Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

IL-10 regulates macrophage activation through activation of SHIP Ghanipour, Ali 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
831-ubc_2007-267202.pdf [ 13.53MB ]
Metadata
JSON: 831-1.0100390.json
JSON-LD: 831-1.0100390-ld.json
RDF/XML (Pretty): 831-1.0100390-rdf.xml
RDF/JSON: 831-1.0100390-rdf.json
Turtle: 831-1.0100390-turtle.txt
N-Triples: 831-1.0100390-rdf-ntriples.txt
Original Record: 831-1.0100390-source.json
Full Text
831-1.0100390-fulltext.txt
Citation
831-1.0100390.ris

Full Text

' IL-10 regulates macrophage activation through activation of SHIP by A l i Ghanipour B.Sc , Simon Fraser University, 2000 A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF G R A D U A T E STUDIES (Biochemistry) THE UNIVERSITY OF BRITISH C O L U M B I A April 2007 © A l i Ghanipour, 2007 Abstract IL-10 is a potent anti-inflammatory and immunosuppressive cytokine, which regulates macrophages by activation of the STAT3 pathway. However, several lines of evidence suggest that IL-10 can inhibit macrophage activation independent of STAT3 through currently unknown mechanisms and pathways. Here for the first time, we show that in murine macrophages, IL-10 activates Src Homology 2 Domain-containing Inositol 5'-Phosphatase (SHIP), a molecule with reported anti-inflammatory effects. Activation of SHIP by IL-10 is required for inhibition of Tumor necrosis factor alpha (TNFa) in macrophages. Additional experiments revealed that IL-10 activation of SHIP acted at the post-transcriptional level and inhibited translation of T N F a . Using a novel small molecule activator of SHIP, AQX-016A, we further confirmed that activation of SHIP alone could inhibit TNFa translation. IL-10 activation of SHIP results in the inhibition of the LPS induced increase in the PI3K product, PIP3,, at the membrane. However, conflicting data as to the role of PI3K in regulation of T N F a have been presented. Our studies show that PI3K inhibition downregulates T N F a production in peritoneal and several other macrophage lines, and upregulates it bone marrow derived macrophages (BMDM). Interestingly, this difference is due to the increased amount of autocrine negative regulators produced in B M D M , removal of which exposes the positive role PI3K plays in regulation of TNFa. Therefore, our studies confirm that PI3K activity positively regulates T N F a production in macrophages and that inhibition of TNFa by IL-10 or AQX-016A through activation of SHIP is likely due to SHIP'S ability to antagonize this pathway. The importance of this i i pathway is further highlighted as IL-10 inhibition of LPS-induced septic shock in mice lacking one allele of SHIP is significantly attenuated. Furthermore, activation of SHIP by AQX-016A inhibits T N F a production in septic mice. We also found that IL-10 inhibited LPS induced p38 activity in a cell-dependent manner. However in all cells tested, IL-10 activated p38 rapidly. We identified several IL-10 induced genes including CRIM1, a transmembrane protein with no previous report of involvement in the immune system. We found that IL-10 induction of CRIM1 was partly dependent on the activity of p38. However, expression of CRIM1 does not seem to be involved in the anti-inflammatory effects of IL-10. i i i Table of contents Abstract • • i i Table of contents iv List of figures vi List of abbreviations viii Chapter 1- Introduction 1 Inflammation 2 Bacterial cell wall architecture 4 Lipopolysaccharide 4 Pathogen sensors -5 The Toll like receptor family 5 The NOD like receptor family 7 R N A helicase •• 8 LPS receptor 8 LPS induced inflammation 10 Tumor necrosis factor 14 Signaling in macrophages 16 LPS signaling in macrophages 19 M A P K pathway . 21 PI3K pathway 22 Role of PI3K in activation of macrophages and other immune cells 24 SHIP 26 Interleukin-10 33 IL-10, homologues and expression... 34 IL-10 signaling 35 IL-10 receptor and STAT3 signaling 35 STAT3 independent IL-10 signalling 37 Post-transcriptional regulation of T N F a by IL-10 41 Thesis objectives • 44 Chapter 2: Methods and materials .46 Cell culture •. 47 iv Immuoprecipitation and immunoblot analysis 48 RNA isolation and Northern blot analysis 49 DNA probes and labeling 50 Cell stimulation for cytokine production and ELISA 52 Lipid isolation and HPLC analysis...! 52 Polyribosome analysis 53 Mouse endotoxemia model 54 Surface marker analysis 54 Transformation of bacteria 55 DNA sequencing. 55 CRIM1 siRNA 56 Statistics 57 Chapter 3: IL-10 inhibits TNFoc through activation of SHIP 58 Introduction 59 Results.-. 62 Discussion.. 77 Chapter 4: The PI3K pathway is a positive regulator of TNFa production 86 Introduction 87 Results 91 Discussion 108 Chapter 5 : IL-10 induces the expression of CRIM1 119 Introduction 120 Results 126 Discussion 135 Chapter 6: Conclusion chapter 142 Tables and supplementary data 146 References 151 v List of figures Figure 1: Macrophage activation and auto-regulation 13 Figure 2: LPS signaling and T N F a production 32 Figure 3: IL-10 requires SHIP to inhibit LPS-induced PKJ3 phosphoryaltion in macrophages 40 Figure 4: IL-10 signal transduction 43 Figure 5: IL-10 stimulates tyrosine phosphorylation of SHIP..... 64 Figure 6: IL-10 decreases LPS-induced PIP 3 levels and increases PI(3,4)P2 levels 65 Figure 7: IL-10 requires SHIP to inhibit LPS-induced T N F a production in macrophages ; ; 67 Figure 8: IL-10 using SHIP shifts LPS-induced T N F a mRNA from polysomes to mono somes 70 Figure 9: The A R E binding protein TIA-1 is not required for the IL-10-mediated inhibition of T N F a production 72 Figure 10 : IL-10 inhibits TNFa production in peritoneal exudates macrophages 74 Figure 11: Plasma T N F a levels induced by LPS are markedly reduced by IL-10 in SHIP + / + but not SHIP+ /" mice 76 Figure 12: Inhibition of PI3K differentially regulates T N F a production in macrophages depending on cell type 93 Figure 13: Expression of CD 1 lb and F4/80 is significantly lower in B M D M than in peritoneal macrophages 95 Figure 14: AQX-016A activates SHIP in intact cells , 98 Figure 15: AQX-016A inhibits P K B phosphorylation in a SHIP dependent manner.... 100 Figure 16: AQX-016A inhibits T N F a in J774 and peritoneal macrophages 101 Figure 17: AQX-016A requires SHIP to maximally inhibit T N F a production in B M D M ; 103 Figure 18: AQX-016A inhibits TNFa translation 105 Figure 19: AQX-016A inhibits T N F a production in mouse model of septicemia 107 Figure 20: CRIM1 structure and size 124 Figure 21: Method for mediating R N A interference in macrophages 125 vi Figure 22: IL-10 induces the expression of CRIM1 127 Figure 23: CRIM1 5' UTR region contains a STAT3 binding site 129 Figure 24: IL-10 activation of p38 regulates CRIM1 expression 130 Figure 25: IL-10 does not inhibit p38 phosphorylation in macrophages 132 Figure 26: IL-10 inhibition of NO or T N F a is not CRIM1 dependent 134 vii List of abbreviations B M D M Bone marrow derived macrophages A R E AU-rich elements B M M C Bone Marrow Derived Mast cells B T K Bruton tyrosine kinase CBP CREB-binding protein CREB cAMP responsive element binding protein 1 CRIM1 Cysteine-rich motor neuron 1 protein precursor CSF-1 Media D M M supplemented with 9% FBS and 5 ng/mL CSF-1 D M E M Dulbecco's modified Eagle's medium D N A DeoxyriboNucleic Acid EIF Eukaryotic translational initiation factors FBS Fetal Bovine Serum G A P D H Glyceraldehyde-3-Phosphate Dehydrogenase GEF Guanine nucleotide exchange factor HO-1 Heme Oxygenase 1 IBD Inflammatory Bowel Disease I D M M Iscove's Modification of D M E M IFIT Interferon-inducible tetratricopeptide repeat domain IFN-y Interferon-y IL-1 Interleukin-1 IL-10 Interleukin-10 IL-6 Interleukin-6 IRF3 Interferon Regulatory Factor JNK • c-Jun M A P kinase LPS Lipopolysaccharide MCP Monocyte chemotactic protein MIF Macrophage inhibitory factor MIP1 Macrophage inflammatory protein M K 2 M A P K A P 2 M T G Monothioglycolate NFkB Nuclear Factor Kappa B NO Nitric Oxide P B M C Peripheral blood mononuclear cells PDK1 3-Phosphoinositide-Dependent Kinase 1 PGE Prostaglandin PH Pleckstrin Homology Domain PI3K Phosphoinositide Kinase-3 P K C Protein kinase C P M Peritoneal Macrophage R N A RiboNucleic Acid SHIP Src Homology 2 Domain-containing Inositol 5'-Phosphatase SSC Standard Saline Citrate TC Tissue Culture T E P M Thioglycolate elicited peritoneal macrophages TF Tissue factor GF Transforming Growth Factor TIA-1 T-cell internal antigen 1 TIR Toll/IL-1 receptor domain r T N F a Tumor Necrosis Factor alpha T R A M TRIF-related adaptor molecule UTR Untranslated region x Chapter 1- Introduction Inflammation Inflammation is an essential component of the immune response and is required for optimal protection of a host against pathogens. Inflammation begins with recognition of foreign antigens by the host immune cells. Subsequently, activated immune cells are activated to produce several inflammatory mediators with the goal of eradicating the invader and restoring the normal state and function of the host tissues. Though critical in host defense against pathogens, i f not strictly regulated, potent products of the innate response can harm host tissues. Therefore, regulatory mechanisms involving the production of anti-inflammatory cytokines, and tissue repair agents that help resolve inflammatory responses have evolved (Figure 1) (Reviewed in (MacDermott, 1996; Serhan et al, 2005); Tracey et al, 2002). Understanding the mechanisms and the players involved in initiation and resolution of inflammation is an important step in identification of the underlying causes of inflammatory diseases. Central to the process of inflammation are macrophages. In tissue, macrophages are the first cells that recognize and respond to the presence of foreign antigens and initiate a cascade of events leading to an inflammatory response (Figure 1). The ability of a host to generate an inflammatory response is greatly impaired in the absence of macrophages as demonstrated when macrophages are depleted in inflammatory models of glomerulonephritis (Tipping et al, 1991), antigen-induced arthritis (Richards et al, 1999), uveitis (Baatz et al, 2001), and peritonitis (Knudsen et al, 2002) (Schumann et al, 2000). In an uncompromised body, there is a constant flow of monocytes from the bloodstream into the peripheral tissues. Upon entering the tissue, monocytes differentiate into macrophages, reside in the tissue, and enhance their ability to recognize foreign 2 antigens. Foreign antigens within the host tissue bind to specific receptors on macrophages and lead to their activation. During a bacterial infection, macrophages can be activated by direct interaction with bacteria or through recognition of soluble products of bacteria. Bacteria are surrounded by a complex set of surface layers, which protect their cell membrane from the environment. Embedded in these layers are unique components such as lipopolysaccharides (LPS) that are recognized by specific receptors on macrophages and lead to macrophage activation (Dinarello, 1997)^ Recognition of these components is required for activation of macrophages and initiation of the sequence of events leading to inflammation. The activated macrophages produce a variety of pro-inflammatory cytokines and chemokines including tumor necrosis factor-a (TNFo;), interleukin-6 (IL-6), and interleukin-1 (IL-1); bactericidal molecules including nitric oxide (NO), and oxygen radicals; and anti-inflammatory molecules including interleukin-10 (IL-10), prostaglandin E (PGE), and transforming growth factor (TGF-/3) (Figure 1) (Lawrence et al, 2002). Inflammatory mediators produced by resident macrophages induce an increase in adhesion molecules on the local vasculatures and with the aid of chemokines produced by the activated macrophages increase the migration of immune cells, including neutrophils and more macrophages into the tissue. The neutrophils aid by ingesting the foreign organisms and by producing more bactericidal molecules to fight bacterial infections (Young et al, 2002; Duffield, 2003). The activated neutrophils undergo apoptosis after which they are phagocytosed and cleared by tissue macrophages (Fadok et al, 1998). With time, the invading organism is removed from the tissue, production of inflammatory 3 molecules is decreased, immune cell migration is inhibited, and the process of tissue repair is initiated. Bacterial cell wall architecture Bacteria cell membranes are surrounded by a cell wall composed of a complex polymer known as peptidoglycan. In gram-positive bacteria, the peptidoglycan layer also contains other polymers such as teichoic and lipoteichoic acids (LTA). In gram-negative bacteria, such as Escherichia coli, an outer membrane is present over the cell wall. The outer membrane is a lipid bilayer structure made of phospholipids and a molecule unique to gram-negative bacteria known as lipopolysaccharide (LPS) (Raetz et al, 2002). Lipopolysaccharide LPS is among the most potent activators of the immune system and is regarded as the toxic portion of gram-negative bacteria. LPS molecules consist of three different regions. The first part, Lipid A is located at one end of LPS and anchors it to the outer membrane of the bacteria. Lipid A interacts with Toll-like receptors on the surface of macrophages and acts as a potent activator with toxic effects on the host (Raetz et al, 2002). Lipid A is composed of two glucosamine sugars bound to varying numbers of fatty acids. The second region is known as the core region and contains multiple 2-keto-3-deoxyoctonic acids and heptose sugars followed by a chain of several common sugars. The last portion of LPS is the O antigen. This portion is structurally diverse and is often used to differentiate LPS from different sources. The O antigen is made of varying numbers of repeating units of three monosacharides, which can be any of more than 60 4 different monosaccharides. The O antigen is the immunogenic portion of LPS (Van Amersfoort et al, 2003). Pathogen Sensors Our innate immune system has evolved germline-encoded receptors that recognize conserved products of metabolism produced by microbial pathogens, but not by our own bodies (Medzhitov et al, 1998). These conserved products of microbial metabolism are known as pathogen-associated molecular patterns (PAMPs) and act as ligands for the pathogen-recognition receptors (PRRs). The ability to recognize PAMPs allows the host to establish defensive actions, which include ingestion of pathogens, induction of anti-pathogenic molecules, directing of the host immune cells to the site of invasion and initiation of an immune response. The first of these receptors described were the Toll-like receptors (TLRs). These receptors play an important role in detecting extracellular and intracellular pathogens (Barton et al, 2002). Later several other PRRs such as NOD-like receptors and RIG-like receptors were also identified. The members of NOD-like receptor (NLR) family act as intracellular microbial sensors and are the largest family of intracellular PRRs. The members of RIG-like receptor (RLR) family are also intracellular, but are specific to virus detection (Creagh et al, 2006). The Toll like receptor family Toll-like receptors were originally discovered in Drosophila melanogaster as regulators of dorsoventral development of the fruit fly during embryogenesis. Later it was found that Toll is also involved in the antifungal responses of fruit flies and 5. generates signals necessary for the production of antifungal peptides (Medzhitov et al, 1998). Toll receptors are characterized by multiple copies of LRRs in their extracellular domain and a cytoplasmic portion that is homologous to IL-1 receptor. TLRs have been found among vertebrates, invertebrates, and even among plants, where they appear to have a role in defence of the host against invading pathogens (Beutler et al, 2000). In mammals, activation of TLRs is a pivotal event in the decision making process for initiation of a cellular immune response. The first supporting data for the role of TLRs in the mammalian immune response were obtained by the discovery of the gene encoding the human Toll (hToll) and initial characterization of its function in immune responses. Medzhitov et al. reported that a constitutively active mutant of hToll transfected into the human monocytic cell line THP-1, displayed characteristics resembling those resulting from THP-1 infection with microbial pathogens (Medzhitov et al, 1997). These studies suggested that hToll could play a role in recognition and response to microbial agents. To date, eleven different hTOLLs (TLR-1 to TLR-11) have been identified which are grouped as members of the TLR family each with affinity for different components of different pathogens. TLR-2 recognizes a wide range of microbial products including peptidoglycans, L T A , LPS from Parphyromonas gingivalis, lipoproteins and lipopetides from mycoplamsa species. TLR-2 also interacts with TLR-1 and TLR-6 to discriminate the subtle differences between different mycoplamsa derived lipopeptides. TLR-4 is required for recognition of lipopolysaccharides. TLR-5 recognizes flagellin, a component of bacterial flagella. TLR-3 confers responsiveness to dsRNA of viruses 6 while TLR-7 and TLR-8 recognize single stranded R N A from viruses. TLR-9 acts as a receptor for bacterial CpG,DNA (Takeda et al, 2005). The NOD like receptor family The nucleotide-bihding oligomerization domain (NOD) like receptor (NLR) are intracellular microbial receptors. The NLRs can be broken down into two main categories; NODs and NALPs. The C terminus of NLRs contains an LRR, which is thought to be involved in ligand binding. Upon ligand binding, N L R members activate caspase-1, which is required for the production of inflammatory cytokine IL-1. NLRs also activate the N F K B signaling pathway to induce production of other inflammatory molecules. NODs NODI and NOD2 are intracellular microbial sensors with known roles in development of several inflammatory diseases. NODI and NOD2 recognize subcomponents of cell wall peptidoglycans via their C-terminal L R R and signal through their N-terminal caspase activation and recruitment (CARD) domains leading to activation of N F K B and M A P kinases. Mutations in the L R R regions of NODI correlate with increased likelihood of developing inflammatory bowel disease and asthma while mutations in NOD2 have been linked to development of Crohn's disease and early onset sarcoidosis (Strober et al, 2006). 7 NALPs Similar to NODs, N A C H T - L R R - and pyrin domain containing protein (NALP) contain a C-terminal L R R for binding to microbial components. Activators of NALP3 < include components of peptidoglycans, toxins, bacterial D N A and double stranded RNA. There are several members in this category with NALP3 being the most studied of the NALPs. Mutations in NALP3 are responsible for Muckle-Wells syndrome and neonatal onset inflammatory diseases (Sutterwala et al., 2006). RNA helicase Intracellular double stranded viral RNAs are recognized by the R N A helicases, Retinoic-acid-inducible gene I (RIG-1) and M D A 5 . These proteins recognize different subsets of viral RNAs but both act by activating caspases through an N-terminal C A R D domain. RIG-I recognizes dsRNA from Sendai virus and hepatitis C virus (HCV), whereas M D A 5 is important for response to picornaviruses. The H C V dsRNA binds to RIG-1 and causes a conformational change allowing C A R D interaction and activation of Interferon (IFN) regulatory factor (IRF) 3 and NF-KB-responsive genes. This leads to induction of IFNa/p and activation of antiviral pathways (Saito et al.,2001). LPS receptor A complex process that involves interaction of several molecules leads to detection of LPS in tissue. LPS is first opsonised by lipid binding protein (LBP), and subsequently attaches to the cell membrane associated CD14. However, since CD14 is associated with the cell membrane via a glycolipid linkage group and is not capable of 8 generating a transmembrane signal by itself, LPS-LBP-CD14 complex generates a transmembrane signal by interacting with a transmembrane receptor on the surface of macrophages (Hoshino et al, 1999; Aderem et al, 2000). The laboratory of Bruce Beutler first identified TLR-4 as the receptor for LPS. Macrophages from C3H/HeJ mice are highly resistant to activation by LPS, even though they express normal amounts of CD 14 on their surface. While the genetic defect in these mice was known to arise from a single locus (LPSd), the gene responsible for this defect remained unknown. The Beutler laboratory cloned and sequenced the LPSd gene and demonstrated that it coded for the TLR-4 protein, suggesting that TLR-4 was the signaling receptor for LPS (Beutler et al, 2000). Paul Godowski and colleagues later reported that TLR-2 is a direct mediator of signaling by LPS (Yang et al, 1998). These investigators reported that human 293 cells stably transfected with TLR-2 could respond to LPS in the presence of LBP. Deletion mutants of TLR-2 that lacked the intracellular domain of TLR-2, failed to mediate LPS responsiveness. Thus, TLR-2 appeared to mediate LPS-induced intracellular signaling initiated by the binding of LPS to CD 14 (Yang et al, 1999). Together, these findings implicated TLR-4 and TLR-2 in LPS signal transduction. However, the fact that TLR-2 7 " mice had no defects in LPS responsiveness, while TLR-4 7 " mice were unresponsive to LPS served as compelling evidence that TLR-4 is the receptor for LPS mediated signaling (Takeuchi et al, 1999) (Takeuchi et al, 1999). The lack of TLR-2 involvement in transmitting a LPS signal was in apparent conflict with the work of Paul Godowski. This conflict however was resolved by observations made in the lab of Richard Tapping, where repurification of commercial 9 LPS by phenol-water extraction to remove proteins, eliminated the TLR-2 dependent response reported by Paul Godowski (Tapping et al, 2000). Since then, TLR-4 has been accepted as the receptor for LPS. However, it has been shown that unlike enterbacterial LPS, purified preparation of P.gingivalis (Hirschfeld et al, 2001) and Leptospira interrogans LPS (Werts et al, 2001) exhibit potent TLR-2, rather than TLR-4 dependent activity. LPS induced inflammation In the presence of low. levels of LPS, macrophages are the first and most dominant cells to be activated by LPS which target the invading bacteria for elimination. Engagement of the TLR-4 receptor on tissue macrophages causes cell activation with the subsequent production of potent effector cytokines such as IL-1, IL-6, IL-12, IL-15, IL-18, TNFa, tissue factor (TF), macrophage inhibitory factor (MIF), interferon-inducible tetratricopeptide repeat domain (IFIT), chemokines like IL-8, macrophage inflammatory protein 1 (MIP1), and monocyte chemotactic protein (MCP). LPS also induces the production of lipid mediators such as prostaglandins, leukotrienes, thromboxane, and oxygen radicals ( Cohen et al, 2002; Landmann et al, 1995; Kato et al, 2004). Presumably, this series of responses helps to isolate the foreign organism, produce an acute localized inflammation, and improve clearance of the infection. Upon activation, T N F a and IL-1 produced by the activated macrophages diffuse towards the vascular endothelial cells (EC) and induce the production of NO and P G I 2 in these cells (Glembot et al, 1996). Combined with histamine released from tissue mast cells, NO and P G I 2 cause relaxation of smooth muscles and lead to dilation of blood 10 vessels. Vascular dilation decreases the resistance to flow and increases blood flow to the site of infection. T N F a and IL-1 also induce cytoskeletal changes in the ECs, causing the expansion of gaps between adjacent cells. This increase in interendothelial space leads to an increase in the permeability of the vessels and allows for increased leakage of plasma and macromolecules into the interstitial tissue (Edamitsu et al, 1995). Subsequently, the increase in blood viscosity and concentration of cells in the blood due to the loss of plasma slows down the flow of blood at the site of infection. This in turn, changes the distribution of cells in the blood vessels, pushing the cells to assume a peripheral position along the endothelial surface (Firrell et al, 1989). T N F a and IL-1 also induce expression of adhesion molecules on ECs. Since the cells moving "through these areas are already pushed closer to the vessel walls, the adhesion molecules, specifically E-selectin on the endothelial cells binds to ligands expressed on the passing leukocytes. These interactions are weak with a slow on and a fast off rate. As a result, leukocytes expressing ligands for these adhesion molecules continually attach and detach from the endothelial cells and begin to roll along the endothelial cells' surface. TNFa and IL-1 also induce endothelial expression of ligands for integrins, mainly V C A M - 1 (the ligand for the V L A - 4 integrin) and ICAM-1 (the ligand for the LFA-1 and Mac-1 integrins), which are higher affinity adhesion molecules. The rolling leukocytes that express the integrins required for interacting with V C A M - 1 and ICAM-1 stop rolling and tightly attach over the endothelial cells. These cells then migrate through the interendothelial spaces and transverse the endothelium (Collins et al, 1995). Once these cells have crossed the endothelial cells, they follow the concentration gradient of chemokines such as IL-8, macrophage inflammatory protein 1 (MIP1), and monocyte 7 11 chemotactic protein (MCP) that were initially produced by the activated macrophages at the site of infection. The leukocytes mainly composed of neutrophils, then migrate into tissues and travel towards the site of injury (Moser et al, 2001). There they aid the resident macrophages in clearing the foreign organisms. As inflammation develops, the process also triggers a variety of stop signals that serve to actively terminate the inflammatory response. These active mechanisms cause a switch in the production of pro-inflammatory mediators to anti-inflammatory molecules such as lipoxins, IL-10 and transforming growth factor-/3 (TGF-/3) which in turn inhibit activated macrophages and newly recruited cells. Thus, the inflammatory response is attenuated and eventually resolves (Asadullah et al, 2003). In autoimmune diseases and chronic inflammatory diseases however, production of inflammatory mediators, especially T N F a continues without regulation (Schwab et al, 2006) 12 LPS Lymphocyte Activation Antigen processing and presentation Tissue Remodeling Elastase/ collagenase/ hyaluronidase, Fibroblast stimulating and angiogenic factors Inflammatory Microbiocidal Anti-Inflammatory TNFa, IL-1, IL-6 Reactive oxygen and IL-10, Lipoxins, PGE, TGFp nitrogen intermediates Anti-Inflammatory Rest ing JbMf Act ivated macrophage ) — m a c r o p h a g e Figure 1: Macrophage activation and auto-regulation Macrophages can be activated by several stimuli upon which they produce a variety of inflammatory and anti-inflammatory molecules. Among these, TNFa, IL -1, and IL-6 are the most potent inflammatory cytokines, which activate other immune cells as well as have systemic effects. Macrophages also produce microbiocidals that directly damage the pathogen. However, these molecules can also harm the host tissue over long periods. Macrophages also produce IL-10, prostaglandins and later TGFp. Production of these anti-inflammatory molecules dampen the immune response by inhibiting the T N F a production in previously activated macrophages as well as limiting the ability of inactivated or newly arriving macrophages to produce inflammatory molecules. 13 Tumor necrosis factor a T N F a acts as an early and central mediator of inflammation and by itself is able to induce the cardinal signs of inflammation: heat, swelling, redness and pain (Vassalli, 1992). TNFa activates the endothelium, leukocytes, and fibroblasts, and induces the production of systemic and acute-phase proteins. In endothelium, T N F a induces changes mostly regulated at the level of gene transcription referred to as endothelial activation. In particular, T N F a increases. both the expression of adhesion molecules ICAM-1 and V C A M - 1 , and enhances the recruitment of immune cells (Collins et al, 1995). T N F a also induces the expression of NO and prostaglandins, which cause vasodilation and membrane permeability allowing for increased flow of blood and plasma to leak into the surrounding. T N F a causes the following sequence of events in launching a successful immune response against a pathogen. First, T N F a causes the release of neutrophils into circulation and enhances their transmigration into tissue. These neutrophils are then primed by T N F a such that they respond to inflammatory mediators. Finally, metalloproteinases are induced to degrade the extracellular matrix (Pober, 2002). TNFa acts in an autocrine fashion to upregulate its own production along with the production of other mediators of inflammation in macrophages and neutrophils (Harmsen et al, 1990). TNFa also induces the production of acute phase proteins from the liver and a number of other mediators, which induce fever, loss of appetite, and malaise (Grays et al, 2005). TNFa plays a central role in initiation and maintenance of inflammation. Therefore, it is not surprising that increased TNFa is involved in many inflammatory and autoimmune diseases. For instance, in TNFa transgenic mice, a heightened production 14 of TNFa results in the presence of several inflammatory diseases including polyarthritis (Keffer et al, 1991) and inflammatory bowel disease (IBD) (Neurath et al, 1997). Increase in T N F a has been associated with symmetrical polyarthritis, ankolysing spondylitis, Crohn's disease, psoriasis and refractory asthma (Li et al, 2003). As a result, T N F a has been researched as a therapeutic target for treatment of/inflammatory diseases. Recently, protein based therapeutics including T N F a neutralizing antibodies such as infliximab (Remicade) or adalimumab (Humira), or circulating T N F a receptor fusion protein such as etanercept (Enbrel) have shown great promise in treatment of many inflammatory diseases (Palladino et al, 2003). Despite the existence of these antagonist molecules, side effects and distribution profiles associated with the use of large molecule therapeutics have created a significant need for development of small molecules that; target the signaling pathways leading to synthesis of TNFa. Several natural mechanisms have evolved to tightly regulate the production of TNFa. For instance, IL-10 produced by T-cells and activated macrophages is a potent inhibitor of T N F a production. In fact, similar to TNFa transgenic mice, IL-10"7" mice (Fadok et al, 1998) , are hyper-responsive to inflammatory stimuli and suffer from inflammatory diseases such as IBD (Kontoyiannis etal, 1999; Scheinin et al, 2003). Therefore, IL-10, along with other inhibitors of T N F a such as IL-4 and TGFp1 are also in clinical trials for treatment of several inflammatory diseases (Asadullah et al, 2003). Because macrophages are the principal source of T N F a (Babu et al, 2004), and play a significant role in initiation of inflammation, understanding the mechanisms underlying regulation of TNFa expression in macrophages via activators such as LPS 15 and inhibitors such as IL-10 could reveal signaling molecules that can be used as targets in treatment of inflammatory diseases. Signaling in macrophages Technical and biological considerations have hampered the analysis of signaling pathways in response to stimuli in macrophages and in many cases have resulted in apparently conflicting data. This is partially due to the heterogeneity among and within macrophage populations with differing abilities to respond to activating stimuli. Tissue macrophages are referred to as resident macrophages and can be found in all tissues including the connective tissue (histiocytes), liver (Kupffer's cells), lung (alveolar macrophages), lymph nodes (free and fixed macrophages), spleen (free and fixed macrophages), bone marrow (fixed macrophages), serous fluids (pleural and peritoneal macrophages), skin (histiocytes, monocyte derived- langerhans cell) and other tissues (Stvrtinova et al, 1995). Resident macrophages derived from different tissues differ in function, mainly due to the adaptive responses to their local environment. Therefore, macrophages occupying different niches in the body will respond differently to similar stimuli. For instance, i f intestinal macrophages acted similar to blood monocytes, continuous exposure to antigens in the intestines would result in their constant activation, which would severely damage the digestive system. For example, retina-derived macrophages do not generate NO in response to IFN-y or TNFa in vitro (Robertson et al, 2002), probably because these macrophages are continuously exposed to the high TGF-p1 levels in the eye (Streilein et al, 1997). Resident intestinal macrophages are likewise responsive to inflammatory stimuli and fail to produce 16 proinflammatory cytokines and chemokines. This phenotype can be mimicked by culturing blood monocytes in media containing soluble factors released from cultured intestinal macrophages (Rugtveit et al, 1995). In contrast, resident peritoneal macrophages derived from the abdominal peritoneal cavity produce high levels of NO and other inflammatory cytokines in the presence of inflammatory stimuli (Ding et al, 1988). Therefore, as the biological response of macrophages from different tissue to the same stimuli differs, the underlying signaling mechanism in these cells would also be expected to differ (Streilein et al, 1997) The differentiation state of macrophages is another important consideration since macrophages change their protein expression profile, altering their capability to respond to stimuli, as they differentiate from their progenitors into mature naive cells. The development of the mature naive resident macrophage proceeds through several steps. Mononuclear phagocytes arise from hematopoietic stem cells in the bone marrow and proceed through monoblast, promonocyte, monocyte, and macrophage stages (Whitelaw, 1972). The progression from pluripotential stem cell to myeloid-macrophages is controlled by a group of cytokines and is dependent on the presence of CSF-1 (Warren et al, 1985). Throughout the differentiation process, the expression of P U . l transcription factor is increased, which has been shown to be involved in the macrophage endotoxin response (Bozinovski et al, 2004). The expression of P U . l transcription factor also relies on the expression of several LPS induced genes including COX-2 (loo et al, 2004), and IL-18 (Kim et al, 1999). A significant increase in LPS induced T N F a production is also observed in macrophages, related to changes in post-transcriptional processing and the 17 expression of R N A binding proteins throughout the differentiation process (MacKenzie et al, 2002). Even when differentiation state within populations is controlled for by use of cell lines, differences between individual cells are still observable. In R A W 264.7 macrophages, only a fraction of the cells expresses iNOS or PAI-2 in response to LPS. Even when these cells are subcloned, expression of iNOS within the cells of the colony are different (Costelloe et al, 1999). Similarly, R A W 264.7 cells cloned to express L A C Z under the control of LPS responsive HIV long terminal repeat show significant differences in expression levels within the same clonal population (Ross et al, 1994). Subclones of the R A W 264.7 cells also show quite divergent patterns of LPS-induced gene expression (Ravasi et al, 2002). The variability within the populations may allow for variability in sensitivity to a wider range of stimuli. But once one of the cells is activated, it may then activate cells around it to respond with a homogenous response as seen when cells treated with LPS are pre-treated with IFNy (Noda et al, 1997). Although this heterogeneity maybe important, it complicates studies of cell signaling in macrophages. Heterogeneity within the populations and potentially activation of different signaling pathways in each subpopulation may give the elusion of interaction or synergism of signaling mechanisms. Furthermore, this may create a situation where signaling mechanisms observed in one system are difficult to reproduce in another. In addition, culture conditions creating selective pressures within a heterogeneous population may change the make up of cell cultures and select for specific subpopulation and specific responses. For instance, Sly et al explained the difference in their observation of SHIP as a negative regulator of LPS induced T N F a production and the 18 opposite observations by Fang et al as a function of the culture density during the derivation of B M D M s and during cell stimulation (Fang et al, 2004; Sly et al, 2004). The density of cells may alter the cell cycle position or select for a specific group of characteristics within subpopulations or the culture. Clearly heterogeneity within and between populations of macrophages exists, and as different macrophages have a different make up of signaling proteins, different responses among macrophage populations would be anticipated. Therefore, in in vitro studies, it is important to keep in mind the type, history, and differentiation status of macrophages as well as culture conditions used in experiments. Although this approach will likely increase the reproducibility in data from lab to lab, the ultimate test of macrophages function and mechanism of action will come from in vivo studies. LPS signaling in macrophages Binding of LPS to TLR-4 results in activation of signaling pathways such as interferon regulatory factor (IRF3), N F K B , and the M A P kinases, extracellular signal-regulated kinase (ERK), c-Jun M A P kinase (JNK), and p38 (Figure 2) (Carter et al, 1999). N F K B and IRF3 directly enter the nucleus and bind to promoter regions of the genes they regulate and the M A P K s activate downstream transcription factors that also induce the transcription of the pro-inflammatory genes they regulate (Bjorkbacka et al, 2004; Lin et al, 2005). Once these genes are transcribed, M A P K s and other signaling pathways such as the phosphatidylinositol-3 kinase (PI3K) pathway regulate their stability (Kotlyarov et al, 1999; Dean et al, 2004), translation (Ramirez et al, 1999; Hitti et al, 2006), and the processing of the translated proteins (Li et al, 2002). 