UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Functional analyses of Arabidopsis MAPK gene families Sritubtim, Somrudee 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-105712.pdf [ 23.29MB ]
Metadata
JSON: 831-1.0099814.json
JSON-LD: 831-1.0099814-ld.json
RDF/XML (Pretty): 831-1.0099814-rdf.xml
RDF/JSON: 831-1.0099814-rdf.json
Turtle: 831-1.0099814-turtle.txt
N-Triples: 831-1.0099814-rdf-ntriples.txt
Original Record: 831-1.0099814-source.json
Full Text
831-1.0099814-fulltext.txt
Citation
831-1.0099814.ris

Full Text

FUNCTIONAL ANALYSES OF ARABIDOPSIS MAPK GENE FAMILIES B y S O M R U D E E S R I T U B T I M B.Sc. Khon Kaen University, Thailand, 1994 M.Sc. , Simon Fraser University, Canada, 1999 A THESIS S U B M I T T E D IN P A R T I A L F U L F I L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF D O C T O R OF P H I L O S O P H Y in T H E F A C U L T Y OF G R A D U A T E S T U D I E S (Plant Science) T H E U N I V E R S I T Y OF BRIT ISH C O L U M B I A October 2005 © Somrudee Sritubtim, 2Q05 ABSTRACT In plants, mitogen-activated protein kinase ( M A P K ) cascades have been implicated in controlling intracellular signaling in developmental processes and in response to many external stimuli, including biotic and abiotic stresses. The hallmark of a M A P K cascade is the participation of three classes of protein kinases ( M A P K , M A P K K and M A P K K K ) that operate hierarchically to amplify the initial signal. Plant genomes appear to encode an exceptionally rich array of M A P K cascade proteins (at least 20 M A P K and 10 M A P K K homologies have been identified in Arabidopsis) but functional analysis of this extensive matrix is just beginning. To gain insight into the specificity/redundancy of M A P K s and M A P K K s , I have used R T - P C R to examine the expression profiles of each of the identified MAPKK and MAPK genes in Arabidopsis. Gene expression patterns have been examined in various tissues, at several developmental stages and following a series of stress treatments. The findings reveal distinct expression patterns of AtMKK6, AtMPK13 and AtMPKll genes. I have analyzed further the cell and tissue distribution of their expression during development and in response to many external stimuli through use of promoter::GUS (j3-glucuronidase) reporter plants. On the one hand, my results show that AtMKK6 and AtMPK13 promoters are specifically active at the primary root zones where lateral root primordia (LRP) are emerging. Auxin treatment further stimulates the promoter of these genes in emerging L R P , and those promoter activities are suppressed by N P A , an auxin transport inhibitor. The AtMPKll promoter, on the other hand, is specifically active in stomatal guard cells and can be induced by high salt and osmotic stress treatments. I have also conducted a phenotypic analysis of AtMKK6, AtMPK13 and AtMPK12 loss-of-function ii mutant plants. Together, these results indicate diverse roles o f MAPKK/MAPK genes. I show that A t M K K 6 and A t M P K 1 3 activities are both associated with the lateral root formation process, while A t M P K 1 2 plays discrete roles during stomatal development. i i i TABLE OF CONTENTS A B S T R A C T ii T A B L E O F C O N T E N T S iv LIST O F T A B L E S viii LIST O F FIGURES ix LIST O F ABBREVIATIONS. . . . xi A C K N O W L E D G E M E N T S xiii C H A P T E R 1: M A P K G E N E F A M I L Y IN P L A N T S 1 1.1 INTRODUCTION 1 1.2 R O L E S OF M A P K P A T H W A Y COMPONENTS IN PLANTS 3 1.2.1 The role of M A P K pathways in stress signaling in plants 4 1.2.1.1 Wounding signaling 4 1.2.1.2 Oxidative stress signaling 5 1.2.1.3 Low temperature stress signaling 6 1.2.2 The role of M A P K pathways in plant development 7 1.2.2.1 Cel l cycle and cytokinesis in plants 7 1.2.2.2 Cell-type specific development: 8 1.2.3 The role of M A P K pathways in plant hormone signaling 9 1.2.3.1 Aux in 10 1.2.3.2 Abscisic acid 10 1.2.3.3 Ethylene 11 1.3 M A P KINASE P A T H W A Y COMPONENTS IN ARABIDOPSIS 12 1.4 THESIS OBJECTIVES 16 C H A P T E R 2: M A P K K / M A P K EXPRESSION PROFILING IN ARABIDOPSIS 18 2.1 INTRODUCTION 18 2.2 M A T E R I A L S A N D M E T H O D S 21 2.2.1 Plant materials and growth conditions 21 2.2.2 Plant treatments 23 2.2.3 Total R N A extraction 24 2.2.4 R N A sample preparation for R T - P C R 24 2.2.5 R T reaction (first-strand c D N A synthesis) prior to P C R 25 2.2.6 P C R amplification 26 2.3 R E S U L T S A N D DISCUSSION 29 2.3.1 Tissue differentiation o f the Arabidopsis MAPKK/MAPK gene families: Characteristic profiles in mature and developing organs using R T - P C R data 29 2.3.2 Stress differentiation o f the Arabidopsis MAPKK/MAPK gene families 37 2.3.3 Three candidate genes with interesting expression pattern for further functional characterization 43 2.3.3.1 The AtMKK6 and AtMPKIS genes 43 2.3.3.2 The AtMPKl2 gene..! 43 2.3.4 Perspectives 44 iv 2.3.4.1 Expression profil ing approach is useful to identify developmentally regulated and stress-responsive genes 44 2.3.4.2 Spatial and temporal expression can infer gene function in Arabidopsis 46 C H A P T E R 3: ARABIDOPSIS M A P KINASE KINASE (ATMKK6) A N D M A P KINASE 13 (ATMPK13) E N C O D E POSITIVE R E G U L A T O R S O F L A T E R A L R O O T F O R M A T I O N 47 3.1 INTRODUCTION 47 3.2 M A T E R I A L S A N D M E T H O D S 50 3.2.1 Plant materials 50 3.2.2 Genomic D N A isolation 50 3.2.3 Molecular cloning of AtMKK6 or AtMPKl3 promoter::GUS D N A construct and generation o f G U S reporter plants 52 3.2.3.1 Cloning of promoters 52 3.2.3.2 Generation o f promoter: :GUS fusion D N A constructs 53 3.2.3.3 Transformation of Agrobacterium 54 3.2.3.4 In planta transformation of Arabidopsis 56 3.2.3.5 Selection o f transformants 57 3.2.4 Histochemical G U S assay 58 3.2.5 Resin embedding and cross-sectioning of root tissue 59 3.2.6 Hormone treatments 60 3.2.7 E. coli (DH5a) competent cells 61 3.2.8 E. coli transformation 61 3.2.9 Agrobacterium competent cells 62 3.2.10 Bacterial growth media 62 3.2.11 Arabidopsis plant growth media 63 3.2.12 Molecular cloning of glucocorticoid-inducible A t M K K 6 R N A i and A t M P K l 3 R N A i D N A constructs and screening for the mutant plants 63 3.2.13 Phenotypic analyses and plant growth conditions 68 3.2.14 Lateral root analysis 69 3.2.15 Total R N A extraction and R T - P C R analysis 69 3.3 RESULTS 71 3.3.1 Histochemical localization o f G U S activities driven by AtMKK6 and AtMPKl3 promoters during plant growth and development 71 3.3.2 AtMKK6 promoter::GUS activity distribution during plant growth and development 72 3.3.3 AtMKK6 promoter activity and lateral root formation 74 3.3.4 AtMPK13 promoter::GUS activity throughout plant growth and development.... 76 3.3.5 A t M K K 6 , auxin and lateral root formation 79 3.3.6 Blocking polar auxin transport with N P A reduces AtMKK6 promoter::GUS activity 81 3.3.7 Aux in can reverse the block o f AtMKK6 promoter::GUS activity by N P A in both vascular tissue and pericycle cells 82 3.3.8 A t M P K l 3 and auxin 85 3.3.9 Phenotypic analysis of A t M K K 6 R N A i transgenic plants 87 3.3.10 Lateral root analysis of A t M P K 1 3 R N A i transgenic plants 92 3.4 DISCUSSION 94 3.4.1 A t M K K 6 is required for lateral root initiation 94 3.4.2 Pericycle-specific expression of the AtMKK6 promoter is regulated by auxin 95 3.4.3 A t M K K 6 and A t M P K 1 3 relationship 97 CHAPTER 4: ATMPK12, AN ARABIDOPSIS MITOGEN-ACTIVATED PROTEIN KINASE IS GUARD CELL-SPECIFIC AND INDUCED BY SALT AND OSMOTIC STRESSES 99 " 4.1 INTRODUCTION 99 4.1.1 Stomatal development 99 4.1.2 Stomatal function and their regulation through ion channels 106 4.1.3 Involvement of protein phosphorylation in stomatal regulation 109 4.1.4 Salt stress signaling 110 4.1.5 Ionic stress signaling: the "salt overly sensitive" (SOS) pathway I l l 4.1.6 Osmotic stress signaling: SOS-independent protein kinases 113 4.2 M A T E R I A L S A N D M E T H O D S 116 4.2.1 Plant materials 116 4.2.2 Genomic D N A isolation 116 4.2.3 Molecular cloning of AtMPK12 promoter::GUS D N A constructs and generating the G U S reporter plants 116 4.2.3.1 Cloning of the AtMPK12 promoter 116 4.2.3.2 Generation of promoter: :GUS fusion D N A constructs and transgenic plants 117 4.2.4 Histochemical G U S analysis 118 4.2.5 Resin embedding and cross-sectioning of leaf tissue 118 4.2.6 N a C l and mannitol treatments 118 4.2.7 Verif ication o f the AtMPK12 S A L K transfer-DNA (T -DNA) 119 4.2.7.1 Genomic D N A extraction of the AtMPK12 S A L K T - D N A 119 4.2.7.2 Identification of a homozygous S A L K T - D N A insertional line 120 4.2.8 Phenotypic analyses of the homozygous AtMPK12 T - D N A insertional mutant (atmpkl2) in normal growth conditions 122 4.3 RESULTS 123 4.3.1 Histochemical localization of G U S activity driven by AtMPKl2 promoter during plant development 123 4.3.2 AtMPKl2 promoter activity was enhanced by N a C l and mannitol 132 4.3.2 Characterization o f S A L K T - D N A insertion lines 136 4.3.3 Phenotypic analysis of the atmpkl2 plants 137 4.4 DISCUSSION 137 4.4.1 AtMPKl2 promoter activity pattern is guard cell-specific throughout 137 plant development 137 4.4.2 A t M P K 1 2 maybe required for guard cell development 139 4.4.3 Guard cell-specific A t M P K l 2 is involved in osmotic stress response 140 4.4.5 Concluding remarks 142 vi CHAPTER 5: OVERALL THESIS DISCUSSION AND FUTURE DIRECTIONS.... 143 5.1 TRANSCRIPTIONAL PROFILING A P P R O A C H VERSUS D E V E L O P M E N T A L SIGNALING 143 5.2 CHARACTERIZATION OF D E V E L O P M E N T A L L Y R E G U L A T E D GENES USING A N INDUCIBLE R N A I A P P R O A C H 144 5.3. F U T U R E DIRECTIONS 144 5.3.1 Systematic analysis o f the MAPKKK genes 145 5.3.2 Use inducible promoters to drive AtMPK12 gene constructs in stomata of transgenic plants 145 5.3.3 Identification o f the M A P K protein network 146 5.3.4 Further characterization of the mutant and transgenic plants 146 REFERENCES 147 vi i LIST OF TABLES Table 1.1 List o f Arabidopsis M A P K signalling components, adapted from Jonak et al. (2002) 14 Table 2.1 AtMKK primer sequences for P C R amplification 27 Table 2.2 AtMPK primer sequences for P C R amplification 28 Table 2.3 The gene expression profiles in all known Arabidopsis MAPK genes 30 Table 2.4 The gene expression profiles in all known Arabidopsis MAPKK genes 31 Table 2.5 The M P S S data for the AtMPK genes 32 Table 2.6 The M P S S data for the AtMKK genes 33 Table 2.7 The gene expression profiles in all known Arabidopsis MAPK genes under different stress conditions 39 Table 2.8 The gene expression profiles in all known Arabidopsis MAPKK genes under different stress conditions 41 Table 3.1 Primer sequences for promoter cloning 53 Table 3.2 Primers for the A t M K K 6 R N A i and A t M P K 1 3 R N A i constructs 65 Table 3.3 Primers used for checking gene expression of the A t M K K 6 R N A i (line 13) 70 Table 4.1 Primer sequences for AtMPK 12 promoter cloning 117 Table 4.2 Primers for verification of the AtMPK12 T - D N A insertional homozygous line(s) (SALK_074849) 120 v i i i LIST OF FIGURES Figure 2.1 Grouping of the M A P K K and M A P K proteins 20 Figure 2.2 R T - P C R analysis o f the expression pattern o f the AtMKK6 and AtMPKl3 genes. 34 Figure 2.3 The AtMKK9 gene was differentially expressed in organs and during developmental stages 36 Figure 3.1 Schematic diagrams of p C A M B I A 1 3 8 1 Z and p C A M B I A 1 3 0 1 vectors 55 Figure 3.2 Schematic diagram describing construction o f the A t M K K 6 R N A i construct 66 Figure 3.3 Glucocorticoid-inducible A t M K K 6 R N A interference ( A t M K K 6 R N A i ) system . 67 Figure 3.4 Overview of the process for generating A t M K K 6 R N A i transgenic plants 68 Figure 3.5 Promoterless-GUS activity as a negative control for G U S assay 71 Figure 3.6 35S promoter-GUS activity as a positive control for G U S assay 72 Figure 3.7 Histochemical localization o f G U S activity in AtMKK6 promoter: :GUS reporter plants through development from 3 days to 35 days 73 Figure 3.8 Detailed examination o f 10-day old seedlings of AtMKK6 promoter:: GUS reporter plants 75 Figure 3.9 Histochemical localization o f G U S activity in AtMPKl3 promoter::GUS reporter plants through development from 3 days to 35 days 77 Figure 3.10 Schematic illustration showing the location of the putative auxin-responsive sequence A u x R E P S I A A 4 in the AtMKK6 promoter region (740 bp) 78 Figure 3.11 N P A effect on lateral root formation in 17-day-old wild-type Arabidopsis seedlings 80 Figure 3.12 N P A (5 p M ) effect on G U S activity in 10-day-old AtMKK6 promoter::GUS reporter seedlings 81 Figure 3.13 Histochemical localization of G U S activity in lateral root primordia (LRPs) and lateral roots of A t M K K 6 promoter::GUS reporter seedlings, upon N P A (5 pM) treatment and co-treatment o f N P A (5 pM) and I A A (1 p M ) 84 Figure 3.14 Schematic illustration showing the location of two putative auxin-responsive sequences AuxRR-core in the A t M P K l 3 promoter region (1534 bp) 85 Figure 3.15 Histochemical localization of AtMPKl3 promoter::GUS activity in L R P s and lateral roots from 13-day-old reporter seedlings, upon treatment o f N P A alone (5 p M ) and co-treatment o f N P A (5 p M ) and I A A (1 pM) 86 Figure 3.16 R T - P C R analysis showing a ~23% reduction in the AtMKK6 transcript level in 10-day-old A t M K K 6 R N A i seedlings (line 13) when the gene silencing was induced by 1 p M dexamethasone (dex) treatment as compared to that without dex treatment (control) 88 Figure 3.17 Phenotypic analyses revealed growth defects of A t M K K 6 R N A i plants 90 Figure 3.18 Close-up views of phenotypes from A t M K K 6 R N A i plants when 91 Figure 3.19 A t M K K 6 R N A i showed ectopic root hairs, when induced by 1 p M dex 92 Figure 3.20 A t M K K 6 R N A i and A t M P K l 3 R N A i showed reduction o f lateral root number when R N A i silencing was induced by 1 p M dex 93 Figure 4.1 Dicot leaf anatomy 100 Figure 4.2 Arabidopsis stomatal development (Nadeau and Sack, 2002b) 101 Figure 4.3 Stomatal clusters in too many mouths 102 i x Figure 4.4 Developmental basis o f stomatal cluster formation in tmm (Nadeau and Sack, 2002b) 103 Figure 4.5 Paired stomata in four lips (Nadeau and Sack, 2002b) 106 Figure 4.6 Guard cell function: stomatal opening and closing 108 Figure 4.7 Salt stress responses in plants and pathways that interconnect them I l l Figure 4.8 Diagram of the SOS pathway for plant Na+ response, from Zhu, J - K (2000).... 113 Figure 4.9 Salt stress activates several protein kinase pathways, the SOS3-SOS2 kinase pathway, multiple M A P K pathways and other protein kinases e.g. A T H K 1 , A S K 1 and A T G S K 1 . Modif ied from (Zhu, 2001a) 114 Figure 4.10 Diagram of S A L K T - D N A verification primer design and P C R product size.. 121 Figure 4.11 AtMPKl2 promoter-GUS activity survey throughout plant development 125 Figure 4.12 Histochemical localization o f G U S activity in AtMPKl2 130 Figure 4.13 Transverse section o f leaf from the AtMPKl2 promoter:: GUS reporter plant. .131 Figure 4.14 N a C l causes an increase in G U S activity of the AtMPKl 2 promoter: :GUS 133 Figure 4.15 N a C l causes an increase in G U S activity in leaf guard cells 134 Figure 4.16 Mannitol (5%) causes an increase in G U S activity o f the AtMPKl2 promoter::GUS reporter seedlings 135 Figure 4.17 P C R screening of AtMPKl 2 T - D N A insertional lines (SALK-074849) 136 Figure 4.18 Phenotypic analysis o f wild-type and atmpk!2 mutant plants on growth 138 LIST OF ABBREVIATIONS 2ip A B A A A P K A C C A C S ANP1/2 /3 A t A t N H X l CTR1 D E P C dex EDR1 E R K F L P G C R 1 G P A 1 G U S G M C I A A L R P M M A P K (or M P K ) M A P K K (or M K K or M E K ) M A P K K K (or M K K K or M E K K ) M B P M E K MIPS M M C M M K 3 M P S S M S N A A N A C K 1 / 2 N C N P A N P K 1 Nt NtF6 O M T K Os OST1 P IN R N A 6-(Y,y-dimethylallyl-amino) purine abscisic acid abscisic acid-activated protein kinase aminocyclopropane-1 -carboxylic acid 1-aminocyclopropane-l-carboxylic acid synthase Arabidopsis N P K l - l i k e protein kinases 1, 2 and 3 Arabidopsis thaliana Arabidopsis thaliana sodium proton exchanger 1 constitutive triple response 1 diethyl pyrocarbonate dexamethasone enhanced disease resistance 1 extracellular signal-regulated kinase four lips G protein-coupled receptor G protein a subunit p-glucuronidase guard mother cell indole-3-acetic acid lateral root primordia meristemoid mitogen-activated protein kinase mitogen-activated protein kinase kinase mitogen-activated protein kinase kinase kinase myelin basic protein M A P K / E R K kinase Munich Information Centre for Protein Sequences meristemoid mother cell Medicago M A P K 3 Massively Parallel Signature Sequencing Murashige and Skoog naphthalene acetic acid Nicotiana tabacum protein kinase 1 activating kinesin-l ike proteins 1 and 2 neighbour cell or sister cell N-l-naphthylphthalamic acid Nicotina protein kinase 1 Nicotiana tabacum Nicotina tabacum FUS3- l ike kinase 6 Oxidative stress-activated M A P triple-kinase Oryza sativa open stomata 1 pin-formed ribonucleic acid x i R T - P C R reverse transcriptase-polymerase chain reaction R N A i R N A interference S A M K stress-activated M A P kinase SDD1 stomatal density and distribution 1 S I M K salt-induced M A P kinase S I M K K S I M K kinase S IPK salicylic acid-induced protein kinase S M satellite meristemoid SOS salt overly sensitive T M M too many mouths W I P K wound-induced protein kinase X - G l u c 5-bromo-4-chloro-3 -indolyl-6eta-D-glucuronic acid, cyclohexylammomum salt x i i ACKNOWLEDGEMENTS It has been a terrific intellectual journey. I have had a great experience during my Ph.D. study at U B C with good support and many good people around me. I would l ike to thank my supervisor, Dr. Brian El l is , for his scientific guidance and ongoing support. Br ian has been the ideal research supervisor for me. He has provided me with excellent guidance, enough space to work independently and a good scientific environment. It has been a privilege to work with an inspirational scientist l ike Brian. I would also l ike to thank my supervisory committee members Dr. James Kronstad, Dr. George Haughn and Dr. Steven Pelech for their scientific advice, encouragement and feedback, especially at the beginning of my Ph.D. They gave me useful guidance at the critical step of my study on how to choose a good research project. I truly appreciate their advice on my work. Thank you to the chair of my Ph.D. examining committee, Dr. Roy Turkington, the university examiners, Dr. Carl Douglas and Dr. Geoffrey Wasteneys and the external examiner, Dr. Daphne Goring (Department of Botany, University o f Toronto) for their time to review my thesis and provide me with comprehensive feedback. Thanks to Jochen Brumm, my partner who knows my M A P K project very wel l by now, for his support, scientific discussion, feedback and encouragement for doing good work. Thanks to L iew, Cherdsak Liewlaksaneeyanawin, for his assistance with my PhD thesis preparation, scientific discussion and friendship. Thanks to Minako Kaneda for her expert assistance with the preparation of root sections. Thanks to Dr. Lacey Samuels for the microscope facility, David Kaplan for the green house facility and Sylv ia Leung for chemical ordering. Thanks to E l l i s ' lab members, Dr. Godfrey Mi les, Dr. Marcus Samuel, Dr. Mich iyo Matsuno, Dr. Rishi G i l l , A lana Clegg, JinSuk Lee, Hardy Ha l l , Corinne Cluis, Greg Lampard, Anki t Wal ia and Alexander Lane for sharing the graduate school experience with me and support me in many ways. Thanks to the directed study students, Raymond Y u and Janet Chung and also thanks to the volunteering students, Vanessa Chan and Kenny Wong for their assistance on my research project. Thanks to my U B C friends, postdocs and staff from the Department o f Botany, Agricultural Sciences and Michael Smith Laboratories and Thai friends for their support during my Ph.D. time. Thanks to the Natural Science and Engineering Research Counci l ( N S E R C ) of Canada and the Institute for the Promotion of Teaching Science and Technology (IPST) of Thailand for generous research and educational funding. Thanks to everyone in my family, especially my grandparents and my parents who always supported me for doing my Ph.D. x iv C H A P T E R 1 MAPK Gene Family in Plants 1.1 Introduction M A P K (mitogen-activated protein kinase) signaling modules play a central role in transduction of extracellular stimuli and developmental signals into cellular responses in eukaryotic cells (Widmann et al, 1999; Ligterink and Hirt, 2001; Pearson et al, 2001). The first mammalian M A P K was discovered by its ability to phosphorylate microtubule-associated protein 2 (MAP-2) in vitro upon a growth factor insulin treatment, and was named M A P - 2 kinase (Ray and Sturgill, 1987). M A P - 2 kinase was renamed a "mitogen-activated protein kinase" (Rossomando et al, 1989) when it was found to be tyrosine phosphorylated upon stimulation o f cells by a variety of mitogens (Cooper et al, 1982; Rossomando et al, 1989). This mammalian M A P K gene was cloned and found to have high homology to previously identified yeast kinases FUS3 and KSS1 (Courchesne et al., 1989; Boulton et al, 1990; E l ion et al, 1990). Since this M A P K was not only activated by mitogens, but also by many other stimuli, it was also designated E R K 1 , for extracellular signal-regulated kinase 1 (Boulton et al, 1990). One hallmark of the M A P K and FUS3 /KSS1 kinases was their ability to phosphorylate myelin basic protein, and hence the term " M B P kinases" is sometimes used to refer to this group of kinases. Soon afterward, two M A P K activators were identified, based on their ability to phosphorylate M B P kinases upon growth factor stimulation o f cells (Ahn et al, 1991). The M A P K activators were shown to phosphorylate M A P K , indicating that they were indeed upstream protein kinases (Seger et al, 1992). One M A P K activator was cloned and named M E K 1 for M A P K / E R K kinase 1, and it was found to be activated 1 through phosphorylation. (Crews et al, 1992; Crews and Erikson, 1992). After the identification of M E K s , the M E K activators, Raf-1 and M E K K 1 were identified (Kyriakis et al, 1992; Lange-Carter et al, 1993). The first indication of an evolutionarily conserved structure for M A P K cascades came from the finding that mammalian M E K K 1 and M E K had high homology to the yeast protein kinases STE11 and STE7, respectively, which function upstream of yeast M A P K s , FUS3 and KSS1 (Lange-Carter et al, 1993). This module architecture, in which activated M A P K K K s ( M E K K s ) phosphorylate, and thus activate, target M A P K K s ( M E K s ) , which in turn activate M A P K s , has been described in taxa as diverse as yeasts, worms, flies and mammals (Widmann et al., 1999). Sequencing of these genomes has also revealed that the three classes o f M A P kinases ( M A P K K K s , M A P K K s and M A P K s ) always occur as gene families. Functional analysis, which is most advanced in yeast, has demonstrated that despite their structural conservation over evolutionary time, individual gene family members generally play distinct roles, although some degree of functional redundancy is also observed (Herskowitz, 1995; Gustin etal, 1998a). In the simplest model, M A P K cascades can be viewed as linear information transmission systems. However, biochemical and genetic evidence suggests a more complex module organization in which kinases at one level within the cascade can be activated by more than one upstream effector and can, in turn, act upon more than one target (Cardinale et al, 2002). When combined with the availability o f multiple related kinases at each level, and the interaction with modifying proteins such as scaffolds (Pearson et al, 2001; Nakagami et al, 2004) and protein phosphatases (Gupta et al, 1998; Meskiene et al, 2003), this complexity creates a remarkably versatile matrix o f signaling capacities. 2 1.2 Roles of MAPK pathway components in plants Our knowledge of signal transduction in plants is less well developed than in other phyla, but there is considerable evidence for broad conservation o f signalling architecture between plants and other eukaryotic organisms. Over the past decade, a number of plant-signalling components have been isolated. Homologues o f heterotrimeric G proteins, phospholipid modifiers, protein phosphatases, receptor kinases, two-component histidine kinases and various other classes o f protein kinases have been identified in plants including members o f the M A P K K K , M A P K K and M A P K families (Mizoguchi et al, 1997; Ichimura et al, 1998a). M A P K s are proposed to be one of the convergence points in the stress- or defense-signalling network in plants (Zhang and Klessig, 2001). The regulation of M A P K pathway components occurs at multiple levels, including transcriptional, post-transcriptional, translational and post-translational levels. Evidence for transcriptional regulation of plant M A P K cascade genes has been provided through observed differences in their expression in different organs, tissue and/or cell-types, as wel l as expression changes induced by extracellular stimuli (Ligterink and Hirt, 2001; Zhang and Klessig, 2001). A n example of post-transcriptional regulation is the report of differential splicing of a single Arabidopsis N P K 1 -related protein kinase 1 (ANP1) gene, which has a high homology to Nicotiana protein kinase 1 (NPK1) gene, giving rise to two species o f A N P 1 transcripts, A N P 1 L and A N P 1 S . The activity o f A N P 1 S was greater than that o f A N P 1 L , suggesting that this molecular mechanism might be involved in modulating the activity of this protein kinase (Nishihama et al, 1997). A t the translational level, changes o f M A P K protein levels in response to pathogenic stimuli have been documented (Zwerger and Hirt, 2001). Post-translational regulation is, of course, central to regulation of M A P K cascades, since each level in the cascade is subjected to phosphorylation by its cognate 3 activator (Jonak and Hirt, 2002; Teige et al, 2004). In addition, some plant M A P K species have been shown to interact with particular upstream kinases using yeast two-hybrid assays (Ichimura et al, 1998b; Mizoguchi et al, 1998; Kiegerl et al, 2000), while genetic approaches such as transient or stable expression o f transgenes have likewise demonstrated functional relationships among specific M A P K K K s , M A P K K s and M A P K s . Beyond these better characterized examples, input stimuli o f many types have been shown to alter the activation states o f plant M A P K s , although the identity o f the responsive kinase has not always been established (Morris, 2001; Zwerger and Hirt, 2001). 1.2.1 The role of MAPK pathways in stress signaling in plants When exposed to an environmental stress, plants respond at many levels in an effort to maximize their chances of survival. M A P K pathways have been implicated in signal transduction in response to a broad variety o f such stresses (Ligterink and Hirt, 2001; Tena et al, 2001). In this chapter, the involvement of plant M A P K s in response to wounding, oxidative stress and chil l ing stress is reviewed. 1.2.1.1 Wounding signaling Wounding in plants could be the outcome of physical injury, herbivore or pathogen attack. Wounding induces a wide variety o f cellular responses, including up-regulation o f genes involved in healing and defense and M A P K pathway genes have been implicated in these wound-responses. For example, in tobacco, a protein kinase activity o f a 46 k D a protein was detected soon after cutting of the leaves (Usami et al, 1995). This 46 k D a protein was proposed to be a M A P K since (1) it could phosphorylate myelin basic protein (MBP) , an artificial substrate o f M A P K , (2) the active form of the kinase was phosphorylated on both 4 serine and/or threonine and tyrosine residue(s), and (3) it was shown to be inactivated through dephosphorylation. Transcripts of a tobacco MAPK, WIPK (wound-induced protein kinase) were shown to rapidly accumulate following wounding, a pattern that was correlated with a rapid increase in its protein activity, indicating that WIPK could be involved in the early stages of the response to the wound-stress (Seo et al, 1995; Seo et al, 1999). Similar to the tobacco WIPK, an alfalfa MAPK, SAMK (stress-activated MAP kinase), showed a rapid increase in its mRNA levels and protein activation following wounding (Bogre et al, 1997). Another tobacco MAPK, SIPK (for salicylic acid-induced protein kinase), can also be activated post-translationally by wounding (Zhang and Klessig, 1998). Unlike WIPK, however, SIPK transcript levels were not significantly changed upon wounding. Interestingly, the expression and activation of WIPK appeared to be regulated by SIPK (Samuel and Ellis, 2002; Liu et al, 2003). In Arabidopsis, another MAPK, AtMPK4, was shown to be activated by wounding as well as touch (Ichimura et al, 2000). Besides the MAPKs, the Arabidopsis MAPKK, AtMEKl, has been shown to be involved in wound-response (Morris et al, 1997). 1.2.1.2 Oxidative stress signaling When exposed to oxidative challenge, plants have to cope with increased potential for damage resulting from oxidation of proteins, lipids and nucleic acids (Baier et al, 2005). Oxidative stress in plants can be a result of the oxidative burst, a rapid release of reactive oxygen species (ROS) in plant tissues upon pathogen attack (Mehdy, 1994; Bolwell, 1996) The ROS, rapidly produced in plant cells following the perception of a range of stress signals include superoxide anion (O2), hydrogen peroxide (H2O2) and hydroxyl radical (OH) (Desikan et al, 1996). Besides pathogen-induced stress, abiotic stresses including ozone 5 exposure, UV-irradiation, wounding and mechanical stresses can induce a rapid oxidative burst (Green and Fluhr, 1995; Yahraus et al, 1995; Schraudner et al, 1996; Huang et al, 2004; Le Deunff et al., 2004). M A P K pathway genes have been implicated in signaling role(s) in oxidative stress responses. For example, AtMPK3 and AtMPK6 have been shown to be activated by H 2 0 2 (Kovtun et al, 2000), as has the alfalfa M A P K K K , OMTK1 (oxidative stress-activated M A P triple-kinase 1) (Nakagami et al., 2004). Ozone-generated ROS can induce SIPK activation in association with lesion formation in tobacco plants, and both gain-of-function and loss-of-function modification of SIPK were shown to render the transgenic tobacco plants increasingly sensitive to ROS stress (Samuel et al, 2000; Samuel and Ellis, 2002). 1.2.1.3 Low temperature stress signaling M A P K pathway genes have been implicated in signaling in response to low temperature stress. For example, Arabidopsis A t M E K K l and AtMPK3, and alfalfa S A M K , showed increased accumulation of transcripts upon exposure to low temperature (Jonak et al, 1996; Mizoguchi et al, 1996). The Arabidopsis M A P K K K , AtMAP3Kp3, also showed transcriptional up-regulation upon cold treatment (Jouannic et al, 1999). In contrast, the maize M A P K K , Z m M E K l , which is expressed in meristematic regions of growing plants, showed a decrease in its transcription level upon cold treatment of roots (Hardin and Wolniak, 1998). 