UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

An archaebacterial ribosomal protein gene cluster 1990

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
UBC_1990_A1 S55.pdf
UBC_1990_A1 S55.pdf [ 10.4MB ]
Metadata
JSON: 1.0100472.json
JSON-LD: 1.0100472+ld.json
RDF/XML (Pretty): 1.0100472.xml
RDF/JSON: 1.0100472+rdf.json
Turtle: 1.0100472+rdf-turtle.txt
N-Triples: 1.0100472+rdf-ntriples.txt
Citation
1.0100472.ris

Full Text

An Archaebacteriai &ibosomoC Prote in dene CCuster by LAWRENCE CHARLES SHIMMIN B.Sc, The University of Victoria, 1981 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR b F PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES DEPARTMENT OF BIOCHEMISTRY We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA April, 1990 © Copyright by Lawrence C. Shimmin, 1990 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada Date DE-6 (2/88) ii Abstract The eubacteria, archaebacteria and eucaryota evolved from a common ancestral state, the progenote, approximately 4,000 million years ago. The archaebacteria flourish in extreme environments, exhibiting unusual macromolecular structures and metabolism of which much has recently been elucidated. Less, however, is known of the genetics of archaebacteria. In order to investigate gene structure, organization, regulation and evolution in the archaebacteria a gene cluster encoding the ribosomal proteins of the GTPase domain was cloned from the extremely halophilic archaebacterium Halobacterium cutirubrum, characterized and compared with the homologous genes and proteins from eubacteria and eucaryota. A clone containing a 5146 basepair insert of genomic Halobacterium cutirubrum NRCC 34001 DNA encoding the GTPase domain ribosomal proteins was characterized and discovered to retain the identical gene order (i.e. L11e, Lie, L10e and L12e) as the homologous Escherichia coli genes and in addition two transcribed upstream open reading frames encoding the potential proteins ORF, of unknown function and NAB, bearing sequence similarity to nucleic acid binding proteins. The predominant transcripts are monocistronic L11e and tricistronic Lie - L10e - L12e transcripts; monocistronic NAB and bicistronic NAB - L11e transcripts are present at reduced levels and the ORF is present as a very rare transcript. Common elements upstream of the transcription initiation sites include the motif TTCGA ... 4-15 bp ... TTAA ... 20-26 bp ... A or G transcription start. The NAB and some of the ORF transcripts are divergently transcribed from a single TTAA promotor element. The NAB and some of the ORF transcripts initiate 1 nucleotide before the coding region; the L11e monocistronic transcript initiates precisely at the first A of the initiator methionine ATG codon. The Lie - L10e - L12e tricistronic transcript has a 75 nucleotide leader that is probably involved in the autogenous regulation of the transcript at the translational level by the Lie protein. Termination of transcription occurs, with a single exception, within T tracts after GC rich regions. Although classic Shine-Dalgarno (eubacterial) type ribosome binding sites are present upstream of the Lie and L10e genes, the mechanism of translation initiation for transcripts with nil or negligible 5' leaders remains to be elucidated. Alignments between the deduced amino acid sequences of the L1le, Lie, LlOe and L12e iii ribosomal proteins and other available homologous proteins of archaebacteria, eubacteria and eucaryota have been made and show that the L11e, Lie and L10e proteins are colinear whereas the L12e protein has suffered a rearrangement through what appears to be gene fusion events. The L11e proteins exhibit (i) sequence conservation in the region interacting with release factor 1, (ii) conserved proline residues (probably contributing to the elongated shape of the molecule) and (iii) sites of methylation in Eco L11 are not conserved in the archaebacterial L11e proteins. The Lie proteins have regions of very high sequence similarity near the center and carboxy termini of the proteins but the relationships between protein structure and function remain unknown. Intraspecies comparisons between L10e and L12e sequences indicate the archaebacterial and eucaryotic L10e proteins contain a partial copy of the L12e protein fused to their carboxy terminus. In the eubacteria most of this fusion has been removed by a carboxy terminal deletion. Within the L12e derived region a 26 amino acid long internal modular sequence reiterated thrice in the archaebacterial L10e, twice in the eucaryotic L10e and once in the eubacterial L10e was discovered. This modular sequence also appears to be present in single copy in all Ll2e proteins and may play a role in L12e dimerization, L10e - L12e complex formation and the function of L10e - L12e complex in translation. From these sequence comparisons a model depicting the evolutionary progression gene cluster and proteins from the primordial state to the contemporary archaebacterial, eucaryotic and eubacterial states is presented. iv JabU 0/ Contents Page Abstract ii Table of Contents iv List of Tables vi List of F igures vii A b b r e v i a t i o n s viii A c k n o w l e d g e m e n t s ix Dedicat ion x Part 1: Introduction 1 1.1 Early Evolution and the Archaebacteria 1 1.2 Halophilic Archaebacteria 4 1.3 Organization of Ribosome Components 5 1.4 GTPase Domain of Escherichia coli 6 1.5 Ribosomal Proteins of Halobacterium cutirubrum 11 1.6 The Present Investigation 12 Part 2: Materials and Methods 13 2.1 Materials 13 2.2 Enzymes 13 2.3 Nucleotides and Oligonucleotides 13 2.4 Bacterial Strains, Plasmids and Phage Vectors 14 2.5 Media and Culture Conditions 16 2.6 General Molecular Biology Techniques 16 2.7 Isolation of Halobacterium cutirubrum Nucleic Acids 16 2.8 Preparation of Radioactive Probes 17 2.9 Southern Blots 17 2.10 Construction and Screening of Libraries 18 2.11 DNA Sequence Analysis 20 2.12 Northern Blots 22 2.13 Analysis of in vivo RNA Transcripts 22 2.14 Nomenclature 23 2.14 Statistical Analysis 24 V Part 3: Organization and Expression of the GTPase Domain Genes 28 3.1 Isolation of the Genomic Clones pLW99 and pLW173 28 3.2 Nucleotide Sequence Analysis of pLW173 30 3.3 Identification of Proteins Encoded by pLW173 35 3.4 Amino Acid Composition and Codon Utilization within pLW173 38 3.5 Transcription Analysis of pLW173 43 3.5.1 Transcription of the ORF Gene 43 3.5.2 Transcription of the NAB and L11e Genes 46 3.5.3 Transcription of the Lie, L10e and L12e Genes 50 * 3.6 Concensus Signal Structures 53 3.6.1 Transcription Initiation Regions 53 3.6.2 Transcription Termination Regions 56 3.6.3 Translation Initiation Regions 56 3.7 Comparative Gene Organization and Expression 57 3.8 Summary 64 Part 4: Structure and Function of the GTPase Domain Proteins 66 4.1 Amino Acid Composition 66 4.2 The L11e Proteins 66 4.3 The L ie Proteins 72 4.4 The L10e Proteins 76 4.5 The L12e Proteins 79 4.6 Intra and Interprotein Relationships 86 4.7 Summary 91 Part 5: Evolution of the GTPase Domain 95 5.1 Evolution of the GTPase Domain 95 5.2 Model of the Evolution of the L10e and L12e Genes and Proteins 96 5.3 Future Prospects 103 References 105 vi List 0/ Ta6Ces Page Table 1 The Characteristics of the Urkingdoms 3 Table 2 Oligonucleotides 15 Table 3 Nomenclature for the GTPase Domain Proteins 25 Table 4 Amino Acid Composition of Proteins Encoded By pLW173 40 Table 5 Codon Utilization of Proteins Encoded By pLW173 ' 41 Table 6 Interkingdom Comparison of Amino Acid Composition of the 67 L11e, Lie, L10e and L12e Ribosomal Proteins Table 7 Intra and Interkingdom Sequence Similarity of the 70 L11e, Lie and L10e Ribosomal Proteins vii List Oj figures Page Figure 1 The Phylogeny of the Urkingdoms 2 Figure 2 Structure of the GTPase Domain 8 Figure 3 Summary of the Organization and Expression of the 10 L11, L1, L10 and L12 Genes in Escherichia coli Figure 4 Southern Blot Analysis and Restriction Maps of pLW99 and pLW173 29 Figure 5 The Nucleotide Sequence of pLW173 31 Figure 6 Identification of the Ribosomal Proteins Encoded by pLW173 36 Figure 7 Alignment of the Putative NAB Protein with EcoRI and PstI 39 Figure 8 Transcription of the ORF gene 44 Figure 9 Transcription of the NAB and L11 e genes 47 Figure 10 Transcription of the Lie, L10e, and L12e genes 51 Figure 11 Summary of Gene Expression in pLW173 54 Figure 12 Summary of the Organization and Expression of the 58 L11e, Lie, L10e and L12e Genes within the Urkingdoms Figure 13 Autogenous Regulation of the Lie - L10e - L12e Operon 61 Figure 14 Archaebacterial Transcription Initiation Sequences 63 Figure 15 Alignment of the L11e Proteins 68 Figure 16 Alignment of the L1 e Proteins 73 Figure 17 Alignment of the L1 Oe Proteins 77 Figure 18 Alignment of the L12e Proteins 80 Figure 19 Line Diagram of the L12e Proteins 83 Figure 20 Intra and Interprotein Relationships between the L10e and L12e Proteins 87 Figure 21 Summary of the Structure and Function of the 92 L11e, Lie, L10e and L12e Ribosomal Proteins Figure 22 Model of the Evolution of the L10e and L12e Genes and Proteins 97 viii Abbreviations AM V Avian myeloblastosis virus ATP Adenosine 5' triphosphate bp Base pair BPB Bromophenol blue BSA Bovine serum albumin dATP 2' deoxyadenosine 5' triphosphate dCTP 2' deoxycytidine 5' triphosphate ddATP 2',3' dideoxyadenosine 5' triphosphate ddCTP 2',3' dideoxycvtidine 5' triphosphate ddGTP 2',3' dideoxyguanosine 5' triphosphate ddTTP 2',3' dideoxythymidine 5' triphosphate dGTP 2" deoxyguanosine 5' triphosphate dITP 2' deoxyinosine 5' triphosphate DNA Deoxyribonucleic acid DTT Dithiothreitol dTTP 2' deoxythymidine 5' triphosphate EDTA Ethylenediamine tetracetic acid GTP Guanosine 5' triphosphate IPTG Isopropylthio (3 Dgalactoside Kbp Kilobase pair MOPS Morpholinopropane sulfonic acid mRNA Messenger RNA PIPES Piperazine N,N' bis[2 ethane sulfonic acid] RNA Ribonucleic acid RNase Ribonuclease rRNA Ribosomal RNA SDS Sodium dodecylsulphate SSC standard saline citrate Tris Tris hydroxymethylaminomethane 1RNA Transfer RNA XC Xylene cyanol Xgal 5 bromo 4 chloro 3 indolyl [3 D galactoside ix Ack,no%vted,y&rnents Sincere thanks to Pat Dennis for providing opportunity, advice and encouragement during the eons, fellow workers Sylvia Evans, Celia Ramirez, Bruce May, Phalgun Joshi, Peter Durovic, Janet Yee, Ivy Hui and Joan MacPherson for thoughts and discussions and Deidre de Jong Wong for large scale plasmid preps, the lemon pie and the meticulously crafted Opus on my much used eraser. Special thanks to Jeff Leung, Willa Downing and Craig Newton for tempting me (however occasionally) into the light of (day and) civilization, to Ross MacGillivray for technical expertise in the early days and Al Matheson for inspiration. I also wish to thank the security folks for understanding the need for perspective during those frequent rooftop sojourns and The Anteater for being. X float ReeJ 1 Part 1: Introduction 1.1 Early Evolution and the Archaebacteria Life has had a long residence on Earth; the most ancient indisputable microfossils of mat forming bacteria preserved as stromatolites occur in the Warrawoona group in Australia, with an age of 3500 million years (Walter, 1983). The most ancient geologic facies, the Isua Supracrustal Belt in Greenland which is too metamorphosized to preserve microfossil structures, retains carbon isotope ratios indicative of the presence of biological metabolism (Schidlowski, 1988). Because of a lack of geologic facies, bona fide fossils and a dearth of distinguishing fossiliferous structures in ancient organisms, the record provides little information on the primordial evolution of life. Throughout evolution organisms have carried their ancestry with them in their genes, thus molecular chronometers, proteins or nucleic acids maintaining constant functionality and wide distribution, can shed light on the evolution of extant organisms (Zuckerkandl and Pauling, 1965). Prior to 1977, extant life was viewed as dichotomous, the more ancient procaryotes giving rise, only recently through symbiosis, to the eucaryota (Margulis, 1970; Stanier, 1970; Schwartz and Dayhoff, 1978). In 1977 Woese and Fox (1977) proposed, based on comparative analysis of the slowly evolving, universally distributed, easily isolated and functionally constant small subunit ribosomal RNA, that extant life forms could be grouped into 3 urkingdoms, the eubacteria, the urcaryota (the nucleus of the modern eucaryote) and a novel group of organisms, the archaebacteria (Figure 1). Although the ensuing decade has seen vigorous debate on primordial evolution with various alternative phytogenies being proposed (the most recent being Cavalier - Smith, 1987 and Lake, 1988) the original archaebacterial conception remains the most promising description (Woese and Fox, 1978; Steitz, 1978; Fox etal., 1980; Van Valen and Maiorara, 1980; Hori et al., 1982; Lake et al., 1984; Stackebrandt, 1985; Garrett, 1985; Cavalier - Smith, 1986; Lederer, 1986; Lake etal., 1986; Lake, 1986a; Lake, 1986b; Stoffler and Stoffler-Meilicke, 1986; Woese etal., 1986; Zillig, 1986; Gouy and Li, 1989; Olsen and Woese, 1989). Archaebacteria are distinguished from eubacteria and eucaryota by a suite of unique and shared characteristics (Table 1; reviews: Jones et al., 1987; Woese, 1987; Danson, 1989). Archaebacteria display 3 distinct phenotypes derived from an anaerobic, thermophilic ancestor: methanogenic - anaerobic production of methane while reducing C 0 2 ; 2 Figure 1 The Phylogeny of the Urkingdoms The evolution of the archaebacteria, eubacteria and eucaryota from the ancestral cellular state, i.e. the progenote, is illustrated (from Woese, 1987). The distances are derived from comparative analysis of the 16S and 18S rRNA sequences. The chloroplast and mitochondria are descendents of symbiotic cyanobacteria and purple sulfur eubacteria respectively. The basal bodies and lysosomes of the eucaryota may also represent remnants of ancient symbiotic acquisitions of eubacterial cells by eucaryota. ARCHAEBACTERIA Holobocterium volconii I / Hofococcvs momSuoe I x Mefbanosfxnllum hungofei Melhanobodemwn formicicurn • Methanogens Mefhaoocoecui vooce/i'i Progenote_ Homo sapiens (human) Xenopus loevfs (frog) Zeo mays (corn) Socchoromyces cerevisicw (budding yeast) / Oxyirkha novo (protozoan) Oicfyos'efiom discoideum (cellwlor slime mold) Zeo mayi chloroplast Anocysfis n'tdutam Trypansomo brucei (trypanosome) EUCARYOTA EUBACTERIA 0.1 mutation* per sequence position 3 T a b l e l The Characteristics of the Urkingdoms Distinguishing features of the eubacteria, archaebacteria and eucaryota are listed. Abbreviations are chloramphenicol (CM), anisomysin (Ani), kanamycin (Kan), pseudouracil (\y), a - amanitin (Ama) and rifampin (Rif). Characteristic Eubacteria Archaebacteria Eucaryota Cellular Organization anucleate anucleate nucleated with organelles Genome Size (bp) Membrane Lipids 5x10 5 -5x10 6 ester linked straight chain 5 x 1 0 5 - 1 0 7 ether linked branched chain 1.5x10 7 -3x10 1 1 ester linked straight chain Cell Walls peptidoglycan various but not peptidoglycan various or none Ribosomes rRNA diptheria toxin antibiotic sensitivity 5S,16S,23S insensitive C M S Ani R K a n s 5S, 16S, 23S sensitive C M R A n i s K a n R 5S, 5.8S, 18S, 28S sensitive C M R A n i s Kan R Transfer RNA T\|/C loop 1 - methyl adenine initiator tRNA initiator amino acid T\|/CG absent 1 - methyl\|/\|/CG present 5' monophosphate 5' triphosphate N - formyl methionine methionine T\|/CG present 5' monophosphate methionine RNA Polymerase number of types subunits antibiotic sensitivity mRNA 1 5 AmaR Rifs uncapped 1 6-13 AmaR RifR uncapped 12 or greater Ama(Polll)s (Pol l+lll)R RifR 7 - methyl G cap and polyadenylation 4 thermoacidophilic - sulfur dependent oxidation or respiration at obligately high temperatures to 110°C and halophilic - requirement for extreme salt concentrations to the point of saturation. 1.2 Halophilic Archaebacteria Magrum et al. (1978) discovered that the extreme halophiles were members of the archaebacteria, having descended from the anaerobic methanogens. They have secured a place of paramount importance in the endeavors of humanity by rotting salted fish and turning salt pans a really neat red. Archaebacterial halophiles display a variety of morphologies (rod, coccus, disk and pleomorph), generate energy from the aerobic metabolism of carbohydrates and amino acids, and have optimal growth conditions of 30°C to 50°C, pH neutral {Halobacterium) or alkaline (Natronobacterium) and 1.7 M to 4.5 M NaCl. The best characterized halophiles are the closely related species Halobacterium halobium, H. cutirubrum and H. salinarium (now classified as strains of the single species H. salinarium; Larsen, 1984). Their genomes contain approximately 4000 Kilobasepairs of DNA and exhibit a high frequency of spontaneous rearrangement by means of deletion, transposition and recombination events caused by more than 50 families of insertion elements and repetitive sequences (Pfeifer et al., 1981; Sapienza et al., 1982; Charlebois and Doolittle, 1988; Pfeifer etal., 1988; Pfeifer et al., 1989). Their genomic DNA can be fractionated into a GC rich fraction containing stable unique single copy chromosomal genes and an AT rich fraction, which undergoes frequent recombinational events, derived from plasmids and a 70 Kilobasepair AT rich island of chromosomal DNA, both enriched for the insertion elements and repetitive sequences (Pfeifer and Betlach, 1985; Kushner, 1985). H. halobium produces a unique purple membrane, composed of the transmembrane protein bacterio -opsin, a proton pump that generates ATP photosynthetically through establishment of an electrochemical gradient (Stockenius et al., 1979; Stockenius and Bogomolni, 1982). Buoyancy in salt brines required for maintainance of optimal efficiency of the purple membrane is achieved by gas filled proteinaceous vesicles composed, almost exclusively, of a single vacuolar protein. The complex genetics of the purple membrane and vacuole systems have been well studied (Home et al., 1988; Leong et al., 1988a; Leong et al., 1988b; Betlach ef al., 1989; Pfeifer et al., 1989). Both of these systems are 5 inactivated by insertion elements at remarkably high frequencies: 10"4 for purple membrane production and 10~2 for gas vesicle production (Pfeifer etal., 1981). Various consensus sequences putatively responsible for expression of halophilic genes have been derived from the approximately 25 cloned genes, however, lack of a transformation system has severely limited functional analysis of these sequences. This lack should be alleviated by the recently described transformation system and shuttle vector for Haloferax volcanii (Charlebois etal., 1987; Cline etal., 1989; Lam and Doolittle, 1989). 1.3 Organization of Ribosome Components The central component of the translation apparatus in all contemporary organisms is a ribonucleoprotein particle, the ribosome. This complex and essential subcellular organelle universally functions by utilizing an mRNA template to align and polymerize amino acids (carried on a set of adaptor tRNAs) into protein. The eubacterial ribosome is comprised of 16S, 23S, and 5S rRNAs and approximately 50 proteins; their eucaryotic counterpart consists of 18S, 5.8S, 28S, and 5S rRNAs and approximately 75 proteins and in archaebacteria the ribosome is comprised of 16S, 23S, and 5S rRNAs and 50 to 65 proteins. In the eubacteria the organization, transcription and genetic regulation of the 16S - 23S - 5S rRNA transcription units and the ribosomal protein genes have been extensively studied (review: Lindahl and Zengel, 1986). In E. coli the rRNAs are encoded on seven operons; the 52 different genes encoding the ribosomal proteins are all single copy, organised into approximately 20 operons distributed throughout the genome and most are located in clusters of one or more transcription units that often contain additional genes encoding protein elements involved in replication (e.g. DNA primase), transcription (e.g. a subunit of RNA polymerase), translation (e.g. EFTu and EFG extrinsic translation factors) or other essential cellular processes. The major gene clusters are the 'RIF' (encoding 4 ribosomal proteins and 2 RNA polymerase subunits), 'STR' (encoding 2 ribosomal proteins and 2 translation factors), 'S10' (encoding 10 ribosomal proteins) and 'SPC (encoding 14 ribosomal proteins, an RNA polymerase subunit and 2 secretion proteins). Translation of the separate ribosomal protein mRNAs and transcription of the rRNA transcripts are balanced by autogenous translational regulatory mechanisms; assembly of ribosomal 6 particles occurs on nascent rRNA transcripts and neither free rRNAs nor free ribosomal proteins accumulate (review: Nomura etal., 1984). In eucaryotic cells three separate RNA polymerases are used for transcription of the 18S - 5.8S - 28S rRNA genes, for ribosomal protein encoding genes and for the 5S rRNA genes and tRNA genes. Ribosomal protein genes are encoded on multiple copies of monocistronic transcription units which are rarely clustered within the genome (reviews: Planta et al., 1986; Warner, 1989). Translation of ribosomal protein mRNAs occurs in the cytoplasm and the ribosomal proteins produced are imported into the nucleus where they are assembled into particles at the sites of rRNA transcription. The ribosomal subunits are then exported to the cytoplasm. Archaebacterial genes encoding the rRNA moieties of the ribosome have been well characterized (Mankin era/., 1984; Hui and Dennis, 1985; Dennis, 1985; Mankin and Kagramanova, 1986; Kjems and Garrett, 1987; Ree etal., 1989; Wolters and Erdmann, 1989). At the outset of this work the structural organization and expression of archaebacterial ribosomal protein genes was unknown. Recently, from this work and others, it has been found that genes encoding ribosomal proteins appear to be clustered as in the eubacteria and facets of their transcriptional organization and regulation have been elucidated (Dennis etal., 1985; Chant et al., 1986; Itoh etal., 1988; Itoh, 1988; Kopke and Wittman-Liebold, 1988; Shimmin etal., 1989a; Shimmin and Dennis, 1989; Auer etal., 1989; Spiridinova etal., 1989; Kopke and Wittmann-Liebold, 1989; Zillig etal., 1989; Ramirez etal., 1990a). 1.4 GTPase Domain of Escherichia coli The binding of extrinsic factors to the ribosome and the concomitant hydrolysis of GTP propagates structural rearrangements in the ribosome during the cyclic amino acid addition process (review: Liljas, 1982). From electron microscopic and biochemical observations it is apparent that the general structure and function of the ribosome factor binding domain (GTPase domain) was fixed prior to the divergence of the archaebacteria, eubacteria, and eucaryotes (Lake, 1983a; Lake, 1983b; Beauclerk et al., 1985; Moller and Maassen, 1986; Oakes et al., 1986; Hanauz etal., 1987; Shimmin and Dennis, 1989; Shimmin et al., 1989a; Shimmin etal., 1989b; Ramirez etal., 1989; Ramirez etal., 1990a; Ramirez era/., 1990b). Subsequently, the proteins forming this domain (i.e. in E. coli L11, L1, L10 and L12) have been subject 7 to evolutionary tinkering to refine efficiency and accuracy of protein synthesis in the three separate lineages. The essential features of each protein are, however, expected to be conserved. The GTPase domain forms the stalk structure on the large ribosomal subunit (Figure 2A; Strycharz etal., 1978; Kastner etal., 1981; Marquis et al., 1981; Moller et al., 1983; Traut era/., 1986) and is comprised of a complex of four copies (a pair of dimers) of the L12e protein bound to a single copy of the L10e protein through which the complex binds to the 23S rRNA (Figure 2B; Osterberg et al., 1976; Osterberg et al., 1977; Gudkov etal., 1978; Pettersson and Liljas, 1979; Petterson, 1979; Dijk et al., 1979; Beauclerk etal., 1984). The L11 protein is located at the base of the stalk and is known to bind 23S rRNA at residues 1052 -1112 (Schmidt etal., 1981; Stoffler-Melicke etal., 1983; Deng etal., 1986; El-Baradi etal., 1987). The L1 protein of E. coli has been localized to the ridge region on the 50S subunit opposite the L12 stalk and binds to and protects nucleotides 2100 - 2200 of 23S rRNA (Branlant et al., 1981; Lake and Strycharz, 1981; Oakes et al., 1986). A number of structural and functional features of the E. coli L11 protein have been reported. The molecule is highly elongated with an axial ratio of 5.5:1, is rich in proline residues and is the most extensively methylated ribosomal protein, containing nine methyl groups that are added to the protein after translation (Dognin and Wittmann-Liebold, 1977; Giri etal., 1978). The amino terminal domain has been implicated in the interaction of the ribosome with translation release factor 1 (Tate et al., 1984). The protein is involved in the synthesis of guanosine 5' diphosphate, 3' diphosphate (ppGpp) during the stringent response (Friesen etal., 1974; Parker etal., 1976; review: Cundliffe, 1986). The L1 protein functions to (i) maximize binding of peptidyl - tRNA to the P site, (ii) maximize the GTPase activity associated with EFG - mediated translation and (iii) autogenously regulate the translation of the L11 - L1 mRNA; excess L1 protein not incorporated into ribosomes can bind to a sequence within the 5' untranslated leader of the L11 - L1 mRNA that exhibits both primary and secondary structural similarity to the L1 binding site on 23S rRNA, thereby preventing translation (Dean and Nomura, 1980; Subramanian and Dabbs, 1980; Baughman and Nomura, 1981; Yates and Nomura, 1981; Sander, 1983; Kearney and Nomura,1987; Thomas and Nomura, 1987). The L10 protein has binding sites for 23S rRNA and four L12 proteins but an active role within the ribosome in the translation process has yet to be demonstrated. Both L10 and the L10 - L12 protein 8 Figure 2 Structure of the GTPase Domain (A) A model of the 50S subunit of Escherichia coli derived from a computer composite of electron micrographs; 'ST', 'FT and 'L1' indicate the stalk, L11 ridge and L1 shoulder of the subunit respectively (adapted from Radermacher et al., 1987). (B) A schematic illustrating the composition and location of the GTPase domain within the 50S subunit. (C) The structure of the E. coli L12 protein (taken from Liljas et al., 1986). The carboxy terminal globular domain of L12 is located at the tip of the stalk structure in diagrams A and B. LflRGE HIBQSOmflL S U B U M T 9 complex function as autogenous translational regulators of the L10 -1_12 transcript (Johnsen era/., 1982; Nomura etal., 1984) L12 is a highly elongated molecule composed of amino and carboxy terminal globular domains connected by an alanine - proline rich region (Figure 2C; Osterberg era/., 1976; Leijonmark etal., 1981). The functions of five translation factors are known to depend upon L12 : IF-2, EF-Tu, EF-G, RF-1 and RF- 2 (review: Liljas, 1982). The first three of these factors associate with the ribosome in complex with a GTP molecule to promote a structural rearrangement before GTP is hydrolysed and the factor is released from the ribosome. Biophysical studies on the L12 protein indicate that the amino terminal domain spontaneously dimerizes and contains the site for binding the L12 protein dimers to the L10 protein (Gudkov'and Behlke, 1978; Koteliansky et al., 1978). The carboxy terminal domain forms a compact structure of alternating a helices and P sheets that crystallizes as a dimer, contains an anion (potential GTP) binding site, a putative dimerization site, undergoes a conformational change upon interaction with extrinsic translation factors during the protein synthesis cycle and may interact with those factors through a conserved face (Gudkov and Gongadze, 1984; Burma et al., 1985; Leijonmarck and Liljas, 1987). The two domains are separated by an alanine - proline rich region believed to be unstructured and to function as a flexible hinge between domains of the L12 proteins, accounting for the observed high mobility of the carboxy terminal domain (Tritton, 1978; Leijonmarck etal., 1981; Cowgill etal., 1984). The genes encoding the four proteins of the GTPase domain are genetically linked with two genes encoding RNA polymerase subunit proteins (p and P') in the order L11 - L1 - L10 - L12 - P - P' (Figure 3; Lindahl et al., 1975). The three kilobasepair region of genomic DNA encoding the L11, L1, LtO and L12 proteins has been sequenced and the regulation and expression of the genes within it have been extensively characterized (Post et al., 1979; reviews: Lindahl and Zengel, 1986; Jinks-Robertson and Nomura, 1987). Regulation of the gene cluster is complex; two major promotors upstream of the L11 and L10 cistrons yield both bicistronic L11 - L1 and L10 - L12 transcripts and tetracistronic L11 - L1 - L10 - L12 transcripts. The RNA polymerase subunits encoded by the downstream P and P' genes are produced by elongation of a fraction (20%) of the transcripts exiting the L12 gene, the remainder of the transcripts are terminated by a transcription attenuator in the L12-P intergenic space (Dennis, 1977; Barry et al., 1979, Barry etal., 1980; Dennis, 1984). Sequences surrounding the RNaselll processing site 10 Figure 3 Summary of the Gene Structure of the L11, L1, L10 and L12 Genes in Escherichia coli The organization and transcription of the L11, L1, L10, and L12 ribosomal protein gene cluster of Escherichia coli is depicted. Ribosomal protein encoding genes are solid boxes and other protein encoding genes are striped boxes. All genes are oriented and transcribed rightwards. The filled circles ( • ) represent 5' transcript ends and the vertical lines (I) represent 3' transcript ends. The open boxes (•) at the ends of trancripts indicate regions of multiple 3' trancript ends. Only the 3' end of the tufB gene is indicated. Triangular interruptions (A) represent RNaselll processing sites and the vertical line on the transcripts running through the L12 - (3 intergenic space represents a transcription attenuator. The checkered boxes (Q) represent sites of autogenous regulation by the L1 and L10 proteins and the L10 - L12 complex by translational inhibition of their respective mRNAs. Escherichia coli tufB secE nusG L i t LI LID L12 fl fl' / / / / / \ EZZZZZZZ1 T77 771 777/77\ \- - 4 -fl t-A 1 Kb 11 downstream trom the transcription attenuator appear to be essential for efficient translation of the (3 and p' genes although processing at this site has no effect on expression of these genes (Barry et al., 1980; Dennis, 1984). The L1 protein autogenously regulates the translation of the L11 and L1 proteins through the leader region of the L11 - L1 mRNA; the regulatory site is well characterized and overlaps with the L11 translation initiation codon (Baughman and Nomura, 1983; Thomas and Nomura, 1987; Said era/., 1988). The L10 protein and L10 - L12 complex autogenously regulate the translation of the L10 - L12 mRNA. The regulatory site is located 140 nucleotides upstream of the L10 translation initiation codon; a model for translational regulation by alternative secondary structures has been proposed to account for the long range effect of the regulatory protein(s) (Fiil etal., 1980; Johnsen et al., 1982; Christensen et al., 1984; Petersen, 1989). The mechanism of the translational enhancement required to produce four copies of the L12 protein versus single copies for all other ribosomal proteins remains unknown although it has been suggested that a promotor exists in the L10 - L12 intergenic space (Newman et al., 1979; Ma et al., 1981). 1.5 Ribosomal Proteins of Halobacterium cutirubrum Early studies of the extreme halophile Halobacterium cutirubrum showed that their ribosomes exhibit several unique characteristics that distinguish them from the ribosomes of eubacteria, eucaryota and the thermoacidophilic and methanogenic archaebacteria, suggesting that their structures have undergone substantial alterations in adapting to their extreme environment. Ribosomes of the extreme halophiles require at least 3.4 M K + and 0.1 M M g 2 + to stabilize their structures; conditions capable of disintegrating and denaturing ribosomes from other organisms (Bayley and Kushner, 1964; Rauser and Bayley, 1968; Kushner, 1985). Most if not all of the 53 ribosomal proteins are acidic with an average isoelectric point of 3.9 (Bayley and Kushner, 1964; Bayley, 1966; Strom and Visentin, 1973; Strom et al., 1975). Acidic residues bind more water molecules per side chain than other amino acids, allowing them to maintain a hydration shell around the proteins in a high salt milieu (Bayley and Morton, 1978; Saenger, 1987; Eisenberg and Wachtel, 1987). Approximately 25 of the proteins have had their amino terminal sequences determined; due to sequence divergence and a lack of assayable functions and comparable sequences, only 6 of the proteins were identified as potential homologues to eubacterial, archaebacterial 12 or eucaryotic ribosomal proteins (Oda et al., 1974; Duggleby et al., 1975; Yaguchi et al., 1982; Matheson etal., 1984). The H. cutirubrum L20 protein was demonstrated to have homologues in eubacteria (E. coli L12), in eucaryota (Artemia salina eL12) and in archaebacteria (Methanobacterium thermoautotrophicum 'A' protein) by sequence comparison and by virtue of sharing the characteristics of being (i) the most acidic ribosomal protein, (ii) extremely alanine rich, (iii) the only protein present in multiple copies per ribosome and (iv) part of the protein complex forming the stalk structure of the 50S subunit (Oda etal., 1974; Amons etal., 1979; Matheson etal., 1979; Visentin etal., 1979; Yaguchi etal., 1980; Gudkov etal., 1984)' The homology of the H. cutirubrum L11 protein and E. coli L11 proteins was based on the available short proline rich amino terminal sequence similarity and the presence of the protein in the GTPase domain (Matheson etal., 1984). Other putative homologies were based solely upon short sequence similarities. 1.6 The Present Investigation The present investigation concerning the GTPase domain of H. cutirubrum had 3 objectives: (i) provision of basic data on structure and organization of translated genes in archaebacteria, (ii) investigation of the expression and regulation of those genes and (iii) to provide perspectives on both the early evolution of the translation apparatus and its later adaptation to high concentrations of salt within the extreme halophiles. Proteins comprising the GTPase domain (specifically L20 and L11) were chosen as cloning would be facilitated by the available partial amino acid sequences, the expression and regulation might prove as complex as that of the GTPase domain of E. coli and homologues from the extant urkingdoms were available for evolutionary comparison studies. This thesis presents the cloning, sequencing, transcriptional characterization and evolutionary analysis of the H. cutirubrum homologues of the L11, L1, L10 and L12 ribosomal proteins comprising the GTPase domain of E. coli. 13 Part 2: !MateriaCs arat Tt&thods 2.1 Materials Culture media components were obtained from: agar, yeast extract, tryptone and casamino acids from Difco Laboratories, ampicillin from Sigma Chemical Co., IPTG and Xgal from BRL and D glucose from BDH. Phenol was obtained from Mallinkrodt, redistilled and stored under water at 4°C. Acrylamide was from Eastman Kodak, BioRad Laboratories and Serva and N N' methylene bisacrylamide was from Eastman Kodak. Agaroses were obtained from: analytical agarose from Sigma Chemical Co., preparative agarose from Schwarz/Mann Biotech, low melting point agarose from BRL and Nusieve agarose from FMC Corporation. Formamide was deionized with BioRad AG501 - X8 - D mixed bed resin for one hour (10 mL resin per 100 mL formamide) and stored at -20°C. Formaldehyde was from BDH. Eastman Kodak XRP-1, XAR-5, Amersham Hyperfilm p Max films and Dupont Cronex Lightning Plus intensifying screens were used for autoradiography of labelled nucleic acids. 