Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The development and characterization of a novel autogene based, dual promoter cytoplasmic expression… Finn, Jonathan Douglas 2004

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-994732.pdf [ 12.08MB ]
Metadata
JSON: 831-1.0099834.json
JSON-LD: 831-1.0099834-ld.json
RDF/XML (Pretty): 831-1.0099834-rdf.xml
RDF/JSON: 831-1.0099834-rdf.json
Turtle: 831-1.0099834-turtle.txt
N-Triples: 831-1.0099834-rdf-ntriples.txt
Original Record: 831-1.0099834-source.json
Full Text
831-1.0099834-fulltext.txt
Citation
831-1.0099834.ris

Full Text

THE DEVELOPMENT AND CHARACTERIZATION OF A NOVEL AUTOGENE BASED, DUAL PROMOTER CYTOPLASMIC EXPRESSION SYSTEM by Jonathan Douglas Finn B.Sc, The University of Guelph, 1999 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY In THE FACULTY OF GRADUATE STUDIES Department of Biochemistry and Molecular Biology We afxept t?fis thesis As confoKffiing tq^h^Tjgguired Standard THE UNIVERSITY OF BRITISH COLUMBIA October 2004 © Jonathan D. Finn, 2004 ABSTRACT The relatively low levels of transfection that can be achieved by current gene delivery systems have limited the therapeutic utility of gene transfer. This is especially true for non-viral gene delivery systems, where the levels of gene expression achieved are usually below the levels achieved by viral gene transfer systems. One strategy for increasing gene expression is to design a cytoplasmic expression system that does not require nuclear delivery for gene expression to occur. This can be achieved through the use of an autocatalytic cytoplasmic expression system using phage RNA polymerases. In this work, the design, construction, and characterization of a novel dual promoter, autogene based cytoplasmic expression system is described. The purpose of this work was to develop new plasmids capable of giving rise to increased gene expression levels over standard plasmids currently used in the field of either non-viral gene therapy, or general gene expression. In Chapter 2 the system is introduced and characterized. Chapter 3 is concerned with attempting to optimize expression levels, and determining what factors are limiting gene expression. In Chapter 4, the differences between a high expressing cell line (BHK) and a low expressing cell line (COS-7) are investigated. In Chapter 2, the ability of the autogene based expression system to give rise to exponential increases in gene expression is demonstrated, as well as the ability of the expression system to give rise to levels of gene expression in BHK cells that are 20 times higher per transfected cell than a standard CMV based nuclear expression plasmid. Further analysis determined that the mRNA transcripts made in the cytoplasm are not as stable as those made in the nucleus (most likely due to the lack of a 5' cap ii structure on the cytoplasmic transcripts), and that the cytoplasmic expression system gives rise to much higher mRNA levels than the nuclear system. In Chapter 3 an attempt is made to determine what factors are limiting the cytoplasmic expression system, in an effort to optimize the system to give rise to even higher levels of gene expression. After exploring various factors, such as the nuclear promoter, RNAP gene and IRES sequence, it was found that the critical factors responsible for limiting the cytoplasmic system is at the mRNA level, both the transcription and translation. It was found that the cytoplasmic transcripts are being translated 20 times less efficiently than their capped nuclear counterparts, and by measuring mRNA transcript levels, it was found that the autogene based cytoplasmic expression system appears to be saturating the cells ability to produce new mRNA, and that transgene transcript levels are reaching 30% of the total RNA in the cell, a level that is 10 times higher than the sum of every other mRNA transcript in the cell. In addition to this finding, insights into possible IRES function are gained. In Chapter 4, the differences between a cell line that gives rise to high levels of cytoplasmic gene expression (BHK) are compared with a cell line that gives poor cytoplasmic expression (COS-7). After investigating the individual components of the cytoplasmic expression system, such as the IRES activity and RNAP function, it was found that the reason for the difference in the two cell lines is most likely at the level of the intracellular processing of the DNA:cationic lipid complexes, as the COS-7 cells appear to have less intact plasmid per cell over time than the BHK cells. In summary, this work represents a substantial advance in the understanding of cytoplasmic expression systems, and demonstrates the potential of these systems to give rise to increased levels of gene expression. In addition, this study clarifies potential areas that need to be addressed in order to further optimize cytoplasmic expression systems. iv TABLE OF CONTENTS ABSTRACT N TABLE OF CONTENTS v LIST OF FIGURES viii ABBREVIATIONS x ACKNOWLEDGEMENTS xii DEDICATION xiii CHAPTER 1 1 1.1 Gene Therapy 1 1.1.1 Overview 1 1.1.2 Viral Vectors 4 1.1.2.1 Adenoviral Vectors 5 1.1.2.2 Adeno-Associated Viral Vectors 7 1.1.2.3 Retroviral Vectors 8 1.1.2.3.1 Lentiviruses 10 1.1.2.4 HSV Vectors 10 1.2.2.5 Pox (vaccinia virus) Vectors 11 1.1.3 Non-viral Vectors 11 1.2 Lipids, Liposomes, and Lipid Polymorphism 12 1.2.1 Cationic Lipids 16 1.3 DNA-cationic Liposome Complexes 18 1.4 Systemic Gene Delivery Systems 21 1.4.1 Liposomes as Carrier Systems 22 1.4.2 Stabilized Plasmid-Lipid Particles (SPLP's) 24 1.5 Transcription and Translation 29 1.5.1 Transcription 29 1.5.2 Translation 29 1.6 Plasmids, DNA, mRNA 31 1.6.1 Eukaryotic Transcription Unit 33 1.6.2 Promoters 34 v 1.6.4 Capping 36 1.7 Cytoplasmic Expression Systems 36 1.7.1 Background 36 1.7.2 Phage RNA Polymerase 37 1.7.3 Initial Cytoplasmic Expression Systems 38 1.7.4 Internal Ribosome Entry Sequence Elements 41 1.8 Objectives of Thesis 42 CHAPTER 2: CREATION AND CHARACTERIZATION OF A NOVEL AUTOGENE BASED CYTOPLASMIC EXPRESSION SYSTEM 44 2.1 Introduction 44 2.2 Materials and Methods 46 2.2.1 Plasmids and Primers 46 2.2.2 Transcription and Translation Assay 46 2.2.3 Transfections 47 2.2.4 Luciferase and BCA Assays 47 2.2.5 Immunofluorescence 48 2.2.6 RNase Protection Assay 49 2.2.7 Primer Extension 50 2.3 Results 50 2.3.1 Autocatalytic Gene Expression Results in an Exponential Time 50 Dependent Increase in Gene Expression...... 50 2.3.2 A Bi-cistronic Construct Results in Higher Levels of Gene Expression 52 Than a Dual Plasmid Transfection 52 2.3.4 The Cytoplasmic Expression System Results in a 20-fold Increase in 55 Gene Expression per Cell Compared to a Nuclear Expression System 55 2.3.4 Cytoplasmic mRNATranscripts have a Shorter Half-life than Nuclear 58 Transcripts 58 2.4 Discussion 63 CHAPTER 3: FACTORS LIMITING AUTOGENE BASED CYTOPLASMIC EXPRESSION 67 3.1 Introduction 67 3.2 Materials and Methods 67 3.2.1 Plasmids and Primers 67 3.2.2 mRNA Synthesis 68 3.2.3 Transfections 69 3.2.4 Luciferase and BCA Assays 70 3.2.5 Immunofluorescence 70 3.2.6 RNase Protection Assay 71 3.2.7 Calculation of Amount of Transgene mRNA per Transfected Cell 72 vi 3.3 Results 73 3.3.1 Replacing the CMV Promoter with either the RSV or SV40 Nuclear 73 Promoter has Little Effect on Autogene Expression 73 3.3.2 Autogene Expression is not Sensitive to the Type of Phage RNAP 73 used 73 3.2.3 Substitution of the EMC IRES by Either the Gtx or elF4G IRES 75 Elements Reduced Autogene Expression 75 3.2.4 Nuclear mRNA Transcripts are Translated 20 Times More Efficiently 78 Than Cytoplasmic Autogene Transcripts 78 3.2.5 mRNA Production is a Limiting Factor in Autogene Expression 80 3.4 Discussion 84 CHAPTER 4 : INVESTIGATION OF FACTORS RESPONSIBLE FOR CELL LINE CYTOPLASMIC EXPRESSION DIFFERENCES 88 4.1 Introduction 88 4.2 Materials and Methods 88 4.2.1 Plasmids: 88 4.2.2 mRNA Synthesis: 89 4.2.3 Transfections: 89 4.2.4 Luciferase and BCA Assays: 90 4.2.5 Cytoplasmic Extract Preparation: 91 4.2.7 Nuclease Assay Procedure: 91 4.2.8 Plasmid Labeling: 91 4.2.9 Fluorescence Microscopy: 92 4.3 Results 92 4.3.1 Autogene Transfection in COS-7 Cells Results in Lower Transgene 92 Expression than in BHK Cells 92 4.3.2 EMCV IRES is Functional in COS-7 Cells 92 4.3.3 T7 RNAP is Functional in COS-7 Cells 94 4.3.4 Effect of T7 RNAP mRNA Pretreatment on Autogene Expression 96 4.3.5 BHK and COS-7 Cells have Similar Levels of Cytosolic Nucleases 99 4.3.5 Intracellular Processing of DNA is Different in BHK and COS-7 Cells 99 4.4 Discussion 102 CHAPTER 5 106 SUMMARY AND FUTURE DIRECTIONS 106 REFERENCES 109 vii LIST OF FIGURES Figure 1-1: A summary of gene therapy clinical trial information to date 3 Figure 1-2: A diagram of adenovirus entry into a cell 6 Figure 1-3: Molony murine leukemia virus vectors 9 Figure 1-4: Diagram of a typical lipid and how it self associates to form lipid bilayers. .13 Figure 1-5: Classifications of liposomes 14 Figure 1-6: Molecular geometry of lipids 15 Figure 1-7: Structures of commonly used cationic lipids 17 Figure 1-8: Diagrams of models of DNA-cationic lipid complexes 19 Figure 1-9: Diagram depicting the passive accumulation of liposomal formulations....23 Figure 1-10: A schematic diagram of Stabilized Plasmid Lipid Particles 25 Figure 1-11: Structure of the major lipids used in the formulation of SPLP 27 Figure 1-12: In vivo SPLP expression profile 28 Figure 1-13: A diagram of translation 30 Figure 1-14: Structure of DNA 32 Figure 1-15: Sequence of CMV promoter 35 Figure 1-16: A diagram of the T7 RNAP autogene 39 Figure 1-17: Diagram of the cytoplasmic expression system 40 Figure 2-1: Transcription and Translation assay 51 Figure 2-2: Bi-cistronic construct versus dual plasmid transfection 51 Figure 2-3: Plasmid size does not effect transfection 51 Figure 2-4: Comparison of autogene and nuclear expression 51 Figure 2-5: Immunofluorescence of BHK cells 57 Figure 2-6: Increased autogene expression is also seen in Neuro-2a cells 59 viii Figure 2-7: Primer extension assay 60 Figure 2-8: Ribonuclease Protection Assay 62 Figure 3-1: Nuclear promoter comparison 74 Figure 3-2: RNAP comparison 76 Figure 3-3: IRES comparison 77 Figure 3-4: Comparison of translation efficiency 79 Figure 3-5: Amount of transgene mRNA per transfected cell 82 Figure 3-6: R011 dose response study in BHK cells 83 Figure 4-1: Autogene expression in COS-7 cells 93 Figure 4-2: Transfection of BHK or COS-7 cells with various mRNA species 95 Figure 4-3: T7 RNAP is functional in COS-7 cells 97 Figure 4-4: Pretreatment of COS-7 cells with T7 RNAP mRNA 98 Figure 4-5: Cytosolic nuclease assays of BHK and COS-7 cytoplasmic extracts 100 Figure 4-6: Intracellular processing of complexes 101 ix ABBREVIATIONS AAV = adeno-associated virus Ad = adenovirus BHK = baby hamster kidney CAR = coxsackie and adenovirus receptor CMV = cytomegalovirus DEAE = diethylaminoethyl DNA = deoxyribonucleic acid DODAC = N,N-dioleyl-N,N-dimethylammonium chloride DOPE = dioleyl phosphatidlyethanoamine elF4G = eukaryotic initiation factor 4 G EM = electron microscopy EMCV = encephalopmyocarditis virus FMDV = foot and mouth disease virus HIV = human immuno-deficiency virus HSV = herpes simplex virus IF = immunofluorescence IRES = internal ribosome entry sequences LUV = large unilamellar vesicle MLV= multilamellar vesicle Mo-MLV = Moloney murine leukemia virus mRNA = messenger RNA PBS = phosphate buffered saline PEG = poly(ethylene glycol) PTB = pyrimidine tract binding protein RES = reticuloendothelial system RLU = relative light unit RNA = ribonucleic acid RNAP = RNA polymerase RNAPII = RNA polymerase II rRNA = ribosomal RNA RSV = Rous sarcoma virus SPLP = stabilized plasmid lipid particle SUV = small unilamellar vesicle SV40 = simian virus 40 TAFs = TBP-associated factors TBP = TATA binding protein TF = transcription factor tRNA = transfer RNA UAS = upstream activation sequences ACKNOWLEDGEMENTS There are so many people I would like to thank for helping me accomplish this goal. First and foremost, I would like to thank Pieter for taking on a young, nai've molecular biologist, giving him the freedom and the resources to make this project work, and beginning the labs foray into the wonderful world of plasmids, RNAPs, and other fun areas of molecular biology. To everyone in the Cullis lab, both present and past members, thank you so much for all of the support, and fun that you've given me. I couldn't have done this alone. A special thanks goes out to Ammen, my gene therapy buddy, cheering on the ups and helping me through the downs over the years. Tabitha, thanks so much for your help cloning and with all of the tissue culture. You were a huge help and I really appreciate the time and effort you put into the project. I would like to also thank Ian MacLachlan, and the gang at Protiva (especially Amy Lee). Thanks for all of the support, both financial and intellectual. Ian, thanks for teaching me how to write, clone, and giving me insights into the world of industrial research. On a personal note, I would like to thank my family, Mom, Dad, Michelle, Matthew, Patrick and Ashley. You have all been such a huge part of my life and I truly could not have done this without every ones support. You've all helped shape me into the person I am today. And another personal thanks to Steph, for being there throughout all the highs and lows. Sam, thanks for everything. You've been a real inspiration to me and have given me nothing but support for everything I've done and accomplished. All in all, its been a great trip, mostly due to the people that I shared it with. I wish everyone the best of luck and success in whatever they choose to do. It's all good baby. xii / dedicate this to my parents. You can never know what you've given me and how much I truly appreciate it. Thank you for all of the sacrifices and the love you've given me. I am most blessed. xiii CHAPTER 1 INTRODUCTION 1.1 Gene Therapy 1.1.1 Overview Ever since Avery, MacLeod and McCarthy determined that DNA was the genetic material of the cell (Avery, MacLeod et al. 1944), (later verified by Hershey and Chase (Hershey, Chase et al. 1952)), Watson and Crick elucidated the double helix structure of DNA (Watson and Crick 1953), and the genetic code was deciphered (Crick, Barnett et al. 1961), a new era of scientific research was ushered in. Since those times progression in the field of molecular biology has proceeded at an astounding rate. The discovery of restriction endonucleases (Meselson and Yuan 1968; Roulland-Dussoix and Boyer 1969) and T4 ligase (Fareed and Richardson 1967) gave researchers the tools they needed to start manipulating life on the genetic level. With recombinant DNA techniques developed and the first gene being cloned in the mid 70's (Cohen, Chang et al. 1973; Rougeon, Kourilsky et al. 1975; Maniatis, Kee et al. 1976), the idea of gene therapy, the treatment of disease at the genetic level, started to emerge. This was demonstrated by the first gene therapy publications that brought the idea of treating disease with genetic material to the attention of both the scientific and public community (Aposhian 1970; Osterman, Waddell et al. 1971; Rogers 1971; Freese, Friedmann et al. 1972; Friedmann and Roblin 1972). In its most basic form, gene therapy can be defined as the insertion of a functioning gene into the cells of an organism to correct an error of metabolism or to provide a new function in a cell. The first reproducible in vivo gene therapy experiment 1 Vectors Used in Gene Therapy Clinical Trials W I L E Y Retrovirus 28% (n=254) # Adenovirus 26% (n=240) # Maked/Plasmid DNA 14% |n=132) # UpofecHon 9.3% (n-85) # Pox virus 5.7% (n=52) # Vaccinia virus 3.3% (n=30) # Herpes simplex virus 2.8% (n=26) # Adeno-associated virus 2.1 % (n = 19} # RNA transfer 1.1 (n=10) # Others 3% (n=23) # N/C 5,1% (n-47) The Journal of Gene Medicine, S 2004 John Wiley and Sons Lid www.witey.co.uk/genraed/ clinical Indications Addressed by Gene Therapy Clinical Trials WILEY Cancer diseases 66% (n-608) Monogeneic diseases 9.8% (n-90) Vascular diseases 8.3% (n=76) Infectious diseases 6.5% (n=60) Other diseases 2.6% (n=24) Gene marking 5.8% (n=53) Healthy volunteers 0.8% (n=7) The Journal of Gene Medicine, © 2004 John Wiley and Sons Lid www.wiley.co. uk/genmed/ clinical 2 Phases of Gene Therapy Clinical Trials WILEY Phase I 64%(n«589) Phase l/ll 20% (n*185) Phase II 13% (n-120} Phase 11/111 1%(n«9) Phase III 1.6% (n-15) The Journal of Gene Medicine, © 2004 John Witty and Sons Lid www.vriloy.eo.uk/genmodl/clinical Gene Types Transferred in Gene Therapy Clinical Trials WIUY m Cytokine 26% (n-237) • Antigen 14%{n=128) • Tumor supressor 12% (n=113) • Suicide 8.1% (n=74) • Deficiency 7.8% (n-68) • Drug resistance 6.1% (n-56) • Receptor 3.4% (n-31) • Replication inhibitor 2.9% (n*27) • Others 14% (n«129) • N/C6%(n=55) The Journal of Gene Medicine, © 2004 John Wiley and Son s Ltd www.wjley.ca.uk/cjenmed/ clinical Figure 1-1: A summary of gene therapy clinical trial information to date. Source: http://www.wilev.co.uk/qenmed/clinical/ 3 was performed in Drosophila using transposable elements as carriers. Flies were 'cured' of a mutant eye color (Rubin and Spradling 1982). Much research has been performed into ways of transmitting genetic material into cells. These vehicles for gene transfer have been termed 'vectors'. Gene therapy vectors can be divided into two major classes, viral and non-viral. 1.1.2 Viral Vectors Ever since it was discovered that tumor viruses could cause cell transformation by inserting viral DNA sequences into host cells (Dulbecco, Sambrook et al. 1966; Dulbecco 1967; Sambrook, Westphal et al. 1968; Westphal and Dulbecco 1968; Dulbecco, Sambrook et al. 1969), viruses have been considered highly promising vectors for the transfer of genetic material into cells. In fact, the first human gene therapy experiment was performed using wild type Shope papillomavirus (Rogers, Lowenthal et al. 1973). In the early 70's while working with the Shope virus, Rogers discovered that cells infected with this virus, and in fact, even laboratory members working with the virus, had very low levels of arginine. He concluded that either the virus carried an arginase gene, or somehow activated a natural cellular arginase. When he was presented with two young German arginase-deficient girls, suffering from seizures due to extremely high systemic levels of arginine, he injected wild type virus in an effort to gain a therapeutic effect (Rogers, Lowenthal et al. 1973). There was no rigorous follow up of the two girls and no convincing evidence was found that the girls were either helped or harmed during the experiment (Terheggen, Lowenthal et al. 1975). The use of recombinant DNA methods to produce recombinant virus vectors (Shimotohno and Temin 1981; Wei, Gibson et al. 1981; Tabin, Hoffmann et al. 1982) 4 opened the door for a major advance in the area of viral gene therapy. Since that time, a number of different types of viruses have been used as gene transfer vectors (Figure 1-1). 1.1.2.1 Adenoviral Vectors Adenovirus (Ad) is a non-enveloped, iscosahedral virus, 60-90 nm in diameter. It has a double stranded DNA (dsDNA) genome that is 30-40 kB in size (Epstein 1959; Home 1962; Strohl, Rabson et al. 1967). Ad was first isolated from adenoid tissue in 1953, and since then, over 50 human serotypes have been identified. Ad has been shown to enter cells using the CAR (coxsackie and adenovirus receptor). Ad enters the cell via clathrin dependent, receptor mediated endocytosis (Wickham, Mathias et al. 1993; Li, Brown et al. 2001) (Figure 1-2). Some of the advantages of this vector are its high nuclear transfer efficiency, broad tissue tropism, and low pathogenicity (Buescher 1967; Meyer 1971). First generation Ad based vectors contained deletions that rendered the virus replication deficient; however they could only carry about 8 kB of genetic material (Fallaux, Bout et al. 1998; Danthinne and Imperiale 2000). Further research led to the development of high capacity, or 'gutless' Ad vectors. These vectors have no viral genes at all, and as a result, can carry up to 36 kB of foreign genetic material. However, they are entirely dependent on a helper virus for packaging (Kochanek 1999; Kochanek, Schiedneret al. 2001). Other work using Ad based vectors include replicative, oncolytic adenovirus vectors. These are modified Ad viruses that are designed to only replicate in tumor cells (usually p53 deficient) (Alemany, Balague et al. 2000; Kirn, Hermiston et al. 2000; Kirn, Hermiston et al. 2001). A disadvantage of Ad vectors is that while they are able to transduce non-5 Figure 1-2: A diagram of adenovirus entry into a cell. The Ad virus binds to cell surface receptors (1), is internalized (2) and escapes from the endosome (3), and the DNA is imported into the nucleus where is remains episomal (4) (Modified from (Wolff 1994)). 6 dividing cells, the DNA stays in an episomal form, and therefore they are not efficient vectors for long-term expression. In addition, immune responses against the viral proteins limit re-application; however, use of different serotypes can help to overcome this problem. The first Ad clinical trial was in 1993, and to date, over 240 trials (26% of total gene therapy trials) (Figure 1-1) have been initiated using Ad vectors. While Ad vectors have usually been well tolerated by patients in the clinic, it was an Ad vector clinical trial that led to the death of Jessie Gelsinger in 1999. This followed a very high dose of Ad vector, and his death was most likely caused by an Ad vector-induced shock syndrome due to a cytokine cascade that led to disseminated intravascular coagulation, acute pulmonary complications and multi-organ failure (Raper, Yudkoff et al. 2002). This adverse event cast a pall over the field of gene therapy (Somia and Verma 2000; Teichler Zallen 2000), and led to a reevaluation of gene therapy clinical trials, including vector dosage, safety, and toxicity. 1.1.2.2 Adeno-Associated Viral Vectors Adeno-associated viral vectors (AAV) are based on the replication defective human "dependent' parvovirus. This virus requires co-infection with another virus (such as adenovirus) to result in a productive infection. The first recombinant adeno-associated viral vector (AAV) was made in 1989 by removing almost all of its genome and replacing it with a transgene. This virus was dependent on a helper cell line expressing the deleted AAV genes, as well as being infected with Ad virus in order to produce transduction competent particles (Samulski, Chang et al. 1989). It was not until 1992 that AAV viruses became commonly used tools for the transduction of mammalian cells (Muzyczka 1992). Some of the advantages of this vector system are 7 that they demonstrate efficient gene transfer, are able to transduce non-dividing cells (McCown, Xiao et al. 1996; Xiao, Li et al. 1996), are not associated with any known human disease, and are able to integrate into a specific region on chromosome 19 (Kotin, Siniscalco et al. 1990). The disadvantages of this system include the difficulty of production and purification from co-infected Ad virus, the small space for gene insertion (~5 kB), and that some recombinant vectors have been shown to lose the nonrandom integration property (Tenenbaum, Lehtonen et al. 2003). Currently, there have been 19 clinical trials (Figure 1-1) initiated using AAV vectors (2.1% of total gene therapy clinical trials). 