19 TLR-4 has an intracellular domain that is homologous with that of the IL-1 receptor, and is known as Toll/IL-1 receptor (TIR) domain. TIR binds to a homologous domain in an adaptor protein, MyD88, which interacts with a death domain in the serine kinase IRAK and in turn binds to T N F a receptor-associated factor 6 (TRAF6) (Li et al, 2005). As an adaptor protein, TRAF6 binds to both TAK1 binding protein 2 (TAB2) (Qian et al, 2001) and evolutionarily conserved signaling intermediate in Toll pathways (ECSIT) (Kopp et al, 1999) and initiates a cascade of events which lead to the activation and translocation of N F K B and M A P K , leading to production of inflammatory molecules (Aderem etal, 2000). MyD88 deficient mice do not produce any inflammatory molecules in response to LPS. However, N F K B activation is still observed albeit with delayed kinetics. Another protein, TIRAP has also been shown to directly interact with the TLR-4 TIR domain and result in N F K B activation (Cohen, 2002). However, similar to MyD88 7 " macrophages, TIRAP 7 " macrophages also show delayed activation of N F K B (Horng et al, 2002). Yamamoto et al identified TRIF-related adaptor molecule (TRAM) as responsible for the delayed LPS signaling. They showed that early N F K B activation by LPS is intact in T R A M 7 " macrophages, but the late N F K B activation is abolished (Yamamoto et al, 2003). This suggests MyD88 and TIRAP control the early induction of N F K B and T R A M the late induction. Other signaling molecules such as PI3K (Monick et al, 2001), G(i)a2 (Fan et al, 2005), Janus Kinase 2 (JAK2) (Okugawa et al, 2003), and Src homology 2 domain-containing inositol 5'-phosphatase (SHIP) (Fang et al, 2004) have also been described to regulate LPS activation of M A P K s and N F K B . These pathways have been shown to be 20 involved in the production of inflammatory cytokines IL-1, IL-6, IL-12, and TNFa and anti-inflammatory cytokine IL-10 (Hsu et al, 2002); (Madrid et al, 2001); (Okugawa et al, 2003). M A P K pathway The three map kinase pathways ERK1/2, JNK and p38 are activated by upstream kinases and in turn activate downstream transcription factors, leading to induction of genes they regulate (Dower et al, 2003). Activation of ERK1/2 by the Ras-c-Raf-MEK pathway activates transcription factors ELK-1 and ETS, both of which have been shown to bind to the T N F a promoter (Guha et al, 2001). Inhibition of ERK1/2 pathway in monocytes reduces LPS induction of several inflammatory cytokines, including IL-1, IL-8, and TNFa (Guha et al, 2001). E R K activation has also been linked to the nuclear transport of T N F a in macrophages (Dumitrue; al, 2000). JNK activation is mediated through a M A P K / E R K kinase (MEK) kinase 1 (MEKK1), M E K kinase 4 (MEKK4) or mitogen activated protein kinase (MAPK) upstream kinase (MUK)/ Dual Leucine Zipper bearing kinase (DLK)/ Zipper protein kinase (ZPK) - mitogen activated protein (MAP) kinase kinase 4 (MKK4), M K K 7 pathway and results in activation of downstream transcription factors that include c-Jun, ATF-2, and Elk-1 which regulate various genes encoding inflammatory mediators (Guha et al, 2001). PKCe has also been shown to be involved in JNK activation that mediates LPS-induced T N F a production (Comalada et al, 2003). 21 p38 activation is mediated through MLK3/SPRK, A S K 1 , T A K 1 - M K K 3 and M K K 6 , and results in activation of transcription factors that include ATF-1, AP-1 and CREB (Monick et al, 2002). p38 has also been implicated in regulation of TNFa and Cox-2 translation and mRNA stability through activation of downstream molecule M A P K A P 2 (MK2) (Lasa et al, 2000; Rousseau et al, 2002). PI3K pathway There are three classes of PI3K; class I, II and III, of which only class I has been shown to have a significant role in LPS signaling. The class II PI3Ks have a preference for phosphatidylinositol (PI) and PI-4-monophosphate (PI4P) (Domin et al, 1997) and some are refractory to the effects of pharmacological inhibitors of PI3K, LY294002 and Wortmannin. Class II PI3K is regulated by MCP-1 and insulin receptor signaling. However, in both cases, class I PI3K activity is also required (MacDougall et al, 2004). Class III PI3K is highly sensitive to Wortmannin and is involved in intracellular trafficking in yeast and sequestering of cytoplasmic material to form autophagosomes {Vetiot etal, 2000). Class I PI3K consists of two subclasses (1A and 1 B). The class IB enzyme, pllOy , is only found in mammals and has a similar structure to class IA p i 10 proteins, p i 10y associates with the regulatory unit pi01, which aids in recruiting the enzyme to G-protein coupled receptors (GPCR) (Brock et al, 2003). The class IA PI3K is a heterodimeric proteins composed of a catalytic (pi 10) and a regulatory subunit (p85, p55, or p50). The regulatory subunits contain two SH2 domains and an inter-SH2 domain. The inter SH2 domain tightly binds the regulatory subunit to p i 10. This association has 22 been shown to stabilize p i 10 and deactivate pl lO's catalytic activity. The two SH2 domains on p85 bind specific phosphotyrosines in the cytoplasmic domains of receptor proteins. Upon binding, p85 undergoes a conformational change which results in promotion of the catalytic activity of p i 10 (Katso et al, 2001). In this way, the regulatory subunit tightly binds pi 10, directs its translocation to the membrane and regulates its activity in response to specific stimuli. The p85 subunit also contains an SH3 and a B H domain, which allow it to interact with proteins with proline rich regions and small GTPases, respectively, p i 10 also contains a Ras binding domain, which allows it to directly bind the proto-oncogene Ras. This interaction does not require the presence of any regulatory subunits and allows for recruitment of p i 10 to sites where Ras is able to access. These additional domains on both the regulatory and. the catalytic subunits have likely evolved to confer additional functions to the class I PI3K signaling pathways (Katso etal, 2001). The catalytic domain on p i 10 catalyzes the phosphorylation of the 3' hydroxyl group of phosphoinositides (Pis). PI(4)P and PI(4,5)P2 can both act as substrates for PI3Ks. However, PI(4,5)P2 is known as the main substrate for PI3K and its phosphorylation results in the formation of PI(3,4,5)P3 (PIP3). PIP3 is a key lipid second messenger that is involved in many functions of cells including movement, growth and metabolism (Katso et al, 2001; Vanhaesebroeck et al, 2005) and acts as a docking site for PH domain containing proteins such as Bruton tyrosine kinase (BTK), Guanine nucleotide exchange factor (GEF), Protein kinase B (PKB), 3-Phosphoinositide-dependent kinase 1 (PDK1), and Protein kinase C (PKC) (Katso et al, 2001). The activation of these molecules in turn regulates downstream molecules, which ultimately 23 have a role in proliferation and differentiation, cell cycle, apoptosis, cell motility, immune cell and cytokine production (Katso et al, 2001). Role of PI3K in activation of macrophage and other immune cells In LPS activated macrophages, the p85-pll0 complex is recruited to the membrane and interacts with MyD88 (Ojaniemi et al, 2003) resulting in an increase in membrane PIP 3 levels. Inhibition of PI3K by LY294002 and/or Wortmannin in activated R A W 264.7 macrophages results in inhibition of ERK1/2 (An et al, 2005) and N F K B activity (Ojaniemi et al, 2003). This inhibition also results in reduced TNFa, IL-1, IL-6, and NO (Lim et al, 2003), Therefore, PI3K activation in R A W 264.7 was concluded to have a positive role in regulation of macrophage activation. Similarly, in neutrophils, inhibition of PI3K results in decreased p38, ERK1/2 and N F K B activation (Strassheim et al, 2004) decreased TNFa (Crepaldi et al, 2001), further supporting a positive role for the PI3K pathway in immune cell regulation. However, some studies suggest a negative role for PI3K. Chemical inhibition of PI3K has been shown to enhance T N F a production in B M D M , human THP-1 and P B M C macrophages (Fang et al, 2004); (Guha et al, 2002). Part of the difference in the role of PI3K in different macrophages may be due to the involvement of differing PI3K downstream molecules or the presence or absence of other signaling molecules interacting with the PI3K pathway. A closer look at the molecules downstream of PI3K reveals several signaling pathways with opposing effects on T N F a production. Inhibition of P K C ^ and PKCe, (Comalada et al, 2003; Cuschieri et al, 2004; Aksoy et al, 2004) or mTOR activation (Weinstein et al, 2000) by pharmacological inhibitors 24 result in decreased T N F a production. In mice, a naturally occurring mutation in the PH domain of B T K at an arginine residue required for BTK-PIP3 interaction gives rise to X -linked immunodeficiency (XID). Interestingly, macrophages from these mice produce significantly less T N F a in response to LPS (Horwood et al, 2003). On the other hand, PKB seems to have a strong role in production of the T N F a negative regulator, IL-10 (Pengal et al, 2005) and all data support a positive role PI3K in production of IL-10 (Martin et al, 2003; Foey et al, 2001; Pengal et al, 2005). Altogether, these data suggest that PI3K plays a pivotal role in activation of macrophages, leading to the expression of both inflammatory and anti-inflammatory molecules. Therefore, the conflicting observations regarding the role of PI3K in regulation of T N F a may be explained by the dual role of PI3K in regulation of both TNFa and negative regulators of TNFa. Thus, PI3K inhibition would affect macrophage TNFa production differently based on the cell's ability to produce and respond to PI3K regulated inhibitors of TNFa. Consistent with this hypothesis, in R A W 264.7 macrophages which show limited response to IL-10 (data not presented) and prostaglandins (Rouzer et al, 2005) as well as potentially other yet unknown negative regulators, PI3K inhibitors lead to a decrease in T N F a production (Weinstein et al, 2000; Ojaniemi et al, 2003; An et al, 2005; Lim et al, 2003). On the other hand, in B M D M which produce high levels of IL-10 and respond to IL-10 (Carl et al, 2004), PI3K inhibitors lead to an enhancement in production of TNFce (Fang et al, 2004); (Cao etal, 2004). Thus, the net effect of PI3K inhibition on the levels of inflammatory cytokines like TNFa depends on cells type and in the case of macrophages may also depend on the 25 environment in which these macrophages have evolved and the array of cytokines they have been exposed to. Ultimately, the balance of negative regulators and positive regulators in each cell type and environment will be the deciding factor on whether TNFa production is inhibited or enhanced by the chemical or pharmacological inhibitors of PI3K pathway. Because of the complicated involvement of PI3K on pro and anti-inflammatory cytokine production, the use of pharmacological and chemical inhibitors of PI3K in vivo for treatment of inflammatory disease have shown limited success. There is no significant difference shown in PI3K inhibitor treated mice in terms of T N F a production in the early hours whereas an increase in serum TNFa is observed in later time points. Of note, higher levels of IL-10 are also reported in these mice (Williams et al, 2004; Schabbauer et al, 2004). These data may suggest that during the later time points, effects of the PI3K inhibitor LY294002 on non-hematopoietic cells may be causing the increase in inflammatory response. Thus studying signaling molecules which are able to modulate PIP3 levels specifically in hematopoietic cells maybe more useful in understanding the role of PI3K in immune cells. One such molecule is SHIP. SHIP Structure and function: SHIP is a 145 K d protein which is exclusively expressed in hematopoietic cells (Ware et al, 1996). Other closely related proteins, SHIP2, (Krystal et al, 1999) and a sSHIP are also expressed in cells. SHIP2 is ubiquitously expressed, whereas sSHIP's 26 expression is limited to embryonic stem (ES) cells and hematopoietic stem cells (Sly et a/., 2003). SHIP contains an N-terminal SH2 domain followed by a phosphatase domain, . N P X Y domain and a proline rich region. The SH2 domain has been shown to interact with DOK-3 (Lemay et al, 2000), G-CSF receptor (Hunter et al, 2004), FcvRIIBl (Tridandapani et al, 1997), and GP49B1 (Kuroiwa et al, 1998). The phosphatase domain of SHIP selectively hydrolyzes PIP3 and IP 4 in vitro. This region is followed by 2 N P X Y domains characteristic of proteins which bind to phosphotyrosine binding domain and a proline rich C-terminus that is able to bind to some SH3 containing proteins (Krystal et al, 1999); (March et al, 2002); (Kalesnikoff et al, 2003). Using its binding domains, SHIP is recruited to the docking sites on activated receptors where it negatively regulates PIP3 signaling by actively converting PIP3 into PI(3,4)P2. SHIP 7" mice have a shortened life span. These mice have enlarged lungs and spleen because of infiltration of myeloid cells. As bone marrow transplant from SHIP + / + restores normal growth and life span, the short life span is likely due to intrinsic defects in bone marrow cells. The peripheral blood of SHIP 7" mice have lower levels of lymphocytes and significantly higher numbers of both macrophages and neutrophils (Helgason et al, 1998). Part of the increase in these cells may be due to the increased number of granulocyte macrophage colony-forming cells (CFC-GM). Also, it is now known that SHIP is a negative regulator of CSF-1 signaling (Baran et al, 2003), G M -CSF (Hunter et al, 1998), and IL-3 signaling (Helgason et al, 1998). The binding of these cytokines to their receptors first activates pro-survival signaling pathways dependent upon the PI3K pathway which is then terminated by activation of SHIP (Baran 27 et al, 2003); (Giallourakis et al, 2000). In this way, SHIP"'" cells would be expected to be more sensitive to the effects the growth factors CSF-1, GM-CSF and IL-3 (Helgason etal, 1998). SHIP 7" macrophages produce high levels of IL-10, are hyper-responsive to CSF-1 and proliferate at a faster rate than their wild type counterpart (Sly et al, 2004); (Rauh et al, 2005). In terms of TNFa production, SHIP"7" neutrophils and mast cells produce much higher levels of TNFa (Strassheim et al, 2005); (Yum et al, 2001) but in macrophages, opposing data exist. Several investigators conclude SHIP negatively regulates TNFa production (An et al, 2005); (Ojaniemi et al, 2003); (Sly et al, 2004) , while one report suggests SHIP is a positive regulator of TNFa (Fang et al, 2004). Fang et al reported that LPS activated SHIP"7" B M D M s produced significantly lower amounts of T N F a and IL-6 (Fang et al, 2004). However, Sly et al. reported that SHIP"7" B M D M produced significantly higher levels of TNFa than SHIP + 7 + in B M D M S (Sly et al, 2004). Similarly in other studies, over-expression of SHIP in R A W 264.7 macrophages resulted in inhibition of T N F a secretion as well as inhibition of p38 and N F K B activation. Also, consistent with a negative role for SHIP in TNFa production, SHIP"7" mice are hyper-responsive to LPS and produce much higher levels of T N F a in a septicemia model where LPS is injected into the peritoneum (Sly et al, 2004); (Fang et al, 2004) (An et al, 2005). However, although similar numbers of peritoneal macrophages are seen in SHIP"7" and SHIP + 7 + mice (Personal Communication, Dr. Laura Sly), increased number of peripheral myeloid cells in SHIP"7" macrophages may complicate the interpretation of this data. SHIP expression has been shown to be involved in inhibition of N F K B activity (An et al, 2005); (Strassheim et al, 2005) which 28 is known for its role in transcriptional regulation of TNFa. SHIP also negatively regulates p38 (An et al, 2005); (Strassheim et al, 2005), and B T K activity (Tomlinson et al, 2004); (Bolland et al, 1998), which are both known to positively regulate TNFa at a post-transcriptional level (Kontoyiannis et al, 2001); (Horwood et al, 2003). In order to directly study the role of SHIP in macrophages, our lab set up assays to screen crude extracts of marine invertebrates for a SHIP activator. Pelorol, extracted from Dactylospongia elegans was found to increase SHIP activity in this assay (Yang et al, 2005). Pelorol belongs to the class of chemicals known as meroterpinoid. Several compounds belonging to this class of chemicals, including Pelorol have been shown to have biological activity in eukaryotic cells (Williams et al, 2004); (Ferrandiz et al, 1996); (Appendino et al, 2006). Pelorol was previously shown to inhibit growth of Trypanosoma rhodesiense and Plasmodium falciparum (Goclik et al, 2000). However, the effect of Pelorol on SHIP has not yet been described. Several analogues of Pelorol were synthesized and screened for any improvement in their SHIP activation ability. A methyl analogue of Pelorol, AQX-016A, showed improved ability to activate SHIP when compared to Pelorol (Yang et al, 2005). 29 Post transcriptional regulation of T N F a Following activation of macrophages with LPS, an array of genes show increased transcription. The corresponding mRNAs are processed and exported into the cytoplasm, where they undergo translation (Figure 2). Translation begins with assembly of a group of eukaryotic translational initiation factors (EIF) that bind to the 5' untranslated region (UTR) of the message and alter its secondary structure to allow for binding of 40S ribosomal subunit. The complex formed by the association of the 40s ribosomal subunits and EIF scan the mRNA until a start codon is detected (Voorma et al, 1994). The initiation factors then dissociate to allow for the association of 60s and 40s subunits allowing for initiation of translation. However, sequences in the 5'UTR and 3'UTR have been shown to play a discriminatory role in regulating translation of different messages. Hairpin elements in the 5'UTR region or polyuridine and AU-rich elements (ARE) in the 3' UTR or interaction of the 3' UTR and 5' UTR can limit the level of message translation. Studies using specific inhibitors have also linked translation to molecules downstream of p38 and PI3K pathway (Svitkin et al, 2001). The TNFa mRNA contains an A R E in the 3' UTR. Proteins which bind to this element regulate both the stability and translation of the TNFa message in macrophages (Gueydan et al, 1996); (Xu et al, 1997). In LPS activated macrophages, A R E mediated translational silencing is removed and TNFa mRNA is found associated with polysomes (message associated with multiple ribosomes). So far, no specific translational regulatory sequence in the TNFa 5'UTR has been described. However, a model where T-cell internal antigen 1 (TIA-1) binds to components of the 3' UTR A R E and the 5' UTR to inhibit TNFa translation has been proposed (Kedersha et al, 2002); (Piecyk et al, 2000). t 30 In this way, both the 3' and the 5' UTR may play an important role in the repression of T N F a translation. Interestingly, inhibition of PI3K and the p38 M A P K has been shown to suppress T N F a expression at the post-transcriptional level which in the case of p38 is dependent on the presence of the A R E in the 3'UTR (Kontoyiannis et al, 1999). Expression and/or activation of p38 activator, M K K 6 , and downstream activated protein M A P K activated protein Kinase (MK) 2 stabilizes TNFa message whereas inhibition of p38 inhibits translation of T N F a and IL-1 (Kontoyiannis et al, 2001); (Dean et al, 2004). The downstream target of p38, M K 2 has been shown positively regulate the translation of T N F a in a 3 'ARE dependent fashion (Piecyk et al, 2000). Activation of these kinases may modulate the activity of A R E binding proteins and result in stabilization and translation of TNFa mRNA. Consistent with this, A R E binding activity of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) AO and Tristetraprolin (TTP), two TNFa mRNA binding proteins, is diminished by inhibition of p38 and by deletion of M K 2 in LPS activated macrophages (Rousseau et al, 2002); (Stoecklin et al, 2004). Although a vast amount of information exists on the role of p38 in post-transcriptional regulation of TNFa, the role of PI3K in post-transcriptional regulation of TNFa has not been well characterized. PI3K regulates some of the components of the 5' UTR dependent translation and stability of mRNA messages (Gingras et al, 2001). For instance, LY294002, an inhibitor of PI3K kinase activity inhibits collagen message stability by inhibition of signaling pathways involved in 5'UTR dependent regulation of message (Shegogue et al, 2004). 31 Figure 2: LPS signaling and TNFa production Stimulation of macrophages with LPS results in activation of TLR -4 mediated signaling. Ultimately, this results in activation of N F K B transcription factor as well as the M A P K pathway, which also regulates other transcription factors. Translocation of these transcription factors into the nucleus results in transcription of pro-inflammatory genes such as TNFa. T N F a mRNA is shuttled to the cytoplasm where pathways downstream of the LPS activated p38, and PI3K, regulate the translation and stability of the T N F a mRNA. 32 However, PI3K has also been implicated in regulation of 3' UTR A R E containing messages such as Cox-2 (St-Germain et al, 2004) and TNFaffang et al, 2001); (Jang et al, 2004). Wortmannin, a specific PI3K inhibitor, inhibits TNFa translation in activated T-cells (Ramirez et al, 1999). BTK, a PIP 3 dependent kinase regulates T N F a production in a 3'UTR dependent fashion (Horwood et al, 2003). It is also possible that by affecting initiation complex components, PI3K may also interfere with the association of 3'UTR binding proteins like T-cell internal antigen-1 (TIA-1) or TIA-1 related protein (TIAR) and thus limit translation of TNFa. Interleukin-10 IL-10 is an important immunoregulatory cytokine produced by several types of cells including T-cells (Fiorentino et al, 1989), keratinocytes (Enk et al, 1992), and activated monocytes and macrophages (de Waal Malefyt et al, 1991). IL-10 plays a central role in regulating differentiation and proliferation of T-cells, B-cells, mast cells and N K cells, and downregulates inflammatory responses by monocytic cells during an immune reaction (Asadullah et al, 2003). IL-10 inhibits production of T N F a (Kontoyiannis et al, 2001), IL-1 (Jenkins et al, 1994), IL-6, IL-8 and GM-CSF in LPS activated human monocytes, mouse B M D M and peritoneal macrophage (de Waal Malefyt et al,. 1991) and limits inflammation in LPS challenged mice (Tanaka et al, 1996); (Gerard et al, 1993); (Van Laethem et al, 1995). Because IL-10 is a potent inhibitor of the inflammatory response, IL-10 deficient mice are 20 fold more sensitive to endotoxin challenge and suffer from Inflammatory.Bowel Disease (IBD) (Berg et al, 1995). Low production of IL-10 in patients is associated with psoriasis (Asadullah et al, 1998) whereas high levels of IL-10 are seen in some tumors attempting to escape immune 33 system detection (Kim et al, 1995); (Dummer et al, 1993). Therefore, understanding the mechanisms by which IL-10 exerts its anti-inflammatory and immunnoregulatory effects can contribute to identification of anti-inflammatory targets that can be used in treatment of many autoimmune and inflammatory diseases (Asadullah et al ,2003). IL-10 homologue and expression Human IL-10 is a 37 Kda hombdimer molecule with over 80% homology to that of mouse and significant homology to IL-19, 20, 22, 24, and 26 (Asadullah et al, 2003). Significant functional and structural homology also exists between hIL-10 and E B V ORF BCRF1, Orfvirus, and C M V IL-10 (Kim et al, 1992); (Fleming et al, 2000); (Jenkins et al, 2004). Regulation of IL-10 expression in immune cells is not fully understood. Several studies have shown that CREB plays a major role in production of IL-10 and agents such as cAMP or signaling molecule that elevate CREB activity regulate monocytic IL-10 synthesis. In one study, activation of macrophages using catecholamines resulted in the production of IL-10. Catecholamines activate the 02 receptor on macrophages and lead to activation of Got proteins. Activation of G a leads to activation of adenyl cyclase enzyme leading to an increase in cytoplasmic cAMP. cAMP then activates P K A which in turn is able to increase the transcriptional activity of CREB/ATF when bound to CRE 1, 3 and 4 on the IL-10 genomic promoter region (Kambayashi et al, 1995); (Ma et al, 2001); (Platzer et al, 1995). PI3K activation has also been shown to increase IL-10 through regulation of CREB activity. PI3K activation by LPS leads to inhibition of GSK313 and leads to increased phosphorylation of CREB on Serine 133. This increase in phosphorylation in 34 turn leads to an increase in association of CREB with CREB binding protein, resulting in increased IL-10 production (Martin et al, 2005); (Foey et al, 2002); (Martin et al, 2003). Conversely, inhibition of PI3K significantly decreases IL-10 production in LPS activated macrophages (Martin et al, 2005) whereas increased P K B activity increases IL-10 production (Pengal'ef al, 2005); (Martin et al, 2003); (Martin et al, 2003); (Foey et al, 2002). Despite the ability of LPS to activate P K B in macrophages, not all macrophages produce detectable levels of IL-10 protein. Brenner et al described the requirement for c/EBP transcription factor in induction of IL-10 and differential expression of IL-10 in two macrophage cell lines was partly due to the difference in the levels of c/EBP between these cells (Brenner et al, 2003). Thus, IL-10 production will be dependent on availability of several other factors and is likely cell dependent. IL-10 signaling IL-10 receptor and STAT3 signaling Functionally active IL-1 OR is composed of two subunits, IL-10R1 and IL-10R2 which belong to the class 2 cytokine receptor family (Renauld, 2003). Class 2 cytokine receptor family members include the receptors for interferons a, 13, and y, and IL-10 (Pestka et al, 2004). This family of receptors transduces a ligand specific signaling through activation of receptor associated tyrosine kinases (Jak and/or Tyk). These kinases then phosphorylate the receptor and thus create a docking site for ligand specific members of STAT family. Recruitment of STATs to the receptor and their activation then allows them to translocate to the nucleus and initiate the transcription of the genes 35 they regulate (Renauld, 2003). So far, signaling in class 2 family members remains primarily limited to activation of STAT signaling pathways (Kotenko et al, 2000). However, in the case of IL-10, some evidence suggests the existence of functional STAT independent pathways, although no such pathways has yet been described (Williams et al, 2004); (Lang et al, 2002). Binding of the IL-10 to its receptors causes the dimerization of the two subunits (IL-10R1 and IL-10R2) and activates the phosphorylation of the receptor associated Janus kinase-1 (Jakl) and Tyrosine kinase-2 (Tyk2). Activation of these kinases in turn results in phosphorylation of two tyrosine residues Tyr 4 2 7 and Tyr 4 7 7 on mouse IL-10R1, which then act as docking sites for STAT3. STAT3 binds to these sites via its SH2 domain and becomes phosphorylated by the receptor associated Jak-1 and Tyk-2. Phosphorylated STAT3 then dissociates from the receptor, homodimerizes, and translocates to the nucleus where it binds to STAT3 binding elements in the promoter region of several anti-inflammatory genes (Figure 5) (Weber-Nordt et al, 1996; O'Farrell et al, 1998; Donnelly et al, 1999; Kotenko et al, 2000). These include, Heme-Oxygenase 1 (HO-1) (Lee et al, 2002), SOCS-3 (Qasimi et al, 2005), and BCL-3 (Kuwata et al, 2003) which regulate the production of IL-6 and T N F a through mechanisms that are not very well understood. In the case of BCL-3, there is some evidence that BCL-3 induction may inhibit LPS induced N F K B binding required for production of TNFa (Jung et al, 2004). IL-10 also induces the production of IL-1RA in LPS activated macrophages and therefore inhibits the effects of the autocrine IL-1 on macrophages (Carl et al, 2004) (Figure 4). IL-10 also inhibits macrophage proliferation through induction p i 9 ^ ° (O'Farrell et al, 2000) 36 Studies using cells expressing chimeric receptors containing only the STAT3 docking sites of the receptor, STAT3"7" macrophages, or macrophages expressing adenoviral dominant negative STAT3 (Ad STAT3 DN) a l l suggest that activation of STAT3 by IL-10 is necessary to transduce IL-10's negative effect in production of TNFa and IL-6 in activated macrophages (Riley et al, 1999) (Takeda et al, 1999) (Williams et al, 2004). Presumably, STAT3 induces the expression of an array of genes which in the case of SOCS-3 and HO-1 interfere with signaling in activated macrophages or in the case of transcription factor inhibitors such as BCL-3 (Jung et al, 2004) interfere with transcription of inflammatory genes in the nucleus (Figure 4) (Echlin et al, 2000); (Cao et al, 2002); (Grutz, 2005). STAT3 independent IL-10 signaling Ho et al have described several functional regions besides the region required for STAT3 binding within the cytoplasmic portion of IL-1 OR (Ho et al, 1995). One region negatively regulates IL-10 activity. In fact a polymorphism (glycine to arginine) in the human IL-10R1 region analogous to this inhibitory region causes reduced sensitivity to IL-10 (Gasche et al, 2003). Another region in the C-terminus appears to regulate aggregation in the presence of IL-10 (Ho et al, 1995). Some direct evidence for the presence of other signaling molecules also exists. Crawley et al. showed rapid and transient activation of PI3K and p70S6 kinase in human primary monocytes (Crawley et al, 1996), while others have shown inhibition of PI3K induced PKB phosphorylation by IL-10 (Bhattacharyya et al, 2004). Similarly, both IL-10 induction (Lee et al, 2002) and inhibition (Kontoyiannis et al, 2001) of p38 phosphorylation in macrophages have been 37 reported. IL-10 treatment of human macrophages has also been reported to result in SHP-2 phosphorylation (Niemand et al, 2003). IL-10 also inhibited TNFa induced N F K B signaling within 10 minutes (Schottelius A J , 1999) while it inhibited TNFa induced ERK, JNK, and p38 activation within 5 minutes of IL-10 stimulation (Sato K, 1999). These observations further support the presence of STAT3 independent pathways since the effect of IL-10 is taking place within a much shorter time than would be required for STAT3 induced genes to elicit these effects. In light of some evidence for STAT3 independent pathways, the question is whether STAT3 induced de novo protein synthesis, also known as STAT3 dependent pathway, is the only pathway responsible for IL-10's anti-inflammatory effects. Williams et al. showed that in macrophages expressing STAT3 dominant negative protein, IL-10 retained its ability to inhibit T N F a production upon LPS stimulation. However, the inhibition of T N F a by IL-10 in these cells was limited to the first hour of IL-10 stimulation (similar to control cells) and no inhibition was seen beyond the second hour (Williams et al, 2004). Similarly, IL-10 inhibited T N F a and IL-1 production in cycloheximide treated macrophages stimulated with LPS, the effect of which was most pronounced within the first hour (similar to cycloheximide untreated cells) and dissipated after 4 hours (Murray, 2005). IL-10 has also been reported to inhibit the transcription of T N F a through the blockade of N F K B transcription factor, a process that does not seem to require IL-10 induced de novo protein synthesis (Schottelius et al, 1999). Thus, the apparent conflict in the literature regarding the existence and role of STAT3 independent pathways downstream of IL-10 receptor may simply reflect the contribution of these pathways at.different time points after initiation of IL-10 signaling. 