2.2 E n z y m e s Restriction enzymes and DNA modifying enzymes were purchased from the following commercial suppliers and used according to the manufacturers recommendations: Boehringer Mannheim Canada (BMC), Bethesda Research Laboratories (BRL), International Biotechnologies Incorporated (IBI), New England Biolabs (NEB), New England Nuclear (NEN) and Pharmacia (P). Other enzymes were purchased from: T4 polynucleotide kinase - PL Biochemicals, P; DNA polymerase I - BMC; calf intestinal alkaline phosphatase - BMC, P; ribonuclease A , lysozyme - Sigma; T4 DNA ligase and S1 nuclease - P; Klenow fragment - BMC, P, BRL, Promega; AMV reverse transcriptase - BMC, IBI; Sequenase - United States Biochemical Corp.; T7 DNA polymerase - P; exonuclease III - BMC and Promega; terminal transferase - BRL. 2.3 Nucleotides and Oligonucleotides Ribonucleoside triphoshates, deoxyribonucleoside triphosphates, dideoxyribonucleoside triphosphates and (1) - phosphorothioate deoxynucleotide triphosphates were obtained from Pharmacia. 14 a 3 2 p j -y32p a n c | a 3 5 S labelled nucleotides were obtained from New England Nuclear and Amersham. The universal 17 nucleotide forward, 5' d[GTAAAACGACGGCCAGT] 3' and 17 nucleotide reverse, 5' d[AACAGCTATGACCATG] 3' sequencing primers were obtained from New England Biolabs. Oligonucleotides used as probes for genes, for progressive deletion of inserts in M13 phage by the procedure of Dale et al. (1985) and for primer extension analysis were synthesized by T. Atkinson (University of British Columbia) on an Applied Biosystems 380B DNA Synthesizer and supplied as lyophilized crude powders (Table 2). Crude oligonucleotides were purified by polyacrylamide gel electrophoresis and C18 Sep-Pak reverse phase chromatography and quantified by measuring the A26O (Atkinson and Smith, 1984). 2.4 Bacterial Strains, Plasmids and Phage Vectors Halobacterium cutirubrum NRCC 34001 was obtained from A T . Matheson at the University of Victoria. Escherichia coli strain JM83 (ara, A(lac-proAB), rpsL, O80dlacZAM15) was used for propagation of plasmids and construction of the library libl_W22 (Viera and Messing, 1982; Messing, 1983). Strains DH1 (F-, recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, X-) and DH5CC (F-, O80dlacZAM15, A(lacZYA-argF)U169, recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, X-) were used for maintainance of plasmids (Hanahan, 1983). Strains JM101 (supE, thi, A(lac-proAB), [F, traD36, proAB, lacl°.ZAM15]) and JM109 (recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, [F\ traD36, proAB, lacl^ZAMIS]) were used for propagation of M13 phage (Messing, 1983). Strain JC8111 (recB21, recC22, recF143, sbcB15, argE3, his-4, leu-6, proA2, thr-1, rpsL31, galK2, lacY1, ara-14, xyl-5, rntl-1, supE44) was used for construction of the libraries libLW37 and libl_W38 (Boissy and Astell, 1985). The plasmid vectors pUC8, pUC12, pUC13, pEMBL8+, pEMBL8-, pTZ18R, pTZ19R and pBR322 (Bolivar etal., 1977; Viera and Messing, 1982; Messing, 1983; Dente et al., 1983) and the phage vectors M13mpl0, M13mp11, M13mp18 and M13mp19 (Messing, 1983; Yanisch-Perron etal., 1985) were used for cloning, subcloning and sequencing. Plasmids pUC12 and pUC13 were obtained from M. Zoller (University of British Columbia), pEMBL8+ and pEMBL8- from J. Leung (University of British Columbia) and pTZ18R and pTZ19R were purchased from Pharmacia. 15 Table 2 Oligonucleotides Designation Sequence 5' - 3'1 Length Position2 Degeneracy Protein or Strand 4 Transcript3 (A) OLIGONUCLEOTIDES FOR GENE PROBES OLW9 [6] A l a T y r V a l T y r G l u M e t [1] GCGTAGACGTATTCCAT A A A C [2] A l a G l u T h r l l e G l u V a l [7] 0 LW17 GCGGAGACGATAGAGGT A A A T A T T C C C [95] AsnAspAsnProPheGly [100] OLW35 AATGATAATCCGTTTGG C C C A C T C 17 16 4034-4018 L20 {L12e} antisense 17 192 1625- 1641 L11 {L11e} sense 17 64 3236 -3252 L3/4{L10e} sense (B) OLIGONUCLEOTIDES FOR PRIMER EXTENSION OLW36 ATGTGGGCTTCTGTCGA 17 1 1165 - 1181 ORF OLW38 CGATCTGCGTCTCCTGT 17 1 2494 - 2478 L1e- L10e - L12e OLW51 TACGTCGACCGGCGTGGGAC 20 1 1714 - 1695 NAB - L11e OLW52 CT TCGAGGTCCACCTCGATG 20 1 1429 - 1410 NAB OLW54 CGTTGTCTGCCATCTTTCAC 20 1 2326 - 2307 L1e- L10e - L12e (1) (2) (3) (4) The oligonucleotide sequence is written below the peptide sequence from which it was derived where applicable. Numbers preceding and following the amino acid sequence indicate the position of the peptide in the protein. The position corresponds to that in Figure 5. The oligonucleotide hybridizes to the gene encoding the indicated equivalent protein for the gene probes and to the indicated transcript for the primer extensibn oligonucleotides. Antisense indicates that the oligonucleotide is complementary to the mRNA. All oligonucleotides for primer extension analysis are complementary to the mRNA. 16 2.5 Media and Culture Conditions Halobacterium cutirubrum was grown at 42°C in a rich medium as described by Bayley (1971). The medium contained 4.28 M NaCl, 81 mM MgSC^, 27 mM KCI, 10 mM Na citrate, 180 [lM FeSC>4, 1% w/v yeast extract and 0.75% w/v casamino acids, was adjusted to pH7.4 - 7.6, autoclaved 10 minutes, filtered through Whatmann No.1 filter paper, acidified with HCI to pH6.2 and autoclaved for 20 minutes. H. cutirubrum stocks were stored in broth culture at 4°C and maintained by subculturing at 6 month intervals. Escherichia coli was grown at 37°C in M9 minimal medium (50 mM Na2HP04, 25 mM KH2P04, 8.5 mM NaCl, 20 mM NH4CI, 1 mM MgS04, 0.1 mM CaCl2 and 0.2% glucose; Miller, 1972) or YT rich medium (86 mM NaCl, 0.8% w/v tryptone and 0.5% w/v yeast extract; Maniatis et al., 1982). Agar plates contained 1.5% w/v agar and soft agar overlays for phage growth contained 0.75% w/v agar. Ampicillin was added to a concentration of 20 |i.gmL~1 to 200 u.gmL"1 when required for plasmid selection and 50 |i.M IPTG and 0.005% w/v Xgal were added to cooled (45°C) agar for visualization of p galactosidase activity. 2.6 General Molecular Biology Techniques General techniques of molecular biology were done essentially as described in Maniatis etal. (1982). Small and large scale plasmid preparations were done by the methods of Birnboim and Doly (1980) and Maniatis et al. (1982). Phage preparations were done as described by Sanger et al. (1977), Messing (1983) and Dente etal. (1983) 2.7 Isolation of Halobacterium cutirubrum Nucleic Acids For isolation of H. cutirubrum DNA , a 2 L culture was grown to an A600 o f 1 -5 and pelleted, yielding 12 g of cells. The cells were resuspended in 30 mL of 4.0 M NaCl, 120 mM MgS04,10 mM Na citrate, 30 mM KCI, lysed at 0°C for 40 minutes by addition of 6 mL of 10% w/v Na deoxycholate and diluted with 70 mL of 100 mM Tris-HCl pH8.0,10 mM EDTA. The lysed cells were extracted twice with phenol, twice with a 1:1 mixture of n-octanol:chloroform and dialysed against 10 mM Tris-HCl pH8.0,1 mM EDTA. CsCl was added and the DNA purified through ultracentifugation in a Beckman Ti60 rotor for 70 hours at 36 Krpm. Recovered DNA was precipitated twice with ethanol and resuspended in 10 mM Tris-HCl pH8.0, 1 mM EDTA and stored at minus 20°C. The yield of pure genomic DNA was 6.2 mg. 17 Glass and plastic wares used for isolation of total cellular H. cutirubrum RNA were treated for 1 hour at 121°C with 0.1% v/v diethylpyrocarbonate. Log phase H. cutirubrum cells (A600 o f 0.5 - 0.7) were cooled rapidly with frozen media, treated for 5 minutes with 10 mM NaN3 and pelleted. The pellet was resuspended in 1 mL of 37 mM NH4CI, 2 mM Na2HP04, 2 mM K H 2 P O 4 and 5 mM NaCl, lysed by heating at 100°C for 30 seconds after addition of 1 mL of 100 mM NaCl, 10 mM EDTA and 0.5% w/v SDS, extracted thrice with phenol, once with chloroform and precipitated twice with ethanol. DNA contaminants were removed by ultracentrifugation though a 5.7 M CsCl block gradient or by selective precipitation of RNA by 1 M LiCI (Chirgwin et al., 1979; Auffray and Rougesn, 1980). The RNA was resuspended in 10mM Tris-HCl pH7.5,1 mM EDTA and stored at -70°C. Yields were approximately 250 (ig from a 10 mL culture. 2 .8 Preparation of Radioactive Probes Oligonucleotides were 5' end labelled with 5 units of T4 polynucleotide kinase in a 10 U.L mixture containing 50 u.Ci of 3000 Ci mmol"1 78 2 p ATP, 5 pmol oligonucleotide, 50 mM Tris-HCl pH8.0, 10 mM MgCl2, 10 mM DTT. The labelled oligonucleotides were purified by exclusion chromatography on Sephadex G25 fine or by ethanol precipitation. Restriction fragments containing recessed 3' ends were 3' end labelled using Klenow enzyme or 5' end labelled using T4 polynucleotide kinase after dephosphorylation with calf intestinal alkaline phosphatase as described by Maniatis et al. (1982). High specific activity double stranded DNA probes were obtained by nick translation using DNA polymerase I and two radioactive deoxynucleotide triphosphates (Rigby er al., 1977) or by random priming from mixed oligonucleotides with Klenow enzyme (Fienberg and Vogelstein, 1982). High specific activity single stranded DNA probes were generated by extension of oligonucleotide primers on M13 templates in the presence of two radioactive deoxynucleotide triphosphates. 2.9 Southern Blots Southern blots of genomic DNA hybridized to radioactive oligonucleotide mixtures were used to identify the genomic restriction fragments containing the GTPase domain ribosomal protein genes (Southern, 1975). Genomic DNA was digested with a variety of restriction enzymes, loaded onto 18 horizontal agarose gels containing 0.5% to 2% w/v agarose, 40 mM Tris-HCl pH8.0, 20 mM Na acetate, 5 mM EDTA and electrophoresed at 3 Vcm" 1 . The DNA was then transferred to nitrocellulose by blotting with 20x SSC and dried at 80°C for 2 hours. Dried filters were prehybridized in 6x SSC (900 mM NaCl, 90 mM Na citrate), 10x Denhardt's (2% w/v bovine serum albumin, 2% w/v polyvinyl-pyrollidine, 2% w/v ficoll) at 60°C for 1 hour before addition of radioactive DNA probe and hyridization for 12 hours at reduced temperature according to the characteristics of the probe DNA (i.e. oLW9, 49°C; oLW17, 45°C; 0LW35, 41 °C). Blots were washed briefly twice at room temperature in 2x SSC, twice at the hybridization temperature for 10 minutes in 1x SSC. once at the hybridization temperature for 10 minutes in 0.2x SSC, dried and exposed to Kodak XRP-1 film. Southern blot experiments utilizing probes longer than 40 nucleotides (i.e. determination of copy number of the GTPase domain genes and checking the sequence fidelity of the pLW173 and pLW180 clones) were performed by transferring the restricted and electrophoresed DNA onto Genescreen nylon filters (New England Nuclear) with 2x SSC, drying at 80°C for 2 hours, prehybridization at 60°C in 2x SSC, 5x Denhardt's, 50 |igmL" 1 denatured calf thymus DNA, 0.5% SDS for 6 hours before addition of the radioactive DNA probe (concentration of less than 20 ngmL"1) and hybridization at 60°C for 12 hours. The filters were then washed briefly twice at room temperature in 2x SSC, twice at 60°C for 10 minutes in 1x SSC, 0.5% SDS, dried and exposed to Kodak XAR-5 film. For the experiment determining the copy number of the GTPase domain genes decreased stringency was achieved by coordinated reduction of the hybridization and wash temperatures to a minimum of 45°C and for the sequence fidelity Southern blot restricted DNA was electrophoresed in 3% Nusieve agarose for superior resolution of low molecular mass fragments. 2 . 1 0 Construction and Screening of Libraries The 1.3 Kilobasepair BamHI - PstI fragment of H. cutirubrum genomic DNA hybridizing to the Hcu L20 specific oligonucleotide probe oLW9 was cloned by the following procedure. Genomic DNA (100 u.g) was doubly restricted with BamHI and PstI, electrophoresed on a 4% polyacrylamide gel, stained with ethidium bromide and 6 fractions containing DNA in the size range of 1.0 to 1.6 Kilobasepairs were recovered by excision from the gel, electroelution and ethanol precipitation. The fraction containing the 1.3 19 Kilobasepair fragment was identified by electrophoresing an aliquot of each fraction on a horizontal agarose slab gel, transferring the DNA to nitrocellulose by blotting with 20x SSC, hybridization with 5" end labelled oLW9, washing nonstringently with 2x SSC at 40°C for 20 minutes and exposure to Kodak XRP-1 film. The library libLW22 was constructed by ligating the DNA size fraction hybridizing to oLW9 into BamHI - Pstl restricted pUC8, transformation into JM83 and plating at a density of 500 colonies per plate onto 15 cm agar plates containing amptcillin, IPTG and Xgal. Colonies were lifted from the plates with Colony- PlaqueScreen (New England Nuclear), denatured twice for 2 minutes with 0.5 M NaOH, neutralized twice for 2 minutes with 1.0 M Tris-HCl pH7.5 and dried at room temperature. Each disk was prehybridized in 5 mL of 5x SSC, 0.5% SDS, 10x Denhardt's for 6 hours, hybridized with 5' end labelled oLW9 (2 Mcpm per disk) for 12 hours at 49°C, washed briefly twice at room temperature in 2x SSC, twice at 49°C for 10 minutes in 1x SSC, 0.5% SDS, once at 49°C for 10 minutes in 0.2x SSC, dried and exposed to Kodak XRP-1 film. Positive colonies were picked, streak purified and checked for the correct insert DNA by Southern blotting. This yielded multiple independent clones, two of which, pLW99 and pLW102, were chosen for further study. The 5.7 and 5.1 Kilobasepair BamHI - Clal fragments of H. cutirubrum genomic DNA hybridizing to the Hcu L11 specific oligonucleotide probe oLW17 were cloned by the following procedure. Genomic DNA (100 |ig) was doubly restricted with BamHI and Clal, electrophoresed on a 0.5% low melting point agarose gel, stained with ethidium bromide and 8 fractions containing DNA in the size range of 4 to 7 Kilobasepairs were recovered by excision from the gel, melting of the gel matrix at 55°C, extraction with phenol twice and twice precipitated with ethanol. Separate fractions containing the 5.7 and 5.1 Kilobasepair fragments were identified by Southern analysis using oLW17 as probe as described above for the Hcu L20 specific fragment. The library libLW38 was constructed by ligating the DNA size fraction containing the 5.1 Kilobasepair fragment hybridizing to oLW17 into pBR322 that was doubly restricted with BamHI and Clal and dephosphorylated with calf intestinal alkaline phosphatase. The ligated mixture was transformed into JC8111 and then treated as described for libLW22 except that 5' end labelled oLW17 (25 Mcpm per disk) was used as probe and the hybridization and stringent wash temperatures were 45°C. This yielded two independent clones, pLW173 and pLW180, containing the 5.1 Kilobasepair fragment which were used for further studies. Two clones, pLW155 and pLW156, containing the 5.7 Kilobasepair fragment were 20 isolated from a library, libLW37, constructed as for libLW38 except for using the 5.7 Kilobasepair DNA size fraction as insert DNA. Subcloning and sequencing of a 1 Kilobasepair EcoRI fragment contained within the insert of pl_W155 that hybridized to ol_W17 indicated that the match to oLW17 was fortuitous and thus characterization of these clones was not persued. 2.11 DNA Sequence Analysis DNA fragments for chemical sequencing were prepared by 3' or 5' end labelling, followed either by digestion with a restriction enzyme yielding size differentiated fragments or by denaturation. The restricted double stranded or strand separated single stranded uniquely end labelled fragments were then purified through polyacrylamide. Chemical sequences of DNA and oligonucleotides were performed essentially as described by Maxam and Gilbert (1977) and by a modified procedure featuring the immobilization of DNA fragments on treated paper substrates (Rosenthal era/., 1985; Rosenthal et al., 1986). For this method 200 Kcpm of a uniquely 3' or 5' endlabelled DNA fragment was denatured by heating at 100°C for 3 minutes, chilled rapidly on ice and immobilized on strips of Hybond M & G paper (Amersham). The strips were washed twice in distilled water, once in ethanol, air dried and transferred to 500 |iL Eppendorf tubes where the chemical modification reactions were performed. Reactions were T > C (380 u,M K2Mn04 for 20 minutes), C (4M hydroxylamine hydrochloride pH6.0 for 10 minutes), A + G (88% v/v formic acid for 10 minutes) and G (50 mM ammonium formate pH3.5, 0.7% v/v dimethyl sulphate for 45 seconds). Reactions were terminated by washing the strips twice in distilled water and once in ethanol. Cleavage was accomplished by addition of 75 p:L of 10% v/v piperidine and heating to 90°C for 30 minutes. The products were then recovered by two lyophilizations, redissolved at 1 - 20 Kcpm |!l_" 1 in FDM (98% formamide, 10 mM EDTA, 2 mgmL-1 XC and 2 mgmL"1 BPB), denatured by heating at 90°C for 3 minutes and electrophoresed on polyacrylamide sequencing gels. For enzymatic sequencing subclones were generated by shotgun and fragment specific subcloning into pUC, pEMBL, pTZ and M13 vectors. Deletion of some of these derivatives was performed on double stranded DNA with exonuclease III as per Henikoff (1984) and on single stranded DNA by the method of Dale et al. (1985). Double stranded DNA templates were prepared by the alkaline denaturation and ethanol precipitation in the presence of the appropriate oligonucleotide primer as described by Hattori and 21 Sakaki (1986). If required the plasmid DNAs were purified through CsCl centrifigation prior to alkaline denaturation. Single stranded DNA templates were prepared as described from M13 derivatives (Sanger etal., 1977; Messing, 1983), from pEMBL derivatives utilizing the IR1 helper phage (Dente et al., 1983) and from pTZ derivatives utilizing the M13K07 helper phage as described by the manufacturer (Pharmacia). Enzymatic sequencing with Klenow fragment, AMV reverse transcriptase and Sequenase was performed essentially as described by Sanger et al. (1977) or by the manufacturers recommendations. For resolution of secondary structure the analogues 7 deaza 2' deoxyguanosine 5' triphosphate and deoxyinosine 5" triphoshate (dITP) were sometimes substituted for dGTP and both dATP and dCTP were used (separately) as the labelled nucleotide (Mills and Kramer, 1979; Mizusawa et al., 1986). For sequencing with T7 DNA polymerase the primer was annealed to the template in 7 |il_ of 40 mM Tris-HCl pH7.5,15 mM MgCl2,50 mM NaCl, 2 to 10 ng oligonucleotide primer and 0.5 - 2 |ig template by heating to 60°C for 10 minutes and cooling slowly to 35°C. To the annealed template - primer was added 0.5 c c 3 2 P dCTP (5 (iCi of 3000 Ci mmor 1), 0.5 jlL of 300 mM DTT, 1 U.L of nucleotide elongation mix (2 |lM dATP, 2 p:M dGTP, 2 \lM dTTP) and 1 u,L of diluted T7 DNA polymerase (0.4 -1.5 units). This labelling reaction was allowed to proceed for 5 minutes at room temperature before 2 J I L was added to1 fxL of termination mix specific for each nucleotide (40 mM Tris-HCl 7.5,10 mM MgCl2, 50 mM NaCl, 150 U.M dATP,150 U.M dGTP,150 JJ.M dCTP,150 |1M dTTP and 3.5 U.M ddATP or ddGTP or ddCTP or ddTTP) and the mixes incubated at 37°C for 5 minutes. Reactions were stopped by addition of 3 (IL of FDM and heat denatured at 90°C for 2 minutes prior to loading onto polyacrylamide sequencing gels. Polyacrylamide sequencing gels (ratio of acrylamide to N N' methylene bisacrylamide 39:2) were composed of and treated to various combinations of the following characteristics: (i) gel length 38 cm or 65 cm; (ii) gel thickness 0.17 mm, 0.25 mm, 0.35 mm or variable wedge; (iii) acrylamide concentration 4% to 20%; (iv) buffers 1x TBE (90 mM Tris-HCl pH8.0, 90 mM boric acid, 2.5 mM EDTA), 0.5x TBE, modified TBE (135 mM Tris-HCl pH8.0, 45 mM boric acid, 2.5 mM EDTA) or buffer gradient as described by Biggin et al. (1983) and (v) gel temperature while electrophoresing 40°C to 80°C. After electrophoresis gels were dried onto Whatmann No.1 (for 0.17 mm thick gels) or Whatmann 3MM (for all thicker gels) and exposed to Kodak XRP-1, XAR-5 or Amersham Hyperfilm p Max. 22 2.12 Northern Blots Twenty \ig of total cellular RNA was denatured at 70°C for 10 minutes in 50 mM MOPS, 1 mM EDTA, 0.66 M formaldehyde and 40% v/v formamide, electrophoresed through a 0.66 M formaldehyde, 50 mM MOPS, 1 mM EDTA, 1.5% or 3% w/v agarose horizontal slab gel and transferred to nitrocellulose filters by blotting with 20x SSC. The filters were hybridized with radioactive DNA probes (generated by Klenow extension of appropriate M13 subclones of pLW173) in 5x SSC, 40% v/v formamide and 2x Denhardt's at 42°C and washed stringently in 0.2x SSC at 52°C - 59°C for 30 minutes, dried and exposed to Kodak XAR- 5 film with an intensifiing screen. 2 .13 Analysis of in vivo RNA Transcripts The in vivo RNA transcripts were analysed by both S1 nuclease protection and primer extension experiments (Favaloro et al., 1980; Newman, 1987). For the S1 nuclease protection of DNA by RNA, 100 Kcpm - 250 Kcpm of a 5' or 3* end labelled DNA probe fragment (500 Kcpm pmor 1) was ethanol precipitated with 5 - 20 \xg of total cellular RNA obtained from log phase cells, resuspended in 20 U.L of 40mM PIPES pH6.8, 400 mM NaCl, 1 mM EDTA and 80% v/v formamide, denatured at 80°C for 15 minutes and hybridized for 3 hours at 64°C - 71°C. Digestion of unprotected single stranded nucleic acids by S1 nuclease was accomplished by addition of 300 of ice cold 280 mM NaCl, 30 mM Na acetate pH 4.4, 4.5 mM ZnCl2, 20 (igmL"1 single stranded M13 DNA and 90 units of S1 nuclease, and incubation at 37°C for 30 minutes. Products were precipitated twice with isopropanol, resuspended in 5 jiL FDM and denatured at 90°C for 2 minutes before loading alongside appropriate size standards (either 3' end labelled and Mspl restricted pBR322 DNA or a chemical sequence derived from the DNA probe fragment) on polyacrylamide sequencing gels. In addition to S1 nuclease experiments, primer extension, by AMV reverse transcriptase of DNA oligonucleotides annealed to RNA was used to localize the 5' ends of in vivo RNA transcripts. One ng of 5' end labelled oligonucleotide (100 Kcpm pmol"1) was annealed to 5 - 20 [ig of total cellular RNA in 10 U.L of 80 mM KCI, 20 mM Tris-HCl pH8.5 and 0.5 mM EDTA by heating to 65°C for 5 minutes, cooling slowly to 37°C and incubating at 37°C for 1 hour. Extension was accomplished by addition of 10 (IL of 10 mM MgCl2, 1 mM of each deoxyribonucleotide triphosphate, 10 mM 2 mercaptoethanol, 5 units RNase 23 inhibitor and 5 units AMV reverse transcriptase and incubation for a further hour at 37°C. The products were ethanol precipitated twice, redissolved in 5 (XL FDM and denatured by heating at 90°C for 2 minutes before loading on a polyacrylamide sequencing gel alongside a sequencing ladder generated from extension of the labelled oligonucleotide and an appropriate single stranded template. 2.14 Nomenclature The literature on the ribosomal proteins presents a chaotic set of conflicting systems of nomenclature and with the advent of rapid sequencing of both proteins and nucleic acids the situation will likely deteriorate further. The system of nomenclature used in this work is based upon each protein having a three letter organism identifier followed by an alphanumeric protein identifier as follows: 1) Organism identifier - organisms are identified by the first letter of the genus and first two letters of the species: Spinacea oleracea is identified as Sol. Chloroplasts and mitochondria are identified by a {c} or {m} following the species identifier, thus: Spinacea oleracea chloroplast is identified as Solfc}. 2) Protein identifiers - proteins may have any or all of A) experimental, B) homology and C) phylogenetic identifiers: A) Experimental - proteins can be identified by a designation based on a defined (published) isolation procedure. Usually the standard alphanumeric system based on two dimensional gel electrophoresis of the large and small subunit ribosomal proteins used for E. coli is utilized, i.e. 'L' or 'S' indicating large or small ribosomal subunit respectively followed by a number indicating the relative position in order of decreasing molecular mass. Thus the twentieth largest protein of the large ribosomal subunit of Halobacterium cutirubrum is designated Hcu L20. B) Homology - proteins from archaebacteria and eucaryota that have been found to be homologous to proteins from E. coli are identified with their E. coli homologue protein identifier with an 'e' (for equivalent) appended: Hcu L20 is homologous to Eco L12 and thus Hcu L20 = Hcu L12e. C) Phylogenetic - proteins found to be present in all urkingdoms and thus present in the progenote carry the identifier 'P' (for progenote) and an (arbitrary) numerical identifier. Thus the E. coli proteins L11, L1, L10 and L12 which have extant homologues in all kingdoms would be identified 24 as Eco P1, Eco P2, Eco P3 and Eco P4 respectively. Similarly Hcu L20 = Hcu L12e = Hcu P4. The proteins unique to a single or a pair of urkingdoms would be identified with 'IT, 'A' or 'E' (or pairs of letters, e.g. 'UA') as a eucaryotic, archaebacterial or eubacterial designator followed by an (arbitrary) numerical identifier. In this work the species designations and the correspondence between the experimental and homology protein identifiers for the GTPase domain proteins appears in Table 3 and the phylogenetic status identifiers are not used as complete sets of archaebacterial and eucaryotic ribosomal proteins have yet to be sequenced. 2 .15 Statistical Analysis Sequence similarity searches of the NBRF PIR protein and GENBANK data bases for proteins homologous to the peptides encoded by the clone pLW173 were done by the FASTP and FASTA protein alignment programs (Lipman and Pearson, 1985; Pearson, 1990). The alignments of the ribosomal proteins were based on all available sequences (Table 3) although not all sequences are illustrated in the alignment figures. The alignments for the L11e and Lie ribosomal proteins (Figures 15, 16) were based on the sequence similarity alignment given by the FASTP protein alignment program and optimized by manually maximizing the amino acid identities. Precise placement of gaps was decided by maximizing conservative substitutions at the amino acid level. The alignment of the L10e proteins from positions 1-218 (Figure 17) was based solely on sequence similarity. In addition to sequence similarity, in some cases known or hypothesized structure - function relationships were utilized for the alignment of the L10e proteins for position 219 - 372 (Figure 17) and for the L12e proteins over their entire length (Figure 18). It is impossible to state explicitly the relative importance of sequence similarity versus structure - function for these alignments. For example, the alanine - proline rich region in the E.coli L12 protein is believed to function as a flexible hinge between the amino terminus (which binds L12 to L10) and the carboxy domain (which binds translation factors); the alanine - proline rich regions in the archaebacterial and eucaryotic L10e proteins have therefore been aligned on the hypothesis that they serve a similar function. The merit of the alignment must therefore be considered both within a structure - function as well as a sequence similarity context. 25 Table 3 Nomenclature of the GTPase Domain Proteins Protein Organism Urkingdom^ Original Reference Designation1 Nomenclature L 1 le Eco L11 Escherichia coli E Pvu L11e Proteus vulgaris E Sma L11 e Serratia marscescens E Hcu L11 e Halobacterium cutirubrum A Sso L11e Sulfolobus solfataricus A See L11e Saccharomyces cerevisiae U L i e Bst Lie Bacillus stearothermophilis E Eco L1 Escherichia coli E Pvu Lie Proteus vulgaris E Sma L1 e Serratia marscescens E Hcu Lie Halobacterium cutirubrum A HhaLle Halobacterium halobium A Sso Lie Sulfolobus solfataricus A L l O e Eco L10 Escherichia coli E Hcu L1 Oe Halobacterium cutirubrum A HhaLlOe Halobacterium halobium A Sso L1 Oe Sulfolobus solfataricus A Hsa L10e Homo sapiens U See L10e Saccharomyces cerevisiae U L l 2 e Bst L12e Bacillus stearothermophilis E Bsu L12e Bacillus subtilis E Eco L12 Escherichia coli E HanL12e Haloanaerobium prevalens E MlyL12e Micrococcus lysodeikticus E Rsp L12e Rhodopseudomonas spheroides E SgrL12e Streptomyces griseus E Sol{c} L12e Spinacea oleracea {chloroplast} E 41227 L12e NRCC 41227 E Hcu L12e Halobacterium cutirubrum A HhaL12e Halobacterium halobium ..A MvaL12e Methanococcus vannielli A Sac L12e Sulfolobus acidocaldarius A Sso L12e Sulfolobus solfataricus A L11 Post et al., 1979 L11 Sor and Nomura, 1987 L11 Sor and Nomura, 1987 Shimmin and Dennis, 1989 Shimmin etal., 1989 L15 Otaka etal., 1984 L1 Kimura etal., 1985 L1 Post et al., 1979 L1 Sor and Nomura, 1987 L1 Sor and Nomura, 1987 Shimmin and Dennis, 1989 ORF A Itoh, 1988 Shimmin etal., 1989 L10 Post et al., 1979 Shimmin and Dennis, 1989 ORF B Itoh, 1988 Shimmin etal., 1989 PO Rich and Steitz, 1987 AO Mitsui and Tsurugi, 1988a L10e Newton et al., 1990 BL13 Garland et al., 1987 BL9 Itoh and Wittmann, 1978 L7/12 Terhorst etal., 1973 A-protein Matheson etal., 1987 MA1/2 Itoh, 1981a RA1 Itoh and Higo, 1983 SA1 Itoh et al., 1982 L12 Bartsch etal., 1982 L12 Falkenberg et al., 1985 Shimmin and Dennis, 1989 'A' protein Itoh, 1988 L12 Strobel etal., 1988 L12 Matheson etal., 1988 Shimmin et al., 1989 26 Table 3 (Continued) Protein Organism Urkingdom^ Original Reference Designation1 Nomenclature AsaL12el Artemia salina U eL12 Amons et al., 1979 Dme L12el Drosophila melanogaster U rP1 Qain etal., 1987 Hsa L12el Homo sapiens U P2 Rich and Steitz, 1987 RraL12el Rattus rattus U P2 Lin etal., 1982 Spo L12el Shizosaccharomyces pombe U SP-40C Beltrame and Bianche, 1987 See Ll2elA Saccharomyces cerevisiae U L45 Remacha etal., 1988 YPA1 Itoh, 1981b L12elA Newton etal., 1990 See L12elB Saccharomyces cerevisiae U L44 Remacha etal., 1988 L12elB Newton etal., 1990 A2 Mitsui and Tsurugi, 1988c AsaL12ell Artemia salina U el_12' Amons etal., 1982 Dme L12ell Drosophila melanogaster U rp21C Wigboldus, 1987 Hsa L12ell Homo sapiens U P1 Rich and Steitz, 1987 See L12ellA Saccharomyces cerevisiae U A1 Mitsui and Tsurugi, 1988b L12ellA Newton etal., 1990 See L12ellB Saccharomyces cerevisiae U L44' Remacha etal., 1988 L12ellB Newton etal., 1990 (1) The See L11e is a partial protein sequence; all others are complete protein and/or nucleotide sequences. (2) Urkingdom abbreviations are: A, archaebacteria; E, eubacteria and U, eucaryota. Note that the chloroplast of the eucaryote Spinacea oleracea is a member of the eubacteria. The RDF program of Lipman and Pearson (1985) was used to determine the statistical significance of the interkingdom and intrakingdom alignments (as presented in Table 7) and the existence of the 26 amino acid module (Figure 20). Significance values (z) of greater than or equal to 10 indicate homologous proteins, whereas values of 6 to 10, 3 to 6 and less than 3 indicate homology that is probable, possible and unlikely respectively. Although the shortness and great divergence of the modules precludes any single module having a highly significant match to any other module, the modules as a group have a statistically highly significant match. To establish this, two hypothetical proteins of 194 amino acids were constructed from the tandem L10e modules such that a linear comparison of the two proteins yielded all potential intraspecies module pairings, that is: Protein 1 Eco p' Hcu oc P y Sso a P y See p Protein 2 Eco y Hcu P y a Sso P y a See y The actual match score was manually calculated from the PAM 250 matrix of Dayhoff (1978). Simulated random match scores for each artificial protein versus jumbled versions of the second artificial protein were generated with the RDF program. The significance (z) of the overall module match was calculated by subtracting the random match value from the actual match value and dividing by the standard deviation of the randomized match values. 28 Part 3: Organization and Expression oJ tne GTPase Domain denes 3.1 isolation of the Genomic Clones pLW99 and pLWl73 The amino terminal sequence of the L20 ribosomal protein of H. cutirubrum is Met-Glu-Tyr-Val-Tyr-Ala (Oda et al., 1974). A 17 nucleotide long synthetic oligonucleotide mixture complementary to all 16 DNA sequences encoding this hexapeptide was prepared (oLW9) and used to probe restriction enzyme digests of H. cutirubrum genomic DNA (Figure 4). The L20 specific oligonucleotide mix (oLW9) hybridized to a 1.3 Kilobasepair PstI - BamHI fragment. Using the oligonucleotide mix as probe, genomic DNA was size fractionated, cloned into the multiple cloning site of plasmid pUC8 and the resulting library was screened by hybridization to oLW9 after being transformed into E. coli JM83 for propagation. Two of the positive clones (pLW99 and pl_W102) were sequenced and the gene encoding the L20 protein was identified. Sequence analysis indicated an open reading frame extending upstream of the Hcu L20 gene. Northern hybridization of genomic RNA with a plasmid (pLW145) containing the entire Hcu L20 gene indicated a transcript of approximately 2200 nucleotides (data not shown). Nuclease S1 protection experiments using total RNA indicated that the 5' transcript end was located in the 5' flanking region of the Hcu L20 gene upstream of the PstI site and the 3' transcript end was localized to about 20 nucleotides beyond the Hcu L20 coding region (Dennis etal., 1985). Attempts to isolate the upstream region as large fragments in phage (A.1059, EMBL3), cosmid (pJB8) and plasmids (pUC, pBR322, pACYC184) or by short fragment 'walks' utilizing restriction enzymes recognizing 4 basepair sites were unsuccessful. The upstream region was eventually cloned utilizing an oligonucleotide probe to the Hcu L11 gene. The amino terminal sequence of the L11 ribosomal protein of H. cutirubrum is Ala-Glu-Thr-lle-Glu-Val (Matheson et al., 1984). A mixture of 192 17 nucleotide long synthetic oligonucleotides complementary to all DNA sequences encoding this hexapeptide was prepared (0LW17) and used to probe restriction enzyme digests of H. cutirubrum genomic DNA (Figure 4). The L11 specific oligonucleotide mix (OLW17) hybridized strongly to a 5.7 Kilobasepair Clal - BamHI fragment and weakly to a 5.1 Kilobasepair Clal - BamHI fragment. Using the oligonucleotide mix as probe, genomic DNA was fractionated (separating the 5.7 and 5.1 Kilobasepair fragments) and the DNA fractions were ligated between the Clal and BamHI sites 29 Figure 4 Southern Blot Analysis and Restriction Maps of pLW99 and pLWl73 Genomic Halobacterium cutirubrum DNA was digested with various restriction enzymes as indicated and hybridized to oligonucleotides (A) oLW9, specific for Hcu L20; (B) oLW17, specific for Hcu L11 and (C) oLW 35, specific for the Hcu L3 / 4 gene. The arrows indicate in (A) a 1.3 Kilobasepair Pstl - BamHI fragment that was subsequently isolated as the clones pLW99 and pLW102; (B) the 5.1 Kilobasepair Clal - BamHI fragment subsequently isolated in the vector pBR322 as the clones pLW173 and pLW180 (the 5.7 Kilobasepair fragment has a fortuitous match to oLW17) and (C) a 1.2 Kilobasepair Smal ( = Xmal) fragment (lane 1: pLW173, lane 2: genomic DNA). The size standards for A and C are Hindlll restricted X DNA, for B a mixture of Hindlll and Pstl restricted X. DNA. Illustrated below are the oligonucleotide sequences and orientations with the amino acid sequence from which they were derived and their positions of hybridization on restriction maps of pLW99 and pLW173. The restriction sites indicated are: B, BamHI; C, Clal; N, Nhel; P, Pstl; S, Sail; X, Xmal ( = Smal). oLW9 BamHI + Pstl B oLW17 Clal 4.35- 2.32, 2.03 0.56 0.13 6.57- [1.3 4.51 5.08 - , 4 - 7 5 : 4.35- [5.7 [5.1 oLW35 Smal 1 2 4.35- 2.32. 2.03 I 0.56 • [1.2 0.13- oLW9: L20 MetGluTyrValTyrAla 3' TACCTCATACAAATACG 5' I T G G G | pLEJll ?: OLW17: L l l AlaGluThrlleGluVal GCAGAAACAATAGAAGT 3' G G G C G C C T I T T | oLW35: L3/4 AsnAspAsnProPheGly AACGACAACCCATTCGG 3 T T T G T C I T I S S nrm CHS S S s s T T S X X s p P s S,P s 30 of the plasmid pBR322. The ligated libraries (libLW37 and libLW38) were transformed and propagated in E. coli JC8111. Two positive clones (pLW155 and pLW156) containing the 5.7 Kilobasepair Clal - BamHI fragment were isolated from libl_W37, the location of a perfect match to oLW17 identified and a 1 Kilobasepair region containing the oligonucleotide hybridization site was sequenced. The perfect match to oLW17 within these clones was fortuitous as there was no similarity within the sequenced region to the Hcu L11 protein other than the oligonucleotide match. Two positive clones (pLW173 and pLW180) containing the 5.1 Kilobasepair Clal - BamHI fragment were isolated from libLW38 and the location of a perfect match to oLW17 was identified. Restriction enzyme and Southern hybridization analysis demonstrated that the smaller 1.3 Kilobasepair PstI - BamHI fragment was derived from the right hand end of the longer 5.1 Kilobasepair Clal - BamHI fragment. In addition, a mixture of 64 17 base long synthetic oligonucleotides complementary to all DNA sequences encoding the amino acid sequence Asn-Asp-Asn- Pro-Phe-Gly contained within a tryptic peptide fragment of the Hcu L3 / 4 protein (oLW35; A T . Matheson, personal communication) hybridized to the 5.1 Kilobasepair Clal - BamHI fragment, indicating the presence of the Hcu L3 / 4 gene (Figure 4). 