UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Functional analyses of Arabidopsis MAPK gene families Sritubtim, Somrudee 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-105712.pdf [ 23.29MB ]
Metadata
JSON: 831-1.0099814.json
JSON-LD: 831-1.0099814-ld.json
RDF/XML (Pretty): 831-1.0099814-rdf.xml
RDF/JSON: 831-1.0099814-rdf.json
Turtle: 831-1.0099814-turtle.txt
N-Triples: 831-1.0099814-rdf-ntriples.txt
Original Record: 831-1.0099814-source.json
Full Text
831-1.0099814-fulltext.txt
Citation
831-1.0099814.ris

Full Text

FUNCTIONAL ANALYSES OF ARABIDOPSIS M A P K GENE FAMILIES By SOMRUDEE SRITUBTIM B.Sc. K h o n Kaen University, Thailand, 1994 M.Sc., Simon Fraser University, Canada, 1999  A THESIS S U B M I T T E D IN P A R T I A L F U L F I L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in T H E F A C U L T Y OF G R A D U A T E STUDIES (Plant Science)  T H E U N I V E R S I T Y OF BRITISH C O L U M B I A October 2005 © Somrudee Sritubtim, 2Q05  ABSTRACT In plants, mitogen-activated protein kinase ( M A P K ) cascades have been implicated in controlling intracellular signaling in developmental processes and in response to many external stimuli, including biotic and abiotic stresses. The hallmark o f a M A P K cascade is the participation o f three classes o f protein kinases ( M A P K , M A P K K and M A P K K K ) that operate hierarchically to amplify the initial signal. Plant genomes appear to encode an exceptionally rich array o f M A P K cascade proteins (at least 20 M A P K and 10 M A P K K homologies have been identified in Arabidopsis) but functional analysis o f this extensive matrix is just beginning. T o gain insight into the specificity/redundancy o f M A P K s and M A P K K s , I have used R T - P C R to examine the expression profiles o f each o f the identified MAPKK  and MAPK  genes in Arabidopsis. Gene expression patterns have been examined in various tissues, at several developmental stages and following a series o f stress treatments. The findings reveal distinct expression patterns of AtMKK6, AtMPK13 and AtMPKll  genes.  I have analyzed further the cell and tissue distribution o f their expression during development and in response to many external stimuli through use o f promoter::GUS (j3glucuronidase) reporter plants. O n the one hand, m y results show that AtMKK6 and AtMPK13 promoters are specifically active at the primary root zones where lateral root primordia (LRP) are emerging. A u x i n treatment further stimulates the promoter o f these genes in emerging L R P , and those promoter activities are suppressed by N P A , an auxin transport inhibitor.  The AtMPKll  promoter, on the other hand, is specifically active in  stomatal guard cells and can be induced b y high salt and osmotic stress treatments. I have also conducted a phenotypic analysis o f AtMKK6, AtMPK13 and AtMPK12 loss-of-function  ii  mutant plants. Together, these results indicate diverse roles o f MAPKK/MAPK  genes. I show  that A t M K K 6 and A t M P K 1 3 activities are both associated with the lateral root formation process, while A t M P K 1 2 plays discrete roles during stomatal development.  iii  TABLE OF CONTENTS ABSTRACT T A B L E OF CONTENTS LIST O F T A B L E S LIST O F FIGURES LIST O F ABBREVIATIONS.... ACKNOWLEDGEMENTS  ii iv viii ix xi xiii  C H A P T E R 1: M A P K G E N E F A M I L Y IN P L A N T S  1  1.1 INTRODUCTION  1  1.2 R O L E S OF M A P K P A T H W A Y COMPONENTS IN P L A N T S  3  1.2.1 The role o f M A P K pathways i n stress signaling i n plants 1.2.1.1 Wounding signaling 1.2.1.2 Oxidative stress signaling 1.2.1.3 L o w temperature stress signaling 1.2.2 The role o f M A P K pathways i n plant development 1.2.2.1 C e l l cycle and cytokinesis i n plants 1.2.2.2 Cell-type specific development: 1.2.3 The role o f M A P K pathways i n plant hormone signaling 1.2.3.1 A u x i n 1.2.3.2 Abscisic acid 1.2.3.3 Ethylene  4 4 5 6 7 7 8 9 10 10 11  1.3 M A P K I N A S E P A T H W A Y COMPONENTS IN ARABIDOPSIS  12  1.4 THESIS OBJECTIVES  16  C H A P T E R 2: M A P K K / M A P K E X P R E S S I O N P R O F I L I N G IN ARABIDOPSIS 2.1 INTRODUCTION  18  2.2 M A T E R I A L S A N D M E T H O D S  2.2.1 2.2.2 2.2.3 2.2.4 2.2.5 2.2.6  18 21  Plant materials and growth conditions Plant treatments Total R N A extraction R N A sample preparation for R T - P C R R T reaction (first-strand c D N A synthesis) prior to P C R P C R amplification  2.3 R E S U L T S A N D DISCUSSION  21 23 24 24 25 26 29  2.3.1 Tissue differentiation o f the Arabidopsis MAPKK/MAPK gene families: Characteristic profiles i n mature and developing organs using R T - P C R data 2.3.2 Stress differentiation o f the Arabidopsis MAPKK/MAPK gene families 2.3.3 Three candidate genes with interesting expression pattern for further functional characterization 2.3.3.1 The AtMKK6 and AtMPKIS genes 2.3.3.2 The AtMPKl2 gene..! 2.3.4 Perspectives iv  29 37 43 43 43 44  2.3.4.1 Expression profiling approach is useful to identify developmentally regulated and stress-responsive genes 44 2.3.4.2 Spatial and temporal expression can infer gene function i n Arabidopsis 46  C H A P T E R 3: ARABIDOPSIS M A P K I N A S E K I N A S E ( A T M K K 6 ) A N D M A P K I N A S E 13 (ATMPK13) E N C O D E POSITIVE R E G U L A T O R S O F L A T E R A L R O O T FORMATION 47 3.1 INTRODUCTION  47  3.2 M A T E R I A L S A N D M E T H O D S  50  3.2.1 Plant materials 50 3.2.2 Genomic D N A isolation 50 3.2.3 Molecular cloning of AtMKK6 or AtMPKl3 promoter::GUS D N A construct and generation o f G U S reporter plants 52 3.2.3.1 Cloning of promoters 52 3.2.3.2 Generation o f promoter: :GUS fusion D N A constructs 53 3.2.3.3 Transformation of Agrobacterium 54 3.2.3.4 In planta transformation of Arabidopsis 56 3.2.3.5 Selection o f transformants 57 3.2.4 Histochemical G U S assay 58 3.2.5 Resin embedding and cross-sectioning of root tissue 59 3.2.6 Hormone treatments 60 3.2.7 E. coli ( D H 5 a ) competent cells 61 3.2.8 E. coli transformation 61 3.2.9 Agrobacterium competent cells 62 3.2.10 Bacterial growth media 62 3.2.11 Arabidopsis plant growth media 63 3.2.12 Molecular cloning o f glucocorticoid-inducible A t M K K 6 R N A i and A t M P K l 3 R N A i D N A constructs and screening for the mutant plants 63 3.2.13 Phenotypic analyses and plant growth conditions 68 3.2.14 Lateral root analysis 69 3.2.15 Total R N A extraction and R T - P C R analysis 69 3.3 R E S U L T S  71  3.3.1 Histochemical localization o f G U S activities driven by AtMKK6 and AtMPKl3 promoters during plant growth and development 71 3.3.2 AtMKK6 promoter::GUS activity distribution during plant growth and development 72 3.3.3 AtMKK6 promoter activity and lateral root formation 74 3.3.4 AtMPK13 promoter::GUS activity throughout plant growth and development.... 76 3.3.5 A t M K K 6 , auxin and lateral root formation 79 3.3.6 B l o c k i n g polar auxin transport with N P A reduces AtMKK6 promoter::GUS activity 81 3.3.7 A u x i n can reverse the block o f AtMKK6 promoter::GUS activity by N P A i n both vascular tissue and pericycle cells 82 3.3.8 A t M P K l 3 and auxin 85 3.3.9 Phenotypic analysis of A t M K K 6 R N A i transgenic plants 87  3.3.10 Lateral root analysis of A t M P K 1 3 R N A i transgenic plants 3.4 DISCUSSION  92 94  3.4.1 A t M K K 6 is required for lateral root initiation 3.4.2 Pericycle-specific expression o f the AtMKK6 promoter is regulated b y auxin 3.4.3 A t M K K 6 and A t M P K 1 3 relationship  94 95 97  CHAPTER 4: ATMPK12, AN ARABIDOPSIS MITOGEN-ACTIVATED PROTEIN KINASE IS GUARD CELL-SPECIFIC AND INDUCED BY SALT AND OSMOTIC STRESSES 99 " 4.1 INTRODUCTION  4.1.1 4.1.2 4.1.3 4.1.4 4.1.5 4.1.6  99  Stomatal development Stomatal function and their regulation through ion channels Involvement of protein phosphorylation in stomatal regulation Salt stress signaling Ionic stress signaling: the "salt overly sensitive" (SOS) pathway Osmotic stress signaling: SOS-independent protein kinases  4.2 M A T E R I A L S A N D M E T H O D S  99 106 109 110 Ill 113 116  4.2.1 Plant materials 116 4.2.2 Genomic D N A isolation 116 4.2.3 Molecular cloning o f AtMPK12 promoter::GUS D N A constructs and generating the G U S reporter plants 116 4.2.3.1 Cloning of the AtMPK12 promoter 116 4.2.3.2 Generation of promoter: :GUS fusion D N A constructs and transgenic plants 117 4.2.4 Histochemical G U S analysis 118 4.2.5 Resin embedding and cross-sectioning of leaf tissue 118 4.2.6 N a C l and mannitol treatments 118 4.2.7 Verification o f the AtMPK12 S A L K transfer-DNA ( T - D N A ) 119 4.2.7.1 Genomic D N A extraction of the AtMPK12 S A L K T - D N A 119 4.2.7.2 Identification of a homozygous S A L K T - D N A insertional line 120 4.2.8 Phenotypic analyses o f the homozygous AtMPK12 T - D N A insertional mutant (atmpkl2) i n normal growth conditions 122 4.3 R E S U L T S  123  4.3.1 Histochemical localization of G U S activity driven by AtMPKl2 promoter during plant development 123 4.3.2 AtMPKl2 promoter activity was enhanced by N a C l and mannitol 132 4.3.2 Characterization o f S A L K T - D N A insertion lines 136 4.3.3 Phenotypic analysis of the atmpkl2 plants 137 4.4 DISCUSSION  137  4.4.1 AtMPKl2 promoter activity pattern is guard cell-specific throughout plant development 4.4.2 A t M P K 1 2 m a y b e required for guard cell development 4.4.3 Guard cell-specific A t M P K l 2 is involved in osmotic stress response 4.4.5 Concluding remarks  vi  137 137 139 140 142  CHAPTER 5: O V E R A L L THESIS DISCUSSION AND FUTURE DIRECTIONS.... 143 5.1 TRANSCRIPTIONAL PROFILING A P P R O A C H V E R S U S D E V E L O P M E N T A L SIGNALING  143  5.2 C H A R A C T E R I Z A T I O N OF D E V E L O P M E N T A L L Y R E G U L A T E D GENES USING A N INDUCIBLE 144  R N A I APPROACH 5.3. F U T U R E DIRECTIONS  144  5.3.1 Systematic analysis o f the MAPKKK genes 5.3.2 Use inducible promoters to drive AtMPK12 gene constructs i n stomata o f transgenic plants 5.3.3 Identification o f the M A P K protein network 5.3.4 Further characterization o f the mutant and transgenic plants  REFERENCES  145 145 146 146  147  vii  LIST OF TABLES Table 1.1 List o f Arabidopsis M A P K signalling components, adapted from Jonak et al. (2002) 14 Table 2.1 AtMKK primer sequences for P C R amplification 27 Table 2.2 AtMPK primer sequences for P C R amplification 28 Table 2.3 The gene expression profiles i n all known Arabidopsis MAPK genes 30 Table 2.4 The gene expression profiles i n all known Arabidopsis MAPKK genes 31 Table 2.5 The M P S S data for the AtMPK genes 32 Table 2.6 The M P S S data for the AtMKK genes 33 Table 2.7 The gene expression profiles i n all known Arabidopsis MAPK genes under different stress conditions 39 Table 2.8 The gene expression profiles i n all known Arabidopsis MAPKK genes under different stress conditions 41 Table 3.1 Primer sequences for promoter cloning 53 Table 3.2 Primers for the A t M K K 6 R N A i and A t M P K 1 3 R N A i constructs 65 Table 3.3 Primers used for checking gene expression of the A t M K K 6 R N A i (line 13) 70 Table 4.1 Primer sequences for AtMPK12 promoter cloning 117 Table 4.2 Primers for verification of the AtMPK12 T - D N A insertional homozygous line(s) (SALK_074849) 120  viii  LIST OF FIGURES Figure 2.1 Grouping of the M A P K K and M A P K proteins 20 Figure 2.2 R T - P C R analysis o f the expression pattern o f the AtMKK6 and AtMPKl3 genes. 34 Figure 2.3 The AtMKK9 gene was differentially expressed i n organs and during developmental stages 36 Figure 3.1 Schematic diagrams of p C A M B I A 1 3 8 1 Z and p C A M B I A 1 3 0 1 vectors 55 Figure 3.2 Schematic diagram describing construction o f the A t M K K 6 R N A i construct 66 Figure 3.3 Glucocorticoid-inducible A t M K K 6 R N A interference ( A t M K K 6 R N A i ) system . 67 Figure 3.4 Overview o f the process for generating A t M K K 6 R N A i transgenic plants 68 Figure 3.5 Promoterless-GUS activity as a negative control for G U S assay 71 Figure 3.6 35S promoter-GUS activity as a positive control for G U S assay 72 Figure 3.7 Histochemical localization o f G U S activity in AtMKK6 promoter: :GUS reporter plants through development from 3 days to 35 days 73 Figure 3.8 Detailed examination o f 10-day old seedlings of AtMKK6 promoter:: GUS reporter plants 75 Figure 3.9 Histochemical localization o f G U S activity i n AtMPKl3 promoter::GUS reporter plants through development from 3 days to 35 days 77 Figure 3.10 Schematic illustration showing the location of the putative auxin-responsive sequence A u x R E P S I A A 4 i n the AtMKK6 promoter region (740 bp) 78 Figure 3.11 N P A effect on lateral root formation i n 17-day-old wild-type Arabidopsis seedlings 80 Figure 3.12 N P A (5 p M ) effect on G U S activity in 10-day-old AtMKK6 promoter::GUS reporter seedlings 81 Figure 3.13 Histochemical localization o f G U S activity i n lateral root primordia (LRPs) and lateral roots of A t M K K 6 promoter::GUS reporter seedlings, upon N P A (5 p M ) treatment and co-treatment o f N P A (5 p M ) and I A A (1 p M ) 84 Figure 3.14 Schematic illustration showing the location o f two putative auxin-responsive sequences A u x R R - c o r e i n the A t M P K l 3 promoter region (1534 bp) 85 Figure 3.15 Histochemical localization of AtMPKl3 promoter::GUS activity i n L R P s and lateral roots from 13-day-old reporter seedlings, upon treatment o f N P A alone (5 p M ) and co-treatment o f N P A (5 p M ) and I A A (1 p M ) 86 Figure 3.16 R T - P C R analysis showing a ~ 2 3 % reduction i n the AtMKK6 transcript level i n 10-day-old A t M K K 6 R N A i seedlings (line 13) when the gene silencing was induced b y 1 p M dexamethasone (dex) treatment as compared to that without dex treatment (control) 88 Figure 3.17 Phenotypic analyses revealed growth defects o f A t M K K 6 R N A i plants 90 Figure 3.18 Close-up views of phenotypes from A t M K K 6 R N A i plants when 91 Figure 3.19 A t M K K 6 R N A i showed ectopic root hairs, when induced b y 1 p M dex 92 Figure 3.20 A t M K K 6 R N A i and A t M P K l 3 R N A i showed reduction o f lateral root number when R N A i silencing was induced b y 1 p M dex 93 Figure 4.1 Dicot leaf anatomy 100 Figure 4.2 Arabidopsis stomatal development (Nadeau and Sack, 2002b) 101 Figure 4.3 Stomatal clusters i n too many mouths 102  ix  Figure 4.4 Developmental basis o f stomatal cluster formation i n tmm (Nadeau and Sack, 2002b) 103 Figure 4.5 Paired stomata in four lips (Nadeau and Sack, 2002b) 106 Figure 4.6 Guard cell function: stomatal opening and closing 108 Figure 4.7 Salt stress responses in plants and pathways that interconnect them Ill Figure 4.8 Diagram of the S O S pathway for plant Na+ response, from Zhu, J - K (2000).... 113 Figure 4.9 Salt stress activates several protein kinase pathways, the S O S 3 - S O S 2 kinase pathway, multiple M A P K pathways and other protein kinases e.g. A T H K 1 , A S K 1 and A T G S K 1 . Modified from (Zhu, 2001a) 114 Figure 4.10 Diagram o f S A L K T - D N A verification primer design and P C R product size.. 121 Figure 4.11 AtMPKl2 promoter-GUS activity survey throughout plant development 125 Figure 4.12 Histochemical localization o f G U S activity in AtMPKl2 130 Figure 4.13 Transverse section o f leaf from the AtMPKl2 promoter:: GUS reporter plant. .131 Figure 4.14 N a C l causes an increase in G U S activity of the AtMPKl 2 promoter: :GUS 133 Figure 4.15 N a C l causes an increase i n G U S activity i n leaf guard cells 134 Figure 4.16 Mannitol (5%) causes an increase in G U S activity o f the AtMPKl2 promoter::GUS reporter seedlings 135 Figure 4.17 P C R screening of AtMPKl 2 T - D N A insertional lines ( S A L K - 0 7 4 8 4 9 ) 136 Figure 4.18 Phenotypic analysis o f wild-type and atmpk!2 mutant plants on growth 138  LIST OF ABBREVIATIONS 2ip ABA AAPK ACC ACS ANP1/2/3 At AtNHXl CTR1 DEPC dex EDR1 ERK FLP GCR1 GPA1 GUS GMC IAA LRP M M A P K (or M P K ) M A P K K (or M K K or M E K ) M A P K K K (or M K K K or M E K K ) MBP MEK MIPS MMC MMK3 MPSS MS NAA NACK1/2 NC NPA NPK1 Nt NtF6 OMTK Os OST1 PIN RNA  6-(Y,y-dimethylallyl-amino) purine abscisic acid abscisic acid-activated protein kinase aminocyclopropane-1 -carboxylic acid 1-aminocyclopropane-l-carboxylic acid synthase Arabidopsis N P K l - l i k e protein kinases 1, 2 and 3  Arabidopsis thaliana Arabidopsis thaliana sodium proton exchanger 1 constitutive triple response 1 diethyl pyrocarbonate dexamethasone enhanced disease resistance 1 extracellular signal-regulated kinase four lips G protein-coupled receptor G protein a subunit p-glucuronidase guard mother cell indole-3-acetic acid lateral root primordia meristemoid mitogen-activated protein kinase mitogen-activated protein kinase kinase mitogen-activated protein kinase kinase kinase myelin basic protein M A P K / E R K kinase M u n i c h Information Centre for Protein Sequences meristemoid mother cell Medicago M A P K 3 Massively Parallel Signature Sequencing Murashige and Skoog naphthalene acetic acid Nicotiana tabacum protein kinase 1 activating kinesinlike proteins 1 and 2 neighbour cell or sister cell N-l-naphthylphthalamic acid Nicotina protein kinase 1  Nicotiana tabacum Nicotina tabacum F U S 3 - l i k e kinase 6 Oxidative stress-activated M A P triple-kinase  Oryza sativa open stomata 1 pin-formed ribonucleic acid xi  RT-PCR RNAi SAMK  SDD1 SIMK SIMKK SIPK SM SOS TMM WIPK X-Gluc  reverse transcriptase-polymerase chain reaction R N A interference stress-activated M A P kinase stomatal density and distribution 1 salt-induced M A P kinase S I M K kinase salicylic acid-induced protein kinase satellite meristemoid salt overly sensitive too many mouths wound-induced protein kinase 5-bromo-4-chloro-3 -indolyl-6eta-D-glucuronic acid, cyclohexylammomum salt  xii  ACKNOWLEDGEMENTS It has been a terrific intellectual journey. I have had a great experience during m y Ph.D. study at U B C with good support and many good people around me. I would like to thank m y supervisor, Dr. Brian E l l i s , for his scientific guidance and ongoing support. Brian has been the ideal research supervisor for me. H e has provided me with excellent guidance, enough space to work independently and a good scientific environment. It has been a privilege to work with an inspirational scientist like Brian. I would also like to thank m y supervisory committee members Dr. James Kronstad, Dr. George Haughn and Dr. Steven Pelech for their scientific advice, encouragement and feedback, especially at the beginning o f m y P h . D . They gave me useful guidance at the critical step of m y study on how to choose a good research project. I truly appreciate their advice on m y work. Thank you to the chair of m y P h . D . examining committee, Dr. R o y Turkington, the university examiners, Dr. Carl Douglas and Dr. Geoffrey Wasteneys and the external examiner, Dr. Daphne Goring (Department of Botany, University o f Toronto) for their time to review m y thesis and provide me with comprehensive feedback. Thanks to Jochen B r u m m , m y partner who knows m y M A P K project very well by now, for his support, scientific discussion, feedback and encouragement for doing good work. Thanks to L i e w , Cherdsak Liewlaksaneeyanawin, for his assistance with m y P h D thesis preparation, scientific discussion and friendship.  Thanks to Minako Kaneda for her expert assistance with the preparation of root sections. Thanks to Dr. Lacey Samuels for the microscope facility, D a v i d Kaplan for the green house facility and Sylvia Leung for chemical ordering. Thanks to E l l i s ' lab members, Dr. Godfrey M i l e s , Dr. Marcus Samuel, Dr. M i c h i y o Matsuno, Dr. R i s h i G i l l , A l a n a Clegg, JinSuk Lee, Hardy H a l l , Corinne Cluis, Greg Lampard, Ankit W a l i a and Alexander Lane for sharing the graduate school experience with me and support me in many ways. Thanks to the directed study students, Raymond Y u and Janet Chung and also thanks to the volunteering students, Vanessa Chan and Kenny W o n g for their assistance on m y research project. Thanks to m y U B C friends, postdocs and staff from the Department o f Botany, Agricultural Sciences and Michael Smith Laboratories and Thai friends for their support during m y Ph.D. time. Thanks to the Natural Science and Engineering Research Council ( N S E R C )  of  Canada and the Institute for the Promotion o f Teaching Science and Technology (IPST) of Thailand for generous research and educational funding. Thanks to everyone in my family, especially m y grandparents and m y parents who always supported me for doing m y P h . D .  xiv  CHAPTER 1 MAPK Gene Family in Plants 1.1 Introduction MAPK  (mitogen-activated protein kinase) signaling modules play a central role i n  transduction o f extracellular stimuli and developmental signals into cellular responses i n eukaryotic cells (Widmann et al, 1999; Ligterink and Hirt, 2001; Pearson et al, 2001). The first mammalian M A P K  was discovered b y its ability to phosphorylate microtubule-  associated protein 2 ( M A P - 2 ) in vitro upon a growth factor insulin treatment, and was named M A P - 2 kinase (Ray and Sturgill, 1987). M A P - 2 kinase was renamed a "mitogen-activated protein kinase" (Rossomando et al, 1989) when it was found to be tyrosine phosphorylated upon stimulation o f cells b y a variety o f mitogens (Cooper et al, 1982; Rossomando et al, 1989). This mammalian M A P K gene was cloned and found to have high homology to previously identified yeast kinases F U S 3 and K S S 1 (Courchesne et al., 1989; Boulton et al, 1990; E l i o n et al, 1990). Since this M A P K was not only activated b y mitogens, but also b y many other stimuli, it was also designated E R K 1 , for extracellular signal-regulated kinase 1 (Boulton et al, 1990). One hallmark o f the M A P K and F U S 3 / K S S 1 kinases was their ability to phosphorylate myelin basic protein, and hence the term " M B P kinases" is sometimes used to refer to this group o f kinases. Soon afterward, two M A P K activators were identified, based on their ability to phosphorylate M B P kinases upon growth factor stimulation o f cells ( A h n et al, 1991). The M A P K activators were shown to phosphorylate M A P K , indicating that they were indeed upstream protein kinases (Seger et al, 1992). One M A P K activator was cloned and named M E K 1 for M A P K / E R K kinase 1, and it was found to be activated  1  through phosphorylation. (Crews et al,  1992; Crews and Erikson, 1992). After  the  identification of M E K s , the M E K activators, Raf-1 and M E K K 1 were identified (Kyriakis et al,  1992; Lange-Carter et al,  1993). The first indication of an evolutionarily conserved  structure for M A P K cascades came from the finding that mammalian M E K K 1 and M E K had high homology to the yeast protein kinases STE11 and S T E 7 , respectively, which function upstream of yeast M A P K s , F U S 3 and K S S 1 (Lange-Carter et al,  1993).  This module architecture, i n which activated M A P K K K s ( M E K K s ) phosphorylate, and thus activate, target M A P K K s ( M E K s ) , which i n turn activate M A P K s , has been described in taxa as diverse as yeasts, worms, flies and mammals (Widmann et al., 1999). Sequencing o f these genomes has also revealed that the three classes o f M A P kinases ( M A P K K K s , M A P K K s and M A P K s ) always occur as gene families. Functional analysis, which is most advanced in yeast, has demonstrated that despite their structural conservation over evolutionary time, individual gene family members generally play distinct roles, although some degree o f functional redundancy is also observed (Herskowitz, 1995; Gustin etal, 1998a). In the simplest model, M A P K  cascades can be viewed as linear  information  transmission systems. However, biochemical and genetic evidence suggests a more complex module organization in which kinases at one level within the cascade can be activated by more than one upstream effector and can, in turn, act upon more than one target (Cardinale et al, 2002). When combined with the availability o f multiple related kinases at each level, and the interaction with modifying proteins such as scaffolds (Pearson et al, 2001; Nakagami et al,  2004) and protein phosphatases (Gupta et al,  1998; Meskiene et al,  complexity creates a remarkably versatile matrix o f signaling capacities.  2  2003), this  1.2 Roles of MAPK pathway components in plants Our knowledge o f signal transduction i n plants is less well developed than i n other phyla, but there is considerable evidence for broad conservation o f signalling architecture between plants and other eukaryotic organisms. Over the past decade, a number o f plant-signalling components have been isolated. Homologues o f heterotrimeric G proteins, phospholipid modifiers, protein phosphatases, receptor kinases, two-component histidine kinases and various other classes o f protein kinases have been identified i n plants including members o f the M A P K K K , M A P K K and M A P K families (Mizoguchi et al,  1997; Ichimura et  al,  1998a). M A P K s are proposed to be one o f the convergence points i n the stress- or defensesignalling network i n plants (Zhang and Klessig, 2001). The regulation o f M A P K pathway components occurs at multiple levels, including transcriptional, post-transcriptional, translational and post-translational levels. Evidence for transcriptional regulation o f plant M A P K cascade genes has been provided through observed differences i n their expression i n different organs, tissue and/or cell-types, as well as expression changes induced b y extracellular stimuli (Ligterink and Hirt, 2001; Zhang and Klessig, 2001). A n example o f post-transcriptional regulation is the report o f differential splicing o f a single Arabidopsis N P K 1 -related protein kinase 1 ( A N P 1 ) gene, which has a high homology to Nicotiana protein kinase 1 ( N P K 1 ) gene, giving rise to two species o f A N P 1 transcripts, A N P 1 L and A N P 1 S . The activity o f A N P 1 S was greater than that o f A N P 1 L , suggesting that this molecular mechanism might be involved i n modulating the activity o f this protein kinase (Nishihama et al, 1997). A t the translational level, changes o f M A P K protein levels i n response to pathogenic stimuli have been documented (Zwerger and Hirt, 2001). Post-translational regulation is, o f course, central to regulation o f M A P K cascades, since each level i n the cascade is subjected to phosphorylation b y its cognate 3  activator (Jonak and Hirt, 2002; Teige et al, 2004). In addition, some plant M A P K species have been shown to interact with particular upstream kinases using yeast two-hybrid assays (Ichimura et al,  1998b; Mizoguchi et al,  1998; Kiegerl et al,  2000), while genetic  approaches such as transient or stable expression o f transgenes have likewise demonstrated functional relationships among specific M A P K K K s , M A P K K s and M A P K s . Beyond these better characterized examples, input stimuli o f many types have been shown to alter the activation states o f plant M A P K s , although the identity o f the responsive kinase has not always been established (Morris, 2001; Zwerger and Hirt, 2001).  1.2.1 The role of MAPK pathways in stress signaling in plants When exposed to an environmental stress, plants respond at many levels i n an effort to maximize their chances o f survival. M A P K pathways have been implicated i n signal transduction i n response to a broad variety o f such stresses (Ligterink and Hirt, 2001; Tena et al, 2001). In this chapter, the involvement o f plant M A P K s i n response to wounding, oxidative stress and chilling stress is reviewed.  1.2.1.1 Wounding signaling Wounding i n plants could be the outcome o f physical injury, herbivore or pathogen attack. Wounding induces a wide variety o f cellular responses, including up-regulation o f genes involved i n healing and defense and M A P K pathway genes have been implicated i n these wound-responses. For example, i n tobacco, a protein kinase activity o f a 46 k D a protein was detected soon after cutting o f the leaves (Usami et al, 1995). This 46 k D a protein was proposed to be a M A P K since (1) it could phosphorylate myelin basic protein ( M B P ) , an artificial substrate o f M A P K , (2) the active form o f the kinase was phosphorylated on both  4  serine and/or threonine and tyrosine residue(s), and (3) it was shown to be inactivated through dephosphorylation. Transcripts of a tobacco MAPK, WIPK (wound-induced protein kinase) were shown to rapidly accumulate following wounding, a pattern that was correlated with a rapid increase in its protein activity, indicating that WIPK could be involved in the early stages of the response to the wound-stress (Seo et al, 1995; Seo et al, 1999). Similar to the tobacco WIPK, an alfalfa MAPK, SAMK (stress-activated MAP kinase), showed a rapid increase in its mRNA levels and protein activation following wounding (Bogre et al, 1997). Another tobacco MAPK, SIPK (for salicylic acid-induced protein kinase), can also be activated post-translationally by wounding (Zhang and Klessig, 1998). Unlike WIPK, however,  SIPK transcript levels were not significantly changed upon wounding.  Interestingly, the expression and activation of WIPK appeared to be regulated by SIPK (Samuel and Ellis, 2002; Liu et al, 2003). In Arabidopsis, another MAPK, AtMPK4, was shown to be activated by wounding as well as touch (Ichimura et al, 2000). Besides the MAPKs, the Arabidopsis MAPKK, AtMEKl, has been shown to be involved in woundresponse (Morris et al, 1997).  1.2.1.2 Oxidative stress signaling When exposed to oxidative challenge, plants have to cope with increased potential for damage resulting from oxidation of proteins, lipids and nucleic acids (Baier et al, 2005). Oxidative stress in plants can be a result of the oxidative burst, a rapid release of reactive oxygen species (ROS) in plant tissues upon pathogen attack (Mehdy, 1994; Bolwell, 1996) The ROS, rapidly produced in plant cells following the perception of a range of stress signals include superoxide anion (O2), hydrogen peroxide (H2O2) and hydroxyl radical (OH) (Desikan et al, 1996). Besides pathogen-induced stress, abiotic stresses including ozone  5  exposure, UV-irradiation, wounding and mechanical stresses can induce a rapid oxidative burst (Green and Fluhr, 1995; Yahraus et al, 1995; Schraudner et al, 1996; Huang et al, 2004; Le Deunff et al., 2004). M A P K pathway genes have been implicated in signaling role(s) in oxidative stress responses. For example, AtMPK3 and A t M P K 6 have been shown to be activated by H 0 2  2  (Kovtun et al, 2000), as has the alfalfa M A P K K K , OMTK1  (oxidative stress-activated M A P triple-kinase 1) (Nakagami et al., 2004). Ozone-generated ROS can induce SIPK activation in association with lesion formation in tobacco plants, and both gain-of-function and loss-of-function modification of SIPK were shown to render the transgenic tobacco plants increasingly sensitive to ROS stress (Samuel et al, 2000; Samuel and Ellis, 2002).  1.2.1.3 Low temperature stress signaling M A P K pathway genes have been implicated in signaling in response to low temperature stress. For example, Arabidopsis A t M E K K l and A t M P K 3 , and alfalfa S A M K , showed increased accumulation of transcripts upon exposure to low temperature (Jonak et al, 1996; Mizoguchi et al,  1996). The Arabidopsis  MAPKKK,  AtMAP3Kp3,  also showed  transcriptional up-regulation upon cold treatment (Jouannic et al, 1999). In contrast, the maize M A P K K , Z m M E K l , which is expressed in meristematic regions of growing plants, showed a decrease in its transcription level upon cold treatment of roots (Hardin and Wolniak, 1998).  6  1.2.2 The role of MAPK pathways in plant development 1.2.2.1 Cell cycle and cytokinesis in plants M A P K s have been shown to be involved i n regulation o f many cell cycle events i n yeasts and animals (Pages et al, 1993; Takenaka et al, 1997; Gustin et al, 1998b; Brunet et al, 1999) and evidence for similar roles i n plants is beginning to appear. Plant M A P K s have been implicated i n the cell cycle or cell-cycle entry based on expression correlated with specific cell-cycle stages and on gene expression and/or kinase activity i n proliferating tissues. For example, transcript levels o f S I M K K were l o w i n the G l phase i n alfalfa cell cultures but increased during S and G 2 phases. The alfalfa M A P K , M M K 3 , and its tobacco homologue, N t F 6 (for Nicotina tabacum F U S 3 - l i k e kinase 6), have been shown to be activated i n a cell cycle-specific manner. These kinases were shown to become active specifically i n anaphase and telophase o f the cell-cycle (Calderini et al, 1998; Bogre et al, 1999). Importantly, M M K 3 and N t F 6 were shown to have a role i n cytokinesis during mitosis. These kinases were immunolocalized at the phragmoplast i n late anaphase, and remained localized to the cell plate during telophase. Besides M A P K s , M A P K K K s have been shown to be involved i n cell division i n plants. F o r example, the tobacco M A P K K K , N P K 1 was actively expressed i n suspension cultured cells (Banno et al, 1993) and i n meristematic and developing tissues (Nakashima et al, 1998). N P K 1 transcripts also increased upon induction o f cell proliferation (Nakashima et al, 1998). The A N P 1 , A N P 2 and A N P 3 were also preferentially expressed i n proliferating tissues (Nishihama et al, 1997). In addition, N P K 1 protein and m R N A were abundant from S to M phases during the cell cycle (Nishihama and Machida, 2000) and this protein is associated with cell-plate formation during cytokinesis (Nishihama et al, 2001). N P K 1 was  7  also shown to interact with the upstream components N A C K 1 and 2 (NPK1 activating kinesin-like proteins) in a yeast two-hybrid system (Ishikawa et al, 2002). NPK1 and N A C K 1 were co-localized at the center of the phragmoplast, as was NtF6, a downstream component of N t M E K l , indicating the involvement of these proteins in a M A P K cascade N A C K 1 - N P K 1 - N t M E K l -NtF6 associated with cell-plate formation (Zwerger and Hirt, 2001; Takahashi et al., 2004). Takahashi et al. (2004) have adopted a different nomenclature for these genes; they use NQR1 for N t M E K l , and NRK1 for NtF6.  