6 1.2.2 The role of MAPK pathways in plant development 1.2.2.1 Cell cycle and cytokinesis in plants M A P K s have been shown to be involved in regulation o f many cell cycle events in yeasts and animals (Pages et al, 1993; Takenaka et al, 1997; Gustin et al, 1998b; Brunet et al, 1999) and evidence for similar roles in plants is beginning to appear. Plant M A P K s have been implicated in the cell cycle or cell-cycle entry based on expression correlated with specific cell-cycle stages and on gene expression and/or kinase activity in proliferating tissues. For example, transcript levels of S I M K K were low in the G l phase in alfalfa cell cultures but increased during S and G2 phases. The alfalfa M A P K , M M K 3 , and its tobacco homologue, NtF6 (for Nicotina tabacum FUS3- l ike kinase 6), have been shown to be activated in a cell cycle-specific manner. These kinases were shown to become active specifically in anaphase and telophase of the cell-cycle (Calderini et al, 1998; Bogre et al, 1999). Importantly, M M K 3 and NtF6 were shown to have a role in cytokinesis during mitosis. These kinases were immunolocalized at the phragmoplast in late anaphase, and remained localized to the cell plate during telophase. Besides M A P K s , M A P K K K s have been shown to be involved in cell division in plants. For example, the tobacco M A P K K K , N P K 1 was actively expressed in suspension cultured cells (Banno et al, 1993) and in meristematic and developing tissues (Nakashima et al, 1998). N P K 1 transcripts also increased upon induction of cell proliferation (Nakashima et al, 1998). The A N P 1 , A N P 2 and A N P 3 were also preferentially expressed in proliferating tissues (Nishihama et al, 1997). In addition, N P K 1 protein and m R N A were abundant from S to M phases during the cell cycle (Nishihama and Machida, 2000) and this protein is associated with cell-plate formation during cytokinesis (Nishihama et al, 2001). N P K 1 was 7 also shown to interact with the upstream components N A C K 1 and 2 (NPK1 activating kinesin-like proteins) in a yeast two-hybrid system (Ishikawa et al, 2002). NPK1 and N A C K 1 were co-localized at the center of the phragmoplast, as was NtF6, a downstream component of N t M E K l , indicating the involvement of these proteins in a M A P K cascade NACK1-NPK1 - N t M E K l -NtF6 associated with cell-plate formation (Zwerger and Hirt, 2001; Takahashi et al., 2004). Takahashi et al. (2004) have adopted a different nomenclature for these genes; they use NQR1 for N t M E K l , and NRK1 for NtF6. 1.2.2.2 Cell-type specific development: M A P K s appear to be involved in regulating the growth and differentiation of various plant organs, including pollen grains, root hairs, embryo, and stomata. Specific examples of these associations are discussed below. Pollen development: A few M A P K members have been implicated in pollen development. For example, Ntf4 is involved in the process of pollen germination in tobacco. Ntf4 transcripts were restricted to pollen (Voronin et al., 2001), and were actively synthesized at the late stages of pollen development. NTF4 protein activation occurred after hydration of dry pollen grains, but prior to pollen tube growth (Wilson et al, 1997). SIPK, the tobacco M A P K most closely related to Ntf4, was also expressed in pollen and was activated upon pollen hydration (Voronin et al., 2004). The tobacco M A P K K , NtMEK2, was shown to activate both SIPK (Yang et al, 2001) and NtF4 (Voronin et al, 2004). Tobacco plants expressing a loss-of-function version of NtMEK2 exhibited inhibition of germination in the transformed pollen grains suggesting that NtMEK2 may be required for pollen germination, as would be predicted i f NtMEK2 is the 8 cognate M A P K K for N T F 4 and SIPK. In addition, the tobacco M A P K s , Ntf3 and Ntf6, were found to be expressed in pollen (Wilson et al, 1993; Wi lson et al., 1997; Prestamo et al., 1999). Stomatal and early embryo development: To date, the MAPKKK gene, YODA (YDA) is the only member o f the plant M A P K gene family known to have a role in stomatal development. Arabidopsis yda mutants form clusters of guard cells in the epidermis o f the cotyledons, instead of the usual spatial distribution. Loss-of-function mutations in Y O D A led to formation o f excessive numbers of guard cells, while constitutive activation o f Y D A produced plants that completely lacked guard cells (Bergmann et al., 2004). Together these results indicate that Y D A acts as a cell-fate switch, and has a negative role in stomatal guard cell development in Arabidopsis. In addition to stomatal development, Y D A was suggested to regulate the first cell-fate decision in embryogenesis (Lukowitz et al., 2004). The loss-of-function YDA mutant zygotes were impaired in elongation and the gain-of function YDA mutants displayed suppressed embryonic development. However, other components in a YDA-conta in ing M A P K cascade remain to be discovered. 1.2.3 The role of MAPK pathways in plant hormone signaling Plant hormones play important roles in both developmental processes and stress-related responses, and it is therefore not surprising to find evidence for involvement of M A P K pathways in plant hormone signaling. In this section, evidence for M A P K signaling associated with plant hormone regulation is reviewed. 9 1.2.3.1 Auxin The plant hormone auxin regulates many growth and development processes including apical dominance, lateral root formation, root hair formation and vascular tissue differentiation (Hobbie and Estelle, 1994; Abe l and Theologis, 1996). The initial indications for a role o f protein kinases and/or phosphatases in auxin signaling came from experiments in soybean plants and pea epicotyl segments, which demonstrated an effect of auxin on overall protein phosphorylation patterns (Reddy et al, 1987; Poovaiah et al, 1988). Mizoguchi and co-workers (1994) first reported specific involvement o f a M A P K in auxin signal transduction. They demonstrated that auxin-starved tobacco B Y - 2 cells treated with the synthetic auxin, 2,4-dichlorophenoxyacetic acid (2,4-D) displayed rapid and transient activation of 46 k D a protein kinase that was capable of using myelin basic protein (MBP) as a substrate. The tobacco M A P K K K , N P K 1 , was subsequently reported to be transcriptionally up-regulated following auxin treatment (Nakashima et al, 1998). However, the ectopic expression of tobacco N P K 1 in maize protoplasts was able to inhibit auxin-induced gene expression, indicating that this kinase might negatively regulate auxin responses (Kovtun et al, 1998). In Arabidopsis protoplasts, constitutively active A N P 1 , A N P 2 and A N P 3 were shown to suppress the auxin-responsive promoter, G H 3 , indicating that A N P s may be a functional orthologue o f the tobacco N P K 1 (Kovtun et al, 2000). 1.2.3.2 Abscisic acid Abscisic acid ( A B A ) plays a role in a wide variety o f physiological processes in plants, including seed maturation and germination, stomatal regulation and responses to abiotic stresses including dehydration, high salt, osmotic stress and low temperature (Leung and Giraudat, 1998). Protein kinase signaling appears to be integral to A B A regulatory processes. 10 Two protein phosphatases belonging to the type 2C (PP2Cs) class (Leung et al, 1997) (ABI1 and ABI2) were shown by mutational analysis to be involved in regulation o f germination, stomatal closure and root growth, and both kinase and phosphatase inhibitors were shown to block ABA-mediated expression of a dehydrin gene in pea (Hey et al, 1997). A specific serine/threonine protein kinase, A A P K (for ABA-act ivated protein kinase) has been found to be involved in Ca 2 +-independent A B A signaling in guard cells o f fava bean (L i and Assmann, 1996). M A P K s have also been implicated in A B A signaling. In barley aleurone protoplasts, A B A induced a rapid and transient activation o f M A P K activity, which was identified by cross-reaction with a phospho-ERKl-speci f ic antibody (Knetsch et al, 1996). A tyrosine phosphatase inhibitor, phenylarsine oxide (PAO) , was able to block this M A P K activation, and also blocked ABA- induced gene expression (Knetsch et al, 1996). Besides A B A signaling, M A P K s have been implicated in activating A B A biosynthesis. 1.2.3.3 Ethylene The gaseous plant hormone, ethylene (C2H4), serves as an important regulator of plant physiological processes including fruit ripening, leaf and flower senescence, leaf abscission, and sex determination, as well as defense responses to various stresses and pathogen attack (Johnson and Ecker, 1998). The first evidence of a role for protein phosphorylation in ethylene signaling came from the work of Raz and Fluhr (1993), who showed that rapid protein phosphorylation was induced upon ethylene treatment o f tobacco leaves. The general kinase inhibitor K252a was able to block both this protein's phosphorylation and the ethylene-induced physiological responses. 11 M A P K s have been specifically implicated in ethylene signal transduction in plants. Mutational analysis showed that CTR1 (constitutive-triple-response 1), which encodes a protein with high homology to Raf-l ike M A P K K K , negatively regulates ethylene responses (Kieber et al., 1993). Ouaked and co-workers (2003) identified four ethylene-activated protein kinases, including one alfalfa M A P K K ( S I M K K ) , two alfalfa M A P K s ( S I M K and M M K 3 ) , as well as one Arabidopsis M A P K (A tMPK6) . These protein kinases were proposed to act downstream of CTR1 in a M A P K cascade because transgenic Arabidopsis plants ectopically over-expressing S I M K K exhibited constitutive A t M P K 6 activation, and also displayed a triple response similar to the Arabidopsis Ctrl mutant in the absence of aminocyclopropane-l-carboxylic acid ( A C C - a precursor o f ethylene biosynthesis). In addition, M M K 3 and S I M K exhibited rapid activation within five minutes o f treatment with A C C . However, L i u and Zhang (2004) recently showed compelling evidence that A t M P K 6 was not involved in ethylene signalling, but rather was involved in regulating the ethylene biosynthesis pathway. They reported that A t M P K 6 was required for ethylene induction in this transgenic system, and found that selected isoforms of 1-aminocyclopropane-l-carboxylic acid synthase (ACS) , the rate-limiting enzyme o f ethylene biosynthesis, are substrates of A t M P K 6 . Furthermore, they reported that phosphorylation o f A C S 2 and A C S 6 by A t M P K 6 led to the stabilization and accumulation o f A C S protein and, therefore, increased levels o f cellular A C S activity and ethylene production. 1.3 MAP kinase pathway components in Arabidopsis Current data collectively implicate M A P K modules as important components of signal transduction in plants, but the full scope and centrality of their participation remains unclear. The sequencing o f the Arabidopsis genome in 2001 allowed, for the first time, the description 12 of the full complement o f MAPK-encod ing genes in a plant ( M A P K Group, 2002). In Arabidopsis, more than 80 M A P K K K , at least 10 M A P K K and 20 M A P K homologues have been identified (Table 1.1). This analysis revealed that this model plant genome encodes more members of each level of M A P K cascades than any other eukaryotic species examined to date, indicating that higher plants may have evolved to place a greater reliance on this signaling modality than have other kingdoms. However, this is difficult to evaluate, since only fragmentary information is available concerning the functionality of the M A P K components encoded in the Arabidopsis genome. Screens for mutant phenotypes have identified a small number of A t M K K K genes that play important roles in specific physiological responses, including A t C T R l (Kieber et al, 1993) and A t E D R l (Frye et al, 2001). Double-mutant combinations have revealed the roles of ANP family o f Arabidopsis M A P K K K s in cell division and growth (Krysan et al, 2002). Yeast two-hybrid screens and yeast mutant complementation analysis have provided some initial insight into the roles played by the M A P K kinase kinases, A t M E K K l (Ichimura et al, 1998b), and A t A N P l , 2 and 3 (Nishihama et al, 1997). The functions of the great majority o f the 80+ A t M A P K K K s , however, remain a mystery. Interestingly, despite the extensive mutant screening carried out in Arabidopsis over the last two decades, only one M A P K mutant, Arabidopsis mpk4 (Petersen et al, 2000) and a small number o f M A P K K K mutants such as edrl and Ctrl (Kieber et al, 1993; Frye et al, 2001) have been discovered, based on phenotype. This may mean that most deficiency phenotypes are subtle and/or growth-stage specific, or that sufficient redundancy exists within the M A P K gene families to 13 Table 1.1 List of Arabidopsis M A P K signalling components, adapted from Jonak et al. (2002) Common Number* Group Number* Name members Name MAPK 20 A 3 MPK3/6/10 B 5 MPK4/5/11/12/13 C 4 MPK1/2/7/14 D 8 MPK8/9/15/16/17/18/19/20 MAPKK 10 A 3 MKK1/2/6 B 1 MKK3 C 2 MKK4/5 D 4 MKK7/8/9/10 MAPKKK 80 MEKK-like 21 MEKK1, ANP1-3, MAP3Ke1 ZIK 11 ZIK1 Raf-like 48 EDR1, CTR1 MAPKKKK 10 Ste20/PAK-like 10 -* A s predicted by analysis of the Arabidopsis genome suppress a deficiency phenotype. Alternatively, homozygous recessive mutants may not be readily recovered due to the severity of the deficiency. Routing within the Arabidopsis M A P K cascades, as in other taxa, appears to be constricted at the M A P K K level, where only ten family members occur, before expanding again to engage twenty downstream M A P K s . This pattern indicates that multiple cascade signal inputs could be converging upon the M A P K K s , which must then integrate and distribute those signals to the appropriate suite of downstream targets, most l ikely specific M A P K s or subsets of M A P K s . The activities and specificities o f M A P K K family members are thus of particular interest. Among the A t M K K s , stress response functions have been ascribed to A t M K K l and 2, which can activate A t M P K 4 (Huang et al, 2000), and to A t M K K 4 and 5, which have been shown to be able to activate A t M P K 3 and 6 (Asai et al, 2002). M K K 2 ( A t M K K 2 ) is 14 involved in mediating cold and salt stress tolerance in plants (Teige et al, 2004). A t M K K 2 has been shown to be activated by cold and salt stress and by the stress-induced M A P K kinase kinase M E K K 1 , and to directly target M P K 4 and M P K 6 in yeast two-hybrid, in vitro, and in vivo protein kinase assays. Accordingly, plants overexpressing M K K 2 exhibited constitutive M P K 4 and M P K 6 activity, constitutively upregulated expression of stress-induced marker genes, and increased freezing and salt tolerance. In contrast, mkk2 null plants were impaired in M P K 4 and M P K 6 activation and were hypersensitive to salt and cold stress. A t M K K 6 (or A N Q 1 ) appears to be actively involved in regulation of cell plate formation during cell division (Soyano et al, 2003). There is no information available concerning the behavior or function o f the remaining five A t M K K s . A t the M A P K level, a large family o f kinases is available to transmit signals from the various M A P K modules to appropriate targets within the cell. The twenty A t M A P K s cluster into four discrete structural classes ( M A P K Group, 2002), and within a cluster the protein sequences show strong similarity. Nevertheless, even closely related A t M A P K s such as A t M P K 3 , 4 and 6, appear to play different biological roles. For example, A t M P K 4 function has been shown to be essential for proper growth and development (Petersen et al, 2000), while loss-of-function mutants o f A t M P K 3 or A t M P K 6 do not display any obvious morphological phenotype (X. L i , personal communication). atmpk4 mutants are also affected in regulation of systemic acquired resistance (SAR) during the plant's response to pathogen attack (Petersen et al, 2000), but the biochemical connection between growth regulation and modulation of S A R remains unresolved. A t M P K 3 and A t M P K 6 also rapidly respond to recognition of an incompatible pathogen (Asai et al, 2002) but the interplay, i f any, between these activation events and the negative regulation by A t M P K 4 of the subsequent appearance of S A R has not been determined. A t M P K 3 and A t M P K 6 , as wel l as A t M P K 4 , are also 15 rapidly activated by a number of other biotic and abiotic stresses (Mizoguchi et al, 1996; Ichimura et al, 2000; Kovtun et al, 2000; Nuhse et a\., 2000; Desikan et al, 2001; Yuasa et al, 2001; Droil lard et al, 2002; Zhang et al, 2002), including the downstream signaling induced by binding o f the bacterial elicitor, flagellin, to the Arabidopsis F L S 2 transmembrane receptor (Asai et al, 2002). A t M P K l 3 (ANR1) appears to be involved cell plate formation during cytokinesis (Soyano et al, 2003) but its targets and specific function are unknown. Little is known about the expression o f the remaining seventeen A t M P K s , or about their biological roles. Thus, while mutant screens and similar gene-by-gene approaches have provided some valuable insights, definition of the full potential for signal transduction through M A P K cascades in Arabidopsis requires a more systematic analysis. 1.4 Thesis objectives The general objective o f this study was to gain further insight into the biological role o f the M A P K gene family in plants, and how these kinases are organized into a signaling network. Arabidopsis was used as the biological system because of its rich cell physiology and genetic resources, as well as the full description of its M A P K gene family derived from the genome sequence. These resources make it possible to link genes and their possible biological function(s) based on gene expression patterns and correlations with physiological /developmental events in Arabidopsis plants. Manipulations of gene expression can then be used to confirm hypotheses based on those correlation patterns. 16 Specific objectives: I. Systematic expression analyses of the complete array o f AtMPK and AtMKK genes, using reverse transcriptase (RT) -PCR with gene-specific primers. These data were used to select candidate genes with the most interesting expression pattern for further detailed functional characterization (Chapter 2). II. Functionally characterization o f these candidate genes through two approaches; (1) histochemical localization o f gene expression using gene-specific promoter::GUS reporter plants and (2) phenotypic analyses o f transgenic or mutant plants in which expression o f the candidate genes has been modified. The candidate genes chosen from expression profi l ing (objective 1) were AtMKK6 and AtMPKl3 (described in Chapter 3) as wel l as AtMPKl2 (Chapter 4). 17 CHAPTER 2 MAPKK/MAPK Expression Profiling in Arabidopsis 2.1 Introduction In this chapter, I have systematically explored the expression o f the entire identified Arabidopsis MAPK gene family members for AtMKK and AtMAPK genes. There were two aims to this study. First, I wanted to develop an overview of the transcription activity of these thirty genes during growth and development of Arabidopsis plants, as well as in response to a limited set o f relevant stresses. M y second aim was to identify interesting individual candidate genes for further detailed functional characterization. I anticipated that the expression survey might also reveal examples o f co-expression patterns of discrete genes in specific organ/tissue types or developmental stages. This could implicate their possible biochemical function in the same cascade. The Arabidopsis MAPK gene family members encoded in the genome have been previously identified and grouped based on their putative amino acid sequences ( M A P K Group, 2002). This study also assembled the limited data regarding function for both the Arabidopsis genes and their orthologs from other plant species. In addition, another studies assembled the available information on their biochemical properties (phosphorylation and physical interaction) (Ichimura et al, 1998b). Sequence alignment placed the putative A t M K K s into four groups (A-D), and the A t M P K s also into four groups (A-D) ( M A P K Group, 2002 and Figure 2.1). The phylogenetic grouping of the putative A t M K K s and A t M P K s , when considered together with the limited functional information, indicates that these groups may represent broad function-related modules (groups). The first such module 18 consists of group A M A P K K s and group B M A P K s , since some members of both groups appear to have functions associated with cell division. (In this thesis, I have referred to it as the cell-division module, see Figure 2.1). The second module consists of the group B M A P K K , A t M K K 3 , and group C M A P K s . In yeast two-hybrid assay, A t M K K 3 was also shown to physically interact with A t M P K l , which is a member of group C M A P K s (Ichimura et al, 1998b). There is very limited information on the function and gene expression for the gene members in this module. The third putative module consists of group C M A P K K s and group A M A P K s whose function was associated with stress response (referred to here as the stress response module). This proposed module is based on the knowledge that A t M K K 4 and A t M K K 5 , members of group C M A P K K s were shown to activate A t M P K 3 and A t M P K 6 , members o f group A M A P K s . The fourth putative module consists of group D M A P K K s and group D M A P K s , whose members' function and gene expression are completely unknown. Overall , most of the MAPK gene family members in Arabidopsis remain uncharacterized and very little experimental data are available on their gene expression and biological function. 19 Activation Group A GroupB GroupC Interaction GroupD r s r ^ r ^ r v AtMKKi° ( A t M K K l )\ A t M K K 2 J { A t M K K J ) ( AtMKKS ) ( At.YlK.K8 ) ' ^ \ l \ . ^ \ / \ \ ( At.YlKK9 ) AtYIKK4 ] / \ / \ \ J ( AtYIKK7 ) \ ^ GroupB GroupC GroupA GroupD Possible Function: Cell Division Limited Information Stress Response No Information Module Module Figure 2.1 Grouping of the M A P K K and M A P K proteins Phylogenetic grouping based on their putative amino acid sequences. The proposed functional grouping is based on functional and biochemical data for both Arabidopsis and orthologues from other species. This figure was adapted from M A P K Group (2002) and (1998b). 20 2.2 Materials and Methods 2.2.1 Plant materials and growth conditions Unless indicated otherwise, Arabidopsis thaliana (Columbia ecotype, Col-0) was grown in soil at 22-24°C under a 16-hour photoperiod. Two sets of plants were prepared for parallel tissue collection, and were harvested separately for R N A extraction. A l l the tissue samples were harvested at the indicated time points. Tissues were harvested from 8-10 different plants at 15.00-17.00, pooled, immediately frozen in l iquid nitrogen and stored at -80°C until further analysis. Leaf tissues: The rosette leaves of 21-day old plants were harvested. Bolting stem tissues: The bolting stems of 25-day old plants were harvested. Flower bud tissues: The flower buds of 25-day old plants were harvested. Root tissues: The Arabidopsis plants were grown hydroponically at 25°C under continuous light and the roots of 34-day old plants were harvested. The surface-sterilized seeds were sown on sterile rafts (Sigma M4417) floating on 100 m L of 0.5x M S (Murashige and Skoog) growth medium in Magenta boxes (6-8 seeds per box). The 0.5x M S growth l iquid medium contained 0.5x M S salts (Invitrogen), l x M S vitamins (Sigma M3900), 0.5% sucrose and 0.5 g/L M E S . The medium p H was adjusted to 5.8 and autoclaved prior to use. 21 Callus tissues: To generate callus, hypocotyls and leaf tissues from 3-week-old aseptically-grown plants were aseptically excised and cultured on callus-induction medium for 34 days. Callus induction medium contained l x M S salts (4.3 g/L), 200 mg/L glycine, l x vitamins, 10 p M naphthalene acetic acid ( N A A ) , 5 p M 6-(y,y-dimethylallyl-amino) purine (2ip), 3% sucrose, 0.3% agar and 0.1% phytagel, p H 5.6. l x vitamins contained 1 mg/L nicotinic acid, 1 mg/L pyridoxine.HCl, 1 mg/L calcium panthothenate, 1 mg/L thiamin.HCl, 0.01 mg/L biotin and 1 mg/L L-cysteine.HCl. 4-day old and 2-week old seedling tissues: Surface-sterilized seeds were sown on Vi x M S medium containing Vi x M S salts, l x M S vitamins (Sigma, Cat No . M3900), 0.5% sucrose and 0.5 g/L M E S , 0.8% phytagar, p H 5.8. The seeds were kept at 4°C in petri dishes wrapped with micropore tape and kept in the dark for 2 days and then grown at 25°C under continuous light for either another 4 days or 2 weeks before the seedlings were harvested. Secondary hypocotyl tissues: Plants were grown in soil at 22-24°C and covered with plastic and aluminum foi l during the first 10 days to induce long hypocotyls. After the plastic and aluminum foi l were removed, the plants were grown in soil at 22-24°C under 16-hour photoperiod for 3 months before the secondary hypocotyls were harvested. Leaf tissues from various developmental stages: The plants were grown in soil at 22-24°C under 16-hour photoperiod. The rosette leaf tissue was harvested at 1-week, 2-week, 3-week, 4-week and 5-week stages. 22 2.2.2 Plant treatments Two sets of plants were prepared for each treatment and each set was harvested separately for R N A extraction. The parallel control plants were grown under the same conditions and were harvested at the same time points, except that the control plants were not treated with ozone, were not wounded and were not shifted to chil l ing temperature. A l l rosette leaf samples were harvested from 8-10 individual plants, pooled, immediately frozen in l iquid nitrogen and stored at -80°C until further analysis. Ozone treatments: The ozone treatments were performed by exposing 26-day-old plants to 300 ± 50 ppb ozone continuously for 8 hours in an ozone fumigation chamber. Ozone was generated with a Delzone ZO-300 ozone generating sterilizer ( D E L Industries, San Luis Obispo, C A , U S A ) and monitored with a Dasibi 1003-AH ozone analyzer (Dasibi Environmental Corp., Glendale, C A , U S A ) . Wounding treatments: The 26-day-old plants were cut 10 times with a blade on the left and right sides of each leaf, avoiding the mid vein. The leaf-wounded plants were allowed to stand for 8 hours before the wounded leaves were harvested. Chilling treatments: The 26-day-old plants were held at 5°C for 8 hours. The rosette leaves were then harvested. 23 2.2.3 Total RNA extraction Total R N A extraction was performed using by TRIzol® Reagent according to the manufacturer 's instructions. Total R N A was isolated using a modified T R I Z O L extraction method. Approximately 1 g plant material was ground in l iquid nitrogen using a mortar and pestle, re-suspended in 15 m L T R I Z O L reagent (Invitrogen, Carlsbad C A , U S A ) , vortexed and incubated at 65°C for 5 min with regular mixing. Ce l l debris was pelleted by centrifugation for 30 min at 12,000 g and 4°C and the supernatant was extracted with 3 m L chloroform. After centrifugation for 20 min at 12,000 g, the aqueous phase was recovered and R N A was precipitated at room temperature for 5 min with 0.5 volume 0.8 M sodium citrate and 0.5 volume isopropanol. After centrifugation for 30 min at 12,000 g, the pellet was washed with 70% ethanol and re-centrifuged. The R N A pellet was air dried for 5 min and re-suspended in 200 pi RNAse-free water. Fol lowing a spectrophotometric determination of R N A concentration, the R N A was precipitated with 2.5 volumes o f ethanol and a 1/10 volume of 3 M sodium acetate at -20°C overnight, and subsequently pelleted at 12,000 g for 30 min at 4°C. The precipitate was washed with 70% ethanol, re-centrifuged, air dried and re-suspended in RNAse-free water to an approximate concentration of 1 pg R N A / p L . The actual concentration was determined spectrophotometrically. 2.2.4 RNA sample preparation for RT-PCR The fol lowing components were added to an ice-cold, RNase-free, 1.5-mL microcentrifuge tube: 3.6 pg total R N A sample, DNase I reaction buffer ( I X final concentration), 4 units DNase I and DEPC-treated water to make a final volume of 40 pL. The reaction mixture was incubated for 15 min at room temperature. To inactivate the DNase I, E D T A solution was 24 added to a final concentration o f 25 m M E D T A and the mixture was heated at 65 °C for 10 min. The resulting R N A sample was free o f genomic D N A and was ready to use in the subsequent R T reaction. 2.2.5 RT reaction (first-strand cDNA synthesis) prior to PCR The following components were added to a nuclease-free microcentrifuge tube: 4 p L (300 ng/pL) random hexaprimers, 3.6 pg DNase I-treated total R N A , 4 p L 10 m M dNTP mix (10 m M each d A T P , dGTP, dCTP and dTTP) and sterile, distilled water to make a final volume of 48 pL . The mixture was heated to 65 °C for 5 min and quickly chilled on ice. It was then briefly centrifuged and the fol lowing components were added: 16 p L 5 X first-strand buffer, 8 p L 0.1 M D T T and 4 p L (40 units/pL) RNaseOUT™ Recombinant Ribonuclease Inhibitor (Gibco B R L ) . The contents were gently mixed and incubated at 25 °C for 2 min and then 4 p L (200 units/pL) SUPERSCRIPT™ II RNase H" Reverse Transcriptase (Gibco B R L ) was added and mixed gently. The resulting mixture was incubated at 25 °C for 10 min and then at 42 °C for 50 min. The reaction was stopped by heating the sample at 70 °C for 15 min. To remove R N A complementary to the c D N A , 2 p L (2 units/pL) E. coli RNase H was added and incubated at 37 °C for 20 min. The cDNA-containing solution was stored at - 2 0 °C until used for amplification. 25 2.2.6 PCR amplification The fol lowing components were added to a sterile 1.5-mL microcentrifuge tube to prepare a master mix which contains a final concentration o f I X P C R buffer minus Mg* 4 " , 0.25 m M dNTP mixture, 1.5 m M M g C l 2 , 0.2 p M forward primer, 0.2 p M reverse primer, 0.2 p M Histone H I forward primer, 0.2 p M Histone H I reverse primer, 2 units/ 50-pL reaction Platinum® Taq D N A polymerase ( G I B C O B R L ) and sterile distilled water to make up a required volume. The master mix contents were mixed gently, centrifuged briefly and aliquoted to 0.2-mL microcentrifuge tubes. Each c D N A (RT reaction) of the same volume (< 1 pL) was then added to the individual microcentrifuge tube. The tubes were incubated in a Biometra T-gradient thermal cycler at 94 °C for 5 min to denature the c D N A template and activate the enzyme. The P C R amplification was performed 30-36 cycles as follows: denaturing at 94 °C for 1 min, annealing at 57 °C for 1 min, extending at 72 °C for 1 min. The reaction was maintained at 72 °C for 10 min after cycling and then maintained at 4 °C. The amplification products were analyzed by agarose gel electrophoresis (0.8% agarose) and visualized by ethidium bromide staining. Molecular weight D N A standards (1 Kb) were used on the same gel. A l l primer sequences for amplification o f AtMKK and AtMPK genes are presented in Table 2.1 and Table 2.2, respectively. 