs subjected to ex vivo expansion can reconstitute a nonmyeloablated mouse 82 4.3 Discussion 88 CHAPTER 5 E X VIVO E X P A N D E D H S C s IN T H E T R E A T M E N T O F B E T A T H A L A S S E M I A IN N O N M Y E L O A B L A T I V E CONDITIONS 91 5.1 Introduction 91 5.2 Results 94 5.2.1 H O X B 4 expanded H S C s contribute to high level chimerism and improvement of hematological parameters in the P B of nonmyeloablated B-MDD mice 94 5.2.2 P B chimerism in B-MDD mice is contributed by a polyclonal population of HSCs : 98 5.2.3 Retroviral integration site analysis confirm the uniqueness of H S C s clones 100 5.2.4 N U P 9 8 - H O X expanded H S C s contribute to high level chimerism and cure of nonmyeloablated MDD mice 102 5.3 Discussion 103 CHAPTER 6 DISCUSSION 6.1 H O X B 4 H S C s induced in vitro expansion for nonmyeloablative H S C T 6.2 Expanded H S C s for the treatment of p-Thalassemia in nonmyeloablative conditions 6.3 N U P - H O X fusion genes to achieve higher levels of H S C expansion in vitro  106 107 110 112 v  6.4 Unanswered questions and future directions CHAPTER 7  REFERENCES  LIST OF TABLES Table 3.1 Table 4.1  62 74  vii  LIST O F F I G U R E S Figure 1.1 Schematic representation of hematopoietic cell development Figure 1.2 Schematic of gene-therapy protocols in humans Figure 1.3 Cell dose and engraftment in minimally irradiated recipients Figure 1.4 Schematic representations of human H O X g e n e clusters and the factors that regulate their expression or interact with their protein products Figure 1.5 Schematic representations of H O X and NUP98-HOX fusion proteins  4 14 18 33 40  Figure 3.1 Cell dose response of average B M engraftment in minimally ablated hosts 56 Figure 3.2 (A) Experimental design and comparison of chimerism for transduced cells transplanted before or after extended ex vivo culture 59 (B) Kinetics of engraftment in mice transplanted with transduced cells after extended culture 59 (C) Lineage distribution in the W B C compartment of a mouse transplanted with cells transduced with HOXB4 and cultured for an additional 7 days 59 Figure 3.3 Significant chimerism achieved with HOXB4 expanded H S C 61 Figure 3.4 Assessment of the degree of polyclonal chimerism from ex vivo expanded HSC 65 Figure 3.5 H S C contribution to chimerism in the bone marrow 67  Figure 4.1 Enhanced P B chimerism achieved using different fusion genes 75 Figure 4.2 Comparison between the chimerism achieved with grafts containing H S C s expanded by fusion genes and unmanipulated cells 77 Figure 4.3 (A) P B chimerism of mice transplanted with NUP98-HOXA10- or NUP98-HOXA10hdtransduced cells after ex vivo expansion 79 (B) Lineage distribution in the W B C compartment 79 Figure 4.4 Comparison of P B chimerism of mice transplanted with GFP-, HOXB4-or NUPA10hd-\ransduced cells 80 Figure 4.5 H O X B 4 expression by B M cells of nonmyeloablated chimeric mice 81 Figure 4.6 Comparison of engraftment achieved with non expanded and expanded cells 82 Figure 4.7 Experimental strategy used to achieve the transduction of one or two H S C s in wells containing limited numbers of 5-FU treated cells 83 Figure 4.8 P B chimerism of mice transplanted with the progeny of one or two A/l/P/WOM-transduced cell 84 Figure 4.9 Lineage distribution in the P B of mice transplanted with the progeny of few H S C s transduced with NUPAWhd 85 Figure 4.10 Composition of the H S C pool of a mouse transplanted with the progeny of few starting H S C s 86 Figure 4.11 NUPAIOhd fusion protein expressed by the progeny of transduced cells. 87 viii  Figure 4.12 Analysis of the composition of the H S C pool in the B M of lethally conditioned mice  88  Figure 5.1 Experimental strategy used to transplant B-MDD mice with H O X B 4 expanded H S C 95 Figure 5.2 R B C G F P chimerism in B-MDD mice receiving HOXB4-transduced and expanded H S C s 96 Figure 5.3 B-MDDs P B chimerism, phenotype and hematological parameters contributed by HOXB4-transduced and expanded H S C s 97 Figure 5.4 Experimental strategy used to assess proviral integrations in C F C colonies 98 Figure 5.5 Chimerism in B-MDD mice receiving /-/OXB4-transduced and expanded cells is contributed by a polyclonal population of H S C s 99 Figure 5.6 Identity of the sites of integration of the M S C V H O X B 4 IRES G F P vector 101 Figure 5.7 B-MDDs P B chimerism, phenotype and hematological parameters contributed by /Vl/PA70fra -transduced and expanded H S C s 103 ,  ix  ABBREVIATIONS 5-FU  5-fluorouracil  BG  benzylguanine  BM  bone marrow  B-MDD BMT  P-major double deletion bone marrow transplantation  CB  cord blood  CFC  colony-forming cell  CLP  common lymphoid progenitor  CMP  common myeloid progenitor  CRU  competitive repopulating unit  DLA  dog leukocyte antigens  DHFR  dihydrofolate reductase  DMEM  Dulbecco's modified Eagles medium  Epo  erythropoietin  FACS  fluorescence-activated cell sorting  FL  flt3-ligand  G-CSF  granulocyte colony-stimulating factor  GFP  green fluorescent protein  GM-CSF  granulocyte/macrophage colony-stimulating factor  GVH  graft-versus-host  GVHD  G V H disease  GVT  graft-versus-tumor  Hb  Hemoglobin  hd  homeodomain  Hox  clustered homeobox gene  HSCs  hematopoietic stem cells  HSCT  hematopoietic stem cell transplantation  HVG  host-versus-graft  ig  immunoglobulin  IGF-2  insulin-like growth factor-2  IL  interleukin  IRES  internal ribosomal entry site  MDR1  multi-drug resistance 1  MGMT  methylguanine methyltransferase  mHA  minior histocompatibility antigens  MHC  major histocompatibility complex  MSCV  murine stem cell virus  MTX  methotrexate  MUD  matched unrelated donor  NUP98  nucleoporin-98  PB  peripheral blood  PBSC  peripheral blood stem cells  PE  phycoerythrin  Pep3B  C57BI6/Ly-Pep3b  PGP  p-glycoprotein  PI  propidium iodide  PT  post transplantation  RBC  red blood cell  Rh-123  rhodamine-123  SCD  sickle cell disease  SCF  stem cell factor (also called Steel Factor)  SCID  severe combined immunodeficiency  SD  standard deviation  TBI  total body irradiation  TFs  transcription factors  TPO  thrombopoietin  UCB  umbilical cord blood  WBC  white blood cells  WT  wild type  ACKNOWLEDGMENTS I would like to thank Keith and Connie for allowing me to carry out my graduate studies under their supervision and for their patient guidance throughout these years. In the many darkest times of my PhD, I always felt their presence and support. In particular, I would like to thank Connie for her maternal support especially when I first came to Vancouver and didn't have any family or friends and I would also like to thank Keith for never giving up on me even when the impulsive side of my Italian personality wasn't easy to deal with. I would like to thank the other members of my advisory committee, Dr Dixie Mager and Dr Aly Karsan for their helpful discussions and advice and the University of British Columbia for funding part of my studies and work presented in this thesis through the University Graduate Fellowship (UGF) and the U G F affiliated fellowship kindly sponsored by Cordula and Gunter Paetzold. The work presented in this thesis was also supported by grants from the National Cancer Institute of Canada with funds from the Terry Fox Foundation; the Canadian N C E Stem Cell Network and the National Institute of Health (USA). I would like to thank all the members of the lab that I have met through the years, Suzan, Christian, Andrew, Carolina, Patty, Jennifer, Nick, Sharlene, Caroline, Cynthia, Rhonna, Ben, Jack, Hide, Koichi, Lars, Sanja, Christy, Adrian, Bob, Florian, Eric, Micheal, Shinichiro, Michelle, Carola for helping me settling down smoothly in the lab, for helpful advice and discussions, for the inspiration they have provided me in many ways and for making the lab a friendly and fun place in which to work.  xii  I would like to thank all the graduate students, postdoctoral fellows and the secretarial staff of the Terry Fox Laboratory that I have met through the years for their friendship and help. Many thanks to Dubravko Pajalic, Nospoom Somnukoonchai, Jay Fei, Ken Ho for their precious computer technical support and in particular for retrieving my thesis files during the preparation of the manuscript. I would like to thank all the friends I have made in Vancouver through the Youth Hostel Club, Jericho Sailing Club, B C Mountaineering Club and V A M L , for helping me going through my PhD and for always cheering for me. I would like to thank the beautiful mountains of B C who taught me the lesson of patience and perseverance. They showed me in many ways that no matter how hard and tiring the ascent can be, you should always be strong and take heart. Eventually you will reach the summit. Lastly, I would like to thank my family for always being there for me and for their endless support, encouragement and love. I especially would like to thank my mum, always a source of inspiration and wisdom to me.  xiii  To my parents  xiv  CHAPTER 1  INTRODUCTION  1.1 T h e s i s overview  The work presented in this thesis is directed at the goal of improving the safety and efficacy of hematopoietic stem cell transplantation for treating malignant and nonmalignant blood disorders. Currently, the transplantation of bone marrow (BM) or other sources of normal hematopoietic stem cells (HSCs) is the only therapeutic option for achieving cures for many disorders affecting the hematopoietic system. These include both hematopoietic malignancies and inherited genetic blood disorders. The curative potential of hematopoietic stem cell transplants relies on their ability to reestablish a normal functioning hematopoietic system in affected patients. This is accomplished by the proliferation of a very primitive population of multipotent hematopoietic cells present within the B M , the H S C s , which are capable to reconstitute a new H S C population as well as the other derivative components of the hematopoietic system as a whole. Despite the curative potential of HSCT, this modality is associated with significant morbidity and mortality due to the intense patient conditioning regimens used, as well as poorly understood problems of delayed myeloid recovery or immune reactions caused by disparities between the host and the graft. Moreover, in many instances, a source of donor cells with an adequate number of H S C s or appropriately matched to the recipient may not be available. One promising strategy to overcome many of these problems is to develop methods for significant expansion of the number of H S C s prior to transplantation. This would, in principle, enable the use of H S C sources that may be limiting in the number of H S C s they can provide, as for example, might be the case after a specific clinical genetic manipulation strategy or if the use of cord blood H S C s  1  for treating adult patients were planned. The availability of increased numbers of H S C s for transplant  could also make it feasible to use less toxic,  nonmyeloablative  conditioning regimens if sufficiently large numbers of donor H S C s could be generated to "out-compete" the residual host H S C s , still present in the host. This latter possibility is particularly attractive in the context of transplant based treatments for genetic blood disorders where nonmyeloablative conditioning and transplantation of normal matched donor H S C s or genetically modified patient H S C s (autologous transplantation) could be very effective. The work described in this thesis was aimed at addressing these challenges in a mouse model. The major goal was to develop and test strategies to expand H S C s in vitro for clinical applications that could lead to a safe and useful extension of H S C based therapies, such as H S C T and gene therapy of genetic blood disorders. The following sections provide a background on key aspects of the biology and regulation of H S C s with particular emphasis on possible approaches to enhance their self-renewal as well as a survey of evolving approaches to improve the safety and broaden the clinical applications of H S C therapies.  1.2 Hematopoiesis and the importance of H S C s  1.2.1  Developmental organization of hematopoiesis  Hematopoiesis is the process by which mature blood cells are produced from immature multipotent stem cells. This developmental process is called monophyletic, which means that a single stem cell, the H S C , can give rise to all the mature blood cell types in the body. The monophyletic theory of hematopoiesis states that multipotent  2  H S C s multiply to produce more multipotent H S C s , thus ensuring that their numbers are maintained at steady and adequate numbers throughout life. Upon cell division, H S C s can self-renew and maintain their multipotency by symmetric cell division or undergo asymmetric cell division. In the first case, both daughter cells are essentially functionally equivalent to the cell that generated them. In the latter case, one cell, remains multipotent and the other one is fated to terminally differentiate. Alternatively, both daughter cells lose multipotency and begin to differentiate. The generation of multiple hematopoietic precursors and lineages occurs through a series of steps that are referred to as intermediate progenitors. Current evidence supports a "roadmap" of hematopoietic lineage development as schematically depicted in Figure 1.1. Major bifurcations include the choice between lymphoid versus myeloid development and subsequent restrictions to major lineages. Example of these early developmental stages are the common lymphoid progenitors (CLPs), which can generate only B, T and NK cells, and common myeloid progenitors (CMPs), which can generate only red cells, platelets, granulocytes and monocytes (Akashi et al., 2000; Kondo et al., 1997). However, recent evidence suggests that the H S C compartment is more heterogeneous than previously thought and may be composed of distinct subsets of cells that are multipotent  but have different  pre-determined  propensities to  differentiate into various types of myeloid versus lymphoid cells (Adolfsson et al., 2005) Dykstra et al. submitted). The production of terminally differentiated cells that cannot proliferate anymore and die after a period of time that ranges from hours (for neutrophils) to decades (for some lymphocytes) (Smith, 2003) marks the end of this developmental process. The proliferative capacity of H S C s is such that a relatively small number of these cells can produce billions of new cells daily to replace hematopoietic cells lost to normal 3  cell turnover processes as well as to illness or trauma. HSCs can be transplantable, proliferate to regenerate multilineage hematopoiesis, and can robustly sustain the hematopoietic system (Smith and Storms, 2000). In the mouse, a single HSC can reconstitute the entire hematopoietic system for the natural lifespan of the animal (Osawa etal., 1996)  Multipotent progenitor cell ^  ) Self-renewal  I^PrimitiveN^ ^sFrogenitor/^z (an  \(CLP))  c e , f e  Committed pr ecu is or ffjNK cells Lineage committed cells  1 . M o n o c y t e s Platelets and Erythrocytes Figure  1.1  N  e  u  t  f  0  p  h  i  b  T-cells  NK-celb  B-celb  Ewlnophlls Basophils  Schematic representation of hematopoietic cell development.  Adapted  f r o m ( K a u s h a n s k y , 2 0 0 6 ) . C L P , c o m m o n l y m p h o i d progenitor; C M P c o m m o n m y e l o i d p r o g e n i t o r ; M E P , megakaryocyte/erythrocyte precursor; G M , granulocyte/macrophage precursor; T N K , T cells a n d natural killer c e l l s p r e c u r s o r ; B C P , B-cell p r e c u r s o r ; M k , m e g a k a r y o c y t e s .  Growth and development of HSCs into terminally differentiated cells is governed by a complex interplay between HSCs and progenitors and various environmental 4  factors. These include cytokines, chemokines, extracellular matrix components, other molecules presented on the surface of hematopoietic and non hematopoietic cells.  1.2.2 Proof of the existence of HSCs The drive to understand the foundation of the hematopoietic system came in response to the clinical need for cells capable of rescuing the hematopoietic system of individuals suffering from radiation accidents. These studies began more than 50 years ago with the observation by Jacobson et al. (Jacobson et al., 1949) that mice receiving lethal doses of radiation were able to survive when they had their spleen shielded which was followed by the report by Lorenz et al. (Lorenz et al., 1951) that lethally irradiated mice could also be protected by an infusion of spleen or marrow cells. Subsequently it was shown by Ford er al. (Ford et al., 1956) that lethally irradiated mice protected  by  infused  marrow  had  their  hematopoietic  tissue  colonized  by  cytogenetically distinguishable cells derived from the donor. In 1961, Till and McCulloch described the formation of colonies in the spleen of lethally irradiated animals 10 days after they had been infused with a relatively small number of marrow cells (Till and Mc Culloch, 1961). The cells from which these colonies arose were called colony-forming units spleen (CFU-S). Because these C F U S were shown to possess extensive proliferation  capacity and be capable of  multilineage differentiation and self-renewal, they were thought to be H S C s (Till et al., 1964). To test the long-term performance of these cells, Hodgson et al. tested the regeneration of C F U - S in serial transplants (Hodgson and Bradley, 1979). From these studies, they inferred that C F U - S might only be capable of short-term repopulation and that there existed a more primitive population of cells to account for the long term 5  repopulating function (Ploemacher and Brons, 1989). In addition, although C F U - S colonies often contain multiple cell types, the presence of lymphoid cells could not be reproducibly demonstrated, leading to the hypothesis that they represent a cell with myeloid-resticted differentiation potential (Schofield, 1978). Cell separation techniques were instrumental in leading to the discovery of a fraction of B M cells that was highly depleted of C F U - S but still capable of sustaining long-term hematopoiesis in vivo (Jones et al., 1989; Jones etal., 1990). Further studies using physically separated cell types confirmed that C F U - S have limited short-term repopulating capacity and are distinct from more primitive cells capable of multilineage repopulation for extended (> 2 months) period of times (Morrison and Weissman, 1994; Szilvassy et al., 1989; van der Loo et al., 1994) Definitive evidence of the existence of multipotent H S C s with lifelong lymphomyeloid repopulating activity came from clonal tracking studies. These were initially based on the use of radiation-induced chromosomal markers and later random genomic integration sites of retroviral vectors. This allowed unique marking of individual H S C s with a genetic signature and visualization of the progeny derived from them. Furthermore, it allowed defining the relationship of various cells in the hematopoietic hierarchy (Dick et al., 1985). Proviral marking studies also proved powerful to distinguish cells with different repopulating potential, detecting those capable of completely repopulating all lineages in the hematopoietic system and those capable of repopulating only certain lineages (Lemischka et al., 1986). More recently, the features of H S C s have been provided by tracking the progeny generated in recipients of highly purified single cells. These studies definitely showed that a single cell was capable of substantial reconsitution of all elements of the hematopoietic system of lethally irradiated mice for extensive periods of time (Osawa et al., 1996). 6  1.2.3 Phenotypic and functional characterization of H S C s  HSCs  from  multiple sources  can  be  identifiedand  quantified by  specific  f u n c t i o n a la s s a y st h a td e t e c tt h e i rl o n gt e r m r e p o p u l a t i n g a b i l 2002). They can also be phenotypically distinguished from other celltypes by a unique profile of expression  of specific cell surface molecules  although most of these are not stable with HSC  and dye exclusion  a c t i v a t i o ns t a t u s ( E a v e s , 2 0 0 2 ) .  In mice there are two main assays used to detect and quantifyHSC firstwas  developed  repopulating  by Harrison (Harrison, 1980) and  activity of atest population  by competing  cells from agenetically distinct (but immunologically a large number  of HSCs  properties,  it measures  activity. The  the  itagainst an equal compatible)  competitive number  population  containing  (to minimize the variance). The test population is then  shown  t o b e s i m i l a r ,m o r e c o m p e t i t i v e o r l e s s c o m p e t i t i v e t h a n t h e c o n t r o l p o p u l a t i o n b a s e d the proportionalcontribution to the RBCs  and/or WBCs  several months  values can also be used to derive quantitative differences in HSC  later. These  frequencies  ifit is  that the average  the same  as in the control population (Harrison et al.,1993). This can prove a possible this assumption  can  be  HSC  on  assumed  limitation where  r e p o p u l a t i n g a c t i v i t yo f e a c h  of  in the test population is  called into question  (e.g. when  using  on use  of limit  genetically modified cells). A second  widely used  dilution principles in combination  assay  for quantitating HSCs  is based  with competitive repopulation. The limitdilution  assay  i n i t i a l l y d e s c r i b e d b y S z i l v a s s y et al. ( S z i l v a s s y e t a l . , 1 9 9 t r a n s p l a n t i n g l i m i t i n gn u m b e r s irradiated compromised  syngeneic  female  o f m a l e " t e s t "c e l l s o f u n k n o w n recipients  together  with  HSC  content intolethally  a radioprotective  dose  competitor cells (1-2X10 ). Hematopoietic tissues of recipientmice 5  of were 7  analyzed by Southern blot 5 or more weeks post transplantation and had to contain >5% cells of male origin in order to be considered reconstituted by a primitive cell. The dilution dose of the test cells that was able to give long-term  lymphomyeloid  repopulation in this competitive setting in 63% of the transplanted mice was assumed on the basis of Poisson statistics to contain at least one so called competitive repopulating unit (CRU). In recent years congenic mice that differ at the Ly5 locus have been introduced to distinguish between donor and competitor cells and this has allowed for the more sensitive and ready detection of donor cells in various tissue suspensions (BM, Thymus, spleen and PB) by staining with antibodies conjugated with fluorescent markers and analysis by flow cytometry. With this method of detection, the current criteria for establishing the repopulation from a C R U requires that >1% of donor derived cells are detected in recipients in both myeloid and lymphoid lineages at 16 or more weeks post-transplant. Identical proviral integrations found in lymphoid and myeloid lineages in mice transplanted at limit dilution, confirmed that these cells were derived from the same original H S C . Another version of this assay makes use of sublethally irradiated W AA/ 41  41  congenic recipients. These mice are compromised in their H S C  content due to a mutation in the c-Kit receptor gene. The sublethal radiation spares enough endogenous cells to allow the recipients to survive in case the test sample does not contain any long-term repopulating cells (Antonchuk et al., 2002; Miller and Eaves, 1997). In normal adult mouse B M , murine H S C s are small cells with minimal cytoplasm. They also express high levels of the multidrug resistance proteins ( P G P and B C R P 1 / A B C G 2 ) (Jones et al., 1996; Uchida et al., 2004). These cells tend not to express surface markers seen on mature hematopoietic cells (lineage markers) but can  8  express low levels of the Thy-1 surface protein and relatively high levels of the Sca-1 surface marker (Spangrude et al., 1995; Weissman, 2000). When single cells from the Thy1  low  S c a 1 Lin- population were injected intravenously, 1 out of 20 engrafted but the +  majority of clones gave rise to transient reconstitution and only a quarter gave rise to long-term repopulation (Morrison et al., 1995b). Furthermore, the T h y 1  low  S c a 1 Lin+  population was divided according to the retention of the fluorescent dye Rhodamine 123 (Rh-123) and it was shown that only the R h - 1 2 3  low  subset of the T h y 1  low  S c a 1 Lin+  population was multipotential (Spangrude and Johnson, 1990), with a minimum of 1 in 40 S c a 1  +  Lin- R h - 1 2 3  low  cells or 5 T h y 1  low  Sca1  +  Lin- R h - 1 2 3  low  capable to engraft  lethally irradiated recipients for up to 19 weeks and 24 weeks, respectively (Li and Johnson, 1992; Spangrude et al., 1995). More recently Hoechst 33342 dye was used to purify H S C s and stem cell activity was demonstrated in the population of cells that has the highest efflux capacity of this dye (Goodell et al., 1996). This subset of cells in conjunction with R h - 1 2 3  low  Lin- cells was determined to be highly enriched for H S C s ,  with a H S C frequency of 1 in 2.5-3 cells (Uchida et al., 2003). The two most recent strategies make use of S L A M (Signaling Lymphocyte Activation Molecule) (Kiel et al., 2005) and of E P C R (Endothelial Protein C Receptor) (Balazs et al., 2006) expression to purify H S C s . S L A M proteins such as CD150, CD48 and CD244 are adhesion and signaling receptors that are not essential for H S C function but are now proving to be very powerful for distinquishing a diversity of primitive hematopoietic cells (Wagers, 2005). Almost half of the cells (45%) that express CD150 but do not express CD48 and the megakaryocytic marker CD41 are capable of long-term multilineage reconstitution of lethally irradiated recipients (Kiel et al., 2005). While a number of purificiation strategies have been effective for identifying adult H S C s , unfortunately many of the markers have proven not to be stable in actively 9  cycling (Zhang and Lodish, 2005) and/or in H S C s at other stages of ontogeny (fetal H S C s ) (Morrison et al., 1995a; Rebel et al., 1996) Interestingly, S L A M markers have been recently demonstrated to be stable and the S L A M purification strategy is therefore the only strategy that is so far consistent in the identification of H S C s and progenitors in adult B M and fetal liver (Kim et al., 2006). There have also been major advances in enrichment and phenotyping of human H S C s with the development of powerful transplantation methods based on use of immune compromised mice and fetal sheep (McCune, 1996; Zanjani et al., 1994). Some understanding of human H S C s have also come from the transplantation of purified populations of autologous cells back into large animals, such as non-human primates (Berenson et al., 1988). Phenotypically human H S C s and progenitors have been reported to be small quiescent cells that express high levels of the surface glycoprotein CD34 and do not express the differentiation marker CD38 (Bhatia et al., 1997b). In addition, they do not express lineage commitment markers and express low levels of Thy-1 (Smith, 2003) and can be purified in fetal human B M (Baum et al., 1992), adult B M (Murray et al., 1994) and mobilized peripheral blood (Murray et al., 1995) as CD34+ Thy-1 + Lin- population. Recent studies indicate that some H S C s  and  progenitors do not express CD34 (Bhatia et al., 1998). A s found for murine H S C s , human H S C s are enriched in a population of cells that have low retention of the dye Rh-123 (McKenzie et al., 2007). A s for murine H S C s , these phenotypic properties of human H S C s are not stable and can be modified by cell cycle progression (Dorrell et al., 2000), ex vivo culture (Danet et al., 2001) and transplantation (Dao et al., 2003). Human H S C s are also known to differ from more mature types of hematopoietic cells in their high expression of aldehyde dehydrogenase (ALDH) which allows their selective  10  isolation  by treatment with cyclophosphamide derivatives  Udomsakdi etal., 1992).  (Hess et  al., 2004;  -  1.2.4 Different sources of H S C  H S C s are found during embryogenesis in different anatomical sites such as the yolk sac, the aorta-gonad mesonephros, the placenta and the fetal liver. After birth H S C s colonize the B M (Mikkola and Orkin, 2006) and throughout adulthood they are primarily found in the B M but can also be located in extramedullary sites such as the liver and the spleen (Taniguchi et al., 1996). H S C s are also present in other tissues including P B (Wright et al., 2001), umbilical cord blood (UCB) (Holyoake et al., 1999) and placenta. In clinical practice today, three sources of cells are used for clinical H S C T s : B M harvests/growth factor-mobilized P B collections and U C B cells. B M for transplantation is usually obtained from the donor's anterior and posterior iliac crests with the donor under spinal or general anesthesia. Over the past decade, primitive H S C mobilized into the peripheral blood have gradually replaced B M harvesting from the iliac crest as the preferred H S C source for autologous and allogeneic transplantation. Obtaining large numbers of primitive cells from mobilized P B is easier, less invasive and it allows more rapid neutrophil, platelet recovery and faster immune reconstitution (Appelbaum, 2003; Arai and Klingemann, 2003). Cord blood, which is the blood that remains in the umbilical cord and placenta following birth, offers substantial logistic and clinical advantages, such as the relative ease of procurement and availability, the absence of risk for mothers and donors, the reduced likelihood of transmitting infections, potential reduced risk of graft versus host disease (GVHD) and less stringent criteria for donor-recipient matching and selection 11  (with the potential of finding donors for minority populations) (Rocha and Gluckman, 2006). Due to the limited number of H S C s that can be collected, U C B transplantation is difficult to use for treating adult patients and it has generally been limited to pediatric patients. It is likely that expanding U C B H S C s will lead to more rapid engraftment and less transplant-related complications even with highly mismatched donors. Indeed the promise of U C B but limitations in their number is a major impetus for the development of H S C expansion strategies such as described in subsequent sections.  