UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Protein modification in plant innate immunity Goritschnig, Sandra 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-267233.pdf [ 8.08MB ]
Metadata
JSON: 831-1.0100388.json
JSON-LD: 831-1.0100388-ld.json
RDF/XML (Pretty): 831-1.0100388-rdf.xml
RDF/JSON: 831-1.0100388-rdf.json
Turtle: 831-1.0100388-turtle.txt
N-Triples: 831-1.0100388-rdf-ntriples.txt
Original Record: 831-1.0100388-source.json
Full Text
831-1.0100388-fulltext.txt
Citation
831-1.0100388.ris

Full Text

Protein modification in plant innate immunity by Sandra Goritschnig A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Botany) UNIVERSITY OF BRITISH COLUMBIA December 2006 © Sandra Goritschnig, 2006 Abstract Plant diseases cause major crop losses worldwide. Crop protection strategies enhancing the plants' own defence mechanisms could be a sustainable solution to ensure future food supply. This thesis describes my research effort to better understand the innate defence mechanisms in plants. Specific resistance responses towards invading pathogens are mediated by Resistance (R) proteins. They recognize pathogen-derived molecules and activate signalling cascades, initiating physiological responses to limit pathogen spread in infected cells while minimizing harmful effects on the rest of the plant. We use the unique gain-of-function R gene snd as a tool to identify components of resistance signalling in Arabidopsis thaliana. In a screen for suppressors of snc7-mediated constitutive resistance, we identified a number of modifier of snd (mos) mutants. My thesis focuses on the identification and characterization of mos5 and mos8. Both mutations partially suppress snd-associated morphological phenotypes and revert susceptibility to virulent pathogens to wild type levels. mos5 contains a deletion in one of two ubiquitin activating enzyme genes in Arabidopsis. The mutation in mos5 lies in a putative binding domain, potentially disrupting interaction with downstream ubiquitin acceptors. The mos5 single mutant displays enhanced susceptibility to virulent bacteria, as well as to bacteria carrying the effector protease AvrRpt2, indicating a role of ubiquitination in both specific and basal resistance. A mutation in the mos5 homolog UBA2 does not affect resistance, however, a double mutant mos5 uba2 is lethal, indicating that the two genes are partially redundant. mos8 is allelic to enhanced response to abscisic acid 1 (eral), which encodes the beta subunit of protein farnesyltransferase. Mutations in the gene are known to affect development and abscisic acid signalling. mos8 displays enhanced susceptibility to virulent and avirulent pathogens and acts additively with NPR1. Defects in geranylgeranylation, a protein modification similar to farnesylation, do not affect resistance responses against virulent or avirulent pathogens. Taken together, my data reveals the importance of post-translational modification of yet to be identified regulatory proteins in plant innate immunity. Further research will aim at unravelling the mechanisms by which mos5 and mos8 affect resistance signalling. Table of Contents Abstract 11 Table of Contents iv List of Tables vi List of Figures vii List of Abbreviations viii Acknowledgements xi Dedication xiii Co-Authorship Statement xiv 1. Introduction 1 1.1 Non-host resistance in plant immunity 1 1.2 Gene-for-gene resistance 3 1.3 Signalling components in plant immunity 4 1.4 The Arabidopsis suppressor of npr1 -1 constitutive 1 (snd) auto-immune model 7 1.5 Identification of R protein signalling components in a snd suppressor screen 9 1.6 Thesis objectives 10 1.7 References 11 2. The ubiquitin pathway is required for innate immunity in Arabidopsis 16 2.1 Introduction 16 2.2 Results 18 2.2.1 Isolation and genetic analysis of mos5 snd npr1-1 18 2.2.2 Characterization of defence related phenotypes of mos5 snd npr1-1 20 2.2.3 Map-based cloning of mos5 22 2.2.4 The mos5 single mutant displays enhanced disease susceptibility. 25 2.2.5 mos5 exhibits differential susceptibility to avirulent pathogens 25 2.2.6 UBA2 is not required for resistance 27 2.2.7 A mos5 uba2 double mutant is lethal 28 2.2.8 Resistance in snd is independent of SGT1b and RAR1.. 30 2.3 Discussion 32 iv 2.4 Experimental procedures 37 2.4.1 Plant growth and mutant phenotypic characterization 37 2.4.2 Map-based cloning of mos5 38 2.4.3 Complementation of mos5 39 2.4.4 Creating the mos5 single and mos5 uba2 double mutants 39 2.4.5 Creating the snd sgt1b-1 and snd rar1-21 double mutants 40 2.6 References 41 3. A novel role for Arabidopsis farnesyltransferase in plant innate immunity 46 3.1 Introduction 46 3.2 Results 48 3.2.1 mos8 suppresses constitutive resistance in snd npr1-1 48 3.2.2 mos8 contains a mutation in a farnesyltransferase subunit 50 3.2.3 The era1-7 mutation affects the start codon of ERA1 53 3.2.4 eral confers enhanced disease susceptibility 55 3.2.5 eral affects resistance to avirulent pathogens 56 3.2.6 ERA1 acts additively with NPR1 in resistance signalling 59 3.2.7 Geranylgeranylation is not required in defence responses 60 3.3 Discussion 62 3.4 Experimental procedures 66 3.4.1 Plant growth and mutant characterization 66 3.4.2 Pathogen assays 66 3.4.3 Positional cloning of mos8 67 3.4.4 Complementation of mos8 with ERA1 cDNA 67 3.4.5 Generating the era1-7 single and double mutants 68 3.4.6 Identification of homozygous T-DNA mutant plants 68 3.5 References 69 4. Discussion 73 4.1 Use for the auto-immune snd model in plant resistance studies 73 4.2 Identification of novel defence signalling components using snd 74 4.3 Post-translational protein modification in plant defence 75 4.4 Perspectives for future research 76 4.5 Conclusion... 77 4.6 References 78 v List of Tables Table 2.1: T-DNA insertion alleles for UBA1 and UBA2 tested in this study 29 Table 3.1: Allelism test between several era7-alleles and mos8snc1 npr1-1 52 Table 3.2: Multiple eral alleles suppress snd 52 vi List of Figures Figure 1.1. Model of downstream signalling pathways in snd 8 Figure 2.1: Phenotypic characterization of mos5 snd npr1-1 19 Figure 2.2: Suppression of constitutive resistance in mos5 snd npr1-1 21 Figure 2.3: Map-based cloning of mos5 23 Figure 2.4: Alignment of the C-terminal domains of ubiquitin activating enzymes from different species 24 Figure 2.5: Requirement for MOS5 in basal and R protein mediated resistance 26 Figure 2.6: UBA2 is not essential for plant innate immunity 27 Figure 2.7: SGT1b and RAR1 are not required for snd-mediated resistance.... 31 Figure 3.1: mos8 suppresses snd-mediated resistance phenotypes 49 Figure 3.2: mos8 is allelic to eral 50 Figure 3.3: Alignment etc 53 Figure 3.4: The mos8 mutation affects the ERA1 start codon 55 Figure 3.5: mos8 confers enhanced susceptibility to virulent P. syringae and P. parasitica..... 56 Figure 3.6: eral affects R protein signaling 57 Figure 3.7: eral confers enhanced susceptibility to avirulent oomycete pathogens 58 Figure 3.8: mos8 and npr1 act additively to confer enhanced disease susceptibility 59 Figure 3.9: Involvement of geranylgeranylation in defence responses 61 vii List of Abbreviations ABA abscisic acid ABRC Arabidopsis Biological Resource Center ATP adenosine triphosphate Avr avirulence BAC bacterial artificial chromosome bp basepair C cytosine C carboxy CaMV35S Cauliflower Mosaic Virus 35S promoter CC coiled coil cDNA complementary DNA cfu colony forming units DNA deoxyribonucleic acid dpi days post inoculation E1 ubiquitin activating enzyme E2 ubiquitin conjugating enzyme E3 ubiquitin ligase ET ethylene g gram G guanine GTP guanosin triphosphate GUS beta glucuronidase h hour HPLC high performance liquid chromatography HR hypersensitive response JA jasmonic acid kb kilobases LRR leucine rich repeat m milli Mb Megabases MgCI2 magnesium chloride micro ml milliliter mM millimolar mRNA messenger RNA MS Murashige and Skoog N amino NBS nucleotide binding site °C degree Celsius OD6oo optical density at 600 nm P probability P.p. Peronospora parasitica P.s.m. Pseudomonas syringae pv. maculicola P.s.t. Pseudomonas syringae pv. tomato PAMP pathogen associated molecular pattern PCR polymerase chain reaction PFT protein farnesyltransferase PGGT protein geranylgeranyltransferase PR pathogenesis related PRR pathogen recognition receptor R resistance RING really interesting new gene RLK receptor-like kinase RNA ribonucleic acid ROI reactive oxygen intermediates RT-PCR reverse transcriptase polymerase chain reaction RUB related to ubiquitin SA salicylic acid SAIL Syngenta Arabidopsis Insertion Library SAR systemic acquired resistance SUMO small ubiquitin-like modifier TAIR The Arabidopsis Information Resource T-DNA transfer DNA TIR Toll/1 nterleukin 1-receptor TLR Toll-like receptor UTR untranslated region x Acknowledgements I have many things to be thankful for, and many people to acknowledge for all their moral/financial/professional/personal support. O Canada.... My first big "Thank-You!" goes out to my host country with all its natural beauty and friendly people. I have gotten so much more out of my stay than "just" a PhD and I am very grateful for that. Thanks to Carl Douglas for being in Austria when I just finished my Diploma and showing me what a good choice Vancouver would be. Working nine to five... The Li lab has provided me with inspiration, entertainment and endless (more or less scientific) discussions. Dr. Xin Li is a great and very focussed supervisor, primary ingredients for a short and successful PhD. Dr. Yuelin Zhang, with his magic eyes, was always there to phenotype mapping populations. Kris Palma, my twin PhD candidate, was (and is) one of the most dedicated nerds I have ever met. Jacqui Monaghan is the other. Marcel Wiermer and Tabea Weihmann, keep up the German language tradition in the lab! Yu-ti Cheng, "oldest" lab member, thanks for always knowing where everything is. Finally, the lab was practically run by our big group of work-study students, so they deserve mentioning. We are scientists.... The work presented in this thesis wouldn't be the same without the advice from my committee members Drs. Ljerka Kunst, Carl Douglas and Brian Ellis, whose constructive criticism helped a lot in shaping the experiments. Material described in chapters three and four was obtained from several laboratories, and I would xi thus like to thank Drs. Jane Parker, Jeff Dangl, Peter McCourt and Elliott Meyerowitz for donating mutant seeds and other material. Money makes the world go around... I am indebted to the financial support I have received during my PhD, first from the Austrian Academy of Sciences, from which I received a three-year doctoral fellowship (DOC) and afterwards from the UBC Faculty of Graduate Studies, who awarded me with a UBC Graduate Fellowship (UGF). Friends will be friends.... Work wouldn't be the same if you didn't have friends to complain to about it. During my stay I have made many good friends and to write down every one of them would fill a few pages. You know who you are and you know you are in my heart. Bist du ned bei mir.... Daham is daham. Ich mochte mich besonders bei meinen Eltern bedanken, die sich mit meiner ewigen Abwesenheit abgefunden und mich immer unterstutzt haben. Auch meiner ganzen Familie, meinen guten Freunden in aller Herren Lander: Danke, dass es euch gibt. xii QMeinen c^msmuttern QKatharina (in oMemoricm) und ^ Knnemme Co-Authorship Statement The work described in this thesis is the culmination of research from 2003 to 2006. Below is a list of papers that have been accepted for publication or are in preparation as a result of this work, and the contribution made by the candidate: Goritschnig, S., Zhang, Y. and Li, X. The ubiquitin pathway is required for innate immunity in Arabidopsis. Plant J. in press. The candidate performed all experiments described in the paper and wrote the manuscript. Y. Zhang was involved in the mutant screen from which the mutant was isolated and in the map-based cloning of the mutation. X. Li designed the suppressor screen and supervised the work and manuscript preparation. Goritschnig, S., Zhang, Y. and Li, X. A novel role for Arabidopsis farnesyltransferase in plant innate immunity (in preparation). The candidate performed all experiments described and wrote the manuscript. Y. Zhang was involved in the mutant screen from which the mutant was isolated and in the map-based cloning of the mutation. X. Li designed the suppressor screen and supervised the work and manuscript preparation. xiv 1. Introduction Plants provide the basic nutritional resource for most other living organisms on the planet. They are constantly challenged by microbial pathogens, such as bacteria, fungi and viruses and thus have evolved a multi-layered and complex network of defence responses, including physical barriers (e.g. bark and cuticle), pre-formed and de novo produced chemical deterrents (e.g. secondary metabolites and phytoalexins), and pathogen-specific induced responses. In the face of fitness costs of resistance, it is clear that induced defences have to be tightly regulated, and aspects of their genetic basis are currently emerging. In animals, specialized cells of the circulatory blood system, such as lymphocytes or macrophages, execute immune responses. In plants, on the other hand, every cell is a potential target of the attacking pathogen, and thus has to autonomously possess the ability to signal and respond in the case of an infection. In the following section, our current understanding of the different layers of plant defence and a number of important components and signalling cascades identified by molecular biology approaches are reviewed. 1.1 Non-host resistance in plant immunity Despite the large number of potential phyto-pathogenic species, disease is a rare occurrence. The predominant form of plant resistance is the so-called "non-host" resistance, whereby an entire plant species is resistant to a certain pathogen species (Heath, 2000). Non-host resistance is conferred by a number of pre-formed and induced defences that prevent microbial entry and generally provide an unfavourable environment for microbial proliferation. Among the constitutive barriers are cuticular wax layers, antimicrobial secondary metabolites and peptides (Heath, 2000). Recent reports suggest a particularly important role of the plant cell wall in non-host interactions (Schulze-Lefert, 2004). This is not surprising, considering the physico-chemical properties of the cell wall, which shields and stabilizes the protoplast. Cell wall fortification, callose deposition and polarized vesicle transport 1 constitute important inducible responses in non-host resistance to fungal pathogens (Collins et al., 2003; Nishimura et al., 2003). Once a pathogen manages to overcome this first obstacle, it is facing another level of defence that likely contributes to defence against non-host pathogens, induced by general pathogen-associated molecular patterns (PAMPs). PAMPs are molecular structures common to a wide range of microbes important for their specific lifestyles and include chitin, lipopolysaccharides, and bacterial flagellin. These conserved microbial features are recognized by pattern recognition receptors (PRRs), which share similarities between animal and plant kingdoms (Ausubel, 2005). In animals, Toll-like receptors (TLRs) involved in innate immunity are localized on the cell surface and contain extracellular leucine rich repeat domains (LRR), a membrane spanning domain and an intracellular TIR (for Toll/lnterleukin 1-receptor) signalling domain (Underhill and Ozinsky, 2002). Signalling through the TIR domain proceeds using several adaptor molecules and induction of serine/threonine kinases, subsequent translocation of N F K B (nuclear factor kappa B) to the nucleus and induction of defence genes (Beutler et al., 2003). In plants, recognition of PAMPs is accomplished by receptor-like kinases (RLK), which, like TLRs, contain extracellular LRRs, but instead of the intracellular TIR domain possess a serine/threonine kinase domain, which is involved in signal transduction (Dievart and Clark, 2004). Cellular responses triggered by PAMP recognition constitute a plant's basal defence, in which physiological changes, such as changes in ion fluxes, production of reactive oxygen intermediates (ROI) and other signalling molecules occur to limit pathogen spread. Recognition of PAMPs in non-host resistance results in activation of signalling cascades that show significant overlap with those associated with cultivar-specific resistance and are discussed below. 2 1.2 Gene-for-gene resistance In an evolutionary arms race, pathogens have acquired genes encoding effector proteins that are essential for virulence and are believed to function in subverting basal defence responses (Nomura et al., 2005). Plants, in return, have evolved receptors that specifically recognize the virulence action of pathogen effectors, resulting in avirulence of the pathogen and resistance of the plant. This cultivar-specific recognition is best described by the gene-for-gene concept (Flor, 1971), whereby an incompatible interaction is observed when the plant possesses a Resistance (R) gene and the attacking pathogen the cognate Avirulence (Avr) gene. All other compatible interactions, where plants do not recognize pathogen effectors, either because they do not contain the R gene or the pathogen does not have the /Avr-gene, lead to disease (Flor, 1971). The major class of R proteins identified predominantly in Arabidopsis thaliana are cytosolic proteins containing conserved nucleotide-binding site (NBS) and leucine rich repeat (LRR) domains, presumably involved in ATP or GTP binding and hydrolysis and protein-protein interaction, respectively (McHale et al., 2006). The domain architecture of the NBS-LRR proteins is reminiscent of another class of mammalian innate immunity receptors, the intracellular NOD (nucleotide-binding oligomerization domain) proteins, again stressing similarities between plant and animal innate immune signalling (Inohara and Nunez, 2003). Based on their N-terminal domains, NBS-LRR proteins can be further subdivided into Toll-lnterleukin1 receptor (TIR) or coiled-coil (CC) NBS-LRRs, and these subclasses activate distinct but overlapping branches of resistance signalling pathways (Aarts et al., 1998). The sequenced Arabidopsis genome contains approximately 150 NBS-LRR genes, a small number for the vast diversity of potentially invading pathogens (Meyers et al., 2003). In vivo physical interaction between R protein and pathogen Avr elicitor has only been shown in a few instances (Jia et al., 2000; Deslandes et al., 2003). In the majority of cases, recognition of pathogen elicitors occurs indirectly. In the guard model described initially by van der Biezen and Jones, R proteins are hypothesized to monitor (or "guard") a small set of host proteins, which function as pathogen 3 effector targets and might play a role in basal resistance (Van der Biezen and Jones, 1998). Modification of guarded proteins by the pathogen effector results in activation of the R protein and a defence response. In the absence of the respective R protein, the effectors provide a selective advantage for the pathogen in colonization of the host, by suppressing host basal defences and/or promoting disease (Chang et al., 2004). The activation of R proteins triggers rapid physiological changes in the plant cell, similar to the ones triggered by PAMP recognition. These include redox changes, production of signal molecules such as ROI or salicylic acid (SA), and induction of defence gene transcription. Those responses usually culminate in localized cell death at the site of infection, referred to as the hypersensitive response (HR), which limits pathogen spread. Race-specific resistance signalling is thought to be superimposed on the basal defence response, which acts more slowly and at a lower amplitude to restrict pathogen growth (Dangl and Jones, 2001; Tao et al., 2003; Eulgem et al., 2004). Our understanding of how recognition of pathogens by NBS-LRR R proteins is transduced into a defence response is the focus of intensive investigations. Several regulators of plant disease resistance have been identified, and their potential functions shed light on signalling events involved in R protein mediated defence. 