Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cloning and expression of the Drosophila melanogaster CuZn superoxide dismutase gene Seto, Nina O. L. 1990

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


831-UBC_1990_A1 S47.pdf [ 7.75MB ]
JSON: 831-1.0100395.json
JSON-LD: 831-1.0100395-ld.json
RDF/XML (Pretty): 831-1.0100395-rdf.xml
RDF/JSON: 831-1.0100395-rdf.json
Turtle: 831-1.0100395-turtle.txt
N-Triples: 831-1.0100395-rdf-ntriples.txt
Original Record: 831-1.0100395-source.json
Full Text

Full Text

Cloning and Expression of the Drosophila melanogaster CuZn Superoxide Dismutase Gene by  Nina O.L. Seto B.Sc. University of Toronto, 1984 M.Sc. University of British Columbia, 1987  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES DEPARTMENT OF BIOCHEMISTRY UNIVERSITY OF BRITISH COLUMBIA We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA November, 1989 © Nina O.L. Seto, 1989  In  presenting  this  thesis  degree at the University  in partial  and study. 1 further agree that  of this thesis for scholarly  department publication  or by  his or her representatives.  permission.  t  BIOCHEMISTRY  The University of British Columbia Vancouver, Canada  Date  DE-6 (2788)  purposes may  of this thesis for financial gain  , Department of  JANUARY  29, 1990  for an advanced  of British Columbia, I agree that the Library shall make it  freely available for reference copying  fulfilment of the requirements  permission for extensive  be granted  by the head  It is understood  that  of my  copying  shall not be allowed without my  or  written  11  ABSTRACT Aging  and disease  irreversible  processes  changes produced  copper-zinc  superoxide  may be due to deleterious and  by free  dismutase  radical  (CuZn  reactions.  The enzyme  SOD; superoxide:  superoxide  oxidoreductase, E C performs a protective function by scavenging superoxide radicals.  In order to determine whether additional SOD activity  affects longevity and oxygen metabolism in Drosophila,  our approach was  to clone the Sod gene and introduce additional copies of the gene back into the  genome  via P element mediated transformation.  increased SOD activity on Drosophila metabolism The  The effects of  life span and oxygen free radical  were investigated. CuZn  melanogaster.  SOD cDNA  and gene were  The sequence of the Sod  cloned  cDNA  from  Drosophila  and gene revealed an  additional C-terminal triplet coding for valine not found in the mature SOD protein. identity  The nucleotide sequence of the coding region has 5 6 % and 5 7 % when compared  respectively.  to the corresponding  human and rat Sod genes,  A probe of the cloned gene hybridizes to position 68A4-9 on  Drosophila polytene chromosomes.  In wild-type Drosophila the Sod cDNA  hybridizes to a 0.7-0.8 kb transcript which is greatly diminished in a SOD 'null' mutant that produces only 3.5% of the SOD protein. A  1.8 kb EcoRI gene fragment containing the Sod gene was cloned  into the P vector pUChsneo  and microinjected into Drosophila  embryos.  Five transformed lines, each of which contain an additional copy of the Sod gene at different chromosomal sites were constructed. positions  of the transposed  Sod  sequence were  hybridization of the Sod gene to salivary  gland  The chromosomal  determined polytene  by in situ chromosomes.  iii Analysis of RNA from  the transformed  Sod gene was expressed. lines  flies revealed that the transposed  The range of SOD activity for the five transformed  was 131% to 170% of the value of wild-type.  There  was good  correlation between the amount of Sod mRNA and the level of SOD activity in the transformed  lines.  Increased SOD levels in the transformed lines did not confer greater resistance lifespan.  to paraquat-generated  superoxide  radicals,  nor increase their  The SOD 'null' mutant with 3.5% of the wild-type SOD activity was  hypersensitive heterozygous  to paraquat  when  compared  to wild-type, whereas the  SOD deficiency Df(3L)\xd /TM3SbSer 9  type SOD activity was not. in oxygen metabolism  with 50% of the wild-  Mutants lacking SOD are dramatically impaired  and a few percent of wild-type activity appears to  provide significant protection against superoxide, while 5 0 % of the wildtype levels confers essentially the same resistance as wild-type.  Despite  the observation that the SOD activities found in a wide range of animals correlates directly with their longevity, Drosophila melanogaster  appears  to be well protected against the toxic effects of oxygen by its native levels of SOD.  1 V  Table  of Contents PAGE  Abstract Table of Contents List of Tables List of Figures Acknowledgements Dedication List of Abbreviations I. Introduction A. Theories of aging B. The free radical theory of aging C. Superoxide dismutase as a longevity determinant D. Drosophila as a model organism for aging studies E. Superoxide dismutase and oxygen toxicity F. Assays for superoxide dismutase activity G. Superoxide dismutase in prokaryotes H. Superoxide dismutase in D. melanogaster I. Superoxide dismutase genes J. Aims and scope of this study 1. Isolation and characterization of the Drosophila cDNA and gene 2. P element transformation of the D. melanogaster CuZn SOD gene 3. Effects of increased Sod expression on oxygen radical metabolism and lifespan II. Materials and Methods A. Materials B. Bacterial strains, media, vectors, buffers and Drosophila stocks C. Isolation of D. melanogaster DNA D. Bacteriophage lambda DNA preparation E. Isolation of D. melanogaster RNA 1. Isolation of total D. melanogaster RNA 2. Isolation of poly(A)+ RNA F. Gel Electrophoresis 1. Neutral agarose gels 2. Formaldehyde agarose gels 3. Denaturing polyacrylamide (DNA sequencing) gels G. Gel hybridization analysis 1. Southern blot analysis of genomic and cloned DNA 2. Northern blot analysis H. Purification of oligonucleotide probes I. Labelling DNA probes 1. Nick-translation of DNA 2. End-labelling with polynucleotide kinase J. Screening lambda libraries 1. Screening a D. melanogaster cDNA library in XgtlO 2. Screening a D. melanogaster genomic library K. DNA subcloning  ii iv vii viii x xi xii 1. 1 1 2 4 5 6 7 8 10 13 13 15 17 18 19 20 21 22 22 23 24 24 24 24 25 25 26 26 27 27 28 29 29 31 31  V  1. 2. 3.  III.  Ligation of DNA into vectors Transformation of bacteria with DNA Growth of transformants (a) Small scale plasmid preparation (b) Large scale plasmid preparation 4. Deletion subclones for sequence analysis L. DNA sequence determination by the Sanger method 1. DNA template preparation (a) Single-stranded DNA templates (b) Double-stranded DNA templates 2. Use of Klenow polymerase 3. Use of modified T7 DNA polymerase (Sequenase™) * 4. Orientation of M13 clones (a) Hybridization with oligonucleotide probes (b) T-track analysis M. P-element transformation of Drosophila by microinjection 1. Preparing the P-element transformation vectors 2. Preparing the Drosophila for egg lays and collecting staged embryos 3. Pulling and filling microinjection needles 4. Microinjection of Drosophila embryos 5. Culturing the injected GO adults 6. Creating transformed Drosophila lines 7. Creating lines homozygous for the inserted gene N. Gene localization by in situ hybridization 1. Labelling an RNA transcript with Iodine-125 2. Labelling the DNA probe with biotin 3. In situ hybridization (a) Preparation of the chromosome squashes (b) Preparation of the slides for hybridization (c) Hybridization and signal detection O. Expression of the transposed gene 1. SOD activity assays 2. Bradford protein assays 3. Northern blot analysis of transcripts P. Drosophila melanogaster longevity studies68 1. The aging curves 2. The genetic crosses Q. Assay of paraquat toxicity  31 32 32 32 33 34 38 38 38 39 39 40 41 41 42 42 42 43  Results and Discussion A. Characterization of the D. melanogaster CuZn SOD cDNA 1. Isolation of the CuZn SOD cDNA using mixed oligonucleotide probes (a) Oligonucleotide probe design (b) Screening a D. melanogaster cDNA library 2. Nucleotide sequence analysis of CuZn SOD cDNA 3. Predicted amino acid sequence of the CuZn SOD protein 4. The SOD gene transcript B. The D. melanogaster CuZn SOD gene 1. Isolation and characterization of CuZn SOD genomic clones 2. Restriction enzyme analysis of the CuZn SOD  73 73  44 45 47 50 50 55 55 62 63 63 64 64 66 66 67 68 68 69 69  73 73 73 75 75 82 85 85 86  v1  C.  D. E.  F. G.  genomic clone 3. Subcloning strategy for the CuZn SOD gene 4. Nucleotide sequence of the CuZn SOD gene 5. Analysis of the CuZn SOD gene sequence 6. Cytogenetic localization of the CuZn Sod gene P element mediated transformation of the CuZn SOD gene 1. Construction of the P element vectors 2. P element mediated transformation 3. Establishment of transformed lines 4. Chromosomal localization of the transposed Sod gene 5. Southern analysis of transformed lines Expression of additional CuZn SOD genes 1. Quantification of the SOD transcript in transformed lines 2. SOD-specific activity of transformed lines Longevity studies 1. The longevity of wildtype isogenic Oregon R 2. The longevity of a SOD 'null' mutant 3. The longevity of the transformed lines Sensitivity to paraquat toxicity Concluding remarks  IV. Literature  cited  89 92 95 106 106 106 109 112 114 114 118 118 121 125 125 126 131 131 143 145  vi 1 LIST OF T A B L E S  PAGE  I.  Codon usage for the CuZn Sod gene  103  II.  Results of the P element mediated transformation experiments  111  III.  Analysis of P element transformation data  113  IV.  Chromosomal localization of the inserted SOD gene  115  V.  SOD-specific activity and control strains  122  VI.  Summary  and transcripts in transformed  of longevity data  136  vi 1 1 LIST OF FIGURES PAGE 1.  Generating  2.  The Drosophila life cycle  49  3.  Culturing the injected GO adults  52  4.  Propagating  54  5.  Creating homozygous transformed lines for a transposon inserted in the second chromosome  6.  deletion  subclones for sequence analysis  the transformed  Creating homozygous  36  lines  transformed  57  lines for a transposon  inserted in the third chromosome  60  7.  The Drosophila hybrids used in the longevity studies  71  8.  Oligonucleotide probe design  74  9.  Southern analysis of CuZn SOD cDNA clones  77  10. Strategy for determining the CuZn SOD cDNA sequence  79  11. The D. melanogaster CuZn SOD cDNA sequence  81  12. Northern blot analysis of wt and "null" mutant Sod transcripts  84  13. Southern analysis of a genomic CuZn SOD clone from a X.EMBL3 DNA library  88  14. Subcloning strategy for the CuZn SOD gene  91  15. The strategy for determining the sequence of the CuZn SOD gene  94  16. Nucleotide sequence of the Drosophila CuZn SOD gene  99  17. Comparison of the transcriptional control sites in the herpesvirus fit and Drosophila CuZn SOD gene 18. Comparison of the nucleotide sequences of the coding region for Drosophila, rat, and human CuZn SOD genes  105  19. Chromosomal localization of the Drosophila Sod gene  107  20. The pneoSOD transposon  108  21. Chromosomal localization of the transposed Drosophila  Sod gene  100  117  ix 22. Southern analysis of transposed Sod  DNA  23. Northern analysis of endogenous and introduced  120 Sod  genes  124  24. Lifespan of wt isogenic Oregon R measured at 29°C  128  25. Lifespan of a SOD  130  null mutant measured at 29°C  26. Lifespan of males from Sod transformed lines at 29°C  132  27. Lifespan of females from Sod transformed lines at 29°C  133  28. Lifespan of males from Sod transformed lines at 25°C  134  29. Lifespan of females from Sod transformed lines at 25°C  135  30. Sensitivity to paraquat toxicity of the transformed and control strains-percent survivors after 48 hr exposure  130  31. Comparison of paraquat sensitivity between the transformed linespercent survivors after 48 hr exposure  142  X  ACKNOWLEDGEMENTS First and foremost, I wish to thank Gordon Tener for his patience, wisdom and generosity. 1 especially thank you for giving me the courage to continue with this work after the initial frustrating years. My sincere thanks go to Shizu Hayashi for being with this project since the beginning, her hard work, for reading this thesis and for teaching me so much. I thank Don Sinclair, whose constant interest and involvement with my work has been an important source of support. I thank all those who have been in our lab past and present. My appreciation goes to the following individuals outside of our lab: Tom Grigliatti, for giving me a bench in the genetics lab and providing all the fly food required to complete this work; all the members of the fly lab for their help and tolerance; Vett Lloyd, for enduring the frustration of setting up the transformation experiments, for the stamina to inject thousands of embryos with me in the cold humid room and for sharing the joy at obtaining our first transformanl; Peter Vaughan for pulling all my microinjection needles; Hugh Brock and members of his lab for helpful discussions throughout this work; and Carol Astell for helpful discussions of many sorts. I thank Ian Gillam for his kindness and generosity over the years and for his discourses-all in an attempt to educate me. Perhaps I will think "Et in Arcadia Ego". Finally, my deepest appreciation goes to my friends, to Stephen, and to my family, especially Michael and Carol, for their constant love and support.  xi  For my family and for Dr. Brenda B. Shapiro  X1 1  LIST OF ABBREVIATIONS A  adenosine  or  2'-deoxyadcnosinc  aa  amino  ATP  adenosine  A26O  absorbance  b p  base  BSA  bovine  C  cytidine  cDNA  D N A complementary to R N A  cpm  counts  dNTP  deoxynucleoside  ddNTP  dideoxynucleoside  DEAE  diethylaminoelhyl  DNA  deoxyribonucleic  DNase  deoxy ribonucleasc  ds  double-stranded  DEPC  diethyl  EOT  dithiothreitol  EDTA  ethylenediaminetetraacctic  EtBr  elhidium  G  guanosine  h r  hour(s)  5-IdCTP  5-iododeoxycylidinc  acid(s) triphosphate at 260  nm  pairs serum or  per  albumin  2'-dcoxycylidinc  minule triphosphate triphosphate  acid  pyrocarbonalc  acid  bromide or  2'-deoxyguanosine  triphosphate  I  inosine  IPTG  i sop ropy l - p - D - t h i o g a l a c i o p y ran 0 side  X111  kb  kilobase  (pairs)  LB  Luria  m A  milliamperes  m in  minute(s)  m M  millimolar  MOPS  3-[N-Morpholino]propanesulfonic  mRNA  messenger  RNA  MW  molecular  weight  N  any nucleotide(G, A, T or C)  NTP  ribonucleoside  nt  nucleotide(s)  PEG  polyethylene  pfu  plaque  RF  replicative  form  RNA  ribonucleic  acid  RNase  ribonuclease  SDS  sodium dodecyl sulfate  SOD  superoxide  broth  acid  triphosphate  glycol  forming  units  dismutase  SODP^OD fast and slow electromorphs, resp., of SOD 8  Sod ss  gene coding for SOD single-stranded  SSC  standard saline citrate (0.15 M sodium citrate. pH 7)  T  thymidine  TBE  Tris-borate-EDTA  TE8  10 mM  NaCl, 0.015  or thymidylic acid electrophoresis  Tris-HCl (pH 8.0), 1 mM  buffer  EDTA  M  X1 V  TEMED  N.N.N'.N'-lelramethylcthylenediamine  Tris  Tr i s (h y d ro x y m e t h y 1) a m i n o m ethane  tRNA  transfer RNA  U  uridine or uridylic acid  uCi  microcurie  l^g  micrograms  uV  ultraviolet  V  volts  wt  wild type  X-Gal  5-bromo-4-chloro-3-indolyl-p-D-galactopyranoside  1  INTRODUCTION A.  Theories Aging  the  of  and  aging  death are universal phenomena.  progressive  accumulation  susceptibility to death. of the aging process  of  changes  al., 1987). aging  associated  be defined as  with  increasing  Despite the universality of aging, the mechanism is basically unknown.  aging theories have been proposed. into genetic and  Aging may  Therefore, a multiplicity of  These theories may  non-genetic theories (Shock, 1981;  It is probable that no  one  be broadly divided  Lamb, 1977;  theory will adequately  Warner et explain all  processes. Genetic or non-stochastic theories of aging propose that the series of  aging  processes  organism.  are  innately programmed  within  the  genome  Non-genetic  theories of  are therefore programmed events.  aging  propose  that  stochastic events  responsible for the changes that occur during senescence. organism  ages, damage  to  structural  attributed to daily "wear and tear". prominent The  stocastic free  The  free  (Harman, 1968; responsible age. radical  each  These theories postulate that aging and death are a normal part  of the process of development and  B.  of  and  The  theory  radical  theory  1981;  components  may  be  free radical theory of aging is a  1982)  of  aging  of aging and  was  processes Free  are  radicals  originally  proposed  in  1955  postulates that free radical reactions are  for the progressive accumulation  reactions.  That is, as the  theory.  radical  Thus, aging  cellular  are  the  result  produced  of changes that occur  with  of random, deleterious free as  transient  intermediates in  2  normal  cellular  metabolism  contribute to the observed processing radicals Lipid  of oxygen  attack  lipids  peroxidation  pathological metabolism oxygen  may  cellular  is the main in cell  conditions  damage. source  stable molecules and  In aerobic  of free radicals. resulting  in lipid  1982).  Whether  the rate  is unknown, but the toxicity  has been  organisms, the Superoxide peroxidation.  systems have been implicated in various  (Yagi,  affects aging  otherwise  membranes  in biological  metabolism  attack  demonstrated  of oxygen  of by-products of  (Fridovich, 1978; Fridovich,  1982a). Antioxidants  found naturally within cells represent  of longevity determinants.  a potential class  In order for an antioxidant to be a potential  determinant of longevity, there should  exist a positive correlation between  the antioxidant levels and the lifespan potential (LSP).  Limited food intake  as well as dietary antioxidants which decrease free radical reactions have been shown to increase lifespan (Masoro et al., 1982; Ross, 1977). free  radical  reactions  do play  a role  in accumulated  damage and lifespan, then longer-lived species should  Thus, if  time-dependent  have more effective  mechanisms against free radicals than shorter-lived species.  C.  Superoxide The  rodent  dismutase  concentration species  have  as  a  longevity  determinant  of potential longevity determinants in primate and been  correlated  particular, antioxidant compounds  to their  and enzymes  lifespan which  potential.  play  an  In  important  role in cellular defenses against oxygen toxicity were tested (Cutler, 1984; 1985).  In various organisms, there is a direct correlation between lifespan  3  potential and the ratio of SOD levels to specific metabolic rates (Tolmasoff et al., 1980). level  For each species there exists a direct relationship between the  of SOD in the tissue  superoxide produced species.  That  and lifespan  potential, since the ratio of  per amount of oxygen consumed is constant for each  is, the total amount of oxygen that a tissue uses over a  lifespan is directly proportional to the amount of SOD protection that tissue has against the toxic by-products correlations  of oxygen metabolism.  In contrast, the  are poorer, non-existent or negative for catalase, glutathione  peroxidase, glutathione and ceruloplasmin. In  an attempt  organism  decreases  concentration species.  to determine as  a  whether  function  antioxidant efficiency  of age, superoxide  as a function of age has been  determined  The results are varied (Bartosz, et al., 1978;  of  an  dismutase for  various  Paynter and Caple,  1984; Reiss and Gershon, 1976a,b; Kellogg and Fridovich, 1976; Massie et al., 1979; Lammi-Keffe et al., 1984).  In D. melanogaster,  mitochondrial MnSOD  declined 21% between 5 and 58 days of age, but cytosolic CuZn SOD remained relatively constant (Massie et al., 1980; Nickla et al., 1983).  A shorter lived  vestigial mutant of Drosophila was found to have a lower total SOD content than a wild-type strain (Bartosz et al., 1979). scavenging  capacity of the tissues and the respiration rate are important  determinants of lifespan (Fleming et al., 1987). Drosophila  In Drosophila, the superoxide  However, the role of SOD in  aging is still unclear since two different wt strains with the  same level of SOD activity have been found yet their life spans differ by 40%  (Massie et al., 1981).  In the light of these divergent results it appears  4  critical that the genetic background of Drosophila  be controlled in order to  study unambiguously the effects of different levels of SOD D. Drosophila  as  Animal and  models  biochemical  of aging. studying  a  model with  well-defined  characteristics are  Drosophila aging  organism  for aging  on aging.  studies  genetic, ecological, physiological  required  for studying  the mechanisms  has been used extensively as a model organism for  (reviewed  by  Lints and  Soliman, 1988).  Drosophila  have a short lifespan, but  it also has  chromosomes  and  information.  a  wealth  of  genetic  Not  only  does  a small number of Furthermore,  the  postmitotic nature of most of the somatic tissues of the adult favors studies of the aging  process  since these are probably  the only cells that senesce  (Miquel et al., 1979). Although physiological  it may  be  differences  argued between  related changes initially discovered mammals.  aging  seem  (lipofuscin)  biochemical  levels  properties  similar  quite are  and to  that  large  structural  and  and  mammals, many  age  related  at  have been confirmed in  subcellular levels, Drosophila Insect both  and  the with  fine age.  debris  suggests that free radical  induced  mitochondrial  membrane may  occur with  Aging may  damage to mitochondria,  and  mammalian  peroxidized  This  in Miquel, 1988).  similar.  of  are  in Drosophila  progressively increase  membranes.  in post-mitotic cells.  there  Drosophila  Moreover, at the cellular and  mammalian pigments  that  aging  structural  and  Lipofuscin has from  subcellular  breakdown  age, leading to lipofuscin  of  the  storage  be the result of accumulated peroxidative  resulting in decreased  ATP  production  (reviewed  5  Drosophila For  has been used extensively to test many theories of aging.  example, the  effects  of various drugs,  nutrients,  vitamins, as well as the influence of genetic and aging processes have been studied (Lints and further research in Drosophila  may  antioxidants and  environmental  Soliman,  factors on  1988).  Therefore,  contribute to our basic understanding  of the aging process.  E.  Superoxide  dismutase  In aerobic organisms, normal  oxygen  reactions.  and  oxygen  free radicals are generated  metabolism  via  Activated oxygen  effects of chemical  both  species  toxicity and free radical damage. the toxic  enzymatic are  and  important  carcinogens, ionizing  a factor in carcinogenesis and  as a by-product  of  non-enzymatic  agents  in oxygen  Free radicals are responsible for most of  cycling compounds such as paraquat. be  toxicity  radiation  and  redox-  Free radical damage is postulated to  aging related disorders (Oberley,  1982;  Ames, 1983). Multiple defenses  against oxygen toxicity have evolved, the primary  ones being enzymatic. the  superoxide  radical  hydrogen peroxide 02" + H 0 2  The  2  O2" +  +  O2" +  while  2H+  catalase and  H2O2 +  —>  2H 0 + 2  removal  of the very  Haber-Weiss  enzyme superoxide dismutase  (SOD)  glutathione peroxidase  removes remove  (H2O2):  H 2 O 2 —>  enzymatic  formation  The  of  O2  O2  superoxide  reactive hydroxyl  reaction:  H 2 O 2 —>  *0H  and  +  O2 +  OH"  hydrogen  radical  peroxide  via the  prevents  iron catalyzed  6 The  hydroxyl  cellular  damage.  constitute toxicity F.  radical  an  Due  different  1982b; McCord 1984;  and  defense  dismutase  no  one  assay  Each  assay is best suited for a  is entirely  measurement solutions  of SOD  catalytic  are  tetrazolium  (NBT) assay is useful for locating SOD  extremely  unstable  gels.  Riboflavin-sensilized  purple  formazan.  SOD  are possible,  activity  solutions  assay  (Fridovich,  photoproduction inhibits  enzymatic  system  in the assay  xanthine/xanthine  1976).  (Beauchamp  is most  oxidase  so  nitroblue  reduces SOD  NBT  continuous  superoxide  the superoxide  radicals  generated  cytochrome  c  spectrophotometric  assay  of  The cytochrome c generator  in the assay  inhibits the rate of reduction of cytochrome c.  1971).  source  and the  reduction of cytochrome c for detection (McCord and Fridovich, 1969). scavenges  to  bands are  and Fridovich,  convenient.  as a  superoxide  bands on polyacrylamide  reduction of N B T  a  since The  of superoxide  for generating  solution  using chemically  but tedious  (Marklund,  against a purple background  uses  satisfactory  A l l assays must have a superoxide generator and  superoxide  superoxide  oxygen  activity  generated  An  against  et al., 1977; Flohe and Otting, 1984; Bannister and Bannister,  Direct  achromatic  glutathione peroxidase  nature of the superoxide substrate, a multiplicity of  Crapo et al., 1978).  detector.  enzymatic  activity have been devised.  purpose,  and  of the  1969).  and Fridovich,  to the unique  responsible for much  catalase  intracellular  f o r superoxide  assays for SOD  to be  SOD,  Therefore,  essential  (McCord  Assays  is postulated  system  SOD  and thus  Modification of the original  has  sensitivity (Crapo et al., 1978; Kirby and Fridovich,  greatly 1982).  increased its  7  With the assay methodology available, SODs from many sources have been isolated and may be broadly divided into three classes, according to the  metal  ligand(s) present,  (Mn), or iron (Fe).  either copper  and zinc  (CuZn), manganese  Prokaryotes possess the two closely related Fe SOD and  Mn SOD, whereas eukaryotes have tetrameric Mn SOD (MW mitochondrial matrix and an independently  80-90,000) in the  evolved dimeric CuZn SOD  (MW  31-33,000) in the cytosol (Weisiger and Fridovich, 1973; Steinman, 1982). Recently, an extracellular SOD  which is found in extracellular fluids such  as plasma and lymph has been identified in humans (Hjalmarsson  et al.,  1987).  G.  Superoxide Studies  dismutase  in prokaryotes  protecting the organism intracellular  levels  in  prokaryotes  have demonstrated the importance of SOD in  against oxygen toxicity.  of SOD  correlated  towards oxygen (Fridovich, 1982a). aerobic  or anaerobic  conditions.  paraquat, which  Fridovich, 1977).  The Mn  increased  resistance  SOD  is not synthesized  by the presence of oxygen and  promotes the formation  of superoxide  (Hassan and  Induction of Mn SOD was similar in cells with differing  concentrations  of Fe SOD.  This  concentration  of superoxide  might  synthesis of Mn  with  In E. coli, Fe SOD is synthesized in  anaerobically, but is dramatically induced by  well  For example, increased  SOD  result  suggests  not be  (Nettleton et al., 1984).  that  responsible  the intracellular for regulating  There is no evidence that  prokaryotic Fe SOD and Mn SOD have different biological activities, but it is evident that their expression in the cell is quite different.  8 A  powerful way to clarify the physiological significance of SOD is by  the study of mutants.  A double mutant lacking both Fe SOD and Mn SOD was  highly sensitive to paraquat and hydrogen peroxide.  Thus, a total absence  of SOD creates a conditional sensitivity to oxygen (Carlioz and Touati, 1986). Similarly, a yeast mutant lacking Mn (van Loon et al., 1986).  SOD  was hypersensitive to oxygen  These studies in prokaryotes and lower eukaryotes  provide direct evidence that SODs play a protective role in cellular defense against oxygen toxicity.  