1.2.2.2 Cell-type specific development: M A P K s appear to be involved in regulating the growth and differentiation of various plant organs, including pollen grains, root hairs, embryo, and stomata. Specific examples of these associations are discussed below.  Pollen development: A few M A P K members have been implicated in pollen development. For example, Ntf4 is involved in the process of pollen germination in tobacco. Ntf4 transcripts were restricted to pollen (Voronin et al., 2001), and were actively synthesized at the late stages of pollen development. NTF4 protein activation occurred after hydration of dry pollen grains, but prior to pollen tube growth (Wilson et al, 1997). SIPK, the tobacco M A P K most closely related to Ntf4, was also expressed in pollen and was activated upon pollen hydration (Voronin et al., 2004). The tobacco M A P K K , NtMEK2, was shown to activate both SIPK (Yang et al, 2001) and NtF4 (Voronin et al, 2004). Tobacco plants expressing a loss-of-function version of NtMEK2 exhibited inhibition of germination in the transformed pollen grains suggesting that NtMEK2 may be required for pollen germination, as would be predicted i f NtMEK2 is the  8  cognate M A P K K for N T F 4 and S I P K . In addition, the tobacco M A P K s , Ntf3 and Ntf6, were found to be expressed i n pollen (Wilson et al, 1993; W i l s o n et al., 1997; Prestamo et al., 1999).  Stomatal and early embryo development: To date, the MAPKKK  gene, YODA (YDA) is the only member o f the plant M A P K gene  family known to have a role i n stomatal development. Arabidopsis yda mutants form clusters of guard cells i n the epidermis o f the cotyledons, instead o f the usual spatial distribution. Loss-of-function mutations i n Y O D A led to formation o f excessive numbers o f guard cells, while constitutive activation o f Y D A produced plants that completely lacked guard cells (Bergmann et al., 2004). Together these results indicate that Y D A acts as a cell-fate switch, and has a negative role i n stomatal guard cell development i n Arabidopsis. In addition to stomatal development, Y D A was suggested to regulate the first cell-fate decision i n embryogenesis (Lukowitz et al., 2004). The loss-of-function YDA mutant zygotes were impaired i n elongation and the gain-of function YDA mutants displayed suppressed embryonic development. However, other components i n a Y D A - c o n t a i n i n g M A P K cascade remain to be discovered.  1.2.3 The role of MAPK pathways in plant hormone signaling Plant hormones play important roles i n both developmental processes and stress-related responses, and it is therefore not surprising to find evidence for involvement o f M A P K pathways i n plant hormone signaling.  In this section, evidence for M A P K signaling  associated with plant hormone regulation is reviewed.  9  1.2.3.1 Auxin The plant hormone auxin regulates many growth and development processes including apical dominance, lateral root formation, root hair formation and vascular tissue differentiation (Hobbie and Estelle, 1994; A b e l and Theologis, 1996). The initial indications for a role o f protein kinases and/or phosphatases i n auxin signaling came from experiments i n soybean plants and pea epicotyl segments, which demonstrated an effect o f auxin on overall protein phosphorylation patterns (Reddy et al, 1987; Poovaiah et al, 1988). Mizoguchi and coworkers (1994) first reported specific involvement o f a M A P K i n auxin signal transduction. They demonstrated that auxin-starved tobacco B Y - 2 cells treated with the synthetic auxin, 2,4-dichlorophenoxyacetic acid (2,4-D) displayed rapid and transient activation o f 46 k D a protein kinase that was capable o f using myelin basic protein ( M B P ) as a substrate. T h e tobacco M A P K K K , N P K 1 , was subsequently reported to be transcriptionally up-regulated following auxin treatment (Nakashima et al, 1998). However, the ectopic expression o f tobacco N P K 1 i n maize protoplasts was able to inhibit auxin-induced gene expression, indicating that this kinase might negatively regulate auxin responses (Kovtun et al, 1998). In Arabidopsis protoplasts, constitutively active A N P 1 , A N P 2 and A N P 3 were shown to suppress the auxin-responsive promoter, G H 3 , indicating that A N P s may be a functional orthologue o f the tobacco N P K 1 (Kovtun et al, 2000).  1.2.3.2 Abscisic acid Abscisic acid ( A B A ) plays a role i n a wide variety o f physiological processes i n plants, including seed maturation and germination, stomatal regulation and responses to abiotic stresses including dehydration, high salt, osmotic stress and l o w temperature (Leung and Giraudat, 1998). Protein kinase signaling appears to be integral to A B A regulatory processes.  10  T w o protein phosphatases belonging to the type 2 C (PP2Cs) class (Leung et al, 1997) (ABI1 and A B I 2 ) were shown by mutational analysis to be involved in regulation o f germination, stomatal closure and root growth, and both kinase and phosphatase inhibitors were shown to block A B A - m e d i a t e d expression of a dehydrin gene i n pea (Hey et al,  1997). A specific  serine/threonine protein kinase, A A P K (for ABA-activated protein kinase) has been found to be involved in Ca -independent A B A signaling in guard cells o f fava bean ( L i and 2+  Assmann, 1996). M A P K s have also been implicated in A B A signaling. In barley aleurone protoplasts, A B A induced a rapid and transient activation o f M A P K activity, which was identified by cross-reaction with a p h o s p h o - E R K l - s p e c i f i c antibody (Knetsch et al,  1996). A tyrosine  phosphatase inhibitor, phenylarsine oxide ( P A O ) , was able to block this M A P K activation, and also blocked A B A - i n d u c e d gene expression (Knetsch et al,  1996). Besides A B A  signaling, M A P K s have been implicated in activating A B A biosynthesis.  1.2.3.3 Ethylene The gaseous plant hormone, ethylene  (C2H4),  serves as an important regulator of plant  physiological processes including fruit ripening, leaf and flower senescence, leaf abscission, and sex determination, as well as defense responses to various stresses and pathogen attack (Johnson and Ecker, 1998). The first evidence of a role for protein phosphorylation in ethylene signaling came from the work of Raz and Fluhr (1993), who showed that rapid protein phosphorylation was induced upon ethylene treatment o f tobacco leaves. The general kinase inhibitor K 2 5 2 a was able to block both this protein's phosphorylation and the ethylene-induced physiological responses.  11  M A P K s have been specifically implicated i n ethylene signal transduction i n plants. Mutational analysis showed that C T R 1 (constitutive-triple-response 1), which encodes a protein with high homology to Raf-like M A P K K K , negatively regulates ethylene responses (Kieber et al., 1993). Ouaked and co-workers (2003) identified four ethylene-activated protein kinases, including one alfalfa M A P K K ( S I M K K ) , two alfalfa M A P K s ( S I M K and M M K 3 ) , as well as one Arabidopsis M A P K ( A t M P K 6 ) . These protein kinases were proposed to act downstream o f C T R 1 i n a M A P K cascade because transgenic Arabidopsis plants ectopically over-expressing S I M K K exhibited constitutive A t M P K 6 activation, and also displayed a triple response similar to the Arabidopsis Ctrl mutant i n the absence o f aminocyclopropane-l-carboxylic acid ( A C C - a precursor o f ethylene biosynthesis). In addition, M M K 3 and S I M K exhibited rapid activation within five minutes o f treatment with A C C . However, L i u and Zhang (2004) recently showed compelling evidence that A t M P K 6 was not involved i n ethylene signalling, but rather was involved i n regulating the ethylene biosynthesis pathway. They reported that A t M P K 6 was required for ethylene induction i n this transgenic system, and found that selected isoforms o f 1-aminocyclopropane-lcarboxylic acid synthase ( A C S ) , the rate-limiting enzyme o f ethylene biosynthesis, are substrates o f A t M P K 6 . Furthermore, they reported that phosphorylation o f A C S 2 and A C S 6 by A t M P K 6 led to the stabilization and accumulation o f A C S protein and, therefore, increased levels o f cellular A C S activity and ethylene production.  1.3 MAP kinase pathway components in Arabidopsis Current data collectively implicate M A P K modules as important components o f signal transduction i n plants, but the full scope and centrality o f their participation remains unclear. The sequencing o f the Arabidopsis genome i n 2001 allowed, for the first time, the description  12  o f the full complement o f M A P K - e n c o d i n g genes i n a plant ( M A P K Group, 2002). In Arabidopsis, more than 80 M A P K K K , at least 10 M A P K K and 20 M A P K homologues have been identified (Table 1.1). This analysis revealed that this model plant genome encodes more members o f each level o f M A P K cascades than any other eukaryotic species examined to date, indicating that higher plants may have evolved to place a greater reliance on this signaling modality than have other kingdoms. However, this is difficult to evaluate, since only fragmentary information is available concerning the functionality  o f the M A P K  components encoded i n the Arabidopsis genome. Screens for mutant phenotypes have identified a small number o f A t M K K K genes that play important roles i n specific physiological responses, including A t C T R l  (Kieber et  al, 1993) and A t E D R l (Frye et al, 2001). Double-mutant combinations have revealed the roles o f ANP family o f Arabidopsis M A P K K K s i n cell division and growth (Krysan et al, 2002). Yeast two-hybrid screens and yeast mutant complementation analysis have provided some initial insight into the roles played b y the M A P K kinase kinases, A t M E K K l (Ichimura et al, 1998b), and A t A N P l , 2 and 3 (Nishihama et al, 1997). The functions o f the great majority o f the 80+ A t M A P K K K s , however, remain a mystery. Interestingly, despite the extensive mutant screening carried out i n Arabidopsis over the last two decades, only one M A P K mutant, Arabidopsis mpk4 (Petersen et al, 2000) and a small number o f M A P K K K mutants such as edrl and Ctrl (Kieber et al, 1993; Frye et al, 2001) have been discovered, based on phenotype. This may mean that most deficiency phenotypes are subtle and/or growth-stage specific, or that sufficient redundancy exists within the M A P K gene families to  13  Table 1.1 List o f Arabidopsis M A P K signalling components, adapted from Jonak et al. (2002)  Common Name MAPK  Number*  Group  Number*  20  A  3 5 4 8  MPK3/6/10 MPK4/5/11/12/13 MPK1/2/7/14 MPK8/9/15/16/17/18/19/20  B C D  3 1 2 4  MKK1/2/6 MKK3 MKK4/5 MKK7/8/9/10 MEKK1, ANP1-3, MAP3Ke1 ZIK1 EDR1, CTR1  B C D MAPKK  A  10  MAPKKK  80  MEKK-like ZIK  21 11  Raf-like  48  MAPKKKK  10  Ste20/PAK-like  10  Name members  -  * A s predicted b y analysis o f the Arabidopsis genome  suppress a deficiency phenotype. Alternatively, homozygous recessive mutants may not be readily recovered due to the severity o f the deficiency. Routing within the Arabidopsis M A P K cascades, as i n other taxa, appears to be constricted at the M A P K K level, where only ten family members occur, before expanding again to engage twenty downstream M A P K s .  This pattern indicates that multiple cascade  signal inputs could be converging upon the M A P K K s , which must then integrate and distribute those signals to the appropriate suite o f downstream targets, most likely specific M A P K s or subsets o f M A P K s . The activities and specificities o f M A P K K family members are thus of particular interest. A m o n g the A t M K K s , stress response functions have been ascribed to A t M K K l and 2, which can activate A t M P K 4 (Huang et al, 2000), and to A t M K K 4 and 5, which have been shown to be able to activate A t M P K 3 and 6 (Asai et al, 2002). M K K 2 ( A t M K K 2 ) is  14  involved in mediating cold and salt stress tolerance i n plants (Teige et al, 2004). A t M K K 2 has been shown to be activated by cold and salt stress and by the stress-induced M A P K kinase kinase M E K K 1 , and to directly target M P K 4 and M P K 6 in yeast two-hybrid, in vitro, and in vivo protein kinase assays. Accordingly, plants overexpressing M K K 2  exhibited  constitutive M P K 4 and M P K 6 activity, constitutively upregulated expression of stressinduced marker genes, and increased freezing and salt tolerance. In contrast, mkk2 null plants were impaired in M P K 4 and M P K 6 activation and were hypersensitive to salt and cold stress. A t M K K 6 (or A N Q 1 ) appears to be actively involved in regulation of cell plate formation during cell division (Soyano et al, 2003). There is no information available concerning the behavior or function o f the remaining five A t M K K s . A t the M A P K level, a large family o f kinases is available to transmit signals from the various M A P K modules to appropriate targets within the cell. The twenty A t M A P K s cluster into four discrete structural classes ( M A P K Group, 2002), and within a cluster the protein sequences show strong similarity.  Nevertheless, even closely related A t M A P K s such as  A t M P K 3 , 4 and 6, appear to play different biological roles. For example, A t M P K 4 function has been shown to be essential for proper growth and development (Petersen et al, while loss-of-function mutants o f A t M P K 3  2000),  or A t M P K 6 do not display any obvious  morphological phenotype ( X . L i , personal communication). atmpk4 mutants are also affected in regulation of systemic acquired resistance ( S A R ) during the plant's response to pathogen attack (Petersen et al, 2000), but the biochemical connection between growth regulation and modulation of S A R remains unresolved. A t M P K 3 and A t M P K 6 also rapidly respond to recognition of an incompatible pathogen (Asai et al, 2002) but the interplay, i f any, between these activation events and the negative regulation by A t M P K 4 of the subsequent appearance of S A R has not been determined.  A t M P K 3 and A t M P K 6 , as well as A t M P K 4 , are also  15  rapidly activated b y a number o f other biotic and abiotic stresses (Mizoguchi et al, 1996; Ichimura et al, 2000; Kovtun et al, 2000; Nuhse et a\., 2000; Desikan et al, 2001; Yuasa et al, 2001; Droillard et al, 2002; Zhang et al, 2002), including the downstream signaling induced b y binding  o f the bacterial  elicitor,  flagellin,  to the Arabidopsis  FLS2  transmembrane receptor (Asai et al, 2002). A t M P K l 3 ( A N R 1 ) appears to be involved cell plate formation during cytokinesis (Soyano et al, 2003) but its targets and specific function are unknown. Little is known about the expression o f the remaining seventeen A t M P K s , or about their biological roles. Thus, while mutant screens and similar gene-by-gene approaches have provided some valuable insights, definition o f the full potential for signal transduction through M A P K cascades in Arabidopsis requires a more systematic analysis.  1.4 Thesis objectives The general objective o f this study was to gain further insight into the biological role o f the M A P K gene family i n plants, and how these kinases are organized into a signaling network. Arabidopsis was used as the biological system because o f its rich cell physiology and genetic resources, as well as the full description o f its M A P K gene family derived from the genome sequence. These resources make it possible to link genes and their possible biological function(s)  based on gene expression patterns  and correlations  with  physiological  /developmental events in Arabidopsis plants. Manipulations o f gene expression can then be used to confirm hypotheses based on those correlation patterns.  16  Specific objectives: I.  Systematic expression analyses o f the complete array o f AtMPK and AtMKK genes, using reverse transcriptase ( R T ) - P C R with gene-specific primers. These data were used to select candidate genes with the most interesting expression pattern for further detailed functional characterization (Chapter 2).  II.  Functionally  characterization  o f these  candidate  genes  through  two  approaches; (1) histochemical localization o f gene expression using genespecific promoter::GUS reporter plants and (2) phenotypic analyses o f transgenic or mutant plants i n which expression o f the candidate genes has been modified.  The candidate genes chosen from expression profiling  (objective 1) were AtMKK6 and AtMPKl3 AtMPKl2  (Chapter 4).  17  (described i n Chapter 3) as well as  CHAPTER 2 MAPKK/MAPK Expression Profiling in Arabidopsis 2.1 Introduction In this chapter, I have systematically explored the expression o f the entire identified Arabidopsis MAPK gene family members for AtMKK and AtMAPK genes. There were two aims to this study. First, I wanted to develop an overview o f the transcription activity o f these thirty genes during growth and development of Arabidopsis plants, as well as i n response to a limited set o f relevant stresses. M y second aim was to identify interesting individual candidate genes for further detailed functional characterization. I anticipated that the expression survey might also reveal examples o f co-expression patterns o f discrete genes i n specific organ/tissue types or developmental stages. This could implicate their possible biochemical function i n the same cascade. The Arabidopsis MAPK gene family members encoded i n the genome have been previously identified and grouped based on their putative amino acid sequences ( M A P K Group, 2002). This study also assembled the limited data regarding function for both the Arabidopsis genes and their orthologs from other plant species. In addition, another studies assembled the available information on their biochemical properties (phosphorylation and physical interaction) (Ichimura et al,  1998b). Sequence alignment placed the putative  A t M K K s into four groups ( A - D ) , and the A t M P K s also into four groups ( A - D ) ( M A P K Group, 2002 and Figure 2.1). The phylogenetic grouping o f the putative A t M K K s and A t M P K s , when considered together with the limited functional information, indicates that these groups may represent broad function-related modules (groups). The first such module  18  consists o f group A M A P K K s and group B M A P K s , since some members o f both groups appear to have functions associated with cell division. (In this thesis, I have referred to it as the cell-division module, see Figure 2.1). The second module consists o f the group B M A P K K , A t M K K 3 , and group C M A P K s . In yeast two-hybrid assay, A t M K K 3 was also shown to physically interact with A t M P K l , which is a member o f group C M A P K s (Ichimura et al,  1998b). There is very limited information on the function and gene  expression for the gene members i n this module. The third putative module consists o f group C M A P K K s and group A M A P K s whose function was associated with stress response (referred to here as the stress response module). This proposed module is based on the knowledge that A t M K K 4 and A t M K K 5 , members o f group C M A P K K s were shown to activate A t M P K 3 and A t M P K 6 , members o f group A M A P K s . The fourth putative module consists o f group D M A P K K s and group D M A P K s , whose members' function and gene expression are completely unknown. Overall, most o f the MAPK gene family members i n Arabidopsis remain uncharacterized and very little experimental data are available on their gene expression and biological function.  19  Activation Group A  GroupB  r  sr  ( '  Interaction  AtMKKl ^  )\ \  GroupB  A  t  M  l\  K  K  2  J  {  GroupC  ^ AtMKKJ .  r  )  (  ^ AtYIKK4  GroupC  GroupD  ^ r AtMKKS \  / ]/  \ \  )  (  v At.YlK.K8  )  \ / (  GroupA  AtYIKK7  °  AtMKKi  \  )  ( \  At.YlKK9 \  ) ^  J  GroupD  Possible Function: Cell Division Limited Information Module  Stress Response Module  No Information  Figure 2.1 Grouping o f the M A P K K and M A P K proteins Phylogenetic grouping based on their putative amino acid sequences. The proposed functional grouping is based on functional and biochemical data for both Arabidopsis and orthologues from other species. This figure was adapted from M A P K Group (2002) and (1998b).  20  2.2 Materials and Methods 2.2.1 Plant materials and growth conditions Unless indicated otherwise, Arabidopsis thaliana (Columbia ecotype, Col-0) was grown i n soil at 22-24°C under a 16-hour photoperiod. T w o sets o f plants were prepared for parallel tissue collection, and were harvested separately for R N A extraction. A l l the tissue samples were harvested at the indicated time points. Tissues were harvested from 8-10 different plants at 15.00-17.00, pooled, immediately frozen i n liquid nitrogen and stored at -80°C until further analysis. Leaf tissues: The rosette leaves o f 21-day old plants were harvested. Bolting stem tissues: The bolting stems o f 25-day old plants were harvested. Flower bud tissues: The flower buds o f 25-day old plants were harvested. Root tissues: The Arabidopsis plants were grown hydroponically at 25°C under continuous light and the roots o f 34-day old plants were harvested. The surface-sterilized seeds were sown on sterile rafts (Sigma M4417) floating on 100 m L o f 0.5x M S (Murashige and Skoog) growth medium in Magenta boxes (6-8 seeds per box). The 0.5x M S growth liquid medium contained 0.5x M S salts (Invitrogen), l x M S vitamins (Sigma M3900), 0.5% sucrose and 0.5 g/L M E S . The medium p H was adjusted to 5.8 and autoclaved prior to use.  21  Callus tissues: To generate callus, hypocotyls and leaf tissues from 3-week-old aseptically-grown plants were aseptically excised and cultured on callus-induction medium for 34 days. Callus induction medium contained l x M S salts (4.3 g/L), 200 m g / L glycine, l x vitamins, 10 p M naphthalene acetic acid ( N A A ) , 5 p M 6-(y,y-dimethylallyl-amino) purine (2ip), 3 % sucrose, 0.3% agar and 0.1% phytagel, p H 5.6. l x vitamins contained 1 m g / L nicotinic acid, 1 m g / L pyridoxine.HCl, 1 m g / L calcium panthothenate, 1 m g / L thiamin.HCl, 0.01 m g / L biotin and 1 m g / L L-cysteine.HCl.  4-day old and 2-week old seedling tissues: Surface-sterilized seeds were sown on Vi x M S medium containing Vi x M S salts, l x M S vitamins (Sigma, Cat N o . M3900), 0.5% sucrose and 0.5 g / L M E S , 0.8% phytagar, p H 5.8. The seeds were kept at 4°C i n petri dishes wrapped with micropore tape and kept i n the dark for 2 days and then grown at 25°C under continuous light for either another 4 days or 2 weeks before the seedlings were harvested.  Secondary hypocotyl tissues: Plants were grown i n soil at 22-24°C and covered with plastic and aluminum foil during the first 10 days to induce long hypocotyls. After the plastic and aluminum foil were removed, the plants were grown i n soil at 22-24°C under 16-hour photoperiod for 3 months before the secondary hypocotyls were harvested.  Leaf tissues from various developmental stages: The plants were grown i n soil at 22-24°C under 16-hour photoperiod. The rosette leaf tissue was harvested at 1-week, 2-week, 3-week, 4-week and 5-week stages.  22  2.2.2 Plant treatments T w o sets o f plants were prepared for each treatment and each set was harvested separately for R N A extraction. The parallel control plants were grown under the same conditions and were harvested at the same time points, except that the control plants were not treated with ozone, were not wounded and were not shifted to chilling temperature.  A l l rosette leaf  samples were harvested from 8-10 individual plants, pooled, immediately frozen i n liquid nitrogen and stored at -80°C until further analysis. Ozone treatments: The ozone treatments were performed b y exposing 26-day-old plants to 300 ± 50 ppb ozone continuously for 8 hours i n an ozone fumigation chamber. Ozone was generated with a Delzone Z O - 3 0 0 ozone generating sterilizer ( D E L Industries, San Luis Obispo, C A , U S A ) and monitored with a Dasibi 1 0 0 3 - A H ozone analyzer (Dasibi Environmental Corp., Glendale, C A , U S A ) . Wounding treatments: The 26-day-old plants were cut 10 times with a blade on the left and right sides o f each leaf, avoiding the m i d vein. The leaf-wounded plants were allowed to stand for 8 hours before the wounded leaves were harvested. Chilling treatments: The 26-day-old plants were held at 5°C for 8 hours. The rosette leaves were then harvested.  23  2.2.3 Total RNA extraction Total R N A extraction was performed using b y TRIzol® Reagent according to the manufacturer 's instructions. Total R N A was isolated using a modified T R I Z O L extraction method. Approximately 1 g plant material was ground i n liquid nitrogen using a mortar and pestle, re-suspended i n 15 m L T R I Z O L reagent (Invitrogen, Carlsbad C A , U S A ) , vortexed and incubated at 65°C for 5 m i n with regular mixing. C e l l debris was pelleted b y centrifugation for 30 m i n at 12,000 g and 4°C and the supernatant was extracted with 3 m L chloroform. After centrifugation for 20 m i n at 12,000 g, the aqueous phase was recovered and R N A was precipitated at room temperature for 5 m i n with 0.5 volume 0.8 M sodium citrate and 0.5 volume isopropanol. After centrifugation for 30 m i n at 12,000 g, the pellet was washed with 7 0 % ethanol and re-centrifuged. The R N A pellet was air dried for 5 m i n and re-suspended i n 200 p i RNAse-free water. Following a spectrophotometric determination of R N A concentration, the R N A was precipitated with 2.5 volumes o f ethanol and a 1/10 volume o f 3 M sodium acetate at - 2 0 ° C overnight, and subsequently pelleted at 12,000 g for 30 m i n at 4°C. The precipitate was washed with 7 0 % ethanol, re-centrifuged, air dried and re-suspended i n RNAse-free water to an approximate concentration o f 1 p g R N A / p L . The actual concentration was determined spectrophotometrically.  2.2.4 RNA sample preparation for RT-PCR The following components were added to an ice-cold, RNase-free, 1.5-mL microcentrifuge tube: 3.6 p g total R N A sample, DNase I reaction buffer ( I X final concentration), 4 units DNase I and DEPC-treated water to make a final volume o f 40 p L . The reaction mixture was incubated for 15 m i n at room temperature. T o inactivate the DNase I, E D T A solution was  24  added to a final concentration o f 25 m M E D T A and the mixture was heated at 65 °C for 10 min. The resulting R N A sample was free o f genomic D N A and was ready to use i n the subsequent R T reaction.  2.2.5 RT reaction (first-strand cDNA synthesis) prior to PCR The following components were added to a nuclease-free microcentrifuge tube: 4 p L (300 ng/pL) random hexaprimers, 3.6 p g DNase I-treated total R N A , 4 p L 10 m M d N T P m i x (10 m M each d A T P , d G T P , d C T P and dTTP) and sterile, distilled water to make a final volume o f 48 p L . The mixture was heated to 65 °C for 5 m i n and quickly chilled on ice. It was then briefly centrifuged and the following components were added: 16 p L 5 X first-strand buffer, 8 p L 0.1 M D T T and 4 p L (40 units/pL) RNaseOUT™ Recombinant Ribonuclease Inhibitor (Gibco B R L ) . The contents were gently mixed and incubated at 25 °C for 2 m i n and then 4 p L (200 units/pL) SUPERSCRIPT™ II RNase H" Reverse Transcriptase (Gibco B R L ) was added and mixed gently. The resulting mixture was incubated at 25 °C for 10 m i n and then at 42 °C for 50 min. The reaction was stopped b y heating the sample at 70 °C for 15 min. T o remove R N A complementary to the c D N A , 2 p L (2 units/pL) E. coli RNase H was added and incubated at 37 °C for 20 min. The cDNA-containing solution was stored at - 2 0 °C until used for amplification.  25  2.2.6 PCR amplification The following components were added to a sterile 1.5-mL microcentrifuge tube to prepare a master m i x which contains a final concentration o f I X P C R buffer minus Mg* ", 0.25 m M 4  d N T P mixture, 1.5 m M  MgCl2,  0.2 p M forward primer, 0.2 p M reverse primer, 0.2 p M  Histone H I forward primer, 0.2 p M Histone H I reverse primer, 2 units/ 5 0 - p L reaction Platinum® Taq D N A polymerase ( G I B C O B R L ) and sterile distilled water to make up a required volume. The master m i x contents were mixed gently, centrifuged briefly and aliquoted to 0.2-mL microcentrifuge tubes. Each c D N A ( R T reaction) o f the same volume (< 1 p L ) was then added to the individual microcentrifuge tube. The tubes were incubated i n a Biometra T-gradient thermal cycler at 94 °C for 5 m i n to denature the c D N A template and activate the enzyme. The P C R amplification was performed 30-36 cycles as follows: denaturing at 94 °C for 1 m i n , annealing at 57 °C for 1 m i n , extending at 72 °C for 1 m i n . The reaction was maintained at 72 °C for 10 m i n after cycling and then maintained at 4 °C. The amplification products were analyzed b y agarose gel electrophoresis (0.8% agarose) and visualized b y ethidium bromide staining. Molecular weight D N A standards (1 K b ) were used on the same gel. A l l primer sequences for amplification o f AtMKK and AtMPK genes are presented i n Table 2.1 and Table 2.2, respectively.  26  Table 2.1 AtMKK primer sequences for P C R amplification. Lower case letters represent the restriction enzyme sites.  Gene  Gene ID  Name  Restriction  Sequences (5'-3')  Enzyme Site  AtH1  At2g30602  AtMKKI  At4g26070  Predicted PCR Product Length (bp)  EcoRI Xhol Xhol  ccggaattccggGGTTAAAGTCAAAGCTTC I I I IAAGA ccgctcgagcggGAGTGAAGAAACCATCACATTATA  726  ccgctcgagcggATGAACAGAGGAAGCTTATGCCCTA  1079  Xhol Xhol Xhol  ccgctcgagcggCTAGTTAGCAAGTGGGGGAATCAAAG  AtMKK2 At4g29810  ccgctcgagcggATGAAGAAAGGTGGATTCAGCAATAA ccgctcgagcggATGGTGATATTATGTCTCCCTTGTAG  1116  AtMKK3 At5g40440  Xhol  ccgctcgagcggATGGCGGCATTGGAGGAGCTAAAG ccgctcgagcggCTAATCTAAG I I IGTAATATAAAG  1587  AtMKK4  Xhol EcoRI  ccggaattccggGAAGAACGAATCAA I I IAAGCCTG  1521  At1g51660  AtMKK5 At3g21220 AtMKK6 At5g56580  EcoRI  ccggaattccggTGGGGATACATGCACCATCATAAG  Xhol Xhol Bam HI  ccgctcgagcggATGAAACCGATTCAATCTCCTTCTGGA ccgctcgagcggGGAAAAATGTCAGGAAAAACTACG  1134  cgcggatccgcgATGGTGAAGATCAAATCGAACTTG ccgctcgagcggTTATCTAAGGTAGTTAACAGGTGG cgcggatccgcgATGGCTCTTGTTCGTAAACGCCGTCA  1095  Xhol AtMKK7 At1g18350  Bam HI EcoRI  AtMKK8 At3g06230  BamHI  AtMKKI 0 At1g32320  ccggaattccggCTAAAGAC I I ICACGGAGAAAAGG cgcggatccgcgATGGTTATGGTTAGAGATAATCA ccggaattccggCTATCTCTCGCTTGCTTTCTTGCGTA  906  EcoRI EcoRI  ccggaattccggATGGC I I IAGTACGTGAACGTCGTCA  957  BamHI  cgcggatccgcgATGACACTTGTTAGAGAACGACGTCA  EcoRI  CcggaattccggCTATCTGTTTTTCACAAAAGAATGACG  EcoRI AtMKK9 At1g73500  948  ccggaattccggTCAAAGATCTTCCCGGAGAAAAGGATGA  27  942  Table 2.2 AtMPK primer sequences for P C R amplification. Lower case letters represent the restriction enzyme sites.  