UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Haploinsufficiency of PTEN augments the chemotactic response of lymphocytes, alters gene expression,… Fox, Joanne 2002

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2003-792188.pdf [ 11.09MB ]
Metadata
JSON: 831-1.0099735.json
JSON-LD: 831-1.0099735-ld.json
RDF/XML (Pretty): 831-1.0099735-rdf.xml
RDF/JSON: 831-1.0099735-rdf.json
Turtle: 831-1.0099735-turtle.txt
N-Triples: 831-1.0099735-rdf-ntriples.txt
Original Record: 831-1.0099735-source.json
Full Text
831-1.0099735-fulltext.txt
Citation
831-1.0099735.ris

Full Text

HAPLOINSUFFICIENCY OF PTEN AUGMENTS THE CHEMOTACTIC RESPONSE OF LYMPHOCYTES, ALTERS GENE EXPRESSION, AND RESULTS IN AUTOIMMUNITY by JOANNE FOX B.Sc, Simon Fraser University, 1997 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Genetics Programme) We accept this thesis as conforming to the reqiujgrLstaedffl'd THE UNIVERSITY OF BRITISH COLUMBIA November 28, 2002 © Joanne A. Fox, 2002 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada DE-6 (2/88) 11 Abstract The ability of the cell to respond to physiological cues and integrate signals from outside sources is important for normal cellular function. The generation of second messengers is a central mechanism by which the cell activates signal transduction cascades that mediate cellular responses. Phosphatidylinositol lipid species (PIP) act as important second messengers in the membrane. Phosphatidylinositol-3-kinase (PI3K) and PTEN are responsible for regulating levels of PIP species and thus, are implicated in the control of many important cellular processes. Regulation of cellular activation is particularly important in the immune system where abnormal activation of lymphocytes can lead to developmental defects, impaired ability to defend against infection, and disease. In support of this, we and others have demonstrated that mice lacking a single allele of Pten develop an autoimmune disease that worsens with age. We observed increased lymph node size, splenomegaly, and elevated levels of serum immunoglobulins in Pten +/- mice. No evidence of major developmental defects were found in Pten +/- lymphocytes, however increased responsiveness of both B and T cells was detected. In the immune system, migration to specialized microenvironments ensures the proper development, differentiation, survival, elimination and activation of lymphocytes. The complex network of celhcell interactions that occurs during an immune response is also controlled by migratory events. Thus, we examined the role of Pten in the control of lymphocyte migration. We found that Pten +/- lymphocytes had an augmented chemotactic response to stromal cell derived factor-1 (SDF-1). We also demonstrated increased phosphorylation of protein kinase B (PKB) in response to SDF-1. Stimulation of lymphocytes with SDF-1 led to changes in gene expression. The expression of a subset Ill of genes was altered in Pten +/- T cells. These observations provide evidence of a regulatory role for PTEN in lymphocytes and implicate PTEN in the dysregulation of the immune system that occurs during autoimmunity. iv Table of Contents Abstract ii Table of Contents iv List of Tables vii List of Figures viii Abbreviations —ix Acknowledgements xi Preface xii Chapter 1 Introduction 1 1.1 Introduction / 1.1.1 Phosphatases are important signaling molecules in lymphocytes 1 1.1.2 The lipid phosphatase activity of PTEN is critical to its function 2 1.1.3 Lipid second messengers are important signaling molecules 3 1.1.4 The PI3K pathway is a central regulator of diverse cellular processes 4 1.1.5 PTEN functions as a negative regulator 6 1.1.6 PTEN regulates cell survival, proliferation, and cell cycle progression 8 1.1.7 Pten deficiency in mice leads to cancer susceptibility as well as an autoimmune phenotype 9 1.2 Thesis Goals 10 1.3 Thesis Layout 10 Chapter 2 Materials and Methods 11 2.1 Characterization of Pten +/- mice 11 2.1.1 Breeding strategy 11 2.1.2 Preparation of tail DNA for genotype testing of mice 11 2.1.3 Determination of the Pten genotype 11 2.1.4 Characterization of Pten tissue weights 12 2.1.5 Serum analysis of immunoglobulin isotype using ELISA 12 2.2 Cellular Isolations 13 2.2.1 Isolation of splenocytes 13 2.2.2 Isolation of peritoneal B cells 13 2.2.3 Purification of B cells from mouse spleen 13 2.2.4 Purification of T cells from mouse spleen 14 2.3 Cellular Stimulations 14 2.3.1 B cell proliferation assays 14 2.3.2 Expansion of CD4 + splenocytes in vitro 15 V 2.3.3 Lymphocyte stimulation for downstream analysis of signaling events 15 2.3.4 Treatment with PI3K inhibitors 15 2.4 Chemotaxis Assays '. 15 2.4.1 Assessment of chemotaxis using the transwell assay 15 2.4.2 Chemokine gradients used for stimulation of chemotaxis 16 2.4.3 Treatment with inhibitors 16 2.5 FACScan Analyses 17 2.5.1 Antibodies used for analysis of cell surface expression using FACScan 17 2.5.2 FACScan staining protocol 17 2.5.3 Analysis of FACScan profiles 18 2.6 Western Blot Analyses 18 2.6.2 Preparation of cellular lysates 18 2.6.3 Antibodies used 18 2.6.4 Electrophoresis conditions 19 2.6.5 Densitometric analyses 19 2.7 Microarray analysis of transcripts from Pten +/- T cells 20 2.7.1 Stimulation of CD4 + T cells for analysis of transcriptional effects 20 2.7.2 Isolation of RNA from CD4 + T cells 20 2.7.3 Affymetrix chip analysis 20 Chapter 3 Characterization of the autoimmune phenotype in Pten +/- mice 22 3.1 Introduction 22 3.2 Results 28 3.2.1 Spleen and body weights are elevated in aging Pten +/- mice 28 3.2.2 Serum Ig levels are increased in Pten +/- mice 30 3.2.3 B cell markers on splenocytes isolated from Pten +/- mice show normal distributions 33 3.2.4 The percentage of CD5+B220+ peritoneal B cells isolated from Pten +/- mice is unaltered 35 3.2.5 Purified B lymphocytes from Pten +/- mice show an altered proliferative response to LPS 35 3.2.6 Purified T lymphocytes from Pten +/- mice show no difference in activation 39 3.2.7 Reduced levels of Pten protein in Pten +/- lymphocytes 44 3.3 Discussion 46 Chapter 4 Haploinsufficiency of Pten results in augmented sensitivity to stromal cell derived factor-1 (SDF-1) 55 4.1 Introduction 55 4.2 Results 61 4.2.1 Pten +/- lymphocytes demonstrate increased responsiveness to SDF-1-induced chemotaxis •• 61 4.2.2 Reduced levels of Pten protein in Pten +/- lymphocytes upon SDF-1 stimulation 68 vi 4.2.3 Sustained PKB phosphorylation in Pten +/- lymphocytes 70 4.2.4 Downstream activation of the PKB substrate GSK-3 is not enhanced in Pten +/- T cells 75 4.2.5 Pten +/- lymphocytes show no significant difference in MAPK pathway activation following SDF-1 stimulation 75 4.2.6 Levels of CXCR4 are not elevated on Pten +/- T cells 78 4.3 Discussion 84 Chapter 5 Deficiency of Pten leads to a slight alteration in the transcriptional state of CD4+ lymphocytes . 92 5.1 Introduction 92 5.2 Results 99 5.2.1 Pten +/- T cells have elevated expression of an activation marker upon stimulation 99 5.2.2 Microarray analysis for the assessment of the transcriptional status of Pten +/-T cells 101 5.2.3 Cell surface expression of CD4 and CD8 in Pten +/- T cells 102 5.2.4 Cell surface expression of TCR|3 in Pten +/- T cells 105 5.2.5 Cell surface expression of IL-2 receptor subunits in Pten +/- T cells 107 5.2.6 Cellular expression of caspase-6 in Pten +/- T cells 109 5.2.7 Cellular expression of PI3K pi 106 in Pten +/- cells 111 5.3 Discussion 115 Chapter 6. Thesis Summary 126 6.1 Summary 126 6.2 Future Directions 127 Chapter 7: References 128 Appendix I: Microarray results from unstimulated +/+ and Pten +/- T cells 142 Appendix II: Microarray results from unstimulated +/+ and Pten +/- T cells 144 vii List of Tables Table 3.1a Spleen and body weights from female Pten +/- mice 29 Table 3.1b Spleen and body weights from male Pten +/- mice 29 Table 3.1c Spleen, body, and lymph node weights from aging female Pten +/- mice 29 Table 3. Id Spleen, body, and lymph node weights from aging male Pten +/- mice 29 Table 3.2a Serum Ig levels from female Pten +/- mice 32 Table 3.2b Serum Ig levels from aging female Pten +/- mice 32 Table 3.3 Isolation of splenocytes and mature B cells from Pten +/- mice 38 Table 3.4 Isolation of splenocytes and mature T cells from Pten +/- mice 42 Table 4.1 Chemotaxis of primary B cells from Pten +/- mice 63 Table 5.1a Altered expression of transcripts from unstimulated CD4 + T cells 103 Table 5.1b Altered expression of transcripts from SDF-1 stimulated CD4 + T cells 103 Table 5.2a Cell surface expression analysis of unstimulated CD4+ T cells 104 Table 5.2b Cell surface expression analysis of SDF-1 stimulated CD4 + T cells 104 vm List of Figures Figure 1.1. PTEN functions as a negative regulator 7 Figure 3.1. Elevated serum immunoglobulin isotypes in Pten +/- mice 31 Figure 3.2. Normal expression of B cell specific markers on splenocytes from Pten +/-mice 34 Figure 3.3. Normal percentages of CD5+B220+ peritoneal B cells are isolated from Pten +/- mice 36 Figure 3.4. Isolation of pure populations of peripheral B cells from splenocytes of Pten +/- mice 37 Figure 3.5. Enhanced viability of Pten +/- B cells in response to LPS 40 Figure 3.6. Isolation of CD4 + T cell populations from splenocytes of Pten +/- mice 41 Figure 3.7. Pten +/- T cells show no reproducible elevation of CD69 expression following CD3 stimulated expansion in vitro 43 Figure 3.8. Pten +/- lymphocytes have decreased levels of Pten protein 45 Figure 4.1. Pten +/- B cells show increased sensitivity to SDF-1 62 Figure 4.2. The SDF-1 induced chemotactic response of Pten +/- B cells is PI3K dependent 65 Figure 4.3. Dose response of Pten +/- T cells to SDF-1 66 Figure 4.4. PI3K inhibition markedly reduces the chemotactic response of Pten +/- T cells towards SDF-1 67 Figure 4.5. Chemotaxis towards MCP-1 is unaltered in Pten +/- T cells 69 Figure 4.6. Levels of Pten protein are decreased as compared to wildtype in SDF-1 stimulated Pten +/- T cells 71 Figure 4.7. Pten +/- B cells show increased phosphorylation of PKB in response to SDF-1 stimulation 73 Figure 4.8. Elevated PKB phosphorylation in Pten +/- T cells in response to SDF-1 stimulation 74 Figure 4.9. Phosphorylation of GSK-3 in Pten +/- T cells in response to SDF-1 76 Figure 4.10. MAPK phosphorylation in Pten +/- lymphocytes following SDF-1 stimulation 77 Figure 4.11. SDF-1 induced PKB phosphorylation, but not MAPK phosphorylation, is PI3K dependent in Pten +/- T cells 79 Figure 4.12. Cellular CXCR4 levels in Pten +/- T cells are not elevated 80 Figure 4.13. CXCR4 is expressed on the cell surface of Pten +/- T cells 82 Figure 4.14. Cell surface expression of CXCR4 is unchanged in Pten +/- T cells 83 Figure 5.1. Enhanced expression of CD69 on Pten +/- T cells upon SDF-1 stimulation. 100 Figure 5.2. Cell surface staining of CD4 and CD8 on Pten +/- T cells 106 Figure 5.3. TCRbeta cell surface staining on Pten +/- T cells 108 Figure 5.4. Reduced expression of IL-2 receptor chains on Pten +/- T cells upon SDF-1 stimulation 110 Figure 5.5. Expression of Caspase-6 in Pten +/- T cells 112 Figure 5.6. Expression of the delta isoform of the PI3K catalytic subunit in Pten +/- T cells 114 Abbreviations BAD Bcl-2 antagonist of apoptosis B A X Bcl-2 association X protein Bcl-2 B cell lymphoma-2 Bcl-Xl B cell lymphoma-Xl BCR B cell receptor BIM Bcl-2 interacting mediator of cell death protein Blk Bik-like killer protein BSA Bovine serum albumin Btk Bruton's tyrosine kinase c-myc Cellular myelocytic leukemia protein CREB CRE binding protein DAG Diacylglycerol DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid ELISA Enzyme linked immunosorbent assay FACScan Fluorescence activated cell scanning FAK Focal adhesion kinase FAS Fibroblast associated protein FASL FAS ligand FCS Fetal calf serum FITC Fluoresceine isothiocyanate GSK-3 Glycogen sythase kinase-3 h Hour HIF-la Hypoxia inducible factor-la IAPs Inhibitors of apoptosis IkB Inhibitor of NFkB IL-2 Interleukin-2 IL-2R IL-2 receptor IL-7 Interleukin-7 LP3 Inositol triphosphate ITAM Immunoreceptor activation motif ITLM Immunoreceptor inhibitory motif Itk LL-2 inducible T cell kinase JAK Janus kinases Lck Lymphocyte specific protein tyrosine kinase LPS Lipopolysacharide MAPK Mitogen activated protein kinase MCP-1 Monocyte chemoattractant protein-1 MHC Major histocompatibility complex min Minute MMAC1 Mutated in multiple advanced cancers-1 mTOR Mammalian target of rapamycin NF-AT Nuclear factor of activated T cells X NFkB Nuclear factor kB p27KIPl Cyclin dependent kinase inhibitor PARP Poly ADP-ribose polymerase PDK-1 Phosphoinositide dependent kinase-1 PE Phycoerytherin PH Pleckstrin homology PI Phosphatidylinositol PIP Phosphatidylinositol lipid species PI(3)P Phosphatidylinositol-3-phosphate PI(3,4)P Phosphatidylinositol-3,4-bisphosphate PI(3,4,5)P3 Phosphatidylinositol-3,4,5-trisphosphate PI(4,5)P2 Phosphatidylinositol-4,5-bisphosphate PI(5)P Phosphatidylinositol-5-phosphate PI3K Phosphatidylinositol 3-kinase PIP Phosphatidylinositol phosphate PKB Protein kinase B PKC Protein kinase C PLCy Phospholipase Cy PTEN Phosphatase and tensin homolog located on chromosome ten RANTES Regulated upon activation normal T cell expressed and secreted Ras Rat derived murine sarcoma virus oncogene rpm Revolution per minute Rsk Ribosomal protein S6 kinase SCF Stem cell factor SCID/NOD Severe combined immunodeficiency/non-obsese diabetic SDF-1 Stromal cell derived factor-1 SEM Standard error of the mean SHIP SH2 containing inositol phosphatase SHP-1 SH2 containing phosphatase STAT Signal transducer and activator of transcription Syk Src tyrosine kinase TCR T cell receptor TEP-1 TGF-P inducible endothelial cell protein-1 TNF-a Tumor necrosis factor-a VEGF Vascular endothelial growth factor wk Week WST-1 4-[3-(4-Idophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate xid X-linked immunodeficiency protein ZAP-70 Z-chain associated protein xi Acknowledgements I am indebted to a number of people who aided me during the course of this thesis. In particular I would like to thank my supervisor, Dr. Frank Jirik, for his continued support and for encouraging me to move in new directions. I am grateful to Dr. Susan Andrew for introducing me to the lab and to Jim Peacock, Dr. Ken Harder, Dr. Scott Pownell, Letti Hsiao and Nicole Janzen for sharing their expertise. I would like to thank the rest of the Jirik lab members for their role in making the lab an enjoyable place to work. I appreciate the advice and support that I have received from my committee members: Dr. Ann Rose, Dr. Robert Kay and Dr. Phil Hieter. I would like to acknowledge the financial support I have received from the Natural Sciences and Engineering Research Council, the Alberta Heritage Foundation for Medical Research and the University of British Columbia. Finally, I could not have done any of this without the continued support of my family and friends. Xll Preface Thesis Format: This thesis includes seven sections. Chapters 3, 4, and 5 focus on the results obtained during my thesis research. Each of these chapters is formatted as an expanded manuscript and contains an introduction, a results section, and a discussion. Work from Chapter 4 resulted in a publication that is referenced below. The first chapter contains a short introduction to PTEN and the signaling pathways regulated by this lipid phosphatase. Chapter 2 contains the materials and methods utilized in this work. Chapter 6 contains a short summary of the results obtained and contains my thoughts about possible directions for experiments emerging from this work. Finally, Chapter 7 contains the references. Publication resulting from this thesis: Fox, J.A., Ung, K., Tanlimco, S.G., Jirik, F.R. (2002) Disruption of a Single Pten Allele Augments the Chemotactic Response of B Lymphocytes to Stromal Cell-Derived Factor-1. The Journal of Immunology, 169: 49-54. 1 Chapter 1 Introduction 1.1 Introduction. 1.1.1 Phosphatases are important signaling molecules in lymphocytes. Phosphatases are a family of enzymes that modulate cellular levels of phosphorylation. Phosphorylation and dephosphorylation events are crucial for the transfer and integration of biochemical signals in the cell. Cells of the immune system have a complex circuitry of signaling pathways that are regulated by phosphorylation events and control fundamental cellular processes such as growth, differentiation and apoptosis during the immune response. Numerous phosphatases are known to be expressed in lymphocytes and a number of these have been demonstrated to be involved in immune responses (reviewed in (Li and Dixon, 2000; Mustelin et al., 1998)). Protein tyrosine phosphatases can be classified into two types depending on their structure. The receptor-like protein tyrosine phosphatases contain a transmembrane domain, an extracellular domain, that varies greatly between different phosphatases, and one or two intracellular phosphatase domains. CD45 was the first transmembrane phosphatase in lymphoid cells shown to be essential for multiple signaling events in both B and T cells (Pani and Siminovitch, 1997). A second group of intracellular phosphatases having a single catalytic domain as well as various other modules that target them to specific intracellular locations also exist. The phosphatase, SH2-containing phosphatase-1 (SHP-1), is an example of an intracellular phosphatase containing tandem SH2 domains that is predominately expressed in hematopoetic cells. SHP-1 regulates signal transduction pathways mediated by a variety of hematopoetic receptors, some of which contain 2 conserved immunoreceptor tyrosine-based inhibitory motifs (ITIM) to which the SH2 domains of this phosphatase bind (Pani and Siminovitch, 1997). An additional family of intracellular phosphatases, known as the dual specificity phosphatases can dephosphorylate serine/threonine as well as tyrosine residues. Al l of these classes of phosphatases utilize a similar catalytic mechanism and possess the active site signature sequence (I/V)HCXXGXXR(S/T). During screens for tumor suppressors, the gene for PTEN was isolated by positional cloning and was found to contain the aforementioned phosphatase signature sequence (Li et a l , 1997; Steck et a l , 1997). As discussed below, PTEN was discovered also to be a phosphatase for specific non-protein substrates. As the complex signaling events that occur during an immune response are regulated in part by phosphatases, the discovery of PTEN, has led to important insights into an additional mechanism by which phosphatases are able to regulate the responses of lymphocytes. 1.1.2 The lipid phosphatase activity of PTEN is critical to its function. PTEN is one of the most frequently mutated tumor suppressor genes in variety of human cancers including: brain, prostate, breast, endometrial and other types (reviewed in (Ali et al , 1999)). The PTEN gene is also mutated in inherited cancer syndromes such as Cowden syndrome (Ali et a l , 1999). Its different names highlight distinct features of this gene: PTEN (phosphatase and tensin homolog located on chromosome ten) (Li et al , 1997); MMAC1 (mutated in multiple advanced cancers) (Steck et a l , 1997); and TEP-1 (TGF-p regulated and epithelial cell enriched phosphatase) (Li and Sun, 1997). The action of PTEN is as a lipid phosphatase whose primary substrate is phosphatidylinositol-3,4,5-triphosphate within cellular membranes (Maehama and Dixon, 1998). PTEN also has weak protein tyrosine phosphatase activity (Myers et a l , 1997; Tamura et al , 1998). 3 However, the function of PTEN as a tumor suppressor is due to its lipid phosphatase activity (Myers et al., 1998). By antagonizing the action of PI3K that generates phosphatidylinositol second messengers in lipid membranes, PTEN affects a number of cellular processes. , 1.1.3 Lipid second messengers are important signaling molecules. Phosphatidylinositol species are key components of eukaryotic cell membranes. Phosphorylation of the inositol head group leads to phosphorylated derivatives of phosphatidylinositol (PI). The following PI species have been identified in mammalian cells: phosphatidylinositol-3-phosphate (PI(3)P), phosphatidylinositol-4-phosphate (PI(4)P), phosphatidylinositol-5-phosphate (PI(5)P), phosphatidylinositol-3,4-bisphosphate (PI(3,4)P2), phosphatidylinositol-3,5-bisphosphate (PI(3,5)P2), phosphatidylinositol-4,5-bisphosphate (PI(4,5)P2), and phosphatidylinositol-3,4,5-trisphosphate (PI(3,4,5)P3) (Fruman et al., 1998). Phosphatidylinositol lipids form a small percentage of total cellular phospholipids but play a crucial role in cell signaling as precursors of several second messenger molecules. Relatively constant levels of PI, PI(4)P, and PI(4,5)P2 predominate in cells and are maintained through the action of lipid kinases, phosphatases, and phospholipases (Fruman et al., 1998). PI(4,5)P2 serves as a substrate for phospholipase Cy (PLCy) resulting in the generation of the second messengers inositol triphosphate (IP3) and diacylglycerol (DAG). The action of these second messengers includes the activation of protein kinase C (PKC) by DAG and the rise in intracellular Ca 2 + levels initiated by LP3. PI(3,4)P2 and PI(3,4,5)P3 also act as important second messengers by regulating the interaction of intracellular proteins with the membrane, affecting their localization and/or activity (Vanhaesebroeck and 4 Waterfield, 1999). Basal levels of PI(3,4)P2 and PI(3,4,5)P3 in cells are very low and can rise sharply upon cellular stimulation. Phosphatidylinositol-3-kinases (PI3K) are responsible for the generation of these important species of 3' phosphorylated lipid messengers. 1.1.4 The PI3K pathway is a central regulator of diverse cellular processes. Phosphatidylinositol kinases are an important group of enzymes responsible for the maintenance of normal levels of inositol phospholipids in the membrane. Phosphatidylinositol-3-kinases are responsible for phosphorylation of the 3' hydroxyl position of the inositol head group. PI3K can be divided into several classes. Class I PI3K are responsible for the generation of PI(3,4)P2 and PI(3,4,5)P3 (Fruman et a l , 1998). PI3K enzymes are made up of a catalytic subunit, which possesses lipid kinase activity, and a regulatory subunit. Multiple isoforms of the catalytic subunit of class I PI3K exist including pi 10a, pi 10(3, pi 105 and p 110y. Likewise, multiple genes encode the different regulatory subunits: p85a, p85(3, p55y, and plOl. As discussed below, PI3K signaling has been implicated in the regulation of many important cellular processes. Much of this work has been facilitated by the use of specific inhibitors. Wortmannin is a fungal metabolite that acts as an irreversible inhibitor of PI3K by covalently binding to the catalytic lysine of this kinase. LY294002, is a reversible inhibitor that has also been used to study the function of PI3K. These studies have revealed that PI3K, through the generation of PI(3,4)P2 and PI(3,4,5)P3, acts a central regulator of diverse cellular processes. Specific lipid binding domains in proteins can cause changes in protein localization, conformation and activity by binding to phosphoinositide species in cellular 5 membranes. Pleckstrin homology (PH) domains are globular protein domains of about 100 amino acids that can bind phospholipids (Vanhaesebroeck and Waterfield, 1999). The activation of PH domain containing proteins by binding to localized concentrations of PI(3,4)P2 and PI(3,4,5)P3 in cell membranes mediates downstream signaling events initiated by PI3K. The kinase protein kinase B (PKB), for example, is a central player in PI3K signaling and contains an N-terminal PH domain. Activation of PKB through PH-domain mediated association with the membrane and subsequent phosphorylation events target downstream molecules for phosphorylation by this kinase (reviewed in (Vanhaesebroeck and Waterfield, 1999))(Kandel and Hay, 1999). Regulation of cell survival through phosphorylation of BAD (Bcl-2 antagonist of apoptosis) is thought to be a consequence of PKB activation (Datta et a l , 1997). Phosphorylated BAD no longer associates with Bcl-2 (B cell lymphoma-2) allowing this protein to inhibit apoptosis. Caspase-9 is also phosphorylated and inhibited by PKB leading to the inhibition of apoptosis (Cardone et a l , 1998). Phosphorylation of the forkhead family of transcription factors by PKB is thought to cause export out of the nucleus away from genes that encode pro-apoptotic molecules, such as fibroblast associated ligand (FASL) (Brunet et al , 1999). Similarly, regulation of the nuclear factor K B ( N F K B ) transcription by PKB mediated degradation of the I K B inhibitor causes activation of anti-apoptotic genes (Kane et al., 1999). PKB has also been shown to phosphorylate the kinases, glycogen synthase kinase-3 (GSK-3) and mammalian target of rapamycin (mTOR), which regulate protein synthesis (Scott et al , 1998; Welsh et a l , 1998). Therefore, through the multiple substrates of PKB diverse cellular responses are initiated by PI3K activity. Other proteins with PH-domains exist in the cell and may also act as important mediators of PI3K induced signaling. The tyrosine kinase, Bruton's tyrosine kinase (Btk), is critical for B cell development and function (Hendriks et al , 1996; Satterthwaite et a l , 2000). As with PKB activation, PH domain mediated translocation to the membrane is also thought to activate Btk. Thus, through the activation of PH-domain containing proteins, lipid second messengers can initiate diverse downstream signaling events. Perturbations in the levels of phosphatidylinositol species through dsyregulation of PI3K could have drastic effects on normal cellular responses. 1.1.5 PTEN functions as a negative regulator. PTEN functions as an antagonist of PI3K by dephosphorylating phosphatidylinositol lipid species (Vazquez and Sellers, 2000). Under conditions of normal cellular growth, stimulation of receptors leads to activation of PI3K, causing the conversion of PI(4,5)P2 to PI(3,4,5)P3 in the membrane (Figure 1.1a). PI3K activation has been linked to the stimulation of various types of receptors in lymphocytes including antigen receptors. Elevated concentrations of PI(3,4,5)P3 levels in the membrane cause activation of PH domain containing proteins, including PKB and Btk, which control normal cellular growth and activation. PTEN controls the activation of these downstream pathways by causing the conversion of PI(3,4,5)P3 back to PI(4,5)P2. In the presence of a mutation which destroys the ability of PTEN to act as a lipid phosphatase levels of PI(3,4,5)P3 remain elevated in the membrane and activation of PKB proceeds unchecked (Figure l.lb). Upregulated activation of PKB can lead to accelerated cell growth and aberrant control of apoptosis. Thus, PTEN is required for normal cellular signaling that controls events such as cellular proliferation and apoptosis. 7 Extracellular other signalling pathways (e.g. Btk) PKB normal (-> cell growth stimulatory signals Extracellular other signalling pathways (e.g. Btk) accelerated cell growth & aberrant apoptosis Figure 1.1. PTEN functions as a negative regulator. The PTEN tumor suppressor acts as a phosphatidylinositol phosphatase, (a). Under normal growth conditions, stimulatory signals from growth factor or antigen receptors activate the enzyme phosphatidyIinositol-3-kinase (PI3K), which phosphorylates phosphatidylinositol-4,5-bisphosphate (PIP2) to generate phosphatidylinositol-3,4,5-trisphosphate (PIP3), a lipid second messenger. Downstream, PIP3 activates several effectors, including P K B . The role of PTEN is to dephosphorylate PIP3, and therefore act as a negative regulator of P K B . (b). If a mutation in PTEN renders it unable to carry out its phosphatase function, PIP3 is no longer degraded, and continues to propagate its signals downstream. This may result in the continued activation of P K B , which, in combination with other factors, leads to increased cell growth and resistance to apoptosis. This figure has been adapted from "PTEN and the tumor suppressor balancing act." NCBI Coffee Break CB8.101199, 10 Nov 1999. 8 1.1.6 PTEN regulates cell survival, proliferation, and cell cycle progression. PTEN has been implicated in the regulation of proliferation and apoptosis in many studies in which PTEN was transiently overexpressed in a variety of tumor cell lines. It has been found that the increased expression of PTEN suppresses proliferation, likely due to an arrest in the GI phase of the cell cycle (Li and Sun, 1998). Corresponding increases in the levels of the cell cycle inhibitors, such as p27K I P I accompany PTEN induced GI arrest (Gottschalk et al , 2001). In other cell types, PTEN overexpression leads to an induction of apoptosis mediated via inhibition of PKB signaling (Lu et a l , 1999; Weng et al , 2001a). Expression of PTEN in the cell leads to downregulation of PKB activity as evidenced by decreased levels of phospho-PKB (Davies et al , 1998a; Myers et a l , 1998; Stambolic et a l , 1998). The cellular context in which PTEN is expressed apparently plays a role in the outcome since distinct cell lines can give slightly different results. Maehema et a l , in an excellent review, summarized all of the published work regarding the effects of PTEN overexpression on cellular responses in human cell lines (Maehama et a l , 2001). The trend across multiple cell types is that PTEN overexpression: inhibits PKB activation, reduces focal adhesion kinase (FAK) phosphorylation, induces apoptosis, inhibits cell proliferation and hinders cellular invasion and/or migration (Maehama et al , 2001). Thus, an alteration in the level of PTEN expressed leads the dysregulation of many important cellular signals. 9 1.1.7 Pten deficiency in mice leads to cancer susceptibility as well as an autoimmune phenotype. Mice deficient for Pten were created to examine the consequence of changes in PTEN expression in vivo. Pten -I- mice were embryonic lethal revealing a role for Pten in normal development (Di Cristofano et al , 1998; Suzuki et a l , 1998). Pten +/- mice developed tumors in multiple tissues that were associated with loss of heterozygosity confirming the ability of PTEN to act as a tumor suppressor in vivo (Podsypanina et al , 1999; Stambolic et al , 2000). Pten +/- animals also developed non-neoplastic hyperplasia of lymph nodes that was accompanied by signs of autoimmunity (Di Cristofano et al , 1999). An inherited defect in the apoptosis of B cells and macrophages was observed in Pten +/- animals (Podsypanina et al , 1999). As well, FAS-mediated apoptosis of T and B cells was impaired in these mice (Di Cristofano et al , 1999). These observations implicate PTEN in the control of lymphocyte homeostasis in the immune system. Embryonic stem cells derived from Pten -I- showed increases in cellular proliferation whereas mouse embryonic fibroblasts from Pten -I- and +/- did not demonstrate any changes in proliferative capacity (Stambolic et a l , 1998; Sun et al , 1999). However, these Pten -I- cells exhibited a decrease in sensitivity to a number of apoptotic stimuli (Stambolic et a l , 1998). Thus, mouse studies reveal the importance of Pten in the control of cellular proliferation, activation and apoptosis and suggest a role in the immune system. 10 1.2 Thesis Goals The implication of PTEN as a negative regulator of PI3K suggests that PTEN may be an important regulator of diverse cellular processes. This evidence, in combination with results associating Pten deficiency with autoimmunity in Pten +/- mice, led us to further investigate the role of Pten in immune regulation. We set out to determine to what extent PTEN plays a role in immune regulation by an examination of the immune dysfunction that occurs in Pten +/- mice. We also wanted to establish the effects of Pten deficiency in lymphocytes. We examined Pten +/- lymphocytes to see if any alteration in cellular responses occurs as a result of Pten haploinsufficiency. Our main aim was to gain insight into alterations in lymphocytes that result from Pten deficiency and how these changes could contribute to the autoimmune disease that develops in Pten +/- mice. 1.3 Thesis Layout This document is organized into seven Chapters. An introduction to phosphatases, relevant signaling pathways, and PTEN is included in Chapter 1. Three major chapters discuss the results of this thesis work: Chapter 3, Chapter 4, and Chapter 5. Each of these chapters includes its own self-contained discussion. The figures and figure legends are interleafed thoughout the text of each chapter. An interruption in text for the inclusion of a figure and legend is indicated by the • symbol. The format adopted here precludes the inclusion of a final discussion and instead a short summary is provided in Chapter 6. The materials and methods used in this work are included in Chapter 2 and the references are contained within Chapter 7. 