Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cloning and expression of the Drosophila melanogaster CuZn superoxide dismutase gene Seto, Nina O. L. 1990

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1990_A1 S47.pdf [ 7.75MB ]
Metadata
JSON: 831-1.0100395.json
JSON-LD: 831-1.0100395-ld.json
RDF/XML (Pretty): 831-1.0100395-rdf.xml
RDF/JSON: 831-1.0100395-rdf.json
Turtle: 831-1.0100395-turtle.txt
N-Triples: 831-1.0100395-rdf-ntriples.txt
Original Record: 831-1.0100395-source.json
Full Text
831-1.0100395-fulltext.txt
Citation
831-1.0100395.ris

Full Text

Cloning and Expression of the Drosophila melanogaster CuZn Superoxide Dismutase Gene by Nina O.L. Seto B.Sc. University of Toronto, 1984 M.Sc. University of British Columbia, 1987 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES DEPARTMENT OF BIOCHEMISTRY UNIVERSITY OF BRITISH COLUMBIA We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA November, 1989 © Nina O.L. Seto, 1989 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. 1 further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. t , BIOCHEMISTRY Department of The University of British Columbia Vancouver, Canada Date JANUARY 29, 1990 DE-6 (2788) 11 ABSTRACT Aging and disease processes may be due to deleterious and irreversible changes produced by free radical reactions. The enzyme copper-zinc superoxide dismutase (CuZn SOD; superoxide: superoxide oxidoreductase, EC 1.15.1.1) performs a protective function by scavenging superoxide radicals. In order to determine whether additional SOD activity affects longevity and oxygen metabolism in Drosophila, our approach was to clone the Sod gene and introduce additional copies of the gene back into the genome via P element mediated transformation. The effects of increased SOD activity on Drosophila life span and oxygen free radical metabolism were investigated. The CuZn SOD cDNA and gene were cloned from Drosophila melanogaster. The sequence of the Sod cDNA and gene revealed an additional C-terminal triplet coding for valine not found in the mature SOD protein. The nucleotide sequence of the coding region has 56% and 57% identity when compared to the corresponding human and rat Sod genes, respectively. A probe of the cloned gene hybridizes to position 68A4-9 on Drosophila polytene chromosomes. In wild-type Drosophila the Sod cDNA hybridizes to a 0.7-0.8 kb transcript which is greatly diminished in a SOD 'null' mutant that produces only 3.5% of the SOD protein. A 1.8 kb EcoRI gene fragment containing the Sod gene was cloned into the P vector pUChsneo and microinjected into Drosophila embryos. Five transformed lines, each of which contain an additional copy of the Sod gene at different chromosomal sites were constructed. The chromosomal positions of the transposed Sod sequence were determined by in situ hybridization of the Sod gene to salivary gland polytene chromosomes. i i i Analysis of RNA from the transformed flies revealed that the transposed Sod gene was expressed. The range of SOD activity for the five transformed lines was 131% to 170% of the value of wild-type. There was good correlation between the amount of Sod mRNA and the level of SOD activity in the transformed lines. Increased SOD levels in the transformed lines did not confer greater resistance to paraquat-generated superoxide radicals, nor increase their lifespan. The SOD 'null' mutant with 3.5% of the wild-type SOD activity was hypersensitive to paraquat when compared to wild-type, whereas the heterozygous SOD deficiency Df(3L)\xd9/TM3SbSer with 50% of the wild-type SOD activity was not. Mutants lacking SOD are dramatically impaired in oxygen metabolism and a few percent of wild-type activity appears to provide significant protection against superoxide, while 50% of the wild-type levels confers essentially the same resistance as wild-type. Despite the observation that the SOD activities found in a wide range of animals correlates directly with their longevity, Drosophila melanogaster appears to be well protected against the toxic effects of oxygen by its native levels of SOD. 1 V Table of Contents PAGE Abstract i i Table of Contents iv List of Tables vii List of Figures viii Acknowledgements x Dedication xi List of Abbreviations xii I. Introduction 1. A. Theories of aging 1 B. The free radical theory of aging 1 C. Superoxide dismutase as a longevity determinant 2 D. Drosophila as a model organism for aging studies 4 E. Superoxide dismutase and oxygen toxicity 5 F. Assays for superoxide dismutase activity 6 G. Superoxide dismutase in prokaryotes 7 H. Superoxide dismutase in D. melanogaster 8 I. Superoxide dismutase genes 10 J. Aims and scope of this study 13 1. Isolation and characterization of the Drosophila cDNA and gene 13 2. P element transformation of the D. melanogaster CuZn SOD gene 15 3. Effects of increased Sod expression on oxygen radical metabolism and lifespan 17 II. Materials and Methods A. Materials 18 B. Bacterial strains, media, vectors, buffers and Drosophila stocks 19 C. Isolation of D. melanogaster DNA 20 D. Bacteriophage lambda DNA preparation 21 E. Isolation of D. melanogaster RNA 22 1. Isolation of total D. melanogaster RNA 22 2. Isolation of poly(A)+ RNA 23 F. Gel Electrophoresis 24 1. Neutral agarose gels 24 2. Formaldehyde agarose gels 24 3. Denaturing polyacrylamide (DNA sequencing) gels 24 G. Gel hybridization analysis 25 1. Southern blot analysis of genomic and cloned DNA 25 2. Northern blot analysis 26 H. Purification of oligonucleotide probes 26 I. Labelling DNA probes 27 1. Nick-translation of DNA 27 2. End-labelling with polynucleotide kinase 28 J. Screening lambda libraries 29 1. Screening a D. melanogaster cDNA library in XgtlO 29 2. Screening a D. melanogaster genomic library 31 K. DNA subcloning 31 V 1. Ligation of DNA into vectors 31 2. Transformation of bacteria with DNA 32 3. Growth of transformants 32 (a) Small scale plasmid preparation 32 (b) Large scale plasmid preparation 33 4. Deletion subclones for sequence analysis 34 L. DNA sequence determination by the Sanger method 38 1. DNA template preparation 38 (a) Single-stranded DNA templates 38 (b) Double-stranded DNA templates 39 2. Use of Klenow polymerase 39 3. Use of modified T7 DNA polymerase (Sequenase™) 40 * 4. Orientation of M13 clones 41 (a) Hybridization with oligonucleotide probes 41 (b) T-track analysis 42 M. P-element transformation of Drosophila by microinjection 42 1. Preparing the P-element transformation vectors 42 2. Preparing the Drosophila for egg lays and collecting 43 staged embryos 3. Pulling and filling microinjection needles 44 4. Microinjection of Drosophila embryos 45 5. Culturing the injected GO adults 47 6. Creating transformed Drosophila lines 50 7. Creating lines homozygous for the inserted gene 50 N. Gene localization by in situ hybridization 55 1. Labelling an RNA transcript with Iodine-125 55 2. Labelling the DNA probe with biotin 62 3. In situ hybridization 63 (a) Preparation of the chromosome squashes 63 (b) Preparation of the slides for hybridization 64 (c) Hybridization and signal detection 64 O. Expression of the transposed gene 66 1. SOD activity assays 66 2. Bradford protein assays 67 3. Northern blot analysis of transcripts 68 P. Drosophila melanogaster longevity studies68 1. The aging curves 68 2. The genetic crosses 69 Q. Assay of paraquat toxicity 69 III. Results and Discussion 73 A. Characterization of the D. melanogaster CuZn SOD cDNA 73 1. Isolation of the CuZn SOD cDNA using mixed oligonucleotide probes 73 (a) Oligonucleotide probe design 73 (b) Screening a D. melanogaster cDNA library 73 2. Nucleotide sequence analysis of CuZn SOD cDNA 75 3. Predicted amino acid sequence of the CuZn SOD protein 75 4. The SOD gene transcript 82 B. The D. melanogaster CuZn SOD gene 85 1. Isolation and characterization of CuZn SOD genomic clones 85 2. Restriction enzyme analysis of the CuZn SOD 86 v1 genomic clone 3. Subcloning strategy for the CuZn SOD gene 89 4. Nucleotide sequence of the CuZn SOD gene 92 5. Analysis of the CuZn SOD gene sequence 95 6. Cytogenetic localization of the CuZn Sod gene 106 C. P element mediated transformation of the CuZn SOD gene 106 1. Construction of the P element vectors 106 2. P element mediated transformation 109 3. Establishment of transformed lines 112 4. Chromosomal localization of the transposed Sod gene 114 5. Southern analysis of transformed lines 114 D. Expression of additional CuZn SOD genes 118 1. Quantification of the SOD transcript in transformed lines 118 2. SOD-specific activity of transformed lines 121 E. Longevity studies 125 1. The longevity of wildtype isogenic Oregon R 125 2. The longevity of a SOD 'null' mutant 126 3. The longevity of the transformed lines 131 F. Sensitivity to paraquat toxicity 131 G. Concluding remarks 143 IV. Literature cited 145 vi 1 LIST OF TABLES PAGE I. Codon usage for the CuZn Sod gene 103 II. Results of the P element mediated transformation experiments 111 III. Analysis of P element transformation data 113 IV. Chromosomal localization of the inserted SOD gene 115 V. SOD-specific activity and transcripts in transformed and control strains 122 VI. Summary of longevity data 136 vi 1 1 LIST OF FIGURES PAGE 1. Generating deletion subclones for sequence analysis 36 2. The Drosophila life cycle 49 3. Culturing the injected GO adults 52 4. Propagating the transformed lines 54 5. Creating homozygous transformed lines for a transposon inserted in the second chromosome 57 6. Creating homozygous transformed lines for a transposon inserted in the third chromosome 60 7. The Drosophila hybrids used in the longevity studies 71 8. Oligonucleotide probe design 74 9. Southern analysis of CuZn SOD cDNA clones 77 10. Strategy for determining the CuZn SOD cDNA sequence 79 11. The D. melanogaster CuZn SOD cDNA sequence 81 12. Northern blot analysis of wt and "null" mutant Sod transcripts 84 13. Southern analysis of a genomic CuZn SOD clone from a X.EMBL3 DNA library 88 14. Subcloning strategy for the CuZn SOD gene 91 15. The strategy for determining the sequence of the CuZn SOD gene 94 16. Nucleotide sequence of the Drosophila CuZn SOD gene 99 17. Comparison of the transcriptional control sites in the herpesvirus fit and Drosophila CuZn SOD gene 100 18. Comparison of the nucleotide sequences of the coding region for Drosophila, rat, and human CuZn SOD genes 105 19. Chromosomal localization of the Drosophila Sod gene 107 20. The pneoSOD transposon 108 21. Chromosomal localization of the transposed Drosophila Sod gene 117 i x 22. Southern analysis of transposed Sod DNA 120 23. Northern analysis of endogenous and introduced Sod genes 124 24. Lifespan of wt isogenic Oregon R measured at 29°C 128 25. Lifespan of a SOD null mutant measured at 29°C 130 26. Lifespan of males from Sod transformed lines at 29°C 132 27. Lifespan of females from Sod transformed lines at 29°C 133 28. Lifespan of males from Sod transformed lines at 25°C 134 29. Lifespan of females from Sod transformed lines at 25°C 135 30. Sensitivity to paraquat toxicity of the transformed and control strains-percent survivors after 48 hr exposure 130 31. Comparison of paraquat sensitivity between the transformed lines-percent survivors after 48 hr exposure 142 X ACKNOWLEDGEMENTS First and foremost, I wish to thank Gordon Tener for his patience, wisdom and generosity. 1 especially thank you for giving me the courage to continue with this work after the initial frustrating years. My sincere thanks go to Shizu Hayashi for being with this project since the beginning, her hard work, for reading this thesis and for teaching me so much. I thank Don Sinclair, whose constant interest and involvement with my work has been an important source of support. I thank all those who have been in our lab past and present. My appreciation goes to the following individuals outside of our lab: Tom Grigliatti, for giving me a bench in the genetics lab and providing all the fly food required to complete this work; all the members of the fly lab for their help and tolerance; Vett Lloyd, for enduring the frustration of setting up the transformation experiments, for the stamina to inject thousands of embryos with me in the cold humid room and for sharing the joy at obtaining our first transformanl; Peter Vaughan for pulling all my microinjection needles; Hugh Brock and members of his lab for helpful discussions throughout this work; and Carol Astell for helpful discussions of many sorts. I thank Ian Gillam for his kindness and generosity over the years and for his discourses-all in an attempt to educate me. Perhaps I will think "Et in Arcadia Ego". Finally, my deepest appreciation goes to my friends, to Stephen, and to my family, especially Michael and Carol, for their constant love and support. xi For my family and for Dr. Brenda B. Shapiro X 1 1 LIST OF ABBREVIATIONS A adenosine or 2'-deoxyadcnosinc a a amino acid(s) ATP adenosine triphosphate A26O absorbance at 260 nm b p base pairs BSA bovine serum albumin C cytidine or 2'-dcoxycylidinc cDNA DNA complementary to RNA c p m counts per minule dNTP deoxynucleoside triphosphate ddNTP dideoxynucleoside triphosphate DEAE d ie thy laminoe lhy l DNA deoxyribonucleic acid DNase deoxy ribonucleasc ds double-stranded DEPC diethyl pyrocarbonalc EOT dithiothreitol EDTA ethylenediaminetetraacctic acid EtBr elhidium bromide G guanosine or 2'-deoxyguanosine h r hour(s) 5-IdCTP 5-iododeoxycylidinc triphosphate I inosine IPTG i sop ropy l -p-D-thiogalaciopy ran 0 side X 1 1 1 kb kilobase (pairs) LB Luria broth m A milliamperes m i n minute(s) m M millimolar MOPS 3-[N-Morpholino]propanesulfonic acid mRNA messenger RNA MW molecular weight N any nucleotide(G, A, T or C) NTP ribonucleoside triphosphate n t nucleotide(s) PEG polyethylene glycol pfu plaque forming units RF replicative form RNA ribonucleic acid RNase ribonuclease SDS sodium dodecyl sulfate SOD superoxide dismutase SODP^OD8 fast and slow electromorphs, resp., of SOD Sod gene coding for SOD ss single-stranded SSC standard saline citrate (0.15 M NaCl, 0.015 M sodium citrate. pH 7) T thymidine or thymidylic acid TBE Tris-borate-EDTA electrophoresis buffer TE8 10 mM Tris-HCl (pH 8.0), 1 mM EDTA X 1 V TEMED N.N.N'.N'-lelramethylcthylenediamine Tris Tr i s (h y d ro x y m e t h y 1) a m i n o m ethane tRNA transfer RNA U uridine or uridylic acid uCi microcurie l^ g micrograms u V ultraviolet V volts wt wild type X-Gal 5-bromo-4-chloro-3-indolyl-p-D-galactopyranoside 1 INTRODUCTION A. Theories of aging Aging and death are universal phenomena. Aging may be defined as the progressive accumulation of changes associated with increasing susceptibility to death. Despite the universality of aging, the mechanism of the aging process is basically unknown. Therefore, a multiplicity of aging theories have been proposed. These theories may be broadly divided into genetic and non-genetic theories (Shock, 1981; Lamb, 1977; Warner et al., 1987). It is probable that no one theory will adequately explain all aging processes. Genetic or non-stochastic theories of aging propose that the series of aging processes are innately programmed within the genome of each organism. These theories postulate that aging and death are a normal part of the process of development and are therefore programmed events. Non-genetic theories of aging propose that stochastic events are responsible for the changes that occur during senescence. That is, as the organism ages, damage to structural and cellular components may be attributed to daily "wear and tear". The free radical theory of aging is a prominent stocastic theory. B. The free radical theory of aging The free radical theory of aging was originally proposed in 1955 (Harman, 1968; 1981; 1982) and postulates that free radical reactions are responsible for the progressive accumulation of changes that occur with age. Thus, aging processes are the result of random, deleterious free radical reactions. Free radicals produced as transient intermediates in 2 normal cellular metabolism may attack otherwise stable molecules and contribute to the observed cellular damage. In aerobic organisms, the processing of oxygen is the main source of free radicals. Superoxide radicals attack lipids in cell membranes resulting in lipid peroxidation. Lipid peroxidation in biological systems have been implicated in various pathological conditions (Yagi, 1982). Whether the rate of oxygen metabolism affects aging is unknown, but the toxicity of by-products of oxygen metabolism has been demonstrated (Fridovich, 1978; Fridovich, 1982a). Antioxidants found naturally within cells represent a potential class of longevity determinants. In order for an antioxidant to be a potential determinant of longevity, there should exist a positive correlation between the antioxidant levels and the lifespan potential (LSP). Limited food intake as well as dietary antioxidants which decrease free radical reactions have been shown to increase lifespan (Masoro et al., 1982; Ross, 1977). Thus, if free radical reactions do play a role in accumulated time-dependent damage and lifespan, then longer-lived species should have more effective mechanisms against free radicals than shorter-lived species. C. Superoxide dismutase as a longevity determinant The concentration of potential longevity determinants in primate and rodent species have been correlated to their lifespan potential. In particular, antioxidant compounds and enzymes which play an important role in cellular defenses against oxygen toxicity were tested (Cutler, 1984; 1985). In various organisms, there is a direct correlation between lifespan 3 potential and the ratio of SOD levels to specific metabolic rates (Tolmasoff et al., 1980). For each species there exists a direct relationship between the level of SOD in the tissue and lifespan potential, since the ratio of superoxide produced per amount of oxygen consumed is constant for each species. That is, the total amount of oxygen that a tissue uses over a lifespan is directly proportional to the amount of SOD protection that tissue has against the toxic by-products of oxygen metabolism. In contrast, the correlations are poorer, non-existent or negative for catalase, glutathione peroxidase, glutathione and ceruloplasmin. In an attempt to determine whether antioxidant efficiency of an organism decreases as a function of age, superoxide dismutase concentration as a function of age has been determined for various species. The results are varied (Bartosz, et al., 1978; Paynter and Caple, 1984; Reiss and Gershon, 1976a,b; Kellogg and Fridovich, 1976; Massie et al., 1979; Lammi-Keffe et al., 1984). In D. melanogaster, mitochondrial MnSOD declined 21% between 5 and 58 days of age, but cytosolic CuZn SOD remained relatively constant (Massie et al., 1980; Nickla et al., 1983). A shorter lived vestigial mutant of Drosophila was found to have a lower total SOD content than a wild-type strain (Bartosz et al., 1979). In Drosophila, the superoxide scavenging capacity of the tissues and the respiration rate are important determinants of lifespan (Fleming et al., 1987). However, the role of SOD in Drosophila aging is still unclear since two different wt strains with the same level of SOD activity have been found yet their life spans differ by 40% (Massie et al., 1981). In the light of these divergent results it appears 4 critical that the genetic background of Drosophila be controlled in order to study unambiguously the effects of different levels of SOD on aging. D. Drosophila as a model organism for aging studies Animal models with well-defined genetic, ecological, physiological and biochemical characteristics are required for studying the mechanisms of aging. Drosophila has been used extensively as a model organism for studying aging (reviewed by Lints and Soliman, 1988). Not only does Drosophila have a short lifespan, but it also has a small number of chromosomes and a wealth of genetic information. Furthermore, the postmitotic nature of most of the somatic tissues of the adult favors studies of the aging process since these are probably the only cells that senesce (Miquel et al., 1979). Although it may be argued that there are large structural and physiological differences between Drosophila and mammals, many age related changes initially discovered in Drosophila have been confirmed in mammals. Moreover, at the cellular and subcellular levels, Drosophila and mammalian aging seem quite similar. Insect and mammalian aging pigments (lipofuscin) are related at both the fine structural and biochemical levels and progressively increase with age. Lipofuscin has properties similar to that of peroxidized debris from subcellular membranes. This suggests that free radical induced breakdown of the mitochondrial membrane may occur with age, leading to lipofuscin storage in post-mitotic cells. Aging may be the result of accumulated peroxidative damage to mitochondria, resulting in decreased ATP production (reviewed in Miquel, 1988). 5 Drosophila has been used extensively to test many theories of aging. For example, the effects of various drugs, nutrients, antioxidants and vitamins, as well as the influence of genetic and environmental factors on aging processes have been studied (Lints and Soliman, 1988). Therefore, further research in Drosophila may contribute to our basic understanding of the aging process. E. Superoxide dismutase and oxygen toxicity In aerobic organisms, free radicals are generated as a by-product of normal oxygen metabolism via both enzymatic and non-enzymatic reactions. Activated oxygen species are important agents in oxygen toxicity and free radical damage. Free radicals are responsible for most of the toxic effects of chemical carcinogens, ionizing radiation and redox-cycling compounds such as paraquat. Free radical damage is postulated to be a factor in carcinogenesis and aging related disorders (Oberley, 1982; Ames, 1983). Multiple defenses against oxygen toxicity have evolved, the primary ones being enzymatic. The enzyme superoxide dismutase (SOD) removes the superoxide radical while catalase and glutathione peroxidase remove hydrogen peroxide ( H 2 O 2 ) : 0 2 " + O2" + 2H+ —> H 2 O 2 + O 2 H 2 0 2 + H 2 O 2 —> 2H 2 0 + O 2 The enzymatic removal of superoxide and hydrogen peroxide prevents formation of the very reactive hydroxyl radical via the iron catalyzed Haber-Weiss reaction: O 2 " + H 2 O 2 —> *0H + O 2 + OH" 6 The hydroxyl radical is postulated to be responsible for much of the cellular damage. Therefore, SOD, catalase and glutathione peroxidase constitute an essential intracellular enzymatic defense against oxygen toxicity (McCord and Fridovich, 1969). F. Assays for superoxide dismutase activity Due to the unique nature of the superoxide substrate, a multiplicity of assays for SOD activity have been devised. Each assay is best suited for a different purpose, and no one assay is entirely satisfactory (Fridovich, 1982b; McCord et al., 1977; Flohe and Otting, 1984; Bannister and Bannister, 1984; Crapo et al., 1978). All assays must have a superoxide generator and detector. Direct measurement of SOD catalytic activity using chemically generated superoxide solutions are possible, but tedious since superoxide solutions are extremely unstable (Marklund, 1976). The nitroblue tetrazolium (NBT) assay is useful for locating SOD bands on polyacrylamide gels. Riboflavin-sensilized photoproduction of superoxide reduces NBT to purple formazan. SOD inhibits reduction of NBT so SOD bands are achromatic against a purple background (Beauchamp and Fridovich, 1971). An enzymatic system for generating a continuous source of superoxide in the assay solution is most convenient. The cytochrome c assay uses xanthine/xanthine oxidase as a superoxide generator and the reduction of cytochrome c for detection (McCord and Fridovich, 1969). SOD scavenges the superoxide radicals generated in the assay system and thus inhibits the rate of reduction of cytochrome c. Modification of the original cytochrome c spectrophotometric assay has greatly increased its sensitivity (Crapo et al., 1978; Kirby and Fridovich, 1982). 7 With the assay methodology available, SODs from many sources have been isolated and may be broadly divided into three classes, according to the metal ligand(s) present, either copper and zinc (CuZn), manganese (Mn), or iron (Fe). Prokaryotes possess the two closely related Fe SOD and Mn SOD, whereas eukaryotes have tetrameric Mn SOD (MW 80-90,000) in the mitochondrial matrix and an independently evolved dimeric CuZn SOD (MW 31-33,000) in the cytosol (Weisiger and Fridovich, 1973; Steinman, 1982). Recently, an extracellular SOD which is found in extracellular fluids such as plasma and lymph has been identified in humans (Hjalmarsson et al., 1987). G. Superoxide dismutase in prokaryotes Studies in prokaryotes have demonstrated the importance of SOD in protecting the organism against oxygen toxicity. For example, increased intracellular levels of SOD correlated well with increased resistance towards oxygen (Fridovich, 1982a). In E. coli, Fe SOD is synthesized in aerobic or anaerobic conditions. The Mn SOD is not synthesized anaerobically, but is dramatically induced by the presence of oxygen and by paraquat, which promotes the formation of superoxide (Hassan and Fridovich, 1977). Induction of Mn SOD was similar in cells with differing concentrations of Fe SOD. This result suggests that the intracellular concentration of superoxide might not be responsible for regulating synthesis of Mn SOD (Nettleton et al., 1984). There is no evidence that prokaryotic Fe SOD and Mn SOD have different biological activities, but it is evident that their expression in the cell is quite different. 