UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies of XIST and macroH2A1.2 independent of gene silencing : subtitle a unique hybrid cell model system Kwok, Edmund 2002

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2002-0455.pdf [ 9.16MB ]
Metadata
JSON: 831-1.0099696.json
JSON-LD: 831-1.0099696-ld.json
RDF/XML (Pretty): 831-1.0099696-rdf.xml
RDF/JSON: 831-1.0099696-rdf.json
Turtle: 831-1.0099696-turtle.txt
N-Triples: 831-1.0099696-rdf-ntriples.txt
Original Record: 831-1.0099696-source.json
Full Text
831-1.0099696-fulltext.txt
Citation
831-1.0099696.ris

Full Text

STUDIES O F XIST A N D M A C R O H 2 A 1 . 2 I N D E P E N D E N T O F G E N E SILENCING: A UNIQUE HYBRID C E L L M O D E L S Y S T E M  By  EDMUND KWOK B.Sc. University of British Columbia, 2000  A THESIS S U B M I T T E D I N P A R T I A L F U L F I L L M E N T O F T H E REQUIREMENTS FOR THE D E G R E E OF  M A S T E R OF SCIENCE In  THE F A C U L T Y OF G R A D U A T E STUDIES D E P A R T M E N T OF M E D I C A L GENETICS We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA August 2002 © Edmund Kwok, 2002  In  presenting  degree freely  at  this  the  available  copying  of  department publication  of  in  partial  fulfilment  of  the  University  of  British  Columbia,  I  agree  for  this or  thesis  reference  thesis by  this  for  his thesis  and  scholarly  or for  her  of  T h e U n i v e r s i t y o f British Vancouver, Canada  DE-6  (2/88)  Columbia  I  further  purposes  gain  that  agree  may  be  It  is  representatives.  financial  permission.  Department  study.  requirements  shall  not  that  the  Library  an shall  permission  granted  by  understood be  for  allowed  the that  without  for head  advanced make  it  extensive of  my  copying  or  my  written  ABSTRACT X chromosome inactivation results in the transcriptional silencing of one of the two X chromosomes present in mammalian female cells. XIST expression from the inactive X (Xi), and subsequent coating of the Xi by the XIST RNA, marks the initial major observable characteristic of X-inactivation. The Xi then begins to exhibit features of heterochromatin such as gene silencing, late replication, histone modification, hypermethylation, and the recruitment of core histone variants. However, the exact mechanistic events between XIST expression and the final heterochromatic state of the Xi remain unclear. To better understand the relationship between XIST, heterochromatin, and silenced gene expression, the first goal of this study was to develop and characterize a model system suitable for examination of those features of heterochromatin which can be induced by XIST independent of gene silencing. Previous work using rodent/human hybrids (containing active human and mouse X chromosomes) that had been demethylated to reactivate XIST/Xist expression showed that while human XIST RNA fails to localize properly to the human Xi, the mouse Xist localizes normally. In both cases no silencing of X-linked genes was observed. To verify this hybrid cell system as a model for studying the effects of XIST/Xist independent of inactivation, I examined the DNA methylation, H3 acetylation, and gene expression statuses of multiple human and mouse X-linked genes in these hybrids. The results confirm both i)the reactivation of XIST/Xist due to demethylation, and ii)the lack of gene silencing despite the presence of XIST/Xist.  This study also examined the core histone variant macroH2A1.2 as the first candidate for study using this hybrid system. Past evidence has shown tight macroH2Al .2 localization to the Xi, and that this macrochromatin body (MCB) formation is abolished if the Xist gene was deleted. I created a macroH2A-GFP construct that was expressed within the hybrid system, and the results suggest that XIST RNA localization is required for proper human macroH2A1.2 localization, probably via a ribonucleoprotein complex. Furthermore, the evidence suggests that there may be species-specific differences in macroH2A1.2 that affects its interaction with XIST or Xist RNA.  TABLE OF CONTENTS  Page Number  ABSTRACT  ii  TABLE OF CONTENTS  —  iv  LIST OF TABLES  vii  LIST OF FIGURES  viii  LIST OF ABBREVIATIONS  ix  ACKNOWLEDGEMENTS  xi  1 INTRODUCTION —  —  1.1 X chromosome inactivation 1.1.1 Background 1.1.2 X chromosome inactivation center 1.1.3 Mechanism of X-inactivation 1.2 Features of Xi 1.2.1 XIST 1.2.1.1 Gene structure 1.2.1.2 Gene expression 1.2.1.2.1 Tsix 1.2.1.3 Role in X-inactivation 1.2.1.3.1 Recruitment of chromatin proteins 1.2.1.4 Functional Domains 1.2.2 DNA methylation — 1.2.3 Histone modifications 1.2.3.1 Acetylation 1.2.3.2 Methylation 1.2.3.3 Phosphorylation 1.2.3.4 Histone code 1.2.4 Replication timing 1.2.5 Histone variants 1.2.5.1 macroH2A 1.2.5.1.1 macroH2Al 1.2.5.1.2 macroH2A2 1.2.5.1.3 macroH2A-Bbd 1.2.5.2 Role in X-inactivation 1.2.5.2.1 Macrochromatin bodies 1.2.5.2.2 Sequence Analysis — 1.2.5.2.3 Functional domains 1.2.5.2.4 Involvement in heterochromatin 1.2.5.2.5 Possible mechanism of interaction 1.3 Rodent/Human hybrid cells  1 1 1 2 3 6 — 6 6 6 7 -8 9 — 10 —- 11 — - 15 - 15 18 20 20 - 22 — 23 24 - 24 26 26 26 26 - 28 29 32 — 33 — 34  iv  1.3.1 XIST localization 1.3.2 Ideal model----1.4 Thesis goals 2 MATERIALS & METHODS 2.1 Tissue culture methods 2.1.1 Cell lines 2.1.2 Freezing cells 2.2 Examining gene methylation status 2.2.1 DNA extraction 2.2.2 Methylation-sensitive restriction digests 2.2.3 Polymerase chain reaction (PCR) 2.3 Examining gene expression status — 2.3.1 RNA extraction 2.3.2 DNase treatment of RNA —2.3.3 Reverse Transcription (RT) 2.3.4 PCR using cDNA 2.4 Cloning 2.4.1 Plasmid preparations from bacteria 2.4.2 Bacterial transformation 2.4.3 Cloning inserts into vectors 2.4.3.1 Inserts 2.4.3.2 Vector insertions 2.4.3.3 Construct verification 2.5 Lipofection 2.6 Chromatin immunoprecipitation (ChIP) assay 2.6.1 PCR ChIP results 2.7 Microscopy 2.7.1 Cremer preparations (fixing cells) — 3 CHARACTERIZATION OF HYBRID MODEL SYSTEM 3.1 Introduction 3.2 Results 3.2.1 Methylation status results 3.2.2 Expression status results 3.2.3 Acetylation status results 3.3 Discussion 4MACROH2A1.2 —-4.1 Introduction 4.2 Results 4.2.1 Missing human factor? — 4.2.2 macroH2A1.2 - GFP constructs 4.2.3 Localization 4.3 Discussion  37 40 41  —-  42 — 42 —- 42 42 43 43 44 46 46 47 47 48 49 52 52 53 54 54 57 58 58 59 61 63 63  —  64 64 67 67 69 72 74 77 77 79 79 83 83 91  v  5 DISCUSSION AND FUTURE DIRECTIONS  —  -  96  REFERENCES  100  APPENDIX  110  vi  LIST OF TABLES  Page Number  Table 1-1: Human/Mouse Hybrid Cell Lines Table 2-1: Primers for Determining Methylation Status  36 —  45  Table 2-2: Primers for Determining (Human) Expression Status  50  Table 2-3: Primers for Determining (Mouse) Expression Status  51  Table 2-4: Primers for Amplifying macroH2A1.2 Inserts  55  Table 2-5: Primers for ChIP Analysis  62  Table 4-1: Hybrid Cell Lines Containing Human Xi and Other Chromosomes — 81  LIST OF FIGURES  Page Number  Figure 1-1: Schematic Diagram of the X-inactivation Process  5  Figure 1-2: mH2A Variants  25  Figure 1-3: Functional Domains of mH2Al  31  Figure 1-4: Reactivated XIST/Xist  39  Figure 2-1: Primers for Amplifying macroH2A1.2 Inserts  56  Figure 3-1: Location of Human X-linked Genes  66  Figure 3-2: Methylation Status of X-linked Genes  68  Figure 3-3: Expression Status of Human X-linked Genes  70  Figure 3-4: Expression Status of Mouse X-linked Genes  71  Figure 3-5: Acetylation of H3 Status of X-linked Genes  73  Figure 4-1: Expression of human macroH2Al Variants in Specific Hybrids  82  Figure 4-2: BOSC 23 Transfections  87  Figure 4-3: AHA-1 laBl Transfections  88  Figure 4-4: AHA-1 laBl-A52b Transfections Figure 4-5: AHA-1 laBl-A52b-4Cl Transfections  - 89 90  vm  LIST OF ABBREVIATIONS *NOTE: Throughout this thesis, gene names with all capitalized letters refer to human genes, whereas names with only thefirstletter capitalized refer to murine genes.  