H. Superoxide dismutase in  D.  melanogaster  The CuZn SOD from D. melanogaster The  enzyme is homodimeric, with each subunit having a molecular  of 16,000. SOD refer  F  There  are two polymorphic  (fast) and S O D to  s  Both  melanogaster,  mobility  variants of superoxide dismutase -  of  the enzymes  variants are common  although S O D  electromorphs  weight  (slow). The designations of F for 'fast' and S for 'slow'  the relative  electrophoresis.  two  has been purified to homogeneity.  F  in standard gel  in natural populations of D.  is the most abundant (Lee et al., 1981b).  differ in properties such  as isoelectric  The  point, specific  activity, rate constant, thermostability, and amino acid composition. specific activity of SOD thermostable. amino acid.  s  is three times greater than SOD , but S O D F  SOD^ has a lysine whereas S O D  F  is more  F  The amino acid sequence of SOD^ differs from S O D  The  F  by one  has an asparagine at amino  acid 96 (Lee and Ayala, 1985). The entire 151 amino acid sequence of SOD from D. melanogaster been determined  (Lee et al., 1985a,1985b).  has  The amino acid sequence of 15  CuZn SODs (man, cow, sheep, pig, horse, rat, mouse, swordfish, fruit fly,  9 cabbage, been  spinach,  aligned  assigned  maize,  and  Neurospora,  compared  to the 23  to  each  yeast,  and  other.  Photobacterium) have  Specific  amino acid identity with SOD  61% identity with the fruit fly enzyme. D.  melanogaster  has an  SOD  does not cross-  (Lee et al., 1981a).  activity in D r o s o p h i l a  shows  that the expression of the activity is ubiquitous during development.  CuZn  SOD and  developmental profde of CuZn SOD  Human SOD  from other mammals, but only  react with antibodies to bovine erythrocyte CuZn SOD The  been  invariant residues identified, 15 of which combine to  form the active site of the enzyme (Getzoff et al., 1989). average of 82%  roles have  levels are high in eggs and embryos, decrease during the larval stages, then stay at a relatively low  pupae (Graf and  Ayala,  1986).  level until adult flies emerge from the In the adult, the SOD  increases until the sixth day, when it reaches a plateau. SOD  is maintained  content  steadily  This level of CuZn  for at least 60 days post eclosion (Nickla et al., 1983).  However, it should be noted that the mitochondrial  MnSOD declined  21%  between 5 and 58 days of age (Nickla et al., 1983). A use  direct approach to examining the protective role of SOD  of mutant organisms with  occuring variant for CuZn SOD 3.5% was  of the SOD designated  complete  little or no  SOD  activity.  A  naturally  was isolated from the wild and found to have  protein relative to wt (Graf and Ayala, 1986). SOD  is by the  'null', since it has low  SOD  This mutant  activity, but it is not a  null.  Some of the toxic effects of ionizing radiation are due caused by superoxide  radicals.  SOD  effects of ionizing radiation in D.  was  to damage  shown to protect against the toxic  melanogaster.  The  sensitivity of  SOD  10  'null' flies to radiation was  much greater than wt.  In addition, flies with  SODS, which have a higher specific activity of SOD  than flies with SOD , F  were more resistant to the toxic effects of ionizing radiation (Peng et al., 1986) . In this study, the effects of decreased SOD oxygen free radical metabolism and a SOD  null mutant, c S 0 D  n l 0 8  O2"  I.  Superoxide  lifespan are also described.  , apparently devoid of SOD  (Phillips et al., 1989). The c S 0 D metabolize  levels in the SOD  n l 0 8  Recently,  activity was isolated  D r o s o p h i l a have a reduced capacity to  radicals, decreased fertility and decreased  dismutase  'null' on  lifespan.  genes  The cDNAs and genes of SODs from various sources have been cloned The FeSOD and MnSOD genes of E.  and the nucleotide sequences determined. coli  have been cloned and  Touati, 1984).  analyzed (Nettleton et al., 1984;  In yeast, the CuZn SOD  gene was  Sakamoto and  cloned, sequenced  shown to have biological activity (Birmingham-McDonogh, 1988). mutant which was  devoid of CuZn SOD  plasmid containing the cloned gene. was  The  activity was CuZn SOD  A  transformed  and yeast  with a  gene on the plasmid  able to rescue the oxygen sensitivity of the yeast mutant . The  bacterial species, Photobacterium  CuZn SOD 1987) . peptide.  leiognathi,  rather than the FeSOD usually found  The  sequence of this SOD  unexpectedly  has a  in prokaryotes (Steinman,  gene revealed the presence of a leader  This result implies that this CuZn  SOD  is exported, unlike the  eukaryotic CuZn SODs which remain in the cytosol. The  rat CuZn SOD  cDNA has been cloned and its sequence determined  (Delebar et al., 1987; Ho and Crapo, 1987; Hass et al., 1989).  It shows 96.7%  n  identity to the mouse cDNA sequence (Bewley, 1988; Getzoff et al., 1989). Northern blot analysis of total RNA  from  various rat and mouse tissues  shows there is a single 0.7 kb SOD mRNA species (Delebar et al., 1987; Hass et al., 1989). Bovine CuZn SOD has been used in the treatment of osteoarthritis and other  inflammatory  distinct from human  The  bovine  enzyme  is antigenically  the human enzyme so it is preferable to use a recombinant  SOD  Therefore,  conditions.  that  there  is identical  has been  to the authentic  great  interest  erythrocyte  enzyme.  in the cloning, expression and  production of the human CuZn SOD for therapeutic use. The  sequence of the human CuZn  SOD  cDNA  (Leiman-Hurwitz et al., 1982; Sherman et al., 1983). transcripts which  has been determined  Of the two human SOD  are 0.9 and 0.7 kb in size, the 0.7 kb transcript is  predominant (Sherman et al., 1984).  The expression  of the human CuZn  SOD gene in E. coli has been described (Hallewell et al., 1985). A  new type of SOD protein was recently discovered in humans and is  the major SOD  protein present  lymph (Hjalmarsson  in extracellular fluids such as plasma and  et al., 1987).  The cDNA sequence of the extracellular  SOD  revealed that amino acid residues number 96-193 have  50%  identity with  the final two thirds of the sequences known for other  eukaryotic CuZn SODs. but  contains  protein. ovary  Extracellular SOD has Cu and Zn as ligands as well,  a signal peptide, as expected  This extracellular SOD  cells  approximately  and the recombinant  from  its role  has been expressed SOD  extracellular SOD (Tibell cl al.. 1987).  as a secretory  in Chinese hamster  has properties identical  to native  12 The  human CuZn SOD gene resides on chromosome 21 at 21q22 and  spans 11 kb of chromosomal DNA.  Sequence analysis reveals that this gene  is composed of five small exons separated by four introns (Levanon et al., 1985) .  Four distinct processed  CuZn SOD pseudogenes not residing on  chromosome 21 have also been found (Danciger et al., 1986). pseudogenes were derived from the 0.7 kb SOD mRNA  Three of these  species while the  fourth was derived from the 0.9 kb SOD mRNA species. Down's syndrome is one of the most common genetic and  is associated  normal two.  with  three copies  abnormalities  of chromosome 21, rather than the  The location of the human CuZn SOD gene (chromosome 21 at  21q22), is also known to be involved in Down' syndrome (Lieman-Hurwitz et al., 1982) and patients with this condition show an increase of about 5 0 % in CuZn SOD activity due to a higher level of the protein present (LiemanHurwitz et al., 1982).  Mouse cells overexpressing human CuZn SOD showed  membrane damaged due to increased lipid peroxidation (Elroy-Stein et al., 1986) .  This damage is thought to be due to increased  efficient metabolism of the superoxide  radical.  H2O2 resulting  Lipid peroxidation has been  shown to occur in the brains of individuals with Down's syndrome. was to  from  Thus, it  suggested that damage to the membrane may affect cell action and lead mental deficiency. The  human  CuZn  SOD gene was introduced  (Elroy-Stein and Groner, 1988).  into rat neuron  The neuron cells overexpressing  cells  CuZn SOD  had  normal morphology, growth rate and response to nerve growth factor,  but  were  impaired  in neurotransmitter  uptake.  Neurotransmitter  uptake  13  was  inhibited by damaged membranes, which  lipid  peroxidation. Transgenic  mice  with additional  human CuZn  appeared normal (Schickler et al., 1989). of  were the result of increased  the  neurotransmitter  serotonin  mice  had  abnormal  genes outwardly  However, they had reduced levels  in their  blood  another symptom characteristic of Down's syndrome. transgenic  SOD  synapses  between  platelets,  which  is  The tongues of these the  neurons  and  the  muscle cells, a condition found in the tongues of individuals with Down's syndrome. results  This  suggests  condition that  neurobiological  was  CuZn  also  SOD  abnormalities  Furthermore, there  may  be  gene  dosage  observed  a possible  Down's syndrome and aging (Avraham J.  apparent in senescent rats.  link  may  with  contribute Down's  between  mental  These to the  syndrome. retardation,  el al., 1988).  Aims a n d scope of this study We  have chosen the fruit fly, Drosophila  melanogaster,  as a model  organism for studying the effects of free radical metabolism on aging. order  to  determine  whether  additional  metabolism and longevity in Drosophila,  SOD  activity  affects  In  oxygen  our approach was to clone the  Sod  gene from  an isogenic stock and introduce additional copies of the gene  back  the  into  genome  transformation.  of  the  Transformants  same  stock  via P  overexpressing  investigate the effects of increased SOD  SOD  element were  used  to  activity on oxygen metabolism and  lifespan of the fly. 1.  mediated  Isolation and characterization of the Drosophila  cDNA and gene  14  Early mapping studies localized the D. melanogaster position 32.5  on  the left arm  recently, the Sod  of chromosome three (Jelnes, 1971).  be  9  deficient  for  the  CuZn  Sod  gene.  of the wt  SOD  protein.  Therefore, the Sod  deficiency.  The  cloned Sod  gene was  to confirm the location of the Sod  50%  resides within  this  locus.  representing  cDNA was  melanogaster  CuZn SOD  to use a mixture of  all possible  predicted from a short amino acid sequence. the D.  The  codon  combinations  amino acid sequence of  is known (Lee et al., 1985a,1985b). Successful  use of mixed oligonucleotide probes rests largely on probe design. such  as  probe  strain  hybridized to polytene chromosomes  strategy chosen to clone the SOD oligonucleotides  gene  The  gene and had  9  synthetic  unit  A deficiency in the lxd region (D/(3L)lxd ) was also  D/(3L)lxd /TM3565er contains only one copy of the Sod  The  More  xanthine dehydrogenase locus (lxd) (Schott et al., 1986;  Campbell et al., 1986). to  locus to  locus has. been mapped to 34.6, and is only 0.1 map  away from the low  found  CuZn Sod  heterogeneity,  base  sequence,  and  length  Factors must  be  considered (Lathe, 1985).  Despite the guidelines available, successful use of  oligonucleotide  probes  are  experimentation.  The  the  least  tryptophan  number  a  matter  of  educated  amino acid sequence chosen should  of  possible  codons.  For  example,  have unique codons, but they are also two  acids found in proteins. nucleotide long probes.  guesswork  and  be specified by methionine  and  of the rarest amino  Previous attempts to clone the gene used two One  probe, GT3,  was  targeted to aa 90-95, whereas  the other probe, SI, was targeted to aa 43-48 of the SOD could not be isolated using GT3  17  protein. A SOD  clone  or SI probes singly or in conjunction with  15  each other (Seto, 1987).  However, the gene was successfully isolated using  the 26 nucleotide long probe (13) described below. 2.  P element transformation of the D. melanogaster CuZn SOD gene P elements are a family of mobile genetic elements in Drosophila and  are  efficient  vectors  for  the introduction  germline.  Transformation results  such  the gene  that  of functional  in the expression  products are indistinguishable  genes  into the  of eukaryotic from  that  genes of  the  endogenous chromosomal gene (Rubin and Spradling, 1982; Spradling and Rubin, 1982). A number of P elements have been cloned and sequenced (O'Hare and Rubin, 1983; Karess and Rubin, 1984).  Intact P elements are 2.9 kb in size  and encode a transposase which can mediate its own transposition as well as the transposition  of smaller defective P elements into  the  germline.  Smaller P elements are derived by a single internal deletion of the 2.9 kb element.  Both intact and defective P elements (which lack the transposase  gene) contain the same 31 bp inverted repeats at their termini, which are presumably  recognized  by the transposase during  Genomic DNA sequences adjacent to many similar.  excision  and insertion.  P elements were found to be  These sequences were used to derive a 8 bp consensus sequence  for the preferred site of P element insertion (O'Hare and Rubin, 1983). DNA  fragments of interest may be introduced into the Drosophila  germline  using  transpose  from  Microinjection  the P element plasmids of cloned  as a vehicle.  and stably P element  integrate DNA  into  Cloned into  P elements can  chromosomal  the embryo  shortly  DNA. after  fertilization results in the transposition o f the P element into the germline  16 of the recipient embryo.  The injected P element DNA  genome of a single pole cell. cells.  integrates into the  The pole cells are the precursors to germline  Due to the multiplicity of germline precursor cells in each embryo,  the P element would only be inherited by a small fraction of the progeny which develop from that embryo. element vectors were constructed the  transposase gene.  For the purpose of transformation,  P  with a multiple cloning site, but lacking  The transposase required  for the transposition of  the recombinant P element must be supplied by an intact helper P element. The  helper P element is transposition defective because the 31 bp inverted  repeat at one of its ends has been removed. DNA  Therefore, extrachromosomal  can be effectively transposed into the germline of D r o s o p h i l a by P  element  mediated  The gene  transformation.  transposable  under  resistance  P vector pUChsneo carries the neomycin resistance  the control of the heat-shock  to the antibiotic  G418  (Steller  promoter  and this  and Pirrotta,  provides  1985).  The  transcription of the neomycin resistance gene may be increased by a heatshock.  The antibiotic  gentamycin, neomycin synthesis.  G418. of  is structurally and functionally related to  and kanamycin,  which  are inhibitors of protein  In contrast to these, G418 is toxic not only to prokaryotic but  also to eukaryotic cells. detected  G418  by  The transposition of pUChsneo into the genome is  selecting transformants  which  have  acquired  resistance to  This system has the advantage over others in that it allows selection  transformants  in any  desired  genetic  background,  mutant strains required for phenotypic selection.  rather  than in  In this study, pUChsneo  was used since it allows the selection of transformants in a desired isogenic  1 7  background.  Maintaining  particularly  important, since  Using  this  the isogenic background of the transformants is genetic  methodology,  variability  may affect their lifespan.  Drosophila  strains, each of which  five  contains an additional copy of the Sod gene at a different chromosomal site were obtained. inserted 3.  Analysis of the transformants showed that the genes were  and functional.  Effects of increased Sod  expression  on oxygen radical metabolism and  lifespan Since the superoxide scavenging ability of tissues has been implicated as important determinants of lifespan, we chose to investigate the lifespan of the SOD 'null' mutant as well as that of the transformed lines which overexpress background the  SOD.  Since  all the transformants  had the same  as the wt controls, it was possible to compare  effect of increased  SOD  activity  on oxygen  radical  genetic  unequivocally  metabolism and  longevity. Paraquat  (1 ,r-dimethyl-4,4'  bipyridinium  generates  O 2 " radicals in vivo by a mechanism that involves the NADPHof P q  2 +  to animals.  +  that is also highly  reduction  and lethal  Pq^ ) is a  herbicide  dependent  cytotoxic  dichloride;  to the relatively stable P q  +  Paraquat  radical  which  then reacts rapidly with O2 to produce O2" (Hassan and Fridovich, 1 9 7 9 ; Farrington et al.,  1973).  Feeding adult Drosophila  aqueous paraquat leads to  exposure of the fly to acute levels of O2* radicals. The effect of SOD levels on  oxygen  free  radical  metabolism  sensitivity of the flies to paraquat.  was investigated  by measuring the  18 MATERIALS AND A.  METHODS  Materials Deoxy and dideoxy NTPs were purchased from P.L. Biochemicals. [y-  32  P]ATP  (3000 Ci/mmol, 10 uCi/ul) and [a- P]dNTP  u.Ci/u.1), [ S ] d A T P o c S (10 u.Ci/u.1) were from 35  England Nuclear (NEN). NEN.  The  primer  were  oligonucleotides 13, NS-1, synthesized  polymerase  purchased  on  an  I and E. coli  Applied  analogs were from  forward primer and reverse Biosystems  oligonucleotide  Restriction enzymes, T4 ligase, E.  DNA  England  New  polymerase  and used as  E.  the manufacturer.  Biochemicals.  Modified T7 DNA  States Biochemical Corp.  RNA  Calf intestinal phosphatase were  manufacturer unless indicated otherwise.  BSA  Sigma.  Pharmacia.  Agarose  was  Acrylamide  polymerase  from  was  was  from  P.L.  polymerase (Sequenase™) was from United  All enzymes  by  Mannheim.  coli  Bethesda  fragment) were  (BRL), Boehringer Mannheim, Promega Biotech, or Pharmacia  Boehringer  Biolabs,  (Klenow  coli  Laboratories  by  New  NS-2,  Corp. and  10  Research  specified  from  Amersham  The a-phosphorothioate dNTP  synthesizer by T. Atkinson (UBC). DNA  (3000 Ci/mmol,  32  BRL,  from  used  as  purchased from  specified  and lysozyme  Genetic  Eastman  was  by  the  were supplied  Technologies Inc. and  Kodak  Co.,  N.N'-methylene  bisacrylamide from Matheson, Coleman and Bell, and TEMED from BioRad. Liquified  phenol (88% aqueous solution) was  formamide from BDH X8(D).  IPTG  was  was  deionized with Bio-Rad mixed  purchased  from  membranes (Hybond-N) were from film was from Agfa-Gevaert.  purchased from Mallinckrodt,  G418  BRL  and  Amersham  bed resin AG501-  X-gal, from Sigma. Corp. and  Nylon  Curix RP1  X-ray  (Genelicin) was from GIBCO-BRL.  Bacto-  19  typtone, Bacto-yeast Xanthine  extract  and Bacto-agar  (2,6 dihydroxypurine, grade  were  purchased  from  Difco.  H I ) , ferricytochrome c (horse heart,  type III) and xanthine oxidase (grade 1) were from Sigma. B.  Bacterial  strains,  media,  vectors,  buffers  and  Drosophila  stocks E. coli strain Q358 (hsdR(r^-,m^~), supE, P2) and C600A////A (thi-1 thr1 /euB6 lacYl  ton A21 supEAA hflA\50 chr::TnlO) were hosts for vectors  XEMBL3 and \gt\0, respectively (Kaiser and Murray, 1985).  E. coli JM101  (supE, thi, A(lac-proAB), [F. traD36, proAB, lacl'i ZAM15]) and  JM109  (recAl, endAl, gyrA96, thi, hsdRM, supEAA, relAl, X\ A(lac-proAB), [F, traD36, proAB, laclQ ZAM15] ) were hosts for pUC and M13 vectors (Yanisch-Perron et al., 1985). JM101/109  were propagated  in M9-minimal  salts  medium  Na2HPC>4, 25 mM K H 2 P O 4 , 8.5 mM NaCl, 20 mM N H 4 C I , 1 mM  CaCl2,  10 mM  transformed  glucose, 0.001%  thiamine)  with plasmid DNA were propagated  (Miller,  (50 mM  MgS04, 0.1 mM  1972).  Bacteria  in either LB ( 1 % Bacto-  typtone, 0.5% Bacto-yeast extract, 0.5% NaCl), 2YT (1.6% Bacto-typtone, 0.5% Bacto-yeast extract, 0.5% NaCl) or TB (1.2% Bacto-typtone, 2.4% Bacto-yeast extract, 4% glycerol, 17 mM K H 2 P O 4 , 72 mM K 2 H P O 4 ) . E. coli strain Q358 was grown in NZYM ( 1 % NZ-amine, 0.5% Bacto-yeast extract, 0.5% NaCl, 10 mM M g C l 2 ) and C600AW//A was grown in LB supplemented with 0.2% glucose. Plates were made by adding 1.5% agar to the media. The plasmid pUCl3 was a gift from Dr. S. Hayashi. vectors  were  amplified  from  P.L. Biochemical  stocks.  The M13mpl8/19 The P element  20  transformation transformed The  vectors  E. coli  pUChsneo  slocks provided  and  phsit  were  amplified  by Dr. J. Leung.  composition of the following buffers were:  TE 8  10 mM Tris-HCl, 1 mM EDTA (pH  SM  0.58% 0.01%  DNase I  50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 0.5 mM CaCl2  10 X SET  0.1 M Tris-HCl (pH 8.0), 50 mM EDTA, 5 % SDS  MOPS-E  20 mM MOPS, 5 mM NaOAc, 10 mM EDTA (pH 7.0)  exo  10 mM Tris-HCl (pH 8), 10 mM MgCl2, 1 mM DTT, 20 mM 0.1 mg/ml BSA  SI  III  NaCl, 0.20% gelatin  8.0)  MgS04-7H 0. 50 mM Tris-HCl (pH 7.5), 2  KC1,  nuclease 0.4 M NaCl, 0.1 M NaOAc (pH 4.5), 2 mM ZnS04, 0.4% glycerol  10 X Hin The  100 mM NaCl, 100 mM Tris-HCl (pH 7.5) D.  melanogaster  chromosomes was constructed balancer stock  wild-type  strain  isogenic  by Dr. G. M. Tener.  CyO\TM2,Ubx/T(2;3)ap  for all the major The chromosome 2,3  (Lindsley and Grell, 1968) was  Xa  obtained from Dr. P.L. Davies (Queen's Univ.; Kingston, Ontario). "null" mutant was generously provided CA)  from  and the Sod  deficiency  strain  The SOD  by Dr. F.J. Ayala (UC Irvine; Irvine, D/(3L)lxd /TM3S6Ser 9  was kindly  provided by Drs. E.M. Meycrwitz (Cal. Tech., Pasadena, CA) and V. Finnerty (Emory Univ.; Atlanta, GA). C. Isolation of D.  melanogaster  DNA  Total genomic DNA from Drosophila of Jowett (1986). nitrogen nitrogen.  Approximately  and homogenized  strains was isolated by the method  400 flies were quick  in a mortar  and pestle  frozen  in liquid  containing  liquid  The resulting powder was transferred into 4.0 ml of lysis buffer  21  (100 mM  Tris-HCl (pH 8.0), 50 mM  spermine, 0.5 ug)  was  mM  added  spermidine) and and  occasional mixing  NaCl, 50 mM mixed by  EDTA, 1% SDS, 0.15  inversion.  the homogcnate incubated  by  inversion.  The  volume of phenol (equilibrated to pH  at 37°C  was  volume  phenol/CHCl3 and then once with CHCI3 only.  The DNA  was  and  DNA  was  NaOAc (pH 5.2) and 2 volumes of cold  was then incubated with RNase A at 100 u.g/ml for  at 37°C, extracted with phenol/CHCl3 once, EtOH precipitated, dried  redissolved in TE  checked on a 0.6% D.  The  pelleted by centrifugation and redissolved in 500-  1000 ul of TE 8. The DNA 30 min  Tris-HCl  upper aqueous phase extracted twice with an equal  precipitated with 1/10 volume of 2.5 M EtOH.  hr with  8 by extracting with 10 mM  8)).  95%  for 1-2  (400  extracted with an equal  buffer (pH of  The  DNA  Proteinase K  mM  Bacteriophage  8.  The  size and quantity of the genomic DNA  was  agarose gel. lambda  Single recombinant  DNA  preparation  kgilO phage plaques were picked into 200 ul of SM  buffer containing 5 ul of chloroform. out of the agar for 24 hr at 4°C.  The  phage were allowed to diffuse  To prepare DNA  phage clones, 100 ul of host C600A///M  from recombinant  XgtlO  (concentrated 2.5 times in 0.01  M g S 0 4 ) was infected with 150 ul of the phage solution in 100 ul of 10  M mM  MgCl2/CaCl2 solution. The phage were adsorbed for 15 min at 37°C and used to  inoculate 20 ml  of pre-warmed NZYM  media.  The  culture was  vigorously at 37°C until it Iysed clear (3-5 hr depending on phage titer). for  5 min  8000 g.  Chloroform  (200 ul) was  shaken  the original  added and the culture swirled slowly  before pelleting the cell debris by centrifugation for 15 min at The  supernatant  was  mixed with 0.15  volumes of 5 M  NaCl, 0.3  22  volumes 5 0 % PEG6000 and the phage precipitated for 3 hr or more at 4°C (Yamamoto and Alberts, 1970). by The  The PEG-precipitated  phage were pelleted  centrifugation (8000g, 15 min., 4°C) and the supernatant was discarded. tubes were  re-spun  for another minute.  was removed as cleanly as possible.  The remaining supernatant  The phage pellet was resuspended in  500 ul of DNase I buffer (50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 0.5 mM CaCl2) and  incubated with DNase I (5 ul of 1 mg/ml) and RNase A (5 u.1 of 10  mg/ml) at 37°C. centrifugation  After incubation  for 3 hr, the debris was pelleted by  for 1 min in a microfuge.  The phage in the supernatant  were treated with 10 ul of 10 mg/ml proteinase K in 1 X SET buffer (10 X SET=0.1M Tris-HCl (pH 8.0), 50 mM EDTA, 5 % SDS) for 2 hr at 68°C. The phage DNA was purified CHCI3  extractions.  by two phenol/CHCl3  (1:1) extractions and three  The DNA was concentrated by EtOH precipitation and  resuspended in 50 ul T E 8 buffer (yield=l-2 pg). E. Isolation of D.  melanogaster RNA  1. Isolation of total D. melanogaster RNA Total Drosophila RNA was isolated by the guanidinium/CsCl method of Chirgwin  (Chirgwin et al., 1979) with  the following  gram of flies were frozen at -70°C for a few minutes. in  a mortar and pestle containing  powder.  liquid  nitrogen  The flies were placed  The powder was quickly transferred to a tube containing  0.1 M p-mercaptoethanol  (added  and mixed  at 8000 g for 5 min.  supernatant was removed as cleanly as possible.  6 ml of  Na3Citrate(pH 7.0) and  after auloclaving))  The solution was centrifuged  One  and ground to a fine  guanidinium solution (7.5 M guanidinium-Cl, 25 mM  vortex.  modifications.  using a  The orange  The solution was drawn  23  into a sterile disposable syringe (21 gauge needle) and passed through the needle 8-10 times until the viscosity of the solution decreased. must be sheared to minimize contamination of the RNA pellet. was  The DNA The solution  layered on top of a 1 ml CsCl cushion (38.5 g CsCl, 40 ml 25  mM  Na3citrate (pH 5.0)) in 2" X 1/2" centrifuge tubes.  The tubes were spun in a  SW50.1 rotor at 42,000 rpm for 16-24 hr (22°C).  After centrifugation, the  upper  guanidinium  centrifuge  solution  tubes wiped  with  without touching the RNA were resusupended  was carefully  with  a tissue.  removed  and the sides of the  The CsCl  solution  pellet on the bottom of the tube.  1200 ul of sterile water.  RNA  The pellets  Four aliquots of 300 u.1  each were made to obtain complete dissolution of RNA. the RNA  was removed  The suspension of  pellets was aided by heating at 55°C for 2-3 min intervals.  was then concentrated by EtOH precipitation and resuspended  u.1 of sterile  water.  The concentration of the RNA  absorbance at 260 nm.  The  in 300  was measured by  The water and CsCl solutions were treated with DEPC.  The solutions were made up to 0.1% DEPC, stirred at room temperature for 30 min and then autoclaved. 2.  Isolation of poly(A) The  poly(A) RNA +  et al., 1982). produce were  +  RNA was purified from total RNA  Total RNA  essentially  pure  detected by spoiling  as described (Maniatis  was passed through an oligo(dT) column twice to poly(A)  +  RNA.  2 u 1 of each  The RNA column  containing fractions fraction  onto  plates  containing EtBr (0.4 g agarose, 40 ml TE 8 buffer, 4 u.1 of 10 mg/ml EtBr) and viewing the plate with uv light.  The poly(A) RNA +  was concentrated by  EtOH  precipitation  and the concentration  was measured  by absorbance at  260 nm. F.  Gel  1.  Neutral agarose gels The  mM  Electrophoresis  buffer used for agarose gel electrophoresis was 90 mM  Tris, 90 mM  boric acid, 1 mM  EDTA, pH 8.3) and gel concentrations  varied from 0.5-1.2% agarose (with 1 ug/ul EtBr). 8 buffer which contained  DNA was suspended in T E  10% sucrose, 0.025% bromophenol blue, 0.0125%  xylene cyanol, 0.025% SDS and 0.25 mM The  gels were run at 2.5V/cm  254  nm  2.  T B E (90  EDTA before loading onto the gel.  for 12 to 14 hr, then photographed using a  transilluminator.  Formaldehyde agarose gels RNA  was  separated  in 1.4%  agarose  gels  containing  0.66  M  formaldehyde in 1 X MOPS-E buffer (10 X MOPS-E = 0.2 M MOPS, 50 mM NaOAc, 10 mM polyA  +  EDTA, pH 7.0). The RNA (either 30 ug total RNA or 3 ug  RNA) was dissolved  in 2.5 u l water and 12.5 u l of RNA  electrophoresis buffer (0.75 ml deionised formamide, 0.15 ml 10 X MOPS-E, 0.24 ml formaldehyde, 0.1 ml RNase free water, 0.1 ml glycerol, 0.08 ml 10% w/v bromophenol blue), then heated at 65°C for 15 min. One ul of 1 mg/ml EtBr was added to each sample before loading onto the gel. was for 18 hr at 30V in 1 X MOPS-E buffer.  