UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Human placentation : the characterization of novel molecular mechanisms involved in trophoblast invasion Beristain, Alexander Guillermo 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-266823.pdf [ 19.44MB ]
Metadata
JSON: 831-1.0100328.json
JSON-LD: 831-1.0100328-ld.json
RDF/XML (Pretty): 831-1.0100328-rdf.xml
RDF/JSON: 831-1.0100328-rdf.json
Turtle: 831-1.0100328-turtle.txt
N-Triples: 831-1.0100328-rdf-ntriples.txt
Original Record: 831-1.0100328-source.json
Full Text
831-1.0100328-fulltext.txt
Citation
831-1.0100328.ris

Full Text

H U M A N P L A C E N T A T I O N : T H E C H A R A C T E R I Z A T I O N OF N O V E L M O L E C U L A R M E C H A N I S M S I N V O L V E D I N T R O P H O B L A S T I N V A S I O N by Alexander Guillermo Beristain B.Sc. , The University of British Columbia, 2001 A THESIS S U B M I T T E D I N P A R T I A L F U L L F I L L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF D O C T O R OF P H I L O S O P H Y in The Faculty of Graduate Studies (Reproductive and Developmental Sciences) T H E U N I V E R S I T Y OF B R I T I S H C O L U M B I A March 2007 © Alexander Guillermo Beristain, 2007 ABSTRACT For normal human placental development to occur, cytotrophoblasts located within implanting chorionic v i l l i , differentiate into extravillous cytotrophoblasts that invade into and remodel the maternal stroma and blood vasculature. Extravillous cytotrophoblast invasion is in part regulated by proteolytic and cell-extracellular matrix adhesion mechanisms that have also been shown to play key roles in regulating cancer cell invasion. Trophoblast invasion has therefore been likened to cancer cell invasion, however, unlike tumorigenesis, trophoblast invasion is highly regulated. A D A M T S , a novel gene family of metalloproteinases, have been shown to play important roles in regulating extracellular matrix remodeling events in both physiological and pathological processes. In addition to extracellular matrix remodeling, A D A M T S have the ability to regulate cell-extracellular matrix adhesion, highlighting the possibility that these proteins perform multifunctional roles. To determine whether members of the A D A M T S family play key roles in early placentation, I have characterized the expression of members of this gene family in first trimester placental chorionic v i l l i and in subpopulations of trophoblastic cells. I determined that A D A M T S - 1 2 is expressed in first trimester chorionic villous tissues, and furthermore is preferentially expressed in highly invasive extravillous cytotrophoblasts. Uti l iz ing loss-of and gain-of function studies, I demonstrated that A D A M T S - 1 2 plays a functional role in promoting an invasive phenotype in human trophoblastic cells through a mechanism independent of its proteolyic activity. A s cell invasion is also regulated by changes in cell-cell adhesion, I examined the roles that the classical/type-I cadherins, E-cadherin and N-cadherin, play in controlling trophoblast invasion. I determined that E-cadherin and N-cadherin are differentially i i expressed between poorly-invasive and highly-invasive trophoblastic cells. Additionally, I demonstrated that E-cadherin inhibits trophoblast invasion in a cell adhesion dependent manner, whereas N-cadherin promoted an invasive phenotype through a mechanism dependent upon its extracellular domain. Collectively, these studies describe novel molecular mechanisms that regulate human trophoblast invasion in vitro. These studies are the first to describe a role for N -cadherin in promoting an invasive phenotype in trophoblastic cells, and are the first to describe a role for A D A M T S - 1 2 in regulating cellular invasion. Additionally, these findings shed insight into the cellular mechanisms that regulate cytotrophoblast differentiation along the extravillous cytotrophoblast pathway. 111 TABLE OF CONTENTS A B S T R A C T i i T A B L E OF C O N T E N T S iv LIST OF T A B L E S v i i LIST OF F I G U R E S v i i i L I S T OF A B B R E V I A T I O N S x i i A C K N O W L E D G M E N T S xv C O - A U T H O R S H I P S T A T E M E N T xvi C H A P T E R 1 O V E R V I E W 1 1.1 Introduction 1 1.2 Human implantation and placentation 3 1.2.1 Placental development and trophoblast differentiation in vivo 3 1.2.2 Animal models used in studying human placentation 9 12.2-A Non-human primate models 10 1.2.2- B Rodent models 11 1.2.3 Models of trophoblast differentiation 12 1.2.3- A Vil lous cytotrophoblast cells isolated from human term placentae 13 1.2.3-B Transformed choriocarcinoma cell lines ...13 1.2.3-C Extravillous cytotrophoblasts propagated from human first trimester chorionic villous explants 14 1.3 Trophoblast invasion: A process that utilizes cellular processes similar to those involved in cancer cell invasion 16 1.3.1 Extracellular matrix degradation: proteinases and their inhibitors 16 1.3.1 - A Plasminogen activators and their inhibitors 17 1.3.1 -B Matrix metalloproteinases and their inhibitors 19 iv 1.3.2 Cell-extracellular matrix interactions 24 1.3.3 Extracellular matrix composition: Regulation of c e l l - E C M interactions and proteolysis 29 1.3.4 Cell-cell interactions 31 1.4 The A D A M T S gene family of metalloproteinases 35 1.4.1 Characterization and structure of the A D A M T S Metalloproteinases 36 1.4.2 A D A M T S expression and biological function 40 1.4.3 Regulation of A D A M T S expression and function 44 1.4.4 A D A M T S and cancer 48 1.4.5 A D A M T S and implantation 50 1.5 The classical/type-I cadherin gene superfamily of C A M s : Regulators of cell phenotype 51 1.5.1 Characterization and structure of classical/type-I cadherins 52 1.5.2 Classical/type-I cadherin-catenin interactions 56 1.5.3 Classical/type-I cadherin expression and function 59 1.5.3-A Classical/type-I cadherins and tissue morphogenesis 59 1.5.3-B Classical/type-I cadherins and cancer 62 1.6 Hypothesis and rationale 66 1.7 B I B L I O G R A P H Y 68 C H A P T E R 2 C H A R A C T E R I S A T I O N OF A D A M T S M E T A L L O P R O T E I N A S E S I N T H E H U M A N FIRST T R I M E S T E R P L A C E N T A A N D M O N O N U L C E A R T R O P H O B L A S T I C C E L L S I l l 2.1 Preface I l l 2.2 Regulated expression of A D A M T S - 1 2 in human trophoblastic cells: A role for A D A M T S - 1 2 in epithelial cell invasion? 113 v 2.3 References 171 C H A P T E R 3 C H A R A C T E R I Z I N G T H E M O L E C U L A R M E C H A N I S M S I N V O L V E D IN A D A M T S - 1 2 -M E D I A T E D C E L L I N V A S I O N 178 3.1 Preface 178 3.2 A D A M T S - 1 2 promotes an invasive phenotype in trophoblastic cells by upregulating ctvP3 integrin expression and function 179 3.3 References 218 C H A P T E R 4 C A D H E R I N - M E D I A T E D R E G U L A T I O N OF H U M A N T R O P H O B L A S T I C C E L L I N V A S I O N 223 4.1 Preface 223 4.2 N-cadherin promotes an invasive phenotype in human trophoblastic cells in vitro 225 4.3 References 294 C H A P T E R 5 G E N E R A L D I S C U S S I O N , S U M M A R Y A N D C O N C L U S I O N S 298 5.1 General Discussion 298 5.1 - A Functional domains of A D A M T S in regulating cellular phenotype 301 5.1-B Cadherins as regulators of cell invasion 305 5.2 Summary and conclusions 213 5.3 B I B L I O G R A P H Y 315 vi L I S T O F T A B L E S Table 2.2.1 Primer sequences and P C R conditions for the semiquantitative analysis of m R N A levels for A D A M T S subtypes in human placental tissue and trophoblastic cells 170 Table 3.2.1 Primer sequences and P C R conditions for the semiquantitative analysis of m R N A levels for A D A M T S - 1 2 and integrin subtypes 217 Table 4.2.1 Primer sequences and P C R conditions for the semiquantitative analysis of m R N A levels for N - and E-cadherin 293 vn L I S T O F F I G U R E S Figure 1.1 Schematic representation of the cytotrophoblast differentiating pathways: Vil lous cytotrophoblast pathway and extravillous cytotrophoblast pathway 7 Figure 1.2 Schematic representation depicting proteinase expression in subpopulations of trophoblastic cells differentiating along the extravillous cytotrophoblast pathway 23 Figure 1.3 Schematic representation depicting integrin expression in subpopulations of trophoblastic cells differentiating along the extravillous cytotrophoblast pathway 28 Figure 1.4 Schematic representation depicting cadherin expression in subpopulations of trophoblastic cells differentiating along the extravillous cytotrophoblast pathway 34 Figure 1.5 Schematic representation of the structural domains of A D A M T S metalloproteinases 37 Figure 1.6 Schematic representation of the structural domains of classical/type-I cadherins 54 Figure 2.2.1 Schematic diagram summarizing the Q C - P C R strategy Employed 145 Figure 2.2.2 Determination of the optimal amount of competitive A D A M T S - 1 2 c D N A to be added to each Q C - P C R reaction 147 Figure 2.2.3 Southern blots demonstrating the m R N A levels of A D A M T S metalloproteinases expressed in first trimester placenta, JEG-3 choriocarcinoma cells, and extravillous cytotrophoblasts 149 Figure 2.2.4 Western blot analysis of A D A M T S - 1 2 expression levels in human placenta and trophoblastic cells 151 Figure 2.2.5 Q C - P C R analysis demonstrating the regulatory effects of T G F - p i on A D A M T S - 1 2 m R N A expression levels in E V T s 153 Figure 2.2.6 Q C - P C R analysis demonstrating the regulatory effects of I L - l p on A D A M T S - 1 2 m R N A expression levels in E V T s 155 V l l l Figure 2.2.7 Reduction of A D A M T S - 1 2 m R N A and protein levels results in a significant decrease in the invasive capacity of extravillous cytotrophoblasts 157 Figure 2.2.8 Exogenous A D A M T S - 1 2 expression specifically increases the invasive capacity of JEG-3 cells, independent of its intrinsic proteolytic activity 160 Figure 2.2.9 Cel l hanging drop assay demonstrating that exogenous expression of A D A M T S - 1 2 in JEG-3 choriocarcinoma cells does not alter their aggregation characteristics 164 Figure 2.2.10 Cell-extracellular matrix binding assay demonstrating that exogenous expression of A D A M T S - 1 2 in JEG-3 choriocarcinoma cells alters their E C M properties 167 Figure 2.2.11 Cel l invasion assay demonstrating that the invasive capacity of JEG-3 choriocarcinoma cells exogenously expressing A D A M T S - 1 2 is inhibited by treatment with an R G D peptide 168 Figure 3.2.1 Cell-extracellular matrix protein binding assay demonstrating that JEG-3 choriocarcinoma cells exogenously expressing A D A M T S - 1 2 have altered E C M protein binding affinities 205 Figure 3.2.2 Alpha integrin binding assay demonstrating that JEG-3 choriocarcinoma cells exogenously expressing A D A M T S - 1 2 exhibit altered integrin subtype binding affinities 207 Figure 3.2.3 Beta integrin binding assay demonstrating that JEG-3 choriocarcinoma cells exogenously expressing A D A M T S - 1 2 exhibit altered integrin subtype binding Affinities : 209 Figure 3.2.4 R T - P C R and Western blot analysis demonstrating that JEG-3 cells exogenously expressing A D A M T S - 1 2 up-regulate the expression of alpha V integrin 211 ix Figure 3.2.5 R T - P C R and Western blot analysis demonstrating that extravillous cytotrophoblasts expressing lowered levels of A D A M T S - 1 2 have lowered levels of alpha V integrin 213 Figure 3.2.6 Cel l invasion assay demonstrating that the invasive capacity of JEG-3 choriocarcinoma cells exogenously expressing A D A M T S - 1 2 or extravillous cytotrophoblasts is reduced when the function of alphavbeta3 integrin is inhibited 215 .Figure 4.2.1 Southern and Western blot analysis demonstrating that E - and N-cadherin are differentially expressed between JEG-3 choriocarcinoma cells and extravillous cytotrophoblasts 259 Figure 4.2.2 Loss of E-cadherin m R N A and protein levels results in JEG-3 choriocarcinoma cells adopting a more invasive phenotype 261 Figure 4.2.3 Cel l hanging drop assay demonstrating that JEG-3 choriocarcinoma cells expressing lowered levels of E-cadherin become less aggregative 263 Figure 4.2.4 Cel l invasion assay demonstrating that loss of E-cadherin function in JEG-3 choriocarcinoma cells leads to an increase in invasive phenotype 265 Figure 4.2.5 Loss of N-cadherin m R N A and protein levels in extravillous cytotrophoblasts leads to an increase in invasive phenotype 267 Figure 4.2.6 Cel l invasion assay demonstrating that loss of N-cadherin function in extravillous cytotrophoblasts cells leads to a decrease in invasive phenotype 269 Figure 4.2.7 Proliferation and apoptosis analysis in extravillous cytotrophoblasts transfected with s i R N A directed against N-cadherin 271 Figure 4.2.8 Western blot analysis demonstrating that a reduction in N-cadherin expression in extravillous cytotrophoblasts Does not lead to de novo expression of E-cadherin 273 Figure 4.2.9 Cel l hanging drop assay demonstrating that reduced levels of N-cadherin in extravillous cytotrophoblasts leads to a more x aggregative phenotype 275 Figure 4.2.10 JEG-3 choriocarcinoma cells exogenously expressing N-cadherin adopt a more invasive phenotype with out altering E-cadherin expression levels 277 Figure 4.2.11 Cel l invasion assay demonstrating that the invasive capacity of JEG-3 choriocarcinoma cells exogenously expressing N-cadherin is reduced when N-cadherin function in inhibited 279 Figure 4.2.12 Proliferation analysis in JEG-3 choriocarcinoma cells exogenously expressing N-cadherin 281 Figure 4.2.13 Western blot analysis demonstrating a-, (3- and y- and catenin expression levels in JEG-3 choriocarcinoma cells exogenously expressing N-cadherin and in extravillous cytotrophoblasts 283 Figure 4.2.14 Cel l hanging drop assay demonstrating that the aggregative ability of JEG-3 choriocarcinoma cells exogenously expressing N-cadherin is not altered 286 Figure 4.2.15 Exogenous expression of a chimeric N/E-cadherin c D N A construct in JEG-3 choriocarcinoma cells leads to an increase in invasive phenotype 288 Figure 4.2.16 Exogenous expression of E-cadherin cytoplasmic domains in JEG-3 choriocarcinoma cells leads to a reduction in invasive phenotype and an increase in cell aggregation 290 Figure 5.1 Schematic diagram demonstrating the relationship between key molecular processes involved in regulating cell invasion 300 Figure 5.2 Schematic diagram summarizing the key findings of this thesis 314 x i LIST OF ABBREVIATIONS A D A M A disintegrin and metalloproteinase A D A M T S A disintegrin and metalloproteinase with thrombospondin repeats A D A M T S - L A D A M T S - l i k e A N O V A Analysis of variance arm Armadillo B S A Bovine serum albumin B r d U 5 -bromo-2' -deoxy-uridine C Carboxy °c Degrees centigrade C a 2 + Calcium C a C l 2 Calcium chloride C A M Cel l adhesion Molecule c A M P Cyclic adenosine 3',5'-monophosphate C A R Cel l adhesion recognition c D N A Complimentary D N A C M V Cytomegalovirus C O M P Cartilage oligomeric matrix protein CP Cytoplasmic domain CSF-1 Colony stimulating factor C U B Complement subcomponent Clr/Cls/embryonic sea urchin protein Uegf (urchin epidermal growth factor)/bone morphogentic protein 1 C x connexin D M E M Dulbeco's modified eagle's medium D N A Deoxyribonucleic acid E C Extracellular subdomain E C L Enhanced chemiluminescence E C M Extracellular matrix E D T A Ethylenediamine tetra-acetate E G F Epidermal growth factor E G F R E G F receptor E M T Epithelial mesenchymal transition E V T Extravillous cytotrophoblast F A K Focal adhesion kinase F G F Fibroblast growth factor F G F R F G F receptor g grams G T P Guanosine triphosphate h hours H A V Histidine-alanine-valine h C G Human chorionic gonadotropin hPL Human placental lactogen H U V E C Human umbilical vascular endothelial cells I C 5 0 Inhibitory concentration 50% x i i Ig Immunoglobin IGF Insulin-like growth factor IGFBP-1 IGF binding protein-1 I L - i p Interleukin-ip I U G R Intrauterine growth restriction kb K i l o bases kDa KiloDaltons ki67 Nuclear cell proliferation-associated epitope LacZ P-galactosidase L E F Lymphocyte enhancing factor L H Luteinizing hormone M g 2 + Magnesium min Minutes ml Mil l i l i ter m M millimolar M A P K Mitogen activated protein kinase M F Microfilaments M M P Matrix metalloproteinase M T - M M P Membrane-type M M P M r Molecular weight m R N A Messenger R N A pl Microliter p M Micromolar N Amino n M Nanomolar N a C l Sodium chloride P Probability P A Plasminogen activator P A G E Polyacrylimide gel electrophoresis P A I Plasminogen activator inhibitor P B S Phosphate buffered saline P C N A Proliferating cell nuclear antigen P C R Polymerase chain reaction P L A C Proteinase and lacunin P M S F Phenylmethyl sulfonyl fluoride P N P Procollagen N-proteinase P R Progesterone receptor Q C - P C R Quantitative-competitive P C R R G D Arginine-glycine-aspartic acid R N A Ribonucleic acid r R N A Ribosomal R N A R T Room temperature R T - P C R Reverse transcriptase-polymerase chain reaction SDS Sodium dodecyl sulfate S E M Standard error of the mean Sp Specificity protein x i i i SPC Substilin-like pro-protein convertase src Rous sarcoma virus SSPE Standard saline phosphate E D T A SV40 Simian vacuolating virus-40 T C F Thymocyte cell factor TGF-p Transforming growth factor-P T I M P Tissue inhibitor of M M P T M Transmembrane domain t P A Tissue-type P A T r i s - H C L Tris (hydroxymethyl)-aminomethane-Hydrochloric acid TSP Thrombospondin type-1 repeat TTP Thrombotic thrombocytopenic purpura u P A Urokinase-type P A v W F von Willebrand factor v W F C P v W F cleaving proteinase V E G F Vascular endothelial growth factor W M S Weill-Marchesani syndrome X-ga l 5-bromo-4-chloro-3-ondolyl-P-D-galactosidase zo Zonula occludens XIV A C K N O W L E D G E M E N T S I would like to thank my supervisor, Dr. Col in D. MacCalman for his support and his continual loyalty throughout my doctorate training. I would also like to thank members of my supervisory committee, Drs. Wendy Robinson, Catherine Pallen, and Dan Rurak. Your counsel and critical analysis of my research is much appreciated. Finally, I must acknowledge the support and encouragement given by my parents, Guillermo and Sharon, my accomplishments would not have been met without them. xv CO-AUTHORSHIP STATEMENT Chapter 2: CHARACTERISATION OF ADAMTS METALLOPROTEINASES IN THE HUMAN FIRST TRIMESTER PLACENTA AND MONONULCEAR TROPHOBLASTIC CELLS This experimental chapter was written exclusively by Alexander G. Beristain. In addition, Alexander G. Beristain performed all the experiments except for the QC-PCR analysis, which was performed by Dr. H. Zhu. Dr. S. Getsios provided me with consult and research design of the hanging drop assays and ECM-binding assays. Chapter 3: CHARACTERIZING THE MOLECULAR MECHANISMS INVOLVED IN ADAMTS-12-MEDIATED CELL INVASION The work and writing of this experimental chapter was performed and written by Alexander G. Beristain. Chapter 4: CADHERIN-MEDIATED REGULATION OF HUMAN TROPHOBLASTIC CELL INVASION This experimental chapter was written by Alexander G. Beristain. In addition, Alexander G. Beristain performed all the experiments except for the proliferation and apoptosis assays that were performed in part by Dr. H. Zhu as well as Alexander G. Beristain. xvi CHAPTER 1: OVERVIEW 1.1 Introduction The human placenta plays a key role in regulating the growth, development and survival of the fetus during pregnancy (Boyd and Hamilton, 1970; Apl in , 1991). Abnormal placental development is thought to be a major underlying cause of several developmental disorders including spontaneous abortion, intrauterine growth restriction, and preeclampsia (Benirschke and Kaufmann, 2000). For example, errors during placental development are associated with fetal demise within the first two months of gestation as is observed in pregnancies terminating in spontaneous abortion (Salafia et al, 1993; van Lijnschoten et al, 1994). Similarly, abnormal placental structure and function are observed in cases of intrauterine growth restriction and preecplampsia, both of which have deleterious effects on the maturation and growth of the fetus (Krebs et al, 1996; Macara et al, 1996). Furthermore, the physiological role of the placenta may extend well beyond the gestational period as recent studies have correlated the size of this organ at birth with the onset and incidence of particular diseases in adults (Barker et al, 1990; Barker, 1995). Placental development and function is dependent on the proliferation, differentiation and invasion of embryonic trophoblastic cells into the maternal endometrium (Aplin, 1991). A t the most fundamental level, these specialized cells anchor the placenta and fetus to the uterine wall . However, trophoblastic cells are also essential in establishing a physiologically active interface between the mother and fetus throughout pregnancy. To date, most studies have focused on the ability of gene mutations in mice to adversely effect placental development and trophoblast 1 differentiation in these animals. These studies have indirectly implicated the products of several genes in the developmental processes that lead to embryonic mortality and intrauterine growth restriction in the human (Cross et al, 1994; Cross, 2000). Despite significant advances in our understanding of murine placental development, the cellular mechanism(s) that regulate trophoblast differentiation and invasion during the formation and organization of the human placenta remain poorly characterized. Extracellular matrix ( E C M ) remodeling, cell-matrix and cell-cell interactions play important roles in regulating cell differentiation, migration and invasion pathways (Munshi and Stack, 2006). The characterization of A D A M T S (A Disintegrin A n d Metalloproteinase with ThromboSpondin-like repeats), a novel family of secreted multifunctional proteins that share structural and functional similarities to the matrix metalloproteinases ( M M P s ) and A D A M s (A Disintegrin A n d Metalloproteinase) have shed new insights into E C M remodeling involved in both normal and pathological processes and have highlighted the biological significance that these proteins play in mediating proteolysis and putative cell adhesion. The first two experimental chapters in this thesis are dedicated to characterizing this novel family of metalloproteinases in the first trimester placenta and in trophoblastic cell lineages. The role(s) that A D A M T S play in controlling trophoblastic cell invasion in vitro, is subsequently described. The calcium (Ca2 +)-dependent cell adhesion molecule ( C A M ) gene superfamily known as the cadherins, has been attributed to playing key roles in cell-cell adhesion and maintaining tissue integrity and structure throughout developmental processes in all tissues. Furthermore, studies have demonstrated the importance that members of the cadherin subtypes play in controlling cell differentiation during cancer development and cancer cell invasion. These findings provide insight into potentially novel molecular mechanisms involved in trophoblast 2 invasion during placental development, as some of the molecular mechanisms involved in regulating cellular invasion have been shown to be shared by trophoblasts and cancer cells. The final set of experiments presented in this thesis describe the expression of N-cadherin and E -cadherin in trophoblastic cells and define the role(s) these C A M s play in regulating trophoblast invasion. In this chapter, the development of the human placenta wi l l be described with particular emphasis on trophoblast invasion in vitro and in vivo. The cellular mechanisms that are believed to modulate trophoblast invasion w i l l then be discussed and compared with mechanisms that play key roles in regulating tumorigenesis. Finally, the cell biology of the A D A M T S and cadherin gene families w i l l be reviewed with particular attention focused on E C M remodeling, cell differentiation and tissue development. 1.2 Human implantation and placentation 1.2.1 Placental development and trophoblast differentiation in vivo The first cell lineage that can be distinguished in the pre-implantation blastocyst is an outer trophectodermal cell layer that gives rise to the epithelial cells of the human placenta (Hertig et al, 1956; Boyd and Hamilton, 1970). During implantation, the trophectodermal cells undergo apposition, attachment and penetration through the surface epithelial cells and basement membrane of the maternal endometrium allowing for the burrowing of the blastocyst into the uterine wall (Schlafke and Enders, 1975; Bentin-Ley et al, 2000). These stages of development 3 are critical to the establishment of a successful pregnancy. It is estimated that between 30% and 70% of human embryos are lost at this time of implantation (Cooke, 1988; Wilcox et al, 1988). During the earliest post-implantation phases observed in the human, the embryonic trophectoderm consists of two discrete trophoblastic cell populations: mononucleate cytotrophoblasts and a multinucleated syncytial trophoblast (Hertig et al, 1956). Although the trophoblastic cell subpopulation that is involved in the initial stages of invasion of maternal tissue remains unclear (Pijnenborg, 1990; Aplin, 2000), histological evidence suggests that both the syncytial trophoblast and cytotrophoblasts interact with the cells that constitute the endometrium (Enders, 1976). These trophoblastic cells are capable of remodeling the uterine environment and, following infiltration by a vascularized fetal mesenchyme, organize into mature chorionic villous structures. Chorionic villi are ultimately comprised of a mesenchymal core containing fetal blood vessels, a single layer of villous cytotrophoblast cells that rest on a basement membrane, and an outer syncytial trophoblast layer that is in direct contact with the maternal endometrium and blood. The formation of the chorionic villi has been described as the hallmark of the human haemochorial placenta, as the fetal circulatory system is separated from the maternal blood cells by at least one layer of trophoblastic cells throughout all stages of pregnancy (Boyd and Hamilton, 1970). The syncytial trophoblast is a terminally differentiated cell formed by the post-mitotic fusion of the underlying villous cytotrophoblasts (Richart, 1961; Kliman et al, 1986). The cellular basis for this terminal differentiaion process was first suggested in 1887 by Langhans in his morphological descriptions of the villous cytotrophoblasts present in the human placenta (Boyd and Hamilton, 1970). Alternatively, it has been proposed that the development of the multinucleated syncytial trophoblast occurs as a result of nuclear duplication in the absence of 4 cytokenesis (referred to as endomitosis) instead of a cellular fusion process (Sarto et al, 1982). Functional evidence that supports cytotrophoblastic origin of the syncytial trophoblast was provided by the studies of Richart (1961) examining H-thymidine incorporation in the trophoblastic cells of the human placenta. These and subsequent studies have demonstrated that the villous cytotrophoblasts are mitotically active and that nuclear division is completely absent in the multinucleated syncytial trophoblast in vivo (Richart, 1961; Galton, 1962; Gerbie et al, 1968). Further evidence to support this model of trophoblast terminal differentiation was provided by ultrastructural analysis of the human term placenta (Carter, 1964; Metz et al, 1979; Metz and Weihe, 1980). These studies demonstrated the presence of intercellular junctions within the syncytial trophoblast layer and at areas of direct contact between the villous cytotrophoblasts and the syncytial trophoblast in the human chorionic villi. The junctional complexes present within the syncytial trophoblast have been interpreted as being remnants of cytotrophoblastic junctions that have incorporated into the syncytial trophoblast cytoplasm following cellular fusion. The ultrastructural and functional properties of the villous cytotophoblasts and the multinucleated syncytial trophoblast differ. For example, villous cytotrophoblasts contain relatively large mitochondria and numerous free ribosomes but few rough endoplasmic reticular (RER) structures (Boyd and Hamilton, 1970). In contrast, the syncytial trophoblast contains larger nuclei and demonstrates a more extensive development of organelles associated with protein synthesis (RER), secretion (Golgi apparatus and secretory vesicles), and steroid hormone biosynthesis (smooth endoplasmic reticulum, lipid vessles and mitochondria) (Boyd and Hamilton, 1970). Despite these ultrastructural differences, villous cytotrophoblasts appear to be the primary site of synthesis of several peptide hormones, including inhibin, activin and 5 gonadotropin-releasing hormnone (Khodr and Siler-Khodr, 1980; Miyake et al, 1982; Petraglia et al, 1991; 1996). Although these mononucleate trophoblastic cells can also produce human chorionic gonadotropin (hCG) at the earliest stages of pregnancy (Ohlsson et al, 1989), the syncytial trophoblast becomes the major source of this and most other peptide and steroid hormones produced by the placenta throughout gestation (Hoshina et al, 1982; Ringler and Strauss, 1990). These two trophoblastic cells subpopulations also demonstrate differences in their ability to transport nutrients to the fetus (Kennedy et al, 1992; Furesz et al, 1993) and in their susceptibility to viral infection during human pregnancy (Burton and Watson, 1997; Hemmings et al, 1998). Cytotrophoblasts at regions adjacent to the maternal tissue enter one of two mutually exclusive differentiation pathways: 1) the villous pathway in which these mononucleate cells undergo terminal differentiation and fusion to form syncytial trophoblasts, as described above or 2) the extravillous pathway, in which cytotrophoblasts differentiate into extravillous cytotrophoblasts (EVTs) that invade into the endometrium and maternal blood vasculature (Morrish et al, 1998). These trophoblastic cells constitute a heterogeneous population of cells and are sub-classified, depending upon their molecular and morphological phenotypes and location within the extravillous compartment, as either intermediate (proliferating E V T s located proximal to the villous basement membrane), interstitial (non-dividing and invasive mesenchymal-like E V T s located in the endometrium and proximal third of the myometrium), or endovascular trophoblasts (invasive E V T s that have acquired molecular characteristics of endothelial cells of the endometrial vasculature) (Lala et al, 2002; Bischof and Irminger-Finger, 2005). A schematic representation of these trophoblast differentiation pathways in a human chorionic villous explant is shown in Figure 1.1. 6 Anchoring Villous Syncytial trophoblast Zone 1 Zone 2 Zone 3 Fig L I : Schematic representation of a chorionic villi depicting the trophoblastic cell subpopulations present in the first trimester. Zone l represents a floating villous consisting of mononuclear villous cytotrophoblasts entering the non-invasive villous pathway. Here villous cytotrophoblasts proliferate and fuse to form the multinucleated synytial cytotrophoblast. Zone 2 depicts an EVT column consisting of differentiating EVTs and a syncytial cytotrophoblast outer layer. Zone 3 represents the invasive extravillous pathway. Subpopulations of EVTs detach from the extravillous column and invade into the maternal decidua and blood vasculature (BV; Adapted from Zhou et al, 1997a). 7 Human E V T s undergo extensive proliferation and breach the syncytial trophoblast layer forming large cellular columns that extend into the maternal decidua and attach the placenta to the uterine wall during pregnancy (Enders, 1968; Muhlhauser et al, 1993). Subpopulation(s) of E V T s subsequently dissociate from the tips of these cellular columns and invade deeply into the underlying maternal tissue (Pijnenborg et al, 1980). E V T s invade the uterine stroma and superficial myometrium as individual mononucleate cells and penetrate the basal lamina and replace the endothelia of the uterine vasculature. This cellular event is believed to result in the remodeling of the endothelial and smooth muscle cells in these blood vessels that thereby increase blood flow to the placenta and ensures an adequate supply of nutrients and oxygen to the developing fetus (Brosens et al, 1967; Pijnenborg et al, 1983). In addition to invasive mononucleate E V T s , large multinucleated trophoblastic cells, referred to as placental bed giant cells are present in the decidua and myometrium and are most numerous at a time period that correlates with the phase of E V T invasion (Pijnenborg et al, 1981; A l - L a m k i et al, 1999). The cellular mechanism(s) involved in placental bed giant cell formation are poorly understood. It has been suggested that these cells are derived from the fusion of maternal decidual cells (Wynn, 1967) or from remnants of the syncytial trophoblast layer of the human placenta (Robertson and Warner, 1974). The E V T origin of placental bed giant cells has been supported by several studies (Pijnenborg et al, 1981; Graham et al, 1992; A l -Lamki et al, 1999). Recent histological studies have demonstrated large aggregates of mononucleate E V T s in direct contact with placental bed giant cells and the surrounding decidual cells suggesting that these cells are formed by a process of cellular fusion rather than endomitosis (Al -Lamki et al, 1999). This hypothesis has been supported by the observation that D N A synthesis is absent in these mutlinucleated placental bed giant cells as determined by H -8 thymidine incorporation or immunoreactivity to cellular proliferation markers such as proliferating cell nuclear antigen ( P C N A ) or the nuclear cell proliferation-associated epitope, Ki67 (Kaufmann and Castellucci, 1997). A t the end of the first trimester of pregnancy the basic structure of the human placenta is established and all of the distinct trophoblastic cell subpopulations are present at the maternal-fetal interface (Boyd and Hamilton, 1970). Placental development beyond this time period involves continued trophoblastic cell proliferation and differentiation which leads to the subsequent growth and expansion of this organ until the end of the gestational period (Simpson et al, 1992). The placenta, along with the majority of trophoblastic cells is normally expelled from the mother following the delivery of the fetus at term. 1.2.2 Animal models used in studying human placentation Ethical limitations prevent extensive in vivo study of human placentation. Consequently, animal models have been used to extrapolate the cellular and molecular mechanisms involved in the placentation process in humans. Unfortunately, the gross structural and cellular components of the human placenta vary considerably from those in most animals (Carter et al, 2006). However, cellular processes in placental development of certain animals provide useful models for studying specific aspects of the human placentation process, such as blastocyst attachment and penetration through the uterine luminal epithelial layer, endovascular trophoblast invasion and remodeling, and interstitial trophoblast invasion (Verkeste et al, 1998; Enders and Lopata, 1999; Enders et al, 2001; Adamson et al, 2002; Caluwaerts et al, 2005; Carter et al, 2006). The placentae of animals used in studying human placentation are mostly of the discoid and 9 haemochorial-type, and consequently exhibit, to some degree, trophoblast invasion and remodeling of the maternal blood vasculature comparable to that observed in the human. 1.2.2-A Non-human primate models The structure of the placentae of non-human primates is very similar to that of the human placenta (Enders et al, 2001), as seen in the macaque (Macaca mulatto), baboon (Papio anubis) and marmoset (Callithrix jacchus), where the chorion of these species is anchored to the uterus by cellular columns of trophoblastic cells extending from implanted chorionic v i l l i (Enders and Lopata, 1999; Enders et al, 2001). However, the trophoblastic cell column in these non-human primates is significantly longer and consists of more trophoblastic cell layers than in the human (Enders et al, 2001). It has been suggested that these differences in the baboon and macaque stem from the relatively rapid extravasation and subsequent remodeling of maternal blood vessels by trophoblasts resulting in a thick lacunar placenta that is superficially implanted into the endometrium (Enders et al, 2001; Kaufmann et al, 2003; Carter et al, 2006). Although blastocyst attachment and uterine luminal epithelial penetration are thought to be very similar in non-human primates and in the human, the cellular pathway leading to maternal endovascular remodeling is thought to be quite different. For instance, in the macaque and baboon, it is generally thought that trophoblast-mediated endovascular remodeling occurs by trophoblast extravasation into maternal spiral arteries (Blankenship et al, 1993). The process of extravasation is thought to involve trophoblast cells originating from an unknown source (possibly from floating vi l l i ) proximal to uterine arterial lumens, which then migrate against the maternal blood flow and adhere to and replace/remodel the vascular endothelium (Blankenship et 10 al, 1993; Enders et al, 2001; Kaufmann et al, 2003). In contrast, it is well accepted that human E V T s , originating from the chorionic villous column, invade the maternal interstitium and then penetrate into (intravasate) and remodel maternal blood vessels (Fisher and Damsky, 1993; Kaufmann et al, 2003). Therefore, non-human primates appear to be excellent models for studying human implantation and endovascular remodeling processes, but are poor models for studying the E V T pathway and interstitial trophoblast invasion. 1.2.2-B Rodent models Nearly all rodent species have a haemochorial type placenta (Pijnenborg et al, 1981), though the ultrastructure is characterized as being labrinthe-type, as opposed to the villous-type observed in most primates (Caluwaerts et al, 2005). The invasive characteristics of rodent trophoblastic cells have therefore been used to study cellular and molecular mechanisms involved in regulating trophoblast invasion and maternal endothelial remodeling (Verkeste et al, 1998; Adamson et al, 2002; Caluwaerts et al, 2005). However, trophoblast invasion in the rat and mouse has been shown to follow two independent invasive pathways: the vascular or the interstitial pathway (Carter et al, 2006). Invasion and remodeling of the maternal endothelium and vascular smooth muscle is thought to result from differentiated trophoblastic cells originating from the outer trophoblast giant cell layer, whereas interstitial trophoblastic cells, referred to as glycogen trophoblasts, are thought to originate from the trophoblast subpopulation underlying the trophoblast giant cell layer, called the spongiotrophoblast (Adamson et al, 2002; Kaufmann et al, 2003). In the rat, glycogen and endovascular trophoblasts invade into the mesometrium, whereas in mice, trophoblast invasion is limited to the decidua basalis (Carter et 11 al, 2006). Trophoblasts of the guinea pig (Cavia porcellus), show a similar invasive capacity to those of the rat (Carter et al, 2006). However, in the guinea pig, the subplacenta, a defining feature in placentae of rodents in the genus Cavia that comprises a distinct area of the chorioallantoic placenta not involved in feto-maternal exchange, is the main source of invasive interstitial and endovascular trophoblast. In addition to cellular components of the subplacenta, trophoblast giant cells from the placental labyrinth are thought to also play key roles in endovascular invasion in the guinea pig (Verkeste et al, 1998; Carter et al, 2006). Thus, rodents appear to be good animal models in studying some molecular aspects involved in interstital trophoblast invasion, although the separate trophoblast invasion pathways in these animals raise some doubt as to whether the cellular mechanisms are too divergent from the human to accurately make comparisons. 1.2.3 Models of human trophoblast differentiation Most of our information regarding human trophoblast differentiation has relied on histological studies of post-implantation hysterectomy and term placental specimens (Hertig et al, 1956; Boyd and Hamilton, 1970; Pijnenborg et al, 1980). More recently, several in vitro model systems have been developed and used to examine specific aspects of human trophoblast differentiation (Frank al, 2000; K i n g et al, 2000). 12 1.2.3-A Vil lous cytotrophoblast cells isolated from human term placentae Human term placental tissues can be enzymatically dispersed and the trophoblastic subpopulations purified using density gradients and/or immunoselection methods. These methods result in the isolation of highly purified populations of mononulceate cytotrophoblasts (Kliman et al, 1986; Y u i et al, 1994; Morrish et al, 1997). Vi l lous cytotrophoblasts isolated from human term placentae undergo a differentiation process that mimics many of the molecular mechanisms associated with syncytial trophoblast formation in vivo (Kao et al, 1988). In particular, freshly isolated mononucleate cytotrophoblasts undergo aggregation, differentiation and fusion to form multinucleated syncytial structures with time in culture. The formation of multinucleated syncytium in these primary cell cultures is associated with an increase in the secretion of the peptide hormone, phCG, where its expression also correlates with trophoblast differentiation and fusion in vivo (Hoshina et al, 1982). 1.2.3-B Transformed choriocarcinoma cell lines Trophoblastic cell lines derived from choriocarcinoma cells have provided a useful alternative to investigate the cell biology of human trophoblast differentiation in vitro (King et al, 2000). Choriocarcinoma is a relatively rare malignant tumor of the human placenta that is comprised of mitotically active cytotrophoblasts (Benirschke and Kaufmann, 2000). Several choriocarcinoma cell lines have been established that exhibit a varying degree of differentiation in culture. BeWo and JEG-3 choriocarcinoma cells, two of the most exclusively used cell lines are discussed below. 13 Bewo choriocarcinoma cells were established as the first hormone-producing trophoblastic cell line (Pattillo et al, 1968; Pattillo and Gey; 1968). There are several BeWo choriocarcinoma cell clones established that have been shown to undergo cellular fusion in response to forskolin or c A M P (cyclic adenosine monophosphate) treatment (Seamon et al, 1981; Wice et al, 1990). This ability has led to the establishment of an in vitro model with which to study the molecular mechanisms involved in syncytial trophoblast formation. JEG-3 choriocarcinoma cells are mononucleate trophoblastic cells that were established from choriocarcinoma explant cultures by Kohler et al (1971). Although an increase in c A M P levels has been shown to increase the production and secretion of (3hCG in these cultures, these cells do not form a multinucleated syncytium under these culture conditions (Chou et al, 1978; Burnside et al, 1985; Coutifaris et al, 1991). Consequently, JEG-3 cells have been used as an in vitro model system to examine mononucleate trophoblastic cell biology. 1.2.3-C Extravillous cytotrophoblast propagation from human first trimester chorionic villous explants The mechanical isolation of E V T s from first trimester chorionic villous explants (8-12 weeks gestation) has been shown to yield pure E V T cultures, as assessed through morphological and phenotypical analysis (Irving et al, 1995). Indirect immunofluorescence for cytokeratin and vimentin revealed that pure trophoblast outgrowths stain 100% positive for the epithelial cell marker cytokeratin, but not the mesenchymal cell marker vimentin (Irving et al, 1995). Furthermore, >90% of mechanically isolated E V T s from chorionic villous explants immunostaining 100% positive for cytokeratin, immunostain positively for insulin-like growth 14 factor-II (Irving et al, 1995; A p l i n et al, 1999). Two subtypes of trophoblastic E V T populations are derived from mincing/mechanical-processing of chorionic v i l l i : multinucleate E V T s and mononucleate E V T s . The multinucleate E V T s are thought to be phenotypically similar to trophoblast giant cells, and are characterized by abundant vesiculated rough endoplasmic reticulum (RER) and express human placental lactogen (hPL; Irving et al, 1995; Aboagye-Mathiesen et al, 1996). The mononucleate E V T s are fibroblastic in appearance, and are characterized by having polymorphic nuclei and numerous cytoplasmic vessels, and express the matrix-degrading geltinases M M P - 2 and -9 (Aboagye-Mathiesen et al, 1996). Additionally, E V T subpopulations isolated from chorionic villous tissues express h C G , establishing this hormone as a reliable trophoblast specific marker (Islami et al, 2001; Handschuh et al, 2006). The trophoblastic cell markers described above have been shown to be expressed by invasive E V T s in situ. Therefore, the documentation of their expression in E V T subpopulations isolated mechanically from chorionic villous explants support the concensus that these trophoblastic cells provide a valid model for studying E V T cell biology (Irving et al, 1995). The addition of specific growth factors to the culture medium has shown to regulate differentiation and invasion in primary cultures of E V T s (Lala and Hamilton, 1996). For example, transforming growth factor-(31 (TGF-(31), which is produced by the placenta and decidua in vivo (Graham et al, 1992; Lysiak et al, 1995), is capable of reducing proliferation, invasion, and promoting the differentiation and fusion of these isolated E V T s in vitro (Graham et al, 1992; 1994; Karmakar and Das, 2002). The formation of multinucleated cellular structures in these primary cultures is believed to mimic the cellular events associated with placental bed giant cell differentiation in vivo (Graham et al, 1994). This terminal differentiation process has also been associated with a reduction in the invasive capacity of these cells (Graham and Lala, 1991). 15 1.3 Trophoblast invasion: A process that utilizes cellular processes similar to those involved in cancer cell invasion. E V T subpopulations invade the endometrium and its vasculature during the first trimester of pregnancy (Apl in and Kimber, 2004). A s discussed previously, E V T s originate from proliferating and differentiating cytotrophoblast stem cells located in the cytotrophoblast layer of anchoring chorionic v i l l i . Vi l lous cytotrophoblasts differentiating along the E V T pathway acquire molecular characteristics similar to those observed in cancer cells (Bischof et al, 2001; Lala et al, 2002). However, unlike cancer cell invasion, normal E V T invasion into the maternal endometrium and vasculature is a highly regulated process, as is demonstrated by the lack of E V T anchorage-independent growth or tumor formation in nude mice (Graham et al, 1993; Irving et al, 1995). E V T s offer an attractive model in studying molecular mechanisms involved in controlling cell-invasion processes. The following sub-sections wi l l discuss components of the molecular machinery that regulate trophoblast differentiation into an invasive phenotype. 1.3.1 Extracellular matrix degradation: Proteinases and their inhibitors Trophoblast invasion is in part due to the active secretion of proteolytic enzymes capable of degrading components of the E C M (Bischoff and Irminger-Finger, 2004). Serine proteinases, cathepsins, and M M P s have all been implicated in contributing to E C M remodeling processes (Kliman and Feinberg, 1990; Westermarck and Kahari, 1999). The best characterized 16 proteinases involved in trophoblast invasion are the plasminogen activators (PA) and M M P s which are discussed below. 1.3.1-A Plasminogen activators and their inhibitors The P A s are substrate-specific proteinases that mediate cleavage of plasminogen to plasmin (Alfano et al, 2005). P A s exhibits a broad range of serine proteinase activity that leads to the degradation of E C M proteins such as fibrin and laminin, but also facilitates the activation of zymogen forms of M M P s (Vasselli et al, 1991; Andreasen et al, 2000; Durand et al, 2004). The P A system includes the urokinase-type P A (uPA), the tissue-type P A (tPA), the P A inhibitor-1 and -2 (PAI-1 and PAI-2), and the u P A receptor (uPAR). The activation of plasminogen can be catalysed by either of the two plasminogen activators: u P A or tPA. u P A has been shown to play roles in ECM-remodeling processes and MMP-activation whereas tPA functions primarily as an enzyme that facilitates fibrinolysis in the blood (Andreasen et al, 2000; Durand et al, 2004). Pro-uPA localizes to the cell surface by binding to its receptor, u P A R , and in doing so becomes proteolytically active (Durand et al, 2004). The proteolytic activity of u P A activation is subsequently regulated by the specific inhibitor P A I by complexing with u P A and u P A R in a covalent manner resulting in a reconfiguration of the proteinase that subsequently leads to proteolytic inhibition (Andreasen et al, 1990). The P A activation system plays an important role many types of cancer in vivo (Kinder et al, 1993; Duggan et al, 1995; Festuccia et al, 1998; Dano et al, 2005). Furthermore, u P A has been shown to be overexpressed in a variety of cancer cell lines in vitro, and has been 17 demonstrated to positively regulate cancer cell invasion (Meissauer et al, 1991; Delbaldo et al, 1994; L i u and Rabbani, 1995; X i n g and Rabbani, 1996; Mohanam et al, 1997). Additionally, u P A has been demonstrated to function in a paracrine manner in cancer as its expression has been documented in stroma and infiltrating macrophages (Behrendt, 2004; Dano et al, 1985; 2005). For example, u P A is expressed by fibroblasts in ductal breast cancers and colon cancers, and by macrophages in prostate cancer and squamous cell carcinomas (Romer et al, 1991; Nielsen et al, 1996; 2001; Usher et al, 2005). In cancer, u P A initiates the proteolytic cascade that facilitates the invasion of blood vessels by tumor cells. Furthermore, the u P A proteolytic system enhances the dissemination of tumor cells through vascular and lymphatic vessels and facilitates metastasis (Fisher et al, 2000). u P A is produced by human trophoblastic cells in vitro and in vivo (Astedt et al, 1986; Queenan et al, 1987; Yagel et al, 1988). In addition, the membrane-bound u P A receptor is expressed by invasive E V T s during the first trimester of pregnancy (Multhaupt et al, 1994; Pierleoni et al, 1998). The inhibition of u P A in isolated E V T s using neutralizing antibodies specific for this proteinase or by increasing endogenous production of PAI -1 , inhibits the invasive capacity of these primary cells in culture (Yagel et al, 1988; Graham et al, 1994; 1997). Furthermore, I L - i p and epidermal growth factor (EGF), factors that have been shown to enhance trophoblast invasion, up-regulate the expression of u P A in E V T s (Karmakar and Das, 2002; Anteby et al, 2004). T G F - p l , a growth factor shown to inhibit trophoblast invasion, subsequently up-regulates the expression of PAI-1 and -2 in E V T s (Graham, 1997; Karmakar and Das, 2002). Based on these observations, it has been suggested that u P A plays a key role in regulating the invasive capacity of E V T s during human implantation. 18 1.3.1-B Matrix metalloproteinases and their inhibitors The M M P s are a gene family of 23 zinc-dependent endopeptidases that mediate a variety of tissue remodeling processes (Feinberg, et al, 1989; Woessner, 1991; Bischof et al, 2001; Nagase et al, 2006). The M M P s are synthesized as latent precursors that must be cleaved following secretion in order to become activated (Fingleton, 2006). The activity of M M P s can further be regulated by the secretion of tissue inhibitors of M M P s (TIMPs; Handsley and Edwards, 2005). According to their substrate specificity and structure, members of the M M P gene family can be classified into four subgroups; the gelatinases, collagenases, stromelysins and membrane bound subgroups (Fingleton, 2006). The gelatinases ( M M P - 2 and -9) digest type IV collagen, a prominent basement membrane protein. Collagenases ( M M P - 1 , -8, and -13) digest types I, II, III, VII , and X collagens, which are major constituents of interstitial E C M . Stromelysins ( M M P -3, -7, -10, -11, and -12) have a broad substrate specificity in that they digest type IV, V and VII collagens, laminin, fibronectin, elastin and proteoglycans. Membrane-bound M M P s (MMP-14 , -15 and -16) predominantly function in activating p roMMP-2 by cleaving it at the cell surface (Bischof al, 2001). M M P s not only play important roles during physiological E C M remodeling, but also play crucial roles during E C M remodeling and degradation during various pathologies, including inflammatory diseases, cancer cell invasion and metastasis (Egeblad and Werb, 2002; Burrage et al, 2006). M M P - 2 and M M P - 9 were among the first members of the M M P family to be cloned and characterized (Liotta et al, 1980; Collier et al, 1988). Localization of these M M P s in malignant cells has provided evidence for their respective roles in cancer cell invasion (Collier et 19 al, 1988). Indeed, there are strong correlations with M M P expression and/or over-expression in metastasizing cancer cells (Jodele et al, 2006). However, the expression of M M P s in cancer is not solely confined to cancer cells, as their expression has been documented in stromal and endovascular cells adjacent to cancer cells. For example, the expression of M M P - 2 has been localized to stromal cells surrounding invasive cutaneous melanomas (Hofmann et al, 2005). In addition, the expression of M M P - 2 , M M P - 9 and M M P - 1 4 have been localized to vascular endothelial cells in certain cancers (Basset et al, 1990; Jia et al, 2000; Chun et al, 2004). These findings emphasize the often ignored role that M M P s play in regulating cancer cell invasion through paracrine manners. The roles M M P s play in cancer are diverse and complex. It was initially believed that M M P s facilitated tumorigenesis solely through degradation of E C M components thus enabling tumor invasion, intravasation into blood or lymphatic circulation, extravasation from the circulation and local migration/invasion at metastatic sites (Crawford and Matrisian, 1994). However it is now known that M M P s also play crucial roles in regulating cell-cell adhesion (Kuefer et al, 2003; Hendrix et al, 2003), c e l l - E C M adhesion (Deryugina et al, 2002; Ratnikov et al, 2002), and growth factor/cytokine availability (Zhang et al, 2004; Koshikawa et al, 2005), all of which are processes that regulate cancer cell invasion. For example, M M P - 7 , -12 and -13 in prostate and lung cancer have been demonstrated to cleave the extracellular domain of the C A M , E-cadherin (Noe et al, 2001; Kuefer et al, 2003; McGuire et al, 2003). Cleavage of the extracellular domain leads to a significant reduction in cell-cell adhesion (McGuire et al, 2003). Furthermore, studies have shown that the soluble 80 kDa E-cadherin fragment generated by M M P cleavage results in paracrine inhibition of E-cadherin-mediated cell-cell adhesion, an 20 increase in the expression of other M M P s , and increased cancer cell invasion (Nawrocki-Raby et al, 2003). Human trophoblastic cells have been shown to produce several M M P s , including M M P -1, -2, -3, -7, -9, -11, -13 and -14 (Fisher et al, 1989; M o l l and Lane, 1990; Librach et al, 1991; Auto-Harmainen et al, 1992; Polette et al, 1994; Nawrocki et al, 1994; Vettraino et al, 1996; Huppertz et al, 1998; Hurskainen et al, 1998; Vegh et al, 1999; Sawicki et al, 2000). E V T s of the first trimester express both gelatinase A ( M M P - 2 ) and gelatinase B ( M M P - 9 ) in vivo (Fisher et al, 1989; Polette et al, 1994; Shimonovitz et al, 1994). Furthermore, the expression of these M M P s has also been shown in cultures of trophoblastic cells propagated from first trimester chorionic villous explants (Librach et al, 1991; X u et al, 2000). Additionally, M M P - 1 4 is expressed by human E V T s in vivo, suggesting a potential autocrine mechanism for regulating M M P - 2 activity in early pregnancy (Narwocki et al, 1995; Hurskainen et al, 1998). The inhibition of M M P - 2 and -9 in E V T s significantly reduces their invasive capacity through the laminin-rich E C M substrate Matrigel, providing evidence that these M M P s play key roles in regulating trophoblast invasion during early pregnancy (Librach et al, 1991; Staun-Ram et al, 2004). Furthermore, IL-1 and E G F , factors that are expressed by E V T s and endometrial cells in vivo, increase the invasive capacity of trophoblastic cells in vitro in part by increasing the expression levels of M M P - 2 and M M P - 9 (Shimonovitz et al, 1996; Karmakar and Das, 2002; Qiu et al, 2004). These M M P s have also been shown to be differentially regulated in cultures of trophoblastic cells propagated from early (6-8 weeks) or late (9-12 weeks) first trimester chorionic villous explants (Xu et al, 2000; Staun-Ram et al, 2004). Specifically, M M P - 2 expression is highest in trophoblastic cells propagated from early placental tissues whereas M M P - 9 expression is highest in trophoblastic cells propagated from late placental tissues. 