38 Because some time is required for the STAT3 induced genes to be expressed, IL-10 may utilize other signaling mechanisms to inhibit macrophage activation during early time points. In fact, our lab has previously shown that IL-10 is able to inhibit early induction of PKB phosphorylation in LPS activated macrophages and that this inhibition is dependent on the presence of SHIP (Figure 3). 39 S H I P + / + S H I P - ' -LPS LPS+IL-10 LPS LPS+IL-10 0 10 20 30 40 60 10 20 30 40 60 0 10 20 30 40 60 10 20 30 40 60 Stimulation time (min) Iff Hi * • *> w m * 4 I K » » Phospho PKB • * PKB Figure 3 : IL-10 requires SHIP to inhibit LPS-induced PKB phosphoryaltion in macrophages. J16 Macrophages derived from S H I P + / + or SHIP 7 " littermates were treated with control buffer or 10 ng/mL L P S ± 100 ng/mL IL-10 for the indicated times before preparation of cell lysates. Samples were treated as in figure 3 and subjected to immunoblot analysis with antibodies specific for phospho-PKB (Thr 3 0 8 ) . The blots were then reprobed with anti-PKB to confirm equal loading ( Dr. Al ice M u i , Unpublished). 40 Post-transcriptional regulation of TNFa by IL-10 The induction of transcriptional repressors such as BCL-3 (Kuwata et al, 2003) or SOCS-3 (Qasimi et al., 2005) by IL-10 are believed to inhibit the transcription of TNF^a. However, studies preformed in macrophages have also revealed that IL-10 can regulate translation and stability of T N F a (Figure 4) The mechanism by which IL-10 regulates T N F a translation has not yet been described. The AU-rich element (ARE) in the 3' untranslated region (UTR) of the T N F a mRNA was previously shown to be required for IL-10 inhibition of T N F a translation, although the molecular mechanism by which IL-10 signaling attenuates translation was not described (Kontoyiannis et al, 2001). The A R E is important for mediating both mRNA stability and translation in response to LPS signaling in both a p38-dependent and independent manner. p38 and its downstream target MAPK-activated protein kinase 2 (MK2) have been implicated in hyperphosphorylating tristetraprolin (TTP), an R N A binding protein that interacts with the A R E and regulates T N F a mRNA stability (Kotlyarov et al, 1999; Kontoyiannis et al, 2001; Mahtani et al, 2001; Neininger et al, 2002; Hitti et al, 2006; Johansen et al, 2006). Kontoyiannis et al have suggested that IL-10 inhibition of TNFa may be dependent on p38 but independent of TTP (Kontoyiannis et al, 2001). However, we and others have not been able to consistently observe IL-10 inhibition of p38 in numerous different macrophage cell lines and primary macrophages (Lee et al, 2002; Grutz, 2005), suggesting IL-10 regulation of TNFa translation likely takes place through a p38 independent mechanism. Interestingly, IL-10 regulation of T N F a translation also requires TNFa 5' UTR, (Mijatovic et al, 1997) (personal communications, Kruys,V.). This observation supports 41 the possibility of a regulation mechanism that may require the interaction of the 3' and 5' regulatory components (Huang et al, 1995); (Aeder et al, 2004); (Lee et al, 2000); (Kumar et al, 2000); (Chu et al, 1999). The A R E binding protein TIA-1 has been proposed to regulate TNFa translation by interacting with both the 3' and 5' UTR of TNFa mRNA. This translational regulation has also been shown to take place through a p38-independent manner (Piecyk et al, 2000). Therefore, TIA-1 may serve as a potential target for regulation of TNFa translation downstream of IL-10 receptor. 42 IL-10 LPS Figure 4: IL-10 signal transduction Upon binding to its receptor, IL-10, Jak kinases associated with the IL-10R1 and IL-10R2, come within each other's proximity and are able to cause activation of one another as well as phosphorylate STAT3 docking sites on the receptor. Activated STAT3 translocates to the nucleus and activates the transcription of several genes that are able to inhibit activation of macrophages. 43 Thesis objectives The overall objectives of this thesis were to define signaling pathways and molecules downstream of the IL-10 receptor that may serve as negative regulators of macrophage activation and T N F a production. IL-10's role as an anti-inflammatory and immunosuppressive molecule is very well established and IL-10 is currently under investigation for treatment of several inflammatory diseases. The STAT3 pathway, leading to de novo transcription of anti-inflammatory molecules is believed to be responsible for IL-10's effects. Others and we have also observed evidence for the presence of mechanisms that do not depend on STAT3 induced de novo transcription. There is currently a great interest in identifying both STAT3 dependent and independent pathways as they may serve as therapeutic targets or markers of inflammatory diseases. As a result, my research is focused on the identification and characterization of STAT3 independent pathways as well as the identification of genes, which are induced by IL-10. Here, we describe rapid activation of SHIP protein by IL-10 and show that this activation is required for IL-10's ability to inhibit TNFa. We report that activation of SHIP by IL-10 leads to a reduction of PI3K product PIP3 and causes inhibition of TNFa translation (Chapter 3). We also show that activation of SHIP alone is sufficient for inhibition of TNFa, as a novel SHIP activator, AQX-016A, is also able to block LPS induced T N F a translation (Chapter 4). The reduction in T N F a production by SHIP activation may be due to the reduction in PIP3 levels, as inhibition of PI3K in macrophages, resulted in inhibition of TNFa. Activation of SHIP by IL-10 represents the first report of a STAT3 independent pathway required for modulation of T N F a production downstream of IL-10 receptor. 44 We also show that IL-10 is able to activate p38, which is required for mRNA expression of a newly identified IL-10 regulated gene, CRIM1. 45 Chapter 2: Methods and materials Cell culture • J774.1 cells (American Type Culture Collection, Rockville, MD) were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 9% (v/v) fetal bovine serum (FBS) (Hyclone, Logan, UT), 0.1 m M 2-mercaptoethanol, 150 uM monothioglycolate (MTG) and 1 m M glutamine on cell culture grade plate (BD Labware, Mississauga, ON, Canada), and cultured at 37°C, 5% C 0 2 and passaged three times per week. A l l cell culture plastic was cell culture grade. J16 and J17 cells were generously provided by Dr. Gerry {Crystal's lab. These cells were made by infecting fresh mature murine B M D M from SHIP"7" and SHIP + / + mice (Helgason et al, 1998) with J2 virus. J16 cells were cultured in Iscove's Modification of D M E M supplemented with 9% (v/v) FBS, 1 m M 2-mercaptoethanol, 150 uM M T G , and 1 m M glutamine and passaged three times per week. B M D M were generated by in vitro differentiation of marrow cells isolated from 3-5 week old SHIP 7" and SHIP + / + (Helgason et al, 1998), C57BL/6J mice (Jackson Laboratory, Bar Harbor, Maine) or TIA 7 " mice (Piecyk et al, 2000). Marrow was flushed out of the femurs by injecting 2 mL of D M E M via a 25-gauge needle through the central cavity. The marrow was then broken up by running it through a 25-gauge needle three times. The marrow suspension was centrifuged and the pellet was resuspended in 10 mL of I D M M supplemented with 9% FBS and 5 ng/mL M-CSF1 (Stem Cell, Vancouver, and B.C.) and plated. After 4 hours, non-adherent cells were removed and plated for 4 days (day 4 macrophages). After 4 days, cells were detached into 5 mL of Cell Dissociation Buffer (Invitrogen, Burlington, ON) and added to the media taken from 47 the cells. Cells were centrifuged and resuspended in CSF-1 containing media and plated for another 3 days (day 7 macrophages). Peritoneal macrophages (PM) were derived by injecting and draining the peritoneum 3 times with 3 mL of D M E M supplemented with 9% FBS (9% DMEM) . A l l washes were pooled and the cells were spun down and resuspended in I D M E M supplemented with 9% FBS and 5 ng/mL of CSF-1 (CSF-1 Media) for 4 hours. . Immuoprecipitation and immunoblot analysis Cells (2 X 106) were plated in 6 cm cell culture plates overnight in growth medium and stimulated the next day with LPS (E. Coli serotype 0111:B4, Sigma, Oakville, Ont) ± IL-10 in 9% D M E M for the indicated length of time. For BMDMs, the cultures were deprived of CSF-1 for 4 hrs prior to stimulation. For immunoprecipitations and peptide pull-down experiments, the cultures were scaled up to 6 X 106 cells in a 10 cm tissue culture plate. Lysates were processed for SDS-PAGE and immunoblot analysis (O'Farrell et al, 1998) (O'Farrell et al, 2000) or used for anti-SHIP immunoprecipitation or IL-1 OR peptide pull-down studies. For SHIP immunoprecipitations, lysates were made 1:100 with rabbit antiserum raised to a N-t.erminal and C-terminal of SHIP (Damen et al, 1998) and incubated for 2 hrs at 4°C prior to the addition of 20 uL (packed bead volume) of protein-A Sepharose. After rocking for 2 hours at 4°C, the beads were washed 3X with 0.1% NP-40/PSB and boiled in 100 uL of SDS-PAGE sample buffer. For IL-1 OR peptide pull-down studies, lysates were made 1 m M with unphosphorylated or phosphorylated, biotinylated IL-1 OR peptides (an equimolar mixture of T F Q G Y Q K Q T R W K and L A A G Y L K Q E S Q G peptides corresponding to the sequence 48 around Y427 and Y477 of the mIL-lORl , respectively). After 2 hours of incubation at 4°C, 20 uL (packed bead volume) of streptavidin-agarose was added and the mixture rocked at 4°C for 2 hrs. The beads were then washed 3X as above and bound proteins eluted by boiling 3 min in SDS-PAGE sample buffer. Immunoblot analyses of samples were performed as previously described (O'Farrell et al, 1998). Briefly, proteins were separated on 10% SDS-PAGE gel at 100 V minigel (Biorad, Mississauga, ON, Canada). Proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Pall Corporation, V W R International, Mississauga, Ontario) at 25 V for 2 hours using the semi dry transfer cell (Transblot SD, BD Biosciences) at 25 Volts for 60 minutes. Following blotting, the membrane was blocked in 5% skim milk powder/TBS-T at 4°C for 1 hour followed by incubation in primary antibody cultured in 3% B S A in PBS at 1 pg/mL of antibody overnight. The next day the membrane was washed and incubated with 0.1 pg/mL HRP-conjugated secondary antibody in TBS-T for 1 hour. The blot was washed three times with TBS-T and protein bands were visualized with E C L chemiluminescent substrate according to manufacturer's instructions (Amersham Life Sciences, Baie d'Urfe, QC, Canada). RNA isolation and Northern blot analysis For mRNA blot analysis, total R N A was extracted from 1.0 X 107 cells using Trizol Reagent (Invitrogen, Burlington, ON, Canada) followed by chloroform extraction, isopropanol precipitation, ethanol wash and re-suspended in diethyl pyrocarbonate-treated water as per manufacturer's protocol. 10-20 jxg of total R N A was prepared in 50% (v/v) formamide, 6% (v/v) formaldehyde, 5 pg/mL ethidium bromide solution 49 resolved electrophoretically on formaldehyde-agarose gels prepared with 1% (w/v) agarose, I X MOPS buffer (20 m M MOPS, 5 m M sodium acetate, 1 m M EDTA) and 6% (v/v) formaldehyde. The gels were washed in 0.05M N A O H for 15 minutes followed by a 45 minute wash in 20X standard saline citrate (SSC) (3 M NaCl, 0.3 M Tri-Sodium itrate, pH 7.0) and blotted via capillary action in 20X SSC onto Biodyne B 0.45/1 membranes (Pall Corporation, Mississauga, ON, Canada). The gel was then washed in was in membranes were U V cross linked and pre-hybridized for 30 minutes in Rapid-Hyb Buffer (Amersham Life Sciences, Baie d'Urfe, QC, Canada) Or Church's buffer ( 0.239 M sodium phosphate- monobasic, 0.261 M podium phosphate- dibasic ,7% SDS, 1% Sodium Pyrophosphate, 2 m M EDTA). Membranes were hybridized with radiolabeled probes in Rapid-hyb buffer or Church's buffer for 2 or 16 hours respectively. The blots were then washed by incubating them twice for 10 minutes at 65°C in a 2XSSC and 0.1% SDS solution , followed by one incubation for 15 minutes in a I X SSC and 0.1% SDS solution and one 10 minute incubation in a 0.1X SSC and 0.1% SDS. Probed membranes were exposed using an Imaging Screen K (Biorad, Mississauga, ON, Canada), scanned on a Molecular Imager F X (Biorad, Mississauga, ON, Canada), and analyzed using Quantity One software (Biorad, Mississauga, ON, Canada). Equal loading of mRNA samples was monitored by hybridizing the same membranes with a labeled G A P D H D N A probe. DNA probes and labeling CRIM1, TNFa, GAPDH. STAT3-IP and C A M P D N A probe templates were prepared by PCR amplification of total cDNA prepared from R N A isolated from LPS and 50 IL-10 stimulated macrophages using Taq Polymerase (Roche Diagnostics, Laval, QC, Canada) in a GeneAmp PCR system 2700 Thermocycler (Applied Biosystems, Streetsville, ON, Canada). PCR products were resolved on a 1% agarose gel, stained with Ethidium bromide (Sigma, Oakville, ON, Canada) and extracted using a QIAquick Gel Extraction Kit (Qiagen, Mississauga, ON, Canada). The products were radiolabeled with (Zhou et al.) [3 2p]a-dCTP for 20 minutes at 37°C in a reaction containing I X Klenow buffer (50 m M Tris-HCl pH 7.2, 10 m M M g C l 2 , 0.1 m M DTT, 0.2 mg/mL BSA), 200nM random hexamers (NAPS Unit, UBC, BC), 1 m M dATP, 1 m M dGTP, 1 m M dTTP, 50 uCi [a- 3 2P]-dCTP (Perkin Elmer, Wellesley, USA), and 5 U of the Klenow fragment (3' - 5' exo") of D N A Polymerase I (Roche Applied sciences, Laval, Queue). 3 2P-labelled probes were separated from unincorporated nucleotides using the QIAquick PCR purification kit (Qiagen, Mississauga, Ont). The specific activity for 1 uL of probe, in counts per minute (cpm), was measured with a Beckman LS 5000 CE liquid scintillation counter (Beckman, Fullerton, USA) and varied between 1-2 X I 0 cpm/ ng of DNA. Primer sequences used for CRIM1 and G A P D H were as follows: CRIM1F: 5'-T G A A G G A G A A G G A C T G C G TT-3', CRIM1R: 5 '-GCA CAT TTC CTT TCC GTT GT-3' , GAPDHF: 5 ' -ACC A C A GTC CAT GCC A T C AC-3 ' , GAPDHR: 5' TCC A C C A C C CTG TTG CTG TA-3 ' , T N F a Sense: A T G A G C A C A G A A A G C A T G A T C CGC. Anti-Sense: C C A A A G T A G A C C TGC C C G G A C TC. A l l probes were sequenced as described on page 46 to ensure the integrity of the probes. 51 Cell stimulation for cytokine production and ELISA 2 X 105 cells were plated for 16 hours in growth media before cells were stimulated in 500 uL of media. For experiments using inhibitor, LY294002, Wortmannin, (Sigma-Aldrich, Oakville, Ont), AQX-016A (Yang et al, 2005) or DMSO (Sigma-Aldrich, Oakville, Ont) as a control were added 45 minutes before cells were stimulated. Where indicated, neutralizing antibody to IL-1 OR (O'Farrell et al, 1998) or TGFp from R & D Systems (Minneapolis, MN) was also added 45 minutes prior stimulation at a final concentration of 1 pg/mL. Supernatants from stimulated cells and appropriate controls were collected after 1, 2 and 4 hours. TNFa production was determined by using an OptEIA Mouse TNFa ELISA kit (BD Biosciences, Mississauga, ON, Canada) as per manufacturer's instructions except that 50 uL reaction volumes were used. Lipid isolation and HPLC analysis 5X10 6 J16 cells were plated in growth media in 10 cm tissue culture dishes. The next day, cell were washed three times with phosphate-free medium before being starved in phosphate free RPMI (MP Biomedicals, Irvine, CA) supplemented with 10% dialyzed FCS (Invitrogen, Burlington, Ont) and 1% RPMI for 2 hrs. Cells were then labeled with 1.0 mCi of orthophosphate (MP Biomedicals, Irvine, CA) per mL for 2 hrs at 37°C. Cells were pretreated for 30 min with AQX-016A, LY294002 or vehicle prior to stimulation with LPS (50 ng/mL) for 15 min, or directly treated with LPS and IL-10 (100 ng/mL) for 15 min. Extraction of inositol phospholipids and HPLC analysis of deacylated lipids were performed by scraping the cells off the plates in 2.5 mL of methanol. Chloroform (1.25 mL) was added and samples are allowed to sit at room temperature for 20 minutes 52 1.5 mL of 2.4 N HC1 was added followed by 1.25 mL chloroform and the samples were centrifuged. The lower phase was washed twice with 1:0.9 EDTA and dried under nitrogen gas. Dried samples were then deacylated by addition of 1.8 mL of methylamine reagent and incubation at 50°C for 45 minutes. Samples were then allowed to dry in a speed vac overnight. Dried samples were then resuspended in water and extracted with 2 mL of butanol/light petroleum ether/ethyl formate (20:4:1) three times. The lower phase was then dried overnight and resuspended in HPLC water. Samples were stored at -80°C until fractionation by HPLC (Waters, Model 510, Waters Spherisorb 5 uM, 4.6X250 mm analytical column, #PSS832715, flow rate at 1 mL/min and l m L fractions were collected). The amount of radioactivity contained in the elution peak for each lipid (two to five fractions) was summed to give the total counts for each lipid, and data were normalized to the first 60 fractions to adjust for fluctuations in total lipid labeling and recovery between samples. Polyribosome analysis J16 and J17 cells (5 X 106 cells in 10 cm dishes) were stimulated with LPS ± IL-10 as indicated before washing in ice-cold PBS containing 150 pg/mL of cycloheximide. Samples were subjected to polyribosome analysis essentially as described by Kontoyiannis et al. (Kontoyiannis et al, 2001) with minor modifications. Briefly, cells were collected into 500 uL of cold hypotonic lysis buffer (10 m M KC1, 10 m M Tris-Cl, pH 7.2, 10 m M M g C l 2 , 20 m M dithiothreitol, 150 ug/mL cycloheximide, 0.5% NP-40 and 100 u/mL Rnasin). Lysates were rocked at 4°C for 30 min prior to microcentrifugation at 14 000 rpm.to remove unbroken cells and nuclei. Clarified lysates 53 were mixed with 50% sucrose solution to bring the concentration to a final 10% sucrose. Five hundred microlitre of this solution was layered on 500 uL of 30% and 500.uL of 50% sucrose prepared in lysis buffer without NP-40 in a 1.5 mL centrifuge tube (Beckman-Coulter, Mississauga, Ont.). Samples were centrifuged in a TLA-100.4 rotor in a TL-100 ultracentrifuge (Beckman-Coulter, Mississauga, Ont.) at 60,000 R P M for 40 minutes. 100 uL fractions were collected from the top and aliquots extracted with phenol/chloroform (1:1). The aqueous phases were then supplemented with 3 M sodium acetate (NaOAc) (Final concentration of 0.3 M) amd two volumes of EtOH were added to precipitate the R N A for Northern blot analysis Mouse endotoxemia model SHIP7", SHIP+ /" and SHIP + / + littermates (4-8 weeks of age, (Helgason et al, 2000) were injected intraperitoneally (IP) with 25 mg/kg (SHIP + / +) or 2.5 mg/kg (SHIP7" and SHIP+/") of LPS ± IL-10. The IL-10 treated mice received 1 ug of IL-10 by IP injection 30 minutes prior to LPS administration. Three hours after LPS injection, blood was drawn from the tail vein for determination of plasma TNFa levels by ELISA. Surface marker analysis Macrophages were suspended for 15 minutes at 107 cells/mL in PBS supplemented with 3% FBS (FACS Buffer) and 5 ug/mL of Fc gamma Rill-specific monoclonal antibody (2.4G2)_(BD Pharmingen, Oakville, Ont). F4/80, CD16/32 (BD Pharmingen, Oakville, Ont.), or C D l l b (Miltenyi Biotec, Auburn, CA) antibody were added at a 0.2 pg/mL per 106 cells/mL for 30 minutes and cells were washed in 500 uL of 54 FACS buffer 3 times and used for analysis by flow cytometry (BD FACS Canto, Mississauga, Ont.). The data generated was collected by BD FACS Diva program and analyzed by FCS Express Version 3 software (De Novo Software, Thronhill, Ont.). Transformation of bacteria The "heat shock" method was used to transform plasmid into CaCl2-competent DH5ot strain E. coli. 50 uL of competent DH5cc E. coli and 10-100 pg D N A were mixed and incubated on ice for 30 minutes. The tube was heated at 42°C for 45 seconds, and immediately placed on ice for 2 minutes. Transformed bacteria were incubated at 37°C for 1 hour and streaked onto LB-Amp plates (LB media, 1.5% (w/v) agar) containing the appropriate antibiotics. Culture were prepared by inoculating a single bacterial colony into 3 mL of Lennox L broth base (10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl) growth media (Invitrogen, Burlington, Canada) incubated at 37° for 16 to 18 hours. Isolation of plasmid D N A was performed by the alkaline lysis method with the QIAprep Spin Miniprep Kit (Qiagen, Mississauga, Ont.). DNA sequencing D N A sequencing reactions were performed with Big Dye Terminator version 2.0 (PE Biosystem). Reactions were prepared with 200 ng of D N A template, 5 pmole.primer, and 2 pi Big Dye ready mix in 20 uL final volume. The cycling condition was as follows: 96°C for 30 s, 52°C for 15 s, and 60°C for 4 minutes. D N A was ethanol precipitated and resuspended in 20 uL HiDi Formamide. Samples were heat denatured at 94 °C for 2 minutes. The D N A sequence was determined by capillary electrophoresis 55 using the A B I 310 Genetic Analyser. Sequence analysis and contig alignments were performed with Sequencher software (Gene Codes Corp., Ann Arbor, USA). CRIM1 siRNA D N A oligonucleotides corresponding to CRIM1 short interfering R N A sequences were synthesized by the University of British Columbia Nucleic Acid Protein Service Unit (Vancouver, BC, Canada). Complementary oligos were annealed and ligated into the U6 promoter vector, pSHAg-1. This G A T E W A Y (Invitrogen, Burlington, ON, Canada) compatible vector was then used to transpose the siRNA expression cassette into the recipient pHR' -CMV-EGFP lentiviral plasmid. Replication-deficient lentiviral vectors were generated by transfection of three plasmids into 293T cells as previously described (Lee et al, 2004). Briefly, 293T cells were co-transfected with the pHR'-CMV-EGFP lentiviral plasmid, the packaging plasmid (pCMVAR8.2), and the envelope plasmid (pCMV-VSVg) (Invitrogen, Burlington, ON) to produce viral particles. The medium was replaced after 16 hours. Conditioned medium was collected 30 hours later and filtered (.45 um). The filterate was then collected and ultracentrifuged using a Beckman SW 28 rotor at 25000 rpm (aprox 85000 rcf) for 100 minutes at 4 C° The superbatant was decanted and the pellet was.resuspnded in PBS and diluted in D M E M . J774 macrophages were incubated for 6 hours in lentiviral supernatants at a multiplicity of infection of 60:1. Transformed cells were then selected by evaluating for GFP expression using fluorescence-activated cell sorting. The oligonucleotide sequences for the CRIM1 siRNA were as follows: Sense 5 ' -CAG CTC TCG TC CTC TGG C G G G C G C A C A G A A G C TTG TGT G C G CCC GCC A G A G G A A C G A G A GCT G C G GTT TTT T-3', Anti-sense 5'-GAT C A A A A A A C C G C A GCT CTC GTT CCT CTG G C G 56 GGC G C A C A C A A G CTT CTG TGC GCC CGC C A G A G G A A C G A G A G C TGC G-3' Statistics Data are reported as means ±S.D., unless otherwise specified: Data were analyzed using unpaired, two-tailed distribution student's t-Test with significance level at P < 0.05. For figures 6, 12D, 14, 17, and 22, the statistic analysis was done on data after combining three biological replicates for each experiment. 57 Chapter 3: IL-10 inhibits TNFa through activation of SHIP This chapter describes the identification of a STAT3 independent pathway downstream of IL-1 OR and the role this pathway plays in regulation of macrophage activation. 58 Introduction: Macrophages are an integral part of the immune response due to their ability to detect and alleviate infections. Upon activation, macrophages produce a variety of pro-inflammatory mediators including, Tumor necrosis factor alpha (TNFa). Although regulated production of TNFa is physiologically beneficial, disregulated expression can lead to chronic inflammatory diseases such as inflammatory bowel disease (Kontoyiannis et al, 2001; Pizarro et al., 2003) and various other pathologies such as endotoxic shock (Williams et al., 2004); (Kollias et al, 1999; Williams et al, 2004; Sandborn et al, 1999). Several approaches have been used to inhibit the effects of T N F a in disease including inhibition of signaling mechanisms that may be required for production of TNFa (Palladino et al, 2003). So far targeting of intracellular signaling molecules as a mechanism to inhibit TNFa has met with little success in clinic. The cytokine interleukin-10 (IL-10) is a key physiological negative regulator of macrophage activation and TNFa production (Moore et al, 2001; Grutz, 2005; Murray, 2006). Targeted disruption of the IL-10 gene in mice results in inflammatory bowel disease (Kuhn et al, 1993; Davidson et al, 2000) and exaggerated immune responses when challenged with LPS (Rennick et al, 1997). Therefore, understanding how IL-10 is able to regulate macrophage activation and T N F a production may serve as a novel approach to identifying molecular targets for modulation of T N F a production. The IL-10 receptor (IL-1 OR) consists of at least two subunits (Moore et al, 2001; Grutz, 2005; Murray, 2006). The primary ligand binding component, designated IL-10R1, binds IL-10 with high affinity and in the presence of IL-10, associates with the accessory subunit IL-10R2. Ligand-induced heterodimerization of 59 IL-10R1 and IL-10R2 results in activation of receptor-associated Jak tyrosine kinases, Jakl and Tyk2, which then phosphorylate IL-10R1 on two cytoplasmic tyrosine residues (Y427/477 of mouse (m)IL-lORl; Y446/496 of human (h)IL-lORl). Phosphorylation of these tyrosines creates docking sites for the latent cytoplasmic transcription factor, STAT3, which upon binding is phosphorylated by receptor-bound Jak kinases (Darnell, 1997; O'Farrell et al, 1998). Upon phosphorylation, STAT3 translocates into the nucleus , binds specific sequences in the promoters of target genes, and regulates their transcription (Darnell, 1997) . For instance, STAT3 induces the transcription of BCL-3 which inhibits LPS induced binding of N F K B to TNFa promoter and inhibits T N F a production (Jung et al, 2004). The induction of SOCS3 and HO-1 by STAT3 also inhibits TNFa production in LPS activated macrophages (Qasimi et al, 2005); (Lee et al., 2002) and interfere with transcription of inflammatory genes in the nucleus (Echlin et al, 2000) ;(Cao etal, 2002); (Grutz, 2005). The STAT pathway is the best characterized pathway downstream of the IL-1 OR and is integral to mediating cellular responses to IL-10 (O'Farrell et al, 1998; Riley et al, 1999; Murray, 2005; Murray, 2006; Weber-Nordt et al, 1996). However, several lines of evidence suggest that the IL-1 OR couples to additional, non-STAT3, signaling pathways which are important for the early effects of IL-10 in activated macrophages (Schottelius et al, 1999; Denys et al, 2002; Williams et al, 2004; Murray, 2005). Our lab had previously found that IL-10 inhibits LPS induced PKB phosphorylation within 15 minutes of IL-10 stimulation, in a SH2 domain-containing inositol 5'-phosphatase (SHIP) dependent manner. t 60 Activation of PI3K leads to upregulation of PIP 3 in the membrane. This PIP3 is responsible for recruiting several proteins, including P K B to the membrane which ultimately results in activation of macrophages and production of pro-inflammatory mediators (Lim et al, 2003). SHIP antagonizes the upregulation of PIP3 dependent signaling pathways by removing the 5'-phosphate of PIP3 (Krystal et al, 1999). In macrophages, SHIP is a negative regulator of T N F a production, potentially through regulation of P K B , p38, and N F K B activation downstream of the PI3K pathway (An et al, 2005). SHIP has also been shown to be negative regulator of signaling in activated mast cells and B-cells (Rauh et al, 2003; Aman et al, 1998). Here, for the first time, we show that IL-10 activates SHIP rapidly and transiently and that this activation is pertinent to the immediate anti-inflammatory effects of IL-10 in macrophages. We also show that activation of SHIP by IL-10 leads to inhibition of TNFa association with polysomes, suggesting SHIP is involved in inhibition of TNFa translation. 61 Results: IL-10 stimulates tyrosine phosphorylation of SHIP We had previously shown that IL-10 inhibits LPS induced PKB phosphorylation in macrophages (Figure 5). As this inhibition was dependent on the presence of SHIP, we questioned whether IL-10 was able to activate SHIP. We thus examined whether IL-10 treatment of J774 and J16 macrophages results in SHIP activation, as assessed by an increase in SHIP tyrosine phosphorylation. Briefly, J16 and J774 macrophages were stimulated with IL-10 for the indicated times and lysed. SHIP protein was immunoprecipitated using an anti-SHIP antibody and subjected to immunoblot analysis using the anti-phosphotyrosine and anti-SHIP antibody. As shown in figure 5A, IL-10 rapidly induces the phosphorylation of SHIP. Although the phosphorylation of SHIP on its tyrosine residues is not required for SHIP 'S phosphatase activity, this phosphorylation correlates with the recruitment of SHIP protein to the membrane where it is able to mediate the conversion of its substrate (Phee et al, 2000). SHIP recruitment to the membrane is dependent on its ability to interact with the cytoplasmic regions of surface receptors. As SHIP contains an SH2. domain and the cytoplasmic region of IL-10R1 contains several tyrosine residues which are phosphorylated upon IL-10 ligation, we speculated SHIP would interact with IL-10R1 through binding to one of these phosphotyrosine residues (Sly et al, 2003). As the two tyrosine residues Tyr 4 2 7 and Tyr 4 7 7 are important for IL-10 signaling (Weber-Nordt et al, 1996) (Asadullah et al, 2003), we used peptides containing the mIL-lORl phosphotyrosine residues Tyr 4 2 7 and Tyr 4 7 7 to pull down interacting molecules in cell 62 lysates (sequence: T F Q G Y Q K Q T R W K and L A A G Y L K Q E S Q G ) . J774 macrophages were stimulated with IL-10 for 5 minutes and lysates were prepared and incubated with phosphorylated or control unphosphorylated peptides. The peptide and the interacting proteins were precipitated using streptavidin beads for immunoblot analysis using anti-SHIP antibody. As shown in figure 5B, tyrosine phosphorylated peptides pulled down substantially more SHIP than the unphosphorylated. Therefore, phosphorylation of tyrosine residues on the cytoplasmic region of IL-10 receptor increases its affinity for SHIP protein. LPS-induced PIP^ levels is inhibited by IL-10 LPS activation of macrophages results in an increase in PIP3 levels through activation of PI3K (Lim et al, 2003). We questioned whether the previousely observed IL-10 induced phosphorylation of SHIP results in increased SHIP phosphatase activity and whether in macrophages, this activity can decrease LPS induced PIP3 levels. SHIP hydrolyzes removal of the 5' phosphate from PIP3 and enhances the formation of PI(3,4)P2 on the plasma membrane (Vanhaesebroeck et al, 2005). Therefore, in LPS activated macrophages, SHIP activation should lead to an increase in PI(3,4)P2 and a decrease in PIP3 levels. J16 macrophages were labeled with [3 2P] orthophosphate for one hour and stimulated with LPS or LPS and IL-10 for 15 minutes. Membrane lipids were isolated and phosphatidylinositol levels were determined. As shown in figure 6A, LPS increased membrane PIP 3 levels. Addition of IL-10 reduced the LPS induced PIP 3 levels 63 A J774 SHIP"'" SHIP 0 5 10 30 0 <*# 1MI • 5 10 IL-10 ( min) • phospho-Tyrosine (4G10) SHIP B SHIP Figure 5: IL-10 stimulates tyrosine phosphorylation of SHIP In panel A , J774 cells (left panel) or SHIP 7" and SHIP + / + J16 B M D M s were treated with 100 ng/mL of IL-10 for the indicated times at 37°C before preparation of cell lysates. SHIP was immunoprecipitated using anti-sera generated against the C-terminus of SHIP and the resulting immunoprecipitates resolved by SDS-PAGE and subjected to immunoblot analysis using anti-phosphotyrosine Ab (4G10). Immunoblots were stripped and reprobed with anti-SHIP anti-N antisera. In panel B, lysates from IL-10 treated cells were incubated with biotinylated, phosphorylated (P-427/477) or unphosphorylated (427/477) peptides corresponding to the sequence around Y427 and Y477 of the mlL-10R1. Bound proteins were precipitated with streptavidin-Agarose, resolved by SDS-PAGE and subjected to immunoblot analysis with rabbit antiserum raised to the N -terminal of SHIP (Damen et al, 1998). Experiment A is representative of at least three experiments in J774 cells and two experiments in J16/J17 macrophages. Experiment B was performed a single time. 64 PI (3,4,5) P 3 3000 2500 Control L.PS LPS+IL-10 B PI(3,4)P2 2 O 3500 3000 2500 £ 2000 1 1500 51 1000 500 0 * -f-Control LPS LPS+IL-10 Figure 6: IL-10 decreases LPS-induced PIP3 levels and increases PI(3,4)P2 levels J16 cells were incubated in phosphate free media containing 1 mCi of orthophosphate per 107 cells. Cells were then treated with control buffer, or LPS (50 ng/mL) ± IL-10 (100 ng/mL) for 15 minutes before preparation of cell lysates. Lysates were subjected to inositol lipid extraction and PIP3 and PI(3,4)P2 levels were determined. (** indicates p<0.01 and * indicates p<0.05 when comparing LPS treated samples to control or LPS+IL-10 samples to LPS alone) 65 by eight folds relative to amounts in LPS induced cells. In line with activation of SHIP, IL-10 caused an increase in PI(3,4)P2 levels (Figure 6B). However, given that LPS stimulation also increased PI(3,4)P2 levels, the same relative change in PI(3,4)P2 did not occur, although a similar absolute change would be expected. Therefore, IL-10 activates SHIP phosphatase activity and reduces LPS induced PIP 3 levels. IL-10 inhibits LPS induced TNFa production in a SHIP dependent manner Activation of macrophages by LPS results in production of an array of cytokines including T N F a whose production is significantly inhibited by IL-10. As the PI3K pathway has been shown to regulate TNFa, we speculated that activation of SHIP by IL-10 might serve as a mechanism to inhibit T N F a production. We treated J16 (SHlP + / + ) and J17 (SHIP 7 ) macrophages with LPS ± IL-10 for two hours and measured T N F a levels in the culture supernatants. We found that IL-10 reduced the level of T N F a produced by LPS-activated SHIP + / + cells in a dose-dependent manner but had a significantly lower inhibitory effect on SHIP 7" macrophages (Fig 7A). We also measured the levels of T N F a at 24 hrs after stimulation and found no difference in the IL-10 responsiveness of SHIP + / + and SHIP 7" macrophages (Fig 7B), suggesting that SHIP was required for the early inhibition of TNFa by IL-10 but not at later times. Inhibition of PI3K directly using Wortmannin resulted in equal inhibition of T N F a expression in both SHIP + / + and SHIP 7" cells (Fig 7D) suggesting that the signaling mechanism downstream of PI3K pathway were still involved in regulation of T N F a in both cell types. Presumably, SHIP"A cells possess higher levels of PIP3 than SHIP + / + cells 66 Figure 7: IL-10 requires SHIP to inhibit LPS-induced TNFa production in macrophages J16 macrophages derived from SHIP + / + and J17 macrophages from SHIP 7" littermates were treated with 100 ng/mL of LPS with the indicated concentration of IL-10 for 2 hours (Panel A) or 24 hours (Panel B). In Panel C, B M D M from P T E N + / + and P T E N 7 + were treated with 100 ng/mL of LPS with the indicated concentration of IL-10 for 2 hours. Culture supernatants were then collected for T N F a protein determination by. ELISA. In panel D, J16 and J17 B M D M were treated with Wortmannin (lOOng/mL) or LY294002 (25 uM) for 45 minutes before 100 ng/mL of LPS was added for 2 hours. Maximum T N F a levels for SHIP + / + and SHIP7" macrophages was at 990 ±15 and 940 pg/mL ±8, respectively at 2 hours and 2900 ±0 and 4100 pg/mL ±201 at 24 hours. Maximum T N F a levels for PTEN and P T E N 7 + macrophages were 1100 ±18 and 1100 ±26 pg/mL. Maximum T N F a levels for wild-type and SHIP 7" macrophages were 980 ±31 and 1700 ±92 pg/mL (Fig. 7D). (** indicates p<0,01 as compared to LPS alone samples). 