1.3 HSCT H S C s play a critical role in the outcome of H S C T , now increasingly used as a powerful treatment option in a range of life-threatening blood, immune system or genetic disorders. Transplantation of B M cells in humans was pioneered in the 1960's by E. Donnall Thomas whose work showed that B M cells infused intravenously could repopulate the B M of irradiated patients affected by malignant blood disorders and rescue the hematopoietic system (Thomas, 1999a; Thomas, 1999b; Thomas et al., 1959; Thomas et al., 1957). This was later explained by the presence in the infused B M of a population of human H S C s , capable of giving rise to all the differentiated cells of the hematopoietic system. Currently, around 45,000 patients each year are treated by H S C T , a number that has been increasing in the past decade. Although most of these cases have involved patients with hematological malignancies - such as lymphoma, myeloma and leukemia - there is growing interest in using H S C T to treat solid tumours and non-malignant diseases such as B-thalassemia and Sickle Cell anemia (Sorrentino, 2004).  12  1.3.1 HSCT and Gene therapy There are three types of HSCT: In autologous transplants, the infused cells are taken from the patient. In syngeneic transplants, patients receive cells from an identical twin. In allogeneic transplants, the cells are from a different individual, usually an HLAmatched  brother  or sister, or haploidentical  parent  (related  donors).  However,  increasingly, cells from matched but unrelated donors (MUDs) are being used. When allogeneic transplants  are performed, the recipient  requires  immunosuppressive  medications to minimize severe immunologic reactions between the donor and the recipient. Allogeneic BMT is often the only option for patients affected by inherited blood disorders but because of the associated morbidity, it is only performed in extreme cases. To overcome this problem, gene therapy strategies to treat and cure these disorders by correcting the patients' own cells are a very attractive option and have been intensively pursued for the last 15 years (Anderson, 1992; Mulligan, 1993). Since many of these disorders are monogenic and the mutation in the gene has been characterized, the approach is to remove H S C s from the affected individual, transfer the wild type functional gene in to the H S C s ex vivo with a vector and subsequently reintroduce the modified cells back into the patient (Figure 1.2).  13  Transduction of HSC with viral vectors containing a therapeutic gene Figure 1.2 Schematic of gene-therapy protocols in humans. Harvested HSCs are cultured with fibronectin, cytokines and retroviral supernatant for one to four days. Autologously transplanted cells migrate to the marrow and initiate hematopoiesis with corrected HSCs.  Conventional allogeneic and autologous H S C T are associated with serious morbidity and even mortality due to the toxic conditioning regimens; in the case of allogeneic transplants there is also a risk of G V H D ; and with autologous H S C T coupled to gene therapy there are significant problems associated with very poor recovery of corrected H S C s . Two related approaches to address and solve these issues are the use of sublethal conditioning and strategies to achieve H S C expansion. 1.3.2 Movement towards nonmyeloablative conditioning  In conventional H S C T , the hematopoietic system of the host is totally eliminated by intensive cytotoxic therapy and subsequently replaced by the infusion of donor hematopoietic cells that lead to the reconstitution of the whole hematopoietic system. The pre-transplantation conditioning is aimed at eliminating malignant cells and, in the  14  case of allograft, host immune cells that mediate rejection. However, in congenital blood disorders there is no need to eradicate a malignant population of cells from the B M and a minimal P B chimerism would be sufficient to ameliorate the disease phenotype. Conventional myeloablative allogeneic BMT has relied upon administration of supralethal doses of total body irradiation (TBI) and/or cytotoxic chemotherapeutic agents.  Given their  intensity,  myeloablative  conditioning  regimens  have  been  associated with significant toxicity, which has limited their use to otherwise healthy, relatively young patients. To extend the use of allogeneic H S C T to include older patients  and  those  with  comorbid  conditions,  reduced  intensity  or  truly  nonmyeloablative conditioning regimens have been introduced. Nonmyeloablative regimens have been based on minimal TBI alone (2 Gy) or minimal TBI combined with different doses of Fludarabine and Busulfan. Oral administration of Busulfan has been associated with unpredictable absorption and relatively large inter- and intrapatient variability. Recently an intravenous formulation of busulfan has become available and has been shown to provide greater predictability in blood levels. However, this approach requires further dose escalation studies to determine the acceptable level of toxicity and allow sufficient engraftment of genetically modified cells (Kahl et al., 2006; Kang et al., 2006). In general, nonmyeloablative regimens have had few toxicities, have produced only mild myelosuppression, and have been associated with a low incidence of mortality, even in elderly patients and those with comorbid conditions (Baron and Storb, 2006). These reduced intensity regimens minimize morbidity and mortality associated with HSCT-based therapies. From the outcome of growing clinical trials for hematologic malignancies treated with reduced conditioning regimens, it has emerged that they can  15  produce mixed to full donor chimerism. Mixed chimerism would be highly suitable for the treatment of genetic blood disorders where a minimal P B chimerism would ameliorate  the  disease  phenotype.  However,  it  also  emerged  that  when  nonmyeloablative conditioning regimens are used, significant chimerism and hence better outcome is achieved only when large transplant doses are used. For this reason, strategies to enrich for H S C s would have a major impact on the success of nonmyeloablative H S C T .  1.3.3 Nonmyeloablative BMT: lessons from studies of mice  Initially it was thought that intravenously injected H S C s could reconstitute the hematopoietic, system only if a suitable "niche" was made available in the B M cavity (Schofield, 1978) through myeloablative treatments such as TBI. Once the space was created, donor cells could home there, start proliferating  and reconstitute  the  hematopoietic system of the host. This concept, however, was challenged by reports of the  successful  transplantation  of  marrow  into  submyeloablated  or  even  nonmyeloablated murine hosts where supposedly part or all of these niches were already occupied by endogenous H S C s . The  first  report which  suggested  that  engraftment  in  the  absence  of  myeloablation was possible came from Micklem in 1968 (Micklem et al., 1968). He showed that reconstitution of up to 8.5% of the hematopoietic system with donor cells could be obtained in normal unconditioned recipients transplanted with 2 X 1 0 cells 7  three months post transplant. A similar phenomenon was reported by Brecher in 1982 when his group showed that 16-25% donor-derived hematopoiesis could be achieved in normal unconditioned recipients of 4 X 1 0 B M cells per day for 5 consecutive days, 7  16  indicating that "niche availability" was not a limitiation to eliciting the  repopulating  activity of injected H S C s . (Brecher et al., 1982). Similar levels of repopulation (between 0 and16%) were also achieved by Saxe who transplanted 10 -10 cells per mouse 6  8  (Saxe et al., 1984). In recent years, Stewart et al. showed persistent donor-derived hematopoiesis in unconditioned recipients for up to 2 years after the transplantation of 4 X 1 0 c e l l s on each of 5 consecutive days (Stewart etal., 1993). 7  The amount of cells transplanted in these studies is massive, reaching the equivalent of almost half of the B M of a mouse. It is important to note that in myeloablated mice the same dose of cells and even a minimal dose of 10 -10 cells 4  5  would produce 60-100% donor P B chimerism. However in nonmyeloablated recipients, transplanted cells have to compete with the endogenous surviving B M cells for appropriate conditions of stimulation (Figure 1.3).  17  • 100 c G y • 300 c G y  AfjcGy • 700 cGy  2  10  20  Cell doseXIO  40 6  HSC content Figure 1.3 Cell dose and engraftment in minimally irradiated recipients. Marrow cells in doses of 2, 2.5, 10, 20 or 40 million cells were infused into recipients treated with 0, 1, 3 and 7 Gy, and the percentage of engraftment was determined 2 months and 6 months post transplantation. T h e results show that donor cell readout in hosts after transplant is related to cell dose and irradiation dose to recipient animals. Modified from (Stewart et al., 1998) and (Goebel et al., 2002).  What  really  determines  the  final  chimerism  in  minimally  ablated  or  nonmyeloablated mice is still a matter of debate. Recently it was shown by using parabiotic mice that H S C s can be found at constant rates in the P B at any given time (Wright et al., 2001), implying that there is a constant exodus of H S C s from the B M or extramedullar sites into the P B circulation (and wee versa). This finding was complemented by the demonstration that in unconditioned recipients 0.1% to 1% of H S C s exit or enter the circulation at any given time point. This finding was interpreted as indicating that this is the number of niches available for engraftment in a normal adult mouse which thus accounted for the ability of a very large number of injected 18  H S C s to eventually compete for blood cell output (Bhattacharya et al., 2006). In support of this hypothesis was the observation that transplanting the cells repetitively over a period of time produced higher levels of contribution than transplanting a single high dose of cells. Moreover, it turns out that in nonmyeloablated recipients the level of chimerism achieved is mathematically predicted by the ratio of the number of cells (and hence H S C s ) in the host relative to the number of cells (and hence H S C s ) transplanted. Thus the transplantation of 4 X 1 0 cells into normal adult mice that have a B M cellularity 7  of roughly 5.3X10 cells lead to donor 7% chimerism (Quesenberry et al., 2005). Based 8  on these studies, it appears that it'is the ratio of host, to donor H S C s rather than availability of niches that is critical (Colvin et al., 2004; Rao et al., 1997; Stewart et al., 1998). If this model is correct, then a treatment of 1 Gy that kills more than 8 5 % of H S C s (Stewart et al., 2001) should increase the donor-to-host H S C ratio of a set graft and thus lead to a dramatic increase in final donor chimerism. In fact, transplantation of 4 X 1 0 cells in mice that received 1 Gy as their conditioning regimen resulted in the 7  predicted 60 to 80% chimerism. Additional issues come to light in considering non-ablative transplants for gene therapy. In gene therapy. protocols cells are usually prestimulated and then kept in cytokine cocktails to enhance viral-mediated gene insertion. This cytokine treatment leads to better rates of genetic transduction but also triggers cell cycle progression. This has been shown to be detrimental to H S C behavior because, after entering the cell cycle, these cells show loss of repopulating potential in both myeloablated and nonmyeloablated mice (Kittler et al., 1997; Peters etal., 1996). This engraftment defect is also reported for cells treated with 5-fluorouracil (5-FU), which is a drug widely used to allow for the transduction of mice, primates and human H S C . H S C s are usually stimulated into cell cycle by the intravenous injection of the drug 5-FU. This treatment 19  results in H S C function impairment and in defective long-term repopulating capability in nonmyeloablated hosts (Ramshaw et al., 1995). Recently Goebel et al. compared the reconstituting capability of fresh B M , 5-FU treated B M and 5-FU treated B M transduced with retroviral vectors in minimally conditioned mice. This study showed that the competitive repopulating activity for marrow treated with a retroviral-mediated gene transfer protocol that included 5-FU treatment was similar to 5-FU-treated B M but subsequent ex vivo culture resulted in decreased overall activity in 1.6 Gy-irradiated hosts as compared to transplants of fresh B M , due to the decreased H S C content found at the end df the in vitro culture (Goebel et al., 2002).  1.3.4  p-thalassemia and Sickle cell disease in humans  Hemoglobins are the major oxygen-carrying molecules of the body. They are packaged into R B C s in quantities sufficient to carry enough oxygen from the lungs to the tissues to meet the needs of cells for oxidative metabolism. These quantities are enormous, nearly two pounds of hemoglobin is present in the body of a reasonably sized man at any given time. Defective synthesis of the p chains of adult hemoglobin A leads to an imbalance in chain production with the accumulation of free a chains in R B C precursors and R B C s . This accumulation causes intramedullary destruction of R B C precursors and markedly ineffective erythropoiesis that results in severe hemolytic anemia.  20  1.3.5 p-thalassemia  The B-thalassemias and Sickle cell disease (SCD) are severe congenital anemias that result from a mutation that causes the deficient or altered synthesis of the P chain of hemoglobin. Both are commonly inherited in an autosomal recessive manner and according to the World Health Organization, approximately 180 million people are heterozygous for one of the several forms of genetic disorders of hemoglobin synthesis (Lucarelli and Clift, 2004) P-thalassemia results from a mutation of the p-globin gene that reduces ( P +  thalassemia) or eliminates (P°-thalassemia) B-globin chain synthesis and hence compromises hemoglobin production. Nearly 200 different mutations  have been  described in patients with P-thalassemia and related disorders. The majority are point mutations in the p-globin gene and occasionally deletions, p-thalassemia is the most common monogenic disorder worldwide, with an estimated 365,000 affected infants born each year. The  clinical  p-thalassemia  phenotypes  are  subdivided  into three  broad  categories. One extreme is P-thalassemia major (also known as Cooley's anemia), where individuals have severe anemia and are dependent on R B C transfusions for survival.  The opposite extreme  is p-thalassemia minor, where  individuals  are  asymptomatic. Any phenotype that falls in between is classified as p-thalassemia intermedia (Urbinati et al., 2006). Infants with thalassemia major who receive no treatment die in early infancy from congestive heart failure or other complications of severe anemia.  21  1.3.6 Sickle cell disease  In S C D , a single nucleotide substitution in the B-globin gene results in the substitution of valine for glutamic acid on the surface of the variant B-globin chain. The resulting hemoglobin polymerizes in the R B C s when deoxygenated and the R B C s assume the shape of a sickle, become dehydrated and rigid, and adhere to the vascular endothelium. This polymerization of S C D R B C s causes accelerated R B C destruction, erythroid hyperplasia and vaso-occlusion. Vaso-occlusion leads to the damage of many organs, eventually causing long-term disabilities (Sadelain, 2006). The carrier states of the thalassemia syndromes and S C D are protective against malarial infections and thus the highest prevalence of these diseases is seen in the r Mediterranean areas, Asia, the Middle East and Africa (Urbinati et al., 2006).  1.3.7 C o n v e n t i o n a l m a n a g e m e n t o f p - t h a l a s s e m i a a n d S C D  For both B-thalassemia and S C D , transfusion therapy is life-saving and aims to correct the anemia, suppress the massive ineffective erythropoiesis, and inhibit increased gastrointestinal absorption of iron. However, transfusion therapy leads to iron overload, which is lethal if untreated. The prevention and treatment of iron overload are the major goals of current patient management. Currently the only available curative treatment for these hemoglobinopathies is allogeneic H S C T . Over 2000 patients have received H S C T for B-thalassemia major worldwide and outcome has proven to be highly dependent on the health status of the recipient at the time of transplantation. In relatively healthy recipients, the probability of cure and survival was 87%, but in patients with more advanced disease, the mortality rate was as high as 47% (Gaziev and Lucarelli, 2005). These figures appeared to be 22  even worse when matched unrelated donor B M was used. Due to the high morbidity and mortality associated with highly toxic myeloablative regimens, H S C T has been so far a suitable option for only a small proportion of affected patients. Fewer patients with S C D (-200) have been treated with H S C T (Gaziev and Lucarelli, 2005). The mortality rate after the procedure has been reported to be 8-10% and the significant toxicity of myeloablative BMT has restricted its application to patients who have already experienced severe and irreversible complications. However, one report of the outcome of H S C T of asymptomatic patients has suggested that better rates of overall cure and survival (93%) may be obtainable (Vermylen et al., 1998). Late complications such as growth disturbances, endocrine complications and infertility are issues  to  ponder  when  considering  conventional  HSCT  for  the  treatment  of  Nonmyeloablative H S C T is a safer option due to the minimal toxicity  of  hemoglobinopathies.  preparative regimens and is being considered for the treatment of a wider variety of patients, although the possibility of inadequate chimerism leading to lack of cures and recurrence of sickle cell crises remains a concern.  1.3.8  Genetic treatment of p-thalassemia  Allogeneic B M T is curative but not devoid of complications. Safe transplantation requires the identification of histocompatible donors to minimize the risks of graft rejection and G V H D . In the absence of a suitable donor, the genetic correction of autologous H S C s represents a highly attractive alternative to achieve a cure. This approach at once resolves the search for a donor and eliminates the risks of G V H D and graft rejection associated with allogeneic H S C T . In order to successfully treat 623  thalassemia using gene therapy, it is necessary to permanently transfer one or more copies of the B-globin gene into H S C s , with appropriate timing and levels of expression of the transduced gene exclusively in the R B C precursors they generate. Achieving therapeutic B-globin expression has represented a tremendous obstacle for over a decade, but recent studies indicate that therapeutic levels of hemoglobin synthesis can be  achieved in the  progeny of virally transduced  HSCs  under  myeloablative  conditioning (Sadelain, 2006). With a lentiviral vector carrying extended sequences of the locus control region and a B-globin gene, May et al. demonstrated the production of the transduced B-globin gene in 17 to 24% of the total hemoglobin tetramers in red cells derived from transduced H S C s . This level of B-globin production was sufficient to ameliorate the anemia and the red cell morphology of mice affected by B-thalassemia that were transplanted with B-globin transduced H S C s (May et al., 2000). Similarly, in a transgenic mouse model of S C D , Pawliuk et al. demonstrated, after  lentiviral  transduction of H S C s , the production of a B-globin variant that prevents sickling in 99% of circulating red blood cells, contributing to up to 52% of the total hemoglobin tetramers. This high level of p-globin production led to subsequent prompt correction of the hematological parameters of the S C D affected mice (Pawliuk et al., 2001). Additionally, Imren et al. demonstrated, with an optimized lentiviral vector, the transduction of virtually all of the H S C s in the graft. This led to the sustained contribution of the transduced B-globin to - 3 2 % of total B-globin chains in - 9 5 % of the red blood cells with subsequent correction of the thalassemic phenotype (Imren et al., 2002). Since in myeloablative conditions, a therapeutic effect can be achieved even if only a minority of H S C s are genetically modified, the remaining challenge is to achieve  24  high-level and permanent hematopoietic reconstitution by genetically modified cells when a nonmyeloablative less toxic regimen is used.  1.3.9 A murine model of P-thalassemia major This model was described by Skow et al. in 1983 and is characterized at the molecular level by a spontaneous 3.7Kb deletion encompassing the entire B  m a j o r  locus  i  including 5' and 3' sequences (Goldberg et al., 1986; Skow et al., 1983). P-globin genes in mice are encoded by a multigene cluster located on chromosome 7. There are four functional genes in the mouse B-globin gene cluster: bh1, an early embryonic globin gene expressed primarily in yolk sac-derived cells from 9.5 to 12.5 days of gestation; y, a late embryonic globin gene expressed primarily in fetal liver-derived cells from 11.5 to 16.5 days of gestation; b1 ( B  major  ) and b2 ( B  minor  ) , adult globin genes first  expressed at 9.5 days of gestation in yolk sac-derived cells, then expressed in R B C s produced in the fetal liver and spleen and thereafter in the B M . In the mouse, the B gene is responsible for 80% of B-globin in adult R B C s and p  m i n o r  m a j o r  for the remaining 20%  (Shehee etal., 1993). In the model of P-thalassemia described by Skow, most mice homozygous for the p  m a j o r  gene deletion survive to adulthood and reproduce but they are smaller at birth  than their littermates and exhibit a hypochromic (reduced R B C hemoglobin), microcytic (reduced R B C size) anemia with severe anisocytosis (irregular size), poikilocytosis (irregular shape), reticulocytosis and inclusion bodies in a high proportion of circulating R B C s . All of these features are comparable to those seen in the human p-thalassemias and make this an attractive model for studies of curative strategies (Imren et al., 2002).  25  1.4 A p p r o a c h e s to achieving H S C selection and expansion  Retroviral transduction protocols are widely used for gene therapy applications but major drawbacks of this promising approach are the rapid loss of H S C s in vitro and the recovery of minimally corrected H S C s at the end of the manipulation. Therefore, in this field there is a compelling need to find ways to preserve or increase H S C function during and after their ex vivo manipulation to allow the application of such treatments to be usefully extended to patients given a safer, nonmyeloablative preparative regimen. In order to accomplish this, much effort has been aimed at elucidating the mechanisms involved in the regulation of H S C self-renewal in order to be able to manipulate the fate of these cells in vitro with preservation of their subsequent in vivo functional activity. These include various strategies to enable the transplanted H S C s to outcompete the large numbers of surviving endogenous H S C s in nonmyeloablated recipients by expansion of the transduced H S C s before transplantation or by enabling their selective growth after transplantation, as summarized below. HSCs  are able to perpetuate themselves through  self-renewal divisions.  Understanding the mechanisms behind the decision of a H S C to self-renew or differentiate might allow for the manipulation of these pathways to preserve the sternness of H S C s after cell division and ultimately for H S C expansion. The fate of H S C s appears to be the consequence of a complex and still poorly understood interplay between intrinsic and extrinsic regulators. These regulators influence the behavior of H S C s by ultimately triggering processes like proliferation, survival, apoptosis, self-renewal or differentiation. All of these processes are executed and regulated by a complex network of gene products that interact both intrinsically within the H S C s and between the H S C s and various cytokines, extracellular matrix  26  components and molecules released by or expressed by surrounding cells in their environment. In the next paragraphs, some of the extrinsic and intrinsic regulators that have been identified so far, will be described. In addition, strategies to expand or selectively promote the self-renewal and therefore, expansion of genetically modified H S C s for gene therapy purposes will also be summarized.  1.4.1 H S C s in vivo selection strategies  Approaches to achieve the in vivo selection of transduced H S C s expressing a therapeutic gene rely on the selective elimination of untransduced cells by specific drugs and subsequent selective survival and growth of transduced cells that co-express a therapeutic gene and a drug-resistance gene. A number of genes encoding drugresistance  molecules  dehydrofolate  are  currently  reductase (DHFR),  under  multi-drug  investigation;  such  as  the  resistance 1 (MDR1/ABCB1),  human and  methylguanine metyltransferase (MGMT) drug-resistance genes. DHFR was first tested for its ability to protect B M cells in vivo. H S C s transduced with DHFR variants become resistant to antifolate agents, such as methotrexate and trimetrexate (Li et al., 1994; Spencer et al., 1996), and can be positively selected both in vitro and in vivo. D H F R naturally functions to generate tetrahydrofolate, which is necessary for the de novo synthesis of pyrimidines and purines. Antifolate drugs act by binding tightly to the active site of the enzyme, thereby inhibiting de novo nucleotide biosynthesis. Single amino acid substitutions in the enzyme active site can result in decreased binding efficiencies for antifolate drugs, thereby preserving the ability of the enzyme to generate sufficient tetrahydrofolate (Sorrentino, 2002).  27  MDR1/ABCB1 encodes p-glycoprotein (PGP), a membrane pump that effluxes a variety of small molecues in an ATP-dependent fashion. Overexpression of P G P confers resistance to a variety of chemotherapeutic agents including vinblastine, colchicine, doxorubicin and paclitaxel. Co-expression of MDR1 with a therapeutic gene allows for enrichment of genetically modified cells and provides a strategy  for  increasing the number of corrected cells since the untransduced cells would be killed by the drug treatment. Large-animal studies and clinical trials using MDR1 as a selectable marker demonstrated overall disappointing results. Among the problems observed were excessive toxicity, low initial marking and moderate and/or transient selection after drug administration (Neff et al., 2006). MGMT is a gene that encodes a DNA repair enzyme that protects cells from DNA-damaging agents, such as nitrosourea and DNA-methylating agents. These drugs are potent stem cell toxins that cause severe and progressive B M suppression by inducing apoptosis. The mechanism of action of these drugs is to modify cellular D N A through the addition of alkyl adducts at the Opposition of guanine. The M G M T protein repairs these adducts by directly removing the alkyl residue. The co-expression of a therapeutic gene and MGMT variants allows selective resistance to alkylating agents and benzylguanine (Chinnasamy et al., 1998; Davis et al., 2000; Hickson et al., 1998; Persons et al., 2003; Sawai et al., 2001). The variant MGMT is the most powerful selective drug resistance gene defined so far, and it provides a survival advantage to the transduced H S C s and their extensive selection, even when limited numbers of transgene-carrying cells are transplanted in recipients given a  nonmyeloablative  conditioning regimen (Budak-Alpdogan et al., 2005). Using M G M T selection, long-term maintenance of 50% of the total blood cell output from transduced cells could be attained in large animal models (Trobridge et al., 2005). 28  Drug resistance genes are the only proven system for in vivo selection of transduced H S C s but these strategies also raise concerns about the high toxicity of the drug treatments required for adequate selection. Furthermore recent discovery of molecules that are able to influence H S C self-renewal in vitro offer another promising approach to achieve H S C expansion pre-transplantation  and avoid the  toxicity  associated with strategies that require in vivo drug selection.  