Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Molecular characterization of potato leafroll luteovirus and development of genetically engineered resistance Kawchuk, Lawrence Michael 1990

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1990_A1 K39.pdf [ 8.98MB ]
Metadata
JSON: 831-1.0100308.json
JSON-LD: 831-1.0100308-ld.json
RDF/XML (Pretty): 831-1.0100308-rdf.xml
RDF/JSON: 831-1.0100308-rdf.json
Turtle: 831-1.0100308-turtle.txt
N-Triples: 831-1.0100308-rdf-ntriples.txt
Original Record: 831-1.0100308-source.json
Full Text
831-1.0100308-fulltext.txt
Citation
831-1.0100308.ris

Full Text

MOLECULAR CHARACTERIZATION OF POTATO LEAFROLL LUTEOVIRUS AND DEVELOPMENT OF GENETICALLY ENGINEERED RESISTANCE By LAWRENCE MICHAEL KAWCHUK B.Sc. (Hons.), The U n i v e r s i t y o f M a n i t o b a , 1985 M . S c , The U n i v e r s i t y o f Man i t o b a , 1987 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Plant Science) We a c c e p t t h i s t h e s i s as c o n f o r m i n g t o t h e r e q u i r e d s t a n d a r d THE UNIVERSITY OF BRITISH COLUMBIA October 1990 © Lawrence M i c h a e l Kawchuk, 1990 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada Date Qr.foW //, mO DE-6 (2/88) i i A B S T R A C T Complementary DNA (cDNA) c l o n e s r e p r e s e n t i n g a p p r o x i m a t e l y 5800 n u c l e o t i d e s o f p o t a t o l e a f r o l l v i r u s (PLRV) genomic RNA were g e n e r a t e d , r e s t r i c t i o n - m a p p e d , and p a r t i a l l y sequenced. W i t h i n one o f t h e cDNA c l o n e s an open r e a d i n g frame (ORF) t h a t c o u l d encode a 23 kDa p r o t e i n was i d e n t i f i e d and f u r t h e r c h a r a c t e r i z e d . Comparison o f t h e deduced amino a c i d sequence w i t h t h e c o a t p r o t e i n amino a c i d sequence o f t h e PAV s t r a i n o f b a r l e y y e l l o w dwarf l u t e o v i r u s (BYDV-PAV) showed s i g n i f i c a n t s i m i l a r i t y . T h i s o b s e r v a t i o n t o g e t h e r w i t h i t s s i z e and i n t e r n a l l o c a t i o n w i t h i n t h e genome s u g g e s t e d t h a t t h i s gene encoded t h e PLRV c o a t p r o t e i n . Other s i m i l a r i t i e s were o b s e r v e d between PLRV and BYDV sequences i n t h i s r e g i o n o f t h e i r genomes, i n c l u d i n g a 17 kDa ORF w i t h i n t h e ORF e n c o d i n g t h e 23 kDa c o a t p r o t e i n , and t e r m i n a t i o n o f t h e l a t t e r w i t h an amber codon which i s i m m e d i a t e l y f o l l o w e d by a l a r g e ORF i n t h e same r e a d i n g frame. Three PLRV c o a t p r o t e i n gene sequences were used t o t r a n s f o r m t o b a c c o and t h e p o t a t o c u l t i v a r s ' D e s i r e e ' and 'Russet Burbank' v i a Agrobacterium tumefaciens m e d i a t e d gene t r a n s f e r s . One c o n s t r u c t p o s s e s s e d 12 n u c l e o t i d e s o f t h e u n t r a n s l a t e d l e a d e r sequence 5' t o t h e p u t a t i v e c o a t p r o t e i n gene s t a r t codon. The o t h e r c o n s t r u c t , which was a l s o i n s e r t e d i n t h e r e v e r s e o r i e n t a t i o n t o produce n e g a t i v e - s e n s e RNA, had 192 n u c l e o t i d e s from t h i s l e a d e r sequence. When t h e s e sequences were i n t r o d u c e d as c h i m a e r i c genes under t h e c o n t r o l o f a d u p l i c a t e d c a u l i f l o w e r mosaic v i r u s 35S (CaMV) promoter, t r a n s c r i p t i o n l e v e l s were h i g h . i i i B o t h p o s i t i v e - s e n s e t r a n s c r i p t s p r o d u c e d p o t a t o l e a f r o l l c o a t p r o t e i n w h i c h accumulated t o maximum l e v e l s o f a p p r o x i m a t e l y 0.5% and 0.01% o f t o t a l l e a f p r o t e i n i n t o b a c c o and p o t a t o , r e s p e c t i v e l y . R e s u l t s show t h a t s i g n i f i c a n t l e v e l s o f i n o c u l u m c o n c e n t r a t i o n - i n d e p e n d e n t s u s t a i n e d r e s i s t a n c e were o b t a i n e d w i t h each c o n s t r u c t , r e s u l t i n g i n PLRV t i t r e s as low as 1% o f t h e l e v e l o b s e r v e d i n u n t r a n s f o r m e d p l a n t s , as d e t e r m i n e d by enzyme-l i n k e d immunosorbent a s s a y s . V i r u s t r a n s m i s s i o n from PLRV-i n o c u l a t e d t r a n s g e n i c 'Russet Burbank' was r e d u c e d s u b s t a n t i a l l y and was c o r r e l a t e d w i t h v i r u s t i t r e . The p a t t e r n and l e v e l o f p r o t e c t i o n were t h e same f o r c o n s t r u c t s p r o d u c i n g p o s i t i v e - and n e g a t i v e - s e n s e RNA, s u g g e s t i n g a s i m i l a r mechanism o f r e s i s t a n c e . V i r u s l e v e l s were n e g a t i v e l y c o r r e l a t e d t o t r a n s c r i p t l e v e l s w i t h i n t h e t r a n s g e n i c p l a n t s . T h i s r e s i s t a n c e w i l l have p r a c t i c a l a p p l i c a t i o n s f o r t h e c o n t r o l , o f PLRV. E l u c i d a t i o n o f t h e mechanism o f r e s i s t a n c e may a l s o h e l p u n d e r s t a n d t h e mechanisms o f v i r u s i n f e c t i o n . i v TABLE OF CONTENTS PAGE ABSTRACT i i TABLE OF CONTENTS i v LIST OF TABLES v i i i LIST OF FIGURES i x LIST OF PLATES x ACKNOWLEDGEMENTS x i LIST OF ABBREVIATIONS x i i I. INTRODUCTION 1 I I . LITERATURE REVIEW 5 2.1 E p i p h y t o l o g y o f P o t a t o L e a f r o l l V i r u s 5 2.1.1 Symptoms o f PLRV I n f e c t i o n 5 2.1.2 T r a n s m i s s i o n o f PLRV 5 2.1.3 V e c t o r S p e c i f i c i t y f o r PLRV 10 2.2 S t r u c t u r e o f t h e L u t e o v i r u s Genome 12 2.2.1 P h y s i c a l P r o p e r t i e s o f PLRV 12 2.2.2 M o l e c u l a r P r o p e r t i e s o f PLRV 13 2.2.2.1 L u t e o v i r u s Genome O r g a n i z a t i o n s .. 13 2.2.2.2 S t r a t e g i e s Used t o T r a n s l a t e L u t e o v i r u s Genes 18 2.2.2.3 L u t e o v i r u s E v o l u t i o n a r y R e l a t i o n s h i p s 22 2.3 V i r u s Induced R e s i s t a n c e 24 2.3.1 C r o s s - p r o t e c t i o n 24 2.3.2 A c q u i r e d R e s i s t a n c e 2 6 2.3.3 M u t u a l E x c l u s i o n 26 2.3.4 Models f o r V i r u s R e s i s t a n c e 27 2.4 G e n e t i c a l l y E n g i n e e r e d V i r u s R e s i s t a n c e 29 2.4.1 Tobacco Mosaic V i r u s 31 2.4.2 A l f a l f a M o s a i c V i r u s 36 V PAGE 2.4.3 Tobacco S t r e a k V i r u s 38 2.4.4 Tobacco R a t t l e V i r u s 38 2.4.5 P o t a t o V i r u s X 39 2.4.6 Cucumber Mosaic V i r u s 40 2.4.7 Soybean Mosaic V i r u s 40 2.4.8 P o t a t o V i r u s Y 41 2.4.9 S a t e l l i t e o f Cucumber M o s a i c V i r u s 42 2.4.10 S a t e l l i t e o f Tobacco R i n g s p o t V i r u s 42 2.4.11 N o n s t r u c t u r a l V i r a l Genes 43 2.4.12 Other Approaches f o r V i r u s C o n t r o l 44 I I I . MATERIALS AND METHODS 45 3.1 P r e p a r a t i o n o f PLRV RNA 45 3.1.1 Maintenance o f PLRV 45 3.1.2 V i r u s P u r i f i c a t i o n 45 3.1.3 E x t r a c t i o n o f PLRV RNA 47 3.1.4 Q u a n t i t a t i o n o f PLRV RNA 48 3.2 C l o n i n g o f PLRV RNA 48 3.2.1 F i r s t - S t r a n d cDNA S y n t h e s i s 48 3.2.2 Second-Strand cDNA S y n t h e s i s 50 3.2.3 L i g a t i o n o f cDNA I n t o a V e c t o r 51 3.2.4 T r a n s f o r m a t i o n o f Competent E. c o l i C e l l s . . 52 3.3 C h a r a c t e r i z a t i o n o f Complementary DNA 53 3.3.1 B a c t e r i a l L y s i s and DNA F i x a t i o n 53 3.3.2 P r e h y b r i d i z a t i o n o f F i l t e r s 54 3.3.3 Randomly Primed cDNA Probes 55 3.3.4 F i l t e r Washing C o n d i t i o n s 55 3.3.5 D e t e c t i o n o f F u s i o n P r o t e i n 56 3.3.6 A l k a l i n e L y s i s Method o f P l a s m i d I s o l a t i o n 56 3.3.7 E l e c t r o p h o r e s i s o f R e s t r i c t i o n Enzyme D i g e s t e d DNA 57 3.3.8 I s o l a t i o n o f H i g h M o l e c u l a r Weight P l a n t RNA 58 3.3.9 N o r t h e r n A n a l y s i s 59 3.3.10 Randomly Primed DNA Probes 60 3.3.11 R e s t r i c t i o n Enzyme A n a l y s i s and Genomic W a l k i n g 61 3.4 P r e p a r a t i o n o f Subclones 62 3.4.1 U n i d i r e c t i o n a l N e s t e d D e l e t i o n s 62 3.4.2 P r e p a r a t i o n o f Competent E. c o l i C e l l s .... 63 v i P A G E 3.5 DNA Sequencing 64 3.5.1 S e l e c t i o n o f Subclones 64 3.5.2 Sequencing G e l s 65 3.5.3 Sequencing w i t h Klenow 66 3.5.4 Sequencing w i t h Sequenase 66 3.6 Coat P r o t e i n Gene C o n s t r u c t s 67 3.7 T r i p a r e n t a l M a t i n g P r o c e d u r e 69 3.8 P l a n t T r a n s f o r m a t i o n s 73 3.8.1 T r a n s f o r m a t i o n o f Tobacco 74 3.8.2 T r a n s f o r m a t i o n o f t h e P o t a t o C u l t i v a r ' D e s i r e e ' 75 3.8.3 T r a n s f o r m a t i o n o f t h e P o t a t o C u l t i v a r 'Russet Burbank' 7 6 3.9 A n a l y s i s o f T r a n s g e n i c P l a n t s 77 3.9.1 South e r n A n a l y s i s 77 3.9.2 I s o l a t i o n o f P o l y (A +) RNA 79 3.9.3 T r a n s g e n i c P l a n t P r o t e i n A n a l y s i s 80 3.9.3.1 E x t r a c t i o n o f P l a n t P r o t e i n 80 3.9.3.2 E l e c t r o p h o r e s i s o f P r o t e i n 81 3.9.3.3 Western B l o t A n a l y s i s 81 3.10 PLRV C h a l l e n g e o f T r a n s g e n i c P o t a t o 82 3.10.1 D e t e r m i n a t i o n o f PLRV T i t r e s 82 3.10.2 PLRV T i t r e s i n ' D e s i r e e ' 83 3.10.3 E f f e c t o f Inoculum L e v e l s 84 3.10.4 PLRV T i t r e s i n 'Russet Burbank' 85 3.11 A p h i d T r a n s m i s s i o n o f PLRV 86 I V . R E S U L T S A N D D I S C U S S I O N 88 4.1 Host R e a c t i o n s t o PLRV I n f e c t i o n 88 4.2 A n a l y s i s o f PLRV cDNA 88 4.3 PLRV Sequence A n a l y s i s 90 4.4 E f f i c i e n c y o f t h e T r i p a r e n t a l M a t i n g P r o c e d u r e ... 96 v i i PAGE 4.5 P l a n t T r a n s f o r m a t i o n E f f i c i e n c i e s 97 4.6 D e t e c t i o n o f PLRV cDNA i n T r a n s g e n i c P l a n t s 98 4.7 D e t e c t i o n o f PLRV T r a n s c r i p t i n T r a n s g e n i c P l a n t s 99 4.8 D e t e c t i o n o f PLRV Coat P r o t e i n i n T r a n s g e n i c P l a n t s 100 4.9 PLRV R e s i s t a n c e 101 4.9.1 R e s i s t a n c e i n T r a n s g e n i c ' D e s i r e e ' 102 4.9.2 E f f e c t o f I n c r e a s i n g t h e PLRV Inoculum .... 104 4.9.3 R e s i s t a n c e i n T r a n s g e n i c 'Russet Burbank' . 107 4.10 PLRV T r a n s m i s s i o n from I n o c u l a t e d T r a n s g e n i c P o t a t o P l a n t s 113 V. GENERAL DISCUSSION 119 VI. BIBLIOGRAPHY 130 v i i i LIST OF TABLES TABLE PAGE 1 Summary o f examples o f g e n e t i c a l l y e n g i n e e r e d p l a n t v i r u s r e s i s t a n c e 32 2 M. persicae t r a n s m i s s i o n e f f i c i e n c y o f PLRV from t r a n s g e n i c 'Russet Burbank' 113 i x LIST OF FIGURES FIGURE PAGE 1 Genomic o r g a n i z a t i o n s r e p o r t e d f o r PLRV and BYDV-PAV 14 2 Diagram o f t h e r e s t r i c t i o n s i t e s used t o p r e p a r e t h e t h r e e PLRV c o a t p r o t e i n c o n s t r u c t s 68 3 Schematic diagram o f t h e i n t e r m e d i a t e e x p r e s s i o n v e c t o r pCDXl 7 0 4 S t r u c t u r e o f t h e pTiB6S3SE::pCDXl c o i n t e g r a t e o b t a i n e d by t r i p a r e n t a l m a t i n g and homologous r e c o m b i n a t i o n 71 5 R e s t r i c t i o n map o f t h e PLRV genome 90 6 Sequencing s t r a t e g y used t o dete r m i n e t h e c o a t p r o t e i n c o d i n g r e g i o n o f PLRV 92 7 N u c l e o t i d e sequence o f c l o n e LP79 93 8 N u c l e o t i d e sequence (cDNA) and p r e d i c t e d amino a c i d sequence o f t h e PLRV 23 kDa and 17 kDa ORFs 94 9 Diagrammatic r e p r e s e n t a t i o n o f t h e c h i m a e r i c genes c o n s t r u c t e d t o e x p r e s s t h e PLRV coa t p r o t e i n gene .. 97 10 D e t e r m i n a t i o n o f PLRV r e s i s t a n c e i n t r a n s g e n i c ' D e s i r e e ' (Experiment 1) 103 11 D e t e r m i n a t i o n o f PLRV r e s i s t a n c e i n t r a n s g e n i c ' D e s i r e e ' (Experiment 2) 104 12 R e l a t i v e v i r u s a c c u m u l a t i o n i n p l a n t s a f t e r i n o c u l a t i o n w i t h PLRV u s i n g 1 (A), 5 (B), o r 25 (C) v i r u l i f e r o u s M. persicae 105 13 Average PLRV t i t r e s o f combined l e a f e x t r a c t s from 30 'Russet Burbank' i n o c u l a t e d by 50 v i r u l i f e r o u s a p h i d s 108 14 Number o f i n d i v i d u a l t r a n s g e n i c p l a n t s w i t h s i g n i f i c a n t PLRV t i t r e s 112 X LIST OF PLATES PLATE PAGE 1 S o u t h e r n b l o t a n a l y s i s o f H i n d I I I d i g e s t e d DNA from p l a n t s t r a n s f o r m e d w i t h t h e PLRV c o a t p r o t e i n gene 114 2 N o r t h e r n b l o t a n a l y s i s o f p o l y a d e n y l a t e d RNA from p l a n t s t r a n s f o r m e d w i t h t h e PLRV c o a t p r o t e i n gene 115 3 Western b l o t a n a l y s i s o f PLRV coa t p r o t e i n e x p r e s s i o n i n t r a n s g e n i c t o b a c c o 116 4 Western b l o t a n a l y s i s o f PLRV coa t p r o t e i n e x p r e s s i o n i n t r a n s g e n i c ' D e s i r e e ' 117 5 Western b l o t a n a l y s i s o f p u r i f i e d PLRV 118 x i ACKNOWLEDGEMENTS I wish t o express my s i n c e r e a p p r e c i a t i o n t o Dr. R.R. M a r t i n f o r h i s s u p e r v i s i o n and f i n a n c i a l support d u r i n g t h i s study. I am a l s o i n d e b t e d t o Dr. J . McPherson f o r her s u p e r v i s i o n and f o r s u p p l y i n g the pCDXl p l a s m i d and Agrobacterium tumefaciens used i n t h i s study. I would a l s o l i k e t o thank Dr. D.M. Rochon f o r s e r v i n g on my committee and f o r the v a l u a b l e d i s c u s s i o n s , e s p e c i a l l y with r e s p e c t t o sequencing. The guidance o f f e r e d by the other committee members, Dr. E.P.M. Candido and Dr. V.C. Runeckles, i s a l s o g r a t e f u l l y acknowledged. The guidance of Dr. M. Shaw i n e d i t i n g t h i s t h e s i s i s most a p p r e c i a t e d . A s p e c i a l thank you i s extended t o Dr. M. Weintraub and Dr. R. Stace-Smith f o r t h e i r h e l p f u l advice and f o r making a v a i l a b l e the f a c i l i t i e s at the Vancouver A g r i c u l t u r e Canada Research S t a t i o n . I a l s o wish t o thank Mr. K. Turner and Mr. D. Kirkham f o r t h e i r h e l p f u l d i s c u s s i o n s with r e s p e c t t o t i s s u e c u l t u r e , Ms. A. Q u a i l f o r t e c h n i c a l a s s i s t a n c e , and Mr. W. MacDiarmid f o r a s s i s t a n c e i n the p r e p a r a t i o n s of photographs. F i n a n c i a l support by the N a t u r a l Sciences and E n g i n e e r i n g Research C o u n c i l of Canada i n the form of postgraduate s c h o l a r s h i p s , by the Vancouver Research S t a t i o n , and from grants h e l d by Dr. R. R. M a r t i n i s g r a t e f u l l y acknowledged. F i n a l l y , I want t o express my s i n c e r e s t a p p r e c i a t i o n t o Mary-Ann and Amanda f o r t h e i r understanding, p a t i e n c e , and encouragement. x i i LIST OF ABBREVIATIONS A ade n o s i n e o r a l a n i n e AMV a l f a l f a mosaic v i r u s AUG t r a n s l a t i o n s t a r t codon BAP b e n z y l a m i n o p u r i n e bp base p a i r BSA b o v i n e serum a l b u m i n BWYV beet w e s t e r n y e l l o w v i r u s BYDV b a r l e y y e l l o w dwarf v i r u s C c y t o s i n e o r c y s t e i n e CaMV c a u l i f l o w e r mosaic v i r u s CAT c h l o r a m p h e n i c o l a c e t y l t r a n s f e r a s e cDNA complementary d e o x y r i b o n u c l e i c a c i d C i C u r i e CIP c a l f i n t e s t i n a l phosphatase CMV cucumber mosaic v i r u s cpm c o u n t s p e r minute CRLV c a r r o t r e d l e a f v i r u s D a s p a r t i c a c i d dATP 2'-deoxyadenosine 5 ' - t r i p h o s p h a t e dCTP 2 ' - d e o x y c y t o s i n e 5 ' - t r i p h o s p h a t e DEPC d i e t h y l p y r o c a r b o n a t e dGTP 2'-deoxyguanosine 5 ' - t r i p h o s p h a t e dITP 2'-deoxyinosine 5 ' - t r i p h o s p h a t e DNA d e o x y r i b o n u c l e i c a c i d DTT d i t h i o t h r e i t o l dTTP 2'-deoxythymidine 5 ' - t r i p h o s p h a t e E g l u t a m i c a c i d EDTA e t h y l e n e d i a m i n e t e t r a a c e t i c a c i d ELISA e n z y m e - l i n k e d immunosorbent assay F p h e n y l a l a n i n e G guanosine o r g l y c i n e GA3 g i b b e r e l l i c a c i d GUS (3-glucuronidase h hour H h i s t i d i n e HEPES N - 2 - h y d r o x y e t h y l p i p e r a z i n e - N ' - 2 - e t h a n e s u l f o n i c a c i d I i s o l e u c i n e IAA i n d o l e - 3 - a c e t i c a c i d IgG i m m u noglobulin G K l y s i n e kb k i l o b a s e kDa k i l o D a l t o n L l e u c i n e LB L u r i a - B e r t a n i medium M m o l a r i t y o r m e t h i o n i n e MAV b a r l e y y e l l o w dwarf v i r u s s e r o t y p e MES 2 - [ N - M o r p h o l i n e ] e t h a n e s u l f o n i c a c i d min minute x i i i Mr r e l a t i v e m o l e c u l a r mass mRNA messenger r i b o n u c l e i c a c i d MS Murashige and Skoog media NAA a - n a p h t h a l e n e a c e t i c a c i d N any n u c l e o t i d e o r a s p a r a g i n e NOS n o p a l i n e s y n t h a s e NPT neomycin p h o s p h o t r a n s f e r a s e n t n u c l e o t i d e OD o p t i c a l d e n s i t y ORF open r e a d i n g frame P p r o l i n e PAV b a r l e y y e l l o w dwarf v i r u s s e r o t y p e PBS phosphate b u f f e r e d s a l i n e PEBV pea e a r l y browning v i r u s PEMV pea e n a t i o n mosaic v i r u s PLRV p o t a t o l e a f r o l l v i r u s p o l y ( A + ) p o l y a d e n y l a t e d PVP p o l y v i n y l p y r r o l i d o n e PVX p o t a t o v i r u s X PVY p o t a t o v i r u s Y Q g l u t a m i n e R a r g i n i n e R l f i r s t f i l i a l t r a n s g e n i c g e n e r a t i o n RNA r i b o n u c l e i c a c i d RMV b a r l e y y e l l o w dwarf v i r u s s e r o t y p e rpm r e v o l u t i o n s p e r minute RPV b a r l e y y e l l o w dwarf v i r u s s e r o t y p e S Svedberg u n i t o r s e r i n e SDS sodium d o d e c y l s u l f a t e SDV soybean dwarf v i r u s SGV b a r l e y y e l l o w dwarf v i r u s s e r o t y p e SMV soybean mosaic v i r u s SSC sodium s a l i n e c i t r a t e T t h y m i d i n e o r t h r e o n i n e TAE t r i s - a c e t a t e - E D T A b u f f e r TAV tomato aspermy v i r u s TBE t r i s - b o r i c acid-EDTA b u f f e r TCA t r i c h l o r o a c e t i c a c i d T-DNA t r a n s f e r DNA o f T i p l a s m i d TE t r i s - E D T A b u f f e r TEMED N , N , N ' , N ' - t e t r a m e t h y l e t h y l e n e d i a m i n e TEV t o b a c c o e t c h v i r u s T i turner i n d u c i n g TMV t o b a c c o mosaic v i r u s TNE t r i s - s o d i u m c h l o r i d e - E D T A b u f f e r TobRV t o b a c c o r i n g s p o t v i r u s T r i s t r i s (hydroxymethyl) aminomethane h y d r o c h l o r i d e tRNA t r a n s f e r r i b o n u c l e i c a c i d TRV t o b a c c o r a t t l e v i r u s TSV t o b a c c o s t r e a k v i r u s TVMV t o b a c c o v e i n m o t t l i n g v i r u s U u r a c i l x i v UAG t r a n s l a t i o n amber s t o p codon v volume V v a l i n e VPg genome-linked v i r a l p r o t e i n w weight W watt o r t r y p t o p h a n X any amino a c i d X g a l 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l - p - D - g a l a c t o s i d e Y t y r o s i n e I . 1 INTRODUCTION Potato l e a f r o l l virus (PLRV) causes a plant disease that i s responsible for s i g n i f i c a n t economic losses i n potato (Solarium tuberosum L.) by reducing both quality and y i e l d . It occurs i n almost every location throughout the world i n which potatoes are grown (Harrison, 1984). In some areas the incidence of i n f e c t i o n has been 100% and y i e l d losses of up to 92% have been recorded (Harper et al., 1975). PLRV i s a member of the luteovirus group (reviewed by Harrison, 1984; Waterhouse et a l . , 1988; Martin et al., 1990), established by the International Committee on Taxonomy of Viruses i n 1975 (Shepherd et a l . , 1976). Only PLRV, barley yellow dwarf (BYDV), and beet western yellows (BWYV) were i n i t i a l l y l i s t e d as d e f i n i t e members at that time. Since then the number of members has increased to 12 but several of these may eventually be i d e n t i f i e d as the same vi r u s . BYDV-MAV i s the designated type member of the group. The group name i s derived from the Latin "luteus" which means yellow, since a l l of the o r i g i n a l members caused yellowing symptoms i n t h e i r host. Luteoviruses are confined to the phloem tissu e of t h e i r host and are not mechanically transmissible. However they are transmitted i n a c i r c u l a t i v e , non-propagative manner by t h e i r aphid vectors. Most luteoviruses have a li m i t e d host range although a few such as BWYV have a very broad host range. As a group, these viruses occur i n numerous crop plants worldwide and 2 a r e r e s p o n s i b l e f o r s i g n i f i c a n t economic l o s s e s . C o n t r o l o f l u t e o v i r u s e s i s e x t r e m e l y d i f f i c u l t because o f t h e i r v e c t o r r e l a t i o n s h i p and t h e i r p r e s e n c e i n weeds and g r a s s e s w h i c h o f t e n s e r v e as i n o c u l u m r e s e r v o i r s . In a d d i t i o n t o t r a n s m i s s i o n i n a p e r s i s t e n t f a s h i o n by s e v e r a l a p h i d s p e c i e s , PLRV i s d i s s e m i n a t e d t h r o u g h i n f e c t e d p o t a t o t u b e r s . I t has been shown t h a t d i f f e r e n t s t r a i n s o f PLRV w i l l c r o s s -p r o t e c t (Webb e t a l . , 1952; H a r r i s o n , 1958). McKinney (1929) was t h e f i r s t t o r e p o r t " c r o s s - p r o t e c t i o n " i n which a p l a n t i n o c u l a t e d w i t h one s t r a i n o f a v i r u s f a i l e d t o d e v e l o p t h e symptoms t y p i c a l o f a second s t r a i n upon i n o c u l a t i o n w i t h t h a t s t r a i n . Recent developments i n t h e i n s e r t i o n and e x p r e s s i o n o f f o r e i g n genes i n p l a n t genomes (Rogers e t a l . , 198 6) have f a c i l i t a t e d f u r t h e r i n v e s t i g a t i o n o f t h e v i r u s c r o s s - p r o t e c t i o n phenomenon. Beachy e t al. (1990) have r e v i e w e d t h e development o f t r a n s g e n i c p l a n t s e x p r e s s i n g d i f f e r e n t v i r u s c o a t p r o t e i n genes. V a r i o u s l e v e l s o f r e s i s t a n c e have been o b s e r v e d depending on t h e v i r u s and gene s t u d i e d . The p r o p e r t i e s o f t h e r e s i s t a n c e o b s e r v e d u s i n g t h e c o a t p r o t e i n genes were not i d e n t i c a l amongst t h e v i r u s e s examined, s u g g e s t i n g t h a t more t h a n one mechanism may be i n v o l v e d . The o b j e c t i v e o f t h i s s t u d y was t o i d e n t i f y and c h a r a c t e r i z e t h e PLRV c o a t p r o t e i n gene. T h i s gene was t h e n t o be used t o d e v e l o p g e n e t i c a l l y e n g i n e e r e d p o t a t o l e a f r o l l v i r u s r e s i s t a n c e i n p o t a t o . T r a n s f o r m a t i o n was i n i t i a l l y c a r r i e d out u s i n g t h e PLRV c o a t p r o t e i n gene s i n c e h i g h l e v e l s o f r e s i s t a n c e had been 3 o b t a i n e d w i t h s p e c i f i c c o a t p r o t e i n genes from o t h e r p l a n t v i r u s e s ( r e v i e w e d by Beachy et al., 1990). I s o l a t i o n o f t h e c o a t p r o t e i n gene r e q u i r e d t h e c l o n i n g , s e q u e n c i n g , and c h a r a c t e r i z a t i o n o f p a r t o f t h e PLRV genome. Once i d e n t i f i e d , t h e c o a t p r o t e i n open r e a d i n g frame (ORF) was t r a n s f e r r e d i n t o Nicotiana tabacum (L.) ' X a n t h i - n c ' (Horsch e t al., 1985) and t h e p o t a t o c u l t i v a r s ' D e s i r e e ' (Stiekema e t al., 1988) and 'Russet Burbank' (De B l o c k , 1988) v i a Agrobacterium tumefaciens m e d i a t e d gene t r a n s f e r s . Three d i f f e r e n t c o n s t r u c t s were i n t r o d u c e d as c h i m a e r i c genes under t h e c o n t r o l o f a d u p l i c a t e d c a u l i f l o w e r mosaic v i r u s (CaMV) 35S promoter-enhancer i n a t t e m p t s t o o b t a i n maximum e x p r e s s i o n . An e a r l i e r s t u d y (Kay e t al., 1987) showed t h a t d u p l i c a t i o n o f upstream r e g i o n s o f t h e CaMV 35S promoter r e s u l t e d i n t r a n s c r i p t i o n a l a c t i v i t y a p p r o x i m a t e l y t e n - f o l d h i g h e r t h a n t h a t o f t h e n a t u r a l promoter. G e n e t i c a l l y e n g i n e e r e d r e s i s t a n c e o f f e r s an a t t r a c t i v e a l t e r n a t i v e t o t h e e c o n o m i c a l l y and e n v i r o n m e n t a l l y c o s t l y p r a c t i c e o f c o n t r o l o f t h e v e c t o r w i t h i n s e c t i c i d e s . The a p h i d v e c t o r o f PLRV has a major p a r t i n t h e e p i p h y t o l o g y o f PLRV and was c r u c i a l f o r t h e t r a n s m i s s i o n o f t h i s v i r u s and c h a r a c t e r i z a t i o n o f r e s i s t a n c e d u r i n g t h e c o u r s e t h i s work. Lower v i r u s t i t r e s i n i n f e c t e d t r a n s g e n i c p l a n t s may r e s u l t i n r e d u c e d a c q u i s i t i o n and t r a n s m i s s i o n by t h e v e c t o r , fewer symptoms and i n c r e a s e d y i e l d s , and p o s s i b l y an i n c r e a s e i n t u b e r q u a l i t y . A n a l y s i s o f t h e mechanism of p r o t e c t i o n c o u l d p r o v i d e i n f o r m a t i o n on c r o s s - p r o t e c t i o n , t h e i n f e c t i o n p r o c e s s , and v i r u s 4 r e p l i c a t i o n . Recent work w i t h o t h e r l u t e o v i r u s e s i n d i c a t e s e x t e n s i v e s i m i l a r i t i e s i n genome o r g a n i z a t i o n , r e p l i c a t i o n and t r a n s l a t i o n a l s t r a t e g i e s , and o t h e r m o l e c u l a r and n o n - m o l e c u l a r p r o p e r t i e s ( M a r t i n e t al., 1990). Thus, t h e development of r e s i s t a n c e t o PLRV may i n d i c a t e a u s e f u l s t r a t e g y t o o b t a i n r e s i s t a n c e towards o t h e r l u t e o v i r u s e s . I I . 5 LITERATURE REVIEW 2.1 Epiphytology of PLRV 2.1.1 Symptoms of PLRV Infection P r i m a r y PLRV symptoms f o l l o w t r a n s m i s s i o n by a p h i d s and appear m a i n l y i n t h e young l e a v e s , which e x h i b i t an u p r i g h t growth h a b i t , upward r o l l i n g , and c h l o r o s i s . These symptoms may not appear w i t h l a t e season i n f e c t i o n . Secondary symptoms o c c u r i n p l a n t s grown from i n f e c t e d t u b e r s . They i n c l u d e upward r o l l i n g and m a r g i n a l n e c r o s i s o f t h e low e r l e a v e s , c h l o r o s i s o f th e upper l e a v e s , and s t u n t i n g o f t h e p l a n t which has d r y and b r i t t l e l e a v e s . The t u b e r s o f some c u l t i v a r s e.g. 'Russet Burbank' d e v e l o p i n t e r n a l net n e c r o s i s o f t h e phloem. I n t u b e r s from p l a n t s w i t h p r i m a r y i n f e c t i o n s t h e n e c r o s i s i s v i s i b l e as a n e t - p a t t e r n e d n e c r o s i s i n t h e c u t t u b e r ( H a r r i s o n , 1984) . 2.1.2 Transmission of PLRV A l t h o u g h PLRV may be d i s s e m i n a t e d t h r o u g h i n f e c t e d p o t a t o t u b e r s and may be t r a n s m i t t e d by g r a f t i n g , i t i s t r a n s m i t t e d by i t s a p h i d v e c t o r t h a t i s r e s p o n s i b l e f o r t h e p r e v a l e n c e o f PLRV. Myzus persicae ( S u l z . ) i s t h e o n l y e f f i c i e n t and s i g n i f i c a n t v e c t o r o f PLRV. Tamada and H a r r i s o n (1981) found t h a t o t h e r a p h i d s , such as Macrosiphum euphorbiae (Thorn.), a r e o f t e n more numerous w i t h i n p o t a t o c r o p s and a l t h o u g h they, may be c a p a b l e o f t r a n s m i t t i n g PLRV t h e y do so i n e f f i c i e n t l y . An e n z y m e - l i n k e d immunosorbent assay (ELISA) showed t h a t t h e l e v e l s o f PLRV w i t h i n 6 M. persicae and M. euphorbiae were t h e same a f t e r an i d e n t i c a l a c q u i s i t i o n p e r i o d , however, M. persicae was more e f f i c i e n t (100%) t h a n M. euphorbiae (3%) i n t r a n s m i t t i n g PLRV. T h i s e f f i c i e n c y o f PLRV t r a n s m i s s i o n has made M. persicae t h e most i m p o r t a n t v e c t o r . M. persicae has a worldwide d i s t r i b u t i o n and a h o s t range t h a t i n c l u d e s o ver 250 o r n a m e n t a l , c u l t i v a t e d , and weed s p e c i e s ( B e r r y and Simpson, 1967) . At l e a s t 116 h o s t p l a n t s have been r e c o r d e d i n B r i t i s h Columbia a l o n e (Forbes and Chan, 1989). S i n c e PLRV i s found m o s t l y w i t h i n t h e S o l a n a c e a e , w i t h o n l y a few h o s t s amongst t h e Amaranthaceae, Nolanaceae, C r u c i f e r a e , and P o r t u l a c e a e , i t i s c l e a r t h a t t h e v i r u s and not t h e v e c t o r i s r e s p o n s i b l e f o r t h e r e l a t i v e l y narrow h o s t range o f PLRV. W i t h i n t h e F r a s e r V a l l e y M. persicae appears t o be e x c l u s i v e l y a n h o l o c y c l i c (produces no e g g s ) . No eggs or f u n d a t r i c e s have been found d u r i n g s e a r c h e s o f peach t r e e s w i t h i n t h i s a r e a . Nymphs and a d u l t s o v e r w i n t e r on sugar b e e t s , b r u s s e l s p r o u t s , C h i n e s e cabbage, swede t u r n i p , hedge mustard, p i n e a p p l e weed, and t a l l b u t t e r c u p (Wright et a l . , 1970) . M. persicae appears t o be a n h o l o c y c l i c i n t h e temperate zones and may be b o t h a n h o l o c y c l i c and h o l o c y c l i c (produces eggs) o r e n t i r e l y h o l o c y c l i c i n c o l d e r a r e a s ( M a c G i l l i v r a y , 1972). A l t h o u g h s e v e r a l weeds such as shepherd's p u r s e and n i g h t s h a d e can be r e s e r v o i r s f o r PLRV t h e y a r e i n s i g n i f i c a n t when compared t o v o l u n t e e r p o t a t o e s from commercial growers and home g a r d e n e r s . The l a t t e r a r e a p a r t i c u l a r l y good s o u r c e o f PLRV as c o n t a m i n a t e d 7 p o t a t o seed i s r e p l a n t e d y e a r a f t e r y e a r and a p h i d p o p u l a t i o n s a r e not u s u a l l y c o n t r o l l e d by i n s e c t i c i d e s ( B i s h o p and G u t h r i e , 1964) . The p r o b a b i l i t y o f e a r l y i n f e c t i o n i n p o t a t o i s i n c r e a s e d i n a r e a s where a n h o l o c y c l i c M. persicae o v e r w i n t e r because o f t h e l a r g e number o f v e c t o r s i n t h e s p r i n g . M. persicae i s more l i k e l y t o a c q u i r e v i r u s from and i n o c u l a t e v i r u s t o younger p l a n t s t h a n t o o l d e r p l a n t s (Tamada and H a r r i s o n , 1981). I n f e c t i o n o f younger p l a n t s i s more l i k e l y t o o c c u r because t h e y a r e l e s s r e s i s t a n t t h a n o l d e r p l a n t s (Knutson and B i s h o p , 1964) . PLRV e p i p h y t o t i c s i n N o r t h A m e r i c a and Europe appear t o o c c u r e v e r y 32 y e a r s and t h e y c o i n c i d e w i t h p e r i o d s o f warm d r y summers and m i l d w i n t e r s which f a v o u r w i n t e r s u r v i v a l and summer development o f M. persicae ( B a g n a l l , 1988). M. persicae f e e d s m a i n l y on t h e l o w e r p o t a t o l e a v e s ( K i r k p a t r i c k and Ross, 1952) which c o n t a i n h i g h e r l e v e l s o f v i r u s t h a n younger l e a v e s a t t h e t o p (Tamada and H a r r i s o n , 1981) . A t t r a c t e d by t h e c o l o u r y e l l o w , a p h i d s c o l o n i z e PLRV i n f e c t e d p l a n t s more r e a d i l y t h a n h e a l t h y p l a n t s s i n c e one o f t h e symptoms of i n f e c t i o n i s y e l l o w i n g o f t h e p l a n t (van Emden e t al., 1969). P r o b i n g o f t h e l e a f s u r f a c e c o n s i s t s o f s h o r t , 1 t o 5 minute, r e p e a t e d s t y l e t i n s e r t i o n s a t d i f f e r e n t s i t e s . M. persicae r e q u i r e s a t l e a s t 15 minutes t o r e a c h the-phloem and no v i r u s a c q u i s i t i o n has been o b s e r v e d o r i s l i k e l y t o o c c u r i n a s h o r t e r p e r i o d as v i r u s i s c o n f i n e d t o t h e phloem t i s s u e . U n l i k e M. euphorbiae, i n which t h e s t y l e t p e n e t r a t i o n i s i n t r a c e l l u l a r , 8 t h e s t y l e t o f M. persicae p e n e t r a t e s u s i n g b o t h an i n t e r c e l l u l a r and i n t r a c e l l u l a r r o u t e (van Emden e t al., 1969). K i r k p a t r i c k and Ross (1952) showed t h a t M. persicae has an a c q u i s i t i o n t h r e s h o l d o f 30 minutes f o r PLRV. They a l s o found t h a t PLRV c o u l d be a c q u i r e d and t r a n s m i t t e d i n as l i t t l e as 90 m i n u t e s . Thus t h e l a t e n t p e r i o d may be as s h o r t as 60 m i n u t e s . The i n o c u l a t i o n t h r e s h o l d was d e t e r m i n e d t o be 30 m i n u t e s . Ponsen (1970) found t h a t b o t h nymphs and a d u l t s o f M. persicae a r e c a p a b l e o f a c q u i r i n g and t r a n s m i t t i n g PLRV. Optimum e f f i c i e n c y o f t r a n s m i s s i o n o f PLRV o c c u r r e d 9 days a f t e r b i r t h . I t was a l s o shown t h a t s t a r v a t i o n p r i o r t o t h e a c q u i s i t i o n o f PLRV d i d not a f f e c t t h e a b i l i t y t o t r a n s m i t . Tamada and H a r r i s o n (1981) used ELISA f o r t h e d e t e c t i o n o f PLRV w i t h i n a p h i d s . Most o f t h e e v i d e n c e f o r t h e c h a r a c t e r i s t i c s o f PLRV i n a p h i d s from e a r l i e r s t u d i e s had been i n d i r e c t . The PLRV c o n t e n t o f M. persicae i n c r e a s e d d u r i n g an a c q u i s i t i o n a c c e s s p e r i o d o f up t o 7 days but v a r i e d s i g n i f i c a n t l y between i n d i v i d u a l a p h i d s . A maximum of 7 ng PLRV/aphid was r e c o r d e d but t h e a p h i d s u s u a l l y accumulated o n l y 0.2 ng/day. I t was shown t h a t a p h i d s c o n t a i n i n g h i g h e r l e v e l s o f PLRV were b e t t e r a t t r a n s m i t t i n g t h e v i r u s . A p h i d s k e p t a t l o w e r t e m p e r a t u r e s , i . e . 15 o r 20°C, c o n t a i n e d c o n s i d e r a b l y more v i r u s t h a n a p h i d s k e p t a t h i g h e r t e m p e r a t u r e s , i . e . 25 o r 30°C. However, a p h i d s kept a t l o w e r t e m p e r a t u r e s were l e s s e f f i c i e n t a t t r a n s m i t t i n g PLRV t h a n a p h i d s k e p t a t h i g h e r t e m p e r a t u r e s . Tamada and H a r r i s o n (1981) 9 s u g g e s t e d t h a t t h i s was a p o s t - a c q u i s i t i o n e f f e c t on t h e speed w i t h w h i c h PLRV moves from one p a r t o f an a p h i d t o a n o t h e r . T h i s was f u r t h e r s u p p o r t e d by t h e l o n g e r l a t e n t p e r i o d o b s e r v e d a t l o w e r t e m p e r a t u r e s . Stegwee and Ponsen (1958) r e p o r t e d t h a t PLRV c o u l d be t r a n s f e r r e d 15 s u c c e s s i v e t i m e s by s e r i a l i n j e c t i o n o f haemolymph from a p h i d s kept on virus-immune p l a n t s . They i n t e r p r e t e d t h e s e r e s u l t s t o i n d i c a t e t h a t PLRV r e p l i c a t e s w i t h i n t h e v e c t o r . E s k a n d a r i e t a l . (1979) were u n a b l e t o c o n f i r m t h i s , and H a r r i s o n (1958) and MacCarthy (1954) found t h a t v i r u s c o n t e n t o f a p h i d s d e c r e a s e s when t h e y are kept on immune p l a n t s . Tamada and H a r r i s o n (1981) found t h a t a f t e r an a c q u i s i t i o n p e r i o d t h e PLRV c o n t e n t o f t h e a p h i d s was o b s e r v e d t o d e c r e a s e i n two d i s t i n c t p h a s es. F i r s t t h e r e was a b r i e f but r a p i d temperature-dependent d e c r e a s e o c c u r r i n g 2-3 days a f t e r a c q u i s i t i o n . T h i s was f o l l o w e d by a slow t e m p e r a t u r e - i n d e p e n d e n t d e c r e a s e o c c u r r i n g o v e r s e v e r a l weeks. M. euphorbiae not o n l y a c q u i r e d s i m i l a r l e v e l s o f PLRV as d i d M. persicae but a l s o had t h e same d e c r e a s e p r o f i l e . The f i r s t r a p i d but b r i e f d e c r e a s e p r o b a b l y r e p r e s e n t s t h o s e v i r u s p a r t i c l e s c o n t a i n e d w i t h i n t h e midgut. The second s l o w e r d e c r e a s e p r o b a b l y r e p r e s e n t s v i r u s p a r t i c l e s i n o t h e r p a r t s o f t h e a p h i d body i . e . t h e haemocoele. I t would seem t h a t b o t h M. persicae and M. euphorbiae have a s i m i l a r d i s t r i b u t i o n o f v i r u s w i t h i n t h e i r t i s s u e s and t h e v i r u s must be a b l e t o pass from gut t o haemocoele i n b o t h a p h i d s . T h e r e f o r e , t h e gut w a l l cannot be r e s p o n s i b l e f o r t h e s p e c i f i c i t y o f t r a n s m i s s i o n . V i r u s i n j e c t e d 10 i n t o t h e haemocoele was not d e t e c t e d w i t h i n t h e a p h i d g u t , s u g g e s t i n g t h a t i t does not pass from t h e haemolymph i n t o t h e gut ( P a l i w a l and S i n h a , 1970). Thus, i t appears t h a t t h e s e c i r c u l a t i v e v i r u s e s t a k e advantage o f t h e normal f o o d a b s o r p t i v e mechanism i n t h e i r movement from gut t o haemocoele. 2.1.3 V e c t o r S p e c i f i c i t y f o r PLRV Once i n t h e haemocoele, t h e v i r u s p e r s i s t s w i t h i n t h e a p h i d v e c t o r , o f t e n f o r t h e d u r a t i o n o f i t s l i f e , b ut t h e v i r u s must move t o t h e s a l i v a r y s y r i n g e b e f o r e t r a n s m i s s i o n can o c c u r ( H a r r i s o n , 1984) . C o n s i s t e n t o b s e r v a t i o n s o f n o n p r o p a g a t i v e c i r c u l a t i v e v i r u s e s i n s p e c i f i c membrane s t r u c t u r e s have i n d i c a t e d t h a t t h e a c c e s s o r y s a l i v a r y g l a n d i s t h e s i t e o f c e l l u l a r t r a n s p o r t o f t h e v i r u s t h r o u g h t o t h e s a l i v a r y d u c t . Other v i r u s e s o r s t r a i n s o f v i r u s not t r a n s m i t t e d by t h e a p h i d v e c t o r were not a s s o c i a t e d w i t h t h e a c c e s s o r y s a l i v a r y g l a n d c e l l s o r t h e i r b a s a l l a m i n a (Gildow, 1982). There i s an e x t r e m e l y h i g h degree o f s p e c i f i c i t y between i n d i v i d u a l l u t e o v i r u s e s and t h e a c c e s s o r y s a l i v a r y g l a n d s o f t h e i r p a r t i c u l a r a p h i d v e c t o r s . T h i s s p e c i f i c i t y appears t o r e s i d e i n two d i f f e r e n t membrane s t r u c t u r e s , t h e b a s a l l a m i n a and plasmalemma. The a c c e s s o r y s a l i v a r y g l a n d o f an a p h i d i s f o u r - c e l l e d . Each s e c r e t o r y c e l l i s su r r o u n d e d by an e x t r a c e l l u l a r b a s a l l a m i n a (Ponsen, 1977) which i s a f i b r o u s network o f c o l l a g e n , p r o t e i n , and c a r b o h y d r a t e s (Gildow, 1982) . G i l d o w (1982) showed 11 t h a t v i r u s - l i k e p a r t i c l e s were c o n s i s t e n t l y found i n t h e b a s a l l a m i n a o f a c c e s s o r y s a l i v a r y g l a n d s o f M. persicae f e d PLRV, but p a r t i c l e s were never o b s e r v e d i n t h e b a s a l l a m i n a o f o t h e r t i s s u e s , not even t h e p r i n c i p a l s a l i v a r y g l a n d . These p a r t i c l e s were c o n f i r m e d as PLRV by f e r r i t i n - a n t i b o d y l a b e l l i n g o f d i s s e c t e d s a l i v a r y g l a n d s . S i m i l a r f i n d i n g s have been r e p o r t e d f o r t h e o t h e r c i r c u l a t i v e v i r u s e s , i n c l u d i n g BWYV (Gildow, 1982), BYDV (Gildow and Rochow, 1980a), and pea e n a t i o n mosaic v i r u s (PEMV) ( H a r r i s e t a l . , 1975). S t r u c t u r a l d i f f e r e n c e s between b a s a l l a m i n a o f d i f f e r e n t t i s s u e s and t h e a b i l i t y o f b a s a l l a m i n a t o s e l e c t and f i l t e r out m o l e c u l e s by s i z e and charge have been r e p o r t e d (Gildow, 1982) . P r o t e i n a s s o c i a t e d w i t h t h i s membrane s t r u c t u r e may a l s o be i n v o l v e d i n t h e v i r a l s p e c i f i c i t y . P r o t e i n s i n t h e plasmalemma o f t h e a c c e s s o r y s a l i v a r y g l a n d c e l l s have been shown t o f u n c t i o n as h i g h l y s p e c i f i c v i r u s r e c e p t o r s (Gildow, 1982). L i k e BYDV (Gildow and Rochow, 1980b), t h e PLRV c o a t p r o t e i n appears t o be i n v o l v e d i n t h e t r a n s m i s s i o n s p e c i f i c i t y o b s e r v e d amongst a p h i d s (Gildow and Rochow, 1980b). Two m o n o c l o n a l a n t i b o d i e s were i d e n t i f i e d by M a s s a l s k i and H a r r i s o n (1987) t h a t r e a c t e d w i t h 28 r e a d i l y a p h i d t r a n s m i s s i b l e PLRV i s o l a t e s but f a i l e d t o r e a c t w i t h two i s o l a t e s t h a t were p o o r l y t r a n s m i t t e d by a p h i d s . Presumably, t h e two a n t i b o d i e s are b i n d i n g t o an e p i t o p e r e q u i r e d f o r a p h i d t r a n s m i s s i o n . They d i d not r e p o r t whether t h e s e m o n o c l o n a l s were a b l e t o p r e v e n t a p h i d t r a n s m i s s i o n o f t h e 28 a p h i d t r a n s m i s s i b l e i s o l a t e s . 