5-azaC - 5-azacytidine 5-azadC - 5-aza-2'-deoxycytidine Ada- encodes protein for part of transcription co activator complex w/Gcn5 AG-TG - azaguanine-thioguanine AR - androgen receptor ATF - transcription factor binding DNA-site ChIP - chromatin immunoprecipitation CREB - cyclic AMP response element-binding protein Dnmt - DNA cytosine methyltransferse ES - embryonic stem EST - expressed sequence tag G6pd - glucose-6-phosphate dehydrogenase, X-linked Gcn5 - HAT homolog in yeast, encodes protein for part of transcriptional co activator complex w/Ada FMR1 - fragile X mental retardation 1, X-linked GFP - green fluorescent protein HAT - histone acetyltransferase HDAC - histone deacetylase HMT - histone methyltransferase HP1 - heterochromatin protein 1 HPRT- hypoxanthineguanine-phosphoribosyl transferase, X-linked LINE - long interspersed nuclear element MBD - methyl CpG binding protein MCB - macrochromatin body MCD -macrochromatin domain MDF - microtubule depolymerizing factor MeCPl/2 - MBD proteins, X-linked mH2A - macroH2A (refers to variants 1.1, 1.2, and 2) MLE - maleless, a helicase protein MMLV-RT - Moloney murine leukemia virus reverse transcriptase MOF - males absent on the first, a histone acetyltransferase MSL-1, -2, -3 - male-specific lethal chromatin proteins mXist - mouse Xist PDHAl/Pdhal - pyruvate dehydrogenase (lipoamide) alpha 1, X-linked PGKl/Pgkl - phosphoglycerate kinase 1, X-linked PHKAl/Phkal - phosphorylase kinase, alpha 1, X-linked PNA - peptide nucleic acid roXl/roX2 - genes for non-coding RNA critical for X-linked dosage compensation in melanogaster RT - reverse transcription  RT-PCR - reverse-transcription PCR SAGA - part of transcription complex in yeast Su(var) - suppressor of variegation TAFII250 - transcriptional regulator TIMP1 - tissue inhibitor of metalloproteinase 1, X-linked TSIX/Tsix - human/mouse antisense of XIST/Xist Ubel - ubiquitin-activating enzyme E l , X-linked Xa - active X chromosome Xce - X-controlling element (mouse) Xi - inactive X chromosome XlC/Xic - human/mouse X-inactivation center XIST/Xist - human/mouse inactive X transcript XPCT- X-linked PEST-containing transporter Zfx - zinc finger protein, X-linked  ACKNOWLEDGEMENTS I have been extremely fortunate to have Dr. Carolyn Brown as my graduate studies supervisor; she has provided me with unparalleled guidance and enthusiasm, and her continual support is greatly appreciated. I would also like to extend my thanks to members of the Brown lab, in particular Cathy Anderson for her amazing patience, Sarah Baldry for her technical expertise, and Jennifer Chow for her wonderful insights and encouragement. Finally, I would like to acknowledge Tracy Tucker for being there every step of the way, and my family for their undying support.  xi  CHAPTER 1: Introduction  1.1 X chromosome inactivation  1.1.1 Background Spawned from a hypothesis initially proposed just over forty years ago by Mary Lyon, the concept of X chromosome inactivation refers to the transcriptional silencing of one of the two X chromosomes present in each mammalian female cell 1. Since each male cell contains only one X chromosome, X-inactivation compensates for dosage differences in X-linked genes between the sexes. In eutherians, X-inactivation occurs in a random fashion, meaning that during early development in the soma either one of the two X chromosomes can be silenced 2,3. In contrast, marsupials utilize a type of imprinted X-inactivation, with the paternal X being preferentially silenced 4>5 This latter mechanism has been thought to be a more ancestral form of X-inactivation 6, and this thesis will concentrate more on the random X-inactivation. Regardless which of these X chromosomes is inactivated, the silenced state is then faithfully inherited in all clonal descendants, and in the case of the random X-inactivation, results in a mosaic pattern of cells in mammalian females 2>3. Over the past forty years however, the precise details of X-inactivation have become more and more difficult to define. Indeed, although we think of X-inactivation as a chromosome-wide mechanism of gene silencing, the inactive X chromosome (Xi) is not completely inactivated. Roughly 10-15% of genes on the human X chromosome escape X-inactivation 7. Some of these genes have homologs residing on the Y  1  chromosome, most of which are located at the pseudoautosomal region, and thus are required to remain active for dosage compensation 8.  1.1.2 X chromosome inactivation center Several years after Lyon's original hypothesis in 1961, there had already been speculations about the existence of a genetic locus that might be responsible for Xinactivation. Rastan noted that in mouse X-autosomal translocations, specific regions of the X chromosome seemed to always be present in order for "spreading" of inactivation to autosomal regions 9. It wasn't until the nineties, however, that transgenic analysis in murine embryonic stem (ES) cells provided solid evidence of a X-inactivation center (XIC). Experimental evidence showed that mouse autosomes could be inactivated when certain X chromosome sequences (~450kb) from the mouse Xic were present in cis \ 1U  The human XIC has been narrowed to a region located at Xql3, and is currently defined as a cis-acting locus that is essential for the X chromosome to be inactivated early in female embryogenesis. Contained within the XlC/Xic is a gene encoding an "inactive X transcript", or XIST/Xist, which is exclusively expressed from the inactive X chromosome in interphase nuclei 11-13. XIST is a functional RNA that appears to "coat" the Xi completely, and has thus been theorized to be critical in the mechanism of X-inactivation. The importance of this gene is discussed in greater detail in a following section.  2  1.1.3 Mechanism of X-inactivation It is generally accepted that X-inactivation occurs via a multi-step process: counting, choice, initiation, propagation, and maintenance. Early in embryogenesis, a mammalian female cell somehow measures the number of X chromosomes it has per haploid autosome set. Any number of X chromosomes above one per diploid set will be subject to silencing 14. Several studies have shown this counting step to be under the control of the Xic, specifically sequences 3' of the Xist gene, although the exact mechanism is still unclear 15,16 Next one of the X chromosomes is then randomly 5  chosen to remain active. Once the choice of the inactive X chromosome is determined, the next series of steps happen in a less-well understood flurry of events. The first sign of the initiation of X-inactivation is decreased expression of the XIST antisense TSIX on the inactive X chromosome, followed by increased expression of XTSTRNA and its subsequent localization to the chosen Xi. Soon thereafter, the Xi exhibits many features of transcriptionally silent heterochromatin: hypermethylation, hypoacetylation of core histones, chromatin condensation and nuclease insensitivity. Recently, a histone variant called macroH2A has also been shown to localize preferentially to the inactive X, although only after initiation 17. All these features of Xinactivation appear to "spread" outwards from the XIC and along the whole X chromosome 18. This ability to induce heterochromatic features onto whole chromosomes seems to mainly depend on the physical presence of the XIC; in somatic cells containing X;4q translocations that included the XIC, most of the genes on the involved autosomal regions were inactivated 19. The actual distance of the affected genes' loci and the XIC did not seem to correlate with gene inactivation, as some genes  3  that remained active were located interstitially throughout the autosomal region. The fact that some genes appeared to be able to "resist" inactivation by the XIC suggests that there may be some unique feature of the X chromosome that allows for greater responsiveness to XlC-induced inactivation. This is not an absolute characteristic of the X chromosome, as there are genes that do escape inactivation 7. Early translocation studies suggested that perhaps the X chromosome contains a series of way stations throughout its chromatin, specific spots upon which XIST RNA can bind more readily 3,20 A recent proposal indicated long interspersed nuclear elements (LINEs) as being such way stations, since the X chromosome contains a significantly higher density of LINES (comparable to that found in pericentromeric regions) than the rest of the genome ^ . Once the X chromosome becomes transcriptionally silent, it remains so throughout the cell cycle, and the inactive state is maintained in all clonal descendants. One theory to explain such observations is thus: XZSTRNA recruits certain factors that silence genes and condense chromatin structure on the Xi (see Figure 1-1). Features such as DNA methylation, histone deacetylation, and macroFOA localization may act in maintaining this silenced state. It is very difficult to experimentally prove/disprove such a theory, however, since these heterochromatic features do not normally accumulate independent of each other; a step-wise breakdown of X-inactivation mechanism is thus poorly defined.  