3.2 Nucleotide Sequence Analysis of pLWl73 The nucleotide sequence of the entire 5146 basepair Clal - BamHI fragment of H. cutirubrum genomic DNA was determined and is illustrated in Figure 5. Two clones were sequenced: pLW173, of which at least two determinations of each nucleotide of each strand, all of which agreed and pLW180, of which 95% was sequenced on both strands and was in perfect agreement with the pLW173 sequence. The fragment contained unique sequences complementary to the oLW9 (ATGGAATACGTCTACGC, positions 4018 - 4034), OLW17 ( A C T T C G A T C G T C T C A G C , positions 1641 - 1625) and oLW35 (CCGAAGGGGTTGTCGTT, positions 3252 - 3236) oligonucleotide probe mixtures. The sequence fidelity of the cloned fragment contained in pLW173 were checked using Southern hybridization. The 5.1 Kilobasepair Clal - BamHI inserts of pLW173 were radioactively labelled by nick translation and hybridized to (i) the Clal - BamHI insert of pLW173 restricted with Sail, (ii) genomic DNA restricted with Clal + BamHI + Sail and (iii) a mixture of the previous two restriction digests. No differences between the genomic and plasmid restriction patterns were seen (data not shown). To check the copy 31 Figure 5 The Nucleotide Sequence of pLWi73 The complete 5' to 3' nucleotide sequence (upper line) of the 5146 basepair Clal - BamHI fragment of H. cutirubrum genomic DNA is shown. The BamHI, Clal, Sail, Nhel, Pstl, Xmal and two of the Avail restriction sites are indicated. The amino acid sequence of the putative ORF protein is written in single letter code in leftward orientation below the DNA sequence (positions 1244 - 135). The deduced amino acid sequences of the rightward oriented putative NAB protein (positions 1345 - 1548) and the L11 (L11e; positions 1622 - 2110), L8 (Lie; positions 2314 - 2949), L3 / 4 (L10e; positions 2954 - 4009), and L20 (L12e; positions 4018 - 4359) ribosomal proteins are written in single letter code above the DNA sequence. The sizes (number of amino acid residues and molecular weight) and calculated isoelectric points of the proteins and sizes (nucleotide basepairs) of the genes are indicated at the initiation methionine positions. 32 10 2 0 3 0 10 5 0 6 0 70 BO 90 100 H O 120 flTCGHTTCCGGflTBCflCGHRCCCCRCGCBnnnCflGCGCfiTBGHCGCCOTTCGHCCflOTCGflCGflTGflCCCflCGGCflCCBCTCCCGCGGCCHGCGCCHCCOCCnCCflCCCGGCGCCGCGCC TflGCTBBGGCCTflTGTGCTTGGGGTGCCTTTTGTCGCCTflTCTGCGGCflflGCTGGTCflGCTGCTflCTGGGTGCCGTGGTGflGGGCGCCGGTCGCGGTGGCGGTGGTGGGCCGCCGCGCGG C l a l S o l i 130 M O i s o tea 170 tea 190 20a 210 220 230 210 GTCGGCBTCGGCTfiGCGCCGCGCHBCCRCGCGCHGGflCGTCCTCGTCTTCGHGGSCGTGflTCGCGGCCCflCCTGCTGGTCGTCGTGTTGGGCCGBCGGGCCGGTGSCCCGCGCGflBCCGG CBGCCGTRGCCGBTCGCGGCGCGTTGGTGCGCGTCCTGCBGGBGCBGBBGCTCCTGCBCTBGCGCCGGGTGGBCGBCCBGCBGCBCBBCCCGGCTGGCCGCCCBCTGGGCGCGCTTGGCC R R R U U R L U D E D E L U H O R G U Q Q D D H Q R S R R T U R f l F f i Khel 2 5 0 2 6 0 2 7 0 2 8 0 2 9 0 3 0 0 3 I 0 3 2 0 3 3 0 3 4 0 3 5 0 3 6 0 RBCCGCTCGTCGflGGGTGCCGCCCflGCTTCTGCflCGGCGTCGTCCflCGGTCTCGCCGCGCCGGBTGRTGflGCGGCTCCTCGCGGTCGflCGCCCCGCCCCGGCTTGTCCRTGTBGflTCCGG TTGGCGBGCRGCTCCCRCGGCGGGTCGRRGRCGTGCCGCRGCBGGTGCCRGRGCGGCGCGGCCTBCTRCTCGCCGRGGRGCGCCBGCTGCGGGGCGGGGCCGBBCBGGTBCRTCTRGGCC F R E O L T G G L K Q U R O D U T E G R R I I L P E E R D U G R G P K O n v l f l S a l I 3 7 0 3 8 0 3 9 0 4 0 0 4 I 0 4 2 0 4 3 0 4 4 0 4 5 0 1 6 0 4 7 0 1 8 0 RTGRGCCCGRGCGCCCGCCRCBTCCGCTCTTTCBGCBCGTCCBBTCCCTTCTCCTCGGCGGCCGBBBTGBBGBTCGCGTCGTCGGGGCTGBCGCCGTGRTCGCGGRGGGCGTCCTTCRTT TflCTCGGGCTCGCGGGCGGTGTflGGCGflGflflflGTCGTGCflGGTTflGGGflflGRGGflGCCGCCGGCTTTflCTTCTflGCGCBGCflGCCCCGflCTGCGGCflCTflGCGCCTCCCGCflGGflflGTflfl I L G L R R U I l R E I C L U O L G K E E A f l S I F I flDDPSUGHDRLBDKn 1 9 0 5 0 0 5 I 0 5 2 0 5 3 0 5 4 0 5 5 0 5 6 0 5 7 0 5 8 0 5 9 0 6 0 0 GTCCCCGCGTBCGflCGGCTCGBTGRGGTCGBCCTTGTTGflCGGTGBCCBGCGflCGGCBTGTBGflCGCGGTTGTCCflTCRCCCCGTCGflTCflGCCGGTCGflCflGRCGGGTTGCCBCGGBTC CRGGGGCGCRTGCTGCCGBGCTBCTCCBGCTGGBBCBflCTGCCBCTGGTCGCTGCCGTBCBTCTGCGCCBBCBGGTBGTGGGGCBGCTRGTCGGCCRGCTGTCTGCCCRBCGGTGCCTBG T G R V S P E I L O U K K U T U L S P I I Y U R H O f l U G D I l R O U S P H G R I S a i l S a i l 6 I 0 6 2 0 6 3 0 6 4 0 6 5 0 6 6 0 6 7 0 6 8 0 6 9 0 7 0 0 7 I 0 7 2 0 GTCflCGTTGGCGTTGflTGflflCCCGCGCTCGCGCRGGflTTCCCTTGflCCGTGTCGCTGTCCBflCTCCRGCTCCCCGGflCGTGTTCRCGTCGflTGCCGTCCTTGCCTTTCCGGCGCfiCGGTC CRGTGCRRCCGCRRCTflCTTGGGCGCGRGCGCGTCCTRRGGGRRCTGGCRCRGCGRCRGGTTGRGGTCGRGGGGCCTGCRCRRGTGCRGCTRCGGCRGGRRCGGRRRGGCCGCGTGCCAG T U N R N I F G R E R L I G K U T D S O L E L E G S T N U O I G O K G K R R U T 7 3 0 7 1 0 7 5 0 7 6 0 770 7 8 0 7 9 0 8 0 0 8 I 0 8 2 0 8 3 0 8 1 0 flCCGRCGGTGGCTCGGCGTCGflCCCGGflTGTTGflCGTTGTflCRGCTCCTCGGCGflGflCGGTCGTflCTGCTCGflTCTCGRflCGCCGflCRGCRCGRfiGflTcnCCRGflTCCGCCCCRCGCflTC TGGCTGCCRCCGRGCCGCRGCTGGGCCTRCRflCTGCRRCRTGTCGRGGRGCCGCTCTGCCRGCRTGRCGRGCTRGRGCTTGCGGCTGTCGTGCTTCTRGTGGTCTRGGCGGGGTGCCTRG U S P P E R D U R I H U H V L E E R L R O V Q E I E F R S L U F I U L D f l G R I S a l I 8 5 0 8 6 0 8 7 0 8 8 0 8 9 0 9 0 0 9 I 0 9 2 0 9 3 0 9 1 0 9 5 0 9 6 0 RCCGflGfiGGRTCTCTTTCCCGCCGCCGCGTCCCCCCGCCGCRCCCTCGRTGRGCCCCGGCflCGTCCRGGflGTTGGRTGTTCGCGCCGCGGTRCTCCflRCRTCCCCGGGTTCflCGTTCHGG TGGCTCTCCTflGflGflflflGGGCGGCGGCGCRGGGGGGCGGCGTGGGflGCIflCTCGGGGCCGTGCflGGTCCTCftRCCTflCflflGCGCGGCGCCfiTGflGGTTGTflGGGGCCCflflGTGCflfiCTCC U S l l E C G G G R G G R R G E I L G P U O L L Q I N A G R V E i r i G P N U N l X . o l 9 7 0 9 8 0 9 9 0 1 0 0 0 1010 1 0 2 0 1 0 3 0 1010 IOSO 1 0 6 0 1 0 7 0 1 0 8 0 GTGGTGRRCTCGTnGGCGCCGRCCTCGCTGTCGGCGTTGGTCRTCGCGTTGflTCRGCGflCGflCTTCCCCRCGCTGGGGfiflTCCflflCCRGGGCCflCGGTCGCGTCGCCGTGCIGTTCuflCT CRCCflCTTGflGCflTCCGCGGCTGGflGCGflCRGCCGCflflCCRGTflGCGCflflCTflGTCGCTGCTGRflGGGGTGCGflCCCCTTflGGTTGGTCCCGGTGCCflGCGCRGCGGCflCGflCflflGCTGR T T F E Y R G U E S O f l r l T t l R M I L S S K G U S P F G U L R U T f l O G H Q E U 1 0 9 0 1100 1 1 10 1 120 1 130 1 110 1 1 SO 1160 1170 1180 1 1 9 0 1 2 0 0 GCGTRCCCGCCGCCRCCGCCGCTGCCGGRCTGCTGGGCTTCGRGCTTCTCCTTTTGCTCCGCGRGCTTCGCCTTCflflGCGGCCGflTGTGGGCTTCT GTCGflCTTGTTGTRCGGCGTGTTC CGCflTGGGCGGCGGIGGCGGCGflCGGCCTGflCGflCCCGflftGCICGflflGflGGflflflflCGRGGCGCTGCflflGCGGRflGTTCGCCGGCTflCflCCCGflflGHCflGCTGflftCflflCRTGCCGCfiCSfiG R V G G G G G S G S O O R E L I C E K O E A U N f l K L R G I H R E T S r N V P T N S o l I 1 2 1 0 1220 1230 1240 1 2 5 0 1260 1270 1280 1 2 9 0 1 3 0 0 1 3 1 0 1 3 2 0 GCGflTTTCTTCTTCGflGCGflTTCGflIGTCCTCCTCGflGCCCCflTCflCGTGCCCGTRGRCRGCflflGCGCCGflflRflGCGCTTTCCTCCGCflGTCCGGTGGGRTCGTTTCGflCflCGTTfi=TfiC GCCTRRRGRRGRRGCTCGCTRRGCTRCRGGRGGRGCTCGGGGTRGTGCRCGGGCRTCTGTCGTTCGCGGCTTTTGCGCRRRGGflGGCGTCRGGCCflCCCTRGCRRRGCTGTGCRRTTRTG R I E E E L S E I O E E L G H ORF 3 7 0 a a / 1110 bp / nU 1 0 1 9 9 d a I / p i 6 . 8 NR6 68 o o / 2 0 1 bp / HU 7 5 3 0 d a I / p i 3 . 8 R u o l l n G O P R R V R D S T O I U L P U G T L E O 1 E U D L E f l E F t l GCCGRGTGRRGCCRTCGCRTflGTGRTGGGTGflCCCTGCTGCGTflCCGCGRCRGCRCGCRGRTCGTGCTCCCflGTOGGGRCGCTGGRGGflCflTCGRGGTGGRCCTCGRflGCCGRGTKRrG CGGCTCflCTTCGGTRGCGTflTCflCTflCCCflCTGGGflCGRCGCflTGGCGCTGTCGTGCGTCTflGCRCGfiGGGTCflCCCCJGCGRCCTCCTGTRGCTCCRCCTGGRGCTTCGGCTCflfiiJTflC 1 3 3 0 1310 1350 1360 1370 1380 1 3 9 0 1100 1110 1120 1 1 3 0 1110 U S U F R P T O R E I U R I I G S P U U I K E U T E F L I R H G U H n P GTCTCflGTGTTCCGGCCGflCCGflCGCGGRGflTCGTCCGCflTCflTCGGGflGTCCGGTCGTGflTCflflGGRGGTCflCCGflGTTCCTCflCGCGCCflCGGCGTCCflCflTGCCGTGflGCGflTrCGfl CflGflGTCflCftRGGCCGGCTGGCTGCGCCTCTRGCflGGCGTRGTflGCCCTCRGGCCflGCflCTflGTTCCTCCflGTGGCTCflflGGflGTGCGCGGTGCCGCflGGTGTflCGGCflCTCGCTfi^GC T 1150 1160 1170 1180 1190 I 5 0 0 IS 10 I S 2 0 I 5 3 0 1510 I 5 5 0 ' 5 6 0 LI l e 163 o o / 1 8 9 bp / I1U 1 7 0 2 0 do I / p i 2 . 7 11 fl E T I E U L U R G G 0 R O P G P = L TCCGCGGCGGCGCCCCGCTCGflflflGflCflflGGGTTflflflCCCGCGGCGGCGGTTTCTCGGfiGTRTGGCTGflGflCGflTCDRflGTGCTCGTTGCCGGTGGGCflGGCCGflCCCTGGCCCGCCCCT RGGCGCCGCCGCGGGGCGRGCTTTCTGTTCCCflfltTTGGGCGCCGCCGCCflflflGRGCCTCflTflCCGflCTCTGCTflGCTTCflCGflGCflflCGGCCflCCCGTCCGGCTGGGflCCGGGCtC-GGfi 1570 1580 1590 1600 1610 1 6 2 0 1630 1610 1650 I 6 6 0 I 6 7 0 1680 33 A u o l l S a i l G P E L G P T P U O U Q A U U Q E I M O Q T E A F O G T E U P t / T I E V E O D G C G G T C C C G f l G C T C G G T C C C f t C G C C G G T C G f l C G T f l C f l G G C G G T C G T C C f l G G f l G f l T C f l f l C G f l C C f l G f l C C G f l f l G C G T T C G f l C G G G f l C G G f l G G T C C C G G T C f l C C f l T C G f l f l T f l C G f l G G f l C G f t C G G G C C f l G G G C T C G f l G C C f l G G G T G C G G C C f l G C T G C f l T G T C C G C C f l G C f l G G T C C T C T f l G T T G C T G G T C T G G C T T C G C f l f l G C T G C C C T G C C T C C f l G G G C C f l G T G G T f l G C T T f l T G C T C C T G C T G C C 1 6 9 0 1 7 0 0 1 7 1 0 1 7 2 0 1 7 3 0 1 7 1 0 I 7 S 0 I 7 6 0 I 7 7 0 1 7 8 0 1 7 9 0 1 8 0 0 S F S I E U G U P P T A A L U K O E A G F D T G S G E P Q E N F U A D L S I E Q C T C G T T C T C C H T C G f l f i G T C G G T G T T C C G C C G f l C G G C C G C G C T G G T G f l H R G H C G f l f l G C T G G C T T C G f l C f l C G G G C T C C G G H G f l G C C C C f l G G f l G f l n C T T C G T C G C G G f l C C T e T C C f l T C G f l f l C f l G f t G C A f l G f l G G T f l G C T T C A G C C R C A R G G C G G C T G C C G G C G C G f l C C f l C T T T C T G C T T C G A C C G A A G C T G T G C C C G A G G C C T C T C G G G G T C C T C T T G A R G C A G C G C C T G G A G A G G T R G C T T G T 1 8 1 0 1 8 2 0 1 8 3 0 1 8 4 0 1 8 5 0 I 8 6 0 1 8 7 0 1 8 8 0 1 8 9 0 1 9 0 0 1 9 1 0 1 9 2 0 L K T I A E Q K K P O L L A V D A R N A A K E U A G T C A S L G U T I E G E O R G C T C R R R A C C R T C G C C G R G C R G R R G R R R C C C G R C C T C C T G G C G T R C G R C G C G C G G A A C G C C G C C A A A G A G G T C G C G G G G A C G T G T G C G T C C C T C G G C G T C A C C A T C G A R G G C G R G G R C G C C G R G T T T T G G T R G C G G C T C G T C T T C T T T G G G C T G G R G G R C C G C R T G C T G C G C G C C T T G C G G C G G T T T C T C C f l G C G C C C C T G C A C A C G C A G G G f l G C C G C f l G T G G T f l G C T T C C G C T C C T G C G 1 9 3 0 1 9 1 0 I 9 S 0 I 9 6 0 I 9 7 0 1 9 8 0 1 9 9 0 2 0 0 0 2 0 1 0 2 0 2 0 2 0 3 0 2 0 1 0 S a i l A T F N E R U D D G D Y O O U L G O E L A A A C C G C R C G T T C f l R C G A G C G C G T C G R C G R C G G C G f l C T R C G R C G R C G T G C T C G G C G f l C G R R C T C G C G G C C G C G T R R C G C C G C C C G R G G R G T T T C T G C G C C G T T C G G T T C G C G T R C T C G R T A G C G G C G T G C A A G T T G C T C G C G C A G C T G C T G C C G C T G A T G C T G C T G C A C G A G C C G C T G C T T G A G C G C C G G C G C A T T G C G G C G G G C T C C T C A A A G A C G C G G C A A G C C A A G C G C A T G A G C T A T C G 2 0 S 0 2 0 6 0 2 0 7 0 2 0 8 0 2 0 9 0 2 1 0 0 2 1 1 0 2 1 2 0 2 1 3 0 2 1 1 0 2 I 5 0 2 I 6 0 X i a I G G C G T G T G T C C G C G G G T C G C G C T C C C A C G C T T G C T T C G C T T C G A C G C T T T T A A G C C C G G G A T C A C C G T C T G T A G A A C C G A G A C A G G C T T C G C C T G T T T C A C T G A C C C G T A G G A G A T C C G A C C G C A C A C A G G C G C C C H G C G C G A G G G T G C G A A C G A A G C G A A G C T G C G A A A A T T C G G G C C C T A G T G G C f l G H C A T C T T G G C T C T G T C C G H A G C G G A C C A A A G T G A C T G G G C A T C T C T A G G C T 2 I 7 0 2 I 8 0 2 I 9 0 2 2 0 0 2 2 I 0 2 2 2 0 2 2 3 0 2 2 1 0 2 2 5 0 2 2 6 0 2 2 7 0 2 2 8 0 L i e 2 1 2 a a / 6 3 6 b p / t i l l 2 3 0 9 5 d a I / p i 6 . 7 n A 0 N 0 I E E A U A R A L E O A P Q R N F R E T U O L f l C C T T C R G R G G G T C f i C C C f l C T R C G G f l G G T G f l f l f l G f l T G G C R G A C A f l C G R T R T A G f l f l G f l G G C C G T f l G C T C G C G C f l C T T G f l G G f l T G C C C C f l C f l G C G G f l f l C T T C C G I G A G R C G G T A G f l C C T C G C A G G f l f l G T C T C C C f l G T G G G T G A T G C C T C C A C T T T C T A C C G T C T G T T G C T A T A T C T T C T C C G G C A T C G A G C G C G T G A A C T C C T A C G G G G T G T C G C C T T G A A G G C A C T C T G C C A T C T G G A G C G T 2 2 9 0 2 3 0 0 2 3 1 0 2 3 2 0 2 3 3 0 2 3 1 0 . 2 3 5 0 2 3 6 0 2 3 7 0 2 3 8 0 2 3 9 0 2 4 0 0 S a l I U N L R D L D L N O P S Q R U D E G U U L P S G T G Q E T Q I U U F A O G E T A G T C A A C C T G C G C G A C C T C G A C C T C A A C G A C C C G T C G C A A C G A G T C G A C G A G G G C G T C G T G C T G C C G T C G G G C A C C G G A C A G G A G A C G C A G A T C G T G G T T T T C G C A G A C G G C G A A A C C G C G C A G T T G G A C G C G C T G G A G C T G G A G T T G C T G G G C A G C G T T G C T C A G C T G C T C C C G C A C C A C G A C G G C A G C C C G T G G C C T G T C C T C T G C G T C T A G C A C C A A A A G C G T C T G C C G C T T T G G C G C 2 4 I 0 2 4 2 0 2 4 3 0 2 4 1 0 2 4 5 0 2 4 6 0 2 4 7 0 2 4 8 0 2 4 9 0 2 5 0 0 2 5 I 0 2 5 2 0 U R A O D U A O D U L O E D D L S D L A D O T D A A K D L R D E T O F F U f l E f l G T T C G C G C G G A C G A C G T C G C T G A C G f l C G T C C T C G A C G A G G H C G A C C T C A G C G A C C T C G C R G A C G A C A C C G H C G C C G C G A A G G A T C T C G C f l G A C G A G f l C G G A C T T C T T C G T G G C G G f t A G C A C f l f l G C G C G C C T G C T G C R G C G f l C T G C T G C A G G f l G C T G C T C C T G C T G G R G T C G C T G G R G C G T C T G C T G T G G C T G C G G C G C T T C C T f l G A G C G T C T G C T C T G C C T G A A G f l f l G C A C C G C C T T C G T 2 5 3 0 2 5 4 0 2 5 5 0 2 5 6 0 2 5 7 0 2 5 8 0 2 5 9 0 2 6 0 0 2 6 1 0 2 6 2 0 2 6 3 0 2 6 4 0 S a l I P n F1 Q D I U G A L G Q U L G P R G K n P T P L Q P D O D U U O T U N R t l K H T C C C A T G f l T G C f l G G A C f l T C G T G G G T G C G C T C G G T C R R G T G C T T G G T C C G C G C G G G A f l A R T G C C G f l C C C C G C T C C A G C C C G f l C G R C G f l C G T C G T C G f l C f l C R G T C f l f l C C G C f l T G R f t f l f l f l C A C C G G G T A C T A C G T C C T G T A G C A C C C A C G C G A G C C A G T T C A C G A R C C A G G C G C G C C C T T T T R C G G C T G G G G C G A G G T C G G G C T G C T G C T G C A G C R G C T G T G T C A G T T G G C G T R C T T T T T G T G G 2 6 5 0 2 6 6 0 2 6 7 0 2 6 8 0 2 5 9 0 2 7 0 0 2 7 1 0 2 7 2 0 2 7 3 0 2 7 4 0 2 7 5 0 2 7 6 0 O Q I R S R O R R T F H T R U G R E O n S R E D I R S H I D U I n R R L H A N L G T G C A G R T C C G C A G C C G C G A C C G C C G C A C G T T C C A C A C G C G C G T C G G C G C G G A G G A C A T G T C C G C C G R G G A C A T C G C C R G C A A C A T C G R C G T C R T C R T G C G T C G G C T G C R C G C G A R C C T C C A C G T C T A G G C G T C G G C G C T G G C G G C G T G C f l f l G G T G T G C G C G C R G C C G C G C C T C C T G T A C A G G C G G C T C C T G T A G C G G T C G T T G T A G C T G C A G T R G T A C G C f l G C C G A C G T G C G C T T G G A G 2 7 7 0 2 7 8 0 2 7 9 0 2 8 0 0 2 8 1 0 2 8 2 0 2 8 3 0 2 8 4 0 2 8 5 0 2 8 6 0 2 8 7 0 2 8 8 0 L l O e 3 5 2 a a / 1 0 5 6 b p / t l U 3 7 1 5 9 d a l / p i 2 . 9 E K G P l N U O S U Y U K T T t l G P A U E U f l I I S f l E E O R T T E E U P E U tc G R R R R f l G G C C C G C T G R R C G T G G A C T C C G T C T A C G T G R R G A C A A C G A T G G G G C C T G C C G T G G A G G T T G C C T R G G A T G T C C G C C G R R G R A C R A C G C R C C R C C G A G G R G G T T C C C G A G T G G A A C T T T T T C C G G G C G A C T T G C A C C T G A G G C R G f l T G C f l C T T C T G T T G C T A C C C C G G A C G G C A C C T C C f l R C G G f l T C C T A C A G G C G G C T T C T T G T T G C G T G G T G G C T C C T C C A A G G G C T C A C C T T 2 8 9 0 2 9 0 0 2 9 1 0 2 9 2 0 2 9 3 0 2 9 1 0 2 9 5 0 2 9 6 0 2 9 7 0 2 9 8 0 2 9 9 0 3 0 0 0 S a l I R Q E U A E L U D L L E T Y O S U G U U N U T G I P S K Q I Q O H R R G L H G Q G C G R C f l A G A G G T C G C C G R A C T C G T C G f l C C T C C T G G R G A C G T A C G A C A G C G T C G G C G T G G T G A A C G T C A C G G G C f l T T C C G R G C R R G C R G C T C C f l G G f l C f l T G C G C C G C G G C C T G C H C G O G C R C G C T G T T C T C C A G C G G C T T G R G C A G C T G G f l G G A C C T C T G C R T G C T G T C G C f l G C C G C A C C A C T T G C A G T G C C C G T f l A G G C T C G T T C G T C G R G G T C C T G T f l C G C G G C G C C G G f l C G T G C C C G T 3 0 1 0 3 0 2 0 3 0 3 0 3 0 1 0 3 0 5 0 3 0 6 0 3 0 7 0 3 0 6 0 3 0 9 0 3 1 0 0 3 I I 0 3 1 2 0 R R U R H S R H T L L U R R L E E R G O G L 0 T L T * E V U E G E U G L U R T N 0 G G C G G C C G T G C G C A T G A G C C G G R A C A C C C T G T T G G T T C G C G C G C T C G A A G A R G C R G G R G R C G G C C T C G R C R C G C T C A C C G R G T R C G T C G A G G G C G R R G T C G G C C T G G T C G C G R C C A A C G A C C G C C G G C f l C G C G T f l C T C G G C C T T G T G G G A C f l f l C C f l f l G C G C G C G A G C T T C T T C G T C C T C T G C C G G A G C T G T G C G R G T G G C T C f l T G C f l G C T C C C G C T T C f l G C C G G f l C C A G C G C T G G T T G C T 3 I 3 0 3 1 1 0 3 I 5 0 3 I 6 0 3 I 7 0 3 I 8 0 3 I 9 0 3 2 0 0 3 2 I 0 3 2 2 0 3 2 3 0 3 2 1 0 X . a l N P F G L Y Q Q L E N S K T P R P ( H R G E U R P N O I U U P E G D T G I O P G C f l f l C C C C T T C G G G C T C T R C C R G C f l G C T T G f l G f l f l C T C G f l R G R C G C C G G C C C C G f l T C f l f l C G C C G G C G A G G T C G C G C C C A f l C G f l C f l T C G T C G T G C C G G f l f l G G T G f l C f l C G G G C f l T C G A C C C G G G G T T G G G G f l f l G C C C G R G f l T G G T C G T C G f l f l C T C T T G f l G C T T C T C G C G C C G G G G C T f l G T T G C G G C C G C T C C f l G C G C G G G T T G C T G T R G C f l G C f l C G G C C T T C C A C T G T G C C C G T f l G C T G G G C C C 3 2 5 0 3 2 6 0 3 2 7 0 3 2 8 0 3 2 9 0 3 3 0 0 3 3 I 0 3 3 2 0 3 3 3 0 3 3 1 0 3 3 5 0 3 3 6 0 34 P s t I P F U G E L Q T I G A M A A I Q E G S I Q U L O O S U U T E E G E T U S D D U S GCCGTTCGTCGGCGRRCTGCHGRCCRTCGGCGCGflRCGCGCGCHTCCflGGHGGGCTCCHTCCflGGTGCTCGRTGflCTCCGTCGTCflCCGRGGflnGGTGflGflCGGTCTCCGflCGnCGTCTC CGGCflflGCflGCCGCTTGflCGTCTGGTRGCCGCGCTTGCGCGCGTflGGTCCTCCCGflGGTflGGTCCflCGflGCTflCTGflGGCflGCflGTGGCTCCTTCCflCTCTGCCflGflGGCTGCTGCflGftG 3 3 7 0 3 3 8 0 3 3 9 0 3 1 0 0 3 1 1 0 3 1 2 0 3 1 3 0 3 1 1 0 3 1 5 0 3 1 6 0 3 1 7 0 3 1 8 0 S o l I K U L S E L G I E P K E U G L O L R G U F S E G U L F T P E E L E I O U O E V R CRflCGTCCTCTCGGRGCTCGGCflTCGflGCCCRflGGRGGTCGGCCTGGRCCTGCGCGGCGTGTTCTCCGRGGGCGTGCTGTTCRCGCCCGflGGflGCTGGflGflTCGRCGTCGRCGRGTflCCG GTTGCflGGflGflGCCTCGflGCCGTflGCTCGGGTTCCICCflGCCGGRCCTGGflCGCGCCGCflCflflGflGGCICCCGCRCGflCflflGTGCGGGCICCTCGflCCTCTflGCTGCflGCTGCTCRTGGC 3 1 9 0 3 5 0 0 3 5 1 0 3 5 2 0 3 5 3 0 3 5 4 0 3 5 5 0 3 5 6 0 3 5 7 0 3 5 8 0 3 5 9 0 3 6 0 0 R O I Q S A A A S A R H L S U N A R Y P T E R T A P O L I R K G R G E A K S L G CGCGGflCRTCCflGTCCGCGGCGGCGTCGGCGCGCflflCCTCTCGGTCflflCGCflGCGTRCCCGflCCGflGCGGflCCGCflCCGGflCCTCflTCGCGflflGGGCCGCGGCGflGGCGRflGflGCCTCGG GCGCCTGTflGGTCRGGCGCCGCCGCRGCCGCGCGTTGGRGflGCCRGTTGCGTCGCflTGGGCTGGCTCGCCTGGCGTGGCCTGGflGTflGCGCTTCCCGGCGCCGCTCCGCTTCTCGGflGCC 3 6 1 0 3 6 2 0 3 6 3 0 3 6 4 0 3 6 5 0 3 6 6 0 3 6 7 0 3 6 8 0 3 6 9 0 3 7 0 0 3 7 1 0 3 7 2 0 P s t I P s t I L Q A S U E S P O L R D D L U S K A O A Q U R A L R A Q I O D E O A L P E E L Q CCTGCflGGCCRGCGTCGRGRGTCCGGRCCTCGCGGRCGflTCTCGTGRGCRRGGCCGRCGCCCRGGTGCGGGCGCTCGCCGCGCflGRTCGRCGflCGflGGflCGCCCTCCCGGflGGRRCTGCfl GGRCGTCCGGTCGCflGCTCTCflGGCCTGGRGCGCCTGCTflGflGCflCTCGTTCCGGCTGCGGGTCCflCGCCCGCGflGCGGCGCGTCTflGCTGCTGCTCCTGCGGGRGGGCCTCCTTGflCGT 3 7 3 0 3 7 4 0 3 7 5 0 3 7 6 0 3 7 7 0 3 7 8 0 3 7 9 0 3 8 0 0 3 8 1 0 3 8 2 0 3 8 3 0 3 8 4 0 S a l I D U O R P f l f l P f l G G E A O T T A O E Q S O E T Q A S E A D O A D O S O O O O O GGRCGTCGRCGCGCCTGCGGCGCCTGCCGGCGGCGRRGCGGRCflCCflCTGCGGflCGRflCRGRGCGflCGRRRCRCflRGCGTCCGRGGCTGflCGflCGCCGflCGflTTCCGRCGRCGflTGRCGfl CCTGCRGCTGCGCGGflCGCCGCGGflCGGCCGCCGCTTCGCCTGTGGTGRCGCCTGCTTGTCTCGCTGCTTTGTGTTCGCRGGCTCCGflCTGCTGCGGCTGCTflRGGCTGCTGCTflCTGCT 3 8 5 0 3 8 6 0 3 8 7 0 3 8 8 0 3 8 9 0 3 9 0 0 3 9 1 0 3 9 2 0 3 9 3 0 3 9 4 0 3 9 5 0 3 9 6 0 L I 2 e 114 a a / 3 4 6 b p / HU 1 1 5 5 0 d a l / p i 2 . 1 D O D G N R G f l E G L G E I t F G n E V U Y R R L I L H E f l O E E L . T E D M CGRCGRCGRCGGGRRCGCTGGCGCCGRGGGCCTCGGGGRGRTGTTCGGflTRRTRRCRRTGGRRTRCGTCTRCGCRGCRCTCRTCCTGRRCGRGGCTGRCGRRGRGCTGACCGRRGRCARC GCTGCTGCTGCCCTTGCGflCCGCGGCTCCCGGfiGCCCCTCTflCflflGCCTRTTflTTGTTflCCTTflTGCflGflTGCGTCGTGRGTflGGflCTTGCTCCGflCTGCTTCTCGflCTGGCTTCTGTTG 3 9 7 0 3 9 8 0 3 9 9 0 4 0 0 0 4 0 1 0 1 0 2 0 4 0 3 0 4 0 4 0 4 0 5 0 4 0 6 0 1 0 7 0 1 0 8 0 S a i l S a i l I T G U L E R A G U D U E E S R A K R L U A A L E O U O I E E R U E E A A A R P RTCRCCGGCGTCCTGGAGGCCGCCGGCGTCGACGTCGRGGRRTCCCGCGCGAAGGCCCTCGTGGCCGCGCTGGAGGRCGTCGflCATCGRGGAAGCCGTCGAflGRGGCCGCCGCCGCGCCT TRGTGGCCGCRGGRCCTCCGGCGGCCGCRGCTGCRGCTCCTTRGGGCGCGCTTCCGGGRGCACCGGCGCGACCTCCTGCRGCTGTAGCTCCTTCGGCRGCTTCTCCGGCGGCGGCGCGGA 4 0 9 0 4 1 0 0 4 1 1 0 4 1 2 0 4 1 3 0 4 1 4 0 4 1 5 0 4 1 6 0 4 1 7 0 4 1 8 0 4 1 9 0 4 2 0 0 R A A P A A S G S D O E R R R D O G D D D E E R O A O E A A E R E O R G O O O D GCCGCCGCRCCTGCGGCGTCCGGCRGCGRCGACGRGGCRGCCGCCGRCGRCGGCGACGACGACGAGGRRGCCGflCGCTGRCGAGGCCGCCGAGGCCGRGGflCGCTGGCGACGRCGRCGRC CGGCGGCGTGGRCGCCGCAGGCCGTCGCTGCTGCTCCGTCGGCGGCTGCTGCCGCTGCTGCTGCTCCTTCGGCTGCGRCTGCTCCGGCGGCTCCGGCTCCTGCGACCGCTGCTGCTGCTG 4 2 1 0 4 2 2 0 1 2 3 0 1 2 1 0 1 2 5 0 1 2 6 0 1 2 7 0 1 2 8 0 1 2 9 0 1 3 0 0 1 3 1 0 1 3 2 0 E E P S G E G L G D L F G GAGGRGCCCRGCGGCGRRGGCCTGGGCGRCCTCTTCGGGTRRCCCGGTCGCGTCGCGCGCCGACRGCCRCGATCRCRTCGTTTTTTRGCCGCGTGCCACTCGGGARGCCACGGCGCTGCG CTCCTCGGGTCGCCGCTTCCGGRCCCGCTGGAGARGCCCRTTGGGCCRGCGCRGCGCGCGGCTGTCGGTGCTAGTGTAGCRRRRRRTCGGCGCRCGGTGAGCCCTTCGGTGCCGCGRCGC 1 3 3 0 1 3 4 0 4 3 S 0 4 3 6 0 1 3 7 0 1 3 8 0 1 3 9 0 1 1 0 0 1 1 1 0 1 1 2 0 1 1 3 0 1 1 1 0 CRCGCGTAGRTTGRRGACGGGGRGCGCGGGCAGCTGGGCGTGRTGGRTGTCGCTGGTGTGCGCGTGTTGGTGRCGCCGRTGGGCGCGCTTGCRGTGCTCGCTGCGGTCGCGGCCGGCGTG GTGCGCRTCTRRCTTCTGCCCCTCGCGCCCGTCGACCCGCACTACCTRCRGCGRCCRCRCGCGCRCRRCCACTGCGGCTACCCGCGCGAACGTCACGAGCGRCGCCRGCGCCGGCCGCRC 1 1 5 0 1 4 6 0 4 4 7 0 4 4 8 0 4 1 9 0 4 5 0 0 1 5 1 0 1 5 2 0 1 5 3 0 1 5 1 0 1 5 5 0 1 5 6 0 X . a l GCGCTGGGGRCGTGTTCGGGGCTGGTGCCCGGCGTGCRCGTGRACRCGCTGGCGTTGCTGCTGGCTGCGGCCGCGCCGCTGGCCCCGGGRCCGCCflCflTCTCGTCGGTGCGGCGCTRCTG CGCGRCCCCTGCACARGCCCCGRCCRCGGGCCGCACGTGCRCTTGTGCGACCGCARCGACGRCCGACGCCGGCGCGGCGACCGGGGCCCTGGCGGTGTRGAGCAGCCRCGCCGCGRTGRC 1 5 7 0 1 5 8 0 1 5 9 0 1 6 0 0 1 6 1 0 1 6 2 0 1 6 3 0 1 6 1 0 1 6 S 0 1 6 6 0 1 6 7 0 1 6 8 0 GCGGCGGGTGTCRCGCRTTCCATCCTGGACGTGGTCCCGRTGCTCGCGCTCGGGGTGCCGGRCGCGGCGCTGGCGGTGRGCGTGCTGCCCGGCCRTCGGCTGGTGCTTGGCGGTCGCGGC CGCCGCCCRCRGTGCGTRRGGTAGGRCCTGCACCAGGGCTACGAGCGCGAGCCCCflCGGCCTGCGCCGCGRCCGCCRCTCGCRCGRCGGGCCGGTRGCCGRCCRCGRACCGCCAGCGCCG 1 6 9 0 1 7 0 0 4 7 I 0 4 7 2 0 4 7 3 0 4 7 4 0 4 7 5 0 4 7 6 0 4 7 7 0 4 7 8 0 4 7 9 0 4 8 0 0 CGGGAGGCGCTGCGGGTGTCTGCCCTCGGGAGCGCGRCCGCCGTCGTGGTCGCCGTCGCRTTCGGGGTGCCGGCGRCGTGGCTGGCGGTTCGGGCGGCACCAGTGGTGTACGCTCACCTC GCCCTCCGCGRCGCCCACRGACGGGflGCCCTCGCGCTGGCGGCflGCRCCAGCGGCAGCGTflflGCCCCflCGGCCGCTGCflCCGRCCGCCAAGCCCGCCGTGGTCRCCACRTGCGAGIGGAG 4 8 I 0 4 8 2 0 4 8 3 0 4 8 4 0 4 8 5 0 4 8 6 0 4 8 7 0 4 8 8 0 4 8 9 0 4 9 0 0 4 9 1 0 4 9 2 0 CCGGTCGTGCTCGCCGTGCTCGTCGTGGTGCTCGTCGCRCGCGAGCGGTCCCGRCGCGCGCGGCTCGGCGCGGTGCTCGCGGTGGCTGCCRGCGGCRCRCTGGGCAGCGTTGCGCTGCCG GGCCRGCRCGRGCGGCACGRGCflGCflCCflCGAGCAGCGTGCGCTCGCCAGGGCTGCGCGCGCCGAGCCGCGCCflCGRGCGCCRCCGACGGTCGCCGTGTGACCCGICGCflACGCGflCGGC 4 9 3 0 4 9 1 0 1 9 S 0 1 9 6 0 1 9 7 0 1 9 8 0 1 9 9 0 5 0 0 0 5 0 1 0 5 0 2 0 5 0 3 0 5 0 1 0 B a . H l RTGCAGCCCGRCGCTGTCGTACCGRCCGGTGACGTGTTGTCGCCGCTGTTCGCGGGGTTGTTCGGTGCGCCCGTGTTGTTGGCGGCGTTCCGGGGGGRTGGGATCC TflCGTCGGGCTGCGACAGCATGGCTGGCCACTGCACflACflGCGGCGACftflGCGCCCCflflCRRGCCflCGCGGGCACflACflflCCGCCGCflAGGCCCCCCTflCCCTAGG 5 0 5 0 5 0 6 0 5 0 7 0 5 0 8 0 5 0 9 0 5 I 0 0 S1 10 5 1 2 0 5 1 3 0 5 1 1 0 number of the ribosomal protein genes labelled pLW173 was hybridized to genomic DNA by Southern blot analysis under progressively less stringent conditions. No other hybridizing bands were seen on such Southerns (data not shown). 3.3 Identification of Proteins Encoded by pLW173 Four of the open reading frames encoded on pLW173 were identified as encoding expressed proteins by matching the putative translated gene products to amino acid sequences of known H. cutirubrum proteins (Figure 6). Homologous proteins from the eubacterium E. coli were also identified (Figure 6). The open reading frame located at nucleotide positions 1622 - 2110 encodes a protein that has 163 amino acids, a molecular mass of 17020 daltons and an isoelectric point of 2.6. The amino acid residues 2 - 35 of the translated open reading frame match the amino terminal sequence of the Hcu L11 protein perfectly; the amino terminal methionine is apparently removed by post-translational modification. The single internal peptide available matches the protein gene product from residues 77 to 101 exactly (AT. Matheson, personal communication). Thus the open reading frame located at nucleotide positions 1622 - 2110 encodes the Hcu L11 protein. The Hcu L11 protein is homologous to the Eco L11 protein: they retain 33% amino acid identities over 138 residues (significance z = 35 by the RDF program) requiring only a single gap of one amino acid residue to maintain alignment. The open reading frame located at nucleotide positions 2314 - 2949 encodes a protein that has 212 amino acids, a molecular mass of 23095 daltons and an isoelectric point of 4.5. The amino acid residues 2 - 37 of the translated open reading frame match the amino terminal sequence of the Hcu L8 protein with the single exception of a glutamic acid residue versus a glycine residue at position 15 in the translated open reading frame and protein sequences respectively. The amino terminal methionine of the protein is removed by post-translational modification. Thus the open reading frame located at nucleotide positions 2314 - 2949 apparently encodes the Hcu L8 protein. The deduced Hcu L8 protein is homologous to the Eco L1 protein: they have a linear correspondence yielding 32% amino acid identities over 213 positions (z = 36 by the RDF program) but require 10 gaps in the alignment. The open reading frame located at nucleotide positions 2954 - 4009 encodes a protein that has 352 36 Figure 6 Identification of the Ribosomal Proteins Encoded by pLW173 The sequences of the H. cutirubrum L11, L8, L3 / 4 and L20 ribosomal proteins as translated from their respective genes are shown with the matches to peptide sequence data underlined. The Hcu L11, L8, L3 / 4 and L20 ribosomal protein sequences are also aligned with the E. coli L11, L1, L10 and L12 ribosomal protein sequences respectively. Amino acid identities are indicated by solid circles (•) and gaps (-) have been inserted where neccesary to maintain alignment. The Eco L12 protein has undergone rearrangement and thus identities are indicated between the Hcu L20 and Eco L12 C domain (•), the Eco L12 N terminus and Eco L12 C domain (0), and the Hcu L20 and Eco L12 N terminus (o). Eco LI t flRKKUQRYUICLQURAGflANPSPPUGPALGQQGUHtflEFCKRFHRKTDSIEKGLPIPUUI TUYRDRSFTFUTKTPPAAULLKKflflG IKSGSGKPHCDKUGKISRRQLQEIA • • • • • • « • • • • « • « • • • • « « • • • • • • « • • « « • • • Hcu L1I flflETIEULUAGGOflDPOPPLGPELGPTPUOUOflUUOEINOOTEflF-DGTEUPUTIEVEDOGSFSIEUGUPPTAALUKOEAGFOTGSGEPOEHFUROLSlEOLKTIfl 10 20 30 10 50 60 70 80 90 100 110 Eco LI I QTKRADnTGROIERHTRSlEGTRRSHGLUUEO • « • • • • Hcu LI I EOKKPOLLAYOflRNflflKEURGTCASLGUTIEGEORRTFNERUODGOVDOULGOELRRfl 120 130 110 ISO 160 Eco LI flRKLTKRHRUIREKUDRTM)Y0I HER IALLKELRT-AKFUESUOURUHL-GlOARKSOQHURGRTULPHGTGRSURUAUFTQGANAEAAKAAGRELUGnEOLROQI • • • • • • ««•• • • ••• • • « • • Hcu L8 tlflOHO-l EE-RURRAL—EOflPQRHFRETUOLflUHLROLOLHDPSQRUOEGUULPSGTGGETQIUUFROGETRURAOOU-ADDULOEOOLSOLADDT 10 20 30 10 50 60 70 80 90 100 110 Eco LI KKGEtlHFQUU IRSPORnfiU-UGQLGQULGPRGLnPHPKUGTUTPNUREflUKHRKflGQURYRNOKNGI IHTTI GKUOFDRQKLKEHLERLLURLKKRICPTQfllCG-UY I Hcu L8 DRAKOLAOETOFFUAEAPriFtQQIUGALGQULGPRGKnPTPLQP--00OUUOTUNAnK-HTUQIRSRDRRTFHTRUGAEDnSREOIRSNIDUI n R R L H A H L E K G P L N U 120 130 110 ISO I60 170 160 190 2 0 0 210 220 Eco LI KKUSISTTnGAGURUOQRGLSASUN • • • • • • • Hcu L8 DSUYUKTTflGPAUEUA 2 3 0 2 1 0 Eco L10 nALNLQDKQRI ORE—USEURKGA - L S R U U R D S R G U T U O K f l T E L R r f l G R E R G U V n R U U R N T L L R R A U E - - G T P F E C L K O A F U G P T L I R V S n E H P G A R f l R L F K E F A • • • • • « • • « •«•»• • • • • • • • • Hcu L3/1 nSREEQRTTEEUPEUKRQEOAELUDLLETVOSUGUUHUTGIPSKQLQOnRflGLH-GQRRURnSRHTLLURflLEEflGOGLDTLTEVUEGEUGLUflTHOHPFGL-YQQLENS 10 20 30 10 50 60 70 80 90 100 1 10 Eco L I O KRHRKFEUKflflf lFEGEL I PASO I DRLfl - - • • « • Hcu L3/1 K T P f l P I H A G E U R P M D I U U P E G D T G I D P G P F U G E L O T I G R H R R I Q E G S IQW . O O S U U T E E G E T U S O O U S H U L S E L G IE P K E U G L O L R G U F S E G U L F T P E E L E I O U O E V R R D I20 130 110 ISO I60 I70 ISO I90 200 2I0 220 Eco L I O — — TLPTVEEfllRRLnflTnKEflSAGKLVRTLAAURDflKEflfl Hcu L3/1 IOSflflfiSRRNLSUHflRVPTERTRPOLIRKGRGERCSLGLOfiSUESPOLfiDOLUSKflORQURRLRftQIDOEORLPEfLQOUOflPflflPflGGEflOTTROEOSOETQfiSEflOOA 230 210 2S0 260 270 280 290 300 3I0 320 330 Hcu L3/1 OOSOOOOOQOOGHAGAEGLGEflFG 310 350 Eco LI2 H TERfllHUS nS I TfOO I I E-RUflfln SUtlOUUEL I SflnEEICFGUSflflflAUA--UflflGPUEflfl. . . Eco L12 C OOnRIN ...EEKTEFDU--ILKflRGRNKUflUIKAURGflTGL--GLCEflKO-LUESRPfifiLKEGUSKDDREALKKflLEERGfiEUEUt • • • ••• • • • 000 o 0 0 o Hcu L20 HEVUVRRL ILHEROEELTEOHITGULERRGUO UE£-SR-fiCflLURRLEQ-UO- IEE-RUEE RRRflPflRRPRRSGSODEHRRDOG 10 20 30 10 50 60 70 80 90 I00 IIO Hcu L20 OOOEEROAOERfiEflEORGOOOOEEPSGEGLGOLFG 120 130 110 37 amino acids, a molecular mass of 37159 daltons and an isoelectric point of 2.6. Amino acid residues 17 - 41, 70 - 109, 151 - 187, 195 - 216, 254 - 273 and 280 - 295 of the translated open reading frame are virtually identical to sequences of internal tryptic peptide fragments of the Hcu L3 / 4 protein thus identifying this open reading frame as encoding the Hcu L3 / 4 protein (A.T. Matheson, personal communication). The Hcu L3 / 4 and Eco L10 proteins are homologous: the Eco L10 protein has a large internal deletion of 118 residues and a carboxy terminal truncation of 61 residues with respect to the Hcu L3/4 protein but retains 23% amino acid identity over 169 residues (z = 10 by the RDF program). The open reading frame located at nucleotide positions 4018 - 4359 encodes a protein that has 114 amino acids, a molecular mass of 11550 daltons and an isoelectric point of 2.1. The translated open reading frame matched the partial sequence of 77 amino acids of the Hcu L20 protein available and was later confirmed in its entirety with the complete sequencing of the 114 residues of the protein (Liljas et al., 1986). The Hcu L20 protein has previously been shown to be the homologue of the Eco L12 protein by means of statistical analysis (3.5 standard deviations from the mean by Monte Carlo simulation) and by virtue of the conservation of structure, dimerization and function (Yaguchi etal., 1980; Matheson, 1985). In summary, the Hcu L11, Hcu L8, Hcu L3 / 4 and Hcu L20 proteins are encoded by the open reading frames located at nucleotide positions 1622 - 2110, 2314 - 2949, 2954 - 4009 and 4018 - 4359 respectively, are homologous (or equivalent "e") to the Eco L11, Eco L1, Eco L10 and Eco L12 proteins respectively and are henceforth referred to as Hcu L11e, Hcu Lie, Hcu L10e and Hcu L12e (for both genes and proteins) respectively. Analysis of the 1621 nucleotides in front of the Hcu L11e gene on the 5.1 Kilobasepair fragment revealed two potential coding regions (designated ORF and NAB). The 784 nucleotides distal to the L12e gene bears an extreme paucity of restriction sites and is devoid of coding potential. The ORF gene, initiating at nucleotide 1244 and terminating at nucleotide 135, encodes a potential protein of 370 amino acids with a molecular mass of 40499 daltons, an isoelectric point of 5.5 and is oriented opposite to and divergently transcribed from the ribosomal protein genes on the genomic fragment. This potential protein shows no similarity to any known protein sequence in the NBRF PIR and GENBANK databases. The NAB gene, initiating at nucleotide position 1245 and terminating at position 1548, has the same 38 orientation as and is located immediately upstream of the four ribosomal proteins. The NAB - L11e intergenic space is 73 nucleotides in length. The gene potentially encodes a short 68 amino acid protein with a molecular mass of 7530 daltons and an isoelectric point of 3.8. The potential gene product exhibits amino acid sequence similarity to proteins binding nucleic acids (thus the name: Nucleic Acid Bjnder) and especially to the restriction endonucleases EcoRI and PstI: 32% and 30% amino acid identity respectively over the central region (positions 6 - 46) of the aligned proteins (Figure 7). 3.4 Amino Acid Composition and Codon Utilization within pl_W173 The amino acid compositions of the six H. cutirubrum proteins encoded by the 5.1 Kilobasepair fragment are listed in Table 4. The composition of the four H. cutirubrum ribosomal proteins differs from the equivalent E. coli proteins in that they have about twice the content of acidic (aspartic + glutamic acids) residues and half the content of basic (arginine + lysine) residues. It is believed that the high content of acidic residues in the halophilic proteins aids in preserving their structure and function in the high intracellular ionic strength environments in which they exist (Bayley and Morton, 1978; Eisenberg and Wachtel, 1987; Saenger, 1987). The putative proteins encoded by NAB and ORF are also rich in acidic residues. The codon utilization of the Hcu ORF, NAB, L11e, Lie, L10e and L12e genes representing 3837 nucleotides or 75% of the 5146 bp fragment are shown in Table 5. Four points are apparent. First, the TTT codon for phenylalanine is never utilized, there is a strong preference to avoid codons with adjacent T residues and in only two cases do codons with T at the third position precede codons with T at the first position. There are unique TTT and M M tracts within the coding regions at positions 427 - 425 and 2498 - 2501 respectively, and no T tract longer than four. In both the (-) strand of coding regions and within non-coding regions T tracts are much more prevalent. The paucity of T tracts on the (+) strand within coding regions is probably related to their participation in transcription termination (see section 3.6.2). Second, G or C occurs 87% of the time at the third position of the codon, the reason for the enhancement above the high G plus C context of H. cutirubrum genomic DNA (68%) remains unknown. Third, arginine is entirely encoded by the CGN codons and never by the AGR codons (68 - 0; N = any nucleotide, R = purine). A similar bias exists for arginine codons in E. coli. In Saccharomyces cerevisiae ribosomal protein Figure 7 Alignment of the Putative NAB Protein with EcoRI and Pstl The 68 amino acid putative protein encoded by the NAB gene is aligned with amino acid residues 50 -117 and residues 151 - 218 of the eubacterial restriction endonucleases EcoRI and Pstl respectively. Amino acid identities (• ) and conservative substitutions ( o ) between the NAB and EcoRI proteins and the NAB and Pstl proteins are indicated above the EcoRI and Pstl sequences respectively. Conservative substitutions are defined as substitutions within the amino acid groups: D - E - Q - N - R - K - H; L -1 - V - M - F; A - S; S - T; A - G. NR8 10 r i G D P f l f l V R D S T Q I U L P U G 20 T L E D I E U D L E 30 ft E F n U S U F R P 40 T - D ft E I U R I I G 50 S P U l l 60 I K E U T E F L T R H G U H t l P EcoRI P 0 L S F 50 R V R 0 S I K K T E I 60 N E R I K K 70 I 0 P 0 L G G o o • • I L F D S 80 N S S I K P 0 G G 90 • o o U E U K O D Y G 100 O • 0 * 0 U R U U l U R E f l K H Q G K D 110 • • • • • • • O 0 O O * O • • • 0 0 * 0 * O O * O O O 0 0 P a l l D R I P I K L l D G T Q I S L S P G E H N Q L H R D I U H E F - C P R F U G D - n G K I L Y I G D t R S S R N E G G K L M U L D S E Y L K 160 170 180 190 200 210 40 Table 4 Amino Acid Composition of Proteins Encoded by pLW173 Amino acid composition is shown in absolute and, in parentheses, mole percent values. The single letter amino acid code is indicated in the second column. L l l e 163 AA MW 17020 L i e 212 AA MW 23095 LlOe 352 AA MW 37159 L12e 114 AA MW 11550 NAB 68 AA MW 7530 ORF 370 AA MW 40499 p i 2. .7 p i 6. .7 pi 2. .9 p i 2. .1 p i 3.8 p i 6. .8 ALANINE A 20 (12. .3%) 23 (10. .8%) 41 (11. .6%) 28 (24. .6*) 4 (5. .9%) 28 (7. .6%) ARGININE R 3 (1. .8*1 15 (7. .1%) 14 (4. ,0%) 1 (0. .9%) 4 (5. ,9*) 31 (8. .4%) ASPARAGINE N 4 (2. .5%) 9 (4, .2%) 12 (3. .4%) 2 (1. .8%) 0 (0. .0%) 16 (4. .3*) ASPARTIC ACID D 18 (11. .0%) 33 (15. .6%) 42 (11. .9*) 20 (17. .5%) 5 (7. .4%) 30 (8, .1%) CYSTEINE C 1 (0. .6%) 0 (0. .0%) 0 (0. .0%) 0 (0. .0%) 0 (0. .0%) 0 (0. .0%) GLUTAMINE Q 7 (4. .3%) 8 (3. .8%) 17 (4. .8%) 0 (0. .0%) 1 (1. ,5%) 10 (2. .7%) GLUTAMIC ACID E 19 (11. .7*) 14 (6. .6%) 41 (11. .6%) 22 (19. .3%) 7 (10. .3%) 34 (9. .2%) GLYCINE G 16 (9. .8%) 11 (5. .2%) 31 (8. .8%) 9 (7. .9*) 4 (5. ,9%) 39 (10. .5%) HISTIDINE H 0 (0. .0%) 2 (0. .9%) 1 (0. .3*) 0 (0. .0%) 2 (2. ,9%) 5 (1. .4%) ISOLEUCINE I 7 (4, .3%) 7 (3. .3%) 12 (3. .4%) 3 (2. . 