26 Table 2.1 AtMKK primer sequences for P C R amplification. Lower case letters represent the restriction enzyme sites. Predicted PCR Gene Gene ID Restriction Sequences (5'-3') Product Name Enzyme Site Length (bp) AtH1 At2g30602 EcoRI Xhol ccggaattccggGGTTAAAGTCAAAGCTTC I I I IAAGA ccgctcgagcggGAGTGAAGAAACCATCACATTATA 726 AtMKKI At4g26070 Xhol Xhol ccgctcgagcggATGAACAGAGGAAGCTTATGCCCTA ccgctcgagcggCTAGTTAGCAAGTGGGGGAATCAAAG 1079 AtMKK2 At4g29810 Xhol Xhol ccgctcgagcggATGAAGAAAGGTGGATTCAGCAATAA ccgctcgagcggATGGTGATATTATGTCTCCCTTGTAG 1116 AtMKK3 At5g40440 Xhol Xhol ccgctcgagcggATGGCGGCATTGGAGGAGCTAAAG ccgctcgagcggCTAATCTAAG I I IGTAATATAAAG 1587 AtMKK4 At1g51660 EcoRI EcoRI ccggaattccggGAAGAACGAATCAA I I IAAGCCTG ccggaattccggTGGGGATACATGCACCATCATAAG 1521 AtMKK5 At3g21220 Xhol Xhol ccgctcgagcggATGAAACCGATTCAATCTCCTTCTGGA ccgctcgagcggGGAAAAATGTCAGGAAAAACTACG 1134 AtMKK6 At5g56580 Bam HI Xhol cgcggatccgcgATGGTGAAGATCAAATCGAACTTG ccgctcgagcggTTATCTAAGGTAGTTAACAGGTGG 1095 AtMKK7 At1g18350 Bam HI EcoRI cgcggatccgcgATGGCTCTTGTTCGTAAACGCCGTCA ccggaattccggCTAAAGAC I I ICACGGAGAAAAGG 948 AtMKK8 At3g06230 BamHI EcoRI cgcggatccgcgATGGTTATGGTTAGAGATAATCA ccggaattccggCTATCTCTCGCTTGCTTTCTTGCGTA 906 AtMKK9 At1g73500 EcoRI EcoRI ccggaattccggATGGC I I IAGTACGTGAACGTCGTCA ccggaattccggTCAAAGATCTTCCCGGAGAAAAGGATGA 957 AtMKKI 0 At1g32320 BamHI cgcggatccgcgATGACACTTGTTAGAGAACGACGTCA 942 EcoRI CcggaattccggCTATCTGTTTTTCACAAAAGAATGACG 27 Table 2.2 AtMPK primer sequences for P C R amplification. Lower case letters represent the restriction enzyme sites. Gene Gene ID Restriction Name Enzyme Site AtMPKl At1g10210 EcoRI Xhol AtMPK2 At1g59580 BamHI EcoRI AtMPK3 At3g45640 BamHI EcoRI AtMPK4 At4g01370 BamHI EcoRI AtMPK5 At4g11330 Xhol Xhol AtMPK6 At2g43790 BamHI BamHI AtMPK7 At2g18170 BamHI EcoRI AtMPK8 At1g18150 Xhol Xhol AtMPK9 At3g18040 EcoRI EcoRI AtMPKl 0 At3g59790 BamHI EcoRI AtMPKl 1 At1g01560 BamHI Xhol AtMPKl 2 At2g46070 BamHI EcoRI AtMPKl 3 At1g07880 BamHI EcoRI AtMPKl 4 At4g36450 BamHI EcoRI AtMPK15 At1g73670 BamHI Xhol AtMPKl 6 At5g19010 BamHI BamHI AtMPKl 7 At2g01450 Xhol Xhol AtMPKl 8 At1g53510 BamHI EcoRI AtMPKl 9 At3g14720 BamHI EcoRI AtMPK20 At2g42880 BamHI Xhol Sequences (5'-3') Predicted PCR Product Length (bp) ccggaattccggATGGCGACTTTGGTTGATCCTCCTAA ccgctcgagcggTGTTACAGACACACATCAAGCTTG cgcggatccgcgATGGCGACTCCTGTTGATCCACCTAA ccggaattccggGTACAAACGTTACAGACACTTAAG cgcggatccgcgATGAACACCGGCGGTGGCCAATACA ccggaattccggCTAACCGTATGTTGGATTGAGTGCTA cgcggatccgcgATGTCGGCGGAGAGTTGTTTCGGAAG ccggaattccggAGAGATTTGATAACAAAAGCAGAG ccgctcgagcggATGGCGAAGGAAATTGAATCAGCG ccgctcgagcggTTAAATGCTCGGCAGAGGATTGA cgcggatccgcgATGGACGGTGGTTCAGGTCAACCG cgcggatccgcgTTGAGACCCATCCCCTTCAACATC cgcggatccgcgATGGCGATGTTAGTTGAGCCACCA ccggaattccggACAAGCCTTAACTTACTTAGTAACA ccgctcgagcggATGGGTGGTGGTGGGAATCTCGTCGA ccgctcgagcggCTATTAAATACAACAAATCAAACCCAA ccggaattccggATGGATCCTCATAAAAAGGTTGCA ccggaattccggTCAAGTGTGGAGAGCCGCGACC cgcggatccgcgATGGAGCCAACTAACGATGCTGAGA ccggaattccggTCAATCATTGCTGGTTTCAGGGTTGA cgcggatccgcgATGTCAATAGAGAAACCATTCTTCG ccgctcgagcggTTAAGGGTTAAACTTGACTGATTCA cgcggatccgcgATGGATTTAGTGTCTTCAAGAGATA ccggaattccggTCAGTGGTCAGGATTGAATTTGACAGA cgcggatccgcgATGGAGAAAAGGGAAGATGGAGGGA ccggaattccggTTACATATTCTTGAAGTGTAAAGA cgcggatccgcgATGGCGATGCTAGTTGATCCTCCA ccggaattccggTTAAGCTCGGGGGAGGTAATGAAGCA cgcggatccgcgATGGGTGGTGGTGGCAATCTCGTCGA ccgctcgagcggCTAAGAATTGTGTAGAGATGCAACTT cgcggatccgcgATGCAGCCTGATCACCGCAAAAAG cgcggatccgcgTTAATACCAGCGACTCATTGCAGTA ccgctcgagcggATGTTGGAGAAAGAGTTTTTCACGGA ccgctcgagcggCTATGACACTGCAGAGGAGACACCA cgcggatccgcgATGGAGTTTTTCACAGAGTATGGTGA ccggaattccggCTATGATGCTGCGCTGTAACTAATTG cgcggatccgcgATGGAGTTTTTCACTGAGTATGGTGA ccggaattccggCTAAGACATGCCATACCCAACA cgcggatccgcgATGGAGTTCTTTTCTGACTATGGCGA ccgctcgagcggCTAGTACATCTTTGACATACCGTA 1384 1363 1137 1242 1155 1393 1392 1920 1557 1206 1134 1245 1116 1110 1755 1728 1575 1836 1785 1809 28 2.3 Results and Discussion 2.3.1 Tissue differentiation of the Arabidopsis MAPKK/MAPK gene families: Characteristic profiles in mature and developing organs using RT-PCR data I initially examined whether individual members o f the Arabidopsis MAPK and MAPKK gene families were expressed in particular organs and tissues by using the R T - P C R approach. M y expression results revealed that transcripts for most of the Arabidopsis MAPK and MAPKK genes could be detected in all tissues/organs tested, although for a few members expression could only be detected in particular organs (Table 2.3 and Table 2.4), and no signal was detected for a few others. I also include the publicly available M P S S (Massively Parallel Signature Sequencing) dataset of the AtMPK and AtMKK genes (Meyers et al, 2004a; Meyers et al, 2004b) as presented in Table 2.5 and Table 2.6. M y R T - P C R data is generally consistent with the M P S S data except a few genes e.g. A t M P K l , A t M P K 8 , A t M P K l 4 and A t M K K 7 . Among the 20 Arabidopsis MAPK genes, AtMPKl 1, AtMPK12 and AtMPKB showed the greatest differentiation in expression across organ types. AtMPKl 1 expression could not be detected in bolting stems and 4-day seedlings, whereas AtMPKl2 and AtMPKl3 transcripts were found in greatest abundance in tissues that contain actively dividing cells such as callus, flowers and roots, but were barely detected in mature organs such as leaves and secondary hypocotyls (Table 2.3). These data are consistent with the report that N T F 6 , a putative tobacco ortholog of A t M P K l 3, has a role in cell division (Calderini et al, 1998). Among the 10 Arabidopsis MAPKK genes whose expression was tested by R T - P C R , the AtMKK6 gene was the only one that showed differentiation o f expression across tissue 29 types (Table 2.4). Its transcripts were detected most readily in tissues that contain young dividing cells such as callus, flowers, roots and seedlings but could barely be detected in mature tissues that were no longer growing (Figure 2.2 A). This expression pattern to a large Table 2.3 The gene expression profiles in all known Arabidopsis MAPK genes RT-PCR Groups Genes CHRJocus Signal in Different Tissues/Organs Leaves Callus Flowers Roots Stems 4-d SL 2-w SL SH AtMPK3 At3g45640 + + + + + + + + A AtMPK6 At2g43790 + + + + + + + + AtMPKl 0 At3g59790 NS NS NS NS NS NS NS NS AtMPK4 At4g01370 + + + + + + + + AtMPKl 1 At1g01560 + + + + - - + + B AtMPKl 2 At2g46070 - + + + + + - -AtMPK5 At4g11330 + + + + + + + + AtMPKl 3 At1g07880 - + + + - - - -AtMPKl At1g10210 NS NS NS NS NS NS NS NS C AtMPK2 At1g59580 + + + + + + + + AtMPK7 At2g18170 + + + + + + + + AtMPKl4 At4g36450 + + + + + + + + AtMPK8 At1g18150 NS NS NS NS NS NS NS NS AtMPKl 5 At1g73670 + + + + + + + + AtMPK9 At3g18040 + + + + + + + + D AtMPKl 7 At2g01450 + + + + + + + + AtMPKl 6 At5g19010 + + + + + + + + AtMPKl 8 At1g53510 + + + + + + + + AtMPKl 9 At3g14720 + + + + + + + + AtMPK20 At2g42880 + + + + + + + + (- ) = not detected or barely detected, (+) = detected and NS = No Signal 4-d SL = 4 days old seedlings, 2-w SL = 2 weeks old seedlings, SH = Secondary hypocotyls 30 Table 2.4 The gene expression profiles in all known Arabidopsis MAPKK genes RT-PCR Groups Genes CHRJocus Signal in Different Tissues/Organs Leaves Callus Flowers Roots Stems 4-dSL 2-wSL SH AtMKKI At4g26070 + + + + + + + + A AtMKK2 At4g29810 + + + + + + + + AtMKK6 At5g56580 - + + + - + + -B AtMKK3 At5g40440 + + + + + + + + C AtMKK4 At1g51660 + + + + + + + + AtMKK5 At3g21220 + + + + + + + + AtMKK7 At1g18350 + + + + + + + -D AtMKK8 At3g06230 NS NS NS NS NS NS NS NS AtMKK9 At1g73500 + + + + + + + + AtMKKI 0 At1g32320 NS NS NS NS NS NS NS NS (-) = not detected or barely detected, ( + ) = detected and NS = No Signal 4-d SL = 4 days old seedlings, 2-w SL = 2 weeks old seedlings, SH = Secondary hypocotyls 31 Table 2.5 The M P S S data for the AtMPK genes Expression Signal* in Different Tissues/Organs Groups Genes Leaf Callus INF Root Silique AtMPK3 341 187 151 162 61 A AtMPK6 152 190 113 347 87 AtMPKl 0 NS NS NS NS NS AtMPK4 114 169 119 175 93 AtMPKl 1 0 0 0 0 0 B AtMPKl 2 21 19 0 0 0 55 63 51 16 3 AtMPK5 19 6 2 16 12 AtMPKl 3 2 4 3 4 16 AtMPKl NS NS NS NS NS C AtMPK2 31 30 17 32 4 15 18 8 31 27 AtMPK7 10 60 65 32 63 0 0 0 3 0 0 0 0 0 0 AtMPKl 4 NS NS NS NS NS AtMPK8 36 26 115 127 114 23 58 59 2 14 AtMPKl 5 33 11 24 20 14 AtMPK9 28 29 30 15 27 D AtMPKl 7 63 117 68 1 26 AtMPKl 6 45 37 59 35 29 51 72 164 101 103 19 2 6 0 25 AtMPKl 8 24 38 68 19 10 18 8 10 6 6 AtMPKl 9 23 46 61 97 89 AtMPK20 22 22 64 120 179 15 12 51 19 80 M P S S has been described in a publication by Brenner et al. (2000). M P S S produces short sequence signatures produced from a defined position within an m R N A , and the relative abundance o f these signatures in a given c D N A library ( e.g. leaf, callus, inflorescence (INF), root, or silique c D N A library) represents a quantitative estimate o f expression o f that gene. Numbers in the same column were derived from expression data from the same sequence signature. * Specific transcripts detected per 1,000,000 total transcripts 32 Table 2.6 The M P S S data for the AtMKK genes Expression Signal In Different Tissues/Organs Groups Genes Leaf Callus INF Root Silique AtMKKI 72 46 50 4 42 A AtMKK2 0 0 0 10 0 6 0 0 0 0 AtMKK6 1 63 16 12 12 B AtMKK3 10 66 36 20 28 5 0 0 3 0 AtMKK4 5 25 10 0 0 C AtMKK5 17 14 23 14 6 10 37 25 15 11 AtMKK7 NS NS NS NS NS AtMKK8 NS NS NS NS NS D AtMKK9 34 75 19 39 21 1 26 0 2 1 3 20 0 0 13 AtMKKI 0 NS NS NS NS NS M P S S has been described in a publication by Brenner et al. (2000). M P S S produces short sequence signatures produced from a defined position within an m R N A , and the relative abundance of these signatures in a given c D N A library ( e.g. leaf, callus, inflorescence (INF), root, or silique c D N A library) represents a quantitative estimate of expression o f that gene. Numbers in the same column were derived from expression data from the same sequence signature. 33 R 4-d 2-w S L S L S H AtMKK6 Histone HI €BP QHI W M P ( H P M P B AtMPK13 Histone HI -AtMPKll Histone HI _^ Figure 2.2 R T - P C R analysis of the expression pattern o f the AtMKK6 and AtMPKl 3 genes. L = Leaves, S = Bolt ing stem, F = Flower buds, R = Roots, C = Cal lus, 4-d S L = 4 days old seedlings, 2-w S L = 2 weeks old seedlings, S H = Secondary hypocotyls A , B and C show the expression patterns of the AtMKK6, AtMPKl3 and AtMPKll genes, respectively. Histone HI was used as a control gene. The experiments were repeated giving comparable results. 34 degree parallels that seen with the AtMPKl3 gene (Figure 2.2 B) . NtMEKl and NTF6, the putative tobacco orthologs of AtMKK6 and AtMPKl3, respectively, were previously reported to be co-expressed both across plant tissues and following the induction o f cell division in leaves (Calderini et al., 2001). In addition, their yeast two-hybrid interaction analysis and in vitro kinase assays indicated that A t M E K l could act as an upstream M A P K K for N T F 6 , and that their biological functions were involved in cell division. This relationship strongly indicates that A t M K K 6 and A t M P K l 3 could operate in an analogous cascade in Arabidopsis and might play a role in cell proliferation. Similar to the AtMPKl3 gene, the AtMPKl2 gene also showed preferential expression in specific tissues/organs, which is, again, similar to AtMKK6 (Figure 2.2 C) . However, very little is known about the biological function o f A T M P K 1 2 . In my R T - P C R expression survey, I also found that AtMKK9 expression was developmentally regulated because it was differentially expressed in different tissues, and its transcriptional level was markedly higher in 2-week-old seedlings as compared with that in 4-day old seedlings (Figure 2.3 A ) . These results were confirmed by performing an expression time-course experiment with 1-week old to 5-week old Arabidopsis leaves. Again, the expression of the AtMKK9 gene was clearly increased as the leaves became mature (Figure 2.3 B) . The possible role o f the M A P K pathways in developmental processes has been studied in a variety o f plant species. The gene encoding the rice M A P K , O s M A P K 4 , was predominantly expressed in leaves of the rice plant at a late developmental stage (Fu et al., 2002), while the synthesis of the tobacco M A P K , N T F 3 , occurred at the late-bi-cellular stage of pollen maturation (Wilson et al., 1997). The transcripts o f the Arabidopsis 35 B Leaves 1W 2W 3W 4W 5W AtMKK9 Histone HI Figure 2.3 The AtMKK9 gene was differentially expressed in organs and during developmental stages. L = Leaves, S = Bolt ing stem, F = Flower buds, R = Roots, C = Callus, 4-d S L = 4 days old seedlings, 2-w S L = 2 weeks old seedlings, S H = Secondary hypocotyls 1W - 5 W = One week old plants - Five week old plants Histone HI was used as a control gene. These are the R T - P C R results. The experiments were repeated giving comparable results. 36 M A P K K , M A P 2 K a (probably A T M K K 5 ) were much more abundant in old leaves than in young leaves (Hamal et al, 1999). 2.3.2 Stress differentiation of the Arabidopsis MAPKK/MAPK gene families Transcription of several genes in the plant M A P K gene family has been reported to be induced by various abiotic stresses (Hirt, 2000; Ichimura et al., 2000; Ligterink and Hirt, 2001; Yuasa et al., 2001; Agrawal et al., 2002; Mayrose et al, 2004). In this R T - P C R survey, I also examined the effects of various abiotic stresses on the expression o f all the identified AtMPK and AtMKK genes in leaves by subjecting three-week old Arabidopsis plants to ozone, wounding and chil l ing stresses. Among the 20 AtMPK gene expression profiles in response to abiotic stresses (Table 2.7), group A AtMPK3 and AtMPK6 genes were induced in response to all abiotic stresses tested. AtMPKlO is classified in the same phylogenetic group as AtMPK3 and AtMPK6 but its expression was not detected. This result is consistent with the fact that no m R N A and E S T were found for this gene in the MIPS (Munich Information Center for Protein Sequences) database (Table 2.7). Ahlfors et al. (2004) demonstrated that AtMPK3, but not AtMPK6 responded transcriptionally and translationally during ozone exposure. Both A T M P K 3 and A T M P K 6 kinases were previously shown to be activated by ozone, wounding, hypoosmolarity, low humidity and touch (Ichimura et al, 2000; Droil lard et al, 2002; Ahlfors et al, 2004). In addition, these two proteins were constitutively activated in the Arabidopsis ssi4 mutant that accumulated H2O2 and salicylic acid prior to lesion formation (Zhou et al, 2004). H202, generated by Arabidopsis cells in response to challenge with harpin 37 (a proteinaceous bacterial elicitor) was also shown to activate A T M P K 6 (Desikan et al, 2001). Some members of the group B M A P K s classified in the cell-division module including AtMPKl 1, AtMPK12 and AtMPKB (Figure 2.1), did not change in their expression in response to the applied abiotic stresses (Table 2.7). The fact that these genes were preferentially expressed in organs containing actively dividing cells such as flowers and callus, indicates that they are more l ikely to encode proteins that function in response to plant growth and development rather than abiotic stresses. However, some other genes in this cell-division module did show a stress response, such as AtMPK4 and AtMPKS. Expression of AtMPK4 was induced by wounding, and that of AtMPK5 was up-regulated by chil l ing (Table 2.7). Additional expression data of the group B M A P K s came from previous work done by Ichimura et al. (2000) and Desikan et al. (2001). Consistent with my data, low temperature did not affect AtMPK4 expression or its protein level, but it did respond at the posttranslational level since this environmental stress induced rapid and transient activation of A T M P K 4 , as assessed by tyrosine phosphorylation on the protein (Ichimura et al, 2000). In contrast to my data, it was previously reported that wounding did not have an effect on AtMPK4 expression (Ichimura et al, 2000), nor did a bacterial elicitor, harpin and H2O2 (Desikan et al, 2001). However, publicly available data showed that the AtMPKS gene was transcriptionally induced by chitin oligomers, elicitors that can be released from fungal cell walls by endochitinase (TAIR, http://www.arabidopsis.org/). 38 Table 2.7 The gene expression profiles in all known Arabidopsis MAPK genes under different stress conditions Groups Genes CHRJocus Stress Treatments (Leaves) Ozone Wounding Chilling mRNA EST AtMPK3 At3g45640 + + + 3 25 A AtMPK6 At2g43790 + + + 2 7 AtMPKl 0 At3g59790 NS NS NS none none AtMPK4 At4g01370 0 + 0 4 1 AtMPKl 1 At1g01560 0 0 0 none none B AtMPK12 At2g46070 0 0 0 2 3 AtMPK5 At4g11330 0 0 + 1 2 AtMPKl 3 At1g07880 0 0 0 none none AtMPKl At1g10210 NS NS NS 3 1 C AtMPK2 At1g59580 0 0 0 4 2 AtMPK7 At2g18170 + + + 1 2 AtMPKl 4 At4g36450 + + 0 none none AtMPK8 At1g18150 NS NS NS 3 11 AtMPKl 5 At1g73670 0 0 0 2 2 AtMPK9 At3g18040 0 0 0 1 2 D AtMPKl 7 At2g01450 + + + none 21 AtMPKl 6 At5g19010 + + + 2 9 AtMPKl 8 At1g53510 0 0 + 3 7 AtMPK19 At3g14720 0 0 + none 6 AtMPK20 At2g42880 0 0 0 2 16 ( + ) = Changed compared to non-treated control ( 0 ) = Not changed compared to non-treated control N S = No signal m R N A and E S T data were taken from MIPS database on January 13, 2004 39 For group C M A P K genes, I found that AtMPK2 had no significant change in its expression whereas AtMPKl and AtMPK14 displayed altered transcript levels in response to the applied abiotic stresses (Table 2.7). Although for AtMPKl, I obtained no expression signal in the R T - P C R dataset, 3 R N A s and 1 E S T derived from this gene were found in the MIPS database (Table 2.7). These observations indicate that AtMPKl gene may not be responsive to some abiotic stresses but perhaps is responsive to other specific stimuli. For instance Mizoguchi et al. (1996) showed that m R N A of AtMPKl was induced by salt-stress treatment, whereas it was transcriptionally unaffected by cold stress. Among previously uncharacterized group D M A P K s , expression of the AtMPKl 7 and AtMPKl6 genes was induced by all the abiotic stresses tested, while AtMPKl8 and AtMPK19 expression was only induced by chil l ing stress. Expression of the A t M P K 9 , A t M P K l 5 and AtMPK20-encoding genes did not change when the abiotic stresses were applied (Table 2.7). I did not detect any expression signal for the AtMPK8 gene by R T - P C R , but at least 3 R N A s and 11 ESTs for this gene were found in the M IPS database (Table 2.7). Among the 10 AtMKK genes, on one hand, AtMKKI and AtMKKI expression was induced in response to wounding and chil l ing stress (Table 2.8). AtMKK6, on the other hand, showed no change in its expression in response to the specified stresses, nor did AtMKK3 (Table 2.8). M y results also showed that the structurally similar AtMKK4 and AtMKKS genes appear to have somewhat different roles, because their expression patterns could be distinguished. The AtMKK4 gene did not change its expression in response to abiotic stresses, but the AtMKK5 gene did (Table 2.8). It is, of course, possible that genes whose transcript levels were not responsive to these abiotic stresses could respond to other stimuli 40 Table 2.8 The gene expression profiles in all known Arabidopsis MAPKK genes under different stress conditions Groups Genes CHRJocus Stress Treatments (Leaves) Ozone Wounding Chilling mRNA EST AtMKKI At4g26070 0 + + 5 6 A AtMKK2 At4g29810 0 + + 4 11 AtMKK6 At5g56580 0 0 0 1 none B AtMKK3 At5g40440 0 0 0 4 2 C AtMKK4 At1g51660 0 0 0 7 7 AtMKK5 At3g21220 + + + 2 7 AtMKK7 At1g 18350 + + 0 none none D AtMKK8 At3g06230 NS NS NS none none AtMKK9 At1g73500 0 0 + 6 8 AtMKKI 0 At1g32320 NS NS NS none none ( + ) = Changed compared to non-treated control ( 0 ) = Not changed compared to non-treated control N S = No signal m R N A and E S T data were taken from MIPS database on January 13, 2004 such as biotic stresses, phytohormones and/or other chemicals. For example, a preliminary experiment showed that AtMKK4 transcription was responsive to infection by Peronospora (our unpublished data), suggesting that A t M K K 4 might play a role in biotic stress responses rather than abiotic stress response. Since H2O2 is known to be generated by Arabidopsis cells in response to exposure to ozone, my expression data for tissue response to ozone is in agreement with previous data showing that the expression of AtMKKI (AtMEKl), and AtMKK2 was not affected by H2O2 treatment (Desikan et al, 2001). A t M K K I expression in response to wounding observed in my study is consistent with a previous report of its transcriptional up-regulation upon wounding (Morris et al, 1997). However, Matsuoke et al. (2002) demonstrated that the amounts o f the A T M K K I protein did not change significantly in response to wounding and 41 other abiotic stresses including cold, drought, and high salt. A t the same time, A t M K K I did display elevated protein kinase activity. Their data also indicated that the A t M E K l becomes activated through phosphorylation and activates its downstream target, A T M P K 4 , during stress response in Arabidopsis. Ichimura et al. (1998b) showed that A T M K K 2 7 A T M K K I and A T M P K 4 physically interacted with two distinct regions of the upstream M A P K K K , A T M E K K 1 ( A t M K K K l ) protein, the N-terminal regulatory domain and the C-terminal kinase domain, respectively. Co-expression of A T M E K K 1 increased the ability o f either o f the two closely related M A P K K s , A T M K K 2 or A t M K K I , to complement a growth defect of the yeast pbs2 mutant. They suggested that A T M E K K 1 , A T M K K 2 / A T M K K I , and A T M P K 4 might therefore constitute a plant M A P kinase cascade. Very little is known about the AtMKK3, AtMKK4 and AtMKK5 gene expression in response to abiotic and biotic stresses. N o information has been published on the function of group D A t M K K s ( M A P K Group, 2002). Our data showed that some group D AtMKK genes were involved in specific abiotic stress responses. For example, the AtMKK7 gene, whose expression signal was weak in non-treated leaves, had its expression significantly induced by ozone and by wounding, whereas the expression of the AtMKK9 gene was induced specifically in response to low temperature stress (Table 2.8). Notably, neither AtMKK8 nor AtMKKlO gene expression was detectable by the R T - P C R method, which is consistent with the absence o f their m R N A and ESTs from the M IPS database (Table 2.8). 42 2.3.3 Three candidate genes with interesting expression pattern for further functional characterization 2.3.3.1 The AtMKK6 and AtMPKl3 genes From the expression profi l ing o f two classes of genes encoding putative M A P K s and M A P K K s in Arabidopsis, I identified a pair of genes, AtMKK6 and AtMPKl3, that were co-expressed in various tissues/organs containing actively dividing cells such as flowers, roots and callus under normal growth condition, and had a similar expression pattern under different environmental conditions in leaves (Figure 2.2 A and B) . Recently, A t M K K 6 was shown to functionally activate the A t M P K l 3 in yeast as the kinase activity o f A t M P K l 3 is stimulated in the presence o f A t M K K 6 in yeast cells (Melikant et al., 2004). In addition, their co-expression data was also consistent with my expression data. Significantly, N t M E K l and NtF6, tobacco orthologues o f A t M K K 6 and A t M P K l 3 , respectively, were shown to be involved in cytokinesis (Calderini et al, 1998; Calderini et al, 2001; Soyano et al, 2003). Based on my expression data together with the available functional information on their orthologues in tobacco and from the in vitro and in vivo (yeast) kinase assays, I postulated that A t M K K 6 and A t M P K l 3 may function in the same cascade involving in cell proliferation in some specific cel l- or tissue- types in Arabidopsis. Therefore, I further investigated the biological function of these two genes in planta as presented in Chapter 3. 2.3.3.2 The AtMPKl2 gene The AtMPKl2 expression pattern is particularly interesting, because it showed preferential expression in some specific tissues (Figure 2.2 C) . In addition, its expression pattern in various organs was somewhat similar to those of AtMKK6 and AtMPKl3 genes (Figure 2.2 43 A , B and C) . Notably, A T M P K 1 2 and A T M P K 1 3 have been grouped in the same functional module based on their deduced amino acid sequences ( M A P K Group, 2002 and Figure 2.1). Therefore, it seemed possible that A T M P K 1 2 could have a function similar to that o f A T M P K 1 3 in planta. To elucidate the function o f A t M P K l 2 in planta, I further characterized the AtMPKl2 gene expression and its function in detail, as presented in Chapter 4. 2.3.4 Perspectives 2.3.4.1 Expression profiling approach is useful to identify developmentally regulated and stress-responsive genes. I focused my interpretation and discussion based on only positive signals, not negative signals. The positive signal detected in various organs by R T - P C R approach is strong evidence for the actual presence of transcripts in those organs, since the identities o f the Arabidopsis MAPK and MAPKK R T - P C R products obtained as positive expression signals were confirmed by sequencing. Similarly, the R T - P C R expression survey of tissues subjected to various abiotic stresses is useful for identification o f stress-responsive genes. A s stated in the introduction in this chapter, my goals were to identify functions of the individual members o f Arabidopsis MAPKK and MAPK gene families and to detect functional cascades between these two classes o f the MAPK gene family based on expression profil ing. A s a result from the expression survey, I found that some previously uncharacterized group C AtMPK7 and AtMPK14 genes and group D AtMPKl6 and AtMPKl 7 genes are responsive to environmental stresses. In addition, I found that group D AtMKK9 is 44 involved in developmental processes. Significantly, I also found one pair of the developmentally regulated genes (AtMKK6 and AtMPKB) that potentially function in the same cascade. This grouping based on the co-expression pattern is consistent with those based on both phylogenetic grouping and the association o f their orthologues with a known function (cell-division) (Figure 2.1). However, some other genes with known physical and/or biochemical interactions could not be associated by the expression profil ing, including some of the well known pairs: A T M K K I and A T M P K 4 ; A T M K K 4 / A T M K K 5 and A T M P K 3 / A T M P K 6 (Figure 2.1). A T M K K I was previously shown to phosphorylate and physically interact with A T M P K 4 in vitro (Huang et al, 2000) as did A T M K K 4 and A T M K K 5 with A T M P K 3 and A T M P K 6 (Asai et al, 2002). Notably, the genes encoding these proteins are stress-responsive genes. Overall, my results demonstrated that expression profil ing using various tissues/organs and under various stress stimuli is informative, because it can be used to identify developmentally regulated genes and stress-responsive genes, respectively. However, this approach is limited and not sufficient for grouping the stress-responsive genes into common signaling cascades. This may be due to the fact that most o f the stress-responsive MAPK/MAPKK genes are expressed ubiquitously across many tissues/organs (Table 2.3 and Table 2.4), so that their co-expression simply cannot be distinguished in tissues/organs. In addition, expression profil ing does not provide differentiation between active and inactive forms of proteins. Some M A P K s are not regulated primarily at the transcriptional level, but rather regulated at the post-translational level through phosphorylation (Tena et al, 2001). 45 Notably, no expression signal from some of the genes, l ike AtMPKl 0, AtMKK8 and AtMKKI0, was detected in any organs and stress conditions tested by the R T - P C R approach, which is consistent with the fact that no R N A and E S T records were found in the MIPS database (Table 2.7 and 2.8). It is possible that these genes might respond specifically to certain stimuli or growth conditions or they could represent non-functional genes (pseudogenes). 2.3.4.2 Spatial and temporal expression can infer gene function in Arabidopsis It is notable that expression analysis in Arabidopsis could detect functional differentiation across different organs despite the fact that the m R N A population reflects a mixture o f cell or tissue types in each plant organ. For example, a wild-type root organ is made o f five tissue types; the outermost is epidermis, and then inside is cortex, endodermis, pericycle and vascular tissues. The abundance o f transcripts o f a cell-specific gene observed in an organ with multiple cell types cannot be assumed to demonstrate the presence of more o f those m R N A s in every cell in the organ. Rather, it may reflect the absence and presence of m R N A s or proteins in certain cell-types in a given organ/tissue. Knowledge o f the expression o f a gene in specific cells or tissues in Arabidopsis, would therefore help to infer the biological roles o f a gene product of unknown function. A useful approach to the more detailed localization of gene expression in planta employs transgenic plants carrying a gene-specific promoter fused with the ^ -glucuronidase (GUS) reporter gene. M y investigation of this is presented in the Chapters 3 and 4. 46 CHAPTER 3 Arabidopsis MAP kinase kinase 6 (AtMKK6) and MAP kinase 13 (AtMPK13) encode positive regulators of lateral root formation. 3.1 Introduction Lateral root formation is an important process for plant growth and development. Root branching greatly increases the zone o f substrates that can be exploited by the plant, and also enables re-direction of root growth in response to locally unfavorable rhizosphere conditions. Environmental and developmental signals must be integrated to determine both the frequency of lateral root initiation and the location of the lateral root primordia (LRP) along a parental root (Malamy and Ryan, 2001; Casimiro et al, 2003). In Arabidopsis, the primary root consists o f four single layers o f epidermal, cortical, endodermal and pericycle cells surrounding the vascular tissues (Figure 3.8 B and Dolan et al, 1993). The formation o f a new lateral root begins with localized renewal of cell division in pericycle cells. The resulting new lateral root primordia originate specifically from pericycle cells positioned opposite the xylem poles of the vascular cylinder (Dolan et al, 1993). In Arabidopsis, the pericycle consists o f dissimilar cell files. Those pericycle basal cells located adjacent to protoxylem poles proceed to G2 phase o f the cell cycle, whereas other pericycle cells remain in G l phase (Beeckman et al, 2001; Himanen et al, 2002). However, since L R P develop at discrete positions along the primary root, it appears that even within the file o f G2-arrested cells, only a subset is involved in lateral root initiation. It has been proposed that this localized initiation competency is established by two intersecting signals. Pericycle cells across from the protoxylem poles are "pr imed" by a radially diffusible factor, while a 47 longitudinally distributed factor subsequently triggers cell division within a subset of the "pr imed" cells (Skene, 2000). The phytohormone auxin is known to play an important role in lateral root formation (Boerjan et al, 1995; Celenza et al, 1995; Laskowski et al, 1995; Beeckman et al, 2001; Himanen et al, 2002), and is a compelling candidate as the longitudinally distributed factor that promotes the primed cells to divide. Aux in has profound effects on root growth and development (Casimiro et al, 2001; Bhalerao et al, 2002; Himanen et al, 2002), and on cell cycle activity (Stals and Inze, 2001), and it has been proposed that auxin induces lateral root initiation by cell cycle stimulation (Himanen et al, 2002). Several auxin-responsive mutants have altered lateral root initiation and emergence (Celenza et al, 1995; Casimiro et al, 2003). Normally quiescent pericycle cells in fully developed areas o f roots still maintain the ability to generate L R P s in response to exogenously applied auxin (Laskowski et al, 1995; Doernerera/ . , 1996). M A P K cascades are involved in many aspects o f growth, stress management and cell fate in eukaryotes including yeasts, mammals and plants (Widmann et al, 1999; Ligterink and Hirt, 2001; Tena et al, 2001). In plants, M A P K cascade genes have been implicated in signal transduction associated within plant development and plant hormone responses (See literature review in Chapter 1 and references therein). M y R T - P C R survey o f the expression patterns of Arabidopsis M A P K s and M A P K K s revealed that most AtMKK and AtMPK genes showed uniform expression during development but AtMKK6 and AtMPKl3 did not (Chapter 2, Table 2.3 and 2.4). These two genes were preferentially expressed in tissues and organs that contain proliferating cells, including flowers, callus and roots (Chapter 2, Figure 2.2). 48 Therefore, activity o f the products o f these genes appears to be associated with active cel l -division processes in plants. Arabidopsis A t M K K 6 and its tobacco ortholog, N t M E K l , have recently been reported to be associated with cell plate formation during cytokinesis (Calderini et al, 2001; Soyano et al, 2003), and a M A P K cascade controlling cytokinesis in tobacco cells was proposed to consist o f the tobacco N P K 1 M A P K K K (Nishihama et al, 2001), the N Q K l / N t M E K l M A P K K and the N R K 1 M A P K (Soyano et al, 2003). This " P Q R " pathway operates downstream of the kinesin-related proteins, N A C K 1 / 2 , during the late M phase o f the cell cycle in tobacco cells (Takahashi et al, 2004). Arabidopsis NACK1 and NACK2 genes are identical to HINKEL (HIK) and STUD (STD) I TETRASPORE (TES) genes, respectively (Strompen et al, 2002; Yang et al, 2003). Loss-of-function mutations in AtNACKl /HIK result in cytokinesis defects such as abnormally large cells with incomplete cell walls and multiple nuclei (Tanaka et al, 2004; Strompen et al, 2002). Plants with mutations in AtNACK2 / STD / TES exhibit cytokinesis defects during the formation of microspores (Yang et al, 2003). The tobacco N R K 1 M A P K (earlier identified as the N T F 6 M A P K (Calderini et al, 1998) is the apparent ortholog of Arabidopsis M P K 1 3 ( A t M P K l 3 ) , and N R K 1 was shown to be activated by constitutively active tobacco N Q K l / N t M E K l (Calderini et al, 2001; Soyano et al, 2003). Similarly, recombinant A t M P K l 3 was recently shown to be phosphorylated by constitutively active recombinant A t M K K 6 (Melikant et al, 2004). In this study, I investigated the hypothesis that A t M K K 6 and A t M P K l 3 activities are restricted to particular cell division phenomena. First, I analyzed the in vivo pattern of the promoter activity of AtMKK6 and AtMPKIi genes in various tissues/cells during 49 development. I also analyzed the behavior of these two promoters upon treatments with auxin and with N P A , a polar auxin transport inhibitor. To examine the loss-of-function mutant phenotype, I generated glucocorticoid-inducible A t M K K 6 R N A i mutant plants and was also able to test A t M P K l 3 R N A i mutant plants (obtained from A.Wal ia) . For this analysis, I focused specifically on lateral root formation. 