4  OCT  |~  XIC  XIC Xist RNA coating iz? era  Late Replication Gene Silencing Histone M e d i a t i o n s ? MacroH2A • DNA Methylation  Figure 1-1: Schematic Diagram of the X-inactivation Process XIST/Xist expression from the XIC marks thefirstsign of X-inactivation, followed by the rapid accumulation of a succession of heterochromatic features.  5  1.2 Features of Xi  1.2.1 XIST First discovered in 1991H, the XIST gene (and its transcribed product's intimate relationship with the inactive X) remains as the primary candidate responsible for initiating X-inactivation.  1.2.1.1 Gene Structure One of the genes that is located within the XIC, the XIST gene encodes a relatively long RNA product: the human XIST is roughly 19.3kb, and the mouse Xist measures 17.8kb 21,22. The RNA itself is an alternatively spliced transcript, and subsequent sequence analysis of the XIST gene product using human/mouse comparisons failed to reveal any long conserved open reading frames 23,24 Combined with the observation that the XIST RNA, when examined using fluorescence in situ hybridization (FISH), maintains a nuclear localization, it is most likely a functional RNA 23,25  1.2.1.2 Gene Expression The XIST/Xist gene on the active X chromosome is silent, accompanied by methylation of its promoter region 26,27 Mouse embryos engineered with defective DNA methyltransferases demonstrate Xist expression in both males and females, presumably due to hypomethylation of the gene's promoter 2. On the inactive X chromosome, the XIST gene is transcribed, but the RNA itself remains untranslated and nuclearly localized 25. i mouse, prior to X-inactivation both X chromosomes express n  6  low levels of Xist. During the initiation of the whole inactivation process, the X chromosome destined to become the inactive X upregulates its Xist expression. Cytogenetically, one can observe the XIST RNA physically coating the inactive X, and colocalizing with the Barr body 25. Most agree that upregulation of XIST expression is the primary (observable) step in silencing the inactive X, and is undoubtedly an essential step for proper X-inactivation 28,29 j  na  tudy using a modified Xist gene where the  s  minimal promoter sequences were retained, it was shown that the presence of Xist RNA and not the actual expression of the gene is the crucial factor for inactivation 28, How XIST expression is actually regulated, however, remains unclear. In mice the X controlling element (Xce) locus, residing 3' to the Xist gene, acts as a strong modifier of choosing an inactive X chromosome; an X chromosome containing a "strong" allele for the Xce gene has a greater chance of being chosen as the active X chromosome 30. Although no orthologous locus has been identified in humans, recently an antisense locus 3' to and partly overlapping the Xist gene (and thus named Tsix) has been uncovered and is suspected of being the primary candidate for regulating Xist expression 16. A human ortholog TSIX was subsequently identified a couple years later 31.  1.2.1.2.1 Tsix Tsix encodes a transcript that starts roughly 40kb downstream of Xist and in its unprocessed form overlaps the entire Xist locus 16. A processed version of the primary transcript has been recently observed in murine ES cells, although its significance is unknown 32. Much like the Xist RNA, Tsix RNA has no recognizable open reading frame and resides in the nucleus; but unlike Xist, Tsix is eventually up regulated on the  7  active X chromosome, and down regulated on the inactive X chromosome. In fact, studies in mice with a deleted Tsix gene demonstrated that Tsix might act antagonistically to Xist 33. in the placental tissues of these mice, the paternal X chromosome is preferentially silenced (and thus Xist is expressed); but in the absence of the Tsix gene, the maternal allele of Xist in these cells also remains expressed 32,33 Lik; Xist, Tsix is e  initially expressed from both X chromosomes prior to X-inactivation. Using RNA-FISH, Tsix RNA been observed to diminish from the future inactive X immediately prior to Xist RNA accumulation 34.  1.2.1.3 Role in X-inactivation Studies in developing cells have shown that XIST expression is an early step in Xinactivation 28,29 As mentioned, the XZSTRNA physically coats the inactive X chromosome in cis; this association is lost during mitosis, but continued transcription of the RNA and its localization is regained in the daughter cells 10,25 Some experiments have provided evidence that the actual stability of the XIST transcript may be the direct trigger of X-inactivation 29. Although substantial disagreement exists in explaining how this increase in transcription/transcript stability is achieved 35 there is strong evidence s  that this trigger for X-inactivation must occur within a specific time window early in development. Deletion of the XIST gene in somatic cells that have already undergone inactivation generally fails to induce any kind of reactivation of the inactive X 36. i  n  fact, even with induced Xist expression and correct coating of Xist RNA to the X chromosome in adult somatic cells, X-inactivation cannot be achieved 37. Only when a Xist transgene is induced in undifferentiated ES cells can X-inactivation be induced; the 8  same Xist transgene failed to inactivate X chromosomes in cells that have already undergone differentiation. However, a recent study using human fibrosarcoma cells demonstrated that ectopic XIST expression was able to induce inactivation of autosomal regions, suggesting that human X-inactivation may be possible within a less stringent time frame 38. This i the only study to date that was able to experimentally show XISTs  induced inactivation in differentiated cells, and much further work is still required to confirm whether this is applicable to not only autosomal regions but also the human X chromosome.  1.2.1.3.1 Recruitment of Chromatin Proteins One likely role of XIST RNA is the recruitment of certain proteins to the inactive X chromosome, either for the initiation and/or maintenance of a heterochromatic state. This hypothesis is partly based on studies done in D. melanogaster, where X-linked dosage compensation also occurs albeit in a slightly different manner. In the fruit fly, the single X chromosome present in the male becomes hypertranscribed in order to match the regular transcription of genes on the 2 X chromosomes present in females. Much like mammalian X-inactivation, dosage compensation in Drosophila depends critically on functional RNAs, namely roXl and roX2 39. These non-coding RNA molecules exert their actions through the recruitment of 5 male-specific lethal proteins: MSL-1, -2, -3, MLE, and MOF 39. These proteins form a complex and are localized along the male X chromosome, presumably changing chromatin features and facilitating the upregulation of X-linked genes; the MOF protein for example, contains an innate histone acetyltransferase activity 39.  9  Similarly, human XIST RNA may also be responsible for interacting with and recruiting chromatin proteins to the inactive X chromosome. Chromatin immunoprecipitation experiments targeting hypoacetylated H3 and H4 core histones have found an association with Xist RNA, supporting the theory that the functional RNA might be recruiting certain protein factors capable of altering chromatin features 40 The most convincing evidence of a relationship between XIST RNA and a chromatin protein is the discovery of the core histone variant macroH2A 41, a topic that will be discussed in further detail in following sections of this thesis.  