21 Studies done in vivo have demonstrated that M M P - 2 and -9 are preferentially expressed in differentiating E V T s of the extravillous column and in interstitial E V T s during the first trimester of pregnancy, with low levels of these proteinases being detected in proliferating columnar E V T s (Huppertz et al, 1998). Although the expression and function of the gelatinases M M P - 2 and -9 in trophoblastic cells have demonstrated their importance in regulating trophoblast invasion during placentation, mice null-mutant for M M P - 2 and -9 are viable and fertile (Ducharme et al, 2000; Asahi et al, 2001; Ratzinger et al, 2002). The expression of M M P - 2 , M M P - 9 , M T 1 - M M P and u P A in subpopulations of E V T s differentiating along the E V T pathway is illustrated schematically in Figure 1.2. TIMP-1 , -2 and -3 are produced by human trophoblastic and decidual cells (Graham and Lala, 1991; Polette et al, 1994; Higuchi et al, 1995; Hurskainen et al, 1996; Ruck et al, 1996). The expression of these TIMPs in trophoblasts and decidua suggest that autocrine and paracrine regulation of M M P activity occurs during human implantation. The ability of TIMP-1 and -2 to inhibit E V T invasion has been demonstrated in vitro (Graham and Lala, 1991; Librach et al, 1991). Consistent with these findings, T G F - p i , a growth factor shown to inhibit trophoblast invasion (Lash et al, 2005), has been demonstrated to increase the expression of TIMP-1 and TIMP-2 in trophoblastic cells (Karmakar and Das, 2002). Although TIMP-2 can serve as an inhibitor of M M P - 2 activity, the recruitment of this secreted protein into a complex with M M P -14 can also activate this proteinase (Strongin et al, 1993; 1995; Young et al, 1995). Studies have demonstrated that TIMP-3 expression is up-regulated during trophoblast invasion in vitro (Bass et al, 1997). The expression levels of M M P - 9 and TIMP-3 are coordinately regulated in these primary cultures, suggesting that an intricate balance between the production of 22 Z o n e 1 Z o n e 2 Figure 1.2: Schematic representation of the MMP and uPA expression patterns during E V T differentiation along the E V T pathway. Zone l depicts the proteinase expression in intermediate EVTs in the E V T column. Zone 2 depicts the proteinase expression in interstitial and endovascular EVTs invading through the endometrial stroma and maternal blood vasculature (BV). The arrow denotes the increase in the invasive phenotype of EVTs as they progress along the EVT pathway. (Adapted from Zhou et al, 1997a). 23 proteases and their inhibitors modulates the overall proteolytic activity of trophoblastic cells during human implantation. 1.3.2 Cell-extracellular matrix interactions C e l l - E C M interactions are mediated by several classes of C A M s , one of the best characterized being the integrins (Hynes, 1992; Berman and Kozlova, 2000). This gene family of integral membrane glycoproteins is comprised of non-covalently associated heterodimeric a and P subunits that both mediate Ca 2 +-dependent c e l l - E C M and cell-cell interactions (Danen and Sonnenberg, 2003; White, 2003). The ligand specificity of the different integrin heterodimers is determined by the paired combination of a and P subunits that are expressed on the cell surface (Kuphal et al, 2005). Integrin binding to specific E C M components not only anchors the cell to the surrounding E C M but also provides the molecular framework for cellular migration, invasion and diverse signal transduction pathways (Lafrenie and Yamada, 1996). Subunit grouping and ligand specificity allows for integrins to be grouped into four subfamilies: the p l , the p2/p7, the av and the P3 subfamilies (Kuphal et al, 2005). The p l integrins constitute the largest subfamily and are expressed in a wide variety of tissues (Brakebusch and Fassler, 2005; Kuphal et al, 2005). The P2 and P7 subfamilies are leukocyte-specific receptors that mediate interactions between intercellular adhesion molecules ( ICAMs) , E-cadherin and fibrinogen (Kuphal et al, 2005). The a v integrin subfamily plays key roles in mammalian organogenesis (Wada et al, 1996; Kuphal et al, 2006). Subsequently av integrins are found in variety of normal and pathological tissues and cells and can bind with a variety of 24 ECM-associated proteins (van der Flier and Sonnenberg, 2001). The (33 subfamily seems to be primarily associated with cancer and other histopathologies (Trikha et al, 1997). Studies have shown that the expression of integrins is frequently changed during malignant transformation and during normal and pathological cell migration processes ( K i m et al, 1992; Leavesley et al, 1994; Jones et al, 1996; Galliher and Schiemann, 2006). Additionally, the upregulation of specific integrin subtypes is associated with the acquisition of a metastatic phenotype (Marshall et al, 1998). For example, av, a2, a3, and a4 integrin subunits correlate with an increase in the metastatic potential of primary melanomas (Moretti et al, 1993; Yoshinaga et al, 1993; Hartstein et al, 1997; Nikko la et al, 2004). Another example is the aberrant expression of av(33 integrin in breast cancer cells and in highly metastatic skin cancers (Felding-Habermann et al, 1992; Galliher and Schiemann, 2006). In these examples, ocvp3 elicits an E M T - l i k e transition and facilitates tumorigenesis partly by activating the Src-family kinase member pp 6 0 c " S r c , and the kinase F A K (focal adhesion kinase), which then coordinately increase the expression and activation of M M P - 2 and reorganize the actin cytoskeleton (Seftor et al, 1992; Hofmann et al, 2000; Godefroy et al, 2005; Samanna et al, 2006). The roles integrins play in facilitating cancer cell development is in part due to their ability to regulate anchorage independent growth, facilitate invasive growth, prevent apoptosis of invading cells and increase tumor growth (Kuphal et al, 2005). Integrins also organize the actin cytoskeleton at sites of cell adhesion and regulate Rho family GTPases to control the dynamics of actin-based structures involved in cell motility (Brakebusch and Fassler, 2005; Munshi and Stack, 2006). Furthermore, integrins have been shown to facilitate growth factor-mediated signaling processes that lead to modulations in mitogenic, motogenic and cell survival pathways (Moro et al, 1998; Mariotti et al, 2001). 25 Human trophoblastic cells express an array of integrin subtypes on their cell surface. Studies have shown that changes in integrin receptor expression occur as trophoblasts differentiate along the invasive E V T pathway (Zhou et al, 1997a; Ki lburn et al, 2000; Bischof and Irminger-Finger, 2005). For example, a reduction in the expression of the oc6 and (34 integrin subunits has been demonstrated in cytotrophoblasts differentiating into invasive interstitial E V T s from poorly-invasive polarized intermediate columnar E V T s in vivo (Damsky et al, 1992; Ap l in , 1993; Burrows et al, 1993). Human E V T s express a diverse repertoire of integrin subunits, including the oc ip i , a 5 p i and the avp3 heterodimeric receptors (Fisher et al, 1989; Damsky et al, 1992; Burrows et al, 1993; Zhou et al, 1993; Irving et al, 1995; Zhou et al, 1997a). Function-disrupting antibodies specific for a i p i , a receptor for collagen type IV and laminin (Ignatius et al, 1990) or avP3, a receptor for vitronectin, fibronectin, thrombospondin, osteopontin and denatured collagen, are capable of inhibiting trophoblastic cell invasion in vitro (Damsky et al, 1994; Zhou et al, 1997'a; Kabir-Salmani et al, 2003). Furthermore, the inhibition of ocvp3 function disrupts the interaction between cytotrophoblasts and endothelial cells in vitro, suggesting that the integrins play a role in mediating both c e l l - E C M and cell-cell interactions during placentation (Thirkill and Douglas, 1999). This observation, along with the finding that ocvp3 integrin promotes an invasive phenotype in trophoblastic cells (Zhou et al, 1997a), suggest that E V T s express an integrin C A M phenotype that facilitates trophoblast-endothelial remodeling processes. The role(s) of the a 5 p i integrin heterodimer, a receptor for fibronectin (Fogerty et al, 1990), in E V T differentiation remains controversial (Damsky et al, 1994; Irving and Lala, 1995; A p l i n et al, 1999). Damsky et al (1994) demonstrated that trophoblastic cells cultured in the presence of a 5 p i integrin blocking antibodies were highly invasive in vitro. In contrast, Irving 26 and Lala (1995) found that function-disrupting antibodies for the a5(31 integrin heterodimer were capable of inhibiting the invasive capacity of primary cultures of E V T s . Similarly, insulin-like growth factor binding protein (IGFBP-1) has been shown to interact with the oc5 integrin subunit in human trophoblastic cells and thereby inhibits cellular invasion in these cultures (Irwin and Guidice, 1998). Finally, function-disrupting antibodies for the a5(31 integrin subunits are capable of disrupting the organization of E V T columns that develop in chorionic villous explant cultures (Apl in et al, 1999). These conflicting findings may be attributed to differences in the cell isolation procedures and culture conditions used in these studies. The expression of integrins shown to play key roles in regulating invasion in subpopulations of E V T s differentiating along the E V T pathway is illustrated in Figure 1.3. Integrin binding to specific components of the E C M can activate signal transduction pathways in human trophoblastic cells (Burrows et al, 1995, Ilic et al, 2001; Kabir-Salmani et al, 2003). For instance, integrin-mediated binding to fibronectin or Matrigel was shown to result in F A K (auto)phosphorylation of tyrosine 397 ( Y 3 9 7 F A K ; Ilic et al, 2001). Y 3 9 7 F A K (auto)phosphorylation results in the recruitment of additional signaling proteins to integrin-mediated focal adhesions, such as Src-family protein tyrosine kinases and PI 3 (phosphoinositide 3)-kinase, that lead to the activation of signaling pathways such as the extracellular signal-related kinase ( E R K ) and c-Jun N - terminal kinase (JNK)/mitogen-activated protein kinase pathways (Schlaepfer et al, 1999). Additionally, insulin-like growth factor I (IGF-I)-mediated migration and invasion of E V T s were shown to be dependent upon avp3 integrin activation of F A K (Kabir-Salmani et al, 2003). Collectively these observations suggest that integrin-ECM interactions regulate intracellular signaling events involved in controlling trophoblast 27 Z o n e 1 Z o n e 2 Figure 1.3: Schematic representation of the integrin C A M expression pattern during E V T differentiation along the E V T pathway. Zone l depicts integrin expression in intermediate E V T s in the E V T column. Zone 2 depicts integrin expression in interstitial and endovascular E V T s invading through the endometrial stroma and maternal blood vasculature (BV) . The integrin expression pattern in the E V T column, endometrial interstitium and B V correlates with the cell color. The arrow denotes the invasive phenotype of E V T s as they progress along the E V T pathway. (Adapted from Zhou et al, 1997a). 28 differentiation and invasion. Indirect support for this hypothesis has been obtained from studies demonstrating alterations in the spatiotemporal expression of integrin subunits in trophoblastic cells of preeclampsia, a disease of pregnancy characterized in part by a poorly-invasive placenta (Zhou etal, 1997b). 1.3.3 Extracellular matrix composition: Regulation of c e l l - E C M interactions and proteolysis Trophoblastic cells penetrating the uterine wall and invading/migrating through the endometrial stroma and vascular endothelium encouter basement membrane E C M proteins (collagen IV, heparin sulphate proteoglycans, entactin, and laminin), interstitial E C M proteins (fibronectin and collagens I/III), and endothelial E C M proteins such as vitronectin (Burrows et al, 1996; Salamonsen and Nie, 2002). Decidual cells also express high amounts of laminin at their periphery, and in doing so create their own basement membrane during the secretory phase of the menstrual cycle (Burrows et al, 1996). A s discussed previously, trophoblastic cells secrete proteinases capable of degrading these E C M components, and in doing so remove structural barriers preventing trophoblast penetration and invasion through the endometrial stroma. E C M composition also controls motogenic events facilitated by integrins (Damsky et al, 1992; Zhou et al, 199"/'a; A p l i n et al, 1999). A s trophoblastic cells express specific combinations of a and (3 integrin heterodimers on their cell surface that bind to specific E C M ligands, trophoblastic cells are able to adhere to and migrate through E C M s (Burrows et al, 1996). Integrin C A M s are thought to facilitate E C M migration and invasion by interacting with E C M proteins at the leading/migrating edge of the cell and by becoming internalized at the trailing edge of the cell, a process that in essence utilizes the E C M as a platform for facilitating cell migration (Burrows et 29 al, 1996). Furthermore, as discussed in the previous subsection, ECM-integrin binding activates cell signaling pathways capable of regulating the expression of genes that promote cellular invasion (Kabir-Salmani et al, 2003; Kuphal et al, 2005). Cytotrophoblasts also contribute to the mileu of E C M proteins at the feto-maternal interface (Burrows et al, 1996). For example, villous cytotrophoblasts secrete basement membrane-associated E C M proteins like laminin, whereas interstitial E V T s predominantely secrete fibronectin (Huppertz et al, 1996). E C M proteins produced by cytotrophoblasts are thought to control their differentiation, invasion and gene expression (Burrows et al, 1996). For example, first trimester cytotrophoblasts plated on laminin, fibronectin or vitronectin upregulate the expression of M M P -9, whereas TIMP-3 is downregulated in E V T s cultured on vitronectin (Xu et al, 2001). In support of these findings, fibronectin has been shown to promote migration in trophoblastic cells and in cancer cells, and activate protein kinases attributed to an increased invasive phenotype, such as Erk-1/2 (Apl in et al, 2000; Zhang et al, 2005; Zeng et al, 2006). Additionally, E C M proteins have been suggested to control E V T migration. For instance, tenascin, produced predominantly by the myometrium, has been suggested to inhibit E V T migration and promote E V T differentiation into placental bed giant cells (Damsky et al, 1992; Burrows et al, 1996). Therefore, it is becoming evident that E C M proteins regulate c e l l - E C M adhesion and proteinase expression in both autocrine and paracrine manners, and regulation of these molecular processes controls cytotrophoblast differentiation, migration and invasion. 30 1.3.4 Cell-cell interactions During human implantation, trophoblastic cells must alter their repertoire of C A M s as these cells differentiate and invade into the maternal endometrium (Burrows et al, 1996; Kimber and Spanswick, 2000). E V T s have been shown to express a variety of C A M s , and their expression levels appear to be regulated spatially and temporally within the E V T column, the endometrial interstitium, and maternal vasculature (Burrows et. al, 1994; Proll et al, 1996; Shih et al, 1998; Floridon et al, 2000). For example, E V T s have been demonstrated to express members of the immunoglobin (Ig) gene superfamily of Ca 2 +-independent C A M s during the first trimester of pregnancy, and these include intercellular ( I ) - C A M - l , neural ( N ) - C A M , vascular ( V ) - C A M - l , platelet-endothelial ( P E ) - C A M - l , melanoma ( M e l ) - C A M and carcinoembryonic antigen ( C E A ) -C A M (Damsky et al, 1992; Burrows et al, 1994; Shih and Kurman, 1996; Coukos et al, 1998; Bamberger et al, 2000). The functional role(s) these C A M s play in regulating trophoblast differentiation appear to be in mediating heterotypic and heterophilic cell-cell interactions between E V T s and maternal smooth muscle, endothelia and decidua (Proll et al, 1996; Shih et al, 1998; 1999). For example, M e l - C A M has been shown to facilitate E V T heterotypic adhesion to uterine smooth muscle, and function-pertubing antibodies to M e l - C A M lead to an increase in E V T migration, suggesting that this C A M plays a role in controlling E V T migration/invasion during early pregnancy (Shih et al, 1998). E V T s also express endothelial (E)-selectin (Milstone et al, 2000), a member of the selectin gene family of Ca 2 +-dependent C A M s that mediate leukocyte-endothelial cell interactions during inflammatory responses (Vestweber, 1992; Varki , 1994). The biological significance of E-selectin expression in E V T s remains largely undefined, however it likely that this C A M facilitates trophoblast-endothelial interactions within uterine 31 spiral arteries and therefore mediates in part the development of the hemochorial placenta (Milstone et al, 2000). The expression of cadherins in the human placenta has been previously described (Zhou et al, 1997a; MacCalman et al, 1998). Cadherins are integral membrane glyoproteins that mediate Ca 2 +-dependent cell-cell adhesion in a homophilic manner and play key roles in a number of biological processes such as epithelial polarization, cell sorting, cell migration, cell differentiation, and organogenesis (Peyrieras et al, 1983; Vestweber et al, 1985; Johnson et al, 1986; Hatta and Takeichi, 1986; Takeichi, 1988; 1990; Rutishauser, 1989; Gumbiner, 1996). The roles cadherins play in regulating aspects of cell development have also implicated these C A M s in a variety of pathologies such as cancer, cardiac diseases, skin and intestinal diseases, and in some infectious diseases (Brackenbury, 1988; Thiery et al, 1988; Chidgey, 2002; Cavarallo and Christofori, 2004; Ahmed, 2006; L i et al, 2006). Not surprisingly, cadherins have received a lot of attention with the hope that understandings in developmental and pathological processes may be furthered. Based on amino acid sequence homology and structural features, the cadherin gene superfamily has been grouped into distinct subfamilies: the classical/type-I cadherins, the atypical/type-II cadherins, the desmosomal cadherins, which are further subdivided into desmocollins and desmogleins, the flamingo cadherins, the protocadherins and finally the unclassified cadherins (Nollet et al, 2000). The cadherin subtypes that are best characterized are the classical/type-I cadherins and include epithelial (E)-cadherin, neural (N)-cadherin, placental (P)-cadherin and retinal (R)-cadherin (Yoshida-Noro et al, 1984; Hatta et al, 1985; 1988; Nose and Takeichi, 1986; Nose et al, 1987; Nagafuchi et al, 1987; Inuzuka et al, 1991; Suzuki et al, 1991). 32 To date, the cadherins that have been detected in invasive E V T s are vascular-endothelial (VE)-cadherin, an unclassified cadherin subtype closely related to the atypical/type-II cadherin subfamily, and cadherin-11, an atypical/type-II cadherin subtype (MacCalman et al, 1996, 1997; Zhou et al, 1997a). The expression of E-cadherin has been detected in proliferating intermediate E V T s of the extravillous column (Floridon et al, 2000). Studies have demonstrated that villous cytotrophoblasts differentiating along the E V T pathway lose the expression of E-cadherin (Zhou et al, 1997a; Floridon et al, 2000). The loss of E-cadherin in differentiating invasive trophoblastic cells is in agreement with the current understanding that E-cadherin functions as an invasion suppressor (Cavallaro et al, 2002). The loss of E-cadherin may facilitate the migratory and invasive phenotype of E V T s in the endometrium or may allow for these trophoblastic cells to interact with maternal endothelia and stroma. The roles cadherin C A M s play in regulating cell invasion is discussed in more detail in section 1.5. The expression of cadherin subtypes expressed in subpopulations of trophoblast cells differentiating along the E V T pathway is illustrated in Figure 1.4. Despite significant insights into the molecular mechanisms involved in trophoblast differentiation and invasion, there is still a significant lack of understanding in what regulates these processes. Furthermore, knowledge of the putative molecular mechanisms involved in aberrant trophoblast development and placentation are severely lacking. In view of our current understandings of the proteolytic and adhesive mechanisms involved in regulating trophoblast invasion during human placentation, we have chosen to focus our studies by characterizing the novel proteinase family, A D A M T S , and members of the classical/type-I cadherin subfamily, in the molecular roles they play in controlling trophoblast invasion. 33 E-cadherin expressing 0 ^ E-cadherin expressing (reduced) (^m) E-cadherin negative (^•) VE-cadherin expressing (£m) Cadherin-11 expressing | n t e r m e d i a t e E x t r a v i | | o u s Cytotrophoblasts / \ n Endovascular Extravillous Cytotrophoblasts Interstitial Extravillous Cytotrophoblasts Z o n e 1 Z o n e 2 Figure 1.4: Schematic representation of the cadherin C A M expression pattern during E V T differentiation along the E V T pathway. Zone 1 depicts cadherin expression in intermediate E V T s in the E V T column. Zone 2 depicts cadherin expression in interstitial and endovascular E V T s invading through the endometrial stroma and maternal blood vasculature (BV) . The syncytial cytotrophoblast is depicted as the multinucleated structure. The cadherin expression pattern in the E V T column, endometrial interstitium and B V correlates with the cell color. The arrow denotes the invasive phenotype of E V T s as they progress along the E V T pathway. (Adapted from Zhou et al, 1997a). 34 1.4 The A D A M T S gene family of metalloproteinases The A D A M T S are a novel family of secreted zinc-dependent metalloproteinases first described in 1997 with the characterization of A D A M T S - 1 , a cachexigenic tumor selective gene involved in inflamation (Kuno, et al. 1997). Since then an additional 18 A D A M T S subtypes have been described (Porter et al, 2005). A t the structural level, A D A M T S proteins are characterized by a signal-peptide, a prodomain, a metalloproteinase domain, a disintegrin-like domain, a central thrombospondin type I module, a spacer region, and depending upon the A D A M T S subtype, an undefined number of thrombospondin type I repeats (Porter et al, 2005). The A D A M T S are members of the Adamalysin family of metalloproteinases, of which other members include the disintegrin-containing snake venom metalloproteinases and A D A M s , multidomain proteins consisting of a disintegrin and metalloproteinase domain (White, 2003). A D A M metalloproteinase domains have been shown to induce ectodomain shedding of integral membrane proteins and cleave E C M components (Blobel, 2000; White, 2003). The proteolytic activity of A D A M s has also been shown to promote cell invasion in brain tumors (Shintani et al, 2004; Wildeboer et al, 2006). Furthermore, the disintegrin and cysteine-rich domains of A D A M s facilitate cell adhesion processes, primarily through integrin-mediated mechanisms (Eto et al, 2002; Bridges et al, 2003; Seals and Courtneidge, 2003). A D A M T S share close homology to the A D A M metalloproteinases, however they differ from A D A M s in that they are secreted proteins and contain thrombospondin type I motifs at the carboxy (C)-terminal region. A D A M T S further differ from A D A M s in that their disintegrin-like domain has yet to be determined as functional. In A D A M metalloproteinases this domain has been shown to interact with integrins on the cell surface of other cells and has therefore given this unique gene family 35 both proteolytic and cell-adhesive properties. The A D A M T S disintegrin domain lacks the canonical cysteine signature of snake venom disintegrins, although it has primary sequence similarity to these disintegrins (Apte, 2004). 1.4.1 Characterization and structure of the A D A M T S metalloproteinases The A D A M T S are organized into conserved domains. These domains are portrayed schematically in Figure 1.5. Overall, there is more variability between the different A D A M T S proteins at the C-terminal than at the amino (N)-terminal. The A D A M T S are synthesized initially as inactive pre-proenzymes that undergo N-terminal processing prior to being secreted from the cell. The first step in A D A M T S processing involves cleavage of the signal peptide domain by a signal peptidase during translation and transit of the protein through the endoplasmic reticulum (Porter et al, 2005). The second step involves removal of the pro-domain. The pro-domain is generally thought to preserve the latency of the enzyme but its removal may also be important for correct protein folding and secretion (Mi l l a et al, 1999; Cao et al, 2000). The mechanism by which A D A M T S enzyme latency is controlled is thought to involve a substilin-like pro-protein convertase (SPC) cleavage site in the pro-domain (Bergeron et al, 2000). The majority of A D A M T S subtype SPC cleavage sites appear to be cleaved by the converting-enzyme furin (Rodriguez-Manzaneque et al, 2000; Cal et al, 2001; Sommerville et al, 2003; 2004a), however the. possibility of other SPC enzymes cannot be discounted as A D A M T S -4 prodomain processing has been observed in furin-deficient cell lines (Wang et al, 2004). Several A D A M T S subtypes have one or more additional SPC cleavage sites upstream from the 36 Figure 1.5: Schematic representation of the basic domain structures of the A D A M T S family of metalloproteinases. The A D A M T S are a secreted protein and are comprised of a signal peptide, a pro-domain, a metalloproteinase domain, a disintegrin-like domain, and an ancillary/extracellular matrix binding region consisting of a central thrombospondin (TS) type I domain, a cysteine-rich region, a spacer region, and depending on the A D A M T S subtype, any number of TS repeats. The A D A M T S carboxy terminal may further contain a P L A C domain, a GON-1 domain, a C U B domain and/or a P N P domain. 37 primary site. However, the importance of these additional cleavage sites remain poorly characterized (Wang et al, 2003). Interestingly, A D A M T S - 7 and -13 have been shown to be catalytically active regardless of whether their pro-domain has been processed, further complicating our understanding of how the activity of these proteinases is regulated (Sommerville et al, 2004a). Following the pro-domain is the catalytic or M M P - l i k e domain (Apte, 2004). The M M P -like domain consists of a reprolysin-type zinc-binding motif characterized by an amino acid sequence of H E X X H X X G / N / S X X H D , where ' X ' represents any amino acid residue (Porter et al, 2005). The aspartic acid residue is conserved in A D A M and A D A M T S metalloproteinases but not in M M P s (Porter et al, 2005). Furthermore, a methionine residue exists within the sequence downstream of the third zinc-binding histidine residue and forms a structure known as a "Met-turn" (Kuno et al, 1997; Vasquez et al, 1999; Tortorella et al, 1999; Porter et al, 2005). The proximity of the Met-turn structure to histidine ligands of the zinc-binding motif have led to the assumption that it plays an essential role in the structure and/or activity of metalloproteinases (Gomis-Ruth, 2003). Proximal to the M M P - l i k e domain is the disintegrin-like domain. This domain shares sequence similarity to the soluble snake venom disintegrins, a family of polypeptides of which some members contain an arginine-glycine-aspartic acid (RGD) integrin recognition sequence (Perutelli, 1995; Porter et al, 2005). Interestingly, A D A M T S subtypes do not contain an R G D sequence in their disintegrin-like domain and there appears to be no evidence to suggest that A D A M T S metalloproteases interact with integrins (Porter et al, 2005). The function of this domain has yet to be elucidated. The remaining subdomains of the A D A M T S metalloproteinases are referred to as the ancillary or ECM-binding domains due to their ability to interact with components of the E C M 38 (Apte, 2004). The first ECM-binding domain is a central thrombospondin type I-like (TSP) repeat, a domain that has been previously characterized in the glycoproteins thrombospondin-1 and -2 (Kuno et al, 1997; Kuno and Matsushima, 1998; Porter et al, 2005). Thrombospondins are multidomain calcium-binding extracellular glycoproteins that associate with the E C M and play key roles in platelet aggregation, inflammatory responses, and angiogenesis during wound repair and tumor growth (Bornstein et al, 2000; Tucker, 2004; Adams and Lawler, 2004). In addition to these properties, thrombospondins have also been shown to modulate cell proliferation, cell migration and invasion possibly through regulating extracellular proteinases, cytokines and growth factors (Adams, 2001; Bornstein et al, 2004). Following the central TSP repeat is a highly conserved cysteine-rich domain containing ten cysteine residues, a spacer domain of variable length and a varying number of C-terminal TSP repeats that range in number from 14 C-terminal repeats ( A D A M T S - 2 0 ) to none ( A D A M T S - 4 ; Tortorella et al, 1999; Llamazares et al, 2003). The significance of the ECM-binding domains in regards to A D A M T S function w i l l be discussed below. Some A D A M T S subtypes contain additional C-terminal modules. In particular, A D A M T S - 7 and -12 both have a mucin domain between the third and fourth TSP repeat (Cai et al, 2001; Somerville et al, 2004b). Other A D A M T S subtypes ( A D A M T S - 9 and -20) contain a G O N domain, first described in gon-1, an A D A M T S subtype involved in gonadal development in Caenorhabtitis elegans (Blelloch and Kimble , 1999). The G O N domain is characterized by the presence of several conserved cysteine residues (Llamazares et al, 2003). A D A M T S - 1 3 is a unique A D A M T S subtype in that it contains two C U B [complement subcomponent Clr/Cls/embryonic sea urchin protein Uegf (urchin epidermal growth factor)/bone morphogentic protein 1] domains (Zheng et al, 2001). Most C U B domain-containing proteins are thought to be 39 involved in developmental processes such as embryogenesis or organogenesis (Bork and Beckmann, 1993). Finally, A D A M T S - 2 , -3, -10, -12, -14, -17 and -19 contain a P L A C (protease and lacunin) domain at their C-terminal (Nardi et al, 1999; Cai et al, 2001; Sommerville et al, 2003). P L A C was first described as a C-terminal domain of unknown function in the E C M protein, lacunin, but has since been attributed to playing roles in epithelial remodeling in embryos and wing development in the moth (Manduca sexta; Nardi et al, 1999). 1.4.2 A D A M T S expression and biological functions A D A M T S metalloproteinases play key roles in a diverse set of biological processes, both physiological and pathological, and appear to function generally as secreted proteolytically active enzymes that degrade/remodel a wide variety of structural and biologically active E C M proteins involved in growth and development. Not surprisingly, A D A M T S have been suggested to play important roles in numerous developmental processes, exemplified by high levels of ADAMTS-sub type expression in fetal tissues (Cai et al, 2001; 2002; Sommerville et al, 2003), and in normal adult tissue maintenance (Colige et al, 2005). Furthermore, the import roles that A D A M T S play in tissue-remodeling events are in accordance with their well-described roles in diseases such as arthritis (Flannery et al, 2002) and their putative roles in the development of cancer (Matthews et al, 2000; Porter et al, 2004), which are decribed in more detail in subsection 1.1.4. The identification of A D A M T S - 1 in a cytokine-induced cancer cachexia model in mouse colon 26 adenocarcinoma cells, established a role for this novel gene family in inflammatory 40 diseases (Kuno et al, 1997). Subsequently, other members of the A D A M T S family have been shown to play critical roles in initiating inflammatory responses in osteoarthritis (Arner et al, 1999; Tortorella et al, 1999; Kuno et al, 2000; Yamanishi et al, 2002). For example, the over-expression of A D A M T S - 4 and -5 in osteoarthritic articular cartilage suggested these proteinases play key roles in the development this inflammatory disease (Arner et al, 1999; Tortorella et al, 1999). Indeed these proteinases are capable of cleaving the G l u 3 7 3 - A l a 3 7 4 cleavage site in aggrecan (Tortorella et al, 1999), however, it was demonstrated in mice null-mutant for A D A M T S - 4 , that this proteinase is not the major enzyme responsible for osteoarthritic development (Glasson et al, 2004). In contrast, osteoarthritic cartilage destruction in mice null-mutant for A D A M T S - 5 was shown to be significantly less than in wildtype mice, indicating the importance of this aggrecanse in the onset of arthritis (Glassen et al, 2005). In addition to A D A M T S - 4 and -5, A D A M T S - 1 , -8, -9, and -15 have also been demonstrated to have aggrecan-degrading abilities in vitro and in vivo (Kuno et al, 2000; Sandy et al, 2001; Somerville et al, 2003; Collins-Racie et al, 2004). Furthermore, A D A M T S - 7 and -12 have recently been shown to play key roles during the onset of osteoarthritis in part by their ability to degrade the cartilage oligomeric matrix protein ( C O M P ; L i u et al, 2006a; 2006b). The expression of multiple A D A M T S subtypes in articular cartilage suggests that there is some overlap/compensation amongst these proteinases in initiating inflammatory responses in arthritic disease. In view of this, it would not be surprising to observe overlapping roles for A D A M T S in other inflammatory responses, such seen during wound repair and in endometrial decidualization. In addition to playing critical roles in inflammatory processes, A D A M T S - 1 , along with A D A M T S - 8 , have been demonstrated to function as potent angio-inhibitors (Vasquez et al, 1999). Specifically, these metalloproteinases inhibited fibroblast growth factor (FGF)-2 induced 41 vascularization of the cornea pocket assay and vascular endothelial growth factor ( V E G F ) -induced angiogenesis in the chorioallantoic membrane assay. It is has been suggested that the TSP-type 1 motif and repeats in the C-terminal of A D A M T S - 1 and -8 facilitate these angio-inhibitory actions as it has been previously shown that the TSP repeats in thrombospondin-1 and -2 inhibit angiogenesis (Vasquez et al, 1999; Lawler and Detmar, 2004). The normal suppression of angiogenesis by thrombospondin-1 and -2 involves multiple mechanisms including direct interaction with V E G F , inhibition of M M P - 9 activation, inhibition of endothelial cell migration and induction of endothelial cell apoptosis (Lawler and Detmar, 2004). Although the molecular mechanisms involved in the ability of A D A M T S - 1 and -8 to inhibit angiogenesis have not been accurately defined, both A D A M T S subtypes inhibited endothelial proliferation suggesting a similar mechanism(s) used by thrombospondin-1 and -2 (Vasquez et al, 1999). In addition to aggrecan, A D A M T S - 1 , -4, -5 and -9 can cleave the closely related E C M -associated aggregating chondroitin sulfate proteoglycans versican and brevican (Russell et al, 2003; Sandy et al; 2001; Somerville et al; 2003; Westling et al, 2004). Versican has been identified in a variety of tissues and appears to be ubiquitously expressed (Wu et al, 2005). Recent studies have demonstrated the importance of versican degradation by A D A M T S - 1 and -4 in cumulus and endothelial cells of the ovulating ovary and there is evidence to suggest A D A M T S - 1 plays key roles in versican-remodeling processes in vascular smooth muscle cells in the human aorta (Jonsson-Rylander et al, 2005; Richards et al, 2005). Brevican, one of the main chondroitin sulfate proteoglycans in the central nervous system, putatively influences neurite outgrowth by inhibiting neural cell migration (Mckeon et al, 1999; Dityatev and Schachner, 2003). It is thought that cleavage of brevican by endogenous proteinases may facilitate neural cell development and regeneration (Mayer et al, 2005). With the recent findings 42 that A D A M T S - 1 and -4 are capable of cleaving brevican and that their expression has been detected in the human and rat brain, it is tempting to speculate that these metalloproteinases facilitate processes such as neuro-regeneration and brain development. Taken together, these studies emphasize the importance of A D A M T S function in a variety of tissues. A D A M T S - 2 , -3 and -14 are characterized as procollagen N-proteinases (Porter et al, 2005). These enzymes play key roles in the processing of procollagens into mature collagen in the skin through a process that involves the removal of the N-terminal propeptide of procollagen (Fernandes et al, 2001; Colige et al, 1997; 1999; 2002). A D A M T S - 2 is capable of processing procollagen I, II and III, whereas A D A M T S - 3 and -14 process the N-terminals of procollagen I and II respectively. Aberrant procollagen processing has been attributed to mutations in the A D A M T S - 2 gene (Colige et al, 1999). Indeed, point and frame-shift mutations in A D A M T S - 2 result in the onset of dermatosparaxis in sheep and cattle and Ehlers-Danlos syndrome type VIIc in humans, both of which disorders are characterized by severe skin fragility (Yang et al, 1991). This phenotype has been reproduced in mice through the generation of A D A M T S - 2 null-mutants (L i et al, 2001). In addition to developing fragile skin as a result of the inability to process procollagens properly, male mice were found to be sterile, characterized by a marked decrease in testicular sperm (L i et al, 2001). This later observation illustrates the putative importance that A D A M T S - 2 plays in spermatogenesis, however the exact role(s) A D A M T S - 2 plays in this process have yet to be elucidated. A D A M T S - 1 3 has been characterized as the von Willebrand factor cleaving proteinase (vWFCP; Fujikawa et al, 2001; Levy et al, 2001). Its substrate, von Willbrande factor (vWF), is a large multimeric glycoprotein present in plasma, platelets and vascular endothelial cells. v W F functions as a carrier protein for clotting factor VIII, supports platelet aggregation and mediates 43 platelet adhesion to areas of vascular damage by binding to glycoproteins on the surface of platelets and to E C M components (Sadler, 1998; Soejima et al, 2001). Due to the shear stress v W F is subjected to during vascular insult a high protein-turnover is required and is mediated by A D A M T S - 1 3 . Deficiency of A D A M T S - 1 3 leads to the development of the disease thrombotic thrombocytopenic purpura (TTP) characterized by the formation of microvascular v W F - and platelet-rich thrombi (Levy et al, 2001). Frame-shift, splice-site and amino acid substitution mutations have been identified in the A D A M T S - 1 3 gene of individuals with TTP (Levy et al, 2001). Mutations in its C U B and spacer domains have revealed the importance of these domains in A D A M T S - 1 3 function. Furthermore, function-inhibiting autoantibodies generated in people with TTP consistently interact with the cysteine-rich/spacer regions of the E C M binding domain (Klaus et al, 2004). These findings provide yet another example of the functional significance of the ancillary components in A D A M T S function. Weill-Marchesani syndrome ( W M S ) is an autosomal recessive disorder of A D A M T S - 1 0 (Dagoneau et al, 2004). W M S is characterized by short stature, brachydactyly, eye and cardiac anomalies and progressive joint stiffness. These clinical features suggest a role for A D A M T S - 1 0 in the development of skin, eye lens and heart, as well as in bone growth. 1.4.3 Regulation of A D A M T S expression and function The similarity between the A D A M T S zinc-dependent catalytic domain and the catalytic domain of M M P s established the possibility that A D A M T S subtypes could be inhibited by the broadly effective M M P inhibitors, TIMPs. Indeed, studies have demonstrated that A D A M T S - 4 and -5 are potently inhibited by TIMP-3 with Ki values in the sub-nano-molar range (Arner et al, 44 1999; Kashiwagi et al, 2001). However, A D A M T S - 1 catalytic activity was partially inhibited by TIMP-2 as well as TIMP-3 (Rodriguez-Manzaneque et al, 2002). Based on these initial observations, TIMP-3 remains to be the most potent natural-inhibitor of the A D A M T S aggrecanases (Gendron et al, 2003). In addition to TIMP-3 , A D A M T S - 1 , -4, and -5 are effectively inhibited by catechin gallate esters found in green tea (Vankemmelbeke et al, 2003). Specifically, epigallocatechin gallate and epicatechin gallate potently inhibited all three A D A M T S subtypes with approximate IC50 values ranging from 100-250nM. Finally, inhibition of A D A M T S - 1 by the synthetic inhibitors E D T A , 1,10-phenthroline, BB-94 and MMP-inhibi tor-2 has been demonstrated (Arner et al, 1999; Kuno et al, 1999; Rodriguez-Manzaneque et al, 2000). BB-94 was also shown to inhibit A D A M T S - 1 2 activity (Cal et al, 2001). Papilin, an E C M glycoprotein found in invertebrates as well as mammals contains a conserved sequence referred to as a 'papilin cassette' (Kramerova et al, 2000). The papilin cassette shares close homology to the ancillary C-terminal domains of A D A M T S subtypes and contains one TSP type-1 domain, a specific cysteine-rich domain and several partial TSP domains but does not contain catalytic or disintegrin-like domains. In vitro, papilin was capable of inhibiting A D A M T S - 2 function in a non-competitive manner (Kramerova et al, 2000). A D A M T S - 2 inhibition by papilin is thought to be mediated by the interaction of their 'papilin cassettes'. Another family of proteins related structurally to the A D A M T S metalloproteinases is the A D A M T S - l i k e ( A D A M T S L ) family (Hirohata et al, 2002; Hal l et al, 2003). These proteins are similar in structure to papilin as they contain a papilin-cassette. However the functional relevance of these proteins in regards to regulating A D A M T S function has yet to be elucidated. A D A M T S metalloproteinase regulation by growth factors, cytokines and hormones has been described. TGF-(31 has been shown to induce A D A M T S - 2 , -4 and -12 m R N A expression 45 levels in osteosarcoma cells, human fetal fibroblasts and fibroblast-like synoviocytes and reduce A D A M T S - 1 , -5, -9, and -15 m R N A levels in prostatic cancer cells as was described earlier (Cai et al, 2001; Yamanishi et al, 2002; Wang et al, 2003; Cross et al, 2005) and reduce A D A M T S - 1 and -5 m R N A and protein levels in human endometrial stromal cells (Ng et al, 2006; Zhu et al, 2006). Recently, TGF-(31 was shown to decrease the expression of A D A M T S - 5 in decidual stromal cells (Zhu et al, 2006). A s mentioned above, IL-1 induced the expression of the aggrecanases A D A M T S - 1 , -4 and -5 in articular cartilage and chondrocytic cell lines (Pratta et al, 2003; Kashiwagi et al, 2004) as well as in cachexigenic mouse colon 26 adenocarcinoma cells (Kuno et al, 1997), and recently was shown to increase the expression of A D A M T S - 5 in decidual stromal cells (Zhu et al, 2006). Furthermore, the inflammatory cytokine IL-17 also promoted the expression of A D A M T S - 4 in bovine articular chondrocytes (Sylvester et al, 2004). The regulation of specific A D A M T S subtypes by hormonal stimuli has also been observed. Tri-iodothyronine (T3) was shown to up-regulate the expression of A D A M T S - 5 , but not A D A M T S - 4 in growth plate cartilage during endochondral ossification whereas parathyroid hormone upregulated A D A M T S - 1 m R N A expression in bone and osteoblasts (Miles et al, 2000; Makihira et al, 2003). A D A M T S - 1 expression in granulosa cells is regulated by L H / h C G in a progesterone receptor (PR)-dependent manner, as determined through P R knock-out studies (Russell et al, 2003). It was demonstrated that the mechanism by which the P R mediates A D A M T S - 1 gene expression does not involve classic P R binding elements within the promoter, but rather regulates promoter activity by regulating other transcription factors through protein-protein interactions (Doyle et al, 2004). Specifically, C A A T enhancer binding protein (3, nuclear factor 1 -like factor, and three specificity proteins (Sp)l/Sp3 binding sites within the A D A M T S - 1 promoter were shown to play key roles in regulating basal PR-mediated A D A M T S - 1 expression 46 (Doyle et al, 2004). Recently, progesterone and dihydrotestosterone were shown to coordinately increase the expression levels of A D A M T S - 1 in human endometrial stromal cells (Wen et al, 2006). The ECM-binding C-terminal domains of A D A M T S metalloproteinases have a profound impact on substrate specificity, E C M localization and enzyme function (Colige et al, 2005; Porter et al, 2005). C-terminal processing has been described for A D A M T S - 1 (Vazquez et al, 1999; Rodriguez-Manzaneque et al, 2000), A D A M T S - 4 (Gao et al, 2002), A D A M T S - 8 (Vazquez et al, 1999), A D A M T S - 9 (Somerville et al, 2003) and A D A M T S - 1 2 (Cal et al, 2001). The locations within the ECM-binding domain that have been shown to be processed include the spacer-region and in the case of A D A M T S - 1 2 , the mucin domain (Cal et al, 2001). Proteolytic cleavage of the spacer-region in A D A M T S - 4 results in an increase in the ability of this metalloproteinase to cleave aggrecan, a protein component of cartilage (Flannery et al, 2002; Gao et al, 2004). Moreover, these studies also revealed the importance of the TSP-repeats in A D A M T S - 4 as TSP-truncated A D A M T S - 4 failed to bind aggrecan and subsequently had lower aggrecan-degrading abilities. The second and fourth TSP-repeats in A D A M T S - 2 were demonstrated to increase enzymatic activity while the presence of the procollagen N-proteinase (PNP) domain positioned at the C-terminal inhibited catalytic activity (Colige et al, 2005). The central TSP-repeats were suggested to facilitate A D A M T S - 2 substrate recognition and binding, whereas it was postulated that the P N P domain might negatively regulate the catalytic activity of A D A M T S - 2 by directly interacting with the catalytic domain of A D A M T S - 2 , or indirectly by altering the recognition site of its substrate (Colige et al, 2005). It is now recognized that proteolysis of the ECM-binding domains, specifically the TSP-repeats and the spacer-region of 47 A D A M T S subtypes influences the mobility of these enzymes by altering ligand binding/recognition sites (Apte, 2004). 1.4.4 A D A M T S and cancer The role(s) A D A M T S subtypes play in the onset of cancer appear to be varied and complex. Early studies that characterized A D A M T S expression in normal and pathological tissues and cells revealed the expression of several A D A M T S subtypes in cancer and cancer cell lines (Matthews et al, 2000; Cai et al, 2001; Cai et al, 2002; Llamazares et al, 2003). For example, A D A M T S - 4 and -12 were shown to be differentially expressed between paired normal gastric and brain tissues and in gastric and brain tumors, with expression levels consistently higher in the tumor samples (Matthews et al, 2000; Cai et al, 2001). A D A M T S - 5 , -13 and -19 have all been detected in tumor cells and tissues (Cai et al, 2002; Held-Feindt et al, 2005). Furthermore, A D A M T S - 4 , and to a lesser extent A D A M T S - 5 , have been shown to play roles in promoting glioblastoma invasion (Matthews et al, 2000; Held-Feindt et al, 2005). Together, these data suggest a positive role for A D A M T S metalloproteinases in the progression of specific cancers. The functional role(s) of A D A M T S - 1 and -8 in facilitating anti-angiogenesis has led to the suggestion that these A D A M T S subtypes may act as cancer-suppressing molecules (Vazquez et al, 1999). A s described above, the mechanism thought to facilitate anti-angiogenesis involves the C-terminal TSP-repeats and spacer domain. This proposed mechanism stems from studies that have demonstrated thrombospondins-1 and -2 to inhibit both angiogenesis and tumor growth (Good et al, 1990; Weinstat-Saslow et al, 1994; Streit et al, 1999; Miao et al, 2001). Indeed, 48 studies done by Kuno et al (2004) demonstrated that A D A M T S - 1 is capable of inhibiting both tumor growth and metastasis in vivo. These studies also confirmed the importance of the C-terminal TSP-repeats and spacer region of A D A M T S - 1 , as ancillary-domain constructs were capable of inhibiting both tumor growth and metastasis. Interestingly, the full-length A D A M T S -1 protein did not inhibit tumor growth but rather tended to enhance it, whereas the full-length protein was capable of inhibiting metastasis (Kuno et al, 2004). Studies have also demonstrated that the expression levels of distinct A D A M T S subtypes in normal tissues were higher than in compliment cancers and cancer cells (Porter et al, 2004; Cross et al, 2005). For example, A D A M T S - 1 , -3, -5, -8, -9, -10 and -18 were consistently down-regulated in breast carcinomas whereas A D A M T S - 1 , -5 and -9 were detected in lower levels in prostatic stromal cells as compared to prostatic cancers. The understanding that components of the E C M in cancer are capable of influencing the invasive and metastatic phenotype of a cell is beginning to be acknowledged. In the prostate, cells that have differentiated into benign prostatic hyperplasia and prostatic cancers exhibit an accumulation of the E C M proteoglycan versican (Ricciardelli et al, 1999; Luo et al, 2002). Furthermore, versican expression appears to be an indicator of poor prognosis in prostate cancers and is enhanced by the tumor cell-derived growth factor T G F - p i (Sakko et al, 2001; Cross et al, 2005). Interestingly, Cross et al (2005) demonstrated that T G F - p i significantly decreased the expression levels of A D A M T S - 1 , -5, -9, and -15 and increased the expression of TIMP-3 , an inhibitor of A D A M T S catalytic function, in prostatic stromal cells. These data suggest that a reduction in the cleavage of versican by T I M P -3-inhibited A D A M T S subtypes contributes to the increase in stromal versican accumulation and a benign hyperplasia phenotype. 49 1.4.5 A D A M T S and implantation The fertility of female mice null-mutant for A D A M T S - 1 is impaired (Shindo et al, 2000; Mittaz et al, 2004). In these gene knock-out studies, ovulation was shown to be significantly compromised. This finding is in agreement with studies that have demonstrated the expression of A D A M T S - 1 in granulosa cells of rupturing mouse follicles and its regulation in the ovary by the P R (Robker et al, 2000a; 2000b; Espey et al, 2000). In addition to ovulation, A D A M T S - 1 has been suggested to play key roles in uterine function, since its expression has been reported in both pregnant and non-pregnant uterine tissues (Abbaszade et al, 1999). However, the A D A M T S - 1 gene knock-out studies have generated inconsistent findings with respect to uterine morphology (Shindo et al, 2000; Mittaz et al, 2004). In one study, the uteri of null mice were shown to be thicker and to contain cysts as compared to wild-type mice (Shindo et al, 2000). In the more recent study, there were no reported uterine morphological differences between null and wild-type mice, and the implantation process in mice null mutant for A D A M T S - 1 was not affected (Mittaz et al, 2004). However, it was shown that the pregnancy rate in null mothers decreased at a greater rate as gestation progressed, suggesting that A D A M T S - 1 may play a role in the maintenace of pregnancy and/or placentation (Mittaz et al, 2004). Indeed, the expression of A D A M T S - 1 has been demonstrated in the murine placenta, suggesting that it does play a role in placental development (Thai and Iruela-Arispe, 2002). Recently, A D A M T S - 1 was determined to be expressed in vivo in human stromal cells of first trimester decidua, and was shown to be differentially regulated by the cytokines IL-1B and T G F - p i (Ng et al, 2006), and gonadal steroids (Wen et al, 2006) providing further evidence that this proteinase does play a role in E C M remodeling events during the decidualization process. 50 A D A M T S - 5 was determined to be specifically expressed in the 7-day mouse embryo, a period that correlates with peri-implantation, and in trophoblastic cells lining the uterine cavity in 8.5-day-old embryos (Hurskainen et al, 1999). Furthermore, A D A M T S - 5 expression was shown to increase during the decidual reaction in mice, providing evidence that this A D A M T S subtype also plays important roles during implantation (Hurskainen et al, 1999). Recently, A D A M T S - 5 was shown to be expressed in human emdometrial stroma in vivo and was also shown to increase with decidualization (Zhu et al, 2006). These findings implicate a role for A D A M T S - 5 in controlling ECM-remodeling processes in endometrial and placental development. In addition, the m R N A of other A D A M T S subtypes ( A D A M T S - 1 , -4, -5, -6, -7, -9, and -10) has been detected in human term placenta (Abbaszade et al, 1999; Hurskainen et al, 1999; Llamazares et al, 2003; Sommerville et al, 2003; 2004) and in the first trimester placenta ( A D A M T S - 2 ; Farina et al, 2006). The expression of multiple A D A M T S subtypes in the human term placenta alludes to their roles in E C M degradation/activation during placental development. 1.5 The classical/type-I cadherin gene superfamily of CAMs: Regulators of cell phenotype The first cadherins to be described were members of the classical/type-I subfamily. A s mentioned previously, these include E-cadherin, N-cadherin, P-cadherin and R-cadherin. A l l classical cadherins have been shown to promote calcium-dependent cell-cell adhesion in a homophilic manner, although N-cadherin has been demonstrated to interact in a heterophilic manner with R-cadherin, and E-cadherin has been demonstrated to interact with P-cadherin (Takeichi, 1995). 