1.1.2.3 Retroviral Vectors A retrovirus is a virus that uses RNA as its genetic material, and relies on a reverse transcriptase to transcribe their RNA template into DNA, that can become integrated into the host cells DNA. Retroviruses have long been used as gene therapy vectors, with the first use of retroviral vectors in 1981 (Shimotohno and Temin 1981; Wei, Gibson etal. 1981). Moloney murine leukemia virus (Mo-MLV) is one of the most highly used retrovirus vectors (Miller, Skotzko et al. 1992; Mulligan 1993; Crystal 1995). Mo-MLV is an enveloped virus containing two single stranded RNAs (ssRNAs) in a nucleocapsid structure. Both RNAs serve as a template to generate a dsDNA via reverse transcriptase. The dsDNA then migrates into the nucleus and integrates into the host genome (Figure 1-3). The advantages of this vector system are that the receptor for the viral envelope protein is expressed on almost all mammalian cells, it is non-pathogenic, able to integrate into the host genome, and the virus encodes its own strong promoter and enhancer. A disadvantage of the system is that Mo-MLV based vectors are not 8 Figure 1-3: Molony murine leukemia virus vectors. These vectors bind to specific cell receptors (1), and are internalized (2). Once inside, the virus escapes from the endosome (3) and the viral RNA undergoes reverse transcription, converting it to DNA (4), where it then enters the nucleus and integrates into the host genome (4) (Modified from (Wolff 1994)). 9 able to transduce non-dividing cells (Roe, Reynolds et al. 1993). Retroviruses account for the highest percentage of clinical trial use at 28% of all clinical trials (over 250 trials) (Figure 1-1). 1.1.2.3.1 Lentiviruses Lentiviruses are a special class of retroviruses that are able to transduce both dividing and non-dividing cells. This is due to the presence of three viral proteins, the matrix protein, Vpr, and integrase (Bukrinsky, Haggerty et al. 1993; Heinzinger, Bukinsky et al. 1994; Gallay, Hope et al. 1997). These proteins all contain a nuclear localization sequence that allows for import of the pre-integration complex into the nucleus. The most well studied lentiviral vector to date is the HIV-1 derived vector. By changing the envelope protein and removing genes essential for viral replication, this vector was first demonstrated by Naldini et al to transduce non-dividing cells both in vitro and in vivo (Naldini, Blomer et al. 1996). Lentiviral vectors also demonstrate long term, stable expression (Blomer, Naldini et al. 1997), making them very attractive vectors for viral gene delivery systems. 1.1.2.4 HSVVectors Herpes Simplex Virus (HSV) vectors are large, enveloped DNA viruses (Batterson 1985). They are the most complex of human viruses, carrying about 75 genes. The HSV genome is approximately 152 kB (McGeoch, Dolan et al. 1986), almost a third of which codes for non-essential viral replication proteins. By making specific deletions and using a packaging cell line, about 40 kB of the genome is available for carrying transgene cassettes. 10 1.2.2.5 Pox (vaccinia virus) Vectors Pox viruses are double stranded DNA viruses that can infect both dividing and non-dividing cells. Similar to HSV, they have a large genome that can carry transgenes up to 25 kB in size (Smith and Moss 1983). The long history in the usage of these vectors as vaccines, their low toxicity, and high capacity for foreign DNA make them attractive candidates for gene delivery. 1.1.3 Non-viral Vectors It was first discovered in the 1950' and 60's that cultured cells were able to take up radiolabeled DNA directly from the surrounding media (Gartler 1959; Sirotnak and Hutchinson 1959; Kraus 1961; Schimizu and Iwafuchi 1962; Rabotti 1963). These findings were further verified when it was demonstrated that adding purified viral genetic material onto cells in culture resulted in virus production from those cells (Klingler, Chapin et al. 1959; Dubes and Klingler 1961). These studies prompted interest in using non-viral methods of transferring genes into cells. The first promising attempts at using a delivery system to deliver purified infectious viral nucleic acid in vitro used calcium phosphate (Graham and van der Eb 1973) or DEAE-dextran (Vaheri and Pagano 1965). These findings led to the second generation of non-viral gene delivery systems for plasmid delivery, such as liposomes (Fraley, Subramani et al. 1980), cationic lipids (Feigner, Gadek et al. 1987), polylysine/receptor mediated systems (Wu and Wu 1987), and the gene gun (Johnston, Anziano etal. 1988). For in vivo applications, the most widely used non-viral gene delivery methods include injection of naked DNA (Wolff, Malone et al. 1990; Acsadi, Jiao et al. 1991; Jiao, 11 Acsadi et al. 1992; Jiao, Williams et al. 1992) and the use of DNA-cationic liposome complexes (Wu and Wu 1987; Curiel, Agarwal et al. 1991; Wagner, Zatloukal et al. 1992; Zatloukal, Schmidt et al. 1993; Zabner, Fasbender et al. 1995; Feigner 1997). 1.2 Lipids, Liposomes, and Lipid Polymorphism Artificial lipid vesicles prepared from dispersions of phospholipids in aqueous media were first described in 1964 (Bangham and Home 1964). Since this discovery, liposomes have been widely accepted as models of biological cell membranes and have important applications as drug (conventional or gene/protein based) carriers. Membrane lipids are amphipathic, possessing hydrophobic and hydrophilic regions (see Figure 1-4). Within the bilayer, the hydrophilic head groups are oriented towards the aqueous environment, while the hydrophobic tails are facing each other. Artificial lipid vesicles are generally designated by size and lamellarity (Figure 1-5). Multilamellar vesicles (MLVs) are generally large in size (>400 nm), while large and small unilamellar vesicles (LUVs and SUVs) are smaller in size (-100 nm or -30 nm respectively) and contain only a single bilayer membrane. LUVs and SUV's can be prepared by a variety of techniques including sonication (Huang 1969), injection of lipids dissolved in ethanol or ether into aqueous buffer (Batzri and Korn 1973; Deamer 1978), and reverse phase evaporation (Szoka and Papahadjopoulos 1978). The most convenient and widely used method for producing LUVs today is via the extrusion technique. A comprehensive explanation of the extrusion technique is described in Hope et al, 1985 (Hope, Bally et al. 1985). Molecular shape theories have been used to rationalize and predict the behavior of various lipids upon dispersion in aqueous buffer (Gruner, Cullis et al. 1985). Lipids with a large head group area and a small hydrocarbon area (e.g. detergents such as 12 Hydrophilic Hydrophobic Biological Membrane Figure 1-4: Schematic diagram of a typical lipid and how it self associates to form lipid bilayers. 13 Multilamellar vesicles (>400nm) Figure 1-5: Classifications of l iposomes. Schematic representation and freeze fracture electron micrographs of MLVs , L U V s and S U V s . The bar in the E M picture represents 200 nm. 14 A A Figure 1-6: Molecular geometry of lipids and the predicted self-assembly of morphologically distinct structures. 15 Triton X-100), have a cone-like geometry and exhibit positive membrane curvature, self assembling into micelles (Figure 1-6). Lipids that are cylindrical in shape, having a ratio of the head group to hydrocarbon area nearly equal (e.g. DOPC), pack into lipid bilayers (Figure 1-6). Alternatively, lipids with a small head group area with a larger hydrocarbon area (e.g. DOPE) exhibit negative membrane curvature and adopt "inverted" lipid phases such as the cubic or inverted hexagonal (Hn) phase. These non-bilayer, HM phase forming lipids are often known as "fusogenic" lipids as they help to promote membrane fusion, presumably by their ability to adopt structural intermediates involved in membrane fusion (reviewed in (Hafez and Cullis 2001)). 1.2.1 Cationic Lipids Biologically, cationic lipids are very rare, appearing in nature only as sphingosine and stearylamine. Cationic lipids posses a positive charge in the head group. This allows for electrostatic interactions with polynucleotides. Since the first synthetic cationic lipids were prepared in the late 1970s (Kunitake 1977; Eibl 1979), there has been a large variety of synthetic cationic lipids prepared (see Figure 1-7). Cationic lipids are also thought to promote biological membrane destabilization through ion pairing with naturally occurring anionic lipids resulting in the formation of non-bilayer structures (Hafez and Cullis 2001). The inner endosomal membrane contains a high percentage of anionic lipids (18%) (Kobayashi, Stang et al. 1998), and formation of ion pairs with cationic lipids would be expected to exclude counter-ions and their associated water molecules, thus reducing hydration and resulting in formation of a cone-shaped zwitterion capable of adopting HM phase structure, thereby promoting membrane fusion. 16 DODAC (N,N-dioleoyl-N,N-dimethylammonium chloride) DOTAP (N-[2,3-(dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride) DOTMA (N-P.S-CdioleyloxyJpropyll-N.N.N-trimethylammoniurri chloride) Br DDAB (N,N-distearyl-N,N-dimethylammonium bromide) DMR1E (N-[2,3-(dimyristyloxy)propyl]-N,N-dimethyl-N-hydroxyethylammonium bromide) DC-CHOL (3-5-[N-(N',N'-dimethylaminoethyl)carbamoyl] cholesterol) NH, DOSPA (2,3-(dioleyloxy)-N-[2-(spermine carboxamido)ethyl]-N,N-dimethyl- l-propanaminium trifluoroacetate) Figure 1-7: Structures of commonly used cationic lipids (Taken from (Palmer 17 1.3 DNA-cationic Liposome Complexes The first use of a cationic liposome to deliver DNA was reported in 1987 (Feigner, Gadek et al. 1987). Since that time, the ability to use cationic liposomes as gene transfer vehicles has advanced significantly. The advantages of cationic liposomes as gene delivery vectors include their ease of manufacture via extrusion (Hope, Bally et al. 1985; Mayer, Hope et al. 1986), their spontaneous condensation with negatively charged DNA via electrostatic interactions, their interaction with negatively charged biological surfaces (e.g. glycoproteins and glycolipids containing negatively charged sialic acid residues on cell membranes), and their ability to aid in membrane disruption. This membrane disruption property is necessary to allow large molecules such as plasmid DNA to be delivered into the cytosol. (Feigner and Ringold 1989; Wattiaux, Jadot et al. 1997; Klemm, Young et al. 1998). It has been shown that higher charge ratios demonstrate more effective transfection, and that larger complexes generally give rise to higher transfection levels than smaller ones (Ross and Hui 1999). DNA-cationic lipid complexes are heterogeneous in structure and size. There have been several structural models proposed (Figure 1-8). These include the "bead on a string" complexes (Feigner and Ringold 1989), lamellar complexes (Gustafsson, Arvidson et al. 1995), and the cylindrical complex model (Sternberg, Sorgi et al. 1994). The 'bead on a string' complexes were first observed using metal shadowing EM (Gershon, Ghirlando et al. 1993). Evidence of lamellar complex formation came from cryo-TEM (Gustafsson, Arvidson et al. 1995), X-ray diffraction and optical microscopy (Radler, Koltover et al. 1997) (Spector and Schnur 1997). In this model, DNA is condensed by the cationic liposome and is trapped between fused lipid bilayers arranged in a typical multi-lamellar vesicle (MLV) pattern. Evidence for the cylindrical model arose from freeze fracture (Sternberg, Sorgi et al. 1994). 18 19 There is currently no consensus as to which structure is responsible for mediating transfection. While DNA-cationic liposome complexes demonstrate high levels of in vitro transfection (Feigner, Gadek et al. 1987; Feigner, Kumar et al. 1994), they also have a very large, heterogeneous size population, and a strong positive surface charge. Both of these features hamper their use for intravenous systemic gene delivery applications. DNA-cationic lipid complexes enter the cell via endocytosis. While it was once hypothesized that the complexes may fuse directly with the plasma membrane, studies have shown that this is not the case (Wrobel and Collins 1995). Further evidence for uptake via endocytosis has been generated employing protocols that modulate endocytosis pathways via ammonium chloride, hypertonic media, depleting cellular ATP levels, lowering temperature or changes in extracellular pH (Farhood, Serbina et al. 1995; Wrobel and Collins 1995; Stegmann and Legendre 1997). In addition, electron microscopy studies have given direct evidence for DNA-lipid complex uptake into endosomes (Zhou and Huang 1994; LabatMoleur, Steffan et al. 1996). In order for genes to be expressed, the DNA must be released from its cationic lipid carrier (Zabner, Fasbender et al. 1995). Earlier studies have shown that free DNA is released into the cytoplasm from an early endosomal compartment (Zhou and Huang 1994; Friend, Papahadjopoulos et al. 1996). A likely hypothesis is that the free DNA is released into the cytosol when the cationic lipids dissociate from the DNA to associate with anionic lipids in the endosomal membrane. This results in the destabilization of the endosomal membrane and subsequent release of plasmid DNA into the cytosol. Studies have also shown that the presence of the DNA carrier can affect the maturation of endosomes to lysosomes (Laurent, Wattiaux-De Coninck et al. 1999; Wattiaux, Laurent et al. 2000). In particular, endosomes containing cationic lipid 20 complexes are transported to and fuse with lysosomes much more slowly than normal endosomes (Wattiaux, Jadot et al. 1996). It has also been shown that not only the carrier system, but also the size of the complex affects the translocation process, with endosomes containing larger complexes being transported to, and fusing, with lysosomes more slowly than endosomes containing smaller complexes (Wattiaux, Laurent et al. 2000). This could be because larger complexes are taken up via phagocytosis. Phagosomes are known to mature and deliver their content to lysosomes more slowly than standard endosomes (Pitt, Mayorga et al. 1992; de Chastellier and Thilo 1997). 1.4 Systemic Gene Delivery Systems Current gene delivery systems for systemic intravenous cancer gene therapy have met with limited success. A systemic gene delivery system showing extended circulation lifetimes, accumulation at distal tumor sites and significant target gene expression has not yet been developed. Upon systemic administration, viral gene transfer systems are rapidly cleared from the circulation (Huard, Lochmuller et al. 1995; Worgall, Wolff et al. 1997), resulting in accumulation in first pass organs such as the liver or lungs. In addition, the immunogenicity of viral systems results in an acute immune response that limits the effect of subsequent doses and can be hazardous to the patient (Worgall, Wolff et al. 1997). Non-viral systems, such as plasmid-DNA-cationic lipid complexes perform adequately in vitro, but due to their large size and positive surface charge lipoplexes are also rapidly cleared from circulation and are similarly limited to applications involving transfection of first pass organs (Hofland, Nagy et al. 1997; Templeton, Lasic et al. 1997). DNA-cationic lipid complexes have also been shown to exhibit significant toxicity (Li and Huang 1997). 21 1.4.1 Liposomes as Carrier Systems The most widely used clinical application of liposomes is for the delivery of anticancer drugs to solid tumor sites. These liposomes are small (-100 nm diameter), long circulating (ti/2 >5 h), and these properties allow them to preferentially accumulate at tumor sites following intravenous (i.v). injection (Gabizon, Price et al. 1990; Gabizon 1992). This tumor accumulation of liposomes is known as passive targeting, and is due to the increased permeability of the vasculature at these tumor sites (see Fig 1-9). Normal vasculature contains capillaries composed of a continuous lining of endothelial cells and have an uninterrupted sub-endothelial layer of basement membrane. Tumor vasculature is often described as hyper-permeable, due to large defects in the endothelial layer. These defects include fenestrations, widened inter-endothelial junctions, and in some cases, blood channels that have little or no endothelial lining at all (Dvorak, Nagy et al. 1988; Kohn, Nagy et al. 1992). In order for liposomes to target to tumor sites, they must be long circulating, either having a neutral surface charge, or containing a poly(ethylene glycol) (PEG) coating. The PEG coating acts as a shield, keeping plasma proteins from binding to the liposomes and preventing their rapid clearance (Allen, Hansen et al. 1991). The promise of liposomes as conventional drug delivery systems has been demonstrated in the clinical use of various liposomal drug formulations, such as Doxil® or Calyx® (liposomal Doxirubicin for use in metastatic ovarian cancer and advanced Kaposi's sarcoma), or Vincristine®/Onco-TCS® (liposomal vincristine for use in non-Hodgkin's Lymphoma) (Maurer, Fenske et al. 2001). From this information, it follows that DNA encapsulated within long circulating liposomes should lead in preferential accumulation at tumor sites due to passive targeting. It was this line of reasoning that lead to the formulation of Stabilized Plasmid 22 Figure 1-9: A schematic diagram depicting the passive accumulation of liposomal formulations at diseased tissues through the enhanced permeability and retention effect. A. Liposomes containing anticancer drug extravasate from the blood through gaps in vascular endothelial cells and accumulate in solid tumor tissue. B. Drug is released from the liposomes and taken up into cells. C. Liposomes containing nucleic acid-based therapeutics such as plasmid DNA or antisense oligonucleotides bind to the cell surface either through ligand-mediated binding to receptors or through charge-charge interactions, which triggers internalization of the liposomal formulation into endosomes. Some proportion of the encapsulated material escapes the endosome with subsequent intracellular release. 23 Lipid Particles, or SPLP (Wheeler, Palmer et al. 1999). 1.4.2 Stabilized Plasmid-Lipid Particles (SPLP's) Previous work in this laboratory has resulted in a detergent dialysis procedure that allows complete encapsulation of plasmid DNA inside small (-70 nm), well-defined lipid vesicles (Wheeler, Palmer et al. 1999) (Figure 1-10). These vesicles contain fusogenic helper lipids (previously described in section 1.2) that are known to induce fusion with cellular membranes. Since fusogenic lipids do not readily form the bilayer structured needed for liposome formation they require stabilization by polyethylene glycol (PEG)-lipid conjugates. 1.4.2.1 Lipids used in SPLP Formulation There are three primary lipids used in the composition of the SPLP particle (Figure 1-11). The most abundant of them is the fusogenic, non-bilayer forming phospholipid dioleyl phosphatidlyethanolamine (DOPE). DOPE is an important component of the SPLP particle as it helps to facilitate the fusion event required for escape from the endosome. A cationic lipid is also a very critical component of the SPLP particle. In our studies, we use the cationic lipid N,N-dioleyl-N,N-dimethylammonium chloride (DODAC). This cationic lipid was chosen due to its permanent positive charge at physiological pH (which simplifies the encapsulation process) and its ease of manufacture. Cationic lipids possess a positively charged head group, and it is this positive charge that allows the interaction and condensation of the 24 Figure 1-10: A schematic diagram of Stabilized Plasmid Lipid Particles. 25 plasmid DNA, driving the encapsulation process. In addition to encapsulating the DNA, the cationic lipids also play a role in helping to stabilize the DOPE, allowing a lipid bilayer to form. The third lipid component of the SPLP is the PEG-lipid. The PEG-lipids purpose is to stabilize the DOPE into a bilayer, as well as allow the liposome to avoid uptake and removal from circulation by the reticuloendothelial system (RES) (Klibanov, Maruyama et al. 1990; Allen, Hansen et al. 1991), which leads to dramatically increased circulation lifetimes. These PEG-lipids diffuse out of the membrane over time, leading to a more fusogenic particle (Wheeler, Palmer et al. 1999). The most commonly used lipid composition in our studies is 8:82:10 DODAC:DOPE:PEG-lipid, respectively. Most foreign particles (including liposomes) are cleared by the RES via a process known as opsonization. This process involves the coating of the particle with either components of the complement system (such as C3b) or with antibodies. These coatings are then recognized by macrophages such as Kupffer cells in the hepatic system, leading to their uptake (Gordon 1995). While it was first thought that the PEG coating shielded the liposomes from opsonization, recent studies have found that PEG-stabilized liposomes are efficiently bound by plasma proteins, such as opsonins and dysopsonins (for a more complete review, see (Moghimi and Szebeni 2003). It is hypothesized that either the binding of dysopsonins (proteins that degrade opsonins), or that the opsonins are buried within the PEG layer, being inaccessible to interacting with cells of the RES, is responsible for the long clearance lifetimes (Moghimi and Szebeni 2003). In vivo studies have shown that systemic administration of SPLP resulted in not only a significant accumulation of plasmid at distal tumor sites, but tumor transfection levels that are over 1000 times higher than any other tissue (Monck, Mori et al. 2000) 26 N,N-dioleyl-N,N-dimethylammonium chloride (DODAC) 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) Ceramide structures Figure 1-11: Structure of the major lipids used in the formulation of SPLP. 27 Figure 1-12: In vivo SPLP expression profile (at 24 h) following a single i.v. injection of 200 ug of SPLP containing a CMV-Luciferase plasmid in an A/J mouse, hind flank Neuro-2a tumor model. 28 (Figure 1-12). There are enough copies of plasmid delivered to the tumor site after a single intravenous dose of SPLP in tumor bearing mice to allow for more than 1000 plasmids per tumor cell. In spite of these encouraging results, a major limitation of these systems is that the gene expression levels obtained in vivo are quite low. 1.5 Transcription and Translation 1.5.1 Transcription In eukaryotic cells, the majority of protein coding genes are transcribed by RNA polymerase II (RNAPII). RNAPII is unable to recognize gene promoters on its own, and relies on protein-protein interactions to recruit RNAPII to the promoter region. Specific transcription factors (TFs) are responsible for this recruitment. A number of TFs play a role in transcription. The major factors are TFIID (binds to TATA box), TFIIA (bound to TFIID as well as upstream DNA-binding proteins, such as those bound to enhancers), TFIIB, TFIIF and TFIIE, all of which contribute to stimulating transcription or to ensure correct initiation of transcription (Russell 1996). 1.5.2 Translation Translation is the process by which the protein coded in the mRNA transcript is read and synthesized. The initiation of translation is complex, and involves the association and co-ordination of many factors. The association of the initiation factors elF4A, elF4E and elF4G form the complex elF4F, which is then able to bind to the 5' cap of the mRNA transcript along with elF4B. This binding allows the recruitment of another complex, composed of the 40S ribosomal subunit, the elF3, and elF2 (bound to GTP and Met-tRNA) to the 5' cap. This complex is able to scan the transcript for the 29 Free ^ Proiein chain of a r rano"^ advance Figure 1-13: A diagram of translation. Incoming charged tRNAs with the appropriate anti-codons are brought into the ribosome and the amino acid they carry is added to the growing polypeptide chain (Russell 1996). 30 appropriate start codon (AUG), where the 60S subunit is recruited, forming a functional ribosome (80S) that is able to start synthesizing protein (Gallie 1998) (Figure 1-13). 