Gene Name  Gene ID  Restriction Enzyme Site  AtMPKl  At1g10210  AtMPK2  At1g59580  EcoRI Xhol BamHI EcoRI BamHI EcoRI BamHI EcoRI Xhol Xhol BamHI BamHI BamHI  AtMPK3 At3g45640 AtMPK4  At4g01370  AtMPK5 At4g11330 AtMPK6 At2g43790 AtMPK7 At2g18170 AtMPK8 At1g18150 AtMPK9 At3g18040 AtMPKl 0 At3g59790  EcoRI Xhol Xhol EcoRI EcoRI BamHI  Sequences (5'-3')  ccggaattccggATGGCGACTTTGGTTGATCCTCCTAA ccgctcgagcggTGTTACAGACACACATCAAGCTTG cgcggatccgcgATGGCGACTCCTGTTGATCCACCTAA ccggaattccggGTACAAACGTTACAGACACTTAAG cgcggatccgcgATGAACACCGGCGGTGGCCAATACA ccggaattccggCTAACCGTATGTTGGATTGAGTGCTA  1384  cgcggatccgcgATGTCGGCGGAGAGTTGTTTCGGAAG ccggaattccggAGAGATTTGATAACAAAAGCAGAG ccgctcgagcggATGGCGAAGGAAATTGAATCAGCG ccgctcgagcggTTAAATGCTCGGCAGAGGATTGA  1242  cgcggatccgcgATGGACGGTGGTTCAGGTCAACCG cgcggatccgcgTTGAGACCCATCCCCTTCAACATC cgcggatccgcgATGGCGATGTTAGTTGAGCCACCA ccggaattccggACAAGCCTTAACTTACTTAGTAACA ccgctcgagcggATGGGTGGTGGTGGGAATCTCGTCGA ccgctcgagcggCTATTAAATACAACAAATCAAACCCAA ccggaattccggATGGATCCTCATAAAAAGGTTGCA ccggaattccggTCAAGTGTGGAGAGCCGCGACC cgcggatccgcgATGGAGCCAACTAACGATGCTGAGA ccggaattccggTCAATCATTGCTGGTTTCAGGGTTGA  1393  cgcggatccgcgATGTCAATAGAGAAACCATTCTTCG ccgctcgagcggTTAAGGGTTAAACTTGACTGATTCA  1134 1245  AtMPKl 1 At1g01560  EcoRI BamHI Xhol  AtMPKl 2 At2g46070  BamHI  cgcggatccgcgATGGATTTAGTGTCTTCAAGAGATA  AtMPKl 3 At1g07880  EcoRI BamHI  ccggaattccggTCAGTGGTCAGGATTGAATTTGACAGA cgcggatccgcgATGGAGAAAAGGGAAGATGGAGGGA ccggaattccggTTACATATTCTTGAAGTGTAAAGA cgcggatccgcgATGGCGATGCTAGTTGATCCTCCA  AtMPK15 At1g73670  EcoRI BamHI EcoRI BamHI  AtMPKl 6 At5g19010  Xhol BamHI  AtMPKl 4 At4g36450  AtMPKl 7 At2g01450  BamHI Xhol Xhol  ccggaattccggTTAAGCTCGGGGGAGGTAATGAAGCA cgcggatccgcgATGGGTGGTGGTGGCAATCTCGTCGA ccgctcgagcggCTAAGAATTGTGTAGAGATGCAACTT cgcggatccgcgATGCAGCCTGATCACCGCAAAAAG cgcggatccgcgTTAATACCAGCGACTCATTGCAGTA ccgctcgagcggATGTTGGAGAAAGAGTTTTTCACGGA ccgctcgagcggCTATGACACTGCAGAGGAGACACCA  AtMPKl 8 At1g53510  BamHI EcoRI  cgcggatccgcgATGGAGTTTTTCACAGAGTATGGTGA ccggaattccggCTATGATGCTGCGCTGTAACTAATTG  AtMPKl 9 At3g14720  BamHI EcoRI BamHI Xhol  cgcggatccgcgATGGAGTTTTTCACTGAGTATGGTGA ccggaattccggCTAAGACATGCCATACCCAACA cgcggatccgcgATGGAGTTCTTTTCTGACTATGGCGA ccgctcgagcggCTAGTACATCTTTGACATACCGTA  AtMPK20 At2g42880  Predicted PCR Product Length (bp)  28  1363 1137  1155  1392 1920 1557 1206  1116 1110 1755 1728 1575 1836 1785 1809  2.3 Results and Discussion 2.3.1  Tissue differentiation of the  Arabidopsis MAPKK/MAPK  gene  families: Characteristic profiles in mature and developing organs using RT-PCR data I initially examined whether individual members o f the Arabidopsis MAPK and  MAPKK  gene families were expressed i n particular organs and tissues by using the R T - P C R approach. M y expression results revealed that transcripts for most of the Arabidopsis MAPK  and  MAPKK genes could be detected i n all tissues/organs tested, although for a few members expression could only be detected i n particular organs (Table 2.3 and Table 2.4), and no signal was detected for a few others. I also include the publicly available M P S S (Massively Parallel Signature Sequencing) dataset of the AtMPK and AtMKK genes (Meyers et  al,  2004a; Meyers et al, 2004b) as presented i n Table 2.5 and Table 2.6. M y R T - P C R data is generally consistent with the M P S S data except a few genes e.g. A t M P K l , A t M P K 8 , A t M P K l 4 and A t M K K 7 . A m o n g the 20 Arabidopsis MAPK  genes, AtMPKl 1, AtMPK12  and  AtMPKB  showed the greatest differentiation i n expression across organ types. AtMPKl 1 expression could not be detected i n bolting stems and 4-day seedlings, whereas AtMPKl2  and AtMPKl3  transcripts were found i n greatest abundance in tissues that contain actively dividing cells such as callus, flowers and roots, but were barely detected in mature organs such as leaves and secondary hypocotyls (Table 2.3). These data are consistent with the report that N T F 6 , a putative tobacco ortholog of A t M P K l 3, has a role in cell division (Calderini et al,  1998).  A m o n g the 10 Arabidopsis MAPKK genes whose expression was tested by R T - P C R , the AtMKK6 gene was the only one that showed differentiation o f expression across tissue  29  types (Table 2.4). Its transcripts were detected most readily in tissues that contain young dividing cells such as callus, flowers, roots and seedlings but could barely be detected in mature tissues that were no longer growing (Figure 2.2 A). This expression pattern to a large  Table 2.3 The gene expression profiles in all known Arabidopsis MAPK genes RT-PCR Groups Genes  Flowers +  Roots +  Stems +  +  +  +  +  +  +  +  NS +  NS +  NS +  NS +  NS +  NS +  NS +  NS +  +  +  +  +  -  -  +  +  AtMPKl 2 At2g46070  -  +  +  +  +  +  -  -  AtMPK5  At4g11330  +  +  +  +  +  +  +  +  AtMPKl 3 At1g07880  -  +  +  +  -  -  -  -  AtMPK6  Leaves + At3g45640 + At2g43790  AtMPKl 0 At3g59790 AtMPK4  At4g01370  AtMPKl 1 At1g01560 B  C  4-d SL 2-w SL + +  SH +  AtMPKl  At1g10210  AtMPK2  At1g59580  NS +  NS +  NS +  NS +  NS +  NS +  NS +  NS +  AtMPK7  At2g18170  +  +  +  +  +  +  +  +  AtMPKl4  At4g36450  +  +  +  +  +  +  +  +  AtMPK8  At1g18150  NS +  NS +  NS +  NS +  NS +  NS +  NS +  NS +  At3g18040  +  +  +  +  +  +  +  +  AtMPKl 7 At2g01450  +  +  +  +  +  +  +  +  AtMPKl 6 At5g19010  +  +  +  +  +  +  +  +  AtMPKl 8 At1g53510  +  +  +  +  +  +  +  +  AtMPKl 9 At3g14720  +  +  +  +  +  +  +  +  AtMPK20 At2g42880  +  +  +  +  +  +  +  +  AtMPKl 5 At1g73670 AtMPK9 D  Signal in Different Tissues/Organs Callus +  AtMPK3 A  CHRJocus  (- ) = not detected or barely detected, ( + ) = detected and NS = No Signal 4-d SL = 4 days old seedlings, 2-w SL = 2 weeks old seedlings, SH = Secondary hypocotyls  30  Table 2.4 The gene expression profiles in all known Arabidopsis MAPKK genes  RT-PCR Groups  Genes  CHRJocus  Signal in Different Tissues/Organs Leaves Callus Flowers Roots Stems 4-dSL 2-wSL  SH  AtMKKI At4g26070 AtMKK2 At4g29810 AtMKK6 At5g56580  +  +  +  +  +  +  +  +  +  +  +  +  +  +  +  +  -  +  +  +  -  +  +  -  B  AtMKK3 At5g40440  +  +  +  +  +  +  +  +  C  AtMKK4 At1g51660 AtMKK5 At3g21220  +  +  +  +  +  +  +  +  +  +  +  +  +  +  +  +  AtMKK7 At1g18350 AtMKK8 At3g06230 AtMKK9 At1g73500 AtMKKI 0 At1g32320  +  +  +  +  +  +  +  -  NS  NS  NS  NS  NS  NS  NS  NS  +  +  +  +  +  +  +  +  NS  NS  NS  NS  NS  NS  NS  NS  A  D  ( - ) = not detected or barely detected, ( + ) = detected and NS = No Signal 4-d SL = 4 days old seedlings, 2-w SL = 2 weeks old seedlings, SH = Secondary hypocotyls  31  Table 2.5 The M P S S data for the AtMPK genes Expression Signal* in Different Tissues/Organs Groups A  Genes  Leaf  Callus  INF  Root  Silique  AtMPK3 AtMPK6  341  187  151  190 NS  113 NS  162 347  61  152 NS  NS  87 NS  114 0 21 55 19 2  169 0 19 63 6 4  119 0 0 51 2 3  175 0 0 16 16 4  93 0 0 3 12 16  AtMPKl AtMPK2  NS 31 15  NS 17 8  10 0 0 NS 36 23 33 28 63 45 51 19  26 58 11 29 117 37  115 59 24 30 68 59 164 6  NS 32 31 32 3 0 NS 127 2 20 15 1 35 101 0  NS 4 27  AtMPK7  NS 30 18 60 0 0 NS  24 18 23  38 8 46 22 12  AtMPKl 0  B  AtMPK4 AtMPKl 1 AtMPKl 2 AtMPK5 AtMPKl 3  C  AtMPKl 4 AtMPK8  D  AtMPKl 5 AtMPK9 AtMPKl 7 AtMPKl 6  AtMPKl 8 AtMPKl 9 AtMPK20  72 2  22 15  65 0 0 NS  68 10 61 64 51  19 6 97 120 19  63 0 0 NS 114 14 14 27 26 29 103 25 10 6 89 179 80  M P S S has been described i n a publication b y Brenner et al. (2000). M P S S produces short sequence signatures produced from a defined position within an m R N A , and the relative abundance o f these signatures i n a given c D N A library ( e.g. leaf, callus, inflorescence (INF), root, or silique c D N A library) represents a quantitative estimate o f expression o f that gene. Numbers i n the same column were derived from expression data from the same sequence signature. * Specific transcripts detected per 1,000,000 total transcripts  32  Table 2.6 The M P S S data for the AtMKK genes Expression Signal In Different Tissues/Organs Groups A  Genes  Leaf  Callus  INF  AtMKKI  72  46  AtMKK2  0 6 1  0 0 63  10 5  66 0  Root  Silique  50  4  42  0 0 16 36 0  10 0 12  0 0 12  20 3  28 0  B  AtMKK6 AtMKK3  C  AtMKK4 AtMKK5  5 17 10  25 14 37  10 23 25  0 14 15  0 6 11  AtMKK7  NS NS 34 1 3 NS  NS NS 75 26 20 NS  NS NS 19 0 0 NS  NS NS 39 2 0 NS  NS NS 21 1 13 NS  D  AtMKK8 AtMKK9  AtMKKI 0  M P S S has been described i n a publication by Brenner et al. (2000). M P S S produces short sequence signatures produced from a defined position within an m R N A , and the relative abundance o f these signatures in a given c D N A library ( e.g. leaf, callus, inflorescence (INF), root, or silique c D N A library) represents a quantitative estimate o f expression o f that gene. Numbers i n the same column were derived from expression data from the same sequence signature.  33  R  4-d SL  2-w SL  SH  AtMKK6 Histone HI  €BP QHI  W  B AtMPK13  Histone HI  M P (HP  -  MP  AtMPKll  _^  Histone HI  Figure 2.2 R T - P C R analysis of the expression pattern o f the AtMKK6 and AtMPKl 3 genes. L = Leaves, S = Bolting stem, F = Flower buds, R = Roots, C = Callus, 4-d S L = 4 days old seedlings, 2-w S L = 2 weeks old seedlings, S H = Secondary hypocotyls A , B and C show the expression patterns o f the AtMKK6, AtMPKl3  and AtMPKll  genes,  respectively. Histone HI was used as a control gene. The experiments were repeated giving comparable results.  34  degree parallels that seen with the AtMPKl3  gene (Figure 2.2 B ) . NtMEKl  putative tobacco orthologs o f AtMKK6 and AtMPKl3,  and NTF6, the  respectively, were previously reported  to be co-expressed both across plant tissues and following the induction o f cell division i n leaves (Calderini et al., 2001). In addition, their yeast two-hybrid interaction analysis and in vitro kinase assays indicated that A t M E K l could act as an upstream M A P K K for N T F 6 , and that their biological functions were involved i n cell division. This relationship strongly indicates that A t M K K 6 and A t M P K l 3 could operate i n an analogous cascade i n Arabidopsis and might play a role i n cell proliferation. Similar to the AtMPKl3  gene, the AtMPKl2  gene  also showed preferential expression i n specific tissues/organs, which is, again, similar to AtMKK6  (Figure 2.2 C ) . However, very little is known about the biological function o f  ATMPK12. In m y R T - P C R expression survey, I also found that AtMKK9  expression was  developmentally regulated because it was differentially expressed i n different tissues, and its transcriptional level was markedly higher i n 2-week-old seedlings as compared with that i n 4-day old seedlings (Figure 2.3 A ) . These results were confirmed b y performing an expression time-course experiment with 1-week old to 5-week old Arabidopsis leaves. Again, the expression o f the AtMKK9  gene was clearly increased as the leaves became  mature (Figure 2.3 B ) . The possible role o f the M A P K pathways i n developmental processes has been studied i n a variety o f plant species. The gene encoding the rice M A P K , O s M A P K 4 , was predominantly expressed i n leaves o f the rice plant at a late developmental stage (Fu et al., 2002), while the synthesis o f the tobacco M A P K , N T F 3 , occurred at the latebi-cellular stage o f pollen maturation (Wilson et al., 1997). The transcripts o f the Arabidopsis  35  B  Leaves 1W  2W  3W  4W  5W  AtMKK9 Histone HI  Figure 2.3 The AtMKK9  gene was differentially  expressed i n organs and during  developmental stages. L = Leaves, S = Bolting stem, F = Flower buds, R = Roots, C = Callus, 4-d S L = 4 days o l d seedlings, 2-w S L = 2 weeks old seedlings, S H = Secondary hypocotyls 1W - 5 W = One week o l d plants - Five week old plants Histone HI was used as a control gene. These are the R T - P C R results. The experiments were repeated giving comparable results.  36  M A P K K , M A P 2 K a (probably A T M K K 5 ) were much more abundant i n o l d leaves than i n young leaves (Hamal et al, 1999).  2.3.2 Stress differentiation of the Arabidopsis MAPKK/MAPK  gene families  Transcription o f several genes i n the plant M A P K gene family has been reported to be induced b y various abiotic stresses (Hirt, 2000; Ichimura et al., 2000; Ligterink and Hirt, 2001; Yuasa et al., 2001; Agrawal et al., 2002; Mayrose et al, 2004). In this R T - P C R survey, I also examined the effects o f various abiotic stresses on the expression o f all the identified AtMPK and AtMKK genes i n leaves b y subjecting three-week old Arabidopsis plants to ozone, wounding and chilling stresses. A m o n g the 20 AtMPK gene expression profiles i n response to abiotic stresses (Table 2.7), group A AtMPK3 and AtMPK6 genes were induced i n response to all abiotic stresses tested. AtMPKlO  is classified i n the same phylogenetic group as AtMPK3 and AtMPK6 but  its expression was not detected. This result is consistent with the fact that no m R N A and E S T were found for this gene i n the M I P S (Munich Information Center for Protein Sequences) database (Table 2.7). Ahlfors et al. (2004) demonstrated that AtMPK3, but not AtMPK6 responded transcriptionally and translationally during ozone exposure. Both A T M P K 3 and ATMPK6  kinases were  previously  shown  to be activated  b y ozone,  wounding,  hypoosmolarity, l o w humidity and touch (Ichimura et al, 2000; Droillard et al, 2002; Ahlfors et al, 2004). In addition, these two proteins were constitutively activated i n the Arabidopsis ssi4 mutant that accumulated H2O2 and salicylic acid prior to lesion formation (Zhou et al, 2004). H202, generated by Arabidopsis cells i n response to challenge with harpin  37  (a proteinaceous bacterial elicitor) was also shown to activate A T M P K 6 (Desikan et  al,  2001). Some members of the group B M A P K s classified in the cell-division module including AtMPKl 1, AtMPK12  and AtMPKB  (Figure 2.1), did not change i n their  expression in response to the applied abiotic stresses (Table 2.7). The fact that these genes were preferentially expressed i n organs containing actively dividing cells such as flowers and callus, indicates that they are more likely to encode proteins that function in response to plant growth and development rather than abiotic stresses.  However, some other genes i n this  cell-division module did show a stress response, such as AtMPK4 and AtMPKS. Expression of AtMPK4 was induced by wounding, and that of AtMPK5 was up-regulated by chilling (Table 2.7). Additional expression data of the group B M A P K s came from previous work done by Ichimura et al. (2000) and Desikan et al. (2001). Consistent with m y data, low temperature did not affect AtMPK4 expression or its protein level, but it did respond at the posttranslational level since this environmental stress induced rapid and transient activation of A T M P K 4 , as assessed by tyrosine phosphorylation on the protein (Ichimura et al, 2000). In contrast to m y data, it was previously reported that wounding did not have an effect on  AtMPK4 expression (Ichimura et al, 2000), nor did a bacterial elicitor, harpin and H2O2 (Desikan et al, 2001). However, publicly available data showed that the AtMPKS gene was transcriptionally induced by chitin oligomers, elicitors that can be released from fungal cell walls by endochitinase ( T A I R , http://www.arabidopsis.org/).  38  Table 2.7 The gene expression profiles i n all known Arabidopsis MAPK different stress conditions  Groups  A  Genes  CHRJocus  Chilling +  mRNA  EST  At3g45640  3  25  AtMPK6  At2g43790  +  +  +  2  7  NS  NS  none  none  0  4  1 none  none  At4g01370  0  NS +  AtMPKl 1 At1g01560  0  0  0  AtMPK12 At2g46070 AtMPK5 At4g11330  0 0  0 0  0 +  none 2 1  AtMPKl 3 At1g07880  0  0  0  none  AtMPKl  At1g10210  NS  NS  NS  AtMPK2  At1g59580  AtMPK7  At2g18170  0 + +  0 + +  0 +  3 4  NS  NS  0 0 + +  0 0 + +  AtMPKl 4 At4g36450 AtMPK8  At1g18150  AtMPKl 5 At1g73670 AtMPK9 At3g18040 D  Wounding +  AtMPK3  AtMPK4  C  Stress Treatments (Leaves) Ozone +  AtMPKl 0 At3g59790  B  genes under  AtMPKl 7 At2g01450 AtMPKl 6 At5g19010 AtMPKl 8 At1g53510  3 2 1  1  2 2  none  none  NS  3  11  0 0 + +  2 1  2 2 21  0  none 2  0  AtMPK19 At3g14720  0 0  +  0  +  3 none  AtMPK20 At2g42880  0  0  0  2  9 7 6 16  ( + ) = Changed compared to non-treated control ( 0 ) = N o t changed compared to non-treated control N S = N o signal m R N A and E S T data were taken from M I P S database on January 13, 2004  39  For group C M A P K genes, I found that AtMPK2 had no significant change in its expression whereas AtMPKl  and AtMPK14 displayed altered transcript levels i n response to  the applied abiotic stresses (Table 2.7). Although for AtMPKl,  I obtained no expression  signal in the R T - P C R dataset, 3 R N A s and 1 E S T derived from this gene were found in the M I P S database (Table 2.7).  These observations indicate that AtMPKl  gene may not be  responsive to some abiotic stresses but perhaps is responsive to other specific stimuli. For instance Mizoguchi et al. (1996) showed that m R N A of AtMPKl  was induced by salt-stress  treatment, whereas it was transcriptionally unaffected by cold stress. A m o n g previously uncharacterized group D M A P K s , expression of the AtMPKl 7 and AtMPKl6  genes was induced by all the abiotic stresses tested, while AtMPKl8  and AtMPK19  expression was only induced by chilling stress. Expression of the A t M P K 9 , A t M P K l 5 and A t M P K 2 0 - e n c o d i n g genes did not change when the abiotic stresses were applied (Table 2.7). I did not detect any expression signal for the AtMPK8 gene by R T - P C R , but at least 3 R N A s and 11 E S T s for this gene were found in the M I P S database (Table 2.7). A m o n g the 10 AtMKK genes, on one hand, AtMKKI  and AtMKKI  expression was  induced in response to wounding and chilling stress (Table 2.8). AtMKK6, on the other hand, showed no change in its expression in response to the specified stresses, nor did AtMKK3 (Table 2.8). M y results also showed that the structurally similar AtMKK4 and AtMKKS genes appear to have somewhat different roles, because their expression patterns could be distinguished. The AtMKK4  gene did not change its expression in response to abiotic  stresses, but the AtMKK5 gene did (Table 2.8). It is, of course, possible that genes whose transcript levels were not responsive to these abiotic stresses could respond to other stimuli  40  Table 2.8 The gene expression profiles i n all known Arabidopsis MAPKK different stress conditions  Groups  genes under  Genes  CHRJocus  Ozone  Wounding  Chilling  mRNA  EST  AtMKKI  0  +  +  5  6  AtMKK2 AtMKK6  At4g26070 At4g29810 At5g56580  0 0  +  +  0  0  4 1  11 none  B  AtMKK3  At5g40440  0  0  0  4  2  C  AtMKK4  0  0  0  AtMKK5  At1g51660 At3g21220  +  +  +  7 2  7 7  AtMKK7  At1g 18350  +  +  0  none  none  AtMKK8  At3g06230 At1g73500  NS 0  NS 0  NS  none  none  +  6  8  AtMKKI 0 At1g32320  NS  NS  NS  none  none  A  D  AtMKK9  Stress Treatments (Leaves)  ( + ) = Changed compared to non-treated control ( 0 ) = Not changed compared to non-treated control N S = N o signal m R N A and E S T data were taken from M I P S database on January 13, 2004  such as biotic stresses, phytohormones and/or other chemicals. F o r example, a preliminary experiment showed that AtMKK4 transcription was responsive to infection b y Peronospora (our unpublished data), suggesting that A t M K K 4 might play a role i n biotic stress responses rather than abiotic stress response. Since  H2O2 is known to be generated by Arabidopsis cells i n response to exposure to  ozone, m y expression data for tissue response to ozone is i n agreement with previous data showing that the expression of AtMKKI  (AtMEKl),  and AtMKK2 was not affected b y  H2O2  treatment (Desikan et al, 2001). A t M K K I expression i n response to wounding observed i n m y study is consistent with a previous report o f its transcriptional up-regulation upon wounding (Morris et al,  1997). However, Matsuoke et al. (2002) demonstrated that the  amounts o f the A T M K K I protein did not change significantly i n response to wounding and 41  other abiotic stresses including cold, drought, and high salt. A t the same time, A t M K K I did display elevated protein kinase activity. Their data also indicated that the A t M E K l becomes activated through phosphorylation and activates its downstream target, A T M P K 4 , during stress response in Arabidopsis. Ichimura et al. (1998b) showed that A T M K K 2 7 A T M K K I and A T M P K 4 physically interacted with two distinct regions o f the upstream  MAPKKK,  A T M E K K 1 ( A t M K K K l ) protein, the N-terminal regulatory domain and the C-terminal kinase domain, respectively. Co-expression o f A T M E K K 1 increased the ability o f either o f the two closely related M A P K K s , A T M K K 2 or A t M K K I , to complement a growth defect o f the yeast pbs2 mutant.  They suggested that A T M E K K 1 ,  A T M K K 2 / A T M K K I , and  A T M P K 4 might therefore constitute a plant M A P kinase cascade. V e r y little is known about the AtMKK3,  AtMKK4  and AtMKK5 gene expression i n response to abiotic and biotic  stresses. N o information has been published on the function o f group D A t M K K s ( M A P K Group, 2002). Our data showed that some group D AtMKK genes were involved i n specific abiotic stress responses. For example, the AtMKK7 gene, whose expression signal was weak i n non-treated leaves, had its expression significantly induced b y ozone and b y wounding, whereas the expression o f the AtMKK9 gene was induced specifically i n response to l o w temperature stress (Table 2.8). Notably, neither AtMKK8 nor AtMKKlO  gene expression was  detectable b y the R T - P C R method, which is consistent with the absence o f their m R N A and E S T s from the M I P S database (Table 2.8).  42  2.3.3 Three candidate genes with interesting expression pattern for further functional characterization 2.3.3.1 The AtMKK6 and AtMPKl3 genes From the expression profiling o f two classes o f genes encoding putative M A P K s and M A P K K s i n Arabidopsis, I identified a pair o f genes, AtMKK6 and AtMPKl3,  that were co-  expressed i n various tissues/organs containing actively dividing cells such as flowers, roots and callus under normal growth condition, and had a similar expression pattern under different environmental conditions i n leaves (Figure 2.2 A and B ) . Recently, A t M K K 6 was shown to functionally activate the A t M P K l 3 i n yeast as the kinase activity o f A t M P K l 3 is stimulated i n the presence o f A t M K K 6 i n yeast cells (Melikant et al., 2004). In addition, their co-expression data was also consistent with m y expression data. Significantly, N t M E K l and N t F 6 , tobacco orthologues o f A t M K K 6 and A t M P K l 3 , respectively, were shown to be involved i n cytokinesis (Calderini et al, 1998; Calderini et al, 2001; Soyano et al, 2003). Based on m y expression data together with the available functional information o n their orthologues i n tobacco and from the in vitro and in vivo (yeast) kinase assays, I postulated that A t M K K 6 and A t M P K l 3 may function i n the same cascade involving i n cell proliferation i n some specific cell- or tissue- types i n Arabidopsis. Therefore, I further investigated the biological function o f these two genes i n planta as presented i n Chapter 3.  2.3.3.2 The AtMPKl2 gene The AtMPKl2  expression pattern is particularly interesting, because it showed preferential  expression i n some specific tissues (Figure 2.2 C ) . In addition, its expression pattern i n various organs was somewhat similar to those o f AtMKK6 and AtMPKl3  43  genes (Figure 2.2  A , B and C ) . Notably, A T M P K 1 2 and A T M P K 1 3 have been grouped i n the same functional module based on their deduced amino acid sequences ( M A P K Group, 2002 and Figure 2.1). Therefore, it seemed possible that A T M P K 1 2 could have a function similar to that o f ATMPK13  i n planta. T o elucidate the function o f A t M P K l 2 i n planta,  characterized the AtMPKl2  I further  gene expression and its function i n detail, as presented i n  Chapter 4.  2.3.4 Perspectives 2.3.4.1 Expression profiling approach is useful to identify developmentally regulated and stress-responsive genes. I focused m y interpretation and discussion based on only positive signals, not negative signals. The positive signal detected i n various organs b y R T - P C R approach is strong evidence for the actual presence o f transcripts i n those organs, since the identities o f the Arabidopsis MAPK and MAPKK R T - P C R products obtained as positive expression signals were confirmed by sequencing. Similarly, the R T - P C R expression survey of tissues subjected to various abiotic stresses is useful for identification o f stress-responsive genes. A s stated in the introduction in this chapter, m y goals were to identify functions of the individual members o f Arabidopsis MAPKK  and MAPK  gene families and to detect  functional cascades between these two classes o f the MAPK gene family based on expression profiling.  A s a result  from  the expression survey, I found that some previously  uncharacterized group C AtMPK7 and AtMPK14 genes and group D AtMPKl6  and AtMPKl 7  genes are responsive to environmental stresses. In addition, I found that group D AtMKK9 is  44  involved i n developmental processes. Significantly,  I  developmentally regulated genes (AtMKK6 and AtMPKB)  also found  one pair  o f the  that potentially function i n the  same cascade. This grouping based on the co-expression pattern is consistent with those based on both phylogenetic grouping and the association o f their orthologues with a known function (cell-division) (Figure 2.1). However, some other genes with known physical and/or biochemical interactions could not be associated b y the expression profiling, including some of  the  well  known  pairs:  ATMKKI  and A T M P K 4 ;  ATMKK4/ATMKK5  and  A T M P K 3 / A T M P K 6 (Figure 2.1). A T M K K I was previously shown to phosphorylate and physically interact with A T M P K 4 i n vitro (Huang et al,  2000) as did A T M K K 4 and  A T M K K 5 with A T M P K 3 and A T M P K 6 (Asai et al, 2002). Notably, the genes encoding these proteins are stress-responsive genes. Overall,  my  results  demonstrated  that  expression profiling  using  various  tissues/organs and under various stress stimuli is informative, because it can be used to identify  developmentally  regulated  genes and stress-responsive genes, respectively.  However, this approach is limited and not sufficient for grouping the stress-responsive genes into common signaling cascades. This may be due to the fact that most o f the stressresponsive MAPK/MAPKK  genes are expressed ubiquitously across many tissues/organs  (Table 2.3 and Table 2.4), so that their co-expression simply cannot be distinguished i n tissues/organs. In addition, expression profiling does not provide differentiation between active and inactive forms o f proteins. transcriptional  level,  but  rather  Some M A P K s are not regulated primarily at the  regulated  phosphorylation (Tena et al, 2001).  45  at  the post-translational  level  through  Notably, no expression signal from some o f the genes, like AtMPKl 0, AtMKK8 and AtMKKI0, was detected i n any organs and stress conditions tested b y the R T - P C R approach, which is consistent with the fact that no R N A and E S T records were found i n the M I P S database (Table 2.7 and 2.8). It is possible that these genes might respond specifically to certain  stimuli  or growth conditions  or they  could represent  non-functional  genes  (pseudogenes).  2.3.4.2 Spatial and temporal expression can infer gene function in Arabidopsis It is notable that expression analysis i n Arabidopsis could detect functional  differentiation  across different organs despite the fact that the m R N A population reflects a mixture o f cell or tissue types i n each plant organ. For example, a wild-type root organ is made o f five tissue types; the outermost is epidermis, and then inside is cortex, endodermis, pericycle and vascular tissues. The abundance o f transcripts o f a cell-specific gene observed i n an organ with multiple cell types cannot be assumed to demonstrate the presence o f more o f those m R N A s i n every cell i n the organ. Rather, it may reflect the absence and presence o f m R N A s or proteins i n certain cell-types i n a given organ/tissue. Knowledge o f the expression o f a gene i n specific cells or tissues i n Arabidopsis, would therefore help to infer the biological roles o f a gene product o f unknown function. A useful approach to the more detailed localization o f gene expression in planta employs transgenic plants carrying a gene-specific promoter fused with the ^-glucuronidase (GUS) reporter gene. M y investigation o f this is presented i n the Chapters 3 and 4.  46  CHAPTER 3 MAP kinase kinase 6 (AtMKK6) and MAP kinase 13 (AtMPK13) encode positive regulators of lateral root formation.  Arabidopsis  3.1 Introduction Lateral root formation is an important process for plant growth and development. Root branching greatly increases the zone o f substrates that can be exploited b y the plant, and also enables re-direction o f root growth i n response to locally unfavorable rhizosphere conditions. Environmental and developmental signals must be integrated to determine both the frequency of lateral root initiation and the location o f the lateral root primordia ( L R P ) along a parental root (Malamy and Ryan, 2001; Casimiro et al, 2003). In Arabidopsis,  the primary root  consists o f four single layers o f epidermal, cortical, endodermal and pericycle cells surrounding the vascular tissues (Figure 3.8 B and Dolan et al, 1993). The formation o f a new lateral root begins with localized renewal o f cell division i n pericycle cells. The resulting new lateral root primordia originate specifically from pericycle cells positioned opposite the xylem poles o f the vascular cylinder (Dolan et al, 1993). In Arabidopsis,  the  pericycle consists o f dissimilar cell files. Those pericycle basal cells located adjacent to protoxylem poles proceed to G 2 phase o f the cell cycle, whereas other pericycle cells remain in G l phase (Beeckman et al, 2001; Himanen et al, 2002). However, since L R P develop at discrete positions along the primary root, it appears that even within the file o f G2-arrested cells, only a subset is involved i n lateral root initiation. It has been proposed that this localized initiation competency is established b y two intersecting signals. Pericycle cells across from the protoxylem poles are "primed" b y a radially diffusible factor, while a  47  longitudinally distributed factor subsequently triggers cell division within a subset o f the "primed" cells (Skene, 2000). The phytohormone auxin is known to play an important role i n lateral root formation (Boerjan et al, 1995; Celenza et al, 1995; Laskowski et al, 1995; Beeckman et al, 2001; Himanen et al, 2002), and is a compelling candidate as the longitudinally distributed factor that promotes the primed cells to divide. A u x i n has profound effects on root growth and development (Casimiro et al, 2001; Bhalerao et al, 2002; Himanen et al, 2002), and on cell cycle activity (Stals and Inze, 2001), and it has been proposed that auxin induces lateral root initiation b y cell cycle stimulation (Himanen et al, 2002). Several auxin-responsive mutants have altered lateral root initiation and emergence (Celenza et al, 1995; Casimiro et al, 2003). Normally quiescent pericycle cells i n fully developed areas o f roots still maintain the ability to generate L R P s i n response to exogenously applied auxin (Laskowski et al, 1995; Doernerera/., 1996). M A P K cascades are involved i n many aspects o f growth, stress management and cell fate i n eukaryotes including yeasts, mammals and plants (Widmann et al, 1999; Ligterink and Hirt, 2001; Tena et al, 2001). In plants, M A P K cascade genes have been implicated i n signal transduction associated within plant development and plant hormone responses (See literature review i n Chapter 1 and references therein). M y R T - P C R survey o f the expression patterns of Arabidopsis M A P K s and M A P K K s revealed that most AtMKK and AtMPK genes showed uniform expression during development but AtMKK6 and AtMPKl3  did not (Chapter  2, Table 2.3 and 2.4). These two genes were preferentially expressed i n tissues and organs that contain proliferating cells, including flowers, callus and roots (Chapter 2, Figure 2.2).  48  Therefore, activity o f the products o f these genes appears to be associated with active celldivision processes i n plants. Arabidopsis A t M K K 6 and its tobacco ortholog, N t M E K l , have recently been reported to be associated with cell plate formation during cytokinesis (Calderini et al, 2001; Soyano et al, 2003), and a M A P K cascade controlling cytokinesis i n tobacco cells was proposed to consist o f the tobacco N P K 1 M A P K K K  (Nishihama et al,  2001), the  N Q K l / N t M E K l M A P K K and the N R K 1 M A P K (Soyano et al, 2003). This " P Q R " pathway operates downstream o f the kinesin-related proteins, N A C K 1 / 2 , during the late M phase o f the cell cycle i n tobacco cells (Takahashi et al, 2004). Arabidopsis NACK1 and NACK2 genes are identical to  HINKEL  respectively (Strompen et al, AtNACKl  /HIK  (HIK) and STUD (STD) I TETRASPORE 2002; Y a n g et al,  (TES) genes,  2003). Loss-of-function mutations i n  result i n cytokinesis defects such as abnormally large cells with incomplete  cell walls and multiple nuclei (Tanaka et al, 2004; Strompen et al, 2002). Plants with mutations i n AtNACK2 / STD / TES exhibit cytokinesis defects during the formation o f microspores (Yang et al, 2003). The tobacco N R K 1 M A P K (earlier identified as the N T F 6 M A P K (Calderini et al, 1998) is the apparent ortholog o f Arabidopsis M P K 1 3 ( A t M P K l 3 ) , and N R K 1 was shown to be activated b y constitutively active tobacco N Q K l / N t M E K l (Calderini et al, 2001; Soyano et al, 2003). Similarly, recombinant A t M P K l 3 was recently shown to be phosphorylated b y constitutively active recombinant A t M K K 6 (Melikant et al, 2004). In this study, I investigated the hypothesis that A t M K K 6 and A t M P K l 3 activities are restricted to particular cell division phenomena. First, I analyzed the in vivo pattern o f the promoter  activity  o f AtMKK6  and AtMPKIi  49  genes i n various tissues/cells during  development. I also analyzed the behavior o f these two promoters upon treatments with auxin and with N P A , a polar auxin transport inhibitor. T o examine the loss-of-function mutant phenotype, I generated glucocorticoid-inducible A t M K K 6 R N A i mutant plants and was also able to test A t M P K l 3 R N A i mutant plants (obtained from A . W a l i a ) . F o r this analysis, I focused specifically on lateral root formation.  