6%) 6 (8. .8%) 23 (6. .2%) LEUCINE L 11 (6. .7%) 16 (7. .5%) 31 (8. .8%) 8 (7. .0%) 4 (5. .9%) 32 (8. . 6%) LYSINE K 5 (3. .1%) 5 (2. .4%) 7 (2. ,0%) 1 (0. .9%] 1 (1. ,5%) 15 (4. .1%) METHIONINE M 1 (0. .6%) 8 (3. .8%) 4 (1. .1%) 1 (0. . 9*) 3 (4. ,4%) 8 (2. .2*) PHENYLALANINE F 5 (3. .1%) 5 (2. .4%) 5 (1. .4%) 1 (0, .9%) 3 (4. .4%) 8 (2. .2%) PROLINE P 11 (6. .7%) 10 (4. .7%) 17 (4. .8%) 3 (2. .6%) 5 (7. .4%) 12 (3. .2%) SERINE S 5 (3. .1%) 7 (3. .3%) 21 (6. .0%) 4 (3. .5%) 3 (4. ,4%) 19 (5. .1*) THREONINE T 11 (6. ,7*) 13 (6. .1%) 19 (5. .4%) 2 (1. .8*) 5 (7. ,4%) 15 (4. .1%! TRYPTOPHAN W 0 (0. .0%) 0 (0. .0%) 1 (0. .3%) 0 '(0. .0*) 0 (0. .0%) 1 (0, .3%) TYROSINE Y 3 (1. .8%) 1 <o. .5%) 5 (1. .4%) 2 (1. .8%) 1 (1. ,5%) 9 (2. .4%) VALINE V 16 (9. . 8%) 25 (11. .8%) 31 (8. .8%) 7 (6. .1%) 10 (14. .7*) 35 (9. .5%) 41 Table 5 Codon Utilization of Proteins Encoded by pLWl73 Codon usage is shown in absolute and, in parentheses, percentage values. 'rPRO* includes the L11e, Lie, L10e and L12e ribosomal proteins. 'ALL* includes all six proteins encoded by pLW173. PHE LEU LEU ILE MET UflL L I U 163 Rfl Lie 212 Rfl LlOe 352 Rfl LI2e I M flfl HflB 68 Rfl ORF 370 RR rPRO 841 flfl RLL 1279 flfl uuu 0 (0 OX) 0 (0.0X) 0 (0.0X) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0 OX) 0 (0 OX) uuc 5 (3 U ) 5 (2.11) 5 (1 1X) 1 (0 9X) 3 (1.1X) 8 (2.2X) 16 (1 9X) 27 (2 IX) UUR 0 (0 01) 0 (0.0X) 0 (0.0X) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0 OX) 0 (O.OX) UUG 0 (0 OX) 0 (0.0X) 1 (0.3X) 0 (O.OX) 0 (O.OX) 4 (1.IX) 1 (0 IX) 5 (0 1X) cuu 0 (0 Ot) 2 (0.9X) 1 (0 it) 0 (0.0X) 0 (O.OX) 0 (O.OX) 3 (0 1X) 3 (0 2X) cue 9 (5 .St) 10 (1.7X) IB (5 \t) 3 (2 6X) 3 (1.1X) 15 (4.IX) 10 (1 BX) 58 (1 5X) CUR 0 (0 Ot) 0 (0.0X) 0 (0 Ot) 0 (0 OX) 0 (O.OX) 0 (O.OX) 0 (0 OX) 0 (0 OX) CUG 2 (1 21) 1 (I.9X) 11 (3 IX) 5 (1 1X) 1 (1.5X) 13 (3.5X) 22 (2 6X) 36 (2 8X) RUU 0 (0 OX) 0 (0.0X) 1 (0 3X) 0 (0 OX) 0 (O.OX) , (0.3X) I (0 IX) 2 (0 2X) RUC 7 (1 3X) 6 (2.8X) 11 (3 IX) 3 (2 6X) 6 (8.8X) 22 (5.9X) 27 (3 2X) 55 (1 3X) nun 0 (0 OX) I (0.5X) 0 (0 OX) 0 (0 OX) 0 (O.OX) 0 (O.OX) 1 (0 IX) 1 (0 IX) RUG 1 (0 6X) 8 (3.8X) 4 (1 IX) 1 (0 9X) 3 (1.1X) 8 (2.2X) 11 (1 7X> 25 (2 OX) GUU 2 (1 21) 3 (I.IX) 2 (0 6X) 0 (0. OX) 0 (O.OX) 2 (0.5X) 7 (0 BX) 9 (0 7X) cue 10 (6 IX) 10 (1.7X) 20 (5.7X) 6 (5. 3X) 5 (7.1X) 16 (1.31) 16 (5. 5X) 67 (5. 2X) GUfl 1 (0 61) 2 (0.9X) 0 (0 OX) 0 (0 OX) 0 (O.OX) 0 (O.OX) 3 (0 1X) 3 (0 2X) CUG 3 (1 8X) 10 (4.7X) 9 (2 6X) 1 (0 .9X) 5 (7.1X) 17 (1.6X) 23 (2 7X) 15 (3 5X) UCU 0 (0 OX) 0 (0.0X) 0 (0 OX) 0 (0 OX) 0 (O.OX) 1 (0.3X) 0 (0 OX) 1 (0 OX) ucc 1 (2 5X) 2 (0.9X) 9 (2 6X) 2 (1 8X) 0 (O.OX) 2 (0.5X) 17 (2 OX) 1 9 (1 5X) UCR 0 (0 OX) 0 (0.0X) 0 (0 OX) 0 (0 OX) 1 (1.5X) 0 (O.OX) 0 (0 OX) 1 (0 IX) UCG 1 (0 6X) 2 (0.9X) 4 (1 IX) 0 (0 OX) 0 (O.OX) 1 1 O.OX) 7 (0 8X) 18 (1 1X) ecu 1 (0 6X) 1 (0.5X) 2 (0 6X) 2 (1 ex) 1 (1.5X) 0 (O.OX) 6 (0 7X> 7 (0 5X) CCC 5 (3 IX) 2 (0.9X) 5 (1 IX) 1 (0 9X) 0 (O.OX) 2 (0.5X) 13 (1 5X) 15 (1 2X) CCR 0 (0 OX) 1 (0.5X) 0 (0 OX) 0 (O.OX) 1 (I.5X) 1 (0.3X) 1 (0 IX) 3 (0 2X) CCG S (3 IX) 6 (2.8X) 10 (2 BX) 0 (0 OX) 3 (1.1X) 9 (2.1X) 21 (2 5X) 33 (2 6X) RCU 0 (0 OX) 0 (0.0X) 1 (0 3X) 0 (0 OX) 0 (O.OX) 0 (O.OX) 1 (0 IX) 1 (0 IX) RCC 4 (2 5X) 5 (2.1X) 10 (2 BX) 2 (1 6X) 2 (2.9X) 9 (2.1X) 21 (2 5X) 32 (2 5X) RCR 0 (0 OX) 2 (0.9X) 1 (0 3X) 0 (0 OX) 0 (O.OX) 2 (0.5X) 3 (0 1X) 5 (0 1X) RCG 7 (4 3X) 6 (2.8X) 7 (2 OX) 0 (0 OX) 3 (1,4X) 4 (I.IX) 20 (2 • 1X) 27 (2 IX) ecu 2 (1 21) 2 (0.9X) 2 (0 6X) 3 (2 6X) 1 (1.5X) 0 (O.OX) 9 (1 .IX) 10 (0 8X) GCC 8 (4 9X) 7 (3.3X) 13 (3 • 7X) 16 (14.OX) 1 (1.5X) 1 3 (3.5X) 14 (5 2X) 58 (1 SX) GCR 0 (0 OX) 7 (3.3X) 3 (0 9X) 1 (3 5X) 0 (O.OX) 1 (0.3X) 11 (1 .7X) 15 (1 2X) GCG 10 (6 IX) 7 (3.3X) 23 (6 5X) 5 (4 4X> 2 (2.9X) 1 4 (3.8X) 15 (5 1X) 61 (1 8X) SER PRO THR RLfl 42 Table 5 (Continued) D i e Lie LlOe Lt2e NfiB ORF rPRO ALL 163 RR 212 flfl 352 flfi 11 1 RR 68 RR 370 RR 811 RR 1279 RR TUD URU 0 (0. ox) 0 (0. OX) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0. OX) 0 (0 .OX) 0 (O.OX) 1 Yn URC 3 (I. 8X) 1 (0. SX) 5 (1, .«) 2 (I.8X) 1 (I.SX) 9 (2.4X) 1 1 (1 .3X) 21 (1.6X) OCH URR 0 (O.OX) 0 (0. OX) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0. OX) 0 (O.OX) 0 (O.OX) RlIB URG 0 (0. 01) 0 (O.OX) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0. OX) 0 (0 .OX) 0 (O.OX) CRU 0 (O.OX) 0 (0. OX) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0. OX) 0 (0 .OX) 0 (O.OX) HIS CRC 0 (0. 01) 2 (0. 9X) 1 (0. 3X) 0 (O.OX) 2 (2.9X) 5 (I. 4X) 3 (0 MX) 10 (o.ex) CRR 0 (0. OX) 2 (0.9X) 3 (0. 9X) 0 (O.OX) 0 (O.OX) 3 (0. 8X) 5 (0 .6X) 8 (0.6X) GLN CRG 7 (1 .3X) 6 (2.8X) M (1. OX) 0 (O.OX) 1 (1.SX) 7 (I • 9X) 27 (3 .2X) 35 (2.7X) ASN RRU 0 (0. OX) 0 (0. OX) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0. OX) 0 (0 .OX) 0 (O.OX) ARC (2 .SX) 9 (« .2X) 12 (3 4X) 2 (1.8X) 0 (O.OX) 16 (4 .3X) 27 (3 .2X) 13 (3.1X) LVS RRR 1 (2. 5X) 3 (I. IX) 0 (0. OX) 0 (O.OX) 0 (O.OX) 3 (0. BX) 7 (0 I.8X) 10 (0.8X) RRG 1 (0 .6X) 2 (0 9X) 7 (2 .OX) I (0.9X) 1 (I.5X) 12 (3 .2X) 1 1 (1 .3X) 21 (1.9X) RSP GRU 0 (0. OX) 3 (I. 1X) 1 (I, IX) 0 (O.OX) 0 (O.OX) 3 (0. 8X) 7 (C I.8X) 10 (O.BX) GRC 18 (II.OX) 30 (M.2X) 38 (I0.8X) 20 (17.5X) 5 (7.4X) 27 (7 .3X) 106 (12 .6X) 138 (10.BX) GLU GRR 8 (1 .9X) 1 (I .9X) 13 (3. 7X) 8 (7.OX) 1 (I.SX) 8 (2 • 2X) 33 (3 .9X) 12 (3.3X) GfiG 1 1 (6 .7X) 10 (4. 7X) 28 (8. OX) 11 (12.3X) 6 (8.8X) 26 (7. OX) 63 (7 .5X) 95 (7.1X) rue UGU 1 (0. ,6X) 0 (0. OX) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0. OX) 1 (0. IX) I (O.IX) LYo UGC 0 (0. OX) 0 (0. OX) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0. OX) 0 (0. OX) 0 (O.OX) OPfl UGfi 0 (0, OX) 0 (0. OX) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0. OX) 0 (0. OX) 0 (O.OX) TRP UGG 0 (0. OX) 0 (0. OX) I (0. 3X) 0 (O.OX) 0 (O.OX) (0. 3X) 1 (0. IX) 2 (0.2X) CGU 0 (0. OX) 2 (0. 9X) 0 (0. OX) 0 (O.OX) 0 (O.OX) 3 (0. 8X) 2 (0. 2X) 5 (0.1X) on/* CGC 2 (I .2X) 10 (1 .7X) 10 (2. ex) I (0.9X) 3 (4.1X) 11 (3 .8X) 23 (2. 7X) 10 O.IX) HRU CGR 0 (0. OX) I (0. 5X) 1 (0. ,3X) 0 (O.OX) 0 (O.OX) 0 (0. OX) 2 (0.2X) 2 (0.2X) CGG 1 (0 ,6X) 2 (0 .9X) 3 (0 .9X) 0 (O.OX) 1 (I•SX) 11 (3 .BX) 6 (0. 7X) 21 (1.6X) CCD RGU 0 (0. OX) 0 (0. OX) 1 (0. ,3X) 0 (O.OX) 1 (I.SX) 0 (0 .OX) 1 (0. IX) 2 (0.2X) StR RGC 0 (0 • OX) 3 (I .11) 7 (2 .OX) 2 (1.8X) 1 (I.SX) s (1 .4X) 12 (1. 4X) 18 (1 .«) RGR 0 (0. OX) 0 (0. OX) 0 (0, OX) 0 (O.OX) 0 (O.OX) 0 (0 OX) 0 (0. OX) 0 (O.OX) RRG RGG 0 (0. OX) 0 (0. OX) 0 (0. OX) 0 (O.OX) 0 (O.OX) 0 (0 .OX) 0 (0. OX) 0 (O.OX) GGU 1 (2 5X) 3 (I 1X) 2 (0 .6X) 0 (O.OX) 1 (I.SX) 2 (0 • SX) 9 (1 . IX) 12 (0.9X) i ~ | y GGC 8 (1 .9X) 5 (2 .4X) 22 (6 .3X) 8 (7.OX) 1 (I.5X) 19 (5 .IX) 13 (5. IX) 63 (4.9X) ULY GGR I (0. ,6X) 1 (0. 51) 2 (0 6X) 0 (O.OX) 0 (O.OX) 1 (1 .IX) 1 (0. SX) 8 (0.6X) GGG 3 (1 .ex) 2 (0 .91) 5 (I .1X) I (0.9X) 2 (2.9X) 11 (3 .8X) 1 1 (1 . 3X) 27 (2.IX) 43 genes both the AGR and CGN codons are used whereas in the archaebacterium S. solfataricus the arginine codon bias of the GTPase domain ribosomal protein genes is inverted from that of H. cutirubrum, arginine being encoded exclusively by the AGR and never by the CGN codons (Ramirez etal., 1990a). Fourth, genes encoding proteins in eubacteria and eucaryota usually contain more R / N / Y and G / non-G / N triplets in the functional reading frame than in the other two possible reading frames or intergenic regions (Y = pyrimidine; Shepherd, 1981; Trifonov, 1987). The six genes encoded by pLW173 (and the majority of archaebacterial genes) follow both the R / N / Y and G / non-G / N patterns. These codon biases are believed to be derived from a frame monitoring / maintaining system developed during the early evolution of the translation apparatus, apparently preceding the divergence of the three urkingdoms. 3.5 Transcription Analysis of pLWl73 The in vivo transcripts produced from the 5.1 Kilobasepair fragment of genomic DNA were detected and analyzed by Northern hybridization, S1 nuclease protection analysis and primer extension analysis utilizing reverse transcriptase. Total RNA was isolated from exponentially growing cells and used in these procedures. The results of these analyses for the ORF gene, the NAB and L11e genes and the Lie, L10e and L12e genes are shown in Figures 8, 9 and 10 respectively and summarized in Figure 11. 3.5.1 Transcription of the ORF Gene The very rare leftwards transcript of the ORF gene was identified by Northern hybridization utilizing OLW703, containing the 189 nucleotide Sail insert from positions 324 - 512 inclusive, as probe (labeled with a 3 2 P dCTP by primer extension with Klenow fragment) and was estimated to be about 1200 nucleotides in length (Figure 8A). The 5' ends of the transcript were identified by primer extension analysis with oLW36 on total RNA as template (Figure 8B). The major 5' end site occurs at the G residue at position 1245, one nucleotide in front of the putative ATG initiation codon and minor 5' end sites occur at positions 1248 (C residue) and 1293 (G residue yielding a 49 nucleotide leader). By densitometry of the autoradiogram the relative transcription levels at the minor sites are 11% and 6% of the major transcription initiation site respectively. The 3' transcript end site was identified by S1 nuclease protection of a 906 basepair PstI - Nhel fragment (positions 3609 of pBR322 to position 131 of the insert) 3' end labelled with 44 Figure 8 Transcription of the ORF Gene Line Diagram The transcription of the ORF gene of Halobacterium cutirubrum is depicted. The gene is oriented towards the left and part of the pBR322 vector is included on the left; the junction between vector and insert is at the Clal site. The transcripts are indicated above; open circles (O ) represent 5' transcript ends and the vertical line (I) represents the 3' transcript end. Restriction sites and their positions used to generate probes for transcription analysis are indicated below. Photographs In the primer extension and S1 nuclease protection experiments having sequence ladders the sequence is written below the photograph and the positions of the transcription initiation site(s) and termination site(s) are indicated by filled circles and the direction of transcription is indicated by an arrow (or arrows). The translation initiation codon is underlined. A Northern blot of genomic H. cutirubrum RNA probed with phage OLW703 containing a 189 nucleotide Sail insert (positions 324 - 512 inclusive). Size standards were Haelll restricted and 5' end labeled single stranded M13mp18 phage. B 5' end of the ORF transcript detected by primer extension (PE) using oLW 36. Sequence is derived from priming phage OLW706 containing a 563 nucleotide insert (positions 943 - 1505) with oLW36 using T7 DNA polymerase. C 3' end of the ORF transcript detected by S1 nuclease protection of an PstI - Nhel fragment (position 3613 of pBR322 to position 131 of the insert DNA) 3' end labelled with a 3 2 P dCTP at position 132. Sequence ladder was generated by chemical sequencing from the Nhel site. 45 pBH322 -O-O ORF Pat I 3613 C l a l 23/1 Nhel 131 Sal I 324 Sal I 512 fl B PE T c 6 fl 1200 C|>703 I 2527 1395 849 34 I I I I l i t \ / 1 / \ GGGTGGCCTGflCGCC flflflfl GCCCGTGCflCTflCCCC CCCACCGGRCTGCGG TTTT CGGGCflCGTGflTGGGG 1293 1 2 4 5 c fl.fl.fl.Gflfl fl.GGflflflfl.AG.GGfl.flGfl TflTGTGCTTGGGGTGCCTTTTGTCGCCTflTCT •••• <C=" 32 46 c t 3 2 P dCTP at the Nhel site. Termination occurs primarily within the I l l l sequence at positions 32 - 29 (Figure 8C). 3.5.2 Transcription of the NAB and L l l e Genes Three different rightwards transcripts are detectable from the NAB - L11e region by Northern hybridization using M13 phage subclones (labeled with c c 3 2 P dCTP by primer extension with Klenow fragment) as probes (Figure 9A). Using OLW635 (containing a 94 nucleotide Mbol insert; positions 1473 - 1380) as a probe, a 270 nucleotide long monocistronic NAB transcript and an 850 nucleotide long bicistronic NAB - L11e transcript were detected. The 850 nucleotide long bicistronic NAB - L11e transcript and a third transcript, a 600 nucleotide long L11e monocistronic transcript, were detected using the phage dXW670 (containing a 115 nucleotide Taql insert; positions 2028 - 1914) as a probe. The phage OLW607 containing a 363 nucleotide insert of 5 noncontiguous Mbol fragments (positions 1562 - 1299 and 1735 - 1633) detects all three transcripts and densitometry of the autoradiogram revealed relative transcriptional expression levels of 1% and 10% of the monocistronic L11e transcript for the NAB and bicistronic NAB - L11 e transcripts respectively. Low resolution of the 5' ends of the ORF, NAB - L11e bicistronic and L11e monocistronic transcripts were detected by S1 nuclease protection of a 529 basepair Sail fragment (positions 1177 - 1706) 5' end labelled at positions 1178 and 1710 with y 3 2 P ATP (Figure 9B). Three specific protection products were observed. The first was a very rare product about 65 nucleotides in length resulting from protection by the leftwards ORF transcript with a 5' end at position 1245 and protecting 5' label at position 1178. The second and third products were about 90 and 370 nucleotides in length and correspond to the rightwards 5' transcript ends at approximate positions 1620 and 1340 respectively and protecting label at position 1710. (A fourth band of about 210 nucleotides in length is the result of contamination of the 5' end labeled probe with the 383 basepair Sail fragment (positions 2060 - 2443) and protection by the 5' end of the Lie - L10e - L12e RNA transcript; see section 3.5.3). Densitometry on this autoradiogram indicates that the relative expression levels of the ORF and NAB - L11e bicistronic transcripts are 0.2% and 11% of the L11e monocistronic transcript expression respectively. Primer extension analysis of transcripts encoding NAB was performed on total RNA with the 47 Figure 9 Transcription of the NAB and L U e Genes Line Diagram The transcription of the NAB and L11e genes of Halobacterium cutirubrum are depicted. The genes are oriented to the right and the transcripts are indicated immediately above; open circles ( O ) represent 5' transcript ends, vertical lines (I) represent the 3' transcript ends and open boxes ( • ) represent multiple 3' transcript ends. Restriction sites and their positions used to generate probes for transcription analysis are indicated below. Photographs In the primer extension and S1 nuclease protection experiments having sequence ladders the sequence is written below the photograph and the positions of the transcription initiation site(s) and termination site(s) are indicated by filled circles and the direction of transcription is indicated by an arrow (or arrows). Translation initiation codons are underlined. C and F are composites of different exposures of single autoradiograms. A Northern blot of genomic H. cutirubrum RNA probed with phage containing regions of the NAB, L11 e and both of the NAB and L11e genes. Probes are: NAB, phage dXW635 containing a 94 nucleotide Mbol insert (positions 1473 -1380 inclusive); L11e, phage OLW670 containing a 115 nucleotide Taql insert (positions 2028 - 1914 inclusive); NAB - L11e, phage OLW607 containing a 363 nucleotide insert of 5 noncontiguous Mbol fragments (containing positions 1562 - 1299 and 1735 - 1633 inclusive). Size standards were Haelll restricted and 5' end labeled single stranded M13mp18 phage. B Low resolution of the 5' ends of the ORF, NAB - L11e bicistronic and L11e monocistronic transcripts detected by S1 nuclease protection of a 529 basepair Sail fragment (positions 1177 - 1706) 5' end labeled with y 3 2 P ATP at positions 1178 and 1710. The very rare transcript from the ORF gene is visible on the original autoradiogram but not on the photographic reproduction. Size standards were Mspl restricted and 3' end labeled pBR322. C 5* end of the NAB - L11e bicistronic transcript detected by primer extension (PE) using oLW51. Sequence is derived from priming phage OLW566 containing a 3382 nucleotide Clal - Pstl insert (positions 1 - 3382 inclusive) with oLW51 using T7 DNA polymerase. D 5' end of the NAB transcript detected by primer extension (PE) using oLW52. Sequence is derived from priming phagecI>LW566 with oLW52 using Klenow fragment. E 3' end of the NAB monocistronic transcript detected by S1 nuclease protection of an Avail fragment (positions 1419 - 1682) 3' end labeled with c c 3 2 P dTTP at position 1421. The sequence ladder was generated by chemical sequencing of the Avail fragment. F 5' end of the L11e transcript detected by primer extension (PE) with O L W 5 1 . The sequence is derived from priming phage OLW566 with oLW51 using T7 DNA polymerase. G 3' ends of the L11e transcripts detected by S1 nuclease protection of a 155 nucleotide Sail - Xmal fragment (positions 2060 - 2215) labeled with a 3 2 P dTTP at position 2064. The sequence ladder was generated by chemical sequencing of the Sail - Xmal fragment labeled at position 2064. 48 ORF i S a i l 1177 nflB A v a l I M I 9 L I l e fluall S a i l 1682 1706 Lie i n i Tool Tool S a i l S . a l 1 9 H 2026 2060 221S Sa l I 211J I I I I I 635 670 607 850 600 I I I 1395 849 270 I I I Z4\ 251 214 309 228 190 160 B i i i i 123 90 76 67 SI A HflB A A L 1 1 e ORF P E T C G R TRTCRCTRCCCRC RTRGTGRTGGGTG 1341 D P E T C G R / / GGTRGCGTRTCRCTRCCCRC CCRTCGCRTRGTGRTGGGTG 1311 SI R fi + G , f l . R G R G R R f l . . 6 . . 6 . . GGTRTGRGGCTCTTTGGCGGCGG • <? 1615 si • t R R R R G . G . . GRRG.GRf lG.RRG.G TTTTCGCflGCTTCGCTTCGTTCGC •o • • • 2209 2201 2196 2192 GflGCCTCRTRCCGRCTCTGCT CTCGGRGTRTGGCTGRGRCGR 1622 \ I G . G R R . . GRR.GG.G.RGRf i f l CGCTTGGCTTGCCGCGTCTTT 2115 2110 2 1 2 9 49 oligonucleotides oLW51 (positions 1714 - 1695; within the L11e gene; Figure 9C) and oLW52 (positions 1429 - 1410; within the NAB gene; Figure 9D). A unique 5' end site was detected at position 1344, corresponding to the G residue immediately in front of the NAB ATG translation initiation codon. The position of 3' transcript end sites within and the extent of trancription through the NAB - L11e intergenic space was assessed by S1 nuclease protection of a 263 basepair Avail fragment (positions 1419 - 1682) 3' end labeled at position 1421 with oc 3 2 P dTTP (Figure 9E). Two protection products were observed and correspond to full protection by read-through transcripts and partial protection by transcripts with 3' end sites at a T residue immediately after a TTT tract near position 1615. Densitometry of the autoradiagram indicates that readthrough from the NAB gene into the L11e gene constitutes 90% of the transcripts. The 5' transcript end site for the 600 nucleotide L11e monocistronic transcript was identified at high resolution by primer extension analysis with oligonucleotide oLW51 (Figure 9F). The predominant 5' end site was detected at the A residue at position 1622. This residue is the initial nucleotide of the initiator methionine ATG codon of the L11e coding region; apparently this abundant transcript has no leader. There is a gap of 6 nucleotides between the 3* end of the monocistronic NAB transcript and the 5' end of the monocistronic L11e transcript. The 3* transcript end sites in the L11e - Lie intergenic space were identified at low resolution by S1 nuclease protection of the 383 basepair Sail fragment (positions 2060 - 2443) 3' end labeled with c c 3 2 P dTTP at position 2064. Protection of fragments up to approximately 155 nucleotides in length was observed with little or no full length transcription readthrough into the Lie gene (data not shown). High resolution determination of the 3' transcript end sites in the L11e - Lie intergenic space was achieved by S1 nuclease protection of the 155 basepair Sail - Xmal fragment (positions 2060 - 2215). The probe fragment was 3' end labeled with c t 3 2 P dTTP at position 2064 and seven different sizes of protection products were observed corresponding to 3' end sites within T tracts near positions 2129, 2140, 2145, 2192, 2296, 2201, and 2209 (Figure 9G). It is worth noting here that tracts of two or more T residues within the coding regions of the six genes did not generate 3' ends in nuclease S1 protection experiments and therefore the seven 3' ends observed in the noncoding 3' flanking region of the L11e gene between positions 2129 and 2209 constitute transcription terminations and are not artifacts due to 50 the action of S1 nuclease at regions of DNA / RNA hybrid instability caused by poly T tracts. 3.5.3 Transcription of the L ie , L10e and L12e Genes A variety of M13 subclones of regions of the Lie, L10e and L12e genes were used as probes in Northern hybridization of total RNA and the results indicated that these three genes are encoded on a single tricistronic transcript of approximately 2150 nucleotides in length. Illustrated in Figure 10A is total RNA probed with OLW730, an M13 subclone containing a 294 nucleotide Sail insert (positions 2736 - 2443 inclusive), and labeled with a 3 2 P dCTP by primer extension with Klenow fragment. The 5' end sites of the tricistronic Lie - L10e - L12e transcript were analyzed by nuclease S1 protection of total RNA by the 383 basepair Sail fragment (positions 2060 - 2443) 5" end labeled with Y^2P ATP at position 2447 (Figure 10B). This resulted in protection of fragments ranging in size from approximately 120 to 210 nucleotides in length, corresponding to 75 nucleotides upstream and 10 nucleotides downstream of the Lie ATG translation initation codon. The 5' end sites were analyzed at higher resolution by primer extension with oLW38 (positions 2494 - 2478; Figure 10C) and oLW54 (positions 2326 - 2307; Figure 10D). The major transcripts had a 5' end at position 2239, 75 nucleotides in front of the Lie ATG translation initation codon and about 30 nucleotides beyond the last termination site for transcripts exiting the L11e gene. A number of other less abundant 5" ends located between positions 2239 and 2322 were also apparent and coincident both in primer extension and S1 nuclease protection experiments; the shortest of these at position 2322 is just within the coding region of Lie and probably represents an intermediate in the degradation of the tricistronic mRNA. No other major 5' ends were detected by S1 nuclease protection of Sail fragments between nucleotides 2322 and 4360, in agreement with the Northern hybridization analysis indicating a single tricistronic transcript encoding the Lie, L10e and L12e ribosomal proteins. The 3' end sites of the tricistronic Lie - LlOe - L12e transcript were mapped by S1 nuclease protection by total RNA of the Sail - Xmal fragment (positions 4159 - 4644) 3' end labeled with a 3 2 P dTTP at position 4163. The 3' transcript end was located near nucleotide 4402 within a tract of six T residues (Figure 10E). All transcripts exiting the L12e gene terminate in this region. Attempts to identify transcripts from either strand of the DNA beyond position 4163 by Northern hybridization and S1 nuclease 51 Figure 10 Transcription of the L i e , LlOe and Ll2e Genes Line Diagram The transcription of the Lie, LlOe and L12e genes of Halobacterium cutirubrum are depicted. The genes are oriented to the right and the transcripts are indicated above; the open circle ( O ) represents the 5' transcript end and the vertical line (I ) represents the 3' transcript end. Restriction sites and their positions used to generate probes for transcription analysis are indicated below. Photographs In the primer extension and S1 nuclease protection experiments having sequence ladders the sequence is written below the photograph and the positions of the transcription initiation site(s) and termination site(s) are indicated by filled circles and the direction of transcription is indicated by an arrow (or arrows). The Lie translation initiation codon is underlined. D is a composite of different exposures of a single autoradiogram. A Northern blot of genomic H. cutirubrum RNA probed with phage OLW730 containing a 294 nucleotide Sail insert (positions 2736 - 2443 inclusive). The autoradiogram is overexposed and bands at approximately 3 Kilobases and 1.5 Kilobases are due to weak hybridization to the 23S and 16S rRNAs respectively. Size standards were Haelll restricted and 5' end labeled single stranded M13mp18 phage. B 5' ends of the L ie - L10e - L12e transcript detected by S1 nuclease protection of a Sail fragment (positions 2060 - 2443) 5' end labeled at position 2447 with -ft2? ATP. Size standards were Mspl restricted and 3' end labeled pBR 322. C 5' ends of the L ie - L10e - Ll2e transcript detected by primer extension (PE) with oLW 38. Sequence is derived from priming phage OLW566 with oLW38 using Klenow fragment. D 5' ends of the L ie - L10e - L12e transcript detected by primer extension (PE) with oLW 54. Sequence is derived from priming phage OLW730 containing a 389 nucleotide Sail - Sail insert (positions 2060 - 2448 inclusive) with oLW54 using T7 DNA polymerase. E 3' end of the L ie - L10e - L12e transcripts detected by S1 nuclease protection of a Sail - Xmal fragment (positions 4159 - 4644) 3' end labeled with c t 3 2 P dTTP at position 4163. The sequence ladder was generated by chemical sequencing of the Sail - Xmal fragment. 52 LI le L i e L lOe L12e Sal I 2060 Sal I 2113 Sal I 2731 Sal I 11 59 Xiiol 1611 fl <j>730 2150 B 210 190 120 St t f 2527 I 1395 I 849 I I I I I I 217 I90 160 147 123 110 T C G fl H II I I J P * l * J l V M l » f i ! • II i I I I I • f i t ! / TTGGCTCTGTCCGARGCGGRCRRRG RflCCGRGRCRGGCTTCGCCTGTTTC 2239 2256 \ \ TCCCRGTG RGGGTCRC 2292 / / TRCCGTCTGT RTGGCRGRCR • 2322 53 protection experiments were negative, implying that this region probably represents a transcriptionally inactive space. 3.6 Consensus Signal Structures Illustrated in Figure 11 is a line diagram depicting the genes encoded on pLW173 and summarizing the results of the transcript mapping experiments. Also summarized are the 5 transcriptional promotors (ORF P1, ORF P2, NAB, L11e and Lie), the 4 transcriptional terminators (ORF, NAB, L11e and L12e) and the translation initiation regions of the 6 genes. 3.6.1 Transcription Initiation Regions Sequences surrounding the 5' transcript end sites are summarized (Figure 11 Transcription Promotion). The two conserved sequences that appear to constitute a part of the H. cutirubrum transcriptional promoter are TTCGA and TTAA. The spacing between these two elements is 4 - 15 nucleotides and the distance to the transcription start site is 20 - 26 nucleotides. More than one TTCGA element may be present. It is interesting to note that the very weak ORF P2 promoter exhibits the least conservation to the consensus at the appropriate position and this may be the reason for the low level of expression of transcription. The ORF P1 promotor has well conserved consensus elements but yields the rarest transcript; this may be related to the fact that the TTAA element is used on the complementary strand for promotion of the much more highly expressed NAB and NAB - L11e transcripts. Alternatively the downstream TTTT tract (positions 1274 - 1271) may result in premature termination; this would not be detected by the primer extension or S1 nuclease protection experiments. It is possible that this constitutes a mechanism for regulation of expression of the ORF gene; an antitermination factor could allow readthrough from the strong P1 promotor to elevate expression dramatically above the rare expression from the very poor P2 promotor. Such activation of the ORF P1 promotor could conceivably be coupled to down regulate the NAB promotor; this would have little effect on the level of expression of the L11 e protein due to it being primarily present as a monocistronic transcript. 54 Figure 11 Summary of Gene Expression in pLW173 Line Diagram The genomic organization of the L11e, Lie, L10e and L12e ribosomal protein gene cluster of Halobacterium cutirubrum is depicted. Known ribosomal protein encoding genes are solid boxes and putative protein encoding genes are striped boxes. Genes above the line are oriented and transcribed rightwards and those below the line are oriented and transcribed leftwards. The restriction sites indicated on the 5.1 Kilobasepair fragment (scale at top) are: Avail, A; BamHI, B; Clal, C; Nhel, N ; PstI, P; Sail, S; Xmal, X. Transcripts of the Halobacterium cutirubrum genes are indicated. The open circles ( O ) represent 5' transcript initiation sites and the vertical lines (I) represent 3' transcript termination sites. The open boxes ( • ) at the ends of trancripts indicate regions of multiple 3' trancript ends. The stippled box ( Q ) on the L ie - L10e - L12e tricistronic transcript indicates the region of potential regulation by autogenous inhibition of translation by the Lie protein (discussed in section 3.7). Transcription Promotion Sequences upstream of putative transcription initiation sites are shown with 5' end sites aligned at position +1 and highlighted with a solid circle (•)• The position of the 5' end sites in the sequence presented in Figure 5 are indicated on the right. The ATG translation inititation codons adjacent to the 5' transcript end sites are heavy overlined. Sequences resembling the consensus TTCGA and TTAA motifs are underlined with the conserved bases highlighted. Where the terminator of the upstream gene overlaps with the promotor (L11e and Lie), the termination site(s) are light overiined. Transcription Termination Sequences upstream from putative transcription termination sites are aligned with the first base of the termination codon (heavy overline) set at +1. The position of the +1 nucleotide in the sequence presented in Figure 5 is indicated on the left. The GC rich tracts and poly T tracts are underlined and highlighted and the most prominent 3' end site in each T tract is indicated by a solid circle (•)• Where the promotor of the downstream gene overlaps with the terminator (NAB and L11 e), the promotor sequences (TTCGA and TTAA) are light overlined. Translation Initiation Sites Sequences surrounding the AUG translation initiation regions are presented with the initiation methionine codons heavy underlined. The first base in the inflation codons are aligned at +1 and their position in the sequence presented in Figure 5 is indicated on the left. Upstream termination codons are indicated by light underline. The sequence of the 3' end of the 16S ribosomal RNA is indicated at top and sequences complementary to the 3' end of the 16S rRNA are highlighted with solid circles (•). In the L12e initiation sequence an internal AUG codon near the end of the L10e cistron is overlined; if it were recognized as an initiation codon, it would produce a tripeptide. I1HB Llle C S N S 5 5 5 X 5 T7A I I 1 . 1 . J M . L J . fV/1 55 Lie LIDe L12e A A S S X S S S X P S P P S S S ORF -03 O O 1000 _ l _ 1500 2000 _ i L_ - • • O 2300 3000 3300 4000 _ J I l _ 4300 3000 TRflnSCRIPTIDn miTiHTion REGions ORF PI cactaTgCGHtggcttcacteggcgtaTTRRcgtgtcgaaacgatcccaccOORC... 1293 ORF P2 cgtgtcgQaocggtcccaccggacTgCGgaggaaagcgcTTttcggcgcttgctgtctQcgggcacgtGRTG.•. 1215 HRB ctccggtgggatcgtTTCGRcacgTTRRtacgccgagtgaagccotcgcalaglGRTG... 1311 L l l e cgoTTCGRtccgcggcggcgccccgcTCGRoQgacoogggTTRRacccgcggeggcggtttctcggagtRTGG... 1622 L i e tqcTTCGcTTCGRcocttTTRRqcccqqqatcoccqtctqtoqooccGRGR... 2239 -60 -SO -10 -30 -20 -10 •! TRflnscRiPTion TERmmRTion REGions •••• ORF cqcTRGecgatqccgQCGGCGCGCCGCCGGGtggtGGCGGtGGCGCLGGCCGCGGGagtggtgccgtgggtcotcgtcgaetggtcgoacggcgtctatccgctgTTTTccg 131 NRB ccgTGRqcqaTTcnatCCGCGGCGGCGCCCCGCtcqaaaqaceoqqqTToaaCCCGCGGCGGCGGTTTctc 1519 L l l e gcgTRRCGCCGCCCGoggqqTTTctgcgccgTTcggTTcgcgtoctcgotqgcgBcqtqtqtCCGCGGGtCGCGCtcccacacTrqcTTcqcTrcqacqcTTTTaaq 2111 L12e gggTRRCCCGGtCGCGtCGCGCGCCGacagccacgateacotcqTTTTTToqc 1360 *1 10 20 30 10 50 60 70 BO 90 100 3' UCCUCCRCURGGUCG...16S rRHfi TRflnSLHTIOn miTiRTion REGions ORF ( P I ) ORF (P2) .. uacggGcflcGUGRUGgggcucgRGGRGGoc. oRUGqqocucqRGGRGGoc,.. 1211 NRB qRUOCGUGficCCuqcuqcq... 1315 L l l e RUGgcuGRGacGRUCgaa... 1622 NRB/L11e •••• ••• •••• ...uucucGGRCuflUGgcuCRCacGflUCgaa... 1622 . •cuacGGRGGUgQaaqRUGqcaqaccQcqauQuQ... 2 3 M LlOe .gccguGGfiGGUugccuaggRUGuccgccgQQgQQcQa... 2951 L l 2 e ...cucggGGflGoUGuUCggauQauaacaRUGgQauocgucuocgcQ... 1016 -20 -10 +1 10 56 3.6.2 Transcription Termination Regions The positions of 3' transcript end sites are located uniformly within (or in the case of the NAB monocistronic transcript immediately after) tracts of T residues and are often preceded by GC rich tracts but not by inverted repeats capable of forming stem - loop structures (Figure 11 Transcription Termination). Longer T tracts appear to result in more efficient termination. Tracts of Ts within coding regions are statistically much less frequent than expected. For active genes where protein products must be stoichiometrically balanced (i.e. ribosomal proteins), it might be important to minimize the potential for premature transcription termination. 3.6.3 Translation Initiation Regions The regions surrounding the translation inititation sites on mRNAs derived from the 5.1 Kilobasepair fragment of genomic DNA are depicted (Figure 11 Translation Initiation Regions). Athough all of these regions exhibit sequences that are complementary to the 3' end of the H. cutirubrum 16S rRNA, the location of many of these matches precludes their identification as potential eubacterial Shine - Dalgamo sequences (Shine and Dalgamo, 1972; Hui and Dennis, 1985). The position of the complementary sequence is 3' to the AUG initiation codon on the ORF P2, NAB and L11e monocistronic transcripts that lack a 5' untranslated leader and is 5' to the AUG initiation codons on the ORF P1, NAB - L1 le and Lie - L10e - L12e transcripts. The spacing between the last base of the complementary sequence and the first base of the initiation codons varies from -15 for ORF P2 to +11 for L12e (a negative value denotes a complementary sequence located 3' to the AUG initiation codon). It has not yet been demonstrated in halobacteria that these complementary sequences function to position ribosomes at authentic AUG initiation codons and other mechanisms (e.g. eucaryotic type thread on') may be involved. In addition to the potential for transcriptional regulation by the ORF P1 promotor as described previously the presence of the 5' Shine - Dalgarno site on the transcript initiated at ORF P1 may serve to increase the efficiency of translation of this transcript. Finally, it should be noted that the L12e cistron is translated about four fold more frequently than the preceding Lie or L10e cistrons. It is not yet clear how this translational enhancement is achieved. 