Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Molecular characterization of potato leafroll luteovirus and development of genetically engineered resistance Kawchuk, Lawrence Michael 1990

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1990_A1 K39.pdf [ 8.98MB ]
Metadata
JSON: 831-1.0100308.json
JSON-LD: 831-1.0100308-ld.json
RDF/XML (Pretty): 831-1.0100308-rdf.xml
RDF/JSON: 831-1.0100308-rdf.json
Turtle: 831-1.0100308-turtle.txt
N-Triples: 831-1.0100308-rdf-ntriples.txt
Original Record: 831-1.0100308-source.json
Full Text
831-1.0100308-fulltext.txt
Citation
831-1.0100308.ris

Full Text

MOLECULAR CHARACTERIZATION OF POTATO LEAFROLL LUTEOVIRUS AND DEVELOPMENT OF GENETICALLY ENGINEERED RESISTANCE By  LAWRENCE MICHAEL KAWCHUK  B.Sc. ( H o n s . ) , The U n i v e r s i t y o f M a n i t o b a , 1985 M . S c , The U n i v e r s i t y o f M a n i t o b a , 1987 A THESIS SUBMITTED I N PARTIAL FULFILMENT THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Plant Science) We a c c e p t t h i s t h e s i s a s c o n f o r m i n g to the required standard  THE UNIVERSITY OF B R I T I S H COLUMBIA O c t o b e r 1990 © L a w r e n c e M i c h a e l Kawchuk, 1990  OF  In  presenting this thesis in partial fulfilment of the  requirements for an  advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or  by  his  or  her  representatives.  It  is  understood  that  copying  or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department The University of British Columbia Vancouver, Canada Date  DE-6 (2/88)  Qr.foW //, mO  ii ABSTRACT C o m p l e m e n t a r y DNA  (cDNA) c l o n e s  5800 n u c l e o t i d e s o f p o t a t o  leafroll virus  generated,  restriction-mapped,  one  cDNA c l o n e s  of the  e n c o d e a 23  kDa  representing  and  p r o t e i n was  (PLRV) g e n o m i c RNA  partially  an open r e a d i n g  sequenced.  frame  i d e n t i f i e d and  approximately  (ORF)  Within  that  could  further characterized.  C o m p a r i s o n o f t h e d e d u c e d amino a c i d s e q u e n c e w i t h t h e p r o t e i n amino a c i d s e q u e n c e o f t h e PAV  strain  together  w i t h i t s s i z e and  internal  w i t h i n t h e ORF  by  coat  encoding the  23 kDa  c o a t p r o t e i n , and  i n the  same r e a d i n g  t o b a c c o and  the potato  B u r b a n k ' v i a Agrobacterium One  followed  frame.  cultivars  tumefaciens  'Desiree'  to and  'Russet  m e d i a t e d gene t r a n s f e r s .  c o n s t r u c t p o s s e s s e d 12 n u c l e o t i d e s o f t h e u n t r a n s l a t e d  s e q u e n c e 5' other  t o t h e p u t a t i v e c o a t p r o t e i n gene s t a r t  c o n s t r u c t , w h i c h was  a l s o i n s e r t e d i n the  o r i e n t a t i o n t o produce negative-sense from t h i s  l e a d e r sequence.  as c h i m a e r i c  genes under t h e  m o s a i c v i r u s 35S  ORF  termination  T h r e e PLRV c o a t p r o t e i n gene s e q u e n c e s w e r e u s e d transform  BYDV  r e g i o n o f t h e i r genomes, i n c l u d i n g a 17 kDa  l a t t e r w i t h an amber c o d o n w h i c h i s i m m e d i a t e l y  a l a r g e ORF  This  location within  O t h e r s i m i l a r i t i e s w e r e o b s e r v e d b e t w e e n PLRV and  sequences i n t h i s  of the  yellow  similarity.  t h e genome s u g g e s t e d t h a t t h i s gene e n c o d e d t h e PLRV protein.  coat  of b a r l e y  d w a r f l u t e o v i r u s (BYDV-PAV) showed s i g n i f i c a n t observation  were  When t h e s e  RNA,  had  codon.  leader The  reverse 192  nucleotides  sequences were  introduced  c o n t r o l of a d u p l i c a t e d c a u l i f l o w e r  (CaMV) p r o m o t e r , t r a n s c r i p t i o n l e v e l s w e r e h i g h .  iii Both positive-sense  t r a n s c r i p t s produced potato  leafroll  coat  p r o t e i n w h i c h a c c u m u l a t e d t o maximum l e v e l s o f a p p r o x i m a t e l y and  0.01% o f t o t a l  l e a f p r o t e i n i n t o b a c c o and  0.5%  potato,  respectively. Results  show t h a t  significant  l e v e l s of inoculum  concentration-independent sustained each c o n s t r u c t , level  r e s u l t i n g i n PLRV t i t r e s  inoculated transgenic  Virus transmission  The p a t t e r n  p r o t e c t i o n w e r e t h e same f o r c o n s t r u c t s  Virus  suggesting  l e v e l s were n e g a t i v e l y  within the transgenic practical  PLRV-  and l e v e l o f  p r o d u c i n g p o s i t i v e - and  a s i m i l a r mechanism o f r e s i s t a n c e .  correlated to transcript levels  plants.  This  resistance w i l l  a p p l i c a t i o n s f o r t h e c o n t r o l , o f PLRV.  t h e m e c h a n i s m o f r e s i s t a n c e may mechanisms o f v i r u s  from  enzyme-  ' R u s s e t B u r b a n k ' was r e d u c e d s u b s t a n t i a l l y  was c o r r e l a t e d w i t h v i r u s t i t r e .  n e g a t i v e - s e n s e RNA,  with  a s l o w a s 1% o f t h e  o b s e r v e d i n u n t r a n s f o r m e d p l a n t s , a s d e t e r m i n e d by  l i n k e d immunosorbent a s s a y s .  and  r e s i s t a n c e were o b t a i n e d  infection.  also help  have  Elucidation of  understand the  iv  TABLE OF CONTENTS PAGE ABSTRACT  i  TABLE OF CONTENTS  i v  LIST OF TABLES  viii  LIST OF FIGURES  i x  LIST OF PLATES  x  ACKNOWLEDGEMENTS  x i  LIST OF ABBREVIATIONS I. II.  x i i  INTRODUCTION  1  LITERATURE REVIEW 2.1  Epiphytology 2.1.1 2.1.2 2.1.3  2.2  2.3  Virus 2.3.1 2.3.2 2.3.3 2.3.4  2.4  o f Potato  5 Leafroll  Virus  5  Symptoms o f PLRV I n f e c t i o n T r a n s m i s s i o n o f PLRV V e c t o r S p e c i f i c i t y f o r PLRV  Structure 2.2.1 2.2.2  i  of the Luteovirus  5 5 10  Genome  P h y s i c a l P r o p e r t i e s o f PLRV M o l e c u l a r P r o p e r t i e s o f PLRV 2.2.2.1 L u t e o v i r u s Genome O r g a n i z a t i o n s 2.2.2.2 S t r a t e g i e s Used t o T r a n s l a t e L u t e o v i r u s Genes 2.2.2.3 L u t e o v i r u s E v o l u t i o n a r y Relationships Induced Resistance Cross-protection Acquired Resistance Mutual Exclusion Models f o r V i r u s R e s i s t a n c e  12  ..  12 13 13 18 22 24 24 26 26 27  G e n e t i c a l l y Engineered Virus Resistance  29  2.4.1 2.4.2  31 36  Tobacco Mosaic V i r u s A l f a l f a Mosaic V i r u s  V  PAGE 2.4.3 2.4.4 2.4.5 2.4.6 2.4.7 2.4.8 2.4.9 2.4.10 2.4.11 2.4.12 III. 3.1  MATERIALS AND Preparation 3.1.1 3.1.2 3.1.3 3.1.4  3.2  Cloning 3.2.1 3.2.2 3.2.3 3.2.4  3.3  Tobacco Streak V i r u s Tobacco R a t t l e V i r u s Potato Virus X Cucumber M o s a i c V i r u s Soybean M o s a i c V i r u s Potato Virus Y S a t e l l i t e o f Cucumber M o s a i c V i r u s S a t e l l i t e of Tobacco R i n g s p o t V i r u s N o n s t r u c t u r a l V i r a l Genes Other Approaches f o r V i r u s C o n t r o l METHODS  45  o f PLRV RNA  45  M a i n t e n a n c e o f PLRV Virus Purification E x t r a c t i o n o f PLRV RNA Q u a n t i t a t i o n o f PLRV RNA  45 45 47 48  o f PLRV RNA F i r s t - S t r a n d cDNA S y n t h e s i s S e c o n d - S t r a n d cDNA S y n t h e s i s L i g a t i o n o f cDNA I n t o a V e c t o r T r a n s f o r m a t i o n o f C o m p e t e n t E.  48  coli Cells..  48 50 51 52  C h a r a c t e r i z a t i o n o f C o m p l e m e n t a r y DNA  53  3.3.1 3.3.2 3.3.3 3.3.4 3.3.5 3.3.6  53 54 55 55 56  B a c t e r i a l L y s i s and DNA F i x a t i o n P r e h y b r i d i z a t i o n of F i l t e r s R a n d o m l y P r i m e d cDNA P r o b e s F i l t e r Washing C o n d i t i o n s D e t e c t i o n of Fusion P r o t e i n A l k a l i n e L y s i s Method of P l a s m i d Isolation 3.3.7 E l e c t r o p h o r e s i s o f R e s t r i c t i o n Enzyme D i g e s t e d DNA 3.3.8 I s o l a t i o n of High M o l e c u l a r Weight P l a n t RNA 3.3.9 Northern Analysis 3.3.10 R a n d o m l y P r i m e d DNA P r o b e s 3.3.11 R e s t r i c t i o n Enzyme A n a l y s i s and Genomic Walking  3.4  38 38 39 40 40 41 42 42 43 44  Preparation 3.4.1 3.4.2  of Subclones  U n i d i r e c t i o n a l Nested Deletions P r e p a r a t i o n o f C o m p e t e n t E. c o l i C e l l s ....  56 57 58 59 60 61 62 62 63  vi  PAGE  3.5  DNA S e q u e n c i n g  64  3.5.1 3.5.2 3.5.3 3.5.4  64 65 66 66  S e l e c t i o n o f Subclones Sequencing Gels Sequencing w i t h Klenow Sequencing w i t h Sequenase  3.6  C o a t P r o t e i n Gene C o n s t r u c t s  67  3.7  T r i p a r e n t a l Mating Procedure  69  3.8  Plant Transformations  73  3.8.1 3.8.2  T r a n s f o r m a t i o n o f Tobacco Transformation of the Potato 'Desiree' Transformation of the Potato 'Russet Burbank'  3.8.3 3.9  3.10  3.11 IV.  74 Cultivar  75  Cultivar  76  A n a l y s i s of Transgenic P l a n t s  77  3.9.1 3.9.2 3.9.3  77 79 80 80 81 81  Southern A n a l y s i s I s o l a t i o n o f P o l y (A ) RNA Transgenic Plant P r o t e i n A n a l y s i s 3.9.3.1 E x t r a c t i o n o f P l a n t P r o t e i n 3.9.3.2 Electrophoresis of Protein 3.9.3.3 W e s t e r n B l o t A n a l y s i s +  PLRV C h a l l e n g e o f T r a n s g e n i c P o t a t o  82  3.10.1 3.10.2 3.10.3 3.10.4  82 83 84 85  D e t e r m i n a t i o n o f PLRV T i t r e s PLRV T i t r e s i n ' D e s i r e e ' E f f e c t o f Inoculum L e v e l s PLRV T i t r e s i n ' R u s s e t B u r b a n k '  A p h i d T r a n s m i s s i o n o f PLRV  RESULTS  AND  86  DISCUSSION  88  4.1  H o s t R e a c t i o n s t o PLRV I n f e c t i o n  88  4.2  A n a l y s i s o f PLRV cDNA  88  4.3  PLRV S e q u e n c e A n a l y s i s  90  4.4  Efficiency  of the T r i p a r e n t a l Mating Procedure  ...  96  vii PAGE 4.5  Plant Transformation E f f i c i e n c i e s  97  4.6  D e t e c t i o n o f PLRV cDNA i n T r a n s g e n i c P l a n t s  98  4.7  D e t e c t i o n o f PLRV T r a n s c r i p t i n T r a n s g e n i c Plants  99  4.8  4.9  D e t e c t i o n o f PLRV C o a t P r o t e i n i n T r a n s g e n i c Plants  100  PLRV R e s i s t a n c e  101  4.9.1 Resistance i n Transgenic 'Desiree' 4.9.2 E f f e c t o f I n c r e a s i n g t h e PLRV I n o c u l u m .... 4.9.3 R e s i s t a n c e i n Transgenic 'Russet Burbank' . 4.10 PLRV T r a n s m i s s i o n f r o m I n o c u l a t e d T r a n s g e n i c  V. VI.  102 104 107  Potato Plants  113  GENERAL DISCUSSION  119  BIBLIOGRAPHY  130  viii LIST OF TABLES TABLE 1 2  PAGE Summary o f e x a m p l e s o f g e n e t i c a l l y virus resistance  engineered plant  M. persicae t r a n s m i s s i o n e f f i c i e n c y o f PLRV from t r a n s g e n i c 'Russet Burbank'  32 113  ix LIST OF FIGURES FIGURE 1 2 3 4  PAGE  Genomic o r g a n i z a t i o n s r e p o r t e d BYDV-PAV  f o r PLRV a n d 14  Diagram o f t h e r e s t r i c t i o n s i t e s used t o prepare t h e t h r e e PLRV c o a t p r o t e i n c o n s t r u c t s  68  Schematic diagram o f t h e intermediate v e c t o r pCDXl  70  expression  S t r u c t u r e o f t h e pTiB6S3SE::pCDXl c o i n t e g r a t e o b t a i n e d by t r i p a r e n t a l m a t i n g and homologous recombination  71  5  R e s t r i c t i o n map o f t h e PLRV genome  90  6  Sequencing s t r a t e g y used t o determine t h e coat p r o t e i n c o d i n g r e g i o n o f PLRV  92  7  Nucleotide  93  8  N u c l e o t i d e s e q u e n c e (cDNA) a n d p r e d i c t e d a m i n o a c i d s e q u e n c e o f t h e PLRV 23 kDa a n d 17 kDa ORFs  94  9  D i a g r a m m a t i c r e p r e s e n t a t i o n o f t h e c h i m a e r i c genes c o n s t r u c t e d t o e x p r e s s t h e PLRV c o a t p r o t e i n g e n e ..  97  10  D e t e r m i n a t i o n o f PLRV r e s i s t a n c e i n t r a n s g e n i c ' D e s i r e e ' ( E x p e r i m e n t 1)  103  D e t e r m i n a t i o n o f PLRV r e s i s t a n c e i n t r a n s g e n i c ' D e s i r e e ' ( E x p e r i m e n t 2)  104  R e l a t i v e v i r u s accumulation i n p l a n t s a f t e r i n o c u l a t i o n w i t h PLRV u s i n g 1 ( A ) , 5 ( B ) , o r 25 (C) v i r u l i f e r o u s M. persicae  105  A v e r a g e PLRV t i t r e s o f c o m b i n e d l e a f e x t r a c t s f r o m 30 ' R u s s e t B u r b a n k ' i n o c u l a t e d b y 50 v i r u l i f e r o u s aphids  108  Number o f i n d i v i d u a l t r a n s g e n i c p l a n t s s i g n i f i c a n t PLRV t i t r e s  112  11 12  13  14  sequence o f c l o n e LP79  with  X  LIST OF PLATES  PLATE 1  PAGE  S o u t h e r n b l o t a n a l y s i s o f H i n d I I I d i g e s t e d DNA f r o m p l a n t s t r a n s f o r m e d w i t h t h e PLRV c o a t p r o t e i n gene  114  N o r t h e r n b l o t a n a l y s i s o f p o l y a d e n y l a t e d RNA f r o m p l a n t s t r a n s f o r m e d w i t h t h e PLRV c o a t p r o t e i n gene  115  W e s t e r n b l o t a n a l y s i s o f PLRV c o a t expression i n t r a n s g e n i c tobacco  protein  116  4  W e s t e r n b l o t a n a l y s i s o f PLRV c o a t expression i n transgenic 'Desiree'  protein  5  W e s t e r n b l o t a n a l y s i s o f p u r i f i e d PLRV  2  3  117 118  xi  ACKNOWLEDGEMENTS I w i s h t o e x p r e s s my s i n c e r e for  h i s supervision  am a l s o  a p p r e c i a t i o n t o D r . R.R. M a r t i n  and f i n a n c i a l  support during t h i s  i n d e b t e d t o Dr. J . McPherson f o r h e r s u p e r v i s i o n  s u p p l y i n g t h e p C D X l p l a s m i d and Agrobacterium this  study.  serving  I would  also  on my c o m m i t t e e  especially  Runeckles,  like  t o sequencing.  A special  this  thank  i s most  discussions, o f f e r e d by  a n d D r . V.C.  The g u i d a n c e  y o u i s e x t e n d e d t o D r . M. W e i n t r a u b helpful  a t t h e Vancouver  a d v i c e and f o r making Agriculture  Canada  for their  helpful  discussions with respect  fortechnical  assistance  assistance,  and D r .  available  Research  I a l s o w i s h t o t h a n k Mr. K. T u r n e r a n d Mr. D.  Quail  o f Dr.  appreciated.  Station.  A.  used i n  Rochon f o r  The g u i d a n c e  acknowledged.  thesis  R. S t a c e - S m i t h f o r t h e i r facilities  D r . D.M.  members, D r . E.P.M. C a n d i d o  i s also gratefully  M. Shaw i n e d i t i n g  t o thank  I  and f o r  tumefaciens  and f o r t h e v a l u a b l e  with respect  t h e o t h e r committee  the  study.  to tissue  Kirkham  culture,  Ms.  a n d Mr. W. M a c D i a r m i d f o r  i n the p r e p a r a t i o n s of photographs.  Financial  s u p p o r t by t h e N a t u r a l  Research Council scholarships,  o f Canada i n t h e f o r m o f p o s t g r a d u a t e  by t h e Vancouver  Research  h e l d b y D r . R. R. M a r t i n i s g r a t e f u l l y Finally,  Station,  and from g r a n t s  acknowledged.  I want t o e x p r e s s my s i n c e r e s t  Mary-Ann a n d Amanda f o r t h e i r encouragement.  S c i e n c e s and E n g i n e e r i n g  appreciation to  u n d e r s t a n d i n g , p a t i e n c e , and  xii  LIST OF ABBREVIATIONS A AMV AUG BAP bp BSA BWYV BYDV C CaMV CAT cDNA Ci CIP CMV cpm CRLV D dATP dCTP DEPC dGTP dITP DNA DTT dTTP E EDTA ELISA F G GA GUS h H HEPES I IAA IgG K kb kDa L LB M MAV MES min 3  adenosine or alanine a l f a l f a mosaic v i r u s t r a n s l a t i o n s t a r t codon benzylamino purine base p a i r b o v i n e serum a l b u m i n beet western yellow v i r u s b a r l e y y e l l o w dwarf v i r u s cytosine or cysteine c a u l i f l o w e r mosaic v i r u s chloramphenicol acetyl transferase complementary d e o x y r i b o n u c l e i c a c i d Curie c a l f i n t e s t i n a l phosphatase cucumber m o s a i c v i r u s counts p e r minute carrot red leaf virus aspartic acid 2'-deoxyadenosine 5'-triphosphate 2'-deoxycytosine 5'-triphosphate d i e t h y l pyrocarbonate 2'-deoxyguanosine 5'-triphosphate 2'-deoxyinosine 5'-triphosphate deoxyribonucleic acid dithiothreitol 2'-deoxythymidine 5'-triphosphate glutamic acid ethylenediaminetetraacetic acid e n z y m e - l i n k e d immunosorbent assay phenylalanine guanosine or g l y c i n e gibberellic acid (3-glucuronidase hour histidine N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic isoleucine indole-3-acetic acid immunoglobulin G lysine kilobase kiloDalton leucine L u r i a - B e r t a n i medium molarity or methionine b a r l e y y e l l o w dwarf v i r u s serotype 2-[N-Morpholine]ethanesulfonic acid minute  acid  xiii M mRNA MS NAA N NOS NPT nt OD ORF P PAV PBS PEBV PEMV PLRV poly(A ) PVP PVX PVY Q R Rl RNA RMV rpm RPV S SDS SDV SGV SMV SSC T TAE TAV TBE TCA T-DNA TE TEMED TEV Ti TMV TNE TobRV Tris tRNA TRV TSV TVMV U r  +  r e l a t i v e m o l e c u l a r mass messenger r i b o n u c l e i c a c i d M u r a s h i g e and Skoog media a-naphthaleneacetic acid any n u c l e o t i d e o r a s p a r a g i n e nopaline synthase neomycin p h o s p h o t r a n s f e r a s e nucleotide optical density open r e a d i n g f r a m e proline b a r l e y y e l l o w dwarf v i r u s serotype phosphate b u f f e r e d s a l i n e pea e a r l y browning v i r u s pea e n a t i o n mosaic v i r u s potato l e a f r o l l virus polyadenylated polyvinylpyrrolidone potato virus X potato virus Y glutamine arginine f i r s t f i l i a l transgenic generation ribonucleic acid b a r l e y y e l l o w dwarf v i r u s serotype r e v o l u t i o n s p e r minute b a r l e y y e l l o w dwarf v i r u s serotype Svedberg u n i t o r s e r i n e sodium d o d e c y l s u l f a t e soybean dwarf v i r u s b a r l e y y e l l o w dwarf v i r u s serotype soybean mosaic v i r u s sodium s a l i n e c i t r a t e thymidine or threonine tris-acetate-EDTA buffer tomato aspermy v i r u s t r i s - b o r i c acid-EDTA b u f f e r trichloroacetic acid t r a n s f e r DNA o f T i p l a s m i d tris-EDTA buffer N,N,N',N'-tetramethylethylenediamine tobacco etch v i r u s turner inducing tobacco mosaic v i r u s tris-sodium chloride-EDTA buffer tobacco ringspot v i r u s t r i s ( h y d r o x y m e t h y l ) aminomethane hydrochloride transfer ribonucleic acid tobacco r a t t l e v i r u s tobacco streak v i r u s tobacco vein mottling v i r u s uracil  xiv UAG v V VPg w W X Xgal Y  t r a n s l a t i o n amber s t o p c o d o n volume valine genome-linked v i r a l p r o t e i n weight watt or tryptophan any amino a c i d 5-bromo-4-chloro-3-indolyl-p-D-galactoside tyrosine  1 INTRODUCTION  I.  Potato l e a f r o l l v i r u s  (PLRV) causes a p l a n t d i s e a s e t h a t i s  r e s p o n s i b l e f o r s i g n i f i c a n t economic l o s s e s i n p o t a t o tuberosum  L.) by r e d u c i n g both q u a l i t y and y i e l d .  almost every l o c a t i o n throughout ( H a r r i s o n , 1984).  grown  (Solarium  I t occurs i n  the world i n which potatoes a r e  In some areas t h e i n c i d e n c e o f i n f e c t i o n  has been 100% and y i e l d l o s s e s o f up t o 92% have been r e c o r d e d (Harper e t al.,  1975).  PLRV i s a member o f the l u t e o v i r u s group Harrison,  (reviewed by  1984; Waterhouse et a l . , 1988; M a r t i n et  al.,  1990),  e s t a b l i s h e d by the I n t e r n a t i o n a l Committee on Taxonomy o f V i r u s e s i n 1975  (Shepherd  e t a l . , 1976).  (BYDV), and beet western  yellows  d e f i n i t e members a t t h a t time.  Only PLRV, b a r l e y y e l l o w dwarf (BWYV) were i n i t i a l l y  l i s t e d as  Since then the number o f members  has i n c r e a s e d t o 12 but s e v e r a l o f these may e v e n t u a l l y be i d e n t i f i e d as t h e same v i r u s . member o f the group.  BYDV-MAV i s t h e d e s i g n a t e d type  The group name i s d e r i v e d from the  Latin  " l u t e u s " which means yellow, s i n c e a l l o f the o r i g i n a l members caused y e l l o w i n g symptoms i n t h e i r h o s t . L u t e o v i r u s e s a r e c o n f i n e d t o t h e phloem t i s s u e o f t h e i r host and are not m e c h a n i c a l l y t r a n s m i s s i b l e .  However they a r e  t r a n s m i t t e d i n a c i r c u l a t i v e , non-propagative aphid v e c t o r s .  manner by t h e i r  Most l u t e o v i r u s e s have a l i m i t e d host  range  although a few such as BWYV have a very broad host range. group,  As a  these v i r u s e s occur i n numerous crop p l a n t s worldwide and  2 are  responsible  f o r s i g n i f i c a n t economic l o s s e s .  Control  l u t e o v i r u s e s i s extremely d i f f i c u l t because of t h e i r r e l a t i o n s h i p and s e r v e as  t h e i r p r e s e n c e i n weeds and  inoculum r e s e r v o i r s .  persistent  f a s h i o n by  I t has protect the  to report  symptoms t y p i c a l  one  in a  disseminated  i n s e r t i o n and  Various  on t h e  v i r u s and  the  cross-protection development protein  l e v e l s of r e s i s t a n c e have been o b s e r v e d  observed using the  properties  c o a t p r o t e i n genes were not  v i r u s e s examined, s u g g e s t i n g  of  have  d i f f e r e n t v i r u s coat  The  that  expression  (1990) h a v e r e v i e w e d t h e  gene s t u d i e d .  was  plant  ( R o g e r s e t a l . , 198 6) virus  cross-  (1929)  o f a s e c o n d s t r a i n upon i n o c u l a t i o n w i t h  plants expressing  genes.  McKinney  s t r a i n of a v i r u s f a i l e d to develop  B e a c h y e t al.  of t r a n s g e n i c  of the  resistance  identical  t h a t more t h a n one  depending  amongst  mechanism  may  involved. The  the  1958).  f u r t h e r i n v e s t i g a t i o n of the  phenomenon.  be  PLRV i s  " c r o s s - p r o t e c t i o n " i n which a  f o r e i g n g e n e s i n p l a n t genomes  the  species,  Harrison,  Recent developments i n the  facilitated  often  b e e n shown t h a t d i f f e r e n t s t r a i n s o f PLRV w i l l  inoculated with  strain.  grasses which  tubers.  (Webb e t a l . , 1952;  first  vector  In a d d i t i o n t o t r a n s m i s s i o n  several aphid  through i n f e c t e d potato  of  o b j e c t i v e of t h i s  PLRV c o a t p r o t e i n g e n e .  s t u d y was This  gene was  develop g e n e t i c a l l y engineered potato in potato.  T r a n s f o r m a t i o n was  to i d e n t i f y  PLRV c o a t p r o t e i n gene s i n c e h i g h  t h e n t o be  leafroll  initially  and  virus  c a r r i e d out  characterize used  to  resistance using  l e v e l s o f r e s i s t a n c e had  the been  3 obtained viruses  with specific (reviewed  by  coat p r o t e i n genes from o t h e r  B e a c h y et  p r o t e i n gene r e q u i r e d t h e  al.,  1990).  plant  I s o l a t i o n of the  c l o n i n g , sequencing,  coat  and  c h a r a c t e r i z a t i o n o f p a r t o f t h e PLRV genome.  Once  the  transferred into  c o a t p r o t e i n open r e a d i n g  Nicotiana potato  tabacum cultivars  Burbank'  'Xanthi-nc'  'Desiree'  (De B l o c k ,  gene t r a n s f e r s . chimaeric  (L.)  1988)  maximum e x p r e s s i o n .  An  was  (Horsch  e t al.,  ( S t i e k e m a e t al.,  Three d i f f e r e n t  (CaMV) 35S  (ORF)  v i a Agrobacterium  genes under the  mosaic v i r u s  frame  identified,  1985)  1988)  and  mediated  c o n s t r u c t s were i n t r o d u c e d  as  c o n t r o l of a d u p l i c a t e d c a u l i f l o w e r  promoter-enhancer i n attempts to  obtain  earlier  showed  study  (Kay  e t al.,  1987)  o f t h e CaMV 35S  resulted in transcriptional  approximately  activity  promoter  ten-fold  than t h a t of the n a t u r a l promoter.  G e n e t i c a l l y engineered a l t e r n a t i v e t o the  r e s i s t a n c e o f f e r s an  economically  and  attractive  environmentally  costly  p r a c t i c e of c o n t r o l of the v e c t o r w i t h i n s e c t i c i d e s . v e c t o r o f PLRV has was  the  'Russet  tumefaciens  t h a t d u p l i c a t i o n of upstream regions  higher  and  crucial  a major p a r t i n the e p i p h y t o l o g y  f o r the t r a n s m i s s i o n of t h i s v i r u s  c h a r a c t e r i z a t i o n of r e s i s t a n c e during the Lower v i r u s t i t r e s  symptoms and quality.  course  and  p o s s i b l y an  o f PLRV  this  t r a n s m i s s i o n by t h e v e c t o r ,  increased yields,  c r o s s - p r o t e c t i o n , the  and  work. result  in  fewer  increase  A n a l y s i s of t h e mechanism of p r o t e c t i o n c o u l d  i n f o r m a t i o n on  aphid  and  i n i n f e c t e d t r a n s g e n i c p l a n t s may  r e d u c e d a c q u i s i t i o n and  The  i n f e c t i o n process,  in  tuber  provide and  virus  4  replication.  R e c e n t work w i t h  extensive s i m i l a r i t i e s translational  other luteoviruses  i n genome o r g a n i z a t i o n ,  s t r a t e g i e s , and  properties  (Martin  e t al.,  resistance  t o PLRV may  resistance  towards other  replication  o t h e r m o l e c u l a r and  1990).  Thus, t h e  indicate a useful luteoviruses.  indicates  non-molecular  development  strategy  and  to  of  obtain  5  LITERATURE REVIEW  II.  2.1 E p i p h y t o l o g y o f PLRV 2.1.1 Symptoms o f PLRV I n f e c t i o n Primary appear mainly  PLRV symptoms f o l l o w t r a n s m i s s i o n  i n t h e young l e a v e s , w h i c h e x h i b i t an u p r i g h t  growth h a b i t , upward r o l l i n g , not  appear w i t h  and c h l o r o s i s .  l a t e season i n f e c t i o n .  i n p l a n t s grown f r o m i n f e c t e d t u b e r s . rolling the  and marginal  upper l e a v e s ,  brittle  by aphids and  leaves.  T h e s e symptoms may  S e c o n d a r y symptoms o c c u r They i n c l u d e  n e c r o s i s o f t h e lower leaves,  upward chlorosis of  and s t u n t i n g o f t h e p l a n t which has d r y and The t u b e r s  o f some c u l t i v a r s e . g . ' R u s s e t  Burbank' develop i n t e r n a l n e t n e c r o s i s o f t h e phloem. from p l a n t s w i t h primary i n f e c t i o n s t h e n e c r o s i s net-patterned  necrosis  i n the cut tuber  In tubers  i sv i s i b l e  (Harrison,  as a  1984) .  2.1.2 T r a n s m i s s i o n o f PLRV A l t h o u g h PLRV may be d i s s e m i n a t e d tubers its  a n d may be t r a n s m i t t e d b y g r a f t i n g ,  aphid  Myzus  through i n f e c t e d  vector that i sresponsible  persicae  vector aphids,  o f PLRV.  (Sulz.)  s u c h a s Macrosiphum  numerous w i t h i n p o t a t o  i t i s t r a n s m i t t e d by  for the prevalence  i sthe only e f f i c i e n t  Tamada a n d H a r r i s o n euphorbiae  (Thorn.),  other  a r e o f t e n more  they, may b e c a p a b l e o f  t r a n s m i t t i n g PLRV t h e y do s o i n e f f i c i e n t l y . immunosorbent assay  o f PLRV.  and s i g n i f i c a n t  (1981) f o u n d t h a t  crops and although  potato  An e n z y m e - l i n k e d  (ELISA) showed t h a t t h e l e v e l s o f PLRV w i t h i n  6 M. persicae  a n d M.  euphorbiae  w e r e t h e same a f t e r an  a c q u i s i t i o n p e r i o d , h o w e v e r , M. persicae (100%)  t h a n M.  efficiency important  euphorbiae  was  more  identical  efficient  (3%) i n t r a n s m i t t i n g PLRV.  o f PLRV t r a n s m i s s i o n h a s made M. persicae  This t h e most  vector.  M. persicae  has a w o r l d w i d e d i s t r i b u t i o n and a h o s t  t h a t i n c l u d e s o v e r 250 ( B e r r y and Simpson,  ornamental, c u l t i v a t e d ,  1967) .  At l e a s t  recorded i n B r i t i s h Columbia  alone  range  a n d weed s p e c i e s  116 h o s t p l a n t s h a v e b e e n  ( F o r b e s a n d Chan,  1989).  S i n c e PLRV i s f o u n d m o s t l y w i t h i n t h e S o l a n a c e a e , w i t h o n l y a h o s t s amongst t h e A m a r a n t h a c e a e , N o l a n a c e a e , Portulaceae,  Cruciferae,  few  and  i t i s c l e a r t h a t t h e v i r u s and n o t t h e v e c t o r i s  r e s p o n s i b l e f o r t h e r e l a t i v e l y n a r r o w h o s t r a n g e o f PLRV. W i t h i n t h e F r a s e r V a l l e y M. persicae exclusively anholocyclic  appears t o  ( p r o d u c e s no e g g s ) .  No  eggs or  f u n d a t r i c e s have been found d u r i n g s e a r c h e s o f peach this  area.  sprouts,  trees  within  Nymphs and a d u l t s o v e r w i n t e r on s u g a r b e e t s , b r u s s e l  C h i n e s e cabbage,  weed, a n d t a l l  swede t u r n i p ,  hedge m u s t a r d ,  b u t t e r c u p ( W r i g h t et a l . , 1970) .  a p p e a r s t o be a n h o l o c y c l i c i n t h e t e m p e r a t e a n h o l o c y c l i c and h o l o c y c l i c holocyclic  be  i n colder areas  zones  (produces eggs) o r (MacGillivray,  s e v e r a l weeds s u c h as s h e p h e r d ' s  M.  pineapple persicae  a n d may  be  both  entirely  1972).  Although  p u r s e and n i g h t s h a d e c a n  be  r e s e r v o i r s f o r PLRV t h e y a r e i n s i g n i f i c a n t when c o m p a r e d t o v o l u n t e e r p o t a t o e s from commercial growers The  latter  a n d home g a r d e n e r s .  a r e a p a r t i c u l a r l y g o o d s o u r c e o f PLRV a s  contaminated  7 potato  seed i s r e p l a n t e d year a f t e r y e a r and a p h i d  populations  a r e n o t u s u a l l y c o n t r o l l e d by i n s e c t i c i d e s ( B i s h o p  and G u t h r i e ,  1964) . The p r o b a b i l i t y o f e a r l y i n f e c t i o n i n p o t a t o a r e a s w h e r e a n h o l o c y c l i c M. persicae l a r g e number o f v e c t o r s l i k e l y t o acquire  overwinter  i n the spring.  because of t h e  M. persicae  i s more  v i r u s from and i n o c u l a t e v i r u s t o younger  plants than t o older plants  (Tamada a n d H a r r i s o n ,  I n f e c t i o n o f y o u n g e r p l a n t s i s more l i k e l y are  i s increased i n  l e s s r e s i s t a n t than older p l a n t s  1981).  t o occur because they  (Knutson and B i s h o p ,  1964) .  PLRV e p i p h y t o t i c s i n N o r t h A m e r i c a a n d E u r o p e a p p e a r t o o c c u r e v e r y 32 y e a r s a n d t h e y c o i n c i d e w i t h p e r i o d s and  mild winters  development o f  which favour M. persicae  M. persicae  feeds mainly  winter  o f warm d r y summers  s u r v i v a l a n d summer  (Bagnall,  1988).  on t h e l o w e r p o t a t o  ( K i r k p a t r i c k a n d R o s s , 1952) w h i c h c o n t a i n h i g h e r than younger leaves  p l a n t s more r e a d i l y t h a n h e a l t h y  Probing  of the leaf surface  persicae  stylet  1981) .  a p h i d s c o l o n i z e PLRV i n f e c t e d p l a n t s s i n c e one o f t h e symptoms  i s yellowing of the plant  minute, repeated  levels of virus  a t t h e t o p (Tamada a n d H a r r i s o n ,  A t t r a c t e d by t h e c o l o u r y e l l o w ,  of i n f e c t i o n  leaves  ( v a n Emden e t al.,  consists of short,  1 to 5  i n s e r t i o n s at d i f f e r e n t s i t e s .  r e q u i r e s a t l e a s t 15 m i n u t e s t o r e a c h  1969).  M.  t h e - p h l o e m a n d no  v i r u s a c q u i s i t i o n has been observed o r i s l i k e l y t o o c c u r i n a s h o r t e r p e r i o d as v i r u s i s c o n f i n e d t o t h e phloem t i s s u e . M. euphorbiae,  i n which the s t y l e t p e n e t r a t i o n  Unlike  i s intracellular,  8 the s t y l e t and  o f M. persicae  intracellular  route  p e n e t r a t e s u s i n g b o t h an ( v a n Emden e t al.,  intercellular  1969).  K i r k p a t r i c k a n d R o s s (1952) showed t h a t M. persicae a c q u i s i t i o n t h r e s h o l d o f 30 m i n u t e s f o r PLRV.  h a s an  They a l s o  found  t h a t PLRV c o u l d be a c q u i r e d a n d t r a n s m i t t e d i n a s l i t t l e  a s 90  minutes.  Thus t h e l a t e n t p e r i o d may be as s h o r t a s 60 m i n u t e s .  The i n o c u l a t i o n t h r e s h o l d was d e t e r m i n e d t o be 30 m i n u t e s . Ponsen  (1970) f o u n d t h a t b o t h nymphs a n d a d u l t s o f M.  a r e c a p a b l e o f a c q u i r i n g a n d t r a n s m i t t i n g PLRV. efficiency  persicae  Optimum  o f t r a n s m i s s i o n o f PLRV o c c u r r e d 9 d a y s a f t e r  birth.  I t was a l s o shown t h a t s t a r v a t i o n p r i o r t o t h e a c q u i s i t i o n o f PLRV d i d n o t a f f e c t t h e a b i l i t y t o t r a n s m i t . Tamada a n d H a r r i s o n (1981) u s e d E L I S A f o r t h e d e t e c t i o n o f PLRV w i t h i n a p h i d s .  Most o f t h e e v i d e n c e f o r t h e c h a r a c t e r i s t i c s  o f PLRV i n a p h i d s f r o m e a r l i e r PLRV c o n t e n t o f  M. persicae  s t u d i e s had been i n d i r e c t .  The  i n c r e a s e d d u r i n g an a c q u i s i t i o n  a c c e s s p e r i o d o f up t o 7 d a y s b u t v a r i e d s i g n i f i c a n t l y b e t w e e n i n d i v i d u a l aphids.  A maximum o f 7 n g P L R V / a p h i d was r e c o r d e d b u t  the aphids u s u a l l y accumulated  o n l y 0.2 n g / d a y .  I t was  shown  t h a t a p h i d s c o n t a i n i n g h i g h e r l e v e l s o f PLRV w e r e b e t t e r a t transmitting the virus. Aphids kept at lower temperatures,  i . e . 15 o r 20°C,  c o n t a i n e d c o n s i d e r a b l y more v i r u s t h a n a p h i d s k e p t a t h i g h e r temperatures, temperatures  i . e . 25 o r 30°C.  However, a p h i d s k e p t a t l o w e r  were l e s s e f f i c i e n t  kept at higher temperatures.  a t t r a n s m i t t i n g PLRV t h a n  Tamada a n d H a r r i s o n (1981)  aphids  9 s u g g e s t e d t h a t t h i s was  a p o s t - a c q u i s i t i o n e f f e c t on t h e  speed  w i t h w h i c h PLRV moves f r o m one p a r t o f an a p h i d t o a n o t h e r . was  This  f u r t h e r s u p p o r t e d by t h e l o n g e r l a t e n t p e r i o d o b s e r v e d a t  lower temperatures. Stegwee and Ponsen  (1958)  r e p o r t e d t h a t PLRV c o u l d  be  t r a n s f e r r e d 15 s u c c e s s i v e t i m e s by s e r i a l  i n j e c t i o n o f haemolymph  f r o m a p h i d s k e p t on v i r u s - i m m u n e  They i n t e r p r e t e d  plants.  r e s u l t s t o i n d i c a t e t h a t PLRV r e p l i c a t e s w i t h i n t h e E s k a n d a r i e t a l . (1979) (1958)  and MacCarthy  (1981)  F i r s t t h e r e was  d e c r e a s e o c c u r r i n g 2-3  o b s e r v e d t o d e c r e a s e i n two a b r i e f but r a p i d  days  M.  euphorbiae  d i d M. persicae first  distinct  T h i s was  followed  decrease o c c u r r i n g over  not o n l y a c q u i r e d s i m i l a r  b u t a l s o h a d t h e same d e c r e a s e p r o f i l e .  c o n t a i n e d w i t h i n the midgut.  The  second  decrease probably represents v i r u s p a r t i c l e s t h e a p h i d body i . e . t h e haemocoele. a n d M.  euphorbiae  I t would  several  l e v e l s o f PLRV as The  r a p i d but b r i e f decrease probably r e p r e s e n t s those  particles  persicae  and  temperature-dependent  after acquisition.  by a s l o w t e m p e r a t u r e - i n d e p e n d e n t weeks.  Tamada  f o u n d t h a t a f t e r an a c q u i s i t i o n p e r i o d t h e PLRV  c o n t e n t o f t h e a p h i d s was phases.  and H a r r i s o n  found t h a t v i r u s content of aphids  d e c r e a s e s when t h e y a r e k e p t on immune p l a n t s . Harrison  vector.  were u n a b l e t o c o n f i r m t h i s ,  (1954)  these  virus  slower  i n other parts  of  seem t h a t b o t h  have a s i m i l a r d i s t r i b u t i o n o f  virus  w i t h i n t h e i r t i s s u e s a n d t h e v i r u s must be a b l e t o p a s s f r o m t o haemocoele i n both a p h i d s . responsible f o r the s p e c i f i c i t y  T h e r e f o r e , the gut w a l l cannot of transmission.  Virus  M.  gut be  injected  10 i n t o t h e h a e m o c o e l e was n o t d e t e c t e d w i t h i n t h e a p h i d g u t , s u g g e s t i n g t h a t i t d o e s n o t p a s s f r o m t h e haemolymph i n t o t h e g u t ( P a l i w a l and Sinha, 1970).  Thus, i t a p p e a r s t h a t  these  c i r c u l a t i v e v i r u s e s take advantage o f t h e normal food a b s o r p t i v e m e c h a n i s m i n t h e i r movement f r o m g u t t o h a e m o c o e l e .  2.1.3  V e c t o r S p e c i f i c i t y f o r PLRV  Once i n t h e h a e m o c o e l e , t h e v i r u s p e r s i s t s w i t h i n t h e a p h i d vector,  often f o rthe duration of i t s l i f e ,  move t o t h e s a l i v a r y (Harrison,  1984) .  but the virus  must  s y r i n g e before t r a n s m i s s i o n can occur Consistent observations of  nonpropagative  c i r c u l a t i v e v i r u s e s i n s p e c i f i c membrane s t r u c t u r e s h a v e indicated that the accessory s a l i v a r y gland i s the s i t e of c e l l u l a r t r a n s p o r t of the v i r u s through t o the s a l i v a r y Other  v i r u s e s o r s t r a i n s o f v i r u s n o t t r a n s m i t t e d by t h e a p h i d  v e c t o r were n o t a s s o c i a t e d w i t h t h e a c c e s s o r y s a l i v a r y cells  or t h e i r b a s a l lamina  extremely  (Gildow,  1982).  h i g h degree o f s p e c i f i c i t y between  particular  aphid vectors.  This s p e c i f i c i t y  gland  T h e r e i s an individual  l u t e o v i r u s e s and t h e a c c e s s o r y s a l i v a r y glands  two  duct.  of their  appears t o r e s i d e i n  d i f f e r e n t membrane s t r u c t u r e s , t h e b a s a l l a m i n a a n d  plasmalemma. The  a c c e s s o r y s a l i v a r y g l a n d o f an a p h i d i s f o u r - c e l l e d .  Each s e c r e t o r y c e l l lamina  (Ponsen,  protein,  i s surrounded  1977) w h i c h  and c a r b o h y d r a t e s  b y an e x t r a c e l l u l a r  basal  i s a f i b r o u s network o f c o l l a g e n , (Gildow,  1982) .  Gildow  (1982) showed  11 t h a t v i r u s - l i k e p a r t i c l e s were c o n s i s t e n t l y f o u n d i n t h e b a s a l lamina  of accessory  s a l i v a r y glands  o f M. persicae  f e d PLRV, b u t  p a r t i c l e s were n e v e r o b s e r v e d i n t h e b a s a l l a m i n a tissues,  not even t h e p r i n c i p a l  were c o n f i r m e d  a s PLRV b y f e r r i t i n - a n t i b o d y  d i s s e c t e d s a l i v a r y glands. for the other BYDV ( G i l d o w (PEMV)  These  l a b e l l i n g of  1982),  S t r u c t u r a l d i f f e r e n c e s between  o f d i f f e r e n t t i s s u e s and t h e a b i l i t y  (Gildow,  of basal  lamina  o u t m o l e c u l e s by s i z e a n d c h a r g e h a v e b e e n  1982) .  Protein associated with this  a l s o be i n v o l v e d i n t h e v i r a l  P r o t e i n s i n t h e plasmalemma  of the accessory  membrane  specificity. s a l i v a r y gland  h a v e b e e n shown t o f u n c t i o n a s h i g h l y s p e c i f i c v i r u s  cells  receptors  1982).  L i k e BYDV ( G i l d o w  a n d Rochow, 1 9 8 0 b ) , t h e PLRV c o a t  a p p e a r s t o be i n v o l v e d i n t h e t r a n s m i s s i o n s p e c i f i c i t y amongst  reported  a n d Rochow, 1 9 8 0 a ) , a n d p e a e n a t i o n m o s a i c v i r u s  s t r u c t u r e may  (Gildow,  particles  c i r c u l a t i v e v i r u s e s , i n c l u d i n g BWYV ( G i l d o w ,  t o s e l e c t and f i l t e r reported  other  S i m i l a r f i n d i n g s have been  ( H a r r i s e t a l . , 1975).  