UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Androgen regulated genes in prostate cancer cells Cochrane, Dawn Renee 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
831-ubc_2007-266984.pdf [ 18.33MB ]
Metadata
JSON: 831-1.0100342.json
JSON-LD: 831-1.0100342-ld.json
RDF/XML (Pretty): 831-1.0100342-rdf.xml
RDF/JSON: 831-1.0100342-rdf.json
Turtle: 831-1.0100342-turtle.txt
N-Triples: 831-1.0100342-rdf-ntriples.txt
Original Record: 831-1.0100342-source.json
Full Text
831-1.0100342-fulltext.txt
Citation
831-1.0100342.ris

Full Text

ANDROGEN REGULATED GENES IN PROSTATE CANCER CELLS by DAWN RENEE COCHRANE B.Sc, University of Victoria, 2000 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Genetics) THE UNIVERSITY OF BRITISH COLUMBIA March 2007 ©Dawn Renee Cochrane, 2007 Abstract Prostate cancer is a leading cause of cancer death in Canadian men. Prostate tumors initially depend on androgens for survival and androgen ablation is an effective therapy. Prostate cancer adapts to the androgen depleted environment and begins to grow in an androgen independent (Al) form. Androgens exert their effects through the action of the androgen receptor (AR), a ligand dependent transcription factor. AR is important for cell survival and appears central to the progression of prostate cancer to Al . The hypothesis driving the present studies is that androgen regulated genes are reactivated during prostate cancer progression to Al and as such, identification of novel androgen regulated genes will provide new targets for which therapeutics can be directed. To discover novel androgen regulated genes, cultured prostate cells were treated with androgens and an expression profile generated using a microarray screen. Validation of the microarray experiment revealed the upregulation of genes involved in cell survival (GADD45G), development of drug resistance (MRP4) and protection against oxidative stress (NFE2L2), while a pro-apoptotic gene (BARD1) was down regulated. Probing a tissue microarray, GADD45G was found upregulated in Al prostate cancer. In vitro studies revealed that GADD45G is important for cell survival and acts as a control point for several critical intracellular signaling cascades. One surprising result was that while GADD45G mRNA levels increase with androgens, protein levels decrease. A miRNA, hsa-miR-326 was found to be responsible for inhibition of GADD45G translation and this inhibition could be relieved under stress conditions such as treatment with high levels of taxol. Clusterin, a gene involved in apoptosis, has two isoforms resulting from alternate transcriptional start sites and ii these were found to be differentially regulated by androgens. Initial transcripts of both isoforms encode an anti-apoptotic protein; however Isoform 1 can be spliced into a pro-apoptotic form, while Isoform 2 cannot. Isoform 1 was found to be repressed by androgens while Isoform 2 is upregulated, consistent with androgens being cytoprotective in prostate cells. The work presented here highlights the importance of androgen regulated genes in prostate cancer survival and identifies GADD45G and clusterin as being potential targets for therapeutics. iii Table of Contents Page Abstract ii Table of Contents iv List of Tables viii List of Figures ix List of Abbreviations xii Acknowledgements and Dedication xv Co-Authorship Statement xvi Chapte r 1. Literature Rev iew, Hypo thes i s a n d Ob ject ives 1 1.1 The Prostate 1 1.2 Androgens and the Androgen Receptor 5 1.2.1 Steroid Receptors 6 1.2.2 Androgen Receptor Gene 7 1.2.3 Ligand Binding Domain 7 1.2.4 DNA Binding Domain 10 1.2.5 Hinge Region 11 1.2.6 N-terminal Domain 12 1.2.7 AR Coregulators 13 1.2.8 AR Post Translational Modifications 15 1.2.9 AR Regulated Gene Expression 16 1.3 Prostate Cancer 20 iv 1.3.1 Risk Factors 21 1.3.2 Gleason Grading 23 1.3.3 Androgen Ablation Therapy 25 1.4 Androgen Independence 27 1.4.1 AR Amplification 28 1.4.2 Hypersensitivity to Androgens 29 1.4.3 AR Mutations 29 1.4.4 AR Coregulators 30 1.4.5 AR Activation by Growth Factors 31 1.4.6 AKT Pathway 32 1.4.7 Non-AR Related Pathways 33 1.5 LNCaP Cell Line and Tumor Model 34 1.6 Scope of Thesis 35 1.6.1 Hypothesis 35 1.6.2 Specific Aims 35 1.7 References 38 Chapter 2. Expression Profiling of Androgen Regulated Genes in LNCaP Cells Using Microarrays 62 2.1 Introduction 62 2.2 Materials and Methods 64 2.3 Results 68 2.4 Discussion 79 2.5 References 85 v Chapter 3. GADD45G is a Key Mediator of Multiple Signaling Pathways in Prostate Cancer Cells 89 3.1 Introduction 89 3.2 Methods and Materials 91 3.3 Results 94 3.4 Discussion 103 3.5 References 109 Chapter 4. The miRNA hsa-miR-326 Targets GADD45G mRNA and Inhibits its Translation 113 4.1 Introduction 113 4.2 Materials and Methods 115 4.3 Results 120 4.4 Discussion 130 4.5 References 134 Chapter 5. Differential Regulation of Clusterin and its Isoforms by Androgens in Prostate Cells 139 5.1 Introduction 139 5.2 Materials and Methods 142 5.3 Results 148 5.4 Discussion 161 5.5 References 165 Chapter 6. Discussion 171 6.1 Microarray Technologies 171 6.2 siRNA Technology 176 vi 6.3 miRNA Technologies 177 6.4 GADD45G as a Therapeutic Target 181 6.5 Clusterin as a Therapeutic Target 183 6.6 Androgen Regulated miRNAs 185 6.7 Significance of the Research 187 6.8 References 189 Appendix 1 Up and Down Regulated Genes in LNCaP cells 191 Appendix 2 Effect of dsRNA on Dicer Levels 196 Appendix 3 Androgen Regulation of miRNA Processing Machinery 198 vii Lis t of Tables Page Table AP 1.1 Genes upregulated 2 fold or more in all three time points in LNCaP cells treated with 1 nM R1881 191 Table AP 1.2 Genes downregulated 3 fold or more in all three time points in LNCaP cells treated with 1 nM R1881 193 vi i i List of Figures Page Figure 1.1 Diagram showing the location and size of the prostate in relation to adjacent anatomical structures 2 Figure 1.2 Cells of the prostate gland 3 Figure 1.3 The hypothalamus-pituitary-gonadal axis showing the steps involved in testosterone production as well as the production of adrenal androgens 6 Figure 1.4 Structure of the androgen receptor gene, mRNA and protein 8 Figure 1.5 Androgen action 17 Figure 1.6 Depiction of the histological features of Gleason grades 1 through 5, hand-drawn by Dr. Gleason 24 Figure 2.1 Differential gene expression in prostate cells in response to androgen treatment 69 Figure 2.2 GADD45G is an androgen regulated gene in LNCaP cells.... 72 Figure 2.3 MRP4 is upregulated in response to androgens in LNCaP cells 73 Figure 2.4 BARD1 is repressed by androgens in LNCaP cells 74 Figure 2.5 Ingenuity network showing an NFE2L2 pathway 75 Figure 2.6 Genes in the NFE2L2 antioxidant pathway upregulated by androgens 76 Figure 2.7 Downregulation of NFE2L2 with siRNA and effects on downstream genes 78 Figure 2.8 Downregulation of NFE2L2 with siRNA in the presence or absence of androgens and effects on downstream genes.... 79 ix Figure 3.1 GADD45G levels are reduced with NHT treatment and increased at androgen independence 95 Figure 3.2 GADD45G is involved in the phosphorylation of HSP27 97 Figure 3.3 Cell viability assay for LNCaPs with depleted GADD45G levels in response to taxol treatment 98 Figure 3.4 Proteins downstream of p38 kinase which are affected by GADD45G 101 Figure 3.5 Antibody array analysis of proteins affected by reduced GADD45G levels 102 Figure 3.6 Validation of antibody arrays 104 Figure 4.1 GADD45G mRNA levels increase with androgen treatment while GADD45G protein levels decrease 121 Figure 4.2 Microarray analysis of androgen treated cells reveals hsa-miR-326 and its source, arresting are upregulated by androgens 123 Figure 4.3 The miRNA, hsa-miR-326, is upregulated with androgens and targets the GADD45G mRNA 3' untranslated region 124 Figure 4.4 Inhibition of hsa-miR-326 relieves the translational repression of GADD45G 126 Figure 4.5 Taxol treatment results in GADD45G recovery from translational inhibition 127 Figure 4.6 Model for androgen inhibition of GADD45G translation followed by taxol recovery 129 Figure 5.1 Clusterin mRNA levels in response to androgen treatment... 149 Figure 5.2 Clusterin protein levels in response to androgen treatment... 151 Figure 5.3 Necessity of AR in clusterin upregulation 153 Figure 5.4 Transcriptional activation due to AR interaction with an enhancer region within the first intron of the clusterin genomic DNA 155 x Figure 5.5 Androgenic regulation of the two clusterin isoforms 158 Figure 5.6 Levels of clusterin isoforms in androgen dependent and independent LNCaP xenografts 160 Figure AP 2.1 Dicer mRNA levels are increased with transfection of dsRNA 196 Figure AP 2.2 Dicer protein levels are increased with transfection of dsRNA 197 Figure AP 2.3 Dicer mRNA levels increase in a dose responsive manner with transfection of dsRNA 197 Figure AP 3.1 Dicer mRNA levels increase with androgen treatment 198 Figure AP 3.2 Ago2 mRNA levels increase with androgen treatment 199 Figure AP 3.3 FMR1 mRNA levels increase with androgen treatment... 199 xi List of Abbreviations °c degrees Celsius ABC ATP-binding cassette ACTH adrenocorticotropin AD androgen dependent AF activation function Ago2 argonaute 2 Al androgen independence AR androgen receptor ARE androgen response element ASO antisense oligonucleotides ATRA all-trans-retanoic acid BARD1 BRCA1-associated RING domain 1 BPH benign prostatic hyperplasia BSA bovine serum albumin CBP CREB-binding protein cdk cyclin dependent kinase CGH comparative genomic hybridization ChIP chromatin immunoprecipitation CK cytokeratin cm centimeter C 0 2 carbon dioxide CSS charcoal stripped serum CZ central zone DBD DNA binding domain DBI diazapam binding inhibitor DEPC diethyl pyrocarbonate DES diethylstilbestrol DHEA dehydroepiandrosterone DHEA-S dehydroepiandrosterone sulphate DHT dihydrotestosterone d p m decintegrations per minute DRE digital rectal exam DTT dithiothreitol EGF epidermal growth factor elF4E eukaryotic translation initiation factor 4E ER estrogen receptor ER endoplasmic reticulum EtOH ethanol FAM fluorescein FBS fetal bovine serum FMR1 fragile X mental retardation 1 GADD45G growth arrest and DNA-damage inducible gamma GCLM glutamate-cysteine ligase, modifier subunit GR glucocorticoid receptor xii GRIP Glutamate receptor-interacting protein 1 GST glutatione S-transferases H&E haematoxylin and eosin HAT histone acetyl transferase HDAC histone deacetylase HSP heat shock protein IAS intermittent androgen suppression IGF-1 insulin-like growth-factor-1 IGFBP IGF binding protein JNK c-jun kinase KGF keratinocyte growth factor KLK kallikrein LBD ligand binding domain LH luteinizing hormone LHRH luteinizing hormone releasing hormone LNA locked nucleic acid M molar MDM2 mouse double minute 2 homolog miRNA microRNA mJ milli Joules MKNK1 MAPK-interacting kinase 1 ml milliliter mM millimolar mm millimeter MMS methyl methanesulfonate MR mineralcorticoid receptor MRP4 multidrug resistance-associated protein 4 MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4sulfophenyl)-2H-tetrazolium N 2 nitrogen NFE2L2 nuclear factor erythroid 2-like 2 ng nanogram NHT neoadjuvant hormone therapy NLS nuclear localization sequence nM nanomolar NQ01 NAD(P)H dehydrogenase, quinone 1 NTD N-terminal domain PAGE polyacrylamide gel electrophoresis PAK6 p21-activated kinase 6 PB processing body PBS phosphate buffered saline pCAF p300/CBP-associated factor PCNA proliferating cell nuclear antigen PCR polymerase chain reaction PDG 6-phosphogluconate dehydrogenase p-gp p-glycoprotein xiii PIN prostatic intraepithelial neoplasia PKA protein kinase A PMS phenazine methosulfate poly-G poly-glycine poly-Q poly-glutamine PR progesterone receptor PRDX1 peroxiredoxin PSA prostate specific antigen PTEN phosphatase and tensin homolog PVDF polyvinyl PZ peripheral zone RAR retinoic acid receptor Rb retinoblastoma RISC RNA-induced silencing complex RNA pol II RNA polymerase II RSK ribosomal protein S6 kinase RT room temperature RXR retinoic acid X receptor SAGE serial analysis of gene expression SDS sodium dodecyl sulphate SHBG sexual hormone binding globulin siRNA small interfering RNA SNP single nucleotide polymorphism SRC steroid receptor coactivator SSC saline sodium citrate SUMO-1 small ubiquitin-like molecule-1 T3 3,3',5-triiodo-L-thyronine TAMRA tetramethyl-6-caboxyrhodamine TFIIF general transcription factor IIF TGF transforming growth factor TMA tissue microarray TR thyroid hormone receptor TRPM-2 testosterone repressed prostate message 2 TXN thioredoxin TZ transition zone UTR untranslated region UV ultraviolet V volts VEGF vascular endothelial growth factor VSN variance stabilizing normalization pg microgram Ml microlitre xiv Acknowledgements and Dedication This work could not have been completed without the help of many people. I'd like to acknowledge my supervisor, Dr. Colleen Nelson, who has been an exceptional mentor to me through the duration of my thesis. Many of my fellow graduate students have been helpful both in the lab and in keeping me sane, especially Vanessa Thomson, Lindsay Brown, Leah Prentice and Melanie Lehman. I've had the benefit of working with postdoctoral fellows who have been very nurturing, including Dr. Susan Moore and Dr. Susan Ettinger. I would like to thank Robert Shukin, John Cavanagh and Steve Hendy, whose expertise and lab skills have been invaluable. I would also like to acknowledge the help from past and present members of the array centre, especially Nadine Tomlinson and Robert Bell. I'd like to express gratitude to the staff at the Prostate Center for all the memories. And finally, I'd like to thank my family and my friends for their continual encouragement. This thesis is dedicated to my husband, Robert Cochrane, for his support through this long process and for keeping me laughing the whole way. XV Co-Authorship Statement The work presented in this Ph.D. thesis was in part due to collaboration with other researchers. Those involved in the research are listed in the publication citations in each of the chapters. Their individual contributions to the research are outlined in a section preceding the Introduction of each chapter. xvi Chapter 1 Literature Review, Hypothesis and Objectives Prostate cancer is a frequently diagnosed disease in older men and one of the leading causes of cancer related deaths in Canada. The disease is initially regulated by androgens, but following androgen ablation therapy inevitably progresses to an androgen independent form which is refractory to therapies. The androgen receptor is ligand activated transcription factor and androgen receptor activity is essential for both prostate cancer survival and the development of androgen independence. I set out to determine which genes are regulated by androgens, as these may be important for survival of the prostate cancer cells and possibly targets for new therapeutics. To accomplish this, an mRNA microarray screen was done to look for novel genes which are regulated by androgens. In this Ph.D. dissertation, I describe the androgen regulation of several genes including GADD45G and clusterin, both of which are important for cell survival. Clusterin is currently being targeted for inhibition in multi-centre phase II trials. With the data obtained in this thesis, I provide evidence to suggest that GADD45G may also be an attractive therapeutic target. 1.1 The Prostate The prostate is a male specific glandular organ which sits below the bladder and surrounds the urethra (Figure 1.1). The prostate secretes proteins into the seminal fluid that are important for coating and uncoating the spermatozoa (1). One of the major secretory proteins of the prostate is the prostate specific antigen (PSA), or kallikrein 3. PSA is a protease which cleaves proteins that cause clotting of the ejaculate and the end result is increased sperm motility (2, 3). While not absolutely 1 necessary for fertility, prostate secretions are a major functional component of the seminal fluid and are involved in the physiological process of ejaculation. Figure 1.1 - Diagram showing the location and size of the prostate in relation to adjacent anatomical structures. Adapted from Goldenberg et al (4). The prostate arises from the urogenital sinus and Wolffian ducts at 10-12 weeks of fetal human development, a process stimulated by circulating fetal androgens (5). At puberty, the maturation process is continued in response to the elevated testosterone levels. While rodent prostates develop into multi-lobed organs, the human prostate is compact and lacks distinctive lobes (6). The size of an adult human prostate is often compared to that of a walnut - 20g and 4 cm by 2.5 cm. Although there are no distinctive lobes in the human prostate, it is divided into three zones - the central zone (CZ), the peripheral zone (PZ) and the transition zone 2 (TZ). The zones not only are discrete regions within the prostate, but they differ in their histology and their susceptibility to disease (7). The PZ and TZ arise from the endodermal urogenital sinus while the CZ, as well as the seminal vesicles, arise from the Wolffian ducts which are mesodermal in origin (8, 9). The majority of prostate cancers arise in the PZ, and more infrequently in the TZ, while CZ prostate cancers are very rare (7). There are different types of epithelial cells found in the prostate - basal, luminal, intermediate, neuroendocrine and stem cells. A figure showing a cross section of prostate glands and the epithelial cells is shown in Figure 1.2. The basal cells are Basal Layer Figure 1.2 - Cells of the prostate gland, (a) A cross section of the prostate gland showing the glandular epithelial cells surrounded by the fibromuscular stroma, (b) The epithelial cells of the prostate gland showing migration of the cells from the basal layer to the luminal layer as they differentiate. Adapted from Long et. al. (10). 3 cuboidal cells with a high mitotic index, and are attached to the basement membrane (11). They have low expression levels of the androgen receptor and are androgen independent. In contrast, the prostatic, secretory luminal cells have a low mitotic index and are androgen dependent, expressing high levels of the androgen receptor (12). The basal and luminal cells each express distinctive cytokeratins, with CK 5 and 14 being indicative of basal cells and luminal cells expressing CK8 and 18 (10). The poorly differentiated basal cells migrate to become differentiated luminal cells. Between basal and luminal cells are intermediate cells (also known as transit-amplifying cells) that express a combination of basal and luminal cell markers (10). Neuroendocrine cells are terminally differentiated, androgen independent cells (13), spread out amongst the basal and luminal compartments and express the chromogranin A marker (14). Their function is not entirely clear, although it is believed that they are involved in prostate epithelial cell development and differentiation through the release of various cytokines (15). In rodents, androgen withdrawal causes involution of the prostate luminal epithelium, however the prostate can be completely regenerated once androgens are restored (16). It is likely that the human prostate responds in a similar manner following castration to induce an apoptotic regression of the secretory luminal epithelium, which can be restored upon reintroduction of androgens. This ability of the prostate to regenerate even after long periods of androgen deprivation, suggested the existence of prostatic stem cells (17). Prostatic stem cells were found to reside in the basal layer and express the Sca-1 stem cell marker (18). Underneath the epithelial layer lies the fibromuscular stroma (19). 4 Stromal-epithelial interactions are important for development of the prostate as well as growth and differentiation of the epithelial cells (20). 1.2 Androgens and the Androgen Receptor Androgens are essential for the development and maintenance of the prostate. Testosterone is the major circulating androgen and is synthesized primarily in the Leydig cells of the testis. The release of testosterone is under the negative feedback loop of the hypothalamus-pituitary-gonadal axis (Figure 1.3). In this axis, low levels of testosterone cause the hypothalamus to release luteinizing hormone-releasing hormone (LHRH) to the pituitary, which responds by releasing luteinizing hormone (LH). The LH induces a release of testosterone from the testes, which results in a negative regulation of LHRH release by the hypothalamus. In the blood stream, there is very little free circulating testosterone, instead it is bound by albumin or sexual hormone binding globulin (SHBG). Free testosterone can enter the cells via diffusion through the membrane and SHBG-bound testosterone enters prostate cells via receptor-mediated endocytosis (21). Testosterone is converted to the more potent androgen, dihydrotestosterone (DHT) through the actions of 5-a-reductase in target tissues such as the prostate (22, 23). The adrenal androgens androstenedione, dehydroepiandrosterone (DHEA) and DHEA-sulfate (DHEAS) have some activity in the prostate, although much weaker than testosterone. The adrenal cortex synthesizes and releases adrenal androgens in response to adrenocorticotropin (ACTH) coming from the pituitary gland (24). Testosterone and its metabolite DHT exert their effects in the prostate through the actions of the androgen receptor (AR). 5 Negative Feedback LHRH LH Testis Testosterone adrenal androgens Figure 1.3 - The hypothalamus-pituitary-gonadal axis showing the steps involved in testosterone production as well as the production of adrenal androgens. The axis is controlled by a negative feedback loop. 1.2.1 Steroid Receptors The nuclear receptor superfamily is a class of ligand activated transcription factors and members of this family can be found in all metazoans (25). The superfamily can be sub-divided into four classes, determined by the manner in which they dimerize and bind to DNA - Class I receptors are steroid receptors which bind to DNA inverted repeats as homodimers, Class II receptors form heterodimers with RXR 6 (retinoic acid X receptor) and tend to bind to direct repeats, Class III receptors form homodimers and bind to direct repeats and Class IV receptors bind to DNA as monomers (26). The steroid receptor family of nuclear receptors includes the androgen receptor (AR), progesterone receptor (PR), glucocorticoid receptor (GR), mineralcorticoid receptor (MR), and estrogen receptor (ER). Steroid receptors have a common structure which relates to their common functions: a C-terminal ligand binding domain, a hinge region, a DNA binding domain and an N-terminal domain. In response to ligand binding, the receptors undergo a conformational change which allows them to bind to DNA and initiate transcription of target genes (27). 1.2.2 Androgen Receptor Gene The androgen receptor (Figure 1.4) is encoded by a single copy gene of over 90 kb in length residing on the X chromosome (28). In the prostate, there are three AR transcripts of approximately 11 ,8 and 5 kb (29). The gene consists of 8 exons which encodes a protein of approximately 917 amino acids and 100-110 kDa in size (30-32). There is a small variation in the size of the AR protein in individuals owing to two polymorphic regions in the gene. 1.2.3 Ligand Binding Domain The region responsible for binding ligands resides at the C-terminal end of the AR and is approximately 250 amino acids in length forming a pocket (33). The ligand binding domain (LBD) is a well conserved region among the nuclear receptors and results in a common structure composed of 12 a-helices which assemble in a bundle with a hydrophobic center, with the 12th helix acting as a lid regulating interactions with 7 qll-12 X chromosome Irrtron size (kb) >20 >15 26 5.6 4.8 0.8 '0.7 Exon size (bp) 1613 152 117 288 145 131 158 155 (Gin)*.* (Pro), (Gly),, DNA-binding Transcription Regulation Hinge Ligand-binding Amino Add 1 537 Zn** Zn+ Figure 1.4 - Structure of the androgen receptor gene, mRNA and protein. The androgen receptor is encoded on chromosome Xq11-12. The mRNA is made from 8 exons and results in a protein with 4 functional domains: N-terminal domain (transcriptional regulation), DNA-binding domain, hinge region and the ligand binding domain. Adapted from Gelmann (34). co-activators and co-repressors (35, 36). As with other steroid receptors, a ligand binding pocket is formed from 12 helices (37). The LBD has different conformations depending on whether antagonist or agonists are bound. Agonist binding results in the movement of helix 12 to a position covering the ligand binding pocket (34). Helix 12 is held away from the binding pocket when antagonists bind and in that position, it interferes with interaction of the receptor with coactivators (38). Mutations in the LBD exist that enable the antagonists to act as agonist. Crystal structure of these mutants show that their conformation while bound to an antagonist like bicalutamide mimics 8 that of the conformation observed while bound to DHT (39). There are 18 key residues in the LBD which are essential for interaction with agonists and with the exception of a few ionic residues, most of these are hydrophobic (37). The LBD is necessary for trans-repression of the AR in the absence of ligand, and as such, its deletion results in a constituatively active receptor (40). The LBD has several functions apart from allowing the receptor to bind ligand. It is also the region which interacts with heat shock proteins, contains one of the two activation function regions of the receptor and is also important for receptor dimerization. The LBD is also the location at which hsp90 and other chaperones interact with the AR (41-43). AR requires interaction with hsp90 so that it can be maintained in a conformation which has a high affinity for ligand binding (44). In the absence of hsp90, with a substantially decreased ligand binding affinity, AR has much lower activity and is degraded more rapidly (45). Dimerization of the androgen receptor is an important factor in its ability to effectively bind to DNA and cause transactivation of target genes. Interaction of the LBD of one monomer with the DBD of the other monomer results in AR dimerization (46). The dimerization is dependant on agonist binding to the LBD, as ligand free or antagonist-occupied LBD does not induce dimerization (47, 48) and dimerized AR is more stable than monomeric AR (49). Mutations causing a disruption in the ability of the AR to dimerize decrease its transactivation activity (50-52). There are two activation function (AF) domains in the androgen receptor and it requires both for complete transcriptional activation. The AF2 domain is the weaker of the two domains and resides in the C-terminal LBD region (53). Upon ligand binding, 9 t h e r e i s a c o n f o r m a t i o n a l c h a n g e i n t h e r e c e p t o r w h i c h a l l o w s t h e A F 2 r e g i o n o f A R t o i n t e r a c t w i t h c o a c t i v a t o r s , s u c h a s p 1 6 0 a n d G R I P ( 5 4 ) . L i k e o t h e r s t e r o i d r e c e p t o r s , A R i n t e r a c t s w i t h c o r e g u l a t o r s c o n t a i n i n g t h e L X X L L m o t i f ( 5 5 , 5 6 ) . U n l i k e o t h e r r e c e p t o r s , A R c a n a l s o b i n d t o c o f a c t o r s c o n t a i n i n g F X X L F m o t i f s ( 5 7 - 5 9 ) . T h i s m o t i f i s a l s o f o u n d w i t h i n i n t h e N - t e r m i n a l d o m a i n o f t h e A R i t s e l f . T h e i n t e r a c t i o n b e t w e e n t h e N - t e r m i n a l a n d C - t e r m i n a l r e g i o n s w i t h i n A R i s i m p o r t a n t f o r i t s t r a n s a c t i v a t i o n ( 6 0 ) . 1.2.4 DNA Binding Domain T h e A R D N A b i n d i n g d o m a i n ( D B D ) i s e n c o d e d b y e x o n s 2 a n d 3 a n d c o n s i s t s o f t w o z i n c f i n g e r s i n w h i c h 4 c y s t e i n e s c o o r d i n a t e e a c h z i n c ( 6 1 , 6 2 ) . It i s t h e m o s t h i g h l y c o n s e r v e d r e g i o n a m o n g s t t h e s t e r o i d r e c e p t o r s ( 3 4 ) . T h e D B D i s e s s e n t i a l f o r D N A b i n d i n g a n d n u c l e a r t r a n s l o c a t i o n , a n d w e l l a s d i r e c t l y i n f l u e n c e s A R t r a n s a c t i v a t i o n . M u t a t i o n s i n t h e D B D c a n a f f e c t t h e a b i l i t y o f t h e r e c e p t o r t o e f f e c t i v e l y i n t e r a c t w i t h D N A a n d r e s u l t i n d e c r e a s e d o r a l t e r e d r e c e p t o r a c t i v i t y ( 6 3 , 6 4 ) . T h e r e a r e 8 c o n s e r v e d c y s t e i n e s i n t h e D B D t h a t a r e n e e d e d t o c o o r d i n a t e w i t h t w o z i n c i o n s t o f o r m t h e t w o z i n c f i n g e r s w h i c h c a n t h e n i n t e r a c t w i t h t h e m a j o r g r o o v e o f D N A ( 6 5 , 6 6 ) . T h e f i r s t ( N - t e r m i n a l ) z i n c f i n g e r i s m o r e i m p o r t a n t f o r d e t e r m i n i n g s p e c i f i c b i n d i n g o f t h e r e c e p t o r t o D N A ( 6 7 - 7 0 ) . T h e s e c o n d z i n c f i n g e r f u r t h e r c o n t r i b u t e s t o t h e s p e c i f i c i t y o f t h e b i n d i n g t o D N A , b u t it a l s o i m p o r t a n t f o r t h e d i m e r i z a t i o n o f t h e r e c e p t o r s w h i l e b o u n d t o D N A ( 7 1 , 7 2 ) . D i f f e r e n c e s i n t h e C -t e r m i n a l e x t e n s i o n s o f A R a n d o t h e r s t e r o i d r e c e p t o r s i s i m p o r t a n t f o r t h e i r a b i l i t y t o r e c o g n i z e t h e i r a p p r o p r i a t e D N A s e q u e n c e ( 6 2 , 7 3 ) . A R b i n d s t o i n v e r t e d p a l i n d r o m i c s e q u e n c e s s e p a r a t e d b y a 3 n u c l e o t i d e s p a c e r , c a l l e d a n d r o g e n r e s p o n s e e l e m e n t s ( A R E s ) . T h e i d e a l i z e d c o n s e n s u s 1 0 sequence for the A R E is 5'-GGA/TACANNNTGTTCT-3' (74, 75). AR is able to induce transactivation off of a single ARE , however the level of transactivation is increased substantially through cooperative binding to two or more adjacent AREs (76-78). Interestingly, GR can bind to the same consensus sequence for its response element, however the two receptors have different targets in vivo (79-81). The specificity of binding of AR and GR to their respective response elements may be in part due to interaction of the receptors with specific nucleotides within spacer and the flanking nucleotides (82). The cooperative nature of multiple response elements may contribute to AR being able to activate certain promoter regions, while GR is not (83). AR has also been shown to bind to response elements containing direct repeats, whereas GR cannot (73, 84, 85). 1.2.5 Hinge Region The hinge region is located between the LBD and the DBD and is poorly conserved amongst the steroid receptors (86). The NLS (nuclear localization sequence) is located within DBD and hinge regions (87). Unliganded AR is resident in the cytoplasm and is shuttled to the nucleus upon stimulation with agonist (88). Binding of some antagonists may result in a slower rate of nuclear entry (89), but most antagonists are thought to interfere with coactivator recruitment on AREs. Mutations in the NLS results in both a decreased rate and degree of receptor import into the nucleus (90). The hinge region may also interact with some co-repressors and is therefore important for preventing activation of the unliganded AR (86, 91). 11 1.2.6 N-terminal Domain The N-terminal domain (NTD) is the most divergent region of the steroid receptors. It is 541 amino acids in length in the human AR and is fully encoded by exon 1 (92, 93). It contains the two polymorphic tri-peptide repeat regions in the AR, two regions important for interaction with the LBD, as well as the AF1 region which is important for the recruitment of transcription factors. The two polymorphic regions within the NTD are a poly-glycine (poly-G) and a poly-glutamine (poly-Q) tract. The poly-G is 10 to 31 repeats in length (94). The length of the poly-G tract does not affect the transactivation of the AR, however the length is inversely proportional to the amount of protein that gets translated (95). A poly-G tract with 14 or less repeats is more likely to be found in men with prostate cancer than in the general population (96, 97). The length of the poly-Q tract has also been associated with disease. As with the poly-G tract, an expansion of the poly-Q tract causes a decrease in AR protein expression, however there is also a decrease in transactivation (97-100). Long poly-Q repeats have been associated with infertility (101, 102) and spinal and bulbar muscular atrophy (103, 104) while shorter repeats have been associated with increased AR activity and prostate cancer (105-107). As mentioned earlier, the NTD and the LBD interact in response to ligand binding. The two sequences in the NTD that interact with the LBD are 2 3 F Q N L F 2 7 and 4 3 3 WHTLF 4 3 7 , with the former having a stronger interaction (108, 109). The N/C interaction is unique to the androgen receptor, which may explain some of the properties of the AR which are uncommon in other receptors. The interaction of the N and C terminal regions of the AR prevents rapid dissociation of ligand, whereas ligand 12 dissociates rapidly from GR where there is no N/C interaction (49). Furthermore, ligand dependent N/C interaction results in increased receptor protein stability (110). Aside from the AR and vitamin D receptor, most other nuclear receptors have decreased protein stability upon ligand binding (111-114). The stronger of the two AF domains, the AF1, is located in the NTD. The AF1 domain has two regions which have been identified as being important for its activity, named Tau-1 (amino acids 101-360) and Tau-5 (amino acids 360-485) (115, 116). The mechanism through which AF1 is able to induce transactivation of the AR is by recruiting both coactivators as well as general transcription factors (92, 117). AF1 interacts with the general transcriptional factor, TFIIF, which has been shown to be important for assembly of the pre-initiation complex (118-120). Interaction of AF1 with coactivators such as p160 and GRIP results in enhanced transcriptional activity (121). 1.2.7 AR Coregulators All nuclear receptors interact with proteins, termed coregulators, which regulate the receptor's ability to transactivate target genes. Coregulators positively (coactivators) or negatively (corepressors) effect gene transactivation without affecting basal transcription (122). The mechanisms through which coregulators act is through direct interaction with transcription factors or to affect chromatin structure directly or indirectly (123). AR and other steroid receptors interact with many of the same coregulators through the LXXLL motifs on the interacting proteins. One unique feature of the AR is its ability to interact with coregulators that have an FXXLF motif. 13 Coactivators fall into two main groups. Type I coactivators function to increase the AR occupancy of the DNA, to remodel chromatin or to recruit general transcription factors. The type II coactivators cause increased stability of the AR itself. The best characterized group of coactivators is the steroid receptor coactivator (SRC) family and these are type 1 coactivators. Several of the S R C family members, including SRC-1 and SRC-3, have demonstrated intrinsic histone acetyl transferase (HAT) activity (124, 125). Furthermore, SRCs can recruit other coactivators to the AR transcriptional complex, such as CBP and p-CAF, which possess HAT activity (126-129). Acetylation of the histone tails by HATs causes a disruption of the nucleosomes and allows the transcriptional machinery to gain access to the location. The p300 and SRC coactivators can also recruit SWI/SNF to the AR complex (130, 131). SWI/SNF is multi-protein complex which functions in an ATP-dependent manner to remodel chromatin and allow AR to have greater access to the DNA (132, 133). Several AR coregulators such as CBP, SRC-1 and pCAF can interact directly with RNA pol II holoenzyme complex to recruit and stabilize the complex on the promoter (134-136). As previously discussed, the interaction between the N and C termini of the AR is important for maintaining its stability, decreasing the ligand dissociation rate and for transactivation. One mechanism of coactivator action is mediation of the N/C interaction (137). The coactivators GRIP, ARA70 and CBP are able to form a bridge between the N and C termini resulting in an enhancement of AR transactivation (138-140). There are several mechanisms through which corepressors exert their effect on the AR. Upon ligand binding, AR translocates to the nucleus where it can interact with 14 DNA. Corepressors such as PAK6 and ARA67, cause the AR to be retained in then cytoplasm and therefore ablates its transactivation potential (141, 142). Like coactivators, AR corepressors can cause changes in the chromatin structure. But in the case of corepressors, it is through the recruitment of histone deacetylases (HDAC) such as TGIF (143). The HDACs have opposing actions to the HAT and cause the chromatin to become more compact and less accessible to the transcription machinery. Some corepressors bind to AR and prevent it from binding coactivators. An example of this is cyclin D inhibition of AR/pCAF interaction (144). Finally, the AR N/C interaction can be disrupted by hRad9 or filamin A, resulting in a less stable AR and decreased transactivation (145, 146). 1.2.8 AR Post Translational Modifications The AR undergoes phosphorylation at several sites and this affects AR stability and transactivation (147-149). AKT and PKA signaling pathways, among others, have been shown to result in the phosphorylation of the AR at the specific sites. All but one of the sites on the AR are phosphorylated in response to agonist binding, with the one site constitutively phosphorylated (150, 151). AKT has been shown to directly phosphorylate AR at two sites. Paradoxically though, phosphorylation of the AR by AKT has been shown to both increase and decrease AR transactivation, depending on the context (152, 153). This is most likely due to the concentration of androgens used in the experiments; where high levels of androgens cause decreased AR activity and low levels have the reverse effect (154). PKA signaling results in an increase in AR phosphorylation and AR activity (155). Hyperphosphorylation of the AR can make it responsive to low levels or the absence of androgens (156). 15 The AR DBD is a target for acetylation by p300 and Tip60, which results in an increase in transcriptional activity (157, 158). Conversely deacetylation of AR by HDAC1 has the opposite effect (158). Acetylation enhances interaction with coactivators and reduces interaction with corepressors (159). The AR can also be modified by the small ubiquitin-like molecule-1 (SUMO-1) in the hinge and NTD (160, 161). Sumoylation results in an inhibition of AR transactivation by mediating the interaction of AR with coregulators (162, 163). Degradation of the AR occurs in the proteosome and is dependent on ubiquitination (164). Ubiquitin ligases have been identified which interact with AR including the E3 ligases MDM2 and CHIP (165-168). Interestingly, the AR also requires ubiquitination for regulation of gene expression (169). The proteosome appears to be an important factor in assembly of the AR transcriptional complex (170). 1.2.9 AR Regulated Gene Expression Androgens, through the AR, control many important functions in the prostate including differentiation, proliferation, cell cycle and apoptosis. The AR can mediate gene expression either directly by interacting with the promoter region of the target gene, or indirectly by modulating expression of genes which can affect downstream targets. The mechanism of androgen action in prostate cells is shown in Figure 1.5. Androgens are important for the differentiation of the luminal cells in the prostate. AR controls the expression of several differentiation markers such as PSA, KLK2, prostatic specific acid phosphatase and NKX3.1 (171-174). In response to androgens, the epithelial cells also express VEGF , which is an important factor in promoting angiogenesis to ensure adequate blood supply to the prostate (175, 176). In 16 Figure 1.5 - Androgen action. Testosterone (blue circle) enters the cell and is converted to dihydrotestosterone (DHT - purple circle). The androgen receptor (AR) binds DHT and undergoes a conformational change allowing it to shed associated heat shock proteins and dimerize. The AR translocates to the nucleus and binds androgen response elements (AREs) to enhance transcription of specific genes. 17 the normal prostate, there is communication between the stromal cells and the epithelial cells through the excretion of androgen regulated growth factors which diffuse across the extracellular matrix. Androgens cause an induction of factors in the stromal cells such as keratinocyte growth factor (KGF), which cause an increase in cellular proliferation of the luminal cells (177, 178). Conversely, androgens inhibit TGF-B1 expression and secretion from the stromal cells, which is a negative growth factor for the epithelial cells (179). Several large scale studies have been done to determine which genes are regulated by androgens in prostate cells. Both microarray and serial analysis of gene expression (SAGE) screens have been performed and have revealed both known and novel androgen regulated genes. The screens usually use known androgen regulated genes such as PSA as positive controls. The studies use different model systems and conditions to study androgen regulated genes and as a result, there are a surprisingly low number of genes common amongst the studies (180). What is common to the studies is that they tend to reveal certain classes of androgen regulated gene which can be functionally grouped. The genes fall into different categories involving function of the prostate as a secretory gland such as metabolism, chaperones and trafficking proteins, secretion, structural and transcriptional regulation, or into categories involving cell survival such cell cycle and regulation of apoptosis (181-183). Androgens are important for the proliferation of prostate cells. The cell cycle is controlled by cyclins and cyclin dependent kinases (cdk), which when complexed will phosphorylate various substrates. Androgens cause an increase in several cdks, including cdk 2 and 4; as well as a decrease in cell cycle inhibitors such as p16, which 18 results in an increase in proliferation (184, 185). Androgens also regulate genes involved in blocking cell cycle, such as p21 (186). Therefore it is hypothesized that androgens act in a biphasic manner and under low concentrations induce proliferation and high concentrations inhibit proliferation and induce differentiation of the prostate secretory epithelium. Androgens are also important in ensuring cell survival by inhibition of apoptosis. One of the ways that androgens affect apoptosis is to regulate the expression of the Bcl-2 family, which has both apoptotic and anti-apoptotic members. Androgens induce the expression of the anti-apoptotic members, Bcl-2 and Bcl-XL, and decrease the expression levels of the pro-apoptotic members, Bik, Bax and Bak (187). Androgens also downregulate caspases 8, 3, 7, 2 and 9 (187). Recently, a fusion protein, TMPRSS2-ERG has been discovered that is expressed in a high proportion of prostate cancer specimens (188-190). The fusion that is commonly observed in prostate cancer specimens the 5' end of the TMPRSS2 gene and the 3' end of the ERG or ETV1 gene. TMPRSS2 is expressed in the prostate and is under the control of the AR (191), therefore the fusion results in the androgen regulated expression of ERG or ETV1, which have been previously known to be overexpressed in prostate cancer (192). The ets family of genes, to which ERG and ETV1 are members, encode transcription factors that have been previously observed to be overexpressed in various types of cancers (193, 194). The TMPRSS2-ERG fusion is observed rarely in well differentiated tumors, but more often in poorly differentiated tumors (195) and is also more often observed in Al prostate cancer (196). This translocation is a novel mechanism by which AR can control the expression of a proto-oncogene. 19 1.3 Prostate cancer Prostate cancer is currently the most commonly diagnosed cancer among Canadian men, with an estimated 20,700 newly diagnosed cases and approximately j 4200 Canadian men will die from prostate cancer in 2006. Prostate cancer is a cancer of a glandular tissue and as such is an adenocarcinoma. The cancer generally arises in the PZ of the prostate (7). It is commonly believed that the precursor for prostate cancer is prostatic intraepithelial neoplasia (PIN) (197). In PIN, there is abnormal growth of the epithelial cells, without penetration through the basement membrane into the stroma (198). In most men, PIN will develop into prostate cancer within 10 years (198) . From adenocarcinoma, approximately a third of the cases will develop into metastatic cancer, most often metastasizing to the bone, lymph and liver. Animal models, such as when PTEN is knocked out in the mouse prostate, can recapitulate this progression of prostate cancer from PIN to adenocarcinoma to metastatic tumors (199) . Benign prostatic hyperplasia (BPH) can present with similar symptoms as prostate cancer, but is not thought to be a precursor for cancer (200). The prostate luminal cells secrete PSA, some of which leaks into the bloodstream (201). The amount of PSA in the bloodstream is correlated to the number of secretory prostate cells. Furthermore, as tumors develop and begin to push through the basement membrane, there is more leakage of PSA into the bloodstream resulting in elevated serum PSA (202). Another method used to detect prostate cancer is the digital rectal exam (DRE). Smaller, tumors may not be detected by DRE and therefore it is not necessarily a good screening method for early detection. Screening blood 20 samples for PSA allows tumors to be detected earlier, when there is a better prognosis (203). The mortality rate for prostate cancer has been decreasing since PSA testing has become commonly used, as the cancers are detected earlier when treatment options are more effective (204, 205). One of the downfalls of PSA is the over-diagnosis of prostate cancer and this may be a problem as the treatments and their side effects can decrease the quality of life (206). 1.3.1 Risk Factors The risk factors for prostate cancer include both genetic and environmental factors. The largest risk factor for prostate cancer is age. The incidence of prostate cancer increased after the age of 50 and is fairly uncommon in younger men (207). The early onset form of the disease is more aggressive than that later in life (208). There is a genetic component which contributes to development of prostate cancer as there is an increase risk of prostate cancer when a first degree family member has had the disease (209, 210). Men with a relative who have early-onset prostate cancer have a greater risk of developing prostate cancer than those with relatives who developed prostate cancer later in life (211, 212). There are racial differences in the incidence of prostate cancer. In America, there is a higher incidence of prostate cancer in African Americans than in Caucasians (213). There are lower rates of prostate cancer in Europe and lower still in Asia (214). However, Asians who have migrated to America have an increased incidence of prostate cancer compared to native Asians (215), indicating that there are environmental factors impacting the development of prostate cancer. 