12 2 . 2 S t r u c t u r e o f t h e L u t e o v i r u s Genome 2 . 2 . 1 P h y s i c a l P r o p e r t i e s o f PLRV A d i s e a s e r e f e r r e d t o as t h e " c u r l " was r e p o r t e d i n 1775 w h i c h has s i n c e been a t t r i b u t e d t o PLRV ( B a g n a l l , 1988). I t was not u n t i l 1916 t h a t t h e i n f e c t i o u s n a t u r e o f PLRV was d e m o n s t r a t e d (Quanjer e t al., 1916). A l t h o u g h i s o m e t r i c p a r t i c l e s a p p r o x i m a t e l y 24 nm i n d i a m e t e r were i d e n t i f i e d by P e t e r s (1967), t h e p r o p e r t i e s o f t h e v i r u s remained unknown u n t i l 1979 (Rowhani and S t a c e - S m i t h , 1979) . The d e n s i t y i n cesium c h l o r i d e s u g g e s t e d a n u c l e i c a c i d c o n t e n t o f 28% and n u c l e a s e d i g e s t i o n s t u d i e s i n d i c a t e d a s i n g l e - s t r a n d e d RNA genome. G e l e l e c t r o p h o r e s i s o f t h e RNA s u g g e s t e d a r e l a t i v e m o l e c u l a r mass (Mr) o f 2.0 X 10 6. S i m i l a r a n a l y s i s o f t h e c o a t p r o t e i n s u b u n i t i n d i c a t e d a Mr o f 26,300. The v i r u s appears t o have 180 c o a t p r o t e i n s u b u n i t s f o r each p a r t i c l e . P o l y c l o n a l a n t i s e r a were f i r s t p r oduced a g a i n s t p u r i f i e d PLRV and s u c c e s s f u l l y used i n ELISA t o d e t e c t PLRV by Casper (1977) . Mouse mono c l o n a l a n t i b o d i e s were p r e p a r e d a g a i n s t a Canadian i s o l a t e o f PLRV by M a r t i n and S t a c e - S m i t h (1984) . Use o f t h e s e m o n o c l o n a l a n t i b o d i e s as secondary a n t i b o d y i n ' double or t r i p l e a n t i b o d y ELISA g r e a t l y enhanced t h e s p e c i f i c i t y and s e n s i t i v i t y o f PLRV d e t e c t i o n . D'Arcy e t al. (1989) found up t o f i v e e p i t o p e s on i n d i v i d u a l l u t e o v i r u s e s and showed t h a t s e v e r a l were s h a r e d between v i r u s e s . 13 2 . 2 . 2 M o l e c u l a r P r o p e r t i e s o f PLRV Recent d e t e r m i n a t i o n o f t h e n u c l e o t i d e sequences f o r t h r e e d i f f e r e n t l u t e o v i r u s e s has c o n t r i b u t e d g r e a t l y t o t h e knowledge o f genome o r g a n i z a t i o n , e x p r e s s i o n s t r a t e g y , and gene f u n c t i o n ( r e v i e w e d by M a r t i n e t al., 1990). The complete n u c l e o t i d e sequence o f BYDV-PAV ( M i l l e r e t a l . , 1988a), BWYV ( V e i d t e t al., 1988), and PLRV (Mayo e t al., 1989; Van der W i l k e t al., 1989; Keese et al., 1990) i n a d d i t i o n t o t h e p a r t i a l sequences o f soybean dwarf v i r u s (SDV) and c a r r o t r e d l e a f v i r u s (CRLV) ( M a r t i n e t al., 1990) has e n a b l e d t h e i d e n t i f i c a t i o n o f s i m i l a r i t i e s and d i f f e r e n c e s between l u t e o v i r u s genomes and p u t a t i v e gene p r o d u c t s . There appear t o be two d i f f e r e n t genome o r g a n i z a t i o n s w i t h i n t h e l u t e o v i r u s group. One o r g a n i z a t i o n i s r e p r e s e n t e d by BYDV-PAV and SDV and t h e o t h e r by PLRV, BWYV, and CRLV ( F i g u r e 1 ) . Each l u t e o v i r u s has a p o s i t i v e - s e n s e , s i n g l e - s t r a n d e d RNA genome o f Mr 1.8 t o 2.0 X 10 6 ( H a r r i s o n , 1984). There i s no e v i d e n c e o f a 3' p o l y a d e n y l a t e d t a i l o r any 3' t R N A - l i k e s t r u c t u r e (Mayo e t al., 1982). A 5' v i r a l g e nome-linked p r o t e i n (VPg) has been r e p o r t e d f o r b o t h PLRV (Mayo e t a l . , 1982) and BYDV-PAV (Murphy et al., 1989). Each l u t e o v i r u s t h a t has been sequenced has a s h o r t u n t r a n s l a t e d r e g i o n a t t h e 5' and 3' ends. 2 . 2 . 2 . 1 L u t e o v i r u s Genome O r g a n i z a t i o n s S e v e r a l s t r u c t u r a l f e a t u r e s o f t h e l u t e o v i r u s genome have been d e t e r m i n e d from t h e i r n u c l e o t i d e sequences. S i x open 14 PLRV GENOME ORGANIZATION (5.88 kb) 5' 28 kDa 69 kDa 17 kDa 1 0 I 2 I I 4 1 1 I I 3 | 5 70 kDa 23 kDa 56 kDa BYDV-PAV GENOME ORGANIZATION (5.68 kb) 39 kDa 17 kDa 7 kDa 5' 1 I 4 , [61 I 2 3 1 5 1 60 kDa 22 kDa 50 kDa 0. Function unknown 1. Viral replicase 2. Viral replicase 3. Coat protein 4. Genome linked protein (VPg)? 5. Aphid transmission factor? 6. Function unknown Figure 1. Genomic o r g a n i z a t i o n s r e p o r t e d f o r PLRV and BYDV-PAV. The PLRV genomic o r g a n i z a t i o n t y p i f i e s t h o s e o f BWYV and CRLV and t h e BYDV-PAV i s s i m i l a r t o t h a t o f SDV. Each ORF i s r e p r e s e n t e d by an open box w i t h t h e p r e d i c t e d s i z e o f t h e p r o t e i n p r o d u c t shown above o r below t h e box. Genes w i t h t h e same numbers a r e th o u g h t t o have s i m i l a r f u n c t i o n s . Each ORF i s l a r g e r t h a n 300 n u c l e o t i d e s e x c e p t ORF 6. The ORFs shown o c c u r between t h e f i r s t AUG r e s i d u e and t h e f i r s t t e r m i n a t i o n codon i n t h e same frame, e x c e p t f o r ORFs 2 and 5 which are between two t e r m i n a t i o n codons. r e a d i n g frames (ORFs) have been i d e n t i f i e d i n t h e BYDV-PAV genome and a l s o i n t h e PLRV ( F i g u r e 1) and BWYV genomes. B o t h PLRV and BWYV have a 5' ORF d e s i g n a t e d 0 which encodes a p u t a t i v e p r o t e i n o f 28 and 29 kDa, r e s p e c t i v e l y . T h i s ORF does not o c c u r i n BYDV-15 PAV. Mayo et al. (1989) r e p o r t e d t h a t the p u t a t i v e product of ORF 0 of PLRV was hydrophobic and t h a t the amino terminus was s i m i l a r t o s e v e r a l membrane-associated p r o t e i n s . Van der Wilk et al. (1989) suggested t h a t t h i s p r o t e i n may f u n c t i o n as a protease t o produce VPgs f o r PLRV and BWYV. Over l a p p i n g e x t e n s i v e l y with ORF 0 but i n a d i f f e r e n t r e a d i n g frame i s ORF 1, which i s the f i r s t of f i v e ORFs shown t o occur i n a l l l u t e o v i r u s e s sequenced t o date. The p u t a t i v e t r a n s l a t i o n a l products have molecular weights of 70, 66, and 39 kDa f o r PLRV, BWYV, and BYDV-PAV, r e s p e c t i v e l y . I t has been proposed t h a t ORF 2 i s expressed by a t r a n s l a t i o n a l f r a m e s h i f t o c c u r r i n g w i t h i n an o v e r l a p of ORFs 1 and 2 ( M i l l e r et al., 1988a). The 5' t e r m i n a l p o r t i o n of ORF 2 from PLRV, BWYV, or BYDV-PAV o v e r l a p s the 3' terminus of ORF 1 by 289, 474, and 13 n u c l e o t i d e s , r e s p e c t i v e l y . T h i s p u t a t i v e f u s i o n p r o t e i n has been i d e n t i f i e d as the r e p l i c a s e , based on the presence of the v i r a l polymerase amino a c i d consensus sequence GXXXTXXXN (X) 20_40GDD (Kamer and Argos, 1984) which i s present i n ORF 2. An u n t r a n s l a t e d r e g i o n of 197, 202, or 116 n u c l e o t i d e s occurs between ORF 2 and 3 of PLRV, BWYV, and BYDV-PAV, r e s p e c t i v e l y . These regions c o n t a i n repeated UnA n u c l e o t i d e sequences f o l l o w e d by AAGA (Mayo et al., 1989), two f e a t u r e s proposed by Marsh et al. (1988) t o be i n v o l v e d i n the p r o d u c t i o n of subgenomic RNAs. Subgenomic RNAs from t h i s r e g i o n o f the genome have been r e p o r t e d f o r PLRV (Mayo and Barker, 1984) and BYDV-PAV ( M i l l e r et al., 1988a). U n t r a n s l a t e d l e a d e r sequences 16 o f p o l i o v i r u s which a r e a l s o r i c h i n adenine and u r i d i n e r e s i d u e s s e r v e as " r i b o s o m a l l a n d i n g pads" f o r i n t e r n a l t r a n s l a t i o n a l i n i t i a t i o n ( P e l l e t i e r and Sonenberg, 1988). T h i s PLRV u n t r a n s l a t e d r e g i o n may a l l o w i n t e r n a l t r a n s l a t i o n a l i n i t i a t i o n t o o c c u r from subgenomic o r genomic RNA. Beyond t h e i n t e r n a l u n t r a n s l a t e d r e g i o n i s ORF 3 e n c o d i n g a 22 t o 23 kDa p r o t e i n . M i l l e r et al. (1988b) d e m o n s t r a t e d t h a t t h i s c e n t r a l l y l o c a t e d ORF encodes t h e BYDV-PAV c o a t p r o t e i n . They found t h a t t h e amino a c i d sequences o f t r y p t i c fragments o f p u r i f i e d c o a t p r o t e i n c o i n c i d e d w i t h t h e amino a c i d sequence deduced from t h e n u c l e o t i d e sequence o f ORF 3. S e r o l o g i c a l d e t e c t i o n o f ORF 3, e x p r e s s e d as a b a c t e r i a l f u s i o n p r o t e i n , w i t h a n t i s e r u m t o whole v i r u s c o n f i r m e d t h e ORF 3 p r o d u c t as t h e c o a t p r o t e i n s u b u n i t . S i m i l a r s e r o l o g i c a l s t u d i e s o f BWYV ( V e i d t et al., 1988), PLRV, and SDV ( M a r t i n e t al., 1990) d e m o n s t r a t e d t h a t ORF 3 encodes t h e c o a t p r o t e i n gene. C o n t a i n e d c o m p l e t e l y w i t h i n ORF 3 but i n a d i f f e r e n t r e a d i n g frame i s ORF 4 which encodes p u t a t i v e p r o t e i n s r a n g i n g from 17 t o 20 kDa. M i l l e r et al. (1988b) have s u g g e s t e d t h a t ORF 4 encodes t h e VPg s i n c e i t i s s i m i l a r t o t h e VPg i s o l a t e d from BYDV-RPV (Murphy e t a l . , 1989) . Pea e n a t i o n mosaic v i r u s (PEMV), an u n c l a s s i f i e d v i r u s , which has many p r o p e r t i e s i n common w i t h t h e l u t e o v i r u s e s a l s o has a VPg o f 17 kDa (Reisman and de Zoeten, 1982). However, t h e VPg o f PLRV has been r e p o r t e d t o be o n l y 7 kDa (Mayo e t al. 1982). I t has been s u g g e s t e d t h a t t h e ORF 4 p r o d u c t s e r v e s as a p r e c u r s o r from which t h e VPg i s d e r i v e d (Van 17 der W i l k e t al., 1989). A s i m i l a r mechanism f o r VPg m a t u r a t i o n i n v o l v i n g a membrane-bound p r o t e a s e o f v i r u s o r i g i n has been p r o p o s e d f o r cowpea mosaic v i r u s (Goldbach and van Kammen, 1985) . The l a s t ORF s h a r e d by a l l l u t e o v i r u s e s , ORF 5, i s s e p a r a t e d from ORF 4 by an amber t e r m i n a t i o n codon. S i n c e t h e r e a d i n g frame o f ORF 4 i s m a i n t a i n e d i n ORF 5, t h e r e s u l t i n g r e a d t h r o u g h t r a n s l a t i o n a l p r o d u c t , i f produced, would be l a r g e r t h a n t h e 50 t o 56 kDa p r o t e i n e x p e c t e d from ORF 5. E v i d e n c e i n d i c a t e s t h a t t h i s ORF may be e x p r e s s e d by t r a n s l a t i o n a l r e a d t h r o u g h o f t h e amber t e r m i n a t i o n codon of t h e c o a t p r o t e i n gene. I n a d d i t i o n t o t h e c o a t p r o t e i n a l a r g e m o l e c u l a r weight p o l y p e p t i d e o f a p p r o x i m a t e l y 60 kDa has been o b s e r v e d on d e n a t u r i n g p o l y a c r y l a m i d e g e l s . T h i s l a r g e p r o t e i n o c c u r s a t a l o w e r c o n c e n t r a t i o n t h a n t h e c o a t p r o t e i n (Waterhouse e t al., 1989). A n t i b o d i e s produced a g a i n s t whole BYDV-PAV p a r t i c l e s o r a f u s i o n p r o t e i n o f t h e c o a t p r o t e i n ORF 3 r e a c t e d w i t h b o t h t h e c o a t p r o t e i n and t h e l a r g e r 60 kDa p r o t e i n (Waterhouse e t al., 1989) . R e a c t i o n o f c o a t p r o t e i n s p e c i f i c a n t i s e r u m w i t h t h e l a r g e r m o l e c u l a r w eight p r o t e i n i n d i c a t e s t h a t t h e l a r g e r p r o t e i n c o n t a i n s a c o a t p r o t e i n component. A n t i b o d i e s p r e p a r e d t o whole v i r u s p a r t i c l e s were a f f i n i t y p u r i f i e d u s i n g t h e f u s i o n p r o t e i n o f ORF 5. These a n t i b o d i e s and t h o s e p r e p a r e d t o t h e f u s i o n p r o t e i n o f ORF 5 d e t e c t e d o n l y t h e l a r g e r m o l e c u l a r weight p r o t e i n i n d i c a t i n g t h a t t h e l a r g e r p r o t e i n has t h e r e a d t h r o u g h component ( M a r t i n e t al., 1990). The l a r g e p r o t e i n had a s m a l l e r t h a n e x p e c t e d s i z e , 60 kDa i n s t e a d o f 72 kDa. T h i s s m a l l e r s i z e 18 may be t h e r e s u l t o f p r o t e i n c o n f o r m a t i o n a r i s i n g from a p r o l i n e -r i c h a r e a i n t h e amino t e r m i n u s o f t h e r e a d t h r o u g h , o f p o s t -t r a n s l a t i o n a l m o d i f i c a t i o n , o r d e g r a d a t i o n ( M a r t i n e t al., 1990). H a r r i s o n (1984) r e p o r t e d s m a l l p r o j e c t i o n s a t t h e v e r t i c e s o f PLRV. I t has been found t h a t a n t i s e r a t o t h e BYDV-PAV ORF 5 f u s i o n p r o t e i n d e c o r a t e d and p r e c i p i t a t e d v i r u s p a r t i c l e s ( M a r t i n e t al., 1990). I t was a l s o shown t h a t t h e ORF 5 p r o t e i n c o u l d be removed from t h e s u r f a c e o f v i r u s p a r t i c l e s by t r y p s i n d i g e s t i o n showing t h a t t h e r e a d t h r o u g h p o r t i o n o f t h e p r o t e i n i s on t h e s u r f a c e o f t h e v i r u s p a r t i c l e . M a r t i n e t al. (1990) have s u g g e s t e d t h a t t h e p r o t e i n , because o f i t s a c c e s s i b i l i t y , may be r e s p o n s i b l e f o r a p h i d s p e c i f i c i t y a t t h e l e v e l o f t r a n s p o r t a t i o n from t h e haemolymph i n t o t h e s a l i v a r y d u c t . An a d d i t i o n a l ORF a t t h e 3' end o f BYDV-PAV t h a t c o u l d encode a 6.7 kDa p r o t e i n has been r e p o r t e d by M i l l e r e t al., (1988a). They found t h a t t h i s ORF o c c u r s a t t h e 5' end o f a subgenomic RNA. However, whether t h e p r o t e i n i s e x p r e s s e d o r what i t s p o s s i b l e f u n c t i o n may be has y e t t o be dem o n s t r a t e d . 2 . 2 . 2 . 2 S t r a t e g i e s Used t o T r a n s l a t e L u t e o v i r u s Genes T r a n s l a t i o n o f l u t e o v i r u s genes appears t o i n v o l v e s e v e r a l d i f f e r e n t s t r a t e g i e s . As w i t h o t h e r p o s i t i v e - s e n s e RNAs, t h e 5' gene i s p r o b a b l y t h e f i r s t t o be t r a n s l a t e d . S i n c e t h e RNA l a c k s a 5' cap s t r u c t u r e a t i t s t e r m i n u s , t h e mechanism o f t r a n s l a t i o n a l i n i t i a t i o n p r o b a b l y d i f f e r s from t h a t o f c e l l u l a r mRNA w i t h a 5' cap. The mechanism o f i n i t i a t i o n may i n v o l v e 19 ribosome r e c o g n i t i o n o f an i n t e r n a l p o r t i o n o f t h e 5' u n t r a n s l a t e d l e a d e r sequence, as o c c u r s i n t h e VPg c o n t a i n i n g p o l i o v i r u s ( P e l l e t i e r and Sonenberg, 1988) . In v i t r o t r a n s l a t i o n s t u d i e s w i t h PLRV r e s u l t e d i n two p r o m i n e n t p r o d u c t s o f 28 kDa and 70 kDa (Mayo e t al., 1989) . Based on s i z e t h e s e p o l y p e p t i d e s were a t t r i b u t e d t o ORFs 0 and 1, r e s p e c t i v e l y . I t was s u g g e s t e d t h a t some o f t h e ribosomes s c a n n i n g t h e 5' end o f t h e RNA pass t h e s t a r t AUG codon o f ORF 0 and i n s t e a d i n i t i a t e t r a n s l a t i o n 133 n u c l e o t i d e s downstream a t t h e AUG o f ORF 1. Such a mechanism would r e q u i r e t h e sequence s u r r o u n d i n g t h e AUG o f ORF 0 t o be i n e f f i c i e n t f o r ribosome r e c o g n i t i o n . The s u r r o u n d i n g n u c l e o t i d e sequence does not c o r r e s p o n d t o e i t h e r t h e p l a n t (Lutcke e t al., 1987) o r a n i m a l (Kozak, 1986) o p t i m a l consensus sequence f o r ribosome r e c o g n i t i o n . F u r thermore s e v e r a l examples e x i s t , a l l v i r a l (Kozak, 1986), i n which ribosomes d i r e c t t h e s y n t h e s i s o f two s e p a r a t e l y i n i t i a t e d p o l y p e p t i d e s from t h e same RNA sequence. M i l l e r e t al. (1988a) p r o p o s e d t h a t ORF 2 was e x p r e s s e d by a t r a n s l a t i o n a l f r a m e s h i f t o f -1 t h a t p e r m i t t e d ribosomes t o bypass t h e s t o p codon at t h e 3' end o f ORF 1. T h i s would r e s u l t i n t h e p r o d u c t i o n o f a f u s i o n p r o t e i n w i t h a m o l e c u l a r w e i g ht o f 118, 115, and 99 kDa f o r PLRV, BWYV, and BYDV-PAV, r e s p e c t i v e l y . In v i t r o t r a n s l a t i o n o f PLRV RNA produced a s m a l l amount o f 125 kDa p r o t e i n which, based on s i z e , was a t t r i b u t e d t o a t r a n s l a t i o n a l f u s i o n o f ORFs 1 and 2 (Mayo et al., 1989). S e v e r a l o t h e r o b s e r v a t i o n s s u p p o r t t h e s u g g e s t i o n t h a t ORFs 20 1 and 2 a r e b o t h e x p r e s s e d and t h a t a t r a n s l a t i o n a l f r a m e s h i f t i s i n v o l v e d . M i l l e r e t al. (1988a) found t h a t c l o n e s from 2 d i f f e r e n t s o u r c e s o f BYDV-PAV had 15 base s u b s t i t u t i o n s w i t h i n ORFs 1 and 2 but none r e s u l t e d i n amino a c i d changes. T h i s s u g g e s t s t h a t t h e amino a c i d s a r e c o n s e r v e d and t h e genes a r e f u n c t i o n a l . They found t h a t amino a c i d sequence s i m i l a r i t y w i t h o t h e r v i r a l r e p l i c a s e s began a t t h e 5' end o f BYDV-PAV ORF 2 whic h i s 94 amino a c i d s b e f o r e t h e f i r s t m e t h i o n i n e o f ORF 2. The f i r s t p o t e n t i a l i n i t i a t i o n codon f o r ORF 2 o f b o t h PLRV and BWYV i s a l s o w e l l downstream o f t h e t e r m i n a t i o n codon o f ORF 1, by 300 and 216 n u c l e o t i d e s , r e s p e c t i v e l y ( M a r t i n e t al., 1 9 9 0 ) . RNA secondary s t r u c t u r e s u r r o u n d i n g p r o p o s e d f r a m e s h i f t s i t e s s h a r e s p r o p e r t i e s w i t h RNAs o f r e t r o v i r u s e s and c o r o n a v i r u s e s i n which r e p l i c a s e gene f r a m e s h i f t s a r e known t o o c c u r . BYDV-PAV c l o s e l y resembles t h e s e v i r u s e s i n h a v i n g an UUUA sequence p r e c e d i n g t h e stem-loop s t r u c t u r e ( M i l l e r e t al., 1988a). B o t h PLRV and BWYV a l s o form secondary s t r u c t u r e i n t h e pr o p o s e d f r a m e s h i f t r e g i o n but t h i s shows l i t t l e resemblance t o t h e BYDV-PAV secondary s t r u c t u r e and l a c k s t h e c h a r a c t e r i s t i c f r a m e s h i f t sequence. Mayo e t al. (198 9) s u g g e s t e d t h a t t h e f r a m e s h i f t was a s s o c i a t e d w i t h t h e o c c u r r e n c e o f G r e s i d u e s i n th e second p o s i t i o n o f codons and t h a t t h e s e G r e s i d u e s a r e s w i t c h e d t o t h e p r e f e r r e d G - non G - N sequence. Those genes l o c a t e d on t h e 3 ' p o r t i o n o f t h e genome i n c l u d e ORFs 3, 4, 5, and 6 ( F i g u r e 1 ) . ORFs 3, 4, and 5 appear t o be e x p r e s s e d from one subgenomic RNA and ORF 6 i s tho u g h t t o be 21 e x p r e s s e d from a n o t h e r subgenomic RNA. Mayo e t al. (1989) s u g g e s t e d t h a t t h e subgenomic fragment o f PLRV RNA may i n i t i a t e from w i t h i n t h e u n t r a n s l a t e d r e g i o n upstream from ORF 3. T h i s r e g i o n has two c o n s e r v e d sequences, r e p e a t e d UnA sequences f o l l o w e d by AAGA, t h a t a r e thought t o be a s s o c i a t e d w i t h t h e f o r m a t i o n o f subgenomic RNAs (Marsh e t al., 1988). E v i d e n c e from brome mosaic v i r u s i n d i c a t e s t h a t t h e v i r u s r e p l i c a s e r e c o g n i z e s an i n t e r n a l subgenomic promoter on t h e n e g a t i v e - s e n s e RNA and produces p o s i t i v e - s e n s e subgenomic RNA ( M i l l e r e t al., 1985). I f a subgenomic RNA i s used t o t r a n s l a t e ORFs 3, 4, and 5 as was s u g g e s t e d by Mayo et al. (1989), t h e AUG o f ORF 3 b e i n g t h e most 5', may be t h e f i r s t t o be r e c o g n i z e d f o r i n i t i a t i o n o f t r a n s l a t i o n by s c a n n i n g ribosomes. The i n i t i a t i o n s i t e f o r PLRV ORF 4 i s o n l y 2 6 n u c l e o t i d e s downstream o f t h e p u t a t i v e i n i t i a t i o n s i t e o f ORF 3 (Mayo e t al., 1989) and may be t r a n s l a t e d by ribosomes t h a t have bypassed t h e i n i t i a t i o n s i t e o f ORF 3 ( i . e . l e a k y s c a n n i n g , see Kozak, 1986). The n u c l e o t i d e sequences s u r r o u n d i n g t h e AUG o f ORF 3 a r e s i m i l a r f o r BWYV, PLRV, and BYDV-PAV. None o f t h e s e resemble t h e o p t i m a l consensus sequences o f p l a n t ( Lutcke e t al., 1987) o r a n i m a l (Kozak, 1986) mRNAs. In v i t r o t r a n s c r i p t i o n and t r a n s l a t i o n o f cDNA c l o n e s from BWYV RNA i n d i c a t e d t h a t an RNA m o l e c u l e w i t h 170 n u c l e o t i d e s 5' t o t h e c o a t p r o t e i n gene s t a r t codon c o u l d e x p r e s s b o t h ORFs 3 and 4 ( V e i d t e t al., 1988). E x p r e s s i o n o f ORF 5 i s thought t o o c c u r by t r a n s l a t i o n a l r e a d t h r o u g h o f t h e amber t e r m i n a t i o n codon o f ORF 3. Waterhouse 22 et al. (1989) p r o v i d e d evidence t h a t ORF 5 i s a s u r f a c e component of the BYDV-PAV p a r t i c l e . V e i d t et al. (1988) found t h a t in vitro t r a n s c r i p t i o n and t r a n s l a t i o n of cDNA with the amber codon produced p o l y p e p t i d e s corresponding t o the s i z e expected of the readthrough. The sequence surrounding the ORF 3 amber codon CCAAAUAGGU i s i d e n t i c a l i n PLRV, BWYV, SDV, and BYDV-PAV (Martin et al., 1990). Moreover, t h i s sequence i s s i m i l a r t o t h a t around UAG t e r m i n a t i o n codons of other v i r u s RNAs t h a t are thought t o be read through d u r i n g t r a n s l a t i o n ( M i l l e r et al., 1 9 8 8 a ) . M i l l e r et al. (1988a) have i d e n t i f i e d a 0.8 kb subgenomic RNA from BYDV-PAV which mapped t o the r e g i o n of ORF 6. T h i s subgenomic, t o g e t h e r with the occurrence of numerous base s u b s t i t u t i o n s which code only f o r c o n s e r v a t i v e amino a c i d changes, suggests t h a t ORF 6 may be f u n c t i o n a l . 2.2.2.3 L u t e o v i r u s E v o l u t i o n a r y R e l a t i o n s h i p s No e r r o r - c o r r e c t i n g mechanism has been r e p o r t e d f o r RNA r e p l i c a s e s and the e r r o r r a t e has been es t i m a t e d at one i n 10"4 n u c l e o t i d e s (Eigen and Schuster, 1977). T h i s i s thought t o r e s u l t i n p o p u l a t i o n s of d i f f e r e n t sequences c l u s t e r e d around a dominant sequence. A comparison of 2208 n u c l e o t i d e s from two d i f f e r e n t i s o l a t e s of BWYV has been r e p o r t e d (Veidt et al., 1988). These i s o l a t e s were ob t a i n e d from two d i f f e r e n t h osts from d i f f e r e n t g e o g r a p h i c a l l o c a t i o n s . T h i s comparison found 145 n u c l e o t i d e d i f f e r e n c e s w i t h i n ORFs 3, 4, and 5. These changes are not evenly d i s t r i b u t e d along the sequence, with 6 changes i n 23 ORF 3, 17 changes i n t h e r e g i o n o f t h e ORFs 3 and 4 o v e r l a p , and 122 i n ORF 5. A p p a r e n t l y , t h e o v e r l a p o f ORFs 3 and 4 imposes c o n s t r a i n t s on t h e m u t a t i o n r a t e . A l l 17 n u c l e o t i d e changes i n th e r e g i o n o f o v e r l a p r e s u l t i n an amino a c i d change i n one o r b o t h o f t h e c o r r e s p o n d i n g amino a c i d sequences. T h i r t y n u c l e o t i d e changes o c c u r r e d i n t h e 5'- 571 n u c l e o t i d e s o f ORF 5 but a l l were s i l e n t . The n u c l e o t i d e changes i n t h e r e m a i n i n g 3' t e r m i n u s o f t h a t ORF 5, however, r e s u l t i n f r e q u e n t amino a c i d s u b s t i t u t i o n s w hich s u g g e s t s ORF 5 has two domains. Keese e t al. (1990) compared t h e n u c l e o t i d e sequence o f f o u r PLRV i s o l a t e s from d i f f e r e n t g e o g r a p h i c a l l o c a t i o n s . The A u s t r a l i a n PLRV i s o l a t e had t h e most d i v e r g e n t genome w i t h about 93% s i m i l a r i t y t o t h e Canadian, N e t h e r l a n d s , and S c o t t i s h i s o l a t e s w hich share 98% n u c l e o t i d e sequence s i m i l a r i t y . Most o f th e n u c l e o t i d e sequence v a r i a t i o n o c c u r s i n ORF 1. The c o a t p r o t e i n gene (ORF 3) had t h e most h i g h l y c o n s e r v e d amino a c i d sequence. The amino a c i d sequence o f ORF 0 was a l s o h i g h l y c o n s e r v e d amongst t h e 4 PLRV i s o l a t e s but showed l i t t l e s i m i l a r i t y t o ORF 0 o f BWYV ( M a r t i n et al., 1990). P r e v i o u s s e r o l o g i c a l and c y t o p a t h o l o g i c a l s t u d i e s have s u g g e s t e d t h a t t h e l u t e o v i r u s e s c o u l d be c l a s s i f i e d i n t o two subgroups ( G i l l and Chong, 1979). T h i s concept i s s u p p o r t e d a t t h e n u c l e o t i d e l e v e l by d i f f e r e n c e s e s p e c i a l l y i n t h e 5' p o r t i o n o f t h e genomes. These d i f f e r e n c e s i n c l u d e (1) t h e p r e s e n c e o f ORF 0 i n BWYV, PLRV, and CRLV, (2) a l o n g o v e r l a p t h a t o c c u r s between ORFs 1 and 2 i n t h e PLRV subgroup, (3) a d i f f e r e n t 24 s t r u c t u r a l f e a t u r e i n t h e p r o p o s e d f r a m e s h i f t a r e a o f ORF 1 and 2 o f t h e two subgroups, and (4) t h e l a c k o f sequence s i m i l a r i t y between ORF 1 and 2 o f t h e d i f f e r e n t subgroups. Based on s e r o l o g i c a l , c y t o p a t h o l o g i c a l , and m o l e c u l a r e v i d e n c e one subgroup i n c l u d e s BYDV-PAV, BYDV-MAV, and BYDV-SGV s e r o t y p e s and SDV; t h e o t h e r subgroup c o n s i s t s o f PLRV, BWYV, BYDV-RPV and BYDV-RMV s e r o t y p e s , and CRLV ( M a r t i n e t al., 1990) . 2.3 V i r u s Induced R e s i s t a n c e 2.3.1 C r o s s - p r o t e c t i o n S i n c e t h e f i r s t r e p o r t o f " c r o s s - p r o t e c t i o n " between p l a n t v i r u s e s (McKinney, 1929), t h e v a r i o u s i n t e r a c t i o n s t h a t o c c u r between v i r u s e s have r e c e i v e d i n t e n s e i n v e s t i g a t i o n . McKinney r e p o r t e d t h a t a p l a n t i n o c u l a t e d w i t h one s t r a i n o f a v i r u s ( i n d u c e r ) f a i l e d t o d e v e l o p t h e symptoms t y p i c a l o f a second s t r a i n ( c h a l l e n g e r ) upon i n o c u l a t i o n w i t h t h a t s t r a i n . The two v i r u s e s c o u l d be i n t r o d u c e d s i m u l t a n e o u s l y t o d i f f e r e n t p a r t s o f t h e p l a n t or t h e y c o u l d be i n t r o d u c e d s e q u e n t i a l l y . These o b s e r v a t i o n s were c o n f i r m e d by Thung (1931) who o b s e r v e d t h a t t h e c h a l l e n g e v i r u s c o u l d not be r e c o v e r e d from p r o t e c t e d p l a n t s by subsequent t r a n s m i s s i o n t o i n d i c a t o r p l a n t s . Thus t h e g e n e r a l i z a t i o n was made t h a t t h e c h a l l e n g e r s t r a i n does not r e p l i c a t e i f t h e p l a n t had p r e v i o u s l y been i n o c u l a t e d w i t h a p r o t e c t i n g s t r a i n . There a r e s e v e r a l examples of c h a l l e n g e r r e p l i c a t i o n i n p l a n t s t h a t l a c k or show a d e l a y i n symptoms. T h i s i s c o n t r a r y 25 t o t h e e a r l y c o n c e p t s o f c r o s s - p r o t e c t i o n which assumed t h a t t h e c h a l l e n g e v i r u s cannot i n f e c t a c e l l a l r e a d y i n f e c t e d w i t h a p r o t e c t i n g v i r u s . I t was thought t h a t r e p l i c a t i o n may r e p r e s e n t i n f e c t i o n by t h e c h a l l e n g e v i r u s o f c e l l s w hich had escaped i n o c u l a t i o n w i t h t h e i n d u c e r . O t s u k i and Takebe (1976) and B a r k e r and H a r r i s o n (1978) demonstrated t h a t p r o t o p l a s t s w i t h i n d u c e d r e s i s t a n c e can be s e q u e n t i a l l y i n f e c t e d w i t h a r e l a t e d c h a l l e n g e r but t h a t t h e i n d u c e r - i n f e c t e d p r o t o p l a s t s became i n c r e a s i n g l y r e s i s t a n t t o t h e c h a l l e n g e r as t h e i n t e r v a l between i n o c u l a t i o n s was i n c r e a s e d . A wide d i v e r s i t y o f defense r e s p o n s e s have been r e p o r t e d and r e f e r r e d t o as c r o s s - p r o t e c t i o n . These i n c l u d e a d e c r e a s e i n t h e number o f l e s i o n s , d e c r e a s e i n t h e l e s i o n s i z e , d e c r e a s e i n t h e c o n c e n t r a t i o n o f c h a l l e n g e r v i r u s , and p r e v e n t i o n o r d e l a y o f symptoms. When l e a v e s , i n f e c t e d s y s t e m i c a l l y w i t h a n o t h e r v i r u s , a r e i n o c u l a t e d w i t h a l o c a l l e s i o n - i n d u c i n g v i r u s t h e r e i s o f t e n a r e d u c t i o n i n t h e number of l e s i o n s as compared t o t h a t o b t a i n e d when t h e same v i r u s i s i n o c u l a t e d t o h e a l t h y p l a n t s . T h i s r e s p o n s e has been r e p o r t e d between r e l a t e d v i r u s s t r a i n s ( F u l t o n , 1951; F u l t o n , 1978) and a l s o between u n r e l a t e d v i r u s e s (Thomson, 1958; K a s s a n i s e t al., 1974). S e v e r a l r e p o r t s have shown a d e c r e a s e i n s i z e o f l e s i o n s produced by t h e c h a l l e n g e r i n s y s t e m i c a l l y i n f e c t e d l e a v e s p r e v i o u s l y i n o c u l a t e d w i t h an i n d u c e r (Davis and Ross, 1968; Ross, 1961). R e d u c t i o n i n t h e c o n c e n t r a t i o n a t t a i n e d by t h e c h a l l e n g e r has been r e p o r t e d between u n r e l a t e d (Wenzel, 1971) and r e l a t e d s t r a i n s o f v i r u s 26 ( Z a i t l i n , 1976; Jockusch, 1968). F i n a l l y , the introduction of a challenger into a plant systemically infected with an inducer often r e s u l t s i n a lack or delay of the symptoms attr i b u t e d to the challenger. Closely related strains usually protect more than d i s t a n t l y related strains and although usually r e c i p r o c a l there are examples of u n i d i r e c t i o n a l or no protection i n one d i r e c t i o n . 2.3.2 A c q u i r e d R e s i s t a n c e Another phenomenon, referred to as "acquired resistance", describes a condition i n which the inducer i s not present i n the same c e l l s as the challenger. When plants are hypersensitive to a p a r t i c u l a r virus, a l o c a l i z e d i n f e c t i o n usually r e s u l t s . Although i n f e c t i o n i s l o c a l i z e d , i t affects distant tissues not infected by the v i r u s . Two types of acquired resistance have been described. One type, l o c a l acquired resistance, was characterized by a rin g of viru s - f r e e tissue surrounding a l o c a l l e s i o n which was resist a n t to inoculation with a lesion-forming challenger (Yarwood, 1960) . The other type, systemic acquired resistance, resulted i n the challenger producing smaller lesions i n the leaves above the point of inducer inoculation (Gilpatrick and Weintraub, 1952; Ross, 1961) . 2.3.3 M u t u a l E x c l u s i o n A t h i r d phenomenon referred to as "mutual exclusion" has been described for certain plant viruses. J e d l i n s k i and Brown 27 (1965) r e p o r t e d t h a t simultaneous i n o c u l a t i o n of s e e d l i n g s with t h r e e d i f f e r e n t s t r a i n s of BYDV t h a t d i f f e r e d not o n l y i n v i r u l e n c e but i n v e c t o r s p e c i f i c i t y r e s u l t e d i n complete recovery of the h o s t . Although the host i n i t i a l l y showed m i l d symptoms they d i d not p e r s i s t and v i r u s was not r e c o v e r e d by the v e c t o r s . S i m i l a r r e s u l t s have been r e p o r t e d by V a l e n t a (1959a and 1959b) and F r e i t a g (1964) with c e r t a i n of the yellows group of v i r u s e s t r a n s m i t t e d by l e a f h o p p e r s . BYDV a l s o appears t o c r o s s - p r o t e c t , as does PLRV. Both Webb et al. (1952) and H a r r i s o n (1958) found t h a t a l l s t r a i n s of PLRV p r o v i d e d s u s t a i n e d c r o s s - p r o t e c t i o n , d e f i n e d as a l a c k of symptoms c h a r a c t e r i s t i c of the s t r a i n and absence of v i r u s r e c o v e r y by aphids. T h i s i s s i m i l a r to the r e s u l t s of Smith (1963) and J e d l e n s k i and Brown (1965) with BYDV. 2.3.4 Models for Virus Resistance S e v e r a l hypotheses have been proposed t o e x p l a i n v i r u s -induced p r o t e c t i o n i n c l u d i n g the s e q u e s t e r i n g of c h a l l e n g e r RNA by the i n d u c e r c a p s i d p r o t e i n (de Zoeten and F u l t o n , 1975). I t has been shown t h a t o c c a s i o n a l l y i n a mixed v i r u s i n f e c t i o n , the genome of one p a r e n t a l type i s e n c a p s i d a t e d i n the c a p s i d p r o t e i n of the other (Dodds and Hamilton, 1976) . T h i s phenomenon r e f e r r e d t o as genomic masking occurs r e a d i l y between l u t e o v i r u s e s (Hu et al., 1988). I t i s an a t t r a c t i v e h y p o t h e s i s because genomic masking i s more l i k e l y t o occur between r e l a t e d v i r u s e s than between u n r e l a t e d ones. However, TMV c a p s i d mutants 28 t h a t produce p r o t e i n i n c a p a b l e o f a s s e m b l i n g w i t h TMV RNA a r e s t i l l c a p a b l e o f p r o t e c t i n g t o b a c c o ( Z a i t l i n , 1976) . S i m i l a r r e s u l t s by J o c k u s c h (1968) f o r TMV and by Cadman and H a r r i s o n (1959) f o r t o b a c c o r a t t l e v i r u s (TRV) argue s t r o n g l y t h a t e n c a p s i d a t i o n o f c h a l l e n g e r RNA by t h e c a p s i d p r o t e i n o f t h e i n d u c e r i s not i n v o l v e d i n t h e p r o t e c t i o n . E v i d e n c e ( N i b l e t t e t a l . , 1979) i n d i c a t e d t h a t p r i o r i n f e c t i o n w i t h a m i l d s t r a i n o f p o t a t o s p i n d l e t u b e r v i r o i d , w hich does not encode a s t r u c t u r a l p r o t e i n , p r o t e c t s a g a i n s t e x p r e s s i o n o f a s e v e r e s t r a i n upon subsequent i n o c u l a t i o n . I t has been s u g g e s t e d (Gibbs, 1969) t h a t t h e r e p l i c a s e o f t h e i n d u c e r c o u l d s e q u e s t e r , but not t r a n s c r i b e , t h e RNA o f t h e c h a l l e n g e r w h i c h would p r e v e n t i t s r e p l i c a t i o n . The RNA o f v i r u s e s c l o s e l y r e l a t e d t o t h e i n d u c e r may have a s i m i l a r but not i d e n t i c a l r e p l i c a s e b i n d i n g s i t e . T h i s s i m i l a r i t y would p e r m i t b i n d i n g o f t h e i n d u c e r r e p l i c a s e t o t h e c h a l l e n g e r RNA but no r e p l i c a t i o n . One h y p o t h e s i s has i m p l i c a t e d d e p l e t i o n o f e s s e n t i a l m o l e c u l e s by t h e i n d u c e r t h u s a f f e c t i n g t h e s y n t h e s i s o f e s s e n t i a l c h a l l e n g e r compounds. Such a mechanism would not e a s i l y e x p l a i n v i r u s s p e c i f i c i t y , a l t h o u g h a c o m p e t i t i o n f o r ribosomes f o r which r e l a t e d s t r a i n s would have s i m i l a r a f f i n i t i e s c o u l d e x p l a i n t h e s p e c i f i c i t y o b s e r v e d . S i m i l a r l y , t h e r e p l i c a s e w h i c h may be composed o f s u b u n i t s o f b o t h v i r a l and h o s t o r i g i n ( Z a i t l i n , 1976) may be l i m i t i n g . A l t e r n a t i v e l y h o s t membrane s i t e s w h i c h may be i n v o l v e d as s i t e s o f v i r a l RNA r e p l i c a t i o n (de 29 Zoeten et al. 1972) may not be a v a i l a b l e t o t h e c h a l l e n g e r . There a r e many r e p o r t s o f a n t i v i r a l s u b s t a n c e s p r o d u c e d by v i r u s - i n f e c t e d p l a n t s ( L o e b e n s t e i n , 1972). F o l l o w i n g i n o c u l a t i o n o f t o b a c c o w i t h TMV, f o u r p r o t e i n s were found t h a t were not p r e s e n t i n v i r u s - f r e e p l a n t s ( G i a n i n a z z i e t al. 1969, van Loon, 197 6 ) . A p h o s p h o g l y c o p r o t e i n which f u n c t i o n s as an a n t i v i r a l f a c t o r ( S e l a and Applebaum, 1962) has been i s o l a t e d from t o b a c c o i n o c u l a t e d w i t h TMV. A p r o t e c t i o n model has been p r o p o s e d t h a t i s a p p l i c a b l e t o v i r u s e s , v i r o i d s , and coa t p r o t e i n - d e f e c t i v e v i r u s e s which o p e r a t e s a t t h e n u c l e i c a c i d l e v e l . Thus i f e i t h e r p o s i t i v e - o r n e g a t i v e - s e n s e RNA o f an i n d u c e r v i r u s i s abundant compared t o t h a t o f t h e e n t e r i n g c h a l l e n g e r , i t might " t r a p " t h e s t r u c t u r a l l y r e l a t e d RNA o f t h e c h a l l e n g e r ( P a l u k a i t i s and Z a i t l i n , 1984) . There i s a l s o some e v i d e n c e t h a t t h e i n d u c e r may m o d i f y t h e plasmodesmata t o a l l o w i t s movement but may p r e v e n t movement o f t h e c h a l l e n g e r . C e r t a i n t y p e s o f p l a n t v i r u s e s s p r e a d t h r o u g h o u t t h e h o s t by moving t h r o u g h plasmodesmata ( K i t a j i m a and L a u r i t i s , 1969). Wolf e t al. (1989) demonstrated t h a t t h e TMV movement p r o t e i n a l t e r s t h e s i z e e x c l u s i o n l i m i t o f t h e plasmodesmata. 