Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Plexin expression in axotomized rubrospinal and facial motoneurons Spinelli, Egidio 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-0323.pdf [ 15.45MB ]
Metadata
JSON: 831-1.0099802.json
JSON-LD: 831-1.0099802-ld.json
RDF/XML (Pretty): 831-1.0099802-rdf.xml
RDF/JSON: 831-1.0099802-rdf.json
Turtle: 831-1.0099802-turtle.txt
N-Triples: 831-1.0099802-rdf-ntriples.txt
Original Record: 831-1.0099802-source.json
Full Text
831-1.0099802-fulltext.txt
Citation
831-1.0099802.ris

Full Text

PLEXIN EXPRESSION IN AXOTOMIZED RUBROSPINAL AND FACIAL MOTONEURONS  by EGIDIO SPINELLI B.Sc, The University of British Columbia, 1999  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES  (Zoology)  THE UNIVERSITY OF BRITISH COLUMBIA April 2005  © Egidio Spinelli, 2005  ABSTRACT  Injuries to the central nervous system (CNS) are characterized by the inability of most axons to regenerate to their respective target tissues leading to permanent loss of sensory/motor function, while following peripheral nervous system (PNS) injuries, regeneration can occur. The failure of CNS nerve regeneration is partly attributed to the inhibitory nature of the CNS injury site. Apart from their roles in nervous system patterning during development, inhibitory guidance molecules present at the spinal cord injury site, such as semaphorins, have been suggested to contribute to the inhibitory nature of the CNS injury site. Secreted class 3 semaphorins bind to a receptor complex composed of neuropilins, the ligand binding subunit, and plexins, the signal transducing component. Although injured CNS and PNS neurons continue to express neuropilins, little is known about the expression patterns of plexins by axotomized neurons. This study analyzes class-A plexins and plexin-Bl expression in injured CNS (rubrospinal) and PNS (facial) neurons. Plexin mRNA and protein expression were analyzed over a period of 2 weeks in injured mouse rubrospinal and facial motoneurons after cervical spinal cord hemisection and facial nerve resection, respectively. In rubrospinal neurons, Plxn-Al mRNA and protein and Plxn-A4 mRNA expression did not differ between injured and uninjured neurons while Plxn-A2 mRNA expression increased in injured compared to uninjured rubrospinal neurons. Plxn-A3 mRNA was not detected in rubrospinal neurons. In facial motoneurons, Plxn-Al, -A3 and -A4 mRNA expression was higher in injured compared to uninjured motoneurons, although Plxn-Al protein expression did not change between injured and uninjured neurons. Plxn-A2 mRNA, on the other hand, decreased in injured facial motoneurons. Plxn-Bl mRNA expression was absent from both rubrospinal and facial neurons. Therefore, most class-A plexins continue to be expressed in both rubrospinal and facial motoneurons after injury, suggesting that these neuronal populations will remain responsive to semaphorins present at the injury site. This study provides a crucial step in understanding how injured neurons may respond to semaphorins and which components of the semaphorin response; either plexins, neuropilins or semaphorins, may be targeted to promote successful CNS nerve regeneration.  ii  TABLE OF CONTENTS ABSTRACT  ii  TABLE OF CONTENTS  iii  LIST OF TABLES  v  LIST OF FIGURES  vi  ABBREVIATIONS  viii  ACKNOWLEDGEMENTS  xi  CHAPTER I -INTRODUCTION  1  Overview of Nervous System Injuries  1  Semaphorins Neuropilins Plexins Semaphorins in Development Neuropilins in Development Plexins in Development Signalling through Plexins Class A plexins: Actin Remodeling Class A plexins: Microtubule Remodeling Class B plexins: Actin Remodeling Integrins and Substrate Adhesion Lipid Rafts and MAPK Semaphorins, Plexins and Neuropilins in Injury Plexin Interactions with other Receptors Off-track LI VEGFR Immune System Hypotheses CHAPTER II - MATERIALS AND METHODS Animal Care Facial Nerve Axotomy Rubrospinal Tract Lesion Tissue Preparation In Situ Hybridization Immunohistochemistry Western Blotting Quantification of In Situ Hybridization Signals Quantification of Immunohistochemical Signals iii  3 4 6 9 12 13 15 16 18 19 20 21 22 26 26 29 29 31 32 34 34 34 34 34 36 37 38 39 39  CHAPTER III - RESULTS  41  Plexin-Al mRNA and Protein Expression in Axotomized Rubrospinal Neurons Plexin-A2, -A3 and -A4 mRNA Expression in Axotomized Rubrospinal Neurons Plexin-Al mRNA and Protein Expression in Axotomized Facial Motoneurons Plexin-A2, -A3 and -A4 mRNA Expression in Axotomized Facial Motoneurons Plexin-Bl mRNA Expression in Rubrospinal and Facial Motoneurons Neuropilin-2 Protein Expression in Axotomized Facial Motoneurons CHAPTER TV - CONLCUSIONS AND DISCUSSION Overview Implications of Plexin Expression in Non-Regenerating Rubrospinal Neurons Implications of Plexin Expression in Regenerating Facial Motoneurons Implications of Neuropilin-2 Expression in Regenerating Facial Motoneurons Plexin and Their Interactions with Other Molecules on Injured Motoneurons Final Remarks BIBLIOGRAPHY  41 41 50 59 68 68 73 73 75 82 88 89 90 92  iv  LIST OF TABLES Table 1. Class 3 semaphorin receptor complexes. Table 2. Semaphorins and all known receptor interactions. Table 3. Expression patterns of Sema3A, Nrp-1 and -2, all class A plexins and Plxn-Bl in injured rubrospinal and facial neurons, 7 and 14 days after axotomy  LIST OF FIGURES Figure 1. The semaphorin family of guidance molecules Figure 2. Phylogram comparing extracellular domains of Plexins A1-A4, B l , CI and D l with MET and Sema3A Figure 3. Plexin interactions with semaphorins Figure 4. Intracellular signalling pathways through plexins Figure 5. Plexin interactions with other receptors Figure 6. Surgical procedures (spinal cord hemisection and facial nerve resection) Figure 7. Plxn-Al mRNA expression in injured rubrospinal neurons at 3, 7 and 14 days after cervical spinal cord lesion Figure 8. Plxn-Al protein expression in injured rubrospinal neurons at 3, 7 and 14 days after cervical spinal cord lesion Figure 9. Plxn-A2 mRNA expression in injured rubrospinal neurons at 3, 7 and 14 days after cervical spinal cord lesion Figure 10. Scatter plot of Plxn-A2 mRNA signal in injured compared to uninjured rubrospinal neurons, 14 days after spinal cord lesion Figure 11. Plxn-A3 mRNA expression in injured rubrospinal neurons at 7 and 14 days after cervical spinal cord lesion Figure 12. Plxn-A4 mRNA expression in injured rubrospinal neurons at 7 and 14 days after cervical spinal cord lesion Figure 13. Plxn-Al mRNA expression in injured facial motoneurons at 1, 3, 7 and 14 days after facial nerve resection Figure 14. Plxn-Al protein expression in injured facial motoneurons at 1, 3, 7 and 14 days after facial nerve resection Figure 15. Plxn-A2 mRNA expression in injured facial motoneurons at 1, 3, 7 and 14 days after facial nerve resection Figure 16. Plxn-A3 mRNA expression in injured facial motoneurons at 1, 3, 7 and 14 days after facial nerve resection and crush Figure 17. Plxn-A4 mRNA expression in injured facial motoneurons at 1, 3, 7 and 14 days after facial nerve resection  vi  Figure 18. Plxn-Al, -A2, -A3, -A4 mRNA sense probe ISH Figure 19. Plxn-Bl mRNA expression in injured rubrospinal and facial neurons as well as expression in cerebellum Figure 20. Nrp-2 protein expression in injured facial motoneurons at 1, 3, 7 and 14 days after facial nerve resection Figure 21. Semaphorin and semaphorin receptor expression at the spinal cord injury site and on axotomized rubrospinal neurons, respectively. Figure 22. Semaphorin and semaphorin receptor expression at the distal stump of the facial nerve and site and axotomized facial motoneurons, respectively.  vn  ABBREVIATIONS ADF - actin depolymerizing factor BDNF - brain derived neurotrophic factor C3/4 - cervical 3/4 level cGMP - guanosine 3 , 5-cyclic monophosphate 1  CAM - cell adhesion molecule CDC - cinnamyl-3,4-dihydroxy-a-cyanocinnamate Cdc42 - cell division cycle 42 homolog Cdk5 - cyclin dependant kinase 5 CIITA - major histocompatibility complex (MHC) class II-specific transactivator CNS - central nervous system CRAM - CRMP3-associated molecule CRIB domain - Cdc42/Racl-binding domain CRMP-2 - collaspin response mediator protein 2 CSPG - chondroitin sulphate proteoglycans DEPC - diethyl pyrocarbonate DRG - dorsal root ganglion eIF-4E - eukaryotic initiation factor-4E eIF-4EBPl - eIF-4E binding protein-1 F-actin - fibrillar actin Fes - feline sarcoma oncogene GAP-43 - growth associated protein-43 GDNF - glial cell line-derived neurotrophic factor GEFs.- guanine nucleotide-exchange factors GPI-linked - glycophosphatydil inositol-linked GSK-3o//3 - glycogen synthase kinase 3 a and /3 GTP- guanosine triphosphate IHC - immunohistochemistry ISH - in situ hybridization LARG - /eukemia-associated i?hoGEF LIM kinase - C. elegans Lin-11, rat Isl-1, and C. elegans Mec-3 motif containing kinase LOT - lateral olfactory tract viii  MAG - myelin associated glycoprotein MAPK - mitogen activated protein kinase MBP - myelin basic protein MICAL - molecule interacting with CasL MET - "metastasis" proto-oncogene Mnk-1 - MAP kinase-interacting kinase mRNA - messenger ribosomal nucleic acid NT-3 - neurotrophin-3 NG2 - chondroitin sulfate proteoglycan 2 NGF - nerve growth factor Nrp-1 -neuropilin-1 Nrp-2 - neuropilin-2 OTK - off-track (tyrosine kinase) PAK - p21-activated kinase PBS - phosphate buffered saline PDZ domain - (PSD-95ADlg/ZO-l) domain Plxn-Al - plexin-Al Plxn-A2 - plexin-A2 Plxn-A3 - plexin-A3 Plxn-A4 - plexin-A4 Plxn-Bl -plexin-Bl Plexin-B2 - plexin-B2 Plexin-B3 - plexin-B3 Plexin-Cl -plexin-Cl Plexin-Dl -plexin-Dl PLP - proteolipid protein PNS - peripheral nervous system Racl - ras-related C3 botulinum toxin substrate 1 RAG - regeneration associated gene Rho - rhotekin RIP A buffer - radio immunoprecipitation buffer Rndl - "round" 1 Sema3 A - semaphorin 3 A ix  Sema3B - semaphorin 3B Sema3C - semaphorin 3C Sema3D -• semaphorin 3D Sema3E - semaphorin 3E Sema3F - semaphorin 3F Sema4A - semaphorin 4A Sema4B - semaphorin 4B Sema4C - semaphorin 4C Sema4D -- semaphorin 4D Sema4F - semaphorin 4F Sema7A - semaphorin 7A Src kinase - sarcoma non-receptor tyrosine kinase Trk - tropomyosin receptor kinase VESPR - viral encoded semaphorin protein receptor VEGFR2 - vascular endothelial growth factor receptor 2 VEGF - vascular endothelial growth factor TIM2 - T-cell, immunoglobulin domain and mucin domain (TIM) protein  x  ACKNOWLEDGEMENTS  The completion of this thesis and the data contained within would not have been possible if not for the continuous encouragement, invaluable insight and immesurable help received from all members of the Tetzlaff lab, present and past, especially: Dr. Lowell McPhail, Loren Oshipock, Ward Plunet and Dr. Jackie Vanderluit. They have my sincerest gratitude. As well, I would be remiss to not thank all other members of the Tetzlaff lab, including: Carmen Chan, Koroush Khodarahmi, Clarrie Lam, Dr. Jie Liu, Dave Stirling and Joshua Teh, as well as members of the Steeves lab: Dr. Chris McBride and Dr. John McGraw, who have in innumerable ways, helped in bringing this thesis to its completion. Thank you to Dr. Wolfram Tetzlaff, my supervisor, for accepting me in his laboratory and for keeping a promise of 2 years to take me as his student. His class was the inspiration for pursuing research and if not for that, this manuscript would not exist. From him, I have learned that science requires above all passion and perseverance, passion for the discovery and perseverance for the processes that go into discovery. My greatest appreciation is reserved for my father, mother and sister. Any expression of gratitude will not sufficiently do justice to their tremendous support and encouragement during these many years. Grazie pertutto.  $5WfcKt£>Qt.L1Zo  Finally, this thesis is dedicated to the many mice and rats which were killed for my experiments and all other animals that have given their lives for the advancement of science.  xi  CHAPTER I: INTRODUCTION  -Nervous system injuriesSpinal cord injuries often result in an irreversible loss of motor as well as sensory function. Although an attempt is initially made by severed axons to re-grow into the injury site, it is abortive as growth cones of injured axons are not able to cross the injury site and thus, are unable to reconnect with their target tissues (Plunet et al., 2002). Injuries to the peripheral nervous system (PNS) on the other hand, allow for successful regeneration of injured neurons into and past the injury site, resulting in reconnection with the appropriate targets and thus restoration of sensory as well motor function (Fu and Gordon, 1997; Terenghi, 1999). Although peripheral regeneration is by no means completely successful (Fu and Gordon, 1997), it is far more extensive than regeneration in the CNS. Thus, understanding the underlying factors that account for differences in regenerative capacity of the two systems is of paramount importance in promoting functional recovery after CNS injury. A variety of factors have been suggested to account for the differences in the regenerative capacity of the two systems, among which differences in intrinsic ability of PNS vs. CNS neurons to regenerate, coupled with differences of injured PNS vs. CNS axonal environments (Tetzlaff et al., 1991; Tetzlaff et al., 1994, Fernandes and Tetzlaff, 2000; Plunet et al., 2002). Increases in expression of regeneration associated genes (RAGs) such as: growth associated protein-43 (GAP-43), actin and tubulin (specifically the T a l isotype) have been associated with a successful regenerative response of injured neurons (Tetzlaff et al., 1991; Plunet et al., 2002). GAP-43 and Tal tubulin mRNA expression were compared between facial motoneurons (PNS) and rubrospinal neurons (CNS). Injured facial motoneurons are able to successfully regenerate, resulting in functional recovery of muscle movement (Moran and Graeber, 2004); while rubrospinal neurons fail to cross the spinal cord injury site (Barron et al., 1989), leading to permanent deficits in motor function (Midha et al., 1987). Although both neuronal populations show increases in RAGs after injury, the increase between rubrospinal and facial motoneurons is variable. For example, GAP-43 mRNA expression is 8 to 60-fold higher in injured facial motoneurons compared to 10 to 20-fold in injured rubrospinal neurons (Tetzlaff et al., 1991) suggesting a greater regenerative response of facial motoneurons. As well, by 2 weeks postinjury, gene expression was downregulated in rubrospinal neurons, while expression was maintained in facial motoneurons (Tetzlaff et al., 1991). These studies indicate that while injured 1  CNS neurons initially attempt a regenerative response, this response is transient. However, the loss of RAG expression in rubrospinal neurons can be reversed by direct application of trophic factors to the cell bodies even up to 1 year post-injury (Kwon et al., 2002a), showing that injured CNS neurons retain some regenerative potential, if stimulated. The difference in the composition of injured CNS vs. PNS axonal environments plays a role in the disparate regenerative capacities between the two nervous systems. PNS injuries result in the invasion of the injury site with macrophages that in turn, stimulate the proliferation of Schwann cells, the resident glial cell in the PNS. Schwann cell proliferation lasts for approximately 2 weeks post injury during which time, bands of Bimgner are formed which act as conduits for regenerating growth cones (Fu and Gordon, 1997; Terenghi, 1999). Apart from their roles as structural guides for regenerating growth cones (Son and Thompson, 1995), Schwann cells secrete a host of neurotrophic factors (e.g. brain-derived neurotrophic factor: BDNF; neutrophin-3: NT-3; glial cell line-derived neurotrophic factor: GDNF), molecules which have been shown to support neuronal regeneration, and which aid in axonal regrowth (Fu and Gordon, 1997; Terenghi, 1999). In contrast, CNS injury results in the formation of a glial-fibroblastic scar caused by the invasion of the injury site by a host of cells including fibroblasts, astrocytes, microglial cells and oligodendrocytes (Pasterkamp et al., 2001b; Kwon et al., 2002b). The scar not only acts as a mechanical barrier for regeneration, but also as a source of molecules that have been shown to be inhibitory towards regenerating neurons (McKerracher 2001; Sandvig et al., 2004; Silver and Miller, 2004). These include molecules present on the myelin that normally surrounds axons: Nogo, myelin associated glycoprotein (MAG) and tenascin-R; as well as molecules associated with the cells present in the glial scar: chondroitin sulphate proteoglycans (NG2, neurocan, phosphocan, versican) present on oligodendrocyte precursors; neurocan, phosphocan, brevican present on astrocytes, and NG2 and versican present on meningeal cells (Pasterkamp et al., 2001b; Fawcett et al, 2002; Sandvig et al., 2004). If the damaged CNS environment is replaced with a more favourable one in the form of a PNS graft, some re-growth of CNS neurons into the graft occurs (Richardson et al., 1980; David and Aguayo, 1981; Richardson et al., 1984). This effect can be further enhanced by combining application of trophic factors to the injured neuron cell bodies (Kobayashi et al., 1997; Kwon et al., 2002a). Attempts to block the inhibitory nature of myelin have also met with some success. Application of anti-Nogo antibody IN-1 to the spinal cord injury site resulted in regrowth of some injured CNS neurons as well as recovery of some motor function (Schnell and Schwab, 1990). Similarly, enzymatic cleavage of CSPGs promoted some regeneration and recovery of 2  function after spinal cord injury (Moon et al, 2001; Bradbury et al., 2002). Together, these studies show that although the CNS environment is not in itself growth permissive, modification of the inhibitory environment either by blocking inhibitory molecules, or replacing it with a more growth permissive environment, can promote nerve regeneration as well as functional recovery of CNS neurons. In addition to the traditional myelin and scar-associated inhibitory signals, growth cone guidance molecules are expressed and possibly act as inhibitory cues towards axonal regeneration at the injury site. These molecules act in concert to physical barriers to regeneration and provide another level of inhibition to regeneration. Four families of inhibitory guidance molecules have been identified as having potential roles in nerve injury: the ephrin (Miranda et al., 1999; Bundesen et al., 2003), netrin (Madison et al., 2000), slit (Hagino et al., 2003) and semaphorin (Pasterkamp, 2001b; De Wit et al., 2003) families of guidance molecules. These molecules have in common that 1) they are all involved in the developing nervous system as guidance molecules responsible for the correct wiring of the nervous system and 2) that, with some exceptions; they have been shown to be inhibitory towards growing growth cones. Therefore, it has been hypothesized (Luo et al., 1993) that their re-expression after injury might contribute to the inhibitory nature of the CNS injury site, subsequently presenting regenerating axons from successfully growing into and out of the injury site. - Semaphorins Semaphorins were initially identified for their ability to steer limb bud growth cones in the developing grasshopper nervous system (Kolodkin et al., 1992). Subsequently, semaphorin 3 A (Sema3A), the prototypical member of the semaphorin family, was isolated from chick brain, and shown to cause collapse of chick sensory neurons in vitro (Luo et al., 1993). To date, 25 semaphorin family members have been identified in vertebrates, invertebrates as well as in viruses (Kolodkin et al., 1993; Ensser et al., 1995; Luo et al., 1995; Piischel et al., 1995; Inagaki et al., 1995, Adams et al, 1996; Furuyama et al., 1996, Feiner et al, 1997). They are organized into 8 subclasses according to their structural and phylogenetic relatedness (Mark et al., 1997; Semaphorin Nomenclature Committee, 1999; see Fig. 1). The 8 subclasses are as follows: Class 1 and 2 - invertebrate transmembrane and secreted respectively; Class 3 - vertebrate secreted; Class 4, 5 and 6 - vertebrate transmembrane; Class 7 - vertebrate glycophosphatydil-linked and Class V - viral secreted semaphorins. Although semaphorin subclasses are subdivided by the presence of a class-specific carboxy-terminal domain (secreted, transmembrane or GPI-linked; Mark et al., 1997), all semaphorins share a conserved extracellular 500 amino acid "Sema" 3  domain (Kolodkin et al., 1993; Winberg et al., 1998). Dimerization of this domain, specifically of a 70 amino-acid stretch, is necessary for the collapsing activity (Koppel et al., 1997; Klostermann et al., 1997; Koppel et al., 1998; Takahashi et al., 1998) and binding affinities of semaphorins to their receptors (Feiner et al., 1997); while other semaphorin structures potentiate semaphorin action (Koppel et al., 1997). The presence of secreted as well as membrane bound forms of semaphorins, suggest that semaphorins may be able to act as local as well as longdistance guidance cues (Mark et a., 1997).  Figure 1. The semaphorin family  •  Fiqure Legend  <  Ig loop Plexin Repeat  Plasma Membrane Class 1 S e m a 1a Semalb  Sema domain Class 2 S e m a 2a  Class 3 Sema 3 A Sema3B Sema3C Sema3D Sema3E Sema3F  Class 4 Sema4A Sema4B Sema4C Sema4D Sema4E Sema4F Sema4G  Class 5 SemaSA SemaSB  LI  Class 6 SemaSA SemaSB SemaSC Sema6D  Class 7 Sema7A  Class V SemaVA SemavB  Basic tail  •  • EJ  Thrombospondin repeats Intracellular domain GPI anchor  - Neuropilins Semaphorin mediated in vitro growth cone collapse and repulsion was found to be mediated through direct association of secreted class 3 semaphorins to neuropilin receptors (Chen et al., 1997; He et al., 1997; Kolodkin et al., 1997). Originally identified as an antigen for an antibody labeling neurons in specific layers of the Xenopus tadpole optic tectum (Takagi et al., 1987; Fujisawa et al., 1989; Takagi et al., 1991), neuropilin-1 (Nrp-1) and neuropilin-2 (Nrp2) form a two-member family of transmembrane proteins found only in vertebrates (Winberg et al., 1998). Neuropilins are expressed in most neuronal populations in some overlapping, but for the most part distinct patterns throughout development (Chen et al., 1997; Kolodkin et al., 1997). Expression of different combinations of neuropilins in neurons can determine the sensitivity of these neurons to secreted semaphorins. While Sema3C, 3D, 3E and 3F can interact with both 4  neuropilins, Sema3A can interact only with Nrp-1 (Chen et al., 1997; Feiner et al., 1997; Takahashi et al., 1998). This explains the ability of Sema3A to repel sensory and sympathetic growth cones, which express only Nrp-1 and both Nrp-1 and Nrp-2 respectively, while Sema3B and 3C are able to repel only sympathetic growth cones (Mark et al., 1997). On the other hand, Nrp-1 is dispensable for Sema3F repelling of superior cervical ganglia and sympathetic axons (both expressing Nrp-1 and Nrp-2) suggesting that neuropilin-2 homodimers form the Sema3F receptors (Giger et al., 1998b).The following interaction patterns have been suggested for neuropilins and their respective ligands: Sema3A exerts its effects by interacting with Nrp-1 homodimers, Sema3C with Nrp-1/2 heterodimers and Sema3F with Nrp-2 homodimers (Chen et al., 1997; Feiner et al., 1997; Takahashi et al., 1998; Giger et al., 1998b; Giger et al., 2000; Table 1). Interestingly, Sema3B and 3C are able to act as antagonists of Sema3A-Nrp-l binding (Takahashi et al, 1998), suggesting that in addition to the combination of neuropilins expressed by a neuron; guidance will depend on the set of semaphorins expressed in the path of a neuron. Furthermore, neuropilins are present in multiple forms as a result of alternative splicing (Chen et al., 1997; Gagnon et al., 2000; Rossignol et al., 2000), pointing to an ever more complex interaction of neuropilins with its ligands.  Table 1. Class 3 semaphorin receptor complexes. Semaphorin  Sema3A  Sema3C  Sema3F  Neuropilin  Nrpl:Nrpl  Nrpl:Nrp2  Nrp2:Nrp2  Plexin  PlxnAl/A2/A3/A4  PlxnAl/A2  PlxnAl/A2/A3  Although neuropilin function-blocking antibodies abrogate semaphorin-induced growth cone collapse (He et al., 1997; Kolodkin et al., 1997), the short 40 amino-acid intracellular domain of neuropilins which does not contain known signaling motifs, is dispensable for signaling (Nakamura et al., 1998; Renzi et al, 1999; Takahashi et al., 1999). As well, sensory axons expressing Nrp-1 respond to Sema3A (Messersmith et al., 1995; Reza et al., 1999), while Sema3C which also binds to Nrp-1, has no effect on these neurons (Piischel et al., 1996). These results suggested that neuropilins were essential but not sufficient to transduce semaphorin signals (Nakamura et al., 1998; Rohm et al., 2000a) and pointed to the presence of other  5  components of the semaphorin receptor complex that could transduce semaphorin signals in the neuron. -PlexinsThe second signal transducing component of the semaphorin receptor complex was identified when a viral semaphorin (A39R) was found to bind to viral semaphorin-receptor (VESPR) homologous to a family of transmembrane proteins known as plexins (Plxn(s)) (Comeau et al., 1998). Subsequently, a study in Drosophila identified DPlexA as the binding partner for transmembrane invertebrate Semala (Winberg et al., 1998). Loss of function mutants showed guidance defects in both CNS as well as peripheral neuron projections to muscles, similar to Semala loss of function mutants (Winberg et al., 1998). Originally identified as B2 in the same screen of the Xenopus optic tectum identifying neuropilins (Takagi et al., 1987), PlxnA l was found to be expressed on neurons of the inner plexiform layer of the retina (Ohta et al., 1992) and to be able to mediate Ca dependent homophilic cell adhesion (Ohta et al., 1995). 2+  Plexins and neuropilins appear to interact in vivo as Sema3 A treatment of chick DRG neurons results in Nrp-1 and Plxn-Al aggregation and subsequent collapse of growth cones (Takahashi et al., 1999). Plexins form a family of large (-200 KDa) glycosylated single-pass transmembrane proteins containing a 500 aa semaphorin sequence as well as cystein-rich Met related sequences (MRS) shared by their ligands, semaphorins, and by the MET family of scatter factor receptors (Kameyama et al., 1996a,b; Maestrini et al, 1996; Winberg et al., 1998; Artigiani et al., 1999, Fig. 2). A phylogenetic comparison of the extracellular protein sequences (containing the Sema domain) of mouse plexin, MET and Sema3A protein shows that each protein can be grouped according to the class it is in. For example, while all class-A plexins are closely related, Class-B, -C and - D plexins all form separate protein families (Fig.2). Interestingly, it appears that within the class-A plexins, Plxn-Al and -A3, and Plxn-A2 and -A4, are the most closely related. The nine vertebrate plexins found to date have been divided into four sub-groups according to similarities in their structural domains (Tamagnone et al., 1999; see Fig. 3). PlexinA family members do not bind directly to their ligands, the secreted class 3 semaphorins, but form a receptor complex with neuropilins, the ligand binding partner, and through neuropilins, they are able to transduce the semaphorin signal, as well as increase the affinity of semaphorins to neuropilins (Takahashi et al., 1999; Tamagnone et al., 1999). Both Nrp-1 and Nrp-2 (aO and bO isoforms) are able to interact with Plxn-A1~A3 and Plxn-Bl (Tamagnone et al., 1999;  6  Figure 2. Phylogram comparing extracellular domains of Plexins A1-A4, B l , CI and D l with MET and Sema3A mouse protein sequences I I •—I  |  Plexin-A1  I  Plexin-A3 •  Plexin A2  I  Plexin-A4 Plexin-BI  • '  Plexin-C 1 Plexin-Dl  I  Met Sema3A  This phylogenetic tree was created by comparing the extracellular domains of the following mouse proteins: PlxnA 1 - A 4 , - B l , -CI and - D l , the M E T scatter factor receptor; as well as the entire Sema3A protein. The evolutionary relatedness of protein sequences is shown. Class-A plexins appear to cluster together, while Plexin-Bl, -CI and - D l all cluster separately. For this tree, the extracellular domain for each protein sequence was determined using an online version of TMbase (Hofrnann and Stoffel, 1993) and multiple sequences were subsequently aligned and compared for phylogenetic relatedness using an online version of ClustalW (Chenna et al., 2003).  