1.3 Signalling components in plant immunity A series of elegant genetic screens were applied to identify components of resistance signalling pathways, some of which were also shown to be involved in basal defence. According to the "guard" hypothesis, NBS-LRR R proteins act within macromolecular complexes (Shirasu and Schulze-Lefert, 2003). Their abundance and activity has to be tightly regulated to avoid inappropriate defence responses and the associated fitness costs. R protein complex association and stability has been shown to depend on several chaperonins. Heat shock protein 90 (Hsp90) interacts with several NBS-LRR proteins and has been shown to be essential for their function (Hubert et al., 2003; Lu et al., 2003; Liu et al., 2004). Hsp90 might act as a chaperonin to stabilize the 4 protein and/or complex in anticipation of elicitation. Required for Mla12 Resistance 1 (RAR1) and Suppressor of G2 Allele of SKP1 1b (SGT1b) were independently identified as essential components in responses by several R proteins (Azevedo et al., 2002; Muskett et al., 2002). Together with Hsp90 they have subsequently been shown to associate with and to affect stability of some R protein complexes (Hubert et al., 2003; Bieri et al., 2004; Holt et al., 2005). Together they appear to function to maintain a certain R protein threshold level, enough for rapid initiation of defence upon pathogen recognition, but too little to cause deleterious effects due to inappropriate activation of defence responses (Bieri et al., 2004; Azevedo et al., 2006). The detrimental impact of inappropriate activation has been shown for the R protein RPS2 (Resistance to Pseudomonas syringae 2), which is activated upon disappearance of its negative regulator RIN4 (RPM1 interacting protein 4). In a rin4 null mutant RPS2 is hyperactivated, resulting in the death of the plant (Mackey et al., 2003). RIN4, a protein that physically interacts with the two R proteins RPM1 (Resistance to Pseudomonas syringae pv. maculicola 1) and RPS2, serves as an excellent example of the "guard hypothesis", as it is a direct target of several pathogen effectors that differentially modify RIN4 to suppress basal defence. Infection with Pseudomonas syringae carrying the effectors AvrB or AvrRPMI triggers phosporylation of RIN4 resulting in activation of RPM1-mediated defence responses (Mackey et al., 2002). RIN4 is also a target for proteolytic cleavage by the cysteine protease AvrRpt2, and subsequent degradation of RIN4 results in activation of RPS2-mediated resistance (Mackey et al., 2003; Kim et al., 2005). Other examples of R protein activation through proteolytic activity of bacterial effectors are RPS5 in Arabidopsis and Cf-2 in tomato. RPS5 is activated upon cleavage of the protein kinase PBS1 (avrPphB susceptible 1) by the P. syringae effector AvrPphB. However, direct interaction between RPS5 and PBS1 has not been documented (Shao et al., 2003). The resistance of tomato against the fungal pathogen Cladosporium fulvum carrying the effector Avr2 depends on the R protein Cf-2. Cf-2 is a transmembrane protein with extracellular LRRs involved in indirect recognition of the pathogen effector, which requires the secreted plant protease Rcr3 (Thomas et al., 1998; Rooney et al., 2005). 5 Apart from these direct and indirect R protein interactors primarily involved in R protein activation, a number of downstream components of resistance signalling pathways have been identified. The membrane-localized protein NDR1 (non-race-specific disease resistance 1) is required for resistance mediated by the CC-NBS-LRR R proteins RPM1, RPS2 and RPS5, and its overexpression results in enhanced disease resistance (Century et al., 1995; Aarts et al., 1998; Coppinger et al., 2004). TIR-NBS-LRR proteins require the action of EDS1 (Enhanced Disease Susceptibility 1), which was first identified as a suppressor of RPP5 (Resistance to Peronospora parasitica 5) mediated resistance towards pathogenic oomycetes (Parker et al., 1996). EDS1 forms temporally and spatially distinct associations with its homologs PAD4 (PhytoAlexin Deficient 4) and SAG101 (Senescence Associated Gene 101), and these distinct complexes are important in basal defence signalling, particularly in promoting the HR (Feys et al., 2001; Feys et al., 2005; Wiermer et al., 2005). The EDS1 protein associations might shuttle between the nucleus and cytoplasm, however, their biochemical role in resistance responses remain to be determined. EDS1 and PAD4 are required for induced production of the signalling molecule salicylic acid (SA) upon R protein activation (Feys et al., 2001). SA accumulation is required to potentiate defence responses and to propagate systemic acquired resistance (SAR; Vernooij et al., 1994; Shah, 2003). SAR is a durable state of heightened resistance in distal parts of the plant that is brought on by a primary infection (Ryals et al., 1996). Mutants with defects in pathogen-inducible SA-production, such as sid2 (salicylic acid induction deficient 2; Nawrath and Metraux, 1999; Wildermuth et al., 2001) or eds5 (Nawrath et al., 2002), do not accumulate SA and are defective in mounting appropriate local and systemic defence responses. In addition to its role in transducing defence responses to biotrophic pathogens, SA also acts antagonistically to responses mediated by the jasmonic acid/ethylene (JA/ET) signalling pathway controlling defences against necrotrophic pathogens and herbivores (Glazebrook et al., 2003). NPR1 (non-expressor of pathogenesis related genes 1) is an important signalling component downstream of SA induction. Mutant npr1 alleles were identified in several screens, looking for non-responsiveness to SA or lack of SA-induced resistance (Cao et al., 1994; Ryals et al., 1997; Shah etal., 1997). NPR1 6 oligomerizes in the cytosol and SA-induced redox changes cause hydrolysis of the connecting disulphide bonds, allowing NPR1 monomers to translocate to the nucleus where they bind to a subclass of TGA transcription factors to activate transcription of PR genes (Zhang et al., 1999; Mou et al., 2003). A number of additional regulatory genes with a variety of potential roles in resistance have been identified, but much work is still necessary to further define signal transduction cascades and to identify correlations between gene expression patterns and disease resistance. 1.4 The Arabidopsis suppressor of nprl-1 constitutive 1 (snd) auto-immune model In an effort to dissect the involvement of NPR1 in plant defence signalling, a suppressor screen for mutations that restore SA responsiveness was conducted. Two classes of suppressors of npr7-mediated abrogation of SA-induced resistance were identified. One class is represented by snil (suppressor of npr1-1 inducible 1), a novel transcriptional repressor, which restored the SA responsiveness of the npr1-1 mutant (Li et al., 1999; Mosher et al., 2006). The other class constitutively suppresses npr?-associated phenotypes, even without induction by SA. The first mutant cloned in the second class was suppressor of npr1-1 constitutive 1 (snd), which encodes a TIR-NBS-LRR R protein homolog of RPP5, located in the RPP4 cluster of R genes on chromosome 4 (Parker et al., 1997; Noel et al., 1999; Li et al., 2001a; van der Biezen et al., 2002; Zhang et al., 2003). A point mutation resulting in a Glu to Lys amino acid change in the linker region between the NBS and LRR domains renders the snd R protein constitutively active even without pathogen presence (Zhang et al., 2003). Interestingly, a similar mutation in the linker region of the human NBS-LRR protein NOD2 has been associated with the auto-inflammatory Crohn's disease (Eckmann and Karin, 2005; Inohara et al., 2005), implying conserved mechanisms in NBS-LRR protein activation (Belkhadir et al., 2004). The constant state of alertness in the snd plants presumably results in mis-allocation of resources, thus affecting development of the snd mutant plant. In addition to dwarf and curly leaf morphology, snd exhibits constitutive expression of several 7 pathogen-responsive PR genes and increased levels of endogenous SA, which is required for the manifestation of the snd phenotypes. Furthermore, and most importantly, snd displays enhanced resistance to virulent biotrophic bacterial and oomycete pathogens (Li et al., 2001a; Zhang et al., 2003). Epistasis analyses have identified signalling components important for snd-mediated constitutive resistance. Like other R proteins of the TIR-NBS-LRR class, snd signalling is fully dependent on EDS1 and PAD4 (Li et al., 2001a; Zhang et al., 2003). The increased endogenous levels of SA in the snd mutant favoured a model in which s/icf-mediated resistance is caused by high levels of this signal molecule. However, mutants impaired in SA production, such as eds5, are unable to fully suppress snd associated phenotypes, indicating the existence of an SA-independent branch of signalling downstream of snd (Figure 1.1; Zhang et al., 2003). Figure 1.1. Model of downstream signalling pathways in snd. Known regulators are indicated and explained in the text, snd signaling involves pathways both dependent and independent of SA and NPR1. Question marks indicate potential positions for regulators identified in the snd suppressor screen. sncl PR genes, resistance PR genes, resistance 8 The fact that some of the known components of plant defence signalling also affect snc7-mediated resistance and the finding that snc7-signalling likely involves a complicated network of signalling pathways, incited the use of snd as a unique model for auto-immunity in plants. The identification of novel components required for snd signalling would increase our understanding of both basal and R protein defence signalling pathways. One way to identify such components is using a suppressor screen approach. 1.5 Identification of R protein signalling components in a snd suppressor screen Most of the previously identified defence signalling components were discovered based on greatly enhanced disease resistance or susceptibility. Mutations in defence genes which only have a subtle effect on disease severity, or which are redundant, were missed by such attempts. Complete and partial suppression of sncZ-associated phenotypes in epistasis analyses with edsl and eds5, respectively, suggested the use of the unique snd innate immune model for the identification of novel players in plant immunity. Mutations in genes required for signal transduction of the constitutively active R protein snd can be identified based on suppression of the easily visible snd-mediated morphological phenotype. Fast-neutron mutagenesis, a method which mainly causes deletion mutations (Li et al., 2001b), of snd and snd npr1-1 seeds created a population of potential suppressors, which restore wild-type morphology and abolish constitutive PR gene expression. Because this approach uses an activated R protein in the background, it could be expected that suppressor mutants identified in this screen would include loss-of-function alleles of novel positive regulators with specific roles in defence responses. Mutagenesis of snd and snd npr1-1 seeds was used in parallel in an attempt to isolate suppressors acting on different branches of the snd signalling pathways, dependent or independent of NPR1. In the initial screen, 15 complementation groups of modifier of snd (mos) mutants were isolated, including several alleles of pad4, demonstrating the efficiency of the applied selection scheme. 9 1.6 Thesis objectives The primary aim of the work presented here was the identification of genes involved in R protein mediated and basal defence signalling, which is crucial for understanding the basic mechanisms of resistance. Using the snd Arabidopsis auto-immune model, it is possible to isolate mutations in genes that were previously unknown to be important in defence signalling. During a screen for suppressors of s/7c7-mediated morphology and resistance in snd npr1-1, a number of mutants were identified. For the screen, snd npr1 double mutant seeds were mutagenized by fast-neutron bombardment (60 Gy) by Andrea Kodym (Agriculture and Biotechnology Laboratory, International Atomic Energy Agency, Vienna, Austria). Mi plants were allowed to self-pollinate and seeds of 10-20 plants were pooled. M 2 plants were screened for bigger size and wild-type morphology. Seeds of those putative suppressors were collected and examined for lack of expression of the pBGL2-GUS reporter gene. Semi-dominant mutations isolated in the screen comprised mainly deletions in the SNC1 gene, reverting the effects of the gain-of-function mutation in snd (Zhang et al., 2003). This screen also yielded a number of recessive mutants, which suppressed the snd npr1-1 phenotypes either completely or partially, and were chosen for further studies. This work describes the identification, positional cloning and in-depth characterization of two mos mutants, mos5 and mos8, isolated in the snd npr1-1 background. Both mutations suppress snc7-mediated phenotypes partially and affect R protein mediated and basal defences. Pleiotropic phenotypes of the mutants indicate the existence of tightly regulated and interconnected signalling networks integrating development and responses to biotic and abiotic stresses. 10 1.7 References Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J., and Parker, J.E. (1998). Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proc Natl Acad Sci USA 95,10306-10311. Ausubel, F.M. (2005). Are innate immune signaling pathways in plants and animals conserved? Nat Immunol 6, 973-979. Azevedo, C , Sadanandom, A., Kitagawa, K., Freialdenhoven, A., Shirasu, K., and Schulze-Lefert, P. (2002). The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science 295, 2073-2076. Azevedo, C , Betsuyaku, S., Peart, J., Takahashi, A., Noel, L., Sadanandom, A., Casais, C , Parker, J. , and Shirasu, K. (2006). Role of SGT1 in resistance protein accumulation in plant immunity. EMBO J 25, 2007-2016. Belkhadir, Y., Subramaniam, R., and Dangl, J.L. (2004). Plant disease resistance protein signaling: NBS-LRR proteins and their partners. Curr Opin Plant Biol 7, 391-399. Beutler, B., Hoebe, K., Du, X., and Ulevitch, R.J. (2003). How we detect microbes and respond to them: the Toll-like receptors and their transducers. J Leukoc Biol 74, 479-485. Bieri, S., Mauch, S., Shen, Q.H., Peart, J. , Devoto, A., Casais, C , Ceron, F., Schulze, S., Steinbiss, H.H., Shirasu, K., and Schulze-Lefert, P. (2004). RAR1 positively controls steady state levels of barley MLA resistance proteins and enables sufficient MLA6 accumulation for effective resistance. Plant Cell 16, 3480-3495. Cao, H., Bowling, S.A., Gordon, A.S., and Dong, X. (1994). Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell 6, 1583-1592. Century, K., Holub, E., and Staskawicz, B. (1995). NDR1, a locus of Arabidopsis thaliana that is required for disease resistance to both a bacterial and a fungal pathogen. Proc Natl Acad Sci USA 92, 6597-6601. Chang, J.H., Goel, A.K., Grant, S.R., and Dangl, J.L. (2004). Wake of the flood: ascribing functions to the wave of type III effector proteins of phytopathogenic bacteria. Curr Opin Microbiol 7, 11-18. Collins, N.C., Thordal-Christensen, H., Lipka, V., Bau, S., Kombrink, E., Qiu, J.L., Huckelhoven, R., Stein, M., Freialdenhoven, A., Somerville, S.C., and Schulze-Lefert, P. (2003). SNARE-protein-mediated disease resistance at the plant cell wall. Nature 425, 973-977. Coppinger, P., Repetti, P.P., Day, B., Dahlbeck, D., Mehlert, A., and Staskawicz, B.J. (2004). Overexpression of the plasma membrane-localized NDR1 protein results in enhanced bacterial disease resistance in Arabidopsis thaliana. Plant J 40, 225-237. 11 Dangl, J.L., and Jones, J.D. (2001). Plant pathogens and integrated defence responses to infection. Nature 411, 826-833. Deslandes, L., Olivier, J. , Peeters, N., Feng, D.X., Khounlotham, M., Boucher, C , Somssich, I., Genin, S., and Marco, Y. (2003). Physical interaction between RRS1-R, a protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus. Proc Natl Acad Sci USA 100, 8024-8029. Dievart, A., and Clark, S.E. (2004). LRR-containing receptors regulating plant development and defense. Development 131, 251-261. Eckmann, L., and Karin, M. (2005). NOD2 and Crohn's disease: loss or gain of function? Immunity 22, 661-667. Eulgem, T., Weigman, V.J., Chang, H.-S., McDowell, J.M., Holub, E.B., Glazebrook, J. , Zhu, T., and Dangl, J.L. (2004). Gene Expression Signatures from three genetically separable resistance gene signaling pathways for downy mildew resistance. Plant Physiol. 135, 1129-1144. Feys, B.J., Moisan, L.J., Newman, M.A., and Parker, J.E. (2001). Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. Embo J 20, 5400-5411. Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina-Escobar, N., Neu, C , Cabral, A., and Parker, J.E. (2005). Arabidopsis SENESCENCE-ASSOCIATED GENE101 stabilizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY 1 complex in plant innate immunity. Plant Cell 17,2601-2613. Flor, H.H. (1971). Current status of the gene-for-gene concept. Annu Rev Phytopathol 9, 275-296. Glazebrook, J., Chen, W., Estes, B., Chang, H.S., N a wrath, C , Metraux, J.P., Zhu, T., and Katagiri, F. (2003). Topology of the network integrating salicylate and jasmonate signal transduction derived from global expression phenotyping. Plant J 34, 217-228. Heath, M.C. (2000). Nonhost resistance and nonspecific plant defenses. Curr Opin Plant Biol 3, 315-319. Holt, B.F., 3rd, Belkhadir, Y., and Dangl, J.L. (2005). Antagonistic control of disease resistance protein stability in the plant immune system. Science 309, 929-932. Hubert, D.A., Tornero, P., Belkhadir, Y., Krishna, P., Takahashi, A., Shirasu, K., and Dangl, J.L. (2003). Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. EMBO J 22, 5679-5689. Inohara, N., and Nunez, G. (2003). NODs: intracellular proteins involved in inflammation and apoptosis. Nat Rev Immunol 3, 371-382. Inohara, N., Chamaillard, M., McDonald, C , and Nunez, G. (2005). NOD-LRR proteins: role in host-microbial interactions and inflammatory disease. Annu Rev Biochem 74, 355-383. 12 Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. (2000). Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J 19, 4004-4014. Kim, H.S., Desveaux, D., Singer, A.U., Patel, P., Sondek, J., and Dangl, J.L. (2005). The Pseudomonas syringae effector AvrRpt2 cleaves its C-terminally acylated target, RIN4, from Arabidopsis membranes to block RPM1 activation. Proc Natl Acad Sci USA 102, 6496-6501. Li, X., Clarke, J.D., Zhang, Y., and Dong, X. (2001a). Activation of an EDS1-mediated R-gene pathway in the snd mutant leads to constitutive, NPR1-independent pathogen resistance. Mol Plant Microbe Interact 14, 1131-1139. Li, X., Zhang, Y., Clarke, J.D., Li, Y., and Dong, X. (1999). Identification and cloning of a negative regulator of systemic acquired resistance, SNI1, through a screen for suppressors of npr1-1. Cell 98, 329-339. Li, X., Song, Y., Century, K., Straight, S., Ronald, P., Dong, X., Lassner, M., and Zhang, Y. (2001b). A fast neutron deletion mutagenesis-based reverse genetics system for plants. Plant J 27, 235-242. Liu, Y., Burch-Smith, T., Schiff, M., Feng, S., and Dinesh-Kumar, S.P. (2004). Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. J Biol Chem 279, 2101-2108. Lu, R., Malcuit, I., Moffett, P., Ruiz, M.T., Peart, J. , Wu, A.J., Rathjen, J.P., Bendahmane, A., Day, L., and Baulcombe, D.C. (2003). High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO J 22, 5690-5699. Mackey, D., Holt, B.F., Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108, 743-754. Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. (2003). Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112, 379-389. McHale, L., Tan, X., Koehl, P., and Michelmore, R.W. (2006). Plant NBS-LRR proteins: adaptable guards. Genome Biol 7, 212. Meyers, B.C., Kozik, A., Griego, A., Kuang, H., and Michelmore, R.W. (2003). Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis. Plant Cell 15, 809-834. Mosher, R.A., Durrant, W.E., Wang, D., Song, J., and Dong, X. (2006). A comprehensive structure-function analysis of Arabidopsis SNI1 defines essential regions and transcriptional repressor activity. Plant Cell 18,1750-1765. Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113, 935-944. 13 Muskett, P.R., Kahn, K., Austin, M.J., Moisan, L.J., Sadanandom, A., Shirasu, K., Jones, J.D.G., and Parker, J.E. (2002). Arabidopsis RAR1 exerts rate-limiting control of R gene-mediated defenses against multiple pathogens. Plant Cell 14, 979-992. Nawrath, C , and Metraux, J.P. (1999). Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 11, 1393-1404. Nawrath, C , Heck, S., Parinthawong, N., and Metraux, J.P. (2002). EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the MATE transporter family. Plant Cell 14, 275-286. Nishimura, M.T., Stein, M., Hou, B.H., Vogel, J.P., Edwards, H., and Somerville, S.C. (2003). Loss of a callose synthase results in salicylic acid-dependent disease resistance. Science 301, 969-972. Noel, L., Moores, T.L., van Der Biezen, E.A., Parniske, M., Daniels, M.J., Parker, J.E., and Jones, J.D. (1999). Pronounced intraspecific haplotype divergence at the RPP5 complex disease resistance locus of Arabidopsis. Plant Cell 11, 2099-2112. Nomura, K., Melotto, M., and He, S.Y. (2005). Suppression of host defense in compatible plant-Pseucfomonas syringae interactions. Curr Opin Plant Biol 8, 361-368. Parker, J.E., Holub, E.B., Frost, L.N., Falk, A., Gunn, N.D., and Daniels, M.J. (1996). Characterization of edsl, a mutation in Arabidopsis suppressing resistance to Peronospora parasitica specified by several different RPP genes. Plant Cell 8, 2033-2046. Parker, J.E., Coleman, M.J., Szabo, V., Frost, L.N., Schmidt, R., van der Biezen, E.A., Moores, T., Dean, C , Daniels, M.J., and Jones, J. (1997). The Arabidopsis downy mildew resistance gene RPP5 shares similarity to the Toll and interleukin-1 receptors with N and L6. Plant Cell 9, 879-894. Rooney, H.C., Van't Klooster, J.W., van der Hoorn, R.A., Joosten, M.H., Jones, J.D., and de Wit, P.J. (2005). Cladosporium Avr2 inhibits tomato Rcr3 protease required for Cf-2-dependent disease resistance. Science 308, 1783-1786. Ryals, J., Weymann, K., Lawton, K., Friedrich, L, Ellis, D., Steiner, H.Y., Johnson, J., Delaney, T.P., Jesse, T., Vos, P., and Uknes, S. (1997). The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor I kappa B. Plant Cell 9, 425-439. Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.Y., and Hunt, M.D. (1996). Systemic acquired resistance. Plant Cell 8, 1809-1819. Schulze-Lefert, P. (2004). Knocking on the heaven's wall: pathogenesis of and resistance to biotrophic fungi at the cell wall. Curr Opin Plant Biol 7, 377-383. Shah, J. (2003). The salicylic acid loop in plant defense. Curr Opin Plant Biol 6, 365-371. 14 Shah, J. , Tsui, F., and Klessig, D.F. (1997). Characterization of a salicylic acid-insensitive mutant (sail) of Arabidopsis thaliana, identified in a selective screen utilizing the SA-inducible expression of the tms2 gene. Mol Plant Microbe Interact 10, 69-78. Shao, F., Golstein, C , Ade, J. , Stoutemyer, M., Dixon, J.E., and Innes, R.W. (2003). Cleavage of Arabidopsis PBS1 by a bacterial type III effector. Science 301,1230-1233. Shirasu, K., and Schulze-Lefert, P. (2003). Complex formation, promiscuity and multi-functionality: protein interactions in disease-resistance pathways. Trends Plant Sci 8, 252-258. Tao, Y., Xie, Z., Chen, W., Glazebrook, J., Chang, H.S., Han, B., Zhu, T., Zou, G., and Katagiri, F. (2003). Quantitative nature of Arabidopsis responses during compatible and incompatible interactions with the bacterial pathogen Pseudomonas syringae. Plant Cell 15, 317-330. Thomas, CM., Dixon, M.S., Parniske, M., Golstein, C , and Jones, J.D. (1998). Genetic and molecular analysis of tomato Cf genes for resistance to Cladosporium fulvum. Philos Trans R Soc Lond B Biol Sci 353,1413-1424. Underhill, D.M., and Ozinsky, A. (2002). Toll-like receptors: key mediators of microbe detection. Curr Opin Immunol 14,103-110. Van der Biezen, E.A., and Jones, J.D. (1998). Plant disease-resistance proteins and the gene-for-gene concept. Trends Biochem Sci 23, 454-456. van der Biezen, E.A., Freddie, C.T., Kahn, K., Parker, J.E., and Jones, J.D. (2002). Arabidopsis RPP4 is a member of the RPP5 multigene family of TIR-NB-LRR genes and confers downy mildew resistance through multiple signalling components. Plant J 29, 439-451. Vernooij, B., Uknes, S., Ward, E., and Ryals, J. (1994). Salicylic acid as a signal molecule in plant-pathogen interactions. Curr Opin Cell Biol 6, 275-279. Wiermer, M., Feys, B.J., and Parker, J.E. (2005). Plant immunity: the EDS1 regulatory node. Curr Opin Plant Biol 8, 383-389. Wildermuth, M.C., Dewdney, J. , Wu, G., and Ausubel, F.M. (2001). Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414, 562-565. Zhang, Y., Goritschnig, S., Dong, X., and Li, X. (2003). A gain-of-function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1. Plant Cell 15, 2636-2646. Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proc Natl Acad Sci USA 96, 6523-6528. 15 2. The ubiquitin pathway is required for innate immunity in Arabidopsis1 2.1 Introduction Plants are constantly challenged by a variety of biotic and abiotic stresses, and have evolved a range of sophisticated mechanisms to cope with them. Attacking pathogens often encounter an unfavorable environment or preformed defences in non-host plants. On host plants, the pathogens can either cause disease or are recognized and rapidly contained at the site of infection by a mechanism usually involving the programmed death of the cells surrounding the infection, referred to as hypersensitive response (HR) (Hammond-Kosack and Jones, 1996; Nimchuk et al., 2003) . This specific recognition of pathogens is mediated by Resistance (R) gene products, which directly or indirectly interact with pathogen derived avirulence (Avr) gene products to induce a resistance response. R proteins are proposed to associate into multimolecular complexes and most likely sense the presence of the pathogen indirectly through the action of its elicitors in the host cell (Belkhadir et al., 2004) . Most R genes encode proteins with highly conserved structural domains, which are also frequently found in mammalian immune system modules (Dangl and Jones, 2001; Ausubel, 2005). For example, the majority of R proteins share a central nucleotide binding site (NBS) domain, and carboxy terminal leucine rich repeats (LRR), similar to mamalian NOD proteins involved in innate immunity (Inohara et al., 2005) . The amino-terminal portions distinguish two classes of R proteins: those containing the Toll/lnterleukin1-receptor-like (TIR) domain with high homology to the cytoplasmic signalling domain of mammalian and Drosophila Toll-like receptors, involved in recognizing microbe-specific antigens in innate immunity (Athman and Philpott, 2004), or proteins with a coiled coil (CC) motif potentially involved in protein-protein interactions (Burkhard et al., 2001; Martin et al., 2003; Belkhadir et al., 2004). ' A version of this chapter has been accepted for publication. Goritschnig, S., Zhang, Y. and Li, The Ubiquitin pathway is required for innate immunity in Arabidopsis. Plant Journal, in press. 16 Upon recognition of the cognate avirulence elicitor, TIR-NBS-LRR and CC-NBS-LRR R proteins activate a range of defence responses. Their requirements of downstream regulators are sometimes, but not always, overlapping. Generally, signalling downstream of TIR-NBS-LRR R proteins is dependent on the lipase-like protein EDS1, whereas CC-NBS-LRR R proteins depend on NDR1 (Aarts et al., 1998). Other signalling components, such as RAR1, SGT1b and Hsp90, are shared by TIR and CC class R protein pathways (Hubert et al., 2003; Muskett and Parker, 2003; Takahashi et al., 2003). RAR1 and SGT1b were independently identified in screens for suppressors of various R gene mediated responses (Shirasu et al., 1999; Austin et al., 2002; Tor et al., 2002; Tornero et al., 2002). In Arabidopsis, both are required for resistance conferred by RPP5 (Resistance to Peronospora Parasitica 5) (Austin et al., 2002). Recent studies have revealed the direct interaction between several R Proteins and SGT1b (Bieri et al., 2004; Leister et al., 2005) as well as Hsp90 (Liu et al., 2004). No direct interaction has been reported between RAR1 and R proteins, but RAR1 interacts with both Hsp90 and SGT1b and might thus be indirectly involved in the assembly and stability of R protein complexes (Bieri et al., 2004; Azevedo et al., 2006). RAR1 and SGT1b have also been shown to act antagonistically as positive and negative regulators, respectively, on R protein accumulation prior to infection (Holtetal., 2005). A gain-of-function mutation in a close homolog of RPP5, suppressor of npr1-1 constitutive 1 (snd), results in constitutive activation of basal defence responses manifested as resistance to the virulent pathogens Pseudomonas syringae pv. maculicola (P.s.m.) ES4326 and Peronospora parasitica (P.p.) Noco2, elevated levels of the endogenous signalling molecule salicylic acid (SA) and dwarf morphology (Li et al., 2001; Zhang et al., 2003). As opposed to other constitutively resistant mutants, snd does not exhibit spontanous lesions. However, like other TIR-NBS-LRR R genes, sftcf-mediated resistance fully depends on functional EDS1 and PAD4, but is only partially dependent on SA accumulation (Li et al., 2001; Zhang etal., 2003). To further understand the signalling downstream of TIR-NBS-LRR R-proteins, a suppressor screen was performed in the snd and snd npr1-1 backgrounds. This 17 screen identified a number of modifier of snd (mos) mutants, including several alleles of pad4. The identities of MOS3 (a putative nucleoporin 96; (Zhang and Li, 2005) and MOS6 (an importin alpha 3 homolog; (Palma et al., 2005) reveal an essential role for nucleo-cytoplasmic trafficking in resistance signalling. MOS2, a nuclear protein with putative RNA-binding motifs, highlights the importance of RNA processing in plant innate immunity (Zhang et al., 2005). Here, we report the identification and cloning of mos5, a modifier of constitutive disease resistance in snd, which suppresses snc7-associated phenotypes and shows differential responses to avirulent bacteria. Cloning of MOS5 revealed that it encodes an essential component of the ubiquitin pathway and implicates a requirement for ubiquitination in R protein signalling. We also show that the resistance regulators RAR1 and SGT1b are not required for sr?c7-mediated constitutive resistance. 2.2 Results 2.2.1 Isolation and genetic analysis of mos5 snd npr1-1 The screen for suppressors of sncf-mediated resistance has been previously described (Zhang and Li, 2005). mos5 was identified in the snd npr1-1 double mutant background based on its ability to revert snd morphology to wild type and to abolish constitutive expression of the pBGL2-GUS reporter transgene (Figure 2.1 a,b). Lack of sncZ-induced constitutive expression of pathogenesis related genes in mos5 snd npr1-1 was further confirmed by semi-quantitative RT-PCR (Figure 2.1 c). When mos5 snd npr1-1 was backcrossed with snd npr1-1, F i progeny displayed the characteristic snd morphology indicating that the mutation is recessive, and GUS-staining of the F 2 progeny segregated 75:21 (staining.non-staining), demonstrating that the phenotype of mos5 is caused by a single recessive mutation (expected 3:1, x2 = 0.5, P = 0.48). 18 Figure 2.1: Phenotypic characterization of mos5 snd npr1-1 (a) Morphology of soil grown plants. The picture was taken 5 weeks after planting, (b) Expression of pBGL2-GUS reporter gene. 20-day-old seedlings grown on MS plates were stained for GUS activity, (c) Semi-quantitative RT-PCR of pathogenesis-related genes. RNA was extracted from 20-day-old seedlings grown on MS-plates and reverse transcribed to obtain total cDNA. The cDNA samples were normalized using the actin probe (Zhang ef al., 2003). PR1, PR2 and Actin were PCR-amplified in 30 cycles using equal amounts of cDNA. 19 2.2.2 Characterization of defence related phenotypes of mos5 snd npr1-1 Salicylic acid (SA) is an important signalling molecule in plant defence responses and is associated with systemic resistance (Ryals et al., 1996; Durrant and Dong, 2004). snd npr1-1 mutant plants have high endogenous levels of SA (Li et al., 2001). The mos5 snd npr1-1 mutant exhibits an approximately 12-fold reduction in endogenous levels of both free and total SA as compared to snd nprl-1 (Figure 2.2 a,b). However, the mutant still displays 10 and 5-fold higher levels of SA than either Col-0 or the npr1-1 single mutant, respectively. This indicates that suppression of high SA levels in snd by mos5 is not complete. The snd npr1-1 double mutant exhibits enhanced resistance to the virulent pathogens P.p. Noco2 and P.s.m. ES4326 as compared to Col-0 wild type (Li et al., 2001). To investigate the role of MOSS in disease resistance, plants were inoculated with either pathogen. The mos5 mutation suppresses sncY-mediated constitutive resistance to P.p. Noco2, resulting in wild type susceptibility (Figure 2.2 c). Furthermore, mos5 snd npr1-1 supports wild type levels of growth of P.s.m. ES4326 (Figure 2.2 d), however, the mutation is not sufficient to restore npr1-\'\ke susceptibility against the bacterial pathogen, again indicating that suppression of snd by mos5 is incomplete. Taken together, these results demonstrate that the mutation in MOS5 strongly impairs defence signalling in snd npr1-1, affecting responses to bacterial and oomycete pathogens as well as accumulation of SA. 20 P.s.m ES4326 30 25 plant 20 u— O 15 mber 10 5 5 • snd npr1-1 Col-0 • mos5snc1 npr1-1 2 3 4 Disease rating Figure 2.2: Suppression of constitutive resistance in mos5snc1 npr1-1 (a,b) Levels of endogenous SA are reduced in mos5 snd npr1-1. Free (a) and total (b) SA was extracted from 5-week-old soil grown plants and analyzed with HPLC. (c,d) mos5 suppresses resistance against virulent oomycete and bacterial pathogens. Bars represent the average of four (a,b) and six (c) biological replicates, error bars represent standard deviation, (c) two-week-old seedlings were infected with Peronospora parasitica Noco2 conidiospores (10 /ml) and disease symptoms were assessed and rated 7 days post-inoculation (dpi) as follows: 0 - no conidiophores on entire plant; 1 - at least one leaf with 1-5 conidiophores; 2 - some infected leaves with 6-20 conidiophores, but most with 1-5; 3 - most infected leaves with 6-20 conidiophores; 4 - all infected leaves with >5 conidiophores, or most infected leaves with >20; 5 - all infected leaves with >20 conidiophores. (d) 4-week-old plants were infected with Pseudomonas syringae pv. maculicola ES4326 (OD 6 0 0 = 0.0001) and bacterial growth was measured by quantifying colony forming units (cfu) at day 0 and day 3. Experiments were repeated at least twice with similar results. 21 2.2.3 Map-based cloning of mosS In order to map the recessive modifier of snd in the Col-0 ecotype, mos5 snd npr1-1 was crossed with Ler-snc/, in which snd had been introgressed into the Landsberg erecta ecotype by repeated backcrossing as described previously (Zhang and Li, 2005). Using 68 plants homozygous for mos5 from the F 2 progeny of the mapping cross, the approximate position of mos5 was determined to be between markers T8018 (12.28 Mb) and T16B12 (13.25 Mb) on the lower arm of Chromosome 2 (Figure 2.3 a). The progeny of F 2 plants heterozygous for mos5 and homozygous for the pBGL2-GUS transgene were used for fine mapping. Out of 747 F 3 plants, 46 recombinants between markers T8018 and T16B12 were identified. The phenotypes of these recombinants were confirmed by following segregation of the F 4 progeny on soil as well as with GUS staining. The mos5 mutation was ultimately mapped to a 95 kb region between T27E13-2 and T9D9, with 1 and 4 remaining recombinants, respectively (Figure 2.3 a). Open reading frames located in this region were sequenced from mos5 snd npr1-1 and a 15 bp deletion was found in the coding region of At2g30110. Sequence analysis indicated that the deletion is located in the last exon of At2g30110, leading to an amino acid substitution (Arg to Ser) and the deletion of the following 5 amino acids (Figure 2.3 b,c). At2g30110 encodes one of two ubiquitin activating (E1) enzymes in Arabidopsis (AtUBAI). AtUBAI is very similar to AtUBA2 (81 % amino acid sequence identity) and E1 enzymes in other organisms, indicating the evolutionary conservation of this essential enzyme (Hatfield et al., 1997). Ubiquitin activating enzymes from all kingdoms share regions of high homology that are involved in binding of the ubiquitin molecule, including the catalytic cysteine residue and ATP-binding regions for the nucleotides that provide the energy for ubiquitin activation. 22 (a) F23F1 T9D9 Chr. 2 200 kb I 1 D ,'12.803 12 .932^. . . F23F1 T27E13 T9D9 10 kb • T9D9-2 T9D9 0 4 4 0 O H D-CHH><10-CHl—KM00OG— * 10 kb (b) (c) Stop * I 500 bp R H K E R M D K K V V D UBAl AGGCACAAGGAGAGGATGGACAAGAAGGTTGTGGAT 324 0 mos5 AGGCACAAGGAGAG TGTGGAT 3225 R H K E S - - - - - V D mos5snc1 npr1-1 pG229-gU8A1 in snd npr1-1 mos5snc1 npr1-1 Figure 2.3: Map-based cloning of mos5 (a) Mapping of mos5 to the bottom of chromosome 2. Markers used for crude and fine mapping are indicated with the number of recombinants below. Open reading frames between the final markers T27E13-2 and T9D9 were sequenced and a deletion was identified in At2g30110 (indicated by *). (b) intron-exon structure of At2g30110. The mutation in mos5 (*) lies close to the stop codon in exon 7. (c) DNA and amino acid sequence alignment of mos5 and UBAL The 15 bp deletion in At2g30110 results in an amino acid substitution and deletion of 5 amino acids, (d) Complementation of mos5 by AtUBAI genomic DNA. mos5 snd npr1-1 plants carrying the 7kb transgene of the genomic sequence of AtUBAI show typical snd morphology. Representative plants are shown, photographed at 5 weeks. 23 The mutation in mos5 is located in the C-terminal domain of the E1, outside the highly conserved nucleotide and ubiquitin binding regions. Interestingly, the C-termini of ubiquitin E1s from different kingdoms are also very similar, suggesting a conserved function of this region in the structure or activity of the enzyme (Figure 2.4). To confirm that the deletion in mos5 is responsible for the suppression of the snd phenotype, a 7 kb genomic clone including the complete At2g30110 ORF as well as 2 kb of the 5' promoter region and the 3' UTR were cloned into pGreen229 (Hellens et al., 2000) and transformed into the mos5 snd npr1-1 mutant. 31 out of 33 Ti transformants displayed snd morphology (Figure 2.3 d) indicating that At2g30110 can complement the mutation in mos5 snd npr1-1 and that MOS5 is AtUBAI. At U B A l 981 A] At UBA2 972 SE A't U B A l 97 9 N T Ta U B A l » 5 2 S O s ' U B A l 94 « Sj XI U B A l 951 j ! ^ U B A l 950 B J 2 3 l | Hs U B A l 950 B2BL'' Sr U B A l 920 Y D K I V Q S N G E E f _ L Q P N G E E B L Q P N G E E i Diid Q P H T B I V T O P M T E I V S C - P M T E I V S L P I T Q L V K A t U B A l A t UBA2 t/t t 'BAl ' U B A l Os U B A l XI_UBAl U B A l Hs U B A l ge~ U B A l 9 p.Bs ms m K\ IMEVRSQtjR I V D V B E O P I K K I G K H V K K J J G R H V R I K D I R A H V S T M I L E I Figure 2.4: Alignment of the C-terminal domains of ubiquitin activating enzymes from different species Protein sequences were aligned using ClustalX and shaded using Boxshade (http://www.ch.embnet.org/software/BOX_form.html). Conserved residues are shaded in black and similar residues are shaded in grey. The location of the deletion in mos5 is indicated with a bar. AtUBAI: Arabidopsis thaliana UBA1 (accession AAC16961); AtUBA2: A. thaliana UBA2 (accession BAB08968); Ta_E1: Triticum aestivum (accession A38373); Os_E1: Oryza sativa (accession NP_910456); Nt_E1: Nicotiana tabacum (accession BAD00983); Hs_E1: Homo sapiens (accession CAA40296); Mm_E1: Mus musculus (accession AAF00149); XI_E1: Xenopus laevis (accession BAB19357); Sc_Uba1p: Saccharomyces cerevisiae (accession NP_012712). 24 2.2.4 The mos5 single mutant displays enhanced disease susceptibility The mos5 single mutant was generated by crossing mos5 snd npr1-1 with Col-0 (carrying the pBGL2-GUS transgene) and identified in the F 2 progeny by genotyping using PCR. mos5 single mutant plants are phenotypically indistinguishable from mos5 snd npr1-1 and grow slightly smaller than Col-0 wild type plants (Figure 2.5 a).To test for effects of mos5 on basal disease resistance, plants were infected with a low dose of the virulent bacterial pathogen P.s.m. ES4326 (OD6oo = 0.0001). Compared to the Col-0 wild type, mos5 supports five-fold more bacterial growth (Figure 2.5 b). These data indicate a minor involvement of mos5 in basal resistance against virulent bacteria. 