1.6 Plasmids, DNA, mRNA Plasmids are small, circular molecules made up of DNA. DNA is composed of a sequence of nucleotides joined together via phosphodiester linkages between the 5' hydroxyl group of the deoxyribose moiety on one nucleotide and the 3' hydroxyl group of another nucleotide. Nucleotides are composed of a purine (A or G) or pyrimidine (C or T) base attached to a deoxyribose sugar via a B-glycosidic bond and a phosphate group. The strands are linked together via hydrogen bonding between purine and pyrimidine bases. Double stranded DNA is stabilized by hydrophobic interactions resulting from base stacking within the helix (Figure 1-14). In vivo, a DNA molecule is usually found as a double helix possessing two nucleotide strands running anti-parallel. Lederberg first coined the term plasmid in 1952 (Lederberg 1952) by studies on E. coli genetic factors that were not found on the chromosome. In more recent times, plasmids have become not only a workhorse of molecular biology, but also an integral part of non-viral gene therapy vectors. This can be attributed to their variable size (can carry from 1 ~ 30 kB of genetic material), their ease of isolation (Sambrook 1989), scale up, and manufacture. Plasmids for gene therapy typically possess a number of essential discrete elements. They contain an origin of replication (such as the ColE1), that is responsible for plasmid replication in bacteria, as well as controlling the copy number, thereby having an impact on plasmid yield. Plasmids also contain an antibiotic resistance gene (such as kanamycin resistance) that allows selection for bacteria containing the desired plasmid. Plasmids for gene therapy also contain a promoter sequence, driving 31 Bases P u r i n e s Pyr imid ines Aden ine (A) Guanine (G) Thymine (T) Cytos ine (C) 3' Figure 1-14: Structure of DNA (Taken from (Mok 1998)) 32 expression of a protein coding gene, either a therapeutic gene (e.g. thymidine kinase), or a reporter gene (e.g. luciferase). 1.6.1 Eukaryotic Transcription Unit The canonical transcription unit (encoding for a protein) is composed of many elements, such as the promoter, structural gene, enhancers, etc. The structural gene refers to the DNA unit that only encodes for a specific polypeptide chain (Jacob and Monod 1961). While this is an integral part of the transcription unit, a gene on its own will not be expressed without a promoter. The core promoter is usually 30-40 nt 5' to the start of transcription. This region contains the TATA box. This is the minimal element necessary for transcription. Proteins such as TBP (TATA-binding protein) bind to this region (Nikolov, Hu et al. 1992), and also interact with other proteins called TAFs (TBP-associated factors) (Greenblatt 1992). This complex eventually leads to the recruitment and positioning of the RNA polymerase, so that transcription can take place (Roeder 1991). Immediately upstream of the core promoter are located the Upstream Activation Sequences (UAS). This region can contain numerous binding sites for various transcription factors and activators. Enhancers are required for maximal transcription of the gene to occur. They can be located quite far (over 1kB) away from the core promoter, can be found 5' or 3' to the promoter, and are able to act in either orientation (Khoury and Gruss 1983). Silencers are control regions of DNA that, like enhancers, may be located very far from the core promoter, however, when transcription factors bind to them, expression of the gene they control is repressed, instead of enhanced (Brand, Breeden et al. 1985). 33 1.6.2 Promoters The CMV promoter is one of the strongest promoters found in nature. It drives expression of the immediate-early genes of human cytomegalovirus (CMV) (Boshart, Weber et al. 1985; Foecking and Hofstetter 1986). This promoter/enhancer unit is the most commonly used promoter as very high expression levels are seen both in vitro and in vivo, and among different cell lines (Cheng, Ziegelhoffer et al. 1993; Wenger, Moreau et al. 1994; Tsan, White et al. 1995; Liu, Cashion et al. 1997) (Figure 1-15). It is for this reason that the CMV promoter was chosen as the primary nuclear promoter for the experiments in this thesis. The CMV promoter is down regulated by hyper-methylation (Scharfmann, Axelrod et al. 1991; Challita and Kohn 1994; Rettinger, Kennedy et al. 1994), and is sensitive to the levels of various transcription factors (e.g. increases in N F K B leads to an increase in CMV expression (Lee, Sohn et al. 2004)). In this thesis, the effect of two other promoters, the Rous Sarcoma Virus (RSV) promoter (Norton and Coffin, 1987), and the Simian Virus 40 (SV40) promoter (Bensimhon, Gabarro-Arpa et al. 1983; Luciw, Bishop et al. 1983) are examined. Studies comparing these promoters have found that there is often a dramatic difference in expression levels depending on the cell line used (Wenger, Moreau et al. 1994; Liu, Cashion et al. 1997; Zarrin, Malkin et al. 1999). In a recent study by Zarrin et al, it was found that for most cell types used, the CMV promoter gave much higher expression than either the RSV or the SV40 promoter. In fact, the SV40 promoter often demonstrated little if any expression in some cell lines. 34 - 6 0 3 R S R F ATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTC C A r G / S R F G C - r i c h ATAGC£CJ^TATGSAGTTCCGCGTTACATAACTTACGGTAAATGGCCCRrCTGGCTC;A SP1 S P 1 / A P 2 C R E B C R E B CCGCCCAACGACCCCCGCCCAYTGACGTCAATAATG_AC^TATGTTCCCATAGTAACGCC N F K B C R E B E - Box AATAG„GuACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGG E - B o x E - Box G C - r i c h C R E B C R F . B CAGl'ACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACCTCAATgACGGTAAA G C - r i c h N F K B TfiGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGCCACTA CATC?ACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATG NFtfB CREB GGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAAT N F k B Long S P 1 GGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGC (SIM) CRliB E - Box SP1 TAT A-Box CCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTC + 1 ---> mRNA Transcripi GTTTAGTGAACCG TCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCA'TAG Figure 1-15: Sequence of CMV promoter. This shows 603 bp of the promoter and the first part of the transcribed message. Note the location of the TATA box and the numerous upstream activation elements that act as binding sites for numerous transcription factors (Taken from (Wolff 1994)). 35 1.6.4 Capping The 5' ends of eukaryotic mRNA transcripts are modified by the addition of a 5' cap. This capping procedure involves the addition of a 7-methyl guanosine nucleotide to the 5' terminal in an unusual 5'-5' linkage, and the addition of two methyl groups to the first two nucleotides of the RNA chain. Capping occurs in the nucleus during transcription when the transcript is around 30 nt long and is catalyzed by the capping enzyme (a guanylyltransferase) (Shatkin 1976). In addition to being the start of translation, the cap site also helps to stabilize the mRNA transcript (Coutts and Brawerman 1993; Ptushkina, von der Haar et al. 1999). 1.7 Cytoplasmic Expression Systems 1.7.1 Background One strategy to increase levels of gene expression following non-viral cell transfection involves the use of a cytoplasmic expression system (Gao and Huang 1993). A cytoplasmic expression system is one that, as the name suggests, is able to mediate the expression of genes in the cytoplasm, as opposed to the nucleus. The advantage of such a system is that it bypasses the need for nuclear delivery of plasmid DNA, a major obstacle in present day gene therapy. The efficiency of nuclear delivery following intracellular delivery is very low and is dependent on the size of the plasmid DNA molecule (Hagstrom et al, 1997). Studies where plasmid DNA was microinjected into either the cytoplasm or the nucleus of cells demonstrated that less than 0.1% of the total cytoplasmic plasmid enters the nucleus (Lechardeur, Sohn et al. 1999). The addition of nuclear localization signals to plasmid DNA has been shown to enhance transfection, but with limited success (only a 3-fold increase in expression) (Aronsohn 36 and Hughes 1998). The primary barrier to nuclear delivery of plasmid DNA is thought to be the nuclear membrane, as plasmid DNA enters the nucleus more efficiently in mitotic or dividing cells, during the breakdown of the nuclear envelope (Coonrod, Li et al. 1997). As a result, gene expression following transfection is much higher in dividing versus non-dividing cells (Vitadello, Schiaffino et al. 1994; Mortimer, Tarn et al. 1999). A further limitation of nuclear expression systems is the finite, saturable limit to the amount of DNA that can be taken up by the nucleus under any condition (Brisson, Tseng et al. 1999). 1.7.2 Phage RNA Polymerase These limitations have led to the development of strategies that do not require nuclear localization of DNA. One of these involves the use of bacteriophage RNA polymerase proteins (phage RNAP). The phage RNAPs are single polypeptide enzymes that mediate transcription of phage genes in the cytosol of infected bacteria (Chamberlin, McGrath et al. 1970). Early on it was discovered that these phage RNAP proteins were able to also mediate transcription in the cytoplasm of eukaryotic cells with high promoter specificity and efficiency (Davanloo, Rosenberg et al. 1984). These properties have facilitated the development of a phage RNAP based cytoplasmic expression system. While most of the field has focused on the T7 RNAP (Davanloo, Rosenberg et al. 1984), this thesis also investigates the T3 as well as the SP6 RNAP proteins (Kupper, McAllister et al. 1972; Butler and Chamberlin 1982). 37 1.7.3 Initial Cytoplasmic Expression Systems The T7 RNAP-based system requires cytoplasmic delivery of both a plasmid construct containing a gene of interest under transcriptional control of the T7 promoter and a source of T7 polymerase. Initial studies involved co-transfection of cells with plasmids carrying T7-controlled genes and purified T7 RNAP protein. These systems were able to bypass the need for the nuclear transcription machinery and yielded high levels of gene expression, however, due to the instability of the T7 RNAP protein, the resulting gene expression was short lived, and considerable T7 RNAP associated cytotoxicity was observed (Gao and Huang 1993). These studies led to the use of a T7 polymerase autogene, first described in 1991 by Dubendorff and Studier (Dubendorff and Studier 1991). This system consists of a T7 RNAP gene driven by its own T7 promoter, along with a reporter gene, also driven by the T7 promoter (Figure 1-16). When cells were co-transfected with these constructs and purified T7 RNAP protein, rapid and sustained levels of reporter protein were detected. The T7 autogene was able to replenish its supply of T7 RNAP, resulting in sustained gene expression (Chen, Li et al. 1994). While these autogenes are effective, the transfection cocktail is difficult to prepare and in practice has been shown to be cytotoxic. To overcome these problems, a dual promoter autogene was created in 1999 (Brisson, He et al. 1999). This construct contained a T7 RNAP gene under control of both T7 (cytoplasmic) and CMV (nuclear) promoters. The basis of this construct is that when plasmid was taken up into the nucleus it would result in some T7 RNAP protein being produced. This RNAP in turn would be able to transcribe the cytoplasmic plasmid (the major portion of plasmid in the cell), which would then lead to further expression of the T7 RNAP. Theoretically, one plasmid reaching and expressing from the nucleus 38 4 Figure 1-16: A diagram of the T7 RNAP autogene. An initial source of T7 RNAP in the cell binds to the T7 promoter (1) and transcribes some T7 RNAP mRNA (2). The mRNA is translated into T7 RNAP protein (3), which is then able to transcribe more T7 RNAP mRNA (1, 2), setting up an autocatalytic, exponentially increasing system. In addition, the T7 RNAP produced is able to transcribe mRNA of a reporter or therapeutic gene, either on the same plasmid or on a separate plasmid (4), allowing for high levels of transgene expression. 39 Figure 1-17: A schematic diagram of the cytoplasmic expression system. The plasmid DNA (circle) is delivered to the target cell via a carrier system (e.g. lipoplex, SPLP) (1). Upon delivery and release of plasmid, a small percentage of DNA will enter the nucleus (2), where the transcription machinery will make a T7 RNAP mRNA transcript (using the CMV promoter), which is then exported into the cytoplasm (3). In the cytoplasm the mRNA is translated into T7 RNAP protein (red circle) (4), where it can then transcribe T7 RNAP and target gene mRNA from cytoplasmic plasmids (via the T7 promoter). This in turn creates more T7 RNAP and more target protein (blue box) (5), which amplifies the cascade until all plasmids are being transcribed, or the cytoplasmic transcription machinery is being used to its full extent. 40 would be sufficient to activate and induce high levels of gene expression from thousands of cytoplasmic plasmids (Figure 1-17). While this system did represent an advance in the field, there were some problems that had not been addressed. First, they had the autogene and reporter gene cassette on separate plasmids, necessitating the co-delivery of two plasmids in order to observe gene expression. In addition, they only observed a 2-3 fold increase in gene expression. This small increase was most likely due to the fact that the autogene cassette that they were using did not contain an IRES element (described below), and therefore the cytoplasmic transcripts (lacking the 5' cap) were not efficiently translated. 1.7.4 Internal Ribosome Entry Sequence Elements Internal Ribosome Entry Sequences (IRES) are elements that have been shown to drive expression of the second gene in a bi-cistronic mRNA transcript, as well as increase the translation of un-capped transcripts. IRES elements were first isolated from viral genomes, such as the encephalomyocarditis virus (EMCV), where they allow the translation of viral mRNA transcripts, made in the cytoplasm, and thus lacking the 5' cap structure essential for mRNA translation (Jang, Pestova et al. 1990). Various viral IRES elements, such as the EMCV, FMDV (foot and mouth disease virus), and other picornavirus based IRES elements share similar features. All are approx 450 bp long and share a conserved secondary structure, as well as a pyrimidine-rich tract that starts -25 bp before the 3' end of the IRES (Agol 1991; Jackson, Hunt et al. 1994; Jackson and Kaminski 1995). The secondary structure is hypothesized to allow for proper alignment of ribosome subunits and other co-factors necessary for translation. Other IRES sequences (e.g. Gtx) are much shorter than picornaviral IRESs and contain 41 sequences that are complementary to rRNA (Chappell, Edelman et al. 2000). These IRES work in a different fashion than the picornaviral IRES and the studies in this thesis (described in Chapter 3) show that these short rRNA complementary IRES sequences are not effective in driving expression from un-capped mRNA. Other mammalian IRES sequences (such as the one driving expression of mRNA encoding elF4G) contain a polypyrimidine tract and some structural similarities to the EMCV IRES, however are shorter than picornaviral IRESs (-100 bp) (Gan, LaCelle et al. 1998). Similar to the rRNA complementary IRES elements, it is shown in this thesis that the elF4G IRES is not effective in directing translation from un-capped mRNA. It is hypothesized that the picornavirus IRES possess a secondary structure that is important for cap-independent mRNA translation (Attal, Theron et al. 1999), an essential component of the autogene based cytoplasmic expression system. 1.8 Objectives of Thesis As described previously, a systemic gene delivery system showing extended circulation lifetimes, accumulation at distal tumor sites and significant target gene expression has not been developed. While the SPLP technology developed in our lab allows for extended circulation lifetimes, accumulation at tumor sites, and preferential tumor gene expression, the levels of expression using this carrier system are quite low. It was the objective of this thesis to increase the levels of gene expression following non-viral, plasmid based gene delivery by increasing the effectiveness of the plasmid payload, as opposed to modifying the lipid-based carrier system. In Chapter 2, the novel dual promoter autogene based cytoplasmic expression system is introduced and characterized, demonstrating an exponential increase in gene expression levels, as well 42 as a 20-fold increase in expression over a standard nuclear control plasmid. In Chapter 3, efforts are made to further enhance the expression levels of the cytoplasmic expression system and in the process, it is determined that the factors responsible for limiting cytoplasmic expression are the levels of mRNA transcription and translation. In Chapter 4, a comparison between a cell line that shows high cytoplasmic expression is compared with a cell line that shows relatively poor expression levels, and it is determined that the most likely cause for the difference is due to the differences in intra-cellular processing of the lipid:DNA complexes. 43 CHAPTER 2 CREATION AND CHARACTERIZATION OF A NOVEL AUTOGENE BASED CYTOPLASMIC EXPRESSION SYSTEM 2.1 Introduction A major limitation of gene delivery systems is the relatively low level of gene expression in transfected tissues. One strategy to increase levels of gene expression following transfection employing a non-viral vector involves improving the plasmid design. The incorporation of a cytoplasmic expression system represents one such approach (Elroy-Stein and Moss 1990; Dubendorff and Studier 1991; Gao and Huang 1993). Cytoplasmic expression systems bypass the requirement for nuclear delivery of plasmid DNA, a major obstacle in present day gene therapy (Capecchi 1980),(Zabner, Fasbender et al. 1995; Wilke, Fortunati et al. 1996; Coonrod, Li et al. 1997). In addition, they take advantage of the large number of plasmids found in the cytoplasm of the cell following transfection with non-viral vectors (Lechardeur, Sohn et al. 1999). Cytoplasmic expression systems can be designed to utilize the unique properties of the bacteriophage RNA polymerases (RNAPs). Phage RNAPs are moderately sized (-100 kD), single subunit proteins capable of synthesizing RNA from DNA templates. They require no additional co-factors and have demonstrated efficient cytoplasmic transcriptional activity (Chamberlin, McGrath et al. 1970; Dunn, Bautz et al. 1971). These features make phage RNAPs attractive candidates for the development of autocatalytic cytoplasmic expression systems using autogenes. Phage RNAP autogenes consist of an RNAP gene, driven by its own cognate promoter (Dubendorff and Studier 1991). In order to evade the requirement for exogenous RNAP to initiate the expression system, a nuclear promoter can be added upstream of the RNAP 44 promoter (Brisson, He et al. 1999). Although the first round of RNAP expression must occur via the nuclear promoter, the resulting RNAP in the cytoplasm drives the cytoplasmic expression system, producing RNA from plasmid DNA template in the cytoplasm. RNA produced in the cytoplasm lacks the 5' cap that stabilizes nuclear transcripts and assists in ribosomal recruitment (Kaempfer, Rosen et al. 1978) (Drummond, Armstrong et al. 1985). Viral Internal Ribosome Entry Site (IRES) elements are sequences that have been shown to enhance the recruitment of the cytoplasmic translational machinery in the absence of 5' capping (Jang and Wimmer 1990). Early dual promoter cytoplasmic expression systems did not contain IRES elements, and as a result, the vast majority of the mRNA produced was not translated (Brisson, He et al. 1999). Although an autogene based on the T7 bacteriophage RNAP that contained an EMCV IRES has been previously described (Deng and Wolff 1994), it did not contain a eukaryotic promoter and required the co-transfection of RNAP protein or mRNA, thereby limiting its utility. In this study, a novel autogene construct containing both the EMCV IRES element (to allow cap-independent translation), and the CMV promoter (to bypass the need for additional exogenous RNAP protein or mRNA during transfection) was characterized. In addition, the autogene and reporter gene cassettes were combined onto a single plasmid, whereas other systems have utilized separate plasmids. A cell-free system for the evaluation of RNAP based transfection reagents was developed and used to demonstrate the potential of the autogene system to elicit high levels of gene expression. 45 2.2 Materials and Methods 2.2.1 Plasmids and Primers Plasmid R023 consists of a basic autogene cassette driven by a CMV promoter and intron. The autogene cassette was derived from the plasmid T7-G1, a gift of Dr. Jon Wolff (Waisman Center, Wisconsin). T7-G1 contains the basic autogene cassette, consisting of the T7 promoter, EMCV IRES, and T7 RNAP gene. The nuclear localization sequence was removed from the T7 RNAP via PCR prior to subcloning into R023. L059 consists of a pTRI-Amp (Ambion) backbone with EMCV IRES, Photinus pyralis luciferase and beta-globin poly-adenylation site derived from EMC-Luc (Dr. Jon Wolff). L053 consists of the CMV promoter (with intron) from NGVL3 and the Photinus pyralis luciferase gene. L069 and L070 consists of L053 containing one or two irrelevant 2.5 kb spacer fragments respectively. R037 consists of R023 without the T7 and T3 promoters. R011 is a bi-cistronic plasmid consisting of R023 with a downstream luciferase reporter gene cassette from L059 (bi-cistronic). PT7-Luc (Promega) consists of the Photinus pyralis luciferase gene driven by a T7 RNAP promoter. RPA-RNAP consists of a 350 bp Kpn I - Ail II T7 RNAP fragment blunted and ligated into the Sma I site of pTRI-Amp in reverse orientation. RPA-Luc consists of a 250 bp Xcm1 - BsrG 1 luciferase fragment blunted and ligated into the Sma'\ site of pTRI-Amp in the reverse orientation. The NVSC1 primer sequence is 5'-TCCTGCAGCCCGGGGGATCCTCTAG-3'. 2.2.2 Transcription and Translation Assay A 25 pi reaction was set up using a Promega (Wisconsin) Coupled In Vitro Transcription and Translation kit as per the manufacturer's instructions. PT7-Luc (250 46 ng) was added to all reactions. R023 (250 ng) (containing a 17 RNAP gene driven by the T7, SP6 and T3 promoters) or R037 (containing a T7 RNAP gene driven only by the SP6 promoter) was then added to the reactions. SP6 RNAP (0.5 U) (Promega) was added and each reaction was incubated at 30°C. At the time points indicated, 2 pi of reaction mixture was removed and assayed for luciferase expression as described below. All reactions were performed in triplicate. 2.2.3 Transfections Lipoplexes were formed by mixing plasmid DNA with large unilamellar vesicles (LUVs) composed of equimolar amounts of DOPE:DODAC (50:50) (prepared via extrusion) on ice and incubated for 20 min prior to use. All transfections were performed at a cationic lipid to plasmid DNA charge ratio of 3:1. Lipoplexes were diluted with serum-containing media before addition directly to cell media. BHK cells were plated at 25,000 cells per well in 24-well plates. Neuro-2a cells were plated at 30,000 cells per well in 24-well plates. The total mass of plasmid added was identical in all transfections. Equimolar transfections using plasmids of different sizes were achieved through the addition of an empty vector (pBlueScript) to normalize the total mass of DNA in each transfection. All transfections were performed in triplicate. Data is presented as mean values +/- standard error. 2.2.4 Luciferase and BCA Assays Cells were washed twice with 1 mL PBS followed by the addition of 0.2 mL lysis buffer (PBS with 0.1 % Triton X-100) before being stored at -70 0 C. Cells were thawed and 5-20 pi of sample were assayed in duplicate on a 96-well plate. Samples were 47 assayed using a Berthhold Centra LB960 Microplate Luminometer and Luciferase Assay System (Promega). Standard luciferase assays were performed and transfection data is reported as mass quantities of luciferase protein using a standard curve obtained from serial 10-fold dilutions of a 20 mg/mL Photinus pyralis luciferase standard (Promega). Cell-free luciferase assays are reported in Relative Light Units (RLUs). Total protein was quantified using a Pierce BCA assay kit as per manufacturer's instructions. 