basal lamina  s a l i v a r y gland.  of  aphids  (Gildow  a n d Rochow, 1 9 8 0 b ) .  Two  protein  observed  monoclonal  a n t i b o d i e s w e r e i d e n t i f i e d by M a s s a l s k i a n d H a r r i s o n  (1987) t h a t  r e a c t e d w i t h 28 r e a d i l y a p h i d t r a n s m i s s i b l e PLRV i s o l a t e s b u t f a i l e d t o r e a c t w i t h two i s o l a t e s t h a t were p o o r l y t r a n s m i t t e d by aphids.  P r e s u m a b l y , t h e two a n t i b o d i e s a r e b i n d i n g t o an  required f o r aphid transmission. these  They d i d n o t r e p o r t w h e t h e r  m o n o c l o n a l s were a b l e t o p r e v e n t  28 a p h i d t r a n s m i s s i b l e i s o l a t e s .  epitope  aphid transmission of the  12 2.2  S t r u c t u r e o f t h e L u t e o v i r u s Genome 2.2.1  P h y s i c a l P r o p e r t i e s o f PLRV  A d i s e a s e r e f e r r e d t o as t h e " c u r l " was w h i c h has  s i n c e b e e n a t t r i b u t e d t o PLRV  not u n t i l  1916  demonstrated particles Peters 1979  reported i n  (Bagnall,  a p p r o x i m a t e l y 24 nm  1916).  Although  (Rowhani a n d  The  unknown  s u g g e s t e d a n u c l e i c a c i d c o n t e n t o f 28% a n d  o f 2.0  X 10 . 6  indicated a M  r  p r o t e i n s u b u n i t s f o r each Polyclonal  genome.  The  v i r u s appears  coat  particle. produced  against purified  s u c c e s s f u l l y u s e d i n E L I S A t o d e t e c t PLRV by  (1977) .  Mouse m o n o c l o n a l  Canadian  i s o l a t e o f PLRV by M a r t i n a n d S t a c e - S m i t h  Casper  a n t i b o d i e s were p r e p a r e d a g a i n s t a  a n t i b o d i e s as s e c o n d a r y  (1984) .  o f PLRV d e t e c t i o n .  D ' A r c y e t al.  viruses.  or  and  (1989) f o u n d up  f i v e e p i t o p e s on i n d i v i d u a l l u t e o v i r u s e s and showed t h a t were s h a r e d between  Use  antibody in'double  a n t i b o d y ELISA g r e a t l y enhanced t h e s p e c i f i c i t y  sensitivity  subunit  t o h a v e 180  PLRV a n d  triple  Gel  s u g g e s t e d a r e l a t i v e m o l e c u l a r mass  a n t i s e r a were f i r s t  of these monoclonal  until  nuclease  S i m i l a r a n a l y s i s of the coat p r o t e i n  o f 26,300.  by  d e n s i t y i n cesium  d i g e s t i o n s t u d i e s i n d i c a t e d a s i n g l e - s t r a n d e d RNA  r  was  isometric  i n d i a m e t e r were i d e n t i f i e d  S t a c e - S m i t h , 1979) .  e l e c t r o p h o r e s i s o f t h e RNA  It  was  (1967), the p r o p e r t i e s of the v i r u s remained  chloride  (M )  1988).  t h a t t h e i n f e c t i o u s n a t u r e o f PLRV ( Q u a n j e r e t al.,  1775  to  several  13 2.2.2  Molecular  P r o p e r t i e s o f PLRV  Recent d e t e r m i n a t i o n different  sequence  by M a r t i n  expression  strategy,  e t al., 1 9 9 0 ) .  o f BYDV-PAV  1 9 8 8 ) , a n d PLRV Keese  sequences  f o r three  l u t e o v i r u s e s has c o n t r i b u t e d g r e a t l y t o t h e knowledge  o f genome o r g a n i z a t i o n , (reviewed  of thenucleotide  a n d gene  The c o m p l e t e  nucleotide  ( M i l l e r e t a l . , 1 9 8 8 a ) , BWYV ( V e i d t e t al.,  (Mayo e t al., 1 9 8 9 ; V a n d e r W i l k  et al., 1990) i n a d d i t i o n t o t h e p a r t i a l  soybean dwarf v i r u s  function  e t al.,  1989;  sequences o f  (SDV) a n d c a r r o t r e d l e a f v i r u s  (CRLV)  ( M a r t i n e t al., 1990) h a s e n a b l e d t h e i d e n t i f i c a t i o n o f similarities putative  and d i f f e r e n c e s between  gene p r o d u c t s .  organizations represented CRLV  l u t e o v i r u s genomes a n d  T h e r e a p p e a r t o be t w o d i f f e r e n t  w i t h i n t h e l u t e o v i r u s group.  genome  One o r g a n i z a t i o n i s  b y BYDV-PAV a n d SDV a n d t h e o t h e r  b y PLRV, BWYV, a n d  (Figure 1 ) . Each l u t e o v i r u s has a p o s i t i v e - s e n s e ,  genome o f M  r  1.8 t o 2.0 X 1 0  6  (Harrison,  1984).  e v i d e n c e o f a 3' p o l y a d e n y l a t e d  tail  structure  A 5' v i r a l  (Mayo e t al., 1 9 8 2 ) .  (VPg) h a s b e e n r e p o r t e d BYDV-PAV  (Murphy  f o r b o t h PLRV  et al., 1 9 8 9 ) .  sequenced has a short  Several  structural  T h e r e i s no tRNA-like  genome-linked  protein  (Mayo e t a l . , 1982)  region  Genome  features  o r a n y 3'  RNA  and  Each l u t e o v i r u s t h a t has been  untranslated  2.2.2.1 Luteovirus  single-stranded  a t t h e 5' a n d 3' e n d s .  Organizations  o f t h e l u t e o v i r u s genome h a v e  been d e t e r m i n e d from t h e i r n u c l e o t i d e  sequences.  S i x open  14  PLRV GENOME ORGANIZATION 28 kDa  5'  1 0 1  2  I 1  I  I  I  I 4  kDa  70  kb)  kDa  17  69 kDa  (5.88  3  5  |  56 kDa  23 kDa  BYDV-PAV GENOME ORGANIZATION (5.68  17 kDa  39 kDa  I  I 3 ,1  2  60 kDa 0. 1. 2. 3. 4. 5. 6.  7 kDa  4  1  5'  kb)  22  kDa  [61 5  1  50 kDa  Function unknown Viral replicase Viral replicase Coat protein Genome linked protein (VPg)? Aphid transmission factor? Function unknown  F i g u r e 1. Genomic o r g a n i z a t i o n s r e p o r t e d f o r PLRV a n d BYDV-PAV. The PLRV g e n o m i c o r g a n i z a t i o n t y p i f i e s t h o s e o f BWYV a n d CRLV a n d t h e BYDV-PAV i s s i m i l a r t o t h a t o f SDV. E a c h ORF i s r e p r e s e n t e d b y an o p e n b o x w i t h t h e p r e d i c t e d s i z e o f t h e p r o t e i n p r o d u c t shown a b o v e o r b e l o w t h e b o x . Genes w i t h t h e same numbers a r e t h o u g h t t o have s i m i l a r f u n c t i o n s . E a c h ORF i s l a r g e r t h a n 300 n u c l e o t i d e s e x c e p t ORF 6. The ORFs shown o c c u r b e t w e e n t h e f i r s t AUG r e s i d u e a n d t h e f i r s t t e r m i n a t i o n c o d o n i n t h e same f r a m e , e x c e p t f o r ORFs 2 a n d 5 w h i c h a r e b e t w e e n two t e r m i n a t i o n c o d o n s . reading  frames  (ORFs) h a v e b e e n i d e n t i f i e d i n t h e BYDV-PAV genome  a n d a l s o i n t h e PLRV BWYV h a v e a 5' ORF  ( F i g u r e 1) a n d BWYV genomes.  designated  B o t h PLRV a n d  0 which encodes a p u t a t i v e p r o t e i n  o f 28 a n d 29 kDa, r e s p e c t i v e l y .  T h i s ORF  d o e s n o t o c c u r i n BYDV-  15 PAV. ORF  Mayo et al. (1989) r e p o r t e d 0 o f PLRV was h y d r o p h o b i c  similar al.  that  and t h a t  theputative product o f t h e amino t e r m i n u s was  t o s e v e r a l membrane-associated p r o t e i n s .  (1989) s u g g e s t e d t h a t  this  Van d e r Wilk e t  p r o t e i n may f u n c t i o n a s a  protease  t o p r o d u c e VPgs f o r PLRV a n d BWYV. Overlapping reading occur  ORF 0 b u t i n a d i f f e r e n t  f r a m e i s ORF 1, w h i c h i s t h e f i r s t  of five  i n a l l l u t e o v i r u s e s sequenced t o date.  translational kDa  e x t e n s i v e l y with  p r o d u c t s have m o l e c u l a r  The p u t a t i v e  w e i g h t s o f 70, 66, a n d 39  f o r PLRV, BWYV, a n d BYDV-PAV, r e s p e c t i v e l y .  proposed that  an o v e r l a p  1988a).  The 5' t e r m i n a l  BYDV-PAV  overlaps  identified  I t has been  ORF 2 i s e x p r e s s e d b y a t r a n s l a t i o n a l  occurring within  nucleotides,  e t al.,  p o r t i o n o f ORF 2 f r o m PLRV, BWYV, o r  t h e 3' t e r m i n u s o f ORF 1 b y 289, 474, a n d 13  respectively.  This putative  f u s i o n p r o t e i n has been  a s t h e r e p l i c a s e , b a s e d on t h e p r e s e n c e o f t h e v i r a l  (Kamer a n d A r g o s ,  occurs  frameshift  o f ORFs 1 a n d 2 ( M i l l e r  p o l y m e r a s e amino a c i d c o n s e n s u s s e q u e n c e GXXXTXXXN  An  ORFs shown t o  1984) w h i c h i s p r e s e n t  untranslated  region  (X) _ GDD 20  40  i n ORF 2.  o f 197, 202, o r 116 n u c l e o t i d e s  b e t w e e n ORF 2 a n d 3 o f PLRV, BWYV, a n d BYDV-PAV,  respectively.  These r e g i o n s  sequences f o l l o w e d  b y AAGA  contain  repeated  U A nucleotide n  (Mayo e t al., 1989), two f e a t u r e s  p r o p o s e d b y M a r s h et al. (1988) t o be i n v o l v e d  i n the production  of  region  s u b g e n o m i c RNAs.  Subgenomic RNAs f r o m t h i s  genome h a v e b e e n r e p o r t e d BYDV-PAV  (Miller  f o r PLRV  e t al., 1 9 8 8 a ) .  (Mayo a n d B a r k e r , Untranslated  leader  of the 1984)  and  sequences  16 of p o l i o v i r u s which a r e a l s o r i c h i n adenine and u r i d i n e serve  as "ribosomal  l a n d i n g pads" f o r i n t e r n a l  ( P e l l e t i e r a n d S o n e n b e r g , 1988).  initiation  untranslated  residues  translational  This  PLRV  r e g i o n may a l l o w i n t e r n a l t r a n s l a t i o n a l  initiation  t o o c c u r f r o m s u b g e n o m i c o r g e n o m i c RNA. Beyond t h e i n t e r n a l u n t r a n s l a t e d 22  t o 23 kDa p r o t e i n .  this  centrally  Miller  region  i s ORF 3 e n c o d i n g a  et al. (1988b) d e m o n s t r a t e d  l o c a t e d ORF e n c o d e s t h e BYDV-PAV c o a t  They f o u n d t h a t t h e amino a c i d s e q u e n c e s o f t r y p t i c p u r i f i e d coat  s e q u e n c e o f ORF 3.  d e t e c t i o n o f ORF 3, e x p r e s s e d a s a b a c t e r i a l t o whole v i r u s confirmed  protein subunit. al.,  1988),  protein. fragments o f  p r o t e i n c o i n c i d e d w i t h t h e amino a c i d s e q u e n c e  deduced from t h e n u c l e o t i d e  antiserum  Serological  fusion protein,  t h e ORF 3 p r o d u c t a s t h e c o a t  PLRV, a n d SDV ( M a r t i n e t al., 1990)  demonstrated  w i t h i n ORF 3 b u t i n a d i f f e r e n t r e a d i n g  f r a m e i s ORF 4 w h i c h e n c o d e s p u t a t i v e p r o t e i n s r a n g i n g Miller  that  p r o t e i n gene.  Contained completely  kDa.  with  S i m i l a r s e r o l o g i c a l s t u d i e s o f BWYV ( V e i d t et  ORF 3 e n c o d e s t h e c o a t  20  that  f r o m 17 t o  et al. (1988b) h a v e s u g g e s t e d t h a t ORF 4 e n c o d e s  t h e V P g s i n c e i t i s s i m i l a r t o t h e V P g i s o l a t e d f r o m BYDV-RPV (Murphy e t a l . , 1989) . unclassified virus,  Pea e n a t i o n mosaic v i r u s  (PEMV), a n  w h i c h h a s many p r o p e r t i e s i n common w i t h t h e  l u t e o v i r u s e s a l s o h a s a V P g o f 17 kDa ( R e i s m a n a n d de Z o e t e n , 1982). kDa  However, t h e V P g o f PLRV h a s b e e n r e p o r t e d  (Mayo e t al. 1 9 8 2 ) .  product serves  t o be o n l y 7  I t h a s b e e n s u g g e s t e d t h a t t h e ORF 4  as a precursor  f r o m w h i c h t h e V P g i s d e r i v e d (Van  17 d e r W i l k e t al.,  1989).  A s i m i l a r mechanism f o r VPg  maturation  i n v o l v i n g a membrane-bound p r o t e a s e o f v i r u s o r i g i n h a s proposed  f o r cowpea m o s a i c  The  l a s t ORF  f r o m ORF  virus  ( G o l d b a c h a n d v a n Kammen, 1985) .  s h a r e d by a l l l u t e o v i r u s e s ,  4 by an amber t e r m i n a t i o n c o d o n .  f r a m e o f ORF  4 i s m a i n t a i n e d i n ORF  t o 56 kDa  5.  may  5,  i s separated  5, t h e r e s u l t i n g w o u l d be  p r o t e i n e x p e c t e d f r o m ORF  ORF  Since the reading  t r a n s l a t i o n a l product, i f produced,  t h i s ORF  been  l a r g e r than the  Evidence  be e x p r e s s e d by t r a n s l a t i o n a l  readthrough  indicates  50  that  readthrough of the  amber t e r m i n a t i o n c o d o n o f t h e c o a t p r o t e i n g e n e .  In a d d i t i o n t o  the coat p r o t e i n a l a r g e molecular weight p o l y p e p t i d e of a p p r o x i m a t e l y 60 kDa  has b e e n o b s e r v e d on d e n a t u r i n g  polyacrylamide gels.  This large p r o t e i n occurs at a  c o n c e n t r a t i o n than the coat p r o t e i n A n t i b o d i e s produced  (Waterhouse  lower  e t al.,  a g a i n s t w h o l e BYDV-PAV p a r t i c l e s  p r o t e i n o f t h e c o a t p r o t e i n ORF p r o t e i n and t h e l a r g e r  60 kDa  1989).  or a  3 reacted with both the  protein  (Waterhouse  molecular weight p r o t e i n i n d i c a t e s that the l a r g e r c o n t a i n s a c o a t p r o t e i n component.  5.  protein  A n t i b o d i e s p r e p a r e d t o whole  These a n t i b o d i e s and t h o s e p r e p a r e d t o t h e  p r o t e i n o f ORF protein  5 detected only the l a r g e r molecular  i n d i c a t i n g t h a t t h e l a r g e r p r o t e i n has t h e  component  ( M a r t i n e t al.,  than expected s i z e ,  60 kDa  1990).  1989) .  larger  v i r u s p a r t i c l e s were a f f i n i t y p u r i f i e d u s i n g t h e f u s i o n o f ORF  coat  e t al.,  Reaction of coat p r o t e i n s p e c i f i c antiserum w i t h the  fusion  The  protein  fusion  weight readthrough  l a r g e p r o t e i n had a s m a l l e r  i n s t e a d o f 72 kDa.  This smaller size  18  may be t h e r e s u l t o f p r o t e i n rich  conformation a r i s i n g from a p r o l i n e -  a r e a i n t h e amino t e r m i n u s o f t h e r e a d t h r o u g h , o f  translational modification, Harrison o f PLRV.  or degradation  (1984) r e p o r t e d  small  I t has been found t h a t  (Martin  projections  post-  e t al.,  1990).  at the vertices  a n t i s e r a t o t h e BYDV-PAV ORF  f u s i o n p r o t e i n d e c o r a t e d and p r e c i p i t a t e d v i r u s p a r t i c l e s e t al.,  1990).  I t was a l s o shown t h a t t h e ORF  removed from t h e s u r f a c e showing t h a t surface  o f v i r u s p a r t i c l e s by t r y p s i n  the readthrough portion  of the virus p a r t i c l e .  suggested that responsible  e t al.  this  ORF  e t al.,  demonstrated.  Luteovirus  o f l u t e o v i r u s genes appears t o i n v o l v e As w i t h  gene i s p r o b a b l y t h e f i r s t  mRNA w i t h  could  i s expressed or  f u n c t i o n may be h a s y e t t o be  strategies.  translational  other positive-sense  t o be t r a n s l a t e d .  Genes several  RNAs, t h e 5'  S i n c e t h e RNA  lacks  a t i t s t e r m i n u s , t h e mechanism o f  i n i t i a t i o n probably d i f f e r s  a 5' c a p .  be  o c c u r s a t t h e 5' e n d o f a  However, w h e t h e r t h e p r o t e i n  a 5' c a p s t r u c t u r e  may  of transportation  by M i l l e r  2 . 2 . 2 . 2 S t r a t e g i e s Used t o T r a n s l a t e  different  i s on t h e  a t t h e 3' e n d o f BYDV-PAV t h a t  They f o u n d t h a t  Translation  be  (1990) h a v e  at the l e v e l  kDa p r o t e i n h a s b e e n r e p o r t e d  what i t s p o s s i b l e  could  i n t o the s a l i v a r y duct.  An a d d i t i o n a l ORF  s u b g e n o m i c RNA.  (Martin  digestion  the p r o t e i n , because of i t s a c c e s s i b i l i t y ,  f r o m t h e haemolymph  (1988a).  of the protein  Martin  f o r aphid s p e c i f i c i t y  e n c o d e a 6.7  5 protein  5  from t h a t  The m e c h a n i s m o f i n i t i a t i o n may  of  cellular  involve  19 r i b o s o m e r e c o g n i t i o n o f an untranslated poliovirus In  leader  s e q u e n c e , as o c c u r s  ( P e l l e t i e r and  and  kDa  and  70 kDa  the  5'  o f ORF  surrounding  (Mayo e t al.,  I t was  s u g g e s t e d t h a t some o f t h e  end  pass the  o f t h e RNA  1.  The  o f ORF  0 t o be  surrounding  nucleotides  inefficient  (Lutcke  e t al.,  1987)  Furthermore s e v e r a l examples e x i s t ,  stop  i n i t i a t e d polypeptides  115,  and  f r a m e s h i f t o f -1  from the  same RNA  3'  end  2 was  that permitted  o f ORF  1.  f o r PLRV, BWYV, and  of  two  sequence. e x p r e s s e d by  ribosomes to  weight of  BYDV-PAV, r e s p e c t i v e l y .  p r o d u c e d a s m a l l amount o f 125  p r o t e i n w h i c h , b a s e d on  was  f u s i o n o f ORFs 1 and Several  other  2  attributed to a  (Mayo e t al.,  observations  the  118,  v i t r o t r a n s l a t i o n o f PLRV RNA size,  In kDa  translational  1989).  support the  suggestion  a  bypass  This would r e s u l t i n  of a f u s i o n p r o t e i n w i t h a molecular  99 kDa  animal  a l l viral  synthesis  (1988a) p r o p o s e d t h a t ORF  codon at the  production  or  not  consensus sequence f o r ribosome  (Kozak, 1986), i n w h i c h r i b o s o m e s d i r e c t t h e  translational  at  sequence  sequence does  recognition.  e t al.  0  f o r ribosome  optimal  Miller  c o d o n o f ORF downstream  ( K o z a k , 1986)  separately  1,  ribosomes  s t a r t AUG  nucleotide  correspond t o e i t h e r the p l a n t  two  1989) .  Such a mechanism would r e q u i r e t h e  t h e AUG  recognition.  the  containing  w e r e a t t r i b u t e d t o ORFs 0 and  i n s t e a d i n i t i a t e t r a n s l a t i o n 133  t h e AUG  i n t h e VPg  S o n e n b e r g , 1988) .  s i z e these polypeptides  respectively. scanning  5'  v i t r o t r a n s l a t i o n s t u d i e s w i t h PLRV r e s u l t e d i n  p r o m i n e n t p r o d u c t s o f 28 B a s e d on  i n t e r n a l p o r t i o n of the  t h a t ORFs  20 1 and 2 a r e b o t h e x p r e s s e d and t h a t a t r a n s l a t i o n a l involved.  Miller  different  e t al. (1988a)  found that  clones  frameshift i s  from 2  s o u r c e s o f BYDV-PAV h a d 15 b a s e s u b s t i t u t i o n s w i t h i n  ORFs 1 a n d 2 b u t none r e s u l t e d i n amino a c i d c h a n g e s .  This  s u g g e s t s t h a t t h e amino a c i d s a r e c o n s e r v e d a n d t h e g e n e s a r e functional. other  They f o u n d t h a t amino a c i d s e q u e n c e  viral  with  r e p l i c a s e s b e g a n a t t h e 5' e n d o f BYDV-PAV ORF 2  w h i c h i s 94 amino a c i d s b e f o r e  thef i r s t  The  codon  first  similarity  potential initiation  m e t h i o n i n e o f ORF 2.  f o r ORF 2 o f b o t h PLRV a n d  BWYV i s a l s o w e l l d o w n s t r e a m o f t h e t e r m i n a t i o n b y 300 a n d 216 n u c l e o t i d e s ,  respectively  RNA s e c o n d a r y s t r u c t u r e s u r r o u n d i n g  codon  o f ORF 1,  ( M a r t i n e t al., 1 9 9 0 ) . proposed  frameshift  s i t e s s h a r e s p r o p e r t i e s w i t h RNAs o f r e t r o v i r u s e s a n d coronaviruses occur.  preceding  t h e stem-loop s t r u c t u r e  region but t h i s  shows l i t t l e  resemblance t o  BYDV-PAV s e c o n d a r y s t r u c t u r e a n d l a c k s t h e c h a r a c t e r i s t i c  frameshift  sequence.  frameshift  was a s s o c i a t e d  the  ( M i l l e r e t al.,  B o t h PLRV a n d BWYV a l s o f o r m s e c o n d a r y s t r u c t u r e i n t h e  proposed frameshift the  a r e known t o  BYDV-PAV c l o s e l y r e s e m b l e s t h e s e v i r u s e s i n h a v i n g an  UUUA s e q u e n c e 1988a).  i n w h i c h r e p l i c a s e gene f r a m e s h i f t s  Mayo e t al. (198 9)  with the occurrence of G residues i n  s e c o n d p o s i t i o n o f codons  switched  and t h a t t h e s e G r e s i d u e s a r e  t o t h e p r e f e r r e d G - non G - N  T h o s e g e n e s l o c a t e d on t h e 3 ' ORFs 3 ,  suggested that t h e  4, 5, a n d 6 ( F i g u r e  p o r t i o n o f t h e genome  1 ) . ORFs 3 ,  e x p r e s s e d f r o m one s u b g e n o m i c  sequence. include  4, a n d 5 a p p e a r t o be  RNA a n d ORF 6 i s t h o u g h t t o b e  21 e x p r e s s e d from a n o t h e r subgenomic s u g g e s t e d t h a t t h e subgenomic  RNA.  fragment  Mayo e t al.  o f PLRV RNA may i n i t i a t e  from w i t h i n t h e u n t r a n s l a t e d r e g i o n upstream r e g i o n has two c o n s e r v e d sequences,  (1989)  f r o m ORF 3.  repeated U A n  This  sequences  f o l l o w e d b y AAGA, t h a t a r e t h o u g h t t o be a s s o c i a t e d w i t h t h e f o r m a t i o n o f subgenomic  RNAs  ( M a r s h e t al., 1 9 8 8 ) .  Evidence  from  brome m o s a i c v i r u s i n d i c a t e s t h a t t h e v i r u s r e p l i c a s e r e c o g n i z e s an i n t e r n a l  subgenomic  promoter  on t h e n e g a t i v e - s e n s e RNA a n d  p r o d u c e s p o s i t i v e - s e n s e subgenomic I f a subgenomic was  RNA i s u s e d t o t r a n s l a t e ORFs 3, 4, a n d 5 a s  s u g g e s t e d b y Mayo et al. ( 1 9 8 9 ) , t h e AUG o f ORF 3 b e i n g t h e  most 5', may be t h e f i r s t  t o be r e c o g n i z e d f o r i n i t i a t i o n o f  t r a n s l a t i o n by scanning ribosomes. ORF  RNA ( M i l l e r e t al., 1 9 8 5 ) .  The i n i t i a t i o n  site  f o r PLRV  4 i s o n l y 2 6 n u c l e o t i d e s downstream o f t h e p u t a t i v e  initiation  s i t e o f ORF 3 (Mayo e t al., 1989) a n d may b e  t r a n s l a t e d by ribosomes t h a t have b y p a s s e d t h e i n i t i a t i o n ORF  3 (i.e.  sequences  l e a k y s c a n n i n g , s e e Kozak,  mRNAs.  The n u c l e o t i d e  s u r r o u n d i n g t h e AUG o f ORF 3 a r e s i m i l a r  PLRV, a n d BYDV-PAV. sequences  1986).  of plant  site of  f o r BWYV,  None o f t h e s e r e s e m b l e t h e o p t i m a l c o n s e n s u s ( L u t c k e e t al., 1987) o r a n i m a l  ( K o z a k , 1986)  In v i t r o t r a n s c r i p t i o n a n d t r a n s l a t i o n o f cDNA c l o n e s  f r o m BWYV RNA i n d i c a t e d t h a t an RNA m o l e c u l e w i t h 170 n u c l e o t i d e s 5' t o t h e c o a t p r o t e i n gene s t a r t  codon  c o u l d e x p r e s s b o t h ORFs 3  a n d 4 ( V e i d t e t al., 1 9 8 8 ) . E x p r e s s i o n o f ORF 5 i s t h o u g h t t o o c c u r b y t r a n s l a t i o n a l r e a d t h r o u g h o f t h e amber t e r m i n a t i o n c o d o n  o f ORF 3.  Waterhouse  22 et  al.  (1989)  provided  evidence  o f t h e BYDV-PAV p a r t i c l e . vitro  transcription  CCAAAUAGGU et UAG  Veidt  t o the size  The s e q u e n c e s u r r o u n d i n g  al., 1 9 9 0 ) .  read through during t r a n s l a t i o n  v i r u s RNAs t h a t (Miller  changes,  with  the occurrence  which code o n l y  suggests  result  different 1988).  isolates  nucleotide are  o f ORF 6.  amino  acid  Relationships  1977).  of different  This  f o r RNA  a t one i n 10"  4  i s thought t o  sequences c l u s t e r e d around a  o f BWYV h a s b e e n r e p o r t e d were o b t a i n e d  geographical  ( V e i d t e t al.,  f r o m two d i f f e r e n t  locations.  This comparison  d i f f e r e n c e s w i t h i n ORFs 3, 4, a n d 5.  not evenly  This  A c o m p a r i s o n o f 2208 n u c l e o t i d e s f r o m two  These i s o l a t e s  from d i f f e r e n t  t o be  a 0.8 kb s u b g e n o m i c  for conservative  (Eigen and S c h u s t e r ,  sequence.  around  t h a t ORF 6 may be f u n c t i o n a l .  i n populations  dominant  (Martin  a r e thought  and t h e e r r o r r a t e has been e s t i m a t e d  nucleotides  codon  t o that  e r r o r - c o r r e c t i n g mechanism h a s b e e n r e p o r t e d  replicases  of the  o f numerous b a s e  2.2.2.3 L u t e o v i r u s E v o l u t i o n a r y No  codon  e t al., 1 9 8 8 a ) .  RNA f r o m BYDV-PAV w h i c h mapped t o t h e r e g i o n  substitutions  expected  t h e ORF 3 amber  (1988a) have i d e n t i f i e d  subgenomic, t o g e t h e r  t h a t in  t h e amber  sequence i s s i m i l a r  codons o f o t h e r  et al.  component  i n PLRV, BWYV, SDV, a n d BYDV-PAV  Moreover, t h i s  termination  found  o f cDNA w i t h  corresponding  i s identical  Miller  et al. (1988)  and t r a n s l a t i o n  produced polypeptides readthrough.  t h a t ORF 5 i s a s u r f a c e  distributed  along  t h e sequence,  These  with  hosts found  145  changes  6 changes i n  23 ORF  3, 17 c h a n g e s i n t h e r e g i o n o f t h e ORFs 3 a n d 4 o v e r l a p , a n d  122  i n ORF 5.  Apparently,  the overlap  c o n s t r a i n t s on t h e m u t a t i o n r a t e . the  region of overlap  amino a c i d s e q u e n c e s .  n u c l e o t i d e changes o c c u r r e d a l l were s i l e n t .  A l l 17 n u c l e o t i d e  changes i n  r e s u l t i n a n amino a c i d c h a n g e i n o n e o r  both o f t h e corresponding  but  o f ORFs 3 a n d 4 i m p o s e s  Thirty  i n t h e 5'- 571 n u c l e o t i d e s  o f ORF 5  The n u c l e o t i d e c h a n g e s i n t h e r e m a i n i n g  t e r m i n u s o f t h a t ORF 5, h o w e v e r , r e s u l t i n f r e q u e n t  3'  amino a c i d  s u b s t i t u t i o n s w h i c h s u g g e s t s ORF 5 h a s t w o d o m a i n s . K e e s e e t al. (1990) c o m p a r e d t h e n u c l e o t i d e PLRV i s o l a t e s f r o m d i f f e r e n t g e o g r a p h i c a l  locations.  A u s t r a l i a n PLRV i s o l a t e h a d t h e most d i v e r g e n t 93%  s i m i l a r i t y t o t h e Canadian, Netherlands,  i s o l a t e s w h i c h s h a r e 98% n u c l e o t i d e the n u c l e o t i d e p r o t e i n gene sequence.  sequence o f f o u r The  genome w i t h  and S c o t t i s h  sequence s i m i l a r i t y .  sequence v a r i a t i o n occurs  about  i n ORF 1.  Most o f  The c o a t  (ORF 3) h a d t h e most h i g h l y c o n s e r v e d a m i n o a c i d  The amino a c i d s e q u e n c e o f ORF 0 was a l s o h i g h l y  c o n s e r v e d amongst t h e 4 PLRV i s o l a t e s b u t showed  little  s i m i l a r i t y t o ORF 0 o f BWYV ( M a r t i n et al., 1 9 9 0 ) . Previous  s e r o l o g i c a l and c y t o p a t h o l o g i c a l s t u d i e s  s u g g e s t e d t h a t t h e l u t e o v i r u s e s c o u l d be c l a s s i f i e d subgroups  (Gill  the nucleotide o f t h e genomes. ORF  a n d Chong, 1 9 7 9 ) .  have  i n t o two  This concept i s supported a t  l e v e l b y d i f f e r e n c e s e s p e c i a l l y i n t h e 5' p o r t i o n These d i f f e r e n c e s i n c l u d e  0 i n BWYV, PLRV, a n d CRLV,  (1) t h e p r e s e n c e o f  (2) a l o n g o v e r l a p  b e t w e e n ORFs 1 a n d 2 i n t h e PLRV s u b g r o u p ,  that  occurs  (3) a d i f f e r e n t  24 structural  feature  o f t h e two  s u b g r o u p s , and  b e t w e e n ORF  1 and  serological,  i n t h e p r o p o s e d f r a m e s h i f t a r e a o f ORF (4) t h e  l a c k of sequence  2 of the d i f f e r e n t  c y t o p a t h o l o g i c a l , and  subgroups.  SDV;  the  2.3  V i r u s Induced 2.3.1  and  one  BYDV-SGV s e r o t y p e s  CRLV ( M a r t i n e t al.,  first  report of  and  1990) .  " c r o s s - p r o t e c t i o n " between p l a n t  (McKinney, 1929), t h e v a r i o u s  reported  and  Resistance  between v i r u s e s have r e c e i v e d i n t e n s e  interactions that investigation.  t h a t a p l a n t i n o c u l a t e d w i t h one  (inducer) strain  on  Cross-protection  Since the viruses  Based  o t h e r s u b g r o u p c o n s i s t s o f PLRV, BWYV, BYDV-RPV  BYDV-RMV s e r o t y p e s ,  2  similarity  molecular evidence  s u b g r o u p i n c l u d e s BYDV-PAV, BYDV-MAV, and  1 and  f a i l e d t o develop the  (challenger)  v i r u s e s c o u l d be the p l a n t  o r t h e y c o u l d be  observations challenge  v i r u s c o u l d not  subsequent t r a n s m i s s i o n  replicate protecting  s t r a i n of a v i r u s  symptoms t y p i c a l  simultaneously introduced  w e r e c o n f i r m e d by  g e n e r a l i z a t i o n was  McKinney  of a  second  upon i n o c u l a t i o n w i t h t h a t s t r a i n .  introduced  be  Thung  The  two  to different parts  sequentially. (1931) who  observed that  made t h a t t h e  challenger  Thus  of  These  r e c o v e r e d from p r o t e c t e d p l a n t s  to i n d i c a t o r plants.  i f t h e p l a n t had  occur  the by  the  s t r a i n does  not  p r e v i o u s l y been i n o c u l a t e d w i t h  a  strain.  There are  s e v e r a l examples of c h a l l e n g e r  p l a n t s t h a t l a c k o r show a d e l a y  i n symptoms.  replication This  is  in  contrary  25 t o t h e e a r l y c o n c e p t s o f c r o s s - p r o t e c t i o n w h i c h assumed t h a t t h e challenge  v i r u s cannot  protecting virus.  infect a cell  already  infected with  I t was t h o u g h t t h a t r e p l i c a t i o n may  i n f e c t i o n by t h e c h a l l e n g e  v i r u s o f c e l l s which had  inoculation with the inducer. B a r k e r and H a r r i s o n  Otsuki  and Takebe  (1978) d e m o n s t r a t e d  a  represent  escaped  (1976) a n d  that protoplasts  with  i n d u c e d r e s i s t a n c e c a n be s e q u e n t i a l l y i n f e c t e d w i t h a r e l a t e d c h a l l e n g e r b u t t h a t t h e i n d u c e r - i n f e c t e d p r o t o p l a s t s became increasingly  r e s i s t a n t t o t h e c h a l l e n g e r as t h e i n t e r v a l  i n o c u l a t i o n s was  increased.  A wide d i v e r s i t y  o f d e f e n s e r e s p o n s e s have been r e p o r t e d  r e f e r r e d t o as c r o s s - p r o t e c t i o n . number o f l e s i o n s ,  are  When l e a v e s ,  decrease i n the  and p r e v e n t i o n  or delay  lesion-inducing v i r u s there  when t h e same v i r u s i s i n o c u l a t e d t o h e a l t h y p l a n t s .  obtained  This  r e s p o n s e has been r e p o r t e d between r e l a t e d v i r u s s t r a i n s F u l t o n , 1978) a n d a l s o b e t w e e n u n r e l a t e d v i r u s e s  1958; K a s s a n i s e t al.,  1974).  Several  virus,  i s often  a r e d u c t i o n i n t h e number o f l e s i o n s a s c o m p a r e d t o t h a t  1951;  of  i n f e c t e d s y s t e m i c a l l y with another  inoculated with a local  (Fulton,  (Thomson,  r e p o r t s h a v e shown a  d e c r e a s e i n s i z e o f l e s i o n s p r o d u c e d by t h e c h a l l e n g e r i n systemically inducer  i n f e c t e d leaves previously inoculated with  (Davis and Ross,  1968; R o s s ,  1961).  (Wenzel,  an  Reduction i n the  c o n c e n t r a t i o n a t t a i n e d by t h e c h a l l e n g e r h a s b e e n between u n r e l a t e d  and  These i n c l u d e a d e c r e a s e i n t h e  decrease i n the l e s i o n s i z e ,  concentration of challenger v i r u s , symptoms.  between  reported  1971) a n d r e l a t e d s t r a i n s o f v i r u s  26 (Zaitlin,  1976; Jockusch, 1968).  challenger  into a plant  F i n a l l y , the i n t r o d u c t i o n  systemically  of a  i n f e c t e d with an i n d u c e r  o f t e n r e s u l t s i n a l a c k or delay o f the symptoms a t t r i b u t e d t o the  challenger.  Closely related strains usually protect  than d i s t a n t l y r e l a t e d s t r a i n s and although u s u a l l y  more  reciprocal  t h e r e are examples o f u n i d i r e c t i o n a l or no p r o t e c t i o n  i n one  direction.  2.3.2 A c q u i r e d R e s i s t a n c e Another phenomenon, r e f e r r e d t o as " a c q u i r e d describes  a condition  resistance",  i n which the inducer i s not present i n the  same c e l l s as the c h a l l e n g e r .  When p l a n t s  are h y p e r s e n s i t i v e  to  a particular virus, a localized infection usually results. Although i n f e c t i o n i s l o c a l i z e d , i t a f f e c t s d i s t a n t t i s s u e s not i n f e c t e d by the v i r u s . been d e s c r i b e d . characterized  Two types of a c q u i r e d  One type, l o c a l a c q u i r e d  resistance  resistance,  resistance,  was  by a r i n g o f v i r u s - f r e e t i s s u e surrounding a l o c a l  l e s i o n which was r e s i s t a n t t o i n o c u l a t i o n with a challenger  have  (Yarwood,  1960) .  The other type, systemic  r e s u l t e d i n the c h a l l e n g e r  i n the l e a v e s above the p o i n t  lesion-forming acquired  producing smaller  of inducer i n o c u l a t i o n  lesions  (Gilpatrick  and Weintraub, 1952; Ross, 1961) .  2.3.3 M u t u a l  Exclusion  A t h i r d phenomenon r e f e r r e d t o as "mutual e x c l u s i o n " has been d e s c r i b e d  f o r certain plant viruses.  J e d l i n s k i and Brown  27 (1965) r e p o r t e d three  that  simultaneous  d i f f e r e n t s t r a i n s o f BYDV t h a t  v i r u l e n c e but  i n vector  of the  Although the  host.  t h e y d i d not Similar and  specificity  p e r s i s t and  host  v i r u s was  Freitag  BYDV a l s o al.  appears t o  by  cross-protection,  aphids.  has  inducer  been  of the  and  one  other  referred to luteoviruses  symptoms  the  vectors.  (1959a and  1959b) viruses  does PLRV.  and  B o t h Webb  a l l s t r a i n s of as  a lack  absence of  PLRV  of  virus  r e s u l t s of  Smith  Resistance  i n c l u d i n g the (de  sequestering Z o e t e n and  of  virus-  challenger  Fulton,  1975).  RNA It  o c c a s i o n a l l y i n a mixed v i r u s i n f e c t i o n , the  parental (Dodds and  as  recovery  (1965) w i t h BYDV.  type  i s encapsidated  Hamilton,  1976)  .  i n the  This  capsid  protein  phenomenon  genomic m a s k i n g o c c u r s r e a d i l y b e t w e e n  (Hu  et  al.,  1988).  I t i s an  b e c a u s e g e n o m i c m a s k i n g i s more l i k e l y viruses  as  defined  strain  Brown  capsid protein  shown t h a t  genome o f  by  h y p o t h e s e s have b e e n p r o p o s e d t o e x p l a i n  induced p r o t e c t i o n the  in  y e l l o w s group of  i s s i m i l a r to the  Models f o r Virus  Several  by  This  Jedlenski  2.3.4  Valenta  (1958) f o u n d t h a t  symptoms c h a r a c t e r i s t i c o f t h e  (1963) and  by  recovered  cross-protect,  Harrison  sustained  recovery  not  showed m i l d  with  leafhoppers.  (1952) and  provided  only  r e s u l t e d i n complete  (1964) w i t h c e r t a i n o f t h e by  seedlings  d i f f e r e d not  initially  r e s u l t s have b e e n r e p o r t e d  transmitted  et  i n o c u l a t i o n of  t h a n between u n r e l a t e d  ones.  to  a t t r a c t i v e hypothesis o c c u r between  However, TMV  related  capsid  mutants  28 t h a t produce p r o t e i n incapable still  o f a s s e m b l i n g w i t h TMV RNA a r e  capable of p r o t e c t i n g tobacco  r e s u l t s by J o c k u s c h  inducer al.,  Similar  (TRV) a r g u e s t r o n g l y  that  o f c h a l l e n g e r RNA b y t h e c a p s i d p r o t e i n o f t h e  i s not involved i n the p r o t e c t i o n .  1979) i n d i c a t e d t h a t p r i o r  potato  1976) .  (1968) f o r TMV a n d b y Cadman a n d H a r r i s o n  (1959) f o r t o b a c c o r a t t l e v i r u s encapsidation  (Zaitlin,  spindle tuber  viroid,  protein, protects against  Evidence  (Niblett et  infection with a mild s t r a i n of  w h i c h does n o t encode a s t r u c t u r a l  expression  of a severe s t r a i n  upon  subsequent i n o c u l a t i o n . I t has been suggested the  inducer  (Gibbs,  could sequester,  1969) t h a t t h e r e p l i c a s e o f  b u t n o t t r a n s c r i b e , t h e RNA o f t h e  c h a l l e n g e r which would prevent i t s r e p l i c a t i o n . viruses c l o s e l y r e l a t e d t o the inducer identical binding  replicase binding site.  of the inducer  This  The RNA o f  may h a v e a s i m i l a r b u t n o t s i m i l a r i t y would permit  r e p l i c a s e t o t h e c h a l l e n g e r RNA b u t no  replication. One h y p o t h e s i s  has i m p l i c a t e d d e p l e t i o n o f e s s e n t i a l  m o l e c u l e s by t h e i n d u c e r essential challenger  thus a f f e c t i n g the synthesis of  compounds.  easily explain virus specificity,  Such a mechanism w o u l d n o t although  a competition f o r  r i b o s o m e s f o r w h i c h r e l a t e d s t r a i n s would have s i m i l a r could explain the s p e c i f i c i t y  observed.  Similarly,  affinities  the replicase  w h i c h may b e composed o f s u b u n i t s  of both v i r a l  (Zaitlin,  A l t e r n a t i v e l y h o s t membrane  1976) may be l i m i t i n g .  s i t e s w h i c h may b e i n v o l v e d a s s i t e s o f v i r a l  and host  origin  RNA r e p l i c a t i o n (de  29 Z o e t e n et al. 1972) may n o t b e a v a i l a b l e t o t h e c h a l l e n g e r . T h e r e a r e many r e p o r t s virus-infected plants of tobacco w i t h  of a n t i v i r a l  (Loebenstein,  factor  1972).  Following  inoculation  TMV, f o u r p r o t e i n s w e r e f o u n d t h a t w e r e n o t  present i n v i r u s - f r e e plants 197 6 ) .  s u b s t a n c e s p r o d u c e d by  ( G i a n i n a z z i e t al. 1 9 6 9 , v a n L o o n ,  A phosphoglycoprotein which functions  a s an a n t i v i r a l  ( S e l a a n d A p p l e b a u m , 1962) h a s b e e n i s o l a t e d f r o m  inoculated with  TMV.  A p r o t e c t i o n model has been p r o p o s e d t h a t viruses,  tobacco  viroids,  i s applicable to  and coat p r o t e i n - d e f e c t i v e v i r u s e s  operates at the n u c l e i c a c i d l e v e l .  which  Thus i f e i t h e r p o s i t i v e - o r  n e g a t i v e - s e n s e RNA o f an i n d u c e r  v i r u s i s abundant compared t o  that  i t might " t r a p " t h e s t r u c t u r a l l y  of the entering  challenger,  r e l a t e d RNA o f t h e c h a l l e n g e r  ( P a l u k a i t i s and Z a i t l i n ,  T h e r e i s a l s o some e v i d e n c e t h a t t h e i n d u c e r plasmodesmata t o a l l o w challenger.  the  h o s t by moving t h r o u g h plasmodesmata  Certain types of plant viruses spread  W o l f e t al.  (1989) d e m o n s t r a t e d t h a t t h e TMV movement limit  2.4  Resistance  G e n e t i c a l l y Engineered Virus  into a plant.  o f t h e plasmodesmata.  (1980) s u g g e s t e d t h a t v i r u s - i n d u c e d  c o u l d be o b t a i n e d  resistance  by t r a n s f e r r i n g a p o r t i o n o f a v i r a l  The c o r r e s p o n d i n g gene p r o d u c t s c o u l d  protection against  throughout  ( K i t a j i m a and L a u r i t i s ,  protein alters the size exclusion  Hamilton  may m o d i f y t h e  i t s movement b u t may p r e v e n t movement o f  the  1969).  1984) .  i n f e c t i o n by t h e c h a l l e n g e r ,  genome provide  either  directly  30 or i n d i r e c t l y . viral  One a d v a n t a g e  i n u s i n g cDNA o f a p o r t i o n o f t h e  genome i n s t e a d o f t h e w h o l e genome, i s t h a t t h e RNA  t r a n s c r i p t w o u l d n o t be i n f e c t i v e .  Another advantage  w o u l d be  t h e i n h e r i t a n c e o f t h e p r o t e c t i o n f r o m one g e n e r a t i o n t o a n o t h e r . Subsequent developments  t o Hamilton's  (1980)  suggestion several  occurred which f a c i l i t a t e d t h e i n s e r t i o n o f f o r e i g n  DNA i n t o p l a n t genomes.  F r a l e y e t al.  (1983) c o n s t r u c t e d  c h i m a e r i c genes t h a t f u n c t i o n e d as dominant s e l e c t a b l e markers i n plant cells.  These c h i m a e r i c genes w h i c h c o n t a i n e d t h e b a c t e r i a l  gene f o r n e o m y c i n p h o s p h o t r a n s f e r a s e I I (NPT I I ) a n d t h e 5' a n d 3' r e g u l a t o r y r e g i o n s o f t h e n o p a l i n e s y n t h a s e expressed c o n s t i t u t i v e l y tumefaciens,  i n higher plant c e l l s .  