67 (Huber et al, 1998; Scheid et al, 2002), thus a potential reason for the relative resistance of the SHIP 7" cells to IL-10 could be that the PIP3-dependent pathways are more strongly activated due to the loss of SHIP-dependent degradation. To examine this possibility we also tested the inhibitory ability of IL-10 in macrophages deficient in one allele of PTEN. PTEN + / " and SHIP 7" cells have similar levels of basal PKB phosphorylation (data not shown). IL-10 inhibited T N F a production to the same degree in P T E N + / + and PTEN + / " macrophages (Fig. 7C), suggesting that the attenuated IL-10-induced inhibition in SHIP 7" cells is specific to SHIP rather than due to higher PIP 3 levels in SHIP 7" cells.. IL-10 requires SHIP to inhibit TNFa translation TNFa production is regulated at transcriptional and post-transcriptional levels. Therefore, we examined i f SHIP was involved in transcriptional or post-transcriptional inhibition of TNFa. We found that the level of inhibition of T N F a mRNA by IL-10 was the same in both J16 SHIP + / + and J17 SHIP 7" macrophages (Figure 8A). Since IL-10 can inhibit translation of T N F a (Kontoyiannis et al, 2001 ) and Wortmannin has been shown to inhibit translation of T N F a in T-cells (Ramirez et al, 1999), we tested whether IL-10 activation of SHIP may modulate TNFa production through regulation of its translation. Highly translated mRNAs are associated with polyribosomes and can be separated from slowly translated mRNAs by sucrose density centrifugation (Kedersha et al, 2002). IL-10 has been shown to shift the cellular population of T N F a mRNA from the active polyribosome pool to the monosome associated or free mRNA pool (Kontoyiannis et al, 2001). We thus examined whether IL-10 inhibition of TNFa translation occurred in a SHIP dependant manner. However, because IL-10 also inhibits 68 TNFa transcription (Qasimi et al, 2005), we needed an IL-10 treatment condition that would not alter the overall level of TNFa mRNA. Macrophages were treated with LPS for 45 minutes followed by treatment with or without IL-10 or media for 15 and 30 minutes. As seen in figure 8B, IL-10 did not inhibit the overall levels of T N F a transcripts in this treatment. Lysates from these cells were loaded over a 3-step sucrose gradient and centrifuged to allow for migration and separation of the cytoplasmic components over the different layers. Ten fractions were collected from each centrifuge tube. Fraction 1 represents the lowest sucrose concentration fraction while fraction 10 has the highest sucrose concentration. T N F a mRNA in each fraction was determined by Northern blot analysis. IL-10 treatment of SHIP + / + macrophages decreased T N F a mRNA in high sucrose fractions (polysome associated TNFa) but IL-10 did not inhibit polysome associated TNFa to the same degree in SHIP 7" macrophages (Figure 8C). In addition, reprobing the Northern blot with G A P D H confirmed equal loading. This suggests while there are other mechanisms downstream of IL-10 receptor involved in inhibition of T N F a translation, activation of SHIP is one of the mechanisms responsible for inhibition of T N F a translation. 69 A SHIP L P S IL-10 T N F a G A P D H +/+ + + - + + - + - - + B +/+ -/- SHIP 1 + -40 <m$ + IL-10 TNFa G A P D H LPS T N F a G A P D H Density Low High Low High Fraction 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 «**>•»«•• • S H I P + / + • • a « - • «• IL-10 (-15 min) <|g m tm .... m IL-10 (-30 min) S H I P • - -# — ««§«»«»<•» — •**> frit IL-10 (-15 min) • IL-10 (-30 min) Figure 8: IL-10 using SHIP shifts LPS-induced TNFa mRNA from polysomes to monosomes. In panel A , SHIP + / + or SHIP"" B M D M were stimulated with 100 ng/mL LPS ±100 ng/mL of IL-10 for 60 min prior to preparation of total R N A for R N A Northern blot analysis for T N F a or GAPDH. Densitometric analyses are also shown. In panel B, S H I P + + or BMDM were stimulated with 100 ng/mL LPS for 60 min ± 100 ng/mL of IL-10 for the last 15 minutes. RNA was prepared and analyzed as in A . In panel C, B M D M were treated with LPS (50 ng/mL) for 1 hour ± 100 ng/mL of IL-10 for the last 15 or 30 minutes. Total cytoplasmic R N A was fractionated using sucrose density gradient centrifugation and fractions analyzed for T N F a and G A P D H transcripts. The experiments were repeated 2 times. 70 The ARE binding protein TIA-1 is not required for the IL-10-mediated inhibition of TNFa production Trans-acting factors that bind to the 3'UTR A R E of T N F a are required for TNFa post-transcriptional regulation. Therefore, the possibility that IL-10 may inhibit TNFa in a 3'UTR dependant fashion through modulation of the activity of these trans-acting factors has been studied. TTP binds to 3'UTR A R E of T N F a and stabilizes the TNFa mRNA. However, IL-10 can still inhibit T N F a in TTP"7" macrophages (Kontoyiannis et al, 2001). TIA-1 was recently identified as an inhibitor of T N F a translation. TIA-1"7" macrophages produce much higher levels of TNFa, presumably because the repression of T N F a translation is removed. Similar to IL-10, TIA-1 regulates the association of T N F a with polysomes (Piecyk et al, 2000). Therefore, we questioned whether TIA-1 may function downstream of SHIP to inhibit T N F a translation. To test this, we derived B M D M from TIA-1 + 7 + and TIA-1"7" mice and treated them with LPS or LPS and IL-10 for 2 hours. IL-10 inhibited T N F a production in TIA-l" 7 " cells to the same extent as it did in TIA-1 + 7 + macrophages (Figure 9A). In addition, we could not see any differences in T N F a production between LPS induced T I A - l + 7 + and TIA-1"7" macrophages. Polysome analysis of T N F a mRNA in LPS ± IL-10 treated was also performed. We observed an increase in polysome associated T N F a in LPS activated TIA-1"7" B M D M . However, IL-10 was still able to inhibit polysome association in TIA-1" 7" macrophages to the same extent as that in TIA-1 + 7 + macrophages (Figure 9B) suggesting that IL-10 does not use TIA-1 to inhibit TNFa translation. 71 A B LPS LPS+IL-10 T I A - 1 1 2 3 4 5 6 7 8 9 10 Wi ld -Type IP 1 2 3 4 5 6 7 8 9 10 i f L P S TIA-1 -/-• « LPS+IL-10 ! 2 ° Figure 9: The ARE binding protein TIA-1 is not required for the IL-10-mediated inhibition of TNFa production TIA-1 + / + or TIA-1 7 " mice B M D M (light or dark bars respectively) were plated in a 24 well plate and stimulated with LPS (100 ng/mL) or LPS and IL-10 (100) for 2 hours. Culture supernatants were then collected for TNFa protein determination by ELISA. Maximum TNFa for T IA-1 + / + B M D M was 1500 ±45 pg/mL and 1500 ±15 pg/mL for TIA-1"" B M D M (Figure 9A). The difference between the two cell types in response to IL-10 was not significant. In panel B, T I A - 1 + / + or TIA-1 7 " B M D M were stimulated with LPS (100 ng/mL) for 60 min ± IL-10 (100 ng/mL) of for the last 15 minutes. RNA was prepared and analyzed by Northern analysis. Corresponding densitomeric analysis is also presented. The above experiments were repeated at least 3 times. 72 IL-10 requires SHIP to inhibit TNFa production in peritoneal exudates Macrophages residing in the peritoneum represent a population of highly differentiated and mature macrophages. We used these cells to test whether our observations in J16 SHIP + / + and J17 SHIP 7" macrophages could be extended to primary cells. Exudate macrophages were obtained by peritoneal lavage of SHIP + / + and SHIP 7" mice. Cells were allowed to adhere for 4 hours in media, and then were stimulated with LPS or LPS and IL-10 for 2 hours. T N F a in the supernatant was measured by ELISA. IL-10 significantly inhibited TNFa in both SHIP + / + and SHIP7" macrophages. However, IL-10 inhibited TNFa better in SHIP + / + than in SHIP7" macrophages. This shows that IL-10 uses SHIP to inhibit TNFa production but that there are also other SHIP independent pathways used by IL-10 in this process (Figure 10). Plasma TNFa levels induced by LPS are markedly reduced by IL-10 in SHIP + / + but not SHIP+/' mice Administration of LPS into the peritoneal cavity of mice leads to release of TNFa, IL-1 and IL-6 into the plasma (Engelberts et al, 1991); (Chensue et al, 1991). Administration of IL-10 along with LPS can however inhibit the production of these inflammatory cytokines in mice (van der Poll et al, 1997). As our data suggested that IL-10 partially utilizes SHIP to inhibit TNFa production in peritoneal exudate' macrophage, we tested i f SHIP 7" mice would be resistant to the anti-inflammatory effects of IL-10. SHIP 7" mice are highly sensitive to LPS and produce more than 10 fold greater T N F a than wild type mice. To avoid the possibility that any potential non-responsiveness to IL-10 is due to the large T N F a levels, we compared SHIP + / + mice to 73 100 90 80 70 £ 80 o 50 0 s B 40 LL Nl 30 20 10 0 S H I P +IM S H I P -/-1 ** ** • • • 0.16 0.80 4.0 IL-10 (ng/rnL) Figure 10 : IL-10 inhibits TNFa production in peritoneal exudates macrophages SHIP + / + and SHIP * mice peritoneal cavity (light or dark bars respectively) were flushed with PBS. The peritoneal exudates were stimulated with LPS ±IL-10 for 2 hours. TNFa level in the supernatants was determined by ELISA. Maximum TNFa levels for SHIP + / + and SHIP ''' macrophages were 780 +16 and 420 ±9 pg/mL, respectively. This experiment was repeated at least 2 times. (** indicates p<0.01 indicates p<0.05 as compared to SHIP + + levels) 74 mice in which only one allele of SHIP was deleted. Even in these SHIP+ /" mice, we had to reduce the LPS dose 10 fold to 2.5 mg/kg in order to observe similar levels of TNFa to that in the SHIP + / + mice. Mice were intraperitoneally injected with LPS and plasma was sampled after 3 hours for the presence of TNFa. Administration of IL-10, 30 minutes prior to LPS administration resulted in significant inhibition of plasma TNFa. However, this inhibitory effect by IL-10 was significantly reduced in SHIP+ /" mice suggesting IL-10's anti-inflammatory effect in vivo is dependent on the presence of SHIP (Figure 11). Therefore, SHIP seems have a significant role in negatively regulating TNFa in vivo and may serve as an anti-inflammatory target. 75 1200 _ + + IL-10 SHIP+/+ SHIP+/-Figure 11: Plasma TNFa levels induced by LPS are markedly reduced by IL-10 in SHIP + / + but not SHIP+/" mice Three SHIP + / + and SHIP+ /" littermates were administered 1 pg of IL-10 or PBS IP 30 min prior to IP injection of 25 mg/kg (wild-type mice) or 2.5 mg/kg (SHIP+/~ mice) LPS. Serum TNFa levels were determined 3 hrs after LPS administration. This experiment was repeated at least 2 times with at least 3 mice for each group each time. (** indicates p<0.01 as compared to LPS only samples) 76 Discussion: Signaling molecules induced by IL-10 have significant potential to act as targets for treatment of inflammatory diseases. So far, our understanding of how IL-10 inhibits macrophage activation is limited to STAT3 dependent transcriptional induction of anti-inflammatory genes. Activated STAT3 translocates to the nucleus and induces the production of several anti-inflammatory proteins such as Heme-Oxygenase 1 (HO-1) (Lee et al, 2002), SOCS-3, IL-4R (Lang et al, 2002), BCL-3 , and IL-1RA in macrophages (Carl et al, 2004). These proteins are then able to prevent macrophage activation by inhibiting cell interactions with other inflammatory molecules (IL-1RA) (Carl et al, 2004); (Barcellini et al, 1996), by inhibiting signaling molecules required for maintaining the activated state of macrophages (SOCS-3) (Kuwata et al, 2003) (Qasimi et al, 2005) as well as by enhancing the production and response to certain anti-inflammatory molecules (HO-1, IL-4R) (Lang et al, 2002). Although this STAT3 dependent transcriptional mechanism, known as the STAT3 pathway is a well accepted mechanism of action for IL-10, there is also evidence for STAT3 independent pathways. In several studies where the activity of STAT3 is abolished, IL-10 can still inhibit TNFa production. In macrophages expressing a STAT3 dominant negative protein, IL-10 inhibits TNFa production during the first hour of IL-10 exposure (Williams et al, 2004). Similarly, IL-10 inhibited TNFa in cycloheximide treated macrophages during the first hour (Murray, 2005). Most convincingly, Lang et al reported inhibition of T N F a production in STAT3 7 " macrophages during the first 2 hours of IL-10 treatment (Lang et al, 2002). However, the mechanism responsible for this early inhibitory effect has not yet been elucidated. 77 Here we describe for the first time a STAT3 independent pathway activated by IL-10 that is responsible for the regulation of early T N F a production. IL-10 rapidly and transiently activates SHIP. The interaction of peptides containing the mlL- lORl phosphotyrosine residues Tyr 4 2 7 and Tyr 4 7 7 with SHIP suggest that SHIP may be recruited to the membrane through direct interaction with IL-10 receptor. This recruitment to the membrane is required for the observed IL-10 induced SHIP phosphatase activity as SHIP'S substrate, PIP3, is mainly located on the membrane. The rapid phosphorylation of SHIP by IL-10 further supports an intermittent relation between IL-10 receptor and SHIP as SHIP phosphorylation correlates with its recruitment to the membrane (Baran et al., 2003). We recognize that since phosphotyrosine residues on the peptides used in this experiment can bind SH 2 , it is possible that these observations will result from a kinetically forced interaction. Therefore, future immunoprecipitaion experiments will be required to conclusively show the interaction of SHIP and IL-1 OR. IL-10 activation of SHIP, which antagonizes PI3K signaling, is required for the production of TNFa in LPS activated macrophages. In the early time points, when STAT3 induced genes are slowly accumulating, activation of SHIP by IL-10 limits production of TNFa production. This is evident by the reduced efficiency of IL-10 to inhibit TNFa in SHIP 7" macrophages. This inefficiency is decreased at higher concentrations of IL-10 and at later time points, likely due to more efficient recruitment of STAT3 dependent and SHIP independent pathways, masking the importance of SHIP signaling. The significance of SHIP in IL-10 signaling is further observed in in vivo studies, where IL-10 requires SHIP to inhibit T N F a production in a mouse endoxemia model. 78 SHIP 7" mice are hyper-responsive to LPS and produce significantly higher levels of T N F a as compared to SHIP + / + mice (Data not shown). To circumvent the potential criticism that any reduction in IL-10's ability to inhibit TNFa levels is simply due to the greater amount of TNFa produced, we used SHIP+ /" instead of SHIP 7" mice. Even then, we had to reduce the LPS dose 10 fold to induce similar TNFa levels in SHIP+ /" and SHIP + / + mice. Administration of IL-10 significantly decreased plasma T N F a levels in wild-type mice but had very little effect on plasma TNFa levels in SHIP+ /" mice. This is highly significant, especially since higher concentrations of LPS were employed in the wild type mice. These data lend more support to a role for SHIP in mediating IL-10's inhibition of TNFa production. Interestingly, despite the differences in inhibition of T N F a protein production in SHIP + / + and SHIP 7" macrophages by IL-10, IL-10 inhibited TNFa mRNA to the same extent in both cells. This suggested that IL-10 activation of SHIP was likely most important for post-transcriptional regulation . of TNFa. Translational regulation of proteins can be studied by taking advantage of the density changes that take place as mRNAs switch from free form to translatable form associating with increasing number of ribosomes. This separation by density is then achieved by centrifuging cell lysates over a sucrose gradient and detecting the mRNA distribution in each fraction (Li et al, 2006). Several studies have shown that lower density fractions are associated, in order, with free mRNA, 40S, 60S and 80S ribosome followed by fractions containing no mRNA followed by fractions consisting of polysomes with more than one ribosome per mRNA. The fraction with no mRNA (Fractions 8 and 9) is likely indicative that change in density of ribosome containing mRNA does not increase in the same linear fashion as the change in 79 the density of each fraction (Piecyk et al, 2000) ;(Kontoyiannis et al, 2001) (Lerner et al, 2006). We found that in LPS treated macrophages, T N F a exists as free mRNA associated with 80s ribosome or associated with polyribosomes. Similar to observations made by Kontoyannis et al, addition of IL-10 inhibited T N F a mRNA association with polysomes. However, IL-10 was not able to shift LPS induced polysome associated TNFa to free mRNA/monosomes in SHIP7" macrophages to the same degree as in wild type macrophages. IL-10 addition also resulted in inhibition of TNFa monosome association in a SHIP dependent manner. This suggest that 1L-I0's effect on T N F a ribosome association is not limited to dissociation of polysomes from T N F a mRNA, but that IL-10 may also play a role in regulating ribosomal complex formation on T N F a message. In addition, the fact that some trans]ational inhibition is still observed in SHIP" / _ macrophages suggests that SHIP is not the only mechanism involved in IL-10's regulation of T N F a translation and that other SHIP independent mechanisms exist: Whether IL-10 activation of SHIP causes inhibition of signaling molecules downstream of LPS, which are required for TNFa translation or whether SHIP directly inhibits TNFa translation remains to be investigated. The A R E in the 3'UTR of the T N F a mRNA controls the stability of TNFa message in activated macrophages and allows for the regulation of its translation (Rousseau et al, 2002); (Kontoyiannis et al, 1999). Most studies suggest that activation of p38 by LPS is responsible for this post-transcriptional regulation. Therefore, Kontoyiannis et al suggested IL-10 may regulate T N F a translation by inhibiting LPS induced p38 phosphorylation (Kontoyiannis et al, 2001). SHIP has been shown to be involved in inhibiting p38 phosphorylation (An et al, 2005). However, we and others 80 have not been able to consistently observe IL-10 inhibition of p38 in numerous different macrophage cell lines and primary macrophages (Lee et al, 2002; Grutz, 2005).However, our findings that addition of IL-10 after 45 minutes of LPS stimulation when activated p38 levels are undetectable in macrophages, still results in inhibition of TNFa translation suggests that IL-10's inhibition of TNFa translation is likely independent of p38. Therefore, other targets downstream of SHIP must be responsible for translational regulation of TNFa. Others have also.suggested a role for TIA-1 (Piecyk et al, 2000), M K 2 (Johansen et al, 2006) (Kotlyarov et al, 1999) (Hitti et al, 2006), and TTP (Phillips et al, 2004) (Kontoyiannis et al, 2001) in regulation of T N F a translation. The A R E binding protein TIA-1 regulates T N F a translation in a p38 independent manner (Piecyk et al, 2000) so we tested whether TIA-1 mediates IL-10 induced attenuation of T N F a translation. We found that IL-10 was still able to inhibit T N F a translation TIA-1"7" macrophages However, it remains to be determined i f the highly homologous protein TIAR (Gueydan et al, 1999) may be compensating for the loss of TIA-1 in mediating IL-10 inhibition of T N F a translation. PIP3 upregulation has been associated with regulation of global translation through the mTOR and P70s6 pathway. However, a role for PIP 3 regulated pathways specifically in translation of TNFa has been described (Ramirez et al, 1999); (Gingras et al, 2001). Other molecules downstream of PIP3 have been implicated in posttranscriptional regulation of TNFa. For instance BTK1 contains a PH domain and in B cells, its recruitment to the membrane is downregualted by SHIP (Bolland et al, 1998) ;(Tomlinson et al, 2004). BTK1 activation has been shown to be involved in post-81 transcriptional regulation of T N F a (Horwood et al, 2003). Whether translational regulation of TNFa by SHIP is through regulation of the above described pathways is currently under investigation. Overall, given the speed of SHIP dependent IL-10 activity and that. STAT-3 signaling remains intact in SHIP 7" macrophages, the novelty of the present findings lies in the description of the first mechanism downstream of IL-10 that does not require transcriptional activity of STAT3. We have provided evidence for a rapid, SHIP-mediated STAT3 independent signaling pathway that is utilized by IL-10 to inhibit TNFa translation. We have also shown that this translational regulation is not dependent on TIA-1 and is likely independent of global p38 activity. This early non-transcriptional response is necessary for the immediate actions of IL-10 on LPS-stimulated macrophages and may complement the later actions of STAT3 regulated genes such as SOCS-3 and HO-1. In addition, this early inhibition of TNFa may play an important role in delaying the cascade of events that would normally take place due to production of the early TNFa. Therefore, we have identified a signaling mechanism in macrophages, which may be targeted to inhibit TNFa production. Given the significance of SHIP in our in vivo studies, SHIP will likely serve as a significant target for downregualtion of acute inflammatory response with the potential for treatment of chronic inflammatory diseases. 82 Future experiments: 1) Here, using peptides, we have shown that SHIP interacts with a phosphorylated region of IL-10 receptor. This interaction can be confirmed by immunoprecipitation studies of SHIP and IL-10 receptor. ' 2) Here we have shown that the membrane lipid profile of macrophages in response to IL-10 is consistent with activation of SHIP. This is further supported by the fact that IL-10 requires SHIP in order to implement several of its biological effects. However, another way to confirm that IL-10's effect on membrane PIP3 levels takes place through activation of SHIP is to study membrane PIP3' levels in response to IL-10 in SHIP"7" macrophages. Alternatively, the effect of IL-10 on SHIP can be measured by quantifying SHIP enzyme activity in a phosphatase activity assay in IL-10 treated macrophages. 3) Here we have shown that IL-10 is not able to efficiently inhibit T N F a in SHIP"7" macrophages. However, since the lack of SHIP throughout development of these cells may have altered responsiveness to IL-10, effect of IL-10 in differentiated cells where SHIP has been knocked down by R N A i should be explored. 4) The speed with which IL-10 is able to modulate signaling in macrophages in a SHIP dependent manner, suggests that STAT3 transcription activity is not required for the SHIP dependent activities of IL-10, therefore making SHIP a STAT3 independent pathway. To confirm this view, studies showing IL-10 inhibition of TNFa translation in STAT3"7" macrophages during early timepoints should be undertaken. 83 5) Although we have shown that SHIP activation is partly responsible for IL-10's ability to inhibit TNFa translation in macrophages, we have not defined the mechanism by which this takes place and whether this regulation requires the TNFa 3'UTR. We have attained several constructs from the lab of Dr. Veronique Kruys, where a reporter gene has been linked to 3', 5' or 3' and 5' of TNFa mRNA. Transfection of these constructs into wild type and SHIP 7" macrophages would serve as a powerful tool in giving some insight into the mechanism used by SHIP in regulating T N F a translation. 6) T N F a is a potent activator of macrophages. IL-10 has been shown to inhibit T N F a signaling in a STAT3 independent pathway (Schottelius A J , 1999). Therefore, whether SHIP is responsible for inhibiting early T N F a signaling should be further explored. 7) IL-10's ability to inhibit TNFa translation through activation of SHIP, is likely due to the modulation of PI3K signaling. Therefore studying regulation of other signaling molecules downstream of PI3K by IL-10 would give more insight into the mechanism of IL-10's action. Some candidate signaling molecules are BTK, P70S6, and PKC. 8) In this study, we have mainly focused on the effect of IL-10 on T N F a production. However, activation of SHIP by IL-10 may also be responsible for other effects of IL-10 in macrophages. For instance, IL-10 has been shown to inhibit GM-CSF ~ induced cell proliferation (Miyashita et al, 2005). Similarly, SHIP has been shown to regulate response to GM-CSF (Helgason et al, 1998). Therefore, inhibition of GM-CSF signaling by IL-10 in SHIP 7" macrophages should be 84 further explored. Similarly, IL-10 inhibits IL-6 and several other cytokines as well as macrophage proliferation in LPS activated macrophages. The role of SHIP in these effects should be further explored. 9) One of the limitations of mieroarray analysis is that differentially regulated genes may not necessarily be translated and therefore do not always play a role in inducing the actions of molecules of interest. Here we have described a method to separate actively translated mRNAs into a concentrated fraction. This fraction can be used in mieroarray analysis to identify differentially translated genes in response to the stimuli of interest, in this case, in response to IL-10. 85 Chapter 4: The PI3K pathway is a positive regulator of TNFa production This chapter examines the role of P I 3 K in regulation of T N F a in macrophages and in a mouse model of inflammation. 86 Introduction: Several lines of evidence suggest Src homology 2-containing Inositol 5' phosphatase (SHIP) is a negative regulator of macrophages. SHIP has been shown to inhibit TNFa production in macrophages (An et al, 2005) as well as elicit anti-inflammatory effects of IL-10 in vitro and in vivo (Chapter 3). Presumably SHIP elicits its anti-inflammatory effects through antagonizing the action of PI3K by hydrolyzing the PI3K product phosphatidylinositol-3,4,5-triphosphate (PIP3) (Backers et al, 2003). In line with this idea, pharmacological inhibitors of PI3K have been shown to decrease TNFa production in LPS-activated macrophages (Weinstein et al, 2000; Ojaniemi et al, 2003; An et al, 2005). However, in some studies the opposite has also been observed. In this report, we show that PI3K is a positive regulator of macrophages. We also show that activation of SHIP phosphatase activity via a small molecule antagonizes signaling and leads to inhibition of T N F a in macrophages. PI3K activation by LPS, CD45 ligation, or phosphatide acid has been shown to correlate with increased T N F a production in macrophages (Hayes et al, 1999; Weinstein et al, 2000; Lim et al, 2003). However, Guha et al. reported an increase in T N F a production in monocytes treated with LPS and LY294002 versus LPS alone (Guha et al, 2002). Similarly, PTEN 7 " and SHIP 7" B M D M s produce lower levels of TNFa in response to LPS, despite the fact that increased levels of PIP3 are present (Guha et al, 2002; Cao et al, 2004). These contradictory conclusions may be due to the different types of macrophages used in these experiments and/or the fact that macrophages produce both inflammatory and anti-inflammatory cytokines, all of which are positively regulated by the PI3K pathway. Activation of macrophages by LPS results in activation 87 of signaling pathways downstream of TLR-4 and production of TNFa. Depending on the macrophage type, activated macrophages can also produce a variety of other cytokines such as IL-10, PGE and TGFp that downregulate the production of TNFa (Kitamura et al, 1996; Kontoyiannis et al, 2001; Rouzer et al, 2005). Interestingly, the PI3K pathway is also required for the production and function of these anti-inflammatory molecules (Martin et al, 2003; Dahle et al, 2004; K im et al, 2004). In this way, inhibition of PI3K not only limits TNFa production but also inhibits the negative regulators of TNFa. The net effect on TNFa production over a long period may then depend on whether the type of macrophage or the state the macrophage is skewed towards production of negative or positive effectors of T N F a production. Here we present data showing that the PI3K regulation of T N F a happens in a cell dependent manner, where a negative role is only observed in BMDMs. We also show that these macrophages represent less differentiated cells and are not representatives of resident macrophages. Therefore, the observed positive role of PI3K in T N F a production supports the idea that SHIP inhibits TNFa through inhibition of PI3K signaling. Part of the challenge in studying PI3K signaling is that the majority of conclusions are drawn from collerative studies using the pharmacological inhibitors of PI3K, LY294002 or Wortmannin and that the exact mechanism by which increased PIP 3 translates into an increase in T N F a production is poorly understood. Inhibition of PI3K by LY294002 and/or Wortmannin result in reduction of PIP3 levels and in activated R A W 264.7 macrophages results in inhibition of ERK1/2 (An et al, 2005) and N F K B activity (Ojaniemi et al, 2003). However, the mechanism connecting PIP3 to activation of these molecules and production of TNFa are still not well understood. In addition, 88 whether the observed effects of pharmacological inhibitors of PI3K are due to actual inhibition of PI3K activity and signaling and not due to non-specific effects of these inhibitors remains elusive. SHIP is a 145 Kd protein which is exclusively expressed in hematopoietic cells (Ware et al, 1996). In response to appropriate stimuli, SHIP is recruited to the membrane where it negatively regulates PIP 3 signaling by actively converting phosphatidylinositol-3,4,5-triphosphate (PIP3) into phosphatidylinositol-3,4-diphosphate (PI(3,4)P2) (Krystal et al, 1999; March et al, 2002; Kalesnikoff et al, 2003). As such, SHIP represents another way where the effects of PIP3 on regulation of macrophages can be studied. As such, SHIP 7" macrophages have been used in several studies to examine the role of the PI3K pathway in regulation of macrophage activity. (Kitamura et al, 1996; Fang et al, 2004; Sly et al, 2004; A n et al, 2005; Rauh et al, 2005). However, since SHIP 7" macrophages are differentiated under high levels of PIP3, peritoneal macrophages go through a developmental process that is very different from their wild type counterpart, limiting their use in macrophage studies (Rauh et al, 2005). Our lab has identified a small molecule SHIP activator known as AQX-016A (Yang et al, 2005) presenting us with an alternative way to study SHIP and PI3K signaling. As a small molecule, AQX-016A also has the advantage of allowing us to study the role of SHIP and hence the role of PIP3 in animal models of disease. Because SHIP is only expressed in hematopoietic cells, inhibition of PI3K signaling pathway by activation of SHIP also overcomes many of the potential side effects associated with ubiquitous PI3K inhibition and as such, SHIP activators are a powerful tool to study the role of PI3K signaling in immune related conditions (Krystal et al, 1999). We show that 89 AQX-016A antagonizes PI3K signaling and is able to inhibit T N F a production in macrophages both invitro and in vivo. We also present evidence that the PI3K pathway regulates posttranscriptional processing of TNFa. 90 Results: The effect of PI3K inhibitors on LPS-induced TNFa production depends on the macrophage cell type Several studies demonstrate that SHIP negatively regulates T N F a production in macrophages (Sly et al, 2004; An et al, 2005), likely through reduction of the PI3K-induced PIP3 levels. However, other investigators have concluded that PI3K activation plays a negative role in TNFa production (Park et al, 1997; Guha et al, 2002). These contradictory conclusions may be due to the different types of macrophages used in these experiments and/or the fact that macrophages produce both inflammatory and anti-inflammatory cytokines, all of which are positively regulated by the PI3K pathway. To examine these possibilities, we compared the effect of the PI3K inhibitor LY294002 on LPS-induced T N F a production in J774.1 and RAW264.7 cell lines, primary B M D M and P M . As described in Materials and Methods, B M D M s were derived in the presence of CSF-1 for 7 days while P M were collected and used within 4 hrs. Cells were pre-treated with LY294002 (25 pg/mL) for 45 min prior to LPS stimulation. As shown in figure 12A, LY294002 (25 pg/mL) inhibited LPS-induced T N F a production in all cell types when assessed at 1 hr after LPS stimulation. However, in BMDMs, LY294002 enhanced LPS-induced T N F a production at the 2 hr time point (Figure 12A). One possible explanation for this time-dependent shift from apparent inhibitory to enhancing activity is the production and action of autocrine-acting negative regulators. Macrophages produce anti-inflammatory cytokines, such as IL-10 (Moore et al, 2001) and TGFp i (Bogdan et al, 1993), which act in an autocrine manner to downregulate macrophage activity. Previous studies have shown that activation of the PI3K pathway is required for macrophage production of IL-10 (Martin et al, 2003; Martin et al, 2005) and we 91 confirmed treatment of B M D M s with LY294002 inhibited LPS induction of IL-10 (Figure 12B). The ability of LY294002 to inhibit TNFa production at 1 hr post LPS stimulation in B M D M s but not at later time points, during which the autocrine macrophage regulators come into play, suggests that LY294002 enhancement of T N F a expression at 2 hours may be due to inhibition of IL-10 and other autocrine anti-inflmmatory molelcue. production. As a corollary, the "switch" to apparent stimulatory effect of LY294002 on TNFa production is mainly observed in B M D M s because immature macrophages, such as B M D M s , produce higher levels of IL-10 (Lang et al, 2002) than mature macrophages, such as J774.1 (Figure 12C). We tested the possibility that the apparent enhancement of LPS-induced TNFa expression in B M D M s by LY294002 at 2 hours post stimulation was due to its subsequent inhibitory effects on IL-10 production by using a blocking antibody against mIL-lOR. In this treatment, LY294002 was no longer able to induce an increase in TNFa production (Data not shown). Sly et al. reported the presence of increased levels of TGFp 1 in LPS activated SHIP 7" macrophages, leading us to assess whether TGFpi may act in conjunction with IL-10 in masking the role of PI3K (Sly et al, 2004). Neutralizing antibody against T G F p l increased TNFa protein expression after 2 hours in LPS activated macrophages (Data not shown). Therefore, macrophages were treated with a neutralizing antibody to IL-10R(O'Farrell et al, 1998), and TGFpi (Sly et al, 2004) or isotype control along with LY294002, Wortmannin or carrier (DMSO) for 30 min before adding of LPS for 2 hrs. As expected, blocking the action of autocrine-acting IL-10 and TGFpi increased the level of TNFa production in B M D M and reversed the ability of LY294002 treatment to enhance T N F a levels (Figure 12D). 