1.4.2 Extrinsic regulators of H S C self-renewal  Numerous cytokines have been identified as important extracellular regulators of hematopoiesis. These include steel factor (SF, also known as stem cell factor [SCF]), Flt3-ligand (FL), Thrombopoietin (TPO) and cytokines from the family that signal through gp130. The combination of interleukin-11 (IL-11), S F , and FL, has been found to stimulate self-renewal of adult mouse H S C s to produce an amplification in vitro of 3 to 4 fold (Audet et al., 2001; Miller and Eaves, 1997). IL-6 in concert with FL, S F , IL-3, and G - C S F has been shown to support the expansion in vitro of human cord blood H S C (Bhatia et al., 1997a; Conneally et al., 1997). In gene therapy applications, cytokines that are capable of maintaining stem cell function in culture during retrovirusmediated gene transfer are IL-3 and IL-6 for murine H S C s (Bodine et al., 1989) and IL3, IL-6, T P O , S C F , FL and G - C S F for large animal H S C s (Trobridge et al., 2005). Nakauchi et al. quantitatively assessed the self-renewal capacity of H S C s at a clonal level in vitro by examining the effect of various cytokines on purified CD34- cKit+ Sca1+ Lin- cells from adult mice marrow and which represent - 2 0 % pure H S C s . Among the cytokines examined, S C F and T P O were the minimum cytokines to most efficiently induce self-renewal cell divisions. In contrast, S C F + IL-3, S C F + IL-6, and 29  S C F + IL-11 + FL appeared to be less effective (Nakauchi et al., 2001). On the other hand, Uchida et al. using purified Lin-Rho-SP+ cells, showed that the combination of S C F + IL-11 + F L was superior to T P O + S C F in maintaining H S C activity in vitro (Uchida etal., 2003). More recently Lodish's group identified additional factors that, together with other growth factors, were found to sustain the ex vivo expansion of long term repopulating cells (8 to 30 fold). These factors are the insulin-like growth factor 2 (IGF2) (Zhang and Lodish, 2004) and angiopoietin-like proteins (Zhang et al., 2006a). In addition, the extracellular matrix contains various ligands that activate receptors implicated in a wide range of developmental processes and these have also been found to be important for the regulation of H S C self-renewal. The pathways activated by these soluble, but matrix-bound ligands or by transmembrane ligands present on adjacent cells, include the Notch pathway, the Wnt pathway and the Sonic Hedgehog pathway (Akala and Clarke, 2006; Nakano, 2003). Hints of the involvement of Notch signaling in hematopoiesis came from overexpression of the Notch 1 receptor. This study showed that immortalized H S C s capable of differentiating into both lymphoid and myeloid cells after transplantation could be produced with the overexpression of an active form of the Notch 1 receptor (Varnum-Finney et al., 2000). The involvement of the Wnt pathway in hematopoiesis was confirmed by various studies with Wnt ligands. One study that linked the effect of a Wnt  ligand with primitive human cell self-renewal, made use of Wnt5a. The  administration of Wnt5a to mice was shown to induce the increased repopulation of human H S C s in NOD/SCID mice and lead to primitive hematopoietic development of human blood stem cells in vivo (Murdoch et al., 2003). A study from the same group also demonstrated the involvement of the Sonic Hedgehog pathway in hematopoiesis. 30  By addition of soluble forms of Sonic Hedgehog to cultures of human cord blood cells, they showed an increase in the number of cells with multipotent repopulating capacity in NOD/SCID mice (Bhardwaj et al., 2001). Similarly to nonhematopoietic systems where different signaling pathways have been shown to cross-talk, in the hematopoietic system as well multiple interactions between different pathways exist (Duncan et al., 2005) and they could be responsible, together with cytokine signaling, for the fine tuning of H S C s self-renewal. Use of growth factors for stimulation of H S C self-renewal is a promising approach to maintain or increase H S C s in vitro but in order to achieve greater expansion, much attention has recently been directed at harnessing intrinsic regulators that could influence H S C fate. These are described in the following section.  1.4.3 Intrinsic regulators of HSC self-renewal The expression and repression of specific genes are believed to ultimately determine the developmental fate of stem cells. Genetic programs establish the H S C pool early on during development and subsequently mediate decisions between proliferation and quiescence, self-renewal and differentiation, and specific lineage restriction events. This way the numbers and types of blood cells produced is balanced throughout a lifetime. Many of the genes involved in hematopoiesis and H S C regulation were first discovered because of their involvement in leukemic transformation. Using genetic approaches, such as loss-of-function or gain-of-function mouse models and conditional gene targeting strategies, their role was further confirmed in normal H S C development and lineage differentiation (Teitell and Mikkola, 2006). A major proportion of these 31  genes encode transcription factors (TFs). T F s are sequence-specific DNA-binding proteins that regulate gene expression and hence control proliferation and many differentiation processes like embryogenesis, organogenesis and also hematopoiesis, due to their ability to activate and coordinate expression of lineage-specific genes. Some of these T F s appear to be required for the establishment of H S C s early in development, others for the maintenance of H S C s throughout life and others for the amplification and self-renewal of H S C s . For example, SCL/taM (Stem Cell Leukemia) is a T F that was initially identified by its association with human mixed lineage leukemias and then later shown to have a vital role in the establishment of H S C s  during  embryonic development. This TF is necessary for the specification of H S C fate in early embryos (Shivdasani et al., 1995) but is dispensable for H S C engraftment, self-renewal and multi lineage differentiation in the adult (Mikkola et al., 2003).  1.4.3.1 Homeobox transcription factors  A major class of T F s that come in to play in the adult is the homeobox family of T F s encoded by HOX genes. H O X proteins are an evolutionary conserved family characterized by a 60 amino acid sequence that specifies a helix-turn-helix D N A binding domain called the homeodomain. Regions outside the homeobox in the variable domain  provide  binding  specificity to  homeoproteins  for  specific D N A  sequences through cooperative binding to other regulatory proteins. Mammalian Hox genes are organized in four genomic clusters (A, B, C and D) that are localized on four different chromosomes (7, 17, 12 and 2, respectively in humans) (Figure 1.4). During embryogenesis, they exhibit a site and time-specific pattern of expression along the anterior-posterior axis of the embryo that correlates with their relative chromosomal 32  position, meaning that the expression order is colinear with the 3'-5' organization of Hox genes on the chromosomes (van Oostveen et al., 1999).  Co-Factors: Meis-1 Pbx-1  Maintenance genes:  Upstream regulators:  P o l y c o m b proteins (e.g. BMI1) Trithorax proteins (e.g. M L L )  Retinoic acid receptor  3 Chr7  4  PARALOGS 5 6 7  8  9  10  11 12  13  H O X A —j  CO  LU Chr17 co =) ^ Chr12 Chr2  HOXB HOXC HOXD  Target genes:  Figure 1.4 Schematic representations of human HOX gene clusters and the factors that regulate their expression or interact with their protein products.  H O X T F s were first implicated in regulating hematopoiesis as a result of studies describing their expression in human and murine hematopoietic cell lines and by evidence of their involvement and aberrant expression in hematological malignancies (Lawrence and Largman, 1992). In the hematopoietic system, Hox gene expression was first reported by Adams and co-workers (Kongsuwan et al., 1988), who showed the presence of several Hox transcripts in hematopoietic cells with some being specific to 33  particular subsets of hematopoietic cells. HOX gene expression was also assessed in primary human B M cells and it was found that the majority of A and B cluster genes were preferentially expressed in primitive subpopulations (Sauvageau et al., 2004). However, knockout studies of Hox genes of the B cluster including combined deletion of Hoxbl through Hoxb9, have not revealed major hematopoietic defects (Bjornsson et al., 2003) (Brun et al., 2004) likely because of redundancies amongst Hox family members (Biji et al., 2006). In contrast, overexpression studies of many H O X genes, including HOXB3, HOXB4, Hoxa9 and HOXA10 have shown major effects on H S C self-renewal  and  involvement  in  differentiation, regulating  demonstrating  hematopoietic  cell  the  possibility  development  of and  a  substantial homeostasis  (Sauvageau et al., 1995; Sauvageau et al., 1997; Thorsteinsdottir et al., 2002; Thorsteinsdottir etal., 1997).  1.4.3.2 Additional HSC regulators  Other related genes (see Figure 1.4 mentioned above) that have emerged as important H S C regulators are Cdx4 (Davidson et al., 2003), Mil (Ernst et al., 2004a) and H O X cofactors such as Meisl (Hisa et al., 2004) and Pbx1 (DiMartino et al., 2001). The knockouts of these genes showed profound hematological abnormalities. Cdx4 is also a T F , while MLL belongs to the Trithorax-group of chromatin regulators that are involved in gene activation. Both these proteins activate the expression of different Hox genes that have a role in the proliferation of leukemic as well as normal hematopoietic cells (Ernst et al., 2004b; Wang et al., 2005). Not surprisingly, T F s that appear to be major players in regulating H S C specification and self-renewal have been extensively  34  investigated as potential candidates for enhancing H S C self-renewal in overexpression studies. HSC  self-renewal  and  maintenance  can also be  accomplished  by  the  transcriptional repression of genes. Polycomb group proteins are a family of T F s responsible for chromatin remodeling and maintenance of gene silencing. Some of the proteins that are part of the Polycomb Repression Complex 1, such as Bmi1, Mel18 and Rae28 have been implicated in the regulation of H S C self-renewal and lineage restriction (Akala and Clarke, 2006). Studies of BMI-1  have shown that loss of  expression of this gene leads to a decrease in the number of H S C s present in the adult and,  in competitive  repopulation  experiments, these  cells also fail to  sustain  lymphomyeloid hematopoiesis long term (Park et al., 2003). This major effect on H S C s has been studied also in leukemic cells where the loss of expression of BMI-1 leads to compromised survival of leukemic stem and progenitor cells. Eventually these BMIdeficient cells undergo proliferation arrest, differentiation and apoptosis (Lessard and Sauvageau, 2003). A direct link between BMI-1 and H S C self-renewal came from overexpression studies in purified H S C s (Iwama et al., 2004). Analysis of the potential of daughter cells derived from single BMM-overexpressing H S C s showed that this promoted H S C self-renewal and enhanced their ability to execute symmetrical divisions resulting in a 3-fold increase in clonogenic progenitors with high proliferative potential compared to control; however, the magnitude of H S C expansion after 10 days in vitro was not assessed. In addition to genes involved in transcriptional activation or repression, genes that regulate apoptosis and cell cycle progression have also been found to influence H S C survival and self-renewal. For example, transgenic mice overexpressing BCL-2, a gene encoding an anti-apoptotic protein, have been shown to have 2.4 fold increase in 35  H S C numbers in vivo (measured by phenotype) and their marrow cells display a higher competitive repopulation ability in lethally conditioned mice as compared to marrow cells from wild type mice. However, this study did not discriminate as to whether the greater competitiveness was simply due to an increase in the number of H S C s transplanted from the BCL-2 transgenic B M or whether the BCL-2 overexpressing H S C s also were able to generate more differentiated cells (Domen et al., 2000). An example of a cell cycle regulator found to play an important role in the maintenance and self-renewal of H S C s is p21. P21 is a cell cycle inihibitor and its suppressed expression leads to a 2-fold increase in H S C numbers in the B M of otherwise unperturbed adult mice by promoting H S C s to continue to enter the cell cycle and execute symmetric divisions resulting in their initial accumulation. However, this deregulation of quiescence is associated with early exhaustion of their self-renewal activity, as demonstrated by their inability to self-renew and reconstitute serially transplanted animals (Cheng et al., 2000). These genes represent just a few of the many genes now shown to be involved in the establishment, maintenance and regulation of H S C s . Nevertheless, how these interact remains largely unknown as does the likely involvement of other genes, proteins and epigenetic changes.  1.4.4 H S C in vitro expansion strategies  H O X B 4 is one of the T F s that has emerged as having a potent ability to stimulate the self-renewal and expansion of H S C s in vitro. HOXB4 is a 361 amino acid human protein in which only 9 amino acids are divergent from the mouse protein and none of these occur in the  homeodomain. HOXB4  is expressed in  primitive 36  hematopoietic cells of both species and is downregulated in their more mature progenitors and differentiated blood cells (Pineault et al., 2002; Sauvageau et al., 1994). Initial studies that led to the discovery of an effect of HOXB4 on H S C activity made use of retroviral vectors to genetically engineer the overexpression of this gene in adult murine B M cells. When cells that had been transduced with a control vector were transplanted into lethally irradiated mice, H S C numbers in the B M regenerated to only 5-10% of normal levels (a 20-fold expansion), whereas cells that had been transduced with a retroviral vector encoding HOXB4 reconstituted the H S C compartment to the size present in normal mice; i.e., a total expansion of 1000-fold and ~50 times more than that obtained from the control H S C s . In addition, proviral integration analysis of the cells regenerated in secondary transplants of the /-/OXB4-transduced cells showed that enhanced self-renewal was the mechanism responsible for their increased amplification in vivo (Sauvageau et al., 1995; Thorsteinsdottir et al., 1999). Further studies demonstrated that HOXB4 could also induce the expansion of mouse H S C s in vitro, Usually, when B M cells are cultured in the presence of cytokines, H S C s are rapidly lost. However, when mouse H S C s were transduced with HOXB4 and then cultured for 10 days, there was a net 40-fold increase in the number of H S C s detectable which were by that time ~1,000-fold higher than the number of H S C s detectable in cultures of H S C s that had been transduced with a control vector. This was measured by a limit dilution competitive repopulation assay (Antonchuk et al., 2002). In attempts to understand the mechanism of action of H O X B 4 and possibly further increase the expansion of H S C s in vitro, it was observed that cells engineered to overexpress H O X B 4 become 20-fold more competitive if P B X 1 , a H O X co-factor and homeobox containing protein, was knocked down (Krosl et al., 2003b). Similarly, 37  abolition of p21 expression significantly enhanced the regenerative activity of HOXB4transduced B M cells (Miyake et al., 2006). Overexpression studies using human cord blood (CB) cells and nonhuman primate B M cells have also demonstrated an effect of H O X B 4 on primitive populations capable of long-term repopulation in transplantation assays, although the magnitude of the expansion was much less than has been demonstrated for murine H S C s . In the experiments with human C B cells, C R U s assayed in a NOD/SCID xenograft model were shown to be amplified 4-fold (Buske et al., 2002). In non-human primates cotransplanted with equal numbers of HOXB4 and control cells, a 5-fold greater contribution of the H O X B 4 overexpressing cells compared to the control cells was seen at 6 months post-transplant (Zhang et al., 2006b). Subsequent studies showed that the effects obtained using retroviral vectors to raise intracellular levels of H O X B 4 could also be obtained using a H O X B 4 fusion protein that contained a plasma-membrane permeabilization sequence to facilitate cell entry (Krosl et al., 2003a). Similarly, human cells cultured on stromal cells engineered to secrete H O X B 4 were found to display enhanced H S C activity (Amsellem et al., 2003). Homeobox T F s are known to act during development in gradients resulting in different quantities eliciting different effects. In the last few years, several studies have shown that this is likely also the case for HOXB4 effects on hematopoietic cells (Klump et al., 2005). An extremely high concentration of H O X B 4 was shown to lead to enhanced regeneration of human CD34+ cells in the B M of NOD/SCID mice but also to severely impair their lymphomyeloid differentiation in vivo (Schiedlmeier et al., 2003). O n the other hand, a study that used adenoviral vectors to achieve the transient enforced expression of HOXB4 in primitive populations of C B cells did not observe 38  increased proliferation of primitive progenitors but instead it showed a significant increase in myeloid differentiation in vitro (Brun et al., 2003). Recently, another study demonstrated that very high overexpression of H O X B 4 inhibited the differentiation of primary murine B M cells in vitro by reducing the rate of commitment (Milsom et al., 2005). Another study comparing the types and extent of lineage outputs obtained in vivo from embryonic stem cell-derived hematopoietic cells and adult hematopoietic cells overexpressing H O X B 4 demonstrated that myeloid cell production was increased and T lymphoid development was suppressed over a wide range of expression levels but that very high H O X B 4 expression interfered with R B C output (Pilat et al., 2005). Altogether, these studies point to the idea that the fate of HOXB4-transduced hematopoietic cells may depend both on the absolute level of H O X B 4 expression obtained and on the stage of differentiation of the cells transduced. To take advantage of the effects of increasing H O X B 4 levels in H S C s for clinical applications, it will clearly be critical to more fully understand how these may affect hematopoietic cell growth and differentiation  and design strategies that retain H S C expansion effects without  impairing the normal output of any mature blood cells. Recent studies have suggested that the ability to induce a significant expansion of H S C s may extend to other HOX genes, which have been identified for their role in leukemogenesis. For example, HOXA9, which has been implicated in acute myeloid leukemia, is preferentially expressed in primitive cells. In addition, Hoxa9 " mice have _/  impaired H S C s behaviour and numbers (Lawrence et al., 2005; Sauvageau et al., 1994) suggesting that this gene is an important regulator of primitive hematopoietic cells. Not surprisingly, overexpression of Hoxa9 in murine B M cells leads to a 15-fold increase in H S C frequency in vivo in secondary transplantation assays (Thorsteinsdottir etal., 2002). 39  NUP98-HOX  fusion proteins have also emerged as potent HSC expanding  factors. The NUP98 protein is a component of the nuclear pore complex, involved in transport of RNA and protein across the nuclear membrane (Slape and Apian, 2004). All NUP98-HOX fusions reported to date that have been found in patients affected by leukemia include the N-terminus of NUP98, which contains a region of multiple phenylalanine-glycine repeats that may act as a transcriptional co-activator through binding to CBP/p300 (Kasper et al., 1999) and the C-terminus of the HOX gene product, including the intact homeodomain and a variable portion of the flanking amino acids (Lam and Apian, 2001) (Figure 1.5).  HOXB4  NH2  HOXA10  NH2  NUP98  _______  PBXl  HD  •  PBX|  HP  |[COOH  COOH  NH2  GLEBS  NUP98-HOXA10 NH2  GLEBS  HC  NUP98-HOXB4 NH2  G:.FBS  HD  NUP98-HOXA1OHD NH2  GLEBS  COOH  COOH  Figure 1.5 Schematic representations of HOX and NUP98-HOX fusion proteins.  PBX is the PBX co-factor binding domain, HD is the Homeodomain, FG is a sequence of repeated Glycine and Phenylalanine, GLEBS is a binding site for RAE1 which is an mRNA-specific carrier, NLS is a nuclear localization signal, RNP is a binding domain that likely facilitates transport of mRNA through the nuclear pore.  40  In a previous study from our laboratory (Pineault et al., 2004), the effects of an engineered fusion of NUP98 with H O X B 4 or HOXA10 were reported. B M cells transduced with retroviral vectors encoding either of these fusion proteins were found to produce a markedly higher number of C F U - S after a few days of culture. Furthermore, overexpression of the NUP98-HOXA10 terminal differentiation  fusion gene appeared to block  leading to a sustained output of cells with a  "primitive"  phenotype. In light of these data, Ohta et al. studied the effect of the overexpression of these fusion genes on H S C expansion after a more prolonged period of culture. The average magnitude of the H S C expansion achieved by overexpression of the NUP98HOXB4 fusion gene was - 3 0 0 fold while using the NUP98-HOXA10  fusion it was  possible to achieve an expansion of H S C numbers of more than 2000 fold. Mice transplanted with the latter cells ultimately develop leukemia after a long latency suggesting that other hits are required for this leukemogenic effect. An additional important finding of this study was the ability of the HOXA10 homeodomain denuded of all adjacent sequences to mimic the effects of the complete exon 2 of HOXA10 when incorporated into a fusion protein with the same NUP98 sequences (Ohta et al., 2007). Interestingly, mice transplanted with cells overexpressing this fusion protein didn't develop leukemia. This is the first time that such high levels of expansion of functionally verified H S C s have ever been achieved in vitro. N U P 9 8 - H O X fusion proteins have a strong effect.on the proliferation and selfrenewal of primitive populations of the blood and they have differential intrinsic potential to cause overt leukemia. Additionally, some of these fusion proteins in order to become leukemogenic require the interaction with co-factors (e.g. meisl). Due to their major impact on early populations of the blood they are good candidates to test and exploit for ex vivo H S C expansion. 41  1.5 p-thalassemia and S C D as a model to test the potential of H S C expansion and nonmyeloablative  conditioning  An important application of in vitro H S C expansion strategies is for gene-therapy, where the HOXB4 gene or NUP98-HOX fusion genes might be considered for their ability to produce a selective expansion of genetically corrected H S C s . A s already noted, an important limitation of current gene-therapy protocols is the relatively inefficient transduction of human H S C s achievable, which in many cases would result in an inadequate proportion of transduced blood cells producing inadequate levels of the therapeutic protein to achieve a curative effect. If the H S C s were transduced with vectors carrying a therapeutic gene and an additional gene such as HOXB4 or a NUP98-HOX  fusion gene, then preferential expansion of the subpopulation  of  genetically modified H S C s might occur, leading to therapeutic levels of "corrected" cells. In theory, such a strategy could be applied to any genetic disease in which corrected H S C s would not per se have acquired a survival advantage, for example, as is the case in S C D and thalassemia (Sorrentino, 2004). From previous studies of different mouse models of B-thalassemia or S C D , it has been found that the corrected R B C s have a survival advantage compared to the original R B C s , but this phenomenon does not extend to any growth or survival difference at the level of the H S C s . In a transplantation model of B-thalassemia it was observed that despite the amplification of the genetically normal erythroid component and the improvement of the anemic phenotype with 10 to 20% engraftment genetically  normal  HSCs,  50% H S C s  engraftment  is necessary to  bring  of the  Hemoglobin (Hb) concentration in the P B within a normal range (Persons et al., 2001).  42  In gene therapy applications, the efficacy of the treatment would depend also on the level of expression of the transduced gene and on the gene transfer efficiency. In the same study, using thalassemic mice crossed with transgenic mice expressing different amounts of a y-globin gene (the fetal counterpart of the B-globin gene), Persons er al. (Persons et al., 2001) showed that clinical improvement of a mild form of thalassemia could be achieved if 20% of the H S C s contained a therapeutic gene that, in the erythroid lineage, was expressed at 15% or more of the level of the normal a- or B-globin genes. In a mouse model of B M transplantation for S C D , it was similarly shown that a 2 5 % normal myeloid chimerism resulted in more than 90% normal Hb in the blood, but to cure the anemia, levels of chimerism as high as 70% were necessary (lannone et al., 2001). Moreover, it was necessary to achieve a level of chimerism in the H S C compartment of at least 50% (which leads to 100% replacement of sickle cells in the PB) to correct all sickle-mediated organ pathologies (Kean et al., 2003). This implies that mixed chimerism can ameliorate S C D but the complete elimination of the abnormal Hb from the blood is only possible with a very high H S C contribution. H S C expansion strategies might thus be critical to achieve the required level of H S C chimerism to obtain cures in patients with these genetic diseases. The same strategies might also allow the establishment of sufficient chimerism in patients conditioned with nonmyeloablative regimens.  1.6 T h e s i s objectives  H S C T is the only curative option for people affected by malignant and nonmalignant blood diseases. When this procedure was developed, it was thought that a myeloablative treatment was necessary to create space in the B M of the recipient and allow the transplanted cells to engraft. However, myeloablative regimens carry a 43  significant risk of severe morbidity and mortality that restrict the use of the procedure. To reduce these problems, less intensive preparative regimens, which are associated with minimal toxicities, are now being investigated clinically. Recent clinical trials corroborated by experimental data in mouse models suggest that the H S C content of the graft may be critical for success in this setting. Accordingly, the first aim of my thesis was to ascertain if strategies to expand H S C s ex vivo would affect and improve the outcome of nonmyeloablative H S C T and to determine if the quality and quantity of the expanded H S C s would be beneficial in this setting. To this end, HOXB4 and NUP98-HOX fusion genes were tested for their ability to promote sufficient H S C expansion ex vivo to achieve high levels of chimerism in nonmyeloablated recipients. The  second aim was to determine if the same type of H S C s expansion  strategies would be useful for the treatment and therapy of a murine model of Bthalassemia using a nonmyeloablative conditioning regimen to treat the recipient. In order to do this, HOXB4 and A/L/P98-HOX-expanded H S C s were transplanted into nonmyeloablated B-thalassemic mice and their hematological parameters were then monitored to follow the effect on their, disease status long term.  44  CHAPTER 2  MATERIAL A N D METHODS  2.1 Retroviral vectors  The retroviral constructs used in this project are Murine.Stem Cell Virus (MSCV) based oncoretroviral vectors. The M S C V 2.1 (Hawley et al., 1994) vector was first modified by replacing the PGK-neo cassette with a sequence containing the internal ribosomal entry site (IRES) sequence derived from the encephalomyocarditis virus and the gene for enhanced green fluorescent protein (GFP). This M S C V IRES G F P vector ( G F P vector) served as a control and backbone for cloning of a HOXB4 c D N A upstream of the IRES, to create M S C V H O X B 4 IRES G F P ( H O X B 4 - G F P vector). In the same way, retroviral vectors containing the fusion gene of NUP98 and the second exon of HOXB4 or HOXA10  or the homeodomain coding sequence of HOXA10 were created. The  c D N A construction of these fusion genes was previously described (Pineauit et al., 2004).  2.2 Generation of retrovirus  Production of helper-free retrovirus was carried out by standard procedures (Pawliuk  et  al.,  1994),  using  virus-containing  supernatants  from  transfected  amphotropic Phoenix packaging cells (Kinsella and Nolan, 1996) to infect the ecotropic packaging cell line G P E 8 6 (Markowitz et al., 1988). The retroviral titers of the G F P and +  H O X B 4 - G F P producer cells were 1 x 10 /ml_ and 4 * 10 /ml_ respectively, as assessed 6  5  by transfer of G F P expression to NIH-3T3 cells. Absence of helper-virus generation in the G F P and H O X B 4 - G F P producer cells was verified by failure to serially transfer virus-conferring G F P expression to NIH-3T3 cells.  45  2.3 Mice  Parental strain mouse breeders were originally purchased from The Jackson Laboratory (Bar Harbor, M E , USA) and subsequently bred and maintained at the British Columbia Cancer Research Centre animal facility. They were housed in microisolator units and provided with sterilized food, water, and bedding. Irradiated animals .were additionally provided with acidified water (pH 3.0). Strains used as bone marrow transplant  donors were  either  C57BI6/Ly-Pep3b (Pep3b) or the  F1  hybrid  (C57BI/6Ly-Pep3b x C3H/HeJ) ([PepC3] ) . Recipients were C57BI/6, C 5 7 B I / 6 J F1  of  W 4 M V  '"  (W ), the F1 hybrid of (C57BI/6J * C3H/HeJ) ([B6C3] F i) and mice affected by B41  thalassemia (B-MDD) (C57BL/6 H b b / H b b - ) . The identity of homozygous B-MDD tM  mice was confirmed  th  1  by isoelectric focusing analysis of R B C lysates to  detect  characteristic single, slow-migrating Hb tetramers consisting of two murine a and two murine B minor globin chains and by restriction digestion analysis on genomic D N A followed by Southern blot. Donor and recipient strains are phenotypically distinguishable on the basis of allelic differences at the Ly5 locus: donor Pep3b are Ly5.1 homozygous and donor [PepC3] F I are Ly5.1/5.2 heterozygous, whereas recipient C57BI/6 and [ B 6 C 3 ] F i are Ly5.2 homozygous. 