2.4 G e n e t i c a l l y E n g i n e e r e d V i r u s R e s i s t a n c e H a m i l t o n (1980) s u g g e s t e d t h a t v i r u s - i n d u c e d r e s i s t a n c e c o u l d be o b t a i n e d by t r a n s f e r r i n g a p o r t i o n o f a v i r a l genome i n t o a p l a n t . The c o r r e s p o n d i n g gene p r o d u c t s c o u l d p r o v i d e p r o t e c t i o n a g a i n s t i n f e c t i o n by t h e c h a l l e n g e r , e i t h e r d i r e c t l y 30 o r i n d i r e c t l y . One advantage i n u s i n g cDNA o f a p o r t i o n o f t h e v i r a l genome i n s t e a d o f t h e whole genome, i s t h a t t h e RNA t r a n s c r i p t would not be i n f e c t i v e . A n o t h e r advantage would be t h e i n h e r i t a n c e o f t h e p r o t e c t i o n from one g e n e r a t i o n t o a n o t h e r . Subsequent t o H a m i l t o n ' s (1980) s u g g e s t i o n s e v e r a l developments o c c u r r e d which f a c i l i t a t e d t h e i n s e r t i o n o f f o r e i g n DNA i n t o p l a n t genomes. F r a l e y e t al. (1983) c o n s t r u c t e d c h i m a e r i c genes t h a t f u n c t i o n e d as dominant s e l e c t a b l e markers i n p l a n t c e l l s . These c h i m a e r i c genes which c o n t a i n e d t h e b a c t e r i a l gene f o r neomycin p h o s p h o t r a n s f e r a s e I I (NPT I I ) and t h e 5' and 3' r e g u l a t o r y r e g i o n s o f t h e n o p a l i n e s y n t h a s e (NOS) gene were e x p r e s s e d c o n s t i t u t i v e l y i n h i g h e r p l a n t c e l l s . Agrobacterium tumefaciens, t h e c a u s a t i v e agent o f crown g a l l d i s e a s e , i s c a p a b l e o f t r a n s f e r r i n g a DNA segment (the T-DNA), l o c a t e d between s p e c i f i c b o r d e r sequences, from i t s t u m o u r - i n d u c i n g p l a s m i d (the T i p l a s m i d ) i n t o t h e n u c l e a r DNA o f i n f e c t e d p l a n t c e l l s . Marker genes were i n c o r p o r a t e d i n t o t h e T i p l a s m i d t h r o u g h homologous r e c o m b i n a t i o n and s u b s e q u e n t l y t r a n s f e r r e d i n t o t o b a c c o c e l l s u s i n g A. tumefaciens (Horsch e t al., 1984). A n a l y s i s o f progeny i n d i c a t e d t h a t t h e c h i m a e r i c kanamycin r e s i s t a n c e gene was i n h e r i t e d and was e x p r e s s e d as a dominant M e n d e l i a n t r a i t . A p r o c e d u r e f o r l e a f d i s k t r a n s f o r m a t i o n and r e g e n e r a t i o n o f p e t u n i a , t o b a c c o , and tomato was d e s c r i b e d by Horsch e t al. (1985) w h i c h u t i l i z e d t h e gene t r a n s f e r c a p a b i l i t y o f A. tumefaciens. They used t h e A. tumefaciens s t r a i n GV3TH1SE which 31 c o n t a i n e d a m o d i f i e d o c t o p i n e T i p l a s m i d (pTiB6S3SE) i n whi c h a l l phytohormone b i o s y n t h e t i c genes and t h e T-DNA r i g h t b o r d e r sequence had been d e l e t e d . F o r m a t i o n o f a c o i n t e g r a t e between pTiB6S3SE and an i n t e r m e d i a t e v e c t o r r e s u l t e d i n a f u n c t i o n a l , a v i r u l e n t T-DNA. 2 .4.1 Tobacco M o s a i c V i r u s The t e c h n o l o g y was now a v a i l a b l e t o t r a n s f e r a p o r t i o n o f a v i r a l genome i n t o a p l a n t . Bevan e t al. (1985) t r a n s f e r r e d a cDNA c l o n e o f t h e t o b a c c o mosaic v i r u s (TMV) co a t p r o t e i n gene i n t o N. tabacum. T h i s was t h e f i r s t o f many a t t e m p t s (summarized i n T a b l e 1) t o a c h i e v e v i r u s r e s i s t a n c e by t h e i n s e r t i o n o f a c l o n e d v i r u s gene i n t o a p l a n t . A d e l a y o f d i s e a s e development was o b s e r v e d i n t r a n s g e n i c t o b a c c o e x p r e s s i n g t h e TMV c o a t p r o t e i n gene ( P o w e l l A b e l e t a l . , 1986). Coat p r o t e i n a c c u m u l a t e d t o 0.1% o f l e a f p r o t e i n w i t h i n t h e t r a n s g e n i c p l a n t s and appeared t o be a monomer or m u l t i m e r w i t h a s e d i m e n t a t i o n c o e f f i c i e n t o f a p p r o x i m a t e l y 4S. Of 17 r o o t e d c u t t i n g s , 10 p l a n t s t h a t d i d not c o n t a i n t h e co a t p r o t e i n gene d e v e l o p e d c l a s s i c a l TMV symptoms. Four o f t h e p l a n t s e x p r e s s i n g t h e gene d e v e l o p e d symptoms 2 t o 14 days l a t e r t h a n t h e c o n t r o l s and t h e o t h e r 3 d i d not d e v e l o p symptoms d u r i n g 20 days o f o b s e r v a t i o n . S i m i l a r r e s u l t s were o b t a i n e d w i t h progeny shown t o e x p r e s s c o a t p r o t e i n . An i n c r e a s e i n i n o c u l u m d e c r e a s e d t h e d e l a y i n symptom appearance and i n c r e a s e d t h e number o f p l a n t s t h a t became i n f e c t e d and d e v e l o p e d symptoms. Those p l a n t s t h a t never 32 T a b l e 1. Summary o f examples o f g e n e t i c a l l y e n g i n e e r e d p l a n t v i r u s r e s i s t a n c e . Virus Test Chimaeric References Group Virus Gene Tobamovirus TMV PSSS^cTMV^NOS3 Powell-Abel et al., 1986 A l f a l f a Mosaic AMV P35S:cAMV:N0S Turner et al., 1987 Van Dun et al., 1987 A l f a l f a Mosaic AMV P19S4:cAMV:CaMS5 Loesch-Fries et al., 1987 I l a r v i r u s TSV P35S:cTSV:N0S Van Dun et al., 1988 Tobravirus TRV, PEBV P35S:cTRV:N0S Van Dun and Bol, 1988 Potexvirus PVX P35S:cPVX:rbcS-E9 6 Hemenway et al., 1988 Potexvirus PVX eP35S7: cPVX: rbcS-E9 Lawson et al., 1990 Potexvirus PVX P35S:cPVX:N0S Hoekema et al., 1989 Cucumovirus CMV P35S:cCMV:rbcS-E9 Cuozzo et al., 1988 Potyvirus TEV, PVY P35S:cSMV:N0S Stark and Beachy, 1989 Potyvirus PVY eP35S:cPVY:rbcS-E9 Lawson et al., 1990 Cucumovirus CMV, TAV P35S:sCMV8:N0S Harrison et al., 1989 Nepovirus TobRV P35S:sTobRV:NOS Gerlach et al., 1987 ^353: 35S promoter from CaMV 2cTMV: coat p r o t e i n cDNA of TMV 3NOS: nopaline synthase polyadenylation s i g n a l "P19S: 19S promoter from CaMV 5CaMS: 19S polyadenylation s i g n a l from CaMV 6rbcS-E9: 3' sequence of the soybean ribulose biphosphate carboxylase gene 7eP35S: duplicated CaMV 35S promoter-enhancer "sCMV: s a t e l l i t e RNA cDNA of CMV d e v e l o p e d symptoms were shown not t o be i n f e c t e d v i a v i r u s r e p l i c a t i o n e x p e r i m e n t s . T r a n s g e n i c tomato e x p r e s s i n g t h e co a t p r o t e i n gene o f t h e common (t^) s t r a i n o f TMV was shown t o be r e s i s t a n t t o TMV s t r a i n s U x and PV 230 and t o a l e s s e r e x t e n t tomato mosaic v i r u s s t r a i n s L, 2, and 2 2, (Nelson e t al., 1988). R e s i s t a n c e i n c l u d e d a d e l a y i n symptoms o r escape from symptom development and l e s s v i r u s a c c u m u l a t i o n i n t h o s e t r a n s g e n i c p l a n t s t h a t d e v e l o p e d symptoms t h a n o c c u r r e d i n c o n t r o l s . Those p l a n t s w h i c h showed no symptom development i n greenhouse e x p e r i m e n t s m a i n t a i n e d r e s i s t a n c e under f i e l d c o n d i t i o n s and tomato y i e l d s were u n a f f e c t e d by v i r u s o r e x p r e s s i o n o f t h e c o a t p r o t e i n gene. Coat p r o t e i n a c c u m u l a t i o n i n t h e t r a n s g e n i c p l a n t s approached 0.05% o f 33 t o t a l l e a f p r o t e i n . A l t h o u g h i n c r e a s i n g t h e v i r u s c o n c e n t r a t i o n caused a more r a p i d appearance of s y s t e m i c d i s e a s e symptoms i n c o n t r o l p l a n t s , t h e p r o t e c t e d t r a n s g e n i c p l a n t s showed no such i n c r e a s e o f d i s e a s e symptoms. R e g i s t e r and Beachy (1988) r e p o r t e d t h a t t h e TMV p r o t e c t i o n i n t r a n s g e n i c t o b a c c o and d e r i v e d p r o t o p l a s t s e x p r e s s i n g TMV c o a t p r o t e i n , c o u l d be overcome by i n o c u l a t i o n w i t h e i t h e r TMV RNA o r TMV w h i c h had been p r e t r e a t e d a t pH 8.0. T h i s s u g g e s t s t h a t i n t e r f e r e n c e w i t h i n f e c t i o n i s p r o b a b l y a t t h e l e v e l o f v i r u s u n c o a t i n g and not r e - e n c a p s i d a t i o n by TMV c o a t p r o t e i n s y n t h e s i z e d i n t r a n s g e n i c p l a n t c e l l s . W i l s o n (1984a and 1984b) p o s t u l a t e d t h a t a b r i e f pH 8.0 t r e a t m e n t o f TMV removes a few c o a t p r o t e i n s u b u n i t s from t h e 5' end o f t h e v i r u s p a r t i c l e a l l o w i n g i n i t i a t i o n o f t r a n s l a t i o n and subsequent c o t r a n s l a t i o n a l d i s a s s e m b l y o f t h e v i r u s . However, t h e o c c u r r e n c e o f low l e v e l p r o t e c t i o n towards TMV RNA was not a d d r e s s e d . The amount o f c o a t p r o t e i n t h a t a c c u m u l a t e d and t h e degree o f r e s i s t a n c e t o TMV i n t r a n s g e n i c t o b a c c o were found t o be t e m p e r a t u r e dependent ( N e j i d a t and Beachy, 1989) . Exposure t o c o n t i n u o u s h i g h t e m p e r a t u r e s (30-35°C) caused t h e l e v e l o f c o a t p r o t e i n t o d e c r e a s e t o v e r y low l e v e l s . Under t h e s e c o n d i t i o n s t h e t r a n s g e n i c p l a n t s d e v e l o p e d s y s t e m i c d i s e a s e symptoms when i n o c u l a t e d w i t h TMV a l t h o u g h d i s e a s e development was d e l a y e d . T r a n s g e n i c p l a n t s which were moved from 35 t o 22°C acc u m u l a t e d normal l e v e l s o f c o a t p r o t e i n w i t h i n s e v e r a l h o u r s . S i n c e t h e l e v e l o f c o a t p r o t e i n mRNA was c o n s t a n t r e g a r d l e s s o f t e m p e r a t u r e 34 and was a s s o c i a t e d w i t h p o l y r i b o s o m e s , t h e low l e v e l o f c o a t p r o t e i n a t e l e v a t e d t e m p e r a t u r e s was thought t o be due t o i n s t a b i l i t y o f t h e p r o t e i n . I n c o n t r a s t , c o a t p r o t e i n l e v e l s i n t r a n s g e n i c tomato a l s o dropped a t e l e v a t e d t e m p e r a t u r e s but t h e tomato r e t a i n e d t h e r e s i s t a n c e t o TMV. I n t r o d u c t i o n o f e i t h e r p u r i f i e d TMV c o a t p r o t e i n o r v i r u s i n a c t i v a t e d by u l t r a v i o l e t i r r a d i a t i o n i n t o t o b a c c o p r o t o p l a s t s i n d u c e d t r a n s i e n t p r o t e c t i o n towards c h a l l e n g e v i r u s i n t r o d u c e d s i m u l t a n e o u s l y o r s u b s e q u e n t l y ( R e g i s t e r and Beachy, 1989). S i m i l a r r e s u l t s were o b t a i n e d u s i n g p o t a t o v i r u s X (PVX). F o r TMV, t h e exten d e d h e l i c a l a g g r e g a t e s o f c o a t p r o t e i n c o n f e r r e d a more l o n g - l a s t i n g p r o t e c t i o n towards TMV t h a n d i d l o w e r o r d e r a g g r e g a t e s . W i l s o n (1989) r e p o r t e d t h e p r e s e n c e o f TMV c o a t p r o t e i n " r o d l e t s " i n t r a n s g e n i c t o b a c c o but P o w e l l A b e l e t a i . (1986) found o n l y a g g r e g a t e s s m a l l e r t h a n 4S. T h e r e f o r e , t h e c o n f o r m a t i o n o f p r o t e i n i n v o l v e d i n p r o t e c t i o n remains t o be i d e n t i f i e d . A l t h o u g h TMV p r o v i d e d t r a n s i e n t p r o t e c t i o n a g a i n s t sunn hemp mosaic v i r u s , a d i s t a n t l y r e l a t e d v i r u s , s i m i l a r p r o t e c t i o n does not o c c u r i n t r a n s g e n i c p l a n t s o r p r o t o p l a s t s e x p r e s s i n g TMV c o a t p r o t e i n . Tobacco mosaic p s e u d o v i r u s p a r t i c l e s c o n t a i n i n g c h i m a e r i c mRNA f o r Escherichia c o l i (Migula) C a s t e l l a n i and Chalmers 0-g l u c u r o n i d a s e (GUS) were e l e c t r o p o r a t e d i n t o c o n t r o l o r t r a n s g e n i c p r o t o p l a s t s e x p r e s s i n g TMV co a t p r o t e i n (Osbourn e t a l . , 1989b). A l t h o u g h u n e n c a p s i d a t e d GUS mRNA was e x p r e s s e d a t s i m i l a r l e v e l s i n b o t h t r a n s g e n i c and c o n t r o l p r o t o p l a s t s , GUS-35 p a r t i c l e mRNA was e x p r e s s e d 1 0 0 - f o l d l e s s e f f i c i e n t l y i n t r a n s f o r m e d p r o t o p l a s t s p r o b a b l y as a r e s u l t o f i n h i b i t i o n o f d i s a s s e m b l y o f t h e p a r t i c l e s . B o t h c o n t r o l and XJX s t r a i n t r a n s f o r m e d p r o t o p l a s t s were e q u a l l y s u s c e p t i b l e t o cowpea s t r a i n TMV, as w e l l as u n e n c a p s i d a t e d RNA o f b o t h TMV s t r a i n s . However, RNA o f t h e cowpea s t r a i n t h a t was t r a n s e n c a p s i d a t e d i n \Jl c o a t p r o t e i n in v i t r o was e q u a l l y i n f e c t i o u s i n b o t h t y p e s o f p r o t o p l a s t . I t appears t h a t a l t h o u g h t h e p r o t e i n - p r o t e i n i n t e r a c t i o n i n h i b i t s n u c l e o c a p s i d d i s a s s e m b l y and GUS e x p r e s s i o n i n t r a n s f o r m e d p r o t o p l a s t s t h e r e must a l s o be a n o t h e r mechanism t h a t i n t e r f e r e s w i t h a l a t e r s t a g e o f i n f e c t i o n i n v o l v i n g t h e homologous v i r a l RNA. Because t r a n s g e n i c t o b a c c o p l a n t s which e x p r e s s TMV c o a t p r o t e i n produce s t a b l e v i r u s - l i k e r o d l e t s o f v a r i o u s l e n g t h s ( W i l s o n 1989) an attempt was made t o measure t h e a b i l i t y o f t h i s c o a t p r o t e i n t o e n c a p s i d a t e c h i m a e r i c c h l o r a m p h e n i c o l -a c e t y l t r a n s f e r a s e (CAT) RNA c a r r y i n g t h e TMV o r i g i n - o f - a s s e m b l y (Osbourn e t al., 1989a). P r o t o p l a s t s and p l a n t s e x p r e s s i n g b o t h t h e c o a t p r o t e i n gene and t h e r e p o r t e r gene ( i . e . d o u b l e t r a n s g e n i c ) f a i l e d t o i n c r e a s e t h e number o f r o d l e t s o r reduce CAT a c t i v i t y . However, i n T M V - i n f e c t e d p l a n t s t h e h i g h l e v e l s o f co a t p r o t e i n e n c a p s i d a t e d s u b s t a n t i a l amounts o f CAT mRNA r e d u c i n g CAT a c t i v i t y ( S l e a t e t al., 1988). The TMV c o a t p r o t e i n p r o d u c e d by t h e t r a n s g e n i c p l a n t s was found t o be e x c l u s i v e l y l o c a t e d i n c h l o r o p l a s t - a s s o c i a t e d e l e c t r o n - d e n s e b o d i e s . Hence, Osbourn et al. (1989a) s u g g e s t e d t h a t t h e s u b c e l l u l a r l o c a t i o n o f 36 coat p r o t e i n i n the c h l o r o p l a s t s prevented i n t e r a c t i o n with CAT mRNA i n the cytoplasm. Since these d o u b l e - t r a n s g e n i c p l a n t s and p r o t o p l a s t s were r e s i s t a n t t o v i r u s a c l o s e i n t e r a c t i o n between v i r u s , v i r u s coat p r o t e i n , and c h l o r o p l a s t s i s i m p l i e d . In a d d i t i o n the coat p r o t e i n must be more e f f i c i e n t at p r e v e n t i n g disassembly or i n t e r f e r i n g at a l a t e r stage of r e p l i c a t i o n than i n repackaging RNA. Powell et al. (1990) made two m o d i f i c a t i o n s t o the chi m a e r i c genes encoding the TMV coat p r o t e i n i n c l u d i n g removal of the i n i t i a t i o n codon and the tRNA-like u n t r a n s l a t e d 3' sequence. Only those tobacco p l a n t s t h a t s y n t h e s i z e d coat p r o t e i n , r e g a r d l e s s of the presence or absence of the 3' end of TMV-RNA, were p r o t e c t e d a g a i n s t TMV i n f e c t i o n . Furthermore, t h e r e was a c o r r e l a t i o n between the l e v e l of p r o t e c t i o n and the amount of accumulated coat p r o t e i n . 2 .4 .2 A l f a l f a Mosaic Virus I n c o r p o r a t i o n of the a l f a l f a mosaic v i r u s (AMV) coat p r o t e i n gene i n tobacco and tomato p r o v i d e d p r o t e c t i o n a g a i n s t AMV i n f e c t i o n (Turner et a l . , 1987). P r o t e c t i o n r e s u l t e d i n a delay of systemic symptoms, at t e n u a t e d symptoms, a number of i n d i v i d u a l s t h a t never produced symptoms, or fewer c h l o r o t i c l e s i o n s i n i n o c u l a t e d l e a v e s . The AMV coat p r o t e i n accumulated i n the t r a n s g e n i c p l a n t s t o l e v e l s of 0.1 to 0.8% of t o t a l l e a f p r o t e i n . I n o c u l a t e d t r a n s g e n i c p l a n t s c o n t a i n e d s u b s t a n t i a l l y lower l e v e l s of AMV coat p r o t e i n as compared t o t h a t i n the 37 c o n t r o l s . T r a n s g e n i c p l a n t c o a t p r o t e i n t r a n s c r i p t s c o n t a i n e d t h e 5' u n t r a n s l a t e d l e a d e r sequence o f t h e c o a t p r o t e i n gene wh i c h has been shown t o i n c r e a s e t r a n s l a t i o n a l e f f i c i e n c y ( J o b l i n g and Gerke, 1987) . L o e s c h - F r i e s e t al. (1987) showed t h a t e x p r e s s i o n o f t h e AMV c o a t p r o t e i n i n t r a n s g e n i c t o b a c c o i n h i b i t e d l o c a l i n f e c t i o n by two AMV s t r a i n s but not TMV. I n o c u l a t i o n w i t h AMV v i r i o n s p r e v e n t e d o r d e l a y e d t h e development o f l o c a l and i n some ca s e s s y s t e m i c i n f e c t i o n . However, t r a n s g e n i c p l a n t s were s u s c e p t i b l e when i n o c u l a t e d w i t h a l l f o u r AMV RNAs. S i m i l a r r e s u l t s were o b t a i n e d by Van Dun e t al. (1987). Van Dun e t al. (1987) a l s o r e p o r t e d t h a t a l t h o u g h a m i x t u r e o f a l l f o u r AMV RNAs i s e q u a l l y i n f e c t i o u s i n c o n t r o l and t r a n s g e n i c p l a n t s , a m i x t u r e o f RNAs 1, 2, and 3 i s not i n f e c t i o u s i n c o n t r o l s but i s i n t r a n s g e n i c p l a n t s . T h i s s u g g e s t s t h a t t h e endogenously pr o d u c e d c o a t p r o t e i n i s b i o l o g i c a l l y a c t i v e and i s a b l e t o r e p l a c e t h e c o a t p r o t e i n p r o d u c e d by RNA 4. Homogenate from a symptomless i n o c u l a t e d t r a n s g e n i c p l a n t was not i n f e c t i o u s . Van Dun e t al. (1988) found t h a t t r a n s g e n i c t o b a c c o e x p r e s s i n g t h e AMV c o a t p r o t e i n p r o t e c t e d a g a i n s t AMV but not t h e r e l a t e d t o b a c c o s t r e a k v i r u s (TSV). A f r a m e - s h i f t m u t a t i o n w i t h i n t h e AMV c o a t p r o t e i n gene produced a t r u n c a t e d c o a t p r o t e i n from t h e c h i m a e r i c mRNA which c o n t a i n e d o n l y f o u r e x t r a n u c l e o t i d e s . T r a n s g e n i c p l a n t s e x p r e s s i n g t h i s m o d i f i e d gene showed no r e s i s t a n c e t o i n f e c t i o n by AMV i n d i c a t i n g t h a t p r o t e c t i o n was c o a t p r o t e i n - m e d i a t e d . I n o c u l a t i o n o f t h e s e 38 p l a n t s w i t h AMV RNAs 1, 2, and 3 d i d not r e s u l t i n i n f e c t i o n d e m o n s t r a t i n g t h a t t h e t r u n c a t e d p r o t e i n was u n a b l e t o a c t i v a t e t h e AMV genome. E x p r e s s i o n o f n e g a t i v e - s e n s e RNA o f t h e AMV c o a t p r o t e i n gene i n t r a n s g e n i c p l a n t s d i d not i n h i b i t v i r u s i n f e c t i o n . 2.4.3 Tobacco Streak Virus T r a n s g e n i c t o b a c c o e x p r e s s i n g t h e c o a t p r o t e i n gene o f TSV remained f r e e o f symptoms f o r 3 weeks p o s t - i n o c u l a t i o n (Van Dun e t al., 1988). These p l a n t s o c c a s i o n a l l y d e v e l o p e d n e c r o t i c l e s i o n s on t h e i n o c u l a t e d l e a v e s a f t e r 3 weeks whereas t h e c o n t r o l p l a n t s became s y s t e m i c a l l y i n f e c t e d . Homogenate o f t h e t r a n s g e n i c p l a n t s p r e p a r e d 1 week a f t e r TSV i n o c u l a t i o n was not i n f e c t i o u s . There was no p r o t e c t i o n towards t h e r e l a t e d AMV o r i t s RNA. AMV RNAs 1, 2, and 3 d i d not i n f e c t c o n t r o l p l a n t s but were a b l e t o i n f e c t t h e TSV t r a n s g e n i c p l a n t s i n d i c a t i n g t h a t t h e e x p r e s s e d c o a t p r o t e i n can a c t i v a t e t h e AMV genome. 2.4.4 Tobacco Rattle Virus P r o d u c t i o n o f t r a n s g e n i c t o b a c c o e x p r e s s i n g t h e TRV c o a t p r o t e i n gene o f t h e TCM s t r a i n and PLB s t r a i n was d e s c r i b e d by Van Dun e t al. (1987) and Angenent et al. (1990), r e s p e c t i v e l y . A l t h o u g h t h e TCM and PLB c o a t p r o t e i n s a c c u mulated t o 0.05% and l e s s t h a n 0.01% o f s o l u b l e l e a f p r o t e i n , r e s p e c t i v e l y , b o t h t y p e s o f t r a n s g e n i c p l a n t s were r e s i s t a n t a g a i n s t i n f e c t i o n by v i r u s p a r t i c l e s from t h e homologous TRV s t r a i n (Van Dun e t al., 1988; 39 Angenent, 1990) . P l a n t s were s u s c e p t i b l e t o i n f e c t i o n w i t h RNA of t h e homologous s t r a i n o r n u c l e o p r o t e i n o f t h e h e t e r o l o g o u s s t r a i n . T r a n s g e n i c p l a n t s remained f r e e o f symptoms a l t h o u g h symptoms o c c a s i o n a l l y d e v e l o p e d on i n o c u l a t e d l e a v e s . Complementary DNA h y b r i d i z a t i o n s i n d i c a t e d t h a t t h e sequence s i m i l a r i t y between t h e coa t p r o t e i n genes of TRV s t r a i n s TCM and PLB i s much lo w e r t h a n t h a t o b s e r v e d between pea e a r l y b rowning v i r u s (PEBV) and t h a t o f TRV-TCM (Van Dun and B o l , 1988) . They s u g g e s t e d t h a t t h i s l a c k o f s i m i l a r i t y between s t r a i n c o a t p r o t e i n s a c c o u n t s f o r l a c k o f p r o t e c t i o n between s t r a i n s which i s s u b s t a n t i a t e d by t h e f a c t t h a t t h e s t r a i n TCM does p r o t e c t a g a i n s t PEBV w h i l e PLB d i d n o t . Angenent e t al. (1990) r e p o r t e d t h a t p r o t o p l a s t s o f b o t h TRV s t r a i n s showed no r e s i s t a n c e towards i n f e c t i o n . 2.4.5 Potato Virus X Hemenway e t al. (1988) demonstrated t h a t t r a n s g e n i c t o b a c c o e x p r e s s i n g e i t h e r PVX coa t p r o t e i n o r t h e c o a t p r o t e i n n e g a t i v e -sense t r a n s c r i p t were p r o t e c t e d from i n f e c t i o n by PVX as i n d i c a t e d by reduced l e s i o n numbers on i n o c u l a t e d l e a v e s , d e l a y o r absence o f s y s t e m i c symptom development, and r e d u c t i o n i n v i r u s a c c u m u l a t i o n i n b o t h i n o c u l a t e d and s y s t e m i c l e a v e s . There was a d i r e c t c o r r e l a t i o n between t h e l e v e l o f p r o t e c t i o n and t h e a c c u m u l a t i o n o f PVX coa t p r o t e i n , which a t t a i n e d l e v e l s between 0.02 and 0.1% o f t o t a l l e a f p r o t e i n i n t r a n s g e n i c p l a n t s p r o d u c i n g p o s i t i v e - s e n s e t r a n s c r i p t s . P l a n t s e x p r e s s i n g 40 n e g a t i v e - s e n s e RNA were p r o t e c t e d o n l y a t low i n o c u l u m l e v e l s . When p l a n t s e x p r e s s i n g h i g h l e v e l s o f PVX c o a t p r o t e i n were i n o c u l a t e d w i t h PVX RNA t h e y remained r e s i s t a n t . S i m i l a r r e s u l t s were o b t a i n e d w i t h t h e t h r e e p o t a t o c u l t i v a r s ' B i n t j e ' , ' D e s i r e e ' , and ' E s c o r t ' t r a n s f o r m e d t o e x p r e s s t h e PVX c o a t p r o t e i n gene (Hoekema e t a l . , 1989). 2.4.6 Cucumber M o s a i c V i r u s Cuozzo e t al. (1988) d e v e l o p e d t r a n s g e n i c t o b a c c o e x p r e s s i n g t h e cucumber mosaic v i r u s (CMV) c o a t p r o t e i n a t l e v e l s between 0.001 and 0.002% of t o t a l l e a f p r o t e i n . T r a n s g e n i c t o b a c c o e x p r e s s i n g t h e c o a t p r o t e i n n e g a t i v e - s e n s e t r a n s c r i p t were a l s o d e v e l o p e d . D e l a y or absence o f symptom development and r e d u c t i o n i n v i r u s a c c u m u l a t i o n i n b o t h i n o c u l a t e d and s y s t e m i c a l l y i n f e c t e d l e a v e s was independent o f t h e s t r e n g t h o f t h e i n o c u l u m i n t h o s e p l a n t s e x p r e s s i n g c o a t p r o t e i n . However, n e g a t i v e - s e n s e t r a n s c r i p t s p r o t e c t e d o n l y a t low i n o c u l u m c o n c e n t r a t i o n s . 2.4.7 Soybean M o s a i c V i r u s H e t e r o l o g o u s p r o t e c t i o n o f p l a n t v i r u s e s was examined u s i n g t r a n s g e n i c t o b a c c o e x p r e s s i n g t h e p o t y v i r u s soybean mosaic v i r u s (SMV) c o a t p r o t e i n which a c c o u n t e d f o r 0.01% t o 0.21% o f t o t a l p r o t e i n ( S t a r k and Beachy, 1989). Tobacco i s immune t o SMV but i s s u s c e p t i b l e t o t h e s e r o l o g i c a l l y u n r e l a t e d p o t y v i r u s e s p o t a t o v i r u s Y (PVY) and t o b a c c o e t c h v i r u s (TEV) w h i c h s h a r e 58% and 61% amino a c i d sequence s i m i l a r i t y , r e s p e c t i v e l y , w i t h SMV c o a t 41 protein. A 3 to 4 day delay i n the development of systemic disease symptoms was observed. Symptoms then developed more slowly and were less severe i n transgenic plants than i n the controls. Some transgenics never developed disease symptoms. There was reduced accumulation of TEV i n both inoculated and systemically infected leaves of the transgenic plants. Protection was correlated with the l e v e l of coat protein i n each transgenic plant, with one exception, and was inoculum dependent. 2.4.8 Potato Virus Y Transgenic 'Russet Burbank', expressing PVX and potato virus Y coat protein to leve l s between 0.05% to 0.2% and 0.01% to 0.05% of the t o t a l leaf protein, respectively, were re s i s t a n t to i n f e c t i o n by mechanical inoculation of PVX and PVY (Lawson et al., 1990) . Individually PVX f a i l e d to i n f e c t at any inoculum concentration and PVY infected only a small percentage of plants of one potato l i n e . A si m i l a r l e v e l of resistance towards PVY was observed when transgenics were inoculated by v i r u l i f e r o u s aphids. However, the percentage of infected plants was s i g n i f i c a n t l y increased. Inoculation of PVX and PVY together gave responses ranging from immunity towards both viruses to i n f e c t i o n by both viruses. In general, i n f e c t i o n of the transgenic potato was delayed, fewer plants became infected, and lower virus t i t r e s occurred. Although plants from one l i n e accumulated the lowest lev e l s of PVX and PVY coat protein, they exhibited the greatest protection against PVX and PVY i n f e c t i o n . 42 2 . 4.9 S a t e l l i t e o f Cucumber M o s a i c V i r u s Baulcombe et al. (1986) d e s c r i b e t h e t r a n s f o r m a t i o n o f t o b a c c o w i t h a DNA copy of t h e symptom a l t e r i n g s a t e l l i t e RNA o f CMV. These p l a n t s c o n t a i n e d s m a l l amounts o f t r a n s c r i b e d s a t e l l i t e RNA and, when i n f e c t e d w i t h s a t e l l i t e - f r e e CMV, p r o d u c e d l a r g e amounts o f u n i t - l e n g t h s a t e l l i t e RNA m o l e c u l e s . Only t h e i n o c u l a t e d l e a v e s and t h e f i r s t two o r t h r e e l e a v e s t o be i n v a d e d s y s t e m i c a l l y d e v e l o p e d symptoms ( H a r r i s o n e t al., 1987). P r o t e c t i o n p e r s i s t e d f o r a t l e a s t 14 weeks and was independent o f i n o c u l u m c o n c e n t r a t i o n . I n t h e t r a n s g e n i c p l a n t s t h e r e was an 80 t o 95% d e c r e a s e i n t h e c o n c e n t r a t i o n o f CMV genomic RNA which c o r r e l a t e d w i t h t h e l a c k o f i n f e c t i v i t y o f l e a f e x t r a c t s . Of s e v e r a l o t h e r v i r u s e s o n l y t h e c l o s e l y r e l a t e d tomato aspermy v i r u s (TAV) i n d u c e d t h e s y n t h e s i s o f s a t e l l i t e RNA and was s u b s e q u e n t l y p r o t e c t e d a g a i n s t . However, n e i t h e r t h e a c c u m u l a t i o n o f TAV genomic RNA nor t h e i n f e c t i v i t y o f l e a f e x t r a c t s was d e c r e a s e d . 2 . 4.10 S a t e l l i t e o f Tobacco R i n g s p o t V i r u s T r a n s g e n i c t o b a c c o e x p r e s s i n g e i t h e r p o s i t i v e o r n e g a t i v e -sense t r a n s c r i p t s o f t h e t o b a c c o r i n g s p o t v i r u s (TobRV) s a t e l l i t e RNA e x h i b i t e d symptom a t t e n u a t i o n when i n o c u l a t e d w i t h TobRV ( G e r l a c h e t al., 1987). Immediately a f t e r i n o c u l a t i o n w i t h TobRV t h e r e was an a m p l i f i c a t i o n o f s a t e l l i t e RNA sequences w h i c h c o r r e l a t e d w i t h t h e r e s i s t a n t phenotype. P l a n t s c o n t a i n i n g t h e p o s i t i v e t r a n s c r i p t d e v e l o p e d p r i m a r y l e s i o n s , i n which t h e 43 c e n t r e s remained green, 1 t o 2 days l a t e r t h a n t h e c o n t r o l p l a n t s i n w h i c h t h e c e n t r e s o f th e l e s i o n s were n e c r o t i c . A f t e r 3 weeks new l e a v e s were symptomless and a m i l d s y s t e m i c r e a c t i o n was obs e r v e d on some l e a v e s o n l y a f t e r 5-6 weeks p o s t - i n o c u l a t i o n . P r o t e c t i o n was m a i n t a i n e d d u r i n g t h e 10 weeks t h e p l a n t s were o b s e r v e d . D i s e a s e development i n t h e p l a n t s e x p r e s s i n g n e g a t i v e -sense t r a n s c r i p t was d i f f e r e n t i n t h a t t h e i n i t i a l r i n g s p o t l e s i o n s p o s s e s s e d n e c r o t i c c e n t r e s s i m i l a r t o t h e c o n t r o l s . 2 . 4 . 1 1 Nonstructural V i r a l Genes Tobacco p l a n t s have been t r a n s f o r m e d w i t h s e v e r a l n o n s t r u c t u r a l genes o f TRV i n c l u d i n g t h e 13 kDa and 16 kDa genes o f s t r a i n PLB and t h e 2 9 kDa gene t h a t i s unique t o t h e RNA o f s t r a i n TCM (Angenent e t al., 1990). A l t h o u g h a c c u m u l a t i o n o f t r a n s c r i p t o c c u r r e d , p r o t e c t i o n was not o b s e r v e d . Other n o n s t r u c t u r a l v i r a l genes have a l s o been used t o produce t r a n s g e n i c p l a n t s . They i n c l u d e : t h e c y t o p l a s m i c i n c l u s i o n p r o t e i n o f t o b a c c o v e i n m o t t l i n g v i r u s (TVMV) wh i c h d i d not produce symptoms o r i n c l u s i o n b o d i e s i n t r a n s g e n i c p l a n t s (Graybosch e t al., 1989); t h e p r o d u c t o f gene V I o f c a u l i f l o w e r mosaic v i r u s which was found i n t h e s e s t u d i e s t o in d u c e d i s e a s e symptoms i n t r a n s g e n i c t o b a c c o (Baughman e t a l . , 1988); and t h e 30 kDa gene p r o d u c t o f TMV which was shown t o be i n v o l v e d i n c e l l - t o - c e l l movement o f TMV (Deom e t a l . , 1987). The TMV t r a n s p o r t p r o t e i n appears t o i n c r e a s e t h e f u n c t i o n a l e x c l u s i o n l i m i t s i z e o f t h e plasmodesmata i n t h e t r a n s g e n i c p l a n t s (Wolf e t al., 1989). E x p r e s s i o n of the virus-encoded n o n s t r u c t u r a l p r o t e i n h e l p e r component of TVMV w i t h i n t r a n s g e n i c tobacco produced an a c t i v e p r o t e i n and was found t o f a c i l i t a t e a p h i d t r a n s m i s s i o n t o the r e l a t e d TEV but only a f t e r c o n c e n t r a t i o n of the h e l p e r component p r o t e i n (Berger et al., 1989). 2.4.12 Other Approaches for Virus Control S e v e r a l other approaches towards v i r u s c o n t r o l through the e x p r e s s i o n of f o r e i g n genes w i l l undoubtedly be attempted. Smith et al. (1988) demonstrated t h a t a n t i s e n s e RNA can i n h i b i t e x p r e s s i o n of the p o l y g a l a c t u r o n a s e gene i n t r a n s g e n i c tomato. Cech (1987) r e p o r t e d t h a t n a t u r a l l y o c c u r r i n g RNA molecules possess the p r o p e r t y of s e l f - c a t a l y z e d cleavage. Using t h i s i n f o r m a t i o n , H a s e l o f f and G e r l a c h (1988) developed simple RNA enzymes wit h h i g h l y s p e c i f i c endoribonuclease a c t i v i t y . A t r a n s g e n i c p l a n t e x p r e s s i n g RNA enzymes capable of c l e a v i n g v i r a l RNA may reduce v i r u s l e v e l s . F i n a l l y , the recent t r a n s f o r m a t i o n of tobacco l e a f segments with complementary DNA d e r i v e d from mouse hybridoma messenger RNAs to produce f u n c t i o n a l a n t i b o d i e s in vivo ( H i a t t et al., 1989) r e p r e s e n t s a mechanism by which s p e c i f i c e p i t o p e s w i t h i n v i r u s p r o t e i n s may be t a r g e t e d and sequestered. I I I . 45 MATERIALS AND METHODS 3.1 Preparation of PLRV RNA 3.1.1 Maintenance of PLRV A Canadian s t r a i n o f PLRV c h a r a c t e r i z e d by Rowhani and S t a c e -Smith (1979) was used t h r o u g h o u t t h i s s t u d y . O r i g i n a l l y i s o l a t e d from a s i n g l e t u b e r o f S. tuberosum (L) c u l t i v a r 'Russet Burbank' i t was d e s c r i b e d as a "se v e r e s t r a i n " (Wright and MacCarthy, 1963). The PLRV was m a i n t a i n e d and p r o p a g a t e d i n Physalis pubescens ( L ) . M. persicae r e a r e d on v i r u s - f r e e Solanaceous h o s t s were used f o r v i r u s t r a n s m i s s i o n s . A p h i d s were g i v e n a c q u i s i t i o n and i n o c u l a t i o n a c c e s s p e r i o d s o f a t l e a s t 36 h on P L R V - i n f e c t e d p l a n t s and were t r a n s f e r r e d between p l a n t s w i t h a m o i s t e n e d p a i n t b r u s h . 3.1.2 Virus P u r i f i c a t i o n V i r u s was p u r i f i e d from v i r u s - i n f e c t e d l e a f t i s s u e which was f r o z e n w i t h l i q u i d n i t r o g e n i n an i c e b u c k e t and broken i n t o c o a r s e p i e c e s w i t h a wooden p e s t l e . The f r o z e n t i s s u e was t r a n s f e r r e d t o a s t a i n l e s s s t e e l b l e n d e r , p r e - c o o l e d w i t h l i q u i d n i t r o g e n , and ground u n t i l f i n e l y powdered. P o t a s s i u m phosphate b u f f e r (0.1 M, pH 7.0) was added a t a r a t i o o f 2 ml p e r gram o f t i s s u e . V i r u s y i e l d was i n c r e a s e d by i n c u b a t i n g t h e p l a n t homogenate w i t h U l t r a z y m 100 ( S c h w e i z e r i s c h e Ferment AG B a s e l , S c h w e i z . ) , a crude m a c e r a t i n g enzyme p r e p a r a t i o n t h a t c o n t a i n s p e c t i n a s e s and c e l l u l a s e s . The p l a n t homogenate had a f i n a l 46 c o n c e n t r a t i o n o f 0.1% (w/v) m a c e r a t i n g enzyme, 0.1% (v/v) 2-m e r c a p t o e t h a n o l , and 0.02% (w/v) sodium a z i d e . The p r e p a r a t i o n was l e f t o v e r n i g h t a t room t e m p e r a t u r e w i t h o u t s t i r r i n g . P r e p a r a t i o n s were c l a r i f i e d by v i g o r o u s s t i r r i n g w i t h 1% (v/v) T r i t o n X-100 f o r 3 h a t room t e m p e r a t u r e , f o l l o w e d by t h e a d d i t i o n o f 1/6 volume c h l o r o f o r m : n - b u t a n o l (1:1, v/v) w i t h c o n t i n u e d v i g o r o u s s t i r r i n g f o r 10 min a t room t e m p e r a t u r e and low speed c e n t r i f u g a t i o n , 20 min a t 8,500 rpm i n a S o r v a l l GSA r o t o r . A f t e r low speed c e n t r i f u g a t i o n t h e aqueous phase was c o l l e c t e d and 8% (w/v) p o l y e t h y l e n e g l y c o l 6000 and 1% (w/v) NaCl were added and s t i r r e d u n t i l d i s s o l v e d . A f t e r i n c u b a t i o n a t 4°C f o r 1 h, t h e p r e p a r a t i o n was c e n t r i f u g e d as above and t h e p e l l e t s were resuspended i n 0.1 M phosphate b u f f e r , pH 7.0, a t a r a t i o o f 10 ml p e r 50 g o f s t a r t i n g t i s s u e w i t h t h e minimum b e i n g 25 ml. A f t e r s h a k i n g o v e r n i g h t (100 rpm, 4°C) , t h e p r e p a r a t i o n was c e n t r i f u g e d as above, t h e s u p e r n a t a n t c o l l e c t e d and c e n t r i f u g e d a t 35,000 rpm f o r 1.5 h i n a Beckman ( I r v i n e , CA) 50.2 T i r o t o r . The p e l l e t s were resuspended u s i n g a g l a s s r o d i n 0.1 M phosphate b u f f e r , pH 7.0, ground i n a ground g l a s s homogenizer and shaken a t 4°C f o r 1 h. A f t e r low speed c e n t r i f u g a t i o n a t 10,000 rpm f o r 20 min i n a S o r v a l l SS34 r o t o r , t h e s u p e r n a t a n t s were l a y e r e d onto 5 ml o f 20% (w/v) s u c r o s e i n phosphate b u f f e r and c e n t r i f u g e d a t 60,000 rpm f o r 1 h i n a Beckman ( I r v i n e , CA) 70.1 T i r o t o r . P e l l e t s were resuspended and shaken as above, t h e n l a y e r e d on t o p o f a 10-40% (w/v) s u c r o s e ( i n phosphate b u f f e r ) l i n e a r d e n s i t y 47 gradient prepared using a gradient maker. After centrifugation at 38, 000 rpm for 2 h i n a Beckman '(Irvine, CA) SW41 rotor the gradient was pumped through an UA5 monitor/recorder (Lincoln, NE) and the absorbance determined at 254 nm. The virus was collected, d i l u t e d with an equal volume of phosphate buffer, and p e l l e t e d by centrifugation at 60,000 rpm for 2 h i n a Beckman 70.1 T i rotor. This f i n a l high speed p e l l e t was resuspended i n 0.5 ml phosphate buffer. The u l t r a v i o l e t absorption spectrum (220 to 320 nm) of the preparation was obtained and recorded using a Hewlett-Packard Model 8451A spectrophotometer. 3.1.3 E x t r a c t i o n o f P L R V R N A PLRV RNA was extracted from p u r i f i e d virus d i l u t e d i n 50 mM T r i s - C l , pH 8.9, 10 mM EDTA, 0.5% (w/v) sodium dodecyl su l f a t e (SDS) and was denatured by vortex mixing with an equal volume of phenol/chloroform (phenol/chloroform/isoamyl alcohol 25:24:1). The aqueous phase was recovered aft e r centrifugation i n an Eppendorf microfuge for 5 min at 14,000 rpm and the organic phase extracted with 200 (ll of diethylpyrocarbonate (DEPC) treated water (deionized water adjusted to 0.1% (v/v) DEPC was vigorously shaken and then autoclaved for 1 h). The two aqueous phases were combined and re-extracted with an equal volume of phenol/chloroform and then chloroform (chloroform/isoamyl alcohol 24:1). PLRV RNA was p r e c i p i t a t e d overnight at -20°C by adding 0.1 volume of 2 M sodium acetate, pH 5.2, and 2.5 volumes of absolute ethanol. The PLRV RNA pr e c i p i t a t e s were recovered by 48 c e n t r i f u g a t i o n as above f o r 20 min. The RNA p e l l e t was washed w i t h 70% e t h a n o l b e f o r e b e i n g d r i e d i n a vacuum and resuspended i n DEPC t r e a t e d w a t e r . 3.1 .4 Quantitation of PLRV RNA The q u a n t i t y o f v i r i o n RNA was d e t e r m i n e d f o r an a l i q u o t d i l u t e d t o 1 ml w i t h water by measuring t h e absorbance a t 260 nm u s i n g an e x t i n c t i o n c o e f f i c i e n t o f 25. The q u a l i t y o f t h e v i r i o n RNA p r e p a r a t i o n was d e t e r m i n e d by agarose g e l e l e c t r o p h o r e s i s i n t h e p r e s e n c e o f 5 mM m e t h y l m e r c u r i c h y d r o x i d e ( B a i l e y and Dav i d s o n 197 6 ) . RNA samples were d e n a t u r e d i n 2 volumes o f l o a d i n g b u f f e r (125 mM b o r i c a c i d , 15 mM m e t h y l m e r c u r i c h y d r o x i d e , 30% (v/v) g l y c e r o l , and 5% (v/v) s a t u r a t e d bromophenol b l u e ) f o r 10 min a t room t e m p e r a t u r e . Samples were l o a d e d onto a 1% (w/v) agarose g e l c o n t a i n i n g 40 mM b o r i c a c i d , pH 8.2, 1 mM EDTA, and 5 mM m e t h y l m e r c u r i c h y d r o x i d e . E l e c t r o p h o r e s i s was f o r 1 h a t 10 v o l t s / c m u s i n g a r u n n i n g b u f f e r o f 40 mM b o r i c a c i d , pH 8.2, and 1 mM EDTA. G e l s were s t a i n e d f o r 20 min i n 100 ml r u n n i n g b u f f e r c o n t a i n i n g 0.5 (ig/ml e t h i d i u m bromide and 0.1 M 2-m e r c a p t o e t h a n o l . I f n e c e s s a r y , g e l s were d e s t a i n e d w i t h d i s t i l l e d w a t e r . 