51 Research into the roles cadherins play in tissue formation has primarily focused on the adhesive properties of these C A M s (Takeichi, 1995; Gumbiner, 1996). The ability of cadherins to regulate cell sorting events during developmental processes, control tissue segregation and mediate heterotypic adhesion is becoming well acknowledged (Angst et al, 2001; Foty and Steinberg, 2004). However, it is now becoming apparent that cadherins also regulate cell signaling events that control tissue formation and cell phenotype (Williams et al, 1994; 2001; Suyama et al, 2002; Wheelock and Johnson, 2003; Qian et al, 2004; Yanagisawa and Anastasiadis, 2006). Consistent with these observations, some classical/type-I cadherin subfamily members have been shown to play important roles in regulating the development of cancer and cell invasion (Hazan et al, 1997; 2004; Foty and Steinberg, 2004). Furthermore, aberrant expression of mesenchymal cadherins (N-cadherin and R-cadherin) in epithelial cells has been linked to processes such as cancer cell development and increased cell invasion/migration (Hazan et al, 1997; Islam et al, 1996; Nieman et al, 1999; Maeda et al, 2006). The following sections w i l l be dedicated to describing the structure of the classical/type-I cadherin C A M s and the biological function(s) these cadherins plays in regulating tissue morphogenesis, modulating cellular phenotype, and controlling cell invasion. 1.5.1 Characterization and structure of classical/type-I cadherins Proteins that belong to the cadherin gene superfamily of C A M s are characterized by having one or more extracellular cadherin repeat (Wheelock and Johnson, 2003). A cadherin repeat is an independently folding sequence of approximately 110 amino acids that contains motifs with the conserved sequences D R E , D X N D N A P X F and D X D , where X represents any 52 amino acid (Takeichi, 1990). The classical/type-I cadherins are comprised of an extracellular domain that contains four cadherin repeat motifs (EC1-EC4) and a poorly conserved extracellular repeat located proximal to the cell membrane (EC5), a single transmembrane domain, and two highly conserved cytoplasmic subdomains (Fig 1.6; Grunwald, 1993). In addition, these C A M s are synthesized as precursor molecules containing a signal peptide and an N-terminal domain that is removed post-translationally by the furin/substilin family of proprotein convertases (Ozawa and Kemler, 1990; Posthaus et al, 1998). The EC1 subdomain of the classical/type-I cadherin subtypes, which is the most distal domain from the plasma membrane, harbors the cell adhesion recognition ( C A R ) sequence, H A V (histidine-alanine-valine; Blaschuk et al, 1990a; 1990b). This C A R sequence is believed to contribute to the adhesive properties of these cadherin subtypes. Proximal to the C A R sequence is a region consisting of non-conserved amino acids. These amino acids are thought to modulate the ability of the classical/type-I cadherins to interact with one another in a homophilic manner (Nose et al, 1990; Will iams et al, 2000). Studies using high-resolution crystallography have provided insight into the three-dimensional structure of the classical/type-I cadherin extracellular domains and the mechanism of homophilic interactions (Koch et al, 1999; Leckband and Sivasankar, 2000). The crystal structure of the EC1 subdomain of N-cadherin revealed the presence of cis and trans interactions in this protein fragment (Shapiro et al, 1995). In view of these observations, Shapiro et al (1995) proposed a model for cadherin-mediated adhesion in which the cadherins interact with an identical subtype on the surface of the same cell and on the surface of an adjacent cell in a 53 Extracellular C y t o p l a s m i c Fig 1.6: Schematic representation of the basic structure of the type 1 classical cadherins in the plasma membrane. The cadherins are comprised of five extracellular subdomains (EC1-EC5), a single transmembrane domain (TM), and two cytoplsmic subdomains (CPl and CP2). The EC1 subdomain contains the C A R sequence H A V which is believed to play a role in cadherin-mediated adhesion. The cytoplasmic subdomains are the most highly conserved regions among the members of the type 1 classical cadherins and interact with a family of cytoplasmic proteins known as the catenins. In particular, C P l interacts with p l20 c t n whereas CP2 forms multimertic complexes with either (3- or y-catenin and oc-catenin. These interactions are believed to link the cadherins to the actin-based microfilaments (MF) of the cytoskeleton. 54 zipper-like fashion. Furthermore, structural analysis of the E-cadherin extracellular domain suggested a two-step model for cadherin-mediated adhesion in which cis interactions serve as a prerequisite for subsequent trans interactions, but provided no direct evidence for zipper-like interactions (Tomschky et al, 1996). Although somewhat conflicting, these structural studies have highlighted the importance of lateral interactions in regulating cadherin-mediated adhesion. These observations have been supported by several in vitro and in vivo studies examining the role of lateral clustering in regulating cadherin-based homophilic interactions (Brieher et al, 1996; Adams et al, 1998; Klingelhofer et al, 2000; Lambert et al, 2000). The transmembrane domain of the classical/type-I cadherins is comprised of approximately 30 amino acids that are relatively hydrophobic and are believed to assume an oc-helical conformation in the plane of the membrane (Hatta et al, 1988; Gruwald et al, 1993). In addition, the cadherin transmembrane domain contains several conserved leucine residues that have been shown to contribute to the lateral clustering of E-cadherin on the cell surface (Gurezka et al, 1999; Huber et al, 1999). The cytoplasmic domains are the most highly conserved regions among members of the classical/type-I cadherin gene superfamily (Hatta et al, 1988; Suzuki et al, 1991), and are implicated in regulating cadherin function at the cell surface through their interactions with the cytoplasmic proteins, the catenins (Hirano et al, 1992; Oyama et al, 1994; Aberle et al, 1996; Ozawa and Kemler, 1998; Yap et al, 1998; Gumbiner, 2000; Murase et al, 2000). 55 1.5.2 Classical/type-I cadherin-catenin interactions Catenins were first identified by immunoprecipitation studies with the classical/type-I cadherins and include a-, (3-, y- and p l20 catenin (Ozawa et al, 1989; Ozawa and Kemler, 1992; Reynolds et al, 1992). P- and y-catenin bind to a serine-rich 30 amino acid sequence in the carboxy terminal cytoplasmic domain of the classical cadherins (Ozawa et al, 1990; Stappert and Kemler, 1994). These two cytoplasmic proteins interact with the cadherins in a mutually exclusive manner and share an imperfect 42 amino acid repeat motif referred to as an armadillo {arm) motif which is believed to facilitate cadherin-catenin binding (Riggleman et al, 1989; Hatzfeld, 1999). a-catenin is believed to link the cadherin-catenin complex to the actin-based cytoskeleton (Ozawa et al, 1990). This cytoplasmic protein has been shown to bind directly to both P- and y-catenin (Huber et al, 1997; Koslov et al, 1997; Nieset et al, 1997; Obama and Ozawa, 1997) and actin (Rimm et al, 1995) leading to the proposal that a-catenin bridges the cadherin-catenin complex to the actin-based microfilaments and thereby strengthens cadherin-mediated interactions (Adams et al, 1996; Vasioukhin, 2000). a-catenin however has also been shown to interact with mutiple actin-binding proteins, including a-actinin (Knudsen et al, 1995) viniculin (Weiss et al, 1998) and myosin (Kussel-Andermann et al, 2000). These interactions suggest that binding to the microfilaments may not be mediated directly by this catenin subtype (Provost and Rimm, 1999). a-catenin may also link the cadherin-catenin complexes to the microtubules of the cytoskeleton (Kaufmann et al, 1999; Chausovsky et al, 2000). The ability of a-catenin to enhance cadherin-mediated cell adhesion has been observed although the precise mechanism(s) have not been determined. Supporting evidence for a-catenin's role in enhancing cadherin adhesion stems from several studies that have demonstrated the inability of a-catenin 56 null-mutant mice to form a functional trophectodermal layer, a process that is dependent on E -cadherin mediated adhesion (Torres et al, 1997). p l20 catenin is a cytoplasmic protein that is distantly related to P- and y-catenin. p l20 catenin binds to a highly conserved region of the cadherin cytoplasmic domain that is more proximal to the plasma membrane than the C-terminal P- and y-catenin binding region (Ozawa and Kemler, 1998; Ohkubo and Ozawa, 1999). Although p l20 catenin has not been shown to interact with the cytoskeleton, its state of phosphorylation appears to influence the adhesive activity of E-cadherin by modulating the ability of this C A M to form lateral interactions with the cell surface (Aono et al, 1999). Additionally, p l20 catenin has been demonstrated to regulate cadherin stability by the observation that loss of p 120 catenin expression leads to significantly reduced levels of E-cadherin in epithelia (Davis et al, 2003). In addition to their role(s) in regulating cadherin-mediated adhesion and linkage to the cytoskeleton, the catenins have been shown to be integral components of signal transduction pathways (Gumbiner, 1995; Ben-Ze'ev et al, 2000). The best-studied catenin-mediated pathway is the P-catenin/wnt pathway. Briefly, wnt is an extracellular matrix-associated growth factor that interacts with its receptor, frizzled, to initiate a signal transduction pathway that stimulates the synthesis of proteins involved in cell growth, such as cyclin D l and myc (Conacci-Sorrell et al, 2002). The role p-catenin plays in facilitating the wnt signal involves activating the lymphocyte enhancing factor/T cell factor ( L E F / T C F ) family of transcription factors by forming a multimeric complex with them (Behrens et al, 1996; Huber et al, 1996; Papkoff et al, 1996). In the absence of the wnt signal, P-catenin that is not bound to the C-terminal cytoplasmic subdomain of a cadherin is ubiquinated and degraded by the proteosomal pathway. The binding of wnt to its receptor inhibits P-catenin degradation and results in the translocation of P-catenin 57 to the nucleus where it binds to L E F / T C F . Although the (3-catenin/LEF/TCF complex has been shown to influence the transcription of target genes in a variety of systems (Korinek et al, 1997; Simcha et al, 1998), the formation and translocation of P-catenin/LEF/TCF complexes is not sufficient to activate gene expression, per se (Prieve and Waterman, 1999). P-catenin also mediates the interaction of the cadherin-catenin complex with the E G F receptor (Hoschuetzky et al, 1994; Pece and Gutkind, 2000) and the IGF type I receptor (Playford et al, 2000), directly linking cadherin function with receptor-mediated signaling. The activation of these receptors results in the phosphorylation of P-catenin on the tyrosine residues and the disruption of E-cadherin-mediated adhesion (Playford et al, 2000). Taken together, these observations suggest that P-catenin binding to the cadherin cytoplasmic domain modulates the ability of this cytoplasmic protein to regulate adhesion, transcription, or enter a pathway of degradation. Although p l 2 0 catenin appears to play a role in modulating the adhesive capacity of cadherins, its role in cadherin-mediated signal transduction is poorly defined. p l20 catenin has been shown to regulate the activities of small GTPases, small (20-25 kDa) proteins involved in regulating a variety of cellular processes such as growth, apoptosis, differentiation and migration signaling through the mitogen-activated protein ( M A P ) kinase pathways (Goodwin et al, 2003). Specifically, p l20 catenin has been demonstrated to inhibit the activity of the small GTPase Rho, and activate the small GTPases Rac and Cdc42, resulting in an increase in cell motility (Anastasiadis et al, 2000; Magie et al, 2002; Goodwin et al, 2003; Fang et al, 2004). However, whether these p l 2 0 catenin regulatory effects occur in association with cadherins remains to be elucidated. 58 1.5.3 Classical/type-I cadherin expression and function N-cadherin, like E-cadherin, is critical during embryonic development (Radice et al, 1997a). This is clearly evident as loss of either cadherin subtype results in early embryonic lethality (Larue et al, 1994; Radice et al, 1997a). This is not surprising as these cadherin subtypes play important roles in embryonic cell compaction, cell-differentiation and cell-sorting events during the early stages of development. The expression of both E - and N-cadherin are spatio-temporally regulated and aberrant expression of either subtype results in abnormal cell, tissue and organ function as well as the onset of cancer. In contrast to E-cadherin and N -cadherin deficient mice, mice null mutant for P-cadherin and R-cadherin are viable and fertile (Radice et al, 1997b; Dahl et al, 2002). The loss of P-cadherin is characterized by an aberrant mammary gland phenotype, whereas the loss of R-cadherin is characterized by a significant reduction in the ability of metanephric mesenchyme to differentiate into ureteric bud epithelium in the kidney. One possible explanation for these relatively benign phenotypes is that the loss of these specific cadherins is rescued by the expression and function of other related cadherin subtypes (Vleminckx and Kemler, 1999). 1.5.3-A Classical/type-I cadherins and tissue morphogenesis In developing tissues, the differential expression in cadherin subtypes amongst a population of cells mediates selective cell recognition events that are important for the sorting of different groups of cells (Takeichi, 1995; Uchida et al, 1996; Duguay et al, 2003). Not only does the differential expression of a specific cadherin subtype(s) facilitate cell sorting and tissue 59 segregation, as is observed during gastrulation and neural crest development in the embryo, but also the quantitative expression levels of cadherin subtypes mediate these processes (Steinberg and Takeichi, 1994; Foty and Steinberg, 2004). For example, Takeichi and Steinberg (1995) demonstrated that L-cells (a mouse fibroblast cell line that are non-adhesive and do not express cadherin C A M s ) expressing differing amounts of P-cadherin formed segregated islands of cells expressing the same levels of P-cadherin. Similarly, the selection of an oocyte from the germ cells in Drosophila is mediated in part by the over-expression of Drosophila (D)E-cadherin in the pre-oocyte germ cell and follicular cells (Gonzalez-Reyez and St Johnston, 1998). Germ cells under-expressing DE-cadherin fail to migrate to the follicle and are therefore not selected as the oocyte. There are many events during embryonic development that involve cadherin-mediated cell sorting and tissue segregation. The importance of cadherins in cell sorting processes was first suggested by Takeichi (1988) who observed that cell rearrangements during embryonic development are associated with changes in the expression of cadherin subtypes. During mammalian development, dynamic and reciprocal changes in cadherin subtype expression are detected. These changes, referred to as 'cadherin switching,' are observed in essentially all epithelial-mesenchymal and mesenchymal-epithelial conversions (Nakagawa and Takeichi, 1995). For example, the formation of the mesoderm during gastrulation involves an E M T and is accompanied with a concomitant increase in N-cadherin expression (Hatta and Takeichi, 1986). During neurulation, a similar change in cadherin expression occurs in the developing neuroepithelium. In this example, epiblast cells differentiating into the neural plate down-regulate the expression of E-cadherin and up-regulate the expression of N-cadherin (Kerszberg and Changeux, 1998; Sadler, 2005). The formation of the nephron, the functional unit within the 60 kidney, is characterized by the differentiation of metanephric mesenchyme into uretric bud epithelium (Dahl et al, 2002). The transient expression of R-cadherin in both the mesenchyme and uretric bud epithelium of the kidney has led to the suggestion that this cadherin plays a role in mediating stromal-epithelial interaction and the mesenchymal-epithelial conversion, and thus facilitates nephrogenesis (Goto et al, 1998; Dahl et al, 2002). These processes support the general concept that segregating cells express qualitative and/or quantitative differences in cadherin subtypes as they separate from existing cell layers. In addition to cell sorting, cadherins also play critical roles in the establishment and maintenance of intercellular junctions (Carthew, 2005). For example, the facilitation of adheren junction formation by N-cadherin has been observed in normal fibroblasts and fibrosarcoma cell lines (Ko et al, 2000; E l Sayegh et al, 2004). In addition, the formation of a unique junctional complex in cardiac muscle, referred to as the intercalated disc, consists of three separate junctions: the adherens junction, the desmosome and the gap junction (Severs, 1990). In this structure, N-cadherin facilitates the formation of the cardiac adherens junction. This junctional complex provides the site of attachment for the myofibrils and enables the transmission of the contractile force (Severs, 1990). E - and N-cadherin also facilitate the formation and maintenance of presynaptic and postsynaptic cell-cell adhesion in synaptic junctions (Uchida et al, 1996). Although the expression of N-cadherin is detected in high levels within vascular endothelial cells, its role in the formation and maintenance of endothelial cell junctions remains to be elucidated (Navarro et al, 1998, Cavallaro et al, 2006). A possible explanation for the relatively high expression levels of N-cadherin in endothelial cells suggests that N-cadherin facilitates heterotypic endothelial-stromal interactions (Hazan et al, 1997; Wheelock and Johnson, 2003; Cavallaro et al, 2006). 61 1.5.3-B Classical/type-I cadherins and cancer Aberrant cellular growth and the ability of cells to metastasize to distant sites are key events that facilitate the development and spreading of tumors. The key cellular processes that occur during metastasis involve the detachment of cells from the primary tumor, followed by the ability of these cells to breach tissue boundaries, enter and exit the circulation, infiltrate into distant organs and finally form distant tumors (Liotta et al, 1991). It has been hypothesized that one of the contributing factors involved in the initiation of cellular metastasis is a reduction in cell-cell adhesion. This theory is supported by observations that the expression and/or function of E-cadherin is lost in many differentiating epithelial tumors and in cancer cells (Mol l et al, 1993; Takeichi, 1993; Berx and Van Roy, 2001; Hazan et al, 2004; Jennbacken et al, 2006). Indeed, E-cadherin function is lost in many cancers by mechanisms that include mutational inactivation of E-cadherin or catenin genes, transcriptional repression, or proteolysis of the extracellular domain, indicating that this molecule plays an important suppressive role in epithelial tumorogenesis (Christofori and Semb, 1999). In addition, invasive cancer cell lines can often be rendered non-invasive by exogenous expression of full-length E-cadherin (Foty and Steinberg, 2004). Whether E-cadherin functions directly as a tumor suppressor by increasing the cohesiveness of cells, and thereby physically restrains cell detachment, or indirectly by controlling the expression of invasion-suppressing genes, has yet to be fully elucidated. It has been proposed that when cancer cells invade into adjacent tissues they use a mechanism like E M T (Hazan et al, 2004). A s discussed previously, E M T s observed in the developing embryo are often associated with a 'switch' in cadherin expression. The 62 classical/type-I cadherin subtype, N-cadherin, appears to play an important role in this transformative process where it has been observed to play key roles in facilitating cell migration by mediating less stable and more dynamic forms of cell adhesion (Bixby and Zhang, 1990). Interestingly, the expression of N-cadherin in invasive tumor cell lines and tissues from brain, breast, prostate and melanoma appears to be up-regulated with a concomitant decrease in the expression of E-cadherin (Hazan et al, 1997; Sanders et al, 1999; Tomita et al, 2000; Asano et al, 2004). These findings suggest N-cadherin plays a putative role(s) in the development of invasive cancers during tumorogenesis. The expression of other cadherin subtypes have also been associated with the development of cancer and an increase in invasive phenotype (Maeda et al, 2006; Yanagisawa and Anastasiadis, 2006). For instance, the atypical/type-II cadherin subtype, cadherin-11, was shown to be highly expressed in invasive breast cancer cell lines, but not in non-invasive breast cancer cell lines (Pishvaian et al, 1999). Additioanlly, endogenous cadherin-11 was demonstrated to promote an invasive phenotype in E-cadherin-negative breast cancer cells through a mechanism involving the activation of the Rho GTPase, R a c l (Yanagisawa and Anastasiadis, 2006). Finally, the aberrant expression of R-cadherin has also been shown to promote cellular invasion in the A431 epithelial cell line, accompanied with a concomitant loss of E - and P-cadherin (Maeda et al, 2006). The exogenous expression of N-cadherin in certain cell types facilitates a fibroblastic-like change in morphological phenotype and increases cell motility. For example, Islam et al (1996) demonstrated that squamous epithelia acquiring N-cadherin down-regulated E-cadherin expression and transformed into a scattered/fibroblastic-like morphology. Furthermore, these cells also adopted a more migratory phenotype. Similarly, Neiman et al (1999) showed that B T -63 20 breast cancer cells transfected with N-cadherin adopted a more invasive phenotype. However in this study, exogenous expression of N-cadherin did not affect the expression or adhesive function of E-cadherin in these cells. The finding that BT-20 breast cancer cells exogenously expressing N-cadherin adopted a more invasive phenotype and retained an epithelial/adhesive phenotype suggests that adhesion and invasion are two mutually exclusive events (Wheelock and Johnson, 2003). Furthermore, breast cancer cells exogenously expressing N-cadherin demonstrate an increase in metastatic ability, in addition to an increase in invasion and migration in nude mice, emphasizing the importance N-cadherin plays in facilitating these processes (Hazan et al, 2000). It has been suggested that N-cadherin promotes an invasive and motile phenotype in cancer cells by facilitating interactions between stroma and endothelia (Takeichi, 1995). For instance, it was demonstrated that N-cadherin-mediated homophilic adhesion facilitates the transmigration of melanoma cells through endothelial cells (Sandig et al, 1997). However, it has also been suggested that N-cadherin regulates cell invasion through growth factor-mediated cell signaling pathways, since it has been demonstrated that N-cadherin is capable of interacting with the fibroblast growth factor receptor (FGFR) and that this interaction appears to influence cell motility and invasion (Saffell et al, 1997; Nieman et al, 1999; Will iams et al, 2001; Suyama et al, 2002). For example, neuronal outgrowth during innervation of target tissues is governed in part by N-cadherin and its ability to interact with the F G F R (Walsh and Doherty, 1997; Saffell et al, 1997; Doherty et al, 2000; Skaper, 2005). Similarly, Suyama et al (2002) demonstrated that in cancer cells, N-cadherin interacts with F G F R - 1 . The physical mechanism by which N -cadherin interacts with F G F R remains controversial. In outgrowing neurons, the H A V motif in F G F R has been suggested to interact with the HAV-containing EC-4 subdomain in N-cadherin. 64 However, Suyama et al (2002) determined through functional studies that the H A V motif within FGFR-1 is not required for associating with N-cadherin. Nonetheless, these and other studies have demonstrated that the interaction between N-cadherin and F G F R is facilitated by interaction of their extracellular domains and that treatment with FGF-2 promotes cellular migration and invasion. The signal transduction pathway(s) that N-cadherin-facilitated F G F R activation induces remains poorly defined and contentious, however F G F R stimulation results in the production of M M P - 9 suggesting a role for M A P K signaling (Suyama et al, 2002; Will iams et al, 2003; Skaper, 2005). Clearly, cadherin C A M s play an important role in regulating cell phenotype and cell invasion. A s discussed previously, trophoblastic cells differentiating along the E V T pathway disassociate from intermediate columnar E V T s , develop an invasive phenotype, in part characterized by a significant reduction in the expression of E-cadherin (Shih et al, 2002), and invade into and remodel the endothelium of spiral arteries in the decidua and proximal third of the myometrium (Apl in and Kimber, 2004). Based on the findings of previous reports that have demonstrated the role(s) that specific cadherin subtypes play in controlling cancer cell invasion, and based on comparing similar proteolytic and c e l l - E C M mechanisms shared by cancer cells and invasive trophoblastic cells (Ferretti et al, 2006), it is tempting to speculate that specific cadherin C A M s also promote an invasive phenotype in E V T s . However, investigation into the potential roles cadherins play in promoting invasion in E V T s has yet to be accomplished. 65 1.6 Hypothesis and rationale M M P s play important roles during trophoblast invasion as has been demonstrated in functional studies in vitro and in vivo (Bischof et al, 2001). However, mice null-mutant for M M P s are viable and fertile (Ducharme et al, 2000; Asahi et al, 2001; Ratzinger et al, 2002), suggesting that other uncharacterized proteinases play key roles in trophoblast invasion and placentation. The novel family of A D A M T S metalloproteinases has been demonstrated to play important roles in tissue remodeling processes and in modulating cellular phenotype in both normal and pathological tissues (Apte, 2004). Based on these observations, I hypothesize that members of the A D A M T S family are expressed in the human first trimester placenta and in trophoblastic cell lines. To date, the identity and expression pattern(s) of the A D A M T S subtypes in the human first trimester placenta and trophoblastic cells remain to be determined. To address these outstanding issues, I examined the m R N A expression levels of A D A M T S subtypes in the first trimester placenta, poorly-invasive JEG-3 choriocarcinoma cells and highly-invasive E V T s propagated from first trimester chorionic villous explants. This study not only characterizes the expression profiles of A D A M T S subtypes in the first trimester placenta, but also provides insight into the possible roles these metalloproteinases play in regulating placentation and trophoblast differentiation along the invasive E V T pathway. Initial studies determined that the expression of the A D A M T S subtype, A D A M T S - 1 2 , is present in the first trimester placenta. Furthermore, I determined that the expression of A D A M T S - 1 2 was detected in cultures of invasive E V T s and not in poorly-invasive JEG-3 choriocarcinoma cells. These findings have therefore led me to hypothesize that A D A M T S - 1 2 plays a key role(s) in promoting an invasive phenotype in trophoblastic cells. To address this 66 issue, I examined the ability of A D A M T S - 1 2 to modulate the invasive capacity of trophoblastic cells using gain-and-loss-of A D A M T S - 1 2 function experiments. These experiments provide evidence that A D A M T S - 1 2 plays an important role in modulating the invasive capacity of trophoblastic cells. Furthermore, these studies provide novel findings and insight into the putative mechanism(s) by which A D A M T S metalloproteinases function. A switch in the expression of the classical/type-I cadherin subtypes E-cadherin and N -cadherin has been well documented in epithelial-to-mesenchymal transitions during embryogenesis and in promoting a migratory phenotype in neuronal cells during neural outgrowth (Nakagawa and Takeichi, 1995). Additionally, the progression of some tumors to more aggressive and invasive cancers is associated with the loss of E-cadherin expression/function and the up-regulation of N-cadherin (Wheelock and Johnson, 2003). Furthermore, functional studies have demonstrated N-cadherin to promote an invasive and migratory phenotype in epithelial cancer cells (Hazan et al, 2000). These observations, and the knowledge that cadherin subtypes have been shown to play key role(s) in placentation and trophoblast differentiation (Zhou et al, 1997a) has led me to hypothesize that N-cadherin promotes invasion in trophoblastic cells by modulating the invasive phenotype. To test my hypothesis, a gain-of and loss-of N-cadherin function experiment was implemented in N -cadherin-expressing E V T s and in JEG-3 choriocarcinoma cells that do not endogenously express N-cadherin. In addition to these functional experiments, I attempted to examine the possible molecular mechanisms that might explain how N-cadherin facilitates an invasive phenotype in these trophoblastic cells. 67 1.7 BIBLIOGRAPHY Abbaszade, I., L i u , R. Q., Yang, F., Rosenfeld, S. A . , Ross, O. FL, Link, J. R., El l is , D . M . , Tortorella, M . D. , Pratta, M . A . , Holl is , J. M . , Wynn, R., Duke, J. L . , George, H . J., Hil lman, M . C. , Jr., Murphy, K . , Wiswal l , B . FL, Copeland, R. A . , Decicco, C. P., Bruckner, R., Nagase, FL, Itoh, Y . , Newton, R. C. , Magolda, R. L . , Trzaskos, J. M . , Burn, T. C. , and et al. (1999). Cloning and characterization of A D A M T S 11, an aggrecanase from the A D A M T S family. J B i o l Chem 274, 23443-50. Aberle, FL, Schwartz, FL, and Kemler, R. (1996). Cadherin-catenin complex: protein interactions and their implications for cadherin function. J Cel l Biochem 61, 514-23. Aboagye-Mathiesen, G. , Laugesen, J., Zdravkovic, M . , and Ebbesen, P. (1996). Isolation and characterization of human placental trophoblast subpopulations from first-trimester chorionic v i l l i . C l i n Diagn Lab Immunol 3, 14-22. Adams, C , Chen, Y . , Smith, S., and Nelson, W . (1998). Mechanisms of epithelial cell-cell adhesion and cell compaction revealed by high-resolution tracking of E-cadherin-green fluorescent protein. J Cel l B i o l 142, 1105-19. Adams, C , Nelson, W. , and Smith, S. (1996). Quantitative analysis of cadherin-catenin-actin reorganization during development of cell-cell adhesion. J Cel l B i o l 135, 1899-911. Adams, J. (2001). Cell-matrix contact structures. Cel l M o l Life Sci 58, 371-92. Adams, J., and Lawler, J. (2004). The thrombospondins. Int J Biochem Cel l B i o l 36, 961-8. Adamson, S., L u , Y . , Whiteley, K . , Holmyard, D. , Hemberger, M . , Pfarrer, C , and Cross, J. (2002). Interactions between trophoblast cells and the maternal and fetal circulation in the mouse placenta. Dev B i o l 250, 358-73. Ahmed, F. (2006). Role of genes, the environment and their interactions in the etiology of inflammatory bowel diseases. Expert Rev M o l Diagn 6, 345-63. A l - L a m k i , R., Skepper, J., and Burton, G . (1999). Are human placental bed giant cells merely aggregates of small mononuclear trophoblast cell? A n ultrastructural and immunocytochemical study. Hum Reprod 14, 496-504. Alfano, D. , Franco, P., Vocca, I., Gambi, N , , Pisa, V . , Mancini , A . , Caputi, M . , Carriero, M . , Iaccarino, I., and Stoppelli, M . (2005). The urokinase plasminogen activator and its receptor: role in cell growth and apoptosis. Thromb Haemost 93, 205-11. Anastasiadis, P., Moon, S., Thoreson, M . , Mariner, D. , Crawford, H . , Zheng, Y . , and Reynolds, A . (2000). Inhibition of R h o A by p l20 catenin. Nat Cel l B i o l 2, 637-44. 68 Andreasen, P., Egelund, R., and Petersen, H . (2000). The plasminogen activation system in tumor growth,invasion and metastasis. Cel l M o l Life Sci 57, 25-40. Andreasen, P., Georg, B . , Lund, L . , Riccio, A . , and Stacey, S. (1990). Plasminogen activator inhibitors: hormonally regulated serpins. M o l Cel l Endocrinol 68,123-8. Angst, B . , Marcozzi , C , and Magee, A . (2001). The cadherin superfamily. J Cel l Sci 114, 625-6. Aono, S., Nakagawa, S., Reynolds, A . , and Takeichi, M . (1999). pl20(ctn) acts as an inhibitory regulator of cadherin function in colon carcinoma cells. J Cel l B i o l 145, 551-62. Apl in , J. (1991). Implantation, trophoblast differentiation and haemochorial placentation: mechanistic evidence in vivo and in vitro. J Cel l Sci 99, 681-92. Apl in , J. (1993). Expression of integrin alpha 6 beta 4 in human trophoblast and its loss from extravillous cells. Placenta 14, 203-15. Apl in , J. (2000). The cell biological basis of human implantation. Baillieres Best Pract Res C l i n Obstet Gynaecol 14, 757-64. Apl in , J., Haigh, T., Jones, C , Church, H . , and Vicovac, L . (1999). Development of cytotrophoblast columns from explanted first-trimester human placental v i l l i : role of fibronectin and integrin alpha5betal. B i o l Reprod 60, 828-38. Apl in , J., and Kimber, S. (2004). Trophoblast-uterine interactions at implantation. Reprod B i o l Endocrinol 2, 48. Apte, S. (2004). A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motifs: the A D A M T S family. Int J Biochem Cel l B i o l 36, 981-5. Arner, E . C , Pratta, M . A . , Trzaskos, J. M . , Decicco, C. P., and Tortorella, M . D . (1999). Generation and characterization of aggrecanase. A soluble, cartilage-derived aggrecan-degrading activity. J B i o l Chem 274, 6594-601. Asahi, M . , Wang, X . , M o r i , T., Sumii, T., Jung, J., Moskowitz, M . , F in i , M . , and Lo , E . (2001). Effects of matrix metalloproteinase-9 gene knock-out on the proteolysis of blood-brain barrier and white matter components after cerebral ischemia. J Neurosci 21, 7724-32. Asano, K . , Duntsch, C , Zhou, Q., Weimar, J., Bordelon, D . , Robertson, J., and Pourmotabbed, T. (2004). Correlation of N-cadherin expression in high grade gliomas with tissue invasion. J Neurooncol 70, 3-15. Asano, K . , Kudo, A . , Tajika, Y . , Takakura, K . , and Suzuki, S. (2000). Expression of cadherin and C S F dissemination in malignant astrocytic tumors. Neurosurg Rev 23, 39-44. 69 Astedt, B . , Hagerstrand, I., and Lecander, I. (1986). Cellular localisation in placenta of placental type plasminogen activator inhibitor. Thromb Haemost 56, 63-5. Autio-Harmainen, H . , Hurskainen, T., Niskasaari, K . , Hoyhyta, M . , and Tryggvason, K . (1992). Simultaneous expression of 70 kDa type IV collgenase and type IV collgen 1 (IV) chain genes by cells of early human placenta and gestational endometrium. Lab Invest 67, 191-200. Bamberger, A . , Sudahl, S., Longing, T., Wagener, C , Bamberger, C , Drakakis, P., Coutifaris, C , and Makrigiannakis, A . (2000). The adhesion molecule C E A C A M 1 (CD66a, C -C A M , B G P ) is specifically expressed by the extravillous intermediate trophoblast. A m J Pathol 156, 1165-70. Barker, D . (1995). Intrauterine programming of adult disease. B M J 1, 418-23. Barker, D. , B u l l , A . , Osmond, C , and Simmonds, S. (1990). Fetal and placental size and risk of hypertension in adult life. B M J 301, 259-62. Baronas-Lowell, D. , Lauer-Fields, J., Borgia, J., Sferrazza, G . , Al -Ghou l , M . , Minond, D . , and Fields, G . (2004). Differential modulation of human melanoma cell metalloproteinase expression by alpha2betal integrin and CD44 triple-helical ligands derived from type IV collagen. J B i o l Chem 279, 43503-13. Bass, K . , L i , H . , and Hawkes, S. (1997). Tissue inhibitor of metalloproteinase-3 expression is up-regulated during human cytotrophoblast invasion in vitro. Dev Genet 21, 61-67. Basset, P., Bellocq, J., Wolf, C , Stoll, I., Hutin, P., Limacher, J., Podhajcer, O., Chenard, M . , Rio, M . , and Chambon, P. (1990). Abstract A novel metalloproteinase gene specifically expressed in stromal cells of breast carcinomas. Nature 348, 699-704. Batlle, E . , Sancho, E . , Franci, C , Dominguez, D. , Monfar, M . , Baulida, J., and Garcia De Herreros, A . (2000). The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cel l B i o l 2, 84-9. Behrendt, N . (2004). The urokinase receptor (uPAR) and the uPAR-associated protein (uPARAP/Endol80) : membrane proteins engaged in matrix turnover during tissue remodeling. B io l Chem 385, 103-36. Behrens, J., Marceel, M . , V a n Roy, F., and Birchmeier, W . (1989). Dissecting tumor cell invasion: epithelial cells acquire invasive properties after the loss of uvomorulin-mediated cell-cell adhesion. J Cel l B i o l 108, 2435-47. Behrens, J., von Kries, J., Kuh l , M . , Bruhn, L . , Wedlich, D. , Grosschedl, R., and Birchmeier, W . (1996). Functional interaction of beta-catenin with the transcription factor L E F - 1 . Nature 382, 638-42. 70 Bek, S., and Kemler, R. (2002). Protein kinase C K I I regulates the interaction of beta-catenin with alpha-catenin and its protein stability. J Cel l Sci 115, 4743-53. Ben-Ze'ev, A . , Shtutman, M . , and Zhurinsky, J. (2000). The integration of cell adhesion with gene expression: the role of beta-catenin. Exp Cel l Res 261, 75-82. Benirschke, K . , and Kaufmann, P. (2000). "Pathology of the human placenta 4th edition." Springer Verlag, New York. Bentin-Ley, U . , Horn, T., Sjogren, A . , Sorensen, S., Falck Larsen, J., and Hamberger, L . (2000). Ultrastructure of human blastocyst-endometrial interactions in vitro. J Reprod Fertil 120, 337-50. Bergeron, F., Leduc, R., and Day, R. (2000). Subtilase-like pro-protein convertases: from molecular specificity to therapeutic applications. J M o l Endocrinol 24, 1-22. Berman, A . , and Kozlova, N . (2000). Integrins: structure and function. Membr Cel l B i o l 13, 207-44. Berx, G . , and V a n Roy, E . (2001). The E-cadherin/catenin complex: an important gatekeeper in breast cancer tumorigenesis and malignant progression. Breast Cancer Res 3, 289-93. Birchmeier, W. , Behrens, J., Weidner, K . , Hulsken, J., and Birchmeier, C. (1996). Epithelial differentiation and the control of metastasis in carcinomas. Curr Top Microbiol Immunol 213, 117-35. Bischof, P., and Irminger-Finger, I. (2005). The human cytotrophoblastic cell, a mononuclear chameleon. Int J Biochem Cel l B i o l 37, 1-16. Bischof, P., Meisser, A . , and Campana, A . (2001). Biochemistry and molecular biology of trophoblast invasion. A n n N Y Acad Sci 943, 157-62. Bixby, J., and Zhang, R. (1990). Purified N-cadherin is a potent substrate for the rapid induction of neurite outgrowth. J Cel l B i o l 110, 1253-60. Blankenship, T., Enders, A . , and King , B . (1993). Trophoblastic invasion and modification of uterine veins during placental development in macaques. Cel l Tissue Res 274, 135-44. Blaschuk, O., Pouliot, Y . , and Holland, P. (1990a). Identification of a conserved region common to cadherins and influenza strain A hemagglutinins. J M o l B i o l 211, 679-82. Blaschuk, O., Sullivan, R., David, S., and Pouliot, Y . (1990b). Identification o f a cadherin cell adhesion recognition sequence. Dev B io l 139, 227-9. Blelloch, R., and Kimble , J. (1999). Control of organ shape by a secreted metalloprotease in the nematode Caenorhabditis elegans. Nature 399, 586-90. 71 Blobel, C . (2000). Remarkable roles of proteolysis on and beyond the cell surface. Curr Opin Cel l B i o l 12, 606-12. Blobel, C , Wolfsberg, T., Turk, C , Myles, D. , Primakoff, P., and White, J. (1992). A potential fusion peptide and an integrin ligand domain in a protein active in sperm-egg fusion. Nature 356 , 248-52. Bork, P., and Beckmann, G . (1993). The C U B domain. A widespread module in developmentally regulated proteins. J M o l B i o l 2 3 1 , 539-45. Bornstein, P., Agah, A . , and Kyriakides, T. (2004). The role of thrombospondins 1 and 2 in the regulation of cell-matrix interactions, collagen fibril formation, and the response to injury. Int J Biochem Cel l B i o l 36 , 1115-25. Bornstein, P., Kyriakides, T., Yang, Z . , Armstrong, L . , and Birk, D . (2000). Thrombospondin 2 modulates collagen fibrillogenesis and angiogenesis. J Investig Dermatol Symp Proc 5, 61-6. Boyd, J., and Hamilton, W . (1970). "The human placenta." W . Heffer and Sons Ltd, Cambridge. Brabletz, T., Jung, A . , Dag, S., Hlubek, F. , and Kirchner, T. (1999). beta-catenin regulates the expression of the matrix metalloproteinase-7 in human colorectal cancer. A m J Pathol 155, 1033-8. Brackenbury, R. (1988). Expression of neural cell adhesion molecules in normal and pathologic tissues. A n n N Y Acad Sci 540, 39-46. Brakebusch, C , and Fassler, R. (2005). beta 1 integrin function in vivo: adhesion, migration and more. Cancer Metastasis Rev 24 , 403-11. Bridges, L . , Hanson, K . , Tani, P., Mather, T., and Bowditch, R. (2003). Integrin alpha4betal-dependent adhesion to A D A M 28 ( M D C - L ) requires an extended surface of the disintegrin domain. Biochemistry 42 , 3734-41. Brieher, W. , Yap, A . , and Gumbiner, B . (1996). Lateral dimerization is required for the homophilic binding activity of C-cadherin. J Cel l B i o l 135, 487-96. Brosens, I., Robertson, W. , and Dixon, H . (1967). The physiological response to vessels of the placental bed to normal pregnancy. J Pathol Bacteriol 93 , 569-79. Burbach, B . , J i , Y . , and Rapraeger, A . (2004). Syndecan-1 ectodomain regulates matrix-dependent signaling in human breast carcinoma cells. Exp Cel l Res 200, 234-47. Burnside, J., Nagelberg, S., Lippman, S., and Weintraub, B . (1985). Differential regulation of h C G alpha and beta subunit m R N A s in JEG-3 choriocarcinoma cells by 8-bromo-cAMP. J B i o l Chem 260, 12705-9. 72 Burrage, P., M i x , K . , and Brinckerhoff, C. (2006). Matrix metalloproteinases: role in arthritis. Front Biosci 11, 529-43. Burrows, T., K ing , A . , and Loke, Y . (1993). Expression of integrins by human trophoblast and differential adhesion to laminin or fibronectin. Hum Reprod 8, 475-84. Burrows, T., K ing , A . , and Loke, Y . (1994). Expression of adhesion molecules by endovascular trophoblast and decidual endothelial cells: implications for vascular invasion during implantation. Placenta 15, 21-33. Burrows, T., K ing , A . , and Loke, Y . (1996). Trophoblast migration during human placental implantation. Hum Reprod Update 2, 307-21. Burrows, T., K ing , A . , Smith, S., and Loke, Y . (1995). Human trophoblast adhesion to matrix proteins: inhibition and signal transduction. Hum Reprod 10, 2489-500. Burton, G . , and Watson, A . (1997). The structure of the human placenta: Implications for initiating and defending against virus infections. Rev M e d V i r o l 7, 219-228. Bussemakers, M . , van Bokhoven, A . , Tomita, K . , Jansen, C. , and Schalken, J. (2000). Complex cadherin expression in human prostate cancer cells. Int J Cancer 85, 446-50. Cai , S., Arguelles, J., Fernandez, P., and Lopez-Otin, C. (2001). Identification, characterization, and intracellular processing of A D A M - T S 1 2 , a novel disintegrin with a complex structural organization involving mutiple thrombospondin-1 repeats. J B i o l Chem 276, 17932-40. Cai , S., Obaya, A . , Llamazares, M . , Garabaya, C , Quesada, V . , and Lopez-Otin, C. (2002). Cloning, expression analysis, and structural characterization of seven novel human A D A M T S s , a family of metalloproteinases with disintegrin and thrombospondin-1 domains. Gene 283, 49-62. Caluwaerts, S., Vercruysse, L . , Luyten, C , and Pijnenborg, R. (2005). Endovascular trophoblast invasion and associated structural changes in uterine spiral arteries of the pregnant rat. Placenta 26, 574-84. Cao, J., Hymowitz, M . , Conner, C , Bahou, W. , and Zucker, S. (2000). The propeptide domain of membrane type 1 -matrix metalloproteinase acts as an intramolecular chaperone when expressed in trans with the mature sequence in COS-1 cells. J B i o l Chem 275, 29648-53. Carter, A . , Enders, A . , Jones, C , Mess, A . , Pfarrer, C , Pijnenborg, R., and Soma, H . (2006). Comparative placentation and animal models: patterns of trophoblast invasion — a workshop report. Placenta 27, S30-3. 73 Carter, J. (1964). Morphologic evidence of syncytial formation from the cytotrophoblastic cells. A m J Obstet Gynecol 23, 647-56. Carthew, R. (2005). Adhesion proteins and the control of cell shape. Curr Opin Genet Dev 15, 358-63. Castanon, I., and Baylies, M . (2002). A Twist in fate: evolutionary comparison of Twist structure and function. Gene 287, 11-22. Cavallaro, U . , and Chirstofori, G . (2004). Cel l adhesion and signalling by cadherins and Ig-C A M s in cancer. Nat Rev Cancer 4, 118-32. Cavallaro, U . , Liebner, S., and Dejana, E . (2006). Endothelial cadherins and tumor angiogenesis. Exp Cel l Res 312, 659-67. Cavallaro, U . , Schaffhauser, B . , and Christofori, G . (2002). Cadherins and the tumour progression: is it all in a switch? Cancer Lett 176, 123-8. Chausovsky, A . , Bershadsky, A . , and Borisy, G . (2000). Cadherin-mediated regulation of microtubule dynamics. Nat Cel l B i o l 2, 797-804. Chidgey, M . (2002). Desmosomes and disease: an update. Hhistol Histopathol 17, 1179-92. Chou, J. (1978). Establishment of clonal human placental cells synthesizing human choriogonadotropin. Proc Natl Acad Sci U S A 75, 1854-8. Christofori, G . , and Semb, H . (1999). The role of the cell-adhesion molecule E-cadherin as a tumour-suppressor gene. Trends Biochem Sci 24, 73-6. Chun, T., Sabeth, F. , Ota, I., Murphy, H . , McDonagh, K . , Holmbeck, K . , Birkedal-Hansen, H . , Al len , E . , and Weiss, S. (2004). Free Fu l l Text M T 1 -MMP-dependent neovessel formation within the confines of the three-dimensional extracellular matrix. J Cel l B i o l 167, 757-67. Colige, A . , L i , S., Sieron, A . , Nusgens, B . , Prockop, D. , and Lapiere, C. (1997). c D N A cloning and expression of bovine procollagen I N-proteinase: a new member of the superfamily of zinc-metalloproteinases with binding sites for cells and other matrix components. Proc Natl Acad Sci U S A 64, 2374-9. Colige, A . , Ruggiero, F., Vandenberghe, I., Dubail, J., Kesteloot, F., Van Beeumen, J., Beschin, A . , Brys, L . , Lapiere, C , and Nusgens, B . (2005). Domains and Maturation Processes That Regulate the Activity of A D A M T S - 2 , a Metalloproteinase Cleaving the Aminopropeptide of Fibrillar Procollagens Types I-III and V . J B i o l Chem 280, 34397-34408. Colige, A . , Sieron, A . , L i , S., Schwarze, U . , Petty, E . , Wertelecki, W. , Wilcox, W. , Krakow, D. , Cohn, D. , Reardon, W. , Byers, P., Lapiere, C , Prockop, D. , and Nusgens, B . (1999). 74 Human Ehlers-Danlos syndrome type VII C and bovine dermatosparaxis are caused by mutations in the procollagen I N-proteinase gene. A m J Hum Genet 65, 308-17. Colige, A . , Vandenberghe, I., Thiry, M . , Lambert, C , V a n Beeumen, J., L i , S., Prockop, D . , Lapiere, C , and Nusgens, B . (2002). Cloning and characterization of A D A M T S - 1 4 , a novel A D A M T S displaying high homology with A D A M T S - 2 and A D A M T S - 3 . J B i o l Chem 277, 5756-66. Collins-Racie, L . , Flannery, C , Zeng, W. , Corcoran, C , Annis-Freeman, B . , Agostino, M . , Ara i , M . , DiBlasio-Smith, E . , Dorner, A . , Georgiadis, K . , Jin, M . , Tan, X . , Morris, E . , and LaVall ie , E . (2004). A D A M T S - 8 exhibits aggrecanase activity and is expressed in human articular cartilage. Matrix B i o l 23, 219-30. Conacci-Sorrell, M . , Ben-Yedidia, T., Shtutman, M . , Feinstein, E . , Einat, P., and Ben-Ze'ev, A . (2002). N r - C A M is a target gene of the beta-catenin/LEF-1 pathway in melanoma and colon cancer and its expression enhances motility and confers tumorigenesis. Genes Dev 16, 2058-72. Cooke, I. (1988). Failure of implantation and its relevance to subfertility. J Reprod Fertil Suppl 36, 155-9. Couchman, J. (2003). Syndecans: proteoglycan regulators of cell-surface microdomains? Nat Rev M o l Cel l B i o l 4, 926-37. Coukos, G . , Makrigiannakis, A . , A m i n , K . , Albelda, S., and Coutifaris, C. (1998). Platelet-endothelial cell adhesion molecule-1 is expressed by a subpopulation of human trophoblasts: a possible mechanism for trophoblast-endothelial interaction during haemochorial placentation. M o l Hum Reprod 4, 357-67. Cousin, H . , Gaultier, A . , Bleux, C , Darribere, T., and Alfandari, D . (2000). P A C S I N 2 is a regulator of the metalloprotease/disintegrin A D A M 1 3 . Dev B i o l 227, 197-210. Coutifaris, C , Babalola, G . , Abisogun, A . , Kao, L . , Chin, U . , Vadillo-Ortega, F., Osheroff, J., Kl iman, H . , and Strauss, J. r. (1991). In vitro systems for the study of human trophoblast implantation. A n n N Y Acad Sci 622, 191-201. Crawford, H . , Fingleton, B . , Rudolph-Owen, L . , Goss, K . , Rubinfeld, B . , Polakis, P., and Matrisian, L . (1999). The metalloproteinase matrilysin is a target of beta-catenin transactivation in intestinal tumors. Oncogene 18, 2883-91. Crawford, H . , and Matrisian, L . (1994-1995). Tumor and stromal expression of matrix metalloproteinases and their role in tumor progression. Invasion Metastasis 14, 234-45. Cross, J., Werb, Z . , and Fisher, S. (1994). Implantation and the placenta: key pieces of the development puzzle. Science 266, 1508-18. 75 Cross, N . , Chandrasekaran, S., Jokonya, N . , Fowles, A . , Hamdy, F., Buttle, D . , and Eaton, C. (2005). The expression and regulation of A D A M T S - 1 , -4, -5, -9, and -15, and TIMP-3 by TGFbetal in prostate cells: relevance to the accumulation of versican. Prostate 63, 269-75. Dahl, U . , Sjodin, A . , Larue, L . , Radice, G . , Cajander, S., Takeichi, M . , Kemler, R., and Semb, H . (2002). Genetic dissection of cadherin function during nephrogenesis. M o l Cel l B i o l 22, 1474-87. Damsky, C , Fitzgerald, M . , and Fisher, S. (1992). Distribution patterns of extracellular matrix components and adhesion receptors are intricately modulated during first trimester cytotrophoblast differentiation along the invasive pathway, in vivo. J C l i n Invest 89, 210-22. Damsky, C , Librach, C , L i m , K . , Fitzgerald, M . , McMaster, M . , Janatpour, M . , Zhou, Y . , Logan, S., and Fisher, S. (1994). Integrin switching regulates normal trophoblast invasion. Development 120, 3657-66. Danen, E . , and Sonnenberg, A . (2003). Integrins in regulation of tissue development and function. J Pathol 201, 632-41. Dano, K . , Andreasen, P., Grondahl-Hansen, J., Kristensen, P., Nielsen, L . , and Skriver, L . (1985). Plasminogen activators, tissue degradation, and cancer. A d v Cancer Res 44, 139-266. Dano, K . , Behrendt, N . , Hoyer-Hansen, G . , Johnsen, M . , Lund, L . , Ploug, M . , and Romer, J. (2005). Plasminogen activation and cancer. Thromb Haemost 93, 676-81. Davis, M . , Ireton, R., and Reynolds, A . (2003). A core function for pl20-catenin in cadherin turnover. J Cel l B i o l 163, 525-34. Delbaldo, C , Masouye, I., Saurat, J., Vassalli, JD, and Sappino, A . (1994). Plasminogen activation in melanocyte neoplasia. Cancer Res 54, 4547-52. Demircan, K . , Hirohata, S., Nishida, K . , Hatipoglu, O., Oohashi, T., Yonezawa, T., Apte, S., and Ninomiya, Y . (2005). A D A M T S - 9 is synergistically induced by interleukin-lbeta and tumor necrosis factor alpha in O U M S - 2 7 chondrosarcoma cells and in human chondrocytes. Arthritis Rheum 52, 1451-60. Deryugina, E . , Sorocceanu, L . , and Strongin, A . (2002). Up-regulation of vascular endothelial growth factor by membrane-type 1 matrix metalloproteinase stimulates human glioma xenograft growth and angiogenesis. Cancer Res 62, 580-8. Dityatev, A . , and Schachner, M . (2003). Extracellular matrix molecules and synaptic plasticity. Nat Rev Neurosci 4,456-68. 76 Doherty, P., Will iams, G. , and Will iams, E . (2000). C A M s and axonal growth: a critical evaluation of the role of calcium and the M A P K cascade. M o l Cel l Neurosci 16, 283-95. Doyle, K . , Russell, D . , Sriraman, V . , and Richards, J. (2004). Coordinate transcription of the A D A M T S - 1 gene by luteinizing hormone and progesterone receptor. M o l Endocrinol 18, 2463-78. Ducharme, A . , Frantz, S., Aikawa, M . , Rabkin, E . , Lindsey, M . , Rohde, L . , Schoen, F. , Kel ly , R., Werb, Z . , Libby, P., and Lee, R. (2000). Targeted deletion of matrix metalloproteinase-9 attenuates left ventricular enlargement and collagen accumulation after experimental myocardial infarction. J C l i n Invest 106, 55-62. Duggan, C , Maguire, T., McDermott, E . , O'Higgins, N . , Fenhelly, J., and Duffy, M . (1995). Urokinase plasminogen activator and urokinase plasminogen activator receptor in breast cancer. Int J Cancer 61, 597-600. Duguay, D. , Foty, R., and Steinberg, M . (2003). Cadherin-mediated cell adhesion and tissue segregation: qualitative and quantitative determinants. Dev B i o l 253, 309-23. Durand, M . , Bodker, J., Christensen, A . , Dupont, D . , Hansen, M . , Jensen, J., Kjelgaafd, S., Mathiasen, L . , Pedersen, K . , Skeldal, S., Wind, T., and Andreasen, P. (2004). Plasminogen activator inhibitor-I and tumour growth, invasion, and metastasis. Thromb Haemost 91, 438-49. Egeblad, M . , and Werb, Z . (2002). New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer 2, 161-74. E l Sayegh, T., Arora, P., C A , L . , Lee, W. , Morrison, C , Overall, C , Kapus, A . , and McCul loch , C. (2004). Cortactin associates with N-cadherin adhesions and mediates intercellular adhesion strengthening in fibroblasts. J Cell Sci 117, 5117-31. Ellerbroek, S., Wu , Y . , Overall, C , and Stack, M . (2001). Functional interplay between type I collagen and cell surface matrix metalloproteinase activity. J Biol Chem 276, 24833-42. Enders, A . (1968). Fine structure of anchoring v i l l i of the human placenta. Am J Anat 122, 419-51. Enders, A . (1976). Cytology of human early implantation. Res Reprod 8, 1-2. Enders, A . , Blankenship, T., Fazleabas, A . , and Jones, C. (2001). Structure of anchoring v i l l i and the trophoblastic shell in the human, baboon and macaque placenta. Placenta 22, 284-303. Enders, A . , and Lopata, A . (1999). Implantation in the marmoset monkey: expansion of the early implantation site. Anat Rec 256, 279-99. 