2.4  Transduction of primary murine bone marrow cells, in vitro culture of  hematopoietic cells and transplantation  Primary mouse bone marrow cells were transduced as previously described (Kalberer et al., 2000; Sauvageau et al., 1995). Briefly, bone marrow cells were extracted from mice treated 4 days previously with 150 mg/kg 5-fluorouracil (Faulding) and  cultured  for  48  hours  in  Dulbecco's modified  eagle's  medium  (DMEM) 46  supplemented with 15% fetal bovine serum (FBS), 10 ng/mL hlL-6, 6 ng/mL mlL-3, and 100 ng/mL m S C F . Media, serum and growth factors were purchased from StemCell Technologies (Vancouver, B C , Canada). The cells were then harvested and cocultured with irradiated (40 Gy x-ray) G P E 8 6 viral producer cells for 48 hours in the +  same medium with the addition of 5 ug/mL protamine sulfate (Sigma, Oakville, O N , Canada). Loosely adherent and nonadherent cells were recovered from the co-cultures and incubated for an additional 7 or 10 days under the same conditions. Cells were split whenever cultures reached confluency. Retrovirally transduced bone marrow cells were monitored based on G F P expression using a FACSCalibur (Becton-Dickinson, Mississauga,  ON,  Canada).  Total  cell  numbers  were  evaluated  using  a  hematocytometer. 7-10 days after transduction, normal recipients were prepared by treatment with 2.5-2 Gy of whole body irradiation using a  1 3 7  C s or an X ray irradiator. B-  M D D recipients were treated with 2 Gy. Irradiated normal mice or B-MDD mice were transplanted with proportions of the culture within 12 to 24 hours after irradiation by tail vein injection. 2.5 In v i v o repopulation Peripheral blood cell progeny of transduced cells were tracked at various intervals posttransplant by expression of G F P and Ly5.1. One hundred uL of blood was extracted from the tail vein, and the erythrocytes were lysed with ammonium chloride (StemCell Technologies). Leukocyte samples suspended in Phosphate Buffer Saline solution ( P B S , StemCell Technologies) with 2% F B S were incubated sequentially on ice with biotinylated anti-Ly5.1 together with phycoerythrin (PE) - labled anti B220 or anti C D 4 and anti C D 8 , or anti Gr1 (Ly6G) and anti M a d (CD11b). Samples were subsequently stained with APC-labeled streptavidin (SA) (Becton Dickinson). All 47  samples were washed with P B S and 1 ug/ml_ propidium iodide (PI; Sigma) prior to analysis on FACScalibur (Becton-Dickinson) flow cytometry machines. Expression of Ly5.1 identified donor-derived cells, and expression of G F P identified  retrovirally  transduced cells. At the time of animal sacrifice, B M samples were analyzed by flow cytometry in the same manner. 2.5 C F C assay, in vitro expansion of myeloid colonies and clonality analysis  To generate clonal myeloid cell populations, GFP+ B M cells were plated at low density in methylcellulose medium (M3434, StemCell Technologies) containing 3 U/mL erythropoietin, 50 ng/mL m S F , 10 ng/mL hlL-6, and 10 ng/mL mlL-3. Well isolated myeloid colonies were plucked 10 days later and transferred into liquid cultures and expanded for 7-14 days in D M E M , supplemented with 15% F B S (6250 STI), mlL-3 (6 ng/ml), hlL-6 (10 ng/ml), m S C F (100 ng/ml), in order to provide sufficient genomic D N A for clonality analysis. Genomic DNA was isolated using DNAzol reagent (Invitrogen, Burlington O N , Canada) per the manufacturer's recommendations. Southern blot analysis was performed as previously described (Sauvageau et al., 1994). Unique proviral integrations were identified by digestion of DNA with Hindlll, which cleaves once within the provirus. Digested DNA was then separated in 1% agarose gel by electrophoresis and transferred to zeta-probe membranes (Bio-Rad, Mississauga, O N , Canada) (Sambrook et al., 1989). Membranes were probed with a P - d C T P - l a b e l e d 32  G F P sequence.  2.6 C R U a s s a y  H S C s were detected and enumerated using a limit-dilution transplantation-based assay for cells with competitive, long-term, lympho-myeloid repopulation function. The  48  basic procedure (Szilvassy et al., 1990), and a modification employing sublethally irradiated W / W 4 1  4 1  recipients (4.5 Gy  1 3 7  C s y-radiation) as a source of endogenous  competitor cells (Miller and Eaves, 1997), have been described in detail previously. Briefly, irradiated W / W 4 1  recipients were injected with 10 to 2 * 10 cells, and the  4 1  2  5  blood obtained by tail vein bleeding of these mice was analyzed by flow cytometry a minimum of 12 weeks posttransplant for evidence of lympho-myeloid repopulation. Mice that had greater than 1% donor-derived ( G F P ) cells in both lymphoid ( S S G +  FSC  l o w  |0W  ,  ) and myeloid ( S S C , F S C ) subpopulations were considered to be repopulated hl  hl  with transduced cells. Discrimination by flow cytometry of myeloid and lymphoid cells was confirmed using cell-surface staining to detect lineage-specific markers (Gr-1, Mac-1, B220, C D 4 and GD8). C R U frequencies in the test bone marrow sample were calculated by applying Poisson statistics to the proportion of negative recipients at different dilutions using Limit Dilution Analysis (StemCell Technologies) software.  2.7 Hematologic parameters  Blood from the tail vein was used to analyze red blood cell (RBC) indices and reticulocyte counts using the Sysmex S E 9500 system (Sysmex Corp of America, Long Grove, IL). Blood smears were stained with methylene blue for manual reticulocyte counts to validate the Sysmex reticulocyte counts in the majority of cases and these numbers correlated well. Blood smears were also stained with Wright-Giemsa using an automatic stainer. Smears were reviewed blinded by 2 independent hematologists.  2.8 Identification of retroviral integration sites  This protocol was adapted from the method previously reported by (Riley et al., 1990). Genomic DNA (1ug) from myeloid colonies expanded in vitro (described in  49  section 2.5 above) was digested with Pstl and the fragments were ligated overnight at room  temperature  to  a  double  stranded  bubble  linker  (Pstl  linker  Top  5'-  CTCTCCCTTCTCGAATCGTMCCGTTCGTACGAGAATCGCTGTCCTCTCCTTCCTG CA-  3'  and  Pstl  linker  bottom  5'-  AAGGAGAGGACGCTGTCTGTCGAAGGGTAAGGAACGGACGAGAGAAGGGAGAG3'). The Bubble linker contains a 29-nucleotide non-homologous sequence (underlined) that prevents binding of the linker primer in the absence of minus strand generated by the G F P - specific primer corresponding to the G F P sequence within the  MSCV  retroviral vector. Nested P C R was performed on one tenth of the ligation products. PCR-A  used  a  linker  specific  primer  (Vectorette  primer  224  5'-  C G A A T C G T A A C C G T T C G T A C G A G A A T C G C T - 3 ' ) and a GFP-specific primer ( G F P - A 5 ' - A C T T C A A G A T C C G C C A C A A C - 3 ' ) under the following conditions: one cycle of 94°C for 2 minutes, 30 cycles of :94°C for 30 seconds, 65°C for 30 seconds, 72°C for 2 minutes, and 1 cycle of 72°C for 2 minutes. A 1ul aliquot of P C R - A reaction product (one twenty-fifth) was used as a template for the second nested P C R ( P C R - B ) using Nested Linker Primer B ( 5 ' - T A C G A G A A T C G C T G T C C T C T C C T T - 3 ' ) and a G F P specific  primer  (GFP-C  5'-ACATGGTCCTGCTGGAGTTC-3')  under  the  same  conditions described for P C R - A . The products of P C R - B were separated by gel electrophoresis on a 1.5% Agarose/TAE gel. Individual bands > 550 base pairs were excised and purified using the Qiaex II Gel Extraction Kit (QIAGEN) then subcloned into the PCR2.1 vector using the PCR2.1 T O P O TA Cloning Kit (Invitrogen) according to the manufacturer's protocol. The T O P O ligation product was transformed with 25ul T O P 1 0 Chemically Competent Cells. DNA was extracted from Ampicillin resistant colonies by standard procedures and digested with Kpnl and EcoRI to select for LTR containing clones. Positive clones were sequenced with an LTR-specific primer (5'50  T C C G A T A G A C T G C G T C G C - 3 ' ) . Sequence results that contained both the Pstl linker sequence and the M S C V 3'LTR were believed to contain captured genomic D N A sequence which was further analysed by BLAT Search using the U C S C Mouse Database (http://www.genome.ucsc.edu/ assembly of March 2006). The same assay was performed using Astl instead of Pstl. 2.9 Western blot analysis  Protein extracts from primary B M cells or spleen cells from mice treated with 2 Gy and transplanted with H O X B 4 or NUP98-HOXA10hd expanded cells were analysed by western blot using the II2 anti-HoxB4 monoclonal antibody (Gould et al., 1997) or the L205 anti-NUP98 polyclonal antibody (Cell Signaling Technology #2288, (Fontoura et al., 1999)) respectively. A s a control, protein extracts from primary B M cells from Pep3B mice or from cell lines (PG13HOXB4 or 293T) were used. Protein extracts were electrophoresed on N U P A G E 4-12% Bis-Tris gel (Invitrogen cat no. NP0321BOX) and blotted  to P V D F  membranes  (Millipore  Immobilon-P  transfer  membrane). For  evaluation of HOXB4, blots were probed with a 1:250 dilution of hybridoma supernatant in T B S , 3 % B S A , 0.001% Tween-20 and visualized with HRP-conjugated donkey-antirat secondary antibody (Jackson ImmunoResearch Laboratories, Inc.). For N U P 9 8 HOXAIOhd testing, blots were probed with a 1:500 dilution of antibody supernatant in 5% skim milk powder and T B S and visualized with HRP-conjugated goat-anti-rabbit secondary antibody (Jackson ImmunoResearch Laboratories, Inc.). Protein expression was detected with Western Lightning Chemiluminescence Reagent Plus (Perkin Elmer, Boston MA).  51  CHAPTER 3 SUBLETHALLY  ENHANCED CONDITIONED  MICE  REPOPULATION USING  EX  VIVO  OF EXPANDED  HOXB4-TRANSDUCED H E M A T O P O I E T I C S T E M C E L L S  The material in this chapter has been prepared for publication with the title "High Level Polyclonal Reconstitution of Nonmyeloablated Mice with expanded HOXB4transduced Hematopoietic Stem Cells" and is co-authored by H. Ohta, who contributed with the transduction of the cells and performed some of the C R U assays, S . Imren, who contributed with the analysis and diagnosis of the thalassemic mice and with the preparation of the manuscript, B. Cavilla, who provided the data on the cell dose response relationship in nonmyeloablated mice, C . J . Eaves and R.K. Humphries, who contributed with designing the experiments, with the critical analysis of the data and with the preparation of the manuscript.  52  3.1 Introduction H S C T is the only cure for some genetic disorders such as S C D and thalassemia, but the morbidity and mortality associated with conventional myeloablative preparative regimens has limited its use to only a minority of the affected patients (Kean et al., 2003; Roberts et al., 2005). Reduced intensity regimens prior to B M T could minimize morbidity and mortality associated with stem cell transplantation-based therapies but require large transplant doses to achieve significant chimerism. Clinical trials have shown that patients with hemoglobinopathies who can achieve stable 20-30% mixed chimerism  after  transplantation,  lead a  normal  life without any further  blood  transfusions however reaching this level of chimerism in nonmyeloablative conditions has been challenging. Several studies in animal models have shown that with no preconditioning or under nonmyeloablative conditioning extremely high transplant doses of cells are required in order to achieve detectable chimerism (Brecher et al., 1982; Kittler et al., 1997; Micklem et al., 1968; Saxe et al., 1984; Stewart et al., 1993; Stewart et al., 1998; Wu and Keating, 1993). This problem is further exacerbated in gene therapy settings of autologous BMT where there is massive loss of H S C resulting from several manipulations needed for gene transfer of a therapeutic gene. Thus the number of corrected H S C s at the end of ex vivo manipulations is generally not sufficient to outcompete the remaining host H S C s in nonmyeloablative settings. One approach to overcome the requirements of massive transplant doses is to confer a selectable advantage to H S C s . This has been achieved by genes/factors that could confer on H S C s a growth advantage or would allow for their in vivo selection. A number of genes encoding drug-resistance molecules are currently under investigation, such as the human  dehydrofolate  reductase (DHFR),  multi-drug resistance  1 (MDR1), and 53  methylguanine metyltransferase (MGMT) drug-resistance genes (Allay et al., 1998; Chinnasamy et al., 1998; Davis et al., 2000; Hickson et al., 1998; Li et al., 1994; Persons et al., 2003; Sawai et al., 2001; Spencer et al., 1996). A side effect to this strategy is the high toxicity of the selective drugs. An alternative and perhaps complementary approach is to use methods to expand H S C before transplantation. Until recently this option was difficult to explore since methods for substantial H S C expansion ex vivo were not available. Based on the ability of forced human H O X B 4 expression to increase H S C s (40-fold) within 10 days in vitro (Antonchuk et al., 2002), we have investigated the applicability of using H O X B 4 expanded H S C s in recipients given reduced intensity preparative regimens. Retroviral transduction and use of 5fluorouracil (5-FU) treated B M have been shown to adversely affect engraftment in unconditioned recipients. Goebel et al. showed that the competitive  repopulating  activity for marrow treated with a retroviral-mediated gene transfer protocol that included 5-FU treatment and subsequent ex vivo culture resulted in decreased overall engraftment in 1.6 Gy-irradiated hosts compared to fresh marrow (Goebel et al., 2002). Since our protocol include retroviral transduction of cells and treatment with 5-FU we therefore investigated whether these HOXB4 ex vivo expanded H S C are still as competitive as fresh B M cells and are achieved in sufficient numbers to be useful in a nonmyeloablative BMT. In particular, we monitored the capacity of these H S C s to engraft, to give rise to normal lymphomyeloid progeny and to sustain long-term hematopoiesis in nonmyeloablated recipients.  54  3.2 Results  3.2.1  Donor  chimerism  and  transplant  cell  dose  in  recipients  given  nonmyeloablative conditioning and unmanipulated B M cells  To establish the baseline for comparison to ex vivo expanded H S C , we first assessed the relationship between transplantation dose with fresh B M cells and chimerism achieved in recipients given 2 Gy TBI. A s shown in Figure 3.1, at least 5 X 10 cells are needed to achieve chimerism above 3%. With increasing transplant doses, 5  we observed a strong correlation between the level of donor chimerism and transplant cell dose achieving a maximum of 55% with the transplantation dose of 1 X 10 cells, 8  which roughly is equivalent to the whole B M of a mouse (Figure 3.1).  55  8 0 "|  200 cGy  70  im o°-  60 50  Q Z Z U O 03  40  g s  30  o. UJ Q  20  H  oQC r_-  10 i  CELL DOSE  1X10  i  1 • V T » - M " t " " . ' " " l fI  TTT*  l  1X10  ESTIMATED CRU CONTENT  1X10  4  1  I llllll  l  1X10  3  6  1X10  7  1X10  8  5  100  10  1000  10000  Figure 3.1 Cell dose response of average B M engraftment in minimally ablated  hosts. B M was harvested from 18 donors and was transplanted into 31 recipients over the dose range 1 X 10 to 1 X 10 cells. Three mice were transplanted at each cell dose, with the exception of 5 X 10 and 1 X 10 where only two mice were transplanted. Recipient mice were given 2 Gy of preparative radiation prior to transplantation. Engraftment levels were assessed 2 months after transplantation on the basis of W B C chimerism. Each point is the average of three mice and error bars represent the standard deviation of the mean. In cases where error bars are not apparent, they are smaller than the size of the marker. The data shown in this graph was generated by Ben Cavilla. 4  8  4  8  3.2.2 Transplantation of in vitro expanded HOXB4-transduced H S C s following nonmeyloabative conditioning yields sustained, high level donor chimerism  We then tested whether HOXB4 could be used to stimulate ex vivo expansion of H S C s that could be obtained in sufficient numbers and with retention of sufficient repopulating ability to achieve robust levels of chimerism under nonablative conditions. 56  B M cells from mice treated with 5-FU 4 days previously were prestimulated for 2 days, transduced with GFP alone or HOXB4 and GFP for 2 days and then cultured for an additional 7 days. Transduction efficiencies as assessed at the end of the culture period were essentially identical for both arms (35% and 25% for G F P versus H O X B 4 arms respectively). The ability to contribute to chimerism was compared for GFPversus HOXS4-transduced cells in mice transplanted immediately after transduction and after the further 7 day culture period to allow for H S C expansion. A s shown in Figure 3.2A, in mice conditioned with 2.5 Gy, equivalent levels of chimerism were obtained when equal numbers of HOXB4- or control GFP-transduced cells (progeny of 260,000 starting cells or ~ 50 C R U ) were transplanted immediately after termination of the infection period (chimerism of 13% ± 7% for H O X B 4 and 13% ± 6% for G F P ) . This was consistent with the anticipated H S C yield and the absence of an in vivo competitive advantage of /-/QXB4-transduced cells in sublethally conditioned mice. When transplants were carried out 7 days after infection, chimerism levels for control GFP-transduced cells were diminished, reaching stable levels of only 6 % ^ ± 2 % consistent with a further decline in H S C numbers with culture. In contrast, HOXB4transduced cells transplanted 7 days after transduction yielded dramatically higher levels of chimerism (48% ±10%) than achieved with cells transplanted immediately after infection consistent with at least an 80-fold expansion in H S C number in vitro and retention of repopulating potential (Figure 3.2B). This H S C expansion quantification was  extrapolated  from  the dose  response curve  of unmanipulated  cells in  nonmyeloablated mice shown in Figure 3.1. Importantly, chimerism achieved with H O X B 4 expanded H S C was lymphomyeloid (Figure 3.2C). Consistent with significant ex vivo H S C expansion and retention of robust repopulating function, substantial levels of chimerism (8% ±3% at 7 months post transplantation) were also achieved with even 57  a 10-fold lower transplant dose of cultured HOXB4-transduced cell (26,000 starting cell equivalents o r - 5 starting HSCs). In contrast, with this low dose of cells essentially no chimerism was detected for mice transplanted with GFP- transduced cells (Figure 3.2B).  60  d-4  62  d11  64  Infection Prewith G F P I 7 d a y s of culture stimulation |or HOXB4I  250cGy '  70 +  a.  60  _¥  40  UL  • HOXB4  I—  O 50 o c £  250cGy^  •  G F P  m 30 m £  JE 20 o m 10  BL  Cells transplanted at  B  0 G F P 260K  1  0  End of infection  B4 260K 70  *  •  |  ••  7days post end of infection  • G F P 26K" B4 26K  60  i  50 40 30 20 10 14  0 • 14  Months post transplantation PB 7 months post transplantation 29|6  25|9 !*»  37T29  o  26139  0-  ....,^0128 47ll5  TO  a, o  CN CN 0Q  a"  PB 14 months post transplantation  o  CN CM  CD  37| 5 48110  O O  3S|3 52110  0  a  o co  6.514.5 78111  W*  o  GFP  58  Figure 3.2 (A) Experimental design and comparison of chimerism for transduced cells transplanted before or after extended ex vivo culture. 5-FU B M was  harvested and prestimulated for 2 days in a cocktail of cytokines containing 100 ng/ml mSF, 10 ng/mL hlL-6, 6 ng/mL mlL-3. B M cells were then transduced for 2 days with oncoretroviral vectors ( M S C V - I R E S - G F P and M S C V - H O X B 4 - I R E S - G F P ) and then either transplanted in to mice immediately after infection or after an additional 7 days in culture. Recipient mice were conditioned with 2.5 Gy. Chimerism was assessed by measuring G F P + cells in the W B C at 7 months post transplantation by flow cytometry analysis. Mice were transplanted with the progeny of 260,000 original 5-FU B M cells. (B) Kinetics of engraftment in mice transplanted with transduced cells after  extended culture. Cells were transduced with GFP or HOXB4. Mice were transplanted with 2 doses of cells: the progeny of 26,000 or 260,000 original 5-FU cells. Chimerism was assessed by measuring the GFP+ proportion in the W B C population at 2, 7 and 14 months post transplantation by flow cytometry analysis. Each data point represents the average of 4 to 5 mice and error bars represent the standard deviation from the mean. (C) Lineage distribution in the W B C compartment of a mouse transplanted with cells transduced with HOXB4 and cultured for an additional 7 days. The lineage  distribution was assessed at 2 months post transplantation (data not shown), at 7 and 14 months post transplantation by flow cytometry analysis. W B C were stained with antibodies that detect B lymphoid cells (anti-B220PE) T lymphoid cells (anti-CD5PE or anti-CD4CD8PE) and myeloid cells (anti-Gr1PE and/or a n t i - M a d PE). The abscissa indicates the G F P fluorescence intensity and the ordinate indicates levels of detected expression for a particular cell surface lineage marker, B220 and C D 5 / C D 4 C D 8 for lymphoid cells, Gr1 and Mac1 for myeloid cells.  59  These findings were confirmed and extended in 2 additional experiments in which mice were transplanted with expanded progeny of a lower range of starting cells, from 8,000 to 80,000 or an estimated 1-2 to 15 starting H S C s and transplanted into mice receiving reduced conditioning of 2 Gy. Figure 3.3A shows the combined data from 2 experiments. At 4 (experiment 1) and 6 months (experiment 2) post-transplant, extremely low levels of donor-derived cells were present in recipients of either dose of control GFP-transduced and expanded cells. In contrast, chimerism as high as 35% (mean=27%, n=5) was reached following the transplantation of the expanded progeny of 80,000 HOXB4-transduced cells and up to 22% with the smaller transplant dose (mean=7.6%, n=6). The level of chimerism achieved for the expanded progeny of 80,000 /-/OXB4-transduced  cells is equivalent to that previously documented upon  transplantation of 1 x 10 unmanipulated fresh B M cells and thus equivalent to a 7  transplant dose of ~ 1,000 H S C s (see Figure 3.1). Measurement of the H S C content in the B M cultures transduced with HOXB4 or with G F P by limit dilution assay for C R U confirmed that the level of expansion achieved in the HOXB4 arm ranged from 23- to 80- fold and thus resulting in an H S C content in the transplant of 360 or 1,000 H S C respectively (Figure 3.3B and Table 3.1). This data shows that the transplantation of the progeny of a minimal number of starting H S C s expanded in vitro lead to the achievement of significant level of chimerism in nonmyeloablated mice. This level of chimerism would never be achievable with the transplantation of the same number of H S C s before expansion or more importantly with unmanipulated H S C s .  60  A 40  £  35 30  E 25  sz  o 20 o c 15 4 o Q 10 5  -Etfflo  0 Initial bulk population expansion of cells  GFP  progeny of 1-2 H S C  ex vv io  B  100  B4  GFP  B4  progeny of 15 H S C  • G F P • B4 3  •o ., , T— >>  -2 o C  10  CO  o -o *- b  -£ CD  E •>.  c iS Z)  o  2  0.1  0.01  EXP1  EXP2  Figure 3.3 Significant chimerism achieved with HOXB4 expanded HSC. (A) The chimerism is determined by the GFP proportion of cells in the WBC compartment. Data from one experiment was collected at 4 months post transplantation while data from the second experiment was collected at 7 months post transplantation. The transduction protocol is as described in chapter 2. At the end of the infection, cells were kept in culture for an additional 7 days and then transplanted into mice that were pre-conditioned with 2 Gy. Two doses of cells were transplanted: the progeny of 8,000 or 80,000 original 5-FU cells. Each data point corresponds to a mouse. Each arm has a total of 5 to 6 mice. The solid horizontal bar indicates the average chimerism in the different arms of the experiment. (B) Comparison of CRU content between starting cultures (dayO) and after in vitro culture (day10).  61  Table 3.1  CRU FREQUENCY EXP1 D a y of  harvest  D a y 10GFP D a y 10 HOXB4 FOLD  EXPANSION  (24  weeks  PT)  1/6114 (1/9739 • 1/3838) 1/46969 (1/103897-1/21233)  (+/-S.E.)  EXP2 (16  weeks  PT)  1/5040 (1/8848-1/2871) 1/319395 (1/860000 -1/118620)  1/76 (1/139 -1/41)  1/218 (1/444 -1/107)  80X  23X  3.2.3 Highly polyclonal donor chimerism in mice transplanted with expanded HOXB4-transduced H S C s following nonmeyloabative conditioning.  The high levels of chimerism achieved by transplantation of /-/OXB4-transduced cells after in vitro culture are consistent with significant ex vivo expansion of H S C s . Previous studies carried out with transplants in lethally conditioned recipients have shown that HOXB4 induced expansion of H S C in vitro is highly polyclonal, consistent with the ability of HOXB4 to enhance the self-renewal of a broad spectrum, perhaps all, successfully transduced H S C s . However, concerns have been raised due to the potential risk of random insertion of the retroviral vectors in sequences with oncogenic potential and subsequent malignant transformation of few transduced H S C clones. To confirm that the high level donor chimerism observed in the setting of nonmyeloablative conditioning was a result of the contribution of many /-/OXB4-transduced H S C s expanded in culture rather than clonal dominance of few transduced H S C s , we harvested B M cells from 3 primary recipients presented in Figure 3.2B, 19 months post 62  transplantation for clonal analysis of the individual transduced H S C s contributing to host hematopoiesis (Figure 3.4). Two of these mice (mouse a and b) were transplanted with the expanded progeny of 260,000 and the 3  r d  one (mouse c) with the expanded  progeny of 26,000 fVOXS4-transduced cells. To gain a measure of number of H S C s contributing to hematopoiesis at the time of analysis, DNA was isolated from C F C derived myeloid colonies generated ex vivo as described in Materials and Methods. FACS-selected GFP+ bone marrow cells were used to assure the donor origin of the colonies generated. Southern blot analysis was performed on DNA from a total of 120 myeloid colonies from these 3 mice (n=36 for mouse a, 45 for mouse b and 39 for mouse c). A unique integration pattern, which corresponds to a C F C clone derived from a unique H S C , was observed in 51 out of the 120 colonies (23 of 36 colonies, 18 of 45 colonies and 10 of 39 colonies for mouse a, b and c respectively). Each integration pattern identifies the uniqueness of every H S C clone from which C F C colonies were generated and each unique pattern was found from 1 to multiple times. The summary of the data is presented in Figure 3.4. Interestingly, there was no overlap of integration patterns  between the 3 mice, and the majority  of these integration  patterns,  representing the unique clonal signature of a tranduced H S C were observed once (36 of 51, or 71%). The presence of. multiple uniquely marked colonies in each mouse indicates a high degree of polyclonal reconstitution consistent both with high level polyclonal H S C expansion ex vivo and an absence of significant clonal dominance in vivo. Moreover the mean number of proviral integrations per HOXB4-transduced H S C was 2.2±1.8 (range: 1-4). The average number of integrations was equivalent for clones detected once versus more than once. This further reinforces the conclusion that there was no dominance of those clones that carried multiple integrations and thus had a potentially  increased risk for integration  into genes conferring  a growth 63  advantage. Furthermore, this data also demonstrated life long persistence, up to 19 months,  of  many  expanded  HOXS4-transduced H S C s  under  nonmyeloablative  conditions.  64  /\  Peripheral blood at 14 months PT Mouse a  Frequency of appearance Mouse a  Mouse b  Frequency of appearance Mouse b  Mouse c  Frequency of appearance Mouse c  Figure 3.4 A s s e s s m e n t of the degree of polyclonal chimerism from ex vivo expanded H S C .  (A) and (B). Flow cytometry profiles documenting chimerism in P B at 14 months post transplantation and for B M at 19 months post transplantation for the three mice used to assess the clonality of transduced H S C s . Mouse a and b received the progeny of 260,000 original 5-FU B M cells; mouse c received the progeny of 26,000 original 5-FU B M cells. (C) Schematic diagram of the method used to carry out proviral integration analysis on clonally expanded C F C isolated from B M of mice at the time of sacrifice (19 months post transplantation). (D) Graphs showing the summary of the data for each of the three mice analyzed. The abscissa shows how many times a specific pattern was found. The ordinate displays what percentage of the clones appeared with the frequency specified on the abscissa. Representative patterns obtained by Southern blot are shown for each of the three mice.  65  3.2.4 Expanded H S C s contribute to high level chimerism in the B M in addition to the P B  The above studies document that high level chimerism can be achieved in the mature peripheral blood cell compartment and in unseparated B M cells of sublethally conditioned mice transplanted with ex vivo expanded /-/OXB4-transduced cells. To assess whether the measured level of chimerism extended to more  primitive  hematopoietic cells and, importantly, to the H S C compartment, B M was harvested from two primary recipients at 12 or 15 months post transplant. The recipient sacrificed at 12 months had been initially transplanted with 1000 H S C s post expansion (corresponding to an estimated 15 starting HSCs). The second recipient sacrificed at 15 months had been transplanted with 100 H S C s post expansion (corresponding to an estimated 1 to 2 starting H S C s ) (Figure 3.5). For both mice, B M cells were analysed by flow cytometry to measure chimerism and by limit dilution transplantation assay in secondary lethally irradiated recipients to assess the level of /-/OXB4-transduced H S C s recovered. The flow cytometry profiles revealed 60% HOXB4-transduced cells in the B M of the mouse that received the highest transplant dose and 10% /-/OXB4-transduced cells in the B M of the mouse that received the lower transplant dose. Subsequent quantitation of H S C numbers in these recipients demonstrated that the mouse initially transplanted with 1,000 H O X B 4 expanded H S C s , had regenerated transduced H S C numbers to 22,000 (estimated range of 11,500 to 24,200) at the time of sacrifice, or essentially to normal numbers of H S C s seen in unmanipulated normal mice. In the mouse  initially  transplanted with 100 H O X B 4 expanded H S C s the number of H S C s had recovered to an estimated 1,200 at the time of sacrifice or approximately 10% of normal H S C  66  numbers. The levels of H S C regeneration are thus highly concordant with the levels of chimerism achieved in the B M .  