3.2 Materials and Methods 3.2.1 Plant materials A l l plants used were Arabidopsis thaliana ecotype Columbia. Unless otherwise noted, seed was planted i n 10-cm pots o f synthetic potting soil (Redi-earth® or Terra-lite®, W . R . Grace & C o . o f Canada Ltd., Ontario, Canada), watered and kept under a mist area for 3 days. The pots were then placed i n the greenhouse under supplemental white lights at ambient temperature. They were watered and fertilized as needed.  3.2.2 Genomic DNA isolation Arabidopsis genomic D N A was isolated from 2-week old leaf tissue using the genomic D N A purification kit (DNeasy Plant M i n i K i t , Qiagen) according to the manufacturer ' s instructions. L e a f tissue (100 mg) was ground to a fine powder under liquid nitrogen using a mortar and pestle. The tissue powder was transferred to a Falcon tube (15 m L ) and the liquid nitrogen was allowed to evaporate. T o extract the cells, 400 p L Buffer A P I and 4 p L RNase A stock solution (100 mg/mL) were added to the tissue powder and vortexed vigorously. The mixture was incubated for 10 minutes at 65 °C and mixed b y inverting the tube 2-3 times during incubation. T o precipitate detergent, proteins and polysaccharides, 130 p L Buffer  50  A P 2 were added to the extract, mixed and incubated for 5 minutes on ice. T o remove most precipitates and cell debris, the mixture was centrifuged for 5 minutes at full speed and the supernatant was applied to a QIAshredder spin column sitting in a 2-mL collection tube. This was then centrifuged for 2 minutes at 12000 x g (Eppendorf model 5415 C ) . Approximate 450 p L flow-through fraction was transferred to a new tube without disturbing the cell-debris pellet. To precipitate D N A , 1.5 volumes (675 p L ) ethanol-containing Buffer A P 3 / E were added to the cleared supernatant and mixed by pipetting. A portion of the mixture (650 p L ) was transferred to a DNeasy mini spin column sitting in a 2 - m L collection tube and centrifuged for 1 minute at > 5300 x g The flow-through was discarded and the remaining mixture was added to the same spin column, which was centrifuged as before. The flowthrough and collection tube were discarded and the DNeasy column was placed i n a new 2m L collection tube. T o wash the column, 500 p L Buffer A W were added to the DNeasy column and centrifuged for 1 minute at > 5300 x g. The flow-through was discarded and the column wash was repeated with 500 p L Buffer A W . This time the DNeasy column was centrifuged for 2 minutes at maximum speed (to dry the DNeasy membrane) before being transferred to a 2 - m L microcentrifuge tube. T o elute the genomic D N A , 50 p L preheated (65 °C) Buffer A E was pipetted directly onto the DNeasy membrane, incubated at room temperature for 5 minutes and centrifuged for 1 minute at > 5300 x g. The D N A concentration was measured by spectrophotometry. The final yield of genomic D N A obtained from this procedure was 13.5 ng D N A / p L .  51  3.2.3 Molecular cloning of AtMKK6 or AtMPKl 3 promoter ..GUS DNA construct and generation of GUS reporter plants To examine cell- and tissues-specific expression o f AtMKK6 and AtMPK13  genes during  plant development, transgenic Arabidopsis plants harboring either an the AtMKK6 AtMPKl3  or  promoter::^-glucuronidase (GUS) reporter gene construct were generated through  the following procedures.  3.2.3.1 Cloning of promoters The promoter regions o f the AtMKK6 and AtMPKl3  genes (740 bp and 1534 bp upstream o f  their translational start A T G codon, respectively) were amplified from Arabidopsis genomic D N A (obtained from Section 3.2.2) using the Expand H i g h Fidelity P C R System K i t (Roche Molecular Biochemicals, Catalog N o . 1 732 641) through a PCR-mediated method according to the manufacturer's instructions. The promoter fragment o f the AtMKK6 amplified using P K K 6 F 1 and P K K 6 R 1 primers, and the promoter fragment o f the  gene was AtMPKl3  gene was amplified using P K 1 3 F 1 and P K 1 3 R 1 primers. A l l primer sequences are presented in Table 3.1. The resulting amplicons were cloned into the pCR®2.1-TOPO® vector using a T O P O T A Cloning® K i t (Invitrogen, Carlsbad, U S A , and Catalogue N o . K4500-01) and sequenced to confirm the identity and sequence accuracy o f the promoters.  52  Table 3.1 Primer sequences for promoter cloning Primer  Restriction  Name  Enzyme Site  PKK6F1  Sequence (5-3')  Amplified Promoter Region Length (bp)  ccggaattcGCTCTCTCTCTCTCTCTCTACAGCGAG cgcggatcc I I I I I I ICI I IGGI I ICTTCCTTGG  741  PKK6R1  EcoRI BamHI  PK13F1  BamHI  cgcggatccGCAATTGGAGGATACATGCTTCGTGTG  1534  PK13R1  Hindlll  cccaagcttCTCTTCTTTGGAAGAAGAACTCGG  3.2.3.2 Generation of promoter::GUS fusion DNA constructs The amplified P C R product o f the 740 bp AtMKK6 promoter fragment was digested with EcoRI and BamHI, and ligated i n the sense orientation adjacent to the GUS coding region i n the promoter cloning vector, p C A M B I A 1 3 8 1 Z ( C S I R O , Canberra, Australia) that had been predigested with EcoRI and BamHI. The 1534 bp promoter fragment o f AtMPKl3 was cloned i n a similar way, except that the P C R product was digested with BamHI and Hindlll, and ligated into p C M B I A 1 3 8 1 Z that had been predigested with the same enzymes. Uncut p C A M B I A 1 3 8 1 Z was used as a promoterless-GUS  construct (negative control) and  p C A M B I A 1 3 0 1 ( C S I R O , Canberra, Australia) was used as a 35S promoter-Gt/S fusion construct (positive control). A schematic diagram o f the p C A M B I A 1 3 8 1 Z vector, showing how a promoter region was integrated into this vector, and o f the p C A M B I A 1 3 0 1 vector are presented i n Figure 3.1. The ligation reactions were performed as follows: digested products were separated on a 0.8 % low-melting point agarose gel. (The amount o f D N A loaded on the gel was estimated b y running the D N A samples alongside a l o w D N A mass ladder (Invitrogen, Catalogue N o . 10068-013). The digested products were then cut from the gel, the excised bands were melted at 65 °C for 10 minutes, transferred to a 37 °C heating block and the D N A samples were purified using QIAquick G e l Extraction K i t (Qiagen, Catalogue N o . 28704)  53  according to the manufacturer's instructions. The purified, digested promoter fragment was mixed with the purified digested vector i n a 3:1 molar ratio and ligase reaction buffer was added to I X . One to two units o f T 4 D N A ligase (Invitrogen, Catalog N o . 15224-041) was added and the mixture was incubated at 37 °C for 1-2 hours. The mixture was cooled to 4 °C and maintained at this temperature overnight. A portion o f the ligation reaction (2 p L ) was used to transform 100 p L E. coli ( D H 5 a ) competent cells (See below i n the Section 3.2.7). The cell culture was then spread on kanamycin (50 mg/L)-containing L B agar plates (See below i n Section 3.2.10), which had been loaded with 40 p L o f 40 m g / m L X - G a l stock half an hour prior to culture plating. Positive white D H 5 a clones which grew successfully on kanamycin- and X-Gal-containing L B agar plates were screened b y P C R and PCR-positive colonies used for plasmid D N A isolation using Wizard® Plus S V Miniprep D N A Purification System (Promega Corporation, Catalogue N o . A1330). Isolated plasmides were analyzed b y restriction enzyme digestion.  3.2.3.3 Transformation of Agrobacterium The AtMKK6  or AtMPKl3  promoter::GUS fusion D N A construct was introduced into  Agrobacterium tumefaciens strain GV3101 b y normal triparental mating (Van Haute et al., 1983). In brief, 10 p L o f D N A solution were used to transfect 200 p L Agrobacterium competent cells (See below i n Section 3.2.9). D N A was added to the frozen Agrobacterium competent cells i n a microcentrifuge tube that was held i n a 37 °C water bath for 5 minutes with occasional mixing during the incubation. T o this sample, 1 m L sterile L B broth was added and the tube was shaken at 100 rpm for 3 hours at 28 °C. The cells were pelleted b y  54  Figure 3.1 Schematic diagrams o f p C A M B I A 1 3 8 1 Z and p C A M B I A 1 3 0 1 vectors (modified from http://www.cambia.org.au/daisy/cambia/585)  55  centrifugation for 30 seconds and the supernatant was discarded. The cell pellet was resuspended i n 1 m L sterile L B broth and 0.2 m L o f this cell suspension were plated on each L B agar plate containing 25 m g / L rifampicin, 25 m g / L gentamycin and 50 m g / L kanamycin. These plates were incubated for 2 and 1/2 days at 28 °C i n the dark for 2 and Vi days to allow development of transformant colonies.  3.2.3.4 In planta transformation of Arabidopsis The AtMKK6 or AtMPKl3  promoter::GUS fusion construct was delivered into wild-type  Arabidopsis thaliana ecotype Columbia b y the floral dip method (Clough and Bent, 1998). Briefly, six 10-cm pots each with 6-8 Arabidopsis plants were used for plant transformation with each genotype. Six days prior to Agrobacterium floral dip the developing inflorescences were cut to induce secondary bolting and formation o f many immature flower clusters. T w o days before floral dip, the appropriate Agrobacterium strain was inoculated into 500 m L o f L B broth, containing 25 m g / L rifampicin, 25 m g / L gentamycin and 50 m g / L kanamycin. This culture was grown for 24 hours at 28 °C with shaking at 200 rpm. The cells were then pelleted at 4000 x g for 5 minutes. The supernatant was discarded and the cells were resuspended i n 500 m L 5 % sucrose containing 0.03% Silwet L-77 (Lehle Seeds, Catalogue N o . VIS-01). The cell suspension was poured into an autoclavable plastic container and Arabidopsis plants that had been watered a day earlier to wet the soil, were held upside down in the container with their inflorescences submerged i n culture suspension for 3 seconds with gentle agitation. The pots were then laid on their side on a plastic tray, covered with a plastic bag, and kept overnight i n the dark to maintain high humidity. The plants were then turned upright and returned to normal growing conditions. The dipped plants were not watered once siliques began to mature, and the seeds ( T l generation) were harvested when dry. 56  3.2.3.5 Selection of transformants Seeds o f the T I generation were surface-sterilized b y vortexing them i n a solution containing 1.5 % sodium hypochlorite (Sigma, Catalogue N o . 42504-4) and 0.01 % tween-20 ( B D H Laboratory Supplies, Catalogue N o . P28829) and letting them sit i n this solution for 20 minutes i n a microcentrifuge tube. The solution was withdrawn and seeds were rinsed with sterile water five times. The surface-sterilized seeds were re-suspended i n sterile, viscous 0.1 % agarose (prepared at least one day before use so it became viscous) and spread on agarsolidified M S medium plates containing 14 M S salt mix, 1% sucrose, 1 x B 5 vitamins, 0.5 g/L M E S , and 0.8 % agar, p H 5.7 plus 50 m g / L hygromycin B (Invitrogen, Catalogue N o . 10687-010) and 50 m g / L vancomycin hydrochloride  (Sigma, Catalogue No.V2002)  (Vancomycin was added to control the Agrobacterium growth). A l l the plates were sealed with 3 M Micropore™ tape (Acrona Inc., Catalogue N o . 1530-0), then wrapped with aluminium foil (dark condition) and kept at 4 °C for 2-4 days to vernalize the seeds. The plates were then placed i n the growth room under 16h/8h light-dark cycle conditions at 22-24 °C. This temperature is critical to control the rapid growth o f contaminating Agrobacterium on the plant agar media. Approximately 7-10 days post-germination, the positive T I transformants displaying resistance to hygromycin B (50 mg/L) were transferred to soil for growth to mature plants. Some o f the T I plant tissues were subjected to histochemical G U S staining. Plants positive for GUS expression were tagged and allowed to set seeds o f the T 2 generation. T 2 plants were similarly analyzed for GUS expression at the young seedling stage. Finally, detailed analysis o f GUS expression was conducted using T 3 homozygous lines (AtMKK6 promoter::GUS lines 1, 2 and 6, and AtMPKl3 promoter::GUS lines 1, 2 and 6). G U S  57  activity o f T3 transgenic plants was monitored throughout plant development from 3-day to 35-day-old plants b y histochemical G U S staining, using independent transformants o f each genotype.  3.2.4 Histochemical GUS assay Histochemical staining for G U S activity was performed as described previously b y (Jefferson, 1987), except that all plant materials analyzed were pre-soaked i n heptane for 10 minutes. The heptane was removed and the plant materials were air-dried for 5 minutes prior to incubation i n a G U S reaction solution. The G U S reaction solution consisted o f 0.5 m g / m L X - G l u c (5-bromo-4-chloro-3-indolyl-6eto-D-glucuronic  acid, cyclohexylammonium salt)  (BioVectra, Prince Edward Island, Canada) i n 50 m M sodium phosphate buffer, p H 7.0, (0.5 m g X - G l u c per 10 p L N , N-dimethyl formamide was completely dissolved before adding to the sodium phosphate buffer), and 0.5 m M each potassium ferricyanide and ferrocyanide as an oxidation catalyst, and 0.1% Triton® X-100. The heptane-treated plant materials were incubated i n the G U S reaction solution at 37 °C for 10-12 hours. The plant materials were then cleared as described previously b y (Malamy and Benfey, 1997). In brief, both stained and unstained plant materials were transferred to small Petri dishes containing 0.24 N HC1 i n 2 0 % methanol and incubated on a 57 °C heat block for 15 minutes. This solution was replaced with 7% N a O H i n 6 0 % ethanol for 15 minutes at room temperature. Samples were then re-hydrated for 5 minutes each i n 40%, 2 0 % and 10% ethanol, and infiltrated for 15 minutes i n 5 % ethanol, 2 5 % glycerol. Cleared tissues were mounted i n 50% glycerol on glass microscope slides and observed under a dissecting microscope and a light microscope.  58  Images were recorded with a digital camera (Nikon coolpix 995, N i k o n Inc., N e w Y o r k , USA).  3.2.5 Resin embedding and cross-sectioning of root tissue Ten-day old Arabidopsis seedlings harboring the AtMKK6 AtMPKll  promoter::GUS fusion or the  promoter::GUS fusion were pre-stained for G U S activity as described i n Section  3.2.4 for 10-12 hours, and then rinsed i n 0.1 M sodium phosphate buffer p H 6.8. The roots were cut into small pieces, approximately 5 m m i n length, on a wax plate and fixed i n 2.5 % glutaraldehyde i n 0.1 M sodium phosphate buffer, p H 6.8, overnight at 4 °C. The fixed root samples were then subjected to serial dehydration i n 10%, 20%, 4 0 % and 8 0 % ethanol (about 15 minutes i n each solution), while rotating slowly on a rotary shaker at room temperature, and then subjected to a final dehydration i n 100% ethanol for 3 x 25 minutes, still rotating slowly at room temperature. The dehydrated samples were left i n 100% ethanol at room temperature overnight. The samples were then infiltrated with Spurr's resin b y passing them through a series o f resimethanol mixtures, 1:3 (25% resin), 1:1 (50% resin), 3:1 (75% resin) and twice with 100% resin solution (1 hour i n each mixture). The infiltrated samples were left rotating overnight i n 100% resin solution, after which the resin solution was changed with a fresh 100% resin solution. The samples were then transferred to rubber or plastic molds, submerged i n resin, and arranged as desired under the dissecting microscope for cross or longitudinal sectioning. The samples were then held at 60 °C for 16 hours to polymerize the resin. The polymerized resin blocks containing embedded root samples were trimmed and sectioned (1 p m thick) and the sections were mounted on glass slides for observation and image recording on a light microscope.  59  The Spurr resin solution was prepared following a recipe from the Electron Microscopy ( E M ) facility o f the University o f British Columbia. For a quantity o f 50 m L , the following chemicals were mixed: 30.2 g noneyl succinic anhydride ( N S A ) ,  11.7 g  vinylcyclohexene dioxide (ERL-4206), 8.2 g diglycidylether of polypropylene glycol D E R 736 and 0.5 g dimethylamino ethanol ( D M A E ) . ( N S A was purchased from C A N E M C O Inc and E R L - 4 2 0 6 , D E R - 7 3 6 and D M A E were purchased from J . B . E M Services Inc).  3.2.6 Hormone treatments Seeds from AtMKK6 promoter- and AtMPK13 promoter-GcTS reporter plants were surface sterilized (see above in the Section 3.2.3.5) and then each individual seed was placed along a line on square agar-solidified M S medium plates containing Vi M S salt m i x , 1% sucrose, (without B 5 vitamins), 0.5 g/L M E S , and 0.8 % agar, p H 5.7. The plates were sealed with 3 M Micropore™ tape and the seeds were vernalized at 4 °C i n the dark for 2-4 days. The plates were then placed i n the growth room, mounted on edge so that the seedlings could grow vertically under 16h/8h light-dark cycle conditions at 22-24 °C for 9 days. For the auxin transport inhibitor treatment, N P A (5 pM)-containing M S liquid medium (without B 5 vitamins) (20 m L ) was added to the 9-day old reporter seedlings, which were allowed to sit in the solution for 24 hours. The solution was then decanted from the plates. For the N P A and auxin ( I A A ) treatment or control, either N P A (5 u M ) / I A A (1 u M ) containing liquid M S medium (without B 5 vitamins) or the unsupplemented liquid M S medium (without B 5 vitamins), respectively, was added to the reporter seedlings for 24 hours and then decanted. Histochemical G U S assays for all control and treatments were performed (24 hours post-treatment) as described in Section 3.2.4.  60  3.2.7 E. coli (DH5a) competent cells One m L o f overnight culture o f E.coli strain DH5ct was transferred to a sterile 250-mL flask containing 100 m L L B broth. The culture was grown for ~2.5 - 3 hours at 37 °C, shaking at 250 rpm (O.D.550 = 0.45-0.55). The culture was chilled on ice for 30 minutes and centrifuged in sterile Oakridge tubes i n a centrifuge rotor at 2500 x g for 10 minutes at 4 °C. The supernatant was then removed and the cell pellet was re-suspended b y vortexing i n 20 m L cold, filtered sterile Tfb I solution containing 30 m M potassium acetate, 100 m M rubidium chloride, 10 m M calcium chloride, 50 m M manganese chloride and 15 % glycerol, p H 5.8. The suspension was chilled on ice for 10 minutes and centrifuged at 2500 x g for 10 minutes at 4 °C. The supernatant was removed and the cell pellet was gently re-suspended b y slowly pipetting up and down several times, i n 2 m L cold, filtered sterile T f b II solution containing 10 m M morpholinepropanesulfonic acid ( M O P S ) , 10 m M rubidium chloride, 75 m M calcium chloride and 15 % glycerol, p H 6.5. The suspension was chilled on ice for 10 minutes and pipetted (100 p L or 200 p L aliquots) into sterile screw-cap microcentrifuge tubes. The competent cell suspension was frozen i n liquid N 2 for 1-2 minutes and then stored at - 8 0 °C.  3.2.8 E. coli transformation Transformation o f E. coli was performed according to instructions i n (Sambrook et al, 1989) A microcentrifuge tube o f E. coli (strain D H 5 a ) competent cells was removed from the - 8 0 °C freezer when needed. The cells were thawed and immediately transferred to an ice bath and stored on ice for 10 minutes. The competent cells were either kept i n the same microcentrifuge tube or transferred to chilled, sterile polypropylene tubes (Falcon 2059, 17 m m x 100 mm), using chilled, sterile pipette tips, then stored on ice. D N A was added to the  61  competent cells and the tubes were swirled gently to m i x their contents. The tubes were stored on ice for 30 minutes. The tubes were transferred to a 42°C water bath for exactly 90 seconds without shaking, and were then immediately transferred to ice bath to be chilled for 1-2 minutes. A n 800 p L aliquot o f L B medium containing appropriate antibiotic(s) was added to each tube and the tubes were incubated at 37 °C with shaking at 200 rpm for 45 minutes. A 200 p L aliquot o f transformed competent cells was spread on each 90-mm Petri plate containing agar L B medium supplemented with appropriate antibiotic(s) and the plates were then incubated at 37 °C overnight. Colonies were observed on the plates within 12-16 hours.  3.2.9 Agrobacterium competent cells One m L o f overnight culture o f Agrobacterium strain GV3101 was transferred to a sterile 250-mL flask that contained 50 m L L B broth with 25 m g / L rifampicin, 25 m g / L gentamycin. The culture was shaken for - 2 . 5 - 3 hours at 28 °C at 250 rpm ( O . D .  5 5 0  =0.45-0.55). The  culture was chilled on ice and centrifuged i n sterile Oakridge tubes at 2500 x g for 5 minutes at 4 °C. The supernatant was removed, the cell pellet was re-suspended i n 0.7 m L 20 m M CaCl2, and 100 p L aliquots were distributes into sterile screw-cap microcentrifuge tubes. The competent cell suspension was frozen i n liquid N2 for 1-2 minutes and then stored at - 8 0 °C.  3.2.10 Bacterial growth media L B (Luria-Bertani) broth medium contained 10 g/L Tryptone Peptone ( D I F C O Laboratories Inc., Catalogue N o . 211705), 5 g / L Bacto™ yeast extract ( D I F C O Laboratories Inc., Catalogue N o . 212750) and 10 g / L N a C l , p H 7.0. L B agar plates consisted o f similar  62  contents as L B broth medium plus 15 g / L Bacto™ agar ( D I F C O Laboratories Inc.). A l l the media were autoclaved for 15-20 minutes at 15 lb / square inch prior to use.  3.2.11 Arabidopsis plant growth media Unless otherwise noted, M S (Murashige and Skoog) liquid or agar-solidified media was used as Arabidopsis growth medium. The M S liquid media contains /i strength M S salt m i x (2.15 x  g/L) (Sigma, Catalogue N o . M 5 5 2 4 ) , 1 x M S vitamins (Sigma M3900) or 1 x B 5 vitamins (containing 100 m g / L myo-inositol, 10 m g / L thiamine-HCl, 1 m g / L nicotinic acid, 1 m g / L pyridoxine-HCl), 1% sucrose and 0.5 g/L M E S (2-[N-morpholino] ethanesulfonic acid (Sigma, Catalogue N o . M2933), p H 5.7. The M S agar-solidified media contains half strength M S (2.15g/L), l x B 5 vitamins, 1% sucrose, 0.5 g / L M E S and 0.8 % agar (Sigma, Catalogue N o . A7002), p H 5.7.  3.2.12 Molecular cloning of glucocorticoid-inducible AtMKK6RNAi and AtMPK13RNAi DNA constructs and screening for the mutant plants The double-stranded R N A interference ( R N A i ) constructs were made through a P C R mediated approach. A minimal intron and the flanking regions (exon parts) o f the fifth intron of AtMPK6 were incorporated into the sense strand reverse primer ( M . Samuel and G . M i l e s , personal communication). For the generation o f A t M K K 6 R N A i , the sense strand was then amplified using a primer combination that generated an Xho I cleavage site and EcoR /-splice junction loop sequence on the opposite end o f the P C R product, whereas the antisense strand was amplified using a primer combination that added Spe I and EcoR I sites on the opposite end o f the P C R product. A l l primers used for generation o f A t M K K 6 R N A i are presented i n Table 3.2. These two P C R products were directionally cloned into Xho 11 Spe /-digested  63  p T A 7 0 0 2 vector through triple ligation as presented i n Figure 3.2, which resulted i n an A t M K K 6 R N A i construct under the control o f the glucocorticoid (dexamethasone)-inducible promoter (Figure 3.3 A ) . A diagram o f the inducible R N A i system is presented i n Figure 3.3 B. The A t M K K 6 R N A i construct was introduced into Agobacterium and transformed to Arabidopsis plants (See Section 3.2.3.3 and 3.2.3.4). Seeds o f the T l generation were germinated on M S agar plates containing 50 m g / L hygromycin  B  (Invitrogen,  Catalogue N o . 10687-010)  and 50 m g / L vancomycin  hydrochloride (Sigma, Catalogue No.V2002) (Vancomycin was added to control the Agrobacterium growth). The seeds were vernalized at 4 °C i n the dark for 2-4 days prior to being grown under 16 h/8 h light-dark cycle conditions, at 22-24 °C (This temperature is critical to delay the growth o f contaminating Agrobacterium i n T l seeds and it is an optimum temperature for growing Arabidopsis plants). Approximately 7-10 days post-germination, the positive T l transformants that displayed resistance to hygromycin B (50 mg/L) were allowed to set seeds for T 2 generation. T 2 plants were screened for the seedlings that showed a difference i n their phenotypes when grown i n the presence or absence o f 1 p M dexamethasone (dex) (Sigma, Catalogue N o . D4902). Five independent T 2 lines were recovered and selfed to produce T3 seeds. T w o o f the T3 homozygous lines that displayed a strong phenotype (line 13 and line 8) were carried though for detailed phenotypic analysis. Transgenic plants containing the empty vector, p T A 7 0 0 2 , (line 4) were used as controls. A n overview o f the procedures for generating the glucocorticoid-inducible A t M K K 6 R N A i transgenic plants is presented i n Figure 3.4. In addition to m y analysis o f these A t M K K 6 R N A i transgenic plants, I also carried out lateral root analysis on three independent lines o f A t M P K l 3 R N A i transgenic plants, which  64  had been generated b y A n k i t W a l i a under m y supervision, using the same protocol as I had for  A t M K K 6 R N A i plants. The primers  used for generation  o f the A t M K P K l 3 R N A i  construct are also presented i n Table 3.2.  Table 3.2 Primers for the A t M K K 6 R N A i and A t M P K l 3 R N A i constructs. Lower case letters represent the restriction enzyme sites.  Construct  Primer  Name AtMKK6RNAi KK6SF1 KK6SR1  Restriction  Sequence (5'-3')  Product Length Enzyme Site (bp) Xhol ccgctcgagATGGTGAAGATCAAATCGAACTTGAAGCA 318 EcoRI + Intron ccaaaaftcCTATGAGCTGCAAAAACTACTTACCTC (A minimal intron with its flanking exons sequence) TCAGCAGTAATTTCGAAATCAAGCTCC  KK6AF1  Spel  KK6AR1  EcoRI  ccggaattcTCAGCAGTAATTTCGAAATCAAGCTCC  Xhol  ccgctcgagGAGATACTTAGAAGAGAGACGCTTTTCCC  AtMPKl 3RNAiK13SF1 K13SR1  __-  ggactagtATGGTGAAGATCAAATCGAACTTGAAGCA  291  441  EcoRI + Intron ccaaaattcCTATGAGCTGCAAAAACTACTTACCTC (A minimal intron with its flanking exons sequence) AGACTCTCTCCAGACAAGCTCCTTG  K13AF1  Spel  K13AR1  EcoRI  ggactagtGAGATACTTAGAAGAGAGACGCTTTTCCC ccggaattcAGACTCTCTCCAGACAAGCTCCTTG  65  414  KK6SF1  KK6AS1 AtMKK6  AIMKK6  KK6SR1  KK6AR1  Xhol  1  AtMKK6  EcoRI |Int |  Spel  1  EcoRI AtMKK6  Xhol  Spel  •  Xhol  EcoRI  Figure 3.2 Schematic diagram describing construction o f the A t M K K 6 R N A i construct frit = Intron  66  A GVG  Kan  R  intron  6XUAS  LB  -AtMKK6RNAi-  B 'Dexamethasone (glucocorticoid) cytoplasm  Targetting endogenous AtMKK6 RNA  t i  AtMKK  nucleus (GVGa ) —  35S  6XUAS AtMKK6RNAi —  GVG  Figure 3.3 Glucocorticoid-inducible A t M K K 6 R N A interference ( A t M K K 6 R N A i ) system (A) T - D N A region of the glucocorticoid-inducible A t M K K 6 R N A i D N A construct consisting o f R B , right T - D N A border; 35S promoter; G V G , glucocorticoid-inducible transcription factor; K a n , kanamycin resistance gene; 6 X U A S , GVG-regulated promoter; A t M K K 6 R N A i D N A construct; L B , left T - D N A border. R  (B) A schematic diagram o f dexamethasone-inducible A t M K K 6 R N A i system showing the activation of the A t M K K 6 R N A i and subsequent targeting of endogenous AtMKK6 R N A . The T - D N A is shown in the nucleus where it has integrated into the plant nuclear genome. For simplicity, the K a n gene is omitted and the genes are shown in the left to right orientation. The G V G protein is made in the cytoplasm and retained there in an inactivated state ( G V G i ) by interaction with heat shock proteins, including hsp70 and hsp90. The binding of exogenously applied dexamethasone causes the disassociation o f hsp proteins from G V G i . G V G i is then converted into an active state ( G V G a ) , enters the nucleus and binds to the target promoter, 6 X U A S , allowing the transcription o f the A t M K K 6 R N A i to be initiated, which then silences endogenous AtMKK6 expression (modified from ( M c N e l l i s et al, 1998). R  67  •;;^-;:Xv :Plant;^ :  Start  Moleojlar Cloning  Transformation  0 month  6 months  Screening  Phenotypic Analysis  8 months  10 months  12 months  ; Transformants ' Heterozygous • Homozygous • ;  Figure 3.4 Overview o f the process for generating A t M K K 6 R N A i transgenic plants  3.2.13 Phenotypic analyses and plant growth conditions For observation o f the plant phenotype in young seedlings, T3 seeds o f the A t M K K 6 R N A i , and empty vector (pTA7002) lines were surface-sterilized and germinated on M S agarsolidified medium plates in the absence and presence o f 1 p M dexamethasone (dex). The seeds were vernalized at 4 ° C in the dark for 2-4 days prior to being grown at 22-24 ° C , under 16 h/8 h light-dark cycle conditions. O n day 7, phenotypes were observed and recorded. For  observation  of  the  AtMKK6  suppression  phenotype  during  growth and  development, five sets o f the A t M K K 6 R N A i and empty vector transgenic plants were grown in soil in a growth chamber, under 16 h/8 h light-dark cycle conditions at 22-24 ° C . For set one to set five, plants were sprayed with  a solution containing 25 p M dex and 0.015 %  Silwet L-77 at day 7, 14, 21, 28 and 35 post-germination, respectively, and photographs were taken at day 3-7 post-treatment. This phenotypic analysis o f A t M K K 6 R N A i transgenic plants grown in soil was performed with two independent T 3 lines and the entire process with each set was done in duplicate.  68  3.2.14 Lateral root analysis A t M K K 6 R N A i , A t M P K l 3 R N A i and empty vector (pTA7002) transgenic seeds were surface sterilized and stratified for 4 days at 4 °C i n the dark. Four seedlings were grown vertically oriented on each M S agar plate at 22-24 °C under 16 h/8 h light-dark conditions. A t day 7 post-germination, each o f two sets o f the same genotype seedlings were sprayed with either a filtered sterile solution containing 1 p M dex and 0.015 % Silwet L-77 or with a control solution containing only 0.015% Silwet L-77 (no dex). Photographs were taken at day 14 post-germination. These experiments were carried out i n triplicate.  3.2.15 Total RNA extraction and RT-PCR analysis Total R N A was extracted from one A t M K K 6 R N A i transgenic line (line 13, with strongest phenotype) and one empty vector line (line 4) using 10 days old seedlings, as described i n Chapter 2, Section 2.2.3. F o r R T - P C R reactions, c D N A was synthesized from total R N A using a First-Strand c D N A Synthesis K i t (Amersham Biosciences, Catalogue N o . 27-926101) according to the manufacturer's instructions. A total o f 1 p g R N A was added to RNasefree water to produce a final volume o f 8 p L The R N A solution was heated for 10 minutes at 65 °C and then placed on ice. B u l k first-stand reaction m i x (5 u L ) containing reverse transcriptase, R N A guard, RNase/DNase-free B S A , d A T P , d C T P , d G T P and d T T P i n aqueous buffer, was added to the tube containing the heat- denatured R N A . One p L D T T solution (200 m M ) and 1 p L oligo d T primers (Not I-d(T)ig) (0.2 pg) were added to the reaction mix, which was mixed b y pipetting up and down several times. The reaction was then incubated at 37 °C for 1 hour.  69  The resulting  cDNA  was employed as the amplification  template.  P C R was  performed using JumpStart™REDTaq™ReadyMix™ (Sigma, Catalogue N o . P0982) and genespecific primers designed to target the AtMKK6, AtMKKI  or AtMKK2 gene (the last two  genes are closely related to AtMKK6 gene), and a control gene, Arabidopsis Histone HI (AtHl). The primers used are presented i n Table 3.3. Twenty microliters o f P C R mixture (a final concentration o f 0.6 units (10 p L ) JumpStart™REDTaq™ReadyMix™,  1 pL  first-stand  c D N A , 0.1 p M each forward and reverse gene-specific primers, and forward and reverse A t H l primers) was cycled i n a Biometra T-gradient thermo cycler as follows: denaturation (4 minutes, at 95°C), 32 cycles (30 seconds, at 95°C, 30 seconds at 57 °C, 2 minutes at 72 °C). The reaction was held for 10 minutes at 72°C after cycling and then maintained at 4 °C. The P C R amplification product was analyzed b y 0.8 % agarose gel electrophoresis.  