3.2 Materials and Methods 3.2.1 Plant materials A l l plants used were Arabidopsis thaliana ecotype Columbia. Unless otherwise noted, seed was planted in 10-cm pots of synthetic potting soil (Redi-earth® or Terra-lite®, W.R. Grace & Co. of Canada Ltd., Ontario, Canada), watered and kept under a mist area for 3 days. The pots were then placed in the greenhouse under supplemental white lights at ambient temperature. They were watered and fertilized as needed. 3.2.2 Genomic DNA isolation Arabidopsis genomic D N A was isolated from 2-week old leaf tissue using the genomic D N A purification kit (DNeasy Plant M i n i K i t , Qiagen) according to the manufacturer 's instructions. Leaf tissue (100 mg) was ground to a fine powder under l iquid nitrogen using a mortar and pestle. The tissue powder was transferred to a Falcon tube (15 mL) and the l iquid nitrogen was allowed to evaporate. To extract the cells, 400 p L Buffer A P I and 4 p L RNase A stock solution (100 mg/mL) were added to the tissue powder and vortexed vigorously. The mixture was incubated for 10 minutes at 65 °C and mixed by inverting the tube 2-3 times during incubation. To precipitate detergent, proteins and polysaccharides, 130 pL Buffer 50 A P 2 were added to the extract, mixed and incubated for 5 minutes on ice. To remove most precipitates and cell debris, the mixture was centrifuged for 5 minutes at full speed and the supernatant was applied to a QIAshredder spin column sitting in a 2-mL collection tube. This was then centrifuged for 2 minutes at 12000 x g (Eppendorf model 5415 C) . Approximate 450 p L flow-through fraction was transferred to a new tube without disturbing the cell-debris pellet. To precipitate D N A , 1.5 volumes (675 pL) ethanol-containing Buffer A P 3 / E were added to the cleared supernatant and mixed by pipetting. A portion of the mixture (650 pL) was transferred to a DNeasy mini spin column sitting in a 2-mL collection tube and centrifuged for 1 minute at > 5300 x g The flow-through was discarded and the remaining mixture was added to the same spin column, which was centrifuged as before. The flow-through and collection tube were discarded and the DNeasy column was placed in a new 2-m L collection tube. To wash the column, 500 p L Buffer A W were added to the DNeasy column and centrifuged for 1 minute at > 5300 x g. The flow-through was discarded and the column wash was repeated with 500 p L Buffer A W . This time the DNeasy column was centrifuged for 2 minutes at maximum speed (to dry the DNeasy membrane) before being transferred to a 2-mL microcentrifuge tube. To elute the genomic D N A , 50 p L preheated (65 °C) Buffer A E was pipetted directly onto the DNeasy membrane, incubated at room temperature for 5 minutes and centrifuged for 1 minute at > 5300 x g. The D N A concentration was measured by spectrophotometry. The final yield of genomic D N A obtained from this procedure was 13.5 ng D N A / p L . 51 3.2.3 Molecular cloning of AtMKK6 or AtMPKl 3 promoter ..GUS DNA construct and generation of GUS reporter plants To examine cel l- and tissues-specific expression o f AtMKK6 and AtMPK13 genes during plant development, transgenic Arabidopsis plants harboring either an the AtMKK6 or AtMPKl3 promoter::^-glucuronidase (GUS) reporter gene construct were generated through the following procedures. 3.2.3.1 Cloning of promoters The promoter regions of the AtMKK6 and AtMPKl3 genes (740 bp and 1534 bp upstream of their translational start A T G codon, respectively) were amplified from Arabidopsis genomic D N A (obtained from Section 3.2.2) using the Expand High Fidelity P C R System K i t (Roche Molecular Biochemicals, Catalog No . 1 732 641) through a PCR-mediated method according to the manufacturer's instructions. The promoter fragment o f the AtMKK6 gene was amplified using P K K 6 F 1 and P K K 6 R 1 primers, and the promoter fragment of the AtMPKl3 gene was amplified using PK13F1 and PK13R1 primers. A l l primer sequences are presented in Table 3.1. The resulting amplicons were cloned into the pCR®2.1-TOPO® vector using a T O P O T A Cloning® K i t (Invitrogen, Carlsbad, U S A , and Catalogue No. K4500-01) and sequenced to confirm the identity and sequence accuracy of the promoters. 52 Table 3.1 Primer sequences for promoter cloning Primer Restriction Sequence (5-3') Amplified Promoter Name Enzyme Site Region Length (bp) PKK6F1 EcoRI ccggaattcGCTCTCTCTCTCTCTCTCTACAGCGAG 741 PKK6R1 BamHI cgcggatcc I I I I I I ICI I IGGI I ICTTCCTTGG PK13F1 BamHI cgcggatccGCAATTGGAGGATACATGCTTCGTGTG 1534 PK13R1 Hindlll cccaagcttCTCTTCTTTGGAAGAAGAACTCGG 3.2.3.2 Generation of promoter::GUS fusion DNA constructs The amplified P C R product of the 740 bp AtMKK6 promoter fragment was digested with EcoRI and BamHI, and ligated in the sense orientation adjacent to the GUS coding region in the promoter cloning vector, p C A M B I A 1 3 8 1 Z (CSIRO, Canberra, Australia) that had been predigested with EcoRI and BamHI. The 1534 bp promoter fragment o f AtMPKl3 was cloned in a similar way, except that the P C R product was digested with BamHI and Hindlll, and ligated into pCMBIA1381Z that had been predigested with the same enzymes. Uncut p C A M B I A 1 3 8 1 Z was used as a promoterless-GUS construct (negative control) and pCAMBIA1301 (CSIRO, Canberra, Australia) was used as a 35S promoter-Gt/S fusion construct (positive control). A schematic diagram of the p C A M B I A 1 3 8 1 Z vector, showing how a promoter region was integrated into this vector, and of the p C A M B I A 1 3 0 1 vector are presented in Figure 3.1. The ligation reactions were performed as follows: digested products were separated on a 0.8 % low-melting point agarose gel. (The amount of D N A loaded on the gel was estimated by running the D N A samples alongside a low D N A mass ladder (Invitrogen, Catalogue No . 10068-013). The digested products were then cut from the gel, the excised bands were melted at 65 °C for 10 minutes, transferred to a 37 °C heating block and the D N A samples were purified using QIAquick Ge l Extraction K i t (Qiagen, Catalogue No. 28704) 53 according to the manufacturer's instructions. The purified, digested promoter fragment was mixed with the purified digested vector in a 3:1 molar ratio and ligase reaction buffer was added to IX . One to two units of T4 D N A ligase (Invitrogen, Catalog No . 15224-041) was added and the mixture was incubated at 37 °C for 1-2 hours. The mixture was cooled to 4 °C and maintained at this temperature overnight. A portion of the ligation reaction (2 pL) was used to transform 100 p L E. coli (DH5a) competent cells (See below in the Section 3.2.7). The cell culture was then spread on kanamycin (50 mg/L)-containing L B agar plates (See below in Section 3.2.10), which had been loaded with 40 p L of 40 mg/mL X - G a l stock half an hour prior to culture plating. Positive white D H 5 a clones which grew successfully on kanamycin- and X-Gal-containing L B agar plates were screened by P C R and PCR-posit ive colonies used for plasmid D N A isolation using Wizard® Plus S V Miniprep D N A Purification System (Promega Corporation, Catalogue No. A1330). Isolated plasmides were analyzed by restriction enzyme digestion. 3.2.3.3 Transformation of Agrobacterium The AtMKK6 or AtMPKl3 promoter::GUS fusion D N A construct was introduced into Agrobacterium tumefaciens strain GV3101 by normal triparental mating (Van Haute et al., 1983). In brief, 10 p L of D N A solution were used to transfect 200 p L Agrobacterium competent cells (See below in Section 3.2.9). D N A was added to the frozen Agrobacterium competent cells in a microcentrifuge tube that was held in a 37 °C water bath for 5 minutes with occasional mixing during the incubation. To this sample, 1 m L sterile L B broth was added and the tube was shaken at 100 rpm for 3 hours at 28 °C. The cells were pelleted by 54 Figure 3.1 Schematic diagrams of p C A M B I A 1 3 8 1 Z and p C A M B I A 1 3 0 1 vectors (modified from http://www.cambia.org.au/daisy/cambia/585) 55 centrifugation for 30 seconds and the supernatant was discarded. The cell pellet was re-suspended in 1 m L sterile L B broth and 0.2 m L of this cell suspension were plated on each L B agar plate containing 25 mg/L rifampicin, 25 mg/L gentamycin and 50 mg/L kanamycin. These plates were incubated for 2 and 1/2 days at 28 °C in the dark for 2 and Vi days to allow development of transformant colonies. 3.2.3.4 In planta transformation of Arabidopsis The AtMKK6 or AtMPKl3 promoter::GUS fusion construct was delivered into wild-type Arabidopsis thaliana ecotype Columbia by the floral dip method (Clough and Bent, 1998). Brief ly, six 10-cm pots each with 6-8 Arabidopsis plants were used for plant transformation with each genotype. Six days prior to Agrobacterium floral dip the developing inflorescences were cut to induce secondary bolting and formation of many immature flower clusters. Two days before floral dip, the appropriate Agrobacterium strain was inoculated into 500 m L of L B broth, containing 25 mg/L rifampicin, 25 mg/L gentamycin and 50 mg/L kanamycin. This culture was grown for 24 hours at 28 °C with shaking at 200 rpm. The cells were then pelleted at 4000 x g for 5 minutes. The supernatant was discarded and the cells were re-suspended in 500 m L 5% sucrose containing 0.03% Silwet L-77 (Lehle Seeds, Catalogue No . VIS-01). The cell suspension was poured into an autoclavable plastic container and Arabidopsis plants that had been watered a day earlier to wet the soi l , were held upside down in the container with their inflorescences submerged in culture suspension for 3 seconds with gentle agitation. The pots were then laid on their side on a plastic tray, covered with a plastic bag, and kept overnight in the dark to maintain high humidity. The plants were then turned upright and returned to normal growing conditions. The dipped plants were not watered once siliques began to mature, and the seeds ( T l generation) were harvested when dry. 56 3.2.3.5 Selection of transformants Seeds of the T I generation were surface-sterilized by vortexing them in a solution containing 1.5 % sodium hypochlorite (Sigma, Catalogue No . 42504-4) and 0.01 % tween-20 ( B D H Laboratory Supplies, Catalogue No . P28829) and letting them sit in this solution for 20 minutes in a microcentrifuge tube. The solution was withdrawn and seeds were rinsed with sterile water five times. The surface-sterilized seeds were re-suspended in sterile, viscous 0.1 % agarose (prepared at least one day before use so it became viscous) and spread on agar-solidified M S medium plates containing 14 M S salt mix, 1% sucrose, 1 x B5 vitamins, 0.5 g/L M E S , and 0.8 % agar, p H 5.7 plus 50 mg/L hygromycin B (Invitrogen, Catalogue No . 10687-010) and 50 mg/L vancomycin hydrochloride (Sigma, Catalogue No.V2002) (Vancomycin was added to control the Agrobacterium growth). A l l the plates were sealed with 3 M Micropore™ tape (Acrona Inc., Catalogue No. 1530-0), then wrapped with aluminium foi l (dark condition) and kept at 4 °C for 2-4 days to vernalize the seeds. The plates were then placed in the growth room under 16h/8h light-dark cycle conditions at 22-24 °C. This temperature is critical to control the rapid growth o f contaminating Agrobacterium on the plant agar media. Approximately 7-10 days post-germination, the positive T I transformants displaying resistance to hygromycin B (50 mg/L) were transferred to soil for growth to mature plants. Some of the T I plant tissues were subjected to histochemical G U S staining. Plants positive for GUS expression were tagged and allowed to set seeds of the T2 generation. T2 plants were similarly analyzed for GUS expression at the young seedling stage. Final ly, detailed analysis o f GUS expression was conducted using T3 homozygous lines (AtMKK6 promoter::GUS lines 1, 2 and 6, and AtMPKl3 promoter::GUS lines 1, 2 and 6). G U S 57 activity o f T3 transgenic plants was monitored throughout plant development from 3-day to 35-day-old plants by histochemical G U S staining, using independent transformants o f each genotype. 3.2.4 Histochemical GUS assay Histochemical staining for G U S activity was performed as described previously by (Jefferson, 1987), except that all plant materials analyzed were pre-soaked in heptane for 10 minutes. The heptane was removed and the plant materials were air-dried for 5 minutes prior to incubation in a G U S reaction solution. The G U S reaction solution consisted of 0.5 mg/mL X - G l u c (5-bromo-4-chloro-3-indolyl-6eto-D-glucuronic acid, cyclohexylammonium salt) (BioVectra, Prince Edward Island, Canada) in 50 m M sodium phosphate buffer, p H 7.0, (0.5 mg X - G l u c per 10 p L N , N-dimethyl formamide was completely dissolved before adding to the sodium phosphate buffer), and 0.5 m M each potassium ferricyanide and ferrocyanide as an oxidation catalyst, and 0.1% Triton® X-100. The heptane-treated plant materials were incubated in the G U S reaction solution at 37 °C for 10-12 hours. The plant materials were then cleared as described previously by (Malamy and Benfey, 1997). In brief, both stained and unstained plant materials were transferred to small Petri dishes containing 0.24 N HC1 in 20% methanol and incubated on a 57 °C heat block for 15 minutes. This solution was replaced with 7% N a O H in 60% ethanol for 15 minutes at room temperature. Samples were then re-hydrated for 5 minutes each in 40%, 20% and 10% ethanol, and infiltrated for 15 minutes in 5% ethanol, 25% glycerol. Cleared tissues were mounted in 50% glycerol on glass microscope slides and observed under a dissecting microscope and a light microscope. 58 Images were recorded with a digital camera (Nikon coolpix 995, N ikon Inc., New York, U S A ) . 3.2.5 Resin embedding and cross-sectioning of root tissue Ten-day old Arabidopsis seedlings harboring the AtMKK6 promoter::GUS fusion or the AtMPKll promoter::GUS fusion were pre-stained for G U S activity as described in Section 3.2.4 for 10-12 hours, and then rinsed in 0.1 M sodium phosphate buffer p H 6.8. The roots were cut into small pieces, approximately 5 mm in length, on a wax plate and fixed in 2.5 % glutaraldehyde in 0.1 M sodium phosphate buffer, p H 6.8, overnight at 4 °C. The fixed root samples were then subjected to serial dehydration in 10%, 20%, 40% and 80% ethanol (about 15 minutes in each solution), while rotating slowly on a rotary shaker at room temperature, and then subjected to a final dehydration in 100% ethanol for 3 x 25 minutes, still rotating slowly at room temperature. The dehydrated samples were left in 100% ethanol at room temperature overnight. The samples were then infiltrated with Spurr's resin by passing them through a series o f resimethanol mixtures, 1:3 (25% resin), 1:1 (50% resin), 3:1 (75% resin) and twice with 100% resin solution (1 hour in each mixture). The infiltrated samples were left rotating overnight in 100% resin solution, after which the resin solution was changed with a fresh 100% resin solution. The samples were then transferred to rubber or plastic molds, submerged in resin, and arranged as desired under the dissecting microscope for cross or longitudinal sectioning. The samples were then held at 60 °C for 16 hours to polymerize the resin. The polymerized resin blocks containing embedded root samples were trimmed and sectioned (1 pm thick) and the sections were mounted on glass slides for observation and image recording on a light microscope. 59 The Spurr resin solution was prepared following a recipe from the Electron Microscopy (EM) facility o f the University o f Brit ish Columbia. For a quantity o f 50 m L , the following chemicals were mixed: 30.2 g noneyl succinic anhydride (NSA) , 11.7 g vinylcyclohexene dioxide (ERL-4206), 8.2 g diglycidylether of polypropylene glycol D E R -736 and 0.5 g dimethylamino ethanol ( D M A E ) . ( N S A was purchased from C A N E M C O Inc and ERL-4206, DER-736 and D M A E were purchased from J . B . E M Services Inc). 3.2.6 Hormone treatments Seeds from AtMKK6 promoter- and AtMPK13 promoter-GcTS reporter plants were surface sterilized (see above in the Section 3.2.3.5) and then each individual seed was placed along a line on square agar-solidified M S medium plates containing Vi M S salt mix, 1% sucrose, (without B5 vitamins), 0.5 g/L M E S , and 0.8 % agar, p H 5.7. The plates were sealed with 3 M Micropore™ tape and the seeds were vernalized at 4 °C in the dark for 2-4 days. The plates were then placed in the growth room, mounted on edge so that the seedlings could grow vertically under 16h/8h light-dark cycle conditions at 22-24 °C for 9 days. For the auxin transport inhibitor treatment, N P A (5 pM)-containing M S liquid medium (without B5 vitamins) (20 mL) was added to the 9-day old reporter seedlings, which were allowed to sit in the solution for 24 hours. The solution was then decanted from the plates. For the N P A and auxin ( IAA) treatment or control, either N P A (5 uM) / I A A (1 uM)-containing l iquid M S medium (without B5 vitamins) or the unsupplemented l iquid M S medium (without B5 vitamins), respectively, was added to the reporter seedlings for 24 hours and then decanted. Histochemical G U S assays for all control and treatments were performed (24 hours post-treatment) as described in Section 3.2.4. 60 3.2.7 E. coli (DH5a) competent cells One m L of overnight culture of E.coli strain DH5ct was transferred to a sterile 250-mL flask containing 100 m L L B broth. The culture was grown for ~2.5 - 3 hours at 37 °C, shaking at 250 rpm (O.D.550 = 0.45-0.55). The culture was chilled on ice for 30 minutes and centrifuged in sterile Oakridge tubes in a centrifuge rotor at 2500 x g for 10 minutes at 4 °C. The supernatant was then removed and the cell pellet was re-suspended by vortexing in 20 m L cold, filtered sterile Tfb I solution containing 30 m M potassium acetate, 100 m M rubidium chloride, 10 m M calcium chloride, 50 m M manganese chloride and 15 % glycerol, p H 5.8. The suspension was chilled on ice for 10 minutes and centrifuged at 2500 x g for 10 minutes at 4 °C. The supernatant was removed and the cell pellet was gently re-suspended by slowly pipetting up and down several times, in 2 m L cold, filtered sterile Tfb II solution containing 10 m M morpholinepropanesulfonic acid (MOPS) , 10 m M rubidium chloride, 75 m M calcium chloride and 15 % glycerol, p H 6.5. The suspension was chilled on ice for 10 minutes and pipetted (100 pL or 200 p L aliquots) into sterile screw-cap microcentrifuge tubes. The competent cell suspension was frozen in l iquid N 2 for 1-2 minutes and then stored at - 8 0 °C. 3.2.8 E. coli transformation Transformation of E. coli was performed according to instructions in (Sambrook et al, 1989) A microcentrifuge tube o f E. coli (strain DH5a) competent cells was removed from the - 8 0 °C freezer when needed. The cells were thawed and immediately transferred to an ice bath and stored on ice for 10 minutes. The competent cells were either kept in the same microcentrifuge tube or transferred to chilled, sterile polypropylene tubes (Falcon 2059, 17 mm x 100 mm), using chilled, sterile pipette tips, then stored on ice. D N A was added to the 61 competent cells and the tubes were swirled gently to mix their contents. The tubes were stored on ice for 30 minutes. The tubes were transferred to a 42°C water bath for exactly 90 seconds without shaking, and were then immediately transferred to ice bath to be chilled for 1-2 minutes. A n 800 p L aliquot o f L B medium containing appropriate antibiotic(s) was added to each tube and the tubes were incubated at 37 °C with shaking at 200 rpm for 45 minutes. A 200 p L aliquot of transformed competent cells was spread on each 90-mm Petri plate containing agar L B medium supplemented with appropriate antibiotic(s) and the plates were then incubated at 37 °C overnight. Colonies were observed on the plates within 12-16 hours. 3.2.9 Agrobacterium competent cells One m L of overnight culture of Agrobacterium strain GV3101 was transferred to a sterile 250-mL flask that contained 50 m L L B broth with 25 mg/L rifampicin, 25 mg/L gentamycin. The culture was shaken for -2 .5 - 3 hours at 28 °C at 250 rpm ( O . D . 5 5 0 =0.45-0.55). The culture was chilled on ice and centrifuged in sterile Oakridge tubes at 2500 x g for 5 minutes at 4 °C. The supernatant was removed, the cell pellet was re-suspended in 0.7 m L 20 m M CaCl2, and 100 p L aliquots were distributes into sterile screw-cap microcentrifuge tubes. The competent cell suspension was frozen in l iquid N2 for 1-2 minutes and then stored at - 8 0 °C. 3.2.10 Bacterial growth media L B (Luria-Bertani) broth medium contained 10 g/L Tryptone Peptone (D IFCO Laboratories Inc., Catalogue No . 211705), 5 g/L Bacto™ yeast extract (D IFCO Laboratories Inc., Catalogue No . 212750) and 10 g/L N a C l , p H 7.0. L B agar plates consisted of similar 62 contents as L B broth medium plus 15 g/L Bacto™ agar (D IFCO Laboratories Inc.). A l l the media were autoclaved for 15-20 minutes at 15 lb / square inch prior to use. 3.2.11 Arabidopsis plant growth media Unless otherwise noted, M S (Murashige and Skoog) l iquid or agar-solidified media was used as Arabidopsis growth medium. The M S liquid media contains x/i strength M S salt mix (2.15 g/L) (Sigma, Catalogue No.M5524), 1 x M S vitamins (Sigma M3900) or 1 x B5 vitamins (containing 100 mg/L myo-inositol, 10 mg/L thiamine-HCl, 1 mg/L nicotinic acid, 1 mg/L pyridoxine-HCl), 1% sucrose and 0.5 g/L M E S (2-[N-morpholino] ethanesulfonic acid (Sigma, Catalogue No. M2933), p H 5.7. The M S agar-solidified media contains half strength M S (2.15g/L), l x B5 vitamins, 1% sucrose, 0.5 g/L M E S and 0.8 % agar (Sigma, Catalogue No. A7002), p H 5.7. 3.2.12 Molecular cloning of glucocorticoid-inducible AtMKK6RNAi and AtMPK13RNAi DNA constructs and screening for the mutant plants The double-stranded R N A interference (RNA i ) constructs were made through a P C R -mediated approach. A minimal intron and the flanking regions (exon parts) o f the fifth intron of AtMPK6 were incorporated into the sense strand reverse primer ( M . Samuel and G . Mi les, personal communication). For the generation o f A t M K K 6 R N A i , the sense strand was then amplified using a primer combination that generated an Xho I cleavage site and EcoR /-splice junction loop sequence on the opposite end of the P C R product, whereas the antisense strand was amplified using a primer combination that added Spe I and EcoR I sites on the opposite end of the P C R product. A l l primers used for generation of A t M K K 6 R N A i are presented in Table 3.2. These two P C R products were directionally cloned into Xho 11 Spe /-digested 63 pTA7002 vector through triple ligation as presented in Figure 3.2, which resulted in an A t M K K 6 R N A i construct under the control o f the glucocorticoid (dexamethasone)-inducible promoter (Figure 3.3 A ) . A diagram of the inducible R N A i system is presented in Figure 3.3 B. The A t M K K 6 R N A i construct was introduced into Agobacterium and transformed to Arabidopsis plants (See Section 3.2.3.3 and 3.2.3.4). Seeds of the T l generation were germinated on M S agar plates containing 50 mg/L hygromycin B (Invitrogen, Catalogue No . 10687-010) and 50 mg/L vancomycin hydrochloride (Sigma, Catalogue No.V2002) (Vancomycin was added to control the Agrobacterium growth). The seeds were vernalized at 4 °C in the dark for 2-4 days prior to being grown under 16 h/8 h light-dark cycle conditions, at 22-24 °C (This temperature is critical to delay the growth o f contaminating Agrobacterium in T l seeds and it is an optimum temperature for growing Arabidopsis plants). Approximately 7-10 days post-germination, the positive T l transformants that displayed resistance to hygromycin B (50 mg/L) were allowed to set seeds for T2 generation. T2 plants were screened for the seedlings that showed a difference in their phenotypes when grown in the presence or absence of 1 p M dexamethasone (dex) (Sigma, Catalogue No . D4902). Five independent T2 lines were recovered and selfed to produce T3 seeds. Two of the T3 homozygous lines that displayed a strong phenotype (line 13 and line 8) were carried though for detailed phenotypic analysis. Transgenic plants containing the empty vector, pTA7002, (line 4) were used as controls. A n overview o f the procedures for generating the glucocorticoid-inducible A t M K K 6 R N A i transgenic plants is presented in Figure 3.4. In addition to my analysis o f these A t M K K 6 R N A i transgenic plants, I also carried out lateral root analysis on three independent lines o f A t M P K l 3 R N A i transgenic plants, which 64 had been generated by Anki t Wal ia under my supervision, using the same protocol as I had for A t M K K 6 R N A i plants. The primers used for generation o f the A t M K P K l 3 R N A i construct are also presented in Table 3.2. Table 3.2 Primers for the A t M K K 6 R N A i and A t M P K l 3 R N A i constructs. Lower case letters represent the restriction enzyme sites. _ _ -Construct Primer Restriction Sequence (5'-3') Product Length Name Enzyme Site (bp) AtMKK6RNAi KK6SF1 Xhol ccgctcgagATGGTGAAGATCAAATCGAACTTGAAGCA 318 KK6SR1 EcoRI + Intron ccaaaaftcCTATGAGCTGCAAAAACTACTTACCTC (A minimal intron with its flanking exons sequence) TCAGCAGTAATTTCGAAATCAAGCTCC KK6AF1 Spel ggactagtATGGTGAAGATCAAATCGAACTTGAAGCA 291 KK6AR1 EcoRI ccggaattcTCAGCAGTAATTTCGAAATCAAGCTCC AtMPKl 3RNAiK13SF1 Xhol ccgctcgagGAGATACTTAGAAGAGAGACGCTTTTCCC 441 K13SR1 EcoRI + Intron ccaaaattcCTATGAGCTGCAAAAACTACTTACCTC (A minimal intron with its flanking exons sequence) AGACTCTCTCCAGACAAGCTCCTTG K13AF1 Spel ggactagtGAGATACTTAGAAGAGAGACGCTTTTCCC 414 K13AR1 EcoRI ccggaattcAGACTCTCTCCAGACAAGCTCCTTG 65 K K 6 S F 1 K K 6 A S 1 AtMKK6 AIMKK6 K K 6 S R 1 1 Xhol EcoRI AtMKK6 |Int | 1 Spel K K 6 A R 1 EcoRI AtMKK6 Xhol Spel • Xhol EcoRI Figure 3.2 Schematic diagram describing construction of the A t M K K 6 R N A i construct frit = Intron 66 A GVG K a n R 6XUAS intron LB B -AtMKK6RNAi-'Dexamethasone (glucocorticoid) cytoplasm Targetting endogenous AtMKK6 RNA t i AtMKK nucleus ( G V G a ) — 35S GVG 6XUAS AtMKK6RNAi — Figure 3.3 Glucocorticoid-inducible A t M K K 6 R N A interference ( A t M K K 6 R N A i ) system (A) T - D N A region of the glucocorticoid-inducible A t M K K 6 R N A i D N A construct consisting o f R B , right T - D N A border; 35S promoter; G V G , glucocorticoid-inducible transcription factor; K a n R , kanamycin resistance gene; 6 X U A S , GVG-regulated promoter; A t M K K 6 R N A i D N A construct; L B , left T - D N A border. (B) A schematic diagram of dexamethasone-inducible A t M K K 6 R N A i system showing the activation of the A t M K K 6 R N A i and subsequent targeting of endogenous AtMKK6 R N A . The T - D N A is shown in the nucleus where it has integrated into the plant nuclear genome. For simplicity, the K a n R gene is omitted and the genes are shown in the left to right orientation. The G V G protein is made in the cytoplasm and retained there in an inactivated state ( G V G i ) by interaction with heat shock proteins, including hsp70 and hsp90. The binding of exogenously applied dexamethasone causes the disassociation o f hsp proteins from G V G i . G V G i is then converted into an active state (GVGa) , enters the nucleus and binds to the target promoter, 6 X U A S , allowing the transcription o f the A t M K K 6 R N A i to be initiated, which then silences endogenous AtMKK6 expression (modified from (McNel l is et al, 1998). 67 •;;^-;:Xv ::Plant;^ Start Moleojlar Cloning Transformation Screening Phenotypic Analysis 0 month 6 months 8 months 10 months 12 months ; Transformants;' Heterozygous • Homozygous • Figure 3.4 Overview of the process for generating A t M K K 6 R N A i transgenic plants 3.2.13 Phenotypic analyses and plant growth conditions For observation of the plant phenotype in young seedlings, T3 seeds of the A t M K K 6 R N A i , and empty vector (pTA7002) lines were surface-sterilized and germinated on M S agar-solidified medium plates in the absence and presence of 1 p M dexamethasone (dex). The seeds were vernalized at 4 ° C in the dark for 2-4 days prior to being grown at 22-24 ° C , under 16 h/8 h light-dark cycle conditions. On day 7, phenotypes were observed and recorded. For observation of the A t M K K 6 suppression phenotype during growth and development, five sets of the A t M K K 6 R N A i and empty vector transgenic plants were grown in soil in a growth chamber, under 16 h/8 h light-dark cycle conditions at 22-24 ° C . For set one to set five, plants were sprayed with a solution containing 25 p M dex and 0.015 % Silwet L-77 at day 7, 14, 21, 28 and 35 post-germination, respectively, and photographs were taken at day 3-7 post-treatment. This phenotypic analysis of A t M K K 6 R N A i transgenic plants grown in soil was performed with two independent T3 lines and the entire process with each set was done in duplicate. 68 3.2.14 Lateral root analysis A t M K K 6 R N A i , A t M P K l 3 R N A i and empty vector (pTA7002) transgenic seeds were surface sterilized and stratified for 4 days at 4 °C in the dark. Four seedlings were grown vertically oriented on each M S agar plate at 22-24 °C under 16 h/8 h light-dark conditions. A t day 7 post-germination, each o f two sets of the same genotype seedlings were sprayed with either a filtered sterile solution containing 1 p M dex and 0.015 % Silwet L-77 or with a control solution containing only 0.015% Silwet L-77 (no dex). Photographs were taken at day 14 post-germination. These experiments were carried out in triplicate. 3.2.15 Total RNA extraction and RT-PCR analysis Total R N A was extracted from one A t M K K 6 R N A i transgenic line (line 13, with strongest phenotype) and one empty vector line (line 4) using 10 days old seedlings, as described in Chapter 2, Section 2.2.3. For R T - P C R reactions, c D N A was synthesized from total R N A using a First-Strand c D N A Synthesis K i t (Amersham Biosciences, Catalogue No. 27-9261-01) according to the manufacturer's instructions. A total o f 1 pg R N A was added to RNase-free water to produce a final volume o f 8 p L The R N A solution was heated for 10 minutes at 65 °C and then placed on ice. Bulk first-stand reaction mix (5 uL) containing reverse transcriptase, R N A guard, RNase/DNase-free B S A , d A T P , dCTP , dGTP and dTTP in aqueous buffer, was added to the tube containing the heat- denatured R N A . One p L D T T solution (200 m M ) and 1 p L oligo dT primers (Not I-d(T)ig) (0.2 pg) were added to the reaction mix, which was mixed by pipetting up and down several times. The reaction was then incubated at 37 °C for 1 hour. 69 The resulting c D N A was employed as the amplification template. P C R was performed using JumpStart™REDTaq™ReadyMix™ (Sigma, Catalogue No . P0982) and gene-specific primers designed to target the AtMKK6, AtMKKI or AtMKK2 gene (the last two genes are closely related to AtMKK6 gene), and a control gene, Arabidopsis Histone HI (AtHl). The primers used are presented in Table 3.3. Twenty microliters of P C R mixture (a final concentration o f 0.6 units (10 pL) JumpStart™REDTaq™ReadyMix™, 1 p L first-stand c D N A , 0.1 p M each forward and reverse gene-specific primers, and forward and reverse A t H l primers) was cycled in a Biometra T-gradient thermo cycler as follows: denaturation (4 minutes, at 95°C), 32 cycles (30 seconds, at 95°C, 30 seconds at 57 °C, 2 minutes at 72 °C). The reaction was held for 10 minutes at 72°C after cycling and then maintained at 4 °C. The P C R amplification product was analyzed by 0.8 % agarose gel electrophoresis. Table 3.3 Primers used for checking gene expression o f the A t M K K 6 R N A i ( l inel3) and empty vector (line 4) plants Primer Name Sequence (5-3') PCR product size (bp) MKK1F ccgctcgagcggATGAACAGAGGAAGCTTATGCCCTA 1079 MKK1R ccgctcgagcggCTAGTTAGCAAGTGGGGGAATCAAAG MKK2F ccgctcgagcggATGAAGAAAGGTGGATTCAGCAATAA 1116 MKK2R ccgctcgagcggATGGTGATATTATGTCTCCCTTGTAG MKK6F cgcggatccgcgATGGTGAAGATCAAATCGAACTTG 1095 MKK6R ccgctcgagcggTTATCTAAGGTAGTTAACAGGTGG AtH1F ccggaattccggGGTTAAAGTCAAAGCTTC I I I IAAGA 726 AtH1R ccgctcgagcggGAGTGAAGAAACCATCACATTATA 70 3.3 Results 3.3.1 Histochemical localization of GUS activities driven by AtMKK6 and AtMPK13 promoters during plant growth and development The 5'-upstream regions o f the AtMKK6 and AtMPK13 genes were fused to the fi-glucuronidase (GUS) reporter gene and the resulting constructs were transformed into Arabidopsis plants. The patterns of G U S activity were surveyed in 3-day, 5-day, 10-day, 15-day, 27-day, and 35-day plants derived from three independent transformation events for each construct. Transgenic plants harboring p C A M B I A 1 3 8 1 Z , a promoterless-Gt/S fusion construct, were used as a negative control (Figure 3.5), and transgenic plants harboring p C A M B I A 1 3 0 1 , a 35S promoter::GUS fusion construct were used as a positive control (Figure 3.6). Root Hairs Primary Root Figure 3.5 Promoterless-GUS activity as a negative control for G U S assay. pCAMBIA1381Z-conta in ing plants showed no blue G U S staining in any plant tissues. 