57 3.7 Comparative Gene Organization and Expression In the archaebacterium H. cutirubrum the genes encoding the four GTPase domain ribosomal proteins are linked in a single copy gene cluster in the order L11e, Lie, L10e and L12e, identical to the order of the homologous genes in the eubacterium E. coli (Figure 12; Post et al., 1979; Shimmin and Dennis, 1989). Intergenic spacing between the L11e - Lie, Lie - L10e and L10e - L12e genes of H. cutirubrum are 203, 4 and 8 nucleotides respectively and compare to spacing of 6, 415 and 69 nucleotides respectively for the corresponding intergenic regions of E. coli. The Hcu ORF and Hcu NAB genes located upstream of the ribosomal protein gene cluster are not homologues of the secE and nusG genes occupying the comparable positions in E. coli and the [J and pV RNA polymerase subunit genes, although preserved in Halobacterium, are not located distal to the L12 gene as in E. coli but rather located upstream of the S12e - S7e - EFGe - EFTue gene cluster (Zillig et al., 1989). In the archaebacterium S. solfataricus the GTPase domain genes are also conserved in a single copy gene cluster with intergenic spacing of -1, -1 and 44 nucleotides between the L11e - Lie, L ie - L10e and L10e - L12e genes respectively (negative values denote overlapping genes; Shimmin et al., 1989a; Ramirez et al., 1990a). The S. solfataricus gene cluster is also flanked by unique genes: a tRNA synthetase located downstream and several open reading frames located upstream. Two Kilobasepairs upstream is a gene encoding a ribosomal protein with no homologue in eubacteria but homologous to L46 of the eucaryote S. cerevisiae. Less information is known of the homologous genes in eucaryota; the best studied organism is S. cerevisiae where the L10e and L12e genes have been characterized but the entire sequences of the L11e and Lie proteins have yet to be published (Otaka et al., 1984; Remacha et al., 1988; Mitsui and Tsurugi, 1988a; Mitsui and Tsurugi, 1988b; Mitsui and Tsurugi, 1988c; Newton et al., 1990). The single L10e gene of S. cerevisiae has no introns and has been localized to chromosome XII (Newton et al., 1990; C. Newton, personal communication). Some eucaryota (Artemia salina, Drosophila melanogaster, Homo sapiens and S. cerevisiae) are known to have two different types of Ll2e genes: L12e type I and L12e type II (Amons et al., 1982; Wigboldus, 1987; Rich and Steitz, 1987; Newton et al., 1990). S. cerevisiae is unique in having four distinct L12e genes, a pair of each type, named L12elA, L12elB, Ll2ellA and L12ellB (Figure 12; Newton etal., 1990). The average identity between the type I and type II proteins is 20%, that between the A and B copies of each type is 54%; thus the duplication of the type I 58 Figure 12 Summary of the Structure and Expression of the L l l e , L i e , LlOe and Ll2e Genes within the Urkingdoms The organization and transcription of the L1 le, Lie, L10e, and L12e ribosomal protein gene clusters of Escherichia coli, Halobacterium cutirubrum, Sulfolobus solfataricus and Saccharomyces cerevisiae are depicted. Ribosomal protein encoding genes are solid boxes and other protein encoding genes or open reading frames are striped boxes. Genes above the line are oriented and transcribed rightwards and those below the line are oriented and transcribed leftwards. The open circles ( O ) represent 5' transcript ends and the vertical lines (I) represent 3' transcript ends. The open boxes ( • ) at the ends of trancripts indicate regions of multiple 3' trancript ends. The dashed lines ( - - ) indicate a small amount of readthrough transcription. In the Escherichia coli diagram the tufB, secE and nusG genes encode proteins functioning in translation elongation, protein secretion and transcription termination respectively. The |3 and P' genes encode the P and P' subunits of RNA polymerase respectively. Triangles ( A ) represent ribonuclease processing sites and the vertical line on the transcripts running through the L12 - P intergenic space represents a transcription attenuator. The checkered boxes ( Q ) represent sites of autogenous regulation in Escherichia coli and putative autogenous regulation in Halobacterium cutirubrum. In Saccharomyces cerevisiae the See L12ellB gene contains an intron and the See L1le and See Lie genes have yet to be characterized. 59 Escherichia coli tufB secE nusG L i l LI ^77771 VSSAS/SA LIO L12 B B" T77 771 777/77\ -i— •s- K / / 1 r6 +2 & - / / - 1 Halobacterium cutirubrum ORF nflB L l l a L i s LlOa L12a T72 YZZZZZZZZZT •—\m • -• Sulfolobus solfataricus L46e 0RF3 0RF2Llle Lie LlOe L12e tHnfl sgn _ 2 3 I II M M — — W l c * 1 LIBe L12elfl L12eIB Saccharomgcas cerevisiae L12eIIfl L12eIIB 1 Kbp 60 and II genes into A and B copies is apparently a relatively recent event of approximately 1000 million years ago whereas the type I: type II divergence is very ancient (Newton ef al., 1990). The three See L12elA, L12elB and L12ellA genes are intronless whereas the See L12ellB gene contains a 301 nucleotide long intron between codons 38 and 39 (Remacha etal., 1988; Newton etal., 1990). The genes are not closely linked; although the L12elA, L12elB and L12ellB genes appear to be located on chromosome IV, the L12ellA gene is located on either chromosome VII or XV (C. Newton, personal communication). The functional significance of two different L12e - like proteins in eucaryotes and apparently only one in archaebacteria and eubacteria remains to be elucidated. Transcription patterns of the GTPase domain ribosomal protein genes of eubacteria, archaebacteria and eucaryota are each unique (Figure 12). In E. coli the genes are divided 2 and 2 ; both bicistronic L11 - L1 and L10 - L12 transcripts and tetracistronic L11 - L1 - L10 - L12 transcripts are produced and transcripts encoding the downstream P and (3* genes are produced by elongation of a fraction of the transcripts exiting the L12 gene. The L1 protein and L10 - L12 complex autogenously regulate the expression of the GTPase domain proteins. In H. cutirubrum the ribosomal protein genes are transcribed primarily into monocistronic (L11e) and tricistronic (Lie - L10e - L12e) transcripts; the bicistronic NAB - L11e transcript represents about 10% of the total L11e mRNA. Regions of the 23S rRNA gene of E. coli involved in binding of the Eco L11 and Eco L1 proteins (i.e. nucleotides 1052 - 1112 and 2100 - 2200 respectively) are homologous to nucleotides 1142 - 1201 and 2123 - 2222 of the 23S rRNA gene of H. halobium indicating the conservation of the L11e and Lie binding domains in the rRNA (Mankin and Kagramanova, 1986). The Lie gene is transcribed as the proximal cistron in the tricistronic Lie - L10e - L12e mRNA and is preceded by a 75 nucleotide long untranslated leader. The leader contains a region that has a sequence and structure almost identical to a region within the L ie binding domain in 23S rRNA (Figure 13). Furthermore, both the primary nucleotide sequence and secondary structure of these sites are highly similar to the E. coli L11 - L1 mRNA leader sequence that has been implicated in autogenous translationai regulation. In H. cutirubrum the L11e gene is transcribed usually as a monocistronic mRNA lacking a 5' untranslated leader; a search in and around the gene for sequences resembling the L11e and Lie binding domains in 23S rRNA has been negative. It is possible that the NAB protein and/or the small 61 Figure 13 Autogenous Translational Regulation of the L i e - L10e - L12e Transcript The binding domain of ribosomal proteins L1 and Lie on Halobacterium halobium and Escherichia coli 23S rRNA (right) and regions in the leader of the Halobacterium cutirubrum Lie - L10e - L12e and the Escherichia coli L11 - L1 mRNA are illustrated. Regions that exhibit sequence and structural similarity to each other and to the binding domain on 23S rRNA are depicted (boxed). The 5' ends of the mRNAs are nucleotide +1. The Lie AUG initiation codon on the Halobacterium cutirubrum L ie - L10e - Ll2e mRNA (position 75) corresponds to nucleotide 2314 in Figure 5. The open circles (o) next to positions 17, 27, 54 and 84 in the Halobacterium cutirubrum Lie - L10e - L12e mRNA show the positions of the minor ends present in the S1 nuclease and primer extension analysis of Figure 10. c 6 0 - U R c o f ; U — R C — G C — G 2 I 3 0 U C fl C G I C R fl 8 0 - C G - C fl G G G G I I C C fl U - R C - G G - C - 2 1 6 0 U U 91 U R G G U I I I C C R C U G - C R G G G G C C fl c c u u U fl R fl G U U G R G G B f i U U U f l U f i U G . E. coli L U - L l mRIlfl E. coli 23S rfinfl c u u c 2 0 C I R G G fl U • G C - G fl - U C - G U — R U - fl U - fl G G U C - C - U 10 7 5 C - C - U • R - G - fl G G I ( C R 6 0 G fl G U U G G C U U C G - C R G H C . . G - C U • G fl.- U G - C U - fl C - G G • U C - G U - fl C - G G • U C - G fl - U C — G 2 I 5 0 U • G G - fl C - G fl - U G — C fl G G I C fl C R C fl U fl fl fl G I 2 2 0 0 H. cutinibnim Lle-Ll0e-Ll2e mRIlfl H. halobium 23SrRRfl 62 amount of bicistronic NAB - L11e mRNA may have some regulatory significance. A further search within the Lie - L10e - L12e transcript for the homologue of the E. coli L10 - L12 autogenous regulation region was also negative. In the distantly related archaebacterium S. solfataricus the four GTPase domain ribosomal proteins are apparently transcribed from twin promoters on a single tetracistronic transcript (Ramirez et al., 1990a). No feature homologous to the autogenous regulatory sites has been identified within or flanking the transcript. The mechanism of enhancement of expression of the L12e proteins within the archaebacteria and eubacteria to maintain a stoichiometry of four protein copies per gene is unknown; it remains to be seen whether this regulatory feature has an origin coincident with the development of the gene cluster. In eucaryota the L11e and Lie genes have yet to be characterized and the L10e and L12e genes are transcribed in unlinked monocistronic transcripts (Mitsui and Tsurugi, 1988a; Mitsui and Tsurugi, 1988b; Mitsui and Tsurugi, 1988c; Remacha etal., 1989; Newton era/., 1990). In S. cerevisiae the four distinct L12e genes are transcribed at greatly differing levels (Newton et al., 1990). Archaebacterial transcription signals have been identified by alignment of sequences at known transcription initiation and termination sites and identification of conserved consensus sequences. Actual binding of RNA polymerase in vitro to regions upstream of transcription initiation sites has been observed for only four methanogen genes; actual initiation in vitro at the in vivo transcription initiation sites has yet to be demonstrated (Thomm et al., 1987; Brown etal., 1988; Thomm and Wich, 1988; Thomm era/., 1989). A universal archaebacterial hexanucleotide promotor motif (TTTAAA) located approximately 25 nucleotides upstream of the transcription initiation site and bearing similarity to the eucaryotic RNA polymerase II promotor motif but not to eubacterial promotors has been proposed although with the subsequent increase in available sequences there appear to be substantial variations within the thermoacidophile, methanogen and halophile groups (Reiter etal., 1988). Thermoacidophiles exhibit the greatest fidelity to the universal archaebacterial promotor whereas the methanogens have an extended AT rich sequence (III AA/TATA) that is generally well conserved (Figure 14). Within the halophiles the core promotor element appears to be shortened to the tetranucleotide TTAA motif. More extensive consensus sequences that have been proposed based primarily on stable RNA transcripts tend to be 63 Figure 14 Archaebacterial Transcription initiation Sequences Archaebacterial transcription initiation sites are aligned at the initiation nucleotide at position +1 (scale at bottom). Consensus sequences are illustrated on the first line of each group; the A or G transcription initiation sites are in all cases 20 to 25 nucleotides 3' to the consensus sequence motifs. Matches to the consensus sequences are indicated in upper case characters. The species abbreviations are: Mva, Methanococcus vanielii ; Tte, Thermoproteus tenax ; S B12, Sulfolobus strain B12. References appearing at the end of each entry are: 1, Shimmin and Dennis, 1989 and this work; 2, Chant et al., 1986; 3, Dunn etal., 1981; 4, Betlach etal., 1986; 5, Blanckand Oesterhelt, 1987; 6, Cue etal., 1985; 7, Cram etal., 1987;8, Wich etal., 1986;9, Wich etal., 1987; 10, Reiter etal., 1988. HALOPHILES (TTCGA) ... TTAA ... A or G i n i t i a t i o n Hcu ORF PI TgCGAtggcttcactcggcgtaTTAAcgtgtcgaaacgatcccaccG 1 Hcu ORF P2 TgCGgaggaaagcgcTTttcggcgcttgctgtctacgggcacgtG 1 Hcu NAB TTCGAcacgTTAAtacgccgagtgaagccatcgcatagtG 1 Hcu L l l e cTCGAaagacaagggTTAAacccgcggcggcggtttctcggagtA 1 Hcu Lie tgcTTCGcTTCGAcgcttTTAAgcccgggatcaccgtctgtagaaccG 1 Hcu rRNA PI tggTTCGAcggtgttTTAtgtaccccaccactcggatgagatgcgaA 2 Hha bop atactgattgggtcgTatAgttacacacatatcctcgttaggtactgttG 3 Hha brp tagcttgggtcttttTTgAtgctcggtagtgacgtgtgtattcatA 4 Hha hop gttgggggaggttatTTAAtggcgtgccgtgtccttccgaacaccA 5 METHANOGENS TTTAA/TATA A or G i n i t i a t i o n Mva hisA Mva mcr Mva tRNA (pMT21) Mva rRNA (pMVl) atttcttaggtaccaaTATATAtgttaaaacctaatttaacataG ttaatgaaaacttgaaTATATcttcctttaataatgttatGA taataaccgaaataTTTATATActagaatacccttcctatactatG tacatacctaaaacaaTAcATAttacaacacgttttcatattatG THERMOACIDOPHILES TTTAAA Tte rRNA Tte tRNA (ala) S B12 SSV1 Tl+2 S B12 SSV1 T3 S B12 SSV1 T4 . A or G i n i t i a t i o n agggagcgaaaaatTTTAAtttagggtgttttaggatggtcG 9 ctctagcgaaaaaaTTTAAAtcggtgagtaagtacgctgG 9 cagaactggaggggTTTAAAaacgtaagcgggaagccgatattG 10 ttagttaggctcttTTTAAAgtctaccttctttttcgcrtacA 10 agaagatagcccttTTTAAAgccataaattttttatcgcttA 10 -40 -30 -20 -10 + 1 64 poorly conserved in polypeptide encoding transcripts (Betlach et al., 1984; Mankin etal., 1984; Dennis, 1985; Hui and Dennis, 1985; Chant etal., 1986; Chant and Dennis, 1986; Daniels etal., 1986; Blanck and Oesterhelt, 1987; Das Sarma etal., 1987). Some of the extended features proposed may affect specific transcripts; the TTCGA element 5 to 15 nucleotides upstream of the TTAA motif proposed in this work is not common to all halophile transcripts but appears in a sufficient number of transcripts encoding both stable RNAs and polypeptides to suggest its participation in some aspect of transcription initiation. Archaebacterial transcription termination appears to occur within poly T tracts that are sometimes preceded by G C rich sequences and/or short inverted repeats, reminiscent of rho independent termination in eubacteria. The paucity of poly T tracts displayed within the coding strands of genes within the extreme halophiles is probably due to the apparent efficacy of T residues to facilitate transcription termination within the GC rich DNA of these organisms. This is best illustrated by the Hcu L11 e transcript where all seven tracts of two to four Ts in the L n e - Lie intergenic space result in termination (Figure 9 and Figure 11). Classic Shine - Dalgarno sequences facilitating translation initiation are usually evident immediately upstream of the initiator methionine codon in the thermoacidophile and methanogen transcripts. Translation initiation in halophiles is enigmatic; some transcripts such as Hcu L11e, Hha S12e and Hha brp have no leader nucleotides at all, others have very short leaders. Various mechanisms for positioning of the ribosome at the authentic methionine initiator codon have been suggested, including a eucaryotic type 'thread on' mechanism, ribosomal recognition of short hairpin structures formed at the 5' end of leaderless transcripts and classic Shine - Dalgarno type positioning when sequences complementary to the 3' end of the 16S rRNA are present either in an appropriate position 5 to 10 nucleotides preceding the initiator methionine codon or even within the coding region in transcripts with negligible leaders (Dunn et al., 1981; Betlach etal., 1984; Betlach etal., 1986; Blanck and.Osterhelt, 1987; Shimmin and Dennis, 1989). Elucidation of ribosome binding to mRNA awaits further study. 3.8 Summary The organization of the GTPase domain genes is conserved in the eubacterium E. coli, the archaebacteria H. cutirubrum and S. solfataricus but not in the eucaryote S. cerevisiae. Most features of 65 the transcription and regulation patterns difter between these diverse organisms. The autogenous regulation of translation by the L1 protein in E. coli is conserved in H. cutirubrum, whether it is conserved in S. cerevisiae is unknown. The mechanisms by which the Hcu L11e protein is regulated and the L12e protein is amplified remain to be elucidated. The cloned 5146 basepair fragment of H. cutirubrum genomic DNA encodes two potential proteins of unknown function (ORF and NAB) and the four GTPase domain ribosomal proteins; the ORF gene is oriented opposite to the remaining genes. Transcription analysis demonstrates that the ORF is encoded on a very rare monocistronic transcript initiated at two distinct promotors, rare initiation occurs on a G residue yielding a 49 nucleotide leader and the majority transcript initiates on a G residue 1 nucleotide before the putative translation initiation codon. Termination occurs in a poly T tract. The NAB and L11e proteins are encoded on both individual monocistronic and a bicistronic transcript. The NAB monocistronic and NAB - L11e bicistronic transcripts share an initiation site at a G residue 1 nucleotide before the translation initiation codon. The monocistronic L1le transcript has no 5' leader sequence, initiating precisely on the A residue of the ATG translation initation codon. All three transcripts terminate in T tracts. A tricistronic transcript with a 75 nucleotide 5' leader sequence containing the site for autogenous regulation of translation by the Lie protein and terminating in a tract of 6 T residues encodes the three ribosomal proteins Lie, L10e and L12e. The level of transcription of the ribosomal proteins appears similar from Northern and S1 nuclease protection experiments. The NAB monocistronic transcript appears at a level approximately 1% of the monocistronic L11e transcript and the bicistronic NAB - L11e transcript is approximately 10% of the L11e monocistronic transcript level. The ORF transcript is expressed at a level approximately 500 fold lower than the ribosomal protein transcripts. Common elements upstream of the transcription initiation sites include the motif TTCGA ... 4 -15 bp ... TTAA ... 20 - 26 bp ... A or G transcription start. The TTAA motif is conserved within the archaebacteria whereas the TTCGA motif is apparently unique to the extreme halophiles. Transcription termination occurs within poly T tracts that may be preceded by a GC rich region, a motif characteristic of most archaebacterial transcripts. The sequences or structures facilitating ribosome binding are not obvious; although the Lie and L10e cistrons are preceded by classic Shine - Dalgamo sequences, transcripts having negligible or nil 5' leaders (e.g. the L11e monocistronic transcript) must utilize some other mechanism to initiate translation. 66 Purt 4 : Structure uraC function oJ trie G/TPase Domain Proteins 4.1 Amino Acid Composition The amino acid compositions of the E. coli L11, L1, L10, and L12 ribosomal proteins and the equivalent proteins from two archaebacteria (H. cutirubrum and S. solfataricus) and a eucaryote (S. cerevisiae) are presented in Table 6. The composition of the proteins in the three urkingdoms are similar. The proteins have primordial amino acid compositions, with few or no cysteine or tryptophan residues, as is the case with ribosomal proteins in general (Wittmann-Liebold, 1986; Taylor, 1989). The H. cutirubrum , proteins are, however, more acidic than those from other organisms; the aspartate and glutamate content is increased about two - fold while the lysine and arginine content is greatly reduced. The L12e proteins are alanine rich (average 21.3%) and acidic (average 22.6% acidic versus 7.0% basic residues). The Hcu L12e protein is the most extreme, with 36.8% acidic to 1.8% basic residues, partially due to the adaptation to their high salt enviroments. The eubacterial, archaebacterial and most eucaryotic type I L12e proteins contain a unique arginine residue whereas the eucaryotic type II contain a unique tryptophan residue. 4.2 The L11e proteins The alignment of the Hcu L11e and Sso L11e proteins is shown in Figure 15. Both proteins can be aligned end to end with 40% amino acid sequence identity and only a single gap at position 65 in the Hcu L11e sequence (Table 7). The Sso L11e protein has an extra amino acid at its amino terminus, an unusual carboxy terminus containing (i) a tryptophan residue at alignment position 169 and (ii) a five residue extension. Alignment of the two archaebacterial L11e proteins with the eubacterial EcoL11 and the available amino terminal portion of the eucaryotic See L11e protein is also shown in Figure 15 (Post etal., 1979; Otaka etal., 1984). Identification of the products of the acchaebacterial genes as the homologues of the Eco L11 ribosomal proteins is based on amino acid sequence similarity and also on physicochemical and genetic characterization (Matheson etal., 1984; Matheson, 1985; Shimmin et al., 1989; Shimmin and Dennis, 1989; Ramirez et al., 1990a; Ramirez et al., 1990b). The Eco L11 sequence aligns end to end with the two archaebacterial sequences requiring only one gap in the archaebacterial proteins at alignment position 50 and exhibit 33% and 32% amino acid identity over the common aligned region (Table 7). The Table 6 Interkingdom Comparison of the Amino Acid Compositions of the L11e, L i e , L10e and L12e Ribosomal Proteins Polypeptide length is in amino acid residues. Composition values are in mole percent. LI 1o Lie LlOe L12e E c o H c u S90 E c o H c u S s o E c o H c u S s o S e e E c o H c u S s o S e e S e e S e e S e e 1 fl 1 B 1 1 fl 1 I B P O L Y P E P T I D E L E N G T H I « 2 1 6 3 1 7 0 2 3 4 2 1 2 2 2 1 1 6 5 3 5 2 3 3 5 3 1 2 1 2 1 1 1 4 1 0 5 1 1 0 1 0 6 1 0 6 1 0 6 flLRMI HE A M . I 1 2 . 3 7 .1 1 4 . 1 1 0 , 8 8 .1 2 0 . 0 1 1 . 6 1 0 . 7 1 1 . 5 2 3 . 1 2 4 , 6 1 7 . 1 2 0 . 9 2 0 . 8 1 8 . 9 2 3 . 6 A R G I N I N E A 2 . S 1 . 6 0 . 6 4 . 7 7 .1 5 . 0 7 . 3 4 . 0 1 . 5 4 , 2 0 , 8 0 . 9 1 . 0 0 . 9 - - - R S P R R R G I N E H 2 . 8 2 . 5 4 . 7 5 .1 4 , 2 5 . 4 1 . 8 3 . 4 3 . 9 4 . 2 0 . 6 1 . 8 2 . 9 1 . 8 2 , 8 4 . 7 3 . 8 A S P A R T A T E D 4 . 2 1 1 . 0 " 5 . 9 6 . 0 1 5 . 6 3 . 2 3 . 6 1 1 . 9 5.1 5 . 4 5 . 0 1 7 . 5 1 . 9 6 . 4 7 . 5 7 . 5 1 0 . 4 C Y S T E I N E C 0 . 7 0 . 6 - - - - - - - - - - - - - - 0 . 9 G L U T A f l l HE 0 4 . 9 4 . 3 4 . 7 3 . 8 3 . 8 5 . 0 1 . 8 4 , 8 3 . 3 1 . 9 0 . 8 - 3 . 8 1 . 8 - 0 . 9 0 . 9 G L U T A H A T E E 4 . 2 1 1 . 6 5 . 9 1.7 6 . 6 7 . 7 9 . 1 1 1 . 6 7 . 8 8 . 7 1 3 . 2 1 9 . 3 1 5 . 2 1 4 . 6 1 5 , 1 1 4 . 2 10 .1 G L Y C I N E G 8 . 5 . 9 . 8 8 . 2 8 , 5 5 . 2 4 .1 5 . 5 8 , 8 7 . 2 7 .1 6 . 6 7 . 9 6 . 7 1 2 . 8 9 . 4 9 . 4 I 3 . 2 HI ST I 01 HE H - - 0 . 6 0 , 9 0 . 9 - 0 , 6 0 . 3 1 .2 1 . 3 1 . 0 - - - - - 0 . 9 I S O L E U C I N E I 6 . 3 4 . 3 9 . 4 4 , 7 3 . 3 7 . 2 3 . 0 3 . 4 9 , 3 5 . 8 5 . 0 2 . 6 6 . 7 3 . 6 4 , 7 4 , 7 5 , 7 L E U C I N E L 4 . 9 6 . 7 8 . 8 7 . 3 7 . 5 1 0 . 0 9 . 1 8 . 8 8 . 4 8 . 0 6 . 6 7 . 0 8 . 6 8 . 2 9 , 4 1 0 . 4 7 . 5 L Y S I N E X. 1 0 . 6 3 .1 1 2 , 9 9 . 8 2 . 4 1 3 . 1 7 , 3 2 . 0 1 2 , 2 4 . 8 1 0 . 7 0 , 9 1 1 . 4 6 . 4 6 , 6 4 . 7 1.7 f l ETH I OH I HE n 4 . 2 0 . 6 1 . 8 3 . 0 3 . 8 2 . 3 3 , 6 1 .1 1 , 5 1 . 9 3 . 3 0 , 9 1 , 9 1 . 8 1 , 9 1 . 9 1 . 9 P H E N Y L A L A H I HE F 2 . 8 3 .1 0 . 6 I , 7 2 . 4 3 , 2 3 . 6 1 . 4 3 . 9 1.8 1 . 7 0 . 9 1 , 0 2 . 7 1 . 9 3 . 8 1.7 P R O L I N E P 6 . 3 6 . 7 6 . 5 3 , 0 4 . 7 5 , 9 3 . 0 4 , 8 4 , 5 4 . 8 1 . 7 2 . 6 2 . 9 1 . 8 2 . 8 1 . 9 0 . 9 S ER I HE S 5 . 6 3 .1 5 . 9 3 , 4 3 . 3 4 . 1 3 . 6 6 , 0 3 . 6 7 .1 5 . 0 3 . 5 5 . 7 7 . 3 7 , 5 7 , 5 6 . 6 THREOHI HE T 6 . 3 6 . 7 8 . 2 5 . 6 6 . 1 5 . 0 5 . 5 5 , 4 6 . 6 4 . 5 2 . 5 1 . 6 3 . 8 1 . 8 2 . 8 2 . 8 2 , 8 T R Y P T O P H A N U - - 0 , 6 - - 0 . 5 - 0 , 3 0 , 3 0 . 3 - - - - - 0 , 9 0 . 9 T Y R O S I N E Y 1 . 4 1 . 8 1 . 8 1 -.3 0 , 5 1 . 8 1 , 8 1 , 4 2 . 7 3 . 2 - 1 . 8 1 . 9 1 . 8 1 . 9 0 . 9 0 . 9 URL I HE U 9 . 2 9 . 8 6 . 5 1 2 . 4 1 1 . 8 8 . 6 9 , 1 8 . 8 6 . 6 I 0 . 6 1 3 . 2 6 , 1 6 . 7 5 . 5 4 , 7 4 . 7 3 . 8 CD 68 Figure 15 Alignment of the L11e Proteins Upper Panel The amino acid sequences of the L11 e ribosomal proteins from the archaebacteria Halobacterium cutirubrum (Hcu L11e) and Sulfolobus solfataricus (Sso L11e), predicted from the nucleotide sequences of the respective genes and partially confirmed by amino acid sequencing, are aligned with the L11e ribosomal proteins from the eubacterium Escherichia coli (Eco L11) and the eucaryote Saccharomyces cerevisiae (See L11e). Only the amino terminal 21 amino acid residues of the See L11e protein have been determined. Gaps required for alignment are indicated as dashes (-). The amino acid position scale is below the See L11e sequence and the proteins are aligned over 170 amino acid positions. Similarities are indicated between the eubacteria and eucaryota (above the Eco L11 sequence), between the eubacteria and archaebacteria (between the eubacterial and archaebacterial sequences), within the archaebacteria (between the Hcu L11e and Sso L11e sequences) and between the archaebacteria and eucaryota (between the archaebacterial and eucaryotic sequences) by the following symbols: | Intrakingdom identities within the archaebacteria | Interkingdom identities where all positions within 2 urkingdoms are identical 0 Interkingdom identities where 2 out of 3 positions within 2 urkingdoms are identical Lower Panel Line diagrams illustrate the end to end interkingdom alignment of the archaebacterial Hcu L11 e and Sso L11e proteins to the complete eubacterial Eco L11 and the partial eucaryotic See L11e sequences. Gaps required to maintain maximum identity in the alignment are indicated by white bars. The common scale is in amino acid residue positions along the linear interkingdom alignment. 69 I I II I Eco CI 1 n A e c u Q A V U K L 0 U A A G It A H P S P P o t P I i ( H t « » i H E F C i i F K A C T O S I E C G L P I P U U I T U V A 0 - R S F T F U T C T P 0 1 0 1 1 1 II II 100 0 00 0 0 1 1 0 1 1 1 1 0 00 1 Hcu Llle It A E T 1 E U L U A G G 0 A 0 P 6 P P L 6 P E L G P T P U 0 U Q A U U Q E I H O O T E A F - D G T E U P U T I E V E D 0 - G S F S 1 E I I G U P 1 1 1 1 1 1 1 1 M i n i I I II 1 1 1 1 1 1 1 1 1 1 1 1 1 I I I ! Sso Llle n p T K T 1 K 1 It U E 6 G S A K P G P P L 6 P T L S Q L 6 L H U Q E U U K K I H D U T A Q F - K G rt S U P U T I E I O S S T i c V D 1 IC U G U P 0 0 1 1 1 See Llle It A U C 0 0 V - G A ? A A L A P K 1 G - P L P . . . 10 20 30 10 SO 60 70 Ece Lll P A A U L L U R H K S i S G l i l t I I S l l t l l ! I I M I I I O n T G A O l E A n T A S 1 E G T A R S n G L U V E O 0 0 1 000 000 0 1 1 1 000 0 10 II 1 0 0 0 0 11001 1 0 1 Hcu Llle P T A A L U C 0 E A G F 0 T G S G E P 0 E N F U A O L S I E O L t T I A E Q K C P D L L A V O A A H A A I E U A G T C A S L G U T 1 E G E D A P T F H 1 1 1 1 1 1 II II I I I 1 1 1 1 II I I 1 1 1 1 See Llle T T T S L I L K A 1 H A 0 E P S G 0 P A H I [ 1 t U D L U 1 I D 1 a K U P U s m u i I A 1 t S L L G T A A S IG 1 T U E GEO P I D U 1 90 90 100 110 120 130 HO 150 Hcu Llle E B U D D 0 0 V 0 D U L 6 0 E L A A A ( 1 < 1 1 See Llle t E 1 0 Q G K V N D L L T H V E 0 C U K E A E G 160 170 1 10 20 30 10 50 60 70 90 90 IOO HO 120 130 HO ISO I60 170 Eco L11 Hcu Llle S)o Llle See Llle 70 Table 7 Intra and Interkingdom Sequence Similarity of the L1le , L i e and L10e Ribosomal Proteins Proteins % Amino Acid Deletion / Insertion1 Significance' Compared Identity Index (Z) L11 e Hcu/Sso 40 1 45 Eco/Hcu 33 1 35 Eco/Sso 33 2 32 L i e Bst/Eco 50 0 62 Hcu/Sso 31 4 40 Bst/Hcu 29 11 30 Bst/Sso 28 9 21 Eco/Hcu 32 11 36 Eco/Sso 26 9 19 L 1 0 e Hcu/Sso 27 1 45 Hsa/Sce 53 4 78 Eco/Hcu 24 6 10 Eco/Sso 21 6 10 Eco/Hsa 15 6 2 Eco/Sce 17 6 3 Hcu/Hsa 25 8 42 Hcu/Sce 24 9 35 Sso/Hsa 24 8 25 Sso/Sce 24 8 27 (1) The number of insertions and deletions introduced into the aligned pair of proteins (2) Significance value is from the RDF program of Lipman and Pearson (1985). o 71 Hcu L11e and the Sso L11e proteins have carboxy terminal extensions of 26 and 31 residues respectively compared to the Eco L11 protein. The Sso L11e protein has an extra threonine residue at position 65 which is not present in the Hcu L11 e or Eco L11 protein. The Eco L11 protein has a short amino terminal extension of 3 or 4 residues that is not present in the archaebacterial proteins. The Eco L11, Hcu L11e and Sso L11e proteins contain 9, 11 and 10 proline residues respectively within the aligned region. Conservation of the proline residues in all three sequences occurs at seven positions (positions 20, 22, 23, 26, 56, 75 and 94 of Figure 15). The unique cysteine residue of the Eco L11 e protein (position 39) is not present in the Sso L11 e protein and present but not positionally conserved in the Hcu L11e protein (position 134). Between the eubacterial and archaebacterial L U e proteins there exist two short regions of high sequence conservation. The amino terminal region contains the highest concentration of conserved residues (positions 13 - 28) and is characterized by four conserved proline residues at positions 20, 22, 23 and 26. The second region is located in the carboxy terminus of Eco L11 (positions 132 - 142) and contains conserved threonine and serine residues at positions 133 and 136 respectively. Regions of high amino acid sequence similarity in homologous proteins that are separated by large distances in evolutionary time are usually indicative of a conserved structural or functional domain in the protein. A number of structural and functional features of the Eco L11e protein have been reported. The axial ratio of the Eco L11e protein is 5.5:1; the conserved proline residues probably contributing to the highly elongated shape of the molecule (Giri et al., 1978). The amino terminal domain of the Eco L11 protein (residues 1 - 64, positions 2 - 66) has been implicated in the interaction of the ribosome with translation release factor 1 (Tate etal., 1984). Thus the highly conserved amino terminal region of the L11e proteins between positions 13 - 28 may be responsible for this interaction. The Eco L11 protein binds to a conserved region of the E. coli 23S rRNA located between nucleotides 1052 and 1112 (Schmidt et al., 1981). Heterologous binding studies have demonstrated that the Eco L11 protein can bind to a conserved domain in the large subunit rRNA from both archaebacteria and eucaryotes (Beauclerk et al., 1985; El-Baradi et al., 1987). Both the nucleotide sequence and secondary structure of the homologous region within the H. halobium 23S rRNA (i.e. nucleotides 1142 - 1201) are remarkably similar to the L11 binding domain in E. coli 23S rRNA (Mankin 72 et al., 1986; Shimmin and Dennis, 1989). The domain within the L11e proteins that binds to the conserved target within the large subunit rRNA has yet to be elucidated. In E. coli the L11 protein is the most highly methylated ribosomal protein, containing nine methyl groups that are added to the protein after translation. The modifications are a trimethyl-alanine at the amino terminal residue (the initiator methionine residue is removed) and two trimethyl-lysines at residues 3 and 39 (alignment positions 2, 4 and 40 respectively in Figure 17; Dognin and Wittman-Liebold, 1977). The first two positions (2 and 4) are within the amino terminal region unique to the Eco L11 protein and not. part of the archaebacterial or eucaryotic proteins. The E. coS lysine (39) residue is conserved in the Sso L11 e protein but not in the lysine depleted Hcu L11 e protein. Like their eubacterial homologue, the initiator methionine residue is post-translationally removed from the amino terminus of the L11e proteins of H. cutirubrum, S. solfataricus and S. cerevisiae ; however, none of these proteins contains the amino terminal methylation modification (Matheson etal., 1984; Otaka etal., 1984; Matheson, 1985). Thus sites of methylation appear not to be conserved between eubacteria and archaebacteria. The Eco L11e protein' is an important component of the GTPase domain of the 50S subunit and is involved in the synthesis of guanosine 5' diphosphate, 3' diphosphate (ppGpp) during the stringent response (Friesen etal., 1974; Parker etal., 1976; review: Cundliffe, 1986). Methanogens and halophiles apparently lack a stringent response (Beauclerck et al., 1985; Chant, J and Dennis P.P. unpublished results). 4 .3 The L i e proteins The Hcu and Sso Lie amino acid sequences can be aligned end to end with the introduction of four small gaps at alignment positions 19, 30 - 31,93 and 207 and exhibit 31% amino acid identity (Figure 16, Table 7). The Sso Lie sequence has extensions of four and two residues at its amino and carboxy terminal ends respectively. There are two highly conserved regions between the archaebacterial proteins, the first from positions 137 - 151 exhibiting 12 out of 15 identical residues and the second between positions 224 - 235 exhibiting 10 out of 12 identical residues. The alignment of the two archaebacterial proteins with their somewhat longer eubacterial counterparts is also shown in Figure 16. Optimal eubacterial to archaebacterial alignment required introduction of eight 73 Figure 16 Alignment of the L i e Proteins Upper Panel The amino acid sequences of the L ie ribosomal proteins from the archaebacteria Halobacterium cutirubrum (Hcu Lie) and Sulfolobus solfataricus (Sso Lie), predicted from the nucleotide sequences of the respective genes and for the Hcu. Lie protein partially confirmed by amino acid sequencing, are aligned with the Lie ribosomal proteins from the eubacteria Bacillus stearothermophilus (Bst Lie) and Escherichia coli (Eco L1). There is no available sequence representing the eucaryota. Gaps required for alignment are indicated as dashes (-). The amino acid position scale is below the Sso Lie sequence and the proteins are aligned over 230 amino acid positions. Similarities are indicated within the eubacteria (between the Bst Lie and Eco L1 sequences), between the eubacteria and archaebacteria (between the eubacterial and archaebacterial sequences) and within the archaebacteria (between the Hcu L11e and Sso L11e sequences) by the following symbols: | Intrakingdom identities within the eubacteria and the archaebacteria | Interkingdom identities where all positions within the 2 urkingdoms are identical 0 Interkingdom identities where 3 out of 4 positions within the 2 urkingdoms are identical Lower Panel Line diagrams illustrate the end to end interkingdom alignment of the archaebacterial Hcu Lie and Sso Lie proteins to the complete eubacterial Bst Lie and Eco L1 sequences. Gaps required to,maintain maximum identity in the alignment are indicated by white bars. The common scale is in amino acid residue positions along the linear interkingdom alignment. 