2.2.5 Immunofluorescence BHK cells were plated on glass coverslips in 6-well plates (150,000 cells per well) and transfected with 1.5 ug of plasmid DNA . At 24 h post-transfection, cells were washed once with 2 mL PBS-IF (10 mM sodium phosphate, 140 mM sodium chloride, pH 7.4) prior to fixation for 10 min with 2 mL 2% paraformaldehyde. Cells were subjected to three 30 s washes before permeabilization with 0.25% Triton X-100 in PBS-IF for 5 min. After washing three times for 30 s with PBS-IF, cells were incubated with blocking buffer (10% BSA in PBS-IF) for 1 h, shaking gently at room temperature. Cells were washed three times for 10 min with PBS-IF followed by addition of primary antibody solution consisting of a 1:1000 dilution of goat anti-T7 RNAP antibody (a gift from Dr. Paul Fisher at the Department of Pharmacological Sciences, State University of New York at Stony Brook) or 1:1000 dilution of mouse anti-luciferase monoclonal antibody (Abeam) in 2% BSA in PBS-IF. Cells were incubated with primary antibody solution for 2 h while shaking at room temperature. Cells were washed three times for 10 min in PBS-IF followed by the addition of secondary antibody (Rabbit anti-goat IgG, FITC labeled (QED Bioscience Inc) or Texas Red labeled Rabbit anti-mouse (Abeam), 48 1:200 dilution in 2% BSA-PBS-IF) and incubated for 2 h while shaking at room temperature. Cells were washed four times for 10 min with PBS-IF before being mounted and photographed on a Zeiss Axiovert S100 fluorescence microscope. The percentage of cells transfected was determined by counting transfected and non-transfected cells under the microscope. Data indicate the average of six separate counts from three different experiments. 2.2.6 RNase Protection Assay RNAP and luciferase probes were prepared from EcoR 1 digested RPA-RNAP or RPA-Luc plasmid respectively. GAPDH probe was purchased from Pharmingen. Probes were labeled following the manufacturers protocol using 3 2P-aUTP (3000 Ci/mmole, 10mCi/mL)(NEN). BHK cells were plated on 6-well plates (150,000 cells per well) and transfected with 1.5 pg of R011 or L053 in triplicate. After 24 h cells were treated with 20 pg/mL Actinomycin D. At 0, 2, 4, 6 or 8 h after Actinomycin D treatments, cells were washed once with PBS and recovered by treatment with trypsin. Cells from triplicate wells were pooled before harvesting total RNA (RNeasy miniprep kit, Qiagen). Total RNA (10, 5 or 2.5 pg) was subjected to RNase protection analysis using the RiboQuant RPA system (Pharmingen) according to the manufacturer's protocol. All values shown are the average +/- standard deviation of two independent experiments. Data was collected using a Typhoon Phosphorimager (Amersham Biosciences) and analysis was performed using ImageQuant software (Amersham Biosciences). 49 2.2.7 Primer Extension Primer extension analysis using 32P-labeled primer NVSC1 and 100 pg of RNA isolated from R011-transfected BHK cells (24 h post transfection) was performed using a Primer Extension System (Promega). The ladder was prepared by end labeling ct>X174 Hint I digested DNA markers with 3 2 P (from AT 3 2 P. All values shown are the average +/- standard deviation of two independent experiments. Data was collected as described for RNase Protection assay above. 2.3 Results 2.3.1 Autocatalytic Gene Expression Results in an Exponential Time Dependent Increase in Gene Expression A hallmark of an autocatalytic, self-amplifying system is an exponential, time-dependent increase in the product being amplified. This exponential relationship would be limited only by the amount of substrate available (i.e. charged tRNA, GTP, etc.), and would continue as long as the template plasmid is in excess. In order to verify the autocatalytic nature of the autogene, a cell-free transcription and translation assay was performed. R023 plasmid DNA (consisting of T7 RNAP driven by both SP6 and T7 RNAP promoters) was incubated with a PT7-Luc reporter gene plasmid (consisting of luciferase driven by only the T7-promoter) in the presence of rabbit reticulocyte lysate and SP6 RNAP. SP6 RNAP transcribes T7 RNAP RNA from the R023 plasmid, leading to the production of T7 RNAP protein that is then able to drive expression of both the T7 RNAP gene from R023 in an autocatalytic fashion, as well as expression of the luciferase gene from PT7-Luc. Figure 2-1 shows a dramatic increase in luciferase expression over time, indicating an exponential, autocatalytic increase in T7 RNAP protein. This increase is not observed when a control plasmid (R037, consisting of T7 50 a c 140 120 100 o o a so X £ 60 s 40 20 • • R 0 2 3 (Autogene) Exponential Fit « P T 7 - L u c (negative control) tR037 (RNAP control) 10 20 30 40 Time (min) Figure 2-1: Transcription and Translation assay, a) Schematic diagram of the transcription and translation assay. SP6 RNAP binds to the SP6 promoter (PSP6) on R023 (17 RNAP driven by SP6 and T7 promoters) (1) transcribing T7 RNAP mRNA, which is (2) translated into T7 RNAP protein. The T7 RNAP protein then binds the T7 promoter (PT7) on R023 (3) resulting in more T7 RNAP protein (2) and initiating the autocatalytic cycle and an exponential increase in T7 RNAP production. T7 RNAP also transcribes luciferase mRNA from PT7-Luc (4), resulting in an increase in luciferase expression proportional to the amount of T7 RNAP present. b) In the control reaction, the lack of PT7 in R037 (T7 RNAP gene driven by only SP6 promoter) prevents any autocatalytic production of T7 RNAP (3). c) An in vitro coupled transcription and translation (Promega) assay. 250 ng of PT7-Luc was combined with 250 ng of either R023 or R037 in a total reaction volume of 15 pi and 0.5 U of SP6 RNAP (Promega) was added and incubated at 30° C. 2 pi aliquots were removed at time points indicated and subjected to luciferase analysis as described in Materials and Methods. After an initial lag phase, the R023 reaction resulted in an exponential increase in luciferase expression, verifying the autocatalytic nature of the system. 51 RNAP driven only by the SP6 promoter) lacking the T7 promoter needed for autocatalytic amplification is used. The reason for the lack of expression from R037 is that without the autocatalytic amplification, the amount of T7 RNAP produced is not enough to give rise to detectable levels of luciferase expression. 2.3.2 A Bi-cistronic Construct Results in Higher Levels of Gene Expression Than a Dual Plasmid Transfection Previously published work on cytoplasmic expression systems employed an autogene cassette and a reporter gene cassette on separate plasmids (Brisson, He et al. 1999). It was of interest to compare the expression resulting from a dual plasmid transfection system with a single plasmid bi-cistronic system in which the autogene and reporter gene were on one large plasmid. When equimolar amounts of autogene and reporter gene constructs were used to transfect BHK cells, it was found that the bi-cistronic construct yielded 2 to 4 fold higher levels of gene expression than the analogous dual plasmid transfection (Figure 2-2). This result was unexpected because previous results suggest that transfection (delivery to nucleus and subsequent expression) would be more efficient for the smaller autogene plasmid than the larger bi-cistronic construct (Kreiss, Cameron et al. 1999). For the dual plasmid transfection, this would result in a greater number of cells expressing RNAP via the CMV promoter in the nucleus, and accordingly greater levels of luciferase via the RNAP promoter in the cytoplasm. In order to understand this phenomenon, a series of luciferase plasmids of increasing size were prepared to determine the effect of plasmid size on transfection efficiency in BHK cells. It was found that L053 (5.8 kb) L069 (8.3 kb) and L070 (10.8 kb) yielded similar levels of gene expression when transfected in equimolar amounts (Figure 2-3). This suggests that for the system described here, larger plasmids are not at a disadvantage compared to 52 a R 0 2 3 L 0 5 9 R 0 2 3 + L 0 5 9 R 0 1 1 Figure 2-2: Comparison of bi-cistronic construct versus a dual plasmid transfection. a) Diagrams of plasmids used, b) BHK cells were transfected with 1 pg/well of plasmid. Equimolar amounts of plasmids were added, and the total mass of DNA per transfection was kept equal by adding an unrelated plasmid (pBlueScript). Transfections and luciferase assays were performed as described in Materials and Methods. Error bars indicate standard error. 53 a L 0 5 3 L 0 6 9 L 0 7 0 ( 5 . 8 k B ) ( 8 . 3 k B ) ( 1 0 . 8 k B ) Figure 2-3: Plasmid size does not effect transfection of BHK cells, a) Diagrams of plasmids used, b) BHK cells were transfected with a total of 1 pg/well. Equimolar amounts of plasmid were added, and the total mass of DNA per transfection was normalized by adding an unrelated plasmid (pBlueScript). Error bars indicate standard error. 54 the smaller plasmids. In addition, immunofluorescence studies using anti-T7 RNAP and anti-luciferase antibodies showed that the same percentage of cells are being transfected with the bi-cistronic construct as with the dual plasmid transfection (data not shown), further supporting this finding. 2.3.4 The Cytoplasmic Expression System Results in a 20-fold Increase in Gene Expression per Cell Compared to a Nuclear Expression System In order to compare the relative efficiency of nuclear versus cytoplasmic expression, BHK cells were transfected with equimolar amounts of a CMV-Luciferase (L053) and a bi-cistronic autogene plasmid containing both the autogene cassette, as well as the luciferase reporter gene cassette (R011). As shown in Figure 2-4, the autogene system yielded a 20-fold increase in luciferase expression when compared with the CMV-mediated nuclear expression system. It was of interest to determine whether the increase in luciferase expression was the result of greater levels of luciferase production in each transfected cell or due to an increase in the total number of cells being transfected. The number of cells transfected with the autogene system was experimentally determined and compared with the number of cells transfected with the standard nuclear expression system. Transfected cells were quantified using immunofluorescence with both anti-T7-RNAP and anti-luciferase antibodies and BHK cells transfected with either the autogene or nuclear expression construct. As seen in Fig 2-5, the autogene and nuclear expression constructs both result in transfection of approximately the same number of cells (autogene 11.4% +/- 3.5, nuclear 10.7% +/- 2.9). The increase in reporter gene expression from the 55 a CMV L 0 5 3 R 0 1 1 Figure 2-4: A comparison of autogene and nuclear expression, a) Diagrams of plasmids used (note, these plasmids were used for all following figures), b) BHK cells were transfected with a total of 1 pg/well. Equimolar amounts of plasmids were added, and the total mass of DNA per transfection was kept equal by adding an unrelated plasmid (pBlueScript). Error bars indicate standard error. 56 L053 R011 (nuclear) (cytoplasmic) Figure 2-5: Immunofluorescence of BHK cells transfected with cytoplasmic or nuclear expression constructs. BHK cells were transfected with equimolar amounts of R011 (autogene) or L053 (nuclear) plasmids. Cells were fixed 24 h post transfection and subjected to immunofluorescence using anti-T7 RNAP antibodies (with a FITC conjugated secondary) and anti-luciferase (with a Texas Red conjugated secondary). A similar number of cells were transfected when using either the autogene or nuclear expression plasmids. In the case of the autogene transfection, every cell that is expressing RNAP is also expressing luciferase. 57 bi-cistronic autogene construct can therefore be attributed to an increase in the level of gene expression in transfected cells, as opposed to an increase in the number of cells being transfected. It was important to make sure that the 20 fold increase in expression was not limited to BHK cells. As can be seen in Figure 2-6, a similar autogene-mediated improvement in gene expression was also observed in the Neuro-2a murine neuroblastoma cell line. The system described here is initially dependent on the nuclear transcription of T7 RNAP. It was of interest to determine the proportion of nuclear transcripts derived from the CMV promoter versus cytoplasmic transcripts derived from the T7 promoter. As the two promoters have different transcription start sites, the two transcripts will have different length 5-untranslated regions. Therefore, a primer extension assay was performed using a primer that binds downstream of the two promoters, 90 bp downstream from P T7 and 300 bp downstream of the P C M V - Figure 2-7 shows that a much higher proportion of mRNA is transcribed from the T7 promoter than from the CMV promoter (~57 +/-11 fold). This is consistent with previous work that found the large majority of transcripts in the cell were transcribed by the T7 RNAP in the cytoplasm (Brisson, He et al. 1999). This further demonstrates that only a catalytic amount of RNAP needs to be expressed in the nucleus for large amounts of cytoplasmic mRNA to be produced. 2.3.4 Cytoplasmic mRNA Transcripts have a Shorter Half-life than Nuclear Transcripts It was of interest to determine the half-life of the cytoplasmic transcripts as the lack of 5' cap structure on the cytoplasmic transcripts may result in a decrease in mRNA 58 7 0 c Figure 2-6: Increased autogene expression is also seen in Neuro-2a cells. Neuro-2a cells were transfected with a total of 2ug/well. Equimolar amounts of plasmids were added, and the total mass of DNA per transfection was kept equal by adding an unrelated plasmid (pBlueScript). Error bars indicate standard error. Transfection with the autogene (R011) yielded a 20-fold increase in expression over the standard nuclear expression plasmid (L053). 59 CD •o CD O 3 0 0 b p 9 0 b p CMV rTRI » I R E S T 7 R N A P • r — • Nuc lear (300 bp) Cy top lasmic (90 bp) Figure 2-7: Primer extension assay performed on BHK cells transfected with the bi-cistronic autogene construct (R011). A) The transcripts initiated at the nuclear CMV promoter were predicted to have a longer 5' untranslated region resulting in larger fragments, -300 bp in size, while transcripts initiated at the T7 promoter were predicted to have a shorter 5' untranslated region, -90 bp in size. B) Transfection of BHK cells with the bi-cistronic autogene construct (R011) yielded approximately 57 +/-11fold more short cytoplasmic transcripts as long nuclear transcripts, indicating that the majority of transcription is initiated by the T7 RNAP in the cytoplasm. 60 stability (Drummond, Armstrong et al. 1985; Bernstein and Ross 1989; Jackson and Standart 1990; Sachs 1990). An RNase Protection Assay (RPA) was used to measure both the half-life of the mRNA as well as the relative amounts of RNA present. BHK cells were transfected with equimolar amounts of R011 (autogene) and L053 (nuclear) plasmids. At 24 hours post-transfection, 20 pg/mL Actinomycin D was added to inhibit all de novo RNA synthesis. Previous work had demonstrated that this amount of Actinomycin D was sufficient to inhibit >99% of RNA synthesis (data not shown). Cells were harvested at 2 hour intervals and total RNA was isolated. As calculated from Figure 2-8, the half-life of the autogene transcripts average 103 +/- 6 min (88 +/- 3 min calculated using the RNAP probe, 115 +/- 5 min calculated using the Luciferase probe). The half-life of the nuclear transcripts was 317 +/- 6 min. By this analysis, it was determined that the cytoplasmic transcripts are not as stable as the nuclear transcripts. Densitometric analysis of the luciferase transcript band from the nuclear and cytoplasmic transfections, there are approximately 20-fold more autogene-derived luciferase transcripts as there are nuclear luciferase transcripts. Given that the half-life of the autogene transcripts is three times shorter than the nuclear transcripts; this suggests that the autogene produces at least 60 fold more mRNA than the standard nuclear expression system. 61 Figure 2-8: Ribonuclease Protection Assay of RNA derived from BHK cells transfected with bi-cistronic autogene construct (R011) or nuclear construct (L053). BHK cells were treated with Actinomycin D 24 h post transfection. Total RNA was harvested at 2-h intervals following treatment. 10, 5 or 2.5 ug of total RNA was subjected to an RNase Protection Assay using 3 2 P labeled probes against 17 RNAP (RNAP) and Luciferase (Luc) transcripts (see Materials and Methods). All values were standardized against the GAPDH control. Approximately 20 times as many luciferase transcripts were detected in the autogene transfected cells as the nuclear transfected cells. The half-life of the autogene transcripts is approx 103 min, approximately 3-fold shorter than the half-life of the nuclear transcripts, 317 min. 62 2.4 Discussion A novel bi-cistronic autogene based cytoplasmic expression system is described that demonstrates a 20-fold increase in gene expression over a standard CMV-based nuclear expression system. The advantages of this system with respect to previous systems will be discussed, as well as the mechanism of action, and the potential utility of this system. The system described here has a number of advantages over previously published systems. Previous work with an autogene based cytoplasmic expression system describes a dual promoter autogene, consisting of an autogene cassette driven by a CMV promoter (Brisson, He et al. 1999). In this system the initial supply of T7 RNAP was derived from nuclear transcripts via the CMV promoter, obviating the need to add exogenous RNAP protein or mRNA during transfection. Although this system showed increased expression when compared with a standard CMV-based nuclear expression system (approximately 2-3 fold increase), the authors found that the majority of the cytoplasmic transcripts were not being translated, likely due to the lack of 5' cap, required for efficient translation in eukaryotic cells. Other work described the creation of a T7 RNAP autogene containing an EMCV IRES sequence (Deng and Wolff 1994). This IRES element facilitated translation of the uncapped cytoplasmic transcripts. It was also noted that the inclusion of the IRES element attenuated the toxicity of the autogene plasmid in host E. coli cells, a major problem with earlier autogene plasmids (Dubendorff and Studier 1991). We observed some evidence of autogene toxicity in E. coli, but isolation of plasmid DNA was easily achieved from bacterial culture. The yield of autogene containing plasmids was approximately 0.5 mg of DNA per liter of bacterial culture. This is a marked decrease from the 5-10 mg/L yield normally obtained from 63 plasmids that share the same vector backbone, but do not contain the autogene sequence. Methods by which the toxicity of autogene plasmids may be further alleviated are currently being investigated. The bi-cistronic autogene system described here is distinguished from previous systems by two key properties. First, it contains both a CMV promoter, bypassing the need for addition of exogenous RNAP protein during transfection, as well as an autogene containing an EMCV IRES sequence, allowing for cap-independent translation of the autogene transcripts. In addition, our system has the autogene cassette and reporter gene cassette on the same plasmid, further simplifying the transfection process and resulting in increased transgene expression. When the expression levels from the cytoplasmic expression system and a standard nuclear expression system were compared, the cytoplasmic system yielded 20-fold higher expression than the nuclear system. This is in contrast with previous systems that demonstrated a maximum of three-fold increase over a nuclear expression system control (Brisson, He et al. 1999). The improvement in performance is most likely due to increased translation of cytoplasmic transcripts generated from the modified expression system described here. The inclusion of an EMCV IRES element in the autogene cassette appears to enhance translation, overcoming the lack of a 5' cap on cytoplasmic transcripts and resulting in increased transgene expression levels. The autogene system was also tested in Neuro-2a cells and a 20-fold increase in expression with the autogene as compared with the CMV-based system was observed. This indicates that the autogene system is not limited to BHK cells. However it should be noted that variable gene expression was seen when using other cell lines (see Chapter 4) and we are currently investigating this phenomenon. 64 The mechanism whereby the bi-cistronic autogene system results in increased gene expression is of obvious interest. It was important to verify that the T7 autogene, that has been the basis for all cytoplasmic expression systems to date, truly does exhibit an autocatalytic expression profile. For the results described in Figure 2-1, assuming that the amounts of substrates and PT7-Luc are not limiting, it is straightforward to show that if an autocatalytic process is occurring, then NL(t)=cet/r, where N|_(t) indicates the number of luciferase molecules at time t and c and T are constants. The close fit (R2=0.94) of an exponential profile to the luciferase expression observed in Figure 2-1 thus supports an autocatalytic mechanism. Any deviation from exponential characteristics at longer times can be attributed to either saturation effects as the amount of PT7-Luc becomes limiting, or the system running out of substrate (e.g charged tRNA, GTP, etc). The primer extension and RPA data in Figure 2-7 and Figure 2-8 provide further evidence of a cytoplasmic autocatalytic process. As demonstrated in the results presented in Figure 2-8, there is at least a 20-fold increase in transgene mRNA levels with the cytoplasmic expression system as compared to the standard nuclear expression system. These transcripts had a much shorter half-life than their nuclear counterparts, which is consistent with the lack of a 5' cap, an important determinant of mRNA stability. When combined with the primer extension data showing that the majority of the transcripts are being made by the T7 RNAP, this data suggests that the increase in gene expression is due to an increase in mRNA levels in the cytoplasm of transfected cells, consistent with the autocatalytic process. There are many possible explanations for why the bi-cistronic construct is more effective than a dual plasmid transfection. One possible reason is that the T7 RNAP is able to transcribe RNA from either the first P T 7, driving T7 RNAP expression, or the 65 second PJJ, driving luciferase expression in the bi-cistronic construct. Due to the lack of a terminator sequence between these two genes, both transcripts will encode for the luciferase gene. Therefore, the cells transfected with the bi-cistronic plasmid should have more mRNA encoding luciferase than the cells in the dual transfection. Upon examination of the RPA data (Figure 2-9), it is clear that there are at least twice as many luciferase transcripts than RNAP transcripts following bi-cistronic transfection, lending support to this hypothesis. In addition, it was found that the luciferase transcripts had a slightly longer half-life than the 17 RNAP transcripts (115 min versus 88 min). This increased half-life may be attributed to the fact that the luciferase transcripts being made from the first Pi7 in effect had a much longer 5' UTR. This would most likely add some stability to the transcript, therefore increasing its half-life and subsequent luciferase expression. The potential applications of an autogene based cytoplasmic expression system are many. Aside from increasing the levels of gene expression in plasmid-based non-viral gene delivery systems, this system could also be used as a tool to express high levels of transgene in vitro for characterization or purification purposes. In summary, the studies described here demonstrate a novel, bi-cistronic autogene based cytoplasmic expression system that shows 20-fold higher levels of gene expression compared with a nuclear expression system. This system has been shown to exhibit an exponential autocatalytic gene expression profile, and result in an increase in reporter gene expression per transfected cell, as opposed to an increase in the number of cells transfected. Furthermore, the bi-cistronic system is more effective than a cytoplasmic expression system carried on two plasmids. This system has a wide range of applications, not the least of which is increasing the therapeutic utility of plasmid based gene delivery systems. 