Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Variation in ATM and genetic susceptibility to non-Hodgkin lymphoma Sipahimalani, Payal 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-0656.pdf [ 7.7MB ]
Metadata
JSON: 831-1.0099901.json
JSON-LD: 831-1.0099901-ld.json
RDF/XML (Pretty): 831-1.0099901-rdf.xml
RDF/JSON: 831-1.0099901-rdf.json
Turtle: 831-1.0099901-turtle.txt
N-Triples: 831-1.0099901-rdf-ntriples.txt
Original Record: 831-1.0099901-source.json
Full Text
831-1.0099901-fulltext.txt
Citation
831-1.0099901.ris

Full Text

Variation in A T M and genetic susceptibility to non-Hodgkin lymphoma by Payal Sipahimalani B . S c . H o n s , M e m o r i a l U n i v e r s i t y , 2003  A THESIS S U B M I T T E D IN PARTIAL F U L F I L L M E N T O F THE REQUIREMENTS FOR THE DEGREE OF M a s t e r of  Science  in THE FACULTY OF GRADUATE  STUDIES  (Medical Genetics)  The University of British Columbia M a y 2006 ©  P a y a l S i p a h i m a l a n i , 2006  Abstract T h e a t a x i a t e l a n g i e c t a s i a m u t a t e d ( A T M ) gene is c r i t i c a l for t h e d e t e c t i o n  and  r e p a i r of d o u b l e s t r a n d e d b r e a k s . M u t a t i o n s i n t h i s gene cause t h e a u t o s o m a l recessive s y n d r o m e a t a x i a t e l a n g i e c t a s i a ( A T ) , a f e a t u r e of w h i c h is a h i g h r i s k of c a n c e r , p a r t i c u l a r l y l y m p h o m a . W e have u n d e r t a k e n a p o p u l a t i o n - b a s e d c a s e / c o n t r o l s t u d y t o assess t h e r o l e of g e n e t i c v a r i a t i o n i n A T M o n t h e r i s k of n o n - H o d g k i n l y m p h o m a ( N H L ) i n the general population.  T h e t e r m N H L encompasses several subtypes,  m a n y of w h i c h h a v e i n c o m m o n t h e o c c u r r e n c e of specific s o m a t i c t r a n s l o c a t i o n s that contribute to lymphomagenesis.  W e hypothesize that variants that result i n  s l i g h t l y d e c r e a s e d f u n c t i o n of A T M c o u l d r e d u c e D N A d o u b l e - s t r a n d e d b r e a k r e p a i r c a p a c i t y , c o n t r i b u t i n g t o t h e o c c u r r e n c e of t r a n s l o c a t i o n s a n d s u b s e q u e n t  lym-  phomas. T h e s t u d y p o p u l a t i o n c o n s i s t s of 798 N H L cases a n d 793 c o n t r o l s t h a t are f r e q u e n c y m a t c h e d b y r e g i o n , age, sex a n d e t h n i c i t y . G e n e t i c v a r i a t i o n i n t h e p r o m o t e r a n d a l l e x o n s of A T M w a s d e t e r m i n e d b y b i - d i r e c t i o n a l s e q u e n c i n g of t h e g e r m l i n e ( b l o o d ) D N A of 86 N H L p a t i e n t s , b o t h T a n d B - c e l l . S e q u e n c i n g r e v e a l e d 79 v a r i a n t s , 18 of w h i c h c o r r e s p o n d t o a m i n o a c i d differences.  S i x of these v a r i -  a n t s are p r e d i c t e d t o b e d e l e t e r i o u s t o p r o t e i n f u n c t i o n ; these v a r i a n t s were a l l r a r e ( 0 . 5 - 1 . 1 % ) . S e v e n of t h e 86 (8.1%) N H L p a t i e n t s were h e t e r o z y g o u s  at these l o c i .  E l e v e n v a r i a n t s were p r e s e n t a t a f r e q u e n c y of 5 % o r g r e a t e r ; these m a k e u p 10 h a p l o t y p e s . S e v e n t a g S N P s w e r e p r e d i c t e d t o s p e c i f y these 10 h a p l o t y p e s . L i n k a g e d i s e q u i l i b r i u m across t h e A T M gene is h i g h b u t n o t c o m p l e t e . S i x t a g S N P s (1 f a i l e d i n assay d e s i g n ) a n d t h e 6 p u t a t i v e l y d e l e t e r i o u s v a r i a n t s were g e n o t y p e d i n t h e e n t i r e c a s e / c o n t r o l set. D i r e c t a s s o c i a t i o n tests b a s e d o n t h e t a g S N P s a n d h a p l o t y p e - b a s e d i n d i r e c t a s s o c i a t i o n tests w e r e p e r f o r m e d .  The  s i x r a r e v a r i a n t s were also assessed. T h e r e s u l t s of t h e a s s o c i a t i o n tests i n d i c a t e t h a t c o m m o n v a r i a n t s o f A T M do not significantly c o n t r i b u t e to the overall risk of N H L i n the general p o p u l a t i o n . O u r r e s u l t s , h o w e v e r , p o i n t t o t h e p o s s i b i l i t y of a r a r e v a r i a n t - r a r e disease m o d e l where some rare, functionally deleterious variants m a y contribute to an increased r i s k of d e v e l o p m e n t o f r a r e s u b t y p e s of t h e disease.  Contents Abstract  ii  Contents  iv  L i s t of T a b l e s  vii  L i s t of F i g u r e s  viii  L i s t of A b b r e v i a t i o n s Acknowledgements  1  Introduction  ix xii  1  1.1  Non-Hodgkin lymphoma  1  1.2  Double stranded break repair  3  1.2.1  Non-homologous end joining  5  1.2.2  Homologous recombination  7  1.3  1.4  ATM  9  1.3.1  A t a x i a telangiectasia  9  1.3.2  F u n c t i o n s of A T M  11  1.3.3  G e n o m i c s t r u c t u r e of A T M  14  A s s o c i a t i o n studies  15  1.4.1  17  Linkage disequilibrium and tagSNPs  1.4.2  2  3  Materials and Methods  19  22  2.1  Cases a n d controls  22  2.2  D N A extraction . .  23  2.3  V a r i a n t detection sequencing  25  2.4  P r e d i c t i o n of h a p l o t y p e s a n d choice of t a g S N P s  26  2.5  Genotyping  26  2.6  Statistical analysis  27  Results and Discussion  29  3.1  Variant detection sequencing  29  3.2  Germline variation in A T M and comparison with literature  36  3.3  t a g S N P s e l e c t i o n for g e n o t y p i n g  40  3.4  G e n o t y p i n g results  41  3.4.1  Q u a l i t y c o n t r o l of g e n o t y p i n g d a t a  43  3.4.2  Linkage disequilibrium  45  3.5  3.6  4  S t r e n g t h s a n d weaknesses of a s s o c i a t i o n s t u d i e s  A s s o c i a t i o n tests w i t h c o m m o n v a r i a n t s  47  3.5.1  O v e r a l l a n d s u b t y p e analyses  47  3.5.2  A n a l y s i s of different e t h n i c i t i e s  56  3.5.3  A n a l y s i s of h a p l o t y p e s  59  A s s o c i a t i o n study w i t h combined rare variants  59  3.6.1  M a n t l e cell l y m p h o m a  63  3.6.2  M a r g i n a l zone l y m p h o m a  64  Conclusions  66  5  Future Work  Bibliography  Appendix A  68  70  Primers and probes  A.l  P C R primers  A.2  TaqM&n  sssays  79 79 79  Appendix B  C o r r e c t i o n for m u l t i p l e t e s t i n g  82  Appendix C  Ethics approval  86  List of Tables  T a b l e 2.1  L i s t of N H L s u b t y p e s  23  T a b l e 2.2  Case a n d control samples  24  T a b l e 3.1  V a r i a n t d e t e c t i o n s e q u e n c i n g set  30  T a b l e 3.2  V a r i a n t s identified by sequencing  34  T a b l e 3.3  S t u d y power  41  T a b l e 3.4  Haplotypes predicted using common variants  42  T a b l e 3.5  P u t a t i v e l y deleterious v a r i a n t s  43  T a b l e 3.6  O R s for c o m m o n v a r i a n t s  48  T a b l e 3.7  O R s for c o m m o n v a r i a n t s for s u b t y p e s of N H L  51  T a b l e 3.8  O R s for c o m m o n v a r i a n t s i n different e t h n i c i t i e s  57  T a b l e 3.9  O R s for h a p l o t y p e s  60  T a b l e 3.10  O R s for 6 r a r e v a r i a n t s  62  Table A . l P C R primers and conditions  80  Table A . 2  T a g M a n primers and probes  81  Table B . l  C o r r e c t i o n for m u l t i p l e t e s t i n g  83  List of Figures  F i g u r e 1.1  D o u b l e stranded break repair  F i g u r e 1.2  G e n o m i c s t r u c t u r e of A T M  16  F i g u r e 1.3  Linkage disequilibrium  18  F i g u r e 3.1  V e r i f i c a t i o n of the 3 ' U T R  32  F i g u r e 3.2  A T M variant types  37  F i g u r e 3.3  V i s u a l genotypes  38  F i g u r e 3.4  E x a m p l e TaqM&n  F i g u r e 3.5  Linkage disequilibrium plots  genotyping plot  6  44 46  List of Abbreviations acid-citrate-dextrose  ACD AT  ataxia telangiectasia  A T M  ataxia telangiectasia mutated  ATR  A T M and Rad-3-related B R C A l - a s s o c i a t e d genome surveillance complex  BASC BRCA1  breast cancer associated 1  Bloom  B L M  syndrome  C I confidence intervals DLBCL  diffuse l a r g e B c e l l l y m p h o m a  DNA-PKcs DSB  double stranded breaks  EDTA  ethylene diamine tetra-acetic acid  expectation maximization  E M  follicular s m a l l cell cleaved  FCL FDR FL  D N A - d e p e n d e n t protein kinase catalytic subunit  false d i s c o v e r y r a t e  follicular large cell l y m p h o m a  F M  follicular mixed l y m p h o m a  H R  homologous recombination  lymphoma  Hardy-Weinberg equilibrium  H W E LD  linkage d i s e q u i l i b r i u m lymphoplasmacytic  LPL  lymphoma  m i n o r allele frequency  M A F  l o w g r a d e B c e l l of m u c o s a a s s o c i a t e d l y m p h o i d t i s s u e  MALT  mantle cell l y m p h o m a  M C L  m e d i a t o r of D N A d a m a g e c h e c k p o i n t 1  MDC1  m i n i m u m detectable odds ratio  M D O R  mycosis  M F  fungoides  M i s c B C L miscellaneous B cell l y m p h o m a M i s c T C L miscellaneous T cell l y m p h o m a m a r g i n a l zone l y m p h o m a  MZL  non-homologous end joining  NHEJ  non-Hodgkin lymphoma  NHL OR  odds ratio  ORF  open reading frame  PCR  polymerase chain reactions  PIKK  p h o s p h a t i d y l i n o s i t o l 3 - O H kinase - like kinase  PTCL  peripheral T cell l y m p h o m a  S L L small lymphocytic  single nucleotide p o l y m o r p h i s m  SNP  tagSNP TE  lymphoma  haplotype tagging S N P  tris-EDTA  TERT U T R  t e l o m e r a s e reverse t r a n s c r i p t a s e untranslated region  holoenzyme  W R N  W e r n e r s y n d r o m e gene  5 3 B P 1 p53-binding protein  Acknowledgements I ' d like to acknowledge  the i n v a l u a b l e c o n t r i b u t i o n of m y supervisor, D r .  Angela  B r o o k s - W i l s o n . Y o u r p a t i e n c e a n d u n b r i d l e d e n t h u s i a s m w e r e a c o n s t a n t s o u r c e of i n s p i r a t i o n . T h i s s t u d y could not have happened w i t h o u t D r . J o h n Spinelli a n d A m y M a c A r t h u r . I ' d also l i k e t o t h a n k S t e p h e n L e a c h , for t e a c h i n g m e e v e r y t h i n g t h a t I n e e d e d t o k n o w i n t h e l a b , a n d K a r e n N o v i k for t i r e l e s s l y a n s w e r i n g a l l m y endless q u e s t i o n s a n d for b e i n g a f r i e n d . I ' d l i k e t o t h a n k m y t h e s i s a d v i s o r y Dr.  committee,  C a r o l y n B r o w n , D r . E l i z a b e t h S i m p s o n a n d D r . D i x i e M a g e r , for s c a r i n g m e  j u s t enough to keep me o n t r a c k a n d everyone i n the C a n c e r G e n e t i c s g r o u p at the G e n o m e Sciences C e n t r e , for m a k i n g i t s u c h a f u n p l a c e t o be. O n a p e r s o n a l note, I c o u l d not have done this w i t h o u t the s u p p o r t of m y p a r e n t s , w h o f i n d a w a y t o m a k e m e feel l o v e d , e v e n f r o m t h o u s a n d s of m i l e s away. A n d R i c h a r d , w h o gets t h e l i o n ' s s h a r e o f t h e c r e d i t . T h a n k y o u for y o u r p a t i e n c e and encouragement,  a n d for f i n d i n g w a y s t o m a k e m e l a u g h , w h e n I n e e d i t m o s t .  PAYAL  The May  University 2006  of British  Columbia  SIPAHIMALANI  1  Introduction 1.1  Non-Hodgkin lymphoma  N o n - H o d g k i n l y m p h o m a ( N H L ) is a s o l i d t u m o u r of l y m p h o i d o r i g i n . It is n o w the f o u r t h m o s t c o m m o n cause of cancer d e a t h i n the U n i t e d S t a t e s [64] a n d the seventh m o s t c o m m o n cause of d e a t h w o r l d w i d e [52]. T h e i n c i d e n c e a n d m o r t a l i t y rates of N H L have been i n c r e a s i n g over t h e last t h r e e decades, a n d N H L is c u r r e n t l y t h e f o u r t h m o s t c o m m o n f o r m of m a l i g n a n c y i n C a n a d a [50]. T h e reasons for t h i s are p o o r l y u n d e r s t o o d a n d w h i l e changes i n lifestyle or e n v i r o n m e n t a l factors are l i k e l y t o affect s u c h change, cases are l i k e l y to arise i n t h e m o s t g e n e t i c a l l y s u s c e p t i b l e f r a c t i o n of o u r p o p u l a t i o n . It is therefore i n c r e a s i n g l y i m p o r t a n t to d e t e r m i n e the genetic a n d e n v i r o n m e n t a l factors t h a t c o n t r i b u t e t o N H L . T h e t e r m n o n - H o d g k i n l y m p h o m a e n c o m p a s s e s s e v e r a l s u b t y p e s of l y m p h o p r o l i f e r a t i v e m a l i g n a n t disease. T h e s e s u b t y p e s have different c l i n i c a l a n d h i s t o l o g ical presentation. N H L can occur during childhood and throughout adulthood but its i n c i d e n c e increases w i t h age.  N H L , l i k e m o s t c a n c e r s , is a c o m p l e x g e n e t i c disease.  Though N H L fami-  lies h a v e b e e n d e s c r i b e d (see [79] for e x a m p l e ) , m o s t cases are s p o r a d i c .  Within  t h e N H L f a m i l i e s , affected r e l a t i v e s g e n e r a l l y have different t y p e s of l y m p h o p r o l i f erative malignancy, including H o d g k i n and n o n - H o d g k i n lymphomas a n d l y m p h o i d l e u k a e m i a s [10, 2 3 , 4 1 , 63]. T h e o c c u r r e n c e of different t y p e s of l y m p h o p r o l i f e r a t i v e disease w i t h i n these r a r e f a m i l i e s r a t h e r t h a n t h e s a m e N H L s u b t y p e m a y  indi-  c a t e t h e e x i s t e n c e of c o m m o n u n d e r l y i n g g e n e t i c s u s c e p t i b i l i t y f a c t o r s for l y m p h o i d cancers. L y m p h o m a f a m i l i e s , i n a d d i t i o n t o b e i n g r a r e , are o f t e n s m a l l , m a k i n g t h e m u n s u i t a b l e for p o s i t i o n a l c l o n i n g s t u d i e s a n d t o d a t e , n o l y m p h o m a genes h a v e b e e n f o u n d b y m a p p i n g i n l y m p h o i d c a n c e r f a m i l i e s . I n c o n t r a s t , c a n d i d a t e gene b a s e d a s s o c i a t i o n s t u d i e s ' u s i n g N H L cases a n d c o n t r o l s m a y i d e n t i f y s u s c e p t i b i l i t y f a c t o r s t h a t are i m p o r t a n t i n t h e d e v e l o p m e n t  of N H L . A s s o c i a t i o n s t u d i e s a l s o h a v e t h e  a d v a n t a g e t h a t t h e y are r o b u s t over a r a n g e of p e n e t r a n c e s a n d i n t h e presence  of  genetic heterogeneity, b o t h likely i n N H L . C y t o g e n e t i c a l l y , s e v e r a l N H L t u m o u r s are k n o w n t o h a v e c h a r a c t e r i s t i c c h r o m o s o m a l t r a n s l o c a t i o n s . O n e e x a m p l e of t h i s is t h e t ( 1 4 ; 1 8 ) ( q 3 2 ; q 2 1 ) t r a n s l o c a t i o n o f t e n seen i n f o l l i c u l a r l y m p h o m a . S i m i l a r l y , m a n t l e c e l l l y m p h o m a s o f t e n h a r b o u r a t(ll;14)(ql3;q32)  t r a n s l o c a t i o n . M a n y N H L s u b t y p e s are n o w c h a r a c t e r i z e d b y  t h e e x i s t e n c e of specific t r a n s l o c a t i o n s [31].  T h e occurrence  of t r a n s l o c a t i o n s i n  m a n y different c l i n i c a l s u b t y p e s of N H L seems t o p o i n t t o a c o m m o n  mechanistic  t h e m e t h a t m a y b e r e f l e c t e d i n c o m m o n g e n e t i c s u s c e p t i b i l i t y f a c t o r s t h a t a c t across different s u b t y p e s of N H L . W e h y p o t h e s i z e t h a t i t is n o t t h e presence of a specific translocation, b u t the propensity to undergo translocations t h a t m a y be shared by different c l i n i c a l s u b t y p e s of l y m p h o m a .  T h i s m a y i m p l y a n u n d e r l y i n g defect i n  t h e c e l l u l a r m e c h a n i s m s t h a t p r o t e c t a g a i n s t t h e o c c u r r e n c e of t r a n s l o c a t i o n s . T h u s , genes i n v o l v e d i n D N A r e p a i r o r s u r v e i l l a n c e for d a m a g e d D N A m a y p l a y a r o l e i n N H L s u s c e p t i b i l i t y . T h i s c o u l d r e s u l t i n different c l i n i c a l s u b t y p e s of N H L a r i s i n g f r o m t h e s a m e g e r m l i n e defect t h a t r e s u l t s i n different specific t r a n s l o c a t i o n s a n d therefore heterogeneous phenotypes.  T o test t h i s h y p o t h e s i s , we w i l l c o m b i n e a l l  clinical subtypes into a single group, to be compared to the controls i n a c o m b i n e d genetic analysis i n a d d i t i o n to a n a l y z i n g the subtypes separately w h e n sample n u m bers p e r m i t .  1.2  Double stranded break repair  S e q u e n c e changes i n s o m a t i c D N A are o f t e n d e l e t e r i o u s a n d a s i n g l e a l t e r a t i o n m a y r e s u l t i n a c h a n g e i n t h e a m o u n t of p r o t e i n p r o d u c e d , o r c h a n g e a s i n g l e a m i n o a c i d , w h i c h m a y , i n t u r n , l e a d t o t h e onset of m a l i g n a n c y . T o p r o t e c t a g a i n s t t h i s , cells have s a f e g u a r d s t h a t m i n i m i z e t h e r i s k of m u t a t i o n a n d g e n o m i c i n s t a b i l i t y [37]. S e q u e n c e changes i n t h e D N A m a y be c a u s e d b y a n u m b e r of different f a c t o r s , i n c l u d i n g spontaneous c h e m i c a l changes, r e p l i c a t i o n errors or damage inflicted by e i t h e r e n d o g e n o u s o r e x o g e n o u s D N A d a m a g i n g agents s u c h as r a d i a t i o n [32].  These  D N A d a m a g i n g agents m a y cause s i n g l e o r d o u b l e s t r a n d e d b r e a k s i n t h e D N A . D o u b l e s t r a n d e d b r e a k s ( D S B s ) are h i g h l y c y t o t o x i c a n d h a v e t h e p o t e n t i a l t o cause m u t a t i o n s i n D N A as a r e s u l t of r e a r r a n g e m e n t s o r d u e t o i n t r o d u c t i o n of e r r o r s d u r i n g r e p a i r . I n r e s p o n s e t o these b r e a k s , t h e c e l l e i t h e r t r i e s t o r e p a i r t h e d a m a g e o r i n i t i a t e s p r o g r a m m e d c e l l d e a t h ( a p o p t o s i s ) i f t h e d a m a g e is e x t e n s i v e .  DSBs  d o , h o w e v e r , o c c u r n a t u r a l l y i n t h e c e l l as p a r t of t h e n o r m a l c o u r s e of m e i o s i s , t o facilitate s t r a n d exchange between homologous chromosomes.  T h e y are also f o r m e d  a n d sealed i n l y m p h o c y t e s d u r i n g V ( D ) J r e c o m b i n a t i o n to generate m a t u r e T - c e l l  r e c e p t o r a n d B - c e l l i m m u n o g l o b u l i n genes [62]. D S B s are p a r t i c u l a r l y d a n g e r o u s i f t h e y o c c u r d u r i n g t h e r e p l i c a t i o n of t h e c e l l . If b r o k e n c h r o m o s o m e s are c a r r i e d t h r o u g h m i t o s i s , t h e a c e n t r i c c h r o m o s o m e f r a g m e n t s w i l l n o t d i v i d e e v e n l y b e t w e e n t h e d a u g h t e r cells. T o p r e v e n t t h i s , t h e r e s p o n s e of t h e c e l l t o D S B s is c h a r a c t e r i z e d b y t h e a c t i v a t i o n of c e l l c y c l e c h e c k p o i n t s , w h i c h are r e g u l a t o r y m e c h a n i s m s t h a t d o n o t a l l o w t h e i n i t i a t i o n of a n e w of t h e c e l l c y c l e before t h e p r e v i o u s one is c o m p l e t e d ,  phase  or t e m p o r a r i l y arrest cell-  c y c l e p r o g r e s s i o n i n r e s p o n s e t o stress. T h i s c e l l - c y c l e a r r e s t is u s u a l l y a c c o m p a n i e d by counteractive measures to balance cellular m e t a b o l i s m .  T h u s , the occurrence  of D S B s i n t h e c e l l t r i g g e r s a n e t w o r k of s i g n a l i n g p a t h w a y s i n a c a s c a d e t h a t is o r c h e s t r a t e d p r i m a r i l y b y a s i n g l e c r i t i c a l p r o t e i n k i n a s e — A T M [62]. W h e n a D S B o c c u r s i n a c e l l , a n e l a b o r a t e p r o c e s s is set i n m o t i o n , t h a t recruits a n d activates several proteins involved i n D S B repair. T h e M R N ( M R E 1 1 R A D 5 0 - N B S 1 ) c o m p l e x p l a y s a c e n t r a l r o l e i n s e n s i n g D N A D S B s . A T M , as p a r t of t h e B R C A l - a s s o c i a t e d g e n o m e s u r v e i l l a n c e c o m p l e x ( B A S C ) also p a r t i c i p a t e s i n t h e d e t e c t i o n of D S B s . A T M is t h o u g h t t o p h o s p h o r y l a t e t h e h i s t o n e H 2 A X , p h o s p h o r y l a t e d f o r m of w h i c h is r e f e r r e d t o as yH2AX. r  the  I n addition, other proteins,  s u c h as t h e m e d i a t o r of D N A d a m a g e c h e c k p o i n t 1 ( M D C l ) a s s o c i a t e w i t h  *yH2AX  triggering conformational changes i n the higher-order c h r o m a t i n structure, w h i c h , t o g e t h e r w i t h A T M causes t h e p 5 3 - b i n d i n g p r o t e i n ( 5 3 B P 1 ) t o l o c a l i z e t o t h e D S B . O t h e r p r o t e i n s t h a t c o - l o c a l i z e t o t h e s i t e of t h e D S B i n c l u d e B R C A 1 a n d R A D 5 4 . T h e D N A e n d s are a l s o a b l e t o s t i m u l a t e a c t i v a t i o n of A T M , w h i c h i n t u r n t r i g g e r s a c a s c a d e of s i g n a l i n g p a t h w a y s t h a t p h o s p h o r y l a t e a n u m b e r of d o w n s t r e a m t a r g e t s . A T M a n d s o m e of i t s t a r g e t s are i m p o r t a n t n o t o n l y for s e n s i n g t h e b r e a k , b u t also for c e l l c y c l e r e g u l a t i o n a n d i n t h e r e p a i r p r o c e s s itself.  S o m e of these  proteins,  s u c h as t h e M R N c o m p l e x h a v e a d d i t i o n a l roles w h e r e b y t h e y f a c i l i t a t e t h e a b i l i t y of A T M t o p h o s p h o r y l a t e i t s s u b s t r a t e s [36, 74]. T h e r e are t w o m a j o r p a t h w a y s for t h e r e p a i r of D S B s i n t h e c e l l :  non-  h o m o l o g o u s e n d j o i n i n g ( N H E J ) a n d h o m o l o g o u s r e c o m b i n a t i o n ( H R ) . T h e s e processes are s u m m a r i z e d i n F i g u r e 1.1.  T h e t w o p a t h w a y s , h o w e v e r , are i n t r i c a t e l y l i n k e d  w i t h e n o u g h f l e x i b i l i t y t o a l l o w for r e d u n d a n c y a n d b a c k u p s s h o u l d one f a c t o r o r p a t h w a y fail.  1.2.1  Non-homologous  Non-homologous  end joining  e n d j o i n i n g ( N H E J ) is a p a t h w a y for t h e r e p a i r of D S B s t h a t  f u n c t i o n s at a l l stages of t h e c e l l c y c l e b u t is of p a r t i c u l a r i m p o r t a n c e i n G 0 / G 1 . I t a p p e a r s t o b e a r a t h e r i m p r e c i s e p a t h w a y a n d o f t e n a l l o w s t h e loss of n u c l e o t i d e s at t h e site of t h e D S B . T h i s is l i k e l y d u e t o t h e p r o c e s s i n g of t h e e n d s of t h e D N A t h a t c a n n o t b e l i g a t e d d i r e c t l y . T h e p r o c e s s of N H E J r e q u i r e s f o u r steps [78]:  • D e t e c t i o n of t h e D S B  • F o r m a t i o n of a m o l e c u l a r b r i d g e t o p h y s i c a l l y h o l d t h e t w o e n d s t o g e t h e r  • E n d processing to m a k e n o n - m a t c h i n g or d a m a g e d ends c o m p a t i b l e  • Ligation  T h e core N H E J m a c h i n e r y c o n s i s t s of t h e K u 7 0 / 8 0 h e t e r o d i m e r , t h e D N A d e p e n d e n t p r o t e i n k i n a s e c a t a l y t i c s u b u n i t ( D N A - P K c s ) , X R C C 4 a n d D N A ligase IV  [78].  