92 A B anti TGFpi+anti IL-10r Figure 12: Inhibition of PI3K differentially regulates TNFa production in macrophages depending on cell type Macrophages were treated with 25 pM LY294002 or control buffer for 45 minutes before being treated with LPS for 1 or 2 hours. T N F a levels in the culture supernatants was quantified by ELISA and plotted as a percentage of maximum T N F a (at 1 hour and 2 hours maximum T N F a for B M D M was 470 ±27 pg/mL or 1100 ±70 pg/mL, for peritoneal cells 240 ±11 pg/mL and 1500 ±90 pg/mL, for J774 171 ±17 pg/mL and 1900 ±150 pg/mL and for R A W cells 420 ±26 and 3300 ±110 pg/mL. In panel D, B M D M were treated with DMSO or LY294002 (25 uM) in the presence of IL-10R1 and TGFpl neutralizing antibody (1 pg/mL) prior to being stimulated with LPS (lOOng/ml) for 2 hours. Data presented here is the average of 3 experiments. Culture supernatant were collected and T N F a quantified by ELISA. (** indicates p<0.01 and * indicates p<0.05 as compared to LPS only samples, except in figure 12D where LPS and LPS+LY294002 or LPS +Wortmannin within each group are compared). 93 Expression of CDl lb and F4/80 is significantly lower in BMDMs than in peritoneal macrophages B M D M s have been used in many studies as a representative of primary macrophages. Given their differences in the response to PI3K inhibitors as compared to peritoneal macrophages, we wondered i f B M D M s might not represent fully differentiated macrophages. C D l l b and more specifically F4/80 are cell surface markers and their expression is correlated with the extent of macrophage differentiation (Austyn et al, 1981). Therefore, we compared the level of expression of CD1 lb and F4/80 in peritoneal macrophages to B M D M . Cells were suspended in PBS and stained with the appropriate antibodies and the levels of surface protein expression were analyzed by FACS analysis. B M D M s expressed significantly lower amounts of CD1 lb and F4/80 on their cell surface as compared to peritoneal macrophages (Figure 13). Similarly, we also observed high levels of these markers on J774 macrophages (Data not shown). Therefore, B M D M s do not represent fully differentiated macrophages and are different from macrophages encountered in vivo. AOX-016A stimulates 5' phosphatase enzyme activity in intact cells Previous studies have shown that activation of SHIP by IL-10 is required for inhibition of activated macrophages (Chapter 3) and that SHIP is a negative regulator of TNFa production in macrophages (Sly et al, 2003). Our lab has recently identified a small molecule (AQX-016A) which activates SHIP in enzyme activity assays. We determined whether AQX-016A activated SHIP 'S enzyme activity in intact cells by analyzing the inositol phospholipid content of macrophages stimulated with LPS in the presence or absence of AQX-016A. J16 (SHIP + / +) macrophages were labeled with [ 3 2P]-94 A-BMDMs CD11b F4/80 Figure 13: Expression of CDl lb and F4/80 is significantly lower in BMDM than in peritoneal macrophages In panel A , CD1 lb and F4/80 expression were quantified by FACS analysis in B M D M . Similarly, in panel B, C D l l b and F4/80 expression were quantified in freshly isolated peritoneal macrophages. Anti- CD4 was used as isotype control for F4/80. Data are from one representative experiment of at least three performed experiments. 95 orthophosphate, and then treated with AQX-016A or carrier (Cyclodextran) for 30 minutes before being stimulated with LPS for 15 minutes. Cells were lysed, cellular phosphotidylinositols were isolated, deacylated, and the resulting inositol phosphates were separated by H P L C and quantified by liquid scintillation counting. As shown in figure 14A, LPS stimulated a 3-5 fold increase in PIP3 levels, in keeping with the ability of LPS to activate PI3K activity (Guha et al, 2002; Bhattacharyya et al, 2004; Fang et al, 2004; Pengal et al, 2005). The addition of AQX-016A abolished this increase (Figure 14A) and resulted in a corresponding increase in the SHIP hydrolysis product PI(3,4)P2 (Figure 14B). For comparison, we also treated LPS-stimulated cells with the PI3K inhibitor LY294002 and, as expected, PIP3 levels were diminished without a corresponding increase in PI(3,4)P2 levels. Thus, both AQX-016A and LY294002 inhibit the PI3K-mediated increase in intracellular PIP3 levels, but through different mechanisms. Therefore, AQX-016A is cell permeable and is able to reduce PIP3 levels through activation of a 5'phosphatase enzyme. AOX-016A inhibits LPS-induced phosphorylation of PKB via SHIP The stimulation of macrophages with LPS has been shown to trigger the recruitment of the serine/threonine kinase, P K B (also known as Akt) to the plasma membrane and cause its subsequent activation via phosphorylation on Ser473 and Thr308 (Guha et al, 2002; Fang et al, 2004; Patel et al, 2004; Pengal et al, 2006). This P K B phosphorylation has been shown to be dependent on PI3K activity (Stokoe et al, 1997). Activation of PI3K catalyses the addition of a phosphate group onto the 3' position of the inositol ring of PI(4,5)P2 resulting in an increase in plasma membrane PIP3 levels 96 (Vanhaesebroeck et al, 2000). PIP 3 then acts as a docking site for recruiting P K B via its PH domain to the membrane where it is phosphorylated/activated by PDK1 and PDK2 (Alessi et al, 1996; Stephens et al, 1998; Belham et al, 1999; Chan et al, 2001; Pengal et al, 2006). This transiently generated PIP3 can be subsequently degraded by several lipid phosphatases. The ubiquitous lipid phosphatase PTEN (phosphatase and tensin homologue deleted on chromosome ten) can remove the 3' phosphate group, regenerating the original PI3K substrate PI(4,5)P2 (Leevers et al, 1999; Waite et al, 2002). The hemopoietic-restricted SHIP, on the other hand, catalyzes the removal of the 5' phosphate and enhances the formation of PI(3,4)P2 at the plasma membrane (Krystal, 2000; March et al, 2002; Rauh et al, 2002) . As AQX-016A led to reduction of PIP 3 levels in macrophages we used P K B phosphorylation levels to determine i f the previously observed reduction in PIP 3 levels by AQX-016A was sufficient to inhibit PKB phosphorylation and to see i f AQX-016A could antagonize PI3K signaling. We found that AQX-016A inhibits LPS induced P K B phosphorylation in a dose dependent manner. Therefore, AQX-016A can antagonize PI3K signaling (Figure 15). The membrane profile in response to AQX-016A was consistent with induction of a 5' phosphatase. As AQX-016A was initially discovered in a SHIP assay, we tested i f SHIP was the 5'phosphatase responsible for the effects of AQX-016A. Because A Q X -016A inhibited LPS induced P K B phosphorylation, it presented an opportunity to examine whether SHIP is the 5'phosphatase responsible for the effects of AQX-016A. We argued i f SHIP were the phosphatase responsible, AQX-016A's ability to inhibit P K B phosphorylation would be reduced in SHIP 7" macrophages. Specifically, J16 97 A 3000 2500 2000 Q. V "1500 CO a. °- 1000 500 0 ME Control LPS LPS+AQX-016A LPS+LY294002 B 6000 5000 4000 I- 3000 CO, E 2000 1000 0 Control LPS LPS+AQX-016A LPS+LY294002 Figure 14: AQX-016A activates SHIP in intact cells J16 cells were treated for 30 min with 5 pg/mL AQX-016A, 25 uM LY294002 or carrier (Gyclodextran) prior to stimulation with 50 ng/mL of LPS for 15 min. Cellular lipids were extracted and analyzed for PIP 3 (Panel A) and PI(3,4)P2 (Panel B) levels as described in Methods. Figure 14 is average of 3 experiments. (** indicates p<0.01 and * indicates p<0.05 as compared to LPS samples) 98 (SHIP ) and J17 (SHIP"'") macrophages were treated with AQX-016A for 45 minutes before treatment with LPS for 15 minutes. Cells were lysed and PKB phosphorylation levels were visualized by immunoblot analysis. In line with our hypothesis, we found that AQX-016A's ability to inhibit P K B phosphorylation was reduced in SHIP"7" macrophages. Therefore, we concluded that the AQX-016A elicits its effect mainly through activation of SHIP and that activation of SHIP antagonizes PI3K signaling. We also observed that AQX-016A could inhibit PI3K signaling independent of SHIP (Figure 15). AQX-016A inhibits TNFa in J774 and peritoneal macrophages Pervious reports have shown that SHIP acts as a negative regulator of macrophage activation and that over expression of SHIP in R A W 264.7 macrophages, results in inhibition of T N F a production in LPS activated macrophages (An et al, 2005). Thus, we examined the ability of AQX-016A to inhibit TNFa production in macrophages. J774 macrophages and peritoneal macrophages were exposed to AQX-016A or cyclodextran as carrier prior to addition of LPS. AQX-016A significantly inhibited TNFa in both J774 and peritoneal macrophages at both 1 and 5 pg/mL (Figure 16A and 16B). Similarly, LY294002 treatment of these cells also resulted in inhibition of TNFa (Figure 16A and 16B). Therefore, activation of SHIP by AQX-016A acts similar to inhibition of PI3K and results in inhibition of TNFa production. 99 +/+ SHIP SHIP -/-LPS 0 5 2 1 *• mm LPS 0 5 2 1 (jig) AQX-016A P-PKB 308 protein PKB Figure 15: AQX-016A inhibits PKB phosphorylation in a SHIP dependent manner J16 and J17 macrophages were treated with LPS (lOOng/mL) ±AQX-16A or carrier (Cells receiving AQX-016A or carrier were pretreated for 30 minutes) at the indicated concentrations before preparation of cell lysates. Samples were subjected to immunoblot analysis with antibody specific for phospho-PKB (Thr ° 8). The blots were then reprobed with anti-p38 M A P K to confirm equal loading. 100 A-J774 B-PECs A Q X - 0 1 6 A A Q X - 0 1 6 A L Y 2 9 4 0 0 2 (5u/j/mL) (1 u^/mL) (25uJVl) Figure 16: AQX-016A inhibits TNFa in J774 and peritoneal macrophages In panel A, J774 macrophages were treated with LPS (20ng/mL) +AQX-016A or carrier (cyclodextran) for 2 hours and T N F a protein in the supernatant was determined by ELISA. Maximum TNFa production was 2100 pg/mL ±170. In panel B, mouse peritoneal cavity was flushed with PBS and the exudates were plated for 4 hours in 24 well plates in D M E M media. Cells were then treated with LPS (100 ng/mL) ± A Q X -01 6A or carrier for 2 hours and the amount of TNFa protein in the supernatant was determined by ELISA. Maximum TNFa was 2200 pg/mL ±74. A l l cells treated with AQX-016A or carriers were pretreated for 30 minutes. Figure 16 is representative of at least three experiments. (** indicates p<0.01 as compared to LPS samples) 101 AOX-016A requires SHIP to maximally inhibit TNFa production in BMDM From our previous studies, we had concluded that AQX-016A mainly acted through activation of SHIP. Therefore, we examined i f the ability for AQX-016A to inhibit TNFa production is due to its ability to activate SHIP. SHIP + / + and SHIP 7" macrophages were pretreated with AQX-016A or carrier before addition of LPS for 60 minutes and quantification of TNFa in supernatant by ELISA. AQX-016A was more effective at inhibiting LPS induced T N F a production in SHIP + / + than in SHIP 7" macrophages (Figure 17). Therefore, the inhibitory effect of AQX-016A is mainly due to the effect of AQX-016A on SHIP. However, the fact that AQX-016A inhibits T N F a in SHIP"'" macrophages, suggest that AQX-016A may also have T N F a inhibitory effects independent of SHIP. One possible target is SHIP2. Despite the SHIP independent activity of AQX-016A, the fact that AQX-016A's inhibitory effects are reduced in SHIP"' macrophages supports that SHIP activation result in inhibition of T N F a production. AOX-016A inhibits TNFa translation The PI3K pathway regulates T N F a production both at transcriptional and post-transcriptional levels (Ramirez et al, 1999; Strassheim et al, 2005). We had observed that antagonizing the PI3K activity led to inhibition of T N F a protein in LPS activated macrophages. Therefore, we examined whether this inhibition took place at a transcriptional or post-transcriptional level. J774 macrophages were treated with AQX-016A, LY294002 or carrier before addition of LPS for 45 or 90 minutes. R N A was 102 isolated and the levels of T N F a mRNA in each sample were examined by Northern analysis. Figure 17: AQX-016A requires SHIP to maximally inhibit TNFa production in BMDM In panel A , SHIP + / + (dark bars) and SHIP 7" (light bars) B M D M were pretreated with the indicated concentration of AQX-016A or carrier for 30 min prior to stimulation with LPS. Supernatants were collected 1 hour later for determination by ELISA and values were plotted as a percentage of maximum TNFa production for SHIP + / + and SHIP 7" (246 and 381 pg/mL, respectively). Figure 17 represents the average of three experiments. (** indicates p<0.01 when comparing SHIP 7" to SHIP + / + samples) 103 AQX-016A and LY294002 had no effect on T N F a mRNA levels (Figure 18B). In order to confirm that TNFa protein expression was being inhibited with LY294002 or A Q X -016A despite lack of any effects on the mRNA levels, we measured the amount of TNFa in the supernatant of the samples used in the Northern analysis. AQX-016A and LY294002 both inhibited TNFa protein production significantly at both 45 and 90 minutes post LPS stimulation (Figure 18A). Therefore, in J774 macrophages, the PI3K pathway induces T N F a production by positively regulating post-transcriptional processing of TNFa. Previous studies described in chapter 3 have suggested a role for SHIP in translation of TNFa message (Chapter 3), so we examined the effect of AQX-016A on TNFa translation. We had previously optimized a system to look at the translation of TNFa in J16 macrophages. Therefore, J16 macrophages were treated with AQX-016A or carrier for 30 minutes before the addition of LPS for 1 hour. Cells lysates were prepared and separated by sucrose density centrifugation. In these cells, pretreatment of AQX-016A resulted in the disappearance of T N F a mRNA from the higher density fractions, which contain polysome-associated messages, representing the rapidly translated mRNAs (Figure 18C). This inhibition was specific to T N F a as G A P D H distribution remained unaffected by 2.5 or 5,0 pg/mL of AQX-016A. Therefore, SHIP inhibits T N F a production in macrophages by inhibiting translation of TNFa. 104 45Mm C a r r i e r A Q > < - 0 1 6 A AQX-01 6A LY294002 (lug/ml_) (5urj/mL) (25 uW) 2.5 AOX-016A LY294002 B Time 0 45 90 45 90 45 90 T N F a • LPS • LPS+AQX-016A • LPS+LY2940Q2 45 Minutes 90 Minutes TNF Density Low High Fraction» 1 2 3 4 5 6 7 8 9 10 GAPDH Low High 1 2 3 4 5 6 7 8 9 10 • •••• » AQX-016A (5 pfj/mL) • AOX-016A (1 mj/mL) Figure 18: AQX-016A inhibits TNFa translation In Panel A , 5 x l 0 6 J774 macrophages were stimulated with L P S (lOOng/mL) for the indicated times 1 A Q X - 0 1 6 A or LY294002 (25 uM) pretreatment for 45 minutes. Supernatants were collected for T N F a determination by E L I S A (Maximum values for 45 and 90 minutes are 500 ±40 pg/mL and 1500 ±180 pg/ml, respectively). In panel B , R N A from cells in panel A was prepared for Northern blot analysis. In panel C, J16 macrophages were treated with L P S (50ng/ml) for 1-hour ±AQX-016A pretreatment of 30 minutes. Total cytoplasmic R N A was fractionated using sucrose density gradient centrifugation and fractions analyzed for T N F a and G A P D H transcripts. Figure 18 represents two experiments. (** indicates p<0.01 indicates p<0.05 as compared to L P S samples) 105 AQX-016A is protective in mouse model of septicemia Injection of LPS into the peritoneal cavity of mice results in production of detectable levels of TNFa in the serum and is seen as a model of septicemia or septic shock (Cohen et al, 2002; Annane et al, 2005). Because of the ability of AQX-016A to inhibit T N F a through activation of SHIP in macrophages, we tested whether AQX-016A would inhibit plasma TNFa levels in LPS treated mice. Mice were administered A Q X -01 6A or carrier or dexamethasone orally for 30 minutes prior to interperitoneal injection with LPS (20 mg/kg). As predicted for an activator of SHIP and an inhibitor of macrophage activation, AQX-016A significantly inhibited plasma T N F a levels and did so to the same extent as the steroidal drug, dexamethasone (Figure 19). Therefore, A Q X -01 6A is active in vivo and is able to inhibit T N F a suggesting that AQX-016A may be useful for treatment of various inflammatory diseases. 106 600 • • • 1 E 400 • Q . a u_ 200 • • I— 0 1 1 Vehicle Dexamethasone AQX-016A Figure 19: AQX-016A inhibits TNFa production in mouse model of septicemia Four mice for each group were administered 20 mg/kg AQX-016A, 0.4 mg/kg dexamethasone, or carrier orally 30 minutes prior to an interperitoneal injection of 20 mg/kg LPS. Blood was collected 2 hrs later and TNFa protein was determined by ELISA. Figure 19 is representative of at least 3 separate experiments. 107 Discussion: The current literature contains contradictory reports regarding, the role the PI3K pathway plays in regulating T N F a expression. Some investigators have concluded that PI3K activation is required for macrophage production of T N F a since inhibition of PI3K by either LY294002 or Wortmannin results in inhibition of T N F a expression in LPS stimulated macrophages (Weinstein et al, 2000; Ojaniemi et al, 2003; A n et al, 2005). However, Wortmannin has also been reported to increase the amount of T N F a produced by LPS stimulated macrophages in other studies (Park et al, 1997; Hayes et al, 1999; Guha et al, 2002). Analyses of cells isolated from PTEN or SHIP deficient mice have also yielded contradictory conclusions implying either a negative (Cao et al, 2004; Fang et al, 2004) or positive (Sly et al, 2004) role for PI3K activation in production of TNFa. These discrepant reports, lead us to examine in greater depth the effect of pharmacological inhibition of PI3K on T N F a expression in various macrophage cell lines and primary cells. . The PI3K pathway is a critical pathway in the regulation of growth, development, migration, and cell activation (Vanhaesebroeck et al, 2005) (Ward et al, 2003). The importance of this pathway is further highlighted by the presence of several endogenous inhibitory molecules including SHIP and PTEN which reduce the level of PI3K products (Sly et al, 2003). Extensive studies have been undertaken to better understand the role of PI3K and its product PIP3 in cancer, autoimmune, and inflammatory diseases. In neutrophils (Koyasu, 2003), mast cells (Rauh et al, 2003), N K cells (Jiang et al, 2000), B cells (Fruman et al, 1999) and T-cells (Ramirez et al, 1999) PI3K pathway plays a positive role in regulating immune response and inhibition of PI3K 108 in these cells results in reduced cell activation. We found that inhibition of PI3K resulted in either higher or lower levels of T N F a in macrophages depending on the type of macrophage and their ability to produce anti-inflammatory molecules. In mature macrophages such as RAW264.7, J774.1 and fresh P M , PI3K inhibition resulted in a decrease in production of TNFa. However, in immature macrophages such as B M D M , there were no inhibitory effects of PI3K inhibitors on TNFa production. B M D M macrophages are derived through in vitro manipulation of bone marrow stem cells in the presence of growth and differentiation factors. After 7 days in conditioned media, these cells take on certain characteristics including expression of cell surface markers C D l l b and F4/80 which are associated with differentiation into macrophages (Austyn et al, 1981). However, we found that B M D M express significantly less CD1 lb and F4/80 on their surface as compared to peritoneal macrophages, suggesting these cells are not fully differentiated. In addition, B M D M s are significantly more resistant to activation as judged by their lower level of response to LPS stimulation (Lang et al., 2002). Therefore, although B M D M may be a good source of cells for studying macrophages, they do not represent the fully differentiated macrophages, such as peritoneal macrophages, which are more likely to be encountered in vivo. Perhaps, as our understanding of macrophage differentiation evolves, modification of cultures used to derive B M D M may yield production of cells that are more representative of cells that are differentiated in vivo. Consistent with our hypothesis that the presence of T N F a negative regulators, such as IL-10 and TGFp i may be responsible for the increase in T N F a production observed in LY294002-treated BMDMs, we found that limiting the action of autocrine 109 IL-10 and TGFp i could reverse the effect of PI3K inhibitors on T N F a production in BMDMs. For instance, at early time points, when the amount and the autocrine effect of these negative regulators are minimal in B M D M s , inhibition of PI3K resulted in inhibition of TNFa. Further, this inhibition of T N F a by PI3K inhibitors could be extended to later time points when the effects of IL-10 and TGFp i were eliminated by neutralizing antibodies. In essence, activation of PI3K in B M D M by LPS leads to production of T N F a as well as negative regulators of T N F a such as IL-10, TGFpi and PGE. Therefore, IL-10 and TGFpi activity is inhibited by PI3K inhibitors, an increase in T N F a production is .observed, masking the direct effects of PI3K on TNFa production (Lang et al, 2002). For that reason, in peritoneal macrophages and J774 macrophages , where IL-10 production as well as potentially other negative regulators is limited, compared to B M D M (Lang et al, 2002) the direct effect of PI3K can be observed and inhibition of PI3K leads to inhibition T N F a in these cells. Other studies suggesting a negative role for PI3K in TNFa expression include analyses of macrophage responses from PTEN and SHIP deficient mice. LPS stimulation of PTEN 7 " or SHIP 7" P M or B M D M resulted in lower levels of T N F a than observed in their respective wild-type controls (Cao et al, 2004; Fang et al, 2004), leading the authors to conclude that PTEN and SHIP participate positively in TLR-4 signaling and production of TNFa. We also occasionally observe lower levels of TNFa in SHIP 7" compared to SHIP + / + P M and B M D M . However, in light of our data showing that IL-10 and AQX-016A activate SHIP, leading to decreased cellular PIP 3 levels and inhibition of TNFa translation, we propose another interpretation. We believe the enhanced TNFa 110 produced in the SHIP 7" and PTEN 7 " macrophages reflects the skewing of macrophage development towards an M2 phenotype, resulting in higher levels of autocrine T N F a negative regulators (Rauh et al, 2005). In other words, comparison of SHIP 7" or PTEN" vs wild-type cells is complicated by the effect SHIP or PTEN deficiency has on macrophage development. Thus, SHIP or PTEN do not alter LPS responses directly, instead they change the differentiation state of the cell so that they produce less T N F a in response to LPS. Our model also draws support from a study by An et al. (An et al, 2005) who demonstrated that siRNA-mediated knockdown of SHIP expression in a mature macrophage cell line, which circumvents the complication of the role of SHIP in development, leads to enhanced TNFa levels. Therefore, in the absence of any condition where the differentiation level of macrophages is compromised, PI3K acts as a positive regulator of T N F a in macrophages. Therefore, in normal physiological settings, PI3K would be expected to positively regulate TNFa production. SHIP is a natural inhibitor of PI3K signaling which elicits its effects through hydrolyzing PI3K product, PIP 3 (Damen et al, 1998) and as such is expected to inhibit TNFa production in macrophages. In line with this, several studies have shown a negative role for SHIP in TNFa regulation. We have also previously shown that IL-10 elicits part of its anti-inflammatory effect through activation of SHIP. As such, SHIP represents another target for studying PI3K signaling and the role of PI3K in regulation of inflammation. Since SHIP is only present in immune cells, it also represents a superior target for studying the role of PI3K in immune cells and animal models of inflammatory diseases. Therefore, our lab had set out to search for potential SHIP agonists by developing a high throughput, non-radioactive chromogenic assay to 111 identify small molecule modifiers of SHIP phosphatase activity from a marine invertebrate extract library. Out of approximately 2000 extracts tested, 10 had exhibited SHIP activating activity. Using enzyme-guided fractionation, the active component was purified from the Papua New Guinea sponge, Dactylospongia elegans. The active component was identified as Pelorol. A structural analogues of Pelorol, AQX-016A, which had shown to produce a higher activation of SHIP than Pelorol was used in our studies (Yang etal, 2005). Treatment of LPS stimulated macrophages with AQX-016A resulted in further increase in PI(3,4)P2 and inhibited LPS induced PIP 3 levels. These intracellular changes suggest that AQX-016A is able to penetrate the macrophage cell membrane and reach its target within the cell. The increase in both PI(3,4)P2 and PIP 3 is in keeping with LPS activation of the PI3K pathway, resulting from addition of phosphate to the 3' site on PI(4)P and PI(4,5)P2, respectively. The reduction in PIP 3 along with an increase in PI(3,4)P2 is best explained by activation of a 5' phosphatase. In light of AQX-016A's activity on SHIP in in vitro enzyme assays (Data not shown), SHIP is the likely target for AQX-016A. LPS induced activation of PI3K also corresponds with activation of PIP3 dependent signaling molecules such as P K B . PKB contains a PH domain that has high affinity towards PIP3 helps recruit it to the membrane, where it becomes phosphorylated and activated (Vanhaesebroeck et al, 2000; Wick et al, 2000; Wymann et al, 2005). In line with its ability to activate SHIP and reduce PIP3 levels, AQX-016A reduced the amount of phosphorylated PKB in LPS activated macrophages. However, we only obtained a weak inhibition of PKB in SHIP"7" macrophages, suggesting that the reduction 112 in PIP 3 required SHIP. Deducing from this observation, the phosphatase activated by AQX-016A is likely SHIP. However, the observed inhibition of PKB in SHIP 7" macrophages suggests that AQX-016A also targets 5'phosphatases other than SHIP. Another enzyme SHIP2 which is 60% similar to SHIP at the amino acid level but unlike SHIP is expressed ubiquitously in all cell types (Backers et al, 2003; Sly et al, 2003) has also been shown to be activated at high concentrations of AQX-016A in an in vitro enzyme assay ( Data not shown). Therefore, SHIP2 may also be activated by AQX-016A. Further studies where AQX-016A activity in SHIP27" macrophages is observed will be able to establish i f in fact AQX-016A also partially activates SHIP2. Consistent with its ability to inhibit PI3K signaling, activation of SHIP by AQX-016A resulted in inhibition of LPS induced TNFa in J774 and peritoneal macrophages, further supporting that PI3K is a positive regulator of TNFa production. However, the effect of A.QX-016A on T N F a was not entirely dependent on SHIP. In combination with data from the effect of A Q X -016A on P K B phosphorylation, it is likely that the SHIP independent T N F a inhibition is due to activation of SHIP2. Future experiments where the membrane lipid profiles in response to AQX-016A are measured in SHIP 7" will aid in examining any SHIP independent phosphatase activating effects of AQX-016A. Given that reduction of PIP3 levels via SHIP activation or PI3K inhibition, decreases T N F a production, we examined whether this inhibition takes place through a transcriptional or post-transcriptional mechanism. T N F a protein was reduced in LPS activated macrophages in the presence of LY294002 or AQX-016A. However, the amount of mRNA taken from the same samples were left unchanged, suggesting that PIP3 induction is likely responsible for post-transcriptional regulation of TNFa. The PI3K 113 pathway has been implicated in regulation of T N F a translation and studies outlined in chapter 3, further support a role for SHIP in translation of T N F a (Ramirez et al, 1999). We have shown previously that translational regulation of proteins can be studied by taking advantage of the increase in density that take place as mRNAs switch from free form to translatable form associating with increasing number of ribosomes (Li et al, 2006). Consistent with these observations, we found that activation of SHIP by A Q X -016A inhibited TNFa translation in macrophages. The best studied model for regulation of T N F a translation depends on the activity of p38 and the downstream M K 2 (Kotlyarov et al, 1999; Kotlyarov et al, 2002; Stoecklin et al, 2004; Hitti et al, 2006; Johansen et. al, 2006). However, we could not consistently observe inhibition of p38 by AQX-016A, hence suggesting that SHIP regulation of TNFa translation takes place through a p38 independent pathway (Data not shown). This therefore outlines a new mechanism by which T N F a translation is regulated in macrophages. Macrophages are a key player in activation of processes that ultimately lead to onset of inflammation. Although several tools allow the examination of the role of PI3K activity in macrophages and other immune cells, role of PIP3 in regulation of inflammatory mediators and inflammatory response is poorly understood. Part of this is because pharmacological inhibitors of PI3K inhibit PI3K in all cells as PI3K is ubiquitously expressed (Fruman et al, 2002). SHIP 7" mice on the other hand provide a powerful model for studying signaling limited to hematopoietic cells. However, these studies are complicated by the increased numbers of granulocyte-macrophage progenitors that are observed in both the bone marrow and spleen of SHIP 7" mice (Helgason et al, 1998). Therefore, A Q X - 0 1 6 A presented us with a unique opportunity to study the role of 114 SHIP and PI3K signaling in regulation of inflammatory responses in vivo. In humans, septic shock is a condition in which uncontrolled bacterial infection leads to the over-enthusiastic production of T N F a and nitric oxide (NO). Death often ensues due to low organ blood perfusion resulting from severe peripheral vasodilation and hypotension (Annane et al., 2005). The mouse model of this condition involves intraperitoneal (IP) injection of bacterial LPS (also known as endotoxin) and measurement of serum T N F a levels 2 hrs later (Galanos et al., 1993). LPS itself has no direct cytotoxic activity; rather its toxic properties are caused indirectly due to production of potent inflammatory cytokines such as TNFa . We orally administered AQX-016A or the steroidal drug dexamethasone to mice 30 min prior to the LPS challenge. As predicted for an activator of SHIP and an inhibitor of macrophage activation, AQX-016A reduced the level of serum T N F a and did so to the same extent as dexamethasone. The data from this experiment shows that inhibition of PI3K signaling in vivo inhibits T N F a production. In addition, inhibition of T N F a via a SHIP activator represents a novel alternative to PI3K inhibitors for inhibition of PI3K signaling pathways. Especially since expression of SHIP is restricted to hematopoietic/immune cells, SHIP is a superior target for modulation of PI3K activity in immune cell related conditions and thus may have therapeutic applications in human inflammatory diseases. Furthermore, the fact that AQX-016A was orally available makes this compound desirable in studies of other inflammatory diseases. In summary, we have concluded that PI3K is a positive regulator of T N F a in macrophages and that production of autocrine negative regulators, and culture manipulations of B M D M result in responses in which the PI3K pathway appears to 115 negatively regulate TNFa production. We have also confirmed that AQX-016A activates SHIP, through which it is able to inhibit TNFa production both in vitro and in vivo. Therefore, modulation of PI3K signaling pathway through activation of SHIP may be used to inhibit inflammation, making AQX-016A a promising therapeutic agent for treatment of inflammatory diseases. The restricted expression of SHIP to immune/hematopoietic cells limits the action of these compounds to these cells and potentially creates an alternative way to studying signaling mechanisms downstream of PI3K. Overall, we have presented another method to study PI3K signaling and have shown that inhibition of PI3K signaling results in inhibition of TNFa production. 116 Future Experiments: 1) Studies of PI3K signaling have been mainly focused around the use of pharmacological inhibitors, whose effects may not be limited to the PI3K pathway. Macrophage cells lines where the catalytic portion of PI3K has been knocked down would serve as a powerful tool to study the role of PI3K in regulation of cytokine production in macrophages. 2) Our studies have shown that although AQX-016A has a higher affinity for SHIP, it is also able to modulate other signaling molecules. One candidate target is SHIP2. Lipid profiling of SHIP 7" macrophages in response to AQX-016A could establish whether AQX-016A also activates SHIP2 phosphatase activity. Alternatively, the effects of AQX-016A on PKB phophorylation levels in non-hematopoietic wild type and SHIP27" cells could be used to establish the presence of targets other than SHIP or SHIP2 for AQX-016 A . 