21 Glutathione S-transferases (GSTs) are detoxifying enzymes which link electrophilic compounds to glutathione. GST is important for protecting DNA against oxidative stress from carcinogens. Certain polymorphisms which result in the loss of GST are associated with increased risk of prostate cancer and poor prognosis (216, 217). Loss of GST is characteristic of precancerous lesions (218). The loss of GST makes the prostate cells susceptible to DNA damage and mutations that can contribute to tumorigenesis. There are several lines of evidence pointing to food intake affecting the risk of developing prostate cancer. Several studies have shown that obesity is a risk factor for not only developing prostate cancer, but also being associated with a more aggressive disease (219-221), however other studies have shown a decreased risk of aggressive prostate cancer in those who were obese younger in life (222, 223). There is a positive correlation between the probability of developing prostate cancer and the amount of red meat consumed (224, 225). Many dietary compounds have demonstrated some degree of protection against prostate cancer, including lycopenes, vitamin E and selenium (226-228). It is unclear whether testosterone levels have an impact on the development of prostate cancer. Some studies have shown individuals with higher levels of circulating testosterone have an increased risk of developing prostate cancer (229, 230). Other studies, however have failed to find a correlation (231, 232). Whether or not smoking is a risk factor for the development of prostate cancer is also up for debate, as the results of epidemiological studies have been inconsistent (233, 234). 22 1.3.2 Gleason Grading A grading scheme for prostate cancer was developed in the 1960s and 1970s by Dr. Donald F. Gleason, which is the gold standard of diagnosis and prognosis used today. The Gleason grade uses H&E staining of prostatic adenocarcinoma to determine the degree of differentiation of the gland and invasion into the stroma, and a grade of 1 to 5 is given (235). The drawing of the five Gleason grades is pictured in Figure 1.6. Gleason grade 1 adenocarcinoma has many glands and the tumor has smooth, well defined edges, and is pushing into the stroma without invasion. A grade 2 tumor has less well defined edges than grade 1, as well as more variation in the size and shape of the glands. Gleason grade 3 tumors are moderately differentiated; they have poorly defined edges with invasion in the stroma. The glands are have a variable size and shape and are less densely packed than in the lower grade tumors. The poorly differentiated grade 4 tumors have ragged edges which infiltrate into the stroma and glands that have become fused. The highest grade, Gleason grade 5 is very poorly differentiated with ragged, infiltrating edges. Being poorly differentiated, these tumors have only a very few and often small glands. Prostate cancer often presents as a multifocal tumor (236). In general, the two areas are scored; one is the area with the most predominant staining pattern and another with the second most prevalent pattern. The scores are combined to give a grade between 2 and 10. In general, Gleason grade 2-4 denotes a well differentiated tumor, grades 5-7, a moderately differentiated tumor and grades 8-10 denotes poor differentiation. Gleason grade is one of the best prognosticators of clinical outcome. 23 Gleason grading can be used to predict progression to metastatic disease, response to therapies and survival. P R O S T A T I C A D E N O C A R C I N O M A (Histologic G r a d e s ) Figure 1.6 - Depiction of the histological features of Gleason grades 1 through 5, hand-drawn by Dr. Gleason. Adapted from Humphrey (235). 24 1.3.3 Androgen Ablation Therapy Much like normal prostate cells, cancerous prostate cells are initially dependent on androgens for growth and survival. The first indication that prostate cancer was dependent on androgens was reported by Huggins and Hodges in 1941 (237). They reported that castration caused a reduction in prostate cancer while testosterone supplementation resulted in prostate cancer growth (238). For his pioneering work identifying the importance of androgens to prostate cancer growth, Huggins received the Nobel Prize in 1966 (239). The prostate tumors grow by taking advantage of the same androgen-regulated pathways which allow normal prostate cells to proliferate and evade apoptosis. The dependence of prostate cancer on AR signaling has been used to develop therapies which disrupt it. The two main avenues that hormone therapy function is through physiological disruption of androgen synthesis or to directly disrupt the action of the AR. The importance of AR in both androgen dependent and independent cancers is also demonstrated in vitro by targeted knockdown of AR using siRNA, which causes growth inhibition and apoptosis (240, 241). Physical and chemical castration have both been long shown to have positive results on prostate cancer. Physical castration is a simple and low risk surgery, but is not commonly used of late due to psychological side effects after the procedure (242). LHRH agonists such as leuprolide or goserelin have been used to cause castrate levels of serum testosterone. LHRH agonists will cause an increase in LH which will cause an initial surge in testosterone. However after three weeks, constant stimulation with LHRH causes a decrease in its receptors and results in levels of testosterone 25 similar to that achieved with physical castration (243). LHRH agonists achieve a decrease in prostate cancer mortality by approximately one third (244). Castration reduces the levels of testicular androgens, however there are still circulating adrenal androgens which will have some activity in the prostate. Ketoconazole is an inhibitor of cytochrome P-450 and effectively suppresses the production of adrenal androgens. Ketoconazole is successful in decreasing PSA levels in patients alone or in combination with other therapies (245). Another method of reducing androgen signaling in the prostate is to directly inhibit DHT from binding to the AR using antagonists or to inhibit 5a-reductase activity so that DHT production is limited. AR antagonists bind to the receptor, but hold it in a conformation which prevents its transactivation. Some AR antagonists such as cyprotenone acetate are steroidal hormone derivatives, while others, like bicalutamide and flutamide, are non-steroidal (246). Antiandrogens are often used in combination with castration or LHRH agonists, resulting in a higher rate of survival (247). 5a-reductase inhibitors, such as finasteride, prevent testosterone from being converted to DHT. These inhibitors cause a decrease in prostate cancer mortality when used in combination with other therapies and are potentially useful as a preventative agents (248, 249). Other hormones or their derivatives have therapeutic use in the treatment of prostate cancer. Estrogenic compounds cause a decrease in LH release from the pituitary and also have an apoptotic effect on prostate cells (250). The synthetic estrogen, diethylstilbestrol (DES) has long been used as a therapy for prostate cancer. Despite the low cost of synthesis, cardiovascular complications are a main deterrent 26 for its use (24). A herbal supplement called P C S P E S was initially shown to have positive effects on prostate cancer, but it was later discovered that some lots were contaminated with DES (251). A novel course of treatment for prostate cancer was developed called intermittent androgen suppression (IAS) therapy. In IAS, there are cycles of androgen ablation therapy interspersed with periods of no treatment. The theory behind IAS is that the periods of off-treatment keep the surviving cells in a differentiated state where they remain susceptible to the androgen ablation therapy (252, 253). Studies have shown a trend of IAS therapy delaying progression of the disease (254). Other advantages of IAS over constant androgen ablation are that the off-treatment periods result in lower cost of treatment and a reprieve from the adverse side effects (255, 256). 1.4 Androgen Independence Androgen ablation therapy, while initially successful, begins to fail after a median time of 24 months, a situation termed androgen independence (Al) (257). As the prostate tumor begins to grow at A l , the PSA levels also begin to rise. Al is resistant to traditional therapies and tends to be fatal, with a median survival time of approximately 16 months (258). The mechanism by which an androgen dependent tumor loses its reliance on androgens is not well understood. There are two theories on how androgen independent tumors arise from androgen dependent tumors, clonal selection and adaptation, and there is evidence to support both theories (259, 260). As discussed 27 previously, the prostate contains several different types of cells, some androgen dependent and some androgen independent. In the clonal selection theory, androgen ablation causes the androgen dependent cells to undergo an apoptotic response, but selects for growth of the androgen independent cells that already exist within the population. In the adaptation theory, hormone therapy causes regression of the tumor, however some cells adapt to survive in the androgen depleted environment through genetic alterations. It is likely that there are aspects of both clonal selection and adaptation in the development of A l . One of the important aspects of Al is that there is a recurrence of AR signaling. This points to the prospect that the AR is important in development of A l . There are several mechanisms through which the AR can become reactivated, as well as some non-AR related mechanisms to achieve A l . 1.4.1 AR Amplification Several studies have looked at AR gene amplification in clinical Al samples and found the gene to be amplified in approximately 20-30% of the cases (261-264). Importantly, AR amplification found in Al tumors is not found in the same patients prior to androgen ablation treatment (263, 264). This is suggestive that AR amplification is an adaptive response to androgen ablation. Amplification of the AR gene results in higher levels of AR protein, but there was also AR overexpression found in Al tumors which had no gene amplification (265). AR overexpression may contribute to tumor growth at distal sites, as AR gene amplification was found in half the bony metastases tested (266). Increased levels of AR may allow prostate tumors to be more sensitive to 28 the lower levels of androgens present in androgen ablation therapy. The AR gene activation appears to result in an increase in functional AR, as there is an increase in PSA expression (267). Patients with amplified AR genes responded favorably to a combined androgen ablation therapy (antiandrogens in conjunction with LHRH agonists), showing that a functional AR continues to be important for tumor survival (268, 269). 1.4.2 Hypersensitivity to Androgens Castrate levels of androgens are not normally sufficient to cause significant transactivation of the AR, however the Al tumors may have adapted such that they require much lower levels of androgens. In vitro cultures of Al prostate cells require levels of androgens that are four orders of magnitude less than androgen dependent (AD) prostate cells for proliferation (270). Furthermore, the AR was more stable and primarily nuclear in the Al cells as compared to the AD cells (270). While castration significantly decreases circulating testosterone, there are still adrenal androgens being produced. Adrenal androgens are poorer ligands for the AR compared to DHT, however Al prostate cells may adapt to the new hormonal milieu. There is an increase in the levels of enzymes converting adrenal androgens to testosterone and DHT in some hormone refractory tumors (271, 272). Prostate cells may therefore be able to increase the intracellular levels of androgens. 1.4.3 AR Mutations There have been mutations described in the LBD of the AR which decrease its specificity, making it able to bind ligands it would not normally bind to. There is a mutational hot spot at codon 877, which resides in helix 11 of the LBD, and the 29 preferred mutation T877A, causes increased flexibility of the ligand binding pocket (273). These mutated ARs have demonstrated the ability to bind to progesterone, estrogens, adrenal androgens and cortisone (273-276). Furthermore, mutations in the LBD of the AR confer the ability of some ligands such as flutamide, which normally act as antagonists, to become agonists (277). These AR LBD mutations explain a phenomenon called "antiandrogen withdrawal syndrome" whereby patients undergoing combined hormone ablation therapy have a decrease in PSA when the antiandrogen is removed from their treatment regimen (278). Mutations in the LBD have also been described that have increased interaction with coactivators, while other mutations in the LBD result in nuclear accumulation of the AR (279, 280). Both these mutations result in a more transcriptionally active AR. AR mutations are rare in early stage tumors, but become more frequent in metastatic, Al tumors (281, 282). Mutations in regions other than the LBD in prostate cancer are rare, however there have also been AR mutations found in the hinge, N-terminal and DBD regions. A mutation found in the hinge region in a patient resulted in a truncated and constituatively active AR (283). Another patient was found to have a mutation in the DBD which resulted in an increase in AR transactivation at non-specific promoters regions (284). 1.4.4 AR Coregulators Coregulators have a large impact on AR transactivation and therefore the levels of coregulators as the tumor progresses to Al may impact the ability of the AR to function in low levels of androgens. AR coactivators are able to increase AR transactivation in the presence of antiandrogens and adrenal androgens (285). Coactivators, such as cdc25B and CARM, are overexpressed in some prostate tumors 30 (286, 287). High levels of the AR coactivator p300 is predictive of larger tumors and progression to A l (288). Upregulation of the coactivators SRC-1, TIF-2 and GAK is observed in hormone refractory tumors (289, 290). Since corepressors have a dampening effect on AR activity, it is likely that there are cases in which a downregulation of AR corepressors can contribute to progression to A l ; however none have been documented to date. The implications of overexpression of coregulators would be expected to be quite broad. 1.4.5 AR Activation by Growth Factors Several growth factors have been shown to activate the AR in the absence of ligand, including insulin-like growth-factor-1 (IGF-1), KGF and epidermal growth factor (EGF). Whether the signaling cascades activate the AR directly or if the activation is a downstream effect is unknown. It is clear, however that a functional AR is needed, as the AR antagonist bicalutamide, blocks the stimulatory effects of these growth factors (291). Of the growth factors discussed here, IGF-1 is the most potent stimulator of AR, with a five-fold increase in transactivation (291). IGF-1 binds to its receptor (IGF-1 R) resulting in an activation of phosphorylation cascades, including PI3K (292). The ability of IGF-1 to interact with its receptor can be positively or negatively impacted by IGF binding proteins (IGFBPs). There is no significant change in the levels of IGF or its receptor in response to castration, however there is significant changes in the levels of some IGFBPs. IGFBP-2 and 5, which are activators of IGF-1 signaling, are increased post castration, while an inhibitor of IGF-1 signaling, IGFBP-3, is decreased (293-295). Increased signaling through the IGF-1 pathway may be a method through which 3 1 prostate cells adapt to a hormone depleted environment to retain AR signaling and progress to Al. A demonstration of the importance of IGFBP-2 and 5 to the progression of prostate cancer to Al is that their downregulation with antisense oligonucleotides causes a delay in the progression to Al and their overexpression accelerates progression (295-297). Signaling through HER-2/neu, a member of the EGF-receptor family is another route through which AR can be activated in the absence of ligand. HER-2/neu is found to be overexpressed in Al cells lines as well as some Al tumors from patients (298, 299). Overexpression of HER-2/neu can induce ligand independent activation of AR transcriptional activity (298). HER-2/neu signals though the MAPK pathway, and MAPK inhibitors can abrogate its ability to activate AR. Treatment with herceptrin, an antibody directed against HER-2/neu, in combination with taxol has antiproliferative effects in androgen independent tumor models (300). HER-2/neu antibodies have not been shown to be effective as a monotherapy for Al prostate cancer in clinical trials, but may have increased efficacy when used in combination with other therapies (301, 302). 1.4.6 AKT pathway PTEN is a phosphatase which dephosphorylates 3-phosphorylated inositol lipids, resulting in the inactivation of the anti-apoptotic AKT pathway. PTEN is frequently inactivated in Al tumor progression, resulting in increased AKT signaling (154, 303). Overexpression of AKT can lead to Al progression in tumor models (304). AKT can phosphorylate the AR and enable it to be activated in the absence of ligand, and expression of a dominant negative AKT blocks AR signaling (153). The AKT 32 pathway can be activated by HER-2/neu, and therefore an increase in HER-2/neu expression may be another route through which AKT can become activated in Al tumors and for the AR to be activated in the absence of ligand (153). 1.4.7 Non-AR Related Pathways Although the AR has been shown to be involved in prostate cancer progression to A l , it is possible that there are routes to Al that are not dependent on AR. Most notably, overexpression of anti-apoptotic pathways could allow the normally androgen dependent cells to evade death in the androgen depleted milieu. The anti-apoptotic gene Bcl-2 is often overexpressed in Al prostate cancer, while it is not expressed in normal luminal prostate cells (305). In some cases, the overexpression of Bcl-2 is a result of gene amplification (306). In xenograft tumor systems, Bcl-2 overexpressing cells were protected from castration induced apoptosis (307). Downregulation of bcl-2 causes a delay in Al progression of tumor models (308-310). Another anti-apoptotic Bel family member, Bcl-xL is also overexpressed in Al prostate tumors (311). Targeting Bcl-xL with antisense oligonucleotides results in an elevated chemosensitivity and decreased proliferation (312). There is enhanced chemosensitivity in Al prostate cells by targeting both Bcl-2 and Bcl-xL with a bi-specific antisense oligonucleotide (313, 314). Other anti-apoptotic proteins that are overexpressed in Al prostate cancer include HSP27 and clusterin (315-317). HSP27 is a molecular chaperone which has been shown to be cytoprotective in prostate cells (315). Targeting HSP27 for downregulation makes prostate cancer cells more sensitive to chemotherapeutics and as such, is currently being tested as a therapeutic target (318, 319). Clusterin is a 33 multi-functional protein which has been shown to have both pro- and anti-apoptotic functions. Overexpression of clusterin in prostate cells results in chemotherapeutic resistance (317). Conversely, targeting the apoptotic form of clusterin has shown to be an effective therapy in A l prostate cancer in mouse xenograft model systems and is currently being tested in clinical trials (320-322). 1.5 LNCaP Cell Line and Tumor Model There are three commonly used cell lines in prostate cancer research - LNCaP, PC3 and DU145. The cell line used for the majority of the experiments herein is LNCaP. The LNCaP cell line was established from a lymph node metastasis, biopsied from a 50 year old Caucasian man (323). LNCaP cells display a high degree of aneuploidy, with the chromosome number ranging from 33 to 91 (324). LNCaP cells express AR and are androgen dependent. The AR in LNCaP cells bears the T877A mutation in its ligand binding domain making it promiscuous. With the mutated AR, LNCaPs are responsive to adrenal androgens, progesterones and estrogens (325-327). Furthermore, flutamide which is normally an AR antagonist, acts as an agonist to the mutated AR in LNCaP cells (328). Despite the mutated AR, LNCaP cells are the preferred system for studying androgen action in vitro as the other two commonly used cell lines do not express AR. The PC3 prostate cancer cell line was established from the lumbar vertebra of a 62 year old Caucasian man (324). PC3 cells are androgen independent and express little or no androgen receptor. Being androgen independent, they are able to form tumors in both male and female mice. 34 The first prostate cell line to be established in culture was DU-145. The cell line is derived from brain lesion of a 69 year old, Caucasian man who suffered from both prostate cancer and lymphocytic leukemia (323). DU-145 cells are moderately differentiated cells, which express some epithelial cell markers. Importantly, DU-145 cells do not express AR, due to promoter methylation, and are thereby androgen independent (329). LNCaP cells can form tumors subcutaneously in nude mice when co-inoculated with matrigel (330). The tumors grow and secrete PSA into the bloodstream in proportion to the tumor load. Upon castration, there is a drop in PSA levels; however there is little regression of the tumor itself. LNCaP tumors become androgen independent, there is an increase in proliferation and the serum PSA levels rise (331). LNCaP tumors grown subcutaneously do not metastasize, however intraprostatic inoculation in mice does result in metastasis to the lung and lymph nodes (332). 1.6 Scope of Thesis 1.6.1 Hypothesis The AR is central to growth and survival of prostate cancer and to the development of Al prostate cancer. Genes regulated by the A R are likely to be involved in pathways essential for proliferation and evasion of apoptosis, and as such may prove to be potential targets at which to direct therapeutics. 1.6.2 Specific aims The first aim of this work is to identify androgen regulated genes in LNCaP cells using an mRNA microarray screen. 35 The second aim is to characterize the functional significance of the genes identified in the first aim and to gauge their potential as therapeutic targets. To complete the first aim of the project (Chapter 2), LNCaP cells were treated with androgens for several different time points and the resulting RNA used for microarray experiments to screen for genes both up and downregulated by androgens. Many genes were found to be dysregulated by androgen treatment including many genes previously shown to be androgen regulated. Three genes picked up from the arrays were validated, two upregulated genes (GADD45G and MRP-4), as well as one downregulated gene (BARD1). Furthermore, networks of coordinately androgen regulated genes were identified, and the NFE2L2 network of genes involved in the protection against oxidative stress was validated. In Chapter 3, the importance of GADD45G expression to prostate cancer cells was established. The levels of GADD45G protein in patient samples being treated with hormone therapy were determined. GADD45G has been shown to interact with and activate MEKK4 and affect p38 signaling. To determine the signaling pathways which are dependent on GADD45G, we knocked down the protein levels of GADD45G and looked for dysregulation of signaling cascades. Many pathways which are important for cell survival were identified, including AKT, p53 and Rb. Since GADD45G seems to have an important role in controlling cell survival, we conclude that GADD45G may be an attractive target at which to direct therapeutics. In Chapter 4, the regulation of GADD45G by androgens was further explored. It was discovered that the protein levels of GADD45G were downregulated by androgens, while the mRNA levels were increasing. An androgen regulated miRNA 36 which targets GADD45G and prevents its translation was identified. The translational inhibition could be reversed by taxol treatment. It is likely that GADD45G mRNA is being stored in the cell in the event that a stress on the cell, such as taxol, signals that it is needed. In C h a p t e r 5, the androgen regulation of clusterin and two of its transcriptional isoforms is described. The transcription of clusterin was originally thought to be downregulated by androgens, but we identified the transcript as being positively regulated by androgens. Upon further inspection we found that there are two transcripts of clusterin made from different transcriptional initiation sites and they are differentially regulated by androgens. The importance of this is that Isoform 1 has the potential to be spliced into a pro-apoptotic form and is downregulated by androgens. Isoform 2 is only capable of making an anti-apoptotic protein and is upregulated by androgens. Clusterin has already been used as a therapeutic target in prostate cancer, and here we show the importance of targeting the anti-apoptotic isoform. 37 1.7 References 1 . H a y w a r d , S . W . , a n d C u n h a , G . R . 2 0 0 0 . T h e p r o s t a t e : d e v e l o p m e n t a n d p h y s i o l o g y . Radiol Clin North Am 3 8 : 1 - 1 4 . 2 . C o n s t a n t i n o u , J . , a n d F e n e l e y , M . R . 2 0 0 6 . P S A t e s t i n g : a n e v o l v i n g r e l a t i o n s h i p w i t h p r o s t a t e c a n c e r s c r e e n i n g . Prostate Cancer Prostatic Dis 9 : 6 - 1 3 . 3 . S t e n m a n , U . H . , L e i n o n e n , J . , Z h a n g , W . M . , a n d F i n n e , P . 1 9 9 9 . P r o s t a t e -s p e c i f i c a n t i g e n . Semin Cancer Biol 9 : 8 3 - 9 3 . 4 . G o l d e n b e r g , S . L . , R a m s e y , E . W . , a n d J e w e t t , M . A . 1 9 9 8 . P r o s t a t e c a n c e r : 6 . S u r g i c a l t r e a t m e n t o f l o c a l i z e d d i s e a s e . Cmaj 1 5 9 : 1 2 6 5 - 1 2 7 1 . 5 . M a r k e r , P . C . , D o n j a c o u r , A . A . , D a h i y a , R . , a n d C u n h a , G . R . 2 0 0 3 . H o r m o n a l , c e l l u l a r , a n d m o l e c u l a r c o n t r o l o f p r o s t a t i c d e v e l o p m e n t . Dev Biol 2 5 3 : 1 6 5 - 1 7 4 . 6 . C u n h a , G . R . , R i c k e , W . , T h o m s o n , A . , M a r k e r , P . C , R i s b r i d g e r , G . , H a y w a r d , S . W . , W a n g , Y . Z . , D o n j a c o u r , A . A . , a n d K u r i t a , T . 2 0 0 4 . H o r m o n a l , c e l l u l a r , a n d m o l e c u l a r r e g u l a t i o n o f n o r m a l a n d n e o p l a s t i c p r o s t a t i c d e v e l o p m e n t . J Steroid Biochem Mol Biol 9 2 : 2 2 1 - 2 3 6 . 7 . E g e v a d , L . 2 0 0 3 . C y t o l o g y o f t h e c e n t r a l z o n e o f t h e p r o s t a t e . Diagn Cytopathol 2 8 : 2 3 9 - 2 4 4 . 8 . L a c z k o , I., H u d s o n , D . L . , F r e e m a n , A . , F e n e l e y , M . R . , a n d M a s t e r s , J . R . 2 0 0 5 . C o m p a r i s o n o f t h e z o n e s o f t h e h u m a n p r o s t a t e w i t h t h e s e m i n a l v e s i c l e : m o r p h o l o g y , i m m u n o h i s t o c h e m i s t r y , a n d c e l l k i n e t i c s . Prostate 6 2 : 2 6 0 - 2 6 6 . 9 . L e x a n d e r , H . , F r a n z e n , B . , H i r s c h b e r g , D . , B e c k e r , S . , H e l l s t r o m , M . , B e r g m a n , T . , J o r n v a l l , H . , A u e r , G . , a n d E g e v a d , L . 2 0 0 5 . D i f f e r e n t i a l p r o t e i n e x p r e s s i o n i n a n a t o m i c a l z o n e s o f t h e p r o s t a t e . Proteomics 5 : 2 5 7 0 - 2 5 7 6 . 1 0 . L o n g , R . M . , M o r r i s s e y , C , F i t z p a t r i c k , J . M . , a n d W a t s o n , R . W . 2 0 0 5 . P r o s t a t e e p i t h e l i a l c e l l d i f f e r e n t i a t i o n a n d i t s r e l e v a n c e t o t h e u n d e r s t a n d i n g o f p r o s t a t e c a n c e r t h e r a p i e s . Clin Sci (Lond) 1 0 8 : 1 - 1 1 . 1 1 . G a r r a w a y , L . A . , L i n , D . , S i g n o r e t t i , S . , W a l t r e g n y , D . , D i l k s , J . , B h a t t a c h a r y a , N . , a n d L o d a , M . 2 0 0 3 . I n t e r m e d i a t e b a s a l c e l l s o f t h e p r o s t a t e : i n v i t r o a n d i n v i v o c h a r a c t e r i z a t i o n . Prostate 5 5 : 2 0 6 - 2 1 8 . 1 2 . F o s t e r , C . S . , D o d s o n , A . , K a r a v a n a , V . , S m i t h , P . H . , a n d K e , Y . 2 0 0 2 . P r o s t a t i c s t e m c e l l s . J Pathol 1 9 7 : 5 5 1 - 5 6 5 . 1 3 . A b r a h a m s s o n , P . A . 1 9 9 9 . N e u r o e n d o c r i n e c e l l s i n t u m o u r g r o w t h o f t h e p r o s t a t e . Endocr Relat Cancer 6 : 5 0 3 - 5 1 9 . 1 4 . A b r a h a m s s o n , P . A . 1 9 9 9 . N e u r o e n d o c r i n e d i f f e r e n t i a t i o n i n p r o s t a t i c c a r c i n o m a . Prostate 3 9 : 1 3 5 - 1 4 8 . 1 5 . P e e h l , D . M . 2 0 0 5 . P r i m a r y c e l l c u l t u r e s a s m o d e l s o f p r o s t a t e c a n c e r d e v e l o p m e n t . Endocr Relat Cancer 1 2 : 1 9 - 4 7 . 1 6 . S c h a l k e n , J . A . , a n d v a n L e e n d e r s , G . 2 0 0 3 . C e l l u l a r a n d m o l e c u l a r b i o l o g y o f t h e p r o s t a t e : s t e m c e l l b i o l o g y . Urology 6 2 : 1 1 - 2 0 . 1 7 . C o l l i n s , A T . , a n d M a i t l a n d , N . J . 2 0 0 6 . P r o s t a t e c a n c e r s t e m c e l l s . EurJ Cancer 4 2 : 1 2 1 3 - 1 2 1 8 . 1 8 . L a m , J . S . , a n d R e i t e r , R . E . 2 0 0 6 . S t e m c e l l s i n p r o s t a t e a n d p r o s t a t e c a n c e r d e v e l o p m e n t . Urol Oncol 2 4 : 1 3 1 - 1 4 0 . 1 9 . F a r n s w o r t h , W . E . 1 9 9 9 . P r o s t a t e s t r o m a : p h y s i o l o g y . Prostate 3 8 : 6 0 - 7 2 . 3 8 20. Cunha, G.R., Cooke, P.S., and Kurita, T. 2004. Role of stromal-epithelial interactions in hormonal responses. Arch Histol Cyto/67:417-434. 21. Andreassen, T.K. 2006. The role of plasma-binding proteins in the cellular uptake of lipophilic vitamins and steroids. Horm Metab Res 38:279-290. 22. Andriole, G., Bruchovsky, N., Chung, L.W., Matsumoto, A.M., Rittmaster, R., Roehrborn, C , Russell, D., and Tindall, D. 2004. Dihydrotestosterone and the prostate: the scientific rationale for 5alpha-reductase inhibitors in the treatment of benign prostatic hyperplasia. J Urol 172:1399-1403. 23. Soronen, P., Laiti, M., Torn, S., Harkonen, P., Patrikainen, L, Li, Y., Pulkka, A., Kurkela, R., Herrala, A., Kaija, H., et al. 2004. Sex steroid hormone metabolism and prostate cancer. J Steroid Biochem Mol Biol 92:281-286. 24. So, A.L, Hurtado-Coll, A., and Gleave, M.E. 2003. Androgens and prostate cancer. World J Urol 21:325-337. 25. Owen, G.I., and Zelent, A. 2000. Origins and evolutionary diversification of the nuclear receptor superfamily. Cell Mol Life Sci 57:809-827. 26. Mangelsdorf, D.J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., et al. 1995. The nuclear receptor superfamily: the second decade. Cell 83:835-839. 27. Tenbaum, S., and Baniahmad, A. 1997. Nuclear receptors: structure, function and involvement in disease. Int J Biochem Cell Biol 29:1325-1341. 28. Kuiper, G.G., Faber, P.W., van Rooij, H.C., van der Korput, J.A., Ris-Stalpers, C., Klaassen, P., Trapman, J . , and Brinkmann, A.O. 1989. Structural organization of the human androgen receptor gene. J Mol Endocrinol 2.R1-4. 29. Trapman, J . , Klaassen, P., Kuiper, G.G., van der Korput, J.A., Faber, P.W., van Rooij, H.C., Geurts van Kessel, A., Voorhorst, M.M., Mulder, E., and Brinkmann, A.O. 1988. Cloning, structure and expression of a cDNA encoding the human androgen receptor. Biochem Biophys Res Commun 153:241-248. 30. Tilley, W.D., Marcelli, M., Wilson, J.D., and McPhaul, M.J. 1989. Characterization and expression of a cDNA encoding the human androgen receptor. Proc Natl Acad Sci USA 86:327-331. 31. Brinkmann, A.O., Klaasen, P., Kuiper, G.G., van der Korput, J.A., Bolt, J . , de Boer, W., Smit, A., Faber, P.W., van Rooij, H.C., Geurts van Kessel, A., et al. 1989. Structure and function of the androgen receptor. Urol Res 17:87-93. 32. Brinkmann, A.O., Faber, P.W., van Rooij, H.C., Kuiper, G.G., Ris, C , Klaassen, P., van der Korput, J A , Voorhorst, M.M., van Laar, J .H., Mulder, E., et al. 1989. The human androgen receptor: domain structure, genomic organization and regulation of expression. J Steroid Biochem 34:307-310. 33. Jenster, G., van der Korput, J.A., Trapman, J . , and Brinkmann, A.O. 1992. Functional domains of the human androgen receptor. J Steroid Biochem Mol Biol 41:671-675. 34. Gelmann, E.P. 2002. Molecular biology of the androgen receptor. J Clin Oncol 20:3001-3015. 35. Lanz, R.B., and Rusconi, S. 1994. A conserved carboxy-terminal subdomain is important for ligand interpretation and transactivation by nuclear receptors. Endocrinology 135:2183-2195. 39 36. Maeda, M. 2001. The conserved residues of the ligand-binding domains of steroid receptors are located in the core of the molecules. J Mol Graph Model 19:543-551, 601-546. 37. Matias, P.M., Donner, P., Coelho, R., Thomaz, M., Peixoto, C , Macedo, S., Otto, N., Joschko, S., Scholz, P., Wegg, A., et al. 2000. Structural evidence for ligand specificity in the binding domain of the human androgen receptor. Implications for pathogenic gene mutations. J Biol Chem 275:26164-26171. 38. Shiau, A.K., Barstad, D., Loria, P.M., Cheng, L, Kushner, P.J., Agard, D.A., and Greene, G.L. 1998. The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927-937. 39. Bohl, C.E., Gao, W., Miller, D.D., Bell, C.E., and Dalton, J.T. 2005. Structural basis for antagonism and resistance of bicalutamide in prostate cancer. Proc Natl Acad Sci USA 102:6201-6206. 40. Jenster, G., van der Korput, H.A., van Vroonhoven, C , van der Kwast, T.H., Trapman, J . , and Brinkmann, A.O. 1991. Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol Endocrinol 5:1396-1404. 41. Nemoto, T., Ohara-Nemoto, Y., and Ota, M. 1992. Association of the 90-kDa heat shock protein does not affect the ligand-binding ability of androgen receptor. J Steroid Biochem Mol Biol 42:803-812. 42. Solit, D.B., Scher, H.I., and Rosen, N. 2003. Hsp90 as a therapeutic target in prostate cancer. Semin Oncol 30:709-716. 43. Segnitz, B., and Gehring, U. 1997. The function of steroid hormone receptors is inhibited by the hsp90-specific compound geldanamycin. J Biol Chem 272:18694-18701. 44. Fang, Y., Fliss, A.E., Robins, D.M., and Caplan, A.J. 1996. Hsp90 regulates androgen receptor hormone binding affinity in vivo. J Biol Chem 271:28697-28702. 45. Vanaja, D.K., Mitchell, S.H., Toft, D.O., and Young, C.Y. 2002. Effect of geldanamycin on androgen receptor function and stability. Cell Stress Chaperones 7:55-64. 46. Nemoto, T., Ohara-Nemoto, Y., Shimazaki, S., and Ota, M. 1994. Dimerization characteristics of the DNA- and steroid-binding domains of the androgen receptor. J Steroid Biochem Mol Biol 50:225-233. 47. Langley, E., Zhou, Z.X., and Wilson, E.M. 1995. Evidence for an anti-parallel orientation of the ligand-activated human androgen receptor dimer. J Biol Chem 270:29983-29990. 48. Kemppainen, J.A., Langley, E., Wong, C.I., Bobseine, K., Kelce, W.R., and Wilson, E.M. 1999. Distinguishing androgen receptor agonists and antagonists: distinct mechanisms of activation by medroxyprogesterone acetate and dihydrotestosterone. Mol Endocrinol 13:440-454. 49. Zhou, Z.X., Lane, M.V., Kemppainen, J.A., French, F.S., and Wilson, E.M. 1995. Specificity of ligand-dependent androgen receptor stabilization: receptor domain interactions influence ligand dissociation and receptor stability. Mol Endocrinol 9:208-218. 40 50. Langley, E., Kemppainen, J.A., and Wilson, E.M. 1998. Intermolecular NH2-/carboxyl-terminal interactions in androgen receptor dimerization revealed by mutations that cause androgen insensitivity. J Biol Chem 273:92-101. 51. Butler, L.M., Centenera, M.M., Neufing, P.J., Buchanan, G., Choong, C.S., Ricciardelli, C., Saint, K., Lee, M., Ochnik, A., Yang, M., et al. 2006. Suppression of androgen receptor signaling in prostate cancer cells by an inhibitory receptor variant. Mol Endocrinol 20:1009-1024. 52. Turek-Plewa, J . , Eckersdorf-Mastalerz, A., Kaluzewski, B., Helszer, Z., and Trzeciak, W.H. 2006. A mutation C.C2812T in the androgen receptor gene resulting in Pro817Leu substitution may affect dimerization of the androgen receptor and result in androgen insensitivity syndrome. Fertil Steril 85:1822 e1821-1824. 53. Moilanen, A., Rouleau, N., Ikonen, T., Palvimo, J.J., and Janne, O.A. 1997. The presence of a transcription activation function in the hormone-binding domain of androgen receptor is revealed by studies in yeast cells. FEBS Lett 412:355-358. 54. Slagsvold, T., Kraus, I., Bentzen, T., Palvimo, J . , and Saatcioglu, F. 2000. Mutational analysis of the androgen receptor AF-2 (activation function 2) core domain reveals functional and mechanistic differences of conserved residues compared with other nuclear receptors. Mol Endocrinol 14:1603-1617. 55. Chang, C.Y., and McDonnell, D.P. 2002. Evaluation of ligand-dependent changes in AR structure using peptide probes. Mol Endocrinol 16:647-660. 56. Estebanez-Perpina, E., Moore, J .M., Mar, E., Delgado-Rodrigues, E., Nguyen, P., Baxter, J.D., Buehrer, B.M., Webb, P., Fletterick, R.J., and Guy, R.K. 2005. The molecular mechanisms of coactivator utilization in ligand-dependent transactivation by the androgen receptor. J Biol Chem 280:8060-8068. 57. He, B., Minges, J.T., Lee, L.W., and Wilson, E.M. 2002. The FXXLF motif mediates androgen receptor-specific interactions with coregulators. J Biol Chem 277:10226-10235. 58. He, B., and Wilson, E.M. 2003. Electrostatic modulation in steroid receptor recruitment of LXXLL and FXXLF motifs. Mol Cell Biol 23:2135-2150. 59. Dubbink, H.J., Hersmus, R., Verma, C.S., van der Korput, H.A., Berrevoets, C.A., van Tol, J . , Ziel-van der Made, A.C., Brinkmann, A.O., Pike, A.C., and Trapman, J . 2004. Distinct recognition modes of FXXLF and LXXLL motifs by the androgen receptor. Mol Endocrinol 18:2132-2150. 60. He, B., Lee, L.W., Minges, J.T., and Wilson, E.M. 2002. Dependence of selective gene activation on the androgen receptor NH2- and COOH-terminal interaction. J Biol Chem 277:25631-25639. 61. Freedman, L.P. 1992. Anatomy of the steroid receptor zinc finger region. Endocr Rev 13:129-145. 62. Schoenmakers, E., Alen, P., Verrijdt, G., Peeters, B., Verhoeven, G., Rombauts, W., and Claessens, F. 1999. Differential DNA binding by the androgen and glucocorticoid receptors involves the second Zn-finger and a C-terminal extension of the DNA-binding domains. Biochem J 341 ( Pt 3):515-521. 63. Aarnisalo, P., Santti, H., Poukka, H., Palvimo, J.J., and Janne, O.A. 1999. Transcription activating and repressing functions of the androgen receptor are 41 differentially influenced by mutations in the deoxyribonucleic acid-binding domain. Endocrinology 140:3097-3105. 64. Imasaki, K., Okabe, T., Murakami, H., Tanaka, Y., Haji, M., Takayanagi, R., and Nawata, H. 1996. Androgen insensitivity syndrome due to new mutations in the DNA-binding domain of the androgen receptor. Mol Cell Endocrinol 120:15-24. 65. Alroy, I., and Freedman, L.P. 1992. DNA binding analysis of glucocorticoid receptor specificity mutants. Nucleic Acids Res 20:1045-1052. 66. Kothekar, V. 1992. Transcription regulation by steroid hormones: a computer simulation study. J Biomol Struct Dyn 10:49-62. 67. Green, S., Kumar, V., Theulaz, I., Wahli, W., and Chambon, P. 1988. The N-terminal DNA-binding 'zinc finger' of the oestrogen and glucocorticoid receptors determines target gene specificity. Embo J 7:3037-3044. 68. Green, S., and Chambon, P. 1989. Chimeric receptors used to probe the DNA-binding domain of the estrogen and glucocorticoid receptors. Cancer Res 49:2282s-2285s. 69. Danielsen, M., Hinck, L., and Ringold, G.M. 1989. Two amino acids within the knuckle of the first zinc finger specify DNA response element activation by the glucocorticoid receptor. Cell 57:1131-1138. 70. Umesono, K., and Evans, R.M. 1989. Determinants of target gene specificity for steroid/thyroid hormone receptors. Cell 57:1139-1146. 71. Hirst, M.A., Hinck, L., Danielsen, M., and Ringold, G.M. 1992. Discrimination of DNA response elements for thyroid hormone and estrogen is dependent on dimerization of receptor DNA binding domains. Proc Natl Acad Sci USA 89:5527-5531. 72. Dahlman-Wright, K., Wright, A., Gustafsson, J.A., and Carlstedt-Duke, J . 1991. Interaction of the glucocorticoid receptor DNA-binding domain with DNA as a dimer is mediated by a short segment of five amino acids. J Biol Chem 266:3107-3112. 73. Claessens, F., Verrijdt, G., Schoenmakers, E., Haelens, A., Peeters, B., Verhoeven, G., and Rombauts, W. 2001. Selective DNA binding by the androgen receptor as a mechanism for hormone-specific gene regulation. J Steroid Biochem Mol Biol 76:23-30. 74. Roche, P.J., Hoare, S.A., and Parker, M.G. 1992. A consensus DNA-binding site for the androgen receptor. Mol Endocrinol 6:2229-2235. 75. Shen, R., Sumitomo, M., Dai, J . , Hardy, D.O., Navarro, D., Usmani, B., Papandreou, C.N., Hersh, L.B., Shipp, M.A., Freedman, L.P., eta l . 2000. Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. Mol Cell Endocrinol 170:131-142. 76. Cleutjens, K.B., van Eekelen, C C , van der Korput, H.A., Brinkmann, A.O., and Trapman, J . 1996. Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter. J Biol Chem 271:6379-6388. 77. Reid, K.J., Hendy, S .C , Saito, J . , Sorensen, P., and Nelson, C C 2001. Two classes of androgen receptor elements mediate cooperativity through allosteric interactions. J Biol Chem 276:2943-2952. 42 78. Zhang, J . , Gao, N„ Kasper, S., Reid, K., Nelson, C., and Matusik, R.J. 2004. An androgen-dependent upstream enhancer is essential for high levels of probasin gene expression. Endocrinology 145:134-148. 79. Kasper, S., Rennie, P.S., Bruchovsky, N., Lin, L., Cheng, H., Snoek, R., Dahlman-Wright, K., Gustafsson, J A , Shiu, R.P., Sheppard, P.C., eta l . 1999. Selective activation of the probasin androgen-responsive region by steroid hormones. J Mol Endocrinol 22:313-325. 80. Rundlett, S.E., and Miesfeld, R.L. 1995. Quantitative differences in androgen and glucocorticoid receptor DNA binding properties contribute to receptor-selective transcriptional regulation. Mol Cell Endocrinol 109:1-10. 81. Ham, J . , Thomson, A., Needham, M., Webb, P., and Parker, M. 1988. Characterization of response elements for androgens, glucocorticoids and progestins in mouse mammary tumour virus. Nucleic Acids Res 16:5263-5276. 82. Nelson, C.C., Hendy, S .C , Shukin, R.J., Cheng, H., Bruchovsky, N., Koop, B.F., and Rennie, P.S. 1999. Determinants of DNA sequence specificity of the androgen, progesterone, and glucocorticoid receptors: evidence for differential steroid receptor response elements. Mol Endocrinol 13:2090-2107. 83. Verrijdt, G., Schauwaers, K., Haelens, A., Rombauts, W., and Claessens, F. 2002. Functional interplay between two response elements with distinct binding characteristics dictates androgen specificity of the mouse sex-limited protein enhancer. J Biol Chem 277:35191-35201. 84. Schoenmakers, E., Verrijdt, G., Peeters, B., Verhoeven, G., Rombauts, W., and Claessens, F. 2000. Differences in DNA binding characteristics of the androgen and glucocorticoid receptors can determine hormone-specific responses. J Biol Chem 275:12290-12297. 85. Shaffer, P.L., Jivan, A., Dollins, D.E., Claessens, F., and Gewirth, D.T. 2004. Structural basis of androgen receptor binding to selective androgen response elements. Proc Natl Acad Sci USA 101:4758-4763. 86. Wang, Q., Lu, J . , and Yong, E.L. 2001. Ligand- and coactivator-mediated transactivation function (AF2) of the androgen receptor ligand-binding domain is inhibited by the cognate hinge region. J Biol Chem 276:7493-7499. 87. Zhou, Z.X., Sar, M., Simental, J.A., Lane, M.V., and Wilson, E.M. 1994. A ligand-dependent bipartite nuclear targeting signal in the human androgen receptor. Requirement for the DNA-binding domain and modulation by NH2-terminal and carboxyl-terminal sequences. J Biol Chem 269:13115-13123. 88. Georget, V., Lobaccaro, J .M., Terouanne, B., Mangeat, P., Nicolas, J.C., and Sultan, C. 1997. Trafficking of the androgen receptor in living cells with fused green fluorescent protein-androgen receptor. Mol Cell Endocrinol 129:17-26. 89. Avances, C , Georget, V., Terouanne, B., Orio, F., Cussenot, O., Mottet, N., Costa, P., and Sultan, C. 2001. Human prostatic cell line PNT1A, a useful tool for studying androgen receptor transcriptional activity and its differential subnuclear localization in the presence of androgens and antiandrogens. Mol Cell Endocrinol 184:13-24. 90. Georget, V., Terouanne, B., Lumbroso, S., Nicolas, J.C., and Sultan, C. 1998. Trafficking of androgen receptor mutants fused to green fluorescent protein: a 43 new investigation of partial androgen insensitivity syndrome. J Clin Endocrinol Metab 83:3597-3603. 91. Liao, G., Chen, L.Y., Zhang, A., Godavarthy, A., Xia, F., Ghosh, J . C , Li, H., and Chen, J.D. 2003. Regulation of androgen receptor activity by the nuclear receptor corepressor SMRT. J Biol Chem 278:5052-5061. 92. McEwan, I.J. 2004. Molecular mechanisms of androgen receptor-mediated gene regulation: structure-function analysis of the AF-1 domain. Endocr Relat Cancer 11:281-293. 93. Faber, P.W., Kuiper, G.G., van Rooij, H.C, van der Korput, J.A., Brinkmann, A.O., and Trapman, J . 1989. The N-terminal domain of the human androgen receptor is encoded by one, large exon. Mol Cell Endocrinol 61:257-262. 94. Lumbroso, R., Beitel, L.K., Vasiliou, D.M., Trifiro, M.A., and Pinsky, L. 1997. Codon-usage variants in the polymorphic (GGN)n trinucleotide repeat of the human androgen receptor gene. Hum Genet 101:43-46. 95. Ding, D., Xu, L., Menon, M., Reddy, G.P., and Barrack, E.R. 2005. Effect of G G C (glycine) repeat length polymorphism in the human androgen receptor on androgen action. Prostate 62:133-139. 96. Hakimi, J .M., Schoenberg, M.P., Rondinelli, R.H., Piantadosi, S., and Barrack, E.R. 1997. Androgen receptor variants with short glutamine or glycine repeats may identify unique subpopulations of men with prostate cancer. Clin Cancer Res 3:1599-1608. 97. Choong, C.S., Kemppainen, J.A., Zhou, Z.X., and Wilson, E.M. 1996. Reduced androgen receptor gene expression with first exon C A G repeat expansion. Mol Endocrinol 10:1527-1535. 98. Mhatre, A.N., Trifiro, M.A., Kaufman, M., Kazemi-Esfarjani, P., Figlewicz, D., Rouleau, G., and Pinsky, L. 1993. Reduced transcriptional regulatory competence of the androgen receptor in X-linked spinal and bulbar muscular atrophy. Nat Genet 5:184-188. 