71 Root Hairs Primary Root Figure 3.6 35S promoter-GUS activity as a positive control for GUS assay pCAMBIA 1301-containing plants showed strong GUS staining in almost all plant tissues. 3.3.2 AtMKK6 promoter::GUS activity distribution during plant growth and development The spatial and temporal patterns of histochemical GUS activity during plant growth and development in transgenic Arabidopsis carrying the AtMKK6 promoter::GUS fusion gene, are shown in Figure 3.7. Overall, GUS activity was observed most strongly in the vascular tissue of many tissues/organs including cotyledons, hypocotyls, leaves, roots and inflorescence (Figure 3.7). No GUS staining was observed in the roots of the 3-day-old seedling (not shown) or 5-day-old seedlings (Figure 3.7 A). However, GUS activity appeared 72 Whole Plants Roots Leaves and Flowers Figure 3.7 Histochemical localization o f G U S activity in AtMKK6 promoter::GUS reporter plants through development from 3 days to 35 days. (A) 5-day-old seedlings, blue G U S staining was detected in hypocotyls (h), but was barely detected in young roots (r); (B) A 15-day-old plant, G U S staining was detected in both shoots and roots; (C) A 27-day-old plant, G U S staining was mainly detected in shoots, not roots; (D) A primary root from a 5-day-old seedling showing no G U S staining; (E) Lateral roots (lr) emerged from a primary root (pr) from a 10-day-old plant, G U S staining was detected along the primary root region where lateral roots emerged and also at columella cell area (co); (F) Roots and leaves from a 27-day-old plant; (G) Light microscopic view of a cotyledon from a 5-day old seedling showing G U S staining in vascular tissue (vt); (H) Light microscopic view of a leaf from a 10-day-old seedling showing G U S staining in trichome bases (tb) and in vascular tissue (vt); (I) A cluster o f flowers from a 35-day-old plant; G U S staining is shown in blue. In B and E, asterisks indicate adventious root primordia or emerged lateral roots from a primary root. Scale bars are located at the bottom left o f each picture. Black and white bars = 2 mm, red bars = 0.2 mm. 73 in the vascular cylinders of the older roots of 10- and 15-day-old seedlings (Figure 3.7 E and B, respectively). G U S staining in the roots was most prominent at the sites o f lateral root emergence in 10-day- and 15-day-old seedlings (Figure 3.7 E and B, respectively). In addition, strong G U S activity was observed in the bases o f trichomes on leaves from 10-day-old seedlings (Figure 3.7 H). B y 27 days, the G U S activity in primary roots had almost entirely disappeared (Figure 3.7 F). However, in leaves, strong G U S activity still remained in the vascular tissue after 27 days (Figure 3.7 F). A t 35 days, only weak G U S activity could be detected, restricted to the floral tissues (Figure 3.7 I) and siliques (not shown). 3.3.3 The AtMKK6 promoter activity and lateral root formation Histochemical G U S staining of root cross-sections from 10-day-old seedlings confirmed the vascular-specific expression pattern of the AtMKK6 promoter in roots (Figure 3.8 A ) . In primary roots, G U S staining was highest at sites along primary roots where new lateral roots were formed (Figure 3.8 A ) , and was also detected in the vascular tissue o f newly emerged lateral roots. Transverse sections o f roots revealed that the AtMKK6 promoter drove G U S activity not only in the central vascular cylinder, but also in the layer o f pericycle cells surrounding the vascular cylinder in primary roots (Figure 3.8 B and C). No G U S activity was detected in other cell types, such as the epidermal, cortical and endodermal cells in roots (Figure 3.8 B and C) . 74 Figure 3.8 Detailed examination of 10-day old seedlings of AtMKK6 promoter:.GUS reporter plants. (A) A root; (B) A transverse section of a primary root at the vicinity of lateral root formation and (C) A transverse section of a primary root at the site where a lateral root emerged, ep = an epidermal cell layer, c = a cortical cell layer, en = an endodermal cell layer, p = a pericycle cell layer. GUS staining is shown as blue. Red bars = 0.02 mm 75 3.3.4 AtMPKl3 promoter: :GUS activity throughout plant growth and development The spatial and temporal patterns o f histochemical G U S activity during plant growth and development in transgenic Arabidopsis carrying the AtMPK13 promoter::GUS fusion gene are shown in Figure 3.9. G U S activity appeared strongly in vascular tissue of shoots o f 3-day-old seedlings (not shown) as wel l as in seedlings from 5-day-old to 35-day-old (Figure 3.9 A - E ) . In the root tips, G U S staining was confined to the collumella cells o f the root cap and elongation zone, but was not observed in the apical meristem zone in which cell division occurs (Figure 3.9 K and L) . A s in the shoots, strong G U S staining was also observed in vascular tissue o f roots of almost all ages (Figure 3.9 A - D , F, H , I, and K ) . In 35-day-old plants, AtMPK13 expression was clearly associated with lateral root formation, although overall G U S staining in roots was substantially diminished at this point (Figure 3.9 E and J). Similar to the G U S activity pattern observed in the AtMKK6 promoter::GUS reporter plants (Figure 3.7 E), G U S activity in the AtMPK13 promoter::GUS reporter plants appeared most strongly at sites along primary roots where lateral root primordia were formed in 10-day-old seedlings (Figure 3.9 G) , 15-day old seedlings (not shown) and 27-day-old seedlings (Figure 3.9 I). In addition, the G U S staining was detected in the trichomes o f both leaves and stems (Figure 3.9 O) and was observed in a ring of cells at the bases o f leaf trichomes (Figure 3.9 N) . In flowers, G U S staining was clearly observed in the pistil (Figure 3.9 Q), and in the vascular tissue of inflorescence stems and sepals, but not in the vasculature of the petals (Figure 3.9 P). G U S staining was also found in stamen filaments but not in anthers (Figure 3.9 R) . In siliques (fruits), G U S staining was detected in the placenta (Figure 3.9 S and T). 76 Whole plants Roots Roots and Leaves Flowers and Siliques Figure 3.9 Histochemical localization of G U S activity in AtMPK13 promoter::GUS reporter plants through development from 3 days to 35 days. (A) 5-day-old seedlings; (B) A 10-day-old seedling; (C) A 15-day-old plant; (D) A 27-day-old plant; (E) A 35-day-old plant; (F) A primary root from a 10-day-old seedling; (G) A lateral root (Ir) emerged from a primary root (pr) from a 10-day-old seedling; (H) Light microscopic view of an emerged lateral root (Ir) from a primary root (pr); (I) Roots from a 27-day-old plant; (J) Roots from a 35-day-old plant; (K) A root tip including root cap (rc), apical meristem (am) and elongation zone (ez); (L) G U S staining at columella cells (co) of a root tip from a 27-day-old plant; (M) A view of the vascular tissue (vt) o f a cotyledon from a 10-day-old seedling; (N) A view of a trichome on a leaf from a 10-day old seedling, G U S staining is shown in a trichome base (tb) and vascular tissue (vt); (O) Trichomes (tc) o f leaves and of leaf stems from a 27-day-old plant; (P) A cluster o f flowers showing G U S 77 staining in inflorescence stem (is), in styles (s) and in sepals (se); (Q) A developing silique or a pistil consisting of stigma (st), a style (s) and an ovary; (R) A pistil and stamens, G U S staining is shown in vascular tissue o f stamen filaments (fi), but not in anthers (an) o f stamens; (S) A mature silique from a 3 5-day-old plant, p = placenta, s = style; (T) A close-up view of a mature silique showing five ovules (o) attached to the placenta (p); s = style; Asterisks indicate adventious root primordia or emerged lateral roots from primary roots; G U S staining is shown in blue. Black bars = 2 mm, white bars = 0.2 mm, red bars = 0.02 mm -740 bp -490 (+ strand) +1 A T G 5' 3' AtMKK6 coding region A u x R E P S I A A 4 Figure 3.10 Schematic illustration showing the location o f the putative auxin-responsive sequence A u x R E P S I A A 4 in the AtMKK6 promoter region (740 bp). AtMKK6 promoter sequence analysis (Higo et al, 1999) revealed the presence of a putative auxin-responsive element, A u x R E P S I A A 4 ( K G T C C C A T ) (Ballas et al, 1993) at nucleotide position -490 , (+ strand). 78 3.3.5 AtMKK6, auxin and lateral root formation Aux in is known to affect lateral root formation, probably by establishing a population o f rapidly dividing pericycle cells (Laskowski et al, 1995). Developing lateral root primordia are thought to receive the endogenous auxin indole-3-acetic acid ( IAA) through directed (polar) auxin transport (Reed et al, 1998). Polar auxin transport depends on the asymmetric localization in plant cell membranes o f a protein called P I N - F O R M E D (PIN), which is an auxin transport facilitator (Galweiler et al, 1998). The direction o f polar auxin transport varies depending on where P IN proteins are localized in plant cell membranes. For example, in the central part of roots, P IN proteins are localized in the cellular basal membranes and auxin f low is directed downward. There is contradictory evidence concerning the direction o f the polar auxin transport associated with lateral root formation. In roots, it has been proposed that plants use the polar auxin transport to move I A A from the base o f root toward the root tip v ia the central cylinder (acropetal) and from the root tip toward the root-shoot junction via the epidermal and cortical cells (basipetal) (Rashotte et al, 2000). N-1-naphthylphthalamic acid (NPA), a polar auxin transport inhibitor, blocks acropetal polar transport of shoot-derived I A A , causing a reduction in I A A level in root and the arrest o f lateral root emergence (Reed et al, 1998). In contrast to the conclusions o f Reed et al, 1998, it has also been shown that N P A blocks basipetal I A A movement from root tip, while also arresting lateral root formation (Casimiro et al, 2001). I confirmed that N P A caused diminished lateral root formation (Figure 3.11). I also observed that the AtMKK6 promoter contains a putative auxin-responsive element, A u x R E P S I A A 4 ( K G T C C C A T ) (Ballas et al, 1993) at nucleotide position -490 , (+ strand) (Figure 3.10), suggesting that auxin might be a regulator o f AtMKK6 expression. To clarify AtMKK6/auxin/ lateral root formation relationship, I 79 performed two experiments; blocking and adding auxin to the AtMKK6 promoter::GUS seedlings. - N P A +NPA • 'i / ( * i \ X '•' \ . . . . . v / S i r A I —m 1 V B i Figure 3.11 N P A effect on lateral root formation in 17-day-old wild-type Arabidopsis seedlings (A) Lateral roots of plants grown on the unsupplemented M S agar medium (B) Diminished lateral root formation in plants grown on M S agar medium containing 5 p M N P A . White bars =10 mm. 80 3.3.6 Blocking polar auxin transport with NPA reduces AtMKK6 promoter: :GUS activity. I grew AtMKK6 promoter::GUS seedlings for 10 days and treated them with and without N P A for 24 hours, before analyzing them for G U S activity. A s observed previously, plants grown in the absence of N P A showed strong G U S activity in the vascular tissue o f the primary roots, with the most intense staining at the sites where lateral roots were formed (Figure 3.12). In contrast, roots on plants grown in the presence o f N P A showed a substantial reduction in G U S activity, accompanied by lower numbers of lateral roots (Figure 3.12). - N P A +NPA Figure 3.12 N P A (5 pM) effect on G U S activity in 10-day-old AtMKK6 promoter:.GUS reporter seedlings. Arrows indicate primary root sites from which lateral roots emerged. A black bar = 0.2 mm. 8 1 3.3.7 Auxin can reverse the block of AtMKK6 promoter::GUS activity by NPA in both vascular tissue and pericycle cells. I have demonstrated in the previous sections that the pattern o f G U S activity driven by AtMKK6 promoter is associated with lateral root formation and that application o f N P A , an auxin transport inhibitor, produces a reduction in the AtMKK6 promoter activity. I hypothesized that optimal levels of auxin could positively regulate the transcriptional control o f the AtMKK6 gene and that optimal levels of A t M K K 6 , in turn, could control lateral root development. This hypothesis predicted that co-treatment with N P A and I A A would restore both G U S activity in roots and lateral root development o f AtMKK6 promoter:.GUS reporter plants. To test this hypothesis, I grew AtMKK6 promoter::GUS seedlings for 9 days and treated them with N P A alone and N P A together with I A A for 24 hours before subjecting to G U S activity assay. Roots o f plants grown in the presence o f N P A alone showed only weak G U S activity in vascular tissue. Strikingly, G U S staining was absent from the pericycle cell layer in primary roots and diminished in almost all dividing pericycle cells o f L R P . This pattern was associated with the contribution of fewer pericycle cells to the L R P , leading to an abnormal L R P shape (Figure 3.13 A and B) . B y contrast, roots o f plants grown in the presence of both N P A and I A A showed a substantial level of G U S activity in vascular tissue, and in both inactive pericycle cells and actively dividing pericycle cells o f L R P , which also had a normal L R P shape (Figure 3.13 C-F) . Closer examination of the AtMKK6 promoter::GUS activity in NPA/IAA-treated roots revealed that the restored G U S activity was localized not only in the root vascular tissue, but also in the pericycle cell layer of primary roots (Figure 3.13 C, D and E). Moreover, G U S staining in the L R P was concentrated in the actively dividing pericycle cells in L R P at the early stage of the lateral 82 root initiation (Figure 3.13 E, C and D in stages V , V I and VIII, respectively, according to Malamy and Benfey 1997 and Casimiro et al, 2003). These results indicate that exogenous auxin can overcome the block of AtMKK6 promoter::GUS activity by N P A in vascular tissue, and in both inactive pericycle cells and actively-dividing pericycle cells. The increased G U S activity in the NPA/IAA-treated roots was correlated with a substantial increase in lateral root numbers. Roots treated with N P A alone had 3-4 primordia per seedling but roots treated with N P A and I A A had 10-22 primordia/lateral roots per seedling. Notably, only early stage primordia were detected in the NPA-treated roots (Figure 3.13 A and B) , whereas both early stage primordia and fully developed lateral roots were detected in the NPA/IAA-treated roots (Figure 3.13 C-F) . The expression pattern of the GUS gene directed by the AtMKK6 promoter changed dramatically when the young primordia continued to form fully developed lateral root organs (Figure 3.13 F). This observation is consistent with the known organization o f specialized cells and tissues during lateral root development (Malamy and Benfey, 1997). In fully developed lateral roots, G U S staining was localized in vascular tissue and in the root cap cells, but not in the meristematic zone of lateral roots, even though this is also a site o f frequent cell-division (Figure 3.13 F). Notably, the G U S staining pattern in mature lateral roots o f AtMKK6 promoter:.GUS seedlings (Figure 3.13 F) was similar to that in mature lateral roots o f AtMPKl3 promoter::GUS seedlings (Figure 3.9 K ) . Together, these data indicate that A t M K K 6 and A t M P K l 3 are l ikely to be specifically involved in cell-division of pericycle cells during L R P initiation in lateral root formation. 83 +NPA Figure 3.13 Histochemical localization of G U S activity in lateral root primordia (LRP) and lateral roots o f A t M K K 6 promoter::GUS reporter seedlings, upon N P A (5 p M ) treatment and co-treatment of N P A (5 pM) and I A A (1 pM) . (A) and (B) L R P in the presence of N P A alone, G U S staining is shown to be faint in vascular tissue (vt) and absent in pericycle cell layer (p) o f the primary roots; (C), (D), (E) L R P in the presence of both N P A and IAA . G U S staining is shown in vascular tissue, in pericycle cell layer (p) o f primary roots and in actively dividing pericycle cells of L R P ; (F) A ful ly developed lateral root (lr) emerged from a primary root (pr). G U S staining is shown in cells of root cap and in vascular tissue (vt) o f both lateral and primary roots; vt = vascular tissue, ep = epidermis, c = cortex, en = endodermis and p = pericycle; Asterisks indicate location o f pericycle cell layer. G U S staining is shown as green/blue. 84 3.3.8 AtMPK13 and auxin The AtMPK13 promoter was found to contain two putative auxin-responsive elements, AuxRR-core (GGTCct t and GGTCcc t ) (Sakai et al, 1996) at nucleotide position -893 , (+) strand and -330 , (-) strand, respectively (Figure 3.14). Similar to the pattern observed in the AtMKK6 promoter::GUS seedlings, the AtMPKl3 promotery.GUS seedlings showed a dramatic decrease in G U S activity in actively-dividing pericycle cells of L R P upon N P A treatment (Figure 3.15 A ) . However, in contrast to AtMKK6 promoter::GUS seedlings, G U S staining of AtMPKl 3 promotery.GUS seedlings remained strong in inactive cells of pericycle layer upon N P A treatment (Figure 3.15 A ) , indicating that N P A cannot block the activity of AtMPKl3 promoter in these non-dividing cells. The diminished G U S activity resulting from N P A treatment was associated with abnormal growth o f L R P s , which contained fewer cells (Figure 3.15 A ) . AtMPK13 promoter::GUS staining was restored in actively dividing pericycle cells when the seedlings were co-treated with both N P A and I A A . (Figure 3.15 B to E) , and an increased number o f new lateral root primordia were also observed (Figure 3.15 C) . -1534 bp -897 (+strand) -330 (-strand) +1 A T G , i 5' , 1 1 AtMPKl 3 coding region AuxRR-core Figure 3.14 Schematic illustration showing the location o f two putative auxin-responsive sequences AuxRR-core in the A t M P K l 3 promoter region (1534 bp). The A t M P K l 3 promoter sequence analysis (Lescot et al., 2002) revealed the presence of a putative auxin-responsive element, AuxRR-core (GGTCct t and GGTCcc t ) (Sakai et al., 1996) at nucleotide position -893, (+) strand and -330 , (-) strand, respectively -490. 85 + N P A + N P A , +IAA + N P A , +IAA Figure 3.15 Histochemical localization of AtMPKH promoter::GUS activity in L R P s and lateral roots from 13-day-old reporter seedlings, upon treatment o f N P A alone (5 pM) and co-treatment o f N P A (5 p M ) and I A A (1 pM) . (A) and (B) A lateral root primordium in the presence of N P A alone and in the presence of both N P A and I A A , respectively. (C) to (F) Different stages of lateral root development emerged from a NPA/IAA-treated roots. Arrowheads indicate L R P . White bars = 0.2 mm. G U S staining is shown as green/blue. 86 3.3.9 Phenotypic analysis of AtMKK6RNAi transgenic plants To further investigate the biological function of A t M K K 6 in plants, and to specifically ask whether the AtMKK6 gene product is required for lateral root development, I generated loss-of-function AtMKK6 mutant plants using a glucocorticoid-inducible R N A interference (RNA i ) system. In this inducible R N A i system, the silencing mechanism can be induced by application o f low levels o f dexamethasone, a glucocorticoid hormone analogue (Figure 3.3 B). Transgenic seedlings of the T2 generation were screened for positive transformants by growing them in the absence and presence of 1 p M dexamethasone (dex). Positive transformants displayed an abnormal phenotype on dex-containing media, whereas the same genotypes grown in the absence of dex showed a phenotype similar to that o f empty vector lines grown in the same growth conditions. Five A t M K K 6 R N A i lines were recovered in this process, all o f which showed a similar "hairy" phenotype with various degrees o f abnormality when induced with dex. Two lines with the strong abnormal phenotype were used for further detailed analysis. I used R T - P C R to examine AtMKK6 transcript levels in the A t M K K 6 R N A i mutant (line 13) that displayed strongest phenotype to determine the specificity o f the gene silencing. The abundance o f the AtMKK6 transcripts in the A t M K K 6 R N A i plants was - 2 3 % decreased when the R N A silencing was induced by dexamethasone (Figure 3.16), whereas the abundance of the transcripts of AtMKKI and AtMKK2, which share high sequence homology to AtMKK6, was not significantly changed by dex treatments (data not shown). 87 A t M K K 6 R N A i - dex + dex AtH1 AtMKK6 Figure 3.16 R T - P C R analysis showing a - 2 3 % reduction in the AtMKK6 transcript level in 10-day-old A t M K K 6 R N A i seedlings (line 13) when the gene silencing was induced by 1 p M dexamethasone (dex) treatment as compared to that without dex treatment (control). AtMKK6 gene-specific primers and Arabidopsis histone H I (A tH l ) primers, a control for equal sample loading, were used. The experiments were done in duplicate. The expression signals for both AtMKK6 and AtHl genes were quantified and AtHl expression signals were used for normalization. 8 8 A s expected, lateral root development was negatively affected in dex-inducible A t M K K 6 R N A i plants. A tMKK6RNAi -suppressed seedlings showed a 82 % reduction in lateral root numbers (Figure 3.20). Interestingly, root hair development was also strongly affected in dex-inducible A t M K K 6 R N A i plants. A t M K K 6 R N A i seedlings grown on plant growth media in the presence of 1 p M dex for 7-10 days showed a "hairy" phenotype (Figure 3.17 A , 3.18 A and 3.19 B) with far more root hairs compared to control seedlings from empty vector line (Figure 3.19 A and B) . Thus, A t M K K 6 may normally be a negative regulator o f root hair development. In mature plants, AtMKK6 suppression resulted in early senescence in leaf, stem and floral tissues (Figure 3.17 C and Figure 3.18 C) . 89 Empty Vector AtMKKBRNAi -dex + dex - dex + dex Figure 3.17 Phenotypic analyses revealed growth defects o f A t M K K 6 R N A i plants during plant growth and development. A t M K K 6 R N A i plants displayed growth defects when gene silencing was induced by dexamethasone (dex) treatment. (A) 7-day-old empty vector and A t M K K 6 R N A i seedlings grown in ±1 p M dex-containing media (B) 10-day-old empty vector and A t M K K 6 R N A i seedlings grown in soil. Seedlings were treated with 25 p M dex at day 7 post-germination. This picture was taken at day 3 post-treatment. (C) 35-day-old empty vector and A t M K K 6 R N A i plants grown in soi l ; Plants were treated with 25 p M dex at day 28 post-germination. This picture was taken at day 7 post-treatment. White bars = 2 mm, red bars = 20 mm. 90 Figure 3.18 Close-up views of phenotypes from A t M K K 6 R N A i plants when induced by dexamethasone (dex). (A) 7-day-old A t M K K 6 R N A i seedlings grown in 1 p M dex-containing media (B) 10-day-old A t M K K 6 R N A i seedlings grown in soi l ; Seedlings were treated with 25 p M dex at day 7 post-germination. This picture was taken after 3 days of dex treatment. (C) 35-day-old A t M K K 6 R N A i plants grown in soi l ; Plants were treated with 25 p M dex at day 28 post-germination. This picture was taken after 7 days of dex treatment. White bars = 2 mm, Red bar = 20 mm. 91 Figure 3.19 A t M K K 6 R N A i showed ectopic root hairs, when induced by 1 p M dex (A) Root hairs from a 10-day-old seedling of an empty vector (pTA7002) plant (line 4) (B) Root hairs from a 10-day-old seedling of the A t M K K 6 R N A i plant (line 13) White bars = 0.2 mm. 3.3.10 Lateral root analysis of AtMPKl3RNAi transgenic plants To investigate whether A t M P K l 3 is required in the lateral root formation, three positive T2 A t M P K l 3 R N A i transgenic independent lines were recovered and assessed for lateral root formation, as with A t M K K 6 R N A i transgenic plants. The A t M P K l 3 R N A i mutant plants, grown in the presence of 1 p M dex showed a marked reduction (80 %) in lateral root numbers (Figure 3.20). 92 Empty Vector AtMKK6RNAi AtMPKl 3RNAi - dex Figure 3.20 A t M K K 6 R N A i and A t M P K l 3 R N A i showed reduction of lateral root number when R N A i silencing was induced by 1 u M dex. Lateral root phenotype of 14-day-old empty vector seedlings, A t M K K 6 R N A i and A t M P K l 3 R N A i seedlings were grown on M S agar medium and subjected to ± 1 p M dex treatments at day 7 post-germination. When compared to the non-treated seedling o f the same genotype, the dex-treated A t M K K 6 R N A i and A t M P K l 3 R N A i seedlings exhibited 82 % and 80 % reduction in the number o f lateral roots, respectively, while the dex-treated empty vector line showed no significant change in the lateral root formation. Pictures were taken at day 14 post-germination. 93 3.4 Discussion 3.4.1 AtMKK6 is required for lateral root initiation The localization of promoter activity of the AtMKK6 gene to cell types with well-defined functions in Arabidopsis provides an initial indication of the biological process(es) in which the gene may play a role. One o f the most fascinating features of plant pericycle cells is their ability to re-initiate cell division and generate a new localized meristem capable of producing all root organ-specific cell types and eventually forming a new lateral root. The AtMKK6 promoter::GUS data reveal that, within the primary roots, AtMKK6 is specifically expressed in vascular tissue and particularly in non-dividing cells o f the pericycle layer surrounding the vascular tissue. Strikingly, GUS-posit ive cells were observed in the actively dividing pericycle at the site o f the lateral root primordia (LRP) initiation. This localization pattern means that the most intense AtMKK6 expression occurs at sites along the primary root where lateral root formation is taking place, which implicates the possible involvement o f AtMKK6 in initiating and/or sustaining pericycle cell division during lateral root initiation. This model is supported by the results obtained with AtMKK6-suppressed plants, where reduction in AtMKK6 gene expression resulted in the formation o f far fewer lateral roots. In addition to the defect in lateral root development observed in older AtMKK6-suppressed seedlings, AtMKK6RNAi seedlings grown in growth media in the presence of the inducer showed a "hairy" phenotype, marked by inhibition o f shoot development and massive formation of ectopic root hairs on elongated primary roots. AtMKK6RNAi plants treated with dexamethasone also displayed growth defects during later stages o f plant development. Together, these observations reveal a requirement for the AtMKK6 gene product activity during lateral root, root hair and whole plant development. 94 3.4.2 Pericycle-specific expression of the AtMKK6 promoter is regulated by auxin. The control o f L R P initiation during lateral root formation is not wel l understood. It has been suggested that there are two possible growth control points for L R P initiation (Dubrovsky et al, 2000). The first control point is developmentally regulated for early lateral root initiation, and is defined after pericycle cells pass from the meristem to the differentiation zone where L R P founder cells are established. The second growth control point is developmentally unrelated to the root apical meristem, and involves L R P initiation as a response to tissue damage or environmental changes, or to being exogenously stimulated with auxin (Laskowski et al, 1995; Doerner et al, 1996). Since AtMKK6 promoter::GUS activity was observed both during L R P initiation in untreated roots, and in exogenously auxin-stimulated roots o f AtMKK6 promoter::GUS seedlings, the AtMKK6 gene product may be required during both growth control points for L R P initiation of the lateral root formation process. Furthermore, treatment with N P A , a polar auxin transport inhibitor, markedly diminished AtMKK6 promoter: :GUS activity in pericycle cells o f roots, both in non-dividing and actively dividing cells (Figure 3.13 A and B) , indicating that auxin is a positive regulator of transcription o f the AtMKK6 gene in the root pericycle cells. The block o f AtMKK6 promoter activity caused by N P A could be reversed by supplying exogenous I A A (Figure 3.13 C to E), which indicates that supply of an optimal amount of endogenous auxin is l ikely an important regulator o f the pericycle-specific activity pattern o f the AtMKK6 promoter. It has been proposed that inhibition o f auxin transport results in accumulation o f levels o f I A A that are sub-optimal for lateral root initiation in Arabidopsis (Casimiro et al, 2001). Notably, in contrast to roots co-treated with the N P A and I A A , roots treated with N P A alone had both 95 fewer and poorly developed lateral roots. The presence of these residual lateral roots may result from L R P that had formed in roots of 9-day old seedlings prior to the N P A treatment. However, their further development was then blocked by N P A . The failure of L R P to develop further in NPA-treated reporter plants, associated with the reduction o f G U S activity in L R P s , might indicate that A t M K K 6 activity is also required for outgrowth of lateral roots, but this possibility would need to be tested more directly. In conclusion, my data show that auxin controls AtMKK6 gene expression and that the AtMKK6 gene product is probably required for lateral root formation. Furthermore, during initiation of lateral root formation, A t M K K 6 is l ikely involved in regulating the active cell-division of pericycle cells in both development-related and environment-related scenarios. However, it is unclear about the mechanism of the A t M K K 6 regulation in root pericycle cell-division. Recent reports have indicated that protein phosphorylation plays an important role in regulating auxin polar transport. P INOID (PID), a protein serine-threonine kinase, regulates cellular localization o f the P I N proteins, auxin transport facilitators (Friml et al, 2004). Ectopic expression of the pid gene in roots resulted in mislocalization of P IN proteins to the root cell apical membranes, whereas in wild-type plants P IN proteins are normally localized to the root cell basal membranes. The mechanism of the PID-PIN interaction e.g. what proteins are the downstream target o f the PID kinase remains unanswered. Based on this information, it would clearly be of interest to determine whether A t M K K 6 is involved in auxin polar transport in Arabidopsis roots. 