66 CHAPTER 3 FACTORS LIMITING AUTOGENE BASED CYTOPLASMIC EXPRESSION 3.1 Introduction In the previous chapter, a novel cytoplasmic expression system that resulted in a 20-fold increase in the levels of gene expression over a standard CMV-based nuclear expression system was described (Finn, Lee et al. 2004), comparing favorably with the 2-3 fold increase seen with previous similar systems (Brisson, He et al. 1999). The potential for this system to give even greater increases in expression prompted further examination of this system, specifically to determine the factors limiting the cytoplasmic expression system and ways in which the levels of gene expression can be increased. Specifically, the effects of changing the nuclear promoter, RNAP gene, and IRES sequence on autogene expression are examined. We find that mRNA production, as well as translation, are most likely the limiting factors for cytoplasmic autogene expression. 3.2 Materials and Methods 3.2.1 Plasmids and Primers Plasmid R011 is a bi-cistronic plasmid consisting of a basic autogene cassette (driven by the 17,13 and SP6 RNAP promoters) driven by a CMV promoter and intron, as well as a downstream Photinus pyralis luciferase reporter gene cassette (for construction details see Finn et al, 2003). L053 consists of the CMV promoter (with intron) from NGVL3 and the Photinus pyralis luciferase gene. R031 and L071 consist of R011 or L053, respectively, with the CMV promoter replaced with the SV40 promoter. 67 R032 and L072 consist of R011 or L053, respectively, with the CMV promoter replaced with the RSV promoter. R063 and R068 consists of R011 with the T7 RNAP gene replaced with the SP6 RNAP gene from pSR3, or the T3 RNAP gene from pTG100, both of which are a gift from Dr. W.T. McAllister (Department of Microbiology and Immunology, State University of New York Health Science Center at Brooklyn). R017 consists of the T7 RNAP gene driven by the CMV promoter (and intron) from NGVL3. L059 consists of a pTRI-Amp (Ambion) backbone with EMCV IRES, Photinus pyralis luciferase and beta-globin poly-adenylation site derived from EMC-Luc, a gift from Dr. Jon Wolff (Waisman Center, Wisconsin). L076 consists of L059 with the EMCV IRES replaced with the elF4G IRES from pCatEIF4GGal, a gift from Dr. Caroline Lee (Faculty of Medicine, National University of Singapore). L059+GTX consists of L059 with the EMCV IRES replaced with the 10 tandem GTX sequences from p(Gtx133-141)10(SI)9BRPh, a gift from Dr. Vincent Mauro (Department of Neurobiology, Scripps Research Institute). PT7-Luc (Promega) consists of the Photinus pyralis luciferase gene driven by a T7 RNAP promoter. L080 consists of PT7-Luc with the Luciferase gene driven by both the T7 and the SP6 promoter. RPA-Luc consists of a 250 bp Xcm1 - BsrG 1 luciferase fragment blunted and ligated into the Sma1 site of pTRI-Amp in the reverse orientation. 3.2.2 mRNA Synthesis mRNA synthesis was performed using a MEGAscript high yield transcription kit (Ambion). For all transcripts used for in vitro transfection, plasmid template (L059 for IRES-Luc and Cap-IRES-Luc mRNA; L080 for Cap-Luc mRNA; PT7-Luc for Luc mRNA) was linearized using EcoR 1 and 1 pg of each plasmid was used as per manufacturers 68 protocols. mRNA was recovered by the LiCI procedure as outlined in manufacturer's protocol. For the synthesis of R011 mRNA (used for RPA standard curve), undigested R011 was used as template for mRNA synthesis as the undigested plasmid more closely resembles that present in the cytoplasm and would serve as a better control than digested plasmid. After LiCI precipitation, the RNA pellet was washed 3 x with 70% ethanol to completely remove any unincorporated NTPs. 3.2.3 Transfections Lipoplexes were formed by mixing plasmid DNA with large unilamellar vesicles (LUVs) composed of equimolar amounts of DOPE:DODAC (50:50) on ice and incubated for 20 min prior to use. All transfections were performed at a cationic lipid to plasmid DNA charge ratio of 3:1. Lipoplexes were diluted with heat inactivated serum-containing media before addition directly to cell media. BHK cells were plated at 30,000 cells per well in 24-well plates. The total mass of plasmid added was identical in all transfections. Equimolar transfections using plasmids of different sizes were achieved through the addition of an empty vector (pPUC19) to normalize the total mass of DNA in each transfection. For mRNA transfections, TransMessenger reagent (Qiagen) was used to transfect 0.6 ug of various mRNA transcripts into BHK cells (30,000 cells per well in 24-well plates). An RNA to TransMessenger reagent ratio of 1:4 was used for all transfections. Transfections were performed as per manufacturer's instructions. Three hours post transfection, the medium was removed and replaced with fresh serum containing medium. Cells were harvested and subjected to luciferase assays at time points indicated. All transfections were performed in triplicate. Data is presented as mean values +/- standard error. 69 3.2.4 Luciferase and BCA Assays Cells were washed twice with 1 mL PBS followed by the addition of 0.2 mL lysis buffer (PBS with 0.1 % Triton X-100) before being stored at -70 0 C. Cells were thawed and 5-20 ul of sample were assayed in duplicate on a 96-well plate. Samples were assayed using a Berthhold Centra LB960 Microplate Luminometer and Luciferase Assay System (Promega). Standard luciferase assays were performed and transfection data is reported as mass quantities of luciferase protein using a standard curve obtained from serial 10-fold dilutions of a 20 mg/mL Photinus pyralis luciferase standard (Promega). Total protein was quantified using a Pierce BCA assay kit as per manufacturer's instructions. 3.2.5 Immunofluorescence BHK cells were plated in 6-well plates (150,000 cells per well) and transfected with various amounts of plasmid DNA. At 24 h post-transfection, cells were washed once with 2 mL PBS-IF (10 mM sodium phosphate, 140 mM sodium chloride, pH 7.4) prior to fixation for 10 min with 2 mL 2% paraformaldehyde. Cells were subjected to three 30 s washes before being permeabilized with 0.25% Triton X-100 in PBS-IF for 5 min. After washing three times for 30 s with PBS-IF, cells were incubated with blocking buffer (10% BSA in PBS-IF) for 1 h, shaking gently at room temperature. Cells were washed three times for 10 min with PBS-IF followed by addition of primary antibody solution consisting of a 1:700 dilution of goat anti-T7 RNAP antibody, a gift from Dr. Paul Fisher (Department of Pharmacological Sciences, State University of New York at Stony Brook) in 2% BSA in PBS-IF. Cells were incubated with primary antibody solution for 2 h while shaking at room temperature. Cells were washed three times for 70 10 min in PBS-IF followed by the addition of secondary antibody (Rabbit anti-goat IgG, FITC labeled (QED Bioscience Inc), 1:200 dilution in 2% BSA-PBS-IF) and incubation for 2 h while shaking at room temperature. Cells were washed four times for 10 min with PBS-IF before being mounted and photographed on a Zeiss Axiovert S100 fluorescence microscope. Percentage of cells transfected was determined by counting transfected and non-transfected cells under the microscope. Data indicate the average of six separate counts from at least three different experiments. 3.2.6 RNase Protection Assay Luciferase probe was prepared from EcoR 1 digested RPA-Luc. GAPDH probe was purchased from Pharmingen. Probes were labeled following the manufacturers protocol using 3 2P-aUTP (3000 Ci/mmole, 10mCi/mL)(NEN). BHK cells were plated on 6-well plates (150,000 cells per well) and transfected with various amounts of R011. At various time points, cells were washed once with PBS and recovered by treatment with trypsin. Total RNA was harvested from cells using an RNeasy miniprep kit (Qiagen). Various amounts of sample RNA was subjected to RNase protection analysis using the RiboQuant RPA system (Pharmingen) according to the manufacturer's protocol. In all experiments, the total amount of RNA was brought up to 2 pg using untransfected BHK total RNA. Standard curves were prepared from in vitro synthesized mRNA from supercoiled R011 as described above,). These mRNA transcripts are similar to those that will be generated from the cytoplasmic system. Serial dilutions of the R011 mRNA were made and various amounts were added to 2 pg untransfected BHK total RNA and subjected to RPA analysis. All values are standardized to the GAPDH control, and are the average +/- standard deviation of at 71 least three independent experiments. Data were collected using a Typhoon Phosphorimager (Amersham Biosciences) and analysis was performed using ImageQuant software (Amersham Biosciences). Note that when quantitating the GAPDH control, the blots were overexposed to give a sufficient value for GAPDH mRNA levels. 3.2.7 Calculation of Amount of Transgene mRNA per Transfected Cell Using the standard curve from the quantitative RNase protection assay, the amount of luciferase mRNA present in each mRNA sample was calculated. Knowing the total amount of RNA loaded on the gel, the amount of luciferase mRNA per pg of total RNA was determined. Using immunofluorescence to determine the percentage of cells transfected, the amount of luciferase mRNA produced per transfected cell was able to be determined. For example: for 24 h time point on Figure3-5, 1.7 ng of luciferase mRNA was present in the sample (value derived from standard curve in Figure 3-5c). 0.5 pg of total RNA was used for that sample, so the total amount of luciferase mRNA per pg of total RNA is 1.7 ng/0.5 pg = 3.4 ng luciferase mRNA/pg total RNA. By examining the immunofluorescence data, it was found that - 3 % of the cells were transfected with the autogene. Therefore, 3.4 ng luciferase mRNA/pg total RNA X 100/3 (dilution factor) = 113 ng luciferase mRNA/pg total RNA/transfected cell. Therefore, 0.-113 pg luciferase mRNA/pg total RNA/transfected cell. 72 3.3 Results 3.3.1 Replacing the CMV Promoter with either the RSV or SV40 Nuclear Promoter has Little Effect on Autogene Expression The enhanced dual promoter autogene system described previously (Finn, Lee et al. 2004) relied on the CMV promoter for the first round of nuclear transcription, effectively "triggering" the cytoplasmic expression system. It was of interest to explore the effect of other commonly used promoters. To this end, autogenes and their nuclear controls containing either the RSV or the SV40 promoters were constructed. As can be seen in Figure 3-1 b, the different promoters had very little effect on the maximum levels of autogene activity. In contrast, the different promoters had a dramatic effect on the levels of nuclear gene expression. In the case of the SV40 promoter, the autogene system demonstrated over a 200-fold increase in expression over the nuclear system. It is important to note that even though the different promoters resulted in dramatically different amounts of nuclear expression (consistent with previously published data (Zarrin, Malkin et al. 1999), they had very little effect on the maximum levels of cytoplasmic expression. This is consistent with only a small, catalytic amount of nuclear expression being required to drive the cytoplasmic expression system, and that the cytoplasmic expression was reaching an apparent saturation level. 3.3.2 Autogene Expression is not Sensitive to the Type of Phage RNAP used. It was of interest to compare the T7 RNAP protein with the two other RNAP proteins commonly used for in vitro transcription purposes, the SP6 and T3 RNAPs (Krieg and Melton 1987; Leary, Baum et al. 1991; Meador, McElroy et al. 1995). To this 73 1600 1400 1 1 2 0 0 o ^ 1 0 0 0 03 H 800 - 600 CD CO | 4 0 0 1 2 0 0 CD 0 R011 L 0 5 3 R031 L071 R 0 3 2 L 0 7 2 ( C M V ) ( C M V ) ( S V 4 0 ) ( S V 4 0 ) ( R S V ) ( R S V ) Figure 3-1: Nuclear promoter comparison a) Diagrams of plasmids used, b) Effect of various nuclear promoters on cytoplasmic versus nuclear expression. BHK cells were transfected with .75 pg/well of plasmid. Equimolar amounts of plasmids were added, and the total mass of DNA per transfection was kept equal by adding an unrelated plasmid (pPUC19). Transfections and luciferase assays were performed as described in Materials and Methods. Error bars indicate standard error. 74 end, the T7 RNAP gene in R011 was replaced with either the SP6 or the T3 RNAP gene. The R011 vector plasmid already had all three of the RNAP promoters in tandem, so there was no need to "add" in the promoter fragments. As can be seen in Figure 3-2b, using either the T3 or the SP6 RNAP in place of the T7 RNAP did not give a substantial increase in gene expression. It is noted that the T3 RNAP did show almost a 2 fold increase in gene expression, however, this increase was not found to be significant (p>0.05). 3.2.3 Substitution of the EMCV IRES by Either the Gtx or elF4G IRES Elements Reduced Autogene Expression Higher expression levels have been observed employing IRES elements other than the EMCV used in the expression system employed here (Chappell, Edelman et al. 2000; Wong, Ngoi et al. 2002). Therefore, luciferase reporter plasmids were constructed containing either the EMCV, elF4G, Gtx, or no IRES element at all, and these plasmids were tested in an in vitro transfection system, co-transfecting with a nuclear plasmid encoding for the T7 RNAP. As can be seen in Figure 3-3b, only the EMCV IRES was efficient at driving cap-independent translation of cytoplasmic transcripts. The elF4G and Gtx IRES sequences appeared to have little if any effect on translation over the control that contains no IRES (which demonstrated background levels of gene expression). Similar results were seen using a cell free transcription and translation assay (data not shown). These results indicate that the EMCV IRES was the most effective IRES in the cytoplasmic expression system and that no advantage was to be gained by using either of the other two classes of IRES sequences. 75 R011 R 0 6 3 R 0 6 8 (17) (SP6 ) (T3) Figure 3-2: RNAP comparison a) Diagrams of plasmid constructs used, b) Comparison of 17, SP6 and T3 RNAP in autogene based cytoplasmic expressions system. BHK cells were transfected with 0.75 pg/well of plasmid. Equimolar amounts of plasmids were added, and the total mass of DNA per transfection was kept equal by adding an unrelated plasmids (pPUC19). Transfections and luciferase assays were performed as described in Materials and Methods. Error bars indicate standard error. Transfection with either of the bi-cistronic autogene constructs (R011, R063 or R068) resulted in similar expression levels after 48 h. The T3 RNAP based autogene (R068) resulted in slightly (less than 2 fold) higher expression than the T7 RNAP based autogene (R011). 76 a R017+ R017+ R017+ R017 + L059 L076 L059+Gtx PT7-Luc (EMCV) (elF4G) (Gtx) (no IRES) Figure 3-3: IRES comparison a) Diagrams of plasmid constructs used, b) Effect of IRES on cytoplasmic expression. BHK cells were transfected with a total of 0.75 pg/well of plasmid DNA. Half of the amount of DNA was R017 (CMV-T7-RNAP), and the other half was the 17 RNAP based luciferase expression cassette. Equimolar amounts of experimental plasmid were added, and the total mass of DNA per transfection was normalized by adding an unrelated plasmid (pPUC19). Error bars indicate standard error. 77 3.2.4 Nuclear mRNA Transcripts are Translated 20 Times More Efficiently Than Cytoplasmic Autogene Transcripts In an effort to understand what other factors may be limiting the expression levels, the translation efficiency of the cytoplasmic transcripts (IRES-Luciferase) was compared with the nuclear transcripts (5' cap-Luciferase). mRNA was synthesized in vitro and the translation efficiency of these transcripts was determined via in vitro mRNA transfection. As can be seen in Figure 3-4, while the inclusion of the EMCV IRES does result in an increase in expression over no IRES at all, the cytoplasmic transcripts are translated -20 times less efficiently than the capped nuclear transcripts. It is also interesting to note that the inclusion of the EMCV IRES into a capped transcript inhibited the expression ~5 fold. This is consistent with previously published data (Attal, Theron et al. 1999). While it has long been known that IRES elements are not as efficient at recruiting ribosomes as the 5' cap of mRNA transcripts, it is clear that the low translation of the cytoplasmic transcripts (as compared with a capped mRNA) is playing a major role in lower levels of gene expression than were expected. However, the low translation of the cytoplasmic transcripts may not be the primary factor limiting autogene expression. The observation that a 20 fold increase in luciferase protein expression is obtained with the cytoplasmic expression system, while the mRNA transcripts are being translated 20 times less efficiently than the capped nuclear transcripts, suggested the possibility that one of the factors responsible for reaching limiting levels of gene expression was at the level of mRNA production. 78 60 I R E S - L u c 5 'cap- IRES-Luc 5'cap-Luc Luc (cytoplasmic) (nuclear) (no 5'cap) Figure 3-4: Comparison of translation efficiency of nuclear versus cytoplasmic mRNA transcripts. BHK cells were transfected with a total of 1 pg/well of in vitro synthesized mRNA using Transmessenger reagent as described in Materials and Methods. All transcripts were of a similar size. Error bars indicate standard error. Capped transcripts (nuclear) were translated 20 times more efficiently than uncapped transcripts containing the EMCV IRES (cytoplasmic). The insertion of the IRES into a capped transcript decreased the translation 5 fold. The lack of any IRES sequence or cap resulted in background levels of expression. 79 3.2.5 mRNA Production is a Limiting Factor in Autogene Expression Given that the cytoplasmic transcripts are translated much less efficiently than the nuclear transcripts, it was clear that the RNA output of the cytoplasmic system must be much higher than that of the nuclear system in order to achieve the marked increase in luciferase expression. Therefore, a quantitative RNase Protection Assay (RPA) was performed to determine the amount of luciferase mRNA being produced. As can be see in Figure 3-5c, the amount of luciferase mRNA in the autogene transfection peaks at around 24 h post transfection. Using the standard curve and determining the percentage of cells transfected using immunofluorescence, it was determined that at 30 h, -12 (+/- 0.4)% of the total RNA in each transfected cell was luciferase mRNA. Noting that in BHK cells only -3% of the total RNA is mRNA (data not shown), this indicates that - 3.5 times more luciferase transcript was being produced than the sum of all other mRNA transcripts in the cell. Since this represents a significant allocation of cellular resources (such as NTPs (including ATP, the major energy source of the cell)), it appeared likely that mRNA production was a major factor limiting autogene expression. To test this hypothesis, a dose response study was performed and RPA and immunofluorescence were used to determine the amount of luciferase transcript per transfected cell. If mRNA production was a limiting factor, we would expect to see a point at which the addition of additional plasmid has no effect on mRNA production. Cells were harvested at 24 h post transfection to reduce any cytotoxic effects that may be seen due to the large amount of foreign mRNA production. As can be seen in Figure 3-6, the amount of luciferase transcript produced reaches a saturation point at approximately 30 (+/- 5) % of the total RNA. This observation is supported by the presence of large molecular weight mRNA species when total RNA from transfected 80 8 h 24 h 33 h 48 h 72 h b 0 1.0 2.0 3.0 4 .0 5.0 ng r011 mRNA 81 c 0.14 TO Q H 1 i i 1 I I I 0 10 20 30 40 50 60 70 80 Time (h) Figure 3-5: Amount of transgene mRNA per transfected cell a) Immunofluorescence of BHK cells transfected with R011. BHK cells were transfected with 0.75 pg of R011. Cells were fixed at time points indicated and subjected to immunofluorescence using anti-T7 RNAP antibodies and a FITC conjugated secondary antibody. The percentage of cells transfected was used to calculate the amount of transgene mRNA expressed per transfected cell. b) RNase Protection Assay (RPA) of BHK cells transfected with R011. BHK cells were transfected with 0.75 pg of R011 and total RNA was harvested at time points indicated as described in Materials and Methods. Various amounts of total RNA (ranging from 0.5 to 2 pg) was subjected to RPA analysis using a 3 2 P labeled probe against luciferase mRNA as well as GAPDH control mRNA. An R011 standard curve was prepared by spiking 2 pg of untransfected BHK total RNA with various amounts (0.25 to 20 ng) of in vitro synthesized R011 mRNA. The inset is a graph of the standard curve of R011 mRNA. Intensity values were obtained using ImageQuant and luciferase mRNA values were standardized against GAPDH values (to control for lane loading differences). Blots were overexposed to get sufficient values for GAPDH controls. Standardized intensities were plotted against amount of R011 mRNA and this standard curve was used to determine the amount of luciferase mRNA in experimental samples. c) Amount of luciferase mRNA produced per transfected cell over time. BHK cells were transfected with 0.75 pg of R011 as seen in Figure 5. The amount of luciferase mRNA per transfected cell was determined as described in Materials and Methods. The amount of luciferase mRNA peaks at around 30 h at -12% of the total RNA, and then rapidly decreases after 72 h. 82 0.4 (0 5 0.15 • CO < 0.1 • z 1 0.05 • 3 — I g> 0 -I 1 1 1 1 1 1 1 1 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 ug DNA transfected / well Figure 3-6: R011 dose response study in BHK cells. Values for mRNA levels and percentage of cells transfected were obtained as described in Materials and Methods and shown in Figure 5. The amount of luciferase mRNA produced per transfected cell increases with increasing amount of plasmid transfected up to a point, at which it then appears to reach a saturation level (-30 % of total RNA levels) at which point the addition of more plasmid has no subsequent increase on luciferase mRNA levels. 83 BHK cells was run on a denaturing agarose gel and subjected to ethidium bromide staining (data not shown). These large mRNA species were not present in RNA from non-transfected cells. This is consistent with the cells only being able to produce a finite amount of luciferase mRNA, and adding more plasmid cannot increase this level. This indicates that the amount of transgene mRNA production, in addition to its poor translation, is the major factor limiting autogene based cytoplasmic expression. 