2.2.5 mos5 exhibits differential susceptibility to avirulent pathogens To investigate whether MOS5 affects resistance mediated by R proteins other than snd , the mos5 single mutant was infected with bacteria expressing /4wgenes. mos5 plants support wild type growth of bacteria expressing AvrB or AvrRps4, determinants recognized by the CC-type R protein RPM1 and the TIR-type R protein RPS4, respectively (Figure 2.5 d,e). Only when infected with bacteria expressing AvrRpt2, the avirulence determinant recognized by the CC-type R protein RPS2, was a reproducible 10-fold increase in bacterial growth observed (Figure 2.5 c). These data suggest that activation or downstream signalling of certain R proteins depends on a functional ubiquitination machinery. 25 Figure 2.5: Requirement for MOS5 in basal and R protein mediated resistance (a) Morphology of the mos5 single mutant compared to Col-0 wild type. Photograph was taken of five-week-old soil-grown plants, (b) Basal resistance is affected by mos5. 4-week-old plants were infected with P.s.m. ES4326 (OD6 0o = 0.0001) and bacterial growth measured as described, (c-e) Response of mos5 to avirulent bacteria. Plants were infected with P.s.t. DC3000 AvrRpt2 (c), P.s.m. ES4326 AvrB (d) or P.s.t. DC3000 AvrRps4 (e) at O D 6 0 0 = 0.001. Bars represent the average of 4 replicates, error bars represent standard deviation. Experiments were repeated at least twice with similar results. 26 2.2.6 UBA2 is not required for resistance Arabidopsis contains two E1 paralogs. To investigate whether AtUBA2 (At5g06460) is also involved in disease resistance we obtained a T-DNA insertion line from the ABRC (Salk_108047; Alonso et al., 2003), containing an insertion in the 5 t h exon of UBA2 (Figure 2.6 a), henceforth referred to as uba2. Figure 2.6: UBA2 is not essential for plant innate immunity (a) Exon-intron structure of UBA2. The position of the T-DNA insertion in SALK_108047 is indicated by a rectangle, (b) Salk_108047 does not express UBA2 mRNA. P C R was performed using cDNA specific primers, (c) uba2 plants are morphologically indistinguishable from Col-0 wild type plants. The picture was taken of 5-week-old soil-grown plants, (d) Resistance to virulent pathogens is not affected in uba2. 4-week-old plants were infected with P.s.m. ES4326 (OD 6 0 0 = 0.0001) and bacterial growth was measured as described. Bars represent the average of six biological replicates, error bars represent standard deviation. Experiments were repeated at least twice with similar results. 27 RT-PCR analysis showed that uba2 does not accumulate UBA2 mRNA (Figure 2.6 b), indicating that the mutation causes a loss of function. In contrast to mos5, the uba2 mutant plants were phenotypically indistinguishable from Col-0 wildtype plants (Figure 2.6 c), suggesting that the loss of UBA2 function has no major effect on development. In bacterial infection assays, uba2 plants did not exhibit increased susceptibility to virulent P.s.m. ES4326 (Figure 2.6 d). We crossed uba2 with snd to obtain the double mutant and uba2 snd plants displayed the typical snd stunted morphology (not shown). This indicates that a loss of UBA2 function is unable to suppress snd, in contrast to the mos5 mutation in UBA1. These data suggest that UBA2 activity is not required in resistance responses. 2.2.7 A mos5 uba2 double mutant is lethal Since uba2 does not have an obvious phenotype whereas mos5 is defective in innate immunity and responses to the plant hormone auxin (S.G., unpublished data), we investigated whether mos5 could be a peculiar allele of UBA1 by two genetic approaches. We first attempted to find insertion alleles that knock out UBA1 function from ABRC seed stocks. Unfortunately, all available alleles with putative T-DNAs in exons of UBA1 did not actually carry an insertion in the gene (for a list of tested T-DNA insertion lines, see Table 2.1). 28 Table 2.1: T-DNA insertion alleles for UBA1 and UBA2 tested in this study. gene line ID T-DNA position insertion verified1' expression2' At2g30110 UBA1 Salk_020406 exon no -Salk 078543 5'-UTR yes no difference Salk 149288 5-UTR yes no difference Salk 0066771 Promoter yes no difference SAIL_1237_E11 exon no -At5g06460 UBA2 Salk_047313 5'-UTR yes no difference Salk 047314 5'-UTR no -Salk 023058 exon no -Salk 108047 exon yes no expression SAIL 840 C08 exon no -1 ) Insertion of T-DNA in the gene was verified using gene-specific primers paired with T-DNA specific primers Lba1 or Sail-1 F. Lines were T-DNA insertions could be detected are indicated. f ) Expression of UBA1 or UBA2 in the homozygous T-DNA insertion lines was determined using real-time RT-PCR using mRNA-specific primers (available upon request) and is indicated relative to levels observed in Col-0. Furthermore, T-DNA insertions in the promoter and 5'-UTR regions of UBA1 did not cause any discernible phenotype and transcription of the gene was unaffected as determined by RT-PCR (data not shown). We could thus not distinguish whether mos5 is a complete or only a partial loss-of-function allele of UBA1. We then attempted to generate a mos5 uba2 double mutant. Out of 183 randomly-chosen F2 plants, none were homozygous for both mutations, indicating that a combination of mos5 and uba2 is lethal. Furthermore, plants homozygous for one mutation and heterozygous for the other (thus only containing one fully functional copy of E1) are statistically under-represented with 15 plants of MOS5/mos5 uba2/uba2 and 10 plants mos5/mos5 UBA2/uba2, vs. 23 expected for either combination {%2 = 9.96, df = 1; P<0.005). All other classes are represented close to expected values. These data suggest that the two copies of UBA present in Arabidopsis are partially redundant and that the loss of both genes causes lethality. Thus mos5 is most likely a complete loss-of-function allele of UBA1, unless a null mutation in UBA1 alone is lethal. 29 2.2.8 Resistance in snd is independent of SGT1b and RAR1 RAR1 and SGT1b were previously identified as necessary components in RPP5-mediated resistance responses and are also required in RPP4-mediated resistance (Austin et al., 2002; Muskett et al., 2002). SGT1b was shown to interact with components of ubiquitin E3 ligases of the Skp/cullin/F-box (SCF) type in yeast and Arabidopsis (Kitagawa et al., 1999; Gray et al., 2003), indicating an additional function in protein degradation. Since MOSS encodes an essential component of the plant's protein degradation machinery and given the fact that snd encodes an RPP5-homolog that is located in the RPP4 cluster (Zhang et al., 2003), snd resistance signalling might also be dependent on either or both proteins. To investigate a potential role for SGT1b and RAR1 in snd signalling, sgtlb-1 (in Landsberg erecta ecotype) and rar1-21 (in Col-0) were crossed with snd nprl-1. As expected, the F-i progeny of both crosses looked phenotypically like wild type. In the F 2 generation, 85 out of 353 plants of the rar1-21 x snd npr1-1 cross showed typical snc1-\\ke morphology, indicating that rarl does not suppress the snd growth phenotype (expected ratio 1:3, x 2 = 0.16, P = 0.69). The snd rar1-21 double mutant was then isolated using genotype-specific markers. SGT1b is closely linked to SNC1 on chromosome 4, resulting in a skewed ratio in F 2 progeny of the snd x sgt1b-1 cross. The snd sgt1b-1 double mutant was isolated by genotyping and the presence of both mutations was subsequently confirmed by sequencing. Both the snd sgt1b-1 and the snd rar1-21 double mutant plants display similar morphological phenotypes as snd, i.e. small stature, dark green colour and curly leaves (Figure 2.7 a). 30 Figure 2.7: SGT1b and RAR1 are not required for snd-mediated resistance (a) Morphology of single and double mutants. Pictures show 4-week-old soil grown plants, (b-d) sgt 1b and rarl do not suppress constitutive resistance towards virulent pathogens in snd. (b,c) Plants were infected with P.p. Noco2 conidiospores and disease ratings assessed 7 dpi as described in Figure 2. (d) Plants were infected with P.s.m. ES4326 (OD 6 0 0 = 0.0001) and bacterial growth measured as desribed. (e,f) sgtlb and rarl do not suppress elevated endogenous SA-levels in snd. Free (e) and total (f) SA was extracted from 5-week old plants and analyzed by HPLC as described. Bars represent the average of six (d) and four (e,f) biological replicates, error bars represent standard deviation. All experiments were repeated at least twice with similar results. 31 To test whether the rarl and sgtlb mutations affect sncf-mediated constitutive resistance towards P.p. Noco2, a pathogen for which rarl and sgtlb are hyper-susceptible (Austin et al., 2002), two week-old seedlings were sprayed with a conidiospore suspension. As shown in Figure 2.7 (b+c), the snd rar1-21 double mutant and snd had a few infected leaves whereas snd sgt1b-1 is completely resistant against P.p. Noco2. We also investigated the effect of both mutations on snd mediated increased basal resistance towards virulent P.s.m. ES4326. As expected, both the rar1-21 and the sgt1b-1 single mutant showed much higher bacterial growth compared to snd (Figure 2.7 d). In the snd sgt1b-1 double mutant, snc1-\\ke resistance was completely restored, whereas the snd rar1-21 double mutant could partially restore resistance. These data indicate that constitutive resistance against P. p. Noco2 and P.s.m. ES4326 in snd is not mediated by these two regulators. To fully evaluate the involvement of RAR1 and SGT1b, the levels of endogenous SA in the single and double mutants were also measured. Both double mutants exhibited elevated levels of SA, similar to those found in the snd mutant (Figure 2.7 e,f). Thus, our results show that neither sgtlb nor rarl suppress snd-mediated phenotypes including stunted morphology, constitutive pathogen resistance and elevated endogenous SA levels. 2.3 Discussion In a screen for suppressors of constitutive resistance responses in snd nprl-1, we identified mos5, a mutant that restores wild type morphology and susceptibility to virulent bacterial and oomycete pathogens. The mutation abolishes constitutive expression of PR genes and mutant plants accumulate reduced levels of endogenous SA, an important signalling molecule in R protein mediated resistance. Using a map-based approach, the mos5 mutation was identified in AtUBAI, one of two ubiquitin activating E1 enzymes in Arabidopsis. Both E1s have previously been shown to bind ubiquitin and to transfer it to various ubiquitin conjugating E2 enzymes (Hatfield et al., 1997). UBA1 is expressed in all parts of the plant, 32 predominantly in young cells and dividing tissue, as determined by promotor-GUS fusion experiments (Hatfield et al., 1997). The identification of mos5 reveals an essential role for ubiquitination in plant defence signalling. In animal systems, ubiquitination has been shown to have a conserved role in different immunity pathways. In the mammalian immune system, ubiquitination is associated with processing of the transcription factor N F - K B precursors into functional products and their activation through the degradation of the inhibitory protein I K B (Ben-Neriah, 2002). Apart from these proteolysis-associated ubiquitination events, a number of regulatory functions for ubiquitination in animal immune signalling have been identified. These include signal termination via ubiquitin-associated receptor endocytosis, inhibition of T-cell activation, modulation of ubiquitination through the activity of deubiquitinating enzymes and activation of I K B kinase (IKK) via ubiquitination of the upstream E3-ligase TRAF6 (Ben-Neriah, 2002). TRAF6 ubiquitination is mediated by a hetero-dimeric ubiquitin conjugating enzyme complex consisting of Ubc13 and UEV1a, and does not lead to its degradation by the proteasome (Deng et al., 2000). The Drosophila homologs of Ubc13 and UEV1a are similarly required for IKK activation and induction of an immune response (Zhou et al., 2005), revealing a strong evolutionary conservation in eukaryotic immune systems. In plants, the role of ubiquitinaton in R protein signalling has been elusive, although ubiquitin-dependent protein degradation has previously been implicated in plant disease resistance responses (Devoto et al., 2003). Tobacco plants expressing an ubiquitin variant unable to form polyubiquitin chains necessary for recognition by the 26S proteasome show altered responses to infection with tobacco mosaic virus (Becker et al., 1993). Jasmonate-dependent responses to wounding and necrotrophic pathogens have been shown to require the action of the S C F C 0 M ubiquitin ligase complex (Xie et al., 1998; Xu et al., 2002). Two RING ubiquitin ligases, RIN2 and RIN3, which were initially identified as interactors of the R protein RPM1, affect the hypersensitive response mediated by RPM1 and RPS2 without having an effect on pathogen proliferation (Kawasaki et al., 2005). In tomato, a set of U-Box ubiquitin ligases that are induced upon elicitor treatment appear to regulate the hypersensitive response, adding further evidence for a role of 33 ubiquitination in specific defence signalling (Gonzalez-Lamothe et al., 2006; Yang et al., 2006). Interestingly, the mos5 mutation affects resistance responses of only one R protein tested. This might reflect divergent signalling pathways employed by different R gene products. Indeed, studies of RIN4, a protein involved in activation of both RPM1- and RPS2-mediated resistance showed that these R proteins are differentially regulated by RIN4. Induction of RPM1-mediated resistance involves phosporylation of RIN4 (Mackey et al., 2002), whereas the proteolytic processing of RIN4 is necessary for activation of RPS2 (Axtell et al., 2003; Chisholm et al., 2005), where MOS5 is also required (Figure 2.5 b). Since snd was originally identified as a gain-of-function R gene rather than from traditional gene-for-gene interactions, the cognate /Aw gene product recognized by wild type SNC1 is not known. We are therefore not able to speculate on the requirement of MOS5 in wild-type SNC1-mediated resistance signalling. Apart from its effect on resistance, mos5 also showed slightly enhanced resistance towards several natural and synthetic auxins (data not shown). These findings are not surprising, since ubiquitination and targeted degradation of Aux/IAA proteins are involved in auxin signalling (Dharmasiri and Estelle, 2004). The auxin resistant mutant axr7 contains a mutation in the RUB-activating enzyme, analogous to UBA1 (Leyser et al., 1993). We therefore conclude that the defects observed in mos5 are likely to be due to alterations in ubiquitination of target proteins. mos5 has a deletion of 15 bp very close to the C-terminus of UBA1, resulting in a substitution of arginine to serine and the deletion of 5 amino acids. The mutation lies in a region with high homology among ubiquitin E1s from different organisms (Figure 2.4), and some recent structural studies of E1s of ubiquitin-like proteins point to a possible function of the C-terminus of UBAL Walden and co-workers reported the three-dimensional structure of the E1 for the human RUB1 ortholog Nedd8, a heterodimer composed of APPBP1 and UBA3 (Walden et al., 2003b; Walden et al., 2003a). Interestingly, the C-terminus of UBA3 adopts a ubiquitin-like fold, which plays a role as an adapter domain for the docking of the cognate conjugating enzyme UBC12 (Huang etal., 2005). The human SUM01 E1 heterodimer Sae1/Sae2 adopts a very similar structure as APPBP1/UBA3 and also features a C-34 terminal ubiquitin-fold domain (Lois and Lima, 2005). In both cases the ubiquitin fold is necessary for binding of the cognate E2s as determined by mutational analyses. Given the strong evolutionary conservation among E1s of different ubiquitin-like proteins over all kingdoms (Walden et al., 2003a), it seems plausible that UBA1 has a similar structure. It might be speculated that the mos5 mutation somehow disrupts the putative ubiquitin-fold domain in UBA1 resulting in reduced binding affinity of some, if not all, conjugating enzymes. This disruption or alteration of the ubiquitination cascade may result in increased stability of negative regulatory proteins, the degradation of which might be necessary during snc7-mediated resistance responses. Alternatively, activation of positive regulators by ubiquitination could be affected by the mos5 mutation. Our data support a model in which pathogen elicitors target a population of host proteins, some of which might be involved in basal defence. Modification of these proteins is perceived by the corresponding R proteins, which are thus activated to initiate defence signalling. The ubiquitination of those target proteins might be impaired in the mos5 mutant, affecting activation of the corresponding R proteins. We cannot exclude the possibility, however, that R protein pathways which are unaffected by mos5 involve signalling via pathways independent of ubiquitination or, alternatively, that UBA2 might act partially redundantly in these pathways. We have identified a T-DNA insertion mutant line for UBA2 (SALK_108047), containing the T-DNA in an exon and likely resulting in a complete loss-of-function phenotype. The uba2 mutant plants, however, do not exhibit any morphological phenotype different from Col-0 wild type and are unaffected in disease susceptibility (Figure 2.6), indicating that UBA2 is not essential. In addition, no T-DNA insertion mutants for UBA1 could be identified and a mos5 uba2 double mutant is lethal. This could hint at a primary requirement for UBA1, and the mutation in mos5 could reduce the activity of UBA1. Most species contain only one copy of the E1 enzyme, and the lack of phenotypic effect in the uba2 insertion mutant indicates that there might be a preferential recruitment of UBA1 in the ubiquitination process. Similarly, Arabidopsis contains two homologs of SGT1 and, while mutations in SGT1a cause no phenotypical abnormalities, only sgtlb mutants display disease-related phenotypes. 35 Interestingly, a sgt1a/b double mutant is also lethal, reminiscent of the mos5/uba2 double mutant (Azevedo et al., 2006). Ultimately, however, the specificity of protein ubiquitination is likely dependent on the action of ubiquitin conjugating enzymes (E2) and ubiquitin ligases (E3), and not on E1. Furthermore, ubiquitination might be a strategy of the pathogen to eliminate host proteins involved in basal defence in order to facilitate infection. The Pseudomonas syringae protein AvrPtoB has recently been shown to possess ubiquitin ligase activity and to inhibit the hypersensitive response in susceptible tomato plants (Janjusevic et al., 2006). The pathogenicity of the human pathogen Shigella flexneri relies on OspG, a protein that specifically binds ubiquitinated E2s to inhibit an immune response in the host (Kim et al., 2005). Pathogens are thus able to exploit the host's ubiquitination machinery to suppress basal defences. SGT1 b and RAR1 are essential signalling components of a number of R gene products (Muskett and Parker, 2003). SGT1 was first identified as an interactor of SCF ubiquitin ligases in yeast (Kitagawa et al., 1999), and its plant homolog SGT1b has been shown to be essential for ubiquitin dependent responses to auxin and jasmonic acid (Gray et al., 2003). These data suggested an involvement of SGT1b in ubiquitination-dependent plant defence responses. Our data, however, indicate that SGT1b and RAR1 act independently from the ubiquitin-proteasome pathway in resistance signalling mediated by snd, because, unlike mos5, sgtlb and rarl do not suppress the constitutive defence responses against virulent pathogens in snd. Our data support other reports positioning RAR1 and SGT1 upstream of R protein activation, where they are potentially involved as co-chaperones in the assembly and stability of putative R protein recognition complexes (Bieri et al., 2004; Azevedo et al., 2006). RAR1 was shown to affect the steady state levels of the R proteins Mla1 and Mla6 in barley although no direct interaction was observed (Bieri et al., 2004). In the same study, SGT1 was identified as an interactor of the LRR C-terminal region of Mla1 in a yeast two-hybrid screen, which was not observed when the bait also contained the N-terminal NBS domain. This suggests a steric hindrance of the R protein structure and might reflect an intramolecular switch (Bieri et al., 2004). In another study, intramolecular association of the R protein Bs2 was shown to be dependent on SGT1b (Leister et al., 2005), and accumulation of the R proteins 36 Rx and N in tobacco is dependent on the presence of SGT1 (Azevedo et al., 2006). These reports indicate that SGT1b and RAR1 directly or indirectly interact with several NBS-LRR R proteins, controlling their abundance on the one hand and their intra- and intermolecular interactions on the other. Interestingly, SGT1b was also shown to act as RAR1 antagonist in negatively regulating R protein accumulation (Holt et al., 2005). Thus, SGT1b and RAR1 presumably act as co-chaperones in the formation of R protein recognition complexes and may be necessary for effector recognition but are likely dispensable once the R protein is activated. This would explain why the constitutively active R protein snd is unaffected by mutations in RAR1 and SGT1b. However, we cannot exclude the possibility that these co-chaperones are important in stabilizing the wild type SNC1 complex. Our results suggest that the ubiquitination pathway is essential for the activation of some, but not all R protein mediated resistance responses, as well as for basal defence. Ubiquitination appears to act both positively on promoting defence responses in the plant as well as negatively to suppress defences when employed by the attacking pathogen. The balance of these positive and negative aspects may determine the outcome of a plant-pathogen interaction. 