8 A powerful way to clarify the physiological significance of SOD is by the study of mutants. A double mutant lacking both Fe SOD and Mn SOD was highly sensitive to paraquat and hydrogen peroxide. Thus, a total absence of SOD creates a conditional sensitivity to oxygen (Carlioz and Touati, 1986). Similarly, a yeast mutant lacking Mn SOD was hypersensitive to oxygen (van Loon et al., 1986). These studies in prokaryotes and lower eukaryotes provide direct evidence that SODs play a protective role in cellular defense against oxygen toxicity. H. Superoxide dismutase in D. melanogaster The CuZn SOD from D. melanogaster has been purified to homogeneity. The enzyme is homodimeric, with each subunit having a molecular weight of 16,000. There are two polymorphic variants of superoxide dismutase -S O D F (fast) and SOD s (slow). The designations of F for 'fast' and S for 'slow' refer to the relative mobility of the enzymes in standard gel electrophoresis. Both variants are common in natural populations of D. melanogaster, although SOD F is the most abundant (Lee et al., 1981b). The two electromorphs differ in properties such as isoelectric point, specific activity, rate constant, thermostability, and amino acid composition. The specific activity of SOD s is three times greater than SODF, but SOD F is more thermostable. The amino acid sequence of SOD^ differs from SOD F by one amino acid. SOD^ has a lysine whereas SOD F has an asparagine at amino acid 96 (Lee and Ayala, 1985). The entire 151 amino acid sequence of SOD from D. melanogaster has been determined (Lee et al., 1985a,1985b). The amino acid sequence of 15 CuZn SODs (man, cow, sheep, pig, horse, rat, mouse, swordfish, fruit fly, 9 cabbage, spinach, maize, Neurospora, yeast, and Photobacterium) have been aligned and compared to each other. Specific roles have been assigned to the 23 invariant residues identified, 15 of which combine to form the active site of the enzyme (Getzoff et al., 1989). Human SOD has an average of 82% amino acid identity with SOD from other mammals, but only 61% identity with the fruit fly enzyme. D. melanogaster SOD does not cross-react with antibodies to bovine erythrocyte CuZn SOD (Lee et al., 1981a). The developmental profde of CuZn SOD activity in D r o s o p h i l a shows that the expression of the activity is ubiquitous during development. CuZn SOD levels are high in eggs and embryos, decrease during the larval stages, and then stay at a relatively low level until adult flies emerge from the pupae (Graf and Ayala, 1986). In the adult, the SOD content steadily increases until the sixth day, when it reaches a plateau. This level of CuZn SOD is maintained for at least 60 days post eclosion (Nickla et al., 1983). However, it should be noted that the mitochondrial MnSOD declined 21% between 5 and 58 days of age (Nickla et al., 1983). A direct approach to examining the protective role of SOD is by the use of mutant organisms with little or no SOD activity. A naturally occuring variant for CuZn SOD was isolated from the wild and found to have 3.5% of the SOD protein relative to wt (Graf and Ayala, 1986). This mutant was designated SOD 'null', since it has low SOD activity, but it is not a complete null. Some of the toxic effects of ionizing radiation are due to damage caused by superoxide radicals. SOD was shown to protect against the toxic effects of ionizing radiation in D. melanogaster. The sensitivity of SOD 1 0 'null' flies to radiation was much greater than wt. In addition, flies with SODS, which have a higher specific activity of SOD than flies with SODF, were more resistant to the toxic effects of ionizing radiation (Peng et al., 1986) . In this study, the effects of decreased SOD levels in the SOD 'null' on oxygen free radical metabolism and lifespan are also described. Recently, a SOD null mutant, c S 0 D n l 0 8 , apparently devoid of SOD activity was isolated (Phillips et al., 1989). The c S 0 D n l 0 8 D r o s o p h i l a have a reduced capacity to metabolize O2" radicals, decreased fertility and decreased lifespan. I. Superoxide dismutase genes The cDNAs and genes of SODs from various sources have been cloned and the nucleotide sequences determined. The FeSOD and MnSOD genes of E. coli have been cloned and analyzed (Nettleton et al., 1984; Sakamoto and Touati, 1984). In yeast, the CuZn SOD gene was cloned, sequenced and shown to have biological activity (Birmingham-McDonogh, 1988). A yeast mutant which was devoid of CuZn SOD activity was transformed with a plasmid containing the cloned gene. The CuZn SOD gene on the plasmid was able to rescue the oxygen sensitivity of the yeast mutant . The bacterial species, Photobacterium leiognathi, unexpectedly has a CuZn SOD rather than the FeSOD usually found in prokaryotes (Steinman, 1987) . The sequence of this SOD gene revealed the presence of a leader peptide. This result implies that this CuZn SOD is exported, unlike the eukaryotic CuZn SODs which remain in the cytosol. The rat CuZn SOD cDNA has been cloned and its sequence determined (Delebar et al., 1987; Ho and Crapo, 1987; Hass et al., 1989). It shows 96.7% n identity to the mouse cDNA sequence (Bewley, 1988; Getzoff et al., 1989). Northern blot analysis of total RNA from various rat and mouse tissues shows there is a single 0.7 kb SOD mRNA species (Delebar et al., 1987; Hass et al., 1989). Bovine CuZn SOD has been used in the treatment of osteoarthritis and other inflammatory conditions. The bovine enzyme is antigenically distinct from the human enzyme so it is preferable to use a recombinant human SOD that is identical to the authentic erythrocyte enzyme. Therefore, there has been great interest in the cloning, expression and production of the human CuZn SOD for therapeutic use. The sequence of the human CuZn SOD cDNA has been determined (Leiman-Hurwitz et al., 1982; Sherman et al., 1983). Of the two human SOD transcripts which are 0.9 and 0.7 kb in size, the 0.7 kb transcript is predominant (Sherman et al., 1984). The expression of the human CuZn SOD gene in E. coli has been described (Hallewell et al., 1985). A new type of SOD protein was recently discovered in humans and is the major SOD protein present in extracellular fluids such as plasma and lymph (Hjalmarsson et al., 1987). The cDNA sequence of the extracellular SOD revealed that amino acid residues number 96-193 have approximately 50% identity with the final two thirds of the sequences known for other eukaryotic CuZn SODs. Extracellular SOD has Cu and Zn as ligands as well, but contains a signal peptide, as expected from its role as a secretory protein. This extracellular SOD has been expressed in Chinese hamster ovary cells and the recombinant SOD has properties identical to native extracellular SOD (Tibell cl al.. 1987). 12 The human CuZn SOD gene resides on chromosome 21 at 21q22 and spans 11 kb of chromosomal DNA. Sequence analysis reveals that this gene is composed of five small exons separated by four introns (Levanon et al., 1985) . Four distinct processed CuZn SOD pseudogenes not residing on chromosome 21 have also been found (Danciger et al., 1986). Three of these pseudogenes were derived from the 0.7 kb SOD mRNA species while the fourth was derived from the 0.9 kb SOD mRNA species. Down's syndrome is one of the most common genetic abnormalities and is associated with three copies of chromosome 21, rather than the normal two. The location of the human CuZn SOD gene (chromosome 21 at 21q22), is also known to be involved in Down' syndrome (Lieman-Hurwitz et al., 1982) and patients with this condition show an increase of about 50% in CuZn SOD activity due to a higher level of the protein present (Lieman-Hurwitz et al., 1982). Mouse cells overexpressing human CuZn SOD showed membrane damaged due to increased lipid peroxidation (Elroy-Stein et al., 1986) . This damage is thought to be due to increased H2O2 resulting from efficient metabolism of the superoxide radical. Lipid peroxidation has been shown to occur in the brains of individuals with Down's syndrome. Thus, it was suggested that damage to the membrane may affect cell action and lead to mental deficiency. The human CuZn SOD gene was introduced into rat neuron cells (Elroy-Stein and Groner, 1988). The neuron cells overexpressing CuZn SOD had normal morphology, growth rate and response to nerve growth factor, but were impaired in neurotransmitter uptake. Neurotransmitter uptake 13 was inhibited by damaged membranes, which were the result of increased lipid peroxidation. Transgenic mice with additional human CuZn SOD genes outwardly appeared normal (Schickler et al., 1989). However, they had reduced levels of the neurotransmitter serotonin in their blood platelets, which is another symptom characteristic of Down's syndrome. The tongues of these transgenic mice had abnormal synapses between the neurons and the muscle cells, a condition found in the tongues of individuals with Down's syndrome. This condition was also apparent in senescent rats. These results suggests that CuZn SOD gene dosage may contribute to the neurobiological abnormalities observed with Down's syndrome. Furthermore, there may be a possible link between mental retardation, Down's syndrome and aging (Avraham el al., 1988). J . Aims a n d scope of this study We have chosen the fruit fly, Drosophila melanogaster, as a model organism for studying the effects of free radical metabolism on aging. In order to determine whether additional SOD activity affects oxygen metabolism and longevity in Drosophila, our approach was to clone the Sod gene from an isogenic stock and introduce additional copies of the gene back into the genome of the same stock via P element mediated transformation. Transformants overexpressing SOD were used to investigate the effects of increased SOD activity on oxygen metabolism and lifespan of the fly. 1. Isolation and characterization of the Drosophila cDNA and gene 1 4 Early mapping studies localized the D. melanogaster CuZn Sod locus to position 32.5 on the left arm of chromosome three (Jelnes, 1971). More recently, the Sod locus has. been mapped to 34.6, and is only 0.1 map unit away from the low xanthine dehydrogenase locus (lxd) (Schott et al., 1986; Campbell et al., 1986). A deficiency in the lxd region (D/(3L)lxd 9) was also found to be deficient for the CuZn Sod gene. The strain D/(3L)lxd 9/TM3565er contains only one copy of the Sod gene and had 50% of the wt SOD protein. Therefore, the Sod gene resides within this deficiency. The cloned Sod gene was hybridized to polytene chromosomes to confirm the location of the Sod locus. The strategy chosen to clone the SOD cDNA was to use a mixture of synthetic oligonucleotides representing all possible codon combinations predicted from a short amino acid sequence. The amino acid sequence of the D. melanogaster CuZn SOD is known (Lee et al., 1985a,1985b). Successful use of mixed oligonucleotide probes rests largely on probe design. Factors such as probe heterogeneity, base sequence, and length must be considered (Lathe, 1985). Despite the guidelines available, successful use of oligonucleotide probes are a matter of educated guesswork and experimentation. The amino acid sequence chosen should be specified by the least number of possible codons. For example, methionine and tryptophan have unique codons, but they are also two of the rarest amino acids found in proteins. Previous attempts to clone the gene used two 17 nucleotide long probes. One probe, GT3, was targeted to aa 90-95, whereas the other probe, SI, was targeted to aa 43-48 of the SOD protein. A SOD clone could not be isolated using GT3 or SI probes singly or in conjunction with 15 each other (Seto, 1987). However, the gene was successfully isolated using the 26 nucleotide long probe (13) described below. 2. P element transformation of the D. melanogaster CuZn SOD gene P elements are a family of mobile genetic elements in Drosophila and are efficient vectors for the introduction of functional genes into the germline. Transformation results in the expression of eukaryotic genes such that the gene products are indistinguishable from that of the endogenous chromosomal gene (Rubin and Spradling, 1982; Spradling and Rubin, 1982). A number of P elements have been cloned and sequenced (O'Hare and Rubin, 1983; Karess and Rubin, 1984). Intact P elements are 2.9 kb in size and encode a transposase which can mediate its own transposition as well as the transposition of smaller defective P elements into the germline. Smaller P elements are derived by a single internal deletion of the 2.9 kb element. Both intact and defective P elements (which lack the transposase gene) contain the same 31 bp inverted repeats at their termini, which are presumably recognized by the transposase during excision and insertion. Genomic DNA sequences adjacent to many P elements were found to be similar. These sequences were used to derive a 8 bp consensus sequence for the preferred site of P element insertion (O'Hare and Rubin, 1983). DNA fragments of interest may be introduced into the Drosophila germline using the P element as a vehicle. Cloned P elements can transpose from plasmids and stably integrate into chromosomal DNA. Microinjection of cloned P element DNA into the embryo shortly after fertilization results in the transposition of the P element into the germline 1 6 of the recipient embryo. The injected P element DNA integrates into the genome of a single pole cell. The pole cells are the precursors to germline cells. Due to the multiplicity of germline precursor cells in each embryo, the P element would only be inherited by a small fraction of the progeny which develop from that embryo. For the purpose of transformation, P element vectors were constructed with a multiple cloning site, but lacking the transposase gene. The transposase required for the transposition of the recombinant P element must be supplied by an intact helper P element. The helper P element is transposition defective because the 31 bp inverted repeat at one of its ends has been removed. Therefore, extrachromosomal DNA can be effectively transposed into the germline of D r o s o p h i l a by P element mediated transformation. The transposable P vector pUChsneo carries the neomycin resistance gene under the control of the heat-shock promoter and this provides resistance to the antibiotic G418 (Steller and Pirrotta, 1985). The transcription of the neomycin resistance gene may be increased by a heat-shock. The antibiotic G418 is structurally and functionally related to gentamycin, neomycin and kanamycin, which are inhibitors of protein synthesis. In contrast to these, G418 is toxic not only to prokaryotic but also to eukaryotic cells. The transposition of pUChsneo into the genome is detected by selecting transformants which have acquired resistance to G418. This system has the advantage over others in that it allows selection of transformants in any desired genetic background, rather than in mutant strains required for phenotypic selection. In this study, pUChsneo was used since it allows the selection of transformants in a desired isogenic 1 7 background. Maintaining the isogenic background of the transformants is particularly important, since genetic variability may affect their lifespan. Using this methodology, five Drosophila strains, each of which contains an additional copy of the Sod gene at a different chromosomal site were obtained. Analysis of the transformants showed that the genes were inserted and functional. 3. Effects of increased Sod expression on oxygen radical metabolism and lifespan Since the superoxide scavenging ability of tissues has been implicated as important determinants of lifespan, we chose to investigate the lifespan of the SOD 'null' mutant as well as that of the transformed lines which overexpress SOD. Since all the transformants had the same genetic background as the wt controls, it was possible to compare unequivocally the effect of increased SOD activity on oxygen radical metabolism and longevity. Paraquat (1 , r-dimethyl -4 ,4 ' bipyridinium dichloride; Pq^ + ) is a herbicide that is also highly cytotoxic and lethal to animals. Paraquat generates O 2 " radicals in vivo by a mechanism that involves the NADPH-dependent reduction of P q 2 + to the relatively stable Pq + radical which then reacts rapidly with O2 to produce O2" (Hassan and Fridovich, 1 9 7 9 ; Farrington et al., 1973) . Feeding adult Drosophila aqueous paraquat leads to exposure of the fly to acute levels of O2* radicals. The effect of SOD levels on oxygen free radical metabolism was investigated by measuring the sensitivity of the flies to paraquat. 1 8 MATERIALS AND METHODS A. Materials Deoxy and dideoxy NTPs were purchased from P.L. Biochemicals. [y-3 2P]ATP (3000 Ci/mmol, 10 uCi/ul) and [a- 3 2P]dNTP (3000 Ci/mmol, 10 u.Ci/u.1), [ 3 5S]dATPocS (10 u.Ci/u.1) were from Amersham Corp. and New England Nuclear (NEN). The a-phosphorothioate dNTP analogs were from NEN. The oligonucleotides 13, NS-1, NS-2, forward primer and reverse primer were synthesized on an Applied Biosystems oligonucleotide synthesizer by T. Atkinson (UBC). Restriction enzymes, T4 ligase, E. coli DNA polymerase I and E. coli DNA polymerase (Klenow fragment) were purchased from New England Biolabs, Bethesda Research Laboratories (BRL), Boehringer Mannheim, Promega Biotech, or Pharmacia and used as specified by the manufacturer. E. coli RNA polymerase was from P.L. Biochemicals. Modified T7 DNA polymerase (Sequenase™) was from United States Biochemical Corp. Calf intestinal phosphatase was purchased from Boehringer Mannheim. All enzymes were used as specified by the manufacturer unless indicated otherwise. BSA and lysozyme were supplied by Sigma. Agarose was from BRL, Genetic Technologies Inc. and Pharmacia. Acrylamide was from Eastman Kodak Co., N.N'-methylene bisacrylamide from Matheson, Coleman and Bell, and TEMED from BioRad. Liquified phenol (88% aqueous solution) was purchased from Mallinckrodt, formamide from BDH was deionized with Bio-Rad mixed bed resin AG501-X8(D). IPTG was purchased from BRL and X-gal, from Sigma. Nylon membranes (Hybond-N) were from Amersham Corp. and Curix RP1 X-ray film was from Agfa-Gevaert. G418 (Genelicin) was from GIBCO-BRL. Bacto-19 typtone, Bacto-yeast extract and Bacto-agar were purchased from Difco. Xanthine (2,6 dihydroxypurine, grade HI ) , ferricytochrome c (horse heart, type III) and xanthine oxidase (grade 1) were from Sigma. B. Bacterial strains, media, vectors, buffers and D r o s o p h i l a stocks E. coli strain Q358 (hsdR(r^-,m^~), supE, P2) and C600A////A (thi-1 thr-1 /euB6 lacYl ton A21 supEAA hflA\50 chr::TnlO) were hosts for vectors XEMBL3 and \gt\0, respectively (Kaiser and Murray, 1985). E. coli JM101 (supE, thi, A(lac-proAB), [F. traD36, proAB, lacl'i ZAM15]) and JM109 (recAl, endAl, gyrA96, thi, hsdRM, supEAA, relAl, X\ A(lac-proAB), [F, traD36, proAB, laclQ ZAM15] ) were hosts for pUC and M13 vectors (Yanisch-Perron et al., 1985). JM101/109 were propagated in M9-minimal salts medium (50 mM Na2HPC>4, 25 mM K H 2 P O 4 , 8.5 mM NaCl, 20 mM N H 4 C I , 1 mM MgS04, 0.1 mM CaCl2, 10 mM glucose, 0.001% thiamine) (Miller, 1972). Bacteria transformed with plasmid DNA were propagated in either LB (1% Bacto-typtone, 0.5% Bacto-yeast extract, 0.5% NaCl), 2YT (1.6% Bacto-typtone, 0.5% Bacto-yeast extract, 0.5% NaCl) or TB (1.2% Bacto-typtone, 2.4% Bacto-yeast extract, 4% glycerol, 17 mM K H 2 P O 4 , 72 mM K 2 H P O 4 ) . E. coli strain Q358 was grown in NZYM (1% NZ-amine, 0.5% Bacto-yeast extract, 0.5% NaCl, 10 mM MgCl2) and C600AW//A was grown in LB supplemented with 0.2% glucose. Plates were made by adding 1.5% agar to the media. The plasmid pUCl3 was a gift from Dr. S. Hayashi. The M13mpl8/19 vectors were amplified from P.L. Biochemical stocks. The P element 20 transformation vectors pUChsneo and phsit were amplified from transformed E. coli slocks provided by Dr. J. Leung. The composition of the following buffers were: TE 8 10 mM Tris-HCl, 1 mM EDTA (pH 8.0) SM 0.58% NaCl, 0.20% MgS04-7H20. 50 mM Tris-HCl (pH 7.5), 0.01% gelatin DNase I 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 0.5 mM CaCl2 10 X SET 0.1 M Tris-HCl (pH 8.0), 50 mM EDTA, 5 % SDS MOPS-E 20 mM MOPS, 5 mM NaOAc, 10 mM EDTA (pH 7.0) exo III 10 mM Tris-HCl (pH 8), 10 mM MgCl2, 1 mM DTT, 20 mM KC1, 0.1 mg/ml BSA SI nuclease 0.4 M NaCl, 0.1 M NaOAc (pH 4.5), 2 mM ZnS04, 0.4% glycerol 10 X Hin 100 mM NaCl, 100 mM Tris-HCl (pH 7.5) The D. melanogaster wild-type strain isogenic for all the major chromosomes was constructed by Dr. G. M. Tener. The chromosome 2,3 balancer stock CyO\TM2,Ubx/T(2;3)apXa (Lindsley and Grell, 1968) was obtained from Dr. P.L. Davies (Queen's Univ.; Kingston, Ontario). The SOD "null" mutant was generously provided by Dr. F.J. Ayala (UC Irvine; Irvine, CA) and the Sod deficiency strain D/(3L)lxd 9/TM3S6Ser was kindly provided by Drs. E.M. Meycrwitz (Cal. Tech., Pasadena, CA) and V. Finnerty (Emory Univ.; Atlanta, GA). C. Isolation of D. melanogaster DNA Total genomic DNA from Drosophila strains was isolated by the method of Jowett (1986). Approximately 400 flies were quick frozen in liquid nitrogen and homogenized in a mortar and pestle containing liquid nitrogen. The resulting powder was transferred into 4.0 ml of lysis buffer 21 (100 mM Tris-HCl (pH 8.0), 50 mM NaCl, 50 mM EDTA, 1% SDS, 0.15 mM spermine, 0.5 mM spermidine) and mixed by inversion. Proteinase K (400 ug) was added and the homogcnate incubated at 37°C for 1-2 hr with occasional mixing by inversion. The DNA was extracted with an equal volume of phenol (equilibrated to pH 8 by extracting with 10 mM Tris-HCl buffer (pH 8)). The upper aqueous phase extracted twice with an equal volume of phenol/CHCl3 and then once with CHCI3 only. The DNA was precipitated with 1/10 volume of 2.5 M NaOAc (pH 5.2) and 2 volumes of cold 95% EtOH. The DNA was pelleted by centrifugation and redissolved in 500-1000 ul of TE 8. The DNA was then incubated with RNase A at 100 u.g/ml for 30 min at 37°C, extracted with phenol/CHCl3 once, EtOH precipitated, dried and redissolved in TE 8. The size and quantity of the genomic DNA was checked on a 0.6% agarose gel. D. Bacteriophage lambda DNA preparation Single recombinant kgilO phage plaques were picked into 200 ul of SM buffer containing 5 ul of chloroform. The phage were allowed to diffuse out of the agar for 24 hr at 4°C. To prepare DNA from recombinant XgtlO phage clones, 100 ul of host C600A///M (concentrated 2.5 times in 0.01 M MgS04) was infected with 150 ul of the phage solution in 100 ul of 10 mM MgCl2/CaCl2 solution. The phage were adsorbed for 15 min at 37°C and used to inoculate 20 ml of pre-warmed NZYM media. The culture was shaken vigorously at 37°C until it Iysed clear (3-5 hr depending on the original phage titer). Chloroform (200 ul) was added and the culture swirled slowly for 5 min before pelleting the cell debris by centrifugation for 15 min at 8000 g. The supernatant was mixed with 0.15 volumes of 5 M NaCl, 0.3 22 volumes 50% PEG6000 and the phage precipitated for 3 hr or more at 4°C (Yamamoto and Alberts, 1970). The PEG-precipitated phage were pelleted by centrifugation (8000g, 15 min., 4°C) and the supernatant was discarded. The tubes were re-spun for another minute. The remaining supernatant was removed as cleanly as possible. The phage pellet was resuspended in 500 ul of DNase I buffer (50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 0.5 mM CaCl2) and incubated with DNase I (5 ul of 1 mg/ml) and RNase A (5 u.1 of 10 mg/ml) at 37°C. After incubation for 3 hr, the debris was pelleted by centrifugation for 1 min in a microfuge. The phage in the supernatant were treated with 10 ul of 10 mg/ml proteinase K in 1 X SET buffer (10 X SET=0.1M Tris-HCl (pH 8.0), 50 mM EDTA, 5% SDS) for 2 hr at 68°C. The phage DNA was purified by two phenol/CHCl3 (1:1) extractions and three C H C I 3 extractions. The DNA was concentrated by EtOH precipitation and resuspended in 50 ul TE 8 buffer (yield=l-2 pg). E. Isolation of D. melanogaster RNA 1. Isolation of total D. melanogaster RNA Total Drosophila RNA was isolated by the guanidinium/CsCl method of Chirgwin (Chirgwin et al., 1979) with the following modifications. One gram of flies were frozen at -70°C for a few minutes. The flies were placed in a mortar and pestle containing liquid nitrogen and ground to a fine powder. The powder was quickly transferred to a tube containing 6 ml of guanidinium solution (7.5 M guanidinium-Cl, 25 mM Na3Citrate(pH 7.0) and 0.1 M p-mercaptoethanol (added after auloclaving)) and mixed using a vortex. The solution was centrifuged at 8000 g for 5 min. The orange supernatant was removed as cleanly as possible. The solution was drawn 23 into a sterile disposable syringe (21 gauge needle) and passed through the needle 8-10 times until the viscosity of the solution decreased. The DNA must be sheared to minimize contamination of the RNA pellet. The solution was layered on top of a 1 ml CsCl cushion (38.5 g CsCl, 40 ml 25 mM Na3citrate (pH 5.0)) in 2" X 1/2" centrifuge tubes. The tubes were spun in a SW50.1 rotor at 42,000 rpm for 16-24 hr (22°C). After centrifugation, the upper guanidinium solution was carefully removed and the sides of the centrifuge tubes wiped with a tissue. The CsCl solution was removed without touching the RNA pellet on the bottom of the tube. The pellets were resusupended with 1200 ul of sterile water. Four aliquots of 300 u.1 each were made to obtain complete dissolution of RNA. The suspension of the RNA pellets was aided by heating at 55°C for 2-3 min intervals. The RNA was then concentrated by EtOH precipitation and resuspended in 300 u.1 of sterile water. The concentration of the RNA was measured by absorbance at 260 nm. The water and CsCl solutions were treated with DEPC. The solutions were made up to 0.1% DEPC, stirred at room temperature for 30 min and then autoclaved. 2. Isolation of poly(A)+ RNA The poly(A) + RNA was purified from total RNA as described (Maniatis et al., 1982). Total RNA was passed through an oligo(dT) column twice to produce essentially pure poly(A) + RNA. The RNA containing fractions were detected by spoiling 2 u 1 of each column fraction onto plates containing EtBr (0.4 g agarose, 40 ml TE 8 buffer, 4 u.1 of 10 mg/ml EtBr) and viewing the plate with uv light. The poly(A) + RNA was concentrated by EtOH precipitation and the concentration was measured by absorbance at 260 nm. F. Gel Electrophoresis 1. Neutral agarose gels The buffer used for agarose gel electrophoresis was 90 mM TBE (90 mM Tris, 90 mM boric acid, 1 mM EDTA, pH 8.3) and gel concentrations varied from 0.5-1.2% agarose (with 1 ug/ul EtBr). DNA was suspended in TE 8 buffer which contained 10% sucrose, 0.025% bromophenol blue, 0.0125% xylene cyanol, 0.025% SDS and 0.25 mM EDTA before loading onto the gel. The gels were run at 2.5V/cm for 12 to 14 hr, then photographed using a 254 nm transilluminator. 2. Formaldehyde agarose gels RNA was separated in 1.4% agarose gels containing 0.66 M formaldehyde in 1 X MOPS-E buffer (10 X MOPS-E = 0.2 M MOPS, 50 mM NaOAc, 10 mM EDTA, pH 7.0). The RNA (either 30 ug total RNA or 3 ug p o l y A + RNA) was dissolved in 2.5 ul water and 12.5 ul of RNA electrophoresis buffer (0.75 ml deionised formamide, 0.15 ml 10 X MOPS-E, 0.24 ml formaldehyde, 0.1 ml RNase free water, 0.1 ml glycerol, 0.08 ml 10% w/v bromophenol blue), then heated at 65°C for 15 min. One ul of 1 mg/ml EtBr was added to each sample before loading onto the gel. Electrophoresis was for 18 hr at 30V in 1 X MOPS-E buffer. After electrophoresis, the gel was placed on a 254 nm transilluminator and photographed. 