Table 3.3 Primers used for checking gene expression o f the A t M K K 6 R N A i (linel3) and empty vector (line 4) plants  Primer Name  Sequence (5-3')  PCR product size (bp)  MKK1F  ccgctcgagcggATGAACAGAGGAAGCTTATGCCCTA  1079  MKK1R MKK2F  ccgctcgagcggCTAGTTAGCAAGTGGGGGAATCAAAG ccgctcgagcggATGAAGAAAGGTGGATTCAGCAATAA  1116  MKK2R  ccgctcgagcggATGGTGATATTATGTCTCCCTTGTAG cgcggatccgcgATGGTGAAGATCAAATCGAACTTG ccgctcgagcggTTATCTAAGGTAGTTAACAGGTGG  MKK6F MKK6R AtH1F AtH1R  ccggaattccggGGTTAAAGTCAAAGCTTC I I I IAAGA ccgctcgagcggGAGTGAAGAAACCATCACATTATA  70  1095 726  3.3 Results 3.3.1 Histochemical localization of GUS activities driven by AtMKK6 and AtMPK13 promoters during plant growth and development The 5'-upstream regions o f the AtMKK6 and AtMPK13 genes were fused to the figlucuronidase (GUS) reporter gene and the resulting constructs were transformed into Arabidopsis plants. The patterns o f G U S activity were surveyed i n 3-day, 5-day, 10-day, 15day, 27-day, and 35-day plants derived from three independent transformation events for each construct. Transgenic plants harboring p C A M B I A 1 3 8 1 Z , a promoterless-Gt/S fusion construct, were used as a negative control (Figure 3.5), and transgenic plants harboring p C A M B I A 1 3 0 1 , a 35S promoter::GUS fusion construct were used as a positive control (Figure 3.6). Root Hairs  Primary Root  Figure 3.5 Promoterless-GUS activity as a negative control for G U S assay. p C A M B I A 1 3 8 1 Z - c o n t a i n i n g plants showed no blue G U S staining i n any plant tissues.  71  Root Hairs  Primary Root  Figure 3.6 35S promoter-GUS activity as a positive control for GUS assay pCAMBIA 1301-containing plants showed strong GUS staining in almost all plant tissues.  3.3.2 AtMKK6 promoter::GUS activity distribution during plant growth and development The spatial and temporal patterns of histochemical GUS activity during plant growth and development in transgenic Arabidopsis carrying the AtMKK6 promoter::GUS fusion gene, are shown in Figure 3.7. Overall, GUS activity was observed most strongly in the vascular tissue of many tissues/organs including cotyledons, hypocotyls, leaves, roots and inflorescence (Figure 3.7).  No GUS staining was observed in the roots of the 3-day-old  seedling (not shown) or 5-day-old seedlings (Figure 3.7 A). However, GUS activity appeared  72  Whole Plants  Roots  Leaves and Flowers  Figure 3.7 Histochemical localization o f G U S activity in AtMKK6 promoter::GUS reporter plants through development from 3 days to 35 days. (A) 5-day-old seedlings, blue G U S staining was detected in hypocotyls (h), but was barely detected in young roots (r); (B) A 15-day-old plant, G U S staining was detected in both shoots and roots; (C) A 27-day-old plant, G U S staining was mainly detected in shoots, not roots; (D) A primary root from a 5-day-old seedling showing no G U S staining; (E) Lateral roots (lr) emerged from a primary root (pr) from a 10-day-old plant, G U S staining was detected along the primary root region where lateral roots emerged and also at columella cell area (co); (F) Roots and leaves from a 27-day-old plant; (G) Light microscopic view o f a cotyledon from a 5-day old seedling showing G U S staining in vascular tissue (vt); (H) Light microscopic view of a leaf from a 10-day-old seedling showing G U S staining in trichome bases (tb) and in vascular tissue (vt); (I) A cluster o f flowers from a 35-day-old plant; G U S staining is shown in blue. In B and E , asterisks indicate adventious root primordia or emerged lateral roots from a primary root. Scale bars are located at the bottom left o f each picture. Black and white bars = 2 m m , red bars = 0.2 m m .  73  i n the vascular cylinders o f the older roots o f 10- and 15-day-old seedlings (Figure 3.7 E and B , respectively). G U S staining i n the roots was most prominent at the sites o f lateral root emergence i n 10-day- and 15-day-old seedlings (Figure 3.7 E and B , respectively). In addition, strong G U S activity was observed i n the bases o f trichomes on leaves from 10-dayold seedlings (Figure 3.7 H ) . B y 27 days, the G U S activity i n primary roots had almost entirely disappeared (Figure 3.7 F). However, i n leaves, strong G U S activity still remained i n the vascular tissue after 27 days (Figure 3.7 F). A t 35 days, only weak G U S activity could be detected, restricted to the floral tissues (Figure 3.7 I) and siliques (not shown).  3.3.3 The AtMKK6 promoter activity and lateral root formation Histochemical G U S staining o f root cross-sections from 10-day-old seedlings confirmed the vascular-specific expression pattern o f the AtMKK6 promoter i n roots (Figure 3.8 A ) . In primary roots, G U S staining was highest at sites along primary roots where new lateral roots were formed (Figure 3.8 A ) , and was also detected i n the vascular tissue o f newly emerged lateral roots. Transverse sections o f roots revealed that the AtMKK6 promoter drove G U S activity not only i n the central vascular cylinder, but also i n the layer o f pericycle cells surrounding the vascular cylinder i n primary roots (Figure 3.8 B and C ) . N o G U S activity was detected i n other cell types, such as the epidermal, cortical and endodermal cells i n roots (Figure 3.8 B and C ) .  74  Figure 3.8 Detailed examination of 10-day old seedlings of AtMKK6 plants.  promoter:.GUS reporter  (A) A root; (B) A transverse section of a primary root at the vicinity of lateral root formation and (C) A transverse section of a primary root at the site where a lateral root emerged, ep = an epidermal cell layer, c = a cortical cell layer, en = an endodermal cell layer, p = a pericycle cell layer. GUS staining is shown as blue. Red bars = 0.02 mm  75  3.3.4 AtMPKl3 promoter: :GUS activity throughout plant growth and development The spatial and temporal patterns o f histochemical G U S activity during plant growth and development i n transgenic Arabidopsis  carrying the AtMPK13  promoter::GUS fusion gene  are shown i n Figure 3.9. G U S activity appeared strongly i n vascular tissue o f shoots o f 3day-old seedlings (not shown) as well as i n seedlings from 5-day-old to 35-day-old (Figure 3.9 A - E ) . In the root tips, G U S staining was confined to the collumella cells o f the root cap and elongation zone, but was not observed i n the apical meristem zone i n which cell division occurs (Figure 3.9 K and L ) . A s i n the shoots, strong G U S staining was also observed i n vascular tissue o f roots o f almost all ages (Figure 3.9 A - D , F, H , I, and K ) . In 35-day-old plants, AtMPK13  expression was clearly associated with lateral root formation, although  overall G U S staining i n roots was substantially diminished at this point (Figure 3.9 E and J). Similar to the G U S activity pattern observed i n the AtMKK6 (Figure 3.7 E ) , G U S activity i n the AtMPK13  promoter::GUS reporter plants  promoter::GUS reporter plants appeared most  strongly at sites along primary roots where lateral root primordia were formed i n 10-day-old seedlings (Figure 3.9 G ) , 15-day old seedlings (not shown) and 27-day-old seedlings (Figure 3.9 I). In addition, the G U S staining was detected i n the trichomes o f both leaves and stems (Figure 3.9 O) and was observed i n a ring o f cells at the bases o f leaf trichomes (Figure 3.9 N ) . In flowers, G U S staining was clearly observed i n the pistil (Figure 3.9 Q), and i n the vascular tissue o f inflorescence stems and sepals, but not i n the vasculature o f the petals (Figure 3.9 P). G U S staining was also found i n stamen filaments but not i n anthers (Figure 3.9 R ) . In siliques (fruits), G U S staining was detected i n the placenta (Figure 3.9 S and T).  76  Whole plants  Roots  Roots and Leaves  Flowers and Siliques  Figure 3.9 Histochemical localization of G U S activity in AtMPK13 promoter::GUS reporter plants through development from 3 days to 35 days. (A) 5-day-old seedlings; (B) A 10-day-old seedling; (C) A 15-day-old plant; (D) A 27-dayold plant; (E) A 35-day-old plant; (F) A primary root from a 10-day-old seedling; (G) A lateral root (Ir) emerged from a primary root (pr) from a 10-day-old seedling; (H) Light microscopic view o f an emerged lateral root (Ir) from a primary root (pr); (I) Roots from a 27-day-old plant; (J) Roots from a 35-day-old plant; (K) A root tip including root cap (rc), apical meristem (am) and elongation zone (ez); (L) G U S staining at columella cells (co) of a root tip from a 27-day-old plant; (M) A view of the vascular tissue (vt) o f a cotyledon from a 10-day-old seedling; (N) A view o f a trichome on a leaf from a 10-day old seedling, G U S staining is shown in a trichome base (tb) and vascular tissue (vt); (O) Trichomes (tc) o f leaves and o f leaf stems from a 27-day-old plant; (P) A cluster o f flowers showing G U S 77  staining i n inflorescence stem (is), i n styles (s) and i n sepals (se); (Q) A developing silique or a pistil consisting o f stigma (st), a style (s) and an ovary; (R) A pistil and stamens, G U S staining is shown i n vascular tissue o f stamen filaments (fi), but not i n anthers (an) o f stamens; (S) A mature silique from a 3 5-day-old plant, p = placenta, s = style; (T) A close-up view o f a mature silique showing five ovules (o) attached to the placenta (p); s = style; Asterisks indicate adventious root primordia or emerged lateral roots from primary roots; G U S staining is shown i n blue. Black bars = 2 m m , white bars = 0.2 m m , red bars = 0.02 m m  -740 bp  -490 (+ strand)  +1 ATG  5'  3'  AtMKK6 coding region AuxREPSIAA4  Figure 3.10 Schematic illustration showing the location o f the putative auxin-responsive sequence A u x R E P S I A A 4 i n the AtMKK6 promoter region (740 bp). AtMKK6 promoter sequence analysis (Higo et al, 1999) revealed the presence o f a putative auxin-responsive element, A u x R E P S I A A 4 ( K G T C C C A T ) (Ballas et al, 1993) at nucleotide position - 4 9 0 , (+ strand).  78  3.3.5 AtMKK6, auxin and lateral root formation A u x i n is known to affect lateral root formation, probably b y establishing a population o f rapidly dividing pericycle cells (Laskowski et al, 1995). Developing lateral root primordia are thought to receive the endogenous auxin indole-3-acetic acid ( I A A ) through directed (polar) auxin transport (Reed et al, 1998). Polar auxin transport depends on the asymmetric localization i n plant cell membranes o f a protein called P I N - F O R M E D (PIN), which is an auxin transport facilitator (Galweiler et al,  1998). The direction o f polar auxin transport  varies depending on where P I N proteins are localized i n plant cell membranes. For example, in the central part o f roots, P I N proteins are localized i n the cellular basal membranes and auxin flow is directed downward. There is contradictory evidence concerning the direction o f the polar auxin transport associated with lateral root formation. In roots, it has been proposed that plants use the polar auxin transport to move I A A from the base o f root toward the root tip v i a the central cylinder (acropetal) and from the root tip toward the root-shoot junction via the epidermal and cortical cells (basipetal) (Rashotte et al, 2000). N-1-naphthylphthalamic acid ( N P A ) , a polar auxin transport inhibitor, blocks acropetal polar transport o f shootderived I A A , causing a reduction i n I A A level i n root and the arrest o f lateral root emergence (Reed et al, 1998). In contrast to the conclusions o f Reed et al, 1998, it has also been shown that N P A blocks basipetal I A A movement from root tip, while also arresting lateral root formation (Casimiro et al, 2001). I confirmed that N P A caused diminished lateral root formation (Figure 3.11). I also observed that the AtMKK6  promoter contains a putative  auxin-responsive element, A u x R E P S I A A 4 ( K G T C C C A T ) (Ballas et al, 1993) at nucleotide position - 4 9 0 , (+ strand) (Figure 3.10), suggesting that auxin might be a regulator o f AtMKK6  expression. T o clarify AtMKK6/auxin/lateral root  79  formation  relationship,  I  performed two experiments; blocking and adding auxin to the AtMKK6  promoter::GUS  seedlings.  -NPA  +NPA  • 'i  (  /  *  i  X  \  '•'  \  ..... v  /  —m  I  Sir  A  1  V i  B  Figure 3.11 N P A effect on lateral root formation in 17-day-old wild-type Arabidopsis seedlings (A) Lateral roots of plants grown on the unsupplemented M S agar medium (B) Diminished lateral root formation in plants grown on M S agar medium containing 5 p M N P A . White bars = 1 0 m m .  80  3.3.6  Blocking polar auxin transport with NPA reduces AtMKK6  promoter: :GUS activity. I grew AtMKK6 promoter::GUS seedlings for 10 days and treated them with and without N P A for 24 hours, before analyzing them for G U S activity. A s observed previously, plants grown i n the absence o f N P A showed strong G U S activity i n the vascular tissue o f the primary roots, with the most intense staining at the sites where lateral roots were formed (Figure 3.12). In contrast, roots on plants grown i n the presence o f N P A showed a substantial reduction i n G U S activity, accompanied b y lower numbers o f lateral roots (Figure 3.12).  -NPA  +NPA  Figure 3.12 N P A (5 p M ) effect promoter:.GUS reporter seedlings.  on G U S activity  i n 10-day-old  Arrows indicate primary root sites from which lateral roots emerged. A black bar = 0.2 m m .  81  AtMKK6  3.3.7 Auxin can reverse the block of AtMKK6 promoter::GUS activity by NPA in both vascular tissue and pericycle cells. I have demonstrated i n the previous sections that the pattern o f G U S activity driven b y AtMKK6 promoter is associated with lateral root formation and that application o f N P A , an auxin transport inhibitor, produces a reduction i n the AtMKK6  promoter activity.  I  hypothesized that optimal levels o f auxin could positively regulate the transcriptional control o f the AtMKK6 gene and that optimal levels o f A t M K K 6 , i n turn, could control lateral root development. This hypothesis predicted that co-treatment with N P A and I A A would restore both G U S activity i n roots and lateral root development o f AtMKK6 promoter:.GUS reporter plants. T o test this hypothesis, I grew AtMKK6 promoter::GUS seedlings for 9 days and treated them with N P A alone and N P A together with I A A for 24 hours before subjecting to G U S activity assay. Roots o f plants grown i n the presence o f N P A alone showed only weak G U S activity i n vascular tissue. Strikingly, G U S staining was absent from the pericycle cell layer i n primary roots and diminished i n almost all dividing pericycle cells o f L R P . This pattern was associated with the contribution o f fewer pericycle cells to the L R P , leading to an abnormal L R P shape (Figure 3.13 A and B ) . B y contrast, roots o f plants grown i n the presence o f both N P A and I A A showed a substantial level o f G U S activity i n vascular tissue, and i n both inactive pericycle cells and actively dividing pericycle cells o f L R P , which also had a normal L R P shape (Figure 3.13 C - F ) . Closer examination o f the  AtMKK6  promoter::GUS activity i n NPA/IAA-treated roots revealed that the restored G U S activity was localized not only i n the root vascular tissue, but also i n the pericycle cell layer o f primary roots (Figure 3.13 C , D and E ) . Moreover, G U S staining i n the L R P was concentrated i n the actively dividing pericycle cells i n L R P at the early stage o f the lateral  82  root initiation (Figure 3.13 E , C and D in stages V , V I and VIII, respectively, according to M a l a m y and Benfey 1997 and Casimiro et al, 2003). These results indicate that exogenous auxin can overcome the block of AtMKK6 promoter::GUS activity by N P A i n vascular tissue, and i n both inactive pericycle cells and actively-dividing pericycle cells. The increased G U S activity i n the N P A / I A A - t r e a t e d roots was correlated with a substantial increase in lateral root numbers. Roots treated with N P A alone had 3-4 primordia per seedling but roots treated with N P A and I A A had 10-22 primordia/lateral roots per seedling. Notably, only early stage primordia were detected i n the NPA-treated roots (Figure 3.13 A and B ) , whereas both early stage primordia and fully developed lateral roots were detected i n the N P A / I A A - t r e a t e d roots (Figure 3.13 C - F ) . The expression pattern of the GUS gene directed by the AtMKK6 promoter changed dramatically when the young primordia continued to form fully developed lateral root organs (Figure 3.13 F). This observation is consistent with the known organization o f specialized cells and tissues during lateral root development (Malamy and Benfey, 1997). In fully developed lateral roots, G U S staining was localized i n vascular tissue and i n the root cap cells, but not i n the meristematic zone of lateral roots, even though this is also a site o f frequent cell-division (Figure 3.13 F). Notably, the G U S staining pattern in mature lateral roots o f AtMKK6 promoter:.GUS seedlings (Figure 3.13 F) was similar to that in mature lateral roots o f AtMPKl3  promoter::GUS seedlings (Figure 3.9 K ) . Together, these data  indicate that A t M K K 6 and A t M P K l 3 are likely to be specifically involved i n cell-division of pericycle cells during L R P initiation i n lateral root formation.  83  +NPA  Figure 3.13 Histochemical localization of G U S activity in lateral root primordia ( L R P ) and lateral roots o f A t M K K 6 promoter::GUS reporter seedlings, upon N P A (5 p M ) treatment and co-treatment of N P A (5 p M ) and I A A (1 p M ) . (A) and (B) L R P in the presence of N P A alone, G U S staining is shown to be faint in vascular tissue (vt) and absent in pericycle cell layer (p) o f the primary roots; (C), (D), (E) L R P in the presence o f both N P A and I A A . G U S staining is shown in vascular tissue, in pericycle cell layer (p) o f primary roots and i n actively dividing pericycle cells of L R P ; (F) A fully developed lateral root (lr) emerged from a primary root (pr). G U S staining is shown in cells of root cap and in vascular tissue (vt) o f both lateral and primary roots; vt = vascular tissue, ep = epidermis, c = cortex, en = endodermis and p = pericycle; Asterisks indicate location o f pericycle cell layer. G U S staining is shown as green/blue.  84  3.3.8 AtMPK13 and auxin The AtMPK13 promoter was found to contain two putative auxin-responsive elements, A u x R R - c o r e ( G G T C c t t and G G T C c c t ) (Sakai et al, 1996) at nucleotide position - 8 9 3 , (+) strand and - 3 3 0 , (-) strand, respectively (Figure 3.14). Similar to the pattern observed i n the AtMKK6  promoter::GUS seedlings, the AtMPKl3  promotery.GUS seedlings showed a  dramatic decrease i n G U S activity i n actively-dividing pericycle cells o f L R P upon N P A treatment (Figure 3.15 A ) . However, i n contrast to AtMKK6 promoter::GUS seedlings, G U S staining of AtMPKl 3 promotery.GUS seedlings remained strong i n inactive cells of pericycle layer upon N P A treatment (Figure 3.15 A ) , indicating that N P A cannot block the activity o f AtMPKl3 promoter i n these non-dividing cells. The diminished G U S activity resulting from N P A treatment was associated with abnormal growth o f L R P s , which contained fewer cells (Figure 3.15 A ) . AtMPK13  promoter::GUS staining was restored i n actively dividing  pericycle cells when the seedlings were co-treated with both N P A and I A A . (Figure 3.15 B to E ) , and an increased number o f new lateral root primordia were also observed (Figure 3.15 C).  -1534 bp 5'  -897 (+strand)  -330 (-strand)  ,  +1 ATG 1  , i 1  AtMPKl 3 coding region AuxRR-core  Figure 3.14 Schematic illustration showing the location o f two putative auxin-responsive sequences A u x R R - c o r e i n the A t M P K l 3 promoter region (1534 bp). The A t M P K l 3 promoter sequence analysis (Lescot et al., 2002) revealed the presence o f a putative auxin-responsive element, A u x R R - c o r e ( G G T C c t t and G G T C c c t ) (Sakai et al., 1996) at nucleotide position -893, (+) strand and - 3 3 0 , (-) strand, respectively -490.  85  +NPA  + N P A , +IAA  + N P A , +IAA  Figure 3.15 Histochemical localization of AtMPKH promoter::GUS activity in L R P s and lateral roots from 13-day-old reporter seedlings, upon treatment o f N P A alone (5 p M ) and co-treatment o f N P A (5 p M ) and I A A (1 p M ) . (A) and (B) A lateral root primordium in the presence o f N P A alone and in the presence o f both N P A and I A A , respectively. (C) to (F) Different stages of lateral root development emerged from a NPA/IAA-treated roots. Arrowheads indicate L R P . White bars = 0.2 m m . G U S staining is shown as green/blue.  86  3.3.9 Phenotypic analysis of AtMKK6RNAi transgenic plants To further investigate the biological function o f A t M K K 6 i n plants, and to specifically ask whether the AtMKK6 gene product is required for lateral root development, I generated lossof-function AtMKK6  mutant plants using a glucocorticoid-inducible R N A interference  ( R N A i ) system. In this inducible R N A i system, the silencing mechanism can be induced b y application o f low levels o f dexamethasone, a glucocorticoid hormone analogue (Figure 3.3 B). Transgenic seedlings o f the T 2 generation were screened for positive transformants b y growing them i n the absence and presence o f 1 p M dexamethasone (dex). Positive transformants displayed an abnormal phenotype on dex-containing media, whereas the same genotypes grown i n the absence o f dex showed a phenotype similar to that o f empty vector lines grown i n the same growth conditions. F i v e A t M K K 6 R N A i lines were recovered i n this process, all o f which showed a similar "hairy" phenotype with various degrees o f abnormality when induced with dex. T w o lines with the strong abnormal phenotype were used for further detailed analysis. I used R T - P C R to examine AtMKK6 transcript levels i n the A t M K K 6 R N A i mutant (line 13) that displayed strongest phenotype to determine the specificity o f the gene silencing. The abundance o f the AtMKK6 transcripts i n the A t M K K 6 R N A i plants was - 2 3 % decreased when the R N A silencing was induced b y dexamethasone (Figure 3.16), whereas the abundance o f the transcripts of AtMKKI and AtMKK2, which share high sequence homology to AtMKK6, was not significantly changed b y dex treatments (data not shown).  87  AtMKK6RNAi  - dex  + dex  AtMKK6  AtH1  Figure 3.16 R T - P C R analysis showing a - 2 3 % reduction i n the AtMKK6 transcript level i n 10-day-old A t M K K 6 R N A i seedlings (line 13) when the gene silencing was induced b y 1 p M dexamethasone (dex) treatment as compared to that without dex treatment (control). AtMKK6 gene-specific primers and Arabidopsis histone H I ( A t H l ) primers, a control for equal sample loading, were used. The experiments were done i n duplicate. The expression signals for both AtMKK6 and AtHl genes were quantified and AtHl expression signals were used for normalization.  88  A s expected, lateral root development was negatively affected in dex-inducible A t M K K 6 R N A i plants. A t M K K 6 R N A i - s u p p r e s s e d seedlings showed a 82 % reduction in lateral root numbers (Figure 3.20). Interestingly, root hair development was also strongly affected i n dex-inducible A t M K K 6 R N A i plants. A t M K K 6 R N A i seedlings grown on plant growth media in the presence of 1 p M dex for 7-10 days showed a "hairy" phenotype (Figure 3.17 A , 3.18 A and 3.19 B ) with far more root hairs compared to control seedlings from empty vector line (Figure 3.19 A and B ) . Thus, A t M K K 6 may normally be a negative regulator o f root hair development. In mature plants, AtMKK6 suppression resulted i n early senescence in leaf, stem and floral tissues (Figure 3.17 C and Figure 3.18 C ) .  89  Empty Vector -dex  AtMKKBRNAi  + dex  - dex  + dex  Figure 3.17 Phenotypic analyses revealed growth defects o f A t M K K 6 R N A i plants during plant growth and development. A t M K K 6 R N A i plants displayed growth defects when gene silencing was induced by dexamethasone (dex) treatment. (A) 7-day-old empty vector and A t M K K 6 R N A i seedlings grown in ±1 p M dex-containing media (B) 10-day-old empty vector and A t M K K 6 R N A i seedlings grown i n soil. Seedlings were treated with 25 p M dex at day 7 post-germination. This picture was taken at day 3 post-treatment. (C) 35-day-old empty vector and A t M K K 6 R N A i plants grown i n soil; Plants were treated with 25 p M dex at day 28 post-germination. This picture was taken at day 7 post-treatment. White bars = 2 m m , red bars = 20 m m .  90  Figure 3.18 Close-up views o f phenotypes from A t M K K 6 R N A i plants when induced by dexamethasone (dex). (A) 7-day-old A t M K K 6 R N A i seedlings grown in 1 p M dex-containing media (B) 10-day-old A t M K K 6 R N A i seedlings grown in soil; Seedlings were treated with 25 p M dex at day 7 post-germination. This picture was taken after 3 days o f dex treatment. (C) 35-day-old A t M K K 6 R N A i plants grown in soil; Plants were treated with 25 p M dex at day 28 post-germination. This picture was taken after 7 days of dex treatment. White bars = 2 m m , Red bar = 20 m m . 91  Figure 3.19 A t M K K 6 R N A i showed ectopic root hairs, when induced b y 1 p M dex (A) Root hairs from a 10-day-old seedling o f an empty vector (pTA7002) plant (line 4) (B) Root hairs from a 10-day-old seedling o f the A t M K K 6 R N A i plant (line 13) White bars = 0.2 m m .  3.3.10 Lateral root analysis of AtMPKl3RNAi transgenic plants To investigate whether A t M P K l 3 is required i n the lateral root formation, three positive T 2 A t M P K l 3 R N A i transgenic independent lines were recovered and assessed for lateral root formation, as with A t M K K 6 R N A i transgenic plants. The A t M P K l 3 R N A i mutant plants, grown i n the presence o f 1 p M dex showed a marked reduction (80 %) i n lateral root numbers (Figure 3.20).  92  Empty Vector  AtMKK6RNAi  AtMPKl 3RNAi  - dex  Figure 3.20 A t M K K 6 R N A i and A t M P K l 3 R N A i showed reduction o f lateral root number when R N A i silencing was induced by 1 u M dex. Lateral root phenotype o f 14-day-old empty vector seedlings, A t M K K 6 R N A i and A t M P K l 3 R N A i seedlings were grown on M S agar medium and subjected to ± 1 p M dex treatments at day 7 post-germination. When compared to the non-treated seedling o f the same genotype, the dex-treated A t M K K 6 R N A i and A t M P K l 3 R N A i seedlings exhibited 82 % and 80 % reduction in the number o f lateral roots, respectively, while the dex-treated empty vector line showed no significant change in the lateral root formation. Pictures were taken at day 14 post-germination.  93  3.4 Discussion 3.4.1 AtMKK6 is required for lateral root initiation The localization o f promoter activity o f the AtMKK6 gene to cell types with well-defined functions i n Arabidopsis provides an initial indication o f the biological process(es) i n which the gene may play a role. One o f the most fascinating features o f plant pericycle cells is their ability to re-initiate cell division and generate a new localized meristem capable of producing all root organ-specific cell types and eventually forming a new lateral root. The AtMKK6 promoter::GUS data reveal that, within the primary roots, AtMKK6 is specifically expressed in vascular tissue and particularly i n non-dividing cells o f the pericycle layer surrounding the vascular tissue. Strikingly, GUS-positive cells were observed i n the actively dividing pericycle at the site o f the lateral root primordia ( L R P ) initiation. This localization pattern means that the most intense AtMKK6 expression occurs at sites along the primary root where lateral root formation is taking place, which implicates the possible involvement o f AtMKK6 in initiating and/or sustaining pericycle cell division during lateral root initiation. This model is supported b y the results obtained with AtMKK6-suppressed plants, where reduction i n AtMKK6 gene expression resulted i n the formation o f far fewer lateral roots. In addition to the defect i n lateral root development observed i n older AtMKK6suppressed seedlings, AtMKK6RNAi seedlings grown i n growth media in the presence of the inducer showed a "hairy" phenotype, marked b y inhibition o f shoot development and massive formation o f ectopic root hairs on elongated primary roots. AtMKK6RNAi plants treated with dexamethasone also displayed growth defects during later stages o f plant development. Together, these observations reveal a requirement for the AtMKK6 product activity during lateral root, root hair and whole plant development.  94  gene  3.4.2 Pericycle-specific expression of the AtMKK6 promoter is regulated by auxin. The control o f L R P initiation during lateral root formation is not well understood. It has been suggested that there are two possible growth control points for L R P initiation (Dubrovsky et al, 2000). The first control point is developmentally regulated for early lateral root initiation, and is defined after pericycle cells pass from the meristem to the differentiation zone where L R P founder cells are established. The second growth control point is developmentally unrelated to the root apical meristem, and involves L R P initiation as a response to tissue damage or environmental changes, or to being exogenously stimulated with  auxin  (Laskowski et al, 1995; Doerner et al, 1996). Since AtMKK6 promoter::GUS activity was observed both during L R P initiation i n untreated roots, and i n exogenously auxin-stimulated roots o f AtMKK6 promoter::GUS seedlings, the AtMKK6  gene product may be required  during both growth control points for L R P initiation of the lateral root formation process. Furthermore, treatment with N P A , a polar auxin transport inhibitor, markedly diminished AtMKK6 promoter: :GUS activity i n pericycle cells o f roots, both i n non-dividing and actively dividing cells (Figure 3.13 A and B ) , indicating that auxin is a positive regulator of  transcription o f the AtMKK6 gene i n the root pericycle cells. The block o f AtMKK6  promoter activity caused b y N P A could be reversed b y supplying exogenous I A A (Figure 3.13 C to E ) , which indicates that supply o f an optimal amount o f endogenous auxin is likely an important regulator o f the pericycle-specific activity pattern o f the AtMKK6 promoter. It has been proposed that inhibition o f auxin transport results i n accumulation o f levels o f I A A that are sub-optimal for lateral root initiation in Arabidopsis (Casimiro et al, 2001). Notably, in contrast to roots co-treated with the N P A and I A A , roots treated with N P A alone had both  95  fewer and poorly developed lateral roots. The presence o f these residual lateral roots may result from L R P that had formed i n roots o f 9-day old seedlings prior to the N P A treatment. However, their further development was then blocked b y N P A . The failure o f L R P to develop further i n NPA-treated reporter plants, associated with the reduction o f G U S activity in L R P s , might indicate that A t M K K 6 activity is also required for outgrowth o f lateral roots, but this possibility would need to be tested more directly. In conclusion, m y data show that auxin controls AtMKK6 gene expression and that the AtMKK6  gene product is probably required for lateral root formation. Furthermore,  during initiation o f lateral root formation, A t M K K 6 is likely involved i n regulating the active cell-division o f pericycle cells i n both development-related and environment-related scenarios. However, it is unclear about the mechanism o f the A t M K K 6 regulation i n root pericycle cell-division. Recent reports have indicated that protein phosphorylation plays an important role i n regulating auxin polar transport. P I N O I D (PID), a protein serine-threonine kinase, regulates cellular localization o f the P I N proteins, auxin transport facilitators (Friml et al, 2004). Ectopic expression o f the pid gene i n roots resulted i n mislocalization o f P I N proteins to the root cell apical membranes, whereas i n wild-type plants P I N proteins are normally localized to the root cell basal membranes.  The mechanism o f the P I D - P I N  interaction e.g. what proteins are the downstream target o f the P I D kinase remains unanswered. Based on this information, it would clearly be o f interest to determine whether A t M K K 6 is involved i n auxin polar transport i n Arabidopsis roots.  