Figure 3. Plexin interactions with semaphorins Class 3  Class 4  Class 7  (e.g. S e m a 3 A , 3 C , 3 F )  (e.g. S e m a 4 D )  (e.g. S e m a 7 A & V A ) Plasma Membrane  JL Figure Legend lg loop  D Neuropilin-1 Neuropilin-2  Basic tail Sema domain Plexin repeat IPT7TIG domain GPI anchor  Plasma Membrane Plexin-A1 Plexin-A2 Plexin-A3 Plexin-A4  Plexin-BI Plexin-B2  Plexin-C1  Plexin-B3  7  Plexin-D1  0  CUB domain  e  FV/VII domain  0 •  MAM domain SEX/PLEX domain! Possible cleavage site  Rohm et al., 2000a). In comparison, some plexins, such as Plxn-Bs and Plxn-C can bind directly to class 4 and 7 semaphorins respectively (Tamagnone et al., 1999; see Fig. 3). In invertebrates, plexins interact directly with semaphorins and the absence of invertebrate neuropilins suggests plexins maybe the ancestral semaphorin receptors (Winberg et al., 1998). Class-A plexins are necessary for the formation of a functional receptor complex for secreted class 3 semaphorins. Specifically, the intracellular domain of plexins, which is highly conserved among all plexin family members (Maestrini et al., 1996; Winberg et al., 1998; Rohm et al., 2000a), is necessary to transduce semaphorin signals to intracellular pathways. The normally repulsive response of chick, mouse and Xenopus DRG neurons to a source of Sema3A is attenuated when these neurons are induced to express a Plxn-Al protein lacking an intracellular domain (Takahashi et al., 1999; Tamagnone et al, 1999: Rohm et al., 2000a). Plexin intracellular domains contain conserved sequences which are necessary for interactions with downstream signaling molecules (Rhom et al., 2000b; Vikis et al., 2000; Zanata et al., 2002). Unlike their distant relatives, the MET growth factor receptors, plexins lack tyrosine kinase activity (Ohta et al., 1995; Maestrini et al., 1996), although the intracellular domain is tyrosine phosphorylated suggesting an association with tyrosine kinases (Tamagnone et al., 1999). In the unbound state, where semaphorins do not interact with the neuropilin-plexin receptor complex, the plexin-sema domain inhibits plexin activity, a block which is released upon binding of semaphorin, resulting in plexin receptor aggregation and phosphorylation (Takahashi et al., 2001). As mentioned above, the presence of different combinations of neuropilins determine whether a specific class 3 semaphorin will be able to exert their effects on neurons. Specificity of the receptor complex for class 3 semaphorins may become more selective if different combinations of neuropilins and class A plexins are able to bind different class 3 semaphorins. As an example, while Sema3A will bind to a Nrp-1 :Plxn-Al :Plxn-A2 complex, Sema3C will interact with a Nrp-1 :Nrp-2:Plxn-A2 but not a Nrp-1 :Nrp-2:Plxn-Al complex (Rohm et al, 2000a). Also, Sema3F will signal through a Nrp-2, but not a Nrp-1 containing receptor complex (Takahashi et al., 2001; see Table 1). Recent crystallographic analyses have shown that a semaphorin receptor complex consists of plexins, neuropilins and semaphorins interacting in a 2:2:2 ratio (Antipenko et al., 2003) which coupled with the many neuropilin splice variants which exist (Chen et al., 1997; Gagnon et al., 2000; Rossignol et al., 2000), hints at the tremendous diversity of possible semaphorin-receptor configurations. Furthermore, this would suggest the response of a neuron to a semaphorin may depend on the different pleximneuropilin 8  combinations present on the neurons. In addition to their function in the semaphorin receptor complex, plexins may be able to induce cellular responses on their own, as has been shown by repulsion of endothelial cells by Plxn-A3 expressed in adjacent mesenchymal cells (Tamagnone etal., 1999). -Semaphorins in developmentThe expression patterns of semaphorins in the developing and adult nervous system strongly suggest their importance in the guidance of growing axons leading to the correct organization of the nervous system. Semaphorin expression is high during development, and is seen in distinct but overlapping patterns (Luo et al., 1995; Wright et al., 1995; Adams et al., 1996; Puschel et al., 1995, 1996; Feiner et al., 1997; Giger et al., 1998b; Chilton and Guthrie, 2003). After birth, semaphorin expression drops in most areas, although it is maintained in 1) structures associated with plasticity and synaptic reorganization (including the hippocampus, cortex, cerebellum along with the visual and olfactory systems), and 2) in subpopulations of cranial and spinal motoneurons including the facial and sciatic motoneurons (Giger et al., 1996; Shepherd et al., 1996; Mark et al., 1997; Catalano et al., 1998; Giger et al., 1998a; WilliamsHogarth et al., 2000). In light of its suggest role as an axonal repellent in vivo, the continued Sema3A expression in adult neurons has been suggested to act to stabilize existing connections and control the formation of new neuronal connections (Giger et al., 1998a). Outside of the developing CNS, semaphorin expression is seen in various structures including the heart and the mesenchyme (future connective tissue and blood vessels) surrounding various bones, although this expression largely disappears by 2 weeks post-birth (Luo et al., 1995; Giger et al., 1996) except in the pineal and pituitary glands (Giger et al., 1998a). In agreement with their expression patterns, semaphorin family members are able to repulse or collapse axons from a wide variety of neuronal populations in vitro. For example, Sema3 A, the prototypical semaphorin member, can induce the repulsion of: hippocampal axons (Chedotal et al., 1998; Pozas et al., 2001), olfactory axons (Kobayashi et al., 1997); most cranial nerve axons (including the facial) but not vestibulocochlear neurons (Kobayashi et al., 1997; Varela-Echavarria et al., 1997), sensory axons (Messersmith et al., 1995; Puschel et al., 1995; He and Tessier-Lavigne, 1997; Kobayashi et al., 1997; Kolodkin et al., 1997; Giger et al., 1998b), spinal motoneuron axons (Varela-Echevarria et al., 1997), and sympathetic axons (Puschel et al., 1995; Giger et al., 1998b; 2000). Cultured embryonic retinal ganglion cells (RGCs) are not repelled by Sema3A (Luo et al., 1993; Varela-Echavarria et al., 1997), although Xenopus RGCs obtained from older animals do collapse in the presence of Sema3A (Campbell et al., 2001). The 9  age of responsiveness to Sema3A is correlated with an increase in Nrp-1 expression on these cells (Campbell et al, 2001), further supporting the importance of Nrp-1 in mediating Sema3A signals. Interestingly, the transmembrane Sema5A is able to repel embryonic RGCs axons (Oster et al., 2003). Sema5A expression around the developing optic nerve as well as its ability to repel RGCs suggests that it may act as an "inhibitory sheath" to ensure that retinal ganglion axons do not stray from their path towards the brain (Oster et al., 2003), pointing to a novel role for a hereto not well understood semaphorin. In the developing spinal cord, Sema3 A plays a pivotal role in segregating sensory neuronal projections into separate zones in a stage-dependent fashion. Sensory axons make stereotypical connections within the spinal cord white matter during development, with the majority of small diameter NGF-sensitive axons projecting into the dorsal and larger diameter NT-3-sensitive sensory axons projecting to the ventral aspects of the spinal cord (Ozaki and Snider, 1997). In the mouse, the large diameter sensory axons reach the spinal grey matter at embryonic day 11 (Ell) and then enter the ventral spinal white matter. Other sensory axons enter into dorsal white matter but do not enter ventral aspects. Sema3 A expression is much higher in the ventral as opposed dorsal spinal cord at this time, placing it at the right time and place to act as a ventral repellent for small-diameter NGF-sensory axons in the rodent (Puschel et al., 1995; Messersmith et al., 1995; Wright et al., 1995; Puschel et al., 1996; Giger et al., 1996) and chick (Shepherd et al., 1996; 1997). While both NGF and NT-3 responsive mouse E12.5 sensory neurons are repulsed by Sema3A-expressing cells (Puschel et al., 1996), NT-3 responsive E14.5 mouse and rat sensory neurons become insensitive to Sema3A (Messershmith et al, 1995; Puschel et al., 1996), agreeing with the view that Sema3A permits growth of NT-3 responsive, but not NGF responsive, sensory axons into the ventral spinal cord. Interestingly, although most DRGs express Nrp-1, only NT-3 responsive neurons are insensitive to Sema3A (Reza et al., 1999), suggesting that a developmental change occurs in these neurons either at the level of the receptor or the signaling pathways. A selective sensitivity to Sema3A also plays a role in the entry of NT-3 sensitive trigeminal axons into the rat dorsal tongue epithelium, an area avoided by NGF, BDNF and GDNF-sensitive axons (Dillon et al., 2004). While all early embryonic (El5) trigeminal axons are repelled by Sema3A-expressing tongue epithelium, only NT-3 responsive axons become insensitive to Sema3A and are able to contact Sema3Aexpressing epithelial cells. This suggests that like in the developing spinal cord, a stagedependent sensitivity to Sema3A can aide in the segregation of different neuronal populations. Interestingly, although Sema 3B, 3C and 3D mRNA are expressed in similar patterns as Sema3 A 10  in the developing spinal cord, they do not repulse sensory axons (Puschel et al., 1996; Shepherd etal., 1997). Although semaphorins have classically been associated with axon repulsion, a growing body of evidence suggests that they may function as attractants as well. For example, although Sema3A has collapsing activity for DRG and sympathetic axons (Puschel et al., 1995; Messersmith et al., 1995) it can act as an attractant for apical dendrites of cortical neurons (Polleux et al., 2000), while Sema3C is an attractant signal for cortical axons (Bagnard et al, 1998). Increased levels of guanosine 3 , 5-cyclic monophosphate (cGMP) in the apical dendrites 1  appear to be responsible for this selective attraction to Sema3A, as Nrp-1 expression is uniform between cortical axons and dendrites (Polleux et al., 2000), although expression of plexins was not determined. Supporting a role for cGMP in playing a role in attraction versus repulsion of semaphorins, the normally chemorepulsive effect of Sema3A on Xenopus growth cones was switched to an attractive one by increasing intracellular guanosine 3 , 5-cyclic monophosphate 1  (cGMP) levels (Song et al., 1998). cGMP has also been shown to play a role in the repulsion of Xenopus retinal axons by Sema3A in vitro (Campbell et al., 2001). Attractive responses for other semaphorins have been reported as well. Sema3B and Sema3C are chemorepulsive for sympathetic axons (Adams et al., 1997; Takahashi et al., 1998) but chemoattractant for olfactory bulb and cortical axons respectively (Bagnard et al., 1998; de Castro et al., 1999). Semaphorin-7A, a GPI-linked semaphorin, is able to enhance growth from a variety of central and peripheral neuronal cell types including neurons from the olfactory epithelium, the olfactory bulb, the cortex and DRGs (Pasterkamp et al., 2003). In the invertebrate grasshopper nervous system, Semala functions as an attractant for mechanoreceptor neurons of the subgenual organ (Wong et al., 1997). These results suggest that semaphorins may have different effects on neurons depending on the neuronal cell type as well as the intracellular state of the neuron. The question of whether the intracellular state of the neurons is set up independently or whether it is determined in response to semaphorin signaling still has to be answered. A role for semaphorins in axon guidance in the developing nervous system is further supported by studies of animals with semaphorin genes which have been genetically inactivated or removed. Two animals lacking the Sema3A gene have been created which show varying degrees of CNS abnormalities (Behar et al., 1996; Taniguchi et al., 1997; reviewed in De Wit and Verhaagen, 2003). Only slight abnormalities in the nervous system are seen in the first animal, including misprojected spinal cord sensory axons, defasciculated trigeminal nerves and 11  misrouted olfactory axons (Behar et al., 1996; Catalano et al., 1998; Ulupinar et al., 1999; Schwarting et al, 2000; White and Behar, 2000; Pozas et al., 2001). Defasciculated DRGs and spinal nerves are seen in these animals early in development, although these errors are eliminated later in the embryo (White and Behar, 2000) suggesting that the mice used by Behar and colleagues are able to compensate for a lack of the Sema3A gene. On the other hand, more severe nervous system abnormalities are seen in the second animal, including defasciculated and misprojected cranial nerves, including the facial nerve (Taniguchi et al, 1997) as well as distorted odour maps in the olfactory bulb, in which Nrp-1 positive neurons project to areas where Sema3 A would normally be expressed and which they would avoid (Taniguchi et al., 2003). Animals from the first mouse line die of severe heart and bone abnormalities, reflecting the expression of Sema3A mRNA in tissues outside of the CNS (Luo et al., 1995; Giger et al., 1996) and supporting a role for Sema3A in vasculogenesis as well as bone formation (Behar et al., 1996). -Neuropilins in developmentExpression patterns of neuropilins, the ligarid-binding subunit of the semaphorin receptor complex, largely mirror the expression of their semaphorin binding partners, either in that they are both expressed in the same neurons or are expressed in adjacent regions. During development, Nrp-1 mRNA and protein is expressed in various neuronal populations, including: cranial neurons, spinal motoneurons, peripheral ganglia, hippocampus and the olfactory system (Kawakami et al., 1996; Kolodkin et al., 1997; Chedotal et al., 1998; Reza et al., 1999). Like Sema3A, expression is lost in most areas after birth, but maintained in the hippocampus, olfactory neurons, DRGs as well as cranial nerves (including the facial nerves) (Kawakami et al., 1996; Pozas et al., 2001; Reza et al., 1999). Outside of the nervous system, Nrp-1 is present in the cardiovascular system and mesenchymal tissue surrounding nerves and blood vessels (Kawakami et al., 1996). Like Sema3A, Nrp-1 expression decreases after birth, although it is maintained in areas associated with high plasticity, such as the hippocampus and olfactory system, as well as in peripheral ganglia (DRG, sympathetic) and cranial nerves (including the facial nerves) (Kawakami et al., 1996; Pozas et al., 2001; Reza et al., 1999). Mice lacking or overexpressing Nrp-1, show defects in many populations of cranial as well as peripheral neurons similar to those found in Sema3A-null mice (Kistukawa et al., 1995; Behar et al., 1996; Kitsukawa et al, 1997; Taniguchi et al, 1997). These include misprojected, defasciculated as well as abnormal spreading of nerve axons, including that of the facial nerve (Kitsukawa et al., 1997; Kawasaki et al., 2002). Animals lacking the Nrp-1 gene also show vascular defects 12  (Kawasaki et al., 1999), which differ from those found in Sema3A-null mice (Behar et al., 1996), reflecting expression of Nrp-1 outside of the nervous system (Kawakami et al., 1996) and the interaction of Nrp-1 with other components in vasculogenesis and angiogenesis (Soker et al, 1998). Nrp-2 mRNA expression is seen in overlapping, but distinct patterns from Nrp-1 during development (Chen et al., 1997; Kolodkin et al., 1997). Like Nrp-1, Nrp-2 expression is seen in various neuronal populations during development. Nrp-2 is found in various cranial nuclei (including facial), peripheral ganglia, cerebellum, hippocampus and the olfactory system (Chen et al., 1997; Kolodkin et al., 1997, Chedotal et al., 1998; Giger et al., 1998b), but unlike Nrp-1, Nrp-2 expression is absent in DRGs late in development (Chen et al., 1997). In non-neuronal tissues, Nrp-2 is detected in developing bones, muscles and other organs, but in contrast to Nrp1, no Nrp-1 signal was seen in the cardiovascular system, blood vessels or capillaries (Chen et al., 1997; Kolodkin et al., 1997; Giger et al., 2000). In the adult nervous system, Nrp-2 expression is maintained in the hippocampus (Pozas et al., 2001) and the vomeronasal organ and the accessory olfactory bulb (Cloutier et al., 2002) as well as other neuronal populations. Mice lacking the Nrp-2 gene show abnormalities in nerves that normally express Nrp-2 as well as in nerves and tracts as well as organs in which both neuropilins are present (Chen et al., 2000; Giger et al., 2000; Cloutier et al., 2002; Walz et al., 2002). Axons of several cranial nerves, including the facial nerve, either are severly defasciculated or misproject, while defects are seen in many other pathways, such as misprojected spinal and hippocampal nerve axons as well as the absence of the anterior and posterior commissures (Chen et al., 2000; Giger et al., 2000; Cloutier et al., 2002; Walz et al., 2002). Many defects seen in animals lacking Nrp-2 are mirrored in animals lacking the Sema3F gene, supporting in vitro evidence that Nrp-2 mediates Sema3F signals (Sahay et al., 2003). Although defects are more severe in these animals than in those lacking the Sema3A gene, many of the axons appear to project into correct areas of the nervous system, pointing to a possible compensatory role from Nrp-1. Mice lacking both neuropilins die early in embryogenesis due to severe vascular impairments, making it difficult to determine the nervous system defects (Takashima et al., 2002). -Plexins in developmentExpression patterns of plexins appear to vary between the four known subfamilies (plexin-A, -B, -C, -D) during development and into adulthood. Developmentally, class A plexins (Plxn-Al~A4) are widely expressed in the CNS neurons and peripheral ganglia (DRGs and sympathetic ganglia) (Maestrini et al., 1996; Takahashi et al., 1999; Tamagnone et al., 1999; 13  Cheng et al., 2001; Murakami et al., 2001; Suto et al., 2003). Expression of all four class-A plexins decreases after birth, although it is maintained in the olfactory system, the hippocampus, as well as in cranial neurons (including facial motoneurons) and peripheral ganglia (Cheng et al., 2001; Murakami et al., 2001; Bagri et al., 2003; Suto et al., 2003). It is interesting to note that of all plexin-As, Plxn-A3 is the most highly and widely expressed throughout development, with Plxn-A2 showing the most restricted expression patterns (Cheng et al., 2001; Murakami et al., 2001; Suto et al., 2003). Although expression overlaps in many areas, some groups of neurons express only certain plexin-As, supporting the view that plexin-mediated effects on a given neuronal population will depend on the complement of plexin-A, and neuropilins, expressed. For example, along with Nrp-1 and -2, mouse embryonic sympathetic ganglia express Plxn-A3 and A4, but not Plxn-Al and -A2 (Giger et al., 1998b; Murakami et al., 2001; Suto et al., 2003). In agreement with this, the normally repulsive effect of Sema3F on mouse sympathetic axons in vitro (Puschel et al., 1995; Giger et al., 1998b) is abolished in sympathetic axons in Plxn-A3 (Cheng et al., 2001) or Nrp-2 (Giger et al., 2000) null mice. This suggests that along with the two neuropilins and Plxn-A4, Plxn-A3 may be necessary to propagate semaphorin signaling in these neurons during development. As well, class A plexins appear to be for the most part, neuronally expressed (Murakami et al., 2001; Suto et al., 2003), although Plxn-Al is also expressed in the developing heart (Toyofuku et al, 2004). A role for plexins in modeling of the developing nervous system is also supported from evidence in mice lacking the Plxn-A3 gene (Cheng et al., 2001; Bagri et al., 2003). In these animals, many cranial nerve projections (including the facial nerve) appear defasciculated, while trigeminal and hippocampal nerve fibres misproject (Cheng et al., 2001). Apart from its guidance effects, Plxn-A3 also mediates the pruning of hippocamapal neurons projections by Sema3A and 3F in vivo (Bagri et al., 2003), a process involving a precisely timed retraction of axons from a temporary target coinciding with expression of Sema3A and 3F mRNA there, and subsequent extension of axons towards a final target lacking Sema3A and 3F expression. The defects seen in the hippocampi of mice lacking the Plxn-A3 gene are similar to those found in Nrp-2 (Chen et al., 2000; Giger et al., 2000; Cloutier et al., 2002; Walz et al., 2002) and Sema3F (Sahay et al., 2003) null mice, providing further evidence for Plxn-A3 and Nrp-2 as the receptor complex for Sema3F in vivo. Despite defects seen in the nervous system of animals lacking the Plxn-A3 gene, axons appear, in general, to project correctly to their targets (Cheng et al., 2001), which suggests a compensatory role for the other class A plexins expressed in the animal. To this end, of the remaining class A plexins, only a Plxn-Al null mouse has been created (Leighton et al., 2001), 14  although, unfortunately, it has not been characterized for nervous system defects. Similarly, a Plxn-Cl knock-mouse is available (Pasterkamp et al., 2003), but information regarding nervous system defects no not yet available. In contrast to the widespread expression of plexin-As in neurons during development (Murakami et al., 2001; Suto et al., 2003), plexin-B family members (Plxn-Bl, -B2, -B3) are expressed in more distinct, non^overlapping patterns and appear in both neuronal and nonneuronal cells during development (Cheng et al., 2001; Worzfeld et al., 2004). Both Plxn-Bl and -B2 mRNA expression is high during development, but becomes undetectable in most neurons after birth and into adulthood (Cheng et al., 2001; Moreau-Fauvarque et al., 2003; Worzlfeld et al., 2004). Plxn-B3 mRNA expression is quite different in that although it is undetectable during development, it increases in most white matter tracts of the CNS after birth (Worzfeld et al., 2004). For example, in the post-natal mouse spinal cord, Plxn-B3 mRNA expression is localized to oligodendrocytes of the spinal cord white matter (Worzfeld et al., 2004). Plxn-B3 mRNA expression overlaps with that of Sema4D (Moreau-Favarque et al., 2003; Worzfeld et al., 2004), suggesting that Sema4D and Plxn-B3 may both mediate signals originating from oligodendrocytes in the adult brain and possibly after CNS injury. Plxn-Dl, the only known member of the plexin-D subfamily (Tamagnone et al., 1999), is also expressed in cranial nerves and peripheral ganglia as well as other regions of the developing mouse nervous system (Cheng et al.,. 2001; Van Der Zwaag et al., 2002). Interestingly, apart from expression in neurons during development, Plxn-Dl mRNA is found in vascular endothelial cells of various structures, suggesting a role for Plxn-Dl in embryonic vasculogenesis as well as neuronal development (Van der Zwaag et al., 2002). Finally the relatively mild nervous system defects seen in animals lacking plexins, neuropilins or semaphorins is in stark contrast with their roles in in vitro guidance of neurons. As previously mentioned, this may well reflect compensation by other plexin, neuropilin or semaphorins which continued to be expressed and animals lacking combinations of these genes need to be examined. -Signaling through PlexinsReorganizations of cytoskeletal elements underlie steering of nerve growth cones in response to an attractive or repulsive guidance cue. Many components make up the cytoskeleton of growth cones, although the actin and microtubule meshworks are two of the most abundant components. Changes in the composition of either or both of these are essential for turning responses towards or away from an attractive or repulsive guidance cue respectively (reviewed in Skaper et al., 2001) and signaling through Sema3A has been shown to affect both actin and 15  microtubule dynamics (Dent et al., 2004). The importance of intracellular signaling pathways in re-growth of injured axons, is underscored by recent studies which show that manipulations of intracellular signaling pathways can increase axon growth either due to regeneration of severed axons or sprouting from pre-existing axons, into and past the spinal cord injury site leading to improvement in motor function (Dergham et al., 2002; Fournier et al., 2003; Pearse et al., 2004). Although still not complete, the intracellular signaling pathways linking semaphorin signaling with changes in the cellular cytoskeleton, as well as other processes, are starting to be understood, and paint a clear picture of how semaphorin induced cytoskeletal remodeling can lead to growth cone guidance before as well as after injury (see Fig. 4). -Class A plexins: Actin remodelingGrowth cones collapse when presented with a source of Sema3A, resulting in an initial loss of fibrillar actin (F-actin) and a subsequent reorganization of microtubules (Fan et al., 1993; Fritsche et al., 1999). F-actin then forms into distinct vacuoles where Sema3A, Nrp-1, Plxn-Al as well as racl, a small guanosine triphosphate (GTP)-binding protein, are all localized, and which are suggested to mediate a Sema3A induced increase in endocytosis (Fournier et al., 2000). These cytoskeletal changes can affect the entire growth cone or can be localized to regions that come into contact with Sema3A (Fan et al., 1993, 1995), agreeing with semaphorin functioning as a localized growth cone guidance cue. Sema3A is able to increase antero-and retrograde transport of vesicles and organelles along the axon (Goshima et al., 1997) suggesting semaphorin signaling effects independent of cytoskeletal remodeling leading to growth cone collapse as well. Monomeric Ras-related GTP-binding proteins (i.e. Cdc42/Racl/RhoA) play prominent roles in changes to the actin-based cytoskeleton and are excellent candidates for semaphorinmediated changes in cell shape and size (Nobes et al., 1995) and by extension, changes in direction of growing axons. Classically, Cdc42 and Racl have been associated with growth cone attraction or growth while RhoA has been associated with repulsion or collapse (Nobes et al., 1995; Hu et al., 2001). In reality, though, it is likely that Cdc42-Racl-Rho act as the convergence point of many signaling pathways which are intimately related in a cycle whereby slight changes in the activity of one molecule may tip the balance towards others (Giniger, 2002). Intracellular signaling involving Ras-related GTP-binding proteins differs between plexin-A and plexin-B subgroups by the type of downstream proteins they interact with. The growth cone collapse response of chick DRGs to class 3 semaphorins signaling through 16  Figure 4. Signalling through plexins Class 3 Secreted Semaphorins  Class-A plexins:  • d Neuropilin-1/2  Plexin-A1~A4  actin depolymerization  crotubule reorganization  plexin-A receptors (Plxn-Al, A2, A3, A4), is mediated in part by the downstream activity of Racl (Jin et al., 1997, Kuhn et al., 1999). This signaling is independent of RhoA and Cdc42 activity and involves Racl interaction with p21-activated kinase (PAK) (Vastrik et al., 1999). Sema3A activated PAK phosphorylates C. elegans Lin-11, rat Isl-1, and C. elegans Mec-3 motif containing kinase (LEVI kinase) which results in cofilin inactivation (Aizawa et al., 2001). During axon outgrowth, cycling of monomeric actin from the trailing edge to the leading edge of F-actin bundles is important for filopodial portrusion (Pantaloni et al., 2001). As an actin depolymerizing factor (ADF), active cofilin can bind the F-actin trailing edge and sever it into its subunits, moving them towards the leading edge and resulting in net F-actin growth (Pantaloni et al., 2001). Sema3A signaling through PAK and LIM kinase leads to a transient increase in inactive cofilin resulting in a remodeling of F-actin bundles (in embryonic chick DRGs) and subsequent collapse of growth cones (Fritsche et al., 1999; Aizawa et al., 2001). A variety of other molecules have been found to mediate class 3 semaphorin induced growth cone collapse. Rndl and RhoD, are two Ras-related family members that bind Plxn-Al and are able to modulate Sema3A-induced cytoskeletal collapse (Rohm et al., 2000b; Zanata et al., 2002). Rndl interaction with Plxn-Al induces growth cone collapse while this association is inhibited by RhoD, although growth cone collapse can occur independently of semaphorin signaling, suggesting the presence of another signal which brings Rndl and Plxn-Al together (Zanata et al., 2002). Fyn, a member of the sarcoma (Src) non-receptor tyrosine kinases, phosphorylates Plxn-Al and -A2 on tyrosine residues upon Sema3A binding to its receptors, and activates cyclin dependant kinase 5 (Cdk5), resulting in mouse and chick growth cone collapse (Sasaki et al., 2002). Src kinases may be responsible for the intracellular tyrosine phosphorylation of plexins shown by Tamagnone and colleagues (1999), although their ability to interact with B-family plexins still needs to be identified. -Class A plexins: Microtubule remodelingA role for a reorganization of microtubules in Sema3 A-induced growth cone collapse, along with actin remodeling, has been shown (Fan et al., 1993; Fritsche et al., 1999). Activation of Cdk5 through Sema3A promotes Fyn activation, leading to phosphorylation of Tau (Sasaki et al., 2002) (a molecule that regulates tubulin dynamics), suggesting that Sema3A signaling through Fyn and Cdk can affect either actin and/or microtubules. Sema3A activates glycogen synthase kinase 3 a and /3 (GSK-3o//3), a serine/threonine kinase, while inhibition of GSK-3o//3 activity prevents Sema3 A growth cone collapse of embryonic chick DRG neurons (Eickholt et al., 2002). Although GSK-3Q//3 is known to influence microtubules dynamics, it also appears to 18  interact with F-actin in the growth cone (Eickholt et al., 2002). Collaspin response mediator protein 2 (CRMP-2) plays a role in Sema3 A-induced growth cone collapse of embryonic chick DRGs as antibody blocking of CRMP-2 significantly reduces Sema3 A-induced growth cone collapse (Goshima et al., 1995). CRMP-2 is the prototypical member of the CRMP protein family (CRMP-1-5; CRAM) (Quinn et al, 1999; Fukada et al., 2000; Inatome et al., 2000). The high levels of CRMP expression in developing neurons, their downregulated expression in adults (Minturn et al., 1995; Quinn et al., 1999), as well as the ability of CRMP-2 to induce axon growth from hippocampal neuron axons in vitro (Inagaki et al., 2001) point to a role in nerve outgrowth. They are able to modulate microtubule dynamics by binding to a and /3-tubulin heterodimers, thereby promoting microtubule assembly (Fukata et al., 2002; Yuasa-Kawada et al, 2003). CRMPs form an intracellular complex with CRMP3-associated molecule (CRAM) and Fes, a tyrosine kinase, as well as other unidentified molecules (Inatome et al., 2000; Mitsui et al, 2002). Semaphorin signaling through Plxn-Al activates Fes, which in turn directly phosphorylates Plxn-Al, CRAM as well as CRMPs (Mitsui et al., 2002), thus providing a novel and crucial link between plexin receptors and modulation of the microtubule cytoskeleton independent of traditional Rho signaling (Arimura et al., 2000). -Class B plexins: Actin remodelingIn contrast, Plxn-Bl interacts directly with GTP bound Racl in a ligand dependent manner in non-neuronal cell lines (Rohm et al., 2000b; Vikis et al., 2000; Driessens et al., 2001). The PlxnBl-Racl interaction appears to be mediated through a Cdc42/RacI-binding (CRIB) domain present only in plexin-B family members and not in plexin-A, C and D (Al, A2, A3, CI Dl) family members, which do not interact bind Racl (Vikis et al., 2000; Driessens et al., 2001). The plexin-B 1-Racl interaction sequesters Racl from its downstream effector, PAK, leading to disassembly of cytoskeletal structures, and enhances interaction of Plxn-Bl with its ligand, Sema4D (Driessens et al., 2001; Vikis et al., 2002). Similarly, Drosophila plexin-B enhances RhoA