3. Denaturing polyacrylamide (DNA sequencing) gels Products of the DNA sequencing reactions were loaded onto 4, 6 or 8% polyacrylamide gels (acrylamide:melhylcnebisacrylamide (19:1), 8 M urea, 25 0. 06% ammonium persulfate, 20 ul TEMED, 50 mM TBE). Regular gels were 40 cm X 18 cm X 0.35 mm and wedge gels were made by the addition of a 1" piece of 0.35 mm spacer at the very bottom of the gel. Electrophoresis was at 1600-1800V such that the current did not exceed 25 mA. The gels were dried onto Whatman 3 MM paper using a vacuum gel drier (1 hr, 80°C) and exposed to X-ray film at room temperature for hours or days depending on the radioactivity incorporated into the products. G. Gel hybridization analysis 1. Southern blot analysis of genomic and cloned DNA Agarose gels were denatured for 10 min twice in 1.5 M NaCl/0.5 M NaOH and neutralized for 10 min twice in 1.5 M NaCl/1.0 M Tris-HCl (pH 7.5) at room temperature with shaking (Southern, 1975). The DNA was transferred to nylon membranes (Hybond-N) with 20 X SSC overnight. The membranes were air dried before covalent linkage of the DNA by uv irradiation (254 nm, 4 min) and were washed in 6 X SSC before prehybridization. For oligonucleotide probes, the filters were prehybridized in 6 X SSC, 10 X Denhardt's reagent (1 X Denhardt's reagent = 0.02% Ficoll, polyvinyl pyrrolidone, and BSA), 0.2% SDS in heat sealed bags for at least 3 hr. The DNA on the filters were hybridized with [ 3 2P]-labelled oligonucleotides at 107 cpm/ml in 6 X SSC, 5 X Denhardt's reagent, 50 mM sodium phosphate (pH 6.8), 0.5% SDS, and 20 ug/ml E. coli tRNA at 55°C for 14-20 hr. The filters were washed at room temperature (twice for 30 min) followed by a high stringency wash in 6 X SSC at 55-65°C (twice for 10 min). When nick-translated probes were used, the prehybridization solution contained 6 X SSC, 0.01 M EDTA, 5 X Denhardt's reagent, 0.5% SDS 26 and 100 ug/ml sheared salmon sperm (or herring testes DNA). Nick-translated DNA probes were added to the prehybridization solution and were hybridized 8 hr or more at 68°C. Filters were washed for 30 min twice in 2 X SSC/0.5% SDS, 30 min twice in 2 X SSC/0.1% SDS and for 1 hr twice in 0.1 X SSC/0.1% SDS at 68°C. 2. Northern Blot Analysis The RNA formaldehyde agarose gels were soaked in 10 X SSC at room temperature for 20 min twice. The RNA in the gels were transferred onto nylon membranes (Hybond-N) with 10 X SSC and air dried before illumination with uv (254 nm, 4 min). The membranes were prehybridized in 0.5 M sodium phosphate (pH 7.2), 7% SDS, 1% BSA and 1 mM EDTA at 68°C for 12 hr or more. The radiolabeled DNAs (10^ cpm/u.g) were added (106 cpm/ml) and hybridized in the same buffer for 14 hr or more at 68°C. The filters were washed in 40 mM sodium phosphate (pH 7.2), 5% SDS, 0.5% BSA and 1 mM EDTA for 60 min twice at 68°C. A higher stringency wash was performed in 40 mM sodium phosphate (pH 7.2), 1% SDS and 1 mM EDTA for 60 min twice at 68°C. This method produces stronger hybridization signals than the methods used for DNA-DNA hybridizations described above (Mahmoudi and Lin, 1989). H. Purification of oligonucleotide probes Oligonucleotides were purified essentially as described by Atkinson and Smith (1984). The crude oligonucleotides were suspended in 50 pi of sterile distilled water. A 10 ul aliquot was mixed with 20 pi of deionized formamide, heated at 90°C for 3 min and rapidly cooled on ice. The oligonucleotide solution was loaded into three 10 mm slots on a 20% 27 polyacrylamide, 50 mM TBE, 7 M urea gel (0.5 mm X 40 cm X 18 cm). As a reference for predicting oligonucleotide mobility, a formamide dye mixture (98% deionized formamide, 10 mM EDTA, 0.2% bromophenol blue, 0. 2% xylene cyanol) was loaded on either side of the gel slots which contain oligonucleotide. The gel was run al constant voltage (1500 V) until the xylene cyanol was 20 cm down the gel (about 3 hr). The gel was transferred to a piece of Saran wrap and the oligonucleotides were visualized by viewing under the uv lamp with a fluorescent plate (Kresel gel 60 F254) underneath the gel. Short wavelength uv illumination from above resulted in dark oligonucleotide bands which were excised from the gel using a scalpel. The gel slices were placed in a 1.5 ml Eppendorf tube and incubated overnight al 37°C in 1 ml of 0.5 M N H 4 OAc. The oligonucleotide containing solution was filtered through a small Millipore disc (Millex HV4, 45u pores) to remove gel fragments. Contaminants were removed by using a reverse phase chromatography , cartridge. These C1 8 SEP-PAK cartridges (Waters Scientific) were washed with 10 ml acetonitrile, followed by 10 ml of distilled water. The oligonucleotides were loaded into the cartridge and washed with 10 ml of distilled water. The pure oligonucleotides were isolated by eluting with three 1 ml aliquots of 20% acetonitrile/water. Oligonucleotide concentrations were determined by absorbance at 260 nm (A260=l for 20 ug/ml), evaporated to dryness using a Savant Speed Vac concentrator, and resuspended to the desired concentration in sterile distilled waicr. 1. Labelling DNA probes 1. Nick-translation of DNA 28 Plasmid or double-stranded DNA probes were labelled with [i2-P] by nick-translation (Rigby et al., 1977) to a specific activity of 107 -10 ^ cpm/ug. DNA probes (0.1-1 tig) were typically reacted with 50 u.Ci [a-3 2P]dATP in 4 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 0.05 ug/ul BSA, 10 mM DTT, 0.2 mM CaCl2, 0.02 mM dCTP, dTTP, dGTP, 0-25 pg DNase I (depending on the DNA quality) and 10 units of E. coli DNA polymerase I. For probes with higher specific activity, 2 to 3 radioactive nucleotides were used in the nick-translation reaction. The mixture was incubated at 15°C for 1-1.5 hr and the reaction terminated by the addition of 3 volumes of 1% SDS and 10 mM EDTA. After the addition of 5 pg of E. coli tRNA as carrier, the unincorporated radioactivity was removed by gel filtration chromatography using a 18 X 0.196 cm 2 Ac A 54 (MW 5000-7000) matrix (Fischer Scientific). The column buffer was 10 mM Tris-HCl (pH 7.5), 0.25 mM EDTA and 0.2 M NaCl. The probe was eluted in the void volume and was typically collected in a 500-800 pi volume. The probe was denatured just before use by heating in a boiling water bath for 3 min. 2. End-labelling with polynucleotide kinase The oligonucleotides were labelled with [ 3 2P] by polynucleotide kinase which transfers the radioactive phosphate from [7- 3 2P]ATP to the 5' OH of the oligonucleotide. One hundred picomoles of the mixed oligonucleotides (probe 13) were reacted with 250 u.Ci of [7- 3 2P]ATP and 25 units of polynucleotide kinase in 0.1 M Tris-HCl (pH 7.5), 20 mM MgCh, 0.2 mM EDTA, 0.2 mM spermidine and 10 mM DTT for 45 min at 37°C. The reaction was terminated by heating at 65°C for 10 min. E. coli tRNA (250 pg) was added as a carrier and the sample diluted with the addition of 4 volumes of TE 8. The 29 reaction mixture was loaded onto a 0.5 ml column of DEAE-cellulose and washed with 4 column volumes of TE 8. The unincorporated label was usually removed by 16 column volumes of 0.2 M NaCl/TE 8 and oligonucleotides were eluted in 6 column volumes of 1.0 M NaCl/TE 8. Total incorporated counts were routinely 2 X 108 cpm (30-40% incorporation). The probes were hybridized to filters at 40 ul/cm 2 and no less than 1 X 107 cpm/ml in 6 X SSC. 50 mM sodium phosphate (pH 6.8), 5 X Denhardt's reagent, 0.5% SDS and 20 ug/ml E. coli tRNA. J. Screening lambda libraries 1. Screening a D. melanogaster cDNA library in XgtlO The titer of a D. melanogaster embryonic (3-12 hr) cDNA library (Poole et al., 1985) was determined by plating a series of 10-fold dilutions of the original phage stock. An overnight culture of host C600A////A grown in LB-0.2% maltose was pelleted and resuspended in 0.01 M MgS04 such that the A600=15. To produce small plaques at a density where they are almost confluent, 400 \i\ of host cells were infected with 3 X 105 pfu in 1000 ul of 10 mM MgCl2/CaCl2- The phage were plated on 150 X 15 mm plates containing LB-0.2% glucose with 8 ml of top agarose (0.7% in LB-glucose). The top and bottom agar were poured on a level surface to obtain uniformly distributed phage plaques. The plates were incubated inverted at 37°C for approximately 8 hr until the plaques were just touching (approx. 30,000 pfu/plate). The library was screened by the in situ plaque hybridization method of Benton and Davis (1977). The plates were chilled at 4°C for 1 hr before blotting the plaques onto 152 mm nylon filters (Hybond-N). The phage DNA were adsorbed by placing two filters on each plate sequentially, 30 the first for 3 min and the second lor 5 min. The orientation of the filters on the agar plates was marked by asymmetric ink spots and air dried. The phage DNA was denatured and neutralized as described (Benton and Davis, 1977). The phage from 14 plates were lifted in duplicates (approx. 4.2 X 10^  pfu) and the DNA was covalently linked to the membrane by irradiation with uv light (254 nm, 4 min). The filters were washed in 6 X SSC and prehybridized for at least 3 hr in the absence of radioactive probe (6 X SSC, 10 X Denhardt's reagent, 0.2% SDS) and hybridized for 14-20 hr (at 55°C) with 10^ cpm/ml radioactive oligonucleotide 13. A maximum of ten filters were hybridized at once stacked up in a 150 X 10 mm Petri plate with 16 ml of hybridization solution. A plastic disc the size of the filter was placed on top of the stack of filters to keep them immersed in the solution. The filters were washed in a large excess of 6 X SSC at room temperature with shaking for two 30 min intervals. A high stringency wash was performed at 55°C for 10 min twice. The filters were exposed to X-ray film for 3 days at -70°C with an intensifying screen. Agar plugs containing plaques from the region corresponding to a positively hybridizing plaque were picked with the wide end of a sterile Pasteur pipette into 0.5 ml of SM buffer with 5 u.1 of CHCI3. In order to isolate a single positive phage from the agar plug picked in the high density screen, the phage were plated at a lower density such that single plaques were well separated. The plaques on these plates were transferred onto nylon membranes and the phage DNA hybridized with radiolabeled probe. The positively hybridizing plaques were picked with the narrow end of a Pasteur pipette into 200 pi of SM buffer containing 5 pi of CHCI3. This procedure was repeated two to three times (secondary and 31 tertiary screens) to produce unique plaques which hybridized the 13 probe. 2. Screening a D. melanogaster genomic library A D. melanogaster genomic library was constructed using the vector XEMBL3 (Leung, 1988) from an isogenic strain of Oregon R (GMT, unpublished). The XEMBL3 phage were added to 100 u.1 of 10 mM MgCl2/CaCl2 and 100 pi of host Q358 and plated on NZYM plates with NZYM top agarose. A 20 ml stationary culture of the host was concentrated 5-fold in 0.01 M MgS04 before use. A total of 60,000 pfu from this library were plated at a density of 10,000 pfu per 10 X 15 mm standard sized Petri plate. The plaques were transferred onto membrane filters, hybridized and washed as described above for the cDNA library. K. DNA subcloning 1. Ligation of DNA into vectors The DNA was disgested with restriction enzymes under the conditions described by Maniatis (1982). For subcloning, the plasmid vector was digested with the appropriate restriction enzymes and heated at 65°C for 10 min. Calf intestinal phosphatase (10U) was added and reacted for 30 min at 50°C. The reaction was terminated by adjusting the reaction mixture to 1 X STE (10 X STE= 0.1 M Tris-HCl (pH 8.0), 1 M NaCl, 10 mM EDTA) in a 100 ul volume and heating at 68°C for 15 min. The mixture was extracted twice with phenol/CHCl3 (1:1) and once with CHCI3 before the DNA was concentrated by EtOH precipitation. The DNA to be subcloned was digested with appropriate restriction enzymes, mixed in varying molar ratios with 100 ng of linearized and dcphosphorylatcd plasmid DNA and ligated in 50 3 2 mM Tris-HCl (pH 7.5), 10 mM MgCl2, ImM DTT, and 0.8 mM ATP with 0.1 units T4 DNA ligase/10 ul reaction volume al 15°C for 12-18 hr. 2. Transformation of bacteria with DNA Recombinant plasmid or M13 R F DNA was introduced into JM101/109 that were made competent for transformation by the CaCl2 method. A JM101/109 colony from a minimal glucose plate or culture was grown in 2YT until A600 w a s 0.6-0.7. The cells were pelleted at 4000 g for 5 min and resuspended in CaCl2 as described by Maniatis (1982). Aliquots (300 ul) of competent cells were incubated on ice with aliquots of the ligation mixture for 40 min. For plasmid transformation, the cells were heat shocked at 42°C for 3 min and plunged into ice; 0.7 ml of LB was added and the cells shaken for 1 hr at 37°C. Aliquots (0.1-0.3 ml) were plated on LB-Amp plates (100 ug/ml) with 50 pi Xgal (2%) and 10 ul IPTG (100 mM). For M13 transformations, the cells were returned to room temperature after heat shock; the cells were plated with 50 ul Xgal (2%), 10 pi IPTG (100 mM), 200 ul fresh exponential JM101/109, and 3 ml soft agarose (0.7% in 2YT at 55°C) on 2YT plates. After overnight incubation at 37°C, white transformants (colonies or plaques) were picked individually or screened with a radiolabeled DNA probe after transfer onto nylon membranes. 3. Growth of transformants (a) Small scale plasmid preparation Colonies containing plasmids were picked into 2 ml of LB-Amp or TB-Amp (100 ug/ml) and the bacteria were grown to saturation. M13 transformants were grown in 2 ml of 2YT containing 20 ul of an overnight minimal glucose culture of JM 101 /l09. M13 transformants were grown for 3 3 5-8 hr at 37°C. Plasmid and RF DNA were isolated by the alkaline lysis method (Birnboim and Doly, 1979). Part of the cultures were frozen in 15% glycerol as stock and the supernatant from M13 cultures were stored as high titer phage or used in ssDNA template preparations, (b) Large scale plasmid preparation TB-Amp cultures (500 ml) were inoculated with transformed E. coli and grown to saturation. The cells were pelleted by centrifugation at 6000g for 5 min in two 250 ml centrifuge tubes. The supernatant was discarded and each pellet was resuspended in 5 ml of 0.9% glucose/25 mM Tris-HCl (pH 8.0)/10 mM EDTA containing 20 mg lysozyme. The suspension was vortexed and incubated at room temperature for 5 min. The cells were lysed by addition of 10 ml of ice cold 0.2 M NaOH/1% SDS to each tube and the tubes were placed on ice for 10 min. The chromosomal DNA was precipitated by the addition of 7.5 ml of ice cold 5 M KOAc (5 M OAc -, 3 M K + ) , incubated on ice for 15 min, and pelleted by centrifugation at 4°C (8000g for 20 min). The supernatant was extracted with 10 ml of phenol/CHCl3 (1:1) and the DNA in the upper aqueous phase was precipitated with 0.6 volumes of isopropanol. The DNA was pelleted by centrifugation at 25°C (8000 g, 10 min). The pellet was rinsed several times with 95% EtOH and air dried brieOy. Each pellet was resuspended in 4 ml of TE 8 and 200 ul of 250 mM EDTA. Powdered CsCl (4.2 g) and 300 ul of 10 mg/ml EtBr was added and the solution vortexed to dissolve the CsCl. The solutions were incubated on ice for 15 min and the RNA pelleted by centrifugation (8000g, 10 min, 4°C). The supernatant was removed and placed into two Beckman quick seal centrifuge tubes. The tubes were 34 centrifuged in the VTi65 rotor (65,000 rpm, 4 hr; 60,000 rpm, 8 hr). The tubes were clamped on a retort stand and the plasmid bands visualized in a long wave uv lamp box. The lower plasmid band was removed using a 1 ml syringe fitted with a 21 gauge needle. Two volumes of water was added to the DNA solution and the EtBr removed by three butanol extractions. The plasmid DNA was precipitated with two volumes of 95% EtOH at -20°C. The DNA pellet was washed in 70% EtOH, dried and resuspended in 75-100 pi of TE 8 (depending on the size of the DNA band) and the DNA concentration measured by absorbance at 260 nm. 4. Deletion subclones for sequence analysis The DNA fragment of interest was subcloned into pUC13 or M13mpl8/mpl9. The length of the DNA fragment was decreased in a progressive, controlled manner by use of exonuclease III (Henikoff, 1984). The plasmid DNA was cut at restriction site A in the multiple cloning site. In method I, the restriction enzyme A produces a 3'-overhang resistant to exo III digestion (figure 1). Next, the clone was cut at a second restriction enzyme site (B), which lies between site A and the end of the DNA fragment to be digested (figure 1). Restriction enzyme B produces a 5'-overhang where exo III can initiate digestion into the fragment of interest. One limitation of this method requires that the DNA fragment to be degraded must not contain any restriction sites for enzyme A or B. In method II, the restriction enzyme A produces a 5' overhang, which is not resistant to exo III digestion. Therefore, both ends were made resistant to exo III digestion by the addition of a-thionucleotides ([aSjdNTP). The Sp diastcriomcr of the nucleoside a-thiotriphosphates 35 Figure 1. Generating deletion subclones for sequence analysis. The DNA fragment (open box) was subcloncd into Ml3 or pUC vectors (solid line). The plasmid DNA was cut at restriction site A in the multiple cloning site. In method (A), the restriction cn/.yme A produces a 3'-overhang which is resistant to ExoIII digestion. Next, the clone was cut with a second restriction enzyme B, which produces a 5'-overhang, where ExoIII initiates digestion into the fragment. In method (B), the restriction enzyme A produces a 5'-overhang, which is not resistant to ExoIII digestion. Both ends are made resistant to ExoIII digestion by the addition of a-phosphorothioate nucleotides (dNTP[aSj). The.DNA molecule was then cut with restriction enzyme B which produces a 5'-overhang where ExoIII digestion initiates. In both methods ExoIII digestion was stopped at specific intervals and a fraction of the molecules cut with restriction enzyme C, which releases the partially deleted DNA fragment (open box) from the vector DNA (solid line). The size of the deletions were estimated by separating the cut DNA by agarose gel electrophoresis. DNA fractions with the appropriate size deletions were religated and used to transform competent E. coli. The appropriate DNA templates were prepared for sequence analysis. 36 1. enzyme B 2. Exo I I I /S l nuclease 3. Klenow + 4 dNTPs C r A C c II (Dr A © r 1. Klenow + dNTP[aS] 2. enzyme B 3. ExoI I I /SI nuc lease 4. Klenow + 4 dNTPs C — U © r c -4: 2. enzyme C check s i z e o f d e l e t i o n on agarose gel 1. T4 U g a s e 2. Transform E. c o l l 3. Prepare templates f o r DNA sequence 37 (which have a sulfur substituted for an oxygen at the a-phosphate) can act as substrates for E. coli DNA polymerase 1; placement of an a-thionucleotide ([aS]dNTP) at one of the 3' ends of a DNA fragment blocks digestion by exo III from that end (Putney et al., 1981; Guo and Wu, 1982). Again, restriction enzyme B was used as in the first method. In both methods, exo III digestion was stopped at specific intervals. A fraction of the molecules were cut with restriction enzyme C, which releases the partially deleted DNA fragment from the vector DNA (figure 1). The size of the deletions were estimated by separating the fragments by agarose gel electrophoresis. DNA fractions with appropriate size deletions were used to transform competent E. coli. The appropriate templates were prepared for DNA sequence analysis. In method I, the plasmid or RF DNA (30 ug) was digested with enzyme A (eg. PstI) and then enzyme B (eg. BamHI). The DNA was EtOH precipitated and resuspended in 220 ul of exo III digestion buffer (10 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 1 mM DTT, 0.1 mg/ml BSA, 20 mM KC1) and prewarmed at 37°C for 5 min. Exo III (300 units) was added to initiate the reaction and 20 pi aliquots were removed every 30 seconds for 5.5 min. The 20 ul aliquots were placed into 20 ul of 2 X SI nuclease buffer (0.4 M NaCl, 0.1 M NaOAc (pH 4.5), 2 mM ZnS04, 0.4% glycerol) which was sitting on ice. SI nuclease (3-5 units) was added to each fraction and allowed to reacted at 37°C for 5 min. Each fraction was extracted with an equal volume of phenol/CHCl3 and EtOH precipitated overnight at -20°C. SI nuclease produces DNA molecules with blunt ends. However, any imperfect blunt ends were made flush by treatment with 2 units of DNA polymerase I (Klenow) and 0.5 mM of each 38 dNTP for 30 min at room temperature in 20 pi of 50 mM NaCl restriction enzyme buffer. Each fraction was EtOH precipitated and resuspended in 10 pi of TE 8. A 3 pi aliquot from each fraction was cut with a restriction enzyme C, which releases the partially deleted insert DNA from the vector DNA. The size of the deletions were estimated by separating the digested DNA in a 0.7% agarose gel. The DNA fractions with the appropriate size deletions were ligated (1 pi of each) to form circular molecules and used to transform competent JM109. Colonies or plaques from each transformation were picked and the DNA templates were prepared. In method II, the DNA (30 pg) was digested with enzyme A, EtOH precipitated, and redissolved in 50 pi of 0-50 mM NaCl restriction buffer and reacted with 0.5 mM of the appropriate [aS]dNTP and 10 units of DNA polymerase I (Klenow) at room temperature for 1 hr. The reaction mixture was extracted once with an equal volume of phenol/CHCl3 and EtOH precipitated. The DNA molecules were redissolved in a restriction enzyme buffer appropriate for enzyme B and then digested with restriction enzyme B. The remaining steps were performed as described above. L. DNA sequence determination by the Sanger method 1. DNA template preparation (a) Single-stranded DNA templates Single-stranded DNA templates from M13 transformants were prepared essentially as described by Messing (1983). A 1.2 ml aliquot of the M13 culture was spun for 5 min in a microfuge. The supernatant was carefully removed and 0.3 ml of 20% PEG6000/2.5 M NaCl was added to it. The phage were precipitated at room temperature for 15 min and pelleted 39 by centrifugation for 15 min in the microfuge. The supernatant was discarded and the pellet was resuspended in 0.2 ml TE 8 and extracted twice with an equal volume of phenol/CHCl3 (1:1) being careful to leave all of the interface. The aqueous layer was EtOH precipitated twice and redissolved in 50 pi of TE 8. (b) Double-stranded DNA templates The plasmid or Ml3 RF preparations were digested with RNase A (1 u.g/u.1) at 37°C for 15 min. The RNA was removed by precipitation with 0.6 volumes of 2.5 M NaCl/20% PEG6000. The sample was left on ice for 15 min and centrifuged for 10 min in a microfuge. The supernatant was removed and the pellet rinsed with 95% EtOH to remove all traces of PEG. The pellet was redissolved to an appropriate concentration and 2-10 pg of DNA were denatured in 0.2 N NaOH (40 pi total volume) for 5 min at room temperature. The solution was neutralized by the addition of 1/10 volume of 2 M N H 4 O A C (pH 4.5), precipitated with 2 volumes of 95% EtOH (at -20°C) and pelleted. The DNA was stored in EtOH, dried and resuspended just before use (Chen and Seeburg, 1985). 2. Use of Klenow polymerase DNA sequence was determined by the dideoxynucleotide chain termination method (Sanger et al., 1977). Single-stranded DNA templates (5 pi) were mixed with 1 pi (4 pmoles) of primer (forward primer 5'-TCACGACGTTGTAAAAC-3'; reverse primer 5'-CAGGAAACAGCTATGAC-3'; NS-1 5'-AGACCTTCACGGGCGTA-3'; NS-2 5'-CAGGGTGGACAGAGCT-3'; 13 5'-AA C/T TTIGTIGG A/G CA A/G TCICCIGTIGC-3') and 2 pi of annealing buffer (100 mM NaCl, 100 mM Tris-HCl (pH 7.5)) The mixture was heated for 10 min at 65°C 40 and allowed to cool slowly to room temperature. Double-stranded DNA templates (2-10 ug) were redissolved in the same manner as for the ssDNA templates, except the primer was annealed by heating at 37°C for 15 min. In both cases, 1 pi of 15 uM dATP and 1.5 ul [a- 3 2P]dATP (3000 uCi/mmole) were added to the template/primer mix and 2.2 pi of the final mixture was distributed to tubes containing 1.5 ul of each of the A.T.C.G deoxy/dideoxy mixes. The following nucleotide mixes were used (Newton, 1984): dG/ddG: 89 uM ddGTP, 7.9 uM dGTP, 158 uM dTTP, 158 uM dCTP dA/ddA: 116 uM ddATP, 111 uM dGTP, 111 uM dTTP, 111 uM dCTP dT/ddT: 547 uM ddTTP, 158 uM dGTP, 7.9 uM dTTP, 158 uM dCTP dC/ddC: 547 uM ddCTP, 158 uM dGTP, 158 uM dTTP, 10.5 uM dCTP The reaction was initiated by the addition of 1 ul of DNA polymerase I Klenow fragment (0.5 units/ul in 80 mM potassium phosphate (pH 7.5), 0.8 mg/ml BSA, 40% glycerol, 10 mM DTT). The four tubes were incubated at 37-55°C for 15 min and then chased by the addition of 1 ul of dNTP (0.5 mM) to each tube followed by another 15 min incubation. The reactions were terminated by adding 5 ul of formamide/dye mix (98% deionized formamide, 10 mM EDTA, 0.2% bromophenol blue and xylene cyanol). The samples were heated for 3 min at 90-100°C, plunged on ice and loaded onto denaturing polyacrylamide gels. 3. Use of modified T7 DNA polymerase (Sequenase™) S e q u e n a s e ™ (modified T7 DNA polymerase) was also used for sequence determination (Tabor and Richardson, 1987). The DNA template (7 ul) was annealed to 1 ul (0.5 pmole) of primer (forward primer 5'-GTAAAACGACGGCCAGT) in 2 ul of 5 X sequencing buffer (5 X buffer= 200 mM 41 Tris-HCl (pH 7.5), 50 mM MgCl2, 250 mM NaCl). The tube was warmed to 65°C for 2 min and allowed to cool to room temperature slowly. Two pi of labeling mix (1.5 uM dGTP, 1.5 pM dCTP, 1.5 pM dTTP), 1 pi 0.1 M DTT, 0.5 pi [a-3 5S]dATP or [ a- 3 2P]dATP (10 pCi/ul), and 2 pi Sequenase™ (diluted 1:8 in TE 8) was added to the template/primer mixture and incubated for 5 min at room temperature. The template/primer mixture was distributed (3.5 pi to each tube) to 4 pre-warmed tubes containing 2.5 pi of each of the following: G: 80 uM dGTP, 80 uM dATP, 80 pM dCTP, 80 pM dTTP, 8 uM ddGTP A: 80 u.M dGTP, 80 pM dATP, 80 pM dCTP, 80 pM dTTP, 8 pM ddATP T: 80 uM dGTP, 80 pM dATP, 80 pM dCTP, 80 pM dTTP, 8 uM ddTTP C: 80 pM dGTP, 80 pM dATP, 80 uM dCTP, 80 pM dTTP, 8 pM ddCTP The tubes were incubated for 5 min at 37°C and the reaction was terminated by the addition of 4 pi of stop solution (95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol FF). The samples were heated to 75-80°C for 2 min and loaded onto the gel immediately. 