3) Difference between protein folding in SHIP and SHIP2 can be exploited in order to synthesize derivatives of AQX-016A with higher specificity for SHIP. 4) SHIP activation in B-cells has been shown to inhibit B cell activation (Brauweiler et al, 2000). Therefore, the effect of AQX-016A on B-cell activity should be explored. This should be followed by studying the effect of AQX-016A in treatment of B-cell dependent diseases such as asthma, arthritis, eczema, B-cell lymphoma and amyloidosis. 5) Our studies show that SHIP activation results in inhibition of TNFa translation. Presumably, this happens through inhibition of PI3K signaling pathway. In order to confirm PI3K involvement in translation of TNFa, polysome studies with PI3K 117 inhibitors should be performed. Further, molecules interacting with 3 ' and 5 ' UTR of TNFa in response to P I 3 K inhibition would give insight into the mechanism by which the P I 3 K pathway regulates TNFa translation. 118 Chapter 5: IL-10 induces the expression of CRIM1 Introduction: Lipopolysaccharide (LPS) activation of macrophages results in production of potent inflammatory mediators, such as Tumor necrosis factor alpha (TNFa) and Nitric oxide (NO) (Kollias et al, 1999). LPS binds to Toll like receptor (TLR)-4 on the surface of macrophages and induces several signaling molecules such as Nuclear Factor kappa B ( N F K B ) and M A P kinases. N F K B is found in its inactive form in the cytoplasm bound to I K B . Upon LPS activation, I K B degradation releases NFkB and allows it to translocate to the nucleus where it initiates transcription of genes such as T N F a by binding to specific D N A sequences in their promoter regions (Rahimi et al, 2005(Kontoyiannis et al, 2001). Although production of TNFa is physiologically beneficial in protecting the host from foreign pathogens, disregulated expression of TNFa can lead to onset of inflammatory diseases such as enterocolitis (Kontoyiannis et al, 2001; Pizarro et al, 2003); (Kollias et al, 1999). Interleukin-10 (IL-10) is a potent anti-inflammatory and immunosuppressive cytokine whose functions are mainly elicited through inhibition of macrophage activation. In LPS activated macrophages, IL-10 potently inhibits the production of inflammatory mediators such as T N F a and NO (Moore et al, 2001; Grutz, 2005; Murray, 2006). The importance of this molecule in immune regulation is further emphasized by observation of enterocolitis and hyperresponsiveness to pathogenic challenge in mice deficient in IL-10 (Kuhn et al, 1993) or IL-10 receptor (Spencer et al., 1998). In humans, decreased IL-10 has been associated with psoriatic lesions (Asadullah et al, 1998) and recombinant human IL-10 has been tested in clinical trials in patients with psoriasis, rheumatoid arthritis, inflammatory bowel disease, organ transplantation, 120 and chronic hepatitis C (Asadullah et al, 2003). The mechanism by which IL-10 elicits its effects is poorly understood. However, several mechanisms have been proposed. IL-10 has been shown to inhibit N F K B translocation to the nucleus (Schottelius et al, 1999), inhibit p38 phosphorylation (Kontoyiannis et al, 2001), and modulate the PI3K signaling pathway (Chapter 3). However, IL-10's main mode of action takes place through de novo synthesis of proteins, which function as anti-inflammatory molecules (Lang et al, 2002; Murray, 2005). The IL-10 receptor (IL-1 OR) consists of at least two subunits (Moore et al, 2001; Grutz, 2005; Murray, 2006). The primary ligand binding component, designated IL-10R1, binds IL-10 with high affinity and in the presence of IL-10, associates with the accessory subunit IL-10R2. Ligand-induced heterodimerization of IL-10R1 and IL-10R2 results in activation of receptor-associated Jak tyrosine kinases, Jakl and Tyk2, which then phosphorylate IL-10R1 on two cytoplasmic tyrosine residues (Y427/477 of mouse (m)IL-lORl; Y446/496 of human (h)IL-lORl). Phosphorylation of these tyrosines creates docking sites for the latent cytoplasmic transcription factor, STAT3, which upon binding is phosphorylated by receptor-bound Jak kinases (Darnell, 1997; O'Farrell et al, 1998). Upon phosphorylation, STAT3 translocates into the nucleus and binds specific sequences in the promoters of target genes, regulating their transcription (Darnell, 1997). There is also evidence that STAT3 may function in conjunction with other signaling molecules such as p38 (Lee et al, 2002) to induce the expression of certain genes (Ricchetti et al, 2004). However, this observation has been under some scrutiny as p38 is considered as a pro-inflammatory signaling molecule. Also, there is evidence that IL-10 actually inhibits p38 in macrophages through which it presumably inhibits the 121 translation of T N F a mRNA (Kontoyiannis et al, 2001). Therefore, further studies are required to explain this apparent inconsistency. The STAT3 pathway is the best characterized pathway downstream of the IL-1 OR and is integral to mediating cellular responses of IL-10 (O'Farrell et al, 1998; Riley et al, 1999; Murray, 2005; Murray, 2006). Several studies have indicated that de novo protein synthesis via STAT3 is the dominant mechanism for IL-10 inhibition of LPS-induced TNFa production (Williams et al, 2004) (Murray, 2005). In this context, several IL-10-inducible STAT3 dependent genes such as SOCS-3, HO-1 and BCL-3 have been identified (Lang et al, 2002) (Donnelly et al, 1999). Because the STAT-3 dependent de novo transcription of genes are crucial for the anti-inflammatory effects of IL-10, genes transcribed in response to IL-10 would be expected to predominantly function as anti-inflammatory molecules and as such serve as a pool of anti-inflammatory targets. CRIM1 is a newly described gene, which in mice exists as a minor 4.2 kb and a major 6.2 kb transcript (Figure 19B). CRIM1 contains six highly conserved cysteine rich repeats, an IGF binding protein motif, and an RGD motif (Figure 19A) (Kolle et al, 2000). The cysteine rich repeat region is known to bind the members of the TGF superfamily, Bone morphogenetic proteins (BMP) 4 and 7 (Wilkinson et al, 2003). Based on homology, the Insulin like growth factor (IGF) binding region is expected to bind IGF-I and IGF-II and perhaps by sequestering IGF may regulate proliferation of cells (Wynes et al, 2003). RGD motifs are known to bind integrins and play an important role in cell attachment (Gonzalez-Amaro et al, 2005). Recently CRIM1 was shown to be important in formation of close cell contacts between endothelial cells. In 122 this same report, LPS was shown to induce migration of CRIM1 protein to the membrane (Glienke etal, 2002). In this study, we identified a novel gene, CRIM1, which is induced by IL-10, and studied the regulation of its expression and its role in regulation of T N F a production in LPS activated macrophages. Identification of STAT3 binding site in the promoter region of CRIM1 suggested that CRIM1 may be regulated by STAT3. We also showed that IL-10 activated p38 and this activation was required for full induction of CRIM1. Downregulation of CRIM1 expression through introduction of R N A i against CRIM1 into macrophages had no effect on IL-10's ability to inhibit LPS induced T N F a production. 123 Human Mouse C . elegans JL 8692 m 95 as 82 91 tOO 91 91 90 93 96 tT C 3 | C 4 J C 5 J C 6 3S 31 44 32 48 50 30 41 0 31 0 C 3 | C 4 | C 5 | C 6 B k b 7 . 5 -4 . 4 -2 . 4 -G.2kb 4.0kb Figure 20: CRIM1 structure and size In panel A , the structure of the human, mouse, and C. elegans for C R I M 1 protein are compared. Signal peptide (S), IGFBP- l ike domain (I) and cysteine rich repeats (C) are marked. In panel B , Northern blot analysis C R I M 1 revealing 2 transcripts of 6.2 and 4.0 kb in mouse embryonic stem cells. The figures and legend were taken from Kol le et al, 2000. 124 ! shRNA CHV—(wok Figure 21: Method for mediating RNA interference in macrophages In panel A , to produce recombinant lentiviral vectors, the packaging cell line H E K 293T was co-transfected by the vector plasmid (pHR-U6-shRNA), helper plasmid ( p C M V A R8.2), and envelope plasmid (VSV-g) . Together, these allow for the production of viral particles. Conditioned medium is then harvested and concentrated by ultracentrifugation. In panel B , transduction of target cells was done at a multiplicity of infection of 60:1. Virions attach at the cell membrane and release the viral core. The d s D N A is then transported into the nucleus where it integrates randomly into the target cell genome. Following integration, the U6 and C M V promoters transcribe their respective genes, and this results in s h R N A production and m R N A for the G F P reporter. The s h R N A and m R N A s are exported to the cytoplasm. G F P is then translated, and the s h R N A is processed by Dicer and then incorporated into the RNA-induced silencing complex (RISC). RISC then targets and degrades cognate m R N A s . This figure and legend are taken from (Lee et al, 2004) with slight modifications. 125 Results: IL-10 induces the expression of CRIM1 Induction of newly expressed genes such as HO-1, SOCS-3 and BCL-3 in response to IL-10 is a mechanism by which IL-10 alters the function of macrophages (Kuwata et al, 2003; Qasimi et al, 2005). As a result, we were interested in identifying other genes, which are up regulated by IL-10 in macrophages. Using mieroarray analysis to identify IL-10 regulated genes, we identified CRIM1 as an upregulated gene in J774 macrophages. Although mieroarray analysis has proven to be an indispensable tool for identification of differentially expressed genes, false positives and false negatives are readily observed and confirmation of identified genes by other methods are required. J774 macrophages were treated with IL-10 for the indicated times and R N A was extracted and used in a Northern analysis. IL-10 induced the expression of CRIM1 major and minor transcripts within 30 minutes of IL-10 stimulation. CRIM1 transcript expression decreased gradually approaching levels similar to those in unstimulated cells after 4 hours (Figure 21). Therefore, IL-10 induces rapid and transient expression of CRIM1 mRNA in macrophages. CRIM1 5' UTR region contains a STAT3 binding site Induction of new genes downstream of IL-10 is known to take place through activation and translocation of STAT3. Once phosphorylated, STAT3 translocates to the nucleus and binds to STAT3 binding regions in the 5' regions of the genes it regulates (Lang et al, 2002; Williams et al, 2004). Therefore, we speculated the 5' promoter region of CRIM1 would contain STAT3 binding regions. We analyzed the 5' promoter 126 IL-10 0 0 . 5 1 2 4 30 60 120 240 Time (Min) Time (hrs) CRIM1 G A P D H F i g u r e 2 2 : IL-10 i nduces the exp ress ion o f CRIM1 J774 macrophages were treated with L P S (10 ng/mL) ±IL-10 (100 ng/mL) for the indicated times. Total R N A was isolated for Northern blot analysis of C R I M 1 . The blot was stripped and re-probed for G A P D H to check for equal loading. Figure 22 is representative of 3 experiments. 127 sequence of CRIM1 using a software at http://tfbind.hgc.ip/. Mouse CRIM1 promoter region contains a STAT3 binding site approximately 200 bp upstream of the initiation sequence (Figure 2IB). In addition, to make sure STAT3 signaling was intact in J774 macrophages, J774 macrophages were treated with IL-10 and cell lysates were used for analysis of phosphorylated STAT3 levels. IL-10 rapidly induced STAT3 phosphorylation in J774 macrophages (O'Farrell et al, 1998; O'Farrell et al, 2000) rapidly reaching a maximum level. Phosphorylation levels remained detectable for the 30 minutes the experiment was followed (Figure 22A). IL-10 activation of p38 regulates CRIM1 expression STAT3 activation by IL-10 is the dominant mechanism by which IL-10 induces the expression of new genes in macrophages. However, expression of IL-10 induced genes such as HO-1 has been shown to also require the activation of p38 (Lee et al, 2002). However, although there are reports of IL-10 inhibiting p38, IL-10 activation of p38 has not been extensively described (Grutz, 2005). Therefore, we stimulated J774 macrophages with IL-10 for the indicated times and analyzed the levels of p38 activation. IL-10 stimulated p38 phosphorylation reaching a maximum after 5 minutes and completely disappearing by 10 minutes (Figure. 24A). Given IL-10's ability to induce p38 phosphorylation, we looked at the role of p38 in induction of CRIM1. J774 macrophages were treated with the p38 inhibitor SB203580 before addition of IL-10 and CRIM1 mRNA levels were analyzed by Northern analysis. Inhibition of p38 resulted in delaying the expression of CRIM1 in IL-10 treated samples (Figure. 24B). Therefore, IL-10 elicits part of its effects through activation of p38. 128 A IL-10 T ime (min) 0 3 6 15 30 Hi m pSTAT3 p38 B >dna/mouse_build_34_nib/chrl7.nib:76012317-76192287 gaggaagagagggggaggaggaggaggcgtggagggaggaagggccggggcagccccggagggaggcgagg gggaggggagggggccggccggcccgagggtgggggggcagccaatgagcagcgcgcggcgcggggagggc ggg g g g g g g a a t g a g g t a g g a t g g g g g a g g g c g c a g c c g g a g c g g c g g a g g c t c c a g c c a t a a a c a a g c g c c c g g a g g a g c g g c g c g g g a g a g a g c c g a g c c g g g c a c a a g g a a c g g a c g c c a c g g a c c t t c t g c t g a g c c a c c g c g c c c a c t c g g c g g c t c g g g a g g c g g g g a c c g g c c c g g a g g c t g c g c t g c c g t c g t c t t t c c c c g g c a a t c a g g a g c a g c g c g g a g g a c c a g a a g g a g c c a c c a g c c c t t c t t c q g a g c q g t q c g c a g c c a c c g c c g c c g c c a g a a g t t t g g g t t g a a c c g g a g c t g c c g a g a g g a a a c t t t t t t t c c t c t t t t c c c c c t c c c g c c c g g g a g g a g a a g g a g g a g g a g [ g g g a a g c c a c | c c g c c a c c g c t g c c g c t g g c g c c a a c g c t c g t g g g c t c c g g g t c g g c g c g g c c c g c a g g g g c g g c g g g g g c c t c g c c c c g c g a g g g g a g g a g c g c c c c g g g g g c c c c t a g t g g g g c a c g a g g a c c g c g g g c t g c g g g t g c g g c g g c g g c g c g t g t g c c c c g c g c a g g g g a g g g c g c c c g c c c c g c t c c c g g c c c g a c t g c g a g g a g g a g g c g g c g g c g c a g g a g g a t g Figure 23: CRIM1 5' UTR region contains a STAT3 binding site In panel A , J774 macrophages were treated with IL-10 (20ng/mL) for the indicated times. Whole cell lysates were analyzed by western blot analysis using the indicated antibodies. In panel B , a contig covering C R I M 1 on chromosome 17 was used to find 750 bp upstream of C R I M 1 start site ( A T G ) . T F B I N D software was used to elucidate binding sites for S T A T 3 (underlined). Figure 23 is representative of 3 experiments. 129 6 L P S + + + + + + IL-10 + + + + + Time (min) 0 5 10 20 5 10 20 5 10 p-p38 ««•» mm mm — ,—. mm mm IL-10 0 0.5 1 2 IL-10+SB203580 0 0.5 1 2 CRIM1 G A P D H p38 _ 4.7 Kb _ 1.9 Kb Figure 24: IL-10 activation of p38 regulates CRIM1 expression In panel A , J774 macrophages were treated with IL-10 (lOOng/mL) for the indicated times. Whole cell lysates were analyzed by western blot analysis using the indicated antibodies. In panel B , J774 macrophages were stimulated with IL-10 (100 ng/mL) +SB203580 (10 nM) for the indicated times. Northern blots with R N A derived from these macrophages were probed with C R I M 1 and G A P D H specific probes. 130 IL-10 does not inhibit the MAPK p38 in macrophages Because our observation that IL-10 induces phosphorylation of p38 is in contradiction with studies from Kontoyiannis et al. who reported that IL-10 could inhibit p38 protein phosphorylation in thioglycolate elicited peritoneal macrophages (TEPM), we decided to further look at the effect of IL-10 on p38 (Denys et al., 2002; Grutz, 2005). Therefore, we investigated whether IL-10 could still inhibit p38 phosphorylation and activation in macrophages. As a result, we assessed IL-10 regulation of p38 in several macrophage types. We stimulated B M D M , peritoneal macrophages (PM) and thioglycolate elicited P M (TEPM) with 100 ng/mL of LPS or LPS and IL-10 (lOOng/mL) for 15 minutes. Cells were lysed and samples were subjected to immunoblot analysis (Figure 25). Because we have occasionally observed a reduction in p38 phosphorylation in B M D M , we also looked at phosphorylation of p38 upstream and downstream kinases, MKK3/6 and M K 2 respectively. IL-10 did not inhibit p38, MKK3/6 or M K 2 in B M D M (Figure 25C). In addition, IL-10 did not inhibit p38 phosphorylation in LPS activated TEPM, P M or J774 macrophages (Figure 25B, 25C). Further, we looked at kinase activity of M K 2 in LPS or LPS and IL-10 treated J774 macrophages. J774 macrophages were treated with LPS, IL-10 or LPS and IL-10 for 15 or 30 minutes and lysates were subjected to immunoprecipitation using a M K 2 antibody. Immunoprecipitates were used in a kinase assay using HSP25 as substrate. IL-10 failed to inhibit M K 2 kinase activity in J774 macrophages (Figure 25 D). 131 B 7J _ in CO CO E - J c a n E 3 co co CL 0. mm mwt p-p38 STAT3 «t*w W W p S T A T 3 - P M K K 3 / 6 I P-P38 mm P M K 2 w id = A K T S T A T 3 mmmm»mm P - P 3 8 15 min D M K 2 Immunoprecipitate Lysate .E .E .E - o ^ ^ £ E 'E~ -o E 1 I I » • e e £ •=. m 3 £ £ o S2. I I 1 1 c ^ L O O o o i O i - ]2 ^ O £ C £ 2 - t - t - " — " *~" £ ^ J= Q_ Q . + + 'i \ M DU + H S P 2 5 Figure 25: IL-10 does not inhibit p38 phosphorylation in macrophages In panel A , B M D M were treated with L P S (10 or 100 ng/mL) ±IL-10 (100 ng/mL) for 15 minutes. Cells were lysed and subjected to immunoblot analysis using the indicated antibodies. In panel B and C, P M or T E P M (elicited for 3 days) were treated with L P S (100 ng/mL) ±IL-10 (100 ng/mL) for 15 minutes and analyzed for levels of phosphorylated p38 in the samples by immunoblot analysis. In panel D , J774 macrophages were stimulated with L P S (100 ng/mL) ±IL-10 (100 ng/mL) or IL-10 alone for 15 or 30 minutes. Cells were lysed and subjected to immunoprecipitation using a M K 2 antibody. Immunoprecipitates were used in a kinase assay using HSP25 as substrate in the presence of radioactive [ 3 2 P] -a -ATP. 132 CR1M1 is not required for IL-10's anti-inflammatory effects Given that IL-10 induced genes are critical in regulation of LPS activated macrophages, we speculated CRIM1 would be required for regulation of macrophage activation. One approach to studying the importance of a gene in certain pathways is to use cells deficient or silenced in the gene of interest. Because deficiency in CRIM1 is not compatible with development of mouse embryos to term, and CRIM1 knockout mice are not available, we chose another way to inhibit the CRIM1 mRNA. We stably silenced the expression of CRIM1 J774 macrophages using a lentiviral-based vector. This vector (CRIM1 shRNA lentiviral vector) expresses a short-hairpin R N A (shRNA) under the control of U6-promoter, against CRIM1 mRNA sequence. Transduced cells expressed GFP and shRNA against CRIM1 (U6-CRIM1 shRNA-GFP J774) or GFP only(U6-GFP-J774). Transduction of J774 cells with CRIM1 -shRNA-GFP lentiviral vector resulted in complete inhibition of CRIM1 expression in response to LPS and IL-10. In contrast, transduction of cells with U6-GFP vector did not inhibit the expression levels of CRIM1 in J774 macrophages (Figure 26A). We then tested these cells to see whether CRIM1 is required for the inhibitory effects of IL-10 on T N F a and NO production in LPS activated macrophages. U6-CRIM1 shRNA-GFP J774 cells were stimulated with LPS ±IL-10 and the inhibition of T N F a and NO were compared to U6-GFP-J774 cells. IL-10 inhibited both TNFa and NO production to the same extent in both cells (Figure 26B). Therefore, IL-10 induces CRIM1 to regulate functions which are unrelated to IL-10's ability to inhibit T N F a or NO production, 133 U6-CRIM1-GFP U6-GFP 30 60 120 30 60 120 Minute 0 25 5 1 25 5 1 IL-10 (ng/mL) Figure 26: IL-10 inhibition of NO or TNFa is not CRIM1 dependent In panel A , U 6 - C R I M 1 - G F P and U 6 - G F P were treated with L P S (lOng/mL) and IL-10 (lOOng/mL) for the indicated periods of time. Expression of C R I M 1 m R N A in these cells was analyzed by Northern analysis. In Panel B , J774 cells with C R I M 1 s h R N A lentiviral vector or lentiviral vector alone were stimulated with L P S (50 ng/mL) ± IL-10 (as concentrations indicated) for 6 hours for T N F a quantification and N O for 24 hours. Culture supernatants were then collected for T N F a protein determination by E L I S A or nitrite levels with Greiss reagent. Maximum T N F a levels are 1100 ±78 pg/mL and 1000 ±71 pg/mL for U 6 - G F P J774 and U 6 - C R I M 1 - G F P respectively. 134 Discussion: In this study, we analyzed the mechanism involved in IL-10 regulation of macrophages. IL-10 elicits its effects in macrophages mainly through induction of new genes (Williams et al, 2004). Using microarray analysis, we analyzed the genes expressed in macrophages in response to IL-10. We found that IL-10 causes rapid and transient expression of C R I M 1 in macrophages. C R I M 1 has been shown localize to the developing kidney and testis, the lens of the eye, the placenta as well as specific regions within the central nervous system (Wilkinson et al, 2003) where it regulates the development of regions in the central nervous system, during the development of mice (Kolle et al, 2000). Interrupted expression of C R I M 1 results in perinatal lethality animals with defects in a variety of organ systems, including the limbs, eyes, and kidneys (Pennisi et al, 2007). CRIM1 expression has been shown to be upregulated by L P S in endothelial cells (Glienke et al, 2002) and C R I M 1 has also been shown to interact with members of the T G F p family (Wilkinson et al, 2003). However, since C R I M 1 has not been detected in immune cells, the role C R I M 1 may play in this system is not understood. Because IL-10 functions as an anti-inflammatory cytokine, we studied whether C R I M 1 may have an anti-inflammatory function. L P S is a potent activator of macrophages and as such results in production of T N F a and N O in macrophages. Therefore, we used L P S activated macrophages to measure whether IL-10 required C R I M 1 in order to inhibit L P S activation of macrophages and production of T N F a . Using s i R N A against C R I M 1 , we were able to completely knockdown the expression of C R I M 1 in J774 macrophages and found that in L P S activated macrophages, IL-10 was not able to induce the expression of detectable 135 levels of C R I M 1 m R N A . Our observation that T N F a and N O production were unaffected by C R I M 1 , suggested that C R I M 1 has no direct role in regulation of these mediators. However, the caveat to these experiments was that the J774 macrophages transduced with the G F P alone lentivirus constitutively expressed C R I M 1 . Thus constitutive expression of C R I M 1 may potentially alter J774 signaling pathways, and potentially mask the role of the C R I M 1 . In addition, lack of antibodies to C R I M 1 hindered our ability to detect the levels of C R I M 1 protein in J774 cells containing the C R I M 1 R N A i . Therefore, although C R I M 1 m R N A expression was significantly reduced, sufficient amounts of C R I M 1 protein could still have been expressed in both cells. Although IL-10 is mainly recognized for its anti-inflammatory effects, there is evidence that in addition to its immuno-inhibitory properties, it is also a potent recruitment signal for macrophage migration in vivo. This was shown where a significant extravasation of macrophages could be observed into the pancreatic tissue of transgenic mice expressing IL-10 in their islets of Langerhans (Wogensen et al, 1993). In addition, during an immune response, IL-10 released by keratinocytes causes an increase in the expression of molecules such as selectins involved in cell-cell interaction on the dermal micro vasculature (Meena Vora, 1996). Interestingly selectin is also upregulated in IL-10 treated macrophages (Lang et al., 2002). However, the mechanism involved in the process of IL-10 mediated macrophage extravasation is still poorly understood, but likely involves upregulation of a combination of adherent molecules on the surface of both endothelial and immune cells. Recently C R l M l was shown to migrate to the cell membrane of endothelial cells and participate in formation of close cell contacts between 136 endothelial cells (Glienke et al, 2002). Presumably, this happens through binding of R G D motifs in C R I M 1 to integrins expressed on endothelial cells (Gonzalez-Amaro et al, 2005). It is possible that IL-10 induced expression of C R I M 1 on macrophages would allow them to bind to endothelial cells at the site of inflammation. In this way IL-10 may function to regulate the trafficking of immune cells into tissue. Therefore, further studies where C R I M 1 is constitutively expressed in macrophages w i l l be pivotal in better understanding the role C R I M 1 may play during an inflammatory response. Interestingly, we found that expression of C R I M 1 was partly dependent on activity of p38 in IL-10 stimulated macrophages. This was of special importance since p38 has been mainly associated with macrophage activation and production of inflammatory cytokines including T N F a . Since IL-10 is known as an anti-inflammatory cytokine, evidence for its ability to inhibit p38 phosphorylation has been presented (Kontoyiannis et al, 2001), therefore questioning the possibility of IL-10 to induce p38 phosphorylation. To address this conflict between our observation and that reported by Konotoyannis et al, we looked at several macrophage lines for lL-10 ' s apparent ability to inhibit p38 (Kontoyiannis et al, 2001). However, in all cell lines used which included B M D M s , P M s and T E P M s , we did not observe consistent inhibition of p38 by IL-10. Therefore, the conflict in our observation and those of Konotoyannis are not l ikely cell dependent. We also found that IL-10 actually caused rapid activation of p38 in macrophages raising the possibility that IL-10 may inhibit the L P S pool of p38 while activating an IL-10 dependent pool, the accumulation of which in our studies may seem as though IL-10 has no effects on L P S activated p38. This possibility o f different pools was further supported by the observation that IL-10 and L P S activated p38 with different 137 kinetics, where IL-10 induced p38 phosphorylation very rapidly and diminished within 5 minutes, while L P S induced p38 phosphorylation was delayed and lasted for at least 30 minutes. L P S regulates T N F a through activation of downstream kinase, M K 2 . In our hand, although L P S increased M K 2 kinase activity in macrophages, IL-10 had no effect on its activation. In B M D M , IL-10 also had no effect on signaling molecules upstream o f p38. Therefore leading us to believe that at least in our hands, IL-10 does not inhibit p38 phosphorylation and is in fact an activator of p38 phosphorylation. However, it is still possible that IL-10 regulates other L P S induced p38 pathways. Perhaps studies in the future can define the pathway used by IL-10 to activate p38 in macrophages and by inhibiting these pathways, a better understanding of the effects of IL-10 on L P S activated p3 8 can be deduced. p38 plays a significant role in production of inflammatory cytokines and as such is in clinic for treatment of inflammatory diseases (Taylor et al, 2004). The fact that IL-10 activates p38 in macrophages may then suggest that either p3 8 has anti-inflammatory effects or that IL-10 may use p38 in non inhibitory pathways. Activation of p38 has been shown to be required for induction of the S T A T dependent anti-inflammatory molecule SOCS-3 (Canfield et al, 2005). Similarly IL-10 induction of S T A T 3 dependent HO-1 required p38 activity (Lee et al, 2002). p38 activation results in activation of several transcriptional factors (Kotlyarov et al, 2002), which may synergize with other signaling pathways to increase transcription of specific genes. Inhibition of p38 only abolished early induction of C R I M 1 by IL-10. Therefore, it is unlikely that p38 activation by itself would be sufficient for induction of C R I M 1 expression. Since we also found a S T A T 3 binding site in the promoter region of C R I M 1 , it is more l ikely that C R I M 1 expression 138 takes place through coordination of both S T A T 3 and p38. Therefore, at least in induction of C R I M 1 , p38 seems to play a synergistic role with S T A T 3 . A s an accessory signaling pathway, p38 may play a role in inflammatory and anti-inflammatory signaling pathways, the function of which would be defined by the main signaling pathway involved. It would be useful to map out the IL-10 induced genes, which are aided by the presence of activated p38 and distinguish i f there are any functional unities among these genes, for instance, i f they are required for some of the proinflammatory effects of IL-10 in macrophages. Here we have described IL-10 induction of C R I M 1 m R N A whose expression has not been previously found in any immune cells. C R I M 1 does not seem to be required for regulation of macrophage activation; hence, understanding the role of C R I M 1 w i l l bring more insight into other functions IL-10 may play in immune cells. We also show that IL-10 activates p38 and this activation is required for induction of C R I M 1 . Future studies where C R I M 1 is over-expressed or deleted w i l l have to be used to further confirm the role of C R I M 1 in T N F a and N O production and analyze any potential role C R I M 1 may have in IL-10 mediated regulation o f growth and development of immune cells or trafficking of immune cells into the tissue. 139 Future Experiments 1) In order to confirm that GRIM1 studies in the context of IL-10 can be extended to studies in mice, expression of C R I M 1 in response to IL-10 should be confirmed in primary macrophages. 2) Here we have shown the expression of C R I M 1 m R N A in response to IL-10. It would be important to confirm that this expression also correlates with protein expression. There are currently no antibodies against C R I M 1 . Therefore, an antibody against C R I M 1 should be raised. 3) Dr. Wilkinson's lab has provided us with C R I M 1 containing constructs which can be used to overexpress C R I M 1 in macrophages. This can be used to study the role of C R I M 1 in inflammatory cytokine production or macrophages migration in vivo. 4) Recently a specific region of C R I M 1 was shown to be important in formation of capillaries. A small peptide containing this region was able to inhibit capillary formation in vitro (Glienke et al., 2002). Hence, inhibition of C R I M 1 activity via a similar peptide or R N A i against C R I M 1 for treatment of cancers, age-related macular degeneration and diabetic retinopathy should be explored. 5) We have described activation of p38 by IL-10 in macrophages. However, whether this p38 activation has inflammatory or anti-inflammatory effects has not yet been described. In addition, the upstream signaling molecules and the region in IL-10 receptor involved in activation of p38 have not been described. Using constructs with different deletion in the cytoplasmic regions of IL-10 receptor, several functional units of IL-10 receptor have been identified. Ce l l lines 140 expressing IL-10 receptor with different deletions in the cytoplasmic region can be used to identify the regions involved in activation of p38. Cells lacking this domain can then be used to study the role p38 activation plays in LPS activated macrophages. 6) In this study, we also confirmed upregualtion of C A M P , and S T A T 3 - B P in response to IL-10. Steps should be taken to better understand the role of these genes in macrophage regulation. 141 Chapter 6: Conclusion chapter The PI3K pathway has many functions in regulation of cell activity. Here, we show that the PI3K pathway is an important regulator of macrophage activation and the inhibition of its activity by IL-10 is used as a method to limit production of pro-inflammatory cytokines in macrophages. In this study, we found that IL-10 rapidly activates SHIP, an antagonist of PI3K activity, in macrophages. We have shown by several methods that SHIP 'S activation results in reduction of PIP3 levels and is important in regulation of T N F a in L P S activated macrophages. We found that IL-10 fails to inhibit T N F a production in SHIP 7 " macrophages. A Q X - 0 1 6 A a specific activator of SHIP discovered in our lab, potently inhibits T N F a in L P S activated macrophages and wortmannin and LY294002, as inhibitors of PI3K activity both inhibit T N F a production. This data supports the notion that activation of SHIP by IL-10 serves to limit the production of T N F a in macrophages and that SHIP is a potential target for modulation of inflammation. SHIP has been shown to have a role in regulation of signaling through other receptors and whether IL-10's ability to activate SHIP alters signaling of receptors other than T L R - 4 as well should be investigated. SHIP acts at a post-transcriptional level to inhibit translation of T N F a . The translation of T N F a has been described to be dependent on the activation of p38 pathway and some have argued that IL-10's ability to inhibit T N F a translation is l ikely through modulation of p38 activity. However, we show that IL-10 requires SHIP to inhibit T N F a translation and the effect of IL-10 on p38 i f any, could not account for the translational inhibition of T N F a . It would be interesting to further characterize the signaling mechanisms downstream of SHIP to identify the proteins responsible for this translation 143 modulation. Post-transcriptional regulation of T N F a is dependent on sequences found within the 3' and 5 ' U T R of the m R N A arid L P S stimulation of T N F a translation has been established to be dependent on the 3 ' U T R . Whether SHIP regulation of T N F a translation is 3 ' U T R , 5 ' U T R or 3'and 5 ' U T R dependant remains to be studied. In this study, we have also provided evidence for the long debated existence of S T A T 3 independent pathways downstream of IL-10 receptor. SHIP activation, required for inhibition of T N F a production, takes place very rapidly and is very unlikely to be dependent on the production of de novo proteins through S T A T 3 activation. We have also shown that IL-10 activates p38 very rapidly which seems to play a role in induction of IL-10 regulated genes. Interestingly, L P S stimulation of macrophages also results in activation of p38 but with a very different kinetic than IL-10 activated p38. It would be interesting to determine whether the difference in kinetics is due to different mechanisms involved in activation, whether different pools of p38 iholecules are involved and whether these different pools have different cellular functions. Our studies support SHIP as an anti-inflammatory target, and establish A Q X -016A as a specific SHIP activator. Because SHIP 'S expression is limited to only hematopoietic cells, it serves as an important target in diseases involving hematopoietic cells. Therefore, A Q X - 0 1 6 A is very promising as a therapeutic given the confined expression of its target, and the role of its target in inflammation and proliferative diseases. Future in vivo studies w i l l have to determine a dose where the anti-proliferative effects of A Q X - 0 1 6 A do not jeopardize its long term use in treatment of inflammatory diseases. Perhaps one approach could be to use this molecule in inflammatory diseases in isolated environments where systemic access is limited. In this way anti-proliferative 144 effects of A Q X - 0 1 6 A on the cells in the bone marrow can be avoided, and given the expression profile of SHIP, only hematopoietic cells in the chosen environment would be affected. In this study, we have also described several IL-10 regulated genes. O f special interest is C R I M 1 as we are the first group to describe its expression in any immune cells. C R I M 1 expression is induced by both L P S and IL-10 suggesting a potential role in regulation of cell activation. However, knockdown studies of C R I M 1 have not conclusively established a role for C R I M 1 in regulation of N O or T N F a production. Given C R I M 1 has been implicated in cell-cell contact studies and growth and development; it would also be interesting to study whether it may have a role in the process of macrophage extravasation, differentiation or development. In summary, we have shown for the first time that IL-10 activates SHIP in macrophages and SHIP is able to inhibit the production of T N F a through regulation of its translation.. We have also shown that activation of SHIP alone by a novel compound is sufficient in inhibiting T N F a production in vitro and in vivo and may serve as a therapeutic in future. We have also described C R I M 1 as an IL-10 regulated gene which may aid us in understanding the function of IL-10 beyond its inhibitory effects in activated macrophages. 