N H E J is i n i t i a t e d b y t h e b i n d i n g of K u t o a d o u b l e s t r a n d e d D N A e n d .  K u is a h e t e r o d i m e r c o n s i s t i n g of t w o s u b u n i t s , K u 7 0 a n d K u 8 0 , w h i c h e n c i r c l e t h e DNA.  T h e b i n d i n g of K u a i d s i n t h e r e c r u i t m e n t a n d a c t i v a t i o n of  DNA-PKcs.  i XBCC4 search  f 3. DNA synthesis  jiii'iMiir,...  \  DNA (gas« i  nn  1. DNAtgas* | 2. rmatnsn  End |.:inn., DcrrafirnM lo^s of 33 m ofafwnucfcwtid**}  ^i n1 1 1 1 1 h1 1 1 1 1 i m n I Homologous rftcorabmatton ' (Error  F i g u r e 1.1: T w o p a t h w a y s o f d o u b l e s t r a n d e d b r e a k r e p a i r a r e i l l u s t r a t e d here. T h e p a n e l o n t h e r i g h t d e p i c t s n o n - h o m o l o g o u s e n d j o i n i n g , w h i l e t h a t o n t h e left s h o w s h o m o l o g o u s r e c o m b i n a t i o n . A s seen i n t h i s f i g u r e , A T M is a t t h e a p e x o f t h e signaling cascade triggered i n response t o double stranded breaks i n t h e D N A . T h i s figure h a s b e e n a d a p t e d f r o m H o e i j m a k e r s et al [32].  It is h y p o t h e s i z e d t h a t D N A - P K c s m a i n t a i n s t h e t w o D N A e n d s i n close p h y s i c a l p r o x i m i t y u n t i l t h e y are r e j o i n e d .  I t is also t h o u g h t t o r e c r u i t t h e D N A ligase  I V / X R C C 4 c o m p l e x , w h i c h is t h e f u n c t i o n a l e n z y m e m a c h i n e r y t h a t is r e s p o n s i b l e for t h e r e j o i n i n g o r l i g a t i o n of t h e t w o D N A e n d s . T h e ligase a c t i v i t y o f t h i s c o m p l e x is g r e a t l y e n h a n c e d b y i t s i n t e r a c t i o n w i t h K u [40, 78]. U n t i l r e c e n t l y , i t w a s t h o u g h t t h a t A T M w a s d i s p e n s a b l e for N H E J . T h i s w a s b e c a u s e cells d e f i c i e n t for A T M r e p a i r a m a j o r i t y of t h e i r D S B s n o r m a l l y .  Recent  a d v a n c e s i n t e c h n i q u e s for t h e d e t e c t i o n of D S B r e p a i r h a v e l e d t o t h e d i s c o v e r y t h a t these cells f a i l t o r e p a i r a p p r o x i m a t e l y 1 0 % o f t h e b r e a k s i n d u c e d b y X a n d 7 r a y s . T h i s s u b s e t of b r e a k s r e m a i n s u n r e p a i r e d e v e n after e x t e n d e d p e r i o d s o f t i m e . It has been suggested t h a t A T M a n d its substrates: A r t e m i s , H 2 A X , 5 3 B P 1 a n d the M R N c o m p l e x , are s p e c i f i c a l l y r e q u i r e d for t h e r e p a i r of these b r e a k s [40].  A r t e m i s is a  r e c e n t l y d i s c o v e r e d p r o t e i n t h o u g h t t o be one o f t h e e n z y m e s t h a t p r o c e s s e s D N A e n d s p r i o r t o l i g a t i o n a n d is r e s p o n s i b l e for r e s e c t i o n of s i n g l e - s t r a n d e d o v e r h a n g s v i a i t s e n d o n u c l e a s e a c t i v i t y [78]. T h u s , f o l l o w i n g e x p o s u r e t o i o n i z i n g r a d i a t i o n , 8 0 - 9 0 % o f t h e D S B s are r e j o i n e d u s i n g the N H E J core components:  K u , X R C C 4 a n d D N A ligase I V . T h i s  e n d - p r o c e s s i n g is fast a n d A T M - i n d e p e n d e n t .  A p p r o x i m a t e l y 1 0 % of the D S B s ,  n o r m a l l y repaired w i t h slow kinetics, require A T M a c t i v i t y ( s u m m a r i z e d b y L o b r i c h a n d J e g g o [40]).  1.2.2  Homologous  recombination  H o m o l o g o u s r e c o m b i n a t i o n ( H R ) is t h e e x c h a n g e o f D N A s e q u e n c e b e t w e e n h o m o l o gous D N A molecules. H R c a n repair D S B s by u s i n g the u n d a m a g e d sister c h r o m a t i d as a t e m p l a t e . T h e r e f o r e , H R o p e r a t e s p r i m a r i l y i n l a t e S a n d G 2 b e c a u s e o f t h e  a v a i l a b i l i t y of s i s t e r c h r o m a t i d s [33]. T h e use of a t e m p l a t e m e a n s t h a t H R g e n e r a l l y r e s u l t s i n t h e a c c u r a t e r e p a i r of t h e D S B . T h e r e p a i r of D S B s u s i n g H R r e q u i r e s t h r e e steps [81]:  • p r e - s y n a p s i s , w h i c h is t h e p r e p a r a t i o n of t h e D N A e n d  • s y n a p s i s o r t h e f o r m a t i o n of a j o i n t m o l e c u l e b e t w e e n t h e p r e p a r e d D N A e n d and a double stranded homologous template  • post-synapsis,  w h e r e t h e D N A s t r a n d is r e p a i r e d a n d c o n s e q u e n t l y t h e r e -  c o m b i n e d m o l e c u l e s are s e p a r a t e d .  H R is a s l o w p r o c e s s t h a t r e q u i r e s t h e R A D 5 2 g r o u p of p r o t e i n s c o n s i s t i n g of R A D 5 1 , R A D 5 2 , R A D 5 4 a n d t h e M R N c o m p l e x c o n s i s t i n g of M R E 1 1 , R A D 5 0 a n d N B S 1 . T h e i n i t i a l r e s p o n s e t o D S B s i n v o l v e s t h e M R N c o m p l e x , w h i c h has a f f i n i t y for D N A e n d s i n a d d i t i o n t o nuclease a c t i v i t i e s a n d t h e a b i l i t y t o m i g r a t e a l o n g D N A [75, 81]. T h i s c o m p l e x is t h o u g h t t o p l a y a p a r t i n t h e u n w i n d i n g a n d p r o c e s s i n g of t h e b r o k e n D N A s t r a n d t o e x p o s e a s i n g l e - s t r a n d o v e r h a n g o n t o w h i c h a recombinase c a n be loaded.  N B S 1 , i n p a r t i c u l a r , a p p e a r s t o b e i m p o r t a n t for  t r a n s m i t t i n g s i g n a l s f r o m t h e D N A d a m a g e sensors t o t h e M R N c o m p l e x . T h e M R N c o m p l e x also f u n c t i o n s as a b r i d g e , k e e p i n g t h e t w o D N A ends i n close p r o x i m i t y t o f a c i l i t a t e r e j o i n i n g . B R C A l a n d B R C A 2 are also i n v o l v e d a t a n e a r l y p o i n t of D S B repair. B R C A l interacts w i t h R A D 5 1 . R A D 5 1 is a r e c o m b i n a s e , w h i c h is t h e k e y p l a y e r i n H R , a n d i t m e d i a t e s h o m o l o g y r e c o g n i t i o n a n d e x c h a n g e of D N A s t r a n d s . S y n a p s i s r e q u i r e s t h a t R A D 5 1 be assembled into a nucleoprotein  filament  on the invading single-stranded D N A .  T h i s i n v o l v e s t h e c o o p e r a t i o n of s e v e r a l r e c o m b i n a t i o n m e d i a t o r s i n c l u d i n g R A D 5 2 , R A D 5 4 a n d the R A D 5 1 paralogs, R A D 5 1 B , R A D 5 1 C , R A D 5 1 D , X R C C 2 a n d X R C C 3  T h e r o l e of these m e d i a t o r s is n o t c o m p l e t e l y u n d e r s t o o d y e t . T h e y m a y , h o w e v e r , c o n t r i b u t e t o s e v e r a l a s p e c t s of s y n a p s i s , s u c h as f a c i l i t a t i n g t h e l o c a t i o n of h o m o l ogous sequences, a n d e x t e n d i n g h e t e r o d u p l e x D N A i n t h e j o i n t m o l e c u l e  [81].  O t h e r p r o t e i n s t h o u g h t t o b e i m p o r t a n t t o H R are t h o s e a s s o c i a t e d  with  B l o o m S y n d r o m e ( B L M ) a n d W e r n e r S y n d r o m e ( W R N ) . B L M is p h o s p h o r y l a t e d b y A T M a n d f o r m s f o c i w i t h R A D 5 1 after e x p o s u r e t o i o n i z i n g r a d i a t i o n . B L M is a l s o p a r t of t h e B R C A l - a s s o c i a t e d g e n o m e s u r v e i l l a n c e c o m p l e x ( B A S C ) , w h i c h acts as a sensor of D N A d a m a g e ( s u m m a r i z e d b y V a l e r i e a n d P o v i r k [74]). C o m p l e t i o n of t h e r e p a i r of a D S B v i a H R r e q u i r e s s e p a r a t i o n of t h e p r o d uct D N A molecules.  T h i s o c c u r s v i a s t r u c t u r e specific e n d o n u c l e a s e s  t h a t cleave  H o l l i d a y j u n c t i o n s , t h e D N A s t r u c t u r e s w h e r e t h e f o u r s t r a n d s of t w o d u p l e x D N A m o l e c u l e s are crossed.  T h i s m a y y i e l d e i t h e r a crossover o r a n o n - c r o s s o v e r  event.  T h e g a p s are t h e n f i l l e d i n b y a D N A p o l y m e r a s e a n d t h e b r e a k s s e a l e d b y ligase ( r e v i e w e d i n [74, 81]).  1.3 1.3.1  ATM Ataxia  telangiectasia  A t a x i a t e l a n g i e c t a s i a ( A T ) is a p r o g r e s s i v e n e u r o d e g e n e r a t i v e  disease t h a t  occurs  e a r l y i n c h i l d h o o d [24]. It is a n a u t o s o m a l recessive d i s o r d e r c a u s e d b y m u t a t i o n s i n a s i n g l e gene, a t a x i a t e l a n g i e c t a s i a m u t a t e d ( A T M ) [56].  T h e c h a r a c t e r i s t i c s of  A T i n c l u d e loss of c e r e b e l l a r f u n c t i o n , o f t e n p r e s e n t i n g as p r o g r e s s i v e s p e e c h defects a n d a t a x i c or u n c o o r d i n a t e d movements  [5, 24].  A n o t h e r s y m p t o m of t h e disease  is t h e presence of t e l a n g i e c t a s e s , o f t e n o c u l a r i.e. d i l a t e d b l o o d vessels of t h e eye. Other symptoms  i n c l u d e i m m u n e defects a n d s t e r i l i t y , r e s u l t i n g f r o m defects i n  e a r l y m e i o s i s . A t t h e c e l l u l a r l e v e l , A T is a c h r o m o s o m a l i n s t a b i l i t y s y n d r o m e , a n d is c h a r a c t e r i z e d b y a d e f e c t i v e D N A d a m a g e r e s p o n s e . T h e cells of A T p a t i e n t s are s e n s i t i v e t o i o n i z i n g r a d i a t i o n a n d o t h e r agents t h a t i n d u c e d o u b l e s t r a n d e d b r e a k s . T h e s e cells s h o w a n e l e v a t e d n u m b e r of c h r o m o s o m a l a b e r r a t i o n s i n r e s p o n s e such agents.  T h e y show decreased a b i l i t y to activate the D N A damage  network a n d defective cell cycle r e g u l a t i o n i n response to D N A damage  to  response [35].  AT  p a t i e n t s are also p r e d i s p o s e d t o m a l i g n a n c i e s , i n c l u d i n g l y m p h o m a s a n d l e u k a e m i a [30]. C a n c e r o c c u r s i n a p p r o x i m a t e l y 3 0 - 4 0 % of A T i n d i v i d u a l s a n d 1 0 - 1 5 % of A T patients develop l y m p h o i d malignancies, often i n v o l v i n g rearrangements at T - c e l l r e c e p t o r l o c i [30, 44].  I n a d d i t i o n , s o m a t i c m u t a t i o n s i n A T M h a v e b e e n seen i n  s o m e s p o r a d i c c a n c e r s , i n c l u d i n g l e u k a e m i a [9, 30]. M o u s e m o d e l s t h a t h a v e b o t h c o p i e s of A T M k n o c k e d o u t s h o w a h i g h i n c i d e n c e of l y m p h o i d t u m o u r s , w h i c h f r e q u e n t l y c o n t a i n t r a n s l o c a t i o n s at T - c e l l r e c e p tor loci. T h i s indicates that the D S B s produced d u r i n g V ( D ) J recombination might b e r e s p o n s i b l e for these c h r o m o s o m a l a b e r r a t i o n s [3, 82]. H e t e r o z y g o u s c a r r i e r s of A T M m u t a t i o n s m a y h a v e a n e l e v a t e d r i s k of c a n c e r , l a r g e l y of t h e b r e a s t , a l t h o u g h t h e r e are c o n f l i c t i n g d a t a i n t h e l i t e r a t u r e (see [11, 76] for e x a m p l e ) . T h e s e c o n f l i c t i n g d a t a m a y , i n p a r t , b e e x p l a i n e d b y t h e different t y p e s of m u t a t i o n s t h a t affect A T M . A T i n d i v i d u a l s u s u a l l y have nonsense m u t a t i o n s i n t h e A T M gene, w h i c h r e s u l t i n t r u n c a t e d , u n u s a b l e f o r m s of t h e p r o t e i n .  Thus,  c a r r i e r s of these m u t a t i o n s have d e c r e a s e d levels of f u n c t i o n a l A T M i n t h e i r cells. S o m e missense m u t a t i o n s , h o w e v e r , r e s u l t i n cells t h a t c o n t a i n b o t h f u n c t i o n a l a n d f u l l - l e n g t h n o n - f u n c t i o n a l v e r s i o n s of t h e A T M m o l e c u l e .  T h e i n c i d e n c e of c a n c e r  i n these cases m a y be h i g h e r b e c a u s e of a d o m i n a n t n e g a t i v e effect e x e r t e d b y t h e i n a c t i v e p r o t e i n , w h i c h m a y r e s u l t i n e v e n lower levels of f u n c t i o n a l A T M t h a n i n  t h e case of nonsense m u t a t i o n s [26, 60]. A l t h o u g h t h e r o l e of A T M i n l y m p h o m a has b e e n e s t a b l i s h e d i n t h e c o n t e x t of A T , t h e f r e q u e n c y of A T M g e r m l i n e v a r i a n t s i n s p o r a d i c l y m p h o m a p a t i e n t s has n o t b e e n d e t e r m i n e d . O u r h y p o t h e s i s is t h a t i n h e r i t e d v a r i a t i o n i n A T M is at least p a r t l y r e s p o n s i b l e for s u s c e p t i b i l i t y t o N H L at t h e p o p u l a t i o n l e v e l .  1.3.2  Functions of A T M  T h e p r o d u c t of t h e a t a x i a t e l a n g i e c t a s i a m u t a t e d ( A T M ) gene is a m e m b e r of t h e p h o s p h a t i d y l i n o s i t o l 3 - O H kinase-like kinase ( P I K K ) family. T h e A T M p r o t e i n resides p r e d o m i n a n t l y i n t h e n u c l e u s of d i v i d i n g cells. It is a s e r i n e - t h r e o n i n e p r o t e i n k i n a s e a n d p l a y s a c e n t r a l r o l e i n b o t h t h e d e t e c t i o n of a n d r e s p o n s e t o D N A d a m age, as w e l l as c e l l u l a r r e c o v e r y a n d s u r v i v a l .  T h i s i n v o l v e s t h e m e d i a t i o n of c e l l  cycle checkpoints, apoptosis and D N A repair.  T h e P I K K f a m i l y of p r o t e i n s also  i n c l u d e s A T M a n d R a d - 3 - r e l a t e d ( A T R ) a n d D N A - P K , w h i c h a l o n g w i t h A T M , are b e l i e v e d t o a c t i n l a r g e c o m p l e x e s t h a t m o n i t o r t h e g e n o m e for D N A d a m a g e .  Upon  encountering such damage, they signal to other proteins a n d coordinate the cellular r e s p o n s e . O n e s u c h d a m a g e s e n s i n g c o m p l e x is B A S C , w h i c h i n c l u d e s A T M , B R C A l and the M R N complex, i n a d d i t i o n to others. ATM  is g e n e r a l l y t h o u g h t t o b e i m p o r t a n t for s e n s i n g d a m a g e c a u s e d  by  ionizing radiation and that induced by radiomimetic drugs.  C e l l cycle  checkpoints  C e l l cycle checkpoints prevent the cell from proceeding t h r o u g h the cell cycle i n the presence of u n - r e p a i r e d D S B s t h a t c o u l d p o t e n t i a l l y b e d a n g e r o u s .  T h e p u r p o s e of  these c h e c k p o i n t s is t o m a i n t a i n g e n o m i c i n t e g r i t y a n d t h e y are t h e r e f o r e i n v o l v e d i n  a l l stages of t h e c e l l c y c l e . A T M r e g u l a t e s t h e G l / S , i n t r a - S a n d G 2 / M c h e c k p o i n t s of t h e c e l l c y c l e .  T h u s , i t i n h i b i t s t h e c e l l c y c l e t h r o u g h t h e a c t i v a t i o n of c e l l -  cycle checkpoints i n response to D N A damage, w h i c h m a y allow t i m e to repair such l e s i o n s , b u t m a y also l e a d t o p e r m a n e n t c e l l c y c l e a r r e s t . F o r i n s t a n c e , A T M - d e p e n d e n t p h o s p h o r y l a t i o n of p 5 3 is r e q u i r e d for t h e G l c h e c k p o i n t of t h e c e l l c y c l e . phorylates p53.  A T M also p h o s p h o r y l a t e s C H K 2 , w h i c h i n t u r n p h o s -  T h i s p h o s p h o r y l a t i o n of p 5 3 s t a b i l i z e s i t , e n a b l i n g t h e a c t i v a t i o n  of a n u m b e r of p 5 3 - r e s p o n s i v e p r o t e i n s , w h i c h r e s u l t i n c e l l c y c l e a r r e s t i n G l / S o r , alternatively, apoptosis  [62].  A T M phosphorylates C H K 2 i n response to i r r a d i a t i o n d u r i n g the G 2 phase of t h e c e l l c y c l e . C H K 2 , i n t u r n , affects a m u l t i t u d e of d o w n s t r e a m t a r g e t s a n d c o n s e q u e n t l y p r e v e n t s t h e G 2 / M t r a n s i t i o n . T h e s e are j u s t e x a m p l e s of t h e c o m p l e x i t y of t h e c o n t r o l t h a t A T M e x e r t s over t h e c e l l c y c l e c h e c k p o i n t s . S i g n i f i c a n t c r o s s t a l k a n d b a c k u p mechanisms exist between A T M a n d A T R i n the G l a n d G 2 checkpoint c o n t r o l [62, 74]. P r o t e i n s s u c h as C H K 2 , B R C A l ATM,  are e x a m p l e s  S phase checkpoint.  a n d N B S 1 , w h i c h are also s u b s t r a t e s  of p r o t e i n s t h a t are i m p o r t a n t for t h e c o n t r o l of t h e C e l l s d e r i v e d f r o m A T i n d i v i d u a l s have defective  of  intra-  cell-cycle  c h e c k p o i n t s [51, 62].  Double stranded break repair A T M is p a r t i c u l a r l y i m p o r t a n t for t h e d e t e c t i o n a n d r e p a i r of d o u b l e s t r a n d e d D N A b r e a k s . I n u n d a m a g e d cells, t h e i n a c t i v e A T M p r o t e i n e x i s t s i n t h e f o r m of d i m e r s o r h i g h e r - o r d e r m u l t i m e r s . T h e p r o t e i n p h o s p h a t a s e 2 A is t h o u g h t t o b e i n v o l v e d i n m a i n t a i n i n g the protein i n m u l t i m e r i c form. I n response to i o n i z i n g r a d i a t i o n a n d  D S B s i n t h e D N A , A T M u n d e r g o e s a u t o p h o s p h o r y l a t i o n at S e r - 1 9 8 1 . T h i s d i s r u p t s the interaction between the p r o t e i n molecules a n d protein phosphatase 2 A , resulting i n the f o r m a t i o n of active m o n o m e r s t h a t subsequently i n i t i a t e a s i g n a l i n g cascade t h a t p h o s p h o r y l a t e s s e v e r a l d o w n s t r e a m s u b s t r a t e s [27, 4 0 , 62]. W h e n a c t i v a t e d , A T M c a n d i r e c t l y associate w i t h the M R N complex,  so  called because of its three p r i n c i p a l component proteins: M R E 1 1 , R A D 5 0 a n d N B S 1 [73].  T h e r e is r e c e n t e v i d e n c e for i n d e p e n d e n t f u n c t i o n s o f t h e M R N c o m p l e x  as  c o m p a r e d t o a c o m p l e x f o r m e d of j u s t M R E 1 1 a n d R A D 5 0 ( M R ) . T h e M R c o m p l e x activates A T M , w h i c h i n t u r n activates p53. I n response to the M R N complex, however, A T M a c t i v a t e s t h e c h e c k p o i n t k i n a s e C H K 2 .  T h i s i n t e r a c t i o n can, therefore,  c o n t r o l s i g n a l i n g b y a f f e c t i n g t h i s A T M s u b s t r a t e [36]. O t h e r k e y s u b s t r a t e s o f A T M i n c l u d e h i s t o n e H 2 A X , m e d i a t o r of d a m a g e c h e c k p o i n t 1 ( M D C 1 ) , p 5 3 - b i n d i n g p r o t e i n 1 ( 5 3 B P 1 ) a n d b r e a s t - c a n c e r a s s o c i a t e d 1 ( B R C A l ) . A f t e r D N A d a m a g e , these f a c t o r s are r e c r u i t e d t o t h e site of D S B s a n d i n i t i a t e a n A T M - d e p e n d e n t s i g n a l i n g c a s c a d e t h a t l e a d s t o t h e r e s o l u t i o n of t h e b r e a k t h r o u g h D N A r e p a i r , o r , i n t h e case of excessive D N A d a m a g e , c e l l d e a t h , o f t e n t h r o u g h p 5 3 - m e d i a t e d  apoptosis  [44, 62]. I n r e s p o n s e t o h i g h doses of i o n i z i n g r a d i a t i o n , A T M is c l e a v e d b y a p r o tease, g e n e r a t i n g a k i n a s e - i n a c t i v e m o l e c u l e t h a t r e t a i n s i t s D N A b i n d i n g a c t i v i t y . T h i s c l e a v e d p r o d u c t c o u l d act as a n i n h i b i t o r of D N A d a m a g e s i g n a l i n g a n d r e p a i r a n d t h u s d i r e c t t h e c e l l t o w a r d a p o p t o s i s i n s t e a d o f s u r v i v a l [74].  D a m a g e independent genomic  stability  T e l o m e r e s are n u c l e o p r o t e i n c o m p l e x e s ing identified a n d processed (TTAGGG)  n  repeats.  as D S B s .  t h a t protect chromosome ends f r o m M a m m a l i a n telomeric D N A consists  beof  Incomplete end replication by D N A polymerases results i n  t h e p r o g r e s s i v e s h o r t e n i n g of t e l o m e r e s w i t h e a c h c e l l d i v i s i o n . O n c e t e l o m e r e s c o m e c r i t i c a l l y s h o r t , these ends e l i c i t c e l l - c y c l e a r r e s t , senescence, o r t h e r e b y l i m i t i n g t h e r e p l i c a t i v e life s p a n of cells.  Chromosome  be-  apoptosis,  end-to-end  fusions  c a n also o c c u r , l e a d i n g t o g e n o m i c i n s t a b i l i t y [43]. T e l o m e r e l e n g t h c a n b e s t a b i l i z e d or increased by telomerase, a n R N A - d e p e n d e n t D N A p o l y m e r a s e t h a t contains the t e l o m e r a s e reverse t r a n s c r i p t a s e h o l o e n z y m e plate  (TERT)  a n d a n essential R N A t e m -  (TERC). I n a d d i t i o n t o i t s role i n D N A D S B r e p a i r , A T M is f u n c t i o n a l l y l i n k e d t o t h e  m a i n t e n a n c e of t e l o m e r e l e n g t h a n d i n t e g r i t y . T h i s is a p r o c e s s t h a t is c r i t i c a l t o a g i n g a n d c a n c e r . A T cells s h o w d e f e c t i v e t e l o m e r e m a i n t e n a n c e , r e s u l t i n g i n a c c e l e r a t e d t e l o m e r e s h o r t e n i n g , t h e f o r m a t i o n of c h r o m o s o m a l e n d - t o - e n d f u s i o n s a n d r e d u c e d life s p a n [45]. I n a d d i t i o n , m i c e l a c k i n g b o t h A T M a n d T e r c d i s p l a y t e l o m ere s h o r t e n i n g , i n c r e a s e d g e n o m i c i n s t a b i l i t y ; r a p i d a g i n g a n d p r e m a t u r e d e a t h [80]. T h e s e f i n d i n g s s t r o n g l y suggest a r o l e for A T M i n t e l o m e r e m a i n t e n a n c e  although  t h e p r e c i s e m e c h a n i s m for t h i s has n o t b e e n e l u c i d a t e d .  1.3.3  Genomic structure of A T M  A T M is a l a r g e gene, m a p p e d t o c h r o m o s o m e l l q 2 2 - 2 3 [25]; t h e g e n o m i c D N A s p a n s 1 5 0 k b a n d c o n t a i n s 62 c o d i n g e x o n s r e s u l t i n g i n a n m R N A of a p p r o x i m a t e l y 1 3 k b . T h e 9 . 2 k b o p e n r e a d i n g f r a m e e n c o d e s a 3 7 0 k D a p r o t e i n w i t h 3056 a m i n o  acids.  T h e A T M t r a n s c r i p t e x h i b i t s a v a r i e t y of 5' u n t r a n s l a t e d r e g i o n s ( U T R s ) f o r m e d b y a l t e r n a t i v e s p l i c i n g a n d a s i n g l e e x o n s p a n n i n g 3 . 5 k b c o n s t i t u t e s t h e 3' U T R [57]. T h e s t r u c t u r e of A T M is i l l u s t r a t e d i n F i g u r e  1.2.  T h e A T M gene shares a b i d i r e c t i o n a l p r o m o t e r w i t h E 1 4 / N P A T , a h o u s e k e e p i n g gene t h a t is e x p r e s s e d i n a l l tissues. T h e 5' e n d s of t h e 2 genes are w i t h i n  7 0 0 b p of one a n o t h e r [14].  