11 Chapter 2 Materials and Methods 2.1 Characterization of Pten +/- mice 2.1.1 Breeding strategy Pten +/- mice were created by gene-targeting of exon 5 which disrupts the catalytic domain of this phosphatase (Podsypanina et a l , 1999). These mice were kindly provided by R. Parsons (Columbia University, New York). Pten +/- mice were maintained by breeding Pten +/- male mice with BL/6 females. Any mice that displayed signs of lymph node enlargement or distress were sacrificed. Al l litters were maintained in a specific pathogen-free barrier animal facility, according to guidelines of the Canadian Council of Animal Care and in conformity with institutional policies. 2.1.2 Preparation of tail DNA for genotype testing of mice Litters from Pten +/- x BL/6 breeding pairs were marked for identification using ear notches and tails were clipped for genotype analyses. DNA was isolated from tissue preparations of ear notches or tail pieces. DNA was extracted from these tissue pieces by boiling for 10 min with a solution of 0.05M NaOH. These preparations were then neutralized with 2M Tris pH 7.5. After spinning down the debris, this solution was used as a template in the Pten genotyping PCR. 2.1.3 Determination of the Pten genotype The strategy for determination of the Pten genotype was developed by Podsypanina et al. (Podsypanina et a l , 2001). Both the mutant and wildtype alleles were amplified simultaneously by using a common 5' primer within intron 4 and two 3' primers, one 12 within exon 5 of Pten and the other within the Pgk gene contained within the targeting vector: GGGATTATCTTTTTGCAACAGT (Pten 5'), GGCCTCTTGTGCCTTTA (Pten 3'), and TTCCTGACTAGGGGAGGAGT (Pgk 3'). PCR was performed as described (Podsypanina et al , 2001). 2.1.4 Characterization of Pten tissue weights Characterization of the lymphoadenopathy and splenomegaly features of the Pten +/- phenotype involved the analysis of tissue and body weights. Body weight of mice was determined by whole body measurement of weight immediately after anaesthesia. Tissue weight was measured immediately following dissection from the animal. For all tissue and body weight measurements age and sex matched littermates were analyzed in parallel. 2.1.5 Serum analysis of immunoglobulin isotype using ELISA Blood was collected from Pten +/- and wildtype littermates using either direct ventricle puncture or a technique of dissection followed by vena cava puncture. An overdose of anaesthesia was given before blood was isolated. Blood isolated from each animal was separated at 14,000 rpm for 10 min at 4°C. Serum was then stored at -70°C until further analysis. Serum immunoglobulin isotype levels were assessed by enzyme linked immunosorbent assay (ELISA). ELISA kits were purchased from Pharmingen and assays were carried out according to the manufacturer's protocols. Dilution series were carried out serum to ensure that all samples were measured within the linear range defined by the 13 standard curve. Al l measurements were performed in duplicate and multiple independent experiments using different littermate sets were analyzed. 2.2 Cellular Isolations 2.2.1 Isolation of splenocytes Spleens were isolated from 8 wk old Pten +/- mice and sex-matched littermate controls. Forcing spleens through wire mesh isolated single-cell suspensions of splenocytes. Splenocytes used for subsequent analysis were washed once and then resuspended in cold media (either RPMI supplemented with FCS or AEV1V). 2.2.2 Isolation of peritoneal B cells Peritoneal B cells were isolated from Pten +/- mice and sex-matched littermate controls by injecting a sterile solution of saline into the peritoneal cavity after the administration of an overdose of anaethesia. The solution was collected from the peritoneal cavity after gentle shaking. Cells were isolated by spinning at 1500 rpm for 5 min and used directly for subsequent analyses. 2.2.3 Purification of B cells from mouse spleen To isolate B cells, single-cell suspensions of splenocytes were first incubated with red blood cell lysis buffer and then washed twice in cold Hanks solution. T cells were depleted from the cell suspension by two separate incubations with monoclonal anti-Thy-1.2 (H013.4), anti-CD4 (2B6), and anti-CD8 (3.155) antibodies together with low endotoxin rabbit complement (Cedarlane) for 45 min at 37°C. The remaining B cells were then isolated by Percoll density centrifugation as previously described (Gold et a l . 14 1992). This cell population consisted of 80%-94% CD19+ cells as determined by flow cytometry. 2.2.4 Purification of T cells from mouse spleen CD4 + splenocytes were purified using the MACS colloidal magnetic MicroBeads according to the manufacturer's instructions (Miltenyi Biotec). Briefly, this protocol involves the positive selection of the CD4 + population of splenocytes using magnetic beads coupled to anti-CD4. In general, the antibody concentration of the antibody-MicroBead complex is such that only a certain percentage of the cells' epitopes are bound by antibody. Therefore, antibodies with the same specificity can be used for magnetic and fluorescent labelling without greatly influencing the quality of fluorescent staining. Subsequently, it was found that this cell population consisted of greater than 90% CD4 + cells as determined by flow cytometry. 2.3 Cellular Stimulations 2.3.1 B cell proliferation assays Purified B cells were resuspended at 5 x 105 cells/mL in RPMI supplemented with 10% FCS, penicillin, streptomycin, and 2-mercaptoethanol and 100 pi per well was aliquoted onto a 96 well plate. After incubation at 37°C, 5% C 0 2 for 24 - 48 h, WST-1 reagent (Boehringer Mannheim) was added to each well at 1:100 dilution. Triplicate wells for each condition were measured for absorbance at 450 nm after 1 h incubation at 37°C. 15 2.3.2 Expansion of CD4 + splenocytes in vitro Purified CD4 + splenocytes were activated on 2Cll-coated (1.0pLg/ml) plates at a density of 3.0 x 106 cells/ml and 48 h later cells were removed from coated plates, washed 3 times with PBS and subsequently expanded in either ALVIV or RPMI supplemented with 10% FCS and 3% X63 OMIL-2 conditioned media. 2.3.3 Lymphocyte stimulation for downstream analysis of signaling events Primary lymphocytes were resuspended in RPMI (without serum) at 1 x 108 cells per ml and stimulated with 50 pg/ml SDF-1. Immunoblotting was carried out as described (Peacock and Jirik, 1999) with 25-100 ug of total protein loaded per lane. 2.3.4 Treatment with PI3K inhibitors Primary lymphocytes were resuspended in RPMI (without serum) at 1 x 108 cells per ml and stimulated with 50 Ug/ml SDF-1. For the LY294002 studies, cells were resuspended at 1 x 108 cells per ml and then 50 uM LY294002 or an equivalent volume of DMSO was added for 15 min at room temperature. Cells were then stimulated with 50 pig/mL SDF-1. Stimulations were terminated with the addition of cold lysis buffer as described (Peacock and Jirik, 1999). 2.4 Chemotaxis Assays 2.4.1 Assessment of chemotaxis using the transwell assay For chemotaxis experiments, purified B lymphocytes were resuspended in RPMI (without serum) at 1 x 107 cells per ml. Migration assays were carried out using Transwell polycarbonate membranes (Coming-Costar, Cambridge, MA) as previously 16 described (Peacock and Jirik, 1999). Briefly, 1 x 106 cells were placed in the top chamber of each Transwell; after incubation for 3 h at 37°C the number of cells that had migrated to the lower chamber were assessed by flow cytometry. 2.4.2 Chemokine gradients used for stimulation of chemotaxis SDF-1 (residues 1-67) was a generous gift from I. Clark-Lewis (University of British Columbia). SDF-1 and MCP-1 were also purchased from Research Diagnostics. Stock solutions of chemokines were stored at -20°C. For chemokine gradients, concentrated stock solutions were diluted in RPMI and placed in the lower chamber to be used immediately in chemotaxis assays. Unused portions of chemokine stock solutions were stored at +4°C after thawing. For assessment of chemokinesis vs. chemotaxis, migration was tested in both the presence and absence of an SDF-1 gradient. To create a situation with no SDF-1 gradient, cells placed in the upper chamber were resuspended in the same SDF-1 solution used for the lower chamber and then migration was allowed to proceed for 3 h. 2.4.3 Treatment with inhibitors For assessment of chemotaxis in the presence of PI3K inhibitors, 100 nM wortmannin was added to both the upper and lower chambers and the migration response was compared to that seen without the inhibitor. For LY294002, a dose of either 50 pM or an equivalent volume of the solvent, DMSO, was added to both the upper and lower chambers. To assess the efficacy of PI3K inhibition by LY294002 under these conditions, 10 ml of cells at 3 x 106 cells/ml were set aside and treated with 1500 ng/mL 17 SDF-1 and incubated 3 h at 37°C. At the end of the incubation, the cells were spun down and resuspended in cold lysis buffer for assessment of PKB phosphorylation. 2.5 FACScan Analyses 2.5.1 Antibodies used for analysis of cell surface expression using FACScan The following antibodies specific for mouse were used: phycoerytherin (PE)-conjugated anti-IgM, fluoresceine isothiocyanate (FITC)-conjugated anti-IgD, FITC-conjugated anti-B220, PE-conjugated anti-CD5, PE-conjugated anti-CD 19, FITC-conjugated anti-CD4, PE-conjugated anti-CD4, FITC-conjugated anti-CD69, PE-conjugated anti-CD69, FITC-conjugated anti-CD8, PE-conjugated TCR-beta, PE-conjugated CCR5, PE-conjugated anti-CD122, PE-conjugated anti-CD25, and FITC-conjugated anti-mouse IgG (from Pharmingen). Antibodies against CXCR4 were obtained from Santa Cruz. 2.5.2 FACScan staining protocol Cells stained for fluorescence activated cell scan (FACScan) analysis were washed 3 times with cold FACS wash buffer (PBS, 2% FCS) and then stained with the appropriate antibody at ~1 pg/mL for 1 h on ice. For PE-conjugated antibodies, cells were blocked with anti-FcyRI for at least 15 min prior to staining. After staining cells were washed 3 more times with FACS wash buffer and analyzed by using a FACScan (Becton Dickson). Cells stained with propidium iodide (Pharmingen) were incubated with 0.05 pg/mL for 15 min on ice and then analyzed immediately after washing. Cells stained for surface expression of CXCR4 were washed and blocked as described above. For CXCR4 staining cells were incubated in combination with 4 pg/mL anti-CXCR4 (fusin C-20, 18 Santa Cruz) and FITC-conjugated anti-mouse IgG (Pharmingen) and stained as described above. The cell staining profile was compared to cells stained with an isotype matched control antibody (EGFR, Santa Cruz) in combination with FITC-conjugated anti-mouse IgG (Pharmingen). 2.5.3 Analysis of FACScan profiles Staining profiles were collected using Cellquest software and analysis was carried out using Flow Jo analysis software. 2.6 Western Blot Analyses 2.6.2 Preparation of cellular lysates Cells were lysed in Nonidet P-40 lysis buffer (1% Nonidet P-40, 150 mM NaCI, 50 mM Tris (pH 7.5), and 10% glycerol) in the presence of protease inhibitors (100 ug/mL PMSF, 1.0p,g/mL aprotinin, 0.7 Ug/mL pepstatin, 0.5 p:g/mL leupeptin, lOug/mL soybean trypsin inhibitor (Boehringer Mannheim), 10 mM sodium fluoride, 1 mM sodium vanadate, and 1 mM sodium molybdate (BDH). After 30 min on ice, lysates were centrifuged for 15 min at 14,000 rpm and stored at -20°C until immunoblot analyses. 2.6.3 Antibodies used Antibodies with the following specificities were diluted 1:1000 in TBST containing 1% BSA: PTEN (6H2.1, A. G. Scientific, Inc.), phospho-specific MAPK, MAPK, phospho-GSK3, caspase-6, caspase-3, cleaved caspase-3, phospho-PKB (Ser473), and PKB (from Cell Signaling Technology). CXCR4 (fusin C-20) was also used at a dilution 19 of 1:1000 in TBST containing 1% BSA (from Santa Cruz). The PI3K pi 10 delta specific antibody was diluted 1:200 (from Santa Cruz) whereas the antibody specific for a-tubulin was diluted 1:500 (from Sigma) in TBST containing 1% BSA. 2.6.4 Electrophoresis conditions Protein concentrations were determined using the Bradford colorimetric assay (Biorad) and a standard curve of known BSA concentrations. Lysate volumes corresponding to 25 - 100 pg of protein were diluted 1:3 with Laemmli sample buffer. Samples were boiled for 5 min before electrophoresis. Proteins were separated by SDS-PAGE at 150 V and transferred to nitrocellulose paper by electroblotting in a semi-dry blotting apparatus (Biorad) at 25 V for 45 min. Filters were incubated for 1 h at room temperature in TBST (10 mM Tris (pH 8.0), 150 mM NaCl, and 0.05% Tween-20) containing 5% Bovine Serum Albumin (BSA). Filters were then incubated overnight in TBST containing 1.0% BSA supplemented with primary antibody at the dilutions described above. After three additional washes in TBST, filters were incubated for 45 min in the appropriate horseradish peroxidase-conjugated secondary antibody and washed again as described, and proteins were detected using enhanced chemiluminescence and visualized using a Fluor-S Multimager (Biorad). 2.6.5 Densitometric analyses Densitometry was carried out on between two to five immunoblots derived from independent experiments. The values obtained for the phospho-specific blots were expressed as a percentage of the density of the protein loading control. Protein loading controls were done in parallel on each of the samples using antibodies specific for the 20 non-phosphorylated forms of the proteins. For each experiment, values were normalized and results represent relative values of phosphorylation. 2.7 Microarray analysis of transcripts from Pten +/- T cells 2.7.1 Stimulation of CD4 + T cells for analysis of transcriptional effects Expanded CD4 + cells isolated from Pten +/- and wildtype littermates were resuspended at 3 x 106 cells per mL in AIMV media supplemented with 5% X63 OMIL-2 conditioned media containing EL-2. Cells were stimulated by the addition of 1.5 ug/mL SDF-1 to the media and subsequent incubation at 37°C for 6 h. After stimulation cells were collected by centrifugation at 1,500 rpm for 5 min. 2.7.2 Isolation of RNA from CD4 + T cells Immediately following stimulation, a 10 mL cell solution was collected and resuspended in 1 mL Trizol reagent (Life Technologies). Total RNA was isolated according to the manufacturers protocols. Isolated RNA samples were purified for microarray analysis using the MessageClean Kit (GenHunter Corporation). RNA samples were checked by gel electrophoresis and then quantified using UV spectrophotometry. 2.7.3 Affymetrix chip analysis RNA samples were sent to the Ottawa Health Research Institute (OHRI) for analysis using the Affymetrix Genechips. Labelled cDNA derived from these RNA samples were hybridized to the Murine U74A genechip. Data analysis of the resulting expression array was carried out at the OHRI. Resulting gene lists were analyzed for genes of interest that 21 showed differential responses in the Pten +/- cells over controls. Candidate genes were then verified by independent techniques for changes in expression. Several terms, which are used in the presentation of the microarray data, require further definition. The analysis of the Affymetrix array data that was carried out involved comparative analysis of an experimental array to a baseline array. In our experiments, the array to which wildtype RNA was hybridized was designated as the baseline array and the array to which Pten +/- RNA was hybridized was designated as the experimental array. During comparative analysis of arrays, a change-algorithm generates a change p-value and an associated change. The change is defined as a qualitative call indicating an increase or decrease in transcript level between a baseline array and an experimental array. The change p-value is defined as the p-value indicating the significance of the change call. The change p-value measures the probability that the expression levels of a probe set in two different arrays are the same or not. When the p-value is close to 0.5, they are likely to be the same. When the p-value is close to 0, the expression level in the experimental array is higher than that of the baseline array. When the p-value is close to 1, the expression level in the experimental array is lower than that of baseline. The signal is the quantitative measure of the relative abundance of a transcript. During comparative analysis of baseline and experimental arrays, a second algorithm produces a quantitative estimate of the change in gene expression in the form of a signal log ratio. Specific details on these algorithms can be found at http://www.affvmetrix.com. The fold change is the base 2 signal log ratio and reflects the change in expression level for a transcript that is calculated by the algorithm that determines the signal log ratio. 22 Chapter 3 Characterization of the autoimmune phenotype in Pten +/- mice 3.1 Introduction Autoimmunity arises when immune tolerance to specific self-antigens is broken. Tolerance can be defined as the failure to respond to an antigen and is an essential feature of the immune system. When tolerance is broken the immune system can destroy self-tissues, as occurs in autoimmunity. It is widely believed that inappropriate activation of self-reactive B or T cells of particular specificities is the fundamental event leading to disease. Normal activation of lymphocytes during the initiation of an immune response must be understood to gain insight into the abnormalities that exist in an autoimmune state. In addition, to understand how self-reactive lymphocytes escape elimination and produce autoimmune disease, it is important to define the sequence of events in which they normally develop and in which self-reactive clones are usually eliminated. The immune system exists to protect the host from infection. Cells of the immune system originate in the bone marrow, and then emigrate, circulating in the blood and through the lymphatic system. The lymphoid organs are organized tissues where lymphocytes interact with non-lymphoid cells that are required for normal lymphoid ontogeny as well as for the initiation of immune responses. Lymphoid organs can be divided into central and peripheral: for example, the bone marrow and the thymus are central lymphoid organs, and primary sites of lymphocyte development; while the spleen and lymph nodes are classed as peripheral (secondary) lymphoid organs. The latter are specialized for the trapping of antigens and facilitating the initiation of immune responses. 23 The peripheral lymphoid organs share similarities in basic architecture. These tissues not only house most of the cells of the immune system, but are also specialized for trapping antigens from diverse sites of infection and presenting them to migratory lymphocytes. The lymph node is organized into an outer cortex where B cells reside, a paracortical region where T lymphocytes home, and an inner medulla where blood vessels enter and leave, and plasma cells are found. Passage of lymph through this organized tissue structure allows the particulate matter to be taken up by professional antigen presenting cells and presented to lymphocytes. Interaction with antigen occurs in B cell follicles and upon B cell activation primary germinal centres are formed in which proliferating B cells differentiate into antibody secreting plasma cells. Subsequently, with CD4 + T cell help, germinal centers mature to give rise to secondary immune responses that generate isotype switched, somatically diversified, antibodies. Lymph node size can increase as B cell follicles expand to produce germinal centres, during vigorous polyclonal immune responses. In addition to its filtration function, the spleen acts as another important peripheral lymphoid tissue. The spleen has the same basic structure as the lymph node, having an outer B cell zone, an inner T cell zone, and a marginal zone where antigen presenting dendritic cells reside. Recognition of a foreign antigen, by both circulating lymphocytes and those residing in lymphoid organs, is an important first step in initiating an effective immune response. A successful immune response involves several mechanisms by which pathogens are detected by lymphocytes and eliminated. Antibodies can bind to foreign antigen to neutralize the pathogen preventing further damage or can coat cells targeting them for phagocytosis in a process known as opsonization. Antibodies can also activate the 24 complement system. The sole contribution of B lymphocytes to the immune response is the production of antibody whereas T cells have a variety of effector actions. Most B cells require an accompanying signal from helper T cells before they can proliferate and differentiate into antibody secreting cells. Cytokines and cell membrane bound proteins of Thl and Th2 T cells can provide help to B lymphocytes. Cytotoxic (CD8+) T lymphocytes can directly kill virally infected cells whereas the Thl subset of T cells is a primary activator of macrophages enabling the control of intracellular pathogens. Thus, lymphocytes play a central role in the initiation of an immune response as well as in the effector functions required for the control or elimination of foreign pathogens. The ability of the immune system to provide a specific and appropriate immune response is largely based on the proper development of the pre-immune repertoire of lymphocytes. Positive and negative selection is a fundamental process contributing to the normal development of the T lymphocytes in the thymus. Early on in T cell development chemoattractants produced by the thymic stromal cells populate this tissue with stem cells that serve as the cellular source for later stages of T cell development. The double negative (CD4TJD8) population of T lymphocytes represents an early stage of T cell development, and proliferation of this population of cells in the thymus requires stem cell factor (SCF) and interleukin-7 (IL-7). After expression of the pre-T cell receptor (TCR), progression into the double positive (CD4+CD8+) population occurs, which represents a non-dividing, short-lived cellular population in a later stage of development. The processes of positive and negative selection act upon the same population of CD4 +CD8 + double positive lymphocytes to ensure that functional T cells are selected for and self-reactive clones are selected against. Positive selection is mediated via epithelial cell 25 interaction with the TCR ccp chains on the surface of the T cell clones (Anderson et a l , 1996). Functional low avidity interactions between the TCR and major histocompatibility complex (MHC):self peptides lead to further proliferation and differentiation into single positive T lymphocytes (CD8+ or CD4+) which will serve as mediators and effectors in subsequent immune responses. Negative selection, through triggering of apoptosis, eliminates all T cell clones which demonstrate high avidity interactions with the MHC:self peptide complexes that are displayed on the surface of dendritic cells. Thus, interactions with the stromal microenvironment of the thymus as well as appropriate signaling and activation of TCR mediated events control and maintain the normal repertoire of T cell reactivity that can be utilized during immune responses. Similarly, B cell development proceeds through a series of checkpoints at which PI3K mediated signals through both antigen and cytokine receptors are required. B cells develop in the bone marrow and then migrate to the periphery to undergo further development and differentiation. In the bone marrow, a major developmental progression occurs from the pro-B cell to the pre-B cell stage. Proper recombination of the antigen receptor loci ensures expression of the pre-B cell receptor (BCR), which provides the survival signal that, in combination with stimulation from IL7 supports the proliferation of pre-B cells (Marshall et a l , 2000). Mice that are lacking the p85a subunit of PI3K display a block at this early stage of B cell development indicating that the PI3K signal is essential for the progression from pro-B to pre-B cells. Further rearrangement of the antigen receptor to produce a functional light chain results in immature B cells which express a functional IgM antigen receptor and can be characterized as IgMh lIgD l 0. Differentiation of these short live immature B cells into mature B cells which express IgD 26 (IgMloIgDhl) represents another important checkpoint during B cell development. At this stage, the BCR signal mediates both positive and negative selection and, in an analogous situation as described for T cells above, high avidity interactions lead to negative selection or anergy, which leads to the elimination of self-reactive clones (Hartley et a l , 1993). Mice that are defective in PI3K signaling in vivo, such as p85oc -/- mice or Btk -/-mice, display a block in the transition from immature to mature B cells in the periphery, indicating that PI3K is also important for this later stage of B cell development. Thus, PI3K plays an important role in the BCR signal, which determines the fate of B-lymphocytes throughout development and during immune responses. Antigen receptor signaling guides the maturation and activation of both B and T lymphocytes and ensures the removal of potentially self-reactive clones. In lymphocytes, antigen recognition leads to activation of protein tyrosine kinase activity, which results in the phosphorylation of the antigen receptor at specialized immunoreceptor activation motifs (ITAM). Phosphorylation of the antigen receptor causes recruitment of adaptor proteins, which mediate the downstream activation of multiple diverse signaling cascades by clustering substrates to the site of activation. Antigen receptors on both B and T cells follow this same pattern of activation however the signaling molecules that participate are different in each cell type. The tyrosine kinases, Lck, in T cells, and Lyn, in B cells, are engaged by the TCR and phosphorylate ITAM motifs. The subsequent recruitment of the adaptor protein ZAP-70 (z-chain associated protein-70) to these phosphorylated sites leads to the phosphorylation and activation of numerous protein and second messenger cascades. These include activation of PLCy, which leads to the release of Ca 2 + and DAG; Vav, which facilitates cytoskeletal reorganization; Itk and other members of the Tec 27 protein tyrosine kinase family; and finally, PI3K, which initiates lipid kinase mediated signaling. In B cells, phosphorylation of the antigen receptor is carried out by the Src family kinases Lyn, Fyn, or Blk, and results in recruitment of Src tyrosine kinase (Syk). Syk activation leads to the initiation of various downstream cascades mediated by PLCy, Ras and PI3K. Thus, in lymphocytes, PI3K has been shown to play a significant role in transducing the signal through the B cell receptor as well as the T cell receptor. In fact, as discussed in more detail later, several in vivo models in which normal PI3K signaling is disrupted demonstrate that aberrant antigen receptor signaling can result in both immunodeficiency and autoimmune disorders. Antigen receptor signaling is important for the maintenance of normal development and appropriate immune responses. As described above, PI3K signaling has been implicated in the many facets of antigen receptor signaling and various stages of lymphocyte development. In Pten deficient animals, deregulation of PI3K likely occurs and appears to be responsible for an autoimmune phenotype that worsens with age (Di Cristofano et a l , 1999). We hypothesized that Pten deficiency leads to autoimmunity because of a deregulation of PI3K signaling in lymphocytes. In the context of previously published work, our aim was to further define the autoimmune phenotype of Pten deficient animals in an effort to gain insight into the mechanisms by which partial deficiency of Pten could cause autoimmunity. 28 3.2 Results 3.2.1 Spleen and body weights are elevated in aging Pten +/- mice In our colony of Pten +1- mice we observed the phenotype of lymphoadenopathy, splenomegaly and autoimmunity that has been described by others (Di Cristofano et a l , 1999; Podsypanina et a l , 1999). To further characterize this phenotype, we sacrificed both healthy and afflicted mice and compared tissue and body weights of Pten +/- to wildtype littermates. Aging afflicted mice were sacrificed upon any sign of distress or impairment of movement with control littermates analyzed in parallel. The aging population oi Pten +/- mice developed a phenotype of increased body weight, increased spleen weight and enlargement of lymph nodes (Table 3.1c,d). The splenomegaly and lymph node hyperplasia were more severe in Pten +/- females than in Pten +/- males (compare Table 3.1c,d). In addition, males displayed a delayed onset of these features as compared to females, which agreed with the average onset of disease reported by others (Podsypanina et a l , 1999). To further examine the onset of the disease features, we examined young healthy mice between the ages of 5 and 9 weeks of age (Table 3.1a,b). At this early age, Pten +/- mice show a slight increase in spleen weight, which appears to be restricted to females (Table 3.1a). This indicates that even at early ages Pten heterozygosity may result in alterations in normal cellular architecture of the spleen and led us to examine the function of these immune cells. Table 3.1a Spleen and body weights from female Pten +/- mice. +/+ +/-Mean Tissue Weight (g) SEM n* Mean Tissue Weight (g) SEM n* / test Total Body 18.57 Spleen 0.10 1.17 0.01 3 3 19.65 0.16 0.91 0.02 3 3 p>0.5 p < 0.08 * number of mice analyzed at 6-8 weeks of age Table 3.1b Spleen and body weights from male Pten +/- mice. +/+ Mean Tissue Weight (g) SEM n* Mean Tissue Weight (g) SEM n* t test Total Body 27.41 Spleen 0.13 0.77 0.01 10 9 26.45 0.14 0.70 0.01 12 12 p>0.3 p>0.5 * number of mice analyzed at 5-9 weeks of age Table 3.1c Spleen, body, and lymph node weights from agingfemale Pten +/- mice. +/+ +/-/ test Mean Tissue Weight (g) SEM n* Mean Tissue Weight (g) SEM n* Total Body 27.68 1.26 7 30.84 0.93 15 p < 0.07 Spleen 0.14 0.02 7 0.38 0.06 15 p < 0.002 Lymph Nodes - - 7 0.91 0.15 15 p< 0.001 * number of mice analyzed at 19-40 weeks of age Table 3. Id Spleen, body, and lymph node weights from aging male Pten +/- mice. +/+ +/-/ test Mean Tissue Weight (g) SEM n* Mean Tissue Weight (g) SEM n* Total Body 35.99 3.01 5 39.64 1.32 6 p>0.4 Spleen Weight 0.12 0.01 5 0.25 0.04 6 p < 0.02 Lymph Nodes 0.07 0.07 5 0.69 0.21 6 p < 0.03 * number of mice analyzed at 25-35 weeks of age 30 3.2.2 Seram Ig levels are increased in Pten +/- mice In addition to the features described above, Pten heterozygosity results in an autoimmune disorder reported to involve immune complex deposition in the kidney, autoantibody production and defects in FAS-mediated apoptosis (Di Cristofano et a l , 1999). Increased serum immunoglobulin production was another feature ascribed to this autoimmune phenotype. Hypothesizing that Ig isotypes might provide clues about Th cell dysregulation in the autoimmune process, serum immunoglobulin levels were examined by ELISA, to differentiate between each immunoglobulin isotype. Serum from female mice aged between 5 - 8 weeks revealed increased levels of IgM, IgGl, and IgG2B in Pten +/- (Figure 3.1a). The results of these ELISA assays are summarized in Table 3.2a. In comparison to younger mice, aging female mice demonstrated an increase in the overall levels of all immunoglobulin isotypes in both wildtype and Pten +/-animals. Further increases in all serum immunoglobulin isotypes were observed in Pten +/- females aged between 14-38 weeks as compared to wildtype littermate controls (Figure 3.1b). The results of these assays are summarized in Table 3.2b. The greatest increase in the female aging Pten +/- population was in serum IgG2B levels, however, it was apparent that there was significant mouse-to-mouse variation as reflected by the large standard error of the mean (SEM) shown in Table 3.2b. Serum levels of IgM, IgGl, and IgG2A were also significantly increased in the Pten +/- as compared to controls. In addition, this aging population of Pten +/- female mice displayed increased levels of serum IgE, an isotype normally found at very low levels in the serum (Figure 3.1c). These results demonstrate that Pten +/- leads to increased serum immunoglobulin, a • 31 E 3 i— O Oi c n <D 2 4.50E+05 4.00E+05 1 3.50E+05 3.00E+05 1 2.50E+05 2.00E+05 1.50E+05 1.00E+05 5.00E+04 0.00E+00 • +/+ 0+/-•I T IgM lgG1 lgG2A lgG2B IgA C. D> _Q. O) E 3 i_ a> w c 10 S 6.00E+06 5.00E+06 -I 4.00E+06 3.00E+06 2.00E+06 1.00E+06 0.00E+00 3.50E+03 •j- 3.00E+03 2.50E+03 • +/+ 0+/-IgM lgG1 lgG2A lgG2B - 2.00E+03 E | 1.50E+03 c o n 1.00E+03 <D S 5.00E+02 0.00E+00 IgE 6-8 weeks IgE 14-38 weeks Figure 3.1. Elevated serum immunoglobulin isotypes in Pten +/- mice. (a) . Serum was collected from 5 - 8 week old female Pten +/- mice and age-matched littermate controls. (b) . Serum from female Pten +/- and +/+ littermates ranging in age from 14-38 weeks was collected. Testing for the different immunoglobulin isotypes was carried out with ELISA using manufacturers protocols. The results shown represent the average serum Ig levels measured from multiple animals, (c). Serum was collected from female Pten +/- and +/+ littermates and analyzed for levels of serum IgE by ELISA. The results shown are mean serum levels of IgE assessed independently on multiple animals. Table 3.2a Serum Ig levels from female Pten +/- mice. +/+ +/-Mean Serum Mean Serum Isotype Ig (pg/mL) SEM n* Ig (Pg/mL) SEM n* l test IgM 2.10E+05 6.01 E+03 21 2.64E+05 8.65E+03 16 p < 0.06 IgGl 1.39E+05 2.12E+04 11 2.97E+05 3.31 E+04 11 p < 0.0003 IgG2A 2.39E+04 6.37E+03 11 4.19E+04 1.56E+04 11 p < 0.3 IgG2B 1.21E+05 1.12E+04 10 3.59E+05 5.05E+04 10 p < 0.001 IgA 3.05E+05 5.69E+04 7 2.47E+05 9.84E+04 6 p > 0.5 IgE 9.50E+01 3.84E+00 19 1.40E+02 6.02E+00 6 p < 0.04 * number of mice analyzed at 5-i. weeks of age Table 3.2b Serum Ig Levels from aging female Pten +/- mice. +/+ +/-Mean Serum Mean Serum Isotype Ig (pg/mL) SEM n* Ig (Pg/mL) SEM n* t test IgM 9.07E+05 4.76E+04 5 1.89E+06 1.01 E+05 12 p < 0.0003 IgGl 2.94E+05 3.98E+04 8 5.03E+05 5.98E+04 16 p < 0.006 IgG2A 3.89E+04 1.56E+04 5 3.31 E+05 1.18E+05 7 p < 0.05 IgG2B 1.17E+06 1.12E+05 6 4.17E+06 9.54E+05 9 p < 0.01 IgE 7.35E+02 7.59E+01 6 2.79E+03 1.69E+02 13 p < 0.0001 * number of mice analyzed at 14-38 weeks of age 33 feature of autoimmune diseases, but failed to show an isotype pattern indicative of a strong Thl versus Th2 bias. 3.2.3 B cell markers on splenocytes isolated from Pten +/- mice show normal distributions Pten +/- mice display autoimmune disease features, however, it remains to be determined whether the development of autoimmunity in Pten +/- is a result of compromised immune cell differentiation and development. To investigate the potential differences in immune cell differentiation, the expression of B cell specific markers was examined on peripheral lymphocytes from Pten +/- mice. Pten +/- splenocytes show normal distribution of CD19+ and CD 19" staining populations indicating that no significant expansion of the B cell compartment has occurred (Figure 3.2a). In addition, no apparent differences in B cell lineage differentiation were revealed upon staining with IgM and IgD (Figure 3.2b). This is in agreement with work by Podyspania et al. which showed normal expression of the following markers in 4 week old Pten +/- mice: B220, CD4, CD8, Macl, CD9, CD43, IgM, and IgD. hi an attempt to assess B cell viability, splenocytes were stained with B220 in combination with propidium iodide. Others have reported defects in apoptosis in Pten +/- B cells including decreased Annexin V staining (Podsypanina et a l , 1999) and reduced responses to Fas-induced apoptosis (Di Cristofano et a l , 1999). In contrast, we were unable to detect decreases in the propidium iodide positive population of dead cells in Pten +/- splenocytes (Figure 3.2c). • 34 2001 150] 1001 ' * 0+ 1000 10000 ! FL2-H: CD19 PE 10001 100C 1001 100 1000 10000 1 FL1-H: IgD FITC +/+ 10001 100C 1001 10000 10 100 1000 10000 10 100 1000 10000 1 FL1-H: B220 FITC i I I 10 100 1000 10000 Figure 3.2. Normal expression of B cell specific markers on splenocytes from Pten +/- mice. Splenocytes from 8 week old Pten +/- (right panel) and +/+ littermates (left panel) were isolated. Expression of cell surface markers was assessed by flow cytometry. For each experiment splenocytes were isolated and pooled from two mice per group. The profiles shown are individual experiments representative of a minimum of three independent cellular isolations, (a). Cells were stained with PE-conjugated anti-CD19. (b). Cells were stained with both PE-conjugated anti-IgM and FITC-conjugated anti-IgD and the distribution of these cell surface markers was analyzed, (c). The amount of B cell death occurring in splenocytes was assessed by staining with propidium idodide in combination with the B cell specific marker, FITC-conjugated anti-B220. 