signaling while inhibiting Rac signaling (Hu et al., 2001). Rho GTP-binding proteins are activated by Rho specific guanine nucleotide-exchange factors (GEFs), which promote Rho activation by catalyzing GTP exchange, resulting in formation of active GTP-bound Rho (Scita et al., 2000). B family plexins (Plxn-Bl, -B2, -B3) can interact with two RhoGEFs: PDZRhoGEF and /eukemia-associated £hoGEF (LARG), through a PDZ (PSD-95/£lg/ZO-l) domain located in the intracellular portion of the receptor (Aurandt et al., 2002; Driessens et al., 2002; Hirotani et al., 2002; Perrot et al., 2002; Swiercz et al., 2002). Sema4D binding to Plxn-Bl leads to receptor clustering and activation of constitutively bound PDZ-RhoGEF/LARG 19 \  resulting in RhoA activity and actin disassembly (Aurandt et al., 2002; Driessens et al., 2002; Perrot et al., 2002; Swiercz et al., 2002). Both PDZ-RhoGEF and signaling is required for activation of Sema4D-mediated cell collapse through B family plexins in various cell lines as well as embryonic rat hippocampal and chick retinal ganglion neurons (Aurandt et al., 2002; Driessens et al., 2002; Hirotani et al., 2002; Perrot et al., 2002; Swiercz et al., 2002). Signaling through PDZ-RhoGEF does not appear to be required in Sema3A induced collapse of embryonic rat hippocampal neurons (Swiercz et al., 2002). Rndl promotes PDZ-RhoGEF interaction with Plxn-Bl in a Sema4D dependent manner, lading to activation of RhoA (Oinuma et al., 2003), which could lead to modulation of actin dynamics. Interestingly, unlike the plexin-Al-Rndl interaction, which can occur in absence of ligand binding, Sema4D binding is needed to recruit Rndl to Plxn-Bl. -Integrins and substrate adhesionAlong with disruption of the actin and microtubule meshwork, signaling through class A and B plexins can result in loss of substrate adhesion, resulting in actin-dependent growth cone collapse. Sema3A stimulates production of 12(S)-hydroxyeicosatetraenic acid; a product of arachidonic acid metabolism, leading to a loss of substrate adhesion in rat embryonic DRG growth cones (Mikule et al., 2002). Sema4D signaling through Plxn-Bl also negatively regulates integrin-mediated adhesion resulting in a rapid dispersal of components of the focal adhesion complex resulting in a collapsed morphology of a mouse (3T3) cell line (Barberis et al., 2004). Interestingly, Sema7A-mediated outgrowth of mouse olfactory bulb neurons appears to be independent of the Plxn-Cl receptor while signaling through 81 -integrins plays a role (Pasterkamp et al., 2003), further providing evidence for the involvement of integrin-mediated adhesion and semaphorin signaling. The intracellular domains of Plxn-A3 and A4 can directly interact with molecule interacting with CasL (MICAL) and MICAL inhibition attenuates Sema3A-mediated embryonic rat DRG growth cones (Terman et al., 2002). MICALs form a family of proteins related to flavoprotein monoxygenases; purported to be able to catalyze the oxidation of proteins, among which is actin which can lead to the dissassembly and a collapse of the actin meshwork (Milzani et al., 1997). Furthermore, the similarity in neuronal aberrations of Drosophila mutants lacking the MICAL gene to Plxn-A and SemalA, suggests the role of MICAL in semaphorin-mediated patterning of the nervous system during development (Terman et al., 2002). MICALs are also implicated in integrin-dependent cell migration, as CasL, which interacts with MICAL (Suzuki  20  et al., 2002), is suggested to localize to focal adhesion complexes and lead to substrate adhesion and subsequent actin-dependent growth cone collapse (Terman et al., 2002). -Lipid rafts and MAPKSemaphorin-induced growth cone collapse and steering can also involve signaling through a mitogen activated protein kinase (MAPK) signaling pathway, independent or possibly dependent on Ras-related GTP binding proteins. Sema3A-induced repulsive growth cone steering of Xenopus growth cones in vitro is abolished when lipid rafts are disrupted, leading to a partial loss of intracellular p42/p44 MAPK (Guirland et al., 2004). Lipid rafts are regions of plasma membrane unique in their high concentration of cholesterol and sphingolipids, which are thought to act as cellular platforms whereby various signaling components can associate and affect downstream signaling pathways (Paratcha and lbanez, 2002). To this end, exposure of Xenopus growth cones to Sema3A in vitro stimulates an association of Nrp-1 to lipid rafts (Guirland et al., 2004), reminiscent of the previously mentioned colocalization of Sema3A, Nrp1, Plxn-Al and racl to intracellular vacuoles in response to Sema3A signaling (Fournier et al., 2001). LI, a cell adhesion molecule that interacts with semaphorins (Castellani et al., 2000; see below), are also localized to lipid rafts (Nakai and Kamiguchi, 2002), allowing it to come into close apposition with neuropilins and possibly plexins. Furthermore, expression of neuronal growth inhibitory molecules such as netrin receptors (Guirland et al., 2004), ephrin receptors (Gauthier and Robbins, 2003) and MAG receptors: Nogo receptor, p75 and ganglioside GTlb (Vinson et al., 2003), all localize to lipid rafts in neurons, suggesting that targeting of lipid rafts may aide in overcoming the inhibition of nerve regeneration after injury. Finally, the increase in intracellular p42/p44 MAPK after Sema3A-induced growth cone turning of Xenopus growth cones in vitro activates MAP kinase-interacting kinase (Mnk-1) (Campbell and Holt, 2003). Mnk-1 forms a complex with the translational regulators, eukaryotic initiation factor-4E (eIF-4E) and eIF-4E binding protein-1 (eIF-4EBPl), which regulates the initiation of protein translation in the growth cone (Pyronnet et al., 1999; Waskiewicz et al., 1999). This may account for the increase in protein synthesis at the growth cone shown to be necessary for collapse of Xenopus retinal growth cones by Sema3A in vitro (Campbell and Holt, 2001) and suggests that in addition to semaphorin-induced changes in the actin and microtubule support structures of cells, novel signaling mechanisms leading to growth cone steering may be present.  21  -Semaphorins, plexins, neuropilins and neuronal injuryThree lines of evidence point to a possible role for plexins as mediators of semaphorin inhibitory signals after nerve injury. Firstly, plexins are a necessary component of the semaphorin receptor complex, through their interaction with the neuropilin receptors or on their own. Secondly, multiple signaling pathways have been identified connecting plexin receptors with modulations in cytoskeletal elements necessary to affect steering of growth cones. Finally, the developmental expression patterns of plexins, neuropilins and semaphorins, as well as nervous system defects in animals lacking these genes, point to an ability of plexins to transduce growth-inhibitory semaphorin signals in neurons in vivo and in vitro. This suggests that semaphorins and their receptors may play a role in the failure of nerve regeneration in vivo. Spinal cord lesions result in an invasion of the injury site by fibroblasts of meningeal origin, which along with astrocytes, contribute to the formation of an astro-gliotic scar that acts as a barrier to nerve growth (Frisen et al., 1998). In vitro, fibroblasts derivedfromrat meninges express Sema3A, 3B, 3C, 3E and 3F mRNA and Sema3 A protein produced by these fibroblasts retains growth cone collapsing activity (Niclou et al., 2003). After a spinal cord transection and contusion injuries, fibroblasts which invade the rat spinal cord injury site express mRNA for almost all of the secreted class 3 semaphorins: Sema3A, 3B, 3C, 3E and 3F, as well as Sema3 A protein (Pasterkamp et al., 1999; Pasterkamp et al., 2001a; De Winter et al., 2002; Lindholm et al., 2004). Sema3A mRNA expressing fibroblasts can proliferate in the CNS scar site (Pasterkamp et al., 1999), resulting in the presence of semaphorin signal in the scar site as early as 6 days and up to 2 months post-spinal cord transection (Pasterkamp et al., 2001a). Descending fibers are unable to enter the rostral border of the semaphorin-positive scar site (De Winter et al., 2002), while ascending sensory fibres halt at the caudal margin of the Sema3A mRNA positive scar site after rat dorsal column transection (Pasterkamp et al., 2001a). Similarly, removal of the olfactory bulb in rats leads to filling of the bulbar cavity with Sema3A mRNA positive fibroblast-like cells which encapsulate Nrp-1 expressing nerve bundles, thus inhibiting their extension into the cavity (Pasterkamp et al., 1998b). Transfection of Sema3A into adult rabbit corneal epithelial cells causes repulsion of regenerating NGF responsive sensory afferents, which after injury, are not able to re-innervate Sema3A expressing areas (Tanelian et al., 1997). Similarly, recent work has shown that in vivo Sema3A expression in rat spinal cord dorsal horn can prevent the spurious sprouting of dorsally terminating small-diameter sensory fibres associated with spinal cord injuries as well as reduce the increased sensitivity to pain responses thought to be associated with inappropriate sprouting (Tang et al., 2004). 22  Sema3A mRNA expression is not as prominent in lesions where successful regeneration of CNS neurons occurs. Axonal regeneration is not successful after a lateral olfactory tract (LOT) transection in adult rats, in comparison to a lesion in neonatal rats where regeneration occurs (Westrum, 1980). Unlike adult LOT lesion, where an increase Sema3A mRNA expressing fibroblasts is associated with regeneration failure, little or no Sema3A mRNA expression is seen at the lesion site after LOT of neonatal rats (Pasterkamp et al., 1999). Similarly, after olfactory nerve transection in adult rats, after which successful regeneration occurs, Sema3A mRNA positive fibroblast-like cells form "string-like" structures in between which Nrp-1 positive axons traversed towards their targets in the olfactory bulb (Pasterkamp et al., 1998b). Sixty days after olfactory nerve transection, Sema3A mRNA expression decreases, while it is maintained up to 60 days after bulbectomy in adult rats, where olfactory neurons do not successfully regenerate (Pasterkamp et al., 1998b). Similarly, lesions of the hippocampus in the rat brain result in a loss of Sema3A, 3C and 3F mRNA which is associated with neuronal regeneration as well as aberrant sprouting (Barnes et al, 2003; Holtmaat et al., 2003). The expression patterns of semaphorins in the scar site as well as the avoidance of semaphorin positive regions by regenerating axons suggest that invasion and proliferation of semaphorin-expressing fibroblasts at the injury site contributes to the inability of semaphorinresponsive neurons to grow into the scar site (De Winter et al., 2002). This view is further supported by evidence that Sema3A mRNA colocalizes with tenascin-C and CSPG, but not with CNS myelin (Pasterkamp et al., 2001a), all known inhibitors of nerve regeneration. Expression of semaphorins at the injury site is not restricted to the secreted class 3 semaphorin-positive fibroblasts. Sema3B mRNA, which had previously been shown to be expressed by Schwann cells (Puschel et al., 1996), was seen in Schwann cells along with fibroblasts that had invaded the spinal cord injury site after a thoracic spinal cord lesion (De Winter et al., 2002). Sema4D protein expression is upregulated in oligodendrocyte cell bodies and myelin proximally and distally to the spinal cord injury site after a lower thoracic spinal cord lesion in mice (MoreauFauvarque et al., 2003). The colocalization of Sema4D along with Nogo-A and myelin associated glycoprotein (MAG) in myelin extracts, suggests that Sema4D may play a role as a novel myelin associated inhibitor of axonal regeneration (Moreau-Fauvarque et al., 2003). Sema7A mRNA expression is reported to increase following spinal cord injury (Pasterkamp et al., 2003) although the cell type expressing it has not been identified. The post-injury expression of members of the semaphorin receptor complex suggests that injured neurons can remain responsive to secreted class 3 semaphorins present at the injury site. 23  Nrp-1, Nrp-2 mRNA and protein as well as Plxn-Al mRNA expression is maintained or increased in injured CNS neurons (Pasterkamp et al., 1998b; Pasterkamp et al., 1999; Gavazzi et al., 2000; Pasterkamp et al., 2001a; De Winter et al., 2002; Widenfalk et al., 2003; Lindholm et al., 2004). The expression patterns of other class-A plexins, or other plexin family members after injury are currently unknown. After an olfactory nerve lesion, Nrp-1 mRNA positive olfactory neurons enter the olfactory nerve layer and avoid SewaJ^-positive cells in the cribiform plate on their way to a successful re-connection in the glomeruli (Pasterkamp et al., 1998b). In contrast, after bulbectomy, Nrp-1 mRNA positive olfactory neurons become encapsulated by SemaSA mRNA positive cells which are thought to act as a barrier, thereby inhibiting successful olfactory nerve regeneration (Pasterkamp et al., 1998b). Injured mitral and tufted cells maintain Nrp-1 protein expression after LOT lesion (Pasterkamp et al., 1999), while Nrp-1 mRNA and protein expression is also maintained in injured DRG neurons after dorsal rhizotomy (Gavazzi et al., 2000) and spinal cord contusion (Widenfalk et al., 2003). Plxn-Al mRNA along with Nrp-1 mRNA and protein expression was maintained in small and large-diameter DRG neurons which had their CNS processes injured (Gavazzi et al., 2000; Pasterkamp et al., 2001a). Similarly PlxnAl, Nrp-1 and Nrp-2 mRNA expression does not change in injured corticospinal tract neurons after a thoracic spinal cord transection, while expression of Plxn-Al and Nrp-2 mRNA, but not Nrp-1 mRNA was observed in injured rubrospinal neurons up to 56 days-post-lesion (De Winter et al., 2002). The different complement of neuropilins present on corticospinal versus rubrospinal neurons points to a possible varied ability of these two neuronal populations to respond to semaphorins present at the injury site. As injured rubrospinal neurons only express Nrp-2 and Plxn-Al, this would strongly point to a role for Sema3F in mediating inhibitory signals towards injured rubrospinal neurons. Similarly, recent work showing upregulation of Nrp-2 mRNA and protein but not Nrp-1 mRNA in axotomized rat ventral motoneurons, suggests a role for Sema3F in the regeneration response of neurons as well (Lindholm et al., 2004). Apart from their expression in the CNS injury site, semaphorins are expressed along with their receptors in injured CNS motoneurons. Although Sema3A mRNA expression is not found in injured rubrospinal neurons, Sema3C mRNA increases while Sema4F mRNA expression does not change in rat rubrospinal neurons up to 14 days after cervical spinal cord lesion (Oschipok et al., 1999; 2000; 2003). In axotomized ventral motoneurons, an increased Sema3A mRNA and protein expression was seen 3 days post-injury, while Sema4F mRNA increased beginning 3 weeks after injury, while Sema3F mRNA expression was not seen (Lindholm et al., 2004). The increase in Sema3A in axotomized ventral motoneurons has been suggested to act as a guidance 24  cue for regenerating DRGs or incoming axons from the dorsal horn (Lindholm et al., 2004) thus affecting reorganization of afferents after spinal cord injury. After olfactory nerve transection in adult rats, Sema3A mRNA increases in regenerating olfactory neurons in the olfactory epithelium, a function thought to be necessary to direct regenerating axons away from the epithelium (Williams-Hogarth et al., 2000). Similar to the delayed increase in Sema4F mRNA in injured VMNs, Sema4A, 4B, 4C mRNA expression only increases in olfactory neurons 2 weeks post-nerve transection, when these neurons have made connections with their targets in the olfactory bulb (Williams-Hogarth et al., 2000). The delayed expression of various class 4 semaphorins maybe a characteristic of this semaphorin sub-family. In contrast to the increased or maintained semaphorin expression seen in lesioned CNS neurons, axotomized PNS motoneurons, which successfully regenerate, are characterized by a loss of Sema3A mRNA. Resection of the sciatic nerve in the adult rat results in a loss of Sema3A mRNA in sciatic motor motoneurons concomitant with an increase in GAP-43 mRNA expression (Pasterkamp et al., 1998a). Nerve resection injury involves the removal of a small portion of the nerve to inhibit functional reconnection with the target, while after a nerve crush injury the surrounding connective tissue remains intact, thus providing a conduit for reconnection of axons with their appropriate targets. Unlike the permanent loss of Sema3A mRNA seen after a sciatic nerve resection, after a crush injury, Sema3A mRNA expression returned to control levels in sciatic motoneurons by 36 days post-injury; a time correlated with the reconnection of regenerating nerves with their targets (Pasterkamp et al., 1998a). A loss of Sema3A mRNA was seen in injured facial motoneurons, 7 days after a crush injury (Pasterkamp et al., 1998a). In both facial and sciatic motoneurons, Nrp-1 mRNA expression did not change following axotomy, while in DRG neurons, Nrp-1 mRNA expression has been reported to be maintained (Pasterkamp et al., 1998a) or to increase (Gavazzi et al., 2000) after injury of the PNS branch of the DRG. This suggests that injured neurons remain sensitive to Sema3A present along the path of regeneration. The decrease in Sema3A expression in regenerating PNS motoneurons has been suggested to play two roles in the successful reconnection of axons with their targets (Pasterkamp and Verhaagen, 2001). Firstly, Sema3A expression in uninjured adult neurons may serve as an autocrine/paracrine signal which represses spurious sprouting of axons. Downregulation after injury would be beneficial in that, removal of the block to regeneration would allow injured neurons to extend their axons towards their targets. Secondly, an injuryinduced loss of Sema3A may make regenerating neurons more sensitive to Sema3A expressed 25  along the regenerating path, allowing for correct guidance of axons towards their target tissues. In support of this, recent work has shown that Sema3A, 3B, 3C, 3E and 3F but not Sema3D mRNA expression is increased distal to the site of sciatic nerve crush in adult mouse and rat (Scarlato et al., 2003; Ara et al., 2004). Like semaphorin expression by fibroblasts which invade the spinal cord injury site (De Winter et al., 2002), the source of Sema3A and JFmRNA in the distal nerve stump appears to be fibroblasts located in the epineurium and perineurium of the nerve (Scarlato et al., 2003). This has led to the hypothesis that fibroblast cells expressing semaphorins along the regeneration path of PNS nerves, could help guide cells along their path acting as localized guidance cues (Scarlato et al., 2003), a view supported by in vitro evidence showing that although some Sema3A is secreted, the majority of it remains associated with the meningeal fibroblasts, thus providing a local inhibitory signal (Niclou et al., 2003). Finally, Sema3A mRNA has been reported to increase in Schwann cells located at the motor endplates, around the time of successful reconnection of regenerating sciatic neurons with their targets (Pasterkamp and Verhaagen, 2001). Like the return of Sema3A mRNA seen in injured sciatic motoneurons after successful reconnection with their targets (Pasterkamp et al., 1998a), the increased Sema3A mRNA in muscles may prevent further aberrant sprouting of axons after they have synapsed with their targets. -Plexin interactions with other receptorsSemaphorins have been implicated in a variety of other cellular process apart from growth cone guidance of neurons ranging from angiogenesis (Neufeld et al., 2002) and organogenesis (Toyofuku et al., 2004) to tumor metastasis (Trusolino and Comoglio, 2002) and immune regulation (Kumanogoh and Kikutani, 2001). Plexins have been shown to play roles in many of these through their interactions with neuropilins as well as other receptors (see Fig. 5; Table 2). -Off-trackClass 6 semaphorins encompass a family of four transmembrane semaphorins (Sema6A~6D), who's functions or receptors have not yet been clearly understood (Eckhardt et al., 1997; Zhou et al., 1997; Xu et al., 2000; Qu et al., 2002; Toyofuku et al., 2004). Sema6A has been shown to collapse sympathetic but not DRG growth cones (Xu et al., 2000), while both Sema6C and 6D cause the collapse of DRGs (Qu et al., 2002). Recent work has shown that Sema6D plays a role in cardiac morphogenesis in chick and mouse embryos, a process that is mediated through the binding of Sema6D to Plxn-Al (Toyofuku et al., 2004). Plxn-Al mediates Sema6D attraction of endothelial cells from the conotruncal segment or repulsion of endothelial cells from the 26  Figure 5. Plexin interactions with other receptors  Neurons/Cancer  Immune Cells  Vascular System Sema6A Figure Legend  C W m •  to  •  0 0 •  B  Plasma Membrane  Nrp-1/2  • \  •  VEGFR  Plxn-A1 Dendritic Cells  Nrp-1  I-. LI  It  Plxn-A1 ~A4  Neurons/Tumor cells  Plxn-A1 Endothelial Cells  •  '9 ' ° ° P  Sema domain BasicTail Plexin Repeat IP17TIG domain CUB domain FV/VII domain MAM domain SEX/PLEX domain Fibronectin 3 domain Tyrosine kinase domain Tyrosine kinase "dead" domain Intracellular domain  Table 2. Semaphorin and their receptor complexes. Semaphorin Semala/lb (G/D/T/Ce) Sema2a (G/D/Ce) Sema3A Sema3B Sema3C Sema3D Sema3E Sema3F Sema4A Sema4B Sema4C Sema4D (CD 100) Sema4E Sema4F Sema4G Sema5A Sema5B Sema6A Sema6B Sema6C Sema6D Sema7A SEMAVA (Vaccinia/V ariola) SEMAVB (AHV)  Plexin PlxA PlxB? Plxn-Al ' /A2 /A3/A4  Neuropilin  Other OTK  s  Nrp-l/Nrp-1 ' ' ' Nrp-1/Nrp-2 Nrp-1 "/Nrp-2 Nrp-1 ' Nrp-l Nrp-2/Nrp-2'  1 2 4 23  24 25  25  13  23  Ll ,VEGFRl /2 18  28  27  7  Plxn-Al" /A2 /Bl  1,7  14  4  2i  2i  2J  2J  Plxn-Al /A2/A3 24  Tim2  Plxn-Bl  Plxn-B3  2U  y  CD72 /Met  26  Met  Plxn-Al Plxn-Cl VESPR (Plxn-Cl/CD232)  iy  26  OTK/VEGFR2 Integnns  10  y  VESPR (Plxn-Cl/CD232)  21  lb  li  li  References: 1. Chen et al., (1997); 2. He and Tessier-Lavigne, (1997); 3. Kitsukawa et al., (1997); 4. Kolodkin et al., (1997); 5. Comeau et al., (1998); 6. Giger et al., (1998); 7. Takahashi et al., (1998); 8. Winberg et al., (1998); 9. Tamagnone et al., (1999); 10. Tamagnone et a l , (2000); 11. Cheng et a l , (2001); 12. Takahashi et a l , (2001); 13. Winberg et a l , (2001) ; 14. Liu et a l , (2004); 15. Comeau et a l , (1998); 16. Toyofuku et a l , (2004); 17. Pasterkamp et a l , (2003); 18. Castellani et a l , (2002); 19. Kumanogoh et a l , (2000); 20. Kumanogoh et a l , (2002); 21. Giordano et a l , (2002) ; 22. Suto et a l , (2003); 23. Feiner et a l , (1997); 24. Takahashi et a l , (1999); 25. Rohm et a l , (2000); 26. Artigiani et a l , (2004); 27. Soker et a l , (1998); 28. Fuh et a l , (2000)  ventricle through interaction with either vascular endothelial growth factor receptor 2 (VEGFR2) or off-track, respectively (Toyofuku et al., 2004). Of all semaphorin family members, class 6 semaphorins are most closely related to Drosophila Semala and grasshopper Sema I (Eckhardt et al., 1997; Zhou et al, 1997). As Drosophila PlxnA and off-track, a novel receptor tyrosinekinase, mediate Sema la induced axon guidance signals in vitro and in vivo (Winberg et al., 1998; Winberg et al., 2001), this supports the view that plexin-As, along with VEGFR2 and off28  track, may form the receptor complexes for class 6 semaphorins. This.would be in addition to the interaction of plexins with neuropilins and class 3 secreted semaphorins. As well, the injuryinduced expression patterns of class 6 semaphorins still need to be determined. -LlL l is a neuronal cell adhesion molecule (CAM), expressed on axons and growth cones, which is a strong stimulator of neurite outgrowth in vitro (Zhang et al., 2000). Through an interaction with Nrp-1, but not Nrp-2, LI has been shown to play a role in repulsion of corticospinal and DRG axons by Sema3A, but not Sema3B or Sema3E in vitro (Castellani et al., 2000; 2002). In the semaphorin receptor complex, LI appears to be necessary for Nrp-1 endocytosis, which is associated with Sema3A-induced growth cone collapse (Castellani et al., 2004). Interestingly, Plxn-Al was shown to not be necessary for a Sema3A collapse-like response in an in vitro cell line, suggesting that either LI and/or Plxn-Al may be sufficient to transduce Sema3A signals (Castellani et al., 2004). It may well be possible that in some neuronal populations class-A plexins are not needed in order to transduce Sema3 A signals, it is probably the case that both Plxn-Al and LI co-operate to modulate Sema3 A signals. For example, mRNAs for Plxn-Al, Nrp-1 (Pasterkamp et al., 1998a; Gavazzi et al., 2000) and LI mRNA (Zhang et al., 2000) are maintained in injured small and medium diameter sensory neurons, a population which classically responds to Sema3A in vitro (Messersmith et al., 1995; Puschel et al., 1996) and in vivo (Tang et al., 2004).  -VEGFRNrp-1 expression is found in multiple cell types, including neurons (Kawakami et al., 1995), cells in the heart (Herzog et al., 2001), endothelial cells of arteries (Herzog et al, 2001), mesothelial cells (Catalano et al., 2004), various tumour cells (Soker et al., 1998; Bachelder et al., 2003; Rieger et al., 2003; Catalano et al., 2004), while Nrp-2 is expressed in neurons (Chen et al., 1997; Kolodkin et al., 1997), endothelial cells of blood vessels (Herzog et al., 2001), mesothelial cells and tumour cells (Rieger et al., 2003; Catalano et al., 2004). Apart from defects in the nervous system, animals with mutations of either or both neuropilin genes also show abnormalities in cardiovascular and vascular systems (Kistukawa et al., 1995; Kawasaki et al., 1999; Yamada et al., 2001; Takashima et al., 2002) implicating the neuropilins in development of vasculature as well as heart development. Animals with mutations in the Sema3A and Sema3C genes also show similar non-neuronal defects to those of neuropilin-null mice (Behar et al., 1996; Kawasaki et al., 1999; Feiner et al., 2001). This in turn, would suggest the involvement of  29  plexins, as the signal transducing component of the secreted class semaphorin receptor complex, in these various cellular processes. A link between neuropilins and angiogenesis was first made clear when it was found that Nrp-1 interacted with vascular endothelial growth factor receptor-2 (VEGFR2) in vascular endothelial cells and enhanced migration of these cells by vascular endothelial growth factor (Soker et al., 1998). Since then, both neuropilins have been shown to interact with the two VEGF receptors to mediate signaling of VEGF and other VEGF family members (Soker et al., 1998; Fuh et al., 2000; Gluzman-Polotoral 2001; Whitaker et al., 2001). VEGF is a potent angiogenic factor which plays a role in vasculogenesis and angiogenesis during development (Neufeld et al., 2002). Sema3A can compete with VEGF for binding with Nrp-1 in vitro, thus either inhibiting or enhancing endothelial cell migration (Miao et al., 1999; Bagnard et al., 2001) while, VEGF can serve as trophic factor for motor, sensory, and sympathetic neurons in vitro (Oosthuyse et al., 2001; Sondell et al., 1999, 2000). This would create a fairly complex picture of semaphorinVEGF interplay in a spinal cord injury site, where semaphorins are expressed by fibroblasts (De Winter et al., 2002), neuropilins are present in injured neurons as well as endothelial cells of the vasculature (Pasterkamp et al., 1999; Lindholm et al., 2004) and VEGF and its receptors are expressed in non neuronal cells including astrocytes (Skold et al., 2000). Evidence from animals lacking either Nrp-1-Sema signaling or Nrp-1-VEGF signaling shows that, while the Nrp-1-VEGF interaction in endothelial cells is required for angiogenesis, the Nrp-1-Sema interaction is required for development of the nervous system and interaction of both is necessary for cardiovascular development (Gu et al., 2003). Thus, it would appear that cell and ligand-specific neuropilin interactions mediate nervous system development, angiogenesis and cardiovascular development, and may play similar roles in adult nervous system after injury. Whether plexins play a part in any of these processes still needs to be understood. As previously mentioned, Plxn-Al is expressed in endothelial cells of the heart and through an interaction with VEGFR2, can mediate attraction of these cells by Sema6D (Toyofuku et al., 2004). Like the two neuropilins, Plxn-Al and protein as well as Plxn-A2 and Plxn-Bl mRNA are found in various cancer cell lines (Bachelder et al., 2003; Rieger et al., 2003; Catalano et al., 2004). In these cells, the Plxn-Al-neuropilin complex functions in an autocrine loop which inhibits cell migration through Sema3A signaling (Bachelder et al., 2003; Catalano et al., 2004). In in vitro endothelial cells, Sema4D-induced migration is mediated by binding of Sema4D to Plxn-Bl and subsequent activation of Met tyrosine kinase (Giordano et al., 2003; Barberis et al., 30  2004; Conrotto et al., 2004), a hepatocyte growth factor/scatter factor receptor (Artigiani et al., 1999). Recent work has also shown that Plxn-B3, can mediate either Sema5A-induced collapse responses in fibroblast, epithelial or endothelial cells in vitro, or can promote migration of these cells through activation of the Met receptor (Artigiani et al., 2004). These studies suggest that plexins can affect migration of non-neuronal cells, either through formation of a complex with neuropilins and signaling through class 3 semaphorins, through interaction with VEGFRs/Offtrack and class 6 semaphorins, or through interaction with class 4 and 5 semaphorins and Met receptors. -Immune SystemPlexins, neuropilins and semaphorins have all been implicated as modulators of the immune system (Kikutani and Kumanogoh, 2003) in what has been termed an "immunological synapse" (Wulfing and Rupp, 2002). Nrp-1 is expressed on dendritic cells as well as T-cells, and has been shown to mediate interactions between the two cell types (Tordjman et al., 2002). PlxnA l , on the other hand, is present only on dendritic cells of the immune system, and plays a role in the stimulation of T-cells by dendritic cells (Wong et al., 2003). Expression of Plxn-Al is controlled by the major histocompatibility complex (MHC) class II-specific transactivator (CUTA), a novel Plxn-Al transcription factor, normally responsible for activating a variety of immune-related-genes. The precise function of class A plexins and neuropilins in dendritic cellT-cell interactions needs to be clarified. Like in neural cells, they may be involved in cytoskeletal rearrangements of immune cells, possibly in response to secreted Sema3 A, which has been shown to inhibit migration of B-cells (Delaire et al., 2001). Sema4D, also known as CD 100, is expressed by T-cells and activates B-cells in the immune system (Hall et al., 1996). Plxn-Bl was proposed to be the Sema4D receptor in vitro (Tamagnone et al., 1999) and this interaction has been shown to mediate collapse of hippocampal and retinal ganglion cell axons (Swiercz et al., 2002) and migration of endothelial cells (Giordano et al., 2003) in vitro. The absence of Plxn-Bl on T- or B-lymphocytes lead to the discovery of CD72, a transmembrane lectin protein family member, which binds to Sema4D and which interaction promotes activation of B-cells (Kumanogoh et al., 2000). Sema4A, another member of the class 4 semaphorins, is expressed on dendritic cells, and activates T-cells through its interaction with T-cell, immunoglobulin domain and mucin domain (TIM) protein: TIM2 (Kumanogh et al., 2002). It interesting to note that after birth, in contrast to the widespread CD72 expression, Plxn-Bl expression appears to be largely absent from neurons, suggesting that in injured and intact neurons, CD72, and not Plxn-Bl, may function to mediate the effects of 31  Sema4D expressed in oligodendrocytes at the spinal cord injury site (Moreau-Fauvarque et al., 2003) and in the intact nervous system (Worzlfed et al, 2004). Finally, functions for other plexins and their receptors in the immune system have been documented (Kikutani and Kumanogoh, 2003). Thus, plexins, along with neuropilins, semaphorins as well as other receptors have functions not only in the nervous system, but also in a variety of non-neuronal cells. Although novel plexin-semaphorin interactions have been found in these cells, it appears that in one case at least (with CD72 and Sema4D), there may be some overlap with injured neurons (MoreauFavarque et al., 2003), underscoring the importance of knowing which receptors are expressed in subsets of neurons, especially if one is to understand their roles in an injury setting. -HypothesisAlthough evidence to date supports a role for the involvement of semaphorins and their ligand-binding partners, the neuropilins, in the regeneration response of injured neurons, little is known about plexins, the signal transducing component of secreted class 3 semaphorins, after injury. Work by the Verhaagen lab has shown that Plxn-Al mRNA expression does not change in injured rubrospinal neurons after a thoracic spinal cord transection (De Winter et al., 2002), while similarly, Plxn-Al mRNA expression is maintained in injured rat DRGs after a dorsal column lesion (Pasterkamp et al., 2001a). To date, no information regarding Plxn-Al mRNA expression in injured PNS motoneurons is available, while expression patterns of other members of the plexin-A subfamily (A2,A3,A4), along with members of the Plexin-B (B1,B2,B3), C (CI) and D (Dl) sub-families, in PNS and CNS neurons after injury have not yet been studied. Although little is known about the role of plexins as mediators of semaphorin-induced inhibition of nerve regeneration after injury in vivo, their importance in mediating semaphorin signaling in vitro, suggests that their expression in injured neurons, along with neuropilins, is necessary to transduce, as well as modulate the semaphorin signals encountered by a regenerating neuron. The expression patterns of plexins in injured motoneurons may increase our understanding on how regenerating neurons will respond to semaphorins present at the injury site and/or along the path of regeneration. To this end, this thesis will examine the expression patterns of all members of the class A plexins (Plxn-Al, -A2, -A3, -A4), as well as Plxn-Bl, in motoneurons after injury. Expression of plexins will be compared in 2 models of adult mouse PNS vs. CNS injury: axotomized facial motoneurons (a model for PNS injury) versus axotomized rubrospinal neurons (a model for CNS spinal cord injury).  