Electrophoresis  After electrophoresis, the gel  was placed on a 254 nm transilluminator and photographed. 3.  Denaturing polyacrylamide  (DNA sequencing) gels  Products of the DNA sequencing reactions were loaded onto 4, 6 or 8% polyacrylamide  gels  (acrylamide:melhylcnebisacrylamide  (19:1), 8 M  urea,  25  0. 06%  ammonium persulfate, 20 ul TEMED, 50 mM  40 cm X 18 cm X 0.35 mm piece of 0.35 mm  TBE). Regular gels were  and wedge gels were made by the addition of a 1"  spacer at the very bottom of the gel.  Electrophoresis was  at 1600-1800V such that the current did not exceed 25 mA. dried onto Whatman 3 MM  The gels were  paper using a vacuum gel drier (1 hr, 80°C) and  exposed to X-ray film at room temperature for hours or days depending on the  radioactivity  incorporated  G.  Gel  1.  Southern blot analysis of genomic and cloned  hybridization  into the products.  analysis DNA  Agarose gels were denatured for 10 min twice in 1.5 M  NaCl/0.5 M  NaOH and neutralized for 10 min twice in 1.5 M NaCl/1.0 M Tris-HCl (pH 7.5) at  room  temperature  DNA  was  transferred to nylon membranes (Hybond-N) with 20 X SSC overnight.  The  membranes  were  irradiation  (254 nm,  with  air dried  prehybridization.  4 For  shaking  before  min)  (Southern,  covalent  and  were  1975).  linkage washed  oligonucleotide  The  of the DNA in 6  probes,  the  X  SSC  by uv before  filters  were  prehybridized in 6 X SSC, 10 X Denhardt's reagent (1 X Denhardt's reagent = 0.02% Ficoll, polyvinyl pyrrolidone, and BSA), 0.2% SDS in heat sealed bags for at least 3 hr. The DNA oligonucleotides  at 10  7  on the filters were hybridized with [ P]-labelled 32  cpm/ml in 6 X SSC, 5 X Denhardt's reagent, 50  mM  sodium phosphate (pH 6.8), 0.5% SDS, and 20 ug/ml E. coli tRNA at 55°C for 14-20 hr.  The filters were washed at room temperature (twice for 30 min)  followed  by a high stringency  min).  When  nick-translated  wash in 6 X SSC at 55-65°C (twice for 10 probes  solution contained 6 X SSC, 0.01 M  were  used,  the  prehybridization  EDTA, 5 X Denhardt's reagent, 0.5% SDS  26  and  100 ug/ml  translated  DNA  sheared  salmon  probes  were  sperm  added  (or herring  testes  DNA).  to the prehybridization  were hybridized 8 hr or more at 68°C.  Nick-  solution and  Filters were washed for 30 min twice  in 2 X SSC/0.5% SDS, 30 min twice in 2 X SSC/0.1% SDS and for 1 hr twice in 0.1 X SSC/0.1% SDS at 68°C. 2.  Northern Blot Analysis The  RNA  formaldehyde agarose gels were soaked in 10 X SSC at room  temperature for 20 min twice. nylon  membranes  The RNA  (Hybond-N)  with  in the gels were transferred onto  10  illumination with uv (254 nm, 4 min).  X  SSC  and  air dried  The membranes were prehybridized  in 0.5 M sodium phosphate (pH 7.2), 7% SDS, 1% BSA and 1 mM for 12 hr or more.  before  EDTA at 68°C  The radiolabeled DNAs (10^ cpm/u.g) were added (10  cpm/ml) and hybridized in the same buffer for 14 hr or more at 68°C. filters were washed in 40 mM and  1 mM  EDTA  than  A higher stringency wash was  sodium phosphate (pH 7.2), 1% SDS and 1 mM  60 min twice at 68°C. the methods  The  sodium phosphate (pH 7.2), 5 % SDS, 0.5% BSA  for 60 min twice at 68°C.  performed in 40 mM  6  EDTA for  This method produces stronger hybridization signals  used  for DNA-DNA  hybridizations  described  above  (Mahmoudi and Lin, 1989). H.  Purification  of  Oligonucleotides and  Smith (1984).  were  oligonucleotide  probes  purified essentially as described  by  Atkinson  The crude oligonucleotides were suspended in 50 pi of  sterile distilled water. formamide, heated  oligonucleotide  A  10 ul aliquot was mixed with 20 pi of deionized  at 90°C  solution  was  for 3 min and rapidly cooled loaded  into three  10 mm  on ice.  The  slots on a 2 0 %  27  polyacrylamide, 50 mM reference  for  mixture (98% 0. 2%  TBE, 7 M  predicting deionized  oligonucleotide  formamide, 10 mM  xylene cyanol) was  loaded  contain oligonucleotide.  The  the xylene cyanol  was  20  transferred  piece  to  visualized by gel 60  a  urea gel (0.5 mm  on  gel was cm  of  Saran  F254) underneath the gel.  and  incubated  overnight  oligonucleotide  a  EDTA, 0.2%  and  the  Short wavelength uv  al 37°C  in  1 ml  solution was  of 0.5  gel  from  filtered  Scientific)  were  Savant  Speed  concentration  eluting with three  Oligonucleotide  Vac  These C1 8  with  Labelling  1.  Nick-translation of  DNA  concentrations  10  ml  oligonucleotides were  1 ml  The pure  aliquots of  were  determined  20% by  (A260=l for 20 ug/ml), evaporated to dryness using a concentrator,  in sterile distilled  1.  The  Contaminants were  washed  10 ml of distilled water. The  oligonucleotides were isolated by  nm  the  through a small Millipore  loaded into the cartridge and washed with 10 ml of distilled water.  absorbance at 260  were  N H 4 OAc.  phase chromatography , cartridge.  (Waters  acetonitrile/water.  was  illumination from  M  a reverse  by  The  bands which were excised  removed by  acetonitrile, followed  V) until  lamp with a fluorescent plate (Kresel  45u pores) to remove gel fragments.  cartridges  slots which  oligonucleotides  disc (Millex HV4,  SEP-PAK  gel  gel slices were placed in a 1.5 ml Eppendorf tube  containing  using  dye  bromophenol blue,  run al constant voltage (1500  wrap  As a  formamide  either side of the  above resulted in dark oligonucleotide The  mobility,  X 18 cm).  down the gel (about 3 hr).  viewing under the uv  gel using a scalpel.  X 40 cm  probes DNA  and  waicr.  resuspended  to  the  desired  28  Plasmid or double-stranded nick-translation cpm/ug. 32  (Rigby  DNA  DNA  i2  al., 1977)  to  a  specific  activity  probes (0.1-1 tig) were typically reacted  P]dATP in 4 mM  0.2 mM  et  probes were labelled with [ -P]  DNA  Tris-HCl (pH 7.5), 5 mM  CaCl2, 0.02 mM quality) and  higher specific  of  10 -10 ^  with 50  u.Ci [a-  MgCl2, 0.05 ug/ul BSA,  10 mM  10 units of E.  activity, 2  coli DNA  to 3 The  polymerase I.  radioactive nucleotides  mixture was  were used  incubated at 15°C  After the addition of 5 pg of E.  unincorporated  radioactivity  chromatography using a 18 (Fischer Scientific). mM  EDTA and 0.2 M  The  X  was  0.196  cm  Ac A  2  column buffer was  NaCl.  coli  by  54  (MW  10 mM  The  spermidine and  gel  filtration  5000-7000) matrix  probe was min.  by  polynucleotide  250  10 mM  DTT  32  u.Ci of [7- P]ATP 32  for 45 min  terminated by heating at 65°C for 10 min.  kinase  [7- P]ATP to the 5' OH  hundred picomoles of the mixed with  denatured just  kinase  polynucleotide kinase in 0.1 M Tris-HCl (pH 7.5), 20 mM 0.2 mM  as carrier, the  was  which transfers the radioactive phosphate from  were reacted  10  and  The probe was eluted in the void volume and  32  (probe 13)  SDS  0.25  oligonucleotides were labelled with [ P]  One  hr  7.5),  End-labelling with polynucleotide  the oligonucleotide.  in the  for 1-1.5  Tris-HCl (pH  before use by heating in a boiling water bath for 3  The  tRNA  removed  typically collected in a 500-800 pi volume.  2.  DTT,  For probes with  and the reaction terminated by the addition of 3 volumes of 1% EDTA.  7  dCTP, dTTP, dGTP, 0-25 pg DNase I (depending on the  nick-translation reaction.  mM  by  oligonucleotides  and  25  MgCh, 0.2 mM  at 37°C.  of  The  units  EDTA,  reaction  E. coli tRNA (250 pg) was  a carrier and the sample diluted with the addition of 4 volumes of TE  of  was  added as 8.  The  29  reaction mixture  loaded onto a 0.5  ml  washed with 4 column volumes of TE  8.  usually  was  removed  by  16  column  column of DEAE-cellulose and The  volumes  unincorporated label  of  0.2  M  NaCl/TE  oligonucleotides were eluted in 6 column volumes of 1.0 M incorporated counts were routinely 2 X  10 cpm  The probes were hybridized to filters at 40 ul/cm cpm/ml in 6 X  SSC.  Screening  lambda  1. Screening a D. The  2  Total  incorporation).  and no less than 1 X  sodium phosphate (pH  and  6.8), 5 X  10  7  Denhardt's  and 20 ug/ml E. coli tRNA.  reagent, 0.5% SDS J.  50 mM  NaCl/TE 8.  (30-40%  8  8  was  libraries  melanogaster cDNA library in XgtlO  titer of a D.  melanogaster  embryonic  (3-12  hr) cDNA  library  (Poole et al., 1985) was determined by plating a series of 10-fold dilutions of the original phage stock.  An  overnight culture of host C600A////A  in LB-0.2% maltose was pelleted and resuspended the A600=15.  in 0.01  MgS04 such that  To produce small plaques at a density where they are almost  confluent, 400 \i\ of host cells were infected with 3 X 10 mM  M  grown  MgCl2/CaCl2-  5  pfu in 1000 ul of 10  The phage were plated on 150 X 15 mm  plates containing  LB-0.2% glucose with 8 ml of top agarose (0.7% in LB-glucose).  The top and  bottom agar were poured  on a level surface to obtain uniformly distributed  phage  plates  plaques.  approximately pfu/plate).  The  were  8 hr until the plaques  The  library was  screened  method of Benton and Davis (1977). before blotting the plaques phage DNA  were adsorbed  onto  152  incubated  inverted  at  37°C  for  were just touching (approx. 30,000 by the in  situ plaque  hybridization  The plates were chilled at 4°C for 1 hr mm  nylon  filters (Hybond-N).  The  by placing two filters on each plate sequentially,  30  the first for 3 min and the second lor 5 min.  The orientation of the filters  on the agar plates was marked by asymmetric ink spots and air dried. phage DNA 1977). pfu)  was denatured and neutralized as described  The  (Benton and Davis,  The phage from 14 plates were lifted in duplicates (approx. 4.2 X 10^  and the DNA  was covalently  with uv light (254 nm, 4 min).  linked to the membrane by irradiation  The filters were washed in 6 X SSC and  prehybridized for at least 3 hr in the absence of radioactive probe (6 X SSC, 10 X Denhardt's reagent, 0.2% SDS) and hybridized with  10^ cpm/ml radioactive oligonucleotide 13.  A maximum of ten filters  were hybridized at once stacked up in a 150 X 10 mm of hybridization solution.  for 14-20 hr (at 55°C)  Petri plate with 16 ml  A plastic disc the size of the filter was placed on  top of the stack of filters to keep them immersed in the solution.  The filters  were washed in a large excess of 6 X SSC at room temperature with shaking for two 30 min intervals. for 10 min twice. with region  an  A high stringency  wash was performed at 55°C  The filters were exposed to X-ray film for 3 days at -70°C  intensifying screen.  corresponding  Agar  plugs  containing  plaques  from the  to a positively hybridizing plaque were picked  with  the wide end of a sterile Pasteur pipette into 0.5 ml of SM buffer with 5 u.1 of  CHCI3.  In order to isolate a single positive phage from the agar plug picked  in the high density screen, the phage were plated at a lower density such that single plaques were well separated.  The plaques on these plates were  transferred  the phage  radiolabeled  onto  nylon  probe.  membranes  and  DNA  hybridized  with  The positively hybridizing plaques were picked  with  the narrow end of a Pasteur pipette into 200 pi of SM buffer containing 5 pi of  CHCI3.  This procedure was repeated two to three times (secondary and  31  tertiary  screens)  to produce  unique  plaques  which  hybridized  the 13  probe. 2.  Screening a D. melanogaster A D.  XEMBL3  melanogaster (Leung,  unpublished).  genomic  library  genomic library was constructed using the vector  1988) from  The XEMBL3  an isogenic strain phage  were added  of Oregon  R  (GMT,  to 100 u.1 of 10  mM  MgCl2/CaCl2 and 100 pi of host Q358 and plated on NZYM plates with NZYM top agarose. in 0.01 M  A 20 ml stationary culture of the host was concentrated 5-fold MgS04 before use.  A total of 60,000 pfu from this library were  plated at a density of 10,000 pfu per 10 X 15 mm The  plaques  were  transferred  onto  membrane  standard sized Petri plate. filters,  hybridized and  washed as described above for the cDNA library. K. 1.  DNA  subcloning  Ligation of DNA into vectors The  described  DNA  was disgested with restriction enzymes under the conditions  by Maniatis (1982).  For subcloning, the plasmid  vector was  digested with the appropriate restriction enzymes and heated at 65°C for 10 min. 50°C.  Calf intestinal phosphatase (10U) was added and reacted for 30 min at The reaction was terminated by adjusting the reaction mixture to 1 X  STE (10 X STE= 0.1 M Tris-HCl (pH 8.0), 1 M NaCl, 10 mM volume and heating at 68°C for 15 min. with  The mixture was extracted twice  phenol/CHCl3 (1:1) and once with CHCI3 before the DNA  concentrated by EtOH precipitation. with  EDTA) in a 100 ul  appropriate restriction  100 ng of linearized  The DNA  enzymes, mixed  and dcphosphorylatcd  was  to be subcloned was digested in varying molar ratios  plasmid  DNA  and ligated  with in 50  32  mM Tris-HCl (pH 7.5), 10 mM  MgCl2, ImM DTT, and 0.8 mM ATP with 0.1 units  T4 DNA ligase/10 ul reaction volume al 15°C for 12-18 hr. 2.  Transformation of bacteria with DNA Recombinant plasmid or M13 R F DNA  that  were made competent  JM101/109 colony from 2YT until A600 resuspended  w a  was introduced into JM101/109  for transformation by the CaCl2 method.  a minimal  s 0.6-0.7.  A  glucose plate or culture was grown in  The cells were pelleted at 4000 g for 5 min and  in CaCl2 as described by Maniatis (1982).  Aliquots (300 ul) of  competent cells were incubated on ice with aliquots of the ligation  mixture  for 40 min. For plasmid transformation, the cells were heat shocked at 42°C for 3 min and plunged into ice; 0.7 ml of LB was added and the cells shaken for 1 hr at 37°C. ug/ml) with  Aliquots (0.1-0.3 ml) were plated on LB-Amp plates (100  50 p i Xgal (2%) and 10 u l IPTG  transformations, the cells  were  returned  to room  (100 mM).  For M13  temperature  after heat  shock; the cells were plated with 50 ul Xgal (2%), 10 pi IPTG (100 mM), 200 ul fresh exponential JM101/109, and 3 ml soft agarose (0.7% in 2YT at 55°C) on 2YT  plates.  (colonies  (a)  overnight  or plaques)  radiolabeled 3.  After  DNA  were  incubation picked  at 37°C,  individually  probe after transfer onto  white  transformants  or screened  with  a  nylon membranes.  Growth of transformants Small scale plasmid preparation Colonies containing plasmids were picked into 2 ml of LB-Amp or TB-  Amp  (100 ug/ml) and the bacteria  were  grown  to saturation.  M13  transformants were grown in 2 ml of 2YT containing 20 ul of an overnight minimal  glucose culture of JM 101 /l09.  M13 transformants were grown for  3 3  5-8 hr at 37°C.  Plasmid and RF DNA  method (Birnboim and Doly, 1979). glycerol  Part of the cultures were frozen in 15%  as stock and the supernatant  high titer phage or used in ssDNA (b)  were isolated by the alkaline lysis  from  M13  template preparations,  Large scale plasmid preparation TB-Amp  cultures (500 ml) were inoculated  and grown to saturation.  and each pellet was resuspended 8.0)/10 mM  vortexed  EDTA  with transformed  in 5 ml of 0.9% glucose/25 mM  containing 20 mg  and incubated at room  The supernatant was discarded  lysozyme.  temperature  lysed by addition of 10 ml of ice cold 0.2 M  was  The cells were  NaOH/1% SDS to each tube and The chromosomal DNA  precipitated by the addition of 7.5 ml of ice cold 5 M KOAc (5 M +  Tris-HCl  The suspension  for 5 min.  the tubes were placed on ice for 10 min.  K ),  E. coli  The cells were pelleted by centrifugation at 6000g  for 5 min in two 250 ml centrifuge tubes.  (pH  cultures were stored as  was  OAc , 3 M -  incubated on ice for 15 min, and pelleted by centrifugation at 4°C  (8000g  for 20  phenol/CHCl3  min).  The  supernatant  (1:1) and the DNA  was  extracted with  in the upper  precipitated with 0.6 volumes of isopropanol.  10  ml of  aqueous phase  The DNA  was  was pelleted by  centrifugation at 25°C (8000 g, 10 min). The pellet was rinsed several times with 95% EtOH and air dried brieOy. TE 8 and 200 ul of 250 mM  EDTA.  Each pellet was resuspended in 4 ml of Powdered CsCl (4.2 g) and 300 ul of 10  mg/ml EtBr was added and the solution vortexed to dissolve the CsCl. solutions  were incubated  centrifugation placed  into  on  ice for 15 min  (8000g, 10 min, 4°C). two  Beckman  quick  seal  and the RNA  The supernatant centrifuge  tubes.  was  The  pelleted by removed and  The tubes were  34  centrifuged in the VTi65 rotor (65,000 rpm, tubes were clamped on a retort stand and long wave uv lamp box.  solution and  plasmid DNA DNA TE  pellet was  8 hr).  The  bands visualized in a removed using a 1 ml  volumes of water was  added to  the EtBr removed by three butanol extractions.  precipitated with two volumes of 95% washed in 70%  absorbance at 260  The  EtOH at -20°C.  The  EtOH, dried and resuspended in 75-100 pi of band) and the DNA  concentration  nm.  Deletion subclones for sequence analysis The  DNA  fragment  M13mpl8/mpl9.  The  of  length  interest of the  progressive, controlled manner by The  Two  8 (depending on the size of the DNA  measured by 4.  was  the plasmid  The lower plasmid band was  syringe fitted with a 21 gauge needle. the DNA  4 hr; 60,000 rpm,  plasmid  DNA  was  was  DNA  subcloned fragment was  pUC13  decreased  In method I, the restriction enzyme A  digested  where exo  (figure 1).  III can  in a  in the multiple cloning site.  produces a 3'-overhang resistant to  Next, the clone was  cut at a second restriction  enzyme site (B), which lies between site A and the end of the DNA to be  or  use of exonuclease III (Henikoff, 1984).  cut at restriction site A  exo III digestion (figure 1).  into  Restriction enzyme B  fragment  produces a 5'-overhang  initiate digestion into the fragment of interest.  limitation of this method requires that the DNA  One  fragment to be degraded  must not contain any restriction sites for enzyme A or B. In method II, the restriction enzyme A is not resistant  resistant to exo to  ([aSjdNTP).  exo The  III digestion.  III digestion Sp  by  the  produces a 5' overhang, which  Therefore, addition  both ends were made  of  a-thionucleotides  diastcriomcr of the nucleoside  a-thiotriphosphates  35  Figure 1. fragment  Generating deletion subclones for sequence analysis. (open  subcloncd into M l 3  box) was  The plasmid DNA  was  cut at restriction site A  In method (A), the restriction resistant  or pUC  cn/.yme A  to ExoIII digestion.  in the multiple cloning site. a 3'-overhang which is  produces  cut with  a  second  a 5'-overhang, where ExoIII initiates  digestion  into the fragment.  In method  produces  a 5'-overhang, which  is not resistant to ExoIII digestion.  ends  are  made  resistant  phosphorothioate with  restriction  enzyme  B  vector  DNA  (solid  line).  separating the cut DNA appropriate  sequence  E.  digestion  by  the  size  coli.  analysis.  deleted DNA The  The  addition  then cut ExoIII  (open  box)  enzyme from  size of the deletions were estimated  were  religated  appropriate DNA  and  templates  a-  stopped at specific  cut with restriction fragment  A  Both of  a 5'-overhang where  by agarose gel electrophoresis. deletions  enzyme  The.DNA molecule was  produces  a fraction of the molecules  releases the partially  competent  which  (B), the restriction  In both methods ExoIII digestion was  which  the  ExoIII  nucleotides (dNTP[aSj).  digestion initiates. intervals and  to  DNA  vectors (solid line).  Next, the clone was  restriction enzyme B, which produces  The  C, the by  DNA  fractions with  used  to  transform  were prepared for  36  1. enzyme B 2. E x o I I I / S l n u c l e a s e 3. Klenow + 4 dNTPs  C  C  1. Klenow + dNTP[aS] 2. enzyme B 3. E x o I I I / S I n u c l e a s e 4. Klenow + 4 dNTPs  II  (Dr—  C  U  A  © r  c © r  r A  2.  enzyme C check s i z e o f d e l e t i o n on agarose gel  c  -4: 1. T4 U g a s e 2. T r a n s f o r m E . c o l l 3. P r e p a r e t e m p l a t e s DNA sequence  for  37  (which have a sulfur substituted for an oxygen at the a-phosphate)  can  act  as substrates for E. coli DNA polymerase 1; placement of an a-thionucleotide ([aS]dNTP) at one of the 3' ends of a DNA fragment blocks digestion by exo III from that end (Putney et al., 1981; Guo and Wu, 1982). enzyme B was used  as in the first  digestion was stopped at specific were cut with restriction DNA were  intervals.  In both methods, exo  III  A fraction of the molecules  enzyme C, which  releases the partially  deleted  fragment from the vector DNA (figure 1). The size of the deletions estimated  electrophoresis. transform DNA  method.  Again, restriction  by  separating  the fragments  by  agarose gel  DNA fractions with appropriate size deletions were used to  competent  E. coli.  The appropriate templates were prepared for  sequence analysis. In method I, the plasmid or RF DNA (30 ug) was digested with enzyme  A (eg. PstI) and then enzyme B (eg. BamHI).  The DNA was EtOH precipitated  and resuspended in 220 ul of exo III digestion buffer (10 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 1 mM DTT, 0.1 mg/ml BSA, 20 mM KC1) and prewarmed at 37°C for 5 min.  Exo III (300 units) was added to initiate the reaction and 20  pi aliquots were removed every 30 seconds for 5.5 min. The 20 ul aliquots were placed into 20 ul of 2 X SI nuclease buffer (0.4 M NaCl, 0.1 M NaOAc (pH 4.5), 2 mM ZnS04, 0.4% glycerol) which was sitting on ice.  SI nuclease (3-5  units) was added to each fraction and allowed to reacted at 37°C for 5 min. Each fraction was extracted with an equal volume of phenol/CHCl3 and EtOH precipitated overnight at -20°C. blunt  ends.  SI nuclease produces DNA molecules with  However, any imperfect  blunt  ends  were  made  flush by  treatment with 2 units of DNA polymerase I (Klenow) and 0.5 mM of each  38  dNTP for 30 min at room temperature in 20 pi of 50 mM enzyme buffer.  Each fraction was EtOH precipitated and resuspended in 10  pi of TE 8. A 3 pi aliquot  from each  fraction was cut with a restriction  enzyme C, which releases the partially deleted insert DNA DNA.  NaCl restriction  from the vector  The size of the deletions were estimated by separating the digested  DNA  in a 0.7% agarose gel.  The DNA  fractions with the appropriate size  deletions were ligated (1 pi of each) to form circular molecules and used to transform competent  JM109.  were picked and the DNA  Colonies or plaques from each transformation templates were prepared.  In method II, the DNA  (30 pg) was digested  precipitated, and redissolved  in 50 pi of 0-50 mM  and reacted with 0.5 mM  with enzyme  NaCl restriction buffer  of the appropriate [aS]dNTP  and 10 units of DNA  polymerase I (Klenow) at room temperature for 1 hr. was  extracted  precipitated. buffer  L.  DNA  1.  DNA  with  The DNA  appropriate  enzyme B.  (a)  once  and EtOH  molecules were redissolved in a restriction enzyme B  and  then  digested  with  restriction  The remaining steps were performed as described above. sequence  determination by  the Sanger  method  from  transformants  template preparation  Single-stranded DNA  templates  DNA  templates  M13  prepared essentially as described by Messing (1983). culture was  spun  for 5 min in a microfuge.  carefully removed and 0.3 ml of 20% PEG6000/2.5 M The  The reaction mixture  an equal volume of phenol/CHCl3  for enzyme  Single-stranded  M13  A, EtOH  were  A 1.2 ml aliquot of the The supernatant was NaCl was added to it.  phage were precipitated at room temperature for 15 min and pelleted  39  by  centrifugation  for  15  min  in  the  microfuge.  The  supernatant  was  discarded and the pellet was resuspended in 0.2 ml T E 8 and extracted twice with an equal volume of phenol/CHCl3 (1:1) being careful to leave all of the interface.  The aqueous layer was EtOH precipitated twice and redissolved in  50 pi of TE 8. (b)  Double-stranded DNA templates The  plasmid or Ml3 RF preparations were digested  u.g/u.1) at 37°C for 15 min.  The RNA was removed by precipitation with 0.6  volumes of 2.5 M NaCl/20% PEG6000. and  with RNase A (1  The sample was left on ice for 15 min  centrifuged for 10 min in a microfuge.  The supernatant was removed  and the pellet rinsed with 95% EtOH to remove all traces of PEG. was redissolved to an appropriate concentration and 2-10  The pellet  pg of DNA were  denatured in 0.2 N NaOH (40 pi total volume) for 5 min at room temperature. The solution was neutralized by the addition of 1/10 volume of 2 M  NH4OAC  (pH 4.5), precipitated with 2 volumes of 95% EtOH (at -20°C) and pelleted. The  DNA was stored in EtOH, dried and resuspended just before use (Chen  and  Seeburg, 1985).  2.  Use of Klenow polymerase DNA  sequence  was  determined  by  the  dideoxynucleotide  chain  termination method (Sanger et al., 1977).  Single-stranded DNA templates (5  pi)  of  were mixed with  1 pi  (4  pmoles)  primer  (forward  primer  5'-  TCACGACGTTGTAAAAC-3'; reverse primer 5'-CAGGAAACAGCTATGAC-3'; NS-1 5'-AGACCTTCACGGGCGTA-3'; NS-2 5'-CAGGGTGGACAGAGCT-3'; 13 5'-AA C/T TTIGTIGG A/G CA A/G TCICCIGTIGC-3') NaCl, 100 mM Tris-HCl (pH 7.5))  and 2 pi of annealing buffer (100 mM  The mixture was heated for 10 min at 65°C  40  and  allowed to cool  slowly to room  temperature.  Double-stranded  DNA  templates (2-10 ug) were redissolved in the same manner as for the ssDNA templates, except the primer was In both cases, 1 pi of 15 uM  annealed by heating at 37°C for 15 min.  dATP and 1.5 ul [a- P]dATP 32  were added to the template/primer mix  (3000 uCi/mmole)  and 2.2 pi of the final mixture  was  distributed to tubes containing 1.5 ul of each of the A.T.C.G deoxy/dideoxy mixes.  The following nucleotide mixes were used (Newton, 1984):  dG/ddG: 89 uM ddGTP, 7.9 uM dGTP, 158 uM  dTTP, 158 uM dCTP  dA/ddA: 116 uM ddATP, 111 uM dGTP, 111 uM dTTP, 111 uM dCTP dT/ddT: 547 uM ddTTP, 158 uM dGTP, 7.9 uM dTTP, 158 uM dCTP dC/ddC: 547 uM ddCTP, 158 uM dGTP, 158 uM dTTP, 10.5 uM dCTP The reaction was initiated by the addition of 1 ul of DNA  polymerase I  Klenow fragment  (0.5 units/ul in 80 mM  potassium phosphate (pH 7.5), 0.8  mg/ml BSA,  glycerol, 10 mM  The four tubes were incubated at  40%  DTT).  37-55°C for 15 min and then chased by the addition of 1 ul of dNTP (0.5 to each tube followed by another 15 min  incubation.  terminated by adding 5 ul of formamide/dye mix 10 mM  EDTA, 0.2%  were heated denaturing 3.  for 3  bromophenol blue and min  at 90-100°C,  (98% deionized formamide,  xylene cyanol).  plunged  on  The  ice and  samples  loaded onto  polymerase (Sequenase™)  S e q u e n a s e ™ (modified T7 determination (Tabor and  (7 ul) was  reactions were  polyacrylamide gels.  Use of modified T7 DNA  sequence  The  mM)  annealed to 1 ul (0.5  DNA  polymerase)  Richardson, 1987).  was The  also  used for  DNA  template  pmole) of primer (forward primer 5'-  GTAAAACGACGGCCAGT) in 2 ul of 5 X sequencing buffer (5 X buffer= 200  mM  41  Tris-HCl (pH 7.5), 50 mM for 2 min  and  MgCl2, 250 mM  NaCl). The tube was warmed to 65°C  allowed to cool to room temperature  slowly.  Two  p i of  labeling mix (1.5 uM dGTP, 1.5 pM dCTP, 1.5 pM dTTP), 1 pi 0.1 M DTT, 0.5 pi [a35  S ] d A T P or [ a- P]dATP (10  TE  32  8) was  pCi/ul), and 2 pi Sequenase™ (diluted 1:8 in  added to the template/primer mixture and incubated for 5 min at  room temperature.  The  each  pre-warmed  tube)  to  4  template/primer mixture was tubes  containing  distributed (3.5 pi to  2.5  p i of each of the  following: G: 80 uM dGTP, 80 uM dATP, 80 pM dCTP, 80 pM dTTP, 8 uM ddGTP A: 80 u.M dGTP, 80 pM dATP, 80 pM dCTP, 80 pM dTTP, 8 pM ddATP T: 80 uM dGTP, 80 pM dATP, 80 pM dCTP, 80 pM dTTP, 8 uM ddTTP C: 80 pM dGTP, 80 pM dATP, 80 uM dCTP, 80 pM dTTP, 8 pM ddCTP The  tubes were incubated for 5 min  the reaction  was  terminated by the addition of 4 pi of stop solution (95% formamide, 20  mM  EDTA, 0.05%  bromophenol blue, 0.05%  at 37°C and  xylene cyanol FF).  