4. Orientation of Ml3 clones (a) Hybridization with oligonucleotide probes Ml3 ssDNA templates (2 pi aliquot) were separated on an agarose mini-gel. The DNA was transferred to a membrane by the method of Southern. The membrane was hybridized with labelled oligonucleotides to determine which templates were of the coding or non-coding strand. Alternatively, the DNA in the gel was denatured for 10 min in 0.15 M NaCl/0.5 M NaOH and the gel neutralized for 10 min in 0.15 M NaCl/1.0 M Tris-HCl (pH 7.5). The 42 gel was placed on a glass plate, dried on a hot plate, and used directly for hybridization with the labelled oligonucleotides, (b) T-track analysis The orientation of the clones was also determined by T-track analysis. To determine the orientation of 15 ssDNA templates, 4 pi of forward primer (A260= 1). 8 pi 10 X Hin buffer (100 mM NaCl, 100 mM Tris-HCl (pH 7.5)) and 12 pi distilled water were mixed together. The primer mixture (1.2 pi) was mixed with 0.8 pi of the ssDNA template and the primer was annealed to the template by heating at 65°C for 10 min. To each sample, 1.7 pi of dT/ddT mix (5 pi [a-32P]dATP (10 pCi/pl), 1 pi 60 pM dATP, and 30 pi of 547 pM ddTTP/158 pM dGTP/7.9 pM dTTP/158 pM dCTP) were added. Klenow polymerase (0.24 units) was added to each tube and reacted at room temperature for 15 min. The reactions were chased with 1 pi of 0.5 mM dNTP for 15 min at room temperature. The reactions were terminated by addition of 5 pi of formamide/dye mix and loaded onto a denaturing polyacrylamide gel immediately. M. P element transformation of Drosophila by microinjection 1. Preparing the P element transformation vectors The restriction fragment containing the Sod gene was isolated and ligated into the multiple cloning site of the P element plasmid pUChsneo to form pneoSOD. The supercoiled plasmids consisting of the recombinant transposon (pneoSOD) and helper (phsTt) were purified on a CsCl gradient (see section K. 3 (b)). The DNAs to be injected, (pneoSOD and phsji)), were coprecipitated in EtOH, washed in 70% ElOH/0.2 M NaCl, and washed again in 70% EtOH. The pellets were redissolved in 50 p i microinjection buffer (5 43 mM KC1, 0.1 mM sodium phosphate (pH 6.8) which had been passed through a 0.45 urn filter) and centrifuged in a microfuge for 10 min. A 5-10 pi aliquot was removed from the surface of the solution for loading into the needle. The concentrations of transposon and helper DNAs were 250 ug/ml and 50 ug/ml, respectively and then changed to 500 ug/ml and 100 ug/ml, respectively. 2. Preparing the D r o s o p h i l a for egg lays and collecting staged embryos The isogenic Oregon R host strain was multiplied until there were approximately a thousand flies of the same age (5-8 days old). Young flies (approximately 400 flies of both sexes) of the same age (within 1 day) were placed in an empty bottle. The lop of the bottle was covered with an egg collection plate (60 X 15 mm Petri plate) which was filled with 1% agar and lightly covered in a thick yeast paste. The yeast paste was made by mixing yeast powder with a solution of 2% HOAc/5% EtOH (Hugh Brock, personal communication). The plates were air-dried slightly so that the females would not adhere to the paste while laying their eggs. The bottles were placed in the dark for a 2-3 hr pre-lay period. During this period, embryos of different ages appear due to the females holding their eggs. Thereafter, uniformly staged embryos were collected at 25°C by changing the egg collection plates every 45 min. In order to maximize egg production during the time set for the microinjections, the adults may be set on a reverse day/night cycle such thai maximal egg laying would occur at a convienent hour. Alternatively, the flies were fed with live yeast to increase their egg production. To harvest the eggs, the egg plates were moved into the microinjection chamber (18°C with 50-70% humidity) and 44 the embryos rinsed off the agar plate with distilled water. The eggs where collected on a piece of Nilex screen (0.7 x 0.7 cm2) placed inside a small Buchner funnel. The eggs were rinsed with water until the yeast paste was completely removed. To enable penetration of the needle into the embryo, the outer chorion of the eggs was removed by a brief rinse in 50% bleach (3% NaOCl), followed by repeated rinsing with distilled water (Hill, 1945). All manipulations were performed at 18°C to slow down embryonic development. The Nitex screen was lifted up with watchmakers forceps and placed on a microscope slide. The embryos were viewed with a dissecting microscope and were mounted onto another slide in preparation for microinjection. With practice, the embryos that are too old for microinjection may be excluded by viewing them through the dissecting scope. The embryos were all mounted, ten at a time, anterior to posterior onto a 1 mm piece of double stick tape stuck to a microscope slide. 3. Pulling and filling microinjection needles Glass capillaries (0D/1D=1.0/0.58 mm, World Precision Instruments) with a 100 um glass filament fused to the inside of the barrel, were pulled with a horizontal electric needle puller (Ultrafine Micropipette Puller, Frederick Haer and Co.) to a point of less than 1 um (pulled courtesy of Dr. Peter Vaughan, UBC Physiology Dept.). The needle must be abruptly tapered at first, then with a finer taper towards the point such that the point will be strong enough to pierce the embryo but not tear a hole that is too large. The dimensions of the needle arc critical and must be obtained by experimentation. The micromanipulator and microscope (Leitz Laborlux 12) were placed on a concrete slab inside the microinjection chamber at 45 1 8 ° C with 5 0 - 7 0 % humidity. The needle was mounted onto the micromanipulator and viewed under the 10 X lens (100 X magnification). The needle was broken to a 2 pm diameter (optimal diameter) by touching the needle tip on the edge of a glass coverslip. For the remaining manipulations, the needle should never be moved without being viewed in focus, because touching the needle lip on any surface will result in breakage. The needle was filled by lowering the tip into a 5-10 pi drop of DNA placed on a piece of Parafilm. Front filling of the needle was accomplished by continuous suction from a 50 ml syringe for 20-60 min, depending on the diameter of the tip and the strength of the suction obtained. The needle was immersed into a pool of halocarbon oil whenever it was not in use, since evaporation of the DNA solution would clog the tip. 4. Microinjection of Drosophila embryos A piece of double sided sticky tape (1 mm width) was placed vertically on a microscope slide and 10 dechorionated eggs were aligned anterior to posterior on the tape. The embryos were viewed under a dissecting microscope (10-30 X magnification) and manipulated with an insect needle or a fine paint brush. The embryos must be securely placed on the tape and aligned perfectly horizontally, otherwise the needle would not penetrate the embryo. The eggs were dessicated by placing the slide in a dish of Drierite for 5-10 min. Eggs from the same collection that were mounted later required much less dessication. The embryos dessicated rapidly even in 50-70% humidity. The correct degree of dessication was empirically determined as the injections proceeded. After incubation in Drierite, the dessicated eggs were covered in halocarbon oil (Series 700, 46 Halocarbon products). The window of time in which embryos are the correct age for microinjection is very small. Embryos that had clearly passed the preblastoderm embryo stage (1.5 hr at 25°C) were discarded. Air bubbles near the posterior end of the embryos were dislodged with a dissecting needle before placing the slide on an inverted compound microscope. The embryos (150 X 450 um) were viewed at 100 X magnification. The ideal embryos for microinjection were those that have a clear polar pocket at their posterior pole. The DNA-filled needle was positioned, using the micromanipulator dials, at the posterior end of the embryo such that it was aligned with the midplane of the embryo. It is very difficult for the needle to penetrate the embryo if it is aligned above or below the midplane. The embryo was pierced with the needle (250 X magnification) using the microscope stage controls rather than the micromanipulator controls, such that the needle penetrated just into the yolk, but past the polar pocket. The DNA was expelled into the embryo (1-5% of embryo volume) until a slight stirring of the yolk contents was seen (Karess, 1985; Rubin et al., 1986). Over injection resulted in massive disruption of the yolk contents, resulting in death of the embryo. Embryos that were over dessicated collapsed upon penetration by the needle, also resulting in death of the embryo. Approximately 70% of the embryos that were mounted were successfully injected. The injected embryos were allowed to develop in the humid 18°C chamber, inside a Petri plate lined with wet filter paper. The embryos which survived the injection and hatched as first instar larvae were placed in a vial of food (30 or less per vial). Frequent checks for hatched larvae were required as they tended to crawl out of the halocarbon oil, resulting in their dessication and death. 5. Culturing the injected GO adults The first instar larvae that hatched were allowed to develop at 18°C for 2 days and were then moved to 25°C. The embryos which have been dechorionated and microinjected developed slower than the embryos which have not been manipulated. Therefore, the time required for development from the embryo to the adult fly at 25°C required 3-4 weeks rather than the normal 1-2 weeks at 25°C (figure 2). The GO adults that eclosed were collected as virgins and individually mated to 10 isogenic Oregon R wt adults in separate vials containing standard Drosophila food. After the third day, egg production was monitored every day. The fertile parents which produced eggs were transferred to food supplemented with the antibiotic G418 (Steller and Pirrotta, 1985). The concentration of G418 that was lethal to wt Drosophila, was determined for every new batch of food that was prepared. The dose of G418 required was approximately 0.8 mg/ml. Subsequent analyses showed that no false transformants survived this dose of G418. The GO females were allowed to lay their eggs on food supplemented with G418 for a total of 9 days. Every third day the adults were removed and the embryos and larvae in the food given a heat shock (37°C, 30 min) to increase the transcription of the neomycin resistance gene. The progeny of the GO adults were given a heat shock every 3 days until the larvae pupated (3-4 weeks later al 25°C). A few drops of water was added daily to the food in each vial to compensate for loss of moisture. 48 Figure 2. The Drosophila life cycle. Embryos were dechorionated and microinjected with DNA. The eggs which developed into first instar larvae were collected and allowed 10 develop into adults. There are four distinct stages in the life cycle of Drosophila:: egg, larva, pupa, and adult. At 20-25°C, a fresh culture will produce new adults in about 2 weeks with eight days in the egg and larval stages, and six days in the pupal stages. Egg Dechorloneted Embryo Injection Needle First instar larva s r Second instar larva 50 The Gl adults which developed from the food containing G418 were putative transformants carrying the pneoSOD transposon. Since the injected GO adults were mated to wt flies, the Gl transformants were heterozygous for the transposon (p|neoSOD]/+) (figure 3). 6. Creating transformed Drosophila lines Each individual transformed Gl adult (p[neoSOD]/+) was initially mated to wt (+/+) flies to create a transformed line (figure 4). Male Gl transformants were mated to 10-20 wt virgin females and the females were allowed to lay eggs on food containing G418. The progeny of the Gl adults were given a heat shock every 2-3 days as described above. One male Gl transformant may produce only 1-10 transformed G2 progeny (p[neoSOD]/+). Female Gl transformants were mated to 3-5 wt males and these adults moved to food containing G418. A single female would usually produce only 1-5 transformed G2 progeny (p[neoSOD]/+). The G2 progeny were then mated again to wt flics and this cycle was repeated several times (3-4 weeks per cycle) to increase the population of each transformed line (figure 4a). Alternatively, the Gl transformants that were mated to wt flies were allowed to lay eggs on food without G418 such that both transformed and wt flies were produced (p[neoSOD]/+, +/+). The greatly increased numbers of G2 progeny were mated together and then allowed to lay eggs on food containing G418. This procedure required more vials of food and used more G418 but produced a larger population of transformed flies faster (figure 4b). The resulting line was a mixture of flies either homozygous or heterozygous for the transposon. 7. Creating lines homozygous for the inserted gene 51 Figure 3. Culturing the injected GO adults. The GO adults which developed from the microinjected embryos were collected as virgins and individually mated to isogenic wt adults. The progeny of the GO adults were selected on G418. Only the Gl adults which have the inserted p[neoSOD] transposon would survive on G418. Since the injected GO adults were mated to wt, the G418 resistant Gl adults would be heterozygous for the transposon (p[neoSOD]/+). Each of these Gl adults were used to form individual transformed lines. 52 GENERATION microinject embryo with. p[neoSOD]and phslT GO FIRST INSTAR L A R V A 3-4 veeks at 25 °C GO EMBRYO plneoSOD] . + + GO ADULTS — X — ? or <^ + + ? ? or select progeny on G-418 (3-4 -veeks) G1 ADULTS plneoSOD] +• + ' T survives on G418 dies on G418 FORM INDIVIDUAL TRANSFORMED LINES 53 Figure 4. Propagating the transformed lines. Each individual transformed Gl adult (p[neoSOD]/+) was initially mated to wt (+/+) to create a transformed line. The progeny were selected on G418 and were heterozygous for the transposon (p[neoSOD]/+). In scheme (a), the resultant G2 progeny were mated to wt adults and the selection on G418 repeated. This cycle was repeated to produce transformed lines which contained only adults heterozygous for the transposon. Alternatively, in scheme (b) the progeny of the Gl adults were not selected on G418. The greatly increased numbers of G2 adults were interbred and then their progeny were selected on G418. This resulted in greatly increased numbers of G418 resistant progeny. This cycle was repeated to form transformed lines had contained flies which were homozygous and heterozygous for the transposon (p[neoSOD]/p[neoSOD]; p[neoSOD]/+). 54 (a) plneoSOD] + (Gl adult) X + + repeat cycle to form, transformed lines select progeny on G418 4r food (3 weeks) plneoSOD] X -select progeny on G418 food (3 weeks) plneoSOD] (b) repeat cycle to form transformed lines plneoSOD] x + <G1 adult) ^ plneoSOD] regular food and interbreed adults select on G418 food plneoSOD] plneoSOD] and plneoSOD] 55 Homozygous transformed lines were produced by conventional genetic crosses using the 2;3 balancer stock Cy0,TM2,l/£;t/T(2,3)apXa (from Peter Davies, Queen's University) (Lindsley and Grell, 1968). The chromosomes with the inserted transposon were placed over marked balancer chromosomes. This enabled stable maintenance of the transposon without the continuous use of G418. The genetic crosses required to created transformed lines homozygous for a transposon inserted on the second or third chromosome are shown (figure 5,6). These homozygous transformed lines have the X, second and third chromosome from the isogenic stock. Therefore, they have the same genetic background as the isogenic stock except for the Y chromosome, which comes from the double balancer stock ( Y B ) . N. Gene localization by in situ hybridization 1. Labelling an RNA transcript with Iodine-125 The DNA was used to make RNA labelled with [ 1 2 5I] 5-ICTP (5-iodoCTP) by in vitro transcription of XEMBL3 recombinant phage DNA by E. coli RNA polymerase in the presence of [ 1 2 5I] 5-ICTP. The phage DNA was treated with RNase A (1 ug/ul), extracted twice with phenol/CHCl3, precipitated with 0.6 volumes of 20% PEG6000/2.5 M NaCl and resuspended in TE 8. The transcription reaction consisted of 5 ug of phage DNA and 80 uCi [ 1 2^I] 5-ICTP in 40 mM Tris-HCl (pH 7.5), 10 mM DTT, 10 mM MgCl2, 20 uM ATP, GTP, UTP, and 5 units of E. coli RNA polymerase. The reaction was incubated at 37°C for 2 hr followed by DNase I treatment (10 ug DNase I, 40 mM Tris-HCl (pH 7.8), 100 ug E. coli tRNA) for 20 min at room temperature. The reaction mixture was extracted once with phenol/CHCl3 and three times with CHCI3 56 Figure 5. Creating homozygous transformed lines for a transposon inserted in the second chromosome. The genotype of the first (X or Y), second and third chromosomes arc listed for each cross. (1) Isogenic wt females with the inserted transposon, p[SOD], on the second chromosome were mated to males from the 2,3 balancer stock, CyO,TM2,[/6;t/T(2,3)ApXa. All the possible (a) curly and (b) apterous winged progeny are listed. The G418 resistant, curly winged and ultrabilhorax (Ubx) males were saved for the next cross. (2) Males from the previous cross were mated to isogenic wt females with p[SOD] on the second chromosome. All the possible progeny are shown. The males and females which were G418 resistant with curly wings were saved. (3) To form a balanced stock, the males and females saved from the previous cross were mated together and their progeny raised on food without G418. The second and third chromosome balancers (CyO and TM2) are homozygous lethal. (4) To create a stock which is homozygous for pfSOD], males and females with straight wings (p[SOD]/p[SOD]) and wl for the third chromosome were collected as virgins from the balanced stock and mated together. These genetic crosses were used to produce transformed lines that were homozygous for p[SOD]. These lines have the same genetic background as the wt isogenic stock except for the Y chromosome which comes from the 2,3 double balancer stock (Y B). 57 1, + . p[SOD] . + + ' + ' + 9 ; insert on 2nd chromosome . B C y O ; TM2 (Ubx) (a) \ + - B or - B a" Y^' T(2,3) ap** select on G418 (3-4 vks) CyO CyO TM21 + o r plSDDl \ + G418" dies G418* curly (Ubx) Ubx (b) ± + B O R "Y~B p[SOD]; + T(2,3) ap** G418R; apterous vings or T(2,3) ap G418S dies X a Save : + . CyO . TM2(Ubx) p YB ' p[SOD] ' + male; curly; G418* 2. + • CyO . TM2(Ubx) Y 5 ' plsoDj' —+ (from above) select on G418 x + . p[SOD] . + $ ; insert on 2nd chromosome + Y b ' plSODJ + P[S0D] + ' + p[SOD] G418R G418S G418 R G418 R curly dies straight straight vings vings wings Ubx Save: + . CyO . TM2(Ubx) , , • „ x < o R > pisbD] ' T male; curly; Ubx; G418 R + . CyO . TM2 (Ubx) + ' p[SOD] ' + female; curly; Ubx; G418 R 58 3. To form a balanced stock: + • CyO . TM2 (Ubx) + . CyO . TM2 Y 5 ' p[SOD] ' + X 7 ' p[SOD] ' + (Ubx) regular food (2-3 wks) V + + CyO CyO p[SOD] TM2 (Ubx) TM2 (Ubx) + — or n " — i — or — L — n r * * or or — + ' CyO p[SOD] p[SOD] ' TM2 (Ubx) + + <j> i P t v , « i curlv straight lethal Ubx vt cr1 le hal yvings vings To maintain a balanced stock, interbreed all surviving progeny from this cross 4. To create a stock homozygous for a transposon inserted on the second chromosome: + . p[SOD] . + + ' p[SOD] ' + + . p[SOD] . + A Y 5 ' p[SOD] ' + regular food + . p[SOD] . + + . p[SOD] . + + ' p[SOD] ' + a n < 1 Y 5 ' p[SOD] ' + This stock has a genetic background identical to the original isogenic stock except for the males, where the Y chromosome comes from the balancer stock (YB), 59 Figure 6. Creating homozygous transformed lines for a transposon inserted in the third chromosome. The relevant genotype of the first (X or Y), second and third chromosomes are listed for each cross. (1) Isogenic wt females with the inserted transposon, p[SOD], on the third chromosome were mated to males from the 2,3 balancer stock CyO,TM2,£/6;t/T(2,3)ApXa. All the possible (a) curly and (b) apterous winged progeny are listed. The G418 resistant, curly winged and ultrabithorax (Ubx) males were saved for the next cross. (2) Males from the previous cross were mated to isogenic wt females with p[SOD] on the third chromosome. All the possible progeny are shown. The males and females which were G418 resistant with Ubx were saved. (3) To form a balanced slock, the males and females saved from the previous cross were mated logcther and their progeny raised on food without G418. The second and third chromosome balancers (CyO and TM2) are homozygous lethal. (4) To create a stock which is homozygous for p[SOD], males and females with no Ubx (p[SOD]/p[SOD]) and wt for the second chromosome were collected as virgins from the balanced stock and mated together. These genelic crosses were used to produce transformed lines that were homozygous for p[SOD]. These lines would have the same genetic background as the wt isogenic slock except for the Y chromosome which comes from the 2,3 double balancer stock (Y B). 60 1. + . + . p[SOD] x + B . CyO; TM2 (Ubx) ' + ' + ' + Y 5 * T(2,3) ap**  (a) + + -B or - B 00 + + CyO . TM2 (Ubx) + ' p[SOD] curly G418R; vings Ubx . +; piSOD] T(2,3) ap** G418R resistant; apterous vings or T(2,3) ap G418S; dies Xa Save: i B CyO . TM2(Ubx) m a ie; curly; G418 R ' + ' p[SOD] ultrabithorax 2. + . CyO . TM2 (Ubx) ' + » p[SOD] + + ~B or - B X + • . + . PiSOD] + * + ' + select on G418 (3-4 vks) CyO . TM2(Ubx) TM2(Ubx) p[SOD] p[SOD] + ' + o r p[SOD] o r p[SOD] o r + G418' dies G418J Ubx G418~ no Ubx G418J no Ubx Save: Y B + + CyO . TM2(Ubx) m a i e ; curly; Ubx; G418 R + ' p[SOD] C y ° • TM2 (Ubx) female; curly; Ubx; G418R + ' p[SOD] 61 3. To form a balanced stock: + . CyO . TM2 (Ubx) + . Cv Y B ' + ' p[SOD] + ' + + + B or ~B + yO . TM2 (Ubx) ' p[SOD] regular food (no G418) v CyO CyO + . TM2 (Ubx) TM2 . p[SOD] CyO ° r + ° r + ' p[SOD] o r TM2 ' p(SOD] lethal curly vt Ubx lethal no Ubx To maintain a balanced stock, interbreed all surviving progeny from this cross 4. To create a stock homozygous for a transposon inserted on the third chromosome: + . + . p[SOD] + ' + 'p[SOD] X + . + . pISOD] Y 5 ' + ' p[SOD] + . + . p[SOD] + ' + 'p[SODJ regular food a n d Y 5 * + ' p[SOD] This stock has a genetic background identical to the original isogenic stock except for the males, where the Y chromosome comes from the balancer stock (Y^). 62 before removal of the unincorporated label on a Sephadex G-25 column (0.196 cm 2 X 20 cm). The column buffer was 0.3 M NaOAc (pH 7.2), 50 pM EDTA, 0.01% SDS. The labelled RNA probes were collected, precipitated by 2.5 volumes of EtOH and redissolved in 0.06 M KH2PO4, 0.06 M K2HPO4, 5 mM EDTA, 4 mM KOH, 0.5 M KG and 70% formamide. 2. Labelling the DNA probe with biotin The DNA probes were labelled with Biotin-11-dUTP (Langer et al., 1981) by nick-translation (Rigby el al., 1977). The reaction mixture consisted of 1 pg of plasmid DNA, 12 pM Bio-11-dUTP, 30 pM dCTP, dGTP, dATP, 2 pCi [a- 3 2P] dATP (optional tracer), 1 pg BSA, 2.5 ng DNase I (titrated for each probe), 50 mM Tris-HCl (pH 7.4), 5 mM MgCl2, 10 mM B-mercaptoethanol, and 10 units DNA polymerase I in a 50 pi volume (Rubin et al., 1986). The reaction was incubated at 16°C for 1.5 hr and stopped by the addition of an equal volume of 50 mM EDTA (pH 8.0) and 50 pg of E. coli tRNA. The unincorporated label was removed on a 0.196 cm 2 X 18 cm Ultragel AcA 54 gel (Fischer Scientific) filtration column equilibrated with 10 mM Tris-HCl (pH 7.5), 0.25 mM EDTA, 0.2 M NaCl and 0.1% SDS. The elution of the biotin-labelled DNA was determined by the fraction incorporating the [ 3 2P] tracer. This fraction was detected by a Geiger counter. The elution volume of each probe was recorded and the corresponding volume was used in subsequent reactions where the radioactive tracer was omitted. The biotin-labelled DNA was EtOH precipitated and redissolved in 75 pi of 50% formamide (deionized), 0.6 M NaCl, 10 X Denhardt's reagent, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.5 mg/ml E. coli tRNA and 5% dcxtran sulfate. An aliquot of the probe was 63 removed and boiled for 3 min before use. The remainder of the probe was stored at -20°C and was used over a period of several months. 3. In situ hybridization (a) Preparation of the chromosome squashes The chromosome squashes were prepared essentially as described (Gall and Pardue, 1971; Shizu Hayashi, personal communication) from larvae grown at 18°C in non-crowded cultures (4 weeks). Climbing third instar larvae were collected and placed in pools of Drosophila saline (0.021% CaCl2, 0.035% KC1, 0.75% NaCl) (Ephrussi and Beadle, 1936) and separated into male and female larvae with the aid of a dissecting microscope using illumination from below. The salivary glands were dissected using fine forceps and the fat bodies were trimmed off the glands as cleanly as possible. The dissected glands were placed into a drop of 45% acetic acid for 2-4 min and then covered with a cover slip. The chromosome arms were spread by gentle tapping of the cover slip. Excessive tapping shattered the chromosomes so that they were no longer visible. The squash was flattened by placing the slide between paper towels and pressing down on the cover slip very hard with the thumb. The slides were placed on a flat piece of dry ice for 5 min and the coverslip was flipped off the slide (without removing the squash). The preparations were dehydrated in 95% EtOH (3 X 10 min) and air dried. Finally, the slides were heated at 70°C for 30 min in 2 X SSC, dehydrated in 70% EtOH (2 X 10 min) and then in 95% EtOH for 5 min. The slides may be stored dry at this point. Slides with optimal chromosome spreading were selected for in situ hybridization. 64 (b) Preparation of the slides for hybridization The squashed chromosomes were treated with RNase A (100 ug/ml in 2 X SSC) for 30 min at 37°C, rinsed three times in 2 X SSC (10 min each) and dehydrated in EtOH (70% EtOH, twice for 10 min; 95% EtOH, 5 min). The chromosomes squashes were acetylated to decrease the non-specific binding of the probe (Hayashi et al., 1978) by ejecting 0.5 ml of acetic anhydride into 200 ml of 0.1 M triethanolamine (pH 8.0) and immediately plunging the slides in with vigorous mixing. The slides were incubated at room temperature for 15 min and then rinsed three times in 2 X SSC (10 min each) and dehydrated through the series of EtOH washes (described above). (c) Hybridization and signal detection The [ 1 2 5l]-labelled RNA probes were hybridized to the chromosomes on the slides for 16 hr at 45°C in 70% formamide, 60 mM KH2PO4, 60 mM K2HPO4, 5 mM EDTA, 4 mM KOH and 0.5 M KC1. The slides were incubated in a moist chamber lined with filter paper soaked with the same hybridization solution. The unbound probe was removed by washing in 2 X SSC at room temperature (4 times for 10 min). The slides were dehydrated through the series of EtOH washes, air dried, coated with photographic emulsion (Ilford K2), and packaged into a light-tight box. They were developed at different times (3 days to 2 weeks) to obtain an optimal exposure. After the film was processed, the slides were dehydrated through the series of EtOH washes and the chromosomes stained for 5-6 min in 0.4% toluidine blue (in 2 X SSC), washed in distilled water, and dehydrated through the series of EtOH washes again. 