77 Espey, L . , Yoshioka, S., Russell, D . , Robker, R., Fujii , S., and Richards, J. (2000). Ovarian expression of a disintegrin and metalloproteinase with thrombospondin motifs during ovulation in the gonadotropin-primed immature rat. Biol Reprod 62, 1090-5. Eto, K . , Huet, C , Tarui, T., Kupriyanov, S., L i u , H . , Puzon-McLaughlin, W. , Zhang, X . , Sheppard, D . , Engvall, E . , and Takada, Y . (2002). Functional classification of A D A M s based on a conserved motif for binding to integrin alpha 9beta 1: implications for sperm-egg binding and other cell interactions. J Biol Chem 277, 17804-10. Fang, X . , J i , FL, K i m , S., Park, J., Vaught, T., Anastasiadis, P., Ciesiolka, M . , and McCrea, P. (2004). Vertebrate development requires A R V C F and p l20 catenins and their interplay with R h o A and Rac. J Cell Biol 165, 87-98. Farina, A . , Vol inia , S., Arce l l i , D . , Francioso, F., Desanctis, P., Zucchini, C , Pi lu , G. , Carinci, P., Morano, D. , Pittalis, M . , Calderoni, P., Vagnoni, S., and Rizzo, N . (2006). Evidence of genetic underexpression in chorionic v i l l i samples of euploid fetuses with increased nuchal translucency at 10-11 weeks' gestation. Prenat Diagn 26, 128-33. Feinberg, R., Kao, L . , Haimowitz, J., Queenan, J. J., Wun, T., Strauss, J. r., and Kl iman, H . (1989). Plasminogen activator inhibitor types 1 and 2 in human trophoblasts. PAI-1 is an immunocytochemical marker of invading trophoblasts. Lab Invest 61, 20-6. Felding-Habermann, B . , Mueller, B . , Romerdahl, C. , and Cheresh, D . (1992). Involvement of integrin alpha V gene expression in human melanoma tumorigenicity. J Clin Invest 89, 2018-22. Feltes, C , Kudo, A . , Blaschuk, O., and Byers, S. (2002). A n alternatively spliced cadherin-11 enhances human breast cancer cell invasion. Cancer Res 62, 6688-97. Fernandes, R., Hirohata, S., Engle, J., Colige, A . , Cohn, D . , Eyre, D . , and Apte, S. (2001). Procollagen II amino propeptide processing by A D A M T S - 3 . Insights on dermatosparaxis. J Biol Chem 276, 31502-9. Ferretti, C , Bruni, L . , Dangles-Marie, V . , Pecking, A . , and Bellet, D . (2006). Molecular circuits shared by placental and cancer cells, and their implications in the proliferative, invasive and migratory capacities of trophoblasts. Hum Reprod Update Epub ahead o f print. Festuccia, C , Dolo, V . , Guerra, F., V i o l i n i , S., M u z i , P., Pavan, A . , and Bolgna, M . (1998). Plasminogen activator system modulates invasive capacity and proliferation in prostatic tumor cells. Clin Exp Metastasis 16, 513-28. Fingleton, B . (2006). Matrix metalloproteinases: roles in cancer and metastasis. Front Biosci 11, 479-91. Fisher, J., Field, C , Zhou, H . , Harris, T., Henderson, M . , and Choong, P. (2000). Urokinase plasminogen activator system gene expression is increased in human breast carcinoma 78 and its bone metastases~a comparison of normal breast tissue, non-invasive and invasive carcinoma and osseous metastases. Breast Cancer Res Treat 61, 1-12. Fisher, S., Cui, T., Zhang, L., Hartman, L. , Grahl, K., Zhang, G., Tarpey, J., and Damsky, C. (1989). Adhesive and degradative properties of human placental cytotrophoblast cells in vitro. JCell Biol 109, 891-902. Fisher, S., and Damsky, C. (1993). Human cytotrophoblast invasion. Semin Cell Biol 4, 183-8. Flannery, C., Zeng, W., Corcoran, C , Collins-Racie, L., Chockalingam, P., Herbert, T., Mackie, S., McDonagh, T., Crawford, T., Tomkinson, K., LaVallie, E. , and Morris, E. (2002). Autocatalytic cleavage of ADAMTS-4 (Aggrecanase-1) reveals multiple glycosaminoglycan-binding sites. J Biol Chem 277, 42775-80. Floridon, C , Nielsen, O., Holund, B., Sunde, L. , Westergaard, J., Thomsen, S., and Teisner, B. (2000). Localization of E-cadherin in villous, extravillous and vascular trophoblasts during intrauterine, ectopic and molar pregnancy. Mol Hum Reprod 6, 943-50. Fogerty, F., Akiyama, S., Yamada, K., and Mosher, D. (1990). Inhibition of binding of fibronectin to matrix assembly sites by anti-integrin (alpha 5 beta 1) antibodies. JCell Biol 111, 699-708. Foty, R., and Steinberg, M . (2004). Cadherin-mediated cell-cell adhesion and tissue segregation in relation to malignancy. Int J Dev Biol. Frank, H., Gunawan, B., Ebeling-Stark, I., Schulten, H., Funayama, H., Cremer, U., Huppertz, B., Gaus, G., Kaufmann, P., and Fuzesi, L. (2000). Cytogenetic and DNA-fingerprint characterization of choriocarcinoma cell lines and a trophoblast/choriocarcinoma cell hybrid. Cancer Genet Cytogenet 116, 16-22. Fujikawa, K., Suzuki, H., McMullen, B., and Chung, D. (2001). Purification of human von Willebrand factor-cleaving protease and its identification as a hew member of the metalloproteinase family. Blood 98, 1662-6. Furesz, T., Smith, C , and Moe, A. (1993). ASC system activity is altered by development of cell polarity in trophoblast from human placenta. Am J Physiol 265, C212-7. Galliher, A., and Schiemann, W. (2006). beta3 Integrin and Src facilitate transforming growth factor-beta mediated induction of epithelial-mesenchymal transition in mammary epithelial cells. Breast Cancer Res 8, R42. Galton, M . (1962). DNA content of placental nuclei. J Cell Biol 13, 183-91. Gao, G., Plaas, A., Thompson, V., Jin, S., Zuo, F., and Sandy, J. (2004). ADAMTS4 (aggrecanase-1) activation on the cell surface involves C-terminal cleavage by glycosylphosphatidyl inositol-anchored membrane type 4-matrix metalloproteinase and 79 binding of the activated proteinase to chondroitin sulfate and heparan sulfate on syndecan-1. J Biol Chem 279, 10042-51. Gao, G. , Westling, J., Thompson, V . , Howell , T., Gottschall, P., and Sandy, J. (2002). Activation of the proteolytic activity of A D A M T S 4 (aggrecanase-1) by C-terminal truncation. J Biol Chem 277, 11034-41. Gendron, C , Kashiwagi, M . , Hughes, C , Caterson, B . , andNagase, H . (2003). TIMP-3 inhibits aggrecanase-mediated glycosaminoglycan release from cartilage explants stimulated by catabolic factors. FEBS Lett 555, 431-6. Gerbie, A . , Hathaway, H . , and Brewer, J. (1968). Autoradiographic analysis of normal trophoblastic proliferation. Am J Obstet Gynecol 100, 640-8. Giroldi , L . , Shimazui, T., Schalken, J., Yamasaki, H . , and Bringuier, P. (2000). Classical cadherins in urological cancers. Morphologic 84, 31-8. Glasson, S., Askew, R., Sheppard, B . , Carito, B . , Blanchet, T., M a , H . , Flannery, C , Kanki , K . , Wang, E . , Peluso, D . , Yang, Z . , Majumdar, M . , and Morris, E . (2004). Characterization of and osteoarthritis susceptibility in ADAMTS-4-knockou t mice. Arthritis Rheum 50, 2547-58. Glasson, S., Askew, R., Sheppard, B . , Carito, B . , Blanchet, T., M a , H . , Flannery, C , Peluso, D . , Kanki , K . , Yang, Z . , Majumdar, M . , and Morris, E . (2005). Deletion of active A D A M T S 5 prevents cartilage degradation in a murine model of osteoarthritis. Nature 434, 644-8. Godefroy, E . , Moreau-Aubry, A . , Diez, E . , Dreno, B . , Jotereau, F., and Guilloux, Y . (2005). alpha v beta3-dependent cross-presentation of matrix metalloproteinase-2 by melanoma cells gives rise to a new tumor antigen. J Exp Med 202, 61-72. Goldman-Wohl, D. , and Yagel, S. (2002). Regulation of trophoblast invasion: from normal implantation to pre-eclampsia. Mol Cell Endocrinol 187, 233-8. Gomis-Ruth, F. (2003). Structural aspects of the metzincin clan of metalloendopeptidases. Mol Biotechnol 24, 157-202. Gonzalez-Reyes, A . , and St Johnston, D . (1998). The Drosophila A P axis is polarised by the cadherin-mediated positioning of the oocyte. Development 125, 3635-44. Good, D . , Polverini, P., Rastinejad, F., Le Beau, M . , Lemons, R., Frazier, W. , and Bouck, n. (1990). A tumor suppressor-dependent inhibitor of angiogenesis is immunologically and functionally indistinguishable from a fragment of thrombospondin. Proc Natl Acad Sci U SAS7, 6624-8. 80 Goodwin, M . , Kovacs, E . , Thoreson, M . , Reynolds, A . , and Yap, A . (2003). Min imal mutation of the cytoplasmic tail inhibits the ability of E-cadherin to activate Rac but not phosphatidylinositol 3-kinase: direct evidence of a role for cadherin-activated Rac signaling in adhesion and contact formation. J Biol Chem 278, 20533-9. Goto, S., Yaoita, E . , Matsunami, H . , Kondo, D. , TYamamoto, T., Kawasaki, K . , Arakawa, M . , and Kihara, I. (1998). Involvement of R-cadherin in the early stage of glomerulogenesis. JAm Soc Nephrol 9, 1234-41. Gould, R., Polokoff, M . , Friedman, P., Huang, T., Holt, J., Cook, J., and Niewiarowski, S. (1990). Abstract Disintegrins: a family of integrin inhibitory proteins from viper venoms. Proc Soc Exp Biol Med 195, 168-71. Gradl, D. , Kuh l , M . , and Wedlich, D. (1999). The Wnt/Wg signal transducer beta-catenin controls fibronectin expression. Mol Cell Biol 19, 5576-87. Graff, J., Gabrielson, E . , Fujii , H . , Baylin, S., and Herman, J. (2000). Methylation patterns of the E-cadherin 5' C p G island are unstable and reflect the dynamic, heterogeneous loss of E -cadherin expression during metastatic progression. J Biol Chem 275, 2727-32. Graham, C. (1997). Effect of transforming growth factor-beta on the plasminogen activator system in cultured first trimester human cytotrophoblasts. Placenta 18, 137-43. Graham, C , Connelly, I., MacDougall , J., Kerbel, R., Stetler-Stevenson, W. , and Lala, P. (1994). Resistance of malignant trophoblast cells to both the anti-proliferative and anti-invasive effects of transforming growth factor-beta. Exp Cell Res 214, 93-9. Graham, C , Hawley, T., Hawley, R., MacDougall , J., Kerbel, R., Khoo, N . , and Lala, P. (1993). Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res 206, 204-11. Graham, C , and Lala, P. (1991). Mechanism of control of trophoblast invasion in situ. J Cell Physiol 148, 228-34. Graham, C , Lysiak, J., McCrea, K . , and Lala, P. (1992). Localization of transforming growth factor-beta at the human fetal-maternal interface: role in trophoblast growth and differentiation. Biol Reprod 46, 561-72. Grunwald, G . (1993). The structural and functional analysis of cadherin calcium-dependent cell adhesion molecules. Curr Opin Cell Biol 5, 797-805. Gumbiner, B . (1995). Signal transduction of beta-catenin. Curr Opin Cell Biol 7, 634-40. Gumbiner, B . (1996). Cel l adhesion: the molecular basis of tissue architecture and morphogenesis. Cell 84, 345-57. 81 Gumbiner, B . (2000). Regulation of cadherin adhesive activity. J Cell Biol 148, 399-404. Gurezka, R., Laage, R., Brosig, B . , and Langosch, D . (1999). A heptad motif of leucine residues found in membrane proteins can drive self-assembly of artificial transmembrane segments. J Biol Chem 274, 9265-70. Gustavson, M . , Crawford, FL, Fingleton, B . , and Matrisian, L . (2004). T c f binding sequence and position determines beta-catenin and Lef-1 responsiveness of M M P - 7 promoters. Mol Carcinog 41, 125-39. Hajra, K . , and Fearson, E . (2002). Cadherin and catenin alterations in human cancer. Genes Chromosomes Cancer 34, 255-68. Hal l , N . , Klenotic, P., Anand-Apte, B . , and Apte, S. (2003). ADAMTSL-3 /punc t in -2 , a novel glycoprotein in extracellular matrix related to the A D A M T S family of metalloproteases. Matrix Biol 22, 501-10. Handschuh, K . , Guibourdenche, J., Tsatsaris, V . , Guesnon, M . , Laurendeau, I., Evain-Brion, D . , and Fournier, T. (2006). Human Chorionic Gonadotropin Expression in Human Trophoblasts from Early Placenta: Comparative Study Between Vil lous and Extravillous Trophoblastic Cells. Placenta Epud ahead of print. Hartstein, M . , Grove, A . , and Woog, J. (1997). The role of the integrin family of adhesion molecules in the development of tumors metastatic to the orbit. Opthal Plast Recontr Surgtt, 227-38. Hashimoto, G . , Shimoda, M . , and Okada, Y . (2004). A D A M T S - 4 (aggrecanase-1) interaction with the C-terminal domain of fibronectin inhibits proteolysis of aggrecan. J Biol Chem 279, 32483-32491. Hatta, K . , Nose, A . , Nagafuchi, A . , and Takeichi, M . (1988). Cloning and expression of c D N A encoding a neural calcium-dependent cell adhesion molecule: its identity in the cadherin gene family. J Cell Biol 106, 873-81. Hatta, K . , Okada, T., and Takeichi, M . (1985). A monoclonal antibody disrupting calcium-dependent cell-cell adhesion of brain tissues: possible role of its target antigen in animal pattern formation. Proc Natl Acad Sci USAS2, 2789-93. Hatta, K . , and Takeichi, M . (1986). Expression of N-cadherin adhesion molecules associated with early morphogenetic events in chick development. Nature 320, 447-9. Hatzfeld, M . (1999). The armadillo family of structural proteins. Int Rev Cytol 186, 179-224. Hazan, R., Kang, L . , Whooley, B . , and Borgen, P. (1997). N-cadherin promotes adhesion between invasive breast cancer cells and the stroma. Cell Adhes Commun 4, 399-411. 82 Hazan, R., Phillips, G . , Qiao, R., Norton, L . , and Aaronson, S. (2000). Exogenous expression of N-cadherin in breast cancer cells induces cell migration, invasion, and metastasis. J Cell Biol 148, 779-90. Hazan, R., Qiao, R., Keren, R., Badano, I., and Suyama, K . (2004). Cadherin switch in tumor progression. Ann N YAcad Sci 1014, 155-63. Hegedus, B . , Margo, F., Jakab, K . , Sharpe-Timms, K . , and Forgacs, G . (2006). The interplay of cell-cell and cell-matrix interactions in the invasive properties of brain tumors. Biophys J 91,2708-16. Held-Feindt, J., Paredes, E . , Blomer, U . , Seidenbecher, C , Stark, A . , Mehdorn, H . , and Mentlein, R. (2005). Matrix-degrading proteases A D A M T S 4 and A D A M T S 5 (disintegrins and metalloproteinases with thrombospondin motifs 4 and 5) are expressed in human glioblastomas. Int J Cancer EPub. Hemmings, D. , Ki l an i , R., Nykiforuk, C , Preiksaitis, J., and Guilbert, L . (1998). Permissive cytomegalovirus infection of primary villous term and first trimester trophoblasts. J Virol 72, 4970-0. Hendrix, M . , Sftor, E . , Kirschmann, D. , Quaranta, V . , and Seftor, R. (2003). Abstract Remodeling of the microenvironment by aggressive melanoma tumor cells. Ann N YAcad Sci 995, 151-61. Hertig, A . , Rock, J.,.and Adams, E . (1956). A description of 34 human ova within the first 17 days of development. Am JAnat 98, 297-328. Higuchi, T., Kanzaki, H . , Nakayama, H . , Fujimoto, M . , Hatayama, H . , Kojima, K . , Iwai, M . , M o r i , T., and Fujita, J. (1995). Induction of tissue inhibitor of metalloproteinase 3 gene expression during in vitro decidualization of human endometrial stromal cells. Endocrinology 136, 4973-81. Hirano, S., Kimoto, N . , Shimoyama, Y . , Hirohashi, S., and Takeichi, M . (1992). Identification of a neural alpha-catenin as a key regulator of cadherin function and multicellular organization. Cell 70, 293-301. Hirohata, S., Wang, L . , Miyagi , M . , Yan, L . , Seldin, M . , Keene, D. , Crabb, J., and Apte, S. (2002). Punctin, a novel A D A M T S - l i k e molecule, A D A M T S L - 1 , in extracellular matrix. J Biol Chem 211,12182-9. Hofmann, U . , Westphal, J., Van Kraats, A . , Ruiter, D. , and Van Muijen, G . (2000). Expression of integrin alpha(v)beta(3) correlates with activation of membrane-type matrix metalloproteinase-1 ( M T 1 - M M P ) and matrix metalloproteinase-2 (MMP-2) in human melanoma cells in vitro and in vivo. Int J Cancer 87, 12-9. 83 Hoschuetzky, H . , Aberle, H . , and Kemler, R. (1994). Beta-catenin mediates the interaction of the cadherin-catenin complex with epidermal growth factor receptor. J Cell Biol 127, 1375-80. Hoshina, M . , Boothby, M . , and Boime, I. (1982). Cytological localization of chorionic gonadotropin alpha and placental lactogen m R N A s during development of the human placenta. JCell Biol 93, 190-8. Huber, O., Kemler, R., and Langosch, D . (1999). Mutations affecting transmembrane segment interactions impair adhesiveness of E-cadherin. J Cell Sci 112, 4415-23. Huber, O., Korn, R., McLaughl in , J., Ohsugi, M . , Herrmann, B . , and Kemler, R. (1996). Nuclear localization of beta-catenin by interaction with transcription factor L E F - 1 . Mech Dev 59, 3-10. Huber, O., Krohn, M . , and Kemler, R. (1997). A specific domain in alpha-catenin mediates binding to beta-catenin or plakoglobin. JCell Sci 110, 1759-65. Huppertz, B . , Kertschanska, S., Demir, A . , Frank, H . , and Kaufmann, P. (1998). Immunohistochemistry of matrix metalloproteinases ( M M P ) , their substrates, and their inhibitors (TIMP) during trophoblast invasion in the human placenta. Cell Tissue Res 291, 133-48. Huppertz, B . , Kertschanska, S., Frank, H . , Gaus, G . , Funayama, H . , and Kaufmann, P. (1996). Extracellular matrix components of the placental extravillous trophoblast: immunocytochemistry and ultrastructural distribution. Histochem Cell Biol 106, 291-301. Hurskainen, T., Hirohata, S., Seldin, M . , and Apte, S. (1999). A D A M - T S 5 , A D A M - T S 6 , and A D A M - T S 7 , novel members of a new family of zinc metalloproteases. General features and genomic distribution of the A D A M - T S family. J Biol Chem 274, 25555-63. Hurskainen, T., Hoyhyta, M . , Tuuttila, A . , Oikarinen, A . , and Autio-Harmainen, H . (1996). m R N A expressions of T IMP-1 , -2, and -3 and 9 2 - K D type IV collagenase in early human placenta and decidual membrane as studied by in situ hybridization. J Histochem Cytochem 44, 1379-88. Hurskainen, T., Seiki, M . , Apte, S., Syrjakallio-Tlitalo, M . , Sorsa, T., Oikarinen, A . , and Autio-Harmainen, H . (1998). Production of membrane-type matrix metalloproteinase-1 ( M T -M M P - 1 ) in early human placenta. A possible role in placental implantation? J Histochem Cytochem 46, 221-9. Hynes, R. (1992). Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69, 11-25. Iba, K . , Albrechten, R., Gi lp i in , B . , Frohlich, C. , Loechel, F., Zolkiewska, A . , Ishiguro, K . , Kojima, T., L i u , W. , Langford, J., Sanderson, R., Brakebusch, C. , Fassler, R., and 84 Wewer, U . (2000). The cysteine-rich domain of human A D A M 12 supports cell adhesion through syndecans and triggers signaling events that lead to betal integrin-dependent cell spreading. J Cell Biol 149, 1143-56. Ignatius, M . , Large, T., Houde, M . , Tawil , J., Barton, A . , Esch, F., Carbonetto, S., and Reichardt, L . (1990). Molecular cloning of the rat integrin alpha 1-subunit: a receptor for laminin and collagen. J Cell Biol 111, 709-20. Ilic, D. , Genbacev, O., Jin, F., Caceres, E . , Almeida, E . , Bellingard-Dubouchaud, V . , Schaefer, E . , Damsky, C , and Fisher, S. (2001). Plasma membrane-associated p Y 3 9 7 F A K is a marker of cytotrophoblast invasion in vivo and in vitro. Am J Pathol 159, 93-108. Inuzuka, FL, Miyatani, S., and Takeichi, M . (1991). R-cadherin: a novel Ca(2+)-dependent cell-cell adhesion molecule expressed in the retina. Neuron 7, 69-79. Irving, J., Lysiak, J., Graham, C , Hearn, S., Han, V . , and Lala, P. (1995). Characteristics of trophoblast cells migrating from first trimester chorionic villus explants and propagated in culture. Placenta 16, 413-33. Irwin, J., and Giudice, L . (1998). Insulin-like growth factor binding protein-1 binds to placental cytotrophoblast alpha5betal integrin and inhibits cytotrophoblast invasion into decidualized endometrial stromal cultures. Growth Horm IGF Res 8, 21-31. Islam, S., Carey, T., Wolf, G . , M J , W. , and Johnson, K . (1996). Expression of N-cadherin by human squamous carcinoma cells induces a scattered fibroblastic phenotype with disrupted cell-cell adhesion. J Cell Biol 135, 1643-54. Islami, D. , Mock, P., and Bischof, P. (2001). Effects of human chorionic gonadotropin on trophoblast invasion. Semin Reprod Med 19, 49-53. Jaffe, A . , and Hal l , A . (2005). Rho GTPases: biochemistry and biology. Annu Rev Cell Dev Biol 21, 247-69. Jennbacken, K . , Gustavsson, H . , Welen, K . , Vallbo, C , and Damber, J. (2006). Prostate cancer progression into androgen independency is associated with alterations in cell adhesion and invasivity. Prostate 66, 1631-40. Jia, M . , Schwartz, M . , and Sang, Q. (2000). Suppression of human microvascular endothelial cell invasion and morphogenesis with synthetic matrixin inhibitors. Targeting angiogenesis with M M P inhibitors. Adv Exp Med Biol 476, 181-94. Jodele, S., Blavier, L . , TYoon , L . , and DeClerck, Y . (2006). Modifying the soil to affect the seed: role of stromal-derived matrix metalloproteinases in cancer progression. Cancer Metastasis Rev 25, 35-43. 85 Johnson, E . , Theisen, C , Johnson, K . , and Wheelock, M . (2004). R-cadherin influences cell motility via Rho family GTPases. J Biol Chem 2 7 9 , 31041 -9. Johnson, M . , Maro, B . , and Takeichi, M . (1986). The role of cell adhesion in the synchronization and orientation of polarization in 8-cell mouse blastomeres. J Embryol Exp Morphol 9 3 , 239-55. Jones, J., Prevette, T., Gockerman, A . , and Clemmons, D . (1996). Ligand occupancy of the alpha-V-beta3 integrin is necessary for smooth muscle cells to migrate in response to insulin-like growth factor. Proc Natl Acad Sci USA 9 3 , 2482-7. Jonsson-Rylander, A . , Nilsson, T., Fritsche-Danielson, R., Hammarstrom, A . , Behrendt, M . , Andersson, J., Lingren, K . , Andersson, A . , Wallbrandt, P., Rosengren, B . , Brodin, P., Thelin, A . , Westin, A . , Hurt-Camejo, E . , and Lee-Sogaard, C. (2005). Role of A D A M T S -1 in atherosclerosis: remodeling of carotid artery, immunohistochemistry, and proteolysis of versican. Arterioscler Thromb Vase Biol 2 5 , 180-5. Kabir-Salmani, M . , Shiokawa, S., Akimoto, Y . , Sakai, K . , Nagamatsu, S., Sakai, K . , Nakamura, Y . , Lotfi , A . , Kawakami, H . , and Iwashita, M . (2003). Alphavbeta3 integrin signaling pathway is involved in insulin-like growth factor I-stimulated human extravillous trophoblast cell migration. Endocrinology 1 4 4 , 1620-30. Karmakar, S., and Das, C. (2002). Regulation of trophoblast invasion by IL-lbeta and T G F -betal. Am J Reprod Immunol 4 8 , 210-9. Kashiwagi, M . , Enghild, J., Gendron, C. , Hughes, C , Caterson, B . , Itoh, Y . , and Nagase, H . (2004). Altered proteolytic activities of A D A M T S - 4 expressed by C-terminal processing. J Biol Chem 2 7 9 , 10109-19. Kashiwagi, M . , Tortorella, M . D. , Nagase, H . , and Brew, K . (2001). TIMP-3 is a potent inhibitor of aggrecanase 1 ( A D A M - T S 4 ) and aggrecanase 2 ( A D A M - T S 5 ) . J Biol Chem 2 7 6 , 12501-4. Kaufmann, P., Black, S., and Huppertz, B . (2003). Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biol Reprod 6 9 , 1 - 7 . Kaufmann, P., and Castellucci, M . (1997). Extravillous trophoblast in the human placenta. Troph Res 1 0 , 21-65. Kaufmann, U . , Kirsch, J., Irintchev, A . , Wernig, A . , and Starzinski-Powitz, A . (1999). The M -cadherin catenin complex interacts with microtubules in skeletal muscle cells: implications for the fusion of myoblasts. J Cell Sci 1 1 2 , 55-68. Kennedy, M . , Douglas, G . , and King , B . (1992). Expression of transferrin receptors during differentiation of human placental trophoblast cells in vitro. Placenta 1 3 , 43-53. 86 Kerszberg, M . , and Changeux, J. (1998). A simple molecular model of neurulation. Bioessays 20, 758-70. Khodr, G . , and Siler-Khodr, T. (1980). Placental luteinizing hormone-releasing factor and its synthesis. Science 207, 315-7. Kilburn, B . , Wang, J., Duniec-Dmuchowski, Z . , Leach, R., Romero, R., and Armant, D . (2000). Extracellular matrix composition and hypoxia regulate the expression of H L A - G and integrins in a human trophoblast cell line. Biol Reprod 62, 739-47. K i m , J., Islam, S., K i m , Y . , Prudoff, R., Sass, K . , Wheelock, M . , and Johnson, K . (2000). N -Cadherin extracellular repeat 4 mediates epithelial to mesenchymal transition and increased motility. J Cell Biol 151, 1193-206. K i m , J., Zhang, K , Chen, J., Wtnn, K , Kramer, R., and Woodley, D. (1992). Abstract Mechanism of human keratinocyte migration on fibronectin: unique roles of R G D site and integrins. J Cell Physiol 151,443-50. Kimber, S., and Spanswick, C. (2000). Blastocyst implantation: the adhesion cascade. Semin Cell Dev Biol 11, 77-92. Kinder, D. , Berger, M . , Meuller, B . , and Silber, J. (1993). Urokinase plasminogen activator is elevated in human astrocytic gliomas relative to normal adjacent brain. Oncol Res 5, 409-14. King , A . , Thomas, L . , and Bischof, P. (2000). Ce l l culture models of trophoblast II: trophoblast cell lines—a workshop report. Placenta 21. Klaus, C , Plaimauer, B . , Studt, J., Dorner, F., Lammle, B . , Mannucci, P., and Scheiflinger, F. (2004). Epitope mapping of A D A M T S 13 autoantibodies in acquired thrombotic thrombocytopenic purpura. Blood 103, 4514-9. Kl iman, H . , and Feinberg, R. (1990). Human trophoblast-extracellular matrix ( E C M ) interactions in vitro: E C M thickness modulates morphology and proteolytic activity. Proc Natl Acad Sci U S A . 1990 Apr;87(8):3057-61. Proc Natl Acad Sci USAS7, 3057-61. Kl iman, H . , Nestler, J., Sermasi, E . , Sanger, J., and Strauss, J. r. (1986). Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 118, 1567-82. Klingelhofer, J., Troyanovsky, B . , Laur, O., and Troyanovsky, S. (2000). Amino-terminal domain of classic cadherins determines the specificity of the adhesive interactions. J Cell Sci 113, 2829-36. 87 Knudsen, K. , . Soler, A . , Johnson, K . , and Wheelock, M . (1995). Interaction of alpha-actinin with the cadherin/catenin cell-cell adhesion complex via alpha-catenin. J Cell Biol 130, 67-77. K o , K . , Arora, P., Lee, W. , and McCul loch , C. (2000). Biochemical and functional characterization of intercellular adhesion and gap junctions in fibroblasts. Am J Physiol Cell Physiol 279 , CI47'-57. Koch, A . , Bozic , D. , Pertz, O., and Engel, J. (1999). Homophilic adhesion by cadherins. Curr Opin Struct Biol 9, 275-81. Kohler, P., and Bridson, W . (1971). Isolation of hormone producing clonal lines of human choriocarcinoma. J Clin Endocrin 32 , 683-687. Korinek, V . , Barker, N . , Mor in , P., van Wichen, D. , de Weger, R., Kinzler, K , Vogelstein, B . , and Clevers, H . (1997). Constitutive transcriptional activation by a beta-catenin-Tcf complex in A P C - / - colon carcinoma. Science 275 , 1784-7. Koshikawa, N . , Minegishi, T., Sharabi, A . , Quaranta, V . , and Seiki, M . (2005). Free Ful l Text Membrane-type matrix metalloproteinase-1 ( M T 1 - M M P ) is a processing enzyme for human laminin gamma 2 chain. J Biol Chem 280 , 88-93. Koslov, E . , Maupin, P., Pradhan, D . , Morrow, J., and Rimm, D. (1997). Alpha-catenin can form asymmetric homodimeric complexes and/or heterodimeric complexes with beta-catenin. J Biol Chem 272, 27301-6. Kramerova, I., Kawaguchi, N . , Fessler, L . , Nelson, R., Chen, Y . , Kramerov, A . , Kusche-Gullberg, M . , Kramer, J., Ackley, B . , Sieron, A . , Prockop, D . , and Fessler, J. (2000). Papilin in development; a pericellular protein with a homology to the A D A M T S metalloproteinases. Development 127, 5475-85. Krebs, C , Macara, L . , Leiser, R., Bowman, A . , Greer, I., and Kingdom, L . (1996). ntrauterine growth restriction with absent end-diastolic flow velocity in the umbilical artery is associated with maldevelopment of the placental terminal villous tree. Am J Obstet Gynecol 175,1534-42. Kuefer, R., Hofer, M . , Gschwend, J., Pienta, K . , Sanda, M . , Chinnaiyan, A . , Rubin, M . , and Day, M . (2003). The role of an 80 k D a fragment of E-cadherin in the metastatic progression of prostate cancer. Clin Cancer Res 9, 6447-52. Kuno, K . , Bannai, K . , Hakozaki, M . , Matsushima, K . , and Hirose, K . (2004). The carboxyl-terminal half region of A D A M T S - 1 suppresses both tumorigenicity and experimental tumor metastatic potential. Biochem Biophys Res Commun 319 , 1327-33. Kuno, K . , Kanada, N . , Nakashima, E . , Fujiki, F., Ichimura, F., and Matsushima, K . (1997). Molecular cloning of a gene encoding a new type of metalloproteinase-disintegrin family 88 protein with thrombospondin motifs as an inflammation associated gene. J Biol Chem 272,556-62. Kuno, K . , and Matsushima, K . (1998). A D A M T S - 1 protein anchors at the extracellular matrix through the thrombospondin type I motifs and its spacing region. J Biol Chem 273, 13912-7. Kuno, K . , Okada, Y . , Kawashima, H . , Nakamura, H . , Miyasaka, M . , Ohno, H . , and Matsushima, K . (2000). A D A M T S - 1 cleaves a cartilage proteoglycan, aggrecan. FEBS Lett 478, 241-5. Kuno, K . , Terashima, Y . , and Matsushima, K . (1999). A D A M T S - 1 is an active metalloproteinase associated with the extracellular matrix. J Biol Chem 274, 18821-6. Kuphal, S., Bauer, R., and Bosserhoff, A . (2005). Abstract Integrin signaling in malignant melanoma. Cancer Metastasis Rev 24, 195-222. Kuphal, S., and Bosserhoff, A . (2006). Influence of the cytoplasmic domain of E-cadherin on endogenous N-cadherin expression in malignant melanoma. Oncogene 25, 248-59. Kussel-Andermann, P., El-Amraoui , A . , Safieddine, S., Nouaille, S., Perfettini, I., Lecuit, M . , Cossart, P., Wolfrum, U . , and Petit, C . (2000). Vezatin, a novel transmembrane protein, bridges myosin VILA to the cadherin-catenins complex. EMBO J19, 6020-9. Lafrenie, R., and Yamada, K . (1996). Integrin-dependent signal transduction. J Biol Chem 61, 543-53. Lala, P., and Hamilton, G . (1996). Growth factors, proteases and protease inhibitors in the maternal-fetal dialogue. Placenta 17, 545-55. Lala, P., Lee, B . , X u , G . , and Chakraborty, C. (2002). Human placental trophoblast as an in vitro model for tumor progression. Can J Physiol Pharmacol 80, 142-9. Lambert, M . , Padilla, F., and Mege, R. (2000). Immobilized dimers of N-cadherin-Fc chimera mimic cadherin-mediated cell contact formation: contribution of both outside-in and inside-out signals. J Cell Sci 113, 2207-19. Larue, L . , Ohsugi, M . , Hirchenhain, J., and Kemler, R. (1994). E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc Natl Acad Sci USA 91, 8263-7. Lash, G . , Otun, H . , Innes, B . , Bulmer, J., Searle, R., and Robson, S. (2005). Inhibition of trophoblast cell invasion by T G F B 1 , 2, and 3 is associated with a decrease in active proteases. Biol Reprod 73, 374-81. Lawler, J., and Detmar, M . (2004). Tumor progression: the effects of thrombospondin-1 and -2. Int J Biochem Cell Biol 36, 1038-45. 89 Leavesley, D . , Oliver, J., Swart, B . , Berndt, M . , Haylock, D . , and Simmons, P. (1994). Abstract Signals from platelet/endothelial cell adhesion molecule enhance the adhesive activity of the very late antigen-4 integrin of human CD34+ hemopoietic progenitor cells. J Immunol 153, 4673-83. Leckband, D. , and Sivasankar, S. (2000). Mechanism of homophilic cadherin adhesion. Curr Opin Cell Biol 12,587-92. Lee, N . , Rodriguez-Manzaneque , J., Thai, S., Twal, W. , Luque, A . , Lyons, K . , Argraves, W. , and Iruela-Arispe, M . (2005). Fibulin-1 acts as a cofactor for the matrix metalloprotease A D A M T S - 1 . J Biol Chem 280, 34796-804. Leiser, R., and Kaufmann, P. (1994). Placental structure: in a comparative aspect. Exp Clin Endocrinol 102, 122-34. Levy, G. , Nichols, W. , Lian, E . , Foround, T., McClin t ick , J., McGee, B . , Yang, A . , Siemieniak, D. , Stark, K . , Gruppo, R., Sarode, R., Shurin, S., Chandrasekaran, V . , Stabler, S., Sabio, H . , Bouhassira, E . , Upshaw, J. J., Ginsburg, D. , and Tsai, H . (2001). Mutations in a member of the A D A M T S gene family cause thrombotic thrombocytopenic purpura. Nature 413, 475-6. L i , J., Patel, V . , and Radice, G . (2006). Dysregulation of cell adhesion proteins and cardiac arrhythmogenesis. Clin Med Res 4, 42-52. L i , S., Arita, M . , Fertala, A . , Bao, Y . , Kopen, G . , Langsjo, T., Hyttinen, M . , Helminen, FL, and Prockop, D . (2001). Transgenic mice with inactive alleles for procollagen N-proteinase ( A D A M T S - 2 ) develop fragile skin and male sterility. Biochem J355, 271-8. Librach, C. , Werb, Z . , Fitzgerald, M . , Chiu, K . , Corwin, N . , Esteves, R., Grobelny, D. , Galardy, R., Damsky, C. , and Fisher, S. (1991). 92-kD type IV collagenase mediates invasion of human cytotrophoblasts. J Cell Biol 113, 437-49. Lickert, FL, Bauer, A . , Kemler, R., and Stappert, J. (2000). Casein kinase II phosphorylation of E-cadherin increases E-cadherin/beta-catenin interaction and strengthens cell-cell adhesion. J Biol Chem 275, 5090-5. Liotta, L . , and Stetler-Stevenson, W . (1991). Tumor invasion and metastasis: an imbalance of positive and negative regulation. Cancer Res 51, 5054s-5059s. L i u , C , Kong, W. , Ilalov, K . , Y u , S., X u , G . , Prazak, L . , Fajardo, M . , Sehgal, B . , and D i Cesare, P. (2006a). A D A M T S - 7 : a metalloproteinase that directly binds to and degrades cartilage oligomeric matrix protein. FASEB J20, 988-90. 90 L i u , C , Kong, W. , X u , K . , Luan, Y . , Ilalov, K . , Sehgal, B . , Y u , S., Howell , R., and D i Cesare, P. (2006b). A D A M T S - 1 2 associates with and degrades cartilage oligomeric matrix protein. J Biol Chem 281, 15800-8. L i u , D . , and Rabbani, S. (1995). Induction of urinary plasminogen activator by retinoic acid results in increased invasiveness of human prostate cancer cells PC-3 . Prostate 27, 269-76. Llamazares, M . , Cai , S., Quesada, V . , and Lopez-Otin, C. (2003). Identification and characterization of A D A M T S - 2 0 defines a novel subfamily of metalloproteinases-disintegrins with multiple thrombospondin-1 repeats and a unique G O N domain. J Biol Chem 278, 13382-9. Luo, J., Dunn, T., Ewing, C , Sauvageot, J., Chen, Y . , Trent, J., and Isaacs, W . (2002). Gene expression signature of benign prostatic hyperplasia revealed by c D N A microarray analysis. Prostate 51, 189-200. Lysiak, J., Hunt, J., Pringle, G . , and Lala, P. (1995). Localization of transforming growth factor beta and its natural inhibitor decorin in the human placenta and decidua throughout gestation. Placenta 16, 221-31. Macara, L . , Kingdom, L . , Kaufmann, P., Kohnen, G. , Hair, J., More, I., Lya l l , F., and Greer, I. (1996) . Structural analysis of placental terminal v i l l i from growth-restricted pregnancies with abnormal umbilical artery Doppler waveforms. Placenta 17, 37-48. MacCalman, C , Furth, E . , Omigbodun, A . , Bronner, M . , Coutifaris, C , and Strauss, J. r. (1996). Regulated expression of cadherin-11 in human epithelial cells: a role for cadherin-11 in trophoblast-endometrium interactions? Dev Dyn 206, 201 -11. MacCalman, C , Omigbodun, A . , Tian, X . , Fortune, J., Furth, E . , Coutifaris, C , and Strauss, J. r. (1997) . Novel cell adhesion molecules: Roles in implantation? In "The endometrium as a target for contraception." (H. Beier, M . Harper, and K . Chwalisz, Eds.), pp. 137-157. Springer Verlag, Berlin. Maeda, M . , Johnson, E . , Mandal, S., Lawson, K . , Ke im, S., Svoboda, R., Caplan, S., Wahl, J. r., Wheelock, M . , and Johnson, K . (2006). Expression of inappropriate cadherins by epithelial tumor cells promotes endocytosis and degradation of E-cadherin via competition for pl20(ctn). Oncogene 25,4595-604. Magie, C , Pinto-Santini, D. , and Parkhurst, S. (2002). R h o l interacts with pl20ctn and alpha-catenin, and regulates cadherin-based adherens junction components in Drosophila. Development 129, 3771-82. Makihira, S., Yan, W. , Murakami, H . , Furukawa, M . , Kawai , T., Nikawa, H . , Yoshida, E . , Hamada, T., Okada, Y . , and Kato, Y . (2003). Thyroid hormone enhances aggrecanase-91 2 / A D A M - T S 5 expression and proteoglycan degradation in growth plate cartilage. Endocrinology 144, 2480-8. Marchenko, N . , Marchenko, G . , Weinreb, R., Lidsey, J., Kyshtoobayeva, A . , Crawford, H . , and Strongin, A . (2004). Beta-catenin regulates the gene of M M P - 2 6 , a novel metalloproteinase expressed both in carcinomas and normal epithelial cells. Int J Biochem Cell Biol 36, 942-56. Margulis, A . , Zhang, W. , Alt-Holland, A . , Crawford, H . , Fusenig, N . , and Garlick, J. (2005). E -cadherin suppression accelerates squamous cell carcinoma progression in three-dimensional, human tissue constructs. Cancer Res 65, 1783-91. Mariotti, A . , Kedeshian, P., Dans, M . , Curatola, A . , Gagnoux-Palacios, L . , and Giancotto, F. (2001). E G F - R signaling through Fyn kinase disrupts the function of integrin alpha6beta4 at hemidesmosomes: role in epithelial cell migration and carcinoma invasion. J Cell Biol 155, 447-58. Marshal, J., Ramdin, L . , Brooks, T., DPhi l , P., and Shute, J. (2003). Plasminogen activator inhibitor-1 supports IL-8-mediated neutrophil transendothelial migration by inhibition of the constitutive shedding of endothelial IL-8/heparan sulfate/syndecan-1 complexes. J Immunol 111, 2057-65. Marshall, J., Rutherford, D. , Happerfield, L . , Hanby, A . , McCartney, A . , Newton-Bishop, J., and Hart, I. (1998). Comparative analysis of integrins in vitro and in vivo in uveal and cutaneous melanomas. Br J Cancer 11, 522-9. Matthews, R., Gary," S., Zerillo, C , Pratta, M . , Solomon, K . , Arner, E . , and Hockfield, S. (2000). Brain-enriched hyaluronan binding (BEHAB)/brevican cleavage in a glioma cell line is mediated by a disintegrin and metalloproteinase with thrombospondin motifs ( A D A M T S ) family member. J Biol Chem 275, 22695-703. Mayer, J., Hamel, M . , and Gottschall, P. (2005). Evidence for proteolytic cleavage of brevican by the A D A M T S s in the dentate gyrus after excitotoxic lesion of the mouse entorhinal cortex. BMC Neurosci 6. McGuire, J., L i , Q., and Parks, W . (2003). Matrilysin (matrix metalloproteinase-7) mediates E -cadherin ectodomain shedding in injured lung epithelium. Am J Pathol 162,1831-43. McKeon , R., Jurynec, M . , and Buck, C. (1999). The chondroitin sulfate proteoglycans neurocan and phosphacan are expressed by reactive astrocytes in the chronic C N S glial scar. J Neurosci 19, 10778-88. Meissauer, A . , Kramer, M . , Hofmann, M . , Erkel l , L . , Jacob, E . , Schirrmacher, V . , and Brunner, G . (1991). Urokinase-type and tissue-type plasminogen activators are essential for in vitro invasion of human melanoma cells. Exp Cell Res 192, 453-9. 92 Metz, J., and Weihe, E . (1980). Intercellular junctions in the full term human placenta. II. Cytotrophoblast cells, intravillous stroma cells and blood vessels. Anat Embryol 158, 167-78. Metz, J., Weihe, E . , and Heinrich, D . (1979). Intercellular junctions in the full term human placenta. I. Syncytiotrophoblastic layer. Anat Embryol 158, 41-50. Miao, W. , Seng, W. , Duquette, M . , Lawler, P., Laus, C , and Lawler, J. (2001). Thrombospondin-1 type 1 repeat recombinant proteins inhibit tumor growth through transforming growth factor-beta-dependent and -independent mechanisms. Cancer Res 61, 7830-9. Miles , R., Sluka, J., Halladay, D . , Santerre, R., Hale, L . , Bloem, L . , Thirunavukkarasu, K . , Galvin, R., Hock, J., and JE, O. (2000). A D A M T S - 1 : A cellular disintegrin and metalloprotease with thrombospondin motifs is a target for parathyroid hormone in bone. Endocrinology 141, 4533-42. M i l l a , M . , Leesnitzer, M . , Moss, M . , Clay, W. , Carter, H . , Mil ler , A . , Su, J., Lambert, M . , Willard, D . , Sheeley, D . , Kost, T., Burkhart, W. , Moyer, M . , Blackburn, R., Pahel, G . , Mitchell , J., Hoffman, C , and Becherer, J. (1999). Specific sequence elements are required for the expression of functional tumor necrosis factor-alpha-converting enzyme ( T A C E ) . JBiol Chem 274, 30563-70. Milstone, D. , Redline, R., O'Donnel, P., Davis, V . , and Stavrakis, G . (2000). E-selectin expression and function in a unique placental trophoblast population at the fetal-maternal interface: regulation by a trophoblast-restricted transcriptional mechanism conserved between humans and mice. Dev Dyn 219, 63-76. Mittaz, L . , Russell, D . , Wilson, T., Brasted, M . , Tkalcevic, J., Salamonsen, L . , Hertzog, P., and Pritchard, M . (2004). Adamts-1 is essential for the development and function of the urogenital system. Biol Reprod 70, 1096-105. Miyake, A . , Sakumoto, T., Aono, T., Kawamura, Y . , Maeda, T., and Kurachi, K . (1982). Changes in luteinizing hormone-releasing hormone in human placenta throughout pregnancy. Am J Obstet Gynecol 60,444-9. Mohanam, S., Chintala, S., Go, Y . , Bhattacharya, A . , Venkaiah, B . , Boyd, D. , Gokaslan, Z . , Sawaya, R., and Rao, J. (1997). In vitro inhibition of human glioblastoma cell line invasiveness by antisense u P A receptor. Oncogene 14, 1351-9. M o l l , R., Mitze, M . , Frixen, U . , and Birchmeier, W . (1993). Differential loss of E-cadherin expression in infiltrating ductal and lobular breast carcinomas. Am J Pathol 143, 1731-42. M o l l , U . , and Lane, B . (1990). Proteolytic activity of first trimester human placenta: localization of interstitial collagenase in villous and extravillous trophoblast. Histochemistry 94, 555-60. 93 Moretti, S., Martini, L . , Berti, E . , Pinzi , C , and Giannotti, B . (1993). Adhesion molecule profile and malignancy of melanocyte lesions. Melanoma Res 3, 235-9. Moro, L . , Venturino, M . , Bozzo, C , Silengo, L . , Altruda, F., Beguinot, L . , Torone, G . , and Defilippi, P. (1998). Integrins induce activation of E G F receptor: role in M A P kinase induction and adhesion-dependent cell survival. EMBO J11, 6622-32. Morrish, D . , Dakour, J., L i , H . , X iao , J., Mi l le r , R., Sherburne, R., Berdan, R., and Guilbert, L . (1997). In vitro cultured human term cytotrophoblast: a model for normal primary epithelial cells demonstrating a spontaneous differentiation programme that requires E G F for extensive development of syncytium. Placenta 18, 577-85. Morrish, E . , Dakour, J., and L i , H . (1998). Functional regulation of human trophoblast differentiation. J Reprod Immunol 39, 179-95. Muhlhauser, J., Crescimanno, C , Kaufmann, P., Hofler, H . , Zacchea, D. , and Castellucci, M . (1993). Differentiation and proliferation patterns in human trophoblast revealed by c-erbB-2 oncogene product and E G F - R . J Histochem Cytochem 41, 165-73. Multhaupt, H . , Mazar, A . , Cines, D. , Warhol, M . , and McCrea, K . (1994). Expression of urokinase receptors by human trophoblast. A histochemical and ultrastructural analysis. Lab Invest 71, 392-400. Munshi, H . , and Stack, M . (2006). Reciprocal interactions between adhesion receptor signaling and M M P regulation. Cancer Metastasis Rev 25, 45-56. Murase, S., Hirano, S., Wang, X . , Kitagawa, M . , Natori, M . , Takentani, S., and Suzuki, S. (2000). Lateral clustering of cadherin-4 without homophilic interaction: possible involvement in the concentration process at cell-cell adhesion sites as well as in the cell adhesion activity. Biochem Biophys Res Commun 276, 1191-8. Nagafuchi, A . , Shirayoshi, Y . , Okazaki, K . , Yasuda, K . , and Takeichi, M . (1987). Transformation of cell adhesion properties by exogenously introduced E-cadherin c D N A . Nature 329, 341-3. Nakamura, I., Pilkington, M . , Lakkakorpi, P., Lipfert, L . , Sims, S., Dixon, S., Rodan, G . , and Duong, L . (1999). Role of alpha(v)beta(3) integrin in osteoclast migration and formation of the sealing zone. JCell Sci 112, 3985-93. Nardi, J., Martos, R., Walden, K . , Lampe, D . , and Robertson, H . (1999). Expression of lacunin, a large multidomain extracellular matrix protein, accompanies morphogenesis of epithelial monolayers in Manduca sexta. Insect Biochem Mol Biol 29, 883-97. Navarro, P., Ruco, L . , and Dejana, E . (1998). Differential localization of V E - and N-cadherins in human endothelial cells: VE-cadherin competes with N-cadherin for junctional localization. JCell Biol 140, 1475-84. 94 Nawrocki, B . , Polette, M . , Clavel, C , Morrone, A . , Eschard, A . , Etienne, J., and Birembaut, P. (1994). Expression of stromelysin 3 and tissue inhibitors of matrix metallo-proteinases, TIMP-1 and TIMP-2 , in rheumatoid arthritis. Pathol Res Pract 190, 690-6. Nawrocki-Raby, B . , Gilles, C , Polette, M . , Bruyneel, E . , Laronze, J., Bonnet, N . , Fiodart, J., Mareel, M . , and Birembaut, P. (2003). Upregulation of M M P s by soluble E-cadherin in human lung tumor cells. Int J Cancer 105, 790-5. N g , Y . , Zhu, H . , Pallen, C , Leung, P., and MacCalman, C. (2006). Differential effects of interleukin-lbeta and transforming growth factor-betal on the expression of the inflammation-associated protein, A D A M T S - 1 , in human decidual stromal cells in vitro. Hum Reprod 21, 1990-9. Nielsen, B . , Sehested, B . , Duun, S., Rank, F., Timshel, S., Rygaard, J., Johnsen, M . , and Dano, K . (2001). Urokinase plasminogen activator is localized in stromal cells in ductal breast cancer. Lab Invest 81, 1485-501. Nielsen, B . , Sehested, B . , Timshel, S., Pyke, C , and Dano, K . (1996). Messenger R N A for urokinase plasminogen activator is expressed in myofibroblasts adjacent to cancer cells in human breast cancer. Lab Invest 74, 168-77. Nieman, M . , Prudoff, R., Johnson, K . , and Wheelock, M . (1999). N-cadherin promotes motility in human breast cancer cells regardless of their E-cadherin expression. JCell Biol 147, 631-44. Nieset, J., Redfield, A . , Jin, F., Knudsen, K . , Johnson, K . , and Wheelock, M . (1997). Characterization of the interactions of alpha-catenin with alpha-actinin and beta-catenin/plakoglobin. JCell Sci 110, 1013-22. Nikkola , J., Vihinen, P., Vlaykova, T., Hahka-kemppinen, M . , Heino, J., and Pyrhonen, S. (2004). Integrin chains betal and alphav as prognostic factors in human metastatic melanoma. Melanoma Res 14, 29-37. Noe, V . , Fingleton, B . , Jacobs, K . , Crawford, H . , Vermeulen, S., Steelant, W. , Bruyneel, E . , Matrisian, L . , and Mareel, M . (2001). Release of an invasion promoter E-cadherin fragment by matrilysin and stromelysin-1. JCell Sci 114, 111-118. Nollet, F., Kools , P., and van Roy, F. (2000). Phylogenetic analysis of the cadherin superfamily allows identification of six major subfamilies besides several solitary members. J Mol Biol 299, 551-72. Nose, A . , Nagafuchi, A . , and Takeichi, M . (1987). Isolation of placental cadherin c D N A : identification of a novel gene family of cell-cell adhesion molecules. EMBOJ6, 3655-61. 95 Nose, A . , and Takeichi, M . (1986). A novel cadherin cell adhesion molecule:its expression patterns associated with implantation and organogenesis of mouse embryos. J Cell Biol 103, 2549-2658. Nose, A . , Tsuji, K . , and Takeichi, M . (1990). Localization of specificity determining sites in cadherin cell adhesion molecules. Cell 61, 147-155. Ntayi, C , Lorimier, S., Berthier-Vergnes, O., Hornebeck, W. , and Bernard, P. (2001). Cumulative influence of matrix metalloproteinase-1 and -2 in the migration of melanoma cells within three-dimensional type I collagen lattices. Exp Cell Res 270, 110-8. Obama, FL, and Ozawa, M . (1997). Identification of the domain of alpha-catenin involved in its association with beta-catenin and plakoglobin (gamma-catenin). J Biol Chem 272, 11017-20. Ohkubo, T., and Ozawa, M . (1999). pl20(ctn) binds to the membrane-proximal region of the E -cadherin cytoplasmic domain and is involved in modulation of adhesion activity. J Biol Chem 274,21409-15. Ohlsson, R., Larsson, E . , Nilsson, O., Wahlstrom, T., and Sundstrom, P. (1989). Blastocyst implantation precedes induction of insulin-like growth factor II gene expression in human trophoblasts. Development 106, 555-9. Oyama, T., Kanai, Y . , Ochiai, A . , Akimoto, S., Oda, T., Yanagihara, K . , Nagafuchi, A . , Tsukita, S., Shibamoto, S., and Ito, F. (1994). A truncated beta-catenin disrupts the interaction between E-cadherin and alpha-catenin: a cause of loss of intercellular adhesiveness in human cancer cell lines. Cancer Res 54, 6282-7. Ozawa, M . , Baribault, H . , and Kemler, R. (1989). The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J 8, 1711-7. Ozawa, M . , and Kemler, R. (1990). Correct proteolytic cleavage is required for the cell adhesive function of uvomorulin. J Cell Biol 111, 1645-50. Ozawa, M . , and Kemler, R. (1992). Molecular organization of the uvomorulin-catenin complex. J Cell Biol 116, 989-96. Ozawa, M . , and Kemler, R. (1998). Altered cell adhesion activity by pervanadate due to the dissociation of alpha-catenin from the E-cadherin.catenin complex. J Biol Chem 273, 6166-70. Papkoff, J., Rubinfeld, B . , Schryver, B . , and Polakis, P. (1996). Wnt-1 regulates free pools of catenins and stabilizes APC-catenin complexes. Mol Cell Biol 16, 2128-34. 96 Pattillo, R., and Gey, G. (1968). The establishment of a cell line of human hormone-synthesizing trophoblastic cells in vitro. Cancer Res 28, 1231-6. Pattillo, R., Gey, G., Delfs, E., and Mattingly, R. (1968). In vitro identification of the trophoblastic stem cell of the human villous placenta. Am J Obstet Gynecol 100, 582-8. Pece, S., and Gutkind, J. (2000). Signaling from E-cadherins to the MAPK pathway by the recruitment and activation of epidermal growth factor receptors upon cell-cell contact formation. J Biol Chem 275, 41227-33. Peifer, M., and Polakis, P. (2000). Wnt signaling in oncogenesis and embryogenesis—a look outside the nucleus. Science 287, 1606-9. Perutelli, P. (1995). Disintegrins: potent inhibitors of platelet aggregation. Recenti Prog Med 86, 168-74. Petraglia, F., Florio, P., Nappi, C., and Genazzani, A. (1996). Peptide signaling in human placenta and membranes: autocrine, paracrine, and endocrine mechanisms. Endocr Rev 17,156-86. Petraglia, F., Garuti, G., Calza, L., Roberts, V., Giadino, L., Genazzani, A., Vale, W., and Meunier, H. (1991). Inhibin subunits in human placenta: localization and messenger ribonucleic acid levels during pregnancy. Am J Obstet Gynecol 165, 750-8. Peyrieras, N., Hyafil, F., Louvard, D., Ploegh, H., and Jacob, F. (1983). Uvomorulin: a nonintegral membrane protein of early mouse embryo. Proc Natl Acad Sci USA 80, 6274-7. Pierleoni, C , Samuelsen, G., Graem, N., Ronne, E., Nielsen, B., Kaufmann, P., and Castellucci, M. (1998). Immunohistochemical identification of the receptor for urokinase plasminogen activator associated with fibrin deposition in normal and ectopic human placenta. Placenta 19, 501-8. Pijnenborg, R. (1990). Trophoblast invasion and placentation in the human: morphological aspects. In "Trophoblast invasion and endometrial receptivity" (H.-W. Denker and J. Aplin, Eds.). Plenum, New York. Pijnenborg, R., Bland, J., Robertson, W., and Brosens, I. (1983). Uteroplacental arterial changes related to interstitial trophoblast migration in early human pregnancy. Placenta 4, 397-413. Pijnenborg, R., Bland, J., Robertson, W., Dixon, G., and Brosens, I. (1981). The pattern of interstitial trophoblastic invasion of the myometrium in early human pregnancy. Placenta 2,303-16. 97 Pijnenborg, R., Dixon, G . , Robertson, W. , and Brosens, I. (1980). Trophoblastic invasion of human decidua from 8 to 18 weeks of pregnancy. Placenta 1, 3-19. Pishvaian, M . , Feltes, C. , Thompson, P., Bussemakers, M . , Schalken, J., and Byers, S. (1999). Cadherin-11 is expressed in invasive breast cancer cell lines. Cancer Res 59, 947-52. Playford, M . , Bicknel l , D. , Bodmer, W. , and Macaulay, V . (2000). Insulin-like growth factor 1 regulates the location, stability, and transcriptional activity of beta-catenin. Proc Natl Acad Sci USA 97, 12103-8. Polette, M . , Nawrocki, B . , Pintiaux, A . , Massenat, C , Maquoi, E . , Volders, L . , Schaaps, J., Birembaut, P., and Foidart, J. (1994). Expression of gelatinases A and B and their tissue inhibitors by cells of early and term human placenta and gestational endometrium. Lab Invest 71, 838-46. Porter, S., Clark, I., Kevorkian, L . , and Edwards, D . (2005). The A D A M T S metalloproteinases. Biochem J386, 15-27. Posthaus, H . , Dubois, C , Laprise, M . , Grondin, F. , Suter, M . , and Muller , E . (1998). Proprotein cleavage of E-cadherin by furin in baculovirus over-expression system: potential role of other convertases in mammalian cells. FEBS Lett 438, 306-10. Pratta, M . , Yao, W. , Decicco, C. P., Tortorella, M . D . , L i u , R., Copeland, R. A . , Magolda, R. L . , Newton, R. C , Trzaskos, J. M . , and Arner, E . C. (2003). Aggrecan protects cartilage collagen from proteolytic cleavage. J Biol Chem 278, 45539-45. Prieve, M . , and Waterman, M . (1999). Nuclear localization and formation of beta-catenin-lymphoid enhancer factor 1 complexes are not sufficient for activation of gene expression. Mol Cell Biol 19, 4503-15. Proll , J., Blaschitz, A . , Hartmann, M . , Thalhamer, J., and Dogr, G . (1996). Human first-trimester placenta intra-arterial trophoblast cells express the neural cell adhesion molecule. Early Pregnancy 2, 271-5. Provost, E . , and Rimm, D . (1999). Controversies at the cytoplasmic face of the cadherin-based adhesion complex. Curr Opin Cell Biol 11, 567-72. Qian, X . , Karpova, T., Sheppard, A . , McNal ly , J., and Lowry, D . (2004). E-cadherin-mediated adhesion inhibits ligand-dependent activation of diverse receptor tyrosine kinases. EMBO J23,1739-48. Qiu, Q., Yang, M . , Tsang, B . , and Gruslin, A . (2004). EGF-induced trophoblast secretion of M M P - 9 and TIMP-1 involves activation of both PI3K and M A P K signalling pathways. Reproduction 128, 355-63. 98 Queenan, J. J., Kao, L . , Arboleda, C , Ulloa-Aguirre, A . , Golos, T., Cines, D . , and Strauss, J. r. (1987). Regulation of urokinase-type plasminogen activator production by cultured human cytotrophoblasts. J Biol Chem 262, 10903-6. Radice, G . , Ferreira-Cornwell, M . , Robinson, S., Rayburn, H . , Chodosh, L . , Takeichi, M . , and Hynes, R. (1997b). Precocious mammary gland development in P-cadherin-deficient mice. J Cell Biol 139, 1025-32. Radice, G . , Rayburn, H . , Matsunami, H . , Knudsen, K . , Takeichi, M . , and Hynes, R. (1997a). Developmental defects in mouse embryos lacking N-cadherin. Dev Biol 181, 64-78. Raftopoulou, M . , and Hal l , A . (2004). Cel l migration: Rho GTPases lead the way. Dev Biol 265, 23-32. Ratnikov, B . , Rozanoz, D . , Postnova, T., Baciu, P., Zhang, H . , DiScipio, R., Chestukhina, G . , Smith, J., Deryugina, E . , and Strongin, A . (2002). A n alternative processing of integrin alpha(v) subunit in tumor cells by membrane type-1 matrix metalloproteinase. J Biol Chem 277, 7377-85. Ratzinger, G. , Stoitzner, P., Ebner, S., Lutz, M . , Lavton, G. , Rainer, C , Senior, R., Shipley, J., Fritsch, P., Schiuler, G. , and Romani, N . (2002). Matrix metalloproteinases 9 and 2 are necessary for the migration of Langerhans cells and dermal dendritic cells from human and murine skin. J Immunol 168, 4361-71. Reynolds, A . , Herbert, L . , Cleveland, J., Berg, S., and Gaut, J. (1992). p l20 , a novel substrate of protein tyrosine kinase receptors and of p60v-src, is related to cadherin-binding factors beta-catenin, plakoglobin and armadillo. Oncogene 1, 2439-45. Ricciardelli, C , Quinn, D . , Raymond, W. , M c C a u l , K . , Sutherland, P., Strieker, P., Grygiel, J., Sutherland, R., Marshall, V . , Tilley, W. , and Horsfall, D . (1999). Elevated levels of peritumoral chondroitin sulfate are predictive of poor prognosis in patients treated by radical prostatectomy for early-stage prostate cancer. Cancer Res 59, 2324-8. Richards, J., Hernandez-Gonzalez, I., Gonzalez-Robavna, I., Teuling, E . , L o , Y . , Boerboom, D. , Falender, A . , Doyle, K . , LeBaron, R., Thompson, V . , and Sandy, J. (2005). Regulated expression of A D A M T S family members in follicles and cumulus oocyte complexes: evidence for specific and redundant patterns during ovulation. Biol Reprod 12, 1241-55. Richart, R. (1961). Studies of placental morphogenesis. I. Radioautographic studies of human placenta utilizing tritiated thymidine. Proc Natl Acad Sci USA 106, 829-31. Riggleman, B . , Wieschaus, E . , and Schedl, P. (1989). Molecular analysis of the armadillo locus: uniformly distributed transcripts and a protein with novel internal repeats are associated with a Drosophila segment polarity gene. Genes Dev 3, 96-113. 99 Rimm, D. , Koslov, E. , Kebriaei, P., Cianci, C , and Morrow, J. (1995). Alpha l(E)-catenin is an actin-binding and -bundling protein mediating the attachment of F-actin to the membrane adhesion complex. Proc Natl Acad Sci US A 92, 8813-7. Ringler, G . , and Strauss, J. r. (1990). In vitro systems for the study of human placental endocrine function. Endocr Rev 11, 105-23. Robertson, W. , and Warner, B . (1974). The ultrastructure of the human placental bed. J Pathol 112, 203-11. Robker, R., Russell, D. , Espey, L . , Lydon, J., O'Malley, B . , and Richards, J. (2000a). Progesterone-regulated genes in the ovulation process: A D A M T S - 1 and cathepsin L proteases. Proc Natl Acad Sci USA 97, 4689-94. Robker, R., Russell, D . , Yoshioka, S., Sharma, S., Lydon, J., O'Malley, B . , Espey, L . , and Richards, J. (2000b). Ovulation: a multi-gene, multi-step process. Steroids 65, 559-70. Rodriguez-Manzaneque , J., Milchanowski, A . , Dufour, E . , Leduc, R., and Iruela-Arispe, M . (2000). Characterization of M E T H - 1 / A D A M T S 1 processing reveals two distinct active forms. JBiol Chem 275, 33471-9. Rodriguez-Manzaneque , J., Westling, J., Thai, S., Luque, A . , Knauper, V . , Murphy, G . , Sandy, J., and Iruela-Arispe, M . (2002). A D A M T S 1 cleaves aggrecan at multiple sites and is differentially inhibited by metalloproteinase inhibitors. Biochem Biophys Res Commun 293,501-8. Romer, J., Lund, L . , Eriksen, J., Ralfkiaer, E . , Zeheb, R., Gelehrter, T., Dano, K . , and Kristensen, P. (1991). Differential expression of urokinase-type plasminogen activator and its type-1 inhibitor during healing of mouse skin wounds. J Invest Dermatol 97, 803-11. Ruck, P., Marzusch, K . , Horny, H . , Dietl , J., and Kaiserling, E . (1996). The distribution of tissue inhibitor of metalloproteinases-2 (TIMP-2) in the human placenta. Placenta 17, 263-6. Russell, D . , Doyle, K . , Oshsner, S., Sandy, J., and Richards, J. (2003). Processing and localization of A D A M T S - 1 and proteolytic cleavage of versican during cumulus matrix expansion and ovulation. J Biol Chem 278, 42330-9. Rutishauser, U . (1989). N-cadherin: a cell adhesion molecule in neural development. Trends Neurosci 12, 275-6. Sadler, J. (1998). Biochemistry and genetics of von Willebrand factor. Annu Rev Biochem 67, 395-424. Sadler, T. (2005). Embryology of neural tube development. Am J Med Genet C Semin Med Genet 135, 2-8. 