The samples were  heated to 75-80°C for 2 min and loaded onto the gel immediately. 4.  Orientation of Ml3 clones  (a)  Hybridization with oligonucleotide probes Ml3  gel. The  The  ssDNA templates (2 pi aliquot) were separated on an agarose miniDNA  was  membrane was  which the DNA  transferred to a membrane by the method of Southern. hybridized  with labelled  oligonucleotides to determine  templates were of the coding or non-coding  strand.  Alternatively,  in the gel was denatured for 10 min in 0.15 M NaCl/0.5 M  the gel neutralized for 10 min in 0.15 M  NaCl/1.0 M  NaOH and  Tris-HCl (pH 7.5).  The  42  gel was placed on a glass plate, dried on a hot plate, and used directly for hybridization (b)  the labelled oligonucleotides,  T-track analysis The  To  with  orientation of the clones was also determined by T-track analysis.  determine the orientation of 15 ssDNA templates, 4 pi  (A260= 1). 8 pi 10 X Hin buffer (100 mM  NaCl, 100 mM  12 pi distilled water were mixed together.  of forward primer  Tris-HCl (pH 7.5)) and  The primer mixture (1.2 pi) was  mixed with 0.8 pi of the ssDNA template and the primer was annealed to the template by heating at 65°C for 10 min. To each sample, 1.7 pi of dT/ddT mix (5 pi [a- P]dATP (10 pCi/pl), 1 pi 60 pM dATP, and 30 pi of 547 pM 32  pM  dGTP/7.9 pM dTTP/158 pM  dCTP) were added.  ddTTP/158  Klenow polymerase (0.24  units) was added to each tube and reacted at room temperature for 15 min. The  reactions were chased with 1 pi of 0.5 mM  temperature.  The  formamide/dye  mix  reactions and  were  loaded  terminated  onto  dNTP for 15 min at room by  addition  a denaturing  of 5  p i of  polyacrylamide gel  immediately. M.  P  element  1.  Preparing The  of Drosophila  transformation  the P element transformation  restriction  fragment  containing  by  microinjection  vectors the Sod  gene was isolated and  ligated into the multiple cloning site of the P element plasmid pUChsneo to form  pneoSOD.  transposon  The supercoiled  (pneoSOD) and helper  (see section K. 3 (b)).  plasmids consisting of the recombinant (phsTt)  were purified on a CsCl  gradient  The DNAs to be injected, (pneoSOD and phsji)), were  coprecipitated in EtOH, washed in 70% ElOH/0.2 M NaCl, and washed again in 70% EtOH.  The pellets were redissolved in 50 p i microinjection  buffer  (5  43  mM  sodium phosphate (pH 6.8) which had been passed through  KC1, 0.1 mM  a 0.45  urn filter) and centrifuged in a microfuge for 10 min.  aliquot was needle.  removed from  the  surface of the  A  5-10 pi  solution for loading into the  The concentrations of transposon and helper DNAs were 250 ug/ml  and 50 ug/ml, respectively and then changed to 500  ug/ml and 100 ug/ml,  respectively. 2.  Preparing the D r o s o p h i l a The  isogenic  Oregon  approximately a thousand  for egg lays and collecting staged embryos R  host strain  was  multiplied  until  there were  flies of the same age (5-8 days old).  Young flies  (approximately 400 flies of both sexes) of the same age (within 1 day) were placed in an empty bottle. collection plate (60 X  The lop of the bottle was  15 mm  Petri plate) which was  lightly covered in a thick yeast paste. yeast powder with a solution of 2% communication).  The  covered with an egg  filled with 1%  The yeast paste was made by mixing HOAc/5% EtOH (Hugh Brock, personal  plates were air-dried  slightly  so that the  would not adhere to the paste while laying their eggs. placed in the dark for a 2-3 hr pre-lay period.  The  staged  collection  plates every  during the time  embryos  During this period, embryos  hour.  increase their egg moved  45  min.  at 25°C  by  such  In order to maximize  thai maximal egg  Alternatively, the production.  into the microinjection  To  flies  were  laying fed  egg  would with  the  egg  production  be  set on a  occur at a  live  harvest the eggs, the egg  chamber (18°C  Thereafter,  changing  set for the microinjections, the adults may  reverse day/night cycle convienent  were collected  females  bottles were  of different ages appear due to the females holding their eggs. uniformly  agar and  yeast to  plates were  with 50-70% humidity) and  44  the embryos rinsed off the agar plate with distilled water.  The eggs where  collected on a piece of Nilex screen (0.7 x 0.7 cm ) placed inside a small 2  Buchner funnel. completely  The eggs were rinsed with water until the yeast paste was  removed.  To enable penetration of the needle into the embryo,  the outer chorion of the eggs was removed by a brief rinse in 5 0 % bleach ( 3 % NaOCl), followed by repeated rinsing with distilled water (Hill, 1945). All  manipulations  development. and  placed  were  performed  The Nitex  at 18°C to slow  screen was lifted  on a microscope  slide.  up with  and were mounted onto  for  With  microinjection.  microinjection scope.  another  the embryos  by viewing  them  with a  slide in preparation  that  are too old  through  for  the dissecting  piece of double stick tape stuck to a microscope slide.  Pulling and filling microinjection needles Glass  capillaries  with a 100 um with  be excluded  were viewed  The embryos were all mounted, ten at a time, anterior to posterior  onto a 1 mm 3.  may  practice,  embryonic  watchmakers forceps  The embryos  dissecting microscope  down  (0D/1D=1.0/0.58 mm,  World  Precision  Instruments)  glass filament fused to the inside of the barrel, were pulled  a horizontal  electric  needle  puller  (Ultrafine  Frederick Haer and Co.) to a point of less than 1 um Dept.).  Micropipette Puller,  (pulled courtesy of Dr.  Peter Vaughan, UBC  Physiology  The needle  must  be abruptly  tapered at first, then  with a finer taper towards the point such  that the  point will be strong enough to pierce the embryo but not tear a hole that is too large. The dimensions of the needle arc critical and must be obtained by experimentation.  The micromanipulator  and microscope  (Leitz  Laborlux  12) were placed on a concrete slab inside the microinjection chamber at  45  18°C  with  50-70%  humidity.  micromanipulator and viewed  The  needle  under the  was  mounted  needle  tip  on  the  edge  of  the  10 X lens (100 X magnification).  The needle was broken to a 2 pm diameter (optimal diameter) the  onto  a glass  coverslip.  by touching  For the  remaining  manipulations, the needle should never be moved without being viewed in focus,  because  breakage. DNA  touching  the  needle  lip  on  any  surface  will  result  in  The needle was filled by lowering the tip into a 5-10 pi drop of  placed on a piece  of  Parafilm.  Front  filling of  the  needle  was  accomplished by continuous suction from a 50 ml syringe for 20-60 min, depending  on  the  diameter  of  the  tip  and the  strength  of  the  suction  obtained.  The needle was immersed into a pool of halocarbon oil whenever  it was not in use, since evaporation of the DNA solution would clog the tip. 4.  Microinjection of Drosophila  embryos  A piece of double sided sticky tape (1 mm width) was placed vertically on  a microscope slide and 10 dechorionated eggs were aligned anterior to  posterior  on  the  microscope (10-30  tape.  The embryos  X magnification)  were  viewed  under  a  dissecting  and manipulated with an insect needle  or a fine paint brush.  The embryos must be securely placed on the tape  and  horizontally,  aligned  perfectly  penetrate the embryo.  The eggs were dessicated  dish of Drierite for 5-10 min. mounted  later  required much  rapidly even in 50-70% empirically  determined  Drierite, the dessicated  otherwise  the  needle  would  not  by placing the slide in a  Eggs from the same collection that were less  humidity. as  the  dessication.  The embryos  dessicated  The correct degree of dessication  injections  proceeded.  eggs were covered  After  was  incubation in  in halocarbon oil (Series 7 0 0 ,  46  Halocarbon correct  products).  The window  age for microinjection  of time in which  is very  small.  passed the preblastoderm embryo stage (1.5 bubbles  near  dissecting microscope.  Embryos that had clearly  hr at 25°C) were discarded.  the posterior end of the embryos  needle  before  The  magnification.  placing  the slide  (150  embryos  450  X  embryos are the  on  um)  were  dislodged  an  inverted  were  viewed  Air  with a  compound at 100  X  The ideal embryos for microinjection were those that have  a clear polar pocket at their posterior pole. positioned, using  The DNA-filled  needle was  the micromanipulator dials, at the posterior end of the  embryo such that it was aligned with the midplane of the embryo. very difficult for the needle to penetrate  using  micromanipulator  the embryo if it is aligned above  The embryo was pierced with the needle (250  or below the midplane. magnification)  It is  the  microscope  controls, such  yolk, but past the polar pocket.  that  stage  controls  the needle  The DNA  rather  penetrated  than  X the  just into the  was expelled into the embryo  (1-  5% of embryo volume) until a slight stirring of the yolk contents was seen (Karess,  1985;  Rubin  et al., 1986).  Over  injection resulted in massive  disruption of the yolk contents, resulting in death of the embryo. that were over dessicated  collapsed  resulting in death of the embryo. were  mounted  were  successfully  Embryos  upon penetration  by the needle, also  Approximately 70%  of the embryos that  injected.  The  injected embryos  were  allowed to develop in the humid 18°C chamber, inside a Petri plate lined with  wet  filter  paper.  The  embryos which  survived  the injection and  hatched as first instar larvae were placed in a vial of food (30  or less per  vial).  Frequent checks for hatched larvae were required as they tended to  crawl out of the halocarbon oil, resulting in their dessication and death. 5.  Culturing the injected GO adults The first instar larvae that hatched were allowed to develop at 18°C for  2  days and  were then moved  dechorionated which  have  and not  development from  to 25°C.  microinjected been  The  embryos which have been  developed  manipulated.  slower  than  Therefore, the  the  time  embryos  required  for  the embryo to the adult fly at 25°C required 3-4 weeks  rather than the normal 1-2 weeks at 25°C (figure 2). The mated  to  standard monitored transferred  GO  adults that eclosed were collected as virgins and individually  10  isogenic  Oregon  Drosophila every  day.  to food  Pirrotta, 1985).  food.  wt  adults  fertile  supplemented  parents  with  The concentration of G418  required was  in separate vials containing  After the third  The  was determined for every new G418  R  the  which  with G418  GO  production  produced  antibiotic  G418  that was lethal to wt  batch of food that was prepared.  approximately 0.8  mg/ml.  (Steller  were and  Drosophila, The dose of  G418.  females were allowed to lay their eggs on food  for a total of 9 days.  eggs  was  Subsequent analyses showed  that no false transformants survived this dose of The  day, egg  supplemented  Every third day the adults were removed and  the embryos and larvae in the food given a heat shock (37°C, 30 min) to increase the transcription of  the GO  of the neomycin  adults were given a heat shock  pupated (3-4 weeks later al 25°C).  resistance gene.  The  progeny  every 3 days until the larvae  A few drops of water was added daily to  the food in each vial to compensate for loss of moisture.  48  Figure 2.  The Drosophila  microinjected  with DNA.  life cycle.  Embryos were dechorionated and  The eggs which developed into first instar larvae  were collected and allowed 10 develop into adults.  There are four distinct  stages in the life cycle of Drosophila::  egg,  25°C, a fresh culture will produce new  adults in about 2 weeks with eight  larva, pupa, and adult.  days in the egg and larval stages, and six days in the pupal stages.  At 20-  Egg Dechorloneted Embryo Injection Needle  First instar larva  sr  Second instar larva  50  The  Gl  putative injected  adults which developed  transformants GO  the  adults were mated  heterozygous 6.  carrying  for the transposon  from  individual  mated to wt (+/+)  pneoSOD  to wt  transposon.  flies, the G l  were  Since  the  transformants were  (p|neoSOD]/+) (figure 3).  Creating transformed Drosophila Each  the food containing G418  lines  transformed  Gl  adult  (p[neoSOD]/+) was  flies to create a transformed line (figure 4).  transformants were mated to 10-20  initially Male G l  wt virgin females and the females were  allowed to lay eggs on food containing G418.  The progeny of the G l adults  were given a heat shock every 2-3 days as described above.  One  male G l  transformant  G2  progeny  may  (p[neoSOD]/+).  produce  only  1-10  transformed  Female G l transformants were mated to 3-5  these adults moved to food containing G418. produce only 1-5 transformed G2  A  wt males and  single female would usually  progeny (p[neoSOD]/+).  were then mated again to wt flics and this cycle was  The  G2  progeny  repeated several times  (3-4 weeks per cycle) to increase the population of each transformed line (figure 4a).  Alternatively, the G l transformants that were mated to wt flies  were allowed to lay eggs on food without G418 and  wt  flies  were produced  numbers of G2  more  faster  G418  (figure  but  The  greatly increased  4b).  This procedure required more vials of food and  produced The  homozygous or heterozygous 7.  (p[neoSOD]/+, +/+).  progeny were mated together and then allowed to lay eggs  on food containing G418. used  such that both transformed  a  resulting  larger line  population of transformed was  a  for the transposon.  Creating lines homozygous for the inserted gene  mixture  of flies  flies either  51  Figure 3. from  Culturing the injected GO adults.  the microinjected  embryos were collected as virgins and individually  mated to isogenic wt adults. G418.  G418  The progeny of the GO adults were selected on  Only the G l adults which  would survive on G418. resistant G l  (p[neoSOD]/+). transformed  Each  lines.  The GO adults which developed  have the inserted p[neoSOD] transposon  Since the injected GO adults were mated to wt, the  adults  would  of these G l  be  heterozygous  adults were used  for the transposon to form individual  52  GENERATION microinject embryo with. p[neoSOD]and phslT  GO EMBRYO  GO FIRST INSTAR L A R V A  3-4 veeks at 25 °C  GO ADULTS  plneoSOD] ?  or  .  +  —  <^  +  X  —  +  +  select progeny on G-418 (3-4 -veeks)  G1 ADULTS  plneoSOD] + survives on G418  FORM INDIVIDUAL TRANSFORMED LINES  +• '  T dies on G418  ??  or  53  Figure 4. Gl  Propagating the transformed  adult  (p[neoSOD]/+) was  transformed  line.  heterozygous resultant G2 repeated. contained  The  lines.  initially  progeny  for the transposon  mated  were  Each individual transformed to wt  selected  (+/+)  on  (p[neoSOD]/+).  to create a  G418  In  and  scheme  were  (a), the  progeny were mated to wt adults and the selection on G418 This cycle  only  was  repeated  adults heterozygous  to produce transformed for the transposon.  lines  which  Alternatively, in  scheme (b) the progeny of the G l adults were not selected on G418. greatly  increased numbers  progeny  were  selected  numbers  of G418  on  resistant had  of G2  adults were  G418. progeny.  contained  This  interbred  resulted  This cycle flies  which  and then  The their  in greatly increased was  were  repeated  to form  transformed  lines  homozygous  heterozygous  for the transposon (p[neoSOD]/p[neoSOD]; p[neoSOD]/+).  and  54  (a)  plneoSOD] +  (Gl adult)  +  X  +  select progeny on G418 4r food (3 weeks)  plneoSOD]  X  repeat cycle to form, transformed lines  select progeny on G418 food (3 weeks)  plneoSOD]  (b)  plneoSOD] <G1 adult)  plneoSOD] repeat cycle to form transformed lines  +  x  ^  regular food  and interbreed adults select on G418 food  plneoSOD] plneoSOD]  and  plneoSOD]  55 Homozygous  transformed  lines  were  produced  by  conventional  genetic crosses using the 2;3 balancer stock Cy0,TM2,l/£;t/T(2,3)ap Peter  Davies,  chromosomes balancer  with  the  University) (Lindsley inserted  chromosomes.  transposon required  Queen's  without to  the  created  and  transposon  were  enabled  stable  This continuous  transformed  use  Grell,  lines  1968).  placed  The  homozygous  The  over  marked  maintenance  of G418.  (from  Xa  of  genetic crosses  for  a  transposon  inserted on the second or third chromosome are shown (figure 5,6). homozygous transformed from  the  background  isogenic  lines have the X,  stock.  Therefore,  as the isogenic  stock except  second they  and  have  for the Y  the  These  third chromosome the  same  genetic  chromosome, which  comes from the double balancer stock ( Y ) . B  N.  Gene localization by  1.  Labelling an RNA The DNA  in  situ  hybridization  transcript with Iodine-125  was used to make RNA  labelled with [  125  I ] 5-ICTP  (5-iodoCTP)  by in vitro transcription of XEMBL3 recombinant  phage DNA  polymerase  The phage DNA  was treated  (1 ug/ul), extracted twice with phenol/CHCl3,  precipitated  in the presence of [  with RNase A  1 2 5  I ] 5-ICTP.  with 0.6 volumes of 20% PEG6000/2.5 M  NaCl and resuspended in TE 8.  transcription reaction consisted of 5 ug of phage DNA ICTP in 40 mM  Tris-HCl (pH 7.5), 10 mM  UTP, and 5 units of E. coli RNA  by E. coli  DTT, 10 mM  polymerase.  The  and 80 uCi [ ^I] 512  MgCl2, 20 uM  The reaction was  ATP,  (pH 7.8), 100 ug E. coli tRNA) for 20 min at room temperature.  GTP,  incubated at  37°C for 2 hr followed by DNase I treatment (10 ug DNase I, 40 mM  mixture was  RNA  Tris-HCl  The reaction  extracted once with phenol/CHCl3 and three times with  CHCI3  56  Figure  5.  Creating  homozygous  inserted in the second chromosome.  transformed  for each cross.  transposon, p[SOD],  the next cross. wt  females  progeny  (2)  Xa  and ultrabilhorax (Ubx)  the second  saved  progeny  raised on food without G418.  which  (CyO  chromosome.  All the possible  were G418  resistant  (3) To form a balanced stock, the males and  females  balancers  The  males were saved for  The males and females which  with curly wings were saved. from  progeny are listed.  Males from the previous cross were mated to isogenic  with p[SOD] on  are shown.  chromosome  CyO,TM2,[/6;t/T(2,3)Ap .  All the possible (a) curly and (b) apterous winged resistant, curly winged  (1) Isogenic wt  on the second  were mated to males from the 2,3 balancer stock,  G418  for a transposon  The genotype of the first (X or Y),  second and third chromosomes arc listed females with the inserted  lines  the previous cross  were  mated  The second and third  and TM2) are homozygous lethal.  is homozygous for pfSOD],  together and their chromosome  (4) To create a stock  males and females with straight wings  (p[SOD]/p[SOD]) and wl for the third chromosome were collected as virgins from the balanced stock and mated together.  These  genetic crosses were  used to produce transformed lines that were homozygous for p[SOD]. lines have the same genetic background  These  as the wt isogenic stock except for  the Y chromosome which comes from the 2,3 double balancer stock ( Y ) . B  57  1,  .B  + . p[SOD] . + + ' + ' +  Y^'  9 ; insert on 2nd chromosome (a) \  +  a"  ± + B  T(2,3) ap**  TM21(Ubx)  CyO  plSDDl \  o r  G418"  +  Ubx  G418*  dies  (b)  curly  p[SOD]; + O  R  "Y~B  or  T(2,3) ap**  T(2,3) apX a  G418 ;  G418  apterous vings  dies  R  Save :  2.  + . CyO . TM2(Ubx) Y B ' p[SOD] ' +  +  •  Y '  CyO . TM2(Ubx)  S  p  male; curly; G418*  + . p[SOD] . +  x  plsoDj' —+  5  (from above)  $ ; insert on 2nd chromosome  select on G418  +  Y  b  ' plSODJ G418  R  curly vings  Save:  TM2 (Ubx)  select on G418 (3-4 vks)  CyO  + or - B  - B  CyO;  +  + G418  [S0D] p[SOD]  P  S  dies  .  CyO . TM2(Ubx)  +  .  CyO . TM2 (Ubx)  +  ' p[SOD] '  > pisbD] '  T  +  G418  R  straight vings  + G418  '  + Ubx  R  straight wings  , , • „ male; curly; Ubx; G418 x<  o  R  R  R  female; curly; Ubx; G418  58 3. To form a balanced stock: + Y  • CyO . TM2 (Ubx) ' p[SOD] ' +  5  + 7  X  TM2 (Ubx) . CyO . TM2 ' p[SOD] ' +  regular food (2-3 wks) V  + — or + <j>  +  n  cr  1  "  CyO  —  i  —  ' CyO ilethal Ptv,«i  or  CyO  p[SOD] TM2 (Ubx) TM2 (Ubx) * * or p[SOD] p[SOD] ' TM2 (Ubx) + curlv lethal Ubx curly straight vings vings —  L  —  nr  + or — + vt  To maintain a balanced stock, interbreed all surviving progeny from this cross  4. To create a stock homozygous for a transposon inserted on the second chromosome: + +  . p[SOD] . + ' p[SOD] ' +  + Y  A  5  . p[SOD] . + ' p[SOD] ' +  regular food  + +  . p[SOD] . + ' p[SOD] ' +  a n < 1  + Y  5  . p[SOD] . + ' p[SOD] ' +  This stock has a genetic background identical to the original isogenic stock except for the males, where the Y chromosome comes from the balancer stock (Y ), B  59  Figure  6.  Creating  homozygous  inserted in the third chromosome.  transformed  lines  for a transposon  The relevant genotype of the first (X or  Y), second and third chromosomes are listed for each cross. females with the inserted  transposon, p[SOD],  were mated to males from the 2,3 balancer stock  (1) Isogenic wt  on the third  chromosome  CyO,TM2,£/6;t/T(2,3)Ap . Xa  All the possible (a) curly and (b) apterous winged progeny are listed. G418  resistant, curly winged  the next cross.  and ultrabithorax (Ubx)  The  males were saved for  (2) Males from the previous cross were mated to isogenic  wt females with p[SOD] on the third chromosome.  All the possible progeny Ubx  are shown.  The males and females which were G418 resistant with  were saved.  (3) To form a balanced slock, the males and females saved from  the previous cross were mated logcther and their progeny without G418.  raised on food  The second and third chromosome balancers (CyO and TM2)  are homozygous lethal.  (4) To create a stock which  p[SOD], males and females with no Ubx  is homozygous for  (p[SOD]/p[SOD]) and wt for the  second chromosome were collected as virgins from the balanced stock and mated together.  These  genelic crosses were used to produce transformed  lines that were homozygous for p[SOD]. genetic background  These lines would have the same  as the wt isogenic slock except for the Y chromosome  which comes from the 2,3 double balancer stock ( Y ) . B  60  1. + . + . p[SOD] ' + ' + ' +  (a)  + + -B or -  + . CyO; TM2 (Ubx) Y * T(2,3) ap** ap B  x  5  CyO . TM2 (Ubx) + ' p[SOD]  B  curly vings 00  .  +  +  G418 Ubx  R ;  +; piSOD] T(2,3) ap**  or  T(2,3) apXa  G418 resistant; apterous vings  G418 ; dies  R  Save:  i B  2.  . '  +  '  S  CyO . TM2(Ubx) + ' p[SOD]  CyO . TM2 (Ubx) + » p[SOD]  i e ; curly; G418 ultrabithorax  R  ma  + • . + . PiSOD] + * + ' +  X  select on G418 (3-4 vks) + + ~B or -  CyO . TM2(Ubx) + ' +  B  o  TM2(Ubx) p[SOD]  r  G418 Ubx  J  G418' dies Save: Y  + +  B  CyO . TM2(Ubx) + ' p[SOD] C  y ° • TM2 (Ubx) + ' p[SOD]  m a  i  e ;  o  r  p[SOD] p[SOD]  o  G418~ no Ubx  curly; Ubx; G418  R  female; curly; Ubx; G418  R  r  p[SOD] + G418 no Ubx J  61  3. To form a balanced stock: + Y  B  . '  CyO . TM2 (Ubx) + ' p[SOD]  CyO . TM2 (Ubx) . Cv ' p[SOD] ' +  + +  r e g u l a r food (no G418)  v +  + B or ~ B  +  CyO CyO + . TM2 (Ubx) CyO ° + ° + ' p[SOD] r  r  lethal curly  vt  Ubx  o r  TM2 . p[SOD] TM2 ' p(SOD] lethal  no Ubx  To maintain a balanced stock, interbreed all surviving progeny from this cross  4.  To create a stock homozygous for a transposon inserted on the third chromosome: + . + . p[SOD] + ' + 'p[SOD]  + Y  X  5  . + . pISOD] ' + ' p[SOD]  r e g u l a r food  + . + . p[SOD] + ' + 'p[SODJ  a  n  d  Y  5  * + ' p[SOD]  This stock has a genetic background identical to the original isogenic stock except for the males, where the Y chromosome comes from the balancer stock (Y^).  62  before  removal of the unincorporated  (0.196 cm  X 20 cm).  2  EDTA, 0.01%  SDS.  label on  a Sephadex G-25  The column buffer was 0.3 M  The labelled RNA  column  NaOAc (pH 7.2), 50  pM  probes were collected, precipitated by  2.5 volumes of EtOH and redissolved in 0.06 M KH2PO4, 0.06 M K2HPO4, 5 EDTA, 4 mM 2.  KOH, 0.5 M K G  Labelling the DNA The  1981)  DNA  by  mM  and 70% formamide.  probe with biotin  probes  were labelled with  nick-translation  (Rigby  consisted of 1 pg of plasmid DNA,  Biotin-11-dUTP  el al., 1977). 12 pM  The  (Langer  et al.,  reaction  Bio-11-dUTP, 30 pM  mixture  dCTP, dGTP,  dATP, 2 pCi [a- P] dATP (optional tracer), 1 pg BSA, 2.5 ng DNase I (titrated 32  for each  probe), 50  mercaptoethanol, and et al., 1986).  mM  Tris-HCl  10 units DNA  The reaction was  (pH  The  10 mM  of  the  incorporating counter.  biotin-labelled  the  The  corresponding radioactive  [ P]  tracer.  elution  volume  32  volume  tracer  precipitated and  E.  EDTA (pH 8.0) and 50 pg of removed on  was  was  EDTA, 0.2 M DNA  a 0.196  cm  E.  coli  X 18 cm  2  of  used  omitted.  redissolved  coli  tRNA and 5%  was  NaCl and 0.1%  determined  This fraction was each in  probe  The  by  the  recorded  reactions  biotin-labelled DNA  The  fraction a Geiger and  the  where  the  was  EtOH  formamide (deionized), 0.6  Tris-HCl (pH 7.5), 1 mM  dcxtran sulfate.  SDS.  detected by  was  subsequent  in 75 pi of 50%  NaCl, 10 X Denhardt's reagent, 10 mM mg/ml  B-  54 gel (Fischer Scientific) filtration column equilibrated with  Tris-HCl (pH 7.5), 0.25 mM  elution  MgCl2, 10 mM  incubated at 16°C for 1.5 hr and stopped by  unincorporated label was  Ultragel AcA  mM  polymerase I in a 50 pi volume (Rubin  the addition of an equal volume of 50 mM tRNA.  7.4), 5  An  M  EDTA, 0.5  aliquot of the probe  was  63  removed and boiled for 3 min before use.  The remainder of the probe was  stored at -20°C and was used over a period of several months. 3. In situ (a)  hybridization  Preparation of the chromosome The  (Gall  chromosome  and Pardue,  squashes  squashes  were  1971; Shizu  prepared  Hayashi,  essentially  personal communication)  larvae grown at 18°C in non-crowded cultures (4 weeks). instar larvae were collected (0.021%  as described from  Climbing third  and placed in pools of Drosophila  saline  CaCl2, 0.035% KC1, 0.75% NaCl) (Ephrussi and Beadle, 1936) and  separated  into  microscope  male  using  and female  illumination  larvae  from  with  below.  the aid of a dissecting The salivary  glands  were  dissected using fine forceps and the fat bodies were trimmed off the glands as cleanly as possible. acetic  acid  chromosome  The dissected glands were placed into a drop of 4 5 %  for 2-4 min and then arms  were  spread  covered  by gentle  with  a cover  slip.  tapping of the cover  The slip.  Excessive tapping shattered the chromosomes so that they were no longer visible. The squash was flattened by placing the slide between paper towels and pressing down on the cover slip very hard with the thumb.  The slides  were placed on a flat piece of dry ice for 5 min and the coverslip was flipped  off the slide  (without  removing  the squash).  were dehydrated in 95% EtOH (3 X 10 min) and air dried.  The preparations Finally, the slides  were heated at 70°C for 30 min in 2 X SSC, dehydrated in 7 0 % EtOH (2 X 10 min) and then in 95% EtOH for 5 min. point.  The slides may be stored dry at this  Slides with optimal chromosome spreading were selected for in situ  hybridization.  64  (b) Preparation of the slides The  for hybridization  squashed chromosomes  were treated  with RNase  A  (100  X SSC) for 30 min at 37°C, rinsed three times in 2 X SSC (10  chromosomes  anhydride  room  squashes  of the probe  plunging  200  into  were  acetylated  (Hayashi  ml  of 0.1  to  each) and  for 15 min dehydrated  decrease  et al., 1978) by M  and then  through  the  ejecting  triethanolamine (pH  the slides in with vigorous mixing.  