3.2 Cloning of PLRV RNA 3.2.1 Fi r s t - S t r a n d cDNA Synthesis D o u b l e - s t r a n d e d complementary DNA (cDNA) c o p i e s o f PLRV RNA were p r e p a r e d u s i n g a m o d i f i e d G u b l e r and Hoffman (1983) p r o c e d u r e . P u r i f i e d PLRV RNA, which was m o s t l y f u l l - l e n g t h as d e t e r m i n e d from an agarose g e l c o n t a i n i n g m e t h y l m e r c u r i c h y d r o x i d e (3.1.4), was used as t h e t e m p l a t e f o r t h e s y n t h e s i s o f t h e f i r s t - s t r a n d o f cDNA. PLRV RNA was d e n a t u r e d by a d d i n g 7 [Ll o f 40 mM m e t h y l m e r c u r i c h y d r o x i d e t o a 7 ( l l volume c o n t a i n i n g 1.5 [ig PLRV RNA and e i t h e r 5 \ig o r 0.05 \ig o f Pharmacia (Uppsala, Sweden) random p r i m i n g hexamers. The m i x t u r e s were i n c u b a t e d 10 min a t room t e m p e r a t u r e b e f o r e f r e e z i n g w i t h l i q u i d n i t r o g e n . The RNA was t h e n brought t o a 100 \il volume c o n t a i n i n g 50 mM T r i s - C l , pH 8.3, 50 mM KC1, 8 mM MgCl 2, 10 mM d i t h i o t h r e i t o l (DTT) , 1 mM dATP, 1 mM dGTP, 1 mM dCTP, 1 mM dTTP, 4 0 H-Ci OC-32P dATP (3000 Ci/mmole, ICN), 32 u n i t s RNasin, and 42 u n i t s a v i a n m y e l o b l a s t o s i s v i r u s r e v e r s e t r a n s c r i p t a s e (Pharmacia, U p p s a l a , Sweden). T h i s m i x t u r e was i n c u b a t e d 5 min a t room t e m p e r a t u r e , 10 min a t 37°C, 30 min a t 42°C, f o l l o w e d by t h e a d d i t i o n o f a n o t h e r 42 u n i t s o f a v i a n m y e l o b l a s t o s i s v i r u s r e v e r s e t r a n s c r i p t a s e and a f i n a l i n c u b a t i o n f o r 30 min a t 42°C b e f o r e t h e r e a c t i o n was t e r m i n a t e d by a d d i n g 5 U.1 o f 0.5 M EDTA. A f t e r e x t r a c t i o n w i t h p h e n o l / c h l o r o f o r m and c h l o r o f o r m , n u c l e i c a c i d s were p r e c i p i t a t e d w i t h 0.5 volume 7.5 M ammonium a c e t a t e and 2.5 volumes o f a b s o l u t e e t h a n o l f o r 1 h a t -70°C. The RNA/DNA h y b r i d p r e c i p i t a t e was c e n t r i f u g e d f o r 30 min i n a m i c r o f u g e t u b e a t 14,000 rpm a t 4°C i n an Eppendorf 5415 c e n t r i f u g e and t h e p e l l e t washed t w i c e w i t h 70% (v/v) e t h a n o l and d r i e d i n a vacuum. 50 3.2.2 S e c o n d - S t r a n d cDNA S y n t h e s i s S e c o n d - s t r a n d cDNA s y n t h e s i s was p e r f o r m e d u s i n g t h e f i r s t -s t r a n d cDNA s y n t h e s i z e d above (3.2.1) and DNA polymerase I and RNase H g e n e r a t e d p r i m e r s as d e s c r i b e d by G u b l e r and Hoffman (1983) . The d r i e d p e l l e t o f t h e f i r s t - s t r a n d r e a c t i o n was r e s uspended i n 100 [ll o f 20 mM T r i s - C l , pH 7.5, 5 mM MgCl 2, 10 mM (NH 4) 2S0 4, 100 mM KC1, 1 mM dATP, 1 mM dCTP, 1 mM dGTP, 1 mM dTTP, c o n t a i n i n g 25 u n i t s E. coli DNA polymerase I , and 1.1 u n i t s RNase H. A f t e r i n c u b a t i o n s o f 1 h a t 12°C f o l l o w e d by 1 h a t 22°C t h e r e a c t i o n was t e r m i n a t e d by a d d i n g 5 ( l l o f 0.5 M EDTA b e f o r e e x t r a c t i o n w i t h p h e n o l / c h l o r o f o r m and c h l o r o f o r m . Low m o l e c u l a r w e i g ht n u c l e i c a c i d was e l i m i n a t e d by p a s s i n g t h e aqueous phase t h r o u g h a Sepharose CL-4B (Pharmacia, U p p s a l a , Sweden) column wh i c h was e q u i l i b r a t e d w i t h 10 mM T r i s - C l , pH 7.5 and 1 mM EDTA (TE b u f f e r ) . A l i q u o t s o f 100 ja.1 were c o l l e c t e d from t h e column and t h e number o f c o u n t s p e r minute (cpm) i n each a l i q u o t d e t e r m i n e d as d e s c r i b e d below. From each 100 ( l l a l i q u o t o f d o u b l e - s t r a n d e d cDNA, a 1 \il sample was s p o t t e d onto a GF/C g l a s s f i b r e f i l t e r (Whatman, C l i f t o n , N J ) . T h i s was a l l o w e d t o d r y and t h e n washed t w i c e w i t h 10 ml o f i c e c o l d 5% (w/v) t r i c h l o r o a c e t i c a c i d (TCA) c o n t a i n i n g 1% (w/v) sodium pyrophosphate, and t h e n once w i t h 10 ml o f i c e c o l d 95% e t h a n o l . F i l t e r s were a i r d r i e d and t h e amount o f r a d i o a c t i v i t y on each f i l t e r d e t e r m i n e d u s i n g t h e s c i n t i l l a t o r A q u a s o l - 2 (DuPont NEN R e s e a r c h P r o d u c t s , B o s t o n , MA) and a P a c k a r d T r i - C a r b 4530 ( U n i t e d T e c h n o l o g i e s ) s c i n t i l l a t i o n 51 c o u n t e r . The f i r s t f o u r f r a c t i o n s w i t h c o u n t s above background were combined and n u c l e i c a c i d p r e c i p i t a t e d a t -70°C o v e r n i g h t u s i n g 0.1 volume o f 3 M sodium a c e t a t e , pH 5.2, and 2.5 volume a b s o l u t e e t h a n o l . P r e c i p i t a t e s were c e n t r i f u g e d and washed w i t h 70% e t h a n o l . D o u b l e - s t r a n d e d cDNA was resuspended i n 200 ( l l o f 30 mM sodium a c e t a t e , pH 5.0, 50 mM N a C l , 1 mM Z n C l 2 , c o n t a i n i n g 5% (v/v) g l y c e r o l . P r o d u c t s were t r e a t e d w i t h 28 u n i t s mung bean n u c l e a s e (Bethesda R e s e a r c h L a b o r a t o r y (BRL), G a i t h e r s b u r g , MD) f o r 30 min a t 30°C b e f o r e t h e r e a c t i o n was t e r m i n a t e d by e x t r a c t i o n w i t h p h e n o l / c h l o r o f o r m and c h l o r o f o r m . The d o u b l e -s t r a n d e d cDNA was p r e c i p i t a t e d w i t h sodium a c e t a t e and a b s o l u t e e t h a n o l , c e n t r i f u g e d , washed w i t h 70% e t h a n o l , d r i e d , and resuspended i n TE. T h i s mung bean n u c l e a s e d i g e s t i o n was t o ensure t h a t t h e d o u b l e - s t r a n d e d DNA t e r m i n i were b l u n t . 3.2.3 Ligation of cDNA Into a Vector H a l f o f t h e PLRV cDNA from each r e a c t i o n was l i g a t e d i n t o Eco RV d i g e s t e d and c a l f i n t e s t i n a l phosphatase (CIP) t r e a t e d B l u e s c r i p t M13+ p l a s m i d ( S t r a t a g e n e , San Diego, CA). The B l u e s c r i p t M13+ p l a s m i d had been d i g e s t e d w i t h Eco RV and d e p h o s p h o r y l a t e d w i t h 4 u n i t s CIP p e r 0.05 mM o f DNA i n a 20 UM volume. The CIP was added d i r e c t l y t o t h e r e s t r i c t i o n enzyme b u f f e r and i n c u b a t e d an a d d i t i o n a l 30 min. A f t e r p h e n o l / c h l o r o f o r m and c h l o r o f o r m e x t r a c t i o n s , p r e c i p i t a t i o n , and washing w i t h 70% e t h a n o l t h e Eco RV d i g e s t e d and CIP t r e a t e d 52 vector were resuspended i n TE. Quantities of DNA were estimated on 1% agarose gels prepared and run using tris-acetate-EDTA (TAE) buffer (0.04 M Tris-acetate, pH 8.0, and 0.001 M EDTA). Known quantities of bacteriophage lambda DNA (BRL) which was Hind III or Pst I digested were used for quantity estimations. Ligation of cDNA into the dephosphorylated M13+ plasmid DNA was done using a molar r a t i o of 1:3, respectively. Ligations were c a r r i e d out in 20 (ll of l i g a t i o n mix (50 mM T r i s - C l , pH 7.6, 10 mM MgCl 2, 1 mM dATP, 1 mM DTT, 5% (w/v) polyethylene glycol-8000, and 1 unit T4 DNA l i g a s e ) . This reaction was incubated at room temperature overnight. An i d e n t i c a l reaction, except without cDNA, was done so that the background number of transformants a r i s i n g from undigested plasmid DNA and r e - l i g a t e d plasmid DNA that was not successfully dephosphorylated could be determined. 3.2.4 T r a n s f o r m a t i o n o f Competent E. coll C e l l s The l i g a t i o n reactions were d i l u t e d f i v e - f o l d with s t e r i l e deionized water and 1 (ll of the di l u t e d reaction was added to 100 UJ of l i b r a r y e f f i c i e n c y E. c o l i DH5CC competent c e l l s (BRL) i n a c h i l l e d 17 X 100 mm polypropylene tube (Falcon Labware 2059, Oxnard, CA) by moving the pipette through the c e l l s while dispensing. C e l l s were transformed according to the manufacturer's instructions as follows. C e l l s were incubated on ice for 30 min, heat shocked for 45 seconds i n a 42°C water bath, and placed on ice for 2 min. Autoclaved media (0.9 ml) consisting of 2% (w/v) bactotryptone (Difco, Detroit, MI), 0.5% 53 (w/v) y e a s t e x t r a c t ( D i f c o , D e t r o i t , M I ) , 10 mM N a C l , and 2.5 mM KC1 was added. The media was made 20 mM i n Mg 2 + b e f o r e i t s a d d i t i o n t o t h e c e l l s u s i n g e q u a l volumes o f f i l t e r s t e r i l i z e d 1 M MgCl 2-6H 20 and 1 M MgS04-7H20 and 20 mM w i t h a f i l t e r s t e r i l i z e d 1 M s t o c k o f g l u c o s e . C u l t u r e s were shaken a t 225 rpm a t 37°C f o r 1 h and 100 ( l l a l i q u o t s s p r e a d on L u r i a - B e r t a n i (LB) 1.5% (w/v) agar ( 1 % (w/v) b a c t o t r y p t o n e , 0.5% (w/v) y e a s t e x t r a c t , and 1% (w/v) N a C l , pH 7.5) c o n t a i n i n g 100 |ig/ml f i l t e r - s t e r i l i z e d a m p i c i l l i n . Each 9 cm p l a t e had 40 u.1 o f 5-bromo-4-chloro-3-i n d o l y l - p - D - g a l a c t o s i d e (Xgal) s p r e a d on t h e s u r f a c e 30 min p r i o r t o t h e a d d i t i o n and s p r e a d i n g o f t h e b a c t e r i a l c e l l s . P l a t e s were i n c u b a t e d f o r 16 hours a t 37°C. 3.3 C h a r a c t e r i z a t i o n o f Complementary DNA 3.3.1 B a c t e r i a l L y s i s and DNA F i x a t i o n C o l ony f i l t e r h y b r i d i z a t i o n was c a r r i e d out by a m o d i f i c a t i o n o f t h e p r o c e d u r e o f Gergen e t al. (1979) . E i g h t hundred recombinant w h i t e a m p i c i l l i n - r e s i s t a n t c o l o n i e s were randomly s e l e c t e d and t r a n s f e r r e d i n d i v i d u a l l y w i t h t o o t h p i c k s t o d u p l i c a t e LB agar p l a t e s c o n t a i n i n g 100 |lg/ml a m p i c i l l i n . P l a t e s were i n c u b a t e d 16 h a t 37°C and a u t o c l a v e d Whatman 541 f i l t e r d i s k s were t h e n c a r e f u l l y p l a c e d over t h e c o l o n i e s o f one o f two d u p l i c a t e p l a t e s . F i l t e r o r i e n t a t i o n r e l a t i v e t o t h e d i s h and c o l o n i e s was marked on t h e f i l t e r a t 3 l o c a t i o n s w i t h a n e e d l e and by pen on t h e p l a t e . A f t e r one minute, t h e f i l t e r was removed from t h e p l a t e u s i n g a s i n g l e s w i f t m o t i o n . F i l t e r s were 54 s u b s e q u e n t l y p r o c e s s e d t o de n a t u r e and f i x t h e DNA t o t h e f i l t e r by s e q u e n t i a l l y p l a c i n g t h e f i l t e r , c o l o n y s i d e up, on s t a c k s o f Whatman number 1 f i l t e r paper i n p e t r i d i s h l i d s . I n i t i a l l y t h e f i l t e r s were i n d i v i d u a l l y p l a c e d on a s t a c k soaked w i t h 0.5 M sodium h y d r o x i d e f o r 5 min and t h e t r e a t m e n t r e p e a t e d . F i l t e r s were t r a n s f e r r e d t o a s t a c k soaked w i t h 0.5 M T r i s - C l , pH 7.5, f o r 5 min and t h e t r e a t m e n t r e p e a t e d . F i l t e r s were t h e n t r a n s f e r r e d t o a s t a c k soaked w i t h 2X SSC (IX SSC i s 150 mM sodium c h l o r i d e and 15 mM t r i s o d i u m c i t r a t e , pH 7.0) f o r 5 min and t h e t r e a t m e n t r e p e a t e d . F i n a l l y t h e f i l t e r s were s u b j e c t e d t o two 1 min washes w i t h 2X SSC, and t o two 1 min washes w i t h 95% e t h a n o l and t h e n a i r d r i e d . Each f i l t e r was p l a c e d on d r y Whatman 3MM paper between each t r e a t m e n t t o remove e x c e s s l i q u i d . 3.3.2 P r e h y b r i d i z a t i o n o f F i l t e r s F i l t e r s were p r e h y b r i d i z e d i n a p l a s t i c t r a y w i t h h y b r i d i z a t i o n s o l u t i o n c o n t a i n i n g 50% formamide ( d e i o n i z e d by s t i r r i n g w i t h Dowex XG 8 mixed-bed r e s i n f o r 1 h and f i l t e r i n g t h r o u g h Whatman 3MM p a p e r ) , 6X SSC, 0.5% (w/v) SDS, 50 M-g/ m l salmon sperm DNA (sheared by numerous passages t h r o u g h an 18 gauge n e e d l e ) , and 5X Denhardt's reagent (1% (w/v) p o l y v i n y l p y r r o l i d o n e , and 1% (w/v) b o v i n e serum a l b u m i n (BSA-pen t a x F r a c t i o n V ) , and 1% (w/v) F i c o l l (Pharmacia, U p p s a l a , Sweden) ) . P r e h y b r i d i z a t i o n was f o r 2 h a t 42°C w i t h g e n t l e a g i t a t i o n a f t e r which a probe was added d i r e c t l y t o t h e h y b r i d i z a t i o n s o l u t i o n . 55 3.3.3 Randomly P r i m e d cDNA Probes F i l t e r s were probed w i t h PLRV cDNA p r e p a r e d from randomly p r i m e d PLRV RNA. The r e a c t i o n was c a r r i e d out i n a f i n a l volume o f 50 i l l c o n t a i n i n g 50 mM T r i s - C l , pH 8.3, 8 mM MgCl 2, 8 mM DTT, 0.6 mM each o f dCTP, dGTP, and dTTP, 15 |ig random hexamers (Pharmacia, U p p s a l a , Sweden) , 50 u C i a- 3 2P dATP ( s p e c i f i c a c t i v i t y 3000 Ci/mmole, ICN) and 1 |lg PLRV RNA. A 1 u.1 a l i q u o t was removed t o d e t e r m i n e TCA p r e c i p i t a b l e background c o u n t s b e f o r e 36 u n i t s o f a v i a n m y e l o b l a s t o s i s v i r u s r e v e r s e t r a n s c r i p t a s e (Pharmacia, U p p s a l a , Sweden) was added. A n o t h e r 1 u\l a l i q u o t was removed a f t e r 1 h a t 37°C and TCA p r e c i p i t a b l e c o u n t s a g a i n d e t e r m i n e d . The probe was c o p r e c i p i t a t e d w i t h 100 ( l l o f 10 mg/ml d e n a t u r e d salmon sperm DNA u s i n g 0.1 volume 3 M sodium a c e t a t e , pH 5.2, and 2.5 volume c o l d a b s o l u t e e t h a n o l and c e n t r i f u g e d i m m e d i a t e l y f o r 10 min a t 11,000 rpm. R a d i o l a b e l l e d cDNA p r e c i p i t a t e s were resuspended i n 100 ( l l 0.1 M NaOH, i n c u b a t e d i n a b o i l i n g water b a t h f o r 5 min, and added d i r e c t l y t o t h e h y b r i d i z a t i o n s o l u t i o n (3.3.2) f o r a 16 h i n c u b a t i o n a t 42°C w i t h g e n t l e a g i t a t i o n . 3.3.4 F i l t e r Washing C o n d i t i o n s F i l t e r s were washed f o r 15 min w i t h 100 ml o f 2X SSC and 0.1% (w/v) SDS a t room t e m p e r a t u r e and t h e n 42°C. They were f u r t h e r washed w i t h 0.IX SSC and 0.1% (w/v) SDS f o r 15 min a t 42°C and t h e n f o r 1 h a t 58°C w i t h 0.1X SSC c o n t a i n i n g 1% (w/v) SDS. A f t e r b l o t t i n g , f i l t e r s were wrapped i n Saran Wrap and 56 exposed t o x - r a y (Kodak X-Omat K) f i l m a t -70°C o v e r n i g h t w i t h i n t e n s i f y i n g s c r e e n s . 3.3.5 D e t e c t i o n o f F u s i o n P r o t e i n E x p r e s s i o n o f t h e c o a t p r o t e i n as a b a c t e r i a l f u s i o n p r o t e i n was a s s a y e d as d e s c r i b e d by Meyer e t al. (1982). Transformed b a c t e r i a l c o l o n i e s from t h e second s e t o f p l a t e s were t r a n s f e r r e d d i r e c t l y t o d r y n i t r o c e l l u l o s e f i l t e r s ( S c h l e i c h e r and S c h u e l l , Keene, NH) as d e s c r i b e d f o r t h e t r a n s f e r o f c o l o n i e s t o Whatman f i l t e r s ( 3 . 3 . 1 ) . The n i t r o c e l l u l o s e membranes were t h e n p l a c e d on Whatman 3MM paper, soaked s e q u e n t i a l l y i n s o l u t i o n s o f 0.5 M NaOH, 1.5 M T r i s - C l , pH 7.5, 2X SSC, and 70% e t h a n o l , f o r 5 min each. A f t e r d r y i n g and b a k i n g under vacuum a t 60°C f o r 2 h, t h e f i l t e r s were s c r e e n e d w i t h PLRV p o l y c l o n a l a n t i s e r a and t h e n 1 2 5 i -l a b e l l e d p r o t e i n A as d e s c r i b e d below f o r w e s t e r n b l o t s (3.9.3.3) . 3.3.6 A l k a l i n e L y s i s Method o f P l a s m i d I s o l a t i o n P l a t e s from which c o l o n y l i f t s were o b t a i n e d were i n c u b a t e d 16 h a t 37°C and s t o r e d a t 4°C u n t i l r e q u i r e d . Those 110 c o l o n i e s which i n c o l o n y h y b r i d i z a t i o n t e s t s gave t h e s t r o n g e s t n u c l e i c a c i d h y b r i d i z a t i o n s i g n a l were s e l e c t e d and were grown o v e r n i g h t w i t h s h a k i n g a t 37°C i n 3 ml LB l i q u i d media c o n t a i n i n g 100 p:g/ml a m p i c i l l i n . Recombinant p l a s m i d s were i s o l a t e d u s i n g a m o d i f i e d a l k a l i n e l y s i s p r o c e d u r e ( M a n i a t i s e t al., 1982) r o u t i n e l y u sed f o r p u r i f y i n g p l a s m i d . H a l f o f t h e c u l t u r e 57 ( a p p r o x i m a t e l y 1.4 ml) was t r a n s f e r r e d t o an Eppendorf m i c r o f u g e t u b e , c e n t r i f u g e d f o r 1 min, and t h e s u p e r n a t a n t removed by a s p i r a t i o n . The p e l l e t was resuspended w i t h v o r t e x i n g i n 100 ( l l o f an i c e c o l d s o l u t i o n o f 50 mM g l u c o s e , 10 mM EDTA, 50 mM T r i s -C l , pH 8.0, and 10 mg/ml lysozyme. A f t e r 5 min a t room t e m p e r a t u r e 200 ( l l o f a f r e s h l y p r e p a r e d s o l u t i o n o f 0.2 M NaOH and 1% (w/v) SDS was added and t h e c o n t e n t s mixed by i n v e r t i n g t h e tube s e v e r a l t i m e s . The m i c r o f u g e tube was p l a c e d on i c e f o r 5 min b e f o r e a d d i n g 200 | l l o f an i c e c o l d s o l u t i o n c o n s i s t i n g o f 60 ml o f 5 M p o t a s s i u m a c e t a t e , 11.5 ml g l a c i a l a c e t i c a c i d , and 28.5 ml d e i o n i z e d w a t e r . A f t e r 5 min on i c e t h e sample was c e n t r i f u g e d a t 14,000 rpm i n an Eppendorf m i c r o f u g e . The s u p e r n a t a n t was t r a n s f e r r e d t o a n o t h e r m i c r o f u g e t u b e and e x t r a c t e d w i t h an e q u a l volume o f p h e n o l / c h l o r o f o r m , and t h e n c h l o r o f o r m . Two volumes o f e t h a n o l were added t o t h e aqueous phase, t h e sample was mixed by v o r t e x i n g , and t h e n i t was c e n t r i f u g e d a t room t e m p e r a t u r e a f t e r 2 min a t room t e m p e r a t u r e . The DNA p e l l e t was washed w i t h 70% e t h a n o l , d r i e d i n a vacuum, and resuspended i n 50 |J.l TE. One ( l l o f a 1 mg/ml RNase A s o l u t i o n t h a t was p r e v i o u s l y h e a t e d i n a 90°C water b a t h f o r 10 min was added. T h i s m i x t u r e was used i m m e d i a t e l y o r s t o r e d a t -20°C. DNA p r e p a r e d i n t h i s manner w i l l be r e f e r r e d t o as a m i n i p r e p . 3.3.7 E l e c t r o p h o r e s i s o f R e s t r i c t i o n Enzyme D i g e s t e d DMA P l a s m i d s were a n a l y z e d by d i g e s t i o n w i t h Pvu I I whi c h 58 e x c i s e d t h e e n t i r e cDNA i n s e r t . R e s t r i c t i o n d i g e s t s were done at 37°C ( u n l e s s o t h e r w i s e i n d i c a t e d ) i n 1.5 ml m i c r o f u g e t u b e s c o n t a i n i n g 1 ( l l o f a m i n i p r e p ( a p p r o x i m a t e l y 100 ng o f p l a s m i d DNA) , 1 ( l l o f 10X r e s t r i c t i o n b u f f e r ( s u p p l i e d by enzyme m a n u f a c t u r e r ) , 5 u n i t s o f r e s t r i c t i o n enzyme, and 7.5 ( l l d e i o n i z e d w a t e r . Two | l l o f a 6X l o a d i n g b u f f e r (IX l o a d i n g b u f f e r i s 0.04% (w/v) bromophenol b l u e and 5% (v/v) g l y c e r o l ) was added a f t e r 1 t o 2 h and t h e samples were l o a d e d onto a 1% a g arose g e l made w i t h TAE b u f f e r c o n t a i n i n g 0.5 (ig/ml e t h i d i u m bromide. E l e c t r o p h o r e s i s was a t 4 v o l t s / c m f o r a p p r o x i m a t e l y 2 h. H i n d I I I d i g e s t e d lambda DNA was used as a s i z e marker. G e l s were photographed under 320 nm u l t r a v i o l e t i l l u m i n a t i o n u s i n g Kodak R o y a l pan f i l m and a r e d f i l t e r (Kodak Wr a t t e n 2A). 3 . 3 . 8 I s o l a t i o n of High Molecular Weight Plant RNA T o t a l RNA from h e a l t h y p o t a t o was p u r i f i e d (Kay e t al., 1987) from 1 g o f l e a f t i s s u e ground t o a f i n e powder under l i q u i d n i t r o g e n w i t h a m o r t a r and p e s t l e . A l l subsequent s t e p s were c a r r i e d out a t 4°C u s i n g a u t o c l a v e d r e a g e n t s . The powdered t i s s u e was t r a n s f e r r e d t o a 30 ml Corex tube and 3 volumes o f 100 mM T r i s - C l , pH 8.0, 100 mM N a C l , and 10 mM EDTA (10X TNE) c o n t a i n i n g 0.2% (w/v) SDS and 0.5% (v/v) 2 - m e r c a p t o e t h a n o l . An e q u a l volume o f p h e n o l / c h l o r o f o r m (1:1) was added and t h e sample g e n t l y v o r t e x e d b e f o r e c e n t r i f u g a t i o n i n a S o r v a l l SS34 r o t o r a t 8,000 rpm f o r 5 min. The o r g a n i c phase was r e - e x t r a c t e d w i t h 0.5 volume o f 10X TNE c o n t a i n i n g 0.2% (w/v) SDS and 0.5% (v/v) 2-59 m e r c a p t o e t h a n o l . The combined aqueous phases were e x t r a c t e d w i t h an e q u a l volume o f p h e n o l : c h l o r o f o r m (1:1) and t h e n w i t h c h l o r o f o r m . N u c l e i c a c i d s , which c o n s i s t e d o f RNA and DNA, were p r e c i p i t a t e d from t h e aqueous phase and resuspended i n 3 ml o f IX TNE. An e q u a l volume o f 5 M L i C I was added and t h e sample i n c u b a t e d a t -20°C f o r a t l e a s t 4 h b e f o r e c e n t r i f u g a t i o n a t 8,000 rpm i n a SS34 r o t o r a t 4°C f o r 10 min. The RNA p e l l e t was washed w i t h 70% e t h a n o l , d r i e d , and resuspended i n DEPC t r e a t e d w a t e r . 3.3.9 N o r t h e r n A n a l y s i s C o l o n i e s c o n t a i n i n g p l a s m i d s w i t h t h e l a r g e s t PLRV cDNA i n s e r t s were s e l e c t e d f o r f u r t h e r s t u d y . The o r i g i n o f t h e two l a r g e s t c l o n e s was c o n f i r m e d by h y b r i d i z a t i o n t o PLRV RNA by n o r t h e r n b l o t a n a l y s i s . Two l a n e s each o f PLRV RNA (100 n g ) , t o t a l RNA from h e a l t h y p o t a t o (10 |lg) , and 500 ng o f an RNA l a d d e r (BRL) were l o a d e d onto an agarose g e l c o n t a i n i n g m e t h y l m e r c u r i c h y d r o x i d e and t h e RNA s p e c i e s s e p a r a t e d by e l e c t r o p h o r e s i s as d e s c r i b e d e a r l i e r ( 3 . 1 . 4 ) . One o f t h e two l a n e s c o n t a i n i n g t h e RNA l a d d e r , RNA from h e a l t h y p o t a t o , and PLRV RNA were e x c i s e d , t r e a t e d w i t h 0.1% (v/v) 2 - m e r c a p t o e t h a n o l and 0.5 }lg/ml e t h i d i u m bromide, and photographed b e s i d e a r u l e r t o i n d i c a t e d i s t a n c e s from t h e w e l l . The remainder o f t h e g e l was r i n s e d t w i c e f o r 30 min w i t h r u n n i n g b u f f e r c o n t a i n i n g 0.1% (w/v) 2 - m e r c a p t o e t h a n o l and used f o r a n o r t h e r n b l o t . C a p i l l a r y a c t i o n was used t o t r a n s f e r RNA from t h e g e l t o N y t r a n 60 ( S c h l e i c h e r and S c h u e l l , Keene, NH). The o r d e r o f t h e i t e m s i n t h e b l o t on a smooth f l a t s u r f a c e from bottom t o t o p were: a l a r g e p i e c e o f Saran Wrap; 3 p i e c e s o f 3MM paper s a t u r a t e d w i t h 10X SSC; t h e g e l ; d e i o n i z e d water m o i s t e n e d N y t r a n t h a t was s a t u r a t e d w i t h 10X SSC; 3 p i e c e s o f 3MM paper s a t u r a t e d w i t h d e i o n i z e d w a t e r ; and a 1 i n c h s t a c k o f paper t o w e l s . B u b b l e s between t h e l a y e r s were removed and c o n t a c t between paper above and below t h e g e l was p r e v e n t e d . The sandwich was wrapped i n t h e Saran Wrap and a l i g h t w eight was p l a c e d on t o p t o keep a l l t h e l a y e r s compressed. A f t e r a minimum of 12 h o f b l o t t i n g t h e N y t r a n was l a b e l l e d w i t h p e n c i l , a i r d r i e d i n a v e n t i l a t e d hood f o r s e v e r a l h o u r s , and t h e n baked under vacuum f o r 1 h a t 80°C. 3.3.10 Randomly-Primed DNA Probes The Random P r i m e r DNA L a b e l l i n g System (BRL), which uses a m o d i f i e d F e i n b e r g and V o g e l s t e i n (1983) p r o c e d u r e , was used t o p r e p a r e r a d i o l a b e l l e d DNA probes t o t h e two p l a s m i d s w i t h t h e l a r g e s t cDNA i n s e r t s . A p p r o x i m a t e l y 25 ng o f p l a s m i d DNA ( p r e v i o u s l y l i n e a r i z e d by d i g e s t i o n ) was d i l u t e d t o 5 U.1 w i t h TE i n a m i c r o f u g e t u b e , p l a c e d i n a b o i l i n g water b a t h f o r 5 min, and i m m e d i a t e l y t r a n s f e r r e d t o i c e . Random-primed l a b e l l i n g was c a r r i e d out i n a f i n a l volume o f 50 ( l l u s i n g 20 (IM each o f dCTP, dGTP, dTTP, 0.2 M HEPES, 50 mM T r i s - C l , pH 6.8, 5 mM MgCl 2, 10 mM 2 - m e r c a p t o e t h a n o l , 0.4 mg/ml BSA, 270 |ig/ml o l i g o d e o x y -r i b o n u c l e o t i d e p r i m e r s (hexamer f r a c t i o n ) , 50 | l C i a-32P dATP (3000 Ci/mmole, ICN), and 3 u n i t s o f t h e Klenow fragment o f DNA 61 polymerase I (BRL). TCA p r e c i p i t a t a b l e cpm were d e t e r m i n e d (3.3.3) b e f o r e t h e a d d i t i o n o f Klenow and a l s o a f t e r 1 h o f i n c u b a t i o n a t 25°C. A f t e r a p p r o x i m a t e l y 1 h, t h e DNA probe was p r e c i p i t a t e d as d e s c r i b e d f o r randomly-primed cDNA pro b e s (3.3.3), d e n a t u r e d , and added d i r e c t l y t o t h e n o r t h e r n b l o t h y b r i d i z a t i o n s o l u t i o n ( 3 . 3 . 2 ) . B l o t s were washed and an a u t o r a d i o g r a p h o b t a i n e d as d e s c r i b e d ( 3 . 3 . 4 ) . 3.3.11 R e s t r i c t i o n Enzyme A n a l y s i s and Genomic W a l k i n g R e s t r i c t i o n enzyme s i t e s w i t h i n t h e l a r g e s t cDNA c l o n e s were d e t e r m i n e d f o r Bam HI, Eco R I , H i n c I I , H i n d I I I , P s t I , S a l I , Sma I ( i n c u b a t e d a t 30°C) , S s t I , and Xba I . C l o n e s were o r i e n t a t e d r e l a t i v e t o each o t h e r based on l o c a t i o n o f r e s t r i c t i o n enzyme s i t e s and h y b r i d i z a t i o n a n a l y s i s . DNA from each o f t h e 110 s e l e c t e d p l a s m i d s was s p o t t e d onto N y t r a n s h e e t s and s u b s e q u e n t l y d e n a t u r e d by p l a c i n g t h e N y t r a n on a s t a c k o f 3MM f i l t e r paper soaked i n 0.5 M NaOH f o r 5 min. The N y t r a n was t h e n b l o t t e d d r y and t h e s t e p r e p e a t e d . The N y t r a n was t r a n s f e r r e d t o a s t a c k o f 3MM f i l t e r paper soaked w i t h 1 M T r i s -C l , pH 7.4, and a f t e r 5 min t h e N y t r a n was b l o t t e d d r y and t h e s t e p r e p e a t e d . F i n a l l y t h e membrane was p l a c e d on 3MM f i l t e r p a per soaked w i t h 1.5 M NaCl and 0.5 M T r i s - C l , pH 7.4, and a f t e r 5 min t h e y were b l o t t e d d r y and baked 1 h a t 8 0°C i n a vacuum. Each membrane, which p o s s e s s e d a l l 110 p l a s m i d s , was p r o b e d w i t h randomly p r i m e d o l i g o n u c l e o t i d e s (3.3.10) s y n t h e s i z e d t o g e l -p u r i f i e d end fragments o f t h e two l a r g e s t cDNA c l o n e s (see next 62 paragraph). This permitted the selection of cDNA clones which extended beyond these two largest clones. Afte r r e s t r i c t i o n enzyme digests and separation of DNA fragments by electrophoresis i n 1% (w/v) low melting temperature agarose gels, end fragments were i s o l a t e d using the method of Thuring et al. (1975). Excised gel fragments were placed i n a microfuge tube, weighed, and then an equal volume of 0.3 M sodium acetate, pH 5.2, and 1 mM EDTA, pH 7.0, was added. The fragments were heated i n a 65°C water bath for 5 min, vortexed, frozen with l i q u i d nitrogen, and then centrifuged for 5 min at room temperature. The aqueous phase was removed and the procedure was repeated twice. The aqueous phases were combined and the DNA end fragments p r e c i p i t a t e d . These end fragments were then l a b e l l e d with 3 2P using the random priming DNA l a b e l l i n g system (3.3.10). 3.4 P r e p a r a t i o n o f Sub c l o n e s 3 . 4 . 1 U n i d i r e c t i o n a l N e s t e d D e l e t i o n s U n i d i r e c t i o n a l deletions of selected cDNA clones were created following the protocol described by Stratagene (San Diego, CA) using exonuclease III (BRL) and mung bean nuclease (BRL) (Henikoff, 1984). Plasmid DNAs were sequentially digested f i r s t with Apa I (incubated at 30°C) to generate a 3' overhang (which i s resist a n t to exonuclease III cleavage) and then with Sal I to produce a 5' overhang for exonuclease III cleavage of cDNA i n s e r t . Approximately 3 |ig of double-digested DNA was used for each time point required. The DNA was suspended i n 50 u\l of 63 a s o l u t i o n c o n t a i n i n g 50 mM T r i s - C l , pH 8.0, 20 mM 2-m e r c a p t o e t h a n o l , 5 mM MgCl 2, and 10 fi.g/ml tRNA. E x o n u c l e a s e I I I (150 u n i t s ) was added and t h e r e a c t i o n i n c u b a t e d a t 30°C. A l i q u o t s were removed a t 1 min i n t e r v a l s t o o b t a i n n e s t e d d e l e t i o n s d i f f e r i n g i n l e n g t h by a p p r o x i m a t e l y 230 bp (St r a t a g e n e ) . A t each t i m e p o i n t a 50 | l l a l i q u o t was t r a n s f e r r e d t o a tub e c o n t a i n i n g 350 \il o f 30 mM sodium a c e t a t e , pH 5.0, 50 mM N a C l , 1 mM Z n C l 2 , and 5% (v/v) g l y c e r o l . Samples were f r o z e n i m m e d i a t e l y w i t h l i q u i d n i t r o g e n u n t i l a l l a l i q u o t s had been removed. Samples were t h e n h e a t e d a t 68°C f o r 15 min and p l a c e d on i c e . Nine u n i t s o f mung bean n u c l e a s e was added and a l l o w e d t o i n c u b a t e f o r 30 min a t 30°C. Samples were e x t r a c t e d w i t h e q u a l volumes o f p h e n o l / c h l o r o f o r m and c h l o r o f o r m , t h e DNA p r e c i p i t a t e d , washed, and resuspended i n 15 (ll TE. A 4 jxl a l i q u o t o f t h e e x o n u c l e a s e I I I , mung bean n u c l e a s e t r e a t e d DNA from each t i m e p o i n t was b l u n t - e n d l i g a t e d as d e s c r i b e d above ( 3 . 2 . 3 ) . T h i s DNA was used t o t r a n s f o r m p r e p a r e d competent E. c o l i DH5a c e l l s . A l t h o u g h s i m i l a r t o p r e v i o u s t r a n s f o r m a t i o n s (3.2.4) t h e s e were done i n Eppendorf m i c r o f u g e t u b e s and o n l y 0.4 ml o f LB l i q u i d media was added a f t e r t h e c e l l s were heat shocked. 3 . 4 . 2 P r e p a r a t i o n o f Competent E. coll C e l l s Competent E. c o l i DH5a c e l l s (BRL) were p r e p a r e d u s i n g t h e p r o c e d u r e o f M o r r i s o n (1979). A s i n g l e DH5a c o l o n y from an LB agar p l a t e was used t o i n o c u l a t e 3 ml o f LB medium and i n c u b a t e d 64 at 37°C w i t h v i g o r o u s s h a k i n g o v e r n i g h t . One ml o f t h e o v e r n i g h t c u l t u r e was used t o i n o c u l a t e 250 ml LB medium i n a l i t r e f l a s k . B a c t e r i a were i n c u b a t e d a t 37°C w i t h v i g o r o u s s h a k i n g (200 rpm) u n t i l t h e OD 6 0 0 n m was a p p r o x i m a t e l y 0.5 on a S p e c t r o n i c 20 (Beckman, F u l l e r t o n , CA) s p e c t r o p h o t o m e t e r . C e l l s were c o o l e d r a p i d l y t o 0-5°C u s i n g a s a l t / i c e b a t h and t h e n c e n t r i f u g e d f o r 8 min a t 4°C i n a GSA r o t o r a t 8000 rpm. P e l l e t s were g e n t l y r esuspended u s i n g a wide mouth p i p e t t e i n 62.5 ml 0.1 M MgCl 2 over a 10 min p e r i o d . C e l l s were c e n t r i f u g e d as above, resuspended i n 62.5 ml 0.1 M C a C l 2 over 20 min, and c e n t r i f u g e d a g a i n . These p e l l e t s were resuspended i n 10.75 ml 0.1 M C a C l 2 and 1.75 ml g l y c e r o l b e f o r e 200 ( l l a l i q u o t s were t r a n s f e r r e d t o 1.5 ml Eppendorf t u b e s and r a p i d l y f r o z e n i n an e t h a n o l / d r y i c e b a t h . C e l l s were s t o r e d a t -70°C. These c e l l s were d i r e c t l y u sed f o r t r a n s f o r m a t i o n as d e s c r i b e d ( 3 . 2 . 4 ) . 3.5 DNA S e q u e n c i n g 3.5.1 S e l e c t i o n o f Su b c l o n e s The s i z e s o f i n s e r t s o b t a i n e d from s u b c l o n e s g e n e r a t e d by e x o n u c l e a s e I I I d e l e t i o n were d e t e r m i n e d from p l a s m i d DNA o b t a i n e d by t h e a l k a l i n e l y s i s method (3 . 3 . 6 ) . P l a s m i d DNA was d i g e s t e d w i t h Pvu I I and i n s e r t s s e p a r a t e d by e l e c t r o p h o r e s i s i n agarose g e l s i n TAE b u f f e r ( 3 . 3 . 7 ) . H i n d I I I and P s t I d i g e s t e d lambda DNA was used as a s i z e marker. Subclones w i t h t h e d e s i r e d s i z e d i n s e r t s were sequenced by t h e d i d e o x y n u c l e o t i d e c h a i n t e r m i n a t i o n method (Sanger e t al., 1977) u s i n g d o u b l e - s t r a n d e d 65 p l a s m i d DNA as t e m p l a t e (Korneluk e t al., 1985). 3.5.2 Se q u e n c i n g G e l s Sequencing g e l s were 21 X 50 cm u s i n g wedge s p a c e r s w i t h a w i d t h o f 0.25 t o 0.75 mm. The g e l c o n t a i n e d IX TBE (89 mM T r i s , 89 mM b o r i c a c i d , and 2 mM EDTA), 6% (w/v) a c r y l a m i d e (from a 20% s t o c k c o n t a i n i n g 19% a c r y l a m i d e and 1% b i s - a c r y l a m i d e ) , and 7.67 M u r e a . Immediately b e f o r e p o u r i n g t h e s o l u t i o n , 52 | l l o f TEMED (Bio-Rad) and 52 ( l l o f f r e s h l y p r e p a r e d 25% (w/v) ammonium p e r s u l f a t e were added. Sequencing g e l s were p r e p a r e d t h e day b e f o r e t h e y were used. Running b u f f e r f o r s e q u e n c i n g g e l s was IX TBE. Sequencing g e l s were p r e - e l e c t r o p h o r e s e d f o r 1 h a t 38 W or u n t i l t h e t e m p e r a t u r e o f t h e g e l r e a c h e d about 50°C. "Sharks t o o t h " combs (Bio-Rad) were removed and w e l l s r i n s e d w i t h TBE b e f o r e samples were l o a d e d . Samples were e l e c t r o p h o r e s e d t h r o u g h t h e s e g e l s f o r 2 t o 8 h a t 40 W depending on t h e d e s i r e d l e n g t h o f DNA sequence t o be r e a d (a 3 h run g e n e r a l l y r e s o l v e d 180 t o 250 n u c l e o t i d e s ) . A f t e r e l e c t r o p h o r e s i s , g e l s were t r a n s f e r r e d t o Whatman 3MM f i l t e r paper and d r i e d f o r 1 h a t 80°C u s i n g a B i o - R a d g e l d r y e r (Richmond, CA). A u t o r a d i o g r a p h y was o v e r n i g h t a t room t e m p e r a t u r e w i t h o u t i n t e n s i f y i n g s c r e e n s . A u t o r a d i o g r a m s were r e a d m a n u a l l y o r w i t h t h e Bi o - R a d Gene M a s t e r d i g i t i z e r and sequence i n f o r m a t i o n s t o r e d and a n a l y z e d u s i n g t h e Gene M a s t e r s o f t w a r e ( B i o - R a d ) . 6 6 3.5.3 Sequencing w i t h Klenow The d o u b l e - s t r a n d e d s e q u e n c i n g p r o t o c o l used was t h a t d e s c r i b e d by S t r a t a g e n e (San Diego, CA). H a l f o f t h e d o u b l e -s t r a n d e d DNA from m i n i p r e p s o f s e l e c t e d s u b c l o n e s was i n c u b a t e d a t room t e m p e r a t u r e f o r 5 min i n 50 [ l l o f 0.2 M NaOH and 0.2 mM EDTA t o d e n a t u r e t h e DNA. N u c l e i c a c i d s were t h e n p r e c i p i t a t e d w i t h 0.1 volume 2 M ammonium a c e t a t e , pH 5.4, and 2.5 volumes o f a b s o l u t e e t h a n o l f o r 10 min i n l i q u i d n i t r o g e n . Samples were c e n t r i f u g e d , washed, d r i e d , and resuspended i n 8 ( l l TE. Sequences were d e t e r m i n e d u s i n g t h e B l u e s c r i p t p l a s m i d r e v e r s e p r i m e r and t h e Klenow (BRL) enzyme a t 42°C. 3.5 .4 Sequencing w i t h Sequenase A r e a s w i t h c ompressions o r where sequences were not i n agreement were a l s o sequenced by a m o d i f i e d p r o c e d u r e u s i n g Sequenase ( U n i t e d S t a t e s B i o c h e m i c a l C o r p o r a t i o n , C l e v e l a n d , OH). H a l f o f a s u b c l o n e m i n i p r e p was added t o 10 ng o f B l u e s c r i p t p l a s m i d r e v e r s e p r i m e r f o r a f i n a l volume o f 50 ( l l c o n t a i n i n g 0.2 M NaOH and 0.2 mM EDTA. Samples were i n c u b a t e d f o r 5 min a t 85°C, p l a c e d on i c e , and p r e c i p i t a t e d w i t h sodium a c e t a t e and e t h a n o l a t -70°C f o r 10 min. N u c l e i c a c i d p r e c i p i t a t e s were c e n t r i f u g e d , washed w i t h 70% e t h a n o l , d r i e d , and resuspended i n 7.5 ( l l o f 40 mM T r i s - C l , pH 7.5, 20 mM MgCl 2, and 50 mM N a C l . Sequences were d e t e r m i n e d u s i n g e i t h e r dGTP or i t s a n a l o g dITP as d e s c r i b e d by t h e m a n u f a c t u r e r . 67 3.6 Coat P r o t e i n Gene C o n s t r u c t s The p u t a t i v e PLRV c o a t p r o t e i n ORF was i d e n t i f i e d from sequence s i m i l a r i t y w i t h a n o t h e r r e c e n t l y sequenced l u t e o v i r u s (BYDV-PAV) c o a t p r o t e i n gene ( M i l l e r e t al., 1988a). F o l l o w i n g i d e n t i f i c a t i o n o f t h e c o a t p r o t e i n gene t h r e e c o n s t r u c t s were p r e p a r e d f o r i n s e r t i o n o f t h e gene i n t o p l a n t s . The c l o n e LP7 9 whi c h c o n t a i n s t h e c o a t p r o t e i n ORF was d i g e s t e d w i t h P s t I and Pvu I I (both o f which c l e a v e t h e PLRV cDNA sequence) and t h e l a r g e s t DNA fragment o f a p p r o x i m a t e l y 1100 base p a i r s was g e l -p u r i f i e d . T h i s fragment was used t o p r e p a r e t h r e e d i f f e r e n t c o n s t r u c t s o f t h e coa t p r o t e i n gene ( F i g u r e 2 ) . Two c o n s t r u c t s were p r e p a r e d by A l u I d i g e s t i o n o f t h e P s t I-Pvu I I fragment. A l u I d i g e s t i o n r e s u l t e d i n a b l u n t - e n d e d fragment o f a p p r o x i m a t e l y 1000 base p a i r s . T h i s fragment was g e l - p u r i f i e d (3.3.11) and t h e n l i g a t e d i n t o Eco RV d i g e s t e d , CIP t r e a t e d M13+ B l u e s c r i p t ( 3 . 