65 The biotinylated DNA probes were hybridized to the chromosomes for 16 hr at 37°C in 50% formamide, 0.6 M NaCl and 10 mM Tris-HCl (pH 7.5). The slides were incubated in a moist chamber containing with same solution. The covcrslips were removed by briefly rinsing the slides in 2 X SSC. The unbound probe was removed by washing at 50°C in 2 X SSC (three times for 10 min) and then at room temperature (twice for 10 min). The slides were prepared for colour development by incubating in 0.1 M Tris-HCl (pH 7.5) and 0.15 M NaCl for 10 min. The slides were then incubated in 3% BSA, 0.1 M Tris-HCl (pH 7.5) and 0.15 M NaCl for 20 min at 42°C. The slides were moved from 42°C to room temperature and allowed to sit an additional 10 min (Hugh Brock, personal communication). The streptavidin-alkaline phosphatase conjugate (SA-AP) stock solution (1.0 mg/ml SA-AP in 3 M NaCl, 1 mM MgCl2, 0.1 mM ZnCl2, 30 mM triethanolamine (pH 7.6)) was diluted 1/1000 in 0.1 M Tris-HCl (pH 7.5) and 0.15 M NaCl. The solution was gently mixed and 80 ul were placed on the squash, covered with a 22 X 22 mm cover slip and allowed to react at room temperature for 15 min. The unbound SA-AP conjugate was removed by washing in 0.1 M Tris-HCl (pH 7.5) and 0.15 M NaCl for two 3 min periods. The slides were then prepared for color development by incubating them in 0.1 M Tris-HCl (pH 9.5), 0.1 M NaCl and 50 mM MgCl2 for two 3 min periods. Nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) were diluted by gently mixing 4.4 ul of 75 mg/ml NBT (in 70% formamide) and 3.3 ul of 50 mg/ml BCIP (in dimethylformamide) into 1.0 ml of 0.1 M Tris-HCl (pH 9.5), 0.1 M NaCl and 50 mM MgCl2- The slides were removed from the buffer sequentially and 80 ul 66 of diluted NBT/BCIP solution was placed on each squash. The squash was covered with a 22 X 22 mm coverslip and placed in a moist chamber in the dark for signal development. The signal development was monitored periodically but was never allowed to exceed 3 hr. The reaction was stopped by washing the slides in 20 mM Tris-HCl (pH 7.5) and 5 mM EDTA. The slides were then stained for 30 seconds in a 1/20 dilution of Giemsa stain (in 10 mM NaP04 (pH 6.8)), washed in distilled water and air-dried. They were mounted in Permounl and stored in the dark. The signals faded slightly with prolonged storage. 0. Expression of the transposed gene 1. SOD activity assays The superoxide dismutase activity in flies was determined by a ferricytochrome c reduction assay (McCord and Fridovich, 1969; Crapo et al., 1978). In this assay, xanthine/xanthine oxidase was used to generate superoxide radicals. The reduction of cytochrome c by the superoxide radicals was monitored at 550 nm. The rate of reduction of cytochrome c in the presence and absence of SOD was measured. SOD competes with cytochrome c for the superoxide radicals and decreases the rate of cytochrome c reduction. One unit of SOD activity was defined as the amount of enzyme which inhibits the rate of cytochrome c reduction by 50%, under the conditions specified. A modified form of the assay was used to increase the sensitivity approximately 10-fold (Crapo et al., 1978). The increased sensitivity eliminates interference from low molecular weight compounds which are chemically capable of reducing cytochrome c. The assay consisted of 1 ml of 50 mM Na2C03 (pH 10.0), 0.1 mM EDTA, 0.1 mM 67 xanthine and 0.01 mM cytochrome c 3 + . A quantity of xanthine oxidase was added (in less than 10 ul) such that the change in absorbance at 550 nm was 0.025 absorbance units/minute. Increasing volumes of Drosophila homogenate were added to produce a 50% inhibition of cytochrome c 3 + reduction (i.e. 0.0125 absorbance units/minute). The concentration of ferricytochrome c was determined using the molar extinction coefficient A£550= 21,000 M~^cm~l. The ferricytochrome c was reduced with sodium dithionite. The concentration of xanthine was determined by using the extinction coefficients £240= 8.9 X 103 M - 1 c m - 1 and 6277 = 9.3 X 10 3 M _ 1cm~ 1 at pH 10.0. For each assay, five male or female flies (less than 24 hr old) were homogenized in 800 ul of phosphate buffer (50 mM potassium phosphate (pH 7.8), 0.1 mM EDTA) using a 25-100 u l Econo-grind homogenizer (Radnoti Glass Technology, Inc.). The homogenate was spun in a microfuge at 4°C for 5 min. The layer of debris on top was removed and the supernatant transferred to a clean tube, kept on ice, and used as the homogenate containing SOD activity 2. Bradford protein assays The protein concentration in each Drosophila homogenate was determined by the Bradford protein assay (Bradford, 1976). The sample or protein standard was made up to a volume of 60 ul with dH20. The Bradford reagent consisted of 50 mg Coomassic Blue G-250, 50 ml phosphoric acid (85% w/v), 25 ml 95% EtOH and 425 ml distilled water. Three ml of reagent were added to the sample and the sample vortexed immediately. The samples were reacted for 15 min at room temperature and the absorbance measured at 595 nm. The protein concentration was determined for 20 ul and 40 u.1 of 68 Drosophila homogenate and compared to a standard curve. A new standard curve was plotted each day, with duplicate data points, using 0-40 pg of bovine gamma globulin (BioRad). The concentrated bovine gamma globulin was stored in 25% glyccrol/dislillcd water al -70°C. 3. Northern blot analysis of transcripts The RNA samples from each strain were separated on denaturing agarose gels and transferred to nylon membranes as described previously. The RNA on the membrane was hybridized with [32P]-labelled DNA probes, washed and exposed to film. The autoradiograms were used to determine the hybridizing regions which were then excised from the membrane. The membranes were placed into 5 ml of dH20 and the radioactivity on the membrane fragments was determined in a scintillation counter by Cerenkov radiation emitted in the presence of water. The average background on the membrane, determined by analyzing areas equal in size to the regions containing Sod RNA from above and below these regions, was subtracted from the radioactivity of the Sod RNA regions. The levels of Sod-specific mRNA were standardized by comparison to levels of three actin transcripts which were quantified in the same manner. These standardized values from the transformants and the heterozygous SOD deficiency D/(3L)lxd 9/TM3S6Ser were compared to that of wt. Multiple determinations were made for each strain and relative levels of expression are reported as the average of the mean ± the standard deviation of the mean. P. Drosophila melanogaster longevity studies 1. The aging curves 69 The Drosophila stocks were expanded by growing the flies in bottles. The newly eclosed flies were collected at 0-24 hr of age, separated by sex, and placed into 8-dram shell vials (10 per vial). Each vial contained 6 ml of standard Drosophila food. The number of flies used per strain varied from 50-200. The flies were maintained at either 25°C or 29°C and transferred to vials with fresh media every 2-3 days. To obtain survival curves, the number of living flies was determined for each genotype at each transfer and this was expressed as a percent of the total starting number (Leffelaar and Grigliatti, 1984a). This process was continued approximately for 60 days at 29°C and 90 days at 25°C, until all the flies were dead. 2. The genetic crosses The SOD 'null' mutant (Graf and Ayala, 1986), heterozygous Sod deficiency Df(3L)lxd9/TM3SbSer (Schott et al., 1986) and isogenic Oregon R were crossed to produce SODnull/+, SOD n u l l/£>/(3L)lxd 9 and D/(3L)lxd 9/ + hybrids used in the aging studies. The SODnu^/+ strain was produced by crossing SOD n u'* males to virgin wt (+/+) females (or vice versa) and collecting the resulting progeny. The SOD n u l l/D/(3L)lxd 9 were produced by crossing males from the SOD n u" strain to virgin females of the D/(3L)lxd 9/TM3S6Ser strain and collecting the progeny which were not marked with either stubble bristles and serrated wings (SbSer). Similarly, to produce the D/(3L)lxd9/+ flies, rcmales from the D/(3L)lxd 9/TM3S6Ser were crossed to males from +/+. The non-stubble bristle and non-serrated wing progeny were collected for the aging studies (figure 7). Q. Assay of paraquat toxicity 70 Figure 7. The Drosophila hybrids used in the longevity studies. (a) The SOD null/+ hybrid was produced by mating cither SOD null males or virgin females to the +/+ strain and collecting the resulting progeny. (b) The SOD null/D/(3L)lxd 9 hybrids were produced by mating the SOD null strain to the heterozygous SOD deficiency strain D/(3L)lxd 9/TM3S6Ser. The flies which do not have stubble bristles or serrated wings were SOD null/D/(3L)lxd 9 hybrids, (c) The D/(3L)lxd9/+ hybrids were produced by mating the D/(3L)lxd 9/TM3 S b S e r strain to wt and collecting the progeny which did not have stubble bristles or serrated wings. 71 (a) SOD null SODnull X + + SODnull (b) Df(3L)lxd9 x SODnull TM3 Sb Ser SOD null SODnull SODnull TM3 Sb Ser save for aging discard flies with stubble bristles; serrated wings (c)Df (3D lxd9 + x + TM3 Sb Ser ^ D f O O x d 9 a n d TM3 Sb Ser save for aging discard flies with stubble bristles; serrated wings 72 Adult Drosophila (0-2 days old) were separated by sex and exposed to paraquat for 48 hr at 25°C in vials (20 per vial) containing filter paper saturated with 0-40 mM paraquat in 1% sucrose solution. The number of living flies was determined after 48 hr and this was expressed as a percent of the total starting number. 73 RESULTS AND DISCUSSION A. Characterization of the D. melanogaster CuZn SOD cDNA 1. Isolation of the CuZn SOD cDNA using mixed oligonucleotide probes (a) Oligonucleotide probe design Previous attempts to clone the Sod gene using a 17 nucleotide long probe, GT3 (targeted to aa 90-95), were unsuccessful (Seto, 1987). In this study, the 26 nucleotide long probe, 13 (figure 8), was targeted to amino acids 87-95, a region unique to the D. melanogaster CuZn SOD protein (Lee et al., 1985a,b). To include every possible codon this amino acid segment would require 8192 different oligonucleotides, which was clearly not experimentally feasible. To decrease the degeneracy of the probe, deoxyinosine (dl) was placed in the third position of four-fold degenerate codons (Martin and Castro, 1985). Deoxyinosine is a deoxyguanosine analog. Studies on the thermal stability of oligonucleotide duplexes containing dl show the order of stability to be dI:dC > dI:dA > dI:dT , dlrdG. Deoxyinosine was placed in positions 6,9,18,21, and 24 of the 13 probe to decrease the degeneracy of the mixture to eight 26-mer sequences (figure 8). (b) Screening a D. melanogaster cDNA library A D. melanogaster cDNA library made from poly (A) + RNA of 3-12 hr embryos (Poole et al., 1985) was screened with the probe 13 at 55°C. Approximately 3 x 105 plaques were screened, resulting in eleven phage to which the probe hybridized at this stringency. The positive signals were still present on duplicate fdters at 65°C. The phage DNA from seven of these were chosen for further analysis. The entire cDNA insert was amino acid Ala 8 7Thr Gly Asp Cys Pro Thr Lys V a l 9 5 sequence possible 5" GCN ACN GGN GA^ UG^ CCN ACN A A £ GUN codons probe T CGI TGI CCI CT^ AC^ GGI TGI 1T\ CA sequence (completive nt a r y s t r a n d ) Figure 8. Oligonucleotide probe design. The amino acids 87-95 of the Drosophila SOD protein were chosen as the target for the oligonucleotide probe 13. All the possible codons for the amino acids are shown. The probe is 26 nucleotides long and is of the template strand for mRNA. Deoxyinosine (I) was used in the third position of appropriate codons to decrease the number of different oligonucleotides in the probe mixture to eight. 75 released from the A gt 10 vector arms by digestion with restriction endonuclease EcoRI. Of these seven phage, five clones contained a -750 bp cDNA insert and two clones contained a smaller-350 bp cDNA insert, all of which hybridized the probe (figure 9). 2. Nucleotide sequence analysis of CuZn SOD cDNA The -750 bp and -350 bp cDNA inserts were subcloned into the EcoRI restriction site of pUC13 and M13mpl8/19 for sequence analysis. The orientation of the inserts in M13mpl8/19 were determined by hybridizing the probe 13 to single-stranded DNA templates, since the probe 13 hybridizes to the coding strand but not the RNA template strand. The sequence of the -350 bp cDNA insert was determined using oligonucleotide 13 (mixed primers), forward primer and reverse primer. Both single and double-stranded DNA templates were used. Translation of the partial sequence obtained in all three open reading frames produced an amino acid sequence corresponding to the SOD protein sequence. The sequence information obtained from this partial cDNA clone was used to design two oligonucleotide primers which correspond to amino acids 24 to 30 (NS-1: 5'-AGACCTTCACGGGCGTA-3', RNA template strand) and amino acids 126 to 131 (NS-2: 5'-CAGGGTGGACACGAGCT-3', coding strand) of SOD. The larger -750 bp cDNA clone was sequenced entirely on both strands using NS-1 and NS-2 as primers (figure 10). The larger -750 bp cDNA insert contained the entire coding region for the CuZn SOD protein as well as 68 bp of the 5' flanking DNA, 174 bp of the 3' flanking DNA and the poly A tail (figure 11). 3. Predicted amino acid sequence of the CuZn SOD protein Translation of a full length SOD mRNA would be expected to give rise 76 Figure 9. Southern analysis of CuZn SOD cDNA clones. A D. melanogaster cDNA library was screened with the oligonucleotide probe 13. The phage DNA from seven plaques which hybridized the probe 13 was digested with EcoRI, separated by electrophoresis in a 0.7% agarose gel and transferred to a nylon membrane. The membrane was hybridized with radiolabeled probe 13, washed at 65°C in 6XSSC, and exposed to X-ray film. The resulting autoradiogram is shown. The entire cDNA insert was released from the XgtlO vector arms by digestion with EcoRI. Lanes 1-7 represent cDNA clones c21, c29, c33, c35, c38 and c41, respectively. Clones c35 and c41 contained a _350 bp cDNA insert (single arrowhead), whereas the remaining clones contained a ~750 bp insert (double arrowhead). Size markers were from a Hinfl digest of pBR322 DNA, run in a parallel lane (sizes shown in kb). 77 78 Figure 10. Strategy for determining the CuZn SOD cDNA sequence. The full cDNA clone (c29) and the partial cDNA clone (c41) are represented by open boxes. The scale on top of the full length cDNA show size in base pairs. The position of the partial cDNA clone (c41) in relation to the full length cDNA clone is shown. The end of the DNA insert with the poly C tail is indicated on both clones, but only the full length clone has a poly A tract at the opposite end. The arrows below the cDNA clones represent the sequencing strategy used, where the length of the arrow indicates the extent of the sequence read on each template. Arrows pointing to the left show DNA sequence determined for the coding strand; arrows pointing to the right show sequence determined for the non-coding strand. Solid arrows and dotted arrows represent DNA sequences obtained from single and double-stranded DNA templates, respectively. Specific oligonucleotides which were used as primers arc shown beneath the arrows. The unlabelled arrows represent sequences determined using universal forward and reverse primers. 79 E c o R I 100 200 300 400 500 600 700 E c ° R ' | I I 1 ' ' I I J p o l y C EcoRI E c o R I NS-1 13 p o l y C NS-2 dsDNA template ssONA template 80 Figure 11. The D. melanogaster CuZn SOD cDNA sequence. The nucleotide sequence of the full length cDNA clone (c29) is shown. The predicted amino acid sequence is given below the nucleotide sequence. The amino acid sequence predicted from the cDNA is identical to the amino acid sequence determined for the SOD F protein, except for the additional C-terminal valine. The clone also contains 68 bp of 5' flanking DNA and 174 bp of 3' flanking DNA, and the poly A tail. The polyadenylation signal AATAAA is underlined (Sclo et al., 1987a). 81 -90 -75 -60 -45 -30 -15 "1 g a a t t c c c c c c c c c c c c c c c c c c c a c a c c a t a g a a g a t a c c t g g a a a ' g t t c t c a a c t t t t t t c g t t t t g a t a a a t t g a t t a a t t c a t t c g a a 15 30 45 GO 75 ATG GTG GTT AAA GCT GTC TGC GTA ATT AAC GGC GAT GCC AAG GGC ACG GTT TTC TTC GAA CAG GAG AGC AGC GGT Met Val Val Lys A l a Val Cys Val H e Asn G l y Asp A l a Lys G l y Thr Val Phe Phe G l u G i n G l u Ser Ser G l y 90 105 120 135 150 ACG CCC GTG AAG GTC TCC GGT GAG GTG TGC GGC CTG GCC AAG GGT CTG CAC GGA TTC CAC GTG CAC GAG TTC GGT Thr Pro Val Lys Val Ser Gly Glu Val Cys Gly Leu Ala Lys Gly Leu His Gly Phe His Val His Glu Phe Gly 165 180 195 210 225 GAC AAC ACC AAT GGC TGC ATG TCG TCC GGA CCG 'CAC TTC AAT CCG TAT GGC AAG GAG CAT GGC GCT CCC GTC GAC Asp Asn Thr Asn Gly Cys Met Ser Ser Gly Pro His Phe Asn Pro Tyr Gly Lys Glu His Gly Ala Pro Val Asp 240 255 270 285 300 GAG AAT CGT CAC CTG GGC GAT CTG GGC A A C ATT GAG GCC ACC GGC GAC TGT CCC ACC AAG GTC AAC ATC ACC GAC Glu Asn Arg His Leu Gly Asp Leu Gly A s n l i e Glu Ala Thr Gly Asp Cys Pro Thr Lys Val Asn He Thr Asp 315 330 345 360 375 TCC AAG ATT ACG CTC TTC GGT GCC GAC AGC ATC ATC GGA CGC ACC GTT GTC GTG CAC GCC GAT GCC GAT GAT CTT Ser Lys H e Thr Leu Phe Gly Ala Asp Ser H e He Gly Arg Thr Val Val Val His Ala Asp Ala Asp Asp Leu 390 405 420 435 450 GGC CAG GGT GGA CAC GAG CTG AGC AAG TCA ACG GGC AAC GCT GGT GCC CGC ATC GGG TGC GGC GTT ATT GGC ATT Gly Gin Gly Gly His Glu Leu Ser Lys Ser Thr Gly Asn Ala Gly Ala Arg H e Gly Cys Gly Val He Gly H e 465 48a 495 510 525 540 GCC AAG GTC TAA gcgataatctattccgatgtcggccactgtgctgatctactctatttagcactacccactggagatatacaaacgatatacat Ala Lys Val »»» 555 570 585 600 615 630 acttctaaacataaatacatagectgtggtctgttagttgatacgcaacctttgaggttcaataaattggtgttttgaaattgccccataaacaaaaaa 660 aaaaaaaaaaaaggaattc 82 to a protein with an amino acid sequence identical to that determined for Drosophila CuZn SOD F (Lee et al., 1985a,b) except it would contain, in addition to the expected N-terminal methionine, a C-terminal valine (figure 11). This finding is not unique; for example, the bacteriorhodopsin gene encodes an additional aspartic acid at the carboxyl terminus (Dunn et al., 1981) and the a-tubulin gene also encodes a C-terminal tyrosine residue not found in the mature protein. This very unique post-translational modification of a-tubulin involves the enzymatic removal and addition of tyrosine at the carboxy terminus. A specific tyrosyl-tubulin carboxypeptidase and a tubulinttyrosine ligase are responsible for these modifications and both have been purified. Although this problem has been an area of considerable interest, the role of the carboxy terminal tyrosine is still not clear (reviewed by Cleveland and Sullivan, 1985). Therefore, the results of the a-tubulin studies do not provide a clue for the function of the additional valine in the mature SOD protein. 4. The SOD gene transcript A Northern blot of equal quantities of total RNA from D. melanogaster (Oregon R) and a SOD "null" mutant (Graf and Ayala, 1986) was probed with [32P]-labelled SOD cDNA and the resulting autoradiogram showed positively hybridizing bands at 0.7-0.8 kb (figure 12). However, the intensity of the 0.7-0.8 kb band in the SOD "null" mutant was much reduced. The autoradiogram also shows a slightly stronger 1.5-1.6 kb hybridizing band in the SOD "null" mutant RNA which may represent an improperly spliced Sod transcript. This result is in agreement with the findings that the SOD "null" mutant has only 3.5% of the wt SOD protein and that the "null" 83 Figure 12. Northern blot analysis of wt and "null" mutant Sod transcripts. Total RNAs of D. melanogaster (Oregon R) (lane a) and Sod "null" mutant strains (lane b) were isolated. The RNA concentration was determined by measuring absorbance at 260 mn. Total RNAs (30 pg) from each strain were separated by electrophoresis on a 1.4% agarose gel containing 0.66 M formaldehyde and transferred to a nylon membrane. The Sod cDNA was radiolabeled and hybridized to RNA on the membrane. The resulting autoradiogram is shown. A single 0.7-0.8 kb band (double arrowhead) is seen in the wt Drosophila RNA (lane a) but is greatly diminished in the Sod "null" mutant (lane b). The autoradiogram also shows a slightly stronger 1.5-1.6 kb hybridizing band (single arrowhead) in the Sod "null" RNA. An RNA ladder (BRL) provided size markers (sizes shown in kb). 9.5 7.5 4.4 2.4 1.4 0.24 85 mutation is tightly linked to the Sod structural gene (Graf and Ayala, 1986). The SOD "null" mutant was a naturally occuring mutation isolated from the wild. The mutation may be due to an altered gene sequence at the intron/exon junction of the gene such that the -725 bp intron is not spliced properly. The unspliced message would be 1.5-1.6 kb in length. Alternatively, the larger transcript may be due to a DNA sequence inserted into the coding region of the SOD protein sequence. The SOD gene from this mutant has been cloned using the Sod cDNA isolated above (F.J. Ayala, personal communication). The nucleotide sequence of this Sod locus should provide more insight into the nature of this very interesting mutation. Northern blot analysis of total RNA from various rat and mouse tissues also show one Sod transcript of about 0.7 kb (Delabar et al., 1987) as opposed to the 0.7 and 0.9 kb transcripts observed' in various human cells. It was found that both human Sod transcripts are transcribed from the same gene with the 0.7 kb transcript being predominant (Sherman et al., 1984). B. The D. melanogaster CuZn SOD gene 1. Isolation and characterization of CuZn SOD genomic clones A D. melanogaster genomic DNA library was constructed in the vector XEMBL3 (Leung, 1988) from a stock of D. melanogaster isogenic for all the major chromosomes (G.M. Tener, unpublished). It has been estimated that approximately 1 x IO4 plaques of this library are required to represent all the DNA sequences present in one Drosophila genome. The equivalent of 6 genomes (6 x 104 pfu) from this DNA library were screened with the mixed oligonucleotide probe 13 at 52° C, which resulted in approximately 10 86 hybridizing plaques per genome. The probe 13 was subsequently hybridized at 58° C, which resulted in 5 hybridizing plaques, or approximately one positive clone per genome. These five plaques were purified and the bacteriophage DNA isolated. 2. Restriction enzyme analysis of the CuZn SOD genomic clone Bacteriophage DNA from one of the phage clones (designated G10), which hybridized the probe 13, was chosen for further analysis. The DNA from phage G10 was digested with various restriction enzymes, separated on an agarose gel and transferred onto a membrane. The membrane was first hybridized with [32P]-labelled mixed oligonucleotide 13. The probe was removed and the same membrane hybridized with nick-translated SOD cDNA. The resulting autoradiograms showed that the oligonucleotide probe 13 (directed to amino acids 87-95 of the SOD protein) and the SOD cDNA both hybridized to the same -1.8 kb EcoRI fragment (figure 13). Both probes also hybridized to the same ~20 kb Hindlll fragment, which represents a fusion of XEMBL3 vector and Drosophila insert DNA. Previous analysis of the SOD cDNA revealed a Sail site (GTC GAC) at codons number 73 and 74 of the SOD cDNA sequence. As expected, Sail digestion of the genomic clone produced two bands which positively hybridized to SOD cDNA, but only one Sail fragment hybridized to oligonucleotide probe 13. The EcoRI/Sall digests showed a ~1.4 kb EcoRI/Sall fragment which hybridized with the SOD cDNA but not with probe 13. The -0.4 kb EcoRI/Sall band hybridized both the cDNA and the oligonucleotide 13 (figure 13). Therefore, the -0.4 kb EcoRI/Sall fragment contains the 3' end of the Sod gene, since the oligonucleotide 13 hybridized this fragment only. Based on this restriction 87 Figure 13. Southern analysis of a genomic CuZn SOD clone from a X E M B L 3 DNA library, (a) Bacteriophage DNA from the clone G10 was digested with (1) Hindlll (2) EcoRI/Sall (3) Sail (4) EcoRI (5) Sall/Hindlll and separated on a 0.7% agarose gel. The DNA was transferred onto a nylon membrane and hybridized with radiolabeled CuZn SOD cDNA and oligonucleotide 13. The resulting autoradiograms of the membranes hybridized with (b) SOD cDNA and (c) oligonucleotide 13 are shown. The probe 13 and the SOD cDNA both hybridized to the same 1.8 kb EcoRI fragment (lane 4). The EcoRI/Sall digests show a 1.4 kb EcoRI/Sall fragment (lane 2) which hybridized with the cDNA clone but not with probe 13. The 0.4 kb EcoRI/Sall fragment hybridized both the SOD cDNA and the oligonucleotide 13. Size markers were from a Hindlll digest of X DNA, run in a parallel lane (sizes in kb). 88 CO CM CN t O." <3 I I CN CN O in I i 11 i N o ' sd I I I l ro O CN CN I I •O VO "<* CO CM m» • i l 1 ! 1 II i i i i i ro O <N o' <5 I T ro o • • CN CN O D 89 analysis, the -1.8 kb EcoRI fragment as well as the -0.4 and -1.4 kb EcoRI/Sall fragments were subcloned for nucleotide sequence analysis. 