t h e c a u s a t i v e agent  o f crown g a l l  c a p a b l e o f t r a n s f e r r i n g a DNA segment between s p e c i f i c b o r d e r sequences, plasmid cells.  (NOS) gene w e r e Agrobacterium disease, i s  ( t h e T-DNA), l o c a t e d  from i t s tumour-inducing  ( t h e T i p l a s m i d ) i n t o t h e n u c l e a r DNA o f i n f e c t e d Marker  plant  g e n e s were i n c o r p o r a t e d i n t o t h e T i p l a s m i d  t h r o u g h homologous r e c o m b i n a t i o n and s u b s e q u e n t l y t r a n s f e r r e d i n t o t o b a c c o c e l l s u s i n g A. tumefaciens A n a l y s i s o f progeny  ( H o r s c h e t al.,  indicated that the chimaeric  1984).  kanamycin  r e s i s t a n c e gene was i n h e r i t e d a n d was e x p r e s s e d a s a d o m i n a n t Mendelian  trait.  A procedure f o r l e a f d i s k t r a n s f o r m a t i o n and r e g e n e r a t i o n o f p e t u n i a , t o b a c c o , a n d t o m a t o was d e s c r i b e d b y H o r s c h e t al. (1985)  w h i c h u t i l i z e d t h e gene t r a n s f e r c a p a b i l i t y  tumefaciens.  They u s e d t h e A. tumefaciens  o f A.  s t r a i n GV3TH1SE  which  31 contained  a modified  octopine  T i plasmid  (pTiB6S3SE) i n w h i c h a l l  p h y t o h o r m o n e b i o s y n t h e t i c g e n e s a n d t h e T-DNA r i g h t sequence had been d e l e t e d .  F o r m a t i o n o f a c o i n t e g r a t e between  p T i B 6 S 3 S E a n d an i n t e r m e d i a t e avirulent  viral  vector resulted i n a functional,  T-DNA.  2.4.1 The  Tobacco Mosaic V i r u s technology  was now a v a i l a b l e t o t r a n s f e r a p o r t i o n o f a  genome i n t o a p l a n t .  cDNA c l o n e  B e v a n e t al. (1985) t r a n s f e r r e d a  o f t h e tobacco mosaic v i r u s  i n t o N. tabacum.  T h i s was t h e f i r s t  i n T a b l e 1) t o a c h i e v e  (TMV) c o a t p r o t e i n gene  o f many a t t e m p t s  A delay  of disease  observed i n transgenic tobacco expressing  p r o t e i n gene  (summarized  v i r u s r e s i s t a n c e by t h e i n s e r t i o n o f a  c l o n e d v i r u s gene i n t o a p l a n t . was  border  (Powell Abel  e t a l . , 1986).  development  t h e TMV c o a t  Coat p r o t e i n  a c c u m u l a t e d t o 0.1% o f l e a f p r o t e i n w i t h i n t h e t r a n s g e n i c and  a p p e a r e d t o b e a monomer o r m u l t i m e r w i t h a  coefficient  o f approximately  4S.  plants  sedimentation  Of 17 r o o t e d c u t t i n g s , 10  p l a n t s t h a t d i d n o t c o n t a i n t h e c o a t p r o t e i n gene d e v e l o p e d classical  TMV symptoms.  Four o f t h e p l a n t s e x p r e s s i n g  t h e gene  d e v e l o p e d symptoms 2 t o 14 d a y s l a t e r t h a n t h e c o n t r o l s a n d t h e other  3 d i d n o t d e v e l o p symptoms d u r i n g 20 d a y s o f o b s e r v a t i o n .  S i m i l a r r e s u l t s were o b t a i n e d protein.  w i t h p r o g e n y shown t o e x p r e s s  An i n c r e a s e i n i n o c u l u m d e c r e a s e d t h e d e l a y  i n symptom  a p p e a r a n c e a n d i n c r e a s e d t h e number o f p l a n t s t h a t became i n f e c t e d a n d d e v e l o p e d symptoms.  Those p l a n t s t h a t  coat  never  32 T a b l e 1. Summary o f e x a m p l e s o f g e n e t i c a l l y e n g i n e e r e d virus resistance. Virus Group  Test Virus  Chimaeric Gene  Tobamovirus A l f a l f a Mosaic  TMV AMV  PSSS^cTMV^NOS P35S:cAMV:N0S  A l f a l f a Mosaic Ilarvirus Tobravirus Potexvirus Potexvirus Potexvirus Cucumovirus Potyvirus Potyvirus Cucumovirus Nepovirus  AMV TSV TRV, PEBV PVX PVX PVX CMV TEV, PVY PVY CMV, TAV TobRV  P19S :cAMV:CaMS P35S:cTSV:N0S P35S:cTRV:N0S P35S:cPVX:rbcS-E9 eP35S : cPVX: rbcS-E9 P35S:cPVX:N0S P35S:cCMV:rbcS-E9 P35S:cSMV:N0S eP35S:cPVY:rbcS-E9 P35S:sCMV :N0S P35S:sTobRV:NOS  plant  References  4  3  5  6  7  8  P o w e l l - A b e l e t al., 1986 Turner e t al., 1987 Van Dun e t al., 1987 L o e s c h - F r i e s e t al., 1987 Van Dun e t al., 1988 Van Dun and B o l , 1988 Hemenway e t al., 1988 Lawson e t al., 1990 Hoekema e t al., 1989 Cuozzo e t al., 1988 S t a r k and Beachy, 1989 Lawson e t al., 1990 H a r r i s o n e t al., 1989 G e r l a c h e t al., 1987  ^353: 35S promoter from CaMV cTMV: coat p r o t e i n cDNA o f TMV NOS: n o p a l i n e synthase p o l y a d e n y l a t i o n s i g n a l "P19S: 19S promoter from CaMV CaMS: 19S p o l y a d e n y l a t i o n s i g n a l from CaMV r b c S - E 9 : 3' sequence o f t h e soybean r i b u l o s e b i p h o s p h a t e c a r b o x y l a s e eP35S: d u p l i c a t e d CaMV 35S promoter-enhancer "sCMV: s a t e l l i t e RNA cDNA o f CMV  2  3  5  gene  6  7  d e v e l o p e d symptoms were shown n o t t o b e i n f e c t e d v i a v i r u s replication  experiments.  T r a n s g e n i c t o m a t o e x p r e s s i n g t h e c o a t p r o t e i n gene o f t h e common  (t^) s t r a i n o f TMV was shown t o be r e s i s t a n t t o TMV  strains U  x  a n d PV 230 a n d t o a l e s s e r e x t e n t t o m a t o m o s a i c v i r u s  s t r a i n s L, 2, a n d 2 , ( N e l s o n e t al., 1 9 8 8 ) . 2  Resistance  included  a d e l a y i n symptoms o r e s c a p e f r o m symptom d e v e l o p m e n t a n d l e s s v i r u s accumulation i nthose transgenic plants that symptoms t h a n o c c u r r e d i n c o n t r o l s .  developed  Those p l a n t s w h i c h showed no  symptom d e v e l o p m e n t i n g r e e n h o u s e e x p e r i m e n t s m a i n t a i n e d r e s i s t a n c e under f i e l d  c o n d i t i o n s and tomato y i e l d s  were  u n a f f e c t e d by v i r u s o r e x p r e s s i o n o f t h e c o a t p r o t e i n gene.  Coat  p r o t e i n a c c u m u l a t i o n i n t h e t r a n s g e n i c p l a n t s a p p r o a c h e d 0.05% o f  33 total  leaf protein.  Although  i n c r e a s i n g the v i r u s  c a u s e d a more r a p i d a p p e a r a n c e o f s y s t e m i c  concentration  disease  symptoms i n  c o n t r o l p l a n t s , t h e p r o t e c t e d t r a n s g e n i c p l a n t s showed no increase of disease R e g i s t e r and  symptoms.  Beachy  i n t r a n s g e n i c t o b a c c o and protein, TMV  c o u l d be  w h i c h had  (1988) r e p o r t e d t h a t t h e  and  o v e r c o m e by  synthesized  8.0.  r e - e n c a p s i d a t i o n by  p o s t u l a t e d t h a t a b r i e f pH  allowing i n i t i a t i o n disassembly  TMV  5'  end  RNA  not  continuous  ( N e j i d a t and  high temperatures  p r o t e i n to decrease to very  Transgenic  (1984a and  o f TMV  1984b)  removes a  occurrence  few  o f low  B e a c h y , 1989) .  level  the  degree  (30-35°C) c a u s e d t h e low  levels.  although  disease  level  Under t h e s e disease  be  Exposure of  to coat  conditions  symptoms when  d e v e l o p m e n t was  delayed.  p l a n t s w h i c h were moved f r o m 35 t o 22°C a c c u m u l a t e d  normal l e v e l s of coat p r o t e i n w i t h i n s e v e r a l hours. level  of v i r u s  addressed.  the transgenic p l a n t s developed systemic i n o c u l a t e d w i t h TMV  that  i n t r a n s g e n i c t o b a c c o were f o u n d t o  t e m p e r a t u r e dependent  or  protein  amount o f c o a t p r o t e i n t h a t a c c u m u l a t e d and  o f r e s i s t a n c e t o TMV  RNA  subsequent c o t r a n s l a t i o n a l  However, t h e was  coat  level  coat  of the v i r u s p a r t i c l e  o f t r a n s l a t i o n and  of the v i r u s .  TMV  suggests  Wilson  treatment  from the  p r o t e c t i o n t o w a r d s TMV The  8.0  This at the  i n transgenic plant c e l l s .  coat p r o t e i n subunits  protection  i n o c u l a t i o n w i t h e i t h e r TMV  b e e n p r e t r e a t e d a t pH  not  TMV  derived protoplasts expressing  interference with i n f e c t i o n i s probably uncoating  such  o f c o a t p r o t e i n mRNA was  constant  r e g a r d l e s s of  Since  the  temperature  34 and was a s s o c i a t e d w i t h p o l y r i b o s o m e s , p r o t e i n a t e l e v a t e d temperatures instability  o f the p r o t e i n .  the low l e v e l  was t h o u g h t  In contrast,  t r a n s g e n i c tomato a l s o dropped  o f coat  t o be due t o  coat p r o t e i n l e v e l s i n  a t elevated temperatures  but the  t o m a t o r e t a i n e d t h e r e s i s t a n c e t o TMV. I n t r o d u c t i o n o f e i t h e r p u r i f i e d TMV c o a t p r o t e i n o r v i r u s i n a c t i v a t e d by u l t r a v i o l e t  irradiation  induced t r a n s i e n t p r o t e c t i o n towards simultaneously o r subsequently  i n t o tobacco p r o t o p l a s t s  challenge virus introduced  ( R e g i s t e r and Beachy,  1989).  S i m i l a r r e s u l t s were o b t a i n e d u s i n g p o t a t o v i r u s X (PVX). TMV,  t h eextended  helical  aggregates  o f coat p r o t e i n c o n f e r r e d a  more l o n g - l a s t i n g p r o t e c t i o n t o w a r d s aggregates. protein  Wilson  "rodlets"  TMV t h a n d i d l o w e r  (1989) r e p o r t e d t h e p r e s e n c e  order  o f TMV c o a t  i nt r a n s g e n i c tobacco but Powell Abel e t a i .  (1986) f o u n d o n l y a g g r e g a t e s  s m a l l e r t h a n 4S.  Therefore, t h e  conformation o f p r o t e i n i n v o l v e d i n p r o t e c t i o n remains identified.  For  t o be  A l t h o u g h TMV p r o v i d e d t r a n s i e n t p r o t e c t i o n a g a i n s t  s u n n hemp m o s a i c v i r u s ,  a distantly  related virus,  similar  p r o t e c t i o n does n o t o c c u r i n t r a n s g e n i c p l a n t s o r p r o t o p l a s t s e x p r e s s i n g TMV c o a t  protein.  Tobacco mosaic p s e u d o v i r u s p a r t i c l e s c o n t a i n i n g c h i m a e r i c mRNA f o r Escherichia glucuronidase  coli  (Migula) C a s t e l l a n i and Chalmers  (GUS) were e l e c t r o p o r a t e d i n t o c o n t r o l o r  t r a n s g e n i c p r o t o p l a s t s e x p r e s s i n g TMV c o a t p r o t e i n al.,  1989b).  similar  levels  0-  Although unencapsidated  (Osbourn e t  GUS mRNA was e x p r e s s e d a t  i n b o t h t r a n s g e n i c a n d c o n t r o l p r o t o p l a s t s , GUS-  35 p a r t i c l e mRNA was e x p r e s s e d 1 0 0 - f o l d  less efficiently i n  t r a n s f o r m e d p r o t o p l a s t s p r o b a b l y as a r e s u l t o f i n h i b i t i o n o f disassembly of the p a r t i c l e s .  B o t h c o n t r o l a n d XJ s t r a i n X  t r a n s f o r m e d p r o t o p l a s t s were e q u a l l y s u s c e p t i b l e t o cowpea TMV, RNA  a s w e l l a s u n e n c a p s i d a t e d RNA o f b o t h TMV s t r a i n s . o f t h e cowpea s t r a i n t h a t was t r a n s e n c a p s i d a t e d  l  i n f e c t i o u s i n both types of  protoplast.  although the  interaction i n h i b i t s nucleocapsid in transformed protoplasts there that  interferes with a later  However,  i n \J c o a t  p r o t e i n in v i t r o was e q u a l l y I t appears t h a t  strain  protein-protein  d i s a s s e m b l y a n d GUS  expression  must a l s o b e a n o t h e r m e c h a n i s m  stage o f i n f e c t i o n i n v o l v i n g t h e  h o m o l o g o u s v i r a l RNA. Because t r a n s g e n i c  t o b a c c o p l a n t s w h i c h e x p r e s s TMV c o a t  p r o t e i n produce s t a b l e v i r u s - l i k e r o d l e t s o f various (Wilson  1989) a n a t t e m p t was made t o m e a s u r e t h e a b i l i t y  coat p r o t e i n t o encapsidate chimaeric acetyltransferase  f a i l e d t o increase  CAT a c t i v i t y .  origin-of-assembly  P r o t o p l a s t s and p l a n t s expressing  c o a t p r o t e i n gene a n d t h e r e p o r t e r gene  transgenic)  of this  chloramphenicol-  (CAT) RNA c a r r y i n g t h e TMV  ( O s b o u r n e t al., 1 9 8 9 a ) . the  lengths  both  ( i . e . double  t h e number o f r o d l e t s o r r e d u c e  However, i n T M V - i n f e c t e d p l a n t s t h e h i g h  levels of  c o a t p r o t e i n e n c a p s i d a t e d s u b s t a n t i a l amounts o f CAT mRNA reducing  CAT a c t i v i t y  ( S l e a t e t al., 1 9 8 8 ) .  produced by t h e t r a n s g e n i c  The TMV c o a t  protein  p l a n t s was f o u n d t o b e e x c l u s i v e l y  located i nchloroplast-associated electron-dense  bodies.  Hence,  O s b o u r n et al. (1989a) s u g g e s t e d t h a t t h e s u b c e l l u l a r l o c a t i o n o f  36 coat  p r o t e i n i n the chloroplasts prevented  mRNA i n t h e c y t o p l a s m .  Since  i n t e r a c t i o n w i t h CAT  these double-transgenic  p r o t o p l a s t s were r e s i s t a n t t o v i r u s a c l o s e virus,  v i r u s coat  addition  t h e coat  disassembly in  protein,  repackaging Powell  chimaeric  at preventing  stage o f r e p l i c a t i o n  e t al. (1990) made two m o d i f i c a t i o n s protein  codon a n d t h e t R N A - l i k e  Only those tobacco p l a n t s regardless  than  that  to the  i n c l u d i n g removal  untranslated synthesized  3' coat  o f t h e p r e s e n c e o r a b s e n c e o f t h e 3' e n d o f  TMV-RNA, were p r o t e c t e d there  at a later  In  RNA.  of t h e i n i t i a t i o n  protein,  and c h l o r o p l a s t s i s i m p l i e d .  g e n e s e n c o d i n g t h e TMV c o a t  sequence.  i n t e r a c t i o n between  p r o t e i n must be more e f f i c i e n t  or interfering  p l a n t s and  against  TMV i n f e c t i o n .  was a c o r r e l a t i o n between t h e l e v e l  amount o f a c c u m u l a t e d  coat  Furthermore,  o f p r o t e c t i o n and t h e  protein.  2 . 4 . 2 A l f a l f a Mosaic V i r u s Incorporation gene i n t o b a c c o infection of  individuals lesions in  e t a l . , 1987).  symptoms, that  plants  Inoculated  lower l e v e l s  symptoms,  o f AMV c o a t  AMV  a number o f o r fewer  The AMV c o a t  to levels  transgenic  protein  Protection r e s u l t e d i n a delay  attenuated  leaves.  (AMV) c o a t  protection against  n e v e r p r o d u c e d symptoms,  i n inoculated  the transgenic  protein.  mosaic v i r u s  and tomato p r o v i d e d  (Turner  systemic  of the a l f a l f a  chlorotic  protein  accumulated  o f 0.1 t o 0.8% o f t o t a l  plants  contained  leaf  substantially  p r o t e i n a s compared t o t h a t  i n the  37 controls. the  Transgenic plant  5' u n t r a n s l a t e d  leader  coat p r o t e i n t r a n s c r i p t s  contained  sequence o f t h e c o a t p r o t e i n  w h i c h h a s b e e n shown t o i n c r e a s e  gene  t r a n s l a t i o n a le f f i c i e n c y  ( J o b l i n g a n d G e r k e , 1987) . Loesch-Fries  e t al.  (1987) showed t h a t e x p r e s s i o n  coat p r o t e i n i n transgenic  tobacco i n h i b i t e d l o c a l  t w o AMV s t r a i n s b u t n o t TMV.  infection.  However, t r a n s g e n i c  when i n o c u l a t e d w i t h a l l f o u r AMV RNAs. obtained  b y V a n Dun e t al.  reported  that  infectious  i n f e c t i o n by  I n o c u l a t i o n w i t h AMV v i r i o n s  p r e v e n t e d o r d e l a y e d t h e development o f l o c a l systemic  o f t h e AMV  (1987).  a n d i n some c a s e s  p l a n t s were  susceptible  S i m i l a r r e s u l t s were  V a n Dun e t al.  (1987)  also  a l t h o u g h a m i x t u r e o f a l l f o u r AMV RNAs i s e q u a l l y  i n c o n t r o l and t r a n s g e n i c  p l a n t s , a m i x t u r e o f RNAs 1,  2, a n d 3 i s n o t i n f e c t i o u s i n c o n t r o l s b u t i s i n t r a n s g e n i c plants.  This  suggests that t h e endogenously produced  protein i s biologically  a c t i v e and i s a b l e  p r o t e i n p r o d u c e d b y RNA 4. inoculated transgenic V a n Dun e t al. expressing  Homogenate  to replace  from a symptomless  (1988) f o u n d t h a t t r a n s g e n i c  t h e AMV c o a t p r o t e i n p r o t e c t e d (TSV).  tobacco  against  A frame-shift  AMV b u t n o t t h e mutation  w i t h i n t h e AMV c o a t p r o t e i n gene p r o d u c e d a t r u n c a t e d from t h e chimaeric  nucleotides.  t h e coat  p l a n t was n o t i n f e c t i o u s .  r e l a t e d tobacco streak v i r u s  protein  coat  mRNA w h i c h c o n t a i n e d  Transgenic plants expressing  only  coat four  t h i s modified  extra gene  showed no r e s i s t a n c e t o i n f e c t i o n b y AMV i n d i c a t i n g t h a t p r o t e c t i o n was c o a t p r o t e i n - m e d i a t e d .  Inoculation of these  38 plants  with  AMV  RNAs 1,  demonstrating that the  AMV  protein  genome.  the  2,  and  3 d i d not  result in infection  truncated protein  was  unable to  E x p r e s s i o n o f n e g a t i v e - s e n s e RNA  gene i n t r a n s g e n i c  plants  d i d not  inhibit  activate  of the  AMV  coat  virus  infection.  2.4.3  Tobacco Streak V i r u s  Transgenic tobacco e x p r e s s i n g the remained free et  al.,  of  1988).  lesions  on  inoculated  control plants transgenic  its  RNA.  were a b l e t o  RNAs 1,  protection and  i n f e c t the  TSV can  necrotic the  inoculation  the  was  not  r e l a t e d AMV  or  infect control plants plants  a c t i v a t e the  AMV  but  i n d i c a t i n g that  the  genome.  Tobacco R a t t l e V i r u s  protein  gene o f t h e  Van  e t al.  Although the  of t r a n s g e n i c  TCM  TCM  and  PLB  from the  PLB  s t r a i n was  A n g e n e n t e t al. coat proteins  of s o l u b l e plants  tobacco e x p r e s s i n g the  s t r a i n and  (1987) and  l e s s t h a n 0.01%  particles  3 d i d not  Dun  Homogenate o f  towards the  transgenic  P r o d u c t i o n of transgenic  Dun  infected.  TSV  (Van  l e a v e s a f t e r 3 weeks w h e r e a s  no 2,  expressed coat p r o t e i n  2.4.4  developed  p r e p a r e d 1 week a f t e r TSV  T h e r e was  AMV  occasionally  became s y s t e m i c a l l y  plants  infectious.  gene o f  symptoms f o r 3 weeks p o s t - i n o c u l a t i o n These p l a n t s  the  coat p r o t e i n  (1990),  TRV  described  0.05%  respectively,  both  w e r e r e s i s t a n t a g a i n s t i n f e c t i o n by  h o m o l o g o u s TRV  strain  (Van  Dun  by  respectively.  accumulated to  leaf protein,  coat  e t al.,  and types  virus 1988;  39 A n g e n e n t , 1990) .  P l a n t s were s u s c e p t i b l e t o i n f e c t i o n w i t h  of t h e homologous s t r a i n o r n u c l e o p r o t e i n strain.  RNA  of the heterologous  T r a n s g e n i c p l a n t s r e m a i n e d f r e e o f symptoms a l t h o u g h  symptoms o c c a s i o n a l l y d e v e l o p e d on i n o c u l a t e d  leaves.  C o m p l e m e n t a r y DNA h y b r i d i z a t i o n s i n d i c a t e d t h a t t h e s e q u e n c e s i m i l a r i t y b e t w e e n t h e c o a t p r o t e i n g e n e s o f TRV s t r a i n s TCM a n d PLB  i s much l o w e r t h a n t h a t o b s e r v e d b e t w e e n p e a e a r l y b r o w n i n g  virus  (PEBV) a n d t h a t  suggested that t h i s proteins  (Van Dun a n d B o l , 1988) .  l a c k o f s i m i l a r i t y between s t r a i n  They  coat  accounts f o r l a c k o f p r o t e c t i o n between s t r a i n s which i s  substantiated against  o f TRV-TCM  b y t h e f a c t t h a t t h e s t r a i n TCM d o e s  PEBV w h i l e  PLB d i d n o t .  A n g e n e n t e t al.  protect  (1990)  reported  t h a t p r o t o p l a s t s o f b o t h TRV s t r a i n s showed no r e s i s t a n c e  towards  infection.  2.4.5  Potato V i r u s X  Hemenway e t al. expressing  (1988) d e m o n s t r a t e d t h a t t r a n s g e n i c  e i t h e r PVX c o a t p r o t e i n o r t h e c o a t p r o t e i n  s e n s e t r a n s c r i p t were p r o t e c t e d  tobacco negative-  f r o m i n f e c t i o n b y PVX a s  i n d i c a t e d b y r e d u c e d l e s i o n numbers on i n o c u l a t e d l e a v e s , or absence o f systemic  symptom d e v e l o p m e n t , a n d r e d u c t i o n i n  v i r u s a c c u m u l a t i o n i n both i n o c u l a t e d and systemic was  delay  leaves.  There  a d i r e c t c o r r e l a t i o n between t h e l e v e l o f p r o t e c t i o n and t h e  a c c u m u l a t i o n o f PVX c o a t p r o t e i n , w h i c h a t t a i n e d l e v e l s b e t w e e n 0.02 a n d 0.1% o f t o t a l  leaf protein i n transgenic  producing positive-sense  transcripts.  Plants  plants  expressing  40 n e g a t i v e - s e n s e RNA  were p r o t e c t e d o n l y a t low i n o c u l u m  When p l a n t s e x p r e s s i n g h i g h l e v e l s o f PVX i n o c u l a t e d w i t h PVX  RNA  they remained  coat p r o t e i n  resistant.  were o b t a i n e d w i t h t h e t h r e e p o t a t o c u l t i v a r s ' D e s i r e e ' , and p r o t e i n gene  2.4.6  results  'Bintje', coat  1989).  Cucumber M o s a i c V i r u s  C u o z z o e t al.  (1988) d e v e l o p e d  transgenic tobacco expressing  t h e cucumber mosaic v i r u s  (CMV)  0.001  leaf protein.  and  were  Similar  ' E s c o r t ' t r a n s f o r m e d t o e x p r e s s t h e PVX  (Hoekema e t a l . ,  levels.  0.002% o f t o t a l  coat p r o t e i n at l e v e l s Transgenic  between  tobacco  e x p r e s s i n g t h e c o a t p r o t e i n n e g a t i v e - s e n s e t r a n s c r i p t were developed.  Delay  also  o r a b s e n c e o f symptom d e v e l o p m e n t and r e d u c t i o n  i n v i r u s a c c u m u l a t i o n i n b o t h i n o c u l a t e d and i n f e c t e d l e a v e s was  independent  systemically  of the s t r e n g t h of the  i n those p l a n t s e x p r e s s i n g coat p r o t e i n .  However,  inoculum  negative-sense  t r a n s c r i p t s p r o t e c t e d o n l y at low inoculum c o n c e n t r a t i o n s .  2.4.7  Soybean M o s a i c V i r u s  Heterologous transgenic tobacco (SMV)  examined u s i n g  e x p r e s s i n g the p o t y v i r u s soybean mosaic  coat p r o t e i n which  protein is  p r o t e c t i o n o f p l a n t v i r u s e s was  accounted  ( S t a r k and B e a c h y , 1 9 8 9 ) .  f o r 0.01%  t o 0.21%  of  virus  total  T o b a c c o i s immune t o SMV  but  s u s c e p t i b l e to the s e r o l o g i c a l l y unrelated potyviruses potato  virus Y  (PVY)  and t o b a c c o e t c h v i r u s  6 1 % amino a c i d s e q u e n c e s i m i l a r i t y ,  (TEV)  which  s h a r e 58%  r e s p e c t i v e l y , w i t h SMV  and coat  41  protein.  A 3 t o 4 day d e l a y i n the development o f systemic  d i s e a s e symptoms was observed.  Symptoms then developed more  s l o w l y and were l e s s severe i n t r a n s g e n i c p l a n t s than i n the controls.  Some t r a n s g e n i c s never developed d i s e a s e symptoms.  There was reduced accumulation o f TEV i n both i n o c u l a t e d and s y s t e m i c a l l y i n f e c t e d l e a v e s o f the t r a n s g e n i c p l a n t s . P r o t e c t i o n was c o r r e l a t e d with the l e v e l o f coat p r o t e i n i n each t r a n s g e n i c p l a n t , with one e x c e p t i o n , and was inoculum dependent.  2.4.8  Potato V i r u s Y  T r a n s g e n i c 'Russet Burbank', e x p r e s s i n g PVX and p o t a t o v i r u s Y coat p r o t e i n t o l e v e l s between 0.05% t o 0.2% and 0.01% t o 0.05% of the t o t a l  l e a f p r o t e i n , r e s p e c t i v e l y , were r e s i s t a n t t o  i n f e c t i o n by mechanical i n o c u l a t i o n o f PVX and PVY al.,  1990) .  (Lawson et  I n d i v i d u a l l y PVX f a i l e d t o i n f e c t at any inoculum  c o n c e n t r a t i o n and PVY i n f e c t e d only a s m a l l percentage o f p l a n t s of one p o t a t o l i n e .  A s i m i l a r l e v e l o f r e s i s t a n c e towards PVY  was observed when t r a n s g e n i c s were i n o c u l a t e d by v i r u l i f e r o u s aphids. However, the percentage o f i n f e c t e d p l a n t s was s i g n i f i c a n t l y increased.  I n o c u l a t i o n of PVX and PVY t o g e t h e r  gave responses r a n g i n g from immunity towards both v i r u s e s t o i n f e c t i o n by both v i r u s e s .  In g e n e r a l , i n f e c t i o n o f the  t r a n s g e n i c p o t a t o was delayed, fewer p l a n t s became i n f e c t e d , and lower v i r u s t i t r e s o c c u r r e d .  Although p l a n t s from one l i n e  accumulated the lowest l e v e l s o f PVX and PVY coat p r o t e i n , they e x h i b i t e d the g r e a t e s t p r o t e c t i o n a g a i n s t PVX and PVY  infection.  42 2.4.9  Satellite  B a u l c o m b e et  al.  t o b a c c o w i t h a DNA CMV.  o f Cucumber M o s a i c V i r u s (1986) d e s c r i b e t h e t r a n s f o r m a t i o n  copy of t h e  These p l a n t s c o n t a i n e d  satellite  RNA  and,  symptom a l t e r i n g  be  when i n f e c t e d w i t h s a t e l l i t e - f r e e  inoculated leaves  invaded  1987).  and  the  first  an  g e n o m i c RNA extracts.  80 t o 95%  (TAV)  subsequently  leaves  (Harrison et  concentration  o f TAV  e x t r a c t s was  decreased.  g e n o m i c RNA  2.4.10 S a t e l l i t e Transgenic  induced  the  nor  was  of  t h e r e was  an  of  leaf  the  However, n e i t h e r infectivity  of  RNA  the  leaf  o f Tobacco R i n g s p o t V i r u s  tobacco expressing  1987).  e i t h e r p o s i t i v e or  Immediately a f t e r  a m p l i f i c a t i o n of s a t e l l i t e  c o r r e l a t e d w i t h the  CMV  synthesis of s a t e l l i t e  negative-  (TobRV)  e x h i b i t e d symptom a t t e n u a t i o n when i n o c u l a t e d w i t h e t al.,  plants  closely related  sense t r a n s c r i p t s of the tobacco r i n g s p o t v i r u s  (Gerlach  to  al.,  l a c k of i n f e c t i v i t y  protected against.  accumulation  of  molecules.  or three  s e v e r a l other v i r u s e s only the  tomato aspermy v i r u s  RNA  RNA  In the t r a n s g e n i c  decrease i n the  which c o r r e l a t e d with the Of  RNA  CMV,  P r o t e c t i o n p e r s i s t e d f o r a t l e a s t 14 weeks a n d  t h e r e was  was  two  s y s t e m i c a l l y d e v e l o p e d symptoms  independent of inoculum concentration.  and  satellite  s m a l l amounts o f t r a n s c r i b e d  p r o d u c e d l a r g e amounts o f u n i t - l e n g t h s a t e l l i t e Only the  of  r e s i s t a n t phenotype.  p o s i t i v e t r a n s c r i p t developed primary  satellite TobRV  inoculation with  RNA  sequences  TobRV  which  Plants containing  l e s i o n s , i n which  the  the  43 centres  remained green, 1 t o 2 days l a t e r t h a n the  i n which the new  leaves  centres  o f the  only  a m i l d systemic  10 weeks t h e p l a n t s  the  lesions possessed necrotic centres  2 . 4 . 1 1 Nonstructural V i r a l  initial  s i m i l a r to the  nonstructural  g e n e s o f TRV i n c l u d i n g t h e  o f s t r a i n PLB  and  2 9 kDa gene t h a t  the  s t r a i n TCM ( A n g e n e n t e t al., occurred,  nonstructural  1990).  controls.  13 k D a and  i s unique t othe  p r o t e c t i o n was n o t  They i n c l u d e :  16 k D a g e n e s RNA o f  Although accumulation o f  the  p r o t e i n o ftobacco vein mottling v i r u s  observed.  Other produce  cytoplasmic  inclusion  (TVMV) w h i c h d i d  p r o d u c e symptoms o r i n c l u s i o n b o d i e s i n t r a n s g e n i c ( G r a y b o s c h e t al.,  ringspot  several  v i r a l genes have a l s o been u s e d t o  plants.  negative-  Genes  Tobacco p l a n t s have been t r a n s f o r m e d w i t h  transgenic  were  D i s e a s e development i n the p l a n t s e x p r e s s i n g  s e n s e t r a n s c r i p t was d i f f e r e n t i n t h a t t h e  transcript  r e a c t i o n was  a f t e r 5-6 weeks p o s t - i n o c u l a t i o n .  P r o t e c t i o n was m a i n t a i n e d d u r i n g observed.  not  plants  1989); t h e p r o d u c t o f gene V I o f c a u l i f l o w e r  m o s a i c v i r u s w h i c h was f o u n d i n t h e s e s t u d i e s t o i n d u c e symptoms i n t r a n s g e n i c  tobacco  transport limit  disease  (Baughman e t a l . , 1988); and  30 k D a gene p r o d u c t o f TMV w h i c h was shown t o b e i n v o l v e d cell-to-cell  plants  A f t e r 3 weeks  l e s i o n s were n e c r o t i c .  w e r e s y m p t o m l e s s and  o b s e r v e d o n some l e a v e s  control  movement o f TMV (Deom e t a l . , 1987).  p r o t e i n appears t o increase  s i z e o f the plasmodesmata i n the  the  in  The TMV  functional  transgenic  the  exclusion  plants  (Wolf e t  al.,  1989).  protein  Expression  helper  component  of the virus-encoded  nonstructural  o f TVMV w i t h i n t r a n s g e n i c  tobacco  p r o d u c e d an a c t i v e p r o t e i n a n d was f o u n d t o f a c i l i t a t e transmission the  helper  t o t h e r e l a t e d TEV b u t o n l y  component p r o t e i n  (Berger  after  e t al.,  aphid  concentration of  1989).  2.4.12 Other Approaches f o r Virus Control Several expression et  al.  approaches towards v i r u s c o n t r o l through t h e  o f f o r e i g n genes w i l l  (1988) d e m o n s t r a t e d t h a t  expression Cech  other  u n d o u b t e d l y be a t t e m p t e d . antisense  of the polygalacturonase  (1987) r e p o r t e d  possess the property  gene i n t r a n s g e n i c  of s e l f - c a t a l y z e d cleavage.  H a s e l o f f and G e r l a c h  enzymes w i t h  highly specific  plant  RNA c a n i n h i b i t  expressing  Using  (1988) d e v e l o p e d  endoribonuclease  activity.  RNA enzymes c a p a b l e  RNA A  of cleaving  Finally,  of tobacco  c o m p l e m e n t a r y DNA d e r i v e d  segments w i t h  this  simple  RNA may r e d u c e v i r u s l e v e l s . leaf  tomato.  t h a t n a t u r a l l y o c c u r r i n g RNA m o l e c u l e s  information,  transgenic  Smith  the recent  viral  transformation from  mouse h y b r i d o m a m e s s e n g e r RNAs t o p r o d u c e f u n c t i o n a l a n t i b o d i e s in  vivo  specific  (Hiatt  e t al., 1989) r e p r e s e n t s  epitopes  sequestered.  a mechanism b y w h i c h  w i t h i n v i r u s p r o t e i n s may be t a r g e t e d a n d  45  MATERIALS AND METHODS  III.  3.1 P r e p a r a t i o n o f PLRV RNA 3.1.1 Maintenance o f PLRV A C a n a d i a n s t r a i n o f PLRV c h a r a c t e r i z e d b y R o w h a n i a n d S t a c e Smith  (1979) was u s e d t h r o u g h o u t t h i s  from a s i n g l e tuber it  o f S. tuberosum  was d e s c r i b e d a s a " s e v e r e  1963). pubescens hosts  (L).  M. persicae  (Wright  and MacCarthy, Physalis  A p h i d s were  periods  given  of at least  36 h on  p l a n t s and were t r a n s f e r r e d between p l a n t s w i t h a  paintbrush.  3.1.2 V i r u s  Purification  V i r u s was p u r i f i e d  f r o m v i r u s - i n f e c t e d l e a f t i s s u e w h i c h was  f r o z e n w i t h l i q u i d n i t r o g e n i n an i c e b u c k e t and b r o k e n coarse  p i e c e s w i t h a wooden p e s t l e .  steel blender,  nitrogen,  f i n e l y powdered.  tissue.  and ground u n t i l  into  The f r o z e n t i s s u e was  transferred to a stainless  buffer  Burbank'  r e a r e d on v i r u s - f r e e S o l a n a c e o u s  a c q u i s i t i o n and i n o c u l a t i o n access  moistened  isolated  'Russet  and propagated i n  were u s e d f o r v i r u s t r a n s m i s s i o n s .  PLRV-infected  Originally  (L) c u l t i v a r  strain"  The PLRV was m a i n t a i n e d  study.  pre-cooled  with  liquid  Potassium phosphate  (0.1 M, pH 7.0) was a d d e d a t a r a t i o o f 2 m l p e r gram o f V i r u s y i e l d was i n c r e a s e d b y i n c u b a t i n g t h e p l a n t  homogenate w i t h U l t r a z y m  100 ( S c h w e i z e r i s c h e  Schweiz.),  a crude macerating  pectinases  and c e l l u l a s e s .  F e r m e n t AG B a s e l ,  enzyme p r e p a r a t i o n t h a t  contains  The p l a n t homogenate h a d a f i n a l  46  concentration  o f 0.1%  (w/v)  m e r c a p t o e t h a n o l , and was  left  overnight  m a c e r a t i n g enzyme, 0.1%  0.02%  (w/v)  sodium a z i d e .  The  a t room t e m p e r a t u r e w i t h o u t  stirring.  w e r e c l a r i f i e d by  T r i t o n X-100  f o r 3 h a t room t e m p e r a t u r e , f o l l o w e d by  continued low  vigorous  stirring  A f t e r low  c o l l e c t e d and  8%  w e r e a d d e d and  (w/v)  stirred until  c e n t r i f u g e d as  a t 4°C  a b o v e and  p h o s p h a t e b u f f e r , pH  (100  above, the 1.5  rpm,  7.0,  7.0, h.  Sorvall  f o r 1 h,  1%  a t a r a t i o o f 10 ml minimum b e i n g  25 m l . was  per  was NaCl  was  a glass rod  i n 0.1  (w/v)  rpm  f o r 1 h i n a Beckman  g  shaking  centrifuged  Ti rotor.  as  ( I r v i n e , CA)  70.1  The  rpm  pellets  M phosphate b u f f e r , s h a k e n a t 4°C  s u p e r n a t a n t s were l a y e r e d  s u c r o s e i n p h o s p h a t e b u f f e r and  M  of  c e n t r i f u g e d a t 35,000 50.2  20%  50  After  s p e e d c e n t r i f u g a t i o n a t 10,000 rpm  f o r 20  o n t o 5 ml  c e n t r i f u g e d at Ti rotor.  in a of  60,000  Pellets  s h a k e n as a b o v e , t h e n l a y e r e d on t o p  10-40%  ( i n phosphate b u f f e r )  linear  pH  for 1  min  w e r e r e s u s p e n d e d and sucrose  GSA  (w/v)  the p r e p a r a t i o n  ( I r v i n e , CA)  SS34 r o t o r , t h e  (w/v)  and  in a Sorvall  aqueous phase  g r o u n d i n a g r o u n d g l a s s h o m o g e n i z e r and A f t e r low  with  dissolved.  s u p e r n a t a n t c o l l e c t e d and  were r e s u s p e n d e d u s i n g  (v/v)  the  v/v)  g l y c o l 6000 and  4°C) , t h e p r e p a r a t i o n  h i n a Beckman  1%  t h e p e l l e t s w e r e r e s u s p e n d e d i n 0.1  s t a r t i n g t i s s u e w i t h the overnight  (1:1,  a t 8,500 rpm  polyethylene  with  a t room t e m p e r a t u r e  speed c e n t r i f u g a t i o n the  After incubation  for  f o r 10 min  s p e e d c e n t r i f u g a t i o n , 20 min  rotor.  stirring  volume c h l o r o f o r m : n - b u t a n o l  2-  preparation  Preparations  a d d i t i o n o f 1/6  vigorous  (v/v)  density  of  a  47 g r a d i e n t prepared u s i n g a g r a d i e n t maker. at  After  centrifugation  38, 000 rpm f o r 2 h i n a Beckman '(Irvine, CA) SW41 r o t o r the  g r a d i e n t was pumped through an UA5 m o n i t o r / r e c o r d e r and the absorbance determined  at 254 nm.  ( L i n c o l n , NE)  The v i r u s was  c o l l e c t e d , d i l u t e d with an equal volume o f phosphate b u f f e r , and p e l l e t e d by c e n t r i f u g a t i o n at 60,000 rpm f o r 2 h i n a Beckman 70.1 T i r o t o r .  T h i s f i n a l h i g h speed p e l l e t was resuspended i n  0.5 ml phosphate b u f f e r .  The u l t r a v i o l e t a b s o r p t i o n  spectrum  (220 t o 320 nm) of the p r e p a r a t i o n was o b t a i n e d and recorded u s i n g a Hewlett-Packard  Model 8451A  3.1.3 E x t r a c t i o n o f  PLRV  spectrophotometer.  RNA  PLRV RNA was e x t r a c t e d from p u r i f i e d v i r u s d i l u t e d i n 50 mM T r i s - C l , pH 8.9, 10 mM EDTA, 0.5% (w/v) sodium dodecyl (SDS)  sulfate  and was denatured by v o r t e x mixing with an equal volume of  phenol/chloroform  (phenol/chloroform/isoamyl  a l c o h o l 25:24:1).  The aqueous phase was recovered a f t e r c e n t r i f u g a t i o n i n an Eppendorf microfuge  f o r 5 min at 14,000 rpm and the o r g a n i c phase  e x t r a c t e d with 200 (ll o f d i e t h y l p y r o c a r b o n a t e (DEPC) t r e a t e d water  ( d e i o n i z e d water a d j u s t e d t o 0.1% (v/v) DEPC was v i g o r o u s l y  shaken and then a u t o c l a v e d f o r 1 h ) .  The two aqueous phases were  combined and r e - e x t r a c t e d with an equal volume o f phenol/chloroform 24:1).  and then c h l o r o f o r m  (chloroform/isoamyl a l c o h o l  PLRV RNA was p r e c i p i t a t e d o v e r n i g h t at -20°C by adding  0.1 volume o f 2 M sodium a c e t a t e , pH 5.2, and 2.5 volumes o f absolute ethanol.  The PLRV RNA p r e c i p i t a t e s were r e c o v e r e d by  48 c e n t r i f u g a t i o n a s a b o v e f o r 20 m i n .  The RNA p e l l e t was w a s h e d  w i t h 7 0 % e t h a n o l b e f o r e b e i n g d r i e d i n a vacuum a n d r e s u s p e n d e d i n DEPC t r e a t e d  3.1.4 The  water.  Q u a n t i t a t i o n o f PLRV RNA  q u a n t i t y o f v i r i o n RNA was d e t e r m i n e d  f o r an a l i q u o t  d i l u t e d t o 1 ml w i t h water by measuring  t h e absorbance  u s i n g an e x t i n c t i o n c o e f f i c i e n t  The q u a l i t y  o f 25.  RNA p r e p a r a t i o n was d e t e r m i n e d b y a g a r o s e the presence Davidson  loading buffer hydroxide,  ( B a i l e y and  RNA s a m p l e s w e r e d e n a t u r e d i n 2 v o l u m e s o f (125 mM b o r i c a c i d ,  30% (v/v) g l y c e r o l ,  15 mM m e t h y l m e r c u r i c  a n d 5% ( v / v ) s a t u r a t e d b r o m o p h e n o l  b l u e ) f o r 10 m i n a t room t e m p e r a t u r e . 1%  of the virion  gel electrophoresis i n  o f 5 mM m e t h y l m e r c u r i c h y d r o x i d e  197 6 ) .  a t 260 nm  (w/v) a g a r o s e  Samples were l o a d e d onto a  g e l c o n t a i n i n g 40 mM b o r i c a c i d , pH 8.2, 1 mM  EDTA, a n d 5 mM m e t h y l m e r c u r i c h y d r o x i d e .  E l e c t r o p h o r e s i s was f o r  1 h a t 10 v o l t s / c m u s i n g a r u n n i n g b u f f e r o f 40 mM b o r i c a c i d , pH 8.2,  a n d 1 mM EDTA.  G e l s were s t a i n e d f o r 20 m i n i n 100 m l  r u n n i n g b u f f e r c o n t a i n i n g 0.5 (ig/ml e t h i d i u m b r o m i d e a n d 0.1 M 2mercaptoethanol. distilled  I f n e c e s s a r y , g e l s were d e s t a i n e d w i t h  water.  3.2 C l o n i n g o f PLRV RNA 3.2.1 F i r s t - S t r a n d Double-stranded  cDNA S y n t h e s i s  c o m p l e m e n t a r y DNA (cDNA) c o p i e s o f PLRV RNA  were p r e p a r e d u s i n g a m o d i f i e d G u b l e r and Hoffman  (1983)  procedure. determined hydroxide  P u r i f i e d PLRV RNA, from  an a g a r o s e  o f cDNA.  o f 40 mM m e t h y l m e r c u r i c  was m o s t l y  f u l l - l e n g t h as  g e l containing methylmercuric  ( 3 . 1 . 4 ) , was u s e d  the f i r s t - s t r a n d  which  as t h e t e m p l a t e  f o r the synthesis of  PLRV RNA was d e n a t u r e d  by a d d i n g  h y d r o x i d e t o a 7 ( l l v o l u m e c o n t a i n i n g 1.5  [ig PLRV RNA a n d e i t h e r 5 \ig o r 0.05 \ig o f P h a r m a c i a Sweden) random p r i m i n g h e x a m e r s . min  a t room t e m p e r a t u r e  (Uppsala,  The m i x t u r e s w e r e i n c u b a t e d 10  before freezing with l i q u i d nitrogen.  The RNA was t h e n b r o u g h t Tris-Cl,  7 [Ll  t o a 100 \il v o l u m e c o n t a i n i n g 50  pH 8.3, 50 mM KC1, 8 mM M g C l , 2  10 mM  mM  dithiothreitol  (DTT) , 1 mM dATP, 1 mM dGTP, 1 mM dCTP, 1 mM dTTP, 4 0 H-Ci OC- P 32  dATP  (3000 C i / m m o l e , I C N ) , 32 u n i t s R N a s i n ,  myeloblastosis virus reverse transcriptase Sweden).  