96 3.4.3 AtMKK6 and AtMPK13 relationship Besides the gene expression and cellular localization levels o f regulation, the AtMKK6 gene product is l ikely to be regulated at other levels such as post-translational phosphorylation by its upstream M A P K K K , and interaction with other proteins such as its downstream M A P K . A t M P K l 3 is a prime candidate as a downstream substrate for A t M K K 6 in the context o f lateral root formation in Arabidopsis, since (1) the activity of the AtMPKl3 promoter and AtMKK6 promoter were both detected in the primary roots at sites o f lateral root formation and in actively dividing pericycle cells of L R P , and (2) A t M K K 6 has been shown to be capable of phosphorylating A t M P K l 3 in vitro (Melikant et al, 2004). A t M P K l 3 might therefore also be involved in regulating the cell-division process in the pericycle, associated with L R P initiation. This model is supported by the observation that dex-induced A t M P K l 3-suppressed plants showed reduced lateral root formation. Beyond this inferred function in lateral root formation, the tissue/cell-specific expression o f the AtMPK13 promoter::GUS activity in floral and silique organs indicates additional involvement o f the AtMPKl3 gene product in other developmental transitions. (Figure 3.9 P to T). The N A C K - P Q R pathway controlling cytokinesis in tobacco cells was proposed to consist o f N A C K 1 / 2 kinesin-like proteins (Takahashi et al, 2004), N P K 1 M A P K K K (Nishihama et al, 2001), the N O K l / N t M E K l M A P K K and the N R K 1 M A P K (Soyano et al, 2003). This pathway operates during the late M phase o f the cell cycle in tobacco cells. N t M E K l / N Q K l (the tobacco orthologues of Arabidopsis A t M K K 6 ) has previously been shown to be capable of phosphorylating and activating N t N T F 6 / N R K l (the tobacco orthologue o f A t M P K 1 3 ) in vitro (Calderini et al, 2001; Soyano et al, 2003). Localization studies have also determined that N T F 6 and M M K 3 , tobacco and alfalfa orthologues, 97 respectively, o f Arabidopsis M P K 1 3 can be detected at developing cell plates (Calderini et al, 1998; Bogre et al, 1999). Interestingly, my results indicate that N P A blocked the activities of both the AtMKK6 and AtMPKl3 promoters in actively dividing pericycle cells during L R P initiation, whereas this treatment failed to block AtMPK13 promoter::GUS activity in non-dividing pericycle cells. It is possible that the A t M K K 6 / A t M P K 1 3 signaling interplay is subject to a 'matrix effect' in which certain functions or interactions only occur under specific conditions defined by cell-types or developmental conditions (Coruzzi and Zhou, 2001). Such context-dependent interactions between A t M K K 6 , A t M P K 1 3 and other auxin-regulated components might give rise to a situation where A t M P K l 3 interacts with A t M K K 6 only in actively dividing pericycle cells during L R P initiation but not in pericycle cells during the inactive stage. This possibility could perhaps be explored by using a technique like F R E T (Fluorescence Resonance Energy Transfer) for measuring interactions between two proteins in vivo (Pollok and Heim, 1999). 98 CHAPTER 4 AtMPK12, an Arabidopsis mitogen-activated protein kinase is guard cell-specific and induced by salt and osmotic stresses. 4.1 Introduction A s discussed in Chapter 2, my examination of MAPK gene expression profiles in Arabidopsis revealed an interesting expression pattern for AtMPKl2. In this chapter, I have explored the tissue and cell distribution of AtMPK12 expression during development through use of AtMPK12 promoter::GUS reporter plants. M y results show that the AtMPK12 promoter directs the GUS reporter gene expression specifically to stomatal guard cells o f many Arabidopsis tissues. This expression is intensified in plants subjected to salt stress and other osmotic stress. In addition, I report the results o f phenotypic analysis of a A t M P K l 2 loss-of-function mutant recovered from the S A L K collection of T - D N A insertional mutants. 4.1.1 Stomatal development Stomata are specialized structures located in the epidermis of plant aerial tissues. Each stoma is comprised o f two opposing guard cells that surround the stomatal pore, an opening which allows exchange of gases and water vapor between the intercellular spaces of the plant and the surrounding atmosphere (Figure 4.1; Nadeau and Sack 2002). Stomata are distributed in the epidermis in a pattern that leaves individual stomata separated by at least one intervening pavement cell (Bergmann, 2004). Little is known about the developmental mechanisms that regulate stomata formation and patterning, but it has been proposed that all Arabidopsis stomata form through at least one asymmetric and one symmetric division (Figure 4.2 and Nadeau and Sack 2003). In brief, during stomatal development, the first division occurs in 99 chloroplasts r xylem phloem bundle sheath vein (vascular bundle) sheath extension air space cuticle epidermis (upper) palisade parenchyma spongy guard cell stomatal pore parenchyma mesophyll epidermis (lower) stoma Figure 4.1 Dicot leaf anatomy (littp://generalhorticulto a presumed stem cel l , the meristemoid mother cel l , ( M M C ) that has become committed to the stomatal pathway (Figure 4.2). The M M C undergoes an asymmetric division, producing a smaller triangular precursor called a meristemoid (M) and a larger sister cell called a neighbor cell (NC). The M can either differentiate immediately into an oval-shape guard mother cell ( G M C ) , which in turn undergoes a symmetric division, producing the two guard cells that form the stoma, or it can continue to divide asymmetrically, producing another M at each division. A t each division, the sister cell (NC) may become an M M C and divide asymmetrically to produce a new meristemoid called a satellite meristemoid (SM) (Figure 4.2). 100 fl Satellite •"•"^meristemoid Meristemoid Meristemoid Guard Young Mother Cell Mother Cell guard cells s t o m a -fa Asymmetric division of MMC Asymmetric division of meristemoid "£? Symmetric division of GMC Figure 4.2 Arabidopsis stomatal development (Nadeau and Sack, 2002b) Mutations in several loci are known to disrupt stomatal development and patterning in Arabidopsis. The best characterized of these loci are TOO MANY MOUTHS (TMM), ERECTA (ER), STOMATAL DENSITY AND DISTRIBUTION 1 (SDD1), YODA (YDA) and FOUR LIPS (FLP). The tmm, er erl er2 triple, sddl and yda mutants display similar phenotypes in that they have an excessive number o f stomata compared to wild-type leaves (Berger and Altmann, 2000; Shpak et al, 2005; Geisler et al, 2000; Bergmann et al, 2004), while the flp mutants display a paired stomata phenotype (Yang and Sack, 1995). TMM, which encodes a leucine-rich receptor-like protein has been proposed to play an essential role in the intercellular communication of positional signaling and in establishment o f stomatal patterning (Yang and Sack, 1995; Geisler et al, 2000; Nadeau and Sack, 2002a; Larkin et al, 2003). Several spacing mechanisms appear to be disrupted in leaves of tmm mutants (Geisler et al, 2000). These mutants have division in cells that 101 normally would not divide, and T M M is required for the correct orientation of the plane o f the asymmetric division that patterns Arabidopsis leaf stomata (Geisler et al, 2000; Nadeau and Sack, 2003). In addition to this randomized division phenotype, tmm plants possess an altered stomatal distribution pattern where stomata form clusters rather than being distributed properly (Figure 4.3 and Geisler et al, 2000). Stomatal cluster formation in tmm plants is partly an outcome of an increase in the number of asymmetric divisions o f neighbor cells, compared to the wild-type patterns, and an increase in the number o f asymmetric divisions of meristemoids, many o f which are misplaced to remain in contact with pre-existing stomata or precursors. Thus, T M M acts as a negative regulator o f asymmetric division in neighbour cells and a positive regulator of asymmetric divisions in meristemoids (Geisler et al, 2000; Nadeau and Sack, 2003). Figure 4.3 Stomatal clusters in too many mouths Cryo-scanning electron micrograph of tmm abaxial cotyledon epidermis. Bar = 15 pm (Nadeau and Sack, 2002b) 102 Figure 4.4 Developmental basis o f stomatal cluster formation in tmm (Nadeau and Sack, 2002b) (Top) Schematic drawing of tmm leaf epidermal surface (bottom row) illustrating that stomatal clusters result from several defects including (1) the randomization o f the orientation o f asymmetric division, (2) cells (*) next to stomata and/or precursors normally do not divide but do in tmm, and (3) sometimes both products of division develop into G M C s (lower right). Top row shows cartoon of what would have happened in wi ld type. (Bottom) Differential interference contrast micrograph of tmm epidermis showing new meristemoids (red asterisks) that are in contact with developing stomata. Bar =10 pm. 103 Arabidopsis ER ERL1 and ERL2, three isi?-family leucine-rich repeat-receptor l ike kinases ( L R R - R L K s ) together control stomatal patterning (Shpak et al, 2005). Loss-of-function mutations in all three £7?-family genes cause stomatal clustering and over proliferation o f stomata, indicating that the three E R proteins may act as negative regulators of stomatal development. Promoter activity pattern o f ERL1 and ERL2 are high in stomatal-lineage cells in developing leaves including meristemoids, guard mother cells and immature guard cells. Their promoter activity pattern supports the proposed function these proteins in stomatal development. SDD1, which encodes a substilisin-like serine protease, has been proposed to function as a processing protease in developmental signaling (Berger and Altmann, 2000; von Grol l and Altmann, 2001). The sddl mutant phenotypes are similar to those o f tmm in that both have many more stomata than wild-type leaves do. However, sddl has fewer and smaller clusters than tmm does, meaning that sddl has many more correctly patterned stomata than tmm (Berger and Altmann, 2000). YODA (YDA), a MAPKKK gene, appears to have a central role in stomatal cell fate determination. It controls both stomatal development and formation (Bergmann et al, 2004). Plants containing mutations in YODA have an excessive number o f stomata, many o f which are misplaced, leading to stomatal clusters, while plants containing two copies o f a permanently active version of YODA completely lack stomata (Bergmann et al., 2004). These authors have proposed that Y O D A acts downstream of SDD1 and T M M because the introduction o f a single copy o f the constitutively active version o f Y O D A into T M M - or SDD-loss of function plants restores the correct distribution of stomata. It has been 104 established that Y O D A also plays a role in cell fate determination in plant embryonic development (Lukowitz et al, 2004). Four lips (FLP), a M Y B transcription factor gene, may function as a negative regulator o f cell division at the guard mother cell ( G M C ) to guard cell transition (Yang and Sack, 1995; Larkin et al, 2003). F L P normally limits the number of symmetrical divisions of the G M C to one, whereas the flp-1 mutants produce many pairs of laterally-aligned stomata in direct contact with each other (Figure 4.5; Yang and Sack, 1995; Larkin et al.,1997). Whi le stomatal clusters in tmm result partly from excess asymmetric divisions, flp clusters develop mostly from excess symmetric divisions from a single guard mother cell ( G M C ) . The flp-1 allele does not appear to affect the total number of meristemoids or pavement cells that are produced (Yang and Sack, 1995; Geisler et al, 1998). The flp stomatal cluster phenotype indicates that F L P does not act in stomatal initiation but rather acts later in the stomatal pathway than T M M . 105 Figure 4.5 Paired stomata in four lips (Nadeau and Sack, 2002b) (Top) flp-1 displays both unclustered and clustered stomata. Stomata visualized using K A T : : G U S staining (promoter from Rebecca Hirsch and Michael Sussman, methods as in Larkin et al, (1997) Bars = 200 pm. (Bottom) Cryo-scanning electron micrograph showing paired stomata at right. Bar = 10 pm. 4.1.2 Stomatal function and their regulation through ion channels Stomata regulate CO2 diffusion into the mesophyll tissue for photosynthetic carbon fixation, water vapor loss v ia transpiration and O2 diffusion out to the environment, through the control o f the stomatal aperture. Stomatal opening and closing are affected by a number o f environmental conditions. For example, high humidity, high CO2 and light induce stomatal opening (Outlaw, 2003), whereas low humidity, cold, drought and soi l salinity induce 106 stomatal closure, which reduces water loss from the plant (Luan, 2002). From external signals to stomatal movements, many signal transduction mechanisms within the guard cells integrate the input stimuli and link them to the response (Schroeder et al, 2001b; Outlaw, 2003) . Both stomatal opening and closing are known to be regulated by various ion channels. Stomatal opening is initiated by H + extrusion from guard cells v ia the H + "ATPase, leading to hyperpolarization o f the plasma membrane. This is then followed by rapid uptake of potassium ions (K + ) v ia the K + - i n channel (Outlaw, 1983; Outlaw, 2003) and rapid uptake of sucrose v ia a H +-sucrose symporter (Talbott and Zeiger, 1998). A s a consequence of this organic solute accumulation, the water potential o f the guard cells drops and water enters the guard cells, leading to increased guard cell turgor and swelling/curving of the cells (Figure 4.6 A ) . Stomatal closure is caused by plasma-membrane depolarization, resulting from the efflux of anions v ia an anion channel and consequent K + efflux via a K + -out channel (Outlaw, 2003). The associated loss of water from the guard cells results in their straightening, and the squeezing together o f their opposing surfaces (Figure 4.6 B) . This stomatal closure generally occurs daily at the point when light levels drop and the use of CO2 in photosynthesis decreases. However, it can also occur at any point when plants have lost an excessive amount o f water. Such a water deficit induces an accumulation o f A B A in plant cells and it has been established that A B A accumulation in guard cells can trigger stomatal closure (Schroeder et al, 2001a), as can application of exogenous A B A (Roelfsema et al, 2004) . 107 A B A regulates ion channel activity in guard cells (MacRobbie, 1997), inhibiting the K + - i n and activating the K + -out channels, thereby decreasing K + influx and increasing K + efflux. These effects are consistent with A B A 's observed ability to inhibit stomatal opening and induce stomatal closure (Luan, 2002). Besides regulation through K + - i n and -out channels, A B A causes a depolarization of the plasma membranes (Thiel et al, 1992) through activation of anion channels (Grabov et al, 1997; Pei et al, 1997). A B A activates the slow anion channels o f the plasma membrane through positive regulation o f a protein kinase (L i et al, 2000) and through negative regulation of a different protein kinase (Pei et al, 1997), which highlights the central role o f phosphorylation in the signal network that regulates the anion channels o f guard cells. P o t a s s i u m ions (K + ) T u r g i d guard c e l l V a c u o l e f i l l e d w i t h w a t e r S t o m a open A F l a c c i d guard c e l l S t o m a c l o s e d B Figure 4.6 Guard cell function: stomatal opening and closing 108 4.1.3 Involvement of protein phosphorylation in stomatal regulation Protein phosphorylation has been implicated in A B A signaling in plant guard cells at several points. A t least three protein kinases and two protein phosphatases involved in this process have been identified and characterized. The three kinases are A A P K (ABA-activated protein kinase), O S T 1 (Open Stomata 1) and A M B P K . A A P K was identified from guard cells o f Vicia faba through a biochemical approach (L i and Assmann, 1996) and has been shown to be involved in modulating the activity of the ABA-regulated slow-anion channel (L i et al, 2000). OST1 is an Arabidopsis ABA-act ivated protein kinase that is closely related to A A P K from Vicia faba. Recessive ostl mutations disrupt both A B A induction of stomatal closing and A B A inhibition of light-induced stomatal opening (Musti l l i et al, 2002). A M B P K , identified as a M A P kinase, positively controls ABA- induced stomatal closure in Pisum sativum (Burnett et al, 2000). Two phosphatases shown to be involved in A B A signaling in guard cells are ABI1 and A B I 2 (ABA-insensit ive 1 and ABA-insensi t ive 2, respectively). They have been identified as type 2C protein phosphatases that are involved in A B A regulation o f ion channel activity in Arabidopsis guard cells (Leung et al, 1994; Meyer et al, 1994; Leung et al, 1997; Leung and Giraudat, 1998). A B A activation of the slow anion is responsible for the membrane depolarization and prolonged anion efflux required for ABA-mediated stomatal closure. In abi mutants, the anion channels remain inactive even in the presence o f accumulating A B A , which results in constantly open stomata (Pei et al, 1997). This implies that protein phosphorylation is required to hold the anion channels in a quiescent state, from which they can be released through the action o f the ABI1 and A B I 2 phosphatases. 109 Other mutations can also affect A B A signaling in stomata. For example, a mutation in the GPA1 gene, which encodes a heterotrimeric G T P binding protein a-subunit (GTPa) , also diminishes ABA- induced stomatal closure (insensitive to A B A ) (Wang et al, 2001). G P A 1 has been shown to interact with the Arabidopsis putative G protein-coupled receptor G C R 1 (Pandey and Assmann, 2004). However, in guard cells, the gcrl mutant exhibited the opposite phenotype from gpal (hypersensitive to A B A ) . Therefore, it has been proposed that G C R 1 may be a negative regulator o f G P A 1 in guard cells (Pandey and Assmann, 2004). 4.1.4 Salt stress signaling Excessive N a + in the soi l , often referred to as high salinity, is a major environmental stress that affects plant growth and development, and can limit crop production (Epstein et al, 1980). When grown in high concentration o f salts, plants exhibit a variety of responses at the molecular, cellular and whole plant levels (Zhu, 2001a). These include developmental changes, ion transport adjustment, and shifts in metabolite accumulation. Some of these responses to salt stress are triggered by ion imbalance and osmotic stress signals, whereas others may be caused by secondary signals generated downstream of the primary signals, such as phytohormones (e.g. A B A ) , reactive oxygen species and intracellular C a + fluxes. A common primary outcome o f salt, drought and cold stresses is associated osmotic stress, whereas a primary outcome uniquely associated with salt stress is ion imbalance or ionic stress. Plants under salt stress therefore have to restore ionic homeostasis as wel l as water or osmotic homeostasis (Figure 4.7). 110 lone stress S O S 3 - » - S O S 2 : Ion transporters 6-9.SOS1 Ion homeostasis Homeostasis Cold Drought A B A \ ; ; Osmotic s(res5 1 Secondary stresses e.g. oxidation i i l I C B F / D R E B T R E N D S I) Plrnl S t a e r e r Figure 4.7 Salt stress responses in plants and pathways that interconnect them. Homeostasis can be regarded as consisting of ionic and osmotic homeostasis Components. The SOS pathway is proposed to mediate ionic homeostasis and the M A P K pathway is proposed to mediate osmotic homeostasis (Zhu, 2001b). The two primary stresses, ionic and osmotic stresses cause secondary stresses such as ROS accumulation. This diagram is modified, from Zhu (2001b). 4.1.5 Ionic stress signaling: the "salt overly sensitive" (SOS) pathway Salt stress disrupts ionic homeostasis in plants, causing a build-up of excess toxic N a + in the cell cytosol and a deficiency of essential ions such as K + as a result of the negative impact of N a + on intracellular K + influx (Hasegawa et al, 2000). The signaling pathway components controlling N a + homeostasis and salt tolerance have been identified through genetic screens to recover mutants in Arabidopsis that are hypersensitive to NaCl stress. These mutants are 111 designated as SOS (salt overly sensitive) (Wu et al., 1996; L i u and Zhu, 1997, 1998), several of which have been cloned and characterized. SOS1 encodes a putative N a + / H + antiport protein whose biological function may be removal of N a + from the cytoplasm with export to the extracellular space. The steady-state level o f SOS1 transcripts is up-regulated by N a C l stress (Shi et al., 2000). SOS2 encodes a serine/threonine protein kinase and is required for salt tolerance (L iu et al., 2000) while SOS3 encodes a myristoylated Ca 2 + -b inding protein (L iu and Zhu, 1998). These SOS proteins are proposed to constitute a pathway that regulates N a + balance in the plant cells. In the proposed SOS pathway, the sequence of signaling events starts with transient elevation of intracellular C a 2 + in response to salt stress. A s a consequence, the Ca 2 + -b inding protein, SOS3, is activated (L iu and Zhu, 1998; Ishitani et al, 2000). This activation results in SOS3 recruiting and activating protein kinase SOS2 (Halfter et al, 2000; Ishitani et al, 2000; L i u et al, 2000). The SOS3-SOS2 kinase complex regulates the activity of the plasma membrane-localized N a + / H + antiporter, SOS1, and also activates the transcription of the SOS1 gene. The complex may also modulate the activity of other ion transporters (Zhu, 2000), which act together to restore ion homeostasis (Figure 4.8). In addition to ion transporters l ike SOS1 that directly control N a + influx into and efflux out o f plant cells through the plasma membrane, there are other ion transporters such as A t N H X l that regulate N a + compartmentation in the vacuole (Figure 4.8). Transport o f N a + to the vacuole helps prevent N a + toxicity in the cytosol; N a + can also be utilized in the vacuole as an osmolyte to help restore osmotic homeostasis (Zhu, 2001b). 112 High N a + SOS1 Figure 4.8 Diagram o f the SOS pathway for plant Na+ response, from Zhu, J - K (2000) 4.1.6 Osmotic stress signaling: SOS-independent protein kinases In addition to the physiological challenges associated with ionic imbalance, high salinity in soil is a major cause o f osmotic stress in plants because o f associated changes in water-generated turgor pressure. Several plant M A P K components have been implicated in osmotic stress responses, mainly based on up-regulation of their transcripts and/or kinase activation in response to salt, drought and cold stresses (Mizoguchi et al, 1996; Kiegerl et al, 2000; Teige et al, 2004). The plant M A P K s identified in this fashion include A t M E K K l , M E K 1 / M K K 2 and M P K 4 / M P K 6 in Arabidopsis (Ichimura et al, 2000; Teige et al, 2004), S I M K K and S I M K in alfalfa (Kiegerl et al, 2000) and N t M E K 2 , S IPK and W I P K in tobacco (Yang et al, 2001; Zhang and Klessig, 2001) (Figure 4.9). 113 In Arabidopsis, the M A P K K , M K K 2 , was specifically activated by salt and cold stresses (Teige et al, 2004). In vivo protein kinase assays showed that activated M K K 2 phosphorylated M P K 4 and M P K 6 . mkk2 null plants were impaired in M P K 4 and M P K 6 activation and were hypersensitive to both salt and cold stresses (Teige et al, 2004). A t M P K 6 can also be activated by low temperature and osmotic stresses in Arabidopsis cell cultures (Ichimura et al, 2000). In alfalfa, activation o f S I M K , a salt stress-induced M A P K , is posttranscriptionally mediated by the M A P K K , S I M K K (Kiegerl et al, 2000). ^ Excess Na + • C a ^ + - - • S O S 3 — OS2 -— • S O S land other tra nsporters strc 3SS \ o a l l t cyto H yperos mo lair ity— ATHK1 ASK1 \ MKK2 AtM PK4/A tMPK6 -NtMEK2 SIPK/WII SI MK K SIM K alir Elicitors Wou nding Figure 4.9 Salt stress activates several protein kinase pathways, the SOS3-SOS2 kinase pathway, multiple M A P K pathways and other protein kinases e.g. A T H K 1 , A S K 1 and A T G S K 1 . Modi f ied from (Zhu, 2001a). 114 Similarly, in tobacco, S IPK (the orthologue o f A t M K K 6 ) becomes activated upon hyperosmotic stress (Mikolajczyk et al, 2000), while W I P K (the orthologue o f A t M P K 3 ) is activated by cold, drought, wounding and biotic stimuli (Seo et al, 1995). In tobacco, N t M E K 2 is a M A P K K capable o f activating both S IPK and W I P K (Yang et al, 2001; Zhang and Klessig, 2001). Beyond M A P K pathway proteins, additional kinases and other proteins are also involved in responding to salt or osmotic stresses (Figure 4.9). These include Arabidopsis A T H K 1 , a two-component histidine kinase homologous to the yeast osmosensor, SLN1 (Urao et al, 2000), a tobacco homologue o f Arabidopsis serine/threonine kinase 1 (ASK1) (Mikolajczyk et al, 2000) and A T G S K 1 (Piao et al, 2001). 115 4.2 Materials and Methods 4.2.1 Plant materials Plant materials were prepared as described in Chapter 3, Section 3.2.1. 4.2.2 Genomic DNA isolation Genomic D N A isolation was performed in the same manner as in Chapter 3, Section 3.2.2. 4.2.3 Molecular cloning of AtMPKl2 promoter: :GUS DNA constructs and generating the GUS reporter plants To examine cel l- and tissues-specific expression o f AtMPKl2 genes during plant development, transgenic Arabidopsis plants harboring the AtMPK12 promoter::/?-glucuronidase (GUS) reporter gene construct were generated through the fol lowing processes. 4.2.3.1 Cloning of the AtMPK12 promoter The promoter region o f the AtMPKl2 gene (the 1300 bp region immediately upstream of its translational start A T G codon) was amplified from Arabidopsis genomic D N A (obtained from section 3.2.2) using the Expand High Fidelity P C R System K i t (Roche Molecular Biochemicals, Catalog No . 1 732 641). P C R was carried out according to the manufacturer 's instructions, using PK12F1 and PK12R1 primers (Table 4.1). The resulting amplicon was cloned into the pCR®2.1-TOPO® vector using a T O P O T A Cloning® K i t (Invitrogen, Carlsbad, U S A , and Catalogue No. K4500-01) and the insert was sequenced to confirm its identity. 116 Table 4.1 Primer sequences for AtMPKl2 promoter cloning Primer Name Restriction Enzyme Site Sequence (5-3') Amplified Promoter Region Length (bp) PK12F1 PK12R1 BamHI BamHI cgcgaatccGTGAAGAGAGAAGCTTTTTTCAACTG cgcggatccGATGAAGCTAGCTATGGAGTCACTCTG 1300 4.2.3.2 Generation of promoter::GILTS' fusion DNA constructs and transgenic plants The amplified AtMPKl2 promoter fragment was digested with BamHI and ligated into the GUS coding region of the promoter cloning vector, p C A M B I A 1 3 8 1 Z (CSIRO, Canberra, Australia) that has been predigested with BamHI. Clones carrying the construct with the promoter in the sense orientation adjacent to the GUS O R F were identified by double restriction enzyme digestion. Uncut p C A M B I A 1 3 8 1 Z was used as a promoterless-Gt/S construct (negative control) and pCAMBIA1301 (CSIRO, Canberra, Australia) was used as a 35S promoter-GcTS fusion construct (positive control). Schematic diagrams o f the p C A M B I A 1 3 8 1 Z and pCAMBIA1301 vectors are presented in Chapter 3, Figure 3.1. The ligation reactions and E.coli transformation were performed as previously described in Chapter 3, Section 3.2.3.2. Agrobacterium transformation, in planta transformation of Arabidopsis and selection of transformants were performed as previously described in Sections 3.2.3.3, 3.2.3.4 and 3.2.3.5, respectively. 117 4.2.4 Histochemical GUS analysis Three independent transformants of the AtMPKl2 promoter::GUS reporter plants (lines 1, 2 and 8) were subjected to detailed histochemical G U S analysis using the methods previously described in Chapter 3, Section 3.2.4. 4.2.5 Resin embedding and cross-sectioning of leaf tissue Resin embedding of leaf tissue of 10-day-old seedlings harboring the AtMPKl2 pTomoter..GUS fusion construct, and cross-sectioning were performed as previously described in Chapter 3, Section 3.2.5. 4.2.6 NaCl and mannitol treatments AtMPK12 promoter::GUS reporter seeds were surface sterilized as previously described in Chapter 3, Section 3.2.3.5) and then individual seeds were arranged on square agar-solidified M S medium plates containing Vi M S salt mix, 1% sucrose, 0.5 g/L M E S , and 0.8 % agar, p H 5.7 (without B5 vitamins). The plates were sealed with 3 M Micropore™ tape and the seeds were vernalized at 4 °C in the dark for 2-4 days. The plates were then placed in the growth room, mounted vertically under 16 h/8 h light-dark cycle conditions at 22-24 °C for 9 days. For the N a C l treatment, sufficient 100 m M N a C l in l iquid M S was added to flood 12-day old reporter seedlings for 24 hours. For the control, unsupplemented M S solution was used. For the mannitol treatment, seedlings were grown on agar-solidified M S medium containing 5% mannitol for 10 days. For the control, seedlings were grown on the normal unsupplemented medium. 118 4.2.7 Verification of the AtMPKl2 SALK transfer-DNA (T-DNA) insertional homozygous line 4.2.7.1 Genomic DNA extraction of the AtMPKU SALK T-DNA insertional plants Leaves o f 4-week-old plants, (the AtMPKU T - D N A insertional plants, SALK_074849) were used for genomic D N A extraction, using an adaptation o f a protocol described in (Edwards et al, 1991) and Western T. L. (personal communication). The leaf sample from each individual plant was ground in a microfuge tube for 15-30 seconds using an electronic dri l l at room temperature. To each ground sample, was added 400 p L extraction buffer (containing 200 m M Tr i s -HCl , p H 7.5, 250 m M N a C l , 25 m M E D T A , p H 8.0 and 0.5% SDS) and the mixture was vortexed for 5 seconds. The sample was then centrifuged for 3 minutes at 10,000 x g. Without disturbing the pellet, 300 p L supernatant was transferred to a fresh microfuge tube, and D N A was precipitated by adding 300 p L isopropanol and mixing by inverting the tube 5 times. The sample was incubated at room temperature for 2 minutes and then centrifuged for 5 minutes at 10,000 x g. The supernatant was discarded, and the pellet was then washed with 500 p L 70% ethanol and air-dried for 10 minutes. The D N A pellet was re-suspended in 100 p L T E , p H 8.0, and the genomic DNA-containing solution was stored at 4 °C. A 2 p L aliquot o f the genomic D N A was used for each P C R reaction. 119 4.2.7.2 Identification of a homozygous SALK T-DNA insertional line To identify homozygous AtMPKl2 T - D N A insertional line(s), Seed were obtained from the Arabidopsis Stock Centre ( A B R C accessed through http://www.Arabidopsis.orgV P C R was performed using genomic D N A obtained from individual AtMPK12 S A L K T - D N A insertional plants at the T3 generation (section 4.2.7.1). This screen employed three S A L K T-D N A primers: the left genomic primer, K 1 2 L P ; the right genomic primer, K 1 2 R P and the left border primer, L B a l . These primers were designed by the S A L K i S E C T online tools (http://signal.salk.edu/isects.html) and the sequences are presented in Table 4.2. A diagram describing the S A L K T - D N A primer design is present in Figure 4.10 (Alonso et al, 2003). The expected amplicon sizes for the various primer combinations used are 900 bps and 410+N bps (N = 0-300 bps). Table 4.2 Primers for verification o f the AtMPK12 T - D N A insertional homozygous line(s) (SALK_074849) Primer Name Sequence (5'-3') K12LP TCACGTAGCGTTCTCTTAGCATCG K12RP TGGCAATGCAGTTGGAGAAGA LBa1 TGGTTCACGTAGTGGGCCATCG 120 Figure 4.10 Diagram of S A L K T - D N A verification primer design and P C R product size (Modif ied from http://signal.salk.edu/tdnaprimers.html and Alonso et al. (2003)) (A) S A L K T - D N A verification primer design K 1 2 L P and K 1 2 R P = Left and right genomic primers for A t M P K l 2 T - D N A insertional lines, respectively N= Difference of the actual insertion site and the flanked sequence position, usually 0 - 300 bases L B a l = Left border primer o f the T - D N A insertion (B) Ampl icon sizes expected from using the three primers (LBa l+K12LP+K12RP) for screening AtMPKl2 SALK_074849 plants, W T (Wi ld Type - no insertion) plants should yield a product o f about 900 bps (from K 1 2 L P to K12RP) , H M (Homozygous lines - insertions in both chromosomes) plants w i l l yield a band o f 410+N bps, and H Z (Heterozygous lines - one of the pair chromosomes with insertion) plants should yield both bands. 121 4.2.8 Phenotypic analyses of the homozygous AtMPKll T-DNA insertional mutant (atmpkll) in normal growth conditions The phenotypic analyses of young seedlings were performed on the M S agar-solidified medium plates. The atmpkll mutant and wild-type seeds were surface sterilized and placed on M S agar-solidified media containing Vi M S salt mix, 3% sucrose, 0.5 g/L M E S and 1.2 % agar, p H 5.7 (without B5 vitamins). The seeds were vernalized at 4 °C in the dark for 2-4 days prior to being grown at 22-24 °C, under 16 h/8 h light-dark cycle conditions. -50-100 seeds were sown per plate and five replicate plates were used. Up to 12 days, morphological phenotypes were monitored and photographed. 