temperature  min  min each) and  in EtOH ( 7 0 % EtOH, twice for 10 min; 9 5 % EtOH, 5 min).  dehydrated  binding  ug/ml in 2  The  non-specific  0.5  ml  8.0) and  of acetic  immediately  The slides were incubated at  rinsed  three times in 2 X  the series  of E t O H  washes  S S C (10 (described  above). (c)  Hybridization The  [  125  and signal  l ] - l a b e l l e d RNA  detection probes  were  hybridized  to the chromosomes KH2PO4, 60  on the slides for 16 hr at 45°C in 7 0 % formamide, 60 mM K2HPO4, 5 mM  EDTA, 4 mM  moist  lined  chamber  filter  and 0.5 M KC1. paper  soaked  The slides were incubated in a with  the same  temperature  (4 times  series of E t O H  for 10  min).  into a light-tight box.  They were developed  were  and  stained  the chromosomes  washes  washed again.  in distilled  dehydrated for 5-6  through min  water, and dehydrated  at different  of E t O H  toluidine  through  (Ilford  After the film  the series  in 0.4%  at room  through the  with photographic emulsion  times (3 days to 2 weeks) to obtain an optimal exposure. processed, the slides  SSC  The slides were dehydrated  washes, air dried, coated  and packaged  SSC),  hybridization  The unbound probe was removed by washing in 2 X  solution.  K2),  with  KOH  mM  was  washes  blue (in 2  X  the series of EtOH  65  The biotinylated DNA  probes were hybridized to the chromosomes for  16 hr at 37°C in 50% formamide, 0.6 M NaCl and 10 mM The  slides  solution. SSC.  were  incubated in a moist  chamber  Tris-HCl (pH 7.5).  containing  with  same  The covcrslips were removed by briefly rinsing the slides in 2 X  The unbound probe was removed by washing at 50°C in 2 X SSC (three  times for 10 min) and then at room temperature (twice for 10 min).  The  slides were prepared for colour development  Tris-  HCl (pH 7.5) and 0.15 M NaCl for 10 min.  by incubating in 0.1 M  The slides were then incubated in  3% BSA, 0.1 M Tris-HCl (pH 7.5) and 0.15 M NaCl for 20 min at 42°C. The slides were moved from 42°C  to room temperature and allowed to sit an  additional  Brock,  10  min  streptavidin-alkaline mg/ml  SA-AP  (Hugh  phosphatase  in 3 M  NaCl,  personal  conjugate 1 mM  communication).  (SA-AP) stock  MgCl2, 0.1 mM  The  solution (1.0  ZnCl2, 30  mM  triethanolamine (pH 7.6)) was diluted 1/1000 in 0.1 M Tris-HCl (pH 7.5) and 0.15 M  NaCl.  The solution was gently mixed and 80 u l were placed on the  squash, covered with a 22 X 22 mm temperature for 15 min.  cover slip and allowed to react at room  The unbound SA-AP conjugate was removed by  washing in 0.1 M Tris-HCl (pH 7.5) and 0.15 M NaCl for two 3 min periods. The  slides were then prepared for color development  in 0.1 M Tris-HCl (pH 9.5), 0.1 M NaCl and 50 mM periods.  Nitroblue  tetrazolium  (NBT)  by incubating them MgCl2 for two 3 min  and  5-bromo-4-chloro-3-  indolylphosphate (BCIP) were diluted by gently mixing 4.4 ul of 75 mg/ml NBT  (in 7 0 %  formamide)  and  3.3  u l of 50  mg/ml  BCIP (in  dimethylformamide) into 1.0 ml of 0.1 M Tris-HCl (pH 9.5), 0.1 M NaCl and 50 mM  MgCl2-  The slides were removed from the buffer sequentially and 80 ul  66  of diluted NBT/BCIP solution was covered with a 22 X 22 mm dark  for signal  periodically  placed on each squash.  was  never  The  allowed  stopped by washing the slides in 20 mM The  signal  development  to exceed  3 hr.  NaP04 (pH  0.  EDTA.  dilution of Giemsa  6.8)), washed in distilled water and air-dried.  of  the  transposed  superoxide  dismutase  The signals faded  gene  activity  ferricytochrome c reduction assay al., 1978). superoxide  radicals.  The  and c  absence  for the  determined  Fridovich, 1969;  which  inhibits  increase the sensitivity sensitivity  was  measured.  radicals  unit of SOD  and  SOD decreases  Crapo et  the superoxide  A  competes with the  reduction by  modified form of the assay was  approximately  rate  of  activity was defined as the amount  the rate of cytochrome c  10-fold  eliminates interference  (Crapo from  50%,  used to  et al., 1978).  low  molecular  The weight  compounds which are chemically capable of reducing cytochrome c. assay consisted of 1 ml of 50 mM  a  The rate of reduction of cytochrome c in  of SOD  under the conditions specified.  by  used to generate  reduction of cytochrome c by  superoxide  cytochrome c reduction. One enzyme  and  was  In this assay, xanthine/xanthine oxidase was  the presence cytochrome  in flies  (McCord  radicals was monitored at 550 nm.  increased  was  activity assays  The  of  reaction  with prolonged storage.  Expression  1. SOD  monitored  Tris-HCl (pH 7.5) and 5 mM  They were mounted in Permounl and stored in the dark. slightly  was  The  slides were then stained for 30 seconds in a 1/20  stain (in 10 mM  was  coverslip and placed in a moist chamber in the  development.  but  The squash  Na2C03 (pH 10.0), 0.1 mM  EDTA, 0.1  The mM  67  xanthine and 0.01 mM added was  (in less than 0.025  reduction  were  added  (i.e. 0.0125  ferricytochrome A£550=  10 ul) such  absorbance  homogenate  c  cytochrome c  that  to produce  A quantity of xanthine oxidase was  the change in absorbance  units/minute.  Increasing volumes a 5 0 % inhibition  absorbance  units/minute).  was determined  21,000 M ~ ^ c m ~ l .  dithionite.  .  3+  using  at 550 nm Drosophila  of  of cytochrome  extinction  The ferricytochrome c was reduced  extinction coefficients £240= 8.9 X 10 M 3  - 1  cm  was determined  coefficient with sodium  by using the  and 6277 = 9.3 X 10  - 1  3 +  The concentration of  the molar  The concentration of xanthine  c  3  M  _ 1  cm~  1 at pH 10.0. For each assay, five male or female flies (less than 24 hr old) were  homogenized  phosphate  (pH 7.8), 0.1 mM  homogenizer in and  EDTA)  using  (Radnoti Glass Technology,  buffer  (50 mM  a 25-100  Inc.).  ul  potassium Econo-grind  The homogenate  was spun  a microfuge at 4°C for 5 min. The layer of debris on top was removed the supernatant  the homogenate 2.  in 800 u l of phosphate  transferred  to a clean  containing S O D  tube, kept  on ice, and used as  activity  Bradford protein assays The  protein  determined  concentration  in each  by the Bradford protein  assay  Drosophila  homogenate  (Bradford, 1976).  protein standard was made up to a volume of 60 ul with dH20. reagent consisted  of 50 mg  Coomassic  Blue  The sample or The Bradford  G-250, 50 ml phosphoric  ( 8 5 % w/v), 25 ml 9 5 % EtOH and 425 ml distilled water.  was  acid  Three ml of reagent  were added to the sample and the sample vortexed immediately. The samples were reacted for 15 min at room at 595 nm.  temperature  and the absorbance  The protein concentration was determined  measured  for 20 u l and 40 u.1 of  68  Drosophila  homogenate and compared to a standard curve.  A new standard  curve was plotted each day, with duplicate data points, using 0-40 pg of bovine  gamma  globulin  (BioRad).  The concentrated  bovine  gamma  globulin was stored in 25% glyccrol/dislillcd water al -70°C. 3.  Northern blot analysis of transcripts The  agarose  RNA  samples  from  each  strain  were separated  on denaturing  gels and transferred to nylon membranes as described previously.  The RNA on the membrane was hybridized with [ P]-labelled DNA 32  washed and exposed to film. the  hybridizing  regions  The autoradiograms  which  were  then  probes,  were used to determine  excised  from  the membrane.  The membranes were placed into 5 ml of dH20 and the radioactivity on the membrane Cerenkov  fragments radiation  was  determined  emitted  in the presence  background on the membrane, determined to the regions containing Sod  in a  RNA  scintillation of water.  counter  by  The average  by analyzing areas equal in size  from  above and below these regions,  was subtracted from the radioactivity of the Sod RNA regions. The levels of Sod-specific actin  mRNA  transcripts  standardized deficiency  were standardized by comparison  which  values  from  were  quantified  in the same  the transformants  D/(3L)lxd /TM3S6Ser 9  to levels of three manner.  and the heterozygous  These SOD  were compared to that of wt. Multiple  determinations were made for each strain and relative levels of expression are reported as the average of the mean  ± the standard deviation of the  mean. P. Drosophila 1.  melanogaster  The aging curves  longevity  studies  69  The Drosophila  stocks were expanded by growing the flies in bottles.  The newly eclosed flies were collected at 0-24 hr of age, separated by sex, and placed into 8-dram shell vials (10 per vial). standard Drosophila 50-200.  food.  Each vial contained 6 ml of  The number of flies used per strain varied from  The flies were maintained at either 25°C or 29°C and transferred to  vials with  fresh  media  every 2-3 days.  To obtain survival curves, the  number of living flies was determined for each genotype at each transfer and this was expressed as a percent of the total starting number (Leffelaar and Grigliatti,  1984a).  This process was continued approximately for 60  days at 29°C and 90 days at 25°C, until all the flies were dead. 2.  The genetic crosses The  SOD  'null' mutant  (Graf and Ayala,  deficiency Df(3L)lxd /TM3SbSer null  /+, SOD  hybrids used in the aging studies. crossing  SOD '* nu  crossing  males  from  D/(3L)lxd /TM3S6Ser 9  null  /£>/(3L)lxd  The SOD ^/+ nu  males to virgin  collecting the resulting progeny. by  Sod  (Schott et al., 1986) and isogenic Oregon R  9  were crossed to produce SOD  1986), heterozygous  9  and D/(3L)lxd / + 9  strain was produced by  wt (+/+) females (or vice versa) and  The S O D  the S O D " n u  null  /D/(3L)lxd  strain  to virgin  9  were produced females of the  strain and collecting the progeny which were not  marked with either stubble bristles and serrated wings (SbSer).  Similarly,  to produce the D/(3L)lxd /+ flies, rcmales from the D/(3L)lxd /TM3S6Ser 9  were crossed to males from +/+.  9  The non-stubble bristle and non-serrated  wing progeny were collected for the aging studies (figure 7). Q.  Assay  of paraquat toxicity  70  Figure 7. SOD  The Drosophila  null/+ hybrid was  hybrids used in the longevity studies. produced by mating cither SOD  females to the +/+  strain and collecting  SOD  9  null/D/(3L)lxd  do  not  null/D/(3L)lxd  9  have  progeny.  (b)  9  hybrids,  bristles  or  serrated  (c) The D/(3L)lxd /+ hybrids 9  mating the D / ( 3 L ) l x d / T M 3 S b S e r 9  which did not have stubble  wings  The  null strain  deficiency strain D/(3L)lxd /TM3S6Ser. stubble  The  null males or virgin  hybrids were produced by mating the SOD  to the heterozygous SOD which  the resulting  (a)  The flies  were  SOD  were produced by  strain to wt and collecting the progeny  bristles or serrated wings.  71  (a)  SOD null SODnull  (b) Df(3L)lxd TM3 Sb Ser 9  x  SODnull  +  X  +  SODnull SOD null  SODnull TM3 Sb Ser  SODnull save for aging  (c)Df (3D lxd9 TM3 Sb Ser  x  + +  ^  D f O O x d  save for aging  discard flies with stubble bristles; serrated wings  9 a  n  d  TM3 Sb Ser  discard flies with stubble bristles; serrated wings  72  Adult Drosophila  (0-2 days old) were separated by sex and exposed to  paraquat for 48 hr at 25°C in vials (20 per vial) containing filter paper saturated with 0-40 mM  paraquat in 1% sucrose solution.  The number of  living flies was determined after 48 hr and this was expressed as a percent of the total starting number.  73  RESULTS AND  DISCUSSION  A.  Characterization of the D.  1.  Isolation of the CuZn SOD cDNA using mixed oligonucleotide probes  (a)  melanogaster  CuZn  SOD  cDNA  Oligonucleotide probe design attempts to clone the Sod  Previous  gene using a 17 nucleotide long  probe, GT3 (targeted to aa 90-95), were unsuccessful (Seto, 1987).  In this  study, the 26 nucleotide long probe, 13 (figure 8), was targeted to amino acids 87-95, a region unique to the D. et al., 1985a,b). would  require  experimentally deoxyinosine codons  CuZn SOD protein (Lee  To include every possible codon this amino acid segment 8192 different  oligonucleotides, which  feasible.  decrease  To  was  the degeneracy  clearly not  of the probe,  (dl) was placed in the third position of four-fold degenerate  (Martin  analog.  melanogaster  and Castro,  Studies  1985).  on the thermal  Deoxyinosine stability  is a deoxyguanosine  of oligonucleotide duplexes  containing dl show the order of stability to be dI:dC > dI:dA > dI:dT , dlrdG. Deoxyinosine was placed in positions 6,9,18,21, and 24 of the 13 probe to decrease the degeneracy of the mixture to eight 26-mer sequences (figure 8). (b)  Screening a D. A D.  melanogaster  melanogaster  embryos (Poole  cDNA library  cDNA library made from poly ( A ) RNA of 3-12 hr +  et al., 1985) was screened  Approximately 3 x 10  5  with  plaques were screened, resulting in eleven phage to  which the probe hybridized at this stringency. still present on duplicate fdters at 65°C. these  were chosen  the probe 13 at 55°C.  for further analysis.  The positive signals were  The phage DNA  from seven of  The entire cDNA  insert  was  amino acid sequence  Ala Thr  Gly  Asp  Cys  Pro  87  Thr  Lys  Val  9 5  possible codons  5"  GCN  ACN  GGN  GA^  UG^  CCN  ACN  AA£  GUN  probe sequence  T  CGI  TGI  CCI  CT^  AC^  GGI  TGI  1T\  CA  (completive nt a r y strand)  Figure  8.  Drosophila probe 13. is  26  Oligonucleotide SOD  probe design.  The  protein were chosen as the target for the oligonucleotide  All the possible codons for the amino acids are shown.  nucleotides  Deoxyinosine (I) was  long  and  is of  the  template  strand  The probe  for  used in the third position of appropriate  decrease the number of different oligonucleotides eight.  amino acids 87-95 of the  mRNA.  codons to  in the probe mixture to  75  released  from  the A gt 10  endonuclease EcoRI.  vector  arms  by  digestion  with  restriction  Of these seven phage, five clones contained a -750 bp  cDNA insert and two clones contained a smaller-350 bp cDNA insert, all of which hybridized the probe (figure 9). 2.  Nucleotide sequence analysis of CuZn SOD cDNA The -750 bp and -350 bp cDNA inserts were subcloned into the EcoRI  restriction  site of pUC13  and M13mpl8/19 for sequence analysis.  The  orientation of the inserts in M13mpl8/19 were determined  by hybridizing  the  the probe 13  probe  13  to single-stranded  hybridizes to the coding  13 (mixed primers), forward  sequence  DNA  obtained  templates,  strand but not the RNA  sequence of the -350 bp cDNA  double-stranded  DNA  were  used.  Both single and  frames produced  protein sequence.  information obtained from this partial cDNA  The  Translation of the partial  reading  to the SOD  strand.  using oligonucleotide  and reverse primer.  in all three open  acid sequence corresponding  template  insert was determined  primer  templates  since  an amino  The sequence  clone was used to design two  oligonucleotide primers which correspond to amino acids 24 to 30 (NS-1: 5'AGACCTTCACGGGCGTA-3', RNA template strand) and amino acids 126 to 131 (NS-2: 5'-CAGGGTGGACACGAGCT-3', coding strand) of SOD.  The larger -750  bp cDNA clone was sequenced entirely on both strands using NS-1 and NS-2 as primers (figure 10).  The larger -750 bp cDNA  entire coding region for the CuZn SOD  contained the  protein as well as 68 bp of the 5'  flanking DNA, 174 bp of the 3' flanking DNA 3.  insert  and the poly A tail (figure 11).  Predicted amino acid sequence of the CuZn SOD protein Translation of a full length SOD mRNA would be expected to give rise  76  A D.  Figure 9. Southern analysis of CuZn SOD cDNA clones. cDNA DNA  melanogaster  library was screened with the oligonucleotide probe 13. from seven plaques which  The phage  hybridized the probe 13 was digested with  EcoRI, separated by electrophoresis in a 0.7% agarose gel and transferred to a nylon membrane.  The membrane  was hybridized  with radiolabeled  probe 13, washed at 65°C in 6XSSC, and exposed to X-ray film. The resulting autoradiogram  is shown.  The entire cDNA  XgtlO vector arms by digestion  insert was released  with EcoRI.  Lanes  clones c21, c29, c33, c35, c38 and c41, respectively. contained  a _350  bp  cDNA  remaining  clones contained  insert  (single  a ~750 bp insert  1-7 represent  cDNA  Clones c35 and c41  arrowhead),  whereas the  (double arrowhead).  markers were from a Hinfl digest of pBR322 DNA, (sizes shown in kb).  from the  Size  run in a parallel lane  77  78  Figure 10.  Strategy for determining the CuZn SOD cDNA sequence.  The full  cDNA clone (c29) and the partial cDNA clone (c41) are represented by open boxes.  The scale on top of the full length cDNA show size in base pairs. The  position of the partial cDNA clone (c41) in relation to the full length cDNA clone is shown. The end of the DNA on  insert with the poly C tail is indicated  both clones, but only the full length clone has a poly A tract at the  opposite end.  The arrows below the cDNA clones represent the sequencing  strategy used, where the length of the arrow indicates the extent of the sequence read on each template. sequence determined  for the coding  show sequence determined dotted  arrows represent  stranded  DNA  were used  as primers  represent  reverse  primers.  strand; arrows pointing to the right  for the non-coding  DNA  templates,  arrows  Arrows pointing to the left show DNA  sequences obtained  respectively.  arc shown  sequences  strand.  Specific  beneath  determined  from  Solid  single and double-  oligonucleotides which  the arrows. using  arrows and  universal  The unlabelled forward  and  79  E c o R I  | polyC  100  200  I  I  300  1  EcoRI  400  500  600  700  E c  '  '  I  I  J  EcoRI  poly C  NS-2  13 NS-1  dsDNA t e m p l a t e ssONA t e m p l a t e  ° ' R  80  Figure 11. The D.  melanogaster  sequence of the full  CuZn SOD  length cDNA  clone  amino acid sequence is given  below  acid  the  sequence  sequence  predicted  determined  terminal valine.  for the S O D  (c29) is shown.  The predicted  the nucleotide sequence.  cDNA F  The nucleotide  is identical  The amino  to the amino acid  protein, except for the additional C-  The clone also contains 68 bp of 5' flanking DNA  bp of 3' flanking DNA, AATAAA  from  cDNA sequence.  and the poly  A  is underlined (Sclo et al., 1987a).  tail.  and 174  The polyadenylation signal  81 -90 -75 -60 -45 -30 -15 "1 gaattcccccccccccccccccccacaccatagaagatacctggaaa'gttctcaacttttttcgttttgataaattgattaattcattcgaa  ATG Met  GTG GTT AAA Val Val Lys  15 GCT GTC TGC A l a V a l Cys  GTA ATT Val H e  30 45 AAC GGC GAT GCC AAG GGC ACG GTT TTC A s n G l y Asp A l a L y s G l y T h r V a l Phe  TTC Phe  GO GAA CAG GAG AGC AGC G l u G i n G l u Ser Ser  75 GGT Gly  90 105 120 135 150 ACG CCC GTG AAG GTC TCC GGT GAG GTG TGC GGC CTG GCC AAG GGT CTG CAC GGA TTC CAC GTG CAC GAG TTC GGT Thr Pro Val Lys Val Ser Gly Glu Val Cys Gly Leu Ala Lys Gly Leu His Gly Phe H i s Val H i s Glu Phe G l y  165 180 195 210 225 GAC AAC ACC AAT GGC TGC ATG TCG TCC GGA CCG 'CAC TTC AAT CCG TAT GGC AAG GAG CAT GGC GCT CCC GTC GAC Asp Asn Thr Asn Gly Cys Met Ser Ser Gly Pro His Phe Asn Pro Tyr Gly Lys Glu His Gly A l a Pro Val Asp  240 255 270 285 300 GAG AAT CGT CAC CTG GGC GAT CTG GGC A A C ATT GAG GCC ACC GGC GAC TGT CCC ACC AAG GTC AAC ATC ACC GAC Glu Asn Arg H i s Leu Gly Asp Leu Gly A s n l i e Glu A l a Thr G l y Asp Cys Pro Thr Lys Val Asn H e Thr Asp  315 330 345 360 375 TCC AAG ATT ACG CTC TTC GGT GCC GAC AGC ATC ATC GGA CGC ACC GTT GTC GTG CAC GCC GAT GCC GAT GAT CTT Ser Lys H e Thr Leu Phe Gly A l a Asp Ser H e H e Gly Arg Thr Val Val Val H i s A l a Asp A l a Asp Asp Leu  390 405 420 435 450 GGC CAG GGT GGA CAC GAG CTG AGC AAG TCA ACG GGC AAC GCT GGT GCC CGC ATC GGG TGC GGC GTT ATT GGC ATT Gly G i n G l y Gly H i s Glu Leu Ser Lys Ser Thr Gly Asn A l a G l y A l a Arg H e G l y Cys G l y Val H e Gly H e  GCC AAG GTC TAA A l a Lys Val »»»  465 48a 495 510 525 540 gcgataatctattccgatgtcggccactgtgctgatctactctatttagcactacccactggagatatacaaacgatatacat  555 570 585 600 615 630 acttctaaacataaatacatagectgtggtctgttagttgatacgcaacctttgaggttcaataaattggtgttttgaaattgccccataaacaaaaaa  660 aaaaaaaaaaaaggaattc  82  to a protein with an amino acid sequence identical to that determined for Drosophila addition  CuZn S O D  (Lee et al., 1985a,b) except it would contain, in  F  to the expected  N-terminal  methionine,  a  C-terminal  valine  (figure 11). This finding is not unique; for example, the bacteriorhodopsin gene encodes an additional aspartic acid at the carboxyl  terminus (Dunn et  al., 1981) and the a-tubulin gene also encodes a C-terminal tyrosine not  found  in the mature protein.  modification tyrosine  of a-tubulin  at  the  carboxypeptidase modifications  involves  carboxy  very  terminus.  A  post-translational  specific  tyrosyl-tubulin  ligase are responsible  and both have been purified.  is still  unique  the enzymatic removal and addition of  and a tubulinttyrosine  been an area of considerable tyrosine  This  residue  Although  for these  this problem has  interest, the role of the carboxy  not clear (reviewed  by Cleveland  terminal  and Sullivan, 1985).  Therefore, the results of the a-tubulin studies do not provide a clue for the function of the additional valine in the mature SOD protein. 4. The SOD gene transcript A Northern blot of equal quantities of total RNA from D.  melanogaster  (Oregon R) and a SOD "null" mutant (Graf and Ayala, 1986) was probed with [ P]-labelled 32  SOD  cDNA and the resulting autoradiogram showed positively  hybridizing bands at 0.7-0.8 kb (figure 12). However, the intensity of the 0.7-0.8 kb band autoradiogram in the SOD Sod  in the SOD  "null"  mutant  was much  reduced.  The  also shows a slightly stronger 1.5-1.6 kb hybridizing band "null" mutant RNA  transcript.  which may represent an improperly spliced  This result is in agreement with the findings that the SOD  "null" mutant has only  3.5% of the wt SOD  protein and that the "null"  83  Figure  12.  Northern blot analysis of wt and  Total RNAs of D.  melanogaster  (Oregon R) (lane a) and Sod The  strains (lane b) were isolated. measuring absorbance at 260  RNA  transferred  radiolabeled  hybridized  and  A  seen in the wt Drosophila  RNA  1.5-1.6 kb RNA  The  a 1.4%  to  RNA  on  pg)  the  single 0.7-0.8 kb  The  "null" mutant determined  by  from each strain  Sod  membrane.  0.66  M  cDNA  was  The  resulting  band (double arrowhead) is  (lane a) but is greatly diminished in the  Sod  autoradiogram also shows a slightly stronger  hybridizing band (single arrowhead) in the Sod  ladder (BRL)  was  transcripts.  agarose gel containing  to a nylon membrane.  autoradiogram is shown.  "null" mutant (lane b).  concentration  Total RNAs (30  mn.  were separated by electrophoresis on formaldehyde and  "null" mutant Sod  "null" RNA.  provided size markers (sizes shown in kb).  An  9.5 7.5  4.4  2.4 1.4  0.24  85  mutation is tightly linked to the Sod The  SOD  wild.  "null" mutant was a naturally occuring mutation  The mutation  intron/exon spliced  structural gene (Graf and Ayala, 1986).  be  may  due to  an altered  junction of the gene such  properly.  isolated from the  gene  that the -725 bp intron  into the coding region of the SOD  protein sequence.  this mutant has been cloned using the Sod  should  communication). provide  at the is  not  The unspliced message would be 1.5-1.6 kb in length.  Alternatively, the larger transcript may be due to a DNA  personal  sequence  more  The SOD gene from  cDNA isolated above (F.J. Ayala,  The nucleotide sequence  insight  into  sequence inserted  the nature  of this  of this  very  Sod  locus  interesting  mutation. Northern blot analysis of total RNA  from various rat and mouse tissues  also show one Sod transcript of about 0.7 kb (Delabar et al., 1987) as opposed to the 0.7 and 0.9 kb transcripts observed' in various human cells. found  that both  human  Sod  transcripts are transcribed from  It was  the same  gene with the 0.7 kb transcript being predominant (Sherman et al., 1984). B. The D. 1.  melanogaster  CuZn  SOD  gene  Isolation and characterization of CuZn SOD genomic clones A D. melanogaster  genomic DNA  library was constructed in the vector  XEMBL3 (Leung, 1988) from a stock of D. melanogaster major chromosomes (G.M. Tener, unpublished). approximately the DNA  It has been estimated that  1 x IO plaques of this library are required to represent all 4  sequences present in one Drosophila  genomes (6 x 10 pfu) from this DNA 4  oligonucleotide  isogenic for all the  probe  13 at 52° C,  genome.  The equivalent of 6  library were screened with the mixed which  resulted  in approximately  10  86  hybridizing  plaques  hybridized  at  per genome.  58° C,  which  resulted  approximately one positive clone  probe  in 5  per genome.  purified and the bacteriophage DNA 2.  The  13  was  subsequently  hybridizing  plaques, or  These five plaques were  isolated.  Restriction enzyme analysis of the CuZn SOD genomic clone Bacteriophage DNA  from one of the phage clones  (designated G10),  which hybridized the probe 13, was chosen for further analysis. from phage G10 was digested on  with various  The DNA  restriction enzymes, separated  an agarose gel and transferred onto a membrane.  The membrane was  first hybridized with [ P]-labelled mixed oligonucleotide 13. 32  The probe  was removed and the same membrane hybridized with nick-translated cDNA.  SOD  The resulting autoradiograms showed that the oligonucleotide probe  13 (directed to amino acids 87-95 of the SOD protein) and the SOD cDNA both hybridized to the same -1.8 kb EcoRI fragment (figure 13).  Both probes  also hybridized to the same ~20 kb Hindlll fragment, which represents a fusion of XEMBL3 vector and Drosophila  insert DNA.  Previous analysis of  the SOD cDNA revealed a Sail site (GTC GAC) at codons number 73 and 74 of the SOD cDNA sequence.  As expected, Sail digestion of the genomic clone  produced two bands which positively hybridized to SOD cDNA, but only one Sail  fragment  hybridized  to oligonucleotide  digests showed a ~1.4 kb EcoRI/Sall  probe  13.  The  fragment which hybridized  EcoRI/Sall with the  SOD cDNA but not with probe 13. The -0.4 kb EcoRI/Sall band hybridized both the cDNA and the oligonucleotide 13 (figure 13). Therefore, the -0.4 kb  EcoRI/Sall  fragment contains  the 3' end of the Sod  oligonucleotide 13 hybridized this fragment only.  gene, since the  Based on this restriction  87  Figure DNA  13.  library,  (1) Hindlll on  Southern analysis of a genomic CuZn SOD (a) Bacteriophage DNA  (2) EcoRI/Sall  a 0.7% agarose gel.  and  hybridized  The  resulting  cDNA  with  (3) Sail  autoradiograms  the clone G10 was digested  (4) EcoRI (5) Sall/Hindlll  The DNA  radiolabeled  from  clone from a X E M B L 3  was transferred onto a nylon  CuZn  SOD  cDNA  of the membranes  and (c) oligonucleotide 13 are shown.  the  show  cDNA  hybridized  a 1.4 kb EcoRI/Sall  clone both  but not with the SOD  cDNA  fragment  probe  13.  separated membrane  and oligonucleotide 13.  hybridized  with  (b) S O D  The probe 13 and the S O D  both hybridized to the same 1.8 kb EcoRI fragment (lane 4). digests  and  (lane  with  2) which  The EcoRI/Sall hybridized  The 0.4 kb EcoRI/Sall  and the oligonucleotide  cDNA  13.  Size  with  fragment markers  were from a Hindlll digest of X DNA, run in a parallel lane (sizes in kb).  88  CO CM  II CN  O." <3  t  I i 11 i N  •  CM  ro  O  CN  CN  I  •O  l  1 !  i  CO  I I l  sd  m»  VO "<*  o'  O  CN  I  I  in  CN  1  II i  i ii i  IT  O  ro o  ro <N  D  o' <5  • • CN CN  O  89  analysis, the -1.8 kb EcoRI fragment as well as the -0.4 and -1.4 EcoRI/Sall fragments were subcloned for nucleotide sequence 3.  kb  analysis.  