100 Saffell, J., Will iams, E . , Mason, I., Walsh, F., and Doherty, P. (1997). Expression of a dominant negative F G F receptor inhibits axonal growth and F G F receptor phosphorylation stimulated by C A M s . Neuron 18, 231-42. Sakko, A . , Ricciadelli , C , Mayne, K . , Til ley, W. , Lebaron, R., and Horsfall, D . (2001). Versican accumulation in human prostatic fibroblast cultures is enhanced by prostate cancer cell-derived transforming growth factor betal. Cancer Res 61, 926-30. Salafia, C , Maier, D. , Vogel , C , Pezzullo, J., Burns, J., and Silberman, L . (1993). Placental and decidual histology in spontaneous abortion: detailed description and correlations with chromosome number. Am J Obstet Gynecol 82, 295-303. Salamonsen, L . , and Nie , G . (2002). Proteases at the endometrial-trophoblast interface: their role in implantation. Rev Endocr Metab Disord 3, 133-43. Samanna, V . , Wei , H . , Ego-Osuala, D . , and Chellaiah, M , (2006). Alpha-V-dependent outside-in signaling is required for the regulation of CD44 surface expression, M M P - 2 secretion, and cell migration by osteopontin in human melanoma cells. Exp Cell Res 312, 2214-30. Sanders, D . , Blessing, K . , Hassan, G . , Brunton, R., Marsden, J., and Jankowski, J. (1999). Alterations in cadherin and catenin expression during the biological progression of melanocytic tumours. Mol Pathol 52, 151-7. Sandig, M . , Voura, E . , Kalnins, V . , and Siu, C. (1997). Role of cadherins in the transendothelial migration of melanoma cells in culture. Cell Motil Cytoskeleton 38, 351-64. Sandy, J., Westling, J., Kenagy, R., Iruela-Arispe, M . , Verscharen, C , Rodriguez-Manzaneque , J., Zimmermann, D . , Lemire, J., Fischer, J., T N , W. , and Clowes, A . (2001). Versican V I proteolysis in human aorta in vivo occurs at the Glu441-Ala442 bond, a site that is cleaved by recombinant A D A M T S - 1 and A D A M T S - 4 . J Biol Chem 276, 13372-8. Sarto, G . , Stubblfield, P., and Therman, E . (1982). Endomitosis in human trophoblast. Hum Genet 62,228-32. Sawicki, G. , Radomski, M . , Winkler-Lowen, B . , Krzymien, A . , and Guilbert, L . (2000). Polarized release of matrix metalloproteinase-2 and -9 from cultured human placental syncytiotrophoblasts. Biol Reprod 63, 1390-5. Schlaepfer, D . , Hauck, C , and Sieg, D . (1999). Signaling through focal adhesion kinase. Prog Biophys Mol Biol 71, 435-78. Schlafke, S., and Enders, A . (1975). Cellular basis of interaction between trophoblast and uterus at implantation. Biol Reprod 12, 41-65. 101 Seals, D. , and Courtneidge, S. (2003). The A D A M s family of metalloproteases: multidomain proteins with multiple functions. Genes Dev 17, 7-30. Seamon, K . , Padgett, W. , and Daly, J. (1981). Forskolin: unique diterpene activator of adenylate cyclase in membranes and in intact cells. Proc Natl Acad Sci U SA 78, 3363. Seftor, R., Seftor, E . , Gehlsen, K . , Stetler-Stevenson, W. , Brown, P., Ruoslahti, E . , and Hendrix, M . (1992). Role of the alpha v beta 3 integrin in human melanoma cell invasion. Proc Natl Acad Sci USA 89, 1557-61. Severs, N . (1990). The cardiac gap junction and intercalated disc. Int J Cardiol 26, 137-73. Shapiro, L . , Fannon, A . , Kwong, P., Thompson, A . , Lehmann, M . , Grubel, G . , Legrand, J., A l s -Nielson, J., Colman, D . , and Hendrickson, W . (1995). Structural basis of cell-cell adhesion by cadherins. Nature 374, 327-37. Shih, I., Hsu, M . , Oldt, R., Herlyn, M . , Gearhart, J., and Kurman, R. (2002). The Role of E -cadherin in the Motil i ty and Invasion of Implantation Site Intermediate Trophoblast. Placenta 23, 706-15. Shih, I., and Kurman, R. (1996). Expression of melanoma cell adhesion molecule in intermediate trophoblast. Lab Invest 75, 377-88. Shih, I., Seidman, J., and Kurman, R. (1999). Placental site nodule and characterization of distinctive types of intermediate trophoblast. Hum Pathol 30, 687-94. Shih, I., Wang, T., Wu , T., Kurman, R., and Gearhart, J. (1998). Expression of M e l - C A M in implantation site intermediate trophoblastic cell line, IST-1, limits its migration on uterine smooth muscle cells. J Cell Sci 111, 2655-64. Shimonovitz, S., Hurwitz, A . , Dushnik, M . , Anteby, E . , Geva-Eldar, T., and Yagel, S. (1994). Developmental regulation of the expression of 72 and 92 kd type IV collagenases in human trophoblasts: a possible mechanism for control of trophoblast invasion. Am J Obstet Gynecol 111, 832-8. Shindo, T., Kurihara, H . , Kuno, K . , Yokoyama, H . , Wada, T., Kuihara, Y . , Imai, T., Wang, Y . , Ogata, M . , Nishinatsu, H . , Moriyama, N . , Oh-hashi, Y . , H , M . , Ishikawa, T., Nagai, R., Yazaki , Y . , and Matsushima, K . (2000). A D A M T S - 1 : a metalloproteinase-disintegrin essential for normal growth, fertility, and organ morphology and function. J Clin Invest 105, 1334-52. Shinoura, N . , Paradies, N . , Warnick, R., Chen, H . , Larson, J., Tew, J., Simon, M . , Lynch, R., Kanai, Y . , and Hirohashi, S. (1995). Expression of N-cadherin and alpha-catenin in astrocytomas and glioblastomas. Br J Cancer 12, 627-33. 102 Simcha, I., Shtutman, M . , Salomon, D . , Zhurinsky, J., Sadot, E . , Geiger, B . , and Ben-Ze'ev, A . (1998). Differential nuclear translocation and transactivation potential of beta-catenin and plakoglobin. J Cell Biol 141, 1433-48. Simpson, R., Mayhew, T., and Barnes, P. (1992). From 13 weeks to term, the trophoblast of human placenta grows by the continuous recruitment of new proliferative units: a study of nuclear number using the disector. Placenta 13, 501-12. Skaper, S. (2005). Neuronal growth-promoting and inhibitory cues in neuroprotection and neuroregeneration. Ann N YAcad Sci 1053, 376-85. Soejima, K . , Mimura, N . , Hirashima, M . , Maeda, FL, Hamamoto, T., Nakagati, T., and Nozaki , C. (2001). A novel human metalloprotease synthesized in the liver and secreted into the blood: possibly, the von Willebrand factor-cleaving protease? Biochem J130, 475-719. Somerville, R., Jungers, K . , and Apte, S. (2004b). Discovery and characterization of a novel, widely expressed metalloprotease, A D A M T S 10, and its proteolytic activation. J Biol Chem 279,51208-17. Somerville, R., Longpre, J., Apel , E . , Lewis, R., Wang, L . , Sanes, J., Leduc, J., and Apte, S. (2004a). A D A M T S 7 B , the full-length product of the A D A M T S 7 gene, is a chondroitin sulfate proteoglycan containing a mucin domain. J Biol Chem 279, 35159-75. Somerville, R., Longpre, J., Jungers, K . , Engle, J., Ross, M . , Evanko, S., Wight, T., Leduc, R., and Apte, S. (2003). Characterization of A D A M T S - 9 and A D A M T S - 2 0 as a distinct A D A M T S subfamily related to Caenorhabditis elegans G O N - 1 . J Biol Chem 278, 9503-13. Stappert, J., and Kemler, R. (1994). A short core region of E-cadherin is essential for catenin binding and is highly phosphorylated. Cell Adhes Commun 2, 319-37. Staun-Ram, E . , Goldman, S., Gabarin, D. , and Shalev, E . (2004). Expression and importance of matrix metalloproteinase 2 and 9 ( M M P - 2 and -9) in human trophoblast invasion. Reprod Biol Endocrinol 2, 59. Steinberg, M . , and Takeichi, M . (1994). Experimental specification of cell sorting, tissue spreading, and specific spatial patterning by quantitative differences in cadherin expression. Proc Natl Acad Sci USA 91, 206-9. Sternlicht, M . , and Werb, Z . (2001). How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol 17, 463-516. Streit, M . , Velasco, P., Brown, L . , Skobe, M . , Richard, L . , Riccardi, L . , Lawler, J., and Detmar, M . (1999). Overexpression of thrombospondin-1 decreases angiogenesis and inhibits the growth of human cutaneous squamous cell carcinomas. Am J Pathol 155, 441-52. 103 Strongin, A., Collier, I., Bannikiov, G., Manner, B., Grant, G., and Goldberg, G. (1995). Mechanism of cell surface activation of 72-kDa type IV collagenase. Isolation of the activated form of the membrane metalloprotease. J Biol Chem 270, 5331-8. Strongin, A., Marmer, B., Grant, G., and Goldberg, G. (1993). Plasma membrane-dependent activation of the 72-kDa type IV collagenase is prevented by complex formation with TIMP-2. JBiol Chem 268, 14033-9. Suyama, K., Shapiro, I., Guttman, M . , and Hazan, R. (2002). A signaling pathway leading to metastasis is controlled by N-cadherin and the FGF receptor. Cancer Cell 2, 301-14. Suzuki, S., Sano, K., and Tanihara, H. (1991). Diversity of the cadherin family: evidence for eight new cadherins in nervous tissue. Cell Reg 2, 261-70. Sylvester, J., Liacini, A., Li , W., and Zafarullah, M . (2004). Interleukin-17 signal transduction pathways implicated in inducing matrix metalloproteinase-3, -13 and aggrecanase-1 genes in articular chondrocytes. Cell Signal 16, 469-76. Takagi, J., and Springer, T. (2002). Integrin activation and structural rearrangement. Immunol Rev 186, 141-63. Takahashi, M . , Tsunoda, T., Seiki, M . , Nakamura, Y., and Furukawa, M . (2002). Identification of membrane-type matrix metalloproteinase-1 as a target of the beta-catenin/Tcf4 complex in human colorectal cancers. Oncogene 21, 5861-7. Takeichi, M . (1988). The cadherins: cell-cell adhesion molecules controlling animal morphogenesis. Development 102, 639-55. Takeichi, M . (1990). Cadherins: a molecular family important in selective cell-cell adhesion. Annu Rev Biochem 59, 237-52. Takeichi, M . (1993). Cadherins in cancer: implications for invasion and metastasis. Curr Opin Cell Biol 5, 806-11. Takeichi, M . (1995). Morphogenetic roles of classic cadherins. Curr Opin Cell Biol 7, 619-27. Thiery, J. (2002). Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer 2, 442-54. Thiery, J., Boyer, B., Tucker, G., Garrilovic, J., and Valles, A. (1988). Adhesion mechanisms in embryogenesis and in cancer invasion and metastasis. Ciba Found Symp 141, 48-74. Thirkill, T., and Douglas, G. (1999). The vitronectin receptor plays a role in the adhesion of human cytotrophoblast cells to endothelial cells. Endothelium 6, 277-90. 104 Tomita, K . , van Bokhoven, A . , van Leenders, G . , Ruijter, E . , Jansen, C , Bussemakers, M . , and Schalken, J. (2000). Cadherin switching in human prostate cancer progression. Cancer Res 60, 3650-4. Tomschy, A . , Fauser, C , Landwehr, R., and Engel, J. (1996). Homophilic adhesion of E -cadherin occurs by a co-operative two-step interaction of N-terminal domains. EMBO J 15,3507-14. Torres, M . , Stoykova, A . , Huber, O., Chowdhurry, K . , Bonaldo, P., Mansouri, A . , Butz, S., Kemler, R., and Gruss, P. (1997). A n alpha-E-catenin gene trap mutation defines its function in preimplantation development. Proc Natl Acad Sci USA 94, 901-6. Tortorella, M . D. , Burn, T. C , Pratta, M . A . , Abbaszade, I., Holl is , J. M . , L i u , R., Rosenfeld, S. A . , Copeland, R. A . , Decicco, C. P., Wynn, R., Rockwell , A . , Yang, F., Duke, J. L . , Solomon, K . , George, H . , Bruckner, R., Nagase, H . , Itoh, Y . , El l i s , D . M . , Ross, H . , Wiswall , B . H . , Murphy, K . , Hil lman, M . C , Jr., Holl is , G . F., Newton, R. C , Magolda, R. L . , Trzaskos, J. M . , and Arner, E . C. (1999). Purification and cloning of aggrecanase-1: a member of the A D A M T S family of proteins. Science 284, 1664-6. Trikha, M . , Timar, J., Lundy, S., Szekeres, K , Cai , Y . , A T , P., and Honn, K . (1997). The high affinity alphallb beta3 integrin is involved in invasion of human melanoma cells. Cancer Res 57, 2522-8. Tucker, R. P. (2004). The thrombospondin type 1 repeat superfamily. Int J Biochem Cell Biol 36, 969-74. Uchida, N . , Honjo, Y . , Johnson, K . , Wheelock, M . , and Takeichi, M . (1996). The catenin/cadherin adhesion system is localized in synaptic junctions bordering transmitter release zones. J Cell Biol 135, 767-79. Usher, P., Thomsen, O., Iversen, P., Johnsen, M . , Brunner, N . , Hoyer-Hansen, G . , Andreasen, P., Dano, K . , and Nielsen, B . (2005). Expression of urokinase plasminogen activator, its receptor and type-1 inhibitor in malignant and benign prostate tissue. Int J Cancer 113, 870-80. van der Flier, A . , and Sonnenberg, A . (2001). Function and interactions of integrins. Cell Tissue Res 305, 285-98. Van Lijnschoten, G . , Evers, J., Menheere, P., and Geraedts, J. (1994). Occult abortion: not a major cause of infertility. Fertil Steril 62, 1271-3. Vankemmelbeke, M . , Jones, G. , Fowles, C , Ilic, M . , Handley, C , Day, A . , Knight, C , Mort, J., and Buttle, D . (2003). Selective inhibition of A D A M T S - 1 , -4 and -5 by catechin gallate esters. Eur J Biochem 270, 2394-403. Varki , A . (1994). Selectin ligands. Proc Natl Acad Sci USA91, 7390-7. 105 Vasioukhin, V . , Bauer, A . , Degenstein, L . , Wise, B . , and Fuchs, E . (2001). Hyperproliferation and defects in epithelial polarity upon conditional ablation of alpha-catenin in skin. Cell 104,605-17. Vasioukhin, V . , Bauer, C , Y i n , M . , and Fuchs, E . (2000). Directed actin polymerization is the driving force for epithelial cell-cell adhesion. Cell 100, 209-19. Vasselli, J., Sappino, A . , and Belin, D . (1991). The plasminogen activator/plasmin system. J Clin Invest 88, 1067-1072. Vazquez, F., Hastings, G . , Ortega, M . , Lane, T., Oikemus, S., Lombardo, M . , and Iruela-Arispe, M . (1999). M E T H - 1 , a human ortholog of A D A M T S - 1 , and M E T H - 2 are members of a new family of proteins with angio-inhibitory activity. J Biol Chem 274, 23349-57. Vegh, G . , Selcuk Tuncer, Z . , Fulop, V . , Genest, D . , Mok , S., and Berkowitz, R. (1999). Matrix metalloproteinases and their inhibitors in gestational trophoblastic diseases and normal placenta. Gynecol Oncol 75, 248-53. Verkeste, C. , Slangen, B . , Daemen, M . , van Straaten, H . , Kohnen, G. , Kaufmann, P., and Peeters, L . (1998). The extent of trophoblast invasion in the preplacental vasculature of the guinea-pig. Placenta 19, 49-54. Vestweber, D . (1992). Selectins: cell surface lectins which mediate the binding of leukocytes to endothelial cells. Semin Cell Biol 3, 211-20. Vestweber, D . , Kemler, R., and Ekblom, P. (1985). Cell-adhesion molecule uvomorulin during kidney development. Dev Biol 112, 213-21. Vettraino, I., Roby, J., Tolley, T., and Parks, W . (1996). Collagenase-I, stromelysin-I, and matrilysin are expressed within the placenta during multiple stages of human pregnancy. Placenta 17, 557-63. Vleminckx, K . , and Kemler, R. (1999). Cadherins and tissue formation: integrating adhesion and signaling. Bioessays 21, 211-20. Wada, J., Kumar, A . , L i u , Z . , Ruoslahti, E . , Reichardt, L . , Marvaldi, J., and Kanwar, Y . (1996). Cloning of mouse integrin alphaV c D N A and role of the alphaV-related matrix receptors in metanephric development. J Cell Biol 132, 1161-76. Walsh, F., and Doherty, P. (1997). Neural cell adhesion molecules of the immunoglobulin superfamily: role in axon growth and guidance. Annu Rev Cell Dev Biol 13, 424-56. Wang, P., Tortorella, M . D. , England, K . , Malfait, A . , Thomas, G. , Arner, E . C , and Pei, D . (2004). Proprotein convertase furin interacts with and cleaves p r o - A D A M T S 4 (Aggrecanase-1) in the trans-Golgi network. J Biol Chem 279, 15434-40. 106 Wang, W. , Lee, S., Steiglitz, B . , Scott, I., Lebares, C , Al len , M . , Brenner, M . , Takahara, K . , and Greenspan, D . (2003). Transforming growth factor-beta induces secretion of activated A D A M T S - 2 . A procollagen III N-proteinase. J Biol Chem 278, 19549-57. Weinstat-Saslow, D. , Zabrenetzky, V . , VanHoutte, K . , Frazier, W. , Roberts, D . , and Steeg, P. (1994). Transfection of thrombospondin 1 complementary D N A into a human breast carcinoma cell line reduces primary tumor growth, metastatic potential, and angiogenesis. Cancer Res 54, 6504-11. Weiss, E . , Kroemker, M . , Rudiger, A . , Jockusch, B . , and Rudiger, M . (1998). Vincul in is part of the cadherin-catenin junctional complex: complex formation between alpha-catenin and vinculin. JCell Biol 141, 755-64. Wen, J., Zhu, H . , Murakami, S., Leung, P., and MacCalman, C. (2006). R E G U L A T I O N OF A D A M T S - 1 E X P R E S S I O N I N H U M A N E N D O M E T R I A L S T R O M A L C E L L S B Y G O N A D A L S T E R O I D S I N V O L V E S P R O G E S T I N S , A N D R O G E N S A N D E S T R O G E N S . J Clin Endocrinol Metab Epud ahead of print. Werb, Z . , V u , T., Rinkenberger, J., and Cousens, L . (1999). Matrix-degrading proteases and angiogenesis during development and tumor formation. APMIS 22, 69-73. Westermarck, J., and Kahari, V . (1999). Regulation of matrix metalloproteinase expression in tumor invasion. FASEB J13, 781-92. Westling, J., Gottschall, P., Thompson, V . , Cockburn, A . , Perides, G . , Zimmermann, D . , and Sandy, J. (2004). A D A M T S 4 (aggrecanase-1) cleaves human brain versican V 2 at Glu405-Gln406 to generate glial hyaluronate binding protein. Biochem J 377, 787-95. Wheelock, M . , and Johnson, K . (2003). Cadherins as modulators of cellular phenotype. Annu Rev Cell Dev Biol 19, 207-35. White, J. (2003). ADAMs:modulators of cell-cell and cell-matrix intreactions. Curr Opin Cell Biol 15, 598-606. Wice, B . , Menton, D . , , and Geuze, H . , Schwartz, A L . (1990). Modulators of cyclic A M P metabolism induce syncytiotrophoblast formation in vitro. Exp Cell ReslSb, 306-16. Wilcox, A . , Weinberg, C , O'Connor, J., Baird, D . , Schlatterer, J., Canfield, R., Armstrong, E . , and Nisula, B . (1988). Incidence of early loss of pregnancy. N Engl J Med 319,189-94. Williams, E . , Furness, J., Walsh, F., and Doherty, P. (1994). Activation of the F G F receptor underlies neurite outgrowth stimulated by L l , N - C A M , and N-cadherin. Neuron 13, 583-94. 107 Williams, E . , Walsh, F., and Doherty, P. (2003). The F G F receptor uses the endocannabinoid signaling system to couple to an axonal growth response. J Cell Biol 160, 481-6. Will iams, E . , Will iams, G . , Gour, B . , Blaschuk, O., and Doherty, P. (2000). A novel family of cyclic peptide antagonists suggests that N-cadherin specificity is determined by amino acids that flank the H A V motif. J Biol Chem 275, 4007-12. Will iams, E . , Will iams, G . , Howell , F., Skaper, S., Walsh, F., and Doherty, P. (2001). Identification of an N-cadherin motif that can interact with the fibroblast growth factor receptor and is required for axonal growth. J Biol Chem 276, 43879-86. Woesnner, J. J. (1991). Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEBJ5, 2145-54. Wolfsberg, T., Bazan, J., Blobel , C , Myles, D . , Primakoff, P., and White, J. (1993). The precursor region of a protein active in sperm-egg fusion contains a metalloprotease and a disintegrin domain: structural, functional, and evolutionary implications. Proc Natl Acad Sci USA 90, 10783-7. Wong, A . , and Gumbiner, B . (2003). Adhesion-independent mechanism for suppression of tumor cell invasion by E-cadherin. JCell Biol 161, 1191-203. Wu, Y . , Wu, J., Lee, D. , Yee, A . , Cao, L . , Zhang, Y . , Kian i , C. , and Yang, B . (2005). Versican protects cells from oxidative stress-induced apoptosis. Matrix Biol 24, 3-13. Wynn, R. (1967). Intrauterine devices: effects on ultrastructure of human endometrium. Science 156, 1508-10. X ing , R., and Rabbani, S. (1996). Overexpression of urokinase receptor in breast cancer cells results in increased tumor invasion, growth and metastasis. Int J Cancer 67, 423-9. X u , P., Wang, Y . , Pia, Y . , Bai , S., X i a , Z . , Jia, Y . , Luo, S., and Zhuang, L . (2001). Effects of matrix proteins on the expression of matrix metalloproteinase-2, -9, and -14 and tissue inhibitors of metalloproteinases in human cytotrophoblast cells during the first trimester. Biol Reprod 65, 240-6. X u , P., Wang, Y . , Zhu, S., Luo, S., Piao, Y . , and Zhuang, L . (2000). Expression of matrix metalloproteinase-2, -9, and -14, tissue inhibitors of metalloproteinase-1, and matrix proteins in human placenta during the first trimester. Biol Reprod 62, 988-94. Yagel, S., Parhar, R., Jeffrey, J., and Lala, P. (1988). Normal nonmetastatic human trophoblast cells share in vitro invasive properties of malignant cells. JCell Physiol 136, 455-62. Yamanishi, Y . , Boyle, D . , Clark, M . , M a k i , R., Tortorella, M . D . , Arner, E . C , and Firestein, G . (2002). Expression and regulation of aggrecanase in arthritis: the role of TGF-beta. J Immunol 168, 1405-12. 108 Yanagisawa, M . , and Anastasiadis, P. (2006). p l 2 0 catenin is essential for mesenchymal cadherin-mediated regulation of cell motility and invasiveness. J Cell Biol 174, 1087-96. Yap, A . , Niessen, C , and Gumbiner, B . (1998). The juxtamembrane region of the cadherin cytoplasmic tail supports lateral clustering, adhesive strengthening, and interaction with pl20ctn. J Cell Biol 141, 779-89. Yoshida-Noro, C. , Suzuki, N . , and Takeichi, M . (1984). Molecular nature of the calcium-dependent cell-cell adhesion system in mouse teratocarcinoma and embryonic cells studied with a monoclonal antibody. Dev Biol 101, 19-27. Yoshinaga, I., Vink , J., Dekker, S., M i h m , M . , and Byers, H . (1993). Role of alpha 3 beta 1 and alpha 2 beta 1 integrins in melanoma cell migration. Melanoma Res 3, 435-41. Young, T., Pizzo, S., and Stack, M . (1995). A plasma membrane-associated component of ovarian adenocarcinoma cells enhances the catalytic efficiency of matrix metalloproteinase-2. J Biol Chem 270, 999-1002. Y u i , J., Garcia-Lloret, M . , Brown, A . , Berdan, R., Morrish, D . , Wegmann, T., and Guilbert, L . (1994). Functional, long-term cultures of human term trophoblasts purified by column-elimination of C D 9 expressing cells. Placenta 15, 231-46. Zeng, Z . , Jia, Y . , Hahn, N . , Markwart, S., Rockwood, K . , and Livant, D . (2006). Role of focal adhesion kinase and phosphatidylinositol 3'-kinase in integrin fibronectin receptor-mediated, matrix metalloproteinase-1-dependent invasion by metastatic prostate cancer cells. Cancer Res 66, 8091-9. Zhang, D . , Bar -El i , M . , Meloche, S., and Brodt, P. (2004). Free Ful l Text Dual regulation of M M P - 2 expression by the type 1 insulin-like growth factor receptor: the phosphatidylinositol 3-kinase/Akt and R a f / E R K pathways transmit opposing signals. J Biol Chem 279, 19683-90. Zhang, J., Zhi , H . , Zhou, C , Ding, F., Luo, A . , Zhang, X . , Sun, Y . , Wang, X . , Wu , M . , and L i u , Z . (2005). Up-regulation of fibronectin in oesophageal squamous cell carcinoma is associated with activation of the Erk pathway. J Pathol 207, 402-9. Zheng, X . , Chung, D. , Takahara, K . , E M , M . , JE, S., and Fujikawa, K . (2001). Structure of von Willebrand factor-cleaving protease ( A D A M T S 13), a metalloprotease involved in thrombotic thrombocytopenic purpura. J Biol Chem 276, 41059-63. Zhou, Y . , Damsky, C , Chiu, K . , Roberts, J., and Fisher, S. (1993). Preeclampsia is associated with abnormal expression of adhesion molecules by invasive cytotrophoblasts. J Clin Invest 91, 950-60. 109 Zhou, Y . , Damsky, C , and Fisher, S. (1997b). Preeclampsia is associated with failure of human cytotrophoblasts to mimic a vascular adhesion phenotype. One cause of defective endovascular invasion in this syndrome? J Clin Invest 99, 2152-64. Zhou, Y . , Fisher, S., Janatpour, M . , Genbacev, O., Dejana, E . , Wheelock, M . , and Damsky, C. (1997a). Human cytotrophoblasts adopt a vascular phenotype as they differentiate. A strategy for successful endovascular invasion? J Clin Invest 99, 2139-51. Zhu, H . , Leung, P., and MacCalman, C. (2006). Expression of ADAMTS-5 / implan t in in human decidual stromal cells: regulatory effects of cytokines. Hum ReprodEpub ahead o f print. Zygmunt, M . , Hahn, D . , Kiesenbauer, N . , Munstedt, K . , and Lang, U . (1998). Invasion of cytotrophoblastic (JEG-3) cells is up-regulated by interleukin-15 in vitro. Am J Reprod Immunol 4 0 , 326-31. 110 CHAPTER V. CHARACTERIZATION OF ADAMTS METALLOPROTEINASES IN THE HUMAN FIRST TRIMESTER PLACENTA AND MONONULCEAR TROPHOBLASTIC CELLS 2.1 Preface This chapter describes a set of studies undertaken to characterize a novel family of zinc dependent metalloproteinases, known as the A D A M T S , in human first trimester placenta and trophoblastic cell lines. The A D A M T S have been shown to play key roles in many biological processes. Although the biological functions of specific A D A M T S subtypes have been elucidated, the majority of A D A M T S subtypes have yet to be characterized beyond the structural level. Due to the important roles A D A M T S play in a diverse set of biological events, I set out to characterize the expression levels of A D A M T S subtypes in the human first trimester placenta as a first step in revealing whether members of this protease family play functional roles in the early developmental processes of human placentation. Initial screening experiments discovered a select number of A D A M T S subtypes expressed in the human first trimester placenta. Furthermore, it was demonstrated that some subtypes were differentially expressed between poorly-invasive and highly-invasive trophoblastic cell lines. These findings provided the initial 1 A version of this chapter has been submitted for publication. Beristain, A G . , Getsios, S., Zhu, H . , and MacCalman, C D . (February, 2007), Regulated expression of A D A M T S - 1 2 in human trophoblastic cells: A role for A D A M T S - 1 2 in epithelial cell invasion? Molecular and Cellular Biology. I l l groundwork that led to the discovery that A D A M T S - 1 2 , a member of the A D A M T S family, plays a key role in facilitating human cytotrophoblast invasion. Dr. H Zhu performed the cytokine regulation and Q C - P C R experiments in these studies (Figures 2.2.2, 2.2.5 and 2.2.6). Dr. S. Getsios provided critical technical assistance for the hanging cell drop and native ECM-binding assays. 112 2.2 Regulated expression of A D A M T S - 1 2 in human trophoblastic cells: A role for A D A M T S - 1 2 in epithelial cell invasion? Introduction Human placental development and function is dependent upon mononucleate cytotrophoblasts entering one of two distinct and mutually exclusive differentiation pathways (Aplin, 1991; Cross et al, 1994; Red-Horse et al, 2004). The villous pathway culminates in the formation of the syncytial trophoblast, a multinucleated, terminally differentiated cell that contributes to the majority of placental transport, immunoregulatory and endocrine functions throughout pregnancy. Alternatively, cytotrophoblasts entering the extravillous pathway develop a highly invasive phenotype, which in turn allows these cells to invade deeply into the underlying maternal tissues and vasculature, thereby ensuring a continuous supply of blood to the developing fetus. Extravillous cytotrophoblast invasion, unlike carcinoma cell metastasis, is a tightly controlled, developmental process (Graham et al, 1993; Chakraborty et al, 2002). The onset of trophoblastic cell differentiation along the extravillous pathway is dependent upon the proteolytic degradation and/or activation of distinct extracellular matrix ( E C M ) components, and regulated changes in cell-cell and cell-matrix interactions (Graham et al, 1993; Burrows et al, 1996; MacCalman et al, 1998; Chakraborty et al, 2002; Cohen et al, 2005). Consequently, most studies to date have focused upon the roles of matrix metalloproteinases/tissue inhibitors of metalloproteinases (MMPs /TIMPs) , cytokines, integrins, and cadherins in this cellular event. However, there is increasing evidence to suggest that the regulated expression of members of the A D A M T S (A Disintegrin A n d Metalloproteinase with ThromboSpondin repeats) gene family 113 may also represent a significant molecular mechanism for mediation of the terminal differentiation of human cytotrophoblasts and the development of an invasive phenotype. The A D A M T S are a novel family of secreted proteins that are generally characterized by four structural and functional domains; an amino terminal prodomain, a catalytic domain, a disintegrin-like domain, and an ECM-binding domain (composed of a central thrombospondin type 1 (TSP1) motif, a spacer region and a variable number of TSP-like motifs) at the carboxyl terminal of the mature protein species (Tang, 2001; Apte, 2004; Porter et al, 2005). Thus, all members of this gene family have the potential to act as metalloproteinases and to regulate cell adhesion. Some A D A M T S subtypes have been further subclassified according to the presence of additional C-terminal modules or the identification of common substrates. Furthermore, distinct A D A M T S subtypes have also been shown to play integral roles in the growth and development of tissues (Shindo et al, 2000; L i et al, 2001; Mittaz et al, 2004; Shozu et al, 2005) and in the onset and progression of degradative diseases including cancer (Porter et al, 2004; 2006; Held-Feindt et al, 2005), arthritis (Bayliss et al, 2001; Nagase and Kashiwagi, 2003), Alzheimer's disease (Miguel et al, 2005) and a number of inflammatory and thrombotic conditions (Kuno et al, 1997; Levy et al, 2001; Tsai, 2002). In these studies, I have examined the function and regulation of the A D A M T S in the differentiation of human cytotrophoblasts along the extravillous pathway. I first determined that multiple A D A M T S subtypes are present in first trimester human placenta, in cultures of invasive E V T s propagated from these tissues and in the poorly invasive JEG-3 choriocarcinoma cell line. O f these, only A D A M T S - 1 2 was found to be present in E V T s at significantly higher levels than 114 in JEG-3 cells. The ability of transforming growth factor (TGF) -p i and interleukin ( IL)- ip , two cytokines assigned counter-regulatory roles in human placentation (Graham et al, 1992; 1993; Chakraborty et al, 2002), to differentially regulate A D A M T S - 1 2 m R N A levels in cultures of E V T s supported my hypothesis that this A D A M T S subtype confers an invasive phenotype on human trophoblastic cells. Loss- or gain-of-function studies subsequently confirmed that this A D A M T S subtype, independent of its intrinsic proteolytic activity, plays an active and dominant role in human trophoblastic cell invasion in vitro. 115 Materials and Methods Tissues. Samples of first trimester placental tissues were obtained from women undergoing elective termination of pregnancy (gestational ages ranging from 6-12 weeks). The use of these tissues was approved by the Committee for Ethical Review of Research on the use of Human Subjects, University of British Columbia, Vancouver, B C , Canada. A l l women provided informed written consent. Cells. Cultures of E V T s were propagated from first trimester placental explants as previously described (Getsios et al, 1998). Briefly, chorionic v i l l i were washed three times in P B S . The v i l l i were minced finely and plated in 25cm 2 tissue culture flasks containing Dulbecco's Modified Eagle's Medium ( D M E M ) containing 25 m M glucose, L-glutamine, antibiotics (lOOU/ml penicillin, 100 pg/ml streptomycin) and supplemented with 10% fetal bovine serum (FBS). The fragments of the chorionic v i l l i were allowed to adhere for 2-3d, after which any non-adherent tissue was removed. The villous explants were cultured for a further 10-14d with the culture medium being replaced every 48h. The E V T s were separated from the villous explants by a brief (2-3min) trypsin digestion at 37°C and plated in 60 m m 2 culture dishes in D M E M supplemented with antibiotics and 10% F B S . The purity of the E V T cultures was determined by immunostaining with a monoclonal antibody directed against human cytokeratin filaments 8 and 18 (Sigma Aldrich, St Louis, M O , U S A ) according to the methods of MacCalman et al. (MacCalman et al, 1996). Only cell cultures that exhibited 100% immunostaining for cytokeratin were included in these studies. 116 JEG-3 choriocarcinoma cells were purchased from A T C C (Manassas, V A , U S A ) . On-going cultures were maintained in D M E M containing 25 m M glucose, L-glutamine, antibiotics (lOOU/ml penicillin, 100 ug/ml streptomycin) and supplemented with 10% F B S . Experimental Culture Conditions. E V T s (5 x 10 6 cells) were plated in 60 m m 2 tissue culture dishes and grown to 80% confluency. The cells were then washed with P B S and cultured in D M E M under serum-free conditions. Twenty four h after the removal of serum from the culture medium, the cells were again washed with P B S before being cultured in the presence of TGF-(31 (0.1, 1, 5, or 10 ng/ml) or I L - i p (1, 10, 100 or 1000 IU/ml) for 24 h or T G F - p l (5 ng/ml) or IL-1B (100 IU/ml) for 0, 6, 12, 24 or 48 h. E V T s cultured in the presence of vehicle (ethanol) served as controls for these studies. To inhibit the regulatory effects of T G F - p l and I L - l p on A D A M T S - 1 2 m R N A levels in these primary cell cultures, E V T s were cultured in the presence of either T G F - p i (5ng/ml) alone or in combination with a function-perturbing monoclonal antibody directed against human T G F - p i (Sigma Aldr ich; 10 ug/ml; clone 9016.2) or I L - l p (100 IU/ml) alone or in combination with a function-perturbing monoclonal antibody specific for this cytokine (Sigma Aldr ich; 1 or 2 ug/ml) for 24 h. The concentrations of cytokines and corresponding function-perturbing antibodies used in these studies are based upon previous reports (Huang et al, 1998; Chung et al, 2001). 117 Generation of first-strand cDNA. Total R N A was prepared from tissue samples of first trimester placenta or cultures of E V T s or JEG-3 cells using an RNeasy M i n i K i t (Qiagen, Inc, C A ) following a protocol recommended by the manufacturer. The total R N A extracts were then treated with Deoxyribonuclease-1 to eliminate possible contamination with genomic D N A . To verify the integrity of the R N A , aliquots of the total R N A extracts electrophoresed in a 1% (w/v) denaturing agarose gel containing 3.7 % (v/v) formaldehyde and the 28 S and 18 S ribosomal R N A subunits visualized by ethidium bromide staining. The purity and concentration of total R N A present in each of the extracts were determined by optical densitometry (260/280nm) using a Du-64 U V -spectrophotometer (Beckman Coulter, Mississauga, O N , Canada). Aliquots (~1 pg) of the total R N A extracts prepared from the human placental tissues or trophoblastic cells was then reverse-transcribed into c D N A using a First Strand c D N A Synthesis K i t according to the manufacturer's protocol (Amersham Pharmacia Biotech, Oakville, O N , Canada). Primer Design and preparation of cDNA Probes. 118 Primer sets specific for A D A M T S - 1 through -12 (Madan et al, 2003) and A D A M T S - 2 0 , or the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase ( G A P D H ) which served as an internal control (Getsios et al, 1998), were synthesized at the N A P S Unit, University of British Columbia, Vancouver, B C , Canada. The nucleotide sequences of these primers, the optimized P C R conditions, and the expected sizes of the P C R products are listed in Table 1. To generate c D N A probes specific for each A D A M T S subtype or G A P D H , P C R products generated from a representative human placental tissue sample were subcloned into the P C R II vector by blunt-end ligation (Invitrogen, Carlsbad, C A , U S A ) and subjected to nucleotide sequence analysis. c D N A probes were subsequently isolated from these plasmids using standard molecular biology techniques. A second set of primers specific for A D A M T S - 1 2 , in which a stretch of nucleotides corresponding to a sequence present within the target A D A M T S - 1 2 P C R product was incorporated into the 3'-end of the forward primer, were also prepared (Figure 1). These primers were used for the quantitative competitive (QC)-PCR analysis of A D A M T S - 1 2 m R N A levels in E V T s cultured in the presence or absence of T G F - p i and I L - l p \ We have recently used a similar approach to examine urokinase plasminogen activator/plasminogen activator inhibitor-1 (u-PA/ PAI-1) and M M P / T I M P m R N A levels in these primary cell cultures (Chou et al, 2002; Chou et al, 2003). Semiquantitative P C R and Southern blot analysis. 119 Semiquantitative P C R was performed using the primer sets specific for A D A M T S - 1 through -12 or G A P D H , and template c D N A generated from the total R N A extracts prepared from first trimester placental tissues or cultures of E V T s or JEG-3 cells. The P C R cycles were repeated 15-40 times to determine a linear relationship between the yield of P C R products from representative samples of placental tissues and trophoblastic cells and the number of cycles performed. The optimized numbers of cycles subsequently used to amplify the A D A M T S subtypes identified in each of these samples and G A P D H are listed in Table 1. A l l P C R reactions were performed on 3 separate occasions. P C R was also performed using the primer sets specific for the distinct A D A M T S subtypes and aliquots of total R N A extracts prepared from the placental tissues or trophoblastic cells (i.e. non-transcribed R N A ) or D E P C -treated water under the same conditions as described above. These P C R reactions, which served as negative controls, did not yield any P C R products confirming the purity of the total R N A extracts used in these studies (data not shown). Aliquots (20 /A) of the P C R products generated from the placental tissue samples and trophoblastic cells were separated by electrophoresis in a 1.2% (w/v) agarose gel and visualized by ethidium bromide staining. The gels were then denatured with 0.5 M N a O H for 5 min, neutralized with 1 M TRIS-HC1 for 5 min and transferred onto a charged nylon membrane (Hybond + , Amersham Canada Ltd. , Oakville, O N , Canada). The Southern blots were probed with a radiolabeled-cDNA specific for each of the distinct A D A M T S subtypes or G A P D H according to the methods of MacCalman et al (1996). The blots 120 were then washed twice with 2 x SSPE (20 x SSPE consists of 0.2 M sodium phosphate, p H 7.4 containing 25 m M E D T A and 3 M NaCl ) at room temperature, twice with 2 x SSPE containing 0.1% SDS at 55°C and twice with 0.2 x SSPE at room temperature. The blots were subjected to autoradiography to detect the hybridization of the radiolabeled probes to the P C R products. The resultant autoradiograms were then scanned using a laser densitometer (Scion Corporation, Frederick, M D , U S A ) and the absorbance values obtained for each of the distinct A D A M T S P C R products normalized relative to the corresponding G A P D H absorbance value. Q C - P C R . The Q C - P C R strategy employed in these studies is based upon the competitive co-amplification of a known amount of competitive A D A M T S - 1 2 P C R product added to aliquots of first strand c D N A prepared from our primary cultures of E V T s . P C R was performed using these c D N A mixtures as templates and the set of Q C - P C R primers specific for A D A M T S - 1 2 under the following optimized conditions: 1 min at 94°C, 1 min at 58.5 C and 1.5 mins at 72°C. This cycle was repeated 28 times followed by a final extension at 72°C for 15 min. The resultant target and competitive A D A M T S - 1 2 P C R products were separated using gel electrophoresis and visualised by ethidium bromide staining. A n aliquot of these P C R products were subcloned into the P C R II vector (Invitrogen) and subjected to D N A sequence analysis to confirm the specificity of the primers (data not shown). To determine the optimal amount of competitive c D N A to be added to each reaction mixture, P C R was performed using either a fixed amount of template c D N A combined with decreasing concentrations of competitive c D N A or conversely, a fixed concentration of competitive c D N A combined with decreasing amounts of template c D N A . Aliquots (10 pl) of the subsequent P C R 121 products was subjected to electrophoresis in a 1% (w/v) agarose gel and visualised by ethidium bromide staining (Figure 2). The intensity of ethidium bromide staining of the P C R products was analysed by U V densitometry (Biometra, Whiteman Co., Gottigen, Germany). Volume counts (mm 3) of the P C R products were then determined using the Scion Image computer software (Scion Image Co. , Frederick, M D ) . Based upon these results, the competitive A D A M T S - 1 2 c D N A was subsequently added to each of the aliquots of first strand c D N A generated from E V T s at a concentration of 4.88x10" pg/pl. Q C - P C R was performed under the optimized conditions and the ratio of target:competitive A D A M T S - 1 2 P C R products in each reaction mixture determined by U V densitometry as described above. Western blot analysis. Cultures of JEG-3 cells or E V T s were washed three times in P B S and incubated in 100 pl of cell extraction buffer (Biosource International, Camarillo, C A ) supplemented with 1.0 m M P M S F and proteinase-inhibitor cocktail for 30 minutes on a rocking platform. The cell lysates were centrifuged at 10, 000 x g for 30 minutes at 4 °C and the supernatants used for Western blot analysis. The concentrations of protein in the cell lysates were determined using a B C A kit (Pierce Chemicals, Rockford, IL, U S A ) . Western blots containing aliquots (30 pg) of the cell lysates were prepared and immunoblotted as previously described (MacCalman et al, 1996) using a polyclonal antibody directed against the carboxyl terminal of human A D A M T S - 1 2 (Santa Cruz Inc, Santa Cruz, C A , U S A ) . To stanadardise the amounts of protein loaded in each lane, the blots were reprobed with a monoclonal antibody directed against human (3-actin (Sigma Aldrich). The Amersham E C L system was used to detect the amount of each antibody bound to 122 antigen. The resultant autoradiograms were analysed by U V densitometry. The absorbance value obtained for the A D A M T S - 1 2 protein species in each of the cell lysates was normalized relative to the corresponding (3-actin absorbance value. siRNA transfection. s i R N A (Xeragon Inc, Germantown, M D ; 13.5 ug/100 mm culture dish) targeting the human A D A M T S - 1 2 m R N A transcript ( 5 ' - A A G C C C G T C C C T C C A C C T A C A - 3 ' ) was transfected into E V T s using oligofectamine reagent (Invitrogen) according to a protocol outlined by the manufacturer. E V T s transfected with a non-silencing, scrambled s i R N A (5'-A T T T C T C C G A A C G T G T C A C G T - 3 ' ) or cultured in the presence of transfection reagent alone, served as negative controls for these studies. The concentration of s i R N A s used in these experiments was selected on the basis of previous studies using primary cultures of E V T s (Poehlmann et al, 2005). Following optimization of the Oligofectamine:siRNA concentration ratio, all experiments were performed using E V T s that had been transfected with either s i R N A or cultured with the transfection reagent alone for at least 24 h. Expression Vectors. Mammalian expression vectors (pcDNA3.1) containing either a full length human A D A M T S - 1 2 c D N A (pcDN A 3 - A D A M - T S 1 2 - H A ) or a full-length human A D A M T S - 1 2 c D N A in which the catalytic domain had been inactivated by site directed mutagenesis ( p c D N A 3 - A D A M - T S 1 2 -123 M U T ) were generously provided by Dr. S. Cai (Universidad de Oviedo, Spain). These c D N A constructs have been described in detail elsewhere (Cai et al, 2001). For the generation of the A D A M - T S 1 2 - M U T c D N A construct, two point mutations in the metalloproteinase domain were performed by PCR-based mutagenesis. Specifically, the thymine (465) and adenine (466) in the metalloproteinase domain where substituted for adenine and cytosine, which results in the translated protein consisting of a glucine amino acid instead of histidine, thus rendering the protein catalytically inactive (Cai et al, 2001). A full-length human A D A M T S - 1 c D N A (Genbank Accession No . NM006988) was purchased from Origene (Rockville, M D , U S A ) and ligated into the Sacl/Smal site of pcDNA3.1 (Invitrogen) using standard molecular biology techniques. A clone ( p c D N A 3 - A D A M - T S - l ) containing the A D A M T S - 1 c D N A in the forward orientation was subsequently identified by D N A sequence analysis. A pcDNA3.1 expression vector containing the P-galactosidase gene (pcDNA3-LacZ; Invitrogen) was used to determine transfection efficiency and also served as a control for these studies. Generation of stably transfected JEG -3 cell lines. Stable transfections were performed to establish clonal JEG-3 cell lines constitutively expressing p c D N A 3 - A D A M - T S 1 2 , p c D N A 3 - A D A M - T S 1 2 - M U T , p c D N A 3 - A D A M - T S 1 or p c D N A 3 -LacZ. Each of these expression vectors (1.0 pg/ml) was transfected into JEG-3 cells using Exgen 500 transfection reagent (Fermentas, Burlington, O N , Canada) according to the manufacturer's protocol. Colonies were first selected after 48 h of culture using G418 antibiotic 124 (400 ug/ml D M E M ; Invitrogen). Positives were then subcloned by limiting dilution and expanded into cell lines that were maintained in the selection medium. A t least three independent clones were selected per construct based solely on expression levels of the exogenous protein, as determined by Western blot analysis (data not shown). Transwell invasion assays. Cellular invasion assays were performed by using Transwells fitted with Mil l ipore Corp. membranes coated with a thin layer of growth factor-reduced Matrigel (6.5-mm filters, 8-pm pore size; Costar, Toronto, O N , Canada) as previously described (Zhou et al, 1997a; X u et al, 2002). Briefly, 2 x 10 4 cells/200 pl of D M E M supplemented with 10 % F B S were plated in the upper wells of the Transwells invasion chambers. The Transwells were then immediately immersed into the lower wells of the invasion chamber which contained 800 pl of D M E M . Invasion assays were performed for 24h (EVTs) or 48h (JEG-3 cells) in a humidified environment (5% CO2) at 37°C after which, cells attached to the porous membranes were fixed in 4% paraformaldehyde and cells from the upper surface of the Matrigel layer were completely removed by gentle swabbing. The remaining cells which had invaded into the Matrigel and appeared on the underside of the filters were fixed and stained using a Diff-Quick Stain kit (Dade A G , Dudingen, Switzerland) according a protocol outlined by the manufacturer. The filters were then rinsed with water, excised from the Transwells, and mounted upside-down onto glass slides. Invasion indices were determined by counting the number of stained cells in 10 randomly selected, non-overlapping fields at 400X magnification using a light microscope. Each cell culture was tested in triplicate wells, on three independent occasions. 125 Cellular aggregation assay. Cellular aggregation assays were performed using the cell hanging-drop method (Getsios et al, 2004, Lorch et al, 2004). Briefly, trypsinized single cell suspensions (1.5 x 10 5 cells/ml) treated with E D T A and passaged through 20pm nylon sieves (Falcon) were prepared in D M E M media containing 10% F B S . From these suspensions, three 20pl droplets were pippetted onto the underside of 6cm culture dish lids. Lids containing the three cell droplets were carefully placed onto their respective culture dishes containing 2ml of I X P B S or D M E M media and incubated for 2, 4 or 8h in a humidified cell culture incubator at 37°C, 5% CO2. After incubation, culture dish lids containing the hanging drops were inverted and glass coverslips were mounted onto the cell-drop suspensions. The extent of cellular aggregation was qualitatively determined by observing the cell-drop suspensions under a light microscope fitted with a digital camera (200X magnification). Each hanging cell-drop experiment was repeated a minimum of three times. ECM-binding assay. Experimental JEG-3 cells stably transfected with p c D N A 3 - A D A M - T S 1 2 , p c D N A 3 - A D A M -T S 1 2 - M U T or p c D N A 3 - L a c Z were plated in 24-well plates in triplicate at high density and were allowed to grow to near confluency for 24h. A t this point, cell media was replaced with fresh D M E M media containing 10% F B S and antibiotics, where cells were then cultured for an additional 48h. Cel l monolayers were removed by incubation for 2 X 5min in 2 0 m M N H 4 O H according to Gospodarowicz et al (1981) followed by washing in I X P B S . Experimental JEG-3 126 cells growing in 100mm plates were trypsinized, passaged through a 40pm nylon sieve to remove cellular aggregates, and plated onto the E C M deposited by the transfected JEG-3 cell lines in the 24-well plates in triplicate combinations. Cells were cultured at 37°C in a humidified incubator (5% CO2) for 30 min. After incubation, cells seeded in the 24-well plate were washed 2 X with P B S , fixed in 4% paraformaldehyde and stained with eosin. E C M binding ability was determined by counting the number of cells that had adhered to the extracellular matrices deposited by transfected JEG-3 cells under a microscope fitted with a digital camera (200X magnification). RGD peptide treatment. A synthetic R G D (Arg-Gly-Asp) peptide (Biomol International) and a control R G D peptide (Biomol International) were used in additional cell invasion experiments utilizing the previously described Matrigel-coated Transwell invasion chambers. For these invasion assays, experimental cells were cultured in Matrigel-coated Transwell inserts in the presence of an R G D ( ImM) or control peptide ( ImM) diluted in D M E M complete media or in D M E M media alone following the procedures of Buckley et al (1999). Prior to seeding cells into invasion chambers, 5.4 x 105 cells in media suspension were pre-incubated in the presence of the R G D or control peptide ( ImM) for 30 min in a humidified cell culture incubator, 37°C, 5% CO2. After pre-incubation, 2 x 10 4 cells/200 pl obtained from the RGD-pre-treated cell suspension, were seeded into Transwell invasion inserts and cultured for 48h, after which they were assayed for invasive capacity. 127 Statistical Analysis. The absorbance values obtained from the ethidium bromide stained gels containing Q c - P C R products and the autoradiograms generated by Southern or Western blotting were subjected to statistical analysis using GraphPad Prism 4 computer software (San Diego, C A , U S A ) . Statistical differences between the absorbance values were assessed by the analysis of variance ( A N O V A ) . Significant differences between the means were determined using Dunnett's test (Getsios et al, 1998; Chou et al, 2002). Differences were considered significant for P < 0.05. Cellular invasion was analysed by one-way A N O V A followed by the Tukey multiple comparison test (Xu et al, 2002). Differences were accepted as significant at P <0.05. 128 Results Characterisation of the A D A M T S subtypes present in human placental tissues and cells A D A M T S - 1 , -2, -4, -5 (also known as A D A M T S - 1 1 ) , -6, -7, -9, and -12 m R N A levels were detected in first trimester human placenta (Figure 2.2.3). In contrast, A D A M T S - 3 , -8 and -10 m R N A was not detected in these placental tissues but were readily detectable in my positive controls (data not shown). This repertoire of A D A M T S subtypes was maintained in both highly invasive E V T s and poorly invasive JEG-3 cells, with the exception of A D A M T S - 5 , which was not detected in either trophoblastic cell type examined in these studies (Figure 2.2.3). However, A D A M T S - 1 2 m R N A levels in E V T s were significantly higher than those detected in JEG-3 cells. In contrast, A D A M T S - 1 , -2, and -9 m R N A levels were significantly lower in E V T s , whereas there was no significant difference between the levels of the A D A M T S - 4 , -6 and -7 m R N A transcripts present in these two trophoblastic cell types. Higher ADAMTS-12 expression levels correlate with an invasive phenotype in human trophoblastic cells A s previous studies had failed to detect A D A M T S - 1 2 in normal human tissues and cells (Cai et al, 2001), I performed Western blot analysis to confirm that this A D A M T S subtype was expressed in first trimester human placenta in vivo and in trophoblastic cells in vitro. A single A D A M T S - 1 2 protein species (83 kDa), corresponding to a C-terminal fragment generated by 2 distinct rounds of post-translational cleavage of the A D A M T S - 1 2 zymogen (Cai et al, 2001) was 129 detected in the total protein lysates prepared from these placental tissues or cultures of E V T s or JEG-3 cells (Figure 2.2.4). Furthermore, and in agreement with my P C R data, A D A M T S - 1 2 protein expression levels were found to be significantly higher in E V T s as compared to JEG-3 cells. (Figure 2.2.4). Cytokines regulate ADAMTS-12 mRNA levels in EVTs TGF-(31 and I L - i p are spatiotemporally expressed at the maternal-fetal interface and have been shown to be potent regulators of human trophoblastic cell invasion in vitro (Graham et al, 1992; 1993). In view of these observations, I examined the ability of these two cytokines to regulate A D A M T S - 1 2 m R N A levels in primary cultures of E V T s in a time- and dose-dependent manner. A D A M T S - 1 2 m R N A was detected in all of the E V T cultures (Figures 2.2.5 and 2.2.6). The addition of vehicle (ethanol) to the culture medium of E V T s , which served as a negative control, had no significant effect on A D A M T S - 1 2 m R N A levels in these cells at any of the time points examined (data not shown). A significant decrease in A D A M T S - 1 2 m R N A levels was detected in E V T s cultured in the presence of T G F - p i (1 ng/ml) for 24 h with the levels of this m R N A transcript continuing to decrease until the termination of these studies at 48 h (Figure 2.2.5-A). The addition of increasing concentrations of T G F - p i to the culture medium of these cells demonstrated that A D A M T S - 1 2 m R N A levels in E V T s were regulated in a dose-dependent manner (Figure 2.2.5-B). A function-perturbing monoclonal antibody directed against T G F - p i abolished the T G F - p i -130 mediated decrease in A D A M T S - 1 2 m R N A levels in these primary cell cultures (Figure 2.2.5-C). In contrast, IL-1 (3 (100 IU) caused a continuous and significant increase in A D A M T S - 1 2 m R N A levels in E V T s over time in culture (Figure 2.2.6-A). Maximum levels of this m R N A transcript were subsequently detected in E V T s cultured in the presence of the highest concentration (1000 IU) of this cytokine examined in these studies (Figure 2.2.6-B). A function-perturbing monoclonal antibody directed against IL-1 P was also found to attenuate the increase in A D A M T S - 1 2 m R N A levels observed in E V T s cultured in the presence of this cytokine (Figure 2.2.6-C). M y initial findings demonstrated that similar to many other normal and malignant epithelial cells examined to date (Cai et al, 2001), A D A M T S - 1 2 expression levels are higher in human trophoblastic cells with an invasive phenotype. The ability of cytokines to differentially regulate A D A M T S - 1 2 m R N A levels in primary cultures of E V T s provided further evidence that A D A M T S - 1 2 contributes to the highly regulated invasion of human trophoblastic cells. In view of these observations, I hypothesised that altered expression levels of this A D A M T S subtype would, in turn, modulate the invasive capacity of these cells. Decreased ADAMTS-12 expression reduces the invasive capacity of EVTs In order to decrease A D A M T S - 1 2 expression in cultures of E V T s , I utilized s i R N A complementary to the human A D A M T S - 1 2 m R N A transcript. Transfection of E V T s with this s i R N A significantly decreased A D A M T S - 1 2 m R N A and protein expression levels in these cell 131 cultures after 24 h (Figure 2.2.1-A and -B) . In contrast, there was no significant difference between A D A M T S - 1 2 m R N A and protein levels in my two control cultures, E V T s transfected with a non-silencing, scrambled s i R N A or cultured in the presence of transfection reagent alone (Figure 2.2.7-A and -B) . To verify the specificity of the knockdown effect of my A D A M T S - 1 2 s i R N A and to determine whether there were compensatory changes in the levels of other A D A M T S subtypes, P C R was performed using template c D N A generated from E V T s transfected with either the A D A M T S - 1 2 or control s i R N A and the primers specific for each A D A M T S subtype previously identified in these cells. In contrast to A D A M T S - 1 2 , there was no significant difference between the levels of the A D A M T S - 1 , -2, -4, -6, and -7 m R N A transcripts present in E V T s transfected with either the A D A M T S - 1 2 or scrambled s i R N A (Figure 2.2.7-C). I next determined whether a reduction in A D A M T S - 1 2 expression levels in E V T s resulted in a concomitant decrease in their invasive capacity. The number of cells that penetrated the Matrigel and appeared on the bottom side of the Mil l ipore filter of the Transwell invasion chambers were found to be significantly and consistently lower in cultures of E V T s transfected with A D A M T S - 1 2 s i R N A compared to those transfected with the scrambled control s i R N A or treated with transfection reagent alone (Figure 2.2.7-D). These observations strengthened my hypothesis that A D A M T S - 1 2 plays an integral role in human trophoblastic cell invasion. 