3. Subcloning strategy for the CuZn SOD gene The -1.8 kb EcoRI and -1.4 kb EcoRI/Sall fragments from phage G10 were subcloned into pUC13 using the host JM101. Attempts to clone the same fragments into M13mpl8/19 using JM101 was not possible, as the inserts appeared to be unstable in this host. The -0.4 kb and -1.4 kb EcoRI/Sall fragments were successfully force cloned in both orientations into M13mpl8 and mpl9 in the host JM109. The sequence of the larger -1.4 kb EcoRI/Sall fragment was determined by producing a series of overlapping deletions by the exonucleaselll method of Henikoff (1984). The -1.8 kb EcoRI fragment (cloned in pUC13) was cut with BamHI/PstI and then treated with exonucleaselll (figure 14a). The exo III deletion reactions were stopped at fixed intervals, and an aliquot of linear molecules from each fraction was digested with EcoRI and separated on an agarose gel (figure 14c). These double-stranded templates were used to determine the sequence on one strand of the entire -1.8 kb EcoRI fragment. To determine the sequence on the other strand (figure 14b), the -1.4 kb EcoRI/Sall fragment was cloned into mpl8 which produces the required orientation. In this clone, a Pstl/Sall digest (to take advantage of the resistance to exo III digestion of ends produced by PstI) was not possible, because the PstI and Sail sites are adjacent in the multiple cloning site. The clone was digested with Hindlll and the ends protected by the addition of dATP[aS]. The linear molecules were cut with Sail, to provide a site 90 Figure 14. Subcloning strategy for the CuZn SOD gene. (a) To determine the DNA sequence on one strand, the 1.8 kb EcoRI (E) fragment (open box) from phage G10 (figure 13) was subcloned into pUC 13 (solid line) in the orientation shown. The clone was cut with BamHI (B)/Pstl (P) and then digested with Exonuclease 111. The direction of the deletions are shown by the arrows on top of the fragment. The primer binding site (represented by a small arrow on the pUC13 vector sequence) remains intact. (b) To determine the DNA sequence on the other strand, the 1.4 kb EcoRI (E)/Sall (S) fragment (open box) was subcloned into M13mpl8 (solid line) in the orientation shown. The clone was cut with Hindlll (H) and made resistant to ExoIII by the addition of dATP(aS). The molecule was then cut at Sail and the direction of the deletions are shown by arrows on top of the fragment. The primer binding site remains intact. (c) The extent of the ExoIII deletions for the pUC13 clone was monitored as follows. The ExoIII digestions were stopped at 30 second intervals (lanes 1-6), digested with EcoRI, and analyzed on a 0.7% agarose gel. The 2.7 kb pUC13 vector sequence remains intact (single arrowhead) whereas the 1.8 kb EcoRI fragment is deleted by approximately 150 bp every 30 seconds. 91 1 2 3 4 5 6 92 where exo III digestion may initiate. The sequence of the _1.4 kb EcoRI/Sall fragment was determined using single-stranded DNA templates with deletions generated in this manner. The smaller ~0.4 kb EcoRI/Sall fragment was cloned into mpl8/19 and sequenced entirely on both strands. The universal primer and the SOD specific oligonucleotides 13 and NS-2 were used as primers for sequence analysis. The oligonucleotide 13 corresponds to the template strand for mRNA and was used to sequence this fragment in mpl9. Similarly, the SOD specific oligonucleotide NS-2 corresponds to the coding strand and was used to sequence the same fragment cloned in the opposite orientation in mpl8. The strategy used to determine the sequence of the complete 1.8 kb gene fragment is shown (figure 15). 4. Nucleotide sequence of the CuZn SOD gene The EcoRI fragment was 1844 bp in size and contained the entire transcribed region for a CuZn SOD gene (in capitals in figure 16), 413 bp of the 5' untranslated region, as well as 247 bp of the 3' untranslated region (figure 16). Transcription start and stop sites were assumed to be the limits of the cDNA sequence. Nucleotide sequence analysis revealed that the Drosophila Sod gene consists of two exons separated by a single 725 bp intron. The first exon codes for the N-terminal methionine and the first 21 amino acids of the SOD protein. The second exon codes for 131 amino acids followed by the TAA termination triplet. The additional C-terminal triplet coding for valine found in the cDNA sequence was also found in the gene sequence. The transcribed region of the gene (in capitals) has three transitions (overlined) when compared to the Sod cDNA which was from 93 Figure 15. The strategy for determining the sequence of the CuZn SOD gene. The solid line at the top of the figure represents a 1.8 kb EcoRI fragment. The scale on top of the line shows the size of the fragment in base pairs. The open boxes represent the coding sequences. The number of the first and last codon in each coding sequence is listed below the box. The Sail site at codons 73 and 74 in the second exon is shown. The arrows below represent the sequencing strategy used, where the length of the arrow indicates the extent of the sequence read. Arrows pointing to the left show DNA sequence determined for the coding strand; arrows pointing to the right show sequence determined on the non-coding strand. Solid arrows and dotted arrows represent DNA sequences obtained from single and double-stranded DNA templates, respectively. Specific oligonucleotides used as primers for sequence determination are stated beneath the arrows. The unlabelled arrows represent sequences determined using universal forward and reverse primers. 94 200 400 600 800 1000 1200 1 <00 1490 1800 EcoRI J —-I I 1 1 ,' I LJ I 21 22 153 C O D O N S ..... I , , -< 13 -< 13 -< -< NS-1 -< -< NS-2 •>-ssDNA template dsONA template 95 another D. melanogaster source. These differences do not affect the amino acid sequence of SOD and may reflect variations between the different D. melanogaster strains used. In many eukaryotic genes the polyadenylation site is found about 30 bp downstream from the signal AATAAA (Watson et al., 1987). The poly A tract is added at this point after removal of part of the 3' untranslated region of the mRNA. The 3' untranslated region of the Drosophila SOD gene has a conserved AATAAA signal 27 bp upstream from the start of the poly A tract site which was identified in the cDNA clone. 5. Analysis of the CuZn SOD gene sequence The CuZn SOD gene has a single 725 bp intron which separates triplets coding for amino acid residues 21 and 22. This intron is in the same position as the first intron of the corresponding human CuZn SOD gene (Levanon et al., 1985). However, the human Sod gene spans 11 kb of chromosomal DNA and has 5 small exons separated by 4 large introns. A survey of intron and exon lengths in genes of vertebrates, insects, plants and fungi have been tabulated (Hawkins, 1988). The two coding regions in the Drosophila CuZn SOD gene are 63 nt and 396 nt long, respectively. The majority of exons in Drosophila genes are 100-180 nt long, but 15% are more than 550 nt long. The average length of a Drosophila exon is 392 nt. On the other hand, vertebrate genes have exons which are 100-170 nt in length with a mean length of 137 nt. Coding sequences of greater than 600 nucleotides are uncommon. Of the 75 Drosophila genes tabulated (including the CuZn SOD gene sequence), over half these genes have introns that are shorter than 100 nt in length. Of the introns which are 100 nt or shorter, 80% of them are between 50-75 nt 96 long. The shortest intron reported to date is 31 nt long and found in a Drosophila gene. In Drosophila, there are also introns greater than 2000 nt in length. Taking into account the very large and very small introns, the average size of an intron in Drosophila genes is 622 nt. In contrast, Hawkins tabulated the data from 1305 vertebrate genes and show that they have introns with a wide range of lengths but that shorter ones predominate. The average length of vertebrate introns has been determined to be 1127 nt long. Examination of split protein-coding gene sequences showed that the nucleotides at exon-intron boundaries are not random. Introns almost always begin with GT and end with AG (Breathnach et al., 1978). Since the work of Breathnach, 130 split gene sequences have been tabulated. Consensus sequences describing nine nucleotides around the exon-intron junctions have been established (Mount, 1982). The exon-intron donor 9AG|GT £ AGT . '. sequence consensus was found to be A | «• and the intron-exon ( T) N C acceptor sequence consensus was C 'n T Examination of the donor and acceptor sequences in the CuZn SOD gene shows that in some instances, the consensus nucleotides are not used. However, the intron-exon junction of the D. melanogaster Sod gene follows the GT-AG consensus sequence. It is interesting to note that the- 5'- donor sequence of the first intron in the human gene has an unusual variant 5' GC rather than the usual GT (Levanon et al., 1985). RNA polymerase II transcribes all known protein-coding genes. Its promoters lie 5' to the end of the transcribed region, and conserved sequences within the promoter regions have been recognized. An AT-rich 97 region of homology known as the TATA box has been frequently observed about 30 bp upstream from the transcription start site and appears to be necessary for accurate transcription initiation. The exact location of the TATA box varies with the first T occuring between positions -34 to -26 from the mRNA start site (reviewed by Breathnach and Chambon, 1981). The 5'-flanking region of the CuZn SOD gene contained a putative imperfect TATA sequence TATTTCT starting at position -26 (figure 16). A second region of homology known as the CAAT box has been found at variable positions and may reside on either DNA strand. The generality of this putative transcriptional control site remains to be demonstrated. In the CuZn SOD gene, the best match to the CAAT consensus sequence was CCCAAT centered at nucleotide -136. There was also a second CAAT box with reverse polarity (ATTGG) followed by a 17 bp G-C rich sequence from -277 to -293 (figure 16). In addition, nine base pairs (TGTCATTGG) which includes the reverse CAAT box, were identical to nine base pairs in the twenty-five base pair second distal signal of the herpesvirus thymidine kinase (tk) gene (McKnight et al., 1984). The herpesvirus tk gene contains one of the best-characterized mammalian RNA polymerase II promoters. Mutations within the proximal, first, and second distal signals reduced promoter activity (figure 17). Site-specific mutagenesis in the G-C rich region of the tk gene distal signal showed that this control site had a strong effect on the transcriptional efficiency of the thymidine kinase gene. The Drosophila Sod G-C rich region differs by being CGCGCC instead of CCGCCC as in the second distal signal of the tk gene. The G-C rich regions may represent a new class of promoters found in all housekeeping genes 98 Figure 16. Nucleotide sequence of the Drosophila CuZn SOD gene. The nucleotide sequence of the 1.8 kb EcoRI fragment is shown. The fragment contained the entire transcribed region for a CuZn SOD gene (in capitals), 413 bp of the 5' untranslated region, 247 bp of the 3' untranslated region and the single 725 bp intron. The transcription start site is numbered +1. The transcribed region of the gene has three transitions (overlined) when compared to the SOD cDNA sequence. The predicted amino acid sequence is shown below the nucleotide sequence. The additional C-terminal triplet coding for valine found in the cDNA sequence was also found in the gene sequence. Putative control sites in the 5' flanking region of the gene and the polyadenylation signal AATAAA in the 3' flanking region of the gene are underlined (Seto et al., 1987b). 99 -331 -312 gaattcctggat tcgt 1111 ta11 tatacaaaac -292 -272 -252 -233 aaagtaaat tgaatagt tcgcgccactgtcat tggaa taaatggaaggct tccaagtgaaccacccgt tegt tgaacag -2T3 " -193 -173 -154 c t c a a a a a a t t c a a c g c c a t t t g t g c a g t a a a a t t g t t c c g t t t t c a a a t t t t g t a a t t t g t a g c t t t t a t c c t t a a a a -134 -114 -94 -75 atgtaaataaatgtcccaataaaacatgagcttgaaata ttacaaagaaaaaatgct tccagtaacggca taatagtgt -55 -35 -15 1 gaacgaaacttttgcacaactgaacactaacagtaaaagttccgcatgtatttctaagctgctctgctacggtcACACC 25 45 65 80 ATAGAAGATACCTGGAAAGTTCTCAACTTTTTTCGTTTTGATAAATTGATTAATTCATTCGAA ATG GTG GTT AAA Met Val Val Lys 85 110 125 141 GCT GTC TGC GTA ATT AAC GGC GAT GCC AAG GGC ACG GTT TTC TTC GAA CAG GAG GTGAGAA Ala Val Cys Val l i e Asn Gly Asp Ala Lys Gly Thr Val Phe Phe Glu Gin Glu 161 181 201 220 TCCAAAATCATTTGAACTTCTCTGCTCGGCAAAATGTACGAAAAACAGAAGTTCTAAAGGTCAAATAGCCGGCTGCACC 240 260 280 299 CGCGGCCCCCTCTTCCACTTCAATATGCTGCTTTAAATTCTGTCGAGCATTTTAATTAAGTCCGATTTGAGTTTACGCC 319 339 359 378 TAGTCACCCAGCAAGTGCACCTTTATATTTATATAAGCCGCACCAAAATGCGCATATGTGTGTGCGCTCAAGTGCCTAC 398 418 438 457 AGCAAAGGTCACGAAATTAGTACTGGACATAAAAAGGAGTTAAGATATAAAGCTCACTTGTTCGTAAAGTATCGTTAAA 477 497 517 536 TATCAACAAATATTTGTTTTAGAATAAGCATTAGGAATATGGGAATAATTAGAATGATGCTGTTCATAATTAATTTGTA 556 576 596 ' 615 CATCAAAGTCAAAGCAGCAATGTCAAGTGTCAAGTAAACGATTATAAACTTGATGATTACAGGTTATGTTTCAGTGCCG 635 655 675 694 AGGAAATTTATGTTTTTAATCTATAAAGATAACCAAATGTTTACTTTGCTGCCTATAAATATTTCCGTTTAACGTGTGT 714 734 754 773 CTATTAACAAATGTTATTTTCTATAATAACCTATTATCATATGAAGTTGGCCACGCTCGTTATCATAATCAGTGCTTCT 793 813 833 852 GCTCACTATTATACACAACTTGTGTCTTATCAGTATTCGAGTATTATCTGAAGCGTTATAACCCAATCCCJTCATCCCG 868 883 898 913 TCCACAG AGC AGC GGT ACG CCC GTG AAG GTC TCC GGT GAG GTG TGC GGC CTG* GCC AAG GGT Ser Ser Gly Thr Pro Val Lys Val Ser Gly Glu Val Cys Gly Leu A l a Lys Gly 928 943 958. 973 CTG CAC GGA TTC CAC GTG CAC GAG TTC GGT GAC AAC ACC AAT GGC TGC ATG TCG TCC GGA Leu H i s Gly Phe His Val His Glu Phe Gly Asp Asn Thr Asn Gly Cys Met Ser Ser Gly 988 1003 1018 1033 CCG CAC TTC AAT CCG TAT GGC AAG GAG CAT GGC GCT CCC GTC GAC GAG AAT CGT CAC CTG-Pro H i s Phe Asn Pro Tyr Gly Lys Glu His Gly A l a Pro Val Asp Glu Asn Arg His Leu 1048 1063 1078 1093 GGC GAT CTG GGC AAC ATT GAG GCC ACC GGC GAC TGC CCC ACC AAG GTC AAC ATC ACC GAC Gly Asp Leu Gly Asn H e Glu Ala Thr Gly Asp Cys Pro Thr Lys Val Asn H e Thr Asp 1108 1123 1 138 1153 TCC AAG ATT ACG CTC TTC GGC GCC GAC AGC ATC ATC GGA CGC ACC GTT GTC GTG CAC GCC Ser Lys H e Thr Leu Phe Gly Ala Asp • Ser H e H e Gly Arg Thr Val Val Val His Ala 1168. 1183 1 198 1213 GAT GCC GAT GAT CTT GGC CAG GGT GGA CAC GAG CTG AGC AAG TCA ACG GGC AAC GCT GGT Asp A l a Asp Asp Leu Gly Gin Gly' Gly His Glu Leu Ser Lys Ser Thr Gly Asn Ala Gly 1228 1243 1259 1278 GCC CGC ATC GGG TGC GGC GTT ATT GGC ATT GCC AAG GTC TAA GCGATAATCTATTCCGATGTCGG Al a Arg H e Gly Cys Gly Val H e Gly H e Ala Lys Val HUH 1298 1318 — 1338 1357 CCACTGTGCTGATCTACTCTATTTAGCACTACCCACTGGAGATATGCAAACGATATACATACTTCTAAACATAAATACA 1377 1397 1417 1436 TAGCCTGTGGTCTGTTAGTTGATACGCAACCTTTGAGGTTCAATAAATTGGTGTTTTGAAATTGCCCCATAAACaaaaq 1456 1476 1496 tt a t a g t t t t e a t t t g a g t t g a g a t g g t a a g a a t g a a t a t a t c a c t t g t t g c t c g a c g a a t t c 100 HERPES V I R U S T H Y M I D I N E KINASE GENE SECOND D 1ST AL SIGNAL FIRST DISTAL SIGNAL PROXIMAL SIGNAL - 1 0 5 -80 -61 - 4 7 -32 - 1 6 - CCCCGCCC AGCGTCTTGTC ATTGGC C AGTCGGGGCGGCG TTCGCATATTAAGGTG— GAATAGTTCGCGCCACTGTCATTGGA TTCCGCATGTATTTCTAA— 1 r I I -293 -277 -35 -18 DROSOPHILA-CU-ZN SOD GENE Figure 17. Comparison of the transcriptional control sites in the herpesvirus tk and Drosophila CuZn SOD gene. The proximal, first and second distal signals of the herpesvirus thymidine kinase (tk) gene (McKnight et al., 1984) are shown. The 5' flanking region of the Drosophila CuZn SOD gene from -18 to -35 and from -277 to -293 is aligned below the tk gene. The SOD gene has a putative imperfect TATA sequence TATTTCT starting at position -26 (underlined). In the SOD gene there was a 17 bp sequence from -277 to -293 that has a CAAT box with reverse polarity (ATTGG) followed by the GC rich sequence CGCGCC (underlined). Nine base pairs (TGTCATTGG) which include the reverse CAAT box are identical to nine base pairs in the twenty five base pair second distal signal of the herpesvirus tk gene. 1 01 (Dynan, 1986). A functional dependence exists between the two distal transcription signals in the herpesvirus tk gene. The first distal signal requires the presence of the second distal signal in order for transcription of the gene to occur. However, the second distal signal can function alone in the absence of the first distal signal. The second distal signal can function in either orientation and increases the transcription of the gene when moved closer to the transcription initiation site. Therefore, the role of the second distal control signal may be investigated in the Sod gene of Drosophila. Moving this control signal closer to the transcription initiation site may be an effective approach towards increasing the transcription of the Sod gene. Another region for which a consensus sequence has been compiled is that flanking the translation start site. ln the Drosophila Sod gene, the initiator methionine codon was preceded by the four nucleotides CGAA compared to the consensus C/A AA A/C derived by Cavener (1981) for Drosophila genes. The variant nucleotide G at the -3 position in the Sod gene was found to occur in 13% of the genes whereas A was found in 82% of the genes used to derive the consensus sequence. It should be noted that the commonly used consensus sequence CANC was derived largely from vertebrate gene sequence data (Cavener, 1981). Codon usage data are useful for designing oligonucleotide probes, as the preferred codon may be used to decrease the degeneracy of a mixed probe. Also, in the cases where several overlapping open reading frames of a gene may be translated, one may examine the preferred codon usage to 1 02 deduce which is the most likely protein sequence. The codon usage of the SOD mRNA was compared to that of eight other Drosophila genes (Table I) and it was found to be similar (O'Connell and Rosbach, 1984). The DNA coding region has relatively high GC content and there is a preference for codons ending in C (46%) and G (28%). The codons ATA, ACA and CGG are not observed in the CuZn Sod gene nor in any of the other eight Drosophila genes examined. In Drosophila, abundant genes do show an extensive codon bias. However, the codon bias in Drosophila differs from that found for abundant yeast genes. Thus, there exists a species specific bias in the usage of the degenerate codons (Grantham et al., 1980). Comparision of the coding regions of the Drosophila, rat, and human Sod genes showed that the Drosophila gene has 57% and 56% homology to the corresponding rat (Delabar el al., 1987; Ho and Crapo, 1987) and human (Levanon et al., 1985) Sod genes, respectively (figure 18). The rat Sod gene shows a 85% sequence homology in the coding region and 71% in the 3' untranslated region when compared to the human Sod gene. The SOD protein has been found to be polymorphic in many organisms. In D. melanogaster, the two common electromorphs are SOD fast (SOD F) and SOD slow (SOD s) (Lee et al., 1981b; Lee and Ayala, 1985). Examination of the CuZn SOD gene sequence revealed that it codes for the SOD fast (SOD F) electromorph. SOD F has an asparagine at amino acid 96 whereas SOD^ has a lysine at this position (Lee and Ayala, 1985). The SOD F gene was isolated from a genomic DNA library made from an isogenic stock of Drosophila. Therefore, this DNA library should only contain the SOD F gene. The S O D F was changed to the SOD^ gene by site-I 03 Table I. Codon usage for the CuZn Sod genc. UUU-PHE-0 (7) UUC-PHE-6 (60) UUA-LEU-0 (4) UUG-LEU-0 (14) UCU-SER-0 (11) UCC-SER-3 (64) UCA-SER-1 (7) UCG-SER-1 (29) UAU-TYR-1 (18) UAC-TYR-0 (59) UAA-OCH-1 UAG-AMB-0 UGU-CYS-1 (3) UGC-CYS-4 (18) UGA-OPL-0 UGG-TRP-0 CUU-LEU-1 (9)" CUC-LEU-1 (17) CUA-LEU-0 (6) CUG-LEU-S (110) CCU-PRO-0 (16) CCC-PRO-3 ( 8 7 ) CCA-PRO-0 (23) CCG-PRO-2 (10) CAU-H1S-1 (12) CAC - H 1 S - 7 (52) CAA-GLN-0 (9) CAG-GLN-2 (104) CGU-ARG-1 (35) CGC-ARG-2 (58) CGA-ARG-0 (6) CGG-ARG-0 (0) AUU-JLE- 5 (23) AUC-ILE- 4 (107) AUA-ILE- 0 (0) AUG-MET-2 ACU-THR-0 (10) ACC-THR-5 (99) ACA-THR-0 (0) ACG-THR-4 (9) AAU-ASN-3 (18) AAC-ASN-5 (89) AAA-LYS-1 (4) AAG-LYS-8 (111) AGU-SER-0 (2) AGC-SER-4 (38) AGA-ARG-0 (5) AGG-ARG-0 (14) GUU-VAL-4 (26) GUC-VAL-6 (61) GUA-VAL-1 (9) GUG-VAL-5 (63) GCU-ALA-3 (3S) GCC-ALA-8 (128) GCA-ALA-0 (9) GCG-ALA-0 (13) GAU-ASP-S (51) GAC-ASP-5 (70) GAA-GLU-1 (14) GAG-GLU-7 (133) GGU-GLY-7 (51) GGC-GLY-13 (74). • GGA-GLY-4 (40) GGG-GLY-1 (1) The CuZn Sod gene codon usage table is shown and compared to that for nine other Drosophila genes (in parentheses): yolk protein genes YP1 and YP2, cuticle protein genes CP1 to CP4, two actin genes, and the ribosomal protein 49 gene (O'Connell and Rosbash, 1984). Results are presented in the order: codon-aa-no. of occurences in the Sod gene-(sum of the no. of occurences in the nine other genes). 1 04 Figure 18., Comparison of the nucleotide sequences of the coding region for Drosophila, rat, and human CuZn SOD genes. The coding region for the Drosophila (d), rat (r), and human (h) CuZn SOD genes are shown. The first nucleotide of the Met initiator triplet in each sequence is number one and blanks introduced to obtain maximum homology are assigned numbers. The Drosophila gene shows 57% and 56% homology to the human and rat Sod genes, respectively (Seto et al., 1989). drosophl la ATG GTG GTT AAA GCT GTC TGC GTA ATT AAC GGC GAT GCC AAG GGC ACG GTT TTC rat -C- A-G —G —C —G --G C-G --G . . . --C -GT CC- GTG CAG GTC A— CA-human -C- ACG --G --C --G --G C-G —G --C -G- CCA GTG CAG -TC A-C AAT d TTC GAA CAG GAG AGC AGC GGT ACG CCC GTG AAG GTC TCC GGT GAG GTG TGC GGC CTG GCC r • —G A— GCA GAA —A --T GT- --G —A —A C-- A-T ACA --A T-A A-T h --G A-- GAA --T AA- GGA --A --G -GG --A AGC A-T AAA --A A-T d AAQ GGT CTG CAC GGA TTC CAC GTG CAC GAG TTC GGT GAC AAC ACC AAT GGC TGC ATG TCG r G-A —C GA- —T --G --T —C --T C-A -AT —G . . . —T —A C-A —T -CC A-T h G-A --C . . . --T --T —T --T —T --A --T --T —A GCA --T -CC AGT d TCC GGA CCG CAC TTC AAT CCG TAT GGC AAG GAG CAT GGC GCT CCC GTC GAC GAG AAT CGT r G-A --T --T --T --T C-C TCT A-A . . . -G- --A -CG --T --A G-G A-G h G-A --T —T --T —T CTA TC- -GA A-A --C —T -GG --A AAG — T --A G-G A-G d CAC CTG GGC GAT CTG GGC AAC ATT QAG GCC ACC GGC GAC TGT CCC ACC AAG GTC AAC ATC r --T G-T —A --C --T G-G -CT —T GGA AAG G— GTG G-- --T --G TC- --T h — T G-T —A —C T-- —T G-Q ACT --T GA- AAA --T G-- GTG G-- G-T --G TCT --T d ACC GAC TCC AAG ATT ACG CTC TTC GGT GCC GAC AGC ATC ATC GGA CGC ACC GTT GTC GTG p GAA —T CGT GT- —C T-A -CA --A -AG C-T TC- —T --C —T — T A-G --G --C h GAA --T —T GT- —C T-A -CA —A -A- C-T T-- --T --C --A C-G --G --C d CAC GCC GAT GCC GAT GAT CTT GGC CAG GGT GGA CAC GAG CTG AGC AAG TCA ACG GGC AAC P . . . -AG A-A CAA . . . --C T-G --- A-A «-- A-T —A GAA —T -CA AAG --T --A --T h --T -AA A-A —A . . . --C T-G A-A . . . A-T --A GAA --T -CA AAG --A --A d GCT GGT GCC CGC ATC GGG TGC GGC GTT ATT GGC ATT GCC AAG GTC TAA p --A AG- T-G -CT --T --T —G . . . --G . . . . . . C-A . . . h --A AGT --T T-G -CT —T --T —A --G --C C-A o 1 06 directed mutagenesis (Smith, 1985). The oligonucleotide 5'-CGGTG ATCJTTGACCTTGG-3' (NS-3) directed to nucleotides 1074-1093 of the genomic SOD sequence (figure 16) was used to change asparagine-96 with the codon AAC at nucleotide 1082-1084 to lysine-96 with the codon AAG (S. Hayashi, personal communication). This SOD^ gene constructed by site-directed mutagenesis will have the same 5'- and 3'- flanking sequences of the SOD F gene. It is possible that the natural SOD s gene has different control elements in these flanking regions. A partial gene sequence for amino acids 90-121 for the SOD^ gene has been reported, but this provides no information on the sequence which flanks the coding region (Kirkland and Phillips, 1987). 6. Cytogenetic localization of the CuZn Sod gene The cytogenetic localization of the CuZn Sod gene was determined by in situ hybridization to the polytene chromosomes of larval salivary glands (figure 19). A single hybridization signal was detected at position 68A4-9 which is within the 68A2-C1 region designated by genetic means as containing the CuZn Sod gene (Campbell et al., 1986). The Sod gene probe also hybridized to the same position in the Sod 'null' mutant (data not shown) indicating that the DNA homologous to this gene is present in the 'null' mutant despite the low level of enzyme found. C. P element mediated transformation of the CuZn SOD gene 1. Construction of the P element vectors Sod-P element hybrid plasmids (figure 20) were constructed by inserting the 1.8 kb EcoRI restriction fragment containing the Sod gene into the unique EcoRI restriction site of the transposable P vector 1 07 Figure 19. Chromosomal localization of the Drosophila Sod gene. Recombinant DNA containing the Sod gene was used as a template to make RNA probes labelled with 5-[ 1 2 5I]CTP using E. coli RNA polymerase. The RNA probes were hybridized to Drosophila polytene chromosomes. Autoradiographic exposure was for four days. The Sod gene hybridized specifically to a unique site at 68A4-9 on chromosome 3L(arrowhead). The bar in the figure represents 10pm. (Photograph courtesy of S. Hayashi). 108 Figure 20. The pneoSOD transposon. The pneoSOD plasmid was constructed by inserting a 1.8 kb EcoRI restriction fragment containing the Sod gene into the unique EcoRI restriction site of pUChsneo. The direction of Sod gene transcription is opposite to that of the hsp70 heat-shock promoter driven neomycin resistance (neo) gene. The terminal repeats (P) of the P element are recognized by the transposasc and are required for transposition. 1 09 pUChsneo (Steller and Pirrotta, 1985). The 1.8 kb gene fragment contains the coding region of the S gene as well as 413 bp of the 5'-untranslated region. Plasmid DNA prepared from transformed E. coli was analyzed by restriction digests to determine the presence and orientation of the inserted gene fragment. Only one hybrid plasmid, pneoSOD, carrying the Sod gene in one orientation was used in these investigations as previous studies have shown that correct gene expression occurs independently of its orientation within the transposon (Goldberg et al., 1983). The direction of Sod transcription in pneoSOD is toward the unique BamHI restriction site in the plasmid and is opposite to that of the neomycin resistance gene which is driven by the hsplQ heat-shock promoter (figure 20). Since the transformants are selected on the basis of acquired resistance to G418, this vector system allows the insertion of P transposons into the genome of the desired isogenic strain. 