Subcloning strategy for the CuZn SOD gene The -1.8 kb EcoRI and -1.4 kb EcoRI/Sall fragments from phage G10  were subcloned into pUC13 using the host JM101. same fragments into M13mpl8/19 using JM101 inserts appeared to be unstable in this host. EcoRI/Sall  fragments were successfully  EcoRI/Sall  overlapping  fragment  deletions  was  was  not possible, as the  The -0.4 kb and -1.4  force cloned  into M13mpl8 and mpl9 in the host JM109. kb  Attempts to clone the  kb  in both orientations  The sequence of the larger -1.4  determined  by  by the exonucleaselll  producing  method  a  series  of  of Henikoff (1984).  The -1.8 kb EcoRI fragment (cloned in pUC13) was cut with BamHI/PstI and then  treated  reactions  with  were  exonucleaselll  stopped  at fixed  (figure  14a).  intervals,  and  The an  exo  III deletion  aliquot  of linear  molecules from each fraction was digested with EcoRI and separated on an agarose gel (figure determine  14c).  the sequence  on  These one  double-stranded templates were used to strand  of the entire  -1.8  kb  EcoRI  fragment. To determine the sequence on the other strand (figure 14b), the -1.4 kb EcoRI/Sall fragment was cloned into mpl8 which produces the required orientation.  In this clone, a Pstl/Sall digest (to take advantage  of the  resistance to exo III digestion of ends produced by PstI) was not possible, because the PstI and Sail sites are adjacent in the multiple cloning site. The clone was digested with Hindlll and the ends protected by the addition of  dATP[aS].  The linear molecules were cut with Sail, to provide a site  90  Figure 14. the DNA  Subcloning strategy for the CuZn SOD  (a) To determine  sequence on one strand, the 1.8 kb EcoRI (E) fragment (open box)  from phage G10 orientation  (figure 13) was  shown.  subcloned into pUC  The clone was  digested with Exonuclease 111. the  gene.  13 (solid line) in the  cut with BamHI (B)/Pstl (P) and then  The direction of the deletions are shown by  arrows on top of the fragment.  The  primer binding site (represented  by a small arrow on the pUC13 vector sequence) remains intact. sequence on the other strand, the 1.4  determine the DNA (S) fragment  (open box) was  orientation shown.  (b)  To  kb EcoRI (E)/Sall  subcloned into M13mpl8 (solid line) in the  The clone was  cut with Hindlll (H) and made resistant  to ExoIII by the addition of dATP(aS).  The molecule was then cut at Sail and  the direction of the deletions are shown by arrows on top of the fragment. The  primer binding  deletions  site  for the pUC13  remains clone  intact. was  digestions were stopped at 30 second EcoRI, and sequence  analyzed on a 0.7%  remains  intact  (single  (c) The  monitored  extent of the ExoIII  as follows.  The ExoIII  intervals (lanes 1-6), digested with  agarose gel.  The  2.7  arrowhead) whereas  kb pUC13 vector the  1.8  fragment is deleted by approximately 150 bp every 30 seconds.  kb  EcoRI  91  12  3 4  5 6  92 where  exo III digestion may  EcoRI/Sall with  fragment  initiate.  The sequence  was determined using  of the _1.4 kb  single-stranded  DNA  templates  deletions generated in this manner. The smaller ~0.4 kb EcoRI/Sall fragment was cloned into mpl8/19 and  sequenced  entirely on both strands.  The universal primer and the SOD  specific oligonucleotides 13 and NS-2 were used as primers for sequence analysis.  The oligonucleotide 13 corresponds to the template strand for  mRNA and was used to sequence this fragment in mpl9. specific  oligonucleotide NS-2  Similarly, the SOD  corresponds to the coding  strand  and was  used to sequence the same fragment cloned in the opposite orientation in mpl8.  The strategy used to determine the sequence of the complete 1.8 kb  gene fragment is shown (figure 15). 4. Nucleotide sequence of the CuZn SOD gene The  EcoRI  fragment was 1844 bp in size and contained  the entire  transcribed region for a CuZn SOD gene (in capitals in figure 16), 413 bp of the 5' untranslated region, as well as 247 bp of the 3' untranslated region (figure 16). Transcription start and stop sites were assumed to be the limits of the cDNA Drosophila intron.  sequence.  Sod  Nucleotide  sequence  analysis revealed  that the  gene consists of two exons separated by a single 725 bp  The first exon codes for the N-terminal methionine and the first 21  amino acids of the SOD protein.  The second exon codes for 131 amino acids  followed by the T A A termination triplet.  The additional C-terminal  triplet  coding for valine found in the cDNA sequence was also found in the gene sequence.  The transcribed region  of the gene  (in capitals) has three  transitions (overlined) when compared to the Sod cDNA  which  was from  93  Figure  15.  The strategy  gene.  The solid  fragment.  for determining  the sequence  line at the top of the figure  of the CuZn  represents a 1.8 kb  The open  boxes  of the first and last codon  represent  the coding  sequences.  The  represent indicates  left show to  DNA  the right  arrows and  and  the sequencing strategy the extent sequence  show dotted  of the sequence  sequence  double-stranded D N A  The  unlabelled and  reverse  where  read.  on  DNA  determination  represent  Arrows  primers.  of the  pointing  to the  strand; arrows pointing  sequences  strand.  obtained  Specific  are stated  sequences  The arrows  the length  the non-coding  templates, respectively.  as primers for sequence  forward  determined  represent  used  arrows  used,  determined for the coding  arrows  number  in each coding sequence is listed below the box.  The Sail site at codons 73 and 74 in the second exon is shown.  arrow  EcoRI  The scale on top of the line shows the size of the fragment in  base pairs.  below  SOD  single  oligonucleotides  beneath  determined  from  Solid  the arrows.  using  universal  94  200  400  J CODONS  I  600  —-I  21  800  1000  I  1200  1  1 <00  1  22  1490  ,' .....  I  153  I , ,  -< -<  1800  EcoRI  LJ  13 13  -<  -<  -<  NS-1  -<  NS-2 ssDNA t e m p l a t e dsONA t e m p l a t e  •>-  95  another D.  melanogaster  acid sequence of SOD melanogaster  source.  and may  strains used.  These differences do not affect the amino D.  reflect variations between the different  In many eukaryotic genes the polyadenylation  site is found about 30 bp downstream from the signal A A T A A A  (Watson et  al., 1987). The poly A tract is added at this point after removal of part of the 3' untranslated region of the mRNA. Drosophila  SOD  The 3' untranslated region of the  gene has a conserved AATAAA  signal 27 bp upstream from  the start of the poly A tract site which was identified in the cDNA clone. 5.  Analysis of the CuZn SOD gene sequence The CuZn SOD  coding  for amino  gene has a single 725 bp intron which separates triplets  acid residues 21 and 22.  This intron is in the same  position as the first intron of the corresponding (Levanon et al., 1985). chromosomal DNA A  human CuZn  the human Sod  However,  SOD  gene  gene spans 11 kb of  and has 5 small exons separated by 4 large introns.  survey of intron and exon lengths in genes of vertebrates, insects,  plants and fungi have been tabulated (Hawkins, 1988). regions in the Drosophila respectively.  SOD  are more than 550  nt long.  The  genes are 100-180 nt average length of a  exon is 392 nt. On the other hand, vertebrate genes have exons  which are 100-170 nt in length with a mean length of 137 nt. sequences of greater than Drosophila  coding  gene are 63 nt and 396 nt long,  The majority of exons in Drosophila  long, but 15% Drosophila  CuZn  The two  600  nucleotides  are uncommon.  genes tabulated (including the CuZn SOD  Coding  Of the 75  gene sequence), over  half these genes have introns that are shorter than 100 nt in length.  Of  the introns which are 100 nt or shorter, 80% of them are between 50-75 nt  96  long.  The shortest intron reported  Drosophila nt  In Drosophila,  gene.  in length.  Taking  to date is 31 nt long  the average size of an intron in Drosophila  have  introns  with  predominate.  a  The  from  wide  in a  there are also introns greater than 2000  into account the very  Hawkins tabulated the data  and found  large and very  small introns,  genes is 622 nt.  In contrast,  1305 vertebrate genes and show that  range  average  o f lengths  length  but that  o f vertebrate  they  shorter  introns  ones  has  been  determined to be 1127 nt long. Examination nucleotides  o f split  protein-coding  at exon-intron  boundaries  gene  sequences  showed  are not random.  that the  Introns  almost  always begin with G T and end with A G (Breathnach et al., 1978).  Since the  work  tabulated.  o f Breathnach,  Consensus  130  sequences  junctions  have  been  sequence  consensus  split  gene  describing  nine  established  (Mount,  was found  have  nucleotides  ( ) N  sequence consensus was  C 'n  the exon-intron  The exon-intron  9AG|GT £ AGT |  been  around  1982).  to be A T  acceptor  sequences  «•  donor  . '.  and the intron-exon  C  Examination of the donor  T  and  acceptor sequences in the CuZn S O D gene shows that in some instances,  the  consensus nucleotides are not used.  of the D. melanogaster  However, the intron-exon junction  Sod gene follows the G T - A G consensus sequence. It  is interesting to note that the- 5'- donor sequence o f the first intron in the human  gene  has an unusual  variant  5' G C  rather  than  the usual  GT  (Levanon et al., 1985). RNA promoters sequences  polymerase  II transcribes all known  protein-coding  lie 5' to the end of the transcribed within  the promoter regions  have been  region,  recognized.  genes.  Its  and conserved A n AT-rich  97  region of homology known as the T A T A box has been frequently observed about 30 bp upstream from the transcription start site and appears to be necessary for accurate transcription initiation.  The  exact location of the  T A T A box varies with the first T occuring between positions -34 to -26 from the  mRNA start site (reviewed by Breathnach and Chambon, 1981).  flanking region of the CuZn SOD  The 5'-  gene contained a putative imperfect T A T A  sequence TATTTCT starting at position -26 (figure 16). A second region of homology known as the CAAT box has been found at variable positions and may  reside on either DNA  strand.  The generality  of this putative transcriptional control site remains to be demonstrated. the  CuZn SOD  gene, the best match to the CAAT consensus sequence  CCCAAT centered at nucleotide -136.  -293  (figure 16).  was  There was also a second CAAT box with  reverse polarity (ATTGG) followed by a 17 bp G-C to  In  rich sequence from -277  In addition, nine base pairs (TGTCATTGG) which  includes the reverse CAAT box, were identical to nine base pairs in the twenty-five base pair kinase (tk) one  second  signal  gene (McKnight et al., 1984).  of the best-characterized  Mutations  distal  within  promoter activity (figure  17).  The herpesvirus tk  mammalian  the proximal, first,  of the herpesvirus thymidine  and  RNA  polymerase  second  distal  Site-specific mutagenesis  gene contains II promoters.  signals reduced in the G-C  rich  region of the tk  gene distal signal showed that this control site had a  strong  the transcriptional  gene.  effect  on  The Drosophila  Sod  G-C  efficiency  of the thymidine kinase  rich region differs by being CGCGCC instead  of CCGCCC as in the second distal signal of the tk gene. may  represent a new  The G-C rich regions  class of promoters found in all housekeeping  genes  98  Figure  16.  Nucleotide sequence of the Drosophila  CuZn SOD  nucleotide sequence of the 1.8 kb EcoRI fragment is shown. contained  the entire transcribed region for a CuZn SOD  gene.  The  The fragment  gene (in capitals),  413 bp of the 5' untranslated region, 247 bp of the 3' untranslated region and  the single 725 bp intron.  The transcription start site is numbered +1.  The transcribed region of the gene has three transitions (overlined) when compared to the SOD cDNA sequence. shown below the nucleotide  The predicted amino acid sequence is  sequence.  The additional C-terminal triplet  coding for valine found in the cDNA sequence was also found in the gene sequence.  Putative control sites in the 5' flanking region of the gene and  the polyadenylation signal AATAAA are underlined (Seto et al., 1987b).  in the 3' flanking region of the gene  99 -331 -312 g a a t t c c t g g a t t c g t 1111 ta11 t a t a c a a a a c -292 -272 -252 -233 a a a g t a a a t t g a a t a g t t c g c g c c a c t g t c a t tggaa t a a a t g g a a g g c t t c c a a g t g a a c c a c c c g t t e g t t g a a c a g -2T3 " -193 -173 -154 ctcaaaaaattcaacgccatttgtgcagtaaaattgttccgttttcaaattttgtaatttgtagcttttatccttaaaa -134 -114 -94 -75 atgtaaataaatgtcccaataaaacatgagcttgaaata ttacaaagaaaaaatgct tccagtaacggca taatagtgt -55 -35 -15 1 gaacgaaacttttgcacaactgaacactaacagtaaaagttccgcatgtatttctaagctgctctgctacggtcACACC 25 45 65 80 ATAGAAGATACCTGGAAAGTTCTCAACTTTTTTCGTTTTGATAAATTGATTAATTCATTCGAA ATG GTG GTT AAA Met Val V a l L y s 85 110 125 141 GCT GTC TGC GTA ATT AAC GGC GAT GCC AAG GGC ACG GTT TTC TTC GAA CAG GAG GTGAGAA A l a V a l Cys V a l l i e Asn G l y Asp A l a L y s G l y Thr V a l Phe Phe G l u G i n G l u 161 181 201 220 TCCAAAATCATTTGAACTTCTCTGCTCGGCAAAATGTACGAAAAACAGAAGTTCTAAAGGTCAAATAGCCGGCTGCACC 240 260 280 299 CGCGGCCCCCTCTTCCACTTCAATATGCTGCTTTAAATTCTGTCGAGCATTTTAATTAAGTCCGATTTGAGTTTACGCC 319 339 359 378 TAGTCACCCAGCAAGTGCACCTTTATATTTATATAAGCCGCACCAAAATGCGCATATGTGTGTGCGCTCAAGTGCCTAC 398 418 438 457 AGCAAAGGTCACGAAATTAGTACTGGACATAAAAAGGAGTTAAGATATAAAGCTCACTTGTTCGTAAAGTATCGTTAAA 477 497 517 536 TATCAACAAATATTTGTTTTAGAATAAGCATTAGGAATATGGGAATAATTAGAATGATGCTGTTCATAATTAATTTGTA 556 576 596 ' 615 CATCAAAGTCAAAGCAGCAATGTCAAGTGTCAAGTAAACGATTATAAACTTGATGATTACAGGTTATGTTTCAGTGCCG 635 655 675 694 AGGAAATTTATGTTTTTAATCTATAAAGATAACCAAATGTTTACTTTGCTGCCTATAAATATTTCCGTTTAACGTGTGT 714 734 754 773 CTATTAACAAATGTTATTTTCTATAATAACCTATTATCATATGAAGTTGGCCACGCTCGTTATCATAATCAGTGCTTCT 793 813 833 852 GCTCACTATTATACACAACTTGTGTCTTATCAGTATTCGAGTATTATCTGAAGCGTTATAACCCAATCCCJTCATCCCG 913 883 898 868 TCCACAG AGC AGC GGT ACG CCC GTG AAG GTC TCC GGT GAG GTG TGC GGC CTG* GCC AAG GGT S e r Ser G l y T h r P r o Val Lys V a l S e r G l y G l u V a l Cys G l y Leu A l a L y s G l y 973 928 943 958. CTG CAC GGA TTC CAC GTG CAC GAG TTC GGT GAC AAC ACC AAT GGC TGC ATG TCG TCC GGA Leu H i s G l y Phe H i s V a l H i s G l u Phe G l y Asp Asn T h r Asn G l y Cys Met Ser Ser G l y 1003 1033 988 1018 CCG CAC TTC AAT CCG TAT GGC AAG GAG CAT GGC GCT CCC GTC GAC GAG AAT CGT CAC CTGP r o H i s Phe Asn P r o T y r G l y Lys G l u H i s G l y A l a P r o V a l Asp G l u Asn Arg H i s Leu 1093 1048 1063 1078 GGC GAT CTG GGC AAC ATT GAG GCC ACC GGC GAC TGC CCC ACC AAG GTC AAC ATC ACC GAC G l y Asp Leu G l y Asn H e G l u A l a Thr G l y Asp Cys P r o Thr L y s V a l Asn H e T h r Asp 1108 1123 1 138 1153 TCC AAG ATT ACG CTC TTC GGC GCC GAC AGC ATC ATC GGA CGC ACC GTT GTC GTG CAC GCC S e r L y s H e Thr Leu Phe G l y A l a Asp • S e r H e H e G l y A r g T h r Val V a l V a l H i s A l a 1168. 1213 1183 1 198 GAT GCC GAT GAT CTT GGC CAG GGT GGA CAC GAG CTG AGC AAG TCA ACG GGC AAC GCT GGT Asp A l a Asp Asp Leu G l y G i n Gly' G l y H i s G l u Leu S e r Lys S e r Thr G l y Asn A l a G l y 1228 1278 1243 1259 GCC CGC ATC GGG TGC GGC GTT ATT GGC ATT GCC AAG GTC TAA GCGATAATCTATTCCGATGTCGG A l a A r g H e G l y Cys G l y Val H e G l y H e A l a Lys V a l HUH 1357 1298 1318 1338 — CCACTGTGCTGATCTACTCTATTTAGCACTACCCACTGGAGATATGCAAACGATATACATACTTCTAAACATAAATACA 1377 1397 1417 1436 TAGCCTGTGGTCTGTTAGTTGATACGCAACCTTTGAGGTTCAATAAATTGGTGTTTTGAAATTGCCCCATAAACaaaaq 1456 1476 1496 ttatagtttteatttgagttgagatggtaagaatgaatatatcacttgttgctcgacgaattc  100  HERPES V I R U S T H Y M I D I N E K I N A S E GENE SECOND D 1ST AL SIGNAL  FIRST DISTAL SIGNAL -80  -105  -61  - CCCCGCCC AGCGTCTTGTC ATTGGC  -47  C AGTCGGGGCGGCG  GAATAGTTCGCGCCACTGTCATTGGA 1 r -293 -277  PROXIMAL SIGNAL  -32  -16  TTCGCATATTAAGGTG—  TTCCGCATGTATTTCTAA— I I -35 -18  DROSOPHILA-CU-ZN SOD GENE  Figure  17.  herpesvirus second  Comparison  tk and Drosophila  distal  (McKnight  of the  signals of  et al., 1984)  Drosophila CuZn SOD below the tk gene.  transcriptional  CuZn SOD  the  gene.  herpesvirus  are shown.  The  control  sites  in the  The proximal, first and  thymidine kinase  (tk)  5' flanking region  gene of the  gene from -18 to -35 and from -277 to -293 is aligned  The SOD  gene has a putative imperfect T A T A sequence  TATTTCT starting at position -26 (underlined).  In the SOD  gene there was a  17 bp sequence from -277 to -293 that has a CAAT box with reverse polarity (ATTGG) followed by the GC rich sequence CGCGCC (underlined).  Nine base  pairs (TGTCATTGG) which include the reverse C A A T box are identical to nine base pairs in the twenty five base pair second distal signal of the herpesvirus  tk  gene.  1 01  1986).  (Dynan, A signals  functional  dependence exists  in the herpesvirus  between  tk gene.  the two distal  transcription  The first distal signal  requires the  presence of the second distal signal in order for transcription of the gene to occur.  However, the second  distal  absence of the first distal signal. either orientation  signal  can function  alone in  the  The second distal signal can function in  and increases the transcription of the gene when moved  closer to the transcription initiation site.  Therefore, the role of the second  distal control  in the Sod gene of  Moving an  signal may be investigated  Drosophila.  this control signal closer to the transcription initiation site may be  effective  approach  towards  increasing  the transcription  of the Sod  gene. Another region for which  a consensus sequence has been compiled is  that flanking the translation start site. initiator methionine codon compared  was preceded  to the consensus C/A AA  Drosophila  genes.  ln the Drosophila by the four  A/C derived  Sod gene, the nucleotides  by Cavener  CGAA  (1981)  for  The variant nucleotide G at the -3 position in the Sod  gene was found to occur in 13% of the genes whereas A was found in 82% of the genes used to derive the consensus sequence. the  commonly  used  consensus  vertebrate gene sequence  sequence  preferred  probe.  Also,  codon  may  was derived  largely from  data (Cavener, 1981).  Codon usage data are useful the  CANC  It should be noted that  for designing oligonucleotide  probes, as  be used to decrease the degeneracy of a mixed  in the cases where several  overlapping open reading frames  of a gene may be translated, one may examine the preferred  codon usage to  1 02  deduce which is the most likely protein sequence.  The codon usage of the  SOD mRNA was compared to that of eight other Drosophila genes (Table I) and it was found to be similar (O'Connell and Rosbach, 1984).  The DNA  coding region has relatively high GC content and there is a preference for codons ending in C (46%) and G (28%). not  observed  in the CuZn  Drosophila genes examined. extensive codon bias.  Sod  The codons ATA, ACA and CGG are gene nor in any of the other eight  In Drosophila,  abundant genes do show an  However, the codon bias in Drosophila  that found for abundant yeast genes.  differs from  Thus, there exists a species specific  bias in the usage of the degenerate codons (Grantham et al., 1980). Comparision of the coding regions of the Drosophila,  rat, and human  Sod genes showed that the Drosophila gene has 5 7 % and 56% homology to the corresponding rat (Delabar el al., 1987; Ho and Crapo, 1987) and human (Levanon et al., 1985) Sod genes, respectively (figure 18). The rat Sod gene shows a 8 5 % sequence homology  in the coding region and 7 1 % in the 3' to the human Sod gene.  untranslated region when compared The  SOD  protein  has been  In D. melanogaster,  organisms.  found  to be polymorphic in many  the two common  electromorphs are SOD  fast (SOD ) and SOD slow (SOD ) (Lee et al., 1981b; Lee and Ayala, 1985). F  s  Examination of the CuZn SOD gene sequence revealed that it codes for the SOD  fast (SOD ) electromorph. F  whereas  SOD  F  has an asparagine at amino acid 96  SOD^ has a lysine at this position (Lee and Ayala, 1985).  The S O D  F  gene was isolated from a genomic DNA library made from an  isogenic stock of Drosophila. contain the S O D  F  gene.  Therefore, this DNA library should only  The S O D  F  was changed to the SOD^ gene by site-  I 03  Table I.  Codon usage for the CuZn Sod genc. UCU-SER-0 (11) UCC-SER-3 (64) UCA-SER-1 (7) UCG-SER-1 (29)  UAU-TYR-1 (18) UAC-TYR-0 (59) UAA-OCH-1 UAG-AMB-0  UGU-CYS-1 (3) UGC-CYS-4 (18) UGA-OPL-0 UGG-TRP-0  CCU-PRO-0 (16) CCC-PRO-3 ( 8 7 ) CCA-PRO-0 (23) CCG-PRO-2 (10)  CAU-H1S-1 (12) C A C - H 1 S - 7 (52)  CAA-GLN-0 (9) CAG-GLN-2 (104)  CGU-ARG-1 (35) CGC-ARG-2 (58) CGA-ARG-0 (6) CGG-ARG-0 (0)  AUU-JLE- 5 (23) AUC-ILE- 4 (107) AUA-ILE- 0 (0) AUG-MET-2  ACU-THR-0 (10) ACC-THR-5 (99) ACA-THR-0 (0) ACG-THR-4 (9)  AAU-ASN-3 (18) AAC-ASN-5 (89) AAA-LYS-1 (4) AAG-LYS-8 (111)  AGU-SER-0 (2) AGC-SER-4 (38) AGA-ARG-0 (5) AGG-ARG-0 (14)  GUU-VAL-4 (26) GUC-VAL-6 (61) GUA-VAL-1 (9) GUG-VAL-5 (63)  GCU-ALA-3 (3S) GCC-ALA-8 (128) GCA-ALA-0 (9) GCG-ALA-0 (13)  GAU-ASP-S (51) GAC-ASP-5 (70) GAA-GLU-1 (14) GAG-GLU-7 (133)  GGU-GLY-7 (51) GGC-GLY-13 (74). • GGA-GLY-4 (40) GGG-GLY-1 (1)  UUU-PHE-0 (7) UUC-PHE-6 (60) UUA-LEU-0 (4) UUG-LEU-0 (14) CUU-LEU-1 CUC-LEU-1 CUA-LEU-0 CUG-LEU-S  The  (9)" (17) (6) (110)  CuZn Sod  gene codon usage table is shown and compared to that for  nine other Drosophila YP2,  genes (in parentheses): yolk protein genes YP1 and  cuticle protein genes CP1 to CP4, two actin genes, and the ribosomal  protein 49 gene (O'Connell the  and Rosbash,  1984).  order: codon-aa-no. of occurences in the Sod  occurences in the nine other genes).  Results are presented in gene-(sum of the no. of  1 04  Figure  18.,  Comparison of the nucleotide  for Drosophila,  sequences of the coding region  rat, and human CuZn SOD genes.  The coding region for the  Drosophila (d), rat (r), and human (h) CuZn SOD genes are shown.  The first  nucleotide of the Met initiator triplet in each sequence is number one and blanks  introduced  The Drosophila  to  obtain  maximum  homology  are  assigned  numbers.  gene shows 57% and 56% homology to the human and rat  Sod genes, respectively (Seto et al., 1989).  ATG GTG GTT AAA GCT GTC TGC GTA ATT AAC GGC GAT GCC AAG GGC ACG GTT TTC -C- A-G — G — C — G --G C-G --G . . . --C -GT CC- GTG CAG GTC A — CA--G C-G — G -C- ACG --G --C --G -TC A-C AAT --C -G- CCA GTG CAG  drosophl la rat human d r h  •  TTC GAA CAG GAG AGC AGC GGT ACG CCC GTG AAG GTC TCC GGT GAG GTG TGC GGC CTG GCC —G A — GCA GAA — A --T GT- --G — A — A C-- A-T ACA --A T-A A-T --G A-- GAA --T AA- GGA --A --G -GG --A AGC A-T AAA --A A-T  d r h  AAQ GGT CTG CAC GGA TTC CAC GTG CAC GAG TTC GGT GAC AAC ACC AAT GGC TGC ATG TCG G-A — C GA- — T --G --T — C --T C-A -AT — G . . . — T — A C-A — T -CC A-T G-A --C . . . --T --T — T --T — T --A --T --T — A GCA --T -CC AGT  d r h  TCC GGA CCG CAC TTC AAT CCG TAT GGC AAG GAG CAT GGC GCT CCC GTC GAC GAG AAT CGT --T --T --T --T C-C TCT A-A G-A . . . -G- --A -CG --T --A G-G A-G G-A --T — T — T CTA TC- -GA A-A --C — T -GG --A AAG — T --A G-G A-G --T  d r h  CAC CTG GGC GAT CTG GGC AAC ATT QAG GCC ACC GGC GAC TGT CCC ACC AAG GTC AAC ATC --T G-G -CT — T GGA AAG G— GTG G-- --T --G TC- --T --T G-T — A --C — T G-T — A — C T-— T G-Q ACT --T GA- AAA --T G-- GTG G-- G-T --G TCT --T  d p h  ACC GAC TCC AAG ATT ACG CTC TTC GGT GCC GAC AGC ATC ATC GGA CGC ACC GTT GTC GTG -CA --A -AG C-T TC— T --C — T — T A-G --G --C GAA — T CGT GT- — C T-A -CA — A -A- C-T T---T --C --A C-G --G --C GAA --T — T GT- — C T-A  d P h  CAC GCC GAT GCC GAT GAT CTT GGC CAG GGT GGA CAC GAG CTG AGC AAG TCA ACG GGC AAC A-T — A GAA — T -CA AAG --T --A --T . . . -AG A-A CAA . . . --C T-G --- A-A «-A-A . . . A-T --A GAA --T -CA AAG --A --A --T -AA A-A — A . . . --C T-G  d p h  GCT GGT GCC CGC ATC GGG TGC GGC GTT ATT GGC ATT GCC AAG GTC TAA --A AGT-G -CT --T --T — G . . . --G . . . . . . C-A ... --G --C C-A --A AGT --T T-G -CT — T --T — A  o  1 06  directed  mutagenesis  (Smith,  C G G T G ATCJTTGACCTTGG-3'  1985).  The  oligonucleotide  5'-  (NS-3) directed to nucleotides 1074-1093 of the  genomic SOD sequence (figure 16) was used to change asparagine-96 with the codon A A C at nucleotide 1082-1084 to lysine-96 with the codon A A G (S. Hayashi, personal  communication).  This  SOD^ gene constructed  by site-  directed mutagenesis will have the same 5'- and 3'- flanking sequences of the  SOD  F  gene.  It is possible that the natural S O D  control elements in these  flanking regions.  s  gene  has different  A partial gene sequence for  amino acids 90-121 for the SOD^ gene has been reported, but this provides no and 6.  information on the sequence which  flanks the coding  region (Kirkland  Phillips, 1987). Cytogenetic The  localization  of the CuZn  Sod gene  cytogenetic localization of the CuZn Sod gene was determined by  in situ hybridization to the polytene  chromosomes of larval salivary glands  (figure 19). A single hybridization signal was detected at position 68A4-9 which  is within  the 68A2-C1  region  designated  by genetic  containing the CuZn Sod gene (Campbell et al., 1986).  means as  The Sod gene probe  also hybridized to the same position in the Sod 'null' mutant (data not shown) indicating that the DNA homologous to this gene is present in the 'null' mutant despite the low level of enzyme found. C.  P element  1.  Construction of the P element vectors Sod-P  mediated  element  hybrid  inserting the 1.8 kb EcoRI into  the unique  EcoRI  of the CuZn  transformation  plasmids restriction  restriction  (figure  20) were  SOD gene  constructed by  fragment containing the Sod gene  site  of  the transposable  P vector  1 07  Figure  19.  Chromosomal  Recombinant DNA RNA RNA  were  of the Drosophila  with 5-[ I]CTP using E. coli RNA polymerase. 125  hybridized  to Drosophila  Autoradiographic exposure was for four days. specifically bar  Sod  gene.  containing the Sod gene was used as a template to make  probes labelled probes  localization  polytene The Sod  chromosomes. gene hybridized  to a unique site at 68A4-9 on chromosome 3L(arrowhead).  in the figure represents 10pm.  The  The  (Photograph courtesy of S. Hayashi).  108  Figure 20.  The pneoSOD transposon.  The pneoSOD plasmid was constructed  by inserting a 1.8 kb EcoRI restriction  fragment containing the Sod  into the unique EcoRI restriction site of pUChsneo. gene  transcription  driven element  neomycin are  transposition.  is opposite  recognized  by  The direction of Sod  to that of the hsp70  resistance (neo)  gene.  the  gene  heat-shock promoter  The terminal repeats (P) of the P  transposasc  and  are  required for  1 09  pUChsneo (Steller and Pirrotta, 1985). the coding region of the S region.  Plasmid DNA  restriction  digests  gene as well as 413 bp of the 5'-untranslated  prepared from transformed E. coli  to determine  inserted gene fragment. Sod  The 1.8 kb gene fragment contains  the presence  and  was analyzed by  orientation  of the  Only one hybrid plasmid, pneoSOD, carrying the  gene in one orientation was used in these investigations as previous  studies have shown that correct gene expression  occurs independently of  its orientation within the transposon (Goldberg et al., 1983).  The direction  of Sod transcription in pneoSOD is toward the unique BamHI restriction site in  the plasmid  and is opposite  which is driven by the hsplQ  to that of the neomycin resistance gene  heat-shock promoter (figure 20).  transformants are selected on the basis of acquired  Since the  resistance to G418, this  vector system allows the insertion of P transposons into the genome of the desired 2.  isogenic  strain.  