1.4  Association studies  C a n c e r is a c o m p l e x disease t h a t is t h e r e s u l t of c o m p l e x i n t e r a c t i o n s b e t w e e n m a n y genes a n d e n v i r o n m e n t a l f a c t o r s . I t s i n h e r i t a n c e is l i k e l y t o b e , i n a v a s t m a j o r i t y of cases, p o l y g e n i c i.e. r e s u l t i n g f r o m t h e c o m b i n e d effects of m a n y genes, e a c h of w h i c h c o u l d h a v e a m o d e s t i n d i v i d u a l effect [53]. F a m i l y - b a s e d l i n k a g e s t u d i e s h a v e i d e n t i f i e d disease genes w i t h r a r e , h i g h l y p e n e t r a n t alleles. H e r e , m o s t c a r r i e r s o f a p a r t i c u l a r a l l e l e d i s p l a y t h e p h e n o t y p e . T h e s e s t u d i e s , h o w e v e r , l a c k t h e a b i l i t y t o d e t e c t alleles t h a t c o n f e r m o d e r a t e r i s k s , w h i c h are l i k e l y t o b e t h e n o r m i n c o m m o n , m u l t i - f a c t o r i a l diseases s u c h as m o s t c a n c e r s . A s s o c i a t i o n s t u d i e s are t h e m a i n a l t e r n a t i v e t o f a m i l y - b a s e d s t u d i e s . H e r e , t h e f r e q u e n c y o f a g e n e t i c v a r i a n t i n i n d i v i d u a l s w i t h disease (cases) is c o m p a r e d t o t h a t i n i n d i v i d u a l s w i t h o u t t h e disease ( c o n t r o l s ) . A l l e l i c a s s o c i a t i o n is p r e s e n t w h e n t h e g e n o t y p e f r e q u e n c y is s i g n i f i c a n t l y different i n t h e cases a n d c o n t r o l s [16, 53]. M o s t a s s o c i a t i o n s t u d i e s t o d a t e h a v e b e e n b a s e d o n c a n d i d a t e genes t h a t are s e l e c t e d u s i n g e x i s t i n g k n o w l e d g e o f t h e i r f u n c t i o n a n d p u t a t i v e r o l e i n disease. E x a m p l e s o f s u c h genes are t h o s e i n v o l v e d i n a p o p t o s i s , c e l l - c y c l e c o n t r o l , c a r c i n o g e n m e t a b o l i s m , D N A repair, or those k n o w n to be s o m a t i c a l l y altered i n cancer. B e f o r e t h e c o m p l e t i o n of t h e h u m a n g e n o m e p r o j e c t ,  association studies  were l i m i t e d b y t h e s m a l l n u m b e r o f genes w i t h k n o w n p o l y m o r p h i s m s .  In re-  cent y e a r s , t h e i d e n t i f i c a t i o n of a l a r g e n u m b e r o f s i n g l e - n u c l e o t i d e p o l y m o r p h i s m s ( S N P s ) across t h e g e n o m e h a s g r e a t l y i n c r e a s e d t h e s c o p e of a s s o c i a t i o n s t u d i e s . T h i s , i n c o m b i n a t i o n w i t h t h e d e v e l o p m e n t of c h e a p e r , h i g h - t h r o u g h p u t g e n o t y p i n g m e t h o d s , h a s l e d t o a n e x p l o s i o n i n t h e n u m b e r of a s s o c i a t i o n s t u d i e s b e i n g c a r r i e d  chrll (q22.3)  E 12| 107650000|  |15.4|  P  chrll: |  III I I  SI I 107700000|  Chromosome Bands Localized by FISH Mapping Clones 11q22.3  Chromosome Band  UCSC Known Genes (June, 05) Based on UniProt, RefSeq, and GenBank mRNA BC061584  I  illilllllll  1111 IHI 111 l i n i l i l 111 IIII IIHHHII Mi ATM ATM BC007023  Hi  M G C 3 3 9 4 8 K < < < < < < < < <t< < <  m j i M i i i n H H111111-111=  j-  i  F i g u r e 1.2: T h e g e n o m i c s t r u c t u r e of t h e a t a x i a t e l a n g i e c t a s i a m u t a t e d ( A T M ) gene i s i l l u s t r a t e d i n t h i s s c r e e n c a p t u r e f r o m t h e U C S C g e n o m e b r o w s e r [13]. I t c o n s i s t s o f 62 c o d i n g e x o n s , t w o n o n - c o d i n g e x o n s i n t h e 5 ' U T R a n d o n e n o n - c o d i n g e x o n (3.5kb) i n t h e 3 ' U T R .  o u t [53]. T h i s h a s also a l l o w e d t h e s t u d y of specific c a n d i d a t e p o l y m o r p h i s m s t o b e r e p l a c e d b y m o r e c o m p r e h e n s i v e e x a m i n a t i o n of c a n d i d a t e genes t o t r y t o d e t e r m i n e if a n y a l l e l i c v a r i a n t s of t h a t gene are a s s o c i a t e d w i t h t h e disease.  1.4.1  Linkage disequilibrium and  tagSNPs  F o r t u n a t e l y , t h e alleles of S N P s t h a t are p h y s i c a l l y close t o e a c h o t h e r i n t h e g e n o m e often t e n d to be correlated w i t h each other.  This phenomenon  is c a l l e d l i n k a g e  d i s e q u i l i b r i u m ( L D ) . It is f o r m a l l y d e f i n e d as t h e c o - o c c u r r e n c e of p a r t i c u l a r alleles at n e a r b y sites, o n t h e s a m e h a p l o t y p e , m o r e o f t e n t h a n is e x p e c t e d b y c h a n c e . a new variant occurs on a chromosome, recombination to occur.  When  e a c h g e n e r a t i o n a l l o w s a n o p p o r t u n i t y for  I n t h e a b s e n c e of r e c o m b i n a t i o n , t h e n e w v a r i a n t w i l l b e  transmitted along w i t h the particular haplotype on w h i c h it occurred. After m a n y g e n e r a t i o n s of r e c o m b i n a t i o n , t h i s v a r i a n t w i l l b e s e p a r a t e d f r o m s o m e p a r t s of i t s a n c e s t r a l h a p l o t y p e , b u t b l o c k s of l i n k a g e d i s e q u i l i b r i u m s t i l l p e r s i s t , s e p a r a t e d b y "recombination hotspots". T h u s , the variant will remain i n association w i t h marker alleles at n e a r b y l o c i [53]. T h i s p h e n o m e n o n is i l l u s t r a t e d i n F i g u r e  1.3.  T h e g e n e t i c v a r i a t i o n across a r e g i o n c a n therefore b e c a p t u r e d b y a l i m i t e d n u m b e r of t a g g i n g S N P s . T h e a b i l i t y of one S N P t o reflect o r a c t as a p r o x y for t h e g e n o t y p e of t h e o t h e r d e p e n d s o n t h e s t r e n g t h of L D b e t w e e n t h e m . T w o p a i r w i s e m e a s u r e s of L D are D ' a n d r . B o t h m e a s u r e s r a n g e f r o m 0 (no L D ) t o 1 ( ' c o m p l e t e ' 2  LD). D ' is a p a i r w i s e m e a s u r e of L D d e f i n e d s u c h t h a t t h e v a l u e of D ' is 1 i f t h e n u m b e r of h a p l o t y p e s o b s e r v e d is less t h a n t h e t h e o r e t i c a l n u m b e r of h a p l o t y p e s . T h i s is o f t e n d e s c r i b e d as ' c o m p l e t e  L D ' between the loci.  t h e o r e t i c a l n u m b e r of h a p l o t y p e s is 4.  F o r any two loci the  I f t h r e e o r fewer h a p l o t y p e s are  observed,  WM I  W/M VAAA  W//A VAAA  Y////A  VAAA  VAVA  VAAA  V////A  VA//A  WA/A  W///A  V//M  W//A  V//M  VAVA  V////A  V////A  I  F i g u r e 1.3: L i n k a g e d i s e q u i l i b r i u m ( L D ) p r o v i d e s t h e g e n e t i c b a s i s for m o s t a s s o c i a t i o n s t u d i e s . T h i s figure shows a ) T w o c o p i e s of a n a n c e s t r a l c h r o m o s o m e .  b)After a  few g e n e r a t i o n s of r e c o m b i n a t i o n , c h r o m o s o m e s c o n t a i n b l o c k s of L D w h e r e r e c o m b i n a t i o n has n o t o c c u r r e d , s e p a r a t e d b y " r e c o m b i n a t i o n h o t s p o t s . "  A r r o w s represent  areas w h e r e r e c o m b i n a t i o n has o c c u r r e d . c ) E v e n after m a n y g e n e r a t i o n s , t h i s p a t t e r n of r a n d o m r e c o m b i n a t i o n is n o t u s u a l l y o b s e r v e d , a n d b l o c k s of L D p e r s i s t . H e r e , a f u n c t i o n a l m u t a t i o n , " * " i n t h e f i g u r e , o c c u r s o n a specific h a p l o t y p e . m a n y g e n e r a t i o n s of r e c o m b i n a t i o n , i t r e m a i n s i n a s s o c i a t i o n w i t h n e a r b y l o c i .  Over  these l o c i w o u l d b e i n ' c o m p l e t e L D ' [53]. O n e d i s a d v a n t a g e of D ' is t h a t i t does n o t take i n t o account the frequency of the variants. T h u s , two loci m a y be i n 'complete L D ' b u t m a y o c c u r at s u b s t a n t i a l l y different frequencies. U n d e r these c i r c u m s t a n c e s , n e i t h e r S N P w i l l serve as a s u r r o g a t e m a r k e r for t h e o t h e r . r  2  is a p a i r w i s e m e a s u r e o f L D t h a t t a k e s i n t o a c c o u n t b o t h r e c o m b i n a t i o n  a n d a l l e l e frequencies. It r e p r e s e n t s t h e s t a t i s t i c a l c o r r e l a t i o n b e t w e e n t w o sites, a n d t a k e s t h e v a l u e o f 1 i f o n l y 2 of t h e 4 p o s s i b l e h a p l o t y p e s are p r e s e n t [53]. T h u s , a n r  2  v a l u e of 1 w o u l d i n d i c a t e t h a t k n o w i n g t h e a l l e l e at one l o c u s w o u l d a l l o w t h e  i n f e r e n c e o f t h e a l l e l e at t h e o t h e r l o c u s . T h e m o s t efficient set of m a r k e r s for a n a s s o c i a t i o n s t u d y c a n t h e r e f o r e  be  selected based o n the pairwise L D between l o c i a n d the h a p l o t y p e d i v e r s i t y observed i n the study population.  1.4.2  Strengths a n d weaknesses of association  studies  O n e of t h e p i t f a l l s of a s s o c i a t i o n s t u d i e s is t h a t m a n y o f t h e p u b l i s h e d r e p o r t s i n the literature have not been confirmed i n subsequent studies. T h i s m a y be due to e i t h e r false p o s i t i v e s i n t h e i n i t i a l r e p o r t or false n e g a t i v e s i n s u b s e q u e n t s t u d i e s . S o m e of t h e e r r o r s c o m m o n l y seen i n a s s o c i a t i o n s t u d i e s are d i s c u s s e d here.  R a n d o m error T h e m o s t c o m m o n r e a s o n for false p o s i t i v e s is r a n d o m c h a n c e .  The probability  of a t y p e I e r r o r is q u a n t i f i e d i n t e r m s of t h e l e v e l o f s t a t i s t i c a l s i g n i f i c a n c e .  For  i n s t a n c e , a p - v a l u e < 0 . 0 5 i n d i c a t e s t h a t one i n 20 p o s i t i v e a s s o c i a t i o n s w i l l b e d u e t o c h a n c e . T h e m u l t i p l e t e s t i n g i m p l i c i t i n a c a s e / c o n t r o l s t u d y e n h a n c e s t h e r i s k of a s s o c i a t i o n d u e t o c h a n c e . T h u s , w h i l e r e p e a t e d a n a l y s e s u s i n g different s u b g r o u p s  of a s t u d y p o p u l a t i o n are a v a l i d r o u t e t o g e n e r a t e h y p o t h e s e s , these  hypotheses  m u s t s u b s e q u e n t l y b e t e s t e d i n a d d i t i o n a l p a t i e n t p o p u l a t i o n s . It is i m p o r t a n t t o realise t h a t i n a p p r o p r i a t e c o r r e c t i o n for m u l t i p l e t e s t i n g i n e v i t a b l y leads t o e i t h e r increased false-positive results due to a weak correction, or decreased  statistical  p o w e r t o d e t e c t effects o w i n g t o a n o v e r l y s t r i n g e n t c o r r e c t i o n [16]. T h e a d o p t i o n of m o r e s t r i n g e n t s i g n i f i c a n c e levels (for e x a m p l e p < 1 0 ~ ) has b e e n 4  recommended  [6], i n a d d i t i o n t o n o v e l w a y s o f c a l c u l a t i n g s i g n i f i c a n c e . O n e g r o u p [77] i n t r o d u c e d t h e i d e a of a s s i g n i n g a p r i o r p r o b a b i l i t y t h a t t h e a s s o c i a t i o n b e t w e e n t h e g e n e t i c v a r i a n t a n d t h e disease is r e a l , w h i c h i n a d d i t i o n t o t h e p - v a l u e w o u l d f o r m t h e "false-positive report p r o b a b i l i t y " . O t h e r c o m m o n l y used corrections include the B o n f e r r o n i c o r r e c t i o n a n d t h e F a l s e D i s c o v e r y R a t e ( F D R ) [6]. these m e t h o d s decreases as t h e n u m b e r of tests increases.  T h e power of a l l  H o w e v e r , t h e loss of  p o w e r is less w i t h t h e F D R m e t h o d t h a n w h e n u s i n g t h e B o n f e r r o n i c o r r e c t i o n , w h i c h m a y h e l p t o a v o i d a n o v e r l y c o n s e r v a t i v e c o r r e c t i o n for t y p e I e r r o r s [6].  Population stratification O t h e r sources o f false p o s i t i v e s i n c l u d e p o p u l a t i o n s t r a t i f i c a t i o n . I f c o n t r o l s are n o t s e l e c t e d f r o m t h e s a m e p o p u l a t i o n as t h e  false p o s i t i v e m a y o c c u r as a r e s u l t  of differences i n a l l e l e frequencies b e t w e e n p o p u l a t i o n s . T h i s c a n , t o s o m e e x t e n t , b e a v o i d e d b y m a t c h i n g c o n t r o l s t o t h e cases o n p l a c e of r e s i d e n c e a n d e t h n i c i t y . O t h e r m e t h o d s , s u c h as g e n o m i c c o n t r o l , h a v e also b e e n s u g g e s t e d as a m e a n s t o a v o i d t h i s p a r t i c u l a r s o u r c e of e r r o r . I n t h i s m e t h o d , m u l t i p l e p o l y m o r p h i s m s t h r o u g h o u t t h e g e n o m e are t e s t e d t o e s t i m a t e t h e effect of c o n f o u n d i n g  [17].  S m a l l s a m p l e size F a l s e n e g a t i v e s m a y o c c u r d u e t o a l a c k of s t a t i s t i c a l p o w e r .  It is i m p o r t a n t t h a t  c a s e / c o n t r o l s t u d i e s are s u f f i c i e n t l y l a r g e to d e t e c t a s s o c i a t i o n s of r e a l i s t i c size [53].  O t h e r f a c t o r s t h a t are l i k e l y t o c o n t r i b u t e t o t h e i n c o n s i s t e n c y of a s s o c i a t i o n s t u d ies i n c l u d e o v e r - i n t e r p r e t a t i o n of m a r g i n a l f i n d i n g s i n s m a l l s a m p l e sizes a n d t h e p u b l i c a t i o n bias toward positive results. M u l t i p l e testing, multi-locus association, b a c k g r o u n d L D levels a n d l a r g e - s c a l e s t u d y d e s i g n are o t h e r f a c t o r s t h a t m a y affect t h e d e s i g n of a c a s e / c o n t r o l b a s e d a s s o c i a t i o n s t u d y .  I n t h i s s t u d y , we d e t e r m i n e d t h e e x t e n t of s e q u e n c e v a r i a t i o n i n t h e p r o m o t e r , c o d i n g a n d u n t r a n s l a t e d r e g i o n s of A T M i n 86 N H L p a t i e n t s .  W e t h e n u s e d a subset of  the S N P s thus identified, a n d m u l t i - S N P haplotypes i n genetic association  tests  i n v o l v i n g 798 cases a n d 793 c o n t r o l s t o d e t e r m i n e i f g e r m l i n e v a r i a n t s i n t h i s gene c o n f e r a n e l e v a t e d r i s k of N H L .  2 Materials and Methods T h i s s t u d y was a p p r o v e d b y t h e j o i n t C l i n i c a l R e s e a r c h a n d E t h i c s B o a r d of t h e B r i t i s h C o l u m b i a C a n c e r A g e n c y a n d t h e U n i v e r s i t y of B r i t i s h C o l u m b i a (See A p p e n d i x C ) . A l l s u b j e c t s gave w r i t t e n i n f o r m e d consent.  2.1  Cases and controls  T h e s a m p l e s were c o l l e c t e d as p a r t of a s t u d y b y D r s . Gallagher.  J o h n Spinelli and Rick  A l l N H L cases aged 20-79 d i a g n o s e d i n B r i t i s h C o l u m b i a d u r i n g t h e  p e r i o d b e t w e e n M a r c h 2000 a n d F e b r u a r y 2004 a n d r e s i d i n g i n t h e g r e a t e r V a n c o u v e r or greater V i c t o r i a m e t r o p o l i t a n areas were a s c e r t a i n e d f r o m t h e B C C a n c e r R e g i s t r y a n d i n v i t e d to p a r t i c i p a t e . H I V p o s i t i v e cases a n d those w h o were u n a b l e t o give i n f o r m e d consent were e x c l u d e d .  C o n t r o l s were o b t a i n e d f r o m t h e C l i e n t R e g i s t r y  of t h e B . C . M i n i s t r y of H e a l t h a n d were frequency m a t c h e d to cases b y age, sex a n d residence w i t h i n t h e same areas. D e t a i l e d s e l f - r e p o r t e d i n f o r m a t i o n o n t h e e t h n i c i t y of each of the four g r a n d p a r e n t s for each i n d i v i d u a l was c o l l e c t e d . S u b j e c t s p r o v i d e d a b l o o d , s a l i v a or m o u t h w a s h s a m p l e . T h e c h a r a c t e r i s t i c s of a l l cases a n d c o n t r o l s  T a b l e 2.1: T h e s u b t y p e s of N H L p r e s e n t i n t h e case g r o u p a n d t h e a b b r e v i a t i o n s u s e d for t h e m . NHL  subtype  Abbreviation  B cell N H L Diffuse large B cell l y m p h o m a  DLBCL  Follicular s m a l l cleaved  FSCL  Follicular m i x e d a n d Follicular large cell  F M and F L  M a r g i n a l zone l y m p h o m a a n d low grade  M Z L and  B cell of m u c o s a associated l y m p h o i d tissue,  MALT  M a n t l e cell l y m p h o m a  MCL  Small lymphocytic lymphoma  • SLL  Lymphoplasmacytic lymphoma  LPL  Miscellaneous B cell l y m p h o m a s  Misc B C L  T cell N H L M y c o s i s fungoides  MF  Peripheral T cell l y m p h o m a  PTCL  Miscellaneous T cell l y m p h o m a s  Misc T C L  are l i s t e d i n T a b l e 2.2.  T a b l e 2.1 l i s t s t h e s u b t y p e s o f N H L a n d t h e a b b r e v i a t i o n s  u s e d here.  2.2  D N A extraction  S u b j e c t s ' p e r i p h e r a l b l o o d s a m p l e s were c o l l e c t e d i n 4 t u b e s , 2 w i t h e t h y l e n e d i a m i n e t e t r a - a c e t i c a c i d ( E D T A ) as a n a n t i c o a g u l a n t a n d 2 w i t h a c i d - c i t r a t e - d e x t r o s e ( A C D ) . T h e A C D t u b e s were u s e d t o i s o l a t e l y m p h o c y t e s u s i n g F i c o l l - H y p a q u e . T h e s e cells were t h e n f r o z e n . T h e b u f f y c o a t l a y e r s of w h o l e b l o o d i n E D T A  tubes  were t r e a t e d w i t h P u r e g e n e R B C l y s i s s o l u t i o n ( G e n t r a S y s t e m s , M N , U S A ) a n d cell w a s h . G e n o m i c D N A was e x t r a c t e d f r o m samples u s i n g the Puregene D N A isol a t i o n k i t according to the manufacturer's instructions ( G e n t r a Systems, M N , U S A ) . D N A w a s e x t r a c t e d b y o t h e r m e m b e r s of t h e l a b o r a t o r y , i n c l u d i n g S t e p h e n L e a c h ,  T a b l e 2.2: C h a r a c t e r i s t i c s of t h e case a n d c o n t r o l s a m p l e s .  See T a b l e 2.1 for a l i s t  of abbreviations. Cases  Controls  Total  Male  464  423  887  Female  334  370  704  Total  798  793  1591  150  208  358  age r a n g e  (years)  20-49 50-59  193  169  362  60-69  215  206  421  70+  240  210  450  Caucasian  626  613  1239  Asian  80  90  170  South Asian  29  37  66  Mixed/Other  36  34  70  Unknown  27  19  46  Ethnicity  NHL  subtype  B cell N H L  722  DLBCL  193  FSCL  138  FM/FL  78  MZL/MALT  93  MCL  47  SLL/CLL  42  LPL  42  MISC B C L  89  T cell N H L  75  MF  39  PTCL  27  MISC T C L  9  MISC  1  R o z m i n J a n o o - G i l a n i , J o h a n n a Schinas, Jennifer Roger a n d Jennifer Jeyes.  2.3  Variant detection sequencing  A l l 62 c o d i n g e x o n s (9170 b p ) o f A T M , 11095 b p of i n t r o n sequence a d j a c e n t  to  c o d i n g e x o n s , 1741 b p o f 5' sequence, a n d 3663 b p of 3' u n t r a n s l a t e d r e g i o n ( U T R ) were P C R a m p l i f i e d w i t h a t o t a l of 78 p r i m e r p a i r s . T h e sequences o f a l l p r i m e r s u s e d i n t h i s s t u d y , a n d t h e i r a n n e a l i n g t e m p e r a t u r e s are s h o w n i n T a b l e A . l . E x o n s were n u m b e r e d a c c o r d i n g t o e s t a b l i s h e d c o n v e n t i o n [73].  C o d i n g exons were a m p l i f i e d  u s i n g p r i m e r s d e s i g n e d i n t h e i n t r o n i c sequences n e a r t h e e x o n b o u n d a r i e s t o a l l o w r e - s e q u e n c i n g across s p l i c e sites. T h e 3' U T R w a s a m p l i f i e d i n o v e r l a p p i n g s e g m e n t s f o l l o w i n g c o n f i r m a t i o n of t h e size of t h i s r e g i o n . P r i m e r s were s e l e c t e d f r o m t h e A T M g e n o m i c  sequence  (accession  num-  b e r B C 0 6 1 5 8 4 ) , r e t r i e v e d f r o m t h e U C S C g e n o m e b r o w s e r [13] u s i n g t h e p r o g r a m P r i m e r 3 [55]. F o r w a r d a n d reverse p r i m e r s i n c o r p o r a t e d t h e - 2 1 M 1 3 F ( T G T A A A A C G A C G G C C A G T ) or M 1 3 R ( C A G G A A A C A G C T A T G A C ) e x t e n s i o n s , r e s p e c t i v e l y , at t h e i r 5' e n d s . P o l y m e r a s e c h a i n r e a c t i o n s ( P C R ) w e r e c a r r i e d o u t i n a v o l u m e o f 20^1 c o n t a i n i n g l O n g g e n o m i c D N A t e m p l a t e , I m M MgSO^, primer, 2 m M d N T P s ,  0 . 5 / x M of each P C R  l x P f x a m p l i f i c a t i o n buffer a n d 0 . 2 5 U P l a t i n u m P f x D N A  p o l y m e r a s e ( I n v i t r o g e n , O N , C a n a d a ) . T h i r t y c y c l e s of 30s a t 9 4 ° C , 30s a t a p r i m e r p a i r specific a n n e a l i n g t e m p e r a t u r e o f 50 — 6 5 ° C a n d 1 m i n a t . 6 8 ° C , w e r e p e r f o r m e d i n p r o g r a m m a b l e t h e r m o c y c l e r s ( M J R e s e a r c h , M A , U S A ) . A 5fil a l i q u o t of e a c h P C R r e a c t i o n w a s r u n o n a 2 % agarose g e l t o c o n f i r m t h e size o f t h e P C R p r o d u c t .  The  r e m a i n i n g 15/xZ o f P C R p r o d u c t w a s p u r i f i e d u s i n g A m P u r e m a g n e t i c b e a d s ( A g e n c o u r t B i o s c i e n c e , M A , U S A ) a n d e l u t e d i n a v o l u m e o f 30/J.l of T E ( T r i s - E D T A , p H 8.0) a c c o r d i n g t o t h e m a n u f a c t u r e r ' s i n s t r u c t i o n s .  A  a l i q u o t of p u r i f i e d P C R p r o d u c t w a s t h e n c y c l e s e q u e n c e d u s i n g B i g  D y e T e r m i n a t o r M i x V 3 . 1 at l/24  th  c h e m i s t r y i n 4/iZ r e a c t i o n s ( A p p l i e d B i o s y s t e m s ,  C A , U S A ) . B o t h f o r w a r d ( - 2 1 M 1 3 F p r i m e r ) a n d reverse ( M 1 3 R p r i m e r ) d i r e c t i o n s were s e q u e n c e d . C y c l e s e q u e n c i n g r e a c t i o n s c o n s i s t e d of 50 c y c l e s of 10s at 9 6 ° C , 5s at 5 2 ° C ( - 2 1 M 1 3 F f o r w a r d p r i m e r ) o r 4 3 ° C ( M 1 3 R reverse p r i m e r ) , a n d 3 m i n a t 6 0 ° C . R e a c t i o n p r o d u c t s were p r e c i p i t a t e d w i t h i s o p r o p y l a l c o h o l a n d r e s u s p e n d e d i n 10/j.I of d o u b l e d i s t i l l e d w a t e r before l o a d i n g o n A B I 3 7 0 0 o r A B I 3 7 3 0 x l c a p i l l a r y sequencers.  S e q u e n c e r e a d s were b a s e - c a l l e d u s i n g P h r e d [18] a n d sequence  reads  a s s e m b l e d w i t h reference sequences u s i n g P h r a p [19]. S e q u e n c e r e a d s were a s s e m b l e d i n t o C o n s e d b y D i a n a P a l m q u i s t at t h e G e n o m e Sciences C e n t r e . C o n t i g s of sequence t r a c e s c o r r e s p o n d i n g t o e a c h e x o n were e x a m i n e d u s i n g P o l y P h r e d [49] for d e t e c t i o n of h e t e r o z y g o t e s a n d v i s u a l i s e d i n C o n s e d [28] t o f a c i l i t a t e v e r i f i c a t i o n of sequence v a r i a n t s b y e x a m i n a t i o n of i n d i v i d u a l t r a c e s .  2.4  Prediction of haplotypes and choice of tagSNPs  T o e s t i m a t e h a p l o t y p e s f r o m t h e sequence d a t a , I u s e d P H A S E v 2 . 0 [66, 67]. L i n k a g e d i s e q u i l i b r i u m across t h e r e g i o n w a s d e t e r m i n e d u s i n g H a p l o v i e w [4]. H a p l o t y p e t a g g i n g S N P s o r t a g S N P s were s e l e c t e d u s i n g 4 p u b l i c l y a v a i l a b l e p r o g r a m s : T a g S N P s [68], S N P t a g g e r [34], B E S T ( B e s t E n u m e r a t i o n of S N P T a g s ) [61] a n d T a g ' n ' T e l l [12].  2.5  Genotyping  Taqman  a l l e l i c d i s c r i m i n a t i o n assays were d e s i g n e d u s i n g A s s a y s - b y - D e s i g n  S i W  (Ap-  p l i e d B i o s y s t e m s , C A , U S A ) . T h e sequences of t h e p r i m e r s a n d p r o b e s are s h o w n  in Table A.2. plates.  G e n o t y p i n g r e a c t i o n s w e r e c a r r i e d o u t i n 5/zZ v o l u m e s o n 3 8 4 - w e l l  E a c h well c o n t a i n e d l O n g of d r i e d d o w n genomic D N A . T h e r e a c t i o n c o n -  t a i n e d 2.5/xZ of Ta<?man U n i v e r s a l P C R M a s t e r M i x , 0.125fxl of 4 0 x A s s a y M i x a n d 2.375fJ,l o f d i s t i l l e d w a t e r . T a g m a n a l l e l i c d i s c r i m i n a t i o n assays [39] were p e r f o r m e d u s i n g a n A B I 7 9 0 0 H T . T h i s i n v o l v e d t h e r m o c y c l i n g for 10 m i n at 9 5 ° C , f o l l o w e d b y 40 c y c l e s of 15s at 9 2 ° C t o d e n a t u r e a n d 1 m i n at 6 0 ° C t o a n n e a l a n d e x t e n d .  