3.4 Discussion Previous work described a dual promoter autogene based cytoplasmic expression system that demonstrated a 20-fold increase in gene expression over a standard CMV-based nuclear control. In the present work, attempts were made to increase the levels of cytoplasmic gene expression further, revealing some of the factors limiting gene expression in this system. Here we discuss the changes made to the autogene system, the finding that mRNA production is a limiting factor in autogene expression, and the implications of this result for future studies. In an effort to further increase gene expression levels, the effect of changing either the nuclear promoter (CMV vs. RSV vs. SV40), the RNAP gene (T7 vs. SP6 vs. T3), or the IRES (EMCV vs. elF4G vs. Gtx) element was examined. It was found that altering any of these three parameters did not significantly increase autogene expression. For example, replacing the T7 RNA polymerase with either the SP6 or the T3 RNAP (both commonly used in in vitro transcription systems) resulted in very minimal (maximum 2-fold) increase in autogene expression. In fact, the SP6 RNAP appeared to be slightly less effective at driving autogene expression than either the T7 or the T3 84 RNAP. It should be noted that the T7 and T3 RNAP share almost 80% amino acid identity, while the SP6 RNAP shares about 25% identity with both the T7 and the T3 RNAP. It is known that the SP6 RNAP does not effectively transcribe linear DNA (Promega). It may be that cytosolic nucleases convert the supercoiled plasmid into a linear form (Pollard, Toumaniantz et al. 2001), therefore accounting for the decreased efficiency of the SP6 RNAP when compared with the 17 or T3 RNAP. Regardless of the mechanisms behind the differences, using either the SP6 or the T3 RNAP did not give any appreciable increase in autogene expression. While other laboratories have reported increased expression when using other classes of IRES elements (60 fold increase with Gtx IRES (Chappell, Edelman et al. 2000), 100 fold increase with elF4G IRES (Wong, Ngoi et al. 2002)) in a bi-cistronic context, no such enhancement was observed here. The most likely explanation for this is that the elF4G and Gtx IRES sequences have thus far only been used to drive expression of the second gene in a bi-cistronic transcript. These transcripts are made in the nucleus and therefore contain a 5' cap structure. It is most likely that these small sequences do not recruit ribosomes de novo, but facilitate the re-initialization of translation of the ribosome after the first gene has been translated. The type of bi-cistronic system that these small IRES elements were studied in previously is not the same as the system tested in this study. Here the ability of the IRES elements ability to directly recruit ribosomes to the 5' end of an uncapped mRNA transcript is assessed. These studies show that the elF4G and GTX IRES elements are not able to recruit ribosomes to an uncapped mRNA transcript. The larger viral EMCV IRES has a complex secondary structure (Jang, Krausslich et al. 1988; Jang and Wimmer 1990; Evstafieva, Ugarova et al. 1991; Le and Maizel 1997) that may be able to recruit 85 ribosomes de novo, thus accounting for its ability to increase the translation of uncapped cytoplasmic transcripts. This hypothesis is consistent with certain controversial aspects of IRES sequences and how they function. There is convincing evidence that IRES elements act as true internal ribosome entry sites (indicated by the ability for the EMCV IRES to allow translation of circular transcripts (Chen and Sarnow 1998)), as well as evidence suggesting that the IRES element only act as rescue translation stimulators (Attal, Theron et al. 1999), allowing the ribosome to re-initiate translation when inserted after the stop codon of the first cistron in a bi-cistronic construct. The evidence presented here suggests that while the Gtx and elF4G IRES elements may be effective in driving second gene expression in a bi-cistronic construct, they are ineffective for recruiting ribosomes de novo in the absence of a 5' cap structure. The studies performed to determine factors that may be limiting the autogene expression indicate that the major factors limiting the autogene expression were both at the level of mRNA production and translation. It is clear that the cytoplasmic expression system is producing a large amount of mRNA (corresponding to transgene mRNA levels that are 10 times the sum of every other transcript in the cell). This significant allocation of cellular resources (such as NTPs) would be expected to eventually have a detrimental effect on cell growth. This is consistent with the results summarized in Figure 3-6, where it is demonstrated that the autogene expression rapidly decreases after 24 h. This could arise because of the short half-life of the cytoplasmic transcripts, the high levels of foreign mRNA production having a cytotoxic effect, or because of the loss of cytoplasmic plasmid (due to cytosolic nuclease activity). 86 While it cannot be stated conclusively that transgene mRNA saturation is responsible for limiting the autogene expression, it cannot be ruled out as a potential factor. Alternately, the cytoplasmic translation machinery may be saturated, meaning that the translation of the mRNA is the limiting factor. There most likely exists an equilibrium between mRNA levels and the translation of the cytoplasmic transcripts, and increasing either the levels of mRNA, or increasing the translation of the cytoplasmic transcripts would lead to a further increase in expression. The cytoplasmic expression system described here has many potential applications. An example is suicide cancer gene therapy where a large amount of a suicide gene (e.g. Thymidine Kinase) is required to be expressed, leading to the death of that cell, and a corresponding large bystander effect. For researchers using siRNA or ribozyme expression, this system could be used for producing high levels of RNA in transfected cells. In addition, future work aimed at increasing the translation efficiency of the cytoplasmic transcripts could lead to a dramatic increase in gene expression, which would improve the utility of non-viral gene therapy based systems. In conclusion, the results presented here demonstrate that modifications to the dual promoter autogene based cytoplasmic expression system, including changes in the nuclear promoter, RNAP gene, or IRES element, had a minimal effect on autogene expression. The factors responsible for limiting autogene expression are most likely at both the level of transgene mRNA saturation, and the poor translation of the cytoplasmic transcripts. This work demonstrates the ability of autocatalytic expression systems to produce extremely large amounts of transgene mRNA, and that advances in improving the translation efficiency of un-capped, cytoplasmic transcripts could lead to a significant increase in the utility of such systems. 87 CHAPTER 4 INVESTIGATION OF FACTORS RESPONSIBLE FOR CELL LINE CYTOPLASMIC EXPRESSION DIFFERENCES 4.1 Introduction Previous chapters have described a novel cytoplasmic expression system that results in a 20-fold increase in the levels of gene expression over a standard CMV-based nuclear expression system (Finn, Lee et al. 2004), as compared with a 2-3 fold increase seen with previous similar systems (Brisson, He et al. 1999). While this increase was seen with BHK and Neuro-2a cells, further studies revealed that some cell lines, such as COS-7, demonstrated relatively poor levels of cytoplasmic expression. The objective of this chapter was to determine what factors were responsible for the different expression levels between BHK (a high expressing cell line) and COS-7 (a low expressing cell line). After investigating numerous factors, including the Internal Ribosome Entry Sequence (IRES) element, T7 RNAP activity, cytosolic nuclease levels and intra-cellular processing, it was found that differences in the intra-cellular processing of the DNA-cationic lipid complex was the most probable factor responsible for the difference in gene expression. 4.2 Materials and Methods 4.2.1 Plasmids: Plasmid R011 is a bi-cistronic plasmid consisting of a basic autogene cassette (containing the T7, T3 and SP6 RNAP promoters) driven by a CMV promoter and intron, as well as a downstream Photinus pyralis luciferase reporter gene cassette (for construction details see Chapter 2). L053 consists of the CMV promoter (with intron) 88 from NGVL3 and the Photinus pyralis luciferase gene. L059 consists of a pTRI-Amp (Ambion) backbone with EMCV IRES, Photinus pyralis luciferase and beta-globin poly-adenylation site derived from EMC-Luc, a gift from Dr. Jon Wolff (Waisman Center, Wisconsin). PT7-Luc (Promega) consists of the Photinus pyralis luciferase gene driven by a T7 RNAP promoter. L080 consists of PT7-Luc with the Luciferase gene driven by both the 17 and the SP6 promoter. 4.2.2 mRNA Synthesis: mRNA synthesis was performed using a MEGAscript high yield transcription kit (Ambion). For all transcripts used for in vitro transfection, plasmid template (L059 for IRES-Luc and Cap-IRES-Luc mRNA; L080 for Cap-Luc mRNA; PT7-Luc for Luc mRNA) was linearized using EcoR 1 and 1 pg of each plasmid was used as per manufacturers protocols. mRNA was recovered by the LiCI procedure as outlined in the manufacturer's protocol. After LiCI precipitation, the RNA pellet was washed 3 x with 70% ethanol to completely remove any unincorporated NTPs. 4.2.3 Transfections: Lipoplexes were formed by mixing plasmid DNA with large unilamellar vesicles (LUVs) composed of equimolar amounts of DOPE:DODAC (50:50) on ice and incubated for 20 min prior to use. All transfections were performed at a cationic lipid to plasmid DNA charge ratio of 3:1. Lipoplexes were diluted with serum-containing media before addition directly to cell medium. BHK or COS-7 cells were plated at 30,000 cells per well in 24-well plates. The total mass of plasmid added was identical in all transfections. Equimolar transfections using experimental plasmids of different sizes 89 were achieved through the addition of an empty vector (pPUC19) to normalize the total mass of DNA in each transfection. For mRNA transfections, TransMessenger reagent (Qiagen) was used to transfect differing amounts of various mRNA transcripts into BHK cells (30,000 cells per well in 24-well plates). An RNA to TransMessenger reagent ratio of 1:4 was used for all transfections. Transfections were performed as per manufacturer's instructions. Three hours post transfection the medium was removed and replaced with fresh serum containing medium. Cells were harvested and subjected to luciferase assays at time points indicated. For mRNA pretreatment studies, cells were transfected with mRNA as described above, followed by a DNA transfection 24 h later. All transfections were performed in triplicate. Data is presented as mean values +/- standard error. 4.2.4 Luciferase and BCA Assays: Cells were washed twice with 1 mL PBS followed by the addition of 0.2 mL lysis buffer (PBS with 0.1 % Triton X-100) before being stored at - 7 0 0 C. Cells were thawed and 5-20 pi of sample were assayed in duplicate on a 96-well plate. Samples were assayed using a Berthhold Centra LB960 Microplate Luminometer and Luciferase Assay System (Promega). Standard luciferase assays were performed and transfection data is reported as mass quantities of luciferase protein using a standard curve obtained from serial 10-fold dilutions of a 20 mg/mL Photinus pyralis luciferase standard (Promega). Total protein was quantified using a Pierce BCA assay kit as per manufacturer's instructions. 90 4.2.5 Cytoplasmic Extract Preparation: Cytoplasmic extracts were prepared using a hypotonic buffer solution. Cells (2 million) were washed with PBS (2 x 1mL) before a 15 min incubation on ice in 500 pi hypotonic extraction buffer (10 mM Hepes-KOH pH 7.9, 1.5 mM MgCI2, 10 mM KCI, 0.5 mM DTT, 0.2 mM PMSF, 0.6% NP-40). The samples were centrifuged at 13,000 x g for 3 min at 4 °C and the supernatant was collected and saved as the cytoplasmic fraction. Protein levels were quantitated using a Pierce BCA assay (as described above) after exchanging the hypotonic extraction buffer with PBS using a centrifugal filter device with a MW cut off of 3000. 4.2.7 Nuclease Assay Procedure: Various amounts of cytoplasmic extract were incubated with plasmid DNA (50-300 ng extract/pg plasmid DNA) at 37°C. At time points indicated, aliquots were removed and flash frozen in liquid nitrogen and stored at -70°C until all assays were completed. Samples were then thawed and run on a 0.8% agarose gel and bands were visualized using ethidium bromide. Nuclease activity defined by the proportion of intact supercoiled plasmid left over time. 4.2.8 Plasmid Labeling: R011 (cytoplasmic expression plasmid) was labeled using a Label IT Tracker Fluorescein Kit from Mirus Corporation following manufacturers instructions. A ratio of 1 pi Label IT Tracker Reagent per pg of plasmid DNA was used. Transfections were performed as previously described. 91 4.2.9 Fluorescence Microscopy: At time points indicated, cells were washed 3 x with room temperature PBS before fixing for 5 min with 2% paraformaldeyde. Cells were further washed with 2 x 1mL PBS before being treated with Prolong Antifade (Molecular Probes) and mounted. Pictures were taken using a Zeiss Axiovert S100 fluorescence microscope. In all cases, exposure times were kept constant to allow for ease of comparison of samples. 4.3 Results 4.3.1 Autogene Transfection in COS-7 Cells Results in Lower Transgene Expression than in BHK Ceils In previous chapters, it was found that the enhanced dual promoter autogene system demonstrated transgene expression levels that were 15-20 times higher than the equivalent nuclear control. This was demonstrated for both BHK and Neuro-2a cells. However, when the system was tested in the COS-7 cell line, the autogene system resulted in levels of gene expression that were lower than the nuclear control (Figure 4-1). It had been thought that the autogene system should produce high levels of gene expression in any transfected cell. Possible factors that would affect autogene expression levels including IRES function, T7 RNAP activity, cytosolic nuclease levels, and intra-cellular processing differences were therefore examined. 4.3.2 EMCV IRES is Functional in COS-7 Cells The first parameter that was tested was whether or not the EMCV IRES was functional in COS-7 cells. In order to determine this, mRNA was synthesized in vitro and transfected directly into either BHK or COS-7 cells. As is observed in Figure 4-2, 92 CMV CMV KanR ColE1 Ori KanR Intron Intron ColE1 Ori Luciferase Luciferase PT7 EMC IRES T7 R N A P PT7 EMC IRES 1 4 0 0 I 1 2 0 0 o t 1 0 0 0 3 o CD 8 0 0 6 0 0 CD CO 2 4 0 0 «-^ -" o 13 - J .CD 2 4 h • 4 8 h • 7 0 h R 0 1 1 (cytoplasmic) ( C O S - 7 ) L 0 5 3 (nuclear) ( C O S - 7 ) Figure 4-1: Autogene expression in COS-7 cells A) Diagrams of plasmids used. B) Comparison of cytoplasmic (R011) and nuclear (L053) expression plasmids in COS-7 cells. COS-7 cells were transfected with 0.75 pg/well of plasmid. Equimolar amounts of plasmids were added, and the total mass of DNA per transfection was kept equal by adding an unrelated plasmid (pPUC19). Transfections and luciferase assays were performed as described in Materials and Methods. Error bars indicate standard error. 93 the pattern of gene expression is similar for both cell lines. This indicates that while the IRES containing transcripts are not translated as efficiently as capped transcripts (previously described in Chapter 3), the EMCV IRES has the same relative expression pattern in both of the cell types, indicating that differences in IRES function are not the reason for the poor expression levels in COS-7 cells. It is interesting to note that the while the pattern of gene expression is similar, the absolute levels of gene expression are much lower in the COS-7 cells than the BHK cells. While it is known that cell division is an important factor for plasmid transfection, the BHK and COS-7 cells were found to have similar doubling times (data not shown), ruling this out as a factor responsible for the low expression levels in the COS-7 cells. Another reason could be because COS-7 cells are transfected (nucleic acid taken up and delivered into the cytoplasm or nucleus and subsequently expressed) less efficiently than BHK cells, or the intracellular processing of the nucleic acid-lipid complexes are different in the two cell lines, with the BHK cells having a greater amount of intact nucleic acid being released into the cytoplasm than the COS-7 cells. This possible difference in nucleic acid:cationic lipid complex processing could be responsible for the low levels of cytoplasmic autogene expression. 4.3.3 T7 RNAP is Functional in COS-7 Cells The next parameter that was examined was whether the T7 RNA polymerase (that is the basis of the cytoplasmic expression system) is active in COS-7 cells. Therefore, in vitro synthesized T7 RNAP mRNA was transfected directly into BHK or COS-7 cells. Twenty-four hours later cells were transfected with a luciferase reporter plasmid that would only express luciferase if functional T7 RNAP was being produced in those cells. As can be seen in Figure 4-3, while the levels of luciferase expression were 94 g CD •+-« o CL " T O -I—< o I— CO CD CO 03 I o 3 .CD 45000 40000 35000 30000 25000 20000 15000 10000 5000 0 IRES-Luc Cap-IRES- Cap-Luc ^ Luc BHK Luc IRES-Luc Cap-IRES- Cap-Luc Luc COS-7 Figure 4-2: Transfection of BHK or COS-7 cells with various mRNA species. Cells were transfected with 0.75 pg/well of mRNA. Transfections and luciferase assays were performed as described in Materials and Methods. Error bars indicate standard error. 95 lower in the COS-7 cells, these lower levels are consistent with the overall lower expression levels also seen in Figure 4-2. Note that in the absence of T7 RNAP pretreatment, no luciferase was detected. This data demonstrates that the T7 RNAP was indeed functional in the COS-7 cells. Therefore, these results indicate that the activity of the T7 RNAP gene was not the reason for the poor expression levels. 4.3.4 Effect of T7 RNAP mRNA Pretreatment on Autogene Expression Since it appeared as if all of the individual components of the autogene expression system were functioning in the COS-7 cells, it was suggested that perhaps the poor expression levels were due to temporal constraints. The cytoplasmic expression system is dependent on the initial source of T7 RNAP coming from the nucleus via the CMV promoter, which is then able to 'trigger' the cytoplasmic system. Perhaps by the time the first T7 RNAP proteins were produced via the nuclear transcripts (at least 8-12 hours post transfection), cytosolic nucleases had degraded the cytoplasmic plasmid, therefore leaving no substrate for the T7 RNAP. In order to test this hypothesis, BHK or COS-7 cells were transfected with T7 RNAP mRNA. Twenty-four hours post mRNA transfection cells were transfected with a plasmid encoding either the cytoplasmic expression system (R011) or the nuclear control (L053). As is apparent in Figure 4-4, the pretreatment of the COS-7 cells led to a 10 fold increase in autogene based expression that was not seen with the nuclear control. It was also observed that only about a 2-3 fold increase in expression was seen with the BHK cells (data not shown). This result appeared to support the hypothesis that timing was a major factor. If the cells were already primed with T7 RNAP protein prior to autogene expression, a substantial increase in gene expression was seen. These results suggest that certain factors affecting the amount of free cytoplasmic plasmid (such as 96 3 5 0 0 0 0 c 2300000 CL 12250000 o l-^200000 co 150000 | l00000 _ l o> 50000 0 C a p - R N A P + C a p - R N A P + L 0 5 9 ( B H K ) L 0 5 9 ( C O S - 7 ) Figure 4-3: T7 RNAP is functional in COS-7 cells. Transfection of BHK or COS-7 cells with 0.75 pg of capped T7-RNAP mRNA for 24 hours, followed by a transfection with 0.75 pg of a luciferase reporter construct (L059) mRNA species. Cells were harvested 20 h post plasmid transfection. Transfections and luciferase assays were performed as described in Materials and Methods. Error bars indicate standard error. Note that in the absence of T7 RNAP (no pre-transfection) no luciferase was detected. 97 1 6 0 § 1 4 0 o 0 ug 0.25 ug 0.5 ug 1.0 ug 0 ug 0.25 ug 0.5 ug 1.0 ug mRNA mRNA mRNA mRNA mRNA mRNA mRNA mRNA Figure 4-4: Pretreatment of COS-7 cells with T7 RNAP mRNA. Transfection of COS-7 cells with 0.75 ug of capped T7-RNAP mRNA for 24 hours, followed by a transfection with 0.75 pg of R011 (cytoplasmic) or L053 (nuclear) expression plasmids. Cells were harvested 24 h post plasmid transfection. Transfections and luciferase assays were performed as described in Materials and Methods. Error bars indicate standard error 98 cytoplasmic nuclease levels or the intracellular processing of complexes) are playing an important role in autogene expression differences between the BHK and COS-7 cells. 4.3.5 BHK and COS-7 Cells have Similar Levels of Cytosolic Nucleases In order to understand the difference between the high expressing (BHK) and low expressing (COS-7) cell lines, it was hypothesized that perhaps the BHK cells had lower levels of cytosolic nuclease, therefore more plasmid survived in the cytoplasm during the 8-12 h lag period before 17 RNAP was produced from the nuclear mRNA. Therefore, cytoplasmic extracts of both cell lines were obtained and subjected to nuclease assays. As can be seen in Figure 4-5, it appears as if the BHK cells did not have lower levels of cytoplasmic nuclease activity than the COS-7 cells, and may even appear to have slightly higher nuclease activity. Therefore, it appears as if the levels of cytosolic nuclease are not a major determining factor with respect to autogene based cytoplasmic expression. 4.3.5 Intracellular Processing of DNA is Different in BHK and COS-7 Cells While it had been determined that the low levels of autogene expression in COS-7 cells was not due to increased levels of cytosolic nucleases, it could occur due to differences in the intracellular processing of DNA-lipid complexes between the two cell lines. In order to investigate this, plasmid DNA was labeled with a fluorescent label, transfected into both BHK or COS-7 cells, and then florescence microscopy was performed at various time points. As can be seen in Figure 4-6, while there appears to be a similar level of plasmid taken up into both cell lines at early time points (24 h), at later time points (48 h), the BHK cells seem to have accumulated a significant amount 99 Time (min) Figure 4-5: Cytosolic nuclease assays of BHK and COS-7 cytoplasmic extracts. 200 ng/pg plasmid DNA was incubated and aliquots were taken at time points indicated. No significant difference in nuclease activity between the BHK and COS-7 cytoplasmic extracts was observed. 100 P h a s e con t ras t F I T O P I a s m i d Figure 4-6: Intracellular processing of complexes. Transfection of B H K or C O S - 7 cells with FITC labeled R011. Cel ls were transfected with 0.75 pg of F ITC-R011. Cel ls were fixed at time points indicated and subjected to phase contrast and f luorescence microscopy. 101 of plasmid in punctate, perinuclear structures, while the COS-7 cells have lost a significant amount of their fluorescence. Thus, it appears as if the BHK cells contain a pool of plasmid DNA for a longer period than the COS-7 cells. This perinuclear pattern seen with the BHK cell is characteristic of DNA-lipid complexes, and previous work (Zabner, Fasbender et al. 1995) has demonstrated that these structures are not associated with lysosomes, and appear to be large structures, presumably formed when multiple endosomes have fused into larger vesicles. These studies clearly show that there is a difference in the intracellular processing of the DNA-lipid complexes between the BHK and COS-7 cells, and this is most likely the reason behind the lower levels of cytoplasmic gene expression seen with the COS-7 cells. 