32  I hypothesize that, based on their roles as mediators of inhibitory semaphorin signaling, plexin expression will be different between injured CNS vs. PNS neurons. As injured CNS neurons are not able to regenerate into a semaphorin-positive scar and are repulsed by a source of semaphorins, (1) plexin expression will be maintained or increased in axotomized CNS neurons, making them sensitive to the inhibitory semaphorin signals present at the spinal cord injury site. In contrast, (2) plexin expression will be downregulated in injured PNS neurons A loss of plexin would make regenerating PNS neurons less sensitive to semaphorins present along the path of regeneration, allowing for their successful regeneration towards their target tissues.  33  CHAPTER II: MATERIALS AND METHODS  -Animal CareMale CD-I mice (6-8 weeks old, University of British Columbia's Animal Care Centre, Vancouver, Canada) were used in this study. Animals were kept in an environmentally controlled facility with a 12hr light/dark cycle and provided water and rodent food ad libitum. All experiments were performed in accordance with the guidelines of the Canadian Council for Animal Care and were approved by the local animal care committee. Animals were anaesthetized by an intraperitoneal injection of a mixture of Ketamine (135 mg/kg) and Xylazine (6.5 mg/kg) prior to surgical procedures. Animals were killed with an overdose of Chloral Hydrate (900 mg/kg). -Facial Nerve AxotomyThe left facial nerve was unilaterally exposed in anaesthetized animals and a 5mm section removed 2-3mm distal to the stylomastoid foramen (see Figure 6A). This was to prevent reconnection of the axons to their targets.'For crush lesions, the facial nerve was crushed twice for 10 seconds with a pair of fine forceps, at the same site as the resection. The contralateral facial nerve was left intact as a control. The wound was closed with wound clips and animals killed at 1, 3, 7 and 14-day time points post-injury. -Rubrospinal Tract LesionFollowing anaesthesia, the neck musculature of animals was separated at the midline to expose the cervical spinal column. Subsequently, the third cervical vertebra along with the underlying dura was unilaterally removed. A dorso-lateral hemisection of the spinal cord was performed with a pair of fine iris scissors, leaving the contralateral tract intact as a control (see Figure 6B). The wound was then closed with wound clips and the animals returned to their housing. Animals were sacrificed at 3, 7 and 14-day time points post-injury. -Tissue PreparationAnimal brains were removed from either fresh-killed or perfused animals. For fresh-kills, brain stems containing the facial nuclei were quickly removed from animals given an overdose of anaesthetic and frozen immediately on dry ice. Facial nuclei were subsequently microdissected (n=10)fromfresh-frozenbrainstems by "punching" out the nuclei with an WAgauge needle. Microdissected nuclei were used either for mRNA or protein isolation.  34  Figure 6. Surgical procedures A.  Facial Nerve Lesion  Caudal  I  Site of crush  35  For perfusions, animals were perfused transcardially with 0.1M phosphate buffered saline (PBS, pH 7.4) followed by an equivalent volume of paraformaldehyde (4% in 0.1M PBS). After removal, brain stems containing facial nuclei as well midbrains containing rubrospinal nuclei were post-fixed for either 2 hrs. or overnight at 4°C. All samples were cryoprotected in increasing sucrose gradients (14%, 18% and 22% sucrose in 0.1M PBS, pH 7.4) for 12hrs each concentration. Each tissue sample was then rapidly frozen in dry-ice cooled iso-pentane. 14um coronal sections of either facial or rubrospinal nuclei were collected from the caudal to rostral aspect of the nuclei at -20°C, mounted onto Superfrost Plus Slides (Fisher Scientific, Pittsburgh, PA) and stored at -80°C. -In Situ HybridizationTwo 50-mer oligonucleotide probes were used for each gene of interest to decrease developing time. The oligonucleotide probes utilized were as follows: for Plexin-Al, nucleotides complementary to bases 588-635 and 5074-5123 (5'-CGGTTGGCTGCATAGTCCAGCAGTA GAAGCTTGTTGACGTTGTCTGTG-3' and 5 '-CTGCTGAGGGACTTAGTGAAGGTAGAG GAGTTGGAGATGTTGTAGGCCGA-3' respectively; GenBank Accession Number D86948); for Plexin-A2, nucleotides complementary to bases 1838-1888 and 3662-3711 (5'-AAACCAC ACTGTAGCCATTGTAAACATAGGAGGCCACAGAGGTCAGGCGGT-3' and 5'-ACTAGT GATACTCCACTCTGGCTCAATACGTTGGACCCGTGGGTCATCTA-3' respectively; GenBank Accession Number D86949); for Plexin-A3, nucleotides complementary to bases 831880 and 4642-4791  (5'-GTGTCCAGCTGCAACGTTAAGAAGTACACGAAGGAGGCACTG  AC AAAGOC-3' and 5' -GT AC AC AGT ATCC A AC AGCTTGTCTTTGGCCTGGGTGATGCT A TCACAGT-3' respectively; GenBank Accession Number NM_08883); for Plexin-A4, nucleotides complementary to bases 1040-1089 and 2645-2694 (5'-TCATCATGACGGTACTT CAGAGCAAGCTAGAGTATGCCACTGACGTGCTG-3' and 5'-GTCCGGCTGACGGTCCA TCCCAACAACATCTCTGTCTCTCAGTACAACGT-3' respectively; GenBank Accession  -  Number NM_175750) and finally, for Plexin-BI, nucleotides complementary to bases 18111860 and 5549-5598  (5'-TGGTCAGTAGAGCAGGACTCTGTTGGTCTCCAAAGTAGCAGA  AATATGAC-3' and 5' -CTCCATCTGGGACCTTGTAATGTTGCAGTGTATTCAGACGCCT CCACAGA-3' respectively, GenBank Accession Number NM_172775). Probes were 3' end-labeled by mixing 80jLig of probe with P-ATP, deoxy terminal transferase (Invitrogen Canada, Burlington, ON, Canada), DTT, diethyl pyrocarbonate DEPC water and 5X reaction buffer. Sections containing perfused mouse facial or rubrospinal nuclei were subsequently hybridized with 1.2 x 10 cpm of the respective probe in lOOul of 6  36  hybridization mixture per slide for 12hrs at 44°C. Slides were then dipped in Kodak NTB-2 emulsion and exposed for 4 weeks at 4°C for both Plxn-Al and -A2 probes. Slides were counterstained with Neurotrace (500/525nm; Molecular Probes Inc., Portland, OR, USA), a fluorescent Nissl stain, to visualize neuronal cell bodies. Slides were first rehydrated in dt^O for lhr. at room temperature (RT), then incubated with Neurotrace (1:200; diluted in 0.01M PBS, pH 7.4) for 2hrs at RT, washed (3x in 0.01M PBS) and rehydratred in 50%, 70%, 90% and 95% ethanol (lmin. each), 3x 100% ethanol washes (lmin. each), lx isopropanol wash (2min.) and 2x toluene washes (3min. each). Finally, slides were coverslipped with entellan (EM Science, Gibstown, NJ, USA) and stored at -20°C until further use. Darkfield images of silver grains and matching fluorescent images of Neurotrace labelled motor neurons were captured using Northern Eclipse image analysis software (Empix Imaging Inc., Mississauga, ON, Canada) with a digital camera (Q-Imaging Systems, Burnaby, BC, Canada) mounted on a Zeiss Axioplan2 microscope (Carl Zeiss Canada Ltd., Toronto, ON, Canada). Controls for in situ hybridizations were performed with sense probes created against the plexin probes mentioned above, performed exactly as with the antisense probes. -ImmunohistochemistryPerfused sections containing the rubrospinal nuclei or facial nuclei were analyzed for protein expression with anti-Plexin-Al antibody (Plxn-Al), kindly provided by Dr. Yanagi (Kobe University Graduate School of Medicine, Japan) or an anti-Neuropilin-2 (Nrp-2) antibody (Zymed Laboratorie Inc., South San Francisco, California, USA). Plxn-Al antibodies were created by immunizing rabbits with a synthetic peptide corresponding to Plxn-Al amino acid residues 1295-1894 (Mitsui et al., 2002). Nrp-2 antibodies recognize an N-terminal portion of the Nrp-2 protein. Slides where initially warmed on a hot plate for 10 min. and rehydrated in 0.01M PBS (pH 7.4) for 10 min. Slides were subsequently incubated with Plxn-Al (1:200) or with Nrp-2 (1:200) for 12hrs at 4°C and primary antibodies visualized with a CY-3 labelled donkey antirabbit secondary (1:200, 2hrs, RT; Jackson Immuno Research Laboratories). All sections were counterstained with Neurotrace (1:200, 5min., RT; 500/525nm) to identify motor neurons. Fluorescent images visualizing Plxn-Al, Nrp-2 or Neurotrace expression were digitally captured as described above. Fluorescent images were analyzed with Northern Eclipse image analysis software and Photoshop (Adobe Systems Incorporated).  37  -Western BlottingFor Western blots, total protein was extracted using radio immunoprecipitation assay (RIPA) lysis buffer (150mM NaCl, 50mM Tris pH 7.4, 5mM ethylenediaminetetraacetic acid (EDTA), 1% IgePalCA630, 1% sodium deoxycholate (DOC), 0.1% sodium-dodecyl-sulfate (SDS), 1 ug/ul each of aprotinin, phenyl-methyl-sufonyl-fluoride (PMSF), leupeptin, pepstatinA; pH 7.4) on ice. Pooled injured and non-injure facial nuclei from ten animals were initially homogenized and incubated on ice for 30min., centrifuged at 7900 x g (Baxter Centrifuge, Germany) for 5min. at 4°C and the supernatant subsequently removed. Protein concentration of supernatant was quantified by bicinchoninic acid (BCA, Pierce, Rockford, IL) assay and samples immediately stored at -80°C. For sodium-dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE), 40/ig of total protein was mixed 1:2 with Laemmli Buffer (Bio-Rad Laboratories, Hercules, CA, USA), boiled for 5min. and resolved by SDS-PAGE (4% stacking gel, 7.5% resolving gel) for 2hrs. Protein was transferred onto PVDF (Immobilon-P, Millipore Canada Ltd., Nepean, ON, Canada) membranes for 2hrs. (100V, 4°C). After transfer, membranes were dipped in 100% MeOH and allowed to dry at room temperature and stored at -20°C. For immunodetection, rehydrated membranes were initially blocked in 5% milk powder (Carnation) with tris-buffered saline containing 0.1% Tween-20 (TBST, pH 8.0) for 2hrs at RT. Membranes were subsequently incubated with primary antibody diluted in 0.5% milk powder with TBST (1:3000 for Plexin-Al antibody for 12hrs at 4°C), bound protein was detected with donkey anti-rabbit HRP conjugated secondary antibody (1:30,000, diluted in 5% milk powder with lx TBST; Jackson Immuno Research Laboratories). Membranes were incubated for lhr at room temperature with secondary and the primary/secondary complex subsequently visualized using electrogenerated chemiluminescence (ECL, Amersham, Pharmacia Biotech, UK; as per manufacturer's instructions). Actin protein was used as a loading control. Membranes were stripped in stripping solution (62.5mM Tris pH6.8, 2% SDS, lOOmM jS-mercaptoethanol, incubated for 30min. at 70°C) and incubated with an anti-actin antibody (1:1000, diluted with lx TBST containing 0.5 % milk powder, incubated for 12hrs at 4°C; ICN Biomedicals Inc., Irvine, CA, USA), followed by a donkey anti-rabbit-HRP (1:10,000, diluted with lx TBST containing 0.5% milk powder, incubated for lhr at RT; Jackson Immuno Research Laboratories) and protein bands visualized with ECL as described above.  38  -Quantification of In Situ Hybridization SignalsPlxn-Al, -A2, -A3, -A4 mRNA signal in injured vs. uninjured contralateral facial and rubrospinal nuclei were analyzed by calculating the neuronal cell area occupied by silver grain deposits. For rubrospinal neurons, all neurons within the rubrospinal nucleus were included in quantifications, while for facial neurons; all neurons except those from the medial group were included in our analysis. Only neurons with a clearly discernible nucleus were counted, and areas of neurons covered by other cell types, i.e. glial cells, or by artefacts of the ISH process, i.e. debris, were avoided when tracing neuronal cell bodies. On average, approximately 120 neurons were counted per facial nucleus and approximately 90 were counted per rubrospinal nucleus. Initially, neuronal profiles visualized with Neurotrace (500/525nm) were digitally traced for each section using Sigma Scan Pro 5.0 image analysis software (SPSS Inc., Chicago, IL, USA). Matching darkfield images containing silver grains where then superimposed onto images with circled neurons and combined. Prior to combining both images, injured and uninjured darkfield images were thresholded to the same intensity to control for differences in intensity when capturing images. In addition, for each section, the intensity of an area lacking neurons or glia was analysed and the value subtracted from the average signal per section to account for background. Three to four animals were analyzed per time point (n=3/4). For each animal, three or four sections, at least 50/xm apart, were included in the measurements. The areas for axotomized vs. contralateral control sections for each time point were compared and plotted using Sigma Plot 2001 (SPSS Inc., Chicago, IL, USA). Statistical analysis of ISH signal differences between injured vs. contralateral control sides was with a paired t-test. All statistical analyses were performed with SigmaStat statistical analysis software (SPSS Inc., Chicago, IL, USA). For Plxn-A2 signal in injured vs. contralateral rubrospinal nuclei, scatter plots were used to compare area occupied by ISH signal with cell area. -Quantification of Immunohistochemical SignalsPlxn-Al protein expression was determined by analyzing the amount of Plxn-Al protein signal present in injured facial as well as rubrospinal nuclei over the various time points tested. Firstly, the average Plxn-Al immunoreactivity per injured nucleus was obtained by thresholding the intensity of the "injured EHC image" with that of the counterpart contralateral uninjured sections to account for any difference in immunoreactivity within as well as between sections. The IHC image was obtained as described above, and is a digitally captured image of Plxn-Al immunoreactivity. Similarly, intensity of Neurotrace immunoreactivity per injured nucleus was thresholded with that of the counterpart contralateral injured section to obtain an average 39  Neurotrace immunoreactive signal. Subsequently, for each section, the total Plxn-Al immunoreactivity per nuclei was divided by that of the total Neurotrace immunoreactivity per nuclei to obtain an average Plxn-Al immunoreactivity for either facial or rubrospinal nuclei. Four sections at least 50[im apart from three separate animals were analyzed (n  =  3). The  average Plxn-Al immunoreactivity per section was summed and all of the time points compared for statistical significance using the analysis of variance (ANOVA) test. All statistical analyses were performed with SigmaStat statistical analysis software.  40  CHAPTER III: RESULTS  -Plexin-Al mRNA and Protein Expression in Axotomized Rubrospinal NeuronsPlxn-Al mRNA and protein were observed in mouse rubrospinal nuclei at 3, 7 and 14 days after a C3/4 spinal cord hemisection by radioactive in situ hybridization (ISH) and immunohistochemistry. For each time point, the average ISH signal expressed by injured and contralateral uninjured rubrospinal nuclei was compared and analyzed for statistical significance using a Student's t-test. Plxn-Al mRNA levels did not differ between injured and contralateral uninjured rubrospinal nuclei at 3 (p <0.5, n = 3) and 7 (p < 0.8, n = 3) days after spinal cord injury (Fig. 7A, B, D). Similarly, by 14 days after spinal cord injury, Plxn-Al mRNA expression was not significantly different between injured and contralateral uninjured rubrospinal neurons (p < 0.8, n = 3) (Fig. 7C and D). To confirm the Plxn-Al mRNA expression, Plxn-Al protein expression was analyzed in rubrospinal neurons using an anti-Plxn-Al antibody (Mitsui et al., 2002). Plxn-Al immunoreactivity appeared to be similar to mRNA expression in that expression in injured rubrospinal nuclei did not differ over the time points observed after analysis of variance (p < 0.4, n = 3) (Fig. 8). These results corroborate those of De Winter and colleagues (2002) by non-radioactive ISH in rat rubrospinal neurons after a thoracic spinal cord injury and suggest that neither Plxn-Al mRNA nor protein expression changes in injured rubrospinal neurons after cervical spinal cord lesion. Although both Plxn-Al mRNA and protein expression shows a trend towards decreased expression in injured rubrospinal neurons by 14 days after spinal cord injury, this change in expression was not found to be significant in for both Plxn-Al mRNA (Fig. 7D) and protein (Fig. 8D). -Plexin-A2, -A3 and -A4 mRNA Expression in Axotomized Rubrospinal NeuronsAnalysis of Plxn-A2 mRNA expression in injured vs. contralateral uninjured rubrospinal neurons appears to be strikingly different to that of Plxn-Al mRNA expression. Although PlxnA2 mRNA expression did not differ between injured and contralateral uninjured rubrospinal neurons 3 days after injury (p < 0.06, n = 4) (Fig. 9D), some neurons appeared to express higher levels of Plxn A2 mRNA than others (arrows, Fig. 9A). 7 days after spinal spinal cord injury, 7  Plxn-A2 mRNA expression was found to be almost double in injured compared to contralateral uninjured rubrospinal neurons (p < 0.04, n = 4) (Fig. 9B and D). A scatter plot of all injured and uninjured rubrospinal neurons, 7 days after spinal cord injury, shows an increase in Plxn-A2 mRNA expression in medium sized as well as larger axotomized rubrospinal neurons compared 41  Figure 7 Plxn-Al inRNA expression in injured rubrospinal neurons, 3 (A), 7 (B) and 14 (C) days after C3/4 spinal cord hemisection injury. For each time point in the horizontal panels (A~C); axotomized-Nissl, axotomized and contralateral uninjured images are from the same animal. In the horizontal panels, Plxn-Al mRNA expression in injured neurons is in the centre, while the corresponding image of cell bodies stained with Neurotrace is on the left (arrows denote cell soma covered with mRNA signal). Therightimage shows Plxn-Al mRNA expression in contralateral uninjured rubrospinal neurons. Plxn-Al mRNA expression does not appear to differ between injured and contralateral uninjured rubrospinal neurons at all time points observed (A-C). Scale bar, 100/rai. Quantification of mRNA expression shows no difference in Plxn-Al mRNA signal between injured and uninjured rubrospinal neurons at 3, 7 and 14 days after injury (D). Each bar in D represents the average cell area (± SEM) occupied by ISH signal for either injured (black bar) or uninjured (white bar) rubrospinal neurons over time points observed from 3 animals. A Student's t-test was used to compare mRNA expression between injured and uninjured neurons.  42  Figure 7 Axotomized-Nissl  Axotomized  Plexin-A1  D  Contralateral Uninjured  mRNA expression in the Rubrospinal Nucleus  i  35 -  nal  CM  30 -  iw  X >»  n  •o  0)  "o. 3 o o O  I  25 20 15 10 5-  < B5 0)  O  03 day  7 day  Days post-injury 43  14 day  Figure 8 Plxn-Al protein expression in injured and contralateral uninjured rubrospinal neurons, 3 (A), 7 (B) 14 (C) days after facial nerve resection injury. Each horizontal panel contains images from a separate animal at each time point (A-C). For each horizontal panel (A-C), PlxnA l protein expression in injured neurons is in the centre, while the corresponding image of cell bodies stained with Neurotrace is on the left. The right image is of Plxn-Al protein expression in contralateral uninjured rubrospinal neurons. Levels of Plxn-Al protein do not appear to differ between injured and contralateral uninjured rubrospinal neurons at all time points observed (AC). Scale bar, 100/rni. Similarly, quantification of Plxn-Al protein signal in injured rubrospinal neurons indicates no statistical difference in expression between all time points observed (D). Each bar in D represents the average Plxn-Al signal (± SEM) per injured nuclei from 3 animals for each of the time points observed. An ANOVA was used to compare Plxn-Al protein expression levels between time points.  44  Figure 8 Axotomized-Nissl  Axotomized  Contralateral Uninjured  Plxn-A1 protein expression in axotomized Rubrospinal Nuclei  D  _ cn  0.6  i..  ,,l Axotomized  0.5  O !T  «  0.4 0  H  3  o  o  al  oo 3 day  7 day Days  45  post-injury  14 day  n=3  Figure 9 Plxn-A2 mRNA expression in injured rubrospinal neurons, 3 (A), 7 (B) and 14 (C) days after C3/4 spinal cord hemisection injury. Horizontal panels (A-C) show a different animal at each time point. For each horizontal panel, the centre image is of Plxn-A2 mRNA expression in injured rubrospinal neurons. The left image is of the corresponding injured neurons stained with Neurotrace to identify neuron cell bodies (arrows show overlap of Plxn-A2 mRNA expression and cell soma). The right image shows Plxn-A2 mRNA expression from the same animal as the centre image, but in contralateral uninjured neurons. At 3 (A) and 7 (B) days after injury, Plxn-A2 mRNA expression is clearly higher in injured compared to contralateral uninjured neurons which appear to express little mRNA (arrows, A and B). By 14 days after injury, this difference does not appear to be as large, although some expression remains in injured rubrospinal neurons (arrows, C). Scale bar, 100/xm. Quantification of Plxn-A2 mRNA expression at 3 days after injury does not show a difference between injured and uninjured neurons, although by 7 days after injury, expression in injured neurons is almost double that of uninjured neurons and is statistically significant (p < 0.04) (D). At 14 days after injury, Plxn-A2 mRNA expression does not differ between injured compared to contralateral uninjured rubrospinal neurons (D). Each bar in D represents the average cell area (± SEM) occupied by ISH signal for either injured (black bar) or uninjured (white bar) rubrospinal neurons over time points observed from 4 animals. A Student's t-test was used to compare mRNA expression between injured and uninjured neurons. * denotes a statistical significance (p < 0.05).  46  Plexin-A2  D  mRNA expression in the Rubrospinal Nucleus  14  to c  Injured Contralateral  12 10 8  •a  o  6  u o  4  O ro  2  0)  0  O  3 day  7 day  Days post-injury 47  14 day  n=4  Figure 10 Scatter plot of Plxn-A2 mRNA expression comparing injured (black circles) and contralateral uninjured (open circles) rubrospinal neurons, 7 days after C3/4 spinal cord hemisection. Each dot represents the cell area occupied by Plxn-A2 mRNA in an individual neuron. A total of approximately 1000 neurons from four animals are represented. Increased Plxn-A2 mRNA expression can be seen in both medium sized neurons (red box) as well as larger neurons (green box) compared to contralateral uninjured neurons.  48  Figure 10 Scatter plot of Plexin-A2 mRNA expression in the Rubrospinal Nucleus 7 days post-injury  • o  O  500  1000  1500  Cell Size (jim ) 2  49  Injured Contralateral Regression  2000  2500  n =4  to contralateral uninjured neurons (Fig. 10). The relatively larger size of injured rubrospinal neurons (black circles) compared to contralateral uninjured neurons (white circles) seen in the scatter plot is indicative of a hypertrophy of injured rubrospinal neurons, 7 days after axotomy. By 14 days after spinal cord injury, although some axotomized neurons expressed higher levels of Plxn-A2 mRNA (arrows, Fig. 9C), mRNA expression did not differ between injured and contralateral uninjured rubrospinal neurons (p <0.8, n = 4) (Fig. 9D). For both Plxn-A3 and -A4 mRNA, expression was only analyzed at 7 and 14 day timepoints after spinal cord injury. No Plxn-A3 mRNA signal was detected in either injured or contralateral uninjured rubrospinal neurons at 7 or 14 days after spinal cord injury (Fig. 11A and B, respectively). In contrast, like Plxn-Al mRNA and protein expression, at 7 days after injury, Plxn-A4 mRNA expression did not differ between injured and uninjured rubrospinal neurons (p = 0.7, n = 4) (Fig. 12A and C). By 14 days after spinal cord injury, Plxn-A4 mRNA expression was found to be statistically less in injured compared to contralateral uninjured rubrospinal neurons (p < 0.03, n = 4) (Fig. 12B and C). The similarities in expression patterns of Plxn-Al and -A4 mRNA are interesting to note. - P l e x i n - A l m R N A a n d Protein Expression in Axotomized F a c i a l Motoneurons-  Plxn-Al mRNA expression was quantified in facial motoneurons 1, 3, 7 and 14 days after a unilateral resection injury of the mouse facial nerve by ISH. Plxn-Al mRNA expression did not differ between injured and contralateral uninjured facial motoneurons at 1 (p < 0.6, n = 3) and 3 (p < 0.4, n = 3) days after resection injury (Fig. 13 A, B and D). Plxn-Al mRNA expression was found to be significantly higher in injured compared to contralateral uninjured facial motoneurons by 7 days after a resection injury (p < 0.02, n = 3) (Fig. 13C and D). Interestingly, at the 14 day time point after resection injury, Plxn-Al mRNA expression was found to be significantly lower in injured compared to contralateral uninjured facial motoneurons (p < 0.04, « = 3).  In contrast to the increased trend of Plxn-Al mRNA seen in injured facial motoneurons, Plxn-Al protein expression appeared to be unchanged in injured facial nuclei all the time points observed (p < 0.7, n = 3) (Fig. 14). Western blot analysis of Plxn-Al protein expression showed no visible change in amount of protein present 14 days after facial nerve resection injury in injured compared to contralateral uninjured facial nuclei, confirming immunohistochemical results (Lane 2 vs. 3, Fig. 14F).  50  Figure 11 Plxn-A3 mRNA expression in axotomized rubrospinal neurons, 7 (A) and 14 (B) days after C3/4 spinal cord hemisection injury. For both A and B, left images show axotomized neurons while right images show contralateral uninjured neurons. Fine red grains show Plxn-A3 mRNA signal, while larger red signals are artefacts of the in situ process and do not represent silver grains. The green stain is fluorescently labeled Nissl-substance. Note the absence of mRNA colocalization, as denoted by fine red grains, with injured and uninjured rubrospinal neuronal cell bodies (arrows, A and B). 