2.6  Statistical analysis  S t a t i s t i c a l a n a l y s e s were c a r r i e d o u t b y a n e p i d e m i o l o g i s t A m y M a c A r t h u r , u n d e r t h e d i r e c t i o n o f D r . J o h n S p i n e l l i , i n c o l l a b o r a t i o n w i t h us. A s a first s t e p , t h e g e n o t y p i n g d a t a w a s s u b j e c t e d t o tests for H a r d y - W e i n b e r g equilibrium.  T h e genotype  frequencies for e a c h c o m m o n  v a r i a n t were t e s t e d i n  t h e c o n t r o l s a m p l e s t o d e t e r m i n e i f t h e y w e r e different f r o m t h e e x p e c t e d cies ( b a s e d o n t h e m i n o r a l l e l e f r e q u e n c y ) .  frequen-  R a r e v a r i a n t s were e x c l u d e d f r o m t h i s  analysis. T h e p r i m a r y association analysis used univariate followed by m u l t i v a r i a t e l o g i s t i c r e g r e s s i o n m o d e l s t o e s t i m a t e t h e o d d s r a t i o s for d e v e l o p m e n t of N H L of each of the c o m m o n S N P s .  T h e 6 r a r e v a r i a n t s were t e s t e d as one g r o u p .  t i c r e g r e s s i o n a n a l y s i s was c a r r i e d o u t u s i n g t h e S P S S p a c k a g e [65].  Logis-  Multivariate  a n a l y s e s were a d j u s t e d for age (20-49, 5 0 - 5 9 , 6 0 - 6 9 , a n d 7 0 + y e a r g r o u p s ) , sex, p l a c e of residence (Vancouver, V i c t o r i a ) a n d e t h n i c i t y ( C a u c a s i a n , A s i a n , S o u t h A s i a n , M i x e d / O t h e r / U n k n o w n ) . W h e n t h e n u m b e r of cases w a s i n s u f f i c i e n t ( n < 5 ) , t h e r a r e h o m o z y g o t e s were c o m b i n e d w i t h t h e h e t e r o z y g o t e s for a n a l y s i s . T e s t s for t r e n d were p e r f o r m e d w h e n sufficient n u m b e r s of h o m o z y g o u s alleles w e r e p r e s e n t . W e u s e d P H A S E v 2 . 0 [66, 67] a n d H a p l o . s t a t s ( p a r t of t h e R s t a t i s t i c a l s y s t e m [59]) t o d e d u c e h a p l o t y p e s p r o b a b i l i s t i c a l l y f r o m g e n o t y p e d a t a . P H A S E uses a  B a y e s i a n m e t h o d a n d w a s u s e d t o e s t i m a t e h a p l o t y p e s for t h e s e l e c t i o n o f t a g S N P s . Haplo.stats estimates haplotypes w i t h the expectation-maximization ( E M )  algo-  r i t h m . H a p l o t y p e s were a n a l y z e d as c a t e g o r i c a l v a r i a b l e s as i f e a c h h a p l o t y p e was a specific a l l e l e o f a m u l t i - a l l e l e m a r k e r . T o c o r r e c t for m u l t i p l e t e s t i n g , t h e F a l s e D i s c o v e r y R a t e ( F D R ) p r o p o s e d b y B e n j a m i n i a n d H o c h b e r g [6] w a s u s e d .  method  T h i s compares the p-values  f r o m t h e tests for t r e n d t o a c o r r e c t e d r a n g e of s i g n i f i c a n c e v a l u e s .  3 Results and Discussion 3.1  Variant detection sequencing  F o r v a r i a n t d e t e c t i o n , I u s e d 86 case s a m p l e s to represent i n d i v i d u a l s w i t h different N H L subtypes and ethnicities.  S p o r a d i c l y m p h o m a s of B - c e l l o r i g i n o c c u r  more  f r e q u e n t l y t h a n those of T - c e l l o r i g i n . T h i s , however, is i n c o n t r a s t w i t h A T , w h e r e T - c e l l m a l i g n a n c i e s are m o r e frequent [71]. T h u s , t h e v a r i a n t d e t e c t i o n g r o u p was e n r i c h e d for T - c e l l cases.  T h e 86 s a m p l e s c o n s i s t e d of 30 cases w i t h T - c e l l b a s e d  N H L ( a l l the cases a v a i l a b l e at t h e t i m e ) a n d 56 cases w h o h a d B - c e l l t u m o u r s . F o r t h e l a t t e r , t h e y o u n g e s t i n d i v i d u a l s were selected since t h e i r disease m a y be m o r e l i k e l y t o have a genetic r a t h e r t h a n e n v i r o n m e n t a l basis. T h e s a m p l e s u s e d for v a r i a n t d e t e c t i o n s e q u e n c i n g are l i s t e d i n T a b l e 3.1. i n c l u d e d i n v a r i a n t discovery.  C o n t r o l s a m p l e s are not  T h i s s e l e c t i o n process is l i k e l y to i d e n t i f y c o m m o n  v a r i a n t s , or those o c c u r r i n g at a l o w f r e q u e n c y t h a t are s t r o n g l y a s s o c i a t e d w i t h NHL. T h e r e are c o n f l i c t i n g d a t a i n t h e l i t e r a t u r e a b o u t t h e l e n g t h of t h e 3 ' U T R of  T a b l e 3.1: C h a r a c t e r i s t i c s of t h e v a r i a n t d e t e c t i o n s e q u e n c i n g a l i s t of  set. See T a b l e 2.1 for  abbreviations. T-cell  B-cell  Total  Male  19  31  50  Female  11  25  36  Total  30  56  86  age r a n g e ( y e a r s ) 20-49  10  56  66  50-59  8  0  8  60-69  5  0  5  70+  7  0  7  Caucasian  20  35  55  Asian  4  8  12  South Asian  3  2  5  Mixed/Other  3  10  13  Unknown  0  1  1  Ethnicity  NHL  subtype  A l l B cell N H L  56  DLBCL  18  FSCL  16  FM/FL  7  MZL/MALT  4  MCL  3  SLL/CLL  1  MISC B C L  7  A l l T cell N H L  30  MF  18  PTCL  8  MISC T C L  4  A T M [57]. T h e longest r e p o r t e d 3 ' U T R s p a n s 3.5 k b . T o v e r i f y t h i s , I u s e d r a n d o m p r i m e d h u m a n c D N A previously generated by D r .  K a r e n Novik from a normal  b l o o d s a m p l e . I u s e d 5 p r i m e r p a i r s d e s i g n e d t o s p a n t h e 3.5 k b r e g i o n t h o u g h t t o c o n s t i t u t e t h e 3 ' U T R . A s c o n t r o l s t o c h e c k for g e n o m i c c o n t a m i n a t i o n , I also u s e d one p a i r of p r i m e r s d e s i g n e d across e x o n s , a n d one p a i r d e s i g n e d w i t h i n i n t r o n s . I t h e n l o o k e d for P C R p r o d u c t u s i n g e a c h of these 7 p r i m e r p a i r s i n b o t h  cDNA  a n d g e n o m i c D N A . T h e r e s u l t s f r o m t h i s e x p e r i m e n t are s h o w n i n F i g u r e 3.1  and  c o n f i r m t h a t t h e 3 ' U T R is at least 3.5 k b l o n g . T h e o v e r a l l average success r a t e for g o o d q u a l i t y sequence r e a d s i n t h e v a r i a n t d e t e c t i o n s e q u e n c i n g w a s 9 7 . 8 7 % . G o o d q u a l i t y sequences were d e n n e d as sequences t h a t c o u l d b e u n a m b i g u o u s l y s c o r e d for v a r i a n t s across t h e r e g i o n of i n t e r e s t u s i n g C o n s e d . T h e success r a t e w a s c a l c u l a t e d p e r l o c u s a n d r a n g e d b e t w e e n 8 8 . 3 7 %  (for  a n a m p l i c o n w i t h a m o n o - n u c l e o t i d e r e p e a t p r e v e n t i n g g o o d r e a d s i n one d i r e c t i o n ) a n d 1 0 0 % . T h i s w a s c a l c u l a t e d as t h e n u m b e r of s a m p l e s for w h i c h t h e r e were g o o d q u a l i t y sequence r e a d s over t h e r e g i o n o f i n t e r e s t i n at least one d i r e c t i o n . E l e v e n a m p l i c o n s h a d m o n o - n u c l e o t i d e s t r e t c h e s t h a t p r e v e n t e d g o o d q u a l i t y sequence r e a d s i n one d i r e c t i o n . F i v e a m p l i c o n s c o n t a i n e d s m a l l i n s e r t i o n s o r d e l e t i o n s t h a t o c c u r r e d i n m o r e t h a n 5 % of i n d i v i d u a l s , c a u s i n g t h e sequence r e a d s t o b e s u p e r i m p o s e d , e v e n t h o u g h t h e y were of g o o d q u a l i t y . G o o d q u a l i t y r e a d s were o b t a i n e d i n b o t h f o r w a r d a n d reverse d i r e c t i o n s for m o s t s a m p l e - a m p l i c o n c o m b i n a t i o n s . V a r i a n t d i s c o v e r y s e q u e n c i n g r e v e a l e d 79 v a r i a n t s . F o r t y - f i v e of these  (57%)  w e r e t r a n s i t i o n s , 25 (31.6%) were t r a n s v e r s i o n s , a n d 9 (11.4%) w e r e s m a l l i n s e r t i o n s or deletions.  F i f t y - t w o of t h e 79 v a r i a n t s were n o n - c o d i n g a n d t h e o t h e r 27 were  i n t h e c o d i n g r e g i o n . O f t h e c o d i n g c h a n g e s , 18 r e s u l t i n n o n - s y n o n y m o u s  changes.  O n e of these r e s u l t s i n a p r e m a t u r e s t o p c o d o n a n d five w e r e c l a s s i f i e d b y P o l y P h e n  1  Genomic DNA  F i g u r e 3.1: V e r i f i c a t i o n of t h e l e n g t h of t h e 3 ' U T R of A T M . (i) T h i s s c h e m a t i c s h o w s t h e p o s i t i o n s of t h e p r i m e r p a i r s u s e d .  P r i m e r pairs 6 a n d 7 are w i t h i n the o p e n  r e a d i n g f r a m e ( O R F ) a n d a r e n o t s h o w n here. T h e 3.5 k b t h o u g h t t o c o n s t i t u t e t h e 3 ' U T R of A T M has 2 p o l y - A s t r e t c h e s , a n d t w o A l u i n s e r t i o n s , w h i c h are i l l u s t r a t e d i n t h i s figure, (ii) I n t h i s agarose g e l , t h e p a n e l o n t h e left c o n t a i n s P C R , p r o d u c t s f r o m c D N A . L a n e s a c o n t a i n c D N A , a n d lanes b a r e n e g a t i v e c o n t r o l s . o n t h e r i g h t c o n t a i n s p o s i t i v e c o n t r o l s i.e.  T h e panel  P C R products from genomic D N A . In  b o t h p a n e l s , lanes 1 t h r o u g h 5 are P C R p r o d u c t s g e n e r a t e d u s i n g p r i m e r p a i r s 1 t h r o u g h 5 as s h o w n a b o v e . L a n e 6 c o n t a i n s P C R p r o d u c t g e n e r a t e d u s i n g p r i m e r s d e s i g n e d across t h e e x o n s , t o c o n f i r m t h a t t h e p r o d u c t is f r o m c D N A , w h i l e l a n e 7 contains P C R p r o d u c t from primers designed i n the introns, to rule out genomic contamination.  [69, 70], a p r o g r a m for p r e d i c t i o n o f t h e s e v e r i t y o f a m i n o a c i d s u b s t i t u t i o n s , as " p o s s i b l y o r p r o b a b l y d a m a g i n g " ; these v a r i a n t s w e r e a l l r a r e ( m i n o r a l l e l e f r e q u e n c y =  0.54-1.1%).  S e v e n of t h e 86 (8.1%) N H L p a t i e n t s were h e t e r o z y g o u s  at these  l o c i . T h e r e s u l t s of t h e v a r i a n t d e t e c t i o n p h a s e are s u m m a r i z e d i n T a b l e 3.2 F i g u r e 3.2.  A v i s u a l r e p r e s e n t a t i o n o f t h e g e n o t y p e s is p r e s e n t e d i n F i g u r e  and 3.3.  O f t h e 79 v a r i a n t s l i s t e d i n T a b l e 3.2, 4 9 ( 6 1 . 2 5 % ) were o b s e r v e d o n l y o n c e . T h e f r e q u e n c y of s i n g l e t o n s , v a r i a n t s o b s e r v e d o n l y once i n t h e d a t a set, is s i m i l a r t o t h a t p r e v i o u s l y i d e n t i f i e d i n A T M i n s a m p l e s f r o m u n a f f e c t e d i n d i v i d u a l s [72]. E l e v e n variants h a d a m i n o r allele frequency of 5% or greater.  T a b l e 3.2:  Variants identified by variant detection sequencing of A T M  i n the germline D N A of 86 n o n - H o d g k i n l y m p h o m a patients. V a r i ants indicated by a n * or ** indicate the deletion or insertion of 1 or 2 nucleotides, respectively. A  1  indicates changes that were  predicted to be deleterious to protein function. Variants that h a d a markedly different minor allele frequency i n our study than i n publicly available d a t a are marked by a . 2  SNP  N a m e of V a r i a n t  Nucleotide  Codon  Amino Acid  Obs minor  change  change  change  allele freq  cctcct / atcccg  T/A  N/A  N/A  aagagg/tgtggg  G/T  N/A  N/A  tggcca/gcggga  A/G  N/A  N/A  47.28%  F l a n k i n g sequence  Number 1 2 3  -5144 T / A  2  -4807 G / T -4519 A / G  2  45.60% '  0.54%  4  -4406 C / T  ttctgc/tgctgg  C/T  N/A  N/A  0.54%  5  -2541 C / T  cttcc/tgggaa  C/T  N/A  N/A  0.54%  6  -2299 A / T  tcaaa/ttaaca  A/T  N/A  N/A  3.23%  7  I V S 4 (4-36) d e l ( A A )  gaaataa/**gtgtg  del(AA)  N/A  N/A  41.48%  8  X 5 (146) C / G  agattc / gcaaac  C/G  TCC/TGC  Ser 49 C y s  0.54%  9  I V S 6 (+48) C / T  actgtc/tgcgtg  C/T  N/A  N/A  0.56%  10  X 7 (378) T / A  atggat/aacagt  T/A  GAT/GAA  A s p 126 G l u  1.10%  11  X 8 (544) G / C  aagatg/cttcat  G/C  GTT/CTT  V a l 182 L e u  0.56%  12  X 8 (657) T / C  cagtgt/cgcgag  T/C  TGT/TGC  C y s 219 C y s  1.11%  13  X 9 (735) C / T  gctgtc/taactt  C/T  GTC/GTT  V a l 245 V a l  0.57%  14  I V S 9 (+24) T / G  tgtttt/ggaatt  T/G  N/A  N/A  0.57%  15  Xll  (1176) C / G  ctaggc/gtggga  C/G  GGC/GGG  G l y 392 G l y  0.56%  16  Xll  (1229) T / C  tcttgt/cgcctt  T/C  GTG/GCG  V a l 410 A l a  17  X 1 2 (1541) G / A  tcaggg/atagtt  G/A  GGT/GAT  G l y 514 A s p  18  IVS14 ( - 5 5 ) T / G  acatat/gaaggc  T/G  N/A  N/A  3.76%  19  X 1 5 (1986) T / C  gacttt/cttaac  T/C  TTT/TTC  P h e 662 P h e  0.54%  20  X 1 5 (2119) T / C  actcat/cctgag  T/C  TCT/CCT  Ser 707 P r o  1.61%  21  I V S 1 5 (-67) T / C  tgttct/ctacaa  T/C  N/A  N/A  3.23%  0.56% 0.53%  1  22  X 1 6 (2127) T / C  gagatt/cacaaa  T/C  ATT/ATC  He 709 He  0.54%  23  X 1 6 (2220) A / G  gaagca/gtataa  A/G  GGA/GCG  A l a 740 A l a  0.54%  24  I V S 1 6 (+77) G / A  tgtttg/agaaga  G/A  N/A  N/A  1.63%  25  X 1 9 (2635) A / G  g t a c c a / gtaggt  A/G  ATA/GTA  lie 879 V a l  0.54%  I V S 1 9 (-16) G / T  aatgag/ttgett  G/T  N/A  N/A  0.54%  27  I V S 2 0 (+28)  ins(A)  ctctt*/aggatt  ins(A)  N/A  N/A  0.54%  28  I V S 2 0 (-17) d e l ( T )  tttttt/*ccctc  del(T)  N/A  N/A  0.56%  29  IVS21 (-20) T / G  gaactt/gttttt  T/G  N/A  N/A  0.56%  30  X 2 3 (3118) A / G  taagaa/gtggcc  A/G  ATG/GTG  M e t 1040 V a l  31  X 2 4 (3161) C / G  tgatcc/gttatt  C/G  CCT/CGT  P r o 1054 A r g  32  I V S 2 4 (-8) d e l ( T )  ttgctt/*gtttt  del(T)  N/A  N/A  26  C o n t i n u e d on next page  0.56% 1  1.10% 9.68%  T a b l e 3.2 — C o n t i n u e d from previous page SNP  Nucleotide  Codon  Amino Acid  Obs minor  change  change  change  allele freq  tttaaa/*tttct  dol(A)  N/A  N/A  44.02%  F l a n k i n g sequence  N a m e of V a r i a n t  Number 33  I V S 2 5 (-12) d e l ( A )  34  X 2 6 (3468) G / A  ctgacg/attgat  G/A  ACG/ACA  T h r 1156 T h r  0.54%  35  I V S 2 8 (+40) G / A  tgaatg/aatatg  G/A  N/A  N/A  0.54%  36  X 2 9 (4009) A / G  tattca/gttagt  A/G  ATT/GTT  He 1337 V a l  0.58%  37  X 3 0 (4138) C / T  cacctc/tatttt  C/T  CAT/TAT  His 1380 T y r  0.55%  38  X 3 1 (4258) C / T  ttcttc/tttgcc  C/T  CTT/TTT  L e u 1420 P h e  1.08%  39  X31 (4424) A / G  tcacta/gtatca  A/G  TAT/TGT  T y r 1475 C y s  0.54%  2  1  40  X 3 2 (4578) C / T  ataccc/tcttg  C/T  CCC/CCT  P r o 1526 P r o  41  I V S 3 3 (-20) A / G  aaagcaa/ggttac  A/G  N/A  N/A  1.63%  42  I V S 3 5 (+42) C / G  aactgc/gggatc  C/G  N/A  N/A  0.54%  3.23%  actgta*/atgttt  ins(A)  N/A  N/A  0.54%  44  I V S 3 8 (-15) G / C  gatttg/ctttgt  G/C  N/A  N/A  0.54%  45  I V S 3 8 (-8) T / C  ttgtat/cattct  T/C  N/A  N/A  2.17%  46  X 3 9 (5557) G / A  tccaag/aataca  G/A  GAT/AAT  A s p 1853 A s n  10.33%  47  X 3 9 (5630) T / C  acactt/cctcgc  T/C  TTC/TCG  48  X 4 0 (5697) C / A  cgatgc/atgttt  C/A  TGC/TGA  Cys  49  X 4 0 (5753) G / C  gagaag/cacaaa  G/C  AGA/ACA  A r g 1918 T h r  50  X 4 1 (5793) T / C  gatgct/cttctg  T/G  GCT/GCC  A l a 1931 A l a  0.54%  51  IVS41 (+71) A / G  taaaga/gtttat  A/G  N/A  N/A  1.22%  52  I V S 4 5 (-54) T / C  acatgt/catatc  T/C  N/A  N/A  1.09%  53  I V S 4 6 (-36) d e l ( T T C T )  acctcttct/****ttat  del(TTCT)  N/A  N/A  0.54%  54  I V S 4 8 (-69) i n s ( A T T )  ctttc***/attattat  ins(ATT)  N/A  N/A  55  X 5 4 (7775) C / G  aagctc/gtcagc  C/G  TCT/TGT  Ser 2592 C y s  56  I V S 5 4 (+30) G / A  cttttag/aaagtg  G/A  N/A  N/A  0.54%  57  I V S 6 2 (-55) T / C  agatat/cgttga  T/C  N/A  N/A  39.36%  43  I V S 3 5 (+82)  ins(A)  2  2  Phe 1877 Ser  0.54% 1  0.54%  1  0.54%  1899 s t o p  46.24% 1  0.54%  58  I V S 6 3 (-43) A / T  gattaa/taatgt  A/T  N/A  N/A  0.53%  59  (9200) C / G  tcattc/gagcct  C/G  N/A  N/A  0.55%  60  (9443) G / A  aggccg/aaggtg  G/A  N/A  N/A  0.54%  61  (9711) C / A  aaaaac/aagaaa  C/A  N/A  N/A  0.54%  62  (9718) T / G  gaaact/gtattt  T/G  N/A  N/A  45.16%  63  (9721) T / C  acttat/cttgga  T/C  N/A  N/A  3.76%  64  (10684) C / T  ttgctc/ttgtca  C/T  N/A  N/A  0.54%  65  (10774) T / C  cctcct / cgagta  T/C  N/A  N/A  44.68%  66  (11052) C / G  gtgttc/gtgttg  C/G  N/A  N/A  0.53%  67  (11250) C / T  attaac/taaatg  C/T  N/A  N/A  0.53%  68  (11369) C / G  ttgatc/gtcctc  C/G  N/A  N/A  0.53%  69  (11390) A / G  ccccta/gaaacc  A/G  N/A  N/A  0.53%  70  (11394) C / T  taaaac/tcaatc  C/T  N/A  N/A  0.53%  71  (11571) A / G  aggaaa/gtgcag  A/G  N/A  N/A  0.53%  72  (11777) T / C  tattct/caatca  T/C  N/A  N/A  0.56%  73  (11810) C / T  atttac/tataca  C/T  N/A  N/A  0.56%  74  (11884) i n s ( T )  ttttt*/tgtaat  ins(T)  N/A  N/A  1.11%  75  (12242) C / T  agtatc/ttaact  C/T  N/A  N/A  1.61%  76  (12306) A / G  ggtcaa/gtgaaa  A/G  N/A  N/A  1.08%  77  (12368) T / G  agttgt/ggtcca  T/G  N/A  N/A  1.05%  2  C o n t i n u e d o n next page  T a b l e 3.2 — C o n t i n u e d f r o m previous page SNP  N a m e of V a r i a n t  F l a n k i n g sequence  Number  Nucleotide  Codon  Amino Acid  Obs minor  change  change  change  allele freq  78  (12563) T / G  ggacat/gcgtaa  T/G  N/A  N/A  44.74%  79  (12583) T / C  tagtct/ctttaa  T/C  N/A  N/A  1.05%  3.2  Germline variation in A T M and comparison with literature j  I i d e n t i f i e d 52 v a r i a n t sites i n 16499 b a s e p a i r s s e q u e n c e d i n t h e n o n - c o d i n g r e g i o n s o f A T M (1 i n 317) a n d 2 7 v a r i a n t sites o f 9170 s e q u e n c e d sites i n t h e c o d i n g r e g i o n of A T M (1 i n 3 4 0 ) , w h i c h c o r r e s p o n d t o n u c l e o t i d e d i v e r s i t y v a l u e s o f 3 . 3 4 X 1 0 i n the n o n - c o d i n g regions a n d 6 . 4 5 X 1 0  - 5  - 4  i n t h e c o d i n g regions of A T M . T h e n u -  c l e o t i d e d i v e r s i t y is d e f i n e d here as t h e average n u m b e r o f n u c l e o t i d e differences o r s u b s t i t u t i o n s p e r site for a g r o u p o f D N A sequences a n d is a m e a s u r e o f t h e degree o f p o l y m o r p h i s m w i t h i n a p o p u l a t i o n [46]. O t h e r groups have recently d e t e r m i n e d t h e nucleotide v a r i a t i o n i n A T M i n a v a r i e t y o f reference s a m p l e s . T h o r s t e n s o n et al., [72] s t u d i e d 93 h u m a n s a m p l e s u s i n g denaturing high-performance liquid chromatography.  T h e y i d e n t i f i e d 88 v a r i a n t  sites i n h u m a n A T M , 17 o f w h i c h w e r e f r e q u e n t ( m i n o r a l l e l e f r e q u e n c y  >4.5%).  A l a r g e n u m b e r (12) o f these c o m m o n v a r i a n t s w e r e also o b s e r v e d i n o u r v a r i a n t d e t e c t i o n s e q u e n c i n g . T h e y i n f e r r e d h a p l o t y p e s u s i n g these 17 sites a n d f o u n d h i g h b u t i n c o m p l e t e l i n k a g e d i s e q u i l i b r i u m over m o r e t h a n 1 3 3 k b o f t h e gene.  Their  s t u d y p o p u l a t i o n i n c l u d e d i n d i v i d u a l s f r o m seven m a j o r h u m a n p o p u l a t i o n s . T h o r s t e n s o n a n d colleagues c a l c u l a t e d n u c l e o t i d e d i v e r s i t y for c o d i n g a n d n o n - c o d i n g regions. I c o m p a r e d o u r nucleotide d i v e r s i t y values to those of T h o r s t e n s o n et al., a n d f o u n d t h e r a t i o t o b e 1:1.92 i n t h e c o d i n g r e g i o n s a n d 1:1.41 i n t h e  79 variants 1 27 c o d i n g  52 n o n - c o d i n g I 6in5'UTR  25 intronic  21 in 3 ' U T R  9 synonymous  18  non-synonymous  6 deleterious  F i g u r e 3.2: A T M v a r i a n t t y p e s . A s u m m a r y o f A T M v a r i a n t s o b s e r v e d a n d t h e i r f u n c t i o n a l classes  F i g u r e 3.3: V i s u a l g e n o t y p e s .  G e n o t y p e d a t a for t h e 79 p o l y m o r p h i c sites i n A T M ,  o b t a i n e d b y r e - s e q u e n c i n g of g e r m l i n e D N A for 86 i n d i v i d u a l s .  E a c h v a r i a n t is  r e p r e s e n t e d b y a c o l u m n , a n d e a c h i n d i v i d u a l b y a r o w . T h e v a r i a n t s are a r r a n g e d i n their genomic order. B l u e squares represent the c o m m o n homozygote, red squares represent heterozygotes a n d yellow squares, the rare homozygote.  M i s s i n g d a t a are  i n d i c a t e d b y g r a y s q u a r e s . T h e 7 t a g S N P s are m a r k e d w i t h b l a c k a r r o w s . T h e one v a r i a n t t h a t f a i l e d assay d e s i g n is m a r k e d w i t h a n a s t e r i s k . T h e 6 r a r e p u t a t i v e l y d e l e t e r i o u s v a r i a n t s t h a t w e r e g e n o t y p e d are m a r k e d b y r e d a r r o w s . T h i s figure w a s g e n e r a t e d u s i n g V G 2 [47, 48].  non-coding regions.  T h e higher diversity, i n b o t h c o d i n g a n d n o n - c o d i n g regions,  f o u n d b y T h o r s t e n s o n et al., i s , i n l a r g e p a r t , e x p l a i n e d b y t h e p r e s e n c e o f A f r i c a n p o p u l a t i o n s i n t h e i r s t u d y . T h o r s t e n s o n a n d colleagues f o u n d f o u r - f o l d g r e a t e r sequence diversity i n A f r i c a n populations w h e n compared to n o n - A f r i c a n populations. W e d i d n o t s t u d y a n y i n d i v i d u a l s o f A f r i c a n e t h n i c i t y , since t h e y are  uncommon  i n t h e p o p u l a t i o n o f B r i t i s h C o l u m b i a . T h e r e s u l t s for t h e C a u c a s i a n , A s i a n a n d S o u t h A s i a n g r o u p s are c o m p a r a b l e w h e r e t h e n u m b e r a n d f r e q u e n c y o f v a r i a n t s c o u l d b e c o m p a r e d . B o t h s t u d i e s f o u n d t h a t t h e c o d i n g r e g i o n s of A T M h a v e m u c h lower nucleotide d i v e r s i t y t h a n the n o n - c o d i n g regions. T h o r s t e n s o n a n d colleagues c o m p a r e d t h e s e q u e n c e d i v e r s i t y i n t h e n o n c o d i n g r e g i o n s o f A T M t o t h a t of 14 o t h e r genes a n d f o u n d these t o b e c o m p a r a b l e .  T h i s indicates that the m u t a t i o n  r a t e a t t h e c h r o m o s o m a l r e g i o n c o n t a i n i n g A T M is n o t l o w e r t h a n t h a t of o t h e r genes, w h i c h l e a d s t o t h e l i k e l i h o o d of t h e l o w e r s e q u e n c e d i v e r s i t y i n t h e c o d i n g r e g i o n of A T M b e i n g d u e t o s e l e c t i v e p r e s s u r e for m a i n t a i n i n g t h e p r o t e i n s e q u e n c e . B o n n e n a n d colleagues  [8] s e q u e n c e d  29 n o n - c o d i n g r e g i o n s of A T M i n 5  i n d i v i d u a l s a n d i d e n t i f i e d 17 n o n - c o d i n g S N P s .  T h e y t h e n g e n o t y p e d 14 of t h o s e  v a r i a n t s i n 295 i n d i v i d u a l s a n d i n f e r r e d 22 h a p l o t y p e s . O n l y 6 o f these h a p l o t y p e s o c c u r r e d a t a f r e q u e n c y o f 5 % o r g r e a t e r . L i k e T h o r s t e n s o n et al., [72], B o n n e n et al., f o u n d h i g h L D over 1 4 2 k b i n a l l t h e p o p u l a t i o n s s t u d i e d , a n d p e r f e c t d i s e q u i l i b r i u m i n the E u r o p e a n A m e r i c a n p o p u l a t i o n .  S i n c e B o n n e n et al., i d e n t i f i e d o n l y n o n -  c o d i n g v a r i a n t s i n different r e g i o n s t h a n t h e ones we r e s e q u e n c e d , w e are u n a b l e t o c o m p a r e o u r specific v a r i a n t s w i t h t h o s e i d e n t i f i e d b y t h e m . have also observed h i g h L D at the A T M locus.  