74 Bit Lie n r C U D I K Y L E f l L K L U O S S K R V P I fl 0 R 1 E 1 U II T H U - R K F D R T U E U fl F R L - t i i D P a R O Q Q I R G A U U L P H G T G C U f l f 1 1 1 < 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 I I I 1 1 1 1 1 1 1 Eco LI n R I L T IC RI1RU 1 R E K U O R T K O Y D I N E R 1 « L L ( E L R T - R K F U E S U D U M H L - G i H I I ; S D Q H U R G R T U L P H G T G R S U 1 0 0 0 0 0 1 1 0 0 0 1 0 0 0 0 0 O i l 000 Hcu Lie H I D I t - 1 E E - H R R R L _ - E D R P Q R H F R E T U 0 L A U H L R 0 L 0 L H 0 P S O R U D E G U U L P S G T G Q E T 1 1 1 • 1 1 1 1 1 1 1 1 1 1 1 1 Sso Lie C E S L I E - R L £ L fl L S T E Y M U K R M F T Q S U E 1 1 L T F K ( i D n i ( G D L K L R E I U P L P I C O P S C R C 10 20 30 10 SO 60 70 Bit Lie ft U L V F R K G E t A K E B E R R 6 R D Y U G 0 T E V 1 R t 1 - - 0 0 G u F D F D 1 I 1 U R T p o n n G E - U G C L G R 1 1 G P K G L f l P H P • 1 1 1 1 t 1 • I I I 1 < 1 1 t i l l 1 1 1 1 I I I I I I 1 1 1 1 1 1 Eco LI R U R U F T Q G f l H A E A R C R A G R E L U 6 H E 0 L R 0 0 1 - tie E I U F D H 1 R s P D ft n R U - U G O L G O U L G P R G L n P M P fl 0 1 0 0 0 0 1 0 0 1 0 0 0 1 00 II 01101 01 1 Hcu Lie 0 1 u u F fl D G E T A U R A D D V - I D O n t E D 0 L S 0 L fl D O T D R A K D L R 0 E T 0 F F U R E i r n n g O I U G A L G O U L G P R G K r l P - P « < I • 1 « 1 1 1 1 • 1 1 1 1 1 1 1 1 M l Sso Lie ft u L U U r S F E Q L E Y A K t R S P H U U I T R E E U s L 0 G O K R P U K K L fl 1 Q H E U F L 1 H 0 E S n R LflGR I L G P A L G P R G K F P T P eo 90 100 110 120 130 110 i SO Bst Lie t T G T U T F 0 U A K R U O E I C R G C U E V R U 0 t fl 6 N 1 K UP I G C U S F D H E I I R E H F fl H V E I 1 I K H C P H f i H K G - T V U K H U T 1 t 1 1 < 1 I I I 1 I I 1 1 1 1 1 1 1 I I I I I I I I 1 1 1 1 1 1 I I 1 1 1 I 1 Eco LI C V G T U T P K U A E R U K K R t A G Q U R Y R H 0 ( H I 1 1 H T T 1 G K V a F 0 R D E K E K L E fl L L V fl L I I K F I t l E G - U V I K t U S I 0 00 0 1 1 0 0 0 1 0 0 0 0 0 1 0 0 01 0 0 Hcu Lie L Q P - D D D U U O T U H R n f - H T U O I R S R 0 R R T F H T R O G R E O d S R E 0 1 R S H 1 0 u i n R R L H R H L E K G P L M U O S U V U 1 1 1 1 1 1 1 1 I I I I I I I 1 1 1 1 1 Sso Lie L P M - - T R D I S E V I H R F t - R S U 1 U t T I OOP 0 U 0 UF 1 G T E 0 n K P E D L fl E N fl 1 A O L - H I 1 E H I I U E T H L R N I V U 160 170 160 190 200 210 220 Bst Lie T s T n G P G I K U D P T T U f l 1 fl 0 1 1 1 1 1 1 Eco LI S T 7 n G R G U R U D Q R G L S i s m o n 1 0 1 Hcu Lie t T T n G P R U E U R 1 1 1 • 1 1 1 1 Sse Lie I T T n G C M U I R A 210 1 20 10 60 to 100 120 110 160 i ISO 200 220 240 75 additional gaps at alignment positions: 23, 36, 50, 107 - 113, 133, 154 - 155, 168 and 203 - 205. The interkingdom amino acid sequence similarity of the Lie proteins from the two urkingdoms ranges from 26% to 32% amino acid identity (Table 7). The two highly conserved regions within the archaebacterial Lie proteins are also conserved in their eubacterial counterparts. The conserved region of 14 residues centrally located within the Lie proteins (positions 137 - 150) is characterized by three conserved proline residues at positions 143, 148 and 150. The second region is found in the carboxy terminus of the Lie proteins (alignment positions 227 - 235) and is characterized by conserved hydroxyl (threonine or serine) residues at positions 227 and 228. The Hcu Lie protein contains a nearly perfect heptapeptide repeat DLAD (D/E) TD at positions 105 - 111 and 115 - 121 that is present but less well conserved in the Sso Lie sequence (KLQGGKR and KLAIQNE). Since the eubacterial Eco L1 and Bst Lie sequences contain a corresponding heptapeptide gap in this region, two evolutionary scenarios are possible. The heptapeptide duplication occurred before divergence and was followed by a deletion in the ancestral L1 e gene of the eubacterial lineage after divergence from archaebacteria or the repeat may have arisen through a partial duplication event in the archaebacterial ancestral gene after divergence from eubacteria; the latter possibility is the most parsimonious. The L1 protein of E. coli has been localized to the ridge region on the 50S subunit opposite the L12 stalk and binds to and protects nucleotides 2100 - 2200 of 23S rRNA (Branlant et al., 1981; Lake and Strycharz, 1981; Oakes et al., 1986). The protein functions to (i) maximize binding of peptidyl - tRNA to the P site, (ii) maximize the GTPase activity associated with EFG mediated translation and (iii) autogenously regulate the translation of the L11 - L1 mRNA (Subramanian and Dabbs, 1980; Sander, 1983; Dean and Nomura, 1980; Baughman and Nomura, 1981; Yates and Nomura, 1981; Thomas and Nomura, 1987; Kearney and Nomura, 1987). The binding domain of the L ie protein in the large subunit RNA of archaebacteria and eukaryota has been sufficiently conserved such that it can still be recognized and protected by Eco L1 in vitro implying that the domain within the Lie protein is probably also highly conserved (Zimmerman et al., 1980; Gourse et al., 1981). This conserved domain, responsible for the autogenous control of the L11 - L1 mRNA in E. coli, probably autogenously regulates the tricistronic Lie - L10e - L12e mRNA of H. cutirubrum (Shimmin and Dennis, 1989). At the present time correlations 76 between the conserved primary structure regions of the Lie protein and its functional role in binding rRNA, autogenous regulation, peptidyl - tRNA binding to the P site and the GTPase activity associated with EFG mediated translation cannot be made. 4.4 The LlOe proteins The end to end alignment of the 352 and 337 amino acid long archaebacterial L10e proteins from H. cutirubrum and S. solfataricus is illustrated and exhibits 27% amino acid sequence identity (Figure 17, Table 7). The proteins exhibit greater than 30% amino acid sequence identity distributed relatively uniformly with no deletions or insertions through the first 302 positions. Identities beyond position 302 are negligible except for the extreme carboxy terminus (positions 365 - 371). Although no identities occur between positions 335 and 362, the lack of identity is partially the result of modification required for the adaptation to a high salt environment in the halophilic archaebacteria. This region in both proteins is rich in charged amino acids; the Hcu L1 Oe protein containing twelve aspartic acid and two glutamic acid residues and the Sso L10e protein containing nine glutamic acid and six lysine residues. An alanine - proline rich region (positions 318 - 331) precedes the charged region in the Hcu L10e protein but is absent from the Sso L1 Oe protein. The H. cutirubrum and S. solfataricus L1 Oe proteins can be aligned to the shorter eubacterial E. coli L10e protein yielding 24% and 21% amino acid sequence identity respectively (Figure 17 and Table 7). During the course of evolution following the divergence of the archaebacterial and eubacterial lineages the 165 amino acid long eubacterial E. coli protein has suffered a large internal deletion (positions 141 - 258, Figure 17), a 3' terminal truncation (position 297 and beyond) and five shorter deletion or insertion events, one of which (positions 15-16) removed the unique and conserved tryptophan residue. The eubacterial E. coli L10 protein is homologous to the H. cutirubrum L10e and S. solfataricus L10e proteins by virtue of both sequence similarity and genetic linkage. The significance of the archaebacterial to eubacterial protein sequence comparisons, i.e. z = 10 for H. cutirubrum versus E. coli and z = 10 for S. solfataricus versus E. coli, are just within the range regarded as indicative of certain homology. In all three organisms the L10e genes exhibit positional conservation within the conserved L11e, Lie, L10e, L12e tetragenic cluster. The probability of fortuitous clustering of nonhomologous genes performing 77 Figure 17 Alignment of the L10e Proteins Upper Panel The amino acid sequences of the L10e ribosomal proteins from the archaebacteria Halobacterium cutirubrum (Hcu L10e) and Sulfolobus solfataricus (Sso L10e), predicted from the nucleotide sequences of the respective genes and for the Hcu L10e protein partially confirmed by amino acid sequence, are aligned with the L10e ribosomal proteins from the eubacterium Escherichia coli (Eco L10) and the eucaryotes Homo sapiens (Hsa L10e) and Saccharomyces cerevisiae (See L10e). Partial amino acid sequence of the Bst L10e protein indicates that it shares the features of the Eco L10 protein (AT. Matheson, personal communication). Gaps required for alignment are indicated as dashes (-). The amino acid position scale is below the See L10e sequence and the proteins are aligned over 372 amino acid positions. Similarities are indicated between the eubacteria and eucaryota (above the Eco L10 sequence), between the eubacteria and archaebacteria (between the eubacterial and archaebacterial sequences), within the archaebacteria (between the Hcu LlOe and Sso L10e sequences), between the archaebacteria and eucaryota (between the archaebacterial and eucaryotic sequences) and within the eucaryota (between the Hsa L10e and See L10e sequences) by the following symbols: | Intrakingdom identities within the archaebacteria and the eucaryota | Interkingdom identities where all positions within 2 urkingdoms are identical 0 Interkingdom identities where 2 out of 3 positions between the eubacterial and archaebacterial urkingdoms or 2 out of 3 positions between the eubacterial and eucaryotic urkingdoms or 3 out of 4 positions between the archaebacterial and eucaryotic urkingdoms are identical. Lower Panel Line diagrams illustrate the end to end interkingdom alignment of the archaebacterial Hcu L10e and Sso L10e proteins to the complete eubacterial Eco L10 and the eucaryotic Hsa L10e and See L10e sequences. Gaps required to maintain maximum identity in the alignment are indicated by white bars. The common scale is in amino acid residue positions along the linear interkingdom alignment. 78 0 0 0 1 0 0 1 1 0 10 1 1 1 1 1 Eco CIO n n L H « 0 C 0 A 1 U A E - - U S E U A C G A L S A u U A D S fl G II T U 0 c n T E I I C 1 G R E A G u v n R U U R H T L L R R A U E - - 1 0 0 0 0 0 H I 0 0 0 1 0 0 0 1 0 0 0 0 0 1 0 1 0 1 0 Hcu LlOe n s fl E E B P> T T E E U P E U C R O E U A E L U O L L E T V D S U G V U K U T G 1 P S C Q L Q D n A A G L H - G 0 A A U R n S R H T L L U A A L E - - 1 1 1 I I 1 1 1 1 1 1 1 1 1 1 1 i i 1 1 1 1 1 1 S»o LlOe n i ( H U T T T C C I A E U C U D E U A E L T E E L E T H C T 1 1 1 A N 1 E O F P A 0 C L H E 1 R C C L R - G C A a 1 C U T c M M L F H 1 A L E - - 01 0 0 1 0 0 0 1 1 0 1 1 0 0 0 1 0 1 H>o UOe n P A E 0 A A T U C S H V F L C I 1 0 L L 0 0 V P E c F 1 u G A OHO G S c o n o o 1 A fl S L R - G C A U U L n G c H T ri n A c A 1 A G H 1 I I I 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 See LlOe n G G I A E E C R E V F A C L A E V L E E V E S L f u g G V D H V s s O O l t H E V R C E L R - G A A U U L n G c « i n v i « A 1 R G F 10 20 30 10 SO 60 70 0 1 1 1 1 0 0 1 1 1 0 01 Ece LIO - - - 61 P f E C L C O A F U G P T L 1 AVSI1 E H P G A A A R L F I E F « < « » A C F E U C A A A F E G E L 1 P A S 0 1 D A L A 1 0 10 1 0 0 I fl 1 1 0' 0 Hcu LlOe E I I D I L D T L T E Y U E G E U G L U A T M 0 H P F G L - V 0 O L E H S C T P A P I M A G E V I P H 1 1 U U P E G D T G 1 D P G P F U G E L 0 T 1 1 1 1 1 1 I I I 1 1 1 1 1 1 1 1 I 1 1 1 1 I 1 See LlOe - PI l i t g t C L F E S V L T G P H A F 1 F T P T H P F E L - D L F l S t F C L E A V A L P G O C A O E E u u U P A G O T G 1 A A G P fl L S U F G C L 0 1 0 0 001 0 0 0 0 0 01 10 10 0 II 00 0 0 0 0 Hie LlOe L E H M P A L E C L L PH 1 A G H U G F U F T C E D L T E 1 -A O n u A H CUP A A A A A G A 1 A P C E U T U P A O M T G L G P E - C T S F F O A L 1 1 < 1 ( 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 M i l l 1 1 1 1 I I I 1 I I I 1 1 1 1 1 See LlOe L 5 0 I P t f E ( L L P F V K G K U G F V F T H t t l l l 1 - E N u 1 v s H A U A A P A R A G A U A P E D l U V A A U H T G t l E P G - K T S F F Q A L M to 100 110 120 130 110 150 Ece LIO Hcu LlOe G n H A R 1 0 E 6 S 1 O U L O D S U U T E E G E T U S O D U S H U L S E L G 1 E P C E U G L 0 L R G U F S E G U L F T P E E L E 1 0 U D E V R A D I O 1 1 1 I I I 1 1 1 1 1 1 1 1 1 1 1 1 1 1 I 1 See LlOe ( i C T C U 0 0 6 C 1 H I L O D T T U f l C P O D E I P A D I U P 1 L 0 C L G 1 11 P U V U C L H 1 E 1 A V 0 H G U 1 1 P G 0 C L S I H L D 0 V T H E I R 0 0 00 1 1 00 1 0 1 0 1 1 1 1 01 0 0 0 1 1 1 Hie LlOe 0 i T H I S A 6 T 1 E I L S O t l Q L I E T G O E l l d S E f l T L L H n L H 1 S P F S F G L U 1 0 0 U F 0 H G S 1 V H P E U L O 1 T E E - - t 1 1 1 1 1 1 1 1 1 I I « 1 I I I I I I 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 See LlOe c U p i n t A G T 1 E 1 V S D U C U U D A G M C U G 0 S E A S L L H L L H 1 S P F T F G 1 1 D V 0 U V 0 H G 0 V F P S S 1 L O 1 T D E - - 160 170 ISO 190 200 210 220 1 1 0 0 0 0 Ece LIO T L P T V E E A 1 A A L n A T n C E R S A G C L U A T L A A U A 0 A C E A A 1 0 1 1 0 0 0 1 0 0 0 0 Hcu LlOe s A A A S A A H L S U H A A V P T E R T A P O L 1 A E G R G E A E S L G L 0 A S U E S P 0 L A D I l V S t A D A 0 U R A L A A 0 1 DD E D A L P E E L 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Sio LlOe c n H 1 H A F A U A T E I A Y P E P C U L E F T A T E A fl fl H A L A L A S E 1 G V 1 T 0 E T A Q A U F T C A U n c A V A U A S S 1 S G C U 0 L G U 0 1 0 0 0 00 0 0 1 0 0 0 H.o LlOe T L H S A F L E G U R H U A s U C L 0 1 G V P T I I S I I P H S 1 1 K G V C A U L A L S U E T 0 V T F P L A E H 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 See LlOe E L U S H F U S A U S T 1 A s 1 S L A 1 G V P T L P S U G H T L 1 H H V C 0 L L A U A 1 A R S V H 1 P E 1 E D L 230 210 250 260 270 260 290 300 Hcu LlOe 0 0 U 0 - A P A A P A G G E A 0 T T A 0 E Q S 0 E T Q A S E A 0 D A 0 D S 0 0 0 0 0 D D 0 G H A G A E - G L G E n F G 1 1 1 1 1 1 See LlOe 0 A o r 0 U S E 0 fl « £ [ ( E E C c E E E C c G r s E E E 1 G G - G L S S L F G 0 0 0 1 0 0 1 Hie LlOe C A F L R OPS A F U fl A A P U A A A T T A A P A A A A A P A - - - C U E A - - - c E E S E E S O E O fl a F G - L F O I 1 1 1 1 1 1 1 1 1 1 1 I I I ! 1 1 1 1 1 1 1 1 See LlOe U O A I E M P E C V A A A A P A A - T S A fl S G 0 A A P A - - E E A A A E E E - E E S D O 0 fl G F G - L F O 310 320 330 310 350 360 370 I 20 10 60 60 100 I20 110 I60 no 200 220 210 260 2SO 300 320 310 360 79 analogous functions (i.e. factor binding GTPase domain) in two separate lineages is exceedingly remote. The very high statistical significance of the archaebacterial versus eucaryotic protein sequences (Hsa L10e and See L10e) ranging from z = 25 for Sso L10e versus Hsa L10e to z = 42 for Hcu L10e versus Hsa L10e unequivocally demonstrate that these proteins are homologous. The gene encoding the ancestral eucaryotic L10e protein has an insertion preceding the alanine - proline rich region (positions 305 - 319), two internal deletions (positions 219 - 244 and 332 - 344), and five short deletion - insertion events with respect to its archaebacterial homologue. The deletion at position 332 - 344 follows the alanine - proline rich sequence and extends into the region of high amino acid charge density that is also present in the H. cutirubrum and S. solfataricus proteins but truncated from the E. coli protein. The sequence similarity and structural features (discussed in section 4.6) of the alignment of eucaryotic L10e proteins to the archaebacterial L10e proteins unequivocally indicate that these proteins are homologous and thus, despite the very low similarity of 15% -17% identity at the amino acid level and statistical significance z = 2 - 3, the eucaryotic L10e protein must be the homologue of the eubacterial Eco L10. The Hsa L10e and L12e proteins are known to form a complex analogous to the L10 - L12 complex of E. coli but because of the low statistical significance of the eubacterial - eucaryotic match Rich and Steitz (1987) were unable to identify PO as the L10e protein. Thus slowly evolving archaebacterial proteins may serve as a link in identifying proteins present in the progenote that have diverged too greatly between the eubacterial and eucaryotic urkingdoms to be demonstrably homologous by sequence similarity methods. 4.5 The Ll2e proteins The complete amino acid sequences of 26 L12e proteins are presently available; 9 eubacterial, 5 archaebacterial, 7 eucaryotic type I and 5 eucaryotic type II (Table 3). Figures 20 and 21 illustrate the alignment of three typical but distantly related eubacterial (E. coli, Micrococcus lysodeikticus and the chloroplast of Spinacea oleracea), three archaebacterial (H. cutirubrum, Methanococcus vanielii and S. solfataricus), three eucaryotic type I (H. sapiens and 2 from S. cerevisiae) and three eucaryotic type II (H. sapiens and 2 from S.cerevisiae ) L12e amino acid sequences. Intrakingdom (and within eucaryota, intratype) alignments and comparisons are readily made; the eubacteria, archaebacteria, eucaryotic type I 80 Figure 18 Alignment of the Ll2e Proteins The amino acid sequences of the L12e ribosomal proteins from three archaebacteria Halobacterium cutirubrum (Hcu L12e), Methanococcus vanielli (Mva L12e) and Sulfolobus solfataricus (Sso L12e), predicted from the nucleotide sequences of the respective genes and confirmed by amino acid sequence, are aligned with the L12e ribosomal proteins from three eubacteria Escherichia coli (Eco L10), Micrococcus lysodeikticus (Mly L12e) and Spinacea oleracea chloroplast (Sol{c) L12e) and two eucaryotes Homo sapiens (Hsa L12el and Hsa L12ell) and Saccharomyces cerevisiae (See L12elA, See L12elB, See L12ellA, and See L12ellB). The amino terminal 66 amino acid positions of the eubacterial proteins have no direct.counterpart in the archaebacterial or eucaryotic proteins; rather it exhibits a degree of sequence similarity with its own carboxy domain (positions 1 - 49 align to positions 122 - 170). In the eubacterial protein position 66 is fused to position 90 and divides the protein into the amino terminus and the carboxy domain. The intervening positions, beginning at position 67, form the unique amino termini of the archaebacterial and eucaryotic proteins. The region of positions 46 - 66 within the amino terminus of the eubacterial protein and approximate positions 161 - 188 of the archaebacterial and eucaryotic proteins are homologous alanine - proline rich hinge regions. Gaps required for alignment are indicated as dashes (-). The amino acid position scale is indicated at top for the eubacterial amino terminal sequences and at bottom for the eubacterial carboxy domain, archaebacterial and eucaryotic sequences; the proteins are aligned over 228 amino acid positions. Similarities within and between urkingdoms and features of the sequence and structure of the proteins are indicated by the symbols: Intrakingdom identities where 2 out of 3 residues are identical (0 , g ); Intrakingdom identities where 3 out of 3 residues are identical (J); Interkingdom identities where at least 2 out of 3 positions within each kingdom are inclusively identical or conserved ( | ) ; Interkingdom identities where all positions in urkingdoms are identical or conserved ( j ); Residues within the Eco L12 carboxy domain involved in the conserved face ( • ); Residues within the Eco L12 carboxy domain involved in the dimerization site ( • ); Residues within the Eco L12 carboxy domain involved in the anion (putative GTP) binding site (I); Position of the intron within the See L12ellB gene ( f~); Position of the unique tryptophan residue within the eucaryotic L12ell proteins ( - ). Position of the usually unique arginine residue (rarely substituted by lysine) within the eubacterial carboxy domain, archaebacterial and eucaryotic L12el proteins (z). Symbols are not shown for the alignment of the eubacterial amino terminus with the eubacterial carboxy domain and archaebacterial and eucaryotic proteins. Symbols are also not shown for the hinge region (approximate positions 45 - 66 for the eubacterial amino terminus and 160 - 190 for the archaebacterial - eucaryotic proteins) due to the relaxed constraint on amino acid sequence conservation in this region. Conserved amino acid substitutions are within the groups: D-E-Q -N-R-K- H, L -1 - V - M - F, Y - F, A - G, S - T, A - S. I 10 20 30 Eco L I 2 N TERniNUS n S 1 T K 0 0 1 I E - R U fl fl n - - - - s u n D U U E 0 I 0 0 0 0 0 0 n 1 y L1 2« N T E R n m u s n H K E 0 1 L E - fl 1 K A n - - - - t u L E L N 0 0 6 0 0 So He) L I 2 e Ii TERniNUS n A u - E n P E K 1 E 0 L G T - 0 L S G L - - - - T L E E fl R g 1 1 • • • • • • • • 0 0 0 0 o • o • o O 0 O Eco L12 C D o n n m . . . E E K T E F 0 U - - 1 L K ft fl c fl M - K U ft U 1 K fl U R G fl T G L - - - G L K E fl PC - 0 L V E S H P fl fl L IC E G U s K D 0 fl E fl 1 1 • t • » 1 1 0 0 0 0 • 0 • 1 1 0 1 1 • 0 1 • 1 • 1 • • a 0 • 0 • 0 1 1 1 t t • t t a • 1 n 1 y L I 2 e C DOHfllN . . . E E K T E F D U - - U L ft S ft G fl E - PC 1 K g 1 K U U R E 1 T G L - - - G L K E ft PC - E U U 0 N fl P K fl L K E a u s K D E fl E E 1 1 1 t • t 1 1 0 0 1 t 1 0 1 I 1 1 • t 1 1 1 • 0 0 0 1 0 1 t t I 1 I 1 1 0 1 1 Sol(c) L12a c D o n n m . . . E E K T E F D U - - S 1 D E u P s M A R 1 S V 1 K fl u R ft L T S L - - - G L K E fl K - E L 1 E G L P K IC L K E G U s PC 0 0 ft E 0 e i n 8 8 e 9 i : i in i i e i Hcu LI2e n E V U V fl ft L 1 L N - E fl D E E L T E D N 1 T G U L E fl A G u 0 - - - - u E E - s R - ft PC fl L U fl - fl L E D - u - D 1 E E - fl U E E • t 1 1 1 • 0 • t 0 • • 0 • a a 1 • 1 a 1 u 0 1 • 1 0 0 • • 1 0 • 0 • • 0 n u a LI2e n E V E V ft ft L L L M - S fl N K E V T E E ft U PC fl U L U fl G G 1 E - - - - fl Ii D - H R - u PC fl L u fl - fl L E G - u - D 1 ft E - fl 1 fl K • I • 1 1 1 1 0 t 1 0 1 1 0 • 0 0 1 1 1 9 1 0 o 0 1 • 1 1 1 1 I 1 • Sso LI2e n E V 1 V ft S L L L H - ft R K K E 1 S E E N 1 K Ii u L S fl fl G 1 T - - - - g 0 E - u R - L K fl U R fl - fl L K E - u - N 1 0 E - 1 L K I • 1 1 i i s 1 8 8 8 8 8 8 8 : 1 81 % 1 8 Hsa LI2el n R V u n s V L L ft ft L C C N S S P S fl K D I IC PC i L D s u 0 1 E - - - - n D D D R _ L M K u 1 S - E L 11 G - IC - N 1 E 0 U 1 fl . . • - 0 G 1 G PC L fl S U P • 1 1 • • • 0 t • 1 0 • 0 I t a 0 1 • • a I 0 a 0 0 • 1 • » 1 0 • 0 1 I a • • t See LI 2s1n n K V L fl ft V L L L U 0 G G H fl fl P S fl fl 0 1 IC fl U U E s u G fl E - - - - u a E - fl ft - 1 It E L L s - S L E G - K G S L E E - i 1 fl - -• - E G 0 PC PC F A I g P I 0 1 0 1 0 1 1 1 0 I • 1 1 1 1 0 0 0 I i 1 0 1 0 0 0 t 1 0 1 1 0 0 t 0 1 • 0 1 1 1 See LI2elB n PC V L fl ft V L L L Ii ft ft G M - T P D fl T PC 1 PC fl 1 L E s u G 1 E - - - - i E D - E X. - u S S U L s - fl L E G - K - s U D E - L 1 T • - E G N E K L R ft g P 1 1 II 8 1 8 8 8 8 8 8 8 _ 1 81 8 1 8 8 8 Hsa LI2el1 n n s U S E L fl c 1 "v - S R L 1 L H D - 0 E u T U T E D K 1 N fl L i PC ft R G u M - - - - u E p - - f - u P G L F R PC fl L n Ii - u N 1 G s - L 1 C • - N g G fl G - G p n P 0 a 1 0 0 • 0 • 1 1 0 0 6 0 0 0 a 0 u I 0 1 0 • 1 • • 0 0 0 0 0 0 • See 112.1 IR n s T E S fl L S - - V - fl R L 1 L ft D - - S E 1 E 1 S S E PC L L T L T M fl R N u p - - - - u E H - - i - u fl D 1 F fl K ft L D G - 0 - H L PC D - L L u - -• - N F S fl G - fl A fl P 0 1 0 0 • 1 • 0 t 0 0 o 0 o 0 0 0 0 0 0 0 1 0 • 0 0 • t t 1 0 0 0 0 0 0 • See LI2elIB n S 0 S 1 1 S - - F - fl R f 1 L fl D - - fl G L E i 1 s u N L L 1 1 1 K A fl G fl H - - - - u 0 11 - - u - u A D U V A PC fl L E 0 - PC - u L PC E - 1 L s - • • - G f H M - - - A G P t 6/ 10 80 90 100 110 120 130 110 I50  83 Figure 19 Line Diagram of the L12e Protein Alignment Line diagrams illustrate the end to end interkingdom alignment of the L12e ribosomal proteins from three archaebacteria Halobacterium cutirubrum (Hcu L12e), Methanococcus vanielli (Mva L12e) and Sulfolobus solfataricus (Sso L12e), three eubacteria Escherichia coli (Eco L10), Micrococcus lysodeikticus (Mly L12e) and Spinacea oleracea chloroplast (Sol{c} L12e) and two eucaryotes Homo sapiens (Hsa L12el and Hsa L12ell) and Saccharomyces cerevisiae (See L12elA, See L12elB, See L12ellA, and See L12ellB). Gaps required to maintain maximum identity in the alignment are indicated by white bars. The eubacterial protein is shown divided into the amino terminus and carboxy domain. The globular domain, hinge region, L10 binding site of Eco L12 and the unique highly charged carboxy terminal region of the archaebacterial and eucaryotic proteins are highlighted by dashed boxes. The amino acid position scale is indicated at top for the eubacterial amino terminal sequences and at bottom for the eubacterial carboxy domain, archaebacterial and eucaryotic sequences. 84 and eucaryotic type II proteins averaging 52%, 42%, 57% and 53% amino acid sequence identity respectively. The archaebacterial and the eucaryotic L12el proteins can be linearly aligned to each other end to end with the initiation methionine at position 75. The unique conserved arginine residue of the archaebacterial L12e proteins (position 117) is conserved in the Hsa H2el and See L12elA proteins and conservatively substituted with a charged basic lysine residue in the See L12elB protein. The archaebacterial - eucaryotic type I interkingdom similarity averages 30% amino acid identity over the amino terminal region (positions 75 -140; reasons for the exclusion of the carboxy terminal region for calculation of interkingdom sequence similarity are discussed in section 4.6). The eucaryotic L12ell proteins align with their archaebacterial and eucaryotic type I homologues but have an extended amino terminus, lack the conserved arginine residue (position 117) and contain, immediately adjacent, a unique tryptophan residue (position 119). Archaebacterial - eucaryotic type II interkingdom similarity averages 26% amino acid identity over the amino terminal region (positions 75 - 140). Thus the archaebacterial L12e protein share greater structural, compositional and slightly higher sequence similarity with the eucaryotic L12el protein than with the eucaryotic L12ell proteins. The eucaryotic L12el and L12ell proteins share only 20% amino acid identity over the amino terminal region (positions 75 -140). This suggests that either the type I and type II proteins diverged from each other prior to the divergence of eucaryota and archaebacteria and the archaebacterial and eubacterial lineage either lost (possibly during the development of the L11 e - L1 e - L10e - L12e gene cluster) or never contained the type II gene, or the rate of divergence of the eucaryotic L12e proteins is significantly greater than that of the archaebacterial Ll2e proteins and the sequence similarity difference between the archaebacterial versus eucaryotic type I proteins (30% identity) and archaebacterial versus eucaryotic type II proteins (26% identity) is fortuitous or insignificant. Although the eubacterial L12e protein cannot be linearly aligned with its archaebacterial or eucaryotic counterparts two homologous domains are common to the proteins from all three urkingdoms. The first domain is located near the amino terminus of the archaebacterial and eucaryotic proteins and in the middle of the eubacterial protein (position 90 - 140); interkingdom similarities for this domain average 28% amino acid sequence identity and range from a minimum of 17 percent identity between the See L12ellB and Eco L12 proteins to a maximum of 36 percent between the Eco L12 and Hcu L12e proteins. The second 85 common region is the alanine - proline rich sequence located between positions 46 - 66 in the eubacterial protein and between positions 167 - 187 in the archaebacterial and eucaryotic proteins (Figure 18). The length and sequence of these alanine - proline rich sequences is highly variable even within urkingdoms, with substitutions occurring between alanine, proline, serine, threonine and glycine. The amino terminus of the eubacterial L12e protein (positions 1 - 43, Figure 18), exhibits greater sequence identity (12 of 31 amino acid identities for Eco L12) to its own carboxy terminus (position 122 - 164) than to any sequence within the archaebacterial or eucaryotic proteins (Figure 19). The second half of this intramolecular complementarity in the eubacterial L12e protein appears to align to regions interrupted by deletion within the archaebacterial (positions 142 - 164) and eucaryotic (positions 153 - 160) L12e proteins (Figure 18). The eubacterial L12e protein has no homologue to the carboxy terminal region of the archaebacterial and eucaryotic L12e proteins. This region consists of a very highly charged region (approximate positions 200 - 220) followed by a mostly hydrophobic extreme carboxy terminus and is very highly conserved both within and between urkingdoms. The Hcu L12e protein has the least sequence similarity in this region due to a complete absence of basic (i.e. lysine) residues and the predominance of aspartate over glutamate residues; this likely occurred during adaptation to a high salt environment. Biophysical studies on the Eco L12 protein indicate that the amino terminal domain spontaneously dimerizes and binds to the Eco L10 protein (Koteliansky etal., 1978). The carboxy terminal domain forms a compact structure that crystallizes as a dimer, contains an anion binding site, and may interact through a conserved face with extrinsic translation factors during the protein synthesis cycle (Leijonmarck and Liljas, 1987; Figure 18). The two domains are separated by an alanine - proline rich region believed to be unstructured and to function as a flexible hinge between domains of the L12e proteins, accounting for the observed high mobility of the carboxy terminal domain of Eco L12 (Tritton, 1978; Leijonmarck et al., 1981; Cowgill etal., 1984). The alignment of the L12e proteins illustrated in Figure 18 implies that the amino terminal end of the archaebacterial - eucaryotic proteins contains the factor binding domain (extending over the region 94 - 148), the dimerization site (positions 117 - 144) and the putative anion binding site (positions 105 and 109). The alignment suggests that the ancestral globular domain comprised 75 to 80 amino acids 86 wherefrom the eubacteria have lost approximately 15 amino acids, including the unique two conserved tyrosine residues (positions 77 and 79 in archaebacteria, 77 and 81 in eucaryotic type I and position 77 in eucaryotic type II), on the amino side of the region of the conserved face. The archaebacteria and eucaryota have lost approximately 25 and 10 amino acids respectively from the carboxy side of the region of the conserved face. However the dimerization, anion and factor binding domains have been retained in all three urkingdoms. The alanine - proline rich hinge region is evident on the amino and carboxy sides of the globular domain of the eubacterial and archaebacterial - eucaryotic proteins respectively (Figure 19). 4.6 Intra and Interproteln Relationships The archaebacterial and eucaryotic L10e and L12e proteins contain a region of high amino acid charge density near their carboxy terminal ends (Rich and Steitz, 1987; Ramirez etal., 1989; Shimmin et al., 1989b; Newton etal., 1990). The L10e and L12e proteins of H. cutirubrum and S. solfataricus exhibit a high degree of sequence similarity at their carboxy terminal ends (Figure 20). For the two S. solfataricus proteins, the 31 carboxy terminal residues which contain the region of high charge density were found to be identical (and, remarkably, the nucleotide sequence was also identical) except for an extra glycine at the end of the L10e sequence. The degree of amino acid sequence identity was less pronounced although highly significant for the H. cutirubrum proteins (45% over 29 residues) and the S. cerevisiae proteins (75% over 23 residues). Extension of the archaebacterial L10e - L12e alignments into the central regions of the proteins resulted in the discovery of a modular sequence of length 26 amino acids. The module, tandemly reiterated three times in the L10e proteins, was present in single copy in the L12e proteins. The three L10e module copies were designated a , P and y. In the Hcu L10e protein short sequences flanking the triple modules are strikingly similar; positions 210 - 218, Figure 17, (PEELEIDVD) compared with positions 297 - 304 (PEELQDVD) have, excluding a one amino acid gap, 7 out of 8 amino acid residues and 21 out of 24 nucleotides identical. It remains unknown whether this nearly perfect direct repeat in the DNA was involved in the module duplication process. These modular sequence domains are separated from the high charge density domain by the alanine - proline rich hinges in the Hcu L10e, HcuL12e and Sso L12e proteins but not in the alanine - proline rich region deficient SsoUOe protein. 87 Figure 20 Intra and Interprotein Relationships between the L10e and L12e proteins Four intraspecies comparisons of L10e and L12e amino acid sequences are presented from top to bottom: Escherichia coli, Halobacterium cutirubrum, Sulfolobus solfataricus and Saccharomyces cerevisiae. The regions of the modules, hinge and charged region are indicated. The L1 Oe a , P and y sequences are the three 26 residue long module repeats. For Eco L12 where the protein has undergone major rearrangements and alterations during eubacterial evolution, a complete and a partial copy of the module appear to be present in the carboxy domain and amino terminus respectively. In See L10e one copy of the module is not present. Amino acid comparisons of identities ( |, |) and conservative substitutions (O.Q ) are as follows: line 1, L10e P with y; line 2, the y module and carboxy terminus of L10e with the module and carboxy terminus of L12e; line 3, the carboxy domain and amino terminus of Eco L12; line 4, L10e a with y; line 5, L10e a with P; line 6, See L10e to See L12elA; line 7, See L12elA to See L12elB; line 8, See L10e to See L12elB. The relative position of the intron within the See L12ellB gene is indicated by the arrow. The numbers at the end of the sequences designates the position number of the terminal amino acid of the modules and proteins (from Figures 17 and 18). Residues representing the carboxy termini of the respective proteins are identified (*). Conservative substitutions are defined as being within the groups: D - E - Q - N - R - K - H, L -1 - V - M - F, Y - F, A - G, S - T, A - S. 88 89 Rich and Steitz (1987) noted sequence similarity at the carboxy terminal ends of the eucaryotic Hsa L10e and L12e proteins, including the alanine - proline rich and high charge density domains. Extension of the eucaryotic alignment resulted in the discovery of a single copy of the module domain in the eucaryotic L12e protein sequences and two tandemly reiterated copies in the eucaryotic L10e protein sequences (Shimmin era/., 1989b). One of the L10e protein's modules was not generated in the ancestral eucaryotic gene or was removed by a deletion (Figure 17). Which of the three modules is actually missing cannot be ascertained, although the alignment given in Figure 17 (i.e. missing the a module, positions 219 - 244) yields the highest degree of sequence similarity. Deletions / insertions within the carboxy terminal region of the archaebacterial - eucaryotic L12e protein appear in similar, and sometimes identical, positions in the L10e proteins, suggesting that these sequences may still be functional homologues and that selection preserves the similarity of the sequences (Figure 20). The only anomaly in this pattern is the lack of the alanine - proline rich hinge feature in the Sso L10e protein. The absolute identity of the S. solfataricus L10e and L12e proteins from positions 74 - 105 (Figure 20) at both the amino acid and nucleic acid level suggests a very recent recombinational restoration event and if this event removed the hinge region leaving only one proline at position 69 (Figure 20) then other thermoacidophilic archaebacteria should retain the extended hinge region. The virtually identical alanine - proline rich hinge and high charge density domains of the four See L12e proteins, and to a lesser extent the See L10e protein, indicates that restoration or conservation of this region is not confined to the archaebacteria (Figure 18 and Figure 20). Neither of the eubacterial L10e and L12e proteins contain the carboxy terminal region of high amino acid charge density and thus they do not exhibit sequence similarity at their carboxy terminal ends. However, regions corresponding to potential single intact and partial copies of the residual modular sequence were located when the Eco L10 and Eco L12 sequences were aligned to the corresponding archaebacterial and eucaryotic proteins (Figure 20). The Eco L10 complete module matches well with the Hcu L1 Oe y module (9 identical amino acid residues) and because of this is aligned at the y position. The 12 amino acids preceding the intact Eco L10 module may represent a second partial module; equal sequence similarity of these 12 residues with the other L10e proteins is evident whether they are aligned at positions 141 -152 or as a partial module at positions 259 - 270 (Figure 17). 90 When treated as a group the modules were highly significant (z = 17) although the statistical significance of matches between individual modules is low or nil. The evidence for the existence of the modules is strengthened by the presence of a conserved gap of precisely 26 residues eliminating the a module within both of the eucaryotic Hsa L10e and See L10e proteins and the termination of the eubacterial Eco L10 protein precisely at the end of its intact module. Thus the existence of a statistically significant module of 26 amino acids in the L10e proteins, repeated thrice in archaebacteria, twice in eucaryotes, and an intact plus a possible partial copy in eubacteria has been demonstrated (Figure 19 and Figure 20). Sequence similarity indicates that a single copy of the module also exists in the L12e protein. Several features of the module region are noteworthy. First, the central section (positions 8 - 2 1 , Figure 20) of the modules within L10e is the most highly conserved (31% amino acid identities and 29% conservative amino acid substitutions); the flanking regions (positions 1 - 7 and 22 - 26, Figure 20) have similarity that is close to random for sequences of this amino acid composition (10% identical and 15% conservative amino acid substitutions). Second, the conserved arginine of the eubacterial, archaebacterial and eucaryotic L12el proteins (position 117, Figure 18) generally aligns with positively charged (five lysine) or hydrophilic (one asparagine, three serine) residues (position 8, Figure 20). Third, the hydrophobic residue in position 16 appears to be the most highly conserved residue (eleven leucine, three valine, one methionine, one isoleucine). Attribution of the 12 amino acid residues preceding the Eco L10 y module to a partial |3 module preserves this leucine residue. Fourth, alanine is also highly conserved in positions 9, 13, 15, 17 (Figure 20); this being best exhibited by the Sso L10e protein where of the sixteen alanines present within the three modules, twelve align perfectly at these positions. The putative copy of the module present in Eco L12 (positions 105-141, Figure 18) contains the majority of the L12 dimerization site of the globular domain (primarily positions 117 - 134). Alignment of the L12e proteins to the L10e proteins (Figure 20) revealed that the dimerization site in the carboxy terminal domain of Eco L12 (positions 8 - 20) was aligned with the region of highest conservation in the L10e modules (approximate positions 8-21). This would suggest that these modules may be reiterative L12 dimerization sites. Furthermore, the amino terminal end of the eubacterial Ll2e protein appears to be a duplication in part of this same dimerization site and this may explain the tendency of the Eco L12 amino 91 terminal domain to spontaneously dimerize (Figure 17). The carboxy terminal region of the Eco L10 protein is thought to be responsible for binding the L12 dimers; this may be facilitated by the presence of the protein's terminal intact module (Liljas, 1982). The presence of these putative dimerization modules in all L10e proteins suggests a mechanism for interaction with the L12e proteins. The E. co// L12 globular domain undergoes a conformational change upon interaction with extrinsic translation factors and if this conformational change exposes the L12 dimerization site then the L12 protein could conceivably fold about the hinge and bring the L12 dimerization site into interaction with the dimerization site of the L10 module (Gudkov and Gongadze, 1984). Thus the bound extrinsic translation factor would be brought to the ribosome surface in a specific orientation. It is possible that the multiple modules in the L10e proteins also serve as multiple interaction sites for the L12e protein and if other ribosomal proteins contain the module sequence then the Ll2e protein (with bound translation factor) could be targeted to various sites on the ribosome surface. This mechanism of action would be possible for all types of L10e - L12e protein complexes. 