1.2.1.4 Functional Domains While the ultimate consequences of XIST/Xist expression are quite clear, how the actual functional RNA molecule exerts its actions remain largely unknown. Some light has recently been shed on the subject by Wutz et al 42; they performed a deletion analysis of the mouse Xist RNA to identify specific functional domains in the molecule. Utilizing a Cre-loxP based transgene approach, the researchers integrated different inducible modified Xist sequences into a specific site on the X chromosome of murine ES cells. Since silencing of the single X chromosome in the male cells results in cell death, the silencing ability of the different transgenic Xist sequences can be measured by degree of cell death. Their published results showed that a 0.9kb region of highly conserved poly-A repeats at the 5' end of Xist was crucial for proper silencing function; large deletions in either the middle or 3' end of Xist had little/no effect on Xist function. RNA FISH revealed that Xist molecules lacking the 0.9kb region were still able to localize to the Barr body, indicating that additional domains are required for localizing Xist to the X  10  chromosome. By fusing the 5' region minimally required for Xist function to different parts of Xist, they identified 3 domains that may contribute to the localization of Xist. To analyze the nature of how the 900bp critical region functions, the researchers inserted a Xist transgene that had the 900bp region placed at the 3' end of Xist. They observed no abolishment of silencing function, suggesting that actual location of this critical region in Xist is not important. Computational analysis demonstrated that this core sequence can form secondary structures of 2 stem loops, and that this 5' repeat region is comprised of 7.5 repeat units of a combination of these two stem loops. Replacement of bases with different bases, while maintaining proper base-pairing required for secondary structures to be conserved, failed to affect Xist's silencing function. Thus, Xist does appear to physically interact somehow with something in a sequence specific manner to initiate Xinactivation. Interestingly, deletions in the middle of Xist, as well as a 3' truncation of Xist, resulted in the loss of macrochromatin body (MCB) formation (see Section on macroH2A). One study used PNA (peptide nucleic acid) interference to functionally eliminate certain specific regions of the Xist RNA, and discovered that MCBs were lost when the C-terminal region of Xist was blocked 43. Although this confirms an intimate relationship between Xist RNA and macroH2A, whether this relationship is direct or indirect remains unclear.  1.2.2 DNA Methylation One well recognized feature of heterochromatin in mammals is the methylation of DNA. Enzymes known as DNA cytosine methyltransferases (DNMTs) add methylgroups to the 5-position of specific cytosine residues 44,45 At the molecular level it has  11  been shown that the addition of a methyl-group to these sites can physically change the appearance of the major groove in a DNA helix, a chromatin alteration that may affect target sites for many DNA binding proteins, including transcriptional machinery 46,47 DNA methylation can thus serve as an epigenetic marker for modifying expression levels of affected genes, and in mammals methylation is associated with the reduction in transcriptional initiation. This particular epigenetic marker can be copied after DNA synthesis from cell cycle to cell cycle, resulting in a heritable feature of heterochromatin. It is important to note that 5-methylcytosine can spontaneously undergo deamination and be converted to a thymine residue 48 Whereas a non-methylated cytosine deamination (resulting in a uracil base) can easily be recognized and replaced by repair enzymes such as uracil DNA glycosylase, a base mismatch resulting from a C -> T conversion is more likely to be overlooked. Throughout evolution, CpG content in the human genome has slowly but consistently been depleted with the exception of certain regions, especially those found near the 5'-promoter sequences of genes; these are found to have the expected frequency of CpG dinucleotides 49. Clusters of CpG dinucleotides are thus, in general, underrepresented in the whole human genome. As a result, regions of relatively high CG content known as CpG islands (usually l-2kb in length) have restriction sites for certain rare-cutting enzymes. CpG islands in mammals are usually found near the 5' end of genes and, as a general rule, are unmethylated with a couple of exceptions. Imprinted genes, as well as inactivated genes in the Xi, are both found to be methylated. The first DNMT to be cloned in mammals was DNMT1, a ~200kDa protein with key functional domains in both its N-terminal (which contains regulator domains  12  responsible for targeting specificity) and C-terminal domains (which shows homology to bacterial cytosine-5 methylases) 50 There has been experimental evidence that the Nterminal domain actually targets replication foci of a replicating DNA strand, a function that has been hypothesized to contribute to the inheritance of methylation by the genomes of daughter cells 50 From observations that embryonic stem cells deficient for Dnmtl (Dnmtl-/-) can still methylate DNA de novo 51, however, it is apparent that other enzymes are capable of methylating DNA. Another group of DNMTs was recently found to have DNA methylating abilities, and these were labeled DNMT3a and DNMT3b. By observing expression levels of these genes in differentiated and ES murine cells, it was found that there was a correlation between increased tissue-specific gene expression and decreased Dnmt3a/b expression 45. it is now believed that while Dnmtl methylates hemimethylated DNA (and thus is involved in the maintenance and inheritance of methylation patterns), Dnmt3a and Dnmt3b are responsible for de novo methyltransferases activities in the cell 52, The actual association of DNA methylation to levels of gene expression was initially observed over two decades ago in experiments using 5-azacytidine. Treatment of mouse embryonic cell lines with 5-azacytidine resulted in a drastic change in phenotype, with cells becoming differentiated 53. Even more interestingly, mouse embryonic cells can be forced to differentiate when transfected with DNA taken from 5-azacytidine treated cells (i.e. methylation marks being copied onto newly synthesized DNA strands), demonstrating the heritable nature of this phenomenon 54. Originally 5-azacytidine and its deoxy- version 5-aza-2'-deoxycytidine were thought to be strong demethylating agents, with their mode of action being the replacement of cytosines with analog residues  13  resistant to methylation in the cellular DNA after DNA replication. Later it was suggested that 5-azacytidine and 5-aza-2'-deoxycytidine can covalently "trap" DNA methyltransferases to the DNA, resulting in a consistent loss of methylation with each successive round of cell division 55. Regardless of the how 5-azacytidine works, numerous other studies have supported the observations from the initial experiments in mouse embryonic cell lines: DNA methylation in promoter regions of genes appears to act as a powerful suppressor of gene expression 56 As mentioned before, methylated cytosines most likely affect transcription by modifying binding affinities of certain factors/proteins. For example, sequence-specific transcription factors such as ATF/CREB have target sequences that contain CpG dinucleotides, and methylation at these target sites may inhibit efficient binding 57. Additionally, there is a certain class of DNA binding proteins that targets methylated CpG specifically; MeCPl and MeCP2 are both members of this MBD family of proteins, and they may affect gene expression by competing with transcription factors for DNA binding, or by altering local chromatin structure to resemble transcriptionally silent heterochromatin 58. One aspect of this "chromatin change" is modification of core histones, a topic to be discussed in detail in a later section of this thesis. Generally, acetylation of core histone tails appears to correlate closely with a local "open" chromatin structure and high gene expression, whereas regions with hypoacetylated histones seem to repress transcription activity 59. Recently, it has been shown that MeCP2 can recruit a histone deacetylase (HDAC1) to methylated DNA, resulting in a closed chromatin conformation that is transcriptionally repressed 56,60  14  The exact reason why mammals have evolved to be so dependent on DNA methylation remains a mystery. Invertebrates such as C. elegans and D. melanogaster do not have extensive CpG methylation systems, and some researchers believe that only larger and more complex organisms require DNA methylation as a control mechanism for large volumes of transcriptional noise. Alternatively, some have argued that DNA methylation serves as a method of silencing expression from foreign viral DNA sequences; these theories are based on the fact that a large percentage of hypermethylated CpGs are found near/within retrotransposons. Regardless of the reason, methylation is essential for proper mammalian development. While mouse undifferentiated ES cells are not dependent on DNA methylation, proper cellular differentiation requires a concise, specific series of demethylation and methylation steps 61,62 Generally, parental methylation marks are removed during gametogenesis and a new set of methylation marks are established upon implantation and throughout gastrulation.  