Estimated GFP+ C R U in BM of primary recipients 12-15 months post transplantation  Estimated Estimated Starting CRU content GFP+ CRU cells in transplant in transplant transplanted on dayO on day11 80000  13  1052  8000  1-2  105  BM chimerism in primary recipients 12-15 months post transplantation  22000  60%  1200  12%  100000 T3  B. CO  > o o  I 10000 CL  M  1  & 3-  rr o  CL  «*—  -+;..  O  LL  CQ  1000  Normal range  1  100  10  0_  O  0  10  20  30  40  50  60  70  % Chimerism in B M  Figure 3.5 H S C contribution to chimerism in the bone marrow. Two primary recipients from the experiments described in Figure 3.4 were sacrificed at 12 months and 15 months post transplantation. Flow cytometry analysis was performed on the BM to assess the proportion of GFP+ cells. Furthermore BM cells were transplanted in limit dilution assay in secondary recipients with the transplantation doses ranging from 1 x 10 to 1 x 10 primary mouse BM cells per secondary recipient. All secondary recipients were analyzed at 6 months post transplantation. 3  6  3.3 D i s c u s s i o n  Many HSC-based therapies would benefit from having protocols to expand H S C s . Up to now expanding H S C s was a difficult task but with newly discovered factors, it is becoming a reality within reach. With the data reported here, we provide 67  evidence of the value and the applicability of H S C expansion strategies for an important clinical application such as nonmyeloablative BMT (Baron and Storb, 2006). H O X B 4 has emerged as a powerful H S C expanding factor, therefore we tested HOX84-transduced and expanded H S C s in nonmyeloablated recipients. The protocol we used for this study to attain H S C expansion requires treatment of B M cells with 5F U , transduction with a retroviral vector and extended ex vivo culture of genetically modified cells. These ex vivo manipulations hold the possible risk of modifying some important features of H S C s and affecting the pathways that are normally activated in c  fresh H S C s , making them less competitive than unmanipulated H S C s . Goebel et al. studied the chimerism achieved after transplantation of retrovirally transduced B M cells (Goebel et al., 2002). They found that B M cells stimulated into cycle by 5-FU and transduced with a retroviral vector had decreased engraftment capacity compared to fresh B M cells. In contrast, our data reveals that H O X B 4 ex vivo expanded H S C s retain the features of fresh unmanipulated cells as manifested by sustained B M and P B chimerism of nonmyeloablated mice. W e tested different proportions of the expanded culture at the end of 7 days in mice that received nonmyeloablative conditioning of 2002.5 Gy. In different experiments, starting from very limited numbers of H S C s we were able to achieve significant engraftment, up to 50% starting with 40-80 H S C s and up to 25-30% starting with 10-20 H S C s . Importantly the chimerism was measured at different time points and it was stable up to 19 months post transplantation. These data show that chimerism levels achieved with the transplantation of expanded H S C s is consistent with the chimerism that would be achieved with the transplantation of the estimated numbers of H S C s recovered after expansion, but unmanipulated. This concordant chimerism confirms that expanded H S C s behave like fresh unmanipulated H S C s and that the competitiveness of these manipulated cells is preserved. Moreover, when 68  /-/0XB4-transduced cells were transplanted at the end of the transduction, they behaved exactly-like the control-transduced cells, demonstrating that H O X B 4 does not alter the in vivo growth properties of these cells. On the other hand, when HOXB4transduced H S C s were transplanted after 7 days of culture, the engraftment achieved in the control arm was very poor while H O X B 4 expanded H S C s performed dramatically better, giving rise to robust and sustained lymphomyeloid chimerism. This dramatic difference in engraftment between expanded and non expanded H S C s confirms that the final chimerism achieved in nonmyeloablated mice strictly depends on the actual amount of H S C s that is transplanted and not on hypothetical properties imparted by H O X B 4 . Previously published reports suggested that the final percentage of donor chimerism in nonmyeloablated mice is determined by the ratio of host to donor stem cells (Colvin et al., 2004; Rao et al., 1997) and our data confirms that the final percent donor chimerism is contributed by the amount of H S C s transplanted. Knowing that this is the relationship ruling the outcome of the P B chimerism then the winning strategy for achieving therapeutic range of chimerism after nonmyeloablative B M T is to outcompete at the stem cell level. In previous studies of H O X B 4 it was shown that when transduced H S C s are transplanted in lethally irradiated mice, these are capable to expand in vivo until H S C numbers are restored to the normal range, even when relatively small HOXB4transduced cells are transplanted. At this point, these H S C s sense feedback signals from the environment and stop expanding (Sauvageau et al., 1995; Thorsteinsdottir et al., 1999). In light of this finding, we analyzed the behaviour of HOXB4-transduced cells in vivo in nonmyeloablated mice and monitored if in this setting in vitro expanded H S C s are also still responsive to regulation in vivo that control the H S C compartment size. The data presented in this chapter demonstrate that transduced H S C s are still subject; 69  to regulation from the environment. These expanded H S C s show an extremely, high proliferative potential and are capable of expanding almost 2 logs in vitro and an additional 1 log in vivo. Nonetheless, in the mouse that received the highest dose of expanded cells, H S C numbers were found to be within the normal range, indicating that in the nonmyeloablative setting as well, HOXB4-transduced cells sense the signals from the environment. Although we have not quantified the proportion of H S C s that are spared after a 2 Gy radiation it has been reported that a radiation of 1 G y is toxic at the stem cell level (Stewart et al., 2001), therefore it is not likely that the total of H S C s in this recipient is above the normal range. On the other hand, in the mouse that received the lower dose of expanded cells, transduced H S C s were only contributing to 10% of the normal range. This could be attributed to the fact that these cells, after expanding 2 logs in vitro and 1 log in vivo, might have reached the limit of their proliferation potential or alternatively might lack the proliferative stimulus from the cytokine storm that is normally triggered in lethally conditioned mice and is responsible for the early H S C regenerative phase. To elucidate if they stopped proliferating because of environmental signaling or because of proliferation exhaustion, these cells should be further tested in lethally conditioned recipients. The protocol used to achieve H S C expansion is based on genetic manipulation of B M cells with retroviral vectors. Concerns are raised due to the possibility of creating malignant H S C clones by insertion of the HOXB4 transgene near host genes with oncogenic potential (Baum et al., 2003; Suzuki et al., 2002; Wu et al., 2003). This would lead to repopulation of the recipients by a mono/oligoclonal population of H S C s bound to trigger malignant transformation. In order to exclude this possibility, we analysed the composition of the H S C pool contributing to the high P B chimerism of these nonmyeloablated mice at very late time points post transplantation (19 months). 70  We showed through genomic proviral integration analysis of the DNA of progenitor cells derived from H S C s that the contribution to the H S C pool is from a highly polyclonal population of H S C s . This is in accordance with previous data in lethally conditioned mice where it was shown that the majority of the H S C s in the bulk B M culture are targeted by the retroviral vector carrying HOXB4 and are subsequently expanded with no preference (Antonchuk et al., 2002; Thorsteinsdottir et al., 1999). Although polyclonal hematopoiesis was documented, the risk of occurrence of malignant clones associated with this transduction procedure remains. In order for this strategy to be safely used in clinical settings, it would be recommended to transiently express the gene or to have the protein product delivered to the cells as a soluble factor over a defined period of time. To circumvent the retroviral integration approach, Krosl et al. tested recombinant human T A T - H O X B 4 protein carrying the  protein  transduction domain of the HIV transactivating protein (TAT) as a potential growth factor for stem cells (Krosl et al., 2003a). Experiments are in progress to test different systems to achieve transient expression of HOXB4. From the experiments presented in this chapter we can conclude that the behavior of H S C s expanded in vitro by HOXB4 is equal to fresh unmanipulated cells and that the yield of H S C s is highly beneficial for pre-clinical applications such as nonmyeloablative H S C T .  71  CHAPTER  4  ENHANCED  EX  VIVO  EXPANSON  OF  HSCs  A N D I M P R O V E D C H I M E R I S M IN N O N M Y E L O A B L A T E D M I C E U S I N G NUP98-HOXFUSION  GENES.  4.1 Introduction  In the previous chapter H O X B 4 was shown to provide an effective strategy for the  ex vivo expansion of H S C s to achieve enhanced levels of chimerism in  nonmyeloablated mice. A s reported in the literature and confirmed in the studies described in Chapter 3, H O X B 4 overexpression can yield ex vivo expansion of transduced H S C s to the order of 15 to 80-fold after 7 days ex vivo culture. Recent findings as reviewed in Chapter 1, section 1.4.4 now indicate that even greater levels of ex vivo H S C expansion can be obtained using the combined overexpression of H O X B 4 and knockdown of the Hox cofactor PBX1 (Krosl et al., 2003b) or the engineered expression of novel fusion proteins of Nudeoporin 98 and H O X B 4 or H O X A 1 0 (Ohta et al., 2007; Pineault et al., 2004). Indeed with both of these strategies, expansions of greater than 1,000-fold in 6 days are possible. In the studies reported in this chapter, the promising NUP98-HOX fusion genes were tested for their improved potency and utility in the context of ex vivo H S C expansion and transplantation in nonmyeloablated recipients.  72  4.2 Results  4.2.1 Ex vivo expansion of H S C s using NUP98-HOXB4 or NUP98-HOXA10 for transplantation in nonmyeloablated recipients  In order to determine the outcome of H S C T in nonmyeloablative conditions using more powerful H S C expanding factors, fusion genes of NUP98 and HOXB4 or HOXA10 (termed NUP98-HOXB4 or NUP98-HOXA10, respectively; see Figure 1.5) were introduced into primary murine B M using an MSCV-based retrovirus carrying the fusion gene c D N A upstream of an IRES-linked G F P selectable marker. Both fusions encode the N-terminal domain of NUP98 and the 60 amino acid homeodomain and limited flanking sequence as contained in the second exon (Lam and Apian, 2001; Moore, 2005; Pineault et al., 2004). Two separate experiments were performed using the same conditions. After the 4 day transduction procedure, the cells were kept in culture for an additional 6 days at which point the H S C content was assessed by limit dilution assay for C R U . The results of the measurements of H S C (CRU) frequency 1  before and after the elapsed 10 days in culture and the estimated levels of H S C expansion achieved are shown in table 4.1.  73  Table 4.1 CRU F R E Q U E N C Y  EXP2 (16 weeks PT)  EXP1 (24 weeks PT) Day of harvest  1/5040  1/6114  (1/8848-1/2871)  (1/9739 • 1/3838) Day 10GFP  < 1/319395  1/46969  < (1/860000 -1/118620)  (1/103897-1/21233)  1/47 (1/96 -1/23)  1/8 (1/16 -1/4)  Day 10 NUPB4  FOLD EXPANSION  Day10NUPA10 FOLD EXPANSION  (+/-S.E.)  769X  106X  >1/3 >(1/8 -1/1)  (1/10 -1/2)  1/5  1000X  >2000X  T h eC R U a s s a yc o n f i r m e dt h a tt h e H S Ce x p a n s i o na c h i e a c h i e v e d w i t h H O X B 4 , r e a c h i n g u p t o 7 0 0 f o l d o r 2 0 0 0 f o l di n c u l t u r e s o f HOXB4-  were  o r A / l / P 9 8 - / - / O X A 7 0 - t r a n s d u c e d c e l l s , r e s p e c t i v e l y . O n d a y 1  also transplanted into nonmyeloablated  mice. Mice were treated with 2Gy  a n d t r a n s p l a n t e d w i t h t h e p r o g e n y o f 8 , 0 0 0 o r 8 0 , 0 0 0 s t a r t i n gc e l l s .T h e P B was  NUP98-  monitored  for 4 months  in one  experiment. The pooled data are shown  experiment  and  for 7 months  TBI  chimerism  in a  second  in Figure 4.1.  74  A WBC 10°  10  •1„ 10  1  2  GFP  m 100  10  3  10  4  ii7';X\- v . v  :  10  " r-r-r-r,*. 10' 10'n-r 10"  GFP  10"  Q.  c o  +  Q. UL o  80  B  60 40  •cr  20  NUP98- NUP98- NUP98- NUP98G e n e 0t e s t e d HOXB4 HOXA10 HOXB4 HOXA10  Cells transplanted ( s t a r t i n g c e l l s )8K  80K  o r x  80K  B  RBC  i 10"  10'  21 10'  GFP  10°  10, 10"  10'  10'  GFP  10°  10*  Figure 4.1 Enhanced P B chimerism achieved using different fusion genes. (A)  R e p r e s e n t a t i v e flow c y t o m e t r y profile o f G F P c h i m e r i s m in t h e W B C c o m p a r t m e n t . D a t a f r o m o n e  e x p e r i m e n t w a s c o l l e c t e d at 4 m o n t h s p o s t t r a n s p l a n t a t i o n ( o p e n s q u a r e s ) w h i l e d a t a f r o m t h e s e c o n d e x p e r i m e n t w a s c o l l e c t e d at 7 m o n t h s p o s t t r a n s p l a n t a t i o n ( r e d s q u a r e s ) . In t h e s e two e x p e r i m e n t s 5 - F U B M c e l l s w e r e p r e s t i m u l a t e d in c y t o k i n e s for 2 d a y s a n d t r a n s d u c e d with o n c o r e t r o v i r a l v e c t o r s for 2 d a y s . A t t h e e n d o f t h e infection c e l l s w e r e kept in culture f o r a n a d d i t i o n a l 7 d a y s a n d t h e n t r a n s p l a n t e d in m i c e that w e r e (MSCV  p r e c o n d i t i o n e d with 2 G y . T h e v e c t o r s u s e d f o r t r a n s d u c t i o n w e r e  NUP98-HOXB4  ires G F P ) a n d N U P 9 8 - H O X A 1 0  (MSCV  NUP98-HOXA10  NUP98-HOXB4  ires G F P ) . In both  e x p e r i m e n t s 2 d o s e s o f c e l l s w e r e t r a n s p l a n t e d : t h e p r o g e n y o f 8 , 0 0 0 o r 8 0 , 0 0 0 original 5 - F U c e l l s . E a c h s q u a r e c o r r e s p o n d s to a m o u s e . E a c h a r m h a s a total o f 5 to 6 m i c e . T h e s o l i d h o r i z o n t a l l i n e s i n d i c a t e t h e a v e r a g e c h i m e r i s m in t h e different a r m s o f t h e e x p e r i m e n t . (B) T w o r e p r e s e n t a t i v e flow c y t o m e t r y profiles o f R B C s h o w i n g G F P c h i m e r i s m f r o m m i c e t r a n s p l a n t e d with t h e h i g h e r d o s e o f and  NUP98-HOXA 7 0 - t r a n s d u c e d  NUP98-HOXB4-  a n d e x p a n d e d c e l l s a r e s h o w n at t h e b o t t o m of t h e f i g u r e .  75  Mice transplanted with the lower dose of NUP98-HOXB4-  and  NUP98-HOXA10-  transduced and expanded cells, attained chimerism levels of 2 5 % (±16%) and 6 3 % (±19%) respectively. Mice transplanted with the higher dose of NUP98-HOXB4-  and  /VL/P98-HOX/470-transduced and expanded cells, reached even higher levels of chimerism (52% ± 9%; and 82% ± 13% respectively). The higher level of chimerism achieved with NUP98-HOXA10-transduced  cells at both transplant doses is consistent  with the higher magnitude of ex vivo H S C expansion documented for N U P 9 8 - H O X A 1 0 compared to NUP98-HOXB4. Moreover, both fusion genes enabled higher levels of chimerism compared to previous results with HOXB4, again consistent with the superior ability of either fusion to stimulate ex vivo H S C expansion (Figure 4.2).  76  80  200 cGy  70  S £ 60 |_  50  g|  40  | |  30  _ HQ 2 0 i 1  10 I Mill  CELL DOSE  1X10'  ESTIMATED CRU CONTENT  1X10*  1X10'  1X10  1  10  100  8  I  1X10  7  1000  I  I  llllll  1X10" 10000  Figure 4.2 Comparison between the chimerism achieved with grafts containing H S C s expanded by fusion genes and unmanipulated cells  Red squares identify the engraftment achieved in mice transplanted with N U P 9 8 H O X A 1 0 expanded cells; yellow squares identify the engraftment achieved in mice transplanted with NUP98-HOXB4 expanded cells. Diamonds represent the cell dose response of average B M engraftment in minimally ablated hosts as described in Figure 3.1. 4.2.2 A s s e s s m e n t of the H S C expanding potential of a fusion of NUP98 and only  the homeodomain of HOXA10 A fusion protein of NUP98 with only the homeodomain (hd) of HOXA10 was tested in limit dilution assays and it was demonstrated that the hd by itself fused to NUP98 is sufficient to trigger high levels of H S C expansion, as high as 1000-fold (Ohta et al., 2007). This fusion protein seems to be non-leukemogenic and has no apparent impact on in vivo lineage differentiation. I therefore tested this fusion protein in nonmyeloablated mice to prove that in addition to a dramatic increase in the quantity of HSCs  in culture,  it was also capable of preserving their  quality  for use in  nonmyeloablative settings. 77  In accordance with previous experiments, B M cells from mice previously treated with 5-FU were transduced with oncoretroviral vectors carrying the NUP98-HOXA10  or  NUP98-HOXA10hd fusion genes or a GFP control gene. After transduction cells were kept in culture for an additional 6 days at the end of which small portions of the culture were transplanted in nonmyeloablated mice that were treated with 2 G y TBI. A s in the experiments described in the previous paragraphs, the progeny of 8,000 or 80,000 starting cells was transplanted. Mice were analysed at 3 months PT. The P B chimerism achieved for both NUP98-HOXA10 and NUP-HOXA10hd was extremely high while mice transplanted with GFP-transduced cells did not show any chimerism. A major difference observed in this experiment, was the better contribution  of  transduced cells to the R B C chimerism in mice transplanted with NUP98-HOXA10hd expanded cells compared to mice transplanted with N U P 9 8 - H O X A 1 0 expanded cells (Figure 4.3A). All the lineages were represented in the peripheral blood although there was some skewing of transduced cells towards myeloid differentiation (Figure 4.3B). To confirm that the chimerism achieved with this fusion gene was superior to that achieved when HOXB4-transduced and expanded cells were used, the experiment was performed using the same experimental design but testing at the same time GFP-,  HOXB4-or  NUP98-HOXA10hd-transducedce\\s.  78  I RBC • WBC Ly5.1+ GFP+  Gene tested Cells transplanted (starting cells)  GFP 8  K  g  0  K  g  K  NUPA10 80K  • B220 " G r 1 /Mac-1  I  100% 80%  NUPA10HD 8K  CD4 CD8  60% 40%  80K  I  I  20% 0%  +  o  g  oo  §  8: P-  U~  ii  o ft 00  5&  < CL D  co o < QL D Z  00  < < i 5  So  1 a o  0  < <  |I z  o  00  Q I o  o 00  Q I  < < CL  D  CL 3  z  Figure 4.3 (A) P B chimerism of mice transplanted with NUP98-HOXA10- o r NUP98-HOXA?0/?d-transduced cells after ex wVo expansion. The chimerism is determined by the donor derived (Ly5.1+) GFP proportion of cells in the WBC compartment. Data was collected at 3 months post transplantation. 5-FU BM cells were prestimulated in cytokines for 2 days and transduced with oncoretroviral vectors for 2 days. At the end of the infection cells were kept in culture for an additional 7 days and then transplanted in mice that were pre conditioned with 2 Gy. In both experiments 2 doses of cells were transplanted. Five mice per arm received the progeny of 8,000 and three mice per arm received 80,000 original 5-FU cells. Red bars represent the GFP+ cells in the RBC compartment. Yellow bars represent the GFP+ cells in the WBC compartment. Mean engraftment and SD are shown. (B) Lineage distribution in the W B C compartment. The lineage distribution was assessed at 3 months post transplantation by flow cytometry analysis. WBC were stained with antibodies that detect B lymphoid cells (anti-B220PE) T lymphoid cells (anti-CD4CD8PE) and myeloid cells (anti-Gr1 PE and anti-Mad PE). The Y axis measures the proportion of lymphoid and myeloid cells in the whole or in the GFP+ proportion of the PB.  79  In Figure 4.4 the outcome of this comparison is shown. The engraftment achieved with the transplantation of the progeny of 80,000 starting cells was 17% ± 0.4% and 52% ± 3% for H O X B 4 and NUP98-HOXA10hd transplanted mice respectively and the engraftment achieved with the transplantation of the progeny of 260,000 starting cells was 24% ± 2 % and 73% ± 2%. To confirm that the transduced cells were expressing the H O X B 4 and NUP98-HOXA10hd proteins, western blot analysis was performed on B M cells and spleen cells of randomly selected mice from this experiment as shown in Figure 4.5 and 4.11.  100 90 80  + a., u. O  CN ID  • 8000 • 80000  70  260000  60 50 40 30 20 10 0  GENE TESTED  GFP  HOXB4  NUP98-HOXA10HD  Figure 4.4 Comparison of P B chimerism of mice transplanted with GFP-, HOXB4or /Vl/P>470/7C/-transduced cells. The chimerism is determined by the donor derived (Ly5.2+) GFP proportion of cells in the WBC compartment. Data was collected at 6 months PT. 5-FU BM cells transduced with oncoretroviral vectors for 2 days and kept in culture for an additional 7 days. Cells were then transplanted in mice treated with 2 Gy. Three doses of cells were transplanted. Three mice per arm received the progeny of 8,000, 80,000 and 260,000 original 5-FU cells. Mean engraftment and SD are shown.  80  H0XB4  m ag  BM  £ I" fe 8  CO  CO  Q.  0.  $  8  $  1  38KDa 28KDa  WB a-HOXB4 Figure  4.5 HOXB4 expression by B M cells of nonmyeloablated chimeric mice.  Representative western blot analysis documenting HOXB4 expression in BM cells of nonmyeloablated mice transplanted with the progeny of 260,000 starting cells transduced with HOXB4 and expanded in culture. Controls are HOXB4 virus producer cells (PG13B4).  In general, the engraftment  achieved in mice transplanted with  NUP98-  HOXAIOhd expanded cells is significantly higher than the engraftment achieved in mice transplanted with H O X B 4 expanded cells and this difference correlates with the different H S C expansion potential of these two genes. These findings were confirmed in two separate experiments. In one of these experiments a comparison between the engraftment achieved with non expanded and expanded cells transduced with HOXB4 or NUP98-HOXA10hd  demonstrated that the higher engraftment achieved at the end of  the in vitro culture is due to the enrichment in H S C s since the engraftment before expansion was minimal for both HOXB4 and NUP98-HOXA10hd (Figure 4.6)  81  Engraftment at 6 months PT with day11 expanded cells  Engraftment at 6 months PT with non expanded cells  100 90 80 O  60  20 10 0  —HI—  —4—  GFP  HOXB4  Figure 4.6 Comparison expanded cells.  — •  —  •  • 8000SC  100 90 80 70 60 50 40 30 20 10 •' 0 -.•  • 80000SC A260000SC  i f  :  NUP98-HOXA10 HD  GFP  of engraftment  achieved  U HOXB4  with  NUP98-HOXA10 HD  non expanded and  4.2.3 T h e progeny of limiting numbers of NUP98-HOXAfOftd-transduced  HSCs  subjected to ex vivo expansion can reconstitute a nonmyeloablated mouse  NUP98-HOXA10hd can stimulate over a three log expansion of H S C in culture and these cells can contribute to high level chimerism in nonmyeloablated recipients. A s a further test of the potency of NUP98-HOXA10hd to stimulate H S C expansion and of the quality of expanded H S C s , additional experiments were conducted in which B M cultures were initiated at limit dilution for H S C content and subjected to transduction. After the expansion, the progeny of these transduced and expanded H S C s were tested in both myeloablated and nonmyeloablated mice. In Figure 4.7 the experimental strategy is shown. In brief, 5,000 B M cells from mice previously treated with 5-FU were plated in a 96 well plate (estimated H S C content, 1-2 HSC/well), transduced with GFP or NUP98-HOXA10hd  and kept in culture for an additional 10 days. At day 14, half-well  content of two randomly selected wells was transplanted into nonmyeloablated mice while the rest of the cells were transplanted into myeloablated mice in limit dilution assay to measure the H S C content of the well at the time of transplant.  82  d -4  £1  d2  dO P restimulation  d 14  d4 Liquid  Infection  Culture  m l L - 3 , rilL-6, m S F NUPA10 H  5-FU  D  GFP 9 6 w e iI p l a t e  D A Y 14  5000 starting cells  v  900  n  cGy  CRU A S S A Y 1/20, 1/200, 1/2000  / O F NUPA10HD W E L L S 2500 S C 1  2  v  200 c G y  Figure 4.7 Experimental strategy used to achieve the transduction of one or two H S C s in wells containing limited numbers of 5-FU treated cells. 5,000 starting cells were inoculated into a single well of a 96 well plate, pre-stimulated for 2 days with cytokines and transduced with NUP98-HOXA10hd or GFP. At the end of 10 days culture, 2 wells were randomly chosen and half of each well transplanted in 2 Gy treated mice. The rest of the cells were transplanted in different proportions into lethally conditioned mice to assess the level of HSC expansion achieved during 10 days of culture.  In Figure 4.8 the P B G F P chimerism achieved in nonmyeloablated recipients is shown. A s indicated, the progeny of limiting numbers of H S C transduced with NUP98HOXAIOhd  were capable of giving high-level lympho-myeloid chimerism in the P B of  nonmyeloablated mice (40% and 35% at 6 months post transplantation respectively) (Yellow dots in Figure 4.8). These levels of chimerism are consistent with the high H S C content of wells documented by limit dilution assay (over 2,000 H S C s per well) (Red dots in Figure 4.8). Importantly, control GFP-transduced cultures started with 100,000  83  cells  and  mice  transplanted  with proportions of these  cultures,  did  not  achieve  significant chimerism (1-3%).  10  A  4  10»J  WBC mm 10°  10  10"  10'  1  10  10  10'  10"  2  3  )°  10*  10  10  1  10*  2  10'  RBC H  399 10°  10"  10  1  10  2  10  3  10*  GFP  GFP 100  B  90 +  80  1  70  Q  60  ^  50  8  40  ^  30  >» cn \j o o o CN  900cGy  •  (n \ZJ o o o CN  •  •  900cGy  •  o  • •  ®  20 10 0 STARTING CELLS PORTION  2500 250 25 25 2.5 2.5 2500 25 25 2.5 1/2  1/20  1/200  1/2000  1/2  1/200  1/2000  OF THE WELL  Well #1  Well #2  Figure 4.8 PB chimerism of mice transplanted with the progeny of o n e or two /Vl/Pi470/7d-transduced cell. (A) Flow cytometry profiles of the WBC and RBC compartment of mice treated with 2 Gy and transplanted with 2,500 starting cells transduced with NUPAIOhd and expanded in vitro for 10 days. (B) Summary of the PB WBC chimerism in nonmyeloablated and myeloablated mice. The graph represents the GFP chimerism in the WBC compartment. Data was collected at 6 months post transplantation.  84  The  reconstitution of the nonmyeloablated mice represented in Figure 4.8 was  lymphomyeloid and representative flow cytometry profiles of the lineage distribution in the P B is shown in Figure 4.9.  W E L L #1  WELL # 2  GFP Figure 4.9 Lineage distribution in the P B of mice transplanted with the progeny of few H S C s transduced with NUPAIOhd.  W B C were stained with antibodies that detect B lymphoid cells (anti-B220PE) T lymphoid cells (anti-CD4CD8PE) and myeloid cells (anti-Gr1PE and/or a n t i - M a d PE). The abscissa indicates the G F P fluorescence intensity and the ordinate indicates levels of detected expression for a particular cell surface lineage marker, B220 and C D 4 C D 8 for lymphoid cells, Gr1 (Ly6G) and M a d for myeloid cells. Data was collected at 6 months post transplantation. 85  B M was aspirated from one mouse at 7 months P T and plated in C F C methylcellulose assay. Twelve days later, colonies were visualized, plucked and put in culture for expansion. DNA was extracted from expanded clones and Southern blot analysis carried out to visualize the pattern of integration of the virus. Altogether D N A from 23 colonies was collected and analysed and five unique patterns identified (Figure 4.10). However, from careful observation of the size of the bands detected it seems that there are only two major patterns that acquired subsequent viral integrations arguing that the engraftment was contributed by at most two original H S C s . The results of western blot analysis performed on spleen cells from primary recipients additionally confirmed the expression of the integrated NUP98-HOXA10hd  MW  1  2  3  4  5  6  7  8  9  (Figure 4.11).  10 11 12 13 14 15 16  Figure 4.10 Composition of the H S C pool of a mouse transplanted with the progeny of few starting H S C s . Southern blot analysis of genomic DNA from C F C colonies derived from the BM of a mouse treated with 2 Gy and transplanted with the progeny of 2,500 starting cells. BM was aspirated from the primary recipient (Well #2, 2,500 starting cells, Figure 4.8), 7 months post transplantation. The bands visualized in the figure represent specific integrations of the retroviral vector. The numbers at the bottom of the red squares represent the frequency of appearance of a particular pattern of integration of the virus amongst the total of colonies/patterns analyzed.  