4.7 Summary The structural features of the eubacterial. archaebacterial and eucaryotic L11e. Lie, L10e and Ll2e ribosomal proteins are illustrated in Figure 21. Complete amino acid sequences of the eucaryotic See L11e and See Lie proteins have been determined but not published; only a short amino terminal region of the See L11e protein is available. The L11e proteins are colinear, rich in conserved proline residues (which may contribute to the highly elongated structure of the protein) and exhibit two regions of high amino acid sequence conservation in the amino and carboxy terminal domains. The amino terminal 64 amino acid residues of the Eco Li 1 protein is known to interact with translation release factor 1 and this region is the best conserved region of the protein; a second conserved region exists in the carboxy terminal domain. The binding site within tine L11e protein for rRNA remains indeterminate. A structural feature, i.e. methylation patterns, anc a functional feature, i.e. synthesis of ppGpp during the stringent response, of the Eco L11 protein appear not to be conserved in the archaebacteria. The Lie proteins of eubacteria and archaebacteria are colinear and preserve two regions with very 92 Figure 21 Summary of the Structure and Function of the L11e, L ie , L10e and L12e Ribosomal Proteins The structural features of the eubacterial, archaebacterial and eucaryotic L11e proteins are illustrated at the upper left with an amino acid scale corresponding to the sequence scale utilized in the L11e alignment of Figure 15. The conserved amino terminal region responsible for the binding of release factor 1 during translation termination is shaded. The Lie proteins of eubacteria and archaebacteria are illustrated at upper right with an amino acid scale corresponding to the sequence scale utilized in the Lie alignment of Figure 16 and the highly conserved regions indicated. The structural features of the L10e and L12e proteins from the eubacteria, archaebacteria and the eucaryota are illustrated at lower left and lower right respectively with amino acid scales corresponding to the sequence scales utilized in the L10e and L12e alignments of Figures 17 and 18 respectively. The upper amino acid scale is unique to the eubacterial L12e protein and has a fusion of position 66 with position 90. The archaebacterial and eucaryotic L12e proteins correspond with the lower L12e scale. The archaebacterial L12e protein is composed of a globular domain containing a single copy of the module, a hinge and the charged carboxy terminus. The archaebacterial L10e contains a fusion of three quarters of a copy of the L12e protein and a triplication of the modular sequence present in the L12e part of the fusion. The eucaryotic proteins are very similar to their archaebacterial counterparts: there exist two types of L12e protein (i.e. L12e type I which is similar to the archaebacterial L12e and the L12e type II which differs in the globular domain) and the L10e protein has only two modules. The eubacterial proteins have undergone substantial alterations. The L10e protein has a large internal deletion, only one complete and one partial module, and the carboxy terminal sequences containing the hinge and highly charged regions are truncated. The L12e protein retains the globular domain with the internal module and dimerization site but the hinge has been relocated to the amino terminal side of the globular domain. The amino terminal end, responsible for dimerization of the L12e proteins and binding to the L10e protein is partially derived from a module. 93 LI la Lie EUBHCTERIfl B I N D I N G S I T E FOR ' R E L E A S E F R C T O R 1 R R C H R E B R C T E H I H P R O L I N E S C O N S E R V E D R X I R L R A T I O 5 . 5 : 1 EUCHRYOTH I O N L V N T E R I I I N R L S E Q U E N C E KNOUN F R N R B I N O I N G S I T E S u t t r n o u N EUBHCTERIfl i — C O N S E R U E O R E G I O N S flRCHHEBHCTERIR I EUCHRYOTH S T R U C T U R E U N K H O U N S I T E S I N U O L U E D I N R U T O G E N O U S R E G U L A T I O N P E P T I D Y L T R N A B I N D I N G GTPase A C T IUI TV U N K N O U N I SO _ l _ 1 0 0 I S O 1 7 1 _ l I I S O _ L _ 1 0 0 _l I S O _l 2 0 0 I 215 __l Ll2e LlOe I 1 1—I 1 6 6 / 5 0 1 5 0 1 7 0 EUBHCTERIfl L HRCHHEBHCTEHIH EUCHRYOTH L LlOe B I N D I N G . S I T E L I 2 . F U S I O N C X X l l l l r ™ — G L O B U L A R D O M A I N 1 • ' • "TTTTW^r-TTTTt I ^ O I H E A I Z A T I O N H I N G E S | T E M — 1 N O D U L E S 1 5 0 1 0 0 1 5 0 2 0 0 2 5 0 3 0 0 3 5 0 3 7 2 I 1 I I I I I I I 1 ' I I G L O B U L A R D O n A I r i H I N G E R E G I O N L 1 2e I L I 2a I I 6 7 100 150 200 2 2 8 I I I I I 94 high amino acid sequence conservation in the center and the carboxy terminal regions of the protein. The correspondence between the highly conserved regions and the functional aspects of the Lie protein, i.e. rRNA binding, autogenous control, interaction with peptidyl - tRNA at the P site and indirect interaction with the GTPase domain, is unknown. The L10e proteins from all three urkingdoms are colinear, although the eubacterial protein is half the size of its archaebacterial and eucaryotic homologues. The archaebacterial and eucaryotic proteins contain approximately three fourths of a copy of the archaebacterial - eucaryotic type L12e protein (including the module, the flexible hinge region and the high charge density region) fused to their carboxy termini. The module which contains a putative dimerization site has been duplicated in the eucaryotic and triplicated in the archaebacterial proteins. The eubacterial protein has suffered a large internal deletion, retains one intact and one partial copy of the module and the flexible hinge and high charge density domains are absent. The regions of the L10e protein responsible for binding to rRNA is unknown but likely to be in the amino terminal domain common to all the proteins. The L12e proteins are not colinear, the eubacterial protein having suffered substantial alterations. The archaebacterial L12e protein is composed of a globular domain containing a copy of the 26 residue long module, a flexible alanine - proline rich hinge and the charged carboxy terminus. The eucaryotic proteins are very similar to their archaebacterial homologues: there exist two types of L12e protein; an L12e type I which is similar to the archaebacterial L12e and a type II which differs in the globular domain. The eubacterial L12e protein has a globular domain responsible for translation factor interactions and containing sites utilized for dimerization and anion binding. In contrast to the archaebacterial and eucaryotic proteins the hinge has been relocated to the amino terminal side of the globular domain and the charged domain is absent. The amino terminal end, responsible for dimerization of the L12e proteins and binding to the L10e protein, is partially derived from a module. 95 Part 5: 'Evolution of the GTPase Domain 5.1 Evolution of the GTPase Domain Although all extant organisms display clustering (and cotranscription) of the 16S / 18S and 23S / 28S rRNA genes, ancient clustering of translated genes is evidenced only by the archaebacteria and eubacteria, where gene clusters corresponding to the 'RIP, 'STR', 'S10' and 'SPC ribosomal protein and the (3 / P' RNA polymerase subunit operons of E. coli have now been identified (Auer et al., 1989; Letters et al., 1989; Puhler etal., 1989; Shimmin and Dennis, 1989; Ramirez et al., 1990a). The L11e, Lie, L10e and L12e ribosomal proteins are conserved in all three extant urkingdoms and thus must have evolved before the existence of the last common ancestral state (the progenote) and more probably during the initial development of the translation apparatus. The functional, structural and sequence similarity data evidenced by the L11e, Lie, L10e and L12e proteins presented in this thesis suggest that the archaebacteria are a coherent phylogenetic group more similar to each other than to either eubacteria or eucaryotes. Amino acid sequence identity in the protein alignments indicate that there is always higher identity within the deep divergence of the thermoacidophilic (represented by S. solfataricus ) and methanogenic / halophilic (represented by H. cutirubrum ) branches of the archaebacteria than between the archaebacteria and either eucaryota or eubacteria. Furthermore, as illustrated by the line diagrams of Figures 15,16,17 and 19, the interruptions in the two archaebacterial proteins (required to maintain amino acid alignment with the eubacterial and eucaryotic proteins) are almost always at identical positions. In many cases the positions of these archaebacterial interruptions are unique to archaebacteria and therefore probably represent deletion or insertion events that took place after divergence of the archaebacteria from eubacteria and eucaryota. A number of the positions of archaebacterial interruptions are shared with eucaryota and few if any are shared with eubacteria. This is exemplified by the highly similar structure of the L10e and L12e proteins of eucaryota and archaebacteria as compared to eubacteria (Figure 21). This may mean either that the archaebacteria and eucaryota are more closely related to each other than to eubacteria or that a plethora of rearrangements in the genes encoding these proteins occurred in the very early eubacterial lineage following its divergence from the archaebacteria and eucaryota. 96 5.2 Model of the Evolution of the LlOe and Ll2e Genes and Proteins Functional, structural and sequence similarity information all indicate that the genes encoding the contemporary L10e and L12e proteins were derived from single ancestral genes present in the common primordial ancestor. During evolution these genes have undergone numerous alterations and rearrangements within the progenote and in the independent lines of descent to produce a variety of products (Figure 21). By recognizing common and conserved features in.the proteins encoded by these genes, it is possible not only to suggest a structure for the ancestral genes but also to construct a model that integrates the hypothetical genetic and structural evolution of the L1 Oe and L12e genes and proteins in eucaryota, archaebacteria, and eubacteria (Figure 22). It is postulated that initially (in the preprogenote or progenote state) there existed a single ancestral L10e protein at least 210 amino acids long that lacked the modular sequence and the highly charged carboxy terminus and a single ancestral L12e gene composed of an amino terminal globular domain and highly charged carboxy terminus separated by a flexible hinge (i.e. structurally similar to the archaebacterial and eucaryotic L12e proteins). The highly charged moiety and conserved hydrophobic residues of the carboxy terminus of the L12e type proteins may have been responsible for or facilitated the binding to the L10e protein and / or the dimerization of the L12e protein. Duplication of the L12e gene (presumably to ensure the elevated stoichiometry of the L12e dimer(s) in the ribosome) and subsequent divergence produced the type I and type II genes found in contemporary eucaryotes; the type II gene was possibly lost during the formation of the L11e - Lie - L10e - L12e gene cluster and development of translational enhancement of the L12e gene in the archaebacterial and eubacterial lineages. A further duplication of the L12e type I gene provided an extra copy for the gene fusion event which created a splice between L10e and one of the copies of L12e; the fusion junction was possibly immediately preceding the conserved basic residue at position 8 of Figure 20 where the intron occurs in the See L12ellB gene. This fusion would have facilitated the autoassociation of the LlOe' - L12e complex. In addition, if the module contains a dimerization site as has been suggested, this would allow specific targeting of the globular domain of the L12e protein to the fusion protein. Duplication of the module within the L10e gene results in the present eucaryotic state and a second module duplication produced the contemporary archaebacterial state. 97 Figure 22 Model of the Evolution of the LlOe and L12e Genes and Proteins Illustrated is a model to explain how simple rearrangements might explain the evolutionary divergence and contemporary relationships between eubacterial, archaebacterial and eucaryotic L10e and L12e genes and proteins. The genes and proteins are illustrated sinister and dexter respectively. The stages and intermediates are illustrated from A to H: (A), L10e and L12e gene structures in the progenote. The binding of the L12e carboxy terminus to the L10e protein is illustrated with a filled circle (•). For clarity only a single L12e protein is illustrated and the globular domain is shown folded to indicate the compactness of this domain. (B), Duplication of the L12e and divergence resulting in the L12e type I and II genes. A further duplication results in 2 copies of L12e type I. (C), a deletion fuses the 3' portion of an L12e type I gene copy to the L10e gene. (D), duplication within the L10e - L12e fusion gene of a 26 codon long module originally from the L12e gene sequence results in the contemporary eucaryotic state. (E), a second duplication of the module within L10e, loss of the L12e type II gene results in the contemporary archaebacterial state. (F), the eubacterial state may have arisen from either the eucaryotic or archaebacterial states; for simplicity only descent from the archaebacterial state is illustrated. Within the eubacterial line translation stop and start codons are generated within the fusion gene to produce two separate and nonoverlapping open reading frames. Part of the distal module is lost. The smaller ORF, designated 'L12e, remains bound to the truncated L10e through the carboxy terminus and also the partial module. (G), 'L12e is fused by deletion with the second copy of the ancestral L12e gene to produce a 'L12e - L12e hybrid containing two L10e binding sites and two hinges. (H), generation of a translation termination codon or a carboxy terminal deletion truncates the 'L12e - L12e fusion to the contemporary eubacterial L12e state. In this gene the proximal and distal regions encoding the amino terminus and the carboxy domain exhibit a degree of sequence similarity and the hinge is relocated. Binding of the L12e protein to the L10e protein is now only through the amino terminus. A deletion within the L10e gene generates the contemporary eubacterial L10e gene. flnCESTRRL LlOe R n C E S T R R L L12e GLOBULAR DOMAIN 1 1 | HINGE NODULE J EUCRRYOTIC STATE DUPLICATION AMD 01UEAGEHCE I I LIO. - LI2aI FUSION MODULE DUPLICATION I T 3 kWI lm MODULE DUPLICATION FOAtlATION OF THE L11 a. L i e , LlOe AND LI2e GENE CLUSTER RRCHREBRCTERIRL STRTE LOSS OF L 1 2 e l l L1 2a CO CD LlOe L12e ARCHAEBRCTEA1AL STATE I I TERRIHflTIOM flTO a n •Lt2« - L12a FUSION LIO* DELETION I TERM IHRT1 ON OR DELETION I EUBACTERIAL STATE LlOe L12e ( E ) ( F ) ( 0 ) (H) L I O . L U . CD CO 100 At this point the eubacteria diverged trom the archaebacteria and eucaryotes. If the 12 amino acid partial Eco L10 (3 module is real then the eubacterial L10e protein probably evolved from a three module ancestor, if the match is fortuitous then evolution may have occurred from a two module ancestor. The eucaryotic L10e state of two modules may have arisen from deletion of a module from the three module archaebacterial L10e state. Thus it is impossible to determine the branching order of eubacteria, archaebacteria and eucaryota from the present data. For simplicity the derivation of the eubacterial state is described as if arising from a three module L10e ancestor. Four additional steps are required to achieve the contemporary eubacterial state. First, within the L10e fusion gene a translation start site is generated in the y module and a translation stop is generated upstream at the 3' end of the (J module resulting in production of a short 'L12e peptide. This short peptide remains associated with the L10e protein through its carboxy terminus and through the partial module binding to the remaining two modules of the L10e protein. Second, fusion of the 'L12e gene to the L12e gene removing the unique carboxy terminal end of the *L12e protein and preserving the functional factor binding globular domain in the L12e protein. This results in a 'L12e - L12e fusion protein associated with the L10e protein through two flexible hinge regions. Third, the deletion or termination of the unique carboxy terminal sequence of the 'L12e - L12e protein leaving the present eubacterial L12e state. The L12e protein binds to L10e through the partial module of its amino terminus. The modern L12e of eubacteria have ragged amino terminal ends, starting between positions 1 and 8 on Figure 18. This may represent fine tuning of the amino terminal binding domain during the evolution of the primary eubacterial lineages. Finally, an internal deletion in L10e (possibly removing the now redundant carboxy terminal binding site) resulting in the shortened contemporary eubacterial LlOe gene. A number of previously published models of the interkingdom relationships of the structural and functional features of the L12e proteins have considered the evolution of the L12e genes (and proteins) in isolation. This has resulted in an enigma: a perplexing series of alignments derived from a variety of sequence and structural criteria, some of which are equally meritorious but apparently mutually exclusive. Alignments based on duplications (Amons era/., 1979; Jue et al., 1980), linear correspondence (Yaguchi etal., 1980; Wittmann-Liebold, 1985), transpositions (Lin et al., 1982; Otaka etal., 1985; Matheson, 1985), and conservation of structural features (Liljas et al., 1986) have been proposed. All of these 101 alignments consider the evolution of the L12e gene (and protein) in isolation. The interkingdom alignments, structural and functional features and evolution of the L12e genes (and proteins) have been considered in concert with those of the related L10e genes (and proteins). The most likely evolutionary events are those which preserve the structure and function of the L10e - L12e complex and the alignments presented for the L10e, L12e and interprotein relationship between the L10e and L12e proteins permits preservation of the structure and function of the complex and resolves some of the enigmatic features of the previous models presented for evolution of the L12e protein. The sheer variety of different alignments yielding approximately equivalent sequence similarities suggests that the Ll2e protein originally arose from duplications of a shorter peptide sequence; Jue etal. (1980) have suggested that the eubacterial L12e protein is derived from a quadruplication of a 30 amino acid long peptide. Although this does not take into account the now known structural features of the L12e protein (domains and hinge) it is interesting to note that the third peptide corresponds fairly well to the module. Amons et al. (1979) have suggested duplication of the eubacterial gene giving rise to the archaebacterial - eucaryotic gene. However, the presence of the unique highly charged carboxy terminus of the archaebacterial - eucaryotic protein makes this derivation unlikely in my view. An end to end linear alignment of all L12e proteins suggested by Wittmann-Liebold (1985) results in very low sequence similarity (typically 18% interkingdom similarity) and fails to conserve structural features (e.g. the hinge). Yaguchi et al. (1980) first proposed the alignment that conserves the unique arginine residue (position 117, Figure 18) and preserves the factor interacting globular domain. However, their alignment of the globular domain is based only on the E. coli and H. cutirubrum sequences and differs from that presented in Figure 18 in the region immediately after the arginine residue, where they introduce a 9 amino acid gap in the H. cutirubrum archaebacterial - eucaryotic Ll2e type protein. This gap would eliminate most of the putative dimerization site in the archaebacterial and eucaryotic L10e and L12e modules. Lin etal. (1982) and Otaka et al. (1985) have aligned the amino terminus of Eco L12 to the region of the 28th to 34th residue (positions 103-113, Figure 18) of the archaebacterial and eucaryotic type I L12e proteins. Their alignment puts the entire amino terminus of the eubacterial L12e protein within the highly ' 102 conserved region of the module. They have considered the evolution of the L12e protein in isolation and thus have forced a one to one correspondence between the eubacterial and archaebacterial - eucaryotic proteins by transposing the 36 residues of the amino terminal end of the archaebacterial - eucaryotic protein to the carboxy terminus of the eubacterial protein. This would mean that the globular factor binding domain of the eubacterial protein would have to be derived from the fusion of the unique highly charged carboxy terminal domain of the archaebacterial - eucaryotic protein and its amino terminus. The generation of this extremely compact functional domain by such means appears unlikely. Matheson (1985) has proposed an alignment conserving the unique arginine but transposing the central 35 amino acids of the archaebacterial - eucaryotic protein to the amino terminus to yield the eubacterial protein. The globular factor binding domain of eubacterial L12e would have to be derived from the fusion of the amino terminus and the unique highly charged carboxy terminus of the archaebacterial - eucaryotic protein. As for the previous transposition model this is unlikely. Liljas et al. (1986) has suggested that the amino terminal end of the archaebacterial - eucaryotic protein represents the factor binding domain and the hydrophobic extreme carboxy terminus represents the binding site to the L10e protein; the two domains being separated by the alanine - proline rich hinge structure. The structure of the archaebacterial - eucaryotic L12e would correspond to an inverted eubacterial L12e structure. The crystal structure of the Eco L12 globular domain has its ends in close spatial proximity; thus the conversion of the L10e binding site from the archaebacterial - eucaryotic carboxy terminus to the eubacterial amino terminus necessitates only a small shift in the joining of the hinge from one end to the other end of the globular domain. The eucaryotic L12e proteins have more sequence on the carboxy end of the common globular domain (approximate positions 144 - 153, Figure 18) than the archaebacterial L12e proteins. The alignment would suggest that this is part of the ancestral globular domain and thus the actual spatial proximity of the amino and carboxy termini of the globular domains is unknown. The alignment of Liljas et al. was based on secondary structure prediction and has 22% identities at the amino acid level. The amino acid secondary structure of L12e proteins tends to be difficult to accurately predict, the proposed alignment of Figure 18 fits such predictions as well as their previous model, particularly over the module region. In their model the dimerization site of Eco L12 aligns to the beginning and therefore the unconserved portion of the L10e modules; the highly conserved 103 central region of the modules aligns to a region in eubacterial L12e proteins that is less well conserved. The alignment illustrated in Figure 18 shifts the start of the globular domain alignment by 15 amino acid residues (from position 75 to position 90, Figure 18) and achieves both higher sequence similarity (28%) and alignment of the dimerization site of L12e with the conserved region of the L10e protein modules. The structural proposal of Liljas et al. (1986) appears to be fundamentally correct and is preserved in the alignment illustrated in Figure 18. Although virtually all of these derivations of the eubacterial L12e protein are possible by varying the positions of the fusion, deletion and termination events in the proposed model (Figure 22), the most likely evolutionary events are those which preserve the structure and function of the L10e - L12e complex. The proposed model always retains an L12e protein that has a potential L10e binding site and a preserved functional globular domain separated by a hinge. The previous models do not retain all of these features. 5.3 Future Prospects A number of archaebacterial genes involved in transcription, translation and metabolism have now been characterized and the forefront of research on the molecular biology of archaebacteria is now focussing on cellular processes, especially by analysis in vivo. Recently the development of a transformation system for Haloferax volcanii utilizing a shuttle vector capable of propagation and selection (mevinolin resistance) in both E. coli and H. volcanii and the demonstration of homologous recombination in H.volcanii has made such in vivo genetic studies possible for the halophilic archaebacteria (Charlebois etal., 1987; Cline etal., 1989; Lam and Doolittle, 1989). As nothing is known in archaebacteria concerning the functional importance of specific nucleotides within (or surrounding) consensus signal sequences, the fir§t objective of future research on the molecular biology of the GTPase domain will be directed toward elucidation of i) the regions (and bases) important in the promotion and termination of transcription, ii) the interaction of the ribosome at the translation initiation site and iii) the autogenous regulation within a ribosomal protein gene cluster. The gene cluster characterized in this thesis serves as a source of five promotors of widely differing (i.e. 500 fold) efficiency, four terminators, eight translational initiation sites and the Lie autogenous regulatory site, -104 all of which can be modified by deletion or site directed mutagenesis and analysed in vivo by transformation into H. volcanii. The second objective is investigation of the structure to function relationships within and between the GTPase domain proteins, especially of the various unique and duplicated domains present within the L10e and L12e proteins of all urkingdoms. The domains of these proteins can be converted into cassettes bounded by restriction sites and hybrid proteins composed of various wild type and mutagenized domains from all urkingdoms can be constructed and transformed into various hosts to elucidate the functionality of the domains of the recombinant proteins. The composition, structure and evolution of the progenote ribosome and the subsequent evolutionary divergence into the urkingdoms will be better understood upon completion of the projects characterizing the entire repertory of ribosomal proteins for the archaebacterium Halobacterium marismortui and the eucaryote Saccharomyces cerevisiae (Otaka et al., 1984; Kimura etal., 1989). Characterization of the GTPase domain genes of the organisms representing the earliest eubacterial branch (Thermotoga maritima ), archaebacterial branch (Thermococcus celer) and eucaryotic branch {Giardia lamblia), also presently underway, should yield insights into the early evolution of the GTPase domain. The GTPase domain genes are extremely ancient, their evolution occurring in a series of discrete steps over the interval from the preprogenote state, through the primary speciation event giving rise to the urkingdoms and extending well into the main eubacterial lineages. The evolution of the L10e and L12e proteins exhibits a series of discrete alterations over the interval of contention between the phylogenetic trees of Woese, Cavalier - Smith and Lake, that is, during the primary speciation event giving rise to the urkingdoms (Woese and Olsen, 1986; Cavalier - Smith, 1987; Lake, 1988). A discrete phylogenetic tree of the evolution of the translation apparatus may eventually be constructed over the contentious time span if during this time a sufficient number of ribosomal proteins either first appeared or share the complex alterations exhibited by the GTPase domain proteins. 105 References Amons, R., Pluijms, W. and Moller, W. (1979) The primary structure of ribosomal protein eL12 / eL12 - P from Artemia salina 80S ribosomes. FEBS Letters 104:85 - 89. Amons, R., Pluijms, W., Kriek, T. and Moller, W. (1982) The primary structure of protein eL12' / eL12* - P from the large subunit of Artemia salina ribosomes. FEBS Letters 146:143-147. Atkinson, T. and Smith, M. (1984) Solid phase synthesis of oligodeoxyribonucleotides by the phosphite - triester method. In Oligonucleotide Synthesis. A Practical Approach. Edited by Gait, M.J. IRL Press, Oxford / Washington, pp. 35 - 81. Auer, J . , Lechner, K. and Bock, A. (1989) Gene organization and structure of two transcriptional units from Methanococcus coding for ribosomal proteins and elongation factors. Can. J. Microbiol. 35: 200 - 204. Auffray, C. and Rougesn, F. (1980) Purification of mouse immunoglobulin heavy - chain messenger RNAs from total myeloma tumor RNA. Eur. J. Biochem. 107:303 - 314. Barry, G., Squires, C. and Squires, C.L. (1979) Control features within the rplKAJL-rpoBC transcription unit of Escherichia coli. Proc. Natl. Acad. Sci. USA 76:4922 - 4926. Barry, G., Squires, C.L. and Squires, C. (1980) Attenuation and processing of RNA from the rplJL-rpoBC transcription unit of Escherichia coli. Proc. Natl. Acad. Sci. USA 77:3331 - 3335. Bartsch, M., Kimura, M. and Subramanian, A.R. (1982) Purification, primary structure, and homology relationships of a chloroplast ribosomal protein. Proc. Natl. Acad. Sci. USA 79:6871 - 6875. Baughman, G. and Nomura, M. (1983) Localization of the target site for translational regulation of the L11 operon and direct evidence for translational coupling in Escherichia coli. Cell 34: 979 - 988. Bayley, S.T. (1966) Composition of ribosomes of an extremely halophilic bacterium. J. Mol. Biol. 15: 420 - 427. Bayley, S.T. (1971) Protein synthesis systems from halophilic bacteria. In Protein Biosynthesis in Bacterial Systems. Edited by Last, J.A. and Laskin, A.I. Marcel Dekker, New York, pp. 89-110. Bayley, S.T. and Kushner, D.J. (1964) The ribosomes of the extremely halophilic bacterium, Halobacterium cutirubrum. J. Mol. Biol. 9: 654 - 669. Bayley, S.T. and Morton, R.A. (1978) Recent developments in the molecular biology of extremely halophilic bacteria. CRC Crit. Rev. Microbiol. 6:151 - 205. Beauclerk, A.A.D., Cundliffe, E. and Dijk, J . (1984) The binding site for ribosomal protein complex L8 within 23S ribosomal RNA of Escherichia coli. J. Biol. Chem. 259: 6559 - 6563. Beauclerk, A.A.D., Hummel, H., Holmes, D.J., Bock, A. and Cundliffe, E. (1985) Studies of the GTPase domain of archaebacterial ribosomes. Eur. J. Biochem. 151:245-255. Beltrame, M. and Bianche, M.E. (1987) Sequence of the cDNA for one acidic ribosomal protein of Schizosaccharomyces pombe. Nucleic Acids Res. 15:9089. Betlach, M., Friedman, J. , Boyer, H.W. and Pfeifer, F. (1984) Characterization of a halobacterial gene affecting bacterio - opsin gene expression. Nucleic Acids Res. 12: 7949 - 7959. Betlach, M., Shand, R. and Leong, D. (1989) Regulation of the bacterio - opsin gene of a halophilic archaebacterium. Can. J. Micro. 35:134- 140. Betlach, M.C., Leong, D. and Boyer, H.W. (1986) Bacterio - opsin gene expression in Halobacterium halobium. Syst. Appl. Microbiol. 7:83-91. 106 Biggin, M.D., Gison, T.J. and Hong, G.F. (1983) Buffer gradient gels and 35S label as an aid to rapid DNA sequence determination. Proc. Natl. Acad. Sci. USA 80:3963 - 3965. Birnboim, H.C. and Doly, J . (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513 - 1523. Blanck, A. and Oesterhelt, D. (1987) The halo - opsin gene. 2. Sequence, primary structure of halorhodopsin and comparison with bacteriorhodopsin. EMBO Journal 6: 265 - 273. Boissy, R. and Astell, C.R. (1985) An Escherichia coli recBCsbcBrecF host permits the deletion - resistant propagation of plasmid clones containing the 5'-terminal palindrome of minute virus of mice. Gene 35: 179-185. Bolivar, F., Rodriguez, R.L., Greene, P.J., Betlach, M.C., Heynecker, H.L., Boyer, H.W., Crosa, J.H. and Falkow, S. (1977) Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2:95 -113. Branlant, C , Krol, A., Machatt, A. and Ebel, J.P. (1981) The secondary structure of the protein L1 binding region of the ribosomal 23S RNA: homologies with putative secondary structures of the L11 mRNA and of a region of mitochondrial 16S rRNA. Nucleic Acids Res. 9:293 - 307. Brown, J.W., Thomm, M., Beckler, G.S., Frey, G., Stetter, K.O. and Reeve, J.N. (1988) An archaebacterial RNA polymerase binding site and transcription initiation of the hisA gene in Methanococcus vanielii. Nucleic Acids Res. 16:135 - 150. Burma, D.P., Srivastava, S., Srivastava, A.K., Mahanti, S. and Dash, D. (1986) Conformational change of 50S ribosomes during protein synthesis. In Structure, Function and Genetics of Ribosomes. Edited by Hardesty, B. and Kramer, G. Springer Verlag, New York, pp. 438 - 453. Cavalier - Smith, T. (1986) The kingdoms of organisms. Nature 324:416-417. Cavalier - Smith, T. (1987) The origin of the eucaryote and archaebacterial cells. Ann. NY Acad. Sci. 503: 17 - 54. Chant, J . and Dennis, P.P. (1986) Archaebacteria: transcription and processing of ribosomal RNA sequences in Halobacterium cutirubrum. EMBO Journal 5:1091 - 1097. Chant, J.S., Hui, I., de Jong-Wong, D., Shimmin, L.C. and Dennis, P.P. (1986) The protein synthesizing machinery of the archaebacterium Halobacterium cutirubrum: molecular characterization. System. Appl. Microbiol. 7:106 -114. Charlebois, R.L. and Doolittle, W.F. (1988) Transposable elements and genomic structure in Halobacteria. In Mobile DNA. Edited by Howe, M. and Beng, D. American Society for Microbiology, Washington, D.C, pp. 297 - 307. Charlebois, R.L., Lam, W.L., Cline, S.W. and Doolittle, W.F. (1987) Characterization of pHV2 from Halobacterium volcanii and its use in demonstrating transformation of an archaebacterium. Proc. Natl. Acad. Sci. USA 84: 8530 - 8534. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294 - 5299. Christensen, T., Johnsen, M., Fiil, N.P. and Friesen, J.D. (1984) RNA secondary structure and translation inhibition: analysis of mutants in the rplJ leader. EMBO Journal 3:1609 - 1612. Cline, S.W., Lam, W.L., Charlebois, R.L., Schalkwyk, L.C. and Doolittle, W.F. (1989) Transformation methods for halophilic archaebacteria. Can. J. Microbiol. 35: 148 - 152. Cowgill, C.A., Nichols, B.G., Kenny, J.W., Butler, P., Bradbury, E.M. and Traut, R.R. (1984) Mobile domains in ribosomes revealed by proton nuclear magnetic resonance. J. Biol. Chem. 259: 15257 - 15263. 