1.2.3 Histone Modifications  1.2.3.1 Acetylation In eukaryotes, naked DNA is constantly associated with many different DNAbinding proteins, and together this chromatin goes through a series of packaging and unwinding steps during a cell's life cycle. The most basic unit of chromatin compaction exists as the nucleosome, which is a complex of eight core histones (two of each of histones H2A, H2B, H3, and H4) around which is coiled 146 bp of double-stranded DNA helix 63. The N-terminal tails of core histones are rich in lysine residues, which are  15  positively charged under normal cellular conditions. This overall positive charge on histone tails has been proposed to allow interaction with the DNA directly, resulting in a higher level of chromatin packaging. However, more recent studies on the crystal structure of the nucleosomes revealed that the tails of the core histones actually pass through the gyres of the DNA double helix, and are free in solution instead of interacting with the DNA 64. More likely, these histone tails are candidates for interactions between nucleosomes, responsible for bringing the basic units of DNA compaction together to form higher order structures. In both cases, acetylation of the histone tails has a net effect of neutralizing the lysine charges, resulting in decreased histone-DNA and/or histonehistone interactions. Whereas transcription by RNA polymerase is prohibited in regions of DNA associated with deacetylated core histones, acetylation of these histone tails facilitates the previously silent transcription process, suggesting a loss of higher order compaction of chromatin 65. Molecularly, a large family of enzymes known as histone acetyltransferases (HAT) is responsible for adding acetyl groups to specific lysine residues on the core histone tails 66. Each HAT subfamily has its own specificity in regards to individual lysine residues on different core histones; more interestingly, in vivo HATs are usually complexed in multisubunit complexes that can modify their specificity 67. F  o r  example  Gcn5, a HAT homologue in yeast, on its own has been shown to preferentially acetylate lysine 14 of histone H3 68,69 when complexed in the Ada or SAGA multiprotein units, however, the specificity expands to lysines 9, 14, and 18, as well as gaining a new preference for histone H2B 70. The actions of HATs in a cell are balanced by the effects of histone deacetylases (HDAC). At least eight HDACs have been cloned so far 71 and ;  16  there is increasing evidence that these also participate in forming multiprotein complexes resulting in a wide range of specificity 72. The acetylation status of core histones is thus a tempting candidate for a regulatory mechanism of chromatin compaction, and consequently accessibility for transcriptional factors. This is supported by not only the complexity and specificity of HATs and HDACs, but also experimental observations. As early as the 1960's, it had been noted that there is an association between the acetylation state of core histones and gene expression status 73,74 Follow-up studies revealed that regions of transcriptionally active chromatin are more likely to contain hyperacetylated core histones 75,76 More strikingly, many co activators of transcription were found to have acetyltransferase activity, one these being Gcn5 in yeast. In D. melanogaster, the presence of hypoacetylated H4 has been observed in the heterochromatic regions of metaphase chromosomes 77,78 Further supporting the idea that gene expression is affected by acetylation status, others have demonstrated that core histone acetylation preferentially occurs at promoters of subsequently activated genes 68,79 Similarly, deacetylation at promoters has been correlated with gene silencing 80. In the context of the inactive X chromosome, it is similar to heterochromatin in that overall it stains poorly with antibodies against acetylated core histones 81,82 -p e n  hypoacetylation of H4 has been shown in both eutherians and marsupials, demonstrating that this property is highly conserved 83. i experiments where mouse embryonic stem n  (ES) cells were induced to differentiate (and thus initiate X-inactivation), it was observed that H4 acetylation at promoters of X-linked genes (Day 4) followed closely soon after Xist expression (Day 2) 84. 17  1.2.3.2 Methylation First observed in the 1960's, post-translational addition of methyl groups to histone tails had eluded functional characterization for nearly four decades 85. Histone methylation is facilitated by enzymes known as histone methyltransferases (HMTs), and the main targets of this modification are lysine residues on the amino-tails of H3 and H4 core histones 86. A varying range of the number of methyl groups at a single residue resulting in mono-, di-, or tri-methylated residues has been observed, although the significance of this remains unclear 87. What is clear is that, much like histone acetylation, there are specific lysine residues that are preferentially methylated 86. On both H3 and H4 tails, unique lysine residues are target for either acetylation or methylation; only one lysine (Lys9) in the H3 tail has been experimentally shown to be a target for both types of modification, although many investigators suspect that it is highly possible for other acetylated lysines to be targeted for methylation 87. Not unlike histone acetylation, histone methylation was initially thought to simply alter physical interactions between the histone tails and DNA. This is deduced from the fact that, although methylation of histone tails does not affect overall charge (unlike histone acetylation), increased histone tail methylation appears to strengthen its affinity for anionic substances such as DNA, as reflected by increased resistance to trypsin digestion 88,89 More recently it has become clear that methylation might also be a mark for recruiting chromatin-associated proteins to facilitate particular transcriptional responses 90. Either way, histone tail methylation has been shown to have an effect on the expression status of nearby genes. For example, DNA prepared from chromatin immunoprecipitations using hyperacetylated H4 (from transcriptionally active regions)  18  has been shown to be a target for H3 methylation . How these different modifications y 1  cooperate to upregulate transcription still remains unclear. Recent work in D. melanogaster and 5*. pombe, however, have provided strong evidence that HMTs play significant roles in regional silencing, or position effect variegation (PEV). PEV is an epigenetic phenomenon where if a transcriptionally active gene is removed from its euchromatic region and inserted into a heterochromatic position in the genome, the gene becomes silenced 92-94 This epigenetic effect is heritable through mitosis and meiosis 95,96 Genetic screens have been used extensively in D. melanogaster and S. pombe to identify genes responsible for PEV; these genes fall into two categories, enhancers and suppressors of variegation. To date, there are about 40 loci that have been identified as suppressors of variegation (Su(var)), responsible for chromatin changes resulting in regional silencing 87,92 These genes encode for proteins that are responsible for a variety of functions, including HDACs, protein phosphatases, and heterochromatin-associated proteins 97,98 One particular suppressor in D. melanogaster, Su(var)3-9, has been found to localize to heterochromatic regions, and seems to regulate the architecture of the condensed chromatin 99  i  n a  recent experiment, it was demonstrated that the human homolog of  Su(var)3-9, SUV39H1, is actually a HMT targeting Lys9 of the core histone H3  1 0  ° . In  the same study, researchers were able to show that overexpression of SUV39H1 resulted in ectopic heterochromatin formation, demonstrating this HMT's effect on chromatin architecture. Mouse knockouts for this gene resulted in divisional defects in mitosis with an overall decrease in heterochromatin formation, further supporting HMTs' importance in gene regulation 100 Qne of the prime candidates assumed to be partly responsible for  19  establishing a heterochromatin state at H3 Lys-9 is heterochromatin proteinl (HP1); it contains a well-conserved chromo-domain which has been shown to bind to methylated H3 Lys-9 in vitro 101,102  1.2.3.3 Phosphorylation Phosphorylation of H3 tails also appears to be important for chromosome condensation 103. Paralleling the observations seen for other core histone tail modifications, phosphorylation of specific amino acid residues is required for significant and reproducible effects. For example, Ser 10 of H3 appears to be a unique target for phosphorylation, and is associated with transcriptional activation along with Lys-9 acetylation 104-106  1.2.3.4 Histone Code It is thus clear that although histones throughout the genome have relatively generic structures, different