4.4 Discussion While previous work (Chapter 2) demonstrated a 15-20 fold increase in levels of gene expression using an autogene based, cytoplasmic expression system (Finn, Lee et al. 2004) in BHK and Neuro-2a cell lines, recent studies showed that the levels of cytoplasmic expression were significantly lower in some other cell lines, such as COS-7. In the present work, an attempt is made to determine what the reason for the difference was. Here various factors are discussed, including the activity of the various components of the autogene system in BHK and COS-7 cells, the finding that pretreating the COS-7 cells with T7 RNAP led to an increase in expression, and that the differences in expression between the two cell lines is most likely due to differences in intracellular processing of the DNA-lipid complexes. 102 Previous studies have shown that IRES function is dependent on trans-acting cellular factors (Belsham and Sonenberg 1996). The pyrimidine tract binding protein (PTB) binds to the EMCV IRES (Kolupaeva, Hellen et al. 1996), and functions by maintaining the IRES secondary structure, thereby facilitating translation through the IRES (Kaminski and Jackson 1998). The La antigen has also been demonstrated to bind to the IRES (Meerovitch, Svitkin et al. 1993; Belsham and Sonenberg 1996). There is also evidence for other proteins binding to various regions of IRES elements (Hoffman and Palmenberg 1996) that have been reported to have an effect on the IRES function. Therefore, it was thought that perhaps one of the differences between the BHK and COS-7 cells was the presence and/or abundance of various trans-acting cellular factors. However, transfection with various mRNA transcripts showed an identical pattern to that of the BHK cells, indicating that the EMCV IRES was functioning similarly in both of the cell lines, ruling out the IRES as the reason for the expression level differences. It was then suggested that perhaps the T7 RNAP protein was not active in the COS-7 cells. This would also lead to poor expression levels. Transfecting the cells with capped mRNA encoding T7 RNAP, and then following 24 h later with a plasmid that will only express luciferase in the presence of T7 RNAP demonstrated that this was not the case. Even though the levels of expression were much lower than in BHK cells, a substantial amount of protein was expressed. It appears as if the COS-7 cells in general may not be very amenable to mRNA transfection, as both the transfections with the luciferase encoding mRNA transcripts (Figure 4-2) as well as the T7 RNAP encoding transcripts (Figure 4-3) gave much lower expression levels in the COS-7 cells than the BHK cells. This may be indicative of some difference in intracellular 103 processing of the nucleic acid-lipid complex, allowing for less cytoplasmic delivery of mRNA. As it appeared that the individual components of the autogene system were functioning, it was thought that perhaps the difference was due to a matter of timing. It is known that it takes at least 8-12 h post transfection in order to detect any expression from the nucleus, with expression usually peaking at around 24-48 h post-transfection. Perhaps in this time the majority of cytoplasmic plasmid in the COS-7 cells was degraded by cytosolic nucleases. By priming the cells with T7 RNAP (via pre-transfection of cells with T7 RNAP mRNA) prior to autogene transfection, a 10 fold increase in autogene expression was observed, as opposed to about a 2 fold increase with the nuclear control (most likely due to non-specific effects associated with increased lipid or nucleic acid delivery). Thus it was clear that the lag time between transfection and T7 RNAP expression from the nucleus was playing a role in the poor expression levels in COS-7 cells. In order to further understand this phenomenon, it was proposed that the COS-7 cells had higher levels of a cytosolic nuclease, and this was degrading the cytoplasmic plasmid, decreasing the amount of intact plasmid left for cytoplasmic expression. However, nuclease assays on cytoplasmic extracts from BHK or COS-7 cells showed that in fact, the COS-7 cytoplasmic extracts had less nuclease activity than the BHK cells. Thus, increased levels of cytosolic nucleases in the COS-7 cells was not the reason for the decreased expression. The observation that the mRNA transfections gave much lower levels of expression in COS-7 cells than BHK cells hinted at the fact that perhaps there were 104 differences in the intracellular processing of the DNA-lipid complexes, with the COS-7 cells allowing for less free plasmid to be released into the cytoplasm. By labeling the plasmid with a fluorescent label (FITC) and looking at the internal distribution of plasmid in both BHK and COS-7 cells over time, it was determined that there was a qualitative difference in not only the localization of the labeled plasmid, but also in the amount of plasmid. It appears as if in the COS-7 cells, the plasmids are degraded more quickly, shown by the less intense overall fluorescence as well as the diffuse green staining throughout the cell, indicative of plasmid degradation. This could be due to either a greater number of complexes being transported to lysosomes in COS-7 cells, or that the complexes are being released from the endosomes faster, and therefore being degraded by cytosolic nucleases before the cytoplasmic expression system can be triggered. In contrast, the BHK cells contained larger pools of plasmid DNA in discrete, most likely non-lysosomal, perinuclear structures, even after 48 h. It is hypothesized that perhaps plasmid is being released into the cytoplasm over time, thereby allowing more free cytoplasmic plasmid to be available for cytoplasmic transcription at later time points. In conclusion, it has been demonstrated that cell line differences in cytoplasmic expression (when compared to nuclear expression) are most likely due to differences in the intra-cellular processing of the nucleic acid-cationic lipid complexes, as opposed to differences in how the individual components (IRES, RNAP, etc.) function. 105 CHAPTER 5 SUMMARY AND FUTURE DIRECTIONS In this work the design, construction, and characterization of a novel dual promoter, autogene based cytoplasmic expression system is described. In Chapter 2 the system is introduced and characterized. Chapter 3 is concerned with attempting to optimize expression levels, and determining what factors are limiting gene expression. In Chapter 4, the differences between a high expressing cell line (BHK) and a low expressing cell line (COS-7) are investigated. In Chapter 2, the ability of the autogene based expression system to give rise to exponential increases in gene expression is demonstrated, as well as the ability of the expression system to give rise to levels of gene expression in BHK cells that are 20 times higher per transfected cell than a standard CMV based nuclear expression plasmid. Further analysis determined that the mRNA transcripts made in the cytoplasm are not as stable as those made in the nucleus (most likely due to the lack of a 5' cap structure on the cytoplasmic transcripts), and that the cytoplasmic expression system gives rise to much higher mRNA levels than the nuclear system. In Chapter 3 an attempt is made to determine what factors are limiting the cytoplasmic expression system, in an effort to optimize the system to give rise to even higher levels of gene expression. After exploring various factors, such as the nuclear promoter, RNAP gene and IRES sequence, it was found that the critical factors responsible for limiting the cytoplasmic system is at the mRNA level, both the transcription and translation. It was found that the cytoplasmic transcripts are being translated 20 times less efficiently than their capped nuclear counterparts, and by measuring mRNA transcript levels, it was found that the autogene based cytoplasmic 106 expression system appears to be saturating the cells ability to produce new mRNA, and that transgene transcript levels are reaching 30% of the total RNA in the cell, a level that is 10 times than the sum of every other mRNA transcript in the cell. In addition to this finding, insights into possible IRES function are gained. In Chapter 4, the differences between a cell line that gives rise to high levels of cytoplasmic gene expression (BHK) are compared with a cell line that gives poor cytoplasmic expression (COS-7). After investigating the individual components of the cytoplasmic expression system, such as the IRES activity and RNAP function, it was found that the reason for the difference in the two cell lines is most likely at the level of the intracellular processing of the DNAxationic lipid complexes, as the COS-7 cells appear to have less intact plasmid per cell over time than the BHK cells. In summary, this work represents a substantial advance in the understanding of cytoplasmic expression systems, and demonstrates the potential of these systems to give rise to increased levels of gene expression. In addition, this study clarifies potential areas that need to be addressed in order to further optimize cytoplasmic expression systems. Future work in this field should focus on not only increasing the amount of gene expression per transfected cell, but also on how to increase the percentage of cells transfected with this system. With respect to increasing the translation of cytoplasmic transcripts, improvement can be expected either through the use of more potent IRES elements, or by co-transfecting with a capping enzyme, allowing for the production of capped, cytoplasmic transcripts. Either of these approaches should give rise to increased expression by increasing the translation of the transcripts. With respect to increasing the proportion of cells that are transfected, approaches that bypass the need 107 for nuclear delivery of the plasmid (in order to trigger the cytoplasmic system) should be explored. These could include the co-transfection of the autogene plasmid with mRNA encoding for the RNAP gene, allowing for production of RNAP in the cell from the mRNA, without the need for nuclear delivery. Alternatively, purified RNAP protein could be co-transfected along with the autogene plasmid, again bypassing the need for nuclear delivery, and resulting in a greater percentage of cells transfected. An extension of this would be to engineer a secretable RNAP protein that would be able to exit an expressing cell and enter into a neighboring cell, thereby serving as the initial source of RNAP in that cell, leading to an increase in the percentage of cells transfected, without the need for any co-transfection. 108 REFERENCES Acsadi, G., S. S. Jiao, A. Jani, D. Duke, P. Williams, W. Chong and J. A. Wolff (1991). "Direct gene transfer and expression into rat heart in vivo." New Biol 3(1): 71-81. Agol, V. I. (1991). "The 5-untranslated region of picornaviral genomes." Adv Virus Res 40: 103-80. Alemany, R., C. Balague and D. T. Curiel (2000). "Replicative adenoviruses for cancer therapy." Nat Biotechnol 18(7): 723-7. Allen, T. M., C. Hansen, F. Martin, C. Redemann and A. Yau-Young (1991). "Liposomes containing synthetic lipid derivatives of poly(ethylene glycol) show prolonged circulation half-lives in vivo." Biochim Biophvs Acta 1066(1): 29-36. Aposhian, H. V. (1970). "The use of DNA for gene therapy-the need, experimental approach, and implications." Perspect Biol Med 14(1): 98-108. Aronsohn, A. I. and J. A. Hughes (1998). "Nuclear localization signal peptides enhance cationic liposome-mediated gene therapy." J Drug Target 5(3): 163-9. Attal, J. , M. C. Theron and L. M. Houdebine (1999). "The optimal use of IRES (internal ribosome entry site) in expression vectors." Genet Anal 15(3-5): 161-5. Avery, O. T., C. M. MacLeod and M. McCarty (1944). "Studies on the chemical nature of the substance inducing transformation of pneumococcal types. Induction of transformation by a desoxyribonucleic acid fraction isolated from Pneumococcus type III." Journal of Experimental Medicine 79(1): 137-58. Bangham, A. D. and R. W. Home (1964). "Negative staining of phospholipids and their structural modification by surface-active agents as observed in the electron microscope." J Mol Bio 8: 660-668. Batterson, R. G. W. (1985). Herpesviruses and their replication. Virology. B. N. Fields. New York, Raven Press: 497-526. Batzri, S. and E. D. Korn (1973). "Single bilayer liposomes prepared without sonication." Biochim Biophvs Acta 298(4): 1015-9. 109 Belsham, G. J. and N. Sonenberg (1996). "RNA-protein interactions in regulation of picornavirus RNA translation." Microbiol Rev 60(3): 499-511. Bensimhon, M., J. Gabarro-Arpa, R. Ehrlich and C. Reiss (1983). "Physical characteristics in eucaryotic promoters." Nucleic Acids Res 11(13): 4521-40. Bernstein, P. and J. Ross (1989). "Poly(A), poly(A) binding protein and the regulation of mRNA stability." Trends Biochem Sci 14(9): 373-7. Blomer, U., L. Naldini, T. Kafri, D. Trono, I. M. Verma and F. H. Gage (1997). "Highly efficient and sustained gene transfer in adult neurons with a lentivirus vector." J Virol 71(9): 6641-9. Boshart, M., F. Weber, G. Jahn, K. Dorsch-Hasler, B. Fleckenstein and W. Schaffner (1985). "A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus." CeH 41(2): 521-30. Brand, A. H., L. Breeden, J. Abraham, R. Sternglanz and K. Nasmyth (1985). "Characterization of a "silencer" in yeast: a DNA sequence with properties opposite to those of a transcriptional enhancer." Cell 41(1): 41-8. Brisson, M., Y. He, S. Li, J. P. Yang and L. Huang (1999). "A novel T7 RNA polymerase autogene for efficient cytoplasmic expression of target genes." Gene Therapy 6(2): 263-270. Brisson, M., W. C. Tseng, C. Almonte, S. Watkins and L. Huang (1999). "Subcellular trafficking of the cytoplasmic expression system." Hum Gene Ther 10(16): 2601-13. Buescher, E. L. (1967). "Respiratory disease and the adenoviruses." Med Clin North Am 51(3): 769-79. Bukrinsky, M. I., S. Haggerty, M. P. Dempsey, N. Sharova, A. Adzhubel, L. Spitz, P. Lewis, D. Goldfarb, M. Emerman and M. Stevenson (1993). "A nuclear localization signal within HIV-1 matrix protein that governs infection of non-dividing cells." Nature 365(6447): 666-9. Butler, E. T. and M. J. Chamberlin (1982). "Bacteriophage SP6-specific RNA polymerase. I. Isolation and characterization of the enzyme." J Biol Chem 257(10): 5772-8. 110 Capecchi, M. R. (1980). "High efficiency transformation by direct microinjection of DNA into cultured mammalian cells." CeH 22(2 Pt 2): 479-88. Challita, P. M. and D. B. Kohn (1994). "Lack of expression from a retroviral vector after transduction of murine hematopoietic stem cells is associated with methylation in vivo." Proc Natl Acad Sci U S A 91 (7): 2567-71. Chamberlin, M., J. McGrath and L. Waskell (1970). "New RNA polymerase from Escherichia coli infected with bacteriophage T7." Nature 228(268): 227-31. Chappell, S. A., G. M. Edelman and V. P. Mauro (2000). "A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity." Proc Natl Acad Sci U S A 97(4): 1536-41. Chen, C. Y. and P. Sarnow (1998). "Internal ribosome entry sites tests with circular mRNAs." Methods Mol Biol 77: 355-63. Chen, X., Y. Li, K. Xiong and T. E. Wagner (1994). "A self-initiating eukaryotic transient gene expression system based on contransfection of bacteriophage T7 RNA polymerase and DNA vectors containing a 17 autogene." Nucleic Acids Res 22(11): 2114-20. Cheng, L., P. R. Ziegelhoffer and N. S. Yang (1993). "In vivo promoter activity and transgene expression in mammalian somatic tissues evaluated by using particle bombardment." Proc Natl Acad Sci U S A 90(10): 4455-9. Cohen, S. N., A. C. Chang, H. W. Boyerand R. B. Helling (1973). "Construction of biologically functional bacterial plasmids in vitro." Proc Natl Acad Sci U S A 70(11): 3240-4. Coonrod, A., F. Q. Li and M. Horwitz (1997). "On the mechanism of DNA transfection: efficient gene transfer without viruses." Gene Ther 4(12): 1313-21. Coutts, M. and G. Brawerman (1993). "A 5' exoribonuclease from cytoplasmic extracts of mouse sarcoma 180 ascites cells." Biochim Biophvs Acta 1173(1): 57-62. Crick, F. H., L. Barnett, S. Brenner and R. J. Watts-Tobin (1961). "General nature of the genetic code for proteins." Nauchni Tr Vissh Med Inst Sofiia 192: 1227-32. 111 Crystal, R. G. (1995). "Transfer of genes to humans: early lessons and obstacles to success." Science 270(5235): 404-10. Curiel, D. T., S. Agarwal, E. Wagner and M. Cotten (1991). "Adenovirus enhancement of transferrin-polylysine-mediated gene delivery." Proc Natl Acad Sci U S A 88(19): 8850-4. Danthinne, X. and M. J. Imperiale (2000). "Production of first generation adenovirus vectors: a review." Gene Ther 7(20): 1707-14. Davanloo, P., A. H. Rosenberg, J . J. Dunn and F. W. Studier (1984). "Cloning and expression of the gene for bacteriophage T7 RNA polymerase." Proc Natl Acad Sci U S A 81(7): 2035-9. de Chastellier, C. and L. Thilo (1997). "Phagosome maturation and fusion with lysosomes in relation to surface property and size of the phagocytic particle." Eur J Cell Biol 74(1): 49-62. Deamer, D. W. (1978). "Preparation and properties of ether-injection liposomes." Ann N Y Acad Sci 308: 250-8. Deng, H. and J. A. Wolff (1994). "Self-amplifying expression from the T7 promoter in 3T3 mouse fibroblasts." Gene 143(2): 245-9. Drummond, D. R., J. Armstrong and A. Colman (1985). "The effect of capping and polyadenylation on the stability, movement and translation of synthetic messenger RNAs in Xenopus oocytes." Nucleic Acids Res 13(20): 7375-94. Dubendorff, J. W. and F. W. Studier (1991). "Creation of a T7 autogene. Cloning and expression of the gene for bacteriophage T7 RNA polymerase under control of its cognate promoter." J Mol Biol 219(1): 61-8. Dubes, G. R. and E. A. Klingler, Jr. (1961). "Facilitation of infection of monkey cells with poliovirus "ribonucleic acid"." Science 133: 99-100. Dulbecco, R. (1967). "The induction of cancer by viruses." Sci Am 216(4): 28-37. Dulbecco, R., J. Sambrook, H. Westphal and P. R. Srinivasan (1966). "Mechanism of cell transformation by polyoma virus, the induction of cancer by viruses." Persoect Biol Med 9(2): 298-305. 112 Dulbecco, R., J. Sambrook, H. Westphal and P. R. Srinivasan (1969). "Cell transformation by viruses: The integrated state of viral DNA in SV40-transformed cells. Viral DNA in polyoma- and SV40-transformed cell lines. The induction of cancer by viruses." Science 166(908): 962-8. Dunn, J. J., F. A. Bautz and E. K. Bautz (1971). "Different template specificities of phage T3 and T7 RNA polymerases." Nat New Biol 230(11): 94-6. Dvorak, H. F., J. A. Nagy, J. T. Dvorak and A. M. Dvorak (1988). "Identification and characterization of the blood vessels of solid tumors that are leaky to circulating macromolecules." Amer Jour Pathol 133: 95-109. Eibl, H., and Wooley, P. (1979). "Electrostatic interactions at charged membranes. Hydrogen bonds in lipid membrane surfaces." Biophysical Chemistry 10: 261-271. Elroy-Stein, O. and B. Moss (1990). "Cytoplasmic expression system based on constitutive synthesis of bacteriophage T7 RNA polymerase in mammalian cells." Proc Natl Acad Sci U S A 87(17): 6743-7. Epstein, M. A. (1959). "Observations on the fine structure of type 5 adenovirus." J Biophvs Biochem Cvtol 6: 523-6. Evstafieva, A. G., T. Y. Ugarova, B. K. Chernov and I. N. Shatsky (1991). "A complex RNA sequence determines the internal initiation of encephalomyocarditis virus RNA translation." Nucleic Acids Res 19(3): 665-71. Fallaux, F. J. , A. Bout, I. van der Velde, D. J. van den Wollenberg, K. M. Hehir, J . Keegan, C. Auger, S. J. Cramer, H. van Ormondt, A. J. van der Eb, D. Valerio and R. C. Hoeben (1998). "New helper cells and matched early region 1-deleted adenovirus vectors prevent generation of replication-competent adenoviruses." Hum Gene Ther9(13): 1909-17. Fareed, G. C. and C. C. Richardson (1967). "Enzymatic breakage and joining of deoxyribonucleic acid. II. The structural gene for polynucleotide ligase in bacteriophage T4." Proc Natl Acad Sci U S A 58(2): 665-72. Farhood, H., N. Serbina and L. Huang (1995). "The role of dioleoylphosphatidylethanolamine in cationic liposome mediated gene transfer." Biochim Biophvs Acta 1235: 289-295. 113 Feigner, J. H., R. Kumar, C. N. Sridhar, C. J. Wheeler, Y. J. Tsai, R. Border, P. Ramsey, M. Martin and P. L. Feigner (1994). "Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations." J Biol Chem 269: 2550-2561. Feigner, P. L. (1997). "Nonviral strategies for gene therapy." Sci Am 276(6): 102-6. Feigner, P. L, T. R. Gadek, M. Holm, R. Roman, H. W. Chan, M. Wenz, J. P. Northrop, G. M. Ringold and M. Danielsen (1987). "Lipofection - a Highly Efficient, Lipid-Mediated DNA- Transfection Procedure." Proceedings of the National Academy of Sciences of the United States of America 84(21): 7413-7417. Feigner, P. L. and G. M. Ringold (1989). "Cationic Liposome-Mediated Transfection." Nature 337(6205): 387-388. Finn, J., A. C. Lee, I. MacLachlan and P. Cullis (2004). "An enhanced autogene-based dual-promoter cytoplasmic expression system yields increased gene expression." Gene Ther 11(3): 276-83. Foecking, M. K. and H. Hofstetter (1986). "Powerful and versatile enhancer-promoter unit for mammalian expression vectors." Gene 45(1): 101-5. Fraley, R., S. Subramani, P. Berg and D. Papahadjopoulos (1980). "Introduction of liposome-encapsulated SV-40 DNA into cells." J Biol Chem 255: 10431-10435. Freese, E., T. Friedmann and R. Roblin (1972). "Prospects of gene therapy Gene therapy for human genetic disease?" Science 175(25): 1024-5. Friedmann, T. and R. Roblin (1972). "Gene therapy for human genetic disease?" Science 175(25): 949-55. Friend, D. S., D. Papahadjopoulos and R. J. Debs (1996). "Endocytosis and intracellular processing accompanying transfection mediated by cationic liposomes." Biochim Biophvs Acta 1278: 41-50. Gabizon, A., D. Price, J. Huberty, R. Bresalier and D. Papahadjopoulos (1990). "Effect of liposome composition and other factors on the targeting of liposomes to experimental tumors: biodistribution and imaging studies." Cancer Res 50: 6371-6378. 114 Gabizon, A. A. (1992). "Selective tumor localization and improved therapeutic index of anthracyclines encapsulated in long-circulating liposomes." Cancer Res 52(4): 891-6. Gallay, P., T. Hope, D. Chin and D. Trono (1997). "HIV-1 infection of nondividing cells through the recognition of integrase by the importin/karyopherin pathway." Proc Natl Acad Sci U S A 94(18): 9825-30. Gallie, D. R. (1998). "A tale of two termini: a functional interaction between the termini of an mRNA is a prerequisite for efficient translation initiation." Gene 216(1): 1-11. Gan, W., M. LaCelle and R. E. Rhoads (1998). "Functional characterization of the internal ribosome entry site of elF4G mRNA." J Biol Chem 273(9): 5006-12. Gao, X. and L. Huang (1993). "Cytoplasmic Expression of a Reporter Gene By Co-Delivery of T7 Rna-Polymerase and T7 Promoter Sequence With Cationic Liposomes." Nucleic Acids Research 21(12): 2867-2872. Gartler, S. M. (1959). "Cellular uptake of deoxyribonucleic acid by human tissue culture cells." Nature 184(Suppl 19): 1505-6. Gershon, H., R. Ghirlando, S. B. Guttman and A. Minsky (1993). "Mode of formation and structural features of DNA-cationic liposome complexes used for transfection." Biochemistry 32: 7143-7151. Gordon, S. (1995). "The macrophage." Bioessays 17(11): 977-86. Graham, F. L. and A. J. van der Eb (1973). "A new technique for the assay of infectivity of human adenovirus 5 DNA." Virology 52(2): 456-67. Greenblatt, J. (1992). "Transcription. Riding high on the TATA box." Nature 360(6399): 16-7. Gruner, S. M., P. R. Cullis, M. J. Hope and C. P. Tilcock (1985). "Lipid polymorphism: the molecular basis of nonbilayer phases." Annu Rev Biophvs Biophvs Chem 14: 211-38. Gustafsson, J., G. Arvidson, G. Karlsson and M. Almgren (1995). "Complexes Between Cationic Liposomes and Dna Visualized By Cryo-Tem." Biochimica Et Biophvsica Acta-Biomembranes 1235(2): 305-312. 