O t h e r g r o u p s [1, 38]  O u r L D findings, therefore,  c o n s i s t e n t w i t h t h e d a t a i n t h e l i t e r a t u r e (see C h a p t e r 3.4.2).  are  3.3  t a g S N P selection for genotyping  D u r i n g t h e v a r i a n t d e t e c t i o n s e q u e n c i n g o f g e r m l i n e D N A f r o m 86 N H L p a t i e n t s , 79 v a r i a n t s w e r e i d e n t i f i e d . O f these 79 v a r i a n t s , o n l y 11 h a d a m i n o r a l l e l e f r e q u e n c y o f g r e a t e r t h a n 5 % . S i n c e N H L , l i k e m o s t c a n c e r s , is a c o m p l e x disease, i t is l i k e l y t h a t m o s t g e n e t i c v a r i a t i o n a s s o c i a t e d w i t h t h e disease is w e a k or i n c o m p l e t e l y penetrant.  It is also l i k e l y n o t t h e o n l y c a n c e r v a r i a n t i n a n y p a r t i c u l a r g r o u p of  p a t i e n t s . T h u s , t h e i n c r e a s e d r i s k d u e t o a n y one s u c h v a r i a n t is e x p e c t e d t o b e l o w . T h e m i n i m u m d e t e c t a b l e o d d s r a t i o s for t h e d e t e c t i o n of g e n e t i c f a c t o r s a f f e c t i n g N H L s u s c e p t i b i l i t y d e p e n d o n t h e n u m b e r o f cases a n d c o n t r o l s . W i t h 8 0 0 cases a n d 800 c o n t r o l s , a m i n o r a l l e l e f r e q u e n c y o f 5 % a l l o w s t h e d e t e c t i o n o f a n o d d s r a t i o of 1.54 ( g i v e n 8 0 % p o w e r a n d a t w o - t a i l e d s i g n i f i c a n c e of 5%)  A s u m m a r y of t h e  m i n i m u m d e t e c t a b l e o d d s r a t i o s o b t a i n a b l e b y o u r s t u d y is p r e s e n t e d i n T a b l e  3.3.  T h e 11 v a r i a n t s t h a t h a d a m i n o r a l l e l e f r e q u e n c y o f 5 % o r m o r e were i n c l u d e d i n t h e e s t i m a t i o n o f h a p l o t y p e s u s i n g P H A S E 2.0 [66, 67]. T h e s e 11 v a r i a n t s s p a n n e d 146 k b of g e n o m i c sequence a n d w e r e i n h i g h l i n k a g e d i s e q u i l i b r i u m ( L D ) w i t h e a c h o t h e r . T e n h a p l o t y p e s w e r e i d e n t i f i e d as s h o w n i n T a b l e  3.4.  These h a p l o t y p e s were used to determine h a p l o t y p e t a g g i n g S N P s ( t a g S N P s ) . A l l t h e m e t h o d s u s e d a g r e e d o n t h e s e l e c t i o n of a m i n i m a l h a p l o t y p e t a g g i n g set c o n s i s t i n g of 7 v a r i a n t s . T h e 7 S N P s s e l e c t e d i n t h i s w a y were -5144 A / T , - 4 5 1 9 G / A , I V S 4 (+36)  d e l ( A A ) , I V S 2 4 (-8) d e l ( T ) , I V S 2 5 (-12) i n s ( A ) , X 3 9 (5557) G / A  a n d I V S 6 2 (-55)  C / T . A c o m b i n a t i o n o f d a t a f r o m a l l o f these sites a l l o w s e a c h  h a p l o t y p e ( c o n s i s t i n g of 11 v a r i a n t s ) t o b e u n i q u e l y i d e n t i f i e d . I n a d d i t i o n , 6 o f t h e 68 r a r e v a r i a n t s i d e n t i f i e d w e r e p r e d i c t e d t o b e d e l e t e r i ous t o p r o t e i n f u n c t i o n a n d w e r e g e n o t y p e d i n t h e c a s e / c o n t r o l g r o u p . T h e effect o n f u n c t i o n w a s p r e d i c t e d u s i n g P o l y P h e n [54, 6 9 , 70]. P r e d i c t i o n s m a d e b y P o l y P h e n  T a b l e 3.3: S t u d y power. T h i s t a b l e s u m m a r i z e s t h e m i n i m u m d e t e c t a b l e o d d s r a t i o ( M D O R ) for t h i s s t u d y of n o n - H o d g k i n l y m p h o m a , g i v e n 8 0 % p o w e r a n d a t w o t a i l e d s i g n i f i c a n c e of 5%. M D O R s were c a l c u l a t e d b y D r . J o h n S p i n e l l i for s a m p l e sizes of 800 cases a n d 800 c o n t r o l s , w i t h a n e q u a l n u m b e r c o n t r o l s f r e q u e n c y  matched  b y age a n d gender. Allele  frequency  in controls  MDOR  (800  a n d 800  cases  controls)  0.005  2.93  0.010  2.27  0.020  1.86  0.050  1.54  0.100  1.41  0.200  1.33  0.300  1.32  are based o n sequence a n n o t a t i o n , sequence p r e d i c t i o n , m u l t i p l e a l i g n m e n t or s t r u c t u r e , d e p e n d i n g o n the i n f o r m a t i o n a v a i l a b l e . E a c h of t h e 6 v a r i a n t s selected  was  seen i n at least one p a t i e n t s a m p l e a n d was p r e d i c t e d b y P o l y P h e n t o be e i t h e r " P o s s i b l y " or " P r o b a b l y D a m a g i n g " t o p r o t e i n f u n c t i o n . T h e s e v a r i a n t s are l i s t e d in Table  3.5.  O f t h e 13 v a r i a n t s selected for g e n o t y p i n g , o n l y one, I V S 2 5 (-12)  ins(A) ,  f a i l e d i n assay d e s i g n . T h i s was due to i t s l o c a t i o n w i t h i n a r e p e t i t i v e r e g i o n .  3.4  Genotyping results  T w e l v e v a r i a n t s were g e n o t y p e d  i n 798 cases a n d 793 c o n t r o l s .  These included 6  c o m m o n t a g S N P s a n d 6 rare v a r i a n t s t h a t were p r e d i c t e d to be deleterious to p r o t e i n function.  T a b l e 3.4: H a p l o t y p e s p r e d i c t e d u s i n g t h e 11 c o m m o n v a r i a n t s of A T M . T h e m i n o r a l l e l e frequencies ( M A F ) of t h e v a r i a n t s are l i s t e d u n d e r t h e v a r i a n t n a m e . T h e 10 e s t i m a t e d h a p l o t y p e s are n u m b e r e d H 1 - H 1 0 . T h e f r e q u e n c y at w h i c h e a c h of t h e s e v a r i a n t s w a s o b s e r v e d i n t h e v a r i a n t d e t e c t i o n s e q u e n c i n g set is l i s t e d as t h e O b s e r v e d F r e q u e n c y ( O b s F r e q ) .  Obs Freq MAF  HI H2 H3 H4 H5 H6 H7 H8 H9 H10  0.420 0.020 0.005 0.006 0.020 0.010 0.006 0.090 0.006 0.410  -5144 A/T 0.44 A A T T T T T T T T  -4519 G/A 0.46 G G G G A A A A A A  IVS4(+36) del(AA) 0.42  IVS24(-8) del(T) 0.10  IVS25(-12) ins(A) 0.42  Wt  Wt  Wt  Wt Wt wt  Del  wt  Wt Wt Wt wt  wt Del Del  Ins Ins Ins Ins Ins Ins Ins  Del Del  Wt Wt  Ins  Wt  wt  Wt  X39(5557) G/A 0.10 G G G G G A G A G G  IVS48(-69) del(ATT) 0.45  Wt Wt Wt Del Del Del Del Del Del Del  IVS62(-55) C/T 0.44 C  c T T T T T T T T  (9718) T/G 0.44 G G  (10774) C/T 0.44 C  T  T T T T T T T T  T T T T T T T  c  (12563) T/G 0.44 G G  T T T T T T T T  T a b l e 3.5: P u t a t i v e l y d e l e t e r i o u s v a r i a n t s . T h e s i x v a r i a n t s t h a t were selected for g e n o t y p i n g b a s e d o n t h e i r p u t a t i v e f u n c t i o n a l effect are l i s t e d here. SNP  name  Amino A c i d Change  Frequency in sequencing  1  X12(1541)G/A X24(3161)C/G  Gly514Asp Prol054Arg  0.53% 1.10%  X31(4424)A/G X40(5697)C/A  Tyrl475Cys  0.54%  4  Cysl899Stop  0.54%  5  X40(57573)G/C  Argl918Thr  0.54%  6  X54(7775)C/G  Ser2592Cys  0.57%  2 3  3.4.1  set  Quality control of genotyping data  G e n o t y p e calls were m a d e u s i n g the d e f a u l t c o n d i t i o n s of t h e S D S 2.2 ( A p p l i e d B i o s y s t e m s , C A , U S A ) a n d a 9 5 % q u a l i t y v a l u e cut-off. t h e o u t p u t f r o m t h e software is s h o w n i n F i g u r e 3.4.  software  A n e x a m p l e of  If a s a m p l e c a n n o t be c l e a n l y  g r o u p e d i n t o one of t h e g e n o t y p e g r o u p s , i t is c a l l e d " U n d e t e r m i n e d " . T h e r e f o r e , we d o n o t have a g e n o t y p e c a l l for these s a m p l e s . T h e o v e r a l l n o - c a l l r a t e was 3.7% a n d was s i m i l a r for cases a n d c o n t r o l s . T h i s was t h e p e r c e n t a g e of s a m p l e s t h a t h a d a n " U n d e t e r m i n e d " c a l l . A s a q u a l i t y check, we c o m p a r e d t h e g e n o t y p e i n d i v i d u a l s sequenced  a n d sequence c a l l s at these 12 l o c i for t h e 86  a n d these agreed c o m p l e t e l y .  W e also checked M e n d e l i a n  i n h e r i t a n c e of each v a r i a n t i n five t h r e e - g e n e r a t i o n C E P H f a m i l i e s ( C e n t r e d ' E t u d e d u P o l y m o r p h i s m e H u m a i n c o l l e c t i o n , C o r i e l l C e l l R e p o s i t o r i e s , N J , U S A ) t h a t were g e n o t y p e d as p a r t of t h e q u a l i t y c o n t r o l process.  N o d i s c r e p a n c i e s were f o u n d . I n  a d d i t i o n , for 235 i n d i v i d u a l s w i t h a low y i e l d of D N A f r o m t h e i r first s a m p l e , a s e c o n d s a m p l e ( b l o o d or s a l i v a ) was o b t a i n e d a n d b o t h were g e n o t y p e d .  H e r e , we  f o u n d a n average d i s c r e p a n c y r a t e of 1.9%. T h i s e r r o r r a t e is e x p e c t e d to be h i g h e r  H  MM  1  -  Homozygate  m  1  - « > I O I « >>  J  HtKM  1  I- etero rygoti  £;  ft  •  \  \  /  •  V/ l"  t  •  Noc all A  \  J/ 1  -•  •  /  •  Ho mozygote 2  *  i Negative contro  F i g u r e 3.4:  E x a m p l e TaqM&n  p l o t g e n e r a t e d b y t h e S D S 2.2 s o f t w a r e d u r i n g t h e  a n a l y s i s of t h e g e n o t y p i n g a s s a y s . T h e  fluorescence  o f o n e d y e ( V I C ) is p l o t t e d o n  the X - a x i s a n d t h a t of the other dye ( F A M ) o n the Y - a x i s .  E a c h d y e is a t t a c h e d  t o t h e p r o b e for o n e a l l e l e o f t h e v a r i a n t . T h u s , e a c h s a m p l e is g r o u p e d i n t o o n e of three clusters representing the two homozygotes a n d the heterozygotes, o n w h e t h e r o n e o r b o t h o f t h e d y e s a r e d e t e c t e d for t h a t s a m p l e .  depending  c o n f i r m t h i s , we r e p e a t e d 1600 g e n o t y p e s for t h e h i g h e r q u a l i t y D N A s a m p l e s a n d f o u n d o n l y a 0 . 0 3 % d i s c r e p a n c y r a t e . E x t r a p o l a t i n g these average e r r o r r a t e s t o t h e e n t i r e g e n o t y p e d set gives us a n average e r r o r r a t e o f 0 . 5 % ( b a s e d o n t h e p r o p o r t i o n of low a n d h i g h q u a l i t y D N A samples).  3.4.2  Linkage disequilibrium  I u s e d t h e p r o g r a m H a p l o v i e w [4] t o d e t e r m i n e t h e e x t e n t o f l i n k a g e d i s e q u i l i b r i u m ( L D ) at t h e A T M l o c u s . T h e L D w a s c a l c u l a t e d u s i n g n o t o n l y t h e i n i t i a l v a r i a n t d e t e c t i o n s e q u e n c i n g d a t a (we u s e d t h e 11 c o m m o n v a r i a n t s ) , b u t also t h e g e n o t y p i n g d a t a for t h e 6 c o m m o n v a r i a n t s . T h e 11 c o m m o n v a r i a n t s i d e n t i f i e d b y s e q u e n c i n g s p a n 1 4 6 k b . T h e 6 c o m m o n g e n o t y p e d v a r i a n t s s p a n 1 3 2 k b . T h e s e 6 v a r i a n t s were t a g S N P s a n d selected t o b e a m a x i m a l l y i n f o r m a t i v e set. T h u s , t h e y were n o t e x pected to have h i g h r  2  v a l u e s w i t h r e s p e c t t o one a n o t h e r , s i n c e a n y v a r i a n t t h a t  c o u l d serve as a p r o x y for a n o t h e r w a s d e l i b e r a t e l y e x c l u d e d f r o m t h e g e n o t y p i n g set. T h e r  2  v a l u e s f r o m t h e L D c a l c u l a t i o n s are s u m m a r i z e d i n F i g u r e 3.5.  w i s e D ' v a l u e s are n o t s h o w n , b u t r a n g e d b e t w e e n 0.85 a n d 1 for t h e 11 variants f r o m sequencing. T h e pairwise D ' values between the 6 c o m m o n v a r i a n t s r a n g e d b e t w e e n 0.98 a n d 1 ( d a t a n o t s h o w n ) .  Pair-  common  genotyped  S i m i l a r l y h i g h levels o f L D  h a v e p r e v i o u s l y b e e n s h o w n b y o t h e r g r o u p s [1, 8, 3 8 , 72]. O v e r a l l , t h e g e n o m i c r e g i o n at t h e A T M l o c u s s h o w s h i g h b u t i n c o m p l e t e L D , w h i c l i c o n f i r m s t h e n e e d for v a r i a n t d e t e c t i o n s e q u e n c i n g .  T h e high L D validates  t h e use of t a g S N P s as m a r k e r s for h a p l o t y p e s , w h i l e t h e f a c t t h a t i t is i n c o m p l e t e indicates that relying completely on previously identified markers m a y not  have  p r o v i d e d t h e d e p t h t h a t we r e q u i r e for t h i s i n v e s t i g a t i o n . T h e g e n o t y p e f r e q u e n c i e s o b s e r v e d i n c o n t r o l s a m p l e s for a l l t h e  common  F i g u r e 3.5:  Linkage disequilibrium plots showing r  2  values.  T h e s e were generated  u s i n g a) sequence d e r i v e d g e n o t y p e d a t a for 11 c o m m o n v a r i a n t s i n 86 N H L i n d i v i d u a l s a n d b) g e n o t y p e d a t a f r o m 798 N H L cases a n d 793 c o n t r o l s for 6 t a g S N P s . v a r i a n t s are l i s t e d i n o r d e r of g e n o m i c p o s i t i o n . r  2  B l o c k s w i t h no v a l u e i n d i c a t e  of 1. T h e A T M gene s h o w s h i g h b u t i n c o m p l e t e l i n k a g e d i s e q u i l i b r i u m .  figures were g e n e r a t e d u s i n g H a p l o v i e w  [4].)  The an  (These  g e n o t y p e d S N P s w e r e v e r y close t o t h o s e e x p e c t e d b y H a r d y - W e i n b e r g e q u i l i b r i u m ( H W E ) ( d a t a n o t s h o w n ) . H W E w a s n o t t e s t e d for t h e r a r e v a r i a n t s . G e n o t y p e d a t a was also used to estimate haplotypes u s i n g P H A S E v2.0. O n l y t h e 6 c o m m o n v a r i a n t s were u s e d here.  These haplotypes and the corresponding  frequencies were c o m p a r a b l e t o t h o s e e s t i m a t e d u s i n g t h e sequence d a t a ( d a t a n o t shown).  3.5 3.5.1  Association tests with common variants Overall and subtype analyses  M u l t i v a r i a t e l o g i s t i c r e g r e s s i o n w a s u s e d t o c a l c u l a t e t h e o d d s r a t i o s for e a c h o f t h e 6 c o m m o n genotyped variants.  T h i s w a s a d j u s t e d for age, g e n d e r , e t h n i c i t y a n d  region of residence. T h i s was done u s i n g the H a p l o . s t a t s package of the R s t a t i s t i c a l s y s t e m [59].  W h e n t h e r e w e r e fewer t h a n 5 i n d i v i d u a l s i n t h e r a r e  homozygote  c a t e g o r y , t h i s g r o u p w a s c o m b i n e d w i t h t h e h e t e r o z y g o t e s for a n a l y s i s . F o r e a c h of t h e s e v a r i a n t s , we c o m p a r e d a l l N H L cases, a l l B - c e l l N H L cases, a n d a l l T - c e l l N H L cases w i t h a l l t h e c o n t r o l s (see T a b l e 3.6).  W h e n a n a l y s e d separately, none of the  6 c o m m o n v a r i a n t s a p p e a r t o confer a s i g n i f i c a n t l y i n c r e a s e d r i s k o f N H L . W e also t e s t e d t h e different N H L s u b t y p e s , c o m p a r i n g e a c h set of cases t o a l l t h e c o n t r o l s . T h e r e s u l t s f r o m t h i s a n a l y s i s are p r e s e n t e d i n T a b l e  3.7.  T a b l e 3.6: O d d s r a t i o s for c o m m o n v a r i a n t s o f A T M . O d d s r a t i o s were c a l c u l a t e d for e a c h c o m m o n v a r i a n t t h a t w a s g e n o t y p e d i n t h e case c o n t r o l g r o u p . A l l N H L cases, B c e l l cases a n d T c e l l N H L cases were e a c h c o m p a r e d t o t h e c o n t r o l group. T cell N H L O R (95% C I )  p value  0.249 0.889  n (%) 22 (29.3%) 38 (50.7%) 15 (20%)  1.25 (0.71-2.2) 1.14 (0.56-2.32)  0.433 0.712  1.16 (0.91-1.47) 0.98 (0.73-1.32)  0.246 0.897  22 (29.3%) 36 (48%) 17 (22.7%)  1.17 (0.66-2.07) 1.18 (0.59-2.33)  0.584 0.642  230 (33.3%) 347 (50.2%) 114 (16.5%)  1.12 (0.89-1.42) 0.94 (0.69-1.28)  0.332 0.68  31 (43.1%) 29 (40.3%) 12 (16.7%)  0.65 (0.38-1.13) 0.64 (0.31-1.31)  0.125 0.224  0.735 0.872  530 (76.9%) 148 (21.5%) 11 (1.6%)  1.00 (0.77-1.30) 1.06 (0.45-2.49)  0.995 0.900  51 (69.9%) 22 (30.1%) 1.70 (0.97-2.98) combined with wt/del  0.064  1.06 (0.82-1.37) 1.06 (0.46-2.44)  0.648 0.892  530 (77%) 147 (21.4%) 11 (1.6%)  1.02 (0.78-1.32) 1.05 (0.45-2.46)  0.908 0.920  52 (70.3%) 22 (29.7%) 1.74 (0.99-3.06) combined with G / A  0.053  1.10 (0.87-1.39) 0.95 (0.71-1.28)  0.441 0.738  211 (30.5%) 346 (50.1%) 134 (19.4%)  1.08 (0.85-1.37) 0.94 (0.69-1.27)  0.553 0.678  21 (28.4%) 39 (52.7%) 14 (18.9%)  Variant  Genotype  n (%) 229 (29.7%) 391 (50.8%) 150 (19.5%)  p value  T/T A/T A/A  Controls n (%) 237 (31.4%) 365 (48.3%) 153 (20.3%)  All N H L O R (95% C I )  -5144A/T  1.16 (0.92-1.47) 1.03 (0.77-1.39)  A/A G/A G/G  230 (30.7%) 359 (47.9%) 160 (21.4%)  227 (29.5%) 388 (50.4%) 155 (20.1%)  IVS4(+36) del(AA)  wt/wt wt/del del/del  259 (34.4%) 355 (47.1%) 139 (18.5%)  IVS24(-8) del(T)  wt/wt wt/del del/del  X39(55S7) G/A  IVS62(-55) C/T  -4519G/A  B cell N H L O R (95% CI)  p value  0.215 0.824  n (%) 207 (29.8%) 352 (50.7%) 135 (19.5%)  1.15 (0.91-1.47) 1.02 (0.76-1.38)  1.15 (0.91-1.46) 1.00 (0.75-1.34)  0.237 0.996  205 (29.5%) 351 (50.6%) 138 (19.9%)  261 (34.2%) 377 (49.3%) 126 (16.5%)  1.08 (0.86-1.35) 0.91 (0.67-1.22)  0.533 . 0.517  593 (78.1%) 155 (20.4%) 11 (1.4%)  582 (76.3%) 169 (22.1%) 12 (1.6%)  1.05 (0.81-1.35) 1.07 (0.46-2.47)  G/G G/A A/A  596 (78.4%) 153 (20.1%) 11 (1.4%)  583 (76.4%) 168 (22%) 12 (1.6%)  T/T C/T  230 (30.7%) 364 (48.5%) 156 (20.8%)  232 (30.3%) 386 (50.4%) 148 (19.3%)  c/c  1.30 (0.74-2.30) 1.06 (0.51-2.19)  0.364 0.879  T h e different s u b t y p e s of N H L t h a t we t e s t e d i n c l u d e :  • Diffuse large B cell l y m p h o m a ( D L B C L )  • F o l l i c u l a r s m a l l cleaved, follicular large cell a n d follicular m i x e d , grouped together ( F L )  • M a r g i n a l z o n e l y m p h o m a a n d l o w g r a d e B c e l l of m u c o s a a s s o c i a t e d l y m p h o i d tissue, grouped together  (MZL/MALT)  • M a n t l e cell l y m p h o m a ( M C L )  • Small lymphocytic lymphoma (SLL)  • Lymphoplasmacytic lymphoma ( L P L )  • Miscellaneous B cell l y m p h o m a s (Misc B C L )  • M y c o s i s fungoides  (MF)  • P e r i p h e r a l T cell l y m p h o m a ( P T C L )  • Miscellaneous T cell l y m p h o m a s (Misc T C L )  N o t e : M i s c T C L a n d M i s c B C L are h e t e r o g e n e o u s g r o u p s of s u b t y p e s t h a t i n c l u d e a n u m b e r of T - c e l l a n d B - c e l l s u b t y p e s t h a t we d i d n o t h a v e sufficient n u m b e r s t o a n a l y z e i n d i v i d u a l l y . T h e r e s u l t s for M i s c T C L are n o t r e p o r t e d since t h e r e were o n l y 9 cases i n t h i s g r o u p . T h e most significant  finding  w a s p = 0 . 0 0 7 , w i t h a n o d d s r a t i o of 0.31  IVS4(+36) del(AA) in peripheral T-cell lymphomas. d i s c o v e r y r a t e ( F D R ) [6], h o w e v e r ,  for  I f we c o r r e c t for t h e F a l s e  t h i s p - v a l u e does n o t r e m a i n s i g n i f i c a n t  (see  Table B . l ) . P e r i p h e r a l T - c e l l l y m p h o m a s m a k e u p a p p r o x i m a t e l y 1 5 % of l y m p h o m a a n d c o n s i s t of a w i d e s p e c t r u m o f disease, i n c l u d i n g a n a p l a s t i c l a r g e T cell l y m p h o m a , I B L - l i k e T - c e l l l y m p h o m a , intestinal T - c e l l l y m p h o m a , adult T - c e l l l e u k a e m i a / l y m p h o m a a n d P T C L u n s p e c i f i e d [2, 42]. T h e s e diseases d i s p l a y m a r k e d differences i n b i o l o g y a n d one o r a s u b s e t of these m a y b e a s s o c i a t e d w i t h A T M . W e do not, i n this study, have the n u m b e r s to s t u d y the subtypes of P T C L vidually.  indi-  T h e r e is s o m e p r e v i o u s e v i d e n c e for t h e i n v o l v e m e n t o f A T M i n P T C L .  F a n g et al,  [20] i d e n t i f i e d one u n e q u i v o c a l l y d e l e t e r i o u s A T M m u t a t i o n i n 1 of 10  P T C L t u m o u r s t h a t t h e y e x a m i n e d b y C G H . T h e o r i g i n of t h i s m u t a t i o n ( g e r m l i n e or somatic) was not d e t e r m i n e d .  A l t h o u g h t h e c l i n i c a l or b i o l o g i c a l r e l e v a n c e o f  t h i s finding c a n n o t b e assessed, s p e c i f i c s u b s e t s o f P T C L m a y be e n r i c h e d for A T M mutations.  T a b l e 3.7:  Odds ratios for common A T M variants for different sub-  types of N H L . Odds ratios were calculated for each variant that was genotyped i n the case control group.  S i x c o m m o n variants  were tested for association using multivariate logistic regression comparing a l l cases of a particular subtype of N H L to a l l controls.  Variant  -5144A/T  -4519G/A  IVS4(+36) del(AA)  IVS24(-8)  Controls  Analysis  n(%)  Group  n(%)  T/T  237 (31.4%)  DLBCL  61 (32.6%)  Genotype  Analysis  Cases O R ( 9 5 % CI)  p value  n(%)  FL  61 (28.5%)  O R ( 9 5 % CI)  p value  A/T  365 (48.3%)  93 (49.7%)  1.01 (0.70-1.45)  0.977  110 (51.4%)  1.23 (0.86-1.76)  0.264  A/A  153 (20.3%)  33 (17.6%)  0.85 (0.53-1.38)  0.517  43 (20.1%)  1.13 (0.72-1.77)  0.599  A/A  230 (30.7%)  61 (32.6%)  58 (27.8%)  G/A  359 (47.9%)  92 (49.2%)  0.98 (0.68-1.42)  0.911  108 (51.7%)  1.2 (0.88-1.83)  0.200  G/G  160 (21.4%)  34 (18.2%)  0.82 (0.51-1.31)  0.404  43 (20.6%)  1.12 (0.72-1.76)  0.613  wt/wt  259 (34.4%)  59 (32.1%)  77 (36.0%)  wt/del  355 (47.1%)  96 (52.2%)  1.18 (0.82-1.70)  0.380  97 (45.3%)  0.93 (0.66-1.31)  0.665  del/del  139 (18.5%)  29 (15.8%)  0.90 (0.55-1.49)  0.687  40 (18.7%)  0.96 (0.62-1.50)  0.860  wt/wt  593 (78.1%)  138 (73.4%)  0.99 (0.68-1.45)  0.975  160 (76.9%)  wt/del  155 (20.4%)  45 (23.9%)  1.28 (0.86-1.89)  0.220  del/del  11 (1.4%)  5 (2.7%)  1.79 (0.60-5.35)  0.297  X39(5557)  G/G  596 (78.4%)  139 (73.9%)  G/A  G/A,A/A  164 (21.5%)  49 (25.0%)  1.31 (0.90-1.92)  0.161  IVS62(-55)  T/T  230 (30.7%)  61 (33.0%)  C/T  C/T  364 (48.5%)  91 (49.2%)  0.95 (0.66-1.38)  0.790  c/c  156 (20.8%)  33 (17.8%)  0.80 (0.49-1.28)  0.349  del(T)  Cases  Group  48 (23.1%)  combined with w t / d e l 162 (77.1%) 48 (22.9%)  1.01 (0.69-1.47)  0.966  109 (51.4%)  1.18 (0.82-1.69)  0.371  42 (19.8%)  1.06 (0.67-1.66)  0.817  61 (28.8%)  C o n t i n u e d on next page  T a b l e 3.7 — C o n t i n u e d from previous page Variant  -5144A/T  -4519G/A  IVS4(+36) del(AA)  IVS24(-8)  Analysis  n(%)  Group  n(%)  Cases  T/T  237 (31.4%)  MZL/MALT  28 (32.2%)  O R ( 9 5 % CI)  Analysis p value  Cases  Group  n(%)  MCL  15 (34.1%)  O R ( 9 5 % CI)  p value  A/T  365 (48.3%)  43 (49.4%)  1.08 (0.64-1.80)  0.782  20 (45.5%)  0.89 (0.44-1.79)  0.740  A/A  153 (20.3%)  16 (18.4%)  0.88 (0.45-1.70)  0.697  9 (20.5%)  0.87 (0.37-2.08)  0.760  A/A  230 (30.7%)  28 (32.2%)  14 (30.4%)  G/A  359 (47.9%)  42 (48.3%)  1.07 (0.64-1.79)  0.808  23 (50.0%)  1.08 (0.54-2.17)  0.836  G/G  160 (21.4%)  17 (19.5%)  0.86 (0.45-1.64)  0.642  9 (19.6%)  0.88 (0.37-2.10)  0.769  wt/wt  259 (34.4%)  28 (31.8%)  10 (23.8%)  wt/del  355 (47.1%)  44 (50.0%)  1.23 (0.74-2.05)  0.432  24 (57.1%)  1.82 (0.85-3.90)  0.126  del/del  139 (18.5%)  16 (18.2%)  1.11 (0.57-2.15)  0.758  8 (19.0%)  1.58 (0.60-4.17)  0.356  wt/wt  593 (78.1%)  65 (70.7%)  0.58 (0.25-1.34)  0.202  39 (83.0%)  wt/del  155 (20.4%)  21 (22.8%)  1.22 (0.71-2.10)  0.472  del/del  11 (1.4%)  6 (6.5%)  0.01 ( 0 . 0 0 - 8 . 