modifications to their tails can result in a staggering array of variation. The identification of a rapidly growing number of accompanying enzymes, with multiple specificities for different histone modifications, is providing solid support for the existence of a "histone code" 107. This code maintained at the histone level provides a further extension of information beyond what is encoded by the DNA base pairs themselves. In their review, Jenuwein & Allis 107 identify what key components are necessary for a functional "histone code". First of all, the covalent histone modifications described previously must provide a target for effector molecules/enzymes to bind to. It  20  has been experimentally proven that many enzymes contain unique domains that target histone tail modifications; for example, the bromodomain on many transcriptional regulators has been shown to preferentially interact with specific acetylated lysine residues on histone tails 108-110 Chromodomains, like the one present in the HP1 protein, target methylated histone tails specifically 102. These effector molecules in turn presumably facilitate changes from euchromatin to heterochromatin, and vice versa. Indeed, many transcriptional activators contain bromodomains, whereas in the case of HP1 the presence of a "chromoshadow" domain suggests self-dimerizing abilities leading to inter-nucleosomal condensation 111,112. A second prediction of the histone code theory dictates that there is a further level of complexity beyond individual covalent modifications. It seems that some of these modifications (whether on the same or different histone tails) may be interdependent, and may in fact act in some combinatorial manner to signal final chromatin effects. For example, the transcriptional regulator TAFII250 contains tandem copies of the bromodomains and binds preferentially to diacetylated histone amino acid residues that are correctly spaced 113. In addition to the fact that acetylation, methylation, and phosphorylation all occur in close proximity on core histone tails, all three modifications can be found in both active euchromatin and inactive heterochromatin 107. i f t n  ac  5  certain modifications have been shown to act synergistically/antagonistically with each other; Lys9 of H3 for example, when methylated prevents phosphorylation of SerlO 100. Likewise, phosphorylation of SerlO antagonizes Lys9 methylation, but at the same time couples synergistically with Lys9/Lysl4 acetylation, resulting in transcriptional activation 104-106  other modifications of histone tails such as ubiquitination have also 21  been observed, although they are less well understood. They do however, seem to fit in with the complexity of a histone code; for example, it was recently discovered that in the yeast, ubiquitination of Lysl23 on H2B is a prerequisite for methylation of Lys4 on H3, with the end effect of transcriptional silencing 114 Taken together, these observations further suggest that the histone code is more complex than simple associations between acetylated histones and active chromatin, etc..  1.2.4 Replication Timing It has been known for decades that not all regions of the eukaryotic genome replicate at the same time during S phase 115,116 n  w  a  s a  j  s o  c  i  e a r  those specific  regions that were found to replicate earlier than others tend to exhibit this property through cell generation after generation 11?. In humans, these "early" replicating regions correspond to R-bands, which are GC rich and contain a high proportion of transcriptionally active genes. "Late" replicating regions thus correspond to G-bands, which are characterized by a low GC content and a transcriptionally silent heterochromatic state. Centromeres and telomeres fall within this latter category 11^. The inactive X chromosome, although containing no less GC content than the active X, still exhibits late replication. The initial explanation for this difference in replication timing suggested a simple consequence of how chromatin was physically packaged. Euchromatin containing transcriptionally active genes was more open and thus more accessible for replication origin-binding proteins and other replication machinery. Euchromatin may also require less physical "unwinding" of DNA for replication to occur.  22  While the exact details at the molecular level are still being worked out in the human, it is clear that replication timing corresponds nicely to transcriptional activity. In females, asynchronous replication patterns between the active and inactive X chromosomes during S phase have been observed for over 40 years 119. i f t this n  ac  ;  correlation can be observed at the level of individual gene loci on the inactive X chromosome 120; i g single dot/double dot FISH technique first described by Selig et u s  n  al. 121 replication timing of individual genes that were subject to inactivation were s  compared to that of genes that escaped X-inactivation. Their observations supported the theory that transcriptionally active genes were early replicating while transcriptionally silent ones were late replicating. More interestingly, studies showed that late replication timing can be "spread" in X;autosome translocations 122. i other words, autosomal n  regions that normally replicate early in S phase can become late replicating when translocated onto the inactive X chromosome. Evidence for correlation between this spread of late-replication and gene inactivation has been limited however, with only 4 reported cases presently 122-125 j  na r e c e n  t study, however, a clinical case was  presented where long-range inactivation of autosomal genes on a derivative chromosome resulting from a X;10 translocation was found, but without any spread of late-replication 126  1.2.5 Histone Variants Besides XIST, all the features of X-inactivation discussed thus far are general characteristics found in all heterochromatin and not exclusively on the inactive X chromosome. Expectedly, great interest was shown over the past 10 years on another  23  feature of X-inactivation that was exclusive to the inactive X; the recruitment of macroH2A to the Barr body. Initially isolated from rat liver nucleosomes 41, and subsequently from human liver tissue 127, the macroH2A (mH2A) protein is a class of histone-like variants that preferentially colocalizes to the inactive X chromosome.  1.2.5.1 macroH2A The gene for macroH2A encodes a protein three times the size (roughly 42kDa) of the core histone H2A. The N-terminal third of macroH2A is similar to H2A, although the C-terminal of macroH2A contains a large non-histone domain extension of unknown function 41.  1.2.5.1.1 macroH2Al To date there are several variants of macroH2A, one of which is macroH2Al. MacroH2Al has two isoforms that arise from alternative splicing called macroH2Al.l and macroH2Al .2, which differs only by a short stretch of amino acids within the nonhistone domain corresponding to the 6 exon 127 ( th  see  Fig  Ure  1-2). Tissue-specific  expression analysis showed that in the tissues examined, levels of spliced RNA for macroH2Al.2 were much more abundant than those for macroH2Al.l 128. More specifically, tissues that contained mostly few- or non-dividing cells such as the liver, kidney and brain demonstrated significant levels of expression of both variants, whereas tissues such as the thymus and testis showed detectable expression of only the macroH2A1.2 variant 129.  24  mH2Al ATG  i  n  1.2  •I • •• m  rv  v > vi  *vn vm  v  STOP  rx  1.1  vi  mII2A2 ATG  n  STOP  m  rv Exon  v  vi  vn vm  Intron  Figure 1-2: mH2A Variants The two mH2Al variants are transcribed from the same gene but alternatively spliced. The mH2A2 gene resides on a completely different chromosome, but its sequence structure is highly conserved with the mH2Al variants. (Exons/introns not drawn to scale.)  25  1.2.5.1.2 macroH2A2 In 2001, Pehrson's group published a paper describing the discovery of a new macroH2A subtype, macroH2A2, using BLAST searches of expressed tagged sequences (ESTs) 130 A search through the human genome sequence revealed that the human gene for macroH2A2 is located on chromosome 10, as opposed to macroH2Al, which is located on chromosome 5. The study's analysis showed that macroH2A2 is, overall, 68% identical to macroH2A1.2 in amino acid sequence.  1.2.5.1.3 macroH2A-Bbd Another group of researchers using BLAST searches to identify novel H2Arelated proteins, identified another core histone variant that appears to be nuclear but excluded from the Barr body and the Xi 131. Termed H2A-Bbd (Barr body deficient), the researchers observed a uniform nuclear distribution in male cells, whereas in female cells they found a number of "exclusion zones" to be one less than the total number of X chromosomes in different cell lines containing different number of X chromosomes.  