P element mediated Drosophila  transformation  embryos of the isogenic wt Oregon R strain (GO embryos)  were microinjected prior to pole cell formation DNA  and the helper  plasmid  phsn.  with a mixture of pneoSOD  The second set of microinjections  differed from the first set in that the humidity was raised to 70% and the DNA  concentration was doubled (Table II). This alteration resulted in a 20%  increase  in the number  of first  instar larvae  that  hatched  from the  injected embryos.  In total, 975 embryos were successfully injected and 327  of these hatched  into first  instar larvae.  larvae survived to become adult flies. were found to be sterile.  Approximately  half of these  Of the 185 adult flies recovered, 81  There were 61 sterile females and only 20 sterile  11 0 Table II.  Results of the P element  Experiment  1 was conducted at 50% humidity and 250 pg/ml  pg/ml  phsTt  conducted  was  used  at 7 0 %  mediated  transformation experiments.  for the microinjections.  pneoSOD/50  Experiments  humidity and the microinjected  solution  2-4  were  contains 500  pg/ml pneoSOD and 100 pg/ml phsn. The number and sex of transformants obtained  from  each  experiment  is shown.  In total, 975  embryos were  successfully injected and 327 of these hatched into first instar larvae. the  185  adult  transformants transformed  flies were  lines.  recovered, 81 obtained, and  were five  found  to be  of which  were  sterile. used  Of  Seven to  form  EXPT.  NO. EMBRYOS FIRST GO ADULTS FERTILE STERILE TRANSFORMANTS TRANSFORMED INJECTED INSTAR ALIVE ADULTS ADULTS LINES LARVAE  1  329  69  260 15?  260* 15?  0 o* 0?  10*  Sod  2  197  70  140* 18?  9 o* 0?  5  o* 8?  10*  Sod + 2  3  239  105  350*  250* 18?  100* 27?  2? 10*  Sod +  20*  Sod  7  5  s  35? 4  TOTAL  210  975  83  327  210* 21?  160*  5 0*  5 ?  16?  185  104  81  (no  +  1  lines)  4  +3,5  112  males.  Previous studies have shown lhat approximately 50% of the adults  were sterile after microinjection(Karcss, 1985).  This is in good agreement  with the 44% sterility reported here (Table III).  The 104 fertile adults that  developed  from  the injected  embryos were individually  mated in vials to  the wt Oregon R recipient strain and allowed to lay eggs on food containing the antibiotic G418.  Germlinc transformants were selected on the basis of  acquired resistance to G418.  Seven putative transformants were recovered  (5 males, 2 females) which represents 0.7% of the injected embryos and 6.7% 3.  of the fertile adults recovered (Table III). Establishment of transformed lines The  transformed lines were initially established by mating  each G418  resistant G l adult to isogenic Oregon R flies and then inbreeding the G418 resistant  progeny.  Many  flies for the subsequent were selected cross  crosses.  and maintained  the transposed  uniform  Sod  genetic background  transformed  generations  lines.  were  required to produce enough  Five of the strongest transformed  (designated Sod \-5). +  Our strategy was to  gene back to the isogenic wt flies so that a could  This was done  be maintained  in all the individual  using conventional genetic techniques  involving balancer chromosomes (see Materials and Methods). desirable  to maintain  the inserts  over  balancer  produce a balanced stock) as it was expensive  genetic crosses, the chromosomal  gland  location  It was also  chromosomes  to  In order to simplify the  of the inserted Sod  first by in situ hybridization of a Sod  polytcne chromosomes of larvae from  (i.e.  and tedious to continually  maintain so many lines on the antibiotic G418.  determined  lines  each  gene was  gene probe to salivary transformed  line (see  i 13  Table III.  Analysis of P clement transformation data. ADULTS STERILE  TRANSFORMANTS FROM FERTILE ADULTS  TRANSFORMANTS FROM INJECTED EMBRYOS  INJECTED EMBRYOS HATCHED  ADULTS ECLOSED FROM LARVAE  1 2 3 4  21 35 44 40  59 46 67 51  0 72 53 50  1.7 1 1 9.1 9.5  0.30 0.51 1.3 0.95  AVG  34  57  44  6.7  0.72  EXFT. NO.  * values expressed as a percentage The  data from  (conducted  Table II is expressed  In experiment  at 2 0 % humidity) only 2 1 % of the injected embryos  into first instar larvae.  found to be sterile. number of injected  1  hatched  Increasing the humidity to 7 0 % in experiments 2-4  increased this value by almost  recovered.  as a percentage.  20%. Of the adults recovered, 4 4 % were  The 7 transformants recovered represent 0.72% of the embryos  and 6.7% of the number  of fertile adults  11  Section  C. 5).  The transformed  homozygous for the inserted transformed transposon Sod  lines  were  insertions.  the Sod -4  line.  +  lines  transposon.  made  flics  balancer  second  Presumably  this  late  pupal  survived 4.  CyO  chromosome  Further Sod  functional  the transformed  line  stage  and homozygous  for the single  have  four potentially  insert  while  others  an essential line  +  determined  gland  polytene  each  transformed  of this  was carried  from  such  was maintained  transformed  line  to have some deaths the same  stock  over  for  with  the  three  out on heterozygotes.  Also,  occuring in  eclosed  the  normally and  that  positions of the transposed  gene pneoSOD  by in situ hybridization of a Sod chromosomes line  only  of larvae one other  o f the endogenous  from site  Sod gene  gene  D N A sequences  probe to salivary  the transformed  of hybridization at  68A4-9.  an insert on chromosome 3 L (Table IV).  polytene chromosomes show  that  for Sod -\ +  the pneoSOD  that the insertions occured Southern  analysis  and Sod -3 +  sequences  lines  In  five  line,  lines Sod -3 +  The hybridization sites on the are shown (figure 21).  transposed  into  al a unique site in the genome.  of transformed  lines.  was observed  O f the  examined, four had inserts on chromosome 2R while the fifth  5.  gene  and was therefore not isogenic  appeared  +  disrupts  The Sod -4  analysis  genes  Sod -5  chromosomal  were  results  functional  as adults.  The  had  and made  four of the five  Chromosomal localization of the transposed Sod  besides  balanced  We were unsuccessful in obtaining a homozygote for  chromosome.  potentially  then  By this approach,  would  that the homozygous state is lethal. the  were  isogenic  These  genes (Table IV).  4  These  the germline and  i  l5  Table IV. Chromosomal localization of the inserted SOD gene. TRANSFORMANT NAME  NO. OF SOD GENES  TRANSFORMED LINE  SITE OF INSERTION (CHROMOSOME)  TF 1  Sod+-l  4  48B (2R)  TF2B  Sod+-2  4  60B (2R)  TF 3  Sod*-3  4  67AB (3L)  TF 6  Sod+-4  3  49BC (2R)  TF 7  Sod+-5  4  51AB (2R)  The chromosomal positions of the transduced pneoSOD DNA sequences were determined polytene Sod -5. +  by in situ hybridization of a Sod- gene probe to salivary chromosomes of larvae The site of insertion  parentheses.  The transformed  from  the transformed  lines  Sod -l +  gland to  is shown, with the chromosome number in line  formed  from  each  transformant and  the number of Sod genes present in each tranformed line is shown.  116  Figure 21.  Chromosomal localization of the transposed Drosophila  Recombinant  DNA  containing  dUTP and hybridized Hybridization phosphatase  to D r o s o p h i l a  signals  detection  the Sod  were  system.  Sod gene.  gene was labelled with  biotin-11-  salivary gland polytene chromosomes.  visualized  by  Hybridization  the  streptavidin-alkaline  was observed at the Sod  locus  at 68A4-9 (single arrowhead) and at the additional site of the Sod sequence in the transposon. (a) inserted  at 67AB  additional transposon  Sod  The transformant Sod -3 +  has an additional Sod gene  (double arrowhead) (b) The transformant Sod -l +  gene inserted at 48B (double arrowhead).  insertion  the same manner.  in the other transformed  Bar=10 um.  has an  The positions of  lines were  determined in  (Photographs courtesy of Dr. S. Hayashi).  117  b  1  11  transposed Sod DNA sequences were analyzed by a Southern blot  The of  genomic  DNA  from  each  reveals that besides  pneoSOD  transformed  line.  Hybridization of  the  Sod gene (cloned in pUC13) to genomic DNA digested with  radiolabeled EcoRI  8  DNA  Sod  the endogenous  is present in each transformant  agreement with the in situ hybridization  gene, a single copy of  (figure 22).  results.  From  This is  in  these results, we  can conclude that an additional copy of the Sod gene has inserted into the genome. line  The genomic DNA analyzed was isolated from  after  appears  many  generations  to be stably  introduced  into  detectable  of inbreeding.  integrated.  germline  each transformed  Thus, the transposed  Previous studies show  gene  that transposons  chromosomes by transformation do not undergo  rearrangement  (Spradling  and  Rubin,  1983; Rubin and  Spradling, 1982). D.  Expression  1.  Quantitation of the SOD transcript in transformed lines  of additional  Genomic demonstrated  Southern the presence  CuZn  and  in  SOD genes  situ  of transposed  hybridization Sod  DNA  experiments  sequences at specific  chromosomal locations in each of the G418-resistant lines.  We proceeded to  examine the quantitative expression of the transposed Sod genes. of RNA from was  the transformed  lines revealed that the transposed Sod gene  expressed and Sod mRNA of the correct size was produced  This expression, quantitaled as Sod-specific mRNA comparison  with  three actin  (figure 23).  was standardized by  transcripts (Fryberg et al., 1980) which are  unaffected by the transformations. RNA  Analysis  A Northern  blot of total  Drosophila  show a 0.7-0.8 kb Sod transcript as well as the 1.65, 1.95, and 2.3 kb  119  Figure 22.  Southern analysis of transposed Sod  adult flies of the wt (lanes 2-6:  +  +  endonuclease,  separated  by  gene  membrane.  fragment The  was  were  A  radiolabeled  band  represents the endogenous Sod  gene  (arrowhead).  hybridizing band  five  in a  five transformed  with 0.7%  EcoRI agarose  and  hybridized  is shown.  The  to DNA  restriction gel  on  gene as well as the transposed  transformed  lines  have  an  and kb the  Sod  additional  which is the result of a fusion of the genomic  were from a Hindlll digest of X DNA,  lines  1.8 kb hybridizing  sequence with the remaining part of the pUChsneo vector.  kb).  from  pUC13 plasmid containing the 1.8  resulting autoradiogram  The  digested  electrophoresis  transferred to a nylon membrane. Sod  Genomic DNA  recipient strain (lane 1) and to Sod -5)  Sod -\  DNA.  DNA  Size markers  run in a parallel lane (sizes shown in  23 9.4 6.6  4.4  2.3 2.0  .56  121  actin transcripts in all the strains studied (figure 23). from  the  transformants  were  compared  the two endogenous Sod  strain which only has that the quantity o f Sod  transcript  was  when compared to the wt Drosophila had about the same level of SOD heterozygous  deficiency  that  50%  position  the  effects,  they  are  wt  genes.  The  results show  recipient  transformed  transcript as wt (Table V).  SbSer(Df  9  gene was  found to  Previous studies have shown  o f transposed  generally  It  In contrast, a  region, D/(3L)lxd /TM3 copy of the Sod  lines  transformant.  +  of the Sod  expression  the  greater in the  of the wt transcript (Table V).  although  measurements  from  except for the Sod -\  68A3,4-68B4,C1), which has only one produce  to those  The  genes  expressed  may  be  (Goldberg  subject to  et  al., 1983;  Hazelrigg et al., 1984; Scholnick et al., 1983; Spradling and Rubin, 1983). 2.  SOD-specific activity of transformed lines Since the Sod  SOD-specific whole  activity  flies.  subsequent  gene should  The  measurements were performed results  generations  measured was  be constitutively expressed  of  the  demonstrated  a heritable trait.  transformed lines was between 131% R  (Table V).  experiments  There was  that  The  the  range  to 170%  SOD  increased  on  flies  specific  activity  from  activity  for the five  of the value for the wt Oregon  essentially no measureable difference in activity  between the males and females in each strain. deficiency strain Df(3L)l  using homogenates of  repeated  of SOD  in all tissues,  xd^/TM 3ShSer  was  Also, the heterozygous  found to have ~60%  Sod  of the wt  activity. Taken together, the Sod  the transformants  additional  transcript and Sod  mRNA  enzyme analyses show that in  and  SOD  enzyme were  produced  122  Table V.  SOD-specific activity and transcripts in transformed and control  strains. STRAIN  Df  NO. OF GENES  1  (3L)lxd9  wt  SOD-SPECIFIC ACTIVITY female male  SOD TRANSCRIPT  60 ± 7 (6)  66 ± 1 5 (5)  50 ± 7 (4)  2  100  100  100  -4  3  145 ± 18 (6)  132 ± 12 (6)  149 ± 3 9 (5)  Sod  +-1  4  131 ± 16 (6)  134 ± 10.(6)  99 ± 8 (4)  Sod  +-2  4  153 ± 19 (8)  142 ± 2 (5)  153 ± 42 (5)  Sod  +-3  • 4  164 ± 26 (10)  146 ± 19 (10)  137 ± 15 (5)  Sod  +-5  4  170 ± 2 2 (8)  130 ± 16 (4)  The  number of Sod  Sod  +  shown.  167 ± 25 (6)  genes in the transformed  and control  The SOD activity in a homogenate of adult males and of females of  each strain was normalized to the amount of protein present. reported is the mean percentage  prepared from males and females.  Total Drosophila  The Sod-specific  to the amount of actin transcript present in each reported is the mean percentage of Sod compared to that of wt Drosophila. Figures  determinations.  The number  of the normalized SOD activity in each  strain as compared to that of wt Drosophila.  given.  strains are  in parentheses  mRNA  mRNA  RNA was  was normalized  sample.  The number  present in each strain as  Means and standard deviations are record  the number  of individual  123  Figure 23.  Northern  Total  (30 pg) from  RNA  electrophoresis transferred  in a  1.4%  to a nylon  radiolabeled resulting  analysis  plasmids  of endogenous and introduced Sod  each D r o s o p h i l a agarose  membrane.  strain  gel containing The membrane  was  genes.  separated by  formaldehyde  and  was hybridized  with  containing the Sod cDNA and the actin gene.  autoradiogram  shows  all strains  have  a  single  Sod  The gene  transcript at 0.7-0.8 kb (single arrowhead) and the three actin transcripts (double arrowhead).  Lanes 1-7: RNAs from Sod deficiency £>/(3L)lxd , wt 9  Oregon R, and transformant lines Sod -\ +  to Sod -5, +  ladder (BRL) was used for size markers (in kb).  respectively.  An  RNA  The regions corresponding  to the Sod and actin gene transcripts were excised from the membrane and the  transcripts  Cerenkov  quantified  radiation.  by  scintillation  counting  of the emitted  124  0 . 2 4 -  125  demonstrating  that the transposed Sod genes were functional.  Despite the  small amount of flanking DNA present, the 1.8 kb gene fragment to include all the cis-acting sequences necessary for Sod With  the exception  of  Sod  +  -l,  the strains  expressed greater levels of SOD-specific mRNA The  carrying  appears  gene expression. the transposon  than their wt counterparts.  discrepancy between the transcript level and SOD activity found in the line remains  Sod -l +  unexplained.  Parallel to the increased SOD mRNA  levels, greater SOD activity was demonstrated  in the other transformants.  In all cases, transformants exhibited higher enzyme activity than the  wt  controls.  E.  Longevity In  studies the superoxide scavenging ability of tissues has been  Drosophila,  implicated as an important determinant of longevity (Fleming et al., 1987). Therefore, the lifespan of the SOD 'null' mutant as well as that of the transformed lines overexpressing SOD was investigated. survival curves of all the sigmoid-shaped  Drosophila  death phase.  In this study, the  populations show the characteristic  The females were longer lived than the males  in most of the strains studied, although this is not always the case. lifespan of  Drosophila  The  depends to a large extent on the environmental  conditions and as many variables as possible must therefore be controlled. For  example, the food  known to alter lifespan.  volume, type  and frequency  Also, the mated or unmated status of the flies and  the age of the parents are important  factors which  lifespan (Lints, 1988). 1.  of replacement are  The longevity of wildtype isogenic Oregon R  affect  Drosophila  126  The survival curves of wt isogenic independent variation  experiments  at 29°C  in the average lifespans  Oregon R strain measured from two  are compared  was noted between  Previous studies on the lifespan of a Drosophila extended variation  period  of time  (Lints, 1988).  (figure  under  the same  24).  Slight  the two experiments.  strain measured  conditions  also  over an  show  some  Also, the elevated temperature of 29°C decreases  the lifespan of Drosophila,  but has no deleterious  effects on development  or behavioral activity (Leffelaar and Grigliatti, 1984a,b). 2.  The longevity of a SOD 'null' mutant At 29°C, the SOD 'null' mutant had a mean adult lifespan of 28 days  compared  to 42 days for wt (figure 25).  Since the genetic background of  the SOD 'null' mutant differed from that of the isogenic  wt strain, the mean  lifespans of the D/(3L)lxd /SOD 'null', SOD 'null7+ and D/(3L)lxd /+ hybrids 9  were determined.  9  These were 46, 52, and 56 days respectively (figure 25).  The free radical theory of aging would predict that a SOD 'null' mutant with its low SOD  level and subsequent impaired  would have a reduced lifespan. found  to be reduced when  genetic background. should have SOD  inbred  strains  importance  to wt Oregon  In contrast, the D/(3L)lxd /SOD 9  R  with  a different  'null' hybrid  which  levels lower than the homozygous SOD 'null' has a mean This unexpected finding may be a reflection  vigour which is known to result from crossing (Lamb,  1978).  of comparing  backgrounds.  In fact, the lifespan of the SOD 'null' was  compared  lifespan exceeding that of wt. of the hybrid  oxygen defense systems  These  the lifespans  Therefore, when  results  clearly  of strains  with  two highly  demonstrate the identical genetic  the genetic backgrounds are controlled, it  "127  Figure 24.  Lifespan of wt isogenic Oregon R measured at 29°C.  (a) The  lifespan of males and females (200 of each) from the wt isogenic Oregon R strain was measured on June 1988 at 29°C. the males.  The females lived longer than  The lifespan of (b) males (#2) and (c) females (#2) from the  same isogenic Oregon R strain (50 of each) was measured on January 1989 at 29°C and compared to the survival curves from June 1988.  The smaller  sample size in the second measurement did not affect the results obtained.  128  0  10  20  30 Ag«  40  SO  60  (days)  a •  0  10  20  30 Ag«  (days)  40  SO  60  « / • females female 12  129  Figure  Lifespan of a SOD null mutant measured at  25.  of males and females ( 2 0 0 of each) from a SOD compared to wt isogenic Oregon R.  The SOD  and  (c) females  from D / ( 3 L ) l x d / S O D 9  null mutant strain  isogenic Oregon R strain. 2 0 0 +/+; 2 0 0 SOD  was  The survival curves of (b) null,  D/(3L)lxd /+ flies were compared to that of the SOD 9  (a) The lifespan  null mutant had a mean adult  lifespan of 2 8 days compared to 4 2 days for wt. males  29°C.  SOD  null/+  and  null mutant and the wt  The sample sizes for (b) males were as follows:  null; 5 7 def/null ; 4 5 null/+; 7 0 def/+ (c) for females were  as follows: 2 0 0 +/+; 2 0 0 SOD null; 6 4 def/null; 4 0 null/+; 6 0 def/+.  1 30  Sod Sod +/+ +/+  10  i  null males null females males females  * * * *i  20 30 Age (days)  Sod . null males def/null males null/+ males def/+ males +/+ males  • •  A  Age (days)  a Sod null females • def/null females • +/null females • A  Age  (days)  def/+ females +/+ females  131  may be possible to demonstrate  that greatly diminished SOD  levels decrease  lifespan. 3.  The longevity of the transformed lines The  transformed  lines  overexpressing  SOD  comparable to that of wt (figures 26 and 27). females from the transformed lines Sod 1,2,4 +  At 29°C, the lifespan of Sod -2 +  lifespans  and 5 was measured at 29°C.  males was the same as wt. Males from  Sod +  In contrast, males from the  line had a decreased lifespan when compared to wt (figure 26).  +  29°C, the Sod -l  females have a lifespan comparable to wt, whereas  +  2,4,5  mean  The lifespan of males and  4,5 had lifespans marginally greater than wt. Sod -\  had  At  Sod +  females have an increased lifespan compared to wt (figure 27). The  survival curves were repeated at 25°C, with some results differing  from those obtained at 29° (figures 28 and 29). these  measurements may  lifespan of Sod -5 +  for these  was marginally shorter than wt males.  only the males from Sod -4 +  and Sod -3A  wt  (figure 29).  +  females, respectively  variability  transformed  In this experiment,  lines  were  At 25°C,  females was shorter and longer than  +  studied are summarized in Table VI. +  At 25°C, the  lived longer than wt males (figure 28).  the lifespan of Sod -l,2,5  the Sod  differences.  males was the same as wt, whereas the lifespan of males  +  from Sod -l,2,3  account  The variability inherent in  The mean  lifespan  of the strains  Thus, the differences in lifespan in  not large  enough  inherent in these types of measurements.  to overcome the These results show  that additional SOD clearly does not increase the lifespan of D r o s o p h i l a . F.  Sensitivity The  to  herbicide  paraquat paraquat  toxicity (methyl  viologen  dichloride  hydrate; 1,1'-  1 32  a  aga(days)  Figure 26.  Lifespan of males from Sod transformed lines at 29°C.  survival curves of the transformed lines (a) Sod -\ +  (80 males) and (b) Sod -4 +  +  males show marginally  +  to wt. Males from Sod -\ +  Sod -2 +  (70 males) was compared to  +  The longevity of Sod -2  wt (50 males) at 29°C. whereas the Sod -4,5  (70 males) and Sod -5  (90 males) and  The  males was the same as wt,  increased  longevity compared  showed decreased longevity when compared to wt.  1 33  a  •g«(d«y»)  o +/+ females • Sod -4 females • Sod -S females +  +  «g«(d«y«)  Figure 27.  Lifespan of females from Sod transformed lines at 29°C.  longevity of the transformed lines (a) Sod -l  (100 females) and Sod -2  +  females) and (b) Sod -4 +  +  (70 females) and Sod -5  to wt (50 females) at 29°C.  (70 females) was  +  The lifespan of Sod -\ +  (80  compared  females was the same as  wt, whereas Sod -2,4,5 females lived longer than wt. +  The  1 34  100  a  80 70 60 50 40 30 20 10 90  H A B'  Tlr-*-**-*  0  —r-  • A a •  +/+ males Sod -l males Sod+-2 males Sod -3 males  H • •  +/+ males Sod -4 males Sod -5 males  +  +  80  20  100  + +  age(days)  Figure 28.  Lifespan of males from Sod transformed  longevity of the transformed lines (a) Sod -\ +  and Sod -3 +  (60 males) (b) Sod -A +  compared to wt (50 males) at 25°C. the same as wt, whereas Sod -1,2,3 +  The males from Sod -4 +  lines at 25°C.  (50 males), Sod -2 +  (60 males) and Sod -5 +  The  (60 males),  (60 males) was  The lifespan of males from Sod -5 +  was  males were shorter lived than wt males.  lived longer than wt males.  1 35  0  20  40  60  80  aga(days)  0  20  40  60  80  100  age(days)  Figure 29. longevity  Lifespan of females from Sod transformed lines at 25°C.  of the transformed lines  females), and Sod -3 +  (a) Sod -\ +  (60 females) (b) Sod -4 +  (60 females), Sod  3,4 were  longer  lived.  -2 (60  (60 females) and Sod -S  females) was compared to wt (50 females) at 25°C. females from Sod*-\,2,5  +  +  The  (60  Compared to wt, the  were shorter lived whereas the females from  Sod +  136  Table VI. Summary of longevity data. STRAIN  AVERAGE SOD-SPECIFIC ACTIVITY  MEAN LIFESPAN AT 29°C (days) males females  MEAN LIFESPAN AT 25°C (days) males females  100  41  47  ND  ND  wt #2 (Jan '89)  100  42  48  61  63  SOD 'null'  3.5*  28  28  ND  ND  D/(3L)lxd /SOD 'null'  1.7*  46  49  ND  ND  SOD 'null'/ +  51.7*  52  55  ND  ND  D/(3L)lxd / +  50.0*  56  59  ND  ND  Sod -l  132  39  47  53  51  Sod -2  148  44  49  54  56  Sod+-3  155  ND  ND  59  70  Sod+-4  138  43  52  61  72  Sod+-5  168  42  46  60  53  wt  (June'88)  9  9  +  +  • * ND The  data from Graf and Ayala (1986) theoretical values no data available survival curves for each strain are shown in figures 24-29.  lifespan of each strain is reported in days. as experimentally determined experimentally determined  The mean  Theoretical SOD activity as well  SOD activity values are also reported.  The  SOD activity values are from Table V and is an  average of the values for male and female samples.  1 37  dimethyl-4,4'-bipyridinium lethal to animals.  dichloride; P q ) is also highly cytotoxic and 2 +  The parent  cation P q  undergoes  2 +  a single electron  transfer to form a relatively stable paraquat free radical P q rapidly  O2 to form  with  toxicological  properties  reduction-oxidation  superoxide  anions  of paraquat  (O2").  are due  The herbicidal and  to this  single  electron  reaction, resulting in depletion of cellular NADPH and  the generation of potentially toxic forms of O2 such as O2". O 2" formed  which reacts  +  which  is not removed  by SOD  The excessive  is responsible  directly or  indirectly for cell death (Hassan and Fridovich, 1978; 1979). Feeding adult D r o s o p h i l a  with aqueous P q  may result in exposure of  2 +  of O2" radicals above the tolerance level of the  the fly to concentrations  fly's endogenous protective mechanisms.  For the SOD  was sufficient to kill all the flies in 48 hr.  survive  from 0-15 mM.  decreases  linearly  as  paraquat  For the other strains, the  response to paraquat dosage appears to be biphasic. which  null, 15 mM  paraquat  The number of flies  concentration  The curve forms a plateau for 15-40 mM  possible explaination for the existence of the plateau may  increases  paraquat.  One  be a saturation  of the system which generates O2" from paraquat.  That is, feeding the flies  paraquat  does  concentrations  additional O2" in vivo.  greater  than  15  mM  not produce  any  Also, it is not known why the plateau is lower in the  D/(3L)lxd /TM3SfeSer and transformed lines compared to wt. 9  The SOD 'null' mutant with only 3.5% of the wt level of SOD protein is clearly  hypersensitive  to P q  2 +  exposure due to its decreased capacity to  dismutate O2" (Graf and Ayala, 1986). SOD 'null' mutant and 10 mM  The LD50 values were 2 mM  for the  for wt isogenic Oregon R flies (figure 30).  The  138  Figure 30.  Sensitivity  to paraquat toxicity of the transformed and control  strains-percent  survivors  after  hypersensitive  to paraquat  sensitivity compared to wt.  48 hr exposure.  (a)  The  SOD  and the D / ( 3 L ) l x d / T M 3 S b S e r 9  (b) The transformed lines Sod -l,2 +  null  had the same have lower  resistance to paraquat at all concentrations measured compared to wt. The resistance to paraquat of transformed lines Sod resistance to paraquat than wt.  +  -4,5  was  (c)  also have lower  1 39  0  5  0  10  5  10  15  20  25  paraquat  mM  15  20  25  paraquat  mM  30  30  35  35  40  40  •a  wt  •«—  Sod+1  -*  Sod+2  140  D/(3L)lxd /TM3SoSer strain has 50% 9  Pq  of the wt SOD protein but showed a  sensitivity comparable to that of wt (figure 30).  2 +  This result suggests  that 5 0 % of the wt SOD activity provides sufficient protection against O2" cytotoxicity. The  transformed  resistance to paraquat.  lines  overexpressing  SOD showed  no increased  In fact, their LD50 values ranged from 4 to 6 mM,  which is slightly lower than wt (figure  30).  In comparing the paraquat Sod -4  resistance of the transformed lines to each other, it appears that the line has the greatest resistance to paraquat (figure Therefore, increased SOD activity in Drosophila resistance to paraquat-generated superoxide radicals. the  transformants,  to paraquat. O2"  increased  resulted  31). did not confer greater On the contrary,  in an increased  2 +  forms of oxygen (*OH,  sensitivity  would be dismutated to H2O2 as well as other active *02), which may be more toxic than O2".  