99. Kazemi-Esfarjani, P., Trifiro, M.A., and Pinsky, L. 1995. Evidence for a repressive function of the long polyglutamine tract in the human androgen receptor: possible pathogenetic relevance for the (CAG)n-expanded neuronopathies. Hum Mol Genet 4:523-527'. 100. Ding, D., Xu, L, Menon, M., Reddy, G.P., and Barrack, E.R. 2004. Effect of a short C A G (glutamine) repeat on human androgen receptor function. Prostate 58:23-32. 101. Tut, T.G., Ghadessy, F.J., Trifiro, M.A., Pinsky, L, and Yong, E.L. 1997. Long polyglutamine tracts in the androgen receptor are associated with reduced trans-activation, impaired sperm production, and male infertility. J Clin Endocrinol Metab 82:3777-3782. 102. Casella, R., Maduro, M.R., Misfud, A., Lipshultz, L.I., Yong, E.L., and Lamb, D.J. 2003. Androgen receptor gene polyglutamine length is associated with testicular histology in infertile patients. J Urol 169:224-227. 103. Merry, D.E., Kobayashi, Y., Bailey, C K . , Taye, A.A., and Fischbeck, K.H. 1998. Cleavage, aggregation and toxicity of the expanded androgen receptor in spinal and bulbar muscular atrophy. Hum Mol Genet 7:693-701. 44 104. MacLean, H.E., Warne, G.L., and Zajac, J.D. 1996. Spinal and bulbar muscular atrophy: androgen receptor dysfunction caused by a trinucleotide repeat expansion. J Neurol Sci 135:149-157. 105. Nelson, K A , and Witte, J.S. 2002. Androgen receptor CAG repeats and prostate cancer. Am J Epidemiol 155:883-890. 106. Santos, M.L., Sarkis, A.S., Nishimoto, I.N., and Nagai, M.A. 2003. Androgen receptor C A G repeat polymorphism in prostate cancer from a Brazilian population. Cancer Detect Prev 27:321-326. 107. Ferro, P., Catalano, M.G., Dell'Eva, R., Fortunati, N., and Pfeffer, U. 2002. The androgen receptor C A G repeat: a modifier of carcinogenesis? Mol Cell Endocrinol 193:109-120. 108. He, B., Kemppainen, J A , and Wilson, E.M. 2000. FXXLF and WXXLF sequences mediate the NH2-terminal interaction with the ligand binding domain of the androgen receptor. J Biol Chem 275:22986-22994. 109. He, B., and Wilson, E.M. 2002. The NH(2)-terminal and carboxyl-terminal interaction in the human androgen receptor. Mol Genet Metab 75:293-298. 110. He, B., Bowen, NT. , Minges, J.T., and Wilson, E.M. 2001. Androgen-induced NH2- and COOH-terminal Interaction Inhibits p160 coactivator recruitment by activation function 2. J Biol Chem 276:42293-42301. 111. Wiese, R.J., Uhland-Smith, A., Ross, T.K., Prahl, J .M., and DeLuca, H.F. 1992. Up-regulation of the vitamin D receptor in response to 1,25-dihydroxyvitamin D3 results from ligand-induced stabilization. J Biol Chem 267:20082-20086. 112. Hoeck, W., Rusconi, S., and Groner, B. 1989. Down-regulation and phosphorylation of glucocorticoid receptors in cultured cells. Investigations with a monospecific antiserum against a bacterially expressed receptor fragment. J Biol Chem 264:14396-14402. 113. Dace, A., Zhao, L., Park, K.S., Furuno, T., Takamura, N., Nakanishi, M., West, B.L., Hanover, J A , and Cheng, S. 2000. Hormone binding induces rapid proteasome-mediated degradation of thyroid hormone receptors. Proc Natl Acad Sci USA 97:8985-8990. 114. Nawaz, Z., Lonard, D.M., Dennis, A.P., Smith, C L , and O'Malley, B.W. 1999. Proteasome-dependent degradation of the human estrogen receptor. Proc Natl Acad Sci U S A 96:1858-1862. 115. Jenster, G., van der Korput, H A , Trapman, J . , and Brinkmann, A.O. 1995. Identification of two transcription activation units in the N-terminal domain of the human androgen receptor. J Biol Chem 270:7341-7346. 116. Callewaert, L., Van Tilborgh, N., and Claessens, F. 2006. Interplay between two hormone-independent activation domains in the androgen receptor. Cancer Res 66:543-553. 117. Bevan, C.L., Hoare, S., Claessens, F., Heery, D.M., and Parker, M.G. 1999. The AF1 and AF2 domains of the androgen receptor interact with distinct regions of SRC1 . Mol Cell Biol 19:8383-8392. 118. Reid, J . , Murray, I., Watt, K., Betney, R., and McEwan, I.J. 2002. The androgen receptor interacts with multiple regions of the large subunit of general transcription factor TFIIF. J Biol Chem 277:41247-41253. 45 119. Choudhry, M.A., and McEwan, I.J. 2004. In vitro regulation of reporter gene transcription by the androgen receptor AF1 domain. Biochem Soc Trans 32:1103-1106. 120. Betney, R., and McEwan, I.J. 2003. Role of conserved hydrophobic amino acids in androgen receptor AF-1 function. J Mol Endocrinol 31:427-439. 121. Ma, H., Hong, H., Huang, S.M., Irvine, R.A., Webb, P., Kushner, P.J., Coetzee, G.A., and Stallcup, M.R. 1999. Multiple signal input and output domains of the 160-kilodalton nuclear receptor coactivator proteins. Mol Cell Biol 19:6164-6173. 122. McKenna, N.J., Lanz, R.B., and O'Malley, B.W. 1999. Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321-344. 123. Heinlein, C.A., and Chang, C. 2002. Androgen receptor (AR) coregulators: an overview. Endocr Rev 23:175-200. 124. Spencer, T.E., Jenster, G., Burcin, M.M., Allis, C D . , Zhou, J . , Mizzen, C.A., McKenna, N.J., Onate, S.A., Tsai, S.Y., Tsai, M.J., et al. 1997. Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194-198. 125. Chen, H., Lin, R.J., Schiltz, R.L., Chakravarti, D., Nash, A., Nagy, L, Privalsky, M.L., Nakatani, Y., and Evans, R.M. 1997. Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569-580. 126. Ogryzko, V.V., Schiltz, R.L., Russanova, V., Howard, B.H., and Nakatani, Y. 1996. The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953-959. 127. Bannister, A.J., and Kouzarides, T. 1996. The CBP co-activator is a histone acetyltransferase. Nature 384:641-643. 128. Herrera, J.E., Sakaguchi, K., Bergel, M., Trieschmann, L., Nakatani, Y., and Bustin, M. 1999. Specific acetylation of chromosomal protein HMG-17 by PCAF alters its interaction with nucleosomes. Mol Cell Biol 19:3466-3473. 129. Voegel, J.J., Heine, M.J., Tini, M., Vivat, V., Chambon, P., and Gronemeyer, H. 1998. The coactivator TIF2 contains three nuclear receptor-binding motifs and mediates transactivation through CBP binding-dependent and -independent pathways. Embo J 17:507-519. 130. Marshall, T.W., Link, K.A., Petre-Draviam, C.E., and Knudsen, K.E. 2003. Differential requirement of SWI/SNF for androgen receptor activity. J Biol Chem 278:30605-30613. 131. Huang, Z.Q., Li, J . , Sachs, L.M., Cole, P A , and Wong, J . 2003. A role for cofactor-cofactor and cofactor-histone interactions in targeting p300, SWI/SNF and Mediator for transcription. Embo J 22:2146-2155. 132. Vignali, M., Hassan, A.H., Neely, K.E., and Workman, J . L 2000. ATP-dependent chromatin-remodeling complexes. Mol Cell Biol 20:1899-1910. 133. Vicent, G.P., Nacht, A.S., Smith, C.L., Peterson, C.L., Dimitrov, S., and Beato, M. 2004. DNA instructed displacement of histones H2A and H2B at an inducible promoter. Mol Cell 16:439-452. 134. Neish, A.S., Anderson, S.F., Schlegel, B.P., Wei, W., and Parvin, J .D. 1998. Factors associated with the mammalian RNA polymerase II holoenzyme. Nucleic Acids Res 26:847-853. 46 135. Liu, Y., Xia, X., Fondell, J.D., and Yen, P.M. 2006. Thyroid hormone-regulated target genes have distinct patterns of coactivator recruitment and histone acetylation. Mol Endocrinol 20:483-490. 136. Muth, V., Nadaud, S., Grummt, I., and Voit, R. 2001. Acetylation of TAF(I)68, a subunit of TIF-IB/SL1, activates RNA polymerase I transcription. Embo J 20:1353-1362. 137. Ikonen, T., Palvimo, J.J., and Janne, O.A. 1997. Interaction between the amino-and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 272:29821-29828. 138. Shen, H.C., Buchanan, G., Butler, L.M., Prescott, J . , Henderson, M., Tilley, W.D., and Coetzee, G.A. 2005. GRIP1 mediates the interaction between the amino- and carboxyl-termini of the androgen receptor. Biol Chem 386:69-74. 139. Hu, Y.C., Yeh, S., Yeh, S.D., Sampson, E.R., Huang, J . , Li, P., Hsu, C.L., Ting, H.J., Lin, H.K., Wang, L., et al. 2004. Functional domain and motif analyses of androgen receptor coregulator ARA70 and its differential expression in prostate cancer. J Biol Chem 279:33438-33446. 140. Huang, S.M., and Cheng, Y.S. 2004. Analysis of two CBP (cAMP-response-element-binding protein-binding protein) interacting sites in GRIP1 (glucocorticoid-receptor-interacting protein), and their importance for the function of GRIP1. Biochem J 382:111-119. 141. Schrantz, N., da Silva Correia, J . , Fowler, B., Ge, Q., Sun, Z., and Bokoch, G.M. 2004. Mechanism of p21-activated kinase 6-mediated inhibition of androgen receptor signaling. J Biol Chem 279:1922-1931. 142. Zhang, Y., Yang, Y., Yeh, S., and Chang, C. 2004. ARA67/PAT1 functions as a repressor to suppress androgen receptor transactivation. Mol Cell Biol 24:1044-1057. 143. Sharma, M., and Sun, Z. 2001. 5TG3 ' interacting factor interacts with Sin3A and represses AR-mediated transcription. Mol Endocrinol 15:1918-1928. 144. Reutens, AT . , Fu, M., Wang, C , Albanese, C , McPhaul, M.J., Sun, Z., Balk, S.P., Janne, O.A., Palvimo, J.J., and Pestell, R.G. 2001. Cyclin D1 binds the androgen receptor and regulates hormone-dependent signaling in a p300/CBP-associated factor (P/CAF)-dependent manner. Mol Endocrinol 15:797-811. 145. Wang, L, Hsu, C.L., Ni, J . , Wang, P.H., Yeh, S., Keng, P., and Chang, C. 2004. Human checkpoint protein hRad9 functions as a negative coregulator to repress androgen receptor transactivation in prostate cancer cells. Mol Cell Biol 24:2202-2213. 146. Loy, C.J., Sim, K.S., and Yong, E.L. 2003. Filamin-A fragment localizes to the nucleus to regulate androgen receptor and coactivator functions. Proc Natl Acad SciUSA 100:4562-4567. 147. Edwards, J . , and Bartlett, J .M. 2005. The androgen receptor and signal-transduction pathways in hormone-refractory prostate cancer. Part 1: Modifications to the androgen receptor. BJU Int 95:1320-1326. 148. Blok, L.J., de Ruiter, P.E., and Brinkmann, A.O. 1998. Forskolin-induced dephosphorylation of the androgen receptor impairs ligand binding. Biochemistry 37:3850-3857. 47 149. Chen, S., Xu, Y., Yuan, X., Bubley, G.J., and Balk, S.P. 2006. Androgen receptor phosphorylation and stabilization in prostate cancer by cyclin-dependent kinase 1. Proc Natl Acad Sci USA 103:15969-15974. 150. Gioeli, D., Ficarro, S.B., Kwiek, J.J., Aaronson, D., Hancock, M., Catling, A.D., White, F.M., Christian, R.E., Settlage, R.E., Shabanowitz, J . , et al. 2002. Androgen receptor phosphorylation. Regulation and identification of the phosphorylation sites. J Biol Chem 277:29304-29314. 151. van Laar, J.H., Berrevoets, C.A., Trapman, J . , Zegers, N.D., and Brinkmann, A.O. 1991. Hormone-dependent androgen receptor phosphorylation is accompanied by receptor transformation in human lymph node carcinoma of the prostate cells. J Biol Chem 266:3734-3738. 152. Lin, H.K., Yeh, S., Kang, H.Y., and Chang, C. 2001. Akt suppresses androgen-induced apoptosis by phosphorylating and inhibiting androgen receptor. Proc Natl Acad Sci USA 98:7200-7205. 153. Wen, Y., Hu, M.C., Makino, K., Spohn, B., Bartholomeusz, G., Yan, D.H., and Hung, M.C. 2000. HER-2/neu promotes androgen-independent survival and growth of prostate cancer cells through the Akt pathway. Cancer Res 60:6841-6845. 154. Ghosh, P.M., Malik, S., Bedolla, R., and Kreisberg, J.I. 2003. Akt in prostate cancer: possible role in androgen-independence. Curr Drug Metab 4:487-496. 155. Nazareth, L.V., and Weigel, N.L. 1996. Activation of the human androgen receptor through a protein kinase A signaling pathway. J Biol Chem 271:19900-19907. 156. Sadar, M.D. 1999. Androgen-independent induction of prostate-specific antigen gene expression via cross-talk between the androgen receptor and protein kinase A signal transduction pathways. J Biol Chem 27'4:7777'-71'83. 157. Fu, M., Wang, O , Reutens, AT . , Wang, J . , Angeletti, R.H., Siconolfi-Baez, L, Ogryzko, V., Avantaggiati, M.L., and Pestell, R.G. 2000. p300 and p300/cAMP-response element-binding protein-associated factor acetylate the androgen receptor at sites governing hormone-dependent transactivation. J Biol Chem 275:20853-20860. 158. Gaughan, L, Logan, I.R., Cook, S., Neal, D.E., and Robson, C.N. 2002. Tip60 and histone deacetylase 1 regulate androgen receptor activity through changes to the acetylation status of the receptor. J Biol Chem 277:25904-25913. 159. Fu, M., Rao, M., Wang, C , Sakamaki, T., Wang, J . , Di Vizio, D., Zhang, X., Albanese, C , Balk, S., Chang, C , et al. 2003. Acetylation of androgen receptor enhances coactivator binding and promotes prostate cancer cell growth. Mol Cell Biol 23:8563-8575. 160. Poukka, H., Aarnisalo, P., Karvonen, U., Palvimo, J.J., and Janne, O.A. 1999. Ubc9 interacts with the androgen receptor and activates receptor-dependent transcription. J Biol Chem 274:19441-19446. 161. Poukka, H., Karvonen, U., Janne, O A , and Palvimo, J.J. 2000. Covalent modification of the androgen receptor by small ubiquitin-like modifier 1 (SUMO-1). Proc Natl Acad Sci USA 97:14145-14150. 48 162. Gross, M., Yang, R., Top, I., Gasper, C., and Shuai, K. 2004. PIASy-mediated repression of the androgen receptor is independent of sumoylation. Oncogene 23:3059-3066. 163. Lin, D.Y., Fang, H.I., Ma, A.H., Huang, Y.S., Pu, Y.S., Jenster, G., Kung, H.J., and Shih, H.M. 2004. Negative modulation of androgen receptor transcriptional activity by Daxx. Mol Cell Biol 24:10529-10541. 164. Sheflin, L, Keegan, B., Zhang, W., and Spaulding, S.W. 2000. Inhibiting proteasomes in human HepG2 and LNCaP cells increases endogenous androgen receptor levels. Biochem Biophys Res Commun 276:144-150. 165. Lin, H.K., Wang, L., Hu, Y.C., Altuwaijri, S., arid Chang, C. 2002. Phosphorylation-dependent ubiquitylation and degradation of androgen receptor by Akt require Mdm2 E3 ligase. Embo J 21:4037-4048. 166. Rees, I., Lee, S., Kim, H., and Tsai, FT . 2006. The E3 ubiquitin ligase CHIP binds the androgen receptor in a phosphorylation-dependent manner. Biochim Biophys Acta 1764:1073-1079. 167. Gaughan, L., Logan, I.R., Neal, D.E., and Robson, C.N. 2005. Regulation of androgen receptor and histone deacetylase 1 by Mdm2-mediated ubiquitylation. Nucleic Acids Res 33:13-26. 168. He, B., Bai, S., Hnat, AT . , Kalman, R.I., Minges, J.T., Patterson, C , and Wilson, E.M. 2004. An androgen receptor NH2 :terminal conserved motif interacts with the COOH terminus of the Hsp70-interacting protein (CHIP). J Biol Chem 279:30643-30653. 169. Lin, H.K., Altuwaijri, S., Lin, W.J., Kan, P.Y., Collins, L L , and Chang, C. 2002. Proteasome activity is required for androgen receptor transcriptional activity via regulation of androgen receptor nuclear translocation and interaction with coregulators in prostate cancer cells. J Biol Chem 277:36570-36576. 170. Kang, Z., Pirskanen, A., Janne, O.A., and Palvimo, J.J. 2002. Involvement of proteasome in the dynamic assembly of the androgen receptor transcription complex. J Biol Chem 277:48366-48371. 171. Kim, J . , and Coetzee, G.A. 2004. Prostate specific antigen gene regulation by androgen receptor. J Cell Biochem 93:233-241. 172. Lee, C , Sutkowski, D.M., Sensibar, J.A., Zelner, D., Kim, I., Amsel, I., Shaw, N., Prins, G.S., and Kozlowski, J .M. 1995. Regulation of proliferation and production of prostate-specific antigen in androgen-sensitive prostatic cancer cells, LNCaP, by dihydrotestosterone. Endocrinology 136:796-803. 173. Mitchell, S.H., Murtha, P.E., Zhang, S., Zhu, W., and Young, C.Y. 2000. An androgen response element mediates LNCaP cell dependent androgen induction of the hK2 gene. Mol Cell Endocrinol 168:89-99. 174. Bieberich, C.J., Fujita, K., He, W.W., and Jay, G. 1996. Prostate-specific and androgen-dependent expression of a novel homeobox gene. J Biol Chem 271:31779-31782. 175. Joseph, I.B., Nelson, J.B., Denmeade, S.R., and Isaacs, J.T. 1997. Androgens regulate vascular endothelial growth factor content in normal and malignant prostatic tissue. Clin Cancer Res 3:2507-2511. 176. Shibata, Y., Kashiwagi, B., Arai, S., Fukabori, Y., Suzuki, K., Honma, S., and Yamanaka, H. 2004. Direct regulation of prostate blood flow by vascular 49 endothelial growth factor and its participation in the androgenic regulation of prostate blood flow in vivo. Endocrinology 145:4507-4512. 177. Fasciana, C , van der Made, A.C., Faber, P.W., and Trapman, J . 1996. Androgen regulation of the rat keratinocyte growth factor (KGF/FGF7) promoter. Biochem Biophys Res Commun 220:858-863. 178. Planz, B., Wang, Q., Kirley, S.D., Lin, C.W., and McDougal, W.S. 1998. Androgen responsiveness of stromal cells of the human prostate: regulation of cell proliferation and keratinocyte growth factor by androgen. J Urol 160:1850-1855. 179. Lee, C., Sintich, S.M., Mathews, E.P., Shah, A.H., Kundu, S.D., Perry, K.T., Cho, J.S., llio, K.Y., Cronauer, M.V., Janulis, L., etal . 1999. Transforming growth factor-beta in benign and malignant prostate. Prostate 39:285-290. 180. Velasco, A.M., Gillis, K.A., Li, Y., Brown, E.L., Sadler, T.M., Achilleos, M., Greenberger, L.M., Frost, P., Bai, W., and Zhang, Y. 2004. Identification and validation of novel androgen-regulated genes in prostate cancer. Endocrinology 145:3913-3924. 181. Jiang, F., and Wang, Z. 2003. Identification of androgen-responsive genes in the rat ventral prostate by complementary deoxyribonucleic acid subtraction and microarray. Endocrinology 144:1257-1265. 182. DePrimo, S.E., Diehn, M., Nelson, J.B., Reiter, R.E., Matese, J . , Fero, M., Tibshirani, R., Brown, P.O., and Brooks, J.D. 2002. Transcriptional programs activated by exposure of human prostate cancer cells to androgen. Genome Biol 3:RESEARCH0032. 183. Xu, L L , Su, Y.P., Labiche, R., Segawa, T., Shanmugam, N., McLeod, D.G., Moul, J.W., and Srivastava, S. 2001. Quantitative expression profile of androgen-regulated genes in prostate cancer cells and identification of prostate-specific genes. Int J Cancer 92:322-328. 184. Chen, Y., Robles, A.I., Martinez, L.A., Liu, F., Gimenez-Conti, I.B., and Conti, C.J. 1996. Expression of G1 cyclins, cyclin-dependent kinases, and cyclin-dependent kinase inhibitors in androgen-induced prostate proliferation in castrated rats. Cell Growth Differ 7:1571 -1578. 185. Lu, S., Tsai, S.Y., and Tsai, M.J. 1997. Regulation of androgen-dependent prostatic cancer cell growth: androgen regulation of CDK2, CDK4, and CKI p16 genes. Cancer Res 57:4511-4516. 186. Lu, S., Liu, M., Epner, D.E., Tsai, S.Y., and Tsai, M.J. 1999. Androgen regulation of the cyclin-dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Mol Endocrinol 13:376-384. 187. Coffey, R.N., Watson, R.W., O'Neill, A.J., Mc Eleny, K., and Fitzpatrick, J .M. 2002. Androgen-mediated resistance to apoptosis. Prostate 53:300-309. 188. Tomlins, S.A., Rhodes, D.R., Perner, S., Dhanasekaran, S.M., Mehra, R., Sun, X.W., Varambally, S., Cao, X., Tchinda, J . , Kuefer, R., et al. 2005. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310:644-648. 189. Macaluso, M., and Giordano, A. 2007. TMPRSS2 .ERG Gene Fusion: A New Genetic Marker for Prostate Cancer Progression. Cancer Biol Ther 6. 50 190. Soller, M.J., Isaksson, M., Eltving, P., Soller, W., Lundgren, R., and Panagopoulos, I. 2006. Confirmation of the high frequency of the TMPRSS2/ERG fusion gene in prostate cancer. Genes Chromosomes Cancer 45:717-719. 191. Vaarala, M.H., Porvari, K., Kyllonen, A., Lukkarinen, O., and Vihko, P. 2001. The TMPRSS2 gene encoding transmembrane serine protease is overexpressed in a majority of prostate cancer patients: detection of mutated TMPRSS2 form in a case of aggressive disease. IntJ Cancer 94:705-710. 192. Petrovics, G., Liu, A., Shaheduzzaman, S., Furasato, B., Sun, C , Chen, Y., Nau, M., Ravindranath, L., Dobi, A., Srikantan, V., et al. 2005. Frequent overexpression of ETS-related gene-1 (ERG1) in prostate cancer transcriptome. Oncogene 24:3847-3852. 193. Bernstein, M., Kovar, H., Paulussen, M., Randall, R.L., Schuck, A., Teot, L.A., and Juergens, H. 2006. Ewing's sarcoma family of tumors: current management. Oncologist 11:503-519. 194. Dittmer, J . 2003. The biology of the Ets1 proto-oncogene. Mol Cancer 2:29. 195. Rajput, A.B., Miller, M.A., De Luca, A., Boyd, N., Leung, S., Hurtado-Coll, A., Fazli, L., Jones, E.C., Palmer, J.B., Gleave, M.E., et al. 2007. Frequency of the TMPRSS2 :ERG gene fusion is increased in moderate to poorly differentiated prostate cancers. J Clin Pathol. 196. Nam, R.K., Sugar, L, Wang, Z., Yang, W., Kitching, R., Klotz, L.H., Venkateswaran, V., Narod, S.A., and Seth, A. 2007. Expression of TMPRSS2 ERG Gene Fusion in Prostate Cancer Cells is an Important Prognostic Factor for Cancer Progression. Cancer Biol Ther 6. 197. Montironi, R., Mazzucchelli, R., and Scarpelli, M. 2002. Precancerous lesions and conditions of the prostate: from morphological and biological characterization to chemoprevention. Ann N Y Acad Sci 963:169-184. 198. Bostwick, D.G., Liu, L., Brawer, M.K., and Qian, J . 2004. High-grade prostatic intraepithelial neoplasia. Rev Urol 6:171-179. 199. Wang, S., Gao, J . , Lei, Q., Rozengurt, N., Pritchard, C , Jiao, J . , Thomas, G.V., Li, G., Roy-Burman, P., Nelson, P.S., etal . 2003. Prostate-specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell 4:209-221. 200. Chokkalingam, A.P., Nyren, O., Johansson, J.E., Gridley, G., McLaughlin, J.K., Adami, H.O., and Hsing, A.W. 2003. Prostate carcinoma risk subsequent to diagnosis of benign prostatic hyperplasia: a population-based cohort study in Sweden. Cancer 98:1727-1734. 201. Sokoll, L.J., and Chan, D.W. 1997. Prostate-specific antigen. Its discovery and biochemical characteristics. Urol Clin North Am 24:253-259. 202. Brawer, M.K. 1999. Prostate-specific antigen: current status. CA Cancer J Clin 49:264-281. 203. Candas, B., Cusan, L., Gomez, J.L., Diamond, P., Suburu, R.E., Levesque, J . , Brousseau, G., Belanger, A., and Labrie, F. 2000. Evaluation of prostatic specific antigen and digital rectal examination as screening tests for prostate cancer. Prostate 45:19-35. 51 204. Stephenson, R.A. 2002. Prostate cancer trends in the era of prostate-specific antigen. An update of incidence, mortality, and clinical factors from the SEER database. Urol Clin North Am 29:173-181. 205. Bartsch, G., Horninger, W., Klocker, H., Reissigl, A., Oberaigner, W., Schonitzer, D., Severi, G., Robertson, C., and Boyle, P. 2001. Prostate cancer mortality after introduction of prostate-specific antigen mass screening in the Federal State of Tyrol, Austria. Urology 58:417-424. 206. Maroni, P.D., and Crawford, E.D. 2006. Screening for prostate cancer in 2006: PSA in the 21 st century. N C Med J 67:136-139. 207. Rowley, K.H., and Mason, M.D. 1997. The aetiology and pathogenesis of prostate cancer. Clin Oncol (R Coll Radiol) 9:213-218. 208. Bratt, O., Kristoffersson, U., Olsson, H., and Lundgren, R. 1998. Clinical course of early onset prostate cancer with special reference to family history as a prognostic factor. Eur Urol 34:19-24. 209. Rodriguez, C , Calle, E.E., Miracle-McMahill, H.L., Tatham, L.M., Wingo, P A , Thun, M.J., and Heath, C.W., Jr. 1997. Family history and risk of fatal prostate cancer. Epidemiology 8:653-657. 210. Negri, E., Pelucchi, C , Talamini, R., Montella, M., Gallus, S., Bosetti, C , Franceschi, S., and La Vecchia, C. 2005. Family history of cancer and the risk of prostate cancer and benign prostatic hyperplasia. Int J Cancer 114:648-652. 211. Bishop, D.T., and Kiemeney, L.A. 1997. Family studies and the evidence for genetic susceptibility to prostate cancer. Semin Cancer Biol 8:45-51. 212. Bratt, O., Kristoffersson, U., Lundgren, R., and Olsson, H. 1997. The risk of malignant tumours in first-degree relatives of men with early onset prostate cancer: a population-based cohort study. EurJ Cancer 33:2237-2240. 213. Powell, I.J. 1997. Prostate cancer and African-American men. Oncology (Williston Park) 11:599-605; discussion 606-515 passim. 214. Marugame, T., and Katanoda, K. 2006. International comparisons of cumulative risk of breast and prostate cancer, from cancer incidence in five continents Vol. VIII. Jpn J Clin Oncol 36:399-400. 215. Shibata, A., Whittemore, A.S., Imai, K., Kolonel, L.N., Wu, A.H., John, E.M., Stamey, T.A., and Paffenbarger, R.S. 1997. Serum levels of prostate-specific antigen among Japanese-American and native Japanese men. J Natl Cancer Inst 89:1716-1720. 216. Agalliu, I., Langeberg, W.J., Lampe, J.W., Salinas, C.A., and Stanford, J.L. 2006. Glutathione S-transferase M1, T1, and P1 polymorphisms and prostate cancer risk in middle-aged men. Prostate 66:146-156. 217. Agalliu, I., Lin, D.W., Salinas, C A , Feng, Z., and Stanford, J.L. 2006. Polymorphisms in the glutathione S-transferase M1, T1, and P1 genes and prostate cancer prognosis. Prostate 66:1535-1541. 218. Nelson, W.G., De Marzo, A.M., Deweese, T.L., Lin, X., Brooks, J.D., Putzi, M.J., Nelson, C P . , Groopman, J.D., and Kensler, T.W. 2001. Preneoplastic prostate lesions: an opportunity for prostate cancer prevention. Ann N Y Acad Sci 952:135-144. 219. Amling, C L . 2005. Relationship between obesity and prostate cancer. Curr Opin Urol 15:167-171. 52 220. Freedland, S.J., Isaacs, W.B., Mangold, L A , Yiu, S.K., Grubb, K A , Partin, A.W., Epstein, J.I., Walsh, P .C, and Platz, E.A. 2005. Stronger association between obesity and biochemical progression after radical prostatectomy among men treated in the last 10 years. Clin Cancer Res 11:2883-2888. 221. Freedland, S.J., Terris, M.K., Platz, E.A., and Presti, J . C , Jr. 2005. Body mass index as a predictor of prostate cancer: development versus detection on biopsy. Urology 66:108-113. 222. Giovannucci, E., Rimm, E.B., Stampfer, M.J., Colditz, G.A., and Willett, W.C. 1997. Height, body weight, and risk of prostate cancer. Cancer Epidemiol Biomarkers Prev 6:557-563. 223. Robinson, W.R., Stevens, J . , Gammon, M.D., and John, E.M. 2005. Obesity before age 30 years and risk of advanced prostate cancer. Am J Epidemiol 161:1107-1114. 224. Colli, J.L., and Colli, A. 2005. Comparisons of prostate cancer mortality rates with dietary practices in the United States. Urol Oncol 23:390-398. 225. Walker, M., Aronson, K.J., King, W., Wilson, J.W., Fan, W., Heaton, J.P., MacNeily, A., Nickel, J . C , and Morales, A. 2005. Dietary patterns and risk of prostate cancer in Ontario, Canada. Int J Cancer 116:592-598. 226. Giovannucci, E. 1999. Tomatoes, tomato-based products, lycopene, and cancer: review of the epidemiologic literature. J Natl Cancer Inst 91:317-331. 227. Basu, A., and Imrhan, V. 2005. Vitamin E and prostate cancer: is vitamin E succinate a superior chemopreventive agent? NutrRev 63:247-251. 228. Nomura, A.M., Lee, J . , Stemmermann, G.N., and Combs, G.F., Jr. 2000. Serum selenium and subsequent risk of prostate cancer. Cancer Epidemiol Biomarkers Prev 9:883-887. 229. Gann, P.H., Hennekens, C.H., Ma, J . , Longcope, C , and Stampfer, M.J. 1996. Prospective study of sex hormone levels and risk of prostate cancer. J Natl Cancer Inst 88:1118-1126. 230. Ntais, C , Polycarpou, A., and Tsatsoulis, A. 2003. Molecular epidemiology of prostate cancer: androgens and polymorphisms in androgen-related genes. Eur J Endocrinol 149:469-477. 231. Nomura, A.M., Stemmermann, G.N., Chyou, P.H., Henderson, B.E., and Stanczyk, F.Z. 1996. Serum androgens and prostate cancer. Cancer Epidemiol Biomarkers Prev 5:621-625. 232. Carter, H.B., Pearson, J.D., Metter, E.J., Chan, D.W., Andres, R., Fozard, J.L., Rosner, W., and Walsh, P.C. 1995. Longitudinal evaluation of serum androgen levels in men with and without prostate cancer. Prostate 27:25-31. 233. Plaskon, L.A., Penson, D.F., Vaughan, T .L , and Stanford, J.L. 2003. Cigarette smoking and risk of prostate cancer in middle-aged men. Cancer Epidemiol Biomarkers Prev 12:604-609. 234. Hickey, K., Do, K.A., and Green, A. 2001. Smoking and prostate cancer. Epidemiol Rev 23:115-125. 235. Humphrey, P.A. 2004. Gleason grading and prognostic factors in carcinoma of the prostate. Mod Pathol 17:292-306. 236. Bostwick, D.G., Shan, A., Qian, J . , Darson, M., Maihle, N.J., Jenkins, R.B., and Cheng, L. 1998. Independent origin of multiple foci of prostatic intraepithelial 53 neoplasia: comparison with matched foci of prostate carcinoma. Cancer 83:1995-2002. 237. Huggins, C , and Hodges, C. 1941. Studies on prostatic cancer, I: the effect of castration, of estrogen and of androgen injections on serum phosphatases in metastatic carcinoma of the prostate. Cancer Res 1:293-297. 238. Morgentaler, A. 2006. Testosterone and prostate cancer: an historical perspective on a modern myth. Eur Urol 50:935-939. 239. Mouraviev, V., and Gleave, M.E. 2003. A meaningful legacy: urologists as Nobel Prize laureates. Can J Urol 10:1737-1742. 240. Haag, P., Bektic, J . , Bartsch, G., Klocker, H., and Eder, I.E. 2005. Androgen receptor down regulation by small interference RNA induces cell growth inhibition in androgen sensitive as well as in androgen independent prostate cancer cells. J Steroid Biochem Mol Biol 96:251-258. 241. Liao, X., Tang, S., Thrasher, J.B., Griebling, T.L., and Li, B. 2005. Small-interfering RNA-induced androgen receptor silencing leads to apoptotic cell death in prostate cancer. Mol Cancer Ther 4:505-515. 242. Hedlund, P.O. 2000. Side effects of endocrine treatment and their mechanisms: castration, antiandrogens, and estrogens. Prostate Suppl 10:32-37. 243. Tammela, T. 2004. Endocrine treatment of prostate cancer. J Steroid Biochem Mol Biol 92:287-295. 244. Labrie, F., Belanger, A., Luu-The, V., Labrie, C , Simard, J . , Cusan, L., Gomez, J . , and Candas, B. 2005. Gonadotropin-releasing hormone agonists in the treatment of prostate cancer. Endocr Rev 26:361-379. 245. Small, E.J., Baron, A., and Bok, R. 1997. Simultaneous antiandrogen withdrawal and treatment with ketoconazole and hydrocortisone in patients with advanced prostate carcinoma. Cancer 80:1755-1759. 246. Culig, Z., Bartsch, G., and Hobisch, A. 2004. Antiandrogens in prostate cancer endocrine therapy. Curr Cancer Drug Targets 4:455-461. 247. Klotz, L. 2006. Combined androgen blockade: an update. Urol Clin North Am 33:161-166, v-vi. 248. Oh, W.K., Manola, J . , Bittmann, L, Brufsky, A., Kaplan, I.D., Smith, M.R., Kaufman, D.S., and Kantoff, P.W. 2003. Finasteride and flutamide therapy in patients with advanced prostate cancer: response to subsequent castration and long-term follow-up. Urology 62:99-104. 249. Andriole, G., Bostwick, D., Civantos, F., Epstein, J . , Lucia, M.S., McConnell, J . , and Roehrborn, C G . 2005. The effects of 5alpha-reductase inhibitors on the natural history, detection and grading of prostate cancer: current state of knowledge. J Urol 174:2098-2104. 250. Malkowicz, S.B. 2001. The role of diethylstilbestrol in the treatment of prostate cancer. Urology 58:108-113. 251. Guns, E.S., Goldenberg, S.L., and Brown, P.N. 2002. Mass spectral analysis of PC-SPES confirms the presence of diethylstilbestrol. Can J Urol 9:1684-1688; discussion 1689. 252. Pether, M., and Goldenberg, S.L. 2004. Intermittent androgen suppression. BJU Int 93:258-261. 54 253. Gleave, M., Goldenberg, S.L., Bruchovsky, N., and Rennie, P. 1998. Intermittent androgen suppression for prostate cancer: rationale and clinical experience. Prostate Cancer Prostatic Dis 1:289-296. 254. Pether, M., Goldenberg, S.L., Bhagirath, K., and Gleave, M. 2003. Intermittent androgen suppression in prostate cancer: an update of the Vancouver experience. Can J Urol 10:1809-1814. 255. Brawer, M.K. 2006. Hormonal therapy for prostate cancer. Rev Urol 8 Suppl 2:S35-47. 256. Goldenberg, S.L., Gleave, M.E., Taylor, D., and Bruchovsky, N. 1999. Clinical Experience with Intermittent Androgen Suppression in Prostate Cancer: Minimum of 3 Years' Follow-Up. Mol Urol 3:287-292. 257. Gleave, M., Miyake, H., and Chi, K. 2005. Beyond simple castration: targeting the molecular basis of treatment resistance in advanced prostate cancer. Cancer Chemother Pharmacol 56 Suppl 1:47-57. 258. Martel, C.L., Gumerlock, P.H., Meyers, F.J., and Lara, P.N. 2003. Current strategies in the management of hormone refractory prostate cancer. Cancer Treat Rev 29:171-187. 259. Craft, N., Chhor, C , Tran, C , Belldegrun, A., DeKernion, J . , Witte, O.N., Said, J . , Reiter, R.E., and Sawyers, C.L. 1999. Evidence for clonal outgrowth of androgen-independent prostate cancer cells from androgen-dependent tumors through a two-step process. Cancer Res 59:5030-5036. 260. Baisch, H., Otto, U., and Fack, H. 1998. Growth of human prostate carcinomas with and without hormone alpha- dehydrotestosterone in nude mice. Eur Urol 34:505-511. 261. Bubendorf, L., Kononen, J . , Koivisto, P., Schraml, P., Moch, H., Gasser, T.C., Willi, N., Mihatsch, M.J., Sauter, G., and Kallioniemi, O.P. 1999. Survey of gene amplifications during prostate cancer progression by high-throughout fluorescence in situ hybridization on tissue microarrays. Cancer Res 59:803-806. 262. Miyoshi, Y., Uemura, H., Fujinami, K., Mikata, K., Harada, M., Kitamura, H., Koizumi, Y., and Kubota, Y. 2000. Fluorescence in situ hybridization evaluation of c-myc and androgen receptor gene amplification and chromosomal anomalies in prostate cancer in Japanese patients. Prostate 43:225-232. 263. Visakorpi, T., Hyytinen, E., Koivisto, P., Tanner, M., Keinanen, R., Palmberg, C , Palotie, A., Tammela, T., Isola, J . , and Kallioniemi, O.P. 1995. In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat Genet 9:401-406. 264. Koivisto, P., Kononen, J . , Palmberg, O , Tammela, T., Hyytinen, E., Isola, J . , Trapman, J . , Cleutjens, K., Noordzij, A., Visakorpi, T., et al. 1997. Androgen receptor gene amplification: a possible molecular mechanism for androgen deprivation therapy failure in prostate cancer. Cancer Res 57:314-319. 265. Linja, M.J., Savinainen, K.J., Saramaki, O.R., Tammela, T.L., Vessella, R.L., and Visakorpi, T. 2001. Amplification and overexpression of androgen receptor gene in hormone-refractory prostate cancer. Cancer Res 61:3550-3555. 55 266. Brown, R.S., Edwards, J . , Dogan, A., Payne, H., Harland, S.J., Bartlett, J .M., and Masters, J.R. 2002. Amplification of the androgen receptor gene in bone metastases from hormone-refractory prostate cancer. J Pathol 198:237-244. 267. Koivisto, P.A., and Helin, H.J. 1999. Androgen receptor gene amplification increases tissue PSA protein expression in hormone-refractory prostate carcinoma. J Pathol 189:219-223. 268. Palmberg, C , Koivisto, P., Kakkola, L, Tammela, T.L., Kallioniemi, O.P., and Visakorpi, T. 2000. Androgen receptor gene amplification at primary progression predicts response to combined androgen blockade as second line therapy for advanced prostate cancer. J Urol 164:1992-1995. 269. Palmberg, C , Koivisto, P., Hyytinen, E., Isola, J . , Visakorpi, T., Kallioniemi, O.P., and Tammela, T. 1997. Androgen receptor gene amplification in a recurrent prostate cancer after monotherapy with the nonsteroidal potent antiandrogen Casodex (bicalutamide) with a subsequent favorable response to maximal androgen blockade. Eur Urol 31:216-219. 270. Gregory, C.W., Johnson, R.T., Jr., Mohler, J . L , French, F.S., and Wilson, E.M. 2001. Androgen receptor stabilization in recurrent prostate cancer is associated with hypersensitivity to low androgen. Cancer Res 61:2892-2898. 271. Stanbrough, M., Bubley, G.J., Ross, K., Golub, T.R., Rubin, M.A., Penning, T.M., Febbo, P.G., and Balk, S.P. 2006. Increased expression of genes converting adrenal androgens to testosterone in androgen-independent prostate cancer. Cancer Res 66:2815-2825. 272. Koh, E., Noda, T., Kanaya, J . , and Namiki, M. 2002. Differential expression of 17beta-hydroxysteroid dehydrogenase isozyme genes in prostate cancer and noncancer tissues. Prostate 53:154-159. 273. Steketee, K., Timmerman, L, Ziel-van der Made, A.C., Doesburg, P., Brinkmann, A.O., and Trapman, J . 2002. Broadened ligand responsiveness of androgen receptor mutants obtained by random amino acid substitution of H874 and mutation hot spot T877 in prostate cancer. Int J Cancer 100:309-317. 274. Culig, Z., Hobisch, A., Cronauer, M.V., Cato, A.C., Hittmair, A., Radmayr, C., Eberle, J . , Bartsch, G., and Klocker, H. 1993. Mutant androgen receptor detected in an advanced-stage prostatic carcinoma is activated by adrenal androgens and progesterone. Mol Endocrinol 7:1541 -1550. 275. Mizokami, A., Koh, E., Fujita, H., Maeda, Y., Egawa, M., Koshida, K., Honma, S., Keller, E.T., and Namiki, M. 2004. The adrenal androgen androstenediol is present in prostate cancer tissue after androgen deprivation therapy and activates mutated androgen receptor. Cancer Res 64:765-771. 276. Elo, J.P., Kvist, L, Leinonen, K., Isomaa, V., Henttu, P., Lukkarinen, O., and Vihko, P. 1995. Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol. J Clin Endocrinol Metab 80:3494-3500. 277. Fenton, M.A., Shuster, T.D., Fertig, A.M., Taplin, M.E., Kolvenbag, G., Bubley, G.J., and Balk, S.P. 1997. Functional characterization of mutant androgen receptors from androgen-independent prostate cancer. Clin Cancer Res 3:1383-1388. 56 278. Wirth, M.P., and Froschermaier, S.E. 1997. The antiandrogen withdrawal syndrome. Urol Res 25 Suppl 2:S67-71. 279. Duff, J . , and McEwan, I.J. 2005. Mutation of histidine 874 in the androgen receptor ligand-binding domain leads to promiscuous ligand activation and altered p160 coactivator interactions. Mol Endocrinol 19:2943-2954. 280. James, A.J., Agoulnik, I.U., Harris, J .M., Buchanan, G., Tilley, W.D., Marcelli, M., Lamb, D.J., and Weigel, N.L. 2002. A novel androgen receptor mutant, A748T, exhibits hormone concentration-dependent defects in nuclear accumulation and activity despite normal hormone-binding affinity. Mol Endocrinol 16:2692-2705. 281. Taplin, M.E., Bubley, G.J., Shuster, T.D., Frantz, M.E., Spooner, A.E., Ogata, G.K., Keer, H.N., and Balk, S.P. 1995. Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer. N Engl J Med 332:1393-1398. 282. Suzuki, H., Akakura, K., Komiya, A., Aida, S., Akimoto, S., and Shimazaki, J . 1996. Codon 877 mutation in the androgen receptor gene in advanced prostate cancer: relation to antiandrogen withdrawal syndrome. Prostate 29:153-158. 283. Ceraline, J . , Cruchant, M.D., Erdmann, E., Erbs, P., Kurtz, J.E., Duclos, B., Jacqmin, D., Chopin, D., and Bergerat, J.P. 2004. Constitutive activation of the androgen receptor by a point mutation in the hinge region: a new mechanism for androgen-independent growth in prostate cancer. Int J Cancer 108:152-157. 284. Monge, A., Jagla, M., Lapouge, G., Sasorith, S., Cruchant, M., Wurtz, J .M., Jacqmin, D., Bergerat, J.P., and Ceraline, J . 2006. Unfaithfulness and promiscuity of a mutant androgen receptor in a hormone-refractory prostate cancer. Cell Mol Life Sci 63:487-497. 285. Miyamoto, H., Yeh, S., Wilding, G., and Chang, C. 1998. Promotion of agonist activity of antiandrogens by the androgen receptor coactivator, ARA70, in human prostate cancer DU145 cells. Proc Natl Acad Sci USA 95:7379-7384. 286. Ngan, E.S., Hashimoto, Y., Ma, Z.Q., Tsai, M.J., and Tsai, S.Y. 2003. Overexpression of Cdc25B, an androgen receptor coactivator, in prostate cancer. Oncogene 22:734-739. 287. Hong, H., Kao, C , Jeng, M.H., Eble, J.N., Koch, M.O., Gardner, T.A., Zhang, S., Li, L, Pan, C.X., Hu, Z., et al. 2004. Aberrant expression of CARM1, a transcriptional coactivator of androgen receptor, in the development of prostate carcinoma and androgen-independent status. Cancer 101:83-89. 288. Debes, J.D., Sebo, T.J., Lohse, C M . , Murphy, L.M., Haugen, D.A., and Tindall, D.J. 2003. p300 in prostate cancer proliferation and progression. Cancer Res 63:7638-7640. 289. Culig, Z., Comuzzi, B., Steiner, H., Bartsch, G., and Hobisch, A. 2004. Expression and function of androgen receptor coactivators in prostate cancer. J Steroid Biochem Mol Biol 92:265-271. 290. Ray, M.R., Wafa, L A , Cheng, H., Snoek, R., Fazli, L, Gleave, M., and Rennie, P.S. 2006. Cyclin G-associated kinase: a novel androgen receptor-interacting transcriptional coactivator that is overexpressed in hormone refractory prostate cancer. Int J Cancer 118:1108-1119. 57 291. Culig, Z., Hobisch, A., Cronauer, M.V., Radmayr, C , Trapman, J . , Hittmair, A., Bartsch, G., and Klocker, H. 1994. Androgen receptor activation in prostatic tumor cell lines by insulin-like growth factor-l, keratinocyte growth factor, and epidermal growth factor. Cancer Res 54:5474-5478. 292. Kulik, G., Klippel, A., and Weber, M.J. 1997. Antiapoptotic signalling by the insulin-like growth factor I receptor, phosphatidylinositol 3-kinase, and Akt. Mol Cell B/o/17:1595-1606. 293. Nickerson, T., Miyake, H., Gleave, M.E., and Pollak, M. 1999. Castration-induced apoptosis of androgen-dependent shionogi carcinoma is associated with increased expression of genes encoding insulin-like growth factor-binding proteins. Cancer Res 59:3392-3395. 294. Kaplan, P.J., Mohan, S., Cohen, P., Foster, B.A., and Greenberg, N.M. 1999. The insulin-like growth factor axis and prostate cancer: lessons from the transgenic adenocarcinoma of mouse prostate (TRAMP) model. Cancer Res 59:2203-2209. 295. Kiyama, S., Morrison, K., Zellweger, T., Akbari, M., Cox, M., Yu, D., Miyake, H., and Gleave, M.E. 2003. Castration-induced increases in insulin-like growth factor-binding protein 2 promotes proliferation of androgen-independent human prostate LNCaP tumors. Cancer Res 63:3575-3584. 296. Miyake, H., Pollak, M., and Gleave, M.E. 2000. Castration-induced up-regulation of insulin-like growth factor binding protein-5 potentiates insulin-like growth factor-l activity and accelerates progression to androgen independence in prostate cancer models. Cancer Res 60:3058-3064. 297. Miyake, H., Nelson, C , Rennie, P.S., and Gleave, M.E. 2000. Overexpression of insulin-like growth factor binding protein-5 helps accelerate progression to androgen-independence in the human prostate LNCaP tumor model through activation of phosphatidylinositol 3'-kinase pathway. Endocrinology 141:2257-2265. 298. Craft, N., Shostak, Y., Carey, M., and Sawyers, C L . 1999. A mechanism for hormone-independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med 5:280-285. 299. Shi, Y., Chatterjee, S.J., Brands, F.H., Shi, S.R., Pootrakul, L, Taylor, C.R., Datar, R., and Cote, R.J. 2006. Role of coordinated molecular alterations in the development of androgen-independent prostate cancer: an in vitro model that corroborates clinical observations. BJU Int 97:170-178. 300. Agus, D.B., Scher, H.I., Higgins, B., Fox, W.D., Heller, G., Fazzari, M., Cordon-Cardo, C , and Golde, D.W. 1999. Response of prostate cancer to anti-Her-2/neu antibody in androgen-dependent and -independent human xenograft models. Cancer Res 59:4761-4764. 301. Ziada, A., Barqawi, A., Glode, L.M., Varella-Garcia, M., Crighton, F., Majeski, S., Rosenblum, M., Kane, M., Chen, L., and Crawford, E.D. 2004. The use of trastuzumab in the treatment of hormone refractory prostate cancer; phase II trial. Prostate 60:332-337. 302. Lara, P.N., Jr., Chee, K.G., Longmate, J . , Ruel, C , Meyers, F.J., Gray, C.R., Edwards, R.G., Gumerlock, P.H., Twardowski, P., Doroshow, J.H., eta l . 2004. Trastuzumab plus docetaxel in HER-2/neu-positive prostate carcinoma: final 58 results from the California Cancer Consortium Screening and Phase II Trial. Cancer 100:2125-2131. 303. Bertram, J . , Peacock, J.W., Fazli, L, Mui, A.L., Chung, S.W., Cox, M.E., Monia, B., Gleave, M.E., and Ong, C.J. 2006. Loss of PTEN is associated with progression to androgen independence. Prostate 66:895-902. 304. Graff, J.R., Konicek, B.W., McNulty, A.M., Wang, Z., Houck, K., Allen, S., Paul, J.D., Hbaiu, A., Goode, R.G., Sandusky, G.E., et al. 2000. Increased AKT activity contributes to prostate cancer progression by dramatically accelerating prostate,tumor growth and diminishing p27Kip1 expression. J Biol Chem 275:24500-24505. 305. McDonnell, T.J., Troncoso, P., Brisbay, S.M., Logothetis, C , Chung, L.W., Hsieh, J.T., Tu, S.M., and Campbell, M.L. 1992. Expression of the protooncogene bcl-2 in the prostate and its association with emergence of androgen-independent prostate cancer. Cancer Res 52:6940-6944. 306. Nupponen, N.N., Kakkola, L., Koivisto, P., and Visakorpi, T. 1998. Genetic alterations in hormone-refractory recurrent prostate carcinomas. Am J Pathol 153:141-148. 307. Raffo, A.J., Perlman, H., Chen, M.W., Day, M.L., Streitman, J.S., and Buttyan, R. 1995. Overexpression of bcl-2 protects prostate cancer cells from apoptosis in vitro and confers resistance to androgen depletion in vivo. Cancer Res 55:4438-4445. 308. Gleave, M.E., Miayake, H., Goldie, J . , Nelson, O , and Tolcher, A. 1999. Targeting bcl-2 gene to delay androgen-independent progression and enhance chemosensitivity in prostate cancer using antisense bcl-2 oligodeoxynucleotides. Urology 54:36-46. 309. Miyake, H., Tolcher, A., and Gleave, M.E. 1999. Antisense Bcl-2 oligodeoxynucleotides inhibit progression to androgen-independence after castration in the Shionogi tumor model. Cancer Res 59:4030-4034. 310. Gleave, M., Tolcher, A., Miyake, H., Nelson, O , Brown, B., Beraldi, E., and Goldie, J . 1999. Progression to androgen independence is delayed by adjuvant treatment with antisense Bcl-2 oligodeoxynucleotides after castration in the LNCaP prostate tumor model. Clin Cancer Res 5:2891-2898. 311. Castilla, C , Congregado, B., Chinchon, D., Torrubia, F.J., Japon, M.A., and Saez, C. 2006. Bcl-xL is overexpressed in hormone-resistant prostate cancer and promotes survival of LNCaP cells via interaction with proapoptotic Bak. Endocrinology 147:4960-4967. 312. Vilenchik, M., Raffo, A.J., Benimetskaya, L, Shames, D., and Stein, C A . 2002. Antisense RNA down-regulation of bcl-xL Expression in prostate cancer cells leads to diminished rates of cellular proliferation and resistance to cytotoxic chemotherapeutic agents. Cancer Res 62:2175-2183. 313. Yamanaka, K., Rocchi, P., Miyake, H., Fazli, L., Vessella, B., Zangemeister-Wittke, U., and Gleave, M.E. 2005. A novel antisense oligonucleotide inhibiting several antiapoptotic Bcl-2 family members induces apoptosis and enhances chemosensitivity in androgen-independent human prostate cancer PC3 cells. Mol Cancer Ther 4:1689-1698. 59 314. Yamanaka, K., Rocchi, P., Miyake, H., Fazli, L, So, A., Zangemeister-Wittke, U., and Gleave, M.E. 2006. Induction of apoptosis and enhancement of chemosensitivity in human prostate cancer LNCaP cells using bispecific antisense oligonucleotide targeting Bcl-2 and Bcl-xL genes. BJU Int 97:1300-1308. 315. Rocchi, P., So, A., Kojima, S., Signaevsky, M., Beraldi, E., Fazli, L., Hurtado-Coll, A., Yamanaka, K., and Gleave, M. 2004. Heat shock protein 27 increases after androgen ablation and plays a cytoprotective role in hormone-refractory prostate cancer. Cancer Res 64:6595-6602. 316. Rocchi, P., Beraldi, E., Ettinger, S., Fazli, L, Vessella, R.L., Nelson, C , and Gleave, M. 2005. Increased Hsp27 after androgen ablation facilitates androgen independent progression in prostate cancer via signal transducers and activators of transcription 3-mediated suppression of apoptosis. Cancer Res 65:11083-11093. 317. Miyake, H., Nelson, C , Rennie, P.S., and Gleave, M.E. 2000. Testosterone-repressed prostate message-2 is an antiapoptotic gene involved in progression to androgen independence in prostate cancer. Cancer Res 60:170-176. 318. Rocchi, P., Jugpal, P., So, A., Sinneman, S., Ettinger, S., Fazli, L., Nelson, C , and Gleave, M. 2006. Small interference RNA targeting heat-shock protein 27 inhibits the growth of prostatic cell lines and induces apoptosis via caspase-3 activation in vitro. BJU Int 98:1082-1089. 