2. P element mediated transformation D r o s o p h i l a embryos of the isogenic wt Oregon R strain (GO embryos) were microinjected prior to pole cell formation with a mixture of pneoSOD DNA and the helper plasmid phsn. The second set of microinjections differed from the first set in that the humidity was raised to 70% and the DNA concentration was doubled (Table II). This alteration resulted in a 20% increase in the number of first instar larvae that hatched from the injected embryos. In total, 975 embryos were successfully injected and 327 of these hatched into first instar larvae. Approximately half of these larvae survived to become adult flies. Of the 185 adult flies recovered, 81 were found to be sterile. There were 61 sterile females and only 20 sterile 11 0 Table II. Results of the P element mediated transformation experiments. Experiment 1 was conducted at 50% humidity and 250 pg/ml pneoSOD/50 pg/ml phsTt was used for the microinjections. Experiments 2-4 were conducted at 70% humidity and the microinjected solution contains 500 pg/ml pneoSOD and 100 pg/ml phsn. The number and sex of transformants obtained from each experiment is shown. In total, 975 embryos were successfully injected and 327 of these hatched into first instar larvae. Of the 185 adult flies recovered, 81 were found to be sterile. Seven transformants were obtained, and five of which were used to form transformed lines. EXPT. NO. EMBRYOS FIRST GO ADULTS FERTILE STERILE TRANSFORMANTS TRANSFORMED INJECTED INSTAR ALIVE ADULTS ADULTS LINES LARVAE 1 329 69 260s 15? 260* 15? 0 o* 0 ? 10* Sod + 1 2 197 70 140* 18? 9 o* 0 ? 5 o* 8 ? 10* Sod + 2 3 239 105 350* 35? 250* 18? 100* 27? 2? 10* ( n o l i n e s ) Sod + 4 4 210 83 210* 21? 160* 5 ? 5 0* 16? 20* Sod +3,5 TOTAL 975 327 185 104 81 7 5 1 1 2 males. Previous studies have shown lhat approximately 50% of the adults were sterile after microinjection(Karcss, 1985). This is in good agreement with the 44% sterility reported here (Table III). The 104 fertile adults that developed from the injected embryos were individually mated in vials to the wt Oregon R recipient strain and allowed to lay eggs on food containing the antibiotic G418. Germlinc transformants were selected on the basis of acquired resistance to G418. Seven putative transformants were recovered (5 males, 2 females) which represents 0.7% of the injected embryos and 6.7% of the fertile adults recovered (Table III). 3. Establishment of transformed lines The transformed lines were initially established by mating each G418 resistant Gl adult to isogenic Oregon R flies and then inbreeding the G418 resistant progeny. Many generations were required to produce enough flies for the subsequent crosses. Five of the strongest transformed lines were selected and maintained (designated Sod+\-5). Our strategy was to cross the transposed Sod gene back to the isogenic wt flies so that a uniform genetic background could be maintained in all the individual transformed lines. This was done using conventional genetic techniques involving balancer chromosomes (see Materials and Methods). It was also desirable to maintain the inserts over balancer chromosomes (i.e. to produce a balanced stock) as it was expensive and tedious to continually maintain so many lines on the antibiotic G418. In order to simplify the genetic crosses, the chromosomal location of the inserted Sod gene was determined first by in situ hybridization of a Sod gene probe to salivary gland polytcne chromosomes of larvae from each transformed line (see i 1 3 Table III. Analysis of P clement transformation data. EXFT. NO. INJECTED EMBRYOS HATCHED ADULTS ECLOSED FROM LARVAE ADULTS STERILE TRANSFORMANTS FROM FERTILE ADULTS TRANSFORMANTS FROM INJECTED EMBRYOS 1 2 3 4 21 35 44 40 59 46 67 51 0 72 53 50 1.7 1 1 9.1 9.5 0.30 0.51 1.3 0.95 AVG 34 57 44 6.7 0.72 * values expressed as a percentage The data from Table II is expressed as a percentage. In experiment 1 (conducted at 20% humidity) only 21% of the injected embryos hatched into first instar larvae. Increasing the humidity to 70% in experiments 2-4 increased this value by almost 20%. Of the adults recovered, 44% were found to be sterile. The 7 transformants recovered represent 0.72% of the number of injected embryos and 6.7% of the number of fertile adults recovered. 1 1 4 Section C. 5). The transformed lines were then balanced and made homozygous for the inserted transposon. By this approach, four of the five transformed lines were made isogenic and homozygous for the single transposon insertions. These flics would have four potentially functional Sod genes (Table IV). We were unsuccessful in obtaining a homozygote for the Sod+-4 line. Presumably this insert disrupts an essential gene such that the homozygous state is lethal. The Sod+-4 line was maintained over the balancer chromosome CyO and was therefore not isogenic for the second chromosome. Further analysis of this transformed line with three potentially functional Sod genes was carried out on heterozygotes. Also, the transformed line Sod+-5 appeared to have some deaths occuring in the late pupal stage while others from the same stock eclosed normally and survived as adults. 4. Chromosomal localization of the transposed Sod gene The chromosomal positions of the transposed pneoSOD DNA sequences were determined by in situ hybridization of a Sod gene probe to salivary gland polytene chromosomes of larvae from the transformed lines. In each transformed line only one other site of hybridization was observed besides that of the endogenous Sod gene at 68A4-9. Of the five lines examined, four had inserts on chromosome 2R while the fifth line, Sod+-3 had an insert on chromosome 3 L (Table IV). The hybridization sites on the polytene chromosomes for Sod+-\ and Sod+-3 are shown (figure 21). These results show that the pneoSOD sequences transposed into the germline and that the insertions occured al a unique site in the genome. 5. Southern analysis of transformed lines i l5 Table IV. Chromosomal localization of the inserted SOD gene. TRANSFORMANT NAME TRANSFORMED LINE NO. OF SOD GENES SITE OF INSERTION (CHROMOSOME) TF 1 Sod+-l 4 48B (2R) TF2B Sod+-2 4 60B (2R) TF 3 Sod*-3 4 67AB (3L) TF 6 Sod+-4 3 49BC (2R) TF 7 Sod+-5 4 51AB (2R) The chromosomal positions of the transduced pneoSOD DNA sequences were determined by in situ hybridization of a Sod- gene probe to salivary gland polytene chromosomes of larvae from the transformed lines Sod+-l to Sod+-5. The site of insertion is shown, with the chromosome number in parentheses. The transformed line formed from each transformant and the number of Sod genes present in each tranformed line is shown. 116 Figure 21. Chromosomal localization of the transposed Drosophila Sod gene. Recombinant DNA containing the Sod gene was labelled with biotin-11-dUTP and hybridized to D r o s o p h i l a salivary gland polytene chromosomes. Hybridization signals were visualized by the streptavidin-alkaline phosphatase detection system. Hybridization was observed at the Sod locus at 68A4-9 (single arrowhead) and at the additional site of the Sod sequence in the transposon. (a) The transformant Sod+-3 has an additional Sod gene inserted at 67AB (double arrowhead) (b) The transformant Sod+-l has an additional Sod gene inserted at 48B (double arrowhead). The positions of transposon insertion in the other transformed lines were determined in the same manner. Bar=10 um. (Photographs courtesy of Dr. S. Hayashi). 1 1 7 b 1 1 1 8 The transposed Sod DNA sequences were analyzed by a Southern blot of genomic DNA from each transformed line. Hybridization of the radiolabeled Sod gene (cloned in pUC13) to genomic DNA digested with EcoRI reveals that besides the endogenous Sod gene, a single copy of pneoSOD DNA is present in each transformant (figure 22). This is in agreement with the in situ hybridization results. From these results, we can conclude that an additional copy of the Sod gene has inserted into the genome. The genomic DNA analyzed was isolated from each transformed line after many generations of inbreeding. Thus, the transposed gene appears to be stably integrated. Previous studies show that transposons introduced into germline chromosomes by transformation do not undergo detectable rearrangement (Spradling and Rubin, 1983; Rubin and Spradling, 1982). D. Expression of additional CuZn SOD genes 1. Quantitation of the SOD transcript in transformed lines Genomic Southern and in situ hybridization experiments demonstrated the presence of transposed Sod DNA sequences at specific chromosomal locations in each of the G418-resistant lines. We proceeded to examine the quantitative expression of the transposed Sod genes. Analysis of RNA from the transformed lines revealed that the transposed Sod gene was expressed and Sod mRNA of the correct size was produced (figure 23). This expression, quantitaled as Sod-specific mRNA was standardized by comparison with three actin transcripts (Fryberg et al., 1980) which are unaffected by the transformations. A Northern blot of total Drosophila RNA show a 0.7-0.8 kb Sod transcript as well as the 1.65, 1.95, and 2.3 kb 119 Figure 22. Southern analysis of transposed Sod DNA. Genomic DNA from adult flies of the wt recipient strain (lane 1) and five transformed lines (lanes 2-6: Sod+-\ to Sod+-5) were digested with EcoRI restriction endonuclease, separated by electrophoresis in a 0 .7% agarose gel and transferred to a nylon membrane. A pUC13 plasmid containing the 1.8 kb Sod gene fragment was radiolabeled and hybridized to DNA on the membrane. The resulting autoradiogram is shown. The 1.8 kb hybridizing band represents the endogenous Sod gene as well as the transposed Sod gene (arrowhead). The five transformed lines have an additional hybridizing band which is the result of a fusion of the genomic DNA sequence with the remaining part of the pUChsneo vector. Size markers were from a Hindlll digest of X DNA, run in a parallel lane (sizes shown in kb). 23 9.4 6.6 4.4 2.3 2.0 .56 1 2 1 actin transcripts in all the strains studied (figure 23). The measurements from the transformants were compared to those from the wt recipient strain which only has the two endogenous Sod genes. The results show that the quantity of Sod transcript was greater in the transformed lines when compared to the wt Drosophila except for the Sod+-\ transformant. It had about the same level of SOD transcript as wt (Table V). In contrast, a heterozygous deficiency of the Sod region, D/(3L)lxd 9/TM3 SbSer(Df 68A3,4-68B4,C1), which has only one copy of the Sod gene was found to produce 50% of the wt transcript (Table V). Previous studies have shown that although the expression of transposed genes may be subject to position effects, they are generally expressed (Goldberg et al., 1983; Hazelrigg et al., 1984; Scholnick et al., 1983; Spradling and Rubin, 1983). 2. SOD-specific activity of transformed lines Since the Sod gene should be constitutively expressed in all tissues, SOD-specific activity measurements were performed using homogenates of whole flies. The results of the experiments repeated on flies from subsequent generations demonstrated that the increased specific activity measured was a heritable trait. The range of SOD activity for the five transformed lines was between 131% to 170% of the value for the wt Oregon R (Table V). There was essentially no measureable difference in activity between the males and females in each strain. Also, the heterozygous Sod deficiency strain Df(3L)l xd^/TM 3ShSer was found to have ~60% of the wt SOD activity. Taken together, the Sod transcript and enzyme analyses show that in the transformants additional Sod m R N A and SOD enzyme were produced 122 Table V. SOD-specific activity and transcripts in transformed and control strains. STRAIN NO. OF GENES SOD-SPECIFIC ACTIVITY female male SOD TRANSCRIPT Df (3L)lxd9 1 66 ± 1 5 (5) 60 ± 7 (6) 50 ± 7 (4) wt 2 100 100 100 Sod + - 4 3 145 ± 18 (6) 132 ± 12 (6) 149 ± 3 9 (5) Sod +-1 4 131 ± 16 (6) 134 ± 10.(6) 99 ± 8 (4) Sod +-2 4 153 ± 19 (8) 142 ± 2 (5) 153 ± 42 (5) Sod +-3 • 4 164 ± 26 (10) 146 ± 19 (10) 137 ± 15 (5) Sod +-5 4 167 ± 25 (6) 170 ± 2 2 (8) 130 ± 16 (4) The number of Sod genes in the transformed and control strains are shown. The SOD activity in a homogenate of adult males and of females of each strain was normalized to the amount of protein present. The number reported is the mean percentage of the normalized SOD activity in each strain as compared to that of wt Drosophila. Total Drosophila RNA was prepared from males and females. The Sod-specific mRNA was normalized to the amount of actin transcript present in each sample. The number reported is the mean percentage of Sod mRNA present in each strain as compared to that of wt Drosophila. Means and standard deviations are given. Figures in parentheses record the number of individual determinations. 1 2 3 Figure 23. Northern analysis of endogenous and introduced Sod genes. Total RNA (30 pg) from each D r o s o p h i l a strain was separated by electrophoresis in a 1.4% agarose gel containing formaldehyde and transferred to a nylon membrane. The membrane was hybridized with radiolabeled plasmids containing the Sod cDNA and the actin gene. The resulting autoradiogram shows all strains have a single Sod gene transcript at 0.7-0.8 kb (single arrowhead) and the three actin transcripts (double arrowhead). Lanes 1-7: RNAs from Sod deficiency £>/(3L)lxd9, wt Oregon R, and transformant lines Sod+-\ to Sod+-5, respectively. An RNA ladder (BRL) was used for size markers (in kb). The regions corresponding to the Sod and actin gene transcripts were excised from the membrane and the transcripts quantified by scintillation counting of the emitted Cerenkov radiation. 124 0 . 2 4 -125 demonstrating that the transposed Sod genes were functional. Despite the small amount of flanking DNA present, the 1.8 kb gene fragment appears to include all the cis-acting sequences necessary for Sod gene expression. With the exception of S o d + - l , the strains carrying the transposon expressed greater levels of SOD-specific mRNA than their wt counterparts. The discrepancy between the transcript level and SOD activity found in the Sod+-l line remains unexplained. Parallel to the increased SOD mRNA levels, greater SOD activity was demonstrated in the other transformants. In all cases, transformants exhibited higher enzyme activity than the wt controls. E. Longevity studies In Drosophila, the superoxide scavenging ability of tissues has been implicated as an important determinant of longevity (Fleming et al., 1987). Therefore, the lifespan of the SOD 'null' mutant as well as that of the transformed lines overexpressing SOD was investigated. In this study, the survival curves of all the Drosophila populations show the characteristic sigmoid-shaped death phase. The females were longer lived than the males in most of the strains studied, although this is not always the case. The lifespan of Drosophila depends to a large extent on the environmental conditions and as many variables as possible must therefore be controlled. For example, the food volume, type and frequency of replacement are known to alter lifespan. Also, the mated or unmated status of the flies and the age of the parents are important factors which affect Drosophila lifespan (Lints, 1988). 1. The longevity of wildtype isogenic Oregon R 126 The survival curves of wt isogenic Oregon R strain measured from two independent experiments at 29°C are compared (figure 24). Slight variation in the average lifespans was noted between the two experiments. Previous studies on the lifespan of a Drosophila strain measured over an extended period of time under the same conditions also show some variation (Lints, 1988). Also, the elevated temperature of 29°C decreases the lifespan of Drosophila, but has no deleterious effects on development or behavioral activity (Leffelaar and Grigliatti, 1984a,b). 2. The longevity of a SOD 'null' mutant At 29°C, the SOD 'null' mutant had a mean adult lifespan of 28 days compared to 42 days for wt (figure 25). Since the genetic background of the SOD 'null' mutant differed from that of the isogenic wt strain, the mean lifespans of the D/(3L)lxd9/SOD 'null', SOD 'null7+ and D/(3L)lxd9/+ hybrids were determined. These were 46, 52, and 56 days respectively (figure 25). The free radical theory of aging would predict that a SOD 'null' mutant with its low SOD level and subsequent impaired oxygen defense systems would have a reduced lifespan. In fact, the lifespan of the SOD 'null' was found to be reduced when compared to wt Oregon R with a different genetic background. In contrast, the D/(3L)lxd 9/SOD 'null' hybrid which should have SOD levels lower than the homozygous SOD 'null' has a mean lifespan exceeding that of wt. This unexpected finding may be a reflection of the hybrid vigour which is known to result from crossing two highly inbred strains (Lamb, 1978). These results clearly demonstrate the importance of comparing the lifespans of strains with identical genetic backgrounds. Therefore, when the genetic backgrounds are controlled, it "127 Figure 24. Lifespan of wt isogenic Oregon R measured at 29°C. (a) The lifespan of males and females (200 of each) from the wt isogenic Oregon R strain was measured on June 1988 at 29°C. The females lived longer than the males. The lifespan of (b) males (#2) and (c) females (#2) from the same isogenic Oregon R strain (50 of each) was measured on January 1989 at 29°C and compared to the survival curves from June 1988. The smaller sample size in the second measurement did not affect the results obtained. 128 0 10 20 30 40 SO 60 Ag« (days) a « / • females • female 12 0 10 20 30 40 SO 60 Ag« (days) 129 Figure 2 5 . Lifespan of a SOD null mutant measured at 2 9 ° C . (a) The lifespan of males and females ( 2 0 0 of each) from a SOD null mutant strain was compared to wt isogenic Oregon R. The SOD null mutant had a mean adult lifespan of 2 8 days compared to 4 2 days for wt. The survival curves of (b) males and (c) females from D/(3L)lxd 9/SOD null, SOD null/+ and D/(3L)lxd9/+ flies were compared to that of the SOD null mutant and the wt isogenic Oregon R strain. The sample sizes for (b) males were as follows: 2 0 0 +/+; 2 0 0 SOD null; 5 7 def/null ; 4 5 null/+; 7 0 def/+ (c) for females were as follows: 2 0 0 +/+; 2 0 0 SOD null; 6 4 def/null; 4 0 null/+; 6 0 def/+. 1 30 10 i * * * * i 20 30 Age (days) Sod null males Sod null females +/+ males +/+ females • • A Sod . null males def/null males null/+ males def/+ males +/+ males Age (days) a Sod null females • def/null females • +/null females • def/+ females A +/+ females A g e (days) 1 3 1 may be possible to demonstrate that greatly diminished SOD levels decrease lifespan. 3 . The longevity of the transformed lines The transformed lines overexpressing SOD had mean lifespans comparable to that of wt (figures 26 and 27). The lifespan of males and females from the transformed lines Sod+1,2,4 and 5 was measured at 29°C. At 29°C, the lifespan of Sod+-2 males was the same as wt. Males from Sod+-4,5 had lifespans marginally greater than wt. In contrast, males from the Sod+-\ line had a decreased lifespan when compared to wt (figure 26). At 29°C, the Sod+-l females have a lifespan comparable to wt, whereas Sod+-2,4,5 females have an increased lifespan compared to wt (figure 27). The survival curves were repeated at 25°C, with some results differing from those obtained at 29° (figures 28 and 29). The variability inherent in these measurements may account for these differences. At 25°C, the lifespan of Sod+-5 males was the same as wt, whereas the lifespan of males from Sod+-l,2,3 was marginally shorter than wt males. In this experiment, only the males from Sod+-4 lived longer than wt males (figure 28). At 25°C, the lifespan of Sod+-l,2,5 and Sod+-3A females was shorter and longer than wt females, respectively (figure 29). The mean lifespan of the strains studied are summarized in Table VI. Thus, the differences in lifespan in the Sod+ transformed lines were not large enough to overcome the variability inherent in these types of measurements. These results show that additional SOD clearly does not increase the lifespan of D r o s o p h i l a . F. Sensitivity to paraquat toxicity The herbicide paraquat (methyl viologen dichloride hydrate; 1,1'-1 32 a aga(days) Figure 26. Lifespan of males from Sod transformed lines at 29°C. The survival curves of the transformed lines (a) Sod+-\ (90 males) and Sod+-2 (80 males) and (b) Sod+-4 (70 males) and Sod+-5 (70 males) was compared to wt (50 males) at 29°C. The longevity of Sod+-2 males was the same as wt, whereas the Sod+-4,5 males show marginally increased longevity compared to wt. Males from Sod+-\ showed decreased longevity when compared to wt. 1 33 a • g « ( d « y » ) o +/+ females • Sod+-4 females • Sod+-S females « g « ( d « y « ) Figure 27. Lifespan of females from Sod transformed lines at 29°C. The longevity of the transformed lines (a) Sod+-l (100 females) and Sod+-2 (80 females) and (b) Sod+-4 (70 females) and Sod+-5 (70 females) was compared to wt (50 females) at 29°C. The lifespan of Sod+-\ females was the same as wt, whereas Sod+-2,4,5 females lived longer than wt. 1 34 100 90 -80 -70 -60 -50 -40 -30 -20 -10 -0 a HA B' T l r - * - * * - * —r-20 80 • +/+ males A Sod+-l males a Sod+-2 males • Sod+-3 males 100 H +/+ males • Sod+-4 males • Sod+-5 males age(days) Figure 28. Lifespan of males from Sod transformed lines at 25°C. The longevity of the transformed lines (a) Sod+-\ (50 males), Sod+-2 (60 males), and Sod+-3 (60 males) (b) Sod+-A (60 males) and Sod+-5 (60 males) was compared to wt (50 males) at 25°C. The lifespan of males from Sod+-5 was the same as wt, whereas Sod+-1,2,3 males were shorter lived than wt males. The males from Sod+-4 lived longer than wt males. 1 35 0 20 40 60 80 aga(days) 0 20 40 60 80 100 age(days) Figure 29. Lifespan of females from Sod transformed lines at 25°C. The longevity of the transformed lines (a) Sod+-\ (60 females), Sod + -2 (60 females), and Sod+-3 (60 females) (b) Sod+-4 (60 females) and Sod+-S (60 females) was compared to wt (50 females) at 25°C. Compared to wt, the females from Sod*-\,2,5 were shorter lived whereas the females from Sod+-3,4 were longer lived. 1 3 6 Table VI. Summary of longevity data. STRAIN AVERAGE SOD-SPECIFIC ACTIVITY MEAN LIFESPAN AT 29°C (days) males females MEAN LIFESPAN AT 25°C (days) males females wt (June'88) 100 41 47 ND ND wt #2 (Jan '89) 100 42 48 61 63 SOD 'null' 3.5* 28 28 ND ND D/(3L)lxd9/SOD 'null' 1.7* 46 49 ND ND SOD 'null'/ + 51.7* 52 55 ND ND D/(3L)lxd 9/ + 50.0* 56 59 ND ND Sod+-l 132 39 47 53 51 Sod+-2 148 44 49 54 56 Sod+-3 155 ND ND 59 70 Sod+-4 138 43 52 61 72 Sod+-5 168 42 46 60 53 • data from Graf and Ayala (1986) * theoretical values ND no data available The survival curves for each strain are shown in figures 24-29. The mean lifespan of each strain is reported in days. Theoretical SOD activity as well as experimentally determined SOD activity values are also reported. The experimentally determined SOD activity values are from Table V and is an average of the values for male and female samples. 1 37 dimethyl-4,4'-bipyridinium dichloride; Pq 2 +) is also highly cytotoxic and lethal to animals. The parent cation P q 2 + undergoes a single electron transfer to form a relatively stable paraquat free radical Pq + which reacts rapidly with O2 to form superoxide anions (O2"). The herbicidal and toxicological properties of paraquat are due to this single electron reduction-oxidation reaction, resulting in depletion of cellular NADPH and the generation of potentially toxic forms of O2 such as O2". The excessive O 2" formed which is not removed by SOD is responsible directly or indirectly for cell death (Hassan and Fridovich, 1978; 1979). Feeding adult D r o s o p h i l a with aqueous P q 2 + may result in exposure of the fly to concentrations of O2" radicals above the tolerance level of the fly's endogenous protective mechanisms. For the SOD null, 15 mM paraquat was sufficient to kill all the flies in 48 hr. For the other strains, the response to paraquat dosage appears to be biphasic. The number of flies which survive decreases linearly as paraquat concentration increases from 0-15 mM. The curve forms a plateau for 15-40 mM paraquat. One possible explaination for the existence of the plateau may be a saturation of the system which generates O2" from paraquat. That is, feeding the flies paraquat concentrations greater than 15 mM does not produce any additional O2" in vivo. Also, it is not known why the plateau is lower in the D/(3L)lxd9/TM3SfeSer and transformed lines compared to wt. The SOD 'null' mutant with only 3.5% of the wt level of SOD protein is clearly hypersensitive to P q 2 + exposure due to its decreased capacity to dismutate O2" (Graf and Ayala, 1986). The LD50 values were 2 mM for the SOD 'null' mutant and 10 mM for wt isogenic Oregon R flies (figure 30). The 138 Figure 30. Sensitivity to paraquat toxicity of the transformed and control strains-percent survivors after 48 hr exposure. (a) The SOD null was hypersensitive to paraquat and the D/(3L)lxd 9/TM3SbSer had the same sensitivity compared to wt. (b) The transformed lines Sod+-l,2 have lower resistance to paraquat at all concentrations measured compared to wt. (c) The resistance to paraquat of transformed lines Sod+ -4,5 also have lower resistance to paraquat than wt. 1 39 0 5 10 15 20 25 30 35 40 paraquat mM •a wt • « — Sod+1 -* Sod+2 0 5 10 15 20 25 30 35 40 paraquat mM 140 D/(3L)lxd 9/TM3SoSer strain has 50% of the wt SOD protein but showed a P q 2 + sensitivity comparable to that of wt (figure 30). This result suggests that 50% of the wt SOD activity provides sufficient protection against O2" cytotoxicity. The transformed lines overexpressing SOD showed no increased resistance to paraquat. In fact, their LD50 values ranged from 4 to 6 mM, which is slightly lower than wt (figure 30). In comparing the paraquat resistance of the transformed lines to each other, it appears that the Sod+-4 line has the greatest resistance to paraquat (figure 31). Therefore, increased SOD activity in Drosophila did not confer greater resistance to paraquat-generated superoxide radicals. On the contrary, in the transformants, increased activity resulted in an increased sensitivity to paraquat. It may be argued that with elevated levels of SOD activity, the O2" generated by Pq 2 + would be dismutated to H2O2 as well as other active forms of oxygen (*OH, *02), which may be more toxic than O2". In cultured mammalian cells, clones that overproduced SOD showed increased lipid peroxidation when exposed to paraquat (Elroy-Stein et al., 1986). Also, lipid peroxidation in biological systems have been implicated in various pathological conditions (Yagi, 1982). Thus, elevated levels of SOD activity alone are not necessarily advantageous. Although increased SOD activity is not essential, a threshold concentration of this enzyme must be present to overcome paraquat toxicity. The SOD 'null' mutant with 3.5% of the wt SOD activity was clearly hypersensitive to paraquat-generated O2". This partial SOD 'null' had a LD50 value of 2 mM for exposure to paraquat, while the mutant c50D n l^8 ( 141 Figure 31. Comparison of paraquat sensitivity between the transformed lines-percent survivors after 48 hr exposure. The resistance to paraquat of the transformed lines were compared to each other. The Sod + -4 line appear to have the highest resistance to paraquat when compared to (a) Sod+-3 (b) Sod+-5 (c) Sod+-l,2. 