115 Hafez, I. M. and P. R. Cullis (2001). "Roles of lipid polymorphism in intracellular delivery." Adv Drug Deliv Rev 47(2-3): 139-48. Heinzinger, N. K., M. I. Bukinsky, S. A. Haggerty, A. M. Ragland, V. Kewalramani, M. A. Lee, H. E. Gendelman, L. Ratner, M. Stevenson and M. Emerman (1994). "The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in nondividing host cells." Proc Natl Acad Sci U SA91(15): 7311-5. Hershey, A. D., M. Chase, J. D. Watson, F. H. Crick, L. Barnett, S. Brenner and R. J. Watts-Tobin (1952). "Independent functions of viral protein and nucleic acid in growth of bacteriophage General nature of the genetic code for proteins." J Gen Physiol 36(1): 39-56. Hoffman, M. A. and A. C. Palmenberg (1996). "Revertant analysis of J-K mutations in the encephalomyocarditis virus internal ribosomal entry site detects an altered leader protein." J Virol 70(9): 6425-30. Hofland, H. E. J., D. Nagy, J. J. Liu, K. Spratt, Y. L. Lee, O. Danos and S. M. Sullivan (1997). "In vivo gene transfer by intravenous administration of stable cationic lipid DNA complex." Pharmaceutical Research 14(6): 742-749. Hope, M. J., M. B. Bally, G. Webb and P. R. Cullis (1985). "Production of large unilamellar vesicles by a rapid extrusion procedure. Characterizationof size distribution, trapped volume and ability to maintain a membrane potential." Biochim Biophvs Acta 812: 55-65. Home, R. W. (1962). "The comparative structure of adenoviruses." Ann N Y Acad Sci 101: 475-84. Huang, C. (1969). "Studies on phosphatidylcholine vesicles. Formation and physical characteristics." Biochemistry 8(1): 344-52. Huard, J., H. Lochmuller, G. Acsadi, A. Jani, B. Massie and G. Karpati (1995). "The Route of Administration Is a Major Determinant of the Transduction Efficiency of Rat-Tissues by Adenoviral Recombinants." Gene Therapy 2(2): 107-115. Jackson, R. J., S. L. Hunt, C. L. Gibbs and A. Kaminski (1994). "Internal initiation of translation of picornavirus RNAs." Mol Biol Rep 19(3): 147-59. Jackson, R. J. and A. Kaminski (1995). "Internal initiation of translation in eukaryotes: the picornavirus paradigm and beyond." Rna 1(10): 985-1000. 116 Jackson, R. J. and N. Standart (1990). "Do the poly(A) tail and 3' untranslated region control mRNA translation?" Cell 62(1): 15-24. Jacob, F. and J. Monod (1961). "Genetic regulatory mechanisms in the synthesis of proteins." J Mol Biol 3: 318-56. Jang, S. K., H. G. Krausslich, M. J. Nicklin, G. M. Duke, A. C. Palmenberg and E. Wimmer (1988). "A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation." J Virol 62(8): 2636-43. Jang, S. K., T. V. Pestova, C. U. Hellen, G. W. Witherell and E. Wimmer (1990). "Cap-independent translation of picornavirus RNAs: structure and function of the internal ribosomal entry site." Enzyme 44(1-4): 292-309. Jang, S. K. and E. Wimmer (1990). "Cap-independent translation of encephalomyocarditis virus RNA: structural elements of the internal ribosomal entry site and involvement of a cellular 57-kD RNA-binding protein." Genes Dev 4(9): 1560-72. Jiao, S., G. Acsadi, A. Jani, P. L. Feigner and J. A. Wolff (1992). "Persistence of plasmid DNA and expression in rat brain cells in vivo." Exp Neurol 115(3): 400-13. Jiao, S., P. Williams, R. K. Berg, B. A. Hodgeman, L. Liu, G. Repetto and J. A. Wolff (1992). "Direct gene transfer into nonhuman primate myofibers in vivo." Hum Gene Ther 3(1): 21-33. Johnston, S. A., P. Q. Anziano, K. Shark, J. C. Sanford and R. A. Butow (1988). "Mitochondrial transformation in yeast by bombardment with microprojectiles." Science 240(4858): 1538-41. Kaempfer, R., H. Rosen and R. Israeli (1978). "Translational control: recognition of the methylated 5' end and an internal sequence in eukaryotic mRNA by the initiation factor that binds methionyl-tRNAfMet." Proc Natl Acad Sci U S A 75(2): 650-4. Kaminski, A. and R. J. Jackson (1998). "The polypyrimidine tract binding protein (PTB) requirement for internal initiation of translation of cardiovirus RNAs is conditional rather than absolute." Rna 4(6): 626-38. Khoury, G. and P. Gruss (1983). "Enhancer elements." Cell 33(2): 313-4. 117 Kirn, D., T. Hermiston and F. McCormick (2000). "Replication-selective oncolytic adenoviruses: virotherapy aimed at genetic targets in cancerONYX-015: clinical data are encouraging." Oncogene 19(56): 6660-9. Kirn, D., T. Hermiston and F. McCormick (2001). "Oncolytic virotherapy for cancer with the adenovirus dl1520 (Onyx-015): results of phase I and II trials ONYX-015: clinical data are encouraging." Expert Opin Biol Ther 1(3): 525-38. Klemm, A. R., D. Young and J. B. Lloyd (1998). "Effects of polyethyleneimine on endocytosis and lysosome stability." Biochem Pharmacol 56(1): 41-6. Klibanov, A. L., K. Maruyama, V. P. Torchilin and L. Huang (1990). "Amphipathic polyethyleneglycols effectively prolong the circulation time of liposomes." FEBS Lett 268: 235-237. Klingler, E., Jr., M. Chapin and G. R. Dubes (1959). "Relationship between inactivation of poliovirus by phenol and appearance of ribonuclease-labile infectivity." Proc Soc Exp Biol Med 101: 829-32. Kobayashi, T., E. Stang, K. S. Fang, P. de Moerloose, R. G. Parton and J. Gruenberg (1998). "A lipid associated with the antiphospholipid syndrome regulates endosome structure and function." Nature 392(6672): 193-7. Kochanek, S. (1999). "High-capacity adenoviral vectors for gene transfer and somatic gene therapy." Hum Gene Ther 10(15): 2451-9. Kochanek, S., G. Schiedner and C. Volpers (2001). "High-capacity 'gutless' adenoviral vectors." Curr Opin Mol Ther 3(5): 454-63. Kohn, S., J. Nagy, H. Dvorak and A. Dvorak (1992). "Pathways of macromolecular tracer transport across venules and small veins. Structural basis for the hyperpermeability of tumor blood vessels." Lab Invet 67: 596-607. Kolupaeva, V. G., C. U. Hellen and I. N. Shatsky (1996). "Structural analysis of the interaction of the pyrimidine tract-binding protein with the internal ribosomal entry site of encephalomyocarditis virus and foot-and-mouth disease virus RNAs." Rna 2(12): 1199-212. Kotin, R. M., M. Siniscalco, R. J. Samulski, X. D. Zhu, L. Hunter, C. A. Laughlin, S. McLaughlin, N. Muzyczka, M. Rocchi and K. I. Berns (1990). "Site-specific integration by adeno-associated virus." Proc Natl Acad Sci U S A 87(6): 2211-5. 118 Kraus, L. M. (1961). "Formation of different haemoglobins in tissue culture of human bone marrow treated with human deoxyribonucleic acid." Nature 192: 1055-7. Kreiss, P., B. Cameron, R. Rangara, P. Mailhe, O. Aguerre-Charriol, M. Airiau, D. Scherman, J. Crouzet and B. Pitard (1999). "Plasmid DNA size does not affect the physicochemical properties of lipoplexes but modulates gene transfer efficiency." Nucleic Acids Res 27(19): 3792-8. Krieg, P. A. and D. A. Melton (1987). "In vitro RNA synthesis with SP6 RNA polymerase." Methods Enzvmol 155: 397-415. Kunitake, K., and Okahata, Y. (1977). "A totally synthetic bilayer membrane." J. Amer. Chem. Soc. 99: 3860-3861. Kupper, H., W. T. McAllister and E. K. Bautz (1972). "Properties of the bacteriophage T3 RNA polymerase in vitro." Hoppe Sevlers Z Physiol Chem 353(10): 1542-3. LabatMoleur, F., A. M. Steffan, C. Brisson, H. Perron, O. Feugeas, P. Furstenberger, F. Oberling, E. Brambilla and J. P. Behr (1996). "An electron microscopy study into the mechanism of gene transfer with lipopolyamines." Gene Therapy 3(11): 1010-1017. Laurent, N., S. Wattiaux-De Coninck, E. Mihaylova, E. Leontieva, M. T. Warnier-Pirotte, R. Wattiaux and M. Jadot (1999). "Uptake by rat liver and intracellular fate of plasmid DNA complexed with poly-L-lysine or poly-D-lysine." FEBS Lett 443(1): 61-5. Le, S. Y. and J. V. Maizel, Jr. (1997). "A common RNA structural motif involved in the internal initiation of translation of cellular mRNAs." Nucleic Acids Res 25(2): 362-69. Leary, S. L., H. J. Baum and Z. G. Loewy (1991). "DNA-dependent RNA polymerase from bacteriophage T3 transcribes and amplifies an RNA template in vitro." Gene 106(1): 93-6. Lechardeur, D., K. J. Sohn, M. Haardt, P. B. Joshi, M. Monck, R. W. Graham, B. Beatty, J. Squire, H. O'Brodovich and G. L. Lukacs (1999). "Metabolic instability of plasmid DNA in the cytosol: a potential barrier to gene transfer." Gene Therapy 6: In Press. Lederberg, J. (1952). "Cell genetics and hereditary symbiosis." Physiol Rev 32(4): 403-30. 119 Lee, Y., W. J. Sohn, D. S. Kim and H. J. Kwon (2004). "NF-kappaB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene enhancer/promoter in response to lipopolysaccharide and bacterial CpG-oligodeoxynucleotides in macrophage cell line RAW 264.7." Eur J Biochem 271(6): 1094-105. Li, E., S. L. Brown, D. G. Stupack, X. S. Puente, D. A. Cheresh and G. R. Nemerow (2001). "Integrin alpha(v)beta1 is an adenovirus coreceptor." J Virol 75(11): 5405-9. Li, S. and L. Huang (1997). "In vivo gene transfer via intravenous administration of cationic lipid-protamine-DNA (LPD) complexes." Gene Ther 4: 891-900. Liu, Z., L. M. Cashion and J. J. Twu (1997). "A systematic comparison of relative promoter/enhancer activities in mammalian cell lines." Anal Biochem 246(1): 150-2. Luciw, P. A., J. M. Bishop, H. E. Varmus and M. R. Capecchi (1983). "Location and function of retroviral and SV40 sequences that enhance biochemical transformation after microinjection of DNA." CeJI 33(3): 705-16. Maniatis, T., S. G. Kee, A. Efstratiadis and F. C. Kafatos (1976). "Amplification and characterization of a beta-globin gene synthesized in vitro." Cell 8(2): 163-82. Maurer, N., D. B. Fenske and P. R. Cullis (2001). "Developments in liposomal drug delivery systems." Expert Qpin Biol Ther 1(6): 923-47. Mayer, L. D., M. J. Hope and P. R. Cullis (1986). "Vesicles of variable sizes produced by a rapid extrusion procedure." Biochim Biophvs Acta 858(1): 161-8. McCown, T. J., X. Xiao, J. Li, G. R. Breese and R. J. Samulski (1996). "Differential and persistent expression patterns of CNS gene transfer by an adeno-associated virus (AAV) vector." Brain Res 713(1-2): 99-107. McGeoch, D. J., A. Dolan, S. Donald and D. H. Brauer (1986). "Complete DNA sequence of the short repeat region in the genome of herpes simplex virus type 1." Nucleic Acids Res 14(4): 1727-45. Meador, J. W., 3rd, H. E. McElroy, B. L. Pasloske, S. C. Milburn and M. M. Winkler (1995). "pTRIPLEscript: a novel cloning vector for generating in vitro transcripts from tandem promoters for SP6, T7 and T3 RNA polymerase." Biotechniques 18(1): 152-7,. 120 Meerovitch, K., Y. V. Svitkin, H. S. Lee, F. Lejbkowicz, D. J. Kenan, E. K. Chan, V. I. Agol, J. D. Keene and N. Sonenberg (1993). "La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate." J Virol 67(7): 3798-807. Meselson, M. and R. Yuan (1968). "DNA restriction enzyme from E. coli." Nature 217(134): 1110-4. Meyer, G. (1971). "Viral genome and oncogenic transformation: nuclear and plasma membrane events." Adv Cancer Res 14: 71-159. Miller, A. R., M. J. Skotzko, K. Rhoades, A. S. Belldegrun, C. L. Tso, R. Kaboo, W. H. McBride, E. Jacobs, D. B. Kohn, R. Moen and et al. (1992). "Simultaneous use of two retroviral vectors in human gene marking trials: feasibility and potential applications." Hum Gene Ther 3(6): 619-24. Moghimi, S. M. and J. Szebeni (2003). "Stealth liposomes and long circulating nanoparticles: critical issues in pharmacokinetics, opsonization and protein-binding properties." Prog Lipid Res 42(6): 463-78. Mok, K. W. C. (1998). Characterization of Lipid-Based DNA Delivery Sysstems. Biochemistry and Molecular Biology. Vancouver, University of British Columbia: 169. Monck, M. A., A. Mori, D. Lee, P. Tarn, J. J. Wheeler, P. R. Cullis and P. Scherrer (2000). "Stabilized plasmid-lipid particles: Pharmacokinetics and plasmid delivery to distal tumors following intravenous injection." Journal of Drug Targeting 7(6): 439-452. Mortimer, I., P. Tarn, I. MacLachlan, R. W. Graham, E. G. Saravolac and P. B. Joshi (1999). "Cationic lipid-mediated transfection of cells in culture requires mitotic activity." Gene Therapy 6(3): 403-411. Mulligan, R. C. (1993). "The basic science of gene therapy." Science 260: 926-932. Muzyczka, N. (1992). "Use of adeno-associated virus as a general transduction vector for mammalian cells." Curr Top Microbiol Immunol 158: 97-129. Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M. Verma and D. Trono (1996). "In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector." Science 272(5259): 263-7. 121 Nikolov, D. B., S. H. Hu, J. Lin, A. Gasch, A. Hoffmann, M. Horikoshi, N. H. Chua, R. G. Roeder and S. K. Burley (1992). "Crystal structure of TFIID TATA-box binding protein." Nature 360(6399): 40-6. Osterman, J. V., A. Waddell and H. V. Aposhian (1971). "Gene therapy systems: the need, experimental approach, and implications." Ann N Y Acad Sci 179: 514-9. Palmer, L. (2000). Development of Stabilized Plasmid Lipid Particles as Intracellular Gene Delivery Vehichles. Biochemistry and Molecular Biology. Vancouver, University of British Columbia: 135. Pitt, A., L. S. Mayorga, A. L. Schwartz and P. D. Stahl (1992). "Transport of phagosomal components to an endosomal compartment." J Biol Chem 267(1): 126-32. Pollard, H., G. Toumaniantz, J. L. Amos, H. Avet-Loiseau, G. Guihard, J. P. Behr and D. Escande (2001). "Ca2+-sensitive cytosolic nucleases prevent efficient delivery to the nucleus of injected plasmids." J Gene Med 3(2): 153-64. Promega (2002). Promega TnT Coupled Reticulocyte Lysate Systems Manual. Madison, Wl, Promega Corporation. Ptushkina, M., T. von der Haar, M. M. Karim, J. M. Hughes and J. E. McCarthy (1999). "Repressor binding to a dorsal regulatory site traps human elF4E in a high cap-affinity state." EMBO J 18(14): 4068-75. Rabotti, G. F. (1963). "Incorporation of DNA into a Mouse Tumor in Vivo and in Vitro." Exp Cell Res 31: 562-5. Radler, J. O., I. Koltover, T. Salditt and C. R. Safinya (1997). "Structure of DNA-cationic liposome complexes: DNA intercalation in multilamellar membranes in distinct interhelical packing regimes." Science 275(5301): 810-814. Raper, S. E., M. Yudkoff, N. Chirmule, G. P. Gao, F. Nunes, Z. J. Haskal, E. E. Furth, K. J. Propert, M. B. Robinson, S. Magosin, H. Simoes, L. Speicher, J . Hughes, J. Tazelaar, N. A. Wivel, J . M. Wilson and M. L. Batshaw (2002). "A pilot study of in vivo liver-directed gene transfer with an adenoviral vector in partial ornithine transcarbamylase deficiency." Hum Gene Ther 13(1): 163-75. Rettinger, S. D., S. C. Kennedy, X. Wu, R. L. Saylors, D. G. Hafenrichter, M. W. Flye and K. P. Ponder (1994). "Liver-directed gene therapy: quantitative evaluation of promoter elements by using in vivo retroviral transduction." Proc Natl Acad Sci U SA91(4): 1460-4. 122 Roe, T., T. C. Reynolds, G. Yu and P. O. Brown (1993). "Integration of murine leukemia virus DNA depends on mitosis." EMBO J 12(5): 2099-108. Roeder, R. G. (1991). "The complexities of eukaryotic transcription initiation: regulation of preinitiation complex assembly." Trends Biochem Sci 16(11): 402-8. Rogers, S. (1971). "Gene therapy: a potentially invaluable aid to medicine and mankind." Res Commun Chem Pathol Pharmacol 2(4): 587-600. Rogers, S., A. Lowenthal, H. G. Terheggen and J. P. Columbo (1973). "Induction of arginase activity with the Shope papilloma virus in tissue culture cells from an argininemic patient." J Exp Med 137(4): 1091-6. Ross, P. C. and S. W. Hui (1999). "Lipoplex size is a major determinant of in vitro lipofection efficiency." Gene Therapy 6(4): 651-659. Rougeon, F., P. Kourilsky and B. Mach (1975). "Insertion of a rabbit beta-globin gene sequence into an E. coli plasmid." Nucleic Acids Res 2(12): 2365-78. Roulland-Dussoix, D. and H. W. Boyer (1969). "The Escherichia coli B restriction endonuclease." Biochim Biophvs Acta 195(1): 219-29. Rubin, G. M. and A. C. Spradling (1982). "Genetic transformation of Drosophila with transposable element vectors." Science 218(4570): 348-53. Russell, P. J. (1996). Genetics: 4th Edition. New York, HarperCollins College Publishers. Sachs, A. (1990). "The role of poly(A) in the translation and stability of mRNA." Curr Opin Cell Biol 2(6): 1092-8. Sambrook, J., Fritsch, E. F., Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Plainview, New York, Cold Spring Harbor Laboratory Press. Sambrook, J., H. Westphal, P. R. Srinivasan and R. Dulbecco (1968). "The integrated state of viral DNA in SV40-transformed cells: Viral DNA in polyoma- and SV40-transformed cell lines: The induction of cancer by viruses." Proc Natl Acad Sci U S A 60(4): 1288-95. 123 Samulski, R. J., L. S. Chang and T. Shenk (1989). "Helper-free stocks of recombinant adeno-associated viruses: normal integration does not require viral gene expression." J Virol 63(9): 3822-8. Scharfmann, R., J . H. Axelrod and I. M. Verma (1991). "Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants." Proc Natl Acad Sci U S A 88(11): 4626-30. Schimizu, T. and M. Iwafuchi (1962). "On the inhibition of protein synthesis in Ehrlich ascites tumor cells by iodinated deoxyribonucleic acid in vitro." Biochim Biophvs Acta 61: 838-9. Shatkin, A. J. (1976). "Capping of eucaryotic mRNAs." CeN 9(4 PT 2): 645-53. Shimotohno, K. and H. M. Temin (1981). "Formation of infectious progeny virus after insertion of herpes simplex thymidine kinase gene into DNA of an avian retrovirus." Cell 26(1 Pt 1): 67-77. Sirotnak, F. M. and D. J. Hutchinson (1959). "Absorption of deoxyribonucleic acid by mouse lymphoma cells." Biochim Biophvs Acta 36: 246-8. Smith, G. L. and B. Moss (1983). "Infectious poxvirus vectors have capacity for at least 25 000 base pairs of foreign DNA." Gene 25(1): 21-8. Somia, N. and I. M. Verma (2000). "Gene therapy: trials and tribulations." Nat Rev Genet 1(2): 91-9. Spector, M. S. and J. M. Schnur (1997). "DNA ordering on a lipid membrane." Science 275(5301): 791-2. Stegmann, T. and J. Y. Legendre (1997). "Gene transfer mediated by cationic lipids: lack of a correlation between lipid mixing and transfection." Biochim Biophvs Acta 1325(1): 71-9. Sternberg, B., F. L. Sorgi and L. Huang (1994). "New Structures in Complex-Formation Between Dna and Cationic Liposomes Visualized By Freeze-Fracture Electron-Microscopy." FEBS Letters 356(2-3): 361-366. Strohl, W. A., A. S. Rabson and H. Rouse (1967). "Adenovirus tumorigenesis: role of the viral genome in determining tumor morphology." Science 156(3782): 1631-3. 124 Szoka, F., Jr. and D. Papahadjopoulos (1978). "Procedure for preparation of liposomes with large internal aqueous space and high capture by reverse-phase evaporation." Proc Natl Acad Sci U S A 75(9): 4194-8. Tabin, C. J., J. W. Hoffmann, S. P. Goff and R. A. Weinberg (1982). "Adaptation of a retrovirus as a eucaryotic vector transmitting the herpes simplex virus thymidine kinase gene." Mol Cell Biol 2(4): 426-36. Teichler Zallen, D. (2000). "US gene therapy in crisis." Trends Genet 16(6): 272-5. Templeton, N. S., D. D. Lasic, P. M. Frederik, H. H. Strey, D. D. Roberts and G. N. Pavlakis (1997). "Improved DNA:liposome complexes for increased systemic delivery and gene expression." Nature Biotech 15(July): 647-652. Tenenbaum, L, E. Lehtonen and P. E. Monahan (2003). "Evaluation of risks related to the use of adeno-associated virus-based vectors." Curr Gene Ther 3(6): 545-65. Terheggen, H. G., A. Lowenthal, F. Lavinha, J. P. Colombo and S. Rogers (1975). "Unsuccessful trial of gene replacement in arginase deficiency." Z Kinderheilkd 119(1): 1-3. Tsan, M. F., J. E. White and B. Shepard (1995). "Lung-specific direct in vivo gene transfer with recombinant plasmid DNA." Am J Physiol 268(6 Pt 1): L1052-6. Vaheri, A. and J. S. Pagano (1965). "Infectious poliovirus RNA: a sensitive method of assay." Virology 27(3): 434-6. Vitadello, M., M. V. Schiaffino, A. Picard, M. Scarpa and S. Schiaffino (1994). "Gene transfer in regenerating muscle." Hum Gene Ther 5(1): 11-8. Wagner, E., K. Zatloukal, M. Cotten, H. Kirlappos, K. Mechtler, D. T. Curiel and M. L. Birnstiel (1992). "Coupling of adenovirus to transferrin-polylysine/DNA complexes greatly enhances receptor-mediated gene delivery and expression of transfected genes." Proc Natl Acad Sci U S A 89(13): 6099-103. Watson, J. D. and F. H. Crick (1953). "Molecular structure of nucleic acids: a structure for deoxyribose nucleic acid." Nature 171(4356): 737-8. Wattiaux, R., M. Jadot, N. Laurent, F. Dubois and S. Wattiaux-De Coninck (1996). "Cationic lipids delay the transfer of plasmid DNA to lysosomes." Biochem Biophvs Res Commun 227(2): 448-54. 125 Wattiaux, R., M. Jadot, M. T. Warnier-Pirotte and S. Wattiaux-De Coninck (1997). "Cationic lipids destabilize lysosomal membrane in vitro." FEBS Lett 417(2): 199-202. Wattiaux, R., N. Laurent, S. Wattiaux-De Coninck and M. Jadot (2000). "Endosomes, lysosomes: their implication in gene transfer." Adv Drug Deliv Rev 41(2): 201-8. Wei, C. M., M. Gibson, P. G. Spear and E. M. Scolnick (1981). "Construction and isolation of a transmissible retrovirus containing the src gene of Harvey murine sarcoma virus and the thymidine kinase gene of herpes simplex virus type 1." J Virol 39(3): 935-44. Wenger, R. H., H. Moreau and P. J. Nielsen (1994). "A comparison of different promoter, enhancer, and cell type combinations in transient transfections." Anal Biochem 221(2): 416-8. Westphal, H. and R. Dulbecco (1968). "Viral DNA in polyoma- and SV40-transformed cell lines The induction of cancer by viruses." Proc Natl Acad Sci U S A 59(4): 1158-65. Wheeler, J . J., L. Palmer, M. Ossanlou, I. MacLachlan, R. W. Graham, Y. P. Zhang, M. J. Hope, P. Scherrer and P. R. Cullis (1999). "Stabilized plasmid-lipid particles: construction and characterization." Gene Therapy 6(2): 271-281. Wickham, T. J., P. Mathias, D. A. Cheresh and G. R. Nemerow (1993). "Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment." Cejl 73(2): 309-19. Wilke, M., E. Fortunati, M. van den Broek, A. T. Hoogeveen and B. J. Scholte (1996). "Efficacy of a peptide-based gene delivery system depends on mitotic activity." Gene Ther 3(12): 1133-42. Wolff, J. A. (1994). Gene Therapeutics: methods and applications of direct gene transfer. J . A. Wolff. Boston, BirkHauser: 417. Wolff, J. A., R. W. Malone, P. Williams, W. Chong, G. Acsadi, A. Jani and P. L. Feigner (1990). "Direct gene transfer into mouse muscle in vivo." Science 247(4949 Pt 1): 1465-8. Wong, E. T., S. M. Ngoi and C. G. Lee (2002). "Improved co-expression of multiple genes in vectors containing internal ribosome entry sites (IRESes) from human genes." Gene Ther 9(5): 337-44. 126 Worgall, S., G. Wolff, P. Falck and R. Crystal (1997). "Innate immune mechanisms dominate elimation of adenoviral vectors following in vivo administration." Hum Gene Ther 8: 37-44. Wrobel, I. and D. Collins (1995). "Fusion of cationic liposomes with mammalian cells occurs after endocytosis." Biochim Biophvs Acta 1235: 296-304. Wu, G. Y. and C. H. Wu (1987). "Receptor-mediated in vitro gene transformation by a soluble DNA carrier system." Jour Biol Chem 262: 4429-4432. Xiao, X., J . Li and R. J. Samulski (1996). "Efficient long-term gene transfer into muscle tissue of immunocompetent mice by adeno-associated virus vector." J Virol 70(11): 8098-108. Zabner, J., A. J. Fasbender, T. Moninger, K. A. Poellinger and M. J . Welsh (1995). "Cellular and molecular barriers to gene transfer by a cationic lipid." J Biol Chem 270(August 11): 18997-19007. Zabner, J., A. J. Fasbender, T. Moninger, K. A. Poellinger and M. J . Welsh (1995). "Cellular and Molecular Barriers to Gene-Transfer By a Cationic Lipid." Journal of Biological Chemistry 270(32): 18997-19007. Zarrin, A. A., L. Malkin, I. Fong, K. D. Luk, A. Ghose and N. L. Berinstein (1999). "Comparison of CMV, RSV, SV40 viral and Vlambdal cellular promoters in B and T lymphoid and non-lymphoid cell lines." Biochim Biophvs Acta 1446(1-2): 135-9. Zatloukal, K., W. Schmidt, M. Cotten, E. Wagner, G. Stingl and M. L. Birnstiel (1993). "Somatic gene therapy for cancer: the utility of transferrinfection in generating 'tumor vaccines'." Gene 135(1-2): 199-207. Zhou, X. H. and L. Huang (1994). "Dna Transfection Mediated By Cationic Liposomes Containing Lipopolylysine - Characterization and Mechanism of Action." Biochimica Et Biophysica Acta-Biomembranes 1189(2): 195-203. 127 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099834/manifest

Comment

Related Items