1.2.5.2 Role in X-inactivation  1.2.5.2.1 Macrochromatin Bodies Early immunoflouresecence studies on macroH2A1.2 concentrated on determining its distribution pattern within the nucleus. It was shown that macroH2Al .2 localized into dense regions termed "macrochromatin bodies" (MCB). This was in stark contrast to macroH2A1.2 staining on autosomes, which although present, was quite faint  26  in comparison. These MCBs were mostly found in females, and more interestingly they colocalized with the Barr body. Further evidence of macroH2Al .2's involvement in Xinactivation was provided by studies in which the Xist gene was deleted in mouse embryonic fibroblasts in vitro; in these cells, MCB formation was disrupted, and the inactive X chromosome showed no greater colocalization of macroH2A1.2 than autosomal chromosomes 132 More convincingly, a recent study demonstrated that MCB formation can be induced by Xist expression alone 17. Utilizing ES cell lines that allow inducible expression of Xist RNA from Xist genes inserted at autosomal sites, these researchers were able to nucleate the formation of ectopic MCBs on autosomes expressing Xist RNA. Further more, studies have looked at the XY-body (or "sex vesicle") for clues to how X-inactivation occurs in the meiotic prophase of the male germline. This XY-body reflects the inactive, condensed state of the sex chromosomes during meiotic division, a mechanism that's been suggested to help prevent recombination between the X and Y chromosomes 133 Some experimental evidence suggests the possibility of Xist involvement in this male germline X-inactivation by demonstrating that Xist is transcribed only in these cells and not in other male tissues 134-136 Subsequent FISH studies revealed that macroH2A1.2 is also concentrated in the XY-body of early pachytene spermatocytes, further supporting the idea of a XIST RNA-macroH2A1.2 interaction 137. More convincingly, chromatin immunoprecipitation experiments targeting macroH2A were able to pull down Xist RNA 40.  27  1.2.5.2.2 Sequence Analysis Core histones in general are extremely well conserved between most eukaryotes. This is in agreement with the idea that histones play a crucial universal role in packaging genomic material in these organisms. Sequence comparisons reveal that macroH2A variants are also well conserved between species that have diverged a long time ago in evolution. For example, chickens and rats split in evolution roughly 300 million years ago, yet they still show tremendous conservation in their mH2Al.l and mH2A1.2 amino acid sequence: an overall 95% in mH2Al.l and 96% in mH2A1.2 138. The above comparison does not provide much clues about potential unique macroH2A functional domains, given that core histone sequences are well conserved as a rule, and the mH2A variants all share an H2A-similar histone N-terminal. A comparison of the non-histone tail sequence with other organisms will thus provide more useful information. This non-histone region of mH2A1.2 shows significant homology to a gene in some bacteria, roughly 34% with Alcaligenes eutrophus 139 and 30% with E. coli 138. The actual function of the bacteria gene remains to be identified. More intriguing is the homology found between the non-histone tail and some positive-strand RNA viruses: 24% identity to the sindbis virus and 25% to the rubella virus 140,141 j e region of n  homology found in the sindbis virus is actually a part of a protein that associates with viral RNA and is required for synthesizing the negative-strand of the RNA virus 142,143 This then lends support for the theory that macroH2A variants can bind RNA species within the cell, a possible candidate being the XIST RNA.  28  1.2.5.2.3 Functional Domains A recent analysis of the macroH2Al and macroH2A2 sequences, with the availability of a continually changing human genome database, showed that the two histone variants share an overall 80% identity in their amino acid sequences 144 j  n a  n  attempt to dissect which region(s) of macroH2A was crucial for MCB formation (and thus candidates for domains interacting with XIST), Chadwick et al. fused green fluorescent protein (GFP) to different truncated macroH2Al protein regions and observed the fusion proteins' ability to form MCBs 144 T  n e  histone-similar tail (i.e. the N-  terminal third of macroH2A), marked by a GFP fusion, demonstrated MCB formation when transfected into humanfibroblastcells. The non-histone two-thirds of the protein failed to show localization of any kind however, and was distributed throughout the nucleus and cytoplasm. To further identify a specific region responsible for MCB formation, the researchers fused the histone-similar tail of macroH2A that had targeted disruptions to GFP to be used in further transfections. The group identified a stretch of 19 amino acid residues that seemed to be essential for MCB formation; this amino acid sequence was conserved between mH2Al and mH2A2, but different from that of the core histone H2A. This domain was in turn termed the macrochromatin domain (MCD) 144 (see Figure 1-3). Interestingly, the non-histone tail also seemed to harbor a MCD of its own. In the same study, Chadwick et al. found that a fusion protein of the core histone H2B, nonhistone tail of macroH2Al, and GFP formed a MCB when transfected into human fibroblast cells 144. This demonstrated that when localized to the nucleosome, the nonhistone tail of macoH2Al could induce MCB formation. In addition, the use of a H2B  29  fusion instead of a H2A fusion suggests that the position of where this non-histone tail lies in the nucleosome structure does not seem to affect MCB formation efficiency. Instead, MCB formation efficiency appeared to be dependent upon the non-histone tail variant used: H2B fused to the mH2Al.l non-histone tail had much lower localization efficiency than a H2B-mH2Al .2 non-histone tail fusion protein 144. This difference seems to be attributable to a short region between amino acid position 120-175, which showed only 35% identity between mH2Al.l and mH2A1.2 as compared to 68% identity for the rest of the two variants.  30  H2A  Nonhistone  19 A A  M C B region  55 A A  Localization region  Figure 1-3: Functional Domains of m H 2 A l Both macroH2Al.l and macroH2A1.2 variants share similar important domains for MCB formation. The H2A tail is essential for proper localization and incorporation into the nucleosome, while two independent domains (one in each H2A and non-histone tails) are capable of MCB formation.  31  1.2.5.2.4 Involvement in Heterochromatin Many experiments have provided evidence of macroH2A's participation in heterochromatic structures. When it was first identified, macroH2Al .2 had been shown to replace the core H2A in some nucleosomes; in the rat it was estimated that there exists roughly one macroH2A molecule for every 30 nucleosomes throughout the genome 41. This was confirmed by experiments using macroH2A1.2 to artificially reconstitute chromatin. Reconstituted nucleosomes made from either H2A or macroH2A were both able to protect roughly 146bp of DNA from micrococcal nuclease digestion, showing that both demonstrated similar nucleosome structures, and that both H2A molecules in a nucleosome can be replaced with macroH2A1.2 145. There were however, some subtle but interesting differences between the two types of reconstituted nucleosomes. When digested with DNase I, the digestion pattern revealed that a particular region in the macroH2A nucleosomes was more resistant than a corresponding region in the H2A nucleosomes 145 This location in the protein is known as the "superhelix location zero" (SHLO) when referring to its crystallographic structure, and corresponds exactly to the non-histone tail of macroH2Al 64 A second difference between the two types of reconstituted nucleosomes was observed in sedimentation studies, in which macroH2A mononucleosomes preferentially associated in pairs 145. This supports earlier evidence that the non-histone tails of macroH2Al.l can form dimers 146. Taken together, the above observations suggest that although macroH2A does generally play a role in heterochromatin, it also contains unique properties that allows for a tighter and more specific DNA packaging role(s). One example of a special case of  32  heterochromatin formation in which macroH2A1.2 seems to play a role is meiotic sex chromosome inactivation, during which the sex chromosomes condense in order for proper pairing and segregation 137,147 j addition to preferential localization to n  centrometric heterochromatin, macroH2A1.2 was found to colocalize to the pseudoautosomal region in male cells along with M31, a mammalian member of the conserved HP 1 protein family 148.  