a n d 42 u n i t s (Pharmacia,  T h i s m i x t u r e was i n c u b a t e d 5 m i n a t room  avian  Uppsala,  temperature,  10 m i n a t 37°C, 30 m i n a t 42°C, f o l l o w e d b y t h e a d d i t i o n o f another  42 u n i t s o f a v i a n m y e l o b l a s t o s i s v i r u s  t r a n s c r i p t a s e and a f i n a l  reverse  i n c u b a t i o n f o r 30 m i n a t 42°C b e f o r e  t h e r e a c t i o n was t e r m i n a t e d b y a d d i n g 5 U.1 o f 0.5 M EDTA. e x t r a c t i o n w i t h p h e n o l / c h l o r o f o r m and c h l o r o f o r m , n u c l e i c  After acids  w e r e p r e c i p i t a t e d w i t h 0.5 v o l u m e 7.5 M ammonium a c e t a t e a n d 2.5 v o l u m e s o f a b s o l u t e e t h a n o l f o r 1 h a t -70°C.  The RNA/DNA h y b r i d  p r e c i p i t a t e was c e n t r i f u g e d f o r 30 m i n i n a m i c r o f u g e  tube at  14,000 rpm a t 4°C i n an E p p e n d o r f 5415 c e n t r i f u g e a n d t h e p e l l e t w a s h e d t w i c e w i t h 7 0 % ( v / v ) e t h a n o l a n d d r i e d i n a vacuum.  50 3.2.2  S e c o n d - S t r a n d cDNA  Synthesis  S e c o n d - s t r a n d cDNA s y n t h e s i s was s t r a n d cDNA s y n t h e s i z e d a b o v e RNase H g e n e r a t e d p r i m e r s (1983) .  The  ( N H ) S 0 , 100 4  2  4  mM  [ll  KC1,  1 mM  Tris-Cl,  dATP, 1 mM  coli  DNA  terminated  by  w h i c h was  and  s a m p l e was Clifton, 10 m l 1%  o f i c e c o l d 5%  (w/v)  cold  ethanol.  radioactivity Aquasol-2 Packard  (w/v)  M EDTA  4530  before  Low  the  pH  7.5  molecular  aqueous phase  and  1 mM  EDTA  column  i n each a l i q u o t  t o d r y and  cDNA, a 1 \il  filter  (Whatman,  t h e n washed t w i c e  trichloroacetic acid  (TCA)  the  determined using the  Research Products,  of  amount  ice  of  scintillator  B o s t o n , MA)  (United Technologies)  with  containing  t h e n o n c e w i t h 10 ml  were a i r d r i e d and  on e a c h f i l t e r  Tri-Carb  (cpm)  glass fibre  allowed  Filters  (DuPont NEN  u n i t s RNase  below.  s o d i u m p y r o p h o s p h a t e , and  95%  dTTP,  1 h a t 22°C t h e  ( l la l i q u o t of double-stranded  T h i s was  mM  2  ja.1 were c o l l e c t e d f r o m t h e  s p o t t e d o n t o a GF/C  NJ).  was  M g C l , 10  1.1  chloroform.  Tris-Cl,  t h e number o f c o u n t s p e r m i n u t e  F r o m e a c h 100  Hoffman  dGTP, 1 mM  f o l l o w e d by  and  and  ( P h a r m a c i a , U p p s a l a , Sweden) c o l u m n  A l i q u o t s o f 100  d e t e r m i n e d as d e s c r i b e d  5 mM  dCTP, 1 mM  a d d i n g 5 ( l l o f 0.5  e q u i l i b r a t e d w i t h 10 mM  (TE b u f f e r ) .  7.5,  e l i m i n a t e d by p a s s i n g  t h r o u g h a S e p h a r o s e CL-4B  and  p o l y m e r a s e I , and  e x t r a c t i o n with phenol/chloroform w e i g h t n u c l e i c a c i d was  Gubler  pH  first-  polymerase I  first-strand reaction  A f t e r i n c u b a t i o n s o f 1 h a t 12°C  r e a c t i o n was  DNA  as d e s c r i b e d by  o f 20 mM  c o n t a i n i n g 25 u n i t s E. H.  (3.2.1) and  d r i e d p e l l e t of the  r e s u s p e n d e d i n 100  performed using the  and  scintillation  a  51 counter.  The f i r s t  four f r a c t i o n s w i t h counts  above b a c k g r o u n d  w e r e c o m b i n e d a n d n u c l e i c a c i d p r e c i p i t a t e d a t -70°C o v e r n i g h t u s i n g 0.1 v o l u m e o f 3 M s o d i u m a c e t a t e , pH 5.2, a n d 2.5 v o l u m e absolute ethanol. 70%  P r e c i p i t a t e s were c e n t r i f u g e d and washed w i t h  ethanol. Double-stranded  cDNA was r e s u s p e n d e d i n 200 ( l l o f 30 mM  s o d i u m a c e t a t e , pH 5.0, 50 mM N a C l , (v/v) g l y c e r o l . nuclease  Products  (Bethesda  1 mM Z n C l , c o n t a i n i n g 5% 2  were t r e a t e d w i t h 28 u n i t s mung b e a n  Research  Laboratory  (BRL),  Gaithersburg,  MD)  f o r 30 m i n a t 30°C b e f o r e t h e r e a c t i o n was t e r m i n a t e d b y extraction with phenol/chloroform  and c h l o r o f o r m .  The  double-  s t r a n d e d cDNA was p r e c i p i t a t e d w i t h s o d i u m a c e t a t e a n d a b s o l u t e ethanol,  c e n t r i f u g e d , washed w i t h 70% e t h a n o l , d r i e d , and  r e s u s p e n d e d i n TE.  T h i s mung b e a n n u c l e a s e  ensure t h a t t h e double-stranded  3.2.3  d i g e s t i o n was t o  DNA t e r m i n i w e r e b l u n t .  L i g a t i o n o f cDNA Into a V e c t o r  H a l f o f t h e PLRV cDNA f r o m e a c h r e a c t i o n was l i g a t e d Eco  RV d i g e s t e d a n d c a l f i n t e s t i n a l p h o s p h a t a s e  B l u e s c r i p t M13+ p l a s m i d  ( S t r a t a g e n e , San D i e g o ,  into  (CIP) t r e a t e d CA).  The  B l u e s c r i p t M13+ p l a s m i d h a d b e e n d i g e s t e d w i t h E c o RV a n d dephosphorylated volume.  w i t h 4 u n i t s C I P p e r 0.05 mM o f DNA i n a 20 UM  The C I P was a d d e d d i r e c t l y t o t h e r e s t r i c t i o n  b u f f e r a n d i n c u b a t e d an a d d i t i o n a l 30 m i n . phenol/chloroform  enzyme  After  and c h l o r o f o r m e x t r a c t i o n s , p r e c i p i t a t i o n , and  w a s h i n g w i t h 7 0 % e t h a n o l t h e E c o RV d i g e s t e d a n d C I P t r e a t e d  52 v e c t o r were resuspended on 1% agarose buffer  i n TE.  Q u a n t i t i e s o f DNA were e s t i m a t e d  g e l s prepared and run u s i n g t r i s - a c e t a t e - E D T A (TAE)  (0.04 M T r i s - a c e t a t e , pH 8.0, and 0.001 M EDTA).  q u a n t i t i e s o f bacteriophage  lambda DNA  Known  (BRL) which was Hind I I I  or  P s t I d i g e s t e d were used f o r q u a n t i t y e s t i m a t i o n s .  of  cDNA i n t o the dephosphorylated  Ligation  M13+ p l a s m i d DNA was done u s i n g  a molar r a t i o o f 1:3, r e s p e c t i v e l y .  L i g a t i o n s were c a r r i e d out  i n 20 (ll of l i g a t i o n mix (50 mM T r i s - C l , pH 7.6, 10 mM MgCl , 1 2  mM dATP, 1 mM DTT, 5% (w/v) p o l y e t h y l e n e g l y c o l - 8 0 0 0 , and 1 u n i t T4 DNA l i g a s e ) . overnight.  T h i s r e a c t i o n was incubated at room  An i d e n t i c a l r e a c t i o n , except without  temperature  cDNA, was done  so t h a t t h e background number of transformants a r i s i n g  from  u n d i g e s t e d p l a s m i d DNA and r e - l i g a t e d p l a s m i d DNA t h a t was not s u c c e s s f u l l y dephosphorylated  3.2.4 The  c o u l d be  T r a n s f o r m a t i o n o f Competent  determined.  E.  coll  Cells  l i g a t i o n r e a c t i o n s were d i l u t e d f i v e - f o l d w i t h  sterile  d e i o n i z e d water and 1 (ll o f the d i l u t e d r e a c t i o n was added t o 100 UJ  o f l i b r a r y e f f i c i e n c y E. c o l i  competent c e l l s  DH5CC  c h i l l e d 17 X 100 mm p o l y p r o p y l e n e tube  (Falcon Labware 2059,  Oxnard, CA) by moving the p i p e t t e through t h e c e l l s dispensing.  while  C e l l s were transformed a c c o r d i n g t o t h e  manufacturer's ice  (BRL) i n a  i n s t r u c t i o n s as f o l l o w s .  f o r 30 min, heat shocked  and p l a c e d on i c e f o r 2 min.  C e l l s were i n c u b a t e d on  f o r 45 seconds i n a 42°C water bath, A u t o c l a v e d media  c o n s i s t i n g o f 2% (w/v) b a c t o t r y p t o n e  (0.9 ml)  (Difco, D e t r o i t , MI), 0.5%  53 (w/v) KC1  yeast extract was a d d e d .  ( D i f c o , D e t r o i t , M I ) , 10 mM N a C l , a n d 2.5 mM  The m e d i a was made 20 mM i n Mg  addition t o the c e l l s using 2  1 M stock for  of glucose.  a filter  2  Cultures  sterilized 1  agar  ( 1 % (w/v) b a c t o t r y p t o n e ,  (w/v) N a C l , pH 7.5) c o n t a i n i n g  ampicillin.  sterilized  w e r e s h a k e n a t 225 rpm a t 37°C  1 h a n d 100 ( l l a l i q u o t s s p r e a d on L u r i a - B e r t a n i  (w/v) 1%  4  before i t s  e q u a l volumes o f f i l t e r  M MgCl -6H 0 a n d 1 M MgS0 -7H 0 a n d 20 mM w i t h 2  2+  (LB) 1.5%  0.5% (w/v) y e a s t e x t r a c t , a n d 100 |ig/ml  filter-sterilized  E a c h 9 cm p l a t e h a d 40 u.1 o f 5 - b r o m o - 4 - c h l o r o - 3 -  indolyl-p-D-galactoside  ( X g a l ) s p r e a d on t h e s u r f a c e  30 m i n p r i o r  t o t h e a d d i t i o n and s p r e a d i n g o f t h e b a c t e r i a l c e l l s .  Plates  w e r e i n c u b a t e d f o r 16 h o u r s a t 37°C.  3.3 C h a r a c t e r i z a t i o n 3.3.1  o f C o m p l e m e n t a r y DNA  B a c t e r i a l L y s i s a n d DNA F i x a t i o n  Colony f i l t e r modification  h y b r i d i z a t i o n was c a r r i e d o u t b y a  o f t h e p r o c e d u r e o f G e r g e n e t al.  (1979) .  Eight  hundred recombinant white a m p i c i l l i n - r e s i s t a n t c o l o n i e s  were  randomly s e l e c t e d and t r a n s f e r r e d i n d i v i d u a l l y w i t h t o o t h p i c k s t o duplicate  LB a g a r p l a t e s  containing  100 |lg/ml  w e r e i n c u b a t e d 16 h a t 37°C a n d a u t o c l a v e d d i s k s were t h e n c a r e f u l l y p l a c e d duplicate plates. colonies and  Filter  Whatman 541  over t h e c o l o n i e s  Plates  filter  o f one o f two  o r i e n t a t i o n r e l a t i v e t o t h e d i s h and  was m a r k e d on t h e f i l t e r  b y p e n on t h e p l a t e .  ampicillin.  at 3 locations with  a needle  A f t e r one m i n u t e , t h e f i l t e r  removed from t h e p l a t e u s i n g  a s i n g l e s w i f t motion.  was  Filters  were  54 subsequently by  processed  t o d e n a t u r e a n d f i x t h e DNA t o t h e f i l t e r  sequentially placing the f i l t e r ,  Whatman number 1 f i l t e r filters  paper i n p e t r i  were i n d i v i d u a l l y  sodium h y d r o x i d e  colony  s i d e u p , on s t a c k s o f  dish lids.  I n i t i a l l y the  p l a c e d on a s t a c k s o a k e d w i t h 0.5 M  f o r 5 min and t h e treatment  repeated.  Filters  w e r e t r a n s f e r r e d t o a s t a c k s o a k e d w i t h 0.5 M T r i s - C l , for  5 min and t h e treatment  repeated.  Filters  were  pH 7.5,  then  t r a n s f e r r e d t o a s t a c k s o a k e d w i t h 2X SSC ( I X SSC i s 150 mM s o d i u m c h l o r i d e a n d 15 mM t r i s o d i u m c i t r a t e , and to  t h e treatment  repeated.  Finally  pH 7.0) f o r 5 m i n  t h e f i l t e r s were  subjected  t w o 1 m i n washes w i t h 2X SSC, a n d t o t w o 1 m i n w a s h e s w i t h 95%  ethanol  and then  a i r dried.  Each f i l t e r  Whatman 3MM p a p e r b e t w e e n e a c h t r e a t m e n t  was p l a c e d on d r y t o remove e x c e s s  liquid.  3.3.2 P r e h y b r i d i z a t i o n o f F i l t e r s Filters  were p r e h y b r i d i z e d i n a p l a s t i c  hybridization  tray  s o l u t i o n c o n t a i n i n g 50% formamide  with  ( d e i o n i z e d by  s t i r r i n g w i t h Dowex XG 8 m i x e d - b e d r e s i n f o r 1 h a n d f i l t e r i n g t h r o u g h Whatman 3MM p a p e r ) , s a l m o n s p e r m DNA gauge n e e d l e ) ,  (sheared  6X SSC, 0.5% (w/v) SDS, 50 M - g /  b y numerous p a s s a g e s t h r o u g h an 18  a n d 5X D e n h a r d t ' s r e a g e n t  polyvinylpyrrolidone,  ( 1 % (w/v)  a n d 1% (w/v) b o v i n e s e r u m a l b u m i n (BSA-  p e n t a x F r a c t i o n V ) , a n d 1% (w/v) F i c o l l Sweden) ) .  (Pharmacia,  P r e h y b r i d i z a t i o n was f o r 2 h a t 42°C w i t h  a g i t a t i o n a f t e r w h i c h a p r o b e was a d d e d d i r e c t l y hybridization  ml  solution.  Uppsala, gentle  to the  55 3.3.3  R a n d o m l y P r i m e d cDNA P r o b e s  F i l t e r s were p r o b e d w i t h p r i m e d PLRV RNA.  The  o f 50 i l l c o n t a i n i n g 0.6  mM  reaction  50 mM  was  activity  c a r r i e d out i n a f i n a l  Tris-Cl,  pH  8.3,  8 mM  removed t o d e t e r m i n e  transcriptase u\l a l i q u o t  DTT,  2  TCA  and  32  (specific  1 |lg PLRV RNA.  A 1 u.1  p r e c i p i t a b l e background  of avian myeloblastosis v i r u s  (Pharmacia, Uppsala,  was  The  Sweden) was  probe  was  sodium  acetate,  centrifuged  pH  5.2,  and 2.5  cDNA p r e c i p i t a t e s w e r e r e s u s p e n d e d  gentle  3.3.4  further  with  a t 11,000 rpm. i n 100  volume 3 M  ( l l 0.1  and  Radiolabelled M NaOH,  and added  directly  (3.3.2) f o r a 16 h i n c u b a t i o n  at  agitation.  w e r e w a s h e d f o r 15 m i n w i t h  SDS  a t room t e m p e r a t u r e  washed w i t h  0.IX  SSC  and  42°C a n d t h e n f o r 1 h a t 58°C w i t h After blotting, filters  100 ml o f 2X SSC  and t h e n 42°C.  0.1% 0.1X  (w/v) SSC  SDS  1  100  F i l t e r Washing C o n d i t i o n s  Filters (w/v)  solution  Another  precipitable  u s i n g 0.1  i n c u b a t e d i n a b o i l i n g water b a t h f o r 5 min,  42°C w i t h  added.  volume c o l d a b s o l u t e e t h a n o l  i m m e d i a t e l y f o r 10 m i n  to the h y b r i d i z a t i o n  counts  coprecipitated  ( l l o f 10 mg/ml d e n a t u r e d s a l m o n s p e r m DNA  aliquot  reverse  r e m o v e d a f t e r 1 h a t 37°C a n d TCA  counts again determined.  SDS.  volume  M g C l , 8 mM  Sweden) , 50 u C i a - P dATP  3000 C i / m m o l e , ICN)  b e f o r e 36 u n i t s  0.1%  randomly  e a c h o f dCTP, dGTP, a n d dTTP, 15 |ig random h e x a m e r s  (Pharmacia, Uppsala,  was  PLRV cDNA p r e p a r e d f r o m  and  They w e r e  f o r 15 m i n  containing  1%  w e r e w r a p p e d i n S a r a n Wrap  at (w/v)  and  56 exposed t o x-ray intensifying  3.3.5  (Kodak X-Omat K) f i l m a t -70°C o v e r n i g h t  screens.  Detection  Expression  of Fusion  Protein  o f t h e coat p r o t e i n as a b a c t e r i a l f u s i o n  was a s s a y e d a s d e s c r i b e d bacterial  colonies  b y M e y e r e t al.  K e e n e , NH) a s d e s c r i b e d (3.3.1).  (1982).  protein  Transformed  from t h e second s e t o f p l a t e s were  directly to dry nitrocellulose f i l t e r s  filters  with  (Schleicher  transferred  and S c h u e l l ,  f o rthe transfer of colonies  t o Whatman  The n i t r o c e l l u l o s e membranes w e r e t h e n  placed  on Whatman 3MM p a p e r , s o a k e d s e q u e n t i a l l y i n s o l u t i o n s o f 0.5 M NaOH, 1.5 M T r i s - C l , each.  After drying  filters  pH 7.5, 2X SSC, a n d 7 0 % e t h a n o l ,  f o r 5 min  a n d b a k i n g u n d e r vacuum a t 60°C f o r 2 h , t h e  w e r e s c r e e n e d w i t h PLRV p o l y c l o n a l a n t i s e r a a n d t h e n  l a b e l l e d p r o t e i n A as d e s c r i b e d  below f o r western  1 2 5  i-  blots  (3.9.3.3) .  3.3.6 A l k a l i n e L y s i s M e t h o d o f P l a s m i d I s o l a t i o n Plates 16  from which colony l i f t s  h a t 37°C a n d s t o r e d  colonies  were o b t a i n e d  a t 4°C u n t i l  required.  were  incubated  T h o s e 110  w h i c h i n c o l o n y h y b r i d i z a t i o n t e s t s gave t h e s t r o n g e s t  n u c l e i c a c i d h y b r i d i z a t i o n s i g n a l w e r e s e l e c t e d a n d w e r e grown overnight 100  with  s h a k i n g a t 37°C i n 3 m l LB l i q u i d m e d i a  p:g/ml a m p i c i l l i n .  modified  containing  Recombinant p l a s m i d s were i s o l a t e d u s i n g  a l k a l i n e l y s i s procedure  (Maniatis  r o u t i n e l y used f o r p u r i f y i n g plasmid.  Half  e t al.,  1982)  of the culture  a  57 ( a p p r o x i m a t e l y 1.4 ml) was t r a n s f e r r e d t o a n E p p e n d o r f  microfuge  t u b e , c e n t r i f u g e d f o r 1 min, and t h e s u p e r n a t a n t removed by aspiration.  The p e l l e t was r e s u s p e n d e d  w i t h v o r t e x i n g i n 100 ( l l  o f a n i c e c o l d s o l u t i o n o f 50 mM g l u c o s e , 10 mM EDTA, 50 mM Cl,  pH 8.0, a n d 10 mg/ml l y s o z y m e .  temperature and  Tris-  A f t e r 5 m i n a t room  200 ( l l o f a f r e s h l y p r e p a r e d s o l u t i o n o f 0.2 M NaOH  1% (w/v) SDS was a d d e d a n d t h e c o n t e n t s m i x e d b y i n v e r t i n g  the tube s e v e r a l times.  The m i c r o f u g e t u b e was p l a c e d on i c e f o r  5 m i n b e f o r e a d d i n g 200 | l l o f an i c e c o l d s o l u t i o n c o n s i s t i n g o f 60 m l o f 5 M p o t a s s i u m a c e t a t e , 11.5 m l g l a c i a l 28.5  ml d e i o n i z e d water.  a c e t i c a c i d , and  A f t e r 5 m i n on i c e t h e s a m p l e was  c e n t r i f u g e d a t 14,000 rpm i n a n E p p e n d o r f  microfuge.  The  s u p e r n a t a n t was t r a n s f e r r e d t o a n o t h e r m i c r o f u g e t u b e a n d e x t r a c t e d w i t h an e q u a l v o l u m e o f p h e n o l / c h l o r o f o r m , a n d t h e n chloroform. phase,  Two v o l u m e s o f e t h a n o l were a d d e d t o t h e a q u e o u s  t h e s a m p l e was m i x e d b y v o r t e x i n g ,  c e n t r i f u g e d a t room t e m p e r a t u r e The  a n d t h e n i t was  a f t e r 2 m i n a t room  temperature.  DNA p e l l e t was w a s h e d w i t h 7 0 % e t h a n o l , d r i e d i n a vacuum,  and r e s u s p e n d e d  i n 50 |J.l TE.  One ( l l o f a 1 mg/ml RNase A  s o l u t i o n t h a t was p r e v i o u s l y h e a t e d i n a 90°C w a t e r b a t h f o r 10 m i n was a d d e d . -20°C.  T h i s m i x t u r e was u s e d i m m e d i a t e l y o r s t o r e d a t  DNA p r e p a r e d i n t h i s manner w i l l be r e f e r r e d t o a s a  miniprep.  3.3.7  E l e c t r o p h o r e s i s o f R e s t r i c t i o n Enzyme D i g e s t e d DMA  P l a s m i d s were a n a l y z e d by d i g e s t i o n w i t h P v u I I w h i c h  58 excised  the  e n t i r e cDNA i n s e r t .  37°C ( u n l e s s containing  R e s t r i c t i o n d i g e s t s w e r e done a t  otherwise indicated) 1 ( l l of a miniprep  DNA) , 1 ( l l o f 10X  i n 1.5  ml m i c r o f u g e  (approximately  ng  of  plasmid  ( s u p p l i e d by  enzyme  m a n u f a c t u r e r ) , 5 u n i t s o f r e s t r i c t i o n enzyme, and  7.5 ( l l  deionized  restriction buffer  100  tubes  water.  Two  b u f f e r i s 0.04%  | l l o f a 6X  (w/v)  bromophenol b l u e  a d d e d a f t e r 1 t o 2 h and a g a r o s e g e l made w i t h bromide. h.  the  TAE  Electrophoresis  Hind I I I digested  3.3.8  1%  was  for approximately  at 4 volts/cm  nm  was  u s e d as  ultraviolet  a red f i l t e r  (ig/ml  potato  ethidium  a s i z e marker.  2 Gels  i l l u m i n a t i o n using  (Kodak W r a t t e n  was  was  purified  2A).  RNA  (Kay  et  al.,  from 1 g of l e a f t i s s u e g r o u n d t o a f i n e powder under with  were c a r r i e d out t i s s u e was  containing  a m o r t a r and  a t 4°C  using  pH  8.0,  0.2%  100  (w/v)  mM  SDS  and  0.5%  8,000 rpm  before  f o r 5 min.  v o l u m e o f 10X  TNE  A l l subsequent  reagents.  C o r e x t u b e and  N a C l , and  e q u a l volume of p h e n o l / c h l o r o f o r m vortexed  pestle.  autoclaved  t r a n s f e r r e d t o a 30 ml  Tris-Cl,  gently  glycerol)  0.5  from h e a l t h y  l i q u i d nitrogen  mM  (v/v)  I s o l a t i o n o f High M o l e c u l a r Weight P l a n t  T o t a l RNA 1987)  5%  loading  samples were l o a d e d o n t o a  l a m b d a DNA  f i l m and  and  (IX  buffer containing  w e r e p h o t o g r a p h e d u n d e r 320 K o d a k R o y a l pan  loading buffer  10 mM (v/v)  (1:1)  The  steps  powdered  3 volumes of  EDTA (10X  TNE)  2-mercaptoethanol. was  a d d e d and  the  An  sample  c e n t r i f u g a t i o n i n a S o r v a l l SS34 r o t o r The  organic  containing  0.2%  p h a s e was (w/v)  SDS  re-extracted and  0.5%  100  with  (v/v)  2-  at 0.5  59 mercaptoethanol.  The  combined aqueous p h a s e s were e x t r a c t e d w i t h  an e q u a l v o l u m e o f p h e n o l : c h l o r o f o r m chloroform.  (1:1)  An  then  N u c l e i c a c i d s , w h i c h c o n s i s t e d o f RNA  p r e c i p i t a t e d f r o m t h e a q u e o u s p h a s e and TNE.  and  e q u a l v o l u m e o f 5 M L i C I was  a d d e d and  a t -20°C f o r a t l e a s t 4 h b e f o r e  8,000 rpm  i n a SS34 r o t o r a t 4°C  DNA,  were  the  of  IX  sample  c e n t r i f u g a t i o n at  f o r 10 m i n .  e t h a n o l , d r i e d , and  and  r e s u s p e n d e d i n 3 ml  incubated  w a s h e d w i t h 70%  with  The  RNA  pellet  was  r e s u s p e n d e d i n DEPC t r e a t e d  water.  3.3.9  Northern  Analysis  Colonies containing plasmids  w i t h the  i n s e r t s were s e l e c t e d f o r f u r t h e r s t u d y . l a r g e s t c l o n e s was  confirmed  northern blot analysis. t o t a l RNA ladder  methylmercuric  were l o a d e d hydroxide  The  o r i g i n of the  by h y b r i d i z a t i o n t o PLRV RNA  Two  l a n e s e a c h o f PLRV RNA  from h e a l t h y potato  (BRL)  l a r g e s t PLRV cDNA  (10 |lg) , and  500  ng  (100  two  by ng),  o f an  RNA  o n t o an a g a r o s e g e l c o n t a i n i n g and  t h e RNA  species separated  e l e c t r o p h o r e s i s as d e s c r i b e d e a r l i e r  (3.1.4).  of the  two  l a n e s c o n t a i n i n g t h e RNA  from h e a l t h y p o t a t o ,  and  PLRV RNA and  0.5  l a d d e r , RNA  w e r e e x c i s e d , t r e a t e d w i t h 0.1%  r i n s e d t w i c e f o r 30 min  (w/v)  2-mercaptoethanol  }lg/ml e t h i d i u m b r o m i d e , and p h o t o g r a p h e d b e s i d e  t o i n d i c a t e d i s t a n c e s from the w e l l . was  (v/v)  One  by  2 - m e r c a p t o e t h a n o l and  a c t i o n was  The  a  remainder of the  with running b u f f e r containing used f o r a northern b l o t .  u s e d t o t r a n s f e r RNA  from the g e l t o  Nytran  ruler gel 0.1%  Capillary  60  ( S c h l e i c h e r and  S c h u e l l , K e e n e , NH).  t h e b l o t on a s m o o t h f l a t  The  order  SSC;  SSC;  d e i o n i z e d w a t e r ; and between the and  l a y e r s were r e m o v e d and  S a r a n Wrap and  for  and  Random P r i m e r  modified Feinberg  s a n d w i c h was  DNA  p l a c e d on t o p t o k e e p a l l t h e  r a d i o l a b e l l e d DNA  largest  cDNA i n s e r t s .  air dried in a ventilated  L a b e l l i n g System  and  immediately  c a r r i e d out  tube,  p r o b e s t o t h e two  Approximately  hood  25 ng  which uses a was  plasmids  transferred to ice.  DNA  for 5  min,  pH  |ig/ml  6.8,  was  (IM e a c h o f dCTP, 5 mM  M g C l , 10 2  2 - m e r c a p t o e t h a n o l , 0.4  mg/ml BSA,  ribonucleotide primers  (hexamer f r a c t i o n ) , 50 | l C i a- P dATP  (3000 C i / m m o l e , I C N ) ,  TE  Random-primed l a b e l l i n g  Tris-Cl, 270  the  d i l u t e d t o 5 U.1 w i t h  v o l u m e o f 50 ( l l u s i n g 20  M HEPES, 50 mM  used to  with  of plasmid  p l a c e d i n a b o i l i n g water bath  in a final  dGTP, dTTP, 0.2  (BRL),  (1983) p r o c e d u r e ,  ( p r e v i o u s l y l i n e a r i z e d by d i g e s t i o n ) was a microfuge  the  Probes  and V o g e l s t e i n  prepare  in  wrapped i n the  t h e n b a k e d u n d e r vacuum f o r 1 h a t 80°C.  3.3.10 R a n d o m l y - P r i m e d DNA The  Bubbles  A f t e r a minimum o f 12 h o f b l o t t i n g  labelled with pencil,  s e v e r a l hours,  with  c o n t a c t between p a p e r above  The  a l i g h t w e i g h t was  l a y e r s compressed. was  prevented.  with  was  paper s a t u r a t e d  a 1 i n c h stack of paper towels.  b e l o w t h e g e l was  Nytran  3 p i e c e s o f 3MM  that  in a  paper s a t u r a t e d  the g e l ; d e i o n i z e d water moistened Nytran  s a t u r a t e d w i t h 10X  items  s u r f a c e from bottom t o t o p were:  l a r g e p i e c e o f S a r a n Wrap; 3 p i e c e s o f 3MM 10X  of the  oligodeoxy32  and  3 u n i t s of the Klenow fragment of  DNA  mM  61  polymerase I (BRL).  TCA p r e c i p i t a t a b l e cpm w e r e d e t e r m i n e d  (3.3.3) b e f o r e t h e a d d i t i o n incubation  a t 25°C.  After  o f Klenow and a l s o  after 1 h of  a p p r o x i m a t e l y 1 h, t h e DNA p r o b e  was  p r e c i p i t a t e d as d e s c r i b e d f o r r a n d o m l y - p r i m e d cDNA p r o b e s (3.3.3), d e n a t u r e d , and added d i r e c t l y t o t h e n o r t h e r n b l o t hybridization  solution  (3.3.2).  Blots  a u t o r a d i o g r a p h o b t a i n e d as d e s c r i b e d  w e r e w a s h e d a n d an (3.3.4).  3.3.11 R e s t r i c t i o n Enzyme A n a l y s i s R e s t r i c t i o n enzyme s i t e s w i t h i n  and Genomic W a l k i n g  the largest  cDNA c l o n e s were  d e t e r m i n e d f o r Bam H I , E c o R I , H i n c I I , H i n d I I I , P s t I , S a l I , Sma  I ( i n c u b a t e d a t 30°C) , S s t I , a n d X b a I .  orientated  r e l a t i v e t o e a c h o t h e r b a s e d on l o c a t i o n o f  r e s t r i c t i o n enzyme  s i t e s and h y b r i d i z a t i o n  e a c h o f t h e 110 s e l e c t e d  filter  Cl,  DNA  from  t h e N y t r a n on a s t a c k o f  p a p e r s o a k e d i n 0.5 M NaOH f o r 5 m i n .  t h e n b l o t t e d d r y and t h e s t e p r e p e a t e d . transferred  analysis.  p l a s m i d s was s p o t t e d o n t o N y t r a n s h e e t s  a n d s u b s e q u e n t l y d e n a t u r e d by p l a c i n g 3MM  C l o n e s were  t o a s t a c k o f 3MM  The N y t r a n was  The N y t r a n was  f i l t e r paper soaked w i t h 1 M T r i s -  pH 7.4, a n d a f t e r 5 m i n t h e N y t r a n was b l o t t e d d r y a n d t h e  step repeated.  F i n a l l y t h e membrane was p l a c e d on 3MM  filter  p a p e r s o a k e d w i t h 1.5 M N a C l a n d 0.5 M T r i s - C l , pH 7.4, a n d a f t e r 5 m i n t h e y w e r e b l o t t e d d r y a n d b a k e d 1 h a t 8 0°C i n a vacuum. E a c h membrane, w h i c h p o s s e s s e d a l l 110 p l a s m i d s , was p r o b e d randomly primed o l i g o n u c l e o t i d e s  with  (3.3.10) s y n t h e s i z e d t o g e l -  p u r i f i e d e n d f r a g m e n t s o f t h e two l a r g e s t  cDNA c l o n e s  (see n e x t  62 paragraph).  T h i s p e r m i t t e d the s e l e c t i o n o f cDNA c l o n e s which  extended beyond these two l a r g e s t  clones.  A f t e r r e s t r i c t i o n enzyme d i g e s t s and s e p a r a t i o n o f DNA fragments by e l e c t r o p h o r e s i s i n 1% (w/v) low m e l t i n g temperature agarose g e l s , end fragments were i s o l a t e d u s i n g the method o f T h u r i n g et al. ( 1 9 7 5 ) .  E x c i s e d g e l fragments were p l a c e d i n a  microfuge tube, weighed, and then an equal volume o f 0.3 M sodium a c e t a t e , pH 5.2, and 1 mM EDTA, pH 7.0, was added.  The fragments  were heated i n a 65°C water bath f o r 5 min, vortexed, f r o z e n with l i q u i d n i t r o g e n , and then c e n t r i f u g e d f o r 5 min at room temperature.  The aqueous phase was removed and the procedure was  repeated t w i c e .  The aqueous phases were combined and t h e DNA end  fragments p r e c i p i t a t e d . with  3.4  32  These end fragments were then  P u s i n g the random p r i m i n g DNA l a b e l l i n g system  labelled (3.3.10).  P r e p a r a t i o n o f Subclones 3.4.1  U n i d i r e c t i o n a l Nested Deletions  U n i d i r e c t i o n a l d e l e t i o n s of s e l e c t e d cDNA c l o n e s were c r e a t e d f o l l o w i n g the p r o t o c o l d e s c r i b e d by Stratagene (San Diego, CA) u s i n g exonuclease I I I (BRL) and mung bean nuclease (BRL)  (Henikoff, 1 9 8 4 ) .  Plasmid DNAs were s e q u e n t i a l l y  digested  f i r s t w i t h Apa I (incubated at 30°C) t o generate a 3' overhang (which i s r e s i s t a n t t o exonuclease I I I cleavage) and then with Sal  I t o produce a 5' overhang  cDNA i n s e r t . for  f o r exonuclease I I I cleavage of  Approximately 3 |ig of d o u b l e - d i g e s t e d DNA was used  each time p o i n t r e q u i r e d .  The DNA was suspended  i n 50 u\l of  63 a s o l u t i o n c o n t a i n i n g 50 mM T r i s - C l , mercaptoethanol,  pH 8.0, 20 mM 2-  5 mM M g C l , a n d 10 fi.g/ml tRNA. 2  Exonuclease I I I  (150 u n i t s ) was a d d e d a n d t h e r e a c t i o n i n c u b a t e d a t 30°C. A l i q u o t s were removed a t 1 m i n i n t e r v a l s t o o b t a i n n e s t e d deletions differing  A t e a c h t i m e p o i n t a 50 | l l a l i q u o t was t r a n s f e r r e d  (Stratagene) . to a tube mM N a C l ,  i n l e n g t h b y a p p r o x i m a t e l y 230 b p  c o n t a i n i n g 350 \il o f 30 mM s o d i u m a c e t a t e , pH 5.0, 50 1 mM Z n C l , a n d 5% ( v / v ) g l y c e r o l . 2  immediately with l i q u i d nitrogen u n t i l removed. on i c e .  Samples were f r o z e n  a l l a l i q u o t s had been  S a m p l e s were t h e n h e a t e d a t 68°C f o r 15 m i n a n d p l a c e d N i n e u n i t s o f mung b e a n n u c l e a s e was a d d e d a n d a l l o w e d  t o i n c u b a t e f o r 30 m i n a t 30°C.  Samples were e x t r a c t e d w i t h  e q u a l v o l u m e s o f p h e n o l / c h l o r o f o r m a n d c h l o r o f o r m , t h e DNA precipitated,  washed, a n d r e s u s p e n d e d  i n 15 (ll TE.  A 4 jxl a l i q u o t o f t h e e x o n u c l e a s e  I I I , mung b e a n  nuclease  t r e a t e d DNA f r o m e a c h t i m e p o i n t was b l u n t - e n d l i g a t e d a s d e s c r i b e d above  (3.2.3).  T h i s DNA was u s e d t o t r a n s f o r m p r e p a r e d  c o m p e t e n t E. c o l i DH5a c e l l s . transformations tubes  Although  similar t o previous  (3.2.4) t h e s e were done i n E p p e n d o r f  microfuge  a n d o n l y 0.4 m l o f LB l i q u i d m e d i a was a d d e d a f t e r t h e  c e l l s were heat  shocked.  3 . 4 . 2 P r e p a r a t i o n o f Competent C o m p e t e n t E. c o l i DH5a c e l l s procedure  of Morrison  (1979).  E.  coll  (BRL)  Cells were p r e p a r e d u s i n g t h e  A s i n g l e DH5a c o l o n y f r o m a n LB  a g a r p l a t e was u s e d t o i n o c u l a t e 3 m l o f LB medium a n d i n c u b a t e d  64 a t 37°C w i t h v i g o r o u s s h a k i n g o v e r n i g h t .  One m l o f t h e o v e r n i g h t  c u l t u r e was u s e d t o i n o c u l a t e 250 m l LB medium i n a l i t r e B a c t e r i a w e r e i n c u b a t e d a t 37°C w i t h v i g o r o u s u n t i l t h e OD  600nm  was a p p r o x i m a t e l y  (Beckman, F u l l e r t o n ,  shaking  (200 rpm)  0.5 on a S p e c t r o n i c 20  CA) s p e c t r o p h o t o m e t e r .  C e l l s were  r a p i d l y t o 0-5°C u s i n g a s a l t / i c e b a t h a n d t h e n min  flask.  a t 4°C i n a GSA r o t o r a t 8000 rpm.  cooled  centrifuged for 8  P e l l e t s were g e n t l y  r e s u s p e n d e d u s i n g a w i d e mouth p i p e t t e i n 62.5 m l 0.1 M M g C l over  a 10 m i n p e r i o d .  C e l l s were c e n t r i f u g e d as above,  r e s u s p e n d e d i n 62.5 m l 0.1 M C a C l again. and  2  2  o v e r 20 m i n , a n d c e n t r i f u g e d  T h e s e p e l l e t s w e r e r e s u s p e n d e d i n 10.75 m l 0.1 M  CaCl  2  1.75 m l g l y c e r o l b e f o r e 200 ( l l a l i q u o t s w e r e t r a n s f e r r e d t o  1.5 m l E p p e n d o r f t u b e s bath.  and r a p i d l y  C e l l s w e r e s t o r e d a t -70°C.  f r o z e n i n an e t h a n o l / d r y i c e These c e l l s were  u s e d f o r t r a n s f o r m a t i o n as d e s c r i b e d  3.5 DNA  directly  (3.2.4).  Sequencing  3.5.1  Selection of  Subclones  The s i z e s o f i n s e r t s o b t a i n e d f r o m s u b c l o n e s exonuclease  I I I d e l e t i o n were d e t e r m i n e d  o b t a i n e d by t h e a l k a l i n e  l y s i s method  generated  from p l a s m i d  (3.3.6).  by  DNA  P l a s m i d DNA  was  d i g e s t e d w i t h Pvu I I and i n s e r t s s e p a r a t e d by e l e c t r o p h o r e s i s i n a g a r o s e g e l s i n TAE b u f f e r ( 3 . 3 . 7 ) .  Hind  l a m b d a DNA was u s e d a s a s i z e m a r k e r .  I I I and P s t I d i g e s t e d  Subclones  with the desired  s i z e d i n s e r t s were s e q u e n c e d by t h e d i d e o x y n u c l e o t i d e t e r m i n a t i o n method  (Sanger  e t al.,  1977) u s i n g  chain  double-stranded  65 p l a s m i d DNA a s t e m p l a t e  ( K o r n e l u k e t al.,  1985).  3.5.2 S e q u e n c i n g G e l s S e q u e n c i n g g e l s were 21 X 50 cm u s i n g wedge s p a c e r s w i t h a w i d t h o f 0.25 t o 0.75 mm. 89 mM b o r i c a c i d ,  The g e l c o n t a i n e d I X TBE  a n d 2 mM EDTA), 6%  (89 mM  Tris,  (w/v) a c r y l a m i d e ( f r o m a 2 0 %  s t o c k c o n t a i n i n g 19% a c r y l a m i d e a n d 1% b i s - a c r y l a m i d e ) ,  a n d 7.67  M urea.  o f TEMED  Immediately before pouring the s o l u t i o n ,  52 | l l  ( B i o - R a d ) a n d 52 ( l l o f f r e s h l y p r e p a r e d 2 5 % (w/v) ammonium p e r s u l f a t e were added.  S e q u e n c i n g g e l s were p r e p a r e d t h e day  b e f o r e t h e y were u s e d .  R u n n i n g b u f f e r f o r s e q u e n c i n g g e l s was I X  TBE.  S e q u e n c i n g g e l s w e r e p r e - e l e c t r o p h o r e s e d f o r 1 h a t 38 W o r  until  t h e t e m p e r a t u r e o f t h e g e l r e a c h e d a b o u t 50°C.  t o o t h " combs  "Sharks  ( B i o - R a d ) were r e m o v e d a n d w e l l s r i n s e d w i t h  b e f o r e s a m p l e s were l o a d e d .  S a m p l e s were e l e c t r o p h o r e s e d t h r o u g h  t h e s e g e l s f o r 2 t o 8 h a t 40 W d e p e n d i n g on t h e d e s i r e d o f DNA s e q u e n c e t o be r e a d 250 n u c l e o t i d e s ) . t o Whatman  TBE  length  (a 3 h r u n g e n e r a l l y r e s o l v e d 180 t o  After electrophoresis,  g e l s were  transferred  3MM f i l t e r p a p e r a n d d r i e d f o r 1 h a t 80°C u s i n g a  B i o - R a d g e l d r y e r (Richmond, C A ) .  A u t o r a d i o g r a p h y was o v e r n i g h t  a t room t e m p e r a t u r e w i t h o u t i n t e n s i f y i n g s c r e e n s .  Autoradiograms  w e r e r e a d m a n u a l l y o r w i t h t h e B i o - R a d Gene M a s t e r d i g i t i z e r a n d s e q u e n c e i n f o r m a t i o n s t o r e d a n d a n a l y z e d u s i n g t h e Gene M a s t e r software (Bio-Rad).  66  3.5.3 The  Sequencing w i t h Klenow double-stranded  s e q u e n c i n g p r o t o c o l u s e d was t h a t  d e s c r i b e d by Stratagene stranded  (San D i e g o , C A ) .  DNA f r o m m i n i p r e p s  Half of the double-  o f s e l e c t e d subclones  was  incubated  a t room t e m p e r a t u r e f o r 5 m i n i n 50 [ l l o f 0.2 M NaOH a n d 0.2 mM EDTA t o d e n a t u r e t h e DNA.  N u c l e i c a c i d s were t h e n p r e c i p i t a t e d  w i t h 0.1 v o l u m e 2 M ammonium a c e t a t e , pH 5.4, a n d 2.5 v o l u m e s o f absolute  ethanol  f o r 10 m i n i n l i q u i d n i t r o g e n .  Samples were  c e n t r i f u g e d , washed, d r i e d , a n d r e s u s p e n d e d i n 8 ( l l TE. Sequences were d e t e r m i n e d u s i n g t h e B l u e s c r i p t p l a s m i d primer  and t h e Klenow  3.5.4  reverse  (BRL) enzyme a t 42°C.  Sequencing w i t h Sequenase  A r e a s w i t h c o m p r e s s i o n s o r where s e q u e n c e s w e r e n o t i n agreement were a l s o sequenced by a m o d i f i e d p r o c e d u r e Sequenase  (United States Biochemical  H a l f o f a subclone plasmid  miniprep  reverse primer  ethanol  Cleveland,  OH).  was a d d e d t o 10 n g o f B l u e s c r i p t  f o r a f i n a l v o l u m e o f 50 ( l l c o n t a i n i n g  M NaOH a n d 0.2 mM EDTA. 85°C, p l a c e d  Corporation,  using  S a m p l e s were i n c u b a t e d  0.2  f o r 5 min a t  on i c e , a n d p r e c i p i t a t e d w i t h s o d i u m a c e t a t e a n d  a t -70°C f o r 10 m i n .  N u c l e i c a c i d p r e c i p i t a t e s were  c e n t r i f u g e d , washed w i t h 70% e t h a n o l , d r i e d , and r e s u s p e n d e d i n 7.5 ( l l o f 40 mM T r i s - C l ,  pH 7.5, 20 mM M g C l , a n d 50 mM 2  NaCl.  S e q u e n c e s w e r e d e t e r m i n e d u s i n g e i t h e r dGTP o r i t s a n a l o g d e s c r i b e d by t h e m a n u f a c t u r e r .  dITP as  67 3.6  C o a t P r o t e i n Gene  Constructs  The p u t a t i v e PLRV c o a t p r o t e i n ORF was i d e n t i f i e d sequence s i m i l a r i t y (BYDV-PAV)  c o a t p r o t e i n gene  identification prepared which Pvu  w i t h another  r e c e n t l y sequenced  (Miller  e t al.,  from  luteovirus  1988a).  Following  o f t h e c o a t p r o t e i n gene t h r e e c o n s t r u c t s w e r e  f o r i n s e r t i o n o f t h e gene i n t o p l a n t s .  The c l o n e LP7 9  c o n t a i n s t h e c o a t p r o t e i n ORF was d i g e s t e d w i t h P s t I a n d  I I (both o f which  l a r g e s t DNA purified.  c l e a v e t h e PLRV cDNA s e q u e n c e ) a n d t h e  fragment o f approximately  1100 b a s e p a i r s was g e l -  T h i s f r a g m e n t was u s e d t o p r e p a r e  c o n s t r u c t s o f t h e c o a t p r o t e i n gene  three  different  (Figure 2 ) .  Two c o n s t r u c t s w e r e p r e p a r e d b y A l u I d i g e s t i o n o f t h e P s t I-Pvu I I fragment.  Alu I digestion resulted i n a  fragment o f approximately gel-purified t r e a t e d M13+  1000 b a s e p a i r s .  blunt-ended  This fragment  was  (3.3.11) a n d t h e n l i g a t e d i n t o E c o RV d i g e s t e d , C I P Bluescript  (3.2.3).  Plasmids  from t r a n s f o r m a n t s o f  E. c o l i DH5oc w e r e e x a m i n e d u s i n g t h e r e s t r i c t i o n  enzyme R s a I t o  o b t a i n c o n s t r u c t s o f t h e gene i n b o t h o r i e n t a t i o n s . (positive-sense)  a n d pCP27E  Both  (negative-sense), l a t e r  LCP 107 a n d LCP 1718 r e s p e c t i v e l y , p o s s e s s e d P L R V s e q u e n c e 5' t o t h e c o a t p r o t e i n AUG  pCP20E  designated  192 n u c l e o t i d e s o f  a n d 112 n u c l e o t i d e s o f  t h e P L R V s e q u e n c e 3' t o t h e c o a t p r o t e i n UAG t e r m i n a t i o n c o d o n . The t h i r d  c o n s t r u c t was p r e p a r e d v i a l i g a t i o n  restriction  fragments  restriction  fragment  Sau  of several  a l l o b t a i n e d from t h e i n i t i a l (Figure 2 ) .  Pstl-Pvu II  One f r a g m e n t was o b t a i n e d b y  3AI d i g e s t i o n p r o d u c i n g a fragment a p p r o x i m a t e l y  370  68  ATG  TAG  Coat Protein ORF nt  100  Figure 2. Diagram of the r e s t r i c t i o n s i t e s used t o prepare the t h r e e PLRV c o a t p r o t e i n c o n s t r u c t s . The P s t I a n d P v u I I r e s t r i c t i o n f r a g m e n t o f LP7 9 i s shown w i t h t h e l o c a t i o n o f t h e r e s t r i c t i o n s i t e s r e l a t i v e t o t h e c o a t p r o t e i n ORF. Below the LP79 r e s t r i c t i o n fragment t h e p o s i t i o n o f t h e coat p r o t e i n s t a r t (ATG) a n d s t o p (TAG) c o d o n i s i n d i c a t e d . n u c l e o t i d e s i n l e n g t h w h i c h was d i g e s t e d f u r t h e r w i t h Ava s e q u e n c e y i e l d i n g two  gel-purified.  