35 3.2.4 The percentage of CD5+B220+ peritoneal B cells isolated from Pten +/- mice is unaltered To investigate a potential expansion of CD5 + compartment of B cells from Pten +/-mice, cells were isolated from the peritoneal cavity. This population of B cells represents a distinct subset of B cells, which follow a different developmental pathway than the splenocytes-derived B cells described above. Cells from young healthy Pten +/- and wildtype littermates were isolated. Normal percentages of CD5+B220+ B cells were evident in the peritoneal cavity of Pten +/- mice (Figure 3.3). Work by others suggested that the CD5 + population might be expanded in older sick Pten +/- mice (Di Cristofano et al , 1999), however, our work shows that in young Pten +/- mice there is no expansion of this subset of B cells. 3.2.5 Purified B lymphocytes from Pten +/- mice show an altered proliferative response to LPS Since autoimmunity in Pten +/- mice was associated with normal distributions of B cell populations, we examined the proliferative response of Pten +/- B-lymphocytes to detect any differences which could potentially contribute to the development of autoimmunity in these mice. In order to examine B cell proliferation, pure populations of B cells were isolated from splenocytes of Pten +/- and wildtype littermates with two mice pooled per genotype. The resulting populations of B cells were determined to be 80 - 94% pure by staining with CD 19 (Figure 3.4). A slight increase in the numbers of B cells isolated from spleens of individual Pten +/- mice was observed as compared to wildtype (Table 3.3). • 3 6 10000 FL1-H: B220 F I T C Figure 3.3. Normal percentages of CD5 + B220 + peritoneal B cells are isolated from Pten +/- mice. The peritoneal cavities of 8 week old Pten +/- (right panel) and +/+ littermates (left panel) were flushed with a saline solution. Cells recovered from this cavity were analyzed for the expression of B cell specific markers by flow cytometry by staining with PE-conjugated anti-CD5 and FITC-conjugated anti-B220. For each experiment two mice were pooled per genotype. The results shown are one experiment representative of similar experiments carried out on three independent cellular isolations. 37 a. +/+ +/-FL2-H: CD19 PE Figure 3.4. Isolation of pure populations of peripheral B cells from splenocytes of Pten +1- mice. Splenocytes from 8 week old Pten +/- (right panel) and +/+ littermates (left panel) were isolated. Expression of cell surface markers was assessed by flow cytometry. For each experiment splenocytes were isolated and pooled from two mice per group, (a). Splenocytes were stained with PE-conjugated anti-C D ^ , (b). Purified B cells were stained with PE-conjugated anti-CD 19. The profiles shown are typical for a successful B cell isolation. The purified populations of B cells used in subsquent assays were assessed in this manner and ranged between 80 -94 % positive for staining with PE-conjugated anti-CD19. Table 3.3 Isolation of Splenocytes and mature B cells from Pten +/- mice. +/+ +/-Mean Cell Mean Cell Population Count SEM n* Count SEM n* / test splenocytes 1.31E+08 1.49E+07 7 1.60E+08 2.21E+07 7 p<0.2 mature B cells 8.43E+06 1.44E+06 14 1.27E+07 2.56E+06 14 p<0.1 * number of independent Percoll cell isolation experiments, one mouse per experiment 39 This likely reflected an increase in the number of splenocytes isolated from Pten +/- due to the slight increase in spleen weight described previously rather than any expansion in the peripheral B cell compartment. To determine if Pten heterozygosity was associated with enhanced responsiveness of lymphocytes, purified B cell populations were stimulated with lipopolysaccharide (LPS). Both wildtype and Pten +/- B cells populations expanded in response to stimulation with 1 pg/mL LPS (Figure 3.5). Additionally, Pten +/- B cells displayed an enhanced response with a 3 fold increase over background in comparison to the 2 fold increase observed in wildtype cells. These results demonstrated that Pten +/- B cells may have an enhanced sensitivity to LPS, and suggest that defects in the responsiveness of Pten +/- B cells may contribute to the autoimmune phenotype observed in the mice. 3.2.6 Purified T lymphocytes from Pten +/- mice show no difference in activation To investigate whether Pten heterozygosity affects the responsiveness across other immune cell types, CD4 + T cell populations were purified from the spleens of Pten +/-mice. Isolated populations of CD4 + T cells were obtained from both wildtype and Pten +/- splenocytes and were greater than 90% pure as determined by CD4 staining (Figure 3.6). Equal numbers of T cells were isolated from Pten +/- and wildtype splenocyte populations (Table 3.4). Thus, no gross abnormalities or expansion of the peripheral splenic T cell compartment were observed in Pten +/- mice. In order to assess the activation level of T cells isolated from Pten +/- mice purified T cells were stained with CD69 (Figure 3.7a,b). CD69 is an early activation marker that reflects the activation status of T cells. Freshly isolated CD4 + T cells from Pten +/- mice sporadically showed a slight elevation in CD69 levels, which varied with cellular • 40 3.5-1 3-1 2-51 2 21 I 1-51 0.5' 0-• +/+ a +/-p<0.001 M \p, \ m 32h 44h 32h I 44h media 1ug/mL LPS Figure 3.5. Enhanced viability of Pten +/- B cells in response to LPS. Purified B cells isolated from splenocytes of 8 week old Pten +/- mice and +/+ littermates. Cells were plated in a 96 well plate and incubated either in media alone or in media with l ttg/mL LPS for the indicated times. The response of these cells was assessed by colorimetric change after incubation with WST-1 reagent. Each experiment was carried out in duplicate with triplicate readings for each time point. The results shown are from two mice pooled per genotype and are representative of two independent cellular isolations. 41 Figure 3.6. Isolation of CD4 T cell populations from splenocytes of Pten +/- mice. Splenocytes from 8 week old Pten +/- and +/+ littermates were isolated. T cells were purified using magnetic separation beads coated with anti-CD4. Cell surface expression of CD4 was then assessed directly after purification using flow cytometry with cells stained with PE-conjugated anti-CD4. Purified populations of Pten +/- (right panel) and +/+ (left panel) T cells were greater than 90% positive for CD4 expression for all isolations used in further experimentation. Isolation of T cell populations was carried out with one mouse used per genotype for each experiment. Table 3.4 Isolation of splenocytes and mature T cells from Pten +/- mice. +/+ +/-Mean Cell Mean Cell Population Count SEM n* Count SEM n* t test splenocytes 1.34E+08 1.12E+07 12 1.55E+08 1.15E+07 12 p < 0.04 mature T cells 1.20E+07 1.33E+06 12 1.21E+07 1.90E+06 12 p>0.5 * number of independent CD4 T cell isolation experiments, one mouse per experiment 43 +/+ 200 150 o iooi 50 1 3001 2001 1 0 0 1 0 \ • i • v o-y 1 10 100 1000 10000 1 l»f« . . 1 . • I ....| 10 100 1000 10000 U J E I 3 +/+ 1000UT 1000J 100" Kir 10 • 1 - • ' - • • • ' " ' " l — T +/-C. c o Q. o Q. •D 0) c 'ro 100 1 10 1 10 100 1000 10000 1 FL1-H: CD69 FITC 10 100 ro 3 Q. O Q. "D 0) C '5 120.00 100.00 80.00 1 60.00 40.00 20.00 i 0.00 ra +/-D+/+ r-'"-ifhWM' W 7 . . 2 : 1000 10000 I-CD69 CD69 Figure 3.7. P/en +/- T cells show no reproducible elevation of CD69 expression following CD3 stimulated expansion in vitro. Splenocytes from 8 week old Pten +/- (right panel) and +/+ (left panel) littermates were isolated with one mouse used per group for each experiment. The CD4+ subset of T cells was purified and stimulated with 1.0 Ug/mL plate bound anti-CD3 for 48 h. Cells were then expanded in AIMV media supplemented with 3% conditioned media containing IL-2 for 4 days. (a). Expanded cells were stained with PE-conjugated anti-CD4 and analyzed using flow cytometry, (b). Cells stained with PE-conjugated anti-CD4 in combination with FITC-conjugated anti-CD69 were assessed for the expression of CD69 using flow cytometry, (c). Three independent cellular isolations and expansions were carried out and the average frequency of the CD69 positive subset (left panel) as well as the mean fluorescence intensity of the positive staining subset (right panel) is reported. Error bars represent the standard error of the mean. 44 isolations (Figure 3.7b). Analysis of the CD4 bright, CD69+ subset of T cells also revealed similar minor alterations in CD69 expression. No significant change in either the level of CD69 expression or the frequency of CD69+ staining cells was seen over multiple experiments (Figure 3.7c). This analysis was carried out on freshly isolated T cells before any stimulation, thus, any alteration in CD69 expression resulting from Pten heterozygosity may be masked by differences in the varying levels of immune activation that occur in each animal. Work by others has suggested that CD69 is indeed elevated in splenocytes from Pten +/- mice (Di Cristofano et a l , 1999), however, this analysis was carried out on aging sick mice which have a strong level of immune activation and thus reflected a more easily detectable difference. Our results showed that resting T cells isolated from young healthy Pten +/- animals show no difference in the levels of activation and thus must have to progress from this normal state to that seen in older mice which display features of autoimmunity and immune cell activation. 3.2.7 Reduced levels of Pten protein in Pten +/- lymphocytes Haploinsufiiciency of Pten leads to an autoimmune phenotype in Pten +/- mice. In order to confirm that Pten deficiency does indeed exist in Pten +/- lymphocytes, immunoblot analyses of Pten protein levels were carried out. Lymphocytes from Pten +/-mice revealed an approximate 50% reduction in Pten as compared to lymphocytes from wildtype littermate controls (Figure 3.8a,b). Our findings indicate that deficiency of Pten exists in lymphocytes from Pten +/- mice and may result in altered immune cell function. • 45 a. +/- +/+ A B C A B C Pten> 1 . 0 1 . 2 1 . 8 1 . 9 1 . 7 3 . 3 +/+ D E F D E F P t e n > 1 . 0 1 . 0 1 . 7 1 . 5 2 . 3 3 . 1 Figure 3.8. Pten +/- lymphocytes have decreased levels of Pten protein. (a). Splenic B cells from three separate litters (A-C) were isolated and immunoblot analyses with a monoclonal antibody against PTEN were carried out. Littermate, sex-matched controls for each genotype were analyzed, (b). Expanded CD4 + cells were isolated from three separate litters (D-F) and immunoblot analyses were carried out as above 46 3.3 Discussion Several groups have described varying degrees of autoimmune phenotypes in Pten +/- mice (Di Cristofano et al , 1999; Podsypanina et a l , 1999; Stambolic et al , 1998). Pten deficient mice created by Podyspanina et al. display non-neoplastic hyperplasia of lymph nodes in which the normal organization of B and T cells is disrupted (Podsypanina et al , 1999). We observed a similar morphology in Pten +/-lymph nodes, where increases in lymph node size were associated with disorganization of normal lymph node architecture. Similar to our observations, the immune phenotypes of these Pten +/- mice are noticeable at 20 weeks of age and by 50 weeks of age 100% of females are affected. Work by Podyspanina et al. demonstrated that there is a defect in apoptosis detected by reduced Annexin V staining in Pten +/- B cells and macrophages. However, at 4 weeks of age cells collected from the thymus, spleen, lymph nodes and bone marrow showed no difference in the following differentiation and lineage markers: B220, CD4, CD8, Macl, CD9, CD43, IgM and IgD. Our work confirms these results by demonstrating normal distribution of B220, CD 19, CD5, CD4, CD8, IgM and IgD in lymphocytes from mice at 8 weeks of age. Thus, along with these authors, we observe no differences in lineage differentiation of lymphocytes from young healthy Pten +/- mice. Further work has been done by Di Cristafano et al. to describe the polyclonal autoimmune disorder that develops in 100% of Pten +/- females between 16-20 weeks of age (Di Cristofano et al , 1999). In this in vivo model, Pten haploinsufficiency leads to enlarged lymph nodes and spleen as well as other signs of autoimmunity such as increased serum immunoglobulins and immune complex deposition in the kidney. In older diseased mice, an expansion of the T cell compartment is observed accompanied by 47 increases in the activation markers CD44, CD54, and CD69. Additionally, the CD5 + compartment of B cells is expanded in these mice. Splenocytes from these Pten +/- mice show equal proliferative responses to CD3 or LPS. But when compared to wildtype, Pten +/- cells show enhanced proliferation upon ConA stimulation. Impaired activation induced cell death of T cells and a decreased response to FAS/CD95 induced apoptosis was observed in these Pten +/- cells. Lastly, hyper-phosphorylation of PKB in LPS stimulated splenocytes was observed in Pten deficient cells. Lymphomas that develop in older Pten +/- mice display loss of heterozygosity for the Pten allele indicating that the second allele of Pten is lost during tumorigenesis (Podsypanina et al , 1999; Stambolic et al , 1998). Our work confirms the increase in spleen, lymph node and body weights observed by this group and also suggests that even at early ages signs of autoimmunity may exist. We also detect similar increases in serum immunoglobulin as discussed below. However, we do not observe any increases in the T cell population or in the CD5 + population of B cells found in the peritoneal cavity of Pten +/- mice. Neither do we see any increase in the expression of CD69 on unstimulated T cells from Pten +/- mice. These discrepancies are most likely due to the lack of stimulation and initiation of immune responses that existed in young healthy mice as compared to the analysis of aberrant and perhaps chronic immune stimulation that occured in aging diseased Pten +/-animals. Thus, the evidence suggests that an autoimmune disease that progresses with age, perhaps following repeated exposures to environmental antigens, exists in Pten deficient animals. In vivo models indicate that deregulation of PI3K signaling can lead to autoimmunity (Di Cristofano et al , 1999; Fruman et al , 1999; Helgason et a l , 1998; 48 Helgason et a l , 2000; Hendriks et a l , 1996; Liu et a l , 1999; Parsons et a l , 2001; Podsypanina et a l , 1999; Rawlings et al , 1993; Satterthwaite et a l , 2000; Stambolic et al , 1998; Strasser et a l , 1991). The autoimmunity that results in Pten deficient animals could be a result of a defect in B cell development and/or an altered responsiveness to B cell signaling. Overactivation of the B cell response could be the primary mechanism leading to autoimmunity. Alternatively, defects in PI3K signaling could affect the development and activation of T lymphocytes, leading to inappropriate activation of B cells, antibody production, and other autoimmune phenotypes. Thus, defects in T lymphocyte homeostasis as a result of alterations in PI3K signaling may provide an alternative mechanism by which autoimmunity may develop in Pten +/- animals. As discussed below, it is probably a combination of defects in both B and T lymphocytes that supports the development of autoimmunity in Pten +/- animals. As mentioned previously, deregulation of PI3K signaling can lead to a block in B cell development contributing to autoimmune disease in vivo. In particular, several key mouse models display defects in B cell development and signs of either autoimmunity or immunodeficiency as a result of inactivation of PI3K signaling components. First, mice lacking the regulatory subunit of PI3K, p85a -/-, have a block at the pro-B to pre-B stage of development indicating that PI3K is essential for this progression (Fruman et al , 1999) . Second, mice lacking the 5' inositol phosphatase, SH2 containing inositol phosphatase (SHIP), have shown that downregulation of PI3K plays a critical role in regulating B cell development and responsiveness to BCR signaling (Helgason et a l , 2000) . SHIP -/- mice display increased proliferation of B cells, increased serum Ig levels and decreased pre- B and immature B cell progenitors in the bone marrow. Lastly, 49 inactivation of Btk, a key kinase for PI3K signaling in B cells, results in an X-linked immunodeficiency disease (xid) in mice, which is accompanied by a 50% reduction of B cells in the spleen as well as a drastic decrease in the CD5 + population in the peritoneal cavity (Rawlings et al , 1993). Furthermore, mice in which Btk has been inactivated display a block in the progression from pre-B to immature B cell development in the bone marrow (Hendriks et a l , 1996). An additional defect in the maturation from immature to mature B cells in the periphery was also detected in Btk deficient animals. Thus, mouse models make it clear that the PI3K pathway plays a critical role in pre-BCR and BCR driven differentiation. Our analysis of B cell differentiation markers on Pten +/- cells, as well as work by others, indicates that B cell development and differentiation is not drastically altered in Pten +/- mice. Interestingly, in a screen for suppressors and enhancers, it was found that both SHIP -/- and PTEN +/- acted as suppressors of reduced B cell proliferation that results from low expression of a Btk transgene (Satterthwaite et a l , 2000). This suggests that there is a partial redundancy of SHIP and Pten in downregulation of the BCR signal in vivo. Thus, redundancy of PI3K regulation provided by SHIP could provide a potential explanation why B cell development and differentiation appears normal in Pten deficient animals. Another key point is that the autoimmunity examined here is a result of the loss of one allele of Pten. As shown by our western blot analysis, Pten +/- results in a significant reduction of Pten protein levels in lymphocytes. Thus, B cells that are heterozygous for Pten may retain enough functional Pten to mediate proper regulation of PI3K as related to control of B cell development and differentiation. Thus, the 50 mechanism for development of autoimmunity in Pten +/- mice does not appear to be a result of defects in B cell development. However, evidence suggests that impaired downregulation of PKB may increase the survival of B cells (Satterthwaite et al , 2000). Stimulation of Pten +/- B cells with LPS showed an enhanced response. In our assay, we assessed the increase in number of live B cells after LPS stimulation and found that Pten +/- B cells had an increased response. In this assay, we did not distinguish between the possibilities that Pten deficiency results in enhanced proliferation versus increased survival due to defects in apoptosis. Taken together this evidence indicates that even though alterations in B cell development may not be a major factor, enhanced responsiveness of B cells may still contribute to the development of autoimmunity in Pten deficient animals. Stronger evidence seems to exist suggesting a primary role for T cells in the development of autoimmunity in Pten +/- mice. In a T cell specific knockout for Pten (Ptenflox/") there is an increase in the total numbers of T cell precursors in the thymus as well as an increase in the CD4 + but not CD8 + subsets in the periphery (Suzuki et al , 2001a). Spontaneous activation of CD69 in CD4 + T cells was observed in Ptenflox/" mice with no accompanying change in CD25 expression. Examination of the Ptenflox/" mice in combination with the HY transgenic TCR model system showed increases in the number of transgenic double positive CD4 +CD8 + T cells observed, indicating a defect in negative selection as a result of Pten deficiency. As well, a decrease in the transgenic CD8 + single positive population was detected indicating that lack of Pten leads to a defect in positive selection or lineage commitment. Additionally, autoreactivity of Ptentlox/" T cells was observed in mixed lymphocyte reactions. Finally, Ptenflox/" T cells showed increased 51 proliferative responses and impaired apoptosis to multiple stimuli. Ptenflox/~ T cells showed enhanced phosphorylation of both PKB and mitogen activated protein kinase (MAPK). In another model of in vivo T cell specific PI3K activation, expression of an activated PKB transgene leads to prolonged survival of T cells due to a defect in FAS mediated apoptosis (Parsons et al , 2001). Thus, as demonstrated in P K B + / + transgenic mice, impaired T cell death leads to the development of lymphoid hyperplasia and autoimmunity. Defects in T cell survival during positive and negative selection in combination with enhanced survival could provide a mechanism for the development of autoimmunity in Pten +/- animals. Survival of self-reactive T cell clones due to defective elimination during negative selection could contribute to the presence of an autoimmune response. Alternatively, enhanced stimulation of low reactivity clones during the initiation of an immune response could lead to inappropriate activation as occurs in autoimmunity. Hence, Ptenn°x/" mice suggest that alterations in T cell tolerance due to deficiency of Pten can lead to the development of autoimmunity. Another T cell mediated mechanism for the development of autoimmunity in Pten +/- mice could be the enhanced activation of B cells due to increased cytokine production and enhanced stimulation by helper T lymphocytes. Several lines of evidence support this explanation. First, expression of activated PKB or deletion of Pten, specifically in T cells, results in autoimmune phenotypes resembling that of Pten +/- mice (Di Cristofano et al , 1999; Parsons et a l , 2001; Suzuki et a l , 2001a). In each of these in vivo models, features of autoimmunity such as lymphoadenopathy, splenomegaly, increased serum immunoglobulins and autoantibody production were observed as a result of these T cell specific alterations. Second, transplantation of SHIP -/- bone marrow into SCfD/NOD 52 mice transfers the observed defects in B cell development but does not transfer the features of autoimmunity such as increased serum Ig that are observed in SHIP -/- mice (Helgason et al , 2000). This indicates that developmental defects in SHIP -/- are intrinsic to cells deficient in SHIP, however, serum immunoglobulin and autoantibody production may require accessory cell function such as that provided by T lymphocytes. In a similar way, Pten deficient T cells may be required for the autoimmune phenotype seen in Pten +/- mice. Evidence from Ptenflox/" suggests that Pten deficiency in T cells is responsible for the development of autoimmunity. However, one caveat does exist with regards to this model. Because complete deficiency of Pten in T cells was studied on a background of Pten heterozygosity, it is still possible that enhanced responsiveness of Pten +/- B cells may play a role in supporting autoimmunity in Pten +/- mice. As mentioned above, Ptenflox/" animals developed lymphomas and displayed features of autoimmunity as well as defects in positive and negative selection. The breakdown of self-tolerance in these animals was further indicated by the observed increases in serum immunoglobulin and the presence of autoantibodies. Interestingly, Ptenflox/" T cells produced excess Thl and Th2 cytokines (Suzuki et a l , 2001a). This may provide the basis for a mechanism by which Pten deficiency leads to increased serum immunoglobulins in Pten +/- mice. The production of antibody during an immune response is initiated when B cells bind antigen and are signalled by helper T cells. The differentiation of CD4 + cells into helper T cells involves a complex differentiation process, which is induced and directed by cytokines. Thl and Th2 helper cells can result from this differentiation process and differ greatly in the cytokines produced and thus differ in function. The increase in cytokine production observed in Ptenflox/" T cells is 53 important because the activation of B cells by both Th2 and Thl cells to produce different isotypes of antibody is one of the most important functions of helper T cells. The first antibodies produced in a humoral immune response are IgM but activated B cells subsequently undergo isotype switching, or class switching, to secrete antibodies of different isotypes, IgG, IgA and IgE. Isotype switching does not affect antibody specificity significantly but alters the effector functions that an antibody can engage in. Isotype switching occurs by a site-specific recombination involving the deletion of the intervening DNA and requires the expression of CD40 ligand by helper T cells in addition to the direction provided by cytokines. The presence of different immunoglobulin isotypes indicates the type of immune response that has been initiated. For example, in the presence of IL4, a Th2 immune response is initiated and class switching from IgM to IgGi and IgE predominates (Snapper et a l , 1988), while Thl help, mediated largely by fENy, results in the IgG2A isotype. The increased production of both Thl and Th2 cytokines by Pten00*7" T cells correlates with the increase in serum immunoglobulin isotypes that we observed in Pten +/- mice. This increase in serum Ig suggests that enhanced stimulation of B cells by helper T cells occurs in Pten +/- mice and that there does not appear to be any skewing to either predominately Thl or Th2 type immune responses. In summary, it has been shown that an autoimmune disease exists in Pten deficient animals. We have suggested mechanisms by which a breakdown in T cell tolerance due to defects in positive/negative selection, enhanced stimulation, or altered survival could lead to autoimmunity. Alternatively, overactive Pten +/- T cells could stimulate B cells to produce antibody inappropriately. Lastly, an intrinsic defect in B cell 54 responsiveness may also exist in Pten +/- B lymphocytes. During the course of these studies, it has become apparent that a discrepancy exists between the effects of PI3K dysregulation in B cells as compared to T cells. As mentioned previously, T cell specific knockout experiments suggest that PI3K modulation in T cells may be responsible for the development of autoimmunity in Pten +/- mice. However, our results seem to suggest that B cells may be more sensitive to haploinsufficiency of Pten as compared to T cells. The naive population of B cells used in our experiments showed more pronounced effects of Pten heterozygosity as compared to the stimulated T cell populations used in our studies. This suggests that naive T cells may be quite sensitive to effects of Pten heterozygosity. Al l together, this provides evidence to support the conclusion that defects in the regulation of PI3K at many levels during the immune response leads to the breakdown of tolerance. 55 Chapter 4 Haploinsufficiency of Pten results in augmented sensitivity to stromal cell derived factor-1 (SDF-1) 4.1 Introduction Chemotaxis, cell movement up a chemical gradient, is vital to many biological processes. Chemokines act as chemoattractants, and thus, along with chemokine receptors, play an important role in regulating cell traffic and positioning. In particular, directed cellular movement is a key element in controlling immune cell function. The ability of immune cells to traffic allows proper localization and co-ordinated interactions of lymphocytes within tissues. Thus, proper regulation of directed cellular movement is needed to maintain normal homeostasis and to control inflammatory responses of the immune system. Chemokines are a group of small molecules that regulate cell trafficking through an interaction with a subset of G-protein coupled receptors (reviewed in (Zlotnik and Yoshie, 2000)). There are two major subfamilies of chemokines, CXC and CC, which can be divided on the basis of the arrangement of the two N-terminal cysteines. Stromal cell derived factor-1 (SDF-1) is an example of a CXC chemokine and has been designated CXCL12 in a new classification system (Zlotnik and Yoshie, 2000). Monocyte chemotactic protein-1 (MCP-1) is classified as a CC chemokine and has been renamed CCL2. This new nomenclature uses ' L ' to designate the ligand and 'R' to designate the receptor. For example, the receptor for CCL2 (MCP-1) is CCR2. With respect to the immune system, chemokines fall into two different functional groups. The first type are the inflammatory chemokines, which recruit cells of the innate immune system and include chemokines such as RANTES (regulated upon activation, normal T 56 cell expressed and secreted) and MCP-1. The second type are the homeostatic chemokines, which act to maintain normal lymphocyte traffic. SDF-1 is an example of a homeostatic chemokine. Defects in various chemokines responses can lead to the inappropriate migration of immune cell subsets to specific anatomical sites thus causing immune dysfunction. In response to chemokine stimulation, cells become polarized in the direction of the chemoattractant, resulting in the formation of a leading edge (Firtel and Chung, 2000). Maintainance of cell polarity through localized activation of signaling pathways at the leading edge of the cell is key to directional movement. The primary signal responsible for these localized responses is the creation of lipid second messengers by PI3K at the leading edge. Pten has been implicated in the lateral inhibition of signaling that occurs along the edges and back of chemotaxing cells (Comer and Parent, 2002). In the current model of chemotaxis, translocation of PH domain containing proteins in response to activation of PI3K is a crucial step in initiating the chemotactic response (Firtel and Chung, 2000). This localized activation of PI3K, generates phosphoinositol species that function as binding sites for PH domain containing proteins, including PKB, at the leading edge of cells. Cellular movement is initiated by this polarized signal in two ways. First, actin polymerization at the leading edge of the cell results in pseudopodia profusions towards the gradient. This is accompanied by myosin contraction at the posterior resulting in retraction of the back of the cell. Thus, chemotaxis requires the co-ordinated regulation of changes in the actin and myosin cytoskeleton, processes regulated by PI3K, Pten, and the action of small G proteins. 