20X primary magnification. Scale bar, 100/mi.  51  Figure 11  52  Figure 12 Plxn-A4 mRNA expression in axotomized rubrospinal neurons, 7 (A) and 14 (B) days after C3/4 spinal cord hemisection injury. Each horizontal panel contains images from the same animal, although different animals are shown at each time point (A and B). The centre image of each panel shows Plxn-A4 mRNA expression in injured rubrospinal neurons, while the right image is of mRNA expression in the corresponding contralateral uninjured rubrospinal neurons. The left images show the centre images stained with Neurotrace to identify neuronal cell bodies (arrows denote overlap between mRNA signal and cell soma). Plxn-A4 mRNA expression does not appear to differ between injured and contralateral uninjured neurons at 7 days (A) after injury although by 14 days after injury (B), expression appears to be slightly lower in injured vs. contralateral uninjured rubrospinal neurons (arrows, A and B). Scale bar, 100/xm. Quantification of Plxn-A4 mRNA expression levels at 7 days post-injury does not show a difference between injured and uninjured neurons, although by 14 days after injury, expression in injured neurons is statistically less than that of uninjured (p < 0.03) (C). Each bar in D represents the average cell area (± SEM) occupied by ISH signal for either injured (black bar) or uninjured (white bar) rubrospinal neurons from 4 animals over the two time points observed. A Student's t-test was used to compare mRNA expression between injured and uninjured neurons. * denotes a statistical significance (p < 0.05).  53  Figure 12 Axotomized-Nissl  Axotomized  Contralateral  Uninjured  Plexin-A4 mRNA expression in the Rubrospinal Nucleus CM  16  ro c  14  w  12  X 10  •a  8  d)  '5.  6  3  o u O  4  ro  2 0  O  7 day  14 day  Days post-injury 54  n=4  Figure 13 Plxn-Al mRNA expression in injured facial motoneurons, 3 (A), 7 (B) and 14 (C)  days after facial nerve resection injury. Each horizontal panel shows three images from a separate animal for each time point (A-C). For every time point, the centre image shows Plxn-Al mRNA expression in axotomized facial motoneurons, while the left image is of the same image, but stained with Neurotrace to identify neuronal cell bodies (arrows identify mRNA signal over facial motoneurons). The right image shows Plxn-Al mRNA expression in the contralateral uninjured facial motoneurons from the same animal. At 3 days (arrows, A) after injury, Plxn-Al mRNA expression does not appear to differ between injured and contralateral uninjured facial motoneurons, while by 7 days (arrows, B), expression appears higher in injured compared to contralateral uninjured neurons. By 14 days after axotomy, Plxn-A2 mRNA expression does not appear to be different between injured and contralateral uninjured motoneurons (arrows, C ) . Scale bar, 100/rni. Quantification of Plxn-Al mRNA expression at 1 and 3 days after axotomy shows a slight increase in expression of injured compared to uninjured neurons although the difference is not significant. By 7 days after axotomy, expression in injured neurons is statistically higher than that in uninjured neurons (p < 0.02) (D). At 14 days after axotomy, PlxnAl mRNA expression is statistically less in injured compared to contralateral uninjured facial motoneurons (D). Each bar in D represents the average cell area (± SEM) occupied by ISH signal for either injured (black bar) or uninjured (white bar) rubrospinal neurons from 4 animals over the four time points observed. A Student's t-test was used to compare mRNA expression between injured and uninjured neurons. * denotes a statistical significance (p < 0.05).  55  Figure 13  Plexin-A1  D  Contralateral U n i n j u r e d  Axotomized  Axotomized-Nissl  mRNA expression in the Facial Nucleus  70  c u>  60  X  50  w >  40  •a a  30  'a. =5 O  20  O  10 H  Injured Contralateral  I  I  a to a>  <  "55 o  1 day  3 day  7 day  Days post-injury 56  14 day  n =3  14 Plxn-Al protein expression in injured and contralateral uninjured facial motoneurons, 1 (A), 3 (B), 7 (C) and 14 (D) days after facial nerve resection injury. The horizontal panels show images from the same animals at each time point. For each horizontal panel ( A - C ) , PlxnA l protein expression in injured neurons is in the centre, while the corresponding image of cell bodies stained with Neurotrace is on the left. The right image is of Plxn-Al protein expression in contralateral uninjured facial motoneurons. Plxn-Al protein expression is similar at all time points observed, although at 7 days after injury (C), expression appears to be slightly higher in injured compared to contralateral uninjured facial motoneurons. Scale bar, lOOjum. Quantification of Plxn-Al protein signal in injured facial nuclei over the time points observed indicates no statistical difference in expression (E). Each bar in E represents the average PlxnA l signal (± SEM) per injured nuclei from 3 animals for each of the time points observed. An ANOVA was used to compare levels of expression. Western blot analysis of mouse Plxn-Al protein approximately 200 kDa in size (F). Amounts of Plxn-Al protein do not appear to differ between injured vs. uninjured facial nuclei from 10 pooled animals (Lane 2 vs. 3, F), 14 days after axotomy. L a n e 1 shows Plxn-Al protein expression from mouse whole brain extract as a control. Western blot probed with Plxn-Al antibody was stripped and re-blotted with anti-actin antibody to ensure equal loading of protein per lane. 7.5% polyacrylamide gel, 20/xg protein/lane. Figure  57  £  Plxn-A1 protein expression in axotomized Facial Nuclei Axotomized  1/1  O O  mouse whole  0.4  0.3  fo O)  ^  0.2  Actin  c o  O &  0.0 1 day  3 day Days  7 day  14 day  n=3  post-injury  58  14 d F a c i a l Nuclei  -Plexin-A2, -A3 and -A4 m R N A expression in axotomized F a c i a l MotoneuronsExpression of Plxn-A2 mRNA was not different between injured and contralateral uninjured facial motoneurons, 1 day after facial nerve resection injury (p < 0.5, n = 3) (Fig. 15D). Similarly, Plxn-A2 mRNA expression was found to not be significantly different between injured and contralateral uninjured facial motoneurons, 3 (p < 0.4, n = 3) and 7 (p < 0.2, n = 3) days after injury (Fig. 15 A, B and D). By 14 days after axotomy, Plxn-A2 mRNA had significantly decreased (p < 0.02, n = 3) in injured compared to contralateral facial motoneurons (Fig. 15CandD). Plxn-A3 and -A4 mRNA expression in facial motoneurons was compared 7 and 14 days after resection injury. Plxn-A3 mRNA signal was found to be statistically higher in injured compared to uninjured facial motoneurons at both 7 (p < 0.01, n = 4) and 14 (p < 0.02, n = 4) day time points after injury (Fig. 16 A, B and C). A resection injury results in the removal of a small section of the facial nerve, therefore preventing the functional regeneration of facial nerve growth cones from the proximal to distal nerve stumps. To begin to understand the nature of the maintained expression of Plxn-A3 mRNA in injured compared to contralateral uninjured facial motoneurons 14 days after injury, Plxn-A3 mRNA expression was analyzed in facial motoneurons 14 days after a crush injury. Although a crush injury results in axotomy of the nerve, the surrounding connective tissue remains intact, thus providing a conduit for any regenerating nerve growth cones. Also, by 14 days after injury, most axons will have reconnected with their various target tissues, as can be seen by the return of motor function in the mouse whisker pads (Kamijo et al, 2003; McGraw et al., 2004). Expression of Plxn-A3 mRNA did not appear to differ between injured and contralateral uninjured facial motoneurons 14 days after crush injury, although only one animal was used for this. Similar to Plxn-Al and -A3, Plxn-A4 mRNA expression was found to be statistically higher in injured compared to contralateral uninjured facial motoneurons, 7 days after axotomy of facial motoneurons by resection injury (p < 0.05 n = 4) (Fig. 17A and C). By 14 days after resection injury, Plxn-A4 mRNA expression was found to not be statistically different between injured compared to contralateral uninjured facial motoneurons (p < 0.2, n = 4) (Fig. 17B and C). As well, individual in situ hybridizations with sense probes to every class-A plexin antisense probes yielded non-specific signal (Fig. 18).  59  Figure 15 Plxn-A2 mRNA expression in injured facial motoneurons, 3 (A), 7 (B) and 14 (C) days after facial nerve resection injury. Each panel (A-C) shows Plxn-A2 mRNA expression in a different animal at each time point. In the three horizontal panels (A-C), Plxn-A2 mRNA expression in injured neurons is in the centre, while the corresponding image of cell bodies stained with Neurotrace is on the left (arrows show mRNA expression over cell bodies). For each horizontal panel, the right image shows Plxn-A2 mRNA expression in uninjured rubrospinal neurons, contralateral to the centre image. Plxn-A2 mRNA expression appears to decrease in injured compared to contralateral uninjured facial motoneurons at 3 (A), 7 (B) and 14 (C) days after axotomy. Scale bar, 100/im. Quantification of Plxn-A2 mRNA expression at 1, 3 and 7 days after axotomy is not significantly different between injured and contralateral uninjured facial motoneurons (D). By 14 days after facial nerve transection, Plxn-A2 mRNA expression is statistically less in injured compared to contralateral uninjured facial motoneurons (p < 0.02) (D). Each bar in D represents the average cell area (± SEM) occupied by ISH signal for either injured (black bar) or uninjured (white bar) rubrospinal neuronsfrom4 animals, over various time points observed. A Student's t-test was used to compare mRNA expression between injured and uninjured neurons. * denotes a statistical significance (p < 0.02).  60  Figure 15 Axotomized-Nissl o a> <> /  o  • *.. t>  •'v'"  -•  t  .  f  *  '.•  Axotomized  Contralateral Uninjured  ,',.'-!" 4,.'  y'W;;>'r •; "V ".'  -•'" •'  O  a •o o  "  " /  ^ ^ ^ ^  • *• * *  o o  •  o a  J  ; \  o .Si •'•' VS."-. -•';.*> . • « , <.*"*r /• •'< a> x i ' *' " t £ /•vV5-".-'.4"»*.- X <> / * , i : W-i J.'*" *„'• * i«;•* •, : J  t  ;....(• '  •  ' "•:<.J:V.-V i-r*^-' *'%»'••  4***'  •.. M-w  v , J'*-'/ -  in  o a -a  Plexin-A2  mRNA expression in the Facial Nucleus  30  (0  C O)  25 A  CO  X  20  i  I  > T3  a  15 H  3  10 H  ro a)  5H  u o O  1  O  x  0  1 day  3 day  7 day  Days post-injury 61  14 day  n=3  Figure 16 Plxn-AS mRNA expression in injured facial motoneurons, 7 (A) and 14 (B) days after facial nerve resection injury as well as 14 days (C) after nerve crush injury. In the first three horizontal panels (A-C), for each time point, the centre image shows Plxn-A3 mRNA expression in injured facial motoneurons, while the left image is the same injured motoneurons stained with Neurotrace to identify cell bodies (arrows indicated Plxn-A3 mRNA expression over cell bodies). For each panel, the right image shows Plxn-A3 mRNA expression in uninjured facial motoneurons contralateral to those in the centre panels. Plxn-A3 mRNA expression appears to be higher in injured compared to contralateral uninjured facial motoneurons at 7 (arrows, A) and 14 days (arrows, B) after resection injury. In contrast, by 14 days after nerve crush, Plxn-A3 mRNA expression does not appear to differ between injured and contralateral uninjured facial motoneurons (C). Scale bar, 100/mi. Quantification oiPlxn-A3 mRNA expression at 7 and 14 days after injury shows an almost 4-fold increase in injured compared to uninjured facial motoneurons at both time points (p < 0.01 andp < 0.02, respectively) (D). Each bar in D represents the average cell area (± SEM) occupied by ISH signal for either injured (black bar) or uninjured (white bar) rubrospinal neurons from 4 animals at 7 and 14-days after facial nerve transection. A Student's t-test was used to compare mRNA expression between injured and uninjured neurons. * denotes a statistical significance (p < 0.02).  62  Plexin-A3 mRNA expression in the Facial Nucleus Injured Contralateral  30  ro c O) CO  x  25  20 H  CO >s  •o 0)  'a. 3 u o O  15  10  5H  ro  ?<>i O  0  7 day  14 day  Days post-injury 63  n =4  Figure 17 Plxn-A4 mRNA expression in injured facial motoneurons, 7 (A) and 14 (B) days after facial nerve resection injury. The first two horizontal panels show Plxn-A4 mRNA expression in the injured (centre) and contralateral (right) facial motoneurons. For each horizontal panel, the left image shows facial motoneurons of the centre image stained with Neurotrace (arrows indicate Plxn-A4 mRNA signal over facial motoneuron cell bodies). One animal is shown for each time point. Plxn-A4 mRNA expression appears to be higher in injured compared to contralateral uninjured facial motoneurons 7 days after injury (arrows, A) while this difference albeit still present, is not as prominent 14 days after injury (arrows, B). Scale bar, 100/xm. Quantification of Plxn-A4 mRNA expression at 7 days after injury shows a statistically significant increase in mRNA expression between injured and uninjured facial motoneurons (p < 0.05) (C). By 14 days, there is no difference in mRNA expression between injured and contralateral uninjured facial motoneurons (C). Each bar in C represents the average cell area (± SEM) occupied by ISH signal for either injured (black bar) or uninjured (white bar) rubrospinal neurons from 4 animals at 7 and 14 days. A Student's t-test was used to compare mRNA expression between injured and uninjured neurons. * denotes a statistical significance (p < 0.05).  64  Figure 17  Plexin-A4  mRNA expression in the Facial Nucleus  35  re c .5*  30 25  CO 20 -\  .2 a  15  3  O  o O re  10 H  0)  =5 o  0  7 day  14 day  Days post-injury  65  n=4  Figure 18 Expression of sense probe to Plxn-Al (A), Plxn-A2 (B), Plxn-A3 (C) and Plxn-A4 (D) mRNA in facial motoneurons. Levels of mRNA are very low and if mRNA colocalizes to motoneurons, it is far below that of background levels. The bright spots in D are UV light reflection from crystal deposits and not from mRNA grains. Scale bar, 100/xm  66  > • v V * r t fete«*"»*>"..•  Figure 18  67  -Plexin-B 1 mRNA Expression in Rubrospinal and Facial MotoneuronsExpression of Plxn-Bl mRNA was analyzed in rubrospinal neurons at 3, 7 and 14 days after a C3/4 cervical spinal hemisection, as well as in facial motoneurons, at 1, 3, 7 and 14 days after a facial nerve resection injury. At all time points observed, Plxn-Bl mRNA expression was not detected in either injured or uninjured rubrospinal (Fig. 19A) or facial neurons (Fig. 19B). Although expression in general appeared to be very weak, some Plxn-Bl mRNA signal could be colocalized to what appear to be Purkinje cells in the cerebellum (Fig. 19C and D), in agreement with previous work by Moureau-Favarque and colleagues (2003).  -Neuropilin-2 Protein Expression in Axotomized Facial MotoneuronsFinally, neuropilin-2 (Nrp-2) protein expression was compared between injured and contralateral uninjured facial motoneurons 1, 3, 7 and 14 days after facial resection injury and axotomy of facial motoneurons. 1 day after nerve resection, levels of Nrp-2 protein signal does not differ between injured and contralateral uninjured facial motoneurons (Fig. 20A). At 3 and 7 days after injury, levels of Nrp-2 protein signal appear to be slightly higher in injured facial motoneurons at 3 and 7 days after injury compared to contralateral uninjured motoneurons (Fig. 20B and C, respectively). By 14 days after resection injury, there appears to be no difference in Nrp-2 protein signal between injured and contralateral uninjured facial motoneurons (Fig. 20D). Similarly, a Western blot for Nrp-2 protein identified a band at 120 kDa and showed no apparent difference in Nrp-2 protein levels between injured and contralateral uninjured facial nuclei, 14 days after transection injury (Lane 1 and 2 respectively, Fig. 20E).  68  Figure 19 Expression of Plxn-Bl mRNA in injured and contralateral uninjured facial (A) and rubrospinal neurons (B), 7 days after axotomy. For both A and B, left images contain axotomized neurons and right contain contralateral uninjured neurons. Red grains represent Plxn-Bl mRNA signal, while green stain is fluorescently labeled Nissl-substance. Arrows indicate neuronal cell somata. Note the absence of mRNA colocalization with neuronal cell bodies (arrows, A and B). Expression of Plxn-Bl mRNA is observed in what appear to Purkinje cells in the cerebellum (arrows, C: 10X primary magnification, D: 20X primary magnification). Scale bar, 100/rni.  69  Figure 19  70  Figure 20 Expression of Nrp-2 protein expression in injured and contralateral uninjured facial motoneurons, 1 (A), 3 (B), 7 (C) and 14 (D) days after facial nerve resection injury, as well as by Western blot (E). For each horizontal panel (A-D), images of Nrp-2 immunoreactivity from the same animal are in injured facial motoneurons (centre image) and Nrp-2 protein expression in contralateral uninjured facial motoneurons (right image) are shown. Neuronal Nrp-2 protein expression was confirmed by counterstaining injured motoneurons with Neurotrace (left image in horizontal panels).Nrp-2 protein signal does not differ between injured and contralateral uninjured sides 1 day after resection injury (A). Expression levels appear to be higher in injured compared to contralaterael uninjured facial motoneurons at 3 (B) and 7 (C) days after injury. By 14 days after axotomy, Nrp-2 protein expression did not appear to differ between injured and contralateral uninjured facial motoneurons (D). Scale bar, 100/rni. Nrp-2 protein expression was analyzed by Western blot from total protein extract of pooled facial nuclei (E). A protein band at -120 kDa was identified as Nrp-2. Amounts of Nrp-2 protein do not appear to differ between injured and uninjured facial nuclei 14 days after facial nerve transection injury (Lane 2 and 3, respectively). Total protein extract from 10 facial nuclei was pooled and run in both lanes containing injured and uninjured facial nuclei. Lane 1 contains total protein from a mouse whole brain extract. Note the larger band at about 120 kDa in size likely representing Nrp-2 protein. 7.5% polyacrylamide gel, 20/xg protein/lane.  71  Figure 20  72  CHAPTER IV: CONCLUSIONS AND DISCUSSION  -OverviewThis study analyzed the expression of all class-A plexins (Plxn-Al~A4) and one class-B plexin (Plxn-Bl), in rubrospinal (CNS) and facial (PNS) motoneurons after injury. As the signal transducing component of the secreted class 3 semaphorin receptor complex, plexins provide a crucial link between semaphorin signaling and intracellular process resulting in either repulsive or attractive modulation of growth cone steering. Therefore, based on their roles as mediators of inhibitory semaphorin signaling, I hypothesized that plexin expression would be different between injured PNS and CNS neurons. Furthermore, I predict that plexin expression would be maintained or increase in axotomized CNS neurons making these neurons sensitive to any inhibitory semaphorins present at the spinal cord injury site, thereby contributing to their inability to regenerate into and past a semaphorin-positive scar. In contrast, plexin expression in injured PNS neurons would decrease, making these neurons less sensitive to semaphorins present along the path of regeneration and thus allowing for successful regeneration towards target tissues. The results of the present study demonstrate that Plxn mRNA expression is either maintained {Plxn-Al or -A4) or increased (Plxn-A2) in rubrospinal neurons axotomized as a result of a cervical spinal cord hemisection injury (Table 4). Plxn-Al protein expression is also maintained in injured rubrospinal neurons, further supporting the mRNA expression data. Interestingly, neither Plxn-A3 nor Plxn-Bl mRNA expression was detected in either injured or contralateral uninjured rubrospinal neurons over the time points studied. The continued expression of Plxn-Al mRNA and protein, as well as Plxn-A2 and -A4 mRNA expression in injured rubrospinal neurons suggests that injured rubrospinal neurons can remain responsive to secreted class 3 semaphorins present at the spinal cord injury site. Furthermore, thefindingthat Plxn-Al mRNA expression is maintained in injured rubrospinal neurons, extends results from an earlier study by De Winter and colleagues (2002), showing continued Plxn-Al mRNA expression in injured rat rubrospinal neurons, up to 56 days after a thoracic spinal cord injury. On the other hand, in facial motoneurons, with the exception of a downward trend in Plxn-A2 mRNA, expression of Plxn-Al, -A3 and -A4 mRNA increased in injured compared to contralateral uninjured motoneurons (Table 5). Analysis of Plxn-Al protein expression showed  73  Figure 21 Semaphorin expression at the spinal cord injury site and semaphorin receptor expression on rubrospinal neurons  r Sema3A,3B,3C,3E,3F*  Spinal Cord.) Injury Site " \ Rubrospinal Neuron Growth Cone  Plexin-Al Plexin-A2 Plexin-A4  f  Neuropilin-2*  * from De Winter et al., 2002 corroborates findings from De Winter et al., 2002 +  Figure 22 Semaphorin expression at the distal stump of the transected facial nerve and semaphorin receptor expression on facial motoneurons  r  Sema3A,3B,3C 3D, 3E,3F*  Distal Stump/7 Neuroma \ Facial Motoneuron Growth Cone  Neuropilin-l^ Neuropilin-2  Plexin-Al Plexin-A2 Plexin-A3 Plexin-A4  * from Scarlato et al., 2003, Bannerman et al., 2003 from Pasterkamp et al., 1998a  f  74  that protein expression was not different between injured an uninjured facial motoneurons at all time points observed. Similar to the absence of expression in rubrospinal neurons, Plxn-Bl mRNA expression was undetectable in both injured and contralateral uninjured facial motoneurons at all time points observed. Therefore, in injured facial motoneurons, the hypothesis was correct for Plxn-A2 only, as mRNA expression decreased after injury, while for all other class-A plexins, mRNA levels increased. Overall, the results show that excluding the probable absence of Plxn-A3 mRNA in rubrospinal neurons and the downward trend in Plxn-A2 mRNA expression in facial motoneurons, expression of plexin-A family members is largely maintained or increased in both injured rubrospinal (CNS), and facial (PNS) neurons at 7 days after injury (Table 6).  -Implications of Plexin Expression in Non-Regenerating Rubrospinal NeuronsAxotomized rubrospinal motoneuron axons do not regenerate into and past the spinal cord injury site (Barron et al., 1989). A variety of class 3 semaphorins, are expressed in fibroblasts (Sema3A, 3B, 3C, 3E and 3F), as well as Schwann cells (Sema3B), that invade the rat spinal cord injury site by 14 days after spinal cord transection (De Winter et al., 2002). Expression of Sema3A mRNA and protein has been shown in fibroblasts at the spinal cord injury site as early as 3 days after ventral funiculus lesion in rats (Lindholm et al., 2004). One class 4 semaphorin, Sema4D, is upregulated on oligodendrocytes surrounding the lesion by 1 week after mouse thoracic spinal cord transection (Moreau-Favarque et al., 2003). At the same time, injured rubrospinal neurons continue to express mRNA of only one of the two neuropilins, Nrp-2, up to 56 days after thoracic spinal cord transection (De Winter et al., 2002). By 7 days after cervical spinal cord injury, expression of regeneration associated genes, such as GAP-43 and Tal-tubulin mRNA, are found to be the highest in rubrospinal neurons (Tetzlaff et al., 1991; Fernandes et al., 1999), suggesting a maximal regenerative capacity at this time. Results from this thesis show that by 7 days after rubrospinal tract axotomy, expression of Plxn-Al mRNA and protein and Plxn-A4 mRNA is maintained and does not change between injured and contralateral uninjured rubrospinal neurons. In contrast, at 7 days after spinal cord injury, a substantial increase in Plxn-A2 mRNA expression is seen in injured vs. uninjured rubrospinal neurons, a difference in expression that is not seen by 14 days after injury. These results, would suggest that the semaphorin receptor complex present in injured rubrospinal neurons consists of Nrp-2 and Plxn-Al, -A2 or -A4 receptors and that the expression of these receptors are maintained. 75  Table 3 Expression of Sema3A, Neuropilins, all Class-A plexins as well as Plexin-B 1 in injured rubrospinal neurons and facial motoneurons, 7 and 14 days after axotomy Rubrospinal Neurons  Facial Motoneurons  Days Post-Injury  7 days  14 days  7 days  14 days  Sema3A  BDL  BDL  4'  ?  Nrp-1 Nrp-2  BDL  «->•  ?  T  •«—»  Plxn-Al Plxn-A2 Plxn-A3 Plxn-A4 Plxn-Bl  <—>  T*  4 1 T  3  3  BDL  2  2 «—>  2 <—>  t  <—>  BDL  BDL  <—>  4  BDL  BDL  2  \ i  T T  BDL  <—>  BDL  Blue - results from this study 1. Pasterkamp et al.,1998a, 2. De Winter et al., 2002,3. Pasterkamp and Verhaagen, 2001b * Confirms De Winter and colleagues' (2002) study of P l x n - A l mRNA expression in rat rubrospinal neurons after thoracic spinal cord transection, t - m R N A expression was statistically higher in injured vs. uninjured neurons I - mRNA expression was statistically lower in injured vs. uninjured neurons <-> - m R N A expression was not different between injured vs. uninjured neurons "a - m R N A expression decreased in injured vs. uninjured neurons but not significantly BDL - mRNA was below detection levels  The continued expression of Plxn-Al mRNA and protein in injured mouse rubrospinal neurons over all time points observed in this study extends those from a previous study. Whereas De Winter and colleagues (2002) compared Plxn-Al mRNA expression in rubrospinal neurons of rats with a complete thoracic spinal cord transection to ones with no spinal cord injury at all, the present study has quantified Plxn-Al mRNA expression in injured compared to contralateral uninjured rubrospinal neurons after a cervical spinal cord hemisection. This would suggest that Plxn-Al mRNA expression does not change in cervically (this study) or thoracically (De Winter et al., 2002) axotomized rubrospinal neurons, unlike the higher expression of regeneration associated genes (RAGs) in cervically compared to thoracically axotomized rubrosapinal neurons in rats (Fernandes et al., 1999). Plxn-Al, along with Nrp-2, has been shown to transduce a variety of class 3 semaphorin signals including Sema3C and 3F in vitro (Rohm et al., 2000a). 