I which recognizes a non-palindromic  Sau 3AI d i g e s t e d t e r m i n u s , b u t o n l y  fragment w i t h t h e d e s i r e d Ava  I terminus.  Another fragment  d e r i v e d f r o m t h e P s t I - P v u I I f r a g m e n t by A v a e x t r a c t i o n of the largest  and a Pvu All  was  fragments of s i m i l a r m o l e c u l a r weight, both  p o s s e s s i n g an i d e n t i c a l  nucleotides i n length.  T h i s fragment  one was  I d i g e s t i o n and g e l  f r a g m e n t o f a p p r o x i m a t e l y 800  T h i s f r a g m e n t c o n t a i n e d an A v a  I terminus  I I terminus.  o f t h e f r a g m e n t s o b t a i n e d were u s e d i n a  orientation,  sticky-end ligation  i n t o Bam  forced-  HI a n d Sma  I digested  69 B l u e s c r i p t M13+ purified. reaction, end  plasmid  Although o n l y two  i s compatible  t h a t was  t r e a t e d and  3 fragments are present c o u l d be  with the  3AI-end i s compatible r e s u l t i n g plasmid,  t h e n CIP  i n the  Sma  n u c l e o t i d e s 5'  w i t h t h e Bam  to the  gel-purified,  and  LCP  of blunt-end be  except only incubated  ligations  but  RV  l i g a t i o n of 12  would s t i l l  the PLRV  have  112  codon.  d i g e s t e d CIP  treated  facilitate  insertion  o r i e n t a t i o n and  expression  vector  (3.2.3).  u n i t s o f T4  2 h a t 37°C and c o m p e t e n t E.  A 1:1  the  coli  those  o r 1:1:1:1 r a t i o o f DNA  l i g a t i o n mixture DNA  I,  pCDXl.  s t i c k y - e n d l i g a t i o n s were s i m i l a r t o  added t o the  0.2  to transform  3.7  f o r the  l i g a t e d was  analyzed  c o a t p r o t e i n amber t e r m i n a t i o n  r e - l i g a t e d i n t o Eco  intermediate  Conditions  31 was  The  l a t e r e x c i s e d from B l u e s c r i p t w i t h A l u  B l u e s c r i p t to reverse the i n t o the  Sau  Hl-end i n B l u e s c r i p t .  c o a t p r o t e i n AUG  s h o r t c o n s t r u c t was  Pvu I I -  the  This construct should possess only  PLRV n u c l e o t i d e s 3' t o t h e The  The  I-end i n B l u e s c r i p t and  pCP13, l a t e r d e s i g n a t e d  fragments.  ligation  l i g a t e d i n t o the v e c t o r .  w i t h v a r i o u s r e s t r i c t i o n enzymes t o v e r i f y t h e correct  gel-  l i g a s e was  previously  used.  described  Reactions  l i g a t i o n r e a c t i o n used  to  were  immediately  DH5CC.  T r i p a r e n t a l Mating Procedure The  three  c o n s t r u c t s were d i g e s t e d w i t h Xho  i n s e r t e d i n t o the  intermediate  expression plasmid,  3 ) , w h i c h p o s s e s s e s a d u p l i c a t e d CaMV 35S ( c o n s t r u c t e d by  Kay  I and  e t a l . , 1987) .  The  Eco  pCDXl  RI  and  (Figure  enhancer-promoter  pCDXl p l a s m i d  had  been  70  F i g u r e 3 . Schematic diagram o f t h e intermediate expression v e c t o r pCDXl. T h i s v e c t o r , c o n s t r u c t e d b y K a y e t al. ( 1 9 8 7 ) , was u s e d t o f a c i l i t a t e t h e t r a n s f e r o f a l l t h r e e PLRV c o n s t r u c t s i n t o p l a n t genomes. The v e c t o r c o n t a i n s t h e d u p l i c a t e d CaMV 35S p r o m o t e r - e n h a n c e r , t h e NPT I I gene, t h e s p e c t i n o m y c i n r e s i s t a n c e gene, t h e NOS g e n e , t h e NOS p o l y a d e n y l a t i o n s i g n a l , a n d a s e c t i o n o f h o m o l o g y w i t h t h e o c t o p i n e s y n t h a s e gene w h i c h f a c i l i t a t e s homologous r e c o m b i n a t i o n w i t h t h e d i s a r m e d T i p l a s m i d . In a d d i t i o n t o a p o l y l i n k e r , t h e pCDXl p l a s m i d a l s o has t h e r i g h t b o r d e r s e q u e n c e o f t h e T-DNA. p r e v i o u s l y d i g e s t e d w i t h Xho I a n d E c o R I a n d C I P t r e a t e d (3.2.3).  A f t e r l i g a t i o n the plasmid  was u s e d t o t r a n s f o r m  c o m p e t e n t E. c o l i MM294. The  v e c t o r , now c o n t a i n i n g t h e PLRV gene c o n s t r u c t s , was  i n s e r t e d i n t o t h e disarmed octopine ( F r a l e y e t al., 1985) described previously  type  T i plasmid  by homologous r e c o m b i n a t i o n ( R o g e r s e t al., 1 9 8 6 ) .  mating procedure involves t h e conjugation  pTiB6S3SE ( F i g u r e 4) a s  The t r i p a r e n t a l  o f t h r e e b a c t e r i a , E.  c o l i MM 294 c o n t a i n i n g t h e p C D X l d e r i v a t i v e p l a s m i d , containing the m o b i l i z a t i o n plasmid  pRK2013  MM 294  ( D i t t a e t al., 1 9 8 0 ) ,  71  Foreign DNA  NFT  NOS  F i g u r e 4. S t r u c t u r e o f t h e pTiB6S3SE::pCDXl c o i n t e g r a t e o b t a i n e d by a t r i p a r e n t a l m a t i n g a n d h o m o l o g o u s r e c o m b i n a t i o n . A. tumefaciens t h e n t r a n s f e r s t h e i n f o r m a t i o n w h i c h o c c u r s between t h e r i g h t (T ) a n d l e f t (T ) T-DNA b o r d e r s e q u e n c e i n t o t h e genome o f t h e wounded p l a n t t i s s u e . I n s e r t e d i n t o t h e genome a l o n g w i t h t h e PLRV c o a t p r o t e i n cDNA was t h e NOS gene a n d t h e NPT I I g e n e . The l a t t e r made t h e t r a n s f o r m e d p l a n t c e l l s r e s i s t a n t t o t h e a n t i b i o t i c kanamycin. R  L  72 and  A.  tumefaciens  s t r a i n GV3TillSE c o n t a i n i n g the  p l a s m i d pTiB6S3SE. transformed (3.4.2).  The  using the  MM  294  l i n e was  same p r o c e d u r e  In the t r i p a r e n t a l mating,  mobilizes  i n t o t h e E.  w i t h i n t h e E.  coli/pCDXl c e l l ,  it  can  tumefaciens.  made c o m p e t e n t  u s e d w i t h E. t h e pRK2013  thereby  was  16 h a t 28°C. p l a s m i d was  and  A s i n g l e colony  also isolated  c o l i MM  294  Overnight  o f E.  LB  c u l t u r e was centrifuged, was  and  c o l i MM  apparatus  been  incubated  1 ml  o f 10 mM  s y r i n g e connected  w i t h a 0.2  |im M i l l i p o r e  colony  selected at  antibiotics  and  grown a t  C u l t u r e s were d i l u t e d  r e s u s p e n d e d i n 2 ml  pig/ml  incubated overnight  colony  A  pRK2013  a single  c u l t u r e s with the appropriate  grown t o l o g p h a s e .  (Xg/ml  with the  Finally,  (ig/ml s p e c t i n o m y c i n  t r a n s f e r r e d t o a 5 ml  filter  294  aliquot  then mixed i n a s t e r i l e p o l y s t y r e n e and  A.  f r o m LB p l a t e s c o n t a i n i n g 50  i n d i c a t e d above.  f o l l o w i n g day  of  c o n t a i n i n g 25  were i n o c u l a t e d from a s i n g l e b a c t e r i a l temperatures  tumefaciens,  w i t h t h e d e s i r e d p C D X l c o n s t r u c t was  f r o m LB p l a t e s w i t h 50 37°C.  plasmid  pTiB6S3SE  50 |lg/ml k a n a m y c i n , t h a t h a d  k a n a m y c i n t h a t w e r e i n c u b a t e d a t 37°C. o f E.  i n A.  a single colony  s e l e c t e d f r o m LB p l a t e s ,  chloramphenicol  Once  recombination.  P r i o r t o the mating procedure tumefaciens  plasmid  m o b i l i z e s the  W i t h t h e pCDXl p l a s m i d  homologous  DH5a  pRK2013 p r o v i d e s t r a n s f e r p r o t e i n  i n t e g r a t e i n t o the r e s i d e n t disarmed  through  coli  and  c o l i c o n t a i n i n g t h e pCDXl p l a s m i d .  t h a t a c t s on t h e p C D X l p l a s m i d and i n t o A.  disarmed  the  the from  each  tube,  MgSO„.  The  to a s t e r i l e  ( B e d f o r d , Ma)  mixture Swinney  filter  73 (SXHA025LS).  C e l l s were c o l l e c t e d on t h e d i s k w h i c h was  t r a n s f e r r e d t o a f r e s h , n o n d r i e d LB a g a r p l a t e a n d i n c u b a t e d a t 28°C o v e r n i g h t .  F i l t e r s were t h e n a s e p t i c a l l y r e m o v e d a n d p l a c e d  i n t o s t e r i l e p o l y s t y r e n e tubes  c o n t a i n i n g 2.0 m l o f 10 mM MgS0  and t h e t u b e g e n t l y v o r t e x e d f o r 1 m i n .  4  A 0.1 m l a l i q u o t o f  c e l l s was t h e n s p r e a d on f r e s h LB s e l e c t i o n p l a t e s c o n t a i n i n g 25 u\g/ml c h l o r a m p h e n i c o l , spectinomycin.  50 |ig/ml k a n a m y c i n , a n d 100 ng/ml  O n l y A. tumefaciens  with a pCDXl::Ti  cointegrate  s h o u l d p r o d u c e c o l o n i e s on t h i s medium. P l a t e s were i n c u b a t e d a t 28°C f o r 3 d a y s a n d i n d i v i d u a l c o l o n i e s t h e n u s e d t o i n o c u l a t e LB o v e r n i g h t c u l t u r e s , w h i c h were i n c u b a t e d a t 28°C.  T h e s e c u l t u r e s c o n t a i n e d t h e same  as i n t h e s e l e c t i o n p l a t e s .  antibiotics  C e l l s were s t o r e d w i t h a n e q u a l  v o l u m e o f g l y c e r o l a t -70°C.  3.8 P l a n t  Transformations  V a r i o u s t i s s u e s from t h r e e d i f f e r e n t p l a n t t y p e s transformed.  Initially  Nicotiana  tabacum  was u s e d s i n c e i t i s r e a d i l y t r a n s f o r m e d and  cultivar  tuberosum  cultivar  (Stiekema  i n o c u l a t e d w i t h r e c o m b i n a n t A. tumefaciens Finally,  was t r a n s f o r m e d  Then t h e  ' D e s i r e e ' , w h i c h h a s b e e n one o f t h e  easier potato c u l t i v a r s t o transform  regenerated.  'Xanthi-nc'  ( H o r s c h e t a l . , 1985)  r e p r e s e n t s a good model t r a n s f o r m a t i o n system.  Solanum  were  t h e S. tuberosum  e t al., 1 9 8 8 ) ,  and t r a n s g e n i c p l a n t s cultivar  w i t h t h e PLRV c o a t p r o t e i n g e n e .  c u l t i v a r has been v e r y d i f f i c u l t  was  'Russet This  Burbank' potato  t o t r a n s f o r m and r e g e n e r a t e b u t  74 represents  t h e most commonly grown c u l t i v a r  i n North America.  PLRV r e s i s t a n c e i n t h i s c u l t i v a r w o u l d , t h e r e f o r e , h a v e greatest  impact.  3.8.1  Transformation  Nicotiana  of  Tobacco  cultivar  tabacum  'Xanthi-nc'  i n o c u l a t e d w i t h c u l t u r e s o f r e c o m b i n a n t A. c u l t u r e d in  v i t r o as d e s c r i b e d  unblemished leaves  Tween 20.  l e a f d i s k s were  (v/v)  by H o r s c h e t a l .  A f t e r 20 min  sodium h y p o c h l o r i t e  with occasional  and  6 mm  w h i c h had  50  dry  s t e r i l i z e d paper towel  30  g/L  borer.  culture  |ig/ml  sucrose,  t r a n s f e r r e d t o an  0.6  and  salts,  the  incubated 0.001  Skoog  (w/v)  agar.  a t 22°C u p s i d e down  0.1  250  A f t e r 2 days the  u\g/ml c e f o t a x i m e ,  and Louis,  (ig/ml n a p h t h a l e n e d i s k s were  i d e n t i c a l medium e x c e p t t h a t i t a l s o  |ig/ml c a r b e n i c i l l i n ,  After  d i s k s were b l o t t e d  volumes of a N i t s c h  1 (ig/ml b e n z y l a d e n i n e , %  of  spectinomycin  s o l u t i o n (Sigma C h e m i c a l Company N8764 S t .  a c e t i c a c i d , and  500  overnight  100  i n a p e t r i p l a t e f o r 1 min  a medium c o n t a i n i n g MS  Nitsch vitamin MO),  were  (Sigma C h e m i c a l Company M5524 S t . L o u i s , MO).  shaking  on  (v/v)  leaves  9 v o l u m e s o f M u r a s h i g e and  gently on  0.01%  disks excised with a  (ig/ml k a n a m y c i n , and  been d i l u t e d w i t h  (1962) s a l t s  sterilized  a t 28°C i n LB medium c o n t a i n i n g 25 u.g/ml  incubated  chloramphenicol,  and  Healthy,  L e a v e s were b l o t t e d  S e v e n t y l e a f d i s k s were s u b m e r g e d i n an tumefaciens  (1985).  a g i t a t i o n the  6 times with s t e r i l e deionized water.  dry w i t h s t e r i l e paper towel  A.  and  tumefaciens  were s e l e c t e d f r o m y o u n g p l a n t s and  i n a s o l u t i o n o f 0.6%  rinsed  the  and  300  contained |ig/ml  75 kanamycin.  The  c a r b e n i c i l l i n and  e l i m i n a t e t h e A.  f r e s h m e d i a e v e r y two mm  are used t o  and t h e k a n a m y c i n f a c i l i t a t e s  tumefaciens  s e l e c t i o n of transformed  cefotaxime  cells.  L e a f d i s k s were t r a n s f e r r e d t o  weeks d u r i n g s h o o t  were e x c i s e d from c a l l i  development.  Shoots  c o n t a i n s o n l y 100  Once r o o t s w e r e o b s e r v e d  t h e medium was  (ig/ml k a n a m y c i n . removed from  r o o t s by w a s h i n g and t h e p l a n t l e t s w e r e t r a n s f e r r e d t o The  humidity.  p l a n t l e t s w e r e h a r d e n e d o f f by A clear plastic  maintain a high humidity c r e a t e an o p e n i n g days  cup  was  sterilized  slowly reducing  the  used t o cover the p l a n t l e t  f o r 3 days.  approximately  the  The  cup  was  then t i l t e d  1 cm w i d e and was  removed  and to  two  later.  3.8.2  Transformation  of the Potato C u l t i v a r  T u b e r d i s k s o f t h e Solanum i n o c u l a t e d and (1988) .  c u l t u r e d in  T h i s 5.  vitro  as d e s c r i b e d by  (3.7.1).  Subsequently,  w e r e p u n c h e d o u t and thickness.  i s one  zeatin,  Stiekema et a l .  followed with tobacco  using a borer,  1.0  salts,  v i t a m i n s , and  cm  3%  (w/v)  0.6%  peeled leaf  cylinders  cut i n t o tuber d i s k s approximately  u s e d t o i n o c u l a t e 91 t u b e r d i s k s and  were  o f t h e most a m e n a b l e  E a c h o f t h e t h r e e c o n s t r u c t s i n A.  c o n t a i n i n g MS  'Desiree'  T u b e r s s t o r e d f o r 2 months a t 4°C w e r e  s t e r i l i z e d using the procedure  disks  'Desiree'  cultivar  tuberosum  cultivar  tuberosum  to transformation. and  3-5  and t r a n s f e r r e d t o a medium w h i c h  l a c k s t h e p h y t o h o r m o n e s and  soil.  the  tumefaciens  2 mm  in  were  i n c u b a t e d on p l a t e s  sucrose,  0.01  mg/l  NAA,  1  mg/l  a g a r f o r 3 d a y s a t 22°C w i t h 16 h/8  h  light/dark.  Subsequently,  t h e d i s k s were t r a n s f e r r e d t o a  s i m i l a r medium w i t h 100 |ig/ml k a n a m y c i n , 500 [iq/ml c a r b e n i c i l l i n , and  250 (lg/ml c e f o t a x i m e .  t r a n s f e r r e d t o a shoot sucrose, GA , 3  0.25 mg/L  Two weeks l a t e r t h e d i s k s w e r e  e l o n g a t i o n medium c o n t a i n i n g MS s a l t s ,  b e n z y l amino p u r i n e , 0.6%  500 [lg/ml c a r b e n i c i l l i n ,  a n d 100 mg/L  t r a n s f e r was made a f t e r a n o t h e r shoots  2-3 mm  kanamycin.  salts,  2%  two weeks d u r i n g w h i c h  (w/v) s u c r o s e ,  3.8.3 T r a n s f o r m a t i o n  w e r e i n o c u l a t e d w i t h A. recombinant plasmids  0.1 mg/L  IAA, a n d  of the Potato C u l t i v a r  tumefaciens  cultivar  0.6%  i n the  'Russet  'Russet  Burbank'  Burbank'  w i t h each of t h e t h r e e  a s were t h e ' X a n t h i '  (3.8.1) a n d  (3.8.2) t i s s u e s .  T u b e r d i s k s were o b t a i n e d ,  c u l t u r e d in vitro  as d e s c r i b e d above  (3.8.2).  (1988) w i t h m i n o r m o d i f i c a t i o n s .  'Desiree'  i n o c u l a t e d , and  s e c t i o n s w e r e i n o c u l a t e d a n d c u l t u r e d in vitro  Stem a n d  leaf  a s d e s c r i b e d by De  T i s s u e was d e r i v e d f r o m  p l a n t s i n a x e n i c c u l t u r e w h i c h were p r o p a g a t e d  in vitro  by  1 cm l o n g s t e m p i e c e s t o g e t h e r w i t h an a x i l l a r y  t o MS medium w i t h 20 g/L s u c r o s e Fifty  similar  plantlets.  V a r i o u s t i s s u e s o f S. tuberosum  transferring  mg/L  time  R o o t e d p l a n t l e t s were t r a n s f e r r e d t o s o i l  same manner a s w e r e t h e t o b a c c o  Block  A  0.1  l o n g were t r a n s f e r r e d t o a r o o t i n g medium  c o n t a i n i n g MS (w/v) a g a r .  (w/v) a g a r ,  3%  leaves approximately  base and f i f t y  a n d 0.6% a g a r 2-10 mm  bud  (SI media).  i n l e n g t h were c u t a t t h e  i n t e r n o d a l stem c u t t i n g s a p p r o x i m a t e l y  l e n g t h w e r e e x c i s e d f r o m 3 t o 4 week o l d s h o o t s .  5 mm i n  Each t i s s u e  was  s u b m e r s e d i n a d i l u t e d A. blotted dry. applicable  Inoculated  culture,  tumefaciens  t h e n washed i n a p o l y s t y r e n e  A l l t i s s u e s were  t u b e w i t h MS medium c o n t a i n i n g  0.5 g/L MES, pH 5.5, 20 g/L m a n n i t o l ,  carbenicillin.  and  t i s s u e was p l a c e d u p s i d e down w h e r e  on S I medium f o r 2 d a y s a t 22°C.  g/L s u c r o s e ,  agitated,  After b l o t t i n g dry the cuttings  30  a n d 1 g/L  were p l a c e d  u p s i d e down on MS medium w i t h o u t s u c r o s e a n d s u p p l e m e n t e d 200  mg/L  glutamine,  g/L m a n n i t o l , (w/v)  agar.  mg/L NAA,  with  0.5 g/L MES, pH 5.7, 0.5 g/L P V P - 4 4 , 0 0 0 , 20  20 g/L g l u c o s e ,  40 mg/L  a d e n i n e s u l f a t e , a n d 0.5%  T h i s medium a l s o c o n t a i n e d 1 mg/L t r a n s - z e a t i n ,  1 g/L c a r b e n i c i l l i n ,  100 mg/L k a n a m y c i n , a n d 10  mg/L  s i l v e r n i t r a t e w h i c h were a d d e d i m m e d i a t e l y b e f o r e p o u r i n g petri plates.  Petri plates  were s e a l e d  i n c u b a t e d a t 22°C u n d e r h i g h l i g h t t i s s u e was t r a n s f e r r e d  the  with  calli  3  After  0.1 g/L  carbenicillin.  two s h o o t s w e r e n e v e r t a k e n  from  duplication.  o f Transgenic  3.9.1 S o u t h e r n  0.1 mg/L GA .  be i s o l a t e d a n d w e r e  t o t h e S I medium c o n t a i n i n g  same c a l l u s t o a v o i d  After  were t r a n s f e r r e d t o new  shoots could  other transformations,  3.9 A n a l y s i s  1 week  0.5 g/L c a r b e n i c i l l i n .  o f t h e same medium s u p p l e m e n t e d w i t h  a n o t h e r 2 weeks t h e f i r s t  As  After  t o new medium a n d 2 weeks l a t e r t o a  2 more weeks t h o s e t i s s u e s w i t h  transferred  into  p a r a f i l m and  intensity.  s i m i l a r medium w i t h o u t NAA a n d o n l y  plates  with  0.1  Plants  Analysis  Southern h y b r i d i z a t i o n a n a l y s i s  ( S o u t h e r n 1975) was u s e d t o  78 c o n f i r m i n s e r t i o n o f t h e PLRV c o a t p r o t e i n gene i n t o kanamycin r e s i s t a n t p l a n t s .  The  DNA  was  h e a l t h y l e a f t i s s u e as d e s c r i b e d a b o v e d i g e s t e d w i t h 20 u n i t s o f H i n d were t e r m i n a t e d  and  separated DNA  and  on t h e g e l s was  t o 10X  t h r e e 3MM The  pH  SSC  filters  g e l was  filters  0.5  As  SSC,  and  (3.3.7) .  DNA  was  bromide  acid agitation  p e r i o d s o f 15 m i n  each.  each.  c h a n g e s o f 1.5  M  accomplished SSC  by p l a c i n g on  S a r a n Wrap.  down, t h e n t h e N y t r a n ,  three  was  d i r e c t c o n t a c t o c c u r r e d between  t o p and b o t t o m f i l t e r s ,  a l i g h t w e i g h t was  pencil, above DNA  transfer,  baked, p r e h y b r i d i z e d  (3.3.10).  t h e membrane was (3.3.2),  p l a c e d on labelled  and p r o b e d as  S o u t h e r n b l o t s were s c r e e n e d  with  w h i c h c o n t a i n s t h e PLRV c o a t p r o t e i n g e n e . were t h e  same as b e f o r e  Washes  (3.3.4).  the  top.  with  described radiolabelled  f r a g m e n t s s p e c i f i c t o t h e PLRV A l u I r e s t r i c t i o n  autoradiography  3MM  1 i n c h of c u t - t o - s i z e paper  w r a p p e d w i t h S a r a n Wrap, no  A f t e r an o v e r n i g h t  NaCl  C a p i l l a r y t r a n s f e r of  w i t h the northern b l o t s the e n t i r e sandwich  and  DNA  overnight.  Nucleic  c u t - t o - s i z e s o a k e d i n 10X  p l a c e d on t o p u p s i d e  Digests  soaking the g e l with  f o r 15 min  soaked Nytran  s o a k e d w i t h 10X  towels.  by  of  was  fig/ml e t h i d i u m  a ruler.  M NaOH f o r two  7.4,  half  mg  I I I o r P s t I d i g e s t e d lambda  f o l l o w e d by n e u t r a l i z a t i o n i n two  1 M Tris-Cl,  t h e DNA  loading buffer  s t a i n e d w i t h 0.5  accomplished  M N a C l and  T h i s was and  Hind  the g e l photographed beside  1.5  (3.3.8) and  by e l e c t r o p h o r e s i s a t 1 v o l t / c m  d e n a t u r a t i o n was in  e x t r a c t e d f r o m 180  I I I i n a 20 ( l l v o l u m e .  w i t h 4 | i l o f a 6X  samples were l o a d e d b e s i d e  the  fragment and  79 3.9.2  Isolation of Poly  Northern  (A )  RNA  +  h y b r i d i z a t i o n a n a l y s i s of t r a n s g e n i c p l a n t s  done u s i n g p o l y  (A ) RNA.  Poly  +  (dT) c e l l u l o s e  (A ) RNA +  was  i s o l a t e d using  (Boehringer Mannheim, D o r v a l , Que.)  chromatography as d e s c r i b e d by A v i v and Leder modifications. RNA  Poly  (A ) RNA +  was  (1972) with minor  i s o l a t e d from t o t a l  (Richmond, CA) oligo  Columns were prepared Poly-Prep  combined u.1 DEPC  u s i n g an a u t o c l a v e d Bio-Rad  10 ml column t o which was  added 50 mg  (dT) c e l l u l o s e suspended i n 1 ml of l o a d i n g b u f f e r B  T r i s - C l , pH column was  7.4,  0.1  M NaCl, 1 mM  EDTA, and  washed with 3 volumes of 0.1  0.1%  (w/v)  l e s s than  The  washed with 5 volumes of l o a d i n g b u f f e r A 1 M NaCl, 1 mM RNA  EDTA, c o n t a i n i n g 0.1%  samples were heated  column was  (40 mM  (w/v)  u\l of l o a d i n g b u f f e r A prewarmed t o 65°C was  T h i s was  mM  then  at which time  added.  The  E l u a t e was  7.4,  400  sample min  collected,  c o o l e d to room temperature f o r 2 min,  r e a p p l i e d t o the column.  The  was  T r i s - C l , pH  mixed and allowed t o c o o l at room temperature f o r 2  t o 65°C f o r 5 min,  mM  SDS).  to 65°C f o r 5 min  b e f o r e a p p l i c a t i o n t o the column.  (20  M NaOH c o n t a i n i n g 5  8 as determined with pH paper.  of  SDS).  EDTA and then DEPC t r e a t e d water u n t i l the pH of e f f l u e n t  was  oligo  column  from 4 i n d i v i d u a l 1 g samples resuspended i n 400  t r e a t e d water.  was  heated and  f o l l o w e d by a 5 volume washing  with l o a d i n g b u f f e r A f o l l o w e d by a 4 volume wash with l o a d i n g b u f f e r B. C l , pH  7.4,  Poly  (A ) RNA +  was  c o n t a i n i n g 1 mM  e l u t e d with 3 volumes of 10 mM EDTA and  0.05%  were c o l l e c t e d and those c o n t a i n i n g RNA  (w/v)  SDS.  were i d e n t i f i e d  Tris-  Fractions by  80 s p o t t i n g an i n TAE  and  a l i q u o t onto a p e t r i 0.5  precipitated,  U\g/ml e t h i d i u m  d i s h c o n t a i n i n g 1%  bromide.  r e s u s p e n d e d i n 10  Poly  and  quantitated with a spectrophotometer. poly  (A )  RNA  +  was  loaded  per  methylmercuric hydroxide as d e s c r i b e d  earlier  t h e membrane was  separated  (3.3.9).  above  w i t h r a d i o l a b e l l e d DNA  3.9.3  on  RNA  +  a 1 |il  was  aliquot  an a g a r o s e g e l  by  (lg o f  containing  e l e c t r o p h o r e s i s and  Transfer  (3.3.10).  agarose  A p p r o x i m a t e l y 0.9  labelled with pencil,  p r o b e d as d e s c r i b e d  restriction  lane  (A )  (w/v)  was  completed  overnight,  baked, p r e h y b r i d i z e d ,  N o r t h e r n b l o t s were  t h e PLRV c o a t  and  screened  f r a g m e n t s s p e c i f i c t o t h e PLRV A l u  fragment which c o n t a i n s  blotted  I  p r o t e i n gene.  Transgenic Plant Protein A n a l y s i s 3.9.3.1 E x t r a c t i o n o f P l a n t P r o t e i n  Total phenol-soluble  p r o t e i n was  f o l l o w i n g t h e p r o t o c o l o f Van was  w e i g h e d and  m o r t a r and  (1979) .  Leaf t i s s u e  1 g f r o z e n w i t h l i q u i d n i t r o g e n and  ground w i t h  pestle.  Etten  e x t r a c t e d from p l a n t t i s s u e  e t al.  S a m p l e s w e r e f u r t h e r h o m o g e n i z e d i n 9 ml  i c e c h i l l e d e x t r a c t i o n b u f f e r c o n s i s t i n g o f an e q u a l buffer  (80 mM  sulfonyl  Tris,  fluoride,  containing  0.1  1 mM and  2%  DTT, (w/v)  10 mM SDS,  M ammonium a c e t a t e  homogenization the  EDTA, 0.2 9 mM  and  pH  6.8)  10 mM  c e n t r i f u g e d a t 10,000 rpm  for  a q u e o u s f r a c t i o n was  f r a c t i o n was  The  DTT.  of of  phenylmethyl80%  phenol  A f t e r thorough  samples were f i l t e r e d t h r o u g h 4 l a y e r s  c h e e s e c l o t h and 10 m i n .  and  volume  of  i n a SS34 r o t o r a t  discarded  e x t r a c t e d 3 t i m e s w i t h an e q u a l  a  and  the  4°C  phenol  v o l u m e o f 30 mM  Tris  81 c o n t a i n i n g 1 mM DTT, 10 mM EDTA, a n d 100 mM ammonium a c e t a t e , pH 6.8.  P r o t e i n was p r e c i p i t a t e d w i t h 5 v o l u m e s  c o n t a i n i n g 0.1 M ammonium a c e t a t e  o f -20°C m e t h a n o l  f o r 2 h a t -20°C a n d p e l l e t e d  w i t h c e n t r i f u g a t i o n a t 9000 rpm w i t h a SS34 r o t o r f o r 5 m i n a t 4°C.  P r o t e i n p r e c i p i t a t e s w e r e washed t w i c e w i t h t h e  p r e c i p i t a t i n g medium a n d o n c e w i t h  3.9.3.2  acetone.  Electrophoresis o f Protein  D u r i n g t h e a c e t o n e wash, a 1/15 a l i q u o t was s p u n down, d r i e d w i t h n i t r o g e n , a n d d i s s o l v e d i n 200 ( l l o f 0.1 M NaOH i n c u b a t i n g 30 m i n a t 60°C. Bradford  (1976)  before  P r o t e i n was a s s a y e d b y t h e m e t h o d o f  using t h e Bio-Rad p r o t e i n assay.  The r e m a i n i n g  a c e t o n e p r e c i p i t a t e was d r i e d w i t h n i t r o g e n a n d r e s u s p e n d e d a t a c o n c e n t r a t i o n o f 15 p.g/(ll p r o t e i n i n 0.5 M T r i s - C l ,  pH 6.8, 1 0 %  (v/v)  2 - m e r c a p t o e t h a n o l , 4% (w/v) SDS, 2 0 % ( v / v ) g l y c e r o l , a n d  0.01%  (w/v) b r o m o p h e n o l  blue.  S a m p l e s were p l a c e d  i n boiling  w a t e r f o r 5 m i n a n d 150 ( i g / l a n e l o a d e d o n t o a 12.5% polyacrylamide  g e l (Laemmli,  SDS-  1970) w i t h a 4% (w/v) s t a c k i n g g e l  using t h e Bio-Rad Laboratories electrophoresis c e l l .  (w/v)  (Richmond,  CA) M i n i - P r o t e a n I I  The g e l was r u n a t 10 m A / g e l u n t i l t h e  t r a c k i n g d y e was t h r o u g h t h e s t a c k i n g g e l a n d t h e n a t 20 m A / g e l until  t h e dye reached t h e bottom o f t h e g e l .  3.9.3.3  Western B l o t A n a l y s i s  Polyacrylamide  p r o t e i n g e l s w e r e b l o t t e d w i t h 25 mM  192 mM g l y c i n e , a n d 2 0 % (v/v) m e t h a n o l ,  a t 100 v o l t s  Tris,  f o r 2 h onto  82 Imraobilon-P the  membrane  Bedford,  MA) .  After  blotting,  Immobilon-P membranes were b l o c k e d o v e r n i g h t a t 4°C i n 10  Tris-Cl, (w/v)  pH 7.4  nonfat  c o n t a i n i n g 150 mM  dry milk,  PLRV m o n o c l o n a l or  (Millipore,  0.1%  ascitic  PLRV p o l y c l o n a l  NaCl,  0.05%  from  antiserum prepared  to the mild s t r a i n  1:250 i n t h e b l o c k i n g b u f f e r was u s e d  western  blots. saline  Na HP0 -12H 0, 2  4  2  containing  B l o t s were washed f o u r t i m e s (PBS) (137 mM  2.7 mM  0.1%  in blocking buffer (Hunter  KC1, a n d 3.1 mM  with  10  6  1.5 mM  cpm/ml  1 2 5  with  KH P0 , 2  4  8.1  screens  mM 7.4)  incubated f o r 1 h  I-chloramine  T-labelled  anti-mouse antiserum  or protein  Autoradiograms  b l o t s were o b t a i n e d w i t h o v e r n i g h t e x p o s u r e s  intensifying  o f PLRV  phosphate  s o d i u m a z i d e , pH  and a g a i n washed f o u r t i m e s .  1:5000  t o probe the  They were t h e n  a n d Greenwood, 1962) g o a t  A, r e s p e c t i v e l y , western  NaCl,  (v/v) Tween 20.  (w/v) BSA.  h y b r i d o m a 371A d i l u t e d  diluted  buffered  (v/v) Tween 20, 1%  (w/v) s o d i u m a z i d e , a n d 1%  fluid  mM  of  with  a t -70°C.  3.10 PLRV Challenge o f T r a n s g e n i c Potato 3.10.1 Determination o f PLRV T i t r e s The assayed from  accumulation by E L I S A .  o f PLRV i n t h e t r a n s g e n i c p o t a t o p l a n t s was  Microtitre  PLRV p o l y c l o n a l  antiserum  f o l l o w e d by b l o c k i n g w i t h with (w/v)  0.05%  0.2%  (v/v) Tween 20.  i n PBS c o n t a i n i n g 0.2%  Tween 20, a n d 2%  w e l l s were c o a t e d w i t h i n 0.05 M c a r b o n a t e , (w/v) n o n f a t  Leaf  1 |ig/ml IgG pH  dried milk  9.6, i n PBS  s a m p l e s were h o m o g e n i z e d  (w/v) n o n f a t  d r i e d milk,  (w/v) p o l y v i n y l p y r r o l i d o n e .  1:10  0.05% (v/v)  One h u n d r e d \il  83 a l i q u o t s were l o a d e d plates,  per w e l l of a m i c r o t i t r e plate  (Immulon I  F l o w L a b o r a t o r i e s , M c L e a n , VA) a n d i n c u b a t e d  room t e m p e r a t u r e .  f o r 3 h a t 37°C.  tap water before  20 was a d d e d a n d  M i c r o t i t r e p l a t e s were washed  goat anti-mouse a n t i b o d i e s conjugated  a l k a l i n e phosphatase  to  f o r 1 h a t 37°C.  P l a t e s w e r e washed  a g a i n w i t h t a p w a t e r a n d 100 | l l o f p - n i t r o p h e n y l p h o s p h a t e  well.  with  (BRL) w e r e a d d e d a s p e r m a n u f a c t u r e r ' s  recommendation and i n c u b a t e d  mg/ml i n 10%  at  P l a t e s w e r e washed w i t h t a p w a t e r a n d 200  n g / m l PLRV m o n o c l o n a l 371A i n PBS-Tween incubated  overnight  (v/v) d i e t h a n o l a m i n e ,  a t 0.5  pH 9.8, was a d d e d t o e a c h  A b s o r b a n c e a t 405 nm was r e c o r d e d  after  1 h and  overnight  i n c u b a t i o n s a t room t e m p e r a t u r e w i t h a T i t e r t e k M u l t i s c a n 8 channel reader  p l a t e reader was b l a n k e d  (Flow L a b o r a t o r i e s , McLean, V A ) .  The p l a t e  on a row t r e a t e d a s d e s c r i b e d b u t w i t h v i r u s  free tissue.  C o n t r o l s were p l a c e d on e a c h p l a t e a n d i n c l u d e d  PLRV-infected  tissue,  healthy uninoculated  t i s s u e from  u n t r a n s f o r m e d p l a n t s , and l e a f sap from h e a l t h y  'Russet  Burbank'  c o n t a i n i n g known q u a n t i t i e s o f p u r i f i e d PLRV as d e t e r m i n e d the u l t r a v i o l e t  absorbance spectrum.  s t e p w i t h S a r a n Wrap t o p r e v e n t  3.10.2  PLRV T i t r e s  Each t r a n s g e n i c assigned  P l a t e s were wrapped a t e a c h  desiccation.  i n 'Desiree'  shoot from t h e potato  t h e l e t t e r D a n d a number.  r e c e i v e d t h e same d e s i g n a t i o n . D12 o f t h e p o t a t o  from  cultivar  A l l vegetative  Transgenic  'Desiree'  cultivar  'Desiree'  was  progeny  p l a n t s D2, D7, D8, a n d  a l l p o s s e s s c o n s t r u c t LCP 31  84 (Figure placed  8).  i n 15 cm p o t s ,  day/night. stock  They were v e g e t a t i v e l y p r o p a g a t e d by stem  Plants  material.  propagated  Control  plants  'Desiree'  w i t h PLRV u s i n g  to  insure  that  Initially D7,  D8,  leaves  Plants  of plants  t h e a p h i d s were  Plants  Myzus  during  persicae pubescens.  and u n t r a n s f o r m e d five  approximately  viruliferous  10 cm i n h e i g h t  the inoculation  cuttings  f r o m e a c h o f D2,  w i t h PLRV.  approximately  1 cm  2  Leaf  from  samples o f  different  were c o l l e c t e d and t e s t e d by E L I S A a t 10  i n t e r v a l s o v e r a 50 day p e r i o d .  control.  s a m p l e s were c o l l e c t e d a n d t e s t e d by E L I S A  o v e r a 72 day p e r i o d  inoculations. determined  Relative  f r o m D2,  following the  D8,  and a  challenge  average absorbance values  f o r each of the t r a n s g e n i c  D12,  then  18 v e g e t a t i v e  biweekly  cuttings  The e x p e r i m e n t was  repeated using Leaf  period  feeding.  18 v i r u s - f r e e v e g e t a t i v e  o f each p l a n t  vector  w i t h PLRV by p l a c i n g  were i n s p e c t e d  2 or 3 i n d i v i d u a l leaves  day  D12,  a n d a c o n t r o l were i n o c u l a t e d  locations  of vegetatively  on P L R V - i n f e c t e d Physalis  were i n o c u l a t e d  5 days.  the aphid  p r o p a g a t e d D2, D7, D8,  a p h i d s on v a r i o u s for  consisted  PLRV-free  n o t t r a n s f o r m e d by Agrobacterium.  which had f e d p r e v i o u s l y Vegetatively  16/8 h  were m o n i t o r e d by E L I S A t o m a i n t a i n  'Desiree'  were i n o c u l a t e d  and grown i n a g r e e n h o u s e w i t h  cuttings,  'Desiree'  i n E L I S A were lines.  3.10.3 E f f e c t o f I n o c u l u m L e v e l s To  e s t a b l i s h the e f f e c t  of the inoculum  v e g e t a t i v e l y propagated cuttings  level,  from t r a n s g e n i c  each o f 8  'Desiree'  D12  85 a n d u n t r a n s f o r m e d ' D e s i r e e ' were i n o c u l a t e d u s i n g e i t h e r 25 v i r u l i f e r o u s M. persicae. titre  1, 5, o r  L e a f samples were c o l l e c t e d and t h e  o f PLRV q u a n t i t a t e d b i w e e k l y by E L I S A o v e r a 78 d a y p e r i o d .  3 . 1 0 . 4 PLRV T i t r e s i n  'Russet  Burbank'  Each t r a n s g e n i c shoot from t h e p o t a t o c u l t i v a r Burbank' letter  was a s s i g n e d t h e l e t t e r s RB, a number,  'Russet  and sometimes a  i f two s h o o t s were f r o m t h e same l e a f o r i n t e r n o d a l  segment.  A l l v e g e t a t i v e progeny  T r a n s g e n i c 'Russet Burbank'  r e c e i v e d t h e same d e s i g n a t i o n .  ( F i g u r e 8) l i n e s RB7A a n d RB7B w h i c h  p o s s e s s t h e LCP 31 c o n s t r u c t , t h e LCP 107 c o n s t r u c t ,  stem  l i n e s RBI a n d RB25 w h i c h  contain  a n d l i n e s RB12B a n d RB16B w h i c h  possess  t h e LCP 1718 c o n s t r u c t were grown i n t h e g r e e n h o u s e v e g e t a t i v e l y propagated.  and  Thirty vegetatively propagated  plants  from each o f t h e s e s i x t r a n s g e n i c l i n e s o f 'Russet Burbank' t h e u n t r a n s f o r m e d 'Russet Burbank'  c o n t r o l were i n o c u l a t e d when  a p p r o x i m a t e l y 10 cm i n h e i g h t by p l a c i n g 50 M. persicae  t h a t had  p r e v i o u s l y f e d f o r more t h a n 1 week on P L R V - i n f e c t e d P. on e a c h o f t h e t e s t p l a n t s .  and  A p h i d s were a l l o w e d an  pubescens  inoculation  a c c e s s p e r i o d o f 5 d a y s on t h e t e s t p l a n t s a f t e r w h i c h t h e p l a n t s were s p r a y e d w i t h t h e s y s t e m i c i n s e c t i c i d e L e a f samples  Pirimor.  were c o l l e c t e d i n d i v i d u a l l y  from each  plant  p r i o r t o i n o c u l a t i o n a n d t h e n e v e r y two weeks f o r a p e r i o d o f 56 days p o s t - i n o c u l a t i o n . 2 distinct,  I n o c u l a t e d l e a v e s were a v o i d e d b y  a p p r o x i m a t e l y 1 cm  during inoculation.  2  taking  l e a v e s , from t i s s u e not p r e s e n t  S a m p l e d l e a v e s were u n b l e m i s h e d a n d f r o m t h e  86  p r i m a r y stem e x c e p t f o r t h e l a s t a secondary  s a m p l i n g when one  from  shoot.  Each ELISA p l a t e had b o t h a n e g a t i v e c o n t r o l u n t r a n s f o r m e d 'Russet Burbank') dilution  l e a f was  (healthy  and a p o s i t i v e c o n t r o l  (a 2  fold  s e r i e s o f q u a n t i t a t e d p u r i f i e d PLRV d i l u t e d i n h e a l t h y  l e a f sap o f 'Russet B u r b a n k ' ) .  From e a c h o f t h e 30  e x t r a c t s o f e a c h l i n e a 100 | l l a l i q u o t was a 2 fold dilution Absorbance  individual  removed, combined,  series prepared using the grinding  buffer.  v a l u e s were t a k e n o f o v e r n i g h t r e a d i n g s and  q u a n t i t a t e d PLRV d i l u t i o n virus titres  the  s e r i e s on e a c h p l a t e u s e d t o d e t e r m i n e  i n the t r a n s g e n i c p l a n t s w i t h the ELIZA  ( L e a d i n g Edge R e s e a r c h V e r s i o n 2.12  Vancouver,  s e r i e s f r o m e a c h t r a n s g e n i c l i n e was virus titres  and  i n each l i n e .  BC).  program The  used t o determine  dilution  average  ELISA v a l u e s f o r i n d i v i d u a l  i n d i c a t e d t h e number o f p l a n t s t h a t showed a h i g h l e v e l  plants of  protection.  3.11  A p h i d T r a n s m i s s i o n o f PLRV 'Russet Burbank'  viruliferous  aphids.  p l a n t s were i n o c u l a t e d u s i n g Two  individual  50  l e a v e s from each p l a n t  c o l l e c t e d 47 d a y s p o s t - i n o c u l a t i o n , p l a c e d i n a p e t r i moistened f i l t e r , leaves f o r 5 days.  a n d P L R V - f r e e M.  month o l d .  pubescens  dish with a  allowed access t o the  persicae  Four a p h i d s , 2 from each l e a f ,  t r a n s f e r r e d t o h e a l t h y P.  were  were t h e n  seedlings approximately 1  A f t e r 5 d a y s t h e s e s e e d l i n g s were s p r a y e d w i t h t h e  insecticide Pirimor to k i l l  the aphids.  One  month l a t e r  ELISA  87  was u s e d t o d e t e r m i n e i f t h e P. pubescens PLRV.  were i n f e c t e d  with  88  RESULTS AND DISCUSSION  IV.  4.1  H o s t R e a c t i o n s t o PLRV  Infection  No r e l i a b l e symptoms w e r e o b s e r v e d w i t h p r i m a r y of  'Desiree'  o r ' R u s s e t Burbank' grown i n t h e g r e e n h o u s e  some c h l o r o s i s lack  infections  a n d l e a f c u r l i n g was o b s e r v e d i n t h e l a t t e r .  o f r e l i a b l e symptoms i s t y p i c a l o f PLRV p r i m a r y  i n g r e e n h o u s e grown p o t a t o e s .  I n P. pubescens,  chlorosis.  tissue  Virus  w h i c h was u s e d a s  Nucleic  sensitive  and had a M  4.2 A n a l y s i s After Bluescript  stunting  y i e l d s a p p r o a c h i n g 1 mg p e r k g o f l e a f  were o b t a i n e d w i t h t h e p u r i f i c a t i o n p r o t o c o l  (3.1.2).  This  infections  a p r o p a g a t i o n h o s t , t h e s t r a i n o f PLRV u s e d c a u s e d some and  although  acid extracted  described  from p u r i f i e d v i r u s  was RNase  o f approximately 2 X 10 . 6  r  o f PLRV cDNA  l i g a t i o n o f PLRV cDNA i n t o C I P t r e a t e d  linearized  M13+ p l a s m i d a n d t r a n s f o r m a t i o n o f c o m p e t e n t E.  DH5a c e l l s w i t h t h e cDNA c o n t a i n i n g  coli  plasmid, thousands o f white  recombinant a m p i c i l l i n - r e s i s t a n t colonies  were o b t a i n e d .  The  number o f t r a n s f o r m a n t s p e r u.g o f s t a r t i n g PLRV RNA was d e t e r m i n e d t o b e a p p r o x i m a t e l y 3.3 X 1 0 . 6  and  CIP t r e a t e d  Bluescript  colonies  resulted  analysis  F i l t e r hybridizations  i na variety  i n d i v i d u a l recombinant c o l o n i e s . further  of digested  (3.2.3) p r o d u c e d no c o l o n i e s  t r a n s f o r m e d i n t o E. c o l i DH5a. selected  Ligation  of signal  when  o f 800  intensities for  C l o n e s were s e l e c t e d f o r  b a s e d on t h e s i g n a l  i n t e n s i t y and t h e assumption  89 that intensity  w o u l d be c o r r e l a t e d w i t h t h e s i z e  The 110 p l a s m i d s LP  e x a m i n e d were d e s i g n a t e d  a n d a number f r o m 1 a n d 110.  