2 .3). P l a s m i d s from t r a n s f o r m a n t s o f E. c o l i DH5oc were examined u s i n g t h e r e s t r i c t i o n enzyme Rsa I t o o b t a i n c o n s t r u c t s o f t h e gene i n b o t h o r i e n t a t i o n s . B o t h pCP20E ( p o s i t i v e - s e n s e ) and pCP27E ( n e g a t i v e - s e n s e ) , l a t e r d e s i g n a t e d LCP 107 and LCP 1718 r e s p e c t i v e l y , p o s s e s s e d 192 n u c l e o t i d e s o f P L R V sequence 5' t o t h e c o a t p r o t e i n AUG and 112 n u c l e o t i d e s o f t h e P L R V sequence 3' t o t h e c o a t p r o t e i n UAG t e r m i n a t i o n codon. The t h i r d c o n s t r u c t was p r e p a r e d v i a l i g a t i o n o f s e v e r a l r e s t r i c t i o n fragments a l l o b t a i n e d from t h e i n i t i a l P s t l - P v u I I r e s t r i c t i o n fragment ( F i g u r e 2 ) . One fragment was o b t a i n e d by Sau 3AI d i g e s t i o n p r o d u c i n g a fragment a p p r o x i m a t e l y 370 68 ATG TAG Coat Protein ORF 100 nt F i g u r e 2 . Diagram of t h e r e s t r i c t i o n s i t e s used t o p r e p a r e t h e t h r e e PLRV c o a t p r o t e i n c o n s t r u c t s . The P s t I and Pvu I I r e s t r i c t i o n fragment o f LP7 9 i s shown w i t h t h e l o c a t i o n o f t h e r e s t r i c t i o n s i t e s r e l a t i v e t o t h e c o a t p r o t e i n ORF. Below t h e L P 7 9 r e s t r i c t i o n fragment t h e p o s i t i o n o f t h e c o a t p r o t e i n s t a r t (ATG) and s t o p (TAG) codon i s i n d i c a t e d . n u c l e o t i d e s i n l e n g t h which was g e l - p u r i f i e d . T h i s fragment was d i g e s t e d f u r t h e r w i t h Ava I which r e c o g n i z e s a n o n - p a l i n d r o m i c sequence y i e l d i n g two fragments o f s i m i l a r m o l e c u l a r w e i g h t , b o t h p o s s e s s i n g an i d e n t i c a l Sau 3AI d i g e s t e d t e r m i n u s , but o n l y one fragment w i t h t h e d e s i r e d Ava I t e r m i n u s . A n o t h e r fragment was d e r i v e d from t h e P s t I-Pvu I I fragment by Ava I d i g e s t i o n and g e l e x t r a c t i o n o f t h e l a r g e s t fragment o f a p p r o x i m a t e l y 800 n u c l e o t i d e s i n l e n g t h . T h i s fragment c o n t a i n e d an Ava I t e r m i n u s and a Pvu I I t e r m i n u s . A l l o f t h e fragments o b t a i n e d were used i n a f o r c e d -o r i e n t a t i o n , s t i c k y - e n d l i g a t i o n i n t o Bam HI and Sma I d i g e s t e d 69 B l u e s c r i p t M13+ p l a s m i d t h a t was t h e n CIP t r e a t e d and g e l -p u r i f i e d . A l t h o u g h 3 fragments a r e p r e s e n t i n t h e l i g a t i o n r e a c t i o n , o n l y two c o u l d be l i g a t e d i n t o t h e v e c t o r . The Pvu I I -end i s c o m p a t i b l e w i t h t h e Sma I-end i n B l u e s c r i p t and t h e Sau 3AI-end i s c o m p a t i b l e w i t h t h e Bam H l - e n d i n B l u e s c r i p t . The r e s u l t i n g p l a s m i d , pCP13, l a t e r d e s i g n a t e d LCP 31 was a n a l y z e d w i t h v a r i o u s r e s t r i c t i o n enzymes t o v e r i f y t h e l i g a t i o n o f t h e c o r r e c t f r a g m e n t s . T h i s c o n s t r u c t s h o u l d p o s s e s s o n l y 12 PLRV n u c l e o t i d e s 5' t o t h e c o a t p r o t e i n AUG but would s t i l l have 112 PLRV n u c l e o t i d e s 3' t o t h e c o a t p r o t e i n amber t e r m i n a t i o n codon. The s h o r t c o n s t r u c t was l a t e r e x c i s e d from B l u e s c r i p t w i t h A l u I , g e l - p u r i f i e d , and r e - l i g a t e d i n t o Eco RV d i g e s t e d CIP t r e a t e d B l u e s c r i p t t o r e v e r s e t h e o r i e n t a t i o n and f a c i l i t a t e i n s e r t i o n i n t o t h e i n t e r m e d i a t e e x p r e s s i o n v e c t o r pCDXl. C o n d i t i o n s f o r t h e s t i c k y - e n d l i g a t i o n s were s i m i l a r t o t h o s e o f b l u n t - e n d l i g a t i o n s ( 3 . 2 .3). A 1:1 o r 1:1:1:1 r a t i o o f DNA t o be l i g a t e d was added t o t h e l i g a t i o n m i x t u r e p r e v i o u s l y d e s c r i b e d e x c e p t o n l y 0.2 u n i t s o f T4 DNA l i g a s e was used. R e a c t i o n s were i n c u b a t e d 2 h a t 37°C and t h e l i g a t i o n r e a c t i o n used i m m e d i a t e l y t o t r a n s f o r m competent E. coli DH5CC. 3 . 7 T r i p a r e n t a l M a t i n g P r o c e d u r e The t h r e e c o n s t r u c t s were d i g e s t e d w i t h Xho I and Eco RI and i n s e r t e d i n t o t h e i n t e r m e d i a t e e x p r e s s i o n p l a s m i d , pCDXl ( F i g u r e 3 ) , which p o s s e s s e s a d u p l i c a t e d CaMV 35S enhancer-promoter ( c o n s t r u c t e d by Kay e t a l . , 1987) . The pCDXl p l a s m i d had been 70 F i g u r e 3 . Schematic diagram o f t h e i n t e r m e d i a t e e x p r e s s i o n v e c t o r pCDXl. T h i s v e c t o r , c o n s t r u c t e d by Kay e t al. (1987), was used t o f a c i l i t a t e t h e t r a n s f e r o f a l l t h r e e PLRV c o n s t r u c t s i n t o p l a n t genomes. The v e c t o r c o n t a i n s t h e d u p l i c a t e d CaMV 35S promoter-enhancer, t h e NPT I I gene, t h e s p e c t i n o m y c i n r e s i s t a n c e gene, t h e NOS gene, t h e NOS p o l y a d e n y l a t i o n s i g n a l , and a s e c t i o n o f homology w i t h t h e o c t o p i n e s y n t h a s e gene which f a c i l i t a t e s homologous r e c o m b i n a t i o n w i t h t h e d i s a r m e d T i p l a s m i d . I n a d d i t i o n t o a p o l y l i n k e r , t h e pCDXl p l a s m i d a l s o has t h e r i g h t b o r d e r sequence o f t h e T-DNA. p r e v i o u s l y d i g e s t e d w i t h Xho I and Eco RI and CIP t r e a t e d ( 3 . 2 . 3 ) . A f t e r l i g a t i o n t h e p l a s m i d was used t o t r a n s f o r m competent E. c o l i MM294. The v e c t o r , now c o n t a i n i n g t h e PLRV gene c o n s t r u c t s , was i n s e r t e d i n t o t h e di s a r m e d o c t o p i n e t y p e T i p l a s m i d pTiB6S3SE ( F r a l e y et al., 1985) by homologous r e c o m b i n a t i o n ( F i g u r e 4) as d e s c r i b e d p r e v i o u s l y (Rogers e t al., 1986). The t r i p a r e n t a l m a t i n g p r o c e d u r e i n v o l v e s t h e c o n j u g a t i o n o f t h r e e b a c t e r i a , E. c o l i MM 294 c o n t a i n i n g t h e pCDXl d e r i v a t i v e p l a s m i d , MM 294 c o n t a i n i n g t h e m o b i l i z a t i o n p l a s m i d pRK2013 ( D i t t a e t al., 1980), 7 1 Foreign D N A NFT N O S F i g u r e 4. S t r u c t u r e o f t h e pTiB6S3SE::pCDXl c o i n t e g r a t e o b t a i n e d by a t r i p a r e n t a l m a t i n g and homologous r e c o m b i n a t i o n . A. tumefaciens t h e n t r a n s f e r s t h e i n f o r m a t i o n w hich o c c u r s between t h e r i g h t (T R) and l e f t (T L) T-DNA b o r d e r sequence i n t o t h e genome o f t h e wounded p l a n t t i s s u e . I n s e r t e d i n t o t h e genome a l o n g w i t h t h e PLRV coa t p r o t e i n cDNA was t h e NOS gene and t h e NPT I I gene. The l a t t e r made t h e t r a n s f o r m e d p l a n t c e l l s r e s i s t a n t t o t h e a n t i b i o t i c kanamycin. 72 and A. tumefaciens s t r a i n G V 3 T i l l S E c o n t a i n i n g t h e d i s a r m e d p l a s m i d pTiB6S3SE. The MM 294 l i n e was made competent and t r a n s f o r m e d u s i n g t h e same p r o c e d u r e used w i t h E. c o l i DH5a (3 . 4 . 2 ) . I n t h e t r i p a r e n t a l m a t i n g , t h e pRK2013 p l a s m i d m o b i l i z e s i n t o t h e E. c o l i c o n t a i n i n g t h e pCDXl p l a s m i d . Once w i t h i n t h e E. c o l i / p C D X l c e l l , pRK2013 p r o v i d e s t r a n s f e r p r o t e i n t h a t a c t s on t h e pCDXl p l a s m i d and t h e r e b y m o b i l i z e s t h e p l a s m i d i n t o A. tumefaciens. With t h e pCDXl p l a s m i d i n A. tumefaciens, i t can i n t e g r a t e i n t o t h e r e s i d e n t d i s a r m e d pTiB6S3SE t h r o u g h homologous r e c o m b i n a t i o n . P r i o r t o t h e m a t i n g p r o c e d u r e a s i n g l e c o l o n y o f A. tumefaciens was s e l e c t e d from LB p l a t e s , c o n t a i n i n g 25 (Xg/ml c h l o r a m p h e n i c o l and 50 |lg/ml kanamycin, t h a t had been i n c u b a t e d 16 h a t 28°C. A s i n g l e c o l o n y o f E. c o l i MM 294 w i t h t h e pRK2013 p l a s m i d was a l s o i s o l a t e d from LB p l a t e s c o n t a i n i n g 50 pig/ml kanamycin t h a t were i n c u b a t e d a t 37°C. F i n a l l y , a s i n g l e c o l o n y o f E. c o l i MM 294 w i t h t h e d e s i r e d pCDXl c o n s t r u c t was s e l e c t e d from LB p l a t e s w i t h 50 (ig/ml s p e c t i n o m y c i n i n c u b a t e d o v e r n i g h t a t 37°C. O v e r n i g h t LB c u l t u r e s w i t h t h e a p p r o p r i a t e a n t i b i o t i c s were i n o c u l a t e d from a s i n g l e b a c t e r i a l c o l o n y and grown a t t h e t e m p e r a t u r e s i n d i c a t e d above. C u l t u r e s were d i l u t e d t h e f o l l o w i n g day and grown t o l o g phase. A 1 ml a l i q u o t from each c u l t u r e was t h e n mixed i n a s t e r i l e p o l y s t y r e n e t u b e , c e n t r i f u g e d , and resuspended i n 2 ml o f 10 mM MgSO„. The m i x t u r e was t r a n s f e r r e d t o a 5 ml s y r i n g e c o n n e c t e d t o a s t e r i l e Swinney f i l t e r a p p a r a t u s w i t h a 0.2 |im M i l l i p o r e ( B e d f o r d , Ma) f i l t e r 73 (SXHA025LS). C e l l s were c o l l e c t e d on t h e d i s k w h i c h was t r a n s f e r r e d t o a f r e s h , n o n d r i e d LB agar p l a t e and i n c u b a t e d a t 28°C o v e r n i g h t . F i l t e r s were t h e n a s e p t i c a l l y removed and p l a c e d i n t o s t e r i l e p o l y s t y r e n e t u b e s c o n t a i n i n g 2.0 ml o f 10 mM MgS0 4 and t h e tube g e n t l y v o r t e x e d f o r 1 min. A 0.1 ml a l i q u o t o f c e l l s was t h e n s p r e a d on f r e s h LB s e l e c t i o n p l a t e s c o n t a i n i n g 25 u\g/ml c h l o r a m p h e n i c o l , 50 |ig/ml kanamycin, and 100 ng/ml s p e c t i n o m y c i n . Only A. tumefaciens w i t h a p C D X l : : T i c o i n t e g r a t e s h o u l d produce c o l o n i e s on t h i s medium. P l a t e s were i n c u b a t e d a t 28°C f o r 3 days and i n d i v i d u a l c o l o n i e s t h e n used t o i n o c u l a t e LB o v e r n i g h t c u l t u r e s , w hich were i n c u b a t e d a t 28°C. These c u l t u r e s c o n t a i n e d t h e same a n t i b i o t i c s as i n t h e s e l e c t i o n p l a t e s . C e l l s were s t o r e d w i t h an e q u a l volume o f g l y c e r o l a t -70°C. 3.8 P l a n t T r a n s f o r m a t i o n s V a r i o u s t i s s u e s from t h r e e d i f f e r e n t p l a n t t y p e s were t r a n s f o r m e d . I n i t i a l l y Nicotiana tabacum c u l t i v a r ' X a n t h i - n c ' was used s i n c e i t i s r e a d i l y t r a n s f o r m e d (Horsch e t a l . , 1985) and r e p r e s e n t s a good model t r a n s f o r m a t i o n system. Then t h e Solanum tuberosum c u l t i v a r ' D e s i r e e ' , which has been one o f t h e e a s i e r p o t a t o c u l t i v a r s t o t r a n s f o r m (Stiekema e t al., 1988), was i n o c u l a t e d w i t h recombinant A. tumefaciens and t r a n s g e n i c p l a n t s r e g e n e r a t e d . F i n a l l y , t h e S. tuberosum c u l t i v a r 'Russet Burbank' was t r a n s f o r m e d w i t h t h e PLRV coa t p r o t e i n gene. T h i s p o t a t o c u l t i v a r has been v e r y d i f f i c u l t t o t r a n s f o r m and r e g e n e r a t e but 74 r e p r e s e n t s t h e most commonly grown c u l t i v a r i n N o r t h A m e r i c a . PLRV r e s i s t a n c e i n t h i s c u l t i v a r would, t h e r e f o r e , have t h e g r e a t e s t i m p a c t . 3.8.1 T r a n s f o r m a t i o n o f Tobacco Nicotiana tabacum c u l t i v a r ' X a n t h i - n c ' l e a f d i s k s were i n o c u l a t e d w i t h c u l t u r e s o f recombinant A. tumefaciens and c u l t u r e d in v i t r o as d e s c r i b e d by H o r sch et a l . (1985). H e a l t h y , u n b l e m i s h e d l e a v e s were s e l e c t e d from young p l a n t s and s t e r i l i z e d i n a s o l u t i o n o f 0.6% (v/v) sodium h y p o c h l o r i t e and 0.01% (v/v) Tween 20. A f t e r 20 min w i t h o c c a s i o n a l a g i t a t i o n t h e l e a v e s were r i n s e d 6 t i m e s w i t h s t e r i l e d e i o n i z e d w a t e r . Leaves were b l o t t e d d r y w i t h s t e r i l e paper t o w e l and 6 mm d i s k s e x c i s e d w i t h a b o r e r . Seventy l e a f d i s k s were submerged i n an o v e r n i g h t c u l t u r e o f A. tumefaciens i n c u b a t e d a t 28°C i n LB medium c o n t a i n i n g 25 u.g/ml c h l o r a m p h e n i c o l , 50 (ig/ml kanamycin, and 100 |ig/ml s p e c t i n o m y c i n w h i c h had been d i l u t e d w i t h 9 volumes o f Murashige and Skoog (1962) s a l t s (Sigma C h e m i c a l Company M5524 S t . L o u i s , MO). A f t e r g e n t l y s h a k i n g i n a p e t r i p l a t e f o r 1 min t h e d i s k s were b l o t t e d d r y on s t e r i l i z e d paper t o w e l and i n c u b a t e d a t 22°C u p s i d e down on a medium c o n t a i n i n g MS s a l t s , 0.001 volumes o f a N i t s c h and N i t s c h v i t a m i n s o l u t i o n (Sigma C h e m i c a l Company N8764 S t . L o u i s , MO), 30 g/L s u c r o s e , 1 (ig/ml b e n z y l a d e n i n e , 0.1 (ig/ml n a p h t h a l e n e a c e t i c a c i d , and 0.6 % (w/v) agar. A f t e r 2 days t h e d i s k s were t r a n s f e r r e d t o an i d e n t i c a l medium ex c e p t t h a t i t a l s o c o n t a i n e d 500 |ig/ml c a r b e n i c i l l i n , 250 u\g/ml c e f o t a x i m e , and 300 |ig/ml 75 kanamycin. The c a r b e n i c i l l i n and c e f o t a x i m e a r e used t o e l i m i n a t e t h e A. tumefaciens and t h e kanamycin f a c i l i t a t e s t h e s e l e c t i o n o f t r a n s f o r m e d c e l l s . L e a f d i s k s were t r a n s f e r r e d t o f r e s h media e v e r y two weeks d u r i n g shoot development. Shoots 3-5 mm were e x c i s e d from c a l l i and t r a n s f e r r e d t o a medium which l a c k s t h e phytohormones and c o n t a i n s o n l y 100 (ig/ml kanamycin. Once r o o t s were o b s e r v e d t h e medium was removed from t h e r o o t s by washing and t h e p l a n t l e t s were t r a n s f e r r e d t o s t e r i l i z e d s o i l . The p l a n t l e t s were hardened o f f by s l o w l y r e d u c i n g t h e h u m i d i t y . A c l e a r p l a s t i c cup was used t o c o v e r t h e p l a n t l e t and m a i n t a i n a h i g h h u m i d i t y f o r 3 days. The cup was t h e n t i l t e d t o c r e a t e an o p e n i n g a p p r o x i m a t e l y 1 cm wide and was removed two days l a t e r . 3.8.2 T r a n s f o r m a t i o n o f t h e P o t a t o C u l t i v a r ' D e s i r e e ' Tuber d i s k s o f t h e Solanum tuberosum c u l t i v a r ' D e s i r e e ' were i n o c u l a t e d and c u l t u r e d in v i t r o as d e s c r i b e d by Stiekema e t a l . (1988) . T h i s 5. tuberosum c u l t i v a r i s one o f t h e most amenable t o t r a n s f o r m a t i o n . Tubers s t o r e d f o r 2 months a t 4°C were p e e l e d and s t e r i l i z e d u s i n g t h e p r o c e d u r e f o l l o w e d w i t h t o b a c c o l e a f d i s k s ( 3 . 7 . 1 ) . S u b s e q u e n t l y , u s i n g a b o r e r , 1.0 cm c y l i n d e r s were punched out and c u t i n t o t u b e r d i s k s a p p r o x i m a t e l y 2 mm i n t h i c k n e s s . Each o f t h e t h r e e c o n s t r u c t s i n A. tumefaciens were used t o i n o c u l a t e 91 t u b e r d i s k s and i n c u b a t e d on p l a t e s c o n t a i n i n g MS s a l t s , 3% (w/v) s u c r o s e , 0.01 mg/l NAA, 1 mg/l z e a t i n , v i t a m i n s , and 0.6% agar f o r 3 days a t 22°C w i t h 16 h/8 h l i g h t / d a r k . S u b s e q u e n t l y , t h e d i s k s were t r a n s f e r r e d t o a s i m i l a r medium w i t h 100 |ig/ml kanamycin, 500 [iq/ml c a r b e n i c i l l i n , and 250 (lg/ml c e f o t a x i m e . Two weeks l a t e r t h e d i s k s were t r a n s f e r r e d t o a shoot e l o n g a t i o n medium c o n t a i n i n g MS s a l t s , 3% s u c r o s e , 0.25 mg/L b e n z y l amino p u r i n e , 0.6% (w/v) agar, 0.1 mg/L GA3, 500 [lg/ml c a r b e n i c i l l i n , and 100 mg/L kanamycin. A s i m i l a r t r a n s f e r was made a f t e r a n o t h e r two weeks d u r i n g w h i c h t i m e s h o o t s 2-3 mm l o n g were t r a n s f e r r e d t o a r o o t i n g medium c o n t a i n i n g MS s a l t s , 2% (w/v) s u c r o s e , 0.1 mg/L IAA, and 0.6% (w/v) ag a r . Rooted p l a n t l e t s were t r a n s f e r r e d t o s o i l i n t h e same manner as were t h e t o b a c c o p l a n t l e t s . 3.8.3 T r a n s f o r m a t i o n o f t h e P o t a t o C u l t i v a r 'Russet Burbank' V a r i o u s t i s s u e s o f S. tuberosum c u l t i v a r 'Russet Burbank' were i n o c u l a t e d w i t h A. tumefaciens w i t h each o f t h e t h r e e recombinant p l a s m i d s as were t h e ' X a n t h i ' (3.8.1) and ' D e s i r e e ' (3.8.2) t i s s u e s . Tuber d i s k s were o b t a i n e d , i n o c u l a t e d , and c u l t u r e d in vitro as d e s c r i b e d above (3.8.2). Stem and l e a f s e c t i o n s were i n o c u l a t e d and c u l t u r e d in vitro as d e s c r i b e d by De B l o c k (1988) w i t h minor m o d i f i c a t i o n s . T i s s u e was d e r i v e d from p l a n t s i n a x e n i c c u l t u r e which were p r o p a g a t e d in vitro by t r a n s f e r r i n g 1 cm l o n g stem p i e c e s t o g e t h e r w i t h an a x i l l a r y bud t o MS medium w i t h 20 g/L s u c r o s e and 0.6% agar (SI m e d i a ) . F i f t y l e a v e s a p p r o x i m a t e l y 2-10 mm i n l e n g t h were c u t a t t h e base and f i f t y i n t e r n o d a l stem c u t t i n g s a p p r o x i m a t e l y 5 mm i n l e n g t h were e x c i s e d from 3 t o 4 week o l d s h o o t s . Each t i s s u e was submersed i n a d i l u t e d A. tumefaciens c u l t u r e , a g i t a t e d , and b l o t t e d d r y . I n o c u l a t e d t i s s u e was p l a c e d u p s i d e down where a p p l i c a b l e on SI medium f o r 2 days a t 22°C. A l l t i s s u e s were t h e n washed i n a p o l y s t y r e n e tube w i t h MS medium c o n t a i n i n g 30 g/L s u c r o s e , 0.5 g/L MES, pH 5.5, 20 g/L m a n n i t o l , and 1 g/L c a r b e n i c i l l i n . A f t e r b l o t t i n g d r y t h e c u t t i n g s were p l a c e d u p s i d e down on MS medium w i t h o u t s u c r o s e and supplemented w i t h 200 mg/L g l u t a m i n e , 0.5 g/L MES, pH 5.7, 0.5 g/L PVP-44,000, 20 g/L m a n n i t o l , 20 g/L g l u c o s e , 40 mg/L adenine s u l f a t e , and 0.5% (w/v) a g a r . T h i s medium a l s o c o n t a i n e d 1 mg/L t r a n s - z e a t i n , 0.1 mg/L NAA, 1 g/L c a r b e n i c i l l i n , 100 mg/L kanamycin, and 10 mg/L s i l v e r n i t r a t e w hich were added i m m e d i a t e l y b e f o r e p o u r i n g i n t o p e t r i p l a t e s . P e t r i p l a t e s were s e a l e d w i t h p a r a f i l m and i n c u b a t e d a t 22°C under h i g h l i g h t i n t e n s i t y . A f t e r 1 week t i s s u e was t r a n s f e r r e d t o new medium and 2 weeks l a t e r t o a s i m i l a r medium w i t h o u t NAA and o n l y 0.5 g/L c a r b e n i c i l l i n . A f t e r 2 more weeks t h o s e t i s s u e s w i t h c a l l i were t r a n s f e r r e d t o new p l a t e s o f t h e same medium supplemented w i t h 0.1 mg/L GA3. A f t e r a n o t h e r 2 weeks t h e f i r s t s h o o t s c o u l d be i s o l a t e d and were t r a n s f e r r e d t o t h e SI medium c o n t a i n i n g 0.1 g/L c a r b e n i c i l l i n . As w i t h o t h e r t r a n s f o r m a t i o n s , two s h o o t s were never t a k e n from t h e same c a l l u s t o a v o i d d u p l i c a t i o n . 3.9 A n a l y s i s o f T r a n s g e n i c P l a n t s 3.9.1 S o u t h e r n A n a l y s i s S o u t h e r n h y b r i d i z a t i o n a n a l y s i s (Southern 1975) was used t o 78 c o n f i r m i n s e r t i o n o f t h e PLRV c o a t p r o t e i n gene i n t o t h e kanamycin r e s i s t a n t p l a n t s . The DNA was e x t r a c t e d from 180 mg o f h e a l t h y l e a f t i s s u e as d e s c r i b e d above (3.3.8) and h a l f was d i g e s t e d w i t h 20 u n i t s o f H i n d I I I i n a 20 ( l l volume. D i g e s t s were t e r m i n a t e d w i t h 4 | i l o f a 6X l o a d i n g b u f f e r (3.3.7) . DNA samples were l o a d e d b e s i d e H i n d I I I o r P s t I d i g e s t e d lambda DNA and s e p a r a t e d by e l e c t r o p h o r e s i s a t 1 v o l t / c m o v e r n i g h t . DNA on t h e g e l s was s t a i n e d w i t h 0.5 fig/ml e t h i d i u m bromide and t h e g e l photographed b e s i d e a r u l e r . N u c l e i c a c i d d e n a t u r a t i o n was a c c o m p l i s h e d by s o a k i n g t h e g e l w i t h a g i t a t i o n i n 1.5 M NaCl and 0.5 M NaOH f o r two p e r i o d s o f 15 min each. T h i s was f o l l o w e d by n e u t r a l i z a t i o n i n two changes o f 1.5 M NaCl and 1 M T r i s - C l , pH 7.4, f o r 15 min each. C a p i l l a r y t r a n s f e r o f t h e DNA t o 10X SSC soaked N y t r a n was a c c o m p l i s h e d by p l a c i n g t h r e e 3MM f i l t e r s c u t - t o - s i z e soaked i n 10X SSC on Saran Wrap. The g e l was p l a c e d on t o p u p s i d e down, t h e n t h e N y t r a n , t h r e e 3MM f i l t e r s soaked w i t h 10X SSC, and 1 i n c h o f c u t - t o - s i z e paper t o w e l s . As w i t h t h e n o r t h e r n b l o t s t h e e n t i r e sandwich was wrapped w i t h Saran Wrap, no d i r e c t c o n t a c t o c c u r r e d between t h e t o p and bottom f i l t e r s , and a l i g h t w eight was p l a c e d on t o p . A f t e r an o v e r n i g h t t r a n s f e r , t h e membrane was l a b e l l e d w i t h p e n c i l , baked, p r e h y b r i d i z e d (3.3.2), and p r o b e d as d e s c r i b e d above (3.3.10). Southern b l o t s were s c r e e n e d w i t h r a d i o l a b e l l e d DNA fragments s p e c i f i c t o t h e PLRV A l u I r e s t r i c t i o n fragment w h i c h c o n t a i n s t h e PLRV c o a t p r o t e i n gene. Washes and a u t o r a d i o g r a p h y were t h e same as b e f o r e ( 3 . 3 . 4 ) . 79 3.9.2 I s o l a t i o n o f P o l y (A +) RNA Northern hybridization analysis of transgenic plants was done using poly (A+) RNA. Poly (A+) RNA was i s o l a t e d using oligo (dT) c e l l u l o s e (Boehringer Mannheim, Dorval, Que.) column chromatography as described by Aviv and Leder (1972) with minor modifications. Poly (A+) RNA was i s o l a t e d from t o t a l combined RNA from 4 i n d i v i d u a l 1 g samples resuspended i n 400 u.1 DEPC treated water. Columns were prepared using an autoclaved Bio-Rad (Richmond, CA) Poly-Prep 10 ml column to which was added 50 mg of oligo (dT) c e l l u l o s e suspended i n 1 ml of loading buffer B (20 mM T r i s - C l , pH 7.4, 0.1 M NaCl, 1 mM EDTA, and 0.1% (w/v) SDS). The column was washed with 3 volumes of 0.1 M NaOH containing 5 mM EDTA and then DEPC treated water u n t i l the pH of e f f l u e n t was less than 8 as determined with pH paper. The column was then washed with 5 volumes of loading buffer A (40 mM T r i s - C l , pH 7.4, 1 M NaCl, 1 mM EDTA, containing 0.1% (w/v) SDS). RNA samples were heated to 65°C for 5 min at which time 400 u\l of loading buffer A prewarmed to 65°C was added. The sample was mixed and allowed to cool at room temperature for 2 min before application to the column. Eluate was collected, heated to 65°C for 5 min, cooled to room temperature for 2 min, and reapplied to the column. This was followed by a 5 volume washing with loading buffer A followed by a 4 volume wash with loading buffer B. Poly (A+) RNA was eluted with 3 volumes of 10 mM T r i s -C l , pH 7.4, containing 1 mM EDTA and 0.05% (w/v) SDS. Fractions were c o l l e c t e d and those containing RNA were i d e n t i f i e d by 80 s p o t t i n g an a l i q u o t onto a p e t r i d i s h c o n t a i n i n g 1% (w/v) agarose i n TAE and 0.5 U\g/ml e t h i d i u m bromide. P o l y (A +) RNA was p r e c i p i t a t e d , resuspended i n 10 and a 1 | i l a l i q u o t q u a n t i t a t e d w i t h a s p e c t r o p h o t o m e t e r . A p p r o x i m a t e l y 0.9 (lg o f p o l y (A +) RNA was l o a d e d p e r l a n e on an agarose g e l c o n t a i n i n g m e t h y l m e r c u r i c h y d r o x i d e s e p a r a t e d by e l e c t r o p h o r e s i s and b l o t t e d as d e s c r i b e d e a r l i e r ( 3 . 3 . 9 ) . T r a n s f e r was c o m p l e t e d o v e r n i g h t , t h e membrane was l a b e l l e d w i t h p e n c i l , baked, p r e h y b r i d i z e d , and p r o bed as d e s c r i b e d above (3.3.10). N o r t h e r n b l o t s were s c r e e n e d w i t h r a d i o l a b e l l e d DNA fragments s p e c i f i c t o t h e PLRV A l u I r e s t r i c t i o n fragment which c o n t a i n s t h e PLRV c o a t p r o t e i n gene. 3.9.3 Transgenic Plant Protein Analysis 3.9.3.1 Extraction of Plant Protein T o t a l p h e n o l - s o l u b l e p r o t e i n was e x t r a c t e d from p l a n t t i s s u e f o l l o w i n g t h e p r o t o c o l o f Van E t t e n e t al. (1979) . L e a f t i s s u e was weighed and 1 g f r o z e n w i t h l i q u i d n i t r o g e n and ground w i t h a m o r t a r and p e s t l e . Samples were f u r t h e r homogenized i n 9 ml o f i c e c h i l l e d e x t r a c t i o n b u f f e r c o n s i s t i n g o f an e q u a l volume o f b u f f e r (80 mM T r i s , 1 mM DTT, 10 mM EDTA, 0.2 9 mM p h e n y l m e t h y l -s u l f o n y l f l u o r i d e , and 2% (w/v) SDS, pH 6.8) and 80% p h e n o l c o n t a i n i n g 0.1 M ammonium a c e t a t e and 10 mM DTT. A f t e r t h o r o u g h h o m o g e n i z a t i o n t h e samples were f i l t e r e d t h r o u g h 4 l a y e r s o f cheese c l o t h and c e n t r i f u g e d a t 10,000 rpm i n a SS34 r o t o r a t 4°C f o r 10 min. The aqueous f r a c t i o n was d i s c a r d e d and t h e p h e n o l f r a c t i o n was e x t r a c t e d 3 t i m e s w i t h an e q u a l volume of 30 mM T r i s 81 c o n t a i n i n g 1 mM DTT, 10 mM EDTA, and 100 mM ammonium a c e t a t e , pH 6.8. P r o t e i n was p r e c i p i t a t e d w i t h 5 volumes o f -20°C methanol c o n t a i n i n g 0.1 M ammonium a c e t a t e f o r 2 h a t -20°C and p e l l e t e d w i t h c e n t r i f u g a t i o n a t 9000 rpm w i t h a SS34 r o t o r f o r 5 min a t 4°C. P r o t e i n p r e c i p i t a t e s were washed t w i c e w i t h t h e p r e c i p i t a t i n g medium and once w i t h a c e t o n e . 3 . 9 . 3 . 2 E l e c t r o p h o r e s i s o f P r o t e i n D u r i n g t h e acetone wash, a 1/15 a l i q u o t was spun down, d r i e d w i t h n i t r o g e n , and d i s s o l v e d i n 200 ( l l o f 0.1 M NaOH b e f o r e i n c u b a t i n g 30 min a t 60°C. P r o t e i n was a s s a y e d by t h e method o f B r a d f o r d (1976) u s i n g t h e Bio - R a d p r o t e i n a s s a y . The r e m a i n i n g acetone p r e c i p i t a t e was d r i e d w i t h n i t r o g e n and resuspended a t a c o n c e n t r a t i o n o f 15 p.g/(ll p r o t e i n i n 0.5 M T r i s - C l , pH 6.8, 10% (v/v) 2 - m e r c a p t o e t h a n o l , 4% (w/v) SDS, 20% (v/v) g l y c e r o l , and 0.01% (w/v) bromophenol b l u e . Samples were p l a c e d i n b o i l i n g w a ter f o r 5 min and 150 (ig / l a n e l o a d e d onto a 12.5% (w/v) SDS-p o l y a c r y l a m i d e g e l (Laemmli, 1970) w i t h a 4% (w/v) s t a c k i n g g e l u s i n g t h e Bio - R a d L a b o r a t o r i e s (Richmond, CA) M i n i - P r o t e a n I I e l e c t r o p h o r e s i s c e l l . The g e l was r u n a t 10 mA/gel u n t i l t h e t r a c k i n g dye was t h r o u g h t h e s t a c k i n g g e l and t h e n a t 20 mA/gel u n t i l t h e dye re a c h e d t h e bottom o f t h e g e l . 3 . 9 . 3 . 3 Western B l o t A n a l y s i s P o l y a c r y l a m i d e p r o t e i n g e l s were b l o t t e d w i t h 25 mM T r i s , 192 mM g l y c i n e , and 20% (v/v) methanol, a t 100 v o l t s f o r 2 h onto 82 Imraobilon-P membrane ( M i l l i p o r e , Bedford, MA) . A f t e r b l o t t i n g , the Immobilon-P membranes were b l o c k e d o v e r n i g h t at 4°C i n 10 mM T r i s - C l , pH 7.4 c o n t a i n i n g 150 mM NaCl, 0.05% (v/v) Tween 20, 1% (w/v) nonfat dry milk, 0.1% (w/v) sodium a z i d e , and 1% (w/v) BSA. PLRV monoclonal a s c i t i c f l u i d from hybridoma 371A d i l u t e d 1:5000 or PLRV p o l y c l o n a l antiserum prepared t o the m i l d s t r a i n o f PLRV d i l u t e d 1:250 i n the b l o c k i n g b u f f e r was used t o probe the western b l o t s . B l o t s were washed f o u r times with phosphate b u f f e r e d s a l i n e (PBS) (137 mM NaCl, 1.5 mM KH2P04, 8.1 mM Na2HP04-12H20, 2.7 mM KC1, and 3.1 mM sodium a z i d e , pH 7.4) c o n t a i n i n g 0.1% (v/v) Tween 20. They were then i n c u b a t e d f o r 1 h i n b l o c k i n g b u f f e r with 10 6 cpm/ml 1 2 5 I - c h l o r a m i n e T - l a b e l l e d (Hunter and Greenwood, 1962) goat anti-mouse antiserum or p r o t e i n A, r e s p e c t i v e l y , and again washed fo u r times. Autoradiograms of western b l o t s were ob t a i n e d with o v e r n i g h t exposures with i n t e n s i f y i n g screens at -70°C. 3.10 PLRV Challenge of Transgenic Potato 3.10.1 Determination of PLRV T i t r e s The accumulation of PLRV i n the t r a n s g e n i c p o t a t o p l a n t s was assayed by ELISA. M i c r o t i t r e w e l l s were coated with 1 |ig/ml IgG from PLRV p o l y c l o n a l antiserum i n 0.05 M carbonate, pH 9.6, f o l l o w e d by b l o c k i n g with 0.2% (w/v) nonfat d r i e d m i l k i n PBS with 0.05% (v/v) Tween 20. Leaf samples were homogenized 1:10 (w/v) i n PBS c o n t a i n i n g 0.2% (w/v) nonfat d r i e d milk, 0.05% (v/v) Tween 20, and 2% (w/v) p o l y v i n y l p y r r o l i d o n e . One hundred \il 83 a l i q u o t s were l o a d e d p e r w e l l o f a m i c r o t i t r e p l a t e (Immulon I p l a t e s , Flow L a b o r a t o r i e s , McLean, VA) and i n c u b a t e d o v e r n i g h t a t room t e m p e r a t u r e . P l a t e s were washed w i t h t a p water and 200 ng/ml PLRV mon o c l o n a l 371A i n PBS-Tween 20 was added and i n c u b a t e d f o r 3 h a t 37°C. M i c r o t i t r e p l a t e s were washed w i t h t a p water b e f o r e goat anti-mouse a n t i b o d i e s c o n j u g a t e d t o a l k a l i n e phosphatase (BRL) were added as p e r m a n u f a c t u r e r ' s recommendation and i n c u b a t e d f o r 1 h a t 37°C. P l a t e s were washed a g a i n w i t h t a p water and 100 | l l o f p - n i t r o p h e n y l p h o s p h a t e a t 0.5 mg/ml i n 10% (v/v) d i e t h a n o l a m i n e , pH 9.8, was added t o each w e l l . Absorbance a t 405 nm was r e c o r d e d a f t e r 1 h and o v e r n i g h t i n c u b a t i o n s a t room t e m p e r a t u r e w i t h a T i t e r t e k M u l t i s c a n 8 c h a n n e l p l a t e r e a d e r (Flow L a b o r a t o r i e s , McLean, VA). The p l a t e r e a d e r was b l a n k e d on a row t r e a t e d as d e s c r i b e d but w i t h v i r u s f r e e t i s s u e . C o n t r o l s were p l a c e d on each p l a t e and i n c l u d e d P L R V - i n f e c t e d t i s s u e , h e a l t h y u n i n o c u l a t e d t i s s u e from u n t r a n s f o r m e d p l a n t s , and l e a f sap from h e a l t h y 'Russet Burbank' c o n t a i n i n g known q u a n t i t i e s o f p u r i f i e d PLRV as d e t e r m i n e d from t h e u l t r a v i o l e t absorbance spectrum. P l a t e s were wrapped a t each s t e p w i t h Saran Wrap t o p r e v e n t d e s i c c a t i o n . 3.10.2 PLRV T i t r e s i n 'Desiree' Each t r a n s g e n i c shoot from t h e p o t a t o c u l t i v a r ' D e s i r e e ' was a s s i g n e d t h e l e t t e r D and a number. A l l v e g e t a t i v e progeny r e c e i v e d t h e same d e s i g n a t i o n . T r a n s g e n i c p l a n t s D2, D7, D8, and D12 o f t h e p o t a t o c u l t i v a r ' D e s i r e e ' a l l p o s s e s s c o n s t r u c t LCP 31 84 (Figure 8). They were v e g e t a t i v e l y propagated by stem c u t t i n g s , p l a c e d i n 15 cm pots, and grown i n a greenhouse w i t h 16/8 h day/night. P l a n t s were monitored by ELISA t o ma i n t a i n PLRV-free stock m a t e r i a l . C o n t r o l p l a n t s c o n s i s t e d of v e g e t a t i v e l y propagated 'Desiree' not transformed by Agrobacterium. P l a n t s were i n o c u l a t e d with PLRV u s i n g the aphid v e c t o r Myzus persicae which had f e d p r e v i o u s l y on PLRV-infected Physalis pubescens. V e g e t a t i v e l y propagated D2, D7, D8, D12, and untransformed 'Des i r e e ' were i n o c u l a t e d with PLRV by p l a c i n g f i v e v i r u l i f e r o u s aphids on v a r i o u s l e a v e s of p l a n t s approximately 10 cm i n he i g h t f o r 5 days. P l a n t s were i n s p e c t e d d u r i n g the i n o c u l a t i o n p e r i o d to i n s u r e t h a t the aphids were f e e d i n g . I n i t i a l l y 18 v i r u s - f r e e v e g e t a t i v e c u t t i n g s from each of D2, D 7 , D8, and a c o n t r o l were i n o c u l a t e d with PLRV. Leaf samples of 2 or 3 i n d i v i d u a l leaves approximately 1 cm2 from d i f f e r e n t l o c a t i o n s of each p l a n t were c o l l e c t e d and t e s t e d by ELISA at 10 day i n t e r v a l s over a 50 day p e r i o d . The experiment was then repeated u s i n g 18 v e g e t a t i v e c u t t i n g s from D2, D8, D12, and a c o n t r o l . Leaf samples were c o l l e c t e d and t e s t e d by ELISA biweekly over a 72 day p e r i o d f o l l o w i n g the c h a l l e n g e i n o c u l a t i o n s . R e l a t i v e average absorbance valu e s i n ELISA were determined f o r each of the t r a n s g e n i c 'Desiree' l i n e s . 3.10.3 E f f e c t o f Inoculum L e v e l s To e s t a b l i s h the e f f e c t of the inoculum l e v e l , each of 8 v e g e t a t i v e l y propagated c u t t i n g s from t r a n s g e n i c ' D e s i r e e ' D12 85 and u n t r a n s f o r m e d ' D e s i r e e ' were i n o c u l a t e d u s i n g e i t h e r 1, 5, or 25 v i r u l i f e r o u s M. persicae. L e a f samples were c o l l e c t e d and t h e t i t r e o f PLRV q u a n t i t a t e d b i w e e k l y by ELISA over a 78 day p e r i o d . 3.10 .4 PLRV T i t r e s i n 'Russet Burbank' Each t r a n s g e n i c shoot from t h e p o t a t o c u l t i v a r 'Russet Burbank' was a s s i g n e d t h e l e t t e r s RB, a number, and sometimes a l e t t e r i f two s h o o t s were from t h e same l e a f o r i n t e r n o d a l stem segment. A l l v e g e t a t i v e progeny r e c e i v e d t h e same d e s i g n a t i o n . T r a n s g e n i c 'Russet Burbank' ( F i g u r e 8) l i n e s RB7A and RB7B which p o s s e s s t h e LCP 31 c o n s t r u c t , l i n e s RBI and RB25 wh i c h c o n t a i n t h e LCP 107 c o n s t r u c t , and l i n e s RB12B and RB16B which p o s s e s s t h e LCP 1718 c o n s t r u c t were grown i n t h e greenhouse and v e g e t a t i v e l y p r o p a g a t e d . T h i r t y v e g e t a t i v e l y p r o p a g a t e d p l a n t s from each o f t h e s e s i x t r a n s g e n i c l i n e s o f 'Russet Burbank' and t h e u n t r a n s f o r m e d 'Russet Burbank' c o n t r o l were i n o c u l a t e d when a p p r o x i m a t e l y 10 cm i n h e i g h t by p l a c i n g 50 M. persicae t h a t had p r e v i o u s l y f e d f o r more t h a n 1 week on P L R V - i n f e c t e d P. pubescens on each o f t h e t e s t p l a n t s . A p h i d s were a l l o w e d an i n o c u l a t i o n a c c e s s p e r i o d o f 5 days on t h e t e s t p l a n t s a f t e r w h i c h t h e p l a n t s were s p r a y e d w i t h t h e s y s t e m i c i n s e c t i c i d e P i r i m o r . L e a f samples were c o l l e c t e d i n d i v i d u a l l y from each p l a n t p r i o r t o i n o c u l a t i o n and t h e n e v e r y two weeks f o r a p e r i o d o f 56 days p o s t - i n o c u l a t i o n . I n o c u l a t e d l e a v e s were a v o i d e d by t a k i n g 2 d i s t i n c t , a p p r o x i m a t e l y 1 cm2 l e a v e s , from t i s s u e n o t p r e s e n t d u r i n g i n o c u l a t i o n . Sampled l e a v e s were u n b l e m i s h e d and from t h e 86 p r i m a r y stem e x c e p t f o r t h e l a s t s a m p l i n g when one l e a f was from a secondary s h o o t . Each ELISA p l a t e had b o t h a n e g a t i v e c o n t r o l ( h e a l t h y u n t r a n s f o r m e d 'Russet Burbank') and a p o s i t i v e c o n t r o l (a 2 f o l d d i l u t i o n s e r i e s o f q u a n t i t a t e d p u r i f i e d PLRV d i l u t e d i n h e a l t h y l e a f sap o f 'Russet B u r b a n k ' ) . From each o f t h e 30 i n d i v i d u a l e x t r a c t s o f each l i n e a 100 | l l a l i q u o t was removed, combined, and a 2 f o l d d i l u t i o n s e r i e s p r e p a r e d u s i n g t h e g r i n d i n g b u f f e r . Absorbance v a l u e s were t a k e n o f o v e r n i g h t r e a d i n g s and t h e q u a n t i t a t e d PLRV d i l u t i o n s e r i e s on each p l a t e u sed t o d e t e r m i n e v i r u s t i t r e s i n t h e t r a n s g e n i c p l a n t s w i t h t h e ELIZA program ( L e a d i n g Edge R e s e a r c h V e r s i o n 2.12 Vancouver, BC). The d i l u t i o n s e r i e s from each t r a n s g e n i c l i n e was used t o d e t e r m i n e average v i r u s t i t r e s i n each l i n e . ELISA v a l u e s f o r i n d i v i d u a l p l a n t s i n d i c a t e d t h e number o f p l a n t s t h a t showed a h i g h l e v e l o f p r o t e c t i o n . 3.11 A p h i d T r a n s m i s s i o n o f PLRV 'Russet Burbank' p l a n t s were i n o c u l a t e d u s i n g 50 v i r u l i f e r o u s a p h i d s . Two i n d i v i d u a l l e a v e s from each p l a n t were c o l l e c t e d 47 days p o s t - i n o c u l a t i o n , p l a c e d i n a p e t r i d i s h w i t h a m o i s t e n e d f i l t e r , and PLRV-free M. persicae a l l o w e d a c c e s s t o t h e l e a v e s f o r 5 days. Four a p h i d s , 2 from each l e a f , were t h e n t r a n s f e r r e d t o h e a l t h y P. pubescens s e e d l i n g s a p p r o x i m a t e l y 1 month o l d . A f t e r 5 days t h e s e s e e d l i n g s were s p r a y e d w i t h t h e i n s e c t i c i d e P i r i m o r t o k i l l t h e a p h i d s . One month l a t e r ELISA 87 was used t o d e t e r m i n e i f t h e P. pubescens were i n f e c t e d w i t h PLRV. IV. 88 RESULTS AND DISCUSSION 4.1 Host R e a c t i o n s t o PLRV I n f e c t i o n No r e l i a b l e symptoms were o b s e r v e d w i t h p r i m a r y i n f e c t i o n s o f ' D e s i r e e ' o r 'Russet Burbank' grown i n t h e greenhouse a l t h o u g h some c h l o r o s i s and l e a f c u r l i n g was o b s e r v e d i n t h e l a t t e r . T h i s l a c k o f r e l i a b l e symptoms i s t y p i c a l o f PLRV p r i m a r y i n f e c t i o n s i n greenhouse grown p o t a t o e s . I n P. pubescens, which was used as a p r o p a g a t i o n h o s t , t h e s t r a i n o f PLRV used caused some s t u n t i n g and c h l o r o s i s . V i r u s y i e l d s a p p r o a c h i n g 1 mg p e r kg o f l e a f t i s s u e were o b t a i n e d w i t h t h e p u r i f i c a t i o n p r o t o c o l d e s c r i b e d ( 3 . 1 . 2 ) . N u c l e i c a c i d e x t r a c t e d from p u r i f i e d v i r u s was RNase s e n s i t i v e and had a Mr o f a p p r o x i m a t e l y 2 X 10 6. 