76  As both Sema3C and 3F are expressed at the spinal cord injury site (De Winter et al., 2002), this suggests that injured rubrospinal neurons may retain the ability to transduce these semaphorin signals in vivo. The absence of Nrp-1 mRNA in rubrospinal neurons (De Winter et al., 2002) is of particular interest as in vitro work has shown that Sema3A signals are transduced by a receptor complex composed of Nrp-1 homodimers (Chen et al., 1997; Feiner et al., 1997; Takahashi et al, 1998; Giger et al., 1998b; Giger et al., 2000; Table 1). Therefore, although signals from other semaphorins at the spinal cord injury site would be transduced, rubrospinal neurons should not respond to Sema3A. The absence of Plxn-A3 mRNA in rubrospinal neurons is surprising, in light of Sema3F signaling, as previous work has pointed to the importance of a Nrp-2 :Plxn-A3 as the Sema3F receptor complex (Cheng et al., 2001; Bagri et al., 2003). Although it is possible that levels of Plxn-A3 may be so low as to be below detection levels, the expression of Plxn-A3 mRNA in other neuronal populations, such as facial motoneurons, supports an absence of Plxn-A3 mRNA in rubrospinal neurons. The low levels or absence of Plxn-A3 mRNA in CNS neurons compared to other class-A plexins may be a feature of CNS neurons as Plxn-A3 mRNA is largely absent from all layers of the sensory cortex in mice (Murakami et al., 2002; Suto et al., 2003). Sema3F does not signal through Plxn-A4, as previous work has shown that despite continued Plxn-A4 expression, sympathetic ganglia lacking Plxn-A3 expression lose Sema3F-induced repulsion in vitro (Cheng et al., 2001). Therefore, in rubrospinal neurons, Sema3F is likely to signal through either a Nrp-2:Plxn-Al receptor complex (Takahashi et al., 1999), or aNrp-2:Plxn-A2 receptor complex, though this has yet to be shown. As Plxn-A3, in combination with either Nrp-1 or Nrp2, does not result in Sema3 A-induced cell contraction in vitro (Takahashi and Strittmatter, 2001), the absence oiPlxn-A3 mRNA in rubrospinal neurons further supports the idea that injured rubrospinal neurons will remain responsive to many class 3 semaphorins in vivo. Another class 3 semaphorin present at the spinal cord injury site with guidance effects on injured rubrospinal neurons is Sema3C. Although Sema3C is thought to signal through a receptor complex formed with Nrp-1 :Nrp-2 heterodimers (Chen et al., 1997), the ability of Sema3C to bind neuronal populations expressing only Nrp-2 (Giger et al., 2000), as well its preferential in vitro interaction with Nrp-2 over Nrp-1 (Bagri and Tessier-Lavigne, 2002), suggests that Sema3C is able to interact with the complement of receptors expressed on rubrospinal neurons. Similarly, Sema3B and Sema3D also appear to signal through neuropilins, including them also as potential guidance molecules for rubrospinal axons (Takahashi et al., 1998; Wolman et al., 2004). To date, no studies have confirmed a role for class A plexins in the 77  signal transduction of Sema3B, 3C or 3D, and future analysis of this, through a combination of genetic manipulations of plexins coupled with in vitro repulsion assays, will be essential in understanding which class 3 semaphorins will be important in promoting regeneration of injured rubrospinal neurons. The large Plxn-A2 mRNA increase in injured rubrospinal neurons is of particular interest, as there is very little evidence to date for any large functional differences between any of the class-A plexins. This study is therefore, the first to suggest that Plxn-A2 may play a different injury-induced role compared to Plxn-Al and -A4 at least in injured rubrospinal neurons. This is despite the distinct but overlapping expression patterns of the four class-A plexin family members during development and into adulthood, especially with Plxn-A2 having the most restricted expression (Murakami et al., 2001). To date, the only study pointing to any functional differences between class-A plexins has shown that the intracellular domain of Plxn-Al, but not of either Plxn-A2 or -A3, will interact with that of Plxn-Bl in vitro (Usui et al., 2003). Although the absence of Plxn-Bl mRNA signal in either facial or rubrospinal neurons in this study suggests that a Plxn-Al :Plxn-Bl interaction will not occur, the specificity of this interaction in vitro supports the view that plexins may interact with different receptors as well as possibly different downstream signaling molecules. A further implication of increased Plxn-A2 mRNA in rubrospinal neurons is that this may result in an increased sensitivity of neurons to certain class 3 semaphorin family members. For example, Sema3C has been shown to bind with greater affinity to a receptor complex formed with Nrp-2:Plxn-Al over a Nrp-2:Plxn-A2 receptor complex in vitro (Rohm et al., 2000a). Although, the functional implications of this interaction have still to be examined, this would suggest that in injured rubrospinal neurons, an increased Plxn-A2 receptor expression would favor an interaction with Sema3C, possibly over other class 3 semaphorins. Even though Sema3C repulses sympathetic neuron axon in vitro (Giger et al., 1998b), Sema3C can also attract a number of neuronal populations in vitro, including cortical axons (Bagnard et al., 1998; 2000), and cerebellar granule neurons (Moreno-Flores et al., 2003). Similarly, Sema3B can attract rat olfactory bulb axons (de Castro et al, 1999), while Sema3D attracts zebrafish telencephalic axons (Wolman et al., 2004) in vitro. An increase in Plxn-A2 expression in injured rubrospinal neurons may therefore, increase sensitivity of regenerating axons to Sema3C, as well as other semaphorins, thereby acting as a chemoattractant rather than a chemorepellent. This would then suggest that increased attraction to certain semaphorins may be a necessary component of  78  successful regeneration, aiding axon guidance towards target tissues in an environment filled with positive as well as negative guidance cues. Paradoxically, if in fact Plxn-A2 were to serve an attractive, as opposed to repulsive, role in response to semaphorin, the continued expression of semaphorins at the injury site (De Winter et al., 2002) would create an attractive zone that may act to keep axons and inhibit growth past the injury site. The decreased levels of Plxn-A2 mRNA in injured rubrospinal neuron, 14 days after spinal cord lesion, may then represent a decrease in regenerative capacity of neurons, possibly due to a lack of trophic support from the injury site. Again, further characterization of the binding properties of class-A plexins, as well as the role of semaphorins on rubrospinal neurons will be necessary to better understand this. The ability of rubrospinal neurons to respond to many class 3 semaphorins but not Sema3A, as suggested by the absence of Nrp-1 (De Winter et al., 2002) and Plxn-A3 expression (this study), conflicts with the projection pattern of rubrospinal axons in the spinal cord. In the rat, rubrospinal tract fibers travel along the dorsolateral funiculus of the spinal cord, and appear to project mainly to spinal cord dorsal lamina IV, V, VI and VIII while making synaptic connections with ventral motoneurons located in lamina IX of the spinal cord (Kuchler et al., 2002). Although rubrospinal synapses with ventral motoneurons are rare, they occur despite the presence of Sema3A (Messersmith et al., 1995), 3C (Puschel et al., 1995) and 3D (Sheperd et al., 1997) in the ventral half of mouse, rat and chicken spinal cord. The expression of various semaphorins in the ventral grey matter could help to restrict projections of rubrospinal axons to dorsal laminae, but does not explain how rubrospinal axons project to the dorsal lamina IX of the spinal cord. This may be accounted either by a developmental change in the Sema3 A receptor complex, possibly through a change in plexin or neuropilin receptor expression, making certain axons less or more sensitive to any ventrally expressed Sema3 A during development. In support of this, corticospinal tract lesion of adult rat spinal cord and subsequent treatment with an antiNo go antibody (IN-1) can lead to sprouting of rubrospinal tract axons into the ventral grey matter and the formation of functional contacts with ventral motoneurons (Raineteau et al., 2002). This could be aided in part by the inability of rubrospinal neurons to respond to any ventrally expressed Sema3 A seen in the adult spinal cord. The possibility that Plxn-A2, and for that matter other class-A plexins, serve a role independent of semaphorin signal transduction should be taken into consideration as well. Early studies which identified Plxn-Al have shown that transfection of mouse fibroblast cells with Xenopus Plxn-Al resulted in a calcium-dependent homophilic cell adhesion of mouse fibroblast 79  in vitro (Ohta et al., 1995). A similar calcium-dependent cell aggregation is seen when various cells are transfected with Plxn-A3 in vitro, while interestingly, overexpression of Plxn-A3 in canine epithelial cells results in a strong repulsion of adjacent mesenchymal cells in vitro (Tamagnone et al., 1999). These semaphorin-independent roles of plexins have largely been ignored to date, and it will be interesting to see firstly, whether either Plxn-A2 or -A4 are also able to mediate similar responses in vitro and in vivo and secondly, whether these roles may play a role in axon guidance and regeneration. Another intriguing finding from this study was the apparent absence of Plxn-Bl mRNA expression in injured as well as uninjured rubrospinal and facial neurons. Plxn-Bl is the putative Sema4D receptor in vitro (Tamagnone et al., 1999), and is able to mediate Sema4D-induced growth cone collapse of embryonic rat hippocampal neuron growth cones in vitro (Swiercz et al., 2002) . This evidence would suggest that Plxn-Bl expressed on injured neurons would transduce inhibitory signals from Sema4D, which expression after spinal cord injury is upregulated in oligodendrocyte cell bodies and myelin proximally and distally to the spinal cord injury site (Moreau-Favarque et al., 2003). Furthermore, the ability of Sema4D to repel mature DRG, granule cell axons and hippocampal cell axons (Swiercz et al., 2002; Moreau-Favarque et al., 2003) suggests that Sema4D, along with MBP, PLP and versican, all expressed on oligodendrocytes after spinal cord injury (Sandvig et al., 2004), may function as a potent myelin inhibitor of axonal regeneration. Plxn-Bl mRNA was not detected in injured or contralateral control rubrospinal or facial neurons at all the time points observed in this study. This is in agreement with previous research showing that Pxn-Bl mRNA does not appear to be widely expressed in post-mitotic neurons in mice (Cheng et al., 2001; Moreau-Favarque et al., 2003; L. Tamagnone, pers. comm.) and puts into question the importance of Plxn-Bl in mediating any Sema4D-induced inhibitory signaling on injured CNS neurons in vivo. In contrast to the limited Plxn-Bl mRNA described so far, Swiercz and colleagues (2002) have reported a ubiquitous Plxn-Bl protein expression in adult mouse brain neurons with a commercially prepared antibody. The stark contrast between Plxn-Bl mRNA and protein expression is hard to explain other than the possibility that like Plxn-A3 mRNA in rubrospinal neurons, Plxn-Bl mRNA levels are below detection levels in this experiment, although some expression was found in cerebellar neurons, in agreement with other researchers (Moreau-Favarque et al., 2003). Non-commercially prepared mouse anti-Plxn-Bl antibodies exist (Barberis et al., 2004), and it will be essential to compare expression of these with the commercial Plxn-Bl antibody to confirm Plxn-Bl mRNA and protein expression patterns. The absence of neuronal Plxn-Bl mRNA signal lead Moreau80  Favarque and colleagues (2003) to suggest that CD72, a C-type lectin receptor of Sema4D mainly expressed on immune T-cells (Kumanogoh et al., 2000), may be the functional receptor for Sema4D in adult CNS neurons. Although specific analysis of Sema4D and CD72 interactions in neurons will have to be carried out, the wide CD72 mRNA expression in the adult mouse nervous system, suggests that it and not plexin-Bl, may function to transduce Sema4D inhibitory signals in mature axons (Moreau-Fauvarque et al., 2003). An anlaysis of CD72 mRNA and protein expression in injured CNS and PNS neurons will be essential to understand the role of Sema4F in nerve regeneration. Finally, if certain plexins are to be targeted as a strategy to inhibit semaphorin signaling and promote regeneration, differences in in vivo response of separate CNS neuronal populations to semaphorin will have to be further analyzed. This is underscored by differences in semaphorin receptor expression on rubrospinal and corticospinal neurons, and by extension, a difference in response of these two neuronal populations to class 3 semaphorins. In the rat, rubrospinal neurons continue to express only Nrp-2 mRNA before and after spinal cord injury, while in cortical neurons, expression of Nrp-2 mRNA is increased in layer II and IV neurons, while Nrp1 mRNA increases in layer II neurons of the rat motor cortex up to 56 days after thoracic spinal cord injury (De Winter et al., 2002). Nrp-2 mRNA expression has also been shown to increase in rat ventral motoneurons after a ventral funiculus lesion, while Nrp-1 mRNA did not change in expression (Lindholm et al., 2004). In the uninjured motor cortex, Nrp-2 mRNA is widely expressed from layer I to VI neurons, while Nrp-1 mRNA expression was more limited to layer V neurons (De Winter et al., 2002). Like rubrospinal neurons, some cortical neurons appear to express only Nrp-2 while some express both neuropilins. This evidence points to a distinct difference in the composition of the semaphorin receptor complex of these two neuronal populations and therefore, in the ability of these neurons to respond to the various semaphorins expressed at the spinal cord injury site. Although expression patterns for the four class A plexins have only been analyzed in the mouse somatosensory cortex, cortical plexin expression appears to be as varied as neuropilin expression in the motor cortex. Plxn-Al mRNA is expressed in layers II to V of the mouse sensory cortex, Plxn-A2 mRNA is found in some cells of layer V and VI, Plxn-A3 mRNA expression is very weak and Plxn-A4 mRNA is present in layer IV neurons (Murakami et al., 2002; Suto et al., 2003). After rat thoracic spinal cord transection, Plxn-Al mRNA is present in neurons in all layers of the rat motor cortex (De Winter et al, 2002), although expression has not been quantified for any changes before and after spinal cord injury. Therefore, not only will a detailed analysis of all class A plexins expressed in injured 81  corticospinal tract neurons be necessary, but also, in vitro analysis of the guidance response of corticospinal as well rubrospinal axons to various semaphorins will be necessary, if the function of plexins and/or semaphorins is to be modulated in order to allow non-regenerating CNS neurons to overcome the inhibitory effects of semaphorins expressed at the spinal cord injury site.  -Implications of Plexin Expression in Regenerating Facial MotoneuronsAxotomized facial motoneurons in the adult mammalian nervous system are able to regenerate past the injury site and make functional connections with their target muscles (Moran and Graeber, 2004). The ability of facial motoneurons to regenerate has been correlated with an upregulation of growth associated genes such as GAP-43 and Tal-tubulin (Tetzlaff et al., 1991), and increased expression of trophic factors such as BDNF (Kobayashi et al., 1996). Unlike injured rubrospinal neurons, in regenerating rat facial motoneurons, expression of these genes is not only more pronounced but is elevated for longer periods of time (Tetzlaff et al., 1991). Although FMNs injured by a resection injury retain a cell body response typical of PNS nerves, they are not able to make functional reconnections with their targets. In contrast, a facial nerve crush injury, which leaves the epineurial, perineurial and endoneurial membranes surrounding axons intact, results in functional regeneration and a return of whisker movement as early as 7 days after injury in mice (McGraw et al., 2004). Successful reconnection of neurons with their targets is characterized by a decrease in GAP-43, Tal tubulin and actin mRNA (Tetzlaff et al., 1991) as well as an increase in mRNA for various neurofilament components (Tetzlaff et al., 1991; McGraw et al., 2002). This is true for semaphorins as well, as 36 days after sciatic nerve crush injury, when nerves have successfully reconnected with their target tissues, Sema3A mRNA expression returns to control levels (Pasterkamp et al., 1998a). Thus, in light of an inhibitory role of semaphorins towards neuronal regeneration, the increase in Plxn-Al, -A3 and -A4 mRNA we observed in injured, compared to contralateral uninjured facial motoneurons, 7 days after facial nerve resection, is somewhat perplexing. Although expression patterns for semaphorins specifically at the site of facial nerve injury have not been analyzed, by comparison, 4 days after a rat sciatic nerve crush injury, Sema3A, 3B, 3C, 3E and 3F mRNA expression has been shown to increase immediately distal to the injury site (Scarlato et al., 2003; Ara et al., 2004). Assuming that induction of plexins at neuronal cell bodies results in transport to and increased expression on regenerating growth cones, this would suggest that regenerating facial motoneuron axons would become more sensitive to any semaphorins expressed distal to the injury site. Assuming repulsion of facial motoneurons by secreted class 3 semaphorins, the increase in various semaphorins distal to the injury site 82  (Scarlato et al., 2003; Ara et al., 2004) would also provide an impenetrable barrier for regenerating motor axons. As well, unlike rubrospinal neurons, where expression of only one neuropilin may limit the sensitivity of axons to only a handful of semaphorins (De Winter et al., 2002) , both neuropilins are present on facial motoneurons after injury (Pasterkamp et al., 1998a present study), suggesting that facial motoneuron growth cones could retain the ability to respond to all semaphorins expressed at the injury site. Interestingly, Scarlato and colleagues (2003) have shown that by 4 days after a rat sciatic nerve crush injury, Sema3F mRNA expression colocalizes to fibroblasts in the epineurial, perineurial and endoneurial sheaths which make up the connective tissue surrounding axons. If in fact, expression of other semaphorins is similiarly colocalized to fibroblast cells ensheathing the regenerating nerves, this would suggest, as has previously been proposed (Scarlato et al., 2003), that the repulsive action of semaphorins may act to ensure that regenerating facial motoneuron axons correctly follow their trajectory towards appropriate target tissues. In vivo data from studies looking at semaphorin, neuropilin and plexin loss-of-function analyses support a repulsive role for these molecules on axon guidance. Mice lacking Plxn-A3 expression (Cheng et al., 2001) have a distinctly misrouted facial nerve, while in mice lacking Sema3A (Taniguchi et al., 1997), Nrp-1 (Kistukawa et al., 1997) and Nrp-2 (Giger et al., 2000), and to a lesser extent in mice lacking Sema3F (Sahay et al., 2003) expression, the facial nerve is largely defasciculated. This agrees with the theory that the expression of semaphorins along the path of regeneration acts to keep regenerating axons within the confines of the membrane surrounding the nerve. Therefore, lack of Plxn-A3 expression in regenerating neurons could therefore, dramatically alter the response of facial axons to semaphorin cues, possibly making them insensitive, and resulting in the misprojection of nerves. Of the four class-A plexins, Plxn-A2 mRNA is unique in that its expression decreases after injury in facial motoneurons. A decrease in availability of Plxn-A2 protein would mean that the majority of semaphorin receptor complexes on regenerating facial neuron growth cones would be composed of both neuropilins (Nrp-1 and Nrp-2) and the three remaining plexins which increase in expression after injury (Plxn-Al, -A3, -A4; Table 5). Thus, regenerating facial motoneurons would be able to respond to all semaphorins expressed along the regeneration path, though the decrease in Plxn-A2 expression suggests that some semaphorins would be favored over others. Like in the rubrospinal system, a lack of knowledge regarding independent roles of plexins in semaphorin signaling allows for only a speculation of why Plxn-A2 expression differs from that of other plexins. The preferential interaction of Sema3C with a Nrp-2 :Plxn-A2, or a Nrp-1 :Plxn-A2 receptor complex (Rohm et al., 2000a) suggests that regenerating facial 83  motoneurons axons will not interact as strongly with any Sema3C seen in the distal nerve stump (Ara et al., 2004). In contrast, the same in vitro data showed a preferential binding of Sema3A to a Nrp-1 :Plxn-Al or Nrp-2:Plxn-Al receptor complex over one with Plxn-A2 (Rohm et al., 2000a). Therefore, in the context of regenerating facial motoneurons, a decrease in Plxn-A2 expression may decrease the availability of Plxn-A2 to form Sema3A receptor complexes at growth cones, resulting in an increased sensitivity to Sema3A expressed along the regeneration path through Sema3A binding to growth cones. The loss of Plxn-A2 may also lead to a decreased sensitivity to any Sema3 A expressed by uninjured facial motoneurons. Endogenous Sema3A expression is thought to act as autocrine/paracrine "break" preventing any spurious and possibly deleterious branching of uninjured axons (Pasterkamp et al., 1998a). This study provides further evidence for a autocrine/paracrine role for Sema3 A, and possibly other class 3 semaphorins, in uninjured neurons by showing that along with Nrp-1 (Pasterkamp et al., 1998a), the full class 3 semaphorin receptor complex (Nrp-2, Plxn-A1~A4) is present on uninjured facial motoneurons. Thus, the increase in certain plexins after axotomy, may be a necessary step in the successful regeneration of facial motoneurons, by increasing the sensitivity of growth cones to semaphorins, thus allowing for the correct navigation through the inhibitory milieu present distal to axotomy. There is also a possibility that signaling by secreted class 3 semaphorins through plexins may not result in repulsion, but the attraction of regenerating facial motoneuron axons. For example, recent work has shown that Plxn-A4 expression in zebrafish sensory axons promoted branching, and not repulsion of these axons in vivo (Miyashita et al., 2004). As previously described, various semaphorins have also been shown to have attractive properties on certain neuronal populations such cortical apical dendrites by Sema3A (Polleux et al., 2000), cortical axons by Sema3C (Bagnard et al., 1998; 2000). A thorough in vitro investigation in to the role that various plexin receptor combinations play in response to class 3 semaphorin signaling will be necessary to differentiate between repulsive and attractive effects on peripheral neurons. Whereas Plxn-Al, -A3, -A4 mRNA similarly increased in facial motoneurons 7 days after axotomy, the expression patterns were more distinct by 14-days after axotomy. In the resection injury paradigm, where a small portion of nerve is removed to prevent reconnection of the distal and proximal facial nerve stumps, regenerating axons will form a neuroma along with other connective tissue (Fu and Gordon, 1997). The high Plxn-A3 mRNA expressed in facial motoneurons, 14 days after facial nerve axotomy is similar to the expression patterns of molecules generally associated with regeneration. For example, regeneration associated genes: 84  GAP-43, Tal tubulin (Tetzlaff et al, 1991), cytoskeletal proteins: actin (Tetzlaff et al., 1991), intermediate filament (McGraw et al., 2002), as well as other molecules such as Galectin-l mRNA, a carbohydrate-binding protein (McGraw et al., 2004), are all expressed at higher levels in injured compared to contralateral uninjured facial motoneurons, 14 days after axotomy. Preliminary analysis of Plxn-A3 mRNA expression in crushed facial motoneurons, 14 days after axotomy, showed that expression between injured and contralateral uninjured neurons did not change. Although this analysis is from only one animal, these results suggest that the increased Plxn-A3 mRNA expression in facial motoneurons 14 days after resection injury, may be due to a loss of target specific factors, which would be restored in facial motoneurons by 14 days after a crush injury. Expression of Plxn-Al and -A4 mRNA in injured facial motoneurons, on the other hand, retuned to levels either comparable or less than that of contralateral uninjured neurons by 14 days after resection injury. The decreased Plxn-Al and -A4 mRNA expression may be indicative of changes in injured neurons caused by lack of trophic support from target tissues or possibly, a modulation of gene expression by factors present in the neuroma (McPhail, 2004a). Further work analyzing mRNA expression after removal of neuroma and/or application of trophic factors will be necessary to better understand the temporal modulation of Plxn-Al and -A4 mRNA in axotomized facial motoneurons. Axotomized mouse and rat facial motoneurons will successfully reconnect with target tissues as early as 7 and 13 days respectively characterized by a return of whisker movements at these times (Kamijo et al., 2003; McGraw et al., 2004). Despite this, retrograde tracing from rat whisker muscles show that the myotopic organization of neurons in the facial nucleus is not retained after regeneration (Tomov et al., 2002). In the context of our results, this would suggest that plexins, and by extension secreted class 3 semaphorins, may play a greater role in correct growth cone guidance towards appropriate targets, rather than in the accuracy of synapse formation. Although we have not compared the expression patterns of plexins in facial motoneurons after a nerve crush compared to a resection injury, we expect that by 14 days after axotomy, when most functional synaptic connections have been restored, plexin expression will return to levels comparable to those before axotomy. In support of this, recent work has shown that in the developing mouse olfactory system, Nrp-2 as well as Sema3F play a role in fasciculation and guidance of vomeronasal neuron axons towards the anterior accessory olfactory bulb (Cloutier et al., 2002; 2004), while specific targeting of axons to the anterior accessory olfactory bulb is accomplished by Slit-1 (Cloutier et al., 2004), a-largely chemorepulsive guidance cue important during development (Tear, 2001). Thus, a return of class 85  A plexin expression to levels in regenerated injured facial motoneurons, to those of the contralateral uninjured motoneurons, as well as continued Nrp-1 (Pasterkamp et al., 1998a) and Nrp-2 expression, may be necessary to inhibit any aberrant sprouting through autocrine/paracrine signaling from Sema3A expressed in motoneurons (Pasterkamp et al., 1998a), that have successfully reconnected with target tissues; Whether plexins and by extension semaphorins and neuropilins are responsible for the guidance, as opposed to synaptic targeting regenerating facial motoneuron axons, could be investigated by observing the regeneration of crushed facial motoneurons axons in animals lacking either plexins or semaphorins. Using multiple retrograde staining of specific muscles and therefore specific neuronal groups in the facial nucleus (Tomov et al., 2002), one could observe for the presence or absence of myotopic reorganization in animals lacking, for example Plxn-A3 (Cheng et al., 2001). If animals lacking either plexins and/or semaphorins continue to show a lack of myotopic organization of facial motoneurons, this would support the view that semaphorins are involved in the guidance and target specificity of regenerating axons, a finding that would need to be taken into consideration if plexins and semaphorins are to be targeted to enhance CNS regeneration. Unlike the increase in Plxn-Al mRNA expression, Plxn-Al protein immunoreactivity did not differ between injured and contralateral uninjured facial motoneurons. The difference in expression pattern may be accounted for by two alternative explanations. The first would be due to post-translational modification resulting in a subsequent loss of protein signal. A decrease in Plxn-Al protein expression may then result either from a decreased ribosomal output or shunting of protein from cell membrane directed vesicles to cell degradation machinery although such mechanisms for plexin proteins have not been identified to date. The second and more likely explanation would be due to increased protein transport to the regenerating growth cones. The presence of Plxn-Al on growth cones is supported by in vitro evidence showing the localization of Plxn-Al protein to inferior collicular neurite growth cones in vitro (Murakami et al., 2001) as well as the coclustering of Plxn-Al and Nrp-1 on embryonic chick DRG growth cones in response to a Sema3A source (Takahashi et al., 1999; Fournier et al., 2000). If in fact, Plxn-Al protein were to be transported to regenerating growth cones in order to form functional receptor complexes, this would account for the apparent discrepancy between Plxn-Al mRNA and protein expression in injured facial motoneurons. To confirm this, it is necessary to localize Plxn-Al immunoreactivity to either rubrospinal or facial regenerating growth cones. For rubrospinal neuron growth cones, immunohistochemical analysis of transverse spinal cord sections in close proximity to the spinal cord injury site would identify any Plxn-Al protein 86  expression in growth cones. Similarly, immunohistochemical analysis of Plxn-Al protein expression in sections containing ligated facial nerves would identify any Plxn-Al expressing facial neuron growth cones as well as any protein accumulation proximal to the ligation, suggesting transport of protein to regenerating growth cones. Conversely, if Plxn-Al protein is transported to growth cones along nerve axons through vesicles, then inhibition of axon transport with inhibitors such as colchicine or vinblastine, both inhibitors of microtubule assembly and therefore, transport on microtubules (Aldskogius and Svensson, 1988). Either inhibitor could then be placed onto the proximal nerve stump to inhibit protein transport and Plxn-Al immunoreactivity could be analyzed in injured facial motoneurons, 7 days after injury. Localization of other plexins to growth cones will be necessary as other plexin-binding antibodies become available. In the spinal cord injury model, it will be particularly interesting to see whether retrogradely traced rubrospinal neuron growth cones express both plexins and neuropilins and whether these growth cones will avoid areas positive for class 3 semaphorins. The avoidance of Sema3 expressing cells by such growth cones would greatly support a role for plexins and neuropilins as mediators of semaphorin-induced regeneration failure. For example, after bulbectomy injury in the rat olfactory system, Nrp-1 positive axons were seen to grow past the Sema3A mRNA expressing cribiform plate, only to become surrounded by Sema3A mRNA expressing cells in the bulbar cavity (Pasterkamp et al., 1998b). In vitro analysis has shown that class-A plexin-neuropilin interactions are essential to mediate semaphorin-induced growth cone collapse, although such an interaction still needs to be confirmed in vivo. The importance of lipid rafts in semaphorin signaling also points to another possible marker that could be used to identify as well as disrupt formation of the plexin:neuropilin semaphorin receptor complex. Sema3 A-induced growth cone repulsion of cultured Xenopus neuron growth cones is mediated by Nrp-1 localization to cholesterol-rich lipid rafts while disruption of lipid rafts abolishes Sema3A inhibitory effects on Xenopus growth cones in vitro (Guirland et al, 2004). This suggests that the clustering of Plxn-Al and Nrp-1 on embryonic chick DRG growth cones in response to Sema3A activation in vitro (Takahashi et al., 1999; Fournier et al., 2000) may be occurring on lipid raft domains located in the growth cone cell membrane. Firstly, the in vitro presence of plexins on lipid rafts will have to be determined in order to ensure that the entire semaphorin receptor complex is present on lipid rafts. Then, colocalization of plexin and neuropilin proteins to cholesterol-rich lipid rafts could be determined immunohistochemically on sections containing injured regenerating facial or rubrospinal neuron growth cones, and then compared to contralateral uninjured counterparts. As 87  well, in vivo inhibition of lipid raft formation, or various components of lipid rafts, may present a novel approach to promoting nerve regeneration of injured CNS neurons. Disruption of lipid rafts can cancel the repulsive effects of Sema3A and Netrin-1 signaling on Xenopus growth cones in vitro (Guirland et al., 2004), as well as attenuate inhibitory signaling from other molecules such as Nogo-66 (Yu et al., 2004) and MAG (Vinson et al., 2003). As lipid rafts appear to be a focal point for the accumulation of various signaling mechanism, decreasing raft formation in vivo, through targeting of cholesterol or other lipid raft components such as gangliosides (Guirland et al., 2004) may help to promote the successful regeneration of injured CNS growth cones into and past the spinal cord injury site.  -Implications of Neuropilin-2 Expression in Regenerating Facial MotoneuronsPrevious work had identified Nrp-1 mRNA expression in injured facial motoneurons, and shown that expression did not differ between injured and contralateral uninjured facial motoneurons (Pasterkamp et al., 1998a). The presence of Nrp-1 on facial motoneurons would only account for an interaction with any Sema3A that would be expressed along the regeneration path of facial motoneurons axons, but not signals from any of the other semaphorins that have been shown to be expressed distal to the sciatic nerve injury site (Scarlato et al., 2003), and therefore, presumably in the severed facial nerve distal stump. As a variety of class 3 semaphorins have been shown to interact either with Nrpl:Nrp-2 homodimers (Sema3B, 3C, 3D) or Nrp-2 homodimers (Sema3F), we felt it was essential to analyze Nrp-2 expression in injured facial motoneurons to create a complete picture of the secreted class 3 semaphorin receptor complex in these neurons. The importance of Nrp-2 in facial motoneurons is suggested by the defasciculated facial nerves in mice lacking Nrp-2 expression (Chen et al., 2000; Giger et al., 2000). Brief analysis of Nrp-2 protein expression, indicated that at 3 and 7 days after injury, Nrp-2 protein expression appeared to be higher in injured compared to contralateral uninjured facial motoneurons, although the apparent increase may be accounted for by the hypertrophy of facial motoneurons seen at 3 and 7 days after injury (Tetzlaff et al., 1991). By 14 days, this difference was not apparent, and expression returned to normal. Although Nrp-2 protein expression needs to be quantified and confirmed with a western blot, this and previous work suggest that injured facial motoneurons express both neuropilins. Continued Nrp-2 protein expression in injured facial motoneurons would suggest that facial motoneurons will remain responsive to all secreted class 3 semaphorins, depending on which semaphorins are present along the regeneration path. As the antibody utilized in this study identifies all Nrp-2 variants, it will be interesting to analyze if there are any differences in expression patterns of different Nrp-2 88  variants (Chen et al., 1997; Gagnon et al., 2000; Rossignol et al., 2000) and what role these would play in the regeneration response of facial motoneurons.  -Plexin and Their Interactions with Other Molecules on Injured MotoneuronsAn increasing body of evidence has suggested a link between semaphorin and integrin signaling in the modulation of cytoskeletal dynamics resulting in axon guidance (Nakamoto et al., 2004). Integrins are part of the larger family of cell adhesion molecules (CAM), which mediate cell to cell as well as cell to extracellular matrix interactions through specialized cell membrane structures called focal adhesion complexes (Clegg, 2000). Semaphorins can bind directly to integrins, as has been shown for Sema7A and /31-integrin (Pasterkamp et al., 2003), or as with class 3 semaphorins, can either interact indirectly with integrins through neuropilins (Castellani et al., 2000; 2002), or through modulation of signaling pathways ultimately leading to disassembly of adhesive structures in endothelial (Serini et al., 2003; Barberis et al., 2004) or neuronal cells (Mikule et al., 2002). For example, Sema3A-mediated loss of E l 5 rat DRG growth cone adhesion sites in vitro involves signaling through 12/15-lipoxygenase, a product of arachidonic acid metabolism, which may provide a link to integrin signaling (Mikule et al., 2002), while in cultured endothelial cells, Sema3 A signaling can modulate integrin function by antagonizing integrin mediated cell adhesion and migration (Serini et al., 2003). Furthermore, semaphorin mediated modulation of cell adhesion of mouse fibroblast cells in vitro has been shown to involve the disassembly of focal adhesion complexes through downstream intracellular signaling from Plxn-Al as well as Plxn-Bl (Barberis et al., 2004). This has lead Barberis and colleagues (2004) to propose a "molecular clutch" model, in which integrin-mediated adhesion is blocked to allow the redirection of regenerating growth cones in response to plexin-mediated semaphorin signaling. Furthermore, increased integrin expression has been associated with facial motoneuron regeneration through a mechanism involving adhesion of integrin on growth cones to their binding partners, laminins, present on Schwann cells and the basal lamina along the regeneration path (Kloss et al., 1999; Werner et al., 2000). Inhibiting plexin signaling may therefore promote regeneration of not only facial motoneurons, but also of rubrospinal neurons, by blocking plexin mediated inhibition of integrin signaling. A potential candidate for blocking inhibition of integrin signaling through plexins could be through cinnamyl-3,4-dihydroxy-acyanocinnamate (CDC), an inhibitor of 12/15-lipooxygenase, which has been shown to attenuate semaphorin-induced growth cone collapse of rat DRGs (Mikule et al., 2002) as well as mouse fibroblasts in vitro (Barberis et al., 2004).  89  Apart from the indirect interaction of plexins and integrins, LI, a neural CAM, is implicated in Sema3A mediated growth cone collapse in vitro (Castellani et al., 2000; 2002), pointing to a direct interaction of plexins, neuropilins and LI molecules as the functional receptors on facial motoneuron growth cones. Lipid rafts on regenerating axons may provide a focal point for all these molecules as Sema3A, Nrp-1, Plxn-Al and racl (Fournier et al., 2000; Guirland et al., 2004) as well as LI (Nakai and Kamiguchi, 2002), have been localized to lipid rafts in vitro. Fu and Gordon (1997) have also suggested that NGF expressed after a peripheral nerve injury may act to promote neurite outgrowth as well as interaction between LI expressed on axons and Schwann cells present along the regeneration path. Therefore, a semaphorin receptor complex composed of plexins, neuropilins and LI may contribute to the correct guidance of regenerating axons towards their target tissues. Further analysis of any plexin:Ll interactions will be crucial to understating this. As previously mentioned, the in vitro Sema7A and /31-integrin interaction (Pasterkamp et al., 2003) may also play a role in successful facial motoneuron regeneration depending on any Sema7A present along the regeneration path. Finally, apart from semaphorin-integrin interactions, mounting in vitro (Tuttle and O'Leary, 1998; Gagliardini and Fankhauser, 1999; Reza et al., 1999; Atwal et al., 2003; Dontchev and Letourneau, 2003), as well as in vivo (Tang et al., 2004) evidence supports a role for semaphorin in neurotrophin signaling in the guidance of axons. The implications in the regeneration response of not only CNS, but also PNS neurons after injury is underscored by the various neurotrophins have been shown to promote the rubrospinal (Tetzlaff et al., 1994; Kobayashi et al., 1997; Kwon et al., 2002a) as well as facial motoneuron (Fernandes et al., 1998; Hottinger et al., 2000; Barras et al., 2002; Sakamoto et al., 2003; McPhail, 2004a) regeneration response after injury. Lipid rafts again, may provide a platform where Trk and p75 receptors, along with plexins and neuropilins may come into close proximity and thereby interact. If the semaphorin receptor complex is to be targeted through disruption of lipid rafts on regenerating axons, the effects of this on neurotrophin signaling will have to be taken into account. Further research will need to be carried out to identify plexin, neuropilin and neurotrophin interaction in vitro as well as in vivo.  -Final RemarksThis study has, for the first time, compared the expression patterns of Plxn-Al mRNA and protein as well as Plxn-A2, -A3, -A4 and -Bl mRNA in injured CNS vs. PNS motoneurons. Plxn-Al~A4, along with Nrp-1 and -2 form the receptor complex for the secreted class 3 semaphorins. Although there are some exceptions, most plexins were found to be present in both 90  injured rubrospinal and facial motoneurons, with their expression either being maintained or increased after injury, suggesting their involvement in the regenerative process that occurs after nervous system injury. Further studies will focus on understanding the role that these various plexins play in the in vivo injury response of both CNS and PNS motoneurons through the use of function blocking peptides/antibodies directed against candidate plexins or genetic manipulations of plexin expression by knock-out studies. If modulation of semaphorin signaling can indeed play a beneficial role in the regenerative response of injured neurons, determining whether other plexins are affected by injury will be crucial in picking the best candidates to manipulate. Ultimately, the manipulation of semaphorin signaling through modulation of plexin receptor expression will be used as part of a combinatorial approach to overcoming the injuryinduced signals present at the spinal cord injury site to allow regenerating nerves grow into and past the spinal cord injury site.  91  REFERENCES  Adams RH, Betz H, Puschel AW (1996) A novel class of murine semaphorins with homology to thrombospondin is differentially expressed in early embryos. Mech. Dev. 57:33-45. Aizawa H, Wakatsuki S, Ishii A, Moriyama K, Sasaki Y, Ohashi K, Sekine-Aizawa Y, SeharaFujisawa A, Mizuno K, Goshima Y, Yahara I (2001). Phosphorylation of cofilin by LEVl-kinase is necessary for semaphorin 3A-induced growth cone collapse. Nat. Neurosci. 4:367-373. Aldskogius H, Svensson M (1988) Effect on the rat hypoglossal nucleus of vinblastine and colchicine applied to the intact or transected hypoglossal nerve. Exp. Neurol. 99:461-73. Antipenko A, Himanen JP, van Leyen K, Nardi-dei V, Lesniak J, Barton WA, Rajashankar KR, Lu M, Hoemme C, Puschel AW, Nikolov DB (2003) Structure of the semaphorin-3 A receptor binding module. Neuron 39:589-598. Ara J, Bannerman P, Hahn A, Ramierz S, Pleasure D (2004) Modulation of sciatic nerve expression of class 3 semaphorins by nerve injury. Neurochem. Res. 29:1153-1159. Arimura N, Inagaki N, Chihara K, Menager C, Nakamura N, Amano M, Iwamatsu A, Goshima Y, Kaibuchi K (2000) Phosphorylation of collapsing mediator protein-2 by Rho-kinase. J. Biol. Chem. 275:23973-23980. Artigiani S, Comoglio PM, Tamagnone L (1999) Plexins, semaphorins, and scatter factor receptors: A common root for cell guidance signals? 1UBMB Life 48:477-482. Artigiani S, Conrotto P, Fazzari P, Gilestro GF, Barberis D, Giordano S, Comoglio PM, Tamagnone L (2004) Plexin-B3 is a functional receptor for semaphorin5A. EMBO Rep. 5:1-5. Atwal JK, Singh KK, Tessier-Lavigne M, Miller FD, Kaplan DR (2003) Semaphorin 3F antagonizes neurotrophin-induced phosphatidylinositol 3-kinase and mitogen-activated protein kinase kinase signaling: A mechanism for growth cone collapse. J. Neurosci. 23:7602-7609. Aurandt J, Vikis HG, Gutkirtd JS, Ahn N, Guan K L (2002) The semaphorin receptor plexin-B 1 signals through direct interaction with the Rho-specific nucleotide exchange factor, LARG. Proc. Nat. Acad. Sci. 99:12085-12090. Bachelder RE, Lipscomb EA, Lin X, Wendt MA, Chadborn NH, Eickholt BJ, Mercurio A M (2003) Competing autocrine pathways involving alternative neuropilin-1 ligands regulate chmeotaxis of carcinoma cells. Cane. Res. 63:5230-5233. Bagnard D, Lohrum M, Uziel D, Puschel A, Bolz J (1998) Semaphorins act as attractive and repulsive guidance signals during the development of cortical projections. Development 125: 5043-5053.  92  Bagnard D, Thomasset N, Lohrum M, Puschel AW, Bolz J (2000) Spatial distributions of guidance molecules regulates chemorepulsion and chemoattraction of growth cones. J. Neurosci. 20:1030-1035. Bagnard D, Vaillant C, Khuth ST, Dufay N, Lohrum N, Puschel AW, Belin MF, Bolz J, Thomasset N (2001) Semaphorin 3A-vascular endothelial growth factor-165 balance mediates migration and apoptosis of neural progenitor cells by the recruitment of shared receptor. J. Neurosci. 21:3332-3341. Bagri A and Tessier-Lavigne M (2002) Neuropilins as semaphorin receptors: in vivo functions in neuronal cell migration and axon guidance. Adv. Exp. Med. Biol. 515:13-31. Bagri A, Cheng HJ, Yaron A, Pleasure SJ, Tessier-Lavigne M (2003) Stereotyped pruning of long hippocampal axon branches triggered by retraction inducers of the semaphorin family. Cell 113:285-299. Barberis D, Artigiani S, Casazza A, Corso S, Giordano S, Love CA, Jones EY, Comoglio PM, Tamagnone L (2004) Plexin signaling hampers integrin-based adhesion leading to Rho-kinase independent cell rounding, and inhibiting lamellipodia extension and cell motility. FASEB J. 18:592-594. Barnes G, Puranam RS, Luo Y, McNamara JO (2003) Temporal specific patterns of semaphorin gene expression in rat brain after kainic acid-induced status epilepticus. Hippocampus 13:1-20. Barras FM, Pasche P, Bouche N, Aebischer P, Zurn AD (2002) Glial cell line-derived neurotrophic factor released by synthetic guidance channels promotes facial nerve regeneration in the rat. J. Neurosci. Res. 70:746-755. Barron KD, Banerjee M, Dentinger MP, Scheibly ME, Mankes R (1989) Cytological and cytochemical (RNA) studies on rubral neurons after unilateral rubrospinal tractotomy: The impact of G M i ganglioside administration. J. Neurosci. Res. 22:331-337. Behar O, Golden JA, Mashimo H, Schoen FJ, Fishman MC (1996) Semaphorin III is needed for normal patterning and growth of nerves, bones and heart. Nature 383:525-528. Bundesen LQ, Aber Scheel T, Bregman BS, Kromer LF (2003) Ephrin-B2 and EphB2 regulation of astrocyte-meningeal fibroblast interactions in response to spinal cord lesions in adult rats. J. Neurosci. 23:7789-7800. Bradbury EJ, Moon LD, Popat RJ, King VR, Bennett GS, Patel PN, Fawcett JW, McMahon SB (2002) Chondroitinase ABC promotes functional recovery after spinal cord injury. Nature 416:636-640. Campbell DS and Holt CE (2001) Chemotropic responses of retinal growth cones mediated by rapid local protein synthesis and degradation. Neuron 32:1013-1026. Campbell DS, Regan AG, Lopez JS, Tannahill D, Harris WA, Holt CE (2001) Semaphorin 3A elicits stage-dependent collapse, turning, and branching in Xenopus retinal growth cones. J. Neurosci. 21:8538-8547. 93  Campbell DS and Holt CE (2003) Apoptotic pathway and MAPKs differentially regulate chemotropic responses of retinal growth cones. Neuron 37:939-952. Castellani V, Chedotal A, Schachner M, Faivre-Sarrailh C, Rougon G (2000) Analysis of the L l deficient mouse phenotype reveals cross-talk between Sema3A and LI signaling pathways in axonal guidance. Neuron 27:237-249. Castellani V, De Angelis E, Kenwrick S, Rougon G (2002) Cis and trans interactions of LI with neuropilin-1 control axonal responses to semaphorin 3A. EMBO J. 21:6348-6357. Castellani V, Falk J, Rougon G (2004) Semaphorin3 A-induced receptor endocytosis during axon guidance responses is mediated by LI CAM. Mol. Cel. Neurosci. 26:89-100. Catalano A, Caprari P, Rodilossi S, Betta P, Castellucci M, Casazza A, Tamagnone L, Procopio A (2004) Cross-talk between vascular endothelial growth factor and semaphorin-3A pathway in the regulation of normal and malignant mesothelial cell proliferation. FASEB J. 18:358-360. Catalano SM, Messersmith EK, Goodman CS, Shatz CJ, Chedotal A (1998) Many major CNS axon projections develop normally in the absence of semaphorin III. Mol. Cell. Neurosci. 11:173-182. Chedotal A, Del Rio JA, Ruiz M, He Z, Borrell V, de Castro F, Ezan F, Goodman CS, TessierLavigne M, Sotelo C, Soriano E (1998) Semaphorins III and IV repel hippocampal axons via two distinct receptors. Development 125:4313-4323. Chen H, Chedotal A, He Z, Goodman CS, Tessier-Lavigne M (1997) Neuropilin-2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins sema E and sema IV but not sema III. Neuron 19: 547-559. Chen H, Bagri A, Zupicich JA, Zou Y, Stoeckli E, Pleasure SJ, Lowenstein DH, Skarnes WC, Chedotal A, Tessier-Lavigne M (2000) Neuropilin-2 regulates the development of select cranial and sensory nerves and hippocampal mossy fiber projections. Neuron 25:43-56. Cheng HJ, Bagri A, Yaron A, Stein E, Pleasure SJ, Tessier-Lavigne M (2001) Plexin-A3 mediates semaphorin signaling and regulates the development of hippocampal axonal projections. Neuron 32:249-263. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD (2003) Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31:34973500. (http://www.ebi.ac.uk/clustalw/#) Chilton JK and Gurthrie S (2003) Cranial expression of class 3 secreted semaphorins and their neuropilin receptors. Dev. Dyn. 2228:726-733. Clegg DO (2000) Novel roles for integrins in the nervous system. Mol. Cell Biol. Res. Comm. 3:1-7.  94  Cloutier JF, Giger RJ, Koentges G, Dulac C, Kolodkin AL, Ginty DD (2002) Neuropilin-2 mediates axonal fasciculation, zonal segregation, but not axonal convergence, of primary accessory olfactory neurons. Neuron 33:877-892. Cloutier JF, Sahay A, Chang EC, Tessier-Lavigne M, Dulac C, Kolodkin AL, Ginty DD (2004) Differential requirements for semaphorin 3F and Slit-1 in axonal targeting fasciculation, and segregation of olfactory sensory neuron projections. J. Neurosci. 24:9087-9096. Comeau MR, Johnson R, DuBose RF, Petersen M, Geaaring P, VandenBos T, Park L, Farrah T, Buller MR, Cohen JI, Strockbine LD, Rauch C, Spriggs MK (1998) A poxvirus-encoded semaphorin induces cytokine production from monocytes and binds to a novel cellular semaphorin receptor, VESPR. Immunity 8:473-482. Conrotto P, Corso S, Gamberini S, Comoglio PM, Giordano S (2004) Interplay between scatter factor receptors and B plexins controls invasive growth. Oncogene 23:5131-5137. de Castro F, Hu L, Drabkin H, Sotelo C, Chedotal A (1999) Chemoattraction and chemorepulsion of olfactory bulb axons by different secreted semaphorins. J. Neurosci. 19:44284436. David S and Aguayo AJ (1981) Axonal elongation into peripheral nervous system "bridges" after central nervous system injury in adult rats. Science 214:931-933. De Winter F, Oudega M, Lankhorst AJ, Hamers FP, Blits B, Ruitenberg MJ, Pasterkamp RJ, Gispen WH, Verhaagen J (2002) Injury-induced class 3 semaphorin expression in the rat spinal cord. Exp. Neurol. 175:61-75. De Wit J and Verhaagen J (2003) Role of semaphorins in the adult nervous system. Prog. Neurobiol. 71:249-267. Delaire S, Billard C, Tordjman R, Chedotal A, Elhabazi A, Bensussan A, Boumsell L (2001) Biological activity of soluble CD 100. Soluble CD 100, similarly to H-Semalll, inhibits immune cell migration. Immunology 166:4348-4354. Dent EW, Barnes AM, Tang F, Kalil K (2004) Netrin-1 and semaphorin 3 A promote or inhibit cortical axon branching, respectively, by reorganization of the cytoskeleton. J. Neurosci. 24:3002-3012. Dergham P, Ellezam B, Essagian C, Avedissian H, Lubell WD, McKerracher L (2002) Rho signaling pathway targeted to promote spinal cord repair. J. Neurosci. 22:6570-6577. Dillon TE, Saldanha J, Giger R, Verhaagen J, Rochlin WM (2004) Sema3A regulates the timing of target contact by cranial sensory axons. J. Com. Neurol. 470:13-24. Dontchev VD, Letourneau PC (2003) Growth cones integrate signaling from multiple guidance cues. J. Histochem. Cytochem. 51:435-444.  95  Driessens MHE, Hu H, Nobes CD, Self, A, Jordens I, Goodman CS, Hall A (2001) Plexin-BI semaphorin receptors interact directly with active Rac and regulate the actin cytoskeleton by activatinRho. Curr. Biol. 11:339-344. Driessens MHE, Olivo C, Nagata K, Inagaki M, Collard JG (2002) B plexins activate Rho through PDZ-RhoGEF. FEBS Lett. 529:168-172. Eckhardt F, Behar O, Calautti E, Yonezawa K, Nishimoto I, Fishman MC (1997) A novel transmembrane semaphorin can bind c-src. Mol. Cell. Neurosci. 9:409-419. Eickholt BJ, Walsh FS, Doherty P (2002) An inactive pool of GSK-3 at the leading edge of growth cones is implicated in semaphorin 3A signaling. J Cell Biol. 157:211-217. Ensser A and Fleckenstein B (1995) Acephaline herpes virus type I has a semaphorin-like gene. J. Gen. Virol. 76:1063-1067. Fan J, Mansfield GS, Redmond T, Gordon-Weeks PR, Raper JA (1993) The organization of Factin and microtubules in growth cones exposed to a brain-derived collapsing factor. J. Cell Biol. 121:867-878. Fan J, Raper JA (1995) Localized collapsing cues can steer growth cones without inducing their full collapse. Neuron 14:263-274. Fawcett J (2002) Repair of spinal cord injuries: Where are we, where are we going? Spinal Cord. 40:615-623. Feiner L, Koppel AM, Kobayashi H, Raper JA (1997) Secreted chick semaphorins bind recombinant neuropilin with similar affinities but bind different subsets of neurons in situ. Neuron 19:539-545. Feiner L, Webber AL, Bron CB, Lo MM, Jia L, Feinstein P, Mombaerts P, Epstein JA, Raper JA (2001) Targeted disruption of semaphorin 3C leads to persistent truncus arteriosus and aortic arch interruption. Development. 128:3061-3070. Fernandes KJL, Kobayashi NR, Jasmin BJ, Tetzlaff W (1998) Acetylcholinesterase gene expression in axotomized rat facial motoneurons is differentially regulated by neurotrophins: Correlation with trkB and trkC mRNA levels and isoforms. J. Neurosci. 18:9936-9947. Fernandes KJL, Fan DP, Tsui BJ, Cassar SL, Tetzlaff W (1999) Influence of the axotomy of cell body distance in rat rubrospinal and spinal motoneurons: Differential regulation of GAP-43, tubulins, and neurofilament-M. J. Comp. Neurol. 414:495-510. Fernandes KJL and Tetzlaff W (2000) Gene expression in axotomized neurons: Identifying the instrinsic determinants of axonal growth. In: Ingoglia NA, Murray M, editors. Axonal regeneration in the central nervous system. New York: Marcel Dekker Inc. p. 219-266. Fournier AE, Nakamura F, Kawamoto S, Goshima Y, Kalb RG, Strittmatter SM (2000) Semaphorin3A enhances endocytosis at sites of receptor-F-actin colocalization during growth cone collapse. J. Cell Biol. 149:411-422. 96  Fournier AE, Takizawa BT, Strittmatter SM (2003) Rho kinase inhibition enhances axonal regeneration in the injured CNS. J. Neurosci. 23:1416-1423. Frisen J, Risling M, Korhonen L, Zirrgiebel U, Johansson CB, Cullheim S, Lindholm D (1998) Nerve growth factor induces process formation in meningeal cells: Implications for scar formation in the injured CNS. J. Neurosci. 18:5714-5722. Fritsche J, Reber BFX, Schindelholz B, Bandtlow C (1999) Differential cytoskeletal changes during growth cone collapse in response to hSema III and thrombin. Mol. Cell. Neurosci. 14:398-418. Fu SY and Gordon T (1997) The cellular and molecular basis of peripheral nerve regeneration. Mol. Neurobiol. 14:67-112. Fuh G, Garcia GK, de Vos A M (2000) The interaction of neuropilin-1 with vascular endothelial growth factor and its receptor Fit-1. J. Biol. Chem. 275:26690-26695. Fujisawa H, Ohtsuki T, Takagi S, Tsuji T (1989) An aberrant retinal pathway and visual centers in Xenopus tadpoles share a common cell surface molecule, A5 antigen. Dev. Biol. 135:231-240. Fukada M, Watakabe I, Yuasa-Kawada J, Kawachi H, Kuroiwa A, Masuda U, Noda M (2000) Molecular characterization of CRMP5, a novel member of the collapsing response mediator protein family. J. Biol. Chem. 275:37957-37965. Fukata Y, Itoh TJ, Kimura T, Menager C, Nishimura T, Shiromizu T, Watanabe H, Inagaki N, Iwamatsy A, Hotani H, Kaibuchi K (2002) CRMP-2 binds to tubulin heterodimers to promote microtubule assembly. Nat. Cell Biol. 4:583-591. Furuyama T, Inagaki S, Kosugi A, Noda S, Saitoh S, Ogata M, Iwahashi Y, Miyazaki H, Hamaoka T, Tohyama M (1996) Identification of a novel transmembrane semaphorin expressed on lymphocytes. J Biol. Chem. 271:33376-33381. Gagliardini V, Fankhauser C (1999) Semaphorin III can induce death in sensory neurons. Mol. Cell. Neurosci. 14:301-316. Gagnon ML, Bielenberg DR, Gechtman Z, Miao HQ, Takashima S, Soker S, Klagsburn M (2000) Identification of a natural soluble neuropilin-1 that binds vascular endothelial growth factor: In vivo expression and antitumor activity. Proc. Nat. Acad. Sci. 97:2573-2578. Gauthier LR and Robbins SM (2003) Ephrin signaling: One raft to rule them all? One raft to sort them? One raft to spread their call and in signaling bind them? Life Sci. 74:207-216. Gavazzi I, Stonehouse J, Sandvig A, Reza JE, Appiah-kubi LS, Keynes R, Cohen J (2000) Peripheral, but not central, axotomy induces neuropilin-1 mRNA expression in adult large diameter primary sensory neurons. J. Comp. Neurol. 423:492-499.  97  Giger RJ, Wolfer DP, De Wit GMJ, Verhaagen J (1996) Anatomy of rat semaphorin III/collapsin-1 mRNA expression and relationship to developing nerve tracts during neuroembryogenesis. J. Comp. Neurol. 375:378-392. Giger RJ, Pasterkamp JR, Heijnen S, Holtmaat AJGD, Verhaagen J (1998a) Anatomical distribution of the chemorepellent semaphorin III.collapsin-1 in the adult rat and human brain: Predominant expression in structures of the olfactory-hippocampal pathway and the motor system. J. Neurosci. Res. 52:27-42. Giger RJ, Urquhart ER, Gillespie SKH, Levelngood DV, Ginty DD, Kolodkin AL (1998b) Neuropilin-2 is a receptor for semaphorin IV: insight into the structural basis of receptor function and specificity. Neuron 21:1079-1092. Giger RJ, Cloutier JF, Sahay A, Prinjha RK, Levengood DV, Moore SE, Pickering S, Simmons D, Rastan S, Walsh FS, Kolodking AL, Ginty DD, Geppert M (2000) Neuropilin-2 is required in vivo for selective axon guidance responses to secreted semaphorins. Neuron 25:29-41. Giniger G (2002) How do Rho family GTPases direct axon growth and guidance? A proposal relating singalling pathaways to growth cone mechanics. Differentiation 70:385-396. Giordano S, Corso S, Conrotto P, Artigiani S, Gilestro G, Barberis D, Tamagnone L, Comoglio PM (2003) The semaphorin 4D receptor controls invasive growth by coupling with Met. Nat. Cell Biol. 4:720-724. Gluzman-Poltorak Z, Coehn T, Shibuya M, Neufeld G (2001) Vascular endothelial growth factor receptor-1 and neuropilin-2 form complexes. J. Biol. Chem. 276:18688-18694. Goshima Y, Nakamura F, Strittmatter P, Strittmatter S (1995) Collapsin-induced growth cone collapse mediated by an intracellular protein related to UNC-33. Nature 376:509-514. Goshima Y, Kawakami T, Hori H, Sugiyama Y, Takasawa S, Hashimoto Y, KagoshimaMaezono M, Takenaka T, Misu Y, Strittmatter S (1997) A novel action of collapsing: Collapsin1 increases antero- and retrograde axoplasmic transport independently of growth cone collapse. J. Neurobiol. 33:316-328. Gu C, Rodriguez RE, Remiert DV, Shu T, Fritzsch B, Richards LJ, Kolodkin AL, Ginty SS (2003) Neuropilin-1 conveys semaphorin and VEGF signaling during neural and cardiovascular development. Dev. Cell 5:45-57. Guirland C, Suzuki S, Kojima M, Lu B, Zheng JQ (2004) Lipid rafts mediate chemotropic guidance of nerve growth cones. Neuron 42:51-62. Hagino S, Iseki K, Mori T, Zhang Y, Hikake T, Yokoya S, Takeuchi M, Hasimoto H, Kikuchi S, Wanaka A (2003) Slit and glypican-1 mRNAs are coexpressed in the reactive astrocytes of the injured adult brain. Glia. 42:130-138. Hall KT, Boumsell L, Schultze JL, Boussiotis VA, Dorfman DM, Cardoso AA, Bensussan A, Nadler LM, Freeman GJ (1996) Human CD100, a novel leukocyte semaphorin that promotes Bcell aggregation and differentiation. Proc. Nat. Acad. Sci. 93:11780-11785. 98  He Z and Tessier-Lavigne M (1997) Neuropilin is a receptor for the axonal chemorepellent semaphorin III. Cell 90:739-751. Herzog Y, Kalcheim C, Kahane N, Reshef R, Neufeld G (2001) Differential expression of neuropilin-1 and neuropilin-2 in arteries and veins. Mech. Dev. 109:115-119. Hirotani M, Ohoka Y, Yamamoto T, Nirasawa H, Furuyama T, Kogo M, Matsuya T, Inagaki S (2002) Interaction of plexin-B 1 and PDZ domain-containing Rho guanine nucleotide exchange factors. Biochem. Biophys. Res. Comm. 297:32-37. Hofmann K and Stoffel W (1993) TMbase - A database of membrane spanning proteins segments. Biol. Chem. Hoppe -Seyler 374:166. (http://www.ch.embnet.org/software/TMPRED_form.html) Holtmaat AJGD, Gorter JA, De Wit J, Tolner EA, SPijker S, Giger RJ, Lopes da Silva FH, Verhaagen J (2003) Transient downregulation of Sema3 A mRNA in a rat model for temporal lobe epilepsy, a novel molecular event potentially contributing to mossy fiber sprouting. Exp. Neurol. 182:142-150. Hottinger AF, Azzouz M, Deglon N, Aebuscher P, Zurn AD (2000) Complete and long-term rescue of lesioned adult motoneurons by lentiviral-mediated expression of glial cell line-derived neurotrophic factor in the facial nucleus. J. Neursci. 20:5587-5593. Hu H, Marton TF, Goodman CS (2001) Plexin B mediates axon guidance in Drosophila by simultaneously inhibiting active Rac and enhancing RhoA signaling. Neuron 32:39-51. Inagaki N, Chihara K, Arimura N, Menager C, Kawano Y, Matsuo N, Nishimura T, Amano M, Kaibuchi K (2001) CRMP-2 induces axons in cultured hippocampal neurons. Nat. Neurosci. 4:781-782. Inagaki S, Furuyama T, Iwahashi Y (1995) Identification of a member of the semaphorin family. FEBS Lett. 370:269-272. Inatome R, Tsujimura T, Hitomi T, Mitsui N, Hermann P, Kuroda S, Yamamura G, Yanagi S (2000) Identification of CRAM, a novel unc-33 gene family protein that associates with CRMP3 and protein-tyrosine kinase(s) in the developing rat brain. J. Biol. Chem. 275:27291-27302. Jin Z, Strittmatter SM (1997) Racl mediates collapsin-1-induced growth cone collapse. J. Neurosci. 15:6256-6563. Kameyama T, Murakami Y, Suto F, Kawakami A, Takagi S, Hirata T, Fujisawa H (1996a) Identification of plexin family molecules in mice. Bioc. Biophys. Res. Comm. 226:396-402. Kameyama T, Murakami Y, Suto F, Kawakami A, Takagi S, Hirata T, Fujisawa H (1996b) Identification of a neuronal cell surface molecule, plexin, in mice. Bioc. Biophys. Res. Comm. 226:524-529.  99  Kamijo Y, Kokyama J, Oikawa S, Koizumi Y, Yokouchi K, Fukushima N, Moriizumi T (2003) Regenerative process of the facial nerve: rate of regeneration of fibers and their bifurcations. Neuros. Res. 46:135-143. Kawakami A, Kitsukawa T, Takagi S, Fujisawa H (1996) Developmentally regulated expression of a cell surface protein, neuropilin, in the mouse nervous system. J. Neurobiol. 29:1-17. Kawasaki T, Kistukawa T, Bekku Y, Matsuda Y, Sanbo M, Yagi T, Fujisawa H, (1999) A requirement for neuropilin-1 in embryonic vessel formation. Development 126:4895-4902. Kikutani H and Kumanogoh A (2003) Semaphorins in interactions between T cells and antigenpresenting cells. Nat. Rev. Immun. 3:159-167. Kitsukawa T, Shimono A, Kawakami A, Kondoh H, Fujisawa H (1995) Overexpression of a membrane protein, neuropilin, in chimeric mice causes anomalies in the cardiovascular system, nervous system and limbs. Development 121:4309-4318. Kitsukawa T, Shimizu M, Sanbo M, Hirata T, Taniguchi M, Bekku Y, Yagi T, Fujisawa H (1997) Neuropilin-semaphorin III/D-mediated chemorepulsive signals play a crucial role in peripheral nerve projection in mice. Neuron 19:995-1005. Kloss CUA, Werner A, Klein MA, Shen Jm Menuz K, Porbst CJ, Kreutzberg GW, Raivich G (1999) Integrin family of cell adhesion molecules in the injured brain: Regulation and cellular localization in the normal and regenerating mouse facial motor nucleus. J. Comp. Neurol. 