319. Teimourian, S., Jalal, R., Sohrabpour, M., and Goliaei, B. 2006. Down-regulation of Hsp27 radiosensitizes human prostate cancer cells. Int J Urol 13:1221-1225. 320. Gleave, M., Nelson, C , and Chi, K. 2003. Antisense targets to enhance hormone and cytotoxic therapies in advanced prostate cancer. Curr Drug Targets 4:209-221. 321. Chi, K.N., Eisenhauer, E., Fazli, L., Jones, E .C, Goldenberg, S.L., Powers, J . , Tu, D., and Gleave, M.E. 2005. A phase I pharmacokinetic and pharmacodynamic study of OGX-011, a 2-methoxyethyl antisense oligonucleotide to clusterin, in patients with localized prostate cancer. J Natl Cancer Inst 97:1287-1296. 322. Cao, C , Shinohara, E.T., Li, H., Niermann, K.J., Kim, K.W., Sekhar, K.R., Gleave, M., Freeman, M., and Lu, B. 2005. Clusterin as a therapeutic target for radiation sensitization in a lung cancer model. Int J Radiat Oncol Biol Phys 63:1228-1236. 323. Webber, M.M., Bello, D., and Quader, S. 1997. Immortalized and tumorigenic adult human prostatic epithelial cell lines: characteristics and applications Part 2. Tumorigenic cell lines. Prostate 30:58-64. 324. Sobel, R.E., and Sadar, M.D. 2005. Cell lines used in prostate cancer research a compendium of old and new lines-part 1. J Urol 173:342-359. 325. Steele, V.E., Arnold, J.T., Lei, H., Izmirlian, G., and Blackman, M.R. 2006. Comparative effects of DHEA and DHT on gene expression in human LNCaP prostate cancer cells. Anticancer Res 26:3205-3215. 60 326. Grigoryev, D.N., Long, B.J., Njar, V.C., and Brodie, A.H. 2000. Pregnenolone stimulates LNCaP prostate cancer cell growth via the mutated androgen receptor. J Steroid Biochem Mol Biol 75:1 -10. 327. Arnold, J.T., Le, H., McFann, K.K., and Blackman, M.R. 2005. Comparative effects of DHEA vs. testosterone, dihydrotestosterone, and estradiol on proliferation and gene expression in human LNCaP prostate cancer cells. Am J Physiol Endocrinol Metab 288:E573-584. 328. Masiello, D., Chen, S.Y., Xu, Y., Verhoeven, M.C., Choi, E., Hollenberg, A.N., and Balk, S.P. 2004. Recruitment of beta-catenin by wild-type or mutant androgen receptors correlates with ligand-stimulated growth of prostate cancer cells. Mol Endocrinol 18:2388-2401. 329. Chlenski, A., Nakashiro, K., Ketels, K.V., Korovaitseva, G.I., and Oyasu, R. 2001. Androgen receptor expression in androgen-independent prostate cancer cell lines. Prostate 47:66-75. 330. Thalmann, G.N., Sikes, R.A., Wu, T.T., Degeorges, A., Chang, S.M., Ozen, M., Pathak, S., and Chung, L.W. 2000. LNCaP progression model of human prostate cancer: androgen-independence and osseous metastasis. Prostate 44:91-103 Jul 101;144(102). 331. Sato, N., Gleave, M.E., Bruchovsky, N., Rennie, P.S., Goldenberg, S.L., Lange, P.H., and Sullivan, L.D. 1996. Intermittent androgen suppression delays progression to androgen-independent regulation of prostate-specific antigen gene in the LNCaP prostate tumour model. J Steroid Biochem Mol Biol 58:139-146. 332. Sato, N., Gleave, M.E., Bruchovsky, N., Rennie, P.S., Beraldi, E., and Sullivan, L.D. 1997. A metastatic and androgen-sensitive human prostate cancer model using intraprostatic inoculation of LNCaP cells in SCID mice. Cancer Res 57:1584-1589. 61 Chapter 2. Expression Profiling of Androgen Regulated Genes in LNCaP Cells Using Microarrays 2.1 Introduction Androgens, such as testosterone, play a vital role to the development and maintenance of the prostate as well as for the development of prostate cancer (1, 2). Prostate tumors are also initially dependent on androgens for growth and survival. Removal of androgens through chemical or physical castration is initially an effective therapy against prostate cancer, however the cancer will recur in an androgen independent (Al) form, which is refractory to conventional therapies and is generally lethal (3). Prostate cancer is currently the most diagnosed cancer and has been the second leading cause of cancer deaths in Canadian men. The androgen receptor (AR) is a ligand activated transcription factor which interacts with specific DNA sequences in response to androgen binding and promotes transcription of various genes (4). Androgen regulated genes include both those important for the normal function of the prostate, such as the prostate specific antigen (PSA), as well as genes involved in cell survival such as Bcl-2 (5, 6). AR remains important as prostate cancer progresses to Al where there is a recurrence of AR regulated gene expression (7). Since the androgen receptor is central to prostate cancer and its progression, we sought to identify and characterize novel androgen regulated genes, which may be important for prostate cancer progression. The two most commonly used techniques for gene expression profiling are serial analysis of gene expression (SAGE) and microarrays. SAGE can allow for gene discovery as well as quantitative expression 62 profiling (8). However, SAGE can be cost prohibitive as well as not being as high throughput as microarrays and technically unable to detect between 10-20% of genes (9). Up to 40,000 oligonucleotide spots can be printed onto microarray slides and they are amenable to high throughput screening of mRNA expression levels in a cost and time effective manner. The microarray platform also includes many applications other than simple transcriptional profiling such ChIP on chip, SNP chips, array C G H and protein chips among others (10). Thereby microarray based expression analysis was the method of our choice for these studies, The LNCaP prostate cell line is a moderately differentiated, androgen dependent cell line often used as a model of prostate cancer and which has also been used to study androgen regulated gene expression in prostate cells (11). We treated LNCaP cells with the synthetic androgen, R1881, for three time points and microarrays were used to determine which genes are differentially regulated by androgens in prostate cancer cells. Two approaches were undertaken - looking at single genes which are androgen regulated and looking at networks of androgen regulated genes. GADD45G, a gene involved in apoptosis and cell cycle progression, and MRP4, which is involved in chemotherapeutic drug resistance were found to be highly upregulated in response to androgens. The pro-apoptotic gene BARD1 was downregulated by androgens. Ingenuity software was used to query biological pathways which are coordinately regulated by androgens. The transcription factor NFE2L2 was upregulated with androgens as well as its downstream genes, all involved in protecting the cell against oxidative stress. 63 2.2 Materials and Methods Cell Culture - LNCaP cells, passage 35-50, were grown at 37°C and 5% C 0 2 in RPMI containing 5% fetal bovine serum (FBS), 50 U penicillin and 50 pg streptomycin. Charcoal stripped serum (CSS) was prepared using FBS rotated with 1 % charcoal and 0 .1% dextran T-70 at 4°C for 30 minutes. The solution was centrifuged at 1000 rpm for 2 minutes and the supernatant saved. The process was repeated twice and the serum filtered through a Steriflip column (0.22 pm membrane, Millipore). Hormone Treatments - R1881 was purchased from Steraloids Inc. and stored as a stock solution in absolute ethanol. Prior to any hormone treatments, cells were grown in RPMI + 2 % C S S for 48 hours. The R1881 was diluted first into 8 0 % ethanol, then into 2 0 % ethanol before being added to RPMI + 2 % C S S and put onto the cells. The concentration of R1881 was 0.01 nM to 10 nM, as indicated. siRNA Transfections - LNCaP cells were grown to 6 0 % confluency before being transfected with 50 nM NFE2L3 siRNA (Ambion). Lipofectamine 2000 (Invitrogen) was added to serum free RPMI (1:50 ratio) and incubated at room temperature for 5 minutes. The lipofectamine 2000/RPMI mix was then added to an equal volume of serum free RPMI containing the negative control s iRNA or NFE2L2 siRNA and allowed to incubate at room temperature for 20 minutes. The siRNAs were added to the cells to a final concentration of 50 nM. As a negative control, some cells were treated with lipofectamine 2000 only. The cells were incubated at 37°C for 4 hours before replacement of the FBS to 5%. When done in conjunction with androgen treatment, the cells were grown in RPMI + 2 % CSS for 24 hours prior to siRNA treatment. After the 4 hour incubation with the siRNA, the C S S was replaced to 2%. After 24 hours, 1 nM 64 R1881 or an equal volume of 20 % EtOH was added. The RNA was harvested 24 hours after the androgen treatment. Preparation of RNA - RNA was harvested from the cells using Trizol (Invitrogen), as per manufacturer's instructions. Briefly, the cell pellet was dissolved in 1 ml_ Trizol by pipeting and 200 uL chloroform was added and the tube shaken. The phases were separated using centrifugation (10,000 x g, 15 minutes). The aqueous (top) phase was removed to a new tube and 500 uL of isopropanol added. The RNA was precipitated with centrifugation at 10,000 x g for 10 minutes. The pellet was washed with 7 5 % ethanol made in DEPC-H2O, and centrifuged at 7500 x g for 5 minutes. The ethanol was aspirated off, the pellet dried and resuspended in DEPC-H 20. The concentration of the RNA was determined using a spectrophotometer (Nano Technologies). Microarrays - To generate labeled cDNA, 20 pg RNA was reverse transcribed in a reaction containing 200 U Superscript II reverse transcriptase (Life Technologies), 1X reaction buffer, 1 mM DTT, 3.75 uM anchor T primer, 0.5 pM dATP, dCTP and dGTP, 0.05 pM dTTP, and 2.5 pM Cy3 or Cy5 dUTP (Amersham). The reaction proceeded for 3 hours after which the RNA was hydrolysed with NaOH. The probe was purified using a PCR purification kit (Qiagen) followed by an ethanol precipitation. The probe was resuspended in hybridization buffer (50% formamide, 5 X SSC, 0.1 % SDS, 0.5 pg/pl poly dA, 0.5 pg/pl yeast tRNA and 1 pg/pl salmon testes DNA) and denatured at 65°C for 5 minutes. The arrays were printed in-house and contained 13,971 spotted 70-mer oligonucleotides (Operon). The probe was then added to a microarray and a cover slip applied. Hybridization was done in a humidified chamber at 42°C overnight. GFP. PCR product was labeled with Cy3 or Cy5 using an oligolabeling kit (Amersham). 65 Labeled GFP was spiked into the reaction after the probe purification step. GFP cDNA was printed on the corners of all the subgrids on every microarray, and was used as an orientation marker. Once hybridized, the microarrays were scanned at a resolution of 10 pm on the Perkin Elmer ScanArray Express scanner. The resulting TIF images were quantified using Imagene software (Biodiscovery). The biological and technical replicates were averaged and the data was normalized using lowess in the GeneSpring software package. Tree diagram was generated using a standard correlation. The normalized data was loaded into the web-based Ingenuity software which generates biological networks from the differentially regulated genes. Northern Blot Analysis - Total RNA (15 pg) was denatured in sample buffer (4 pM MOPS, I pM Na acetate, 4 2 % formamide, 4 .4% formaldehyde) and run through a denaturing 1% MOPS formaldehyde agarose gel (0.04 mM MOPS, 0.01 mM Na acetate, 1mM EDTA, 5.3% formaldehyde, 1% agarose) for 1 hour at 80 V. The RNA was transferred to a nylon membrane (Biodyne B, Pall Gelman Laboratory) in 20x SSC (3 M sodium chloride, 0.3 M sodium citrate, pH 7.0) for 20 hours. The RNA was crosslinked to the membrane using a UV Stratalinker (Stratagene) according to manufacturer's instructions. Membranes were prehybridized in ExpressHyb (Clontech) containing 0.1 mg/ml denatured salmon testes DNA (Sigma) for 3 hours at 65°C. The Northern blot probes were generated by PCR amplification from LNCaP cDNA using the following primers: NFE2L2 forward 5 -CACCGCTCATCATGATGGACTTGG-3 and reverse 5 -CTAGTTTTTCTTAACATCTGGCTT-3; G C L M forward 5-TCAGTCCTTGGAGTTGCACA-3 and reverse 5-CCCTGATACCTAGGCCAAAA-3 ; NQ01 forward 5 -GCACTGATCGTACTGGCTCA-3 and reverse 5-66 CGGAAGGGTCCTTTGTCATA-3 ; PGD forward 5 -ATGCCCTGTTTTACCACTGC-3 and reverse 5-TTCAGCCGCATGATACAGAG-3 ; PRDX1 forward 5-TTGAACCCCAAGCTGATAGG-3 and reverse 5 -TCCCCATGTTTGTCAGTGAA-3; TXN forward 5 -GCCAAGATGGTGAAGCAGAT-3 and reverse 5-GCAGATGGCAACTGGGTTTA-3 . Radioactivity was incorporated into the probe using Ready-To-Go DNA labeling beads (Amersham Pharmacia Biotech) to a specific activity of 1-2x108 dpm/pg. Probes were hybridized to the membrane overnight at 65°C in hybridization buffer containing salmon testes DNA. The membranes were washed 4 times in Wash Buffer I (2 x SSC, 0 .5% SDS) for 30 minutes each and twice in Wash Buffer II (0.1 x SSC, 0 .1% SDS) for 30 minutes each, at 65°C. The membranes were sealed in plastic and exposed to a phosphorimager screen for 24-72 hours. The screens were scanned on a Typhoon Scanner (GE Healthcare) at a resolution of 100 pm. Real Time PCR - Real time PCR was used to quantify the mRNA levels of NFE2L2 in the siRNA experiments. Before generating the cDNA, 2 ug of the RNA was treated with DNAse l (1 U, Invitrogen) for 15 minutes at room temperature to remove any DNA contamination. The DNase 1 was inactivated by adding 10 mM EDTA and heating the sample to 65°C for 10 minutes before cooling on ice. The RNA was reverse transcribed into cDNA in a reaction containing 1X reaction buffer, 0.01 M DTT, 1 mM dNTPs, 40 U RNAsin (Promega), 250 ng random hexamers and 200 U of MMLV (Invitrogen). The reaction proceeded at 25°C for 10 minutes, then at 37°C for one hour. The enzyme was heat denatured at 95°C for 5 minutes. The levels of NFE2L2 transcript were then assayed using real time PCR on the ABI 7900 HT Sequence 67 Detection System. The primers and probes used to amplify NFE2L2 are as follows: forward 5 -ACTCCCAGGTTGCCCACAT-3 , reverse 5 -TGCGCCAAAAGCTGCAT-3 and probe 5-[6 FAM] TCAGATGCTTTGTACTTTGATGACTG[TAMRA-Q]-3. For normalization purposes, rRNA control primers and probes (ABI) were used. The cycle used for the real time PCR was as follows: Step 1 - 50°C for 2 min; Step 2 - 95°C for 10 min; Step 3 - 95°C for 15 sec, 60°C for 1 min. Step 3 were repeated 39 times. The reported values are the averages and the error bars are the standard error on the mean of three biological replicates. LNCaP xenografts - 2 x 10 6 cultured LNCaP cells were combined with Matrigel (Becton Dickinson Labware) at a 50:50 volume ratio of cells to matrigel and injected subcutaneously into four sites of 6-8 week old athymic nude mice (BALB/c strain; Charles River Laboratory). The mice were surgically castrated 8 weeks post injection under methoxycluorane anesthesia. To harvest the tumors, the mice were sacrificed using carbon dioxide asphyxiation, the tumors were removed and frozen immediately at -80°C. Tumors were harvested prior to castration or at 7, 14, 21, 28 or 35 days post-castration. 2.3 Results Many genes are regulated in prostate cells treated with androgens - To determine which genes are regulated in androgen treated cells, a set of microarrays were probed with cDNA generated from LNCaP cells treated with androgens for 24, 48 or 72 hours. The microarray results were analyzed using GeneSpring software. Figure 2.1 A shows a line graph of the expression levels of the over 13,000 genes represented on the arrays. Green indicates downregulation and red indicates upregulation in the 68 0.01 24 hrs 48 hrs 72 hrs 24 hrs 48 hrs 72 hrs Figure 2.1 Differential gene expression in prostate cells in response to androgen treatment. A, LNCaP cells were treated with 1 nM R1881 or ethanol vehicle alone for 24, 48 or 72 hours. From the treated cells, labeled cDNA was generated and used to probe microarrays containing 13,971 spotted oligonucleotides. A line graph showing the expression levels of all genes represented on the microarray for each of the three 69 time points. The data at each time point represents the average of two biological and two technical replicates. Green indicates upregulation, red downregulation and yellow represents no change in the androgen treated cells as compared to the ethanol treated cells. 8, Heat map of the most differentially regulated genes in the androgen treated cells. The data was filtered to remove genes that had low or absent expression levels. Shown are 88 genes upregulated two fold or more and 64 downregulated three fold or more in the presence of androgens. Genes known to be differentially regulated by androgens are highlighted (DBI, PSA and dopa decarboxylase) as well as three genes of interest (GADD45G, MRP4 and BARD1). R1881 treated cells versus the ethanol vehicle control. There were 88 genes found to be upregulated by androgens by at least 2 fold at all three time points and there were 64 genes downregulated by 3 fold or more. A complete list of these genes appears in Appendix 1. The regulated genes are shown in Figure 2.1 B, with several important genes highlighted. Genes known to be upregulated by androgens were found to be upregulated in our arrays including PSA, diazepam binding inhibitor (DBI), ornithine decarboxylase, and fatty acid synthase, (5, 12-14) as well as several prostate specific proteins such as the prostate epithelium specific Ets transcription factor and the prostate differentiation factor. Genes downregulated by androgens are less well characterized than upregulated ones, however dopa decarboxylase has been consistently downregulated by androgens in microarrays performed in our lab and others (15); and is seen to be downregulated here. Several novel genes were found to be regulated by androgens. To validate the expression patterns observed in the microarray experiment, Northern blotting was used to confirm the mRNA expression levels. Furthermore, the expression levels of these genes in Al prostate cancer progression were determined using the LNCaP xenograft tumor model. GADD45G and MRP4 are upregulated by androgens in LNCaP cells - Two of 70 the genes which were found to be upregulated by androgens in LNCaP cells, GADD45G and MRP4, were validated using northern blotting to confirm the expression patterns. Since there appears to be a recurrence of androgen regulated gene expression in A l prostate cancer, we were interested in determining whether or not the genes found to be upregulated in vitro were also upregulated in the LNCaP tumor progression model. LNCaP tumors are implanted subcutaneously in male nude mice. As the tumors grow, PSA is secreted into the vasculature and used to track the progression of tumor growth. Upon castration there is a decrease in androgen regulated gene expression as demonstrated by the marked decrease in serum PSA levels. The serum PSA levels begin to increase as the tumor progresses to A l , after approximately 21 days. Of the androgen upregulated genes we were interested in was GADD45G because it has been described as a protein which is involved in stress response and has also been implicated in protection against apoptosis (16) and therefore may be important for prostate cancer progression to A l . Figure 2.2A shows that GADD45G mRNA levels are increased in LNCaP cells treated with androgens for 16 hours or longer. Furthermore, GADD45G acts similarly to other androgen regulated genes we have studied in the LNCaP tumor progression model, as its levels are high in both the precastrate and the Al tumors (Figure 2.2B). MRP4 is a member of the ABC transporter family of proteins which are membrane transporters able to confer multidrug resistance to cells (17). Resistance to chemotherapeutics is common in androgen independent cells and therefore MRP4 was of interest. MRP-4 is strongly induced in LNCaP cells in response to androgen 71 A 1 nM R1881 + + + + total RNA GADD45G B total RNA GADD45G Figure 2.2 GADD45G is an androgen regulated gene in LNCaP cells. LNCaP cells were treated with 1 nM R1881 or ethanol vehicle alone for 16, 24, 48 or 72 hours and the resulting mRNA run on a Northern blot and probed for GADD45G (panel A). The Northern blot of the timecourse was repeated with three independent biological replicates, with similar results. LNCaP cells were injected subcutaneously into nude mice and allowed to form tumors. The mice were castrated and tumors harvested directly prior to castration and at various time points after castration. B, Northern blot of the LNCaP xenograft tumor series probed for GADD45G. The two samples shown for each time point arise from tumors on different mice. treatment from 16 hours onward (Figure 2.3A). Further evidence for MRP4 being androgen regulated, is that it has high levels in the LNCaP xenografts prior to castration, dropping substantially after castration, followed by an increase at Al (Figure BARD1 is downregulated by androgens in LNCaP cells - BARD1 (BRCA1-associated ring domain protein) is thought to be a pro-apoptotic protein which interacts with BRCA1 (18). Some pro-apoptotic genes have been shown to be downregulated 2.3B). 72 A M R P 4 total RNA Figure 2.3 MRP4 is upregulated in response to androgens in LNCaP cells. A, Northern blot of LNCaP cells treated with 1 nM R1881 or ethanol vehicle alone for 16, 24, 48 or 72 hours probed for MRP4. The Northern blot of the timecourse was repeated with three independent biological replicates, with similar results. LNCaP tumor progression series was generated from subcutaneous xenograft tumors harvested at various time points following castration as well as prior to castration. B, Northern blot of the LNCaP xenograft tumor series probed for MRP4. by androgens and it therefore is functionally plausible that BARD1 is also repressed by androgens. Figure 2.4 shows a northern blot of BARD1 levels in response to androgen treatment. The levels of BARD1 in the absence of androgens is quite high, however diminishing over time, while there is little or no BARD1 mRNA in the androgen treated cells. There was no detectable BARD1 mRNA in any of the LNCaP xenograft tumors at any of the time points. 7 3 Figure 2.4 BARD1 is repressed by androgens in LNCaP cells. LNCaP cells were treated with 1 nM R1881 or ethanol vehicle alone for 16, 24, 48 or 72 hours and the resulting mRNA run on a Northern blot and probed for BARD1. Northern blotting was performed on three biological replicates with similar results. Androgens upregulate a network of genes involved in protection against oxidative stress - Ingenuity software is a powerful tool which allows researchers to visualize array data in the context of biological pathways and interactions. The array data from the androgen treated cells was loaded into the Ingenuity software to determine networks of genes affected by androgens. One network that emerged involved the upregulation of the transcription factor NFE2L2 (nuclear factor erythroid 2-like 2). Many of the genes regulated by NFE2L2 are involved in the protection of the cell against oxidative stress (19). As NFE2L2 is upregulated by androgens, so are many of the genes it regulates (Figure 2.5). The array data was validated for several 74 Figure 2.5 Ingenuity network showing an NFE2L2 pathway. Microarray data was analyzed with Ingenuity software, which constructs networks of biologically linked genes. Shown is the NFE2L2 pathway of antioxidant genes with expression levels overlaid from the 24 hour time point. Green indicates downregulation, red indicates upregulation in the R1881 treated cells in relation to the ethanol control and white indicates no data available. 75 A R NFE2L2 + 1nMR1881 TXN PGD GCLM PRDX1 NQ01 Figure 2.6 Genes in the NFE2L2 antioxidant pathway upregulated by androgens. LNCaP cells were treated with androgens for 48 hours and the resulting RNA run on Northern blots which were probed for NFE2L2, TXN, PRDX1, PGD GCLM and NQ01 . The northern blots were performed on three sets of independent biological replicates and representative samples are shown. genes in the NFE2L2 network including, thioredoxin (TXN), peroxiredoxin (PRDX1), 6-phosphogluconate dehydrogenase (PGD), glutamate-cysteine ligase, modifier subunit (GCLM), using northern blotting. The effects of androgens on the expression of a gene which has been well characterized as being an NFE2L2 regulated gene, NQ01 , was also assayed even though there was no obvious upregulation observed in the microarrays. Figure 2.6 shows the northern blots for LNCaP cells treated with 76 androgens for 48 hours. NFE2L2, TXN, PRDX1, PGD and GCLM are all upregulated in the androgen treated cells. NQ01 however shows no apparent androgen regulation. This suggests that perhaps transcriptional activation of genes by NFE2L2 is different when upregulated by androgens than in other contexts. The effect of NFE2L2 downregulation on downstream genes differs in the absence and presence of androgens - Since NFE2L2 is a transcription factor reported to increase the levels of a host of downstream genes, we wanted to confirm that the upregulation observed in response to androgens was due to an increase in NFE2L2 levels. An siRNA targeted to NFE2L2 was used and effectively downregulated NFE2L2 to approximately 1 0 % of its endogenous levels (Figure 2.7A). Surprisingly, downregulation of NFE2L2 did not result in a downregulation of any of the genes picked up on the microarrays in the presence of androgens (Figure 2.7B). NQ01 levels, however, were decreased in the NFE2L2 siRNA treated cells. The siRNA experiment was performed in media supplemented with FBS, which will contain some testosterone. A second siRNA experiment was performed in the presence or absence of androgens. The siRNA caused NFE2L2 levels to be depressed to approximately 1 4 % of the endogenous levels, both in the presence and absence of androgens (Figure 2.8A). NQ01 mRNA levels are decreased in NFE2L2 siRNA, both in the presence and absence of androgens (Figure 2.8B). PRDX1 is unaffected by the decrease in NFE2L2 levels, and this suggests that in LNCaP cells, PRDX1 may not be NFE2L2 regulated at all and is only regulated by androgens. Surprisingly, TXN and PGD levels are decreased only in the cells which are androgen depleted and which 77 < z B j £ Jt? <V ft* • Neg siRNA NFE2L2 SiRNA N F E 2 L 2 TXN PGD PRDX1 NQ01 Total RNA Figure 2.7 Downregulation of NFE2L2 with siRNA and effects on downstream genes. LNCaP cells were treated with 50 nM siRNA targeted to NFE2L2, a negative control siRNA or lipofectamine 2000 only. The RNA was used in real time PCR as well as Northern blotting. A, Quantification of three biological replicates, showing the NFE2L2 mRNA levels in response to siRNA treatment. LO indicates the lipofectamine 2000 only negative control, Neg siRNA indicates the negative control siRNA, and NFE2L2 siRNA is the siRNA specific for NFE2L2. B, Northern blotting of the NFE2L2 siRNA treated cells, probed for NFE2L2, TXN, PGD, PRDX1 and NQ01, with the ethidium bromide stained rRNA to show loading. The northern blots were done in triplicate with similar results. have decreased NFE2L2 levels. This suggests that the regulation of TXN and PGD transcription is complex and can be influenced by androgens or NFE2L2 in different contexts. 78 LOE LOR Neg E Neg R NF E NFR B So <? # ^ € € 9 * £S /•> it f <S ^ >5 >r <v <vM l JM| A f t * L . . <HP W W W I' 1" 1 1 ' ' 1 N F E 2 L 2 TXN PGD PRDX1 NQOI Total RNA Figure 2.8 Downregulation of NFE2L2 with siRNA in the presence or absence of androgens and effects on downstream genes. LNCaP cells were treated with 50 nM siRNA targeted to NFE2L2, a negative control siRNA or lipofectamine 2000 in conjunction with 1 nM R1881 or ethanol vehicle control. The RNA was used in real time PCR as well as Northern blotting. A, Quantification of three biological replicates, showing the NFE2L2 mRNA levels in response to siRNA and androgen treatment using real time PCR. E - EtOH, R - R1881, LO - lipofectamine, Neg - negative control siRNA, NF - NFE2L2 siRNA. S, Northern blotting of the NFE2L2 siRNA and androgen treated cells, probed for NFE2L2, TXN, PGD, PRDX1 and NQ01 , with the ethidium bromide stained rRNA to show loading. The northern blots were performed on triplicate samples with results similar to what is shown. 2 .4 Discussion The AR is important to the development of the prostate, prostate cancer and importantly to the progression of the disease to A l . Since the AR is a transcriptional 7 9 activator for many genes which are important for cell survival and evasion of apoptosis, we sought to characterize novel androgen regulated genes using a microarray screen. Initially, the data was filtered to determine the genes which were upregulated or downregulated by androgens. The resulting lists were mined in search of genes which may be important in prostate cancer progression. Genes known to be androgen regulated were picked up on the array providing confidence to the results. One gene which was of interest for further characterization was GADD45G. Androgens are known to be cytoprotective for prostate cells and there is an upregulation of certain anti-apoptotic genes (6). GADD45G has been implicated in both cell cycle progression and protection against apoptosis (20). Therefore it is reasonable that GADD45G is upregulated by androgens as one of the proteins which helps protect against apoptosis. Furthermore, GADD54G mRNA levels are increased in Al prostate cancer progression. An important feature of Al progression is the evasion of apoptosis and therefore GADD45G may be involved in that. Another lab has independently demonstrated GADD45G upregulation in LNCaP cells (21). The importance of the GADD45G protein in prostate cancer is explored in Chapter 3. Surprisingly, I discovered that while the mRNA levels of GADD45G are increased with androgens, the protein levels are decreased. This new dimension to the androgen regulation of GADD45G is further examined in Chapter 4. Another gene found to be upregulated by androgens in this initial microarray study and by northern blots was MRP4, which is one of 9 members of the ATP-binding cassette (ABC) transporter efflux pumps. MRP4 is able to confer resistance to nucleotide analogs and antiviral agents (22, 23). Al prostate cancer exhibits poor 80 response to chemotherapeutic agents (24, 25). A mechanism through which cells become resistant to cytotoxic agents is to increase the levels of transporters which can pump the toxins out of the cell. One of the well characterized multidrug resistance genes is p-glycoprotein (p-gp) has been shown to be overexpressed in prostate tumors and its activity is increased during progression to Al (26, 27). MRP4 may be another efflux pump which contributes to drug resistance in Al prostate cancer. In a recent report another lab has also found MRP4 to be upregulated by androgens in LNCaP cells (28). Furthermore, they demonstrated that downregulation of MRP4 sensitizes prostate cells to methotrexate (28). One of the downregulated genes verified from the microarrays is BARD1. Studies have demonstrated that BARD1 is a tumor suppressor protein which can interact with BRCA1 (29). The interaction of BARD1 and BRCA1 is important for DNA damage repair (30). BARD1 also has a pro-apoptotic function which involves interaction with p53 resulting in its phosphorylation (31, 32). Here we demonstrate that BARD1 is repressed by androgens in LNCaP cells in vitro. Other pro-apoptotic proteins have been found to be androgen repressed (6), and BARD1 may be another such gene. There were no detectable levels of BARD1 in northern blots of the LNCaP tumor xenograft, and it is therefore difficult to speculate whether or not it has a role in prostate cancer progression. As a pro-apoptotic protein, it would be expected that there would be increased levels following androgen ablation and lower levels as the tumors progress to A l . The LNCaP tumor series does not regress however, so it may be reasonable that no BARD1 is expressed. There is an increased risk of prostate cancer in men carrying BRCA1 mutations (33, 34). It is therefore possible that 81 mutations or suppression of BARD1 will result in an increased risk of prostate cancer. Certain mutations of BARD1 have been shown to result in a slightly higher risk of breast or ovarian cancer (35, 36). Whether or not BARD1 mutations are involved in the development of prostate cancer remains to be thoroughly tested, however in the sole report looking at a specific BARD1 mutation found no increased risk of prostate cancer (37). Oxidative stress is thought to play a role in the development of prostate cancer. Evidence to this is that the loss of the detoxifying enzyme, GST, is a risk factor for the development of prostate cancer (38, 39). Also, antioxidants like lycopenes or vitamin E confer some degree of protection against prostate cancer (40, 41). One of the effects of oxidative stress is increased DNA damage which could lead to deleterious mutations. Androgens have been shown to cause an increase in oxidative stress in LNCaP cells (42). One of the networks that became apparent in the Ingenuity pathway analysis was NFE2L2 and its downstream genes. NFE2L2 is a transcription factor which binds to antioxidant response elements and increases the expression of various genes involved in protection against oxidative stress. NFE2L2 knockout mice are susceptible to oxidative stress (43). Here we show that NFE2L2 and several of its downstream genes are regulated by androgens in LNCaP cells. While androgens increase oxidative stress in prostate cells, the upregulation of NFE2L2 and its downstream genes may provide a route to temper these effects, as an accumulation of mutations could lead to decreased cell viability. Interestingly, the siRNA experiments revealed different regulation patterns for 82 the genes in the NFE2L2 network. NQ01 is solely an NFE2L2 regulated gene and PRDX1 is only regulated by androgens. PGD and TXN require either androgens or NFE2L2 for their expression. One of the GST genes, GST-P1 has been shown to have both antioxidant response elements and androgen response elements which allow for the control of the gene by both NFE2L2 and AR (44). Therefore there may be a whole group of anti-oxidant genes which are regulated by both AR and NFE2L2. Another possibility for the unexpected patterns of regulation is that the genes are being affected by off target effects of the NFE2L2 siRNA. There have been many reports of siRNAs affecting genes which share partial homology to the siRNA (45-47). Off target s iRNA effects can allow for mismatches within the sequence and can result in downregulation of the RNA or inhibition of translation, similar to what is seen with miRNAs (48, 49). Therefore it is possible that the genes downstream of NFE2L2 actually share some homology to the transfected siRNA and are subject to off target effects, or these genes are downstream of a gene affected by off target s iRNA effects. To control for off target effects, siRNAs that target different areas of NFE2L2 would need to be tested. If several siRNAs targeted against NFE2L2 have the same effect on the downstream genes, then it is likely that it is truly a specific result. The data presented here demonstrate that androgens regulate a wide variety of genes in LNCaP cells. Two genes discussed are involved in apoptosis - BARD1 is a pro-apoptotic gene which is downregulated by androgens and GADD45G is an anti-apoptotic gene which is upregulated by androgens. The data suggests that androgens may also upregulate the efflux pump MRP4, which may enhance cell survival by protection against toxic agents, however it may also contribute to resistance to 8 3 chemotherapeutic agents in Al prostate cancer. Finally, we demonstrated that many genes involved in protection of prostate cells against oxidative stress are upregulated by androgens. Taken together, the data provides further evidence that the AR affects gene expression which results in increased cell survival and these genes may also be important for progression to A l . 8 4 2.5 References 1. Marker, P .C, Donjacour, A.A., Dahiya, R., and Cunha, G.R. 2003. Hormonal, cellular, and molecular control of prostatic development. Dev Biol 253:165-174. 2. So, A.I., Hurtado-Coll, A., and Gleave, M.E. 2003. Androgens and prostate cancer. World J Urol 21:325-337. 3. Gleave, M., Miyake, H., and Chi, K. 2005. Beyond simple castration: targeting the molecular basis of treatment resistance in advanced prostate cancer. Cancer Chemother Pharmacol 56 Suppl 1:47-57. 4. Gelmann, E.P. 2002. Molecular biology of the androgen receptor. J Clin Oncol 20:3001-3015. 5. Kim, J . , and Coetzee, G.A. 2004. Prostate specific antigen gene regulation by androgen receptor. J Cell Biochem 93:233-241. 6. Coffey, R.N., Watson, R.W., O'Neill, A.J., Mc Eleny, K., and Fitzpatrick, J .M. 2002. Androgen-mediated resistance to apoptosis. Prostate 53:300-309. 7. Grossmann, M.E., Huang, H., and Tindall, D.J. 2001. Androgen receptor signaling in androgen-refractory prostate cancer. J Natl Cancer Inst 93:1687-1697. 8. Patino, W.D., Mian, O.Y., and Hwang, P.M. 2002. Serial analysis of gene expression: technical considerations and applications to cardiovascular biology Circ Res 91:565-569. 9. Pollock, J.D. 2002. Gene expression profiling: methodological challenges, results, and prospects for addiction research. Chem Phys Lipids 121:241-256. 10. Hoheisel, J.D. 2006. Microarray technology: beyond transcript profiling and genotype analysis. Nat Rev Genet 7:200-210. 11. Sobel, R.E., and Sadar, M.D. 2005. Cell lines used in prostate cancer research a compendium of old and new lines-part 1. J Urol 173:342-359. 12. Swinnen, J.V., Esquenet, M., Rosseels, J . , Claessens, F., Rombauts, W., Heyns, W., and Verhoeven, G. 1996. A human gene encoding diazepam-binding inhibitor/acy1-CoA-binding protein: transcription and hormonal regulation in the androgen-sensitive human prostatic adenocarcinoma cell line LNCaP. DNA Cell Biol 15:197-208. 13. Betts, A.M., Waite, I., Neal, D.E., and Robson, C N . 1997. Androgen regulation of ornithine decarboxylase in human prostatic cells identified using differential display. FEBS Lett 405:328-332. 14. Heemers, H., Maes, B., Foufelle, F., Heyns, W., Verhoeven, G., and Swinnen, J.V. 2001. Androgens stimulate lipogenic gene expression in prostate cancer cells by activation of the sterol regulatory element-binding protein cleavage activating protein/sterol regulatory element-binding protein pathway. Mol Endocrinol 15:1817-1828. 15. Nelson, P., Clegg, N., Arnold, H., Ferguson, C , Bonham, M., White, J . , Hood, 85 L, and Lin, B. 2002. The program of androgen-responsive genes in neoplastic prostate epithelium. Proc Natl Acad Sci U S A 99:11890-11895. 16. Zerbini, L.F., and Libermann, T.A. 2005. Life and death in cancer. GADD45 alpha and gamma are critical regulators of NF-kappaB mediated escape from programmed cell death. Cell Cycle 4:18-20. 17. Adachi, M., Reid, G., and Schuetz, J.D. 2002. Therapeutic and biological importance of getting nucleotides out of cells: a case for the ABC transporters, MRP4 and 5. Adv Drug Deliv Rev 54:1333-1342. 18. Fabbro, M., Schuechner, S., Au, W.W., and Henderson, B.R. 2004. BARD1 regulates BRCA1 apoptotic function by a mechanism involving nuclear retention. Exp Cell Res 298:661-673. 19. Lee, J .M., and Johnson, J.A. 2004. An important role of Nrf2-ARE pathway in the cellular defense mechanism. J Biochem Mol Biol 37:139-143. 20. Gupta, M., Gupta, S.K., Balliet, A.G., Hollander, M.C., Fornace, A.J., Hoffman, B., and Liebermann, D.A. 2005. Hematopoietic cells from Gadd45a- and Gadd45b-deficient mice are sensitized to genotoxic-stress-induced apoptosis. Oncogene 24:7170-7179. 21. Jiang, F., and Wang, Z. 2004. Gadd45gamma is androgen-responsive and growth-inhibitory in prostate cancer cells. Mol Cell Endocrinol 213:121-129. 22. Jedlitschky, G., Burchell, B., and Keppler, D. 2000. The multidrug resistance protein 5 functions as an ATP-dependent export pump for cyclic nucleotides. J Biol Chem 275:30069-30074. 23. Lee, K., Klein-Szanto, A.J., and Kruh, G.D. 2000. Analysis of the MRP4 drug resistance profile in transfected NIH3T3 cells. J Natl Cancer Inst 92:1934-1940. 24. Yagoda, A., and Petrylak, D. 1993. Cytotoxic chemotherapy for advanced hormone-resistant prostate cancer. Cancer 71:1098-1109. 25. Pienta, K.J., and Smith, D.C. 2005. Advances in prostate cancer chemotherapy: a new era begins. CA Cancer J Clin 55:300-318; quiz 323-305. 26. Bhangal, G., Halford, S., Wang, J . , Roylance, R., Shah, R., and Waxman, J . 2000. Expression of the multidrug resistance gene in human prostate cancer. Urol Oncol 5:118-121. 27. Gimenez-Bonafe, P., Fedoruk, M.N., Whitmore, T.G., Akbari, M., Ralph, J.L., Ettinger, S., Gleave, M.E., and Nelson, C C . 2004. YB-1 is upregulated during prostate cancer tumor progression and increases P-glycoprotein activity. Prostate 59:337-349. 28. Cai, C , Omwancha, J . , Hsieh, C.L., and Shemshedini, L. 2006. Androgen induces expression of the multidrug resistance protein gene MRP4 in prostate cancer cells. Prostate Cancer Prostatic Dis. 29. Irminger-Finger, I., and Jefford, C.E. 2006. Is there more to BARD1 than BRCA1 ? Nat Rev Cancer 6:382-391. 30. Greenberg, R.A., Sobhian, B., Pathania, S., Cantor, S.B., Nakatani, Y., and 86 Livingston, D.M. 2006. Multifactorial contributions to an acute DNA damage response by BRCA1/BARD1-containing complexes. Genes Dev 20:34-46. 31. Feki, A., Jefford, C.E., Berardi, P., Wu, J.Y., Cartier, L, Krause, K.H., and Irminger-Finger, I. 2005. BARD1 induces apoptosis by catalysing phosphorylation of p53 by DNA-damage response kinase. Oncogene 24:3726-3736. 32. Irminger-Finger, I., Leung, W.C., Li, J . , Dubois-Dauphin, M., Harb, J . , Feki, A., Jefford, C.E., Soriano, J.V., Jaconi, M., Montesano, R., et al. 2001. Identification of BARD1 as mediator between proapoptotic stress and p53-dependent apoptosis. Mol Cell 8:1255-1266. 33. Lorenzo Bermejo, J . , and Hemminki, K. 2004. Risk of cancer at sites other than the breast in Swedish families eligible for BRCA1 or BRCA2 mutation testing. Ann Oncol 15:1834-1841. 34. Horsburgh, S., Matthew, A., Bristow, R., and Trachtenberg, J . 2005. Male BRCA1 and BRCA2 mutation carriers: a pilot study investigating medical characteristics of patients participating in a prostate cancer prevention clinic. Prostate 65:124-129. 35. Stacey, S.N., Sulem, P., Johannsson, O.T., Helgason, A., Gudmundsson, J . , Kostic, J.P., Kristjansson, K., Jonsdottir, T., Sigurdsson, H., Hrafnkelsson, J . , et al. 2006. The BARD1 Cys557Ser variant and breast cancer risk in Iceland. PLoS Med 3:e217. 36. Wu, J.Y., Vlastos, A.T., Pelte, M.F., Caligo, M.A., Bianco, A., Krause, K.H., Laurent, G.J., and Irminger-Finger, I. 2006. Aberrant expression of BARD1 in breast and ovarian cancers with poor prognosis. IntJ Cancer 118:1215-1226. 37. Karppinen, S.M., Barkardottir, R.B., Backenhorn, K., Sydenham, T., Syrjakoski, K., Schleutker, J . , Ikonen, T., Pylkas, K., Rapakko, K., Erkko, H., et al. 2006. Nordic collaborative study of the BARD1 Cys557Ser allele in 3956 patients with cancer: enrichment in familial BRCA1/BRCA2 mutation-negative breast cancer but not in other malignancies. J Med Genet 43:856-862. 38. Agalliu, I., Langeberg, W.J., Lampe, J.W., Salinas, C.A., and Stanford, J.L. 2006. Glutathione S-transferase M1, T1, and P1 polymorphisms and prostate cancer risk in middle-aged men. Prostate 66:146-156. 39. Nelson, W.G., De Marzo, A.M., Deweese, T.L., Lin, X., Brooks, J.D., Putzi, M.J., Nelson, C.P., Groopman, J.D., and Kensler, T.W. 2001. Preneoplastic prostate lesions: an opportunity for prostate cancer prevention. Ann N Y Acad Sci 952:135-144. 40. Giovannucci, E. 1999. Tomatoes, tomato-based products, lycopene, and cancer: review of the epidemiologic literature. J Natl Cancer Inst 91:317-331. 41. Basu, A., and Imrhan, V. 2005. Vitamin E and prostate cancer: is vitamin E succinate a superior chemopreventive agent? Nutr Rev 63:247-251. 42. Ripple, M.O., Hagopian, K., Oberley, T.D., Schatten, H., and Weindruch, R. 1999. Androgen-induced oxidative stress in human LNCaP prostate cancer cells 87 is associated with multiple mitochondrial modifications. Antioxid Redox Signal 1:71-81. 43. Rangasamy, T., Cho, C.Y., Thimmulappa, R.K., Zhen, L, Srisuma, S.S., Kensler, T.W., Yamamoto, M., Petrache, I., Tuder, R.M., and Biswal, S. 2004. Genetic ablation of Nrf2 enhances susceptibility to cigarette smoke-induced emphysema in mice. J Clin Invest 114:1248-1259. 44. Ikeda, H., Serria, M.S., Kakizaki, I., Hatayama, I., Satoh, K., Tsuchida, S., Muramatsu, M., Nishi, S., and Sakai, M. 2002. Activation of mouse Pi-class glutathione S-transferase gene by Nrf2(NF-E2-related factor 2) and androgen. Biochem J 364:563-570. 45. Jackson, A.L., and Linsley, P.S. 2004. Noise amidst the silence: off-target effects of siRNAs? Trends Genet 20:521-524. 46. Jackson, A . L , Bartz, S.R., Schelter, J . , Kobayashi, S.V., Burchard, J . , Mao, M., Li, B., Cavet, G., and Linsley, P.S. 2003. Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechnol 21:635-637. 47. Scacheri, P.C., Rozenblatt-Rosen, O., Caplen, N.J., Wolfsberg, T.G., Umayam, L., Lee, J.C., Hughes, C.M., Shanmugam, K.S., Bhattacharjee, A., Meyerson, M., et al. 2004. Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells. Proc Natl Acad Sci USA 101:1892-1897. 48. Jackson, A.L., Burchard, J . , Schelter, J . , Chau, B.N., Cleary, M., Lim, L., and Linsley, P.S. 2006. Widespread siRNA "off-target" transcript silencing mediated by seed region sequence complementarity. Rna 12:1179-1187. 49. Lin, X., Ruan, X., Anderson, M.G., McDowell, J.A., Kroeger, P.E., Fesik, S.W., and Shen, Y. 2005. siRNA-mediated off-target gene silencing triggered by a 7 nt complementation. Nucleic Acids Res 33:4527-4535. 88 Chapter 3. GADD45G is a Key Mediator of Multiple Signaling Pathways in Prostate Cancer Cel ls 1 This work was completed with the help of several people. Amy Lubik performed the MTS assay and probed the HSP27 western blot. John Cavanagh labeled proteins from cell lysates and probed the antibody arrays. Dr. Amina Zoubeidi provided expertise in the cell signaling pathways and experimental design. Dr. Ladan Fazli stained and scored the tissue microarrays. 