4.2 A n a l y s i s o f PLRV cDNA A f t e r l i g a t i o n o f PLRV cDNA i n t o CIP t r e a t e d l i n e a r i z e d B l u e s c r i p t M13+ p l a s m i d and t r a n s f o r m a t i o n o f competent E. c o l i DH5a c e l l s w i t h t h e cDNA c o n t a i n i n g p l a s m i d , thousands o f w h i t e recombinant a m p i c i l l i n - r e s i s t a n t c o l o n i e s were o b t a i n e d . The number o f t r a n s f o r m a n t s p e r u.g o f s t a r t i n g PLRV RNA was d e t e r m i n e d t o be a p p r o x i m a t e l y 3.3 X 10 6. L i g a t i o n o f d i g e s t e d and CIP t r e a t e d B l u e s c r i p t (3.2.3) produced no c o l o n i e s when t r a n s f o r m e d i n t o E. c o l i DH5a. F i l t e r h y b r i d i z a t i o n s o f 800 s e l e c t e d c o l o n i e s r e s u l t e d i n a v a r i e t y o f s i g n a l i n t e n s i t i e s f o r i n d i v i d u a l recombinant c o l o n i e s . C l o n e s were s e l e c t e d f o r f u r t h e r a n a l y s i s based on t h e s i g n a l i n t e n s i t y and t h e assumption 89 t h a t i n t e n s i t y would be c o r r e l a t e d w i t h t h e s i z e o f cDNA. The 110 p l a s m i d s examined were d e s i g n a t e d w i t h t h e l e t t e r s LP and a number from 1 and 110. The two l a r g e s t c l o n e s , LP79 and LP93, were each shown by r e s t r i c t i o n a n a l y s i s t o c a r r y i n s e r t s g r e a t e r t h a n 3000 n u c l e o t i d e s i n l e n g t h . N o r t h e r n a n a l y s i s c o n f i r m e d t h e o r i g i n o f t h e s e two c l o n e s from PLRV RNA. B o t h c o n c e n t r a t i o n s o f o l i g o d e o x y r i b o n u c l e o t i d e hexamer p r i m e r s used i n t h e f i r s t - s t r a n d cDNA r e a c t i o n (3.2.1), r e s u l t e d i n cDNA c l o n e s o f s i m i l a r s i z e and number. G e l - p u r i f i e d end fragments of LP79 and LP93 were used t o s e l e c t c l o n e s LP4 and LP41 which i n c r e a s e d t h e l e n g t h o f PLRV c l o n e d ( F i g u r e 5 ) . Only one c l o n e mapped 3' t o t h e LP41 P s t I r e s t r i c t i o n s i t e whereas 24 c l o n e s mapped 5' t o t h e LP4 Xba I r e s t r i c t i o n s i t e . T h i s s u g g e s t e d t h a t LP41 mapped towards t h e 3' end o f t h e v i r u s genome. E x t e n s i o n o f f i r s t - s t r a n d cDNA s y n t h e s i s would be 3' t o 5' on t h e v i r a l RNA. Thus s y n t h e s i s i n i t i a t e d anywhere on t h e RNA c o u l d e x t e n d t o t h e 5' end b u t o n l y s y n t h e s i s i n i t i a t e d a t t h e 3' end would r e s u l t i n c l o n e s o f t h e 3' end. The cDNA c l o n e s shown i n F i g u r e 5 were o r i e n t a t e d r e l a t i v e t o each o t h e r based on r e s t r i c t i o n enzyme and h y b r i d i z a t i o n a n a l y s i s . These f o u r c l o n e s r e p r e s e n t e d most o f t h e 5,883 n u c l e o t i d e s o f t h i s PLRV i s o l a t e (Keese e t al., 1990). A l t h o u g h some d i f f e r e n c e s were obs e r v e d , r e s t r i c t i o n a n a l y s i s r e v e a l e d o v e r a l l s i m i l a r i t i e s w i t h t h e r e s t r i c t i o n s i t e s o f t h e PLRV i s o l a t e s d e s c r i b e d by b o t h P r i l l e t al. (1988) and Smith e t al. (1988). 90 5' PLRV RNA 3' £ ,0 » 0 =S - - t> # is £ CL co i D: — Q; Oa X ii! O. o? 3: * 5 g o g e§ £ c§ 3 23 kDa ORF LP41 LP79 LP93 LP4 1000 nt F i g u r e 5 . R e s t r i c t i o n map o f t h e PLRV genome. T h i s was d e r i v e d from t h e a n a l y s i s o f o v e r l a p p i n g cDNA c l o n e s t h a t a r e i n d i c a t e d below t h e map. The LP c l o n e s were d e r i v e d from randomly p r i m e d cDNA s y n t h e s i s . The r e g i o n o f t h e c l o n e LP7 9 c o r r e s p o n d i n g t o t h e 23 kDa ORF i s r e p r e s e n t e d by an open r e c t a n g l e . 4 .3 PLRV Sequence A n a l y s i s None o f t h e cDNA c l o n e s e x p r e s s e d PLRV c o a t p r o t e i n as a f u s i o n p r o t e i n . Sequence d a t a o b t a i n e d w h i l e s e q u e n c i n g PLRV cDNA i n d i c a t e d t h a t t h e B l u e s c r i p t p l a s m i d M13+ was m i s s i n g a c y t o s i n e r e s i d u e t h a t caused a f r a m e s h i f t . T h i s f r a m e s h i f t i n t h e v i r u s RNA r e s u l t e d i n a UAA s t o p codon o c c u r r i n g between t h e AUG s t a r t codon o f t h e amino t e r m i n u s o f t h e ( 3-galactosidase p r o t e i n and t h e p o l y l i n k e r c o n t a i n i n g t h e cDNA. S t r a t a g e n e (San Diego, CA) l a t e r c o n f i r m e d i n a b u l l e t i n t h a t t h i s p a r t i c u l a r 91 b a t c h o f B l u e s c r i p t p l a s m i d was l a c k i n g a c y t o s i n e r e s u l t i n g i n a s p u r i o u s s t o p codon which would i n h i b i t e x p r e s s i o n o f a f u s i o n p r o t e i n . B a r b a r a e t al. (1987) r e p o r t e d t h a t f u s i o n p r o t e i n s e x p r e s s e d from cDNA r e s t r i c t i o n fragments i n d i c a t e d t h a t t h e BYDV-MAV c o a t p r o t e i n gene mapped a t a d i s t a n c e o f 65 t o 80% o f t h e genome l e n g t h from t h e 5' end. More r e c e n t l y M i l l e r e t al. (1988a) r e p o r t e d t h a t e x p r e s s i o n o f BYDV-PAV cDNAs as f u s i o n p r o t e i n s i n d i c a t e d t h a t t h e coa t p r o t e i n gene mapped a t a d i s t a n c e o f 50 t o 60% o f t h e genome l e n g t h from t h e 5' end o f t h e v i r a l RNA. Amino a c i d and n u c l e o t i d e sequences c o n f i r m e d t h a t t h e ORF i n t h i s r e g i o n encodes t h e BYDV-PAV c o a t p r o t e i n ( M i l l e r e t al., 1988a). I f t h e PLRV c o a t p r o t e i n were s i m i l a r l y l o c a t e d , t h e c l o n e LP79 s h o u l d c o n t a i n t h e coa t p r o t e i n c o d i n g r e g i o n o f PLRV. T h i s c l o n e c o v e r e d a l a r g e p r o p o r t i o n o f t h e i n t e r n a l r e g i o n o f t h e PLRV genome and t h e r e f o r e was t h e f i r s t t o be s u b c l o n e d and sequenced u s i n g t h e s t r a t e g y shown i n F i g u r e 6. The n u c l e o t i d e sequence o f LP79 ( F i g u r e 7) r e v e a l e d an ORF, 627 n u c l e o t i d e s i n l e n g t h , as shown i n F i g u r e 8 (Kawchuk e t al., 1989). The deduced amino a c i d sequence o f t h i s ORF ( F i g u r e 8) shows 47.1% homology w i t h t h e amino a c i d sequence o f t h e c o a t p r o t e i n o f BYDV-PAV ( M i l l e r e t al., 1988b). Comparisons w i t h subsequent sequences o f t h e S c o t t i s h (Mayo e t a l . , 1989), N e t h e r l a n d s (Van der W i l k e t a l . , 1989), and A u s t r a l i a n (Keese e t a l . , 1990) i s o l a t e s o f PLRV coa t p r o t e i n s r e v e a l e d amino a c i d sequence d i f f e r e n c e s o f 1.9%, 2.4%, and 1.4%, r e s p e c t i v e l y . 92 £ LP79 £ | Coat Protein | 5' 300 nt ^ 5' • • • 3' F i g u r e 6. Sequencing s t r a t e g y used t o de t e r m i n e t h e c o a t p r o t e i n c o d i n g r e g i o n o f PLRV. Arrows i n d i c a t e t h e d i r e c t i o n and l e n g t h o f sequence from u n i d i r e c t i o n a l n e s t e d d e l e t i o n s o f c l o n e L P 7 9 . The r e g i o n c o r r e s p o n d i n g t o t h e coa t p r o t e i n ORF i s r e p r e s e n t e d by an open r e c t a n g l e . The p r e d i c t e d Mr o f t h e PLRV 23 kDa ORF p r o t e i n (208 amino a c i d s ) i s 23,202 which i s s i m i l a r t o t h e 26,300 e s t i m a t e d p r e v i o u s l y by e l e c t r o p h o r e s i s on p o l y a c r y l a m i d e g e l s (Rowhani and S t a c e - S m i t h , 1979). The above s i m i l a r i t i e s i n p o s i t i o n , s i z e , and sequence s t r o n g l y suggest t h a t t h e 23 kDa p r o t e i n encoded by t h i s ORF i s t h e PLRV c o a t p r o t e i n . L i k e BYDV-PAV c o a t p r o t e i n t h e a m i n o - t e r m i n a l r e g i o n o f t h e PLRV 23 kDa p r o t e i n i s h i g h l y b a s i c , c o n t a i n i n g many a r g i n i n e r e s i d u e s (R i n F i g u r e 8 ) . The amino t e r m i n a l r e g i o n s o f many p l a n t v i r u s c a p s i d p r o t e i n s have been found t o be h i g h l y b a s i c and i t has been s u g g e s t e d t h a t t h e y 93 1 5 ' C G C A G A G A A A A C T G C T C A A A C A A A C T C A G C A G A G A A G A C T G C T C C A T C A A C T T C A G C A G A G A A A A C T G C T C C A A C A A A C A A G C C T T T A A A 91 T G G G C A A G C G G C A C C G T C C G C C A A A A C A A A C G G C A A C T C C G A C A T C C C C G A C G C C G C T A C A A G C G C A C C A C C A A T G A A C A A A A T G G T C G A 181 ACAGATCATCACAGCTATGGTGGGGAGAATCAATCTCTCGGAGATAGAGGAGAAGATAGAGTGCAGGGTGTCTCAGAAAGCCCTGCAGAA 271 GCCCAAACAAAAGAAACGCGGAAGGCGTGGAGGGAAGAACAAGCAAAACAATTTACCTCCTACTTCGACGCAATCTATAAGTGGGGCGCC 3 61 CAAGAAGGAGGCTGCCCCCCAGGCTTCAGGAAGTGCGGGAATATCCCCGGTTACTACCACCCCCGCACCAGAGGTCAAACCAAGTGGGGG 451 C A A A A A C T C T G C C A A G T T C A T C C C G A G C T G G C G G A G A A A A C A G C A G G A T T C G G C T G G C C A A A A G C C G G A T C T G A A G C T G A G C T C C A A A G C 541 C T G A A T C T A C A G G C T G C C A G G T G G C T C C A A C G C G C G G A G T C G G C C A C T A T C C C T G G C G C A G A A G C A A G A A A A C G C G T G A T T G A G A A A A C A 631 G T G G A G A C A T A C A G A A A T T G T G T A A C T A A C G C C C C A C T G T G C T C C C T T A A A T C C A A A C T G G A T T G G G C T G G C T T T C A A C A A G G T T G A G G A 721 C C A T A A G C T T C T C C C A G T G C T C A C T C A G C T G A C C T T T G A C C G A C T A C A G A A G A T G T C G G A G G C C A G C T T T G A G G A T A T G A G C G C A G A A G A 811 G C T G G T T C A A G A A G G G C T C T G T G A T C C T A T C A G A C T A T T T G T C A A A G G A G A G C C C C A C A A A C A G A G C A A A C T C G A T G A A G G C C G C T A C C T 901 C C T C A T C A T G T C T G T T T C C T T G G T G G A T C A A C T G G T A G C C C G G G T T C T G T T C C A A A A T C A G A A C A A A A G G G A A A T T T C C C T G T G G A G G T C 991 T G T G C C T T C C A A A C C C G G T T T T G G C C T T T C A A C T G A C A C T C A A A C T G C T G A A T T C T T G G A G T G T C T T C A A A A G G T G T A T G G A G C G C C A T C 1081 T G T G G A A G A A T T G T G T G C A A A T C A C A A G G A G T A C A C G C G C T C A A C C G A C T G T T C C G G T T T C G A C T G G T C A G T C G C G T A T T G G A T G C T G G A 1171 G G A T G A T A T G G A G G T G A G A A A T C G C C T G A C A T T T A A T A A C A C C C A G C T C A C C A A G C G T C T T C G G G C T G C C T G G T T G A A G T G C A T A G G A A A 12 61 C T C C G T C T T A T G C C T G T C C G A T G G C A C T T T A C T T G C C C A A A C T G T T C C C G G T G T G C A A A A G A G C G G A A G T T A C A A T A C A A G T T C C T C C A A 1351 C T C T A G A A T C C G G G T T A T G G C T G C C T A T C A C T G T G G C G C C G A C T G G G C A A T G G C C A T G G G G G A C G A T G C C C T C G A A G C C C C C A A C T C C G A 1441 C C T G G A G G A G T A T A A A A C A C T A G G T T T C A A A G T C G A G G r A G G T C G A G A A C T C G A A T T C T G T T C A C A C A T C T T C A G A A A T C C G A C C C T C G C 1531 C G T T C C G G T C A A T A C C A A C A A A A T G C T T T A C A A G T T G A T C C A T G G T T A T A A T C C G G A A T G T G G C A A T C C A G A A G T G A T T C A A A A C T A T C T 1621 G G C T G C A G T A T T C T C T G T G C T G C A G G A G C T C A G A C A C G A T C G T G A G C T C G T T G C C A A G C T C C A C C A G T G G T T G G T T C C G A G T G C C A C C A C 1711 A A A A G A A C A C T G A A G G A G C T C A C T A A A A C T A G C C A A G C A T A A G C G A G T T G C A A G C A T T G G A A G T T C A A G C C T C G T T A C A T C A A C C G G A C A 1801 A A A T A G A T T A T A A A T T C T T A G C G G G A T T C G C T T T A G G A T T T T C A T C C G C A A T C C C A T T T T C A G T A G C C G G T T T A T A T T T T G T T T A C C T A A 18 91 A G A r r r C C r C C C A C G r G C G A r C A A r r G r r A A r G A G r A C G G T C G T G G r r A A A G G A A A r G r C A A r G G T G G r G r A C A A C A A C C A A G A A G G C G A 1981 A G A A G G C A A T C C C T T C G C A G G C G C G C T A A C A G A G T T C A G C C A G T G G T T A T G G T C A C G G C C C C T G G G C A A C C C A G G C G C C G A A G A C G C A G A 2071 A G A G G A G G C A A T C G C C G C T C A A G A A G A A C T G G A G T T C C C C G A G G A C G A G G C T C A A G C G A G A C A T T C G T G T T T A C A A A G G A C A A C C T C G T G 2161 G G C A A C T C C C A A G G A A G T T T C A C C T T C G G G C C G A G T C T A T C A G A C T G T C C G G C A T T C A A G G A T G G A A T A C T C A A G G C C T A C C A T G A G T A T 2251 A A G A T C A C A A G C A T C T T A C T T C A G T T C G T C A G C G A G G C C T C T T C C A C C T C C T C C G G T T C C A T C G C T T A T G A G T T G G A C C C C C A T T G C A A A 2341 G T A T C A T C C C T C C A G T C C T A C G T C A A C A A G T T C C A A A T T A C G A A G G G C G G C G C C A A A A C T T A T C A A G C G C G G A T G A T A A A C G G G G T A G A A 2431 T G G C A C G A T T C T T C T G A G G A T C A G T G C C G G A T A C T G T G G A A G G G A A A T G G A A A A T C T T C A G A T C C C G C A G G A T C C T T C A G A G T C A C C A T C 2521 A G G G T G G C T T T G C A A A A C C C C A A A T A G G T A G A C T C C G G A T C A G A G C C T G G T C C A A G C C C A C A A C C A A C A C C C A C T C C A A C T C C C C A G A A G 2611 C A C G A G A G A T T T A T T G C T T A C G T T G G C A T A C C T A T G C T A A C C A T T C A A G C T A G G G A G A A C G A C G A C C A A A T C A T A T T G G G T T C C T T A G G G 2701 A G C C A A A G G A T G A A A T A T A T A G A G G A C G A G A A C C A G A A C T A T A C A A A T A T T A G T T C T G A G T A T T A C T C T C A A T C G A G T A T G C A A G C C G T C 27 91 C C T A T G T A T T A T T T C A A T G T C C C G A A A G G G C A A T G G T C A G T C G A T A T C A G C T G C G A A G G G T A T C A A C C C A C T A G C A G C A C C T C G G A T C C A 2881 C A C C G G G G T A G G A G T G A C G G G A T G A T C G C G T A T T C A A A C G C G G A T T C C G A T T A C T G G A A T G T T G G T G A A G C G G A T G G T G T C A A A A T T T C G 2971 A A G C T A C G C A A C G A T A A C A C C T A C C G C C A A G G T C A C C C A G A A C T T G A A A T T A A C T C G T G T C A T T T T C G C G A G G G C C A A C T C C T T C A A C G G 30 61 G A C G C T A C A A T T A G C T T C C A C G T T G A A G C G C C T A C T G A T G G G C G A T T C T T T C T C G T T G G T C C C G C T A T C C A G A A A A C C G C A A A G T A T A A C 3151 T A T A C T A T C T C A T A C G G T G A C T G G A C G G A C C G A G A C A T G G A G C T G G G G C T G A T C A C T G T G G T G C T T G A T G A A C A T T T A G A A G G C A C T G G T 3241 T C G G C T A A C A G A G T G C G G C G G C C C C C A C G G G A G G G C C A C A T C T A T A T G G C G T C 3 ' F i g u r e 7 . N u c l e o t i d e sequence o f c l o n e L P 7 9 . T h i s DNA sequence was d e t e r m i n e d from d o u b l e - s t r a n d e d d i d e o x y r i b o n u c l e o t i d e s e q u e n c i n g . B o t h s t r a n d s were sequenced i n t h e r e g i o n o f t h e PLRV c o a t p r o t e i n gene. The b e g i n n i n g and end o f t h e c o a t p r o t e i n gene i s i n d i c a t e d by t h e b o l d s t a r t (ATG) and s t o p (TAG) codons. may be i n v o l v e d i n p r o t e i n - R N A i n t e r a c t i o n s ( H a r r i s o n , 1983) . Comparison o f t h e PLRV 23 kDa p r o t e i n ORF n u c l e o t i d e sequence w i t h t h a t o f t h e BYDV-PAV c o a t p r o t e i n ORF gave 58.0% s i m i l a r i t y . T h i s r e f l e c t s t h e amino a c i d s i m i l a r i t y and s u g g e s t s a c l o s e e v o l u t i o n a r y r e l a t i o n s h i p between t h e s e two v i r u s e s . The 23 kDa ORF i n t h e cDNA o f PLRV RNA t e r m i n a t e s w i t h an amber (TAG) codon ( F i g u r e 8) which i s i m m e d i a t e l y f o l l o w e d by a l o n g i n - f r a m e ORF. A s i m i l a r f i n d i n g was o b s e r v e d by M i l l e r e t 94 * M S T V V V K G N V N G G V * M S M V V Y TAAAGATTTCCTCCCACGTGCGATCAATTGTTAATGAGTACGGTCGTGGTTAAAGGAAATGTCAATGGTGGTGTA 10 20 30 40 50 60 70 Q Q P R R R R R Q S L R R R A N R V Q P V V M V T N N Q E G E E G N P F A G A L T E F S Q W L W S R CAACAACCAAGAAGGCGAAGAAGGCAATCCCTTCGCAGGCGCGCTAACAGAGTTCAGCCAGTGGTTATGGTCACG 85 95 105 115 125 135 145 A P G Q P R R R R R R R G G N R R S R R T G V P R P L G N P G A E D A E E E A I A A Q E E L E F P E GCCCCTGGGCAACCCAGGCGCCGAAGACGCAGAAGAGGAGGCAATCGCCGCTCAAGAAGAACTGGAGTTCCCCGA 160 170 180 190 200 210 220 G R G S S E T F V F T K D N L V G N S Q G S F T F D E A Q A R H S C L Q R T T S W A T P K E V S P S GGACGAGGCTCAAGCGAGACATTCGTGTTTACAAAGGACAACCTCGTGGGCAACTCCCAAGGAAGTTTCACCTTC 235 245 255 265 275 285 295 G P S L S D C P A F K D G I L K A Y H E Y K I T S G R V Y Q T V R H S R M E Y S R P T M S I R S Q A GGGCCGAGTCTATCAGACTGTCCGGCATTCAAGGATGGAATACTCAAGGCCTACCATGAGTATAAGATCACAAGC 310 320 330 340 350 360 370 I L L Q F V S E A S S T S S G S I A Y E L D P H C S Y F S S S A R P L P P P P V P S L M S W T P I A ATCTTACTTCAGTTCGTCAGCGAGGCCTCTTCCACCTCCTCCGGTTCCATCGCTTATGAGTTGGACCCCCATTGC 385 395 405 415 425 435 445 K V S S L Q S Y V N K F Q I T K G G A K T Y Q A R K Y H P S S P T S T S S K L R R A A P K L I K R G AAAGTATCATCCCTCCAGTCCTACGTCAACAAGTTCCAAATTACGAAGGGCGGCGCCAAAACTTATCAAGCGCGG 460 470 480 490 500 510 520 M I N G V E W H D S S E D Q C R I L W K G N G K S * ATGATAAACGGGGTAGAATGGCACGATTCTTCTGAGGATCAGTGCCGGATACTGTGGAAGGGAAATGGAAAATCT 535 545 555 565 575 585 595 S D P A G S F R V T I R V A L Q N P K * V D S G S TCAGATCCCGCAGGATCCTTCAGAGTCACCATCAGGGTGGCTTTGCAAAACCCCAAATAGGTAGACTCCGGATCA 610 620 630 640 650 660 670 E P G P S P GAGCCTGGTCCAAGCCCA 685 695 F i g u r e 8. N u c l e o t i d e sequence (cDNA) and p r e d i c t e d amino a c i d sequence o f t h e PLRV 23 kDa and 17 kDa ORFs. The amino a c i d sequence o f t h e 23 kDa ORF i s shown above t h a t o f t h e 17 kDa ORF. Each amino a c i d d e s i g n a t i o n o c c u r s over t h e f i r s t n u c l e o t i d e o f i t s codon. The s t a r t codons used f o r t h e 23 kDa and 17 kDa ORFs are t h e f i r s t ATG codons f o l l o w i n g a s t o p codon (*) i n t h e same frame. al. (1988a) f o r BYDV-PAV and i t was s u g g e s t e d by t h e s e a u t h o r s t h a t a r e a d t h r o u g h o f t h e amber codon may o c c u r . In b o t h cases s e v e r a l p r o l i n e r e s i d u e s (P) o c c u r i n t h e r e g i o n i m m e d i a t e l y f o l l o w i n g t h e amber codon; f o r PLRV, 7 out o f 13 amino a c i d s i n 95 t h i s r e g i o n a r e p r o l i n e . T h i s p o t e n t i a l r e a d t h r o u g h was s u b s e q u e n t l y o b s e r v e d i n t h e o t h e r l u t e o v i r u s e s sequenced and was shown t o be e x p r e s s e d i n BYDV-PAV (Waterhouse e t al., 1989). A l t h o u g h t h e s i m i l a r i t y o f t h e p r e d i c t e d amino a c i d sequences o f t h e PLRV 23 kDa p r o t e i n ORF and BYDV-PAV p r o t e i n s was h i g h (47.1%), when t h e two i n t a c t v i r u s e s were used as immunogens and a n t i g e n t h e r e was a l a c k o f s e r o l o g i c a l c r o s s -r e a c t i v i t y . However, e x t e n s i v e c r o s s - r e a c t i v i t y was o b s e r v e d when d e n a t u r e d v i r u s was used as a n t i g e n ( M a r t i n and D'Arcy, 1990). T h i s s u g g e s t s t h a t t h e most v a r i a b l e r e g i o n s o f t h e l u t e o v i r u s c a p s i d a r e exposed i n i n t a c t v i r i o n s . W i t h i n t h e c o a t p r o t e i n c o d i n g r e g i o n , b u t i n a d i f f e r e n t frame, l i e s a n o t h e r ORF o f 468 n u c l e o t i d e s t h a t may code f o r 156 amino a c i d s ( F i g u r e 8 ) . T r a n s l a t i o n o f t h i s ORF would y i e l d a p r o t e i n o f Mr 17,381. BYDV-PAV ( M i l l e r e t al., 1988a), SDV ( M i l l e r e t al., 1988a) and BWYV ( V e i d t e t al., 1988) each c o n t a i n a 17 kDa p r o t e i n ORF w i t h i n t h e r e g i o n e n c o d i n g t h e c o a t p r o t e i n . The f i n d i n g t h a t a 17 kDa ORF o c c u r s w i t h i n t h e p u t a t i v e c o a t p r o t e i n gene o f each l u t e o v i r u s s u g g e s t s t h a t i t encodes a f u n c t i o n a l gene p r o d u c t . The 17 kDa ORF has a c e n t r a l l y l o c a t e d r e g i o n i n which 6 out o f 8 amino a c i d s a r e p r o l i n e . T h i s p r o l i n e - r i c h r e g i o n may be p a r t o f a p r o t e i n c o n f o r m a t i o n a l f o l d t h a t c o u l d produce two d i s t i n c t domains. M i l l e r e t al. (1988a) s u g g e s t e d t h a t t h e BYDV-PAV 17 kDa p r o t e i n i s t h e VPg because i t i s s i m i l a r i n s i z e t o t h e i s o l a t e d VPg o f t h e RPV s t r a i n o f BYDV (Murphy e t al., 1 9 8 9 ) . The PLRV 96 VPg i s o l a t e d by Mayo e t al. (1982) has been e s t i m a t e d as 7 kDa. There i s l e s s homology (31.1%) between t h e 17 kDa p r o t e i n s o f PLRV and BYDV t h a n t h e r e i s between t h e c o a t p r o t e i n s . Thus, i f a f u n c t i o n a l p r o t e i n i s encoded by t h e 17 kDa ORF, i t may be r e s p o n s i b l e f o r some s h a r e d but d i s t i n c t p r o p e r t i e s o f each v i r u s . Other examples o f p l a n t RNA v i r u s e s w hich i n d i c a t e e x t e n s i v e use o f o v e r l a p p i n g ORFs a r e s o u t h e r n bean mosaic (Wu e t al., 1987), c a r n a t i o n m o t t l e v i r u s ( G u i l l e y e t a l . , 1985), and cucumber n e c r o s i s v i r u s (Rochon and Tremaine, 1989) . 4.4 E f f i c i e n c y of the Triparental Mating Procedure Coat p r o t e i n cDNAs from PLRV were i n s e r t e d i n t o t h e i n t e r m e d i a t e v e c t o r , pCDXl ( F i g u r e 3 ) , a t p o l y l i n k e r r e s t r i c t i o n s i t e s l o c a t e d between a d u p l i c a t e d CaMV 35S promoter (Kay e t al., 1987) and a NOS p o l y a d e n y l a t i o n s i g n a l . The l i g a t i o n s i t e s used and t h e c h i m a e r i c genes g e n e r a t e d are d e s i g n a t e d i n F i g u r e 9. C o n s t r u c t s LCP 31 and LCP 107 were d e s i g n e d t o produce p o s i t i v e -sense t r a n s c r i p t s w i t h a s h o r t p o l y l i n k e r from b o t h t h e pCDXl and B l u e s c r i p t M13+ v e c t o r sequence between t h e promoter and t h e ATG o f t h e c o a t p r o t e i n ORF. However, no s p u r i o u s ATGs were i n t r o d u c e d and t h e sequence would not be e x p e c t e d t o i n t e r f e r e w i t h t r a n s c r i p t i o n o r t r a n s l a t i o n . C o n s t r u c t LCP 1718 i s s i m i l a r t o LCP 107 but was i n s e r t e d i n t h e o p p o s i t e o r i e n t a t i o n t o o b t a i n n e g a t i v e - s e n s e RNA. F o l l o w i n g t r a n s f e r o f t h e genes i n t o pTiB6S3SE w i t h i n A. tumefaciens a p p r o x i m a t e l y 100 c o l o n i e s r e s i s t a n t t o 97 LCP 31 ATG TAG 35S 35S 12 PLRV COAT PROTEIN 112nt POLY A Sail 3AI A u I LCP 107 ATG TAG 35S 35S 192nt PLRV COAT PROTEIN 112nt POLY A Alu I Alu I LCP 1718 CTA CAT 35S 35S 112nt Njaioyd JLVOO Ay-y 192nt POLY A Alu I Alu I Figure 9. Diagrammatic representation of the chimaeric genes constructed to express the PLRV coat protein gene. The PLRV cDNA fragment i n LCP 31 possessed 12 nucleotides 5' to the coat protein ATG whereas LCP 107 and LCP 1718 (negative-sense) had 192 nucleotides. Each construct also had 112 nucleotides occurring beyond the amber (TAG) codon of the coat protein gene. Also shown are the duplicated CaMV 35S promoter and the NOS polyadenylation signal that provide control regions for the expression of the PLRV coat protein gene. spectinomycin, chloramphenicol, and kanamycin were obtained from each t r i p a r e n t a l mating. Each colony was capable of growth i n l i q u i d media containing the three a n t i b i o t i c s . 4.5 Plant Transformation E f f i c i e n c i e s Only 12 shoots were i s o l a t e d from independent c a l l i from 273 'Desiree' tuber disks inoculated with A. tumefaciens. A l l 12 were obtained from the 91 disks inoculated with the A. 98 tumefaciens c a r r y i n g the LCP 31 c o n s t r u c t . Many more shoots were o b t a i n e d from the tobacco t r a n s f o r m a t i o n , averaging 1 shoot per l e a f d i s k . H a l f of the 'Russet Burbank' stem and l e a f segments produced c a l l i w ith the number of shoots o b t a i n e d a v e r a g i n g approximately 50% of the number of c a l l i . With the e x c e p t i o n of the D2 and RBI p o t a t o p l a n t s , t r a n s g e n i c p o t a t o and tobacco showed no observable phenotypic response t o the i n s e r t i o n of the PLRV coat p r o t e i n gene or the presence of the t r a n s c r i p t or p r o t e i n . T r a n s g e n i c D2 showed a minor a l t e r a t i o n i n l e a f morphology. The l e a v e s were narrower than i n untransformed ' D e s i r e e ' . A l l RBI p l a n t s were m o t t l e d and s p i n d l y . Leaf morphology was v a r i a b l e with the p i n n a t e l y compound l e a f l e t s v a r i a b l y fused. Each t r a n s g e n i c p o t a t o produced v i a b l e t u b e r s and the tobacco gave f e r t i l e R l progeny by s e l f f e r t i l i z a t i o n . V e g e t a t i v e l y propagated c u t t i n g s p r o v i d e d the means of m o n i t o r i n g a l a r g e sample of p h e n o t y p i c a l l y and g e n e t i c a l l y i d e n t i c a l p otato p l a n t s . 4.6 Detection of PLRV cDNA i n Transgenic Plants D i g e s t i o n of t r a n s g e n i c p l a n t genomic DNA with Hind I I I produced fragments of approximately 1100 n u c l e o t i d e s (LCP 31) or 1300 n u c l e o t i d e s (LCP 107 and LCP 1718) . These c o n t a i n , r e s p e c t i v e l y , the 751 and 931 n u c l e o t i d e s of the i n s e r t e d PLRV DNA sequence. A l l other n u c l e o t i d e s o r i g i n a t e from the B l u e s c r i p t p l a s m i d p o l y l i n k e r and the pCDXl pla s m i d . Southern a n a l y s i s ( P l a t e 1) i n d i c a t e d d i f f e r e n t s i g n a l s t r e n g t h s and 99 suggested the occurrence of variable number of inserts i n the plants. The tobacco l i n e T18 appeared to have the highest copy number of the PLRV coat protein gene. Similar analysis was used to confirm that a l l plants examined except DI contained the appropriate DNA i n s e r t . 4 .7 Detection of PLRV Transcript in Transgenic Plants High l e v e l s of poly (A+) PLRV coat protein t r a n s c r i p t were detected i n northern blots (Plate 2) of tobacco T5 and T18, and potato D2, RBI, RB2, RB7A, RB7B, RB16B, and RB25. Comparison of the signal i n t e n s i t y of known quantities of PLRV RNA to that of the detected t r a n s c r i p t suggests that the transgenic plants contain approximately 1 to 50 ng of PLRV t r a n s c r i p t for each |ig of t o t a l polyadenylated RNA. Similar analysis of control 'Xanthi', 'Desiree' and 'Russet Burbank' showed no detectable coat protein t r a n s c r i p t . The LCP 31 t r a n s c r i p t s were approximately 1000 nucleotides i n length, which i s the expected size i f the t r a n s c r i p t s have a poly (A+) t a i l of approximately 250 nucleotides. The LCP 107 and LCP 1718 t r a n s c r i p t s from constructs with a longer 5' leader sequence were approximately 1200 nucleotides i n length, also i n d i c a t i n g a poly (A+) t a i l of approximately 250 nucleotides. Coat protein t r a n s c r i p t s appear to be most abundant i n tobacco l i n e T18 and 'Russet Burbank' l i n e RB7A. The t r a n s c r i p t s appear to be r e l a t i v e l y stable as l i t t l e degradation product was observed. 100 4.8 D e t e c t i o n o f PLRV Coat P r o t e i n i n T r a n s g e n i c P l a n t s Although 10 in d i v i d u a l tobacco l i n e s with positive-sense PLRV t r a n s c r i p t were analyzed for coat protein only l i n e T18 was c l e a r l y p o s i t i v e (Plate 3). This l i n e produced coat protein at le v e l s approaching 0.5% of t o t a l leaf protein as determined from western blots with quantitated amounts of PLRV. These plants possessed the same LCP 107 construct as several of the other tobacco l i n e s , but accumulated much higher l e v e l s of protein. Northern (Plate 2) and Southern (Plate 1) blots indicated possibly higher copy and t r a n s c r i p t l e v e l s , but these were not high enough to account for the differences i n protein l e v e l s . The extraction of phenol-soluble proteins removed plant material that i n t e r f e r e d with the resolution of proteins separated by electrophoresis. This made i t possible to load greater amounts of protein on polyacrylamide gels and to detect lower l e v e l s of protein. Among the 'Desiree' l i n e s tested, the amount of PLRV coat protein varied from zero ( i . e . undetectable amounts) to approximately 0.01% of the t o t a l protein, with D2 expressing the highest l e v e l s (Plate 4). The protein produced by the transgenic plants comigrated with PLRV coat protein subunit from p u r i f i e d v i r u s . No protein degradation was observed. Although the t r a n s l a t i o n a l readthrough product (Figure 8) was detectable by western analysis i n p u r i f i e d PLRV samples (Plate 5) there was no evidence for expression of the 112 nucleotides (33 amino acids) from ORF 5 (Figure 9) i n the transgenic plants. Coat protein subunit i n transgenic plant extracts was not 101 d e t e c t e d by ELISA. Thus, a l t h o u g h i n t a c t PLRV p a r t i c l e s was d e t e c t e d by ELISA t h e PLRV s u b u n i t e x p r e s s e d by t h e t r a n s g e n i c p l a n t s was n o t . T h i s p e r m i t t e d ELISA t o be used f o r s c r e e n i n g v i r u s l e v e l s i n P L R V - i n o c u l a t e d t r a n s g e n i c p l a n t s . S i n c e t h e l e v e l s o f c o a t p r o t e i n e x p r e s s e d i n T18 were s i m i l a r t o t h o s e f o u nd i n i n f e c t e d P. pubescens ( P l a t e 3 ) , f a i l u r e t o d e t e c t c o a t p r o t e i n s u b u n i t s i n t r a n s g e n i c p l a n t s does not appear t o be caused by low p r o t e i n l e v e l s . U n l i k e v i r u s - i n f e c t e d p l a n t s , t r a n s g e n i c p l a n t s o n l y p o s s e s s c o a t p r o t e i n s u b u n i t s o r p o s s i b l y a g g r e g a t e s . The ELISA p r o c e d u r e used was a t r i p l e a n t i b o d y sandwich, d e v e l o p e d t o d e t e c t v i r u s a n t i g e n a t low t i t r e by t r a p p i n g w i t h a p o l y c l o n a l a n t i s e r u m . W i t h an i n t a c t v i r u s p a r t i c l e t h e p o l y c l o n a l b i n d s e p i t o p e s o f some s u b u n i t s o f t h e p a r t i c l e but l e a v e s t h e e p i t o p e s o f o t h e r s u b u n i t s a v a i l a b l e t o t h e secondary m o n o c l o n a l . However, t h e e p i t o p e o f t h e s u b u n i t s r e c o g n i z e d by t h e m o n o c l o n a l may be s e q u e s t e r e d by t h e t r a p p i n g p o l y c l o n a l and would t h e r e f o r e not be a v a i l a b l e t o t h e secondary monoclonal i n t h e a s s a y used. By e x p l o i t i n g t h e a b i l i t y o f t h e ELISA t o d i s c r i m i n a t e between t h e t r a n s g e n i c p r o d u c t and t h e n a t i v e v i r u s i t was p o s s i b l e t o m o n i t o r t h e v i r u s t i t r e i n i n o c u l a t e d t r a n s g e n i c p l a n t s by ELISA. 4 . 9 PLRV Resistance L e a f e x t r a c t s from p l a n t s not i n o c u l a t e d w i t h PLRV gave ELISA absorbance r e a d i n g s between 0 and 0.02 a t 405 nm. F i v e independent and s e q u e n t i a l e x p e r i m e n t s were used t o c h a r a c t e r i z e 102 t h e r e s i s t a n c e t o PLRV, 3 w i t h t r a n s g e n i c ' D e s i r e e ' and 2 w i t h t r a n s g e n i c 'Russet Burbank'. 4.9.1 R e s i s t a n c e i n T r a n s g e n i c ' D e s i r e e ' S h o r t l y a f t e r i n o c u l a t i o n o f ' D e s i r e e ' by 5 v i r u l i f e r o u s ^ a p h i d s , PLRV l e v e l s i n b o t h u n t r a n s f o r m e d c o n t r o l and t r a n s g e n i c p l a n t s were m o n i t o r e d p e r i o d i c a l l y by ELISA ( F i g u r e 1 0 ) . A l l absorbance r e a d i n g s o c c u r r e d on t h e l i n e a r p o r t i o n o f t h e response c u r v e s and t h e r e f o r e r e p r e s e n t r e l a t i v e v i r u s t i t r e s . D u r i n g t h e i n i t i a l s t a g e s o f i n f e c t i o n v i r u s l e v e l s i n t h e u n t r a n s f o r m e d c o n t r o l and t r a n s g e n i c p l a n t s were s i m i l a r . As t h e i n f e c t i o n d e v e l o p e d t h e PLRV t i t r e s i n c o n t r o l p l a n t s i n c r e a s e d r a p i d l y a f t e r 30 days. In t h e t r a n s g e n i c s t h e t i t r e s remained a t g e n e r a l l y low l e v e l s but appears t o have i n c r e a s e d 2 t o 3 f o l d by 40 days a f t e r i n o c u l a t i o n and t h e n d e c r e a s e d t o low o r even u n d e t e c t a b l e l e v e l s . The o v e r a l l response was s i m i l a r i n a l l t h r e e t r a n s g e n i c ' D e s i r e e ' l i n e s t e s t e d . R e p e t i t i o n o f t h e experiment ( F i g u r e 11) i n d i c a t e d a r e l a t i v e l y low l e v e l o f v i r u s i n t h e t h r e e t r a n s g e n i c l i n e s and a s i m i l a r p a t t e r n o f i n c r e a s e and d e c r e a s e i n t h e v i r u s t i t r e . The average v i r u s t i t r e s i n t h e t r a n s g e n i c s were e s t i m a t e d t o be l e s s t h a n 10% o f t h o s e i n t h e u n t r a n s f o r m e d c o n t r o l s i n b o t h e x p e r i m e n t s ( F i g u r e s 10 and 11). T r a n s f o r m a t i o n o f ' D e s i r e e ' w i t h t h e LCP 31 c o n s t r u c t p r o d u c e d a l i n e d e s i g n a t e d DI t h a t d e v e l o p e d s h o o t s i n t h e p r e s e n c e o f kanamycin. However, s o u t h e r n a n a l y s i s f a i l e d t o 103 0.6 0 10 20 30 40 Days Post-inoculation Figure 1 0 . Determination of PLRV r e s i s t a n c e i n the t r a n s g e n i c 'Desiree' (Experiment 1). Average ELISA v a l u e s (absorbances at 405 nm) were determined f o r 18 p l a n t s of t r a n s g e n i c ' D e s i r e e ' l i n e s D2, D7, and D8 which c o n t a i n e d the LCP 31 c o n s t r u c t and an untransformed c o n t r o l . P l a n t s were i n o c u l a t e d with PLRV u s i n g 5 v i r u l i f e r o u s aphids. U n i n o c u l a t e d p l a n t s gave readings between 0 and 0.02 (absorbances at 405 nm). i n d i c a t e the presence of the PLRV coat p r o t e i n gene. I n o c u l a t i o n of Dl with PLRV and the m o n i t o r i n g of v i r u s t i t r e were conducted e a r l i e r f o r the other 'Desiree' l i n e s (3.10.1 and 3.10.2). V i r u s t i t r e s i n the Dl l i n e were very s i m i l a r t o those of the untransformed c o n t r o l 'Desiree' (not shown), s u g g e s t i n g t h a t t i s s u e p r o p a g a t i o n and t r a n s f o r m a t i o n with genes ot h e r than the 104 0 10 20 30 40 50 60 70 Days Post-inoculation Figure 11. Determination of PLRV resistance i n transgenic 'Desiree' (Experiment 2). Average ELISA values (absorbances at 405 nm) were determined for 18 plants of transgenic 'Desiree' l i n e s D2, D8, and D12 which contained the LCP 31 construct and an untransformed control. Plants were inoculated with 5 v i r u l i f e r o u s aphids. Uninoculated plants gave readings between 0 and 0.02 (absorbances at 405 nm). coat protein gene are not responsible for the reduced PLRV t i t r e s observed i n the transgenic plants expressing PLRV coat protein gene t r a n s c r i p t s . 4.9.2 E f f e c t of Increasing the PLRV Inoculum An increase i n the concentration of the PLRV inoculum did 105 F i g u r e 12. R e l a t i v e v i r u s a c c u m u l a t i o n i n p l a n t s a f t e r i n o c u l a t i o n w i t h PLRV u s i n g 1 (A), 5 (B), o r 25 (C) v i r u l i f e r o u s M. persicae. Each p o i n t r e p r e s e n t s t h e average ELISA (absorbances a t 405 nm) v a l u e s i n e i g h t p l a n t s . R e s u l t s a t each i n o c u l u m l e v e l a re r e p o r t e d f o r t h e t r a n s g e n i c ' D e s i r e e ' l i n e D12 and u n t r a n s f o r m e d c o n t r o l ' D e s i r e e ' . 106 not overcome t h e o b s e r v e d r e s i s t a n c e a c h i e v e d i n t h e t r a n s g e n i c ' D e s i r e e ' p l a n t s . I n o c u l a t i o n w i t h one v i r u l i f e r o u s a p h i d f a i l e d t o g i v e c o n s i s t e n t l e v e l s o f PLRV i n f e c t i o n i n t r a n s g e n i c and u n t r a n s f o r m e d c o n t r o l ' D e s i r e e ' ( F i g u r e 12A). I n o c u l a t i o n w i t h e i t h e r 5 o r 25 v i r u l i f e r o u s a p h i d s ( F i g u r e 12B and F i g u r e 12C) q u i c k l y r e s u l t e d i n h i g h e r average v i r u s t i t r e s i n u n t r a n s f o r m e d c o n t r o l p l a n t s . T r a n s g e n i c D12, however, y i e l d e d s i m i l a r low average v i r u s t i t r e s whether i n o c u l a t e d by 5 o r by 25 v i r u l i f e r o u s a p h i d s . The average l e v e l o f v i r u s i n t h e t r a n s g e n i c p l a n t s was always l e s s t h a n 10% o f t h a t i n t h e c o n t r o l s . U s i n g 5 v i r u l i f e r o u s a p h i d s f o r i n o c u l a t i o n , 5 and 4 o f t h e 18 c o n t r o l p l a n t s escaped i n f e c t i o n i n t h e f i r s t ( F i g u r e 10) and second ( F i g u r e 11) t e s t s , r e s p e c t i v e l y . I n c l u s i o n o f t h e s e escapes r e s u l t e d i n an e x t r e m e l y l a r g e s t a n d a r d d e v i a t i o n . I g n o r i n g t h e escapes t h e average and s t a n d a r d d e v i a t i o n o f t h e u n t r a n s f o r m e d c o n t r o l s on t h e l a s t s a m p l i n g d a t e was 0.99 ± 0.53 ( f i r s t t e s t , F i g u r e 10) and 0.83 ± 0.64 (second t e s t , F i g u r e 11). One p o s s i b l e e x p l a n a t i o n o f t h e s e h i g h s t a n d a r d d e v i a t i o n s i s t h a t t h e v i r u s d e v e l o p e d at d i f f e r e n t r a t e s i n d i f f e r e n t u n t r a n s f o r m e d p l a n t s . No escapes o c c u r r e d when 25 v i r u l i f e r o u s a p h i d s were used t o i n o c u l a t e each p l a n t ( F i g u r e 12C) and t r a n s g e n i c p l a n t s e x h i b i t e d s i m i l a r r e s i s t a n c e t o t h a t o b s e r v e d w i t h 5 a p h i d s p e r p l a n t ( F i g u r e 12B). The average and s t a n d a r d d e v i a t i o n f o r t h e c o n t r o l p l a n t s a t 80 days p o s t - i n o c u l a t i o n was 0.95 ± 0.43 ( F i g u r e 12C). I n f e c t e d u n t r a n s f o r m e d c o n t r o l p l a n t s 107 were re a d i l y distinguished from escapes. This was not true for the inoculated transgenic plants. While some of these were c l e a r l y infected, i n some instances the virus t i t r e was so low that i t was impossible to determine whether or not i n f e c t i o n had occurred. However, there was no evidence to suggest that the number of escapes among the inoculated transgenic plants was any higher than i n any of the corresponding controls. During the i n i t i a l stages of i n f e c t i o n , i n a l l experiments with 'Desiree' (Figures 10, 11, and 12) virus was detected i n some i n d i v i d u a l plants but not i n others, regardless of whether they were transformed or not. The number of control plants which tested p o s i t i v e for PLRV increased with time, but the number of transgenic plants which tested p o s i t i v e remained constant or decreased. T i t r e s i n the i n d i v i d u a l transgenic plants remained low with most t i t r e s being well below those i n i n d i v i d u a l control plants. As the plants matured the virus t i t r e s i n control plants increased to high levels but remained the same or decreased to low or undetectable le v e l s i n the transgenic plants over an extensive growth period of up to 80 days. 4 . 9 . 