57 It has become evident that chemokines play a role in the development, homeostasis, and function of the immune system. For instance, chemokines are critical to the normal development of lymphoid lineages as well as for the appropriate homing of these cells to specific anatomical sites (Baggiolini, 1998). In addition to their role in lymphocyte trafficking, specific chemokines have been shown to be capable of regulating the ontogeny and maturation of secondary lymphoid tissues (Baird et a l , 1999). Examples of roles for chemokine receptors in primary, effector and memory immune responses can be cited (Sallusto et al , 2000). Thus, the chemokine system occupies a central position in all phases of the immune sytem. One of the key chemokines involved in lymphocyte development and function is SDF-1, a CXC chemokine originally described as a B cell maturation factor (Nagasawa et al , 1994). SDF-1 has been shown to be a powerful chemoattractant for pro- and pre- B cells, as well as for mature B and T cells (Bleul et a l , 1996; Oberlin et al , 1996). Attesting to the importance of SDF-1, mice lacking this chemokine exhibit a severe block in B cell maturation, demonstrating abnormally low numbers of B lymphocyte as well as myeloid progenitors. In contrast, T cell development appears to proceed normally in these animals (Nagasawa et a l , 1996). SDF-1 binds to CXCR4, thereby stimulating a series of intracellular signaling events downstream of this G-protein coupled receptor (Bleul et a l , 1996; Oberlin et a l , 1996). Mice lacking CXCR4 exhibit various developmental defects equivalent to those of SDF-1 deficient mice, confirming that the SDF-1/CXCR4 signaling pathway is essential for normal hematopoietic development (Zou et a l , 1998). 58 SDF-1-mediated activation of CXCR4 results in increased phosphorylation of focal adhesion components, activation and phosphorylation of phosphatidylinositol-3-kinase, and increased activity of the N F - K B transcription factor (Ganju et a l , 1998). PI3K activation generates the membrane bound second messengers, PI(3,4)P2 and PI(3,4,5)P3, that recruit and activate cytosolic proteins containing pleckstrin homology domains, such as members of the family of serine/threonine kinases that includes PKB. Studies using either PI3K inhibitors or activated and dominant negative mutants of PI3K have indicated that the PI3K pathway is critical to SDF-1-induced chemotaxis (Sotsios et a l , 1999; Tilton et a l , 2000; Vicente-Manzanares et al , 1999). Furthermore, SDF-1 is able to induce sustained signaling and to promote prolonged activation of downstream effectors such as PKB and MAPK (Tilton et a l , 2000). Given the importance of SDF-1-induced PI3K activation, it is noteworthy that the tumor suppressor gene, PTEN, has been shown to downregulate this signaling pathway (Vazquez and Sellers, 2000). In addition to sharing a catalytic signature motif with dual-specificity phosphatases, PTEN is capable of dephosphorylating the 3' position of PI(3,4,5)P3 and PI(3,4)P2. This lipid phosphatase activity appears to account for the tumor suppressor effect of PTEN (Dahia, 2000). By modulating phosphatidylinositol levels, for example, PTEN can negatively regulate PKB dependent cell survival signals (Stambolic et a l , 1998). As well, mice heterozygous for Pten spontaneously develop malignancies and show resistance to pro-apoptotic stimuli (Di Cristofano et a l , 1999; Di Cristofano et a l , 1998; Podsypanina et al , 1999; Suzuki et a l , 1998). In addition to cancer susceptibility, Pten +/- develop a non-malignant lymphoproliferative disorder that is accompanied by autoimmune features (Di Cristofano et a l , 1999; Stambolic et a l . 59 2000), similar to that of mice expressing a constitutively active form of PI3K (Borlado et al , 2000). This suggests that hyper-responsiveness of the PI3K signaling pathway to external stimuli might contribute to the lymphoproliferative disorder in Pten +/- mice. In support of this hypothesis, expression of active PKB in a T cell transgenic model system disturbs both T and B cell homeostasis and results in an inflammatory/autoimmune phenotype that closely resembles that seen in the Pten +/- mice (Parsons et a l , 2001). T cell specific loss of Pten leads to activation of PKB and secondarily to defects in T cell homeostasis (Suzuki et a l , 2001a), suggesting that Pten, through its ability to regulate the PI3K/PKB pathway, is important in controlling lymphoid activation and development. Several lines of evidence have suggested a role for PTEN in the control of cell movement. For example, while PTEN overexpression inhibited fibroblast motility and directional movement through effects on focal adhesion kinase (FAK) (Gu et a l , 1999; Tamura et a l , 1998; Tamura et a l , 1999), murine embryonic fibroblasts lacking Pten exhibited increased cell motility, an effect attributed to Racl and Cdc42 dsyregulation (Liliental et al , 2000). Consistent with the importance of PI3K and lipid second messengers in directed migration, increased chemotaxis was seen in both thymic and splenic hematopoietic cells obtained from mice lacking SHIP, a lipid phosphatase that specifically targets the 5' position of PI(3,4,5)P3 (Kim et al , 1999). We hypothesized that Pten levels might regulate chemokine dependent cell migration in cells of the immune system. To examine this possibility, we studied the migratory response oi Pten +/- lymphocytes to SDF-1 in vitro. Purified lymphocytes from Pten heterozygous mice demonstrated an augmented sensitivity to this chemokine that was accompanied by an increase in SDF-1 dependent chemotaxis. Thus, PTEN 60 protein levels may be an important factor in the regulation of chemokine dependent events in lymphocytes. In the context of Pten +/- mice, altered sensitivity to chemokines may contribute to the development of autoimmunity. 61 4.2 Results 4.2.1 Pten +/- lymphocytes demonstrate increased responsiveness to SDF-1-induced chemotaxis To assess the effect of Pten heterozygosity on cell migration, we examined the response of primary B cells to SDF-1. In addition to showing a characteristic bell-shaped response to SDF-1 stimulation (Figure 4.1a), it was apparent that an increased number of Pten +/- cells had migrated to the lower chamber, at concentrations ranging between 500 and 2000 ng/ml, as compared to control cells. The peak chemotactic response occurred at 1500 ng/mL SDF-1 for the Pten +1- B cells, whereas the wildtype cells responded maximally at doses between 2000 and 3000 ng/mL (Figure 4.1a). These results suggested that Pten +/- B cells had an altered response threshold to SDF-1. To further explore the differential responsiveness of Pten +/- and control cells to SDF-1, B cells isolated from multiple mice were stimulated with 1500 ng/ml (Table 4.1 and Figure A.lb). At this concentration, Pten +/- B cells showed a ~2.5-fold (p < 0.01) greater chemotactic response. Pten +/- B cells also displayed elevated chemokinesis compared to controls, showing a statistically significant (~2-fold) increase in their ability to move to the lower chamber in the absence of SDF-1. To demonstrate that the increased migration of Pten +/- cells at 1500 ng/ml of SDF-1 was due to chemotaxis, as • 62 2000 500 1000 1500 2000 2500 3000 ng/mL SDF 1500 bottom ng/mL SDF 1500 top/bottom Figure 4.1. Pten +/- B cells show increased sensitivity to SDF-1. (a). Dose response of Pten +/- B cells to SDF-1. Purified splenic B cells (1 x 106 per well) were evaluated for their ability to migrate from the upper chamber towards SDF-1 at indicated concentrations in the lower chamber. After 3 h, cells in the lower chamber were counted by flow cytometry. Results represent pooled data from four independent splenic B cell isolations and transmigration experiments, (b). Purified splenic B cells were examined for their ability to transmigrate from the upper chamber in the presence or absence of an SDF-1 gradient. Cells were placed in the top chamber in the absence of SDF-1 and allowed to migrate towards media with (1500 bottom) or without SDF-1 (0). For the assessment of chemotaxis in the absence of an SDF-1 gradient, cells were resuspended in media containing 1500 ng/mL SDF-1 and placed in the top chamber and allowed to migrate towards media containing 1500 ng/mL SDF-1 (1500 top/bottom). Results represent pooled data obtained from at least three independent splenic B cell isolations with each transmigration experiment performed in triplicate. Table 4.1 Chemotaxis of primary B cells from Pten +/- mice. +/+ +/-Mean Cell Mean Cell Gradient Number SEM n* Number SEM n* t test medium 118 24 19 361 65 22 p < 0.005 SDF** 688 211 20 1871 329 22 p < 0.005 * pooled data from 5 independent B cell isolations ** 1500 ug/mL SDF 64 opposed to chemokinesis, migration in the presence or absence of an SDF-1 gradient was assessed. The contribution of chemokinesis, as assessed by migration in the absence of an SDF-1 gradient, was small as compared to the maximal migratory response (Figure 4.1b). However, Pten +/- B cells did show a small but statistically significant increase in chemokinetic movement (p<0.03) as well as the previously observed increase in migration due to chemotaxis. To examine the role of PI3K in the chemotactic response of B cells, cell migration in the presence of the PI3K inhibitor wortmannin was tested. Inhibition of PI3K greatly diminished the chemotactic reponse of both wildtype and Pten +/- B cells at an SDF-1 dose which induced maximal migration (Figure 4.2). Thus, the ability of Pten +/- B cells to migrate towards SDF-1 was dependent on PI3K signaling. To test whether this observation of altered sensitivity to SDF-1 held across other cell types we assessed the chemotactic response of purified splenic CD4 + T cells. At all doses tested, an increased number of Pten +/- CD4 + T cells migrated towards SDF-1 (Figure 4.3a). The peak response for both the wildtype and the Pten +/- cells was 1500 ng/mL. This migratory response was almost entirely dependent on the presence of an SDF-1 gradient, indicating that the contribution of chemokinesis to the observed response was minimal (Figure 4.3b). To examine the contribution of PI3K to the chemotatic response of T cells, cell migration in the presence of the PI3K inhibitor LY294002 was assessed. LY294002 caused a reduction in the chemotatic response of CD4 + T cells to SDF-1 (Figure 4.4a). Under the same conditions that inhibited chemotaxis, LY294002 also abolished • 65 0> E IS E o « 0) o o 2500-2000-1500-1000-500-I I i 1500 ng/mL SDF • +/+ Z+l-1500 + Wortmannin Figure 4.2. The SDF-1 induced chemotactic response of Pten +/- B cells is P13K dependent. Purified splenic B cells were examined for their ability to transmigrate from the upper chamber towards media with or without addition of 1500 ng/ml SDF-1 in the lower chamber. Results represent pooled data obtained from five independent splenic B cell isolations with each transmigration experiment performed in duplicate as a minimum. For the inhibitor study, 100 nM wortmannin was added to both the lower and upper chambers and results shown are triplicates from one splenic B cell isolation. 66 70000 60000 • n E cha 50000 -E o 40000 n lis in 30000 -a O *— o 20000 • * 10000* 1000 2000 3000 ng/mL SDF 4000 60000 g 50000 to o E o c o . Q C 40000 30000 g 20000 *— o * 10000 *43 •+/+ E+/-^ i — ^ 1500 bottom 1500 top/bottom ng/mL SDF Figure 4.3. Dose response of Pten +/- T cells to SDF-1. Purified splenic C D 4 + cells were expanded on anti-CD3 and grown in the presence of IL-2 for 8 days as described, (a). These T cells (1 x 106 per well) were evaluated for their ability to migrate from the upper chamber towards SDF-1 at indicated concentrations in the lower chamber. After 3 h, cells in the lower chamber were counted by flow cytometry. Results represent pooled data from four independent splenic T cell isolations and transmigration experiments, (b). T cells were assessed for the ability to migrate in the presence or absence of a SDF-1 gradient. Cells were resuspended in media alone and placed in the top chamber and allowed to migrate towards media alone (0) or towards SDF-1 (1500 bottom). Cells were allowed to migrate in the absence of a gradient by resuspending cells placed in the top chamber in the same SDF-1 solution as placed in the lower chamber (1500 top/bottom). Results represent pooled data from at least three independent splenic T cell isolations with each transmigration experiment carried out in triplicate. 67 6000 0+DMSO 1500+DMSO ng/mL SDF 1500 + LY +/-DMSO SDF P-PKB> P K B > +/+ LY DMSO LY Figure 4.4. PI3K inhibition markedly reduces the chemotactic response of Pten +/- T cells towards SDF-1. (a). T cells were examined for their ability to transmigrate from the upper chamber towards media with or without 1500 ng/ml SDF-1 in the lower chamber. For the inhibitor study, either 50 | i M LY294002 or equivalent volumes of the solvent DMSO, was added to both the lower and upper chambers. The results shown are triplicates from one splenic T cell isolation, (b). T cells were incubated in the presence of 1500 ng/mL SDF-1 and 50 U.M LY294002 under the same conditions used for the chemotaxis experiment shown in (a). The blots from parallel immunoblot analyses using either a phospho-specific antibody for P K B (Ser-473) or an antibody against P K B represent data from the same splenic T cell isolation as shown in (a). 68 SDF-1-dependent phosphorylation of PKB (Figure 4.4b). Thus, chemotaxis was abrogated by inhibition of PI3K activity in both wildtype and Pten +/- cells. To evaluate the response of Pten +/- cells to another chemokine, we tested the chemotactic response to MCP-1. This chemokine has been shown to be a major attractant for CD4 + T lymphocytes (Loetscher et a l , 1994). Based on the position of the NH2 terminal conserved cysteines, it is possible to distinguish between chemokine subfamilies. MCP-1, for example, is representative of the Cys-Cys subfamily, whereas SDF-1 is falls into the class of Cys-X-Cys chemokines. Interestingly, MCP-1 uses an alternative signal transduction pathway than SDF-1 (Sozzani et a l , 1994). Treatment with MCP-1 successfully induced chemotaxis in Pten +/- cells, however, at the doses tested, Pten +/- CD4 + T cells failed to show any significant differences in sensitivity to MCP-1 as compared to wildtype cells (Figure 4.5). These results indicated that the increased responsiveness of Pten +/- lymphocytes might be specific to SDF-1 and also dependent on PI3K activity. 4.2.2 Reduced levels of Pten protein in Pten +/- lymphocytes upon SDF-1 stimulation Pten heterozygosity could lead to differences in lymphocyte migration owing to a reduction of levels of Pten, an important negative regulator of PI3K mediated signal transduction pathways. To confirm that Pten +/- mice did in fact show a reduced amount of Pten protein in primary lymphocytes in vivo, immunoblot analyses on purified populations of primary lymphocytes were carried out (Figure 3.8). Lymphocytes from Pten +1- mice revealed an approximate 2-fold reduction in Pten as compared to • 69 30000 cu | 25000 CO o 20000 15000 10000 5000 • +/+ H+/-100 ng/mL MCP-1 200 Figure 4.5. Chemotaxis towards MCP-1 is unaltered in Pten +/- T cells. Expanded T cells were evaluated for their ability to migrate from the upper chamber towards MCP-1 at the indicated concentrations in the lower chamber. Results represent pooled data from three independent T cell isolations with each transmigration experiment performed in triplicate. 70 lymphocytes from wildtype littermate controls. It has been shown that protein levels of Pten are regulated by phosphorylation and protein degradation (Torres and Pulido, 2001; Vazquez et al , 2000) as well as by promoter methylation (Salvesen et a l , 2001). Thus, it was important to confirm that the relative levels of Pten protein did not change throughout the time course of SDF-1 stimulation when comparing Pten +/- and wildtype samples. For all time points, Pten levels in Pten +/- cells remained at about half those of wildtype controls (Figure 4.6). 4.2.3 Sustained PKB phosphorylation in Pten +/- lymphocytes To investigate a potential mechanism by which Pten heterozygosity leads to enhanced chemotaxis in lymphocytes we examined two signaling events lying downstream of SDF-1, PKB and MAPK phosphorylation. Chemotaxis was abrogated when 1500 ng/ml SDF-1 was added to B cells in the presence of 100 nM wortmannin, indicating that the chemotactic response of both Pten +/- and control B cells was PI3K dependent (Figure 4.2). Additionally, chemotaxis was reduced when 1500 ng/ml SDF-1 was added to CD4 + T cells in the presence of 50 pM LY294002, indicating that the migratory response of both Pten +/- and control T cells were also PI3K dependent (Figure 4.4). Hypothesizing that differences in the activation of the PI3K pathway might account for the differential response of the Pten +/- and control lymphocytes to SDF-1, we examined PKB phosphorylation, an event reflective of PI3K activation. PH-domain mediated recruitment of PKB, and its upstream kinase, phosphoinositide dependent kinase-1 (PDK-1), to the membrane is the first step in activation of this kinase by PI3K. Full activation of PKB requires two phosphorylation events, one at Ser-473 and another at Thr-308. It has been demonstrated that PKB phosphorylation at Ser-473 correlates • 71 +/- +/+ min SDF 0 2 10 20 0 2 10 20 Pten> — i i i i i i t * 1.0 1.0 0.9 0.7 1.6 1.7 1.7 1.6 Figure 4.6. Levels of Pten protein are decreased as compared to wildtype in SDF-1 stimulated Pten +/- T cells. Expanded T cells were stimulated with SDF-1 for the indicated amounts of time and the level of Pten protein was assessed by immunoblot analyses. Results are representative of five independent T cell isolations done on littermate matched wildtype and Pten +/-. The numbers below the blots represent relative densitometry units for each band. 72 with the kinase activity in vitro (Jones et a l , 2000; Scheid et a l , 2002; Stambolic et a l , 1998). We observed an increased level phosphorylation of PKB on Ser-473 upon stimulation of Pten +/- B cells with 50 pg/mL SDF-1, compared to controls (Figure 4.7a). This SDF-1 concentration was selected so that differences in intracellular signaling events occurring within minutes of SDF-1 stimulation could be readily evaluated. An alteration in the kinetics of PKB phosphorylation was also evident in Pten +/- B cells, which showed a prolonged phosphorylation response to SDF-1 as compared to wildtype cells. To quantitate the differential response of Pten +/- and control cells to SDF-1, densitometric analysis of multiple independent experiments was carried out (Figure 4.7b). To assess whether this difference in PKB in response to SDF-1 stimulation was similar in other cell types, the PKB status in CD4 + T cells was examined. Enhanced phosphorylation at Ser-473 of PKB was seen in Pten +/- CD4 + T cells without the addition of any chemokine (Figure 4.8). This is in agreement with other reports (Di Cristofano et a l , 1999) of increased phosphorylation of PKB in mixed populations of splenocytes in Pten +/- mice. Upon stimulation with SDF-1, CD4 + T cells demonstrated an increase in PKB phosphorylation with kinetics resembling that of B cells (Figure 4.8a). The Pten +/- T cells were maximally stimulated to the same extent as the wildtype cells, however, increased phosphorylation of PKB was restricted to the 10 min post-SDF-1 stimulation time point. To quantitate this differential response of Pten +/- T cells to SDF-1, densitometric analysis of multiple independent experiments was carried out (Figure 4.8b). • 73 a. min SDF 0 P - P K B > r~~ P K B ^ +/+ 2 10 20 0 10 20 b. 1.2 c o 45 1.0 c o I 0.8 o £ a CO 0.6 z CL X ra | 0.2 o 0.0 +-H+/-• +/+ h i . 1 I t l 0 2 10 20 min SDF stimulation Figure 4.7. Pten +/- B cells show increased phosphorylation of P K B in response to SDF-1 stimulation. Purified splenic B cells from Pten +/- and sex-matched littermate controls were stimulated with 50 ug/ml SDF-1 for the indicated times, (a). Representative blots from parallel immunoblot analyses using either a phospho-specific antibody for P K B (Ser-473) or an antibody against P K B . (b). Densitometric analysis of autoradiographs derived from four independent experiments. In each case, splenic B cell isolations consisted of two mice pooled per experiment. Results have been normalized for maximal P K B phosphorylation, as determined by percentage P K B phosphorylated at 2 min in Pten +/- cells, and represent the percentage of phosphorylated P K B relative to parallel loading controls. Bars represent mean and SEM percentage of maximal P K B phosphorylation upon SDF-1 stimulation (p < 0.002). 74 a. +/- +/+ min SDF 0 2 10 20 0 2 10 20 P-PKB> P K B > 120 c I 100 I o a 80 o £ ffl 60 1 CL | 40 S a E 20 H+/-• +/+ T 1 1 H 0 2 10 20 min SDF stimulation Figure 4.8. Elevated PKB phosphorylation in Pten +/- T cells in response to SDF-1 stimulation. Expanded CD4 + cells from Pten +/- and sex-matched littermate controls were stimulated with 50 ug/ml SDF-1 for the indicated times, (a). Representative blots from parallel immunoblot analyses using either a phospho-specific antibody for P K B (Ser-473) or an antibody against P K B . (b). Densitometric analysis derived from four independent experiments. Results have been normalized for maximal P K B phosphorylation, as determined by percentage P K B phosphorylated at 2 min in Pten +1- cells, and represent the percentage of phosphorylated P K B relative to parallel loading controls. Bars represent mean and S E M percentage of maximal PKB phosphorylation upon SDF-1 stimulation. 75 4.2.4 Downstream activation of the PKB substrate GSK-3 is not enhanced in Pten +/- T cells In an attempt to assess the effects of enhanced activation of PKB in Pten +/- T cells, downstream phosphorylation of the PKB substrate, GSK-3, was tested. GSK-3 has been shown to be a direct substrate for PKB and becomes inactivated upon phosphorylation by PKB. Upon SDF-1 stimulation, GSK-3 is phosphorylated in Pten +/- and wildtype T cells with similar kinetics (Figure 4.9a). However, reproducible elevation in levels of GSK-3 phosphorylation was not observed in Pten +/- T cells as compared to wildtype cells (Figure 4.9b), even though increased activation of PKB was observed in Pten +/-cells. Many substrates for PKB have been defined and the inability to detect differences in GSK-3 phosphorylation in Pten +/- T cells may reflect the alternate use of different subsets of PKB substrates. 4.2.5 Pten +/- lymphocytes show no significant difference in MAPK pathway activation following SDF-1 stimulation As with PKB, MAPK also becomes phosphorylated following SDF-1 stimulation, subsequent to the activation of receptor associated G proteins (Ganju et a l , 1998). We therefore assessed the phosphorylation status of p44/42 MAPK in lymphocytes using phospho-specific antibodies. SDF-1 stimulation resulted in MAPK phosphorylation in Pten +/- B lymphocytes, however when compared to wildtype cells, no reproducible difference in either the level or kinetics of phosphorylation was evident. Representative immunoblots are shown in Figure 4.10a. Densitometric analyses from multiple experiments revealed that Pten +/- B cells did not exhibit any significant differences in • 7 6 a. +/+ +/-min S D F P - G S K - 3 ^ I 2 1 0 2 0 1 0 2 0 2 . 5 c % 2 a f o • o JZ CL * 1 o | 0 . 5 a 0 4-J H+/-• +/+ 2 1 0 2 0 min S D F stimulation Figure 4.9. Phosphorylation of GSK-3 in Pten +/- T cells in response to SDF-1. Expanded CD4* cells from Pten +/- and sex-matched littermate controls were stimulated with 50 ug/ml SDF-1 for the indicated times, (a). A representative blot from immunoblot analyses using a phospho-specific antibody for GSK-3 is shown, (b). Densitometric analysis derived from three independent experiments. Results have been normalized relative to levels of GSK-3 phosphorylation seen in the Pten +/- at 2 min. Bars represent mean and SEM percentage of relative GSK-3 phosphorylation upon SDF-1 stimulation. 77 a. c. +/+ min SDF 0 2 5 10 20 0 2 5 10 20 P-MAPKW . MAPKra b. • o a 2 > 2 5 min SDF 0 ± ^ 10 +/+ +/-min S D F 0 2 10 20 60 0 2 10 20 60 P-MAPK> S MAPK> 2 10 min SDF Figure 4.10. MAPK phosphorylation in Pten +/- lymphocytes following SDF-1 stimulation. Representative blots from parallel immunoblot analyses using either a phospho-specific antibody for p42/p44 MAPK or an antibody against MAPK. (a). Splenic B cells were pooled from two mice per group for each isolation, and four independent experiments were carried out. (b). Densitometric analysis derived from three independent experiments. Results were normalized relative to the amount of MAPK phosphorylated at 2 min in Pten +/- cells, and represent the percentage of phosphorylated MAPK relative to parallel loading controls. Bars represent mean and SEM percentage of maximal MAPK phosphorylation upon SDF-1 stimulation, (c). Expanded CD4+ cells were isolated from one mouse per genotype and four independent stimulations and blotting experiments were carried out. (d). Densitometric analysis derived from four independent experiments. Results have been normalized relative to the amount of MAPK phosphorylated at 2 min in Pten +/- cells, and represent the percentage of phosphorylated MAPK relative to parallel loading controls. Bars represent mean and SEM percentage of maximal MAPK phosphorylation upon SDF-1 stimulation. 78 phosphorylation of MAPK as compared to wildtype cells (Figure 4.106). In Pten +/- T cells, the case may be slightly more complex. Reproducible differences in MAPK phosphorylation were less clear-cut and any increases in phosphorylation seen were restricted to the 10 min time point of SDF-1 stimulation (Figure 4.\0c,d). To further investigate the contribution of PI3K signaling to events downstream of SDF-1, CD4 + T cells were pretreated with 50 LiM LY294002 for 15 min prior to SDF-1 stimulation. SDF-1-induced phosphorylation of PKB was completely abrogated by pretreatment with LY294002 in both wildtype and Pten +/- cells (Figure 4.1 la). On the other hand, SDF-1-stimulated MAPK phosphorylation was not altered in either wildtype or Pten +/- T cells by the addition of the PI3K inhibitor LY294002 (Figure 4.1 lb). These results support the idea that the differential response of Pten +/- lymphocytes to SDF-1 is linked to dysregulation of PI3K-dependent events, including PKB phosphorylation. 4.2.6 Levels of CXGR4 are not elevated on Pten +/- T cells The chemokine receptor CXCR4 is required for stimulation of SDF-1 induced events. In addition to the activation of downstream signaling events, it has also been shown that SDF-1 induces the rapid down modulation of CXCR4 (Signoret et a l , 1997). To investigate altered CXCR4 receptor expression levels as a mechanism contributing to the increased sensitivity of Pten deficient cells towards SDF-1, we assessed the levels of CXCR4 present in Pten +/- T lymphocytes. Western blot analyses revealed that CXCR4 expression was detectable in preparations of total cellular lysates in both +/+ and Pten +/-T cells (Figure 4.12a). Densitometric analyses over multiple experiments revealed that unstimulated Pten +/- T cells have slightly decreased levels of CXCR4 (Figure 4.126). • 79 DMSO LY DMSO LY min SDF 0 2 1 0 2 0 0 2 1 0 2 0 0 2 1 0 2 0 0 2 1 0 2 0 P-PKBN PKBOJ b. +/+ +/-DMSO LY DMSO LY min SDF 0 2 1 0 2 0 0 2 1 0 2 0 0 2 1 0 2 0 0 2 1 0 2 0 P - M A P K M MAPKH Figure 4.11. SDF-1 induced PKB phosphorylation, but not M A P K phosphorylation, is P13K dependent in Pten +/- T cells. Expanded splenic CD4 + T cells were pretreated with either DMSO or 50 u M LY294002 for 15 min and then stimulated with 50 Ug/mL SDF-1 for the indicated times, (a). Representative blots from parallel immunoblot analyses using either a phospho-specific antibody for PKB (Ser-473) or an antibody against P K B . (b). Representative blots from parallel immunoblot analyses using either a phospho-specific antibody for p42/p44 M A P K or an antibody against M A P K . Results are representative of three independent T cell isolations and immunoblot analyses. 8 0 +/+ min SDF 0 CXCR4> 10 20 10 20 Figure 4.12. Cellular C X C R 4 levels in Pten +/- T cells are not elevated. Expanded CD4 + cells from Pten +/- and sex-matched littermate controls were stimulated with 50 ug/ml SDF-1 for the indicated times, (a). A representative blot from immunoblot analyses using an antibody specific for CXCR4 is shown, (b). Densitometric analysis derived from five independent experiments. Results have been normalized relative to levels of C X C R 4 seen in the Pten +/- at 2 min. Bars represent mean and S E M percentage of relative C X C R 4 expression upon SDF-1 stimulation. 81 Upon stimulation, however, the total cellular pool of CXCR4 in Pten +/- cells is indistinguishable from that seen in wildtype cells. While CXCR4 may be present intracellularly in the endosomal compartment, as occurs during receptor down modulation, functional CXCR4 receptors exist on the cell surface. Using an antibody specific to murine CXCR4 in combination with a FITC conjugated secondary antibody, the cell surface expression of CXCR4 was assessed on Pten +/- lymphocytes. Purified populations of T lymphocytes displayed detectable levels of CXCR4 on the cell surface while mixed populations of splenocytes showed no shift associated with expression (Figure 4.13). To further investigate the cell surface expression of CXCR4, we carried out multiple isolations of T cells and compared the expression of CXCR4 on wildtype and Pten +/- T cells. A similar CXCR4 expression pattern was detected on the suface of both Pten +/- and wildtype T cells (Figure 4.14a). In fact, analysis of multiple experiments revealed that over multiple experiments there was no significant difference in cell surface expression in unstimulated cells (Figure 4.146). Attempts to find differences in CXCR4 expression levels upon stimulation were unsuccessful. Therefore, it does not seem likely that altered expression level of CXCR4 contributes to the enhanced sensitivity of Pten +/-lymphocytes towards SDF-1 that has been demonstrated. • 82 100-1 • i — i 10 100 1000 FL1-H: cxcr4 + goat IgG 10 100 1000 FL1-H: cxcr4 + goat IgG Splenocytes Isotype control Splenocytes CXCR4 + FITC CD4* Isotype control CD4* CXCR4 + FITC Figure 4.13. C X C R 4 is expressed on the cell surface of Pten +/- T cells. Splenocytes from 8 week old Pten +/- (left panel) and +/+ (right panel) littermates were isolated with one mouse used per genotype for each experiment. Splenocytes were stained with either anti-CXCR4 (purple) or an isotype control antibody (green) in combination with FITC-conjugated anti-IgG. Freshly isolated CD4 + T cells were stained with either anti-CXCR4 (blue) or an isotype control antibody (red) in combination with FITC-conjugated anti-IgG. The results shown are representative of experiments carried out independently on duplicate cellular isolations. 