132 Exogenous ADAMTS-12 expression induces an invasive phenotype in JEG-3 cells To determine whether exogenous A D A M T S - 1 2 expression could confer an invasive phenotype on trophoblastic cells, JEG-3 cells were stably transfected with p c D N A 3 - A D A M - T S - 1 2 . In agreement with my preceding observations, a single A D A M T S - 1 2 protein species (83 kDa) was readily detectable in these JEG-3 cells but not in those transfected with the control expression vector, p c D N A 3 - L a c Z (Figure 2.2.8-A). Using transwell invasion assays, we next determined that the invasive capacity of JEG-3 cells expressing A D A M T S - 1 2 was significantly and consistently higher than the control cultures (Figure 2.2.8-A). Expression of pcDNA3-ADAM-TS-12-MUT increases the invasive capacity of JEG-3 cells A s a first step in characterizing the molecular mechanisms underlying A D A M T S - 12-mediated cellular invasion, JEG-3 cells were stably transfected with the mammalian expression vector, containing the proteinase-dead form of A D A M T S - 1 2 ( p c D N A 3 - A D A M - T S - 1 2 - M U T ; Cal et al, 2001). Similar to my preceding findings, a single A D A M T S - 1 2 protein species (83 kDa) was readily detectable in these JEG-3 cells following transfection with this vector (Figure 2.2.8-B). Furthermore, matrigel invasion analysis demonstrated that there was no significant difference in the invasive capacity of these cells and those expressing wildtype A D A M T S - 1 2 (3.5+ 0.9 (mutant) vs. 5.43± 1.3 (full-length); p<0.28), with both cell lines being consistently and significantly more invasive than the control cultures of JEG-3 cells (Figure 2.2.8-B). 133 Increased ADAMTS-1 levels cannot mimic the effects of ADAMTS-12 expression on the invasive capacity of JEG-3 cells To determine whether an increase in the expression levels of another A D A M T S subtype, other than A D A M T S - 1 2 , could increase the invasive capacity of human trophoblastic cells in vitro, JEG-3 cells were stably transfected with the mammalian expression vector, p c D N A 3 - A D A M -TS-1. Western blot analysis revealed the presence of two distinct A D A M T S - 1 protein species in these JEG-3 cell cultures and, albeit at lower levels, in those transfected with the control vector, pcDNA3-LacZ . These 2 isoforms of A D A M T S - 1 correspond to the zymogen and mature active form (Rodriguez-Manzaneque et al, 2000). However, higher A D A M T S - 1 expression levels in JEG-3 cells did not result in a concomitant increase in their invasive capacity, as determined by counting the number of cells that had successfully invaded into the Matrigel layer and appeared on the underside of the Transwell filters (Figure 2.2.8-C). Exogenous ADAMTS-12 does not alter cellular aggregation To investigate whether exogenous A D A M T S - 1 2 in JEG-3 choriocarcinoma cells could influence cell-cell binding affinity, p c D N A 3 - A D A M - T S 1 2 , p c D N A 3 - A D A M - T S 1 2 - M u t , and p c D N A 3 -LacZ stably transfected JEG-3 cells were subjected to a hanging cell-drop assay. Figure 2.2.9 demonstrates qualitatively that neither exogenous A D A M T S - 1 2 nor proteinase-dead A D A M T S -12 alters the aggregative capacity of JEG-3 trophoblastic cells. 134 Cell-extracellular matrix binding affinities are altered in JEG-3 cells exogenously expressing ADAMTS-12 To further elucidate the potential molecular mechanism by which A D A M T S - 1 2 elicits an invasive phenotype in poorly-invasive trophoblastic cells, I analyzed whether c e l l - E C M binding affinities differed between JEG-3 cells exogenously expressing full-length A D A M T S - 1 2 , proteinase-dead A D A M T S - 1 2 or JEG-3 cells transfected with the LacZ c D N A control construct. To do this, I cultured p c D N A 3 - A D A M - T S 1 2 , p c D N A 3 - A D A M - T S 1 2 - M u t , and p c D N A 3 - L a c Z transfected JEG-3 cells in a combinatorial fashion on extracellular matrices deposited by these same JEG-3 transfectants. JEG-3 cells exogenously expressing A D A M T S - 1 2 significantly adhered more readily to their own deposited native E C M . JEG-3 cells exogenously expressing proteinase-dead A D A M T S - 1 2 also bound more readily to their own E C M as did LacZ-transfected JEG-3 cells to their own E C M (Figure 2.2.10). However, JEG-3 cells exogenously expressing A D A M T S - 1 2 adhered with similar binding affinity to the E C M deposited by proteinase-dead A D A M T S - 1 2 transfected JEG-3 cells as they had adhered to their own E C M . Proteinase-dead A D A M T S - 1 2 transfected JEG-3 cells were likewise shown to bind with similar affinity to E C M deposited by JEG-3 cells transfected with full-length A D A M T S - 1 2 . LacZ-transfected JEG-3 cells, however, were shown to bind with less affinity to E C M deposited by either A D A M T S - 1 2 or proteinase-dead A D A M T S - 1 2 transfected JEG-3 cells (Figure 2.2.10). 135 The increase in invasive capacity of JEG-3 cells exogenously expressing ADAMTS-12 is abolished with treatment of an R G D peptide The finding that A D A M T S - 1 2 transfected JEG-3 cells had altered ECM-binding affinities compared to control JEG-3 cells suggested that there may be differences in integrin-mediated c e l l - E C M adhesion between these trophoblastic cell populations. A s a first step in determining whether exogenous expression of A D A M T S - 1 2 alters the expression and/or function of integrin cell adhesion molecules, I cultured A D A M T S - 1 2 , protease-dead A D A M T S - 1 2 , and LacZ transfected JEG-3 cells in Matrigel-coated Transwell invasion chambers in the presence of an R G D peptide. Cells were also cultured in the presence of a control R G D peptide that served as a technical control, or were cultured in complete D M E M media alone. Arbitrary invasion indexes of 1 were assigned to untreated cell transfectants and invasion indices of cells treated with either the R G D or control peptide were calculated relative to these. There were no significant differences in the invasive indices of LacZ transfected JEG-3 cells when cultured in the presence of either the R G D or control peptides (Figure 2.2.11). However, the invasive indices of JEG-3 cells stably transfected with A D A M T S - 1 2 or proteinase-dead A D A M T S - 1 2 cultured in the presence of the R G D peptide were significantly less than the invasive indices of the same cells cultured in media containing the control peptide (Figure 2.2.11). 136 DISCUSSION Multiple A D A M T S subtypes ( A D A M T S - 1 , -2, -4, -5, -6, -7, -9, and -12) were detected in tissue samples of first trimester human placenta. With the exception of A D A M T S - 5 , this repertoire of A D A M T S subtypes was maintained, albeit at differing levels, in cultures of highly invasive E V T s propagated from these tissues and in poorly invasive JEG-3 cells. Although the overall biological significance of this expression pattern of A D A M T S subtypes in the human placenta remains to be elucidated, my studies demonstrate that A D A M T S - 1 2 plays a non-redundant role in human trophoblastic cell invasion in vitro. In addition, the present results show that A D A M T S 12 m R N A levels in E V T s are differentially regulated by T G F - p i and I L - i p in a concentration-and time-dependent manner. These data show that A D A M T S - 1 2 is tightly regulated in human trophoblastic cells and that signaling pathways that control invasion act, in part, by downregulating A D A M T S - 1 2 gene expression. In agreement with my findings, A D A M T S - 2 m R N A has recently been detected in first trimester placenta (Farina et al, 2006), with m R N A transcripts encoding A D A M T S - 1 , -4, -5, -6, -7, -9, and -10 m R N A also being found in human term placenta (Abbaszade et al, 1999; Hurskainen et al, 1999; Llamazares et al, 2003; Sommerville et al, 2003; 2004). In addition to these A D A M T S subtypes, we have determined that A D A M T S - 1 2 is present in placenta obtained during the first trimester of pregnancy and in primary cultures of E V T s propagated from these tissues. However, previous studies failed to detect A D A M T S - 1 2 m R N A transcripts in an array of normal human tissues that included term placenta, with this A D A M T S subtype being found exclusively in fetal lung (Cal et al, 2001). Differences in placental A D A M T S - 1 2 m R N A levels are likely attributable 137 to the changes in the subpopulations of cytotrophoblasts that constitute this dynamic tissue throughout gestation. In particular, E V T s predominate during the first trimester with the number of these cells declining sharply thereafter and being absent in term placental tissues (Pijnenborg et al, 1980; Ap l in , 1991). Failure to detect A D A M T S - 5 in human trophoblastic cells in vitro suggests that the expression of this A D A M T S subtype in the placenta is restricted to one or more of the other cellular compartments that comprise this dynamic tissue, particularly the mesenchymal core and/or vasculature. In contrast to its restricted expression in normal human tissues, A D A M T S - 1 2 m R N A is readily detectable in cancer cell lines of diverse origin with levels of this m R N A transcript also being present at higher levels in gastric carcinomas compared to matched normal tissue controls (Cai et al, 2001). Although these findings suggest role(s) for this A D A M T S subtype in the development of an invasive cellular phenotype, my studies are the first to assign this biological function to A D A M T S - 1 2 and provide further evidence that E V T s adopt similar molecular mechanisms to those underlying tumor cell metastasis. However, altered A D A M T S - 1 2 expression levels have not been detected in breast and lung carcinomas (Porter et al, 2004; Rocks et al, 2006). Altered expression levels of other A D A M T S subtypes have also been detected in human carcinomas but their individual contribution(s) to the onset and progression of cancer also remains unclear (Masui et al, 2001; Kang et al, 2003 Apte, 2004; Porter et al, 2004; 2006; Rocks et al, 2006). For example, A D A M T S - 1 m R N A levels have been shown to be either increased (Kang et al, 2003) or decreased (Porter et al, 2004) in breast carcinomas. Higher levels of this 138 A D A M T S subtype have also being associated with pancreatic and hepatocellular cancer (Masui et al, 2001) whereas A D A M T S - 1 m R N A levels are unchanged in the onset and progression of kidney cancer (Kuno et al, 2004) and decreased in lung carcinomas (Rocks et al, 2006). Among the pancreatic cancer cases, those with higher levels of A D A M T S - 1 showed poorer prognosis, with evidence of increased local invasion and lymph node metastasis (Masui et al, 2001) whereas there was no direct correlation between A D A M T S - 1 expression and the clinicopathological features of breast or renal carcinomas (Porter et al, 2004; Roemer et al, 2004). Furthermore, the exogenous expression of A D A M T S - 1 has been shown to decrease the experimental metastasis of Chinese hamster ovary cells (Kuno et al, 2004) but increase the metastatic potential of mammary and lung cancer cell lines in vivo (L iu et al, 2005) whereas my studies demonstrate that increased expression levels of this A D A M T S subtype do not alter the invasive capacity of human trophoblastic cells in vitro. Further studies are required to evaluate the biological and clinical significance of (dys)regulated expression levels of distinct A D A M T S subtypes, alone or in combination, in the onset and/or progression of cancer to the later stages of the disease state. Recent studies indicate that in carcinomas of the breast, the expression levels of A D A M T S - 8 , in conjunction with A D A M T S - 1 5 , may serve as clinically relevant, prognostic cellular markers (Porter et al, 2005). The detection of multiple A D A M T S subtypes in tissues under normal and pathological conditions suggests that members of this gene family have overlapping biological function(s) (Madan et al, 2003; Porter et al, 2004, Richards et al, 2005). Gene knockout studies in mice have confirmed that A D A M T S can have either redundant or non-redundant biological activities 139 depending upon the tissue, its developmental stage or its disease state. For example, A D A M T S - 1 has redundant roles in the growth and development of cartilage and bone (Little et al, 2005), in cartilage degradation during the progression of arthritis (Stanton et al, 2005) but has non-redundant roles in follicular development and ovulation (Shindo et al, 2000; Shozu et al, 2005). Similarly, A D A M T S - 5 has been shown to have a dominant role in the degradation of cartilage in a murine model of arthritis but subordinate roles in normal bone and cartilage development and in the multistep processes of folliculogenesis and ovulation (Richards et al, 2005, Stanton et al, 2005). In contrast, A D A M T S - 4 is neither necessary nor sufficient for any of these developmental processes, despite being spatiotemporally expressed in murine ovaries during folliculogenesis (Richards et al, 2005) and being the predominant A D A M T S subtype present in bone growth plates of immature mice (Glasson et al, 2004). In support of my observations of a non-redundant, non-compensatory role for A D A M T S - 1 2 in trophoblastic cell invasion, a critical step in placentation (Pijnenborg et al, 1980; Ap l in , 1991), A D A M T S - 1 , -2, -4, and -5 gene knockout mice do not exhibit any gross abnormalities in the structure and function of their placental tissues (Shindo et al, 2000; L i et al, 2001; Glasson et al, 2004; 2005). To date, the phenotypes of mice null-mutant for A D A M T S - 1 2 or any of the other A D A M T S subtypes identified in first trimester human placenta have not been characterised. A D A M T S - 1 2 , similar to other members of this gene family, is synthesized as an inactive proform which is activated by cleavage of the prodomain (Cai et al, 2001). This mature form of A D A M T S - 1 2 is subsequently subjected to a second round of post-translational cleavage that results in the generation of two distinct fragments; an N-terminal fragment (120 kDa) that includes both the metalloproteinase and disintegrin domains, the central TSP-1 motif a spacer 140 region and 3 TSP-like motifs and a C-terminal fragment (83 kDa) containing the second spacer region (mucin binding domain) and the four additional TSP-1 motifs that are characteristic of this A D A M T S subtype (Cal et al, 2001). Similarly, the mature forms of other A D A M T S subtypes including A D A M T S - 1 , -2, -4, -8, and -9 are also subjected to at least one round of carboxyl-terminal processing culminating in the generation of protein fragments with distinct and sometimes opposing bioactivities (Vazquez et al, 1999; Rodriguez-Manzaneque et al, 2000; Gao et al, 2002; Sommerville et al, 2003; Colige et al, 2005). Furthermore, studies using deletion mutants have demonstrated that the proteolytic domain, the central TSP-1, spacer region and TSP-like motifs contribute to the overall biological activity and/or function of at least A D A M T S - 1 , -2 and -4 (Rodriguez-Manzaneque et al, 2000; Gao et al, 2002; Kuno et al, 2004; Colige et al, 2005). In contrast to my findings, in which a proteinase-dead form of A D A M T S - 1 2 was capable of promoting trophoblastic cell invasion, a functional proteolytic domain of A D A M T S - 1 is.required in order for this A D A M T S subtype to promote tumor cell metastasis (Kuno et al, 2004; L i u et al, 2005). Furthermore, the inability of A D A M T S - 1 to substitute for A D A M T S - 1 2 in the development of an invasive phenotype in my JEG-3 cell cultures suggests that other intrinsic molecular mechanism(s), likely mediated by one or more of their structural domains, confer specificity on the biological actions of the distinct A D A M T S subtypes. A candidate domain is the variable spacer region(s) of the A D A M T S which is responsible for A D A M T S - 1 sequestering growth factors in the E C M (Luque et al, 2003; L i u et al, 2005) and governs E C M binding and substrate specificity of A D A M T S - 4 (Hashimoto et al, 2004). To date, the biological significance of the two spacer regions present in A D A M T S - 1 2 are less well understood although one of them contains a mucin domain, potentially allowing this A D A M T S subtype to function as a proteoglycan in the E C M (Cal et al, 2001; Sommerville et al, 2004). I 141 believe that the trophoblastic cell cultures examined in these studies represent an ideal model in which to dissect the contribution(s) of the distinct domains of A D A M T S - 1 2 and underlying molecular pathways to epithelial cell invasion. To further my understanding in how A D A M T S - 1 2 modulates the invasive phenotype in trophoblastic cells, I utilized hanging cell drop and ECM-binding assays to determine whether cell-cell or c e l l - E C M binding abilities of JEG-3 cells exogenously expressing A D A M T S - 1 2 were altered. M y results suggest that cell-cell interactions are not modified by A D A M T S - 1 2 , however, the compromised ability of normal JEG-3 cells to bind to the native E C M deposited by JEG-3 cells exogenously expressing A D A M T S - 1 2 or proteinase-dead A D A M T S - 1 2 suggests that A D A M T S - 1 2 is modulating c e l l - E C M binding mechanisms in these cells through a catalytically independent manner. The central TSP-1, cysteine-rich and spacer domains of A D A M T S subtypes have been shown to be important in facilitating matrix glycosaminoglycan ( G A G ) binding and therefore may play key roles in facilitating matrix-remodeling processes (Kuno and Matsushima, 1998; Gao et al, 2002; Sommerville et al, 2003; Gao et al, 2004). Recently, the four carboxy-terminal TSP domains of A D A M T S - 1 2 have been shown to bind to EGF- l ike domains in C O M P (cartilage oligomeric matrix protein), a protein molecule found in cartilage E C M (Liu et al, 2006). These findings suggest that some component of A D A M T S - 1 2 , most likely an ancillary ECM-binding domain(s), associates with and/or remodels a component of the E C M , and in doing so alters the matrix-binding affinity of the cell. Since changes in c e l l - E C M binding affinities have been shown to alter the migratory and invasive characteristic of both normal and pathological cells (Hanahan and Weinberg, 2000), I wished to determine whether disrupting potential ECM-binding integrin receptors could affect 142 the invasive capacity in JEG-3 cells associated with exogenously expressed A D A M T S - 1 2 . M y data clearly shows that R G D peptide treatment significantly reduces the invasive capacity of both JEG-3 cells exogenously expressing full length A D A M T S - 1 2 or proteinase-dead A D A M T S - 1 2 . These data suggest that A D A M T S - 1 2 modulates cell invasion through an R G D -dependent mechanism. This is an intriguing finding as neither the disintegrin-like domain, the TSP-repeat domains nor any other domain of any characterized A D A M T S metalloproteinase contain RGD- l ike motifs (Porter et al, 2005). It is therefore unlikely that A D A M T S - 1 2 directly promotes an invasive phenotype through an RGD-dependent mechanism, but rather regulates the function or expression of proteins capable of controlling RGD-mediated cell-matrix adhesion and cell invasion. In light of this speculation, and the previous findings that demonstrated the ability of A D A M T S - 1 2 to alter c e l l - E C M binding, it is likely that exogenous expression of A D A M T S - 1 2 regulates and/or alters the expression of RGD-mot i f containing integrin receptor(s), and this modulation influences the invasive characteristics of trophoblastic cells. Further experimentation is required to determine i f indeed A D A M T S - 1 2 modulates the expression and/or function of integrins. The factors capable of regulating A D A M T S - 1 2 expression in mammalian tissues and cells remain poorly characterised. Consistent with their counteractive, regulatory roles in trophoblast invasion in vivo and in vitro (Graham et al, 1992), T G F - p i and I L - i p differentially regulated A D A M T S - 1 2 m R N A levels in our primary cultures of E V T s , with T G F - p i decreasing, and IL-i p increasing the levels of A D A M T S - 1 2 transcript. However, in cultured human fibroblasts, T G F - p i increased whereas I L - i p had no significant effect on the levels of A D A M T S - 1 2 transcript (Cal et al, 2001). Taken together, these observations suggest that the regulatory effects 143 of T G F - p i and l L - i p on A D A M T S - 1 2 m R N A levels are indirect and dependent upon the cellular context. In summary, I have determined that A D A M T S - 1 2 , independent of its proteolytic activity, plays a non-redundant role in human trophoblastic cells invasion in vitro. These studies not only provide further insight into the molecular mechanism underlying epithelial cell invasion but add to our understanding of the basic cell biology of the A D A M T S gene family. Acknowledgements I am grateful to Dr S. Cai for his generous gift of reagents used in these studies and his helpful advice. 144 Figure 2.2.1 Schematic diagram summarizing the QC-PCR strategy employed in these studies. A competitive A D A M T S - 1 2 c D N A (263 bp) was generated through the addition of a stretch of nucleotides, corresponding to a specific sequence within the target c D N A (548 bp), to the 3' end of the initial forward primer. 145 m R N A Primers 5'-3 * Size (bp) position on c D N A ADAMTS-12 Upstream (5'end) l.GGCCTTGACAATGATGTTGA 548 2772-2791 Downstream (3' end) 2.CTAGAAGGGCATTGCTGGA 3319-3300 Competitor 3. GGCCTTGACAATGATGTTGA GCAGGCTCTC 263 2772-2791,3077-3086 548bp target cDNA Forward Primer G C C C I J C A C A A T G A T G T T C A 5P 2772 2791 OOC CTTG-AC A A X G A T O T T O A 3077 3086 G C A G G C T C T C A G G T C G T T A C G G G A A G A T C Reverse Primer 3319 3300 C I C C A G C A A T G C C C T T C I A G Mutant Forward Primer C G C C T T G A C A A T G A T G T T G A C C A C C C T C T C A G G T C G T T A C G G C A A G A T C Reverse Primer 263bp competitor cDNA 146 Figure 2.2.2 Determination of the optimal amount of competitive ADAMTS-12 cDNA to be added to each QC-PCR reaction. Q C - P C R was performed under optimized conditions using an aliquot of first strand c D N A synthesized from E V T s containing decreasing amounts of competitive A D A M T S - 1 2 c D N A . A representative ethidium bromide-stained gel containing the resultant P C R products is presented (upper panel). The gels were analysed by densitometry and the volume counts obtained for both P C R products plotted in the line graph (lower panel). The point of interception indicates the optimal amount of competitive c D N A to be added to each Q C -P C R reaction mixture. This range was highly reproducible resulting in the addition of 4.88 pg/u.1 of competitive c D N A to each Q C - P C R reaction mixture. 147 148 Figure 2.2.3 Characterisation of the ADAMTS subtypes present in human placenta and trophoblastic cells. Shown are representative autoradiograms of Southern blots containing P C R products using template c D N A synthesized from total R N A extracted from first trimester placenta (P), JEG-3 cells (J) or E V T s (E) and primers specific for A D A M T S - 1 , -2, -4, -5, -6, -7, -9, -12 or G A P D H . The autoradiograms were scanned using a laser densitometer. The absorbance values obtained for the distinct A D A M T S subtypes were then standardized to the absorbance value obtained for G A P D H . The results derived from this analysis, as well as those from at least three other studies (autoradiograms not shown) are represented (mean + S E M ; n > 4) in the corresponding bar graphs (* = P O . 0 5 ) . 149 A D A M T 5 - 7 m R N A L e v e l s A D A M T S - 1 m R N A L e v e l s ADAMTS-H 111 ADAMTS-71 III ADAMTS-2 i ADAMTS-4* ADAMTS-5 • ADAMTS-61 A D A M T S - 2 m R N A L e v e l s L L i A D A M T S - 9 m R N A L e v e l s I \ B X 5 » =" 0.4 ADAMTS-91 A D A M T S - 4 m R N A L e v e l s A D A M T S - 1 2 m R N A L e v e l s A D A M T S - 5 m R N A L e v e l s I ADAMTS-12 • GAPDH • 5*0.2 ADAMTS-6 m R N A L e v e l s I . 150 Figure 2.2.4 ADAMTS-12 protein levels in human first trimester placental tissues and cell lines. Shown is a representative autoradiogram of a Western blot containing total protein extracts prepared from first trimester placenta (P), or cultures of E V T s (E) or JEG-3 cells (J). Western blot analysis was performed by using a polyclonal antibody directed against A D A M T S - 1 2 . The blots were then reprobed with a monoclonal antibody specific for human P-actin. The Amersham E C L system was used to detect antibody bound to antigen. The relative electrophoretic mobilities of the molecular weight markers (kDa) are shown to the left of the immunoblot. 151 1 5 2 Figure 2.2.5 Regulatory effects ofTGF-Bl on ADAMTS-12 mRNA expression levels in EVTs. Q C - P C R analysis of A D A M T S - 1 2 m R N A levels in E V T s cultured in the presence of (A) a fixed concentration of TGF-(31 for 0, 6, 12, 24, or 48h; (lanes 1-5 respectively), (B) increasing concentrations of T G F - p i (0, 0.001, 0.01, 0.1, 1 or 10 ng/ml) for 24 h (lanes 1-6, respectively) for 24h or (C) in the presence of vehicle alone (lane 1), T G F - p i alone (lane 2), an antibody directed against T G F - p l (lane 3), or T G F - p l plus the ant i -TGF-pl antibody (lane 4) for 24h. Representative photomicrographs of the resultant ethidium bromide-stained gels are presented. A 100-bp ladder is shown in lane M with the size of the target and competitive c D N A s indicated to the left. Gels generated from at least 3 other independent experiments were analysed by densitometry and subjected to statistical analysis. The data are presented as the mean absorbance + S . E . M . (n=3; a= P O . 0 5 vs. untreated control; b=P<0.5 vs. cytokine alone) in the bar graphs below. 153 548bp (Target) 263bp (Competitor) Time (h) 0 6 12 24 48 (TGF-pM, lng/ml) B TGF-(31 (ng/ml) 0 1 0 1 A n t i - T G F - p l antibody (lig/ml) 0 0 10 10 154 F i g u r e 2.2.6 Regulatory effects of IL-1/3 on ADAMTS-12 mRNA expression levels in EVTs. Q C - P C R analysis of A D A M T S - 1 2 m R N A levels in E V T s cultured in the presence of (A) a fixed concentration of IL-1 p for 0, 6, 12, 24, or 48h (lanes 1-5 respectively), (B) increasing concentrations of IL-1 (3 (0, 1, 10, 100, 1000 IU/ml) for 24h (lanes 1-5, respectively) or (C) in the presence of vehicle alone (lane 1), IL-1 P alone (lane 2), an antibody directed against IL-1 P alone (lane 3), or IL-1 P plus increasing concentrations of the anti-IL-ip antibody (lanes 4 and 5, respectively) for 24h. Representative photomicrographs of the resultant ethidium bromide-stained gels are presented. A 100-bp ladder is shown with the size of the target and competitive c D N A s indicated to the right. Gels generated from at least 3 other independent experiments were analysed by densitometry and subjected to statistical analysis. The data are presented as the mean absorbance + S . E . M . (n=3; a = P<0.05 vs. untreated control; b=P<0.5 vs. cytokine alone) in the bar graphs below. 155 Time (h) 0 (IL-ip lOOIU/ml) B 12 24 48 548bp (Target) 263bp (Competitor) 4 — 548bp (Target) - 263bp (Competitor) 3 < Q 2.5 o o 2 Q. 1 .0 E 8 1 S> 0.5 CD IL-l p (IU/ml) 0 a 10 100 1000 548bp (Target) 263bp (Competitor) IL-l (3 (IU/ml) 0 100 0 100 100 Anti-IL-1 p antibody (pg/ul) 0 0 2 1 2 156 Figure 2.2.7 Reduced ADAMTS-12 expression levels decrease EVT invasion. E V T s were transfected with s i R N A specific for A D A M T S - 1 2 (A12i), a scrambled control s i R N A (NS) or cultured in the presence of transfection reagent alone (con) for 48h. Cultures were harvested for total R N A or protein extraction. (A) Autoradiogram of a Southern blot containing R T - P C R products generated using these total R N A extracts and primers specific for A D A M T S - 1 2 or G A P D H . Quantification of A D A M T S - 1 2 m R N A levels was determined by standardizing the values obtained from optical densitometry of A D A M T S - 1 2 to the densitometric values generated from the housekeeping gene G A P D H . The results are presented (mean ± S E M ; n> 4) in the bar graphs (* = P<0.05). (B) Autoradiogram of a Western blot prepared using these total protein extracts and probed with antibodies directed against either A D A M T S - 1 2 or P-actin. The Amersham E C L was used to detect antibody bound to antigen. Quantification of A D A M T S - 1 2 protein levels was determined by standardizing the values obtained from optical densitometry of A D A M T S - 1 2 to the densitometric values generated from actin. The relative electrophoretic mobilities of the molecular weight markers (kDa) are shown to the left of the immunoblot. The results are presented (mean + S E M ; n> 4) in the bar graphs (* = P<0.05). (C) Autoradiograms of Southern blots containing P C R products generated using these total R N A and primers specific for ADAMTS-1,-2,-4,-5,-6,-7-12 or G A P D H . For each analysis, the resultant autoradiograms were scanned using a laser densitometer. The A D A M T S - 1 2 absorbance values were then standarized to those obtained for the corresponding G A P D H . The results are presented (mean + S E M ; n > 4) in the bar graphs (* = P<0.05). (D) These cell cultures were also plated in the upper well of Transwell invasion chambers. After a further 24h of culture, the cells were fixed, stained and mounted upside-down on a glass microscope slide. Invasion was determined by counting the number of cells that invaded through the thin layer of Matrigel precoated on top of the porous (8pm) filter and that had migrated through the pours to its underside in 3 randomly selected fields of a light microscope. E V T s cultured in the presence of transfection reagent alone (con) were given an arbitrary invasion index =1.0. Each cell line was plated in triplicate wells with the experiment being repeated on at least 3 independent occasions (n=3). The results are presented as mean + S . E . M . in the bar graph (*= P < 0.05, compared to E V T control (con)). 157 > > it-t ADAMTS-6/GAPDH arbitrary units 0 o o o O H M W » t ADAMTS-4/GAPDH ADAMTS-2/GAPDH ADAMTS-1/GAPDH arbitrary units arbitrary units arbitray units d p O O O O M H H r-• K F F t > -t I I ADAMTS-12/GAPDH AD AMTS-7/GAPDH arbitrary units arbitrary units • Figure 2.2.8 Exogenous ADAMTS-12 expression specifically increases the invasive capacity of JEG-3 cell, independent of its intrinsic proteolytic activity. Western blot analysis of the expression levels of (A) A D A M T S - 1 2 in JEG-3 cells stably transfected with p c D N A 3 - A D A M -TS-12 or pcDNA3-Lac Z , (B) A D A M T S - 1 2 in JEG-3 cells stably transfected p c D N A 3 - A D A M -TS-12, p c D N A 3 - A D A M - T S - 1 2 - M U T or p c D N A 3 - L a c Z or (C) A D A M T S - 1 in JEG-3 cells stably transfected with p c D N A 3 - A D A M - T S - l or pcDNA3-Lac Z . Expression levels o f each A D A M T S subtype were standardized to P-actin using densitometry. The relative electrophoretic mobilities of the molecular weight markers (kDa) are shown to the left of the immunoblot. Invasion assays were also performed using these cell lines (A-C). The results of each analysis, performed as described above, are presented as mean + S . E . M ; n> 10 in the bar graphs (*= P < 0.05, where * denotes a significantly different value compared to LacZ). 160 Invasion Index O » * N W » U I Q l N J 0 0 j i i i i i i i i ADAMTS-12/ACTIN arbitrary unit o o o o o o o o o OMfcjwj i inaNia i iD pcDNA3 -LacZ p c D N A 3 - A D A M - T S - l 163 Figure 2.2.9 Exogenous ADAMTS-12 does not alter cellular aggregation. JEG-3 cells were stably transfected with p c D N A 3 - A D A M - T S 1 2 (A12FL) , p c D N A 3 - A D A M - T S 1 2 -M U T (A12Mut) or p c D N A 3 - L a c Z (LacZ). Cells in single-cell suspensions (20pl) were pipetted onto the underside of 60mm plate lids and incubated for 2, 4 or 8h at 37°C in a humidified cell incubator as hanging droplets. Afterwards, culture plate lids were inverted, and a glass cover slip was mounted onto the 20ul droplet. Cellular aggregates were then visualized through an inverted microsope (200X magnification) to qualitatively assess cellular aggregation. Photomicrographs are representatives of hanging drop assays performed in triplicate (n=3). 164 LacZ A12FL A12Mut 165 Figure 2.2.10 Cell-extracellular matrix binding affinities are altered in JEG-3 cells exogenously expressing ADAMTS-12. JEG-3 cells stably transfected with A D A M T S - 1 2 (A12FL) , protease-dead A D A M T S - 1 2 (A12Mut) or LacZ were seeded onto 24-well plates pre-coated with extracellular matrices deposited by the same JEG-3 cell lines in a combinatorial fashion. Cells were cultured at 37°C in a humidified cell culture chamber (5% CO2) for 30min. After incubation, cells were flushed with P B S and fixed in 4% paraformaldehyde and stained with eosin. Uti l iz ing a microscope fitted with a digital camera, 5 fields of view/well (200X magnification) were used to determine the number of cells that had bound to the pre-deposited native E C M . Cells were plated in triplicates and the native ECM-binding experiment was preformed on three independent occasions (n=3; * = P O . 0 5 ) . 166 167 Figure 2.2.11 RGD treatment to JEG-3 cells exogenously expressing ADAMTS-12 significantly reduces their invasive capacity. JEG-3 cells transfected with p c D N A 3 - L a c Z (LacZ), p c D N A 3 - A D A M - T S 1 2 (A12FL) or p c D N A 3 - A D A M - T S 1 2 - M U T (A12Mut) were cultured in Matrigel-coated Transwell invasion chambers in complete D M E M media, complete D M E M media containing a control R G D peptide or complete D M E M media containing an R G D peptide. Cells were allowed to invade through Matrigel-coated Transwell chambers for 48h, after which cells were fixed in 4% paraformaldehyde, stained with eosin and counted under a microscope (200X). Untreated cell lines were given an arbitrary invasion index of 1, and the invasive capacity of cells cultured in the presence of the control R G D or R G D peptide were determined by generating an invasion index corresponding to their control cell line. Cel l transfectants were cultured in Matrigel Transwell chambers in triplicate, and the invasion experiment was performed on three independent occasions (n=3; * = P<0.05, compared to peptide-untreated controls). 168 Invasion Index O O O 0 fcA j* M Table 2.2.1 Primer sequences and P C R conditions for the semiquantitative analysis of m R N A levels for A D A M T S subtypes in human placental tissue and trophoblastic cells. A D A M T S subtype Primer Sequence Estimated PCR product size (bp) PCR conditions ADAMTS-1 Forward: 5 ' - C G A G T G T G C A A A G G A A G T G A - 3 ' Reverse: 5 ' - C T A C C C C A T A A T C C C A C C T - 3 ' 399 Denaturing: 94°C 30s Annealing: 64°C 30s Extension: 72°C 60s 28 cycles ADAMTS-2 Forward: 5 ' - C C T A T G A C T G G C T G C T G G A T - 3 ' Reverse: 5 ' - C T C C C A A A G T G C T G G G A T A A - 3 ' 310 Denaturing: 94°C 30s Annealing: 62°C 30s Extension: 72°C 60s 30 cycles ADAMTS-4 Forward: 5' - A A T C C A G G G T G G T G G T G A T A-3 ' Reverse: 5 ' - T A C T C A G G A G G C T G A G G C A T - 3 ' 349 Denaturing: 94°C 30s Annealing: 60°C 30s Extension: 72°C 60s 30 cycles ADAMTS-5 Forward: 5 ' - G C C C A T G G T A A C T G T T T G C T - 3 ' Reverse: 5' - C C T C T T C C C T G T G C A G T A G C - 3 ' 444 Denaturing: 94°C 30s Annealing: 64°C 30s Extension: 72°C 60s 35 cycles ADAMTS-6 Forward: 5 ' - T G A C A G T C C A G C A C C T T C A G - 3 ' Reverse: 5 ' - G C A G G A G C A C G T T C A G T G T A - 3 ' 249 Denaturing: 94°C 30s Annealing: 55°C 30s Extension: 72°C 60s 30 cycles ADAMTS-7 Forward: 5 ' - C C A T G T G G T G T A C A A G C G T C - 3 ' Reverse: 5 ' -GGTCCTTCCTCCTCATCTTCC-3 ' 389 Denaturing: 94°C 30s Annealing: 58°C 30s Extension: 72°C 60s 35 cycles ADAMTS-9 Forward: 5' - A C C C G G A T G A T G A G A T ACGT-3 ' Reverse: 5' -CC A C A G G T C A C A G A G C A A G A-3 ' 161 Denaturing: 94°C 30s Annealing: 62°C 30s Extension: 72°C 60s 28 cycles ADAMTS-12 Forward: 5 ' - G T G C A G C G A G G A G T A C A T C A - 3 ' Reverse: 5' -GCGTTTTCTTTCTCCAGTGC-3 ' 488 Denaturing: 94°C 30s Annealing: 63°C 30s Extension: 72°C 60s 28 cycles G A P D H Forward: 5 ' - C C C A A T T C T C T A C G G A G T C G - 3 ' Reverse: 5' - A A T C T C C C AGGGTTGCTTCT-3 ' 203 Denaturing: 94°C 45s Annealing: 55°C 30s Extension: 72°C 60s 20 cycles 170 2.3 References Abbaszade, I., L i u , R. Q., Yang, F., Rosenfeld, S. A . , Ross, O. FL, Link, J. R., El l is , D . M . , Tortorella, M . D. , Pratta, M . A . , Holl is , J. M . , Wynn, R., Duke, J. L . , George, H . J., Hil lman, M . C. , Jr., Murphy, K . , Wiswall , B . H . , Copeland, R. A . , Decicco, C. P., Bruckner, R., Nagase, H . , Itoh, Y . , Newton, R. C. , Magolda, R. L . , Trzaskos, J. M . , Burn, T. C. , and et al. (1999). Cloning and characterization of A D A M T S 11, an aggrecanase from the A D A M T S family. J Biol Chem 21 A, 23443-50. Ap l in , J. (1991). Implantation, trophoblast differentiation and haemochorial placentation: mechanistic evidence in vivo and in vitro. J Cell Sci 99, 681-92. Apte, S. (2004). A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motifs: the A D A M T S family. Int J Biochem Cell Biol 36, 981-5. Bayliss, M . , Hutton, S., Hayward, J., and Maciewicz, R. (2001). Distribution of aggrecanase ( A D A M t s 4/5) cleavage products in normal and osteoarthritic human articular cartilage: the influence of age, topography and zone of tissue. Osteoarthritis Cartilage 9, 553-60. Buckley, C , Pi l l ing, D. , Henriquez, N . , Parsonage, G . , Threlfall, K . , Scheel-Toellner, D. , Simmons, D. , Akbar, A . , Lord, J., and Salmon, M . (1999). R G D peptides induce apoptosis by direct caspase-3 activation. Nature 397, 534-9. Burrows, T., K i n g , A . , and Loke, Y . (1996). Trophoblast migration during human placental implantation. Hum Reprod Update 2, 307-21. Cai , S., Arguelles, J., Fernandez, P., and Lopez-Otin, C. (2001). Identification, characterization, and intracellular processing of A D A M - T S 1 2 , a novel disintegrin with a complex structural organization involving mutiple thrombospondin-1 repeats. J Biol Chem 276, 17932-40. Chakraborty, C , Gleeson, L . , McKinnon , T., and Lala, P. (2002). Regulation of human trophoblast migration and invasiveness. Can J Physiol Pharmacol 80, 116-124. Chou, C , Zhu, H . , MacCalman, C , and Leung, P. (2003). Regulatory effects of gonadotropin-releasing hormone (GnRH) I and G n R H II on the levels of matrix metalloproteinase (MMP)-2 , M M P - 9 and tissue inhibitor of metalloproteinases-1 in primary cultures of human extravillous cytotrophoblasts. J Clin Endocrinol Metab 88, 4781-4790. Chou, C , Zhu, H . , Shalev, E . , MacCalman, C , and Leung, P. (2002). The effects of gonadotropin-releasing hormone (GnRH) I and G n R H II on the urokinase-type 171 plasminogen activator/plasminogen activator inhibitor system in human extravillous cytotrophoblasts in vitro. J Clin Endocrinol Metab 87, 5594-603. Chung, H . , Wen, Y . , Ahn , J., Moon, H . , and Polan, M . (2001). Interleukin-lbeta regulates urokinase plasminogen activator (u-PA), u -PA receptor, soluble u -PA receptor, and plasminogen activator inhibitor-1 messenger ribonucleic acid expression in cultured human endometrial stromal cells. J Clin Endocrinol Metab 86, 1332-40. Cohen, M . , Meisser, A . , and Bischof, P. (2005). Metalloproteinases and Human Placental Invasiveness. Placenta 27, 783-93. Colige, A . , Ruggiero, F. , Vandenberghe, I., Dubail, J., Kesteloot, F., Van Beeumen, J., Beschin, A . , Brys, L . , Lapiere, C , and Nusgens, B . (2005). Domains and Maturation Processes That Regulate the Activi ty of A D A M T S - 2 , a Metalloproteinase Cleaving the Aminopropeptide of Fibrillar Procollagens Types I-III and V . JBiol Chem 280, 34397-34408. Cross, J., Werb, Z . , and Fisher, S. (1994). Implantation and the placenta: key pieces of the development puzzle. Science 266, 1508-18. Farina, A . , Vol inia , S., Arcel l i , D. , Francioso, F., Desanctis, P., Zucchini, C , Pi lu , G . , Carinci, P., Morano, D . , Pittalis, M . , Calderoni, P., Vagnoni, S., and Rizzo, N . (2006). Evidence of genetic underexpression in chorionic v i l l i samples of euploid fetuses with increased nuchal translucency at 10-11 weeks' gestation. Prenat Diagn26, 128-33. Gao, G . , Plaas, A . , Thompson, V . , Jin, S., Zuo, F., and Sandy, J. (2004). A D A M T S 4 (aggrecanase-1) activation on the cell surface involves C-terminal cleavage by glycosylphosphatidyl inositol-anchored membrane type 4-matrix metalloproteinase and binding of the activated proteinase to chondroitin sulfate and heparan sulfate on syndecan-1. J Biol Chem 279, 10042-51. Gao, G . , Westling, J., Thompson, V . , Howell , T., Gottschall, P., and Sandy, J. (2002). Activation of the proteolytic activity of A D A M T S 4 (aggrecanase-1) by C-terminal truncation. JBiol Chem 211, 11034-41. Getsios, S., Amargo, E . , Dusek, R., Ishii, K . , Godsel, L . , and Green, K . (2004). Coordinated expression of desmoglein 1 and desmocollin 1 regulates intercellular adhesion. Differentiation 12, 419-33. Getsios, S., Chen, G . , Huang, D . , and MacCalman, C. (1998). Regulated expression of cadherin-11 in human extravillous cytotrophoblasts undergoing aggregation and fusion in response to transforming growth factor beta 1. J Reprod Fertil 114, 357-63. 172 Glasson, S., Askew, R., Sheppard, B . , Carito, B . , Blanchet, T., M a , H . , Flannery, C , Kanki , K . , Wang, E . , Peluso, D . , Yang, Z . , Majumdar, M . , and Morris, E . (2004). Characterization of and osteoarthritis susceptibility in ADAMTS-4-knockou t mice. Arthritis Rheum 50, 2547-58. Glasson, S., Askew, R., Sheppard, B . , Carito, B . , Blanchet, T., M a , H . , Flannery, C , Peluso, D . , Kanki , K . , Yang, Z . , Majumdar, M . , and Morris, E . (2005). Deletion of active A D A M T S 5 prevents cartilage degradation in a murine model of osteoarthritis. Nature 434, 644-8. Gospodarowicz, D . , Hirabayashi, K . , Giguere, L . , and Tauber, J. (1981). Factors controlling the proliferative rate, final cell density, and life span of bovine vascular smooth muscle cells in culture. J Cell Biol 89, 568-78. Graham, C , Hawley, T., Hawley, R., MacDougall , J., Kerbel, R., Khoo, N . , and Lala, P. (1993). Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res 206, 204-11. Graham, C , Lysiak, J., McCrea, K . , and Lala, P. (1992). Localization of transforming growth factor-beta at the human fetal-maternal interface: role in trophoblast growth and differentiation. Biol Reprod 46, 561-72. Hanahan, D . , and Weinberg, R. (2000). The hallmarks of cancer. Cell 100, 57-70. Hashimoto, G . , Shimoda, M . , and Okada, Y . (2004). A D A M T S - 4 (aggrecanase-1) interaction with the C-terminal domain of fibronectin inhibits proteolysis of aggrecan. JBiol Chem 279, 32483-32491. Held-Feindt, J., Paredes, E . , Blomer, U . , Seidenbecher, C , Stark, A . , Mehdorn, H . , and Mentlein, R. (2005). Matrix-degrading proteases A D A M T S 4 and A D A M T S 5 (disintegrins and metalloproteinases with thrombospondin motifs 4 and 5) are expressed in human glioblastomas. Int J Cancer 118, 55-61. Huang, H . , Wen, Y . , Irwin, J., Kruessel, J., Soong, Y . , and Polan, M . (1998). Cytokine-mediated regulation of 92-kilodalton type IV collagenase, tissue inhibitor or metalloproteinase-1 (TIMP-1), and TIMP-3 messenger ribonucleic acid expression in human endometrial stromal cells. J Clin Endocrinol Metab 83, 1721-9. Hurskainen, T., Hirohata, S., Seldin, M . , and Apte, S. (1999). A D A M - T S 5 , A D A M - T S 6 , and A D A M - T S 7 , novel members of a new family of zinc metalloproteases. General features and genomic distribution of the A D A M - T S family. J Biol Chem 274, 25555-63. 173 Kang, Y . , Siegel, P., Shu, W. , Drobnjak, M . , Kakonen, S., Cordon-Cadro, C , Guise, T., and Massague, J. (2003). A multigenic program mediating breast cancer metastasis to bone. Cancer Cell 3, 537-549. Kuno, K . , Bannai, K . , Hakozaki, M . , Matsushima, K , and Hirose, K . (2004). The carboxyl-terminal half region of A D A M T S - 1 suppresses both tumorigenicity and experimental tumor metastatic potential. Biochem Biophys Res Commun 319, 1327-33. Kuno, K . , Kanada, N . , Nakashima, E . , Fujiki, F., Ichimura, F., and Matsushima, K . (1997). Molecular cloning of a gene encoding a new type of metalloproteinase-disintegrin family protein with thrombospondin motifs as an inflammation associated gene. J Biol Chem 272, 556-62. Kuno, K . , and Matsushima, K . (1998). A D A M T S - 1 protein anchors at the extracellular matrix through the thrombospondin type I motifs and its spacing region. J Biol Chem 273, 13912-7. Levy, G. , Nichols, W. , Lian, E . , Foround, T., McClin t ick , J., McGee, B . , Yang, A . , Siemieniak, D. , Stark, K . , Gruppo, R., Sarode, R., Shurin, S., Chandrasekaran, V . , Stabler, S., Sabio, FL, Bouhassira, E . , Upshaw, J. J., Ginsburg, D. , and Tsai, H . (2001). Mutations in a member of the A D A M T S gene family cause thrombotic thrombocytopenic purpura. Nature 413, 475-6. L i , S., Arita, M . , Fertala, A . , Bao, Y . , Kopen, G . , Langsjo, T., Hyttinen, M . , Helminen, FL, and Prockop, D . (2001). Transgenic mice with inactive alleles for procollagen N-proteinase ( A D A M T S - 2 ) develop fragile skin and male sterility. Biochem J 355, 271-8. Little, C. , Mittaz, L . , Belluoccio, D . , Rogerson, F., Campbell, I., Meeker, C , Bateman, J., Pritchard, M . , and Fosang, A . (2005). ADAMTS-1-knockou t mice do not exhibit abnormalities in aggrecan turnover in vitro or in vivo. Arthritis Rheum 52, 1461-72. L i u , C , Kong, W. , X u , K . , Luan, Y . , Ilalov, K . , Sehgal, B . , Y u , S., Howell , R., and D i Cesare, P. (2006). A D A M T S - 1 2 associates with and degrades cartilage oligomeric matrix protein. J Biol Chem 281, 15800-8. L i u , Y . , X u , Y . , and Tu, Q. (2006). Full-length A D A M T S - 1 and the A D A M T S - 1 fragments display pro- and antimetastatic activity, respectively. Oncogene 25, 2452-67. Llamazares, M . , Cai , S., Quesada, V . , and Lopez-Otin, C. (2003). Identification and characterization of A D A M T S - 2 0 defines a novel subfamily of metalloproteinases-disintegrins with multiple thrombospondin-1 repeats and a unique G O N domain. J Biol Chem 278, 13382-9. 174 Lorch, J., Klessner, J., Park, J., Getsios, S., Wu , Y . , Stack, M . , and Green, K . (2004). Epidermal growth factor receptor inhibition promotes desmosome assembly and strengthens intercellular adhesion in squamous cell carcinoma cells. J Biol Chem 279,37191-200. Luque, A . , Carpizo, D. , and Iruela-Arispe, M . (2003). A D A M T S 1/METH1 inhibits endothelial cell proliferation by direct binding and sequestration of V E G F 1 6 5 . J Biol Chem 278, 23656-65. MacCalman, C , Furth, E . , Omigbodun, A . , Bronner, M . , Coutifaris, C. , and Strauss, J. r. (1996). Regulated expression of cadherin-11 in human epithelial cells: a role for cadherin-11 in trophoblast-endometrium interactions? Dev Dyn 206, 201-11. MacCalman, C , Getsios, S., and Chen, G . (1998). Type 2 cadherins in the human endometrium and placenta: their putative roles in human implantation and placentation. Am J Reprod Immunol 39, 96-107. Madan, P., Bridges, P., Komar, C , Beristain, A . , Rajamahendran, R., Fortune, J., and MacCalman, C. (2003). Expression of messenger R N A for A D A M T S subtypes changes in the periovulatory follicle after the gonadotropin surge and during luteal development and regression in cattle. Biol Reprod 69, 1506-14. Masui, T., Hosotani, R., Tsuji, S., Miyamoto, Y . , Yasuda, S., Ida, J., Nakajima, S., Kawaguchi, M . , Kobayashi, H . , Toyoda, E . , Tulachan, E . , A r i i , S., Do i , R., and Imamura, M . (2001). Expression of M E T H - 1 and M E T H - 2 in pancreatic cancer. Clin Cancer Res 7, 3437-43. Miguel , R., Pollak, A . , and Lubec, G . (2005). Metalloproteinase A D A M T S - 1 but not A D A M T S - 5 is manifold overexpressed in neurodegenerative disorders as Down syndrome, Alzheimer's and Pick's disease. Brain Res Mol Brain Res 133, 1-5. Mittaz, L . , Russell, D . , Wilson, T., Brasted, M . , Tkalcevic, J., Salamonsen, L . , Hertzog, P., and Pritchard, M . (2004). Adamts-1 is essential for the development and function of the urogenital system. Biol Reprod 70, 1096-105. Nagase, H . , and Kashiwagi, M . (2003). Aggrecanases and cartilage matrix degradation. Arthritis Res Ther 5, 94-103. Pijnenborg, R., Dixon, G . , Robertson, W. , and Brosens, I. (1980). Trophoblastic invasion of human decidua from 8 to 18 weeks of pregnancy. Placenta 1, 3-19. Poehlmann, T., Fitzgerald, J., Meisser, A . , Wengenmayer, T., Schleussner, E . , Friedrich, K . , and Markert, U . (2005). Trophoblast invasion: tuning through LIF , signalling via Stat3. Placenta 26, S37-41. 175 Porter, S., Clark, I., Kevorkian, L . , and Edwards, D . (2005). The A D A M T S metalloproteinases. Biochem J 386, 15-27. Porter, S., Scott, S., Sasson, E . , Will iams, M . , Jones, J., Girl ing, A . , Ba l l , R., and Edwards, D . (2004). Dysregulated expression of adamalysin-thrombospondin genes in human breast carcinoma. Clin Cancer Res 10, 2429-40. Porter, S., Span, P., Sweep, F., Tjan-Heijnen, V . , Pennington, C , Pedersen, T., Johnson, M . , Lund, L . , Romer, J., and Edwards, D . (2006). A D A M T S 8 and A D A M T S 15 expression predicts survival in human breast carcinoma. Int J Cancer 118, 1241-7. Red-Horse, K , Zhou, Y . , Genbacev, O., Prakobphol, A . , McMaster, M . , and Fisher, S. (2004). Trophoblast differentiation during embryo implantation and formation of the maternal-fetal interface. J Clin Invest 114, 744-54. Richards, J., Hernandez-Gonzalez, I., Gonzalez-Robavna, I., Teuling, E . , Lo , Y . , Boerboom, D. , Falender, A . , Doyle, K . , LeBaron, R., Thompson, V . , and Sandy, J. (2005). Regulated expression of A D A M T S family members in follicles and cumulus oocyte complexes: evidence for specific and redundant patterns during ovulation. Biol Reprod 12, 1241-55. Rocks, N . , Paulissen, G . , Quesada Calvo, F., Polette, M . , Gueders, M . , Munaut, C , Foidart, J., Noel , A . , Birembaut, P., and Cataldo, D . (2006). Expression of a disintegrin and metalloprotease ( A D A M and A D A M T S ) enzymes in human non-small-cell lung carcinomas ( N S C L C ) . Br J Cancer 94, 724-30. Rodriguez-Manzaneque , J., Milchanowski, A . , Dufour, E . , Leduc, R., and Iruela-Arispe, M . (2000). Characterization of M E T H - 1 / A D A M T S 1 processing reveals two distinct active forms. J Biol Chem 275, 33471-9. Roemer, A . , Schwettmann, L . , Jung, M . , Roigas, J., Kristiansen, G . , Schnorr, D . , Loening, S., Jung, K . , and Lichtinghagen, R. (2004). Increased m R N A expression of A D A M s in renal cell carcinoma and their association with clinical outcome. Oncol Rep 11, 529-36. Shindo, T., Kurihara, H . , Kuno, K . , Yokoyama, H . , Wada, T., Kuihara, Y . , Imai, T., Wang, Y . , Ogata, M . , Nishinatsu, H . , Moriyama, N . , Oh-hashi, Y . , H , M . , Ishikawa, T., Nagai, R., Yazaki , Y . , and Matsushima, K . (2000). A D A M T S - 1 : a metalloproteinase-disintegrin essential for normal growth, fertility, and organ morphology and function. J Clin Invest 105, 1334-52. Shozu, M . , Minami , N . , Yokoyama, H . , Inoue, M . , Kurihara, H . , Matsushima, K . , and Kuno, K . (2005). A D A M T S - 1 is involved in normal follicular development, ovulatory process and organization of the medullary vascular network in the ovary. J Mol Endocrinol 35, 343-55. 176 Somerville, R., Jungers, K . , and Apte, S. (2004). Discovery and characterization of a novel, widely expressed metalloprotease, A D A M T S 10, and its proteolytic activation. J Biol Chem 279, 51208-17. Somerville, R., Longpre, J., Jungers, K . , Engle, J., Ross, M . , Evanko, S., Wight, T., Leduc, R., and Apte, S. (2003). Characterization of A D A M T S - 9 and A D A M T S -20 as a distinct A D A M T S subfamily related to Caenorhabditis elegans G O N - 1 . J Biol Chem 278, 9503-13. Stanton, FL, Rogerson, F. , East, C , Golub, S., Lawlor, K . , Meeker, C , Little, C , Last, K . , Farmer, P., Campbell, I., Fourie, A . , and Fosang, A . (2005). A D A M T S 5 is the major aggrecanase in mouse cartilage in vivo and in vitro. Nature 4 3 4 , 648-52. Tang, B . (2001). A D A M T S : a novel family of extracellular matrix proteases. Int J Biochem Cell Biol 3 3 , 33-44. Tsai, H . (2002). V o n Willebrand factor, A D A M T S 13, and thrombotic thrombocytopenic purpura. J Mol Med 80, 639-47. Vazquez, F., Hastings, G . , Ortega, M . , Lane, T., Oikemus, S., Lombardo, M . , and Iruela-Arispe, M . (1999). M E T H - 1 , a human ortholog of A D A M T S - 1 , and M E T H - 2 are members of a new family of proteins with angio-inhibitory activity. J Biol Chem 274, 23349-57. X u , G . , Guimond, M . , Chakraborty, C , and Lala, P. (2002). Control of proliferation, migration, and invasiveness of human extravillous trophoblast by decorin, a decidual product. Biol Reprod 67, 681-9. Zhou, Y . , Fisher, S., Janatpour, M . , Genbacev, O., Dejana, E . , Wheelock, M . , and Damsky, C. (1997a). Human cytotrophoblasts adopt a vascular phenotype as they differentiate. A strategy for successful endovascular invasion? J Clin Invest 99, 2139-51. 177 C H A P T E R 3: C H A R A C T E R I Z I N G T H E M O L E C U L A R M E C H A N I S M S I N V O L V E D IN ADAMTS-12-MEDIATED C E L L INVASION 3.1 Preface Findings stemming from the data described in chapter 2 led me to investigate possible molecular mechanisms by which A D A M T S - 1 2 elicits an invasive phenotype in trophoblastic cells. I had previously shown that E C M interactions were modified in trophoblastic cells exogenously expressing A D A M T S - 1 2 . This finding, and the observation that A D A M T S - 1 2 promoted an invasive phenotype through a non-catalytic mechanism, prompted me to investigate whether changes in integrin expression and function due to A D A M T S - 1 2 expression facilitated the invasive phenotype in trophoblastic cells. M y studies demonstrated that the av(53 integrin, an integrin heterodimer previously shown to promote invasion in human trophoblasts (Zhou et al, 1997a), was significantly up-regulated in trophoblastic cells exogenously expressing A D A M T S - 1 2 . Furthermore, perturbing ctvp3 integrin function attenuated the invasive phenotype associated with A D A M T S - 1 2 expression. This study is the first to demonstrate a link between A D A M T S and integrin function. Furthermore, the work accomplished in this study provides key insight into elucidating the complex molecular mechanism(s) that members of the A D A M T S family utilize. 