cells, clones  that  overproduced  SOD showed  peroxidation  in biological  systems  pathological conditions (Yagi, 1982).  have  been  In cultured  increased  peroxidation when exposed to paraquat (Elroy-Stein et al., 1986).  alone  in  It may be argued that with elevated levels of SOD activity, the  generated by P q  mammalian  activity  +  implicated  lipid  Also, lipid in various  Thus, elevated levels of SOD activity  are not necessarily advantageous. Although  concentration toxicity.  increased of this  SOD  enzyme  activity must  be present  The SOD 'null' mutant with 3.5%  hypersensitive  to paraquat-generated  is not essential,  a threshold  to overcome  paraquat  of the wt SOD activity was clearly  O2". This partial SOD 'null' had a  LD50 value of 2 mM for exposure to paraquat, while the mutant c 5 0 D ^ 8 n l  (  141  Figure  31.  Comparison of paraquat sensitivity  lines-percent survivors after 48 hr exposure. the  transformed lines  were compared  appear to have the highest Sod+-3 (b) Sod+-5 (c)  the transformed  The resistance to paraquat of  to each  other.  The Sod -4 +  resistance to paraquat when compared  Sod -l,2. +  between  line to (a)  142  Sod+3 Sod+4  l—'—i— —i—«—r 1  20  25  30  35  40  paraquat mM  100  Sod+1 Sod+2 Sod+4  paraquat  mM  100  Sod+4 Sod+5  paraquat  143  which is apparently devoid of SOD activity had a much lower value of 0.05 mM  (Phillips et al., 1989).  D/(3L)lxd /TM3So5er  In contrast, the heterozygous SOD deficiency with  9  5 0 % of the wt SOD  hypersensitive to O2" generated by paraquat. of  the wt  SOD  activity  provides  activity  was not  This result suggests that 50%  sufficient  protection  against O 2 "  cytotoxicity. Catalase  also  oxygen toxicity  plays  an important  role in cellular  defense  by removing the H 2 O 2 formed by SOD.  against  Parallel to the  findings with SOD, a mutant, C a f , with only 5 % of the wt catalase activity n2  exhibited a two-fold Caf  increase in resistance to H 2 O 2 when compared to the  mutant that has no detectable catalase activity (MacKay and Bewley,  n l  1989).  Also, a 50% reduction in catalase activity had little or no effect on  H 2 O 2 sensitivity (MacKay and Bewley, 1989). catalase with  activity  are dramatically  a few percent  protection  against  impaired  Thus, mutants lacking SOD or in oxygen  of the wt activities  metabolism, those  are provided  with  significant  O2" and H 2 O 2 toxicity, while those with 5 0 % of the wt  levels are as resistant as wt. G.  Concluding  remarks  In this study, the CuZn SOD gene from D. melanogaster analyzed.  Transformed  lines  were  was cloned and  successfully created  with  additional  copies of the SOD gene whose expression results in increased SOD activity. Since  the transformants  controls, it was now  have  the same  genetic  possible to compare  background  unequivocally  as the wt  the effect of  increased SOD activity on oxygen metabolism and longevity in D r o s o p h i l a . We  found  that increased  SOD  levels have little  effect  on resistance to  144  O 2 " and  paraquat-generated activity  are  sufficient  to  lifespan and  provide  that very low  significant  levels of  protection  against  SOD O2"  cytotoxicity. Our  findings do  not  contradict the  Despite the observation that the SOD animals  correlates directly  Drosophila  Another important mitochondrial Mn the  the total SOD  process. Mn  SOD  of  aging.  in a wide range of  with their longevity (Tolmasoff  et al., 1980),  protective enzyme not considered in this study is  SOD.  In eukaryotes, most of the oxygen is metabolized  damage  to  production (Miquel, 1988).  SOD  activity found  theory  and catalase.  mitochondrion.  peroxidative  Mn  radical  appears to be well protected against the toxic effects of oxygen  by its native levels of SOD  within  free  Aging  may  mitochondria, Since Mn  activity in Drosophila  rather than CuZn SOD  SOD  be  the  resulting  result in  of  accumulated  decreased  activity represents only 10%  ATP of  (Massie et al., 1980), it is possible that levels are the limiting factor in the aging  Therefore, isolation, characterization and gene is the focus of our future work.  transformation of the  145 REFERENCES Ames, B.N.: 1256-1264.  Dietary carcinogens  and  anticarcinogens.  Science 221  Atkinson, T . and Smith, M. (1984) in "Oligonucleotide Synthesis: Approach", M.J. Gait, ed. IRL Press, Oxford, 35-81.  (1983)  A Practical  Avraham, K.B., Schickler, M., Sapoznikov, D., Yarom, R. and Groner, Y.: Down's syndrome: Abnormal neuromuscular junction in tongue of transgenic mice with elevated levels of human Cu/Zn-superoxide dismutase. Cell 54 (1988) 823-829. Bannister, J.V and Bannister, W.H.: Isolation and characterization of superoxide dismutase, Methods Enzymol. 105 (1984) 88-93. Bartosz, G., Leyko, W. and Fried, R.: Superoxide dismutase and life span of Drosophila melanogaster. Mech. Ageing Dev. 12 (1979) 1193. Bartosz, G., Tannert, C, Fried, R. and Leyko, W.: Superoxide dismutase activity decreases during erythrocyte aging. Experienta 34 (1978) 1464. Beauchamp, C. and Fridovich, I.: Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 44 (1971) 276287. Benton, W.D. and Davis, R.W.: Screening Xgt recombinant clones hybridization to single plaques in situ. Science 196 (1977) 180-182.  by  Bewley, G.C.: cDNA and deduced amino acid sequence of murine Cu-Zn superoxide dismutase. Nucleic Acids Res., 16 (1988) 2728. Birmingham-McDonogh, O., Gralla, E.B. and Valentine, J.S.: The copper, zinc-superoxide dismutase gene of Saccharomyces cerevisiae: Cloning, sequencing, and biological activity. Proc. Natl. Acad. Sci. USA 85 (1988) 4789-4793. Birnboim, H.C. and Doly, J.: A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7 (1979) 15131523. Bradford, M.M.: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72 (1976) 248-254. Breathnach, R. and Chambon, P.: Organization and expression of euckaryotic split genes coding for proteins. Ann. Rev. Biochem. 50 (1981) 349-383. Breathnach, R., Benoist, C, O'Hare, K., Gannon, F. and Chambon, P.: Ovalbumin gene: Evidence for a leader sequence in mRNA and DNA  146 sequences at the exon-intron (1978) 4853-4857.  boundaries.  Proc. Natl. Acad. Sci. USA 75  Campbell, S.D., Hilliker, A.J. and Phillips, J.P.: Cytogenetic analysis of the cSOD microregion in Drosophila melanogaster. Genetics 112 (1986) 205-215. Carlioz, A. and Touati, D.: Isolation of superoxide dismutase mutants in Escherichia coli: is superoxide dismutase necessary for aerobic life?. EMBO J. 5 (1986) 623-630. Cavener, D.R.: Comparision of the consensus translational start sites in Drosophila and vertebrates. 15 (1987) 1353-1361.  sequence flanking Nucleic Acids Res.  Chen, E.Y. and Seeburg, P.H.: Supercoil sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4 (1985) 165-170. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J.: Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18 (1979) 5294-5299. Cleveland, D.W. and Sullivan, K.F.: Molecular tubulin, Ann. Rev. Biochem. 54 (1985) 331-365.  biology and genetics of  Crapo, J.D., McCord, J.M. and Fridovich, I.: Preparation and assay of superoxide dismutases. Methods Enzymol. 53 (1978) 382-393. Cutler, R.G.: Antioxidants and longevity of mammalian species. Basic Life Sciences 35 (1985) 15-73. Cutler, R.G.: Antioxidants, aging, and longevity, in Free Radicals in Biology Vol. VI, Pryor, W.A. (Ed.), 1984, Academic Press, New York, 371-428. Danciger, E., Dafni, N., Bernstein, Y., Laver-Rudich, Z., Neer, A. and Groner, Y.: Human Cu/Zn superoxide dismutase gene family: Molecular structure and characterization of four Cu/Zn superoxide dismutase-related pseudogenes. Proc. Natl. Acad. Sci. USA 83 (1986) 3619-3623. Delabar, J-M., Nicole, A., D'Auriol, L., Jacob, Y., Meunier-Rotival, M., Galibert, F., Sinet, P-M. and Jerome, H.: Cloning and sequencing of a rat CuZn superoxide dismutase cDNA. Correlation between CuZn superoxide dismutase mRNA level and enzyme activity. Eur. J. Biochem. 166 (1987) 181187. Dunn, R., McCoy, J., Simsek, M., Majumdar, A., Chang, S.H., RajBhandary, U.L. and Khorana, H.G.: The bacteriorhodopson gene. Proc. Natl. Acad. Sci. USA, 78 (1981) 6744-6748. Dynan, W.S.: 196-197.  Promoters for housekeeping genes.  Trends Genetics 2 (1986)  147 Elroy-Stein, O. and Groner, Y.: Impaired neurotransmitter uptake in PC12 cells overexpressing human Cu/Zn-superoxide dismutase-implication for gene dosage effects in Down syndrome. Cell 52 (1988) 259-267. Elroy-Stein, O., Bernstein, Y. and Groner, Y.: Overproduction of human Cu/Zn-superoxide dismutase in transfected cells: extenuation of paraquatmediated cytotoxicity and enhancement of lipid peroxidation. EMBO J. 5 (1986) 615-622. Ephrussi, B. and Beadle, G.W.: A technique of transplantation for Drosophila. Am. Naturalist 70 (1936) 218. Farrington, J.A., Ebert, M., Land, E.J. and Fletcher, K.: Bipyridylium quaternary salts and related compounds. V. Pulse radiolysis studies of the reaction of paraquat radical with oxygen. Implications for the mode of action of bipyridyl herbicides. Biochem. Biophys. Acta 314 (1973) 372-381. Fleming, J.E., Shibuya, R.B. and Bensch, K.G.: consumption and hydroxyl radical scavenging capacity Drosophila melanogaster. Age 10 (1987) 86-89.  Lifespan, oxygen of two strains of  Flohe, L. and Otting, F.: Superoxide dismutase assays, Methods Enzymol. 105 (1984) 93-105. Fridovich, I.: Oxygen toxicity in prokaryotes: The importance of superoxide dismutases, in Superoxide dismutases Vol. 1, Oberley, L.W. (Ed.), 1982a, CRC Press, Boca Raton, pp. 79-88. Fridovich, I: Measuring the activity of superoxide dismutases: an embarrassment of riches, in Superoxide Dismutase Vol. I, 1982b, CRC Press, Boca Raton, pp. 69-77. Fridovich, I: The biology of oxygen radicals. Science 201 (1978) 875-880. Fyrberg, E.A., Kindle, K.L., Davidson, N. and Sodja, A.: The actin genes of Drosophila: a dispersed multigene family. Cell 19 (1980) 365-378. Gall, J.G. and Pardue, M.L.: Nucleic acid hybridization preparations. Methods Enzymol. 21 (1971) 470-480.  in cytological  Getzoff, E.D., Tainer, J.A., Stempien, M.M., Bell, G.I. and Hallewell, R.A.: Evolution of CuZn superoxide dismutase and the greek key P-barrel structural motif. Proteins 5 (1989) 322-336. Goldberg, D.A., Posakony, J.W. and Maniatis, T.: Correct developmental expression of a cloned alcohol dehydrogenase gene transduced into the Drosophila germ line. Cell 34 (1983) 59-73. Graf, J.-D. and Ayala, F.J.: in Drosophila melanogaster.  Genetic variation for superoxide dismutase level Biochem. Genet. 24 (1986) 153-168.  148  Grantham, R., Gautier, C. and Gouy, M.: Codon frequencies in 119 individual genes confirm consistent choices of degenerate bases according to genome type. Nucleic Acids Res., 8 (1980) 1893-1912. Guo, L-H. and Wu, R.: Exonuclease III: Use for DNA sequence analysis and in specific deletions of nucleotides. Methods Enzymol. 100 (1983) 60-96. Hallewell, R.A., Masiarz, F.R., Najarian, R.C., Puma, J.P., Quiroga, M.R., Randolph, A., Sanchez-Pescador, R., Scandella, C.J., Smith, B., Steimer, K.S. and Mullenbach, G.T.: Human Cu/Zn superoxide dismutase cDNA: isolation of clones synthesising high levels of active or inactive enzyme from an expression library. Nucleic Acids Res. 13 (1985) 2017-2034. Harman, D. : Free radical theory of aging: effect of free radical reaction inhibitors on the mortality rate of male L A F mice. J. Gerontology 23 (1968) 476-482. Harman, D.: 7128.  The aging process. Proc. Natl. Acad. Sci. USA 78 (1981) 7124-  Harman, D.: The free radical theory of aging, in Free Radicals in Biology Vol. V, Pryor, W.A. (Ed.), 1982, Academic Press, New York, pp. 255-275. Hass, M.A., Iqbal, J., Clerch, L.B., Frank, L. and Massaro, D.: Rat lung Cu.Zn superoxide dismutase. J. Clin. Invest 83 (1989) 1241-1246. Hassan, H.M. and Fridovich, I.: Regulation of the synthesis of superoxide dismutase in Escherichia coli. J. Biol. Chem. 252 (1977) 7667-7672. Hassan, H.M. and Fridovich, I.: Superoxide radical and the oxygen enhancement of the toxicity of paraquat in Escherichia coli. J. Biol. Chem. 253 (1978) 8143-8148. Hassan, H.M. and Fridovich, I.: Intracellular production of superoxide radical and of hydrogen peroxide by redox active compounds. Arch. Biochem. Biophys. 196 (1979) 385-395. Hawkins, J.D.: A survey on intron and exon lengths. (1988) 9893-9908.  Nucleic Acids Res., 16  Hayashi, S., Gillam, I.C., Delaney, A.D. and Tener, G.M.: chromosome squashes of D r o s o p h i l a melanogaster background in autoradiographs from hybridization with RNA. J. Histochem. Cytochem. 26 (1978) 677-679.  Acetylation of decreases the I] -label led  Hazelrigg, T., Levis, R. and Rubin, G.M.: Transformation of white locus DNA in Drosophila: Dosage compensation, zeste interaction, and position effects. Cell 36 (1984) 469-481. Henikoff, S.: Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28 (1984) 351-359.  149  Hill, D.L.: Chemical removal of the chorion Drosophila Information Service 19 (1945) 62.  from  Drosophila  eggs.  Hjalmarsson, K., Marklund, S.L., Engstrom, A. and Edlund, T.: Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase. Proc. Natl. Acad. Sci. USA 84 (1987) 6340-6344. Ho, Y. and Crapo, J.D.: cDNA and deduced amino acid sequence of rat copper-zinc-containing superoxide dismutase. Nucleic Acids Res., 15 (1987) 6746. Jelnes, J.E.: Identification of hexokinases and localisation of a fructokinase and a tetrazolium oxidase locus in Drosophila melanogaster. Hereditas 67 (1971) 291-293. Jowett, T.: Preparation of nucleic acids in Roberts, D.B. practical approach. IRL Press, Oxford, 1986, 275-286.  (Ed.), Drosophila, a  Kaiser, K. and Murray, N.E.: The use of phage lambda replacement vectors in the construction of representative genomic DNA libraries. In DNA Cloning, Vol. I. Glover, D.M. (Ed.) IRL Press, Oxford, 1985. Karess, R.E. and Rubin, G.M.: Analysis of P transposable element functions in Drosophila. Cell 38 (1984) 135-146. Karess, R.E.: P element mediated germ line transformation of Drosophila. In DNA Cloning, Vol. II. Glover, D.M. (Ed.). IRL Press, Oxford, 1985. Kellogg, E.W. and Fridovich, I.: Superoxide dismutase in the rat and mouse as a function of age and longevity. J. Gerontol. 31 (1976) 405-408. Kirby, T.W. and Fridovich, I.: A picomolar spectrophotometric superoxide dismutase, Anal. Biochem. 127 (1982) 435-440. Kirkland, K.C. genomic DNA from Drosophila Lamb, M.J.:  assay for  and Phillips, J.P.: Isolation and chromosomal localization of sequences coding for the cytoplasmic superoxide dismutase melanogaster . Gene 61 (1987) 415-419.  Biology of Ageing, Blackie, Glasgow, 1977.  Lamb, M.J.: Ageing. In The Genetics and Biology of Drosophila, Vol. 2C. Ashburner, M. and Wright, T.R.F. (Eds.). Academic Press, New York, 1978, 43-104. Lammi-Keffe, C.J., Swan, P.B. and Hegarty, P.V.J.: Copper-zinc and manganese superoxide dismutase activities in cardiac and skeletal muscles during aging in male rats. Gerontology 30 (1984) 153-158. Langer, P.R., Waldrop, A.A. and Ward, D.C: labelled polynucleotides: novel nucleic acid  Enzymatic synthesis of biotinaffinity probes. Proc. Natl.  150 Acad. Sci. USA 78 (1981) 6633-6637. Lathe, R.: Synthetic oligonucleotide probes deduced sequence data: theoretical and practical considerations. (1985) 1-12.  from amino acid J. Mol. Biol. 183  Lee, Y.M. and Ayala, F.J.: Superoxide dismutase of Drosophila melanogaster. Mutation site difference between two electromorphs. FEBS Lett. 179 (1985) 115-119. Lee, Y.M., Ayala, F.J. and Misra, H.P.: Purification and properties of superoxide dismutase from Drosophila melanogaster. J. Biol. Chem. 256 (1981a) 8506-8509. Lee, Y.M., Friedman, D.J. and Ayala, F.J.: Complete amino acid sequence of copper-zinc superoxide dismutase from Drosophila melanogaster. Arch. Biochem. Biophys. 241 (1985a) 577-589. Lee, Y.M., Friedman, D.J. and Ayala, F.J.: Superoxide dismutase: an evolutionary puzzle. Proc. Natl. Acad. Sci. USA 82 (1985b) 824-828. Lee, Y.M., Misra, H.P. and Ayala, F.J.: Superoxide dismutase in Drosophila melanogaster : Biochemical and structural characterization of allozyme variants. Proc. Natl. Acad. Sci. USA 78 (1981b) 7052-7055. Leffelaar, D. and Grigliatti, T.: Age-dependent behavior loss in adult Drosophila melanogaster. Dev. Genet. 4 (1984a) 211-227. Leffelaar, D. and Grigliatti, T.: A mutation in Drosophila accelerate aging. Dev. Genet. 4 (1984b) 199-210.  that appears to  Leung, J. Concerted evolution of a cluster of X-linked tRNA^ySer Genes from Drosophila melanogaster. University of British Columbia PhD thesis, 1988. Levanon, D., Lieman-Hurwitz, J., Dafni, N., Wigderson, M., Sherman, L., Bernstein, Y., Laver-Rudich, Z., Danciger, E., Stein, O. and Groner, Y.: Architecture and anatomy of the chromosomal locus in human chromosome 21 encoding the Cu/Zn superoxide dismutase. EMBO J. 4 (1985) 77-84. Lieman-Hurwitz, J., Dafni, N., Lavie, V. and Groner, Y.: Human cytoplasmic superoxide dismutase cDNA clone: A probe for studying the molecular biology of Down syndrome. Proc. Natl. Acad. Sci. USA 79 (1982) 2808-2811. Lindsley, D. and Grell, R.: Genetic Variations of Drosophila melanogaster, Carnegie Inst., Washington, 1968. Lints, F.A. : Aim and scope of Drosophila aging research in Drosophila as a model organism for ageing studies, Lints, F.A. and Soliman, M.H. (Eds),  151 Blackie, 1988, Glasgow, 3-16. Lints, F.A. and Soliman, M.H. (Eds): Drosophila Ageing Studies, Blackie, 1988, Glasgow.  as a Model Organism for  MacKay, W.J. and Bewley, G.C.: The genetics of catalase in Drosophila melanogaster:: isolation and characterization of acatalasemic mutants. Genetics 122 (1989) 643-652. Mahmoudi, M. and Lin, V.K.: Comparison of two different hybridization systems in northern transfer analysis. Biotechniques 7 (1989) 331-333. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Marklund, S.: Spectrophotometric study of spontaneous disproportionation of superoxide anion radical-a sensitive direct assay of superoxide dismutase, J. Biol. Chem. 251 (1976) 7504-7507. Martin, G.H. and Castro, M.M.: Base pairing involving deoxyinosine: implications for probe design, Nucleic Acids Res. 13 (1985) 8927-8938. Masaro, E.J., Yu, B.P. and Bertrand, H.A.: Action of food restriction in delaying the aging process. Proc. Natl. Acad. Sci. USA 79 (1982) 4239-4241. Massie, H.R., Aiello, V.R. and Iodice, A.A.: Changes with age in copper and superoxide dismutase levels in brains of C57BL/6J mice. Mech. Ageing Dev. 10 (1979) 93-99. Massie, H.R., Aiello, V.R. and Williams, T.R.: Changes in superoxide dismutase activity and copper during development and ageing in the fruit fly Drosophila melanogaster. Mech. Ageing Dev. 12 (1980) 279-286. Massie, H.R., Williams, T.R. and Aiello, V.R.: in two different wild-type strains of Drosophila 27 (1981) 205-208.  Superoxide dismutase activity melanogaster. Gerontology  McCord, J.M. and Fridovich, I.: Superoxide dismutase-an enzymic function for erythrocuprein (hemocuprein). J. Biol. Chem. 244 (1969) 6049-6055. McCord, J.M., Crapo, J.D. and Fridovich, I.: Superoxide dismutase assays: a review of methodology, in Superoxide and superoxide dismutases, Michelson, A.M., McCord, J.M. and Fridovich, I. (Eds.), 1977, Academic Press, London, pp. 11-17. McKnight, S.L., Kingsbury, R.D., Spence, A. and Smith, M.: transcription signals of the Herpesvirus tk gene share hexanucleotide control sequence. Cell 37 (1984) 253-262. Messing, J.:  New vectors for cloning.  The distal a common  Methods in Enzymology 101 (1983)  152 20-78. Miller, J.H.: Experiments in molecular genetics. Laboratory, Cold Spring Harbor, NY, 1972.  Cold  Spring Harbour  Miquel, J., Economos, A.C., Beusch, K.G., Atlan, H. and Johnson, J.E.: of cell aging in Drosophila and mouse. Age 2 (1979) 78-88. Miquel, J., Economos, A.C., Fleming, J. and Johnson, J.E.: (1980) 575-591.  Exp. Gerontol. 15  Miquel, J.: Ultrastructure and cytochemistry, in Drosophila organism for ageing studies, Blackie, 1988, Glasgow, 193-200. Mount, S.M.: A catalogue of splice junction sequences. 10 (1982) 459-472. Nettleton, C.J., Bull, C , Baldwin, T.O. and Fee, Escherichia coli iron superoxide dismutase intracellular superoxide concentration does dependent synthesis of the manganese superoxide Acad. Sci. USA 81 (1984) 4970-4973. Newton, C.H.: Transfer RNA genes in D. British Columbia MSc. thesis, 1984.  Review  as a model  Nucleic Acids Res.  J.A.: Isolation of the gene: Evidence that not regulate oxygendismutase. Proc. Natl.  melanogaster. University of  Nickla, H., Anderson, J. and Palzkill, T.: Enzymes involved in oxygen detoxification during development of Drosophila melanogaster. Experientia 39 (1983) 610-612. O'Connell, P. and Rosbash, M.: Sequence, structure, and codon preference of the Drosophila ribosomal protein 49 gene. Nucleic Acids Res. 12 (1984) 5495-5514. O'Hare, K. and Rubin, G.M.: Structures of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34 (1983) 25-35. Oberley, L.W.: Superoxide dismutase and cancer, in Superoxide dismutase Vol. II, Oberley, L.W. (Ed.), 1982, CRC Press, Boca Raton, pp.127-165. Paynter, D.I. and Caple, I.W.: Age-related changes in activities of the superoxide dismutase enzymes in tissue of the sheep and the effect of dietary copper and manganese on these changes. J. Nutrition 114 (1984) 1090-1916. Peng, T., Moya, A. and Ayala, F.J.: Irradiation-resistance conferred by superoxide dismutase: Possible adaptive role of a natural polymorphism in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 83 (1986) 684-687.  153 Phillips, J.P., Campbell, S.D., Michaud, D., Charbonneau, M. and Hilliker, A.J.: Null mutation of copper/zinc superoxide dismutase in Drosophila confers hypersensitivity to paraquat and reduced longevity. Proc. Natl. Acad. Sci. USA 86 (1989) 2761-2765. Poole, S.J., Kauvar, L.M., Drees, B. and Kornberg, T.: The engrailed locus of Drosophila: structural analysis of an embryonic transcript. Cell 40 (1985) 37-43. Putney, S.D., Benkovic, S.J. and Schimmcl, P.R.: A DNA fragment with an aphosphorothioate nucleotide at one end is asymmetrically blocked from digestion by exonuclease 111 and can be replicated in vivo . Proc. Natl. Acad. Sci. USA 78 (1981) 7350-7354. Reiss, U. and Gershon, D.: Comparison of cytoplasmic superoxide dismutase in liver, heart and brain of aging rats and mice. Biochem. Biophys. Res. Commun. 73 (1976a) 255-262. Reiss, U. and Gershon, D.: 63 (1976b) 617-623.  Rat-liver superoxide dismutase. Eur. J. Biochem.  Rigby, P.W.S., Diekman M., Rhodes, C. and Berg, P.: Labelling deoxyribonucleic acids to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 113 (1977) 237-251. Ross, M.H.: 257-265.  Dietary behavior and longevity. Nutritional Reviews 35 (1977)  Rubin, G.M. and Spradling, A.C: Genetic transformation of with transposable element vectors. Science 218 (1982) 348-353.  Drosophila  Rubin, G.M. et al.: The Rubin Laboratory Manual: "Procedures for the molecular biology of Drosophila", available from the Rubin laboratory, 1986. Sakamoto, H. and Touati, D.: Cloning of the iron superoxide dismutase gene (sodB) in Escherichia coli K-12. J. Bacteriol. 159 (1984) 418-420. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74 (1977) 5463-5466. Schickler, M., Knobler, H., Avaraham, K.B., Elroy-Stein, O. and Groner, Y . : Diminished serotonin uptake in platelets of transgenic mice with increased Cu/Zn-superoxide dismutase activity. EMBO J. 8 (1989) 1385-1392. Scholnick, S.B., Morgan, B.A. and Hirsh, J.: The cloned dopa decarboxylase gene is developmentally regulated when reintegrated into the Drosophila genome. Cell 34 (1983) 37-45. Schott, D.R., Baldwin, M.C. and Finnerty, V.: Molybdenum hydroxylases in Drosophila. III. Further characterization of the low xanthine  154 dehydrogenase gene.  Biochem. Genet. 24 (1986) 509-527.  Seto, N.O.L. : The copper-zinc dismutase gene from Drosophila melanogaster : attempts to clone the gene using two mixed sequence oligonucleotide probes (1987) M.Sc. thesis, University of British Columbia. Seto, N.O.L., Hayashi, S. and Tcncr, G.M.: Cloning, sequence analysis and chromosomal localization of the Cu-Zn superoxide dismutase gene of Drosophila melanogaster . Gene 75 (1989) 85-92. Seto, N.O.L., Hayashi, S. and Tencr, G.M.: Drosophila Cu-Zn superoxide dismutase cDNA sequence. Nucleic Acids Res. 15 (1987a) 5483. Seto, N.O.L., Hayashi, S. and Tener, G.M.: The sequence of the Cu-Zn superoxide dismutase gene of Drosophila. Nucleic Acids Res. 15 (1987b) 10601. Sherman, L., Dafni, N., Lieman-Hurwitz, J. and Groner, Y.: sequence and expression of human chromosome 21-encoded dismutase mRNA. Proc. Natl. Acad. Sci. USA 80 (1983) 5465-5469.  Nucleotide superoxide  Sherman, L., Levanon, D., Lieman-Hurwitz, J., Dafni, N. and Groner, Y.: Human Cu/Zn superoxide dismutase gene: molecular characterization of its two mRNA species. Nucleic Acids Res. 12 (1984) 9349-9365. Shock, N.W.: Biological theories of aging, in CRC Handbook of Biochemistry in Aging, Florini, J.R. (Ed.), CRC Press Inc., Boca Raton, 1981. Smith, M.: In vitro mutagenesis.  Ann. Rev. Genetics 19 (1985) 423-463.  Southern, E.M.: Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98 (1975) 503-517. Spradling, A.C. and Rubin, G.M.: The effect of chromosomal position on the expression of the Drosophila xanthine dehydrogenase gene. Cell 34 (1983) 47-57. Spradling, A.C. and Rubin, G.M.: The transposition of cloned P elements into Drosophila germ line chromosomes. Science 218 (1982) 341-347. Steinman, H.M.: Bacteriocuprein superoxide dismutase of Photobacterium leiognathi. Isolation and sequence of the gene and evidence for a precursor form. J. Biol. Chem. 262 (1987) 1882-1887. Steinman, H.M.: Superoxide dismutases: protein chemistry and structurefunction relationships, in Superoxide dismutase Vol. I, Oberley, L.W. (Ed.), 1982, CRC Press, Boca Raton, pp. 11-68. Steller, H. and Pirrolla, V.: A transposable P vector that confers selectable G418 resistance to Drosophila larvae. EMBO J. 4 (1985) 167-171.  155 Tabor, S. and Richardson, C C : DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84 (1987) 4767-4771. Tibell, L., Hjalmarsson, K., Edlund, T., Skogman, G., Engstrom, A. and Marklund, S.L.: Expression of human extracellular superoxide dismutase in Chinese hamster ovary cells and characterization of the product. Proc. Natl. Acad. Sci. USA 84 (1987) 6634-6638. Tolmasoff, J.M., Ono, T. and Cutler, R.G.: Superoxide dismutase: correlation with life-span and specific metabolic rate in primate species. Proc. Natl. Acad. Sci. USA 77 (1980) 2777-2781. vanLoon, A.P.G.M., Pesold-Hurt, B. and Schatz, G.: A yeast mutant lacking mitochondrial manganese-superoxidc dismutase is hypersensitive to oxygen. Proc. Natl. Acad. Sci. USA 83 (1986) 3820-3824. Warner, H.R., Butler, R.N., Sprotl, R.L. and Schneider, E.L. (Eds.): biological theories of aging. Raven Press, New York, 1987.  Modem  Watson, J.D., Hopkins, N.H., Roberts, J.W., Steitz, J.A. and Weiner, A.M.: Molecular Biology of the Gene, Benjamin/Cummings Publishing Co., Menlo Park, 1987. Weisiger, specificity.  R.A. and Fridovich. I.: Superoxide J. Biol. Chem. 248 (1973) 3582-3592.  dismutase-organelle  Yagi, K. (Ed.): Lipid peroxides in biology and medicine. New York, 1982.  Academic Press,  Yamamoto, K.R. and Alberts, B.M. Rapid bacteriophage sedimentation in the presence of polyethylene glycol and its application to large scale virus purfication. Virology 40 (1970) 734-744. Yanisch-Perron, C, Vieira, J. and Messing, J.: Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33 (1985) 103-119.  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items