2.4 Experimental procedures 2.4.1 Plant growth and mutant phenotypic characterization All plants were grown at 22°C under 16 h-light/8 h-dark cycles. The screen for suppressors of snd npr1-1 double mutants was described elsewhere (Zhang and Li, 2005). pBGL2-GUS reporter gene expression was tested on 20 day-old plants grown on MS plates as described previously (Zhang et al., 2003). Infection experiments with Pseudomonas syringae and Peronospora parasitica were performed as described in (Li et al., 2001). Endogenous salicylic acid (SA) was extracted from 4 week-old soil grown plants and determined by HPLC as described previously (Li et al., 1999). RNA was extracted from 20 day-old seedlings grown on MS plates using the Totally RNA kit (Ambion, Austin, TX) and reverse transcribed to cDNA using the RT-for-PCR kit (Clontech, Palo Alto, CA). Expression levels of the 37 pathogenesis related genes PR1 and PR2 were determined as described previously (Zhang et al., 2003). Expression of uba2 was determined using the cDNA specific primers UBA2-RT-F (5'-tccagtttgaaaaggacgatg-3') and UBA2-RT-R (5-tcaccactttaggtggaacc-3'). 2.4.2 Map-based cloning of mos5 The markers used to map mos5 corresponding to the respective BAC-clones were derived from insertion-deletion (InDel) and single sequence polymorphisms (SSLP) between the Col-0 and Ler Arabidopsis ecotypes, identified by mining the available genomic sequences of both ecotypes as well as a database provided by Monsanto on the TAIR homepage (Jander et al., 2002; http://www.arabidopsis.org/Cereon/). Marker T8018 was amplified using primers T8018-NF (5'-tgtgatgtgaaccaagattg-3') and T8018-R (5'-agcttcgagtggattctac-3') yielding PCR-fragments of 728 and 401 bp in Col-0 and Ler, respectively. Marker T16B12 was amplified using primers T16B12-F (5'-atactattaccgtactcatg-3') and T16B12-R (5'-acgcatgcattagacaacg-3') yielding PCR-fragments of 542 and 238 bp in Col-0 and Ler, respectively. Marker F23F1-1 was amplified using primers F23F1-1F (5'-ctctgtttccagcttgtatg-3') and F23F1-1R (5'-gtgacgtacactactttctc-3') yielding PCR-fragments of 231 and 206 bp in Col-0 and Ler, respectively. Marker T9D9 was amplified using primers T9D9-F (5'-tatgtttagtcaacgcctcc-3') and T9D9-R (5'-cattaccatactaacgtacg-3') yielding PCR-fragments of 267 and 222 bp in Col-0 and Ler, respectively. The marker T27E13-2 was amplified using primers T27E13-2F (5'-gattagtgtcacaagttcttg-3') and T27E13-R (5'-tctaaagtcagaaccaactag-3') yielding 291 bp PCR-fragments in both ecotypes, but only the Col-0 derived product was digested with H/nP1l. 38 2.4.3 Complementation of mos5 A genomic clone of At2g30110 encompassing 7 kb was amplified by PCR using Platinum Pfx DNA polymerase (Invitrogen, Carlsbad, CA) in a two-step reaction using primers with modified restriction enzyme cleavage sites (underlined). The N-terminal fragment UBA1-N was amplified using primers mos5-Kpnl (5'-cttggtaccaggtttcaactgcatc-3') and mos5-intR (5'-ggctgtttcacttgagtgac-3') and the C-terminal fragment UBA1-C was amplified using primers mos5-intF (5'-catacaggcatcattgcgtc-3') and mos5-Notl (5'-ttttccttttgcgqccgcgaaacaccacctgcaag-3'). Both fragments were first cloned into pBluescript (Alting-Mees et al., 1992) using the restriction enzymes Kpn\ISal\ and Sal\/Not\, respectively and sequenced to ensure that no mutations were introduced. UBA1-C was then subcloned into pBS-UBA1-N to create pBS-UBA1g. UBA1g was subsequently cloned into the binary vector pGreen229 (Hellens et al., 2000) to create pG229-UBA1g. mos5 snd npr1-1 plants were transformed with Agrobacterium containing pSoup and pG229-UBA1g using the floral dip method and Ti plants containing the UBA1g transgene were selected by spraying with glufosinate. 2.4.4 Creating the mos5 single and mos5 uba2 double mutants The mos5 single mutant was obtained by crossing mos5 snd npr1-1 with Col-0 carrying the pBGL2-GUS transgene. Fi progeny of the cross displayed wild type morphology and were allowed to self-pollinate and set seed. mos5 single mutants were identified among the F 2 progeny using genotype-specific markers. Presence of the mos5 deletion was determined by PCR using the primers mos5del-F (5'-aactcttcgtgaggtgttgc-3') and mos5del-R (5'-actcgactttcgcaacatcc-3'), which amplify fragments of 181 and 166 bp in Col-0 and mos5, respectively. The uba2 homozygous T-DNA insertion mutants were identified in SALK_108047 using the gene-specific primers 1972900F (5'-ctcacctcactgagaactatg-3') and 1974050R (5'-tcaccactttaggtggaacc-3'). One uba2 line was crossed with mos5 to yield progeny with wild type phenotype. Segregating progeny in the F 2 were genotyped using the PCR markers described above. Presence of the T-DNA 39 was determined using the combination of T-DNA specific LBa1 (5'-tggttcacgtagtgggccatcg-3') and 1974050R. 2.4.5 Creating the snd sgt1b-1 and snd rar1-21 double mutants In order to create the snd sgt1b-1 double mutant, snd (in the Col-0 background) was crossed with sgt1b-1 (in the Ler background). F 2 plants that were homozygous Col-0 at the SNC1 locus, but heterozygous Col-O/Ler at the SGT1b locus were selfed and their progeny screened for lines homozygous for sgt1b-1. The obtained double mutant line was confirmed by sequencing to be homozygous for both snd and sgt1b-1 and used for further analysis. To create the snd rarl double mutant, snd npr1-1 was crossed with rar1-21 (both in the Col-0 background). Selfed F 2 progeny segregated 1 : 3 s n c f - l i k e : wild type and plants displaying the characteristic snd-Wke phenotype were screened with genetic markers specific for the npr1-1 and rar1-21 mutations. Nine plants out of 32 snd-Wke plants were homozygous for rar1-21. Among those, two plants were homozygous for the segregating npr1-1 mutation, three plants were heterozygous and four plants were homozygous for wild type NPR1. The presence of the rar1-21 mutation in those four plants was confirmed by sequencing the locus and one line was used for further characterization. 40 2.6 References Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J., and Parker, J.E. (1998). Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proc Natl Acad Sci USA 95,10306-10311. Alonso, J.M., Stepanova, A.N., Leisse, T.J., et al. (2003). Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653-657. Alting-Mees, M.A., Sorge, J.A., and Short, J.M. (1992). pBluescriptll. multifunctional cloning and mapping vectors. Methods Enzymol 216, 483-495. Athman, R., and Philpott, D. (2004). Innate immunity via Toll-like receptors and Nod proteins. Curr Opin Microbiol 7, 25-32. Austin, M.J., Muskett, P., Kahn, K., Feys, B.J., Jones, J.D., and Parker, J.E. (2002). Regulatory role of SGT1 in early R gene-mediated plant defenses. Science 295, 2077-2080. Ausubel, F.M. (2005). Are innate immune signaling pathways in plants and animals conserved? Nat Immunol 6, 973-979. Axtell, M.J., Chisholm, S.T., Dahlbeck, D., and Staskawicz, B.J. (2003). Genetic and molecular evidence that the Pseudomonas syringae type III effector protein AvrRpt2 is a cysteine protease. Mol Microbiol 49, 1537-1546. Azevedo, C , Betsuyaku, S., Peart, J., Takahashi, A., Noel, L., Sadanandom, A., Casais, C , Parker, J., and Shirasu, K. (2006). Role of SGT1 in resistance protein accumulation in plant immunity. EMBO J 25, 2007-2016. Becker, F., Buschfeld, E., Schell, J., and Bachmair, A. (1993). Altered response to viral infection by tobacco plants perturbed in ubiquitin system. Plant J 3, 875-881. Belkhadir, Y., Subramaniam, R., and Dangl, J.L. (2004). Plant disease resistance protein signaling: NBS-LRR proteins and their partners. Curr Opin Plant Biol 7, 391-399. Ben-Neriah, Y. (2002). Regulatory functions of ubiquitination in the immune system. Nat Immunol 3, 20-26. Bieri, S., Mauch, S., Shen, Q.H., Peart, J. , Devoto, A., Casais, C , Ceron, F., Schulze, S., Steinbiss, H.H., Shirasu, K., and Schulze-Lefert, P. (2004). RAR1 positively controls steady state levels of barley MLA resistance proteins and enables sufficient MLA6 accumulation for effective resistance. Plant Cell 16, 3480-3495. Burkhard, P., Stetefeld, J., and Strelkov, S.V. (2001). Coiled coils: a highly versatile protein folding motif. Trends Cell Biol 11, 82-88. Chisholm, S.T., Dahlbeck, D., Krishnamurthy, N., Day, B., Sjolander, K., and Staskawicz, B.J. (2005). Molecular characterization of proteolytic cleavage sites of the Pseudomonas syringae effector AvrRpt2. Proc Natl Acad Sci USA 102, 2087-2092. 41 Dangl, J.L., and Jones, J.D. (2001). Plant pathogens and integrated defence responses to infection. Nature 411, 826-833. Deng, L., Wang, C , Spencer, E., Yang, L, Braun, A., You, J. , Slaughter, C , Pickart, C , and Chen, Z.J. (2000). Activation of the IkappaB kinase complex by TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain. Cell 103, 351-361. Devoto, A., Muskett, P.R., and Shirasu, K. (2003). Role of ubiquitination in the regulation of plant defence against pathogens. Curr Opin Plant Biol 6, 307-311. Dharmasiri, N., and Estelle, M. (2004). Auxin signaling and regulated protein degradation. Trends Plant Sci 9, 302-308. Durrant, W.E., and Dong, X. (2004). Systemic acquired resistance. Annu Rev Phytopathol 42, 185-209. Gonzalez-Lamothe, R., Tsitsigiannis, D.I., Ludwig, A.A., Panicot, M., Shirasu, K., and Jones, J.D. (2006). The U-Box protein CMPG1 Is required for efficient activation of defense mechanisms triggered by multiple resistance genes in tobacco and tomato. Plant Cell 18,1067-1083. Gray, W.M., Muskett, P.R., Chuang, H.W., and Parker, J.E. (2003). Arabidopsis SGT1b is required for SCF(TIR1)-mediated auxin response. Plant Cell 15, 1310-1319. Hammond-Kosack, K.E., and Jones, J.D. (1996). Resistance gene-dependent plant defense responses. Plant Cell 8, 1773-1791. Hatfield, P.M., Gosink, M.M., Carpenter, T.B., and Vierstra, R.D. (1997). The ubiquitin-activating enzyme (E1) gene family in Arabidopsis thaliana. Plant J 11,213-226. Hellens, R.P., Edwards, E.A., Leyland, N.R., Bean, S., and Mullineaux, P.M. (2000). pGreen: a versatile and flexible binary Ti vector for Ag rob acted um-mediated plant transformation. Plant Mol Biol 42, 819-832. Holt, B.F., 3rd, Belkhadir, Y., and Dangl, J.L. (2005). Antagonistic control of disease resistance protein stability in the plant immune system. Science 309, 929-932. Huang, D.T., Paydar, A., Zhuang, M., Waddell, M.B., Holton, J.M., and Schulman, B.A. (2005). Structural basis for recruitment of Ubc12 by an E2 binding domain in NEDD8's E1. Mol Cell 17, 341-350. Hubert, D.A., Tornero, P., Belkhadir, Y., Krishna, P., Takahashi, A., Shirasu, K., and Dangl, J.L. (2003). Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. EMBO J 22, 5679-5689. Inohara, N., Chamaillard, M., McDonald, C , and Nunez, G. (2005). NOD-LRR proteins: role in host-microbial interactions and inflammatory disease. Annu Rev Biochem 74, 355-383. 42 Janjusevic, R., Abramovitch, R.B., Martin, G.B., and Stebbins, C.E. (2006). A bacterial inhibitor of host programmed cell death defenses is an E3 ubiquitin ligase. Science 311, 222-226. Kawasaki, T., Nam, J., Boyes, D.C., Holt, B.F., 3rd, Hubert, D.A., Wiig, A., and Dangl, J.L. (2005). A duplicated pair of Arabidopsis RING-finger E3 ligases contribute to the RPM1- and RPS2-mediated hypersensitive response. Plant J 44, 258-270. Kim, D.W., Lenzen, G., Page, A.L., Legrain, P., Sansonetti, P.J., and Parsot, C. (2005). The Shigella flexneri effector OspG interferes with innate immune responses by targeting ubiquitin-conjugating enzymes. Proc Natl Acad Sci USA 102, 14046-14051. Kitagawa, K., Skowyra, D., Elledge, S.J., Harper, J.W., and Hieter, P. (1999). SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell 4, 21-33. Leister, R.T., Dahlbeck, D., Day, B., Li, Y., Chesnokova, O., and Staskawicz, B.J. (2005). Molecular genetic evidence for the role of SGT1 in the intramolecular complementation of Bs2 protein activity in Nicotiana benthamiana. Plant Cell 17,1268-1278. Leyser, H.M., Lincoln, C.A., Timpte, C , Lammer, D., Turner, J., and Estelle, M. (1993). Arabidopsis auxin-resistance gene AXR1 encodes a protein related to ubiquitin-activating enzyme E1. Nature 364, 161-164. Li, X., Clarke, J.D., Zhang, Y., and Dong, X. (2001). Activation of an EDS1-mediated R-gene pathway in the snd mutant leads to constitutive, NPR1-independent pathogen resistance. Mol Plant Microbe Interact 14, 1131-1139. Li, X., Zhang, Y., Clarke, J.D., Li, Y., and Dong, X. (1999). Identification and cloning of a negative regulator of systemic acquired resistance, SNI1, through a screen for suppressors of npr1-1. Cell 98, 329-339. Liu, Y., Burch-Smith, T., Schiff, M., Feng, S., and Dinesh-Kumar, S.P. (2004). Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rarl to modulate an innate immune response in plants. J Biol Chem 279, 2101-2108. Lois, L.M., and Lima, CD. (2005). Structures of the SUMO E1 provide mechanistic insights into SUMO activation and E2 recruitment to EL EMBO J 24, 439-451. Mackey, D., Holt, B.F., Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108, 743-754. Martin, G.B., Bogdanove, A.J., and Sessa, G. (2003). Understanding the functions of plant disease resistance proteins. Annu Rev Plant Biol 54, 23-61. Muskett, P., and Parker, J. (2003). Role of SGT1 in the regulation of plant R gene signalling. Microbes Infect 5, 969-976. 43 Muskett, P.R., Kahn, K., Austin, M.J., Moisan, L.J., Sadanandom, A., Shirasu, K., Jones, J.D.G., and Parker, J.E. (2002). Arabidopsis RAR1 exerts rate-limiting control of R gene-mediated defenses against multiple pathogens. Plant Cell 14, 979-992. Nimchuk, Z., Eulgem, T., Holt, B.F., 3rd, and Dangl, J.L. (2003). Recognition and response in the plant immune system. Annu Rev Genet 37, 579-609. Palma, K., Zhang, Y., and Li, X. (2005). An importin alpha homolog, MOS6, plays an important role in plant innate immunity. Curr Biol 15,1129-1135. Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.Y., and Hunt, M.D. (1996). Systemic acquired resistance. Plant Cell 8,1809-1819. Shirasu, K., Lahaye, T., Tan, M.W., Zhou, F., Azevedo, C , and Schulze-Lefert, P. (1999). A novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling in barley and development in C. elegans. Cell 99, 355-366. Takahashi, A., Casais, C , Ichimura, K., and Shirasu, K. (2003). HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc Natl Acad Sci USA 100, 11777-11782. Tor, M., Gordon, P., Cuzick, A., Eulgem, T., Sinapidou, E., Mert-Turk, F., Can, C , Dangl, J.L., and Holub, E.B. (2002). Arabidopsis SGT1b is required for defense signaling conferred by several downy mildew resistance genes. Plant Cell 14, 993-1003. Tornero, P., Merritt, P., Sadanandom, A., Shirasu, K., Innes, R.W., and Dangl, J.L. (2002). RAR1 and NDR1 contribute quantitatively to disease resistance in Arabidopsis, and their relative contributions are dependent on the R gene assayed. Plant Cell 14,1005-1015. Walden, H., Podgorski, M.S., and Schulman, B.A. (2003a). Insights into the ubiquitin transfer cascade from the structure of the activating enzyme for NEDD8. Nature 422, 330-334. Walden, H., Podgorski, M.S., Huang, D.T., Miller, D.W., Howard, R.J., Minor, D. L., Jr., Holton, J.M., and Schulman, B.A. (2003b). The structure of the APPBP1-UBA3-NEDD8-ATP complex reveals the basis for selective ubiquitin-like protein activation by an E1. Mol Cell 12, 1427-1437. Xie, D.X., Feys, B.F., James, S., Nieto-Rostro, M., and Turner, J.G. (1998). COM: an Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 280, 1091-1094. Xu, L., Liu, F., Lechner, E., Genschik, P., Crosby, W.L., Ma, H., Peng, W., Huang, D., and Xie, D. (2002). The SCF(COM) ubiquitin-ligase complexes are required for jasmonate response in Arabidopsis. Plant Cell 14, 1919-1935. 44 Yang, C.W., Gonzalez-Lamothe, R., Ewan, R.A., Rowland, O., Yoshioka, H., Shenton, M., Ye, H., O'Donnell, E., Jones, J.D., and Sadanandom, A. (2006). The E3 ubiquitin ligase activity of Arabidopsis PLANT U-BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense. Plant Cell 18, 1084-1098. Zhang, Y., and Li, X. (2005). A putative nucleoporin 96 is required for both basal defense and constitutive resistance responses mediated by suppressor of npr1-1,constitutive 1. Plant Cell 17,1306-1316. Zhang, Y., Goritschnig, S., Dong, X., and Li, X. (2003). A gain-of-function mutation in a plant fisease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1. Plant Cell 15, 2636-2646. Zhang, Y., Cheng, Y.T., Bi, D., Palma, K., and Li, X. (2005). MOS2, a protein containing G-patch and KOW motifs, is essential for innate immunity in Arabidopsis thaliana. Curr Biol 15,1936-1942. Zhou, R., Silverman, N., Hong, M., Liao, D.S., Chung, Y., Chen, Z.J., and Maniatis, T. (2005). The role of ubiquitination in DrosophHa innate immunity. J Biol Chem 280, 34048-34055. 45 3. A novel role for Arabidopsis farnesyltransferase in plant innate immunity2 3.1 Introduction Plant immunity to microbial pathogens requires an intricate signalling network, components of which are subjects of current investigation. An integral part of pathogen-specific defence is mediated by so-called Resistance (R ) proteins, which may recognize pathogenic effector molecules or, more likely, the results of their pathogenic activity, such as attempted suppression of the plant defence responses by pathogenic avirulence factors. According to their predicted structure, most R proteins belong to the NBS-LRR class, with carboxy-terminal leucine-rich repeats (LRRs) and a central nucleotide binding site (NBS) domain. The amino-terminal domains divide the NBS-LRR proteins into two subclasses, the TIR-NBS-LRR class with a Toll/lnterleukin-1-receptor domain, and the CC-NBS-LRR class with a coiled coil-domain potentially involved in protein-protein interaction (Belkhadir et al., 2004). NBS-LRR proteins are similar to receptor modules in mammalian innate immunity, the Toll-like receptors (TLR) and NOD-proteins, which recognize general pathogen associated molecular patterns (PAMPs) as a first step in an innate immune response (Ausubel, 2005). Activation of R proteins initiates discrete and overlapping signalling events, usually culminating in programmed death of cells at the site of infection (Hypersensitive Response, HR) and containment of the invading pathogen (Nimchuket al., 2003). Several components involved in R protein signalling have been identified. For example, the Enhanced Disease Susceptibility 1/Phytoalexin Deficient4/Senescence Associated Gene101 (EDS 1 /PAD4/SAG 101) complex functions genetically downstream of TIR-NBS-LRR R proteins and is present in both the nucleus and cytoplasm in varying composition (Feys et al., 2005; Wiermer et al., 2005). Non-expressor of Pathogenesis-Related genesl (NPR1) 2 A version of this chapter will be submitted for publication. Goritschnig, S., Zhang, Y . and L i , X . A novel role for Arabidopsis farnesyltransferase in plant innate immunity. 