83 1000 FL1-H: cxcr4 + goat IgG 10000 10 100 1000 FL1-H: cxcr4 + goat IgG ' unstained cells Isotype Control CXCR4-G19 o 3 — O Q. T J a c '<0 o >> o c a 3 50 45 40 35 30 25 20 15 10 5 0 0 + / -• +/+ CXCR4 + FITC Isotype control + FITC antibody used for staining Figure 4.14. Cell surface expression of C X C R 4 is unchanged in Pten +/- T cells. Freshly isolated populations of CD4 + T cells were purified from Pten +/- (left panel) and +/+ (right panel) littermates. (a). Cells were stained with either anti-CXCR4 (blue) or an isotype control antibody (red) in combination with FITC-conjugated anti-IgG and analyzed by flow cytometry. Unstained cells are shown in green. Typical staining profiles are shown and represent three independent experiments, (b). The average frequency of the C X C R 4 positive staining population is reported. The frequency of staining that the isotype control antibody displays in the C X C R 4 positive gate is also reported. Error bars represent the standard error of the mean. The results shown are triplicate cellular isolations carried out with one mouse per genotype. 84 4.3 Discussion In this chapter, we have presented evidence that supports our hypothesis that deficiency of Pten results in augmented sensitivity towards chemokine stimulation. The central role that PI3K signaling plays in chemokine signaling likely underlies the mechanism by which Pten affects this cellular response. Since cellular movement is key to many biological processes, altered migratory responses could have pleiotropic effects in Pten +/- mice. In particular, it is important to consider how enhanced sensitivity to chemokines may contribute to the development of autoimmunity in these mice. Modulation of lipid second messenger levels in the membrane is central to the regulation of cellular migration and thus provides a potential mechanism to explain how Pten deficiency leads to increased cellular migration. For example, Pten deficiency may cause alterations in phosphoinositol levels and PH-domain recruitment patterns. The PKB PH-domain rapidly and transiently translocates to the plasma membrane upon chemoattractant stimulation and is found at the leading edge in migrating cells (Servant et al , 2000). It has been proposed that activation of PI3K at the leading edge leads to the formation of PI(3,4,5)P3 and PI(3,4)P2 enriched lipid domains that function as docking sites for diverse PH-domain containing proteins. This results in a clustering of these signaling proteins, which leads to the formation of a new pseudopod and directed cellular movement (Firtel and Chung, 2000; Funamoto et al , 2001). In addition to this pivotal role at the leading edge of cells, PKB has also been implicated in the regulation of chemotaxis through its ability to cause the phosphorylation of G-protein coupled receptors (Lee et a l , 2001a). Although the increased phosphorylation of PKB in Pten +/-cells suggests a plausible mechanism for the enhanced response of these cells to SDF-1, it 85 is possible that other phosphoinositide-binding domain containing proteins are also involved. The maintenance of cell polarity and subsequent activation of signaling at the leading edge of a cell is important in the process of cellular migration. Very recently, studies with Pten in Dictyostelium discoideum, have revealed a fundamental role for Pten in the process of sensing chemical gradients during directional migration (Funamoto et al , 2002; Iijima and Devreotes, 2002). In Dictyostelium, it has been shown that Pten is localized at the rear of migrating cells in a pattern reciprocal to PI3K. It has been hypothesized that Pten and PI3K play important roles in establishing cell polarity through modulation of phosphoinositiol species and localized recruitment of PH domain containing proteins to the membrane. In support of this, cells mutant for Pten show prolonged and broadened PH domain localization, which results in the Pten deficient cells taking a circuitous route towards the chemoattractant (Iijima and Devreotes, 2002). Dictyostelium cells overexpressing Pten also had defects in cellular movement, which resulted from a less polarized response (Funamoto et al , 2002). Thus, the inability to restrict PH domain and cytoskeletal events to the leading edge underlies the observed defects in cellular movement observed in Pten deficient Dictyostelium. This recent work supports our results and, in combination with our results, firmly establishes the importance of PI3K and Pten in mediating directional movement (Funamoto et a l , 2002; Iijima and Devreotes, 2002). In fact, a model of the mechanism for maintenance of cell polarity during chemotaxis suggests that a short-range signal with a positive feedback loop involving PI(3,4,5)P3, actin polymerization and RhoGTPase activity is important for the orientation and stabilization of the leading edge of a migrating cell (Wang et a l . 86 2002; Weiner et al , 2002). In this model, the signals from the short-range activator maintain cell polarity by generating a more long-range inhibitory signal, which likely involves PTEN, SHIP or negative regulators of Rho. Thus, the effects of Pten on chemotaxis could be due to deregulation of fundamental events that must occur during cell migration. Taken together, this evidence suggests that regulation by Pten is important for the control of signaling events that are central to the process of cellular movement. The central relevance of PI3K signaling for the process of directed cellular migration provides further rationale for the hypothesis that Pten is capable of regulating SDF-1-induced events. Using specific inhibitors it has been shown that the PI3K pathway, but not the MAPK pathway, is required for both SDF-1-induced phosphorylation of focal adhesion proteins and SDF-1-induced migration (Wang et a l , 2000). As well, consistent with the importance of PI(3,4,5)P3 levels in chemokine dependent migration, lymphocytes lacking the 5' inositol phosphatase SHIP, showed increased responsiveness to SDF-1 and other chemokines (Kim et a l , 1999). Our work demonstrates an increased capacity of Pten deficient lymphocytes for cellular movement. We have shown increases in chemotaxis as well as increased random cellular movement. This indicates that Pten may have several modes of action in the control of cellular movement. Other recently published work confirmed our findings by demonstrating an essential role for Pten in the cell migration of neural precursor cells in Pten deficient animals (Li et a l , 2002; Marino et al , 2002). In Pten +/- lymphocytes, Pten levels were about half those of wildtype controls. We hypothesized that the reduced levels of Pten were accompanied by a decrease in Pten activity. Other studies support the hypothesis 87 that Pten heterozygosity leads to haploinsufficiency (Kwabi-Addo et al , 2001). Since Pten has been implicated as an important negative regulator of the PI3K pathway, the link between SDF-1 and Pten could be through dysregulation of signaling pathways dependent on PI(3,4,5)P3 and PI(3,4)P2 in Pten +/- cells. SDF-1 is known to activate multiple signal transduction pathways including receptor associated trimeric G proteins, phospholipase Cy and protein kinase C, PI3K and PKB, small G proteins, and specific protein tyrosine kinase pathways (Ganju et a l , 1998; Sotsios et a l , 1999; Vicente-Manzanares et al , 1999; Vila-Coro et a l , 1999). SDF-1-induced chemotaxis is a complex and coordinated phenomenon that is initiated by binding to the SDF-1 receptor, CXCR4 (Servant et a l , 2000). These events, in turn, lead to increased intracellular Ca 2 + levels, cytoskeletal reorganization, and ultimately the chemotactic response of the cell. Tyrosine phosphorylation of multiple focal adhesion proteins such as RAFTK/Pyk2, pl30Cas, Paxillin, FAK, CrkL, and Crk is also seen following SDF-1 stimulation (Wang et al , 2000). Human PTEN has been implicated in the dephosphorylation of some of these intermediates, such as FAK and pl30Cas, suggesting a role for the protein tyrosine phosphatase domain of PTEN in the regulation of integrin mediated cell adhesion (Tamura et al , 1998; Tamura et a l , 1999). In addition to the activation of protein kinase signaling pathways, SDF-1 also causes an accumulation of PI(3,4,5)P3 in the membrane and SDF-l-induced chemotaxis is fully dependent on PI3K activation (Sotsios et al , 1999). Thus it is evident that PI3K plays a central role in the signal initiated by the SDF-1:CXCR4 interaction. The role of MAPK signaling in chemotaxis seems to be linked to the control of the cytoskeleton through the action of small G proteins such as Ras. While there is some 88 debate as to whether Pten is able to regulate MAPK phosphorylation (Davies et al , 1998b; Gu et a l , 1998; Li and Sun, 1998; Nakashima et a l , 2000; Weng et al , 2001b), we observed no enhancement in MAPK phosphorylation in Pten +/- B lymphocytes exposed to SDF-1. Our data also suggested that Pten +/- T cells may show a limited difference in MAPK phosphorylation under these same conditions. Subsequently, through the use of PI3K inhibitors in T cells, we were able to show that SDF-1-induced phosphorylation of MAPK occurred independently of PI3K inhibition. Further experimentation would be necessary to determine whether MAPK activity is affected in Pten +/- T cells. Taken together, our results suggest that the differential response of Pten +/- lymphocytes to SDF-1 may be linked to dysregulation of PI3K dependent events, including PKB phosphorylation. As mentioned previously, recruitment of PKB via PH-domain interactions leads to activation of the kinase and subsequent signaling at the leading edge of the cell. GSK-3 is known to be a substrate for PKB in T cells. Thus we examined the phosphorylation status of GSK-3 in Pten +/- T cells. We did not find any increase in GSK-3 phosphorylation that would be reflective of increased PKB activity in Pten +/- T cells. Thus, it is likely that other substrates of PKB play more important roles in the initiation of the migratory response at the leading edge of cells. Control of the level of receptor expression has been shown to be an important factor in the regulation of the responsiveness of a cell to SDF-1 (Signoret et al , 1997). PKC-dependent receptor down-modulation has been demonstrated to play a role in attenuating cellular responsiveness to SDF-1 (Signoret et a l , 1997). Total cellular pools of CXCR4 in unstimulated Pten deficient lymphocytes were slightly decreased, indicating that a dampening of CXCR4 expression may counter enhanced sensitivity to SDF-1. 89 However, Pten deficient lymphocytes had normal levels of CXCR4 on the cell surface and no changes in the receptor down modulation could be detected upon stimulation. Thus, mechanisms to maintain normal levels of CXCR4 on the surface exist in Pten deficient lymphocytes. It seems likely that dysregulation of PI3K mediated events rather than control of receptor expression exists as a mechanism to explain the enhanced sensitivity of Pten deficient cells towards SDF-1. Monocyte chemoattractant proteins form a structurally related subclass of chemokines distinct from SDF-1. MCP-1 is the prototype CC chemokine and is a major chemoattractant for monocytes and T lymphocytes. While Pten deficient T lymphocytes display an augmented sensitivity towards SDF-1, there seems to be no alteration in the chemotactic response initiated by MCP-1. MCP-1 induces rapid and transient activation of MAPK pathways, including MAPK1/2, SAPK1/JNK1, and SAPK2/p38. MCP-1 has also been shown to activate PI3K. Inhibitor studies have shown that MEK inhibition significantly inhibited MAPK 1/2 activation and MCP-1 induced chemotaxis, however, PI3K inhibition only partially inhibited the chemotactic response induced by MCP-1 and had no effect on MAPK1/2 activation (Wain et al , 2002). These inhibitor studies suggest that MAPK plays a more pivotal role in MCP-1 induced migration than PI3K. As with SDF-1, PI3K appears to be required for MCP-1 induced chemotaxis, although for MCP-1 it seems that this requirement is not ultimate. Thus, differences in the relative contributions of PI3K signaling to MCP-1 versus SDF-1 induced events seem to explain the lack of enhanced responsiveness seen in Pten deficient cells. As discussed in Chapter 3, PI3K signaling plays a central role in many facets of normal lymphocyte development and activation. The migratory capacity of lymphocytes 90 is also tightly regulated and is a key element in immune regulation. The proper development of lymphocytes as well as the initiation of immune responses depends on the ability of lymphocytes to traffic, localize within tissues, and interact in a co-ordinated fashion (Sallusto et a l , 2000). The ability of Pten to regulate the migratory response may result in altered immune function through effects on any of these processes. Pten heterozygosity does not initially compromise normal lymphoid development, as reflected in the normal ratios of CD4+, CD8 + and B220+ lymphocytes in the lymph nodes of young Pten +/- mice (Di Cristofano et a l , 1999). Over time, however, a progressive lymphoproliferative disorder develops in these mice (Di Cristofano et al , 1999). If Pten +/- lymphoid cells were indeed abnormally sensitive to chemokines in vivo, it is plausible that the aberrant recruitment and accumulation of lymphoid cells would contribute to the lymphoproliferative disorder of Pten +/- mice. SDF-1 is expressed at high levels in the lymph node (Muller et al , 2001) and thus increased recruitment of Pten +/- lymphocytes could account for the increased lymphoadenopathy observed in these mice. In a similar fashion, SDF-1 has been shown to be involved in the recruitment of precursor cells during population of the thymus that occurs during T cell development. Alternatively, altered migration could lead to enhanced infiltration of lymphocytes into areas of the peripheral immune tissues that support lymphocyte activation and survival. Since both SDF-1 and CXCR4 are present at high levels in the lymph node (Muller et al , 2001), it is possible that residing lymphocytes may have an increased capacity to move into zones that support potential lymphocyte/dendritic or lymphocyte/lymphocyte interactions. Inappropriate interactions that lead to an immune response could contribute to the autoimmunity that develops in these mice. Finally, 91 control of cellular migration by SDF-1 provides an important developmental signal for lymphocytes. Therefore, altered lymphocyte survival and activation patterns resulting from altered migratory responses during development may support the accumulation of autoreactive lymphocytes in Pten +/- mice. Thus, there are multiple ways in which the altered sensitivity of Pten deficient lymphocytes towards chemokine stimulation may support the development of autoimmunity in Pten +/- mice. 92 Chapter 5 Deficiency of Pten leads to a slight alteration in the transcriptional state of CD4 + lymphocytes. 5.1 Introduction Cellular responsiveness depends on the ability of a cell to modulate the activation as well as expression of important genes and proteins. Control of gene expression by regulation of transcription, especially through the control of transcription factor activity, is one way in which the cell can regulate responses to external stimulation. PI3K, PKB and PTEN have all been implicated in the control of transcription (Brunet et a l , 2001; Kops and Burgering, 1999; Mayo et al , 2002; Nakamura et al , 2000). Furthermore, SDF-1 stimulation has been shown to cause diverse transcriptional changes in the cell (Suzuki et a l , 2001b). Thus, an examination of the transcriptional changes that occur in Pten +/- lymphocytes may provide insights into the differential responsiveness of these lymphocytes towards SDF-1. By looking at the substrates and downstream effects of PKB, one can make the connection between PI3K signaling and transcriptional changes. The control of transcription factors is important for the cell survival signal provided by the PI3K-PKB pathway (reviewed in (Brunet et al , 2001)). In the absence of survival factors, transcription factors such as FOXO and p53 induce expression of target death genes, including FasL or the pro-apoptotic Bcl-2 family members, BEVI and BAX (Brunet et a l , 2001). In the presence of survival factors the PI3K-PKB pathway is activated. PKB prevents the execution of apoptosis at several levels, in both transcription-dependent and -independent manners. PKB phosphorylates and inhibits the transcription factor FOXO, and PKB indirectly inhibits p53, thereby preventing the expression of their target death 93 genes. PKB also indirectly activates N F K B , leading to the expression of survival genes, such as A l , Bcl-xl and IAPs (Brunet et al , 2001). Analysis of other substrates of PKB has also revealed more indirect roles for this kinase in transcriptional regulation. Phosphorylation of GSK-3 by PKB is known to cause inactivation of this kinase, which has been shown to be involved in the negative regulation of CPvEB and AP-1 (Kops and Burgering, 1999). Thus, through inactivation of GSK-3, PKB has the potential to positively regulate these transcription factors. It has also been shown that PKB activity affects the control of the c-myc transcription factors by a mechanism that has not been defined (Kops and Burgering, 1999). Other transcription factors such as HLF-la and E2F are also regulated by PKB activity (Kops and Burgering, 1999). Thus, activation of PKB can initiate a cascade of signaling events whose end result is the regulation of transcription factor activity. A more direct role for the PI3K-PKB pathway in the control of transcription is demonstrated by the finding that PKB can directly regulate the Forkhead superfamily of transcription factors. The initial connection between PKB and Forkhead transcription factors came from work done in C. Elegans (reviewed in (Scheid and Woodgett, 2001)). Genetic studies with mutants that controlled dauer formation revealed that DAF-16 (homolog of Forkhead transcription factors) was negatively regulated by PKB, which in turn was activated by AGE-1 (PI3K homolog) and DAF-2 (insulin receptor homolog) (Lee et al , 2001b; Medema et al , 2000). DAF-18, the C. elegans version of Pten was found to downregulate this signaling pathway (Gil et al , 1999; Ogg and Ruvkun, 1998; Rouault et a l , 1999). Subsequent work in mammalian systems has shown that PKB can directly phosphorylate all three of the Forkhead transcription factors: AFX, FKHR, and 94 FKHRL1 (Biggs et al , 1999; Kops et al , 1999). Phosphorylation of Forkhead transcription factors leads to nuclear export and functional inactivation of these proteins, likely through a mechanism involving cytosolic sequestering that occurs through association with the 14-3-3 protein (Kops and Burgering, 1999). Gene targets for the Forkhead transcription factors include: cell cycle genes such as p27K l p l, apoptosis inducing genes such as FAS and FASL, and metabolic genes with insulin responsive elements contained in their promoter sequences. Thus, the ability of PKB to directly control the activity of the Forkhead transcription factors means that activation of the PI3K-PKB pathway has the potential to induce diverse transcriptional changes. It is also possible that transcription factors are critical downstream effectors of Pten. In support of this, modulation of Pten levels in various cell systems has been shown to have effects on transcription. For example, Pten deficient cell lines have deregulated localization as well as impaired activity of the forkhead transcription factors, FKHR and FKHRL1 (Nakamura et al , 2000). It has been suggested that regulation of this transcription factor is responsible for the induction of cell death that occurs as a result of Pten expression, possibly through the control of FAS expression (Nakamura et al , 2000). Other effects of Pten have been linked to regulation of transcriptional activity. Overexpression of Pten blocked the expression of the transcriptional regulator HIFla and prevented HIFla dependent upregulation of vascular endothelial growth factor (VEGF) causing defects in the angiogenic response (Zhong et al , 2000). Similarly, effects on cell survival, attributed to Pten, were mediated through effects on the phosphorylation and activation of the CREB transcription factor and expression of the BCL-2 gene (Huang et al , 2001). Most of these effects of Pten on various transcription factors can be attributed 95 to regulation of PKB activity, however, through unknown mechanisms Pten has also been shown to regulate the expression of the important transcription regulator c-MYC (Ghosh et a l , 1999). In Jurkat T cells, overexpression of PTEN was found to cause a 50% reduction in the basal NF-AT (nuclear factor of activated T cells) activity (Shan et a l , 2000). Similarly, in multiple cell types, overexpression of PTEN inhibited N F K B activity by blocking the transactivation potential of both N F K B and CREB (Mayo et a l , 2002). Thus, it is clear that Pten can regulate the activity of several important transcriptional regulators and as a consequence the transcriptional response of Pten +/- cells may be altered. SDF-1 stimulation activates many different transcription factors and can induce a transcriptional response in several different cell types. In Jurkat T cells, microarray analyses revealed that a large number of genes showed significant alterations in expression upon SDF-1 stimulation (Suzuki et al , 2001b). Particularly, increased transcription of cell-survival related genes and genes associated with TCR signaling were noted. SDF-1 stimulation also induced the phosphorylation of the Forkhead transcription factor, FKHR, and caused the upregulation of FAS expression. SDF-1 stimulation has also been found to induce phosphorylation of the MAPK and ribosomal protein S6 kinases (Rsk), associated with an SDF-1 induced increase in phosphorylation of the CREB transcription factor (Suzuki et al , 2001b). Another pathway leading to transcription factor activation that is regulated by SDF-1 is the JAK/STAT pathway. Upon SDF-1 treatment, activation and phosphorylation of Janus kinase (JAK1/2) and several STAT (signal transducer and activator of transcription) proteins occurs upon association with CXCR4 (Vila-Coro et a l , 1999). SDF-1 stimulation also activates the 96 N F K B transcription factor by inducing IkB degradation (Han et a l , 2001). N F K B is a heterodimer that is an important transcription factor during immune responses. It is sequestered in the cytoplasm through association with cellular inhibitors that are members of the I K B family of proteins. Upon stimulation, I K B are phosphorylated and then undergo ubiquitination and degradation in proteosomes, allowing rapid nuclear translocation of N F K B . Once inside the nucleus, N F K B co-operates with other factors to activate gene expression. Thus, SDF-1 may modulate the activity of several important transcription factors during stimulation. Analysis of gene expression can be carried out using various different strategies and methods. One exciting new technology that is emerging is the analysis of gene expression on a global level using microarray techniques. Microarray analysis involves the isolation of the sample mRNA, generation of a labeled sample, followed by hybridization in parallel to a large number of DNA sequences immobilized on a solid surface in an ordered array (Schulze and Downward, 2001). There are two major approaches to microarray analyses, which can be grouped according to the arrayed material. The cDNA microarry technique uses spotted cDNAs as arrayed probes whereas oligonucleotide microarrays use 20-25mer oligonucleotides that are synthesized in high-density arrays in situ. In this second method, oligonucleotides represent individual transcripts and are generated as a probe set of perfectly complementary "matched" oligonucleotides and "mismatched" oligonucleotides containing a single base pair mismatch in the center. Between 11-16 probe sets are selected from all possible 25mers to represent each transcript. The "perfect match/mismatch" probe pairs allow the quantitation of signals caused by non-specific hybridization and can serve as indicators of 97 specific target abundance. The high reproducibility of oligonucleotide chips allows accurate comparison of signals generated by samples hybridized to separate arrays. By contrast, cDNA microarray techniques utilize distinct fluorescent probes to label the different RNA samples and hybridization occurs on a single array. Using techniques such as these, multiple groups have examined changes in gene expression that occur as a result of overexpression of Pten (Hong et al , 2000; Matsushima-Nishiu et a l , 2001; Simpson et a l , 2001). These results showed that Pten could regulate the level of expression of a diverse set of genes. However, the sets of genes regulated in each of these microarray experiments were not correlated. This could be due to differences in the secondary effects of Pten overexpression in the different cell types ultilized. We used microarrray analysis as an initial screen to identify interesting candidate genes that may be modulated by Pten deficiency in lymphocytes. We have found that Pten +/- lymphocytes display altered sensitivity to SDF-1 stimulation and we postulated that altered sensitivity to chemokines may be important for the development of autoimmunity that occurs in Pten +/- mice. As discussed above, recent work has characterized an essential role for PKB and Pten in the control of transcription. Pten +/- T lymphocytes have enhanced sensitivity towards SDF-1 stimulation and in other systems SDF-1 stimulation in CD4 + cell lines leads to an altered transcriptional state. Thus, we hypothesized that transcriptional differences might play a role in the altered sensitivity of Pten +/- lymphocytes. As mentioned before, Pten +/-mice develop symptoms of autoimmunity that can be replicated by T cell specific deletion of Pten. T cell-specific loss of Pten leads to defects in central and peripheral tolerance. Ptenn°x/" targeted mice develop similar signs of autoimmunity as Pten +/-, 98 including lymphadenopathy, splenomegaly, autoantibody production and hypergammaglobulinemia (Suzuki et a l , 2001a). Thus, T lymphocytes have been shown to play a pivotal role in the autoimmune phenotype of Pten +/- mice. Taken together, these results showed that deficiency of Pten specifically in T cells can lead to autoimmunity and provided rationale for the gene expression analysis of T lymphocytes. It is possible that major changes in baseline transcription that existed in Pten deficient lymphocytes were responsible for the altered responsiveness towards SDF-1 that we have observed. Alternatively, it is possible that altered sensitivity to PKB signaling that occurs upon SDF-1 stimulation may cause more subtle transcriptional changes. Therefore, we examined the transcriptional status of Pten +/- T cells using various methods in an attempt to test these two hypotheses. These experiments provide insight into potential mechanisms in which altered transcriptional responses of Pten +/- lymphocytes may lead to altered sensitivity towards chemokine stimulation, and ultimately, contribute to the development of autoimmunity in Pten +/- mice. 99 5.2 Results 5.2.1 Pten +/- T cells have elevated expression of an activation marker upon stimulation In order to assess potential differences in gene expression in Pten deficient T cells we analyzed the cell surface expression of CD69, an activation marker for T cells. Pten +/- and wildtype T cells were activated with plate bound anti-CD3 for 48 h and then subsequently expanded in the presence of IL-2 for 4 days. The expression of CD69 was detectable on the surface of these cells before any further stimulation reflecting the activated status of this expanded T cell subset (Figure 5.1a, left panel). Expansion followed by subsequent stimulation with 1500 ng/mL SDF-1 for 6 h causes a preferential increase in CD69 expression on the surface of Pten +/- T cells (Figure 5.1a, right panel). The dose of 1500 ng/ml SDF-1 used here reflects the optimal dose used to described differences in cellular migration responses outlined in Chapter 4. A longer time course of stimulation was carried out so that differences in expression resulting from changes in transcription could be detected. Over multiple experiments, an augmented response in CD69 expression upon SDF-1 stimulation was consistently demonstrated (Figure 5.1b). This indicates that Pten +/- cells are more sensitive to SDF-1 in terms of upregulating the expression of the activation marker, CD69. This finding also suggests that other differences in gene expression may exist in Pten deficient cells. • 100 100 1000 FL2-H: CD69 PE unstimulated 10000 "1 1 1 10 100 1000 FL2-H: CD69 PE 6h SDF 10000 60.00 media alone 6h SDF stimulation Figure 5.1. Enhanced expression of CD69 on Pten +/- T cells upon SDF-1 stimulation. Purified populations of CD4 + T cells from Pten +/- and +/+ littermates were stimulated with anti-CD3 and expanded in vitro. Expanded populations of T cells at 3 x 106 cells/mL were incubated for 6 h at 37°C in either media alone or in media supplemented with 1.5 u.g/mL SDF-1 (6h SDF). (a). Pten +/- (blue) and +/+ (red) T cells were stained with PE-conjugated anti-CD69 and analyzed by flow cytometry. One set of staining profiles representative of three independent experiments are shown, (b). The average frequency of the CD69 positive staining population from three independent experiments is shown. Error bars represent the standard error of the mean. 101 5.2.2 Microarray analysis for the assessment of the transcriptional status of Pten +/-T cells To reveal any underlying differences in gene expression that may exist in Pten deficient cells, microarray analyses of RNA isolated from Pten +/- and wildtype T lymphocytes were carried out. T lymphocytes were expanded and then treated with media, either with or without the addition of 1500 ng/mL SDF-1 for 6 h at 37°C. RNA was then immediately isolated, purified and prepared for microarray analyses. The RNA was hybridized to the first array of the Murine Genome U74Av2 from Affymetrix. Analysis was carried out to compare the signal for each transcript between wildtype and Pten +/- RNA samples. The complete lists of genes that show a greater than two-fold difference for both the unstimulated and stimulated cases are appended. In unstimulated T cells, there were 160 genes that revealed a greater than two fold alteration in message level between wildtype and Pten +/- cells. The array used for this experiment contains -6000 genes from the mouse Unigene database as well as -6000 EST clusters. Therefore, the 160 genes found to be different between the two genotypes represent a very small portion of the total numbers of genes analyzed. In addition, it was observed that most of the fold changes represented in this data set were on the same order of magnitude as a two-fold difference. In the case of SDF-1 stimulated cells, 161 genes showed differences in expression of greater than two-fold. The subset of genes that displayed varied transcript levels was different in the unstimulated case as compared to the SDF-1 stimulated situation. Our approach for the assessment of changes in gene expression in Pten +/- T cells was to use microarray analyses as an initial screen to guide our further characterization of 102 gene expression at the protein level. In this context, the microarray result presented here represents one experiment that has not been duplicated, however, all subsequent analyses of expression were carried out with a more rigorous approach to reproducibility. From this initial microarray analysis the expression of a subset of interesting genes, potentially relevant to immune function and regulation, were addressed in further experiments. The genes chosen for further analysis are summarized in Tables 5.1a and 5.1b. Further analysis of cell surface gene expression in Pten +/- T cells was carried out by flow cytometry using a FACScan instrument. A summary of the genes analyzed by FACS is presented in Tables 5.2a and 5.2b. The frequency of the positive staining population, as determined by comparison of the shift in fluorescence from negative staining populations, is reported as an average of data from multiple experiments for each gene analyzed. Any changes in surface staining that were replicated over multiple experiments were quite subtle, thus, individual FACScan staining profdes for each gene were examined individually for differences in expression. 