142 100 Sod+3 Sod+4 l—'—i—1—i—«—r 20 25 30 35 40 paraquat mM Sod+1 Sod+2 Sod+4 paraquat mM 100 Sod+4 Sod+5 paraquat 143 which is apparently devoid of SOD activity had a much lower value of 0.05 mM (Phillips et al., 1989). In contrast, the heterozygous SOD deficiency D / ( 3 L ) l x d 9 / T M 3 S o 5 e r with 50% of the wt SOD activity was not hypersensitive to O2" generated by paraquat. This result suggests that 50% of the wt SOD activity provides sufficient protection against O2" cytotoxicity. Catalase also plays an important role in cellular defense against oxygen toxicity by removing the H 2 O 2 formed by SOD. Parallel to the findings with SOD, a mutant, Caf n 2 , with only 5% of the wt catalase activity exhibited a two-fold increase in resistance to H 2 O 2 when compared to the C a f n l mutant that has no detectable catalase activity (MacKay and Bewley, 1989). Also, a 50% reduction in catalase activity had little or no effect on H 2 O 2 sensitivity (MacKay and Bewley, 1989). Thus, mutants lacking SOD or catalase activity are dramatically impaired in oxygen metabolism, those with a few percent of the wt activities are provided with significant protection against O2" and H2O2 toxicity, while those with 50% of the wt levels are as resistant as wt. G. Concluding remarks In this study, the CuZn SOD gene from D. melanogaster was cloned and analyzed. Transformed lines were successfully created with additional copies of the SOD gene whose expression results in increased SOD activity. Since the transformants have the same genetic background as the wt controls, it was now possible to compare unequivocally the effect of increased SOD activity on oxygen metabolism and longevity in D r o s o p h i l a . We found that increased SOD levels have little effect on resistance to 144 paraquat-generated O 2 " and lifespan and that very low levels of SOD activity are sufficient to provide significant protection against O 2 " cytotoxicity. Our findings do not contradict the free radical theory of aging. Despite the observation that the SOD activity found in a wide range of animals correlates directly with their longevity (Tolmasoff et al., 1980), D r o s o p h i l a appears to be well protected against the toxic effects of oxygen by its native levels of SOD and catalase. Another important protective enzyme not considered in this study is mitochondrial Mn SOD. In eukaryotes, most of the oxygen is metabolized within the mitochondrion. Aging may be the result of accumulated peroxidative damage to mitochondria, resulting in decreased ATP production (Miquel, 1988). Since Mn SOD activity represents only 10% of the total SOD activity in Drosophila (Massie et al., 1980), it is possible that Mn SOD rather than CuZn SOD levels are the limiting factor in the aging process. Therefore, isolation, characterization and transformation of the Mn SOD gene is the focus of our future work. 145 REFERENCES Ames, B.N.: Dietary carcinogens and anticarcinogens. Science 221 (1983) 1256-1264. Atkinson, T . and Smith, M. (1984) in "Oligonucleotide Synthesis: A Practical Approach", M.J. Gait, ed. IRL Press, Oxford, 35-81. Avraham, K.B., Schickler, M., Sapoznikov, D., Yarom, R. and Groner, Y.: Down's syndrome: Abnormal neuromuscular junction in tongue of transgenic mice with elevated levels of human Cu/Zn-superoxide dismutase. Cell 54 (1988) 823-829. Bannister, J.V and Bannister, W.H.: Isolation and characterization of superoxide dismutase, Methods Enzymol. 105 (1984) 88-93. Bartosz, G., Leyko, W. and Fried, R.: Superoxide dismutase and life span of Drosophila melanogaster. Mech. Ageing Dev. 12 (1979) 1193. Bartosz, G., Tannert, C, Fried, R. and Leyko, W.: Superoxide dismutase activity decreases during erythrocyte aging. Experienta 34 (1978) 1464. Beauchamp, C. and Fridovich, I.: Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 44 (1971) 276-287. Benton, W.D. and Davis, R.W.: Screening Xgt recombinant clones by hybridization to single plaques in situ. Science 196 (1977) 180-182. Bewley, G.C.: cDNA and deduced amino acid sequence of murine Cu-Zn superoxide dismutase. Nucleic Acids Res., 16 (1988) 2728. Birmingham-McDonogh, O., Gralla, E.B. and Valentine, J.S.: The copper, zinc-superoxide dismutase gene of Saccharomyces cerevisiae: Cloning, sequencing, and biological activity. Proc. Natl. Acad. Sci. USA 85 (1988) 4789-4793. Birnboim, H.C. and Doly, J.: A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7 (1979) 1513-1523. Bradford, M.M.: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72 (1976) 248-254. Breathnach, R. and Chambon, P.: Organization and expression of euckaryotic split genes coding for proteins. Ann. Rev. Biochem. 50 (1981) 349-383. Breathnach, R., Benoist, C, O'Hare, K., Gannon, F. and Chambon, P.: Ovalbumin gene: Evidence for a leader sequence in mRNA and DNA 146 sequences at the exon-intron boundaries. Proc. Natl. Acad. Sci. USA 75 (1978) 4853-4857. Campbell, S.D., Hilliker, A.J. and Phillips, J.P.: Cytogenetic analysis of the cSOD microregion in Drosophila melanogaster. Genetics 112 (1986) 205-215. Carlioz, A. and Touati, D.: Isolation of superoxide dismutase mutants in Escherichia coli: is superoxide dismutase necessary for aerobic life?. EMBO J. 5 (1986) 623-630. Cavener, D.R.: Comparision of the consensus sequence flanking translational start sites in Drosophila and vertebrates. Nucleic Acids Res. 15 (1987) 1353-1361. Chen, E.Y. and Seeburg, P.H.: Supercoil sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4 (1985) 165-170. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J.: Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18 (1979) 5294-5299. Cleveland, D.W. and Sullivan, K.F.: Molecular biology and genetics of tubulin, Ann. Rev. Biochem. 54 (1985) 331-365. Crapo, J.D., McCord, J.M. and Fridovich, I.: Preparation and assay of superoxide dismutases. Methods Enzymol. 53 (1978) 382-393. Cutler, R.G.: Antioxidants and longevity of mammalian species. Basic Life Sciences 35 (1985) 15-73. Cutler, R.G.: Antioxidants, aging, and longevity, in Free Radicals in Biology Vol. VI, Pryor, W.A. (Ed.), 1984, Academic Press, New York, 371-428. Danciger, E., Dafni, N., Bernstein, Y., Laver-Rudich, Z., Neer, A. and Groner, Y.: Human Cu/Zn superoxide dismutase gene family: Molecular structure and characterization of four Cu/Zn superoxide dismutase-related pseudogenes. Proc. Natl. Acad. Sci. USA 83 (1986) 3619-3623. Delabar, J-M., Nicole, A., D'Auriol, L., Jacob, Y., Meunier-Rotival, M., Galibert, F., Sinet, P-M. and Jerome, H.: Cloning and sequencing of a rat CuZn superoxide dismutase cDNA. Correlation between CuZn superoxide dismutase mRNA level and enzyme activity. Eur. J. Biochem. 166 (1987) 181-187. Dunn, R., McCoy, J., Simsek, M., Majumdar, A., Chang, S.H., RajBhandary, U.L. and Khorana, H.G.: The bacteriorhodopson gene. Proc. Natl. Acad. Sci. USA, 78 (1981) 6744-6748. Dynan, W.S.: Promoters for housekeeping genes. Trends Genetics 2 (1986) 196-197. 147 Elroy-Stein, O. and Groner, Y.: Impaired neurotransmitter uptake in PC12 cells overexpressing human Cu/Zn-superoxide dismutase-implication for gene dosage effects in Down syndrome. Cell 52 (1988) 259-267. Elroy-Stein, O., Bernstein, Y. and Groner, Y.: Overproduction of human Cu/Zn-superoxide dismutase in transfected cells: extenuation of paraquat-mediated cytotoxicity and enhancement of lipid peroxidation. EMBO J. 5 (1986) 615-622. Ephrussi, B. and Beadle, G.W.: A technique of transplantation for Drosophila. Am. Naturalist 70 (1936) 218. Farrington, J.A., Ebert, M., Land, E.J. and Fletcher, K.: Bipyridylium quaternary salts and related compounds. V. Pulse radiolysis studies of the reaction of paraquat radical with oxygen. Implications for the mode of action of bipyridyl herbicides. Biochem. Biophys. Acta 314 (1973) 372-381. Fleming, J.E., Shibuya, R.B. and Bensch, K.G.: Lifespan, oxygen consumption and hydroxyl radical scavenging capacity of two strains of Drosophila melanogaster. Age 10 (1987) 86-89. Flohe, L. and Otting, F.: Superoxide dismutase assays, Methods Enzymol. 105 (1984) 93-105. Fridovich, I.: Oxygen toxicity in prokaryotes: The importance of superoxide dismutases, in Superoxide dismutases Vol. 1, Oberley, L.W. (Ed.), 1982a, CRC Press, Boca Raton, pp. 79-88. Fridovich, I: Measuring the activity of superoxide dismutases: an embarrassment of riches, in Superoxide Dismutase Vol. I, 1982b, CRC Press, Boca Raton, pp. 69-77. Fridovich, I: The biology of oxygen radicals. Science 201 (1978) 875-880. Fyrberg, E.A., Kindle, K.L., Davidson, N. and Sodja, A.: The actin genes of Drosophila: a dispersed multigene family. Cell 19 (1980) 365-378. Gall, J.G. and Pardue, M.L.: Nucleic acid hybridization in cytological preparations. Methods Enzymol. 21 (1971) 470-480. Getzoff, E.D., Tainer, J.A., Stempien, M.M., Bell, G.I. and Hallewell, R.A.: Evolution of CuZn superoxide dismutase and the greek key P-barrel structural motif. Proteins 5 (1989) 322-336. Goldberg, D.A., Posakony, J.W. and Maniatis, T.: Correct developmental expression of a cloned alcohol dehydrogenase gene transduced into the Drosophila germ line. Cell 34 (1983) 59-73. Graf, J.-D. and Ayala, F.J.: Genetic variation for superoxide dismutase level in Drosophila melanogaster. Biochem. Genet. 24 (1986) 153-168. 148 Grantham, R., Gautier, C. and Gouy, M.: Codon frequencies in 119 individual genes confirm consistent choices of degenerate bases according to genome type. Nucleic Acids Res., 8 (1980) 1893-1912. Guo, L-H. and Wu, R.: Exonuclease III: Use for DNA sequence analysis and in specific deletions of nucleotides. Methods Enzymol. 100 (1983) 60-96. Hallewell, R.A., Masiarz, F.R., Najarian, R.C., Puma, J.P., Quiroga, M.R., Randolph, A., Sanchez-Pescador, R., Scandella, C.J., Smith, B., Steimer, K.S. and Mullenbach, G.T.: Human Cu/Zn superoxide dismutase cDNA: isolation of clones synthesising high levels of active or inactive enzyme from an expression library. Nucleic Acids Res. 13 (1985) 2017-2034. Harman, D. : Free radical theory of aging: effect of free radical reaction inhibitors on the mortality rate of male LAF mice. J. Gerontology 23 (1968) 476-482. Harman, D.: The aging process. Proc. Natl. Acad. Sci. USA 78 (1981) 7124-7128. Harman, D.: The free radical theory of aging, in Free Radicals in Biology Vol. V, Pryor, W.A. (Ed.), 1982, Academic Press, New York, pp. 255-275. Hass, M.A., Iqbal, J., Clerch, L.B., Frank, L. and Massaro, D.: Rat lung Cu.Zn superoxide dismutase. J. Clin. Invest 83 (1989) 1241-1246. Hassan, H.M. and Fridovich, I.: Regulation of the synthesis of superoxide dismutase in Escherichia coli. J. Biol. Chem. 252 (1977) 7667-7672. Hassan, H.M. and Fridovich, I.: Superoxide radical and the oxygen enhancement of the toxicity of paraquat in Escherichia coli. J. Biol. Chem. 253 (1978) 8143-8148. Hassan, H.M. and Fridovich, I.: Intracellular production of superoxide radical and of hydrogen peroxide by redox active compounds. Arch. Biochem. Biophys. 196 (1979) 385-395. Hawkins, J.D.: A survey on intron and exon lengths. Nucleic Acids Res., 16 (1988) 9893-9908. Hayashi, S., Gillam, I.C., Delaney, A.D. and Tener, G.M.: Acetylation of chromosome squashes of D r o s o p h i l a melanogaster decreases the background in autoradiographs from hybridization with I] -label led RNA. J. Histochem. Cytochem. 26 (1978) 677-679. Hazelrigg, T., Levis, R. and Rubin, G.M.: Transformation of white locus DNA in Drosophila: Dosage compensation, zeste interaction, and position effects. Cell 36 (1984) 469-481. Henikoff, S.: Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28 (1984) 351-359. 149 Hill, D.L.: Chemical removal of the chorion from Drosophila eggs. Drosophila Information Service 19 (1945) 62. Hjalmarsson, K., Marklund, S.L., Engstrom, A. and Edlund, T.: Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase. Proc. Natl. Acad. Sci. USA 84 (1987) 6340-6344. Ho, Y. and Crapo, J.D.: cDNA and deduced amino acid sequence of rat copper-zinc-containing superoxide dismutase. Nucleic Acids Res., 15 (1987) 6746. Jelnes, J.E.: Identification of hexokinases and localisation of a fructokinase and a tetrazolium oxidase locus in Drosophila melanogaster. Hereditas 67 (1971) 291-293. Jowett, T.: Preparation of nucleic acids in Roberts, D.B. (Ed.), Drosophila, a practical approach. IRL Press, Oxford, 1986, 275-286. Kaiser, K. and Murray, N.E.: The use of phage lambda replacement vectors in the construction of representative genomic DNA libraries. In DNA Cloning, Vol. I. Glover, D.M. (Ed.) IRL Press, Oxford, 1985. Karess, R.E. and Rubin, G.M.: Analysis of P transposable element functions in Drosophila. Cell 38 (1984) 135-146. Karess, R.E.: P element mediated germ line transformation of Drosophila. In DNA Cloning, Vol. II. Glover, D.M. (Ed.). IRL Press, Oxford, 1985. Kellogg, E.W. and Fridovich, I.: Superoxide dismutase in the rat and mouse as a function of age and longevity. J. Gerontol. 31 (1976) 405-408. Kirby, T.W. and Fridovich, I.: A picomolar spectrophotometric assay for superoxide dismutase, Anal. Biochem. 127 (1982) 435-440. Kirkland, K.C. and Phillips, J.P.: Isolation and chromosomal localization of genomic DNA sequences coding for the cytoplasmic superoxide dismutase from Drosophila melanogaster . Gene 61 (1987) 415-419. Lamb, M.J.: Biology of Ageing, Blackie, Glasgow, 1977. Lamb, M.J.: Ageing. In The Genetics and Biology of Drosophila, Vol. 2C. Ashburner, M. and Wright, T.R.F. (Eds.). Academic Press, New York, 1978, 43-104. Lammi-Keffe, C.J., Swan, P.B. and Hegarty, P.V.J.: Copper-zinc and manganese superoxide dismutase activities in cardiac and skeletal muscles during aging in male rats. Gerontology 30 (1984) 153-158. Langer, P.R., Waldrop, A.A. and Ward, D.C: Enzymatic synthesis of biotin-labelled polynucleotides: novel nucleic acid affinity probes. Proc. Natl. 150 Acad. Sci. USA 78 (1981) 6633-6637. Lathe, R.: Synthetic oligonucleotide probes deduced from amino acid sequence data: theoretical and practical considerations. J. Mol. Biol. 183 (1985) 1-12. Lee, Y.M. and Ayala, F.J.: Superoxide dismutase of Drosophila melanogaster. Mutation site difference between two electromorphs. FEBS Lett. 179 (1985) 115-119. Lee, Y.M., Ayala, F.J. and Misra, H.P.: Purification and properties of superoxide dismutase from Drosophila melanogaster. J. Biol. Chem. 256 (1981a) 8506-8509. Lee, Y.M., Friedman, D.J. and Ayala, F.J.: Complete amino acid sequence of copper-zinc superoxide dismutase from Drosophila melanogaster. Arch. Biochem. Biophys. 241 (1985a) 577-589. Lee, Y.M., Friedman, D.J. and Ayala, F.J.: Superoxide dismutase: an evolutionary puzzle. Proc. Natl. Acad. Sci. USA 82 (1985b) 824-828. Lee, Y.M., Misra, H.P. and Ayala, F.J.: Superoxide dismutase in Drosophila melanogaster : Biochemical and structural characterization of allozyme variants. Proc. Natl. Acad. Sci. USA 78 (1981b) 7052-7055. Leffelaar, D. and Grigliatti, T.: Age-dependent behavior loss in adult Drosophila melanogaster. Dev. Genet. 4 (1984a) 211-227. Leffelaar, D. and Grigliatti, T.: A mutation in Drosophila that appears to accelerate aging. Dev. Genet. 4 (1984b) 199-210. Leung, J. Concerted evolution of a cluster of X-linked tRNA^ySer Genes from Drosophila melanogaster. University of British Columbia PhD thesis, 1988. Levanon, D., Lieman-Hurwitz, J., Dafni, N., Wigderson, M., Sherman, L., Bernstein, Y., Laver-Rudich, Z., Danciger, E., Stein, O. and Groner, Y.: Architecture and anatomy of the chromosomal locus in human chromosome 21 encoding the Cu/Zn superoxide dismutase. EMBO J. 4 (1985) 77-84. Lieman-Hurwitz, J., Dafni, N., Lavie, V. and Groner, Y.: Human cytoplasmic superoxide dismutase cDNA clone: A probe for studying the molecular biology of Down syndrome. Proc. Natl. Acad. Sci. USA 79 (1982) 2808-2811. Lindsley, D. and Grell, R.: Genetic Variations of Drosophila melanogaster, Carnegie Inst., Washington, 1968. Lints, F.A. : Aim and scope of Drosophila aging research in Drosophila as a model organism for ageing studies, Lints, F.A. and Soliman, M.H. (Eds), 151 Blackie, 1988, Glasgow, 3-16. Lints, F.A. and Soliman, M.H. (Eds): Drosophila as a Model Organism for Ageing Studies, Blackie, 1988, Glasgow. MacKay, W.J. and Bewley, G.C.: The genetics of catalase in Drosophila melanogaster:: isolation and characterization of acatalasemic mutants. Genetics 122 (1989) 643-652. Mahmoudi, M. and Lin, V.K.: Comparison of two different hybridization systems in northern transfer analysis. Biotechniques 7 (1989) 331-333. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Marklund, S.: Spectrophotometric study of spontaneous disproportionation of superoxide anion radical-a sensitive direct assay of superoxide dismutase, J. Biol. Chem. 251 (1976) 7504-7507. Martin, G.H. and Castro, M.M.: Base pairing involving deoxyinosine: implications for probe design, Nucleic Acids Res. 13 (1985) 8927-8938. Masaro, E.J., Yu, B.P. and Bertrand, H.A.: Action of food restriction in delaying the aging process. Proc. Natl. Acad. Sci. USA 79 (1982) 4239-4241. Massie, H.R., Aiello, V.R. and Iodice, A.A.: Changes with age in copper and superoxide dismutase levels in brains of C57BL/6J mice. Mech. Ageing Dev. 10 (1979) 93-99. Massie, H.R., Aiello, V.R. and Williams, T.R.: Changes in superoxide dismutase activity and copper during development and ageing in the fruit fly Drosophila melanogaster. Mech. Ageing Dev. 12 (1980) 279-286. Massie, H.R., Williams, T.R. and Aiello, V.R.: Superoxide dismutase activity in two different wild-type strains of Drosophila melanogaster. Gerontology 27 (1981) 205-208. McCord, J.M. and Fridovich, I.: Superoxide dismutase-an enzymic function for erythrocuprein (hemocuprein). J. Biol. Chem. 244 (1969) 6049-6055. McCord, J.M., Crapo, J.D. and Fridovich, I.: Superoxide dismutase assays: a review of methodology, in Superoxide and superoxide dismutases, Michelson, A.M., McCord, J.M. and Fridovich, I. (Eds.), 1977, Academic Press, London, pp. 11-17. McKnight, S.L., Kingsbury, R.D., Spence, A. and Smith, M.: The distal transcription signals of the Herpesvirus tk gene share a common hexanucleotide control sequence. Cell 37 (1984) 253-262. Messing, J.: New vectors for cloning. Methods in Enzymology 101 (1983) 152 20-78. Miller, J.H.: Experiments in molecular genetics. Cold Spring Harbour Laboratory, Cold Spring Harbor, NY, 1972. Miquel, J., Economos, A.C., Beusch, K.G., Atlan, H. and Johnson, J.E.: Review of cell aging in Drosophila and mouse. Age 2 (1979) 78-88. Miquel, J., Economos, A.C., Fleming, J. and Johnson, J.E.: Exp. Gerontol. 15 (1980) 575-591. Miquel, J.: Ultrastructure and cytochemistry, in Drosophila as a model organism for ageing studies, Blackie, 1988, Glasgow, 193-200. Mount, S.M.: A catalogue of splice junction sequences. Nucleic Acids Res. 10 (1982) 459-472. Nettleton, C.J., Bull, C, Baldwin, T.O. and Fee, J.A.: Isolation of the Escherichia coli iron superoxide dismutase gene: Evidence that intracellular superoxide concentration does not regulate oxygen-dependent synthesis of the manganese superoxide dismutase. Proc. Natl. Acad. Sci. USA 81 (1984) 4970-4973. Newton, C.H.: Transfer RNA genes in D. melanogaster. University of British Columbia MSc. thesis, 1984. Nickla, H., Anderson, J. and Palzkill, T.: Enzymes involved in oxygen detoxification during development of Drosophila melanogaster. Experientia 39 (1983) 610-612. O'Connell, P. and Rosbash, M.: Sequence, structure, and codon preference of the Drosophila ribosomal protein 49 gene. Nucleic Acids Res. 12 (1984) 5495-5514. O'Hare, K. and Rubin, G.M.: Structures of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34 (1983) 25-35. Oberley, L.W.: Superoxide dismutase and cancer, in Superoxide dismutase Vol. II, Oberley, L.W. (Ed.), 1982, CRC Press, Boca Raton, pp.127-165. Paynter, D.I. and Caple, I.W.: Age-related changes in activities of the superoxide dismutase enzymes in tissue of the sheep and the effect of dietary copper and manganese on these changes. J. Nutrition 114 (1984) 1090-1916. Peng, T., Moya, A. and Ayala, F.J.: Irradiation-resistance conferred by superoxide dismutase: Possible adaptive role of a natural polymorphism in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 83 (1986) 684-687. 153 Phillips, J.P., Campbell, S.D., Michaud, D., Charbonneau, M. and Hilliker, A.J.: Null mutation of copper/zinc superoxide dismutase in Drosophila confers hypersensitivity to paraquat and reduced longevity. Proc. Natl. Acad. Sci. USA 86 (1989) 2761-2765. Poole, S.J., Kauvar, L.M., Drees, B. and Kornberg, T.: The engrailed locus of Drosophila: structural analysis of an embryonic transcript. Cell 40 (1985) 37-43. Putney, S.D., Benkovic, S.J. and Schimmcl, P.R.: A DNA fragment with an a-phosphorothioate nucleotide at one end is asymmetrically blocked from digestion by exonuclease 111 and can be replicated in vivo . Proc. Natl. Acad. Sci. USA 78 (1981) 7350-7354. Reiss, U. and Gershon, D.: Comparison of cytoplasmic superoxide dismutase in liver, heart and brain of aging rats and mice. Biochem. Biophys. Res. Commun. 73 (1976a) 255-262. Reiss, U. and Gershon, D.: Rat-liver superoxide dismutase. Eur. J. Biochem. 63 (1976b) 617-623. Rigby, P.W.S., Diekman M., Rhodes, C. and Berg, P.: Labelling deoxyribonucleic acids to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 113 (1977) 237-251. Ross, M.H.: Dietary behavior and longevity. Nutritional Reviews 35 (1977) 257-265. Rubin, G.M. and Spradling, A.C: Genetic transformation of Drosophila with transposable element vectors. Science 218 (1982) 348-353. Rubin, G.M. et al.: The Rubin Laboratory Manual: "Procedures for the molecular biology of Drosophila", available from the Rubin laboratory, 1986. Sakamoto, H. and Touati, D.: Cloning of the iron superoxide dismutase gene (sodB) in Escherichia coli K-12. J. Bacteriol. 159 (1984) 418-420. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74 (1977) 5463-5466. Schickler, M., Knobler, H., Avaraham, K.B., Elroy-Stein, O. and Groner, Y.: Diminished serotonin uptake in platelets of transgenic mice with increased Cu/Zn-superoxide dismutase activity. EMBO J. 8 (1989) 1385-1392. Scholnick, S.B., Morgan, B.A. and Hirsh, J.: The cloned dopa decarboxylase gene is developmentally regulated when reintegrated into the Drosophila genome. Cell 34 (1983) 37-45. Schott, D.R., Baldwin, M.C. and Finnerty, V.: Molybdenum hydroxylases in Drosophila. III. Further characterization of the low xanthine 154 dehydrogenase gene. Biochem. Genet. 24 (1986) 509-527. Seto, N.O.L. : The copper-zinc dismutase gene from Drosophila melanogaster : attempts to clone the gene using two mixed sequence oligonucleotide probes (1987) M.Sc. thesis, University of British Columbia. Seto, N.O.L., Hayashi, S. and Tcncr, G.M.: Cloning, sequence analysis and chromosomal localization of the Cu-Zn superoxide dismutase gene of Drosophila melanogaster . Gene 75 (1989) 85-92. Seto, N.O.L., Hayashi, S. and Tencr, G.M.: Drosophila Cu-Zn superoxide dismutase cDNA sequence. Nucleic Acids Res. 15 (1987a) 5483. Seto, N.O.L., Hayashi, S. and Tener, G.M.: The sequence of the Cu-Zn superoxide dismutase gene of Drosophila. Nucleic Acids Res. 15 (1987b) 10601. Sherman, L., Dafni, N., Lieman-Hurwitz, J. and Groner, Y.: Nucleotide sequence and expression of human chromosome 21-encoded superoxide dismutase mRNA. Proc. Natl. Acad. Sci. USA 80 (1983) 5465-5469. Sherman, L., Levanon, D., Lieman-Hurwitz, J., Dafni, N. and Groner, Y.: Human Cu/Zn superoxide dismutase gene: molecular characterization of its two mRNA species. Nucleic Acids Res. 12 (1984) 9349-9365. Shock, N.W.: Biological theories of aging, in CRC Handbook of Biochemistry in Aging, Florini, J.R. (Ed.), CRC Press Inc., Boca Raton, 1981. Smith, M.: In vitro mutagenesis. Ann. Rev. Genetics 19 (1985) 423-463. Southern, E.M.: Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98 (1975) 503-517. Spradling, A.C. and Rubin, G.M.: The effect of chromosomal position on the expression of the Drosophila xanthine dehydrogenase gene. Cell 34 (1983) 47-57. Spradling, A.C. and Rubin, G.M.: The transposition of cloned P elements into Drosophila germ line chromosomes. Science 218 (1982) 341-347. Steinman, H.M.: Bacteriocuprein superoxide dismutase of Photobacterium leiognathi. Isolation and sequence of the gene and evidence for a precursor form. J. Biol. Chem. 262 (1987) 1882-1887. Steinman, H.M.: Superoxide dismutases: protein chemistry and structure-function relationships, in Superoxide dismutase Vol. I, Oberley, L.W. (Ed.), 1982, CRC Press, Boca Raton, pp. 11-68. Steller, H. and Pirrolla, V.: A transposable P vector that confers selectable G418 resistance to Drosophila larvae. EMBO J. 4 (1985) 167-171. 155 Tabor, S. and Richardson, C C : DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84 (1987) 4767-4771. Tibell, L., Hjalmarsson, K., Edlund, T., Skogman, G., Engstrom, A. and Marklund, S.L.: Expression of human extracellular superoxide dismutase in Chinese hamster ovary cells and characterization of the product. Proc. Natl. Acad. Sci. USA 84 (1987) 6634-6638. Tolmasoff, J.M., Ono, T. and Cutler, R.G.: Superoxide dismutase: correlation with life-span and specific metabolic rate in primate species. Proc. Natl. Acad. Sci. USA 77 (1980) 2777-2781. vanLoon, A.P.G.M., Pesold-Hurt, B. and Schatz, G.: A yeast mutant lacking mitochondrial manganese-superoxidc dismutase is hypersensitive to oxygen. Proc. Natl. Acad. Sci. USA 83 (1986) 3820-3824. Warner, H.R., Butler, R.N., Sprotl, R.L. and Schneider, E.L. (Eds.): Modem biological theories of aging. Raven Press, New York, 1987. Watson, J.D., Hopkins, N.H., Roberts, J.W., Steitz, J.A. and Weiner, A.M.: Molecular Biology of the Gene, Benjamin/Cummings Publishing Co., Menlo Park, 1987. Weisiger, R.A. and Fridovich. I.: Superoxide dismutase-organelle specificity. J. Biol. Chem. 248 (1973) 3582-3592. Yagi, K. (Ed.): Lipid peroxides in biology and medicine. Academic Press, New York, 1982. Yamamoto, K.R. and Alberts, B.M. Rapid bacteriophage sedimentation in the presence of polyethylene glycol and its application to large scale virus purfication. Virology 40 (1970) 734-744. Yanisch-Perron, C, Vieira, J. and Messing, J.: Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33 (1985) 103-119. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0100395/manifest

Comment

Related Items