178 3.2 ADAMTS-12 promotes an invasive phenotype in trophoblastic cells by upregulating av(33 integrin expression and function. Introduction The development of the human placenta is dependent upon the ability of subpopulations of trophoblasts to develop a highly-invasive phenotype during the first trimester of pregnancy (Bischof et al, 2001). The acquisition of an invasive phenotype allows for specific trophoblast populations, namely extravillous cytotrophoblasts (EVTs) derived from the implanting embryo's chorionic v i l l i , to invade into the maternal endometrium (Aplin, 1991). This developmental process results in the formation of an anchoring E V T column and establishes a continuous blood supply for the fetus by means of endothelial-remodeling of maternal spiral arteries. This invasive process shares similar physical and molecular events to those observed during cancer development, although the events involved in trophoblast invasion are highly regulated. O f the several classes of proteins involved in cell adhesion, the integrins, which link cells to E C M substrates, have been assigned key roles in modulating the invasive and migratory properties of cells (Hanahan and Weinberg, 2000). Integrins are heterodimeric receptors resulting from combinatorial expression of various a- and (5-receptor subunits (DeSimone, 1994). Different integrin heterodimer combinations allow for cells to acquire distinct E C M substrate preferences, and studies have shown in both cancer and 179 trophoblast models that integrins regulate invasive phenotype. Zhou et al (1997a) demonstrated that E V T s adopt a vascular integrin phenotype, demonstrated in part by highly-invasive E V T expression of the av(33 integrin. Further studies demonstrated that function-perturbing antibodies specific to the a v integrin subunit and av(33 subtype, as well as R G D blocking peptides, inhibit E V T invasion (Zhou et al, 1997a; Kabir-Salmani et al, 2003). Furthermore, the importance of E V T s adopting a vascular phenotype characterized by the expression of specific integrin subtypes is accentuated by the finding that in preeclampsia, an aberrant condition of pregnancy associated with a poorly-invasive placenta, the avP3 integrin heterodimer is not expressed (Zhou et al, 1997b). A D A M T S (A Disintegrin A n d Metalloproteinase with ThromboSpondin-like repeats) are a novel family of secreted zinc-dependent metalloproteinases that have been shown to play key roles in a number of developmental processes and in the progression of matrix-degrading diseases (Apte, 2004). I have recently demonstrated that A D A M T S - 1 2 , an A D A M T S subtype, promotes an invasive phenotype in human trophoblastic cells through a proteinase-independent mechanism. Initial studies attempting to characterize the molecular mechanism(s) by which A D A M T S - 1 2 elicits an invasive phenotype demonstrated that trophoblastic cells expressing either exogenous full length A D A M T S -12 or a full length proteinase-dead mutant A D A M T S - 1 2 adhered to their ECM-deposited substratum more efficiently than trophoblastic cells not expressing exogenous A D A M T S -12. In addition to this finding, we also demonstrated that treating trophoblastic cells expressing A D A M T S - 1 2 with an R G D peptide significantly inhibited the increase in invasive phenotype associated with exogenous A D A M T S - 1 2 expression. Taken 180 together, these data suggest that trophoblastic cells exogenously expressing A D A M T S - 1 2 express a different integrin profile to untransfected cells, and this difference in integrin expression appears to control trophoblast invasive phenotype. A D A M T S - 1 2 has been described as a secreted protein that associates with the E C M , and it has further been suggested that the ancillary domain(s) of A D A M T S - 1 2 binds to specific E C M proteins and influences substrate specificity (Cai et al, 2001; Apte, 2004). Furthermore, the ancillary domains of specific A D A M T S subtypes have been shown to influence the efficacy of A D A M T S function (Flannery et al, 2002; Gao et al, 2004; Colige et al, 2005). In view of these observations and my previous findings that suggest A D A M T S - 1 2 controls cellular phenotype through a mechanism independent of its catalytic domain, I wished to determine whether A D A M T S - 1 2 could modulate the expression and/or function of specific integrins and whether these changes in integrin expression/function correlate with an invasive phenotype. In this study I describe the ability of exogenous A D A M T S - 1 2 in poorly-invasive JEG-3 choriocarcinoma cells to alter cell binding affinities to specific E C M proteins and increase the expression and function of the avP3 integrin heterodimer. I further demonstrate through function perturbing studies that the increase in ocvp3 function is directly related to the increase in invasive phenotype associated with exogenous A D A M T S - 1 2 expression. 181 Materials and Methods Tissues. Samples of first trimester placental tissues were obtained from women undergoing elective termination of pregnancy (gestational ages ranging from 6-12 weeks). The use of these tissues was approved by the Committee for Ethical Review of Research on the use of Human Subjects, University of British Columbia, Vancouver, B C , Canada. A l l women provided informed written consent. Cells. Cultures of E V T s were propagated from first trimester placental explants as previously described (Getsios et al, 1998). Briefly, chorionic v i l l i were washed three times in P B S . 2 * * The v i l l i were minced finely and plated in 25cm tissue culture flasks containing Dulbecco's Modified Eagle's Medium ( D M E M ) containing 25 m M glucose, L -glutamine, antibiotics (lOOU/ml penicillin, 100 ug/ml streptomycin) and supplemented with 10% fetal bovine serum (FBS). The fragments of the chorionic v i l l i were allowed to adhere for 2-3 d, after which any non-adherent tissue was removed. The villous explants were cultured for a further 10-14d with the culture medium being replaced every 48h. The E V T s were separated from the villous explants by a brief (2-3min) trypsin digestion at 37°C and plated in 60 m m 2 culture dishes in D M E M supplemented with antibiotics and 10% F B S . The purity of the E V T cultures was determined by immunostaining with a monoclonal antibody directed against human cytokeratin filaments 8 and 18 (Sigma 182 Aldrich, St Louis, M O , U S A ) according to the methods of MacCalman et al. (1996). Only cell cultures that exhibited 100% immunostaining for cytokeratin were included in these studies. JEG-3 choriocarcinoma cells were purchased from A T C C (Manassas, V A , U S A ) . On-going cultures were maintained in D M E M containing 25 m M glucose, L-glutamine, antibiotics (lOOU/ml penicillin, 100 pg/ml streptomycin) and supplemented with 10% F B S . Prior to experimental procedures, E V T s and JEG-3 choriocarcimona cell transfectants were cultured for at least 24h on a thin layer of pre-coated Matrigel (BD Biosciences) diluted 1:3 (vol/vol) in D M E M and cultured in the D M E M media described above. Expression Vectors. Mammalian expression vectors (pcDNA3.1; Invitrogen, Carlsbad, C A ) containing either a full-length human A D A M T S - 1 2 c D N A ( p c D N A 3 - A D A M - T S 12-HA) or a full-length human A D A M T S - 1 2 c D N A in which the catalytic domain had been inactivated by site directed mutagenesis ( p c D N A 3 - A D A M - T S 1 2 - M U T ) were generously provided by Dr. S. Cai (Universidad de Oviedo, Spain). These c D N A constructs have been described in detail elsewhere (Cai et al, 2001). For the generation of the A D A M - T S 1 2 - M U T c D N A construct, two point mutations in the metalloproteinase domain were performed by P C R -based mutagenesis. Specifically, the thymine (465) and adenine (466) in the metalloproteinase domain where substituted for adenine and cytosine, which results in the 183 translated protein consisting of a glucine amino acid instead of histidine, thus rendering the protein catalytically inactive (Cal et al, 2001). A pcDNA3.1 expression vector containing the p-galactosidase gene (pcDNA3-LacZ; Invitrogen) was used to determine transfection efficiency and also served as a control for these studies. Generation of stably transfected J E G - 3 cell lines. JEG-3 choriocarcinoma cells were transfected with expression vectors p c D N A 3 - A D A M -TS 12, p c D N A 3 - A D A M - T S 1 2 - M U T or pcDNA3-LacZ . Briefly, 1.2 x 10 5 JEG-3 cells were plated onto 6-well plates and were cultured for 24h in complete D M E M containing 10% F B S . After 24h, cells were transfected with l u g of plasmid D N A using Exgen 500 transfection reagent following the manufacturers protocol. After a further 24h incubation in a humidified incubator at 37°C, 5% CO2, JEG-3 cell culture media was replaced with complete D M E M containing 10% F B S and 400ug/ml G418 antibiotic. Cells were selected and maintained in this media for the remainder of these studies. A t least three independent clones were selected per construct based solely on expression levels of the exogenous protein, as determined by Western blot analysis. 184 E C M Cell Adhesion Assay. A fluorimetric E C M cell adhesion array kit (Chemicon International) allowed us to screen for and quantitate the binding affinity of cells to 7 different human E C M proteins. Collagen I, collagen II, collagen IV, fibronectin, laminin, tenascin, and vitronectin were pre-coated onto 96-well microtiter plates arranged in 12 x 8-well strips. In each 8-well strip, one BSA-coated well served as a negative control. Following the manufacturers instructions, we seeded 1 X 10 5 cells suspended in D M E M (100ul) onto the coated E C M -subtrates and analysed for the cells ability to bind to the respective E C M proteins using a fluorescence plate reader (485/530nm). The plating of a trophoblastic cells onto 8-well E C M protein coated strips was performed on three independent occasions (n=3). Alpha and Beta Integrin Functional Binding Assay. A fluorimetric Alpha/Beta Integrin-Mediated Cel l Adhesion Array Combo K i t was obtained from Chemicon International. The kit is comprised of two 96-well plates, an alpha-integrin binding 96-well plate, and a beta-integrin 96-well plate. Each kit uses mouse monoclonal antibodies generated against human alpha ( a l , a2, a3 , a4, a5, av, avp3), and beta ( p i , P2, P3, P4, P6, avp5, a 5 p i ) integrins/subunits, that are immobilized onto goat-anti-mouse antibody coated microtiter plates. Goat anti-mouse antibody coated wells served as negative assay controls. The plate is used to capture cells seeded onto the coated surfaces expressing the respective integrins on their surface. Following the manufacturers protocol, 1 X 10 5 cells suspended in D M E M (lOOpl) were 185 plated into the 96-wells and incubated for 2h. Unbound cells were washed away, and adherent cells were lysed and integrin binding function/expression was detected using a fluorescent dye provided with the integrin binding kit using a fluorescence plate reader (485/530nm). Integrin binding assays, as assessed by culturing transfected cells in 8-well integrin-binding strips, were performed on three independent occasions (n=3). Generation of first-strand cDNA. Total R N A was prepared from cultures of E V T s or JEG-3 cells using an RNeasy M i n i K i t (Qiagen, Inc, C A ) following a protocol recommended by the manufacturer. The total R N A extracts were then treated with Deoxyribonuclease-1 to eliminate possible contamination with genomic D N A . To verify the integrity of the R N A , aliquots of the total R N A extracts electrophoresed in a 1% (w/v) denaturing agarose gel containing 3.7 % (v/v) formaldehyde and the 28 S and 18 S ribosomal R N A subunits visualized by ethidium bromide staining. The purity and concentration of total R N A present in each of the extracts were determined by optical densitometry (2607280nm) using a Du-64 U V -spectrophotometer (Beckman Coulter, Mississauga, O N , Canada). Aliquots (~1 ug) of the total R N A extracts prepared from trophoblastic cells were then reverse-transcribed into c D N A using a First Strand c D N A Synthesis K i t according to the manufacturer's protocol (Amersham Pharmacia Biotech, Oakville, O N , Canada). 186 Primer design and preparation. Primers specific for A D A M T S - 1 2 and the av , a3, and (33 integrin subunits were generated using Primer3 software and the integrin subunits c D N A coding sequence obtained from the N C B I nucleotide public database. 5' and 3' primer sets for each integrin subtype and primers specific for the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase ( G A P D H ) , were synthesized at the N A P s Unit, The University of British Columbia. The specific nucleotide sequences of these primers are listed in Table 1. Primer specificity was determined by P C R using the primers described above and subcloning the resultant per products generated from human E V T or JEG-3 cell c D N A into the PCRII cloning vector by blunt-end ligation (Invitrogen, Carlsbad, C A , U S A ) . Vectors were subsequently subjected to nucleotide sequence analysis to confirm the presence of integrin subtype. Semiquantitative P C R analysis. Semiquantitative P C R was performed using the primer sets specific for A D A M T S - 1 2 and av, a3 , and P3 integrin subunits or G A P D H , and template c D N A generated from the total R N A extracts prepared from cultures of transfected JEG-3 cells or E V T s . The cycles were repeated 20-40 times to determine a linear relationship between the yield of P C R products from representative samples of these trophoblastic cells and the number of 187 cycles performed. The optimized conditions and number of cycles subsequently used to amplify the integrin subtypes and G A P D H are listed in Table 1. A l l P C R reactions were performed on 3 separate occasions. P C R was also performed using the primer sets specific for the distinct integrin subtypes and aliquots of total R N A extracts prepared from the trophoblastic cells (i.e. non-transcribed R N A ) or D E P C -treated water under the same conditions as described above. These P C R reactions, which served as negative controls, did not yield any P C R products confirming the purity of the total R N A extracts used in these studies (data not shown). Aliquots (20 /A) of the P C R products generated from the trophoblastic cells were separated by electrophoresis in a 1.2% agarose gel and visualized by ethidium bromide staining. Western blot analysis. Cultures of JEG-3 cells or E V T s were washed three times in P B S and incubated in 100 pl of cell extraction buffer (Biosource International, Camarillo, C A ) supplemented with 1.0 m M P M S F and proteinase-inhibitor cocktail for 30 minutes on a rocking platform. The cell lysates were centrifuged at 10, 000 x g for 30 minutes at 4 °C and the supernatants used for Western blot analysis. The concentration of protein in the cell lysates was determined using the B C A kit (Pierce Chemicals, Rockford, IL). Western blots containing aliquots (20 ug) of the cell lysates were prepared as previously described 188 (Getsios et al, 1998) and immunoblotted with a polyclonal antibody directed against A D A M T S - 1 2 (SantaCruz Biotechnologies), a monoclonal antibody directed against the av integrin subunit (Chemicon International), or a monoclonal antibody directed against the p3 integrin subunit (Chemicon International). To standardize the amounts of protein loaded in each lane, the blots were reprobed with a monoclonal antibody directed against human P-actin (Sigma). The Amersham E C L system was used to detect the amount of each antibody bound to antigen. siRNA transfection. s i R N A oligonucleotide duplexes (Xeragon Inc, Germantown, M D ; 13.5 ug/100 mm plate) targeting human A D A M T S - 1 2 m R N A ( 5 ' - A A G C C C G T C C C T C C A C C T A C A - 3 ' ) or a nonspecific R N A (5'- A T T T C T C C G A A C G T G T C A C G T - 3 ' ) , which served as a negative control in these studies, were transfected into E V T s using oligofectamine reagent (Invitrogen). The concentrations of oligonucleotides used in these experiments were selected on the basis of previous studies. Verification of A D A M T S - 1 2 knockdown in E V T s was determined by analyzing A D A M T S - 1 2 m R N A and protein levels using semiquantitative R T - P C R and Western blot analysis. Following optimization of the culture conditions, all experiments were performed with E V T s transfected with the A D A M T S - 1 2 or scrambled control s i R N A oligonucleotide duplexes for 24 h. 189 ocvp3 integrin function-perturbing Transwell invasion assay. A synthetic bicyclic R G D peptide (H-Glu[cyclo(Arg-Gly-Asp-D-Phe-Lys)]2; Peptides International) was used to inhibit the function of av(33 integrin. This bicyclic R G D peptide has been previously shown to possess high affinity towards avP3 integrin (IC50 = 0.9nM) with low affinity for avP5 and an B p3 integrins (IC50 =10nM; Janssen et al, 2002) . The synthetic peptide cyclo (Arg-Ala-Asp-D-Phe-cys; Peptides International) was used as a negative control. In addition to the R G D peptides, a monoclonal a v integrin antibody (Chemicon International) was used to inhibit integrin function (Burdick et al, 2003) . Cellular invasion assays were performed using Transwells fitted with Mil l ipore Corp. membranes coated with a thin layer of growth factor-reduced Matrigel (6.5mm filters, 8pm pore size, Costar, Toronto, O N , Canada). Briefly, transfected JEG-3 cells and E V T s were plated at 2 x 10 4 cells/1 OOul in D M E M supplemented with 10% F B S in the upper wells of Transwell invasion chambers. Complete D M E M media in the upper and lower wells contained 5 n M of cyclic R G D or control R G D peptide, av integrin monoclonal antibody (1:50 dilution) or D M E M media alone. Prior to culturing cells in Transwells, cells were pre-treated with the antibody, bicyclic R G D or control R G D peptide for 30min in media cell-suspensions containing the peptides (5% CO2, at 37°C). Invasion assays were performed for 24h (EVT) or 48h (JEG-3) in a humidified environment (5% CO2) at 37°C. After incubation, cells from the upper surface of the matrigel were completely removed with gentle swabbing. The remaining cells which had invaded into the matrigel were fixed and stained using a Diff-Quik Stain kit (Dade A G , Dudingen, Switzerland) according to a protocol provided by the manufacturer. The 190 membranes were then rinsed with water, cut from the Transwells, and mounted upside-down onto glass slides. Invasion indices were determined by counting the number of stained cells on the membranes in 10 randomly selected, non-overlapping fields at x 400 magnification using a light microscope. Control cells not treated with either the R G D or control R G D peptide were assigned an arbitrary invasion index of 1, and the invasive indices of cells treated with the peptides were subsequently calculated based on the control index. Each cell culture was tested in triplicate wells, on three independent occasions. Statistical analysis. The absorbance values obtained from the ethidium bromide stained gels, autoradiograms generated from Western blotting or fluorescent absorbance readings obtained from an automated 96-well plate reader were subjected to statistical analysis using GraphPad Prism 4 computer software (San Diego, C A , U S A ) . Statistical differences between the absorbance values were assessed by the analysis of variance ( A N O V A ) . Significant differences between the means were determined using Dunnett's test (Getsios et al, 1998; Chou et al, 2002). Differences were considered significant for P < 0.05. Cellular invasion was analysed by one-way A N O V A followed by the Tukey multiple comparison test ( X u et al, 2002). Differences were accepted as significant at P <0.05. 191 Results Exogenous expression of ADAMTS-12 in JEG-3 trophoblastic cells is characterized by different E C M protein-binding affinities A fluorimetric E C M cell adhesion array kit was used to determine the differences in E C M protein-binding affinities between JEG-3 trophoblastic cells transfected with p c D N A 3 - L a c Z (LacZ), p c D N A 3 - A D A M - T S 1 2 (A12FL) or p c D N A 3 - A D A M - T S 1 2 -M U T (A12Mut). In this experiment, wildtype E V T s isolated from first trimester chorionic villous explants served as a biological control for integrin binding affinities associated with invasive trophoblastic cells. E V T s were shown to bind with significant affinity to all the E C M proteins analysed (Figure 3.2.1). However, E V T s were shown to bind with the greatest affinity to collagen II and fibronectin, and with modest affinity to collagen I, collagen IV, laminin, tenascin and vitronectin (Figure 3.2.1). JEG-3 choriocarcinoma cells transfected with p c D N A 3 - L a c Z were shown to bind with significant affinity to collagen I, collagen II, fibronectin, laminin and tensacin. However, these cells did not bind with significant affinity to collagen IV or vitronectin as determined by comparing cell-binding affinities to pre-coated B S A controls (Figure 3.2.1). p c D N A 3 - L a c Z transfected cells bound to tenascin and fibronectin with significantly greater affinity than did E V T s . JEG-3 choriocarcinoma cells transfected with p c D N A 3 - A D A M - T S 1 2 or p c D N A 3 - A D A M - T S 1 2 - M U T were demonstrated to bind with significant affinity to all the E C M proteins analysed compared to the B S A controls 192 (Figure 3.2.1). Both p c D N A 3 - A D A M - T S 1 2 and p c D N A 3 - A D A M - T S 1 2 - M U T transfected JEG-3 cells bound to collagen II, collagen IV and vitronectin with significantly higher affinity, and to tenascin with a significantly lower affinity, than did p c D N A 3 - L a c Z transfected cells. A D A M T S - 1 2 transfected JEG-3 cells also demonstrated similar overall E C M binding affinities to wildtype E V T s (Figure 3.2.1). There were no significant differences in the abilities of the JEG-3 transfectants to bind to collagen I, fibronectin or laminin (Figure 3.2.1). Taken together, these data demonstrate that exogenous A D A M T S - 1 2 expression in JEG-3 cells significantly alters cell-binding to specific E C M proteins. Trophoblastic cells exogenously expressing ADAMTS-12 have an altered integrin-mediated binding ability and up-regulate the expression of av£3 integrin M y finding that A D A M T S - 1 2 transfected cells display different E C M protein-binding affinities to those of LacZ transfected JEG-3 choriocarcinoma cells suggests that changes in c e l l - E C M binding, and specifically changes in integrin expression/function, are occurring. Fluorimetric a and P integrin-mediated cell adhesion array kits were used to analyze potential differences in integrin subtype expression and binding. Immobilized monoclonal alpha ( a l , a2 , a3 , a4, a5, av, avp3) and beta ( p i , P2, P3, P4, P6, avp5, a 5 p i ) integrin/subunit antibodies in 96-well plates allowed for high-throughput analysis of an array of integrin expression and functional binding in JEG-3 cells transfected with p c D N A 3 - L a c Z , p c D N A 3 - A D A M - T S 1 2 or p c D N A 3 - A D A M - T S 1 2 - M U T expression vectors or wildtype E V T s . 193 In this experiment, E V T s served as a control depicting integrin expression/binding in trophoblastic cells with an invasive phenotype. E V T s bound with significant affinity to all the a integrins analysed (as determined by comparing binding affinities to goat anti-mouse antibody coated control wells; Figure 3.2.2), and also bound with significant affinity to (31, p2, P 3 , a v P 5 and ot5pi. However, E V T s did not bind significantly to wells that were coated with P 4 or P 6 integrin subunits (Figure 3.2.3). In LacZ and A D A M T S - 1 2 transfected JEG-3 choriocarcinoma cells, there were no significant differences noted between the expression/binding of a l , a2, a4, a5, p i , P 3 , P4, P6, avp5 or a 5 p l integrins/subtypes (Figures 3.2.2 and 3.2.3). Furthermore, the expression/binding of a5, p i , P3, P6 and avP5 in E V T s was comparable to those observed in all the JEG-3 transfectants (Figures 3.2.2 and 3.2.3). JEG-3 cells exogenously expressing p-galactosidase did not bind with significant affinity to wells coated with a l , a3 , a4 or a3 integrin subunits. A D A M T S - 1 2 and proteinase-dead A D A M T S - 1 2 transfected JEG-3 cells were demonstrated to bind with significantly greater affinity to wells coated with antibodies to the a3 and a v integrin subunits and the avP3 integrin heterodimer (Figure 3.2.2). The binding affinities of JEG-3 cells exogenously expressing A D A M T S - 1 2 and proteinase-dead A D A M T S - 1 2 to these integrin antibodies was shown to be similar to the binding affinities of invasive E V T s . The a/p integrin-mediated binding assays demonstrated that both full-length and proteinase-dead A D A M T S - 1 2 alters integrin-mediated adhesion, specifically the a3 and a v integrin subunits and the avp3 heterodimer. 194 Previous studies have correlated the expression of the a v integrin subunit with an increase in invasive phenotype in E V T s in vivo (Damsky et al, 1993). To investigate whether the expression levels of the a v integrin subunit were higher in A D A M T S - 1 2 transfected and proteinase-dead A D A M T S - 1 2 transfected JEG-3 cells than in LacZ transfected JEG-3 cells, semiquantitative R T - P C R and Western blot analysis were performed on total m R N A and protein lysates extracted from these cells using primers specific for a v integrin and a monoclonal antibody directed against the a v integrin subunit. A s shown in Figure 3.2.4, m R N A levels of the a v integrin subunit significantly increased in JEG-3 cells exogenously expressing either full-length A D A M T S - 1 2 or proteinase-dead A D A M T S - 1 2 . Furthermore, the m R N A levels of a v integrin observed in A D A M T S - 1 2 JEG-3 cell transfectants and in E V T s are significantly higher than the m R N A levels detected in control LacZ-transfected JEG-3 cells. Western blot analysis of a v expression in protein lysates prepared from transfected JEG-3 cells and wildtype E V T s detected a 150 kDa band in all protein lysates. The size of this band is in agreement with that previously detected in denatured, but not reduced, protein samples (Hirsch et al, 1994). Protein levels of the a v integrin subunit were significantly higher in JEG-3 cells transfected with either of the A D A M T S - 1 2 c D N A constructs or in wildtype E V T s than in JEG-3 cells transfected with the control LacZ c D N A construct. Analysis of m R N A levels of a3 and (33 integrin subunits demonstrated that these did not significantly differ between the trophoblastic cells analyzed. Protein expression levels of the [33 integrin subunit were also assessed by Western blot analysis. A single band of 105 kDa was detected, but did not differ in intensity between A D A M T S - 1 2 - and LacZ-transfected 195 JEG-3 cells (Figure 3.2.4). These experiments demonstrate that exogenous A D A M T S - 1 2 correlates with a significant increase in a v expression levels. Reduced endogenous levels of ADAMTS-12 in EVTs correlates with reduced expression levels of the av integrin subunit Previous findings stemming from chapter II demonstrated that a significant reduction of endogenous A D A M T S - 1 2 levels in E V T s resulted in cells adopting a less-invasive phenotype. To determine whether the knock-down of A D A M T S - 1 2 in E V T s is associated with altered a v integrin expression, I prepared total m R N A and protein lysates from cells transfected with s i R N A directed against A D A M T S - 1 2 or a non-silencing s i R N A control and analyzed the expression of the av integrin subunit by means of semi-quantitative R T - P C R analysis and Western blot analysis. The effectiveness of the A D A M T S - 1 2 s i R N A in knocking down endogenous levels of A D A M T S - 1 2 was demonstrated by analyzing the m R N A and protein levels of A D A M T S - 1 2 in E V T s transfected with an s i R N A directed against A D A M T S - 1 2 (A12i), compared to cells transfected with a non-silencing control s i R N A (NS) or untransfected E V T s (Figure 3.2.5). I further demonstrated a significant reduction, respectively, in m R N A and protein levels of the a v integrin subunit in E V T s transfected with A D A M T S - 1 2 s i R N A (Figure 3.2.5). This was specific to a v integrin, as the m R N A and protein levels of 03 integrin did not significantly differ between A D A M T S - 1 2 s i R N A transfected E V T s or control E V T s . These data demonstrate that siRNA-mediated reduction of endogenous 196 A D A M T S - 1 2 in E V T s correlates with a significant reduction in endogenous av integrin expression levels. A D A M T S - 1 2 p romotes an invas i ve pheno type i n t r o p h o b l a s t i c cel ls b y r e g u l a t i n g the f u n c t i o n o f the a v 0 3 i n t e g r i n h e t e r o d i m e r The avP3 integrin has been previously shown to promote an invasive phenotype in human E V T s in vitro (Kabir-Salmani et al, 2003). To investigate whether A D A M T S - 1 2 -mediated invasion in human trophoblastic cells is facilitated by avP3 integrin function, I analyzed the ability of A D A M T S - 1 2 and LacZ transfected JEG-3 cells and E V T s to invade through a Matrigel matrix in the presence or absence of an avP3 integrin-specific R G D cyclo-peptide or an av integrin function-perturbing antibody (Burdick et al, 2003). Figure 3.2.6 shows the invasive properties of the trophoblastic cells as analyzed in Matrigel-coated Boyden chambers. The treatment of p c D N A 3 - L a c Z transfected cells with either the control or bicyclic R G D peptide had no significant effect on their invasive index (Figure 3.2.6-A). However, treatment of p c D N A 3 - A D A M - T S 1 2 and p c D N A 3 -A D A M - T S 1 2 - M U T transfected JEG-3 cells with the bicyclic R G D peptide led to a significant decrease in their invasive index while the control R G D peptide had no effect (Figure 3.2.6-A). Similar to the effect the bicyclic R G D peptide had on inhibiting the invasive capacity of JEG-3 cells exogenously expressing full-length A D A M T S - 1 2 or proteinase-dead A D A M T S - 1 2 , treatment with the function-perturbing a v integrin antibody also led to a significant reduction in their invasive indices (Figure 3.2.6-B). The invasive index of p c D N A - L a c Z transfected JEG-3 cells treated with the a v integrin 197 antibody did not significantly differ from the invasive index of control JEG-3 cells (Figure 3.2.6-B). I also looked at the whether the av03 integrin-specific RGD bicyclic-peptide inhibited EVT invasion in Matrigel-coated Boyden invasion chambers. The invasive index of EVTs cultured in the presence of the RGD peptide was significantly less than the invasive index assigned to control EVTs (Figure 3.2.6-C). To confirm that endogenous levels of ADAMTS-12 were not affected by the treatment with the bicyclic RGD peptide, semi-quantitative RT-PCR analysis was performed on total mRNA extracted from these cells using primers specific for ADAMTS-12. RT-PCR analysis revealed that there were no significant differences in ADAMTS-12 mRNA levels in RGD peptide-treated versus RGD peptide-untreated EVTs (data not shown). These data demonstrate that the increase in invasive phenotype promoted by ADAMTS-12 is facilitated by regulation of av03 function. 198 Discussion In this study, I demonstrated that exogenous A D A M T S - 1 2 in JEG-3 choriocarcinoma cells significantly alters cell binding to specific E C M proteins and to specific integrin cell adhesion molecules. Furthermore, I also demonstrated that A D A M T S - 1 2 expression promotes an invasive phenotype in human trophoblastic cells by regulating the expression of the a v integrin subunit and the function of the avp3 integrin heterodimer. To my knowledge, this is the first body of research that has provided evidence demonstrating that A D A M T S proteins can regulate cellular phenotype by altering components of the E C M through mechanisms independent of their M M P - l i k e domains. A D A M T S metalloproteinases have been demonstrated to play key roles in a variety of biological systems, and function predominantly by remodeling the E C M of tissues in both physiological and pathological environments (Apte, 2004). A D A M T S metalloproteinase subtypes have subsequently been shown to interact with and remodel specific E C M proteins. For example, the procollagenases A D A M T S - 2 , -3 and -14 function as amino (N)-propeptidases of procollagens I, II and III (Colige et al 1997; 2002; Fernandes et al, 2001). A D A M T S - 1 , -4, -5, -8, -9, -15, and -20 have been shown to bind to and cleave the proteoglycan aggrecan in cartilage and subsequently have been shown to play key roles in both normal connective tissue homeostasis and in the development of arthritic disease (Bayliss et al, 2001; Rodriguez-Manzaneque et al, 2002; Jones and Riley, 2005). Furthermore, A D A M T S - 1 and -4 interact with and cleave the proteoglycan versican (Sandy et al, 2001), and A D A M T S - 4 and -5 cleave the 199 proteoglycan brevican (Matthews et al, 2000; Held-Feindt et al, 2005). More recently, A D A M T S - 4 , -7 and -12 bind to and degrade the cartilage-associated glycoprotein C O M P (cartilage oligomeric matrix protein; Kashiwagi et al, 2004; L i u et al, 2006a; 2006b). The biological roles that A D A M T S subtypes play are in part regulated by their E C M -binding domain which controls substrate specificity, ECM-local izat ion and enzyme function (Colige et al, 2005; Porter et al, 2005). For example, cleavage of the spacer-region in A D A M T S - 4 increases its ability to degrade cartilage aggrecan, whereas the presence of the procollagen N-proteinase domain in A D A M T S - 2 positioned at the carboxy-terminus, inhibits catalytic activity (Flannery et al, 2002; Colige et al, 2005). Furthermore, the thrombospondin-repeats and spacer regions of A D A M T S subtypes influence the mobility of these enzymes by altering ligand binding/recognition sites (Apte, 2004). For example, the four carboxy-terminal TSP repeats of A D A M T S - 7 and -12 facilitate the binding of these proteases to the glycoprotein C O M P (L iu et al, 2006a; 2006b). The finding that exogenously expressed proteinase-dead A D A M T S - 1 2 was able to alter trophoblastic cell binding affinities to specific E C M proteins suggests that domains other than the M M P - l i k e domain play an important role in regulating ADAMTS-media ted cell-matrix interactions. Exogenous expression of A D A M T S - 1 2 led to an increase in the ability of JEG-3 choriocarcinoma cells to bind to collagen II, IV and vitronectin. Collagen II is a fibrillar collagen predominantly found in cartilage connective tissue, whereas collagen IV is a network-forming collagen found predominantly in basement membranes (Eyre, 2004). Collagen II has been shown to bind predominantly with a l 200 and a2 integrins (Kuphal et al, 2006), however, I did not observe any changes in a l or a2 integrin-mediated binding in A D A M T S - 1 2 transfected JEG-3 cells. This conflicting finding may be explained by the ability of E V T s to synthesize the collagen II degrading protease, M M P - 1 3 (Lamarca et al, 2005). Collagen II remodeling by M M P - 1 3 may result in the uncovering of cryptic integrin-binding sites that may lead to increased cell-matrix adhesion by integrins other than a l or a2. Furthermore, the association of A D A M T S - 1 2 with the E C M might lead to proteolytic-independent conformational E C M changes that may also result in uncovering cryptic integrin binding sites. Vitronectin is an RGD-containing multifunctional protein found in serum and extracellular matrices, and is secreted by trophoblastic cells during the first trimester of pregnancy (Felding-Habermann and Cheresh, 1993; X u et al, 2001). It has been demonstrated that some integrin receptors recognize and bind to proteins containing R G D motifs (e.g., avp3, avp5, a 5 p i and a l lbp3 ; Kuphal et al, 2006). Consistent with this knowledge, the observed increase in vitronectin binding in cells exogenously expressing A D A M T S - 1 2 coincided with significantly higher a v and avP3 integrin binding and expression levels. Interestingly, the avP3 integrin subtype has been shown to play important roles in promoting both trophoblast and cancer cell invasion and endothelial cell migration (Brooks et al, 1994a; 1994b; Damsky et al, 1994; Jones et al, 1996 Gasparini et al, 1998; Byzova et al, 2000). Furthermore, avp3-mediated invasion requires binding to its main E C M ligand, vitronectin, since RGD-containing proteins have been shown to prevent binding of avp3 to vitronectin and consequently inhibit ovarian cancer cell invasion (Beck et al, 2005). M y study, in which avp3 integrin 201 function was inhibited by a bicyclic R G D peptide and by an a v function-perturbing antibody, demonstrated the importance of the av03 integrin heterodimer in promoting trophoblastic cell invasion. These data are in agreement with previous findings that have demonstrated a functional role for av03 integrin in promoting trophoblast invasion (Zhou et al, 1997a; Kabir-Salmani et al, 2003). Although I did not determine the mechanism by which A D A M T S - 1 2 elicits an increase in avb*3 binding function or expression, the data generated in this study provides speculative insight into A D A M T S and integrin regulation. It is an interesting observation that a reduction in endogenous levels of A D A M T S - 1 2 in E V T s results in a significant decrease in expression of the av integrin subunit, since this data suggest that A D A M T S - 1 2 is capable of regulating the expression of this integrin subunit. Further experimentation is needed to demonstrate how A D A M T S - 1 2 modulates integrin expression and by what molecular mechanism(s) the increased av03 integrin expression and function promote an invasive phenotype in my cell model system. Although the disintegrin-like and TSP type 1 domains of A D A M T S metalloproteinases do not have an RGD-binding sequence and therefore cannot directly interact with R G D -binding integrins through RGD-dependent mechanisms, it is possible that A D A M T S - 1 2 modulates integrin expression and function by remodeling the composition of the E C M . The ability of A D A M T S - 1 2 to associate with the E C M (Cai et al, 2001) allows for the possibility that it interacts with and alters the structure of proteins residing within the E C M . It is also possible that A D A M T S - 1 2 can directly interact with av03 integrin through an RGD-independent mechanism. For example, av(33 integrin can bind to 202 M M P - 2 in an RGD-independent manner (Deryugina et al, 2000). However, although intriguing, this latter possibility seems unlikely since I demonstrated that perturbation of avp3 function is RGD-dependent and that ADAMTS-12-media ted changes in the expression of a v integrin appear to be regulated at the m R N A level. Binding of avp3 integrin to its ligands results in the activation of mitogen-activated protein kinase ( M A P K ) and focal adhesion kinase ( F A K ; Camenisch et al, 2002). Indeed, the activity of extracellular signal-regulated kinase-1 (Erk-1), a member of the M A P K family, is required for avp 3-dependent migration of endothelial cells during angiogenesis (Klemke et al, 1997). Interestingly, Kabir-Salmani et al (2003) demonstrated that IGF-I-mediated migration of trophoblasts is avp3 integrin-dependent and is associated with avP3 integrin heterodimer co-localization with phosphorylated F A K , paxil l in and viniculin at focal adhesions. These data, along with the findings in my study, provide strong evidence in assigning a key role for the avp3 integrin in promoting an invasive phenotype in human trophoblast. Indeed, the avp3 integrin has been shown to promote cancer cell metastasis in immunodeficient nude mice (Felding-Habermann et al, 2002). Furthermore, avp3 integrin has been demonstrated to increase cancer cell invasion/migration and regulate the expression and function of the M M P - 2 / T I M P -2 / M T M M P - l activation complex (Felding-Habermann et al, 2002; Furger et al, 2003). In light of these observations, avp3 integrin appears to play key roles in facilitating cell invasion processes in both physiological and pathological contexts. 203 In summary, I have identified a novel action by which A D A M T S - 1 2 promotes an invasive phenotype in trophoblastic cells. Specifically, I have demonstrated that A D A M T S - 1 2 modulates the expression and function of the av(33 integrin heterodimer, and that the increase in expression and function of this integrin is in part responsible for the increased invasive ability of these cells. Further experimentation is needed to elucidate the molecular mechanisms underlying in this process. However, the results of this study demonstrate the complexity of A D A M T S function, and highlight the importance of the ECM-binding domains of A D A M T S - 1 2 . 204 Figure 3.2.1 Fluorimetric ECM-binding assay of trophoblastic cells exogenously expressing ADAMTS-12: JEG-3 cells transfected with p c D N A 3 - L a c Z (LacZ), p c D N A 3 -A D A M - T S 1 2 (A12FL) , or p c D N A 3 - A D A M - T S 1 2 - M U T (A12Mut) and primary cultures of E V T s were cultured in a 96-well plate with wells pre-coated with specific E C M proteins or B S A control for 2 hours at 37°C in a humidified culture chamber, 5% C O 2 . Following incubation, wells were washed, lysed with a CyQuant G R dye solution (Chemicon), and measured using a fluorimetric plate reader. ECM-binding assays were performed on three independent occasions (n=3; * = P O . 0 5 ) . 205 250000 collagen I collagen II collagen IV fibronectin laminin tenascin vitronectin BSA-control 206 Figure 3.2.2 Alpha integrin expression in trophoblastic cells exogenously expressing ADAMTS-12: JEG-3 cells transfected with p c D N A 3 - L a c Z (LacZ), p c D N A 3 - A D A M -TS12 (A12FL) or p c D N A 3 - A D A M - T S 1 2 - M U T (A12Mut) and primary cultures of E V T s were cultured in a 96-well plate coated with a defined repertoire of a integrin monoclonal antibodies for 2 hours at 37°C in a humidified culture chamber, 5% CO2. After incubation, cells were washed in P B S , lysed with a fluorescence dye, and measured using a fiuorimetric plate reader. Each trophoblastic cell population was cultured in a specific well pre-coated with an antibody to an a integrin subtype on three separate occasions (n=3; * - P<0.05, where * denotes a significantly different value compared to LacZ control values). 207 Alpha Integrin Binding Assay o 35000 -i 208 Figure 3.2.3 Beta Integrin-Mediated Cell Adhesion Fluorimetric Array. JEG-3 cells transfected with p c D N A 3 - L a c Z (LacZ), p c D N A 3 - A D A M - T S 1 2 (A12FL) or p c D N A 3 -A D A M - T S 1 2 - M U T (A12Mut) and primary cultures of E V T s were cultured in a 96-well plate coated with a defined repertoire of P integrin monoclonal antibodies for 2 hours at 37°C in a humidified culture chamber, 5% CO2. After incubation, cells were washed in P B S , lysed with a fluorescence dye, and measured using a fluorimetric plate reader. Each trophoblastic cell population was cultured in a specific well pre-coated with an antibody to a P integrin subtype on three independent occasions (n=3; * = P<0.05, where * denotes a significantly different value compared to LacZ control values). 209 Beta Integrin Binding Assay 2 1 0 Figure 3.2.4 mRNA and protein expression levels of integrin subtypes in ADAMTS-12 transfected trophoblastic cells. (A) Ethidium bromide-stained agarose gel photographs depicting reverse transcription (RT)-PCR analysis of A D A M T S - 1 2 , a v integrin, a3 integrin, p3 integrin and G A P D H m R N A levels in JEG-3 choriocarcinoma cells stably transfected with the full-length A D A M T S - 1 2 c D N A construct p c D N A 3 - A D A M - T S 1 2 (A12FL) , the full-length catalytically-mutated A D A M T S - 1 2 c D N A construct p c D N A 3 -A D A M - T S 1 2 - M U T (A12Mut), or the p c D N A 3 - L a c Z construct (LacZ) and in E V T s propagated from first trimester chorionic villous explants (EVT) which served as a positive A D A M T S - 1 2 control. R T - P C R analysis conditions, P C R product sizes and forward and reverse primer sequences are shown in Table 1. For each analysis, the resultant ethidium bromide-stained agarose gel photographs were scanned using a laser densitometer. The a v integrin absorbance values were then standardized to G A P D H . The results are presented (mean + S E M ; n > 3) in the bar graphs (* = P O . 0 5 , where * denotes a significantly different value compared to LacZ control). (B) Autoradiograms of Western blots containing total protein extracted from JEG-3 choriocarcinoma cells stably transfected with the full-length A D A M T S - 1 2 c D N A construct (A12FL) , the full-length catalytically-mutated A D A M T S - 1 2 c D N A construct (A12Mut), or the LacZ c D N A construct (LacZ) and from E V T s propagated from first trimester chorionic villous explants (EVT) . Western blot analysis was performed using antibodies directed against human A D A M T S - 1 2 , a v integrin subunit, and the P3 integrin subunit. The relative electrophoretic mobilities of the molecular weight markers (kDa) are shown on the left hand side of the immunoblots. Quantification of a v integrin protein levels was determined by standardizing the values obtained from optical densitometry of av integrin to the densitometric values generated from actin. The results are presented (mean ± S E M ; n> 4) in the bar graphs (* = P<0.05, where * denotes a significantly different value compared to LacZ control). 211 GAPDH 1204 831 ADAMTS-12 1504 av integrin (non-reducing cond.) 105-47-\-p3 integrin Uactin 1 t Z £ M J3 0.1 >s, av integrin mRNA levels A12 AX2Mut LacZ I av integrin protein levels 212 Figure 3.2.5 mRNA and protein expression levels of integrin subtypes in EVTs transfected with an siRNA construct specific to ADAMTS-12. (A) Ethidium bromide-stained agarose gel photographs depicting reverse transcription (RT)-PCR analysis of A D A M T S - 1 2 , a v integrin and P3 integrin m R N A levels in E V T s transiently transfected with double-stranded s i R N A directed against A D A M T S - 1 2 (A12i), a non-silencing double stranded s i R N A control (NS) and untransfected E V T s (EVT) . R T - P C R analysis conditions, P C R product sizes and forward and reverse primer sequences are described in Table 1. Each R T - P C R reaction was performed on three separate occasions (n=3; * = P<0.05). (B) Autoradiograms of Western blots containing total protein extracted from E V T s transiently transfected with double-stranded s i R N A directed against A D A M T S - 1 2 (A12i), a non-silencing double stranded s i R N A control (NS) and untransfected E V T s (EVT) . The relative electrophoretic mobilities of the molecular weight markers (kDa) are shown on the left hand side of the immunoblots. Western blot analysis for each protein species was performed on three separate occasions (n=3; * = P<0.05, where * denotes a significantly different value compared to E V T control). 213 1 ll z c a s I -1{« 3 s : A12i NS EVT av integrin mRNA levels S 3 (9 > UJ J: £| EVT av integrin protein levels 214 Figure 3.2.6 Treatment of trophoblastic cells expressing ADAMTS-12 with an RGD peptide inhibits cellular invasion. (A) JEG-3 choriocarcinoma cells were stably transfected with p c D N A 3 - A D A M - T S 1 2 (A12FL) , p c D N A 3 - A D A M - T S 1 2 - M U T (A12Mut) or p c D N A 3 - L a c Z (LacZ). Transfected cells were cultured in Matrigel-coated Transwell invasion chambers for 48h in D M E M media containing an avP3 integrin-specific cyclic R G D peptide, a control R G D peptide or media only. After 48h, cells were fixed in 4% paraformaldehyde and stained with eosin. Untreated cell lines were given an arbitrary invasion index of 1, and the invasive capacity of cells cultured in the presence of the control R G D or R G D peptide were determined generating an invasion index corresponding to their control cell line. Invasive indexes were determined by counting the number of cells that had invaded to the underside of the porous Transwell insert. Each invasion trial was performed on three independent occasions (n=3). (B) Stably transfected JEG-3 cells described above were also cultured in Matrigel-coated Transwell invasion chambers for 48h in D M E M media containing a monoclonal a v integrin-specific function-perturbing antibody or media alone. After 48h, cells were fixed in 4% paraformaldehyde and stained with eosin. Untreated cell lines were given an arbitrary invasion index of 1, and the invasive capacity of cells cultured in the presence of the a v antibody was determined generating an invasion index corresponding to their control cell line. Each invasion trial was performed on three independent occasions (n=3). (C) E V T s propagated from first trimester chorionic villous explants were cultured in Matrigel-coated Transwell invasion chambers for 24h in D M E M media containing an avp3 integrin-specific cyclic R G D peptide, a control R G D peptide or media only. After 24h, cells were fixed in 4% paraformaldehyde and stained with eosin. Invasive capacity was determined by counting the number of cells that had invaded to the underside of the Matrigel-precoated porous Transwell insert. Each invasion trial was performed on three independent occasions (n=3; * = P O . 0 5 , where * denotes a significantly different value compared to peptide/antibody-untreated control cell populations). 215 A 1.4 H LacZ LacZ-alphaV Ab A12FL A12FL-alphaV AlZMut A12Mut-alphaV Ab Ab c 1.2 N EVT EVT-cont ro l pept ide EVT-alphaVbeta3 pept ide 216 Table 3.2.1 Primer sequences and P C R conditions Gene Primer Sequence Estimated PCR Product Size (bp) PCR Conditions av integrin Forward:5 ' -AGATGTTGGGCCAGTTGTTC-3' Reverse: 5' - G C A A C T C C A C A A C C C A A AGT-3 ' 321 Denaturing: 94°C 45 s Annealing: 62°C 45s Extension: 72°C 90s 28 cycles a3 integrin Forwards ' - T T G G G T A C A C G A T G C A G G T A - 3 ' Reverse: 5' -CTGGTTG A T G T C A C C A A T G C - 3 ' 420 Denaturing: 94°C 45s Annealing: 60°C 45s Extension: 72°C 90s 30 cycles (33 integrin Forwards' - G G C C A T G T G A C C T G A A C T T T - 3 ' Reverse: 5' -C A T C T C C C A C C C T A G T C C A A - 3 ' 397 Denaturing: 94°C 45 s Annealing: 55°C 45s Extension: 72°C 90s 28 cycles ADAMTS-12 Forward: 5 ' - G T G C A G C G A G G A G T A C A T C A - 3 ' Reverse: 5 ' -GCGTTTTCTTTCTCCAGTGC-3 ' 488 Denaturing: 94°C 30s Annealing: 63°C 30s Extension: 72°C 60s 28 cycles G A P D H Forward: 5'- C C C A A T T C T C T A C G G A G T C G - 3 ' Reverse: 5 ' -AATCTCCCAGGGTTGCTTCT-3 ' 378 Denaturing: 94°C 45s Annealing: 55°C 30s Extension: 72°C 60s 20 cycles 217 3.3 References Apl in , J. (1991). Implantation, trophoblast differentiation and haemochorial placentation: mechanistic evidence in vivo and in vitro. J Cell Sci 99, 681-92. Apte, S. (2004). A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motifs: the A D A M T S family. Int J Biochem Cell Biol 36, 981-5. Bayliss, M . , Hutton, S., Hayward, J., and Maciewicz, R. (2001). Distribution of aggrecanase ( A D A M t s 4/5) cleavage products in normal and osteoarthritic human articular cartilage: the influence of age, topography and zone of tissue. Osteoarthritis Cartilage 9, 553-60. Beck, V . , Herold, H . , Benge, A . , Luber, B . , Hutzler, P., Tschesche, H . , Kessler, H . , Schmitt, M . , Geppert, H . , and Reuning, U . (2005). A D A M I 5 decreases integrin alphavbeta3/vitronectin-mediated ovarian cancer cell adhesion and motility in an RGD-dependent fashion. Int J Biochem Cell Biol 37, 590-603. Bischof, P., Meisser, A . , and Campana, A . (2001). Biochemistry and molecular biology of trophoblast invasion. Ann N Y Acad Sci 943, 157-62. Brooks, P., Clark, R., and Cheresh, D . (1994a). Requirement of vascular integrin alpha v beta 3 for angiogenesis. Science 264, 569-71. Brooks, P., Montgomery, A . , Rosenfeld, M . , Reisfeld, R., Hu, T., Kl ier , G . , and Cheresh, D . (1994b). Integrin alpha v beta 3 antagonists promote tumor regression by inducing apoptosis of angiogenic blood vessels. Cell 79, 1157-64. Burdick, M . , McCaffery, J., K i m , Y . , Bochner, B . , and Konstantopoulos, K . (2003). Colon carcinoma cell glycolipids, integrins, and other glycoproteins mediate adhesion to H U V E C s under flow. Am J Physiol Cell Physiol 284, C997-87. Byzova, T., K i m , W. , Midura, R., and Plow, E . (2000). Activation of integrin alpha(V)beta(3) regulates cell adhesion and migration to bone sialoprotein. Exp Cell Res 254, 299-308. Cai , S., Arguelles, J., Fernandez, P., and Lopez-Otin, C. (2001). Identification, characterization, and intracellular processing of A D A M - T S 1 2 , a novel disintegrin with a complex structural organization involving mutiple thrombospondin-1 repeats. J Biol Chem 276, 17932-40. Camenisch, G . , Pisabarro, M . , Sherman, D. , Kowalski , J., Nagel, M . , Hass, P., X ie , M . , Gurney, A . , Bodary, S., Liang, X . , Clark, K . , Beresini, M . , Ferrara, N . , and Gerber, H . (2002). A N G P T L 3 stimulates endothelial cell adhesion and migration 218 via integrin alpha vbeta 3 and induces blood vessel formation in vivo. J Biol Chem 277, 17281-90. Chou, C , Zhu, H . , Shalev, E . , MacCalman, C , and Leung, P. (2002). The effects o f gonadotropin-releasing hormone (GnRH) I and G n R H II on the urokinase-type plasminogen activator/plasminogen activator inhibitor system in human extravillous cytotrophoblasts in vitro. J Clin Endocrinol Metab 87, 5594-603. Colige, A . , L i , S., Sieron, A . , Nusgens, B . , Prockop, D. , and Lapiere, C. (1997). c D N A cloning and expression of bovine procollagen I N-proteinase: a new member of the superfamily of zinc-metalloproteinases with binding sites for cells and other matrix components. Proc Natl Acad Sci U S A 64, 2374-9. Colige, A . , Ruggiero, F., Vandenberghe, I., Dubail, J., Kesteloot, F., Van Beeumen, J., Beschin, A . , Brys, L . , Lapiere, C , and Nusgens, B . (2005). Domains and Maturation Processes That Regulate the Activi ty of A D A M T S - 2 , a Metalloproteinase Cleaving the Aminopropeptide of Fibrillar Procollagens Types I-III and V . JBiol Chem 280, 34397-34408. Damsky, C , Librach, C , L i m , K . , Fitzgerald, M . , McMaster, M . , Janatpour, M . , Zhou, Y . , Logan, S., and Fisher, S. (1994). Integrin switching regulates normal trophoblast invasion. Development 120, 3657-66. Deryugina, E . , Bourdon, M . , Jungwirth, K . , Sith, J., and Strongin, A . (2000). Functional activation of integrin alpha V beta 3 in tumor cells expressing membrane-type 1 matrix metalloproteinase. Int J Cancer 86, 15-23. DeSimone, D . (1994). Adhesion and matrix in vertebrate development. Curr Opin Cell Biol 6, 747-51. Eyre, D . (2004). Collagens and cartilage matrix homeostasis. Clin Orthop Relat Res 427 Suppl, SI 18-22. Felding-Habermann, B . , and Cheresh, D . (1993). Vitronectin and its receptors. Curr Opin Cell Biol 5, 864-8. Felding-Habermann, B . , Fransvea, E . , O'Toole, T., Manzuk, L . , Faha, B . , and Hensler, M . (2002). Involvement of tumor cell integrin alpha v beta 3 in hematogenous metastasis of human melanoma cells. Clin Exp Metastasis 19, 427-36. Fernandes, R., Hirohata, S., Engle, J., Colige, A . , Cohn, D. , Eyre, D. , and Apte, S. (2001). Procollagen II amino propeptide processing by A D A M T S - 3 . Insights on dermatosparaxis. J Biol Chem 276, 31502-9. 