5.2.3 Cell surface expression of CD4 and CD8 in Pten +/- T cells Microarray analysis suggested that Pten +/- CD4 + T cells might have increased transcription of CD8. In order to assess whether the cell surface expression of CD8 was altered, the expanded populations of purified CD4 + T cells used in this study were stained for CD4 and CD8 simultaneously. The populations of cells used in this study were purified using CD4 directed magnetic separation methods and typically represented a pure population of CD4 + T cells. However, analyses of CD8 expression revealed the presence of an additional CD4 +CD8 + double positive population that existed after • Table 5.1 a Altered expression of transcripts from unstimulated CD4* T cells +/- compared to +/+ fold change p-value gene follow-up technique 2.8 Increase 0.000154 CD8 FACS 2.5 Decrease 1 TGF-beta1 western blot/ELISA Table 5.1 b Altered expression of transcripts from SDF-1 stimulated" CD4+ T cells +/- compared to +/+ fold change p-value gene follow-up technique 3.2 Increase 0 CD8 FACS 2.1 Increase 0.000006 CCR5 FACS 2 Increase 0.000047 caspase-6 western blot 4.3 Decrease 0.999993 P110PI3K delta western blot 2.3-4.3 Decrease >0.999969 TCR beta (multiple)* FACS 4.3 Decrease 1 IL-2R beta FACS 'stimulation with 1.5 ng/mL SDF-1 for 6h with cells at 3x10 6 cells/mL * multiple TCR beta genes (5 distinct hits) were found to be decreased Table 5.2a Cell surface expression analysis of unstimulated CD4+ T cells +/- +/+ marker average frequency SEM average frequency SEM n# CD8 4.6 0.9 6.0 1.3 3 TCR-beta 93.0 2.6 94.1 0.9 3 CD69 37.3 1.7 35.1 1.3 3 CCR5 5.2 0.9 5.9 0.9 3 CD25 92.9 1.4 96.2 0.5 4 CD 122 29.7 1.3 34.6 3.8 2 * number of mice analyzed per genotype Table 5.2b Cell surface expression analysis of SDF-1 stimulated' CD4*T cells +/- +/+ marker average frequency SEM average frequency SEM n" CD8 3.7 0.5 6.0 1.4 3 TCR-beta 94.3 1.8 92.2 3.0 3 CD69 51.6 1.6 41.6 2.6 3 CCR5 6.9 2.1 6.5 1.2 3 CD25 92.0 1.8 97.3 0.5 4 CD 122 30.4 1.3 34.7 0.5 2 'stimulation with 1.5 ug/mL SDF-1 for 6h with cells at 3x10 6 cells/mL * number of mice analyzed per genotype 105 expansion (Figure 5.2, upper right quadrant). Unstained control cells fell completely within the lower left ungated quadrant. The gate for the double stained population was set using the single stained samples as controls. The CD4 +CD8 + population displayed two subset populations of: CD4 l oCD8 h i and CD4 h iCD8 h i T cells (Figure 5.2, upper right quadrant). There seemed to be a decrease in the CD4 h iCD8 h i subset of the CD4 +CD8 + population in Pten +/-. Furthermore, Pten +/- T cell populations seemed to display a decrease in the frequency of this CD4 +CD8 + population as compared to wildtype in both the stimulated and unstimulated cases. In addition, SDF-1 stimulated cells from Pten +/-mice seemed to show an increase in a CD4 loCD8" population of T cells as compared to wildtype. This finding was not replicated across multiple independent experiments and thus, likely reflects experimental artifact. The average CD8 + staining frequency revealed a trend of decreased staining in Pten +/- T cells. However, the large standard error of the mean (SEM) for this data, resulting from variability between the different isolations, revealed that this decrease in expression is not very significant (Table 5.2a,b). Thus, peripheral CD4 + T cells from Pten +/- mice, which normally should not express CD8, may have slight alterations in the control of CD8 levels on the cell surface. 5.2.4 Cell surface expression of TCRJ3 in Pten +/- T cells Expression of the T cell receptor (TCR) is important for normal development and the activation of T lymphocytes. Our initial screen for changes in gene expression in Pten +/- T cells revealed a depression in the level of several TCR (3 chain genes after SDF-1 treatment. Functional expression of the TCR requires rearrangement of both the a/p chains. (3 chain rearrangement occurs during T cell development and precedes • 106 FL2-H: CD4 PE Figure 5.2. Cell surface staining of CD4 and CD8 on Pten +/- T cells. Purified populations of CD4 + T cells from Pten +/- and +/+ littermates were stimulated with anti-CD3 and expanded in vitro, (a). Expanded populations of T cells at 3 x 106 cells/mL were incubated for 6 h at 37°C in media alone. Pten +/- (right panel) and +/+ (left panel) T cells were stained with PE-conjugated anti-CD4 in combination with FITC-conjugated anti-CD8 and analyzed by flow cytometry, (b). T cells were incubated for 6 h at 37°C in media supplemented with 1.5 ug/mL SDF-1 and stained as described. The staining profiles shown are representative of three independent experiments. 107 selection events. Functional (3 chain protein production suppresses the rearrangement of other (3 chain transcripts in any given lymphocyte; however, multiple P chains are represented in the total immune repertoire. In order to assess the cell surface expression of all TCR P chains in Pten +1- T cells, an antibody that reacts with the common epitope of the P chain of the TCR was used in FACScan analyses. In both unstimulated and SDF-1 stimulated cells the same peak level of TCR P chain expression was observed (Figure 5.3). Unstained wildtype T cells contained a subset of cells with slightly decreased levels of TCR P chain that was absent from Pten +/- cells (Figure 5.3a). In contrast, Pten +/- T cells stimulated with 1500 ng/ml SDF-1 for 6 h, contained a small subset of cells that showed slightly decreased levels of TCR P chain expression that was not present in wildtype cells (Figure 5.3b). This pattern of expression was replicated in 2 of 3 independent experiments. The slight decrease in TCR P chain expression seen in Pten +/- upon SDF-1 stimulation confirms the microarray results. Taken together, these results led us to believe that the change in functional TCR P chain expression, if any, is very small in Pten deficient cells. 5.2.5 Cell surface expression of IL-2 receptor subunits in Pten +/- T cells Activated T cells synthesize the T cell growth factor interleukin-2 (IL-2) and its receptor. On resting T cells, only the p and y chains of the IL-2 receptor (IL-2R) are expressed. T cell activation induces the synthesis of the IL-2R a chain. Since microarray analysis of Pten +/- T cells indicated that a difference in IL-2R chain expression might exist after SDF-1 stimulation, we assessed the levels of IL-2R a and P chains. An antibody specific • 108 a. o i q i 1 10 100 1000 10000 FL2-H: TCR beta ""I I I 10 100 1000 10000 FL2-H: TCR beta Figure 5.3. TCRbeta cell surface staining on Pten +/- T cells. Purified populations of CD4 + T cells from Pten +/- and +/+ littermates were stimulated with anti-CD3 and expanded in vitro, (a). Expanded populations of T cells at 3 x 106 cells/mL were incubated for 6 h at 37°C in media alone. Pten +/- (blue) and +/+ (red) T cells were stained with PE-conjugated anti-TCRbeta and analyzed by flow cytometry, (b). T cells were incubated for 6 h at 37°C in media supplemented with 1.5 ug/mL SDF-1 and stained as described. The staining profiles shown are representative of three independent experiments. 109 to the IL-2R (3 chain, designated CD 122, detected low levels of [3 chain expression that appeared equivalent when Pten +/- staining profiles were compared to that of wildtype cells (Figure 5.4a, left panel). Representative FACScan profiles were obtained from cells stimulated with 1500 ng/mL SDF-1 for 6 h and unstimulated cells reproducibly showed similar staining patterns to that shown in Figure 5.4a. An antibody specific to the IL-2R a chain, designated CD25, detected high levels of expression in both Pten +1- and wildtype T cells reflecting the activated status of this expanded population of lymphocytes (Figure 5.4a, right panel). Although a slight decrease was evident in CD25 expression, data from multiple experiments showed no significant decrease in either IL-2R chain expression in the Pten +/- cells (Figure 5.4b). 5.2.6 Cellular expression of caspase-6 in Pten +/- T cells An examination of any differences in protein expression in Pten +/- T cells was carried out using western blot analyses for several of the interesting candidates revealed in the initial microarray experiment. Activation of the caspase family proceeds requires cleavage of the pro-enzymes into an active complex of a large subunit and a small subunit. These activated caspases are responsible for initiating and mediating the complex cellular processes of apoptosis. Activation of apoptosis by cell death receptors such as tumor necrosis factor-a (TNF-a), FAS, or CD95 induces a cascade of caspase cleavage events that includes activation of the upstream caspases-8 and -10. In a parallel pathway, cytochrome-c release causes the activation of caspase-9. The cleavage and activation of these upstream caspases causes further downstream activation of caspases-3 and -7. Caspase-3 and -7 activation lead to events associated with cell death including • 110 a. 1001 100T b. 45 4 0 1 35 30 t 25 e > ? 2 0 o a 1 5 a o 1 0 a+i-• +/+ T 10 100 CD122-PE 1000 S 601 "1 ' ' ' ' " " I 10 100 CD25-PE 1000 10000 unstimulated 6h SDF unstimulated 6h SDF Figure 5.4. Reduced expression of IL-2 receptor chains on Pten +1- T cells upon SDF-1 stimulation. Purified populations of CD4 + T cells from Pten +/- and +/+ littermates were stimulated with anti-CD3 and expanded in vitro. Expanded populations of T cells at 3 x 10A cells/mL were incubated for 6 h at 37°C in either media alone or in media supplemented with 1.5 Ug/mL SDF-1 (6h SDF). (a). Pten +/- (blue) and +/+ (red) T cells were stained with either PE-conjugated anti-CD122 (left panel) or PE-conjugated anti-CD25 (right panel) and analyzed by flow cytometry. The staining profiles shown for CD25 are representative of four independent experiments whereas the C D 122 experiments were preformed in duplicate. The representative F A C S profiles shown in (a) are taken from the 6h SDF-1 stimulation experiment, (b). The average frequency of the C D 122 and CD25 positive staining populations from multiple independent experiments is shown. Error bars represent the standard error of the mean. I l l caspase-6 activation, PARP cleavage and DNA fragmentation. In Pten +/- cells, there was a marginal increase in the level of caspase-6 expression (Figure 5.5b). Immunblotting using an antibody raised against the residues surrounding the cleavage site of caspase-6 detected a 35 kDa band that represented the uncleaved form of this enzyme (Figure 5.5a). Equal loading of western blots was determined by parallel immunoblot analyses using an antibody against tx-tubulin. Because of blot-to-blot variability, the increase in caspase-6 observed was not significant. The detection of marginal increases in caspase-6 protein levels in Pten +/- T cells, however, is consistent with microarray result that suggests that increased caspase-6 transcripts were present in unstimulated Pten +/- T cells. The antibody used for this analysis reacts with both the full length and cleaved small subunit of caspase-6. In our experiments, very little evidence of any cleavage product of caspase-6 was observed in either wildtype or Pten +/- cells. Caspase-3 is an important upstream activator of caspase-6 and a central mediator of the apoptotic response. We checked by western blot for any differences in caspase-3 expression or activation in Pten +/- T cells. No difference in the level of expression of either the cleaved or uncleaved form of caspase-3 was observed in unstimulated Pten +/- T cells as compared to wildtype (data not shown). Thus, in T cells we did not see evidence for any major effects of Pten deficiency on the level of expression of several important caspases. 5.2.7 Cellular expression of PI3K pi 108 in Pten +/- cells Our initial microarray screen indicated that an isoform of the catalytic subunit of PI3K, pi 10 8, might be decreased in Pten +/- T cells. The potential regulation of expression levels of PI3K may reveal interesting feedback regulation mechanisms that • 112 a. SDF Caspase-6> otu bulin^ +/- +/+ E O > 18000 16000 14000 12000 10000 8000 6000 4000 2000 0 unstimulated B+/. • +/+ 6h SDF caspase-6 Figure 5.5. Expression of Caspase-6 in Pten +/- T cells. Purified populations of CD4 + T cells from Pten +/- and +/+ littermates were stimulated with anti-CD3 and expanded in vitro. Expanded populations of T cells at 3 x 10 6 cells/mL were incubated for 6 h at 37°C in either media alone (-) or in media supplemented with 1.5 Ug/mL SDF-1 (+). (a). Representative blots from parallel immunoblot analyses using either an antibody specific for Caspase-6 or an antibody against oc-tubulin. (b). Densitometric analysis derived from four independent experiments. Bars represent the mean densitometric values (adj volume) and SEM of Caspase-6 levels assessed by immunoblot analyses. 113 exist in Pten deficient cells to control this centrally important signaling pathway. To further investigate this possibility, we analyzed the expression of PI3K using an antibody that reacts with all isoforms of the catalytic subunit of PI3K. No differences in PI3K expression using this broad-specificity antibody when wildtype and Pten +/- cells were compared (data not shown). Using a more specific antibody, we detected a 110 kDa band that corresponds to the 8 isoform of the PI3K catalytic subunit (Figure 5.6a). Parallel immunoblot analysis using an antibody against oc-tubulin was carried out to determine that equivalent amounts of protein were loaded in each lane. No major differences in expression between Pten +/- and wildtype cells were observed in this isoform specific analysis of PI3K expression. Analysis of multiple experiments using densitometry revealed a slight increase in PI3K pi 10 8 expression in Pten +/- T cells (Figure 5.6b). These results indicated that although some slight alterations may exist in the expression of the 8 isoform of PI3K, there is no major alteration in the expression of PI3K that could account for altered sensitivity of Pten +/- cells to PI3K-mediated signaling events. • 114 a. +/- +/+ SDF + - + unstimulated 6h SDF PI3K p110 delta Figure 5.6. Expression of the delta isoform of the PI3K catalytic subunit in Pten +/- T cells. Purified populations of CD4 f T cells from Pten +/- and +/+ littermates were stimulated with anti-CD3 and expanded in vitro. Expanded populations of T cells at 3 x 10A cells/mL were incubated for 6 h at 37°C in either media alone (-) or in media supplemented with 1.5 Ug/mL SDF-1 (+). (a). Representative blots from parallel immunoblot analyses using either an antibody specific for the delta isoform of the PI3K. catalytic subunit or an antibody against oc-tubulin. (b). Densitometric analysis derived from four independent experiments. Bars represent the mean densitometric values (adj volume) and SEM of PI3K pi 10 delta levels assessed by immunoblot analyses. 115 5.3 Discussion Transcriptional regulation is an important mechanism for control of gene expression. Extracellular signals are carried through the cell through a network of signaling pathways that regulate transcription factors. This complex network of transcription factors can then modulate the expression of other genes as well as their own expression. Changes in gene expression can lead to altered cellular responsiveness to external stimuli. We have observed that Pten deficient lymphocytes have an altered sensitivity to SDF-1 stimulation that likely resulted from dysregulation of PI3K and PKB. SDF-1 stimulation has been shown to induce changes in transcription and functional gene expression (Suzuki et a l , 2001b). Additionally, PI3K and PKB have been shown to be important upstream modulators of many transcription factors (Brunet et al , 2001). Greatly altered gene transcription in Pten +/- T cells could potentially provide a mechanism to explain the altered cellular responsiveness to SDF-1 that we observed. Our results indicated that no drastic baseline changes in gene expression existed, at the timepoints sampled and within the genes assessed, in Pten +/- lymphocytes, under the conditions that were evaluated. Instead, it is likely that altered sensitivity to SDF-1 and dysregulation of PI3K and PKB signaling that occurs in Pten +/- lymphocytes resulted in the subtle changes in gene expression that we observed. As discussed below, subtle changes in gene expression could be relevant to the altered cellular responsiveness of Pten +/- lymphocytes, potentially contributing to the development of autoimmunity in Pten +/- mice. CD69 is an early activation marker that displays rapid but transient surface expression after TCR stimulation (Testi et al , 1994). CD69 induces IL-2 production and 116 lymphocyte proliferation (Risso et al , 1991). We found that CD69 expression was high on the lymphocyte populations used in our experiments. This high level of expression is expected because of the stimulation protocol used during expansion of this lymphocyte population. We found that CD69 expression was further elevated on Pten +/-lymphocytes after SDF-1 stimulation whereas the expression of CD69 on wildtype cells was unchanged. CD69 is a type II transmembrane glycoprotein that is part of a family of proteins, which include similar receptors expressed on NK cells (Testi et a l , 1994). The putative ligand for CD69 has not yet been identified and consequently little is known about its molecular function. However, CD69 generates intracellular signals resulting in various cellular responses. For example, CD69 crosslinking can induce proliferation, induce cytotoxic activity of NK cells, cause an influx of Ca2+ intracellularly, induce the phosphorylation and activation of MAPK, stimulate the activity of PKC, and cause transcriptional regulation of IL-2 and other cytokine levels (Conde et al , 1996; Risso et al , 1991; Testi et a l , 1994; Zingoni et a l , 2000). Thus, CD69 is an important signaling molecule even though the precise molecular action of CD69 remains ill defined. An alteration in the expression of CD69 in Pten +/- cells could lead to diverse signaling events that might affect the responsiveness of the cell to SDF-1. The expression of CD69 itself is controlled at a transcriptional level. The upstream promoter sequence for CD69 contains binding sites for multiple transcription factors including: N F K B , Egr-1, AP-1, Oct-1/2, PU-1, and GATA family members (Lopez-Cabrera et al , 1995; Testi et a l , 1994). The regulation of several of these transcription factors has been linked to PI3K and PKB. In particular, dsyregulation of PI3K activation that occurs as a result of Pten deficiency in lymphocytes could result in 117 alterations in the transcriptional response of NFkB accounting for the increased expression of CD69 that we observed (Mayo et a l , 2002). It has been suggested that the rapid cell surface expression of CD69 is likely due to translocation of the molecules already present in the cytoplasm because of findings that the expression of CD69 does not require RNA or protein synthesis (Risso et a l , 1991). However, other reports suggest that protein and RNA synthesis is required for CD69 expression (Cebrian et al , 1989; Testi et al , 1989). If CD69 expression is independent of mRNA synthesis this might explain the apparent discrepancy between the absence of any increase in CD69 transcripts detectable in the microarray experiment and the increase in cell surface expression detected by FACScan analyses. Revisiting possible functional roles of CD69 in lymphocytes provides further evidence about how enhanced expression of CD69 may result in altered responses from Pten +/- cells. Experiments with transgenic mice expressing CD69 in the thymus uncovered a role for CD69 in T cell trafficking (Feng et al , 2002). In these transgenics, CD69+ cells accumulated in the thymus presumably due to a defect in the migration of these maturing thymocytes out of the thymic environment. In the context of Pten +/- thymocytes, an increase in CD69 expression that occurs in combination with the migratory signal provided by SDF-1 may result in a trafficking defect that explains why lymphocytes accumulate in the lymph nodes of Pten +/- mice. Additionally, evidence from these CD69+ transgenics suggests that CD69 may function to augment chemotaxis initiated by certain chemokine receptors (Feng et a l , 2002). This hypothesis is particularly attractive in light of the augmented sensitivity of Pten +/-lymphocytes to SDF-1 that we have demonstrated. Al l together this evidence provides rationale for Pten deficiency causing increases in CD69 expression possibly through 118 control of PI3K dependent transcription factors and allows speculation on how altered expression of this activation marker may contribute to the phenotypes seen in Pten +/-lymphocytes. IL-2 is a pivotal growth factor for T cells that plays a dual role in the immune system by activating naive T cell, promoting rapid clonal expansion, as well as inducing apoptosis of antigen activated T cells (Gaffen, 2001). Attesting to the importance of this signal for immune homeostasis, mice deficient the capacity to transmit IL-2 signals develop autoimmunity and severe immunodeficiency (Sadlack et al , 1993; Schorle et a l , 1991; Suzuki et a l , 1995; Willerford et al , 1995). The expression of members of the IL-2 receptor complex is one point at which response to IL-2 can be regulated (Gaffen, 2001). The JJL-2 receptor is a multi-subunit receptor made up of the IL-2R.OC, IL-2RP and yc chains. The IL-2RP and yc chains form the functional signaling unit of the receptor. Although not capable of signaling alone, the IL-2Ra chain is responsible for sensitizing the receptor to IL-2. Regulation of expression of the IL-2Ra occurs by a feedback autocrine loop in which the initial IL-2 signal activates STAT5 binding to the promoter sequence of IL-2Roc and initiates increased transcription of the IL-2Rcc subunit (Lecine et al , 1996). Thus, transcription regulation of the LL-2Ra subunit is an important mechanism for control of IL-2 responsiveness. Normally, IL-2Ra is not detectable on unstimulated cells but becomes upregulated upon T cell activation to act as a key regulator of the IL-2 response (Soldaini et al , 1995). Our analysis of IL-2R chain expression revealed very high levels of IL-2Ra on the surface of both Pten +/- and wildtype cells. Pten +/- T cells were expanded in the presence of IL-2 and although they showed high levels of expression of IL-2Ra, there was no change in either the mRNA 119 levels or the cell surface expression of IL-2Ra on Pten +/- T lymphocytes as compared to wildtype cells. CD25, or IL-2Ra is often used alongside CD69 as an activation marker of T cells, however in Pten +/- T cells increases in CD69 levels seen after SDF-1 exposure were not mirrored by any change in IL-2Roc expression, likely reflecting differences in the mechanisms of regulation of these two markers. IL-2R (3-chains are constitutively expressed on T cells at rest, and like IL-2Ra, are induced by stimulation, albeit to a much lesser degree (Tanaka et a l , 1991). Using microarray techniques we noted that IL-2R(3 transcripts were potentially decreased in Pten +/- T lymphocytes. We found low levels of cell surface expression of IL-2RJ3 in both Pten +/- and wildtype CD4 + T cells. This is in keeping with normal levels of IL-2R(3 expression in the murine lymphoid system, where it has been observed that IL-2RP +CD4 + cells are infrequent (Tanaka et al , 1991). Control of IL-2R subunits is transcriptionally regulated by multiple elements including Egr-1, Elf-1, NFkB and NF-AT (Kim et al , 2001; Lin and Leonard, 1997; Schuh et a l , 1998). It is possible that in Pten deficient lymphocytes the subtle decreases in IL-2R subunit expression at the transcript level are functionally insignificant. However, it is also possible that this subtle decrease in IL-2R transcripts is part of a negative feedback loop where the increased sensitivity of Pten deficient cells is countered by decreased expression of the IL-2R. Alternatively, Pten deficiency could lead to dsyregulation of the proper transcriptional responses initiated upon stimulation leading to less efficient expression of the IL-2R components. In a similar fashion, we observed decreased levels of TCRP in Pten +/- T cells upon stimulation. This work brings up the question of whether Pten +/- lymphocytes would have altered sensitivity to IL-2 and other T cell stimuli. T cell specific targeting of 120 Pten demonstrated an increased proliferative response of Pten00"7" cells in response to IL-2 stimulation (Suzuki et al , 2001a). Although we observed no differences in the proliferative capacity of Pten +/- cells cultured in IL-2 after CD3 stimulation, it is possible that Pten +/- lymphocytes could have altered sensitivity to IL-2 and TCR activation in vivo. This possibility requires further experiments and provides another way in which Pten deficiency could lead to disease through alterations in the sensitivity of lymphocytes to T cell stimulation during the immune response. During the analysis of transcripts from Pten +/- T cells, we noted a change in the levels of CD8 transcripts. This was particularly striking because the cell population used for analysis was CD4 + and normally T cells isolated from the periphery express either CD4 or CD8. This prompted us to examine the cell surface expression of both CD4 and CD8 in our population of T cells that was used for expression analyses. FACScan analyses revealed the existence of a CD4 +CD8 + population in both Pten +/- and wildtype T cell isolates. Furthermore, we observed a decrease in the number of CD4 +CD8 + cells present in the expanded Pten +/- lymphocyte population. Others have also observed this CD4 +CD8 + T cell population in the periphery (Falk et al , 1996). During the staining protocol cells were preincubated with Fc block. Thus, it is unlikely that the staining seen here resulted from non-specific FcR:antibody interactions. Any difference in the starting lymphocyte populations that were used in these experiments is a potential cause for concern. The contaminating CD4 +CD8 + population that is present is likely an artifact of the purification scheme used here. It is possible that this contaminating population may be responsible for any discrepant results seen at the transcript level. Our strategy was to use microarray analysis as an initial screen followed by more robust analyses of 121 expression by other methods. It is possible that the non-equivalency of the Pten +/- and wildtype populations that is suggested by the CD4 +CD8 + FACScan profdes could account for some of the subtle differences in expression that we observe. Thus, the results presented here may serve as indicators for interesting differences in gene expression that may exist in Pten +/- lymphocytes. Using this strategy for identification of changes in gene expression in Pten +/-lymphocytes, we identified several other interesting candidates. TGFP transcript levels were decreased in Pten +/- T cells, which correlated with other findings of a regulatory role of TGF(3 in Pten expression (Ebert et al , 2002; Li and Sun, 1997; Stolarov et a l , 2001). Experiments attempting to validate this finding were unsuccessful with levels of TGFP that were undetectable by ELISA in our samples. In our screen of interesting candidates, genes in which cell surface expression could be easily tested were given precedence. Further experimentation would be necessary to determine whether TGFp protein levels are indeed altered in Pten +/- lymphocytes, and although interesting, this result was not pursued any further in the work presented here. Another candidate was the chemokine receptor CCR5. CCR5 plays a role in chemotaxis and can be induced by SDF-l(Gotoh et a l , 2001). Transcription factors such as NFkB mediate the transcriptional regulation of CCR5 (Liu et a l , 1998). However, no change in expression level of CCR5 was observed on the cell surface of Pten +/- cells, as compared to wildtype cells. This result highlights the discrepancy between the results obtained from the different gene expression methods used in our strategy. Because of the reproducibility issues introduced by our strategy of using the microarray method as a primary screen, we have the potential to see false positive results such as these. There is also the potential 122 that our microarray screen will miss interesting candidates because of the inherent limitations of current microarray technology. Nonetheless, this technique offers exciting potential for the analysis of gene expression. Another interesting candidate for potential alteration in expression in Pten +1-cells was caspase-6. Caspase-6 is known to coordinate the execution phase of apoptosis (Slee et al , 2001). Presumably, Pten +/- cells have increased cell survival signaling because of an inability to downregulate PI3K mediated activation of PKB. Upregulation of caspase-6 in Pten deficient cells may be part of a compensatory mechanism by which the cell death threshold of the cell could be lowered (MacLachlan and El-Deiry, 2002). Caspase-3 is the primary executioner caspase thought to be responsible for the actual destruction of the cell whereas caspase-6 plays a more minor or perhaps more specialized role (Slee et a l , 2001). In Pten +/- cells, we found no change in the level of caspase-3 expression or activation by cleavage. Although we cannot rule out the possibility, it appears unlikely that control of caspase expression plays a major role in Pten deficient cells. The last candidate that showed interesting patterns of gene expression in Pten +/-T cells was the delta isoform of the catalytic subunit of PI3K. Class la PI3Ks have two widely distributed isoforms of pi 10 known as a and (3 as well as pi 105 (Fruman et a l , 1998). pi 108 is expressed at high levels in lymphocytes and lymphoid tissues and may therefore play a role in PI3K mediated signaling in the immune system (Chantry et al , 1997; Clayton et a l , 2001; Vanhaesebroeck et a l , 1997). Our initial microarray screen indicated that pi 108 transcripts were diminished in Pten +/- T cells. In contrast, our analysis at the level of protein expression revealed no change in overall levels of pi 10 123 expression and perhaps a mild increase in pi 108 expression in Pten +/- T cells. It is unclear to what extent PI3K isoforms have overlapping or distinct biological roles. Monoclonal antibody experiments, in which specific isoforms of pi 10 were inactivated, indicated a role for pi 108 and not the other isoforms in actin reorganization and cellular migration (Vanhaesebroeck et a l , 1999). Thus enhanced expression of pi 108 in Pten +/-T cells could provide increased capacity to respond to migratory stimulus. The unique role of pi 108 in the immune system is supported by evidence showing that antigen receptor signaling is impaired in pi 108 PI3K mutant mice (Okkenhaug et a l , 2002). Thus, altered expression of pi 108 could modify the threshold of activation of Pten deficient lymphocytes resulting in the enhanced responsiveness of Pten +/- lymphocytes that we postulate contributes to the development of autoimmunity in the Pten +/- mice. In this chapter, we have identified several interesting candidate genes, whose modulation of expression might be relevant in Pten +/- lymphocytes. Several methods of expression analyses were used in our experimental design. Initially, analysis of gene expression at the transcript level was done by microarray analyses. This was followed by an assessment of gene expression at the protein level using techniques such as flow cytometry and western blot analyses. In some cases, our results showed a discrepancy between the trends seen at the transcript level as compared to that seen at the protein level. In the evaluation of these results, it is important to consider potential reasons for this discrepancy as well as the limitations that are imposed by our experimental design. In the cell, it is normal that transcript levels may not be exactly correlated with levels of protein expression. Processes controlling mRNA versus protein stability are independently regulated and may lead to these differences. Similarly, there are many 124 levels at which gene expression is regulated, each with potential contributions to the discrepancy between transcript and protein levels. Alternative splicing, transcript modification, and messenger RNA half-life may all play a role in the regulation of transcript levels. Regulation of translation as well as post-translational modifications may change the level of expression seen at the protein level. Thus, it is possible that our results reflect real changes and the discrepancy between the protein and transcript data sets is because of these biological phenomena. It is also possible that the delay between transcription and translation, at the 6h time point used for these experiments, provides an inherent difference in transcript versus protein levels. In this case, examination of a time course of expression extended out to later time points would be preferred. The specialized expression of distinct gene networks in different cell types also imposes certain limitations. Changes in gene expression reported in other fibroblast-based assays may not be reflected in the Pten +/- lymphocyte system. Other limitations are imposed by the design of our experiment. Using microarray data, obtained from a single experiment, provides data limited by the success of that particular microarray experiment. The subset of genes effectively tested for expression may vary from experiment to experiment and may not reflect the entire gene pool contained on the array. Small trends or changes in genes with low levels of expression may not be represented in a single experiment. The data obtained from our microarray experiment was a list of genes that were changed by more than two-fold between the different genotypes under certain conditions. This data is limited in its predictive value. For instance, individual genes which would predicted to be changed in Pten +/- cells are not represented in this data set if the change is not more than two-fold. The absence of a 125 difference in gene expression, in our data set, does not mean that the transcript would not be changed across multiple microarray experiments. For example, even though we have shown a reduction in Pten protein levels in Pten +/- cells, the Pten transcript was not present in our gene lists. In this case, it is likely that an examination of the individual data points for the Pten transcript would reveal a decrease of less than 2-fold in Pten +/-cells. Multiple repeats of microarray experiments can provide the experimental rigor that is required to prove or disprove hypotheses. However, the issue becomes the trade off between the increased cost of additional microarray experiments and the limitations of the approach described here. In order to assess whether the changes in gene expression that we have observed are real or apparent, we must consider all of these above factors. We have come to the conclusion that the assessment of gene expression using microarrays, even with limited scale analyses, can be a very powerful technique. Microarray experiments can rapidly provide a large list of interesting candidate genes for further experimentation. A strategy similar to that presented here could be very powerful especially when coupled with complementary techniques, such as RT-PCR, which can rapidly verify test individual transcript levels. More robust microarray analyses of Pten +/- lymphocytes would also offer the ability to predict Pten dependent changes in gene expression and would even allow the coordinate analysis of changes in networks of gene expression. Thus, microarray analysis is a powerful technique, which within the capacity used here, has allowed us to generate several interesting candidate genes whose regulation might be altered in Pten +/- lymphocytes. 