3 Resistance i n Transgenic 'Russet Burbank' Resistance was observed i n transgenic 'Russet Burbank' possessing any one of the three constructs (Figure 13). The pattern of resistance was s i m i l a r for each transgenic l i n e regardless of construct although l i n e 1-107 d i f f e r e d s l i g h t l y from the others. The f i r s t large increase i n virus t i t r e 108 F i g u r e 13. Average PLRV t i t r e s o f combined l e a f e x t r a c t s from 30 'Russet Burbank' i n o c u l a t e d by 50 v i r u l i f e r o u s a p h i d s . V i r u s t i t r e s were d e t e r m i n e d from known q u a n t i t i e s o f p u r i f i e d PLRV. L e a f e x t r a c t s from p l a n t s not i n o c u l a t e d w i t h PLRV gave background l e v e l s o f l e s s t h a n 0.3 ng PLRV p e r mg o f l e a f t i s s u e . Each t r a n s g e n i c 'Russet Burbank' l i n e c o n t a i n e d one o f t h e t h r e e c o a t p r o t e i n c o n s t r u c t s . T r a n s g e n i c l i n e s RB7A and RB7B p o s s e s s t h e LCP 31 c o n s t r u c t , RBI and RB25 c o n t a i n t h e LCP 107 c o n s t r u c t , and RB2 and RB16B have t h e LCP 1718 c o n s t r u c t . o c c u r r e d i n b o t h t h e t r a n s g e n i c l i n e s and t h e u n t r a n s f o r m e d c o n t r o l s between 14 and 28 days p o s t - i n o c u l a t i o n . However, t h e i n c r e a s e i n t h e t r a n s g e n i c s was l e s s t h a n 30 t o 40% o f t h a t i n t h e u n t r a n s f o r m e d c o n t r o l s . Between 28 and 42 days p o s t -i n o c u l a t i o n t h e i n c r e a s e o f v i r u s i n t h e u n t r a n s f o r m e d c o n t r o l 109 p l a n t s s lowed s l i g h t l y . I t i s i n t e r e s t i n g t h a t d u r i n g t h i s p e r i o d t h e r e was a d e c r e a s e of v i r u s i n each t r a n s g e n i c l i n e . The average t i t r e s i n t h e t r a n s g e n i c s l e v e l l e d o f f between 42 and 56 days p o s t - i n o c u l a t i o n w h i l e t h e v i r u s t i t r e i n t h e u n t r a n s f o r m e d c o n t r o l s c o n t i n u e d t o r i s e s h a r p l y . A t 56 days p o s t - i n o c u l a t i o n t h e average v i r u s t i t r e i n t h e most and l e a s t p r o t e c t e d t r a n s g e n i c l i n e s , RB7A and RB7B r e s p e c t i v e l y , was 1% and 8% o f t h e average l e v e l o b s e r v e d i n c o n t r o l p l a n t s . The average v i r u s t i t r e i n t h e u n t r a n s f o r m e d 'Russet Burbank' at 56 days p o s t - i n o c u l a t i o n was 772 ng PLRV p e r mg o f l e a f t i s s u e w i t h a s t a n d a r d d e v i a t i o n o f 175 ng. The p a t t e r n o f i n c r e a s e o f v i r u s t i t r e i n t h e t r a n s g e n i c l i n e 1-107, which e x h i b i t e d abnormal m o r p h o l o g i c a l c h a r a c t e r i s t i c s , appeared t o d i f f e r from t h e p a t t e r n s f o r t h e o t h e r t r a n s g e n i c s ( F i g u r e 13). In l i n e 1-107 t h e v i r u s t i t r e showed a slow s t e a d y i n c r e a s e between 14 t o 56 days t o a l e v e l s i m i l a r t o t h e l e v e l s i n t h e o t h e r t r a n s g e n i c l i n e s . T h i s p a t t e r n o f v i r u s a c c u m u l a t i o n may r e s u l t from t h e p h e n o t y p i c a b n o r m a l i t y c h a r a c t e r i s t i c o f t h i s l i n e , p a r t i c u l a r l y i f t h e phloem s t r u c t u r e o f t h e p l a n t i s a f f e c t e d . The p a t t e r n and l e v e l s o f p r o t e c t i o n o b t a i n e d were i d e n t i c a l w i t h b o t h p o s i t i v e and n e g a t i v e - s e n s e t r a n s c r i p t s and appear t o be c o r r e l a t e d w i t h t h e l e v e l o f t r a n s c r i p t ( P l a t e 2 ) . T r a n s l a t i o n o f c o a t p r o t e i n cannot o c c u r from t h e n e g a t i v e - s e n s e t r a n s c r i p t , t h e r e f o r e t h e p r o t e c t i o n c o n f e r r e d may i n v o l v e t h e t r a n s c r i p t . A l l ORFs on t h e n e g a t i v e - s e n s e t r a n s c r i p t were l e s s 110 t h a n 100 n u c l e o t i d e s i n l e n g t h and are u n l i k e l y t o be t r a n s l a t e d o r produce f u n c t i o n a l p r o t e i n . S i n c e p o s i t i v e - s e n s e t r a n s c r i p t g i v e s s i m i l a r p r o t e c t i o n and c o a t p r o t e i n c o u l d not be d e t e c t e d i n 'Russet Burbank' t h e p o s i t i v e - s e n s e t r a n s c r i p t may c o n f e r r e s i s t a n c e . I t i s p o s s i b l e t h a t , whatever t h e mechanism o f r e s i s t a n c e , i t i s t h e same f o r b o t h p o s i t i v e - and n e g a t i v e - s e n s e t r a n s c r i p t s . Thus t h e c o a t p r o t e i n may not be i n v o l v e d i n t h e e x p r e s s i o n o f r e s i s t a n c e . P r i m a r y symptoms o f PLRV i n f e c t i o n a r e l e s s s e v e r e t h a n secondary symptoms and greenhouse-propagated p l a n t s g e n e r a l l y m a n i f e s t few i f any d i s c e r n i b l e symptoms. Thus ELISA r e a d i n g s r a t h e r t h a n symptoms were used t o m o n i t o r t h e p r o g r e s s o f t h e v i r u s i n f e c t i o n (3.9.1). The v i r u s l e v e l s d e t e r m i n e d by ELISA i n d i c a t e t h e p r o b a b i l i t y t h a t t r a n s g e n i c p l a n t s may become v i r u s r e s e r v o i r s w i t h o u t e x h i b i t i n g o b s e r v a b l e symptoms. Some c h l o r o s i s and l e a f c u r l i n g were o b s e r v e d i n i n f e c t e d 'Russet Burbank' c o n t r o l s and t o a l e s s e r degree i n i n o c u l a t e d t r a n s g e n i c i n d i v i d u a l s . However, t h e s e 'symptoms' o c c u r r e d l a t e i n t h e i n f e c t i o n when t h e p l a n t s were e x t r e m e l y l a r g e and c o u l d have r e s u l t e d from t h e growing c o n d i t i o n s . In any cas e , i f t h e s e were symptoms, t h e y were e x t r e m e l y m i l d , s p o r a d i c , and c o u l d not be r e l i a b l y s c o r e d . The v i r u s t i t r e s f o r 'Russet Burbank' were a l s o a c c u m u l a t e d o v e r t i m e f o r each i n d i v i d u a l p l a n t . A l l u n t r a n s f o r m e d c o n t r o l p l a n t s a c c u m u l a t e d PLRV t o s i m i l a r h i g h l e v e l s , whereas t h r e e d i f f e r e n t r e s p o n s e s were o b s e r v e d i n t r a n s g e n i c p l a n t s . Each I l l t r a n s g e n i c l i n e had some p l a n t s i n which v i r u s was n e v e r d e t e c t e d and o t h e r s i n which v i r u s t i t r e s d e c r e a s e d t o u n d e t e c t a b l e l e v e l s . I n o t h e r i n d i v i d u a l s w i t h i n each t r a n s g e n i c l i n e , e x c ept 1-107, t h e v i r u s l e v e l s d e c l i n e d between 28 and 42 days p o s t -i n o c u l a t i o n t o l o w e r but s t i l l d e t e c t a b l e l e v e l s ( F i g u r e 1 3 ) . I n c o n t r a s t w i t h t h e ' D e s i r e e ' e x p e r i m e n t s ( F i g u r e s 10, 11, and 12) none o f t h e 'Russet Burbank' u n t r a n s f o r m e d c o n t r o l s e scaped i n f e c t i o n , perhaps because 50 v i r u l i f e r o u s a p h i d s were used f o r i n o c u l a t i o n . 'Russet Burbank' may a l s o be a p r e f e r r e d h o s t f o r PLRV. The average v i r u s t i t r e s and t h e r a t e o f a c c u m u l a t i o n o f t h e v i r u s i n u n t r a n s f o r m e d 'Russet Burbank' were g r e a t e r t h a n i n u n t r a n s f o r m e d ' D e s i r e e ' . P r o t e c t i o n i n b o t h ' D e s i r e e ' and 'Russet Burbank' t r a n s g e n i c p l a n t s f o l l o w e d s i m i l a r p a t t e r n s ( F i g u r e s 10, 11, and 1 3 ) . A d e c r e a s e i n v i r u s t i t r e i n t r a n s g e n i c ' D e s i r e e ' o c c u r r e d between 40 and 58 days p o s t - i n o c u l a t i o n ( F i g u r e s 10 and 1 1 ) ; i n t r a n s g e n i c 'Russet Burbank' a s i m i l a r d e c r e a s e o c c u r r e d between 28 and 42 days ( F i g u r e 13) p o s t - i n o c u l a t i o n . The f i n a l v i r u s t i t r e s i n t h e d i f f e r e n t t r a n s g e n i c 'Russet Burbank' l i n e s were more v a r i e d t h a n i n t h e ' D e s i r e e ' l i n e s , w i t h average absorbance v a l u e s (405 nm) from 0.135 t o 0.741 ( c o r r e s p o n d i n g t o 10 and 62 ng p e r mg o f l e a f t i s s u e ) , a t 56 days p o s t - i n o c u l a t i o n . The o v e r a l l r e d u c t i o n i n v i r u s t i t r e i n t h e t r a n s g e n i c ' D e s i r e e ' l i n e s was a p p r o x i m a t e l y 90%; i n t h e t r a n s g e n i c 'Russet Burbank' t h e r e d u c t i o n was 90 t o 99%. R e s i s t a n c e i n t h e t r a n s g e n i c ' D e s i r e e ' and 'Russet Burbank' was not overcome by t h e h i g h 112 F i g u r e 14. Number of ind i v i d u a l transgenic plants with s i g n i f i c a n t PLRV t i t r e s . Thirty transgenic 'Russet Burbank' from each l i n e were inoculated using 50 v i r u l i f e r o u s aphids and the number of plants with PLRV t i t r e s above 1 ng per mg of leaf tissue recorded. Virus t i t r e s were determined from known quantities of p u r i f i e d PLRV. Leaf extracts from plants not inoculated with PLRV gave background leve l s of less than 0.3 ng PLRV per mg of leaf t issue. Transgenic l i n e s RB7A and RB7B possess the LCP 31 construct, RBI and RB25 contain the LCP 107 construct, and RB2 and RB16B have the LCP 1718 construct. inoculum pressures used (Figures 12 and 13) . Leaf samples were taken from post-inoculation growth above the s i t e of inoculation. Therefore, the virus must be capable of r e p l i c a t i o n and appears to be capable of systemic movement within the transgenic plants. Because PLRV i s confined to the phloem 113 and movement i n t h e s i e v e t u b e s i n which t h e a p h i d s f e e d i s p a s s i v e , i t i s u n l i k e l y t h a t s y s t e m i c s p r e a d o f t h i s v i r u s i s i m p a i r e d . 4 . 1 0 PLRV Transmission from Inoculated Transgenic Potato Plants The PLRV t r a n s m i s s i o n e f f i c i e n c y o f M. persicae from s i x t r a n s g e n i c l i n e s o f 'Russet Burbank' was d e t e r m i n e d (Table 2 ) . A p h i d t r a n s m i s s i o n o f PLRV from i n f e c t e d t r a n s g e n i c p l a n t s was r e d u c e d and appears t o r e f l e c t t h e v i r u s t i t r e w i t h i n t h e p l a n t . The a b i l i t y o f t h e v e c t o r t o t r a n s m i t t h e v i r u s from t h e t r a n s g e n i c p l a n t s i n d i c a t e s t h a t t h e l a t t e r c o n t a i n v i a b l e v i r u s p a r t i c l e s and not s i m p l y c o a t p r o t e i n a g g r e g a t e s . T h i s r e d u c t i o n i n t r a n s m i s s i o n combined w i t h a r e d u c t i o n o f v i r u s r e p l i c a t i o n i n s i s t e r t r a n s g e n i c p l a n t s s h o u l d p r o v i d e e f f e c t i v e r e s i s t a n c e w i t h i n a c r o p . Table 2 . M. persicae t r a n s m i s s i o n 1 e f f i c i e n c y o f PLRV from t r a n s g e n i c 'Russet Burbank'. T r a n s g e n i c L i n e T r a n s m i s s i o n E f f i c i e n c y C o n s t r u c t RB7A 1/8 LCP 31 RB7B 4/8 LCP 31 RBI 0/8 LCP 107 RB25 3/8 LCP 107 RB2 2/8 LCP 1718 RB16B 6/8 LCP 1718 RB C o n t r o l 7/8 U n t r a n s f o r m e d 1 Four a p h i d s were t r a n s f e r r e d t o h e a l t h y P. pubescens a f t e r an a c q u i s i t i o n a c c e s s p e r i o d on t r a n s g e n i c 'Russet Burbank' t h a t had been p r e v i o u s l y i n o c u l a t e d w i t h PLRV u s i n g a p p r o x i m a t e l y 50 v i r u l i f e r o u s a p h i d s . 114 i A B C D E F G H I J K L M N O P 2.8-Kb 1.1-0.5-m P l a t e 1. Southern b l o t a n a l y s i s o f H i n d I I I d i g e s t e d DNA from p l a n t s t r a n s f o r m e d w i t h t h e PLRV c o a t p r o t e i n gene. The a u t o r a d i o g r a p h shows a H i n d I I I fragment o f a p p r o x i m a t e l y 1100 n t i n t r a n s g e n i c t o b a c c o T5 and t r a n s g e n i c p o t a t o D12, D8, D7, D2, RB7A, and RB7B ( l a n e s B,E,F,G,H,0, and P, r e s p e c t i v e l y ) a l l o f which were t r a n s f o r m e d w i t h c o n s t r u c t LCP 31. The H i n d I I I fragment was a p p r o x i m a t e l y 1300 n t i n t r a n s g e n i c t o b a c c o T18 and T l (l a n e s A and C) and t r a n s g e n i c p o t a t o RBI and RB25 ( l a n e s N and M) which p o s s e s s t h e LCP 107 c o n s t r u c t . The H i n d I I I fragment i n t r a n s g e n i c p o t a t o RB16B and RB2 (l a n e s K and L) which c o n t a i n e d t h e LCP 1718 c o n s t r u c t were a l s o a p p r o x i m a t e l y 1300 n t i n l e n g t h . H y b r i d i z a t i o n was not ob s e r v e d i n u n t r a n s f o r m e d t o b a c c o , ' D e s i r e e ' , o r 'Russet Burbank' ( l a n e s D,I, and J , r e s p e c t i v e l y ) . The b l o t was probed w i t h randomly p r i m e d 3 2P l a b e l l e d DNA p r e p a r e d from a g e l - p u r i f i e d A l u I fragment c o n t a i n i n g t h e PLRV c o a t p r o t e i n gene. 115 Kb 9.49 4.40 A B C D E F G H I J K L 1.35-* • - • 0.24-P l a t e 2. N o r t h e r n b l o t a n a l y s i s o f p o l y a d e n y l a t e d RNA from p l a n t s t r a n s f o r m e d w i t h t h e PLRV c o a t p r o t e i n gene. A p o l y a d e n y l a t e d t r a n s c r i p t w i t h an approximate s i z e o f 1000 n t was ob s e r v e d i n t h e a u t o r a d i o g r a p h o f 0.9 \Lq o f t o t a l p o l y a d e n y l a t e d RNA from t r a n s f o r m e d t o b a c c o T5, ' D e s i r e e ' D2, and 'Russet Burbank' RB7A and RB7B ( l a n e s D,E,H, and K, r e s p e c t i v e l y ) which p o s s e s s t h e LCP 31 c o n s t r u c t . The homologous t r a n s c r i p t s o b s e r v e d i n t h e a u t o r a d i o g r a m o f 0.9 \iq o f t o t a l p o l y a d e n y l a t e d RNA from t r a n s g e n i c t o b a c c o T18 and 'Russet Burbank' RBI and RB25 ( l a n e s C,J, and G, r e s p e c t i v e l y ) which p o s s e s s t h e LCP 107 c o n s t r u c t and t r a n s g e n i c 'Russet Burbank' RB2 and RB16B ( l a n e s I and F) which c o n t a i n t h e LCP 1718 c o n s t r u c t were s l i g h t l y l a r g e r w i t h an approximate s i z e o f 1200 n t . No homologous t r a n s c r i p t was obs e r v e d i n 0.9 \iq o f t o t a l p o l y a d e n y l a t e d RNA o f un t r a n s f o r m e d ' D e s i r e e ' o r 'Russet Burbank' ( l a n e s B and L ) . Q u a n t i t i e s o f t r a n s c r i p t were e s t i m a t e d from t h e s i g n a l i n t e n s i t y from 10 ng o f p u r i f i e d PLRV RNA (la n e A) . B l o t s were probed w i t h randomly p r i m e d 3 2P l a b e l l e d DNA p r e p a r e d t o a g e l - p u r i f i e d A l u I fragment c o n t a i n i n g t h e PLRV co a t p r o t e i n gene. 116 B Kd H P l a t e 3. Western b l o t a n a l y s i s o f PLRV c o a t p r o t e i n e x p r e s s i o n i n t r a n s g e n i c t o b a c c o . T o t a l p h e n o l - s o l u b l e p r o t e i n s were e x t r a c t e d from t h e l e a v e s o f t r a n s g e n i c t o b a c c o T18 ( l a n e s E and F ) , u n t r a n s f o r m e d t o b a c c o ( l a n e s C and D) , and PLRV i n f e c t e d P. pubescens ( l a n e s G and H). T o t a l p r o t e i n was q u a n t i t a t e d , 150 (lg ( l a n e s C, E, and G) and 50 [ig ( l a n e s D, F, and H) were f r a c t i o n a t e d by e l e c t r o p h o r e s i s , b l o t t e d , and probed u s i n g PLRV p o l y c l o n a l and 1 2 5 I l a b e l l e d p r o t e i n A. The b l o t a l s o shows 50 and 25 ng o f p u r i f i e d PLRV ( l a n e s A and B ) . 117 P l a t e 4. Western b l o t a n a l y s i s of PLRV c o a t p r o t e i n e x p r e s s i o n i n t r a n s g e n i c ' D e s i r e e ' . T o t a l p h e n o l - s o l u b l e p r o t e i n s were e x t r a c t e d from t h e l e a v e s o f t r a n s g e n i c ' D e s i r e e ' D2, D7, D8, D12, u n t r a n s f o r m e d ' D e s i r e e ' , and PLRV i n f e c t e d P. pubescens ( l a n e s B,C,D,E,A, and F, r e s p e c t i v e l y ) . T o t a l p r o t e i n was q u a n t i t a t e d , 150 Jig l o a d e d p e r l a n e , s e p a r a t e d , b l o t t e d and p r o b e d u s i n g PLRV monoclonal 371A and 1 2 5 I l a b e l l e d goat anti-mouse. The b l o t a l s o shows 20 ng o f p u r i f i e d PLRV ( l a n e G). 118 A B Kd 6 5 -2 3 -P l a t e 5 . Western b l o t a n a l y s i s o f p u r i f i e d PLRV. A b l o t o f 1 [ig and 100 ng o f p u r i f i e d PLRV ( l a n e s A and B) showing b o t h t h e 23 kDa co a t p r o t e i n and t h e 65 kDa p u t a t i v e t r a n s l a t i o n a l r e a d t h r o u g h p r o d u c t . B l o t s were probed w i t h PLRV p o l y c l o n a l and 1 2 5 I l a b e l l e d p r o t e i n A. V . 119 GENERAL DISCUSSION The p o t a t o l e a f r o l l v i r u s c o a t p r o t e i n gene was s u c c e s s f u l l y i n s e r t e d i n t o t o b a c c o and t h e p o t a t o c u l t i v a r s ' D e s i r e e ' (Kawchuk e t al., 1990) and 'Russet Burbank'. H i g h l e v e l s o f s u s t a i n e d r e s i s t a n c e t o PLRV i n f e c t i o n were o b t a i n e d i n t h e p o t a t o c u l t i v a r s . I n v e s t i g a t i o n s o f o t h e r p l a n t v i r u s e s ( P o w e l l A b e l e t al., 1986; Turner e t al., 1987; L o e s c h - F r i e s e t al., 1987; Van Dun et al., 1987; Hemenway e t al., 1988; Cuozzo e t al., 1988; Van Dun et al., 1988; Van Dun and B o l , 1988; S t a r k and Beachy, 1989; and Lawson e t al., 1990) have demonstrated r e s i s t a n c e t o i n f e c t i o n i n p l a n t s e x p r e s s i n g s p e c i f i c c o a t p r o t e i n genes. However, t h e r e s i s t a n c e t o PLRV o b s e r v e d i n t h i s s t u d y may be unique i n t h a t s i m i l a r l e v e l s o f r e s i s t a n c e were o b t a i n e d w i t h p o s i t i v e - and n e g a t i v e - s e n s e RNA. L e v e l s o f PLRV co a t p r o t e i n t r a n s c r i p t s were r e l a t i v e l y h i g h i n t h e t r a n s g e n i c p l a n t s ( P l a t e 2) as was p r e d i c t e d u s i n g t h e d u p l i c a t e d CaMV 35S promoter f o r t r a n s c r i p t i o n . However, c o a t p r o t e i n r e p r e s e n t e d l e s s t h a n 0.01% o f t o t a l l e a f p r o t e i n i n a l l t r a n s g e n i c p l a n t s e x c e p t t r a n s g e n i c t o b a c c o T18-107 wh i c h e x p r e s s e d c o a t p r o t e i n a t 0.5% o f t o t a l l e a f p r o t e i n ( P l a t e 3 ) . The c o a t p r o t e i n accumulated t o a p p r o x i m a t e l y 0.5% i n PLRV i n f e c t e d p l a n t s ( P l a t e 3 ) . The low l e v e l o f c o a t p r o t e i n i n t h e t r a n s g e n i c s may be a r e s u l t o f low t r a n s l a t i o n a l e f f i c i e n c y o f c o a t p r o t e i n RNA but t h i s seems u n l i k e l y i n vi e w o f t h e r e l a t i v e l y h i g h e x p r e s s i o n i n T18-107. The sequence s u r r o u n d i n g t h e PLRV c o a t p r o t e i n AUG l a c k s c e r t a i n consensus sequences n o r m a l l y a s s o c i a t e d w i t h h i g h l e v e l s o f t r a n s l a t i o n and t h e s t a r t codon t h e r e f o r e may not promote h i g h l e v e l s o f t r a n s l a t i o n (Kozak, 1986; L u t c k e e t al., 1987). However t h i s does not i n h i b i t t r a n s l a t i o n from n a t i v e v i r a l RNA w h i c h presumably has t h e same sequence. A n o t h e r p o s s i b i l i t y i s t h a t t h e u n t r a n s l a t e d r e g i o n 5' t o t h e PLRV c o a t p r o t e i n i s n e c e s s a r y f o r e f f i c i e n t t r a n s l a t i o n o f t h e c o a t p r o t e i n . The c o n s t r u c t LCP 31 ( F i g u r e 9) i n c l u d e d o n l y 12 n u c l e o t i d e s from t h i s 197 n u c l e o t i d e u n t r a n s l a t e d r e g i o n a d j a c e n t t o t h e c o a t p r o t e i n ORF. However, t h e LCP 107 c o n s t r u c t w i t h a l o n g e r 5' l e a d e r d i d not g i v e c o n s i s t e n t l y h i g h e r l e v e l s o f t r a n s c r i p t o r p r o t e i n i n o t h e r t r a n s g e n i c l i n e s o f t o b a c c o or p o t a t o . A l t e r n a t i v e l y , low l e v e l s o f c o a t p r o t e i n may be a r e s u l t o f t h e p r o t e i n s u b u n i t b e i n g u n s t a b l e o r s t a b l e o n l y w i t h i n s p e c i f i c t i s s u e s such as phloem c e l l s t o which n a t i v e v i r u s i s c o n f i n e d . However, t h e o b s e r v e d c o a t p r o t e i n showed no d e t e c t a b l e d e g r a d a t i o n and would be e x p e c t e d t o be s t a b l e i n a l l t r a n s g e n i c l i n e s . A l t h o u g h t h e r e s u l t s d e m o n s t r a t e d c l e a r l y t h a t e x p r e s s i o n o f t h e PLRV c o a t p r o t e i n in vivo o c c u r s , t h e p r e s e n c e of t r a n s c r i p t i t s e l f d i d not g u a r a n t e e e x p r e s s i o n o f d e t e c t a b l e l e v e l s o f c o a t p r o t e i n . I f t h e c o a t p r o t e i n i s i m p a r t i n g r e s i s t a n c e t h e n i t must be a b l e t o do so a t e x t r e m e l y low l e v e l s o r p o s s i b l y be c o n c e n t r a t e d i n s p e c i f i c c e l l s such as t h o s e o f t h e phloem. A l i n e o f t r a n s g e n i c p o t a t o e x p r e s s i n g low l e v e l s o f PVX and PVY c o a t p r o t e i n was more r e s i s t a n t towards t h e s e v i r u s e s t h a n o t h e r 121 transgenic l i n e s that expressed higher le v e l s of coat protein (Lawson et al., 1990). Tobacco expressing the CMV coat protein at l e v e l s as low as 0.001% of t o t a l leaf protein showed a reduction i n virus accumulation and i n the number of infected plants both of which were independent of the inoculum concentration (Cuozzo et al., 1988). At t h i s time the p o s s i b i l i t y cannot be eliminated that undetectably low level s of coat protein may be responsible for i n t e r f e r i n g with virus r e p l i c a t i o n . Even the negative-sense construct could produce coat protein i f the CaMV enhancer assisted t r a n s c r i p t i o n from TATA sequences within the PLRV construct. However, the observation that each transgenic plant appears to produce only a single PLRV coat protein t r a n s c r i p t (Plate 2) indicates that the CaMV enhancer does not enhance t r a n s c r i p t i o n from spurious TATA sequences found within PLRV cDNA sequences. However, a TATA sequence (Figure 7) found within the untranslated leader sequence 5' to the coat protein st a r t codon could possibly serve as a functional TATA and i t s t r a n s c r i p t would only be approximately 80 nucleotides shorter than the tr a n s c r i p t produced by the CaMV 35S promoter. Another question of interest i s the possible role of the 17 kDa ORF i n mediating resistance. The 17 kDa ORF i s nested within the PLRV coat protein gene so that a l l transgenic plants containing the PLRV coat protein gene also contain the 17 kDa ORF (Figure 8). Although expression of t h i s gene remains to be substantiated and i t s function determined, i t i s thought to 122 encode t h e PLRV VPg. The p r e s e n c e o f t h e 17 kDa ORF i n a l l l u t e o v i r u s e s sequenced s u g g e s t s t h a t i t i s e x p r e s s e d and s e r v e s an i m p o r t a n t f u n c t i o n i n l u t e o v i r u s i n f e c t i o n . T h i s i s t h e f i r s t example o f i n s e r t i o n o f t h e 17 kDa p r o t e i n ORF i n t o t r a n s g e n i c p l a n t s , and i t s p o s s i b l e i n v o l v e m e n t i n p r o t e c t i o n a g a i n s t PLRV cannot be r u l e d o u t . A l t e r n a t i v e l y , p r o t e c t i o n i n t r a n s g e n i c p l a n t s may be a c h i e v e d by t h e c o a t p r o t e i n gene t r a n s c r i p t , which may i n t e r f e r e at some s t a g e o f v i r a l r e p l i c a t i o n . Other workers have de m o n s t r a t e d v i r u s p r o t e c t i o n i n t r a n s g e n i c p l a n t s e x p r e s s i n g n e g a t i v e - s e n s e c o a t p r o t e i n t r a n s c r i p t but a t much l o w e r i n o c u l u m l e v e l s t h a n t h e p r o t e c t i o n o b t a i n e d from p o s i t i v e - s e n s e t r a n s c r i p t and i t s c o a t p r o t e i n p r o d u c t . Examples i n c l u d e t r a n s g e n i c t o b a c c o e x p r e s s i n g n e g a t i v e - s e n s e t r a n s c r i p t o f t h e PVX c o a t p r o t e i n gene (Hemenway et a l . , 1988) and n e g a t i v e - s e n s e t r a n s c r i p t o f CMV (Cuozzo e t al., 1988). B o t h PLRV p o s i t i v e - and n e g a t i v e - s e n s e t r a n s c r i p t from t h e t r a n s g e n i c p l a n t s c o u l d c o n c e i v a b l y s e q u e s t e r t h e o p p o s i t e sense v i r a l RNA. One or t h e o t h e r may i n t e r f e r e w i t h r e p l i c a s e r e c o g n i t i o n , r e p l i c a t i o n , o r p o s s i b l y t h e p r o d u c t i o n o f subgenomic messenger RNA. The n e g a t i v e - s e n s e t r a n s c r i p t c o u l d i n h i b i t t r a n s l a t i o n o f p o s i t i v e - s e n s e v i r u s RNA t h e r e b y p r e v e n t i n g c o a t p r o t e i n s y n t h e s i s . These p o s s i b l e mechanisms, may l i m i t t h e r a t e o f v i r u s i n f e c t i o n and r e p l i c a t i o n t o d i f f e r e n t degrees but would not c o m p l e t e l y i n h i b i t v i r a l r e p l i c a t i o n . However, s i n c e t h e l e v e l s o f p o s i t i v e - and 123 n e g a t i v e - s e n s e v i r a l RNA are p r o b a b l y d i f f e r e n t d u r i n g t h e c o u r s e of i n f e c t i o n a s i m i l a r p a t t e r n o f r e s i s t a n c e seems u n l i k e l y i f RNA i s b e i n g s e q u e s t e r e d . A n o t h e r p o s s i b i l i t y i s t h a t t h e u n t r a n s l a t e d l e a d e r sequence 5' t o t h e c o a t p r o t e i n s e q u e s t e r s t h e v i r a l r e p l i c a s e . T h i s , however, would o n l y o c c u r w i t h n e g a t i v e - s e n s e t r a n s c r i p t and would not account f o r t h e s i m i l a r p a t t e r n o f PLRV r e s i s t a n c e o b s e r v e d w i t h b o t h p o s i t i v e - and n e g a t i v e - s e n s e t r a n s c r i p t s ( F i g u r e 1 2 ) . I t i s p o s s i b l e t h a t t h e mechanism of PLRV r e s i s t a n c e i n t r a n s g e n i c p l a n t s e x p r e s s i n g p o s i t i v e - s e n s e t r a n s c r i p t d i f f e r s from t h a t o b t a i n e d w i t h t h e n e g a t i v e - s e n s e t r a n s c r i p t . The p r e c i s e mechanisms by which s u s t a i n e d v i r u s i n f e c t i o n a r e c o n t r o l l e d remains t o be e l u c i d a t e d . In o r d e r t o e s t a b l i s h an i n f e c t i o n i n t r a n s g e n i c p l a n t s , PLRV has t o be a b l e t o e n t e r a c e l l , become t r a n s l a t e d by h o s t r i b o s o m e s , and undergo r e p l i c a t i o n o f n e g a t i v e - and p o s i t i v e -sense RNA i n c l u d i n g t h e p r o d u c t i o n o f subgenomic RNA. The PLRV c o a t p r o t e i n , VPg, and r e a d t h r o u g h p r o t e i n a r e p r o b a b l y e x p r e s s e d from t h e t r a n s l a t i o n o f a subgenomic RNA. E n c a p s i d a t i o n o f t h e v i r a l RNA and t r a n s p o r t o f t h e v i r u s t h r o u g h t h e phloem a l s o must o c c u r . The t r a n s c r i p t o r t r a n s l a t i o n a l p r o d u c t p r o d u c e d i n t h e t r a n s g e n i c p l a n t s may i n t e r f e r e w i t h one o r more o f t h e s e s t a g e s d u r i n g t h e i n f e c t i o n p r o c e s s . D e t e r m i n a t i o n o f PLRV RNA l e v e l s and whether t h e y c o r r e s p o n d t o t h e l e v e l o f whole v i r u s o b s e r v e d w i t h i n t h e t r a n s g e n i c p l a n t s c o u l d h e l p u n d e r s t a n d t h e mechanism of t h e PLRV r e s i s t a n c e . 124 Each PLRV c o n s t r u c t examined ( F i g u r e 9) i n c l u d e s an a d d i t i o n a l 112 n u c l e o t i d e s beyond t h e PLRV c o a t p r o t e i n ORF amber t e r m i n a t i o n codon. The 112 n u c l e o t i d e s 3' t o t h e c o a t p r o t e i n gene were i n c l u d e d because o f t h e a v a i l a b i l i t y o f an A l u I r e s t r i c t i o n s i t e . T r a n s c r i p t s from b o t h p o s i t i v e - s e n s e c o n s t r u c t s c o u l d t r a n s l a t e t h e c o a t p r o t e i n r e a d t h r o u g h sequence i f t h e amber codon were su p p r e s s e d , as i s thought t o o c c u r i n n a t i v e v i r u s ( M a r t i n e t a l . , 1990). The r e a d t h r o u g h p r o d u c t was not o b s e r v e d i n w e s t e r n a n a l y s i s ( P l a t e s 3 and 4) o f t h e t r a n s g e n i c p l a n t s . I n s e r t e d a l o n g w i t h t h e PLRV c o a t p r o t e i n gene were e i t h e r 12 o r 192 u n t r a n s l a t e d n u c l e o t i d e s 5' t o t h e AUG. By i n c l u d i n g o n l y 12 n u c l e o t i d e s 5' t o t h e AUG i t was p o s s i b l e t o keep t h e d u p l i c a t e d CaMV promoter and t r a n s c r i p t i o n i n i t i a t i o n s i t e i n c l o s e p r o x i m i t y t o t h e c o a t p r o t e i n ORF w i t h v e r y l i t t l e i n t e r v e n i n g sequence. T h i s was done t o o b s e r ve t h e e f f e c t t h a t t h e absence o f t h e u n t r a n s l a t e d l e a d e r sequence has on t r a n s c r i p t i o n and t r a n s l a t i o n . I f PLRV subgenomic messenger RNA has a VPg l i n k e d t o i t s 5' t e r m i n u s as i s o b s e r v e d w i t h PLRV genomic RNA (Mayo et al., 1982), t h e VPg may n e c e s s i t a t e a p a r t i c u l a r t r a n s l a t i o n a l s t r a t e g y which would not r e q u i r e a capped 5' t e r m i n u s . P o l i o v i r u s w h i c h has a 5' VPg t e r m i n u s uses a s t r a t e g y o f i n t e r n a l i n i t i a t i o n o f ribosomes 5' t o t h e AUG u s i n g " r i b o s o m a l l a n d i n g pads" ( P e l l e t i e r and Sonenberg, 1988). These a r e r e g i o n s o f h i g h a d enosine and u r i d i n e c o n t e n t which a r e s i m i l a r t o t h o s e 125 i n t h e PLRV c o a t p r o t e i n 5' u n t r a n s l a t e d 192 n u c l e o t i d e l e a d e r sequence ( F i g u r e 7 ) . The p r e s e n c e o f t h i s 192 n u c l e o t i d e u n t r a n s l a t e d l e a d e r sequence 5' t o t h e AUG d i d not c o n s i s t e n t l y produce h i g h e r l e v e l s o f PLRV c o a t p r o t e i n . P r e s e n c e o f t h e PLRV t r a n s c r i p t and PLRV c o a t p r o t e i n d i d not r e s u l t i n symptoms i n t r a n s g e n i c p l a n t s grown i n a greenhouse. However, symptoms are not u s u a l l y d e t e c t e d i n greenhouse p l a n t s w i t h a p r i m a r y PLRV i n f e c t i o n and such was t h e case f o r b o t h t h e u n t r a n s f o r m e d c o n t r o l s and t h e t r a n s g e n i c s . F i e l d t r i a l s w i l l be n e c e s s a r y t o de t e r m i n e i f t h e p r e s e n c e o f t h e PLRV coa t p r o t e i n t r a n s c r i p t and t h e c o a t p r o t e i n produce any symptoms o f p o t a t o l e a f r o l l d i s e a s e i n t h e absence o f v i r u s i n f e c t i o n . F i e l d t r i a l s w i l l a l s o be r e q u i r e d t o d e t e r m i n e whether t r a n s g e n i c p l a n t s d i s p l a y a r e d u c t i o n o f symptoms o r are symptom-free f o l l o w i n g v i r a l i n f e c t i o n . Such t r i a l s w i l l a l s o be r e q u i r e d t o e v a l u a t e y i e l d i n b o t h P L R V - i n f e c t e d and PL R V - f r e e t r a n s g e n i c p l a n t s . P o t a t o l e a f r o l l d i f f e r s from o t h e r v i r u s e s t o wh i c h g e n e t i c a l l y e n g i n e e r e d r e s i s t a n c e has been d e v e l o p e d i n t h a t i t i s a p h l o e m - l i m i t e d v i r u s . A l t h o u g h t h e l u t e o v i r u s e s appear t o have t h e a b i l i t y t o r e p l i c a t e i n c e l l s o t h e r t h a n phloem t i s s u e in vitro (Takanami and Kubo, 1979; B a r n e t t e t al., 1981), t h e y a r e n o r m a l l y u n a b l e t o move out o f t h e phloem. A c h i m a e r i c c o n s t r u c t w i t h t h e CaMV 35S promoter has been shown t o be t r a n s c r i b e d and t r a n s l a t e d i n many c e l l t y p e s i n a d d i t i o n t o phloem c e l l s i n t r a n s g e n i c p l a n t s (Benfey e t al., 1989). 126 However, s i n c e PLRV i s c o n f i n e d t o t h e phloem, t h e i n t e r a c t i o n between PLRV and t r a n s g e n i c p l a n t p r o d u c t i s p r o b a b l y c o n f i n e d t o t h e phloem. L u t e o v i r u s l e v e l s have been r e p o r t e d t o v a r y among d i f f e r e n t l e a v e s on t h e same p l a n t ( P e r e i r a and L i s t e r , 1989). I n an a ttempt t o m i n i m i z e s a m p l i n g e r r o r s two l e a v e s were h a r v e s t e d from e v e r y p l a n t a t each s a m p l i n g d a t e . V i r u s l e v e l s i n t h e t r a n s g e n i c p l a n t s showed an i n c r e a s e i n v i r u s t i t r e f o l l o w e d by a d e c l i n e w h i c h o c c u r r e d from 28 t o 45 days f o l l o w i n g i n o c u l a t i o n ( F i g u r e s 10, 11, and 1 3 ) . T h i s p a t t e r n o f d e c l i n e i n v i r u s c o n c e n t r a t i o n , a f t e r r e p l i c a t i o n has o c c u r r e d , has not been r e p o r t e d i n p l a n t s e x p r e s s i n g o t h e r v i r a l c o a t p r o t e i n genes. W i t h o t h e r v i r u s e s , once t h e t r a n s g e n i c p l a n t became i n f e c t e d , r e s i s t a n c e was not as e f f e c t i v e and symptoms o f i n f e c t i o n i n c r e a s e d ( P o w e l l A b e l e t al., 1986; Turner e t al., 1987; L o e s c h -F r i e s e t al., 1987; Van Dun e t al., 1987; Hemenway e t al., 1988; Cuozzo e t a l . , 1988; Van Dun e t a l . , 1988; Van Dun and B o l , 1988; S t a r k and Beachy, 1989; and Lawson e t al., 1990). The d e c l i n e i n PLRV t i t r e appears t o o c c u r d u r i n g a p e r i o d o f r a p i d p l a n t growth, p o s s i b l y because t h e r a t e o f v i r u s r e p l i c a t i o n does not p e r m i t maintenance o f t h e i n i t i a l l e v e l o f v i r u s i n a l l t i s s u e s . However, i t seems u n l i k e l y t h a t t h i s a l o n e can account f o r t h e c o n t i n u e d d e c l i n e i n c e r t a i n t r a n s g e n i c l i n e s such as RB7A ( F i g u r e 1 3 ) . An i n c r e a s e i n t h e l e v e l o f PLRV i n o c u l u m d i d not overcome t h e o b s e r v e d r e s i s t a n c e . S i m i l a r i n o c u l u m c o n c e n t r a t i o n -127 independent p r o t e c t i o n has a l s o been r e p o r t e d f o r CMV (Cuozzo et al., 1988) and SMV ( S t a r k and Beachy, 1989). Young p o t a t o p l a n t s , s i m i l a r t o t h o s e i n o c u l a t e d i n t h e e x p e r i m e n t s d e s c r i b e d i n t h i s t h e s i s , a r e t h e most s u s c e p t i b l e t o PLRV i n f e c t i o n (Knutson and B i s h o p , 1964). The h i g h i n o c u l u m l e v e l s o b t a i n e d w i t h 25 o r 50 v i r u l i f e r o u s a p h i d s a r e much h i g h e r t h a n t h e l e v e l s t h a t would be o b s e r v e d on young p l a n t s i n a f i e l d s i t u a t i o n . The a b i l i t y o f t h e t r a n s g e n i c p l a n t s t o a c h i e v e r e s i s t a n c e under t h e s e h i g h i n o c u l u m l e v e l s i n d i c a t e s t h a t t h e y may o f f e r a p r a c t i c a l means of v i r u s c o n t r o l . A l t h o u g h v i r u s was not e x c l u d e d from e v e r y t r a n s g e n i c p l a n t , i t d e c l i n e d t o v e r y low or u n d e t e c t a b l e l e v e l s . From a p r a c t i c a l s t a n d p o i n t a d o p t i o n o f a s u i t a b l e r e s i s t a n t t r a n s g e n i c l i n e o f p o t a t o c o u l d reduce o r e l i m i n a t e a p h i d t r a n s m i s s i o n o f PLRV and r e s u l t i n an improvement i n y i e l d and q u a l i t y o f t u b e r s . F i e l d t r i a l s w i l l be r e q u i r e d t o d e t e r m i n e i f such r e s i s t a n c e p r o t e c t s a g a i n s t net n e c r o s i s , a f f e c t s y i e l d o r q u a l i t y , or s i g n i f i c a n t l y a l t e r s t h e e p i d e m i o l o g y o f PLRV i n t h e f i e l d . I n t h e s e e x p e r i m e n t s p l a n t s were i n o c u l a t e d by v i r u l i f e r o u s M. persicae, which i s t h e a p h i d r e s p o n s i b l e f o r t h e s p r e a d o f PLRV i n t h e f i e l d . Most o t h e r s t u d i e s o f v i r a l c o a t p r o t e i n e x p r e s s i o n i n t r a n s g e n i c p l a n t s have c h a l l e n g e d t h e p l a n t s u s i n g m e c h a n i c a l i n o c u l a t i o n . W h i l e m e c h a n i c a l i n o c u l a t i o n a l l o w s f o r more p r e c i s e q u a n t i t a t i o n o f t h e i n o c u l u m i t may not r e s u l t i n t h e l e v e l o f p r o t e c t i o n o b s e r v e d when t h e v i r u s i s t r a n s m i t t e d by i t s n a t u r a l v e c t o r s . An a p h i d t r a n s m i t t e d v i r u s i s d e p o s i t e d a t 128 a low l e v e l on a l e a f b a s i s , but a t t h e c e l l u l a r l e v e l t h e i n o c u l u m may be a t a much h i g h e r c o n c e n t r a t i o n t h a n t h a t o b t a i n e d by m e c h a n i c a l t r a n s m i s s i o n . Thus, v i r u s t r a n s m i s s i o n t o t r a n s g e n i c p l a n t s by t h e n a t u r a l v e c t o r would be e x p e c t e d t o p r o v i d e t h e b e s t i n d i c a t i o n o f t h e e f f e c t i v e n e s s o f g e n e t i c a l l y e n g i n e e r e d r e s i s t a n c e i n t h e f i e l d . As a group, t h e l u t e o v i r u s e s p o s s e s s many un i q u e c h a r a c t e r i s t i c s . T h e i r s p h e r i c a l p a r t i c l e s a r e l i m i t e d t o t h e phloem and a r e u s u a l l y t r a n s m i t t e d by a s p e c i f i c a p h i d s p e c i e s i n a c i r c u l a t i v e , n o n - p r o p a g a t i v e manner. The v i r u s e s o c c u r a t low t i t r e b u t can cause s e r i o u s economic l o s s e s i n y i e l d and q u a l i t y . These c h a r a c t e r i s t i c s make PLRV d i f f i c u l t t o c o n t r o l . G e n e t i c e n g i n e e r i n g may p r o v i d e p r a c t i c a l r e s i s t a n c e i f t h e f o l l o w i n g c o n d i t i o n s a r e s a t i s f i e d : d e c r e a s e d a c q u i s i t i o n o f v i r u s by t h e a p h i d v e c t o r , a l l e v i a t i o n o f symptoms and i n c r e a s e d y i e l d s , and d e c r e a s e d i n t e r n a l net n e c r o s i s o f t h e phloem i n t u b e r s . E v i d e n c e from t h e greenhouse s t u d i e s i n d i c a t e s t h a t a s i g n i f i c a n t r e d u c t i o n i n v i r u s t r a n s m i s s i o n was o b t a i n e d i n t h e t r a n s g e n i c p l a n t s (Table 2 ) . C r o s s - p r o t e c t i o n has been r e p o r t e d f o r many p l a n t v i r u s e s i n c l u d i n g t h e l u t e o v i r u s PLRV (Webb e t a l . , 1952; H a r r i s o n , 1958) . When c r o s s - p r o t e c t i o n o c c u r s t h e i n d u c e r v i r u s p e r s i s t s a f t e r i n o c u l a t i o n w i t h t h e c h a l l e n g e v i r u s and t h e l a t t e r i s not o b s e r v e d . A n o t h e r phenomenon termed mutual e x c l u s i o n , where two or more v i r u s e s a r e i n o c u l a t e d a t t h e same t i m e and l o c a t i o n , r e s u l t s i n an i n c r e a s e i n b o t h v i r u s e s f o l l o w e d by t h e 129 d i s a p p e a r a n c e o f b o t h v i r u s e s ( J e d l i n s k i and Brown, 1965). The re s p o n s e o b s e r v e d i n t h e PLRV r e s i s t a n t t r a n s g e n i c p l a n t s may resemble e i t h e r o f t h e above phenomena. An u n d e r s t a n d i n g o f t h e method o f p r o t e c t i o n o p e r a t i n g i n PLRV r e s i s t a n t t r a n s g e n i c p l a n t s c o u l d l e a d t o an u n d e r s t a n d i n g o f t h e mechanisms i n v o l v e d i n c r o s s - p r o t e c t i o n , mutual e x c l u s i o n , and v i r u s r e p l i c a t i o n , and t o an u n d e r s t a n d i n g o f t h e mechanisms o f c o n t r o l o f o t h e r v i r u s e s . F u r t h e r m o d i f i c a t i o n s o f t h e i n s e r t e d gene c o u l d be made t o i n c r e a s e o r d e c r e a s e t h e l e v e l s o f t r a n s c r i p t o r co a t p r o t e i n and perhaps i n c r e a s e t h e l e v e l s o f r e s i s t a n c e o b t a i n e d . In v i e w o f t h e s i m i l a r i t y between t h e t h r e e l u t e o v i r u s e s sequenced t o d a t e , PLRV (Mayo e t al., 1989; Van der W i l k et al., 1989; Keese e t al., 1990), beet w e s t e r n y e l l o w s v i r u s ( V e i d t e t a l . , 1988), and b a r l e y y e l l o w dwarf v i r u s - P A V ( M i l l e r e t al., 1988a) i t i s l i k e l y t h a t t h i s s t r a t e g y emphasized i n t h e e x p e r i m e n t s d e s c r i b e d i n t h i s t h e s i s w i l l be used i n a t t e m p t s t o o b t a i n r e s i s t a n c e w i t h o t h e r l u t e o v i r u s e s . 