3.1 Introduction Prostate cancer is the most frequently diagnosed cancer and the third leading cause of cancer death in North American men. Initially, prostate cancer is dependent on androgens for growth and survival, and most patients respond favorably to androgen ablation therapy. However, patients progress to androgen independent (Al) disease which there is currently no effective therapy. Progression to A l is a complex process by which cells acquire the ability to both survive and proliferate in the absence of androgens. The mechanism through which prostate cancer survives in an androgen depleted milieu is not entirely understood, but it is thought to involve a combination of clonal selection, adaptive upregulation of anti-apoptotic genes, and alternative growth factor pathways (1-4). It is well documented that stress genes are upregulated in prostate cancer progression to Al (5, 6) pointing out the importance to investigate their potential therapeutic for the hormone refractory prostate cancer. Understanding the 1 A version of this chapter is in preparation to be submitted for publication. Cochrane, DR; Lubik, AA; Cavanagh, J ; Zoubeidi, A; Fazli, L; Pelech, S; Gleave, ME and Nelson, CC. (2006) GADD45G is a Key Mediator of Multiple Signaling Pathways in Prostate Cancer Cells. To be submitted to Oncogene 8 9 mechanism underlying the progression from AD to Al and the implication of stress proteins in this process will help us to identify potential therapeutic targets. The GADD45 family of proteins contains three members, GADD45A, GADD45B and GADD45G, all of which respond to stresses by upregulating cell survival signaling pathways. The expression of all three family member is induced by environmental stresses such as treatment with MMS (7), however they differ in their induction to DNA damaging agents such as UV, or H2O2 (8). Furthermore, the three members have different tissue distributions (8). The third member of the family, GADD45G was originally identified as having an early induction in response to interleukin-2 stimulation of T lymphocytes (9). Interestingly, GADD45G has been shown previously (10) and in our studies to be upregulated by androgens in prostate cancer cells. GADD45 proteins are potent upstream regulators of MEKK4 (MTK1/MAP3K4) activation through which they are able to initiate the key signaling pathways that allow the cell to respond to environmental stresses and DNA damage. MEKK4 responds to stresses such as UV and osmotic shock (11) and induces the activation of the p38 and JNK signaling pathways (8, 12, 13). MEKK4 contains an autoinhibitory domain within its N-terminus, and upon cell stress GADD45 proteins bind the autoinhibitory domain of MAP3K4 leading to the rapid activation of a host of downstream signaling pathways (8, 14). Activation of the p38 kinase pathway by GADD45 likely results in the upregulation of key cell survival proteins to protect cells against stress-induced apoptosis (15). When mice deficient in GADD45A or GADD45G are stimulated with genotoxic stress, there is a marked increase in apoptosis of the hematopoietic cells 9 0 (16), demonstrating that GADD45 is important in the control of apoptosis in these cells. The GADD45G protein has also been shown to effect the cell cycle by inducing a G2/M cell cycle arrest (17, 18). It has been suggested that a decrease in GADD45 levels in cancer cells leads to a decrease in p38 kinase and JNK activity which may provide a mechanism for tumor cells to evade apoptosis (19). GADD45G is an androgen regulated gene which is important for cell survival by controlling signaling pathways (refs). As prostate cancer progresses to A l , there is a systematic concurrent increase in androgen regulated genes as well as stress responsive genes. GADD45G could possibly be an important factor in the progression of prostate cancer to A l . In the current study, we present data showing that GADD45G levels are increased in Al tumor samples as compared to those treated with neo-adjuvant hormone therapy (NHT). We demonstrate the importance of GADD45G in controlling multiple intracellular signaling pathways including p38 kinase, HSP27, JNK, AKT and Rb, as well as its role to prostate cell survival. 3.2 Materials and Methods Neoadjuvant Hormone Therapy (NHT) treated Tissue Microarray (TMA) - Slides (H&E) from 112 radical prostatectomy specimens (from 1989 to 2003) obtained from the Vancouver General Hospital. The treatment groups consisted of: 21 untreated patients, 21 treated with less than three months NHT, 28 treated with 3-6 months NHT, 28 treated with more than 6 months NHT and 14 Al metastatic tumors. Benign and cancer sites were identified and marked in donor paraffin blocks using matching H&E reference slides. TMA was constructed using a manual tissue micro arrayer (Beecher Instruments). Each marked block for benign and cancer was sampled 3 times with a 91 core diameter of 0.6 mm arrayed in a rectangular pattern with 1 mm between the centers of each core, creating a triplicate a TMA layout and ordered by treatment of the patients. The number of patients in this TMA was 112 with a total of 336 cores. The TMA paraffin block was sectioned into 0.5 micrometer sections and mounted on positively charged slides. Immunohistochemistry - Staining was done using a Ventana autostainer with a concentration of 1:10 of GADD45G rabbit polyclonal antibody (Protein tech group. Inc). Scoring Method - The slide was scanned with the BLISS system (Bacus Lab) and scored (0 to 3) by pathologist (L.F) based on the intensity of staining with consideration of the percentages of cells. Cell Culture - LNCaP cells, passage 35-50, were maintained at 37°C and 5% C 0 2 in RPMI containing 5% fetal bovine serum (FBS) and penicillin/streptomycin. siRNA transfections - LNCaP cells were grown to 6 0 % confluency before being transfected with 50 nM negative control s iRNA or pre-designed GADD45G siRNA (Ambion, Austin, TX, USA). Lipofectamine 2000 (Invitrogen) was diluted in serum free RPMI and allowed to sit for 5 minutes before the siRNA was added and incubated for 20 minutes more. The transfection mixture was added to the LNCaP cells and they were incubated at 37°C for 4 hours at which point FBS was added to a concentration of 5%. Cells were harvested 48 hours post transfection and lysed in RIPA lysis buffer ( 1% NP40, 0 .5% NaDeoxycholate, 0 .1% SDS, 50 mM Tris, 150 mM NaCl, 5 mM EDTA). Western Blot Analysis - Cell lysate (30 u.g) was separated using SDS polyacrylamide gel electrophoresis and proteins were transferred electropheretically onto PVDF 92 membrane (Millipore). The blots were blocked with Li-cor blocking buffer (Li-cor Biosciences). Blots were probed with the primary antibodies: phosphor-RSK1/2/4 (Ser 363) 6-tubulin (Santa Cruz Biotechnology), GADD45G (Proteintech Group Inc), MEKK4 (Abnova), phospho-HSP27(Ser 78) and HSP27 (Nventa Biopharmaceuticals Corp.), phospho-p38 kinase (Thr 180/Tyr 182), p38 kinase, phospho-AKT (Ser 473), AKT, phospho-elF4E (Ser 209), elF4E, RSK, phospho-p53 (Ser 392), p53, phospho-JNK (Thr 183/Tyr 185), JNK, phospho-Rb (Ser 807/811) and Rb (Cell Signaling Technology Inc). Blots were probed with secondary antibodies and signal was detected on film using chemiluminescent ECL reagents (GE Healthcare) or fluorescently using the Li-cor Odyssey (Li-cor Biosciences). MTS Assay - LNCaP cells were grown in 96-well cell culture plates. Once the cells achieved 6 0 % confluency, the siRNAs were transfected. 24 hours post transfection, paclitaxol was added to the wells and the plate allowed to incubate for another 24 hours before addition of the MTS reagents. A 2 mg/ml MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4sulfophenyl)-2H-tetrazolium) (Promega Corporation) solution was combined in a 20:1 ratio with a 0.92 mg/ml PMS (phenazine methosulfate) (Sigma) solution. The mixture was added to the cell culture wells at a ratio of 1:5 and incubated at 37°C for 4 hours. The absorbance at 490 nm was read as a measure of metabolic activity and cell viability. Antibody Arrays - Sodium carbonate (pH 8.3) at a final concentration of 0.1 M. was added to 0.1 ml (200 pg) of the lysate. Alexa Fluor 546 or 647 was added to the cell lysate and incubated for 1 hour at room temperature. 80 mM Tris pH 8.0 was added to saturate the reaction. Unbound dye was removed using an Ultrafree-0.5 Centrifugal 93 f i l t e r D e v i c e ( M i l l i p o r e ) . L a b e l e d p r o t e i n w a s f i n a l l y m a d e u p t o 0 . 2 m l w i t h P B S . A n t i b o d y a r r a y s ( K i n e x u s ) w e r e w a s h e d a n d a n y r e m a i n i n g a c t i v e s i t e s w e r e i n a c t i v a t e d w i t h 5 0 m M T r i s f o r 1 h o u r . S l i d e s w e r e f i n a l l y r i n s e d w i t h H2O a n d s t o r e d a t 4 ° C . 5 0 p g o f c o n t r o l l y s a t e - A l e x a 6 4 7 a n d 5 0 p g o f t r e a t e d l y s a t e - A l e x a 5 4 6 w e r e m i x e d t o g e t h e r a n d a d d e d t o o n e s l i d e . A d u p l i c a t e s l i d e w i t h t h e d y e s r e v e r s e d w a s a l s o p r e p a r e d . B o t h s l i d e s w e r e i n c u b a t e d f o r 1 h o u r a n d t h e n w a s h e d w i t h P B S -T w e e n 2 0 ( 0 . 2 % ) f o r 5 m i n . S a m p l e l o a d i n g , i n c u b a t i o n a n d w a s h s t e p w e r e a l l d o n e u s i n g a n a u t o m a t e d P r o t e i n A r r a y W o r k s t a t i o n ( P e r k i n E l m e r ) . S l i d e s w e r e r e m o v e d , w a s h e d e x t e n s i v e l y i n d i s t i l l e d w a t e r a n d d r i e d w i t h a s t r e a m o f a i r . T h e l a b e l e d s l i d e s w e r e s c a n n e d w i t h S c a n A r r a y E x p r e s s ( P e r k i n E l m e r ) a n d t h e s p o t s q u a n t i f i e d u s i n g I m a g e n e s o f t w a r e ( B i o d i s c o v e r y I n c ) . D a t a a n a l y s i s w a s p e r f o r m e d u s i n g G e n e S p r i n g s o f t w a r e ( A g i l e n t ) . 3.3 Results GADD45G levels decrease with neo-adjuvant hormone therapy, but recur at androgen independence. A s p r o s t a t e c a n c e r d e v e l o p s , it d e p e n d s o n a n d r o g e n s a n d a n d r o g e n r e g u l a t e d g e n e e x p r e s s i o n f o r s u r v i v a l . A n d r o g e n a b l a t i o n i s i n i t i a l l y a n e f f e c t i v e t h e r a p y , h o w e v e r a s A l c a n c e r d e v e l o p s t h e t u m o r b e g i n s t o p r o l i f e r a t e a n d t h e r e i s a r e c u r r e n c e o f a n d r o g e n r e g u l a t e d , c e l l s u r v i v a l g e n e s . U s i n g m i c r o a r r a y b a s e d e x p r e s s i o n p r o f i l i n g o f a n d r o g e n r e s p o n s i v e g e n e s i n L N C a P c e l l s w e h a v e f o u n d t h a t a n u m b e r o f g e n e s a r e r e g u l a t e d b y a n d r o g e n s i n a t i m e a n d d o s e d e p e n d e n t m a n n e r . O n e g e n e o f i n t e r e s t t h a t w a s s t r o n g l y u p r e g u l a t e d b y a n d r o g e n s w a s G A D D 4 5 G , w h i c h h a d b e e n p r e v i o u s l y r e p o r t e d t o b e a n d r o g e n r e g u l a t e d i n a p r o s t a t e c a n c e r c e l l l i n e ( 1 0 ) . P a r a d o x i c a l l y , t h e r e i s a c t u a l l y a d e c r e a s e i n G A D D 4 5 G 94 protein with androgen treatment. This is due to the inhibition of translation through interaction with a miRNA, and this will be discussed in Chapter 4. A 0 NHT <3M NHT 3-6M NHT >6M NHT Al NHT Groups B C D E No NHT <3 mo NHT 3-6 mo NHT > 6 mo NHT F G H Bone Lymph Node Liver Figure 3.1 GADD45G levels are reduced with NHT treatment and increased at androgen independence, (a) Graph showing the immunohistochemical staining of the tissue tumor microarray for GADD45G. The TMA contained cores from 112 radical prostatectomy patients. The tumors were treated with varying durations of NHT from less than 3 months to more than 6 months. Staining levels of androgen independent samples are also shown. An * indicates that the value is statistically different from the non treated levels with a p-value less than 0.01 (p-value of 4.4x10"^ for the <3M NHT; 95 3.0x10"6 for the 1-6M NHT and 1.8x10"5 for >6M NHT). Representative cores are pictured for non-treated samples (b), less than 3 months NHT (c), 3 to 6 months NHT (d) and greater than 6 months NHT (e). Androgen independent samples from metastatic sites are also shown, bone (f), lymph node (g) and liver (h). Since GADD45G is androgen responsive in cell culture, we sought to determine if it retains its androgen regulation by hormonal treatment in prostate cancer patients. A tumor tissue microarray was generated from prostate cancer specimens from patients who had been treated with various durations of neo-adjuvant hormone therapy (NHT) prior to undergoing a radical prostatectomy. The array was stained for GADD45G protein levels. Figure 3.1 shows GADD45G staining in the granular cytoplasm of the prostatic epithelial cells. GADD45G is present in some of the cells of the benign secretory gland but almost all of the cells in the malignant glands. The levels of GADD45G are significantly decreased up to and including over 6 months of NHT. There is a high level of GADD45G staining in Al disease from metastatic sites including bone liver and lymph node. The level of GADD45G in the Al samples is comparable to the levels observed prior to NHT treatment. The expression pattern of GADD45G in these samples is consistent with previous reports and our observations that GADD45G is androgen regulated in prostate cells (10), as NHT causes a decrease in androgen regulated gene expression. As the cancer becomes hormone resistant, there is a recurrence of expression of genes that are regulated by androgens (20). HSP27 phosphorylation is dependent on GADD45G expression. The stress responsive p38 kinase signaling pathway is thought to be important for the 96 development of prostate cancer as well as the progression to Al (5, 21). GADD45G is known to interact physically with MEKK4 thereby relieving its autorepression (14), and the activated MEKK4 phosphorylates p38 kinase. One of the proteins phosphorylated 4 ? B GADD45G M E K K 4 p38 kinase phospho p38 kinase HSP27 phospho HSP27 P-tubulin GADD45G <• * MEKK4 p38 kinase HSP27 Figure 3.2 GADD45G is involved in the phosphorylation of HSP27. LNCaP cells were treated with siRNA directed at GADD45G levels, (a) Western blotting shows the protein levels of GADD45G, MEKK4, p38 kinase and HSP27. As well, the levels of phosphorylated p38 kinase and HSP27 are shown, (b) The pathway through which GADD45G effects the phosphorylation of HSP27. The Western blots were performed in triplicate with similar results each time. by p38 kinase is HSP27 (22), a protein that has proven critically important for cell survival of prostate cancer cell lines (2, 23). To determine the importance of GADD45G in regulating the phosphorylation of these important cell survival proteins, we 97 downregulated GADD45G in LNCaP cells using siRNA (Figure 3.2A). Downregulation of GADD45G by siRNA results in a dramatic decrease in phosphorylated HSP27 in LNCaP cells. There is also a decrease in phosphorylated p38 kinase in the siRNA treated cells versus the non treated cells, however, there is also a decrease observed with the negative control siRNA, and it is therefore possible that the effects observed are the result of non-specific siRNA effects. The decrease in GADD45G levels does not affect the overall levels of MEKK4, p38 kinase or HSP27, suggesting that GADD45G is likely regulating the activity of MEKK4 as previously described. These data provide a link between GADD45G and HSP27 phosphorylation (Figure 3.2B). Figure 3.3 Cell viability assay for LNCaPs with depleted GADD45G levels in response to taxol treatment. LNCaP cells were treated with siRNA targeting GADD45G in conjunction with 24 hour treatment with 0, 2 or 20 nM taxol, with 8 9 8 biological replicates per treatment. An MTS assay was performed to determine the cell viability in response to these treatments and A490 is linear with the number of respirating cells. An asterisk indicates a significant difference between the GADD45G siRNA treated samples and the no treatment (p-value of 0.051 for 0 nM taxol; p-value of 0.010 for 2 nM taxol; p-value of 0.039 for 20 nM taxol). The importance of GADD45G for cell viability of LNCaP cells. The implications of that GADD45G regulates critical stress activated cell survival pathways in prostate cancer cells, suggests that GADD45G knockdown may affect cell viability. The effect of GADD45G suppression was tested using the colorimetric MTS assay which provides a quantitative indicator of mitochondrial activity. The absorbance reading in the MTS assay is often used as an indicator of the amount of surviving cells. LNCaP cells were treated through transient transfection with siRNA to GADD45G in conjunction with increasing concentrations of taxol. The cells treated with GADD45G siRNA demonstrate decreased levels of survival (F igure 3.3) in the absence of taxol. As expected, taxol treatment results in decreased survival in a dose dependent manner. At all concentrations of taxol, there is decreased cell viability in the GADD45G treated cells in comparison to those treated with lipofectamine only or the negative control siRNA. Since there is not a 100% knockdown of GADD45G in response to the siRNA, these results are an underestimate of the effect seen in the pooled population of cells. It should be noted however that the interpretation of these results as showing that GADD45G being important for cell viability, however strictly speaking, the MTS assay measures mitochondrial activity. It is possible therefore, that the reduced levels of MTS metabolized in the assay are merely a sign of reduced respiration, as opposed to a decrease in cell survival. 99 GADD45G is critical for p38 kinase intracellular signaling. There are many downstream effectors of p38 kinase which are important for cell survival and prostate cancer progression. Since GADD45G is an important mediator of p38 kinase phosphorylation, we sought to determine if other downstream targets were affected by downregulation of GADD45G. p38 kinase can effect AKT phosphorylation through a variety of mechanisms (Figure 3.4A). The GADD45G siRNA indeed caused a decrease in AKT phosphorylation, however it is unclear whether this is a specific effect, because the negative control s iRNA also has an effect on the phosohporylation of AKT. AKT has been reported to be important for prostate cancer cell survival when challenged with a number of stressors and therefore may be a key mechanism through which GADD45G exerts its cytoprotective functions. p38 kinase is also involved in a phosphorylation cascade in which MKNK1 phosphorylates the translation initiation factor elF4E, and as such, with reduced levels of GADD45G, there is decreased phosphorylated elF4E (Figure 3.4B). The phosphorylation of elF4E can have effects on regulating protein translation and has been shown to be important for tumorigenesis (24). Another downstream effector of p38 kinase is RSK, which is a serine/theronine kinase important for cell survival (25). Studies have shown that RSK is a significant factor in the proliferation of prostate cancer cells (26). Reduction of GADD45G levels causes a decrease in the phosphorylation of RSK (Figure 3.4C). Each of these downstream effectors of p38 kinase has been shown individually to be important for cell survival, and we have demonstrated here that GADD45G is important for their phosphorylation. 1 0 0 A 4? AKT phospho AKT MAPKAPK2 p38 kinase JNK FN 1 SPP1 AKT B 4? elf4E phospho elf4E RSK phospho RSK p38 kinase • MKNK1 »-elF4E p38 kinase • ERK • RSK Figure 3.4 Proteins downstream of p38 kinase which are affected by GADD45G. (a) Western blots showing the levels of AKT and phosphorylated AKT and the possible pathways leading to AKT phosphorylation. Levels of total and phosphorylated elF4E (b) and RSK (c) as visualized by western blotting are shown. The western blots were done in triplicate, with similar results each time. 101 phospho-p38a MAPK p38 gamma phospho-Rb C N co QJ aj <x> a. a. a. S E E co ra ra CO CQ CO Figure 3.5 Antibody array analysis of proteins affected by reduced GADD45G levels. LNCaP cells were treated with negative control s iRNA or GADD45G siRNA. The cell lysate was labeled and used to probe antibody arrays. A heat map of all of the differentially regulated (at least 1.5 fold up or down in two of the three samples) proteins is shown. Red indicates an upregulation, green indicates downregulation and grey indicates data from spots that did not pass the quality control filters and was removed from the analysis. 102 GADD45G is important for JNK, Rb and p53 phosphorylation. The MTS assay revealed that GADD45G could be important to cell survival in prostate cancer cells, and targeted evaluation of the p38 pathway are clearly downstream effectors of GADD45G action. However, it is likely that GADD45G regulates other pathways that have not yet been described in relation to it. Therefore we assayed LNCaP cells treated with siRNA to GADD45G with antibody arrays containing over 600 antibodies directed towards various signaling proteins and phospho-proteins. The arrays probed with fluorescently labeled cell lysates isolated from GADD45G siRNA treated cells compared to cells treated with the negative control siRNA. The data was filtered for proteins or phosphorylated proteins which are up or downregulated in the GADD45G siRNA treated cells versus the negative control s iRNA treated cells by at least 1.5 fold in two of the three samples. As shown in Figure 3.5, multiple pathways are affected by the downregulation of GADD45G levels. Using Western blotting, the antibody array results were validated for three key proteins known for their role in cancer: p53, Rb and JNK. Both p53 and Rb demonstrated decreased levels of phosphorylation following GADD45G siRNA treatment (Figure 3 . 6 A and B), which reproduced the effects observed in the protein array. JNK demonstrated dramatically increased phosphorylation in response to suppression of GADD45G (Figure 3 .6C). 3.4 Discussion Both GADD45G and HSP27 have been shown to be stress induced and serve to protect cells against apoptosis. Chaperones like HSP27 are responsible for ensuring proper folding of proteins after stress-induced misfolding (27) and are important in 103 protection against apoptosis (28, 29). HSP27 has been demonstrated to be an important cytoprotective factor in prostate cancer cells and its expression is linked to JNK phospho JNK Figure 3.6 Validation of antibody arrays. Western blots of total and phosphorylated p53 (a), Rb (b) and JNK (c) in GADD45G siRNA treated cells. The western blots were done with three biological samples, with similar results each time. 104 progression to A l . HSP27 levels are increased in high Gleason grade prostate tumors and high HSP27 levels are linked to poor clinical outcome (30, 31). Importantly, HSP27 expression correlates with hormone refractory prostate cancer (32). Downregulation of HSP27 in prostate cancer cells causes an activation of the apoptotic program Furthermore, downregulation of HSP27 in both androgen dependent and androgen independent mouse xenograft tumors causes increased sensitivity to taxol (2, 23). The phosphorylation status of HSP27 is linked to its activation. In unstressed cells, HSP27 largely resides in the cytoplasm in large, oligomeric units. In response to a stress such as heat shock, HSP27 becomes phosphorylated and there is a dissociation of the oligomers into tetramers (33, 34). Thermoresistance can be conferred to cells by overexpression of HSP27, however this is dependent on it being phosphorylated (34). Therefore the cytoprotective effects of HSP27 are dependent on its phosphorylation status. Phosphorylation of HSP27 occurs via the p38 kinase pathway as determined by the use of specific kinase inhibitors (35). We have demonstrated for the first time that GADD45G is a potent upstream master regulator of HSP27 phosphorylation likely acting through regulation of p38 kinase. We have also demonstrated in our studies that GADD45G is an upstream regulator of the phosphorylation of other targets downstream of p38 kinase, such as AKT. AKT has been shown to be important in cell survival and the suppression of apoptosis in a variety of cancer model systems and is thought to be a critical element in therapeutic resistance (6, 36). Activity of AKT is pleiotropic and can suppress apoptosis directly through substrates involved in mitochondrial induced apoptosis such 105 as BAD (37) or caspases (38). AKT can act indirectly to provide apoptotic resistance by inhibition of FKHRL1, a forkhead transcription factor which normally induces expression of the Fas ligand gene (39, 40). Translation is regulated by a number of elongation initiation factors. One limiting factor of translational initiation is elF4E, which binds the 5 cap of the mRNA and as been described to be a critical factor in tumor progression and is being explored as a therapeutic target (24). elF4E can be phosphorylated by MKNK1, which has been shown to be dependent on AKT activity (41). As well, AKT/mTOR signaling can cause phosphorylation and inactivation of elF4E binding proteins, which normally act to inhibit elF4E activity (42). Therefore both AKT and elF4E are involved in the regulation of protein translation, and we show that the activity of both is dependent on GADD45G in prostate cancer cells. Members of the GADD45 family have been shown to both upregulate and downregulate JNK signaling in different model systems. GADD45G-/- mice are deficient in their ability to activate JNK signaling (43). Conversely, GADD45A and GADD45B deficient mice demonstrated an inhibition of JNK signaling (15). The ability of GADD45 to mediate JNK activity may be dependent on the cell type or on the type of stimulus being responded to. The activity of JNK itself has been shown to be both pro-apoptotic (44) and anti-apoptotic (45) dependent on the cell context. We show that in prostate cancer cells inhibition of GADD45G by siRNA results in a profound upregulation of JNK phosphorylation. Both p53 and Rb are important regulators of cell cycle and apoptosis and underpin many mechanisms in cancer biology. p53 is a multi functional transcription 106 factor that reacts to DNA damage to induce cell cycle arrest, DNA repair or apoptosis. Stress, such as DNA damage results in p53 phosphorylation, which increased the p53 protein stability by inhibiting MDM2 and subsequent ubiquitination (46). Active p53 can then cause cell cycle arrest and induction of apoptosis through both transcriptional and non-transcriptional activities (47). One of the genes reportedly being transcriptionally p53 responsive is GADD45 (48). Here we show in prostate cells that GADD45G's transcription is androgen regulated and that GADD45G acts upstream of p53. The phosphorylation of Rb is central to the progression of the cell cycle (49). GADD45G has been shown to be involved in cell cycle progression (18) and our data would suggest that one possible mechanism may be GADD45G regulating the phosphorylation status of p53 and Rb. In several of the blots shown herein, there is a decreased level of the phosphorylation proteins in response to the negative control siRNA as well as the GADD45G siRNA. It is therefore possible that there are some non-specific effects of transfected dsRNA which results in altered levels of the phospho-proteins. It is therefore very difficult to tease apart the specific versus the non-specific results. A protein array which compares the lipofectamine treated cells versus the negative control s iRNA could perhaps be used to determine the non-specific effects of the negative control siRNA, and these results compared to the GADD45G siRNA treated cells to determine the effects specific to GADD45G downregulation. Furthermore, since there was only one siRNA targeting GADD45G used in these experiments, it is possible that this GADD45G siRNA has off-target effects (50, 51) and the results observed are not due to specific downregulation of GADD45G. The 107 effects observed in the western blots are at the protein phosphorylation levels, and not at the level of total protein, therefore any off target effects would not likely be directly on the proteins themselves, rather on an upstream protein which controls their phosphorylation. In future studies, to control for off target effects, several other siRNAs directed against other areas of GADD45G should be tested to determine if the effects are due to downregulation of GADD45G itself. To further characterize the phosphorylation cascades and their importance in prostate cancer, future directions would include staining the NHT TMAs with the antibodies for the phospho-proteins described herein. Attempts have been made to stain the TMAs for phospho-HSP27, however this was met with limited success. The importance of GADD45G in cancer is highlighted by the multiple signaling pathways involved in cell survival which it regulates. All the proteins discussed herein as being regulated by GADD45G have been shown to be of great significance in many types of cancers, many of which have been explored as therapeutic targets. Therefore GADD45G itself which we show is highly differentially upregulated in human prostate cancer specimens and likely to be an important player in the progression of prostate cancer. GADD45G therefore may prove to be a suitable therapeutic target as it regulates a number of key downstream pathways important for cancer cell survival. 1 0 8 3.5 References 1. Feldman, B., and Feldman, D. 2001. The development of androgen-independent prostate cancer. Nature Reviews Cancer 1:34-45. 2. Rocchi, P., Beraldi, E., Ettinger, S., Fazli, L, Vessella, R.L, Nelson, C , and Gleave, M. 2005. Increased Hsp27 after androgen ablation facilitates androgen-independent progression in prostate cancer via signal transducers and activators of transcription 3-mediated suppression of apoptosis. Cancer Res 65:11083-11093. 3. Gleave, M., Tolcher, A., Miyake, H., Nelson, C , Brown, B., Beraldi, E., and Goldie, J . 1999. Progression to androgen independence is delayed by adjuvant treatment with antisense Bcl-2 oligodeoxynucleotides after castration in the LNCaP prostate tumor model. Clin Cancer Res 5:2891-2898. 4. Craft, N., Shostak, Y., Carey, M., and Sawyers, C L . 1999. A mechanism for hormone-independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med 5:280-285. 5. Uzgare, A.R., Kaplan, P.J., and Greenberg, N.M. 2003. Differential expression and/or activation of P38MAPK, erk1/2, and jnk during the initiation and progression of prostate cancer. Prostate 55:128-139. 6. Lu, S., Ren, C , Liu, Y., and Epner, D.E. 2006. PI3K-Akt signaling is involved in the regulation of p21(WAF/CIP) expression and androgen-independent growth in prostate cancer cells. Int J Oncol 28:245-251. 7. Fornace, A.J., Jr., Alamo, I., Jr., and Hollander, M .C 1988. DNA damage-inducible transcripts in mammalian cells. Proc Natl Acad Sci USA 85:8800-8804. 8. Takekawa, M., and Saito, H. 1998. A family of stress-inducible GADD45-like proteins mediate activation of the stress-responsive MTK1/MEKK4 MAPKKK. Cell 95:521-530. 9. Beadling, C , Johnson, K.W., and Smith, K.A. 1993. Isolation of interleukin 2-induced immediate-early genes. Proc Natl Acad Sci USA 90:2719-2723. 10. Jiang, F., and Wang, Z. 2004. Gadd45gamma is androgen-responsive and growth-inhibitory in prostate cancer cells. Mol Cell Endocrinol 213:121-129. 11. Takekawa, M., Posas, F., and Saito, H. 1997. A human homolog of the yeast Ssk2/Ssk22 MAP kinase kinase kinases, MTK1, mediates stress-induced activation of the p38 and JNK pathways. Embo J 16:4973-4982. 12. Gaido, K.W., Maness, S .C , McDonnell, D.P., Dehal, S.S., Kupfer, D., and Safe, S. 2000. Interaction of methoxychlor and related compounds with estrogen receptor alpha and beta, and androgen receptor: structure-activity studies. Mol Pharmacol 58:852-858. 13. Gerwins, P., Blank, J.L., and Johnson, G.L. 1997. Cloning of a novel mitogen-activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway. J Biol Chem 272:8288-8295. 14. Mita, H., Tsutsui, J . , Takekawa, M., Witten, E.A., and Saito, H. 2002. Regulation of MTK1/MEKK4 kinase activity by its N-terminal autoinhibitory domain and GADD45 binding. Mol Cell Biol 22:4544-4555. 109 15. Gupta, M., Gupta, S.K., Hoffman, B., and Liebermann, D A 2006. Gadd45a and Gadd45b protect hematopoietic cells from UV-induced apoptosis via distinct signaling pathways, including p38 activation and JNK inhibition. J Biol Chem 281:17552-17558. 16. Gupta, M., Gupta, S.K., Balliet, A.G., Hollander, M.C., Fornace, A.J., Hoffman, B., and Liebermann, D.A. 2005. Hematopoietic cells from Gadd45a- and Gadd45b-deficient mice are sensitized to genotoxic-stress-induced apoptosis. Oncogene 24:7170-7179. 17. Vairapandi, M., Balliet, A.G., Hoffman, B., and Liebermann, D.A. 2002. GADD45b and GADD45g are cdc2/cyclinB1 kinase inhibitors with a role in S and G2/M cell cycle checkpoints induced by genotoxic stress. J Cell Physiol 192:327-338. 18. Chung, H.K., Yi, Y.W., Jung, N.C., Kim, D., Suh, J.M., Kim, H., Park, K.C., Song, J.H., Kim, D.W., Hwang, E.S., et al. 2003. CR6-interacting factor 1 interacts with Gadd45 family proteins and modulates the cell cycle. J Biol Chem 278:28079-28088. 19. Zerbini, L.F., and Libermann, T.A. 2005. Life and death in cancer. GADD45 alpha and gamma are critical regulators of NF-kappaB mediated escape from programmed cell death. Cell Cycle 4:18-20. 20. Ettinger, S.L., Sobel, R., Whitmore, T.G., Akbari, M., Bradley, D.R., Gleave, M.E., and Nelson, C.C. 2004. Dysregulation of sterol response element-binding proteins and downstream effectors in prostate cancer during progression to androgen independence. Cancer Res 64:2212-2221. 21. Uzgare, A.R., and Isaacs, J.T. 2004. Enhanced redundancy in Akt and mitogen-activated protein kinase-induced survival of malignant versus normal prostate epithelial cells. Cancer Res 64:6190-6199. 22. Rane, M.J., Coxon, P.Y., Powell, D.W., Webster, R., Klein, J.B., Pierce, W., Ping, P., and McLeish, K.R. 2001. p38 Kinase-dependent MAPKAPK-2 activation functions as 3-phosphoinositide-dependent kinase-2 for Akt in human neutrophils. J Biol Chem 276:3517-3523. 23. Rocchi, P., So, A., Kojima, S., Signaevsky, M., Beraldi, E., Fazli, L., Hurtado-Coll, A., Yamanaka, K., and Gleave, M. 2004. Heat shock protein 27 increases after androgen ablation and plays a cytoprotective role in hormone-refractory prostate cancer. Cancer Res 64:6595-6602. 24. Averous, J . , and Proud, C.G. 2006. When translation meets transformation: the mTOR story. Oncogene 25:6423-6435. 25. Bonni, A., Brunet, A., West, A.E., Datta, S.R., Takasu, M.A., and Greenberg, M.E. 1999. Cell survival promoted by the Ras-MAPK signaling pathway by transcription-dependent and -independent mechanisms. Science 286:1358-1362. 26. Clark, D.E., Errington, T.M., Smith, J A , Frierson, H.F., Jr., Weber, M.J., and Lannigan, D.A. 2005. The serine/threonine protein kinase, p90 ribosomal S6 kinase, is an important regulator of prostate cancer cell proliferation. Cancer Res 65:3108-3116. 27. Jakob, U., Gaestel, M., Engel, K., and Buchner, J . 1993. Small heat shock proteins are molecular chaperones. J Biol Chem 268:1517-1520. 110 28. Concannon, C.G., Orrenius, S., and Samali, A. 2001. Hsp27 inhibits cytochrome c-mediated caspase activation by sequestering both pro-caspase-3 and cytochrome c. Gene Expr 9:195-201. 29. Pandey, P., Nakazawa, A., Ito, Y., Datta, R., Kharbanda, S., and Kufe, D. 2000. Requirement for caspase activation in monocytic differentiation of myeloid leukemia cells. Oncogene 19:3941-3947. 30. Cornford, P A , Dodson, A.R., Parsons, K.F., Desmond, A.D., Woolfenden, A., Fordham, M., Neoptolemos, J.P., Ke, Y., and Foster, C S . 2000. Heat shock protein expression independently predicts clinical outcome in prostate cancer. Cancer Res 60:7099-7105. 31. Miyake, H., Muramaki, M., Kurahashi, T., Yamanaka, K., Hara, I., and Fujisawa, M. 2006. Enhanced expression of heat shock protein 27 following neoadjuvant hormonal therapy is associated with poor clinical outcome in patients undergoing radical prostatectomy for prostate cancer. Anticancer Res 26:1583-1587. 32. Bubendorf, L, Kolmer, M., Kononen, J . , Koivisto, P., Mousses, S., Chen, Y., Mahlamaki, E., Schraml, P., Moch, H., Willi, N., eta l . 1999. Hormone therapy failure in human prostate cancer: analysis by complementary DNA and tissue microarrays. J Natl Cancer Inst 91:1758-1764. 33. Zantema, A., Verlaan-De Vries, M., Maasdam, D., Bol, S., and van der Eb, A. 1992. Heat shock protein 27 and alpha B-crystallin can form a complex, which dissociates by heat shock. J Biol Chem 267:12936-12941. 34. Lavoie, J .N., Lambert, H., Hickey, E., Weber, L A , and Landry, J . 1995. Modulation of cellular thermoresistance and actin filament stability accompanies phosphorylation-induced changes in the oligomeric structure of heat shock protein 27. Mol Cell Biol 15:505-516. 35. Dorion, S., and Landry, J . 2002. Activation of the mitogen-activated protein kinase pathways by heat shock. Cell Stress Chaperones 7:200-206. 36. Li, B., Sun, A., Youn, H., Hong, Y., Terranova, P.F., Thrasher, J.B., and Xu, P. 2006. Conditional Akt activation promotes androgen-independent progression of prostate cancer. Carcinogenesis. 37. Aziz, M.H., Nihal, M., Fu, V.X., Jarrard, D.F., and Ahmad, N. 2006. Resveratrol-caused apoptosis of human prostate carcinoma LNCaP cells is mediated via modulation of phosphatidylinositol 3'-kinase/Akt pathway and Bcl-2 family proteins. Mol Cancer Ther 5:1335-1341. 38. Sinha, S., Pal, B.C., Jagadeesh, S., Banerjee, P.P., Bandyopadhaya, A., and Bhattacharya, S. 2006. Mahanine inhibits growth and induces apoptosis in prostate cancer cells through the deactivation of Akt and activation of caspases. Prostate 66:1257-1265. 39. Brunet, A., Bonni, A., Zigmond, M.J., Lin, M.Z., Juo, P., Hu, L.S., Anderson, M.J., Arden, K.C., Blenis, J . , and Greenberg, M.E. 1999. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96:857-868. 40. Ciechomska, I., Pyrzynska, B., Kazmierczak, P., and Kaminska, B. 2003. Inhibition of Akt kinase signalling and activation of Forkhead are indispensable 111 for upregulation of FasL expression in apoptosis of glioma cells. Oncogene 22:7617-7627. 41. Chang, S.H., Yu, K.N., Lee, Y.S., An, G.H., Beck Jr, G.R., Colburn, N.H., Lee, K.H., and Cho, M.H. 2006. Elevated Inorganic Phosphate Stimulates AKT-ERK1/2-Mnk1 Signaling in Human Lung Cells. Am J Respir Cell Mol Biol. 42. Gingras, A.C., Raught, B., and Sonenberg, N. 2001. Regulation of translation initiation by FRAP/mTOR. Genes Dev 15:807-826. 43. Lu, B., Yu, H., Chow, C , Li, B., Zheng, W., Davis, R.J., and Flavell, R.A. 2001. GADD45gamma mediates the activation of the p38 and JNK MAP kinase pathways and cytokine production in effector TH1 cells. Immunity 14:583-590. 44. Wang, W.H., Gregori, G., Hullinger, R.L., and Andrisani, O.M. 2004. Sustained activation of p38 mitogen-activated protein kinase and c-Jun N-terminal kinase pathways by hepatitis B virus X protein mediates apoptosis via induction of Fas/FasL and tumor necrosis factor (TNF) receptor 1/TNF-alpha expression. Mol Cell Biol 24:10352-10365. 45. Yu, C., Minemoto, Y., Zhang, J . , Liu, J . , Tang, F., Bui, T.N., Xiang, J . , and Lin, A. 2004. JNK suppresses apoptosis via phosphorylation of the proapoptotic Bcl-2 family protein BAD. Mol Cell 13:329-340. 46. Helton, E.S., and Chen, X. 2006. p53 modulation of the DNA damage response. J Cell Biochem. 47. Balint, E.E., and Vousden, K.H. 2001. Activation and activities of the p53 tumour suppressor protein. BrJ Cancer 85:1813-1823. 48. Kannan, K., Amariglio, N., Rechavi, G., and Givol, D. 2000. Profile of gene expression regulated by induced p53: connection to the TGF-beta family. FEBS Lett 470:77-82. 49. Giacinti, C , and Giordano, A. 2006. RB and cell cycle progression. Oncogene 25:5220-5227. 50. Jackson, A.L., and Linsley, P.S. 2004. Noise amidst the silence: off-target effects of s iRNAs? Trends Genet 20:521-524. 51. Jackson, A.L., Burchard, J . , Schelter, J . , Chau, B.N., Cleary, M., Lim, L., and Linsley, P.S. 2006. Widespread siRNA "off-target" transcript silencing mediated by seed region sequence complementarity. Rna 12:1179-1187. 112 Chapter 4. The miRNA hsa-mir-326 Targets GADD45G mRNA and Inhibits its Translation 1 The microarray analyses were performed by Melanie Lehman, Dr. Mauricio Neira and Manuel Altamirano. The RNA labeling, array hybridizations and scanning were performed by Nadine Tomlinson. 41 Introduction GADD45G (growth arrest and DNA-damage inducible, gamma) is a member of a three gene family whose proteins share a high degree of homology and functionality. These genes have been shown to have both cytoplasmic and nuclear functions. In the cytoplasm, the GADD45G proteins interact with MEKK4, reversing its auto-repression (1, 2) and activating the p38 kinase signaling cascade (3, 4). This interaction is induced by environmental stresses, such as treatment with MMS, UV or gamma irradiation, and results in decreased apoptosis (5, 6). In the nucleus, GADD45 proteins can regulate cell cycle arrest in response to DNA damage and may contribute to DNA damage repair. The GADD45 proteins are downstream effectors of p53 and deletion of GADD45 genes leads to defects in DNA damage repair and genomic instability similar to the phenotype exhibited with a p53 deletion (7, 8), suggesting that the GADD45 proteins are important mediators of DNA damage repair. Furthermore, GADD45 proteins can stimulate DNA damage nucleotide excision repair (9, 10), while cells deficient in GADD45 have impaired DNA damage repair capabilities (11). GADD45 proteins are also involved in regulating G2/M arrest in response to various 1 A version of this chapter is in preparation to be submitted for publication. Cochrane, DR; Lehman, M; Neira, M; Altamirano, M; Tomlinson, N and Nelson, C C (2006) The miRNA hsa-mir-326 Targets GADD45G mRNA and Inhibits its Translation. To be submitted to J . Biol. Chem. 1 1 3 stresses (11-13). GADD45G interacts with both p21 and PCNA, interfering with PCNA induced growth suppression (14-16). This interaction with p21 and PCNA is important in the control of DNA damage repair (17). Androgens are important regulators of prostate cell growth and proliferation and contribute to the progression of prostate cancer. GADD45G is highly expressed in the prostate (18). Recent studies have shown that GADD45G mRNA is upregulated by androgens in LNCaP cells, an androgen-dependent prostate cancer cell line, in a time and dose dependent manner (19). Recombinant overexpression of a GADD45G construct encoding the protein coding region in prostate cells causes growth inhibition and results in morphological changes (19). Recently, microRNAs (miRNAs) have emerged as important mediators of gene expression. These miRNAs are short RNA molecules, approximately 22 nucleotides in length, derived from non-coding regions of the genome (20, 21). Following transcription, a hairpin in the RNA is excised by Drosha to form the 60-70 nucleotide pre-miRNAs (22, 23). The pre-miRNAs are exported from the nucleus via Exportin-5 (24-26) and further cleaved by Dicer (27-29) to yield the mature miRNA, which is then loaded into the RNA-induced silencing complex (RISC) (30). miRNAs can affect either mRNA stability or translation of the mRNA that they target (31, 32). Degradation of mRNA is accomplished if there is a perfect match of the miRNA to the target mRNA (33), in a manner akin to siRNA, however imperfectly matched miRNAs can also cause mRNA degradation (34). Some miRNAs prevent translation of the target mRNA and cause their storage in cytoplasmic processing 114 bodies (PBs) (35, 36) miRNAs have also been shown to mediate a change in the poly-A tail length (37) and a removal of the 5 cap (38). The data presented here shows that while androgen treatment causes an increase in GADD45G mRNA levels, the protein levels actually decrease. A screen for androgen-regulated miRNAs identified the miRNA, hsa-miR-326, which was further shown to target the GADD45G 3 UTR. An anti-miR directed against hsa-miR-326 prevented the androgen-mediated translational repression of GADD45G. We hypothesize that androgen stimulation causes GADD45G mRNA storage in PBs. In this study, androgen treatment caused storage of mRNA and subsequent taxol treatment caused translation of that stored mRNA and restored GADD45G protein levels. 4.2 Materials and Methods Cell Culture and Treatments - LNCaP cells, passage 35-50, were grown at 37°C and 5% C O 2 in RPMI containing 5% fetal bovine serum (FBS) and penicillin/streptomycin. R1881, dihydrotestosterone was purchased from Steraloids Inc. and was stored as a stock solution in absolute ethanol. Prior to R1881 treatment, cells were grown in media + 2 % Charcoal Stripped Serum (CSS, Hyclone) for 48 hours. For UV treatments, cells were grown to 8 0 % confluency and washed twice with PBS before 25 mJ of UV treatment using the Stratalinker (Stratagene). After UV treatment, RPMI + 5% FBS was added back to the cells and they were incubated at 37°C for 6 hours. Cells were harvested for protein, using RIPA lysis buffer (150 mM NaCl, 1% Igepal, 0 .5% Na Deoxycholate, 0 .1% SDS, 50 mM Tris). RNA used in the real time PCR and northern blots was harvested using Trizol (Invitrogen). Trizol was also used to harvest miRNA 115 for real time PCR analysis. RNA and miRNA used for probing the microarrays were harvested using the mirVana kit (Ambion). Anti-miR Transfections - LNCaP cells were grown to 5 0 % confluency in RPMI + 5% FBS before being incubated with RPMI + 2 % C S S for 24 hours. Lipofectamine 2000 (Invitrogen) was incubated with the control anti-miR or anti-miR-326 (Ambion) in serum free RPMI for 20 minutes. The anti-miRs were added to the cells to a final concentration of 30 nM. As a negative control, some cells were treated with lipofectamine 2000 only. The cells were incubated at 37°C for 4 hours before replacement of the C S S to 2% . After 24 hours, the cells were treated with 1 nM R1881 or the ethanol vehicle and incubated at 37°C for 48 hours prior to harvesting protein and RNA. Taxol treatments - LNCaP cells were treated with R1881 or ethanol vehicle, as described above, for 48 hours. Following this treatment, various concentrations of Paclitaxel (Taxol, Biolyse Pharma Corp.) were added and the cells were incubated for an additional 24 hours before harvesting for protein and RNA. Northern Blotting - Total RNA (10 u.g) was denatured in sample buffer and electrophoresed through a denaturing 1% MOPS formaldehyde agarose gel for 1 hour at 80V. The RNA was transferred to a nylon membrane (Biodyne B, Pall Gelman Laboratory) in 20X SSC (3M sodium chloride, 0.3M sodium citrate, pH 7.0) for 20 hours. The RNA was crosslinked to the membrane using a UV Stratalinker (Stratagene) according to manufacturer's instructions. Membranes were prehybridized in ExpressHyb (Clontech) containing denatured salmon testes DNA (Sigma) for 3 hours at 65°C. Radioactivity was incorporated into the probe using Ready-To-Go DNA 116 labeling beads (Amersham Pharmacia Biotech) to a specific activity of 1-2x10 dpm/pg. Probes were hybridized to the membrane overnight at 65°C. High stringency washes were performed on the membranes at 65°C. The membranes were exposed to a phosphorimager screen and scanned with a Typhoon scanner (GE Healthcare). Western Blotting - Protein sample (30 u.g) was boiled at 95°C for 5 minutes in sample buffer containing (3-mercaptoethanol. Samples were loaded on 1 0 % polyacrylamide gels and subjected to electrophoresed for 1.5 hours at 110 V. Proteins were transferred electropheretically onto PVDF membrane (Millipore). Membranes were incubated with blocking buffer (Li-cor) for one hour followed by an overnight incubation at 4°C with the GADD45G antibody (Proteintech Group) or the (3-tubulin antibody (Santa Cruz). The membranes were washed and incubated with Alexa-fluor 680 labeled secondary antibodies (Molecular Probes). Following a second set of washes, the bands were detected by scanning the membranes on the Odyssey scanner (Li-cor). Real Time PCR - To quantify the mRNA and miRNA levels, real time PCR analysis was performed. Prior to generating cDNA, the mRNA was treated with DNasel (Invitrogen) for 15 minutes at room temperature to remove any DNA contamination. The DNase reaction was stopped by adding 2.8 mM EDTA and incubating at 65°C for 10 minutes. The RNA was then reverse transcribed into cDNA in a reaction containing 1X reaction buffer, 0.01 M DTT, 1 mM dNTPs, 40 U RNAout (Invitrogen), random hexamers (250 ng) and 200 units of MMLV reverse transcriptase (Invitrogen). The reaction proceeded at 25°C for 10 minutes, then at 37°C for one hour. To detect GADD45G transcript levels, the forward primer 5 -GAGTCAGCCAAAGTCTTGAACGT-117 3, reverse primer 5 -CGCAGCCAGCACACAGAA-3 and probe 5-[6 FAM]CTGCTGCGAGAACG[MGB]-3 were used. To generate the cDNA used in the miRNA real time PCR, the TaqMan MicroRNA Reverse Transcription kit was used in conjunction with a hsa-miR-326 specific primer (ABI). The primer was designed such that only mature miRNA was detected. Specific primers and probes were used in the real time PCR reaction to detect hsa-miR-326 (ABI). For normalization purposes, a reaction using rRNA control primers and probes (ABI) was run in parallel. The real time PCR reactions were run on the ABI 7900 HT Sequence Detection System. The reported values are the means and standard errors of four biological replicates. Student's t-test was used to determine statistical significance. Generation of miRNA Cell Line pool - Small RNAs were isolated and pooled from LNCaP, HL-60, MDA, TF-1 and PC-3 cell lines. The quality of the RNA was assessed with the 2100 Bioanalyzer (Agilent) and equal amounts of RNA were pooled from each cell line to make the cell line pool. miRNA Labeling and Microarray Hybridization - miRNAs isolated from LNCaP cells were labeled using the NCode miRNA labeling system (Invitrogen). 