9 X 1 0 )  0.628  X39(5557)  G/G  596 (78.4%)  65 (76.5%)  G/A  G/A, A/A  164 (21.5%)  20 (23.5%)  1.08 (0.62-1.87)  0.784  del(T)  Cn  Controls  Genotype  6  8 (17.0%)  combined with w t / d e l 39 (84.8%) 7(15.2%)  0.57 (0.25-1.32)  0.191  21 (44.7%)  0.81 (0.41-1.58)  0.530  9 (19.1%)  0.74 (0.32-1.71)  0.476  17 (36.2%)  IVS62(-55)  T/T  230 (30.7%)  28 (32.9%)  C/T  C/T  364 (48.5%)  42 (49.4%)  1.01 (0.60-1.70)  0.971  C/C  156 (20.8%)  15 (17.6%)  0.78 (0.40-1.53)  0.473  C o n t i n u e d o n next page  T a b l e 3.7 — C o n t i n u e d from previous page Variant  Controls  Genotype  n(%) -5144A/T  -4519G/A  IVS4(+36)  del(AA)  IVS24(-8) de)(T)  X39(55S7) G / A  T/T  237  00  Group SLL  Cases n(%)  O R ( 9 5 % CI)  Analysis p value  7 (18.9%)  Group LPL  Cases n(%)  O R ( 9 5 % CI)  p value  9 (22.5%)  A/T  365 (48.3%)  21 (56.8%)  2.08 (0.86-5.06)  0.105  23 (57.5%)  1.69 (0.76-3.76)  0.197  A/A  153  (20.3%)  9 (24.3%)  1.90 (0.68-5.29)  0.219  8 (20.0%)  1.33 (0.50-3.57)  0.570  A/A  230  (30.7%)  7 (18.9%)  9 (22.0%)  G/A  359  (47.9%)  21 (56.8%)  2.07 (0.85-5.02)  0.109  23 (56.1%)  1.69 (0.76-3.76)  0.198  G/G  160  (21.4%)  9 (24.3%)  1.83 (0.66-5.08)  0.250  9 (22.0%)  1.42 (0.55-3.71)  0.471  wt/wt  259  (34.4%)  12 (31.6%) 26 (68.4%)  19 (50.0%)  1.01 (0.49-2.08)  0.971  5 (13.2%)  0.68 (0.24-1.94)  0.467  0.73 (0.31-1.72)  0.473  0.80 (0.34-1.90)  0.617  wt/del  355 (47.1%)  del/del  139  (18.5%)  wt/wt  593  (78.1%)  14 (36.8%) 1.13 (0.55-2.31)  0.735  combined w i t h w t / d e l  32 (76.2%)  33 (86.8%)  wt/del,del/del  166  (21.5%)  5 (13.2%)  G/G  596  (78.4%)  33 (86.8%)  G/A,A/A I V S 6 2 (-55) C / T  (31.4%)  Analysis  0.47 (0.18-1.23)  0.122  10 (23.8%) 30 (81.1%)  164 (21.5%)  5 (13.1%)  T/T  230  (30.7%)  7 (18.9%)  C/T  364 (48.5%)  21 (56.8%)  2.04 (0.84-4.96)  0.115  23 (57.5%)  1.65 (0.74-3.68)  0.217  c/c  156  9 (24.3%)  1.83 (0.66-5.09)  0.248  8 (20.0%)  1.28 (0.48-3.42)  0.626  (20.8%)  0.47 (0.18-1.25)  0.130  7 (18.9%) 9 (22.5%)  C o n t i n u e d o n next page  T a b l e 3.7 — C o n t i n u e d from previous page Variant  -5144A/T  -4519G/A  IVS4(+36)  Controls  Analysis  n(%)  Group  n(%)  T/T  237 (31.4%)  Misc B C L  26 (30.6%)  Genotype  Cases O R ( 9 5 % CI)  Analysis p value  Cases  Group  n(%)  MF  12 (30.0%) 28 (70.0%)  O R ( 9 5 % CI)  p value  1.25 (0.61-2.54)  0.546  A/T  365 (48.3%)  42 (49.4%)  1.12 (0.66-1.88)  0.684  A/A  153 (20.3%)  17 (20.0%)  1.06 (0.55-2.03)  0.872  A/A  230 (30.7%)  28 (32.2%)  G/A  359 (47.9%)  42 (48.3%)  1.02 (0.61-1.71)  0.931  23 (57.5%)  1.41 (0.68-2.95)  0.357  G/G  160 (21.4%)  17 (19.5%)  0.89 (0.47-1.70)  0.726  5 (12.5%)  0.68 (0.23-2.01)  0.487  wt/wt  259 (34.4%)  30 (34.5%)  combined with A / T 12 (30.0%)  12 (30.0%)  wt/del  355 (47.1%)  44 (50.6%)  1.07 (0.65-1.75)  0.799  19 (47.5%)  1.11 (0.52-2.37)  0.788  del/del  139 (18.5%)  13 (14.9%)  0.80 (0.40-1.61)  0.537  9 (22.5%)  1.22 (0.49-3.06)  0.668  IVS24(-8)  wt/wt  593 (78.1%)  63 (75.0%)  1.34 (0.64-2.83)  0.438  del(AA)  29 (72.5%)  wt/del,del/del  166 (21.5%)  21 (25.0%)  G/G  596 (78.4%)  62 (73.8%)  G/A  G/A,A/A  164 (21.5%)  22 (26.2%)  IVS62(-55)  T/T  230 (30.7%)  28 (32.9%)  C/T  364 (48.5%)  39 (45.9%)  0.93 (0.55-1.56)  0.772  C/C  156 (20.8%)  18 (21.2%)  0.97 (0.51-1.83)  0.919  C/T  1.16 (0.68-1.99)  0.582  del(T) X39(5557)  11 (27.5%) 29 (72.5%)  1.28 (0.75-2.18)  0.366  11 (27.5%)  1.37 (0.65-2.89)  .  0.413  12 (30.0%)  C o n t i n u e d on next page  28 (70.0%)  1.21 (0.59-2.47)  combined with C / T  0.602  T a b l e 3.7 — C o n t i n u e d from previous page Variant  -5144A/T  -4519G/A  IVS4(+36) del(AA)  IVS24(-8) del(T)  X39(5557) G / A  I V S 6 2 (-55) C / T  OX  Genotype  Controls  Analysis  n(%)  Group  T/T  237 (31.4%)  PTCL  Cases n(%)  Analysis  O R ( 9 5 % CI)  p value  6 (23.1%)  A/T  365 (48.3%)  13 (50%)  1.46 (0.54-3.95)  0.453  A/A  153 (20.3%)  7 (26.9%)  1.72 (0.56-5.30)  0.345  A/A  230 (30.7%)  6 (23.1%)  G/A  359 (47.9%)  12 (46.2%)  1.37 (0.50-3.76)  0.537  G/G  160 (21.4%)  8 (30.8%)  1.79 (0.60-5.35)  0.297  wt/wt  259 (34.4%)  15 (62.5%)  wt/del,del/del  494 (65.6%)  9 (37.5%)  0.31 (0.13-0.73)  0.007  wt/wt  593 (78.1%)  16 (66.7%) 2.18 (0.86-5.57)  0.102  2.28 (0.89-5.87)  0.086  wt/del,del/del  166 (21.5%)  8 (33.3%)  G/G  596 (78.4%)  17 (68.0%)  G/A,A/A  164 (21.5%)  8 (32.0%)  T/T  230 (30.7%)  5 (20.0%)  C/T  364 (48.5%)  14 (56.0%)  1.79 (0.63-5.11)  0.277  C/C  156 (20.8%)  6 (24.0%)  1.65 (0.49-5.58)  0.422  Group  Cases n(%)  O R ( 9 5 % CI)  p value  3.5.2  Analysis of different  ethnicities  E a c h i n d i v i d u a l i n t h e c a s e / c o n t r o l g r o u p w a s c l a s s i f i e d u n d e r one of f o u r e t h n i c i t y b a s e d g r o u p s . T h e s e were C a u c a s i a n , A s i a n , S o u t h A s i a n a n d M i x e d / O t h e r / U n k n o w n E a c h of t h e g e n o t y p e d v a r i a n t s was t h e n a n a l y z e d s e p a r a t e l y for e a c h of these g r o u p s . T h e M i x e d / O t h e r / U n k n o w n g r o u p was e x c l u d e d f r o m t h e a n a l y s i s , as a n y r e s u l t s o b t a i n e d were u n l i k e l y t o b e m e a n i n g f u l .  T h u s , the odds ratios were calculated  u s i n g m u l t i v a r i a t e l o g i s t i c r e g r e s s i o n c o m p a r i n g C a u c a s i a n N H L cases t o C a u c a s i a n c o n t r o l s a n d so o n for A s i a n a n d S o u t h A s i a n i n d i v i d u a l s . T h e s e c o m p a r i s o n s a d j u s t e d for age, g e n d e r a n d r e g i o n of r e s i d e n c e . T a b l e 3.8.  were  T h e r e s u l t s are s u m m a r i z e d i n  N o n e of t h e v a r i a n t s c o n f e r r e d a s i g n i f i c a n t o d d s r a t i o for a n y of t h e  i n d i v i d u a l ethnicities.  Table 3.8:  Odds ratios for common A T M variants for different  ethnicities. O d d s ratios were calculated for each variant that was genotyped i n the case/control group. S i x c o m m o n variants were tested for association using multivariate logistic regression comparing a l l cases of a particular ethnicity to controls of the same ethnicity. Three separate ethnicities were analysed.  Analysis  Variant  Genotype  Group Caucasians  Controls  A l l N H L Cases 011(95% C I )  p value  314 (51.6%)  1.18 (0.91-1.54)  0.219  126 (21.4%)  118 (19.4%)  0.97 (0.70-1.35)  - 0.850  A/A  176 (30.2%)  176 (29.0%)  G/A  279 (47.9%)  311 (51.3%)  1.16 (0.89-1.52)  0.267  G/G  128 (22.0%)  119 (19.6%)  0.94 (0.68-1.30)  0.708  IVS4(+36)  wt/wt  214 (36.5%)  207 (34.3%)  del(AA)  wt/del  274 (46.7%)  305 (50.5%)  1.17 (0.91-1.51)  0.233  del/del  99 (16.9%)  92 (15.2%)  0.97 (0.68-1.37)  0.847  IVS24(-8)  wt/wt  440 (74.8%)  443 (73.8%)  del(T)  wt/del  140 (23.8%)  150 (25.0%)  1.02 (0.78-1.33)  0.892  del/del  8 (1.4%)  7 (1.2%)  0.91 (0.33-2.54)  0.854  G/G  443 (74.8%)  444 (74.0%)  G/A  140 (23.6%)  149 (24.8%)  1.02 (0.78-1.33)  0.884  A/A  9 (1.5%)  7 (1.2%)  0.77 (0.29-2.12)  0.621  IVS62(-55)  T/T  176 (30.0%)  178 (29.4%)  C/T  C/T  283 (48.2%)  310 (51.2%)  1.13 (0.86-1.47)  0.388  C/C  128 (21.8%)  117 (19.3%)  0.92 (0.66-1.27)  0.598  -5144A/T  -4519G/A  X39(5557) G/A  .  n(%)  n(%)  T/T  180 (30.6%)  176 (28.9%)  A/T  282 (48.0%)  A/A  C o n t i n u e d o n next page  Table 3.8 - C o n t i n u e d from previous page Analysis  Variant  Genotype  Group Asian  A l l N H L Cases OR(95% CI)  p value  36 (48.0%)  1.29 (0.59-2.85)  0.524  20 (23.5%)  23 (30.7%)  1.62 (0.67-3.94)  0.288  A/A  23 (27.4%)  15 (19.7%)  G/A  38 (45.2%)  37 (48.7%)  1.56 (0.70-3.47)  0.280  G/G  23 (27.4%)  24 (31.6%)  1.55 (0.64-3.73)  0.333  IVS4(+36)  wt/wt  28 (32.9%)  28 (38.4%)  del(AA)  wt/del  38 (44.7%)  33 (45.2%)  0.95 (0.46-1.96)  0.899  del/del  19 (22.4%)  12 (16.4%)  0.63 (0.26-1.56)  0.323  IVS62(-55)  T/T  21 (25.6%)  17 (22.7%)  C/T  C/T  40 (48.8%)  35 (46.7%)  1.14 (0.51-2.52)  0.750  C/C  21 (25.6%)  23 (30.7%)  1.31 (0.54-3.15)  0.554  T/T  16 (50.0%)  14 (51.9%)  A/T/T/T  16 (50.0%)  13 (48.1%)  0.97 (0.32-2.99)  0.958  A/A  13 (41.9%)  13 (48.1%)  G/A.G/G  18 (58.0%)  14 (51.9%)  0.81 (0.25-2.56)  0.713  IVS4(+36)  wt/wt  4 (12.9%)  5 (18.5%)  del(AA)  wt/del  17 (54.8%)  12 (44.4%)  0.35 (0.06-1.97)  0.231  del/del  10 (32.3%)  10 (37%)  0.64 (0.10-4.16)  0.635  IVS62(-55)  T/T  17 (53.1%)  14 (53.8%)  C/T  C/T,C/C  15 (46.9%)  12 (46.2%)  0.97 (0.31-3.05)  0.954  -5144A/T  -4519G/A  South  Controls  -5144A/T  Asian -4519G/A  n(%)  n(%)  T/T  23 (27.1%)  16 (21.3%)  A/T  42 (49.4%)  A/A  3.5.3  Analysis of haplotypes  I n a d d i t i o n t o a n a l y s i n g e a c h o f t h e c o m m o n v a r i a n t s i n d i v i d u a l l y , we a l s o c a l c u l a t e d o d d s r a t i o s for t h e h a p l o t y p e s f o r m e d b y these v a r i a n t s . were observed. in <5  Three m a i n haplotypes  T h e s e were a n a l y s e d s i n g l y , w h i l e less f r e q u e n t h a p l o t y p e s (seen  i n d i v i d u a l s ) were g r o u p e d t o g e t h e r for a n a l y s i s .  We compared  haplotype  frequencies i n a l l N H L cases, B - c e l l N H L cases a n d T - c e l l N H L cases i n a d d i t i o n t o s o m e o f t h e m a j o r s u b t y p e s of N H L t o t h e c o n t r o l s .  O d d s r a t i o s were c a l c u l a t e d  u s i n g m u l t i v a r i a t e l o g i s t i c r e g r e s s i o n a d j u s t e d for age, g e n d e r a n d r e g i o n , for t h e C a u c a s i a n cases as c o m p a r e d t o t h e C a u c a s i a n c o n t r o l s . T h e r e s u l t s are s u m m a r i z e d i n T a b l e 3.9 a n d are n o t s i g n i f i c a n t for a n y of t h e c o m p a r i s o n s . T h u s , b a s e d o n t h e a n a l y s i s of these v a r i a n t s , c o m m o n v a r i a n t s i n A T M , o r h a p l o t y p e s thereof, do not appear to confer increased s u s c e p t i b i l i t y to N H L ( w i t h the possible e x c e p t i o n of P T C L ) . T h e power of this s t u d y to detect a n y such associations, s h o u l d t h e y e x i s t , w a s r e l a t i v e l y h i g h (as s h o w n i n T a b l e 3.3).  If there were a n  effect, i t w o u l d h a v e t o c o n f e r a n o d d s r a t i o o f less t h a n 1.4 i n o r d e r t o be b e y o n d the power of this study.  T h u s , c o m m o n v a r i a n t s i n A T M are u n l i k e l y t o p l a y a  s u b s t a n t i a l role i n N H L susceptibility.  3.6  Association study with combined rare variants  T h e 6 rare variants genotyped i n this s t u d y were selected based o n their p u t a t i v e effect o n p r o t e i n f u n c t i o n . A l l 6 were seen i n at least one s a m p l e t h a t we s e q u e n c e d as p a r t of t h e v a r i a n t d e t e c t i o n p h a s e .  F i v e o f t h e 6 were p r e d i c t e d t o b e  "Possi-  b l y " o r " P r o b a b l y d a m a g i n g " t o p r o t e i n f u n c t i o n b y P o l y P h e n [54, 69, 70].  The  s i x t h r e s u l t e d i n a p r e m a t u r e s t o p c o d o n a n d so is p r e d i c t e d t o b e i n t h e s a m e  T a b l e 3.9: O d d s r a t i o s for A T M h a p l o t y p e s . O d d s r a t i o s w e r e c a l c u l a t e d for e a c h variant that was genotyped i n the c a s e / c o n t r o l group. H a p l o t y p e s were estimated u s i n g H a p l o . s t a t s [59] b a s e d o n these g e n o t y p e s . H e r e , t h e r e s u l t s for t h e s e h a p lotypes are presented.  Several sub-groups were tested i n a d d i t i o n to the entire  c a s e / c o n t r o l g r o u p . See T a b l e 2.1 for a l i s t o f a b b r e v i a t i o n s . Analysis  Haplotype  Freq  AGwtwtGC  0.44  TAwtdelAT TAdelwtGT Rare  O R (95% CI)  P-val  0.12  1.03 (0.82-1.30)  0.787  0.41  0.97 (0.83-1.14)  0.729  0.02  0.91 (0.50-1.63)  0.740  Group All N H L  B-cell N H L  T-cell N H L  DLBCL  FL  AGwtwtGC  0.44  TAwtdelAT  0.12  1.00 (0.78-1.27)  0.983  TAdelwtGT  0.42  0.99 (0.84-1.16)  0.895  Rare  0.02  0.86 (0.47-1.57)  0.617  AGwtwtGC  0.44  TAwtdelAT  0.12  1.52 (0.92-2.52)  0.104  TAdelwtGT  0.41  0.81 (0.56-1.18)  0.278  Rare  0.02  1.09 (0.39-3.10)  0.867  AGwtwtGC  0.44  TAwtdelAT  0.12  1.31 (0.92-1.86)  0.133  TAdelwtGT  0.42  1.03 (0.80-1.32)  0.834  Rare  0.02  1.25 (0.56-2.75)  0.588  AGwtwtGC  0.45  TAwtdelAT  0.12  0.93 (0.65-1.33)  0.704  TAdelwtGT  0.42  0.95 (0.75-1.20)  0.661  Rare  0.02  0.45 (0.14-1.43)  0.176  Caucasians  AGwtwtGC  0.45  All NHL  TAwtdelAT  0.13  1.02 (0.79-1.31)  0.909  TAdelwtGT  0.40  1.01 (0.85-1.21)  0.891  Rare  0.01  0.77 (0.29-2.04)  0.597  Asians  AGwtwtGC  0.50  All NHL  TAdelwtGT  0.41  0.83 (0.53-1.31)  0.432  Rare  0.09  1.18 (0.54-2.62)  0.676  S Asian  TAdelwtGT  0.58  All N H L  TAwtdelAT  0.10  0.69 (0.18-2.62)  0.593  AGwtwtGC  0.27  1.62 (0.61-4.33)  0.341  Rare  0.05  0.78 (0.11-5.50)  0.802  f u n c t i o n a l c a t e g o r y as t h e o t h e r s . W e d i d n o t h a v e sufficient p o w e r , i n t h i s s t u d y , t o a n a l y z e e a c h o f these r a r e v a r i a n t s i n d i v i d u a l l y .  I n s t e a d , w e a n a l y z e d t h e m as  a f u n c t i o n a l l y deleterious group, h y p o t h e s i z i n g t h a t heterozygosity at a n y one of these l o c i confers i n c r e a s e d s u s c e p t i b i l i t y t o N H L . A l l a s s o c i a t i o n s w e r e t e s t e d u s i n g m u l t i v a r i a t e l o g i s t i c r e g r e s s i o n t e s t s , a d j u s t e d for age, g e n d e r , p l a c e o f r e s i d e n c e a n d when appropriate, ethnicity. T h e frequency of the heterozygotes to that of the c o m m o n homozygotes  a n d rare homozygotes  i n t h e association tests.  was compared  W e calculated the  o d d s r a t i o s f o r a l l t h e N H L cases, a l l B - c e l l N H L cases a n d T - c e l l N H L cases ( T a b l e 3.10(a)). W e also c o m p a r e d e a c h o f t h e s u b t y p e s o f N H L t o a l l t h e c o n t r o l s . T h e r e s u l t s o f these a n a l y s e s a r e s h o w n i n T a b l e 3 . 1 0 ( b ) . L a s t l y , w e a n a l y z e d e a c h m a j o r e t h n i c g r o u p s e p a r a t e l y as s h o w n i n T a b l e 3 . 1 0 ( c ) . T h e r a r e g e n o t y p e s o f t h e 6 c o m b i n e d v a r i a n t s confer a n o d d s r a t i o o f a p p r o x i m a t e l y 3 i n t w o of t h e subtypes a n a l y z e d . T h e s e were m a n t l e cell l y m p h o m a ( O R : 3 . 3 (1.16-9.33), p = 0 . 0 2 6 ) a n d t h e M Z L / M A L T c a t e g o r y ( O R : 2 . 8 ( 1 . 2 2 - 6 . 3 6 ) , p = 0 . 0 1 5 ) . T h e s e r e s u l t s were s i g n i f i c a n t a t o u r s e l e c t e d a o f 0.05, w h i c h i n d i c a t e s t h a t h e t e r o z y g o s i t y a t a n y o f t h e r a r e alleles assessed m a y c o n f e r a n i n c r e a s e d s u s c e p t i b i l i t y t o these diseases ( a l t h o u g h t h i s does n o t r e m a i n s i g n i f i c a n t after a d j u s t m e n t for t h e F D R , see T a b l e B . l ) . T h u s , we h a v e s o m e e v i d e n c e p o i n t i n g t o t h e i m p o r t a n c e o f t h e s e r a r e v a r i a n t s i n r a r e s u b t y p e s o f t h e disease; t h i s m a y s u p p o r t a c o r o l l a r y o f t h e c o m m o n v a r i a n t - c o m m o n disease m o d e l : t h e m u l t i p l e r a r e v a r i a n t s - r a r e disease m o d e l .  T a b l e 3.10: O d d s r a t i o s for p o o l e d a n a l y s i s of 6 r a r e , p u t a t i v e l y deleterious v a r i a n t s of A T M . R e s u l t s for categories  t h a t h a d insufficient n u m b e r s (fewer t h a n 5 i n d i -  v i d u a l s w i t h t h e rare v a r i a n t s ) are not s h o w n . T h e s e i n c l u d e a l l T - c e l l N H L , S L L , L P L , M i s c B C L , M F , P T C L , M i s c T C L a n d analyses for t h e A s i a n a n d t h e S o u t h A s i a n e t h n i c g r o u p s . See T a b l e 2.1 for a list of a b b r e v i a t i o n s . I n a l l categories,  the  r a r e h o m o z y g o t e s ( Z / Z ) were c o m b i n e d w i t h h e t e r o z y g o t e s ( Y / Z ) for a n a l y s i s a n d compared to the c o m m o n homozygotes ( Y / Y ) . (a)  Analysis Group All N H L B cell N H L  Genotype Y/Y Y / Z , Z/Z Y/Y Y / Z , Z/Z  Overall  Controls n(%) 745 (96.1%) 30 (3.9%) 745 (96.1%) 30 (3.9%)  n (%) 741 (94.2%) 46 (5.8%) 669 (94.1%) 42 (5.9%)  Cases 011(95% CI)  p value  1.54 (0.96-2.48)  0.077  1.52 (0.94-2.48)  0.090  (b) Subtypes Analysis Group DLBCL FL MZL/MALT MCL  Genotype Y/Y Y / Z , Z/Z Y/Y Y / Z , Z/Z Y/Y Y / Z , Z/Z Y/Y Y / Z , Z/Z  Controls n(%) 745 (96.1%) 30 (3.9%) 745 (96.1%) 30 (3.9%) 745 (96.1%) 30 (3.9%) 745 (96.1%) 30 (3.9%)  Genotype Y/Y Y / Z , Z/Z  Controls n(%) 577 (96%) 24 (4%)  (c)  Analysis Group Caucasian  n(%) 181 (94.3%) 11 (5.7%) 204 (95.8%) 9 (4.2%) 81 (90%) 9 (10%) 42 (89.4%) 5 (10.6%)  Cases O R ( 9 5 % CI)  p value  1.46 (0.71-3.00)  0.306  1.08 (0.50-2.34)  0.843  2.78 (1.22-6.36)  0.015  3.28 (1.16-9.33)  0.026  Ethnicities  n(%) 584 (94.2%) 36 (5.8%)  Cases O R ( 9 5 % CI)  p value  1.54 (0.91-2.63)  0.111  3.6.1  Mantle cell lymphoma  M a n t l e c e l l l y m p h o m a ( M C L ) a c c o u n t s for 6 % of a l l l y m p h o m a s . T h i s is a n e o p l a s m t h a t is c h a r a c t e r i z e d b y s o m a t i c a l t e r a t i o n s i n genes t h a t r e g u l a t e c e l l c y c l e a n d D N A d a m a g e p a t h w a y s . T h e s e genes t y p i c a l l y i n c l u d e c y c l i n D l (seen i n a l m o s t a l l cases), t h e I N K 4 a / A R F l o c u s ( 2 0 % of cases), A T M ( 4 0 - 7 5 % of cases) a n d i n s o m e cases, C H K 2 (rare) ( R e v i e w e d b y F e r n a n d e z et al,  [21]).  M o r e t h a n 4 0 % of M C L t u m o u r s h a v e b e e n s h o w n t o h a v e m u t a t i o n s i n A T M [15]. A l t h o u g h M C L h a s b e e n k n o w n t o h a v e c i r c u l a t i n g cells we d o n o t b e l i e v e t h a t o u r r e s u l t s are d u e t o s o m a t i c m u t a t i o n s . T h e p r o p o r t i o n of c i r c u l a t i n g cells w o u l d n o t b e e x p e c t e d t o be h i g h e n o u g h t o affect t h e g e n o t y p e c a l l . F o r a s a m p l e t o b e c a l l e d h e t e r o z y g o u s b y s e q u e n c i n g , i t w o u l d have t o h a v e t w o p e a k s of a p p r o x i m a t e l y e q u a l h e i g h t a t t h a t v a r i a n t s i t e . A s m a l l f r a c t i o n of c i r c u l a t i n g cells w o u l d n o t b e sufficient t o r e s u l t i n e q u a l p e a k h e i g h t s . S i m i l a r l y , d u r i n g g e n o t y p i n g w i t h  TaqM&n,  s a m p l e s w i t h fluorescence f r o m b o t h d y e s , b u t i n u n e q u a l a m o u n t s , w o u l d n o t f a l l w i t h i n the heterozygous  g r o u p , a n d w o u l d therefore b e l a b e l l e d " U n d e t e r m i n e d " .  W e c a n , t h e r e f o r e , w i t h s o m e c o n f i d e n c e , r u l e o u t t h e p o s s i b i l i t y of c i r c u l a t i n g c e l l c o n t a m i n a t i o n causing the heterozygosity. T h e r e is e v i d e n c e for s o m a t i c m u t a t i o n s i n A T M i n M C L . G r e i n e r a n d c o l leagues [29] e x a m i n e d M C L t u m o u r s i n w h i c h A T M is m u t a t e d a n d f o u n d t h a t these t u m o u r s h a v e a n a l t e r e d gene e x p r e s s i o n p r o f i l e w h e n c o m p a r e d t o w i l d t y p e A T M M C L . T h e r e h a v e b e e n o b s e r v a t i o n s of i n c r e a s e d c h r o m o s o m a l i m b a l a n c e s i n M C L w i t h i n a c t i v a t e d A T M [15]. C a m a c h o a n d colleagues  [15] l o o k e d at 20 M C L t u m o u r s p e c i m e n s .  They  i d e n t i f i e d 8 m u t a t i o n s ( 4 0 % of cases h a d m u t a t i o n s ) . T h e y e s t a b l i s h e d t h e g e r m l i n e o r i g i n of one m u t a t i o n , w h i c h w a s h e t e r o z y g o u s , w i t h a loss of t h e w i l d t y p e c o p y i n  t h e h e m i z y g o u s t u m o u r . T h e y f o u n d t h a t A T M gene m u t a t i o n s s e e m e d t o b e a s s o c i a t e d w i t h M C L t u m o u r s t h a t d i s p l a y e d a l a r g e n u m b e r of c h r o m o s o m a l i m b a l a n c e s , suggesting that A T M i n a c t i v a t i o n m a y favor increasing c h r o m o s o m a l i n s t a b i l i t y i n these l y m p h o m a s . T h u s , a n u m b e r of s t u d i e s [15, 58] f o u n d t h a t A T M i n a c t i v a t i o n is a frequent o c c u r r e n c e i n M C L a n d h a v e c o n c l u d e d t h a t A T M m u t a t i o n s are a n e a r l y f a c t o r i n t h e p a t h o g e n e s i s of M C L .  3.6.2  Marginal zone lymphoma  M a r g i n a l z o n e l y m p h o m a s ( M Z L ) c o n s i s t of s e v e r a l different e n t i t i e s t h a t t o g e t h e r c o m p r i s e a p p r o x i m a t e l y 8 % of l y m p h o m a s ( R e v i e w e d b y B e r t o n i a n d Z u c c a [7]):  • mucosa-associated l y m p h o i d tissue ( M A L T )  • e x t r a n o d a l m a r g i n a l - z o n e l y m p h o m a ( E M Z L ) : T h e s e arise a t s e v e r a l different s i t e s , b u t t h e g a s t r i c l o c a t i o n is t h e m o s t  common  • n o d a l m a r g i n a l zone B - c e l l l y m p h o m a ( N M Z L ) a n d  • splenic m a r g i n a l zone l y m p h o m a ( S M Z L )  O u r results indicate that rare, p u t a t i v e l y deleterious variants i n A T M m a y b e a s s o c i a t e d w i t h i n c r e a s e d s u s c e p t i b i l i t y t o M Z L . A l t h o u g h t h e r e is n o p r e v i o u s e v i d e n c e of t h i s , these changes m a y b e a s s o c i a t e d w i t h j u s t one of t h e s u b t y p e s of M Z L , p e r h a p s one of t h e less f r e q u e n t ones.  A l t h o u g h these r e s u l t s d o n o t r e m a i n s i g n i f i c a n t after a d j u s t m e n t for t h e F D R , t h e c o r r e c t i o n , i n t h i s case, is l i k e l y t o b e o v e r l y s t r i n g e n t . T h e F D R c a l c u l a t i o n a s s u m e s  t h a t a l l v a r i a n t s / t e s t s are i n d e p e n d e n t , w h i c h i n t h e case of a l o c u s i n h i g h L D , s u c h as A T M , is n o t t h e case. A l t h o u g h s o m e efforts h a v e b e e n m a d e t o a d d r e s s t h i s issue [22], t h e r e is n o c o n s e n s u s o n t h e s u i t a b i l i t y o f t h e a s s u m p t i o n o f i n d e p e n d e n c e i n t h e case of a s s o c i a t i o n s t u d i e s s u c h as t h i s one. T h u s , t h e r e s u l t s of t h i s s t u d y s h o w t h a t c o m m o n v a r i a n t s i n t h e A T M gene, a n d h a p l o t y p e s t h e r e o f , d o n o t a p p e a r t o confer i n c r e a s e d s u s c e p t i b i l i t y t o N H L . P T C L m a y b e one s u b t y p e o f disease t h a t is a n e x c e p t i o n t o t h i s f i n d i n g .  Rare,  p u t a t i v e l y d e l e t e r i o u s v a r i a n t s m a y also p l a y a p a r t i n l y m p h o m a g e n e s i s of s o m e rare N H L subtypes.  4 Conclusions I n these e x p e r i m e n t s ,  I s e q u e n c e d t h e A T M gene i n D N A f r o m t h e b l o o d of 86  n o n - H o d g k i n l y m p h o m a ( N H L ) p a t i e n t s . I i d e n t i f i e d 79 v a r i a n t s i n t h i s p h a s e of t h e s t u d y . U s i n g h a p l o t y p e s e s t i m a t e d f r o m sequence d a t a , I i d e n t i f i e d 7 t a g S N P s a n d 6 rare v a r i a n t s t h a t were p r e d i c t e d to have a deleterious effect o n p r o t e i n f u n c t i o n . S i x of t h e t a g S N P s a n d t h e 6 rare v a r i a n t s were t h e n g e n o t y p e d i n 798 N H L cases a n d 793 c o n t r o l s . A s s o c i a t i o n studies were c a r r i e d o u t a n d o d d s r a t i o s c a l c u l a t e d for t h e 6 c o m m o n t a g S N P s separately, as w e l l as for the h a p l o t y p e s f o r m e d b y t h e m .  