130 BIBLIOGRAPHY Angenent, G.C, Van Den Ouweland, J.M.W., and B o l , J.F. 1990. S u s c e p t i b i l i t y t o v i r u s i n f e c t i o n o f t r a n s g e n i c t o b a c c o p l a n t s e x p r e s s i n g s t r u c t u r a l and n o n s t r u c t u r a l genes o f t o b a c c o r a t t l e v i r u s . V i r o l o g y 175:191-198. A v i v , H., and Leder, P. 1972. P u r i f i c a t i o n o f b i o l o g i c a l l y a c t i v e g l o b i n messenger RNA by chromatography on o l i g o t h y m i d y l i c a c i d - c e l l u l o s e . P r o c . Nat. Acad. S c i . USA 69:1408-1412. B a g n a l l , R.H. 1988. E p i d e m i c s o f p o t a t o l e a f r o l l i n N o r t h A m e r i c a and Europe l i n k e d t o drought and sunspot c y c l e s . Can. J . P l a n t P a t h o l . 10:192-202. B a i l e y , J.M., and Davi d s o n , N. 1976. M e t h y l m e r c u r y as a r e v e r s i b l e d e n a t u r i n g agent f o r agarose g e l e l e c t r o p h o r e s i s . A n a l . Biochem. 70:75-85. B a r b a r a , D.J., Kawata, E.E., Ueng, P.P., L i s t e r , R.M., and L a r k i n s , B.A. 1987. P r o d u c t i o n o f cDNA c l o n e s from t h e MAV i s o l a t e o f b a r l e y y e l l o w dwarf v i r u s . J . Gen. V i r o l . 68:2419-2427. B a r k e r , H., and H a r r i s o n , B.D. 1978. Double i n f e c t i o n , i n t e r f e r e n c e and s u p e r i n f e c t i o n i n p r o t o p l a s t s exposed t o two s t r a i n s o f r a s p b e r r y r i n g s p o t v i r u s . J . Gen. V i r o l . 40:647-658. B a r n e t t , A., Hammond, J . , and L i s t e r , R.M. 1981. L i m i t e d i n f e c t i o n o f c e r e a l l e a f p r o t o p l a s t s by b a r l e y y e l l o w dwarf v i r u s . J . Gen. V i r o l . 57:397-401. Baughman, G.A., Jac o b s , J.D., and H o w e l l , S.H. 1988. C a u l i f l o w e r mosaic v i r u s gene VI produces a symptomatic phenotype i n t r a n s g e n i c t o b a c c o p l a n t s . P r o c . N a t l . Acad. S c i . USA 85:733-737. Baulcombe, D.C., Saunders, G.R., Bevan, M.W., Mayo, M.A., and H a r r i s o n , B.D. 1986. E x p r e s s i o n o f b i o l o g i c a l l y a c t i v e v i r a l s a t e l l i t e RNA from t h e n u c l e a r genome o f t r a n s f o r m e d p l a n t s . N a t u r e 321:446-449. Beachy, R.N., L o e s c h - F r i e s , S., and Turner, N.E. 1990. Coat p r o t e i n - m e d i a t e d r e s i s t a n c e a g a i n s t v i r u s i n f e c t i o n . Annu. Rev. P h y t o p a t h o l . 28:451-474. Benfey, P.N., Ren, L., and Chua, N.-H. 1989. The CaMV.35S enhancer c o n t a i n s a t l e a s t two domains which can c o n f e r d i f f e r e n t d e v e l o p m e n t a l and t i s s u e - s p e c i f i c e x p r e s s i o n p a t t e r n s . EMBO J o u r n a l 8:2195-2202. 131 B e r g e r , P.H., Hunt, A.G., Domier, L.L., Hellmann, G.M., Stram, Y., Thornbury, D.W., and P i r o n e , T.P. 1989. E x p r e s s i o n i n t r a n s g e n i c p l a n t s o f a v i r a l gene p r o d u c t t h a t m e d i a t e s i n s e c t t r a n s m i s s i o n o f p o t y v i r u s e s . P r o c . N a t l . Acad. S c i . USA 86:8402-8406. B e r r y , R., and Simpson, R.G. 1967. F l i g h t a c t i v i t i e s o f t h e green peach a p h i d . C o l o r a d o S t a t e U n i v . Tech. B u l l . 92. Bevan, M.W., Mason, S.E., and G o e l e t , P. 1985. E x p r e s s i o n o f to b a c c o mosaic v i r u s c o a t p r o t e i n by a c a u l i f l o w e r mosaic v i r u s p romoter i n p l a n t s t r a n s f o r m e d by Agrobacterium. EMBO J o u r n a l 4:1921-1926. B i s h o p , G.W., and G u t h r i e , J.W. 1964. Home gardens as a sourc e o f t h e green peach a p h i d and v i r u s d i s e a s e s i n Idaho. Amer. P o t a t o J . 41:28-34. B r a d f o r d , M.M. 1976. A r a p i d and s e n s i t i v e method f o r t h e q u a n t i t a t i o n o f microgram q u a n t i t i e s o f p r o t e i n u t i l i z i n g t h e p r i n c i p l e o f p r o t e i n dye b i n d i n g . A n a l . Biochem. 72:248-254. Cadman, C.H., and H a r r i s o n , B.D. 1959. S t u d i e s on t h e p r o p e r t i e s o f s o i l - b o r n e v i r u s e s o f t h e t o b a c c o - r a t t l e t y p e o c c u r r i n g i n S c o t l a n d . Ann. A p p l . B i o l . 47:542-556. Casper, R. 1977. D e t e c t i o n o f p o t a t o l e a f r o l l v i r u s i n p o t a t o and Physalis floridana by e n z y m e - l i n k e d immunosorbent as s a y ( E L I S A ) . P h y t o p a t h o l . Z. 90:364-368. Cech, T.R. 1987. The c h e m i s t r y o f s e l f - s p l i c i n g RNA and RNA enzymes. S c i e n c e 236:1532-1539. Cuozzo, M., O ' C o n n e l l , K.M., K a n i e w s k i , W., Fang, R.-X., Chua, N.-H., and Turner, N.E. 1988. V i r a l p r o t e c t i o n i n t r a n s g e n i c t o b a c c o p l a n t s e x p r e s s i n g t h e cucumber mosaic v i r u s c o a t p r o t e i n o r i t s a n t i s e n s e RNA. B i o / T e c h n o l o g y 6:549-557. D'Arcy, C.J., T o r r a n c e , L., and M a r t i n , R.R. 1989. D i s c r i m i n a t i o n among l u t e o v i r u s e s and t h e i r s t r a i n s by mo n o c l o n a l a n t i b o d i e s and i d e n t i f i c a t i o n o f common e p i t o p e s . P h y t o p a t h o l o g y 79:869-873. D a v i s , R.E., and Ross, A.F. 1968. I n c r e a s e d h y p e r s e n s i t i v i t y i n d u c e d i n t o b a c c o by s y s t e m i c i n f e c t i o n by p o t a t o v i r u s Y. V i r o l o g y 34:509-520. De B l o c k , M. 1988. Genotype-independent l e a f d i s c t r a n s f o r m a t i o n o f p o t a t o (Solanum tuberosum) u s i n g Agrobacterium tumefaciens. Theor. A p p l . Genet. 76:767-774. 132 Deom, CM., O l i v e r , M.J., and Beachy, R.N. 1987. The 30-k i l o d a l t o n gene p r o d u c t o f t o b a c c o mosaic v i r u s p o t e n t i a t e s v i r u s movement. S c i e n c e 237:389-394. de Zoeten, G.A., and F u l t o n , R.W. 1975. U n d e r s t a n d i n g g e n e r a t e s p o s s i b i l i t i e s . P h y t o p a t h o l o g y 65:221-222. de Zoeten, G.A., Gaard, G., and D i e z , F.B. 1972. N u c l e a r v e s i c u l a t i o n a s s o c i a t e d w i t h pea e n a t i o n mosaic v i r u s - i n f e c t e d p l a n t t i s s u e . V i r o l o g y 53:638-647. D i t t a , G., S t a n f i e l d , S., C o r b i n , D., and H e l i n s k i , D.R. 1980. Bro a d h o s t range DNA c l o n i n g system f o r gram-negative b a c t e r i a : C o n s t r u c t i o n o f a gene bank o f Rhizobium meliloti. P r o c . N a t l . Acad. S c i . USA 77:7347-7351. Dodds, J.A., and H a m i l t o n , R.I. 1976. S t r u c t u r a l i n t e r a c t i o n s between v i r u s e s as a consequence o f mixed i n f e c t i o n s . Adv. V i r u s Res. 20:33-86. E i g e n , M., and S c h u s t e r , P. 1977. The h y p e r c y c l e . N a t u r w i s s e n s c h a f t e n 64:541-565. E s k a n d a r i , F., S y l v e s t e r , E.S., and R i c h a r d s o n , J . 1979. E v i d e n c e f o r l a c k o f p r o p a g a t i o n o f p o t a t o l e a f r o l l v i r u s i n i t s a p h i d v e c t o r , Myzus persicae. P h y t o p a t h o l o g y 69:45-47. F e i n b e r g , A.P., and V o g e l s t e i n , B. 1983. A t e c h n i q u e f o r r a d i o l a b e l i n g DNA r e s t r i c t i o n e ndonuclease fragments t o h i g h s p e c i f i c a c t i v i t y . A n a l . Biochem. 132:6-13. F o r b e s , A.R., and Chan, C . K . 1989. A p h i d s o f B r i t i s h C o lumbia. A g r i c . Can. Tech. B u l l . 1989-1E. F r a l e y , R.T., Rogers, S.G., Horsch, R.B., E i c h o l t z , D.A., F l i c k , J.S., F i n k , C.L., Hoffman, N.L., and Sanders, P.R. 1985. The SEV system: A mew di s a r m e d T i p l a s m i d v e c t o r system f o r p l a n t t r a n s f o r m a t i o n . B i o / T e c h n o l o g y 3:629-635. F r a l e y , R.T., Rogers, S.G., Horsch, R.B., Sanders, P.R., F l i c k , J.S., Adams, S.P., B i t t n e r , M.L., Brand, L.A., F i n k , C L . , F r y , J.S., G a l l u p p i , G.R., G o l d b e r g , S.B., Hoffmann, N.L., and Woo, S.C. 1983. E x p r e s s i o n o f b a c t e r i a l genes i n p l a n t s c e l l s . P r o c . N a t l . Acad. S c i . USA 80:4803-4807. F r e i t a g , J.H. 1964. I n t e r a c t i o n and mutual s u p p r e s s i o n among t h r e e s t r a i n s o f a s t e r y e l l o w s v i r u s . V i r o l o g y 24:401-413. F u l t o n , R.W. 1951. S u p e r i n f e c t i o n by s t r a i n s o f t o b a c c o mosaic v i r u s . P h y t o p a t h o l o g y 41:579-592. 133 F u l t o n , R.W. 1978. S u p e r i n f e c t i o n by s t r a i n s o f t o b a c c o s t r e a k v i r u s . V i r o l o g y 85:1-8. Gergen, J.P., S t e r n , R.H., and Wensink, P.C. 1979. F i l t e r r e p l i c a s and permanent c o l l e c t i o n s o f recombinant DNA p l a s m i d s . N u c l e i c A c i d s Res. 7:2115-2136. G e r l a c h , W.L., L l e w e l l y n , D., and H a s e l o f f , J . 1987. C o n s t r u c t i o n o f a p l a n t d i s e a s e r e s i s t a n c e gene from t h e s a t e l l i t e RNA o f t o b a c c o r i n g s p o t v i r u s . N a t u r e 328:802-805. G i a n i n a z z i , S., V a l l e e , J.C., and M a r t i n , C. 1969. H y p e r s e n s i b i l i t e aux v i r u s , t e m p e r a t u r e e t p r o t e i n e s s o l u b l e s chez l e Nicotians X a n t h i n.c. C R . Hebd. Seances Acad. S c i . , Se r . D 268:800-802. G i b b s , A . J . 1969. P l a n t v i r u s c l a s s i f i c a t i o n . Adv. V i r u s Res. 14:263-328. G i l d o w , F.E. 1982. C o a t e d - v e s i c l e t r a n s p o r t o f l u t e o v i r u s e s t h r o u g h s a l i v a r y g l a n d s o f Myzus p e r s i c a e . P h y t o p a t h o l o g y 72:1289-1296. G i l d o w , F.E., and Rochow, W.F. 1980a. R o l e o f a c c e s s o r y s a l i v a r y g l a n d s i n a p h i d t r a n s m i s s i o n o f b a r l e y y e l l o w dwarf v i r u s . V i r o l o g y 104:97-108. G i l d o w , F.E., and Rochow, W.F. 1980b. Importance o f c a p s i d i n t e g r i t y f o r i n t e r f e r e n c e between two i s o l a t e s o f b a r l e y y e l l o w dwarf v i r u s i n an a p h i d . P h y t o p a t h o l o g y 70:1013-1015. G i l l , C.C., and Chong, J . 1979. C y t o p a t h o l o g i c a l e v i d e n c e f o r t h e d i v i s i o n o f b a r l e y y e l l o w dwarf v i r u s i s o l a t e s i n t o two subgroups. V i r o l o g y 95:59-69. G i l p a t r i c k , J.D., and Weintraub, M. 1952. An u n u s u a l t y p e o f p r o t e c t i o n w i t h t h e c a r n a t i o n mosaic v i r u s . S c i e n c e 115:701-702. Goldbach, R., and van Kammen, A. 1985. S t r u c t u r e , r e p l i c a t i o n and e x p r e s s i o n o f t h e b i p a r t i t e genome of cowpea mosaic v i r u s . I n M o l e c u l a r P l a n t V i r o l o g y , v o l . I I , J.W. D a v i e s , ed. CRC P r e s s , Boca R a t a n . pp. 83-120.. Graybosch, R., Hellmann, G.M., Shaw, J.G., Rhoads, R.E., and Hunt, A.G. 1989. E x p r e s s i o n o f a p o t y v i r u s n o n - s t r u c t u r a l p r o t e i n i n t r a n s g e n i c t o b a c c o . B i o c h . B i o p h y s . Res. Commun. 160:425-432. G u b l e r , U., and Hoffman, B . J . 1983. A s i m p l e and v e r y e f f e c i e n t method f o r g e n e r a t i n g cDNA l i b r a r i e s . Gene 25:263-269. 134 G u i l l e y , H., C a r r i n g t o n , J . C , B a l a z s , E., J o n a r d , G., R i c h a r d s , K., and M o r r i s , T.J. 1985. N u c l e o t i d e sequence and genome o r g a n i z a t i o n o f c a r n a t i o n m o t t l e v i r u s RNA. N u c l e i c A c i d s Res. 13:6663-6677. H a m i l t o n , R . I . 1980. Defenses t r i g g e r e d by p r e v i o u s i n v a d e r s : v i r u s e s . I n : P l a n t D i s e a s e : An Advanced T r e a t i s e , V o l . 5. J.G. H o r s f a l l and E.B. C o w l i n g , eds. Academic P r e s s , New York. pp. 279-303. Har p e r , F.R., N e l s o n , G.A., and P i t t m a n , U.J. 1975. R e l a t i o n s h i p between l e a f r o l l symptoms and y i e l d i n N e t t e d Gem p o t a t o . P h y t o p a t h o l o g y 65:1242-1244. H a r r i s , K.F., B a t h , J.E., T h o t t a p p i l l y , G., and Hooper, G.R. 1975. F a t e o f pea e n a t i o n mosaic v i r u s i n P E M V - i n j e c t e d pea a p h i d s . V i r o l o g y 65:148-162. H a r r i s o n , B.D. 1958. A b i l i t y o f s i n g l e a p h i d s t o t r a n s m i t b o t h a v i r u l e n t and v i r u l e n t s t r a i n s o f p o t a t o l e a f r o l l v i r u s . V i r o l o g y 6:278-286. H a r r i s o n , B.D. 1984. P o t a t o l e a f r o l l v i r u s . D e s c r i p t i o n s o f P l a n t V i r u s e s , No. 291. Commonw. M y c o l . I n s t . , A s s o c . A p p l . B i o l . , Kew, S u r r e y , E n g l a n d . H a r r i s o n , B.D., Mayo, M.A., and Baulcombe, D.C 1987. V i r u s r e s i s t a n c e i n t r a n s g e n i c p l a n t s t h a t e x p r e s s cucumber mosaic v i r u s s a t e l l i t e RNA. Nature 328:799-802. H a r r i s o n , S.C. 1983. V i r u s s t r u c t u r e : h i g h r e s o l u t i o n p e r s p e c t i v e s . Advances i n V i r u s R e s e a r c h 28:175-240. H a s e l o f f , J . , and G e r l a c h , W.L. 1988. Simple RNA enzymes w i t h new and h i g h l y s p e c i f i c e n d o r i b o n u c l e a s e a c t i v i t i e s . N a t u r e 334:585-591 Hemenway, C , Fang, R.-X., K a n i e w s k i , W.K., Chua, N.-H., and Turner, N.E. 1988. A n a l y s i s o f t h e mechanism o f p r o t e c t i o n i n t r a n s g e n i c p l a n t s e x p r e s s i n g t h e p o t a t o v i r u s X c o a t p r o t e i n o r i t s a n t i s e n s e RNA. EMBO J . 7:1273-1280. H e n i k o f f , S. 1984. U n i d i r e c t i o n a l d i g e s t i o n w i t h e x o n u c l e a s e I I I c r e a t e s t a r g e t b r e a k p o i n t s f o r DNA s e q u e n c i n g . Gene 28:351-359. H i a t t , A., C a f f e r k e y , R., and Bowdish, K. 1989. P r o d u c t i o n o f a n t i b o d i e s i n t r a n s g e n i c p l a n t s . N a t u r e 342:76-78. 135 Hoekema, A., Huisman, M.J., M o l e n d i j k , L., van den E l z e n , P.J.M., and C o r n e l i s s e n , B.J.C. 1989. The g e n e t i c e n g i n e e r i n g o f two comm e r c i a l p o t a t o c u l t i v a r s f o r r e s i s t a n c e t o p o t a t o v i r u s X. B i o / T e c h n o l o g y 7:273-278. Hor s c h , R.B., F r a l e y , R.T., Rogers, S.G., Sanders, P.R., L l o y d , A., and Hoffmann, N. 1984. I n h e r i t a n c e o f f u n c t i o n a l f o r e i g n genes i n p l a n t s . S c i e n c e 223:496-498. Hor s c h , R.B., F r y , J.E., Hoffmann, N.L., E i c h h o l t z , D., Rogers S.G., and F r a l e y , R.T. 1985. A s i m p l e and g e n e r a l method f o r t r a n s f e r r i n g genes i n t o p l a n t s . S c i e n c e 227:1229-1231. Hu, J.S., Rochow, W.F., P a l u k a i t i s , P., and D i e t e r t , R.R. 1988. P h e n o t y p i c m i x i n g : mechanisms o f dependent t r a n s m i s s i o n f o r two r e l a t e d i s o l a t e s o f b a r l e y y e l l o w dwarf v i r u s . P h y t o p a t h o l o g y 78:1326-1330. Hunter, W.M., and Greenwood, F.C. 1962. P r e p a r a t i o n o f i o d i n e -131 l a b e l l e d human growth hormone o f h i g h s p e c i f i c a c t i v i t y . N a t u r e 194:495-496. J e d l i n s k i , H., and Brown, C M . 1965. C r o s s p r o t e c t i o n and mutual e x c l u s i o n by t h r e e s t r a i n s o f b a r l e y y e l l o w dwarf v i r u s i n Avena sativa L. V i r o l o g y 26:613-621. J o b l i n g , S.A., and Gehrke, L. 1987. Enhanced t r a n s l a t i o n o f c h i m a e r i c messenger RNAs c o n t a i n i n g a p l a n t v i r a l u n t r a n s l a t e d l e a d e r sequence. N a t u r e 325:622-625. J o c k u s c h , H. 1968. Two mutants o f t o b a c c o mosaic v i r u s t e m p e r a t u r e s e n s i t i v e i n two d i f f e r e n t f u n c t i o n s . V i r o l o g y 35:94-101. Kamer, C , and Argos, P. 1984. P r i m a r y s t r u c t u r a l comparison o f RNA-dependent polymerases from p l a n t , a n i m a l and b a c t e r i a l v i r u s e s . N u c l e i c A c i d s R e s e a r c h 12:7269-7282. K a s s a n i s , B., G i a n i n a z z i , S., and White, R.F. 1974. A p o s s i b l e e x p l a n a t i o n o f t h e r e s i s t a n c e o f v i r u s - i n f e c t e d t o b a c c o p l a n t s t o second v i r u s i n f e c t i o n . J . Gen. V i r o l . 23:11-16. Kawchuk, L.M., M a r t i n , R.R., Rochon, D.M., and McPherson, J . 1989. I d e n t i f i c a t i o n and c h a r a c t e r i z a t i o n o f t h e p o t a t o l e a f r o l l v i r u s p u t a t i v e c o a t p r o t e i n gene. J . Gen. V i r o l . 70:783-788. Kawchuk, L.M., M a r t i n , R.R., and McPherson, J . 1990. R e s i s t a n c e i n t r a n s g e n i c p o t a t o e x p r e s s i n g t h e p o t a t o l e a f r o l l v i r u s c o a t p r o t e i n gene. M o l e c u l a r P l a n t - M i c r o b e I n t e r a c t i o n s 3:301-307. 136 Kay, R., Chan, A., D a l y , M., and McPherson, J . 1987. D u p l i c a t i o n o f CaMV 35S promoter sequences c r e a t e s a s t r o n g enhancer f o r p l a n t genes. S c i e n c e 236:1299-1302. Keese, P., M a r t i n , R.R., Kawchuk, L.M., Waterhouse, P.M., and G e r l a c h , W.L. 1990. N u c l e o t i d e sequences o f an A u s t r a l i a n and a Canadian i s o l a t e o f p o t a t o l e a f r o l l l u t e o v i r u s and t h e i r r e l a t i o n s h i p s w i t h two European i s o l a t e s . J . Gen. V i r o l . 71:719-724 . K i r k p a t r i c k , H.C., and Ross, A.F. 1952. A p h i d - t r a n s m i s s i o n o f p o t a t o l e a f r o l l v i r u s t o Solanaceous s p e c i e s . P h y t o p a t h o l o g y 42:540-546. K i t a j i m a , E.W., and L a u r i t i s , J.A. 1969. P l a n t v i r i o n s i n plasmodesmata. V i r o l o g y 37:681-685. Knutson, K.W., and B i s h o p , G.W. 1964. P o t a t o l e a f r o l l v i r u s -e f f e c t o f d a t e o f i n o c u l a t i o n on p e r c e n t i n f e c t i o n and symptom e x p r e s s i o n . Amer. P o t a t o J . 41:227-238. K o r n e l u k , R.G., Quan, F., and G r a v e l , R.A. 1985. R a p i d and r e l i a b l e d i d e o x y s e q u e n c i n g o f d o u b l e - s t r a n d e d DNA. Gene 40:317-323. Kozak, M. 1986. B i f u n c t i o n a l Messenger RNAs i n E u k a r y o t e s . C e l l 47:481-483. Laemmli, U.K. 1970. Cleavage o f s t r u c t u r a l p r o t e i n s d u r i n g t h e assembly o f t h e head o f b a c t e r i o p h a g e T4. Nat u r e 227:680-685. Lawson, C , K a n i e w s k i , W., Haley , L., Rozman, R., N e w e l l , C , Sanders, P., and Turner, N.E. 1990. E n g i n e e r i n g r e s i s t a n c e t o mixed v i r u s i n f e c t i o n i n a commercial p o t a t o c u l t i v a r : r e s i s t a n c e t o p o t a t o v i r u s X and p o t a t o v i r u s Y i n t r a n s g e n i c R u s s e t Burbank. B i o / T e c h n o l o g y 8:127-134. L o e b e n s t e i n , G. 1972. L o c a l i z a t i o n and i n d u c e d - r e s i s t a n c e i n v i r u s - i n f e c t e d p l a n t s . Ann. Rev. P h y t o p a t h o l . 10:177-206. L o e s c h - F r i e s , L.S., M e r l o , D., Zinnen, T., Burhop, L., H i l l , K., Krahn, K., J a r v i s , N., N e l s o n , S., and Ha l k , E. 1987. E x p r e s s i o n o f a l f a l f a mosaic v i r u s RNA 4 i n t r a n s g e n i c p l a n t s c o n f e r s v i r u s r e s i s t a n c e . EMBO J . 6: 1845-1851. L u t c k e , H.A., Chow, K.C., M i c k e l , F.S., Moss, K.A., Kern, H.F., and S c h e e l e , G.A. 1987. S e l e c t i o n o f AUG i n i t i a t i o n codons d i f f e r s i n p l a n t s and a n i m a l s . EMBO J . 6:43-48. MacCarthy, H.R. 1954. A p h i d t r a n s m i s s i o n o f p o t a t o l e a f r o l l v i r u s . P h y t o p a t h o l o g y 44:167-174. 137 M a c G i l l i v r a y , M.E. 1972. The s e x u a l i t y o f Myzus persicae ( S u l z e r ) , t h e green peach a p h i d , i n New B r u n s w i c k (Homopter: A p h i d i d a e ) . Can. J . Z o o l . 50:469-471. M a n i a t i s , T., F r i t s c h , E.F., and Sambrook, J . 1982. M o l e c u l a r C l o n i n g : A L a b o r a t o r y Manual. New York: C o l d S p r i n g Harbor L a b o r a t o r y . Marsh, L.E., Dreher, T.W., and H a l l , T.C. 1988. M u t a t i o n a l a n a l y s i s o f t h e c o r e and mod u l a t o r sequences o f t h e BMV RNA3 subgenomic promoter. N u c l e i c A c i d s R e s e a r c h 16:981-995. M a r t i n , R.R., and D'Arcy, C.J. 1990. R e l a t i o n s h i p s among l u t e o v i r u s e s based on n u c l e i c a c i d h y b r i d i z a t i o n and s e r o l o g i c a l s t u d i e s . I n t e r v i r o l o g y 31:23-30. M a r t i n , R.R., Keese, P.K., Young, M.J., Waterhouse, P.M., and G e r l a c h , W.L. 1990. E v o l u t i o n and m o l e c u l a r b i o l o g y o f l u t e o v i r u s e s . Annu. Rev. P h y t o p a t h o l . 28:341-363. M a r t i n , R.R., and S t a c e - S m i t h , R. 1984. P r o d u c t i o n and c h a r a c t e r i z a t i o n o f monoclonal a n t i b o d i e s s p e c i f i c t o p o t a t o l e a f r o l l v i r u s . Can. J . P l a n t P a t h o l . 6:206-210. M a s s a l s k i , P.R., and H a r r i s o n , B.D. 1987. P r o p e r t i e s o f mo n o c l o n a l a n t i b o d i e s t o p o t a t o l e a f r o l l l u t e o v i r u s and t h e i r use t o d i s t i n g u i s h v i r u s i s o l a t e s d i f f e r i n g i n a p h i d t r a n s m i s s i b i l i t y . J . Gen V i r o l . 68:1813-1821. Mayo, M.A., and B a r k e r , H. 1984. T r a n s l a t i o n p r o d u c t s and RNA s p e c i e s o f p o t a t o l e a f r o l l v i r u s (PLRV). Rep. S c o t t . Crop Res. I n s t . 1983, p.187. Mayo, M.A., B a r k e r , H., Robinson, D.J., Tamada, T., and H a r r i s o n , B.D. 1982. E v i d e n c e t h a t p o t a t o l e a f r o l l v i r u s RNA i s p o s i t i v e -s t r a n d e d , i s l i n k e d t o a s m a l l p r o t e i n and does not c o n t a i n p o l y a d e n y l a t e . J . Gen. V i r o l . 59:163-167. Mayo, M.A., Robinson, D.J., J o l l y , C.A., and Hyman, L. 1989. N u c l e o t i d e sequence o f p o t a t o l e a f r o l l l u t e o v i r u s RNA. J . Gen. V i r o l . 70:1037-1051. McKinney, H.H. 1929.. M o s a i c d i s e a s e s i n t h e Canary I s l a n d s , West A f r i c a , and G i b r a l t a r . J . A g r i c . Res. 39:557-578. Meyer, T.F., Mlawer, N., and So, M. 1982. P i l u s e x p r e s s i o n i n N e i s s e r i a gonorrhoeae i n v o l v e s chromosomal rearrangement. C e l l 30:45-52. M i l l e r , W.A., Dreher, T.W., and H a l l , T.C. 1985. S y n t h e s i s o f brome mosaic v i r u s subgenomic RNA in vitro by i n t e r n a l i n i t i a t i o n on (-)-sense genomic RNA. N a t u r e 313:68-70. 138 M i l l e r , W.A., Waterhouse, P.M., and Gerlach, W.L. 1988a. Sequence and organization of barley yellow dwarf virus genomic RNA. Nucleic Acids Res. 16:6097-6111. M i l l e r , W.A., Waterhouse, P.M., Kortt, A.A., and Gerlach, W.L. 1988b. Sequence and i d e n t i f i c a t i o n of the barley yellow dwarf virus coat protein gene. Virology 165:306-309. Morrison, D.A. 1979. Transformation and preservation of competent b a c t e r i a l c e l l s by freezing. Methods i n Enzymol. 68:326-331. Murashige, T., and Skoog, F. 1962. A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol. Plant. 14:473-497. Murphy, J.F., D'Arcy, C.J., and Clark, J.M. 1989. Barley yellow dwarf virus RNA has a 5'-terminal genome-linked protein. J. Gen. V i r o l . 70:2253-2256. Nejidat, A., and Beachy, R.N. 1989. Decreased l e v e l s of TMV coat protein i n transgenic tobacco plants at elevated temperatures reduce resistance to TMV i n f e c t i o n . Virology 173:531-538. Nelson, R.S., McCormick, S.M., Delannay, X., Dube, P., Layton, J., Anderson, E.J., Kaniewska, M., Proksch, R.K., Horsch, R.B., Rogers, S.G., Fraley, R.T., and Beachy, R.N. 1988. Virus tolerance, plant growth, and f i e l d performance of transgenic tomato plants expressing coat protein from tobacco mosaic v i r u s . Bio/Technology 6:403-409. Ni b l e t t , C.L., Dickson, E., Fernow, K.H., Horst, R.K., and Z a i t l i n , M. 1979. Cross protection among four v i r o i d s . Virology 91:198-203. Osbourn J.K., P l a s k i t t , K.A., Watts, J.W., and Wilson, T.M.A. 198 9a. Tobacco mosaic virus coat protein and reporter gene t r a n s c r i p t s containing the TMV origin-of-assembly sequence do not inte r a c t i n double-transgenic tobacco plants: implications for coat protein-mediated protection. Molecular Plant-Microbe Interactions. 2:340-345. Osbourn, J.K., Watts, J.W., Beachy, R.N., and Wilson, T.M.A. 198 9b. Evidence that nucleocapsid disassembly and a l a t e r step i n virus r e p l i c a t i o n are i n h i b i t e d i n transgenic tobacco protoplasts expressing TMV coat protein. Virology 172:370-373. 139 O t s u k i , Y., and Takebe, I . 1976. Double i n f e c t i o n o f i s o l a t e d t o b a c c o l e a f p r o t o p l a s t s by two s t r a i n s o f t o b a c c o mosaic. I n " B i o c h e m i s t r y and C y t o l o g y o f P l a n t - P a r a s i t e I n t e r a c t i o n " K. Tomiyama, J.M. Da l y , I . U r i t a n i , H. Oka, and S. Ou c h i , eds. Kodansha, L t d . , Tokyo, pp. 213-222. P a l i w a l , Y.C., and S i n h a , R.C. 1970. On t h e mechanism o f p e r s i s t e n c e and d i s t r i b u t i o n o f b a r l e y y e l l o w dwarf v i r u s i n an a p h i d v e c t o r . V i r o l o g y 42:668-680. P a l u k a i t i s , P., and Z a i t l i n , M. 1984. A model t o e x p l a i n t h e " c r o s s - p r o t e c t i o n " phenomenon shown by p l a n t v i r u s e s and v i r o i d s . I n " P l a n t - m i c r o b e i n t e r a c t i o n s : M o l e c u l a r and g e n e t i c p e r s p e c t i v e s . " Kosuge, T. and N e s t o r , E.W. eds. M a c m i l l a n Co., New York. pp. 420-430. P e l l e t i e r , J . , and Sonenberg, N. 1988. I n t e r n a l i n i t i a t i o n o f t r a n s l a t i o n o f e u k a r y o t i c mRNA d i r e c t e d by a sequence d e r i v e d from p o l i o v i r u s RNA. Nature 334:320-325. P e r e i r a , A.-M.N., and L i s t e r , R.M. 1989. V a r i a t i o n s i n v i r u s c o n t e n t among i n d i v i d u a l l e a v e s o f c e r e a l p l a n t s i n f e c t e d w i t h b a r l e y y e l l o w dwarf v i r u s . P h y t o p a t h o l o g y 79:1348-1352. P e t e r s , D. 1967. The p u r i f i c a t i o n o f p o t a t o l e a f r o l l v i r u s from i t s v e c t o r Myzus persicae. V i r o l o g y 31:4 6-54. Ponsen, M.B. 1970. The b i o l o g i c a l t r a n s m i s s i o n o f p o t a t o l e a f r o l l v i r u s by Myzus persicae. Neth. J . P I . P a t h . 76:234-239. Ponsen, M.B. 1977. Anatomy o f an a p h i d v e c t o r : Myzus persicae. Pages 63-82 i n : A p h i d s as V i r u s V e c t o r s . K.F. H a r r i s and K. Maramorosch, eds. Academic P r e s s , New York 559 pp. P o w e l l A b e l , P., N e l s o n , R.S., De, B., Hoffmann, N., Rogers, S.G., F r a l e y , R.T., and Beachy, R.N. 1986. Del a y o f d i s e a s e development i n t r a n s g e n i c p l a n t s t h a t e x p r e s s t h e t o b a c c o mosaic v i r u s c o a t p r o t e i n gene. S c i e n c e 232:738-743. P o w e l l , P.A., Sanders, P.R., Turner, N., F r a l e y , R.T., and Beachy, R.N. 1990. P r o t e c t i o n a g a i n s t t o b a c c o mosaic v i r u s i n f e c t i o n i n t r a n s g e n i c p l a n t s r e q u i r e s a c c u m u l a t i o n o f co a t p r o t e i n r a t h e r t h a n c o a t p r o t e i n RNA sequences. V i r o l o g y 175:124-130. P r i l l , B., M a i s s , E., C h a n s i l p a , N., and Casper, R. 1988. M o l e c u l a r c l o n i n g o f s i n g l e - s t r a n d e d RNAs o f p o t a t o l e a f r o l l v i r u s and be e t w e s t e r n y e l l o w s v i r u s . J . Gen. V i r o l . 69:2397-2402. 140 Quanjer, H.M., van der Lek, H.A.A., and O o r t w y j n - B o t j e s , J . 1916. N a t u r e , mode o f d i s s e m i n a t i o n and c o n t r o l o f phloem n e c r o s i s ( l e a f r o l l ) and r e l a t e d d i s e a s e s . Meded. R i j k s . hoog. l a n d - , t u i n - boschbouwschool 10:1-90. R e g i s t e r , J.C., and Beachy, R.N. 1988. R e s i s t a n c e t o TMV i n t r a n s g e n i c p l a n t s r e s u l t s from i n t e r f e r e n c e w i t h an e a r l y event i n i n f e c t i o n . V i r o l o g y 166:524-532. R e g i s t e r , J.C., and Beachy, R.N. 1989. E f f e c t o f p r o t e i n a g g r e g a t i o n s t a t e on c o a t p r o t e i n - m e d i a t e d p r o t e c t i o n a g a i n s t t o b a c c o mosaic v i r u s u s i n g a t r a n s i e n t p r o t o p l a s t a s s a y . V i r o l o g y 173:656-663. Reisman, D., de Zoeten, G.A. 1982. A c o v a l e n t l y l i n k e d p r o t e i n a t t h e 5'-ends o f t h e genomic RNAs o f pea e n a t i o n mosaic v i r u s . J . Gen. V i r o l . 62:187-190. Rochon, D.M., and Tremaine, J.H. 1989. Complete n u c l e o t i d e sequence o f t h e cucumber n e c r o s i s v i r u s genome. V i r o l o g y 169:251-259. Rogers, S.G., Horsch, R.B., and F r a l e y , R.T. 1986. Gene t r a n s f e r i n p l a n t s : p r o d u c t i o n o f t r a n s f o r m e d p l a n t s u s i n g T i p l a s m i d v e c t o r s . Methods Enzymol. 118:627-640. Ross, A.F. 1961. S y s t e m i c a c q u i r e d r e s i s t a n c e i n d u c e d by l o c a l i z e d v i r u s - i n f e c t i o n s i n p l a n t s . V i r o l o g y 14:340-358. Rowhani, A., and S t a c e - S m i t h , R. 1979. P u r i f i c a t i o n and c h a r a c t e r i z a t i o n o f p o t a t o l e a f r o l l v i r u s . V i r o l o g y 98:45-54. Sanger, F., N i c k l e n , S., and C o u l s o n , A.R. 1977. DNA s e q u e n c i n g w i t h c h a i n - t e r m i n a t i n g i n h i b i t o r s . P r o c . Nat. Acad. S c i e n c e s U.S.A. 74:5463-5467. S e l a , I . , and Applebaum, S.W. 1962. O c c u r r e n c e of an a n t i v i r a l f a c t o r i n v i r u s - i n f e c t e d p l a n t s . V i r o l o g y 17:543-548. Shepherd, R.J., F r a n k i , R.I.B., H i r t h , L., H o l l i n g s , M., Inouye, T., Macleod, R., P u r c i f u l l , D., S i n h a , R.C., Tremaine, J.H., V a l e n t a , V., and W etter, C. 1976. New groups o f p l a n t v i r u s e s approved by t h e I n t e r n a t i o n a l Committee on Taxonomy o f V i r u s e s . I n t e r v i r o l o g y 6:181-184. S l e a t , D.E., P l a s k i t t , K.A., and W i l s o n , T.M.A. 1988b. S e l e c t i v e e n c a p s i d a t i o n o f CAT gene t r a n s c r i p t s i n T M V - i n f e c t e d t r a n s g e n i c t o b a c c o i n h i b i t s CAT s y n t h e s i s . V i r o l o g y 165:609-612. 141 Smith, C.J.S., Watson, C.F., Ray, J . , B i r d , C.R., M o r r i s , P . C , Schuch, W., and G r i e r s o n , D. 1988. A n t i s e n s e RNA i n h i b i t i o n o f p o l y g a l a c t u r o n a s e gene e x p r e s s i o n i n t r a n s g e n i c tomatoes. N a t u r e 334:724-726. Smith, H.C 1963. I n t e r a c t i o n between i s o l a t e s o f b a r l e y y e l l o w dwarf v i r u s . New Z e a l a n d J . Agr. Res. 6:343-353. Smith, O.P., H a r r i s , K.F., T o l e r , R.W., and Summers, M.D. 1988. M o l e c u l a r c l o n i n g o f p o t a t o l e a f r o l l v i r u s complementary DNA. P h y t o p a t h o l o g y 78:1060-1066. S o u t h e r n , E.M. 1975. D e t e c t i o n o f s p e c i f i c sequences among DNA fragments s e p a r a t e d by g e l e l e c t r o p h o r e s i s . J . M o l . B i o l . 98:503-517. S t a r k , D.M., and Beachy, R.N. 1989. P r o t e c t i o n a g a i n s t p o t y v i r u s i n f e c t i o n i n t r a n s g e n i c p l a n t s : e v i d e n c e f o r b r o a d spectrum r e s i s t a n c e . B i o / T e c h n o l o g y 7:1257-1262. Stiekema, W.J., Heidekamp, F., Louwerse, J.D., Verhoeven, H.A., and D i j k h u i s , P. 1988. I n t r o d u c t i o n o f f o r e i g n genes i n t o p o t a t o c u l t i v a r s ' B i n t j e ' and ' D e s i r e e ' u s i n g an Agrobacterium tumefaciens b i n a r y v e c t o r . P l a n t C e l l Rep. 7:47-50. Stegwee, D., and Ponsen, M.B. 1958. M u l t i p l i c a t i o n o f p o t a t o l e a f r o l l v i r u s i n t h e a p h i d Mysuz persicae ( S u l z . ) . Entomol. Exp. & A p p l . 1:291-300. Takanami, Y., and Kubo, S. 1979. E n z y m e - a s s i s t e d p u r i f i c a t i o n o f two p h l o e m - l i m i t e d p l a n t v i r u s e s : t o b a c c o n e c r o t i c dwarf and p o t a t o l e a f r o l l . J . Gen. V i r o l . 44:153-159. Tamada, T., and H a r r i s o n , B.D. 1981. Q u a n t i t a t i v e s t u d i e s on t h e uptake and r e t e n t i o n o f p o t a t o l e a f r o l l v i r u s by a p h i d s i n l a b o r a t o r y and f i e l d c o n d i t i o n s . Ann. A p p l . B i o l . 98:261-276. Thomson, A.D. 1958. I n t e r f e r e n c e between p l a n t v i r u s e s . Nature (London) 181:1547-1548. Thung, T.H. 1931. Smetstof en p l a n t e n c e l by e n k e l e v i r u s z i e k t e n van de t a b a k s - p l a n t . Handel. Ned.-Ind. N a t u r w e t e n s c h . Congr., 6 t h , 1931 pp. 450-463; a b s t r . i n Rev. A p p l . M y c o l . 11:750-751 1932. T h u r i n g , R.W.J., Sanders, J.P.M., and B o r s t , P. 1975. A f r e e z e -squeeze method f o r r e c o v e r i n g l o n g DNA from agarose g e l s . A n a l y t i c a l B i o c h e m i s t r y 66:213-220. 142 Turner, N.E., O'Connell, K.M., Nelson, R.S., Sanders, P.R., Beachy, R.N., F r a l e y , R.T., and Shah, D.M. 1987. E x p r e s s i o n of a l f a l f a mosaic v i r u s coat p r o t e i n gene c o n f e r s c r o s s - p r o t e c t i o n i n t r a n s g e n i c tobacco and tomato p l a n t s . EMBO J . 6:1181-1188. V a l e n t a , V. 1959a. I n t e r f e r e n c e s t u d i e s with y e l l o w s - t y p e p l a n t v i r u s e s . I. Cross p r o t e c t i o n t e s t with European v i r u s e s . A c t a V i r o l . (Prague) 3:65-72. V a l e n t a , V. 1959b. I n t e r f e r e n c e s t u d i e s with y e l l o w s - t y p e p l a n t v i r u s e s . I I . Cross p r o t e c t i o n t e s t s with European and American v i r u s e s . A c t a . V i r o l . (Prague) 3:145-152. Van der Wilk, F., Huisman, M.J., C o r n e l i s s e n , B.J.C., Huttinga, H., and Goldbach, R. 1989. N u c l e o t i d e sequence and o r g a n i z a t i o n of p o t a t o l e a f r o l l v i r u s genomic RNA. FEBS L e t t e r s 245:51-56. Van Dun, CM.P., and B o l , J.F. 1988. Transgenic tobacco p l a n t s accumulating tobacco r a t t l e v i r u s coat p r o t e i n r e s i s t i n f e c t i o n w ith tobacco r a t t l e v i r u s and pea e a r l y browning v i r u s . V i r o l o g y 167:649-652. Van Dun, CM.P., B o l , J.F., and Van Vl o t e n - D o t i n g , L. 1987. Ex p r e s s i o n of a l f a l f a mosaic v i r u s and tobacco r a t t l e v i r u s coat p r o t e i n genes i n t r a n s g e n i c tobacco p l a n t s . V i r o l o g y 159:299-305. Van Dun, CM., Overduin, B., Van Vl o t e n - D o t i n g , L., and B o l , J.F. 1988. Transgenic tobacco e x p r e s s i n g tobacco s t r e a k v i r u s or mutated a l f a l f a mosaic v i r u s coat p r o t e i n does not c r o s s - p r o t e c t a g a i n s t a l f a l f a mosaic v i r u s i n f e c t i o n . V i r o l o g y 164:383-389. van Emden, H.F., Eastop, V.F., Hughes, R.D., and Way, M.J. 1969. The ecology of Myzus persicae. Ann. Rev. Entomol. 14:197-270. Van E t t e n , J.L., F r e e r , S.N., and McCune, B.K. 1979. Presence of a major (storage?) p r o t e i n i n dormant spores of the fungus Botryodiplodia theobromae. J . B a c t e r i o l . 138:650-652. van Loon, L . C 1976. S p e c i f i c s o l u b l e l e a f p r o t e i n s i n v i r u s -i n f e c t e d tobacco p l a n t s are not normal c o n s t i t u e n t s . J . Gen. V i r o l . 30:375-379. V e i d t , I., Lot, H., L e i s e r , M., Scheidecker, D., G u i l l e y , H., Richards, K., and Jonard, G. 1988. N u c l e o t i d e sequence of beet western yellows v i r u s RNA. N u c l e i c A c i d s Res. 16:9917-9932. Waterhouse, P.M., Gildow, F.E., and Johnstone, G.R. 1988. Lu t e o v i r u s e s group. D e s c r i p t i o n s of P l a n t V i r u s e s , No. 339. Commonw. Mycol. I n s t . , Assoc. Appl. B i o l . , Kew, Surrey, England. 143 Waterhouse, P.M., M a r t i n , R.R., and G e r l a c h , W.L. 1989. BYDV-PAV v i r i o n s c o n t a i n r e a d t h r o u g h p r o t e i n . P h y t o p a t h o l o g y ( A b s t r a c t ) 79:1215. Webb, R.E., L a r s o n , R.H., and Walker, J.C. 1952. R e l a t i o n s h i p s of p o t a t o l e a f r o l l v i r u s s t r a i n s . Res. B u l l . W i s c o n s i n Exp. St n . 178:1-38. Wenzel, G. 1971. V e r g l e i c h e n d e Untersuchung des I n t e r f e r e n z v e r h a l t e n s phtyo-pathogenes V i r e n a u f Tabak. P h y t o p a t h o l . Z. 71:147-162. W i l s o n , T.M.A. 1984a. C o t r a n s l a t i o n a l d i s a s s e m b l y o f t o b a c c o mosaic v i r u s in v i t r o . V i r o l o g y 137:255-265. W i l s o n , T.M.A. 1984b. C o t r a n s l a t i o n a l d i s a s s e m b l y i n c r e a s e s t h e e f f i c i e n c y o f e x p r e s s i o n o f TMV RNA i n wheat germ c e l l - f r e e e x t r a c t s . V i r o l o g y 138:353-356. W i l s o n , T.M.A. 1989. P l a n t v i r u s e s : A t o o l - b o x f o r g e n e t i c e n g i n e e r i n g and c r o p p r o t e c t i o n . B i o / E s s a y s 10:179-186. Wolf, S., Deom, CM., Beachy, R.N., and Lucas, W.J. 1989. Movement p r o t e i n o f t o b a c c o mosaic v i r u s m o d i f i e s plasmodesmatal s i z e e x c l u s i o n l i m i t . S c i e n c e 246:377-379. W r i g h t , N.S., and MacCarthy, H.R. 1963. E x p r e s s i o n and d e t e c t i o n o f l e a f r o l l v i r u s s t r a i n s i n p o t a t o . Amer. P o t a t o . J . 40:154-162. W r i g h t , N.S., MacCarthy, H.R., and Fo r b e s , A.R. 1970. E p i d e m i o l o g y o f p o t a t o l e a f r o l l v i r u s i n t h e F r a s e r R i v e r d e l t a o f B r i t i s h C olumbia. Amer. P o t a t o J . 47:1-8. Wu, S., R i n e h a r t , C.A., and Kaesberg, P. 1987. Sequence and o r g a n i z a t i o n o f s o u t h e r n bean mosaic v i r u s genomic RNA. V i r o l o g y 161:73-80. Yarwood, C.E. 1960. L o c a l i z e d a c q u i r e d r e s i s t a n c e t o t o b a c c o mosaic v i r u s . P h y t o p a t h o l o g y 50:741-744. Z a i t l i n , M. 1976. V i r a l c r o s s - p r o t e c t i o n : More u n d e r s t a n d i n g i s needed. P h y t o p a t h o l o g y 66:382-383. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0100308/manifest

Comment

Related Items