411:162-178. Klostermann A, Lohrum M, Adams RH, Puschel AW (1997) The chemorepulsive activity of the axonal guidance signal semaphorin D requires dimerization. J. Biol. Chem. 273:7326-7331. Kobayashi H, Koppel A M , Luo Y, Raper J A (1997) A role for collapsin-1 in olfactory and cranial sensory axon guidance. J. Neurosci. 17:8339-8353. Kobayashi NR, Bedard AM, Hinche MT, Tetzlaff W (1996) Increased expression of BDNF and trkB mRNA in rat facial motoneurons after axotomy. Eur. J. Neurosci. 8:1018-1029. Kobayashi NR, Fan DP, Giehl KM, Bedard AM, Weigand SJ, Tetzlaff W (1997) BDNF and NT4/5 prevent atrophy of rat rubrospinal neurons after cervical axotomy, stimulate GAP-43 and Ted tubulin mRNA expression, and promote axonal regeneration. J. Neurosci. 17:9583-9595. Kolodkin AL, Matthes DJ, O'Connor TP, Patel NH, Admon A, Bentley D, Goodman CS (1992) Fasciclin IV: sequence, expression, and function during growth cone guidance in the grasshopper embryo. Neuron 9:831-845. Kolodkin AL, Matthes DJ, Goodman CS (1993) The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules. Cell 75:1389-1399. Kolodkin AL, Levengood DV, Rowe EG, Tai YT, Giger RJ, Ginty DD (1997) Neuropilin is a semaphorin III receptor. Cell 90:753-762.  100  Koppel AM, Feiner L, Kobayashi H, Raper JA (1997) A 70 amino acid region within the semaphorin domain activates specific cellular response for semaphorin family members. Neuron 19:531-537. Koppel AM, Raper JA (1998) Collapsin-1 covalently dimerizes, and dimerization is necessary for collapsing activity. J. Bio. Chem. 273:15708-15713. Kuchler M, Fouad Km Weinmann O, Schwab ME, Raineteau O (2002) Red nucleus projections to distinct motor neuron pools in the rat spinal cord. J. Comp. Neurol. 338:349-359. Kuhn TB, Brown MD, Wilcox CL, Raper JA, Bamburg JR (1999) Myelin and collapsing-1 induce motor neuron growth cone collapse through different pathways: inhibition of collapse by opposing mutants of racl. J. Neurosci. 19:1965-1975. Kumanogoh A, Watanabe C, Lee I, Wang X, Shi W, Araki H, Hirata H, Iwahori K, Uchida J, Yasui T, Matsumoto M, Yoshida K, Yakura H, Pan C, Parnes JR, Kikutani H (2000) identification of CD72 as a lymphocyte receptor for the class IV semaphorin CD 100: A novel mechanism for regulating B cell signaling. Immunity 13:621-631. Kumanogoh A and Kikutani H (2001) The CD100-CD72 interaction: a novel mechanism of immunre regulation. Trends Immunol. 22:670-676. Kumanogoh A, Marukawa S, Suzuki K, Takegahara N, Watanabe C, Ch'ng E, Ishida I, Fujimura H, Sakoda S, Yoshida K, Kikutani H (2002) Class IV semaphorin Sema4A enhances T-cell activation and interacts with Tim-2. Nature 419:629-633. Kwon BK, Liu J, Messerer C, Kobayashi NR, McGraw J, Oschipok L, Tetzlaff W (2002a) Survival and regeneration of rubrospinal neurons 1 year after spinal cord injury. Proc. Nat. Acad. Sci. 99:3246-3251. Kwon BK, Borisoff JE, Tetzlaff W (2002b) Molecular targets for therapeutic intervention after spinal cord injury. Mol. Interventions 2:24-258. Leighton PA, Mitchell KJ, Goodrich LV, Lu X, Pinson K, Scherz P, Skarnes WC, TessierLavigne M (2001) Defining brain wiring patterns and mechanisms through gene trapping in mice. Nature 410:174-179. Lindholm T, Skold MK, Suneson A, Carlstedt T, Cullheim S, Risling M (2004) Semaphorin and neuropilin expression in motoneurons after intraspinal motoneurons axotomy. NeurReport 15:649-654. Luo Y, Raible D, Raper JA (1993) Collapsin: A protein in brain that induces the collapse and paralysis of neuronal growth cones. Cell 75:217-227. Luo Y, Sheperd I, Li J, Renzi MJ, Chang S, Raper JA (1995) A family of molecules related to collapsing in the embryonic chick nervous system. Neuron 14:1131-1140.  101  Maestrini E, Tamagnone L, Longati P, Cremona O, Gulisano M, Bione S, Tamanini F, Neel BG, Toniolo D, Comoglio PM (1996) A family of transmembrane proteins with homology of the MET-hepatocyte growth factor receptor. Proc. Nat. Acad. Sci. 93:674-678. Mark MD, Lohrum M, Puschel AW (1997) Patterning neuronal connections by chemorepulsion: the semaphorins. Cell Tiss. Res. 290:299-306. McGraw J, McPhail LT, Oschipok LW, Horie H, Poirier F, Steeves JD, Ramer MS, Tetzlaff W (2004) Galectin-1 in regenerating motoneurons. Eur. J. Neurosci. 20:2872-2880. McGraw TS, Mickle JP, Shaw G, Streit WJ (2002) Axonally transported peripheral signals regulate a-internexin expression in regenerating motoneurons. J. Neurosci. 22:4955-4963. McKerracher L (2001) Spinal cord repair strategies to promote axonal regeneration. Neurobiol. Dis. 8:11-18. McPhail, LT (2004a) Motonueron response to axonal injury. Ph.D. Thesis. Department of Zoology, University of British Columbia, Vancouver, B.C. McPhail LT, McBride CB, McGraw J, Steeves JD, Tetzlaff W (2004b) Axotomy abolishes NeuN expression in facial but not rubrospinal neurons. Exp. Neurol. 185:182-190. Messersmith EK, Leonardo DE, Shatz CJ, Tessier-Lavigne M, Goodman CS, Kolodkin AL (1995) Semaphorin III can function as a selective chemorepellent to pattern sensory projection in the spinal cord. Neuron 14:949-959. Miao HQ, Soker S, Feiner L, Alonso JL, Raper JA, Klagsburn M (1999) Neuropilin-1 mediates collaspin-1/semaphorin III inhibition of endothelial cell motility: Functional competition of collapse-1 and vscular endothelial growth factor-165. J. Cell Biol. 146:233-241. Midha R, Fehlings MG, Tator CH, Saint-Cyr JA, Guha A (1987) Assessment of spinal cord injury by counting corticospinal and rubrospinal neurons. Brain Res. 410:299-308. Mikule K, Gatlin JC, de la Houssaye BA, Pfenninger KH (2002) Growth cone collapse induced by semaphorin 3A requires 12/15-lipoxygenase. J. Neurosci. 22:4932-4941. Milzani A, DalleDonne I, Colombo R (1997) Prolonged oxidative stress on actin. Arch. Biochem. Biophys. 339:267-274. Minturn JE, Fryer HJL, Geschwind DH, Hockfield S (1995) TOAD-64, a gene expressed earlu in neuronal differentiation in the rat, is related to unc-33, a C. elegans gene involved in axon outgrowth. J. Neurosci. 15:6757-6766. Miranda JD, White LA, Marcillo AE, Willson CA, Jagid J, Whittemore SR (1999) Induction of Eph B3 after spinal cord injury. Exp. Neurol. 156:218-222. Mitsui N, Inatome R, Takahashi S, Goshima Y, Yamamura H, Yanagi S (2002) Involvement of Fes/Fps tyrosine kinase in semaphorin3A signaling. EMBO J. 13:3274-3285.  102  Moon LD, Asher RA, Rhodes KE, Fawcett JW (2001) Regeneration of CNS axons back to their target following treatment of adult rat brain with chondroitinase ABC. Nat. Neurosci. 4:465-466. Moran LB, Graeber MB (2004) The facial nerve axotomy model. Brain Res. Rev. 44:154-178. Moreau-Fauvarque C, Kumanagoh A, Camand E Jailard C, Barbin G, Boquet I, Love C, Jone YE, Kikutani H, Lubetzki C, Dusart I, Chedotal A (2003) The transmembrane semaphorin Sema4D/CD100, an inhibitor of axon growth, is expressed on oligodendrocytes and upregulated after CNS lesion. J. Neurosci. 23:9229-9239. Moreno-Flores MT, Martin-Aparicio E, Martin-Bemejo MJ, Agudo M, McMahon S, Acila J, Diaz-Nido J, Wandosell F (2003) Semaphorin 3C preserves survival and increases neuritogenesis of cerebellar granule neurons in culture. J. Neurochem. 87:879-890. Murakami Y, Suto F, Shimizu M, Shinoda T, Kaneyama T, Fujisawa H (2001) Differential expression of plexin-A subfamily members in the mouse nervous system. Dev. Dyn. 220:246258. Nakai Y and Kamiguchi H (2002) Migration of nerve growth cones requires detergent-resistant membranes in a spatially defined and substrate-dependent manner. J. Cell Biol. 159:1097-108. Nakamoto T, Kain KH, Ginsberg MH (2004) Neurobiology: New connections between integrins and axons guidance. Curr. Biol. 14:R121-123. Nakamura F, Tanaka M, Takahashi T, Kalb RG, Strittmatter SM (1998) Neuropilin-1 extracellular domains mediate semaphorin D/III-induced growth cone collapse. Neuron 21:10931100. Neufeld G, Cohen T, Shraga N, Lange T, Kessler O, Herzog Y (2002) The neuropilins: Multifunctional semaphorin and VEGF receptors that modulate axon guidance and angiogenesis. Trends in Cardiovasc. Med. 12:13-19. Niclou SP, Franssen EHP, Ehlert EME, Taniguchi M, Verhaagen J (2003) Meningeal cellderived semaphorin 3 inhibits neurite outgrowth. Mol. Cell. Neurosci. 24:902-912. Nobes CD and Hall A (1995) Rho, Rac and Cdc42 GTPases: regulators of actin structures, cell adhesion and motility. Bioch. Soc. Transact. 23:456-459. Ohta K, Takagi S, Asou H, Fujisawa H (1992) Involvement of neuronal cell surface molecule B2 in the formation of the retinal plexiform layers. Neuron 9:151-161. Ohta K, Mizutani A, Kawakami A, Murakami Y, Kasuya Y, Takagi S, Tanaka H, Fujisawa H (1995) Plexin: A novel neuronal cell surface molecule that mediates cell adhesion via a homophilic binding mechanism in the presence of calcium ions. Neuron 14:1189-1199. Oinuma I, Katoh H, Harada A, Negishi M (2003) Direct interaction of Rndl with plexin-B 1 regulates PDZ-RhoGEF-mediated Rho activation by plexin-B 1 and induces cell contraction COS-7 cells. J. Biol. Chem. 278:25671-25677.  103  Oosthuyse B, Moons L, Storkebaum E, Beck H, Nuyens D, Brusselmans K, Van Dorpe J, Hellings P, Gorselink M, Heymans S, Theilmeier G, Dewerchin M, Laudenbach V, Vermylen P, Raat H, Acker T, Vleminckx V, Van Den Bosch L, Cashman N, Fujisawa H, Drost MR, Sciot R, Bruyninckx F, Hicklin DJ, Ince C, Gressens P, Lupu F, Plate KH, Robberecht W, Herbert JM, Collen D, Carmeliet P. Deletion of the hypoxia-response element in the vascular endothelial growth factor promoter causes motor neuron degeneration. Nat. Genet. 28:131-138. Oschipok LW, Liu J, Barclay S, Steeves JS, Tetzlaff W (1999) Expression of semaphorins and neuropilins in the injured spinal cord and axotomized rubrospinal neurons. Soc. Neurosci. Abstr. 25:243. Oschipok LW,Spinelli ED, Liu J, Steeves JD, Tetzlaff W (2000) Expression of semaphorin 3C and semaphorin 4F in rubrospinal and facial motoneurons following axotomy. Soc. Neurosci. Abstr. 326.5. Oschipok LW, Wang W, Spinelli ED, McPhail LT, Liu J, Kimura K, Steeves JD, O" Connor T, Tetzlaff W (2003) Semaphorin-4F is highly expressed in axotomized facial motoneurons but not in non-regenerating rubrospinal neurons. Soc. Neurosci. Abstr. 275.18. Ozaki S and Snider WD (1997) Initial trajectories of sensory axons toward laminar targets in the developing mouse spinal cord. J. Comp. Neurol. 380:215-229. Oster SF, Bodeker MO, He F, Stretavan DW (2003) Invariant Sema5A inhibition serves an ensheathing function during optic nerve development. Development 130:775-784. Pantaloni D, Le Clainche C, Carlier M.F. (2001) Mechanism of actin-based motility. Science 292:1502-1506. Paratcha G and Ibanez CF (2002) Lipid rafts and the control of neurotrophic factor signaling in the nervous system: Variations on a theme. Curr. Op. Neurobiol. 12:542-549. Pasterkamp RJ, Giger RJ, Verhaagen J (1998a) Regulation of semaphorin Ill/collapsing-1 gene expression during peripheral nerve regeneration. Exp. Neurol. 153:313-327. Pasterkamp RJ, De Winter F, Holtmaat AJGD, Verhaagen J (1998b) Evidence for a role of the chemorepellent semaphorin III and its receptor neuropilin-1 in the regeneration of primary olfactory axons. J. Neurosci. 18:9962-9976. Pasterkamp RJ, Giger RJ, Ruitenberg MJ, Holtmaat AJDG, De Wit J, De Winter F, Verhaagen J (1999) Expression of the gene encoding the chemorepellent semaphorin III is induced in the fibroblast component of the neural scar tissue formed following injuries of adult but not neonatal CNS. Mol. Cell. Neurosci. 13:143-166. Pasterkamp RJ, Anderson PN, Verhaagen J (2001a) Peripheral nerve injury fails to induce growth of lesioned dorsal column axons into spinal cord scar tissue expressing the axon repellent semaphorin 3 A. Eur. J. Neurosci. 13:457-471. Pasterkamp RJ, Verhaagen J (2001b) Emerging roles for semaphorins in neural regeneration. Brain Res. Rev. 35:36-54. 104  Pasterkamp PJ, Peschon JJ, Spriggs MK, Kolodkin AL (2003) Semaphorin 7A promotes axon outgrowth through integrins and MAPKs. Nature 424:398-405. Pearse DD, Pereira FC, Marcillo AE, Bates ML, Berrocal YA, Filbin MT, Bunge MB (2004) cAMP and Schwann cells promote axonal growth and functional recovery after spinal cord injury. Nat. Med. 10:610-616. Perrot V, Vasquez-Prado J, Gutkind SJ (2002) Plexin B regulates Rho through the guanine nucleotide exchange factors leukemia-associated Rho GEF (LARG) and PDZ-RhoGEF. J. Biol. Chem. 277:43115-43120. Plunet W, Kwon BK, Tetzlaff W (2002) Promoting axonal regeneration in the central nervous system by enhancing the cell body response to axotomy. J. Neurosci. Res. 68:1-6. Polleux F, Morrow T, Ghosh A (2000) Semaphorin 3 A is a chemoattractant for cortical apical dendrites. Nature 404:567-573. Pozas E, Pascual M, Ba-Charvet KTN, Guijarro P, Sotelo C, Chedotal A, Del Rio JA, Soriano E (2001) Age-dependent effects of secreted semaphorins 3 A, 3F, 3E on developing hippocampal axons: in vitro effects and phenotype of semaphorin 3A(-/-) mice. Mol. Cell. Neurosci. 18:26-43. Puschel AW, Adams RH, Betz H (1995) Murine semaphorin D/collapsing is a member of a diverse gene family and creates domains inhibitory for axonal extension. Neuron 14:941-948. Puschel AW, Admas RH, Betz H (1996) The sensory innervation of the mouse spinal cord may be patterned by differential expression of and differential responsiveness to semaphorins. Mol. Cell. Neurosci. 7:419-431. Pyronnet S, Imataka H, Gingras AC, Fukunaga R, Hunter T, Sonenberg N (1999) Human eukaryotic translation initiation factor 4G (eIF4G) recruits mnkl to phosphorylate eIF4E. EMBO J. 18:270-279. Qu X, Wei H, Zhai Y, Que H, Chen Q, Tang F, Wu Y, Xing G, Zhu Y, Liu S, Fan M, He F (2002) Identification, characterization, and functional study of the two novel human members of the semaphorin gene family. J. Bio. Chem. 277:35574-35585. Quinn CC, Gra GE, Hockfield S (1999) A family of proteins implicated in axon guidance and outgrowth. J. Neurobiol. 41:158-164. Raineteau O, Fouad K, Bareyre FM, Schwab ME (2002) Reorganization of descending motor tracts in the rat spinal cord. Eur. J. Neurosci. 16:1761-1771. Renzi MJ, Feiner L, Koppel AM, Raper JA (1999) A dominant negative receptor for specific secreted semaphorins is generated by deleting an extracellular domainfromneuropilin-1. J. Neurosci. 19:7870-7880.  105  Reza JN, Gavazzi I, Cohen J (1999) Neuropilin-1 is expressed on adult mammalian dorsal root ganglion neurons and mediates semaphroin3A/collaspin-l-induced growth cone collapse by small diameter sensory afferents. Mol. Cell. Neurosci. 14:317-326. Richardson PM, McGuinness UM, Aguayo AJ (1980) Axons from CNS neurons regenerate into PNS grafts. Nature 284:264-265. Richardson PM, Issa VMK, Aguayo AJ (1984) Regeneration of long spinal axons in the rat. J. Neurocyt. 13:165-182. Rieger J, Wick W, Weller M (2003) Human malignant glioma cells express semaphorins and their receptors, neuropilins and plexins. Glia 42:379-389. Rohm B, Ottemeyer A, Lohrum M, Puschel AW (2000a) Plexin/neuropilin complexes mediate repulsion by the axonal guidance signal semaphorin3A. Mech. Dev. 93:95-104. Rohm B, Rahim B, Kleiber B, Hovatta I, Puschel AW (2000b) The semaphorin 3A receptor may directly regulate activity of small GTPases. FEBS Lett. 486:68-72. Rossignol M, Gagnon ML, Klagsburn M (2000) Genomic organization of human neuropilin-1 and neuropilin-2 genes: Identification and distribution of splice variants and soluble isoforms. Genomics 70:221-222. Sahay A, Molliver ME, Ginty DD, Kolodkin AL (2003) Semaphorin 3F is critical for development of limbic system circuitry and is required in neurons for selective CNS axon guidance events. J. Neurosci. 23:6671-6680. Sakamoto T, Kawazoe Y, Shen JS, Takeda Y, Arakawa Y, Ogawa J, Oyanagi K, Ohashi T, Watanabe K, Inoue K, Eto Y, Watabe K (2003) Adenoviral gene transfer of GDNF, BDNF and TGF/32, but not CNTF, Cardiotrphin-1 or IGF1, protects injured adult motoneurons after facial nerve avulsion. J. Neurosci. Res. 72:54-64. Sandvig A, Berry M, Barrett LB, Butt A, Logan A (2004) Myelin-, reactive glia-, and scarderived CNS axon growth inhibitors: Expression, receptor signaling, and correlation with axon regeneration. Glia 46:225-251. Sasaki Y, Cheng C, Uchida Y, Nakajima O, Ohshima T, Yagi T, Taniguchi M, Nakayama T, Kishida R, Kudo Y, Ohno S, Nakamura F, Goshima Y (2002) Fyn and Cdk5 mediate semaphorin-3 A signaling, which is involved in regulation of dendrite orientation in cerebral cortex. Neuron 35:907-920. Scarlato M, Ara J, Bannerman P, Scherer S, Pleasure D (2003) Induction of neuropilins-1 and -2 and their ligands, Sema3 A, Sema3F, and VEGF, during Wallerian degeneration in the peripheral nervous system. Exp. Neurol. 183:489-498. Schnell L and Schwab ME (1990) Axonal regeneration in the rat spinal cord produced by an antibody against myelin-associated neurite growth inhibitors. Nature 343:269-272.  106  Schwarting GA, Kostek C, Ahmad N, Dibble C, Pays L, Puschel AW (2000) Semaphorin 3 A is required for guidance of olfactory axons in mice. J. Neurosci. 20:7691-7697. Scita G, Tenca P, Frittoli E, Tocchetti A, Innocenti M, Giardina G, Di Fiore PP (2000) Signaling from Ras to Rac and beyond: Not just a matter of GEFs. EMBO J. 19:2393-2398. Semaphorin Nomenclature Committee (1999) Unified nomenclature for the semaphorins/collapsins. Cell 97:551-552. Serini G, Valdembri D, Zanivan S, Morterra G, Burkhardt C, Caccavari F, Zammataro L, Primo L, Tamagnone L, Logan M, Tesseri-Lavigne M, Taniguchi M, Puschel A, Bussolino F (2003) Class 3 semaphorins control vascular morphogenesis by inhibiting integrin function. Nature 424:391-398. Shepherd IT, Luo Y, Raper J A, Chang S (1996) The distribution of collapsin-1 mRNA in the developing chick nervous system. Dev. Biol. 173:185-199. Shepherd IT, Luo Y, Lefcort F, Reichdardt LF, Raper J A (1997) A sensory axon repellent secreted from ventral spinal cord explants is neutralized by antibodies raised against collapsin-1. Development 124:1377-1385. Shimizu M, Murakami Y, Suto F, Fujisawa H (2000) Determination of cell adhesion sites of neuropilin-1. J. Cell Bio. 148:1283-1293. Silver J and Miller JH (2004) Regeneration beyond the glial scar. Nat. Rev. Neurosci. 5:146-156. Skaper SD, Moore SE, Walsh FS (2001) Cell signaling cascades regulating neuronal growthpromoting and inhibitory cues. Prog. Neurobiol. 65:593-608. Skold M, Cullheim S, Hammarberg H, Piehl F, Suneson A, Lake S, Sjorgren AM, Walum E, Risling M (2000) Induction of VEGF and VEGF receptors in the spinal cord after mechanical spinal injury and prostaglandin administration. Eur. J. Neurosci. 12:3675-3686. Soker S, Takashima S, Miao HQ, Neufeld G, Klagsburn M (1998) Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor. Cell 92:735-745. Son YJ, Thompson WJ (1995) Nerve sprouting in muscle is induced and guided by processes extended by Schwann cells. Neuron 14:133-141. Sondell M, Lundborg G, Kanje M (1999) Vascular endothelial growth factor has neurotrophic activity and stimulates axonal outgrowth, enhancing cell survival and Schwann cell proliferation in the peripheral nervous system. J. Neurosci. 19:5731-5740. Sondell M, Sundler F, Kanje M (2000) Vascular endothelial growth factor is a neurotrophic factor which stimulates axonal outgrowth through the flk-1 receptor. Eur. J. Neurosci. 12:42434254.  107  Song HJ, Ming GL, He Z, Lehmann M, McKerracher L, Tessier-Lavigne M, Poo M M (1998) Conversion of neuronal growth cone responses from repulsion to attraction by cyclic nucleotides. Science 281:1515-1518. Suto F, Murakami Y, Nakamura F, Goshima Y, Fujisawa H (2003) Identification and characterization of a novel mouse plexin, plexin-A4. Mech. Dev. 120:385-396. Suzuki T, Nakamoto T, Ogawa S, Seo S, Matsumura T, Tachibana K, Morimoto C, Hirai H (1999) MICAL, a novel CasL interacting molecule, associates with vimentin. J. Biol. Chem. 277:14933-14941. Swiercz JM, Kunier R, Behrens, Offermanns S (2002) Plexin-BI directly interacts with PDZRhoGEF/LARG to regulate RhoA and growth cone morphology. Neuron 35:51-63. Takagi S, Tsuji T, Amagai T, Takamatsu T, Fujisawa J (1987) Specific cell surface labels in the visual centers of Xenopus laevis tadpole identified using monoclonal antibodies. Dev. Biol. 122:90-100. Takagi S, Hirata T, Agata K, Mochii M, Eguchi G, Fujisawa H (1991). The A5 antigen, a candidate for the neuronal recognition molecule, has homologies to complement components and coagulation factors. Neuron 7:295-307. Takagi S, Kasuya Y, Shimizu M, Matsuura T, Tsuboi, Kawakami A, Fujisawa H (1995) Expression of a cell adhesion molecule, neuropilin, in the developing chick nervous system. Dev. Biol. 170:207-222. Takahashi T, Nakamura F, Jin Z, Kalb RG, Strittmatter SM (1998) Semaphorins A and E act as antagonists of neuropilin-1 and agonists of neiuropilin-2 receptors. Nat. Neurosci. 1:487-493. Takahashi T, Fournier A, Nakamura F, Wang LH, Murakami Y, Kalb RG, Fujisawa H, Strittmatter SM (1999) Plexin-neuropilin-1 complexes form functional semaphorin-3a receptors. Cell 99:59-69. Takahashi T, Strittmatter SM (2001) PlexinAl autoinhibition by the plexin sema domain. Neuron 29:429-439. Takashima S, Kitakaze M, Asakura M, Asanuma H, Sanada S, Tashiro F, Niwa H, Miyazaki J, Hirota S, Kitamura Y, Kitsukawa T, Fujisawa H, Klagsburn M, Hori M (2002) Targeting of both mouse neuropilin-1 and neuropilin-2 genes severely impairs developmental yolk sac and embryonic angiogenesis. Proc. Nat. Acad. Sci. 99:3657-3662. Tamagnone L, Artigiani S, Chen H, He Z, Ming GI, Song H, Chedotal A, Winberg ML, Goodman CS, Poo M, Tessier-Lavigne M, Comoglio PM (1999) Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99:71-80. Tanelian DL, Barry MA, Johnston SA, Le T, Smith GM (1997) Semaphorin III can repulse and inhibit adult sensory afferents in vivo. Nat. Med. 3:1398-1401.  108  Taniguchi M, Yuasa S, Fujisawa H, Naruse I, Saga SM, Mishima M, Yagi T (1997) Disruption of semaphorin III/D gene causes severe abnormality in peripheral nerve projections. Neuron 19:519-530. Taniguchi M, Nagao H, Takahashi YK, Yamaguchi M, Mitsui S, Yagi T, Mori K, Shimizu T (2003) Distorted odor maps in the olfactory bulb of semaphorin 3A-deficient mice. J. Neurosci. 23:1390-1397. Tang XD, Tanelian DL, Smith GM (2004) Semaphorin3 A inhibits nerve growth factor-induced sprouting of nociceptive afferents in adult rat spinal cord. J. Neurosci. 24:819-827. Tear G (2001) A new code for axons. Nature 409:472-473. Terenghi G (1999) Peripheral nerve regeneration and neurotrophic factors. J. Anat. 194:1-14. Terman JR, Mao T, Pasterkamp RJ, Yu HH, Kolodikin AL (2002) MICALs, a family of conserved flavoprotein oxidoreductases, function in plexin-mediated axonal repulsion. Cell 109:887-900. Tetzlaff W, Alexander SW, Miller FD, Bisby MA (1991) Response of facial and rubrospinal neurons to axotomy: Changes in mRNA expression of cytoskeletal proteins and GAP-43. J. Neurosci. 11:2528-2544. Tetzlaff W, kobayashi NR, Giehl KMG, Tsui BJ, Cassar SL, Bedard A M (1994) Response of rubrospinal and corticospinal neurons to injury and neurotrophins. Prog. Brain Res. 103:271286. Tomov TL, Gluntinas-Lichius O, Grosheva M, Streppel M, Schraermeyer U, Neiss WF, Angelov DN (2002) An example of neural plasticity evoked by putative behavioural demand and early use of vibrissal hairs after faical nerve transection. Exp. Neurol. 178:207-218. Toyofuku T, Zhang H, Kumanogoh A, Takegahara N, Suto F, Kamei J, Aoki K, Yabuki M, Hori M, Fujisawa H, Kikutani H (2004) Dual role of Sema6D in cardiac morphogenesis through region-specific association of its receptor, Plexin-Al, with off-track and vascular endothelial growth factor receptor type 2. Genes Dev. 18:435-447. Tordjman R, Lepelletier Y, Lemarchandel V, Cambot M, Gaulard P, Hermine O, Romeo PH (2002) A neuronal receptor, neuropilin-1, is essential for the initiation of the primary immune response. Nat. Immun. 3:477-482. Trusolino L and Comoglio PM (2002) Scatter-factor and semaphorin receptors: Cell signaling for invasive growth. Nat. Rev. Cancer 2:289-300. Tuttle R, O'Leary DDM (1998) Neurotrophins rapidly modulate growth cone response to the axon guidance molecule, collapsin-1. Mol. Cel. Neurosci. 11:1-8. Ulupinar E, DAtwani A, Behar O, Fujisawa H, Erzurumlu R (1999) Role of semaphorin III in the developing rodent trigeminal system. Mol. Cell. Neurosci. 13:281-292.  109  Usui H, Taniguchi M, Yokomizo T, Shimizu T (2003) Plexin-Al and plexin-Bl specifically interact at their cytoplasmic domains. Biochem. Biophys. Res. Comm. 300:927-931. Van Der Zwaag B, Hellemons AJCGM, Leenders WPJ, Burbach JPH, Brunner HG, Padberg GW, van Bokhoven H (2002) Plexin-Dl, a novel plexin family member, is expressed in vascular endothelium and the central nervous system during mouse embryogenesis. Dev. Dyn. 225:336343. Varela-Echavarria A, Tucker A, Puschel AW, Guthrie S (1997) Motor axon subpopulations respond differentially to the chemorepellents netrin-1 and semaphorin D. Neuron 18:193-207. Vastrik I, Eickholt BJ, Walsh FS, Ridley A, Doherty P (1999) Sema3A-induced growth-cone collapse is mediated by Racl amino acids 17-32. Curr. Biol. 9:991-998. Vikis HG, Li W, He Z, Guan KL (2000) The semaphorin receptor plexin-Bl specifically interacts with active Rac in a ligand dependent manner. Proc. Nat. Acad. Sci. 97:457-462. Vikis HG, Li W, Gu KL (2002) The plexin-Bl/Rac interaction inhibits PAK activation and enhances Sema4D ligand binding. Genes Dev. 16:836-845. Vinson M, Rausch O, Maycox PR, Prinjha RK, Chapman D, Morrow R, Harper AJ, Dingwall C, Walsh FS, Burbidge SA, Riddell DR (2003) Lipid rafts mediate the interaction between myelinassociated glycoprotein (MAG) on myelin and MAG-receptors on neurons. Mol. Cell. Neurosci. 22:344-352. Walz A, Rodriguez I, Mombaerts P (2002) Aberrant sensory innervation of the olfactory bulb in neuropilin-2 mutant mice. J. Neurosci. 22:4025-35. Waskiewicz AJ, Johnson JC, Penn B, Mahalingam M, Kimball SR, Cooper JA (1999) Phosphorylation of the cap-binding protein eukaryotic translation initiation factor 4E by protein kinase Mnkl in vivo. Mol. Cell. Biol. 19:1871-1880. Werner A, Willem M, Jones LL, Kreutzberg GW, Mayer U, Raivich G (2000) Impaired axonal regeneration in al integrin-deficient mice. J. Neurosci. 20:1822-1830. Westrum LE (1980) Alterations in axons and synapses of olfactory cortex following olfactory bulb lesions in newborn rats. Anat. Embryol. 160:153-172. Whitaker BG, Limberg BJm Rosenbaum JS (2001) Vascular endothelial growth factor receptor2 and neuropilin-1 form a receptor complex that is responsible for the differential signaling potency of V G F and VEGF i. J. Biol. Chem. 276:25520-25531. l 6 5  12  White FA and Behar O (2000) The development and subsequent elimination of aberrant peripheral axon projections in Semaphorin3A null mutant mice. Dev. Biol. 225:79-86. Widenfalk J, Lipson A, Jubran M, Hofstetter C, Ebendal T, Cao Y, Olson L (2003) Vascular endothelial growth factor improves functional outcome and decreases secondary degeneration in experimental spinal cord contusion injury. Neuroscience 120:951-960.  110  Williams-Hogarth LC, Puche AC, Torrey C, Cai X, Song I, Kolodkin AL, Shipley MT, Ronnett GV (2000) Expression of semaphorin in developing and regenerating olfactory epithelium. J. Comp. Neurol. 423:565-578. Winberg ML, Noordermeer JN, Tamagnone L, Comoglio P, Spriggs MK, Tessier-Lavigne M, Goodman CS (1998) Plexin A is a neuronal semaphorin receptor that controls axon guidance. Cell 95:903-916. Winberg ML, Tamagnone L, Bai J, Comoglio PM, Montell D, Goodman CS (2001) The transmembrane protein Off-track associates with Plexins and functions downstream of Semaphorin signaling during axon guidance. Neuron 32:53-62. Wright DE, White FA, Gefren RW, Silos-Santiago I, Snider WD (1995) The guidance molecule semaphorin III is expressed in regions of spinal cord and periphery avoided by growing sensory axons. J. Comp. Neurol. 361:321-333. Wolman MA, Liu Y, Tawarayama H, Shoji W, Halloran MC (2004) Repulsion and attraction of axons by semaphorin3D are mediated by different neuropilins in vivo. J. Neurosci. 24:84288425. Wong AW, Brickney JW, Taxman DJ, van Deventer HW, Reed W, Gao JX, Zheng P, Liu Y, Li P, Blum JS, McKinnonKP, Ting JPY (2003) CIITA-regulated plexin-Al affects T-cell-dendritic cell interactions. Nat. Immun. 4:891-898. Wong JT, Yu WT, O'Connor (1997) Transmembrane grasshopper semaphorin I promotes axon outgrowth in vivo. Development 124:3597-3607. Worzfeld T, Puschel AW, Offermanns S, Kuner R (2004) Plexin-B family members demonstrate non-redundant expression patterns in the developing mouse nervous system: an anatomical basis for morphogenetic effects of Sema4D during development. Eur. J. Neurosci. 19:2622-2632. Wulfing C and Rupp F (2002) Neuropilin-1: another neuronal molecule in the "immunological synapse". Nat. Immunol. 3:418-419. Xu XM, Fisher DA, Zhou L, White FA, Ng S, Snider WD, Luo Y (2000) The transmembrane protein semaphorin 6A repels embryonic sympathetic axons. J. Neurosci. 20:2638-2648. Yamada Y, Takakura N, Yasue H, Ogawa H, Fujisawa H, Suda T (2001) Exogenous clustered neuropilin 1 enhances vasculogenesis and angiogenesis. Blood 97:1671-1678. Yu W, Guo W, Feng L (2004) Segregation of Nogo66 receptors into lipid rafts in rat brain and inhibition of Nogo66 signaling by cholesterol depletion. FEBS Lett. 577:87-92. Yuasa-Kuwada J, Suzuki R, Kano F, Ohkawara T, Murata M, Noda M (2003) Axonal morphogenesis controlled by antagonistic roles of two CRMP subtypes in microtubule organization. Eur. J. Neurosci. 17:2329-2343.  Ill  Zanata SM, Hovatta I, Rohm B, Puschel AW (2002) Antagonistic effects of Rndl and RhoD GTPases regulate receptor activity in semaphorin 3A-induced cytoskeletal collapse. J. Neuroci. 22:471-477. Zhang Y, Roslan R, Lang D, Schachner M, Lieberman AR, Anderson PN (2000) Expression of CHL1 and LI by neurons and glia following sciatic nerve and dorsal root injury. Mol. Cell. Neurosci. 16:71-86. Zhou L, White FA, Lentz SI, Wright DE, Fisher DA, Snider WD (1997) Cloning and expression of a novel murine semaphorin with structural similarity to insect semaphorin I. Mol. Cell. Neurosci. 9:26-41.  112  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099802/manifest

Comment

Related Items