500 ng miRNA were labeled following the standard procedure of 3 tagging of the miRNA with the dendrimer capture sequence. Arrays containing the NCode multi-species miRNA probe sets (Invitrogen) were pre-hybridized in 5x SSC, 0.2% SDS and 0.2% BSA for 45 minutes, followed by washing 3 times with dH20 and 1x with isopropanol. The slides were spun dry and hybridized wjth the 3 tagged miRNA at 52°C for 16-19 hours. Following the first hybridization, the slides were washed with a succession of 2x SSC, 0.2% SDS at 50°C, 2x SSC at RT and 0.2x SSC at room temperature for 15 minutes 118 each, spun dry and hybridized with Alexa 546 (cell line pool) and Alexa 647 (test condition) dendrimer-350 (Genisphere) for 4 hours. Slides were washed similarly as after the first hybridization, except that the first wash was performed at 62°C. mRNA Labeling and Microarray Hybridization - 10 pg of mRNA isolated from LNCaP cells were 3 end-labeled and converted to cDNA as described in the Genisphere Array 350 expression array detection kit protocol. The 3 end-labeled cDNA was co-hybridized with 3 end-labeled human reference RNA (Stratagene) to an array printed in-house with Operon Version 2 human 70-mer oligonucleotides. The expression arrays were pre-hybridized in 5x SSC, 0.2% SDS and 0.2% BSA for 45 minutes and were washed 3 times with dH 20, once with isopropanol, spun dry and hybridized with the 3 tagged mRNA. The slides were hybridized at 52°C for 16-19 hours. Following the first hybridization, the slides were washed with a succession of 2x SSC, 0.2% SDS at 50°C, 2x SSC at RT and 0.2x SSC at RT for 15 minutes each, spun dry and hybridized with cy3 (human universal reference) and cy5 (test condition) dendrimer-350 for 3.5 hours. Slides were washed similarly as after the first hybridization, except that the first wash was performed at 62°C. Scanning and Image Analysis - Each slide was scanned on the Genepix Autoloader 4200AL scanner (Axon) with laser power at 100%, PMT for Alexa 647 at 400 and Alexa 546 at 420 at a 10 pm resolution. The spot intensities were quantified with ImaGene 6.0 (Biodiscovery). Microarray Data Analysis - To analyze the mRNA arrays, GeneSpring (Silicon Genetics) was used for a local background correction and lowess normalization. For the miRNA arrays, the Limma Bioconductor package was used for variance stabilizing 119 normalization (VSN) and differential expression was determined using a moderated t statistic. 4.3 Results GADD45G mRNA levels are increased with androgens, while the protein levels are decreased - We have previously observed GADD45G upregulation by androgens in LNCaP cells in microarray experiments and similar observations have also been reported by another group (19). To confirm the microarray data, LNCaP cells were treated with 1 nM R1881 for 48 hours and the mRNA harvested and used for Northern blotting and real time PCR. Both the northern blot (Figure 4.1A) and the real time PCR (Figure 4.1 B) confirm that GADD45G mRNA is upregulated with androgen treatment. Quantitatively, the real time PCR shows a statistically significant 3.17 fold increase of GADD45G mRNA levels in the R1881 treated cells versus the vehicle control. A Western blot of cell lysate from androgen treated cells was done to determine if the protein levels of GADD45G increase concomitantly with the mRNA levels. Surprisingly, GADD45G protein decreased after 48 hours of androgen treatment (Figure 4.1 C). This disparity between RNA and protein levels was specific to androgen treatment, as UV induction of GADD45G mRNA results in a corresponding increase in GADD45G protein (Figure 4.1 D and E). Since there is a large disconnection between the observed low protein levels and the high mRNA levels following androgen treatment, it is likely that the GADD45G mRNA is not being translated. It is unclear whether the increase in GADD45G mRNA levels is due to an increase in transcription or if there is simply an accumulation of untranslated mRNA. Since miRNAs are known to inhibit 120 D GADD45G tubulin -UV +UV Figure 4.1 GADD45G mRNA levels increase with androgen treatment while GADD45G protein levels decrease. LNCaP cells were treated with 1 nM R1881 or ethanol vehicle alone for 48 hours before protein and RNA were harvested. A, Northern blot probed for GADD45G mRNA showing increasing levels with androgen treatment. Ethidium bromide stained gel shows rRNA as a loading control. The Northern blot was performed with three biological replicates, similar results achieved each time. 8, Quantification of the GADD45G mRNA transcript levels using real time PCR. Asterisk indicates the R1881 treated levels are statistically different from the ethanol control with a p-value of 0.0016 (Student's t-test) with four replicates. C, Western blot of androgen treated LNCaP cell lysate probed for GADD45G and B-tubulin as a loading control, performed on three biological replicates and a representative blot shown. LNCaP cells were treated with or without 25 mJ UV and allowed 6 hours recovery before RNA and protein were harvested. Real time PCR (panel D) and Western blotting (panel E) were used to determine RNA and protein levels of GADD45G. The asterisk denotes a statistical significant difference between the UV and non treated sample in the real time PCR (p-value of 0.038, Student's t-test) for four biological replicates. 121 translation of targeted transcripts we reasoned that GADD45G was being targeted by a miRNA in an androgen-dependent manner. The levels of the miRNA hsa-miR-326 are increased with androgen treatment -A microarray screen was performed to identify potential androgen-regulated miRNAs which could target GADD45G mRNA, thereby preventing translation of the GADD45G protein. Two sets of microarrays were probed. The first set was spotted with oligonucleotides specific for 21,521 mRNAs. The second contained shorter oligonucleotides specific for 883 miRNAs. Both miRNA and mRNA were extracted from LNCaP cells treated with or without androgens and these were fluorescently-labeled and used to probe the appropriate microarrays. We reasoned that it is possible that there is a miRNA which is upregulated by androgens and which targets GADD45G. The mRNA array data was filtered so that only genes which are sources of miRNAs that target GADD45G are shown (Figure 4.2A). One of the miRNA sources, arresting, was found to be consistently upregulated in the androgen treated samples compared the untreated samples. Arresting is the source for the miRNA hsa-miR-326, which we found upregulated in the miRNA arrays (Figure 4.2B). The miRNA, hsa-miR-326 is derived from the first intron of arresting. Real time PCR using primers and probes which amplify only the mature miRNA were used to confirm the array result and this analysis showed that hsa-miR-326 was significantly upregulated by 1.60 fold with androgen treatment (Figure 4.3A). The Sanger miRBase Targets (39) database identified two regions in the GADD45G 3 UTR predicted to bind hsa-miR-326. The two 122 A R1881 +R1 TNKS arrestiri/91 CLCN5 B • • • • • • hsa-miR-505 hsa-miR-124a hsa-miR-28 hsa-miR-151 hsa-miR-130b hsa-miR-326 hsa-miR-133a hsa-miR-29c hsa-miR-324-5p hsa-miR-520 hsa-miR-141 hsa-miR-93 hsa-miR-30d hsa-miR-145 hsa-miR-526b Figure 4.2 Microarray analysis of androgen treated cells reveals hsa-miR-326 and its source, arrestinBI are upregulated by androgens. A, LNCaP cells were treated with or without androgens and the resulting mRNA used to probe oligonucleotide arrays. The data was filtered for the sources of the miRNAs which target GADD45G. Of the sources in the microarray data, only arrestinBI (highlighted) is consistently upregulated with androgens. B, miRNAs were harvested from two biological replicates of androgen treated LNCaP cells and used to probe miRNA arrays. Pictured are the miRNAs which are increased or decreased with androgen treatment by 1.5 fold or more in both biological replicates. hsa-miR-326 (highlighted) is upregulated in both of the androgen treated samples. 123 A B « a eCUIXCCOOOUCUCc-5* 111:1111 MS 652 3 " *»CUXUUCCCGOGUCUCC-5-11111: MINI: 1 11 y—gc^ggcctcccGACX3ACK)fJOCCCGGTGOcMKagg—3' EtOH R1881 713 770 Intron ArrestinBI pre-mRNA splicing pri-miRNA (hsa-mir-326) Drosha pre-miRNA (hsa-mir-326) Dicer mature miRNA (hsa-miR-326\ 3- GADD45G 3 'UTR m R N A Translation Figure 4.3 The miRNA, hsa-miR-326, is upregulated with androgens and targets the GADD45G mRNA 3 untranslated region. A, LNCaP cells were treated with 1nM R1881 or vehicle for 48 hour. The levels of hsa-miR-326 were assayed using real time PCR for four biological replicates. The asterisk indicates a statistically significant difference between the R1881 and vehicle-treated cells with a p-value <0.05 (Student's t-test). 6, Two regions on the GADD45G mRNA 3'UTR are targeted by hsa-miR-326. 124 The top sequence shown is hsa-miR-326 and the bottom is the GADD45G mRNA. Complementary base pairing is shown by a solid line. G-U or G-T wobble base pairing is shown by a dashed line. C, Diagram showing the generation of hsa-miR-326 from the first intron of arrestinBI. predicted interaction sites are pictured in Figure 4.3B. Figure 4.3C shows a flow diagram describing the generation of hsa-miR-326 from the first intron of arrestinBI The first intron of the arrestinBI pre-mRNA, containing a hairpin loop, is spliced to generate the pri-miRNA. The pre-miRNA is produced from the pri-miRNA by digestion with drosha. Dicer further digests the pre-mir and the resulting mature, single stranded miRNA is loaded into the RISC complex. The mature hsa-miR-326, along with RISC, interacts with the 3 UTR of the GADD45G mRNA transcript and prevents its translation. It should be noted that there are hundreds of predicted targets of hsa-miR 326, however to date, none have been validated. Inhibition of hsa-miR-326 counteracts the androgen-induced inhibition of GADD45G translation - LNCaP cells were transfected with an inhibitor (anti-miR) of hsa-miR-326, a control anti-miR or lipofectamine only, followed by androgen treatment. Protein, RNA and miRNA were harvested from the cells and the levels of hsa-miR-326, GADD45G mRNA and GADD45G protein were assayed. The levels of hsa-miR-326 were decreased to approximately 3 0 % the levels of the lipofectamine-only controls (Figure 4.4A). GADD45G mRNA levels were not increased with the anti-miR treatment, and were in fact slightly decreased (Figure 4.4B). The GADD45G protein levels increased in the cells treated with anti-miR-326 and androgens (Figure 4.4C). Since there was no observable increase in mRNA levels, this increase in protein levels was likely due to increased translation in the anti-miR-326 and androgen treated cells. 125 There was no observable increase in protein levels in cells treated with the control anti-miR; therefore, increased translation in the anti-miR-326 and androgen treated cells is likely specific to hsa-miR-326. 1nM R1881 anti-miR B InM R1881 anti-miR 1nMR1881 - + - + - + anti-miR Lo Lo ctr ctr 326 326 GADD45G Tubulin Figure 4.4 Inhibition of hsa-miR-326 relieves the translational repression of GADD45G. LNCaP cells were treated with lipofectamine 2000 only (Lo), control anti-miR (ctr) or an anti-miR that targets hsa-miR-326 (326), followed by treatment with 1nM R1881 (+) or ethanol (-). hsa-miR-326 (panel A) and GADD45G mRNA (panel fi) levels were assayed using real time PCR with four biological replicates. Asterisks indicate significant differences; panel A, significant difference between Lo + EtOH and 126 anti-miR-326 + EtOH (* p-value 4.9 x 1CT) and between Lo + R1881 and anti-miR-326 + R1881 (** p-value 0.027). For panel B, significance was tested between the samples treated + and - R1881 (* p-value of 0.027; ** p-value of 0.019; and *** p-value of 0.013). C, Western blot showing GADD45G protein levels with androgen and anti-miR treatment and (3-tubulin as a loading control. Three biological replicates were performed with similar results. 1nM R1881 nM taxol 3 1nM R1881 nM taxol 1nM R1881 nM taxol GADD45G Tubulin + 5 10 + 10 Figure 4.5 Taxol treatment results in G A D D 4 5 G recovery from translational inhibition. LNCaP cells were treated with 1 nM R1881 or ethanol for 48 hours followed by 24 hours of taxol (1-10 nM) treatment before protein and RNA were harvested. Real time PCR of four biological replicates was used to quantify hsa-miR-326 (panel A) and GADD45G mRNA (panel B) levels. An asterisk indicates a significant difference 127 between the R1881 and EtOH samples. For panel A, significant difference at 10 nM (p-value of 0.010). For panel B, significant difference between the R1881 and EtOH samples at all taxol levels (at 0 nM taxol, p-value of 0.039; at 1 nM taxol, p-value of 0.025; at 5 nM taxol, p-value of 0.0066; and at 10 nM taxol, p-value of 9.6x10"5). GADD45G protein levels were assayed using Western blotting (panel C), with (3-tubulin levels are shown as loading control. The Western blot was done in triplicate, with a representative blot shown. Taxol treatment relieves the GADD45G translational inhibition caused by androgen treatment - When miRNAs interact with miRNAs both become targeted to cytoplasmic processing bodies (PBs) (40). PBs contain both mRNAs being degraded as well as those which are not being translated. PBs are granular structures containing the argonaute proteins, proteins responsible for removal of the 5 cap structure and exonucleases (41, 42). Once the appropriate trigger is sensed, the PBs can release those mRNAs that are not being translated so that the transcripts can interact with polysomes. GADD45G is inducible by cell cycle arrest and DNA damage. We reasoned that the GADD45G mRNA will commence translation when the cell senses a need for the protein and that taxol, which induces cell cycle arrest and apoptosis, may be a sufficient trigger to induce this translation. Cells were treated with or without androgens for 48 hours followed by treatment with various concentrations of taxol and assayed for hsa-miR-326 miRNA levels and GADD45G mRNA and protein levels. Figure 4.5A demonstrates that there is less hsa-miR-326 in the androgen treated and 5 or 10 nM taxol as compared to the ethanol controls. GADD45G transcript levels were unaffected by taxol treatment (Figure 4.5B); however, the protein levels increased in cells treated with androgens followed by 10 nM taxol (Figure 4.5C). Figure 4.6 shows a model of GADD45G androgen-induced translational inhibition and subsequent recovery following taxol treatment. In androgen depleted cells, GADD45G 128 Transcription ofSADD4S<3 mRNA Protein Translation <f^y GADD45G protein Transcnption of GADD4SG mRNA Binding of hsa-miR-326 to GADD45Q mRNA Storage of GADD450 mRNA in processing bodies _TT¥ TTTTV Taxol — „ Binding of hsa-mi R-328to GADD45G mRNA Storage of GADD45G mRNA in processing bodies Protein Translation o GAOD45G protein Figure 4.6 Model for androgen inhibition of GADD45G translation followed by taxol recovery. A, In androgen depleted cells, GADD45G mRNA is transcribed and GADD45G protein is translated. B, The addition of androgens to LNCaPs causes an increase in hsa-miR-326, which binds to GADD45G mRNA and causes it to be stored in cytoplasmic processing bodies. C, Once GADD45G mRNA is stored in processing bodies, the translational repression can be relieved through taxol treatment. 129 mRNA is transcribed and translated (Figure 4.6A). Androgen treatment induces an increase in GADD45G transcript levels, but a concurrent increase in hsa-miR-326 levels results in translational inhibition of the GADD45G protein (Figure 4.6B). GADD45G is important in protecting the cell against stress-induced apoptosis and androgens are cytoprotective in prostate cells. Treatment with androgens primes the cells by inducing transcription of GADD45G mRNA, but does not lead to increased translation of the GADD45G transcript, until the cells are exposed to an apoptotic stress. Cells treated with both taxol and androgens therefore show increased translation of the GADD45G protein. As shown in Figure 4.5B, taxol treatment itself does not cause an increase in GADD45G mRNA levels; however, when the cells are primed with androgens, GADD45G mRNA is held in stasis until a stress, such as taxol, allows the mRNA to be translated (Figure 4.6C). 4.4 Discussion Several cases have been described in which miRNAs inhibit the translation of specific mRNAs. Translational repression caused by miRNAs was first described in C.elegans, with the inhibition of Lin-14 protein translation by the small RNA lin-4 (43, 44). Since that finding, similar miRNA activity has been described in other species, including bantam in Drosophila melanogaster (45) and mir-15a and miR-16-1 in humans (46). The rules for target recognition have not been fully defined; however, complementarity of pairing in the 5 region of the miRNA with the target is the most important determinant for translation inhibition (47-49). There is a requirement for the target mRNA to have a 5 cap and a poly A tail (50). The mechanism by which miRNAs 130 accomplish this translational silencing has not been fully elucidated. Translational inhibition requires Argonaute 2, which is a component of the RISC complex (51). The silenced mRNAs are initially targeted to polysomes (52-54). It is unclear, however, if the translation is inhibited prior to or after translation initiation (55-58). Here we show that GADD45G is targeted by a miRNA, hsa-miR-326, which prevents its translation. Both mRNAs destined to be degraded and those whose translation is inhibited are targeted to cytoplasmic PBs. The argonaute proteins, as well as miRNAs and their target mRNAs, have been found to localize in PBs (54, 55, 59). PBs do not contain ribosomes and therefore translation is effectively blocked (60). The mRNA may not necessarily be destined to remain in the PBs indefinitely, though. PBs may simply be a storage place for mRNAs that the cell does not immediately need. There is evidence that mRNA can be released from the PBs, as seen with CAT-1 mRNA, upon stress stimuli (36). We propose that the translation of GADD45G is similarly stalled until the appropriate stress is detected by the cell, in this case taxol treatment. GADD45G is important in mediating cell survival and protection against apoptosis in stress situations (6). Androgens also have an anti-apoptotic effect in prostate cells (61-63). It therefore makes sense that androgens would cause an increase in GADD45G levels. However, overexpression of GADD45G causes growth arrest in prostate cells and this may counteract the proliferative effects of androgens (19). Ideally, cells treated with androgens would retain high levels of proliferation while being prepared to prevent apoptosis in a stress situation. When LNCaP cells are cultured in the absence of androgens, basal transcription of GADD45G mRNA leads to translation of the protein. For androgen-131 dependent LNCaP cells, culturing in androgen depleted media constitutes a stressful situation and the GADD45G protein would provide cytoprotection. When LNCaP cells are stimulated with androgens, GADD45G mRNA accumulates. However, in this case, the cells have an increased rate of proliferation and high levels of GADD45G protein would counteract this growth by inducing cell cycle arrest. Consequently, androgens also stimulate increased production of the miRNA, hsa-miR-326, from the arrestin(31 intron. This miRNA binds to the 3 UTR of GADD45G leading to its storage in the PBs. We therefore observe a decrease in GADD45G protein levels following androgen treatment, presumably due to turnover of the protein that was already produced and loss of further translation due to sequestration of transcripts in the PBs. If, however, the cells are exposed to a stressor following androgen stimulation, an increase in the GADD45G protein would be expected. In this case, the cells were treated with androgens, which caused storage of GADD45G mRNA in the PBs, followed by taxol, which led to increased GADD45G protein. Taxol causes apoptosis in LNCaP cells (64, 65), while androgens are cytoprotective. We therefore propose that androgen stimulation 'primes' the cells for future apoptotic stimuli by facilitating storage of mRNA encoding anti-apoptotic genes, such as GADD45G, in PBs. It is likely that the GADD45G mRNA is not the only anti-apoptotic gene whose storage is induced following androgen exposure; however, further studies will be needed to determine which other mRNAs share the same fate. Future studies could be done to further characterize the action of hsa-miR-326 on GADD45G mRNA. To determine if the putative binding sites on the GADD45G 3 UTR are functional, a luciferase vector can be used in which the putative hsa-miR-326 132 binding sites are cloned into the 3 UTR of the luciferase gene. Treatment with androgens should cause an increase in hsa-miR-326 levels and a decrease in luciferase protein, or treatment with an anti-miR will have the opposite effect. To determine if the GADD45G mRNA is being stored in PBs, in situ hybridization can be done for the GADD45G mRNA and verify that it co-localizes with components of PBs, such as the argonaute proteins. Furthermore, since hsa-miR-326 potentially targets hundreds of other mRNAs, further testing can be performed to determine if the translation or mRNA stability of any of these is impacted by androgen treatment. Although we have shown evidence that hsa-miR-326 inhibits the translation of GADD45G, there are other possible explanations for the disconnection between the mRNA and protein levels of GADD45G in response to androgens. One such possibility is that in response to androgens, there is increased protein turnover of GADD45G. Or that the GADD45G protein become modified (cleaved or post translational modifications) which cause the protein to not be recognized by the antibody used. While other possibilities exist, the evidence provided here points to regulation of GADD45G translation by miRNAs. 133 4.5 References 1. Takekawa, M., and Saito, H. 1998. A family of stress-inducible GADD45-like proteins mediate activation of the stress-responsive MTK1/MEKK4 MAPKKK. Cell 95:521-530. 2. Mita, H., Tsutsui, J . , Takekawa, M., Witten, E.A., and Saito, H. 2002. Regulation of MTK1/MEKK4 kinase activity by its N-terminal autoinhibitory domain and GADD45 binding. Mol Cell Biol 22:4544-4555. 3. Chi, H., Lu, B., Takekawa, M., Davis, R.J., and Flavell, R.A. 2004. GADD45beta/GADD45gamma and MEKK4 comprise a genetic pathway mediating STAT4-independent IFNgamma production in T cells. Embo J 23:1576-1586. 4. Aissouni, Y., Zapart, G., lovanna, J.L., Dikic, I., and Soubeyran, P. 2005. CIN85 regulates the ability of MEKK4 to activate the p38 MAP kinase pathway. Biochem Biophys Res Commun 338:808-814. 5. Gupta, M., Gupta, S.K., Balliet, A.G., Hollander, M.C., Fornace, A.J., Hoffman, B., and Liebermann, D.A. 2005. Hematopoietic cells from Gadd45a- and Gadd45b-deficient mice are sensitized to genotoxic-stress-induced apoptosis. Oncogene 24:7170-7179. 6. Gupta, M., Gupta, S.K., Hoffman, B., and Liebermann, D.A. 2006. Gadd45a and Gadd45b protect hematopoietic cells from UV-induced apoptosis via distinct signaling pathways, including p38 activation and JNK inhibition. J Biol Chem 281:17552-17558. 7. Smith, M.L., Ford, J .M., Hollander, M.C., Bortnick, R.A., Amundson, S.A., Seo, Y.R., Deng, C.X., Hanawalt, P.C., and Fornace, A.J., Jr. 2000. p53-mediated DNA repair responses to UV radiation: studies of mouse cells lacking p53, p21, and/or gadd45 genes. Mol Cell Biol 20:3705-3714. 8. Hollander, M.C., Sheikh, M.S., Bulavin, D.V., Lundgren, K., Augeri-Henmueller, L, Shehee, R., Molinaro, T.A., Kim, K.E., Tolosa, E., Ashwell, J.D., et al. 1999. Genomic instability in Gadd45a-deficient mice. Nat Genet 23:176-184. 9. Smith, M.L., Chen, IT., Zhan, Q., Bae, I., Chen, C.Y., Gilmer, T.M., Kastan, M.B., O'Connor, P.M., and Fornace, A.J., Jr. 1994. Interaction of the p53-regulated protein Gadd45 with proliferating cell nuclear antigen. Science 266:1376-1380. 10. Maeda, T., Espino, R.A., Chomey, E.G., Luong, L., Bano, A., Meakins, D., and Tron, V.A. 2005. Loss of p21WAF1/Cip1 in Gadd45-deficient keratinocytes restores DNA repair capacity. Carcinogenesis 26:1804-1810. 11. Maeda, T., Hanna, A.N., Sim, A.B., Chua, P.P., Chong, M.T., and Tron, V.A. 2002. GADD45 regulates G2/M arrest, DNA repair, and cell death in keratinocytes following ultraviolet exposure. J Invest Dermatol 119:22-26. 12. Mak, S.K., and Kultz, D. 2004. Gadd45 proteins induce G2/M arrest and modulate apoptosis in kidney cells exposed to hyperosmotic stress. J Biol Chem 279:39075-39084. 134 13. Jiang, F., Li, P., Fornace, A.J., Jr., Nicosia, S.V., and Bai, W. 2003. G2/M arrest by 1,25-dihydroxyvitamin D3 in ovarian cancer cells mediated through the induction of GADD45 via an exonic enhancer. J Biol Chem 278:48030-48040. 14. Vairapandi, M., Azam, N., Balliet, A.G., Hoffman, B., and Liebermann, D.A. 2000. Characterization of MyD118, Gadd45, and proliferating cell nuclear antigen (PCNA) interacting domains. PCNA impedes MyD118 AND Gadd45-mediated negative growth control. J Biol Chem 275:16810-16819. 15. Azam, N., Vairapandi, M., Zhang, W., Hoffman, B., and Liebermann, D.A. 2001. Interaction of CR6 (GADD45gamma ) with proliferating cell nuclear antigen impedes negative growth control. J Biol Chem 276:2766-2774. 16. Vairapandi, M., Balliet, A.G., Fornace, A.J., Jr., Hoffman, B., and Liebermann, D.A. 1996. The differentiation primary response gene MyD118, related to GADD45, encodes for a nuclear protein which interacts with PCNA and p21WAF 1/CIP1. Oncogene 12:2579-2594. 17. Gramantieri, L., Chieco, P., Giovannini, C , Lacchini, M., Trere, D., Grazi, G.L., Venturi, A., and Bolondi, L. 2005. GADD45-alpha expression in cirrhosis and hepatocellular carcinoma: relationship with DNA repair and proliferation. Hum Pathol 36:1154-1162. 18. Suzuki, M., Watanabe, T.K., Fujiwara, T., Nakamura, Y., Takahashi, E., and Tanigami, A. 1999. Molecular cloning, expression, and mapping of a novel human cDNA, GRP17, highly homologous to human gadd45 and murine MyD118. J Hum Genet 44:300-303. 19. Jiang, F., and Wang, Z. 2004. Gadd45gamma is androgen-responsive and growth-inhibitory in prostate cancer cells. Mol Cell Endocrinol 213:121-129. 20. Ouellet, D.L., Perron, M.P., Gobeil, L.A., Plante, P., and Provost, P. 2006. MicroRNAs in Gene Regulation: When the Smallest Governs It All. J Biomed Biotechnol 2006:69616. 21. Lai, E.C. 2002. Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptional regulation. Nat Genet 30:363-364. 22. Lee, Y., Ahn, C , Han, J . , Choi, H., Kim, J . , Yim, J . , Lee, J . , Provost, P., Radmark, O., Kim, S., et al. 2003. The nuclear RNase III Drosha initiates microRNA processing. Nature 425:415-419. 23. Zeng, Y. 2006. Principles of micro-RNA production and maturation. Oncogene 25:6156-6162. 24. Lund, E., Guttinger, S., Calado, A., Dahlberg, J.E., and Kutay, U. 2004. Nuclear export of microRNA precursors. Science 303:95-98. 25. Yi, R., Qin, Y., Macara, I.G., and Cullen, B.R. 2003. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev 17:3011-3016. 26. Bohnsack, M.T., Czaplinski, K., and Gorlich, D. 2004. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. Rna 10:185-191. 27. Ketting, R.F., Fischer, S.E., Bernstein, E., Sijen, T., Hannon, G.J., and Plasterk, R.H. 2001. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev 15:2654-2659. 135 28. Hutvagner, G., McLachlan, J . , Pasquinelli, A.E., Balint, E., Tuschl, T., and Zamore, P.D. 2001. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293:834-838. 29. Provost, P., Dishart, D., Doucet, J . , Frendewey, D., Samuelsson, B., and Radmark, O. 2002. Ribonuclease activity and RNA binding of recombinant human Dicer. Embo J 21:5864-5874. 30. Gregory, R.I., Chendrimada, T.P., Cooch, N., and Shiekhattar, R. 2005. Human RISC couples microRNA biogenesis and posttranscriptional gene silencing. Cell 123:631-640. 31. Hutvagner, G., and Zamore, P.D. 2002. A microRNA in a multiple-turnover RNAi enzyme complex. Science 297:2056-2060. 32. Zeng, Y., Yi, R., and Cullen, B.R. 2003. MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci USA 100:9779-9784. 33. Doench, J.G., Petersen, C P . , and Sharp, P.A. 2003. siRNAs can function as miRNAs. Genes Dev 17:438-442. 34. Martinez, J . , and Tuschl, T. 2004. RISC is a 5' phosphomonoester-producing RNA endonuclease. Genes Dev 18:975-980. 35. Liu, J . , Valencia-Sanchez, M.A., Hannon, G.J., and Parker, R. 2005. MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol 7:719-723. 36. Bhattacharyya, S.N., Habermacher, R., Martine, U., Closs, E.I., and Filipowicz, W. 2006. Relief of microRNA-mediated translational repression in human cells subjected to stress. Cell 125:1111-1124. 37. Wu, L., Fan, J . , and Belasco, J .G. 2006. MicroRNAs direct rapid deadenylation of mRNA. Proc Natl Acad Sci USA 103:4034-4039. 38. Rehwinkel, J . , Behm-Ansmant, I., Gatfield, D., and Izaurralde, E. 2005. A crucial role for GW182 and the DCP1:DCP2 decapping complex in miRNA-mediated gene silencing. Rna 11:1640-1647. 39. Griffiths-Jones, S., Grocock, R.J., van Dongen, S., Bateman, A., and Enright, A.J. 2006. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res 34:D140-144. 40. Anderson, P., and Kedersha, N. 2006. RNA granules. J Cell Biol 172:803-808. 41. Leung, A.K., Calabrese, J .M., and Sharp, P.A. 2006. Quantitative analysis of Argonaute protein reveals microRNA-dependent localization to stress granules. Proc Natl Acad Sci USAJ\ 03:18125-18130. 42. Pillai, R.S. 2005. MicroRNA function: multiple mechanisms for a tiny RNA? Rna 11:1753-1761. 43. Lee, R.C, Feinbaum, R.L., and Ambros, V. 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75:843-854. 44. Wightman, B., Ha, I., and Ruvkun, G. 1993. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75:855-862. 45. Brennecke, J . , Hipfner, D.R., Stark, A., Russell, R.B., and Cohen, S.M. 2003. bantam encodes a developmental^ regulated microRNA that controls cell 136 proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 113:25-36. 46. Cimmino, A., Calin, G.A., Fabbri, M., lorio, M.V., Ferracin, M., Shimizu, M., Wojcik, S.E., Aqeilan, R.I., Zupo, S., Dono, M., et al. 2005. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci USA 102:13944-13949. 47. Doench, J.G., and Sharp, P.A. 2004. Specificity of microRNA target selection in translational repression. Genes Dev 18:504-511. 48. Stark, A., Brennecke, J . , Russell, R.B., and Cohen, S.M. 2003. Identification of Drosophila MicroRNA targets. PLoS Biol 1 :E60. 49. Lewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., and Burge, C.B. 2003. Prediction of mammalian microRNA targets. Cell 115:787-798. 50. Wang, B., Love, T.M., Call, M.E., Doench, J.G., and Novina, C D . 2006. Recapitulation of short RNA-directed translational gene silencing in vitro. Mol Cell 22:553-560. 51. Pillai, R.S., Artus, C G . , and Filipowicz, W. 2004. Tethering of human Ago proteins to mRNA mimics the miRNA-mediated repression of protein synthesis. Rna 10:1518-1525. 52. Krichevsky, A.M., King, K.S., Donahue, C P . , Khrapko, K., and Kosik, K.S. 2003. A microRNA array reveals extensive regulation of microRNAs during brain development. Rna 9:1274-1281. 53. Kim, J . , Krichevsky, A., Grad, Y., Hayes, G.D., Kosik, K.S., Church, G.M., and Ruvkun, G. 2004. Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. Proc Natl Acad Sci USA 101:360-365. 54. Nelson, P.T., Hatzigeorgiou, A.G., and Mourelatos, Z. 2004. miRNP:mRNA association in polyribosomes in a human neuronal cell line. Rna 10:387-394. 55. Pillai, R.S., Bhattacharyya, S.N., Artus, C.G., Zoller, T., Cougot, N., Basyuk, E., Bertrand, E., and Filipowicz, W. 2005. Inhibition of translational initiation by Let-7 MicroRNA in human cells. Science 309:1573-1576. 56. Petersen, C P . , Bordeleau, M.E., Pelletier, J . , and Sharp, P.A. 2006. Short RNAs repress translation after initiation in mammalian cells. Mol Cell 21:533-542. 57. Olsen, P.H., and Ambros, V. 1999. The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev B/'o/216:671-680. 58. Humphreys, D.T., Westman, B.J., Martin, D.L, and Preiss, T. 2005. MicroRNAs control translation initiation by inhibiting eukaryotic initiation factor 4E/cap and poly(A) tail function. Proc Natl Acad Sci USA 102:16961-16966. 59. Sen, G.L., and Blau, H.M. 2005. Argonaute 2/RISC resides in sites of mammalian mRNA decay known as cytoplasmic bodies. Nat Cell Biol 7:633-636. 60. Teixeira, D., Sheth, U., Valencia-Sanchez, M.A., Brengues, M., and Parker, R. 2005. Processing bodies require RNA for assembly and contain nontranslating mRNAs. Rna 11:371-382. 137 61. Berchem, G.J., Bosseler, M., Sugars, L.Y., Voeller, H.J., Zeitlin, S., and Gelmann, E.P. 1995. Androgens induce resistance to bcl-2-mediated apoptosis in LNCaP prostate cancer cells. Cancer Res 55:735-738. 62. Kimura, K., Markowski, M., Bowen, O , and Gelmann, E. 2001. Androgen blocks Apoptosis of hormone-dependent prostate cancer cells. Cancer Res. 61:5611-5618. 63. Coffey, R.N., Watson, R.W., O'Neill, A.J., Mc Eleny, K., and Fitzpatrick, J .M. 2002. Androgen-mediated resistance to apoptosis. Prostate 53:300-309. 64. Liu, Q.Y., and Stein, C A . 1997. Taxol and estramustine-induced modulation of human prostate cancer cell apoptosis via alteration in bcl-xL and bak expression. Clin Cancer Res 3:2039-2046. 65. Panvichian, R., Orth, K., Pilat, M.J., Day, M.L., Day, K .C, Yee, C , Kamradt, J .M., and Pienta, K.J. 1999. Signaling network of paclitaxel-induced apoptosis in the LNCaP prostate cancer cell line. Urology 54:746-752. 138 Chapter 5. Differential Regulation of Clusterin and its Isoforms by Androgens in Prostate Cel ls 1 Zhou Wang performed the rat organ culture and the Northern blot from those samples. Motosugu Muramaki aided in the design of the experiments involving the clusterin isoforms. 5.1 Introduction Clusterin, also known as the testosterone repressed prostate message (TRPM-2), ApoJ and SPG-2, is a heterodimeric sulphated glycoprotein, first isolated in ram rete testis fluid (1, 2). Clusterin is widely expressed in many tissues including brain, ovary, testis, liver, heart, lung, breast and prostate (3) and appears to be involved in a diverse number of biological processes. There is evidence that clusterin can act as a molecular chaperone (4), and has been implicated in tissue remodeling (5), lipid transport (6, 7), cell-cell interactions (8), sperm maturation (9) and apoptosis (10). However, the exact role of clusterin in many of these processes remains unclear. Upon castration, the prostatic epithelial cells undergo apoptosis in rat ventral prostate and clusterin mRNA levels are greatly increased (11, 12), therefore clusterin was originally thought to be repressed by testosterone. Clusterin also increases in the androgen dependent Shionogi tumor model in which castration causes a rapid apoptotic response following castration (13). However, in later studies it was shown 1 A version of this chapter has been published in the Journal of Biological Chemistry. Cochrane DR, Wang Z, Muramaki M, Gleave ME, and Nelson C C (2007). Differential Regulation of Clusterin and its Isoforms by Androgens in Prostate Cells. J . Biol. Chem. 282(4):2278-87 139 that mice bearing Shionogi tumors, when treated with calcium channel blockers that prevent apoptosis, clusterin upregulation was not observed in the absence of testicular androgens (14). Similarly, if the rate of prostatic atrophy is decreased using glucocorticoid treatment, clusterin mRNA levels are reduced (15). Therefore, the current understanding is that clusterin induction is associated with apoptosis rather than being an androgen repressed gene. Clusterin has been a somewhat enigmatic protein, being described as being both pro-apoptotic (16, 17) and anti-apoptotic (18, 19). It was later discovered that the differential translation and post-translational processing result in either a secreted or nuclear clusterin. The secreted form of clusterin has been shown to be cytoprotective whereas the nuclear form is pro-apoptotic (20, 21). An alternative splicing event generates nuclear clusterin (21-23). This splicing event removes the ER-targeting signal and allows the protein to be transported into the nucleus using a nuclear localization sequence (21). Recent updates to GenBank have highlighted that there are two transcriptional isoforms of human clusterin (Isoform 1, NM_001831 and Isoform 2, NM_203339). These isoforms result from different transcriptional initiation sites and are only produced in human and chimpanzee. These transcriptional isoforms result in proteins that have different N-termini. Both clusterin isoforms produce proteins which are cytoprotective (24). Intriguingly, it is only Isoform 1 which is capable of producing a splice variant that results in the nuclear, apoptotic form of clusterin (21). Many studies demonstrating that clusterin has anti-apoptotic properties have been undertaken in mouse or rat and these species are only capable of transcribing the orthologue to 140 Isoform 1 of clusterin, however, the first exon is predicted to not be translated due to the lack of an initiating methionine in non-primate species. Clusterin is expressed in many cancers including breast, prostate, ovarian, pancreatic and renal cancers (25-29). In prostate cancer, high levels of clusterin correlate with Gleason grade (30), which may suggest that clusterin plays a role in the aggressiveness of a tumor. The levels of clusterin increase significantly following androgen ablation therapy (31). Clusterin provides a route by which a subset of the prostate cancer cells can evade apoptosis due to androgen ablation and thereby allows the cells to grow into androgen independent (Al) cancer. In xenografts of LNCaP cells overexpressing clusterin, the tumors reach androgen independence faster than the parental cell line, suggesting that clusterin plays a role in the acquisition of the Al phenotype (11). Prostate cells overexpressing Isoform 2 of clusterin become more resistant to Fas mediated apoptosis (32). Oligonucleotides which target Isoform 2 of clusterin endow the cells with sensitivity to radiation (33) and chemotherapeutic agents (34). In the present study, we show that total clusterin expression is in fact upregulated by androgens. In an androgen dependent prostate cancer cell line, clusterin is upregulated at both the RNA and protein levels when treated with androgens, and this effect is reversed with anti-androgen treatment. Clusterin mRNA levels are also seen increasing in rat ventral prostate organ culture when treated with androgens. This effect is specific to androgens, as exposure to other steroid hormones does not have an effect on clusterin levels. We show that the AR directly regulates clusterin expression through interaction with an intronic enhancer region on the 141 clusterin gene. Furthermore, androgens have opposing effects on the two mRNA isoforms of clusterin which are generated from alternative start sites. Isoform 1 is repressed by androgens, while Isoform 2 is upregulated by androgens through direct interaction with the first intron. 5.2 Materials and Methods Cell Culture - LNCaP cells, passage 35-50, and PC3 cells, passage 10-20, were grown at 37°C and 5% C 0 2 in RPMI and DMEM, respectively, both containing 5% fetal bovine serum (FBS) and penicillin/streptomycin. Charcoal stripped serum (CSS) was prepared using FCS incubated with 1% charcoal and 0 .1% dextran T-70 followed by filtration. Hormone Treatments - R1881, dihydrotestosterone (DHT) and dexamethazone were purchased from Steraloids Inc. Progesterone, 17p-estradiol (estradiol), all-trans-retinoic acid (ATRA) and 3,3 ,5-triiodo-L-thyronine sodium salt (T3) were from Sigma. Casodex (bicalutamide) was from Astro Zenica, UK. All hormone stock solutions were in absolute ethanol with the exception of the T3, which was dissolved in NaOH. Prior to any hormone treatments, cells were grown in media + 2 % C S S for 48 hours. Cells were harvested for protein, using RIPA lysis buffer (150 mM NaCl, 1% Igepal, 0 .5% Na Deoxycholate, 0 .1% SDS, 50 mM Tris) and RNA, using Trizol (Invitrogen). Northern Blot Analysis - Total RNA (10 pg) was denatured in sample buffer and run through a denaturing 1% MOPS formaldehyde agarose gel for 1 hour at 80 V. The RNA was transferred to a nylon membrane (Biodyne B, Pall Gelman Laboratory) in 20X SSC (3 M sodium chloride, 0.3 M sodium citrate, pH 7.0) for 20 hours. The RNA was crosslinked to the membrane using a UV Stratalinker (Stratagene) according to 142 manufacturer's instructions. Membranes were prehybridized in ExpressHyb (Clontech) containing denatured salmon testes DNA (Sigma) for 3 hours at 65°C. Clusterin probes were generated using reverse transcriptase PCR from human kidney RNA using the following primers: 5-AAGGAAATTCAAAAATGCTGTCAA-3 and 5-A C A G A C A A G A T C T C C C G G C A C T T - 3 . Radioactivity was incorporated into the probe using Ready-To-Go DNA labeling beads (Amersham Pharmacia Biotech) to a specific activity of 1-2x108 dpm/pg. Probes were hybridized to the membrane overnight at 65°C. High stringency washes were performed on the membranes at 65°C. The membranes were exposed to Kodak MR film. Western Blot Analysis - Protein sample (15 u.g) was boiled at 95°C for 5 minutes in sample buffer containing B-mercaptoethanol. Samples were loaded on 1 0 % polyacrylamide gels and subjected to electrophoresis for 1 hour at 150 V. Proteins were transferred electropheretically onto PVDF membrane (Millipore). Blots were probed for clusterin using a goat polyclonal clusterin-8 (C-18) antibody (Santa Cruz). After incubation with a secondary antibody, the membranes were incubated with ECL reagents (Amersham) and exposed to Kodak Blue XB-1 Film. For normalization purposes, membranes were reprobed with a rabbit polyclonal B-tubulin antibody (Santa Cruz). Real Time PCR - To quantitatively evaluate the levels of clusterin in the samples, real time PCR was undertaken. Before generating the cDNA, 2 pg of the RNA was treated with DNAse l (Invitrogen) to remove any DNA contamination. The RNA was then reverse transcribed into cDNA in a reaction containing 1X reaction buffer, 0.01 M DTT, 1 mM dNTPs, 40 U RNAsin (Promega), random hexamers (250 ng) and 200 U of 143 MMLV reverse transcriptase (Invitrogen). The reaction proceeded at 25°C for 10 minutes, then at 37°C for one hour. The levels of clusterin transcript were then assayed using real time PCR on the ABI 7900 HT Sequence Detection System. To determine the levels of total clusterin, a region of Exon 3 was amplified. The primers used were; forward 5-GAGCAGCTGAACGAGCAGTTT-3 , reverse primer 5-C T T C G C C T T G C G T G A G G T and probe 5-[6-FAM]ACTGGGTGTCCCGGCTGGCA[TAMRA-Q]-3. To differentiate Isoform 1 and 2 levels, primers and probes in the unique 5 untranslated regions of the respective transcripts were used. For Isoform 1, forward primer 5-C G T G A G T C A T G C A G G T T T G C -3, reverse primer 5 - C T G G G A G G C G C C G A A T -3 and probe 5 -[6-FAM]TGTGTGCGCGAGCAGAGCGCTAT[TAMRA-Q]-3. For Isoform 2, forward primer 5-CTCTACTCTCCGAAGGGAATTGTC-3 , reverse primer 5-CGGGCTGCCTGTGCAT-3 and probe 5-[6-FAM]TTCCTGGCTTCCACTACTTCCACCCC[TAMRA-Q]-3. For normalization purposes, rRNA control primers and probes (ABI) were used. The reported values are the averages and standard deviations of three biological replicates. Organ Culture - Young adult male Harlan Sprague Dawley rats (250-300 g), from Harlan, Inc. (Indianapolis, IN), were castrated by removing testes, fat pads, and epididymis in a room dedicated for animal manipulation according to a protocol approved by the Northwestern University Animal Care and Use Committee (Chicago, IL). The castrated animals were maintained in the Northwestern University Animal Facility. The ventral prostate was dissected out from the rats 7-days after castration. Organ culture was done as described previously (35, 36). Briefly, the prostates were 144 minced with a scalpel to generate uniform fragments with ~1 mm in all dimensions. The prostate fragments were placed on lens paper supported at the media-air interface with a stainless steel screen in a 10 cm culture plate and incubated in 5% CO2 incubator at 37°C. The prostate fragments were in good contact with the media but not submerged in the M-199 media consisting of Earles salts, L glutamine, and 2.2 g/L sodium bicarbonate, without phenol red, from Invitrogen, with the addition of 1 0 % charcoal-stripped, penicillin G sodium at 200 U/ml, and streptomycin sulfate at 0.2 pg/ml. Treatment with DHT was at 1 pM final concentration for 24 hours. After treatment, the prostate fragments were harvested and frozen immediately in liquid nitrogen (N2), and the RNA was isolated using the guanidinum/CsCI gradient method. Northern blot analysis of clusterin mRNA was carried out as described previously using a clusterin cDNA probe. Transfections - LNCaP cells were grown to 6 0 % confluency before being transfected with 1.5 pg of the steroid receptor expression vectors. Prior to the transfections, cells were grown in RPMI + 2 % CSS for two days. Lipofectin (Invitrogen) was incubated with serum free RPMI for 30 minutes before the DNA was added and incubated for 10 minutes more. Cells were transfected with lipofectin/DNA mix for 5 hours before the media was changed to RPMI + 2 % CSS . Cells were treated with 1 nM of the indicated hormone ligand for 72 hours prior to harvesting unless otherwise indicated. Luciferase Assay - Consite (http://mordor.cgb.ki.se/cgi-bin/CONSITE/consite/) (37) was used to predict the location of androgen response elements (ARE's) in the clusterin gene. Luciferase reporter plasmids were created by cloning the PCR generated fragments into pTK-luc (ATCC). Both LNCaP and PC3 cells were plated into 145 6 well plates then using Lipofectin, the cells were transfected with 3 pg of reporter plasmid, 2 pg of rat AR in pRcCMV (Invitrogen), and 0.05 pg of the renilla expression plasmid pRLTKS (Promega) per plate. After transfection, the cells were incubated with either 2 % C S S medium alone or with R1881. Cells were washed and harvested with passive lysis buffer (Promega). PC3 cells were harvested after 48 hours of hormone treatment, and LNCaP cells were harvested after 72 hours. Luciferase activity of 20 pl aliquots of lysate was determined using the Dual-Luciferase Reporter assay system (Promega) on a luminometer (Berthold, Germany). Luciferase activity was normalized for transfection efficiency using renilla activity. Experiments were done in triplicate, averaged, and expressed as fold induction. Chromatin Immunoprecipitation - Plates of LNCaP cells were incubated with formaldehyde at a concentration of 1% for 10 minutes on a shaking platform. Glycine was then added to a final concentration of 0.125 M for 5 minutes. The cells were washed twice with ice cold PBS before being scraped off the plate with 5 mM EDTA in PBS. The cells were then pelleted and washed with ice cold PBS. The pellet was resuspended in 500 pL cell lysis buffer (5 mM PIPES pH 8.0, 85 mM KCL, 0 .5% NP40) and incubated on ice for 10 minutes. The sample was centrifuged and the supernatant removed. The nuclei were then lysed by adding 1 ml nuclei lysis buffer (50 mM Tris-CI pH 8.1, 10 mM EDTA, 1% SDS) and incubating on ice for 10 minutes. The samples were then sonicated on setting 3 (Sonic Dismembrator 550, Fisher Scientific), four pulses of 15 seconds, separated by 30 seconds. The sonicated chromatin was then precleared by rotating at 4°C for 2 hours with normal rabbit IgG (2 pg/ml), salmon sperm DNA (20 pg/ml) and 40 pL protein A/G agarose beads (Santa Cruz) that have 146 been pre-washed with dialysis buffer (2mM EDTA, 50 mM Tris-CI pH 8.0, 0 .2% Sarkosyl), followed by brief centrifugation. For the immunoprecipitation, 200 pL of the precleared sample was diluted with 400 pL of dilution buffer (0.01% SDS, 1.1% Triton X 100, 1.2 mM EDTA, 16.7 mM Tris-CI pH 8.1, 167 mM NaCl). The sample was then rotated overnight, at 4°C with 2 pL of normal rabbit serum or 5 pL of rabbit polyclonal AR antibody (Upstate). Protein A/G agarose beads that have been pre-washed with dialysis buffer were added and the samples were rotated at 4°C for 2 hours. The samples were centrifuged briefly and the resulting pellet was washed twice with dialysis buffer and four times with IP wash buffer (100 mM Tris-CI pH 9.0, 500 mM LiCI, 1% NP40, 1% deoxycholic acid). Between washes, the samples were rotated at 4°C for 3 minutes. To the pellet, 150 pL of elution buffer (50 mM NaHC03, 1% SDS) was added and the samples were shaken vigorously at room temperature for 15 minutes. The samples were centrifuged briefly, the supernatant collected and the elution process repeated. For input, 200 pL of the pre-cleared DNA is diluted into 100 pL of elution buffer. To the pooled elutions and the input sample, NaCl (final concentration of 0.3 M) was added and the samples were incubated at 67°C overnight to de-crosslink. The DNA was ethanol precipitated and the protein digested with proteinase K (Invitrogen). The DNA was purified using a PCR purification kit (Qiagen). Thirty five cycles of PCR was then performed using 1 pL of the chromatin as template. Primers for the PSA enhancer: 5 - CATGTTCACATTAGTACACCTTGCC-3 and 5 -TCTCAGATCCAGGCTTGCTTACTGTC-3 . Primers for Clu 1, which encompasses region +2094 to + 2433 of the clusterin gene were: 5 -CAGCCCTGCAGTGATTCATA-3 and 5 -CCCGACCCCTAGTCCAGTAT-3 . Primers for Clu 2, which encompasses 147 region +2443 to +2761 were: 5 -CTCTACTCCCAGGGTTACCA-3 and 5-CCCCTGAAAGCAACAACTTC-3 . Primes for Clu 3, encompassing +2779 and +3083 of the gene were: 5-TTCTGGCTGGCTTTGTCTCT-3 and 5-GTTCCCCTTCCTGAAATGGT-3 . LNCaP xenografts - 2 x 10 6 cultured LNCaP cells were combined with Matrigel (Becton Dickinson Labware) at a 50:50 volume ratio of cells to matrigel and injected subcutaneously into four sites of 6-8 week old athymic nude mice (BALB/c strain; Charles River Laboratory). The mice were surgically castrated 8 weeks post injection under methoxycluorane anesthesia. To harvest the tumors, the mice were sacrificed using carbon dioxide asphyxiation, the tumors were removed and frozen immediately at -80°C. Androgen dependent (AD) tumors were harvested 8-14 days post castration while Al tumors were harvested 22-35 days post castration. Statistical analysis - Error bars on the real time PCR graphs represent standard error of the mean. The luciferase data was analyzed using a Kruskal-Wallis non-parametric test followed by Dunn's multiple comparison test to determine statistical significant differences between EtOH and R1881 treated samples using Prism (Graph Pad). For the real time PCR, statistical significance was measured using a Student's t-test (Microsoft Exel). 