o f cDNA.  with the letters  The two l a r g e s t c l o n e s ,  L P 9 3 , w e r e e a c h shown b y r e s t r i c t i o n a n a l y s i s t o c a r r y g r e a t e r t h a n 3000 n u c l e o t i d e s i n l e n g t h . confirmed  the origin  concentrations  two c l o n e s  of similar  cDNA r e a c t i o n  analysis  f r o m PLRV RNA.  size  (3.2.1),  a n d number.  i n c r e a s e d t h e l e n g t h o f PLRV c l o n e d  used  r e s u l t e d i n cDNA  LP4 a n d L P 4 1 w h i c h  (Figure 5 ) .  mapped  3' t o t h e L P 4 1 P s t I r e s t r i c t i o n  mapped  5' t o t h e LP4 X b a I r e s t r i c t i o n  O n l y one  s i t e w h e r e a s 24 site.  This  clone  clones  suggested that  mapped t o w a r d s t h e 3' e n d o f t h e v i r u s genome.  first-strand  Both  G e l - p u r i f i e d end fragments of  LP79 and LP93 were u s e d t o s e l e c t c l o n e s  LP41  inserts  o f o l i g o d e o x y r i b o n u c l e o t i d e hexamer p r i m e r s  in the f i r s t - s t r a n d clones  of these  Northern  LP79 a n d  Extension  cDNA s y n t h e s i s w o u l d be 3' t o 5' on t h e v i r a l  of  RNA.  Thus s y n t h e s i s i n i t i a t e d a n y w h e r e on t h e RNA c o u l d e x t e n d t o t h e 5' e n d b u t o n l y s y n t h e s i s i n i t i a t e d a t t h e 3' e n d w o u l d r e s u l t i n clones  o f t h e 3' e n d .  orientated relative  The cDNA c l o n e s  t o e a c h o t h e r b a s e d on r e s t r i c t i o n enzyme a n d  hybridization analysis. the  These f o u r c l o n e s  5,883 n u c l e o t i d e s o f t h i s PLRV i s o l a t e  Although  represented  PLRV i s o l a t e s (1988).  s i m i l a r i t i e s with the r e s t r i c t i o n  d e s c r i b e d by b o t h P r i l l  most o f  ( K e e s e e t al.,  some d i f f e r e n c e s w e r e o b s e r v e d , r e s t r i c t i o n  revealed overall  al.  shown i n F i g u r e 5 w e r e  e t al.  1990).  analysis  sites  of the  (1988) a n d S m i t h e t  90  PLRV RNA  5' £ ,0 » 0 =S  #  CL  -  t>  is  £  co  i  3'  D:  —  Q;  Oa  X  ii! O. o?  3: * 5 g o g e§ £ c§  3  23 kDa ORF LP41 LP79 LP93 LP4 1000  nt  F i g u r e 5 . R e s t r i c t i o n map o f t h e PLRV genome. T h i s was d e r i v e d f r o m t h e a n a l y s i s o f o v e r l a p p i n g cDNA c l o n e s t h a t a r e i n d i c a t e d b e l o w t h e map. The LP c l o n e s were d e r i v e d f r o m r a n d o m l y p r i m e d cDNA s y n t h e s i s . The r e g i o n o f t h e c l o n e LP7 9 c o r r e s p o n d i n g t o t h e 23 kDa ORF i s r e p r e s e n t e d b y an open r e c t a n g l e .  4.3  PLRV Sequence A n a l y s i s None o f t h e cDNA c l o n e s  fusion protein.  e x p r e s s e d PLRV c o a t  Sequence d a t a  obtained  while  cDNA i n d i c a t e d t h a t t h e B l u e s c r i p t p l a s m i d cytosine residue  t h a t caused a f r a m e s h i f t .  t h e v i r u s RNA r e s u l t e d i n a UAA s t o p  p r o t e i n as a  s e q u e n c i n g PLRV  M13+ was m i s s i n g This  a  frameshift i n  codon o c c u r r i n g between t h e  AUG s t a r t c o d o n o f t h e amino t e r m i n u s o f t h e ( 3 - g a l a c t o s i d a s e p r o t e i n a n d t h e p o l y l i n k e r c o n t a i n i n g t h e cDNA.  S t r a t a g e n e (San  D i e g o , CA) l a t e r c o n f i r m e d i n a b u l l e t i n t h a t t h i s p a r t i c u l a r  91 batch  of B l u e s c r i p t plasmid  spurious  stop  was l a c k i n g a c y t o s i n e r e s u l t i n g i n a  codon which would i n h i b i t  expression  of a fusion  protein. B a r b a r a e t al.  (1987) r e p o r t e d  e x p r e s s e d f r o m cDNA r e s t r i c t i o n BYDV-MAV c o a t the  that fusion  fragments i n d i c a t e d t h a t the  p r o t e i n gene mapped a t a d i s t a n c e  genome l e n g t h f r o m t h e 5' e n d .  (1988a) r e p o r t e d  proteins  that expression  o f 65 t o 80% o f  More r e c e n t l y M i l l e r  e t al.  o f BYDV-PAV cDNAs a s f u s i o n  p r o t e i n s i n d i c a t e d t h a t t h e c o a t p r o t e i n gene mapped a t a distance viral the  o f 50 t o 60% o f t h e genome l e n g t h f r o m t h e 5' e n d o f t h e  RNA.  Amino a c i d a n d n u c l e o t i d e  ORF  i n this  e t al.,  1988a).  the  clone  sequences confirmed  r e g i o n e n c o d e s t h e BYDV-PAV c o a t I f t h e PLRV c o a t  LP79 s h o u l d clone  protein  (Miller  p r o t e i n were s i m i l a r l y  c o n t a i n the coat p r o t e i n coding  covered a large proportion  that  located,  region of  PLRV.  This  of the internal  region  o f t h e PLRV genome a n d t h e r e f o r e was t h e f i r s t  t o be  s u b c l o n e d a n d s e q u e n c e d u s i n g t h e s t r a t e g y shown i n F i g u r e The n u c l e o t i d e 627 n u c l e o t i d e s 1989).  s e q u e n c e o f LP79  i n length,  ( F i g u r e 7) r e v e a l e d  as shown i n F i g u r e  an  6. ORF,  8 (Kawchuk e t al.,  The d e d u c e d amino a c i d s e q u e n c e o f t h i s  ORF  (Figure  8)  shows 4 7 . 1 % h o m o l o g y w i t h t h e amino a c i d s e q u e n c e o f t h e c o a t p r o t e i n o f BYDV-PAV  (Miller  e t al.,  1988b).  Comparisons w i t h  s u b s e q u e n t s e q u e n c e s o f t h e S c o t t i s h (Mayo e t a l . , 1 9 8 9 ) , Netherlands al.,  (Van d e r W i l k  e t a l . , 1989), and A u s t r a l i a n (Keese e t  1990) i s o l a t e s o f PLRV c o a t p r o t e i n s r e v e a l e d  s e q u e n c e d i f f e r e n c e s o f 1.9%, 2.4%, a n d  amino a c i d  1.4%, r e s p e c t i v e l y .  92 £  LP79  £ |  Coat Protein  |  '  5  300 nt  ^  5'  •  • •  3'  F i g u r e 6. Sequencing s t r a t e g y used t o determine t h e coat p r o t e i n c o d i n g r e g i o n o f PLRV. A r r o w s i n d i c a t e t h e d i r e c t i o n a n d l e n g t h of sequence from u n i d i r e c t i o n a l n e s t e d d e l e t i o n s o f c l o n e L P 7 9 . The r e g i o n c o r r e s p o n d i n g t o t h e c o a t p r o t e i n ORF i s r e p r e s e n t e d by a n o p e n r e c t a n g l e . The acids)  predicted M  r  o f t h e PLRV 23 kDa ORF p r o t e i n  i s 23,202 w h i c h i s s i m i l a r t o t h e 26,300  p r e v i o u s l y by e l e c t r o p h o r e s i s Stace-Smith, and  1979).  on p o l y a c r y l a m i d e  The a b o v e s i m i l a r i t i e s  estimated gels  (Rowhani a n d  i n position,  size,  s e q u e n c e s t r o n g l y s u g g e s t t h a t t h e 23 kDa p r o t e i n e n c o d e d b y  t h i s ORF i s t h e PLRV c o a t p r o t e i n . the  (208 amino  amino-terminal region  basic,  L i k e BYDV-PAV c o a t  o f t h e PLRV 23 kDa p r o t e i n i s h i g h l y  c o n t a i n i n g many a r g i n i n e r e s i d u e s  amino t e r m i n a l  regions  protein  (R i n F i g u r e  8 ) . The  o f many p l a n t v i r u s c a p s i d p r o t e i n s  have  been f o u n d t o be h i g h l y b a s i c and i t has been s u g g e s t e d t h a t  they  93 1 5' CGCAGAGAAAACTGCTCAAACAAACTCAGCAGAGAAGACTGCTCCATCAACTTCAGCAGAGAAAACTGCTCCAACAAACAAGCCTTTAAA 91 T G G G C A A G C G G C A C C G T C C G C C A A A A C A A A C G G C A A C T C C G A C A T C C C C G A C G C C G C T A C A A G C G C A C C A C C A A T G A A C A A A A T G G T C G A 181 ACAGATCATCACAGCTATGGTGGGGAGAATCAATCTCTCGGAGATAGAGGAGAAGATAGAGTGCAGGGTGTCTCAGAAAGCCCTGCAGAA 271 GCCCAAACAAAAGAAACGCGGAAGGCGTGGAGGGAAGAACAAGCAAAACAATTTACCTCCTACTTCGACGCAATCTATAAGTGGGGCGCC 3 61 CAAGAAGGAGGCTGCCCCCCAGGCTTCAGGAAGTGCGGGAATATCCCCGGTTACTACCACCCCCGCACCAGAGGTCAAACCAAGTGGGGG 451 CAAAAACTCTGCCAAGTTCATCCCGAGCTGGCGGAGAAAACAGCAGGATTCGGCTGGCCAAAAGCCGGATCTGAAGCTGAGCTCCAAAGC 541 C T G A A T C T A C A G G C T G C C A G G T G G C T C C A A C G C G C G G A G T C G G C C A C T A T C C C T G G C G C A G A A G C A A G A A A A C G C G T G A T T G A G A A A A C A 631 GTGGAGACATACAGAAATTGTGTAACTAACGCCCCACTGTGCTCCCTTAAATCCAAACTGGATTGGGCTGGCTTTCAACAAGGTTGAGGA 721 CCATAAGCTTCTCCCAGTGCTCACTCAGCTGACCTTTGACCGACTACAGAAGATGTCGGAGGCCAGCTTTGAGGATATGAGCGCAGAAGA 811 GCTGGTTCAAGAAGGGCTCTGTGATCCTATCAGACTATTTGTCAAAGGAGAGCCCCACAAACAGAGCAAACTCGATGAAGGCCGCTACCT 901 CCTCATCATGTCTGTTTCCTTGGTGGATCAACTGGTAGCCCGGGTTCTGTTCCAAAATCAGAACAAAAGGGAAATTTCCCTGTGGAGGTC 991 TGTGCCTTCCAAACCCGGTTTTGGCCTTTCAACTGACACTCAAACTGCTGAATTCTTGGAGTGTCTTCAAAAGGTGTATGGAGCGCCATC 1081 TGTGGAAGAATTGTGTGCAAATCACAAGGAGTACACGCGCTCAACCGACTGTTCCGGTTTCGACTGGTCAGTCGCGTATTGGATGCTGGA 1171 GGATGATATGGAGGTGAGAAATCGCCTGACATTTAATAACACCCAGCTCACCAAGCGTCTTCGGGCTGCCTGGTTGAAGTGCATAGGAAA 12 61 C T C C G T C T T A T G C C T G T C C G A T G G C A C T T T A C T T G C C C A A A C T G T T C C C G G T G T G C A A A A G A G C G G A A G T T A C A A T A C A A G T T C C T C C A A 1351 C T C T A G A A T C C G G G T T A T G G C T G C C T A T C A C T G T G G C G C C G A C T G G G C A A T G G C C A T G G G G G A C G A T G C C C T C G A A G C C C C C A A C T C C G A 1441 CCTGGAGGAGTATAAAACACTAGGTTTCAAAGTCGAGGrAGGTCGAGAACTCGAATTCTGTTCACACATCTTCAGAAATCCGACCCTCGC 1531 C G T T C C G G T C A A T A C C A A C A A A A T G C T T T A C A A G T T G A T C C A T G G T T A T A A T C C G G A A T G T G G C A A T C C A G A A G T G A T T C A A A A C T A T C T 1621 GGCTGCAGTATTCTCTGTGCTGCAGGAGCTCAGACACGATCGTGAGCTCGTTGCCAAGCTCCACCAGTGGTTGGTTCCGAGTGCCACCAC 1711 AAAAGAACACTGAAGGAGCTCACTAAAACTAGCCAAGCATAAGCGAGTTGCAAGCATTGGAAGTTCAAGCCTCGTTACATCAACCGGACA 1801 AAATAGATTATAAATTCTTAGCGGGATTCGCTTTAGGATTTTCATCCGCAATCCCATTTTCAGTAGCCGGTTTATATTTTGTTTACCTAA 18 91 AGArrrCCrCCCACGrGCGArCAArrGrrAArGAGrACGGTCGTGGrrAAAGGAAArGrCAArGGTGGrGrACAACAACCAAGAAGGCGA 1981 A G A A G G C A A T C C C T T C G C A G G C G C G C T A A C A G A G T T C A G C C A G T G G T T A T G G T C A C G G C C C C T G G G C A A C C C A G G C G C C G A A G A C G C A G A 2071 AGAGGAGGCAATCGCCGCTCAAGAAGAACTGGAGTTCCCCGAGGACGAGGCTCAAGCGAGACATTCGTGTTTACAAAGGACAACCTCGTG 2161 GGCAACTCCCAAGGAAGTTTCACCTTCGGGCCGAGTCTATCAGACTGTCCGGCATTCAAGGATGGAATACTCAAGGCCTACCATGAGTAT 2251 AAGATCACAAGCATCTTACTTCAGTTCGTCAGCGAGGCCTCTTCCACCTCCTCCGGTTCCATCGCTTATGAGTTGGACCCCCATTGCAAA 2341 GTATCATCCCTCCAGTCCTACGTCAACAAGTTCCAAATTACGAAGGGCGGCGCCAAAACTTATCAAGCGCGGATGATAAACGGGGTAGAA 2431 TGGCACGATTCTTCTGAGGATCAGTGCCGGATACTGTGGAAGGGAAATGGAAAATCTTCAGATCCCGCAGGATCCTTCAGAGTCACCATC 2521 AGGGTGGCTTTGCAAAACCCCAAATAGGTAGACTCCGGATCAGAGCCTGGTCCAAGCCCACAACCAACACCCACTCCAACTCCCCAGAAG 2611 CACGAGAGATTTATTGCTTACGTTGGCATACCTATGCTAACCATTCAAGCTAGGGAGAACGACGACCAAATCATATTGGGTTCCTTAGGG 2701 AGCCAAAGGATGAAATATATAGAGGACGAGAACCAGAACTATACAAATATTAGTTCTGAGTATTACTCTCAATCGAGTATGCAAGCCGTC 27 91 C C T A T G T A T T A T T T C A A T G T C C C G A A A G G G C A A T G G T C A G T C G A T A T C A G C T G C G A A G G G T A T C A A C C C A C T A G C A G C A C C T C G G A T C C A 2881 CACCGGGGTAGGAGTGACGGGATGATCGCGTATTCAAACGCGGATTCCGATTACTGGAATGTTGGTGAAGCGGATGGTGTCAAAATTTCG 2971 AAGCTACGCAACGATAACACCTACCGCCAAGGTCACCCAGAACTTGAAATTAACTCGTGTCATTTTCGCGAGGGCCAACTCCTTCAACGG 30 61 G A C G C T A C A A T T A G C T T C C A C G T T G A A G C G C C T A C T G A T G G G C G A T T C T T T C T C G T T G G T C C C G C T A T C C A G A A A A C C G C A A A G T A T A A C 3151 T A T A C T A T C T C A T A C G G T G A C T G G A C G G A C C G A G A C A T G G A G C T G G G G C T G A T C A C T G T G G T G C T T G A T G A A C A T T T A G A A G G C A C T G G T 3241 T C G G C T A A C A G A G T G C G G C G G C C C C C A C G G G A G G G C C A C A T C T A T A T G G C G T C 3'  Figure 7. N u c l e o t i d e sequence o f c l o n e L P 7 9 . T h i s DNA s e q u e n c e was d e t e r m i n e d f r o m d o u b l e - s t r a n d e d dideoxyribonucleotide sequencing. B o t h s t r a n d s were s e q u e n c e d i n t h e r e g i o n o f t h e PLRV c o a t p r o t e i n g e n e . The b e g i n n i n g a n d e n d o f t h e c o a t p r o t e i n gene i s i n d i c a t e d b y t h e b o l d s t a r t (ATG) a n d s t o p (TAG) codons.  may be i n v o l v e d i n p r o t e i n - R N A i n t e r a c t i o n s ( H a r r i s o n , 1983) C o m p a r i s o n o f t h e PLRV 23  kDa p r o t e i n ORF n u c l e o t i d e  sequence  w i t h t h a t o f t h e BYDV-PAV c o a t p r o t e i n ORF g a v e 58.0%  similarity.  T h i s r e f l e c t s t h e amino a c i d s i m i l a r i t y  and suggests a c l o s e  e v o l u t i o n a r y r e l a t i o n s h i p between these  two v i r u s e s .  The 23 amber  kDa ORF i n t h e cDNA o f PLRV RNA t e r m i n a t e s  (TAG) c o d o n ( F i g u r e 8)  long in-frame  ORF.  which i s immediately  .  w i t h an  f o l l o w e d by a  A s i m i l a r f i n d i n g was o b s e r v e d b y M i l l e r e t  94 *  M S T V V V K G N V N G G V * M S M V V Y TAAAGATTTCCTCCCACGTGCGATCAATTGTTAATGAGTACGGTCGTGGTTAAAGGAAATGTCAATGGTGGTGTA 10 20 30 40 50 60 70 Q Q P R R R R R Q S L R R R A N R V Q P V V M V T N N Q E G E E G N P F A G A L T E F S Q W L W S R CAACAACCAAGAAGGCGAAGAAGGCAATCCCTTCGCAGGCGCGCTAACAGAGTTCAGCCAGTGGTTATGGTCACG 85 95 105 115 125 135 145 AP G Q P R R R R R R R G G N R R S R R T G V P R P L G N P G A E D A E E E A I A A Q E E L E F P E GCCCCTGGGCAACCCAGGCGCCGAAGACGCAGAAGAGGAGGCAATCGCCGCTCAAGAAGAACTGGAGTTCCCCGA 160 170 180 190 200 210 220 G R G S S E T F V F T K D N L V G N S Q G S F T F D E A Q A R H S C L Q R T T S W A T P K E V S P S GGACGAGGCTCAAGCGAGACATTCGTGTTTACAAAGGACAACCTCGTGGGCAACTCCCAAGGAAGTTTCACCTTC 235 245 255 265 275 285 295 G P S L S D C P A F K D G I L K A Y H E Y K I T S G R V Y Q T V R H S R M E Y S R P T M S I R S Q A GGGCCGAGTCTATCAGACTGTCCGGCATTCAAGGATGGAATACTCAAGGCCTACCATGAGTATAAGATCACAAGC 310 320 330 340 350 360 370 I L L Q F V S E A S S T S S G S I A Y E L D P H C S Y F S S S A R P L P P P P V P S L M S W T P I A ATCTTACTTCAGTTCGTCAGCGAGGCCTCTTCCACCTCCTCCGGTTCCATCGCTTATGAGTTGGACCCCCATTGC 385 395 405 415 425 435 445 K V S S L Q S Y V N K F Q I T K G G A K T Y Q A R K Y H P S S P T S T S S K L R R A A P K L I K R G AAAGTATCATCCCTCCAGTCCTACGTCAACAAGTTCCAAATTACGAAGGGCGGCGCCAAAACTTATCAAGCGCGG 460 470 480 490 500 510 520 M I N G V E W H D S S E D Q C R I L W K G N G K S * ATGATAAACGGGGTAGAATGGCACGATTCTTCTGAGGATCAGTGCCGGATACTGTGGAAGGGAAATGGAAAATCT 535 545 555 565 575 585 595 S D P A G S F R V T I R V A L Q N P K * V D S G S TCAGATCCCGCAGGATCCTTCAGAGTCACCATCAGGGTGGCTTTGCAAAACCCCAAATAGGTAGACTCCGGATCA 610 620 630 640 650 660 670 E P G P S P GAGCCTGGTCCAAGCCCA 685 695 F i g u r e 8. N u c l e o t i d e s e q u e n c e (cDNA) a n d p r e d i c t e d a m i n o a c i d s e q u e n c e o f t h e PLRV 23 kDa a n d 17 kDa ORFs. The a m i n o a c i d s e q u e n c e o f t h e 23 kDa ORF i s shown a b o v e t h a t o f t h e 17 kDa ORF. E a c h amino a c i d d e s i g n a t i o n o c c u r s o v e r t h e f i r s t n u c l e o t i d e o f i t s codon. The s t a r t c o d o n s u s e d f o r t h e 23 kDa a n d 17 kDa ORFs are t h e f i r s t ATG c o d o n s f o l l o w i n g a s t o p c o d o n (*) i n t h e same frame. al. that  (1988a) f o r BYDV-PAV a n d i t was  s u g g e s t e d by t h e s e  a r e a d t h r o u g h o f t h e amber c o d o n may  several proline  residues  f o l l o w i n g t h e amber c o d o n ;  (P) o c c u r  occur.  i n the region  authors  In both  cases  immediately  f o r PLRV, 7 o u t o f 13 a m i n o a c i d s i n  95 this  region  are proline.  T h i s p o t e n t i a l r e a d t h r o u g h was  subsequently observed i nthe other shown t o b e e x p r e s s e d i n BYDV-PAV Although the s i m i l a r i t y  l u t e o v i r u s e s s e q u e n c e d a n d was ( W a t e r h o u s e e t al., 1 9 8 9 ) .  o f t h e p r e d i c t e d amino a c i d  s e q u e n c e s o f t h e PLRV 23 kDa p r o t e i n ORF a n d BYDV-PAV was h i g h  (47.1%),  when t h e t w o i n t a c t v i r u s e s w e r e u s e d a s  immunogens a n d a n t i g e n reactivity.  there  was a l a c k o f s e r o l o g i c a l c r o s s -  However, e x t e n s i v e  c r o s s - r e a c t i v i t y was o b s e r v e d  when d e n a t u r e d v i r u s was u s e d a s a n t i g e n 1990).  This  proteins  ( M a r t i n and D'Arcy,  s u g g e s t s t h a t t h e most v a r i a b l e r e g i o n s  of the  l u t e o v i r u s c a p s i d a r e exposed i n i n t a c t v i r i o n s . Within  t h e coat p r o t e i n coding  region,  frame, l i e s  a n o t h e r ORF o f 468 n u c l e o t i d e s  amino a c i d s  (Figure  protein of M  r  8).  17,381.  but i na different t h a t may c o d e f o r 156  T r a n s l a t i o n o f t h i s ORF w o u l d y i e l d a  BYDV-PAV  ( M i l l e r e t al., 1 9 8 8 a ) , SDV  ( M i l l e r e t al., 1988a) a n d BWYV ( V e i d t e t al., 1988) e a c h a 17 kDa p r o t e i n ORF w i t h i n t h e r e g i o n The  finding that  encoding the coat p r o t e i n .  a 17 kDa ORF o c c u r s w i t h i n t h e p u t a t i v e  p r o t e i n gene o f e a c h l u t e o v i r u s s u g g e s t s t h a t f u n c t i o n a l gene p r o d u c t . region  contain  coat  i t encodes a  The 17 kDa ORF h a s a c e n t r a l l y l o c a t e d  i n w h i c h 6 o u t o f 8 amino a c i d s a r e p r o l i n e .  This  p r o l i n e - r i c h r e g i o n may b e p a r t  of a protein conformational  that  domains.  c o u l d p r o d u c e two d i s t i n c t Miller  protein VPg  fold  e t al. (1988a) s u g g e s t e d t h a t t h e BYDV-PAV 17 kDa  i s t h e VPg because i t i ss i m i l a r i n s i z e t o t h e i s o l a t e d  o f t h e RPV s t r a i n o f BYDV  (Murphy e t  al.,  1 9 8 9 ) .  The PLRV  96  V P g i s o l a t e d b y Mayo e t al. There i s l e s s homology  (1982) h a s b e e n e s t i m a t e d  (31.1%) b e t w e e n t h e 17 kDa p r o t e i n s o f  PLRV a n d BYDV t h a n t h e r e  i s between t h e coat p r o t e i n s .  a f u n c t i o n a l p r o t e i n i s e n c o d e d by t h e 17 kDa ORF, responsible virus.  Thus, i f  i t may  be  f o r some s h a r e d b u t d i s t i n c t p r o p e r t i e s o f e a c h  O t h e r e x a m p l e s o f p l a n t RNA v i r u s e s w h i c h i n d i c a t e  extensive al.,  a s 7 kDa.  use o f o v e r l a p p i n g  1987), c a r n a t i o n m o t t l e  cucumber n e c r o s i s v i r u s  ORFs a r e s o u t h e r n b e a n m o s a i c (Wu e t virus  ( G u i l l e y e t a l . , 1985),  and  (Rochon a n d T r e m a i n e , 1989) .  4.4 E f f i c i e n c y o f the T r i p a r e n t a l Mating Procedure C o a t p r o t e i n cDNAs f r o m PLRV were i n s e r t e d i n t o t h e intermediate sites  v e c t o r , pCDXl  l o c a t e d b e t w e e n a d u p l i c a t e d CaMV 35S p r o m o t e r (Kay e t al.,  1987) a n d a NOS and  (Figure 3), at p o l y l i n k e r r e s t r i c t i o n  polyadenylation  the chimaeric  Constructs  signal.  The l i g a t i o n  genes g e n e r a t e d a r e d e s i g n a t e d  s i t e s used  i n Figure  9.  LCP 31 a n d LCP 107 were d e s i g n e d t o p r o d u c e p o s i t i v e -  sense t r a n s c r i p t s w i t h a s h o r t p o l y l i n k e r f r o m b o t h t h e pCDXl and B l u e s c r i p t M13+ of the coat introduced  vector  s e q u e n c e b e t w e e n t h e p r o m o t e r a n d t h e ATG  p r o t e i n ORF.  However, no s p u r i o u s  ATGs w e r e  a n d t h e s e q u e n c e w o u l d n o t be e x p e c t e d t o i n t e r f e r e  with t r a n s c r i p t i o n or t r a n s l a t i o n . t o LCP 107 b u t was negative-sense  Construct  inserted i n the opposite  LCP 1718 i s s i m i l a r  orientation to obtain  RNA.  F o l l o w i n g t r a n s f e r o f t h e genes i n t o pTiB6S3SE w i t h i n A.  tumefaciens  approximately  100 c o l o n i e s r e s i s t a n t t o  97 LCP 31  ATG  35S  35S  12  TAG  PLRV COAT PROTEIN  POLY A  112nt Au I  Sail 3AI  LCP 107 35S  ATG  35S  192nt  TAG  Alu I  LCP 1718 35S  35S  POLY A  112nt  PLRV COAT PROTEIN  Alu I  CTA  112nt  CAT  Njaioyd JLVOO  Ay-y  POLY A  192nt  Alu I  Alu I  F i g u r e 9. Diagrammatic r e p r e s e n t a t i o n of t h e c h i m a e r i c genes c o n s t r u c t e d t o express the PLRV coat p r o t e i n gene. The PLRV cDNA fragment i n LCP 31 possessed 12 n u c l e o t i d e s 5' t o t h e coat p r o t e i n ATG whereas LCP 107 and LCP 1718 (negative-sense) had 192 nucleotides. Each c o n s t r u c t a l s o had 112 n u c l e o t i d e s o c c u r r i n g beyond t h e amber (TAG) codon o f the coat p r o t e i n gene. Also shown are t h e d u p l i c a t e d CaMV 35S promoter and t h e NOS polyadenylation s i g n a l that provide c o n t r o l regions f o r the e x p r e s s i o n o f t h e PLRV coat p r o t e i n gene. spectinomycin,  chloramphenicol,  each t r i p a r e n t a l mating.  and kanamycin were o b t a i n e d  Each colony was capable  l i q u i d media c o n t a i n i n g the t h r e e  4.5  Plant Transformation  o f growth i n  antibiotics.  Efficiencies  Only 12 shoots were i s o l a t e d from independent c a l l i ' D e s i r e e ' tuber d i s k s i n o c u l a t e d with A. tumefaciens. were o b t a i n e d  from  from the 91 d i s k s i n o c u l a t e d with t h e A.  from 273  A l l 12  98 tumefaciens obtained leaf  c a r r y i n g the  from  disk.  produced  the tobacco  H a l f of the  calli  approximately With the  LCP  50%  e x c e p t i o n o f t h e D2 tobacco  to the  presence  of the t r a n s c r i p t  insertion  minor a l t e r a t i o n  compound l e a f l e t s  self  variably  tubers  fertilization.  and  genetically  4.6  identical  produced  RBI  segments  averaging  potato plants,  observable  or p r o t e i n .  Transgenic The  A l l RBI  variable  fused.  phenotypic gene o r  the  D2  showed a  l e a v e s were  narrower  p l a n t s were m o t t l e d  and  with the p i n n a t e l y  Each t r a n s g e n i c p o t a t o  the tobacco  gave f e r t i l e  R l progeny  by  cuttings provided  a l a r g e sample o f p h e n o t y p i c a l l y and  potato p l a n t s .  o f t r a n s g e n i c p l a n t genomic DNA  fragments of approximately  nucleotides  respectively, DNA  per  D e t e c t i o n o f PLRV cDNA i n T r a n s g e n i c P l a n t s Digestion  1300  obtained  V e g e t a t i v e l y propagated  t h e means o f m o n i t o r i n g  leaf  o f t h e PLRV c o a t p r o t e i n  L e a f m o r p h o l o g y was  viable  and  showed no  'Desiree'.  1 shoot  were  calli.  i n l e a f morphology.  i n untransformed  produced  B u r b a n k ' stem and  o f t h e number o f  and  Many more s h o o t s  transformation, averaging  'Russet  response  spindly.  construct.  w i t h t h e number o f s h o o t s  transgenic potato  than  31  Bluescript analysis  107  and  LCP  751  and  931  n u c l e o t i d e s of the  1)  indicated  and  (LCP  inserted  from  t h e pCDXl p l a s m i d .  different  III 31)  These c o n t a i n ,  A l l other nucleotides o r i g i n a t e  plasmid p o l y l i n k e r  (Plate  1718) .  nucleotides  (LCP  the  sequence.  1100  with Hind  signal  PLRV  the Southern  strengths  and  or  99 suggested the occurrence of v a r i a b l e number o f i n s e r t s i n the plants.  The tobacco l i n e T18 appeared t o have the h i g h e s t  number o f the PLRV coat p r o t e i n gene.  copy  S i m i l a r a n a l y s i s was used  t o c o n f i r m t h a t a l l p l a n t s examined except DI c o n t a i n e d the appropriate  DNA  insert.  4.7 Detection of PLRV Transcript i n Transgenic High l e v e l s of p o l y detected potato  i n northern  Plants  (A ) PLRV coat p r o t e i n t r a n s c r i p t were +  blots  (Plate 2) of tobacco T5 and T18, and  D2, RBI, RB2, RB7A, RB7B, RB16B, and RB25.  Comparison of  the s i g n a l i n t e n s i t y o f known q u a n t i t i e s o f PLRV RNA t o t h a t o f the d e t e c t e d t r a n s c r i p t suggests t h a t the t r a n s g e n i c  plants  c o n t a i n approximately 1 t o 50 ng of PLRV t r a n s c r i p t f o r each |ig of t o t a l p o l y a d e n y l a t e d 'Xanthi',  'Desiree'  RNA.  S i m i l a r a n a l y s i s of c o n t r o l  and 'Russet Burbank' showed no d e t e c t a b l e  coat p r o t e i n t r a n s c r i p t .  The LCP 31 t r a n s c r i p t s were  approximately 1000 n u c l e o t i d e s  i n l e n g t h , which i s the expected  s i z e i f the t r a n s c r i p t s have a p o l y 250 n u c l e o t i d e s .  (A ) t a i l +  of approximately  The LCP 107 and LCP 1718 t r a n s c r i p t s from  c o n s t r u c t s with a longer 5' l e a d e r sequence were approximately 1200 n u c l e o t i d e s  i n length, a l s o i n d i c a t i n g a p o l y  approximately 250 n u c l e o t i d e s .  (A ) t a i l of +  Coat p r o t e i n t r a n s c r i p t s appear  t o be most abundant i n tobacco l i n e T18 and 'Russet Burbank' l i n e RB7A.  The t r a n s c r i p t s appear t o be r e l a t i v e l y s t a b l e as l i t t l e  degradation  product was observed.  100  4.8  D e t e c t i o n o f PLRV C o a t P r o t e i n i n T r a n s g e n i c P l a n t s Although 10 i n d i v i d u a l tobacco l i n e s w i t h  positive-sense  PLRV t r a n s c r i p t were analyzed f o r coat p r o t e i n only clearly positive  (Plate 3 ) .  l i n e T18 was  This l i n e produced coat p r o t e i n at  l e v e l s approaching 0.5% o f t o t a l l e a f p r o t e i n as determined from western b l o t s with q u a n t i t a t e d  amounts o f PLRV.  possessed the same LCP 107 c o n s t r u c t  These p l a n t s  as s e v e r a l o f the other  tobacco l i n e s , but accumulated much h i g h e r l e v e l s o f p r o t e i n . Northern  (Plate 2) and Southern  (Plate 1) b l o t s  indicated  p o s s i b l y h i g h e r copy and t r a n s c r i p t l e v e l s , but these were not h i g h enough t o account f o r the d i f f e r e n c e s i n p r o t e i n l e v e l s . The  e x t r a c t i o n of phenol-soluble  proteins  removed p l a n t  m a t e r i a l t h a t i n t e r f e r e d with the r e s o l u t i o n o f p r o t e i n s s e p a r a t e d by e l e c t r o p h o r e s i s . greater  This made i t p o s s i b l e t o l o a d  amounts of p r o t e i n on p o l y a c r y l a m i d e g e l s and t o d e t e c t  lower l e v e l s o f p r o t e i n .  Among the 'Desiree'  amount o f PLRV coat p r o t e i n v a r i e d from zero  l i n e s t e s t e d , the ( i . e . undetectable  amounts) t o approximately 0.01% of the t o t a l p r o t e i n , with D2 expressing  the h i g h e s t  the t r a n s g e n i c  l e v e l s (Plate 4 ) .  The p r o t e i n produced by  p l a n t s comigrated with PLRV coat p r o t e i n  from p u r i f i e d v i r u s .  No p r o t e i n degradation was observed.  Although the t r a n s l a t i o n a l readthrough product detectable there  (Figure 8) was  by western a n a l y s i s i n p u r i f i e d PLRV samples  was no evidence f o r e x p r e s s i o n  amino acids)  subunit  of the 112 n u c l e o t i d e s  from ORF 5 (Figure 9) i n the t r a n s g e n i c  Coat p r o t e i n subunit  (Plate 5)  i n transgenic  (33  plants.  p l a n t e x t r a c t s was not  101 d e t e c t e d by E L I S A .  Thus, a l t h o u g h  i n t a c t PLRV p a r t i c l e s  d e t e c t e d by E L I S A t h e PLRV s u b u n i t e x p r e s s e d p l a n t s was virus  not.  levels  by t h e t r a n s g e n i c  T h i s p e r m i t t e d E L I S A t o be u s e d f o r s c r e e n i n g  i n PLRV-inoculated  transgenic plants.  l e v e l s of coat p r o t e i n expressed found  was  i n i n f e c t e d P. pubescens  i n T18  Since  were s i m i l a r t o  those  (Plate 3), f a i l u r e to detect  p r o t e i n s u b u n i t s i n t r a n s g e n i c p l a n t s does not appear t o c a u s e d by  the  be  low p r o t e i n l e v e l s .  Unlike v i r u s - i n f e c t e d plants, transgenic plants only coat p r o t e i n subunits or p o s s i b l y aggregates. procedure  coat  u s e d was  a triple  antibody  The  possess  ELISA  sandwich, developed  to  d e t e c t v i r u s a n t i g e n a t l o w t i t r e by t r a p p i n g w i t h a p o l y c l o n a l antiserum.  With  an i n t a c t v i r u s p a r t i c l e t h e p o l y c l o n a l b i n d s  e p i t o p e s o f some s u b u n i t s o f t h e p a r t i c l e b u t  leaves the  of other s u b u n i t s a v a i l a b l e t o the secondary  monoclonal.  However, t h e e p i t o p e o f t h e s u b u n i t s r e c o g n i z e d by t h e may  be  n o t be By  sequestered  a v a i l a b l e t o the secondary  the transgenic product  4.9  monoclonal  by t h e t r a p p i n g p o l y c l o n a l and w o u l d t h e r e f o r e  e x p l o i t i n g the a b i l i t y  monitor  epitopes  the v i r u s t i t r e  monoclonal i n the assay  used.  of the ELISA t o d i s c r i m i n a t e between  and t h e n a t i v e v i r u s i t was  possible to  i n i n o c u l a t e d t r a n s g e n i c p l a n t s by  ELISA.  PLRV R e s i s t a n c e Leaf e x t r a c t s from p l a n t s not  i n o c u l a t e d w i t h PLRV g a v e  E L I S A a b s o r b a n c e r e a d i n g s b e t w e e n 0 and i n d e p e n d e n t and  s e q u e n t i a l experiments  0.02  a t 405  nm.  Five  were u s e d t o c h a r a c t e r i z e  102 the  r e s i s t a n c e t o PLRV, 3 w i t h t r a n s g e n i c  transgenic  'Desiree'  'Russet Burbank'.  4.9.1 R e s i s t a n c e  i n Transgenic  'Desiree'  Shortly a f t e r i n o c u l a t i o n of 'Desiree' aphids,  by 5 v i r u l i f e r o u s ^  PLRV l e v e l s i n b o t h u n t r a n s f o r m e d c o n t r o l a n d t r a n s g e n i c  p l a n t s were m o n i t o r e d p e r i o d i c a l l y by E L I S A absorbance readings response curves During  and 2 w i t h  occurred  on t h e l i n e a r p o r t i o n o f t h e  and t h e r e f o r e r e p r e s e n t  the i n i t i a l  stages  (Figure 10). A l l  relative virus  of i n f e c t i o n v i r u s l e v e l s  titres.  i n the  u n t r a n s f o r m e d c o n t r o l and t r a n s g e n i c p l a n t s were s i m i l a r . i n f e c t i o n d e v e l o p e d t h e PLRV t i t r e s r a p i d l y a f t e r 30 d a y s .  i n control plants  In the transgenics the t i t r e s  As t h e  increased remained at  g e n e r a l l y l o w l e v e l s b u t a p p e a r s t o h a v e i n c r e a s e d 2 t o 3 f o l d by 40 d a y s a f t e r i n o c u l a t i o n a n d t h e n d e c r e a s e d t o l o w o r e v e n undetectable  levels.  three transgenic  The o v e r a l l r e s p o n s e was s i m i l a r  'Desiree'  lines  tested.  R e p e t i t i o n of the experiment relatively  low l e v e l  i na l l  ( F i g u r e 11) i n d i c a t e d a  of v i r u s i n the three transgenic  l i n e s and a  s i m i l a r p a t t e r n o f i n c r e a s e and d e c r e a s e i n t h e v i r u s t i t r e . average v i r u s t i t r e s t h a n 10% o f t h o s e experiments  i n t h e t r a n s g e n i c s were e s t i m a t e d  t o be l e s s  i n the untransformed c o n t r o l s i n both  ( F i g u r e s 10 a n d 1 1 ) .  Transformation  of 'Desiree'  produced a l i n e designated presence of kanamycin.  w i t h t h e LCP 31  construct  DI t h a t d e v e l o p e d s h o o t s  However, s o u t h e r n  The  i n the  analysis failed to  103 0.6  0  10  20  30  40  Days Post-inoculation  Figure  10. D e t e r m i n a t i o n o f PLRV r e s i s t a n c e i n t h e t r a n s g e n i c ' D e s i r e e ' (Experiment 1 ) . Average ELISA v a l u e s (absorbances at 405 nm) were d e t e r m i n e d f o r 18 p l a n t s o f t r a n s g e n i c ' D e s i r e e ' l i n e s D2, D7, and D8 w h i c h c o n t a i n e d t h e LCP 31 c o n s t r u c t and an untransformed c o n t r o l . P l a n t s were i n o c u l a t e d w i t h PLRV u s i n g 5 v i r u l i f e r o u s aphids. U n i n o c u l a t e d p l a n t s gave r e a d i n g s b e t w e e n 0 and 0.02 ( a b s o r b a n c e s a t 405 nm).  indicate of  the presence  o f t h e PLRV c o a t p r o t e i n  D l w i t h PLRV and t h e m o n i t o r i n g  earlier titres  f o r the other  tissue  'Desiree' l i n e s  i n t h e D l l i n e were v e r y  untransformed  control  propagation  of virus  'Desiree'  gene.  titre  Inoculation  were  conducted  (3.10.1 and 3 . 1 0 . 2 ) .  similar  t o those  (not shown),  Virus  of the  suggesting that  and t r a n s f o r m a t i o n w i t h g e n e s o t h e r t h a n t h e  104  0  10  20  30  40  50  60  70  Days Post-inoculation  F i g u r e 11. Determination of PLRV r e s i s t a n c e i n t r a n s g e n i c 'Desiree' (Experiment 2 ) . Average ELISA values (absorbances at 405 nm) were determined f o r 18 p l a n t s of t r a n s g e n i c 'Desiree' l i n e s D2, D8, and D12 which contained the LCP 31 c o n s t r u c t and an untransformed c o n t r o l . P l a n t s were i n o c u l a t e d with 5 v i r u l i f e r o u s aphids. U n i n o c u l a t e d p l a n t s gave readings between 0 and 0.02 (absorbances at 405 nm). coat p r o t e i n gene are not r e s p o n s i b l e f o r the reduced PLRV t i t r e s observed i n the t r a n s g e n i c p l a n t s e x p r e s s i n g PLRV coat p r o t e i n gene t r a n s c r i p t s .  4.9.2  E f f e c t o f I n c r e a s i n g the PLRV Inoculum  An i n c r e a s e i n the c o n c e n t r a t i o n of the PLRV inoculum d i d  105  F i g u r e 12. R e l a t i v e v i r u s accumulation i n p l a n t s a f t e r i n o c u l a t i o n w i t h PLRV u s i n g 1 ( A ) , 5 ( B ) , o r 25 (C) v i r u l i f e r o u s M. persicae. Each p o i n t r e p r e s e n t s t h e average ELISA ( a b s o r b a n c e s a t 405 nm) v a l u e s i n e i g h t p l a n t s . R e s u l t s a t e a c h i n o c u l u m l e v e l a r e r e p o r t e d f o r t h e t r a n s g e n i c ' D e s i r e e ' l i n e D12 and u n t r a n s f o r m e d c o n t r o l ' D e s i r e e ' .  106 not  overcome t h e  'Desiree' to give  observed r e s i s t a n c e achieved i n the  plants.  Inoculation with  consistent  viruliferous  quickly r e s u l t e d i n higher control plants.  v i r u l i f e r o u s aphid  (Figure  aphids  12A).  (Figure  T r a n s g e n i c D12,  transgenic  aphids.  The  p l a n t s was  12B  and  Inoculation  with  and  12C)  average v i r u s t i t r e s  Figure  i n untransformed  however, y i e l d e d s i m i l a r  a v e r a g e v i r u s t i t r e s w h e t h e r i n o c u l a t e d by viruliferous  failed  l e v e l s o f PLRV i n f e c t i o n i n t r a n s g e n i c  untransformed c o n t r o l 'Desiree' e i t h e r 5 o r 25  one  transgenic  5 o r by  25  average l e v e l of v i r u s i n  a l w a y s l e s s t h a n 10%  of t h a t  low  the in  the  controls. U s i n g 5 v i r u l i f e r o u s a p h i d s f o r i n o c u l a t i o n , 5 and 18  c o n t r o l p l a n t s escaped i n f e c t i o n i n the  second  (Figure  11)  tests, respectively.  first  Ignoring  the  escapes the  a v e r a g e and  u n t r a n s f o r m e d c o n t r o l s on t h e (first test, One  Figure  10)  and  possible explanation  that the  last  0.83  standard  ± 0.64  of these high  No  transgenic with  5 aphids per  ± 0.43  0.99  plant  (Figure  control plants  (Figure  12C).  12B).  The  and  the ±  0.53  Figure  deviations  11).  is  in different when 25  (Figure  viruliferous  12C)  plants exhibited s i m i l a r resistance to that  d e v i a t i o n f o r the 0.95  d e v i a t i o n of  standard  a p h i d s were u s e d t o i n o c u l a t e each p l a n t  10)  these  (second t e s t ,  escapes occurred  the  deviation.  s a m p l i n g d a t e was  v i r u s developed at d i f f e r e n t r a t e s  untransformed plants.  (Figure  I n c l u s i o n of  e s c a p e s r e s u l t e d i n an e x t r e m e l y l a r g e s t a n d a r d  4 of  a v e r a g e and  and observed standard  a t 80 d a y s p o s t - i n o c u l a t i o n  Infected untransformed c o n t r o l  was  plants  107 were r e a d i l y d i s t i n g u i s h e d from escapes. the  inoculated transgenic plants.  T h i s was  not t r u e f o r  While some of these were  c l e a r l y i n f e c t e d , i n some i n s t a n c e s the v i r u s t i t r e was t h a t i t was occurred.  impossible  to determine whether or not  However, there was  so  low  infection  no evidence t o suggest t h a t  the  number of escapes among the i n o c u l a t e d t r a n s g e n i c p l a n t s was h i g h e r than i n any During the with  'Desiree'  of the corresponding  initial  stages  (Figures 10,  and  12)  any  controls.  of i n f e c t i o n ,  11,  had  i n a l l experiments  v i r u s was  some i n d i v i d u a l p l a n t s but not  i n others,  they were transformed or not.  The  detected  in  r e g a r d l e s s of whether  number of c o n t r o l p l a n t s which  t e s t e d p o s i t i v e f o r PLRV i n c r e a s e d with time, but the number of t r a n s g e n i c p l a n t s which t e s t e d p o s i t i v e remained constant decreased.  or  T i t r e s i n the i n d i v i d u a l t r a n s g e n i c p l a n t s remained  low with most t i t r e s being w e l l below those i n i n d i v i d u a l c o n t r o l plants.  As the p l a n t s matured the v i r u s t i t r e s i n c o n t r o l p l a n t s  i n c r e a s e d to h i g h l e v e l s but low  or undetectable  extensive  4.9.3  l e v e l s i n the t r a n s g e n i c p l a n t s over an  growth p e r i o d of up t o 80 days.  Resistance  Resistance possessing  remained the same or decreased t o  any  was one  i n Transgenic  'Russet Burbank'  observed i n t r a n s g e n i c of the t h r e e c o n s t r u c t s  p a t t e r n of r e s i s t a n c e was  The  (Figure 13).  s i m i l a r f o r each t r a n s g e n i c  r e g a r d l e s s of c o n s t r u c t although l i n e 1-107 from the o t h e r s .  'Russet Burbank'  first  differed  The  line slightly  large increase i n v i r u s t i t r e  108  F i g u r e 13. A v e r a g e PLRV t i t r e s o f c o m b i n e d l e a f e x t r a c t s f r o m 30 ' R u s s e t B u r b a n k ' i n o c u l a t e d by 50 v i r u l i f e r o u s a p h i d s . Virus t i t r e s w e r e d e t e r m i n e d f r o m known q u a n t i t i e s o f p u r i f i e d PLRV. L e a f e x t r a c t s f r o m p l a n t s n o t i n o c u l a t e d w i t h PLRV g a v e b a c k g r o u n d l e v e l s o f l e s s t h a n 0.3 n g PLRV p e r mg o f l e a f t i s s u e . E a c h t r a n s g e n i c ' R u s s e t B u r b a n k ' l i n e c o n t a i n e d one o f t h e t h r e e coat p r o t e i n constructs. T r a n s g e n i c l i n e s RB7A a n d RB7B p o s s e s s t h e LCP 31 c o n s t r u c t , RBI a n d RB25 c o n t a i n t h e LCP 107 c o n s t r u c t , a n d RB2 a n d RB16B h a v e t h e LCP 1718 c o n s t r u c t . occurred i n both the transgenic  l i n e s and t h e  untransformed  c o n t r o l s b e t w e e n 14 a n d 28 d a y s p o s t - i n o c u l a t i o n . increase the  i n the transgenics  untransformed c o n t r o l s .  i n o c u l a t i o n the increase  was  However, t h e  l e s s t h a n 30 t o 40% o f t h a t i n  B e t w e e n 28 a n d 42 d a y s p o s t -  of v i r u s i n the untransformed  control  109 plants  slowed s l i g h t l y .  period  there  The 56  was  It i s interesting that  during  a decrease of v i r u s i n each t r a n s g e n i c  average t i t r e s  i n the  transgenics  days p o s t - i n o c u l a t i o n w h i l e  the  virus titre  in  sharply.  