122 4.3 Results 4.3.1 Histochemical localization of GUS activity driven by AtMPK12 promoter during plant development In Chapter 2, reverse transcriptase polymerase chain reaction (RT-PCR) analysis o f the expression of all Arabidopsis M A P K genes showed that the AtMPK12 gene was differentially expressed in Arabidopsis tissues and the highest expression was detected in callus (Chapter 2, Figure 2.2). To investigate the cel l- or tissue-specific expression of AtMPKl2 gene more closely during plant development, I performed a promoter-GUS activity analysis. A 1.3 kb-promoter region upstream of the AtMPKl2 A T G start codon was fused with the ^-glucuronidase (GUS) reporter gene and the resulting construct was introduced into wild-type Arabidopsis plants. G U S activity was monitored throughout plant development, from 3 days to 35 days, by histochemical staining in three independent transgenic lines. G U S staining in all three lines was highly localized, appearing as dark blue spots in cotyledons, rosette leaves and hypocotyls (Figure 4.11 A - C ) . This pattern resulted from strong GUS expression in guard cells in these tissues in plants of all ages tested. In contrast to the R T - P C R results, G U S staining was barely detectable in roots (Figure 4.11 A - C , E and F), appearing sporadically in the upper parts (adjacent to the hypocotyls) of the primary roots. No G U S staining was observed in trichomes (Figure 4.11 D). G U S activity was also observed in the guard cells in the inflorescence stems and cauline leaves (Figure 4.11 G). In young flowers and mature flowers, strong G U S staining was observed in guard cells in sepals and anthers, but not in guard cells in petals (Figure 4.11 H). In the pistil of young flowers, G U S activity was barely detected in the stylar region o f young pistils (not shown), whereas 123 strong G U S activity was detectable in guard cells of the style in mature flowers (not shown) and in guard cells o f the stylar region at the base of developing siliques (Figure 4.11 J). In addition, strong G U S activity was observed in guard cells along the pedicel and body of the siliques (Figure 4.11 I and J). B y contrast, no G U S activity was observed in stigma of flowers or the distal end of siliques at either young and mature stages (Figure 4.11 H and J). Overall, the AtMPK12 promoter drove GUS expression specifically in guard cells o f most aerial tissues throughout plant development. 124 Whole plants and leaf guard cells A 1 Hypocotyl Cotyledon tissue t • . * • ' *' * o « Root Figure 4.11 AtMPKl2 promoter-GUS activity survey throughout plant development (A, B and C) 5-day, 10-day and 35-day old seedlings or plants are shown, respectively. Black bars = 2 mm and white bars = 0.2 mm. 125 Trichomes and Roots Inflorescence, flowers and silique Figure 4.11 (continued) AtMPKl2 promoter-GUS activity survey of inflorescence, flowers and silique White bar = 2 mm and black bars = 0.4 mm. 127 A pistil of a fertilized mature flower Figure 4.11 (continued) AtMPKl2 promoter-GUS activity survey of floral pistils (J) A pistil from a fertilized mature flower. Gt/5-expression guard cells was clearly detected in the guard cells of mature style tissue. Arrows indicate stigma and style region o f a pisti l. Black bar = 0.1 mm. 128 Higher magnification o f leaves from 10-day-old AtMPKl2 promoter::GUS seedlings revealed G U S activity in leaf guard cells (Figure 4.12 A ) . However, strong G U S activity was not detected in all leaf guard cells. Strong G U S staining was restricted to the large guard cells, whereas relatively weak G U S staining was observed in the smaller cells (Figure 4.12 B) . Weak G U S staining was detectable in many (not all) guard mother cells, which are precursor cells o f stomata development, but G U S staining was not detectable in other types of stomatal precursor cells (data not shown). No G U S activity was detected in epidermal pavement cells (Figure 4.12 B) , although it was observed in some parts o f the leaf vascular tissues (Figure 4.12 A ) . Finally, examination of leaf cross-sections from 10-day-old seedlings confirmed the guard cell-specific GUS expression pattern seen in whole tissue mounts (Figure 4.13 A and B) . 129 B 0 4 o 0 Figure 4.12 Histochemical localization of GUS activity in AtMPKl2 promoter::GUS reporter plants. Arrows indicate smaller guard cells expressing relatively weak GUS activity, compared to the larger ones. A red bar = 20 pm. GUS staining is shown as blue. 130 Figure 4.13 Transverse section of leaf from the AtMPKl2 promoter: :GUS reporter plant. Arrowheads indicate guard cells where G U S staining is localized as blue. 131 4.3.2 AtMPK12 promoter activity was enhanced by NaCl and mannitol treatments. AtMPK12 promoter::GUS activity in both shoots and roots was increased by exposure of the plants to N a C l (100 m M ) for 24 hours (Figure 4.14). Normally, G U S staining is barely detectable in roots at different stages o f development (Figure 4.11 E-F), but the activity was dramatically increased upon N a C l treatment, as compared to the control, particularly in the vascular tissue o f the roots (Figure 4.14 B) . Higher magnification revealed that, upon N a C l treatment, a substantial increase in G U S activity could also be induced in leaf stomatal guard cells (Figure 4.15 A and B) . In addition to N a C l stress, I tested the effect o f a direct osmotic stress stimulus, using mannitol. In reporter plants grown on M S agar medium containing 5% w/v mannitol, G U S activity was markedly increased in leaf stomata (Figure 4.16). Notably, the seedlings grown in the presence of mannitol also displayed growth defects, as their leaves were smaller and their roots were shorter, compared to the control where the same genotypes were grown on the unsupplemented media. 132 -NaCl +NaCI -NaCl +NaCI Figure 4.14 N a C l causes an increase in G U S activity of the AtMPKl 2 promoter: :GUS reporter seedlings. G U S staining is shown as blue. (A) Shoot and roots from 13-day old seedlings treated without and with N a C l (100 mM) (B) Roots from 13-day old seedlings treated without and with N a C l (100 m M ) 133 -NaCl A , C: Figure 4.15 NaCl causes an increase in GUS activity in leaf guard cells of AtMPKl 2 promoter: :GUS reporter seedlings. (A) and ( B ) Leaf guard cells from 13-day old seedlings treated without and with NaCl (100 mM), respectively. GUS staining is shown as blue. 134 Figure 4.16 Mannitol (5%) causes an increase in G U S activity o f the AtMPKl2 promoter:.GUS reporter seedlings. (Left) 10-day-old seedlings grown in the absence of mannitol. (Right) 10-day-old seedlings grown in the presence of 5% mannitol. 135 4.3.2 Characterization of SALK T-DNA insertion lines To gain more insight into the function o f A t M P K 12 in plants, I characterized a mutant line in which the AtMPKl2 gene has been disrupted by a T - D N A insertion in the first exon (Alonso et al, 2003). In collaboration with an undergraduate student, Janet Chung, a homozygous line (line 28) of the atmpkl2 mutant was recovered from screening an accession from the S A L K T - D N A insertional mutation collection (SALK_074849), using a P C R genotyping approach (Figure 4.17). Figure 4.17 P C R screening of AtMPKl 2 T - D N A insertional lines (SALK-074849) to identify a plant homozygous for recessive mutant alleles of the AtMPKl 2 gene. Line 28 represents a homozygous atmpkl2 mutant that has T - D N A insertions in both chromosomes. A n arrow indicates a single band of an amplification product from line 28 (see more details in Section 4.2.7.2). 136 4.3.3 Phenotypic analysis of the atmpkll plants Under normal growth conditions on M S agar medium, the young atmpkl2 mutant seedlings showed a mixture of both dwarf phenotype (-37 %) and normal-looking phenotype (~ 63 %) in the population (Figure 4.18 A and B) . However, the atmpkl2 mutant plants displaying dwarf phenotypes were segregated away in the next generation, leaving only homogenous wild-type looking plants (Figure 4.18 C) . This result indicates that the dwarf phenotypes in the previous generation were not an outcome of the AtMPKl2 mutation. It was confirmed by P C R genotyping that the plants with the homogenous phenotypes are atmpkl2 homozygous mutants that contain T - D N A inserts in both chromosomes. 4.4 Discussion 4.4.1 AtMPKll promoter activity pattern is guard cell-specific throughout plant development Epidermal tissues of Arabidopsis leaves and stems contain three distinct cell types: stomatal guard cells, trichomes, and epidermal pavement cells (Melaragno et al, 1993). M y results show that the AtMPKl2 promoter activity was confined to the stomatal guard cells and was not detected in pavement cells or trichomes (Figure 4.12 B and Figure 4.11 D). In addition, my results reveal that the AtMPK12 promoter directs GUS expression specifically to the guard cells in a range o f developmental contexts, since GC/5-expressing guard cells were detected in cotyledons, hypocotyls, and siliques, as wel l as in specific floral tissues such as sepals, anthers and the stylar region o f pistils (Figure 4.11 H and J). However, the activity was not detected uniformly in all guard cells. The level o f G U S activity appears to be related to the size o f the guard cells, or perhaps their state o f development (Figure 4.12 B) . 137 Wild-type atmpk12 atmpk12 Figure 4.18 Phenotypic analysis of wild-type and atmpkl2 mutant plants on growth medium (1.2 % agar and 3 % sucrose) (A) 12-day-old wild-type plants (B) 12-day-old atmpk!2 mutants with both dwarf and wild-type looking plants. (B inset b) a closer view of a dwarf plant; black bars = 2 mm (C) 12-day-old atmpkl2 mutants in the next generation with homogeneous wild-type looking plants. 138 4.4.2 AtMPK12 may be required for guard cell development. Two aspects of the promoter activity and gene expression patterns of AtMPK12 are noteworthy. First, the pattern of G U S activity driven by the AtMPK12 promoter included strong expression in mature stomatal guard cells. This indicates the involvement of A t M P K l 2 in later stages of stomatal development and/or in stomata function. Similarly, Gt/S-expressing guard cells were not detectable in the stylar region of young pistils, but were detectable in the same region of mature siliques (Figure 4.11 J), indicating again that AtMPKl2 expression is most pronounced at later stages of stomatal development. The second observation is that AtMPKl2 was highly expressed in callus, a tissue that contains actively dividing cells (Chapter 2, Figure 2.2). This indicates that A t M P K l 2 may also be involved in a specific cell division process in plants. It is known that formation of Arabidopsis stomata requires at least one asymmetric and one symmetric division (Figure 4.2 and Nadeau and Sack 2003). Thus, A t M P K l 2 may be required for controlling specific cell division counts during stomatal development. These two observations indicate that A t M P K l 2 may function differently at different developmental stages. In contrast to AtMPK12, transcription of other stomata-associated genes, e.g. SDD1 and TMM, is particularly active in developing cells in the stomatal pathway. The TMM promoter was active in both daughter cells of the asymmetric division, i.e. the meristemoids and their neighbor cells (Nadeau and Sack, 2002a). Similarly, the SDD1 promoter was active in the smaller stomata precursor cells, the meristemoids and guard mother cells, whereas its activity decreased during guard cell formation and maturation (Von Groll et al, 2002). These genes are proposed to regulate early events in asymmetric cell division (Berger and Altmann, 2000; Geisler et al, 2000). The pattern of AtMPKl2 promoter activity with the late 139 developmental events in the stomatal pathway indicates that A t M P K l 2 might be involved in the terminal differentiation o f a guard mother cell to form guard cells. 4.4.3 Guard cell-specific AtMPK12 is involved in osmotic stress response. Some members o f the plant M A P K gene family have been previously identified as salt or osmotic stress-responsive genes; for example, A t M K K 2 , A t M P K 4 , A t M P K 6 , SEV1KK, S I M K , N t M E K 2 , S IPK and W I P K (Chapter 4 Introduction and references therein). In my study, an increase in AtMPKl2 promoter activity upon N a C l treatments in stomatal guard cells indicates the involvement of the AtMPKl2 gene product in transducing the salt stress signal in these specialized cells. Protein phosphorylation plays an important role in the regulation of stomatal aperture and in ion transport in guard cells (L i et al, 1998), and the guard-cell specific activity pattern of the AtMPKl2 promoter is similar to that of the promoter o f the KAT1 gene, which encodes a potassium channel (Figure 4.12 and Nakamura et al, (1995)). Another ion transporter gene, AtNHXl (Arabidopsis thaliana sodium proton exchanger 1) is also exclusively expressed in stomatal guard cells (Shi and Zhu, 2002). It is tempting to suggest that A t M P K l 2 might function in regulation of one or more classes o f ion channels that control stomata opening and closing. Interestingly, expression of the AtNHXl gene was also increased by treatment o f leaves with N a C l , KC1 or A B A (Shi and Zhu, 2002), and overexpression o f the AtNHXl gene conferred increased salt tolerance (Apse et al, 1999). A t N H X l has been proposed to regulate N a + compartmentation in the vacuole under salt stress (Zhu, 2001b). 140 I also showed that mannitol treatment enhanced the activity o f the AtMPK12 promoter in leaf stomata and in roots. One common feature o f both salt and mannitol stresses is osmotic stress (Kreps et al, 2002), presumably because these agents generate a common water deficiency stress. This triggers the expression of genes whose products are involved in cell and/or whole plant protection from the water deficit, locally or distantly. For example, more osmolytes are synthesized, as is the plant hormone abscisic acid ( A B A ) , and more water channels are produced or activated. It has been established that roots exposed to drought synthesize A B A and export it from root xylem to leaves, where it induces stomatal closure (Wilkinson and Davies, 2002). It has been demonstrated that injection o f A B A into the xylem (Zhang and Outlaw, 2001a) and slow drying of the entire roots (Zhang and Outlaw, 2001b) increase the concentration o f xylem-derived A B A up to 30-fold in guard cells (Outlaw, 2003). Together, the observation of AtMPKll promoter activity in both stomatal guard cells and root tissues would be consistent with the involvement o f this gene in osmotic stress response. However, it does not appear that expression of AtMPKl 2 is directly regulated by A B A , since exogenously applied A B A had no significant effect on the AtMPK12 promoter-GUS activity in this study (data not shown). This result is consistent with SOS1 work (Shi et al, 2000) in that SOS1 can be induced transcriptionally by N a C l , but not by A B A . Although, my results indicate that A B A does not control the AtMPKl2 gene at the transcriptional level, this does not exclude the possibility that A B A could have an effect at the post-transcriptional level. For example, the activation o f A t M P K 4 and A t M P K 6 in response to osmotic stresses was not associated with changes in the amount of the cognate m R N A or protein (Ichimura et al, 2000). Similarly, A B A had no detectable effect on the transcript level o f the protein kinase, OST1, or on the level o f OST1 promoter-GUS activity, 141 but it did induce the activation of the OST1 kinase. Notably, OST1 expression and its promoter activity are also associated with the guard cells (Musti l l i et al, 2002). 4.4.5 Concluding remarks Through molecular biology and reverse genetics approaches, I have identified a novel guard cell-specific M A P K , A t M P K l 2, that may be involved in correct guard cell development/patterning in normal growth conditions. In addition, I have shown that expression of AtMPKll is also salt-stress and osmotic-stress regulated. The mechanisms/pathways within which A t M P K l 2 operates in guard cell development or patterning and in response to salt and osmotic stress signal transduction remain largely unknown. Identification of A t M P K l 2 upstream regulators (e.g. M A P K K s and M A P K K K s ) and downstream targets (e.g. transcription factors or other proteins) would be a priority. AtMPKll gene expression has been shown to be upregulated in yda mutant and downregulated in AN-YDA, a constitutively active version of Y D A (Supporting online material in Bergmann et al, 2004). This data raises the question whether Y O D A is an upstream M A P K K K signaling to A t M P K l 2 . Biochemical investigations w i l l be required to address this question, and further detailed characterization of the phenotypes of the atmpkll mutant would be required to address questions on the role(s) of A t M P K l 2 at specific stages during guard cell development and function. 142 CHAPTER 5 Overall Thesis Discussion and Future Directions 5.1 Transcriptional profiling approach versus developmental signaling In my thesis research I screened Arabidopsis MAPK and MAPKK genes for their expression pattern, selected the most interesting candidate genes based on these expression patterns, formed hypotheses concerning their possible function(s), and tested the hypotheses with more specific experiments. However, many o f the MAPK gene family members appear to function without marked changes over time and development at the transcriptional level. Therefore, expression profil ing provides only limited information. Notably, all of the candidate genes chosen for further detailed functional characterization in this study appear to be involved in plant development. They are well differentiated in their expression in Arabidopsis cells, tissues and organs, which is not surprising given the basis of their selection. For these family members, at least, the pattern of transcript levels for particular M A P K signaling molecules can provide an initial indication of their molecular function. It is interesting that some MAPKJMAPKK genes display large differences in transcriptional activity during development whereas others apparently do not. There are at least two possible explanations. (1) The gene products may be required for routine functioning of specific cells or tissues, and these cells are increasing in number or size at a particular point in development. In this scenario, a M A P K / M A P K K gene produces more m R N A in order to generate more o f the encoded proteins in order to meet the needs of multiple copies of similar cell types, or to execute more of the same process in existing cells. The amount of transcript may be critical 143 for production of a certain threshold level of a protein that regulates downstream targets. For example, in the case of the PID gene, the amount o f its gene product is critical for its function in regulating P IN protein localization (Kaplinsky and Barton, 2004). (2) In the case of the AtMKK6 and AtMPKl3 genes, their gene products are presumably required for particular functions associated with initiation of a new tissue, lateral root primordia, within the pericycle. 5.2 Characterization of developmentally regulated genes using an inducible RNAi approach Timing is critical in developmental processes; therefore, I used an inducible expression system in my study. The inducible R N A i approach is good for the functional analysis o f developmentally regulated genes because gene expression can be interfered at a certain point during a biological process of interest. For example, I was able to use A t M K K 6 R N A i and A t M P K l 3 R N A i for a lateral root formation assay by inducing the R N A i to interfere with the formation of lateral roots at the age that plants started to form these organs, (see Chapter 3). 5.3. Future directions M y thesis makes a significant contribution to the characterization o f the MAPK gene family in plants, but there are many issues that need to be pursued further. Some of these issues would require new methodology and specific molecular tools, e.g. protein-specific antibodies. Suggestions for both complementary work and in-depth exploration of issues arising from my thesis results are presented as follows. 144 5.3.1 Systematic analysis of the MAPKKK genes When I started my Ph.D. thesis in the year 1999, expression data for Arabidopsis genes was sparse in the publicly available databases, but extensive gene expression data is now available such as T A I R (http://www.arabidopsis.org/links/microarrays.jspl M P S S (http://mpss.udel. edu/ at/). Plantsp (http://plantsp.genomics.purdue.edu/) and G E N E V E S T I G A T O R : Arabidopsis Microarray Database and Analysis Toolbox (https://www.genevestigator.ethz.ch/V It would therefore not require expensive and time-consuming experiments to obtain expression profiles for most members of any given gene family. M y thesis indicates that a transcriptional profi l ing survey would be a useful entry point for systematic analysis o f the MAPKKK genes, the class o f MAPK gene family that presumably functions at the top o f M A P K cascades. Since MAPKK and MAPK genes, the middle and the bottom components o f these cascades, are transcriptionally regulated, it would be expected that some AtMKKK genes would also be transcriptionally regulated. Such transcriptional profi l ing would be a useful approach to identification o f candidate genes worthy o f further functional characterization. For example, the Arabidopsis orthologs of NPK1 namely, ANP1, ANP2 and ANP3, are highly expressed in organs that are rich in dividing cells (Nishihama et al, 1997). These kinases are prime candidates to be tested for being upstream components of A t M K K 6 and/or A t M P K l 3. 5.3.2 Use inducible promoters to drive AtMPKH gene constructs in stomata of transgenic plants The AtMPKH gene is expressed in guard cells of most aerial tissues under normal growth conditions. This pattern indicates that A T M P K 1 2 may be involved in stomatal development. 145 Therefore, I anticipate that loss-of-function or gain-of-function in A T M P K 1 2 would interfere with this developmental process. To clarify the possible function o f A T M P K 1 2 in stomatal development, it would be useful to specifically interfere with stomatal AtMPK12 expression by using an inducible promoter or tissue-specific promoter to drive expression of AtMPKl2 gene constructs ( R N A i or over-expression of the gene) and perform analyses o f the stomatal development. 5.3.3 Identification of the MAPK protein network On the one hand, to identify an upstream component of A T M P K 1 2 , one could use an in vivo phosphorylation assay and identify which A T M K K s can phosphorylate the A T M P K 1 2 . On the other hand, one could use microarray analysis with the AtMPK12 T - D N A mutant or inducible A t M P K l 2 R N A i transgenic plants to identify possible downstream targets of A T M P K 1 2 . 5.3.4 Further characterization of the mutant and transgenic plants It would be interesting to investigate the possible roles of the A t M K K 6 and A t M P K l 3 in auxin polar transport and L R P cell-division using immunolocalization techniques (Sugimoto et al, 2000; Fr iml et al, 2004) with the A t M K K 6 R N A i and A t M P K l 3 R N A i transgenic plants. In the case o f A t M P K l 2 , I am interested in further characterizing atmpkl2 plants to investigate their guard cell function such as guard cell opening and closing. 146 REFERENCES Abel, S., and Theologis, A . (1996). Early genes and auxin action. Plant Physiol 111, 9-17. Agrawal, G.K. , Rakwal, R., and Iwahashi, H . (2002). Isolation of novel rice (Oryza sativa L.) multiple stress responsive M A P kinase gene, O s M S R M K 2 , whose m R N A accumulates rapidly in response to environmental cues. Biochem Biophys Res Commun294, 1009-1016. Ahlfors, R., Macioszek, V. , Rudd, J . , Brosche, M . , Schlichting, R., Scheel, D., and Kangasjarvi, J . (2004). Stress hormone-independent activation and nuclear translocation o f mitogen-activated protein kinases in Arabidopsis thaliana during ozone exposure. Plant J 40, 512-522. Ahn, N.G. , Seger, R., Bratlien, R .L . , Diltz, C.D., Tonks, N.K., and Krebs, E . G . (1991). Mult iple components in an epidermal growth factor-stimulated protein kinase cascade. In vitro activation of a myelin basic protein/microtubule-associated protein 2 kinase. J B io l Chem 266,4220-4227. Alonso, J . M . , Stepanova, A.N. , Leisse, T.J . , Kim, C.J . , Chen, H . , Shinn, P., Stevenson, D.K., Zimmerman, J . , Barajas, P., Cheuk, R., Gadrinab, C , Heller, C , Jeske, A. , Koesema, E . , Meyers, C .C . , Parker, H . , Prednis, L . , Ansari, Y. , Choy, N., Deen, H . , Geralt, M . , Hazari, N., Horn, E . , Karnes, M . , Mulholland, C , Ndubaku, R., Schmidt, I., Guzman, P., Aguilar-Henonin, L . , Schmid, M . , Weigel, D., Carter, D.E. , Marchand, T., Risseeuw, E . , Brogden, D., Zeko, A. , Crosby, W.L . , Berry, C .C . , and Ecker, J.R. (2003). Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653-657. Apse, M.P., Aharon, G.S., Snedden, W.A., and Blumwald, E . (1999). Salt tolerance conferred by overexpression o f a vacuolar Na+/H+ antiport in Arabidopsis. Science 285, 1256-1258. Asai, T., Tena, G. , Plotnikova, J . , Willmann, M.R., Chiu, W.L . , Gomez-Gomez, L . , Boiler, T., Ausubel, F . M . , and Sheen, J . (2002). M A P kinase signalling cascade in Arabidopsis innate immunity. Nature 415, 977-983. Baier, M . , Kandlbinder, A. , Golldack, D., and Dietz, K . - J . (2005). Oxidative stress and ozone: Perception, signalling and response. Plant, Ce l l and Environment, 1-9. Ballas, N., Wong, L . M . , and Theologis, A . (1993). Identification o f the auxin-responsive element, A u x R E , in the primary indoleacetic acid-inducible gene, PS- IAA4 /5 , o f pea (Pisum sativum). J M o l B io l 233, 580-596. Banno, H . , Hirano, K. , Nakamura, T., Irie, K. , Nomoto, S., Matsumoto, K. , and Machida, Y . (1993). N P K 1 , a tobacco gene that encodes a protein with a domain homologous to yeast B C K 1 , STE11, and Byr2 protein kinases. M o l Cel l B i o l 13, 4745-4752. Beeckman, T., Burssens, S., and Inze, D. (2001). The peri-cell-cycle in Arabidopsis. J Exp Bot 52, 403-411. Berger, D., and Altmann, T. (2000). A subtilisin-like serine protease involved in the regulation of stomatal density and distribution in Arabidopsis thaliana. Genes Dev 14, 1119-1131. Bergmann, D.C. (2004). Integrating signals in stomatal development. Curr Opin Plant B io l 7, 26-32. 147 Bergmann, D.C. , Lukowitz, W., and Somerville, C.R. (2004). Stomatal development and pattern controlled by a M A P K K kinase. Science 304, 1494-1497. Bhalerao, R.P., Eklof, J . , Ljung, K. , Marchant, A. , Bennett, M . , and Sandberg, G . (2002). Shoot-derived auxin is essential for early lateral root emergence in Arabidopsis seedlings. Plant J 29, 325-332. Boerjan, W., Cervera, M.T . , Delarue, M . , Beeckman, T., Dewitte, W., Bellini, C. , Caboche, M . , Van Onckelen, H . , Van Montagu, M . , and Inze, D. (1995). Superroot, a recessive mutation in Arabidopsis, confers auxin overproduction. Plant Ce l l 7, 1405-1419. Bogre, L . , Ligterink, W., Meskiene, I., Barker, P.J., Heberle-Bors, E . , Huskisson, N.S., and Hirt, H . (1997). Wounding induces the rapid and transient activation o f a specific M A P kinase pathway. Plant Ce l l 9, 75-83. Bogre, L . , Calderini, O., Binarova, P., Mattauch, M . , Till, S., Kiegerl, S., Jonak, C , Pollaschek, C , Barker, P., Huskisson, N.S., Hirt, H . , and Heberle-Bors, E . (1999). A M A P kinase is activated late in plant mitosis and becomes localized to the plane o f cell division. Plant Ce l l 11,101-113. Bolwell, G.P. (1996). The origin of the oxidative burst in plants. Biochem Soc Trans 24, 438-442. Boulton, T . G . , Yancopoulos, G.D., Gregory, J.S., Slaughter, C , Moomaw, C , Hsu, J . , and Cobb, M . H . (1990). A n insulin-stimulated protein kinase similar to yeast kinases involved in cell cycle control. Science 249, 64-67. Brenner, S., Johnson, M . , Bridgham, J . , Golda, G. , Lloyd, D.H. , Johnson, D., Luo, S., McCurdy, S., Foy, M . , Ewan, M . , Roth, R., George, D., Eletr, S., Albrecht, G. , Vermaas, E . , Williams, S.R., Moon, K. , Burcham, T., Pallas, M . , DuBridge, R.B., Kirchner, J . , Fearon, K. , Mao, J . , and Corcoran, K . (2000). Gene expression analysis by massively parallel signature sequencing (MPSS) on microbead arrays. Nat Biotechnol 18, 630-634. Brunet, A., Roux, D., Lenormand, P., Dowd, S., Keyse, S., and Pouyssegur, J . (1999). Nuclear translocation o f p42/p44 mitogen-activated protein kinase is required for growth factor-induced gene expression and cell cycle entry. E M B O J 18, 664-674. Burnett, E . C . , Desikan, R., Moser, R.C. , and Neill, S.J. (2000). A B A activation of an M B P kinase in Pisum sativum epidermal peels correlates with stomatal responses to A B A . J Exp Bot 51, 197-205. Calderini, O., Glab, N., Bergounioux, C , Heberle-Bors, E . , and Wilson, C . (2001). A novel tobacco mitogen-activated protein ( M A P ) kinase kinase, N t M E K l , activates the cell cycle-regulated p43Ntf6 M A P kinase. J B io l Chem 276, 18139-18145. Calderini, O., Bogre, L . , Vicente, O., Binarova, P., Heberle-Bors, E . , and Wilson, C . (1998). A cell cycle regulated M A P kinase with a possible role in cytokinesis in tobacco cells. J Cel l Sci 111 (Pt 20), 3091-3100. Cardinale, F., Meskiene, I., Ouaked, F., and Hirt, H . (2002). Convergence and divergence of stress-induced mitogen-activated protein kinase signaling pathways at the level of two distinct mitogen-activated protein kinase kinases. Plant Ce l l 14, 703-711. Casimiro, I., Beeckman, T., Graham, N., Bhalerao, R., Zhang, H. , Casero, P., Sandberg, G. , and Bennett, M . J . (2003). Dissecting Arabidopsis lateral root development. Trends Plant Sci 8,165-171. 148 Casimiro, I., Marchant, A. , Bhalerao, R.P., Beeckman, T., Dhooge, S., Swarup, R., Graham, N., Inze, D., Sandberg, G. , Casero, P.J., and Bennett, M . (2001). Aux in transport promotes Arabidopsis lateral root initiation. Plant Ce l l 13, 843-852. Celenza, J .L . , Grisafi, P.L., and Fink, G.R. (1995). A pathway for lateral root-formation in Arabidopsis thaliana. Gene Dev 9, 2131-2142. Clough, S.J., and Bent, A .F . (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735-743. Cooper, J.A., Bowen-Pope, D.F., Raines, E . , Ross, R., and Hunter, T. (1982). Similar effects of platelet-derived growth factor and epidermal growth factor on the phosphorylation o f tyrosine in cellular proteins. Ce l l 31, 263-273. Coruzzi, G . M . , and Zhou, L . (2001). Carbon and nitrogen sensing and signaling in plants: emerging 'matrix effects'. Curr Opin Plant B io l 4, 247-253. Courchesne, W.E . , Kunisawa, R., and Thorner, J . (1989). A putative protein kinase overcomes pheromone-induced arrest o f cell cycling in S. cerevisiae. Ce l l 58, 1107-1119. Crews, C M . , and Erikson, R . L . (1992). Purification of a murine protein-tyrosine/threonine kinase that phosphorylates and activates the Erk-1 gene product: relationship to the fission yeast byr l gene product. Proc Natl Acad Sci U S A 89, 8205-8209. Crews, C M . , Alessandrini, A., and Erikson, R . L . (1992). The primary structure o f M E K , a protein kinase that phosphorylates the E R K gene product. Science 258,478-480. Desikan, R., Hancock, J.T. , Coffey, M.J . , and Neill, S.J. (1996). Generation o f active oxygen in elicited cells of Arabidopsis thaliana is mediated by a N A D P H oxidase-like enzyme. F E B S Lett 382,213-217. Desikan, R., Hancock, J.T. , Ichimura, K. , Shinozaki, K. , and Neill, S.J. (2001). Harpin induces activation o f the Arabidopsis mitogen-activated protein kinases A t M P K 4 and A t M P K 6 . Plant Physiol 126, 1579-1587. Doerner, P., Jorgensen, J .E . , You, R., Steppuhn, J . , and Lamb, C (1996). Control of root growth and development by cycl in expression. Nature 380, 520-523. Dolan, L . , Janmaat, K. , Willemsen, V. , Linstead, P., Poethig, S., Roberts, K. , and Scheres, B. (1993). Cellular-organization o f the Arabidopsis thaliana root. Development 119, 71-84. Droillard, M . , Boudsocq, M . , Barbier-Brygoo, H . , and Lauriere, C . (2002). Different protein kinase families are activated by osmotic stresses in Arabidopsis thaliana cell suspensions. Involvement of the M A P kinases A t M P K 3 and A t M P K 6 . F E B S Lett 527,43-50. Dubrovsky, J .G. , Doerner, P.W., Colon-Carmona, A. , and Rost, T . L . (2000). Pericycle cell proliferation and lateral root initiation in Arabidopsis. Plant Physiol 124, 1648-1657. Edwards, K. , Johnstone, C , and Thompson, C (1991). A simple and rapid method for the preparation of plant genomic D N A for P C R analysis. Nuc l . Ac ids Res. 19, 1349-. Elion, E.A. , Grisafi, P.L., and Fink, G.R. (1990). FUS3 encodes a cdc2+/CDC28-related kinase required for the transition from mitosis into conjugation. Ce l l 60, 649-664. Epstein, E . , Norlyn, J.D., Rush, D.W., Kingsbury, R.W., Kelley, D.B., Cunningham, G.A., and Wrona, A . F . (1980). Saline culture o f crops: a genetic approach. Science 210, 399-404. 