46 is activated by salicylic acid (SA) and, upon redox-changes in the cytoplasm as a result of SA induction, relocates to the nucleus and interacts with TGA-transcription factors to induce expression of defence-related genes (Zhang et al., 1999; Mou etal., 2003). Like NPR1, many proteins involved in plant defence signalling are regulated post-translationally, ensuring a rapid initial response that can be further amplified by transcriptional activation. Proper localization and interaction with other signalling components are imperative for successful defence responses, and these often depend on post-translational modifications. For example, membrane association has been demonstrated for the negative regulatory and avirulence target protein RPM1 interacting protein4 (RIN4), which is tethered to the plasma membrane most likely via palmytoylation at its C-terminus. RIN4 release from the membrane after proteolytic cleavage by the P. syringae type III effector AvrRpt2 results in its degradation by the proteasome and activation of the associated R protein Resistance to P. syringae 2 (RPS2) (Kim et al., 2005). Recent reports are proposing a role for the versatile and reversible protein modification by ubiquitination in plant defences. Ubiquitination has been implicated in plant-virus interactions (Becker et al., 1993) and a number of ubiquitin ligases have been shown to be important in plant resistance responses (Kim and Delaney, 2002; Kawasaki et al., 2005; Gonzalez-Lamothe et al., 2006; Yang et al., 2006). We have recently identified a unique loss-of-function mutant allele of the ubiquitin-activating enzyme UBA1, which affects some aspects of basal and R protein mediated defence responses (Goritschnig et al., Plant Journal, in press). To search for additional components required for R protein signalling, we took advantage of the plant auto-immune model suppressor of npr1 constitutive 1 (snd), a unique gain-of-function allele of a TIR-NBS-LRR R gene homologous to RPP4 [Resistance to Peronospora parasitica 4) and RPP5. Apart from constitutive resistance against virulent bacterial and oomycete pathogens, the snd mutant also displays several constitutive defence-related phenotypes, including increased levels of endogenous SA and constitutive expression of several PR genes (Li et al., 2001; Zhang et al., 2003). snot-mediated resistance completely depends on EDS1/PAD4 and involves several branches of the 47 downstream signalling network, dependent or independent of SA and NPR1, or both (Zhang et al., 2003). The unique properties of the sntf auto-immune model facilitate the identification of novel signalling components downstream of activated R proteins. Here we present mos8 (modifier of snd 8), another suppressor of snd-mediated defence responses. mos8 is a novel allele of ERA1 (Enhanced Response to ABA1), which encodes the protein farnesyltransferase beta subunit and has been shown to be important in development and hormonal responses (Cutler et al., 1996; Yalovsky et al., 2000; Ziegelhoffer et al., 2000). mos8 affects both basal resistance against virulent pathogens as well as some R protein mediated resistance responses. We also show that defence responses have a specific requirement for farnesylation, which cannot be substituted by geranylgeranylation. This novel function of farnesylation in response to biotic stresses adds another layer of complexity to the signalling network integrating biotic and abiotic stress responses. 3.2 Results 3.2.1 mos8 suppresses constitutive resistance in snd npr1-1 The suppressor screen of snd npr1-1 was described elsewhere (Zhang and Li, 2005). mos8 was isolated based on a partial suppression of the small size and constitutive expression of the pBGL2-GUS reporter gene in the snd npr1-1 mutant background (Figure 3.1 a and data not shown). The mutant, however, displayed a very distinct morphological phenotype with flat, dark green leaves and delayed flowering. When crossed with snd npr1-1, the Fi progeny exhibited the characteristic snd phenotype, and in the F 2 progeny, 424 out of 556 plants had snc1-\\ke morphology (expected 3A, j2'- 0.47, P = 0.5), confirming that the phenotype is caused by a recessive mutation in a single gene. 48 Figure 3.1: mos8 suppresses sncf-mediated resistance phenotypes (a) Morphology of five-week-old soil-grown plants of indicated phenotypes. (b) Semi-quantitative RT-PCR of pathogenesis related genes PR1 and PR2. Fragments were amplified from standardized cDNA in 30 cycles. Actin is included as a normalization control, (c+d) mos8 completely suppresses constitutive resistance to virulent bacteria and oomycetes. (c) 5-week-old soil-grown plants were infected with P.s.m. ES4326 (OD60o=0.0001) and colony forming units (cfu) quantified at 0 (white bars) and 3 (dark bars) days post inoculation (dpi), (d) 2-week-old seedlings were inoculated with P.p. Noco2 and conidia were quantified 7 dpi. (e) mos8 reduces endogenous salicylic acid (SA) in snd nprl. Total SA was extracted and analyzed with HPLC. Bars represent the average of six (c) and four (d,e) biological replicates, error bars represent standard deviation. All experiments were repeated at least twice with similar results. At the same time, constitutive PR gene expression and enhanced resistance is abolished in mos8 snd npr1-1 (Figure 3.1). In infection experiments with virulent Peronospora parasitica (P.p.) Noco2, mos8 snd npr1-1 restores more than wild type-like susceptibility (Figure 3.1 d). When infected with virulent bacteria Pseudomonas syringae pv. maculicola (P.s.m.) ES4326, mos8 snd npr1-1 sustained high levels of bacterial growth, significantly greater than Col-0 49 wild type (Figure 3.1 c; P-value <0.0001, t-test). Furthermore, elevated levels of endogenous SA, which are observed in snd npr1-1 mutant plants, are drastically reduced in mos8 snd npr1-1 (Figure 3.1 e), indicating that mos8 most likely functions upstream of or in parallel with SA synthesis. 3.2.2 mos8 contains a mutation in a farnesyltransferase subunit The mutation in mos8 was identified using a map-based approach. mos8 snd npr1-1 was crossed with snd in Landsberg erecta background (Ler-snd; Zhang and Li, 2005) to generate a mapping population in the F 2 progeny. The approximate map position of mos8 was determined on the bottom arm of chromosome 5 (Figure 3.2 a). / (a) (b) i era1-8 moS8/era1-7 Col wt Figure 3.2: mos8 is allelic to eral (a) Positional cloning of mos8. BAC clones and recombinants are indicated. A mutation (*) was identified in At5g40280/ERA1. (b) Two additional alleles of eral display the same late flowering phenotype as the mos8 (era1-7) single mutant. Pictures were taken at 7 weeks after planting. 50 Using 918 F 2 plants, the region containing the mos8 mutation was localized to a 723 kb region between markers MUL8 and K1013, with 56 recombinants remaining. The phenotypes of these recombinants were confirmed in the next generation and they were used to narrow down the region containing mos8. The final position of mos8 was flanked by the markers MSN9-2 and MP012-4, with two remaining recombinants, respectively. This region encompassed 40 kb, containing 7 genes. Sequencing of the coding regions of these genes revealed a point mutation in mos8, substituting G to C in At5g40280 (Figure 3.4 a). At5g40280 encodes the beta subunit of protein farnesyltransferase. Plants with loss-of-function mutations in At5g40280 have been described previously and display several characteristic developmental phenotypes, including delayed germination in enhanced response to abscisic acid 1 (eral; Cutler et al., 1996) and increased floral meristem size and delayed flowering in wiggum mutants (Ziegelhoffer et al., 2000). Closer inspection of mos8 mutant plants revealed an increase in the number of floral organs, as described for the wiggum mutants (Running et al., 1998; data not shown). wiggum mutants obtained from Dr. E. Meyerowitz and era1-2 mutants from Dr. P. McCourt, as well as a T-DNA insertion allele from the Arabidopsis stock centre (Salk_110517; Alonso et al., 2003) were crossed with mos8 snd npr1-1 to test for complementation. All available mutant alleles oiAt5g40280 were unable to complement the mos8 mutation, confirming that MOS8 is allelic to ERA1IWIGGUM (Table 3.1). Therefore, mos8 was subsequently referred to as era1-7, and Salk_110517 was renamed era1-8. Figure 3.2 b shows the similarity in the morphological phenotypes of three era7 alleles, which are late flowering and have darker rosette leaves than the Col-0 wild type. Moreover, era 1-2 snd and era1-8 snd double mutants were obtained, and both alleles were able to suppress snc7-associated phenotypes and resistance, further confirming that mos8 is an allele of eral (Table 3.2 and data not shown). 51 Table 3.1: Allelism test between several eraf-alleles and mos8 snd npr1-1. cross 1' Fi morphology2' total F 2 phenotypic segregation wt-like snd-Wke 3) era 1-\ike era 7-8 X mos8 snd npr1-1 eraf-like 197 0 0 197 mos8 snd npr1-1 X eral-5 eraf-like 150 0 0 150 mos8 snd npr1-1 X era1-6 era 1 -like 125 0 0 125 era1-2Xera1-7 era •/-like 205 0 0 205 1 ) The crosses are indicated with the female parent first, the male parent second, eral-4,5,6 are in Ler ecotype, era1-2,8 are in Col-0 ecotype. 2 ) Ft phenotypes were scored for seedlings sown on MS-plates and transferred to soil, based on flowering time and morphology. 3 ) F 2 phenotypes were scored for seedlings stratified for seven days and sown directly on soil, wt, wild type. Table 3.2: Multiple era? alleles suppress snd. cross1' Fi morphology 2) F 2 phenotypic segregation 3 > total wt-like sncf-like eraf-like hypothesis4' 2 X P snd X era1-4 wt-like 142 80 28 34 9 : 3 : 4 0.1346 0.93 era1-5Xsnd wt-like 104 61 20 23 9 : 3 : 4 0.4658 0.79 snd X era 1-6 wt-like 168 92 35 41 9 : 3 : 4 0.4788 0.79 era 7-8 X snd wt-like 327 175 66 86 9 : 3 : 4 1.0136 0.60 era1-2X snd wt-like 206 118 41 47 9 : 3 : 4 0.5782 0.75 1 ) The crosses are indicated with the female parent first, the male parent second, era 1-4,5,6 are in Ler ecotype, era1-2,8 are in Col-0 ecotype. 2 ) F t phenotypes were scored for seedlings sown on MS-plates and transferred to soil, based on flowering time and morphology, wt, wild type. 3 ) F 2 phenotypes were scored for seedlings stratified for seven days and sown directly on soil. 4 ) The hypothesis for suppression of snd in the F 2 is 9 wild type : 3 sncMike : 4 eraMike. 52 3.2.3 The era1-7 mutation affects the start codon of ERA1 The phenotype of era1-7 is comparable to the deletion mutant allele era1-2, suggesting that era1-7 is likely a complete loss-of-function allele. The G/C point mutation in era1-7 changes a methionine to an isoleucine. Based on the annotation of the published ERA1 open reading frame (Ziegelhoffer et al., 2000), this mutated Met is placed 40 amino acids downstream of the start codon. Sequence comparison with ERA1 homologs in other plant species however, suggests that the annotated cDNA for ERA1 is too long and that translation initiates at a later start codon (Figure 3.3). In accordance with the null-allele phenotype in era1-7, we hypothesized that the actual start codon of ERA1 is absent in era1-7, resulting in an altered protein product as the translation initiates at the next available ATG (Figure 3.3 and 3.4 a). To test this hypothesis, we cloned the ERA 1 cDNA beginning with the predicted start codon into the binary vector pBI1.4 (Mindrinos et al., 1994) under control of the CaMV35S promoter and transformed the construct into mos8 snd npr1-1 plants using Agrobacter/um-mediated floral dip transformation. Ti seeds were screened for plants that restored snd phenotypes, and 20 independent primary transformant lines were obtained. Constitutive expression of the ERA1 cDNA starting at the ATG start codon mutated in mos8 fully complemented mos8 (Figure 3.4 b), indicating that the ERA1 protein may indeed be smaller than previously suggested. Complementation was also observed when era1-2 and era1-7 single mutant plants were transformed with 35S::ERA1 (data not shown). Figure 3.3: Alignment of Farnesyltransferases from different plant species. Amino acid sequences were aligned using clustalW (http://www.ebi.ac.uk/clustalw/) and shaded using boxshade (http://www.ch.embnet.org/software/BOX_form.html). Conserved residues are shaded in black and similar residues are shaded in grey. At_ERA1 Arabidopsis thaliana (accession NP_198844); Le_FTaseB Lycopersicon esculentum (tomato, accession AB69757); Cr_FTase B: Catharanthus roseus (Madagascar periwinkle, accession AAQ02809); Os_FTaseB Oryza sativa japonica cultivar-group (rice, accession NP_001044183); Ps_FTaseB: Pisum sativum (pea, accession Q04903). 53 £ £ H t J a > >« >H a A J i M! m w «s 01 i E B P . _ 2 01 w i ™ Q £ 3 W O. « i 'Pt « » H a ' z H iiaj «c 03 01 o a — K M E S O t > ™ X >( H H H M H M M H H M X ft O r « c « j W i O t BS g os « «: 01 >J J > S M H PS 9 9 i ?! # » * 4 * t t t i m * » * • * r S c V «i hi U V <-w « W i w r s 2S ^ a a a a a H H H H H w X X X B X SB A A A AVSiA A A A A A A O O O o o o S H J I to to Cu to IH H H E J H B * >t SM D O O O D O < A A A A A H W 61 W W W w w w m ESI 81 o o o o E J o 0t fit 0* P< Pi Pi 0 0 0 0 0 0 , SSSSA AAA] M H H M M 8 0 8 0 0 O O O O O O •H (M SH SH * >< f ) B h « H 5 ( o o a ot o a o o o o o o to io w «E3ai H H H H H H w w a w w w o o o o o o ! K 3 3 0 e> OE3 Q Q D a D p W M W W W W a K os os « os Pi to to to fe fe. D D O O E p O O O O s o o ui Ol tn aj to t< H E H E 3 H a a a a a S3 X SS S3 S S « « os as as « imsi _3E| _ _ _ J M i £ _i ft ol ol i D roiosH H oiwi ft O © Oi Gu SG D a j H oi ws so ou >> a g____«ai>< w E i E a g o A H 3 "a > < »* o 5T515IHEI t - E f w O H f t B8 DB TO rtiO J ac x cn co o o mmmxmui a Z «;'f«}OiM! 5fci! |H ! :W |«lf O W i i o'ia ia o. o. E E E > < 04 a r i i o ra > i l l £ TO H • i i a >> > i i i O i Cu K X ft < i 0< P M ~ Z g i E l O O J > W H Q S s B > ^ > H • > A*3 > 0. 0. !> > « i « ! W W K< Z 01 o . § S § § « PS ft ft O K K tt. »H n i l 0 o o : o o u K o s a ; i c o o Toi « o i ~ >-i tM g W M 01 ^ t - l i H l i l l i l 01 011*71It—j~31 a x —i¥ns "a a o a c M M > M > > jOk 0* fti O C3 o o H H H r l r l H <-) M »-< <n \& <y» 03 TJ* tj* <7* ^i y> r-- oo o r> m ro <h r-i H H »-< »-l H H r-( t>4 r i n l / l CO i> ro r l oo o -<r u i co <N <N -<r O r-i ri'V CO ^ "*1* tl* S^* f*i ffi CQ n 03 <r> <c * a; ^ as m to oi to 01 nj <c (C fl) CB O E-i H E-l H H S t 6< It (U 1^ ffi tQ < >J u o o. M 05 03 « « * 1 » H a> a as a m < oi <t ns os to K O h H h H ca s o . &4 Cu o . I I XJ <D M tfi tD A A i-3 U O P. 03 03 03 03 0! ti) m <D rA 05 a to to to « ; » « « « « « O H h H H til S Cu Cu Cu to -M +J Q! ^ to to A A >A O O 0. 03 03 03 03 d) 0) <]) <]) H CO to tQ to tO A oi nj nj <is as Bl S to Cu _ to I 41 JJ d> M to to < A J O O O. 03 03 03 03 (D <S <D <D H CO to to CO to « ; oi o) as ns as K O H H H H Ca £ Cu to Cu Cu I ! a a <C u to to « < J U O H 03 03 03 03 <D Oi 0) <D H CO t» to CO to A ol aj as as as K O H H H H U £ Cu to Cu to 4J AJ <D ^ to to A ^ u o o . 54 (a) A T _ G A A G A G C T T T C A A G C C T A A C C G T G A G T C A G C G C G A G C A A mosS/eral-1 I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I A T G G A A G A G C T T T C A A G C C T A A C C G T G A G T C A G C G C G A G C A A At2g402B0 M E E L S S L T V S Q R E Q mos8/eral- 7 - - - - - M C S G S I I T S T T T C T G G T G G A G A A C G A T G T G T T C G G G A T C T A T A A T T A C T T C I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I T T T C T G G T G G A G A A C G A T G T G T T C G G G A T C T A T A A T T A C T T C At2g4 0280 F L V E N D V F G I Y N Y F (b) Figure 3.4: The mutation in mos8/era1-7 affects the ERA1 start codon (a) The G to C mutation in era7-7 (indicated by *) causes a loss of the endogenous ATG start codon. Translation of the wild type and the mutant gene are indicated below and above the alignment, respectively, (b) Complementation of era1-7 snd npr1-1 with ERA 1 cDNA initiating at the start codon mutated in era1-7 restores snc7-phenotype. Representative 5-week-old plants are shown. 3.2.4 eral confers enhanced disease susceptibility Since mos8 snd npr1-1 was shown to be more susceptible than Col-0 to virulent bacteria, we suspected that era7" might also play a role in basal resistance. We generated the mos8/era1-7 single mutant by back crossing with wild type and tested it together with the other available alleles in Col-0 background for infection assays. The era 1-7 single mutant showed about 20-fold more growth of virulent P.s.m. ES4326 compared with Col-0, similar to era1-2 and era1-8. (Figure 3.5 a). Furthermore, the eral alleles in Col-0 background were more susceptible to the virulent oomycete P.p. Noco2 (Figure 3.5 b). These data suggest that ERA1 plays a role in basal defence signalling in responses to different virulent pathogen species. 55 Figure 3.5: eral confers enhanced susceptibility to virulent P. syringae and P. parasitica. (a) 5-week old plants were infected with P.s.m. ES4326 (OD60o=0.0001) and bacterial growth quantified at 0 (white bars) and 3 dpi (black bars), (b) Quantification of P.p. Noco2 conidiospores 7 dpi. Susceptibility in the era 1 single mutants is significantly enhanced compared to Col-0 wild type (P<0.0001, t-test). Bars represent the average of 6 biological replicates, error bars indicate standard deviation. Experiments were repeated twice with similar results. 3.2.5 eral affects resistance to avirulent pathogens Several of the mos mutants identified in the snd suppressor screen have previously been shown to exhibit reduced resistance towards avirulent pathogens (Palma et al., 2005; Zhang et al., 2005; Zhang and Li, 2005; Goritschnig et al., in press). To investigate whether a mutation in ERA1 also affects other R protein signalling pathways, single mutant plants were infected with avirulent bacterial and oomycete pathogens. We did not observe significant differences compared with Col-0 in susceptibility towards P. syringae expressing the effectors AvrB or AvrRpt2, which trigger defence signalling of the R proteins RPM1 and RPS2, respectively (data not shown). However, in infection experiments with P. syringae pv. tomato (P.s.t.) DC3000 expressing AvrRpml or AvrRps4, effectors recognized by the R proteins RPM1 and RPS4, respectively, we observed significantly increased susceptibility in era1-7 compared to Col-0 wild type (Figure 3.6 a,b). 56 Figure 3.6: eral affects R protein signaling 5-week-old plants were infected with P.s.t. DC3000 expressing AvrRpml (a) or AvrRps4 (b) at OD6 0 0=0.001 and bacterial growth quantified at 0 (white bars) and 3 dpi (black bars). Susceptibility towards AvrRpml in the era7 single mutant is significantly enhanced compared to Col-0 wild type (P=0.0071, t-test). Bars represent the average of six biological replicates, error bars indicate standard deviation. Experiments were repeated twice with similar results. These data indicate that ERA1 might be preferentially required in the interaction between some pathogen effectors and their cognate R protein. We also took advantage of the availability of eral alleles in different genetic backgrounds to investigate their responses to avirulent oomycetes. P.p. Noco2 is a virulent pathogen for the Col-0 ecotype but avirulent on Ler, which contains the RPP5 R gene. Infection assays with P.p. Noco2 on eral alleles in different ecotypes can thus provide insight into the involvement of ERA1 in both compatible and incompatible interactions, eral mutants in the Col-0 genetic background showed significantly more growth of the oomycete pathogen, as determined by quantification of conidiospores (Figure 3.5 b). Inoculation of Ler plants induced a rapid hypersensitive response, which is apparent in trypan blue staining (Figure 3.7 c). This staining method is used to reveal hyphal structures and dead cells, whereas live cells are not stained. The wiggum alleles era1-4 and era1-6 in the Ler background were able to suppress RPP5-mediated resistance 57 towards P.p. Noco2, visualized by hyphal growth in infected tissues and the formation of conidiophores (Figure 3.7 a+c). In infection experiments with P.p. Emwal, which is recognized by RPP4 in Col-0, the eral mutant plants were more susceptible than Col-0 (Figure 3.7 b+c). eral alleles allowed sporulation of the pathogen to which Col-0 is resistant to, albeit to a lesser extent than the susceptible ecotype control Wassilewskija (Ws). Strong resistance towards P.p. Emwal in Ler conferred by RPP5 and RPP8 was also compromised in the wiggum alleles, as demonstrated by extensive trailing necrosis and occasional sporulation on the mutant plants (Figure 3.7 c and data not shown). Taken together, these findings indicate that the farnesyltransferase encoded by ERA 1 and therefore farnesylation might be important in a subset of R protein-mediated resistance responses, that confer resistance to bacterial and oomycete pathogens. Figure 3.7: eral confers enhanced susceptibility to avirulent oomycete pathogens. (a-b) Growth of P. parasitica isolates Noco2 and Emwal on era7 alleles in different ecotypes. P.p. Noco2 is avirulent on Ler ecotype (a), and P.p. Emwa is avirulent on Col-0 (b). Ws is included as a susceptible control. Conidiospores were harvested and quantified 7 dpi. Bars represent the average of four biological replicates, error bars indicate standard deviation. Experiments were repeated twice with similar results, c) Visualization of oomycete growth by lactophenol trypan blue staining at 7 dpi. HR, hypersensitive response. TN, trailing necrosis. Bar in (c) represents 100 nm. 58 3.2.6 ERA1 acts additively with NPR1 in resistance signalling Resistance signalling downstream of snd has been shown to combine the contributions of at least three distinct signalling pathways, dependent and independent on either SA or NPR1, or both (Zhang et al., 2003). In order to genetically dissect the contribution of era 1 in the snd signalling pathway, we generated era1-7 snd and era1-7 npr1-1 double mutants and compared them with their respective controls in bacterial infection assays (Figure 3.8 a). Figure 3.8: eral and npr1 act additively to confer enhanced disease susceptibility. (a) Enhanced susceptibility to virulent P. s. m. ES4326 in eral is potentiated by npr1-1. Bacterial growth was determined 0 (white bars) and 3 (dark bars) dpi. (b+c) era 1 and npr1 have additive effects in susceptibility to virulent P.p. Noco2 (b) and avirulent P p . Emwal (c). Conidiospores were harvested and quantified 7 dpi. Bars represent the average of six (a) and four (b,c) biological replicates, error bars indicate standard deviation. Experiments were repeated twice with similar results. 