5.3 Results Clusterin is Upregulated by Androgens in a Dose and Time Dependent Manner - To determine if clusterin levels are affected by androgens in vitro, LNCaP cells were treated with 1 nM R1881 for a time period ranging from 16 to 72 hours. Northern blot analysis of those samples reveal that when compared to the time-matched vehicle 148 Figure 5.1 Clusterin mRNA levels in response to androgen treatment. A, Northern blot of an R1881 time course probed for clusterin in the top panel; bottom panel showing the loading control. LNCaP cells were treated with 1 nM R1881 (+) or ethanol vehicle (-) for periods of time ranging from 16 to 72 hours. Northern blots for three biological replicates were performed, all with similar results. 6, Real time PCR quantification of clusterin mRNA levels in response to androgen treatment. The graph shows the ratio of clusterin mRNA in R1881 treated cells to vehicle control treated cells, for three biological replicates. C, Northern blot of R1881 titration. LNCaP cells were treated with doses of R1881 ranging from 0.01 to 10 nM R1881 for a time period of 72 hours. Northern blots for three biological replicates were performed, all with similar results. D, The ventral prostates from 7-day castrated adult rats were minced into small pieces and cultured in dish, as described. After overnight culture, the prostates were treated with DHT at a final concentration of 1 pM or ethanol vehicle for 24 hours. The tissues from organ culture were then harvested and isolated for Northern blot analysis. The lanes of the Northern blot shown is RNA from 50 pooled rat prostates. The lower panel is the methylene blue staining pattern, indicating the amount and quality of total RNA loaded in each lane. 149 control, the levels of clusterin mRNA increase with androgen treatment starting at 36 hours and continue to rise up to and including 72 hours (Figure 5.1A). Real time PCR was used to quantify the increase of clusterin levels in response to androgens (Figure 5.1 B). DNA laddering analysis of the androgen treated cells revealed no apparent increase in apoptosis over the time period when clusterin levels increase (data not shown). To verify that the response being seen is dose dependent, LNCaP cells were treated with R1881 for 72 hours in doses ranging from 0.01 to 10 nM. There is no detectable response to low levels of androgens up to 0.1 nM R1881. Clusterin mRNA levels increase in cells treated with levels of R1881 greater than 1 nM (Figure 5.1C). A similar increase in clusterin mRNA levels was seen with 10 nM DHT (data not shown). We were interested in determining if clusterin was also upregulated by androgens in the rat prostate. The rat ventral prostate is highly androgen responsive and has been used to study the affects of androgen withdrawal and as a model to study androgen regulated genes. Young male Sprague Dawley rats were castrate for 7 days and prostates were removed, microdissected and grown in organ culture with or without androgen treatment for 24 hours. RNA was harvested and analyzed for a variety of genes (38, 39). In these ex vivo prostate samples, the levels of clusterin RNA increased in the prostate organ culture following treatment with DHT (Figure 5.1 D). This data shows that clusterin is also upregulated in the normal prostate secretory epithelium in response to androgens. To verify that levels of clusterin protein corroborate the increase detected at the mRNA level, protein from androgen treated LNCaP cells was harvested and probed by 150 Western blot. A time course of androgen treatment is shown in Figure 5.2A. In the absence of treatment, there are low levels of clusterin expression in LNCaP cells. With increasing duration of androgen treatment, the levels of clusterin increase starting at j> f /> <f ^ ^ ^ ^ 1 nM R1881 - + - + - + - + - + - + clusterin tubulin —60 kDa •-40 kDa B clusterin tubulin ^ Q »». «5r Figure 5.2 Clusterin protein levels in response to androgen treatment. A, Western blot of an R1881 time course probed for clusterin in the top panel; bottom panel showing (3-tubulin levels as a loading control. LNCaP cells were treated with 1 nM R1881 (+) or ethanol vehicle (-) for periods of time ranging from 16 to 72 hours. Shown are both the 60 kDa (full length) and 40 kDa (processed) forms of clusterin. B, Western blot of R1881 titration. LNCaP cells were treated with doses of R1881 ranging from 0.01 to 10 nM R1881 for 72 hours. The Western blots were performed in triplicate with similar results each time. 36 hours and continuing through to 72 hours. The antibody used in the Western blots detects the (3-chain of clusterin. The two bands seen in the Western blots are the 60 kDa form and the 40 kDa cleaved form of clusterin. Both the 40 and 60 kDa bands are seen increasing beginning at 36 hours. The dose responsiveness of the clusterin is highly similar to that seen at the mRNA level, dramatically increasing with exposure of 151 R1881 at 1 nM and above (Figure 5.2B). The AR is Necessary for Clusterin to be Upregulated - To prove that AR mediates the upregulation of clusterin, LNCaP cells were treated with R1881 alone or in conjunction with the AR-antagonist casodex for 48 to 72 hours. At all time points tested, casodex was able to completely block the effect of R1881 upregulation of clusterin (Figure 5.3A and B). The AR belongs to the steroid receptor subclass of nuclear receptors, which also includes estrogen (ER), progesterone (PR), glucocorticoid (GR) and mineralocorticoid receptors (40). Nuclear receptors are structurally similar containing a C-terminal ligand binding domain, a central DNA binding domain and an N-terminal transactivation domain (41). It is possible that the response to androgens is not specific and that other steroid receptors and their cognate hormones could also regulate clusterin expression. To test this possibility, LNCaP cells were transfected with specific hormone receptors and treated with their respective ligands to examine whether the effect being seen is confined to androgens (Figure 5.3C). The exogenous expression of receptors alone had no effect on clusterin levels, nor was there a noticeable effect on the mRNA levels (Figure 5.3C) or protein levels (data not shown) when the receptor transfected cells were ligand activated. The First Intron of the Clusterin Gene Contains Functional ARE's - It has been reported previously that the first intron of human clusterin contained putative androgen response elements (ARE) to which the AR may bind (42, 43). To examine this further in our studies, the first intron was analyzed using Consite software, which predicts response elements within a DNA sequence and has shown the reliable prediction of validated AREs (44). Many AREs were predicted, however, a cluster of AREs was 152 B i jt?» A <r iS* df* X * 3 1 nM R1881 - + + - + + - + + 1 pM Casodex - - + - - + - - + i i 1 nM R1881 1 pM Casodex Clusterin mRNA clusterin tubulin 60 kDa +-40 kDa Figure 5.3 Necessity of AR in clusterin upregulation. A , Northern blot showing that the upregulation of clusterin is blocked by casodex, an AR antagonist. LNCaP cells were treated with 1 nM R1881 alone or in conjunction with 1pM casodex for periods of time ranging from 48 to 72 hours. B, Western blot showing that casodex also blocks androgen action on clusterin at the protein level. C, LNCaP cells were transfected with the steroid receptors AR, GR, ER, PR, TR and RAR and then treated with 1 nM of the cognate ligand (R1881, dexamethasone, estradiol, progesterone, T3 or ATRA respectively). Northern blots of these samples, probed for clusterin. The blots were performed in triplicate, with representative blots shown. 153 found between +2595 and +3211 of the clusterin gene (Figure 5.4A). It has been These data demonstrate that an increase in clusterin levels is mediated specifically by AR and not other steroid receptors in LNCaP cells. shown previously that for maximal androgen responsiveness, AREs function cooperatively (45, 46), therefore, it is likely that the androgen responsive region in the intron lies within the cluster of AREs . Two luciferase reporter constructs were made, both of which encompassed the region high in putative ARE's. The reporter construct termed T21 contained the region high in ARE 's in addition to the region 5, while the T23 construct contained the region high in putative ARE 's as well as the region 3 to this. Both constructs were tested in luciferase assays done both in LNCaP and PC3 cells. As a positive control, the same amount of a luciferase reporter construct with the promoter region of the prostate specific antigen (PSA) was used in parallel. In LNCaP cells, the T21 construct was more responsive to androgens than the T23 construct and slightly more active than the PSA proximal promoter construct (Figure 5.4B). This suggests that there may be ARE's or other elements on the DNA 5 to the region encompassed by both T21 and T23, which can further enhance the activity of the DNA. In PC3 cells transfected with AR, T21 has similar transcriptional activity as PSA in response to androgens, however, T23 shows no activity at all (Figure 5.4C). The difference in the activity of the T23 construct between LNCaP and PC3 cells shows that the response is modulated by cell type and could require additional transcription factors. To verify that AR is binding to the clusterin intron in vivo, chromatin immunoprecipitation (ChIP) was performed (Figure 5.4D). The 154 Clu 1 (ChIP) Clu 2 (ChIP) Clu 3 (ChIP) T21 (luciferase) T23 (luciferase) • 2 0 9 4 » 2 4 1 3 • 2 4 4 3 ^2761 I—I •2779 +3083 I I • 2141 I— Input Serum AR Figure 5.4 Transcriptional activation due to AR interaction with an enhancer region within the first intron of the clusterin genomic DNA. A, The clusterin gene and constructs made from it for the purposes of the luciferase assay and ChIP. The asterisk denotes the region containing clusters of putative AREs. B, Luciferase assay in LNCaP cells. The LNCaPs were transfected with the reporter constructs, the renilla 155 c o n s t r u c t a n d a n A R e x p r e s s i o n p l a s m i d . T h e c e l l s w e r e t r e a t e d w i t h 0 , 0 . 1 , 1 a n d 1 0 n M R 1 8 8 1 . P S A i s i n c l u d e d a s a p o s i t i v e c o n t r o l . A n a s t e r i s k i n d i c a t e s t h e v a l u e i s s i g n i f i c a n t l y d i f f e r e n t f r o m t h e E t O H v a l u e ( p - v a l u e < 0 . 0 5 ) f o r t h e t h r e e b i o l o g i c a l r e p l i c a t e s . C , L u c i f e r a s e a s s a y i n P C 3 c e l l s . T h e P C 3 c e l l s w e r e t r a n s f e c t e d w i t h t h e r e p o r t e r c o n s t r u c t s , t h e r e n i l l a c o n s t r u c t a n d a n A R e x p r e s s i o n p l a s m i d . T h e c e l l s w e r e t r e a t e d w i t h 0 , 0 . 0 1 , 0 . 0 5 a n d 0 . 1 n M R 1 8 8 1 A n a s t e r i s k i n d i c a t e s t h e v a l u e i s s i g n i f i c a n t l y d i f f e r e n t f r o m t h e E t O H v a l u e ( p - v a l u e < 0 . 0 5 ) . D , P C R p r o d u c t s f r o m C h I P a s s a y . T h e c e l l s w e r e t r e a t e d f o r 2 h o r 4 8 h o u r s , w i t h ( R ) o r w i t h o u t ( E ) 1 n M R 1 8 8 1 . I m m u n o p r e c i p i t a t i o n u s i n g r a b b i t s e r u m i s a n e g a t i v e c o n t r o l s h o w i n g b a c k g r o u n d l e v e l s o f t h e P C R p r o d u c t s . P S A i s a p o s i t i v e c o n t r o l f o r A R b i n d i n g . C l u 1 , C l u 2 a n d C l u 3 a r e t h r e e r e g i o n s w i t h i n t h e c l u s t e r i n f i r s t i n t r o n c o n t a i n i n g p u t a t i v e A R E s . c h r o m a t i n f r o m L N C a P c e l l s t h a t h a d b e e n c u l t u r e d i n t h e p r e s e n c e o r a b s e n c e o f R 1 8 8 1 f o r 2 o r 4 8 h o u r s w a s i m m u n o p r e c i p i t a t e d w i t h e i t h e r n o r m a l r a b b i t s e r u m , a s a n e g a t i v e c o n t r o l , o r w i t h a n A R a n t i b o d y . A s a p o s i t i v e c o n t r o l , P C R w a s p e r f o r m e d o n a r e g i o n o f t h e P S A e n h a n c e r k n o w n t o b e b o u n d b y A R . In t h e t w o h o u r t i m e p o i n t , t h e r e i s m o r e P S A e n h a n c e r P C R p r o d u c t i n t h e R 1 8 8 1 t r e a t e d s a m p l e t h a n t h e e t h a n o l c o n t r o l , s h o w i n g t h a t t h e r e i s m o r e A R b o u n d . T h r e e r e g i o n s o f t h e c l u s t e r i n i n t r o n a s s a y e d . T h e r e i s n o b i n d i n g o f A R o b s e r v e d i n t h e r e g i o n s o f C l u 1 a n d C l u 3 . I n t h e C l u 2 r e g i o n , h o w e v e r , t h e r e i s m o r e P C R p r o d u c t i n t h e R 1 8 8 1 t r e a t e d s a m p l e s w i t h a 4 8 h o u r d u r a t i o n o f t r e a t m e n t . Differential regulation of clusterin isoforms - In p r i m a t e s , t h e r e a r e t w o t r a n s c r i p t i o n a l i s o f o r m s o f c l u s t e r i n r e s u l t i n g f r o m t w o i n d e p e n d e n t t r a n s c r i p t i o n a l s t a r t s i t e s (Figure 5.5A). It i s p r e d i c t e d t h a t i n h u m a n t h e t w o i s o f o r m s d i f f e r i n t h e i r t r a n s l a t i o n a l s t a r t s i t e s , w i t h I s o f o r m 1 t r a n s l a t i n g t h e f i r s t e x o n , w h e r e a s I s o f o r m 2 , w h o s e t r a n s c r i p t i o n a l s t a r t s i t e i s i n I n t r o n 1 , i n i t i a t e s t r a n s l a t i o n i n E x o n 2 . H o w e v e r , a l l a v a i l a b l e c l u s t e r i n a n t i b o d i e s r e c o g n i z e t h e e p i t o p e s o f t h e p r o t e i n w h i c h a r e c o m m o n t o b o t h i s o f o r m s , a n d a r e t h e r e f o r e n o t a b l e t o d i s t i n g u i s h b e t w e e n i s o f o r m s . 156 Since the ARE containing region in the first intron is located between the two transcriptional start sites we were interested in determining whether androgens can regulate the transcription of one or both isoforms. Primers and probes for real time PCR were designed to the unique 5 untranslated regions of the two isoforms to measure their individual transcriptional levels. Interestingly, Isoform 2 is upregulated by androgens by 24 hours and is maintained throughout the 48 hour time point, while Isoform 1 is downregulated by androgens (Figure 5.5B-E). The upregulation of total clusterin mRNA levels is not observed until 48 hours, suggesting that at 24 hours, the upregulation of the Isoform 2 is masked by the downregulation of Isoform 1 and there is no observable change in total clusterin levels. The LNCaP xenograft tumor model is often used as a model for progression from androgen dependence to androgen independence. In this model, androgen regulated genes such as PSA respond to castration by being downregulated following castration up to about day 21. However, during progression to Al, androgen regulated genes, including PSA, are reactivated by about day 28 and remain elevated in Al tumors. To determine the kinetics of clusterin expression during progression to Al, tumors from an LNCaP tumor series were harvested for RNA. A northern blot of PSA levels in the tumors prior to and following castration is shown (Figure 5.6A) and the corresponding serum PSA levels are shown in Figure 5 .6B. The tumor volumes of the 157 TATA Bo* Clusienn Isoform 1 (NM_001831) ARE CluSifil (•2094 to +3083) ;2 3 4 5 — 6 ' ' ' II ' 1 111 ' ' fW 1 ' \f ' ' Clusterin gene Chromosome 8p2M2 Clusterin isoform 2 5'UTR (NM_203339) Clusterin Isoform 1 Splice variant ? UTR r 3 4 5 6 7 8 5' UTR NLS B D ll O S Icoform 2, 48 hours • A Figure 5.5 Androgenic regulation of the two clusterin isoforms. A, The clusterin gene and the two mRNA transcripts formed from alternate transcriptional start sites. The clusterin gene is pictured with the exons appearing as numbered boxes and the introns numbered in roman numerals. The locations of real time PCR primers used to distinguish the two isofoms is indicated on the clusterin gene as QPCR. The bent 158 arrows show the translational start sites on the mRNAs. Splicing out of exon 2 results in the nuclear isoform of clusterin. The ER targeting signal is found in exon2 and the nuclear localization signal (NLS) in exon 3. LNCaP cells were treated with 1 nM R1881 for 24 or 48 hours. RNA from the cells was assayed for clustering Isoform 1 and Isoform 2 levels using real time PCR. Clusterin Isoform 1 levels at 24 hours (B) and 48 hours (C) of treatment with R1881. Levels of clusterin Isoform 2 levels at 24 hours (D) and 48 hours (£). A p-value <0.05 is indicated by *. All real time PCR was done using 8 biological replicates for each time point. tumors are shown in Figure 5.6C. Unlike normal prostate cells, LNCaP tumors do not undergo apoptosis in response to castration. The tumor volumes instead cease growing until A l , where proliferation continues. Real time PCR was used to determine transcript levels of clusterin and its two isoforms. PSA is shown as a positive control and its levels increase with progression (Figure 5.6B). Both total clusterin and Isoform 1 levels increase moderately with progression to Al (Figure 5.6C and D), however, the increase is not statistically significant. Isoform 2 levels do show a significant increase in levels at Al as compared to AD (Figure 5.6E), consistent with the androgen regulation of this isoform. PCR has been used previously to detect the nuclear splice variant (21). Such PCR did not reveal the presence of the nuclear splice variant of clusterin (data not shown); however, neither androgen treatment in vitro, nor progression to androgen independence in the LNCaP tumor model is expected to have nuclear, apoptotic clusterin expressed. 159 Figure 5.6 Levels of clusterin isoforms in androgen dependent and independent LNCaP xenografts. LNCaP cells were injected subcutaneously into athymic mice and tumors were harvested prior to castration and at various time points after castration. A, Northern blots showing the PSA levels in the LNCaP tumors as it progressed to androgen independence (Al). The serum PSA (panel B) and the tumor volume (panel C) of the tumor series is also shown. The mRNA levels of PSA (panel D), total clusterin (panel E), clusterin Isoform 1 (panel F) and Isoform 2 (panel G) were determined using real time PCR for androgen dependent (AD, using day 8 samples) or Al (using day 35 samples). A p-value <0.05 is indicated by *. 160 5.4 Discussion Levels of clusterin increase dramatically in the rat ventral prostate upon castration, leading to its designation as a testosterone repressed message. Later studies demonstrated that the increase in clusterin was most likely a stress response brought about by castration-induced apoptosis of the prostatic epithelial cells and is perhaps regulated in concert with the heat shock proteins (16, 47). The androgenic regulation of clusterin has been primarily studied in vivo by removal of androgens by physical or hormonal castration of rats or on mice bearing xenograft tumors (48-50). However, in this context, it is difficult to dissociate the androgenic and the apoptotic stimuli. In the Shionogi tumor model, apoptosis is blocked by calcium channel blockers, clusterin levels do not increase upon castration (14). Therefore, studying the effects of androgens on prostate cells in cell culture and in organ culture avoids the confounding influence of the multiple signals present in the in vivo system. In the present study we have demonstrated that in both human prostate cancer cells and in the rat ventral prostate, total clusterin is in fact upregulated by androgens. Androgen treatment causes an increase in the levels of both the total clusterin mRNA as well as the resulting protein, clusterin. The effect seen is both time and dose dependent, while independent of apoptosis. Androgens are necessary for the growth and differentiation of normal prostatic epithelium. It has been shown that clusterin plays a role in many different types of cancer as a cell survival factor and helps cancerous cells to evade stress induced apoptosis. We propose herein, that clusterin may also play a cytoprotective role in normal prostate cells under the regulation of androgens. Androgens themselves have 161 long been known to promote survival of prostatic epithelium and they appear to increase the cell's ability to withstand apoptotic stimuli (47). Androgens have been shown to play a cytoprotective role by decreasing the levels of pro-apoptotic proteins such as the caspases and members of the Bcl-2 family of proteins (51, 52) as well as preventing the release of cytochrome c from the mitochondria (53). It is therefore not surprising that androgens could increase the levels of anti-apoptotic proteins such as clusterin, which would act to protect prostate cells against apoptosis. The transcriptional regulation of the clusterin gene is likely quite complex. When a cell undergoes a stress response to stimuli such as heat shock, clusterin is induced. It was shown that in this scenario, the heat shock transcription factor, HSF-1, binds to a heat shock element in the 5 promoter region of the murine clusterin gene and induces its expression (54). In addition to stress induction, there are various growth factors that can induce clusterin expression, including transforming growth factor (3, nerve growth factor and epidermal growth factor (55-57). These growth factors have been shown to require an AP-1 site found in the 5 proximal promoter region of the clusterin gene to induce its expression. Other steroid hormones have been shown to have effects on clusterin expression in other cell types. A number of studies have reported that estradiol treatment can cause an increase or decrease of clusterin levels in uterus and endometrium (58-60). As well, vitamin D has been shown to increase clusterin levels in human breast cancer MCF-7 cells (61, 62). Although these steroids have been implicated in clusterin regulation, there has not been shown to be direct interaction of the cognate steroid receptor with the clusterin gene and they are possibly downstream 162 effects. In contrast, we have shown that the AR does interact with a regulatory region found in the first intron of the clusterin gene and increases the transcription of clusterin in prostate epithelial cells. It has been postulated that there are AREs within the first intron of both the rat and human clusterin genes and that the AR could bind to these response elements and repress the expression of clusterin (42, 43, 63). We have shown that the AR does bind specifically to the clusterin intronic DNA, resulting in increased transactivation in a reporter assay. The ChIP assay demonstrated that although AR does bind a region of the clusterin first intron in vivo, binding does not occur at 2 hours post androgen treatment as it does for the PSA enhancer region. Rather, AR binding occurs later, within 48 hours after androgen treatment. We therefore hypothesize that there may be repressor proteins at play which prevent AR from binding or other positive acting factors or chromatin remodeling needed for AR to bind and initiate assembly of a transcription complex. AR is known to induce transcriptional activity through interaction with AREs . However, there is little known about its ability to directly cause transcriptional repression. Therefore, it is unclear as to whether the direct interaction of AR with the intronic region of clusterin is the cause of the downregulation of Isoform 1 or if this is an effect of transcriptional interference. The differential regulation of two clusterin isoforms may be critical to regulation of the opposing apoptotic and anti-apoptotic functions of the two isoforms. Both isoforms are cytoprotective (24), however, Isoform 1 has the capacity to produce the nuclear, apoptotic form of clusterin generated by alternative splicing (21). In the 163 context of androgens, which are cytoprotective in prostate cells, we show that androgens specifically upregulate Isoform 2 of clusterin while downregulating Isoform 1. Studies performed in other species demonstrate the anti-apoptotic nature of clusterin, and interestingly these other species only produce an orthologue equivalent to Isoform 2, as they lack an initiating methionine in the first exon. Isoform 2 is shown to increase during progression to Al in LNCaP xenograft tumors and this correlates with the induction of PSA at A l . This is consistent with Isoform 2 being an androgen regulated gene as there is a reactivation of AR signaling at A l , demonstrated by the recurrence of PSA and other androgen regulated genes (64, 65). AR remains important as tumors progress to A l , and as such these tumors retain high expression levels of AR (66) and downregulation of AR using siRNA causes an increase in apoptosis (67). Therefore as prostate tumors progress to A l , the reactivation in AR signaling is functionally important for maintenance of cell viability. Clusterin is also important for evasion of apoptosis during progression to A l (31, 68). In that context, Al prostate cells will seek to upregulate the anti-apoptotic form of clusterin and as such, will upregulate Isoform 2, which cannot be spliced into the apoptotic form. The data presented herein suggests that androgens may be cytoprotective in secretory prostatic epithelial cells in human in part through upregulation of clusterin Isoform 2 and downregulation of clusterin Isoform 1. This is not only important in the maintenance of normal prostate, but also during the progression to androgen independent prostate cancer. 164 5.5 References 1. Fritz, I., Burdzy, K., Stechell, B., and Blaschuck, O. 1983. Ram rete testis fluid contains a protein (clusterin) which influences cell-cell interactions in vitro. Biol Reprod 28:1173-1188. 2. Blaschuck, O., Burdzy, K., and Fritz, I. 1983. Purification and characterization of a cell-aggregating factor (clusterin), the major glycoprotein in ram rete testis fluid. J. Biol. Chem. 258:7714-7720. 3. de Silva, H., Harmony, J . , Stuart, W., Gil, C., and Robbins, J . 1990. Apolipoprotein J : strucuture and tissue distribution. Biochemistry 29:5380-5389. 4. Poon, S., Easterbrook-Smith, S.B., Rybchyn, M.S., Carver, J.A., and Wilson, M.R. 2000. Clusterin is an ATP-independent chaperone with very broad substrate specificity that stabilizes stressed proteins in a folding-competent state. Biochemistry 39:15953-15960. 5. Ahuja, H., Tenniswood, M., Lockshin, R., and Zakeri, Z. 1994. Expression of clusterin in cell differentiation and cell death. Biochem Cell Biol 72:523-530. 6. Burkey, B., Stuart, W., and Harmony, J . 1992. Hepatic apolipoprotein J is secreted as a lipoprotein. J Lipid Res 33:1517-1526. 7. Gelissen, I., Hochgrebe, T., Wilson, M., Easterbrook-Smith, S., Jessup, W., Dean, R., and Brown, A. 1998. Apolipoprotein J (clusterin) induces cholesterol export from macrophage-foam cells: a potential anti-atherogenic function? Biochem J 331:231-237. 8. Silkensen, J.R., Skubitz, K.M., Skubitz, A.P., Chmielewski, D.H., Manivel, J . C , Dvergsten, J.A., and Rosenberg, M.E. 1995. Clusterin promotes the aggregation and adhesion of renal porcine epithelial cells. J Clin Invest 96:2646-2653. 9. Sylvester, S.R., Morales, C , Oko, R., and Griswold, M.D. 1991. Localization of sulfated glycoprotein-2 (clusterin) on spermatozoa and in the reproductive tract of the male rat. Biol Reprod 45:195-207. 10. Rosenberg, M., and Silkensen, J . 1995. Clusterin: physiologic and pathophysiologic considerations. Int J Biochem Cell Biol 27:633-645. 11. Montpetit, M., Lawless, K., and Tenniswood, M. 1986. Androgen-repressed messages in the rat ventral prostate. Prostate 8:25-36. 12. Leger, J .G., Montpetit, M.L., and Tenniswood, M.P. 1987. Characterization and cloning of androgen-repressed mRNAs from rat ventral prostate. Biochem Biophys Res Commun 147:196-203. 13. Rennie, P.S., Bruchovsky, N., Akakura, K., Goldenberg, S.L., Otal, N., Akakura, S., Wong, P., and Tenniswood, M. 1994. Effect of tumour progression on the androgenic regulation of the androgen receptor, TRPM-2 and YPT1 genes in the Shionogi carcinoma. J Steroid Biochem Mol Biol 50:31-40. 14. Miyake, H., Nelson, C , Rennie, P., and Gleave, M. 2000. Testosterone-165 repressed prostate message-2 is an antiapoptotic gene involved in progression to androgen independence in prostate cancer. Cancer Res. 60:170-176. 15. Rennie, P., Bowden, J . , Freeman, S., Bruchovsky, N., Cheng, H., Lubahn, D., Wilson, E., French, F., and Main, L. 1989. Cortisol alters gene expression during involution of the rat ventral prostate. Mol. Endo. 3:703-708. 16. Buttyan, R., Olsson, C.A., Pintar, J . , Chang, C , Bandyk, M., Ng, P.Y., and Sawczuk, I.S. 1989. Induction of the TRPM-2 gene in cells undergoing programmed death. Mol Cell Biol 9:3473-3481. 17. Wong, P., Borst, D.E., Farber, D., Danciger, J.S., Tenniswood, M., Chader, G.J., and van Veen, T. 1994. Increased TRPM-2/clusterin mRNA levels during the time of retinal degeneration in mouse models of retinitis pigmentosa. Biochem Cell Biol 72:439-446. 18. French, L, Sappino, A., Tschopp, J . , and Schifferli, J . 1992. Distinct sites of production and deposition of the putative cell death marker clusterin in hte human thymus. J. Clin. Invest. 90:1919-1925. 19. French, L, Wohlwend, A., Sappino, A., Tschopp, J . , and Schifferli, J . 1994. Human clusterin gene expression is confined to surviving cells during in vitro programmed cell death. J. Clin. Invest. 93:877-884. 20. Zhang, Q., Zhou, W., Kundu, S., Jang, T.L., Yang, X., Pins, M., Smith, N., Jovanovic, B., Xin, D., Liang, L., et al. 2006. The leader sequence triggers and enhances several functions of clusterin and is instrumental in the progression of human prostate cancer in vivo and in vitro. BJU Int 98:452-460. 21. Leskov, K.S., Klokov, D.Y., Li, J . , Kinsella, T.J., and Boothman, D.A. 2003. Synthesis and functional analyses of nuclear clusterin, a cell death protein. J Biol Chem 278:11590-11600. 22. Yang, C.R., Leskov, K., Hosley-Eberlein, K., Criswell, T., Pink, J.J., Kinsella, T.J., and Boothman, D.A. 2000. Nuclear clusterin/XIP8, an x-ray-induced Ku70-binding protein that signals cell death. Proc Natl Acad Sci USA 97:5907-5912. 23. Caccamo, A.E., Scaltriti, M., Caporali, A., D'Arca, D., Scorcioni, F., Candiano, G., Mangiola, M., and Bettuzzi, S. 2003. Nuclear translocation of a clusterin isoform is associated with induction of anoikis in SV40-immortalized human prostate epithelial cells. Ann N Y Acad Sci 1010:514-519. 24. Muramaki, M., Beraldi, E., Cochrane, D., Cox, M., Rennie, P., Nelson, C , and Gleave, M. 2006 submitted. Antisense oligonucleotide targeting clusterin enhances the cytotoxic effect of bispecific antisense oligonucleotide inhibiting both IGHBP-2 and IGFBP-5 by recruiting apoptotic nuclear isoform of clusterin in prostate cancer cells. Oncogene. 25. Redondo, M., Villar, E., Torres-Munoz, TTellez, T., Morell, M., and Petito, C. 2000. Overexpression of clusterin in human breast carcinoma. American Journal of Pathology 157:393-399. 26. Lee, C , Janulis, L, llio, K., Shah, A., Park, I., Kim, S., Cryns, V., Pins, M., and Bergan, R. 2000. In vitro models of prostate apoptosis: clusterin as an 166 antiapoptotic mediator. Prostate Suppl 9:21-24. 27. Hough, C , Cho, K., Zonderman, A., Schwartz, D., and Morin, P. 2001. Coordinately up-regulated genes in ovarian cancer. Cancer Res. 61:3869-3876. 28. Xie, M., Motoo, Y., Mouri, H., Ohtsubo, K., Matsubara, F., and Sawabu, N. 2002. Expression of clusterin in human pancreatic cancer. Pancreas 25:234-238. 29. Dvergsten, J . , Manivel, J.C., Correa-Rotter, R., and Rosenberg, M.E. 1994. Expression of clusterin in human renal diseases. Kidney Int 45:828-835. 30. Steinberg, J . , Oyasu, R., Lang, S., Sintich, S., Rademaker, A., Lee, C , Kozlowski, J .M., and Sensibar, J.A. 1997. Intracellular levels of SGP-2 (Clusterin) correlate with tumor grade in prostate cancer. Clin Cancer Res 3:1707-1711. 31. July, L.V., Akbari, M., Zellweger, T., Jones, E .C, Goldenberg, S.L., and Gleave, M.E. 2002. Clusterin expression is significantly enhanced in prostate cancer cells following androgen withdrawal therapy. Prostate 50:179-188. 32. Miyake, H., Hara, S., Zellweger, T., Kamidono, S., Gleave, M.E., and Hara, I. 2001. Acquisition of resistance to Fas-mediated apoptosis by overexpression of clusterin in human renal-cell carcinoma cells. Mol Urol 5:105-111. 33. Zellweger, T., Chi, K., Miyake, H., Adomat, H., Kiyama, S., Skov, K., and Gleave, M.E. 2002. Enhanced radiation sensitivity in prostate cancer by inhibition of the cell survival protein clusterin. Clin Cancer Res 8:3276-3284. 34. Gleave, M.E., Miyake, H., Zellweger, T., Chi, K., July, L., Nelson, C , and Rennie, P. 2001. Use of antisense oligonucleotides targeting the antiapoptotic gene, clusterin/testosterone-repressed prostate message 2, to enhance androgen sensitivity and chemosensitivity in prostate cancer. Urology 58:39-49. 35. Freeman, A.E., and Hoffman, R.M. 1986. In vivo-like growth of human tumors in vitro. Proc Natl Acad Sci USA 83:2694-2698. 36. Martikainen, P., and Isaacs, J.T. 1990. An organ culture system for the study of programmed cell death in the rat ventral prostate. Endocrinology 127:1268-1277. 37. Sandelin, A., Wasserman, W.W., and Lenhard, B. 2004. ConSite: web-based prediction of regulatory elements using cross-species comparison. Nucleic Acids Res 32.W249-252. 38. Zhu, N., Pewitt, E.B., Cai, X., Cohn, E.B., Lang, S., Chen, R., and Wang, Z. 1998. Calreticulin: an intracellular Ca++-binding protein abundantly expressed and regulated by androgen in prostatic epithelial cells. Endocrinology 139:4337-4344. 39. Pewitt, E.B., Haleem, R., and Wang, Z. 1999. Adrenomedullin gene is abundantly expressed and directly regulated by androgen in the rat ventral prostate. Endocrinology 140:2382-2386. 40. Beato, M., Herrlich, P., and Schultz, G. 1995. Steroid hormone receptors: many 167 actors in search of a plot. Cell 83:851-857. 41. Truss, M., and Beato, M. 1993. Steroid hormone receptors: Interaction with deoxyribonucleic acid and transcription factors. Endocrine Reviews 14:459-479. 42. Wong, P., Pineault, J . , Lakins, J . , Taillefer, D., Leger, J . , Wang, C , and Tenniswood, M. 1993. Genomic organization and expression of the rat TRPM-2 (clusterin) gene, a gene implicated in apoptosis. J Biol Chem 268:5021-5031. 43. Rosemblit, N., and Chen, C.L. 1994. Regulators for the rat clusterin gene: DNA methylation and cis-acting regulatory elements. J Mol Endocrinol 13:69-76. 44. Yeung, L.H., Read, J.T., Sorenson, P., Nelson, C.C., Jia, W., and Rennie, P.S. 2003. Identification and characterization of a prostate-specific androgen-independent protein-binding site in the probasin promoter. Biochem J 371:843-855. 45. Scheller, A., Hughes, E., Golden, K., and Robins, D. 1998. Multiple receptor domains interact to permit, or restrict, androgen-specific gene activation. J. Biol. Chem. 273:24216-24222. 46. Reid, K.J., Hendy, S.C., Saito, J . , Sorensen, P., and Nelson, C C . 2001. Two classes of androgen receptor elements mediate cooperativity through allosteric interactions. J Biol Chem 276:2943-2952. 47. Berchem, G.J., Bosseler, M., Sugars, L.Y., Voeller, H.J., Zeitlin, S., and Gelmann, E.P. 1995. Androgens induce resistance to bcl-2-mediated apoptosis in LNCaP prostate cancer cells. Cancer Res 55:735-738. 48. Leger, J . , Montpetit, M., and Tenniswood, M. 1987. Characterization and cloning of androgen-repressed mRNA's from rat ventral prostate. Biochem Biophys Res Commun 147:196-203. 49. Leger, J.G., Le Guellec, R., and Tenniswood, M.P. 1988. Treatment with antiandrogens induces an androgen-repressed gene in the rat ventral prostate. Prostate 13:131-142. 50. Rennie, P.S., Bruchovsky, N., Buttyan, R., Benson, M., and Cheng, H. 1988. Gene expression during the early phases of regression of the androgen-dependent Shionogi mouse mammary carcinoma. Cancer Res 48:6309-6312. 51. Kimura, K., Markowski, M., Bowen, C , and Gelmann, E. 2001. Androgen blocks Apoptosis of hormone-dependent prostate cancer cells. Cancer Res. 61:5611-5618. 52. Coffey, R.N., Watson, R.W., O'Neill, A.J., Mc Eleny, K., and Fitzpatrick, J .M. 2002. Androgen-mediated resistance to apoptosis. Prostate 53:300-309. 53. Carson, J.P., Kulik, G., and Weber, M.J. 1999. Antiapoptotic signaling in LNCaP prostate cancer cells: a survival signaling pathway independent of phosphatidylinositol 3'-kinase and Akt/protein kinase B. Cancer Res 59:1449-1453. 54. Michel, D., Chatelain, G., North, S., and Brun, G. 1997. Stress-induced transcription of the clusterin/apoJ gene. Biochem J 328 ( Pt 1):45-50. 168 55. Gutacker, C., Klock, G., Diel, P., and Koch-Brandt, C. 1999. Nerve growth factor and epidermal growth factor stimulate clusterin gene expression in PC12 cells. Biochem J 339 ( Pt 3):759-766. 56. Jin, G., and Howe, P.H. 1997. Regulation of clusterin gene expression by transforming growth factor beta. J Biol Chem 272:26620-26626. 57. Jin, G., and Howe, P.H. 1999. Transforming growth factor beta regulates clusterin gene expression via modulation of transcription factor c-Fos. EurJ Biochem 263:534-542. 58. Heikaus, S., Winterhager, E., Traub, O., and Grummer, R. 2002. Responsiveness of endometrial genes Connexin26, Connexin43, C3 and clusterin to primary estrogen, selective estrogen receptor modulators, phyto-and xenoestrogens. J Mol Endocrinol 29:239-249. 59. Waters, K.M., Safe, S., and Gaido, K.W. 2001. Differential gene expression in response to methoxychlor and estradiol through ERalpha, ERbeta, and AR in reproductive tissues of female mice. Toxicol Sci 63:47-56. 60. Wunsche, W., Tenniswood, M.P., Schneider, M.R., and Vollmer, G. 1998. Estrogenic regulation of clusterin mRNA in normal and malignant endometrial tissue. IntJ Cancer 76:684-688. 61. James, S.Y., Mackay, A.G., and Colston, K.W. 1996. Effects of 1,25 dihydroxyvitamin D3 and its analogues on induction of apoptosis in breast cancer cells. J Steroid Biochem Mol Biol 58:395-401. 62. Simboli-Campbell, M., Narvaez, C.J., Tenniswood, M., and Welsh, J . 1996. 1,25-Dihydroxyvitamin D3 induces morphological and biochemical markers of apoptosis in MCF-7 breast cancer cells. J Steroid Biochem Mol Biol 58:367-376. 63. Wong, P., Taillefer, D., Lakins, J . , Pineault, J . , Chader, G., and Tenniswood, M. 1994. Molecular characterization of human TRPM-2/clusterin, a gene associated with sperm maturation, apoptosis and neurodegeneration. EurJ Biochem 221:917-925. 64. Gleave, M.E., Hsieh, J.T., Wu, H.C., von Eschenbach, A.C., and Chung, L.W. 1992. Serum prostate specific antigen levels in mice bearing human prostate LNCaP tumors are determined by tumor volume and endocrine and growth factors. Cancer Res 52:1598-1605. 65. Ettinger, S.L., Sobel, R., Whitmore, T.G., Akbari, M., Bradley, D.R., Gleave, M.E., and Nelson, C C . 2004. Dysregulation of sterol response element-binding proteins and downstream effectors in prostate cancer during progression to androgen independence. Cancer Res 64:2212-2221. 66. Buchanan, G., Irvine, R.A., Coetzee, G.A., and Tilley, W.D. 2001. Contribution of the androgen receptor to prostate cancer predisposition and progression. Cancer Metastasis Rev 20:207-223. 67. Liao, X., Tang, S., Thrasher, J.B., Griebling, T .L , and Li, B. 2005. Small-interfering RNA-induced androgen receptor silencing leads to apoptotic cell death in prostate cancer. Mol Cancer Ther 4:505-515. 169 Gleave, M.E., Zellweger, T., Chi, K., Miyake, H., Kiyama, S., July, L, and Leung, S. 2002. Targeting anti-apoptotic genes upregulated by androgen withdrawal using antisense oligonucleotides to enhance androgen- and chemo-sensitivity in prostate cancer. Invest New Drugs 20:145-158. 170 Chapter 6 Discussion In this Ph.D. dissertation, I have described a microarray screen for androgen regulated genes in LNCaP cells and I have further characterized two important genes, GADD45G and clusterin. The following discussion will focus on the significance of the results, the technologies used and how they have helped achieve the results, the strengths and weaknesses of the research and future directions. 