149 Friml, J . , Yang, X. , Michniewicz, M . , Weijers, D., Quint, A., Tietz, O., Benjamins, R., Ouwerkerk, P.B., Ljung, K. , Sandberg, G. , Hooykaas, P.J., Palme, K. , and Offringa, R. (2004). A PINOID-dependent binary switch in apical-basal P IN polar targeting directs auxin efflux. Science 306, 862-865. Frye, C.A. , Tang, D., and Innes, R.W. (2001). Negative regulation of defense responses in plants by a conserved M A P K K kinase. Proc Natl Acad Sci U S A 98, 373-378. Fu, S.F., Chou, W.C. , Huang, D.D., and Huang, H.J . (2002). Transcriptional regulation o f a rice mitogen-activated protein kinase gene, O s M A P K 4 , in response to environmental stresses. Plant Cel l Physiol 43, 958-963. Galweiler, L . , Guan, C , Muller, A., Wisman, E . , Mendgen, K. , Yephremov, A. , and Palme, K. (1998). Regulation of polar auxin transport by A t P I N l in Arabidopsis vascular tissue. Science 282,2226-2230. Geisler, M . , Yang, M . , and Sack, F.D. (1998). Divergent regulation of stomatal initiation and patterning in organ and suborgan regions of the Arabidopsis mutants too many mouths and four lips. Planta 205, 522-530. Geisler, M . , Nadeau, J . , and Sack, F.D. (2000). Oriented asymmetric divisions that generate the stomatal spacing pattern in Arabidopsis are disrupted by the too many mouths mutation. Plant Ce l l 12, 2075-2086. Grabov, A. , Leung, J . , Giraudat, J . , and Blatt, M.R. (1997). Alteration o f anion channel kinetics in wild-type and abil-1 transgenic Nicotiana benthamiana guard cells by abscisic acid. Plant J 12,203-213. Green, R., and Fluhr, R. (1995). UV-B-Induced PR-1 Accumulation is mediated by active oxygen species. Plant Ce l l 7, 203-212. Gupta, R., Huang, Y. , Kieber, J . , and Luan, S. (1998). Identification of a dual-specificity protein phosphatase that inactivates a M A P kinase from Arabidopsis. Plant J 16, 581-589. Gustin, M . C , Albertyn, J . , Alexander, M . , and Davenport, K. (1998a). M A P kinase pathways in the yeast Saccharomyces cerevisiae. Microbio l M o l B io l Rev 62, 1264-1300. Gustin, M . C , Albertyn, J . , Alexander, M . , and Davenport, K. (1998b). M A P kinase pathways in the yeast Saccharomyces cerevisiae. Microbio l M o l B io l Rev 62,1264-+. Halfter, U., Ishitani, M . , and Zhu, J .K. (2000). The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3. Proc Natl Acad Sci U S A 97, 3735-3740. Hamal, A. , Jouannic, S., Leprince, A.-S., Kreis, M . , and Henry, Y . (1999). Molecular characterization and expression of an Arabidopsis thaliana L. M A P kinase kinase c D N A , AtMAP2K[a lpha] . Plant Science 140,49-64. Hardin, S . C , and Wolniak, S.M. (1998). Molecular cloning and characterization o f maize Z m M E K l , a protein kinase with a catalytic domain homologous to mitogen- and stress-activated protein kinase kinases. Planta 206, 577-584. Hasegawa, P.M., Bressan, R.A., Zhu, J .K. , and Bohnert, H.J . (2000). Plant cellular and molecular responses to high salinity. Annu Rev Plant Physiol Plant M o l B io l 51, 463-499. Herskowitz, I. (1995). M A P kinase pathways in yeast: for mating and more. Ce l l 80, 187-197. 150 Hey, S.J., Bacon, A. , Burnett, E . C . , and Neill, S.J. (1997). Abscisic acid signal transduction in epidermis cells o f Pisum sativaum L. Argentewn: both dehydrin m R N A accumulation and stomatal responses require protein phosphorylation and dephosphorylation. Planta 202, 85-92. Higo, K. , Ugawa, Y. , Iwamoto, M . , and Korenaga, T. (1999). Plant cis-acting regulatory D N A elements ( P L A C E ) database: 1999. Nucleic Ac ids Res 27,297-300. Himanen, K. , Boucheron, E . , Vanneste, S., de Almeida Engler, J . , Inze, D., and Beeckman, T. (2002). Auxin-mediated cell cycle activation during early lateral root initiation. Plant Ce l l 14,2339-2351. Hirt, H . (2000). M A P kinases in plant signal transduction. Results Probl Cel l Differ 27, 1-9. Hobbie, L . , and Estelle, M . (1994). Genetic approaches to auxin action. Plant Ce l l Environ 17, 525-540. Huang, X. , Stettmaier, K. , Michel, C , Hutzler, P., Mueller, M.J . , and Durner, J . (2004). Nitr ic oxide is induced by wounding and influences jasmonic acid signaling in Arabidopsis thaliana. Planta 218, 938-946. Huang, Y. , L i , H . , Gupta, R., Morris, P.C., Luan, S., and Kieber, J .J . (2000). A T M P K 4 , an Arabidopsis homolog of mitogen-activated protein kinase, is activated in vitro by A t M E K l through threonine phosphorylation. Plant Physiol 122, 1301-1310. Ichimura, K. , Mizoguchi, T., Hayashida, N., Seki, M . , and Shinozaki, K . (1998a). Molecular cloning and characterization o f three c D N A s encoding putative mitogen-activated protein kinase kinases ( M A P K K s ) in Arabidopsis thaliana. D N A Res 5, 341-348. Ichimura, K. , Mizoguchi, T., Yoshida, R., Yuasa, T., and Shinozaki, K . (2000). Various abiotic stresses rapidly activate Arabidopsis M A P kinases A T M P K 4 and A T M P K 6 . Plant J 24, 655-665. Ichimura, K. , Mizoguchi, T., Irie, K. , Morris, P., Giraudat, J . , Matsumoto, K. , and Shinozaki, K . (1998b). Isolation of A T M E K K 1 (a M A P kinase kinase kinase)-interacting proteins and analysis o f a M A P kinase cascade in Arabidopsis. Biochem Biophys Res Commun 253, 532-543. Ishikawa, M . , Soyano, T., Nishihama, R., and Machida, Y . (2002). The N P K 1 mitogen-activated protein kinase kinase kinase contains a functional nuclear localization signal at the binding site for the N A C K 1 kinesin-like protein. Plant J 32, 789-798. Ishitani, M . , Liu, J . , Halfter, U., Kim, C.S., Shi, W., and Zhu, J .K. (2000). SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding. Plant Cel l 12, 1667-1678. Jefferson, R.A. (1987). Assaying chimeric genes in plants: The G U S gene fusion system. plant molecular biology reporter 5, 387-405. Johnson, P.R., and Ecker, J.R. (1998). The ethylene gas signal transduction pathway: a molecular perspective. Annu Rev Genet 32, 227-254. Jonak, C , and Hirt, H . (2002). Glycogen synthase kinase 3 / S H A G G Y - l i k e kinases in plants: an emerging family with novel functions. Trends in Plant Science 7,457-461. Jonak, C , Okresz, L . , Bogre, L . , and Hirt, H . (2002). Complexity, cross talk and integration of plant M A P kinase signalling. Curr Opin Plant B io l 5,415-424. Jonak, C , Kiegerl, S., Ligterink, W., Barker, P.J., Huskisson, N.S., and Hirt, H . (1996). Stress signaling in plants: a mitogen-activated protein kinase pathway is activated by cold and drought. Proc Natl Acad Sci U S A 93, 11274-11279. 151 Jouannic, S., Hamal, A. , Leprince, A.S., Tregear, J.W., Kreis, M . , and Henry, Y . (1999). Characterisation o f novel plant genes encoding M E K K 7 S T E 1 1 and RAF-related protein kinases. Gene 229, 171-181. Kaplinsky, N.J., and Barton, M . K . (2004). Plant biology. Plant acupuncture: sticking PINs in the right places. Science 306, 822-823. Kieber, J .J. , Rothenberg, M . , Roman, G. , Feldmann, K .A. , and Ecker, J.R. (1993). C T R 1 , a negative regulator o f the ethylene response pathway in Arabidopsis, encodes a member of the raf family o f protein kinases. Ce l l 72,427-441. Kiegerl, S., Cardinale, F., Siligan, C , Gross, A. , Baudouin, E . , Liwosz, A. , Eklof, S., Till , S., Bogre, L . , Hirt, H . , and Meskiene, I. (2000). SEVIKK, a mitogen-activated protein kinase ( M A P K ) kinase, is a specific activator o f the salt stress-induced M A P K , S I M K . Plant Ce l l 12, 2247-2258. Knetsch, M . , Wang, M . , Snaar-Jagalska, B.E. , and Heimovaara-Dijkstra, S. (1996). Abscisic acid induces mitogen-activated protein kinase activation in barley aleurone protoplasts. Plant Ce l l 8, 1061-1067. Kovtun, Y. , Chiu, W.L. , Zeng, W., and Sheen, J . (1998). Suppression of auxin signal transduction by a M A P K cascade in higher plants. Nature 395, 716-720. Kovtun, Y. , Chiu, W.L . , Tena, G. , and Sheen, J . (2000). Functional analysis o f oxidative stress-activated mitogen-activated protein kinase cascade in plants. Proc Natl Acad Sci U S A 97, 2940-2945. Kreps, J.A., Wu, Y. , Chang, H.S., Zhu, T., Wang, X. , and Harper, J .F. (2002). Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress. Plant Physiol 130, 2129-2141. Krysan, P.J., Jester, P.J., Gottwald, J.R., and Sussman, M.R. (2002). A n Arabidopsis mitogen-activated protein kinase kinase kinase gene family encodes essential positive regulators o f cytokinesis. Plant Ce l l 14, 1109-1120. Kyriakis, J . M . , App, H . , Zhang, X.F. , Banerjee, P., Brautigan, D.L. , Rapp, U.R., and Avruch, J . (1992). Raf-1 activates M A P kinase-kinase. Nature 358,417-421. Lange-Carter, C.A. , Pleiman, C M . , Gardner, A . M . , Blumer, K . J . , and Johnson, G . L . (1993). A divergence in the M A P kinase regulatory network defined by M E K kinase and Raf. Science 260, 315-319. Larkin, J .C. , Brown, M . L . , and Schiefelbein, J . (2003). How do cells know what they want to be when they grow up? Lessons from epidermal patterning in Arabidopsis. Annu Rev Plant B io l 54,403-430. Larkin, J . C , Marks, M.D. , Nadeau, J . , and Sack, F. (1997). Epidermal cell fate and patterning in leaves. Plant Ce l l 9,1109-1120. Laskowski, M.J . , Williams, M . E . , Nusbaum, H . C , and Sussex, I .M. (1995). Formation o f lateral root meristems is a two-stage process. Development 121, 3303-3310. Le Deunff, E . , Davoine, C , Le Dantec, C , Billard, J.P., and Huault, C . (2004). Oxidative burst and expression of germin/oxo genes during wounding o f ryegrass leaf blades: comparison with senescence of leaf sheaths. Plant J 38,421-431. Lescot, M . , Dehais, P., Thijs, G. , Marchal, K. , Moreau, Y. , Van de Peer, Y. , Rouze, P., and Rombauts, S. (2002). P lan tCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis o f promoter sequences. Nucleic Acids Res 30, 325-327. 152 Leung, J . , and Giraudat, J . (1998). Abscisic acid signal transduction. Annu Rev Plant Physiol Plant M o l B io l 49, 199-222. Leung, J . , Merlot, S., and Giraudat, J . (1997). The Arabidopsis ABSCISIC ACID INSENSITIVE 2 (ABI2) and ABI1 genes encode redandant protein phosphatases 2C involved in abscisic acid signal transduction. Plant Ce l l 9, 759-771. Leung, J . , Bouvier-Durand, M . , Morris, P . - C , Guerrier, D., Chefdor, F. , and Giraudat, J . (1994). Arabidopsis ABA-response gene A B I 1 : features o f a calcium-modulated protein phosphatase. Science 264, 1448-1452. L i , J . , and Assmann, S.M. (1996). A n abscisic acid-activated and calcium-independent protein kinase from guard cells of fava bean. Plant Ce l l 8, 2359-2368. L i , J . , Lee, Y.R., and Assmann, S.M. (1998). Guard cells possess a calcium-dependent protein kinase that phosphorylates the K A T 1 potassium channel. Plant Physiol 116, 785-795. L i , J . , Wang, X.Q. , Watson, M.B. , and Assmann, S.M. (2000). Regulation o f abscisic acid-induced stomatal closure and anion channels by guard cell A A P K kinase. Science 287, 300-303. Ligterink, W., and Hirt, H . (2001). Mitogen-activated protein ( M A P ) kinase pathways in plants: versatile signaling tools. Int Rev Cytol 201, 209-275. Liu, J . , Ishitani, M . , Halfter, U . , Kim, C.S., and Zhu, J .K. (2000). The Arabidopsis thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance. Proc Natl Acad Sci U S A 97, 3730-3734. Liu, S., and Zhu, J .K. (1997). A n Arabidopsis mutant that requires increased calcium for potassium nutrition and salt tolerance. P N A S 94,14960-14964. Liu, S., and Zhu, J .K. (1998). A calcium sensor homolog required for plant salt tolerance. Science 280, 1943-1945. Liu, Y. , and Zhang, S. (2004). Phosphorylation o f 1-aminocyclopropane-l-carboxylic acid synthase by M P K 6 , a stress-responsive mitogen-activated protein kinase, induces ethylene biosynthesis in Arabidopsis. Plant Ce l l 16, 3386-3399. Liu, Y. , Jin, H . , Yang, K .Y . , Kim, C.Y. , Baker, B., and Zhang, S. (2003). Interaction between two mitogen-activated protein kinases during tobacco defense signaling. Plant J 34,149-160. Luan, S. (2002). Signalling drought in guard cells. Plant Ce l l Environ 25,229-237. Lukowitz, W., Roeder, A. , Parmenter, D., and Somerville, C . (2004). A M A P K K kinase gene regulates extra-embryonic cell fate in Arabidopsis. Cel l 116,109-119. MacRobbie, E . A . C . (1997). Signalling in guard cells and regulation of ion channel activity. J E x p B o t 48,515-528. Malamy, J .E . , and Benfey, P.N. (1997). Organization and cell differentiation in lateral roots of Arabidopsis thaliana. Development 124, 33-44. Malamy, J .E . , and Ryan, K.S. (2001). Environmental regulation o f lateral root initiation in Arabidopsis. Plant Physiol 127, 899-909. M A P K Group. (2002). Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends Plant Sci 7, 301-308. Matsuoka, D., Nanmori, T., Sato, K. , Fukami, Y. , Kikkawa, U . , and Yasuda, T. (2002). Activation o f A t M E K l , an Arabidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis o f active mutants expressed in E. col i and generation o f the active form in stress response in seedlings. Plant J 29, 637-647. 153 Mayrose, M . , Bonshtien, A. , and Sessa, G . (2004). L e M P K 3 is a mitogen-activated protein kinase with dual specificity induced during tomato defense and wounding responses. J B io l Chem 279, 14819-14827. McNellis, T.W., Mudgett, M.B. , L i , K. , Aoyama, T., Horvath, D., Chua, N.H. , and Staskawicz, B.J. (1998). Glucocorticoid-inducible expression of a bacterial avirulence gene in transgenic Arabidopsis induces hypersensitive cell death. Plant J 14, 247-257. Mehdy, M . C . (1994). Act ive oxygen species in plant defense against pathogens. Plant Physiol 105, 467-472. Melaragno, J .E . , Mehrotra, B., and Coleman, A .W. (1993). Relationship between endopolyploidy and cell size in epidermal tissue of Arabidopsis. Plant Ce l l 5, 1661-1668. Melikant, B., Giuliani, C , Halbmayer-Watzina, S., Limmongkon, A. , Heberle-Bors, E . , and Wilson, C . (2004). The Arabidopsis thaliana M E K A t M K K 6 activates the M A P kinase A t M P K l 3 . F E B S Lett 576, 5-8. Meskiene, I., Baudouin, E . , Schweighofer, A., Liwosz, A. , Jonak, C , Rodriguez, P.L., Jelinek, H . , and Hirt, H . (2003). Stress-induced protein phosphatase 2C is a negative regulator of a mitogen-activated protein kinase. J B io l Chem 278, 18945-18952. Meyer, K. , Leube, M.P., and Grill, E . (1994). A protein phosphatase 2C involved in A B A signal transduction in Arabidopsis thaliana. Science 264, 1452-1455. Meyers, B.C. , Lee, D.K., Vu, T . H . , Tej, S.S., Edberg, S.B., Matvienko, M . , and Tindell, L .D . (2004a). Arabidopsis M P S S . an online resource for quantitative expression analysis. Plant Physiol 135, 801-813. Meyers, B.C. , Tej, S.S., Vu, T . H . , Haudenschild, C D . , Agrawal, V. , Edberg, S.B., Ghazal, H . , and Decola, S. (2004b). The use of M P S S for whole-genome transcriptional analysis in Arabidopsis. Genome Res 14, 1641-1653. Mikolajczyk, M . , Awotunde, O.S., Muszynska, G. , Klessig, D.F., and Dobrowolska, G . (2000). Osmotic stress induces rapid activation of a salicylic acid-induced protein kinase and a homolog o f protein kinase A S K 1 in tobacco cells. Plant Ce l l 12, 165-178. Mizoguchi, T., Ichimura, K. , and Shinozaki, K . (1997). Environmental stress response in plants: the role of mitogen-activated protein kinases. Trends Biotechnol 15,15-19. Mizoguchi, T., Irie, K. , Hirayama, T., Hayashida, N., Yamaguchi-Shinozaki, K. , Matsumoto, K. , and Shinozaki, K . (1996). A gene encoding a mitogen-activated protein kinase kinase kinase is induced simultaneously with genes for a mitogen-activated protein kinase and an S6 ribosomal protein kinase by touch, cold, and water stress in Arabidopsis thaliana. Proc Natl Acad Sci U S A 93, 765-769. Mizoguchi, T., Ichimura, K. , Irie, K. , Morris, P., Giraudat, J . , Matsumoto, K. , and Shinozaki, K . (1998). Identification o f a possible M A P kinase cascade in Arabidopsis thaliana based on pairwise yeast two-hybrid analysis and functional complementation tests of yeast mutants. F E B S Lett 437, 56-60. Mizoguchi, T., Gotoh, Y. , Nishida, E . , Yamaguchi-Shinozaki, K. , Hayashida, N., Iwasaki, T., Kamada, H . , and Shinozaki, K . (1994). Characterization of two c D N A s that encode M A P kinase homologues in Arabidopsis thaliana and analysis of the possible role of auxin in activating such kinase activities in cultured cells. Plant J 5,111-122. 154 Morris, P.C. (2001). M A P kinase signal transduction pathways in plants. New Phytol 151, 67-89. Morris, P . C , Guerrier, D., Leung, J . , and Giraudat, J . (1997). Cloning and characterisation of M E K 1 , an Arabidopsis gene encoding a homologue o f M A P kinase kinase. Plant M o l B io l 35, 1057-1064. Mustilli, A . C , Merlot, S., Vavasseur, A. , Fenzi, F., and Giraudat, J . (2002). Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production. Plant Ce l l 14, 3089-3099. Nadeau, J.A., and Sack, F.D. (2002a). Control o f stomatal distribution on the Arabidopsis leaf surface. Science 296, 1697-1700. Nadeau, J.A., and Sack, F.D. (2002b). The Arabidopsis Book. (Rockvil le, M D : American Society o f Plant Biologists). Nadeau, J.A., and Sack, F.D. (2003). Stomatal development: cross talk puts mouths in place. Trends Plant Sci 8, 294-299. Nakagami, H . , Kiegerl, S., and Hirt, H . (2004). O M T K 1 , a novel M A P K K K , channels oxidative stress signaling through direct M A P K interaction. J B io l Chem 279, 26959-26966. Nakamura, R.L. , McKendree, W.L . , Jr., Hirsch, R .E . , Sedbrook, J . C , Gaber, R.F. , and Sussman, M.R. (1995). Expression o f an Arabidopsis potassium channel gene in guard cells. Plant Physiol 109, 371-374. Nakashima, M . , Hirano, K. , Nakashima, S., Banno, H . , Nishihama, R., and Machida, Y. (1998). The expression pattern o f the gene for N P K 1 protein kinase related to mitogen-activated protein kinase kinase kinase ( M A P K K K ) in a tobacco plant: correlation with cell proliferation. Plant Ce l l Physiol 39, 690-700. Nishihama, R., and Machida, Y. (2000). The M A P kinase cascade that includes M A P K K K -related protein kinase N P K 1 controls a mitotic proces in plant cells. Results Probl Ce l l Differ 27, 119-130. Nishihama, R., Banno, H . , Kawahara, E . , Irie, K. , and Machida, Y . (1997). Possible involvement of differential splicing in regulation of the activity o f Arabidopsis A N P 1 that is related to mitogen-activated protein kinase kinase kinases ( M A P K K K s ) . Plant J 12, 39-48. Nishihama, R., Ishikawa, M . , Araki, S., Soyano, T., Asada, T., and Machida, Y . (2001). The N P K 1 mitogen-activated protein kinase kinase kinase is a regulator o f cell-plate formation in plant cytokinesis. Genes Dev 15, 352-363. Nuhse, T.S., Peck, S . C , Hirt, H . , and Boiler, T. (2000). Microbial elicitors induce activation and dual phosphorylation of the Arabidopsis thaliana M A P K 6. J B io l Chem 275, 7521-7526. Ouaked, F., Rozhon, W., Lecourieux, D., and Hirt, H . (2003). A M A P K pathway mediates ethylene signaling in plants. Embo J 22, 1282-1288. Outlaw. (2003). Integration o f cellular and physiological functions of guard cells. Crit Rev Plant Sci 22, 503-529. Outlaw, W.H. , Jr. (1983). Current concepts on the role o f potassium in stomatal movements. Physiol Plant 59, 302-311. Pages, G. , Lenormand, P., L'Allemain, G . , Chambard, J . C , Meloche, S., and Pouyssegur, J . (1993). Mitogen-activated protein kinases p42mapk and p44mapk are required for fibroblast proliferation. Proc Natl Acad Sci U S A 90, 8319-8323. 155 Pandey, S., and Assmann, S.M. (2004). The Arabidopsis putative G protein-coupled receptor G C R 1 interacts with the G protein alpha subunit G P A 1 and regulates abscisic acid signaling. Plant Cel l 16, 1616-1632. Pearson, G. , Robinson, F., Beers Gibson, T., Xu, B.E. , Karandikar, M . , Berman, K. , and Cobb, M . H . (2001). Mitogen-activated protein ( M A P ) kinase pathways: regulation and physiological functions. Endocr Rev 22, 153-183. Pei, Z . M . , Kuchitsu, K. , Ward, J . M . , Schwarz, M . , and Schroeder, J.I. (1997). Differential abscisic acid regulation of guard cell slow anion channels in Arabidopsis wild-type and abi l and abi2 mutants. Plant Cel l 9,409-423. Petersen, M . , Brodersen, P., Naested, H . , Andreasson, E . , Lindhart, U. , Johansen, B., Nielsen, H.B., Lacy, M . , Austin, M.J . , Parker, J .E . , Sharma, S.B., Klessig, D.F., Martienssen, R., Mattsson, O., Jensen, A.B. , and Mundy, J . (2000). Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. Ce l l 103, 1111-1120. Piao, H . L . , Lim, J .H. , Kim, S.J., Cheong, G.W., and Hwang, I. (2001). Constitutive over-expression o f A t G S K l induces N a C l stress responses in the absence of N a C l stress and results in enhanced N a C l tolerance in Arabidopsis. Plant J 27, 305-314. Pollok, B.A., and Heim, R. (1999). Using G F P in FRET-based applications. Trends Cel l B io l 9, 57-60. Poovaiah, B.W., Friedmann, M . , Reddy, A.S., and Rhee, J .K. (1988). Aux in induced delay of abscission: The involvement of calcium ions and protein phosphorylation in bean plants. Physiol Plant 73, 354-359. Prestamo, G. , Testillano, P.S., Vicente, O., Gonzalez-Melendi, P., Coronado, M.J . , Wilson, C , Heberle-Bors, E . , and Risueno, M . C . (1999). Ultrastructural distribution of a M A P kinase and transcripts in quiescent and cycling plant cells and pollen grains. J Cel l Sci 112 ( Pt 7), 1065-1076. Rashotte, A . M . , Brady, S.R., Reed, R.C. , Ante, S.J., and Muday, G.K. (2000). Basipetal auxin transport is required for gravitropism in roots of Arabidopsis. Plant Physiol 122, 481-490. Ray, L .B . , and Sturgill, T .W. (1987). Rapid stimulation by insulin of a serine/threonine kinase in 3T3-L1 adipocytes that phosphorylates microtubule-associated protein 2 in vitro. Proc Natl Acad Sci U S A 84, 1502-1506. Raz, V. , and Fluhr, R. (1993). Ethylene signal is transduced v ia protein phosphorylation events in plants. Plant Ce l l 5, 523-530. Reddy, A.S., Chengappa, S., and Poovaiah, B.W. (1987). Auxin-regulated changes in protein phosphorylation in pea epicotyls. Biochem Biophys Res Commun 144, 944-950. Reed, R.C. , Brady, S.R., and Muday, G.K. (1998). Inhibition o f auxin movement from the shoot into the root inhibits lateral root development in Arabidopsis. Plant Physiol 118, 1369-1378. Roelfsema, M.R., Levchenko, V. , and Hedrich, R. (2004). A B A depolarizes guard cells in intact plants, through a transient activation o f R- and S-type anion channels. Plant J 37, 578-588. Rossomando, A .J . , Payne, D .M. , Weber, M.J . , and Sturgill, T .W. (1989). Evidence that pp42, a major tyrosine kinase target protein, is a mitogen-activated serine/threonine protein kinase. Proc Natl Acad Sci U S A 86, 6940-6943. 156 Sakai, T., Takahashi, Y., and Nagata, T. (1996). Analysis of the promoter of the auxin-inducible gene, parC, of tobacco. Plant Ce l l Physiol 37, 906-913. Sambrook, J., Fritsch, E., and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd edition. (New York : Co ld Spring Harbor Laboratory Press). Samuel, M.A., and Ellis, B.E. (2002). Double jeopardy: both overexpression and suppression of a redox-activated plant mitogen-activated protein kinase render tobacco plants ozone sensitive. Plant Ce l l 14,2059-2069. Samuel, M.A., Miles, G.P., and Ellis, B.E. (2000). Ozone treatment rapidly activates M A P kinase signalling in plants. Plant J 22, 367-376. Schraudner, M., Langebartels, C , and Sandermann, H., Jr. (1996). Plant defence systems and ozone. Biochem Soc Trans 24,456-461. Schroeder, J.L, Kwak, J.M., and Allen, G.J. (2001a). Guard cell abscisic acid signalling and engineering drought hardiness in plants. Nature 410, 327-330. Schroeder, J.I., Allen, G.J., Hugouvieux, V., Kwak, J.M., and Waner, D. (2001b). Guard cell signal transduction. Annu Rev Plant Physiol Plant M o l B io l 52, 627-658. Seger, R., Ahn, N.G., Posada, J., Munar, E.S., Jensen, A.M., Cooper, J.A., Cobb, M.H., and Krebs, E.G. (1992). Purification and characterization o f mitogen-activated protein kinase activator(s) from epidermal growth factor-stimulated A431 cells. J B io l Chem 267, 14373-14381. Seo, S., Sano, H., and Ohashi, Y. (1999). Jasmonate-based wound signal transduction requires activation of W I P K , a tobacco mitogen-activated protein kinase. Plant Cel l 11, 289-298. Seo, S., Okamoto, M., Seto, H., Ishizuka, K., Sano, H., and Ohashi, Y. (1995). Tobacco M A P kinase: a possible mediator in wound signal transduction pathways. Science 270, 1988-1992. Shi, H., and Zhu, J.K. (2002). Regulation of expression of the vacuolar Na+/H+ antiporter gene A t N H X l by salt stress and abscisic acid. Plant M o l B io l 50, 543-550. Shi, EL, Ishitani, M., Kim, C , and Zhu, J.K. (2000). The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proc Natl Acad Sci U S A 97, 6896-6901. Shpak, E.D., McAbee, J.M., Pillitteri, L.J., and Torn, K.U. (2005). Stomatal patterning and differentiation by synergistic interactions o f receptor kinases. Science 309, 290-293. Skene, K. (2000). Pattern formation in cluster roots: Some developmental and evolutionary considerations. A n n Bot-London 85, 901-908. Soyano, T., Nishihama, R., Morikiyo, K., Ishikawa, M., and Machida, Y. (2003). N Q K l / N t M E K l is a M A P K K that acts in the N P K 1 M A P K K K - m e d i a t e d M A P K cascade and is required for plant cytokinesis. Genes Dev 17, 1055-1067. Stals, EL, and Inze, D. (2001). When plant cells decide to divide. Trends Plant Sci 6, 359-364. Strompen, G., El Kasmi, F., Richter, S., Lukowitz, W., Assaad, F.F., Jurgens, G., and Mayer, TJ. (2002). The Arabidopsis H I N K E L gene encodes a kinesin-related protein involved in cytokinesis and is expressed in a cell cycle-dependent manner. Curr B io l 12, 153-158. 157 Sugimoto, K. , Williamson, R .E . , and Wasteneys, G.O. (2000). New techniques enable comparative analysis o f microtubule orientation, wal l texture, and growth rate in intact roots of Arabidopsis. Plant Physiol 124, 1493-1506. Takahashi, Y. , Soyano, T., Sasabe, M . , and Machida, Y . (2004). A M A P kinase cascade that controls plant cytokinesis. J Biochem (Tokyo) 136, 127-132. Takenaka, K. , Gotoh, Y. , and Nishida, E . (1997). M A P kinase is required for the spindle assembly checkpoint but is dispensable for the normal M phase entry and exit in Xenopus egg cell cycle extracts. J Cel l B io l 136, 1091 -1097. Talbott, L .D. , and Zeiger, E . (1998). The role of sucrose in guard cell osmoregulation. J Exp Bot 49, 329-337. Tanaka, H . , Ishikawa, M . , Kitamura, S., Takahashi, Y. , Soyano, T., Machida, C , and Machida, Y . (2004). The A t N A C K l / H I N K E L and S T U D / T E T R A S P O R E / A t N A C K 2 genes, which encode functionally redundant kinesins, are essential for cytokinesis in Arabidopsis. Genes Cells 9, 1199-1211. Teige, M . , Scheikl, E . , Eulgem, T., Doczi, R., Ichimura, K. , Shinozaki, K. , Dangl, J .L . , and Hirt, H . (2004). The M K K 2 pathway mediates cold and salt stress signaling in Arabidopsis. M o l Ce l l 15,141-152. Tena, G. , Asai, T., Chiu, W.L . , and Sheen, J . (2001). Plant mitogen-activated protein kinase signaling cascades. Curr Opin Plant B io l 4, 392-400. Thiel, G. , MacRobbie, E.A. , and Blatt, M.R. (1992). Membrane transport in stomatal guard cells: the importance o f voltage control. J Membr B io l 126, 1-18. Urao, T., Yamaguchi-Shinozaki, K. , and Shinozaki, K . (2000). Two-component systems in plant signal transduction. Trends Plant Sci 5, 67-74. Usami, S., Banno, H . , Ito, Y. , Nishihama, R., and Machida, Y. (1995). Cutting activates a 46-kilodalton protein kinase in plants. Proc Natl Acad Sci U S A 92, 8660-8664. Van Haute, E . , Joos, H . , Maes, M . , Warren, G. , Van Montagu, M . , and Schell, J . (1983). Intergeneric transfer and exchange recombination of restriction fragments cloned in pBR322: a novel strategy for the reversed genetics of the T i plasmids of Agrobacterium tumefaciens. Embo J 2, 411-417. von Groll, U. , and Altmann, T. (2001). Stomatal cell biology. Curr Opin Plant B io l 4, 555-560. Von Groll, U. , Berger, D., and Altmann, T. (2002). The subtilisin-like serine protease SDD1 mediates cell-to-cell signaling during Arabidopsis stomatal development. Plant Ce l l 14, 1527-1539. Voronin, V. , Touraev, A. , Kieft, H . , van Lammeren, A.A. , Heberle-Bors, E . , and Wilson, C . (2001). Temporal and tissue-specific expression of the tobacco ntf4 M A P kinase. Plant M o l B io l 45, 679-689. Voronin, V. , Aionesei, T., Limmongkon, A. , Barinova, I., Touraev, A. , Lauriere, C , Coronado, M.J . , Testillano, P.S., Risueno, M . C , Heberle-Bors, E . , and Wilson, C (2004). The M A P kinase kinase N t M E K 2 is involved in tobacco pollen germination. F E B S Lett 560, 86-90. 158 Wang, X .Q. , Ullah, H . , Jones, A . M . , and Assmann, S.M. (2001). G protein regulation of ion channels and abscisic acid signaling in Arabidopsis guard cells. Science 292, 2070-2072. Widmann, C. , Gibson, S., Jarpe, M.B. , and Johnson, G . L . (1999). Mitogen-activated protein kinase: conservation o f a three-kinase module from yeast to human. Physiol Rev 79, 143-180. Wilkinson, S., and Davies, W.J . (2002). ABA-based chemical signalling: the co-ordination o f responses to stress in plants. Plant Cel l Environ 25, 195-210. Wilson, C , Eller, N., Gartner, A. , Vicente, O., and Heberle-Bors, E . (1993). Isolation and characterization of a tobacco c D N A clone encoding a putative M A P kinase. Plant M o l B io l 23, 543-551. Wilson, C , Voronin, V. , Touraev, A., Vicente, O., and Heberle-Bors, E . (1997). A developmentally regulated M A P kinase activated by hydration in tobacco pollen. Plant Ce l l 9,2093-2100. Wu, S.J., Ding, L . , and Zhu, J .K. (1996). SOS1, a genetic locus essential for salt tolerance and potassium acquisition. Plant Ce l l 8, 617-627. Yahraus, T., Chandra, S., Legendre, L . , and Low, P.S. (1995). Evidence for a mechanically induced oxidative burst. Plant Physiol 109, 1259-1266. Yang, C.Y. , Spielman, M . , Coles, J.P., L i , Y. , Ghelani, S., Bourdon, V., Brown, R.C. , Lemmon, B.E. , Scott, R.J. , and Dickinson, H . G . (2003). T E T R A S P O R E encodes a kinesin required for male meiotic cytokinesis in Arabidopsis. Plant J 34,229-240. Yang, K . Y . , Liu, Y. , and Zhang, S. (2001). Activation of a mitogen-activated protein kinase pathway is involved in disease resistance in tobacco. Proc Natl Acad Sci U S A 98, 741-746. Yang, M . , and Sack, F.D. (1995). The too many mouths and four lips mutations affect stomatal production in Arabidopsis. Plant Ce l l 7, 2227-2239. Yuasa, T., Ichimura, K. , Mizoguchi, T., and Shinozaki, K . (2001). Oxidative stress activates A T M P K 6 , an Arabidopsis homologue of M A P kinase. Plant Ce l l Physiol 42,1012-1016. Zhang, B., Ramonell, K. , Somerville, S., and Stacey, G . (2002). Characterization of early, chitin-induced gene expression in Arabidopsis. M o l Plant Microbe Interact 15, 963-970. Zhang, S., and Klessig, D.F. (1998). The tobacco wounding-activated mitogen-activated protein kinase is encoded by SIPK. Proc Natl Acad Sci U S A 95, 7225-7230. Zhang, S., and Klessig, D.F. (2001). M A P K cascades in plant defense signaling. Trends Plant Sci 6, 520-527. Zhang, S.Q., and Outlaw, W.H. , Jr. (2001a). Abscis ic acid introduced into the transpiration stream accumulates in the guard-cell apoplast and causes stomatal closure. Plant Cel l Environ 24, 1045-1054. 159 Zhang, S.Q., and Outlaw, W.H. , Jr. (2001b). Gradual long-term water stress results in abscisic acid accumulation in the guard-cell symplast and guard-cell apoplast o f intact Vicia faba L. plants. J Plant Growth Regul 20, 300-307. Zhou, F., Menke, F . L . , Yoshioka, K. , Moder, W., Shirano, Y. , and Klessig, D.F. (2004). H igh humidity suppresses ssi4-mediated cell death and disease resistance upstream of M A P kinase activation, H 2 0 2 production and defense gene expression. Plant J 39, 920-932. Zhu, J . -K. (2000). Genetic analysis o f plant salt tolerance using Arabidopsis. Plant Physiol 124, 941-948. Zhu, J . -K. (2001a). Cel l signaling under salt, water and cold stresses. Curr Opin Plant B io l 4, 401-406. Zhu, J . -K. (2001b). Plant salt tolerance. Trends in Plant Science 6, 66-71. Zwerger, K. , and Hirt, H . (2001). Recent advances in plant M A P kinase signalling. B io l Chem 382, 1123-1131. 160 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099814/manifest

Comment

Related Items