p o s t - i n o c u l a t i o n the  average v i r u s t i t r e  i n the  protected  lines,  8%  transgenic  of the  RB7A and  i n the  days p o s t - i n o c u l a t i o n  was  line  At  56  days  most and  least  RB7B r e s p e c t i v e l y , was  1%  The  untransformed 'Russet Burbank' at 772  a s t a n d a r d d e v i a t i o n o f 175 pattern  and  the  average l e v e l observed i n c o n t r o l p l a n t s .  average v i r u s t i t r e  The  line.  l e v e l l e d o f f b e t w e e n 42  untransformed controls continued to r i s e  and  this  of i n c r e a s e  ng PLRV p e r  mg  of l e a f t i s s u e  56 with  ng. of v i r u s t i t r e  i n the  transgenic  1-107, w h i c h e x h i b i t e d a b n o r m a l m o r p h o l o g i c a l  characteristics,  appeared to d i f f e r  other transgenics  (Figure  13).  showed a s l o w s t e a d y i n c r e a s e s i m i l a r to the pattern  l e v e l s i n the  In l i n e  The  pattern  and  t o 56  other transgenic  a b n o r m a l i t y c h a r a c t e r i s t i c of t h i s plant  patterns  1-107  b e t w e e n 14  o f v i r u s a c c u m u l a t i o n may  phloem s t r u c t u r e of the  from the  the  virus  days t o a lines.  r e s u l t from the line,  obtained  l e v e l of t r a n s c r i p t (Plate  Translation  of coat p r o t e i n cannot occur from the  transcript,  therefore  A l l ORFs on  protection the  This  were  be  transcript.  level  p a r t i c u l a r l y i f the  n e g a t i v e - s e n s e t r a n s c r i p t s and  the  titre  i s affected.  l e v e l s of p r o t e c t i o n  the  the  phenotypic  w i t h b o t h p o s i t i v e and correlated with  for  conferred  may  identical  appear  to  2). negative-sense involve  the  n e g a t i v e - s e n s e t r a n s c r i p t were l e s s  110 t h a n 100 n u c l e o t i d e s  i n length  or produce f u n c t i o n a l p r o t e i n . gives in  a n d a r e u n l i k e l y t o be t r a n s l a t e d Since  positive-sense transcript  s i m i l a r p r o t e c t i o n a n d c o a t p r o t e i n c o u l d n o t be  'Russet Burbank' t h e p o s i t i v e - s e n s e  resistance.  confer  I t i s p o s s i b l e t h a t , whatever t h e mechanism o f  resistance,  i t i s t h e same f o r b o t h p o s i t i v e - a n d n e g a t i v e - s e n s e  transcripts. expression  t r a n s c r i p t may  detected  Thus t h e c o a t p r o t e i n may n o t b e i n v o l v e d  i n the  of resistance.  P r i m a r y symptoms o f PLRV i n f e c t i o n a r e l e s s s e v e r e s e c o n d a r y symptoms a n d g r e e n h o u s e - p r o p a g a t e d p l a n t s m a n i f e s t f e w i f any d i s c e r n i b l e symptoms.  than  generally  Thus E L I S A  readings  r a t h e r t h a n symptoms were u s e d t o m o n i t o r t h e p r o g r e s s o f t h e virus  i n f e c t i o n (3.9.1).  The v i r u s l e v e l s d e t e r m i n e d b y E L I S A  indicate the p r o b a b i l i t y that transgenic  p l a n t s may become v i r u s  r e s e r v o i r s w i t h o u t e x h i b i t i n g o b s e r v a b l e symptoms. c h l o r o s i s a n d l e a f c u r l i n g were o b s e r v e d i n i n f e c t e d  Some 'Russet  Burbank' c o n t r o l s and t o a l e s s e r degree i n i n o c u l a t e d individuals.  However, t h e s e 'symptoms' o c c u r r e d  late i n the  i n f e c t i o n when t h e p l a n t s were e x t r e m e l y l a r g e a n d c o u l d r e s u l t e d from t h e growing c o n d i t i o n s . symptoms, t h e y were e x t r e m e l y m i l d , reliably  I n any c a s e , i f t h e s e w e r e  sporadic,  a n d c o u l d n o t be  f o r ' R u s s e t B u r b a n k ' were a l s o  over time f o r each i n d i v i d u a l p l a n t .  accumulated  A l l untransformed c o n t r o l  a c c u m u l a t e d PLRV t o s i m i l a r h i g h  different  have  scored.  The v i r u s t i t r e s  plants  transgenic  levels,  whereas  three  r e s p o n s e s were o b s e r v e d i n t r a n s g e n i c  plants.  Each  Ill transgenic  l i n e had  and  i n which v i r u s t i t r e s  others  levels.  In other  some p l a n t s i n w h i c h v i r u s was decreased to  i n o c u l a t i o n to lower  but  still  In c o n t r a s t w i t h the 12)  none o f t h e  escaped i n f e c t i o n ,  f o r PLRV.  accumulation  'Desiree'  The  average v i r u s t i t r e s  and  titres  42 d a y s  and  (405  the  ( F i g u r e 13)  nm)  11,  were  a preferred  rate  11,  'Desiree' and  post-inoculation.  'Desiree'  f r o m 0.135  of l e a f t i s s u e ) ,  approximately  r e d u c t i o n was  'Desiree'  aphids  of  'Russet Burbank'  i n transgenic  and  transgenic 13).  occurred 11);  and  The  90 t o 99%.  between  final  w i t h average  (corresponding  i n the t r a n s g e n i c  i n the t r a n s g e n i c Resistance  ' R u s s e t B u r b a n k ' was  between  in  virus  not  i n the  were  absorbance  t o 10  a t 56 d a y s p o s t - i n o c u l a t i o n .  90%;  A  'Russet Burbank' l i n e s lines,  t o 0.741  overall reduction i n virus t i t r e l i n e s was  13).  ( F i g u r e s 10,  the  ( F i g u r e s 10,  i n the d i f f e r e n t transgenic  ng p e r mg  (Figure  'Russet Burbank' a s i m i l a r decrease o c c u r r e d  more v a r i e d t h a n i n t h e values  post-  a l s o be  and  d a y s p o s t - i n o c u l a t i o n ( F i g u r e s 10  transgenic  days  'Desiree'.  i n both 'Desiree'  decrease i n v i r u s t i t r e  28  experiments  ' R u s s e t B u r b a n k ' may  plants followed similar patterns  58  levels  except  o f t h e v i r u s i n u n t r a n s f o r m e d ' R u s s e t B u r b a n k ' were  Protection  and  42  p e r h a p s b e c a u s e 50 v i r u l i f e r o u s  greater than i n untransformed  40  and  line,  'Russet Burbank' u n t r a n s f o r m e d c o n t r o l s  used f o r i n o c u l a t i o n . host  detectable  detected  undetectable  i n d i v i d u a l s w i t h i n each t r a n s g e n i c  1-107, t h e v i r u s l e v e l s d e c l i n e d b e t w e e n 28  and  never  and The  'Desiree'  'Russet  Burbank'  transgenic  o v e r c o m e by  62  the  high  112  F i g u r e 14. Number o f i n d i v i d u a l t r a n s g e n i c p l a n t s with s i g n i f i c a n t PLRV t i t r e s . T h i r t y t r a n s g e n i c 'Russet Burbank' from each l i n e were i n o c u l a t e d u s i n g 50 v i r u l i f e r o u s aphids and the number of p l a n t s with PLRV t i t r e s above 1 ng per mg o f l e a f t i s s u e recorded. V i r u s t i t r e s were determined from known q u a n t i t i e s of p u r i f i e d PLRV. Leaf e x t r a c t s from p l a n t s not i n o c u l a t e d with PLRV gave background l e v e l s o f l e s s than 0.3 ng PLRV per mg of l e a f t i s s u e . Transgenic l i n e s RB7A and RB7B possess the LCP 31 c o n s t r u c t , RBI and RB25 c o n t a i n the LCP 107 c o n s t r u c t , and RB2 and RB16B have the LCP 1718 c o n s t r u c t . inoculum pressures  used  (Figures 12 and 13) .  Leaf samples were taken from p o s t - i n o c u l a t i o n growth above the s i t e o f i n o c u l a t i o n .  Therefore,  the v i r u s must be capable of  r e p l i c a t i o n and appears t o be capable o f systemic the t r a n s g e n i c p l a n t s .  movement  within  Because PLRV i s c o n f i n e d t o the phloem  113 and  movement i n t h e  passive,  sieve tubes i n which the aphids  i t i s u n l i k e l y that systemic  spread  feed i s  of t h i s v i r u s i s  impaired.  4 . 1 0 PLRV T r a n s m i s s i o n from I n o c u l a t e d T r a n s g e n i c P o t a t o P l a n t s The  PLRV t r a n s m i s s i o n e f f i c i e n c y o f M.  transgenic Aphid  l i n e s o f ' R u s s e t B u r b a n k ' was  persicae  from s i x  determined  (Table  2).  t r a n s m i s s i o n o f PLRV f r o m i n f e c t e d t r a n s g e n i c p l a n t s  was  r e d u c e d and  appears to r e f l e c t the v i r u s t i t r e  The  of the v e c t o r t o t r a n s m i t the v i r u s from  ability  t r a n s g e n i c p l a n t s i n d i c a t e s t h a t the particles  and  not  simply  w i t h i n the  plant.  the  latter contain viable virus  coat p r o t e i n aggregates.  This  reduction  i n t r a n s m i s s i o n combined w i t h a r e d u c t i o n of v i r u s r e p l i c a t i o n s i s t e r transgenic plants should provide within a  effective  in  resistance  crop.  Table 2 . M. persicae transmission t r a n s g e n i c 'Russet Burbank'. Transgenic Line RB7A RB7B RBI RB25 RB2 RB16B RB C o n t r o l  1  efficiency  Transmission Efficiency 1/8 4/8 0/8 3/8 2/8 6/8 7/8  o f PLRV f r o m Construct LCP 31 LCP 31 LCP 107 LCP 107 LCP 1718 LCP 1718 Untransformed  F o u r a p h i d s w e r e t r a n s f e r r e d t o h e a l t h y P. pubescens a f t e r an a c q u i s i t i o n a c c e s s p e r i o d on t r a n s g e n i c ' R u s s e t B u r b a n k ' t h a t had b e e n p r e v i o u s l y i n o c u l a t e d w i t h PLRV u s i n g a p p r o x i m a t e l y 50 v i r u l i f e r o u s aphids. 1  114  i  A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  2.8Kb  1.1-  m  0.5-  P l a t e 1. S o u t h e r n b l o t a n a l y s i s o f H i n d I I I d i g e s t e d DNA f r o m p l a n t s t r a n s f o r m e d w i t h t h e PLRV c o a t p r o t e i n g e n e . The a u t o r a d i o g r a p h shows a H i n d I I I f r a g m e n t o f a p p r o x i m a t e l y 1100 n t i n t r a n s g e n i c t o b a c c o T5 a n d t r a n s g e n i c p o t a t o D12, D8, D7, D2, RB7A, a n d RB7B  (lanes  B,E,F,G,H,0, a n d P, r e s p e c t i v e l y ) a l l o f w h i c h w e r e t r a n s f o r m e d w i t h c o n s t r u c t LCP 3 1 . The H i n d I I I f r a g m e n t was a p p r o x i m a t e l y 1300 n t i n t r a n s g e n i c t o b a c c o T18 a n d T l ( l a n e s A a n d C) a n d t r a n s g e n i c p o t a t o R B I a n d RB25 ( l a n e s N a n d M) w h i c h p o s s e s s t h e LCP 107 construct. The H i n d I I I f r a g m e n t i n t r a n s g e n i c p o t a t o RB16B a n d RB2 ( l a n e s K a n d L) w h i c h c o n t a i n e d t h e LCP 1718 c o n s t r u c t were a l s o a p p r o x i m a t e l y 1300 n t i n length. H y b r i d i z a t i o n was n o t o b s e r v e d i n u n t r a n s f o r m e d t o b a c c o , ' D e s i r e e ' , o r 'Russet Burbank' ( l a n e s D,I, and J, r e s p e c t i v e l y ) . The b l o t was p r o b e d w i t h r a n d o m l y p r i m e d P l a b e l l e d DNA p r e p a r e d f r o m a g e l - p u r i f i e d A l u I f r a g m e n t c o n t a i n i n g t h e PLRV c o a t p r o t e i n g e n e . 32  115  Kb  A  B  C  D  E  F  G  H  I  J  K  L  9.49 4.40  * 1.35-  • -•  0.24-  P l a t e 2.  N o r t h e r n b l o t a n a l y s i s o f p o l y a d e n y l a t e d RNA f r o m p l a n t s t r a n s f o r m e d w i t h t h e PLRV c o a t p r o t e i n g e n e . A p o l y a d e n y l a t e d t r a n s c r i p t w i t h an a p p r o x i m a t e s i z e o f 1000 n t was o b s e r v e d i n t h e a u t o r a d i o g r a p h o f 0.9 \Lq o f t o t a l p o l y a d e n y l a t e d RNA f r o m t r a n s f o r m e d t o b a c c o T5, ' D e s i r e e ' D2, a n d ' R u s s e t B u r b a n k ' RB7A a n d RB7B ( l a n e s D,E,H, a n d K, r e s p e c t i v e l y ) w h i c h p o s s e s s t h e LCP 31 construct. The h o m o l o g o u s t r a n s c r i p t s o b s e r v e d i n t h e a u t o r a d i o g r a m o f 0.9 \iq o f t o t a l p o l y a d e n y l a t e d RNA f r o m t r a n s g e n i c t o b a c c o T18 a n d ' R u s s e t B u r b a n k ' R B I a n d RB25 ( l a n e s C , J , a n d G, r e s p e c t i v e l y ) w h i c h p o s s e s s t h e LCP 107 c o n s t r u c t a n d t r a n s g e n i c ' R u s s e t B u r b a n k ' RB2 a n d RB16B ( l a n e s I a n d F) w h i c h c o n t a i n t h e LCP 1718 c o n s t r u c t were s l i g h t l y l a r g e r w i t h an a p p r o x i m a t e s i z e o f 1200 n t . No h o m o l o g o u s t r a n s c r i p t was o b s e r v e d i n 0.9 \iq o f t o t a l p o l y a d e n y l a t e d RNA o f u n t r a n s f o r m e d ' D e s i r e e ' o r 'Russet Burbank' ( l a n e s B and L ) . Q u a n t i t i e s o f t r a n s c r i p t w e r e e s t i m a t e d f r o m t h e s i g n a l i n t e n s i t y f r o m 10 n g o f p u r i f i e d PLRV RNA ( l a n e A) . B l o t s were p r o b e d w i t h r a n d o m l y p r i m e d P l a b e l l e d DNA p r e p a r e d t o a g e l - p u r i f i e d A l u I f r a g m e n t c o n t a i n i n g t h e PLRV c o a t p r o t e i n g e n e . 32  116  B  H  Kd  P l a t e 3. W e s t e r n b l o t a n a l y s i s o f PLRV c o a t p r o t e i n e x p r e s s i o n i n transgenic tobacco. T o t a l p h e n o l - s o l u b l e p r o t e i n s were e x t r a c t e d f r o m t h e l e a v e s o f t r a n s g e n i c t o b a c c o T18 ( l a n e s E a n d F ) , u n t r a n s f o r m e d t o b a c c o ( l a n e s C a n d D) , and PLRV i n f e c t e d P. pubescens (lanes G and H ) . Total p r o t e i n was q u a n t i t a t e d , 150 (lg ( l a n e s C, E, a n d G) a n d 50 [ig ( l a n e s D, F, a n d H) w e r e f r a c t i o n a t e d b y e l e c t r o p h o r e s i s , b l o t t e d , a n d p r o b e d u s i n g PLRV p o l y c l o n a l and I l a b e l l e d p r o t e i n A. The b l o t a l s o shows 50 a n d 25 n g o f p u r i f i e d PLRV ( l a n e s A a n d B ) . 1 2 5  117  P l a t e 4. W e s t e r n b l o t a n a l y s i s o f PLRV c o a t p r o t e i n e x p r e s s i o n i n transgenic 'Desiree'. Total phenol-soluble proteins were e x t r a c t e d f r o m t h e l e a v e s o f t r a n s g e n i c ' D e s i r e e ' D2, D7, D8, D12, u n t r a n s f o r m e d ' D e s i r e e ' , a n d PLRV i n f e c t e d P. pubescens ( l a n e s B,C,D,E,A, a n d F, r e s p e c t i v e l y ) . T o t a l p r o t e i n was q u a n t i t a t e d , 150 Jig l o a d e d p e r l a n e , separated, b l o t t e d and p r o b e d u s i n g PLRV m o n o c l o n a l 371A a n d I l a b e l l e d goat anti-mouse. The b l o t a l s o shows 20 n g o f p u r i f i e d PLRV ( l a n e G ) . 1 2 5  118  Kd  A  B  65-  2 3 -  P l a t e 5 . W e s t e r n b l o t a n a l y s i s o f p u r i f i e d PLRV. A b l o t o f 1 [ig a n d 100 n g o f p u r i f i e d PLRV ( l a n e s A a n d B) s h o w i n g b o t h t h e 23 kDa c o a t p r o t e i n a n d t h e 65 kDa p u t a t i v e t r a n s l a t i o n a l r e a d t h r o u g h p r o d u c t . B l o t s were p r o b e d w i t h PLRV p o l y c l o n a l a n d I l a b e l l e d p r o t e i n A. 1 2 5  119  GENERAL DISCUSSION  V.  The p o t a t o l e a f r o l l i n s e r t e d i n t o tobacco e t al.,  v i r u s c o a t p r o t e i n gene was s u c c e s s f u l l y  and t h e p o t a t o c u l t i v a r s  1990) a n d ' R u s s e t  Burbank'.  High  'Desiree'  (Kawchuk  levels of sustained  r e s i s t a n c e t o PLRV i n f e c t i o n w e r e o b t a i n e d i n t h e p o t a t o cultivars. al.,  I n v e s t i g a t i o n s of other p l a n t v i r u s e s (Powell Abel et  1 9 8 6 ; Turner e t al.,  1 9 8 7 ; L o e s c h - F r i e s e t al.,  e t al.,  1 9 8 7 ; Hemenway e t al.,  e t al.,  1 9 8 8 ; V a n Dun a n d B o l , 1 9 8 8 ; S t a r k a n d B e a c h y , 1 9 8 9 ; a n d  L a w s o n e t al.,  1 9 8 8 ; C u o z z o e t al.,  1 9 8 7 ; V a n Dun  1990) h a v e d e m o n s t r a t e d  resistance to infection i n  p l a n t s e x p r e s s i n g s p e c i f i c coat p r o t e i n genes. r e s i s t a n c e t o PLRV o b s e r v e d similar  i nthis  1 9 8 8 ; V a n Dun  However, t h e  s t u d y may b e u n i q u e  i n that  l e v e l s o f r e s i s t a n c e were o b t a i n e d w i t h p o s i t i v e - and  negative-sense  RNA.  L e v e l s o f PLRV c o a t p r o t e i n t r a n s c r i p t s were r e l a t i v e l y in the transgenic plants  ( P l a t e 2) a s was p r e d i c t e d u s i n g t h e  d u p l i c a t e d CaMV 35S p r o m o t e r f o r t r a n s c r i p t i o n . p r o t e i n represented l e s s than t r a n s g e n i c p l a n t s except expressed  0.01% o f t o t a l  t r a n s g e n i c tobacco  c o a t p r o t e i n a t 0.5% o f t o t a l  The c o a t p r o t e i n a c c u m u l a t e d infected plants  high  (Plate 3).  However,  leaf protein i n a l l T18-107  leaf protein  t o approximately The l o w l e v e l  coat  which (Plate 3 ) .  0.5% i n PLRV  of coat p r o t e i n i n the  t r a n s g e n i c s may b e a r e s u l t o f l o w t r a n s l a t i o n a l e f f i c i e n c y o f c o a t p r o t e i n RNA b u t t h i s  seems u n l i k e l y  r e l a t i v e l y h i g h e x p r e s s i o n i n T18-107.  i n view  of the  The s e q u e n c e s u r r o u n d i n g  the  PLRV c o a t  normally  p r o t e i n AUG  l a c k s c e r t a i n consensus  associated with high  c o d o n t h e r e f o r e may  not  l e v e l s o f t r a n s l a t i o n and  promote h i g h  L u t c k e e t al.,  ( K o z a k , 1986;  same s e q u e n c e .  region  5'  1987).  However t h i s d o e s  translation  of the  included only untranslated the  LCP  107  12 n u c l e o t i d e s region adjacent  i s that the  construct  from t h i s  construct with a longer  197  coat 5'  e x p e c t e d t o be  (Figure  p r o t e i n ORF.  However, give other  a r e s u l t of the p r o t e i n subunit  detectable  in  vivo  occurs,  guarantee expression I f the a b l e t o do specific  coat  lines.  transgenic potato p r o t e i n was  phloem observed  would  be  Although  o f t h e PLRV  the coat  the presence of t r a n s c r i p t i t s e l f  of d e t e c t a b l e  l e v e l s of coat  protein i s imparting  so a t e x t r e m e l y l o w cells  and  levels  being  However, t h e  degradation  stable i n a l l transgenic  l e v e l s o f PVX  A line and  not  protein.  l e v e l s o r p o s s i b l y be  low  did  r e s i s t a n c e t h e n i t must  s u c h as t h o s e o f t h e p h l o e m . expressing  9)  nucleotide  r e s u l t s demonstrated c l e a r l y that expression  in  31  o r s t a b l e o n l y w i t h i n s p e c i f i c t i s s u e s s u c h as  p r o t e i n showed no  protein  LCP  A l t e r n a t i v e l y , low  c e l l s to which n a t i v e v i r u s i s confined. coat  efficient  l e v e l s of t r a n s c r i p t or p r o t e i n i n  be  has  untranslated  l e a d e r d i d not  l i n e s of tobacco or p o t a t o .  o f c o a t p r o t e i n may unstable  The  to the  start  not  which presumably  protein i s necessary for  coat p r o t e i n .  consistently higher transgenic  RNA  Another p o s s i b i l i t y  t o t h e PLRV c o a t  the  l e v e l s of t r a n s l a t i o n  i n h i b i t t r a n s l a t i o n from n a t i v e v i r a l the  sequences  PVY  more r e s i s t a n t t o w a r d s t h e s e v i r u s e s t h a n  be  concentrated of coat other  121 transgenic  l i n e s t h a t expressed h i g h e r  (Lawson e t al., 1990).  l e v e l s o f coat p r o t e i n  Tobacco e x p r e s s i n g  t h e CMV coat p r o t e i n  at l e v e l s as low as 0.001% of t o t a l l e a f p r o t e i n showed a r e d u c t i o n i n v i r u s accumulation and i n the number o f i n f e c t e d p l a n t s both o f which were independent o f t h e inoculum concentration  (Cuozzo et al., 1988).  At t h i s time t h e p o s s i b i l i t y cannot be e l i m i n a t e d t h a t undetectably  low l e v e l s of coat p r o t e i n may be r e s p o n s i b l e f o r  i n t e r f e r i n g with v i r u s r e p l i c a t i o n .  Even the negative-sense  c o n s t r u c t c o u l d produce coat p r o t e i n i f t h e CaMV enhancer a s s i s t e d t r a n s c r i p t i o n from TATA sequences w i t h i n t h e PLRV construct.  However, t h e o b s e r v a t i o n  t h a t each t r a n s g e n i c  plant  appears t o produce only a s i n g l e PLRV coat p r o t e i n t r a n s c r i p t ( P l a t e 2) i n d i c a t e s t h a t t h e CaMV enhancer does not enhance t r a n s c r i p t i o n from spurious sequences. untranslated  TATA sequences found w i t h i n PLRV cDNA  However, a TATA sequence  (Figure 7) found w i t h i n the  l e a d e r sequence 5' t o the coat p r o t e i n s t a r t  codon  c o u l d p o s s i b l y serve as a f u n c t i o n a l TATA and i t s t r a n s c r i p t would only be approximately 80 n u c l e o t i d e s  s h o r t e r than t h e  t r a n s c r i p t produced by the CaMV 35S promoter. Another q u e s t i o n  of i n t e r e s t i s t h e p o s s i b l e r o l e o f t h e 17  kDa ORF i n mediating r e s i s t a n c e .  The 17 kDa ORF i s nested  the PLRV coat p r o t e i n gene so t h a t a l l t r a n s g e n i c  within  plants  c o n t a i n i n g t h e PLRV coat p r o t e i n gene a l s o c o n t a i n t h e 17 kDa ORF (Figure 8 ) .  Although e x p r e s s i o n  o f t h i s gene remains t o be  s u b s t a n t i a t e d and i t s f u n c t i o n determined, i t i s thought t o  122 e n c o d e t h e PLRV VPg.  The  presence  o f t h e 17 kDa  ORF  ina l l  l u t e o v i r u s e s s e q u e n c e d s u g g e s t s t h a t i t i s e x p r e s s e d and an i m p o r t a n t f u n c t i o n i n l u t e o v i r u s i n f e c t i o n . e x a m p l e o f i n s e r t i o n o f t h e 17 kDa plants, cannot  and be  ruled  This i s the  p r o t e i n ORF  i t s p o s s i b l e involvement  i n p r o t e c t i o n a g a i n s t PLRV  out.  a c h i e v e d by t h e c o a t p r o t e i n gene t r a n s c r i p t , some s t a g e o f v i r a l  demonstrated  first  into transgenic  A l t e r n a t i v e l y , p r o t e c t i o n i n t r a n s g e n i c p l a n t s may  at  serves  replication.  be  w h i c h may  Other workers  interfere  have  virus protection i n transgenic plants expressing  n e g a t i v e - s e n s e c o a t p r o t e i n t r a n s c r i p t b u t a t much l o w e r  inoculum  l e v e l s t h a n t h e p r o t e c t i o n o b t a i n e d from p o s i t i v e - s e n s e transcript  and  i t s coat p r o t e i n product.  transgenic tobacco PVX  expressing negative-sense t r a n s c r i p t of  c o a t p r o t e i n gene  transcript  o f CMV  Examples i n c l u d e  (Hemenway e t a l . ,  (Cuozzo  e t al.,  1988)  and  negative-sense  1988).  B o t h PLRV p o s i t i v e - and n e g a t i v e - s e n s e t r a n s c r i p t  from  transgenic p l a n t s could conceivably sequester the opposite viral  RNA.  One  recognition,  o r t h e o t h e r may  replication,  s u b g e n o m i c m e s s e n g e r RNA.  interfere with  The  replication.  could  thereby  These p o s s i b l e  t h e r a t e o f v i r u s i n f e c t i o n and  d i f f e r e n t degrees  sense  replicase  negative-sense t r a n s c r i p t  preventing coat p r o t e i n synthesis. limit  the  or p o s s i b l y the p r o d u c t i o n of  i n h i b i t t r a n s l a t i o n o f p o s i t i v e - s e n s e v i r u s RNA  may  the  mechanisms,  replication  but would not c o m p l e t e l y i n h i b i t  to  viral  However, s i n c e t h e l e v e l s o f p o s i t i v e -  and  123 negative-sense v i r a l of RNA  infection i s being  RNA  are probably d i f f e r e n t d u r i n g the  course  a s i m i l a r p a t t e r n o f r e s i s t a n c e seems u n l i k e l y i f sequestered.  Another p o s s i b i l i t y  i s t h a t the u n t r a n s l a t e d l e a d e r sequence  5' t o t h e c o a t p r o t e i n s e q u e s t e r s t h e v i r a l  replicase.  This,  however, would o n l y o c c u r w i t h n e g a t i v e - s e n s e t r a n s c r i p t would not account  f o r t h e s i m i l a r p a t t e r n o f PLRV  o b s e r v e d w i t h b o t h p o s i t i v e - and n e g a t i v e - s e n s e (Figure 12).  and  resistance  transcripts  I t i s p o s s i b l e t h a t t h e m e c h a n i s m o f PLRV  resistance i n transgenic plants expressing positive-sense transcript differs transcript.  The  from t h a t o b t a i n e d w i t h the  p r e c i s e m e c h a n i s m s by w h i c h s u s t a i n e d v i r u s  i n f e c t i o n a r e c o n t r o l l e d r e m a i n s t o be In  elucidated.  o r d e r t o e s t a b l i s h an i n f e c t i o n  PLRV h a s t o be ribosomes, s e n s e RNA  able to enter a c e l l ,  become t r a n s l a t e d by  occur.  i n c l u d i n g t h e p r o d u c t i o n o f s u b g e n o m i c RNA.  The  and r e a d t h r o u g h p r o t e i n a r e p r o b a b l y  PLRV  expressed  Encapsidation of the  and t r a n s p o r t o f t h e v i r u s t h r o u g h t h e p h l o e m a l s o must  The  transcript  t r a n s g e n i c p l a n t s may  or t r a n s l a t i o n a l product produced i n the i n t e r f e r e w i t h one  during the i n f e c t i o n process.  o r more o f t h e s e  D e t e r m i n a t i o n o f PLRV RNA  and w h e t h e r t h e y c o r r e s p o n d t o t h e l e v e l  of whole v i r u s  w i t h i n the transgenic p l a n t s could help understand of  host  positive-  f r o m t h e t r a n s l a t i o n o f a s u b g e n o m i c RNA. RNA  i n transgenic plants,  and u n d e r g o r e p l i c a t i o n o f n e g a t i v e - and  c o a t p r o t e i n , VPg,  viral  negative-sense  t h e PLRV  resistance.  stages levels  observed  t h e mechanism  124 E a c h PLRV c o n s t r u c t additional  112  termination  examined  ( F i g u r e 9)  n u c l e o t i d e s b e y o n d t h e PLRV c o a t  codon.  The  112  nucleotides  gene w e r e i n c l u d e d b e c a u s e o f t h e restriction constructs if  the  site.  not  coat  (Martin et a l . , 1990).  observed i n western a n a l y s i s  only  5'  t o t h e AUG  I  positive-sense sequence  i s thought to occur i n  The  readthrough product 4)  of  was  the  coat  i n t e r v e n i n g sequence.  T h i s was  i t was  may  the  with very  in  little effect that  leader  on  s e q u e n c e has  translation. has  a VPg  necessitate a particular  s t r a t e g y which would not P o l i o v i r u s w h i c h has  a 5' VPg  (Pelletier  a d e n o s i n e and  and  l i n k e d t o i t s 5' (Mayo e t  terminus.  terminus uses a s t r a t e g y t o t h e AUG  Sonenberg, 1988).  u r i d i n e content  al.,  translational  r e q u i r e a c a p p e d 5'  i n i t i a t i o n o f r i b o s o m e s 5'  l a n d i n g pads"  including  p o s s i b l e t o keep  i s o b s e r v e d w i t h PLRV g e n o m i c RNA  1 9 8 2 ) , t h e VPg  By  done t o o b s e r v e t h e  I f PLRV s u b g e n o m i c m e s s e n g e r RNA t e r m i n u s as  t o t h e AUG.  p r o t e i n ORF  absence of the u n t r a n s l a t e d  t r a n s c r i p t i o n and  5'  transcription initiation site  c l o s e p r o x i m i t y t o the  of high  o f an A l u  ( P l a t e s 3 and  untranslated nucleotides  12 n u c l e o t i d e s  internal  protein  w i t h t h e PLRV c o a t p r o t e i n gene w e r e e i t h e r  d u p l i c a t e d CaMV p r o m o t e r and  the  amber  plants.  Inserted along o r 192  coat  p r o t e i n readthrough  amber c o d o n were s u p p r e s s e d , as  transgenic  12  availability  an  p r o t e i n ORF  3' t o t h e  T r a n s c r i p t s from b o t h  could t r a n s l a t e the  native virus  includes  which are  using  of "ribosomal  These a r e similar to  regions those  125 i n t h e PLRV c o a t sequence  p r o t e i n 5' u n t r a n s l a t e d  192 n u c l e o t i d e  ( F i g u r e 7 ) . The p r e s e n c e o f t h i s  untranslated  leader  produce higher  192 n u c l e o t i d e  s e q u e n c e 5' t o t h e AUG d i d n o t c o n s i s t e n t l y  l e v e l s o f PLRV c o a t  protein.  P r e s e n c e o f t h e PLRV t r a n s c r i p t a n d PLRV c o a t not  leader  protein d i d  r e s u l t i n symptoms i n t r a n s g e n i c p l a n t s g r o w n i n a  greenhouse.  However, symptoms a r e n o t u s u a l l y d e t e c t e d i n  g r e e n h o u s e p l a n t s w i t h a p r i m a r y PLRV i n f e c t i o n  a n d s u c h was t h e  case f o r b o t h t h e untransformed c o n t r o l s and t h e t r a n s g e n i c s . Field trials  w i l l be n e c e s s a r y t o d e t e r m i n e i f t h e p r e s e n c e o f  t h e PLRV c o a t p r o t e i n t r a n s c r i p t a n d t h e c o a t p r o t e i n p r o d u c e any symptoms o f p o t a t o infection.  leafroll  Field trials  whether t r a n s g e n i c  disease  will  required t o evaluate plants.  Potato  leafroll  a l s o be r e q u i r e d t o d e t e r m i n e  plants display a reduction  symptom-free f o l l o w i n g v i r a l  transgenic  i n t h e absence o f v i r u s  yield  differs  infection.  o f symptoms o r a r e  Such t r i a l s  i n both PLRV-infected  from other  will  a l s o be  and PLRV-free  v i r u s e s t o which  g e n e t i c a l l y e n g i n e e r e d r e s i s t a n c e has been d e v e l o p e d i n t h a t i t is  a phloem-limited  have t h e a b i l i t y in  vitro  Although t h e l u t e o v i r u s e s appear t o  t o r e p l i c a t e i n c e l l s other  ( T a k a n a m i a n d Kubo, 1 9 7 9 ; B a r n e t t  are normally construct  virus.  than phloem t i s s u e  e t al.,  u n a b l e t o move o u t o f t h e p h l o e m .  A  1981),  they  chimaeric  w i t h t h e CaMV 35S p r o m o t e r h a s b e e n shown t o be  t r a n s c r i b e d a n d t r a n s l a t e d i n many c e l l t y p e s i n a d d i t i o n t o phloem c e l l s  i n transgenic plants  ( B e n f e y e t al.,  1989).  126 However, s i n c e PLRV i s c o n f i n e d t o t h e p h l o e m , t h e i n t e r a c t i o n b e t w e e n PLRV and the  transgenic  plant product i s probably  to  phloem. Luteovirus  leaves  on t h e  l e v e l s have been r e p o r t e d  same p l a n t  ( P e r e i r a and  p l a n t s showed an  d e c l i n e which occurred (Figures  10,  11,  concentration, reported  and  13).  a f t e r r e p l i c a t i o n has  increased  not  F r i e s e t al.,  1987;  C u o z z o e t a l . , 1988; and  in virus titre  Van  Dun  Van  Dun and  1986;  e t al.,  coat  An  f o l l o w e d by  1987;  not  been  infection 1987;  Loesch-  Hemenway e t al., Van  Dun  1990).  and  Bol,  The  decline in  r a t e o f v i r u s r e p l i c a t i o n does  initial  1988; 1988;  a p e r i o d of r a p i d p l a n t not  l e v e l of v i r u s i n a l l t i s s u e s .  decline i n certain transgenic  lines  account f o r s u c h as  the  RB7A  13). increase  a  p r o t e i n genes.  Turner e t al.,  However, i t seems u n l i k e l y t h a t t h i s a l o n e c a n  (Figure  has  symptoms o f  Lawson e t al.,  appears t o occur during  permit maintenance of the  occurred,  e t a l . , 1988;  growth, p o s s i b l y because the  continued  the  t r a n s g e n i c p l a n t became i n f e c t e d ,  e t al.,  B e a c h y , 1989;  PLRV t i t r e  harvested  Virus levels in  other v i r a l  as e f f e c t i v e and  (Powell Abel  were  an  This p a t t e r n of d e c l i n e i n v i r u s  v i r u s e s , once t h e  r e s i s t a n c e was  In  f r o m 28 t o 45 d a y s f o l l o w i n g i n o c u l a t i o n  i n plants expressing  With other  Stark  increase  among d i f f e r e n t  1989).  leaves  from every p l a n t at each sampling date. transgenic  to vary  Lister,  a t t e m p t t o m i n i m i z e s a m p l i n g e r r o r s two  the  confined  i n the  observed r e s i s t a n c e .  level  o f PLRV i n o c u l u m d i d n o t  S i m i l a r inoculum  overcome  concentration-  127 i n d e p e n d e n t p r o t e c t i o n has al.,  1988)  plants,  and  SMV  a l s o been r e p o r t e d  ( S t a r k and  Beachy, 1989).  s i m i l a r to those i n o c u l a t e d i n the  f o r CMV  (Cuozzo  Young  et  potato  experiments  described  i n t h i s t h e s i s , a r e t h e most s u s c e p t i b l e t o PLRV i n f e c t i o n ( K n u t s o n and with  25  Bishop,  o r 50  viruliferous  t h a t w o u l d be ability  The  high  transgenic  e x c l u d e d from every t r a n s g e n i c levels.  yield  in a field  aphid and  plant,  transmission  standpoint  o f PLRV and  q u a l i t y of tubers.  determine i f such r e s i s t a n c e p r o t e c t s  against  reduce  w i l l be net  which i s the  persicae,  PLRV i n t h e expression  field.  mechanical i n o c u l a t i o n .  aphid  level  its  natural vectors.  or  improvement required  to  necrosis,  f o r the  s t u d i e s of v i r a l  p l a n t s have c h a l l e n g e d  coat  viruliferous spread  of  protein  the p l a n t s  using  While mechanical i n o c u l a t i o n allows i n o c u l u m i t may  o f p r o t e c t i o n o b s e r v e d when t h e An  a  a l t e r s the  responsible  more p r e c i s e q u a n t i t a t i o n o f t h e the  or  field.  Most o t h e r  i n transgenic  low  adoption of  I n t h e s e e x p e r i m e n t s p l a n t s were i n o c u l a t e d by M.  not  r e s u l t i n an  a f f e c t s y i e l d or q u a l i t y , or s i g n i f i c a n t l y e p i d e m i o l o g y o f PLRV i n t h e  offer a  could  Field trials  The  under  i t declined to very  l i n e of potato  levels  situation.  A l t h o u g h v i r u s was  From a p r a c t i c a l  suitable resistant transgenic  in  than the  i n o c u l u m l e v e l s i n d i c a t e s t h a t t h e y may  undetectable  obtained  plants to achieve resistance  p r a c t i c a l means o f v i r u s c o n t r o l .  eliminate  inoculum l e v e l s  a p h i d s a r e much h i g h e r  o b s e r v e d on y o u n g p l a n t s  of the  these high  1964).  aphid  transmitted  not  for  result in  virus i s transmitted virus i s deposited  by at  128 a low l e v e l  on a l e a f b a s i s , b u t a t t h e c e l l u l a r  i n o c u l u m may be a t a much h i g h e r by m e c h a n i c a l t r a n s m i s s i o n . transgenic provide  concentration  level the  than that  Thus, v i r u s t r a n s m i s s i o n  p l a n t s by t h e n a t u r a l v e c t o r  obtained  to  w o u l d be e x p e c t e d t o  the best i n d i c a t i o n of the effectiveness of g e n e t i c a l l y  engineered resistance i n the f i e l d . As  a g r o u p , t h e l u t e o v i r u s e s p o s s e s s many u n i q u e  characteristics.  Their  spherical p a r t i c l e s are l i m i t e d t o the  phloem and a r e u s u a l l y t r a n s m i t t e d a circulative, titre  by a s p e c i f i c  n o n - p r o p a g a t i v e manner.  T h e s e c h a r a c t e r i s t i c s make PLRV d i f f i c u l t  conditions aphid  may p r o v i d e  practical  are s a t i s f i e d :  vector,  a l l e v i a t i o n o f symptoms a n d i n c r e a s e d  i n virus transmission  Genetic  yields,  and  o f t h e phloem i n t u b e r s . indicates that  was o b t a i n e d  a significant  i n the transgenic  (Table 2 ) .  Cross-protection  has been r e p o r t e d  i n c l u d i n g t h e l u t e o v i r u s PLRV 1958) .  to control.  resistance i fthe following  Evidence from t h e greenhouse s t u d i e s  plants  i n y i e l d and q u a l i t y .  d e c r e a s e d a c q u i s i t i o n o f v i r u s by t h e  decreased i n t e r n a l net necrosis  reduction  species i n  The v i r u s e s o c c u r a t l o w  b u t can cause s e r i o u s economic l o s s e s  engineering  aphid  f o r many p l a n t  (Webb e t a l . , 1 9 5 2 ; H a r r i s o n ,  When c r o s s - p r o t e c t i o n o c c u r s t h e i n d u c e r  a f t e r inoculation with the challenge observed.  viruses  virus persists  v i r u s and t h e l a t t e r  i s not  A n o t h e r phenomenon t e r m e d m u t u a l e x c l u s i o n , w h e r e two  o r more v i r u s e s a r e i n o c u l a t e d a t t h e same t i m e a n d l o c a t i o n , results  i n an i n c r e a s e  i n b o t h v i r u s e s f o l l o w e d by t h e  129 disappearance of both viruses  ( J e d l i n s k i and Brown, 1965).  r e s p o n s e o b s e r v e d i n t h e PLRV r e s i s t a n t t r a n s g e n i c  plants  The may  r e s e m b l e e i t h e r o f t h e a b o v e phenomena. An u n d e r s t a n d i n g o f t h e m e t h o d o f p r o t e c t i o n o p e r a t i n g i n PLRV r e s i s t a n t t r a n s g e n i c  plants could  l e a d t o an u n d e r s t a n d i n g  o f t h e mechanisms i n v o l v e d i n c r o s s - p r o t e c t i o n , m u t u a l and  virus replication,  of c o n t r o l of other  a n d t o an u n d e r s t a n d i n g o f t h e m e c h a n i s m s  viruses.  Further  modifications  i n s e r t e d gene c o u l d be made t o i n c r e a s e transcript  virus  et al.,  1989; K e e s e e t al.,  (Mayo e t al.,  e t al.,  1988a) i t i s l i k e l y t h a t t h i s  i n the experiments described attempts t o obtain  1989; Van d e r  1990), beet w e s t e r n  ( V e i d t e t a l . , 1988), and b a r l e y y e l l o w  (Miller  the l e v e l s of  In view o f t h e s i m i l a r i t y between t h e three  l u t e o v i r u s e s s e q u e n c e d t o d a t e , PLRV Wilk  of the  or decrease the l e v e l s of  o r c o a t p r o t e i n and p e r h a p s i n c r e a s e  resistance obtained.  exclusion,  dwarf  yellows virus-PAV  strategy  emphasized  i n t h i s t h e s i s w i l l be u s e d i n  resistance with other  luteoviruses.  130  BIBLIOGRAPHY A n g e n e n t , G . C , V a n Den O u w e l a n d , J.M.W., a n d B o l , J . F . 1990. S u s c e p t i b i l i t y t o v i r u s i n f e c t i o n o f transgenic tobacco plants e x p r e s s i n g s t r u c t u r a l and n o n s t r u c t u r a l genes o f t o b a c c o r a t t l e virus. V i r o l o g y 175:191-198. A v i v , H., a n d L e d e r , P. 1 9 7 2 . P u r i f i c a t i o n o f b i o l o g i c a l l y a c t i v e g l o b i n m e s s e n g e r RNA b y c h r o m a t o g r a p h y on o l i g o t h y m i d y l i c acidc e l l u l o s e . P r o c . N a t . A c a d . S c i . USA 6 9 : 1 4 0 8 - 1 4 1 2 . B a g n a l l , R.H. 1 9 8 8 . E p i d e m i c s o f p o t a t o l e a f r o l l i n N o r t h America and Europe l i n k e d t o drought and sunspot c y c l e s . Can. J . P l a n t P a t h o l . 10:192-202. B a i l e y , J.M., a n d D a v i d s o n , N. 1 9 7 6 . M e t h y l m e r c u r y a s a r e v e r s i b l e d e n a t u r i n g agent f o r agarose g e l e l e c t r o p h o r e s i s . A n a l . Biochem. 70:75-85. B a r b a r a , D . J . , K a w a t a , E.E., Ueng, P.P., L i s t e r , R.M., a n d L a r k i n s , B.A. 1 9 8 7 . P r o d u c t i o n o f cDNA c l o n e s f r o m t h e MAV i s o l a t e o f b a r l e y y e l l o w d w a r f v i r u s . J . Gen. V i r o l . 6 8 : 2 4 1 9 2427. B a r k e r , H., a n d H a r r i s o n , B.D. 1 9 7 8 . D o u b l e i n f e c t i o n , i n t e r f e r e n c e and s u p e r i n f e c t i o n i n p r o t o p l a s t s exposed t o two s t r a i n s o f r a s p b e r r y r i n g s p o t v i r u s . J . Gen. V i r o l . 4 0 : 6 4 7 - 6 5 8 . B a r n e t t , A., Hammond, J . , a n d L i s t e r , R.M. 1 9 8 1 . L i m i t e d i n f e c t i o n o f c e r e a l l e a f p r o t o p l a s t s by b a r l e y y e l l o w dwarf virus. J . Gen. V i r o l . 