86  NUPAIOhd Flag  #30  #31  #34  #75  56KDa —  WB a-NUP98 Figure 4.11 N U P A I O h d fusion protein expressed by the progeny of t r a n s d u c e d cells. Representative WB to assess the protein expression from spleen cells of mice transplanted with A/L/P/WOftd-transduced and expanded cells. Recipient mice 30, 31 were myeloablated with 9 Gy and transplanted with the progeny of 25 starting cells (well #1, Figure 4.8). Mouse 34 and 75 were treated with 2 Gy and received the progeny of 2,500 starting cells (well #2, Figure 4.8) and 260,000 starting cells (Figure 4.4) respectively.  Southern months  blot analysis from whole  BM  of lethallyirradiated mice collected at 7  P T c o n f i r m e d t h a t m a i n l y t w o c l o n e s c o n t r i b u t e d t h e r e c o n s t i t u t i o no f  these  mice transplanted at limitdilution (Figure 4.12).  87  o  100 90 + 80 Ck 70 UL s 60 " 50 o 40 > 30 ^ 20 10 0  w  CELLS  PORTION OF THE WELL  900cGy  900c6y  •  1  STARTING  O O O CO o CO CO o LO m CM i o LO CN CM CM  •  •  CM  •  #  ©  •  2500 250 25 25 2.5 2.5 2500 25 25 2.5 1/2  1/20  1/200  Welt #1  1/2000  1/2  1/200 1/2000  Weil #2  A/hole Bl\  Figure 4.12 Analysis of the composition of the H S C pool in the B M of lethally conditioned mice. Southern blot analysis visualizing the viral integrations in BM cells of recipients treated with 9 Gy and transplanted with small proportions of well #2 (the progeny of 25 and 2.5 starting cells) is shown. BM was collected 7 months PT. Whole BM from a nonmyeloablated mouse recipient of the progeny of 2,500 starting cells from the same well is also shown. BM from this mouse was collected 11 months PT. BM from this mouse collected at 7 months PT was used in clonogenic progenitor assay to produce the C F C colonies shown in Figure 4.10.  4.3 D i s c u s s i o n  Results presented in the previous chapter based on engineered overexpression of H O X B 4 provide proof of principle evidence that methods to expand H S C s in vitro are a potentially powerful strategy for increasing chimerism in nonmyeloablated transplant recipients. Findings reported in this chapter confirm and extend these conclusions through the demonstration of the remarkable potency of various N U P 9 8 - H O X fusions to stimulate even higher levels of ex vivo expansion compared to H O X B 4 with attendant improvements in chimerism. HOXB4- and /vl/P98-HOX-transduced cells performed equivalently (and to GFP control transduced cells) when transplanted immediately after  88  infection (i.e. without extended culture) thus arguing that their beneficial effect in the nonmyeloablative setting is dependent on extended culture and attendant ex vivo H S C expansion. This is further argued by the strong correlation between the demonstrated magnitudes of H S C expansion in vitro and resultant chimerism levels following transplantation of cultured cells. Such findings add to the evidence that chimerism levels in nonmyeloablative recipients is largely the result of the quantitative competition between transplanted  HSCs  and the endogenous surviving H S C s  and further  encourages the optimization and application of ex vivo H S C expansion strategies. In this light, the additional findings obtained using a N U P 9 8 - H O X fusion restricted to the 60 amino acid homeodomain of HOXA10 are of interest. N U P 9 8 HOXAIOhd retains the potency of NUP98-HOXA10 which has additional sequences flanking  the homeodomain. The potency of NUP98-HOXA10hd  is dramatically  illustrated by the demonstration of high level chimerism achievable with the progeny of cultures set up at or near limit dilution for H S C s . Moreover, for reasons not yet understood, in both the studies reported here and in previous studies in the ablated setting (Ohta et al., 2007), NUP98-HOXA10hd-i\-ansduced  H S C have  improved  functional characteristics as evidenced by heightened contribution to red blood cell production.  In our studies, again consistent with  HOXA10/?c/-transduced  previous  analyses,  NUP98-  cells, either without.or following ex vivo expansion did not  manifest any leukemogenic potential. Together these findings encourage further optimization and application of H S C expansion methods building on the potent properties of NUP98-HOXA10hd. In this regard the recent development of protein delivery methods to achieve H S C expansion with H O X B 4 (e.g. by production of T A T - H O X B 4 fusions) suggest that tests of TATNUP98-HOXA10hd fusion proteins will be of interest as a way to avoid genetic 89  manipulation  of target cells. The  such molecules on human  current results also should stimulate efforts to test  hematopoietic stem cells.  90  CHAPTER  5  EX  VIVO  E X P A N D E D H S C s IN T H E T R E A T M E N T  O F B E T A T H A L A S S E M I A IN N O N M Y E L O A B L A T I V E C O N D I T I O N S 5.1 Introduction  Thalassemia  and  Sickle Cell Disease  (SCD)  are widespread  genetic  blood  d i s o r d e r s t h a t a r e l i f et h r e a t e n i n g i f n o t t r e a t e d . T h e m o s t u s e d l i f e - s a v i n g t r e a t m e n t such pathologies is RBC RBC  with healthy  ones.  transfusions that allow for the replacement of malfunctioning This  repeatedly because the HSCs with defective RBC.  is a life-long treatment  that has  to be  performed  t h a t c a r r y t h e g e n e t i c m u t a t i o n k e e p r e p l e n i s h i n gt h e  responsible  replacement  PB  Blood transfusions carry the undesired side effect of iron overload  that require further treatment of the patient with iron chelating therapies. Since are  for  for perpetuating  the  disease,  a treatment  that  of such pluripotent cells with healthy ones, would  allows  allow for the  HSCs for  the  ultimate  cure of affected patients. The only curative treatment currently available is allogeneic HSCT,  but the successful outcome  of this procedure highly depends  general medical condition of the patient and between  the donor  and  of patients have  (Schrierand Angelucci, 2005). Furthermore, many are not suitable candidates for  of the advanced  status of the disease and because  of conventional myeloablative transplantationon  BM  that some  thalassemic and  people  myeloablative  r e l a t e d m o r b i d i t y a n d m o r t a l i t ya s s o c i a t e d w i t h m y e l o a b l a t i o n . R e p o r t s o n t h e  showed  a  and for unrelated donors the disease free survival has  affected by p-thalassemia or SCD transplantation because  and  histocompatibility match  the recipient. Unfortunately, only ~30%  suitable family donor of HSCs been reported to be 69%  an adequate  on the age  SCD  of the outcome patients  patientsdeveloped mixed chimerism (simultaneous presence in the  o f c e l l s o f d o n o r a n d h o s t o r i g i n )w i t h s o m e  patientshaving only 20%  donor cells. 91  Although mixed chimerism after H S C T is a risk factor for rejection, it was however .sufficient to resolve the thalassemic and S C D manifestations (Andreani et al., 2000; Walters et al., 2001). Consequently this observation led to the realization that even a less toxic conditioning regimen might be sufficient to achieve minimal  engraftment  decreasing the transplant related morbidity and mortality associated with myeloablative transplantation (Gaziev and LucareNi, 2005). The challenge in a nonmyeloablative transplantation  setting  is that H S C s  from the donor  have to outcompete  the  endogenous surviving population of H S C s of the recipient and to be able to achieve higher levels of mixed chimerism, the ratio of donor to host H S C s should be increased. Therefore, methods to achieve expansion of donor H S C s would be extremely beneficial in this setting. Over the past decade, many of the mutations causing blood disorders have been characterized at the molecular level. This has allowed for the development of gene therapy strategies by which a functional gene is transferred with viral vectors into the genome of H S C s from affected patients. These corrected H S C s are subsequently transplanted back to the patients, are capable of giving rise to the differentiated cells in the P B and are afterward potentially functional (Klein and Baum, 2004). Therefore another attractive treatment possibility for thalassemia and S C D would be autologous transplantation of genetically corrected H S C s , which would avoid the complications associated with histocompatibility mismatches between donors and recipients. This genetic approach has been considered since the early 1990s to treat blood genetic disorders such as severe combined  immunodeficiencies  (SCID) and  metabolic  diseases such as chronic granulomatous disease (Bordignon et al., 1995; CavazzanaCalvo et al., 2000; Ott et al., 2006) and is now increasingly considered for the treatment of hemoglobinopathies. The success of this genetic approach has been hampered by 92  technical difficulties. Amongst these is the difficulty to achieve sufficient gene transfer levels in H S C s , to achieve the appropriate regulation of the expression of the transferred gene, especially in the field of globin gene transfer (Sadelain, 2006) and the undesired integration of the transferred gene in or near oncogenic sequences leading to the development of malignant transformation  (Hacein-Bey-Abina et al., 2003).  Another major hurdle of gene therapy applications is the massive loss of H S C s caused by extended ex vivo culture required for the genetic modification. Nevertheless, there has been in recent years considerable progress in this field. Many studies in mouse models of B-thalassemia and S C D have now demonstrated, after many years of struggles with the optimization of viral vectors, the feasibility of permanently transferring a functional B-globin gene into the genome of H S C s of affected mice and stably expressing hemoglobin at a therapeutic level in R B C of reconstituted mice (Imren et al., 2002; May et al., 2000; Pawliuk et al., 2001). The number of cells transplanted in these mice was quite low but the amount of corrected H S C s retrieved at the end of the genetic manipulation was sufficient to achieve a therapeutic level of Hemoglobin A production in R B C and correction of the thalassemic or S C D phenotype. This was possible because a myeloablative treatment before H S C T was used. Unfortunately, if real patients affected by the same disorders were selected for gene therapy pre-clinical trials, very few would be eligible for conventional myeloablative H S C T . This is mainly because many of the patients affected by hemoglobinopathies are older patients and suffer from many of the devastating effects of the disease such as treatment-related organ damage due to prolonged exposure to iron overload (Gaziev and Lucarelli, 2005). In order for these patients to benefit from gene therapy applied to autologous H S C T , milder conditioning regimens have to be used but in such a setting, the major problem is that the modified population of H S C s have to out-compete the large endogenous 93  H S C population that is spared by the nonmyeloablative treatment. Therefore, methods to expand corrected H S C s after the in vitro manipulation would have a major impact and benefit in this field. A s shown in the previous chapters, engineered overexpression of H O X B 4 or N U P H O X fusion proteins offer a powerful strategy for expanding H S C s ex vivo and would offer major advantages in the recovery of H S C s if coupled to gene therapy protocols. In this chapter I have tested whether this approach would enable H S C s to be obtained in sufficient numbers and with retention of sufficient repopulating ability to obtain cures in nonmyeloablated mice with severe B-thalassemia caused by the homozygous deletion of the B-major globin gene (Goldberg et al., 1986; Skow et al., 1983). 5.2 Results  5.2.1  HOXB4  expanded  HSCs  contribute  to  high  level  chimerism  and  improvement of hematological parameters in the P B of nonmyeloablated p-MDD mice  Autologous  transplantation  of  genetically  corrected  HSCs  using  nonmyeloablative conditioning holds great promise for safely treating patients with hemoglobinopathies. This approach, however, is challenged by the large doses of H S C s required to achieve therapeutic levels of chimerism. Engineered overexpression of H O X B 4 offers a powerful strategy for expanding H S C s ex vivo. In these experiments, to model genetically corrected cells, day 4 5-FU B M cells were harvested from congenic healthy donors and transduced with an M S C V - H O X B 4 - I R E S - G F P virus. Cells were cultured for 10 days following transduction and the progeny of 200,000 starting  94  cells were transplanted into 3 B-thalassemic (B-MDD) and 4 normal recipients previously given 2 Gy. Figure 5.1 shows a schematic of the experimental design.  DAYO BM harvest  Transplant D A Y 14  INFECTION with HOXB4 ' 2d  EXPAND  Ur**r**«-*y*>J 2d 10 ng/ml hlL-6, 6 ng/ml mlL-3, 100 ng/ml mSF  500K S C day4 5-FU cells  ^  ^ DAYS  ( \ 200 c G v *  MDD 3 mice 2 f J 0 K  s t a r t  i g n  ce  ||s,  transduced with HOXB4 C57 4 mice 200K starting cells, transduced with HOXB4  200 cGy  'Ok  900 c G y  C57 1000SC C R U A S S A Y 500SC 100SC  4m ice 4mice 4m ice  Figure 5.1 Experimental strategy used to transplant p-MDD mice with H O X B 4 expanded H S C .  A s a control, 500,000 freshly harvested day 4 5-FU B M cells were transplanted into 4 similarly conditioned normal mice. Significant chimerism was not achieved in these mice (1-3% Ly5.1+ in W B C at 5 months). In contrast, all 4 normal recipients of ex vivo expanded HOX84-transduced cells exhibited stable, high level chimerism (21 ±6% G F P + W B C at 5 months). Significant chimerism was also achieved in all 3 B-MDD recipients (18-77% GFP+ R B C s at 10 weeks) (Figure 5.2) and, in 1 of these, the chimerism was sustained at a high level at 5 months PT (34% GFP+ W B C s and 52% 95  GFP+  R B C s ) . T h e s u s t a i n e d d o n o r d e r i v e d P B c h i m e r i s m a t 5m o n t h s p o s t t r a n s p l a n t  was also associated with substantial improvement 23%  in untreated B-MDD)  and hemoglobin  in the hematocrit level (36%  versus  production (10.5 g/dl versus 5g/dl) (Figure  5.3).  10 W E E K S  5 WEEKS  *1—1 it  H  25%  mI  •^44%  i©*  P-MDD1  P-MDD3  P-MDD2  21% ie?  J8*  #  sap  6-MD01  '#  f'  f  (J-MDD2  RBC (10* per mm*)  I »» 18% s>> »• P-MDD3  RBC (10* per mm*}  P-MDD3 P-MDD2 M4DD1 f>-MDD WT 10  20  30  40  50  0  10  20  30  40  SO  60  Figure 5.2 RBC GFP chimerism in B-MDD mice receiving HOXB4-transduced and expanded HSCs.  A n a l y s i s o f t h e P B w a s p e r f o r m e d a t 5 ( l e f ts i d e o f t h e f i g u r e ) a n d 1 0 of the figure) PT. Flow cytometry profiles in the top section of thi proportion of GFP+ transduced cellsin the PB. In the bottom side of thisfigure RBC numbers and hematocrit level is V a l u e s s h o w n a r e o f aW T m o u s e , a n u n m a n i p u l a t e d B - M D D m o u s e mice transplantedwith /-/OXB4-transduced and expanded HSCs. The that the hematocrit values and RBC numbers are withinnormal range  weeks (right side s figure show the  .  represented. and of the three asterisksindicate  96  PB SMEAR  RBC  WBC  Hemoglobin Hematocrit g/dl %  C57BI/6J  0  f  r  mm-  10°  10  1  10  2  10  3  10*  10°  10  1  10  2  10  10°  10  1  10  2  10  3  10*  10°  10'  10  2  10  3  o  10*  B-MDD 1  3  10'  18 16 14 12 10 8 6 4 2 0  •  B-MDD 2 miff- •  IP;, 34 10°  10*  10  2  10  3  10*  ft 10°  10  1  52 10  2  10  3  60 50 40 30 20 10 0  10*  • •  JJ  GFP Figure 5.3 B-MDDs PB chimerism, phenotype and hematological contributed by HOXB4-transduced and expanded H S C s .  parameters  B-MDD mice were transplanted with 200K starting cells /-/OXB4-transduced and expanded. This graph shows the chimerism and phenotype of the P B at 5 months post transplantation. The values for a W T mouse are also shown for comparison. Furthermore, correction of hematological parameters was evidenced by a significant elevation in R B C numbers as well as a dramatic reduction in reticulocyte numbers (down to 4 % from 25%). Morphologic examination of blood smears from this recipient  showed a marked improvement  in R B C anisocytosis (irregular  size),  poikilocytosis (irregular shape), and polychromasia (variation of the hemoglobin content of erythrocytes) and showed that more than 80% of the R B C s were normochromic (normal color) and normocytic (normal size and shape) (Figure 5.3).  97  5.2.2 PB chimerism in B-MDD mice is contributed by a polyclonal population of HSCs  When sequences  dealing with oncoretroviral transduction, insertion of the transgene w i t h o n c o g e n i c p o t e n t i a lc o u l d l e a d t o t h e e m e r g e n c e  of HSC  in  clones with  hyperproliferative capacity and to risk of malignant transformation. In the protocol  that  was  that  used for the experiments described in this and the previous chapters, clones  h a v ep o t e n t i a l l ya c q u i r e dh y p e r p r o l i f e r a t i v ec a p a c i t y ,c o u l dt a k eo v c u l t u r e o ft r a n s d u c e d c e l l s o r  in vivo,  a f t e r t r a n s p l a n t a t i o  h e m a t o p o i e s i s d e r i v e d f r o m o n l y o n e o rf e w c l o n e s e x p a n d d e t e r m i n e t h e c o m p o s i t i o n o ft h e H S C p o o l e x p a n d e d safety of this approach,  we  performed  proviral integration analysis on  methylcellulose progenitor colonies derived from the BM  of the B-MDD  individual  recipient that  had the highest chimerism throughout the experiment (Figure 5.4). 50% Chimeric recipient at 12 weeks PT  BM  1 GFP  1 colony/ well  Methylcellulose CFC assay  Expand  Proviral integration analysis on individual C  F  Figure 5.4 Experimental strategy used to assess proviral integrations in CFC colonies.  BM and was inte  of the chimeric plated in methy processed as grations through  B-MDD recip lcellulose CF described in Southern blot  At the time of aspiration(12 weeks  ient was aspirated at 12 weeks posttransplantation C assay. Genomic DNA derived from CFC colonies material and methods and analysed for proviral analysis. p o s t t r a n s p l a n t a t i o n )t h e c h i m e r i s m i n t h e B M o f t h i s  m o u s e w a s 5 0 % . D N A w a s e x t r a c t e d f r o m e x p a n d e d c l o n e s a n d S o u t h e r n b l o ta n a l y s i s allowed  us to establish the presence  of apolyclonal population of HSC  through  the 98  C  in  visualization of different patterns of integration of the virus in different clonogenic progenitors derived from unique H S C clones. Figure 5.5 shows a representative Southern blot showing different specific patterns of integration corresponding to different unique clones.  17 unique patterns / 53 total patterns  2  3 5 6 7 frequency of appearance  15  Figure 5.5 Chimerism in B-MDD mice receiving HOX64-transduced and expanded cells is contributed by a polyclonal population of H S C s .  In the top panel of this picture is a representative southern blot showing unique patterns of proviral integration. The bottom graph shows a summary of the frequency of appearance of different clones.  Altogether we identified 17 unique patterns/clones out of 53 colonies analyzed. The graph in the bottom part of Figure 5.5 shows a summary of the frequency of appearance of different clones. Only 7 clones were found more than once, while the  99  majority (10 clones) was found only once. This indicates that the population of H S C s contributing to the hematopoiesis was polyclonal and that multiple transduced H S C s were expanded in the culture with similar probabilities with few clones expanded with higher rate. 5.2.3 Retroviral integration site analysis confirm the uniqueness of H S C s clones  To  further  confirm  that different  bands visualized in the  Southern  blot  corresponded to specific integrations in different sites of the genome and to identify the sequences in the genome where they integrated, linker mediated amplification of retroviral integration sites was performed by Patricia Rosten, as described in chapter 2. This technique allows identification of specific sites of integration of the retroviral vector in the genome. This analysis allowed us to identify 21 unique integations from 14 clones (Figure 5.6).  100  mm  .'• .  ABCDEFGH  I  |  •  1 "• • |||'  LMNOPQRS  Identity of MSCV H0XB4 IRES GFP integration sites Accession n. Chromosomal band 11qE2 NM_013672 NM_029640.1  15qF3 15qD3  Ref Seq gene name  Proposed function  intergenic  -  "Promoter of Sp1 NIK IKK (beta) bp isoform 1  Proviral Site of ntegration (bp) integration* 119,742,337  -  TF  102,232,889  R  B  adaptor protein  72,799,478  R  C  Kinase  18,880,992  R  -  43,202,242  -  C C  51,468,061  F  63,448,410  -  A  NM_008845.2  2qA3  Plp5k2a  -  13qA4  intergenic  -  3qC  mRNA AK042136  -  15qD1  intergenic  NM_026353.2  15qF1  4930570C03Rik  unknown  97,615,464  R  NM_027900.3  10qD3  R3hdm2  F  12qC3  Nucleic acid binding  126,885,153  Zbtb25  77,285,581  F  "Promoter of Lnfg Transferase  140,850,726  -  23,478,146  F  157,852,628  -  49,865,995  F  NM_028356.1 NM_008494.2  5qG2  NM_011295  10qA3  -  2qH1  "Promoter of Rps12 intergenic  unknown -  Rbpt  -  NM_013632  14qC1  NM_021419  17qA3.3  Rnf8  ligase  29,123,276  F  NM_008112.4  13qA1  "Promoter of Gdi2  inhibitor  3,536,981  F  -  2qE1  intergenic  -  90,413,818  -  NM_001033279  17qA3.3  D17Wsu92e  unknown  27,512,018  R  -  2qA3  intergenic  -  24,986,913  -  NM_026350  8qC3  87,164,202  F  136,864,925  -  -  6qG1  "Promoter of Pnp Transferase  " Promoter of Cede! 30 unknown intergenic  -  D D E E E F L L H M  O  P  Q  R R  S  "With respect to transcriptional direction of the gene (F) Forward (R) Reverse •"Integration happened up to 10Kb upstream of a gene  Figure 5.6 Identity of the sites of integration of the M S C V H O X B 4 IRES G F P vector  The top panel shows the Southern blot and the clones that have been selected for proviral integration site analysis in red boxes. Each clone is also identified with aletter. The bottom table shows the exact locationof the siteof integrationin the genome. 101  Roughly, 30% of the integrations were intergenic, 30% were in introns of genes and 30% were in promoter regions (these included integrations up to 10Kb upstream of a gene). Of the genes in which the integration occurred, only 5 had known functions, while the others are still uncharacterized. The integration of the vector in different sites of the genome confirms that the chimerism is contributed by a polyclonal population of cells.  5.2.4 NUP98-HOX expanded HSCs contribute to high level chimerism and cure of nonmyeloablated MDD mice A s a further test of the utility of ex vivo expanded H S C s , another experiment was carried out using the more potent NUP98-HOXA10hd gene to stimulate high level expansion prior to transplantation. Day 4 5-FU B M cells were harvested from congenic healthy donors and transduced with an M S C V - N U P A 1 0 h d - I R E S - G F P virus. Cells were cultured for 7 days following transduction and the progeny of 300,000 starting cells were transplanted into 2 B-MDD and 4 normal recipients previously given 2 Gy. A s a control, 500,000 freshly harvested day 4 5-FU B M cells were transplanted into 4 similarly conditioned normal mice and these mice as in the previous experiment, did not achieve significant chimerism ( 2 % ± 1 % Ly5.1+ in W B C at 5 weeks post transplantation). In contrast, all 4 normal recipients of ex vivo expanded NUP98-HOXA10hd -transduced cells exhibited stable, high level chimerism (50±4% GFP+ W B C at 5 weeks). Significant chimerism was also achieved in 2 B-MDD recipients (84-82% GFP+ R B C s at 5 weeks) and, in both of these, the high chimerism resulted in cure of the thalassemic phenotype and in the correction of hematologic parameters to normal range (Figure 5.7). Limit dilution assay quantification of H S C s at 14 weeks post transplantation, confirmed that  102  there was a 700-fold increase in H S C s in the culture after 10 days of ex vivo expansion and the H S C frequency on day 10 was 1 in 7 with a range of 1/14-1/4. RBC  WBC  PB SMEAR  C57  o% 10  IO  to  10  MOD  NUP98HOXA10HD MDD #1  48%  C57  NA10HD HUM  NA10HD MOD#2  84% Hematoa«% 0  NUP98HOXA10HD» MDD #2  10  10 '  10 •  32%  m  to  s  to  82% MDD  10  10  10  C57  NA10HD MDD#1  NA10HD MDDS2  10  GFP  Figure 5.7 6-MDDs PB chimerism, phenotype and hematological parameters contributed by NUPA1 Ohd-transduced and expanded HSCs. B-MDD mice were transplanted with 300K starting cells NUPAIOhd transduced and expanded. This graph shows the chimerism and phenotype of the P B at 5 weeks post transplantation. The values for a WT and a B-MDD mouse are also shown for comparison. The asterisks indicate that the hematological parameters of the two treated mice are within normal range.  5.3 Discussion The data presented in this chapter provides proof of principle evidence that expansion of H S C s in vitro is a powerful strategy that can be coupled to gene therapy protocols for the treatment of inherited blood disorders. To model the situation of a minimal number of genetically corrected cells retrieved at the end of genetic manipulations, congenic cells from healthy donors were used and transduced with HOXB4 or NUP98-HOXA10hd,  expanded in culture for 10-11 103  days and then the progeny of a small number of starting cells transplanted into nonmyeloablated thalassemic recipients. This initial amount of H S C s used in these experiments is comparable to that retrieved in the end of gene therapy  related  manipulations therefore this study potentially shows the benefit of inducing H S C expansion  in vitro to achieve sustained  stable  mixed  chimerism  in  vivo in  nonmyeloablated recipients. W e expanded 200,000 and 300,000 starting cells, which roughly contains 40 and 60 H S C s before the expansion. From the curve shown in Figure 3.1 it is evident that this amount of H S C s would produce very minimal chimerism in mice that received 2 G y TBI pre-transplantation. Instead, our experiments showed that W B C chimerism as high as 34% and R B C chimerism as high as 52% could be achieved  in  mice  transplanted  with  the progeny  of 200,000  starting  cells  overexpressing H O X B 4 and as high as 4 8 % and 8 0 % W B C chimerism and R B C chimerism respectively with the transplantation of the progeny of 300,000 starting cells overexpressing NUP98-HOXA10hd. In both experiments this high P B chimerism produced dramatic improvement of the hematologic parameters and in the case of NUP98-HOXA10hd cure of the thalassemic phenotype. This is likely a reflection of the higher H S C expansion obtained with NUP98-HOXA10hd as opposed to H O X B 4 . In the study presented in this chapter and in gene therapy manipulations as well, retroviral vectors are generally used for the delivery of genes. Oncoretroviral vectors carry the risk to integrate near or within important cellular regulatory genes that might give them a selective growth advantage (Hematti et al., 2004; Kustikova et al., 2005). During the ex vivo culture these clones might outcompete the other H S C clones leading to a monoclonal reconstitution in vivo. In order to demonstrate that in the thalassemic mouse treated with H O X B 4 overexpressing cells there is not such an occurrence and the H S C pool is polyclonal we analysed the pattern of integration of the virus in 104  clonogenic progenitor cells derived from different H S C s . We were able to identify 17 unique patterns out of 53 colonies analysed meaning that the chimerism at 12 weeks post transplantation, was contributed by at least 17 unique H S C clones. Recently it has also been shown in patients of X-linked chronic granulomatous disease treated by gene therapy and non myeloablative H S C T that the chimerism achieved was contributed by clones that preferentially proliferated due to activating integrations in genes (Ott et al., 2006). In order to confirm that the cure of the thalassemic mouse transplanted with H O X B 4 overexpressing cells was not influenced by fortuitous integrations in genes that affect cell proliferation, we performed linkermediated amplification of retroviral integration sites (see material and methods for details) which allowed us to determine the identity of the site of integration of the vector. Among the 21 unique sites identified, one third were intergenic, one third were in promoter regions and one third were intragenic sequences. None of the genes in which the vector integrated have been implicated in malignant transformation according to published reports, although it is interesting to notice that one clone that was found with high frequency carried an integration in the upstream region of the gene coding for the TF Sp1 (Du et al., 2005; Suzuki et al., 2002). Altogether, these data demonstrate the curative potential of ex vivo expanded HSCs  in  a  preclinical model of  B-thalassemia treated  with  nonmyeloablative  conditioning. They also underscore the potential of H O X B 4 and N U P H O X A I O h d as potent tools to achieve the H S C expansion required.  