6.1 Microarray Technologies The microarray platform allows for a single experiment to test a large number of data points. In the work presented here I relied on several different types of microarrays, used either as screens or to validate previous studies. Having the ability to perform a single experiment that results in hundreds or thousands of data points is very powerful. One of the advantages to working at the Prostate Centre is that it houses an array printing facility which can generate the oligonucleotide, miRNA and antibody arrays, as well as a pathology lab which can generate the tissue microarrays. Having the arrays being produced in house makes them readily available for use in experiments. Since AR signaling is important to the development of prostate cancer and its progression to A l , it was of interest to determine which genes it regulates. Of particular interest were genes predicted to be involved in cell survival of prostate cancer cells as these may be potential therapeutic targets. Microarrays were chosen as the method to screen for androgen regulated genes. The advantages of using a microarray screen are the large number of genes that can be queried, the high throughput nature of the 171 technology and in-house printing of the slides makes the experiments relatively inexpensive (1). Since the microarray experiment presented here was performed, there have been several improvements to the technology. The oligonucleotide set used for this screen contained 13,971 individual oligos, while the newer set contains 21,000 individual oligos. As time continues, there will be larger oligo sets and theoretically, every gene in the human genome can be represented on a microarray. When one considers that many genes have multiple isoforms resulting from differential transcriptional start sites or differential splicing - one oligo per gene is not sufficient for a complete screen of mRNA expression. Using clusterin as an example, the two isoforms arising from different transcriptional start sites can have vastly different biological consequences. An interesting footnote here is that the oligo for clusterin recognizes both isoforms and we have not observed any changes in its expression in response to androgens in our array experiments, possibly because one isoform is repressed by androgens while the other is activated, cancelling out the measured response. One of the issues with the cDNA labeling is that there may be dye bias when the labeled nucleotides are incorporated by the reverse transcriptase into the cDNA strand (2). To normalize against dye bias, dye swap experiments were performed. To avoid the dye bias altogether, now we use a dendrimer kit from Genisphere in which the oligo used in the generation of the cDNA contains a capture sequence to which the dyes anneal to. In this way, there is no differential incorporation of the two dyes. 172 In the years since performing the microarray experiment, there have been numerous other array experiments performed in our lab with samples in the presence or absence of androgens. These experiments have confirmed the androgen regulation of the genes (GADD45G, MRP4, BARD1, NQ01 , etc) that I had found in my array experiment, which lends additional confidence in the results found here. Although mRNA microarray screen formed the basis of the research presented here, there were several other types of microarrays used. In Chapter 3, a tissue microarray (TMA) was used to show the expression of GADD45G in clinical samples. Although we use cell lines as models for prostate cancer, they are not necessarily representative of how a cancer acts in vivo. Biological diversity in the population can affect the genetic profile of a tumor, which in turn affects the biology of a particular tumor, such as its aggressiveness or how it responds to treatment. TMAs therefore offer a route to observe the expression of many patient samples with diverse genetic backgrounds. The TMAs can be stained for specific proteins, mRNAs, miRNAs or genes. In the TMA used in this study, the samples were taken from patients that had been treated with various durations of anti-hormone therapy and therefore a method of observing androgen regulated gene expression in tumors from a variety of patients. An antibody array was also used in Chapter 3 to determine which proteins are affected by GADD45G siRNA. While an mRNA microarray can give information about gene expression, the antibody array can give information about signaling pathways and protein expression in a given sample. The antibody array contained antibodies that recognize either a specific protein or phospho-protein and therefore can be used to look at phosphorylation cascades. This is important since these signaling cascades 173 often result in a change in the activity of a given protein through its phosphorylation status, with no change in total protein levels. Furthermore, there is often no change in mRNA levels of these signaling proteins and so there would be no change in expression observed in the mRNA arrays. The technology of antibody arrays is newer than the mRNA arrays and therefore is still undergoing the process optimization for the technical aspects. There is a host of different problems involved in the printing and hybridizing of the antibody slides in ' comparison to the oligonucleotide arrays. Antibodies are stored in a variety of different solutions and have different viscosities which cause them to have different binding properties to the slides. There is therefore more of a variation in spot morphology than is seen in oligonucleotide spots, which must be taken into consideration when analyzing the images. When working with antibodies in western blotting, there is usually optimization of the conditions used for the most effective binding of the antibody and the protein, and often different antibodies require different conditions. With antibody arrays, however, one set of hybridization conditions has to be used for all the antibodies on the array and therefore some antibodies will not be at their optimal conditions. The proteins are labeled directly with the dyes and we have observed a strong dye labeling bias, so it is very important that dye swaps are performed for each pair of samples probed. In Chapter 4, we found that although GADD45G mRNA was upregulated by androgens, the protein was actually downregulated. The lesson here was not to assume that the results seen in an mRNA array is automatically translated to protein expression. In many cases miRNAs affect protein translation without affecting mRNA 174 levels (3) and those effects would not be picked up if only an mRNA array was performed. Ideally mRNA arrays and antibody arrays would be probed in parallel to confirm both the RNA and protein changing. Unfortunately there is only a fraction of antibodies on the array in comparison to the mRNA arrays (approximately 600 versus 21,000). The synthesis and validation of oligonucleotides is much more rapid and consistent than for antibodies, and as a result, the antibody array is much smaller. For antibodies to be used for the array, they must first be validated to show that they do not bind any other proteins non-specifically and there is only one band seen on a western blot. Furthermore, there are many proteins for which no suitable antibody is commercially available. The antibody array is continually expanding as more antibodies become available and are validated. The final type of array performed for this work is a miRNA array. The miRNA arrays are short oligos which are complementary to miRNAs. Since miRNAs are often derived from mRNAs, you must be sure that only miRNAs are labeled and hybridized to the slides. Kits are commercially available which will separate small RNAs (< 200 nt) from the larger ones. This will contain some small RNAs, such as 5S RNA, pre-miRNAs and miRNAs. A fraction containing only the smaller, mature miRNAs (<40 nt) can be separated from the larger ones using SDS PAGE. The miRNAs are labeled by adding a polyA tail with modified nucleotides, to which dyes can bind. Since this is the newest of the array technologies used here, there are many issues that need to be addressed. There is not much known about what the normal expression profile of miRNAs is, and importantly, there are not any validated "housekeeping" miRNAs, whose expression is not expected to change under many conditions. Furthermore, 175 since there is a smaller number of oligos on the miRNA slides as compared to the mRNA slides, assumptions made when normalizing the data, such as the expression of most of the genes does not change, may not be necessarily be true. 6.2 siRNA Technology In Chapter 3, s iRNA was used to decrease the levels of GADD45G in order to determine downstream effects on various cell signaling pathways and in Chapter 2, siRNA was used to downregulate NFE2L2 to look at downstream gene expression. The advantages to siRNA are that they are commercially available, inexpensive and efficient. Many companies offer siRNAs targeting to a wide range of genes, with guaranteed results. There are however disadvantages to siRNAs. One is that although transfection of dsRNA can be readily performed in cell culture, administration of dsRNA in vivo elicits a strong cellular based immune response (4). Another disadvantage is that there are off-target effects of siRNAs, and since only a single siRNA was used for each target gene, there is a possibility that the effects observed are not due to specific siRNA effects. Off target effects occur when there is sufficient homology of the siRNA to genes other than the target genes and this can cause them to be downregulated (5, 6). Homology in the 5' end of the siRNA is the most important for effecting downregulation of off target transcripts (7), which is also the region which is important for miRNA binding to target transcripts. To control for off-target effects, several siRNAs targeted to different regions on the target genes should be tested. If all s iRNAs have the same effect, it is likely that the observed effect is specific. If only one or some of the siRNAs show the desired effect, then the observed effect is an off-target effect. 176 Negative control siRNA is used to correct for non-specific effects due to transfection of dsRNA into the cell. Our lab as well as others, has noted that certain genes are affected by the negative control siRNA. An example of this non-specific downregulation can be seen in Figure 3 .6A for p53. This is not a global effect, as it is only observed for certain genes and it appears to be irregardless of the sequence of the negative control siRNA used. Since Dicer recognizes dsRNA, we hypothesized that the non-specific siRNA effects are due to an activation of Dicer which causes an upregulation of miRNAs, with resulting effects on their targets. We have shown that dsRNA, and not ssRNA, ssDNA or dsDNA causes an induction of Dicer RNA and protein in a dose dependent manner (see Appendix 2). To determine which genes are affected by the negative control siRNA, we have performed mRNA and miRNA and plan to also run protein arrays. When the arrays are analyzed, we will try to determine if there is a global effect on miRNA generation and activity. These results provide a possible explanation for some of the non-specific effects observed in the siRNA experiments performed here, however many of the effects will only be seen at the protein level as miRNAs often inhibit translation. One important implication of this is that an observation that the negative control siRNA has a strong effect on a particular gene is suggestive that the gene either possesses a level of homology or is a target for miRNAs. 6.3 miRNA Technologies The existence of miRNAs was only recently described and as such, there is currently much interest in this field of study. Originally described in 1993 in C.elegans, it is now known that miRNAs are likely expressed in all eukaryotic cells (8). The 1 7 7 expression of miRNAs is important for post transcriptional gene regulation and also for cell survival (9). There are still many aspects of miRNA regulation and activity which are unknown. In the work presented here, I have shown a specific miRNA, hsa-miR-326, which acts on the GADD45G transcript to prevent its translation. Furthermore, I showed that this translational repression could be relieved in a stress situation, such as higher levels of taxol treatments. Since the field of miRNAs is relatively new, there are still many technologies which are in development. To show that hsa-miR-326 is upregulated with androgens, I used real time PCR. There are several different types of real time PCR that can be used to detect miRNAs, however the one used in this thesis from ABI is able to specifically detect the mature, active miRNA. This is important as other technologies, such as sybr green real time PCR, will detect the mature miRNA, as well as all of its inactive precursors. One of the difficulties with real time PCR for miRNAs mentioned earlier is that there are no known housekeeping miRNAs which can be used to normalize the real time PCR results. Since the ABI real time PCR only detects mature miRNAs, there is no need to purify miRNA from the total RNA. Therefore when running the miRNA reverse transcription reaction, a parallel reaction is run using random hexamers which I can then use to detect rRNA, which is the approach I took to normalize our real time PCRs for miRNA. In the future, we hope to identify a small RNA which can be used to normalize the real time PCRs. Another miRNA technology that was used in this work was to downregulate the miRNA using anti-miRs from Ambion. These are used to show that the effect observed 178 is a result of the specific miRNA. In our scenario, we used the anti-326-miR to show that hsa-miR-326 targets the GADD45G transcript. One of the issues in working with miRNAs is that they bind to the target mRNA transcripts with inexact matches, and there are therefore many predicted targets for each miRNA. The prediction algorithms are constantly being updated and refined and the databases of miRNA targets are still under development. The number of transcripts that are predicted to be bound by a single miRNA can number in the hundreds. At times, one miRNA has several predicted hits on a single mRNA transcript. We assume that the more predicted hits on a transcript, the more likely it is that the prediction is true and that the effect may be stronger, however this may not necessarily be true. Altering the expression of a miRNA, such as I have done in the anti-miR experiments should have a larger effect on gene expression than just the one gene that we were interested in. There will be a downregulation of many of the target mRNA as well as an inhibition of translation of others. Since the expression of mRNA is associated with the production of miRNAs, then we would expect to see far reaching results in which networks of mRNAs and miRNAs are affected. Currently we are probing microarrays (mRNA and miRNA arrays) with the RNA from cells treated with the anti-326-miR to determine if there is a network of genes and miRNAs that are affected by aberrant hsa-miR-326 expression. Furthermore, this will allow us to validate which of the miRNA databases is best at predicting miRNA targets, which will prove to be valuable in future miRNA experiment. There is a similar technology called pre-miRs, in which specific pre-miRs are transfected into cells to observe the effects of overexpressing a specific miRNA. This technology has been previously used to change the genetic profile of a cell. For 179 example, transfection of miR-124, which is preferentially expressed in brain, into other cell types will shift their mRNA expression profiles to be more like brain (10). To date, I am continuing the optimization process for the use of pre-miR technology and would expect that overexpression of hsa-miR-326 will result in decreased GADD45G expression, even in the absence of androgens. We have used anti-miRs to show that hsa-miR-326 affects GADD45G translation. There are techniques which can confirm binding of the miRNA to the transcript and affecting translation. One such technique is to use a luciferase reporter plasmid to which the putative binding region of the RNA can be cloned into the 3' UTR of the luciferase gene. A cotransfection of anti-miR or pre-miRs along with the luciferase vector is performed and the luciferase activity tested. If the cloned sequence is the target sequence for the miRNA, then the specific pre-miR or anti-miR will cause a decrease or increase respectively in the luciferase activity. We are currently testing such a reporter system for confirmation that hsa-miR-326 binds to the two regions within the GADD45G transcript, as well as for other miRNAs and their targets which are of interest. One of the exciting, new techniques being used in miRNA research is in situ hybridization in tissue samples. Since miRNAs are so small, an RNA probe itself will not have strong enough binding to be useful for in situ hybridization. Instead, an oligonucleotide containing a modified RNA molecule is used. The modification of choice is the locked nucleic acid (LNA). LNAs have a high affinity binding to RNA due to their higher melting temperature (11, 12). In the future we plan to probe patient tissues with LNAs specific to specific miRNAs. Initially the optimization will be done in 180 paraffin embedded LNCaP cell pellets which have been treated with or without androgens. Since we have confirmed that hsa-miR-326 is an androgen regulated miRNA, it will be used initially for the optimization. We will also use other miRNAs that have come up in our screen which have high levels in LNCaP cells and which are androgen regulated such as hsa-miR-198 and 337. The power of this technology is that patient samples, such at the NHT TMA, can be probed for miRNAs which may prove to be important in the progression of prostate cancer. If a particular miRNA is found to be upregulated in A l , then it may also be a potential target for therapeutics. In Chapter 4, I demonstrated that relief of the miRNA mediated translational inhibition could be achieved with taxol treatment. We do not currently understand through which mechanism taxol releases the mRNA to be translated. It is unlikely however that the GADD45G mRNA is uniquely released and it is possible that there are other transcripts with a similar function to GADD45G which undergo the same type of stress-induced regulation. To determine which transcripts are in the processing bodies in response to androgens, and which ones are released upon taxol treatment, we plan to immunoprecipitate proteins from the processing bodies and then perform microarrays in a procedure analogous to ChIP on chip. 6.4 GADD45G as a Therapeutic Target One of the genes of interest from the microarray screen was GADD45G, a protein involved in apoptosis and cell cycle progression. We showed the importance of GADD45G in cell viability and as a controller of important signaling pathways. Several pathways that are controlled by GADD45G have been shown to be important in prostate cancer progression to androgen independence and as such make good 181 therapeutic targets. One example is HSP27 - its levels are increased during progression to A l , and downregulation using antisense oligonucleotides (ASO) renders the cells more sensitive to chemotherapeutics (13). Therefore GADD45G may be a superior therapeutic agent as its downregulation will affect many important signaling pathways. A S O technology is currently being used as a therapeutic in clinical trials for cancer. Unmodified oligonucleotides have a very short half life in vivo, and therefore for clinical applications, ASOs must be chemically modified to increase their serum and tissue half lives (14). Several groups have found that targeting anti-apoptotic genes with modified ASOs in combination with chemotherapeutics delays progression of the cancer over chemotherapeutics alone (15). For Al prostate cancer, some of the targets currently being evaluated include clusterin, ribonucleotide reductase, HSP27, AR and an A S O that targets both IGFBP2 and IGFPB5 (15). We believe that GADD45G transcript will be a good therapeutic target and we will be testing ASOs directed at GADD45G for their ability to effect androgen dependent and androgen independent prostate cancer growth. Several different ASOs will be developed which target sequences along the length of the GADD45G transcript and tested for their efficacy in knocking down GADD45G protein. Previously, we have found that the ASOs that span the initiating ATG are the most successful at suppressing transcript levels. We have shown here that siRNA targeted to GADD45G can knockdown its levels and affect downstream pathways, however s iRNA is not amenable to in vivo work and therefore currently has limited capacity for therapeutics. The most effective ASO will be tested in vitro to 182 determine if it has similar effect on the signaling pathways as observed with the siRNA, as well as its effect on cell viability. These experiments will be performed in both the androgen dependent cell line, LNCaP, and the androgen independent cell line, PC3 and they will be done in conjunction with paclitaxel to determine if there is an additive effect of the two therapeutics. The most efficacious A S O will be tested in vivo in LNCaP and PC3 tumor xenografts. For the LNCaP tumor series, two sets of experiments will be performed. In the first, ASO will be administered with or without paclitaxel, in intact mice. The PSA and tumor volume will be followed to determine if GADD45G ASO is able to slow the androgen dependent growth of the tumors, and if there is increased efficacy in conjunction with taxol. In the second experiment, the tumors will be allowed to grow before the mice are castrated. The GADD45G ASO with or without taxol treatment, will be administered to the castrated mice. The PSA and tumor volumes will be tracked to determine if the GADD45G ASO is able to delay progression to A l . Finally, the GADD45G and taxol will be given to mice bearing PC3 tumors, which are not dependent on androgens for their growth, to determine if there is an effect on growth of Al tumors. 6.5 Clusterin as a Therapeutic Target Clusterin was originally thought to be downregulated by androgens due to its upregulation in rat prostate following castration (16). It was later shown that clusterin expression is linked to the apoptotic regression which occurs upon castration rather than due to direct action of the androgen receptor (17). It has recently been demonstrated that a splice variant in which exon 2 is removed results in the nuclear, 183 apoptotic form of clusterin protein, whereas in the absence of splicing, the anti-apoptotic form is expressed. For the first time, I have described the regulation of the two transcriptional forms of clusterin. The importance of the two isoforms is that Isoform 2 is incapable of generating the apoptotic splice variant and therefore is always anti-apoptotic. Full length Isoform 1 is anti-apoptotic, however it has the potential to be spliced into the apoptotic form. Much of the research that has been done with clusterin's involvement in prostate cancer has been purely with the Isoform 2. Clusterin has already proven an effective target for therapeutics using an A S O called OGX-011. Initial studies in mouse xenografts have shown that OGX-011 in combination with paclitaxel can delay progression to Al (18). Following the success of the xenograft experiments, OGX-011 was tested in Phase 1 clinical trials, in which the appropriate dosage was determined (19). The clinical trial also revealed that there was a decrease in clusterin expression in the tumor and only minor toxicity. OGX-011 is currently being tested in multi-centre phase II clinical trials across North America (19). OGX-011 is also being tested as a treatment for breast cancer and non-small cell lung cancer in addition to prostate cancer (20, 21). One important factor is that OGX-011 targets the start codon in exon 2. Studies in our lab have now demonstrated that in LNCaP cells, treatment with OGX-011 causes a decrease in clusterin protein, but it causes an induction of the splicing event in which exon 2 is removed (unpublished data). This type of ASO-mediated "exon skipping" has been previously described with the dystrophin gene (22). In the case of clusterin, treatment with OGX-011 therefore has two effects on the same gene - it 184 downregulates the anti-apoptotic form while inducing a splicing event to generate the apoptotic form, an ideal situation for therapeutic uses. 6.6 Androgen Regulated miRNAs In Chapter 4, hsa-miR-326 was originally found to be upregulated in response to androgens. There were many other miRNAs found to be both up and down regulated by androgens in the microarray. The question arises as to the mechanism by which these miRNAs are regulated by androgens. Undoubtedly, since some miRNAs are generated from mRNAs, androgen regulation of various genes will affect the levels of the miRNAs derived from those genes. We have however found an additional explanation as to how miRNAs are androgen regulated. In some mRNA arrays we have found that Dicer and two components of the RISC complex (Ago2 and FMR1) are upregulated with androgens, and this has been confirmed using real time PCR (Appendix 3). Since many of the components of the machinery which generates and aids in miRNA function are upregulated with androgens, there may be a global increase in miRNA processing from the genes being expressed that harbor miRNAs. This presents a potential problem when attempting to normalize the miRNA arrays in experiments in the presence or absence of androgens, as normalization often assumes that there are no global changes being made. While other nuclear receptors have been shown to directly repress target genes, the AR has not. It is therefore possible that many of the genes repressed by androgens are a result of androgen upregulation of miRNAs. Androgen regulated genes have been shown to be important for progression to A l , and therefore it is possible that the miRNA machinery and miRNAs themselves play a role in progression. A recent report 185 has indicated that Dicer is increased in clinical prostate cancer specimens and correlates with Gleason grade (23). It would therefore be of interest to determine if Dicer levels are increased in Al clinical samples. And perhaps Dicer itself could be a potential therapeutic target. Currently, we are using an siRNA to downregulate Dicer in LNCaP cells and then to screen for its effects using mRNA, miRNA and protein array microarrays. These results will be compared to the arrays of cells treated with or without androgens to find genes common to both experiments as these will be the genes whose androgen regulation is mediated through Dicer. There are several androgen regulated genes which are of interest to our lab which are possibly regulated by miRNAs. In Chapter 5, I demonstrated that the two isoforms of clusterin are differentially regulated by androgens - Isoform 1 is decreased and Isoform 2 is increased with androgens. The upregulation of Isoform 2 is a result of AR binding to AREs within the intron which is upstream of the transcriptional start site of Isoform 2. It is possible that the regulation of Isoform 1 repression is also mediated directly by the AR through this region. However another explanation is that there is a miRNA upregulated by androgens which targets the Isoform 1 transcript for degradation. Generally, miRNAs target the 3' UTRs of transcripts and the databases indicate that there are two possible 3' UTRs in the clusterin gene. There is however a lack of agreement between the databases as to which 3' UTR is associated with which isoform. We have found that the miRNA which are both androgen regulated and which target a 3'UTR of clusterin and efforts are being made to determine if these affect expression of either isoform. 186 It has long been known that there is a disconnection between the mRNA and protein levels of the AR gene in response to androgens. Androgen binding to the AR induces a stabilization of the protein and therefore with androgen treatment, the AR protein levels increase, however the AR mRNA levels decrease in response to androgens (24). We therefore hypothesize that there are miRNAs upregulated by androgens which can target the AR mRNA for degradation. Two androgen induced miRNAs, hsa-miR-337 and 29a, are predicted to target the AR 3'UTR. Finally, one of the miRNAs which we have shown to be repressed by androgens is hsa-miR-1, and it is predicted to target Dicer itself. It is possible that the androgen upregulation of Dicer is not direct, rather through the downregulation of a repressive miRNA. 6.7 Significance of the Research The hypothesis of this research was that AR regulated genes are important for the progression of prostate cancer to A l . In a microarray screen I have shown that there are androgen regulated genes which are involved in protection against oxidative stress, chemotherapeutic resistance and apoptosis. Further studies on GADD45G have demonstrated that it is a key regulator of intracellular signaling cascades which are important for progression to A l . We believe that GADD45G is an attractive target for therapeutics such as ASO to induce downregulation, and furthermore, it will be a superior therapeutic to some of the current targets as it will affect many important pathways that have been characterized to have a profound role in cancer. I have also described GADD45G as a target for translational inhibition by the miRNA hsa-miR-326. And importantly, the release of the translational inhibition by a stress such as taxol 187 treatment is suggesting of a novel mechanism of translational regulation in response to cellular stress. Clusterin has already been shown to be an effective therapeutic target, and here we demonstrate the differential regulation of its transcriptional isoforms by androgens. While Isoform 2 is anti-apoptotic, Isoform 1 has the capacity to produce an apoptotic splice variant. The differential regulation of two transcriptional isoforms of the same gene by androgens is a unique method of gene expression regulation and potentially has significant biological effects. 188 6.8 References 1. Pollock, J.D. 2002. Gene expression profiling: methodological challenges, results, and prospects for addiction research. Chem Phys Lipids 121:241-256. 2. Dobbin, K.K., Kawasaki, E.S., Petersen, D.W., and Simon, R.M. 2005. Characterizing dye bias in microarray experiments. Bioinformatics 21:2430-2437. 3. Engels, B.M., and Hutvagner, G. 2006. Principles and effects of microRNA-mediated post-transcriptional gene regulation. Oncogene 25:6163-6169. 4. Hexner, E.O., and Gewirtz, A.M. 2005. RNA interference for treating haematological malignancies. Expert Opin Biol Ther 5:1585-1592. 5. Snove, O., Jr., and Holen, T. 2004. Many commonly used s iRNAs risk off-target activity. Biochem Biophys Res Commun 319:256-263. 6. Jackson, A.L., and Linsley, P.S. 2004. Noise amidst the silence: off-target effects of siRNAs? Trends Genet 20:521-524. 7. Jackson, A.L., Burchard, J . , Schelter, J . , Chau, B.N., Cleary, M., Lim, L., and Linsley, P.S. 2006. Widespread siRNA "off-target" transcript silencing mediated by seed region sequence complementarity. Rna 12:1179-1187. 8. Ouellet, D.L., Perron, M.P., Gobeil, L.A., Plante, P., and Provost, P. 2006. MicroRNAs in Gene Regulation: When the Smallest Governs It All. J Blomed Biotechnol 2006:69616. 9. Leaman, D., Chen, P.Y., Fak, J . , Yalcin, A., Pearce, M., Unnerstall, U., Marks, D.S., Sander, C , Tuschl, T., and Gaul, U. 2005. Antisense-mediated depletion reveals essential and specific functions of microRNAs in Drosophila development. Cell 121:1097-1108. 10. Lim, LP . , Lau, N.C., Garrett-Engele, P., Grimson, A., Schelter, J .M., Castle, J . , Bartel, D.P., Linsley, P.S., and Johnson, J .M. 2005. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433:769-773. 11. Kloosterman, W.P., Wienholds, E., de Bruijn, E., Kauppinen, S., and Plasterk, R.H. 2006. In situ detection of miRNAs in animal embryos using LNA-modified oligonucleotide probes. Nat Methods 3:27-29. 12. McTigue, P.M., Peterson, R.J., and Kahn, J.D. 2004. Sequence-dependent thermodynamic parameters for locked nucleic acid (LNA)-DNA duplex formation. Biochemistry 43:5388-5405. 13. Rocchi, P., So, A., Kojima, S., Signaevsky, M., Beraldi, E., Fazli, L., Hurtado-Coll, A., Yamanaka, K., and Gleave, M. 2004. Heat shock protein 27 increases after androgen ablation and plays a cytoprotective role in hormone-refractory prostate cancer. Cancer Res 64:6595-6602. 14. Urban, E., and Noe, C.R. 2003. Structural modifications of antisense oligonucleotides. Farmaco 58:243-258. 15. Gleave, M.E., and Monia, B.P. 2005. Antisense therapy for cancer. Nat Rev Cancer 5:468-479. 16. Bettuzzi, S., Hiipakka, R.A., Gilna, P., and Liao, S T . 1989. Identification of an androgen-repressed mRNA in rat ventral prostate as coding for sulphated 189 glycoprotein 2 by cDNA cloning and sequence analysis. Biochem J 257:293-296. 17. Miyake, H., Nelson, C , Rennie, P.S., and Gleave, M.E. 2000. Testosterone-repressed prostate message-2 is an antiapoptotic gene involved in progression to androgen independence in prostate cancer. Cancer Res 60:170-176. 18. Gleave, M.E., Miyake, H., Zellweger, T., Chi, K., July, L, Nelson, C , and Rennie, P. 2001. Use of antisense oligonucleotides targeting the antiapoptotic gene, clusterin/testosterone-repressed prostate message 2, to enhance androgen sensitivity and chemosensitivity in prostate cancer. Urology 58:39-49. 19. Chi, K.N., Eisenhauer, E., Fazli, L, Jones, E .C, Goldenberg, S.L., Powers, J . , Tu, D., and Gleave, M.E. 2005. A phase I pharmacokinetic and pharmacodynamic study of OGX-011, a 2'-methoxyethyl antisense oligonucleotide to clusterin, in patients with localized prostate cancer. J Natl Cancer Inst 97:1287-1296. 20. Cao, C , Shinohara, E.T., Li, H., Niermann, K.J., Kim, K.W., Sekhar, K.R., Gleave, M., Freeman, M., and Lu, B. 2005. Clusterin as a therapeutic target for radiation sensitization in a lung cancer model. Int J Radiat Oncol Biol Phys 63:1228-1236. 21. So, A., Sinnemann, S., Huntsman, D., Fazli, L., and Gleave, M. 2005. Knockdown of the cytoprotective chaperone, clusterin, chemosensitizes human breast cancer cells both in vitro and in vivo. Mol Cancer Ther 4:1837-1849. 22. Wilton, S.D., and Fletcher, S. 2006. Redirecting splicing to address dystrophin mutations: molecular by-pass surgery. Prog Mol Subcell Biol 44:161 -197. 23. Chiosea, S., Jelezcova, E., Chandran, U., Acquafondata, M., McHale, T., Sobol, R.W., and Dhir, R. 2006. Up-Regulation of Dicer, a Component of the MicroRNA Machinery, in Prostate Adenocarcinoma. Am J Pathol 169:1812-1820. 24. Yeap, B.B., Krueger, R.G., and Leedman, P.J. 1999. Differential posttranscriptional regulation of androgen receptor gene expression by androgen in prostate and breast cancer cells. Endocrinology 140:3282-3291. 190 Appendix 1 Up and Down Regulated Genes in LNCaP cells Table 1 Genes upregulated 2 fold or more in all three timepoints in LNCaP cells treated with 1 nM R1881 fold change Systematic name 24 h 48 h 72 h D87953AN-myc downstream regulated 7.8157 3.0278 2.3363 L10333Areticulon 1 3.0000 2.4015 5.2750 L29008Asorbitol dehydrogenase 5.8932 9.5433 9.3026 D25215 Ahect domain and RLD 3 3.3018 5.5719 4.6763 D29954 AKIAA0056 protein 3.4392 3.5657 4.4549 D49490 Afor protein disulfide isomerase-related 2.3810 2.3621 2.7670 NM 001963Aepidermal growth factor (beta-urogastrone) 3.6884 2.8831 2.1813 NM 004024Aactivating transcription factor 3 2.2020 2.1966 2.4475 NM 004917Akallikrein 4 (prostase_ enamel matrix_ prostate) 2.4035 2.9920 2.2891 M14200 Adiazepam binding inhibitor (GABA receptor modulator_ acyl-Coenzyme A binding protein) 7.1542 8.0397 6.5073 M26326Akeratin 18 4.8661 5.0702 3.7424 AL117666 A DKFZP58601624 protein 6.1944 2.8524 2.0481 AL122098 AHomo sapiens mRNA; cDNA DKFZp434B1517 (from clone DKFZp434B1517); partial eds 8.6332 14.7893 6.9326 AL133645 AHomo sapiens mRNA; cDNA DKFZp434C107 (from clone DKFZp434C107) 9.9519 8.7515 8.7053 AL050290Aspermidine/spermine N1-acetyltransferase 4.6435 6.9221 5.3311 AL080081 ADKFZP564F1862 protein 2.8750 2.4420 3.4736 AL117441 ADKFZP434N126 protein 6.2318 5.4747 4.2391 D00726Aferrochelatase (protoporphyria) 2.0161 2.4827 3.2846 D13643 AKIAA0018 gene product 2.6577 6.1148 6.2507 NM 001634AS-adenosylmethionine decarboxylase 1 2.5043 3.1151 3.6689 AL137316 AHomo sapiens mRNA; cDNA DKFZp727K101 (from clone DKFZp727K101); partial eds 2.4469 2.1219 2.0200 AL137506 AHomo sapiens mRNA; cDNA DKFZp761O031 (from clone DKFZp761O031); partial eds 4.7801 5.6018 6.2182 X16277Aornithine decarboxylase 1 14.9929 14.1679 8.8503 X57985 AH2B histone family member Q 2.5449 2.0725 2.1415 X59766Aalpha-2-glycoprotein 1 zinc 3.2161 4.2948 4.7022 U96876Ainsulin induced gene 1 2.2391 4.6356 4.7087 X07730Akallikrein 3 (prostate specific antigen) 5.3092 10.9480 6.5156 X12433Aputative transmembrane protein 2.3120 2.2656 2.0008 X74929Akeratin 8 7.2090 9.9197 9.0647 Z11793Aselenoprotein P plasma 1 2.5720 3.7181 2.9641 Z83821 AHuman DNA sequence from PAC 296K21 on chromosome X contains cytokeratin exon_ delta-aminolevulinate 10.4102 6.3946 5.6510 X62250 Aglycine N-methyltransferase 3.7640 11.2933 15.8443 X66276Amyosin-binding protein C _ slow-type 3.2209 3.3705 2.1704 NM 013451Afer-1 (C. elegans)-like 3 2.1002 2.1264 2.0402 NM 014182 A HSPC160 proteinA(PRHU04-C1-0145-BG013-001-F-3) 2.2617 2.4051 2.0547 NM 016336 AUbc6p homolog 2.9129 2.6988 3.9459 191 AL137663 AHomo sapiens mRNA; cDNA DKFZp434G227 (from clone DKFZp434G227) 2.0615 2.1278 2.3906 NM 006117Aperoxisomal D3 D2-enoyl-CoA isomerase 4.4613 6.4352 5.5698 NM 006705Agrowth arrest and DNA-damage-inducible_ gamma 2.0955 2.1238 4.1831 U75329Atransmembrane protease serine 2 4.3932 4.4143 3.9383 U95006 AHuman D9 splice variant B mRNA_ complete eds 2.5058 2.8302 2.0416 X69141Afarnesyl-diphosphate farnesyltransferase 1 2.9577 3.9782 5.3289 U07919 Aaldehyde dehydrogenase 6 3.0105 3.2433 3.5272 U29344Afatty acid synthase 3.7979 5.2795 4.9704 AF052107 A Homo sapiens clone 23620 mRNA sequence 2.1428 4.9861 7.8038 AF054184 ASec61 gamma 2.3664 2.7279 2.6111 AF055001 AKIAA0025 gene product; MMS-inducible gene 2.3334 2.2161 2.1205 AC004839 A Homo sapiens PAC clone DJ0593H12 from 7p31 2.7503 3.1736 3.9210 AD001528 Aspermine synthase 10.6894 16.2068 14.1001 AF014403 APhosphatidic acid phosphatase type 2a 4.7198 3.9685 4.4351 AF099989 ASte-20 related kinase 3.6608 20.8987 13.0956 AF126799Adelta-6 fatty acid desaturase 4.0233 7.6111 8.8959 AJ000512Aserum/glucocorticoid regulated kinase 7.1648 3.7618 2.2913 AF055376 Av-maf musculoaponeurotic fibrosarcoma (avian) oncogene homolog 2.2479 2.4565 4.8151 AF071202 AATP-binding cassette_ sub-family C (CFTR/MRP)_ member 4 4.9248 2.1632 4.0440 AB015019ABAI1-associated protein 2 2.3793 3.5545 2.3388 AB020637 AKIAA0830 protein 3.3244 3.9864 4.5000 AB020676 AKIAA0869 protein 3.0711 3.0836 2.4950 AB000584 Aprostate differentiation factor 2.1257 3.2913 4.2328 AB011004AUDP-N-acteylglucosamine pyrophosphorylase 1; Sperm associated antigen 2 2.2021 4.6392 4.4409 AB013818 Aperoxisome biogenesis factor 10 2.0424 3.4418 4.9182 AB033091 AHomo sapiens mRNA for KIAA1265 protein_ partial eds 2.2961 3.2413 3.6998 AC004770Ahypothetical protein of unknown function 7.0639 3.8507 3.3037 AF071538 Aprostate epithelium-specific Ets transcription factor 4.0731 4.4714 6.8104 AB022427Astress-associated endoplasmic reticulum protein 1; ribosome associated membrane protein 4 2.4164 2.6428 2.6271 AB029020 AKIAA1097 protein 2.4427 2.5575 2.0160 AL022718 Aodz (odd Oz/ten-m Drosophila) homolog 1 2.9898 4.8391 2.6735 AL031903 AHuman DNA sequence from clone 1032F13 on chromosome Xq25-26.3. Contains a pseudogene similar to Kera 5.6769 5.7791 5.1300 AL034348 AHuman DNA sequence from clone 84D21 on chromosome 6q15-16.3 Contains keratin pseudogene STSs GSSs 2.7164 3.2369 2.7366 AK002126Ahypothetical protein FLJ11264 5.7388 5.0442 4.6329 AL022068 AHuman DNA sequence from clone 167F1 on chromosome 6p22.1-22.3. Contains a KRT18 (Keratin type 1 Cyt 4.6585 6.0953 6.0164 AL022333 AHuman DNA sequence from clone 474112 on chromosome 22q13.1-13.2 Contains cytokeratin 18 pseudogene_ 5.3007 5.0477 4.7294 AL035541 AHuman DNA sequence from clone 718J7 on chromosome 20q13.31-13.33. Contains part of a gene for a nove 3.2018 2.5451 2.6759 AL049977 AHomo sapiens mRNA; cDNA DKFZp564C122 (from clone DKFZp564C122) 2.6391 3.8932 7.4466 U42031AFK506-binding protein 5 11.0591 22.9359 8.7910 AL034374 AHomo sapiens clone 23904 mRNA sequence 3.1607 3.5734 3.0928 AL034417 A Gene 33/Mig-6 7.5504 3.4729 2.3963 AK000631 hypothetical protein FLJ20624 11.0973 5.0587 13.8855 AK000759Ahypothetical protein 3.0388 2.4025 2.2417 AK000860 AHomo sapiens cDNA FLJ20853 fis clone ADKA01365 highly similar to C O R O BOVIN CORONIN-LIKE PROTEIN P 3.1407 2.6732 2.0382 AB033062 ADKFZP434N178 protein 2.7455 3.0881 3.4528 AJ001017 ATBP-associated factor 172 2.8317 2.3756 2.0267 AJ002744AUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 2.2809 2.0775 2.4402 AK001700 Aamino acid transporter 2 2.5112 2.6650 2.2155 AK002107 AHomo sapiens cDNA FLJ11245 fis clone PLACE1008629 2.4268 3.5065 4.3835 AL035304 ADKFZP564B167 protein 3.4655 5.2943 5.4234 AK001212Ahypothetical protein FLJ10350 4.4439 2.4538 2.2774 AK001471Afatty-acid-Coenzyme A ligase_ long-chain 3 6.8060 6.5100 5.0990 AK001478 AHomo sapiens cDNA FLJ10616 fis_ clone NT2RP2005453 17.8659 14.0492 10.3717 Table 2 Genes downregulated 3 fold or more in all three timepoints in LNCaP cells treated with 1 nM R1881 fold change Systematic name 24 h 48 h 72 h M62840Aacyloxyacyl hydrolase (neutrophil) 0.2845 0.2666 0.1615 M76180 Adopa decarboxylase (aromatic L-amino acid decarboxylase) 0.1135 0.0257 0.0692 L48728 AHomo sapiens T cell receptor beta (TCRBV10S1) gene_ complete eds 0.2147 0.0442 0.1090 M36821 A GR03 oncogene 0.3067 0.1023 0.1510 NM 012133 Acoatomer protein complex_ subunit gamma 2 0.1697 0.3074 0.3083 NM 012275Ainterleukin-1 receptor antagonist homolog 1 0.2197 0.2412 0.2505 NM 006063 Asarcomeric muscle protein 0.1589 0.1376 0.1533 NM_006144 Agranzyme A (granzyme 1_ cytotoxic T-lymphocyte-associated serine esterase 3) 0.3145 0.2050 0.2005 AL137688 Acopine VI (neuronal) 0.1201 0.1549 0.0783 AL161979 AHomo sapiens mRNA; cDNA DKFZp761G1823 (from clone DKFZp761G1823) 0.1673 0.1089 0.3080 AL137507 AHomo sapiens mRNA; cDNA DKFZp761P211 (from clone DKFZp761P211) 0.1315 0.2734 0.2779 AL137654 AHomo sapiens mRNA; cDNA DKFZp434C0814 (from clone DKFZp434C0814) 0.0965 0.2427 0.0480 D86962Agrowth factor receptor-bound protein 10 0.2759 0.1934 0.2112 L25664 AHuman interferon mRNA_ complete eds 0.2076 0.2639 0.2942 D70830 Adouble C2-like domains beta 0.1428 0.0535 0.2684 D86407Aapolipoprotein E receptor 2 0.1987 0.1304 0.0808 U67784 AHuman orphan G protein-coupled receptor (RDC1) mRNA_ partial eds 0.1290 0.0224 0.1132 193 U76638 ABRCA1 associated RING domain 1 0.2314 0.1716 0.1839 U43843ANeuro-d4 (rat) homolog 0.1297 0.2880 0.0724 U59209 A UDP glycosytransferase 2 family_ polypeptide B17 0.1789 0.1471 0.1283 X02761Afibronectin 1 0.3202 0.1550 0.2089 Y00636 A CD58 antigen_ (lymphocyte function-associated antigen 3) 0.3016 0.1283 0.3219 U79248 AHuman clone 23826 mRNA sequence 0.3172 0.1980 0.1470 X02330Acalcitonin/calcitonin-related polypeptide_ alpha 0.3297 0.3037 0.1067 S68805 Aglycine amidinotransferase (L-arginine:glycine amidinotransferase) 0.0794 0.0329 0.0952 S73591Aupregulated by 1_25-dihydroxyvitamin D-3 0.2243 0.2292 0.2452 NM_013261 Aperoxisome proliferative activated receptor_ gamma_ coactivator 1 0.0199 0.1097 0.2196 NM 015980 AHMP19 protein 0.3117 0.2813 0.1985 U38545 Aphospholipase D1_ phophatidylcholine-specific 0.2036 0.2454 0.1693 U38805 Aa disintegrin and metalloproteinase domain 2 (fertilin beta) 0.3001 0.2836 0.3080 U03877AEGF-containing fibulin-like extracellular matrix protein 1 0.2260 0.0100 0.1857 U24578 Acomplement component 4B 0.2431 0.2375 0.2146 AF039555Avisinin-like 1 0.1098 0.2116 0.0621 AF090099 A Homo sapiens clone IMAGE 21721 0.0479 0.0638 0.3202 AF035315 A Homo sapiens clone 23664 and 23905 mRNA sequence 0.1561 0.1219 0.1503 AF038963 A RNA helicase 0.2295 0.1265 0.1618 AF134160 Aclaudin 1 0.3128 0.3144 0.2025 AF134891 Anuclear factor (erythroid-derived 2)-like 3 0.1573 0.0815 0.1691 AF131740 A Homo sapiens mRNA; cDNA DKFZp434L1021 (from clone DKFZp434L1021); partial eds 0.1768 0.2785 0.0650 AF131838 A Homo sapiens clone 25107 mRNA sequence 0.1449 0.0869 0.0649 AB011538 Aslit (Drosophila) homolog 3 0.1664 0.2013 0.2546 AB013924 Asimilarto lysosome-associated membrane glycoprotein 0.1347 0.2749 0.2485 AB007865Afibronectin leucine rich transmembrane protein 2 0.1920 0.2854 0.2876 AB007872 Azinc finger protein 264 0.1205 0.0439 0.1300 AB023227 AKIAA1010 protein 0.1213 0.2418 0.3208 AB026187Aprotocadherin 11 0.2950 0.2060 0.3145 AB020631 AKIAA0824 protein 0.0702 0.3095 0.3290 AB023165 AKIAA0948 protein 0.2913 0.1208 0.2389 AL050281 A DKFZP586G1219 protein 0.1054 0.2997 0.3279 AL117435 ADKFZP434I216 protein 0.2289 0.1516 0.0473 AL050020 A DKFZP564C196 protein 0.2592 0.0100 0.2108 AL050078 AHomo sapiens cDNA FLJ10784 fis_ clone ' NT2RP4000448 highly similar to Homo sapiens mRNA; cDNA DKFZp5 0.3272 0.0738 0.2284 AL133415 A DNA (cytosine-5-)-methyltransferase 2 0.2807 0.3045 0.1614 AL137291 hypothetical protein FLJ 10357 0.0882 0.2918 0.1044 AL117557 A DKFZP564D177 protein 0.2146 0.0697 0.1590 AL133013 Achimerin (chimaerin) 2 0.2320 0.1525 0.0100 AJ389983 AHomo sapiens partial TCR beta gene for T cell receptor beta chain variable region_ germinal center 3 0.1061 0.1525 0.0886 AK000885 AHomo sapiens cDNA FLJ 10023 fis clone HEMBA1000608 moderately similar to HYPOTHETICAL PROTEIN KIAA0 0.3109 0.2564 0.0910 AJ000730Asolute carrier family 7 (cationic amino acid transporter 0.0541 0.1154 0.1893 194 y+ system)_ member 4 AJ251847 AHomo sapiens partial CHI3L1 gene for cartilage glycoprotein-39_ exons 10-13 0.1929 0.0100 0.2454 AL035122 Asoluble adenylyl cyclase 0.1855 0.3300 0.0224 AL049270 AHomo sapiens mRNA; cDNA DKFZp564G223 (from clone DKFZp564G223) 0.1304 0.2658 0.1508 AK002137Ahypothetical protein FLJ11275 0.1635 0.1343 0.1278 AK002160 AHomo sapiens cDNA FLJ11298 fis clone P LACE 1009794 0.2536 0.2236 0.0747 Y10601Aankyrin-like with transmembrane domains 1 0.1855 0.3046 0.3209 195 Appendix 2 Effect of dsRNA on Dicer Levels LO Neg si ctrl si premir anti mir scr pt pBS pcdna3.1 dsRNA ssRNA ssDNA dsDNA (plasmid) Figure A P 2 . 1 Dicer mRNA levels are increased with transfection of dsRNA. LNCaP cells were transfected with 50 nM of various negative control dsRNA, ssRNA or ssDNA, or 0.2ug plasmid DNA. The resulting RNA was used for real time PCR to detect Dicer levels. An asterix denotes p-value < 0.05 (Student's t-test). LO = lipofectamine 200; Neg si = Ambion negative control siRNA; ctrl = qiagen negative control siRNA; pre-mir = negative pre-mir RNA; anti-mir = negative control anti-mir; scr pt = scramble phosphothioate antisense oligonucleotide; pBS = pBlueScript empty vector; pcdna 3.1 = pcDNA 3.1 empty vector 196 Figure A P 2.2 Dicer protein levels are increased with transfection of dsRNA. LNCaP cells were transfected with 50 nM of various negative control dsRNA, ssRNA or ssDNA, or 0.2ug plasmid DNA. The resulting protein was used in Western blotting. (3-tubulin is shown as a loading control. LO = lipofectamine 200; Neg si = Ambion negative control siRNA; ctrl = qiagen negative control siRNA; pre-mir = negative pre-mir RNA; anti-mir = negative control anti-mir; scr pt = scramble phosphothioate antisense oligonucleotide; pBS = pBlueScript empty vector; pcdna 3.1 = pcDNA 3.1 empty vector 10 25 50 Cone siRNA (nM) Figure A P 2.3 Dicer mRNA levels increase in a dose responsive manner with transfection of dsRNA. LNCaP cells were transfected with various concentrations of Ambion negative control siRNA. The RNA was used in real time PCR for Dicer. 197 Appendix 3. Androgen Regulation of miRNA Processing Machinery EtOH R1881 Figure A P 3.1 Dicer mRNA levels increase with androgen treatment. LNCaP cells were treated with 1 nM R1881 for 48 hours. RNA was harvested and used for real time PCR to detect Dicer mRNA. Asterisk indicates p-value < 0.01 (Student's t-test). — 1 EtOH R1881 Figure A P 3.2 Ago2 mRNA levels increase with androgen treatment. LNCaP cells were treated with 1 nM R1881 for 48 hours. RNA was harvested and used for real time PCR to detect Ago2 mRNA. Asterisk indicates p-value < 0.01 (Student's t-test). 198 EtOH R1881 Figure A P 3.3 FMR1 mRNA levels increase with androgen treatment. LNCaP cells were treated with 1 nM R1881 for 48 hours. RNA was harvested and used for real time PCR to detect FMR1 mRNA. Asterisk indicates p-value < 0.01 (Student's t-test). 199 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0100342/manifest

Comment

Related Items