96  3.4.3 AtMKK6 and AtMPK13 relationship Besides the gene expression and cellular localization levels o f regulation, the AtMKK6 gene product is likely to be regulated at other levels such as post-translational phosphorylation b y its upstream M A P K K K , and interaction with other proteins such as its downstream M A P K . A t M P K l 3 is a prime candidate as a downstream substrate for A t M K K 6 i n the context o f lateral root formation i n Arabidopsis, since (1) the activity o f the AtMPKl3  promoter and  AtMKK6 promoter were both detected i n the primary roots at sites o f lateral root formation and i n actively dividing pericycle cells o f L R P , and (2) A t M K K 6 has been shown to be capable o f phosphorylating A t M P K l 3 in vitro (Melikant et al, 2004). A t M P K l 3 might therefore also be involved i n regulating the cell-division process i n the pericycle, associated with L R P initiation. This model is supported b y the observation that dex-induced A t M P K l 3suppressed plants showed reduced lateral root formation. Beyond this inferred function i n lateral root formation, the tissue/cell-specific expression o f the AtMPK13  promoter::GUS  activity i n floral and silique organs indicates additional involvement o f the AtMPKl3  gene  product i n other developmental transitions. (Figure 3.9 P to T). The N A C K - P Q R pathway controlling cytokinesis i n tobacco cells was proposed to consist o f N A C K 1 / 2 kinesin-like proteins (Takahashi et al,  2004), N P K 1 M A P K K K  (Nishihama et al, 2001), the N O K l / N t M E K l M A P K K and the N R K 1 M A P K (Soyano et al, 2003). This pathway operates during the late M phase o f the cell cycle i n tobacco cells. N t M E K l / N Q K l (the tobacco orthologues o f Arabidopsis A t M K K 6 ) has previously been shown to be capable o f phosphorylating and activating N t N T F 6 / N R K l  (the tobacco  orthologue o f A t M P K 1 3 ) in vitro (Calderini et al, 2001; Soyano et al, 2003). Localization studies have also determined that N T F 6 and M M K 3 , tobacco and alfalfa orthologues,  97  respectively, o f Arabidopsis M P K 1 3 can be detected at developing cell plates (Calderini et al,  1998; Bogre et al,  1999). Interestingly, m y results indicate that N P A blocked the  activities o f both the AtMKK6 and AtMPKl3  promoters i n actively dividing pericycle cells  during L R P initiation, whereas this treatment failed to block AtMPK13  promoter::GUS  activity i n non-dividing pericycle cells. It is possible that the A t M K K 6 / A t M P K 1 3 signaling interplay is subject to a 'matrix effect' i n which certain functions or interactions only occur under specific conditions defined b y cell-types or developmental conditions (Coruzzi and Zhou, 2001). Such context-dependent interactions between A t M K K 6 , A t M P K 1 3 and other auxin-regulated components might give rise to a situation where A t M P K l 3 interacts with A t M K K 6 only i n actively dividing pericycle cells during L R P initiation but not i n pericycle cells during the inactive stage.  This possibility could perhaps be explored b y using a  technique like F R E T (Fluorescence Resonance Energy Transfer) for measuring interactions between two proteins in vivo (Pollok and H e i m , 1999).  98  CHAPTER 4 AtMPK12, an Arabidopsis mitogen-activated protein kinase is guard cellspecific and induced by salt and osmotic stresses. 4.1 Introduction A s discussed i n Chapter 2, m y examination of MAPK gene expression profiles in Arabidopsis revealed an interesting expression pattern for AtMPKl2.  In this chapter, I have explored the  tissue and cell distribution o f AtMPK12 expression during development through use o f AtMPK12 promoter::GUS reporter plants. M y results show that the AtMPK12  promoter  directs the GUS reporter gene expression specifically to stomatal guard cells o f many Arabidopsis tissues. This expression is intensified i n plants subjected to salt stress and other osmotic stress. In addition, I report the results o f phenotypic analysis o f a A t M P K l 2 loss-offunction mutant recovered from the S A L K collection o f T - D N A insertional mutants.  4.1.1 Stomatal development Stomata are specialized structures located i n the epidermis of plant aerial tissues. Each stoma is comprised o f two opposing guard cells that surround the stomatal pore, an opening which allows exchange o f gases and water vapor between the intercellular spaces o f the plant and the surrounding atmosphere (Figure 4.1; Nadeau and Sack 2002). Stomata are distributed i n the epidermis i n a pattern that leaves individual stomata separated b y at least one intervening pavement cell (Bergmann, 2004). Little is known about the developmental mechanisms that regulate stomata formation and patterning, but it has been proposed that all Arabidopsis stomata form through at least one asymmetric and one symmetric division (Figure 4.2 and Nadeau and Sack 2003). In brief, during stomatal development, the first division occurs i n  99  cuticle epidermis (upper) chloroplasts r  palisade parenchyma  xylem phloem  spongy  parenchyma  bundle sheath  mesophyll  vein  epidermis (lower)  (vascular bundle) sheath extension  guard cell  air space  stomatal pore  stoma  Figure 4.1 Dicot leaf anatomy (littp://generalhorticulto  a presumed stem cell, the meristemoid mother cell, ( M M C ) that has become committed to the stomatal pathway (Figure 4.2). The M M C undergoes an asymmetric division, producing a smaller triangular precursor called a meristemoid ( M ) and a larger sister cell called a neighbor cell ( N C ) . The M can either differentiate immediately into an oval-shape guard mother cell ( G M C ) , which in turn undergoes a symmetric division, producing the two guard cells that form the stoma, or it can continue to divide asymmetrically, producing another M at each division. A t each division, the sister cell ( N C ) may become an M M C and divide asymmetrically to produce a new meristemoid called a satellite meristemoid ( S M ) (Figure  4.2).  100  fl  Meristemoid Mother Cell  Meristemoid  Guard Mother Cell  Young guard cells  Satellite •"•"^meristemoid  s  t  o  m  a  -fa Asymmetric division of MMC Asymmetric division of meristemoid "£? Symmetric division of GMC  Figure 4.2 Arabidopsis stomatal development (Nadeau and Sack, 2002b)  Mutations in several loci are known to disrupt stomatal development and patterning in Arabidopsis. The best characterized o f these loci are TOO  ERECTA (ER), STOMATAL DENSITY AND DISTRIBUTION FOUR LIPS (FLP). The tmm,  er erl  MANY MOUTHS  (TMM),  1 (SDD1), YODA (YDA) and  er2 triple, sddl and yda  mutants display similar  phenotypes in that they have an excessive number o f stomata compared to wild-type leaves (Berger and Altmann, 2000; Shpak et al, 2005; Geisler et al, 2000; Bergmann et al, 2004), while the flp mutants display a paired stomata phenotype (Yang and Sack, 1995). TMM, which encodes a leucine-rich receptor-like protein has been proposed to play an essential role in the intercellular  communication of positional signaling and i n  establishment o f stomatal patterning (Yang and Sack, 1995; Geisler et al, 2000; Nadeau and Sack, 2002a; Larkin et al,  2003). Several spacing mechanisms appear to be disrupted in  leaves of tmm mutants (Geisler et al,  2000). 101  These mutants have division in cells that  normally would not divide, and T M M is required for the correct orientation o f the plane o f the asymmetric division that patterns Arabidopsis leaf stomata (Geisler et al, 2000; Nadeau and Sack, 2003). In addition to this randomized division phenotype, tmm plants possess an altered stomatal distribution pattern where stomata form clusters rather than being distributed properly (Figure 4.3 and Geisler et al, 2000). Stomatal cluster formation i n tmm plants is partly an outcome o f an increase i n the number o f asymmetric divisions o f neighbor cells, compared to the wild-type patterns, and an increase in the number o f asymmetric divisions o f meristemoids, many o f which are misplaced to remain in contact with pre-existing stomata or precursors. Thus, T M M acts as a negative regulator o f asymmetric division i n neighbour cells and a positive regulator o f asymmetric divisions i n meristemoids (Geisler et al, 2000; Nadeau and Sack, 2003).  Figure 4.3 Stomatal clusters i n too many mouths Cryo-scanning electron micrograph o f tmm abaxial cotyledon epidermis. Bar = 15 p m (Nadeau and Sack, 2002b)  102  Figure 4.4 Developmental basis o f stomatal cluster formation i n tmm (Nadeau and Sack, 2002b) (Top) Schematic drawing of tmm leaf epidermal surface (bottom row) illustrating that stomatal clusters result from several defects including (1) the randomization o f the orientation o f asymmetric division, (2) cells (*) next to stomata and/or precursors normally do not divide but do in tmm, and (3) sometimes both products of division develop into G M C s (lower right). Top row shows cartoon of what would have happened i n w i l d type. (Bottom) Differential interference contrast micrograph of tmm epidermis showing new meristemoids (red asterisks) that are i n contact with developing stomata. Bar = 1 0 pm.  103  Arabidopsis ER ERL1 and ERL2, three isi?-family leucine-rich repeat-receptor like kinases ( L R R - R L K s ) together control stomatal patterning (Shpak et al, 2005). Loss-offunction mutations i n all three £7?-family genes cause stomatal clustering and over proliferation o f stomata, indicating that the three E R proteins may act as negative regulators of stomatal development. Promoter activity pattern o f ERL1 and ERL2 are high i n stomatallineage cells i n developing leaves including meristemoids, guard mother cells and immature guard cells. Their promoter activity pattern supports the proposed function these proteins i n stomatal development. SDD1, which encodes a substilisin-like serine protease, has been proposed to function as a processing protease i n developmental signaling (Berger and Altmann, 2000; v o n G r o l l and Altmann, 2001). The sddl mutant phenotypes are similar to those o f tmm i n that both have many more stomata than wild-type leaves do. However, sddl has fewer and smaller clusters than tmm does, meaning that sddl has many more correctly patterned stomata than tmm (Berger and Altmann, 2000). YODA (YDA), a MAPKKK  gene, appears to have a central role i n stomatal cell fate  determination. It controls both stomatal development and formation (Bergmann et al, 2004). Plants containing mutations i n YODA have an excessive number o f stomata, many o f which are misplaced, leading to stomatal clusters, while plants containing two copies o f a permanently active version o f YODA completely lack stomata (Bergmann et al., 2004). These authors have proposed that Y O D A acts downstream o f S D D 1 and T M M because the introduction o f a single copy o f the constitutively active version o f Y O D A into T M M - or SDD-loss o f function plants restores the correct distribution o f stomata. It has been  104  established that Y O D A also plays a role in cell fate determination i n plant embryonic development (Lukowitz et al, 2004). Four lips (FLP), a M Y B transcription factor gene, may function as a negative regulator o f cell division at the guard mother cell ( G M C ) to guard cell transition (Yang and Sack, 1995; Larkin et al, 2003). F L P normally limits the number of symmetrical divisions o f the G M C to one, whereas the flp-1 in direct contact  mutants produce many pairs of laterally-aligned stomata  with each other (Figure 4.5; Y a n g and Sack, 1995; Larkin et al.,1997).  W h i l e stomatal clusters i n tmm result partly from excess asymmetric divisions, flp clusters develop mostly from excess symmetric divisions from a single guard mother cell ( G M C ) . The flp-1  allele does not appear to affect the total number of meristemoids or pavement cells  that are produced (Yang and Sack, 1995; Geisler et al,  1998). The flp  stomatal cluster  phenotype indicates that F L P does not act in stomatal initiation but rather acts later in the stomatal pathway than T M M .  105  Figure 4.5 Paired stomata in four lips (Nadeau and Sack, 2002b) (Top) flp-1 displays both unclustered and clustered stomata. Stomata visualized using K A T : : G U S staining (promoter from Rebecca Hirsch and M i c h a e l Sussman, methods as in Larkin et al, (1997) Bars = 200 p m . (Bottom) Cryo-scanning electron micrograph showing paired stomata at right. Bar = 10 pm.  4.1.2 Stomatal function and their regulation through ion channels Stomata regulate CO2 diffusion into the mesophyll tissue for photosynthetic carbon fixation, water vapor loss v i a transpiration and O2 diffusion out to the environment, through the control o f the stomatal aperture. Stomatal opening and closing are affected by a number o f environmental conditions. F o r example, high humidity, high CO2 and light induce stomatal opening (Outlaw, 2003), whereas l o w humidity, cold, drought and soil salinity induce  106  stomatal closure, which reduces water loss from the plant (Luan, 2002). From external signals to stomatal movements, many signal transduction mechanisms within the guard cells integrate the input stimuli and link them to the response (Schroeder et al, 2001b; Outlaw, 2003) . Both stomatal opening and closing are known to be regulated by various ion channels. Stomatal opening is initiated by H extrusion from guard cells v i a the H " A T P a s e , leading to +  +  hyperpolarization o f the plasma membrane. This is then followed by rapid uptake o f potassium ions ( K ) v i a the K - i n channel (Outlaw, 1983; Outlaw, 2003) and rapid uptake of +  +  sucrose v i a a H -sucrose symporter (Talbott and Zeiger, 1998). A s a consequence o f this +  organic solute accumulation, the water potential o f the guard cells drops and water enters the guard cells, leading to increased guard cell turgor and swelling/curving of the cells (Figure 4.6 A ) . Stomatal closure is caused by plasma-membrane depolarization, resulting from the efflux of anions v i a an anion channel and consequent K  +  efflux via a K - o u t channel +  (Outlaw, 2003). The associated loss of water from the guard cells results i n their straightening, and the squeezing together o f their opposing surfaces (Figure 4.6 B ) . This stomatal closure generally occurs daily at the point when light levels drop and the use o f CO2 in photosynthesis decreases. However, it can also occur at any point when plants have lost an excessive amount o f water. Such a water deficit induces an accumulation o f A B A i n plant cells and it has been established that A B A accumulation in guard cells can trigger stomatal closure (Schroeder et al, 2001a), as can application of exogenous A B A (Roelfsema et 2004) .  107  al,  A B A regulates ion channel activity i n guard cells (MacRobbie, 1997), inhibiting the K - i n and activating the K - o u t channels, thereby decreasing K +  +  +  influx and increasing K  +  efflux. These effects are consistent with A B A ' s observed ability to inhibit stomatal opening and induce stomatal closure (Luan, 2002). Besides regulation through K - i n and -out +  channels, A B A causes a depolarization o f the plasma membranes (Thiel et al, 1992) through activation o f anion channels (Grabov et al, 1997; Pei et al, 1997). A B A activates the slow anion channels o f the plasma membrane through positive regulation o f a protein kinase ( L i et al, 2000) and through negative regulation o f a different protein kinase (Pei et al, 1997), which highlights the central role o f phosphorylation i n the signal network that regulates the anion channels o f guard cells.  P o t a s s i u m ions (K ) +  T u r g i d guard cell Vacuole filled with water S t o m a open A  F l a c c i d guard cell Stoma  closed  B Figure 4.6 Guard cell function: stomatal opening and closing  108  4.1.3 Involvement of protein phosphorylation in stomatal regulation Protein phosphorylation has been implicated i n A B A signaling i n plant guard cells at several points. A t least three protein kinases and two protein phosphatases involved i n this process have been identified and characterized. The three kinases are A A P K (ABA-activated protein kinase), O S T 1 (Open Stomata 1) and A M B P K . A A P K was identified from guard cells o f Vicia faba through a biochemical approach ( L i and Assmann, 1996) and has been shown to be involved i n modulating the activity o f the ABA-regulated slow-anion channel ( L i et al, 2000). OST1 is an Arabidopsis ABA-activated protein kinase that is closely related to A A P K from Vicia faba. Recessive ostl mutations disrupt both A B A induction o f stomatal closing and A B A inhibition o f light-induced stomatal opening (Mustilli et al, 2002). A M B P K , identified as a M A P kinase, positively controls A B A - i n d u c e d stomatal closure i n Pisum sativum (Burnett et al, 2000). T w o phosphatases shown to be involved i n A B A signaling i n guard cells are A B I 1 and A B I 2 (ABA-insensitive 1 and ABA-insensitive 2, respectively). They have been identified as type 2 C protein phosphatases that are involved i n A B A regulation o f i o n channel activity in Arabidopsis guard cells (Leung et al, 1994; Meyer et al, 1994; Leung et al, 1997; Leung and Giraudat, 1998). A B A activation o f the slow anion is responsible for the membrane depolarization and prolonged anion efflux required for A B A - m e d i a t e d stomatal closure. In abi mutants, the anion channels remain inactive even i n the presence o f accumulating A B A , which results i n constantly open stomata (Pei et al, 1997). This implies that protein phosphorylation is required to hold the anion channels i n a quiescent state, from which they can be released through the action o f the A B I 1 and A B I 2 phosphatases.  109  Other mutations can also affect A B A signaling i n stomata. For example, a mutation in the GPA1 gene, which encodes a heterotrimeric G T P binding protein a-subunit ( G T P a ) , also diminishes A B A - i n d u c e d stomatal closure (insensitive to A B A ) (Wang et al, 2001). G P A 1 has been shown to interact with the Arabidopsis putative G protein-coupled receptor G C R 1 (Pandey and Assmann, 2004). However, i n guard cells, the gcrl mutant exhibited the opposite phenotype from gpal (hypersensitive to A B A ) . Therefore, it has been proposed that G C R 1 may be a negative regulator o f G P A 1 i n guard cells (Pandey and Assmann, 2004).  4.1.4 Salt stress signaling Excessive N a i n the soil, often referred to as high salinity, is a major environmental stress +  that affects plant growth and development, and can limit crop production (Epstein et al, 1980). When grown i n high concentration o f salts, plants exhibit a variety o f responses at the molecular, cellular and whole plant levels (Zhu, 2001a). These include developmental changes, i o n transport adjustment, and shifts i n metabolite accumulation. Some o f these responses to salt stress are triggered b y ion imbalance and osmotic stress signals, whereas others may be caused b y secondary signals generated downstream o f the primary signals, such as phytohormones (e.g. A B A ) , reactive oxygen species and intracellular C a fluxes. A +  common primary outcome o f salt, drought and cold stresses is associated osmotic stress, whereas a primary outcome uniquely associated with salt stress is ion imbalance or ionic stress. Plants under salt stress therefore have to restore ionic homeostasis as well as water or osmotic homeostasis (Figure 4.7).  110  lone stress  SOS3-»-SOS2  Ion transporters 6-9.SOS1  :  Ion homeostasis Homeostasis  Osmotic s(res5  Cold  1  Drought ABA  \  ;  i i l  ;  Secondary stresses e.g. oxidation  I CBF/DREB  T R E N D S I)  Plrnl S t a e r e r  Figure 4.7 Salt stress responses in plants and pathways that interconnect them. Homeostasis can be regarded as consisting of ionic and osmotic homeostasis Components. The SOS pathway is proposed to mediate ionic homeostasis and the M A P K pathway is proposed to mediate osmotic homeostasis (Zhu, 2001b). The two primary stresses, ionic and osmotic stresses cause secondary stresses such as ROS accumulation. This diagram is modified, from Zhu (2001b).  4.1.5 Ionic stress signaling: the "salt overly sensitive" (SOS) pathway Salt stress disrupts ionic homeostasis in plants, causing a build-up of excess toxic N a in the +  cell cytosol and a deficiency of essential ions such as K as a result of the negative impact of +  N a on intracellular K influx (Hasegawa et al, 2000). The signaling pathway components +  +  controlling N a homeostasis and salt tolerance have been identified through genetic screens +  to recover mutants in Arabidopsis that are hypersensitive to NaCl stress. These mutants are  111  designated as SOS (salt overly sensitive) ( W u et al., 1996; L i u and Z h u , 1997, 1998), several of which have been cloned and characterized. SOS1 encodes a putative N a / H +  +  antiport  protein whose biological function may be removal of N a from the cytoplasm with export to +  the extracellular space. The steady-state level o f SOS1 transcripts is up-regulated b y N a C l stress (Shi et al., 2000). SOS2 encodes a serine/threonine protein kinase and is required for salt tolerance ( L i u et al., 2000) while SOS3 encodes a myristoylated C a - b i n d i n g protein 2+  ( L i u and Zhu, 1998). These S O S proteins are proposed to constitute a pathway that regulates N a balance in the plant cells. +  In the proposed S O S pathway, the sequence of signaling events starts with transient elevation o f intracellular C a  2 +  i n response to salt stress. A s a consequence, the C a - b i n d i n g 2+  protein, S O S 3 , is activated ( L i u and Zhu, 1998; Ishitani et al, 2000). This activation results i n SOS3 recruiting and activating protein kinase SOS2 (Halfter et al, 2000; Ishitani et al, 2000; L i u et al, 2000). The S O S 3 - S O S 2 kinase complex regulates the activity of the plasma membrane-localized N a / H +  SOS1  antiporter, S O S 1 , and also activates the transcription o f the  +  gene. The complex may also modulate the activity o f other i o n transporters (Zhu,  2000), which act together to restore ion homeostasis (Figure 4.8). In addition to ion transporters like SOS1 that directly control N a influx into and +  efflux out o f plant cells through the plasma membrane, there are other ion transporters such as A t N H X l that regulate N a compartmentation in the vacuole (Figure 4.8). Transport o f N a +  +  to the vacuole helps prevent N a toxicity i n the cytosol; N a can also be utilized i n the +  +  vacuole as an osmolyte to help restore osmotic homeostasis (Zhu, 2001b).  112  High N a  +  SOS1  Figure 4.8 Diagram o f the S O S pathway for plant Na+ response, from Z h u , J - K (2000)  4.1.6 Osmotic stress signaling: SOS-independent protein kinases In addition to the physiological challenges associated with ionic imbalance, high salinity in soil is a major cause o f osmotic stress in plants because o f associated changes i n watergenerated turgor pressure. Several plant M A P K components have been implicated in osmotic stress responses, mainly based on up-regulation o f their transcripts and/or kinase activation i n response to salt, drought and cold stresses (Mizoguchi et al, 1996; Kiegerl et al, 2000; Teige  et al, 2004). The plant M A P K s identified in this fashion include A t M E K K l , M E K 1 / M K K 2 and M P K 4 / M P K 6 i n Arabidopsis (Ichimura et al, 2000; Teige et al, 2004), S I M K K and S I M K in alfalfa (Kiegerl et al, 2000) and N t M E K 2 , S I P K and W I P K i n tobacco (Yang et al, 2001; Zhang and Klessig, 2001) (Figure 4.9).  113  In Arabidopsis, the M A P K K , M K K 2 , was specifically activated by salt and cold stresses (Teige et al, 2004). In vivo protein kinase assays showed that activated M K K 2 phosphorylated M P K 4 and M P K 6 . mkk2 null plants were impaired i n M P K 4 and M P K 6 activation and were hypersensitive to both salt and cold stresses (Teige et al,  2004).  A t M P K 6 can also be activated by l o w temperature and osmotic stresses i n Arabidopsis cell cultures (Ichimura et al, 2000). In alfalfa, activation o f S I M K , a salt stress-induced M A P K , is posttranscriptionally mediated by the M A P K K , S I M K K (Kiegerl et al, 2000).  ^  o all  Excess Na +  •C a ^ --•SOS3 +  strc3SS  Hyperos mo lair ity—  ATHK1 ASK1  —  OS2 -— • S O S land other transporters  \ t cyto  \ MKK2 -NtMEK2 SI MK K  AtM PK4/A tMPK6 SIPK/WII SIM K  alir  Elicitors Wou nding  Figure 4.9 Salt stress activates several protein kinase pathways, the S O S 3 - S O S 2 kinase pathway, multiple M A P K pathways and other protein kinases e.g. A T H K 1 , A S K 1 and A T G S K 1 . M o d i f i e d from (Zhu, 2001a).  114  Similarly, i n tobacco, S I P K  (the orthologue  o f A t M K K 6 ) becomes activated  upon  hyperosmotic stress (Mikolajczyk et al, 2000), while W I P K (the orthologue o f A t M P K 3 ) is activated b y cold, drought, wounding and biotic stimuli (Seo et al,  1995). In tobacco,  N t M E K 2 is a M A P K K capable o f activating both S I P K and W I P K (Yang et al, 2001; Zhang and Klessig, 2001). Beyond M A P K pathway proteins, additional kinases and other proteins are also involved i n responding to salt or osmotic stresses (Figure 4.9). These include Arabidopsis A T H K 1 , a two-component histidine kinase homologous to the yeast osmosensor, S L N 1 (Urao et al, 2000), a tobacco homologue o f Arabidopsis serine/threonine kinase 1 (ASK1) (Mikolajczyk et al, 2000) and A T G S K 1 (Piao et al, 2001).  115  4.2 Materials and Methods 4.2.1 Plant materials Plant materials were prepared as described i n Chapter 3, Section 3.2.1.  4.2.2 Genomic DNA isolation Genomic D N A isolation was performed i n the same manner as i n Chapter 3, Section 3.2.2.  4.2.3 Molecular cloning of AtMPKl2 promoter: :GUS DNA constructs and generating the GUS reporter plants To  examine cell-  and tissues-specific expression o f AtMPKl2  development,  transgenic  glucuronidase  (GUS) reporter  Arabidopsis  plants  gene construct  harboring  genes during  the AtMPK12  were generated through  plant  promoter::/?the following  processes.  4.2.3.1 Cloning of the AtMPK12 promoter The promoter region o f the AtMPKl2 gene ( t h e 1300 bp region immediately upstream o f its translational start A T G codon) was amplified from Arabidopsis genomic D N A (obtained from section 3.2.2) using the Expand H i g h Fidelity P C R System K i t (Roche Molecular Biochemicals, Catalog N o . 1 732 641). P C R was carried out according to the manufacturer 's instructions, using P K 1 2 F 1 and P K 1 2 R 1 primers (Table 4.1). The resulting amplicon was cloned into the pCR®2.1-TOPO® vector using a T O P O T A Cloning® K i t (Invitrogen, Carlsbad, U S A , and Catalogue N o . K4500-01) and the insert was sequenced to confirm its identity.  116  Table 4.1 Primer sequences for AtMPKl2 promoter cloning Primer  Restriction  Name  Enzyme Site  Sequence (5-3')  Amplified Promoter Region Length (bp)  PK12F1  BamHI  cgcgaatccGTGAAGAGAGAAGCTTTTTTCAACTG  PK12R1  BamHI  cgcggatccGATGAAGCTAGCTATGGAGTCACTCTG  1300  4.2.3.2 Generation of promoter::GILTS' fusion DNA constructs and transgenic plants The amplified AtMPKl2 promoter fragment was digested with BamHI and ligated into the GUS coding region o f the promoter cloning vector, p C A M B I A 1 3 8 1 Z ( C S I R O , Canberra, Australia) that has been predigested with BamHI. Clones carrying the construct with the promoter i n the sense orientation adjacent to the GUS O R F were identified b y double restriction enzyme digestion. Uncut p C A M B I A 1 3 8 1 Z was used as a promoterless-Gt/S construct (negative control) and p C A M B I A 1 3 0 1 ( C S I R O , Canberra, Australia) was used as a 35S  promoter-GcTS fusion construct  (positive  control).  Schematic diagrams o f the  p C A M B I A 1 3 8 1 Z and p C A M B I A 1 3 0 1 vectors are presented i n Chapter 3, Figure 3.1. The ligation reactions and E.coli transformation were performed as previously described i n Chapter 3, Section 3.2.3.2. Agrobacterium transformation, in planta transformation o f Arabidopsis and selection o f transformants were performed as previously described i n Sections 3.2.3.3, 3.2.3.4 and 3.2.3.5, respectively.  117  4.2.4 Histochemical GUS analysis Three independent transformants o f the AtMPKl2  promoter::GUS reporter plants (lines 1, 2  and 8) were subjected to detailed histochemical G U S analysis using the methods previously described i n Chapter 3, Section 3.2.4.  4.2.5 Resin embedding and cross-sectioning of leaf tissue Resin  embedding o f leaf tissue o f  pTomoter..GUS  10-day-old seedlings harboring  fusion construct, and cross-sectioning were performed  the  AtMPKl2  as previously  described i n Chapter 3, Section 3.2.5.  4.2.6 NaCl and mannitol treatments AtMPK12 promoter::GUS reporter seeds were surface sterilized as previously described i n Chapter 3, Section 3.2.3.5) and then individual seeds were arranged on square agar-solidified M S medium plates containing Vi M S salt mix, 1% sucrose, 0.5 g / L M E S , and 0.8 % agar, p H 5.7 (without B 5 vitamins). The plates were sealed with 3 M Micropore™ tape and the seeds were vernalized at 4 °C i n the dark for 2-4 days. The plates were then placed i n the growth room, mounted vertically under 16 h/8 h light-dark cycle conditions at 22-24 °C for 9 days. For the N a C l treatment, sufficient 100 m M N a C l i n liquid M S was added to flood 12day old reporter seedlings for 24 hours. F o r the control, unsupplemented M S solution was used. For the mannitol treatment, seedlings were grown on agar-solidified M S medium containing 5 % mannitol for 10 days. F o r the control, seedlings were grown on the normal unsupplemented medium. 118  4.2.7 Verification of the AtMPKl2 SALK transfer-DNA (T-DNA) insertional homozygous line  4.2.7.1 Genomic DNA extraction of the AtMPKU SALK T-DNA insertional plants Leaves o f 4-week-old plants, (the AtMPKU  T - D N A insertional plants, S A L K _ 0 7 4 8 4 9 ) were  used for genomic D N A extraction, using an adaptation o f a protocol described i n (Edwards et al,  1991) and Western T. L. (personal communication). The leaf sample from each  individual plant was ground i n a microfuge tube for 15-30 seconds using an electronic drill at room temperature. T o each ground sample, was added 400 p L extraction buffer (containing 200 m M T r i s - H C l , p H 7.5, 250 m M N a C l , 25 m M E D T A , p H 8.0 and 0.5% S D S ) and the mixture was vortexed for 5 seconds. The sample was then centrifuged for 3 minutes at 10,000 x g. Without disturbing the pellet, 300 p L supernatant was transferred to a fresh microfuge tube, and D N A was precipitated b y adding 300 p L isopropanol and mixing b y inverting the tube 5 times. The sample was incubated at room temperature for 2 minutes and then centrifuged for 5 minutes at 10,000 x g. The supernatant was discarded, and the pellet was then washed with 500 p L 7 0 % ethanol and air-dried for 10 minutes. The D N A pellet was re-suspended i n 100 p L T E , p H 8.0, and the genomic DNA-containing solution was stored at 4 °C. A 2 p L aliquot o f the genomic D N A was used for each P C R reaction.  119  4.2.7.2 Identification of a homozygous SALK T-DNA insertional line To identify homozygous AtMPKl2  T - D N A insertional line(s), Seed were obtained from the  Arabidopsis Stock Centre ( A B R C accessed through http://www.Arabidopsis.orgV P C R was performed using genomic D N A obtained from individual AtMPK12 S A L K T - D N A insertional plants at the T3 generation (section 4.2.7.1). This screen employed three S A L K T D N A primers: the left genomic primer, K 1 2 L P ; the right genomic primer, K 1 2 R P and the left border primer, L B a l . These primers were designed b y the S A L K i S E C T online tools (http://signal.salk.edu/isects.html) and the sequences are presented i n Table 4.2. A diagram describing the S A L K T - D N A primer design is present i n Figure 4.10 (Alonso et al, 2003). The expected amplicon sizes for the various primer combinations used are 900 bps and 410+N bps ( N = 0-300 bps).  Table 4.2 Primers for verification o f the AtMPK12 T - D N A insertional homozygous line(s) (SALK_074849)  Primer Name  Sequence (5'-3')  K12LP  TCACGTAGCGTTCTCTTAGCATCG  K12RP  TGGCAATGCAGTTGGAGAAGA  LBa1  TGGTTCACGTAGTGGGCCATCG  120  Figure 4.10 Diagram o f S A L K T - D N A verification primer design and P C R product size (Modified from http://signal.salk.edu/tdnaprimers.html and Alonso et al. (2003)) (A) S A L K T - D N A verification primer design K 1 2 L P and K 1 2 R P = Left and right genomic primers for A t M P K l 2 T - D N A insertional lines, respectively N = Difference of the actual insertion site and the flanked sequence position, usually 0 - 300 bases L B a l = Left border primer o f the T - D N A insertion (B) A m p l i c o n sizes expected from using the three primers ( L B a l + K 1 2 L P + K 1 2 R P ) for screening AtMPKl2  S A L K _ 0 7 4 8 4 9 plants, W T ( W i l d Type - no insertion) plants  should yield a product o f about 900 bps (from K 1 2 L P to K 1 2 R P ) , H M (Homozygous lines - insertions in both chromosomes) plants w i l l yield a band o f 410+N bps, and H Z (Heterozygous lines - one of the pair chromosomes with insertion) plants should yield both bands.  121  4.2.8 Phenotypic analyses of the homozygous mutant (atmpkll)  AtMPKll  T-DNA insertional  in normal growth conditions  The phenotypic analyses o f young seedlings were performed on the M S agar-solidified medium plates. The atmpkll mutant and wild-type seeds were surface sterilized and placed on M S agar-solidified media containing Vi M S salt mix, 3% sucrose, 0.5 g/L M E S and 1.2 % agar, p H 5.7 (without B5 vitamins). The seeds were vernalized at 4 °C i n the dark for 2-4 days prior to being grown at 22-24 °C, under 16 h/8 h light-dark cycle conditions. -50-100 seeds were sown per plate and five replicate plates were used. U p to 12 days, morphological phenotypes were monitored and photographed.  