None  of these were f o u n d to be s i g n i f i c a n t l y a s s o c i a t e d w i t h t h e o v e r a l l r i s k of N H L . W e therefore c o n c l u d e t h a t c o m m o n i n h e r i t e d v a r i a n t s of A T M do not c o n t r i b u t e to t h e risk of N H L i n t h e general p o p u l a t i o n .  O n e of t h e c o m m o n v a r i a n t s was f o u n d  be s i g n i f i c a n t l y associated w i t h p e r i p h e r a l T - c e l l l y m p h o m a ( P T C L ) . H o w e v e r ,  to not  o n l y d i d t h i s result not r e m a i n s i g n i f i c a n t after c o r r e c t i o n for m u l t i p l e t e s t i n g , b u t also the n u m b e r of P T C L cases i n t h i s s t u d y was t o o s m a l l ( n = 2 7 ) to be  conclusive.  I n a d d i t i o n , t h e 6 rare v a r i a n t s were a n a l y z e d as a single g r o u p of p u t a t i v e l y deleterious v a r i a n t s .  T h i s s h o w e d a s i g n i f i c a n t l y i n c r e a s e d r i s k of d e v e l o p m e n t of  t w o s u b t y p e s of N H L , m a n t l e c e l l l y m p h o m a ( M C L ) a n d m a r g i n a l z o n e l y m p h o m a ( M Z L ) . W e conclude t h a t the "rare v a r i a n t - r a r e disease" m o d e l , whereby rare, delet e r i o u s v a r i a n t s i n t h e g e r m l i n e of these i n d i v i d u a l s c o n t r i b u t e s t o t h e i r r i s k of d e v e l o p i n g these r a r e s u b t y p e s of disease, m a y b e r e l e v a n t for A T M i n s o m e N H L subtypes. T h i s e x p e r i m e n t w a s n o v e l i n i t s use of t h e r a r e v a r i a n t s . M o s t a s s o c i a t i o n s t u d i e s d o n o t possess t h e p o w e r t o assess t h e r o l e of v a r i a n t s w i t h a m i n o r allele f r e q u e n c y of < 5 % .  W e i m p l e m e n t e d a m e t h o d w h e r e b y these r a r e v a r i a n t s were  grouped together based o n a functional classification. O t h e r such groups m a y i n c l u d e g e n o m i c p o s i t i o n , for i n s t a n c e , v a r i a n t s p r e s e n t i n t h e s a m e p r o t e i n d o m a i n . T h i s m a y a l l o w for t h e e l u c i d a t i o n of f a c t o r s t h a t h a v e a s u b t l e effect o n  disease  d e v e l o p m e n t , w h i c h is l i k e l y t o b e t h e case i n c o m p l e x diseases, s u c h as c a n c e r . A l l w o r k p r e s e n t e d h e r e i n w a s p e r f o r m e d b y m y s e l f e x c e p t t h e e x t r a c t i o n of D N A f r o m p a t i e n t s a m p l e s , t h e a s s e m b l y of sequence c h r o m a t o g r a m s i n t o C o n s e d a n d m o s t of t h e s t a t i s t i c a l a n a l y s e s , as s t a t e d i n t h e a p p r o p r i a t e s e c t i o n s .  5 Future Work A n i m m e d i a t e off-shoot of t h i s e x p e r i m e n t w o u l d be to e x a m i n e t h e t u m o u r s t h e i n d i v i d u a l s w i t h M C L or M Z L , w h o were h e t e r o z y g o u s ,  of  i n t h e i r g e r m l i n e , for  one of t h e 6 r a r e , p u t a t i v e l y deleterious v a r i a n t s . A n a n a l y s i s of t h i s t i s s u e w o u l d a l l o w t h e d e t e r m i n a t i o n of w h e t h e r t h e t u m o u r s were h e m i z y g o u s , i.e. h a d lost t h e n o r m a l c o p y of t h e A T M gene, or if b o t h copies of t h e gene were m u t a t e d i n t h e tumours.  T h i s m a y f u r t h e r v a l i d a t e t h e role of A T M i n t h e l y m p h o m a g e n e s i s  of  these t u m o u r s . F u r t h e r , a l a r g e r s t u d y t h a t l o o k e d at these s u b t y p e s a n d P T C L i n greater d e t a i l c o u l d v a l i d a t e o u r r e s u l t s . T h i s w o u l d also a l l o w for a b e t t e r u n d e r s t a n d i n g of t h e use of r a r e v a r i a n t s i n a s s o c i a t i o n s t u d i e s a n d p e r h a p s l e a d t o n e w  approaches  o n h o w to u s e f u l l y a n a l y z e d a t a g e n e r a t e d u s i n g s u c h v a r i a n t s . F a m i l y m e m b e r s of A T p a t i e n t s are t h o u g h t t o have a n i n c r e a s e d risk of c a n cer. If c o m m o n e n o u g h i n t h e g e n e r a l p o p u l a t i o n , these a n d e q u i v a l e n t v a r i a n t s m a y c o n t r i b u t e to t h e p o p u l a t i o n b u r d e n of t h i s disease.  C o n f i r m a t i o n of t h i s h y p o t h -  esis w o u l d r e q u i r e m u c h larger scale s t u d i e s of t h o u s a n d s of i n d i v i d u a l s , p e r h a p s  i n v o l v i n g d i r e c t e d r e - s e q u e n c i n g of t h e A T M l o c u s .  N e w sequencing  technologies  m a y m a k e s u c h e x p e r i m e n t s m o r e feasible. L i k e a l l a s s o c i a t i o n s t u d i e s , t h i s one w o u l d b e s t r e n g t h e n e d b y r e p l i c a t i o n . S i m i l a r s t u d i e s i n different p o p u l a t i o n s , o r i n different g e o g r a p h i c areas c o u l d c o n f i r m o u r r e s u l t s . S p e c i f i c a l l y , r e p l i c a t i o n or f u r t h e r i n v e s t i g a t i o n of t h e r e s u l t s w i t h P T C L w i t h a l a r g e r n u m b e r of cases w o u l d b e v a l u a b l e .  Bibliography [1] K . A l l e n - B r a d y a n d N . J . C a m p . C h a r a c t e r i z a t i o n of t h e l i n k a g e d i s e q u i l i b r i u m s t r u c t u r e a n d i d e n t i f i c a t i o n of t a g g i n g - s n p s Cancer,  i n five d n a r e p a i r genes.  BMC  5:99, 2005. 1471-2407 ( E l e c t r o n i c ) J o u r n a l A r t i c l e .  [2] W . Y . A u a n d R . L i a n g . P e r i p h e r a l t - c e l l l y m p h o m a . Curr  Oncol Rep,  4(5):434-  4 2 , 2 0 0 2 . 1523-3790 ( P r i n t ) J o u r n a l A r t i c l e R e v i e w . [3] C . B a r l o w , S. H i r o t s u n e , R . P a y l o r , M . L i y a n a g e , M . E c k h a u s , F . C o l l i n s , Y . Shiloh, J . N . Crawley, T . R i e d , D . Tagle, and A . W y n s h a w - B o r i s .  Atm-  deficient m i c e :  1996.  a p a r a d i g m of a t a x i a t e l a n g i e c t a s i a .  Cell, 8 6 ( 1 ) : 1 5 9 - 7 1 ,  0092-8674 J o u r n a l A r t i c l e . [4] J . C . B a r r e t t , B . F r y , M a i l e r J . , a n d M . D a l y . H a p l o v i e w : a n a l y s i s a n d v i s u a l i z a t i o n of Id a n d h a p l o t y p e m a p s , h t t p : / / w w w . b r o a d . m i t .  edu/mpg/haploview/  i n d e x . p h p , 2005. [5] S. G . B e c k e r - C a t a n i a a n d R . A . G a t t i . Biol,  Ataxia-telangiectasia.  Adv  Exp  Med  495:191-8, 2001. 0065-2598 ( P r i n t ) J o u r n a l A r t i c l e R e v i e w .  [6] Y . B e n j a m i n i a n d Y . H o c h b e r g . C o n t r o l l i n g t h e false d i s c o v e r y r a t e : A p r a c t i c a l and powerful Society.  Series  approach  to m u l t i p l e testing.  B (Methodological),  [7] F . B e r t o n i a n d E . Z u c c a . p h o m a . J Clin  Journal  of the  Royal  Statistical  5 7 ( l ) : 2 8 9 - 3 0 0 , 1995.  State-of-the-art  therapeutics:  marginal-zone  lym-  Oncol, 2 3 ( 2 6 ) : 6 4 1 5 - 2 0 , 2005. 0 7 3 2 - 1 8 3 X ( P r i n t ) J o u r n a l A r t i c l e  Review. [8] P . E . B o n n e n , M . D . S t o r y , C . L . A s h o r n , T . A . B u c h h o l z , M . M . W e i l , a n d D . L . Nelson.  H a p l o t y p e s at a t m i d e n t i f y c o d i n g - s e q u e n c e v a r i a t i o n a n d i n d i c a t e a  r e g i o n of e x t e n s i v e l i n k a g e d i s e q u i l i b r i u m . 2000. 0002-9297 J o u r n a l A r t i c l e .  Am  J Hum  Genet,  67(6):1437-51,  [9] J B o u l t w o o d . p h o m a . J Clin  A t a x i a t e l a n g i e c t a s i a gene m u t a t i o n s i n l e u k a e m i a a n d Pathol,  lym-  54(7):512-516, 2001.  [10] C . C . B o u r g u e t , S. G r u f f e r m a n , E . D e l z e l l , E . R . D e L o n g , a n d H . J . C o h e n . M u l t i p l e m y e l o m a a n d f a m i l y h i s t o r y of c a n c e r , a c a s e - c o n t r o l s t u d y .  Cancer,  5 6 ( 8 ) : 2 1 3 3 - 9 , 1985. 0 0 0 8 - 5 4 3 x J o u r n a l A r t i c l e . [11] A . B r o e k s , J . H . U r b a n u s , A . N . F l o o r e , E . C . D a h l e r , J . G . K l i j n , E . J . R u t g e r s , P . D e v i l e e , N . S. R u s s e l l , F . E . v a n L e e u w e n , a n d L . J . v a n ' t V e e r .  Atm-  heterozygous germline m u t a t i o n s contribute to breast cancer-susceptibility.  Am  Genet, 6 6 ( 2 ) : 4 9 4 - 5 0 0 , 2000. 0 0 0 2 - 9 2 9 7 ( P r i n t ) J o u r n a l A r t i c l e .  J Hum  [12] A . J . B r o o k e s . T a g ' n ' t e l l v 2 . 0 .  http://snp.cgb.ki.se/tagntell/.  [13] U C S C G e n o m e B r o w s e r . H u m a n m a y 2004 b u i l d ,  http://www.genome.ucsc.  e d u / , 2004. [14] P J B y r d , P R C o o p e r , T S t a n k o v i c , H S K u l l a r , G D W a t t s , P J R o b i n s o n , a n d M R T a y l o r . A gene t r a n s c r i b e d f r o m t h e b i d i r e c t i o n a l a t m p r o m o t e r c o d i n g for a s e r i n e r i c h p r o t e i n : a m i n o a c i d sequence, s t r u c t u r e a n d e x p r e s s i o n s t u d i e s . Hum.  Mol.  Genet.,  [15] E . C a m a c h o ,  5 ( 1 1 ) : 1 7 8 5 - 1 7 9 1 , 1996.  L . Hernandez,  S. H e r n a n d e z , F . T o r t , B . B e l l o s i l l o , S. B e a ,  F . Bosch, E . Montserrat, A . Cardesa, P. L . Fernandez, and E . C a m p o .  Atm  gene i n a c t i v a t i o n i n m a n t l e c e l l l y m p h o m a m a i n l y o c c u r s b y t r u n c a t i n g m u t a tions a n d missense m u t a t i o n s i n v o l v i n g the p h o s p h a t i d y l i n o s i t o l - 3 kinase dom a i n a n d is a s s o c i a t e d w i t h i n c r e a s i n g n u m b e r s of c h r o m o s o m a l Blood,  imbalances.  9 9 ( l ) : 2 3 8 - 4 4 , 2002. 0 0 0 6 - 4 9 7 1 ( P r i n t ) J o u r n a l A r t i c l e .  [16] L . R . C a r d o n a n d J . I. B e l l . Nat Rev  A s s o c i a t i o n s t u d y designs for c o m p l e x  diseases.  Genet, 2 ( 2 ) : 9 1 - 9 , 2 0 0 1 . 1471-0056 ( P r i n t ) J o u r n a l A r t i c l e R e v i e w .  [17] B . D e v l i n , K . R o e d e r , a n d L . W a s s e r m a n . to genetic-based  association studies.  Theor  Genomic control, a new Popul  Biol,  approach  60(3):155-66,  2001.  0040-5809 J o u r n a l A r t i c l e R e v i e w R e v i e w , T u t o r i a l . [18] B . E w i n g a n d P . G r e e n .  B a s e - c a l l i n g of a u t o m a t e d  p h r e d . i i . e r r o r p r o b a b i l i t i e s . Genome  sequencer traces using  Res, 8 ( 3 ) : 1 8 6 - 9 4 , 1998. 1088-9051 ( P r i n t )  Journal Article. [19] B . E w i n g , L . H i l l i e r , M . C . W e n d l , a n d P . G r e e n . B a s e - c a l l i n g of s e q u e n c e r t r a c e s u s i n g p h r e d . i . a c c u r a c y assessment. 1998. 1088-9051 ( P r i n t ) J o u r n a l A r t i c l e .  Genome  automated  Res, 8(3): 1 7 5 - 8 5 ,  [20] N . Y . F a n g , T . C . G r e i n e r , D . D . W e i s e n b u r g e r ,  W . C . C h a n , J . M . Vose,  L . M . S m i t h , J . O . A r m i t a g e , R . A . M a y e r , B . L . P i k e , F . S. C o l l i n s , a n d J . G . H a c i a . O l i g o n u c l e o t i d e m i c r o a r r a y s d e m o n s t r a t e t h e h i g h e s t f r e q u e n c y of a t m m u t a t i o n s i n t h e m a n t l e c e l l s u b t y p e of l y m p h o m a . Proc Natl Acad Sci  USA,  1 0 0 ( 9 ) : 5 3 7 2 - 7 , 2003. 0 0 2 7 - 8 4 2 4 ( P r i n t ) J o u r n a l A r t i c l e . [21] V . F e r n a n d e z , E . H a r t m a n n , G . O t t , E . C a m p o , a n d A . R o s e n w a l d .  Pathogen-  esis of m a n t l e - c e l l l y m p h o m a : a l l o n c o g e n i c r o a d s l e a d t o d y s r e g u l a t i o n of c e l l cycle a n d d n a damage response pathways.  J Clin  Oncol,  2 3 ( 2 6 ) : 6 3 6 4 - 9 , 2005.  0732-183X (Print) Journal Article Review. [22] M . A . F e r r e i r a , L . O ' G o r m a n , P . L e Souef, P . R . B u r t o n , B . G . T o e l l e , C . F . R o b e r t s o n , P. M . Visscher, N . G . M a r t i n , a n d D . L . Duffy. R o b u s t  estimation  of e x p e r i m e n t w i s e p v a l u e s a p p l i e d t o a g e n o m e s c a n of m u l t i p l e a s t h m a t r a i t s i d e n t i f i e s a n e w r e g i o n of s i g n i f i c a n t l i n k a g e o n c h r o m o s o m e 2 0 q l 3 . Am  J  Hum  Genet, 7 7 ( 6 ) : 1 0 7 5 - 8 5 , 2 0 0 5 . 0 0 0 2 - 9 2 9 7 ( P r i n t ) J o u r n a l A r t i c l e . [23] J . F . F r a u m e n i , W . W e r t e l e c k i , W . A . B l a t t n e r , R . D . J e n s e n , a n d B . G . L e v e n t h a l . V a r i e d m a n i f e s t a t i o n s of a f a m i l i a l l y m p h o p r o l i f e r a t i v e d i s o r d e r . Am Med,  J  5 9 ( 1 ) : 1 4 5 - 5 1 , 1975. 0 0 0 2 - 9 3 4 3 J o u r n a l A r t i c l e .  [24] R . A . G a t t i , S. B e c k e r - C a t a n i a , H . H . C h u n , X . S u n , M . M i t u i , C . H . L a i , N . K h a n l o u , M . B a b a e i , R . C h e n g , C . C l a r k , Y . H u o , N . C . U d a r , a n d R . K . Iyer. T h e p a t h o g e n e s i s of a t a x i a - t e l a n g i e c t a s i a , l e a r n i n g f r o m a r o s e t t a s t o n e . Rev  Allergy  Immunol,  20(1):87-108, 2001.  Clin  1080-0549 ( P r i n t ) J o u r n a l A r t i c l e  Review. [25] R . A . G a t t i , I. B e r k e l , E . B o d e r , G . B r a e d t , P . C h a r m l e y , P . C o n c a n n o n , F . E r soy, T . F o r o u d , N . G . J a s p e r s , K . L a n g e , a n d et a l . L o c a l i z a t i o n of a n a t a x i a t e l a n g i e c t a s i a gene t o c h r o m o s o m e l l q 2 2 - 2 3 .  Nature,  3 3 6 ( 6 1 9 9 ) : 5 7 7 - 8 0 , 1988.  0028-0836 ( P r i n t ) J o u r n a l A r t i c l e . [26] R . A . G a t t i , A . T w a r d , a n d P . C o n c a n n o n .  Cancer risk i n a t m heterozygotes:  a m o d e l of p h e n o t y p i c a n d m e c h a n i s t i c differences b e t w e e n m i s s e n s e a n d t r u n cating mutations.  Mol  Genet  Metab,  6 8 ( 4 ) : 4 1 9 - 2 3 , 1999.  1096-7192 ( P r i n t )  Journal Article Review. [27] A . A . G o o d a r z i , J . C . J o n n a l a g a d d a , Moorhead,  P. Douglas, D . Young, R. Ye, G . B .  S. P . L e e s - M i l l e r , a n d K . K . K h a n n a .  Autophosphorylation  a t a x i a - t e l a n g i e c t a s i a m u t a t e d is r e g u l a t e d b y p r o t e i n p h o s p h a t a s e J, 2 3 ( 2 2 ) : 4 4 5 1 - 6 1 , 2004. 0 2 6 1 - 4 1 8 9 ( P r i n t ) J o u r n a l A r t i c l e .  2a.  of  Embo  [28] D . G o r d o n , C . A b a j i a n , a n d P . G r e e n . C o n s e d : a g r a p h i c a l t o o l for s e q u e n c e finishing.  Genome  8 ( 3 ) : 1 9 5 - 2 0 2 , 1998. 1088-9051 J o u r n a l A r t i c l e .  Res,  [29] T . C . G r e i n e r , C . D a s g u p t a , V . V . H o , D . D . W e i s e n b u r g e r , L . M . S m i t h , J . C . L y n c h , J . M . Vose, K . F u , J . O . A r m i t a g e , R . M . B r a z i e l , E . C a m p o , J . Delabie, R . D . G a s c o y n e , E . S. Jaffe, H . K . M u l l e r - H e r m e l i n k , G . O t t , A . R o s e n w a l d , L. M . Staudt, M . Y . Im, M . W . K a r a m a n , B . L . Pike, W . C. Chan, and J . G . H a c i a . M u t a t i o n a n d g e n o m i c d e l e t i o n s t a t u s of a t a x i a t e l a n g i e c t a s i a m u t a t e d ( a t m ) a n d p 5 3 c o n f e r specific gene e x p r e s s i o n profiles i n m a n t l e c e l l l y m p h o m a . Proc  Natl  Acad  Sci  1 0 3 ( 7 ) : 2 3 5 2 - 7 , 2006.  USA,  0027-8424 ( P r i n t ) J o u r n a l  Article. [30] F . G u m y - P a u s e , P . W a c k e r , a n d A . P . S a p p i n o . A t m gene a n d l y m p h o i d m a lignancies.  Leukemia,  1 8 ( 2 ) : 2 3 8 - 4 2 , 2004.  0887-6924 J o u r n a l A r t i c l e R e v i e w  Review, Tutorial. [31] N a n c y L e e H a r r i s , H a r a l d S t e i n , S a r a h E . C o u p l a n d , M i c h a e l H u m m e l , R i c cardo D a l l a Favera, L a u r a Pasqualucci, and W i n g C . C h a n . N e w t o l y m p h o m a d i a g n o s i s . Hematology, [32] J . H . H o e i j m a k e r s . Nature,  approaches  2 0 0 1 ( l ) : 1 9 4 - 2 2 0 , 2001.  G e n o m e m a i n t e n a n c e m e c h a n i s m s for p r e v e n t i n g  cancer.  411 (6835) : 3 6 6 - 7 4 , 2 0 0 1 . 0 0 2 8 - 0 8 3 6 ( P r i n t ) J o u r n a l A r t i c l e R e v i e w .  [33] R . D . J o h n s o n a n d M . J a s i n . S i s t e r c h r o m a t i d gene c o n v e r s i o n is a p r o m i n e n t d o u b l e - s t r a n d b r e a k r e p a i r p a t h w a y i n m a m m a l i a n cells. Embo J, 1 9 ( 1 3 ) : 3 3 9 8 4 0 7 , 2000. 0 2 6 1 - 4 1 8 9 ( P r i n t ) J o u r n a l A r t i c l e . [34] X . K e a n d L . R . C a r d o n . Bioinformatics,  E f f i c i e n t selective s c r e e n i n g of h a p l o t y p e t a g s n p s .  1 9 ( 2 ) : 2 8 7 - 8 , 2003. 1 3 6 7 - 4 8 0 3 J o u r n a l A r t i c l e .  [35] M . F . L a v i n , G . B i r r e l l , P . C h e n , S. K o z l o v , S. S c o t t , a n d N . G u e v e n . signaling a n d genomic stability i n response to d n a damage.  Mutat  Res,  Atm 569(1-  2):123-32, 2005. 0027-5107 J o u r n a l A r t i c l e . [36] J . H . L e e a n d T . T . P a u l l .  D i r e c t a c t i v a t i o n of t h e a t m p r o t e i n k i n a s e b y  the m r e l l / r a d 5 0 / n b s l complex.  Science,  3 0 4 ( 5 6 6 7 ) : 9 3 - 6 , 2004.  1095-9203  (Electronic) Journal Article. [37] N . C . L e v i t t a n d I. D . H i c k s o n . C a r e t a k e r t u m o u r s u p p r e s s o r genes t h a t d e f e n d g e n o m e i n t e g r i t y . Trends Journal Article Review.  Mol  Med,  8 ( 4 ) : 1 7 9 - 8 6 , 2002.  1471-4914 ( P r i n t )  [38]  A . L i , Y . H u a n g , a n d M . S w i f t . N e u t r a l s e q u e n c e v a r i a n t s a n d h a p l o t y p e s at t h e 150 k b a t a x i a - t e l a n g i e c t a s i a l o c u s .  Am  J Med  86(2):140-4,  Genet,  1999.  0148-7299 ( P r i n t ) J o u r n a l A r t i c l e . [39]  K . J . L i v a k . A l l e l i c d i s c r i m i n a t i o n u s i n g f l u o r o g e n i c p r o b e s a n d t h e 5' n u c l e a s e assay.  Genet Anal,  14(5-6): 1 4 3 - 9 , 1999. J o u r n a l A r t i c l e .  [40] M . L o b r i c h a n d P . A . J e g g o . H a r m o n i s i n g t h e r e s p o n s e t o d s b s : a n e w s t r i n g i n the a t m bow.  DNA  Repair  (Amst),  4(7):749-59, 2005.  1568-7864 ( P r i n t )  Journal Article Review. [41]  H . T . L y n c h , J . N . M a r c u s , D . D . Weisenburger,  P. Watson, M . L . Fitzsim-  mons, H . Grierson, D . M . S m i t h , J . L y n c h , and D . Purtilo. Genetic and i m munopathological  findings i n a l y m p h o m a family.  Br  J Cancer,  59(4):622-6,  1989. 0 0 0 7 - 0 9 2 0 J o u r n a l A r t i c l e . [42] M . M a t s u o k a . P t c l : lessons f r o m a d u l t t - c e l l l e u k e m i a . Int J Hematol,  76 S u p p l  2 : 1 1 6 - 7 , 2002. 0 9 2 5 - 5 7 1 0 ( P r i n t ) J o u r n a l A r t i c l e R e v i e w . [43] M . J . M c E a c h e r n , A . K r a u s k o p f , a n d E . H . B l a c k b u r n . c o n t r o l . Annu  Rev  Telomeres and their  Genet, 3 4 : 3 3 1 - 3 5 8 , 2 0 0 0 . 0 0 6 6 - 4 1 9 7 ( P r i n t ) J o u r n a l A r t i c l e  Review. [44]  P . J . M c K i n n o n . A t m a n d a t a x i a t e l a n g i e c t a s i a . EMBO  Rep,  5 ( 8 ) : 7 7 2 - 6 , 2004.  1469-221x J o u r n a l A r t i c l e R e v i e w R e v i e w , T u t o r i a l . [45] J . A . M e t c a l f e , J . P a r k h i l l , L . C a m p b e l l , M . S t a c e y , P . B i g g s , P . J . B y r d , a n d A . M . Taylor. Genet,  Accelerated  1 3 ( 3 ) : 3 5 0 - 3 , 1996.  [46] M . N e i a n d J . C . M i l l e r .  telomere shortening i n a t a x i a telangiectasia.  Nat  1061-4036 ( P r i n t ) J o u r n a l A r t i c l e . A s i m p l e m e t h o d for e s t i m a t i n g average n u m b e r  of  nucleotide substitutions w i t h i n and between populations from restriction data. Genetics, [47]  125(4) : 8 7 3 - 9 , 1990. 0 0 1 6 - 6 7 3 1 ( P r i n t ) J o u r n a l A r t i c l e .  D . A . Nickerson.  Displaying genotype data: V i s u a l genotypes.  http://pga.  gs.Washington.edu/VG2.html, 2005. [48] D . A . N i c k e r s o n , S. L . T a y l o r , K . M . W e i s s , A . G . C l a r k , R . G . H u t c h i n s o n , J . Stengard, V . Salomaa, E . Vartiainen, E . Boerwinkle, and C. F . Sing. s e q u e n c e d i v e r s i t y i n a 9 . 7 - k b r e g i o n of t h e h u m a n l i p o p r o t e i n l i p a s e gene. Genet,  1 9 ( 3 ) : 2 3 3 - 4 0 , 1998.  1061-4036 ( P r i n t ) J o u r n a l A r t i c l e .  Dna Nat  [49]  D . A . N i c k e r s o n , V . O . T o b e , a n d S. L . T a y l o r .  Polyphred:  automating the  detection a n d genotyping of single nucleotide s u b s t i t u t i o n s using fluorescencebased resequencing.  Nucleic  Res, 2 5 ( 1 4 ) : 2 7 4 5 - 5 1 , 1997. 0 3 0 5 - 1 0 4 8 J o u r -  Acids  nal Article. [50] N a t i o n a l  Cancer  Institute  of  Canada.  Canadian  cancer  statistics.  http://www.ncic.cancer.ca/vgn/images/portal/cit_86751114/31/ 23/935505938cw_2006stats_en. pdf. pdf, 2006. [51] T . K . P a n d i t a . A m u l t i f a c e t e d r o l e for a t m i n g e n o m e m a i n t e n a n c e . Mol [52]  Expert  Rev  Med, 2 0 0 3 : 1 - 2 1 , 2 0 0 3 . 1462-3994 N e w s .  D . M . P a r k i n , F . B r a y , J . Ferlay, a n d P . P i s a n i . G l o b a l cancer statistics, 2002. CA  Cancer  J Clin,  5 5 ( 2 ) : 7 4 - 1 0 8 , 2005. 0 0 0 7 - 9 2 3 5 ( P r i n t ) J o u r n a l A r t i c l e .  [53] P . D . P h a r o a h , A . M . D u n n i n g , B . A . P o n d e r ,  and D . F . Easton.  t i o n s t u d i e s for finding c a n c e r - s u s c e p t i b i l i t y g e n e t i c v a r i a n t s . Nat Rev  AssociaCancer,  4 ( l l ) : 8 5 0 - 6 0 , 2004. 1 4 7 4 - 1 7 5 X ( P r i n t ) J o u r n a l A r t i c l e R e v i e w . [54]  PolyPhen:  p r e d i c t i o n o f f u n c t i o n a l effect o f h u m a n n s S N P s .  http://tux.  embl-heidelberg.de/raimensky/. [55]  S. R o z e n a n d H . S k a l e t s k y .  Primer3.  http://frodo.wi.mit.edu/cgi-bin/  primer3/primer3_www.cgi, 2 0 0 0 . [56] K . S a v i t s k y , A . B a r - S h i r a , S. G i l a d , G . R o t m a n , Y . Z i v , L . V a n a g a i t e , D . A . T a g l e , S. S m i t h , T . U z i e l , S. Sfez, a n d et a l . A s i n g l e a t a x i a gene w i t h a p r o d u c t s i m i l a r t o p i - 3 k i n a s e . Science,  telangiectasia  268(5218):1749-53, 1995.  0036-8075 J o u r n a l A r t i c l e . [57] K S a v i t s k y , M P l a t z e r , T U z i e l , S G i l a d , A S a r t i e l , A R o s e n t h a l , O E l r o y Stein, Y Shiloh, a n d G R o t m a n .  Ataxia-telangiectasia: structural diversity of  u n t r a n s l a t e d sequences suggests c o m p l e x p o s t - t r a n s c r i p t i o n a l r e g u l a t i o n o f a t m gene e x p r e s s i o n . [58]  Nucl.  Acids  Res., 2 5 ( 9 ) : 1 6 7 8 - 1 6 8 4 , 1997.  C . Schaffner, I . I d l e r , S. S t i l g e n b a u e r , H . D o h n e r , a n d P . L i c h t e r . M a n t l e c e l l l y m p h o m a is c h a r a c t e r i z e d b y i n a c t i v a t i o n o f t h e a t m gene. Proc Natl Acad Sci USA,  9 7 ( 6 ) : 2 7 7 3 - 8 , 2000. 0 0 2 7 - 8 4 2 4 ( P r i n t ) J o u r n a l A r t i c l e .  [59] D . J . S c h a i d . H a p l o . s t a t s , http://mayoresearch.mayo.edu/mayo/research/ biostat/schaid.cfm.  [60] S. P . S c o t t , R . B e n d i x , P . C h e n , R . C l a r k , T . D o r k , a n d M . F . L a v i n . M i s s e n s e mutations b u t not allelic variants alter t h e function of a t m b y d o m i n a n t interference i n p a t i e n t s w i t h b r e a s t c a n c e r . Proc Natl Acad Sci USA,  99(2):925-30,  2002. 0 0 2 7 - 8 4 2 4 J o u r n a l A r t i c l e . [61] P . S e b a s t i a n i , R . L a z a r u s , S. T . W e i s s , L . M . K u n k e l , I. S . K o h a n e , a n d M . F . R a m o n i . M i n i m a l h a p l o t y p e t a g g i n g . Proc Natl Acad Sci USA,  100(17):9900-  5, 2003. 0 0 2 7 - 8 4 2 4 J o u r n a l A r t i c l e . [62] Y . S h i l o h . A t m a n d r e l a t e d p r o t e i n k i n a s e s : s a f e g u a r d i n g g e n o m e i n t e g r i t y . Nat Rev  Cancer,  3 ( 3 ) : 1 5 5 - 6 8 , 2 0 0 3 . 1474-175x J o u r n a l A r t i c l e R e v i e w .  [63] O . S h p i l b e r g , M . M o d a n , B . M o d a n , A . C h e t r i t , Z . F u c h s , a n d B . R a m o t . F a m i l i a l aggregation of h a e m a t o l o g i c a l neoplasms: Haematol,  a controlled study.  Br J  8 7 ( l ) : 7 5 - 8 0 , 1994. 0007-1048 J o u r n a l A r t i c l e .  [64] A m e r i c a n C a n c e r S o c i e t y . S t a t i s t i c s f o r 2005. http: //www. c a n c e r . o r g , 2005. [65] S P S S , http://www.spss.com. [66] M . S t e p h e n s a n d P . D o n n e l l y . A c o m p a r i s o n o f b a y e s i a n m e t h o d s f o r h a p l o t y p e r e c o n s t r u c t i o n f r o m p o p u l a t i o n g e n o t y p e d a t a . Am J Hum Genet, 7 3 ( 5 ) : 1 1 6 2 - 9 , 2003. 0002-9297 J o u r n a l A r t i c l e . [67] M . S t e p h e n s , N . J . S m i t h , a n d P . D o n n e l l y .  A n e w s t a t i s t i c a l m e t h o d for  h a p l o t y p e r e c o n s t r u c t i o n f r o m p o p u l a t i o n d a t a . Am J Hum Genet,  68(4):978-  89, 2001. 0002-9297 J o u r n a l A r t i c l e . [68] D . O . S t r a m , C . A . H a i m a n , J . N . H i r s c h h o r n , D . A l t s h u l e r , L . N . K o l o n e l , B . E . Henderson, a n d M . C . P i k e . C h o o s i n g haplotype-tagging snps based o n unphased genotype d a t a using a preliminary sample of unrelated subjects w i t h a n e x a m p l e f r o m t h e m u l t i e t h n i c c o h o r t s t u d y . Hum Hered, 5 5 ( l ) : 2 7 - 3 6 , 2003. 0001-5652 J o u r n a l A r t i c l e . [69] S. S u n y a e v , V . R a m e n s k y , a n d P . B o r k . T o w a r d s a s t r u c t u r a l b a s i s o f h u m a n non-synonymous  single nucleotide p o l y m o r p h i s m s .  Trends  Genet,  16(5):198-  200, 2000. 0 1 6 8 - 9 5 2 5 J o u r n a l A r t i c l e R e v i e w R e v i e w , T u t o r i a l . [70] S. S u n y a e v , V . R a m e n s k y , I. K o c h , 3 r d L a t h e , W . , A . S. K o n d r a s h o v , a n d P . B o r k . P r e d i c t i o n o f d e l e t e r i o u s h u m a n alleles. Hum Mol Genet, 2001. 0964-6906 J o u r n a l A r t i c l e .  10(6):591-7,  [71] A . M . T a y l o r , J . A . M e t c a l f e , J . T h i c k , a n d Y . F . M a k . L e u k e m i a a n d l y m p h o m a in a t a x i a telangiectasia.  Blood,  8 7 ( 2 ) : 4 2 3 - 3 8 , 1996. 0 0 0 6 - 4 9 7 1 J o u r n a l A r t i c l e  Review. [72] Y . R . T h o r s t e n s o n , P . S h e n , V . G . T u s h e r , T . L . W a y n e , R . W . D a v i s , G . C h u , a n d P . J . O e f n e r . G l o b a l a n a l y s i s of a t m p o l y m o r p h i s m reveals s i g n i f i c a n t f u n c tional constraint.  Am  J Hum  Genet,  69(2):396-412, 2001.  0002-9297 J o u r n a l  Article. [73] T a m a r  Uziel,  Kinneret Savitsky, M a t t h i a s Platzer, Y a e l Ziv, T a l Helbitz,  M i c h a e l Nehls, T h o m a s B o e h m , A n d r e Rosenthal, Yosef Shiloh, and G a l i t R o t m a n . G e n o m i c o r g a n i z a t i o n of t h e a t m gene. Genomics,  3 3 ( 2 ) : 3 1 7 - 3 2 0 , 1996.  T Y - JOUR. [74] K . V a l e r i e a n d L . F . P o v i r k . R e g u l a t i o n a n d m e c h a n i s m s of m a m m a l i a n d o u b l e s t r a n d b r e a k r e p a i r . Oncogene,  2 2 ( 3 7 ) : 5 7 9 2 - 8 1 2 , 2003. 0 9 5 0 - 9 2 3 2 ( P r i n t ) J o u r -  nal Article Review. [75] D . C . v a n G e n t , J . H . H o e i j m a k e r s , a n d R . K a n a a r . C h r o m o s o m a l s t a b i l i t y a n d the d n a double-stranded break connection.  Nat Rev  Genet, 2 ( 3 ) : 1 9 6 - 2 0 6 , 2 0 0 1 .  1471-0056 ( P r i n t ) J o u r n a l A r t i c l e R e v i e w . [76] I. V o r e c h o v s k y , D . R a s i o , L . L u o , C . M o n a c o , L . H a m m a r s t r o m , A . D . W e b s t e r , J . Z a l o u d i k , G . B a r b a n t i - B r o d a n i , M . J a m e s , G . R u s s o , a n d et a l . T h e gene a n d s u s c e p t i b i l i t y t o b r e a s t c a n c e r : n o e v i d e n c e for m u t a t i o n . Cancer  a n a l y s i s of 38 b r e a s t t u m o r s  atm  reveals  Res, 5 6 ( 1 2 ) : 2 7 2 6 - 3 2 , 1996. 0 0 0 8 - 5 4 7 2 ( P r i n t )  Journal Article. [77] S. W a c h o l d e r , S. C h a n o c k , M . G a r c i a - C l o s a s , L . E l G h o r m l i , a n d N . R o t h m a n . A s s e s s i n g t h e p r o b a b i l i t y t h a t a p o s i t i v e r e p o r t is false: a n a p p r o a c h for m o l e cular epidemiology  s t u d i e s . J Natl  Inst, 9 6 ( 6 ) : 4 3 4 - 4 2 , 2004. 1460-2105  Cancer  (Electronic) J o u r n a l Article. [78] E . W e t e r i n g s a n d D . C . v a n G e n t . joining:  a synopsis  of s y n a p s i s .  T h e m e c h a n i s m of n o n - h o m o l o g o u s e n d -  DNA  Repair  (Amst),  3(ll):1425-35,  2004.  1568-7864 ( P r i n t ) J o u r n a l A r t i c l e R e v i e w . [79] P . H . W i e r n i k , S. Q . W a n g , X . P . H u , P . M a r i n o , a n d E . P a i e t t a . A g e of onset e v i d e n c e for a n t i c i p a t i o n i n f a m i l i a l n o n - h o d g k i n ' s l y m p h o m a . Br J  Haematol,  1 0 8 ( l ) : 7 2 - 9 , 2000. 0 0 0 7 - 1 0 4 8 J o u r n a l A r t i c l e . [80] K . K . W o n g , R . S. M a s e r , R . M . B a c h o o , J . M e n o n , D . R . C a r r a s c o , Y . G u , F. W . A l t , and R. A . DePinho.  Telomere  dysfunction  and atm  deficiency  c o m p r o m i s e s o r g a n h o m e o s t a s i s a n d a c c e l e r a t e s a g e i n g . Nature,  421(6923):643-  8, 2 0 0 3 . 0 0 2 8 - 0 8 3 6 ( P r i n t ) J o u r n a l A r t i c l e . [81] C . W y m a n , D . R i s t i c , a n d R . K a n a a r . double-strand break repair.  DNA  Repair  Homologous recombination-mediated (Amst),  3(8-9) : 8 2 7 - 3 3 , 2004.  1568-  7864 ( P r i n t ) J o u r n a l A r t i c l e R e v i e w . [82] Y . X u , T . A s h l e y , E . E . B r a i n e r d , R . T . B r o n s o n , M . S. M e y n , a n d D . B a l t i more.  T a r g e t e d d i s r u p t i o n of a t m l e a d s t o g r o w t h r e t a r d a t i o n , c h r o m o s o m a l  f r a g m e n t a t i o n d u r i n g m e i o s i s , i m m u n e defects, a n d t h y m i c l y m p h o m a . Dev,  1 0 ( 1 9 ) : 2 4 1 1 - 2 2 , 1996. 0 8 9 0 - 9 3 6 9 ( P r i n t ) J o u r n a l A r t i c l e .  Genes  Appendix A  Primers and probes A.l  P C R primers  L i s t e d here are t h e sequences a n d a n n e a l i n g t e m p e r a t u r e s of t h e p r i m e r s u s e d t o P C R a m p l i f y t h e r e g i o n s of i n t e r e s t o f A T M , p r i o r t o s e q u e n c i n g .  A. 2  Tag M a n sssays  T h i s t a b l e l i s t s t h e sequence o f t h e p r i m e r s a n d p r o b e s u s e d t o g e n o t y p e t h e 12 s e l e c t e d v a r i a n t s of A T M . T h e s e p r i m e r s a n d p r o b e s were d e s i g n e d a n d g e n e r a t e d b y Assays  — by — Design  SM  (Applied Biosystems, C A , U S A ) .  Table A . l : P C R primers and conditions amplicon Promoter L e a d e r exon l a Exon 3 Intron 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exon 9 E x o n 10 E x o n 11 E x o n 12 E x o n 13 E x o n 14 E x o n 15 E x o n 16 E x o n 17 E x o n 18 E x o n 19 E x o n 20 E x o n 21 E x o n 22 E x o n 23 E x o n 24 E x o n 25 E x o n 26 E x o n 27 E x o n 28 E x o n 29 E x o n 30 E x o n 31 E x o n 32 E x o n 33 E x o n 34 E x o n 35 E x o n 36 E x o n 37 E x o n 38 E x o n 39 E x o n 40 E x o n 41 E x o n 42 E x o n 43 E x o n 44 E x o n 45 E x o n 46 E x o n 47 E x o n 48 E x o n 49 E x o n 50 E x o n 51 E x o n 52 E x o n 53 E x o n 54 E x o n 55 E x o n 56 E x o n 57 E x o n 58 E x o n 59 E x o n 60 E x o n 61 E x o n 62 E x o n 63 E x o n 64 E x o n 65 3'UTRl 3'UTR2 3'UTR3 3'UTR4 3'UTR5 3'UTR6 3'UTR7 3'UTR8 3'UTR9 3'UTRIO 3'UTRll 3'UTR12  annealing temperature(C) 60 60 61 61 60 60 58 58 60 61 57 57 60 60 58 62 58 58 61 56 56 60 60 62 62 61 61 61 58 61 56 58 62 61 58 56 62 62 62 58 58 58 56 58 56 52 56 52 56 54 60 56 60 56 61 58 60 60 60 62 62 60 60 60 58 60 55 58 60 60 60 58 58 61 58 61 57 62  product size (bp) 530 535 531 576 318 408 375 335 377 480 383 417 601 388 331 513 415 321 335 361 418 335 396 247 317 305 380 418 507 296 406 407 395 418 420 374 453 315 389 379 285 415 272 298 272 392 284 308 481 409 284 410 425 350 426 390 285 385 285 341 420 326 315 270 326 414 617 574 508 493 735 517 527 533 481 520 521 422  F o r w a r d primer sequence TGTAAAACGACGGCCAGTtccttctgtccagcatagcc TGTAAAACGACGGCCAGTttccgtcctcagacttggag TGTAAAACGACGGCCAGTtcagttccgccaacatactg TGTAAAACGACGGCCAGTctgctgcccagatatgacttc TGTAAAACGACGGCCAGTtttttcacacctctttctctcta TGTAAAACGACGGCCAGTtgctgccgtcaactagaaca TGTAAAACGACGGCCAGTgctctttgtgatggcatgaa TGTAAAACGACGGCCAGTgccattccaagtgtcttattttt TGTAAAACGACGGCCAGTcctttttctgtatgggattatgg TGTAAAACGACGGCCAGTttttctttcagcataccacttca TGTAAAACGACGGCCAGTtaacgctgatgcagcttgac TGTAAAACGACGGCCAGTgtgctgttccactccaacct TGTAAAACGACGGCCAGTtggaaatgatggtgattctct TGTAAAACGACGGCCAGTgccaggcactgtcctgata TGTAAAACGACGGCCAGTtctaggatccaaattttagaagtcaa TGTAAAACGACGGCCAGTagtctttgaatgatgtagatactagg TGTAAAACGACGGCCAGTtccaggatatgccaccttta TGTAAAACGACGGCCAGTtcaaagtacactgtaaaaagcaatact TGTAAAACGACGGCCAGTagaaaacactgtctgccaagaa TGTAAAACGACGGCCAGTgtgcccagcctgattaggta TGTAAAACGACGGCCAGTtgaagaggaggaaatttgagtt TGTAAAACGACGGCCAGTgcacccggcctatgttta TGTAAAACGACGGCCAGTgatgttcttgaacttctgaaacca TGTAAAACGACGGCCAGTttcagtgagttttctgagtgcttt TGTAAAACGACGGCCAGTgcagtctttgtttgttaatgagtaat TGTAAAACGACGGCCAGTtgctttggaaagtagggtttg TGTAAAACGAGGGCCAGTtctggagttcagttgggatttta TGTAAAACGACGGCCAGTccatctcatagatgaggaaatcaa TGTAAAACGACGGCCAGTctttaatgctgatggtattaaaacag TGTAAAACGACGGCCAGTtgagctgtcttgacgttcaca TGTAAAACGACGGCCAGTggtttttgaatttgggggtta TGTAAAACGACGGCCAGTaaagtgtatttattgtagccgagtat TGTAAAACGACGGCCAGTggcatataagaattagagatgctgaac TGTAAAACGACGGCCAGTaagctgggtatcttagacgtaa TGTAAAACGACGGCCAGTaacattgtagggtttgcagt TGTAAAACGACGGCCAGTtgagctactcatgacttaaaacct TGTAAAACGACGGCCAGTggttaattcttgaagtacagaaaaaca TGTAAAACGACGGCCAGTcagtggaggttaacattcatcaag TGTAAAACGACGGCCAGTttgtgtaggaaaggtacaatgatttc TGTAAAACGACGGCCAGTatatgtcaacggggcatgaa TGTAAAACGACGGCCAGTgaaggaagaaggtgtgtaagca TGTAAAACGACGGCCAGTggaaatgtggtttttgggaat TGTAAAACGACGGCCAGTagtatatgtattcaggagcttccaa TGTAAAACGACGGCCAGTttgggagttacatattggtaatgatac TGTAAAACGACGGCCAGTaattctgtttatgaaggagttatgtg TGTAAAACGACGGCCAGTccagctgatattttgggatttt TGTAAAACGACGGCCAGTttgtcctttggtgaagctattt TGTAAAACGACGGCCAGTaaacatttatttccctgaaaacc TGTAAAACGACGGCCAGTttctagtcttgtcactacaaaagttcc TGTAAAACGACGGCCAGTcctcaatgaatggtagttgc TGTAAAACGACGGCCAGTatgaagggcagttgggtaca TGTAAAACGACGGCCAGTaccttaatttgagtgattctttag TGTAAAACGACGGCCAGTccctgggataaaaacccaac TGTAAAACGACGGCCAGTttgtgctaatagaggagcactgtc TGTAAAACGACGGCCAGTcgctctacccactgcagtatc TGTAAAACGACGGCCAGTttgtgcataaattctgtttttctc TGTAAAACGACGGCCAGTtgcttgaccttcaatgctgt TGTAAAACGACGGCCAGTtcacatcgtcatttgtttctctg TGTAAAACGACGGCCAGTctattctcagatgactctgtgttttt TGTAAAACGACGGCCAGTaaatgctttgcactgactctga TGTAAAACGACGGCCAGTctgttcatctttattgccccta TGTAAAACGACGGCCAGTcatcatttaagtaggctaaaaatcct TGTAAAACGACGGCCAGTcgtaggtaacatgtggtttcttg TGTAAAACGACGGCCAGTagcataggctcagcatactacac TGTAAAACGACGGCCAGTtggcttatttgtatgatactggttct TGTAAAACGACGGCCAGTtgcaaacgaaatctcaggtg TGTAAAACGACGGCCAGTatggaaagcttgggtgtgat TGTAAAACGACGGCCAGTtggtcttaaggaacatctctgc TGTAAAACGACGGCCAGTtggatttttcctagtaagatcactca TGTAAAACGACGGCCAGTtttcagatctctgtttcttgatgtc TGTAAAACGACGGCCAGTccaaggcaaacacacttcct TGTAAAACGACGGCCAGTctggtttttcattcccctca TGTAAAACGACGGCCAGTcccctcatttttgaccgtaa TGTAAAACGACGGCCAGTcaaatgggtgattgagctttc TGTAAAACGACGGCCAGTtgtctttaagaaagccctgaaa TGTAAAACGACGGCCAGTcagggttgccattgtaUcc TGTAAAACGACGGCCAGTaagttgtccaaggcaagaaga TGTAAAACGACGGCCAGTaggttcacaaactcttggtca  Reverse p r i m e r sequence CAGGAAACAGCTATGACaacactgccccaaaacattc CAGGAAACAGCTATGACgacagactgggtcgcacac CAGGAAACAGCTATGACttttccccatggtgtgactt CAGGAAACAGCTATGACcccatcccccaacactatta CAGGAAACAGCTATGACcaggcgcttaaatttctcaa CAGGAAACAGCTATGACtgccaaattcatatgcaagg CAGGAAACAGCTATGACcaaacttatgcaacagttaagtcc CAGGAAACAGCTATGACcagagtgctttctttggtgaag CAGGAAACAGCTATGACctgagtctaaaacatggtcttgc CAGGAAACAGCTATGACtcaaccagagaaatccagagg CAGGAAACAGCTATGACcacaggttttaaaagcccaaa CAGGAAACAGCTATGACggtttgggggtagacaaatg CAGGAAACAGCTATGACtgatcagggatatgtgagtgtg CAGGAAACAGCTATGACaaagccatctggcatcaaat CAGGAAACAGCTATGACtgcagctactacccagctaaaa CAGGAAACAGCTATGACcctttactgccactttgctt CAGGAAACAGCTATGACaaagagaaagggttaacctgcat CAGGAAACAGCTATGACttgtgacaatcccactgcac CAGGAAACAGCTATGACtggccttaatttccacattt CAGGAAACAGCTATGACgaggcctcttatactgccaaa CAGGAAACAGCTATGACtcttcaaagacaccatgtgattc CAGGAAACAGCTATGACtcttggtcacgacgatacaa CAGGAAACAGCTATGACtggatacaaaacttgcattcg CAGGAAACAGCTATGACtcattaacaaacaaagactgcttta CAGGAAACAGCTATGACttgcaactgtgagctgttactatg CAGGAAACAGCTATGACaccaaacttggtgaagtaatttatg CAGGAAACAGCTATGACagtgccactcagaaaatctagc CAGGAAACAGCTATGACctggtgaggggacttgctaa CAGGAAACAGCTATGACtgattaccacaagctaagtttcaa CAGGAAACAGCTATGACagacattgaaggtgtcaacca CAGGAAACAGCTATGACtgaatgttttcctttttaattatgag CAGGAAACAGCTATGACgcggacagagtgagtctttg CAGGAAACAGCTATGACcataaaacactcaaatccttctaaca CAGGAAACAGCTATGACtgctagagcattacagatttttga CAGGAAACAGCTATGACaaaccaagagcaagactttg CAGGAAACAGCTATGACatactacaggcaacagaaaacata CAGGAAACAGCTATGACaagaattttcataaagacactgagatt CAGGAAACAGCTATGACtgacccacagcaaacagaa CAGGAAACAGCTATGACaacagtttgagtgggggtga CAGGAAACAGCTATGACgggattccatcttaaatccatc CAGGAAACAGCTATGACtgcaacaccttcacctaaaat CAGGAAACAGCTATGACgggaacaggaggcaaaataa CAGGAAACAGCTATGACggcatctgtacagtgtctataacaaa CAGGAAACAGCTATGACgctttgggttttacacacacat CAGGAAACAGCTATGACccaacatactgaaataacctcagc CAGGAAACAGCTATGACgagaaaaacagttgttgtttagaatga CAGGAAACAGCTATGACttcagaaaagaagccatgaca CAGGAAACAGCTATGACtgcccggcctatagtttttat CAGGAAACAGCTATGACttccctcaggctttctgttt CAGGAAACAGCTATGACactaatttcaaggctctaataaaa CAGGAAACAGCTATGACgatcttgatgaaaagatgaagcat CAGGAAACAGCTATGACgaccaagtcactctttctatgc CAGGAAACAGCTATGACtcctgacatcaaggggctta CAGGAAACAGCTATGACtccatttcttagagggaatggtat CAGGAAACAGCTATGACccagccttgaaccgatttta CAGGAAACAGCTATGACgcttttggattacgtttgtgatt CAGGAAACAGCTATGACgccaatatttaaccaattttgacc CAGGAAACAGCTATGACaagacaaaatcccaaataaagcag CAGGAAACAGCTATGACccaaccaaatggcatcttt CAGGAAACAGCTATGACgctgtcagctttaataagccatt CAGGAAACAGCTATGACcactatcatccccctgcaac CAGGAAACAGCTATGACaggcaaacaacattccatga CAGGAAACAGCTATGACcccagcccatgtaattttga CAGGAAACAGCTATGACgacttcctgatgagatacacagtct CAGGAAACAGCTATGACaaggccttgggaataagaaaa CAGGAAACAGCTATGACtggcaggttaaaaataaaggcta CAGGAAACAGCTATGACaggaaaaatccaaataagtttctg CAGGAAACAGCTATGACtggacagtacagaagggcttaaa CAGGAAACAGCTATGACcaaaactggatgaacagcctatc CAGGAAACAGCTATGACgccataaaggtgggacacat CAGGAAACAGCTATGACctaagcccttcccttccaac CAGGAAACAGCTATGACggggacagagaaatgttcca CAGGAAACAGCTATGACtctccagaagtcaaaccaagaa CAGGAAACAGCTATGACgcataccatgcaaggctaaag CAGGAAACAGCTATGACcctcatttgtccttggcagt CAGGAAACAGCTATGACtctcccttaatctggacacaac CAGGAAACAGCTATGACgataatttcattaaggtgcaattaaaa CAGGAAACAGCTATGACccttagaacgagtcccatgc  T a b l e A . 2 : TaqM&n SNP  VIC  p r i m e r s a n d p r o b e s . A s s a y s designee o n t h e o p p o s i t e s t r a n d a r e m a r k e d w i t h a n *  Probe  6 F A M Probe  Forward Primer  CCCTCCATCCCGCG  ACCCTCCTTCCCGCG  CAGCATAGCCGGGTCCAA  GCCCGGCTTGTATTGGGTAA  CTCCCGCGGCCAC  CCTCCCGTGGCCAC  CGTGGCTAACGGAGAAAAGAAG  GCAGATCCCGACTCCTCTC  TTACTAATCACACTTATTTCAA  TTACTAATCACAC**ATTTCAA  TGATAGAGCTACAGAACGAAAGGTAGTAAA  GCGCTTAAATTTCTCAACTTCTTTCTGAAAA  Common/htSNPs SNP 1 -5144 A / T SNP 3 -4519 G/A* S N P 7 IVS4  00  (+36) d e l ( A A ) * S N P 32 I V S 2 4 (-8) d e l ( T ) S N P 47 X 3 9 (5557) G / A S N P 58 I V S 6 2 (-55) C / T * Rare/Potentially deleterious S N P s S N P 17 X 1 2 (1541) G / A S N P 31 X 2 4 (3161) C / G * S N P 40 X 3 1 (4424) A / G S N P 49 X 4 0 (5697) C / A S N P 50 X 4 0 (5753) G / C S N P 56 X 5 4 (7775) C / G *  Reverse P r i m e r  TTGCTTGCTTGTTTTAA  TTGCTTGCT*GTTTTAA  GCTTTGGAAAGTAGGGTTTGAAATTAGAAAATT  CCCTTCGTGTCCTGGAACAATC  TTTTACTCCAAGATACAAATG  TTTTACTCCAAAATACAAATG  GTCAGACTGTACTTCCATACTTGATTCA  CCCTGAACATGTGTAGAAAGCAGAT  CAATGTTGTCAACGTATCT  AATGTTGTCAACATATCT  CATAGGCTCAGCATACTACACATGA  CTCACAGCATCTAGAGTCAAACACATTATAAA  CCATAATTCAGGGTAGTTT  CCATAATTCAGGATAGTTT  AGCTGAAAACTTTGGCTTACTTGGA  GCTGACCCAGTAAATAACTTCCAGAA  CCATTTTGAATAAGGATCAG  CCATTTTGAATAACGATCAG  ACCACAGTTCTTTTCCCGTAGG  ACTTCATTTACAGGAAAGTCTTTTCCCATT  CTTTGATTCACTATATCAAC  TTTGATTCACTGTATCAAC  GCCTTTGTTCTTCGAGACGTTATTT  ACAGGATAGAAAGACTGCTTATATATTGGTCT  TTTTTCCGATGCTGTTTG  TTTCCGATGATGTTTG  GCAAGAATGCCTGGGACTGA  GTAGTCCACAACAGCAAGCATTG  TACATGAGAAGACAAAAG  CATGAGAACACAAAAG  TGTCAGAGTCAGAGCACTTTTTCC  ATCCTAAACGTAAGAAGCAACACTCA  CAAGCTGAGAGCTTT  CAAGCTGACAGCTTT  GGTAGCCAGAAGAAGCAGAATAACT  TAAAAGGTACGTATGTTTAATCCAAATACCTCA  Appendix B  Correction for multiple testing T h e r e s u l t s of t h e a s s o c i a t i o n s t u d y w e r e c o r r e c t e d for t h e F a l s e D i s c o v e r y ( F D R ) [6]. Table B . l s h o w s t h e r e s u l t s of t h a t c o r r e c t i o n .  Rate  T h i s table shows the  s i g n i f i c a n c e v a l u e s for t h e o d d s r a t i o s f r o m t h e a s s o c i a t i o n t e s t s . T h e s e v a l u e s are c o m p a r e d t o v a l u e s c o r r e c t e d for t h e F a l s e D i s c o v e r y R a t e ( F D R ) . T o i m p l e m e n t t h i s , for e a c h t e s t , t h e s i g n i f i c a n c e v a l u e s are r a n k e d i n o r d e r of s i g n i f i c a n c e . E a c h p v a l u e is t h e n c o m p a r e d t o t h e F D R v a l u e c o r r e s p o n d i n g t o i t s r a n k . If t h e o b s e r v e d p - v a l u e is s m a l l e r t h a n t h e F D R v a l u e , t h e test is s a i d t o r e m a i n s i g n i f i c a n t after c o r r e c t i o n for F D R . N o n e of t h e p - v a l u e s i n t h i s s t u d y r e m a i n e d s i g n i f i c a n t after c o r r e c t i o n for F D R , w h i c h m a y b e o v e r - c o n s e r v a t i v e for a l o c u s w i t h h i g h L D .  Table B . i :  Significance values for the odds ratios from the association  tests corrected for multiple testing using the False Discovery Rate.  Rank  F D R Formula  FDR  Variant  Obs.  p-value  Variant  O b s . p-value  Variant  O b s . p-value  C o r r e c t i o n for F D R i n the overall N H L types T cell N H L  B cell N H L  All N H L (1/7)  0.007  rare6  0.077  rare6  0.090  rVS24(-8)del(T)  0.019  (2/7)  0.014  X39(5557)G/A  0.651  -5144A/T  0.746  X39(5557)G/A  0.083  *  (3/7)  0.021  -5144A/T  0.678  X39(5557)G/A  0.884  IVS4(+36)del(AA)  0.142  0.05  *  (4/7)  0.029  IVS4(+36)del(AA)  0.693  IVS4(+36)del(AA)  0.915  rare6  0.348  5  0.05  *  (5/7)  0.036  IVS24(-8)del(T)  0.716  IVS24(-8)del(T)  0.948  -4519G/A  0.613  6  0.05  *  (6/7)  0.043  -4519G/A  0.854  -4519G/A  0.953  -5144A/T  0.636  7  0.05  *  (7/7)  0.050  IVS62(-55)C/T  0.862  IVS62(-55)C/T  0.979  IVS62(-55)C/T  0.768  1  0.05  *  2  0.05  *  3  0.05  4  C o r r e c t on for F D R in tests of the different N H L subtypes LPL  FL  DLBCL (1/7)  0.007  IVS24(-8)del(T)  0.125  -5144A/T  0.511  rare6  0.113  0.05  (2/7)  0.014  X39(5557)G/A  0.163  -4519G/A  0.519  IVS24(-8)del(T)  0.379  3  0.05  • (3/7)  0.021  rareG  0.306  IVS62(-55)C/T  0.726  -4519G/A  0.431  4  0.05 * ( 4 / 7 )  0.029  IVS62(-55)C/T  0.373  IVS4(+36)del(AA)  0.797  X39(5557)G/A  0.500  5  0.05  *  (5/7)  0.036  -4519G/A  0.441  rare6  0.843  -5144A/T  0.501  6  0.05  • (6/7)  0.043  -5144A/T  0.569  IVS24(-8)del(T)  0.988  IVS4(+36)del(AA)  0.547  7  0.05 • (7/7)  0.050  IVS4(+36)del(AA)  0.905  X39(5557)G/A  0.993  IVS62(-55)C/T  0.559  1  0.05  2  *  MF  MCL  Misc B C L  1  0.05  (1/7)  0.007  rare6  0.026  X39(5557)G/A  0.573  rare6  0.233  2  0.05 • (2/7)  0.014  IVS24(-8)del(T)  0.179  IVS24(-8)del(T)  0.595  X39(5557)G/A  0.340  3  0.05  *  (3/7)  0.021  IVS4( + 3 6 ) d e l ( A A )  0.265  IVS62(-55)C/T  0.617  IVS24(-8)del(T)  0.519  4  0.05  *  (4/7)  0.029  X39(5557)G/A  0.280  rare6  0.617  IVS4(+36)del(AA)  0.647  IVS62(-55)C/T  0.447  IVS4( + 3 6 ) d e l ( A A )  0.665  -4519G/A  0.762  *  5  0.05  *  (5/7)  0.036  6  0.05  • (6/7)  0.043  -5144A/T  0.738  -5144A/T  0.695  -5144A/T  0.828  7  0.05  *  (7/7)  0.050  -4519G/A  0.811  -4519G/A  0.713  IVS62(-55)C/T  0.889  Continued on next page  T a b l e B . l — C o n t i n u e d from previous page Rank  F D R Formula  FDR  Variant  O b s . p-value  Variant  O b >. p - v a l u e  Obs.  Variant  MZL/MALT  Misc T C L  p-value  PTCL  1  0.05 * ( 1 / 7 )  0.007  IVS24(-8)del(T)  0.077  rare6  0.015  IVS4(+36)del(AA)  0.013  2  0.05 * ( 2 / 7 )  0.014  X39(5557)G/A  0.077  IVS62(-55)C/T  0.524  X39(5557)G/A  0.186  3  0.05 * ( 3 / 7 )  0.021  IVS4(+36)del(AA)  0.293  IVS4(+36)del(AA)  0.651  IVS24(-8)del(T)  0.206  4  0.05 * ( 4 / 7 )  0.029  -5144A/T  0.576  -4519G/A  0.701  rare6  0.237  5  0.05 * ( 5 / 7 )  0.036  IVS62(-55)C/T  0.619  -5144A/T  0.767  -4519G/A  0.295  6  0.05 * ( 6 / 7 )  0.043  -4519G/A  0.644  X39(5557)G/A  0.924  -5144A/T  0.338  7  0.05 * ( 7 / 7 )  0.050  rare6  0.923  IVS24(-8)del(T)  0.988  IVS62(-55)C/T  0.407  CLL  00  1  0.05 * ( 1 / 7 )  0.007  IVS24(-8)del(T)  0.202  2  0.05 * ( 2 / 7 )  0.014  -5144A/T  0.208  3  0.05 * ( 3 / 7 )  0.021  X39(5557)G/A  0.212  4  0.05 * ( 4 / 7 )  0.029  IVS62(-55)C/T  0.237  5  0.05 * ( 5 / 7 )  0.036  -4519G/A  0.240  6  0.05 * ( 6 / 7 )  0.043  rare6  0.301  7  0.05 * ( 7 / 7 )  0.050  IVS4(+36)deI(AA)  0.509  C o r r e c t i o n for F D R in tests of the different ethnicities Caucasian A l l N H L  S Asian A l l N H L  Asian A l l N H L  1  0.05 * ( 1 / 7 )  0.007  rare6  0.111  -5144A/T  0.288  -5144A/T  0.369  2  0.05 * ( 2 / 7 )  0.014  IVS62(-55)C/T  0.724  -4519G/A  0.355  IVS24(-8)del(T)  0.370  3  0.05 * ( 3 / 7 )  0.021  IVS4(+36)del(AA)  0.845  IVS4(+36)del(AA)  0.365  X39(5557)G/A  0.370  4  0.05 * ( 4 / 7 )  0.029  -4519G/A  0:854  IVS24(-8)del(T)  0.415  -4519G/A  0.480  5  0.05 * ( 5 / 7 )  0.036  X39(5557)G/A  0.932  X39(5557)G/A  0.434  IVS62(-55)C/T  0.531  6  0.05 * ( 6 / 7 )  0.043  IVS24(-8)del(T)  0.966  IVS62(-55)C/T  0.553  rare6  0.939  7  0.05 * ( 7 / 7 )  0.050  -5144A/T  0.987  rare6  0.678  IVS4(+36)del(AA)  0.943  Appendix C  Ethics approval T h i s s t u d y w a s a p p r o v e d b y t h e j o i n t C l i n i c a l R e s e a r c h a n d E t h i c s B o a r d of t h e B r i t i s h C o l u m b i a C a n c e r A g e n c y a n d t h e U n i v e r s i t y of B r i t i s h C o l u m b i a . A l l s u b j e c t s gave w r i t t e n i n f o r m e d c o n s e n t . A c o p y of t h e a p p r o v a l is a t t a c h e d .  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099901/manifest

Comment

Related Items