5 7 : 3 9 7 - 4 0 1 . Baughman, G.A., J a c o b s , J.D., a n d H o w e l l , S.H. 1 9 8 8 . C a u l i f l o w e r m o s a i c v i r u s gene V I p r o d u c e s a s y m p t o m a t i c p h e n o t y p e i n transgenic tobacco p l a n t s . P r o c . N a t l . A c a d . S c i . USA 8 5 : 7 3 3 737. B a u l c o m b e , D.C., S a u n d e r s , G.R., B e v a n , M.W., Mayo, M.A., a n d H a r r i s o n , B.D. 1 9 8 6 . E x p r e s s i o n o f b i o l o g i c a l l y a c t i v e v i r a l s a t e l l i t e RNA f r o m t h e n u c l e a r genome o f t r a n s f o r m e d p l a n t s . N a t u r e 321:446-449. B e a c h y , R.N., L o e s c h - F r i e s , protein-mediated resistance Phytopathol. 28:451-474.  S., a n d Turner, N.E. 1 9 9 0 . C o a t a g a i n s t v i r u s i n f e c t i o n . Annu. Rev.  B e n f e y , P.N., R e n , L., a n d Chua, N.-H. 1 9 8 9 . The CaMV.35S enhancer c o n t a i n s a t l e a s t two domains w h i c h c a n c o n f e r d i f f e r e n t developmental and t i s s u e - s p e c i f i c expression p a t t e r n s . EMBO J o u r n a l 8:2195-2202.  131 B e r g e r , P.H., H u n t , A.G., D o m i e r , L.L., H e l l m a n n , G.M., S t r a m , Y., T h o r n b u r y , D.W., a n d P i r o n e , T.P. 1 9 8 9 . E x p r e s s i o n i n t r a n s g e n i c p l a n t s o f a v i r a l gene p r o d u c t t h a t m e d i a t e s i n s e c t t r a n s m i s s i o n o f p o t y v i r u s e s . P r o c . N a t l . A c a d . S c i . USA 8 6 : 8 4 0 2 8406. B e r r y , R., a n d S i m p s o n , R.G. 1 9 6 7 . F l i g h t a c t i v i t i e s o f t h e green peach aphid. C o l o r a d o S t a t e U n i v . Tech. B u l l . 92. B e v a n , M.W., Mason, S.E., a n d G o e l e t , P. 1 9 8 5 . E x p r e s s i o n o f tobacco mosaic v i r u s coat p r o t e i n by a c a u l i f l o w e r mosaic v i r u s p r o m o t e r i n p l a n t s t r a n s f o r m e d b y Agrobacterium. EMBO J o u r n a l 4:1921-1926. B i s h o p , G.W., a n d G u t h r i e , J.W. 1 9 6 4 . Home g a r d e n s a s a s o u r c e of t h e green peach aphid and v i r u s d i s e a s e s i n Idaho. Amer. P o t a t o J . 41:28-34. B r a d f o r d , M.M. 1976. A r a p i d and s e n s i t i v e method f o r t h e q u a n t i t a t i o n o f microgram q u a n t i t i e s o f p r o t e i n u t i l i z i n g t h e p r i n c i p l e o f p r o t e i n dye b i n d i n g . A n a l . Biochem. 72:248-254. Cadman, C.H., a n d H a r r i s o n , B.D. 1 9 5 9 . S t u d i e s on t h e p r o p e r t i e s o f s o i l - b o r n e v i r u s e s o f t h e t o b a c c o - r a t t l e type occurring i n Scotland. Ann. A p p l . B i o l . 47:542-556. C a s p e r , R. 1 9 7 7 . D e t e c t i o n o f p o t a t o l e a f r o l l v i r u s i n p o t a t o and Physalis floridana by enzyme-linked immunosorbent assay (ELISA). P h y t o p a t h o l . Z. 9 0 : 3 6 4 - 3 6 8 . C e c h , T.R. 1 9 8 7 . The c h e m i s t r y o f s e l f - s p l i c i n g RNA a n d RNA enzymes. S c i e n c e 236:1532-1539. C u o z z o , M., O ' C o n n e l l , K.M., K a n i e w s k i , W., F a n g , R.-X., Chua, N.-H., a n d Turner, N.E. 1 9 8 8 . V i r a l p r o t e c t i o n i n t r a n s g e n i c t o b a c c o p l a n t s e x p r e s s i n g t h e cucumber m o s a i c v i r u s c o a t p r o t e i n o r i t s a n t i s e n s e RNA. B i o / T e c h n o l o g y 6:549-557. D ' A r c y , C . J . , T o r r a n c e , L., a n d M a r t i n , R.R. 1 9 8 9 . D i s c r i m i n a t i o n among l u t e o v i r u s e s a n d t h e i r s t r a i n s b y m o n o c l o n a l a n t i b o d i e s a n d i d e n t i f i c a t i o n o f common e p i t o p e s . Phytopathology 79:869-873. D a v i s , R.E., a n d R o s s , A . F . 1 9 6 8 . I n c r e a s e d h y p e r s e n s i t i v i t y i n d u c e d i n t o b a c c o b y s y s t e m i c i n f e c t i o n b y p o t a t o v i r u s Y. V i r o l o g y 34:509-520. De B l o c k , M. 1 9 8 8 . G e n o t y p e - i n d e p e n d e n t l e a f d i s c t r a n s f o r m a t i o n o f p o t a t o (Solanum tuberosum) using tumefaciens. Theor. A p p l . Genet. 76:767-774.  Agrobacterium  132 Deom, C M . , O l i v e r , M.J., a n d B e a c h y , R.N. 1 9 8 7 . The 3 0 k i l o d a l t o n gene p r o d u c t o f t o b a c c o m o s a i c v i r u s p o t e n t i a t e s movement. S c i e n c e 2 3 7 : 3 8 9 - 3 9 4 .  virus  de Z o e t e n , G.A., a n d F u l t o n , R.W. 1975. U n d e r s t a n d i n g g e n e r a t e s possibilities. P h y t o p a t h o l o g y 65:221-222. de Z o e t e n , G.A., G a a r d , G., a n d D i e z , F.B. 1 9 7 2 . N u c l e a r v e s i c u l a t i o n a s s o c i a t e d w i t h pea e n a t i o n mosaic v i r u s - i n f e c t e d plant tissue. V i r o l o g y 53:638-647. D i t t a , G., S t a n f i e l d , S., C o r b i n , D., a n d H e l i n s k i , D.R. 1 9 8 0 . B r o a d h o s t r a n g e DNA c l o n i n g s y s t e m f o r g r a m - n e g a t i v e b a c t e r i a : C o n s t r u c t i o n o f a gene b a n k o f Rhizobium meliloti. Proc. Natl. A c a d . S c i . USA 7 7 : 7 3 4 7 - 7 3 5 1 . D o d d s , J.A., a n d H a m i l t o n , R . I . 1 9 7 6 . S t r u c t u r a l i n t e r a c t i o n s between v i r u s e s as a consequence o f mixed i n f e c t i o n s . Adv. V i r u s Res. 20:33-86. E i g e n , M., a n d S c h u s t e r , P. 1 9 7 7 . The h y p e r c y c l e . N a t u r w i s s e n s c h a f t e n 64:541-565. E s k a n d a r i , F., S y l v e s t e r , E.S., a n d R i c h a r d s o n , J . 1 9 7 9 . Evidence f o r lack of propagation of potato l e a f r o l l v i r u s i n i t s a p h i d v e c t o r , M y z u s persicae. P h y t o p a t h o l o g y 69:45-47. F e i n b e r g , A.P., a n d V o g e l s t e i n , B. 1 9 8 3 . A t e c h n i q u e f o r r a d i o l a b e l i n g DNA r e s t r i c t i o n e n d o n u c l e a s e f r a g m e n t s t o h i g h specific activity. A n a l . Biochem. 132:6-13. F o r b e s , A.R., a n d Chan, C . K . 1 9 8 9 . A p h i d s o f B r i t i s h A g r i c . C a n . T e c h . B u l l . 1989-1E.  Columbia.  F r a l e y , R.T., R o g e r s , S.G., H o r s c h , R.B., E i c h o l t z , D.A., F l i c k , J . S . , F i n k , C.L., H o f f m a n , N.L., a n d S a n d e r s , P.R. 1 9 8 5 . The SEV s y s t e m : A mew d i s a r m e d T i p l a s m i d v e c t o r s y s t e m f o r p l a n t transformation. B i o / T e c h n o l o g y 3:629-635. F r a l e y , R.T., R o g e r s , S.G., H o r s c h , R.B., S a n d e r s , P.R., F l i c k , J . S . , Adams, S.P., B i t t n e r , M.L., B r a n d , L.A., F i n k , C L . , F r y , J . S . , G a l l u p p i , G.R., G o l d b e r g , S.B., H o f f m a n n , N.L., a n d Woo, S.C. 1983. E x p r e s s i o n o f b a c t e r i a l genes i n p l a n t s c e l l s . P r o c . N a t l . A c a d . S c i . USA 8 0 : 4 8 0 3 - 4 8 0 7 . F r e i t a g , J . H . 1 9 6 4 . I n t e r a c t i o n a n d m u t u a l s u p p r e s s i o n among three strains of aster yellows virus. V i r o l o g y 24:401-413. F u l t o n , R.W. 1951. S u p e r i n f e c t i o n by s t r a i n s o f t o b a c c o virus. P h y t o p a t h o l o g y 41:579-592.  mosaic  133 F u l t o n , R.W. 1978. S u p e r i n f e c t i o n by s t r a i n s o f t o b a c c o virus. V i r o l o g y 85:1-8.  streak  G e r g e n , J . P . , S t e r n , R.H., a n d W e n s i n k , P.C. 1979. Filter r e p l i c a s a n d p e r m a n e n t c o l l e c t i o n s o f r e c o m b i n a n t DNA p l a s m i d s . N u c l e i c A c i d s R e s . 7:2115-2136. G e r l a c h , W.L., L l e w e l l y n , D., a n d H a s e l o f f , J . 1987. C o n s t r u c t i o n o f a p l a n t d i s e a s e r e s i s t a n c e gene f r o m t h e s a t e l l i t e RNA o f t o b a c c o r i n g s p o t v i r u s . N a t u r e 328:802-805. G i a n i n a z z i , S., V a l l e e , J.C., a n d M a r t i n , C. 1969. H y p e r s e n s i b i l i t e aux v i r u s , t e m p e r a t u r e e t p r o t e i n e s s o l u b l e s c h e z l e Nicotians X a n t h i n . c . C R . Hebd. S e a n c e s A c a d . S c i . , Ser. D 268:800-802. Gibbs, A.J. 14:263-328.  1969.  Plant virus c l a s s i f i c a t i o n .  Adv. V i r u s Res.  G i l d o w , F.E. 1982. C o a t e d - v e s i c l e t r a n s p o r t o f l u t e o v i r u s e s t h r o u g h s a l i v a r y g l a n d s o f Myzus p e r s i c a e . Phytopathology 72:1289-1296. G i l d o w , F.E., a n d Rochow, W.F. 1980a. R o l e o f a c c e s s o r y s a l i v a r y glands i n aphid t r a n s m i s s i o n o f b a r l e y y e l l o w dwarf virus. V i r o l o g y 104:97-108. G i l d o w , F.E., a n d Rochow, W.F. 1980b. Importance of c a p s i d i n t e g r i t y f o r i n t e r f e r e n c e b e t w e e n two i s o l a t e s o f b a r l e y y e l l o w d w a r f v i r u s i n an a p h i d . P h y t o p a t h o l o g y 70:1013-1015. G i l l , C.C., a n d Chong, J . 1979. C y t o p a t h o l o g i c a l e v i d e n c e f o r t h e d i v i s i o n o f b a r l e y y e l l o w d w a r f v i r u s i s o l a t e s i n t o two s u b g r o u p s . V i r o l o g y 95:59-69. G i l p a t r i c k , J.D., a n d W e i n t r a u b , M. 1952. An u n u s u a l t y p e o f p r o t e c t i o n w i t h the c a r n a t i o n mosaic v i r u s . S c i e n c e 115:701-702. G o l d b a c h , R., a n d v a n Kammen, A. 1985. Structure, replication and e x p r e s s i o n o f t h e b i p a r t i t e genome o f cowpea m o s a i c v i r u s . I n M o l e c u l a r P l a n t V i r o l o g y , v o l . I I , J.W. D a v i e s , e d . CRC P r e s s , Boca R a t a n . pp. 83-120.. G r a y b o s c h , R., H e l l m a n n , G.M., Shaw, J.G., R h o a d s , R.E., a n d H u n t , A.G. 1989. E x p r e s s i o n o f a p o t y v i r u s n o n - s t r u c t u r a l p r o t e i n i n transgenic tobacco. B i o c h . B i o p h y s . R e s . Commun. 160:425-432. G u b l e r , U., a n d H o f f m a n , B . J . 1983. A s i m p l e a n d v e r y e f f e c i e n t m e t h o d f o r g e n e r a t i n g cDNA l i b r a r i e s . Gene 2 5 : 2 6 3 - 2 6 9 .  134 G u i l l e y , H., C a r r i n g t o n , J . C , B a l a z s , E., J o n a r d , G., R i c h a r d s , K., a n d M o r r i s , T . J . 1985. N u c l e o t i d e s e q u e n c e a n d genome o r g a n i z a t i o n o f c a r n a t i o n m o t t l e v i r u s RNA. N u c l e i c A c i d s Res. 13:6663-6677. H a m i l t o n , R . I . 1980. D e f e n s e s t r i g g e r e d by p r e v i o u s i n v a d e r s : viruses. I n : P l a n t D i s e a s e : An A d v a n c e d T r e a t i s e , V o l . 5. J.G. H o r s f a l l a n d E.B. C o w l i n g , e d s . A c a d e m i c P r e s s , New Y o r k . p p . 279-303. H a r p e r , F.R., N e l s o n , G.A., a n d P i t t m a n , U . J . 1975. R e l a t i o n s h i p b e t w e e n l e a f r o l l symptoms a n d y i e l d i n N e t t e d potato. P h y t o p a t h o l o g y 65:1242-1244.  Gem  H a r r i s , K.F., B a t h , J . E . , T h o t t a p p i l l y , G., a n d H o o p e r , G.R. 1975. F a t e o f pea e n a t i o n mosaic v i r u s i n P E M V - i n j e c t e d pea aphids. V i r o l o g y 65:148-162. H a r r i s o n , B.D. 1958. A b i l i t y o f s i n g l e a p h i d s t o t r a n s m i t a v i r u l e n t and v i r u l e n t s t r a i n s o f p o t a t o l e a f r o l l v i r u s . V i r o l o g y 6:278-286.  both  H a r r i s o n , B.D. 1984. P o t a t o l e a f r o l l v i r u s . Descriptions of P l a n t V i r u s e s , No. 2 9 1 . Commonw. M y c o l . I n s t . , A s s o c . A p p l . B i o l . , Kew, S u r r e y , E n g l a n d . H a r r i s o n , B.D., Mayo, M.A., a n d B a u l c o m b e , D.C 1987. Virus r e s i s t a n c e i n t r a n s g e n i c p l a n t s t h a t e x p r e s s cucumber m o s a i c v i r u s s a t e l l i t e RNA. N a t u r e 328:799-802. H a r r i s o n , S.C. 1983. V i r u s s t r u c t u r e : h i g h r e s o l u t i o n perspectives. Advances i n V i r u s R e s e a r c h 28:175-240. H a s e l o f f , J . , a n d G e r l a c h , W.L. 1988. S i m p l e RNA enzymes w i t h new a n d h i g h l y s p e c i f i c e n d o r i b o n u c l e a s e a c t i v i t i e s . Nature 334:585-591 Hemenway, C , F a n g , R.-X., K a n i e w s k i , W.K., Chua, N.-H., a n d Turner, N.E. 1988. A n a l y s i s o f t h e m e c h a n i s m o f p r o t e c t i o n i n t r a n s g e n i c p l a n t s expressing the potato v i r u s X coat p r o t e i n or i t s a n t i s e n s e RNA. EMBO J . 7:1273-1280. H e n i k o f f , S. 1984. U n i d i r e c t i o n a l d i g e s t i o n w i t h I I I c r e a t e s t a r g e t b r e a k p o i n t s f o r DNA s e q u e n c i n g . 359. H i a t t , A., antibodies  exonuclease Gene 2 8 : 3 5 1 -  C a f f e r k e y , R., a n d B o w d i s h , K. 1989. P r o d u c t i o n i n t r a n s g e n i c p l a n t s . N a t u r e 342:76-78.  of  135 Hoekema, A., H u i s m a n , M.J., M o l e n d i j k , L., v a n den E l z e n , P.J.M., and C o r n e l i s s e n , B . J . C . 1989. The g e n e t i c e n g i n e e r i n g o f two c o m m e r c i a l p o t a t o c u l t i v a r s f o r r e s i s t a n c e t o p o t a t o v i r u s X. B i o / T e c h n o l o g y 7:273-278. H o r s c h , R.B., F r a l e y , R.T., R o g e r s , S.G., S a n d e r s , P.R., Lloyd, A., a n d H o f f m a n n , N. 1984. Inheritance of functional foreign genes i n p l a n t s . S c i e n c e 223:496-498. H o r s c h , R.B., F r y , J . E . , H o f f m a n n , N.L., E i c h h o l t z , D., R o g e r s S.G., a n d F r a l e y , R.T. 1985. A s i m p l e and g e n e r a l method f o r t r a n s f e r r i n g genes i n t o p l a n t s . S c i e n c e 227:1229-1231. Hu, J . S . , Rochow, W.F., P a l u k a i t i s , P., a n d D i e t e r t , R.R. 1988. Phenotypic mixing: m e c h a n i s m s o f d e p e n d e n t t r a n s m i s s i o n f o r two r e l a t e d i s o l a t e s of b a r l e y y e l l o w dwarf v i r u s . Phytopathology 78:1326-1330. H u n t e r , W.M., a n d Greenwood, F.C. 1962. P r e p a r a t i o n o f i o d i n e 131 l a b e l l e d human g r o w t h hormone o f h i g h s p e c i f i c a c t i v i t y . N a t u r e 194:495-496. J e d l i n s k i , H., a n d Brown, C M . 1965. C r o s s p r o t e c t i o n a n d m u t u a l e x c l u s i o n by t h r e e s t r a i n s o f b a r l e y y e l l o w d w a r f v i r u s i n Avena sativa L. V i r o l o g y 2 6 : 6 1 3 - 6 2 1 . J o b l i n g , S.A., a n d G e h r k e , L. 1987. E n h a n c e d t r a n s l a t i o n o f c h i m a e r i c m e s s e n g e r RNAs c o n t a i n i n g a p l a n t v i r a l u n t r a n s l a t e d l e a d e r sequence. N a t u r e 325:622-625. J o c k u s c h , H. 1968. Two m u t a n t s o f t o b a c c o m o s a i c v i r u s t e m p e r a t u r e s e n s i t i v e i n two d i f f e r e n t f u n c t i o n s . Virology 35:94-101. Kamer, C , a n d A r g o s , P. 1984. P r i m a r y s t r u c t u r a l c o m p a r i s o n o f RNA-dependent p o l y m e r a s e s from p l a n t , a n i m a l and b a c t e r i a l viruses. N u c l e i c A c i d s R e s e a r c h 12:7269-7282. K a s s a n i s , B., G i a n i n a z z i , S., a n d W h i t e , R.F. 1974. A p o s s i b l e explanation of the resistance of v i r u s - i n f e c t e d tobacco plants to second v i r u s i n f e c t i o n . J . Gen. V i r o l . 2 3 : 1 1 - 1 6 . Kawchuk, L.M., M a r t i n , R.R., R o c h o n , D.M., and McPherson, J . 1989. I d e n t i f i c a t i o n and c h a r a c t e r i z a t i o n o f t h e p o t a t o leafroll v i r u s p u t a t i v e c o a t p r o t e i n gene. J . Gen. V i r o l . 7 0 : 7 8 3 - 7 8 8 . Kawchuk, L.M., M a r t i n , R.R., a n d M c P h e r s o n , J . 1990. Resistance i n transgenic potato expressing the potato l e a f r o l l v i r u s coat p r o t e i n g e n e . M o l e c u l a r P l a n t - M i c r o b e I n t e r a c t i o n s 3:301-307.  136 Kay, R., Chan, A., D a l y , M., a n d M c P h e r s o n , J . 1 9 8 7 . D u p l i c a t i o n o f CaMV 35S p r o m o t e r s e q u e n c e s c r e a t e s a s t r o n g enhancer f o r p l a n t genes. S c i e n c e 236:1299-1302. K e e s e , P., M a r t i n , R.R., Kawchuk, L.M., W a t e r h o u s e , P.M., a n d G e r l a c h , W.L. 1990. N u c l e o t i d e sequences o f an A u s t r a l i a n and a Canadian i s o l a t e o f p o t a t o l e a f r o l l l u t e o v i r u s and t h e i r r e l a t i o n s h i p s w i t h two European i s o l a t e s . J . Gen. V i r o l . 7 1 : 7 1 9 724 . K i r k p a t r i c k , H.C., a n d R o s s , A . F . 1 9 5 2 . A p h i d - t r a n s m i s s i o n o f p o t a t o l e a f r o l l v i r u s t o Solanaceous s p e c i e s . Phytopathology 42:540-546. K i t a j i m a , E.W., a n d L a u r i t i s , J . A . 1 9 6 9 . P l a n t v i r i o n s i n plasmodesmata. V i r o l o g y 37:681-685. K n u t s o n , K.W., a n d B i s h o p , G.W. 1964. P o t a t o l e a f r o l l v i r u s e f f e c t o f d a t e o f i n o c u l a t i o n on p e r c e n t i n f e c t i o n a n d symptom expression. Amer. P o t a t o J . 4 1 : 2 2 7 - 2 3 8 . K o r n e l u k , R.G., Quan, F., a n d G r a v e l , R.A. 1 9 8 5 . R a p i d a n d r e l i a b l e d i d e o x y s e q u e n c i n g o f d o u b l e - s t r a n d e d DNA. Gene 4 0 : 3 1 7 323. K o z a k , M. 1 9 8 6 . B i f u n c t i o n a l M e s s e n g e r RNAs i n E u k a r y o t e s . C e l l 47:481-483. L a e m m l i , U.K. 1 9 7 0 . C l e a v a g e o f s t r u c t u r a l p r o t e i n s d u r i n g t h e a s s e m b l y o f t h e h e a d o f b a c t e r i o p h a g e T4. N a t u r e 2 2 7 : 6 8 0 - 6 8 5 . L a w s o n , C , K a n i e w s k i , W., H a l e y , L., Rozman, R., N e w e l l , C , S a n d e r s , P., a n d Turner, N.E. 1 9 9 0 . E n g i n e e r i n g r e s i s t a n c e t o mixed v i r u s i n f e c t i o n i n a commercial p o t a t o c u l t i v a r : r e s i s t a n c e to p o t a t o v i r u s X and p o t a t o v i r u s Y i n t r a n s g e n i c Russet Burbank. B i o / T e c h n o l o g y 8:127-134. L o e b e n s t e i n , G. 1 9 7 2 . L o c a l i z a t i o n a n d i n d u c e d - r e s i s t a n c e i n virus-infected plants. Ann. Rev. P h y t o p a t h o l . 10:177-206. L o e s c h - F r i e s , L . S . , M e r l o , D., Z i n n e n , T., B u r h o p , L., H i l l , K., K r a h n , K., J a r v i s , N., N e l s o n , S., a n d H a l k , E. 1 9 8 7 . E x p r e s s i o n o f a l f a l f a m o s a i c v i r u s RNA 4 i n t r a n s g e n i c p l a n t s confers virus resistance. EMBO J . 6: 1 8 4 5 - 1 8 5 1 . L u t c k e , H.A., Chow, K.C., M i c k e l , F.S., Moss, K.A., K e r n , H.F., a n d S c h e e l e , G.A. 1 9 8 7 . S e l e c t i o n o f AUG i n i t i a t i o n c o d o n s d i f f e r s i n p l a n t s a n d a n i m a l s . EMBO J . 6:43-48. M a c C a r t h y , H.R. 1 9 5 4 . A p h i d t r a n s m i s s i o n o f p o t a t o virus. P h y t o p a t h o l o g y 44:167-174.  leafroll  137 M a c G i l l i v r a y , M.E. 1 9 7 2 . The s e x u a l i t y o f Myzus ( S u l z e r ) , t h e g r e e n p e a c h a p h i d , i n New B r u n s w i c k Aphididae). Can. J . Z o o l . 50:469-471.  persicae  (Homopter:  M a n i a t i s , T., F r i t s c h , E.F., a n d Sambrook, J . 1 9 8 2 . M o l e c u l a r C l o n i n g : A L a b o r a t o r y M a n u a l . New Y o r k : C o l d S p r i n g H a r b o r Laboratory. M a r s h , L . E . , D r e h e r , T.W., a n d H a l l , T.C. 1988. M u t a t i o n a l a n a l y s i s o f t h e c o r e a n d m o d u l a t o r s e q u e n c e s o f t h e BMV RNA3 subgenomic p r o m o t e r . N u c l e i c A c i d s R e s e a r c h 16:981-995. M a r t i n , R.R., a n d D ' A r c y , C . J . 1 9 9 0 . R e l a t i o n s h i p s among l u t e o v i r u s e s b a s e d on n u c l e i c a c i d h y b r i d i z a t i o n a n d s e r o l o g i c a l studies. I n t e r v i r o l o g y 31:23-30. M a r t i n , R.R., K e e s e , P.K., Young, M.J., W a t e r h o u s e , P.M., a n d G e r l a c h , W.L. 1990. E v o l u t i o n and m o l e c u l a r b i o l o g y o f luteoviruses. Annu. Rev. P h y t o p a t h o l . 28:341-363. M a r t i n , R.R., a n d S t a c e - S m i t h , R. 1984. P r o d u c t i o n a n d c h a r a c t e r i z a t i o n of monoclonal antibodies s p e c i f i c t o potato roll virus. C a n . J . P l a n t P a t h o l . 6:206-210.  leaf  M a s s a l s k i , P.R., a n d H a r r i s o n , B.D. 1987. P r o p e r t i e s o f monoclonal a n t i b o d i e s t o p o t a t o l e a f r o l l l u t e o v i r u s and t h e i r use to d i s t i n g u i s h virus i s o l a t e s d i f f e r i n g i n aphid transmissibility. J . Gen V i r o l . 6 8 : 1 8 1 3 - 1 8 2 1 . Mayo, M.A., a n d B a r k e r , H. 1984. T r a n s l a t i o n p r o d u c t s a n d RNA s p e c i e s o f p o t a t o l e a f r o l l v i r u s ( P L R V ) . Rep. S c o t t . C r o p R e s . I n s t . 1983, p.187. Mayo, M.A., B a r k e r , H., R o b i n s o n , D . J . , Tamada, T., a n d H a r r i s o n , B.D. 1 9 8 2 . E v i d e n c e t h a t p o t a t o l e a f r o l l v i r u s RNA i s p o s i t i v e s t r a n d e d , i s l i n k e d t o a s m a l l p r o t e i n and does n o t c o n t a i n polyadenylate. J . Gen. V i r o l . 5 9 : 1 6 3 - 1 6 7 . Mayo, M.A., R o b i n s o n , D.J., J o l l y , C.A., a n d Hyman, L. N u c l e o t i d e s e q u e n c e o f p o t a t o l e a f r o l l l u t e o v i r u s RNA. V i r o l . 70:1037-1051.  1989. J . Gen.  M c K i n n e y , H.H. 1929.. M o s a i c d i s e a s e s i n t h e C a n a r y I s l a n d s , West A f r i c a , a n d G i b r a l t a r . J . A g r i c . Res. 39:557-578. M e y e r , T.F., M l a w e r , N., a n d So, M. 1982. P i l u s e x p r e s s i o n i n N e i s s e r i a g o n o r r h o e a e i n v o l v e s chromosomal r e a r r a n g e m e n t . C e l l 30:45-52. M i l l e r , W.A., D r e h e r , T.W., a n d H a l l , T.C. 1985. S y n t h e s i s o f brome m o s a i c v i r u s s u b g e n o m i c RNA in vitro by i n t e r n a l i n i t i a t i o n on ( - ) - s e n s e g e n o m i c RNA. N a t u r e 3 1 3 : 6 8 - 7 0 .  138 M i l l e r , W.A., Waterhouse, P.M., and Gerlach, W.L. 1988a. Sequence and o r g a n i z a t i o n o f b a r l e y yellow dwarf v i r u s genomic RNA. N u c l e i c A c i d s Res. 16:6097-6111. M i l l e r , W.A., Waterhouse, P.M., K o r t t , A.A., and Gerlach, W.L. 1988b. Sequence and i d e n t i f i c a t i o n o f t h e b a r l e y yellow dwarf v i r u s coat p r o t e i n gene. V i r o l o g y 165:306-309. Morrison, D.A. 1979. Transformation and p r e s e r v a t i o n o f competent b a c t e r i a l c e l l s by f r e e z i n g . Methods i n Enzymol. 68:326-331. Murashige, T., and Skoog, F. 1962. A r e v i s e d medium f o r r a p i d growth and b i o a s s a y with tobacco t i s s u e c u l t u r e s . P h y s i o l . P l a n t . 14:473-497. Murphy, J.F., D'Arcy, C.J., and C l a r k , J.M. 1989. B a r l e y yellow dwarf v i r u s RNA has a 5'-terminal genome-linked p r o t e i n . J . Gen. V i r o l . 70:2253-2256. N e j i d a t , A., and Beachy, R.N. 1989. Decreased l e v e l s o f TMV coat p r o t e i n i n t r a n s g e n i c tobacco p l a n t s a t e l e v a t e d temperatures reduce r e s i s t a n c e t o TMV i n f e c t i o n . V i r o l o g y 173:531-538. Nelson, R.S., McCormick, S.M., Delannay, X., Dube, P., Layton, J . , Anderson, E.J., Kaniewska, M., Proksch, R.K., Horsch, R.B., Rogers, S.G., F r a l e y , R.T., and Beachy, R.N. 1988. V i r u s t o l e r a n c e , p l a n t growth, and f i e l d performance o f t r a n s g e n i c tomato p l a n t s e x p r e s s i n g coat p r o t e i n from tobacco mosaic v i r u s . Bio/Technology 6:403-409. N i b l e t t , C.L., Dickson, E., Fernow, K.H., Horst, R.K., and Z a i t l i n , M. 1979. Cross p r o t e c t i o n among four v i r o i d s . V i r o l o g y 91:198-203. Osbourn J.K., P l a s k i t t , K.A., Watts, J.W., and Wilson, T.M.A. 198 9a. Tobacco mosaic v i r u s coat p r o t e i n and r e p o r t e r gene t r a n s c r i p t s c o n t a i n i n g t h e TMV o r i g i n - o f - a s s e m b l y sequence do not i n t e r a c t i n d o u b l e - t r a n s g e n i c tobacco p l a n t s : i m p l i c a t i o n s f o r coat p r o t e i n - m e d i a t e d p r o t e c t i o n . Molecular P l a n t - M i c r o b e I n t e r a c t i o n s . 2:340-345. Osbourn, J.K., Watts, J.W., Beachy, R.N., and Wilson, T.M.A. 198 9b. Evidence t h a t n u c l e o c a p s i d disassembly and a l a t e r step i n v i r u s r e p l i c a t i o n are i n h i b i t e d i n t r a n s g e n i c tobacco p r o t o p l a s t s e x p r e s s i n g TMV coat p r o t e i n . V i r o l o g y 172:370-373.  139 O t s u k i , Y., a n d T a k e b e , I . 1 9 7 6 . D o u b l e i n f e c t i o n o f i s o l a t e d t o b a c c o l e a f p r o t o p l a s t s by two s t r a i n s o f t o b a c c o m o s a i c . I n " B i o c h e m i s t r y a n d C y t o l o g y o f P l a n t - P a r a s i t e I n t e r a c t i o n " K. Tomiyama, J.M. D a l y , I . U r i t a n i , H. Oka, a n d S. O u c h i , e d s . Kodansha, L t d . , Tokyo, pp. 213-222. P a l i w a l , Y.C., a n d S i n h a , R.C. 1 9 7 0 . On t h e m e c h a n i s m o f p e r s i s t e n c e and d i s t r i b u t i o n o f b a r l e y y e l l o w dwarf v i r u s i n an aphid vector. V i r o l o g y 42:668-680. P a l u k a i t i s , P., a n d Z a i t l i n , M. 1 9 8 4 . A m o d e l t o e x p l a i n t h e " c r o s s - p r o t e c t i o n " phenomenon shown b y p l a n t v i r u s e s a n d v i r o i d s . In "Plant-microbe i n t e r a c t i o n s : M o l e c u l a r and g e n e t i c p e r s p e c t i v e s . " K o s u g e , T. a n d N e s t o r , E.W. e d s . M a c m i l l a n Co., New Y o r k . p p . 4 2 0 - 4 3 0 . P e l l e t i e r , J . , a n d S o n e n b e r g , N. 1 9 8 8 . I n t e r n a l i n i t i a t i o n o f t r a n s l a t i o n o f e u k a r y o t i c mRNA d i r e c t e d b y a s e q u e n c e d e r i v e d f r o m p o l i o v i r u s RNA. N a t u r e 3 3 4 : 3 2 0 - 3 2 5 . P e r e i r a , A.-M.N., a n d L i s t e r , R.M. 1 9 8 9 . V a r i a t i o n s i n v i r u s c o n t e n t among i n d i v i d u a l l e a v e s o f c e r e a l p l a n t s i n f e c t e d w i t h b a r l e y y e l l o w dwarf v i r u s . P h y t o p a t h o l o g y 79:1348-1352. P e t e r s , D. 1 9 6 7 . The p u r i f i c a t i o n o f p o t a t o l e a f r o l l i t s v e c t o r Myzus persicae. V i r o l o g y 31:4 6-54.  v i r u s from  P o n s e n , M.B. 1 9 7 0 . The b i o l o g i c a l t r a n s m i s s i o n o f p o t a t o l e a f r o l l v i r u s b y Myzus persicae. N e t h . J . P I . P a t h . 76:234-239. P o n s e n , M.B. 1 9 7 7 . Anatomy o f an a p h i d v e c t o r : Myzus persicae. P a g e s 63-82 i n : A p h i d s a s V i r u s V e c t o r s . K.F. H a r r i s a n d K. M a r a m o r o s c h , e d s . A c a d e m i c P r e s s , New Y o r k 559 p p . P o w e l l A b e l , P., N e l s o n , R.S., De, B., H o f f m a n n , N., R o g e r s , S.G., F r a l e y , R.T., a n d B e a c h y , R.N. 1 9 8 6 . D e l a y o f d i s e a s e development i n t r a n s g e n i c p l a n t s t h a t express t h e tobacco mosaic v i r u s c o a t p r o t e i n gene. S c i e n c e 232:738-743. P o w e l l , P.A., S a n d e r s , P.R., Turner, N., F r a l e y , R.T., a n d B e a c h y , R.N. 1990. P r o t e c t i o n a g a i n s t t o b a c c o mosaic v i r u s i n f e c t i o n i n t r a n s g e n i c p l a n t s r e q u i r e s accumulation o f coat p r o t e i n r a t h e r t h a n c o a t p r o t e i n RNA s e q u e n c e s . V i r o l o g y 1 7 5 : 1 2 4 - 1 3 0 . P r i l l , B., M a i s s , E., C h a n s i l p a , N., a n d C a s p e r , R. 1 9 8 8 . M o l e c u l a r c l o n i n g o f s i n g l e - s t r a n d e d RNAs o f p o t a t o l e a f r o l l v i r u s and beet western yellows v i r u s . J . Gen. V i r o l . 6 9 : 2 3 9 7 2402.  140 Q u a n j e r , H.M., v a n d e r Lek, H.A.A., and O o r t w y j n - B o t j e s , J . 1916. N a t u r e , mode o f d i s s e m i n a t i o n and c o n t r o l o f p h l o e m n e c r o s i s ( l e a f r o l l ) and r e l a t e d d i s e a s e s . Meded. R i j k s . h o o g . l a n d - , t u i n - b o s c h b o u w s c h o o l 10:1-90. R e g i s t e r , J.C., and B e a c h y , R.N. 1988. R e s i s t a n c e t o TMV i n t r a n s g e n i c p l a n t s r e s u l t s f r o m i n t e r f e r e n c e w i t h an e a r l y e v e n t in infection. V i r o l o g y 166:524-532. R e g i s t e r , J.C., and B e a c h y , R.N. 1989. E f f e c t of p r o t e i n a g g r e g a t i o n s t a t e on c o a t p r o t e i n - m e d i a t e d protection against tobacco mosaic v i r u s using a t r a n s i e n t p r o t o p l a s t assay. V i r o l o g y 173:656-663. R e i s m a n , D., de Z o e t e n , G.A. 1982. A covalently linked protein a t t h e 5'-ends o f t h e g e n o m i c RNAs o f p e a e n a t i o n m o s a i c v i r u s . J . Gen. V i r o l . 6 2 : 1 8 7 - 1 9 0 . R o c h o n , D.M., and T r e m a i n e , J.H. sequence o f t h e cucumber n e c r o s i s 169:251-259.  1989. Complete n u c l e o t i d e v i r u s genome. Virology  R o g e r s , S.G., H o r s c h , R.B., and F r a l e y , R.T. 1986. Gene transfer in plants: p r o d u c t i o n of transformed p l a n t s u s i n g plasmid vectors. Methods Enzymol. 118:627-640.  Ti  R o s s , A.F. 1961. S y s t e m i c a c q u i r e d r e s i s t a n c e i n d u c e d by l o c a l i z e d v i r u s - i n f e c t i o n s i n p l a n t s . V i r o l o g y 14:340-358. R o w h a n i , A., and S t a c e - S m i t h , R. 1979. P u r i f i c a t i o n and c h a r a c t e r i z a t i o n o f p o t a t o l e a f r o l l v i r u s . V i r o l o g y 98:45-54. S a n g e r , F., N i c k l e n , S., and C o u l s o n , A.R. 1977. DNA sequencing with chain-terminating inhibitors. P r o c . Nat. Acad. S c i e n c e s U.S.A. 7 4 : 5 4 6 3 - 5 4 6 7 . S e l a , I . , and A p p l e b a u m , S.W. 1962. O c c u r r e n c e o f an f a c t o r i n v i r u s - i n f e c t e d p l a n t s . V i r o l o g y 17:543-548.  antiviral  S h e p h e r d , R . J . , F r a n k i , R . I . B . , H i r t h , L., H o l l i n g s , M., Inouye, T., M a c l e o d , R., P u r c i f u l l , D., S i n h a , R.C., Tremaine, J.H., V a l e n t a , V., and W e t t e r , C. 1976. New g r o u p s o f p l a n t v i r u s e s a p p r o v e d by t h e I n t e r n a t i o n a l C o m m i t t e e on Taxonomy o f V i r u s e s . I n t e r v i r o l o g y 6:181-184. S l e a t , D.E., P l a s k i t t , K.A., and W i l s o n , T.M.A. 1988b. S e l e c t i v e e n c a p s i d a t i o n o f CAT gene t r a n s c r i p t s i n T M V - i n f e c t e d t r a n s g e n i c t o b a c c o i n h i b i t s CAT s y n t h e s i s . V i r o l o g y 165:609-612.  141 S m i t h , C . J . S . , W a t s o n , C.F., R a y , J . , B i r d , C.R., M o r r i s , P . C , S c h u c h , W., a n d G r i e r s o n , D. 1 9 8 8 . A n t i s e n s e RNA i n h i b i t i o n o f polygalacturonase gene e x p r e s s i o n i n t r a n s g e n i c t o m a t o e s . Nature 334:724-726. Smith, H.C 1963. I n t e r a c t i o n between i s o l a t e s o f b a r l e y d w a r f v i r u s . New Z e a l a n d J . A g r . R e s . 6:343-353.  yellow  S m i t h , O.P., H a r r i s , K.F., T o l e r , R.W., a n d Summers, M.D. 1 9 8 8 . M o l e c u l a r c l o n i n g o f p o t a t o l e a f r o l l v i r u s c o m p l e m e n t a r y DNA. P h y t o p a t h o l o g y 78:1060-1066. S o u t h e r n , E.M. 1 9 7 5 . D e t e c t i o n o f s p e c i f i c s e q u e n c e s among DNA fragments s e p a r a t e d by g e l e l e c t r o p h o r e s i s . J . Mol. Biol. 98:503-517. S t a r k , D.M., a n d B e a c h y , R.N. 1 9 8 9 . P r o t e c t i o n a g a i n s t potyvirus i n f e c t i o n i n transgenic p l a n t s : evidence f o r broad spectrum r e s i s t a n c e . B i o / T e c h n o l o g y 7:1257-1262. S t i e k e m a , W.J., H e i d e k a m p , F., L o u w e r s e , J.D., V e r h o e v e n , H.A., and D i j k h u i s , P. 1 9 8 8 . I n t r o d u c t i o n o f f o r e i g n g e n e s i n t o p o t a t o c u l t i v a r s ' B i n t j e ' and ' D e s i r e e ' u s i n g an Agrobacterium tumefaciens binary vector. P l a n t C e l l R e p . 7:47-50. S t e g w e e , D., a n d P o n s e n , M.B. 1958. M u l t i p l i c a t i o n o f p o t a t o l e a f r o l l v i r u s i n t h e a p h i d Mysuz persicae ( S u l z . ) . Entomol. E x p . & A p p l . 1:291-300. T a k a n a m i , Y., a n d Kubo, S. 1 9 7 9 . E n z y m e - a s s i s t e d p u r i f i c a t i o n o f two p h l o e m - l i m i t e d p l a n t v i r u s e s : t o b a c c o n e c r o t i c dwarf and potato l e a f r o l l . J . Gen. V i r o l . 4 4 : 1 5 3 - 1 5 9 . Tamada, T., a n d H a r r i s o n , B.D. 1 9 8 1 . Q u a n t i t a t i v e s t u d i e s on the uptake and r e t e n t i o n o f potato l e a f r o l l v i r u s by aphids i n l a b o r a t o r y and f i e l d c o n d i t i o n s . Ann. A p p l . B i o l . 98:261-276. Thomson, A.D. 1 9 5 8 . I n t e r f e r e n c e (London) 1 8 1 : 1 5 4 7 - 1 5 4 8 .  between p l a n t v i r u s e s .  Nature  Thung, T.H. 1 9 3 1 . S m e t s t o f e n p l a n t e n c e l b y e n k e l e v i r u s z i e k t e n v a n de t a b a k s - p l a n t . Handel. Ned.-Ind. Naturwetensch. Congr., 6 t h , 1931 p p . 4 5 0 - 4 6 3 ; a b s t r . i n R e v . A p p l . M y c o l . 11:750-751 1932. T h u r i n g , R.W.J., S a n d e r s , J.P.M., a n d B o r s t , P. 1 9 7 5 . A s q u e e z e m e t h o d f o r r e c o v e r i n g l o n g DNA f r o m a g a r o s e g e l s . A n a l y t i c a l Biochemistry 66:213-220.  freeze-  142 Turner, N.E., O ' C o n n e l l , K.M., N e l s o n , R.S., S a n d e r s , P.R., Beachy, R.N., F r a l e y , R.T., a n d Shah, D.M. 1987. E x p r e s s i o n o f a l f a l f a m o s a i c v i r u s c o a t p r o t e i n gene c o n f e r s c r o s s - p r o t e c t i o n i n t r a n s g e n i c t o b a c c o a n d t o m a t o p l a n t s . EMBO J . 6:1181-1188. V a l e n t a , V. 1959a. Interference studies with yellows-type plant v i r u s e s . I . Cross p r o t e c t i o n t e s t with European v i r u s e s . Acta V i r o l . (Prague) 3:65-72. V a l e n t a , V. 1959b. Interference studies with yellows-type plant v i r u s e s . I I . C r o s s p r o t e c t i o n t e s t s w i t h European and American viruses. A c t a . V i r o l . (Prague) 3:145-152. Van d e r W i l k , F., Huisman, M.J., C o r n e l i s s e n , B.J.C., H u t t i n g a , H., a n d G o l d b a c h , R. 1989. N u c l e o t i d e s e q u e n c e a n d o r g a n i z a t i o n o f p o t a t o l e a f r o l l v i r u s genomic RNA. FEBS L e t t e r s 245:51-56. Van Dun, CM.P., a n d B o l , J . F . 1988. T r a n s g e n i c t o b a c c o p l a n t s accumulating tobacco r a t t l e v i r u s coat p r o t e i n r e s i s t i n f e c t i o n w i t h t o b a c c o r a t t l e v i r u s and pea e a r l y browning v i r u s . Virology 167:649-652. Van Dun, CM.P., B o l , J . F . , a n d V a n V l o t e n - D o t i n g , L . 1987. E x p r e s s i o n o f a l f a l f a mosaic v i r u s and t o b a c c o r a t t l e v i r u s coat p r o t e i n genes i n t r a n s g e n i c t o b a c c o p l a n t s . V i r o l o g y 159:299305. Van Dun, C M . , O v e r d u i n , B., V a n V l o t e n - D o t i n g , L., a n d B o l , J . F . 1988. Transgenic tobacco expressing tobacco streak v i r u s or m u t a t e d a l f a l f a m o s a i c v i r u s c o a t p r o t e i n does n o t c r o s s - p r o t e c t a g a i n s t a l f a l f a mosaic v i r u s i n f e c t i o n . V i r o l o g y 164:383-389. van The  Emden, H.F., E a s t o p , V . F . , Hughes, R.D., a n d Way, M.J. 1969. e c o l o g y o f Myzus persicae. Ann. Rev. E n t o m o l . 14:197-270.  Van E t t e n , J . L . , F r e e r , S.N., a n d McCune, B.K. 1979. P r e s e n c e o f a m a j o r ( s t o r a g e ? ) p r o t e i n i n dormant s p o r e s o f t h e f u n g u s Botryodiplodia theobromae. J . B a c t e r i o l . 138:650-652. v a n Loon, L . C 1976. S p e c i f i c s o l u b l e l e a f p r o t e i n s i n v i r u s i n f e c t e d t o b a c c o p l a n t s a r e n o t n o r m a l c o n s t i t u e n t s . J . Gen. V i r o l . 30:375-379. V e i d t , I . , L o t , H., L e i s e r , M., S c h e i d e c k e r , D., G u i l l e y , H., R i c h a r d s , K., a n d J o n a r d , G. 1988. N u c l e o t i d e s e q u e n c e o f b e e t w e s t e r n y e l l o w s v i r u s RNA. N u c l e i c A c i d s R e s . 16:9917-9932. W a t e r h o u s e , P.M., G i l d o w , F . E . , a n d J o h n s t o n e , G.R. 1988. L u t e o v i r u s e s group. D e s c r i p t i o n s o f P l a n t V i r u s e s , No. 339. Commonw. M y c o l . I n s t . , A s s o c . A p p l . B i o l . , Kew, S u r r e y , E n g l a n d .  143 W a t e r h o u s e , P.M., M a r t i n , R.R., a n d G e r l a c h , W.L. 1 9 8 9 . BYDVPAV v i r i o n s c o n t a i n r e a d t h r o u g h p r o t e i n . Phytopathology ( A b s t r a c t ) 79:1215. Webb, R.E., L a r s o n , R.H., a n d W a l k e r , J . C . 1 9 5 2 . R e l a t i o n s h i p s of p o t a t o l e a f r o l l v i r u s s t r a i n s . Res. B u l l . Wisconsin Exp. Stn. 178:1-38. W e n z e l , G. 1 9 7 1 . V e r g l e i c h e n d e U n t e r s u c h u n g d e s I n t e r f e r e n z v e r h a l t e n s p h t y o - p a t h o g e n e s V i r e n a u f Tabak. P h y t o p a t h o l . Z. 7 1 : 1 4 7 - 1 6 2 . W i l s o n , T.M.A. 1 9 8 4 a . m o s a i c v i r u s in v i t r o .  C o t r a n s l a t i o n a l disassembly o f tobacco V i r o l o g y 137:255-265.  W i l s o n , T.M.A. 1984b. Cotranslational disassembly increases the e f f i c i e n c y o f e x p r e s s i o n o f TMV RNA i n wheat germ c e l l - f r e e extracts. V i r o l o g y 138:353-356. W i l s o n , T.M.A. 1 9 8 9 . P l a n t v i r u s e s : A t o o l - b o x f o r g e n e t i c e n g i n e e r i n g and crop p r o t e c t i o n . B i o / E s s a y s 10:179-186. W o l f , S., Deom, C M . , B e a c h y , R.N., a n d L u c a s , W.J. 1 9 8 9 . Movement p r o t e i n o f t o b a c c o m o s a i c v i r u s m o d i f i e s p l a s m o d e s m a t a l size exclusion limit. S c i e n c e 246:377-379. W r i g h t , N.S., a n d M a c C a r t h y , H.R. 1 9 6 3 . E x p r e s s i o n a n d d e t e c t i o n o f l e a f r o l l v i r u s s t r a i n s i n p o t a t o . Amer. P o t a t o . J . 40:154-162. W r i g h t , N.S., M a c C a r t h y , H.R., a n d F o r b e s , A.R. 1 9 7 0 . Epidemiology of potato leaf r o l l v i r u s i nthe Fraser River delta of B r i t i s h C o l u m b i a . Amer. P o t a t o J . 4 7 : 1 - 8 . Wu, S., R i n e h a r t , C.A., a n d K a e s b e r g , P. 1 9 8 7 . S e q u e n c e a n d o r g a n i z a t i o n o f s o u t h e r n b e a n m o s a i c v i r u s g e n o m i c RNA. V i r o l o g y 161:73-80. Y a r w o o d , C.E. mosaic v i r u s . Zaitlin, needed.  1960. L o c a l i z e d a c q u i r e d r e s i s t a n c e t o t o b a c c o P h y t o p a t h o l o g y 50:741-744.  M. 1 9 7 6 . V i r a l c r o s s - p r o t e c t i o n : More u n d e r s t a n d i n g i s P h y t o p a t h o l o g y 66:382-383.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100308/manifest

Comment

Related Items