122  4.3 Results  4.3.1 Histochemical localization of GUS activity driven by AtMPK12 promoter during plant development In Chapter 2, reverse transcriptase polymerase chain reaction ( R T - P C R ) analysis o f the expression o f all Arabidopsis  MAPK  genes showed that the AtMPK12  gene was  differentially expressed i n Arabidopsis tissues and the highest expression was detected i n callus (Chapter 2, Figure 2.2). T o investigate the cell- or tissue-specific expression o f AtMPKl2  gene more closely during plant development, I performed a promoter-GUS activity  analysis. A 1.3 kb-promoter region upstream o f the AtMPKl2  A T G start codon was fused  with the ^-glucuronidase (GUS) reporter gene and the resulting construct was introduced into wild-type Arabidopsis plants. G U S activity was monitored throughout plant development, from 3 days to 35 days, b y histochemical staining i n three independent transgenic lines. G U S staining i n all three lines was highly localized, appearing as dark blue spots i n cotyledons, rosette leaves and hypocotyls (Figure 4.11 A - C ) . This pattern resulted from strong GUS expression i n guard cells i n these tissues i n plants o f all ages tested. In contrast to the R T - P C R results, G U S staining was barely detectable i n roots (Figure 4.11 A - C , E and F ) , appearing sporadically i n the upper parts (adjacent to the hypocotyls) o f the primary roots. N o G U S staining was observed i n trichomes (Figure 4.11 D ) . G U S activity was also observed i n the guard cells i n the inflorescence stems and cauline leaves (Figure 4.11 G ) . In young flowers and mature flowers, strong G U S staining was observed i n guard cells i n sepals and anthers, but not i n guard cells i n petals (Figure 4.11 H ) . In the pistil o f young flowers, G U S activity was barely detected i n the stylar region o f young pistils (not shown), whereas  123  strong G U S activity was detectable i n guard cells of the style i n mature flowers (not shown) and i n guard cells o f the stylar region at the base o f developing siliques (Figure 4.11 J). In addition, strong G U S activity was observed in guard cells along the pedicel and body o f the siliques  (Figure 4.11 I and J). B y contrast, no G U S activity was observed in stigma o f  flowers or the distal end o f siliques at either young and mature stages (Figure 4.11 H and J). Overall, the AtMPK12 promoter drove GUS expression specifically i n guard cells o f most aerial tissues throughout plant development.  124  Whole plants and leaf guard cells A  1  Hypocotyl  Cotyledon tissue  • . * • ' *'  t  Root  *o«  Figure 4.11 AtMPKl2 promoter-GUS activity survey throughout plant development ( A , B and C ) 5-day, 10-day and 35-day old seedlings or plants are shown, respectively. Black bars = 2 m m and white bars = 0.2 m m .  125  Trichomes and Roots  Inflorescence, flowers and silique  Figure 4.11 (continued) AtMPKl2  promoter-GUS activity survey of inflorescence,  flowers and silique White bar = 2 m m and black bars = 0.4 m m .  127  A pistil of a fertilized mature flower  Figure 4.11 (continued) AtMPKl2 promoter-GUS activity survey o f floral pistils (J) A pistil from a fertilized mature flower. Gt/5-expression guard cells was clearly detected i n the guard cells o f mature style tissue. Arrows indicate stigma and style region o f a pistil. Black bar = 0.1 m m .  128  Higher magnification o f leaves from 10-day-old AtMPKl2 promoter::GUS seedlings revealed G U S activity i n leaf guard cells (Figure 4.12 A ) . However, strong G U S activity was not detected in all leaf guard cells. Strong G U S staining was restricted to the large guard cells, whereas relatively weak G U S staining was observed in the smaller cells (Figure 4.12 B ) . Weak G U S staining was detectable in many (not all) guard mother cells, which are precursor cells o f stomata development, but G U S staining was not detectable in other types of stomatal precursor cells (data not shown). N o G U S activity was detected in epidermal pavement cells (Figure 4.12 B ) , although it was observed in some parts o f the leaf vascular tissues (Figure 4.12 A ) . Finally, examination of leaf cross-sections from 10-day-old seedlings confirmed the guard cell-specific GUS  expression pattern seen in whole tissue mounts  (Figure 4.13 A and B ) .  129  B  o  0  4  0 Figure 4.12 Histochemical localization of GUS activity in AtMPKl2 promoter::GUS reporter plants. Arrows indicate smaller guard cells expressing relatively weak GUS activity, compared to the larger ones. A red bar = 20 pm. GUS staining is shown as blue. 130  Figure 4.13 Transverse section of leaf from the AtMPKl2  promoter: :GUS reporter plant.  Arrowheads indicate guard cells where G U S staining is localized as blue.  131  4.3.2 AtMPK12 promoter activity was enhanced by NaCl and mannitol treatments. AtMPK12 promoter::GUS activity i n both shoots and roots was increased b y exposure o f the plants to N a C l (100 m M ) for 24 hours (Figure 4.14). Normally, G U S staining is barely detectable i n roots at different stages o f development (Figure 4.11 E - F ) , but the activity was dramatically increased upon N a C l treatment, as compared to the control, particularly i n the vascular tissue o f the roots (Figure 4.14 B ) . Higher magnification revealed that, upon N a C l treatment, a substantial increase i n G U S activity could also be induced i n leaf stomatal guard cells (Figure 4.15 A and B ) . In addition to N a C l stress, I tested the effect o f a direct osmotic stress stimulus, using mannitol. In reporter plants grown on M S agar medium containing 5 % w / v mannitol, G U S activity was markedly increased i n leaf stomata (Figure 4.16). Notably, the seedlings grown in the presence o f mannitol also displayed growth defects, as their leaves were smaller and their roots were shorter, compared to the control where the same genotypes were grown o n the unsupplemented media.  132  -NaCl  +NaCI  -NaCl  +NaCI  Figure 4.14 N a C l causes an increase in G U S activity of the AtMPKl 2 promoter: :GUS reporter seedlings. G U S staining is shown as blue. (A) Shoot and roots from 13-day old seedlings treated without and with N a C l (100 m M ) (B) Roots from 13-day old seedlings treated without and with N a C l (100 m M )  133  -NaCl A  ,  C:  Figure 4.15 NaCl causes an increase in GUS activity in leaf guard cells of AtMPKl 2 promoter: :GUS reporter seedlings. (A) and ( B ) Leaf guard cells from 13-day old seedlings treated without and with NaCl (100 mM), respectively. GUS staining is shown as blue.  134  Figure 4.16 Mannitol (5%) causes an increase in G U S activity o f the AtMPKl2 promoter:.GUS reporter seedlings. (Left) 10-day-old seedlings grown in the absence o f mannitol. (Right) 10-day-old seedlings grown in the presence o f 5 % mannitol.  135  4.3.2 Characterization of SALK T-DNA insertion lines To gain more insight into the function o f A t M P K 12 i n plants, I characterized a mutant line i n which the AtMPKl2  gene has been disrupted by a T - D N A insertion in the first exon (Alonso  et al, 2003). In collaboration with an undergraduate student, Janet Chung, a homozygous line (line 28) o f the atmpkl2 mutant was recovered from screening an accession from the S A L K T - D N A insertional mutation collection ( S A L K _ 0 7 4 8 4 9 ) , using a P C R genotyping approach (Figure 4.17).  Figure 4.17 P C R screening of AtMPKl 2 T - D N A insertional lines ( S A L K - 0 7 4 8 4 9 ) to identify a plant homozygous for recessive mutant alleles of the AtMPKl 2 gene. Line 28 represents a homozygous atmpkl2 mutant that has T - D N A insertions in both chromosomes. A n arrow indicates a single band o f an amplification product from line 28 (see more details in Section 4.2.7.2).  136  4.3.3 Phenotypic analysis of the atmpkll  plants  Under normal growth conditions on M S agar medium, the young atmpkl2 mutant seedlings showed a mixture o f both dwarf phenotype (-37 %) and normal-looking phenotype (~ 63 %) in the population (Figure 4.18 A and B ) . However, the atmpkl2 mutant plants displaying dwarf phenotypes were segregated away i n the next generation, leaving only homogenous wild-type looking plants (Figure 4.18 C ) . This result indicates that the dwarf phenotypes i n the previous generation were not an outcome o f the AtMPKl2  mutation. It was confirmed b y  P C R genotyping that the plants with the homogenous phenotypes are atmpkl2 homozygous mutants that contain T - D N A inserts i n both chromosomes.  4.4 Discussion 4.4.1 AtMPKll  promoter activity pattern is guard cell-specific throughout  plant development Epidermal tissues o f Arabidopsis leaves and stems contain three distinct cell types: stomatal guard cells, trichomes, and epidermal pavement cells (Melaragno et al, 1993). M y results show that the AtMPKl2  promoter activity was confined to the stomatal guard cells and was  not detected i n pavement cells or trichomes (Figure 4.12 B and Figure 4.11 D ) . In addition, m y results reveal that the AtMPK12 promoter directs GUS expression specifically to the guard cells i n a range o f developmental contexts, since GC/5-expressing guard cells were detected i n cotyledons, hypocotyls, and siliques, as well as i n specific floral tissues such as sepals, anthers and the stylar region o f pistils (Figure 4.11 H and J). However, the activity was not detected uniformly i n all guard cells. The level o f G U S activity appears to be related to the size o f the guard cells, or perhaps their state o f development (Figure 4.12 B ) . 137  Wild-type  atmpk12  atmpk12  Figure 4.18 Phenotypic analysis of wild-type and atmpkl2 mutant plants on growth medium (1.2 % agar and 3 % sucrose) (A) 12-day-old wild-type plants (B) 12-day-old atmpk!2 mutants with both dwarf and wild-type looking plants. (B inset b) a closer view of a dwarf plant; black bars = 2 mm (C) 12-day-old atmpkl2 mutants in the next generation with homogeneous wild-type looking plants.  138  4.4.2 AtMPK12 may be required for guard cell development. Two  aspects of the promoter activity and gene expression patterns o f  noteworthy.  First, the pattern o f G U S activity driven by the  strong expression  in mature stomatal  guard cells.  AtMPK12  are  AtMPK12 promoter included  This indicates the involvement  of  A t M P K l 2 in later stages o f stomatal development and/or in stomata function. Similarly, Gt/S-expressing guard cells were not detectable in the stylar region of young pistils, but were detectable in the same region of mature siliques (Figure 4.11  J), indicating again that  AtMPKl2 expression is most pronounced at later stages o f stomatal development. The second observation is that  AtMPKl2 was highly expressed in callus, a tissue that  contains actively dividing cells (Chapter 2, Figure 2.2). This indicates that A t M P K l 2 may also be involved in a specific cell division process in plants. It is known that formation of  Arabidopsis stomata requires at least one asymmetric and one symmetric division (Figure 4.2 and Nadeau and Sack 2003). Thus, A t M P K l 2 may be required for controlling specific cell division  counts  during stomatal  development.  These  two  observations  indicate  that  A t M P K l 2 may function differently at different developmental stages. In contrast to AtMPK12, transcription of other stomata-associated genes, e.g.  SDD1  and TMM, is particularly active in developing cells in the stomatal pathway. The TMM promoter was active in both daughter cells o f the asymmetric division, i.e. the meristemoids and their neighbor cells (Nadeau and Sack, 2002a). Similarly, the SDD1 promoter was active in the smaller stomata precursor cells, the meristemoids and guard mother cells, whereas its activity decreased during guard cell formation and maturation (Von Groll et al, 2002). These genes are proposed to regulate early events in asymmetric cell division (Berger and Altmann, 2000; Geisler  et al, 2000). The pattern of AtMPKl2  139  promoter activity with the late  developmental events i n the stomatal pathway indicates that A t M P K l 2 might be involved i n the terminal differentiation o f a guard mother cell to form guard cells.  4.4.3 Guard cell-specific AtMPK12 is involved in osmotic stress response. Some members o f the plant M A P K gene family have been previously identified as salt or osmotic stress-responsive genes; for example, A t M K K 2 , A t M P K 4 , A t M P K 6 , SEV1KK, S I M K , N t M E K 2 , S I P K and W I P K (Chapter 4 Introduction and references therein). In m y study, an increase i n AtMPKl2  promoter activity upon N a C l treatments i n stomatal guard  cells indicates the involvement o f the AtMPKl2  gene product i n transducing the salt stress  signal i n these specialized cells. Protein phosphorylation plays an important role i n the regulation o f stomatal aperture and i n ion transport i n guard cells ( L i et al, 1998), and the guard-cell specific activity pattern of the AtMPKl2  promoter is similar to that o f the promoter o f the KAT1 gene, which  encodes a potassium channel (Figure 4.12 and Nakamura et al, transporter gene, AtNHXl  (1995)). Another ion  (Arabidopsis thaliana sodium proton exchanger 1) is also  exclusively expressed i n stomatal guard cells (Shi and Zhu, 2002). It is tempting to suggest that A t M P K l 2 might function i n regulation o f one or more classes o f ion channels that control stomata opening and closing. Interestingly, expression o f the AtNHXl gene was also increased b y treatment o f leaves with N a C l , K C 1 or A B A (Shi and Z h u , 2002), and overexpression o f the AtNHXl  gene conferred increased salt tolerance (Apse et al, 1999).  A t N H X l has been proposed to regulate N a compartmentation i n the vacuole under salt +  stress (Zhu, 2001b).  140  I also showed that mannitol treatment enhanced the activity o f the  AtMPK12  promoter i n leaf stomata and in roots. One common feature o f both salt and mannitol stresses is osmotic stress (Kreps et al, 2002), presumably because these agents generate a common water deficiency stress. This triggers the expression of genes whose products are involved in cell and/or whole plant protection from the water deficit, locally or distantly. For example, more osmolytes are synthesized, as is the plant hormone abscisic acid ( A B A ) , and more water channels are produced or activated. It has been established that roots exposed to drought synthesize A B A and export it from root xylem to leaves, where it induces stomatal closure (Wilkinson and Davies, 2002). It has been demonstrated that injection o f A B A into the xylem (Zhang and Outlaw, 2001a) and slow drying o f the entire roots (Zhang and Outlaw, 2001b) increase the concentration o f xylem-derived A B A up to 30-fold i n guard cells (Outlaw, 2003). Together, the observation of AtMPKll  promoter activity i n both  stomatal guard cells and root tissues would be consistent with the involvement o f this gene in osmotic stress response. However, it does not appear that expression of AtMPKl 2 is directly regulated by A B A , since exogenously applied A B A had no significant effect on the AtMPK12 promoter-GUS activity i n this study (data not shown). This result is consistent with SOS1 work (Shi et al, 2000) in that SOS1 can be induced transcriptionally by N a C l , but not by A B A . Although, my results indicate that A B A does not control the AtMPKl2  gene at  the transcriptional level, this does not exclude the possibility that A B A could have an effect at the post-transcriptional level. For example, the activation o f A t M P K 4 and A t M P K 6 i n response to osmotic stresses was not associated with changes i n the amount of the cognate m R N A or protein (Ichimura et al, 2000). Similarly, A B A had no detectable effect on the transcript level o f the protein kinase, OST1, or on the level o f OST1 promoter-GUS activity,  141  but it did induce the activation of the OST1 kinase. Notably, OST1  expression and its  promoter activity are also associated with the guard cells (Mustilli et al, 2002).  4.4.5 Concluding remarks Through molecular biology and reverse genetics approaches, I have identified a novel guard cell-specific  MAPK,  A t M P K l 2,  that  may  be  involved  in  correct  guard  cell  development/patterning i n normal growth conditions. In addition, I have shown that expression  of  AtMPKll  is  also  salt-stress  and  osmotic-stress  regulated.  The  mechanisms/pathways within which A t M P K l 2 operates in guard cell development or patterning and in response to salt and osmotic stress signal transduction remain largely unknown. Identification of A t M P K l 2 upstream regulators (e.g. M A P K K s and M A P K K K s ) and downstream targets (e.g. transcription factors or other proteins) would be a priority. AtMPKll  gene expression has been shown to be upregulated i n yda  mutant and  downregulated i n AN-YDA,  a constitutively active version o f Y D A (Supporting online  material in Bergmann et al,  2004). This data raises the question whether Y O D A is an  upstream M A P K K K signaling to A t M P K l 2 . Biochemical investigations w i l l be required to address this question, and further detailed characterization of the phenotypes of the atmpkll mutant would be required to address questions on the role(s) of A t M P K l 2 at specific stages during guard cell development and function.  142  CHAPTER 5 Overall Thesis Discussion and Future Directions 5.1 Transcriptional profiling approach versus developmental signaling In m y thesis research I screened Arabidopsis MAPK and MAPKK genes for their expression pattern, selected the most interesting candidate genes based on these expression patterns, formed hypotheses concerning their possible function(s), and tested the hypotheses with more specific experiments. However, many o f the MAPK gene family members appear to function without marked changes over time and development at the transcriptional level. Therefore, expression profiling provides only limited information. Notably, all o f the candidate genes chosen for further detailed functional characterization i n this study appear to be involved i n plant development. They are well differentiated i n their expression i n Arabidopsis cells, tissues and organs, which is not surprising given the basis o f their selection. F o r these family members, at least, the pattern o f transcript levels for particular M A P K signaling molecules can provide an initial indication o f their molecular function. It is interesting  that some MAPKJMAPKK  genes display large differences  in  transcriptional activity during development whereas others apparently do not. There are at least two possible explanations. (1) The gene products may be required for routine functioning o f specific cells or tissues, and these cells are increasing i n number or size at a particular point i n development. In this scenario, a M A P K / M A P K K gene produces more m R N A i n order to generate more o f the encoded proteins i n order to meet the needs o f multiple copies o f similar cell types, or to execute more o f the same process i n existing cells. The amount o f transcript may be critical  143  for production of a certain threshold level of a protein that regulates downstream targets. For example, in the case of the PID gene, the amount o f its gene product is critical for its function i n regulating P I N protein localization (Kaplinsky and Barton, 2004). (2) In the case o f the AtMKK6 and AtMPKl3  genes, their gene products are presumably  required for particular functions associated with initiation of a new tissue, lateral root primordia, within the pericycle.  5.2 Characterization of developmentally regulated genes using an inducible RNAi approach T i m i n g is critical in developmental processes; therefore, I used an inducible expression system in m y study. The inducible R N A i approach is good for the functional analysis o f developmentally regulated genes because gene expression can be interfered at a certain point during a biological process of interest. For example, I was able to use A t M K K 6 R N A i and A t M P K l 3 R N A i for a lateral root formation assay by inducing the R N A i to interfere with the formation of lateral roots at the age that plants started to form these organs, (see Chapter 3).  5.3. Future directions M y thesis makes a significant contribution to the characterization o f the MAPK gene family in plants, but there are many issues that need to be pursued further. Some of these issues would require new methodology  and specific molecular tools, e.g. protein-specific  antibodies. Suggestions for both complementary work and in-depth exploration of issues arising from m y thesis results are presented as follows.  144  5.3.1 Systematic analysis of the MAPKKK genes When I started m y Ph.D. thesis i n the year 1999, expression data for Arabidopsis genes was sparse i n the publicly available databases, but extensive gene expression data is now available  such  as  TAIR  (http://mpss.udel. edu/ at/). GENEVESTIGATOR:  (http://www.arabidopsis.org/links/microarrays.jspl Plantsp  Arabidopsis  (https://www.genevestigator.ethz.ch/V  (http://plantsp.genomics.purdue.edu/) Microarray  Database  and Analysis  MPSS and Toolbox  It would therefore not require expensive and time-  consuming experiments to obtain expression profiles for most members o f any given gene family. M y thesis indicates that a transcriptional profiling survey would be a useful entry point for systematic analysis o f the MAPKKK  genes, the class o f MAPK gene family that  presumably functions at the top o f M A P K cascades. Since MAPKK and MAPK genes, the middle and the bottom components o f these cascades, are transcriptionally regulated, it would be expected that some AtMKKK genes would also be transcriptionally regulated. Such transcriptional profiling would be a useful approach to identification o f candidate genes worthy o f further functional characterization. F o r example, the Arabidopsis orthologs o f NPK1  namely, ANP1, ANP2 and ANP3, are highly expressed i n organs that are rich i n  dividing cells (Nishihama et al, 1997). These kinases are prime candidates to be tested for being upstream components o f A t M K K 6 and/or A t M P K l 3.  5.3.2 Use inducible promoters to drive AtMPKH  gene constructs in  stomata of transgenic plants The AtMPKH  gene is expressed i n guard cells o f most aerial tissues under normal growth  conditions. This pattern indicates that A T M P K 1 2 may be involved i n stomatal development.  145  Therefore, I anticipate that loss-of-function or gain-of-function i n A T M P K 1 2 would interfere with this developmental process. T o clarify the possible function o f A T M P K 1 2 i n stomatal development, it would be useful to specifically interfere with stomatal AtMPK12 expression by using an inducible promoter or tissue-specific promoter to drive expression o f AtMPKl2 gene constructs ( R N A i or over-expression o f the gene) and perform analyses o f the stomatal development.  5.3.3 Identification of the MAPK protein network O n the one hand, to identify an upstream component o f A T M P K 1 2 , one could use an in vivo phosphorylation assay and identify which A T M K K s can phosphorylate the A T M P K 1 2 . O n the other hand, one could use microarray analysis with the AtMPK12 T - D N A mutant or inducible A t M P K l 2 R N A i transgenic plants to identify possible downstream targets o f ATMPK12.  5.3.4 Further characterization of the mutant and transgenic plants It would be interesting to investigate the possible roles o f the A t M K K 6 and A t M P K l 3 i n auxin polar transport and L R P cell-division using immunolocalization techniques (Sugimoto et al, 2000; F r i m l et al, 2004) with the A t M K K 6 R N A i and A t M P K l 3 R N A i transgenic plants. In the case o f A t M P K l 2 , I am interested i n further characterizing atmpkl2 plants to investigate their guard cell function such as guard cell opening and closing.  146  REFERENCES Abel, S., and Theologis, A . (1996). Early genes and auxin action. Plant Physiol 111, 9-17. Agrawal, G . K . , Rakwal, R., and Iwahashi, H . (2002). Isolation o f novel rice (Oryza sativa L.) multiple stress responsive M A P kinase gene, O s M S R M K 2 , whose m R N A accumulates rapidly i n response to environmental cues. Biochem Biophys Res C o m m u n 2 9 4 , 1009-1016. Ahlfors, R., Macioszek, V . , Rudd, J . , Brosche, M . , Schlichting, R., Scheel, D., and Kangasjarvi, J . (2004). Stress hormone-independent activation and nuclear translocation o f mitogen-activated protein kinases i n Arabidopsis thaliana during ozone exposure. Plant J 40, 512-522. Ahn, N . G . , Seger, R., Bratlien, R . L . , Diltz, C . D . , Tonks, N . K . , and Krebs, E . G . (1991). Multiple components i n an epidermal growth factor-stimulated protein kinase cascade. In vitro activation o f a myelin basic protein/microtubule-associated protein 2 kinase. J B i o l Chem 266,4220-4227. Alonso, J . M . , Stepanova, A . N . , Leisse, T . J . , K i m , C . J . , Chen, H . , Shinn, P., Stevenson, D.K., Zimmerman, J . , Barajas, P., Cheuk, R., Gadrinab, C , Heller, C , Jeske, A . , Koesema, E . , Meyers, C . C . , Parker, H . , Prednis, L . , Ansari, Y . , Choy, N . , Deen, H . , Geralt, M . , Hazari, N . , Horn, E . , Karnes, M . , Mulholland, C , Ndubaku, R., Schmidt, I., Guzman, P., Aguilar-Henonin, L . , Schmid, M . , Weigel, D., Carter, D . E . , Marchand, T., Risseeuw, E . , Brogden, D., Zeko, A . , Crosby, W . L . , Berry, C . C . , and Ecker, J.R. (2003). Genome-wide insertional mutagenesis o f Arabidopsis thaliana. Science 301, 653-657. Apse, M . P . , Aharon, G.S., Snedden, W . A . , and Blumwald, E . (1999). Salt tolerance conferred b y overexpression o f a vacuolar Na+/H+ antiport i n Arabidopsis. Science 285, 1256-1258. Asai, T . , Tena, G . , Plotnikova, J . , Willmann, M . R . , Chiu, W . L . , Gomez-Gomez, L . , Boiler, T., Ausubel, F . M . , and Sheen, J . (2002). M A P kinase signalling cascade i n Arabidopsis innate immunity. Nature 415, 977-983. Baier, M . , Kandlbinder, A . , Golldack, D., and Dietz, K . - J . (2005). Oxidative stress and ozone: Perception, signalling and response. Plant, C e l l and Environment, 1-9. Ballas, N . , Wong, L . M . , and Theologis, A . (1993). Identification o f the auxin-responsive element, A u x R E , i n the primary indoleacetic acid-inducible gene, P S - I A A 4 / 5 , o f pea (Pisum sativum). J M o l B i o l 233, 580-596. Banno, H . , Hirano, K . , Nakamura, T . , Irie, K . , Nomoto, S., Matsumoto, K . , and Machida, Y . (1993). N P K 1 , a tobacco gene that encodes a protein with a domain homologous to yeast B C K 1 , S T E 1 1 , and Byr2 protein kinases. M o l C e l l B i o l 13, 4745-4752. Beeckman, T . , Burssens, S., and Inze, D. (2001). The peri-cell-cycle i n Arabidopsis. J E x p Bot 52, 403-411. Berger, D., and Altmann, T . (2000). A subtilisin-like serine protease involved i n the regulation o f stomatal density and distribution i n Arabidopsis thaliana. Genes D e v 14, 1119-1131. Bergmann, D . C . (2004). Integrating signals i n stomatal development. Curr Opin Plant B i o l 7, 26-32.  147  Bergmann, D.C., Lukowitz, W . , and Somerville, C.R. (2004). Stomatal development and pattern controlled b y a M A P K K kinase. Science 304, 1494-1497. Bhalerao, R.P., Eklof, J . , Ljung, K . , Marchant, A . , Bennett, M . , and Sandberg, G . (2002). Shoot-derived auxin is essential for early lateral root emergence i n Arabidopsis seedlings. Plant J 29, 325-332. Boerjan, W . , Cervera, M . T . , Delarue, M . , Beeckman, T . , Dewitte, W . , Bellini, C . , Caboche, M . , Van Onckelen, H . , Van Montagu, M . , and Inze, D . (1995). Superroot, a recessive mutation i n Arabidopsis, confers auxin overproduction. Plant C e l l 7, 1405-1419. Bogre, L . , Ligterink, W . , Meskiene, I., Barker, P.J., Heberle-Bors, E . , Huskisson, N.S., and Hirt, H . (1997). Wounding induces the rapid and transient activation o f a specific M A P kinase pathway. Plant C e l l 9, 75-83. Bogre, L . , Calderini, O., Binarova, P., Mattauch, M . , Till, S., Kiegerl, S., Jonak, C , Pollaschek, C , Barker, P., Huskisson, N.S., Hirt, H . , and Heberle-Bors, E . (1999). A M A P kinase is activated late i n plant mitosis and becomes localized to the plane o f cell division. Plant C e l l 11,101-113. Bolwell, G.P. (1996). The origin o f the oxidative burst i n plants. Biochem Soc Trans 24, 438-442. Boulton, T . G . , Yancopoulos, G.D., Gregory, J.S., Slaughter, C , Moomaw, C , Hsu, J . , and Cobb, M . H . (1990). A n insulin-stimulated protein kinase similar to yeast kinases involved i n cell cycle control. Science 249, 64-67. Brenner, S., Johnson, M . , Bridgham, J . , Golda, G . , Lloyd, D . H . , Johnson, D., Luo, S., McCurdy, S., Foy, M . , Ewan, M . , Roth, R., George, D., Eletr, S., Albrecht, G . , Vermaas, E . , Williams, S.R., Moon, K . , Burcham, T., Pallas, M . , DuBridge, R.B., Kirchner, J . , Fearon, K . , Mao, J . , and Corcoran, K . (2000). Gene expression analysis b y massively parallel signature sequencing ( M P S S ) on microbead arrays. Nat Biotechnol 18, 630-634. Brunet, A . , Roux, D., Lenormand, P., Dowd, S., Keyse, S., and Pouyssegur, J . (1999). Nuclear translocation o f p42/p44 mitogen-activated protein kinase is required for growth factor-induced gene expression and cell cycle entry. E M B O J 18, 664-674. Burnett, E . C . , Desikan, R., Moser, R . C . , and Neill, S.J. (2000). A B A activation o f an M B P kinase i n Pisum sativum epidermal peels correlates with stomatal responses to A B A . J E x p Bot 51, 197-205. Calderini, O., Glab, N . , Bergounioux, C , Heberle-Bors, E . , and Wilson, C . (2001). A novel tobacco mitogen-activated protein ( M A P ) kinase kinase, N t M E K l , activates the cell cycle-regulated p43Ntf6 M A P kinase. J B i o l Chem 276, 18139-18145. Calderini, O., Bogre, L . , Vicente, O., Binarova, P., Heberle-Bors, E . , and Wilson, C . (1998). A cell cycle regulated M A P kinase with a possible role i n cytokinesis in tobacco cells. J C e l l Sci 111 (Pt 20), 3091-3100. Cardinale, F., Meskiene, I., Ouaked, F., and Hirt, H . (2002). Convergence and divergence of stress-induced mitogen-activated protein kinase signaling pathways at the level o f two distinct mitogen-activated protein kinase kinases. Plant C e l l 14, 703-711. Casimiro, I., Beeckman, T . , Graham, N., Bhalerao, R., Zhang, H . , Casero, P., Sandberg, G . , and Bennett, M . J . (2003). Dissecting Arabidopsis lateral root development. Trends Plant Sci 8,165-171.  148  Casimiro, I., Marchant, A . , Bhalerao, R.P., Beeckman, T . , Dhooge, S., Swarup, R., Graham, N . , Inze, D., Sandberg, G . , Casero, P.J., and Bennett, M . (2001). A u x i n transport promotes Arabidopsis lateral root initiation. Plant C e l l 13, 843-852. Celenza, J . L . , Grisafi, P.L., and Fink, G.R. (1995). A pathway for lateral root-formation i n Arabidopsis thaliana. Gene Dev 9, 2131-2142. Clough, S.J., and Bent, A . F . (1998). Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant J 16, 735-743. Cooper, J.A., Bowen-Pope, D.F., Raines, E . , Ross, R., and Hunter, T . (1982). Similar effects o f platelet-derived growth factor and epidermal growth factor on the phosphorylation o f tyrosine i n cellular proteins. C e l l 31, 263-273. Coruzzi, G . M . , and Zhou, L . (2001). Carbon and nitrogen sensing and signaling i n plants: emerging 'matrix effects'. Curr Opin Plant B i o l 4, 247-253. Courchesne, W . E . , Kunisawa, R., and Thorner, J . (1989). A putative protein kinase overcomes pheromone-induced arrest o f cell cycling i n S. cerevisiae. C e l l 58, 11071119. Crews, C M . , and Erikson, R . L . (1992). Purification o f a murine protein-tyrosine/threonine kinase that phosphorylates and activates the Erk-1 gene product: relationship to the fission yeast b y r l gene product. Proc Natl A c a d S c i U S A 89, 8205-8209. Crews, C M . , Alessandrini, A . , and Erikson, R . L . (1992). The primary structure o f M E K , a protein kinase that phosphorylates the E R K gene product. Science 258,478-480. Desikan, R., Hancock, J.T., Coffey, M . J . , and Neill, S.J. (1996). Generation o f active oxygen i n elicited cells o f Arabidopsis thaliana is mediated b y a N A D P H oxidaselike enzyme. F E B S Lett 382,213-217. Desikan, R., Hancock, J.T., Ichimura, K . , Shinozaki, K . , and Neill, S.J. (2001). Harpin induces activation o f the Arabidopsis mitogen-activated protein kinases A t M P K 4 and A t M P K 6 . Plant Physiol 126, 1579-1587. Doerner, P., Jorgensen, J . E . , You, R., Steppuhn, J . , and Lamb, C (1996). Control o f root growth and development b y cyclin expression. Nature 380, 520-523. Dolan, L . , Janmaat, K . , Willemsen, V . , Linstead, P., Poethig, S., Roberts, K . , and Scheres, B. (1993). Cellular-organization o f the Arabidopsis thaliana root. Development 119, 71-84. Droillard, M . , Boudsocq, M . , Barbier-Brygoo, H . , and Lauriere, C . (2002). Different protein kinase families are activated b y osmotic stresses i n Arabidopsis thaliana cell suspensions. Involvement o f the M A P kinases A t M P K 3 and A t M P K 6 . F E B S Lett 527,43-50. Dubrovsky, J . G . , Doerner, P.W., Colon-Carmona, A . , and Rost, T . L . (2000). Pericycle cell proliferation and lateral root initiation i n Arabidopsis. Plant Physiol 124, 16481657. Edwards, K . , Johnstone, C , and Thompson, C (1991). A simple and rapid method for the preparation o f plant genomic D N A for P C R analysis. N u c l . A c i d s Res. 19, 1349-. Elion, E . A . , Grisafi, P.L., and Fink, G.R. (1990). F U S 3 encodes a cdc2+/CDC28-related kinase required for the transition from mitosis into conjugation. C e l l 60, 649-664. Epstein, E . , Norlyn, J.D., Rush, D.W., Kingsbury, R . W . , Kelley, D.B., Cunningham, G.A., and Wrona, A . F . (1980). Saline culture o f crops: a genetic approach. Science 210, 399-404.  