59 The era1-7 snd double mutant plants exhibited susceptibility comparable to Col-0, indicating complete suppression of sr/c7-mediated resistance by era l The npr1-1 mutation confers greatly enhanced susceptibility towards virulent bacteria, an effect that is slightly increased in the presence of the era1-7 mutation. The additive effects of the npr1 and eral mutations are apparent in Peronospora infection assays, where the double mutant resulted in increased growth of virulent P.p. Noco2 (Figure 3.8 b). Interestingly, we also observed a similar additive effect of eral and npr1-1 in infection assays with avirulent P.p. Emwal (Figure 3.8 c). We therefore concluded that ERA1 most likely acts in an npr1 independent pathway to mediate resistance signalling and that both genes act synergistically in basal and RPP4-mediated resistance responses. 3.2.7 Geranylgeranylation is not required in defence responses Protein farnesyltransferase (PFT) is a modular enzyme in which the alpha subunit forms a scaffold for the barrel-shaped beta subunit that performs the addition reaction (Park et al., 1997). In an alternative prenylation pathway, protein geranylgeranyltransferase 1 (PGGT1) utilizes the same alpha subunit but a distinct beta subunit to transfer geranylgeranyl units to target proteins. The enhanced susceptibility of the era 7 mutant towards virulent and avirulent pathogens prompted us to investigate a potential role of geranylgeranylation in defence responses. We obtained a T-DNA insertion line with a defect in At2g39550, the gene encoding the geranygeranyltransferase beta subunit GG6, from the Arabidopsis stock center (Salk_040904). The Salk_040904 line, representing the ggb-2 allele, carries the T-DNA insertion in the first exon. Although ggb-2 represents a null allele with no detectable GGB transcript, the ggb-2 mutant did not exhibit significant morphological differences compared with wildtype (Johnson etal., 2005). However, the mutant has been described to be involved in several aspects of hormone signalling (Johnson et al., 2005). We challenged the ggb-2 mutant with virulent P.s.m. ES4326 and avirulent P. syringae and, in contrast to the eral alleles, the mutant did not exhibit enhanced susceptibility (Figure 3.9 a and data not shown). The ggb-2 mutant 60 showed a slight but not statistically significant increased susceptibility to P.p. Noco2 compared to wild type (P=0.3307, t-test), but the mutation did not result in the extensive oomycete growth observed in eral (Figure 3.9 b). Furthermore, RPP4-mediated resistance towards P. p. EMWA1 was only mildly affected in ggb-2 as visualized by the development of trailing necrosis and delayed HR in the mutant (Figure 3.9 c). These data imply a very minor involvement of geranylgeranylation in some aspects of defence responses. To test whether the ggb-2 mutation had an effect on snct-mediated resistance, we generated a double snd ggb-2 mutant. However, we did not observe suppression of snd-associated phenotypes (data not shown). Taken together, our findings suggest that farnesylation, and not geranylgeranylation, plays an important role in both basal and R protein defence signalling. (a) (b) P.s.m. ES4326 P-P- N°co2 Col-0 ggb-2 eraf-2 Figure 3.9: Involvement of geranylgeranylation in defence responses Col-0 wild type, ggb-2 and era7 plants were infected with virulent P.s.m. ES4326 (a), virulent P.p. Noco2 (b) and avirulent P.p. EMWA (c). Bacterial growth in (a) was determined as colony forming units 0 (white bars) and 3 (dark bars) dpi. Oomycete growth was determined by quantifying conidiospores (b) and trypan-blue staining of infected plant tissue (c) 7 dpi. Experiments were repeated twice with similar results. Bars represent the average of six (a) and four (b,c) biological replicates, error bars indicate standard deviation. Asteriks indicate statistically significant differences (t-test). Bars in (c) represent 100 nm. 61 3 . 3 Discussion Proteins are frequently altered post-translationally to modify their solubility, compartmentalisation or interaction with other proteins. The most common lipid modification, prenylation, involves the covalent attachment of farnesyl- or geranylgeranyl-diphosphate moieties to the C-terminus of a small group of target proteins, which contain a conserved CaaX motif (Galichet and Gruissem, 2003). Unlike in yeast and Drosophila, mutations in prenyltransferases are not lethal in Arabidopsis, suggesting that plants may have evolved alternative mechanisms to bypass the essential requirement for protein farnesylation (Trueblood et al., 1993; Therrien et al., 1995). Protein prenyltransferases are modular enzymes and mutations in several subunits have been described in Arabidopsis (Galichet and Gruissem, 2003; Running et al., 2004; Johnson et al., 2005). Enhanced response to ABA 1 (eral), a mutant in the farnesyltransferase beta subunit, was first identified based on delayed germination in the presence of abscisic acid (ABA) (Cutler et al., 1996) and was later found to display a variety of morphological phenotypes, including an increase in floral organ number and enlarged meristems (Bonetta et al., 2000; Yalovsky et al., 2000; Ziegelhoffer et al., 2000). Guard cell responses to ABA are enhanced in era 7, resulting in enhanced drought resistance of the mutant plants (Pei et al., 1998). This phenomenon was used in the production of transgenic Brassica napus, in which silencing of endogenous ERA 1 by an antisense construct results in increased drought resistance (Wang et al., 2005). Here we show that farnesylation is not only important in development and abiotic stress responses, but also in biotic interactions. The enhanced susceptibility of mos8/era1-7 towards virulent bacterial and oomycete pathogens indicates the involvement of farnesylation in basal defence responses. In addition, our findings indicate that signalling mediated by several R proteins relies on functional ERA1, further demonstrating the existence of divergent signalling events downstream of different R protein classes. Interestingly, a mutation in the alternative prenyltransferase p-subunit, ggb-2 resulted in no detectable defence-related phenotype and it is unable to 62 suppress constitutive resistance mediated by snd. Geranylgeranyltransferase-beta (GGB) was previously shown to partially compensate a lack of farnesyltransferase activity, probably due to the larger substrate binding-pocket in GGB, which might accommodate the farnesyl-diphosphate (Johnson et al., 2005). Overexpression of GGB complemented the eral phenotype and the double mutant ggb-2 era1-4 was shown to exhibit a phenotype similar to pluripetala (pip), a mutant in the a-subunit of prenyltransferase which exhibits an aggravated era 7-like phenotype (Running et al., 2004; Johnson et al., 2005). However, in our cross between ggb-2 and era 1-7, both in the Col-0 ecotype background, we did not see the drastic increase of floral meristem size and the plants resembled era1-7 (data not shown). It has been shown previously for the wig mutants that backcrosses with Col-0 increased the number of floral organs (Running et al., 1998). Hence, the p/p-like phenotype observed in the ggb-2 era1-4 double mutant may result from the hybrid Col-0 and Ler ecotype cross (era1-4 is wigl isolated in the Ler ecotype). The differential requirement for farnesylation and geranylgeranylation in defence responses suggests that one or more targets of farnesyltransferase are involved in defence signalling. Farnesyl- and geranylgeranyltransferase target proteins differ with respect to their C-terminal CaaX consensus sequence. The C represents the prenylation target cysteine, whereas 'a' indicates an aliphatic amino acid. While the X in farnesylated proteins stands for methionine, alanine, glutamine, serine or cysteine, the geranylgeranylated proteins usually have a leucine in this position (Rodriguez-Concepcion et al., 1999). Since sequencing of the Arabidopsis genome has been completed, more than 100 proteins with a PFT CaaX consensus sequence at the C-terminus have been identified, roughly twice the number identified in the human genome (Galichet and Gruissem, 2003; Roskoski, 2003). Among putative prenylated proteins with a CaaX consensus, cell cycle regulators, metal-binding proteins and signalling proteins represent the majority (Galichet and Gruissem, 2003). It is tempting to speculate about a requirement for specific farnesylated proteins in defence responses, and some prenylated proteins have been associated with plant-pathogen interactions. AIG1 (avrRpt2 induced gene 1) was 63 identified as rapidly upregulated transcriptionally in response to infection with P.s.m. ES4326 AvrRpt2 (Reuber and Ausubel, 1996) and the amino acid sequence of the predicted protein terminates in the geranylgeranylation consensus sequence CSIL. The Arabidopsis genome contains a small family of AIG1-like proteins clustered on chromosome 1, and their function is predicted to involve GTP-binding. Other G-proteins, that contain the geranylgeranylation consensus sequence, are members of the plant ras (rat sarcome oncogene product) related C3 botulinum toxin substrate (RAC)/Rho of plants (ROP) family, which have been implicated in the susceptible interaction between barley and the powdery mildew Blumeria gramins f.sp. hordei [Bgn) (Schultheiss et al., 2003). The functional analogs of RAC/ROP proteins in animals, Rho, are involved in cytoskeleton reorganization (Takai et al., 2001). Interestingly, one of the RAC proteins in barley has been connected to cell polarization and actin rearrangements in the interaction with Bgh (Opalski et al., 2005). Both of these examples concern geranylgeranylation targets involved in defence responses, leaving an open question as to why mutations in farnesyltransferase, but not geranylgeranyltransferase so severely affected resistance responses in our study. We attempted to investigate potential farnesylated signalling components by a reverse genetics approach using available T-DNA insertion lines from the Arabidopsis stock center and a collection from P. McCourt. After testing 25 homozygous knockout lines, we did not find any mutants that were affected in their response to avirulent P.p. Emwal to the same extent as eral (S.G. unpublished data). However, one has to be cautious with the interpretation of these results, given that not all potential targets were tested due to unavailability of T-DNA insertions in a number of interesting genes (such as AIG1) or potential redundancies among protein family members. Another perspective for the role of ERA1 in defence signalling is a link to abiotic stresses via its involvement in ABA signalling. Recent studies using mutants impaired in ABA production and signalling indicate a negative correlation between ABA and susceptibility to biotrophic and necrotrophic pathogens (Mauch-Mani and Mauch, 2005). For example, reduced levels of ABA in aba1-1 64 mutant plants correlated with increased resistance towards virulent and avirulent Peronospora isolates, but the ABA insensitive mutant abi1-1 displayed wild type susceptibility (Mohr and Cahill, 2003). Interestingly, eral suppresses ABA insensitivity of abil and the two genes are hypothesized to function in parallel pathways in guard cell responses (Pei et al., 1998). The fact that eral and abal mutations, but not abil, affect defence responses might therefore indicate the existence of a complicated network integrating ABA and resistance signalling. Indeed, gene expression profiling experiments unveiled antagonistic interactions between ABA and wound-responsive signalling pathways employing jasmonic acid (JA) and ethylene (Anderson et al., 2004). The transcriptional activator AtMYC2 was shown to be involved in ABA- and JA-responsive gene activation during drought stress and pathogen attack (Abe et al., 2003; Lorenzo et al., 2004). In the tomato - Botrytis cinerea interaction, antagonistic interactions between ABA and SA signalling were observed (Audenaert et al., 2002). Finally, ABA signalling in guard cells has been shown to play an important role in the initial recognition of bacterial pathogens on the leaf surface and their potential for invasion through the stomata in an SA-dependent manner (Melotto et al., 2006). Taken together, previous results and data presented in this study indicate complex cross-talk between development, biotic and abiotic stress signalling, shedding light on a more extensive involvement of ABA in defence responses than previously suggested. It will be interesting to further dissect the detailed function of farnesylation and ABA in disease resistance. 65 3.4 Experimental procedures 3.4.1 Plant growth and mutant characterization Plants were grown at 22°C under long-day conditions (16h light/8h dark). Seeds were surface-sterilized using 5% hypochlorite solution and stratified for 7 days at 4°C before sowing. The screen for suppressors of the snd npr1-1 double mutant was described previously (Zhang and Li, 2005). pBGL2-GUS expression was determined by histochemical staining of 20-day old seedlings grown on MS following standard protocols. Measurements of endogenous SA levels were performed as described (Li et al., 1999). RNA extraction and semi-quantitative RT-PCR were performed as described (Zhang et al., 2003). 3.4.2 Pathogen assays For Pseudomonas infection assays, 5-week old soil-grown plants were infiltrated with a bacterial suspension in 10 mM MgCI2 at an optical density of OD 6 0o = 0.0001 for virulent P. s.m. ES4326 or OD 6 0 o= 0.001 for avirulent P.s.m. and P.s.f. using a blunt syringe. Bacterial growth was measured 3 days post-infection (dpi) by harvesting leaf discs and determining colony forming units (cfu). Peronospora parasitica isolates Noco2 and Emwal were inoculated on 2-week-old seedlings at a concentration of 5 x 105 conidiospores per ml. At 7 dpi, conidiospores were quantified by harvesting replicate samples of 15 plants, vortexing and counting using a hemocytometer. Plant necrosis and hyphal growth were visualized using lactophenol trypan blue staining following a protocol by Koch and Slusarenko (1990). All experiments were repeated at least twice with similar results. 66 3.4.3 Positional cloning of mos8 The markers used to map mos8 were derived from the Ler/Col-0 polymorphism database provided by Monsanto on the TAIR homepage (Jander etal., 2002; http://www.arabidopsis.org/Cereon/). Marker MUL8 was amplified using primers MUL8-F (5'-aaggttaatagacctgtcgg-3') and MUL8-R (5'-aagcacaagccatttgacca-3') yielding PCR-fragments of 285 and 174 bp in Col-0 and Ler, respectively. Marker K1013 was amplified using primers K1013-F (5'-tgatcacaacttcaccattg-3') and K1013-R (5'-aatgtaaacaccaaagctgc-3') yielding PCR-fragments of 352 and 230 bp in Col-0 and Ler, respectively. Marker MSN9-2 was amplified using primers MSN9-2F (5'-gtggagaagtgggtttatgg-3') and MSN9-2R (5'-cgggaagatttgagagcagc-3') yielding PCR-fragments of 265 bp in Col-0 and Ler, which were digested with HincW only in Ler. The marker MP012-3 was amplified using primers MP012-3F (5'-agacgtttatagcttcggag-3') and MP012-3R (5'-actggttggagatggaatcg-3') yielding 397 bp PCR-fragments in both ecotypes, which upon digestion with Taq\ generated four fragments in Col-0 and three in Ler. 3.4.4 Complementation of mos8 with ERA1 cDNA ERA1 cDNA was amplified using Platinum Pfx DNA polymerase (Invitrogen, Carlsbad, CA) with primers ERA1short_5'_EcoR1: 5'-agaattcatgqaaqaqctttcaaqcc-3' and ERA1 short_3_Not1: 5'-ttttqcqgccqctcatqctqctttaaaqaaqaac-3', containing novel restriction sites (underlined). The PCR fragment was subcloned into pBluescript (Alting-Mees et al., 1992) using EcoR1 and A/or1, and sequenced. The fragment was subcloned into pBIN1.4 (Mindrinos et al., 1994) under the control of the CaMV-35S promoter and transformed into mos8 snd npr1-1 using the Agrobacterium floral dip method (Clough and Bent, 1998). Transformants were identified based on kanamycin resistance. 67 3.4.5 Generating the eraf-7 single and double mutants To generate the era1-7 single and the era1-7 snd and era1-7 npr1-1 double mutant, mos8 snd npr1-1 was crossed with Col-0 carrying the pBGL2::GUS reporter transgene. Mutant combinations were identified among the F2 progeny of selfed F1 plants based on morphological phenotypes and genotyping. Homozygosity of snd in the era1-7 snd double mutant was confirmed by backcrossing with snd, all F1 progeny displayed snd morphology. 3.4.6 Identification of homozygous T-DNA mutant plants The era 1-8 allele was identified in Salk_110517 using the gene-specific primers Salk_110517-A (5'-agaacacaaggggctgcctg-3') and Salk_110517-B (5'-tgcttccctcttccttgatg-3'). Homozygous ggb-2 mutant plants were identified in Salk_040904 using gene-specific primers Salk_040904-A (5'-tagtaggaaaggcctggaag-3') and Salk_040904-B (5'- gatccaagtgtccttgaacg-3'). Presence of either T-DNA was verified using a combination of Lba1 and Salk 040904-A or Salk_110517-A 68 3.5 References Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2003). Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15, 63-78. Alonso, J.M., Stepanova, A.N., Leisse, et al. (2003). Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653-657. Alting-Mees, M.A., Sorge, J.A., and Short, J.M. (1992). pBluescriptll: multifunctional cloning and mapping vectors. Methods Enzymol 216, 483-495. Anderson, J.P., Badruzsaufari, E., Schenk, P.M., Manners, J.M., Desmond, O.J., Ehlert, C , Maclean, D.J., Ebert, P.R., and Kazan, K. (2004). Antagonistic interaction between abscisic acid and jasmonate-ethylene signaling pathways modulates defense gene expression and disease resistance in Arabidopsis. Plant Cell 16, 3460-3479. Audenaert, K., De Meyer, G.B., and Hofte, M.M. (2002). Abscisic acid determines basal susceptibility of tomato to Botrytis cinerea and suppresses salicylic acid-dependent signaling mechanisms. Plant Physiol 128, 491-501. Ausubel, F.M. (2005). Are innate immune signaling pathways in plants and animals conserved? Nat Immunol 6, 973-979. Becker, F., Buschfeld, E., Schell, J. , and Bachmair, A. (1993). Altered response to viral infection by tobacco plants perturbed in ubiquitin system. Plant J 3, 875-881. Belkhadir, Y., Subramaniam, R., and Dangl, J.L. (2004). Plant disease resistance protein signaling: NBS-LRR proteins and their partners. Curr Opin Plant Biol 7, 391-399. Bonetta, D., Bayliss, P., Sun, S., Sage, T., and McCourt, P. (2000). Farnesylation is involved in meristem organization in Arabidopsis. Planta 211, 182-190. Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium-med'iated transformation of Arabidopsis thaliana. Plant J 16,735-743. Cutler, S., Ghassemian, M., Bonetta, D., Cooney, S., and McCourt, P. (1996). A protein farnesyl transferase involved in abscisic acid signal transduction in Arabidopsis. Science 273, 1239-1241. Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina-Escobar, N., Neu, C , Cabral, A., and Parker, J.E. (2005). Arabidopsis SENESCENCE-ASSOCIATED GENE101 stabilizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity. Plant Cell 17, 2601-2613. 69 Galichet, A., and Gruissem, W. (2003). Protein farnesylation in plants-conserved mechanisms but different targets. Curr Opin Plant Biol 6, 530-535. Gonzalez-Lamothe, R., Tsitsigiannis, D.I., Ludwig, A.A., Panicot, M., Shirasu, K., and Jones, J.D. (2006). The U-box protein CMPG1 is required for efficient activation of defense mechanisms triggered by multiple resistance genes in tobacco and tomato. Plant Cell 18, 1067-1083. Johnson, CD., Chary, S.N., Chernoff, E.A., Zeng, Q., Running, M.P., and C rowel I, D.N. (2005). Protein geranylgeranyltransferase I is involved in specific aspects of abscisic acid and auxin signaling in Arabidopsis. Plant Physiol 139, 722-733. Kawasaki, T., Nam, J. , Boyes, D.C., Holt, B.F., 3rd, Hubert, D.A., Wiig, A., and Dangl, J.L. (2005). A duplicated pair of Arabidopsis RING-finger E3 ligases contribute to the RPM1- and RPS2-mediated hypersensitive response. Plant J 44, 258-270. Kim, H.S., and Delaney, T.P. (2002). Arabidopsis SON1 is an F-Box protein that regulates a novel induced defense response independent of both salicylic acid and systemic acquired resistance. Plant Cell 14, 1469-1482. Kim, H.S., Desveaux, D., Singer, A.U., Patel, P., Sondek, J., and Dangl, J.L. (2005). The Pseudomonas syringae effector AvrRpt2 cleaves its C-terminally acylated target, RIN4, from Arabidopsis membranes to block RPM1 activation. Proc Natl Acad Sci USA 102, 6496-6501. Koch, E., and Slusarenko, A. (1990). Arabidopsis is susceptible to infection by a downy mildew fungus. Plant Cell 2, 437-445. Li, X., Clarke, J.D., Zhang, Y., and Dong, X. (2001). Activation of an EDS1-mediated R-gene pathway in the snd mutant leads to constitutive, NPR1-independent pathogen resistance. Mol Plant Microbe Interact 14,1131-1139. Li, X., Zhang, Y., Clarke, J.D., Li, Y., and Dong, X. (1999). Identification and cloning of a negative regulator of systemic acquired resistance, SNI1, through a screen for suppressors of npr1-1. Cell 98, 329-339. Lorenzo, O., Chico, J.M., Sanchez-Serrano, J.J., and Solano, R. (2004). JASMONATE-INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis. Plant Cell 16, 1938-1950. Mauch-Mani, B., and Mauch, F. (2005). The role of abscisic acid in plant-pathogen interactions. Curr Opin Plant Biol 8, 409-414. Melotto, M., Underwood, W., Koczan, J., Nomura, K., and He, S.Y. (2006). Plant stomata function in innate immunity against bacterial invasion. Cell 126, 969-980. 70 Mindrinos, M., Katagiri, F., Yu, G.L., and Ausubel, F.M. (1994). The A. thaliana disease resistance gene RPS2 encodes a protein containing a nucleotide-binding site and leucine-rich repeats. Cell 78,1089-1099. Mohr, P.G., and Cahill, D.M. (2003). Abscisic acid influences the susceptibility of Arabidopsis thaliana to Pseudomonas syringae pv. tomato and Peronospora parasitica. Funct Plant Biol 30, 461-469. Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113, 935-944. Nimchuk, Z., Eulgem, T., Holt, B.F., 3rd, and Dangl, J.L. (2003). Recognition and response in the plant immune system. Annu Rev Genet 37, 579-609. Opalski, K.S., Schultheiss, H., Kogel, K.H., and Huckelhoven, R. (2005). The receptor-like MLO protein and the RAC/ROP family G-protein RACB modulate actin reorganization in barley attacked by the biotrophic powdery mildew fungus Blumeria graminis f.sp. hordei. Plant J 41, 291-303. Palma, K., Zhang, Y., and Li, X. (2005). An importin alpha homolog, MOS6, plays an important role in plant innate immunity. Curr Biol 15, 1129-1135. Park, H.W., Boduluri, S.R., Moomaw, J.F., Casey, P.J., and Beese, L.S. (1997) . Crystal structure of protein farnesyltransferase at 2.25 angstrom resolution. Science 275,1800-1804. Pei, Z.M., Ghassemian, M., Kwak, CM., McCourt, P., and Schroeder, J.I. (1998) . Role of farnesyltransferase in ABA regulation of guard cell anion channels and plant water loss. Science 282, 287-290. Reuber, T.L., and Ausubel, F.M. (1996). Isolation of Arabidopsis genes that differentiate between resistance responses mediated by the RPS2 and RPM1 disease resistance genes. Plant Cell 8, 241-249. Rodriguez-Concepcion, M., Yalovsky, S., and Gruissem, W. (1999). Protein prenylation in plants: old friends and new targets. Plant Mol Biol 39, 865-870. Roskoski, R., Jr. (2003). Protein prenylation: a pivotal posttranslational process. Biochem Biophys Res Commun 303, 1-7. Running, M.P., Fletcher, J . C , and Meyerowitz, E.M. (1998). The WIGGUM gene is required for proper regulation of floral meristem size in Arabidopsis. Development 125, 2545-2553. Running, M.P., Lavy, M., Sternberg, H., Galichet, A., Gruissem, W., Hake, S., Ori, N., and Yalovsky, S. (2004). Enlarged meristems and delayed growth in pip mutants result from lack of CaaX prenyltransferases. Proc Natl Acad Sci USA 101, 7815-7820. Schultheiss, H., Dechert, C , Kogel, K.H., and Huckelhoven, R. (2003). Functional analysis of barley RAC/ROP G-protein family members in susceptibility to the powdery mildew fungus. Plant J 36, 589-601. 71 Takai, Y., Sasaki, T., and Matozaki, T. (2001). Small GTP-binding proteins. Physiol Rev 81, 153-208. Therrien, M., Chang, H.C., Solomon, N.M., Karim, F.D., Wassarman, D.A., and Rubin, G.M. (1995). KSR, a novel protein kinase required for RAS signal transduction. Cell 83, 879-888. Trueblood, C.E., Ohya, Y., and Rine, J. (1993). Genetic evidence for in vivo cross-specificity of the CaaX-box protein prenyltransferases farnesyltransferase and geranylgeranyltransferase-l in Saccharomyces cerevisiae. Mol Cell Biol 13, 4260-4275. Wang, Y., Ying, J., Kuzma, M., Chalifoux, M., Sample, A., McArthur, C , Uchacz, T., Sarvas, C , Wan, J., Dennis, D.T., McCourt, P., and Huang, Y. (2005). Molecular tailoring of farnesylation for plant drought tolerance and yield protection. Plant J 43,413-424. Wiermer, M., Feys, B.J., and Parker, J.E. (2005). Plant immunity: the EDS1 regulatory node. Curr Opin Plant Biol 8, 383-389. Yalovsky, S., Kulukian, A., Rodriguez-Concepcion, M., Young, C.A., and Gruissem, W. (2000). Functional requirement of plant farnesyltransferase during development in Arabidopsis. Plant Cell 12,1267-1278. Yang, C.W., Gonzalez-Lamothe, R., Ewan, R.A., Rowland, O., Yoshioka, H., Shenton, M., Ye, H., O'Donnell, E., Jones, J.D., and Sadanandom, A. (2006). The E3 ubiquitin ligase activity of Arabidopsis PLANT U-BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense. Plant Cell 18, 1084-1098. Zhang, Y., and Li, X. (2005). A putative nucleoporin 96 is required for both basal defense and constitutive resistance responses mediated by suppressor of npr1-1,constitutive 1. Plant Cell 17,1306-1316. Zhang, Y., Goritschnig, S., Dong, X., and Li, X. (2003). A gain-of-function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1. Plant Cell 15, 2636-2646. Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proc Natl Acad Sci USA 96, 6523-6528. Zhang, Y., Cheng, Y.T., Bi, D., Palma, K., and Li, X. (2005). MOS2, a protein containing G-patch and KOW motifs, is essential for innate immunity in Arabidopsis thaliana. Curr Biol 15,1936-1942. Ziegelhoffer, E.C., Medrano, L.J., and Meyerowitz, E.M. (2000). Cloning of the Arabidopsis WIGGUM gene identifies a role for farnesylation in meristem development. Proc Natl Acad Sci USA 97, 7633-7638. 72 4. Discussion 4.1 Use for the auto-immune snd model in plant resistance studies Agricultural crop production registers significant losses annually due to phytopathogenic attacks. In plant-pathogen interactions, R proteins have been identified as the principal sentries responsible for surveillance in the plant cell. Upon recognition of pathogenic elicitors, R protein activation triggers major transcriptional reprogramming leading to pathogen containment and resistance. On the one hand, much is known about the physiological outcome of R protein activation, such as production of reactive oxygen intermediates, induction of SA and phytoalexin production and expression of pathogenesis-related proteins with toxic effects to the attacking pathogen. On the other hand, only a few key signalling players responsible for those physiological changes have been characterized in depth so far, and much is yet to be learned about the detailed pathways involved in defence responses. This thesis describes the discovery of two genes with important roles in plant resistance, which were identified based on suppression of a gain-of-function R gene allele conferring constitutive resistance, snd. The snd mutant is unique in that it constitutes the only reported gain-of-function R gene in which enhanced resistance is not associated with constitutive cell death, as observed in several lesion mimic mutants. For example, mutations in the NBS and LRR regions of the potato R genes Rx or of ssi4 in Arabidopsis result not only in enhanced resistance, but also in constitutive HR and the formation of spontaneous lesions (Bendahmane et al., 2002; Shirano et al., 2002). The position of the snd mutation in the linker region connecting the NBS and LRR domains suggests that constitutive activation of SNC1 results from a conformational rearrangement between the domains, thereby potentially losing the ability to associate with a negative regulator (Zhang et al., 2003). The absence of deleterious side effects, such as spontaneous lesion formation, make snd an excellent model to study signalling downstream of activated R proteins. Suppressors of constitutive HR in lesion-mimic mutants such as Rx or ssi4 would likely constitute components of 73 the cell-death pathway rather than genes involved in R protein signalling, and thus make it difficult to discern between the two. 4.2 Identification of novel defence signalling components using snd Using the snd mutant as a background for a suppressor screen, a number of mos (modifier of snd) mutants were identified that completely or partially suppress snct-mediated morphological and resistance phenotypes. The identity of some of them unveiled new perspectives on defence signalling pathways not only in plants, but also in animal innate immunity, where their homologs might perform similar functions. MOS2, a nuclear protein with putative RNA binding-activity, is involved in basal and R protein mediated defences and might control transcript levels of regulatory genes during resistance responses (Zhang et al., 2005). The significance of nucleo-cytoplasmic trafficking was obvious from the fact that defence responses coincide with transcriptional reprogramming, including the de novo expression of pathogenesis-related genes. The important regulatory protein NPR1 was shown to shuttle between cytoplasm and nucleus, where it associates with transcription factors to actively initiate PR gene transcription (Zhang et al., 1999; Mou et al., 2003). Three mos mutants affecting nucleo-cytoplasmic transport were identified in the snd suppressor screen, with lesions in the importin alpha homolog MOS6 and the nucleoporins MOS3 and MOS7 (Palma et al., 2005; Zhang and Li, 2005; Cheng, Y. et al., unpublished data). All of these affect basal and R protein resistance. MOS3 likely serves as a gateway for mRNA export while MOS6 and MOS7 are involved in protein import (Vasu et al., 2001; Palma et al., 2005; Cheng, Y. et al., unpublished data). The mos mutants described in this work reveal a requirement for ubiquitination and farnesylation in defence responses, implying a global role for protein modification in defence signalling. 74 4.3 Post-translational protein modification in plant defence An effective immune response requires intricate networks of regulatory signalling pathways. Appropriate spatial and temporal distribution of the contributing proteins is imperative for proper function. A variety of post-translational modifications assists in correct targeting of the protein to the right cell compartment, facilitates secretion or membrane association or helps in the assembly of multi-molecular protein complexes. Proteins are frequently modified by attachment of carbohydrate moieties, fatty acids or prenyl groups, all of which alter the surface properties of the protein and aid in their interaction with hydrophilic and hydrophobic environments or other proteins. Chemical modification of amino acids in a protein, such as methylation, can also alter the protein properties. Transient modifications include phosphorylation or ubiquitination, and these are typically employed to alter the activity and stability of proteins. An association between protein modification and defence signalling has been reported for protein phosphorylation, where Mitogen Activated Protein (MAP) Kinase cascades play a pivotal role in resistance to viruses and non-host pathogens (Zhang and Klessig, 2001). There is, however, a limit to the complexity of how proteins can be modified by phosphorylation. Recent reports are proposing an emerging role for the versatile and reversible protein modification by ubiquitination in plant defenses. Ubiquitination has been implicated in plant-virus interactions (Becker et al., 1993) and a number of ubiquitin ligases have been shown to be important in plant resistance responses (Kim and Delaney, 2002; Kawasaki et al., 2005; Gonzalez-Lamothe et al., 2006; Yang etal., 2006). The work presented here provides novel aspects for the involvement of protein modification in defence responses. MOS5 pinpoints the requirement of ubiquitination in plant innate immunity, and MOS8/ERA1 constitutes the first report of the involvement of farnesylation in defence. 75 4.4 Perspectives for future research The fact that mos5 as well as mos8 contain mutations in enzymes involved in the first step of two important modification pathways adds another layer of complexity to defence signalling networks. It is tempting to speculate about regulatory roles of the proteins targeted for modification, but the identity of those so far remains elusive. In an initial attempt, a number of available T-DNA insertion mutant lines in genes coding for potential farnesyltransferase target proteins were screened for alterations in disease phenotypes. No significant difference was observed compared to wildtype Col-0 for the lines tested. However, since the number of farnesylation targets is limited by their carboxy-terminal consensus sequence, a systematic reverse genetics approach could be used to identify the one(s) involved in defence signalling. Screening a complete selection of homozygous insertion mutant lines for defence-related phenotypes is labour intensive but doable. One difficulty using this approach could be the potential redundancy of target proteins, since some of them are present in large families in Arabidopsis. It might be necessary to generate multiple knockouts for those or, alternatively, RNA interference-based approaches could be used to knock down expression of closely related genes simultaneously. Alternatively, defence-related target proteins of farnesyltransferase could be identified in an eral suppressor screen, looking for abrogation of enhanced susceptibility towards virulent and avirulent pathogens. A similar approach could be used to identify M0S5 target proteins, except here one would have to target the enzymes catalyzing the second step of ubiquitination, the conjugating enzymes, or E2s. The complexity of the ubiquitination network, with around 40 E2s and hundreds of E3s, which work together to specifically ubiquitinate proteins to alter their stability or functionality, poses a significant challenge in this respect (Bachmair et al., 2001). The mos5 mutation lies within the carboxy-terminal region of UBA1, which is potentially involved in binding of E2s. Thus, protein-protein interaction assays could aid in identifying the E2s, which might discriminate between UBA1 and M0S5. 76 However, it cannot be ruled out that binding of all E2s is affected by the mos5 mutation, and that it can be partially compensated for by the alternative E1, UBA2. This hypothesis is supported by the observation that a double mutant mos5 uba2 is lethal. A different approach to unravel the contribution of MOS5 in defence signalling would be to investigate the mos5 mutant in the context of E3 ligases that have been documented to participate in defence responses. One could generate mutant combinations with mos5 and E3 mutants, if available, or one could compare E3 functions between mos5 and the wild type. 4.5 Conclusion The identification of mos5 and mos8 in a screen for suppressors of a constitutively active R protein has added significantly to the complexity of signalling networks in plant disease resistance. Transient and stable modifications are known to be important in specifying a protein's localization and activity, and the data described in this thesis highlight the particular importance of ubiquitination and farnesylation in plant defence responses. However, identification of a defence-related role for the ubiquitin activating enzyme and farnesyltransferase represent only the "tip of the iceberg", and the much larger body of the downstream targets remains to be brought to light. Much research is still needed to fully understand the role and involvement of these protein modification pathways in resistance responses, and this thesis presents a first stepping stone. 77 4.6 References Bachmair, A., Novatchkova, M., Potuschak, T., and Eisenhaber, F. (2001). Ubiquitylation in plants: a post-genomic look at a post-translational modification. Trends Plant Sci 6, 463-470. Becker, F., Buschfeld, E., Schell, J. , and Bachmair, A. (1993). Altered response to viral infection by tobacco plants perturbed in ubiquitin system. Plant J 3, 875-881. Bendahmane, A., Farnham, G., Moffett, P., and Baulcombe, D.C. (2002). Constitutive gain-of-function mutants in a nucleotide binding site-leucine rich repeat protein encoded at the Rx locus of potato. Plant J 32, 195-204. Gonzalez-Lamothe, R., Tsitsigiannis, D.I., Ludwig, A.A., Panicot, M., Shirasu, K., and Jones, J.D. (2006). The U-Box protein CMPG1 is required for efficient activation of defense mechanisms triggered by multiple resistance genes in tobacco and tomato. Plant Cell 18, 1067-1083. Kawasaki, T., Nam, J. , Boyes, D.C, Holt, B.F., 3rd, Hubert, D.A., Wiig, A., and Dangl, J.L. (2005). A duplicated pair of Arabidopsis RING-finger E3 ligases contribute to the RPM1- and RPS2-mediated hypersensitive response. Plant J 44, 258-270. Kim, H.S., and Delaney, T.P. (2002). Arabidopsis SON1 is an F-box protein that regulates a novel induced defense response independent of both salicylic acid and systemic acquired resistance. Plant Cell 14, 1469-1482. Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113, 935-944. Palma, K., Zhang, Y., and Li, X. (2005). An importin alpha homolog, MOS6, plays an important role in plant innate immunity. Curr Biol 15, 1129-1135. Shirano, Y., Kachroo, P., Shah, J. , and Klessig, D.F. (2002). A gain-of-function mutation in an Arabidopsis Toll Interleukinl receptor-nucleotide binding site-leucine-rich repeat type R gene triggers defense responses and results in enhanced disease resistance. Plant Cell 14, 3149-3162. Vasu, S., Shah, S., Orjalo, A., Park, M., Fischer, W.H., and Forbes, D.J. (2001). Novel vertebrate nucleoporins Nup133 and Nup160 play a role in mRNA export. J Cell Biol 155, 339-354. Yang, C.W., Gonzalez-Lamothe, R., Ewan, R.A., Rowland, O., Yoshioka, H., Shenton, M., Ye, H., O'Donnell, E., Jones, J.D., and Sadanandom, A. (2006). The E3 ubiquitin ligase activity of Arabidopsis PLANT U-BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense. Plant Cell 18,1084-1098. Zhang, S., and Klessig, D.F. (2001). MAPK cascades in plant defense signaling. Trends Plant Sci 6, 520-527. 78 Zhang, Y., and Li, X. (2005). A putative nucleoporin 96 is required for both basal defense and constitutive resistance responses mediated by suppressor of npr1-1,constitutive 1. Plant Cell 17, 1306-1316. Zhang, Y., Goritschnig, S., Dong, X., and Li, X. (2003). A gain-of-function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1. Plant Cell 15, 2636-2646. Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-7 gene. Proc Natl Acad Sci USA 96, 6523-6528. Zhang, Y., Cheng, Y.T., Bi, D., Palma, K., and Li, X. (2005). MOS2, a protein containing G-patch and KOW motifs, is essential for innate immunity in Arabidopsis thaliana. Curr Biol 15,1936-1942. 79 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100388/manifest

Comment

Related Items