145 Tables and supplementary data Table 1: Effect of PI3K in regulation of immune cell responses Reference Cell type Receptor Cytokines Up Cytokines Down Ti me (hr s) Signaling Time (hr) Method Extra (Weinstein et al., 2000) R A W 264.7 TLR-4 (10-1000 ng/mL) -IFN 'P protein - T N F a protein -NO 6 6 24 Lyn association LY294002 Rapa inhibits N O , T N F a . IFN ups N O (Ojanienii et a!., 2003) R A W 264.7 TLR-4 LPS (1 n g /ml) -11-1 mRNA - T N F a mRNA -IL-1 protein 2 No effect on N F K B translocation Increase reporter activity 1 LY294002 wortmannin - M Y D 8 8 and P85 co-IP (Salh et al., 1998) R A W •264.7 TLR-4 LPS (1 u.g /mL) -NO 24 INOS phosphorylation 24 LY294002 Rapamycin W T no effect - L Y and Rapa inhibitP70S6 (An et al., 2005) R A W 264.7 TLR-4 LPS (lOOng/mL) T N F a Protein 8 Increase p E R K , I K B degrade., Decrease N F K B activity, pP38 .5 .5 6 SHIP1 express R N A i Ly294002 Unlike Ly , Wort had no effect on T N F a (Lim et al., 2003) R A W 264.7 Phosphatidic Acid TNFa, IL-6, 11-l , N O , P G E 18 P70S6 activation Ly294002 Rapa (50nM) inhibits T N F a (ran et al.. 2003) TLR-4 (LPS) T N F a 24 LY294002 (bowling et al.. 1996) Tolerized R A W 264.7 TLR-4 ( LPS lOng/mL) -NO - T N F a 24 wortmannin -Tolerated more NO and (Fang et al.. 2004) R A W 264.7 TLR-4 (LPS 500ng//mL) Inhibits N F K B reporter PI 10 Over expressed Ivoo i. i N J. \JL (Diaz-Guerra et al.. 1999) R A W 264.7 TLR-4 (LPS 200ng/mL) -NO 18 hou rs Inhibits INOS mRNA Inhibit I K B degradation 6 LY294002 wortmannin - Wortmannin is better • : : (5>Iy et al., 2004) B M D M TLR-4 (LPS lOOng/ml) T N F a , IL-1, 11-6 protein, NO 24 Increase p - E R K , p S T A T l 1 SHIP-/- No effect on N F K B (Fang et al.. 2004) B M D M TLR-4 (LPS 500ng//mL) | TNFa. IL-6 protein Inhibits p-P38,p-PERK — _ .25 SHIP-/-wortmanmn serum starved ON,*V.low IL-6 made Reference Cell type Receptor Cytokines Up Cytokines Down Ti me (hr s) Signaling Time (hr) Method Extra (Park et til.. 1997) TG Peritoneal TLR-4 ( LPS 10 ng/mL) TNFa protein NO 1-5 Inhibits INOS protein 24 wortmannin T N F a increase s if Won. Added 1 hour after LPS (2,5 hr) (Cao et al.. 2004) TG Peritoneal TLR-4 (LPS 500ng/mL) TNFa protein 16 Inhibit P ERK,pP38 .25 PTEN-/-T G Peritoneal Cluster FCyR T N F a , IL-6, IL-10 16 Induce p E R K .1 P T E N - / -(Hayes et al.. 1999). P B M C TLR-4 LPS(10ng/mL) TNFa protein 18 - wortmannin -Ly had no effect, p70s6 not active P B M C Anti CD45 (10 ug/mL) T N F a protein 18 - wortmannin Ly294002 -Rapa inhibited - N F K B Indep (Martin et al.. 2003) P B M C •TLR-2 ( G.LPS) IL-10 mRNA, protein IL-12 mRNA, protein 20 Inhibits N F K B translocation independent of I K B degradation 1 LY294002 (Guha et al.. 2002) P B M C TLR-4 LPS(10ng/mL) - TNFa protein 5 L Y 294002 wortmannin (Guha et al.. 2002) THP-1 TLR-4 LPS (10 ng /mL) - TNFa protein - T N F a mRNA - TNFa reporter 5 5 5 Inhibit Raf-l,p-P38 , N F K B binding , EGR, AP 1 , N F K B reporter .5 • 1 5 L Y 294002 wortmannin D N A K T L i C l inhibits P65 transcript activity (Arbibe et al.. 2000) THP-1 TLR-2 (HSKA) Activate N F K B transactivation No effect on binding, translocation, degradation 1 A K T D N wortmannin R A C 1 , P85 and PI 10 form a complex on cyto of TLR-2 (Fan et al.. 2003) THP-1 TLR-4 TNFa 24 LY294002 (Monick let al.. 2002) Alveolar Macs TLR-4 LPS (lOOng/mL) Cox-2 mRNA Stability 24 Inhibits pMKK3/6, pP38, M A P K A P 6 Ly294002 -P38re-up 2 hr - L Y no effect Cox-l , r PLA2 Reference Cell type Receptor Cytokines Up Cytokines Down Ti me (hr s) Signaling Time (hr) Method Extra (Kim et al., 2004) BV2 Microglia 1 TLR-4 200 ng/mL NO T N F a , IL-6, M M P 9 48 24 24 -Increases p-P38,p-JNK -inhibit N F K B binding 1 2 Ly294002 - T G F inhibits PIP 3 (Dahle et al.. 2004) Kupffer cells TLR-4 (1 Mg/mL) -IL-6 protein -11-10 protein 6 18 JAK2 LY294002 AG490 -no effect on T N F a (Re et al.. 2001) P B M C DC TLR-4 (LPS lOng/mL) -IP-10,I1-12,I1-10 mRNA 4 LY294002 -LPS makes IFN, No TGF1 P B M C DC-TLR-2 (PGN 10 ng/mL) IL-10 4 LY294002 - P G N makes TGF-No IL-12 IFN Beta (Fukao et al.. 2002) Spleen DC TLR-4 ( LPS lug), TLR-2 (PGN)TLR9 . (CPG) IL-12 24 -inhibits P38 Kinase activity .25 P85 -/-wortmannin Wortmannin increased il-12. further in LPS • and P G N -/-(Strassheim et a l . . 2005) B M Neutroph ils TLR-2 T N F a , IL-6, IL-10, IL-1 4 Increase pP38 p E R K pP65 .5 •5 1 SHIP-/- increased A L I in SHIP -(Strassheim etal., 2004) B M Neutroph il TLR-2 (PGN) - T N F a -MIP2 1.5 1 Increase pP38,pERK P-P65 .5 1 LY294002 wortmannin (Yum et al., 2001) m-lung neutrophi Is TLR-4 T N F a , IL1 mRN A/Protein M P O Increase N F K B binding 1 LY294002 wortmannin PI3Ky -/-. edema, cyt low in PI3Ky -/- lung (Fukao et al.. 2002) Peritoneal . cavity TLR (CLP) T N F a 1 P85 -/- -recon with WT mast cell T N F a to norm (Kalesnikof'f et al.. 2003) Peritoneal TLR-4 NO ? ' Increased arginase SHIP-/- Unstim make IL-6,11-10 o References: Aderem, A . and Ulevitch, R. J. (2000). Toll- l ike receptors in the induction of the innate immune response. Nature 406(6797): 782-7. Aeder, S. E . , Martin, P. M . , Soh, J. W . and Hussaini,T. M . (2004). PKC-eta mediates glioblastoma cell proliferation through the A k t and m T O R signaling pathways. Oncogene 23(56): 9062-9. Aksoy, E . , Goldman, M . and Willems, F. (2004). Protein kinase C epsilon: a new target to control inflammation and immune-mediated disorders. Int JBiochem Cell Biol 36(2): 183-8. Alessi , D . R., Andjelkovic, M . , Caudwell, FJ., Cron, P., Morrice, N . , Cohen, P. and Hemmings, B . A . (1996). Mechanism of activation of protein kinase B by insulin and IGF-1. Embo J 15(23): 6541-51. A n , H . , X u , H . , Zhang, M . , Zhou, J., Feng, T., Qian, C , Q i , R. and Cao, X . (2005). Src homology 2 domain-containing inositol-5-phosphatase 1 (SHIP1) negatively regulates TLR4-mediated L P S response primarily through a phosphatase activity-and PI-3K-independent mechanism. Blood 105(12): 4685-92.' Annane, D. , Bellissant, E . and Cavaillon, J. M . (2005). Septic shock. Lancet 365(9453): 63-78. Appendino, G . , Maxia , L . , Bascope, M . , Houghton, P. J., Sanchez-Duffhues, G . , Munoz, E . and Sterner, O. (2006). A meroterpenoid NF-kappaB inhibitor and drimane sesquiterpenoids from Asafetida. JNat Prod 69(7): 1101-4. Arbibe, L . , Mi ra , J. P., Teusch, N . , Kl ine , L . , Guha, M . , Mackman, N . , Godowski, P. J., Ulevitch, R. J. and Knaus, U . G . (2000). Toll- l ike receptor 2-mediated NF-kappa B activation requires a Racl-dependent pathway. Nat Immunol 1(6): 533-40. Asadullah, K . , Sterry, W. , Stephanek, K . , Jasulaitis, D. , Leupold, M . , Audring, H . , Vo lk , . H . D . and Docke, W . D . (1998). IL-10 is a key cytokine in psoriasis. Proof of principle by IL-10 therapy: a new therapeutic approach. J Clin Invest 101(4): 783-94. Asadullah, K . , Sterry, W . and Volk , H . D . (2003). Interleukin-10 therapy-review of a new approach. Pharmacol Rev 55(2): 241-69. Austyn, J. M . and Gordon, S. (1981). F4/80, a monoclonal antibody directed specifically against the mouse macrophage. Eur J Immunol 11(10): 805-15. 151 Baatz, H . , Puchta, J., Reszka, R. and Pleyer, U . (2001). Macrophage depletion prevents leukocyte adhesion and disease induction in experimental melanin-protein induced uveitis. Exp Eye Res 73(1): 101-9. Babu, K . S., Davies, D . E . and Holgate, S. T. (2004). Role of tumor necrosis factor alpha in asthma. Immunol Allergy Clin North Am 24(4): 583-97, v -v i . Backers, K . , Blero, D . , Paternotte, N . , Zhang, J. and Erneux, C. (2003). The termination of PI3K signalling by SHIP1 and SHIP2 inositol 5-phosphatases. Adv Enzyme Regul 43: 15-28. Baran, C. P., Tridandapani, S., Helgason, C. D . , Humphries, R. K . , Krystal, G . and Marsh, C. B . (2003). The inositol 5'-phosphatase SHIP-1 and the Src kinase L y n negatively regulate macrophage colony-stimulating factor-induced A k t activity. J Biol Chem 278(40): 38628-36. Barcellini, W. , Rizzardi, G . P., Marriott, J. B . , Fain, C , Shattock, R. J., Meroni, P. L . , Pol i , G . and Dalgleish, A . G . (1996). Interleukin-10-induced HIV-1 expression is mediated by induction of both membrane-bound tumour necrosis factor (TNF)-alpha and T N F receptor type 1 in a promonocytic cell line. Aids 10(8): 835-42. Barton, G . M . and Medzhitov, R. (2002). Toll-l ike receptors and their ligands. Curr Top Microbiol Immunol 270: 81-92. Belham, C , W u , S. and Avruch, J. (1999). Intracellular signalling: PDK1—a kinase at the hub of things. Curr Biol 9(3): R93-6. Berg, D . J., Kuhn, R., Rajewsky, K . , Muller, W. , Menon, S., Davidson, N . , Grunig, G . . and Rennick, D . (1995). Interleukin-10 is a central regulator of the response to L P S in murine models of endotoxic shock and the Shwartzman reaction but not endotoxin tolerance. J Clin Invest 96(5): 2339-47. Beutler, B . and Poltorak, A . (2000). Positional cloning of Lps, and the general role of toll-like receptors in the innate immune response. Eur Cytokine Netw 11(2): 143-52. Bhattacharyya, S., Sen, P., Wallet, M . , Long, B . , Baldwin, A . S., Jr. and Tisch, R. (2004). Immunoregulation of dendritic cells by IL-10 is mediated through suppression of the PI3K/Akt pathway and of IkappaB kinase activity. Blood 104(4): 1100-9. Bjorkbacka, H . , Fitzgerald, K . A . , Huet, F. , L i , X . , Gregory, J. A . , Lee, M . A . , Ordija, C. M . , Dowley, N . E . , Golenbock, D . T. and Freeman, M . W . (2004). The induction of macrophage gene expression by L P S predominantly utilizes Myd88-independent signaling cascades. Physiol Genomics 19(3): 319-30. 152 Bolland, S., Pearse, R. N . , Kurosaki, T. and Ravetch, J. V . (1998). SHIP modulates immune receptor responses by regulating membrane association of Btk. Immunity 8(4): 509-16. Bowling, W . M . , Flye, M . W. , Qiu, Y . Y . and Callery, M . P. (1996). Inhibition of phosphatidylinositol-3'-kinase prevents induction of endotoxin tolerance in vitro. J Surg Res 63(1): 287-92. Bozinovski, S., Jones, J., Beavitt, S. J., Cook, A . D . , Hamilton, J. A . and Anderson, G . P. (2004). Innate immune responses to L P S in mouse lung are suppressed and reversed by neutralization of G M - C S F via repression of T L R - 4 . Am J Physiol Lung Cell Mol Physiol 286(4): L877-85. Brenner, S., Prosch, S., Schenke-Layland, K . , Riese, U . , Gausmann, U . and Platzer, C. (2003). cAMP-induced Interleukin-10 promoter activation depends on CCAAT/enhancer-binding protein expression and monocytic differentiation. J Biol Chem 278(8): 5597-604. Brock, C , Schaefer, M . , Reusch, H . P., Czupalla, C , Michalke, M . , Spicher, K . , Schultz, G . and Nurnberg, B . (2003). Roles o f G beta gamma in membrane recruitment and activation of p i 10 gamma/plOl phosphoinositide 3-kinase gamma. J Cell Biol 160(1): 89-99. Canfield, S., Lee, Y . , Schroder, A . and Rothman, P. (2005). Cutting edge: IL-4 induces suppressor of cytokine signaling-3 expression in B cells by a mechanism dependent on activation o f p38 M A P K . J Immunol 174(5): 2494-8. Cao, S., L i u , J., Chesi, M . , Bergsagel, P. L . , Ho, I. C , Donnelly, R. P. and M a , X . (2002). Differential regulation of IL-12 and IL-10 gene expression in macrophages by the basic leucine zipper transcription factor c -Maf fibrosarcoma. J Immunol 169(10): 5715-25. Cao, X . , Wei , G . , Fang, H . , Guo, J., Weinstein, M . , Marsh, C. B . , Ostrowski, M . C. and Tridandapani, S. (2004). The inositol 3-phosphatase P T E N negatively regulates Fc gamma receptor signaling, but supports Toll- l ike receptor 4 signaling in murine peritoneal-macrophages. J Immunol 172(8): 4851-7. Carl, V . S., Gautam, J. K . , Comeau, L . D . and Smith, M . F., Jr. (2004). Role of endogenous IL-10 in LPS-induced S T A T 3 activation and IL-1 receptor antagonist gene expression. JLeukoc Biol 76(3): 735-42. Carter, A . B . , Knudtson, K . L . , Monick, M . M . and Hunninghake, G . W . (1999). The p38 mitogen-activated protein kinase is required for NF-kappaB-dependent gene expression. The role of TATA-b ind ing protein (TBP). J Biol Chem 274(43): 30858-63. 153 Chan, T. O. and Tsichlis, P. N . (2001), P D K 2 : a complex tail in one Akt . Sci STKE 2001(66): P E L Chensue, S. W. , Terebuh, P. D . , Remick, D . G . , Scales, W . E . and Kunkel , S. L . (1991). In vivo biologic and immunohistochemical analysis of interleukin-1 alpha, beta and tumor necrosis factor during experimental endotoxemia. Kinetics, Kupffer cell expression, and glucocorticoid effects. Am J Pathol 138(2): 395-402. Chu, Z . Y . and Rui , Y . C. (1999). Effects of pentoxifylline and protein kinase C inhibitor on phorbol ester-induced intercellular adhesion molecule-1 expression in brain microvascular endothelial cells. Zhongguo Yao LiXue Bao 20(8): 741-4. Cohen, J. (2002). The immunopathogenesis of sepsis. Nature 420(6917): 885-91. Collins, T., Read, M . A . , Neish, A . S., Whitley, M . Z . , Thanos, D . and Maniatis, T. (1995). Transcriptional regulation of endothelial cell adhesion molecules: N F -kappa B and cytokine-inducible enhancers. Faseb J9(10): 899-909. Comalada, M . , Xaus, J., Valledor, A . F., Lopez-Lopez, C , Pennington, D . J. and Celada, A . (2003). P K C epsilon is involved in J N K activation that mediates LPS-induced TNF-alpha, which induces apoptosis in macrophages. Am J Physiol Cell Physiol 285(5): C1235-45. Costelloe, E . O., Stacey, K . J., Antalis, T. M . and Hume, D . A . (1999). Regulation of the plasminogen activator inhibitor-2 (PAI-2) gene in murine macrophages. Demonstration of a novel pattern of responsiveness to bacterial endotoxin. J LeukocBiol 66(1): 172-82. Crawley, J. B . , Will iams, L . M . , Mander, T., Brennan, F. M . and Foxwell , B . M . (1996). Interleukin-10 stimulation of phosphatidylinositol 3-kinase and p70 S6 kinase is. required for the proliferative but not the antiinflammatory effects of the cytokine. J Biol Chem 271(27): 16357-62. .. Creagh, E . M . and O'Nei l l , L . A . (2006). T L R s , N L R s and R L R s : a trinity of pathogen sensors that co-operate in innate immunity. Trends Immunol 27(8): 352-7. Crepaldi, L . , Gasperini, S., Lapinet, J. A . , Calzetti, F., Pinardi, C , L i u , Y . , Zurawski, S., de Waal Malefyt, R., Moore, K . W . and Cassatella, M . A . (2001). Up-regulation of IL-1 OR 1 expression is required to render human neutrophils fully responsive to IL-10. J Immunol 167(4): 2312-22. Cuschieri, J., Umanskiy, K . and Solomkin, J. (2004). PKC-zeta is essential for endotoxin-induced macrophage activation. J Surg Res 121(1): 76-83. Dahle, M . K . , Overland, G . , Myhre, A . E . , Stuestol, J. F., Hartung, T., Krohn, C. D . , Mathiesen, O., Wang, J. E . and Aasen, A . O. (2004). The phosphatidylinositol 3-154 kinase/protein kinase B signaling pathway is activated by lipoteichoic acid and plays a role in Kupffer cell production of interleukin-6 (IL-6) and IL-10. Infect Immun 72(10): 5704-11. Damen, J. E . , L i u , L„ Ware, M . D . , Ermolaeva, M . , Majerus, P. W . and Krystal, G . (1998). Multiple forms of the SH2-containing inositol phosphatase, SHIP, are generated by C-terminal truncation. Blood 92(4): 1199-205. Darnell, J. E. , Jr. (1997). S T A T s and gene regulation. Science 277(5332): 1630-5. Davidson, N . J., Fort, M . M . , Muller, W. , Leach, M . W . and Rennick, D . M . (2000). Chronic colitis in IL-10-/- mice: insufficient counter regulation of a T h l response. Int Rev Immunol 19(1): 91-121. de Waal Malefyt, R., Abrams, J., Bennett, B- , Figdor, C. G . and de Vries, J. E . (1991). Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exp Med 174(5): 1209-20. Dean, J. L . , Sully, G . , Clark, A . R. and Saklatvala, J. (2004). The involvement of A U - r i c h element-binding proteins in p38 mitogen-activated protein kinase pathway-mediated m R N A stabilisation. Cell Signal 16(10): 1113-21.. Denys, A . , Udalova, I. A . , Smith, C , Will iams, L . M . , Ciesielski, C . J., Campbell, J., Andrews, C , Kwaitkowski, D . and Foxwell , B . M . (2002). Evidence for a dual mechanism for IL-10 suppression of TNF-alpha production that does not involve inhibition of p38 mitogen-activated protein kinase or NF-kappa B in primary human macrophages. J Immunol 168(10): 4837-45. Diaz-Guerra, M . J., Castrillo, A . , Martin-Sanz, P. and Bosca, L . (1999). Negative regulation by phosphatidylinositol 3-kinase of inducible nitric oxide synthase expression in macrophages. J Immunol 162(10): 6184-90. Dinarello, C. A . (1997). Proinflammatory and anti-inflammatory cytokines as mediators in the pathogenesis of septic shock. Chest 112(6 Suppl): 321S-329S. Ding, A . H . , Nathan, C. F. and Stuehr, D . J. (1988). Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidence for independent production. J Immunol 141(7): 2407-12. Domin, J., Pages, F., Vol in ia , S., Rittenhouse, S. E . , Zvelebil, M . J., Stein, R. C. and Waterfield, M . D . (1997). Cloning of a human phosphoinositide 3-kinase with a C2 domain that displays reduced sensitivity to the inhibitor wortmannin. Biochem J326(Ptl): 139-47. 155 Donnelly, R. P., Dickensheets, H . and Finbloom, D . S. (1999). The interleukin-10 signal transduction pathway and regulation of gene expression in mononuclear phagocytes. J Interferon Cytokine Res 19(6): 563-73. Dower, S. K . and Qwarnstrom, E . E . (2003). Signalling networks, inflammation and innate immunity. Biochem Soc Trans 31(Pt 6): 1462-71. Duffield, J. S. (2003). The inflammatory macrophage: a story of Jekyll and Hyde. Clin Sci (Lond) 104(1): 27-38. Dumitru, C. D . , Ceci , J. D . , Tsatsanis, C , Kontoyiannis, D . , Stamatakis, K . , L i n , J. H . , Patriotis, C , Jenkins, N . A . , Copeland, N . G . , Koll ias , G., et al. (2000). T N F -alpha induction by L P S is regulated posttranscriptionally via a T p l 2 / E R K -dependent pathway. Cell 103(7): 1071-83. Dummer, R., K o h l , O., Gillessen, J., Kagi , M . and Burg, G . (1993). Peripheral blood mononuclear cells i n patients with nonleukemic cutaneous T-cell lymphoma. Reduced proliferation and preferential secretion of a T helper-2-like cytokine pattern on stimulation. Arch Dermatol 129(4): 433-6. Echlin, D . R., Tae, H . J., Mi t in , N . and Taparowsky, E. J. (2000). B - A T F functions as a negative regulator of AP-1 mediated transcription and blocks cellular transformation by Ras and Fos. Oncogene 19(14): 1752-63. Edamitsu, S., Matsukawa, A . , Ohkawara, S., Takagi, K . , Nariuchi, H . and Yoshinaga, M . (1995). Role of T N F alpha, IL-1 , and I L - l r a in the mediation of leukocyte infiltration and increased vascular permeability in rabbits with LPS-induced pleurisy. Clin Immunol Immunopatholl5(\): 68-74. Engelberts, I., von Asmuth, E . J., van der Linden, C. J. and Buurman, W . A . (1991). The interrelation between T N F , IL-6, and P A F secretion induced by L P S in an in vivo and in vitro murine model. Lymphokine Cytokine Res 10(1-2): 127-31. Enk, A . H . and Katz, S. I. (1992). Identification and induction of keratinocyte-derived IL-10. J Immunol 149(1): 92-5. Fadok, V . A . , Bratton, D . L . , Konowal , A . , Freed, P. W. , Westcott, J. Y . and Henson, P. M . (1998). Macrophages that have ingested apoptptic cells in vitro inhibit proinflammatory cytokine production through autocrine/paracrine mechanisms involving TGF-beta, P G E 2 , and P A F . J Clin Invest 101(4): 890-8. Fan, H . , Teti, G. , Ashton, S., Guyton, K . , Tempel, G . E . , Halushka, P. V . and Cook, J. A . (2003). Involvement of G(i) proteins and Src tyrosine kinase in T N F alpha production induced by lipopolysaccharide, group B Streptococci and Staphylococcus aureus. Cytokine 22(5): 126-33. 156 Fan, H . , Zingarelli, B . , Peck, O. M . , Teti, G . , Tempel, G . E . , Halushka, P. V . , Spicher, K . , Boulay, G . , Bimbaumer, L . and Cook, J. A . (2005). Lipopolysaccharide- and gram-positive bacteria-induced cellular inflammatory responses: role of heterotrimeric Galpha(i) proteins. Am J Physiol Cell Physiol 289(2): C293-301. Fang, H . , Pengal, R. A . , Cao, X . , Ganesan, L . P., Wewers, M . D. , Marsh, C. B . and Tridandapani, S. (2004). Lipopolysaccharide-induced macrophage inflammatory response is regulated by SHIP. J Immunol 173(1): 360-6. Ferrandiz, M . L . , G i l , B . , Sanz, M . J., Ubeda, A . , Erazo, S., Gonzalez, E . , Negrete, R., Pacheco, S., Paya, M . and Alcaraz, M . J. (1996). Effect o f bakuchiol on leukocyte functions and some inflammatory responses in mice. J Pharm Pharmacol 48(9): 975-80. Fiorentino, D . F. , Bond, M . W . and Mosmann, T. R. (1989). Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by T h l clones. J Exp Med 170(6): 2081-95. Firrell , J. C . and Lipowsky, H . H . (1989). Leukocyte margination and deformation in mesenteric venules of rat. Am J Physiol 256(6 Pt 2): H I 667-74. Fleming, S. B . , Haig, D . M . , Nettleton, P., Reid, H . W. , McCaughan, C. A . , Wise, L . M . . and Mercer, A . (2000). Sequence and functional analysis of a homolog of interleukin-10 encoded by the parapoxvirus orf virus. Virus Genes 21(1-2): 85-95. Foey, A . , Green, P., Foxwell , B . , Feldmann, M . and Brennan, F. (2002). Cytokine-stimulated T cells induce macrophage IL-10 production dependent on phosphatidylinositol 3-kinase and p70S6K: implications for rheumatoid arthritis. Arthritis Res 4(1): 64-70. Fruman, D . A . and Cantley, L . C. (2002). Phosphoinositide 3-kinase in immunological systems. Semin Immunol 14(1): 7-18. Fukao, T., Tanabe, M . , Terauchi, Y . , Ota, T., Matsuda, S., Asano, T., Kadowaki, T., Takeuchi, T. and Koyasu, S. (2002). PI3K-mediated negative feedback regulation of IL-12 production in DCs . Nat Immunol 3(9): 875-81. Fukao, T., Yamada, T., Tanabe, M . , Terauchi, Y „ Ota, T., Takayama, T., Asano, T., Takeuchi, T., Kadowaki, T., Hata J i , J., et al. (2002). Selective loss of gastrointestinal mast cells and impaired immunity in PI3K-deficient mice. Nat Immunol 3(3): 295-304. Galanos, C. and Freudenberg, M . A . (1993). Mechanisms of endotoxin shock and endotoxin hypersensitivity. Immunobiology 187(3-5): 346-56. 157 Gasche, C. , Grundtner, P., Zwirn, P., Reinisch, W. , Shaw, S. H . , Zdanov, A . , Sarma, U . , Wil l iams, L . M . , Foxwell , B . M . and Gangl, A . (2003). Novel variants of the IL-10 receptor 1 affect inhibition of monocyte TNF-alpha production. J Immunol 170(11): 5578-82. Gerard, C. , Bruyns, C. , Marchant, A . , Abramowicz, D . , Vandenabeele, P., Delvaux, A . , Fiers, W. , Goldman, M . and Velu , T. (1993). Interleukin 10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. J Exp Med 177(2): 547-50. Giallourakis, C. , Kashiwada, M . , Pan, P. Y . , Danial, N . , Jiang, H . , Cambier, J., Coggeshall, K . M . and Rothrnan, P. (2000). Positive regulation of interleukin-4-mediated proliferation by the SH2-containing inositol-5'-phosphatase. J Biol Chem 275(38): 29275-82. Gingras, A . C. , Raught, B . and Sonenberg, N . (2001). Regulation of translation initiation by F R A P / m T O R . Genes Dev 15(7): 807-26. Glembot, T. M . , Britt, L . D. and H i l l , M . A . (1996). Endotoxin interacts with tumor necrosis factor-alpha to induce vasodilation of isolated rat skeletal muscle arterioles. Shock 5(4): 251-7. . N Glienke, J., Sturz, A . , Menrad, A . and Thierauch, K . H . (2002). C R I M 1 is involved in endothelial cell capillary formation in vitro and is expressed in blood vessels in vivo. Mech Dev 119(2): 165-75. Goclik, E . , Konig, G . M . , Wright, A . D . and Kaminsky, R. (2000). Pelorol from the tropical marine sponge Dactylospongia elegans. J Nat Prod 63(8): 1150-2. Gonzalez-Amaro, R., Mittelbrunn, M . and Sanchez-Madrid, F. (2005). Therapeutic anti-integrin (alpha4 and alphaL) monoclonal antibodies: two-edged swords? \ Immunology 116(3): 289-96. Grutz, G . (2005). New insights into the molecular mechanism of interleukin-10-mediated immunosuppression. JLeukoc Biol 77(1): 3-15. Gruys, E . , Toussaint, M . J., Niewold, T. A . and Koopmans, S. J. (2005). Acute phase reaction and acute phase proteins. JZhejiang Univ Sci B 6(11): 1045-56. Gueydan, C. , Droogmans, L . , Chalon, P., Huez, G . , Caput, D . and Kruys, V . (1999). Identification of T I A R as a protein binding to the translational regulatory A U - r i c h element of tumor necrosis factor alpha m R N A . J Biol Chem 274(4): 2322-6. Gueydan, C , Houzet, L . , Marchant, A . , Sels, A . , Huez, G . and Kruys, V . (1996). Engagement of tumor necrosis factor m R N A by an endotoxin-inducible cytoplasmic protein. Mol Med 2(4): 479-88. 158 Guha, M . and Mackman, N . (2001). L P S induction of gene expression in human monocytes. Cell Signal 13(2): 85-94. Guha, M . and Mackman, N . (2002). The phosphatidylinositol 3-kinase-Akt pathway limits lipopolysaccharide activation of signaling pathways and expression of inflammatory mediators in human monocytic cells. J Biol Chem 277(35): 32124-32. Harmsen, A . G . and Havell , E . A . (1990). Roles of tumor necrosis factor and macrophages in lipopolysaccharide-induced accumulation of neutrophils in cutaneous air pouches. Infect Immun 58(2): 297-302. Hayes, A . L . , Smith, C , Foxwell , B . M . and Brennan, F. M . (1999). CD45-induced tumor necrosis factor alpha production in monocytes is phosphatidylinositol 3-kinase-dependent and nuclear factor-kappaB-independent. J Biol Chem 274(47): 33455-61. Helgason, C. D . , Damen, J. E . , Rosten, P., Grewal, R., Sorensen, P., Chappel, S. M . , Borowski, A . , Jirik, F. , Krystal, G . and Humphries, R. K . (1998). Targeted disruption of SHIP leads to hemopoietic perturbations, lung pathology, and a shortened life span. Genes Dev 12(11): 1610-20. Helgason, C. D . , Kalberer, C. P., Damen, J. E . , Chappel, S. M . , Pineault, N . , Krystal, G . and Humphries, R. K . (2000). A dual role for Src homology 2 domain-containing inositol-5-phosphatase (SHIP) in immunity: aberrant development and enhanced function of b lymphocytes in ship -/- mice. J Exp Med 191(5): 781-94. Hirschfeld, M . , Weis, J. J., Toshchakov, V . , Salkowski, C. A . , Cody, M . J., Ward, D. C , Qureshi, N . , Michalek, S. M . and Vogel , S. N . (2001). Signaling by toll-like receptor 2 and 4 agonists results in differential gene expression in murine macrophages. Infect Immun 69(3): 1477-82. Hitti , E . , Iakovleva, T., Brook, M . , Deppenmeier, S., Gruber, A . D . , Radzioch, D . , Clark, A . R., Blackshear, P. J., Kotlyarov, A . and Gaestel, M . (2006). Mitogen-activated protein kinase-activated protein kinase 2 regulates tumor necrosis factor m R N A stability and translation mainly by altering tristetraprolin expression, stability, and binding to adenine/uridine-rich element. Mol Cell Biol 26(6): 2399-407. Ho, A . S., W'eij S. H . , M u i , A . L . , Miyajima, A . and Moore, K . W . (1995). Functional regions of the mouse interleukin-10 receptor cytoplasmic domain. Mol Cell Biol 15(9): 5043-53. Horng, T., Barton, G . M . , Flavell , R. A . and Medzhitov, R. (2002). The adaptor molecule T I R A P provides signalling specificity for Toll- l ike receptors. Nature 420(6913): 329-33. 159 Horwood, N . J., Mahon, T., McDaid , J. P., Campbell, J., Mano, PL, Brennan, F. M . , Webster, D . and Foxwell , B . M . (2003). Bruton's tyrosine kinase is required for lipopolysaccharide-induced tumor necrosis factor alpha production. J Exp Med 197(12): 1603-11. Hoshino, K . , Takeuchi, O., Kawai , T., Sanjo, H . , Ogawa, T., Takeda, Y . , Takeda, K . and Aki ra , S. (1999). Cutting edge: Toll- l ike receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for T L R 4 as the Lps gene product. J Immunol 162(7): 3749-52. Hsu, H . Y . and Wen, M . H . (2002). Lipopolysaccharide-mediated reactive oxygen species and signal transduction in the regulation of interleukin-1 gene expression. JBiol Chem 277(25): 22131-9. Huang, D . , Hubbard, C. J. and Jungmann, R. A . (1995). Lactate dehydrogenase A subunit messenger R N A stability is synergistically regulated via the protein kinase A and C signal transduction pathways. Mol Endocrinol 9(8): 994-1004. Huber, M . , Helgason, C. D. , Scheid, M . P., Duronio, V . , Humphries, R. K . and Krystal, G . (1998). Targeted disruption of SHIP leads to Steel factor-induced degranulation of mast cells. Embo J 17(24): 7311-9. Hunter, M . G . and Avalos, B . R. (1998). Phosphatidylinositol 3'-kinase and SH2-containing inositol phosphatase (SHIP) are recruited by distinct positive and negative growth-regulatory domains in the granulocyte colony-stimulating factor receptor. J Immunol 160(10): 4979-87. Hunter, M . G . , Jacob, A . , O'Donnell L , C , Agler, A . , Druhan, L . J., Coggeshall, K . M . and Avalos, B . R. (2004). Loss of SHIP and CIS recruitment to the granulocyte colony-stimulating factor receptor contribute to hyperproliferative responses in severe congenital neutropenia/acute myelogenous leukemia. J Immunol 173(8): 5036-45. Jang, B . C , K i m , D . H . , Park, J. W. , Kwon , T. K . , K i m , S. P., Song, D . K . , Park, J. G. , Bae, J. H . , Mun , K . C , Baek, W . K. , et al. (2004). Induction of cyclooxygenase-2 in macrophages by catalase: role o f NF-kappaB and PI3K signaling pathways. Biochem Biophys Res Commun 316(2): 398-406. Jenkins, C , Abendroth, A . and Slobedman, B . (2004). A novel viral transcript with homology to human interleukin-10 is expressed during latent human cytomegalovirus infection. J Virol 78(3): 1440-7. Jenkins, J. K . , Malyak, M . and Arend, W. P. (1994). The effects of interleukin-10 on interleukin-1 receptor antagonist and interleukin-1 beta production in human monocytes and neutrophils. Lymphokine Cytokine Res 13(1): 47-54. 160 Johansen, C , Funding, A . T., Otkjaer, K . , Kragballe, K . , Jensen, U . B . , Madsen, M . , Binderup, L . , Skak-Nielsen, T., Fjording, M . S. and Iversen, L . (2006). Protein expression of TNF-alpha in psoriatic skin is regulated at a posttranscriptional level by MAPK-act ivated protein kinase 2. J Immunol 176(3): 1431-8. Joo, M . , Park, G . Y . , Wright, J. G . , Blackwell , T. S., Atchison, M . L . and Christman, J. W . (2004). Transcriptional regulation of the cyclooxygenase-2 gene in macrophages by P U . l . J Biol Chem 279(8): 6658-65. Jung, M . , Sabat, R., Kratzschmar, J., Seidel, H . , Wolk, K . , Schonbein, C. , Schutt, S., Friedrich, M . , Docke, W . D. , Asadullah, K. , et al. (2004). Expression profiling of IL-10-regulated genes in human monocytes and peripheral blood mononuclear cells from psoriatic patients during IL-10 therapy. Eur J Immunol 34(2): 481-93. Kalesnikoff, J., Sly, L . M . , Hughes, M . R., Buchse, T., Rauh, M . J., Cao, L . P., Lam, V . , M u i , A . , Huber, M . and Krystal, G . (2003). The role of SHIP in cytokine-induced signaling. Rev Physiol Biochem Pharmacol 149: 87-103. Kambayashi, T., Jacob, C. O., Zhou, D. , Mazurek, N . , Fong, M . and Strassmann, G . (1995). Cycl ic nucleotide phosphodiesterase type IV participates in the regulation of IL-10 and in the subsequent inhibition of TNF-alpha and IL-6 release by endotoxin-stimulated macrophages. J Immunol 155(10): 4909-16. Kato, A . , Ogasawara, T., Homma, T., Saito, H . and Matsumoto, K . (2004). Lipopolysaccharide-binding protein critically regulates lipopolysaccharide-induced IFN-beta signaling pathway in human monocytes. J Immunol 172(10): 6185-94. Katso, R., Okkenhaug, K . , Ahmadi, K . , White, S., Timms, J. and Waterfield, M . D . (2001). Cellular function o f phosphoinositide 3-kinases: implications for development, homeostasis, and cancer. Annu Rev Cell Dev Biol 17: 615-75. Kedersha, N . , Chen, S., Gilks , N . , L i , W. , Mil ler , I. J., Stahl, J. and Anderson, P. (2002). Evidence that ternary complex (eIF2-GTP-tRNA(i)(Met))-deficient preinitiation complexes are core constituents of mammalian stress granules. Mol Biol Cell . 13(1): 195-210. Keffer, J., Probert, L . , Cazlaris, H . , Georgopoulos, S., Kaslaris, E. , Kioussis, D . and Koll ias , G . (1991). Transgenic mice expressing human tumour necrosis factor: a predictive genetic model of arthritis. Embo J 10(13): 4025-31. K i m , J., Modl in , R. L . , Moy , R. L . , Dubinett, S. M . , McHugh, T., Nickoloff, B . J. and Uyemura, K . (1995). IL-10 production in cutaneous basal and squamous cell carcinomas. A mechanism for evading the local T cell immune response. J Immunol 155(4): 2240-7'. 161 K i m , J. M . , Brannan, C. I., Copeland, N . G. , Jenkins, N . A . , Khan, T. A . and Moore, K . W . (1992). Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes. J Immunol 148(11): 3618-23. K i m , W . K . , Hwang, S. Y . , Oh, E . S., Piao, H . Z . , K i m , K . W . and Han, I. O. (2004). TGF-betal represses activation and resultant death of microglia via inhibition of phosphatidylinositol 3-kinase activity. J Immunol 172(11): 7015-23. K i m , Y . M . , Kang, H . S., Paik, S. G. , Pyun, K . H . , Anderson, K . L . , Torbett, B . E . and Choi , I. (1999). Roles of I F N consensus sequence binding protein and P U . l in regulating IL-18 gene expression. J Immunol 163(4): 2000-7. Kitamura, M . , Suto, T., Yokoo, T., Shimizu, F. and Fine, L . G . (1996). Transforming growth factor-beta 1 is the predominant paracrine inhibitor of macrophage cytokine synthesis produced by glomerular mesangial cells. J Immunol 156(8): 2964-71. Knudsen, E . , Iversen, P. O., V a n Rooijen, N . and Benestad, H . B . (2002). Macrophage-dependent regulation of neutrophil mobilization and chemotaxis during development of sterile peritonitis in the rat. Eur J Haematol 69(5-6): 284-96. Kol le , G. , Georgas, K . , Holmes, G . P., Little, M . H . and Yamada, T. (2000). C R I M 1 , a novel gene encoding a cysteine-rich repeat protein, is developmentally regulated and implicated in vertebrate C N S development and organogenesis. Mech Dev 90(2): 181-93. Koll ias , G . , Douni, E . , Kassiotis, G . and Kontoyiannis, D . (1999). On the role of tumor necrosis factor and receptors in models of multiorgan failure, rheumatoid arthritis, multiple sclerosis and inflammatory bowel disease. Immunol Rev 169: 175-94. Kontoyiannis, D . , Kotlyarov, A . , Carballo, E . , Alexopoulou, L . , Blackshear, P. J., Gaestel, M . , Davis, R., Flavell , R. and Koll ias , G . (2001). Interleukin-10 targets p38 M A P K to modulate ARE-dependent T N F m R N A translation and limit intestinal pathology. Embo J 20(14): 3760-70. Kontoyiannis, D. , Pasparakis, M . , Pizarro, T. T., Cominell i , F. and Koll ias , G . (1999). Impaired on/off regulation of T N F biosynthesis in mice lacking T N F A U - r i c h elements: implications for joint and gut-associated immunopathologies. Immunity 10(3): 387-98. Kopp, E . , Medzhitov, R., Carothers, J., Xiao, C , Douglas, I., Janeway, C. A . and Ghosh, S. (1999). ECSIT is an evolutionarily conserved intermediate in the Toll/IL-1 signal transduction pathway. Genes Dev 13(16): 2059-71. 162 Kotenko, S. V . and Pestka, S. (2000). Jak-Stat signal transduction pathway through the eyes of cytokine class II receptor complexes. Oncogene 19(21): 2557-65. Kotlyarov, A . and Gaestel, M . (2002). Is M K 2 (mitogen-activated protein kinase-activated protein kinase 2) the key for understanding post-transcriptional regulation of gene expression? Biochem Soc Trans 30(Pt 6): 959-63. Kotlyarov, A . , Neininger, A . , Schubert, C. , Eckert, R., Birchmeier, C. , Volk , H . D . and Gaestel, M . (1999). M A P K A P kinase 2 is essential for LPS-induced TNF-alpha biosynthesis. Nat Cell Biol 1(2): 94-7. Krystal, G . (2000). L ip id phosphatases in the immune system. Semin Immunol 12(4): 397-403. Krystal, G . , Damen, J. E . , Helgason, C. D . , Huber, M . , Hughes, M . R., Kalesnikoff, J. , Lam, V . , Rosten, P., Ware, M . D . , Yew, S., et al. (1999). SHIPs ahoy. IntJ Biochem Cell Biol 31(10): 1007-1.0. Kuhn, R., Lohler, J., Rennick, D . , Rajewsky, K . and Muller , W . (1993). Interleukin-10-deficient mice develop chronic enterocolitis. Cell 75(2): 263-74. Kumar, V . , Pandey, P., Sabatini, D . , Kumar, M . , Majumder, P. K . , Bharti, A . , Carmichael, G . , Kufe, D . and Kharbanda, S. (2000). Functional interaction between R A F T l / F R A P / m T O R and protein kinase cdelta in the regulation of cap-dependent initiation of translation. Embo J 19(5): 1087-97. Kuroiwa, A . , Yamashita, Y . , Inui, M . , Yuasa, T., Ono, M . , Nagabukuro, A . , Matsuda, Y . and Takai, T. (1998). Association of tyrosine phosphatases SHP-1 and SHP-2, inositol 5-phosphatase SHIP with gp49Bl , and chromosomal assignment of the gene. J Biol Chem 273(2): 1070-4. Kuwata, H . , Watanabe, Y . , Miyoshi , H . , Yamamoto, M . , Kaisho, T., Takeda, K . and Aki ra , S. (2003). IL-10-inducible Bcl-3 negatively regulates LPS-induced T N F -alpha production in macrophages. Blood 102(12): 4123-9. Landmann, R., Scherer, F., Schumann, R., Link, S., Sansano, S. and Zimmerli , W . (1995). L P S directly induces oxygen radical production in human monocytes via L P S binding protein and CD14. JLeukoc Biol 57(3): 440-9. Lang, R., Patel, D . , Morris , J. J., Rutschman, R. L . and Murray, P. J. (2002). Shaping gene expression in activated and resting primary macrophages by IL-10. J Immunol 169(5): 2253-63. Lasa, M . , Mahtani, K . R., Finch, A . , Brewer, G . , Saklatvala, J. and Clark, A . R. (2000). Regulation of cyclooxygenase 2 m R N A stability by the mitogen-activated protein kinase p38 signaling cascade. Mol Cell Biol 20(12): 4265-74. 163 Lawrence, T., Willoughby, D . A . and Gilroy, D. W . (2002). Anti-inflammatory l ipid mediators and insights into the resolution of inflammation. Nat Rev Immunol 2(10): 787-95. Lee, J. S., Hmama, Z . , M u i , A . and Reiner, N . E . (2004). Stable gene silencing in human monocytic cell lines using lentiviral-delivered small interference R N A . Silencing of the p i lOalpha isoform of phosphoinositide 3-kinase reveals differential regulation of adherence induced by lalpha,25-dihydroxycholecalciferol and bacterial lipopolysaccharide. J Biol Chem 279(10): 9379-88. Lee, T. S. and Chau, L . Y . (2002). Heme oxygenase-1 mediates the anti-inflammatory effect o f interleukin-10 in mice. Nat Med 8(3): 240-6. Lee, W . Y . , Lofl in , P., Clancey, C. J., Peng, H . and Lever, J. E . (2000). Cycl ic nucleotide regulation of Na+/glucose cotransporter (SGLT1) m R N A stability. Interaction of a nucleocytoplasmic protein with a regulatory domain in the 3'-untranslated region critical for stabilization. J Biol Chem 275(43): 33998-4008. Leevers, S. J., Vanhaesebroeck, B . and Waterfield, M . D . (1999). Signalling through phosphoinositide 3-kinases: the lipids take centre stage. Curr Opin Cell Biol 11(2): 219-25. Lemay, S., Davidson, D. , Latour, S. and Veillette, A . (2000). Dok-3, a novel adapter molecule involved in the negative regulation of immunoreceptor signaling. Mol Cell Biol 20(8): 2743-54. Lerner, R. S. and Nicchitta, C. V . (2006). m R N A translation is compartmentalized to the endoplasmic reticulum following physiological inhibition of cap-dependent translation. Rna 12(5): 775-89. L i , L . , Yang, Y . , Wang, Z . and Gong, F. (2002). Study of the effects of L P S on the T A C E gene expression and its function. JHuazhong Univ Sci Technolog Med Sci 22(1): 5-8. L i , P. and Schwarz, E . M . (2003). The TNF-alpha transgenic mouse model of inflammatory arthritis. Springer Semin Immunopathol 25(1): 19-33. L i , X . and Qin, J. (2005). Modulation of Toll-interleukin 1 receptor mediated signaling. J Mol Med 83(4): 258-66. L i , Y . , Bor, Y . C , Misawa, Y . , Xue, Y . , Rekosh, D . and Hammarskjold, M . L . (2006). A n intron with a constitutive transport element is retained in a Tap messenger R N A . Nature 443(7108): 234-7. 164 L i m , H . K . , Choi , Y . A . , Park, W. , Lee, T., Ryu, S. H . , K i m , S. Y . , K i m , J. R., K i m , J. H . and Baek, S. H . (2003). Phosphatidic acid regulates systemic inflammatory responses by modulating the Akt-mammalian target of rapamycin-p70 S6 kinase 1 pathway. J Biol Chem 278(46): 45117-27. L i n , W . J. and Yeh , W . C. (2005). Implication of Toll- l ike receptor and tumor necrosis factor alpha signaling in septic shock. Shock 24(3): 206-9. M a , W. , L i m , W. , Gee, K . , Aucoin, S., Nandan, D . , Kozlowski , M . , Diaz-Mitoma, F. and Kumar, A . (2001). The p38 mitogen-activated kinase pathway regulates the human interleukin-10 promoter via the activation of S p l transcription factor in lipopolysaccharide-stimulated human macrophages. J Biol Chem 276(17): 13664-74. MacDermott, R. P. (1996). Alterations o f the mucosal immune system in inflammatory bowel disease. J Gastroenterol 31(6): 907-16. MacDougall , L . K . , Gagou, M . E . , Leevers, S. J., Hafen, E . and Waterfield, M . D . (2004). Targeted expression of the class II phosphoinositide 3-kinase in Drosophila melanogaster reveals lipid kinase-dependent effects on patterning and interactions with receptor signaling pathways. Mol Cell Biol 24(2): 796-808. MacKenzie, S., Fernandez-Troy, N . and Espel, E . (2002). Post-transcriptional regulation of TNF-alpha during in vitro differentiation of human monocytes/macrophages in primary culture. JLeukoc Biol 71(6): 1026-32. Madrid, L . V . , Mayo, M . W. , Reuther, J. Y . and Baldwin, A . S., Jr. (2001). A k t stimulates the transactivation potential of the RelA/p65 Subunit of NF-kappa B through utilization of the Ikappa B kinase and activation of the mitogen-activated protein kinase p38. J Biol Chem 276(22): 18934-40. Mahtani, K . R., Brook, M . , Dean, J. L . , Sully, G . , Saklafvala, J. and Clark, A . R. (2001). Mitogen-activated protein kinase p38 controls the expression and posttranslational modification of tristetraprolin, a regulator of tumor necrosis factor alpha m R N A stability. Mol Cell Biol 21(19): 6461-9. March, M . E . and Ravichandran, K . (2002). Regulation of the immune response by SHIP. Semin Immunol 14(1): 37-47. Martin, M . , Rehani, K . , Jope, R. S. and Michalek, S. M . (2005). Toll- l ike receptor-mediated cytokine production is differentially regulated by glycogen synthase kinase 3. Nat Immunol 6(8): 777-84. Martin, M . , Schifferle, R. E . , Cuesta, N . , Vogel , S. N . , Katz, J. and Michalek, S. M . (2003). Role of the phosphatidylinositol 3 kinase-Akt pathway in the regulation of 165 IL-10 and IL-12 by Porphyromonas gingivalis lipopolysaccharide. J Immunol 171(2): 717-25. Medzhitov, R. and Janeway, C . A . , Jr. (1998). A n ancient system of host defense. Curr Opin Immunol 10(1): 12-5. Medzhitov, R., Preston-Hurlburt, P. and Janeway, C. A . , Jr. (1997). A human homologue of the Drosophila To l l protein signals activation of adaptive immunity. Nature 388(6640): 394-7. Mijatovic, T., Kruys, V . , Caput, D . , Defrance, P. and Huez, G . (1997). Interleukin-4 and -13 inhibit tumor necrosis factor-alpha m R N A translational activation in lipopolysaccharide-induced mouse macrophages. J Biol Chem 272(22): 14394-8. Monick, M . M . , Carter, A . B . , Robeff, P. K . , Flaherty, D . M . , Peterson, M . W . and Hunninghake, G . W . (2001). Lipopolysaccharide activates Ak t in human alveolar macrophages resulting in nuclear accumulation and transcriptional activity of beta-catenin. J Immunol 166(7): 4713-20. Monick, M . M . and Hunninghake, G . W . (2002). Activation of second messenger pathways in alveolar macrophages by endotoxin. Eur Respir J20(1): 210-22. Monick, M . M . , Robeff, P. K , Butler, N . S., Flaherty, D . M . , Carter, A . B . , Peterson, M . W . and Hunninghake, G . W . (2002). Phosphatidylinositol 3-kinase activity negatively regulates stability of cyclooxygenase 2 m R N A . J Biol Chem 277(36): 32992-3000. Moore, K . W. , de Waal Malefyt, R., Coffman, R. L . and O'Garra, A . (2001). Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 19: 683-765. Moser, B . and Loetscher, P. (2001). Lymphocyte traffic control by chemokines. Nat Immunol 2(2): 123-8. Murray, P. J. (2005). The primary mechanism of the IL-10-regulated antiinflammatory response is to selectively inhibit transcription. Proc Natl Acad Sci U SA 102(24): 8686-91. Murray, P. J. (2006). Understanding and exploiting the endogenous interleukin-10/STAT3-mediated anti-inflammatory response. Curr Opin Pharmacol 6(4): 379-86. Neininger, A . , Kontoyiannis, D . , Kotlyarov, A . , Winzen, R., Eckert, R., Vo lk , H . D . , Holtmann, H . , Koll ias , G . and Gaestel, M . (2002). M K 2 targets A U - r i c h elements and regulates biosynthesis of tumor necrosis factor and interleukin-6 independently at different post-transcriptional levels. J Biol Chem 277(5): 3065-8. 166 Neurath, M . F., Fuss, I., Pasparakis, M . , Alexopoulou, L . , Haralambous, S., Meyer zum Buschenfelde, K . PL, Strober, W . and Koll ias , G . (1997). Predominant pathogenic role of tumor necrosis factor in experimental colitis in mice. Eur J Immunol 27(7): 1743-50. Niemand, C , Nimmesgern, A . , Haan, S., Fischer, P., Schaper, F., Rossaint, R., Heinrich, P. C. and Muller-Newen, G . (2003). Activation of S T A T 3 by IL-6 and IL-10 in primary human macrophages is differentially modulated by suppressor of cytokine signaling 3. J Immunol 170(6): 3263-72. Noda, T. and Amano, F . (1997). Differences in nitric oxide synthase activity in a macrophage-like cell line, RAW264.7 cells, treated with lipopolysaccharide (LPS) in the presence or absence of interferon-gamma (IFN-gamma): possible heterogeneity of i N O S activity. JBiochem (Tokyo) 121(1): 38-46. O'Farrell, A . M . , L i u , Y . , Moore, K . W . and M u i , A . L . (1998). IL-10 inhibits macrophage activation and proliferation by distinct signaling mechanisms: evidence for Stat3-dependent and -independent pathways. Embo J 17(4): 1006-18. O'Farrell, A . M . , Parry, D . A . , Zindy, F. , Roussel, M . F., Lees, E. , Moore, K . W . and M u i , A . L . (2000). Stat3-dependent induction of p l 9 I N K 4 D by IL-10 contributes to inhibition of macrophage proliferation. J Immunol 164(9): 4607-15. O'Farrell, A . M . , Parry, D . A . , Zindy, F., Roussel, M . F. , Lees, E. , Moore, K . W . and M u i , A . L . (2000). Stat3-dependent induction of p l 9 I N K 4 D by IL-10 contributes to inhibition of macrophage proliferation. J Immunol 164(9): 4607-15. Ojaniemi, M . , Glumoff, V . , Harju, K . , Liljeroos, M . , Vuor i , K . and Hallman, M . (2003). Phosphatidylinositol 3-kinase is involved in Toll- l ike receptor 4-mediated cytokine expression in mouse macrophages. Eur J Immunol 33(3): 597-605. Okugawa, S., Ota, Y . , Kitazawa, T., Nakayama, K . , Yanagimoto, S., Tsukada, K . , Kawada, M . and Kimura, S. (2003). Janus kinase 2 is involved in lipopolysaccharide-induced activation of macrophages. Am J Physiol Cell Physiol 285(2): C399-408. Palladino, M . A . , Bahjat, F. R., Theodorakis, E . A . and Moldawer, L . L . (2003). Ant i -TNF-alpha therapies: the next generation. Nat Rev Drug Discov 2(9): 736-46. Park, Y . C, Lee, C. H . , Kang, H . S., Chung, H . T. and K i m , H . D . (1997). Wortmannin, a specific inhibitor of phosphatidylinositol-3-kinase, enhances LPS-induced N O production from murine peritoneal macrophages. Biochem Biophys Res Commun 240(3): 692-6. 167 Patel, T. R. and Corbett, S. A . (2004). Simvastatin suppresses LPS-induced A k t phosphorylation in the human monocyte cell line THP-1 . J Surg Res 116(1): 116-20. Pengal, R. A . , Ganesan, L . P., Wei , G . , Fang, H . , Ostrowski, M . C. and Tridandapani, S. (2005) . Lipopolysaccharide-induced production of interleukin-10 is promoted by the serine/threonine kinase Akt . Mol Immunol. Pengal, R. A . , Ganesan, L . P., We i , G . , Fang, H . , Ostrowski, M . C. and Tridandapani, S. (2006) . Lipopolysaccharide-induced production o f interleukin-10 is promoted by the serine/threonine kinase Akt . Mol Immunol 43(10): 1557-64. Pennisi, D . J., Wilkinson, L . , Kol le , G . , Sohaskey, M . L . , Gillinder, K . , Piper, M . J., M c A v o y , J. W. , Lovicu, F. J. and Little, M . H . (2007). C r i m l K S T 2 6 4 / K S T 2 6 4 mice display a disruption of the C r i m l gene resulting in perinatal lethality with defects in multiple organ systems. Dev Dyn 236(2): 502-11. Pestka, S., Krause, C. D . , Sarkar, D . , Walter, M . R., Shi, Y . and Fisher, P. B . (2004). Interleukin-10 and related cytokines and receptors. Annu Rev Immunol 22: 929-79. Petiot, A . , Ogier-Denis, E . , Blommaart, E . F., Meijer, A . J. and Codogno, P. (2000). Distinct classes o f phosphatidylinositol 3'-kinases are involved in signaling pathways that control macroautophagy in HT-29 cells. J Biol Chem 275(2): 992-. 8 . Phee, H . , Jacob, A . and Coggeshall, K . M . (2000). Enzymatic activity of the Src homology 2 domain-containing inositol phosphatase is regulated by a plasma membrane location. J Biol Chem 275(25): 19090-7. Phillips, K . , Kedersha, N . , Shen, L . , Blackshear, P. J. and Anderson, P. (2004). Arthritis suppressor genes TIA-1 and TTP dampen the expression of tumor necrosis factor alpha, cyclooxygenase 2, and inflammatory arthritis. Proc Natl Acad Sci USA 101(7): 2011-6. Piecyk, M . , Wax, S., Beck, A . R., Kedersha, N . , Gupta, M . , Mari t im, B . , Chen, S., Gueydan, C , Kruys, V . , Streuli, M . , et al. (2000). TIA-1 is a translational silencer that selectively regulates the expression of TNF-alpha. Embo J 19(15): 4154-63. Pizarro, T. T., Arseneau, K . O., Bamias, G . and Cominell i , F. (2003). Mouse models for the study of Crohn's disease. Trends Mol Med 9(5): 218-22. Platzer, C , Meisel , C , Vogt, K . , Platzer, M . and Volk , H . D . (1995). Up-regulation of monocytic IL-10 by tumor necrosis factor-alpha and c A M P elevating drugs. Int Immunol 7(4): 517-23. 168 Pober, J. S. (2002). Endothelial activation: intracellular signaling pathways. Arthritis Res 4Suppl3: S109-16. Qasimi, P., Ming-Lum, A . , Ghanipour, A . , Ong, C. J., Cox, M . E . , Ihle, J., Cacalano, N . , Yoshimura, A . and M u i , A . L . (2005). Divergent mechanisms utilized by SOCS3 to mediate interleukin-10 inhibition of tumour necrosis factor alpha and nitric oxide production by macrophages. J Biol Chem. Qian, Y . , Commane, M . , Ninomiya-Tsuji, J., Matsumoto, K . and L i , X . (2001). I R A K -mediated translocation of T R A F 6 and T A B 2 in the interleukin-1 -induced activation of NFkappa B . J Biol Chem 276(45): 41661-7. Raetz, C. R. and Whitfield, C. (2002). Lipopolysaccharide endotoxins. Annu Rev Biochem 71: 635-700. Ramirez, M . , Fernandez-Troy, N . , Buxade, M . , Casaroli-Marano, R. P., Benitez, D . , Perez-Maldonado, C. and Espel, E . (1999). Wortmannin inhibits translation of tumor necrosis factor-alpha in superantigen-activated T cells. Int Immunol 11(9): 1479-89. Rauh, M . J., Ho, V . , Pereira, C , Sham, A . , Sly, L . M . , Lam, V . , Huxham, L . , Minchinton, A . I., M u i , A . and Krystal, G . (2005). SHIP Represses the Generation of Alternatively Activated Macrophages. Immunity 23(4): 361-74. Rauh, M . J. and Krystal, G . (2002). O f mice and men: elucidating the role of SH2-containing inositol 5-phosphatase (SHIP) in human disease. Clin Invest Med 25(3): 68-70. Ravasi, T., Wells, C , Forest, A . , Underhill, D . M . , Wainwright, B . J., Aderem, A . , Grimmond, S. and Hume, D . A . (2002). Generation of diversity in the innate immune system: macrophage heterogeneity arises from gene-autonomous transcriptional probability of individual inducible genes. J Immunol 168(1): 44-50. Re, F. and Strominger, J. L . (2001). Toll- l ike receptor 2 (TLR2) and T L R 4 differentially activate human dendritic cells. J Biol Chem 276(40): 37692-9. Renauld, J. C. (2003). Class II cytokine receptors and their ligands: key antiviral and inflammatory modulators. Nat Rev Immunol 3(8): 667-76. Rennick, D . M . , Fort, M . M . and Davidson, N . J. (1997). Studies with IL-10-/- mice: an overview. JLeukoc Biol 61(4): 389-96. Richards, P. J., Wil l iams, A . S., Goodfellow, R. M . and Wil l iams, B . D . (1999). Liposomal clodronate eliminates synovial macrophages, reduces inflammation 169 and ameliorates joint destruction in antigen-induced arthritis. Rheumatology (Oxford) 38(9): 818-25. Riley, J. K . , Takeda, K . , Aki ra , S. and Schreiber, R. D . (1999). Interleukin-10 receptor signaling through the J A K - S T A T pathway. Requirement for two distinct receptor-derived signals for anti-inflammatory action. J Biol Chem 274(23): 16513-21. Robertson, M . J., Erwig, L . P., Liversidge, J., Forrester, J. V . , Rees, A . J. and Dick, A . D . (2Q02). Retinal microenvironment controls resident and infiltrating macrophage function during uveoretinitis. Invest Ophthalmol Vis Sci 43(7): 2250-7'. Ross, I. L . , Browne, C. M . and Hume, D . A . (1994). Transcription of individual genes in eukaryotic cells occurs randomly and infrequently. Immunol Cell Biol 72(2): 177-85. Rousseau, S., Morrice, N . , Peggie, M . , Campbell, D . G . , Gaestel, M . and Cohen, P. (2002). Inhibition of SAPK2a/p38 prevents hnRNP AO phosphorylation by M A P K A P - K 2 and its interaction with cytokine m R N A s . Embo J21(23): 6505-14. Rouzer, C . A . , Jacobs, A . T., Nirodi , C . S., Kingsley, P. J., Morrow, J. D . and Marnett, L . J. (2005). RAW264.7 cells lack prostaglandin-dependent autoregulation of tumor, necrosis factor-alpha secretion. J Lipid Res 46(5): 1027-37. Rugtveit, J., Haraldsen, G . , Hogasen, A . K . , Bakka, A . , Brandtzaeg, P. and Scott, H . (1995). Respiratory burst of intestinal macrophages in inflammatory bowel disease is mainly caused by CD14+L1+ monocyte derived cells. Gut 37(3): 367-73. Saito, T., Hirai , R., Loo, Y . M . , Owen, D . , Johnson, C. L . , Sinha, S. C , Aki ra , S., Fujita, T. and Gale, M . , Jr. (2007). Regulation of innate antiviral defenses through a shared repressor domain in RIG-I and L G P 2 . Proc Natl Acad Sci USA 104(2): 582-7. Salh, B . , Wagey, R., Marotta, A . , Tao, J. S. and Pelech, S. (1998). Activation of phosphatidylinositol 3-kinase, protein kinase B , and p70 S6 kinases in lipopolysaccharide-stimulated Raw 264.7 cells: differential effects of rapamycin, Ly294002, and wortmannin on nitric oxide production. J Immunol 161(12): 6947-54. Schabbauer, G . , Tencati, M . , Pedersen, B . , Pawlinski, R. and Mackman, N . (2004). PI3K-Akt pathway suppresses coagulation and inflammation in endotoxemic mice. Arterioscler Thromb Vase B i o l . 24: 1963-9. Scheid, M . P., Huber, M . , Damen, J. E . , Hughes, M . , Kang, V . , Neilsen, P., Prestwich, G . D. , Krystal, G . and Duronio, V . (2002). Phosphatidylinositol (3,4,5)P3 is essential but not sufficient for protein kinase B ( P K B ) activation; phosphatidylinositol 170 (3,4)P2 is required for P K B phosphorylation at Ser-473: studies using cells from SH2-containing inositol-5-phosphatase knockout mice. JBiol Chem 277(11): 9027-35. Scheinin, T., Butler, D . M . , Salway, F., Scallon, B . and Feldmann, M . (2003). Validation of the interleukin-10 knockout mouse model of colitis: antitumour necrosis factor-antibodies suppress the progression of colitis. Clin Exp Immunol 133(1): 38-43. Schottelius, A . J., Mayo, M . W. , Sartor, R. B . and Baldwin, A . S., Jr. (1999). Interleukin-10 signaling blocks inhibitor of kappaB kinase activity and nuclear factor kappaB D N A binding. JBiol Chem 274(45): 31868-74. Schumann, J., Wolf, D . , Pahl, A . , Brune, K . , Papadopoulos, T., van Rooijen, N . and Tiegs, G . (2000). Importance of Kupffer cells for T-cell-dependent liver injury in mice. Am J Pathol 157(5): 1671-83. Schwab, J. M . and Serhan, C. N . (2006). Lipoxins and new lipid mediators in the resolution of inflammation. Curr Opin Pharmacol 6(4): 414-20. Serhan, C. N . and Savil l , J. (2005). Resolution of inflammation: the beginning programs the end. Nat Immunol 6(12): 1191-7. Shegogue, D . and Trojanowska, M . (2004). Mammalian target of rapamycin positively regulates collagen type I production via a phosphatidylinositol 3-kinase-independent pathway. JBiol Chem 279(22): 23166-75. Sly, L . M . , Rauh, M . J., Kalesnikoff, J., Buchse, T. and Krystal, G . (2003). SHIP, SHIP2, and P T E N activities are regulated in vivo by modulation of their protein levels: SHIP is up-regulated in macrophages and mast cells by lipopolysaccharide. Exp Hematol 31(12): 1170-81. Sly, L . M . , Rauh, M . J., Kalesnikoff, J., Song, C. H . and Krystal, G . (2004). LPS-induced upregulation of SHIP is essential for endotoxin tolerance. Immunity 21(2): 227-39. Spencer, S. D . , D i Marco, F. , Hooley, J., Pitts-Meek, S., Bauer, M . , Ryan, A . M . , Sordat, B . , Gibbs, V . C. and Aguet, M . (1998). The orphan receptor CRF2-4 is an essential subunit of the interleukin 10 receptor. J Exp Med 187(4): 571-8. Stephens, L . , Anderson, K . , Stokoe, D . , Erdjument-Bromage, H . , Painter, G . F. , Holmes, A . B . , Gaffney, P. R., Reese, C. B . , McCormick, F. , Tempst, P., et al. (1998). Protein kinase B kinases that mediate phosphatidylinositol 3,4,5-trisphosphate-dependent activation of protein kinase B . Science 279(5351): 710-4. 171 ,St-Germain, M . E . , Gagnon, V . , Parent, S. and Asselin, E . (2004). Regulation of C O X - 2 protein expression by A k t in endometrial cancer cells is mediated through N F -kappaB/IkappaB pathway. Mol Cancer 3:7. Stoecklin, G . , Stubbs, T., Kedersha, N . , Wax, S., Rigby, W . F., Blackwell , T. K . and Anderson, P. (2004). MK2-induced tristetraprolin: 14-3-3 complexes prevent stress granule association and A R E - m R N A decay. EmboJ23(6): 1313-24. Stokoe, D . , Stephens, L . R., Copeland, T., Gaffney, P. R., Reese, C. B . , Painter, G . F., Holmes, A . B . , McCormick, F. and Hawkins, P. T. (1997). Dual role of phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase B . Science 277(5325): 567-70. Strassheim, D. , Asehnoune, K . , Park, J. S., K i m , J. Y . , He, Q., Richter, D . , Kuhn, K . , Mitra, S. and Abraham, E . (2004). Phosphoinositide 3-kinase and Ak t occupy central roles in inflammatory responses o f Toll- l ike receptor 2-stimulated neutrophils. J Immunol 172(9): 5727-33. Strassheim, D. , K i m , J. Y . , Park, J. S., Mitra, S. and Abraham, E . (2005). Involvement of SHIP in TLR2-induced neutrophil activation and acute lung injury. J Immunol 174(12): 8064-71. Streilein, J. W. , Ksander, B . R. and Taylor, A . W . (1997). Immune deviation in relation to ocular immune privilege. J Immunol 158(8): 3557-60. Strober, W. , Murray, P. J., Kitani , A . and Watanabe, T. (2006). Signalling pathways and molecular interactions of N O D I and N O D 2 . Nat Rev Immunol 6(1): 9-20. Sutterwala, F. S., Ogura, Y . , Szczepanik, M . , Lara-Tejero, M . , Lichtenberger, G . S., Grant, E . P., Bertin, J., Coyle, A . J., Galan, J. E . , Askenase, P. W., et al. (2006). Critical role for N A L P 3 / C I A S l / C r y o p y r i n in innate and adaptive immunity through its regulation of caspase-1. Immunity 24(3): 317-27. Svitkin, Y . V . , Pause, A . , Haghighat, A . , Pyronnet, S., Witherell, G . , Belsham, G . J. and Sonenberg, N . (2001). The requirement for eukaryotic initiation factor 4 A (elF4A) in translation is in direct proportion to the degree of m R N A 5' secondary structure. Rna 7(3): 382-94. Takeda, K . and Aki ra , S. (2005). Toll- l ike receptors in innate immunity. Int Immunol 17(1): 1-14. Takeda, K . , Clausen, B . E. , Kaisho, T., Tsujimura, T., Terada, N . , Forster, I. and Aki ra , S. (1999). Enhanced T h l activity and development of chronic enterocolitis in mice devoid of Stat3 in macrophages and neutrophils. Immunity 10(1): 39-49. 172 Takeuchi, O;, Hoshino, K . , Kawai , T., Sanjo, H . , Takada, H . , Ogawa, T., Takeda, K . and Akira , S. (1999). Differential roles of T L R 2 and T L R 4 in recognition of gram-negative and gram-positive bacterial cell wall components. Immunity 11(4): 443-51. Tanaka, Y . , Otsuka, T., Hotokebuchi, T., Miyahara, H . , Nakashima, H . , Kuga, S., Nemoto, Y . , Ni i ro , H . and Niho, Y . (1996). Effect of IL-10 on collagen-induced arthritis in mice. Inflamm Res 45(6): 283-8. Tang, Q., Gonzales, M . , Inoue, H . and Bowden, G . T. (2001). Roles o f A k t and glycogen synthase kinase 3beta in the ultraviolet B induction of cyclooxygenase-2 transcription in human keratinocytes. Cancer Res 61(11): 4329-32. Tapping, R. I., Akashi, S., Miyake, K . , Godowski, P. J. and Tobias, P. S. (2000). Toll- l ike receptor 4, but not toll-like receptor 2, is a signaling receptor for Escherichia and Salmonella lipopolysaccharides. J Immunol 165(10): 5780-7. Taylor, P. C. , Will iams, R. O. and Feldmann, M . (2004). Tumour necrosis factor alpha as a therapeutic target for immune-mediated inflammatory diseases. Curr Opin Biotechnol 15(6): 557-63. Tipping, P. G . , Leong, T. W . and Holdsworth, S. R. (1991). Tumor necrosis factor production by glomerular macrophages in anti-glomerular basement membrane glomerulonephritis in rabbits. Lab Invest 65(3): 272-9. Tomlinson, M . G . , Heath, V . L . , Turck, C. W . , Watson, S. P. and Weiss, A . (2004). SHIP family inositol phosphatases interact with and negatively regulate the Tec tyrosine kinase. JBiol Chem 279(53): 55089-96. Tridandapani, S., Kelley, T., Pradhan, M . , Cooney, D . , Justement, L . B . and Coggeshall, K . M . (1997). Recruitment and phosphorylation of SH2-containing inositol phosphatase and She to the B-cel l Fc gamma immunoreceptor tyrosine-based inhibition motif peptide motif. Mol Cell Biol 17(8): 4305-11. Van Amersfoort, E . S., V a n Berkel, T. J. and Kuiper, J. (2003). Receptors,.mediators, and mechanisms involved in bacterial sepsis and septic shock. Clin Microbiol Rev 16(3): 379-414. van der Pol l , T., Jansen, P. M . , Montegut, W . J. , Braxton, C. C. , Calvano, S. E . , Stackpole, S. A . , Smith, S. R., Swanson, S. W. , Hack, C. E . , Lowry, S. F., et al. (1997). Effects of IL-10 on systemic inflammatory responses during sublethal primate endotoxemia. J Immunol 158(4): 1971-5. Van Laethem, J. L . , Marchant, A . , Delvaux, A . , Goldman, M . , Robberecht, P., Velu , T. and Deviere, J. (1995). Interleukin 10 prevents necrosis in murine experimental acute pancreatitis. Gastroenterology 108(6): 1917-22. 173 Vanhaesebroeck, B . and Alessi , D . R. (2000). The P I 3 K - P D K 1 connection: more than just a road to P K B . Biochem J346 Pt 3: 561-76. Vanhaesebroeck, B . , A l i , K . , Bilancio, A . , Geering, B . and Foukas, L . C. (2005). Signalling by PI3K isoforms: insights from gene-targeted mice. Trends Biochem Sci 30(4): 194-204. Vassalli, P. (1992). The pathophysiology of tumor necrosis factors. Annu Rev Immunol 10:411-52. Voorma, H . O., Thomas, A . A . and Van Heugten, H . A . (1994). Initiation of protein synthesis in eukaryotes. Mol Biol Rep 19(3): 139-45. Waite, K . A . and Eng, C. (2002). Protean P T E N : form and function. Am J Hum Genet 70(4): 829-44. Ward, S. G. , Finan, P. and Welham, M . J. (2003). PI3K comes of age. Nat Immunol 4(1): 2. Ware, M . D. , Rosten, P., Damen, J. E. , L i u , L . , Humphries, R. K . and Krystal, G . (1996). Cloning and characterization of human SHIP, the 145-kD inositol 5-phosphatase that associates with S H C after cytokine stimulation. Blood 88(8): 2833-40. Warren, M . K . and Vogel , S. N . (1985). Bone marrow-derived macrophages: development and regulation of differentiation markers by colony-stimulating factor and interferons. J Immunol 134(2): 982-9. Weber-Nordt, R. M . , Riley, J. K . , Greenlund, A . C , Moore, K . W. , Darnell, J. E . and Schreiber, R. D . (1996). Stat3 recruitment by two distinct ligand-induced, tyrosine-phosphorylated docking sites in the interleukin-10 receptor intracellular domain. J Biol Chem 271(44): 27954-61. Weinstein, S. L . , Finn, A . J. , Dave, S. H . , Meng, F. , Lowel l , C . A . , Sanghera, J. S. and DeFranco, A . L . (2000). Phosphatidylinositol 3-kinase and m T O R mediate lipopolysaccharide-stimulated nitric oxide production in macrophages via interferon-beta. JLeukoc Biol 67(3): 405-14. Werts, C , Tapping, R. I., Mathison, J. C , Chuang, T. H . , Kravchenko, V . , Saint Girons, I., Haake, D . A . , Godowski, P. J., Hayashi, F., Ozinsky, A . , et al. (2001). Leptospiral lipopolysaccharide activates cells through a TLR2-dependent mechanism. Nat Immunol 2(4): 346-52. Whitelaw, D . M . (1972). Observations on human monocyte kinetics after pulse labeling. Cell Tissue Kinet 5(4): 311-7. 174 Wick, M . J., Dong, L . Q., Riojas, R. A . , Ramos, F. J. and L i u , F. (2000). Mechanism of phosphorylation of protein kinase B / A k t by a constitutively active 3-phosphoinositide-dependent protein kinase-1. J Biol Chem 275(51): 40400-6. Wilkinson, L . , Kol le , G . , Wen, D. , Piper, M . , Scott, J. and Little, M . (2003). C R I M 1 regulates the rate of processing and delivery of bone morphogenetic proteins to the cell surface. J Biol Chem 278(36): 34181-8. Will iams, D . E . , Telliez, J. B . , L i u , J., Tahir, A . , van Soest, R. and Andersen, R. J. (2004). Meroterpenoid M A P K A P ( M K 2 ) inhibitors isolated from the indonesian marine sponge Acanthodendrilla sp. J Nat Prod 67(12): 2127-9. Wil l iams, D . L . , L i , C. , Ha, T., Ozment-Skelton, T., Kalbfleisch, J. H . , Preiszner, J., Brooks, L . , Breuel, K . and Schweitzer, J. B . (2004). Modulation of the phosphoinositide 3-kinase pathway alters innate resistance to polymicrobial sepsis. J Immunol 172(1): 449-56. Will iams, L . , Bradley, L . , Smith, A . and Foxwell , B . (2004). Signal transducer and activator of transcription 3 is the dominant mediator of the anti-inflammatory effects of IL-10 in human macrophages. J Immunol 172(1): 567-76. Wogensen, L . , Huang, X . and Sarvetnick, N . (1993). Leukocyte extravasation into the pancreatic tissue in transgenic mice expressing interleukin 10 in the islets of Langerhans. J Exp Med 178(1): 175-85. Wymann, M . P. and Marone, R. (2005). Phosphoinositide 3-kinase in disease: timing, location, and scaffolding. Curr Opin Cell Biol 17(2): .141-9. Wynes, M . W . and Riches, D . W . (2003). Induction of macrophage insulin-like growth factor-I expression by the Th2 cytokines IL-4 and IL-13. J Immunol 171(7): 3550-9. Xaus, J., Comalada, M . , Valledor, A . F. , Lloberas, J., Lopez-Soriano, F., Argiles, J. M . , Bogdan, C . and Celada, A . (2000). L P S induces apoptosis in macrophages mostly through the autocrine production of TNF-alpha. Blood 95(12): 3823-31. X u , N . , Chen, C. Y . and Shyu, A . B . (1997). Modulation of the fate of cytoplasmic m R N A by A U - r i c h elements: key sequence features controlling m R N A deadenylation and decay. Mol Cell Biol 17(8): 4611-21. Yamamoto, M . , Sato, S., Hemmi, H . , Uematsu, S., Hoshino, K . , Kaisho, T., Takeuchi, O., Takeda, K . and Aki ra , S. (2003). T R A M is specifically involved in the Toll- l ike receptor 4-mediated MyD88-independent signaling pathway. Nat Immunol 4(11): 1144-50. 175 Yang, L . , Wil l iams, D . E. , M u i , A . , Ong, C , Krystal, G . , van Soest, R. and Andersen, R. J. (2005). Synthesis of pelorol and analogues: activators of the inositol 5-phosphatase SHIP. Org Lett 7(6): 1073-6. Yang, R. B . , Mark, M . R., Gray, A . , Huang, A . , X i e , M . H . , Zhang, M . , Goddard, A . , Wood, W . I., Gurney, A . L . and Godowski, P. J. (1998). Toll- l ike receptor-2 mediates lipopolysaccharide-induced cellular signalling. Nature 395(6699): 284-8. Yang, R. B . , Mark, M . R., Gurney, A . L . and Godowski, P. J . (1999). Signaling events induced by lipopolysaccharide-activated toll-like receptor 2. J Immunol 163(2): 639-43. Young, R. E . , Thompson, R. D . and Nourshargh, S. (2002). Divergent mechanisms of action of the inflammatory cytokines interleukin 1-beta and tumour necrosis factor-alpha in mouse cremasteric venules. Br J Pharmacol 137(8): 1237-46. Y u m , H . K . , Arcaroli , J., Kupfher, J., Shenkar, R., Penninger, J. M . , Sasaki, T., Yang, K . Y . , Park, J. S. and Abraham, E . (2001). Involvement of phosphoinositide 3-kinases in neutrophil activation and the development of acute lung injury. J Immunol 167(11): 6601-8. Zhou, K . , Pandol, S., Bokoch, G . and Traynor-Kaplan, A . E . (1998). Disruption of Dictyostelium PI3K genes reduces [32P]phosphatidylinositol 3,4 bisphosphate and [32P]phosphatidylinositol trisphosphate levels, alters F-actin distribution and impairs pinocytosis. J Cell Sci 111 ( Pt 2): 283-94. 176 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0100390/manifest

Comment

Related Items