107 Cram, D.S., Sherf, B.A., Libby, R.T., Mattaliano, R.J., Ramachandran, K.L and Reeve, J.N. (1987) Structure and expression of the genes, mcrBDCGA, which encode the subunits of component C of methyl coenzyme M reductase in Methanococcus vanielii. Proc. Natl. Acad. Sci. USA 84: 3992 - 3996. Cue, D., Beckler, G.S., Reeves, J.N. and Konisky, J. (1985) Structure and sequence divergence of two archaebacterial genes. Proc. Natl. Acad. Sci. USA 82: 4207 - 4211. Cundliffe, E. (1986) Involvement of specific portions of ribosomal RNA in defined ribosomal functions: a study utilizing antibiotics. In Structure, Function and Genetics of Ribosomes. Edited by Hardesty, B. and Kramer, G. Springer Verlag, New York, pp. 586 - 604. Dale, R.M.K., McClure, B.A. and Houchins, J.P. (1985) A rapid single - stranded cloning strategy for producing a sequential series of overlapping clones for use in DNA sequencing: application to sequencing the corn mitochondrial 18S rDNA. Plasmid 13:31 - 40. Daniels, C.J. , Douglas, S.E. and Doolittle, W.F. (1986) Genes for transfer RNAs in Halobacterium halobium. Syst. Appl. Microbiol. 7:26-29. Danson, M.J. (1989) Central metabolism of the archaebacteria: an overview. Can. J. Microbiol. 35:58- 64. Das Sarma, S., Damerval, T. and de Marsac, N.T. (1987) A plasmid-encoded gas vesicle gene in halophilic archaebacterium. Mol. Microbiol. 1:365 - 370 Dayhoff, M. (1978) Atlas of Protein Sequence and Structure, 8th Edition. MacGregor and Warner, Silver Springs, Maryland, pp. 352 - 375. Dean, D. and Nomura, M. (1980) Feedback regulation of ribosomal protein gene expression in Escherichia coli. Proc. Natl. Acad. Sci. USA 77: 3590 - 3594. Deng, H., Odom, O.W. and Hardesty, B. (1986) Localization of L11 on the E. coli ribosome by singlet- singlet energy transfer. Eur. J. Biochem. 156: 497 - 503. Dennis, P.P. (1977) Transcription patterns of adjacent segments on the chromosome of E. coli containing genes coding for four 50S ribosomal proteins and the P and P ' subunits of RNA polymerase. J. Mol. Biol. 115: 603 - 625. Dennis, P.P. (1984) Site specific deletions of regulatory sequences in a ribosomal protein - RNA polymerase operon in Escherichia coli. J. Biol. Chem. 259:3202 - 3209. Dennis, P.P. (1985) ' Multiple promotors for the transcription of the ribosomal RNA gene cluster in Halobacterium cutirubrum. J. Mol. Biol. 186:457 - 461. Dennis, P.P., Hui, I., Shimmin, L . C , McPherson, J . , Pao, C C . and Matheson, A.T. (1985) Archaebacteria: our first look at their ribosome component genes. In The Molecular Biology of Bacterial Growth. Edited by Schaechter, M., Neidhardt, F . C , Ingraham, J.L. and Kjeldgaard, N.O. Jones and Bartlett Publishers, Inc., Boston, pp.78 - 91. Dente, L., Cesareni, G. and Cortese, R. (1983) pEMBL: a new family of single stranded plasmids. Nucleic Acids Res. 6: 1645 - 1655. Dijk, J. , Garrett, R.A. and Muller, R. (1979) Studies on the binding of the ribosomal protein complex L7/L12-L10 and protein L11 to the end one third of the 23S RNA: a functional center of the 50S subunit. Nucleic Acids Res. 6: 2717 - 2729. Dognin, W.L. and Wittman-Liebold, B. (1977) The primary structure of L11, the most heavily methylated protein from Escherichia coli ribosomes. FEBS Letters 84: 342 - 346. 108 Duggleby, R.G., Kaplan, H. and Visentin, L.P. (1975) Carboxy - terminal sequences of procaryotic ribosomal proteins from Escherichia coli. Bacillus stearothermophilus, and Halobacterium cutirubrum. Can J. Biochem. 53: 827 - 833. Dunn, R., McCoy, J . , Simsek, M., Majumdar, A., Chang, S.H., RajBhandary, U.L. and Khorana, H.G. (1981) The bacteriorhodopsin gene. Proc. Natl. Acad. Sci. USA 78: 6744 - 6748. Eisenberg, H. and Wachtel, E.J. (1987) Structural studies of halophilic proteins, ribosomes and organelles of bacteria adapted to extreme salt concentrations. Ann. Rev. Biophys. Chem. 16: 69 - 92. El-Baradi, T.T.A.L., de Regt, C.H.F., Einerhand, S.W.C., Teixido, J. , Planta, R.J., Ballesta, J.P.G. and Raue, H.A. (1987) Ribosomal proteins EL11 from Escherichia coli and L15 from Saccharomyces cerevisiae bind to the same site in both yeast 26S and mouse 28S rRNA. J. Mol. Biol. 195: 909 - 917. Falkenberg, P., Yaguchi, M., Roy, C , Zuker, M. and Matheson, A T . (1985) The primary structure of the ribosomal A-protein (L12) from the moderate halophile NRCC 41227. Biochem. Cell Biol. 64: 675 - 680. Favaloro, J . , Treisman, R. and Kamen, R. (1980) Transcription maps of polyoma virus-specific RNA: analysis by two dimensional nuclease S1 gel mapping. Methods in Enzymology 65: 718 - 749. Fienberg, A.P. and Vogelstein, B. (1982) A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6 -13. Fiil, N.P., Friesen, J.D., Downing, W.D. and Dennis, P.P. (1980) Post-transcriptional regulatory mutants in a ribosomal protein - RNA polymerase operon of E. coli. Cell 19:837 - 844. Fox, G.E., Stackebrandt, E., Hespell, R.B., Gibson, J . , Maniloff, J . , Dyer, T.A., Wolfe, R.S., Balch, W.E., Tanner, R.S., Magrum, L.J., Zablen, L.B., Blakemore, R., Gupta, R., Bonen, L., Lewis, B.J., Stahl, D.A., Luersen, K.R., Chan, K.N. and Woese, C.R. (1980) The phylogeny of prokaryotes. Science 209 : 457 - 463. Freisen, J.D., Fiil, N.P., Parker, J.M. and Hasettine, W.A. (1974) A new relaxed mutant of Escherichia coli with an altered 50S ribosomal subunit. Proc. Natl. Acad. Sci. USA 71: 3465 - 3469. Garland, W.G., Louie, K.A., Matheson, A.T. and Liljas, A. (1987) The complete amino acid sequence of the ribosomal 'A' protein (L12) from Bacillus stearothermophilus. FEBS Letters 220:43 - 46. Ganett, R.A. (1985) The uniqueness of archaebacteria. Nature 318:233-235. Giri, L., Dijk, J. , Labischinski, H. and Bradaczek, H. (1978) Shape of protein L11 from the 50S ribosomal subunit of Escherichia coli. Biochemistry 17: 745 - 749. Gourse, R.L., Thurlow, D.L., Gerbi, S.A. and Zimmerman, R.A. (1981) Specific binding of a prokaryotic ribosomal protein to a eukaryotic ribosomal RNA: implications for evolution and autoregulation. Proc. Natl. Acad. Sci. USA 78: 2722 - 2726. Gouy, M. and Li, W. - H. (1989) Phylogenetic analysis based on rRNA sequences supports the archaebacterial rather than the eocyte tree. Nature 339:145 - 147. Gudkov, A T . and Behlke, J . (1978) The N - terminal sequence of L7/L12 is responsible for its dimerization. Eur. J. Biochem. 90: 309 - 312. Gudkov, A T . and Gongadze, G.M. (1984) The L7/L12 proteins change their conformation upon interaction of EF-G with ribosomes. FEBS Letters 176: 32 - 36. Gudkov, AT . , Venyaminov, S.Y. and Matheson, A T . (1984) Physical studies on the ribosomal "A" protein from two archaebacteria, Halobacterium cutirubrum and Methanobacterium thermoautotrophicum. Can. J. Biochem. Cell Biol. 62: 44 - 48. 109 Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557 - 580. Hanauz, G., Stoffler-Melicke, M. and van Heel, U. (1987) Characteristic views of prokaryotic 50S ribosomal subunits. J. Mol. Evol. 28: 347 - 357. Hattori, M. and Sakaki, Y. (1986) Dideoxy sequencing method using denatured plasmid templates. Anal. Biochem. 152: 232 - 238. Henikoff, S. (1984) Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28: 351 - 359. Hori, H., Itoh, T. and Osawa, S. (1982) The phylogenetic structure of the metabacteria. Zbl. Bakt. Hyg., I. Abt. Orig. C3:18-30. Home, M., Englest, C. and Pfeifer, F. (1988) Two gas vacuole proteins in Halobacterium halobium. Mol. Gen. Genet. 213: 459 - 464. Hui, I. and Dennis, P.P. (1985) Characterization of the ribosomal RNA gene clusters in Halobacterium cutirubrum. J. Biol. Chem. 260: 899 - 906. Itoh, T. (1981a) Primary structure of an acidic ribosomal protein from Micrococcus lysodeikticus. FEBS Letters 127: 67 - 70. Itoh, T. (1981b) Primary structure of an acidic ribosomal protein YPA1 from Saccharomyces cerevisiae. Isolation and characterization of peptides and the complete amino acid sequence. Biochim. Biophys. Acta 671: 16-24. Itoh, T. (1988) Complete nucleotide sequence of the ribosomal 'A' protein operon from the archaebacterium Halobacterium halobium. Eur. J. Biochem. 176: 297 - 303. Itoh, T. and Higo, K.I. (1983) Complete amino acid sequence of an L7/L12-type ribosomal protein from Rhodopseudomonas spheroides. Biochim. Biophys. Acta 744: 105 - 109. Itoh, T. and Wittman-Liebold, B. (1978) The primary structure of Bacillus subtilis acidic ribosomal protein B-L9 and its comparison with Escherichia coli proteins L7/L12. FEBS Letters 96: 392 - 394. Itoh, T., Kamazaki, T., Sugiyama, M. and Otaka, E. (1988) Molecular cloning and sequence analysis of the ribosomal 'A' protein gene from the archaebacterium, Halobacterium halobium. Biochim. Biophys. Acta 949: 110 - 118. Itoh, T., Sugiyama, M. and Higo, K.I. (1982) The primary structure of an acidic ribosomal protein from Streptomyces griseus. Biochim. Biophys. Acta 701:164 - 172. Jinks-Robertson, S. and Nomura, M. (1987) Ribosomes and tRNA. In Escherichia coli and Salmonella typhimurium; Cellular and Molecular Biology, Vol. 2. Edited by Neidhardt, F.C. American Society for Microbiology, Washington D.C, pp. 1358 - 1385. Johnsen, M., Christiensen, T., Dennis, P.P. and Fiil, N.P. (1982) Autogenous control: ribosomal protein L10-L12 complex binds to the leader of its mRNA. EMBO Journal 1: 999 - 1004. Jones, W.J., Nagle Jr., D.P. and Wittmann, W.B. (1987) Methanogens and the diversity of archaebacteria. Microbiol. Rev. 51:135 - 177. Jue, R.A., Woodbury, N.W. and Doolittle, R.F. (1980) Sequence homologies among E. coli ribosomal proteins: evidence for evolutionary related groupings and internal duplications. J. Mol. Evol. 15: 129 - 148. Kastner, B., Stoffler-Meilicke, M. and Stoffler, G. (1981) Arrangement of the subunits in the ribosome of Escherichia coli: demonstration by immunoelectron microscopy. Proc. Natl. Acad. Sci. USA 78: 6652 - 6656. 110 Kearney, K.R. and Nomura, M. (1987) Secondary structure of the autoregulatory mRNA binding site of ribosomal protein L1. Mol. Gen. Genet. 210: 609 - 618. Kimura, M., Arndt, E., Hatakeyama, T., Hatekeyama, T. and Kimura, J . (1989) Ribosomal proteins in halobacteria. Can. J. Microbiol. 35:195 - 199. Kimura, M., Kimura, J . and Ashman, K. (1985) The complete primary structure of ribosomal proteins L1, L14, L15, L23, L24 and L29 from Bacillus stearothermophilus. Eur. J. Biochem. 150: 491 - 497. Kjems, J . and Garrett, R.A. (1987) Novel expression of the ribosomal RNA genes in the extreme thermophile and archaebacterium Desulfurococcus mobilis. EMBO Journal 6:3521 - 3530. Kopke, A.K.E., and Wittmann - Liebold, B. (1988) DNA sequence of the gene for ribosomal protein L23 from the archaebacterium Methanococcus vanielii. FEBS Letters 239:313 - 318. Kopke, A.K.E. and Wittmann - Liebold, B. (1989) Comparative studies of ribosomal proteins and their genes from Methanococcus vannielii and other organisms. Can. J. Microbiol. 35:11 - 20. Koteliansky, V.E., Domogatsky, S.P., and Gudkov, A T . (1978) Dimer state of protein L7/L12 and EF-G dependent reactions on ribosomes. Eur. J. Biochem. 90: 319 - 323. Kushner, D.J. (1985) The Halobacteriaciae. In The Bacteria. Vol. VIII. Edited by Woese, C.R. and Wolfe, R.S. Academic Press, New York, pp. 171-214. Lake, J.A. (1983a) Evolving ribosome structure: domains in archaebacteria, eubacteria, and eucaryotes. Cell 33:318 -319. Lake, J.A. (1983b) Ribosome evolution: the structural bases of protein synthesis in archaebacteria, eubacteria and eukaryotes. Prog, in Nucleic Acid Res. 30:163 - 194. Lake, J.A. (1986a) An alternative to archaebacterial dogma. Nature 319:626. Lake, J.A. (1986b) In defense of bacterial phylogeny. Nature 321: 657 - 658 Lake, J.A. (1988) Origin of the eucaryotic nucleus determined by rate-invarient analysis of rRNA sequences. Nature 331:184 - 186. Lake, J.A. and Strycharz, W.A. (1981) Ribosomal proteins L1, L17, L27 localized at single sites on the large subunit by immune electron microscopy. J. Mol. Biol. 153: 979 - 992. Lake, J.A., Henderson, E., Clarke, M.W., Scheinman, A. and Oakes, M.I. (1986) Mapping evolution with three dimensional ribosome structure. System. Appl. Microbiol. 7:131 -136. Lake, J.A., Henderson, E., Oakes, M. and Clark, M.W. (1984) Eocytes : a new ribosome structure indicates a kingdom with a close relationship to eukaryotes. Proc. Natl. Acad. Sci. USA 81: 3786 - 3790. Lam, W.L. and Doolittle, W.L. (1989) Shuttle vectors for the archaebacterium H. volcanii. Proc. Natl. Acad. Sci. USA 86: 5478 - 5482. Larsen, H. (1984) Family V. Halobacteriaceae. In Bergey's Manual of Systematic Bacteriology. Edited by Krieg, N.R. and Holt, J.G. Williams and Wilkins, Baltimore, pp. 261 - 267. Lederer, H. (1986) Archaebacterial status quo is defended. Nature 320: 220. Letters, H., Gropp, F., Lottspeich, F., Zillig, W. and Garret, R.A. (1989) Sequence, organization, transcription and evolution of RNA polymerase subunit genes from the archaebacterial extreme halophiles Halobacterium halobium and Halococcus morrhuae. J. Mol. Biol. 206:1 - 17. Leijonmarck, M. and Liljas, A. (1987) Structure of the C - terminal domain of the ribosomal protein L7/L12 from Escherichia coli at 1.7A. J. Mol. Biol. 195: 555 - 580. 111 Leijonmarck, M., Pettersson, I. and Liljas, A. (1981) Structural studies on the protein L7/L12 from E. coli ribosomes. In Structural Aspects of Recognition and Assembly in Biological Macromolecules. Edited by Balaban, M., Sussmann, J.L., Traub, W. and Yonath, A. ISS, Rehovot and Philadelphia, pp. 761 - 777. Leong, D., Boyer, H. and Betlach. M. (1988a) Transcription of genes involved in bacterio - opsin gene expression in mutants of a halophilic archaebacterium. J. Bacteriol. 170: 4910 - 4915. Leong, D., Pfeifer, F., Boyer, H. and Betlach. M. (1988b) Characterization of a second gene involved in bacterio - opsin gene expression in a halophilic archaebacterium. J. Bacteriol. 170:4903 - 4909. Liljas, A. (1982) Structural studies of ribosomes. Prog. Biophys. Mol. Biol. 40:161 -228. Liljas, A., Thirup, S. and Matheson, A T . (1986) Evolutionary aspects of ribosome - factor interactions. Chemica Scripta 26B: 109-119. Lin, A., Wittmann-Liebold, B., McNally, J . and Wool, I.G. (1982) The primary structure of the acidic phosphoprotein P2 from rat liver 60S ribosomal subunits. J. Biol. Chem. 257: 9189 - 9197. Lindahl, L. and Zengel, J. (1986) Ribosomal genes in Escherichia coli. Ann. Rev. Genet. 20:297-326. Lindahl, L., Jaskunas, S.R., Dennis, P.P. and Nomura, M. (1975) Cluster of genes in Escherichia coli for ribosomal proteins, ribosomal RNA and RNA polymerase. Proc. Natl. Acad. Sci. USA 72: 2743 - 2747. Lipman, D.J. and Pearson, W.R. (1985) Rapid and sensitive protein similarity searches. Science 227: 1435 - 1441. Ma, J.C., Newman, A.J. and Hayward, R.S. (1981) Internal promotors of the rpoBC operon of Escherichia coli. Mol. Gen. Genet. 184: 548 - 550. Magrum, L.J., Luehrsen, K.R. and Woese, C.R. (1978) Are extreme halophiles actually "bacteria"? J. Mol. Evol. 11: 1 -8. Maniatis, T., Fritsch, E.F. and Sambrook, J . (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbour Laboratory, Cold Spring Harbour, New York. Mankin, A.S. and Kagramanova, V.K. (1986) Complete nucleotide sequence of the single ribosomal RNA operon of Halobacterium halobium: secondary structure of the archaebacterial 23S rRNA. Mol. Gen. Genet. 202: 152 - 161. Mankin, A.S., Teterina, N.L., Rubstov, P.M., Baratova, L.A. and Kagaramanova, V.K. (1984) Putative promotor region of rRNA operon from archaebacteium Halobacterium halobium. Nucleic Acids Res. 12: 6537 - 6546. Margulis, L. (1970) Origin of eukaryotic cells. Yale University Press, New Haven. Marquis, D.M., Fahnestock, S.R., Henderson, E., Woo, D., Schwinge, S., Clarke, M.W. and Lake, J.A. (1981) The L7/L12 stalk, a conserved feature of the prokaryotic ribosome, is attached to the large subunit through its N terminus. J. Mol. Biol. 150: 121 - 132. Matheson, A T . (1985) Ribosomes of archaebacteria. In The Bacteria : Vol. 8, The Archaebacteria. Edited by Woese, C.R. and Wolfe, R.S. Academic Press, New York, pp. 761 - 777. Matheson, AT. , Louie, K.A. and Bock, A. (1988) The complete amino acid sequence of the ribosomal A protein (L12) from the archaebacterium Sulfolobus acidocaldarius. FEBS Letters 231: 331 - 335. Matheson, AT. , Louie, K.A., Tak, B.D. and Zuker, M. (1987) The primary structure of the ribosomal A - protein (L12) from the halophilic eubacterium Haloanaerobium praevalens. Biochemie 69: 1013 - 1020. 112 Matheson, A.T., Yaguchi, M., Balch.W.E. and Wolfe, R.S. (1979) Sequence homologies in the N - terminal region of the ribosomal 'A' proteins from Methanobacterium thermoautotrophicum and Halobacterium cutirubrum. Biochim. Biophys. Acta 626:162- 169. Matheson, AT. , Yaguchi, M., Christensen, P., Rollin, C.T. and Hasnain, S. (1984) Purification, properties and N - terminal amino acid sequence of certain 50S ribosomal subunit proteins from the archaebacterium Halobacterium cutirubrum. Can. J. Biochem. Cell Biol. 62:426 - 433. Maxam, A.M. and Gilbert, W. (1977) Sequencing end - labelled DNA with base specific chemical cleavages. Proc. Natl. Acad. Sci. USA 74:560 - 564. Messing, J . (1983) New M13 vectors for cloning. Methods in Enzymology 101: 20 - 79. Miller, J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, pp. 431 - 433. Mills, D.R. and Kramer, F.R. (1979) Structure independent nucleotide sequence analysis. Proc. Natl. Acad. Sci. USA 76: 2232 - 2235. Mitsui, K. and Tsurugi, K. (1988a) cDNA and deduced amino acid sequence of acidic ribosomal protein AO from Saccharomyces cerevisiae. Nucleic Acids Res. 16:3573. Mitsui, K. and Tsurugi, K. (1988b) cDNA and deduced amino acid sequence of acidic ribosomal protein A1 from Saccharomyces cerevisiae. Nucleic Acids Res. 76:3574. Mitsui, K. and Tsurugi, K. (1988c) cDNA and deduced amino acid sequence of acidic ribosomal protein A2 from Saccharomyces cerevisiae. Nucleic Acids Res. 16:3575. Mizusawa, S., Nishimura, S. and Seela, F. (1986) Improvement of the dideoxy chain termination method of DNA sequencing by use of deoxy - 7 - deazaguanosine triphosphate in place of dGTP. Nucleic Acids Res. 14: 1319 - 1324. Moller, W. and Maasen, J.A. (1986) On the structure, function and dynamics of L7/L12 from Escherichia coli ribosomes. In Structure, Function and Genetics of Ribosomes. Edited by Hardesty, B. and Kramer, G. Springer Verlag, New York, pp. 309 - 325. Moller, W., Schrier, P.I., Maasen, J.A., Zantema, A., Schop, E., Reinalda, H., Cremers, A.F.M. and Mellema, J.E. (1983) Ribosomal proteins L7/L12 of Escherichia coli. Localization and possible molecular mechanism in translation. J. Mol. Biol. 163:553 - 573. Newman, A. (1987) Specific accessory sequences in Saccharomyces cerevisiae introns control assembly of pre - messenger RNAs into spliceosomes. EMBO Journal 6: 3833 - 3839. Newman, A., Linn, T. and Hayward, R. (1979) Evidence for co-transcription of the RNA polymerase genes rpoBC with a ribosomal protein gene of Escherichia coli. Mol. Gen. Genet. 169:195 - 204. Newton, C.H., Shimmin, L .C, Yee, J. and Dennis, P.P. (1990) A family of genes encode the multiple forms of the yeast L12 equivalent ribosomal proteins and a single form of the L10 equivalent ribosomal protein. J. Bacterid. 172: 579 - 588. Nomura, M., Gourse, R. and Baughman, G. (1984) Regulation of the synthesis of ribosomes and ribosome components. Ann. Rev. Biochem. 53: 119 - 162. Oakes, M., Henderson, E., Scheinman, A., Clark, M. and Lake, J.A. (1986) Ribosome structure, function and evolution: mapping ribosomal RNA, proteins and functional sites in three dimensions. In Structure, Function and Genetics of Ribosomes. Edited by Hardesty, B. and Kramer, G. Springer Verlag, New York, pp. 47 - 67. Oda, G., Strom, A.R., Visentin, L.P. and Yaguchi, M. (1974) An acidic, alanine - rich 50S ribosomal protein from Halobacterium cutirubrum : amino acid sequence homology with Escherichia coli proteins L7 and L12. FEBS Letters 43: 127 - 130. 113 Olsen, G.J. and Woese, C.R. (1989) A brief note concerning archaebacterial phylogeny. Can. J. Microbiol. 35: 119 - 123. Osterberg, R., Sjoberg, B., Liljas, A. and Pettersson, I. (1976) Small angle X-ray scattering and crosslinking study of the proteins L7/L12 from Escherichia coli ribosomes. FEBS Letters 66: 48 - 51. Osterberg, R., Sjoberg, B., Pettersson, I., Liljas, A. and Kurland, C.J. (1977) Small angle X-ray scattering study of the protein complex of L7/L12 and L10 from Escherichia coli ribosomes. FEBS Letters 73: 22 - 24. Otaka, E., Higo, K. and Itoh, T. (1984) Yeast ribosomal proteins. Mol. Gen. Genet. 195:544 - 546. Otaka, E., Ooi, T., Kumazaki, T. and Itoh, T. (1985) Examination of protein sequence homologies: II. six Escherichia coli L7/L12 type ribosomal 'A' protein sequences from eukaryotes and metabacteria, contrasted with those from prokaryotes. J. Mol. Evol. 22: 342 - 350. Parker, J . , Watson, R.J., Freisen, J.D. and Fiil, H.P. (1976) A relaxed mutant with an altered ribosomal protein L11. Mol. Gen. Genet. 144:111 -114. Pearson, W.R. (1990) Rapid and sensitive sequence comparison with FASTP and FASTA. Methods in Enzymology In press. Petersen, C. (1989) Long - range translational coupling in the rplJL - rpoBC operon of Escherichia coli. J. Mol. Biol. 206: 323 - 332. Pettersson, I. (1979) Studies on the RNA and protein binding sites of the E. coli ribosomal protein L10. Nucleic Acids Res. 6: 2637 - 2646. Pettersson, I. and Liljas, A. (1979) The stoichiometry and reconstitution of a stable protein complex from Escherichia coli ribosomes. FEBS Letters 98: 39 -144. Pfeifer, F. and Betlach, M. (1985) Genome organization in Halobacterium : a 70 Kb island of more (AT) rich DNA in the chromosome. Mol. Gen. Genet. 198: 449 - 455. Pfeifer, F., Blasio, U. and Ghorman, P. (1988) Dynamic plasmid populations in Halobacterium halobium. J. Bacteriol. 170: 3718 - 3724. Pfeifer, F., Blasio, U. and Home, M. (1989) Genome structure of Halobacterium halobium : plasmid dynamics in gas vacuole deficient mutants. Can. J. Microbiol. 35:96 -100. Pfeifer, F., Weidinger, G. and Goebel, W. (1981) Genetic variability in Halobacterium halobium. J. Bacteriol. 145: 375 - 381. Planta, R., Mager, W., Leer, R., Wondt, L., Raue, H. and El-Baradi, T. (1986) Structure and expression of ribosomal proteins in yeast. In Structure, Function and Genetics of Ribosomes. Edited by Hardesty, B. and Kramer, G. Springer Verlag, New York, pp. 699 - 718. Post, L.E., Strycharz, G.D., Nomura, M., Lewis, H. and Dennis, P.P. (1979) Nucleotide sequence of the ribosomal protein gene cluster adjacent to the gene for RNA polymerase subunit in Escherichia coli. Proc. Natl. Acad. Sci. USA 76: 1697 - 1701. Puhler, G., Lottspei, F. and Zillig, W. (1989) Organization and nucleotide sequence of the genes encoding the large subunit A, subunit B and subunit C of the DNA dependent RNA polymerase of the archaebacterium Sulfolobus solfataricus. Nucleic Acids Res. 17: 4517 - 4534. Qian, S., Zhang, J. , Kay, M.A. and Jacobs-Lorena, M. (1987) Structural analysis of the Drosophila rpA1 gene, a member of the eucaryotic 'A' type ribosomal protein family. Nucleic Acids Res. 15: 987 - 1003. Radermacher, M., Wagenknecht, T., Verschoor, A. and Frank, J. (1987) Three-dimensional structure of the large ribosomal subunit from Escherichia coli. EMBO Journal 6:1107 -1114. 114 Ramirez, C , Shimmin, L.C. and Matheson, A.T. (1990a) Characterization of the GTPase domain gene cluster from Sulfolobus solfataricus. Submitted. Ramirez, C , Shimmin, L .C , Matheson, A.T. and Dennis, P.P. (1990b) Structure of archaebacterial ribosomal proteins equivalent to proteins L11 and L1 from Escherichia coli ribosomes. Submitted. Ramirez, C , Shimmin, L . C , Newton, C H . , Matheson, A.T. and Dennis, P.P. (1989) Structure and evolution of the L11.L1.L10 and L12 equivalent ribosomal proteins in eubacteria, archaebacteria and eucaryotes. Can. J. Microbiol. 35: 234 - 244. Rauser, W.E. and Bayley, S.T. (1968) Ribosomal complexes from an extremely halophilic bacterium and the role of cations. J. Bacteriol. 96:1304 - 1313. Ree, H.K., Cao, K., Thurlow, D.L. and Zimmermann, R.A. (1989) The structure and organization of the 16S ribosomal RNA gene from the archaebacterium Thermoplasma acidophilum. Can. J. Microbiol. 35: 124 - 133. Reiter, W., Palm, P. and Zillig, W. (1988) Analysis of transcription in the archaebacterium Sulfolobus indicates that archaebacterial promotors are homologous to eucaryotic polll promotors. Nucleic Acids Res. 16: 1 - 20. Remacha, M., Saenz-Robles, M.T., Vilella, M.D and Ballesta, J.P.G. (1988) Independent genes coding for three acidic proteins of the large ribosomal subunit from Saccharomyces cerevisiae. J. Biol. Chem. 263: 9094 - 9101. Rich, B.E. and Steitz, J.A. (1988) Human acidic ribosomal phosphoproteins P0, P1, and P2: analysis of cDNA clones, in vitro synthesis, and assembly. Mol. Cell. Biol. 7:4065 - 4074. Rigby, P.W.J., Diekmann, M., Rhodes, C. and Berg, P. (1977) Labelling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 113: 237 - 251. Rosenthal, A., Jung, R. and Hunger, H - D. (1986) Optimized conditions for solid phase sequencing: simultaneous chemical cleavage of a series of long DNA fragments immobilized on CCS anion - exchange paper. Gene 42:1 - 9. Rosenthal, A., Schwertner, S., Hahn, V. and Hunger, H - D. (1985) Solid - phase methods for sequencing of nucleic acids. I. Simultaneous sequencing of different oligodeoxyribonucleotides using a mechanically stable anion - exchange paper. Nucleic Acids Res. 13:1173 -1184. Saenger, W. (1987) Structure and dynamics of water surrounding biomolecules. Ann. Rev. Biophys. Chem. 16: 93 -114. Said, B., Cole, J.R. and Nomura, M. (1988) Mutational analysis of the L1 binding site of 23S rRNA in Escherichia coli. Nucleic Acids Res. 16:10529 - 10545. Sander, G. (1983) Ribosomal protein L1 from Escherichia coli. Its role in the binding of tRNA to the ribosome and in elongation factor G - dependent hydrolysis. J. Biol. Chem. 258:10098 - 10102. Sanger, F., Nicklen, S. and Coulsen, A.R. (1977) DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463 - 5467. Sapienza, C , Rose, M. and Doolittle, W.F. (1982) High-frequency genomic rearrangements involving archaebacterial repeat sequence elements. Nature 299: 182 - 185. Schidlowski, M. (1988) A 3,800 - million - year isotopic record of life from carbon in sedimentary rocks. Nature 333: 313 - 318. Schmidt, F.J., Thompson, J. , Lee, K., Diik, J. and Cundliffe, E. (1981) The binding site for ribosomal protein L11 within 23S ribosomal RNA of Escherichia coli. J. Biol. Chem. 256: 12301-12305. Schwartz, R.M. and Dayhoff, M.O. (1978) Origins of prokaryotes, eukaryotes, mitochondria, and chloroplasts. Science 199: 395 - 403. 115 Shepherd, J.C. (1981) Method to determine the reading frame of a protein from the purine/pyrimidine genome sequence and its possible evolutionary justification. Proc. Natl. Acad. Sci. USA 78:1596 - 1600. Shimmin, L.C. and Dennis, P.P. (1989) Characterization of the L11, L1, L10 and L12 equivalent ribosomal protein gene cluster of the halophilic archaebacterium Halobacterium cutirubrum. EMBO Journal 8: 1225 - 1235. Shimmin, L .C , Newton, C.H., Ramirez, C , Yee, J . , Downing, W.L., Louie, A., Matheson, A T . and Dennis, P.P. (1989a) Organization of genes encoding the L11, L1, L10 and L12 equivalent ribosomal proteins in eubacteria, archaebacteria and eucaryotes. Can. J. Microbiol. 35:164 - 170. Shimmin, L . C , Ramirez, C , Matheson, A T . and Dennis, P.P. (1989b) Sequence alignment and evolutionary comparison of the L10 and L12 equivalent ribosomal proteins from archaebacteria, eubacteria and eucaryotes. J. Mol. Evol. 29:448 - 462. Shine, J . and Dalgarno, L. (1974) The 3' terminal sequence of Escherichia coli 16S ribosomal RNA: complementarity to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. USA 71: 1342 - 1346. Sor, F. and Nomura, N. (1987) Cloning and DNA sequence determination of the L11 ribosomal protein operon of SerraHa marcescens and Proteus vulgaris. Translational feedback regulation of Escherichia coli L11 operon by heterologous L1 proteins. Mol. Gen. Genet. 210: 52 - 59. Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517. Spiridonova, V.A., Akhmanova, A.S., Kagramanova, V.K., Kopke, A.K.E. and Mankin, A.S. (1989) Ribosomal protein gene cluster of Halobacterium halobium : nucleotide sequence of the genes coding for S3 and L29 equivalent ribosomal proteins. Can. J. Microbiol. 35:153 - 159. Stackebrandt, E. (1985) Phylogeny and phylogenetic classification of prokaryotes. In Evolution of Prokaryotes. Edited by Schleifer, K.H. and Stackebrandt, E. Academic Press, London, pp. 309 - 334. Stanier, R.Y. (1970) Organization and control in prokaryotic and eukaryotic cells. Symp. Soc. Gen. Microbiol. 20: 1 - 38. Steitz, J.A. (1978) Methanogenic bacteria. Nature 273:10. Stockenius, W. and Bogomolni, R.A. (1982) Bacteriorhodopsin and related pigments of halobacteria. Ann. Rev. Biochem. 52: 587 - 616. Stockenius, W., Lozier, R.H. and Bogomolni, R.A. (1979) Bacteriorhodopsin and the purple membrane of halobacteria. Biochim. Biophys. Acta. 505: 215-298. Stoffler - Melicke, M., Noah, M. and Stoffler, G. (1983) Location of eight ribosomal proteins on the surface of the 50S subunit from £ coli. Proc. Natl. Acad. Sci. USA 80: 6780 - 6784. . Stoffler, G. and Stoffler - Meilicke, M. (1986) Electron microscopy of archaebacterial ribosomes. System. Appl. Microbiol. 7: 123 - 130. Strobel, O., Kopke, A.K.E., Kamp, R.M., Bock, A. and Wittmann - Liebold, B. (1988) Primary structure of the archaebacterial Methanococcus vannielii ribosomal protein L12. J. Biol. Chem. 263: 6538 - 6546. Strom, A.R. and Visentin, L.P. (1973) Acidic ribosomal proteins from the extreme halophile, Halobacterium cutirubrum. FEBS Letters 37: 274 - 280. Strom., A.R., Hasnain, S., Smith, N., Matheson, AT. and Visentin, L.P. (1975) Ion effects on protein - nucleic acid interactions; the disassembly of the 50S ribosomal subunit from the halophilic bacterium, Halobacterium cutirubrum. Biochim. Biophys. Acta 383: 325 - 337. 116 Strycharz, W.A., Nomura, A. and Lake, J.A. (1978) Ribosomal proteins L7/L12 localized at a single region of the' large subunit by immune electron microscopy. J. Mol. Biol. 126:123 - 140. Subramanian, A.R. and Dabbs, E.R. (1980) Functional studies on ribosomes lacking protein L1 from mutant E. coli. Eur. J. Biochem. 112: 425 - 430. Tabor, S. and Richardson, C.C. (1987) DNA sequence analysis with modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84: 4767 - 4771. Tate, W.P., Dognin, M.J., Noah, M., Stoffler - Melicke, M. and Stoffler, G. (1984) The N - terminal domain of Escherichia coli ribosomal protein L11: its three dimensional location and its role in the binding of release factor 1. J. Biol. Chem. 259: 7317 - 7324. Taylor, F.J.R. and Coates, D. (1989) The code within the codons. BioSystems 22:177 -187. Terhorst, C., Moller, W., Laursen, R. and Wittman - Liebold, B. (1973) The primary structure of an acidic protein from 50-S ribosomes of Escherichia coli which is involved in GTP hydrolysis dependent on elongation factors G and T. Eur. J. Biochem. 34:138-152. Thomas, M.S. and Nomura, M. (1987) Translational regulation of the L11 ribosomal protein operon of Escherichia coli : mutations that define the target site for repression by L1. Nucleic Acids Res. 15: 3085 - 3096. Thomm, M. and Wich, G. (1988) An archaebacterial promotor element for stable RNA genes with homology to the TATA box of higher eucaryotes. Nucleic Acids Res. 16:151 -164. Thomm, M., Shed, B.A. and Reeve, J.N. (1988) The RNA polymerase binding and transcription initiation site upstream of the methylreductase operon of Methanococcus vanielii. J. Bacteriol. 170: 1958 - 1961. Thomm, M., Wich, G., Brown, J.W., Frey, G., Shed, B.A. and Beckler, G.S. (1989) An archaebacterial promotor sequence assigned by RNA poymerase binding experiments. Can. J. Microbiol. 35: 30 - 35. Traut, R.R., Tewari, D.S., Sommer, A., Gavino, G.R., Olson, H.M. and Glitz, D.G. (1986) Protein topography of ribosomal functional domains: effects of monoclonal antibodies to different epitopes in Escherichia coli protein L7/L12 on ribosome function and structure. In Structure, Function and Genetics of Ribosomes. Edited by Hardesty, B. and Kramer, G. Springer Verlag, New York, pp. 286 - 308. Trifonov, E.N. (1987) Translation framing code and frame-monitoring mechanism as suggested by analysis of mRNA and 16S rRNA nucleotide sequences. J. Mol. Biol. 194: 643 - 652. Tritton, T.R. (1978) Spin - labelled ribosomes. Biochemistry 17:3959 - 3964. Van Valen, L.M. and Maiorara, V.C. (1980) The archaebacteria and eukaryotic origins. Nature 287: 248 - 250. Viera, J . and Messing, J. (1982) The pUC plasmids, an M13mp7 - derived system for insertion mutagenesis and sequencing with the synthetic universal primers. Gene 19: 259 - 268. Visentin, L.P., Yaguchi, M. and Matheson, A T . (1979) Structural homologies in alanine - rich acidic ribosomal proteins from procaryotes and eucaryotes. Can. J. Biochem. 57: 719 - 726. Walter, M.R., Buick, R. and Dunlop, J.S.R. (1980) Stromatolites 3,400 - 3,500 Myr old from the North Pole area, Western Australia. Nature 284: 443 - 445. Warner, J.R. (1989) Synthesis of ribosomes in Saccharomyces cerevisiae. Microbiol. Reviews 53:256- 271. Wich, G., Hummel, H., Jarsch, M., Bar, U. and Bock, A. (1986) Transcription signals for stable RNA genes in Methanococcus. Nucleic Acids Res. 14: 2459 - 2479. 117 Wich, G., Leinfelder, W. and Bock, A. (1987) Genes for stable RNA in the extreme thermophile Thermoproteus tenax: introns and transcription signals. EMBO Journal 6: 523 - 528. Wigboldus, J.D. (1987) cDNA and deduced amino acid sequence of Drosophila rp21C, another 'A'-type ribosomal protein. Nucleic Acids Res. 15:10064. Wittmann-Liebold, B. (1986) Ribosomal proteins: their structure and evolution. In Structure, Function and Genetics of Ribosomes. Edited by Hardesty, B. and Kramer, G. Springer Verlag, New York, pp. 326-361. Woese, C.R. (1987) Bacterial evolution. Microbiol. Rev. 51: 221 - 271. Woese, C.R. and Fox, G.E. (1977) Phylogenetic structure of the prokaryotic domain: the primary kingdoms. Proc. Natl. Acad. Sci. USA 74: 5088 - 5090. Woese, C.R. and Fox, G.E. (1978) Methanogenic bacteria. Nature 273:101. Woese, C.R. and Olsen, G.J. (1986) Archaebacterial phytogeny: perspectives on the urkingdoms. System. Appl. Microbiol. 7:161 -177. Woese, C.R., Pace, N.R. and Olsen, G.J. (1986) Are arguments against archaebacteria valid? Nature 320: 401 - 402. Wolters, J . and Erdmann, V.A. (1989) The structure and evolution of archaebacterial ribosomal RNAs. Can. J. Microbiol. 35: 43 - 51. Yaguchi, M., Matheson, A.T., Visentin, L.P. and Zuker, M. (1980) Molecular evolution of the alanine - rich, acidic ribosomal A protein. In Genetics and Evolution of RNA Polymerase, tRNA and Ribosomes. Edited by Osawa, S., Ozeki, H., Uchida, H. and Yura, Y. University of Tokyo Press, Tokyo, pp. 585 - 599. Yaguchi, M., Visentin, LP . , Zuker, M., Matheson, A.T., Roy, C. and Strom, A.R. (1982) Amino - terminal sequences of ribosomal proteins from the 30S subunit of the archaebacterium Halobacterium cutirubrum. Zbl. Bakt. Hyg., I. Abt. Orig. C3: 200 - 208. Yanisch - Perron, C , Viera, J . and Messing, J . (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mp18 and pUC19 vectors. Gene 33:103 - 119. Yates, J.L. and Nomura, M. (1981) Feedback regulation of ribosomal protein synthesis in E. coli: localization of the mRNA target sites for repressor action of ribosomal protein L1. Cell 24: 243 - 249. Zillig, W. (1986) Archaebacterial status quo is defended. Nature 320: 220. Zillig, W., Klenk, H., Palm, P., Puhler, G., Gropp, F., Garrett, R.A. and Letters, H. (1989) The phylogenetic relations of DNA - dependent RNA polymerases of archaebacteria, eukaryotes, and eubacteria. Can. J. Microbiol. 35: 73 - 80. Zimmerman, R.A., Thurlow, D.L., Finn, R.S., March, T.L. and Ferrett, L.K. (1980) Conservation of specific protein - RNA interactions in ribosome evolution. In Genetics and Evolution of RNA Polymerase, tRNA and Ribosomes. Edited by Osawa, S., Ozeki, H., Uchida, H. and Yura, Y. University of Tokyo Press, Tokyo, pp. 569 - 584. Zuckerkandl, E. and Pauling, L. (1965) Molecules as documents of evolutionary history. J. Theor. Biol. 8: 357 - 366.

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
United States 4 0
Zambia 2 0
Russia 1 0
City Views Downloads
Unknown 3 1
Ashburn 3 0
Mountain View 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}

Share

Share to:

Comment

Related Items