105  CHAPTER 6  DISCUSSION  BMT is a procedure that allows for the treatment and cure of a variety of blood disorders ranging from malignant to inherited blood disorders. It was pioneered in the fifties by E. Donnal Thomas (Thomas et al., 1959) and relies on the replacement of abnormal blood forming cells of the affected patient with ones from healthy donors. Its clinical use has become increasingly more widespread in the last few decades due to better understanding and management of the complications associated with it, to increased availability of screening techniques for matching donors and recipients and to better understanding of the population of cells responsible for the reconstitution of the whole hematopoietic system, the H S C s . Currently, the major complications associated with BMT are the immune histocompatibility differences between the donor and the recipient of the graft that can lead to fatal G V H D reactions or engraftment failure, and the regimen related morbidity and mortality. Conventional B M T is associated with elevated toxicity because of the intense myeloablative chemotherapy and/or radiotherapy conditioning given to patients before the procedure. These regimens lead to the depletion of the hematopoietic system and create space for the transplanted cells to engraft but can produce several undesired side effects, such as infertility, neurodevelopmental effects, impaired growth, endocrine dysfunction and secondary malignancy. To decrease the toxicity and broaden the applicability of this procedure to older patients and those whose health is compromised by comorbid conditions, mildly ablative or nonmyeloablative regimens have been tested for their potential and applicability (Baron and Storb, 2006). From studies in mice, large animals and humans it emerged that because of the competition provided by the cells spared in the recipient, engraftment from donor cells would be possible only if the ratio of donor 106  to recipient cells was increased. In particular, it was observed that by increasing the number of H S C s transplanted, the chimerism in the P B of patients would consequently improve, the recovery time would be faster and the chances of a successful outcome would be higher. Obtaining substantial numbers of H S C s from donors is not always an easy task; consequently ways to achieve H S C expansion would be highly beneficial. In this thesis, I present data on the applicability of H S C s expansion strategies in a mouse model of nonmyeloablative BMT. I evaluate the potential of H S C s expanded in vitro by the overexpression of H O X B 4 or NUP98-HOX fusion proteins to maintain the capacity to long-term engraft nonmyeloablated mice and to properly differentiate into lineages with lymphoid and myeloid features. Additionally I present findings on the treatment and cure of an important model of a genetic blood disorder in nonmyeloablative conditions with such expanded H S C s .  6.1 HOXB4 HSCs induced in vitro expansion for nonmyeloablative HSCT A s of today, many strategies have been attempted to achieve H S C expansion in vitro for clinical applications. These rely on two main approaches. One is the manipulation of the environment by addition of different cytokines and the second is to genetically manipulate cells by insertion of genes. Both strategies aim at triggering maintenance of sternness and self-renewal after cell division. While the former strategy has been shown to lead to only modest expansion, strategies that make use of retroviral vectors for the genetic manipulation of H S C have been more successful. O n e of the genes tested is the human HOXB4 (Sauvageau et al., 1995). H O X B 4 is a T F that plays an important role during development but is also involved in H S C regeneration in situations of stress. It has been shown to trigger in vitro up to 40 fold expansion when overexpressed in H S C without impairing  normal proliferation  and differentiation 107  (Antonchuk et al., 2002). t h e s e features make it a good candidate to test in nonmyeloablative H S C T where the prediction is that transplantation of grafts containing increased numbers of H S C s will achieve better chimerism in the nonmyeloablated recipients (Rao et al., 1997). The questions that I addressed in this thesis are about the quality and the quantity achieved after expansion. Due to the extensive in vitro manipulations, it was conceivable that expanded H S C s would not behave like fresh H S C and this would correlate with poor competition with the endogenous H S C s spared in the nonmyeloablated recipient. Additionally, in conventional myeloablative BMT, different inflammatory cytokines are released as a response to the irradiation stress and tissue damage and these might help the transplanted H S C s to proliferate and find their way to the B M while in nonmyeloablative H S C T this cytokine storm would not take place. In the experiments presented in this thesis, I show that the transplantation of the expanded progeny of limited numbers of initial H S C s leads to significantly greater level of chimerism than would be achieved with the original non expanded cells. From previous experiments conducted by Ben Cavilla, it emerges that in order to detect any chimerism in mice that received a nonmyeloablative radiation of 2 Gy, 500,000 fresh B M cells (that contain roughly 50 HSCs) have to be transplanted. By contrast, in one of my experiments, I was able to achieve up to 50% chimerism with the in vitro expanded progeny of 50 starting H S C s . The reconstitution was lymphomyeloid and sustained for up to 19 months. This finding was confirmed in multiple experiments and it established that the quality of expanded H S C was preserved and the quantity achieved after the expansion was highly beneficial. When dealing with high-level in vitro H S C expansion, a possibility exists that few original clones are aberrantly transformed and are taking over the whole H S C culture because of acquired mutations and consequent aberrant proliferation. This could be 108  partly due to the insertion of the oncoretroviral vector in oncogenic sequences that lead to deregulated proliferation. To exclude this possibility, I assessed the constitution of the H S C pool in chimeric animals that received a nonmyeloablative irradiation dose of 2 Gy by analyzing the patterns of integration of the oncoretroviral vector in progenitor cells clonally derived from H S C s . Different H S C s will carry different integrations of the virus in specific sites of the genome and since this integration pattern is unique for each H S C clone, the variety of patterns of integrations indicates how many H S C contributed to the chimerism. I performed this analysis in three different recipients at 19 months post-transplantation  and found that in all three cases the population of H S C  contributing to the P B chimerism was highly polyclonal excluding the possibility of a pre-leukemic transformation in few selectively expanded H S C clones. H O X B 4 overexpression has also been reported to have an effect on H S C in vivo in myeloablated mice, by restructuring the H S C pool to normal numbers after transplantation while normal H S C are capable to reconstitute only 10% of the normal H S C pool of a mouse (Thorsteinsdottir et al., 1999). There are no previous reports on the in vivo effect of H O X B 4 overexpression in nonmyeloablated mice and I therefore assessed if in this setting a further H S C expansion was possible. Two of the primary recipients were assessed for their donor  H S C content  12 to 15 times  post  transplantation and by limit dilution assay it was possible to show that in addition to the almost 2 logs expansion in vitro, these cells expanded also 1 log in vivo. Of great interest was the observation that the contribution from donor H S C to the H S C pool correlated with the donor chimerism in the P B . Additionally, while one of the two analyzed recipients had the donor H S C contributing to half of the H S C pool of the recipient mouse, the second mouse that received the lower dose of H S C had the donor H S C contributing to 10% of the H S C pool. The fact that in this recipient H S C s did not 109  proliferateto reach the normal s i t u a t i o n s .O n e  HSC  is that the HSCs  range  could be  because  of three different  have finallyexhausted theirexpansion  c a n n o t p r o l i f e r a t ea n y f u r t h e r . T h e s e c o n d  is that there are some  potential and  feedback  signals  f r o m t h e B M e n v i r o n m e n t o f n o n m y e l o a b l a t e d m i c e t h a t b l o c k t h e f u r t h e r p r o l i f e r a t i o no f these  HSCs  occupied  and athird related reason by recipient HSCs  donor HSCs.  therefore there is no need  for further proliferation from  of these issues were  recipients.Since itis known compartment  that HOXB4  HSCs  into myeloablated  overexpressing  cells are  of myeloablated mice to normal numbers,  stillhave proliferativepotentialthen in this setting they would be able to  it.The  third hypothesis  secondary  could be addressed  recipients with alimit dilution  HSCs  and  capable if donor manifest  by quantifying the recipient HSCs  in  assay.  Altogether this data confirmed that HOXB4 fresh  investigated,the first hypothesis  b y t r a n s p l a n t a t i o no f t h e s e e x p a n d e d  to restore the HSC HSCs  niches of the recipient are  Although none  could be addressed secondary  is that the HSC  expanded  are a useful tool for achieving  cells maintains features of  high levels of PB  chimerism  in  n o n m y e l o a b l a t i v e B M T / H S C T . 6.2 Expanded HSCs for the treatment of p-Thalassemia in nonmyeloablative conditions  Many suffer many organ risk  patientsaffected by genetic blood disorders such as  health complications associated with long-term transfusion treatments  damage. of  hemoglobinopathies  These  mortality  Nonmyeloablative  patients affected by multiple comorbid  if they HSCT  are  put  through  transplantationof higher HSC  conditions have  a high  myeloablative  BMT.  patients but requires  the  conventional  is a safer alternative for these numbers, thereforeHSC  and  expansion strategieswould 110  be  highly beneficial for the treatment of these diseases in non myeloablative conditions. Additionally, H S C T is the only curative option for many inherited blood disorders but despite the world registry network, which includes more than 3 million volunteers characterized for their histocompatibility markers, about 40% of patients still fail to find a suitably matched donor. This makes allogeneic H S C T a risky procedure with high chances of immune complications and potential rejection of the graft. Autologous H S C T coupled to gene therapy protocols is a safer option since it relies on the transplantation of patient's own H S C s that have been genetically modified to correct the original genetic defect. However, the recovery of corrected H S C s expressing sufficient levels of the therapeutic protein in the end of the transduction protocol is minimal and definitely not  sufficient  transplantation  for  transplantation  of H S C s  in  nonmyeloablated  recipients.  Hence,  the  expressing a therapeutic gene and expanded by the  overexpression of H O X B 4 would be greatly beneficial. In the experiment presented in this thesis, to model genetically corrected cells, healthy donor cells were transduced with HOXB4, expanded in vitro and transplanted in nonmyeloablated mice with severe B-thalassemia caused by the homozygous deletion of the B-major globin gene. With this system, we were able to demonstrate that H S C expansion strategies could lead to the improvement of the phenotype of sick mice by increasing the contribution by healthy cells to the P B chimerism. To exclude the possibility that the contribution was from a clone that was transformed and hyperproliferative I analyzed the B M of a mouse that exhibited high P B chimerism and through the visualization of unique patterns of integrations in clonogenic progenitors demonstrated that the high P B chimerism was contributed by a polyclonal pool of expanded H S C s .  111  Recently, in two patients who received gene therapy for the treatment of X linked chronic granulomatous disease coupled to nonmyeloablative bone marrow conditioning, it was found that the therapeutic effect was enforced by the integration of the retroviral vector in genes that gave a proliferative advantage to the corrected cells (Ott et al., 2006). Although this did not lead to overt malignant transformation, concerns were raised about the safety of this procedure. Therefore, to investigate if the same situation applied to our nonmyeloablated mice, we analyzed the different sites in the genome where the retroviral vector integrated. We were able to identify 21 unique integrations from 14 different clones. Of these, roughly one third were in promoter regions, one third were intergenic and one third were in introns of genes. Many of these genes are not characterized yet and the ones that are, have not been reported to be implicated in malignant transformations (Kustikova et al., 2006). Independently of the results achieved in these experiments it would be safer to avoid the genetic manipulations, therefore studies are ongoing to optimize transient delivery of H S C expanding factors.  6.3 NUP-HOX fusion genes to achieve higher levels of HSC expansion in vitro Despite the striking H S C expansion obtained with HOXB4, many studies are ongoing to understand the mechanism of H S C self-renewal to further identify the genes that are responsible for triggering this process. Some of the genes so far implicated have been identified in part from for their involvement in leukemic transformation. Recently Pineault er al. characterized the biologic effect of some fusion proteins composed by the N-terminal portion of the Nucleoporin 98 and the C terminal portion of H O X proteins (HOXA10 or HOXB4) in hematopoietic cells and he observed that they were capable to expand short term repopulating cells and block differentiation (Pineault 112  et al., 2004). Subsequently, Ohta et al. tested these same fusion proteins for their H S C expansion potential and observed up to 1000-fold H S C amplification when these fusion proteins were overexpressed in H S C s . Since from different studies performed in nonmyeloablated mice in the last few decades it has emerged that the higher the amount of H S C transplanted, the higher the chimerism achieved, we tested H S C s expanded by these genes for their repopulation capacity in nonmyeloablated recipients. With these genes we were able to explore a wider range of H S C expansion and transplantation doses for nonmyeloablative HSCT. In the experiments presented in this thesis I was able to show that further expansion of H S C s gave rise to a significantly higher P B chimerism. The reconstitution in all mice tested was lymphomyeloid and sustained for up to 15 months PT. Of great interest was the observation that H S C s expanded clonally from few starting H S C s by a fusion gene carrying NUP98 and the homeodomain only of the HOXA10 gene were capable of significantly contributing to the P B chimerism of nonmyeloablated mice. This would lead to major clinical benefit when using genetically modified H S C s since it would allow for pre-screening of clones and identification of those that have safe genetic integrations. With the availability of such powerful H S C expanding factors, I further assessed if the improved chimerism in nonmyeloablated mice would help the prompt recovery and cure of mice affected by a genetic blood disorder such as B-thalassemia. A s mentioned above, in gene therapy applications coupled to autologous H S C T there is the urgency to expand corrected H S C s prior to transplantation. The remarkable H S C expansion achieved with NUP98-HOX fusion genes allowed us to obtain prompt therapy and cure of two nonmyeloablated thalassemic mice which had all the hematologic parameters within normal range.  113  6.4 Unanswered questions and future directions The findings presented in this thesis add evidence in support of the hypothesis that the final chimerism in a nonmyeloablated recipient highly depends on the ratio of donor to recipient H S C s . The experiments described in this thesis were conducted in a murine system and no reports are available at this point on the effect of H S C expansion • strategies  in  non-human  large animal  models  in  nonmyeloablative  conditions.  Therefore studies are needed to confirm the findings in mice to higher models closer to the human system. To confirm and extend the findings in mice on H O X B 4 mediated H S C expansion to. the human system for possible future clinical applications, H O X B 4 is under intense study in human and in nonhuman primate models. Current evidence indicates that the ability of H O X B 4 to promote expansion of H S C extends to human, dog and non human primates. While the levels of expansion so far achieved appear to be somewhat less than observed in the murine model, the findings encourage further testing and optimization of H O X B 4 and even more potent molecules such as NUP98-HOXA10hd as described here.  In gene therapy applications the use of retroviral vectors for the  delivery of genes has emerged as an unsafe procedure with the associated risk of insertional mutagenesis. Furthermore, it is not clear what the long-term effect on H S C could be, especially of genes that trigger H S C proliferation. For this reason, better methods for the transient expression of genes or for the transient delivery of proteins have to be engineered. To this end, a fusion protein of H O X B 4 with the protein transduction domain of the HIV transactivating protein (TAT) has been produced and tested as a potential growth factor for stem cells (Krosl et al., 2003a). This strategy has avoided the potential risk of insertional mutagenesis but the effect documented on  114  murine H S C s was low. Work is in progress to improve the stability of this protein and efficacy of this delivery system. Furthermore the TAT fusion with NUP98-HOXA10hd is also being produced and shortly will be tested in our laboratory for its biologic effect on hematopoietic cells. It is my hope that the findings described in this thesis help further  the  understanding of the dynamic of engraftment in nonmyeloablative H S C T . The efforts put into finding H S C strategies for future clinical applications will allow for better use of different H S C sources such as U C B and will hopefully lead to safer H S C therapies for the treatment of inherited blood disorders.  115  CHAPTER 7  REFERENCES  Adolfsson, J . , Mansson, R., Buza-Vidas, N., Hultquist, A., Liuba, K., Jensen, C. T., Bryder, D., Yang, L., Borge, O. J . , Thoren, L. A., et al. (20G5). Identification of Flt3+ lympho-myeloid stem cells lacking erythro-megakaryocytic potential a revised road map for adult blood lineage commitment. Cell 121, 295-306. Akala, O. O., and Clarke, M. F. (2006). Hematopoietic stem cell self-renewal. Curr Opin Genet Dev. Akashi, K., Traver, D., Miyamoto, T., and Weissman, I. L. (2000). A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature 404, 193-197. Allay, J . A., Persons, D. A., Galipeau, J . , Riberdy, J . M., Ashmun, R. A., Blakley, R. L , and Sorrentino, B. P. (1998). In vivo selection of retrovirally transduced hematopoietic stem cells. Nat Med 4, 1136-1143. Amsellem, S., Pflumio, F., Bardinet, D., Izac, B., Charneau, P., Romeo, P. H., DubartKupperschmitt, A., and Fichelson, S. (2003). Ex vivo expansion of human hematopoietic stem cells by direct delivery of the HOXB4 homeoprotein. Nat Med 9, 1423-1427. Anderson, W. F. (1992). Human gene therapy. Science 256, 808-813. Andreani, M., Nesci, S., Lucarelli, G , Tonucci, P., Rapa, S., Angelucci, E., Persini, B., Agostinelli, F., Donati, M., and Manna, M. (2000). Long-term survival of ex-thalassemic patients with persistent mixed chimerism after bone marrow transplantation. Bone Marrow Transplant 25, 401-404. Antonchuk, J . , Sauvageau, G., and Humphries, R. K. (2002). HOXB4-induced expansion of adult hematopoietic stem cells ex vivo. Cell 709, 39-45. Appelbaum, F. R. (2003). The current status of hematopoietic cell transplantation. Annu Rev Med 54, 491-512. Arai, S., and Klingemann, H. G . (2003). Hematopoietic stem cell transplantation: bone marrow vs. mobilized peripheral blood. Arch Med R e s 34, 545-553. Audet, J . , Miller, C. L , Rose-John, S., Piret, J . M., and Eaves, C. J . (2001). Distinct role of gp130 activation in promoting self-renewal divisions by mitogenically stimulated murine hematopoietic stem cells. Proc Natl Acad Sci U S A 98, 1757-1762. Balazs, A. B., Fabian, A. J . , Esmon, C. T., and Mulligan, R. C . (2006). Endothelial protein C receptor (CD201) explicitly identifies hematopoietic stem cells in murine bone marrow. Blood 707, 2317-2321.  116  Baron, F., and Storb, R. (2006). Allogeneic hematopoietic cell transplantation following nonmyeloablative conditioning as treatment for hematologic malignancies and inherited blood disorders. Mol Ther 13, 26-41. Baum, C , Dullmann, J . , Li, Z., Fehse, B., Meyer, J . , Williams, D. A., and von Kalle, C. (2003). Side effects of retroviral gene transfer into hematopoietic stem cells. Blood 101, 2099-2114. Baum, C. M., Weissman, I. L , Tsukamoto, A. S., Buckle, A. M., and Peault, B. (1992). Isolation of a candidate human hematopoietic stem-cell population. Proc Natl Acad Sci U S A 89, 2804-2808. Berenson, R. J . , Andrews, R. G., Bensinger, W. I., Kalamasz, D., Knitter, G., Buckner, C. D., and Bernstein, I. D. (1988). Antigen CD34+ marrow cells engraft lethally irradiated baboons. J Clin Invest 81, 951-955. Bhardwaj, G . , Murdoch, B., W u , D., Baker, D. P., Williams, K. P., Chadwick, K., Ling, L. E., Karanu, F. N., and Bhatia, M. (2001). Sonic hedgehog induces the proliferation of primitive human hematopoietic cells via B M P regulation. Nat Immunol 2, 172-180. Bhatia, M., Bonnet, D., Kapp, U., Wang, J . C , Murdoch, B., and Dick, J . E. (1997a). Quantitative analysis reveals expansion of human hematopoietic repopulating cells after short-term ex vivo culture. J Exp Med 186, 619-624. Bhatia, M., Bonnet, D., Murdoch, B., Gan, 6. I., and Dick, J . E. (1998). A newly discovered class of human hematopoietic cells with SCID-repopulating activity. Nat Med 4, 1038-1045. Bhatia, M., Wang, J . C , Kapp, U., Bonnet, D., and Dick, J . E. (1997b). Purification of primitive human hematopoietic cells capable of repopulating immune-deficient mice. Proc Natl Acad Sci U S A 94, 5320-5325. Bhattacharya, D., Rossi, D. J . , Bryder, D., and Weissman, I. L. (2006). Purified hematopoietic stem cell engraftment of rare niches corrects severe lymphoid deficiencies without host conditioning. J Exp Med 203, 73-85. Biji, J . , Thompson, A., Ramirez-Solis, R., Krosl, J . , Grier, D. G . , Lawrence, H. J . , and Sauvageau, G . (2006). Analysis of H S C activity and compensatory Hox gene expression profile in Hoxb cluster mutant fetal liver cells. Blood 108, 116-122. Bjornsson, J . M., Larsson, N., Brun, A. C , Magnusson, M., Andersson, E., Lundstrom, P., Larsson, J . , Repetowska, E., Ehinger, M., Humphries, R. K., and Karlsson, S . (2003). Reduced proliferative capacity of hematopoietic stem cells deficient in Hoxb3 and Hoxb4. Mol Cell Biol 23, 3872-3883. Bodine, D. M., Karlsson, S., and Nienhuis, A. W. (1989). Combination of interleukins 3 and 6 preserves stem cell function in culture and enhances retrovirus-mediated gene transfer into hematopoietic stem cells. Proc Natl Acad Sci U S A 86, 8897-8901.  117  Bordignon, C , Notarangelo, L. D., Nobili, N., Ferrari, G., Casorati, G . , Panina, P., Mazzolari, E., Maggioni, D., Rossi, C , Servida, P., et al. (1995). Gene therapy in peripheral blood lymphocytes and bone marrow for A D A - immunodeficient patients. Science 270, 470-475. Brecher, G . , Ansell, J . D., Micklem, H. S., Tjio, J . H., and Cronkite, E. P. (1982). Special proliferative sites are not needed for seeding and proliferation of transfused bone marrow cells in normal syngeneic mice. Proc Natl Acad Sci U S A 79, 5085-5087. Brun, A . C , Bjomsson, J . M., Magnusson, M., Larsson, N., Leveen, P., Ehinger, M., Nilsson, E., and Karlsson, S. (2004). Hoxb4-deficient mice undergo normal hematopoietic development but exhibit a mild proliferation defect in hematopoietic stem cells. Blood 103, 4126-4133. Brun, A. C , Fan, X., Bjornsson, J . M., Humphries, R. K., and Karlsson, S. (2003). Enforced adenoviral vector-mediated expression of H O X B 4 in human umbilical cord blood CD34+ cells promotes myeloid differentiation but not proliferation. Mol Ther 8, 618-628. Budak-Alpdogan, T., Banerjee, D., and Bertino, J . R. (2005). Hematopoietic stem cell gene therapy with drug resistance genes: an update. Cancer Gene Ther 12, 849-863. Buske, C , Feuring-Buske, M., Abramovich, C , Spiekermann, K., Eaves, C. J . , Coulombel, L , Sauvageau, G . , Hogge, D. E., and Humphries, R. K. (2002). Deregulated expression of H O X B 4 enhances the primitive growth activity of human hematopoietic cells. Blood 100, 862-868. Cavazzana-Calvo, M., Hacein-Bey, S., de Saint Basile, G., Gross, F., Yvon, E., Nusbaum, P., Selz, F., Hue, C , Certain, S., Casanova, J . L , et al. (2000). Gene therapy of human severe combined immunodeficiency (SCID)-X1 disease. Science 288, 669-672. Cheng, T., Rodrigues, N., Shen, H., Yang, Y., Dombkowski, D., Sykes, M., and Scadden, D. T. (2000). Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science 287, 1804-1808. Chinnasamy, N., Rafferty, J . A., Hickson, I., Lashford, L. S., Longhurst, S. J . , Thatcher, N., Margison, G . P., Dexter, T. M., and Fairbairn, L. J . (1998). Chemoprotective gene transfer II: multilineage in vivo protection of haemopoiesis against the effects of an antitumour agent by expression of a mutant human 06-alkylguanine-DNA alkyltransferase. Gene Ther 5, 842-847. Colvin, G . A., Lambert, J . F., Abedi, M., Hsieh, C. C , Carlson, J . E., Stewart, F. M., and Quesenberry, P. J . (2004). Murine marrow cellularity and the concept of stem cell competition: geographic and quantitative determinants in stem cell biology. Leukemia 18, 575-583. Conneally, E., Cashman, J . , Petzer, A., and Eaves, C. (1997). Expansion in vitro of transplantable human cord blood stem cells demonstrated using a quantitative assay of 118  their lympho-myeloid repopulating activity in nonobese diabetic-scid/scid mice. Proc Natl Acad Sci U S A 94, 9836-9841. Danet, G . H., Lee, H. W-, Luongo, J . L , Simon, M. C , and Bonnet, D. A. (2001). Dissociation between stem cell phenotype and NOD/SCID repopulating activity in human peripheral blood CD34(+) cells after ex vivo expansion. Exp Hematol 29, 14651473. Dao, M. A., Arevalo, J . , and Nolta, J . A. (2003). Reversibility of C D 3 4 expression on human hematopoietic stem cells that retain the capacity for secondary reconstitution. Blood 101, 112-118. Davidson, A. J . , Ernst, P., Wang, Y., Dekens, M. P., Kingsley, P. D., Palis, J . , Korsmeyer, S. J . , Daley, G . Q., and Zon, L. I. (2003). cdx4 mutants fail to specify blood progenitors and can be rescued by multiple hox genes. Nature 425, 300-306. Davis, B. M., Koc, O. N., and Gerson, S. L. (2000). Limiting numbers of G156A 0(6)methylguanine-DNA methyltransferase-transduced marrow progenitors repopulate nonmyeloablated mice after drug selection. Blood 95, 3078-3084. Dick, J . E., Magli, M. C , Huszar, D., Phillips, R. A., and Bernstein, A . (1985). Introduction of a selectable gene into primitive stem cells capable of long-term reconstitution of the hemopoietic system of W/Wv mice. Cell 42, 71-79. DiMartino, J . F., Selleri, L , Traver, D., Firpo, M. T., Rhee, J . , Warnke, R., O'Gorman, S., Weissman, I. L., and Cleary, M. L. (2001). The Hox cofactor and proto-oncogene Pbx1 is required for maintenance of definitive hematopoiesis in the fetal liver. Blood 98, 618626. o  .  '  .  Domen, J . , Cheshier, S. H., and Weissman, I. L. (2000). The role of apoptosis in the regulation of hematopoietic stem cells: Overexpression of Bcl-2 increases both their number and repopulation potential. J Exp Med 191, 253-264. Dorrell, C , G a n , O. I., Pereira,.D. S., Hawley, R. G., and Dick, J . E. (2000). Expansion of human cord blood CD34(+)CD38(-) cells in ex vivo culture during retroviral transduction without a corresponding increase in SCID repopulating cell ( S R C ) frequency: dissociation of S R C phenotype and function. Blood 95, 102-110. Du, Y., Jenkins, N. A., and Copeland, N. G . (2005). Insertional mutagenesis identifies genes that promote the immortalization of primary bone marrow progenitor cells. Blood 106, 3932-3939. Duncan, A. W., Rattis, F. M., DiMascio, L. N., Cohgdon, K. L., Pazianos, G., Zhao, C., Yoon, K., Cook, J . M., Willert, K., Gaiano, N., and Reya, T. (2005). Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 6, 314-322. Eaves, C . J . (2002). Myelopoiesis, In Leukemia, E. S. Henderson, T. A. Lister, and M. F. Greaves, eds. (Philadelphia: Saunders), pp. 19-45.  119  Ernst, P., Fisher, J . K., Avery, W., Wade, S., Foy, D., and Korsmeyer, S. J . (2004a). Definitive hematopoiesis requires the mixed-lineage leukemia gene. Dev Cell 6, 437443. f  Ernst, P., Mabon, M., Davidson, A. J . , Zon, L. I., and Korsmeyer, S. J . (2004b). An Mildependent Hox program drives hematopoietic progenitor expansion. Curr Biol 14, 2063-2069. Fontoura, B. M., Blobel, G., and Matunis, M. J . (1999). A conserved biogenesis pathway for nucleoporins: proteolytic processing of a 186-kilodalton precursor generates Nup98 and the novel nudeoporin, Nup96. J Cell Biol 144, 1097-1112. Ford, C . E., Hamerton, J . L , Barnes, D. W., and Loutit, J . F. (1956). Cytological identification of radiation-chimaeras. Nature 177, 452-454. Gaziev, J . , and Lucarelli, G . (2005). Stem cell transplantation and gene therapy for hemoglobinopathies. Curr Hematol Rep 4, 126-131. Goebel, W. S., Yoder, M. C , Pech, N. K., and Dinauer, M. C. (2002). Donor chimerism and stem cell function in a murine congenic transplantation model after low-dose radiation conditioning: effects of a retroviral-mediated gene transfer protocol and implications for gene therapy. Exp Hematol 30, 1324-1332. Goldberg, S. Z., Kuebbing, D., Trauber, D., Schafer, M. P., Lewis, S. E., Popp, R. A., and Anderson, W. F. (1986). A 66-base pair insert bridges the deletion responsible for a mouse model of beta-thalassemia. J Biol Chem 261, 12368-12374. Goodell, M. A., Brose, K., Paradis, G., Conner, A. S., and Mulligan, R. C. (1996). Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183, 1797-1806. Gould, A., Morrison, A., Sproat, G., White, R. A., and Krumlauf, R. (1997). Positive cross-regulation and enhancer sharing: two mechanisms for specifying overlapping Hox expression patterns. Genes Dev 11, 900-913. Hacein-Bey-Abina, S., Von Kalle, C , Schmidt, M., McCormack, M. P., Wulffraat, N., Leboulch, P., Lim, A., Osborne, C , S., Pawliuk, R., Morillon, E . , e f al. (2003). L M 0 2 associated clonal T cell proliferation in two patients after gene therapy for S C I D - X 1 . Science 302, 415-419. Harrison, D. E. (1980). Competitive repopulation: a new assay for long-term stem cell functional capacity. Blood 55, 77-81. Harrison, D. E., Jordan, C. T., Zhong, R. K., and Astle, C. M. (1993). Primitive hemopoietic stem cells: direct assay of most productive populations by competitive repopulation with simple binomial, correlation and covariance calculations. Exp Hematol 21, 206-219. Hawley, R. G . , Lieu, F. H., Fong, A. Z., and Hawley, T. S. (1994). Versatile retroviral vectors for potential use in gene therapy. Gene Ther 1, 136-138. 120  Hematti, P., Hong, B. K., Ferguson, C , Adler, R., Hanawa, H., Sellers, S., Holt, I. E., Eckfeldt, C. E., Sharma, Y., Schmidt, M., et al. (2004). Distinct genomic integration of M L V and SIV vectors in primate hematopoietic stem and progenitor cells. P L o S Biol 2, e423. Hess, D. A., Meyerrose, T. E., Wirthlin, L , Craft, T. P., Herrbrich, P. E., Creer, M. H., and Nolta, J . A. (2004). Functional characterization of highly purified human hematopoietic repopulating cells isolated according to aldehyde dehydrogenase activity. Blood 104, 1648-1655. Hickson, I., Fairbairn, L. J . , Chinnasamy, N., Lashford, L. S., Thatcher, N., Margison, G . P., Dexter, T. M., and Rafferty, J . A. (1998). Chemoprotective gene transfer I: transduction of human haemopoietic progenitors with 06-benzylguanine-resistant 0 6 alkylguanine-DNA alkyltransferase attenuates the toxic effects of 06-alkylating agents in vitro. Gene Ther 5, 835-841. Hisa, T., Spence, S. E., Rachel, R. A., Fujita, M., Nakamura, T., Ward, J . M., DevorHenneman, D. E., Saiki, Y., Kutsuna, H., Tessarollo, L., er al. (2004). Hematopoietic, angiogenic and eye defects in M e i s l mutant animals. Embo J 23, 450-459. Hodgson, G . S., and Bradley, T. R. (1979). Properties of haematopoietic stem cells surviving 5-fluorouracil treatment: evidence for a pre-CFU-S cell? Nature 281, 381-382. Holyoake, T. L , Nicolini, F. E., and Eaves, C. J . (1999). Functional differences between transplantable human hematopoietic stem cells from fetal liver, cord blood, and adult marrow. Exp Hematol 27, 1418-1427. lannone, R., Luznik, L , Engstrom, L. W., Tennessee, S. L , Askin, F. B., Casella, J . F., Kickler, T. S., Goodman, S. N., Hawkins, A. L , Griffin, C. A., et al. (2001). Effects of mixed hematopoietic chimerism in a mouse model of bone marrow transplantation for sickle cell anemia. Blood 97, 3960-3965. Imren, S., Payen, E., Westerman, K. A., Pawliuk, R., Fabry, M. E., Eaves, C. J . , Cavilla, B., Wadsworth, L. D., Beuzard, Y., Bouhassira, E. E., er al. (2002). Permanent and panerythroid correction of murine beta thalassemia by multiple lentiviral integration in hematopoietic stem cells. Proc Natl Acad Sci U S A 99, 14380-14385. Iwama, A., Oguro, H., Negishi, M., Kato, Y., Morita, Y., Tsukui, H., Ema, H., Kamijo, T., Katoh-Fukui, Y., Koseki, H., etal. (2004). Enhanced self-renewal of hematopoietic stem cells mediated by the polycomb gene product Bmi-1. Immunity 21, 843-851. Jacobson, L. O., Marks, E. K., Robson, M. J . , Gaston, E. O., and Zirkle, R. E. (1949). Effect of spleen protection on mortality following X-irradiation. J Lab Clin Med 34, 15381543. Jones, R. J . , Celano, P., Sharkis, S. J . , and Sensenbrenner, L. L. (1989). Two phases of engraftment established by serial bone marrow transplantation in mice. Blood 73, 397-401.  121  Jones, R. J , , Collector, M. I., Barber, J . P., Vala, M. S., Fackler, M. J . , May, W. S., Griffin, C. A., Hawkins, A. L , Zehnbauer, B. A., Hilton, J., etal. (1996). Characterization of mouse lymphohematopoietic stem cells lacking spleen colony-forming activity. Blood 88,487-491. Jones, R. J . , Wagner, J . E., Celano, P., Zicha, M. S., and Sharkis, S. J . (1990). Separation of pluripotent haematopoietic stem cells from spleen colony-forming cells. Nature 347, 188-189. Kahl, C . A., Tarantal, A. F., Lee, C. I., Jimenez, D. F., Choi, C , Pepper, K., Petersen, D., Fletcher, M. D., Leapley, A. C , Fisher, J . , et al. (2006). Effects of busulfan dose escalation on engraftment of infant rhesus monkey hematopoietic stem cells after gene marking by a lentiviral vector. Exp Hematol 34, 369-381. Kalberer, C. P., Pawliuk, R., Imren, S., Bachelot, T., Takekoshi, K. J . , Fabry, M., Eaves, C. J . , London, I. M., Humphries, R. K., and Leboulch, P. (2000). Preselection of retrovirally transduced bone marrow avoids subsequent stem cell gene silencing and age-dependent extinction of expression of human beta-globin in engrafted mice. Proc Natl Acad Sci U S A 97, 5411 -5415. Kang, E. M., Hsieh, M. M., Metzger, M., Krouse, A., Donahue, R. E., Sadelain, M., and Tisdale, J . F. (2006). Busulfan pharmacokinetics, toxicity, and low-dose conditioning for autologous transplantation of genetically modified hematopoietic stem cells in the rhesus macaque model. Exp Hematol 34, 132-139. Kasper, L. H., Brindle, P. K., Schnabel, C. A., Pritchard, C. E., Cleary, M. L., and van Deursen, J . M. (1999). C R E B binding protein interacts with nucleoporin-specific F G repeats that activate transcription and mediate N U P 9 8 - H 0 X A 9 oncogenicity. Mol Cell Biol 19, 764-776. Kaushansky, K. (2006). Lineage-specific hematopoietic growth factors. N Engl J Med 354,2034-2045. Kean, L. S., Manci, E. A., Perry, J . , Balkan, C , Coley, S., Holtzclaw, D., Adams, A. B., Larsen, C. P., Hsu, L. L., and Archer, D. R. (2003). Chimerism and cure: hematologic and pathologic correction of murine sickle cell disease. Blood 102, 4582-4593. Kiel, M. J . , Yilmaz, O. H., Iwashita, T., Yilmaz, O. H., Terhorst, C , and Morrison, S . J . (2005). S L A M family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell 121, 1109-1121. Kim, I., He, S., Yilmaz, O. H., Kiel, M. J . , and Morrison, S. J . (2006). Enhanced purification of fetal liver hematopoietic stem cells using S L A M family receptors. Blood 108, 737-744. Kinsella, T. M., and Nolan, G . P. (1996). Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum Gene Ther 7, 1405-1413.  122  Kittler, E. L , Peters, S. O., Crittenden, R. B., Debatis, M. E., Ramshaw, H. S., Stewart, F. M., and Quesenberry, P. J . (1997). Cytokine-facilitated transduction leads to lowlevel engraftment in nonablated hosts. Blood 90, 865-872. Klein, C , and Baum, C. (2004). Gene therapy for inherited disorders of haematopoietic cells. Hematol J 5, 103-111. Klump, H., Schiedlmeier, B., and Baum, C. (2005). Control of Self-Renewal and. Differentiation of Hematopoietic Stem Cells: HOXB4 on the Threshold. Ann N Y Acad Sci 1044, 6-15. Kondo, M., Weissman, I. L , and Akashi, K. (1997). Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell 91, 661-672. Kongsuwan, K., Webb, E., Housiaux, P., and Adams, J . M. (1988). Expression of multiple homeobox genes within diverse mammalian haemopoietic lineages. Embo J 7, 2131-2138. Krosl, J . , Austin, P., Beslu, N., Kroon, E., Humphries, R. K., and Sauvageau, G . (2003a). In vitro expansion of hematopoietic stem cells by recombinant T A T - H O X B 4 protein. Nat Med 9, 1428-1432. Krosl, J . , Beslu, N., Mayotte, N., Humphries, R. K., and Sauvageau, G . (2003b). The competitive nature of HOXB4-transduced H S C is limited by P B X 1 : the generation of ultra-competitive stem cells retaining full differentiation potential. Immunity 18, 561-571. Kustikova, O., Fehse, B., Modlich, U., Yang, M., Dullmann, J . , Kamino, K., von Neuhoff, N., Schlegelberger, B., Li, Z., and Baum, C. (2005). Clonal dominance of hematopoietic stem cells triggered by retroviral gene marking. Science 308, 1171-1174. Kustikova, O. S., Geiger, H., Li, Z., Brugman, M. H., Chambers, S. M., Shaw, C . A., Pike-Overzet, K., de Ridder, D., Staal, F. J . , von Keudell, G , et al. (2006). Retroviral vector insertion sites associated with dominant hematopoietic clones mark "sternness" pathways. Blood. ^ Lam, D. H., and Apian, P. D. (2001). NUP98 gene fusions in hematologic malignancies. Leukemia 15, 1689-1695. Lawrence, H. J . , Christensen, J . , Fong, S., Hu, Y. L., Weissman, I., Sauvageau, G , Humphries, R. K., and Largman, C. (2005). Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells. Blood 706, 3988-3994. Lawrence, H. J . , and Largman, C. (1992). Homeobox genes in normal hematopoiesis and leukemia. Blood 80, 2445-2453. Lemischka, I. R., Raulet, D. H., and Mulligan, R. C. (1986). Developmental potential and dynamic behavior of hematopoietic stem cells. Cell 45, 917-927.  123  Lessard, J . , and Sauvageau, G . (2003). Bmi-1 determines the proliferative capacity of normal and leukaemic stem cells. Nature 423, 255-260. Li, C. L., and Johnson, G . R. (1992). Rhodamine123 reveals heterogeneity within murine Lin-, Sca-1+ hemopoietic stem cells. J Exp Med 175, 1443-1447. • i  Li, M. X., Banerjee, D., Zhao, S. C , Schweitzer, B. I., Mineishi, S., Gilboa, E., and Bertino, J . R. (1994). Development of a retroviral construct containing a human mutated dihydrofolate reductase cDNA for hematopoietic stem cell transduction. Blood 83, 3403-3408. Lorenz, E., Uphoff, D., Reid, T. R., and Shelton, E. (1951). Modification of irradiation injury in mice and guinea pigs by bone marrow injections. J Natl Cancer Inst 12, 197201. Lucarelli, G . , and Clift, R. A. (2004). Marrow Transplantation in Thalassemia, In Thomas' Hematopoietic Cell Transplantation, K. G . Blume, S. J . Forman, and F. R. Appelbaum, eds. (London: Blackwell Publishing Ltd), pp. 1409-1416. Markowitz, D., Goff, S., and Bank, A. (1988). A safe packaging line for gene transfer: separating viral genes on two different plasmids. J Virol 62, 1120-1124. May, C , Rivella, S., Callegari, J . , Heller, G . , Gaensler, K. M., Luzzatto, L., and Sadelain, M. (2000). Therapeutic haemoglobin synthesis in beta-thalassaemic mice expressing lentivirus-encoded human beta-globin. Nature 406, 82-86. McCune, J . M. (1996). Development and applications of the SCID-hu mouse model. Semin Immunol 8, 187-196. McKenzie, J . L., Takenaka, K., Gan, O. I., Doedens, M., and Dick, J . E. (2007). Low rhodamine 123 retention identifies long-term human hematopoietic stem cells within the Lin-CD34+CD38- population. Blood 109, 543-545. Micklem, H. S., Clarke, C. M., Evans, E. P., and Ford, C. E. (1968). Fate of chromosome-marked mouse bone marrow cells tranfused into normal syngeneic recipients. Transplantation 6, 299-302. Mikkola, H. K., Klintman, J . , Yang, H., Hock, H., Schlaeger, T. M., Fujiwara, Y., and Orkin, S . H. (2003). Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene. Nature 421, 547-551. Mikkola, H. K., and Orkin, S. H. (2006). The journey of developing hematopoietic stem cells. Development 133, 3733-3744. Miller, C . L., and Eaves, C. J . (1997). Expansion in vitro of adult murine hematopoietic stem cells with transplantable lympho-myeloid reconstituting ability. Proc Natl Acad Sci U S A 9 4 , 13648-13653.  124  Milsom, M. D., Duxbury, R., Gagen, D., Humphries, R. K., Schmidt, M., von-Kalle, C , and Fairbairn, L. J . (2005). Overexpression of H O X B 4 confers a myelo-erythroid differentiation delay in vitro. Leukemia 19, 148-153. Miyake, N., Brun, A. C , Magnusson, M., Miyake, K., Scadden, D. T., and Karlsson, S. (2006). HOXB4-induced self-renewal of hematopoietic stem cells is significantly enhanced by p21 deficiency. Stem Cells 24, 653-661. Moore, M. A. (2005). Converging pathways in leukemogenesis and stem cell selfrenewal. Exp Hematol 33, 719-737. Morrison, S. J . , Hemmati, H. D., Wandycz, A. M., and Weissman, I. L. (1995a). The purification and characterization of fetal liver hematopoietic stem cells. Proc Natl Acad Sci U S A 9 2 , 10302-10306. Morrison, S. J . , Uchida, N., and Weissman, I. L. (1995b). The biology of hematopoietic stem cells. Annu Rev Cell Dev Biol 11, 35-71. Morrison, S. J . , and Weissman, I. L. (1994). The long-term repopulating subset of hematopoietic stem cells is deterministic and isolatable by phenotype. Immunity 1, 661673. Mulligan, R. C. (1993). The basic science of gene therapy. Science 260, 926-932. Murdoch, B., Chadwick, K., Martin, M., Shojaei, F., Shah, K. W G a l l a c h e r , L , Moon, R. T., and Bhatia, M. (2003). Wnt-5A augments repopulating capacity and primitive hematopoietic development of human blood stem cells in vivo. Proc Natl Acad Sci U S A 100, 3422-3427. Murray, L., Chen, B., Galy, A., Chen, S., Tushinski, R., Uchida, N., Negrin, R., Tricot, G , Jagannath, S., Vesole, D., and et al. (1995). Enrichment of human hematopoietic stem cell activity in the CD34+Thy-1+Lin- subpopulation from mobilized peripheral blood. Blood 85, 368-378. Murray, L., DiGiusto, D., Chen, B., Chen, S., Combs, J . , Conti, A., Galy, A., Negrin, R., Tricot, G , and Tsukamoto, A. (1994). Analysis of human hematopoietic stem cell populations. Blood Cells 20, 364-369; discussion 369-370. Nakano, T. (2003). Hematopoietic stem cells: generation and manipulation. Trends Immunol 24, 589-594. Nakauchi, H., Sudo, K., and Ema, H. (2001). Quantitative assessment of the stem cell self-renewal capacity. Ann N Y Acad Sci 938, 18-24; discussion 24-15. Neff, T., Beard, B. C , and Kiem, H. P. (2006). Survival of the fittest: in vivo selection and stem cell gene therapy. Blood 707, 1751-1760. Ohta, H., Sekulovicac, S., Bakovic, S., Eaves, C. J . , Pineault, N.,Gasparetto, M., Smith, C , Sauvageau, G., and Humphries, R. K. (2007). Near-maximal expansions of  125  hematopoietic stem cells in culture using NUP98-HOX fusions. Exp Hematol 35, 817830, Osawa, M., Hanada, K., Hamada, H., and Nakauchi, H. (1996). Long-term lymphohematopoietic reconstitution by a single GD34-low/negative hematopoietic stem cell. Science 273, 242-245. Ott, M. G . , Schmidt, M., Schwarzwaelder, K., Stein, S., Siler, U., Koehl, U., Glimm, H., Kuhlcke, K., Schilz, A., Kunkel, H., er al. (2006). Correction of X-linked chronic granulomatous disease by gene therapy, augmented by insertional activation of M D S 1 EVI1, P R D M 1 6 o r S E T B P I . Nat Med 12, 401-409. Park, I. K., Qian, D., Kiel, M., Becker, M. W., Pihalja, M., Weissman, I. L., Morrison, S . J . , and Clarke, M. F. (2003). Bmi-1 is required for maintenance of adult self-renewing haematopoietic stem cells. Nature 423, 302-305. Pawliuk, R., Kay, R., Lansdorp, P., and Humphries, R. K. (1994). Selection of retrovirally transduced hematopoietic cells using CD24 as a marker of gene transfer. Blood 84, 2868-2877. Pawliuk, R., Westerman, K. A., Fabry, M. E., Payen, E., Tighe, R., Bouhassira, E. E., Acharya, S . A., Ellis, J . , London, I. M., Eaves, C. J . , et al. (2001). Correction of sickle cell disease in transgenic mouse models by gene therapy. Science 294, 2368-2371. Persons, D. A., Allay, E. R., Sabatino, D. E., Kelly, P., Bodine, D. M., and Nienhuis, A. W. (2001). Functional requirements for phenotypic correction of murine betathalassemia: implications for human gene therapy. Blood 97, 3275-3282. Persons, D. A., Allay, E. R., Sawai, N., Hargrove, P. W., Brent, T. P., Hanawa, H., Nienhuis, A. W., and Sorrentino, B. P. (2003). Successful treatment of murine betathalassemia using in vivo selection of genetically modified, drug-resistant hematopoietic stem cells. Blood 102, 506-513. Peters, S . O., Kittler, E. L , Ramshaw, H. S., and Quesenberry, P. J . (1996). Ex vivo expansion of murine marrow cells with interleukin-3 (IL-3), IL-6, IL-11, and stem cell factor leads to impaired engraftment in irradiated hosts. Blood 87, 30-37. Pilat, S., Carotta, S., Schiedlmeier, B., Kamino, K., Mairhofer, A., Will, E., Modlich, U., Steinlein, P., Ostertag, W., Baum, C , etal. (2005). HOXB4 enforces equivalent fates of ES-cell-derived and adult hematopoietic cells. Proc Natl Acad Sci U S A 102, 1210112106. Pineault, N., Abramovich, C , Ohta, H., and Humphries, R. K. (2004). Differential and common leukemogenic potentials of multiple NUP98-Hox fusion proteins alone or with M e i s l . Mol Cell Biol 24, 1907-1917. Pineault, N., Helgason, C. D., Lawrence, H. J . , and Humphries, R. K. (2002). Differential expression of Hox, M e i s l , and Pbx1 genes in primitive cells throughout murine hematopoietic ontogeny. Exp Hematol 30, 49-57.  126  Ploemacher, R. E., and Brons, R. H. (1989). Separation of C F U - S from primitive cells responsible" for reconstitution of the bone marrow hemopoietic stem cell compartment following irradiation: evidence for a pre-CFU-S cell. Exp Hematol 17, 263-266. Quesenberry, P. J . , Colvin, G., and Abedi, M. (2005). Perspective: fundamental and clinical concepts on stem cell homing and engraftment: a journey to niches and beyond. Exp Hematol 33, 9-19. Ramshaw, H. S., Rao, S. S., Crittenden, R. B., Peters, S. O . ^ W e i e r , H. U., and Quesenberry, P. J . (1995). Engraftment of bone marrow cells into normal unprepared hosts: effects of 5-fluorouracil and cell cycle status. Blood 86, 924-929. Rao, S . S., Peters, S. O., Crittenden, R. B., Stewart, F. M., R a m s h a w , H . S., and Quesenberry, P. J . (1997). Stem cell transplantation in the normal nonmyeloablated host: relationship between cell dose, schedule, and engraftment. Exp Hematol 25, 114121. -  Rebel, V. I., Miller, C. L , Thornbury, G . R., Dragowska, W. H., Eaves, C . J . , and Lansdorp, P. M. (1996). A comparison of long-term repopulating hematopoietic stem cells in fetal liver and adult bone marrow from the mouse. Exp Hematol 24, 638-648. Riley, J . , Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J . C , and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids R e s 18, 2887-2890. Roberts, C , Kean, L , Archer, D., Balkan, C , and Hsu, L. L. (2005). Murine and Math Models for the Level of Stable Mixed Chimerism to Cure {beta}-Thalassemia by Nonmyeloablative Bone Marrow Transplantation. Ann N Y Acad Sci 1054, 423-428. Rocha, V., and Gluckman, E. (2006). Clinical use of umbilical cord blood hematopoietic stem cells. Biol Blood Marrow Transplant 12, 34-41. Sadelain, M. (2006). Recent advances in globin gene transfer for the treatment of betathalassemia and sickle cell anemia. Curr Opin Hematol 13, 142-148. Sambrook, J . , Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning: a laboratory manual. : Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.). Sauvageau, G . , Iscove, N. N., and Humphries, R. K. (2004). In vitro and in vivo expansion of hematopoietic stem cells. Oncogene 23, 7223-7232. Sauvageau, G , Lansdorp, P. M., Eaves, C. J . , Hogge, D. E., Dragowska, W, H., Reid, D. S., Largman, C , Lawrence, H. J . , and Humphries, R . ' K . (1994). Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells. Proc Natl A c a d S c i U S A 91, 12223-12227. Sauvageau, G , Thorsteinsdottir, U., Eaves, C. J . , Lawrence, H. J . , Largman, C , Lansdorp, P. M., and Humphries, R. K. (1995). Overexpression of H O X B 4 in  127  hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev 9, 1753-1765. Sauvageau, G., Thorsteinsdottir, U., Hough, M. R., Hugo, P., Lawrence, H. J . , Largman, C., and Humphries, R. K. (1997). Overexpression of H 0 X B 3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation. Immunity 6, 13-22. Sawai, N., Zhou, S., Vanin, E. F., Houghton, P., Brent, T. P., and Sorrentino, B. P. (2001). Protection and in vivo selection of hematopoietic stem cells using temozolomide, 06-benzylguanine, and an alkyltransferase-expressing retroviral vector. Mol Ther 3, 78-87. Saxe, D. F., Boggs, S. S., and Boggs, D. R, (1984). Transplantation of chromosomally marked syngeneic marrow cells into mice not subjected to hematopoietic stem cell depletion. Exp Hematol 12, 277-283. Schiedlmeier, B., Klump, H., Will, E., Arman-Kalcek, G . , Li, Z., Wang, Z., Rimek, A., Friel, J . , Baum, O , and Ostertag, W. (2003). High-level ectopic H 0 X B 4 expression confers a profound in vivo competitive growth advantage on human cord blood CD34+ cells, but impairs lymphomyeloid differentiation. Blood 101, 1759-1768. Schofield, R. (1978). The relationship between the spleen colony-forming cell and the haemopoietic stem cell. Blood Cells 4, 7-25. Schrier, S. L., and Angelucci, E. (2005). New strategies in the treatment of the thalassemias. Annu Rev Med 56, 157-171. Shehee, W. R., Oliver, P., and Smithies, O. (1993). Lethal thalassemia after insertional disruption of the mouse major adult beta-globin gene. Proc Natl Acad Sci U S A 90, 3177-3181. Shivdasani, R. A., Mayer, E. L., and Orkin, S . H. (1995). Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL. Nature 373, 432-434. Skow, L. C , Burkhart, B. A., Johnson, F. M., Popp, R. A., Popp, D. M., Goldberg, S. Z., Anderson, W. F., Barnett, L. B., and Lewis, S. E. (1983). A mouse model for betathalassemia. Cell 34, 1043-1052. Slape, C , and Apian, P. D. (2004). The role of NUP98 gene fusions in hematologic malignancy. Leuk Lymphoma 45, 1341-1350. Smith, C . (2003). Hematopoietic stem cells and hematopoiesis. Cancer Control 10, 916. Smith, O , and Storms, B. (2000). Hematopoietic stem cells. Clin Orthop Relat Res, S91-97. Sorrentino, B. P. (2002). Gene therapy to protect haematopoietic cells from cytotoxic cancer drugs. Nat Rev Cancer 2, 431-441. 128  Sorrentino, B. P. (2004). Clinical strategies for expansion of haematopoietic stem cells. Nat Rev Immunol 4, 878-888. Spangrude, G . J . , Brooks, D. M., and Tumas, D. B. (1995). Long-term repopulation of irradiated mice with limiting numbers of purified hematopoietic stem cells: in vivo expansion of stem cell phenotype but not function. Blood 85, 1006-1016. Spangrude, G . J . , and Johnson, G . R. (1990). Resting and activated subsets of mouse multipotent hematopoietic stem cells. Proc Natl Acad Sci U S A 87, 7433-7437. Spencer, H. T., Sleep, S. E., Rehg, J . E., Blakley, R. L., and Sorrentino, B. P. (1996). A gene transfer strategy for making bone marrow cells resistant to trimetrexate. Blood 87, 2579-2587. Stewart, F. M., Crittenden, R. B., Lowry, P. A., Pearson-White, S., and Quesenberry, P. J . (1993). Long-term engraftment of normal and post-5-fluorouracil murine marrow into normal nonmyeloablated mice. Blood 81, 2566-2571. Stewart, F. M., Zhong, S., Lambert, J . F., Colvin, G . A., Abedi, M., Dooner, M. S., McAuliffe, C. I., Wang, H., Hsieh, C , and Quesenberry, P. J . (2001). Host marrow stem cell potential and engraftability at varying times after low-dose whole-body irradiation. Blood 98, 1246-1251. Stewart, F. M., Zhong, S., Wuu, J . , Hsieh, C , Nilsson, S. K., and Quesenberry, P. J . (1998). Lymphohematopoietic engraftment in minimally myeloablated hosts. Blood 91, 3681-3687. Suzuki, T., Shen, H., Akagi, K., Morse, H. C , Malley, J . D., Naiman, D. Q., Jenkins, N. A., and Copeland, N. G . (2002). New genes involved in cancer identified by retroviral tagging. Nat Genet 32, 166-174. Szilvassy, S. J . , Fraser, C. C , Eaves, C. J . , Lansdorp, P. M., Eaves, A. C , and Humphries, R. K. (1989). Retrovirus-mediated gene transfer to purified hemopoietic stem cells with long-term lympho-myelopoietic repopulating ability. Proc Natl Acad Sci U S A 86, 8798-8802. Szilvassy, S. J . , Humphries, R. K., Lansdorp, P. M., Eaves, A. C , and Eaves, C. J . (1990). Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive repopulation strategy. Proc Natl Acad Sci U S A 87, 8736-8740. Szilvassy, S. J . , Nicolini, F. E., Eaves, C. J . , and Miller, C. L. (2002). Quantitation of Murine and Human Hematopoietic Stem Cells by Limiting-Dilution Analysis in Competitively Repopulated Hosts, In Methods in molecular medecine: hematopoietic stem cell protocols, C. T. Jordan, and C . A . Klug, eds. (New Jersey: Humana Press), pp. 167-187. Taniguchi, H., Toyoshima, T., Fukao, K., and Nakauchi, H. (1996). Presence of hematopoietic stem cells in the adult liver. Nat Med 2, 198-203.  129  Teitell, M. A., and Mikkola, H. K. (2006). Transcriptional activators, repressors, and epigenetic modifiers controlling hematopoietic stem cell development. Pediatr Res 59, 33R-39R. Thomas, E. D. (1999a). Bone marrow transplantation: a review. Semin Hematol 36, 95103. Thomas, E. D. (1999b). A history of haemopoietic cell transplantation. Br J Haematol 105, 330-339. Thomas, E. D., Lochte, H. L , Jr., Cannon, J . H., Sahler, O. D., and Ferrebee, J . W. (1959). Supralethal whole body irradiation and isologous marrow transplantation in man. J Clin Invest 38, 1709-1716. Thomas, E. D., Lochte, H. L., Jr., Lu, W. C , and Ferrebee, J . W. (1957). Intravenous infusion of bone marrow in patients receiving radiation and chemotherapy. N Engl J Med 257, 491-496. Thorsteinsdottir, U., Mamo, A., Kroon, E., Jerome, L., Biji, J . , Lawrence, H. J . , Humphries, K., and Sauvageau, G . (2002). Overexpression of the myeloid leukemiaassociated Hoxa9 gene in bone marrow cells induces stem cell expansion. Blood 99, 121-129. Thorsteinsdottir, U., Sauvageau, G., Hough, M. R., Dragowska, W., Lansdorp, P. M., Lawrence, H. J . , Largman, C , and Humphries, R. K. (1997). Overexpression of H O X A 1 0 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol Cell Biol 17, 495-505. Thorsteinsdottir, U., Sauvageau, G., and Humphries, R. K. (1999). Enhanced in vivo regenerative potential of HOXB4-transduced hematopoietic stem cells with regulation of their pool size. Blood 94, 2605-2612. Till, J . E., and Mc Culloch, E. A. (1961). A direct measurement of the radiation sensitivity of normal mouse bone marrow cells. Radiat Res 14, 213-222. Till, J . E., McCulloch, E. A., and Siminovitch, L. (1964). A Stochastic Model of Stem Cell Proliferation, Based on the Growth of Spleen Colony-Forming Cells. Proc Natl Acad Sci U S A 51, 29-36. Trobridge, G., Beard, B. C , and Kiem, H. P. (2005). Hematopoietic stem cell transduction and amplification in large animal models. Hum Gene Ther 16, 1355-1366. Uchida, N., Dykstra, B., Lyons, K., Leung, F., Kristiansen, M., and Eaves, C. (2004). A B C transporter activities of murine hematopoietic stem cells vary according to their developmental and activation status. Blood 103, 4487-4495. Uchida, N., Dykstra, B., Lyons, K. J . , Leung, F. Y., and Eaves, C. J . (2003). Different in vivo repopulating activities of purified hematopoietic stem cells before and after being stimulated to divide in vitro with the same kinetics. Exp Hematol 31, 1338-1347.  130  Udomsakdi, C , Lansdorp, P. M., Hogge, D. E., Reid, D. S., Eaves, A. C , and Eaves, C. J . (1992). Characterization of primitive hematopoietic cells in normal human peripheral blood. Blood 80, 2513-2521. Urbinati, F., Madigan, C , and Malik, P. (2006). Pathophysiology and therapy for haemoglobinopathies; Part II: thalassaemias. Expert Rev Mol Med 8, 1-26. van der Loo, J . C , van den Bos, C , Baert, M. R., Wagemaker, G., and Ploemacher, R. E. (1994). Stable multilineage hematopoietic chimerism in alpha-thalassemic mice induced by a bone marrow subpopulation that excludes the majority of day-12 spleen colony-forming units. Blood 83, 1769-1777. van Oostveen, J . , Biji, J . , Raaphorst, F., Walboomers, J . , and Meijer, C . (1999). The role of homeobox genes in normal hematopoiesis and hematological malignancies. Leukemia 13, 1675-1690. Varnum-Finney, B., X u , L., Brashem-Stein, C , Nourigat, C , Flowers, D., Bakkour, S., Pear, W. S., and Bernstein, I. D. (2000). Pluripotent, cytokine-dependent, hematopoietic stem cells are immortalized by constitutive Notch 1 signaling. Nat Med 6, 1278-1281. Vermylen, C , Cornu, G . , Ferster, A., Brichard, B., Ninane, J . , Ferrant, A., Zenebergh, A., Maes,; P., Dhooge, C , Benoit, Y., et al. (1998). Haematopoietic stem cell transplantation for sickle cell anaemia: the first 50 patients transplanted in Belgium. Bone Marrow Transplant 22, 1-6. Wagers, A. J . (2005). Stem cell grand S L A M . Cell 121, 967-970. Walters, M. C , Patience, M., Leisenring, W., Rogers, Z. R., Aquino, V. M., Buchanan, G. R., Roberts, I. A., Yeager, A. M., Hsu, L , Adamkiewicz, T., et al. (2001). Stable mixed hematopoietic chimerism after bone marrow transplantation for sickle cell anemia. Biol Blood Marrow Transplant 7, 665-673. Wang, Y., Yates, F., Naveiras, O., Ernst, P., and Daley, G . Q. (2005). Embryonic stem cell-derived hematopoietic stem cells. Proc Natl Acad Sci U S A 102, 19081-19086. Weissman, I. L. (2000). Stem cells: units of development, units of regeneration, and units in evolution. Cell 100, 157-168. Wright, D. E., Wagers, A. J . , Gulati, A. P., Johnson, F. L , and Weissman, I. L. (2001). Physiological migration of hematopoietic stem and progenitor cells. Science 294, 19331936. W u , D. D., and Keating, A. (1993). Hematopoietic stem cells engraft in untreated transplant recipients. Exp Hematol 21, 251-256. Wu, X., Li, Y., Crise, B., and Burgess, S. M. (2003). Transcription start regions in the human genome are favored targets for M L V integration. Science 300, 1749-1751.  131  Zanjani, E. D., Flake, A. W., Rice, H., Hedrick, M., and Tavassoli, M. (1994). Long-term repopulating ability of xenogeneic transplanted human fetal liver hematopoietic stem cells in sheep. J Clin Invest 93, 1051-1055. Zhang, C . C , Kaba, M., G e , G , Xie, K., Tong, W., Hug, C , and Lodish, H. F. (2006a). Angiopoietin-like proteins stimulate ex vivo expansion of hematopoietic stem cells. Nat Med 72, 240-245. Zhang, C. C , and Lodish, H. F. (2004). Insulin-like growth factor 2 expressed in a novel fetal liver cell population is a growth factor for hematopoietic stem cells. Blood 703, 2513-2521. Zhang, C. C , and Lodish, H. F. (2005). Murine hematopoietic stem cells change their surface phenotype during ex vivo expansion. Blood 705, 4314-4320. Zhang, X . B., Beard, B. C , Beebe, K., Storer, B., Humphries, R. K., and Kiem, H. P. (2006b). Differential effects of HOXB4 on nonhuman primate short- and long-term repopulating cells. P L o S Med 3, e173.  132  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100525/manifest

Comment

Related Items