126 Chapter 6. Thesis Summary 6.1 Summary In this thesis, we have shown that Pten plays a role in the regulation of normal lymphocyte function. We have characterized immune perturbations that exist in Pten +/-animals. In particular, we observed enlargement of the lymph nodes that was accompanied by splenomegaly that affected aged females with the.greatest severity. We also observed elevated levels of serum immunoglobulin and an increased capacity of Pten +/- B cells to respond to stimulation. These features were placed in the context of the autoimmune disease that has been described in Pten +/- mice (Di Cristofano et al , 1999). In an effort to gain insight into the mechanism by which Pten deficiency results in autoimmunity, we examined Pten +/- lymphocytes in greater detail. Decreased levels of Pten protein in lymphocytes resulted in enhanced chemotaxis induced by SDF-1. SDF-1 stimulation also increased phosphorylation of PKB in Pten +/- lymphocytes. This observation likely accounts for the molecular mechanism by which Pten deficient lymphocytes are more responsive to chemokine stimulation since no change in the chemokine induced phosphorylation of MAPK or chemokine receptor level expression was detected in Pten +/- cells. Enhanced sensitivity to chemokine stimulation may underlie the deregulation of normal lymphocyte homeostasis that occurs during the development of autoimmunity in Pten +/- mice. The effect of Pten deficiency on transcription was also examined in T lymphocytes. We observed that basal transcription levels were largely unchanged in Pten +/- CD4 + T cells as compared to wildtype cells. However, mild perturbations in gene expression were observed in Pten +/- lymphocytes. Increased levels of SDF-1 induced expression of the early activation marker CD69 were 127 observed in Pten +/- cells. Changes in gene expression demonstrated another altered response of Pten +/- lymphocytes. Altered responsiveness of Pten +/- lymphocytes results in deregulation of several key processes and might contribute to the aberrant activation and regulation of lymphocytes that occurs in autoimmune disease. 6.2 Future Directions In light of the results presented here, several new avenues for experimentation exist. In order to further examine the extent of immune dysregulation that occurs in Pten +/- animals, it would be interesting to challenge these animals with antigen. During the progression of an active immune response additional regulatory roles for Pten may be revealed. Further experiments to clarify the role of Pten in mammalian cell chemotaxis would also be interesting. New evidence has emerged that suggest Pten plays a role in the maintenance of cell polarity during cellular migration in Dictyostelium (Funamoto et al , 2002; Iijima and Devreotes, 2002). A closer examination of the directionality and polarity of Pten +/- lymphocytes using real-time imaging techniques would clarify the role that Pten plays in mammalian cellular migration. Additionally, experiments with mutant mice that express the lipid kinase defective form of Pten (G129E) may further clarify the role of the protein phosphatase activity of Pten and the FAK/SHC pathways in chemotaxis. Lastly, our work has provided evidence that the regulation of expression of certain genes may be altered in Pten +/- lymphocytes. Further experiments to determine the functional significance of these modifications may provide further insight into mechanisms by which Pten deficiency alters cellular responses. 128 Chapter 7: References Ali , I. U , Schriml, L. M , and Dean, M . (1999). Mutational spectra of PTEN/MMAC1 gene: a tumor suppressor with lipid phosphatase activity. J Natl Cancer Inst 91, 1922-1932. Anderson, G , Moore, N . C , Owen, J. J , and Jenkinson, E. J. (1996). Cellular interactions in thymocyte development. Annu Rev Immunol 14, 73-99. Baggiolini, M . (1998). Chemokines and leukocyte traffic. Nature 392, 565-568. Baird, A. M , Gerstein, R. M , and Berg, L. J. (1999). The role of cytokine receptor signaling in lymphocyte development. Curr Opin Immunol 11, 157-166. Biggs, W. H , 3rd, Meisenhelder, J , Hunter, T , Cavenee, W. K , and Arden, K. C. (1999). Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1. Proc Natl Acad Sci U S A 96, 7421-7426. Bleul, C. C , Farzan, M , Choe, H , Parolin, C , Clark-Lewis, I, Sodroski, J , and Springer, T. A. (1996). The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature 382, 829-833. Borlado, L. R , Redondo, C , Alvarez, B , Jimenez, C , Criado, L. M , Flores, J , Marcos, M . A , Martinez, A. C , Balomenos, D , and Carrera, A. C. (2000). Increased phosphoinositide 3-kinase activity induces a lymphoproliferative disorder and contributes to tumor generation in vivo. Faseb J 14, 895-903. Brunet, A , Bonni, A , Zigmond, M . J , Lin, M . Z , Juo, P , Hu, L. S, Anderson, M . J , Arden, K. C , Blenis, J , and Greenberg, M . E. (1999). Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96, 857-868. Brunet, A , Datta, S. R , and Greenberg, M . E. (2001). Transcription-dependent and -independent control of neuronal survival by the PI3K-Akt signaling pathway. Curr Opin Neurobiol 11, 297-305. Cardone, M . H , Roy, N , Stennicke, H. R , Salvesen, G. S, Franke, T. F , Stanbridge, E , Frisch, S, and Reed, J. C. (1998). Regulation of cell death protease caspase-9 by phosphorylation. Science 282, 1318-1321. Cebrian, M , Miguel Redondo, J , Lopez-Rivas, A , Rodriguez-Tarduchy, G , De Landazuri, M . O , and Sanchez-Madrid, F. (1989). Expression and function of AIM, an activation inducer molecule of human lymphocytes, is dependent on the activation of protein kinase C. Eur J Immunol 19, 809-815. 129 Chantry, D , Vojtek, A , Kashishian, A , Holtzman, D. A , Wood, C , Gray, P. W , Cooper, J. A., and Hoekstra, M . F. (1997). pllOdelta, a novel phosphatidylinositol 3-kinase catalytic subunit that associates with p85 and is expressed predominantly in leukocytes. J Biol Chem 272, 19236-19241. Clayton, E , McAdam, S, Coadwell, J , Chantry, D , and Turner, M . (2001). Structural organization of the mouse phosphatidylinositol 3-kinase pllOd gene. Biochem Biophys Res Commun 280, 1328-1332. Comer, F. I, and Parent, C. A. (2002). PI 3-kinases and PTEN: how opposites chemoattract. Cell 109, 541-544. Conde, M , Montano, R , Moreno-Aurioles, V. R , Ramirez, R , Sanchez-Mateos, P , Sanchez-Madrid, F , and Sobrino, F. (1996). Anti-CD69 antibodies enhance phorbol-dependent glucose metabolism and Ca2+ levels in human thymocytes. Antagonist effect of cyclosporin A. J Leukoc Biol 60, 278-284. Dahia, P. L. (2000). PTEN, a unique tumor suppressor gene [In Process Citation]. Endocr Relat Cancer 7, 115-129. Datta, S. R , Dudek, H , Tao, X , Masters, S, Fu, H , Gotoh, Y , and Greenberg, M . E. (1997). Akt phosphorylation of BAD couples survival signals to the cell- intrinsic death machinery. Cell 91, 231-241. Davies, M . A , Lu, Y , Sano, T , Fang, X , Tang, P , LaPushin, R , Koul, D , Bookstein, R , Stokoe, D , Yung, W. K., et al. (1998a). Adenoviral transgene expression of MMAC/PTEN in human glioma cells inhibits Akt activation and induces anoikis [published erratum appears in Cancer Res 1999 Mar 1;59(5):1167]. Cancer Res 58, 5285-5290. Davies, M . A , Lu, Y , Sano, T , Fang, X , Tang, P , LaPushin, R , Koul, D , Bookstein, R , Stokoe, D , Yung, W. K., et al. (1998b). Adenoviral transgene expression of MMAC/PTEN in human glioma cells inhibits Akt activation and induces anoikis. [erratum appears in Cancer Res 1999 Mar 1;59(5):1167]. Cancer Research 58, 5285-5290. Di Cristofano, A , Kotsi, P , Peng, Y. F , Cordon-Cardo, C , Elkon, K. B , and Pandolfi, P. P. (1999). Impaired Fas response and autoimmunity in Pten+/- mice. Science 285, 2122-2125. Di Cristofano, A , Pesce, B , Cordon-Cardo, C , and Pandolfi, P. P. (1998). Pten is essential for embryonic development and tumour suppression. Nat Genet 19, 348-355. Ebert, M . P , Fei, G , Schandl, L , Mawrin, C , Dietzmann, K , Herrera, P , Friess, PL, Gress, T. M , and Malfertheiner, P. (2002). Reduced PTEN expression in the pancreas overexpressing transforming growth factor-beta 1. Br J Cancer 86, 257-262. 130 Falk, I, Potocnik, A. J , Barthlott, T , Levelt, C. N , and Eichmann, K. (1996). Immature T cells in peripheral lymphoid organs of recombinase- activating gene-l/-2-deficient mice. Thymus dependence and responsiveness to anti-CD3 epsilon antibody. J Immunol 156, 1362-1368. Feng, C , Woodside, K. J , Vance, B. A , El-Khoury, D , Canelles, M , Lee, J , Gress, R , Fowlkes, B. J , Shores, E. W , and Love, P. E. (2002). A potential role for CD69 in thymocyte emigration. Int Immunol 14, 535-544. Firtel, R. A , and Chung, C. Y. (2000). The molecular genetics of chemotaxis: sensing and responding to chemoattractant gradients. Bioessays 22, 603-615. Fruman, D. A , Meyers, R. E , and Cantley, L. C. (1998). Phosphoinositide kinases. Annu Rev Biochem 67, 481-507. Fruman, D. A., Snapper, S. B , Yballe, C. M , Davidson, L , Yu, J. Y , Alt, F. W , and Cantley, L. C. (1999). Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85alpha. Science 283, 393-397. Funamoto, S, Meili, R , Lee, S, Parry, L , and Firtel, R. A. (2002). Spatial and Temporal Regulation of 3-Phosphoinositides by PI 3-Kinase and PTEN Mediates Chemotaxis. Cell 709,611-623. Funamoto, S, Milan, K , Meili, R , and Firtel, R. A. (2001). Role of phosphatidylinositol 3' kinase and a downstream pleckstrin homology domain-containing protein in controlling chemotaxis in dictyostelium. J Cell Biol 753, 795-810. Gaffen, S. L. (2001). Signaling domains of the interleukin 2 receptor. Cytokine 14, 63-77. Ganju, R. K , Brubaker, S. A , Meyer, J , Dutt, P., Yang, Y , Qin, S, Newman, W , and Groopman, J. E. (1998). The alpha-chemokine, stromal cell-derived factor-1 alpha, binds to the transmembrane G-protein-coupled CXCR-4 receptor and activates multiple signal transduction pathways. J Biol Chem 273, 23169-23175. Ghosh, A. K , Grigorieva, I, Steele, R , Hoover, R. G , and Ray, R. B. (1999). PTEN transcriptionally modulates c-myc gene expression in human breast carcinoma cells and is involved in cell growth regulation. Gene 235, 85-91. Gil, E. B , Malone Link, E , Liu, L. X , Johnson, C. D , and Lees, J. A. (1999). Regulation of the insulin-like developmental pathway of Caenorhabditis elegans by a homolog of the PTEN tumor suppressor gene. Proc Natl Acad Sci U S A 96, 2925-2930. Gold, M. R , Chan, V. W , Turck, C. W , and DeFranco, A. L. (1992). Membrane Ig cross-linking regulates phosphatidylinositol 3-kinase in B lymphocytes. J Immunol 148, 2012-2022. 131 Gotoh, K , Yoshimori, M , Kanbara, K , Tamamura, H , Kanamoto, T , Mochizuki, K , Fujii, N , and Nakashima, H. (2001). Increase of R5 HIV-1 infection and CCR5 expression in T cells treated with high concentrations of CXCR4 antagonists and SDF-1. J Infect Chemother 7, 28-36. Gottschalk, A. R , Basila, D , Wong, M , Dean, N . M , Brandts, C. H , Stokoe, D , and Haas-Kogan, D. A. (2001). p27Kipl is required for PTEN-induced G l growth arrest. Cancer Research 61, 2105-2111. Gu, J , Tamura, M , Pankov, R , Danen, E. H , Takino, T , Matsumoto, K , and Yamada, K. M . (1999). She and FAK differentially regulate cell motility and directionality modulated by PTEN. J Cell Biol 146, 389-403. Gu, J , Tamura, M , and Yamada, K. M . (1998). Tumor suppressor PTEN inhibits integrin- and growth factor-mediated mitogen-activated protein (MAP) kinase signaling pathways. J Cell Biol 143, 1375-1383. Han, Y , He, T , Huang, D. R , Pardo, C. A , and Ransohoff, R. M . (2001). TNF-alpha mediates SDF-1 alpha-induced NF-kappa B activation and cytotoxic effects in primary astrocytes. J Clin Invest 108, 425-435. Hartley, S. B , Cooke, M . P , Fulcher, D. A , Harris, A. W , Cory, S, Basten, A , and Goodnow, C. C. (1993). Elimination of self-reactive B lymphocytes proceeds in two stages: arrested development and cell death. Cell 72, 325-335. Helgason, C. D , Damen, J. E , Rosten, P , Grewal, R , Sorensen, P , Chappel, S. M , Borowski, A , Jirik, F , Krystal, G , and Humphries, R. K. (1998). Targeted disruption of SHIP leads to hemopoietic perturbations, lung pathology, and a shortened life span. Genes Dev 12, 1610-1620. Helgason, C. D , Kalberer, C. P , Damen, J. E , Chappel, S. M , Pineault, N , Krystal, G , and Humphries, R. K. (2000). A dual role for Src homology 2 domain-containing inositol-5-phosphatase (SHIP) in immunity: aberrant development and enhanced function of b lymphocytes in ship -/- mice. J Exp Med 191, 781-794. Hendriks, R. W , de Bruijn, M . F , Maas, A , Dingjan, G. M , Karis, A , and Grosveld, F. (1996). Inactivation of Btk by insertion of lacZ reveals defects in B cell development only past the pre-B cell stage. Embo J 15, 4862-4872. Hong, T. M , Yang, P. C , Peck, K , Chen, J. J , Yang, S. C , Chen, Y. C , and Wu, C. W. (2000). Profiling the Downstream Genes of Tumor Suppressor PTEN in Lung Cancer Cells by Complementary DNA Microarray. Am J Respir Cell Mol Biol 23, 355-363. 132 Huang, H , Cheville, J. C , Pan, Y , Roche, P. C , Schmidt, L. J , and Tindall, D. J. (2001). PTEN induces chemosensitivity in PTEN-mutated prostate cancer cells by suppression of Bcl-2 expression. J Biol Chem 276, 38830-38836. Iijima, M , and Devreotes, P. (2002). Tumor Suppressor PTEN Mediates Sensing of Chemoattractant Gradients. Cell 109, 599-610. Jones, R. G , Parsons, M , Bonnard, M , Chan, V. S, Yeh, W. C , Woodgett, J. R , and Ohashi, P. S. (2000). Protein kinase B regulates T lymphocyte survival, nuclear factor kappaB activation, and Bcl-X(L) levels in vivo. J Exp Med 191, 1721-1734. Kandel, E. S, and Hay, N . (1999). The regulation and activities of the multifunctional serine/threonine kinase Akt/PKB. Exp Cell Res 253, 210-229. Kane, L. P , Shapiro, V. S, Stokoe, D , and Weiss, A. (1999). induction of NF-kappaB by the Akt/PKB kinase. Curr Biol 9, 601-604. Kim, C. H , Hangoc, G , Cooper, S, Helgason, C. D , Yew, S, Humphries, R. K , Krystal, G , and Broxmeyer, H. E. (1999). Altered responsiveness to chemokines due to targeted disruption of SHIP. J Clin Invest 104, 1751-1759. Kim, H. P , Kelly, J , and Leonard, W. J. (2001). The basis for IL-2-induced IL-2 receptor alpha chain gene regulation: importance of two widely separated IL-2 response elements. Immunity 75, 159-172. Kops, G. J , and Burgering, B. M . (1999). Forkhead transcription factors: new insights into protein kinase B (c-akt) signaling. J Mol Med 77, 656-665. Kops, G. J , de Ruiter, N . D , De Vries-Smits, A. M , Powell, D. R , Bos, J. L , and Burgering, B. M . (1999). Direct control of the Forkhead transcription factor AFX by protein kinase B. Nature 398, 630-634. Kwabi-Addo, B , Giri, D , Schmidt, K , Podsypanina, K , Parsons, R , Greenberg, N , and Ittmann, M . (2001). Haploinsufficiency of the Pten tumor suppressor gene promotes prostate cancer progression. Proc Natl Acad Sci U S A 98, 11563-11568. Lecine, P , Algarte, M , Rameil, P , Beadling, C , Bucher, P , Nabholz, M , and Imbert, J. (1996). Elf-1 and Stat5 bind to a critical element in a new enhancer of the human interleukin-2 receptor alpha gene. Mol Cell Biol 16, 6829-6840. Lee, M . J , Thangada, S, Paik, J. H , Sapkota, G. P , Ancellin, N , Chae, S. S, Wu, M , Morales-Ruiz, M , Sessa, W. C , Alessi, D. R , and Hla, T. (2001a). Akt-mediated phosphorylation of the G protein-coupled receptor EDG-1 is required for endothelial cell chemotaxis. Mol Cell 8, 693-704. 133 Lee, R. Y , Hench, J , and Ruvkun, G. (2001b). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957. Li , D. M , and Sun, H. (1997). TEP1, encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor beta. Cancer Res 57, 2124-2129. Li , D. M , and Sun, H. (1998). PTEN/MMAC 1 /TEP1 suppresses the tumorigenicity and induces G l cell cycle arrest in human glioblastoma cells. Proc Natl Acad Sci U S A 95, 15406-15411. Li , J , Yen, C , Liaw, D , Podsypanina, K , Bose, S, Wang, S. I, Puc, J , Miliaresis, C , Rodgers, L , McCombie, R., et al. (1997). PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer [see comments]. Science 275, 1943-1947. Li , L , and Dixon, J. E. (2000). Form, function, and regulation of protein tyrosine phosphatases and their involvement in human diseases. Semin Immunol 12, 75-84. Li , L , Liu, F , Salmonsen, R. A , Turner, T. K , Litofsky, N . S, Di Cristofano, A , Pandolfi, P. P , Jones, S. N , Recht, L. D , and Ross, A. H. (2002). PTEN in Neural Precursor Cells: Regulation of Migration, Apoptosisr and Proliferation. Mol Cell Neurosci 20, 21-29. Liliental, J , Moon, S. Y , Lesche, R , Mamillapalli, R , Li , D , Zheng, Y , Sun, H , and Wu, H. (2000). Genetic deletion of the Pten tumor suppressor gene promotes cell motility by activation of Racl and Cdc42 GTPases. Curr Biol 10, 401-404. Lin, J. X , and Leonard, W. J. (1997). The immediate-early gene product Egr-1 regulates the human interleukin- 2 receptor beta-chain promoter through noncanonical Egr and Spl binding sites. Mol Cell Biol 17, 3714-3722. Liu, Q , Sasaki, T , Kozieradzki, I, Wakeham, A , Itie, A , Dumont, D. J , and Penninger, J. M . (1999). SHIP is a negative regulator of growth factor receptor-mediated PKB/Akt activation and myeloid cell survival. Genes Dev 13, 786-791. Liu, R , Zhao, X , Gumey, T. A , and Landau, N . R. (1998). Functional analysis of the proximal CCR5 promoter. AIDS Res Hum Retroviruses 14, 1509-1519. Loetscher, P , Seitz, M , Clark-Lewis, I, Baggiolini, M , and Moser, B. (1994). Monocyte chemotactic proteins MCP-1, MCP-2, and MCP-3 are major attractants for human CD4+ and CD8+ T lymphocytes. Faseb J 8, 1055-1060. Lopez-Cabrera, M , Munoz, E , Blazquez, M . V , Ursa, M . A , Santis, A. G , and Sanchez-Madrid, F. (1995). Transcriptional regulation of the gene encoding the human 134 C-type lectin leukocyte receptor AIM/CD69 and functional characterization of its tumor necrosis factor-alpha-responsive elements. J Biol Chem 270, 21545-21551. Lu, Y , Lin, Y. Z , LaPushin, R , Cuevas, B , Fang, X , Yu, S. X , Davies, M . A , Khan, PL, Furui, T , Mao, M., et al. (1999). The PTEN/MMAC1/TEP tumor suppressor gene decreases cell growth and induces apoptosis and anoikis in breast cancer cells. Oncogene 18, 7034-7045. MacLachlan, T. K , and El-Deiry, W. S. (2002). Apoptotic threshold is lowered by p53 transactivation of caspase-6. Proc Natl Acad Sci U S A 99, 9492-9497. Maehama, T , and Dixon, J. E. (1998). The tumor suppressor, PTEN/MMAC 1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 273, 13375-13378. Maehama, T , Taylor, G. S, and Dixon, J. E. (2001). PTEN and myotubularin: novel phosphoinositide phosphatases. Annu Rev Biochem 70, 247-279. Marino, S, Krimpenfort, P , Leung, C , Van Der Korput, H. A , Trapman, J , Camenisch, I, Berns, A , and Brandner, S. (2002). PTEN is essential for cell migration but not for fate determination and tumourigenesis in the cerebellum. Development 129, 3513-3522. Marshall, A. J , Niiro, H , Yun, T. J , and Clark, E. A. (2000). Regulation of B-cell activation and differentiation by the phosphatidylinositol 3-kinase and phospholipase Cgamma pathway. Immunological Reviews 176, 30-46. Matsushima-Nishiu, M , Unoki, M , Ono, K , Tsunoda, T , Minaguchi, T , Kuramoto, H , Nishida, M , Satoh, T , Tanaka, T , and Nakamura, Y. (2001). Growth and gene expression profde analyses of endometrial cancer cells expressing exogenous PTEN. Cancer Research 61, 3741-3749. Mayo, M . W , Madrid, L. V , Westerheide, S. D , Jones, D. R , Yuan, X. J , Baldwin, A. S, Jr., and Whang, Y. E. (2002). PTEN blocks tumor necrosis factor-induced NF-kappa B-dependent transcription by inhibiting the transactivation potential of the p65 subunit. J Biol Chem 277, 11116-11125. Medema, R. PL, Kops, G. J , Bos, J. L , and Burgering, B. M . (2000). AFX-like Forkhead transcription factors mediate cell-cycle regulation by Ras and PKB through p27kipl. Nature 404, 782-787. Muller, A , Homey, B , Soto, H , Ge, N , Catron, D , Buchanan, M . E , McClanahan, T , Murphy, E , Yuan, W , Wagner, S. N., et al. (2001). Involvement of chemokine receptors in breast cancer metastasis. Nature 410, 50-56. 135 Mustelin, T , Brockdorff, J , Gjorloff-Wingren, A , Tailor, P , Han, S, Wang, X , and Saxena, M . (1998). Lymphocyte activation: the coming of the protein tyrosine phosphatases. Front Biosci 3, D1060-1096. Myers, M . P , Pass, I, Batty, I. H , Van der Kaay, J , Stolarov, J. P , Hemmings, B. A , Wigler, M . H , Downes, C. P , and Tonks, N . K. (1998). The lipid phosphatase activity of PTEN is critical for its tumor supressor function. Proc Natl Acad Sci U S A 95, 13513-13518. Myers, M . P , Stolarov, J. P , Eng, C , Li , J , Wang, S. I, Wigler, M . H , Parsons, R , and Tonks, N . K. (1997). P-TEN, the tumor suppressor from human chromosome 10q23, is a dual- specificity phosphatase. Proc Natl Acad Sci U S A 94, 9052-9057. Nagasawa, T , Hirota, S, Tachibana, K , Takakura, N , Nishikawa, S, Kitamura, Y , Yoshida, N , Kikutani, H , and Kishimoto, T. (1996). Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 382, 635-638. Nagasawa, T , Kikutani, H , and Kishimoto, T. (1994). Molecular cloning and structure of a pre-B-cell growth-stimulating factor. Proc Natl Acad Sci U S A 91, 2305-2309. Nakamura, N , Ramaswamy, S, Vazquez, F , Signoretti, S, Loda, M , and Sellers, W. R. (2000). Forkhead transcription factors are critical effectors of cell death and cell cycle arrest downstream of PTEN. Molecular & Cellular Biology 20, 8969-8982. Nakashima, N , Sharma, P. M , Imamura, T , Bookstein, R , and Olefsky, J. M . (2000). The tumor suppressor PTEN negatively regulates insulin signaling in 3T3-L1 adipocytes. J Biol Chem 275, 12889-12895. Oberlin, E , Amara, A , Bachelerie, F , Bessia, C , Virelizier, J. L , Arenzana-Seisdedos, F , Schwartz, O , Heard, J. M , Clark-Lewis, I, Legler, D. F., et al. (1996). The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV-1 [published erratum appears in Nature 1996 Nov 21;384(6606):288]. Nature 382, 833-835. Ogg, S, and Ruvkun, G. (1998). The C. elegans PTEN homolog, DAF-18, acts in the insulin receptor-like metabolic signaling pathway. Mol Cell 2, 887-893. Okkenhaug, K , Bilancio, A , Farjot, G , Priddle, H , Sancho, S, Peskett, E , Pearce, W , Meek, S. E , Salpekar, A , Waterfield, M . D., et al. (2002). Impaired B and T Cell Antigen Receptor Signaling in pll0{delta} PI 3- Kinase Mutant Mice. Science 297, 1031-1034. Pani, G , and Siminovitch, K. A. (1997). Protein tyrosine phosphatase roles in the regulation of lymphocyte signaling. Clin Immunol Immunopathol 84, 1-16. 136 Parsons, M . J , Jones, R. G , Tsao, M . S, Odermatt, B , Ohashi, P. S, and Woodgett, J. R. (2001). Expression of active protein kinase b in t cells perturbs both t and b cell homeostasis and promotes inflammation. J Immunol 167, 42-48. Peacock, J. W , and Jirik, F. R. (1999). TCR activation inhibits chemotaxis toward stromal cell-derived factor-1: evidence for reciprocal regulation between CXCR4 and the TCR. J Immunol 162, 215-223. Podsypanina, K , Ellenson, L. PL, Nemes, A , Gu, J , Tamura, M , Yamada, K. M , Cordon-Cardo, C , Catoretti, G., Fisher, P. E , and Parsons, R. (1999). Mutation of Pten/Mmacl in mice causes neoplasia in multiple organ systems. Proc Natl Acad Sci U S A 96, 1563-1568. Podsypanina, K , Lee, R. T , Politis, C , Hennessy, I, Crane, A , Puc, J , Neshat, M , Wang, PL, Yang, L , Gibbons, J., et al. (2001). An inhibitor of mTOR reduces neoplasia and normalizes p70/S6 kinase activity in Pten+/- mice. Proc Natl Acad Sci U S A 98, 10320-10325. Rawlings, D. J , Saffran, D. C , Tsukada, S, Largaespada, D. A , Grimaldi, J. C , Cohen, L , Mohr, R. N , Bazan, J. F , Howard, M , Copeland, N . G , and et al. (1993). Mutation of unique region of Bruton's tyrosine kinase in immunodeficient XID mice. Science 261, 358-361. Risso, A , Smilovich, D , Capra, M . C , Baldissarro, I, Yan, G , Bargellesi, A , and Cosulich, M . E. (1991). CD69 in resting and activated T lymphocytes. Its association with a GTP binding protein and biochemical requirements for its expression. J Immunol 146, 4105-4114. Rouault, J. P., Kuwabara, P. E , Sinilnikova, O. M , Duret, L., Thierry-Mieg, D , and Billaud, M. (1999). Regulation of dauer larva development in Caenorhabditis elegans by daf-18, a homologue of the tumour suppressor PTEN. Curr Biol 9, 329-332. Sadlack, B , Merz, H , Schorle, H , Schimpl, A , Feller, A. C , and Horak, I. (1993). Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 75, 253-261. Sallusto, F , Mackay, C. R , and Lanzavecchia, A. (2000). The role of chemokine receptors in primary, effector, and memory immune responses. Annu Rev Immunol 18, 593-620. Salvesen, H. B , MacDonald, N , Ryan, A , Jacobs, I. J , Lynch, E. D , Akslen, L. A , and Das, S. (2001). PTEN methylation is associated with advanced stage and microsatellite instability in endometrial carcinoma. International Journal of Cancer 91, 22-26. Satterthwaite, A. B , Willis, F , Kanchanastit, P , Fruman, D , Cantley, L. C , Helgason, C. D , Humphries, R. K , Lowell, C. A , Simon, M , Leitges, M., et al. (2000). A 137 sensitized genetic system for the analysis of murine B lymphocyte signal transduction pathways dependent on Bruton's tyrosine kinase. Proc Natl Acad Sci U S A 97, 6687-6692. Scheid, M . P , Huber, M , Damen, J. E , Hughes, M , Kang, V , Neilson, P , Prestwich, G. D , Krystal, G , and Duronio, V. (2002). Phosphatidylinositol(3,4,5)P3 is essential but not sufficient for PKB activation: Phosphatidylinositol(3,4)P2 is required for PKB phosphorylation at Ser473. Studies using cells from SHIP-/- knockout mice. J Biol Chem 277, 9027-9035. Scheid, M . P , and Woodgett, J. R. (2001). PKB/AKT: functional insights from genetic models. Nat Rev Mol Cell Biol 2, 760-768. Schorle, H , Holtschke, T , Hunig, T , Schimpl, A , and Horak, I. (1991). Development and function of T cells in mice rendered interleukin-2 deficient by gene targeting. Nature 352, 621-624. Schuh, K , Twardzik, T , Kneitz, B , Heyer, J , Schimpl, A , and Serfling, E. (1998). The interleukin 2 receptor alpha chain/CD25 promoter is a target for nuclear factor of activated T cells. J Exp Med 188, 1369-1373. Schulze, A , and Downward, J. (2001). Navigating gene expression using microarrays~a technology review. Nat Cell Biol 3, El90-195. Scott, P. H , Brunn, G. J , Kohn, A. D , Roth, R. A , and Lawrence, J. C , Jr. (1998). Evidence of insulin-stimulated phosphorylation and activation of the mammalian target of rapamycin mediated by a protein kinase B signaling pathway. Proc Natl Acad Sci U S A 95, 7772-7777. Servant, G , Weiner, O. D , Herzmark, P , Balla, T , Sedat, J. W , and Bourne, H. R. (2000) . Polarization of chemoattractant receptor signaling during neutrophil chemotaxis. Science 287, 1037-1040. Shan, X , Czar, M . J , Bunnell, S. C , Liu, P , Liu, Y , Schwartzberg, P. L , and Wange, R. L. (2000). Deficiency of PTEN in Jurkat T cells causes constitutive localization of Itk to the plasma membrane and hyperresponsiveness to CD3 stimulation. Molecular & Cellular Biology 20, 6945-6957. Signoret, N , Oldridge, J , Pelchen-Matthews, A , Klasse, P. J , Tran, T , Brass, L. F , Rosenkilde, M . M , Schwartz, T. W , Holmes, W , Dallas, W., et al. (1997). Phorbol esters and SDF-1 induce rapid endocytosis and down modulation of the chemokine receptor CXCR4. J Cell Biol 139, 651-664. Simpson, L , Li , J , Liaw, D , Hennessy, I , Oliner, J , Christians, F , and Parsons, R. (2001) . PTEN expression causes feedback upregulation of insulin receptor substrate 2. Molecular & Cellular Biology 21, 3947-3958. 138 Slee, E. A , Adrain, C , and Martin, S. J. (2001). Executioner caspase-3, -6, and -7 perform distinct, non-redundant roles during the demolition phase of apoptosis. J Biol Chem 276, 7320-7326. Snapper, C. M , Finkelman, F. D , and Paul, W. E. (1988). Regulation of IgGl and IgE production by interleukin 4. Immunol Rev 102, 51-75. Soldaini, E , Pla, M , Beermann, F , Espel, E , Corthesy, P , Barange, S, Waanders, G. A , MacDonald, H. R , and Nabholz, M . (1995). Mouse interleukin-2 receptor alpha gene expression. Delimitation of cis- acting regulatory elements in transgenic mice and by mapping of DNase-I hypersensitive sites. J Biol Chem 270, 10733-10742. Sotsios, Y , Whittaker, G. C , Westwick, J , and Ward, S. G. (1999). The CXC chemokine stromal cell-derived factor activates a Gi-coupled phosphoinositide 3-kinase in T lymphocytes. J Immunol 163, 5954-5963. Sozzani, S, Zhou, D , Locati, M , Rieppi, M , Proost, P , Magazin, M , Vita, N , van Damme, J , and Mantovani, A. (1994). Receptors and transduction pathways for monocyte chemotactic protein-2 and monocyte chemotactic protein-3. Similarities and differences with MCP-1. J Immunol 752, 3615-3622. Stambolic, V , Suzuki, A , de la Pompa, J. L , Brothers, G. M , Mirtsos, C , Sasaki, T , Ruland, J , Penninger, J. M , Siderovski, D. P , and Mak, T. W. (1998). Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95, 29-39. Stambolic, V , Tsao, M . S, Macpherson, D , Suzuki, A , Chapman, W. B , and Mak, T. W. (2000). High incidence of breast and endometrial neoplasia resembling human Cowden syndrome in pten+/- mice. Cancer Res 60, 3605-3611. Steck, P. A , Pershouse, M . A , Jasser, S. A , Yung, W. K , Lin, H , Ligon, A. H , Langford, L. A , Baumgard, M . L , Hattier, T , Davis, T., et al. (1997). Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 75, 356-362. Stolarov, J , Chang, K , Reiner, A , Rodgers, L , Hannon, G. J , Wigler, M . H , and Mittal, V. (2001). Design of a retroviral-mediated ecdysone-inducible system and its application to the expression profiling of the PTEN tumor suppressor. Proc Natl Acad Sci U S A 98, 13043-13048. Strasser, A , Whittingham, S, Vaux, D. L , Bath, M . L , Adams, J. M , Cory, S, and Harris, A. W. (1991). Enforced BCL2 expression in B-lymphoid cells prolongs antibody responses and elicits autoimmune disease. Proc Natl Acad Sci U S A 88, 8661-8665. 