219 Flannery, C , Zeng, W. , Corcoran, C , Collins-Racie, L . , Chockalingam, P., Herbert, T., Mackie, S., McDonagh, T., Crawford, T., Tomkinson, K . , LaVal l ie , E . , and Morris, E . (2002). Autocatalytic cleavage of A D A M T S - 4 (Aggrecanase-1) reveals multiple glycosaminoglycan-binding sites. J Biol Chem 277, 42775-80. Furger, K . , Al lan , A . , Wilson, S., Hota, C , Vantyghem, S., Postenka, C , Al -Kat ib , W. , Chambers, A . , and Tuck, A . (2003). Beta(3) integrin expression increases breast carcinoma cell responsiveness to the malignancy-enhancing effects of osteopontin. Mol Cancer Res 1, 810-9. Gao, G . , Plaas, A . , Thompson, V . , Jin, S., Zuo, F. , and Sandy, J. (2004). A D A M T S 4 (aggrecanase-1) activation on the cell surface involves C-terminal cleavage by glycosylphosphatidyl inositol-anchored membrane type 4-matrix . metalloproteinase and binding of the activated proteinase to chondroitin sulfate and heparan sulfate on syndecan-1. J Biol Chem 279, 10042-51. Gasparini, G . , Brooks, P., Biganzoli , E . , Vermeulen, P., Bonoldi, E . , Dir ix , L . , Ranieri, G . , Mice l i , R., and Cheresh, D . (1998). Vascular integrin alpha(v)beta3: a new prognostic indicator in breast cancer. Clin Cancer Res 4, 2625-34. Getsios, S., Chen, G . , Huang, D. , and MacCalman, C. (1998). Regulated expression of cadherin-11 in human extravillous cytotrophoblasts undergoing aggregation and fusion in response to transforming growth factor beta 1. J Reprod Fertil 114, 357-63. Hanahan, D . , and Weinberg, R. (2000). The hallmarks of cancer. Cell 100, 57-70. Held-Feindt, J., Paredes, E . , Blomer, U . , Seidenbecher, C , Stark, A . , Mehdorn, H . , and Mentlein, R. (2005). Matrix-degrading proteases A D A M T S 4 and A D A M T S 5 (disintegrins and metalloproteinases with thrombospondin motifs 4 and 5) are expressed in human glioblastomas. Int J Cancer 118, 55-61. Hirsch, E . , Gullberg, D. , Balzac, F., Altruda, F., Silengo, L . , and Tarone, G . (1994). Alpha v integrin subunit is predominantly located in nervous tissue and skeletal muscle during mouse development. Dev Dyn 201, 108-20. Janssen, M . , Oyen, W. , Dijgraaf, I., Massuger, L . , Frielink, C , Edwards, D . , Rajopadhye, M . , Boonstra, H . , Corstens, F., and Boerman, O. (2002). Tumor targeting with radiolabeled alpha(v)beta(3) integrin binding peptides in a nude mouse model. Cancer Res 62, 6146-51. Jones, G. , and Riley, G . (2005). A D A M T S proteinases: a multi-domain, multi-functional family with roles in extracellular matrix turnover and arthritis. Arthritis Res Ther 7,160-9. 220 Jones, J., Prevette, T., Gockerman, A . , and Clemmons, D . (1996). Ligand occupancy of the alpha-V-beta3 integrin is necessary for smooth muscle cells to migrate in response to insulin-like growth factor. Proc Natl Acad Sci USA 9 3 , 2482-7. Kabir-Salmani, M . , Shiokawa, S., Akimoto, Y . , Sakai, K . , Nagamatsu, S., Sakai, K . , Nakamura, Y . , Lotfi , A . , Kawakami, H . , and Iwashita, M . (2003). Alphavbeta3 integrin signaling pathway is involved in insulin-like growth factor I-stimulated human extravillous trophoblast cell migration. Endocrinology 1 4 4 , 1620-30. Kashiwagi, M . , Enghild, J., Gendron, C , Hughes, C , Caterson, B . , Itoh, Y . , and Nagase, H . (2004). Altered proteolytic activities of A D A M T S - 4 expressed by C-terminal processing. JBiol Chem 2 7 9 , 10109-19. Klemke, R., Cai , S., Giannini, A . , Gallagher, P., de Lanerolle, P., and Cheresh, D . (1997). Regulation of cell motility by mitogen-activated protein kinase. JCell Biol 1 3 7 , 481-92. Kuphal, S., and Bosserhoff, A . (2006). Influence of the cytoplasmic domain of E -cadherin on endogenous N-cadherin expression in malignant melanoma. Oncogene 2 5 , 248-59. Lamarca, H . , Ott, C , Honer, Z . , Bentrup, K . , Pierson, D . , Nelson, A . , Scandurro, A . , Whitley, G. , Nickerson, C , and Morris, C . (2005). Three-dimensional growth of extravillous cytotrophoblasts promotes differentiation and invasion. Placenta 2 6 , 709-20. L i u , C , Kong, W. , Ilalov, K . , Y u , S., X u , G . , Prazak, L . , Fajardo, M . , Sehgal, B . , and D i Cesare, P. (2006a). A D A M T S - 7 : a metalloproteinase that directly binds to and degrades cartilage oligomeric matrix protein. FASEB J 20, 988-90. L i u , C , Kong, W. , X u , K . , Luan, Y . , Ilalov, K . , Sehgal, B . , Y u , S., Howell , R., and D i Cesare, P. (2006b). A D A M T S - 1 2 associates with and degrades cartilage oligomeric matrix protein. JBiol Chem 2 8 1 , 15800-8. MacCalman, C , Furth, E . , Omigbodun, A . , Bronner, M . , Coutifaris, C , and Strauss, J. r. (1996). Regulated expression of cadherin-11 in human epithelial cells: a role for cadherin-11 in trophoblast-endometrium interactions? Dev Dyn 2 0 6 , 201-11. Matthews, R., Gary, S., Zerillo, C , Pratta, M . , Solomon, K . , Arner, E . , and Hockfield, S. (2000). Brain-enriched hyaluronan binding (BEHAB)/brevican cleavage in a glioma cell line is mediated by a disintegrin and metalloproteinase with thrombospondin motifs ( A D A M T S ) family member. J Biol Chem 2 7 5 , 22695-703. 221 Porter, S., Clark, I., Kevorkian, L . , and Edwards, D . (2005). The A D A M T S metalloproteinases. Biochem J386, 15-27. Rodriguez-Manzaneque , J., Westling, J., Thai, S., Luque, A . , Knauper, V . , Murphy, G. , Sandy, J., and Iruela-Arispe, M . (2002). A D A M T S 1 cleaves aggrecan at multiple sites and is differentially inhibited by metalloproteinase inhibitors. Biochem Biophys Res Commun 293, 501-8. Sandy, J., Westling, J. , Kenagy, R., Iruela-Arispe, M . , Verscharen, C , Rodriguez-Manzaneque , J., Zimmermann, D. , Lemire, J., Fischer, J., T N , W. , and Clowes, A . (2001). Versican V I proteolysis in human aorta in vivo occurs at the Glu441-Ala442 bond, a site that is cleaved by recombinant A D A M T S - 1 and A D A M T S - 4 . J Biol Chem 276, 13372-8. X u , G . , Guimond, M . , Chakraborty, C , and Lala, P. (2002). Control of proliferation, migration, and invasiveness of human extravillous trophoblast by decorin, a decidual product. Biol Reprod 67, 681-9. X u , P., Wang, Y . , Pia, Y . , Ba i , S., X i a , Z . , Jia, Y . , Luo, S., and Zhuang, L . (2001). Effects of matrix proteins on the expression of matrix metalloproteinase-2, -9, and -14 and tissue inhibitors of metalloproteinases in human cytotrophoblast cells during the first trimester. Biol Reprod 65, 240-6. Zhou, Y . , Damsky, C , and Fisher, S. (1997b). Preeclampsia is associated with failure of human cytotrophoblasts to mimic a vascular adhesion phenotype. One cause of defective endovascular invasion in this syndrome? J Clin Invest 99, 2152-64. Zhou, Y . , Fisher, S., Janatpour, M . , Genbacev, O., Dejana, E . , Wheelock, M . , and Damsky, C. (1997a). Human cytotrophoblasts adopt a vascular phenotype as they differentiate. A strategy for successful endovascular invasion? J Clin Invest 99, 2139-51. 222 C H A P T E R 4: C A D H E R I N - M E D I A T E D R E G U L A T I O N O F H U M A N T R O P H O B L A S T I C C E L L INVASION 4.1 Preface This chapter describes a set of studies aimed at characterizing the roles played by the classical/type-I cadherins expressed in human mononuclear trophoblastic cells in regulating cellular invasion. Trophoblast cells of the human first trimester placenta follow a differentiative pathway that leads to the development of highly-invasive cells that invade into the maternal endometrium and placental blood vasculature. Events that play key roles in cellular invasion processes include proteolytic mechanisms, the loss of cell polarity and alterations in cell-matrix and cell-cell adhesions. Previous studies that have characterized the expression of E-cadherin in early placentation, have demonstrated that its expression in highly differentiated and invasive E V T s is significantly reduced and/or is absent (Zhou et al, 1997a; Shih et al, 2002). In this chapter, I demonstrated that poorly-invasive and highly-invasive trophoblastic cells differentially express the classical/type-I cadherin subtypes E-cadherin and N-cadherin. Util ising E - and N-cadherin loss-of and gain-of function experiments in trophoblastic cells, I provide evidence to suggest that both E - and N-cadherin regulate trophoblast invasion in opposing manners. Specifically, E-cadherin was shown to suppress whereas N-cadherin was shown to enhance invasion. This body of work is the first to explicitly characterize the expression of N-cadherin in highly-223 invasive trophoblast cells. Furthermore, these studies are the first to demonstrate a important functional role for N-cadherin in regulating trophoblast invasion. Dr. H . Zhu helped perform the proliferation and apoptosis assays (Figures 4.2. and 4.2.12). 224 4.2 N-cadherin promotes an invasive phenotype in human trophoblastic cells in vitro Introduction Successful human placentation is dependent upon the ability of trophoblastic cells to terminally differentiate into key cellular components of the placenta. Vil lous cytotrophoblasts originating from the trophectodermal layer of the implanting blastocyst differentiate along one of two pathways: The non-invasive syncytial trophoblast pathway, or the invasive E V T pathway (Aplin et al, 2000; Potgens et al, 2002). The latter pathway is characterized by villous cytotrophoblast proliferation and breaching of the overlying multi-nucleated syncytial trophoblast at select sights of implantation. This process results in the formation of an extravillous column comprised of trophoblast cells referred to as intermediate E V T s . Subpopulations of E V T s detach from the column and invade into the maternal decidua and into the maternal spiral arteries where these cells replace the vascular endothelial lining thereby creating low-resistance, high-capacity blood vessels that provide nutrient-rich maternal blood to the fetus through until term. The ability of E V T s to adopt an invasive phenotype is in part dependent upon their ability to modify their cell-matrix and cell-cell adhesion profiles (Lala and Graham, 1990; Bischof et al, 2001). The cadherins, a family of calcium-dependent cell adhesion molecules, have been shown to play key roles in regulating the invasive and migratory phenotype of cells in a variety of normal biological systems such as during embryogenesis (Takeichi, 1995), and in 225 pathological systems such as tumor metastasis (Islam et al, 1996; Hazan et al, 1997; Tomita et al, 2000). In these instances, the increase in invasive phenotype is characterised by the loss of epithelial-associated cadherins, such as E - and P-cadherin, both of which facilitate tight aggregation and intricate cell-cell adhesion. Interestingly, the loss or down-regulation of epithelial-cadherins is often associated with an increase in expression and function of mesenchymal-associated cadherins, such as cadherin-11, N -and R-cadherin (Hazan et al, 1997; Johnson et al, 2004; Maeda et al, 2005; Smalley et al, 2005). For example, it has been demonstrated in prostate (Tomita et al, 2000) and breast cancer cells (Hazan et al, 1997; 2000) that cancer progression is accociated with the loss of E-cadherin and the de novo expression of N-cadherin. Other studies have demonstrated a functional role for N-cadherin in promoting an invasive phenotype. For example, it was demonstrated that in squamous epithelial cells and breast epithelial cells, exogenous expression of N-cadherin resulted in a significantly more invasive phenotype (Islam et al, 1996; Nieman et al, 2000). To complement these studies, Hazan et al (2000) demonstrated that in addition to exogenous expression of N-cadherin eliciting an invasive and migratory phenotype in a weakly-invasive breast cancer cell line, de novo expression of N-cadherin led to a significant increase in metastasis in nude mice. M y laboratory has previously studied the importance of cadherin expression and function during syncytial formation in the human placenta (Getsios et al, 1998; 2003), but at this point it is uncertain whether cadherins play a key role(s) in regulating trophoblast invasion during E V T differentiation. To address this outstanding issue, I examined the expression of E - and N-cadherin in poorly- and highly-invasive human trophoblastic 226 cells. Util ising functional studies, I further characterized the roles E - and N-cadherin play in regulating the invasive phenotype of these cells. M y results demonstrate for the first time that E V T s adopt an invasive phenotype facilitated in part by the expression and function of N-cadherin. I further demonstrated that the exogenous expression of N -cadherin in trophoblastic cells normally expressing high levels of endogenous E -cadherin, results in a significant increase in invasive phenotype. M y results demonstrate through gain-of and loss-of function experiments the importance that N-cadherin plays in promoting an invasive phenotype in trophoblasts and provides further evidence to support the notion that E V T s adopt similar molecular mechanisms to those associated with cancer cell progression and cell invasion. 227 Materials and Methods Tissues and cell culture. Samples of first trimester placental tissues were obtained from women undergoing elective termination of pregnancy (gestational ages ranging from 6-12 weeks). The use of these tissues was approved by the Committee for Ethical Review of Research on the use of Human Subjects, University of British Columbia, Vancouver, B C , Canada. A l l women provided informed written consent. Cultures of E V T s were propagated from first trimester placental explants as previously described. Briefly, chorionic v i l l i were washed three times in P B S . The v i l l i were minced finely and plated in 25cm 2 tissue culture flasks containing Dulbecco's Modified Eagle's Medium ( D M E M ) containing 25 m M glucose, L-glutamine, antibiotics (lOOU/ml penicillin, 100 ug/ml streptomycin) and supplemented with 10% fetal bovine serum (FBS). The fragments of the chorionic v i l l i were allowed to adhere for 2-3d, after which any non-adherent tissue was removed. The villous explants were cultured for a further 10-14d with the culture medium being replaced every 48h. The E V T s were separated from the villous explants by a brief (2-3min) trypsin digestion at 37°C and plated in 60 m m 2 culture dishes in D M E M supplemented with antibiotics and 10% F B S . The purity of the E V T cultures was determined by immunostaining with a monoclonal antibody directed against human cytokeratin filaments 8 and 18 (Sigma Aldrich, St Louis, M O , U S A ) according to the methods of MacCalman et al (1996). Only cell cultures that exhibited 100% immunostaining for cytokeratin were included in these studies. 228 JEG-3 choriocarcinoma cells were purchased from A T C C (Manassas, V A , U S A ) . On-going cultures were maintained in D M E M containing 25 m M glucose, L-glutamine, antibiotics (lOOU/ml penicillin, 100 ug/ml streptomycin) and supplemented with 10% F B S . Generation of first-strand cDNA. Total R N A was prepared from cultures of E V T s or JEG-3 cells using an RNeasy M i n i K i t (Qiagen, Inc, C A ) following a protocol recommended by the manufacturer. The total R N A extracts were then treated with Deoxyribonuclease-1 to eliminate possible contamination with genomic D N A . To verify the integrity of the R N A , aliquots of the total R N A extracts electrophoresed in a 1% (w/v) denaturing agarose gel containing 3.7 % (v/v) formaldehyde and the 28 S and 18 S ribosomal R N A subunits visualized by ethidium bromide staining. The purity and concentration of total R N A present in each of the extracts were determined by optical densitometry (260/280nm) using a Du-64 U V -spectrophotometer (Beckman Coulter, Mississauga, O N , Canada). Aliquots (~1 ug) of the total R N A extracts prepared from the human trophoblastic cells was then reverse-transcribed into c D N A using a First Strand c D N A Synthesis K i t according to the manufacturer's protocol (Amersham Pharmacia Biotech, Oakville, O N , Canada). 229 Primer design and preparation of cDNA probes. Primer sets specific for E-cadherin, N-cadherin or the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase ( G A P D H ) which served as an internal control were synthesized at the N A P S Unit, University of British Columbia, Vancouver, B C , Canada. The nucleotide sequences of these primers, the optimized P C R conditions, and the expected sizes of the P C R products are listed in Table 1. To generate c D N A probes specific for E-cadherin, N-cadherin or G A P D H , P C R products generated from a representative human trophoblastic cell sample were subcloned into the P C R II vector by blunt-end ligation (Invitrogen, Carlsbad, C A , U S A ) and subjected to nucleotide sequence analysis. c D N A probes were subsequently isolated from these plasmids using standard molecular biology techniques. Semiquantitative PCR and Southern blot analysis. Semiquantitative P C R was performed using the primer sets specific for E-cadherin, N -cadherin or G A P D H , and template c D N A generated from the total R N A extracts prepared from cultures of E V T s or JEG-3 cells. The P C R cycles were repeated 15-40 times to determine a linear relationship between the yield of P C R products from representative trophoblastic cells and the number of cycles performed. The optimized numbers of cycles subsequently used to amplify the cadherin subtypes identified in each cell lineage and G A P D H are listed in Table 1. 230 A l l P C R reactions were performed on 3 separate occasions. P C R was also performed using the primer sets specific for E-cadherin and N-cadherin, and aliquots of total R N A extracts prepared from trophoblastic cells (i.e. non-transcribed R N A ) or DEPC-treated water under the same conditions as described above. These P C R reactions, which served as negative controls, did not yield any P C R products confirming the purity of the total R N A extracts used in these studies (data not shown). Aliquots (20 /A) of the P C R products generated from the trophoblastic cells were separated by electrophoresis in a 1.2% (w/v) agarose gel and visualized by ethidium bromide staining. The gels were then denatured with 0.5 M N a O H for 5 min, neutralized with 1 M TRIS-HC1 for 5 min and transferred onto a charged nylon membrane (Hybond + , Amersham Canada Ltd., Oakville, O N , Canada). The Southern blots were probed with a radiolabeled-cDNA specific for the cadherin subtypes analysed or G A P D H according to the methods of MacCalman et al (1996). The blots were then washed twice with 2 x SSPE (20 x SSPE consists of 0.2 M sodium phosphate, p H 7.4 containing 25 m M E D T A and 3 M NaCl ) at room temperature, twice with 2 x SSPE containing 0.1% SDS at 55°C and twice with 0.2 x SSPE at room temperature. The blots were subjected to autoradiography to detect the hybridization of the radiolabeled probes to the P C R products. The resultant autoradiograms were then scanned using a laser densitometer (Scion Corporation, Frederick, M D , U S A ) and the absorbance values obtained for each of the distinct cadherin P C R products normalized relative to the corresponding G A P D H absorbance value. 231 Western blot analysis. Cultures of JEG-3 cells or E V T s were washed three times in P B S and incubated in 100 ul of cell extraction buffer (Biosource International, Camarillo, C A ) supplemented with 1.0 m M P M S F and proteinase-inhibitor cocktail for 30 minutes on a rocking platform. The cell lysates were centrifuged at 10, 000 x g for 30 minutes at 4 °C and the supernatants used for Western blot analysis. The concentrations of protein in the cell lysates were determined using a B C A kit (Pierce Chemicals, Rockford, IL, U S A ) . Western blots containing aliquots (30 pg) of the cell lysates were prepared and immunoblotted as previously described using monoclonal antibodies directed against either the C-terminal of human N-cadherin (clone 13A9, obtained as a gift from K . Green, North Western University, Chicago, U S A ) , the N-terminal of N-cadherin (clone 8C11, Sigma Aldrich), the carboxy terminal of E-cadherin (Transduction Laboratories, U S A ) , a-catenin (Transduction Laboratories), P-catenin (Transduction Laboratories), y-catenin (Transduction Laboratories) or p 1 2 0 Catenin (Transduction Laboratories). To stanadardise the amounts of protein loaded in each lane, the blots were reprobed with a monoclonal antibody directed against human P-actin (Sigma Aldrich). The Amersham E C L system was used to detect the amount of each antibody bound to antigen. The resultant autoradiograms were analysed by U V densitometry. The absorbance value obtained for the cadherin protein species in each of the cell lysates was normalized relative to the corresponding P-actin absorbance value. 232 Immunoprecipitations. Total protein lysates from JEG-3 choriocarcinoma cells cultured in 100mm culture plates transfected with a full-length N-cadherin c D N A construct (p-Ncad) or a LacZ c D N A construct (p-LacZ) and E V T s propagated from first trimester chorionic villous explants were extracted with the cell extraction buffer (Biosource International, Camarillo, C A ) described above. A monoclonal antibody directed against human P-catenin (Transduction Laboratories) was used to immunoprecipitate P-catenin from these total protein lysates following standard immunoprecipitation protocols. Briefly, 10pl of p-catenin antibody was added to approximately 1ml of protein lysate and incubated overnight at 4°C. Afterwards, protein lysates were incubated with 30pl of Protein A agarose beads for 2h at 4°C, and following repeated (3X) washing of the bead pellet in RIP A buffer, immunoprecipitates were subjected to polyacrylamide gel electrophoresis and Western blot analysis utilizing antibodies directed against P-catenin, E-cadherin or N-cadherin (antibodies described above). Function perturbing antibodies. Function perturbing monoclonal antibodies previously described (Volk et al, 1990; Hengel et al, 1999) were used to inhibit to inhibit the function of N-cadherin (Sigma Aldrich, Clone GC-4)) and E-cadherin (Sigma Aldrich, Clone D E C M A - 1 ) . Antibody working dilutions were determined by trial. Specifically 1:25, 1:50 and 1:100 dilutions were used in invasion and cell hanging drop assays (diluted in D M E M media). After 233 determining the most efficient concentration of antibody, a 1:50 dilution was used in experiments. s i R N A transfection. s i R N A (Xeragon Inc, Germantown, M D ; 13.5 ug/100 mm culture dish) targeting the human E-cadherin and N-cadherin m R N A transcript (5'-A A G C C C G T C C C T C C A C C T A C A - 3 ' ) were transfected into either JEG-3 cells or E V T s using oligofectamine reagent (Invitrogen) according to a protocol outlined by the manufacturer. JEG-3 cells or E V T s transfected with a non-silencing, scrambled s i R N A (5'- A T T T C T C C G A A C G T G T C A C G T - 3 ' ) or cultured in the presence of transfection reagent alone, served as negative controls for these studies. The concentration of s iRNAs used in these experiments was selected on the basis of previous studies using primary cultures of E V T s . Following optimization of the Oligofectamine:siRNA concentration ratio, all experiments were performed using E V T s that had been transfected with either s i R N A or cultured with the transfection reagent alone for at least 24 h. Expression vectors. A mammalian expression vector (pCEP-Pu) containing a full length human N-cadherin c D N A (p-Ncad) was generously provided by Dr. K . Green (NorthWestern University, U S A ) . 234 Mammalian expression vectors ( p X M E ) containing the c D N A constructs encoding the E -cadherin cytoplasmic domain (p-ECD) and the E-cadherin membrane-anchored (p-EM) cytoplasmic domain, were generous gifts from Dr. A . Bosserhoff (Institute of Pathology, University of Regensburg, Regensburg, Germany). To target the cadherin cytoplasmic domain to the plasma membrane, the E-cadherin M c D N A was modified by ligating a myristoylation signal from the vector M (Aronheim et al, 1994). These vectors are described in detail elsewhere (Kuphal and Bosserhoff, 2006). A mammalian expression vector (pcDNA3.1) containing a cadherin chimeric c D N A consisting of an extracellular domain corresponding to the five extracellular repeat motifs of N-cadherin, and the transmembrane and cytoplasmic domains of E-cadherin (p-N/E), was generously provided by Dr. M . Wheelock (Eppley Institute, Nebraska, U S A ) . A pcDNA3.1 expression vector containing the P-galactosidase gene (p-LacZ; Invitrogen) was used to determine transfection efficiency and also served as a control for these studies. Generation of stably transfected JEG-3 cell lines. Stable transfections were performed to establish clonal JEG-3 cell lines constitutively expressing p-Ncad, p -N/E or p-LacZ. Likewise, stable transfections were performed to establish clonal E V T cell lines constitutively expressing p - E C D and p - E M . Each of these expression vectors (1.0 pg/ml) was transfected into JEG-3 cells using Exgen 500 transfection reagent (Fermentas, Burlington, O N , Canada) according to the 235 manufacturer's protocol. Colonies were first selected after 48 h of culture using either puromycin antibiotic (3 ug/ml D M E M ; Invitrogen) for p-Ncad transfectants or G418 antibiotic (400 ng/ml D M E M ; Invitrogen) for p -N/E, p - E C D , p - E M or p-LacZ transfectants. Positives were then subcloned by limiting dilution and expanded into cell lines that were maintained in the selection medium. A t least three independent clones were selected per construct based solely on expression levels of the exogenous protein, as determined by Western blot analysis (data not shown). Transwel l invasion assays. Cellular invasion assays were performed by using Transwells fitted with Mil l ipore Corp. membranes coated with a thin layer of growth factor-reduced Matrigel (6.5-mm filters, 8-um pore size; Costar, Toronto, O N , Canada) as previously described. Briefly, 2 x 10 4 cells/200 pl of D M E M supplemented with 10 % F B S were plated in the upper wells of the Transwells invasion chambers. The Transwells were then immediately immersed into the lower wells of the invasion chamber which contained 800 pl of D M E M . Invasion assays were performed for 24 h (EVTs) or 48h (JEG-3 cells) in a humidified environment (5% CO2) at 37°C after which, cells from the upper surface of the Matrigel layer were completely removed by gentle swabbing. The remaining cells which had invaded into the Matrigel and appeared on the underside of the filters were fixed and stained using a Diff-Quick Stain kit (Dade A G , Dudingen, Switzerland) according to the protocol outlined by the manufacturer. The filters were then rinsed with water, excised from the Transwells, and mounted upside-down onto glass slides. Invasion indices were determined by 236 counting the number of stained cells in 10 randomly selected, non-overlapping fields at 400X magnification using a light microscope. Each cell culture was tested in triplicate wells, on three independent occasions. Proliferation and apoptosis assays. A Brdu labeling and detection kit (Brdu labeling and detection kit II: Roche Diagnostics) was used to determine the effects of exogenous N-cadherin expression in JEG-3 cell proliferation. Briefly, experimental JEG-3 cells were cultured in the presence of B r d U ( lOuM) prior to being fixed in 70% ethanol containing 15mM glycine, p H 2.0 for 20 min at -20°C. B r d U was immunolocalized in these fixed cultures using a fluorescin conjugated mouse monoclonal antibody directed against B r d U (Roche Diagnostics). Cells staining positive for B r d U were counted in 10 random fields of view, (200X magnification) and a ratio between D A P I stained versus B r d U stained cells was obtained and used to determine the percentage of cells undergoing proliferation. Cells were plated in triplicate per assay, and the assay was performed on three independent occasions (n=3). A M30 C y t o D E A T H apoptosis kit (Roche Diagnostics) was used in assaying apoptosis in experimental cells transfected with s i R N A constructs. The M 3 0 C y t o D E A T H kit utilizes a fluorescin conjugated mouse monoclonal antibody (clone M30) that detects a caspase cleavage product of cytokeratin 18. Briefly, following the manufacturers protocol, experimental cells cultured on glass cover slips in 6-well plates were fixed in methanol, 237 washed and permeated with a buffer solution containing Tween 20, and incubated with lOOul M30 C y t o D E A T H fluorescein antibody (1:250 dilution) for 60min at RT. Following antibody incubation, cells were washed in washing buffer and then mounted using D A P I onto glass microscope sides and analysed under a fluorescent microscope. Cells staining positive for M 3 0 were counted in 10 random fields of view, (200X magnification) and a ratio between D A P I stained versus M30 stained cells was obtained and used to determine the percentage of cells undergoing apoptosis. Cells were plated in triplicate per assay, and the assay was performed on three independent occasions (n=3). Cellular aggregation assays. Cellular aggregation assays were performed using the cell hanging-drop method (Getsios et al, 2004). Briefly, trypsinized single cell suspensions (1.5 x 10 5 cells/ml) treated with E D T A and passaged through 20pm nylon sieves (Falcon) were prepared in D M E M media containing 10% F B S . From these suspensions, three 20pl droplets were pippetted onto the underside of 6cm culture dish lids. Lids containing the three cell droplets were carefully placed onto their respective culture dishes containing 2ml of I X P B S or D M E M media and incubated for 4h in a humidified cell culture incubator at 37°C, 5% CO2. After incubation, culture dish lids containing the hanging drops were inverted and glass coverslips were mounted onto the cell-drop suspensions. The extent of cellular aggregation was qualitatively determined by observing the cell-drop suspensions under an inverted light microscope. Each cell hanging-drop experiment was repeated a minimum of three times. 238 Statistical Analysis. The absorbance values obtained from the autoradiograms generated by Southern or Western blotting were subjected to statistical analysis using GraphPad Prism 4 computer software (San Diego, C A , U S A ) . Statistical differences between the absorbance values were assessed by the analysis of variance ( A N O V A ) . Significant differences between the means were determined using Dunnett's test. Differences were considered significant for P < 0.05 (Getsios et al, 1998; Chou et al, 2002). Cellular invasion was analysed by one-way A N O V A followed by the Tukey multiple comparison test (Xu et al, 2002). Differences were accepted as significant at P <0.05. 239 Results E-cadherin and N-cadherin are differentially expressed between poorly and highly invasive trophoblastic cells Semiquantitative R T - P C R using primers specific for E-cadherin followed by Southern blot analysis revealed high m R N A levels of E-cadherin from c D N A s generated from total R N A extracted from JEG-3 choriocarcinoma cells, a poorly-invasive mononuclear trophoblastic cell lineage (Figure 4.2.1-A). Semiquantitative R T - P C R using primers specific for N-cadherin failed to detect any significant m R N A levels of N-cadherin in these cells. Conversely, in c D N A s generated from total m R N A extracted from highly invasive E V T s , high levels of N-cadherin m R N A were detected while levels of E -cadherin m R N A expression were undetectable (Figure 4.2.1-A). To further confirm these findings, Western blot analysis was performed using E-cadherin and N-cadherin monoclonal antibodies. Western blot analysis revealed a single protein species for both E-cadherin (120kE)a) and N-cadherin (130kDa). Furthermore, the same differential expression profile was demonstrated between E - and N-cadherin in these two trophoblastic cell lines (Figure 4.2.1-B). These findings are in agreement with other studies that link E-cadherin expression to a poorly invasive epithelial phenotype (Shih et al, 2002). Furthermore, these are the first studies to describe the expression of N -cadherin in highly-invasive subpopulations of E V T s propogated from chorionic villous explants. 240 E-cadherin functions as an invasion suppressor and promotes cellular aggregation in JEG-3 cells E-cadherin has been described as a tumor suppressor gene and has been shown to promote strong cell-cell adhesion and cellular aggregation in epithelial cells. To examine whether E-cadherin functions in a similar manner in human trophoblasts I transfected s i R N A designed against E-cadherin into JEG-3 choriocarcinoma cells to knock-down endogenous E-cadherin levels. Semiquantitative R T - P C R and Western blot analysis using primers specific for E-cadherin and the monoclonal antibody described above for E-cadherin were performed in order to demonstrate a significant reduction in m R N A and protein levels of E-cadherin in JEG-3 cells transfected with E-cadherin s i R N A (Figure 4.2.2-A and -B) . Cellular aggregation between E-cadherin s i R N A transfected JEG-3 cells and non-silencing s i R N A transfected control JEG-3 cells was determined by subjecting cells to a hanging drop assay (Figure 4.2.3). The hanging drop experiment, that assays a cells aggregative ability, demonstrated qualitatively that cells with significantly reduced E-cadherin levels were less adhesive than control JEG-3 cells (Figure 4.2.3). To determine whether E-cadherin also plays a key role in suppressing trophoblast invasion I cultured E-cadherin s i R N A and non-silencing s i R N A transfected JEG-3 cells onto Matrigel-coated Transwell invasion chambers for 48h. JEG-3 cells with significantly lower levels of E-cadherin were significantly more invasive than JEG-3 241 cells transfected with the s i R N A control or than untreated JEG-3 cells (Figure 4.2.2-C). JEG-3 cells were also cultured in the presence of a function perturbing antibody for E -cadherin to examine whether the significant increase in invasive capacity observed in JEG-3 cells with lowered levels of E-cadherin was do to a reduction in E-cadherin cell-cell adhesion function. JEG-3 cells cultured in the presence of the E-cadherin function-perturbing antibody were significantly more invasive than JEG-3 cells cultured in the absence of the antibody (Figure 4.2.4). Loss of N-cadherin expression and function reduces the invasive capacity of E V T s without compromising cell proliferation or promoting apoptosis Recent findings that have demonstrated N-cadherin to promote invasion in a number of cancer and normal epithelial cell models, and my recent observation that invasive human E V T s express N-cadherin prompted me to investigate a potential role for N-cadherin in promoting trophoblast invasion. Human E V T s derived from first trimester chorionic villous tissue were transfected with s i R N A specific for N-cadherin to knock-down endogenous N-cadherin levels. To assess s i R N A efficacy, semi-quantitative R T - P C R and Western blot analysis were performed, and demonstrated a significant reduction in both N-cadherin m R N A and protein levels (Figure 4.2.5-A and -B) . In order to determine whether N-cadherin facilitates E V T invasion, s i R N A transfected E V T s were cultured in Matrigel-coated Transwell invasion chambers for 24h. The invasion assays demonstrated that E V T s transfected with N-cadherin s i R N A were significantly less invasive than E V T s transfected with a non-silencing s i R N A control or untransfected 242 E V T s (Figure 4.2.5-C). To investigate whether the reduction in invasive capacity in E V T s transfected with N-cadherin s i R N A was potentially due to a loss of N-cadherin cell-cell adhesion function, E V T s were cultured in the presence of a N-cadherin function-perturbing antibody that binds to its extracellular domain, and assayed for invasive potential as described above. Consistent with my initial findings, perturbation of endogenous N-cadherin led to a significantly less-invasive phenotype than E V T s cultured without the function-perturbing antibody (Figure 4.2.6). I next wished to examine whether the observed loss in invasive capacity in E V T s due to endogenous knock-down of N-cadherin was the result of changes in cell proliferation or increased rates of apoptosis, as N-cadherin has been demonstrated to influence these cellular events (Luo and Radice, 2005). To do this, N-cadherin s i R N A transfected and non-silencing s i R N A transfected E V T s were assayed using a Brdu proliferation assay kit to assay for cell proliferation or a caspase-labeling apoptosis assay kit to assay for apoptosis. Neither cell proliferation nor apoptosis were significantly affected in E V T s with significantly reduced levels of N-cadherin (Figure 4.2.7-A and -B) . This data confirms that the decrease in invasive capacity due to a decrease in N-cadherin expression is indeed attributable to an invasion-promoting affect of N-cadherin. Loss of N-cadherin promotes cellular aggregation in EVTs Although a significant reduction in N-cadherin levels mediated through s i R N A knock-down in E V T s did not result in de novo expression of E-cadherin (Figure 4.2.8), I was 243 interested in examining whether the reduction of N-cadherin would affect E V T cell adhesion/aggregation. E V T s transfected with N-cadherin s i R N A or non-silencing s i R N A were subjected to a hanging-drop assay to analyze cell aggregation ability. Interestingly, a significant reduction in N-cadherin levels in E V T s resulted in an increase in aggregative ability as shown qualitatively in Figure 4.2.9. Exogenous expression of N-cadherin in J E G - 3 cells results in an increase in invasive phenotype without compromising E-cadherin expression and/or function I next wished to examine whether the exogenous expression of N-cadherin could promote an invasive phenotype in JEG-3 trophoblastic cells, a cell line that is normally poorly-invasive and characterized by high levels of E-cadherin. The mammalian expression vector pCEP-Pu containing the full-length N-cadherin c D N A (p-Ncad), obtained as a generous gift from Dr. K . Green, Northwestern University, Chicago U S A , was transfected into JEG-3 cells. Western blot analysis using the 13A9 monoclonal antibody directed against the amino terminal of N-cadherin generated a single band at 130kDa in JEG-3 cells stably transfected with this vector (Figure 4.2.10-A). JEG-3 cells were also transfected with a pcDNA3.1 vector containing LacZ that served as a control (p-LacZ). JEG-3 cells stably transfected with p-Ncad or p-LacZ, or untransfected JEG-3 cells were subjected to Matrigel-coated Transwell invasion assays following the exact protocol as described above. Consistent with recent studies that have demonstrated the ability of N -cadherin to promote an invasive phenotype in breast cancer cell lines and breast BT20 epithelial cells (Islam et al, 1996; Hazan et al, 2000), JEG-3 cells acquiring exogenous 244 N-cadherin developed a significantly higher invasive capacity compared to JEG-3 cells transfected with p-LacZ or untransfected J E G cells (Figure 4.2.10-B). To determine whether the increase in invasive capacity in JEG-3 cells exogenously expressing N-cadherin was due to N-cadherin cell-cell adhesive function, I subjected JEG-3 cells exogenously expressing N-cadherin to a Matrigel-coated Transwell invasion assay in the presence of a function-perturbing antibody raised specifically against the amino terminal of N-cadherin ( K i m et al, 2000). A s represented in Figure 4.2.11, JEG-3 cells exogenously expressing N-cadherin treated with the function-perturbing antibody were significantly less invasive than N-cadherin-expressing JEG-3 cells cultured in the absence of the antibody. Though the morphology of N-cadherin transfected JEG-3 cells did not appear to change, as assessed through microscopic analysis, I examined whether endogenous levels of E -cadherin were affected due to exogenous expression of N-cadherin in JEG-3 cells. A s shown in Figure 4.2.10-A, Western blot analysis utilizing a monoclonal antibody directed against E-cadherin, which detected a single protein band of 120kDa, revealed no change in protein levels of E-cadherin in lieu of exogenous N-cadherin expression. To determine whether exogenously expressed N-cadherin influenced the proliferation of JEG-3 cells, a Brdu-labeling kit was employed. However, there were no differences in cell proliferation detected between N-cadherin transfected versus untransfected cells (Figure 4.2.12). 245 In addition to looking for changes in E-cadherin expression/localization, I also looked at the protein expression levels of P-catenin, a-catenin, and p l 2 0 catenin, with the intent of gaining a better understanding of whether the gain-of N-cadherin expression and/or function might lead to the disruption/alteration of adherens junction formation, thus leading to an increase in invasive capacity in JEG-3 trophoblastic cells. Util ising Western blot analysis and monoclonal antibodies directed against the above-mentioned catenins, I detected single-band protein species for P-catenin (98 kDa) and p l 2 0 catenin (120 kDa), and a doublet protein species (102 kDa and 90 kDa) for a-catenin in JEG-3 cells transfected with the N-cadherin or LacZ expression vectors. JEG-3 cells expressing exogenous N-cadherin were shown to have significantly reduced levels of P- and a-catenin protein expression (Figure 4.2.13-A). However, immunnoprecipitation of p-catenin followed by polyacrylamide electrophoresis and immunoblotting using an antibody directed against E-cadherin demonstrated that there was no detectable change in P-catenin association with E-cadherin, suggesting that adherens junction formation were not compromised (Figure 4.2.13-B). Indeed, extraction of cell membrane and soluble protein fractions from N-cadherin- and LacZ-transfected JEG-3 cells demonstrated that levels of P-catenin in the soluble fraction of N-cadherin-expressing JEG-3 cells was significantly lower than in control LacZ-transfected cells (Figure 4.2.13-C). Interestingly, p-catenin immunnoprecipitation followed by probing with the 13A9 N -cadherin monoclonal antibody demonstrated that exogenous N-cadherin, like endogenous E-cadherin, also associates with p-catenin and therefore may also participate in the formation of adherens-like junctions. 246 Because exogenous N-cadherin was shown to bind with P-catenin in JEG-3 cells, I was interested in whether endogenous N-cadherin in E V T s interacted with P-catenin. Immunoprecipitation of P-catenin from protein lysates obtained from E V T s revealed that P-catenin does indeed bind to endogenous N-cadherin, suggesting a possible role for N -cadherin in facilitating adherens-like junctions in E V T s (Figure 4.2.13-B). However, the endogenous levels of P-catenin in E V T s are significantly lower than in JEG-3 cells whereas levels of a-catenin in E V T s were undetectable (Figure 4.2.13-A). Exogenous expression of N-cadherin in JEG-3 cells promoted an invasive phenotype without compromising E-cadherin expression or E-cadherin's association with P-catenin. I was therefore interested in determining whether exogenous expression of N-cadherin in JEG-3 cells affected cell-cell adhesion, even though E-cadherin protein levels and cellular localization seemed to suggest strong cell-cell interaction. JEG-3 cells transfected with p-Ncad or p-LacZ were subjected to a cell-hanging drop assay for 4h. A s shown in Figure 4.2.14, the cell-cell aggregative abilities between these two JEG-3 populations did not qualitatively differ, suggesting that there were no changes in cell-cell adhesion associated with de novo expression of N-cadherin. 247 The N-terminal extracelluar domain of N-cadherin is required for promoting JEG-3 cell invasion Previous studies have lead to the suggestion that the extracellular domain of N-cadherin is necessary to elicit an invasive phenotype in certain cell models ( K i m et al, 2000). To investigate whether N-cadherin may be facilitating cell-invasion in a similar extracellular-dependent manner, I transfected JEG-3 trophoblastic cells with a chimeric cadherin c D N A construct ligated into the pcDNA3.1 mammalian expression vector (p-N / E ) . The cadherin chimeric c D N A construct contained the 5 extracellular (EC) motifs corresponding to those of N-cadherin, and whose transmembrane and cytoplasmic domains corresponded to those of E-cadherin. This c D N A construct has been previously characterized elsewhere and has been demonstrated to function as a cell adhesion molecule participating in adherens-like junctions ( K i m et al, 2000). To confirm that the chimeric cadherin expression vector was expressing the chimeric cadherin protein, I subjected protein lysates extracted from transfected JEG-3 cells to Western blot analysis using a monoclonal antibody directed against the amino terminal of N-cadherin (Clone 8C11; Figure 4.2.15-A). In accordance with the manufacturers predicted band size, a lOOkDa protein product was detected in JEG-3 cells exogenously expressing the chimeric p -N/E cadherin construct. In addition to the chimeric construct, I also transfected JEG-3 cells with p-Ncad and p-LacZ expression vectors and subjected the transfected cells to an invasion experiment as assayed by culturing cells in Matrigel-coated Transwell invasion chambers for 48h. In E V T s , which served as a postive control for N-cadherin expression, a single 130 k D a protein species was detected. JEG-3 trophoblastic cells transfected with 248 p-N/E demonstrated a significantly more invasive phenotype compared to JEG-3 cells transfected with p-LacZ, and demonstrated a similar invasive capacity to JEG-3 cells transfected with p-Ncad (Figure 4.2.15-B). The cytoplasmic domain of E-cadherin elicits a less-invasive phenotype in E V T s A previous study done by Kuphal et al (2006) demonstrated that the cytoplasmic domain of E-cadherin was sufficient to elicit a reduction in invasive phenotype, as well as a reduction in growth and survival in melanoma cells expressing endogenous N-cadherin. In view of these observations, I wished to determine whether the cytoplasmic domain of E-cadherin could influence the invasive capacity of E V T s in a similar manner. A membrane-anchored (p-EM) or soluble (p-ECD) E-cadherin cytoplasmic domain expression vectors were stably transfected into E V T s , and cells were assayed for invasive capacity through culturing in Matrigel-coated Boyden Transwell chambers for 24h. Western blot analysis using protein lysates extracted from E V T s transfected was performed to demonstrate exogenous expression of the cytoplasmic domain of E-cadherin or the chimeric N/E-cadherin construct (p-N/E) using a monoclonal antibody directed against the carboxy terminal of E-cadherin (Figure 4.2.16-A). Western blot analysis detected a single protein species of 130 kDa in p -N/E transfected E V T s , one protein species of approximately 30 kDa in p - E M transfected E V T s , two major protein species of approximately 30 and 25 kDa in p - E C D transfected E V T s and a single protein species of 120 kDa in JEG-3 cells, which served as a positive control for E-cadherin expression. E V T s transfected with p - E M or p - E C D were significantly less-invasive than E V T s 249 transfected with the LacZ control expression vector (Figure 4.2.16). I also wished to analyze i f there were any differences in aggregative ability between the truncated and chimeric cadherin transfected E V T s and LacZ transfected control E V T s . Hanging-drop analysis demonstrated that in E V T s exogenously expressing either membrane-bound or soluble cytoplasmic domain E-cadherin ( p - E M or P - E C D ) were more aggregative than E V T s over-expressing P-galactosidase or chimeric N/E-cadherin (Figure 4.2.16-B). I also transfected E V T s with the p -N/E c D N A construct to see what effect this expression vector would have on E V T invasion. The invasive capacity of E V T s exogenously expressing the chimeric N / E c D N A construct was not significantly altered, compared to the invasive capacity of LacZ-transfected E V T s (Figure 4.2.16-C). 250 Discussion The body of work presented in this chapter clearly identifies and characterizes the cadherin cell adhesion molecule N-cadherin as a key protein expressed in human E V T s propagated from first trimester chorionic villous explants and demonstrates the role N -cadherin plays in facilitating trophoblastic cell invasion in vitro. Furthermore, this study demonstrates the role E-cadherin plays in maintaining trophoblastic cells in an aggregative and poorly-invasive phenotype. Although previous studies have assigned role(s) for N-cadherin in promoting an invasive phenotype in normal epithelial and cancer cell models (Islam et al, 1996; Hazan et al, 2000), this is the first body of evidence that demonstrates through loss-of and gain-of function experiments that human trophoblastic cells utilize an N-cadherin-mediated mechanism in promoting cell invasion. This novel finding further strengthens the growing consensus that trophoblast cells differentiating along the invasive E V T pathway utilize many of the same molecular mechanisms that normal cells undergoing neoplastic transformation and metastasis use. Cadherins are calcium-dependent cell adhesion molecules that typically interact in a homophilic manner through their extracellular domains (Yagi and Takeichi, 2000). Cadherins play key roles in tissue morphogenesis and organogenesis, and are essential in many aspects of development (Thiery, 2003). In particular, cadherins have been shown to play key roles in facilitating cell-sorting and migratory events during embryogenesis, largely in part to differential and dynamic changes in the expression of cadherin subtypes in developing tissues/cells (Arias, 2001; Thiery, 2003). For example, the switching in 251 expression of E-cadherin to N-cadherin is observed during the directed movement and coalescence of mesodermal cells during gastrulation or during the migration of neural crest cells from the neuroepithelium. Similar events occur during the development of cancer, where the expression of an epithelial-associated cadherin subtype is often substituted for the de novo expression of a mesenchymal cadherin subtype (Tomita et al, 2000; Arias, 2001; Hazan et al, 2004). For example, E-cadherin expression, along with the cells epithelial morphology, is lost in many prostate carcinomas (Tomita et al, 2000). In turn, prostate carcinoma cells adopt a mesenchymal phenotype characterized in part by the novel expression of N-cadherin. M y study clearly demonstrates the differential expression between E-cadherin and N-cadherin in poorly-invasive and highly-invasive trophoblastic cells. Though I have not definitively shown that there is a "switch" in cadherin expression in differentiating E V T s , I do demonstrate that poorly-invasive and highly-invasive trophoblastic cells differentially express E - and N-cadherin, and that this differential expression pattern is associated with differences in invasive character. E-cadherin function is often lost in many epithelial cancers by mechanisms that include mutational inactivation of E-cadherin or catenin genes, transcriptional repression, extracellular domain cleavage through proteolysis, and D N A methylation of E-cadherin promoter regions (Guilford et al, 1998; Christofori and Semb, 1999; Grady et al, 2000; Poser et al, 2001). These findings indicate that E-cadherin plays an important suppressive role in epithelial tumorigenesis. In agreement with E-cadherin functioning as an invasion-suppressor, I demonstrated by way of siRNA-mediated knock-down of endogenous E-cadherin in JEG-3 trophoblastic cells that these cells adopted a more 252 invasive phenotype and became less aggregative. The understanding that cadherins play a key role in early trophoblast differentiation is not a new finding, as previous studies done by my laboratory have demonstrated the importance of the atypical/type-II classical cadherin, cadherin-11, in regulating the differentiation of subpopulations of trophoblasts along the non-invasive syncytiotrophoblast pathway (Getsios and MacCalman, 2003). In this study, E-cadherin expression and function was shown to be lost in fusing cytotrophoblasts while de novo expression of cadherin-11 was detected in the subsequently formed multinucleated syncytiotrophoblast. However, the notion that cadherins play a key role in facilitating and regulating the differentiation of trophoblasts along the invasive E V T pathway has been less well characterized. It is known that there is a marked reduction in the expression of E-cadherin in intermediate columnar E V T s and that E-cadherin expression is absent in more differentiated interstitial E V T s that harbor an invasive/migratory and fibroblastic phenotype. These observations agree with the notion that E-cadherin functions in part as an invasion-suppressor, and in the case of early E V T differentiation, may be restraining column E V T cell invasion and migration. Human E V T s propagated from first trimester chorionic villous explants fail to express E -cadherin and are therefore unsurprisingly poorly-aggregative and highly-invasive. Invasive populations of cells from other tissues have been shown to express a similar N -cadherin profile to that of invasive E V T s . For example, prostate carcinomas (Tran et al, 2002; Suyama et al, 2002; Maeda et al, 2005), melanomas (Silye et al, 1998; Sanders et al, 1999; Poser et al, 2001), squamous cell carcinomas (Islam et al, 1996) and metastatic breast cancer cells (Hazan et al, 2000) have all been shown to express high levels of N -253 cadherin and low to non-existing levels of E-cadherin. I demonstrated that s i R N A -mediated knock-down of endogenous N-cadherin in E V T s resulted in a less-invasive phenotype, a result consistent with earlier findings that demonstrated through antisense knockdown of N-cadherin in invasive squamous cell carcinoma a marked reduction in invasive capacity (Islam et al, 1996). However, in addition to E V T s acquiring a less invasive phenotype in lieu of significantly lowered N-cadherin levels, the cells aggregative ability was demonstrated to increase. This interesting finding suggests that N-cadherin may actually be promoting a scattered phenotype and weak cell-cell interactions in my cell model system. Indeed, N-cadherin is primarily expressed in adult neural tissues and fibroblasts where it has been demonstrated to mediate less stable and more dynamic forms of cell-cell adhesion (Hatta and Takeichi, 1986; Bixby and Zhang, 1990). Another possible explanation for this observation is that the loss/reduction of N -cadherin leads to the up-regulation of other cell adhesion molecules. However, I did not detect an increase in the expression of E-cadherin (unpublished observation), though the de novo expression of other cadherin subtypes and C A M s is possible and deserves further investigation. It is important to recognize the recently described differences in how E-cadherin and N -cadherin influence cell invasion. Kuphal and Bosserhoff (2006) clearly demonstrated the functional importance that the cytoplasmic domain of E-cadherin has in regulating the morphological and invasive phenotype of melanoma cells. In this study, the E-cadherin cytoplasmic domain, regardless of whether it was associated to the plasma membrane or not, was capable of down-regulating the expression of the transcription factor N F K B and 254 therefore resulted in a decrease in the expression of endogenously expressed N-cadherin. Interestingly, in this same study, the authors further demonstrated that the N-cadherin cytoplasmic domain was able to elicit the same regulation of N F K B and N-cadherin expression and therefore led to the development of melanoma cells with a lowered migratory ability and an epithelial phenotype (Kuphal and Bosserhoff, 2006). Studies describing the role(s) that N-cadherin plays in regulating cellular invasion and morphology have demonstrated the ability of N-cadherin t