149  Friml, J . , Yang, X., Michniewicz, M . , Weijers, D., Quint, A., Tietz, O., Benjamins, R., Ouwerkerk, P.B., Ljung, K . , Sandberg, G . , Hooykaas, P.J., Palme, K . , and Offringa, R. (2004). A PINOID-dependent binary switch in apical-basal P I N polar targeting directs auxin efflux. Science 306, 862-865. Frye, C . A . , Tang, D., and Innes, R.W. (2001). Negative regulation of defense responses in plants by a conserved M A P K K kinase. Proc Natl A c a d Sci U S A 98, 373-378. Fu, S.F., Chou, W . C . , Huang, D.D., and Huang, H . J . (2002). Transcriptional regulation o f a rice mitogen-activated protein kinase gene, O s M A P K 4 , i n response to environmental stresses. Plant C e l l Physiol 43, 958-963. Galweiler, L . , Guan, C , Muller, A., Wisman, E . , Mendgen, K . , Yephremov, A., and Palme, K . (1998). Regulation of polar auxin transport by A t P I N l i n Arabidopsis vascular tissue. Science 282,2226-2230. Geisler, M . , Yang, M . , and Sack, F.D. (1998). Divergent regulation of stomatal initiation and patterning i n organ and suborgan regions of the Arabidopsis mutants too many mouths and four lips. Planta 205, 522-530. Geisler, M . , Nadeau, J . , and Sack, F.D. (2000). Oriented asymmetric divisions that generate the stomatal spacing pattern in Arabidopsis are disrupted by the too many mouths mutation. Plant C e l l 12, 2075-2086. Grabov, A., Leung, J . , Giraudat, J . , and Blatt, M . R . (1997). Alteration o f anion channel kinetics in wild-type and abil-1 transgenic Nicotiana benthamiana guard cells by abscisic acid. Plant J 12,203-213. Green, R., and Fluhr, R. (1995). U V - B - I n d u c e d PR-1 Accumulation is mediated by active oxygen species. Plant C e l l 7, 203-212. Gupta, R., Huang, Y . , Kieber, J . , and Luan, S. (1998). Identification o f a dual-specificity protein phosphatase that inactivates a M A P kinase from Arabidopsis. Plant J 16, 581589. Gustin, M . C , Albertyn, J . , Alexander, M . , and Davenport, K . (1998a). M A P kinase pathways i n the yeast Saccharomyces cerevisiae. M i c r o b i o l M o l B i o l Rev 62, 12641300. Gustin, M . C , Albertyn, J . , Alexander, M . , and Davenport, K . (1998b). M A P kinase pathways i n the yeast Saccharomyces cerevisiae. M i c r o b i o l M o l B i o l Rev 62,1264-+. Halfter, U., Ishitani, M . , and Zhu, J . K . (2000). The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3. Proc Natl A c a d Sci U S A 97, 3735-3740. Hamal, A., Jouannic, S., Leprince, A.-S., Kreis, M . , and Henry, Y . (1999). Molecular characterization and expression of an Arabidopsis thaliana L. M A P kinase kinase c D N A , A t M A P 2 K [ a l p h a ] . Plant Science 140,49-64. Hardin, S . C , and Wolniak, S.M. (1998). Molecular cloning and characterization o f maize Z m M E K l , a protein kinase with a catalytic domain homologous to mitogen- and stress-activated protein kinase kinases. Planta 206, 577-584. Hasegawa, P . M . , Bressan, R.A., Zhu, J.K., and Bohnert, H . J . (2000). Plant cellular and molecular responses to high salinity. A n n u Rev Plant Physiol Plant M o l B i o l 51, 463499. Herskowitz, I. (1995). M A P kinase pathways i n yeast: for mating and more. C e l l 80, 187197.  150  Hey, S.J., Bacon, A . , Burnett, E . C . , and Neill, S.J. (1997). Abscisic acid signal transduction i n epidermis cells o f Pisum sativaum L. Argentewn: both dehydrin m R N A accumulation and stomatal responses require protein phosphorylation and dephosphorylation. Planta 202, 85-92. Higo, K . , Ugawa, Y . , Iwamoto, M . , and Korenaga, T . (1999). Plant cis-acting regulatory D N A elements ( P L A C E ) database: 1999. Nucleic A c i d s Res 27,297-300. Himanen, K . , Boucheron, E . , Vanneste, S., de Almeida Engler, J . , Inze, D., and Beeckman, T . (2002). Auxin-mediated cell cycle activation during early lateral root initiation. Plant C e l l 14,2339-2351. Hirt, H . (2000). M A P kinases i n plant signal transduction. Results Probl C e l l Differ 27, 1-9. Hobbie, L . , and Estelle, M . (1994). Genetic approaches to auxin action. Plant C e l l Environ 17, 525-540. Huang, X . , Stettmaier, K . , Michel, C , Hutzler, P., Mueller, M . J . , and Durner, J . (2004). Nitric oxide is induced by wounding and influences jasmonic acid signaling i n Arabidopsis thaliana. Planta 218, 938-946. Huang, Y . , L i , H . , Gupta, R., Morris, P.C., Luan, S., and Kieber, J . J . (2000). A T M P K 4 , an Arabidopsis homolog o f mitogen-activated protein kinase, is activated i n vitro b y A t M E K l through threonine phosphorylation. Plant Physiol 122, 1301-1310. Ichimura, K . , Mizoguchi, T . , Hayashida, N., Seki, M . , and Shinozaki, K . (1998a). Molecular cloning and characterization o f three c D N A s encoding putative mitogenactivated protein kinase kinases ( M A P K K s ) i n Arabidopsis thaliana. D N A Res 5, 341-348. Ichimura, K . , Mizoguchi, T . , Yoshida, R., Yuasa, T . , and Shinozaki, K . (2000). Various abiotic stresses rapidly activate Arabidopsis M A P kinases A T M P K 4 and A T M P K 6 . Plant J 24, 655-665. Ichimura, K . , Mizoguchi, T . , Irie, K . , Morris, P., Giraudat, J . , Matsumoto, K . , and Shinozaki, K . (1998b). Isolation o f A T M E K K 1 (a M A P kinase kinase kinase)interacting proteins and analysis o f a M A P kinase cascade i n Arabidopsis. Biochem Biophys Res Commun 253, 532-543. Ishikawa, M . , Soyano, T., Nishihama, R., and Machida, Y . (2002). The N P K 1 mitogenactivated protein kinase kinase kinase contains a functional nuclear localization signal at the binding site for the N A C K 1 kinesin-like protein. Plant J 32, 789-798. Ishitani, M . , L i u , J . , Halfter, U . , K i m , C.S., Shi, W., and Zhu, J . K . (2000). SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding. Plant C e l l 12, 1667-1678. Jefferson, R . A . (1987). Assaying chimeric genes i n plants: The G U S gene fusion system. plant molecular biology reporter 5, 387-405. Johnson, P.R., and Ecker, J.R. (1998). The ethylene gas signal transduction pathway: a molecular perspective. A n n u Rev Genet 32, 227-254. Jonak, C , and Hirt, H . (2002). Glycogen synthase kinase 3 / S H A G G Y - l i k e kinases i n plants: an emerging family with novel functions. Trends i n Plant Science 7,457-461. Jonak, C , Okresz, L . , Bogre, L . , and Hirt, H . (2002). Complexity, cross talk and integration o f plant M A P kinase signalling. Curr Opin Plant B i o l 5,415-424. Jonak, C , Kiegerl, S., Ligterink, W., Barker, P.J., Huskisson, N.S., and Hirt, H . (1996). Stress signaling i n plants: a mitogen-activated protein kinase pathway is activated b y cold and drought. Proc Natl A c a d Sci U S A 93, 11274-11279.  151  Jouannic, S., Hamal, A . , Leprince, A.S., Tregear, J.W., Kreis, M . , and Henry, Y . (1999). Characterisation o f novel plant genes encoding M E K K 7 S T E 1 1 and RAF-related protein kinases. Gene 229, 171-181. Kaplinsky, N.J., and Barton, M . K . (2004). Plant biology. Plant acupuncture: sticking PINs i n the right places. Science 306, 822-823. Kieber, J . J . , Rothenberg, M . , Roman, G . , Feldmann, K . A . , and Ecker, J.R. (1993). C T R 1 , a negative regulator o f the ethylene response pathway i n Arabidopsis, encodes a member o f the raf family o f protein kinases. C e l l 72,427-441. Kiegerl, S., Cardinale, F., Siligan, C , Gross, A . , Baudouin, E . , Liwosz, A . , Eklof, S., Till, S., Bogre, L . , Hirt, H . , and Meskiene, I. (2000). SEVIKK, a mitogen-activated protein kinase ( M A P K ) kinase, is a specific activator o f the salt stress-induced M A P K , S I M K . Plant C e l l 12, 2247-2258. Knetsch, M . , Wang, M . , Snaar-Jagalska, B . E . , and Heimovaara-Dijkstra, S. (1996). Abscisic acid induces mitogen-activated protein kinase activation i n barley aleurone protoplasts. Plant C e l l 8, 1061-1067. Kovtun, Y . , Chiu, W . L . , Zeng, W., and Sheen, J . (1998). Suppression o f auxin signal transduction b y a M A P K cascade i n higher plants. Nature 395, 716-720. Kovtun, Y . , Chiu, W . L . , Tena, G . , and Sheen, J . (2000). Functional analysis o f oxidative stress-activated mitogen-activated protein kinase cascade i n plants. Proc Natl A c a d Sci U S A 97, 2940-2945. Kreps, J . A . , W u , Y . , Chang, H.S., Zhu, T., Wang, X . , and Harper, J . F . (2002). Transcriptome changes for Arabidopsis i n response to salt, osmotic, and cold stress. Plant Physiol 130, 2129-2141. Krysan, P.J., Jester, P.J., Gottwald, J.R., and Sussman, M . R . (2002). A n Arabidopsis mitogen-activated protein kinase kinase kinase gene family encodes essential positive regulators o f cytokinesis. Plant C e l l 14, 1109-1120. Kyriakis, J . M . , App, H . , Zhang, X . F . , Banerjee, P., Brautigan, D . L . , Rapp, U.R., and Avruch, J . (1992). Raf-1 activates M A P kinase-kinase. Nature 358,417-421. Lange-Carter, C . A . , Pleiman, C M . , Gardner, A . M . , Blumer, K . J . , and Johnson, G . L . (1993). A divergence i n the M A P kinase regulatory network defined b y M E K kinase and Raf. Science 260, 315-319. Larkin, J . C . , Brown, M . L . , and Schiefelbein, J . (2003). H o w do cells know what they want to be when they grow up? Lessons from epidermal patterning i n Arabidopsis. A n n u Rev Plant B i o l 54,403-430. Larkin, J . C , Marks, M . D . , Nadeau, J . , and Sack, F . (1997). Epidermal cell fate and patterning i n leaves. Plant C e l l 9,1109-1120. Laskowski, M . J . , Williams, M . E . , Nusbaum, H . C , and Sussex, I . M . (1995). Formation o f lateral root meristems is a two-stage process. Development 121, 3303-3310. Le Deunff, E . , Davoine, C , Le Dantec, C , Billard, J.P., and Huault, C . (2004). Oxidative burst and expression o f germin/oxo genes during wounding o f ryegrass leaf blades: comparison with senescence o f leaf sheaths. Plant J 38,421-431. Lescot, M . , Dehais, P., Thijs, G . , Marchal, K . , Moreau, Y . , Van de Peer, Y . , Rouze, P., and Rombauts, S. (2002). P l a n t C A R E , a database o f plant cis-acting regulatory elements and a portal to tools for i n silico analysis o f promoter sequences. Nucleic Acids Res 30, 325-327.  152  Leung, J . , and Giraudat, J . (1998). Abscisic acid signal transduction. A n n u Rev Plant Physiol Plant M o l B i o l 49, 199-222. Leung, J . , Merlot, S., and Giraudat, J . (1997). The Arabidopsis ABSCISIC ACID INSENSITIVE 2 (ABI2) and ABI1 genes encode redandant protein phosphatases 2 C involved in abscisic acid signal transduction. Plant C e l l 9, 759-771. Leung, J . , Bouvier-Durand, M . , Morris, P . - C , Guerrier, D., Chefdor, F., and Giraudat, J . (1994). Arabidopsis ABA-response gene A B I 1 : features o f a calcium-modulated protein phosphatase. Science 264, 1448-1452. L i , J . , and Assmann, S.M. (1996). A n abscisic acid-activated and calcium-independent protein kinase from guard cells of fava bean. Plant C e l l 8, 2359-2368. L i , J . , Lee, Y.R., and Assmann, S.M. (1998). Guard cells possess a calcium-dependent protein kinase that phosphorylates the K A T 1 potassium channel. Plant Physiol 116, 785-795. L i , J . , Wang, X . Q . , Watson, M . B . , and Assmann, S.M. (2000). Regulation o f abscisic acidinduced stomatal closure and anion channels by guard cell A A P K kinase. Science 287, 300-303. Ligterink, W., and Hirt, H . (2001). Mitogen-activated protein ( M A P ) kinase pathways i n plants: versatile signaling tools. Int Rev Cytol 201, 209-275. L i u , J . , Ishitani, M . , Halfter, U . , Kim, C.S., and Zhu, J . K . (2000). The Arabidopsis thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance. Proc Natl A c a d Sci U S A 97, 3730-3734. L i u , S., and Zhu, J . K . (1997). A n Arabidopsis mutant that requires increased calcium for potassium nutrition and salt tolerance. P N A S 94,14960-14964. L i u , S., and Zhu, J . K . (1998). A calcium sensor homolog required for plant salt tolerance. Science 280, 1943-1945. L i u , Y . , and Zhang, S. (2004). Phosphorylation o f 1-aminocyclopropane-l-carboxylic acid synthase by M P K 6 , a stress-responsive mitogen-activated protein kinase, induces ethylene biosynthesis i n Arabidopsis. Plant C e l l 16, 3386-3399. L i u , Y . , Jin, H . , Yang, K . Y . , Kim, C . Y . , Baker, B., and Zhang, S. (2003). Interaction between two mitogen-activated protein kinases during tobacco defense signaling. Plant J 34,149-160. Luan, S. (2002). Signalling drought in guard cells. Plant C e l l Environ 25,229-237. Lukowitz, W., Roeder, A., Parmenter, D., and Somerville, C . (2004). A M A P K K kinase gene regulates extra-embryonic cell fate in Arabidopsis. C e l l 116,109-119. MacRobbie, E . A . C . (1997). Signalling in guard cells and regulation of ion channel activity. J E x p B o t 48,515-528. Malamy, J . E . , and Benfey, P.N. (1997). Organization and cell differentiation in lateral roots of Arabidopsis thaliana. Development 124, 33-44. Malamy, J . E . , and Ryan, K.S. (2001). Environmental regulation o f lateral root initiation i n Arabidopsis. Plant Physiol 127, 899-909. M A P K Group. (2002). Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends Plant Sci 7, 301-308. Matsuoka, D., Nanmori, T., Sato, K . , Fukami, Y., Kikkawa, U . , and Yasuda, T. (2002). Activation o f A t M E K l , an Arabidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis o f active mutants expressed in E. coli and generation o f the active form in stress response in seedlings. Plant J 29, 637-647.  153  Mayrose, M . , Bonshtien, A . , and Sessa, G . (2004). L e M P K 3 is a mitogen-activated protein kinase with dual specificity induced during tomato defense and wounding responses. J B i o l Chem 279, 14819-14827. McNellis, T . W . , Mudgett, M . B . , L i , K . , Aoyama, T . , Horvath, D., Chua, N . H . , and Staskawicz, B . J . (1998). Glucocorticoid-inducible expression o f a bacterial avirulence gene i n transgenic Arabidopsis induces hypersensitive cell death. Plant J 14, 247-257. Mehdy, M . C . (1994). Active oxygen species i n plant defense against pathogens. Plant Physiol 105, 467-472. Melaragno, J . E . , Mehrotra, B., and Coleman, A . W . (1993). Relationship between endopolyploidy and cell size i n epidermal tissue of Arabidopsis. Plant C e l l 5, 16611668. Melikant, B., Giuliani, C , Halbmayer-Watzina, S., Limmongkon, A . , Heberle-Bors, E . , and Wilson, C . (2004). The Arabidopsis thaliana M E K A t M K K 6 activates the M A P kinase A t M P K l 3 . F E B S Lett 576, 5-8. Meskiene, I., Baudouin, E . , Schweighofer, A . , Liwosz, A . , Jonak, C , Rodriguez, P . L . , Jelinek, H . , and Hirt, H . (2003). Stress-induced protein phosphatase 2 C is a negative regulator o f a mitogen-activated protein kinase. J B i o l Chem 278, 18945-18952. Meyer, K . , Leube, M.P., and Grill, E . (1994). A protein phosphatase 2 C involved i n A B A signal transduction in Arabidopsis thaliana. Science 264, 1452-1455. Meyers, B.C., Lee, D.K., V u , T . H . , Tej, S.S., Edberg, S.B., Matvienko, M . , and Tindell, L . D . (2004a). Arabidopsis M P S S . an online resource for quantitative expression analysis. Plant Physiol 135, 801-813. Meyers, B . C . , Tej, S.S., V u , T . H . , Haudenschild, C D . , Agrawal, V . , Edberg, S.B., Ghazal, H . , and Decola, S. (2004b). The use o f M P S S for whole-genome transcriptional analysis i n Arabidopsis. Genome Res 14, 1641-1653. Mikolajczyk, M . , Awotunde, O.S., Muszynska, G . , Klessig, D.F., and Dobrowolska, G . (2000). Osmotic stress induces rapid activation o f a salicylic acid-induced protein kinase and a homolog o f protein kinase A S K 1 i n tobacco cells. Plant C e l l 12, 165178. Mizoguchi, T., Ichimura, K . , and Shinozaki, K . (1997). Environmental stress response i n plants: the role of mitogen-activated protein kinases. Trends Biotechnol 15,15-19. Mizoguchi, T . , Irie, K . , Hirayama, T . , Hayashida, N . , Yamaguchi-Shinozaki, K . , Matsumoto, K . , and Shinozaki, K . (1996). A gene encoding a mitogen-activated protein kinase kinase kinase is induced simultaneously with genes for a mitogenactivated protein kinase and an S6 ribosomal protein kinase b y touch, cold, and water stress i n Arabidopsis thaliana. Proc Natl A c a d Sci U S A 93, 765-769. Mizoguchi, T . , Ichimura, K . , Irie, K . , Morris, P., Giraudat, J . , Matsumoto, K . , and Shinozaki, K . (1998). Identification o f a possible M A P kinase cascade i n Arabidopsis thaliana based on pairwise yeast two-hybrid analysis and functional complementation tests o f yeast mutants. F E B S Lett 437, 56-60. Mizoguchi, T . , Gotoh, Y . , Nishida, E . , Yamaguchi-Shinozaki, K . , Hayashida, N., Iwasaki, T . , Kamada, H . , and Shinozaki, K . (1994). Characterization o f two c D N A s that encode M A P kinase homologues i n Arabidopsis thaliana and analysis o f the possible role o f auxin i n activating such kinase activities i n cultured cells. Plant J 5,111-122.  154  Morris, P . C . (2001). M A P kinase signal transduction pathways i n plants. N e w Phytol 151, 67-89. Morris, P . C , Guerrier, D., Leung, J . , and Giraudat, J . (1997). Cloning and characterisation o f M E K 1 , an Arabidopsis gene encoding a homologue o f M A P kinase kinase. Plant M o l B i o l 35, 1057-1064. Mustilli, A . C , Merlot, S., Vavasseur, A . , Fenzi, F., and Giraudat, J . (2002). Arabidopsis OST1 protein kinase mediates the regulation o f stomatal aperture b y abscisic acid and acts upstream o f reactive oxygen species production. Plant C e l l 14, 3089-3099. Nadeau, J.A., and Sack, F.D. (2002a). Control o f stomatal distribution on the Arabidopsis leaf surface. Science 296, 1697-1700. Nadeau, J.A., and Sack, F . D . (2002b). The Arabidopsis Book. (Rockville, M D : American Society o f Plant Biologists). Nadeau, J . A . , and Sack, F . D . (2003). Stomatal development: cross talk puts mouths i n place. Trends Plant S c i 8, 294-299. Nakagami, H . , Kiegerl, S., and Hirt, H . (2004). O M T K 1 , a novel M A P K K K , channels oxidative stress signaling through direct M A P K interaction. J B i o l Chem 279, 2695926966. Nakamura, R . L . , McKendree, W . L . , Jr., Hirsch, R . E . , Sedbrook, J . C , Gaber, R.F., and Sussman, M . R . (1995). Expression o f an Arabidopsis potassium channel gene i n guard cells. Plant Physiol 109, 371-374. Nakashima, M . , Hirano, K . , Nakashima, S., Banno, H . , Nishihama, R., and Machida, Y . (1998). The expression pattern o f the gene for N P K 1 protein kinase related to mitogen-activated protein kinase kinase kinase ( M A P K K K ) i n a tobacco plant: correlation with cell proliferation. Plant C e l l Physiol 39, 690-700. Nishihama, R., and Machida, Y . (2000). The M A P kinase cascade that includes M A P K K K related protein kinase N P K 1 controls a mitotic proces i n plant cells. Results Probl C e l l Differ 27, 119-130. Nishihama, R., Banno, H . , Kawahara, E . , Irie, K . , and Machida, Y . (1997). Possible involvement o f differential splicing i n regulation o f the activity o f Arabidopsis A N P 1 that is related to mitogen-activated protein kinase kinase kinases ( M A P K K K s ) . Plant J 12, 39-48. Nishihama, R., Ishikawa, M . , Araki, S., Soyano, T . , Asada, T., and Machida, Y . (2001). The N P K 1 mitogen-activated protein kinase kinase kinase is a regulator o f cell-plate formation i n plant cytokinesis. Genes D e v 15, 352-363. Nuhse, T.S., Peck, S . C , Hirt, H . , and Boiler, T . (2000). Microbial elicitors induce activation and dual phosphorylation o f the Arabidopsis thaliana M A P K 6. J B i o l Chem 275, 7521-7526. Ouaked, F., Rozhon, W . , Lecourieux, D., and Hirt, H . (2003). A M A P K pathway mediates ethylene signaling i n plants. Embo J 22, 1282-1288. Outlaw. (2003). Integration o f cellular and physiological functions o f guard cells. Crit Rev Plant S c i 22, 503-529. Outlaw, W . H . , Jr. (1983). Current concepts on the role o f potassium i n stomatal movements. Physiol Plant 59, 302-311. Pages, G . , Lenormand, P., L'Allemain, G . , Chambard, J . C , Meloche, S., and Pouyssegur, J . (1993). Mitogen-activated protein kinases p42mapk and p44mapk are required for fibroblast proliferation. Proc Natl A c a d S c i U S A 90, 8319-8323.  155  Pandey, S., and Assmann, S . M . (2004). The Arabidopsis putative G protein-coupled receptor G C R 1 interacts with the G protein alpha subunit G P A 1 and regulates abscisic acid signaling. Plant C e l l 16, 1616-1632. Pearson, G . , Robinson, F., Beers Gibson, T . , X u , B . E . , Karandikar, M . , Berman, K . , and Cobb, M . H . (2001). Mitogen-activated protein ( M A P ) kinase pathways: regulation and physiological functions. Endocr R e v 22, 153-183. Pei, Z . M . , Kuchitsu, K . , Ward, J . M . , Schwarz, M . , and Schroeder, J.I. (1997). Differential abscisic acid regulation o f guard cell slow anion channels i n Arabidopsis wild-type and a b i l and abi2 mutants. Plant C e l l 9,409-423. Petersen, M . , Brodersen, P., Naested, H . , Andreasson, E . , Lindhart, U . , Johansen, B., Nielsen, H.B., Lacy, M . , Austin, M . J . , Parker, J . E . , Sharma, S.B., Klessig, D.F., Martienssen, R., Mattsson, O., Jensen, A . B . , and Mundy, J . (2000). Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. C e l l 103, 1111-1120. Piao, H . L . , L i m , J . H . , K i m , S.J., Cheong, G.W., and Hwang, I. (2001). Constitutive overexpression o f A t G S K l induces N a C l stress responses i n the absence o f N a C l stress and results i n enhanced N a C l tolerance i n Arabidopsis. Plant J 27, 305-314. Pollok, B.A., and Heim, R. (1999). U s i n g G F P i n FRET-based applications. Trends C e l l B i o l 9, 57-60. Poovaiah, B.W., Friedmann, M . , Reddy, A.S., and Rhee, J . K . (1988). A u x i n induced delay o f abscission: The involvement o f calcium ions and protein phosphorylation i n bean plants. Physiol Plant 73, 354-359. Prestamo, G . , Testillano, P.S., Vicente, O., Gonzalez-Melendi, P., Coronado, M . J . , Wilson, C , Heberle-Bors, E . , and Risueno, M . C . (1999). Ultrastructural distribution o f a M A P kinase and transcripts i n quiescent and cycling plant cells and pollen grains. J C e l l Sci 112 ( Pt 7), 1065-1076. Rashotte, A . M . , Brady, S.R., Reed, R . C . , Ante, S.J., and Muday, G . K . (2000). Basipetal auxin transport is required for gravitropism i n roots o f Arabidopsis. Plant Physiol 122, 481-490. Ray, L . B . , and Sturgill, T . W . (1987). Rapid stimulation b y insulin o f a serine/threonine kinase i n 3T3-L1 adipocytes that phosphorylates microtubule-associated protein 2 i n vitro. Proc Natl A c a d Sci U S A 84, 1502-1506. Raz, V . , and Fluhr, R. (1993). Ethylene signal is transduced v i a protein phosphorylation events i n plants. Plant C e l l 5, 523-530. Reddy, A.S., Chengappa, S., and Poovaiah, B.W. (1987). Auxin-regulated changes i n protein phosphorylation i n pea epicotyls. Biochem Biophys Res Commun 144, 944950. Reed, R . C . , Brady, S.R., and Muday, G . K . (1998). Inhibition o f auxin movement from the shoot into the root inhibits lateral root development i n Arabidopsis. Plant Physiol 118, 1369-1378. Roelfsema, M.R., Levchenko, V . , and Hedrich, R. (2004). A B A depolarizes guard cells i n intact plants, through a transient activation o f R- and S-type anion channels. Plant J 37, 578-588. Rossomando, A . J . , Payne, D . M . , Weber, M . J . , and Sturgill, T . W . (1989). Evidence that pp42, a major tyrosine kinase target protein, is a mitogen-activated serine/threonine protein kinase. Proc Natl A c a d Sci U S A 86, 6940-6943.  156  Sakai, T., Takahashi, Y., and Nagata, T. (1996). Analysis o f the promoter o f the auxininducible gene, parC, of tobacco. Plant C e l l Physiol 37, 906-913. Sambrook, J., Fritsch, E., and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd edition. (New Y o r k : C o l d Spring Harbor Laboratory Press). Samuel, M.A., and Ellis, B.E. (2002). Double jeopardy: both overexpression and suppression o f a redox-activated plant mitogen-activated protein kinase render tobacco plants ozone sensitive. Plant C e l l 14,2059-2069. Samuel, M.A., Miles, G.P., and Ellis, B.E. (2000). Ozone treatment rapidly activates M A P kinase signalling i n plants. Plant J 22, 367-376. Schraudner, M., Langebartels, C , and Sandermann, H., Jr. (1996). Plant defence systems and ozone. Biochem Soc Trans 24,456-461. Schroeder, J.L, Kwak, J.M., and Allen, G.J. (2001a). Guard cell abscisic acid signalling and engineering drought hardiness i n plants. Nature 410, 327-330. Schroeder, J.I., Allen, G.J., Hugouvieux, V., Kwak, J.M., and Waner, D. (2001b). Guard cell signal transduction. A n n u Rev Plant Physiol Plant M o l B i o l 52, 627-658.  Seger, R., Ahn, N.G., Posada, J., Munar, E.S., Jensen, A.M., Cooper, J.A., Cobb, M.H., and Krebs, E.G. (1992). Purification and characterization o f mitogen-activated protein kinase activator(s) from epidermal growth factor-stimulated A431 cells. J B i o l Chem 267, 14373-14381. Seo, S., Sano, H., and Ohashi, Y. (1999). Jasmonate-based wound signal transduction requires activation o f W I P K , a tobacco mitogen-activated protein kinase. Plant Cell 11, 289-298. Seo, S., Okamoto, M., Seto, H., Ishizuka, K., Sano, H., and Ohashi, Y. (1995). Tobacco M A P kinase: a possible mediator i n wound signal transduction pathways. Science 270, 1988-1992. Shi, H., and Zhu, J.K. (2002). Regulation o f expression o f the vacuolar Na+/H+ antiporter gene A t N H X l b y salt stress and abscisic acid. Plant M o l B i o l 50, 543-550. Shi, EL, Ishitani, M., Kim, C , and Zhu, J.K. (2000). The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proc Natl A c a d Sci U S A 97, 6896-6901. Shpak, E.D., McAbee, J.M., Pillitteri, L.J., and Torn, K.U. (2005). Stomatal patterning and differentiation b y synergistic interactions o f receptor kinases. Science 309, 290293. Skene, K. (2000). Pattern formation i n cluster roots: Some developmental and evolutionary considerations. A n n Bot-London 85, 901-908. Soyano, T., Nishihama, R., Morikiyo, K., Ishikawa, M., and Machida, Y. (2003). N Q K l / N t M E K l is a M A P K K that acts i n the N P K 1 M A P K K K - m e d i a t e d M A P K cascade and is required for plant cytokinesis. Genes Dev 17, 1055-1067. Stals, EL, and Inze, D. (2001). When plant cells decide to divide. Trends Plant Sci 6, 359364.  Strompen, G., El Kasmi, F., Richter, S., Lukowitz, W., Assaad, F.F., Jurgens, G., and Mayer, TJ. (2002). The Arabidopsis H I N K E L gene encodes a kinesin-related protein involved i n cytokinesis and is expressed i n a cell cycle-dependent manner. Curr B i o l 12, 153-158.  157  Sugimoto, K . , Williamson, R . E . , and Wasteneys, G . O . (2000). N e w techniques enable comparative analysis o f microtubule orientation, wall texture, and growth rate i n intact roots of Arabidopsis. Plant Physiol 124, 1493-1506. Takahashi, Y . , Soyano, T . , Sasabe, M . , and Machida, Y . (2004). A M A P kinase cascade that controls plant cytokinesis. J Biochem (Tokyo) 136, 127-132. Takenaka, K . , Gotoh, Y . , and Nishida, E . (1997). M A P kinase is required for the spindle assembly checkpoint but is dispensable for the normal M phase entry and exit i n Xenopus egg cell cycle extracts. J C e l l B i o l 136, 1091 -1097. Talbott, L . D . , and Zeiger, E . (1998). The role o f sucrose i n guard cell osmoregulation. J E x p Bot 49, 329-337. Tanaka, H . , Ishikawa, M . , Kitamura, S., Takahashi, Y . , Soyano, T., Machida, C , and Machida, Y . (2004). The A t N A C K l / H I N K E L and S T U D / T E T R A S P O R E / A t N A C K 2 genes, which encode functionally redundant kinesins, are essential for cytokinesis i n Arabidopsis. Genes Cells 9, 1199-1211. Teige, M . , Scheikl, E . , Eulgem, T . , Doczi, R., Ichimura, K . , Shinozaki, K . , Dangl, J . L . , and Hirt, H . (2004). The M K K 2 pathway mediates cold and salt stress signaling i n Arabidopsis. M o l C e l l 15,141-152. Tena, G . , Asai, T., Chiu, W . L . , and Sheen, J . (2001). Plant mitogen-activated protein kinase signaling cascades. Curr Opin Plant B i o l 4, 392-400. Thiel, G . , MacRobbie, E . A . , and Blatt, M . R . (1992). Membrane transport i n stomatal guard cells: the importance o f voltage control. J Membr B i o l 126, 1-18. Urao, T . , Yamaguchi-Shinozaki, K . , and Shinozaki, K . (2000). Two-component systems in plant signal transduction. Trends Plant Sci 5, 67-74. Usami, S., Banno, H . , Ito, Y . , Nishihama, R., and Machida, Y . (1995). Cutting activates a 46-kilodalton protein kinase i n plants. Proc Natl A c a d S c i U S A 92, 8660-8664. Van Haute, E . , Joos, H . , Maes, M . , Warren, G . , Van Montagu, M . , and Schell, J . (1983). Intergeneric transfer and exchange recombination o f restriction fragments cloned i n p B R 3 2 2 : a novel strategy for the reversed genetics o f the T i plasmids o f Agrobacterium tumefaciens. Embo J 2, 411-417. von Groll, U . , and Altmann, T . (2001). Stomatal cell biology. Curr Opin Plant B i o l 4, 555560. Von Groll, U . , Berger, D., and Altmann, T . (2002). The subtilisin-like serine protease S D D 1 mediates cell-to-cell signaling during Arabidopsis stomatal development. Plant C e l l 14, 1527-1539. Voronin, V . , Touraev, A . , Kieft, H . , van Lammeren, A . A . , Heberle-Bors, E . , and Wilson, C . (2001). Temporal and tissue-specific expression o f the tobacco ntf4 M A P kinase. Plant M o l B i o l 45, 679-689. Voronin, V . , Aionesei, T . , Limmongkon, A . , Barinova, I., Touraev, A . , Lauriere, C , Coronado, M . J . , Testillano, P.S., Risueno, M . C , Heberle-Bors, E . , and Wilson, C (2004). The M A P kinase kinase N t M E K 2 is involved i n tobacco pollen germination. F E B S Lett 560, 86-90.  158  Wang, X . Q . , Ullah, H . , Jones, A . M . , and Assmann, S . M . (2001). G protein regulation o f ion channels and abscisic acid signaling i n Arabidopsis guard cells. Science 292, 2070-2072. Widmann, C . , Gibson, S., Jarpe, M . B . , and Johnson, G . L . (1999). Mitogen-activated protein kinase: conservation o f a three-kinase module from yeast to human. Physiol Rev 79, 143-180. Wilkinson, S., and Davies, W . J . (2002). A B A - b a s e d chemical signalling: the co-ordination o f responses to stress i n plants. Plant C e l l Environ 25, 195-210. Wilson, C , Eller, N . , Gartner, A., Vicente, O., and Heberle-Bors, E . (1993). Isolation and characterization o f a tobacco c D N A clone encoding a putative M A P kinase. Plant M o l B i o l 23, 543-551. Wilson, C , Voronin, V . , Touraev, A . , Vicente, O., and Heberle-Bors, E . (1997). A developmentally regulated M A P kinase activated b y hydration i n tobacco pollen. Plant C e l l 9,2093-2100. W u , S.J., Ding, L . , and Zhu, J . K . (1996). SOS1, a genetic locus essential for salt tolerance and potassium acquisition. Plant C e l l 8, 617-627. Yahraus, T . , Chandra, S., Legendre, L . , and Low, P.S. (1995). Evidence for a mechanically induced oxidative burst. Plant Physiol 109, 1259-1266. Yang, C . Y . , Spielman, M . , Coles, J.P., L i , Y . , Ghelani, S., Bourdon, V., Brown, R . C . , Lemmon, B . E . , Scott, R.J., and Dickinson, H . G . (2003). T E T R A S P O R E encodes a kinesin required for male meiotic cytokinesis in Arabidopsis. Plant J 34,229-240. Yang, K . Y . , L i u , Y . , and Zhang, S. (2001). Activation o f a mitogen-activated protein kinase pathway is involved i n disease resistance i n tobacco. Proc Natl A c a d Sci U S A 98, 741-746. Yang, M . , and Sack, F.D. (1995). The too many mouths and four lips mutations affect stomatal production i n Arabidopsis. Plant C e l l 7, 2227-2239. Yuasa, T . , Ichimura, K . , Mizoguchi, T . , and Shinozaki, K . (2001). Oxidative stress activates A T M P K 6 , an Arabidopsis homologue o f M A P kinase. Plant C e l l Physiol 42,1012-1016. Zhang, B., Ramonell, K . , Somerville, S., and Stacey, G . (2002). Characterization o f early, chitin-induced gene expression i n Arabidopsis. M o l Plant Microbe Interact 15, 963970. Zhang, S., and Klessig, D.F. (1998). The tobacco wounding-activated mitogen-activated protein kinase is encoded b y S I P K . Proc Natl A c a d Sci U S A 95, 7225-7230. Zhang, S., and Klessig, D . F . (2001). M A P K cascades i n plant defense signaling. Trends Plant Sci 6, 520-527. Zhang, S.Q., and Outlaw, W . H . , Jr. (2001a). Abscisic acid introduced into the transpiration stream accumulates i n the guard-cell apoplast and causes stomatal closure. Plant C e l l Environ 24, 1045-1054.  159  Zhang, S.Q., and Outlaw, W . H . , Jr. (2001b). Gradual long-term water stress results i n abscisic acid accumulation i n the guard-cell symplast and guard-cell apoplast o f intact Vicia faba L. plants. J Plant Growth Regul 20, 300-307. Zhou, F., Menke, F . L . , Yoshioka, K . , Moder, W . , Shirano, Y . , and Klessig, D.F. (2004). H i g h humidity suppresses ssi4-mediated cell death and disease resistance upstream o f M A P kinase activation, H 2 0 2 production and defense gene expression. Plant J 39, 920-932. Zhu, J . - K . (2000). Genetic analysis o f plant salt tolerance using Arabidopsis. Plant Physiol 124, 941-948. Zhu, J . - K . (2001a). C e l l signaling under salt, water and cold stresses. Curr Opin Plant B i o l 4, 401-406. Zhu, J . - K . (2001b). Plant salt tolerance. Trends i n Plant Science 6, 66-71. Zwerger, K . , and Hirt, H . (2001). Recent advances i n plant M A P kinase signalling. B i o l Chem 382, 1123-1131.  160  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099814/manifest

Comment

Related Items