139 Sun, H , Lesche, R , Li , D. M , Liliental, J , Zhang, H , Gao, J , Gavrilova, N , Mueller, B , Liu, X , and Wu, H. (1999). PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc Natl Acad Sci U S A 96, 6199-6204. Suzuki, A , de la Pompa, J. L , Stambolic, V , Elia, A. J , Sasaki, T , del Barco Barrantes, I, Ho, A , Wakeham, A , Itie, A , Khoo, W., et al. (1998). High cancer susceptibility and embryonic lethality associated with mutation of the PTEN tumor suppressor gene in mice. Curr Biol 8, 1169-1178. Suzuki, A , Yamaguchi, M . T , Ohteki, T , Sasaki, T , Kaisho, T , Kimura, Y , Yoshida, R , Wakeham, A , Higuchi, T , Fukumoto, M., et al. (2001a). T cell-specific loss of Pten leads to defects in central and peripheral tolerance. Immunity 14, 523-534. Suzuki, H , Kundig, T. M , Furlonger, C , Wakeham, A , Timms, E , Matsuyama, T , Schmits, R , Simard, J. J , Ohashi, P. S, Griesser, H , and et al. (1995). Deregulated T cell activation and autoimmunity in mice lacking interleukin-2 receptor beta. Science 268, 1472-1476. Suzuki, Y , Rahman, M , and Mitsuya, H. (2001b). Diverse transcriptional response of CD4(+) T cells to stromal cell- derived factor (SDF)-l: cell survival promotion and priming effects of SDF-1 on CD4(+) T cells. J Immunol 167, 3064-3073. Tamura, M , Gu, J , Matsumoto, K , Aota, S, Parsons, R , and Yamada, K. M . (1998). Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science 280, 1614-1617. Tamura, M , Gu, J , Takino, T , and Yamada, K. M . (1999). Tumor suppressor PTEN inhibition of cell invasion, migration, and growth: differential involvement of focal adhesion kinase and pl30Cas. Cancer Res 59, 442-449. Tanaka, T , Tsudo, M , Karasuyama, H , Kitamura, F , Kono, T , Hatakeyama, M , Taniguchi, T., and Miyasaka, M. (1991). A novel monoclonal antibody against murine IL-2 receptor beta-chain. Characterization of receptor expression in normal lymphoid cells and EL- 4 cells. J Immunol 147, 2222-2228. Testi, R , D'Ambrosio, D , De Maria, R , and Santoni, A. (1994). The CD69 receptor: a multipurpose cell-surface trigger for hematopoietic cells. Immunol Today 15, 479-483. Testi, R , Phillips, J. H , and Lanier, L. L. (1989). Leu 23 induction as an early marker of functional CD3/T cell antigen receptor triggering. Requirement for receptor cross-linking, prolonged elevation of intracellular [Ca++] and stimulation of protein kinase C. J Immunol 142, 1854-1860. Tilton, B , Ho, L , Oberlin, E , Loetscher, P , Baleux, F , Clark-Lewis, I, and Thelen, M . (2000). Signal transduction by CXC chemokine receptor 4. Stromal cell-derived factor 1 140 stimulates prolonged protein kinase b and extracellular signal-regulated kinase 2 activation in t lymphocytes [In Process Citation]. J Exp Med 192, 313-324. Torres, J , and Pulido, R. (2001). The tumor suppressor PTEN is phosphorylated by the protein kinase CK2 at its C terminus. Implications for PTEN stability to proteasome-mediated degradation. Journal of Biological Chemistry 2 76, 993-998. Vanhaesebroeck, B , Jones, G. E , Allen, W. E , Zicha, D , Hooshmand-Rad, R , Sawyer, C , Wells, C , Waterfield, M . D , and Ridley, A. J. (1999). Distinct PI(3)Ks mediate mitogenic signalling and cell migration in macrophages. Nat Cell Biol 1, 69-71. Vanhaesebroeck, B , and Waterfield, M . D. (1999). Signaling by distinct classes of phosphoinositide 3-kinases. Exp Cell Res 253, 239-254. Vanhaesebroeck, B , Welham, M . J , Kotani, K , Stein, R , Warne, P. H , Zvelebil, M . J , Higashi, K , Volinia, S, Downward, J , and Waterfield, M . D. (1997). PI lOdelta, a novel phosphoinositide 3-kinase in leukocytes. Proc Natl Acad Sci U S A 94, 4330-4335. Vazquez, F , Ramaswamy, S, Nakamura, N , and Sellers, W. R. (2000). Phosphorylation of the PTEN tail regulates protein stability and function. Mol Cell Biol 20, 5010-5018. Vazquez, F , and Sellers, W. R. (2000). The PTEN tumor suppressor protein: an antagonist of phosphoinositide 3-kinase signaling. Biochim Biophys Acta 1470, M21-35. Vicente-Manzanares, M , Rey, M , Jones, D. R , Sancho, D , Mellado, M , Rodriguez-Frade, J. M , del Pozo, M . A , Yanez-Mo, M , de Ana, A. M , Martinez, A. C , et al. (1999). Involvement of phosphatidylinositol 3-kinase in stromal cell-derived factor-1 alpha-induced lymphocyte polarization and chemotaxis. J Immunol 163, 4001-4012. Vila-Coro, A. J , Rodriguez-Frade, J. M , Martin De Ana, A , Moreno-Ortiz, M . C , Martinez, A. C , and Mellado, M. (1999). The chemokine SDF-1 alpha triggers CXCR4 receptor dimerization and activates the JAK/STAT pathway. Faseb J 13, 1699-1710. Wain, J. H , Kirby, J. A , and Al i , S. (2002). Leucocyte chemotaxis: Examination of mitogen-activated protein kinase and phosphoinositide 3-kinase activation by Monocyte Chemoattractant Proteins-1, -2, -3 and -4. Clin Exp Immunol 127, 436-444. Wang, F , Herzmark, P., Weiner, O. D , Srinivasan, S, Servant, G , and Bourne, H. R. (2002). Lipid products of PI(3)Ks maintain persistent cell polarity and directed motility in neutrophils. Nat Cell Biol 4, 513-518. Wang, J. F , Park, I. W , and Groopman, J. E. (2000). Stromal cell-derived factor-1 alpha stimulates tyrosine phosphorylation of multiple focal adhesion proteins and induces migration of hematopoietic progenitor cells: roles of phosphoinositide-3 kinase and protein kinase C. Blood 95, 2505-2513. 141 Weiner, O. D , Neilsen, P. O , Prestwich, G. D , Kirschner, M . W , Cantley, L. C , and Bourne, H. R. (2002). A PtdInsP(3)- and Rho GTPase-mediated positive feedback loop regulates neutrophil polarity. Nat Cell Biol 4, 509-513. Welsh, G. I, Miller, C. M , Loughlin, A. J , Price, N . T , and Proud, C. G. (1998). Regulation of eukaryotic initiation factor eIF2B: glycogen synthase kinase-3 phosphorylates a conserved serine which undergoes dephosphorylation in response to insulin. FEBS Lett 421, 125-130. Weng, L , Brown, J., and Eng, C. (2001a). PTEN induces apoptosis and cell cycle arrest through phosphoinositol-3-kinase/Akt-dependent and -independent pathways. Human Molecular Genetics 10, 237-242. Weng, L. P , Smith, W. M , Brown, J. L , and Eng, C. (2001b). PTEN inhibits insulin-stimulated MEK/MAPK activation and cell growth by blocking IRS-1 phosphorylation and IRS-l/Grb-2/Sos complex formation in a breast cancer model. Human Molecular Genetics 10, 605-616. Willerford, D. M , Chen, J , Ferry, J. A , Davidson, L , Ma, A , and Alt, F. W. (1995). Interleukin-2 receptor alpha chain regulates the size and content of the peripheral lymphoid compartment. Immunity 3, 521-530. Zhong, H , Chiles, K , Feldser, D , Laughner, E , Hanrahan, C , Georgescu, M . M , Simons, J. W , and Semenza, G. L. (2000). Modulation of hypoxia-inducible factor 1 alpha expression by the epidermal growth factor/phosphatidylinositol 3-kinase/PTEN/AKT/FRAP pathway in human prostate cancer cells: implications for tumor angiogenesis and therapeutics. Cancer Res 60, 1541-1545. Zingoni, A , Palmieri, G , Morrone, S, Carretero, M , Lopez-Botel, M , Piccoli, M , Frati, L , and Santoni, A. (2000). CD69-triggered ERK activation and functions are negatively regulated by CD94 / NKG2-A inhibitory receptor. Eur J Immunol 30, 644-651. Zlotnik, A , and Yoshie, O. (2000). Chemokines: a new classification system and their role in immunity. Immunity 12, 121-127. Zou, Y. R , Kottmann, A. H , Kuroda, M , Taniuchi, I, and Littman, D. R. (1998). Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development [see comments]. Nature 393, 595-599. 142 Appendix 1: Microarray results from unstimulated +/• and Pten •/- T cells. Fold Change Change change p-value Description Signal +/+ Signal H-2.00 Increase 0 A disintegrin and metalloprotease domain (ADAM) 8 5620.3 10937.6 2.00 Increase 0 UI-M-BH1-alt-d-05-0-Ul.s1 Mus musculus cDNA, 3 end 4799.8 11998.8 2.00 Increase 0 UI-M-BH2.1-apa-a-02-0-UI.s1 Mus musculus cDNA, 3 end 2460.8 5250.3 2.00 Increase 0 UI-M-BH2.1-apx-h-05-0-UI.s1 Mus musculus cDNA, 3 end 9909.7 18585.6 2.00 Increase 0 UI-M-AK0-adoe-02-0-Ul.s1 Mus musculus cDNA, 3 end 3788.6 7625.4 2.00 Increase 0 Topoisomerase (DNA) II alpha 2139.6 4164 2.14 Increase 0 UI-M-AI1-afl-a-11-0-Ul.s1 Mus musculus cDNA, 3 end 5565.7 15097.9 2.14 Increase 0 Mus musculus WD40-repeat type I transmembrane protein A72.5 mRNA, complete cds 8102.4 17655.6 2.14 Increase 0 UI-M-AH1-agv-d-05-0-Ul.s1 Mus musculus cDNA, 3 end 5990.4 9875.5 2.30 Increase 0 M.musculus mRNA for caspase-11 833 1700 2.30 Increase 0 UI-M-BH0-ajf-a-06-O-Ul.s1 Mus musculus cDNA, 3 end 9612.5 20791.8 2.46 Increase 0 UI-M-AM1-agb-h-11-0-Ul.s1 Mus musculus cDNA, 3 end 26877.5 63879.2 2.64 Increase 0 vs32d07.r1 Mus musculus cDNA, 5 end 1921.6 6090.7 2.64 Increase 0 Mouse calcineurin catalytic subunit mRNA, complete cds 4342.1 11256.2 2.64 Increase 0 vu69f10.M Mus musculus cDNA, 5 end 2593.3 6747.2 3.03 Increase 0 AV370035 Mus musculus cDNA, 3 end 4567.9 14034.6 2.00 Increase 0.000001 Interferon concensus sequence binding protein 2466.7 4695.6 2.00 Increase 0.000001 UI-M-BHO-aiu-d-07-0-Ul.s1 Mus musculus cDNA, 3 end 3744.5 6805.8 2.14 Increase 0.000001 UI-M-BH2.1-aps-h-06-0-UI.s1 Mus musculus cDNA, 3 end 8800.9 18458 2.14 Increase 0.000001 M.musculus h2-calponin cDNA 3749.6 9286 2.14 Increase 0.000001 UI-M-AH1-agw-d-04-0-Ul.s1 Mus musculus cDNA, 3 end 1556.6 5130.5 2.30 Increase 0.000001 M.musculus TOP gene for topoisomerase I, exons 19-21 7107.6 17016 2.46 Increase 0.000001 Mus musculus histone stem-loop binding protein (SLBP) mRNA, complete cds 886.5 2307 2.46 Increase 0.000001 mz67g09.M Mus musculus cDNA, 5 end 5237.2 12393.8 2.64 Increase 0.000001 UI-M-BH2.1-apw-b-04-0-UI.s1 Mus musculus cDNA, 3 end 6285.9 15978.8 2.64 Increase 0.000001 UI-M-AM0-adv-f-O1-0-Ul.s1 Mus musculus cDNA, 3 end 2055 5955 2.64 Increase 0.000001 UI-M-BH1-anw-e-09-0-Ul.s1 Mus musculus cDNA, 3 end 4954.3 13000.9 4.29 Increase 0.000001 UI-M-BH2.1-apr-b-09-0-UI.s1 Mus musculus cDNA, 3 end 3184.1 13703.2 2.00 Increase 0.000002 Mus musculus polyhomeotic 2 protein (Mph2) mRNA, partial cds 970.9 2724.3 2.30 Increase 0.000002 Mus musculus Pur-alpha mRNA, complete cds 2718.8 6621.9 2.64 Increase 0.000002 Mus musculus connexin 43 (alpha-1 gap junction) mRNA, complete cds 1074.8 3532.1 2.64 Increase 0.000002 Mus musculus radio-resistance 398.7 1210.8 2.00 Increase 0.000003 vt38b12.M Mus musculus cDNA, 5 end 870.8 2118.8 2.00 Increase 0.000003 UI-M-BH1-alh-c-10-0-Ul.s1 Mus musculus cDNA, 3 end 4922.9 12067.3 2.14 Increase 0.000003 Mus musculus plasma membrane protein syntaxin-4 mRNA, complete cds 2602.1 5049.9 3.03 Increase 0.000003 UI-M-BH2.3-aoe-f-11-0-UI.s1 Mus musculus cDNA, 3 end 1639.8 8503.9 2.14 Increase 0.000004 Insulin-like growth factor 2 receptor 2824.4 5741.4 2.30 Increase 0.000004 ELKL motif kinase 19790.9 45255.8 2.46 Increase 0.000004 UI-M-BH2.2-aoq-e-12-0-UI.s1 Mus musculus cDNA, 3 end 1172.1 2490.5 2.00 Increase 0.000005 ua88d09.r1 Mus musculus cDNA, 5 end 689.5 1606.6 2.30 Increase 0.000005 AV316162 Mus musculus cDNA, 3 end 1897.7 6312.4 2.30 Increase 0.000005 Tumor necrosis factor (ligand) superfamily, member 11 564.8 1357.2 2.64 Increase 0.000005 Mus musculus mRNA for sterol-C5-desaturase, complete cds 495.2 1378.2 3.03 Increase 0.000005 UI-M-BH1-amx-d-06-0-Ul.s1 Mus musculus cDNA, 3 end 1512.7 4054 2.14 Increase 0.000006 uc41c02.M Mus musculus cDNA, 5 end 2520.3 4551.1 2.14 Increase 0.000006 UI-M-AN1-afb-c-09-0-Ul.s1 Mus musculus cDNA, 3 end 4242.3 10399.9 2.14 Increase 0.000009 Mus musculus methyl-CpG binding protein MBD1 (Mbd1) mRNA, complete cds 1544.8 3130.3 2.30 Increase 0.000009 uc62f07.r1 Mus musculus cDNA, 5 end 1175.7 3902.1 2.00 Increase 0.000011 vq44e08.y1 Mus musculus cDNA, 5 end 1502.8 3107.3 2.14 Increase 0.000014 Mouse germline Ig lambda-2-chain V-region (V-J) gene, 5 end 1614.2 3572.9 3.25 Increase 0.000014 Core binding factor alpha 1 486.5 1517.8 2.00 Increase 0.000015 Cell division cycle control protein 2a 3176.1 6128.5 3.03 Increase 0.000019 Chromobox homolog (Drosophila HP1 beta) 357.9 1749.3 2.30 Increase 0.000023 Mus musculus SHYC (Shyc) mRNA, complete cds 1178 1953 2.30 Increase 0.000027 Mouse mRNA for minopontin 1300.6 2129.7 2.00 Increase 0.000031 UI-M-BH2.2-aol-h-09-0-UI.s1 Mus musculus cDNA, 3 end 1804.4 4196 2.00 Increase 0.000043 Ul67b12.x1 Mus musculus cDNA, 3 end 365.3 699.7 3.25 Increase 0.000044 AV107153 Mus musculus cDNA 4452.7 12386.9 5.28 Increase 0.000047 Mus musculus pigment epithelium-derived factor (PEDF) mRNA, complete cds 115.5 1065.1 6.06 Increase 0.000054 Tumor necrosis factor receptor superfamily, member 7 166.1 1326 2.83 Increase 0.000068 M.musculus gene encoding hexokinase II, exon 1 (and joined CDS) 1113.5 3055.3 4.29 Increase 0.000074 Fibroblast growth factor receptor 3 28.9 176.7 2.30 Increase 0.000079 Mus musculus secreted frizzled related protein sFRP-2 (Sfrp2) mRNA, complete cds 2577.6 5413.8 2.64 Increase 0.000092 UI-M-BH2.1-apg-f-01-0-UI.s1 Mus musculus cDNA, 3 end 487.2 1489.6 3.03 Increase 0.000092 UI-M-BH1-amr-c-07-0-Ul.s1 Mus musculus cDNA, 3 end 873.5 3923.5 2.14 Increase 0.000115 UI-M-ANO-acj-h-05-0-Ul.s1 Mus musculus cDNA, 3 end 1462.9 2563.3 2.30 Increase 0.000154 AV347947 Mus musculus cDNA, 3 end 471.6 1831.1 2.83 Increase 0.000154 CD8 antigen, alpha chain 709.3 2682.6 3.48 Increase 0.000191 Creatine kinase, muscle 433.5 1423.3 2.00 Increase 0.000253 ub69a03.x1 Mus musculus cDNA, 3 end 641.5 1171.3 2.14 Increase 0.000333 AV341985 Mus musculus cDNA, 3 end 293.2 676.9 5.28 Increase 0.000357 Protein tyrosine phosphatase, non-receptor type 12 192.2 965.3 2.00 Increase 0.000408 up29a12.y1 Mus musculus cDNA, 5 end 262.8 575.1 2.00 Increase 0.000408 ua95g09.r1 Mus musculus cDNA, 5 end 655 1492.7 2.00 Increase 0.000533 Mus musculus golgi SNARE (GS27) mRNA, complete cds 484.8 1187.3 2.14 Increase 0.00057 UI-M-BH2.1-apg-b-09-0-UI.s1 Mus musculus cDNA, 3 end 542.9 436.2 2.30 Increase 0.000982 AV365271 Mus musculus cDNA, 3 end 264.5 514 2.46 Increase 0.001876 ue14g03.x1 Mus musculus cDNA, 3 end 295.4 763.6 2.00 Increase 0.001991 UI-M-BH2.2-aov-g-09-0-UI.s1 Mus musculus cDNA, 3 end 570.1 954.8 2.00 Increase 0.002517 UI-M-BH2.3-aoe-g-02-0-UI.s1 Mus musculus cDNA, 3 end 648.9 1373.4 2.00 Increase I 0.002991 Mus musculus TRA1 mRNA, complete cds 557.7 1317.5 143 Appendix 1 continued: Microarray results from unstimulated •/+ and Pten +/- T cells. Fold Change Change change p-value Description Signal +/+ Signal +/-2.00 Decrease 0.997333 uh85b06.r1 Mus musculus cDNA, 5 end 538.8 228.4 4.00 Decrease 0.997483 C80857 Mus musculus cDNA, 3 end 326.7 114.9 2.83 Decrease 0.997625 Zinc finger protein X-linked 1183 449 3.48 Decrease 0.997942 ms93e11 r1 Mus musculus cDNA, 5 end 291.1 109.3 2.64 Decrease 0.998233 UI-M-BH0-aki-h-08-0-Ul.s1 Mus musculus cDNA, 3 end 289.1 83.8 9.85 Decrease 0.998696 UI-M-BH0-ajz-g-06-0-Ul.s1 Mus musculus cDNA. 3 end 332.5 28.2 2.00 Decrease 0.998848 Max protein 3667.1 1715.2 2.00 Decrease 0.998918 uj19c03.x1 Mus musculus cDNA. 3 end 1117.9 374.2 2.14 Decrease 0.998918 Early lymphoid specific transcription factor 1210.3 552.5 2.14 Decrease 0.998983 Utrophin 789.6 282.7 2.00 Decrease 0.999045 vx93d09.M Mus musculus cDNA, 5 end 553.4 379.2 2.00 Decrease 0.999045 Mus musculus protein kinase C zeta mRNA. complete eds 1226.4 611.9 6.96 Decrease 0.999045 vq48e08.x1 Mus musculus cDNA, 3 end 1450.2 210.7 2.30 Decrease 0.999104 vu36g08.M Mus musculus cDNA. 5 end 362 150.7 2.00 Decrease 0.999159 M.musculus mRNA for e1 protein 1727.6 644.2 3.73 Decrease 0.999351 vu94h01 .r1 Mus musculus cDNA. 5 end 322.7 85.1 2.00 Decrease 0.999533 Mus musculus protein-serine 3224.1 1734.1 2.64 Decrease 0.999592 vx28b11.y1 Mus musculus cDNA, 5 end 147.9 47.6 2.64 Decrease 0.999643 Regulatory protein, T lymphocyte 1 1128.6 360.6 3.25 Decrease 0.999667 M.musculus mRNA for transferrin receptor 673.6 144.7 2.14 Decrease 0.99971 Protein phosphatase 1B. magnesium dependent, beta isoform 1046.9 432.9 2.00 Decrease 0.99978 M.musculus mRNA for C1D protein 570.4 241.8 2.00 Decrease 0.999795 Mus musculus 1KB kinase beta (IKKbeta) mRNA, complete eds 1052.8 433 2.00 Decrease 0.999809 Selenophosphate synthetase 2 1300.9 689.1 2.00 Decrease 0.999846 UI-M-AM1-afz-b-09-0-Ul.s1 Mus musculus cDNA, 3 end 2028.4 777.5 2.14 Decrease 0.999867 Mus musculus Rab8-interacting protein mRNA, complete eds 1084.1 467.6 2.14 Decrease 0.999867 UI-M-AI0-aak-a-10-0-Ul.s2 Mus musculus cDNA, 3 end 582.8 258.2 5.28 Decrease 0.999876 X-ray repair complementing defective repair in Chinese hamster cells 5 834.8 103 2.30 Decrease 0.999885 Cytoplasmic tyrosine kinase, Dscr28C related (Drosophila) 1922.6 824 2.00 Decrease 0.999915 UI-M-BH1-anp-c-04-0-Ul.s1 Mus musculus cDNA, 3 end 720 360.6 2.30 Decrease 0.999921 Mus musculus gene for matrin3, complete eds 875.2 315 2.64 Decrease 0.999926 Mus musculus mRNA for A6 related protein 6793.1 2999.7 2.30 Decrease 0.999932 AV335799 Mus musculus cDNA, 3 end 398.5 256.6 2.00 Decrease 0.999963 AV103574 Mus musculus cDNA 1022.4 475.3 2.14 Decrease 0.999963 vh78d08.M Mus musculus cONA, 3 end 405.1 212.3 2.64 Decrease 0.999963 UI-M-BH0-ajc-a-05-0-Ul.s1 Mus musculus cDNA, 3 end 1438.6 662.6 2.00 Decrease 0.999969 UI-M-AQ1-adx-c-06-0-Ul.s1 Mus musculus cDNA, 3 end 3625.3 1823.5 2.83 Decrease 0.999971 vc51g02.r1 Mus musculus cDNA, 3 end 3205.8 862.7 3.48 Decrease 0.999971 UI-M-AK1-aet-b-03-0-Ul.s1 Mus musculus cDNA, 3 end 497.2 83.6 19.70 Decrease 0.999971 AU015180 Mus musculus cDNA, 3 end 1309.5 89.8 2.83 Decrease 0.999973 UI-M-BH1-ann-g-07-0-Ul.s1 Mus musculus cDNA, 3 end 1242.4 426.2 2.46 Decrease 0.999981 UI-M-AI0-aan-b-12-0-Ul.s1 Mus musculus cDNA, 3 end 2138.4 686 2.00 Decrease 0.999985 MUSGS01047 Mus musculus cDNA, 3 end 2274.9 1382.3 2.00 Decrease 0.999987 M.musculus mRNA for ZT3 zinc finger factor 846.1 362.1 2.30 Decrease 0.999987 mt52b02.M Mus musculus cDNA, 5 end 779.6 212.1 2.14 Decrease 0.999988 Mus musculus transcriptional coactivator ALY (ALY) mRNA, complete eds 3193.2 1666.8 12.13 Decrease 0.999988 mr23c08.y1 Mus musculus cDNA, 5 end 630.8 55.4 2.00 Decrease 0.99999 Ataxia telangiectasia gene mutated in human beings 1697.5 1579.7 2.00 Decrease 0.99999 UI-M-BH0-ajd-g-O1-O-Ul.s1 Mus musculus cDNA, 3 end 3440.9 1738.2 2.14 Decrease 0.999991 UI-M-BH2.1-apu-c-11-0-UI.s1 Mus musculus cDNA, 3 end 648.8 303.3 2.14 Decrease 0.999993 Mus musculus zinc finger protein (RP-8) mRNA, complete eds 1024.8 726.4 2.00 Decrease 0.999996 vr15c03.y1 Mus musculus cDNA, 5 end 781.3 314.7 5.66 Decrease 0.999996 C81612 Mus musculus cDNA, 3 end 1162.9 363.4 2.00 Decrease 0.999997 UI-M-AJ1-ahe-h-07-0-Ul.s1 Mus musculus cDNA, 3 end 2909.8 2072.3 2.14 Decrease 0.999997 UI-M-BH1-akt-b-12-0-Ul.s1 Mus musculus cDNA, 3 end 1936.1 827.2 3.25 Decrease 0.999997 M.musculus ASF mRNA 404.2 97.8 2.00 Decrease 0.999998 vx36f11 x1 Mus musculus cDNA, 3 end 2482.6 1118.6 2.14 Decrease 0.999998 wv20f11.x1 Mus musculus cDNA, 3 end 4304.9 1748 2.30 Decrease 0.999998 CD7 antigen 6147.3 2308 8.57 Decrease 0.999998 Actin, beta, cytoplasmic 1328.7 216.8 2.00 Decrease 0.999999 Hexokinase 1 61014.3 15435.4 2.14 Decrease 0.999999 Mus musculus mRNA for transcription factor S-ll-related proteins, complete eds 1981 776.9 2.30 Decrease 0.999999 UI-M-AN0-acp-f-07-0-Ul.s1 Mus musculus cDNA, 3 end 2442.7 873.4 2.64 Decrease 0.999999 UI-M-BH2.1-aoz-c-05-0-UI.s2 Mus musculus cDNA, 3 end 2424.6 951.8 2.64 Decrease 0.999999 Mus musculus mRNA for erythroid differentiation regulator, partial 24771.2 10768.8 4.00 Decrease 0.999999 Myosin VI 4569.6 1179.5 2.00 Decrease 1 Mouse surfeit locus surfeit 3 protein gene 50027.3 25207 2.00 Decrease 1 Cofilin 1, non-muscle 22036.6 11013.7 2.14 Decrease 1 UI-M-BH2.1-apb-b-08-0-UI.s1 Mus musculus cDNA, 3 end 22336.7 8666.4 2.30 Decrease 1 D-E-A-D (aspartate-glutamate-alanine-aspartate) box polypeptide 6 9864.9 3739.5 2.46 Decrease 1 Mouse Cu-Zn superoxide dismutase mRNA, complete eds 20715.5 8208.8 2.46 Decrease 1 Mus musculus mRNA for transforming growth factor-beta 1 4710.2 2095.1 2.46 Decrease 1 UI-M-AP0-abm-e-O2-O-Ul.s1 Mus musculus cDNA, 3 end 153698 66461.2 2.46 Decrease 1 Guanine nucleotide binding protein, beta-2, related sequence 1 77830.9 29615.3 2.64 Decrease 1 Ub97f03.r1 Mus musculus cDNA, 5 end 3824.8 1183.5 2.83 Decrease 1 Mouse mRNA for Topoisomerase-inhibitor suppressed, complete eds 9708.4 3380.8 3.03 Decrease 1 Murine mRNA with homology to yeast 129 ribosomal protein gene 51688 16532.4 144 Appendix 2: Microarray results from +/+ and Pten +1- T cells stimulated with 1.5 ug/mL SDF-1 for 6h. Fold change Change change p-value Description Signal +/+ Signal +/-2.00 Increase 0 vo73e09.r1 Mus musculus cDNA, 5 end 1430 2650 2.00 Increase 0 AV316162 Mus musculus cDNA. 3 end 1418.7 4539 2.14 Increase 0 Mouse myb proto-oncogene mRNA encoding 71 kd myb protein, complete eds 1769.5 3699.7 2.14 Increase 0 Epithelial membrane protein 1 2407.6 5216 2.30 Increase 0 A disintegrin and metalloprotease domain (ADAM) 8 5938.9 14071.3 2.46 Increase 0 Ecotroplc viral integration site 2 1272.5 3273.1 2.64 Increase 0 Mus musculus mRNA for caspase-8 1220.6 3117.8 3.25 Increase 0 CD8 antigen, alpha chain 1087.1 5715.2 2.00 Increase 0.000001 Max interacting protein 1 2164 3749.2 2.00 Increase 0.000001 AV370035 Mus musculus cDNA, 3 end 1827.6 5092.5 2.14 Increase 0.000001 Lamin A 5435.8 12817.6 2.30 Increase 0.000001 UI-M-BH1-anf-h-02-0-Ul.s1 Mus musculus cDNA, 3 end 2401.9 5079.9 2.64 Increase 0.000001 Mouse Eps8 mRNA sequence, complete eds 249.9 809 2.64 Increase 0.000001 Lipocortin 1 320.7 794.5 3.03 Increase 0.000001 Mouse mRNA for minopontin 1665.8 4810.5 4.92 Increase 0.000001 Mus musculus S H Y C (Shyc) mRNA, complete eds 169.6 1061.4 2.00 Increase 0.000002 UI-M-BH2.3-aoa-a-08-0-UI.s1 Mus musculus cDNA, 3 end 1084.8 2338.9 2.14 Increase 0.000002 Mouse mRNA for Rab 11, partial sequence 2959.1 5618.5 2.14 Increase 0.000002 vm48a05.r1 Mus musculus cDNA, 5 end 279.9 942.3 2.46 Increase 0.000002 ul59a06.x1 Mus musculus cDNA, 3 end 713.2 1904.6 13.93 Increase 0.000002 Mus musculus mRNA for sterol-C5-desaturase, complete eds 63.7 723.6 2.00 Increase 0.000003 Mus musculus TRAF-interacting protein l-TRAF mRNA, complete eds 591.3 1207.3 2.30 Increase 0.000003 UI-M-BH1-anj-a-06-0-Ul.s1 Mus musculus cDNA, 3 end 328.4 1223.1 6.96 Increase 0.000003 Mouse H2B and H2A histone genes (291 A) 60.3 617.2 2.00 Increase 0.000004 Mouse mRNA for SCID complementing gene 2 1657.6 4108.2 2.14 Increase 0.000004 Mus musculus connexin 43 (alpha-1 gap junction) mRNA, complete eds 464 1411.7 2.14 Increase 0.000004 Mus musculus vacuolar adenosine triphosphatase subunit C mRNA, complete eds 1416.9 3569.2 2.00 Increase 0.000005 UI-M-AO1-aem-g-05-0-Ul.s1 Mus musculus cDNA, 3 end 1145 2057.6 2.00 Increase 0.000006 Cyclin 6 2726.8 5343.5 2.14 Increase 0.000006 Mus musculus C C chemokine receptor-5 (CCR5) gene, complete eds 708.1 1333.3 2.00 Increase 0.000009 UI-M-AK1-aes-b-10-0-Ul.s1 Mus musculus cDNA, 3 end 1226.6 2269.6 2.14 Increase 0.000009 Mus musculus serine 770.9 1458.6 2.00 Increase 0.000012 vq67g04.s1 Mus musculus cDNA, 5 end 473.3 1033.9 2.14 Increase 0.000013 UI-M-BH1-amd-d-08-0-Ul.s1 Mus musculus cDNA, 3 end 609.5 1233 2.00 Increase 0.000017 Mouse gene for granulocyte-macrophage colony stimulating factor (GM-CSF) 516.5 827.9 9.19 Increase 0.000019 Mus musculus mRNA for GCN2 elF2alpha kinase 47.8 360.3 2.64 Increase 0.000021 vq44e08.y1 Mus musculus cDNA, 5 end 699.9 2700.5 2.14 Increase 0.000023 UI-M-AP0-abh-c-11-0-UI.S1 Mus musculus cDNA, 3 end 367.5 833.9 3.03 Increase 0.000023 UI-M-BG0-ahv-f-12-0-Ul.s1 Mus musculus cDNA, 3 end 126.8 362.5 2.00 Increase 0.000025 Mus musculus immunoglobulin kappa light chain variable region gene, partial eds 1616.7 4165.4 6.50 Increase 0.000025 Mouse dilute myosin heavy chain gene for novel heavy chain with unique C-terminal region 55 526.7 2.00 Increase 0.000027 Mus musculus E1B 19K 726.9 1271.3 2.00 Increase 0.000031 UI-M-BH2.1-aph-d-10-0-UI.s1 Mus musculus cDNA, 3 end 805.7 1800.2 8.00 Increase 0.000032 UI-M-BG1-aih-h-10-0-Ul.s1 Mus musculus cDNA, 3 end 27.1 234.5 2.30 Increase 0.000034 Killer cell lectin-like receptor, subfamily D, member 1 476.8 1265.1 2.14 Increase 0.00004 UI-M-BH0-ajq-b-06-0-UI.S1 Mus musculus cDNA, 3 end 415.5 887.1 2.00 Increase 0.000043 Mus musculus Ig kappa light chain mRNA, partial eds 649.6 1226.3 2.00 Increase 0.000047 M.musculus mRNA for caspase-6 472.6 872.3 2.30 Increase 0.000047 Mus musculus 11-12 receptor beta2 mRNA, complete eds 185.3 738.4 5.66 Increase 0.000047 UI-M-AH0-acx-b-06-0-Ul.s1 Mus musculus cDNA, 3 end 67.8 539.6 6.06 Increase 0.000047 Core binding factor alpha 1 57.5 382.4 2.30 Increase 0.00005 M.musculus mRNA for B-cell-specific coactivator BOB.1 283.1 862.3 2.46 Increase 0.00005 UI-M-BH2.3-aog-g-02-O-UI.s1 Mus musculus cDNA, 3 end 363.9 840.7 2.14 Increase 0.000059 UI-M-BH2.1-apq-e-12-0-UI.s1 Mus musculus cDNA, 3 end 280.6 703.6 2.64 Increase 0.000059 w57c05.r1 Mus musculus cDNA, 5 end 152.6 608.9 2.30 Increase 0.000079 Mouse mRNA for coproporphyrinogen oxidase, complete eds 131.5 548.6 2.83 Increase 0.000085 Mouse mRNA for uridine phosphoryiase, complete eds 351.6 1084.4 2.46 Increase 0.000092 Mus musculus B cell antigen receptor Ig beta associated protein 1 (IBAP-1) mRNA, complete eds 473.3 1881.5 13.00 Increase 0.000107 ud59e02.r1 Mus musculus cDNA, 5 end 27.7 333.7 3.48 Increase 0.000115 Mouse mRNA for weel kinase 281.3 713.8 2.83 Increase 0.000135 UI-M-AQ1-aeb-h-07-0-Ul.s1 Mus musculus cDNA, 3 end 121.7 323.4 2.00 Increase 0.000143 ui22e07.y1 Mus musculus cDNA, 5 end 391.4 959.3 3.73 Increase 0.000153 AV365271 Mus musculus cDNA, 3 end 8.3 245.9 2.00 Increase 0.000177 Murine mRNA for 2,3-bisphosphoglycerate mutase (BPGM; E C 5.4.2.4) 313.5 676.3 2.30 Increase 0.000177 Intercellular adhesion molecule 372.1 1159.8 2.46 Increase 0.000236 UI-M-BH1-alc-a-08-0-Ul.s1 Mus musculus cDNA, 3 end 192.4 564.7 2.14 Increase 0.000271 vn73d05.r1 Mus musculus cDNA, 5 end 309.1 445 3.48 Increase 0.00029 Mus musculus tyrosylprotein sulfotransferase-1 mRNA, complete eds 477.7 1440.3 2.30 Increase 0.000311 ui35b03.y1 Mus musculus cDNA, 5 end 275 527.7 2.83 Increase 0.000357 Gut enriched Kruppel-like factor 188.8 674.2 3.03 Increase 0.000357 Mus musculus syntenin mRNA, complete eds 204.2 591.4 2.64 Increase 0.000408 UI-M-BH2.2-aou-f-01-0-UI.s1 Mus musculus cDNA, 3 end 77.8 193.7 4.29 Increase 0.000467 UI-M-AQ1-adz-a-05-0-Ul.s1 Mus musculus cDNA, 3 end 121.7 517.9 2.14 Increase 0.000499 Ul67b12.x1 Mus musculus cDNA, 3 end 269 550.2 10.56 Increase 0.00057 Imprinted and ancient 49.2 451.7 2.83 Increase 0.000608 vz33g10.r1 Mus musculus cDNA, 5 end 111.3 177.4 2.46 Increase 0.000649 ul18f11.y1 Mus musculus cDNA, 5 end 308.6 854.7 2.46 Increase 0.000649 U044c02.x1 Mus musculus cDNA, 3 end 306.7 951.4 2.00 Increase 0.000693 Mus musculus vesicle transport protein (munc-18c) mRNA, complete eds 758.8 1684.9 8.00 Increase 0.000693 va11c04.x1 Mus musculus cDNA, 3 end 21.7 230.2 2.46 Increase 0.000789 House-keeping protein 1 289.3 997.2 145 Appendix 2 continued: Microarray results Fold change Change change p-value 2.00 Increase 0.000841 2.00 Increase 0.000841 2.00 Increase 0.000841 2.14 Increase 0.000841 2.14 Increase 0.000955 2.00 Increase 0.001017 6.50 Increase 0.001226 5.66 Increase 0.001304 6.50 Increase 0.001304 2.14 Increase 0.001387 2.14 Increase 0.001474 2.00 Increase 0.001566 2.00 Increase 0.001991 2.14 Increase 0.001991 2.64 Increase 0.001991 2.00 Increase 0.002112 2.00 Increase 0.002375 2.83 Decrease 0.997445 2.30 Decrease 0.99776 4.92 Decrease 0.997831 2.14 Decrease 0.997888 2.83 Decrease 0.997888 97.01 Decrease 0.998799 2.00 Decrease 0.999104 2.14 Decrease 0.999104 2.14 Decrease 0.999159 2.14 Decrease 0.999307 3.48 Decrease 0.999351 2.00 Decrease 0.999533 2.30 Decrease 0.999533 2.64 Decrease 0.999533 2.46 Decrease 0.999581 2.00 Decrease 0.999618 2.14 Decrease 0.999618 2.00 Decrease 0.999667 6.96 Decrease 0.999689 2.46 Decrease 0.999765 2.00 Decrease 0.999809 2.30 Decrease 0.999846 2.14 Decrease 0.999852 2.00 Decrease 0.999857 2.46 Decrease 0.999857 2.83 Decrease 0.999867 2.00 Decrease 0.999893 2.46 Decrease 0.999915 2.46 Decrease 0.999969 3.03 Decrease 0.999973 2.14 Decrease 0.999975 2.64 Decrease 0.999979 2.30 Decrease 0.999981 2.64 Decrease 0.999985 2.00 Decrease 0.999988 2.00 Decrease 0.999988 3.03 Decrease 0.999988 25.99 Decrease 0.999989 2.30 Decrease 0.999991 4.29 Decrease 0.999993 2.64 Decrease 0.999995 3.03 Decrease 0.999995 4.29 Decrease 0.999995 2.30 Decrease 0.999996 2.30 Decrease 0.999996 2.46 Decrease 0.999996 2.46 Decrease 0.999996 2.83 Decrease 0.999996 2.30 Decrease 0.999997 3.73 Decrease 0.999997 4.00 Decrease 0.999997 2.30 Decrease 0.999998 2.46 Decrease 0.999998 2.14 Decrease 0.999999 2.30 Decrease 0.999999 2.46 Decrease 0.999999 2.64 Decrease 0.999999 3.48 Decrease 0.999999 4.29 Decrease 0.999999 4.29 Decrease 1 4.29 Decrease 1 uc62f07.r1 Mus musculus cDNA. 5 end Mus musculus DNA polymerase zeta catalytic subunit mRNA, complete cds UI-M-BH1-ann-e-07-0-Ul.s1 Mus musculus cDNA, 3 end vt38b12.M Mus musculus cDNA, 5 end uc45a07.x2 Mus musculus cDNA, 3 end Ect2 oncogene va04a10.y1 Mus musculus cDNA. 5 end Mus musculus mRNA for rabkinesln-6 vp87e06.x1 Mus musculus cDNA, 3 end Uf10c07.y1 Mus musculus cDNA, 5 end UI-M-BH2.1-apy-a-11-0-UI.s1 Mus musculus cDNA, 3 end Mus musculus eps15 mRNA. complete cds UI-M-BH2.3-aoi-a-03-0-UI.s1 Mus musculus cDNA. 3 end UI-M-AO1-aej-g-06-0-Ul.s1 Mus musculus cDNA, 3 end Mouse Ig aberrantly rearranged kappa-chain V10-J2 gene (V-kappa-21 subfamily) from plasmacytoma UI-M-BH0-aji-h-09-0-Ul.s1 Mus musculus cDNA. 3 end UI-M-AJ0-aba-e-08-0-Ul.s1 Mus musculus cDNA, 3 end AV319920 Mus musculus cDNA, 3 end M.musculus mRNA for RIL protein |vj14b01.r1 Mus musculus cDNA, 5 end Mus musculus integrin beta3 subunit mRNA. complete cds UI-M-AJO-aaz-h-01-0-Ul.s1 Mus musculus cDNA, 3 end AV337324 Mus musculus cDNA. 3 end vo34f04.r1 Mus musculus cDNA, 5 end AV233314 Mus musculus cDNA, 3 end M.musculus (clone S5) WRS mRNA for tryptophan-tRNA ligase Mus musculus alpha-endosulfine (complete coding sequence) UI-M-BH1-alm-d-07-0-Ul.s1 Mus musculus cDNA. 3 end w40e08.r1 Mus musculus cDNA, 5 end Lysosomal trafficking regulator Mus musculus Hex(prh) gene M. musculus mRNA for MAP klnase-activated protein kinase 2 Integrin alpha L (Cd11a) UI-M-AP0-abl-h-01-0-Ul.s1 Mus musculus cDNA, 3 end Mus musculus major histocompatibility locus class II region; Fas-binding protein Daxx (DAXX) gene, p| C81612 Mus musculus cDNA, 3 end Iud46a12.y1 Mus musculus cDNA, 5 end UI-M-BHO-akb-f-05-0-Ul.s1 Mus musculus cDNA, 3 end Proviral integration site 1 AV248951 Mus musculus cDNA, 3 end mz92g02.r1 Mus musculus cDNA, 5 end Mus musculus golgi SNARE (GS27) mRNA, complete cds Diaphanous homolog 1 (Drosophila) UI-M-AJO-aav-h-02-0-Ul.s2 Mus musculus cDNA, 3 end Mus musculus C57BL Mouse T-cell receptor rearranged beta-chain mRNA V-J-C region, 3 end Sialophorin Mouse mRNA for acidic ribosomal phosophoprotein PO UI-M-BH2.1-ape-h-06-0-UI.s1 Mus musculus cDNA, 3 end RAN GTPase activating protein 1 Mus musculus double-stranded RNA-specific adenosine deaminase mRNA, complete cds UI-M-AL1-ahk-g-10-0-Ul.s1 Mus musculus cDNA, 3 end UI-M-BH2.2-aql-f-08-0-UI.s1 Mus musculus cDNA, 3 end Actin, beta, cytoplasmic ud47h05.y1 Mus musculus cDNA, 5 end Mus musculus lunatic fringe (lunatic-fringe) mRNA, complete cds Mus musculus phosphatidylinositol 3-kinase catalytic subunit p110 delta mRNA, complete cds Mus musculus Lsc (Isc) oncogene mRNA, complete cds Mouse A-X actin mRNA, complete cds AV380793 Mus musculus cDNA, 3 end UI-M-AP0-abm-e-02-0-Ul.s1 Mus musculus cDNA, 3 end Mus musculus C57BL Mus musculus TFII-I protein short form mRNA, alternatively spliced, complete cds Mouse rearranged T-cell receptor beta V14 Mouse T-cell receptor germline beta-chain gene, V-region promoter (clone V-beta-16) Mouse T-cell receptor germline beta-chain gene constant region (CT) Mus musculus major histocompatibility complex region NG27, NG28, RPS28, NADH oxidoreductase, Mus musculus type I inosine monophosphate dehydrogenase mRNA, complete cds UI-M-BH0-akg-f-05-0-Ul.s1 Mus musculus cDNA, 3 end Mus musculus schlafen2 (Slfn2) mRNA, complete cds ua66c04.r1 Mus musculus cDNA, 5 end Mus musculus ribosomal protein L41 mRNA, complete cds Early lymphoid specific transcription factor Mus musculus schlafen2 (Slfn2) mRNA, complete cds Mouse T-cell receptor beta-chain gene (LVDJ), 5 end Interieukin 2 receptor, beta chain Cytokine inducible SH2-containing protein 7 Signal +/+ +/-673.7 1632.2 1073.2 2282.2 341.9 805.4 264.1 757.5 337 577.7 370.4 827.3 31.4 312.7 58.7 387.7 237.3 977.2 458.9 1389.7 97.2 288.5 354.1 649 184.2 387.9 66.5 176.9 283.6 918 260.7 618.6 286.6 787.4 493.1 177.8 1079.4 455.3 206.1 48.4 439.3 211.2 920.7 238.9 192.3 4.8 1955 1036.4 492.7 184.4 4130.5 1722.2 724 213.5 836.5 284.2 2053.6 1094.2 711.5 385.1 462.9 153.9 592 286.4 4872.7 2437.7 3838.6 1731.7 175353.3 85496.2 420.6 51.6 2514.4 861.5 1680.2 854.7 1417.4 768.8 2089.1 1474.9 2092.6 1042.9 1913.4 557.9 2383.7 648.6 1734.8 827 2353.5 824.9 1496.1 635.1 803.9 215.9 158551.8 87664.3 1517.2 512.3 2066.5 746.6 1059.1 562.6 1985.8 881.5 3954.5 2102.4 2861.2 1016 2410 79.7 3419.3 934.8 2893.7 580.2 8123.2 2814.6 1101.2 320.8 856.9 179.6 265956.5 104443.3 185520.7 85843.9 3608 1683.7 2830.9 1272.2 1607.6 539.8 104216.7 50536.6 4390.1 1240.9 2611.7 510.3 6363.7 2616.2 10651.6 3928.2 226999.3 98286 7944.7 3078.4 275013.9 110592.9 3914.4 1285.1 32383.2 9061.6 4796.4 1488.4 3942.1 1190.4 12812.3 2765.2 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0099735/manifest

Comment

Related Items