1.2.5.2.5 Possible Mechanism of Interaction The precise function of MCBs in the inactivation of the X chromosome remains unclear; however, studies using immunofluoresence have revealed some interesting clues. To better understand the timing of macroH2A1.2 recruitment, one study utilized differentiating murine ES cells to study MCB formation over time 149 j  n  m  o  u  s  e  undifferentiated female ES cells, both X chromosomes are initially active, with random X-inactivation occurring during differentiation. By double-labeling macroH2A1.2 and Xist RNA, the study demonstrated that MCB does not colocalize with the Xist RNA until after the initiation and establishment of X-inactivation has been completed 149.  l n  a  follow-up study, the same research group provided evidence that a "pool" of macrH2Al .2 is continually contained at the centrosome (in both males and females) prior to and throughout the mouse ES cell differentiation, before it becomes colocalized to the inactive X chromosome in the female cells (in the male cells, the macroH2A1.2 becomes dispersed) 1^0. These experiments suggest that macroH2A1.2 recruitment is a relatively late event in the sequential steps of X-inactivation, and is probably more important in the maintenance of the inactive state than in initiation and establishment of the Xi.  33  Nevertheless, there is no disputing the fact that experimental evidence also suggests an intimate relationship between Xist RNA and macroH2Al .2. Chromatin immunoprecipitation experiments targeting macroH2Al pulled down Xist RNA 40 . Using the Cre-loxP system, Csankovszki et al. observed female mouse fibroblasts in the absence of the Xist gene 132 They observed that although the inactive X chromosome still retained features of heterochromatin, such as silenced genes, late replication, and hypoacetylated H4, the macroH2A1.2 localization was lost. This suggests that macroH2A1.2 may not be crucial for maintenance of heterochromatin, but may be more important in mediating actions between XIST and the establishment of X-inactivation. Xist RNA has previously been shown to interact with the nuclear matrix; even after DNA and histones were extracted Xist RNA remained nuclearly localized 25. MacroH2Al .2, as described above, is tightly associated with nucleosomes. Thus, an interaction between Xist RNA and macroH2Al .2 would provide a convenient link between the inactive X chromatin and the nuclear matrix. However, whether XIST RNA physically interacts with and recruits the histone variant to the Xi remains to be proven.  1.3 Rodent/Human Hybrid Cells Rodent/human somatic cell hybrids were initially created for mapping purposes, as they retain few human chromosomes after fusion. Hybrids containing either the active or inactive human X chromosome can be selected for in culture 151,152 The hybrid AHA-1 laBl, was a subclone of a monochromosomal hybrid line AHA 11a (GMO10324) originally obtained from Dr. H. F. Willard (Case Western Reserve University). These somatic cell hybrids containing an active human X chromsome in a mouse background  34  were repeatedly treated with a demethylation agent such as 5-azadeoxycytidine (5azadC), which inhibits methyltransferase activity, in order to reactivate XIST expression 153 Because most genes on the human active X chromosome lack methyl groups at their 5' promoter regions, 5-azadC will have little effect on their expression status. The XIST gene, however, is transcriptionally silent on the active X 153,154 Digestion of genomic DNA using methylation-sensitive restriction enzymes has revealed multiple methylation marks at the 5' end of the XIST gene 155. Initial expression analysis of X-linked genes in this cell line (AHA-11 aB 1 -A52b) revealed that only the XIST gene was affected by the demethylation treatment. Further rounds of treatment with 5-azadC resulted in hybrids that expressed both human XIST and mouse Xist  37  (see Table 1-1).  35  Table 1-1: Human Mouse Hybrid Cell Lines  Cell Line AHA-llaBl Human Xa + Mouse Xa AHA-llaBl-A52b Demethylated AHA-1 laBl-A52b-4Cl Further demethylated  XIST  Localized  Xist  Localized  Expression NO  toXi -  Expression NO  toXi -  YES  NO  NO  -  YES  NO  YES  YES  36  1.3.1 XIST Localization A handful of experiments have been done involving such (demethylated) hybrids, and their unexpected results identified some intriguing questions concerning XIST/Xist RNA localization and the RNA's ultimate function in X-inactivation. Generation of the AHA-1 laBl-A52b mouse/human hybrid cells was initially reported by Tinker & Brown 153 j  na  n  experiment where they demethylated mouse/human cells that contained an  active human chromosome. The XIST gene was found to be reactivated, and the XIST RNA molecules were confirmed to have a nuclear localization. Using RT-PCR, they examined whether the expression status of 8 X-linked genes were affected by the reactivation of the XIST gene; despite previous evidence of XISTs importance in Xinactivation, none of the genes examined were silenced after XIST reactivation. This was confirmed with an azaguanine-thioguanine (AG-TG) growth assay, in which the media was supplemented with AG-TG and only cells that had lost expression (presumably via induced X-inactivation) of the X-linked gene hypoxanthineguanine-phosphoribosyl transferase (HPRT) would be unable to incorporate the toxic 8-azaguanine and 6thioguanine. A similar study in the same year was performed using hamster-human somatic hybrid cells 154. The cells were put through the same demethylation process, and once again XIST RNA was found only in nuclear extracts of these cells. RT-PCR was also used to examine gene expression changes, and the two genes they looked at appeared to show no signs of induced silencing at all. More interestingly, when the researchers applied RNA FISH analysis on the induced XIST RNA they observed a general diffuse  37  localization, unlike normal female mammalian cells in which the XIST RNA tightly coats and "paints" the inactive X chromosome. Clemson et al. confirmed this unexpected result 7 shortly after in mouse/human 3  somatic cell hybrids. In fact, not only did the XIST RNA from a demethylated human Xa-containing hybrid demonstrate aberrant derealization, the XIST RNA from a normally inactive human X chromosome in Xi-containing hybrids also showed a similar deficiency in proper localization! Thus, despite recent identification of domain regions on the XIST RNA crucial for its localization to the Xi, a tight association with the X chromosome does not appear to be a pure innate feature of the XIST RNA itself. Clemson et al. 37 suggested that perhaps certain species-specific factors were missing in the somatic cells hybrids that interacts with XIST RNA and assists in proper localization. This theory is supported by their further observations that mouse Xist RNA appeared to localize properly in their demethylated mouse/human hybrids 37 ( e Figure 1-4). Much se  like previous observations however, the X-linked genes on the mouse X chromosome showed no signs of silencing despite proper Xist RNA localization.  38  Figure 1-4: Reactivated XIST/Xist RNA FISH analysis of AHA-1 laBl-A52b-4Cl hybrids. The green signal represents XIST RNA, which is drifting off the X chromosome. The red signal represents Xist RNA, which is localized correctly to the X chromosome. {Clemson et al 1998)37  1.3.2 Ideal Model As a result of the experiments described above, we have now at our disposal a unique hybrid model system in which to study X-inactivation. The key features of this model system are as follows: i)  Active X chromosomes (human and mouse) are present, containing genes that have not been subjected to X-inactivation.  ii)  These hybrid cells have been demethylated to reactivate the XIST gene; the resulting XIST RNA is delocalized.  iii)  Some hybrid cells have been further demethylated to reactivate the Xist gene; the resulting Xist RNA is localized.  iv)  None of the X-linked genes examined thus far demonstrate any signs of silencing as an effect of induced XIST/Xist expression.  In short, having all these features in a single cell line provides a unique system where one can begin to dissect the role of XIST RNA independent of gene silencing. As mentioned before, X-inactivation occurs in a cascade of events, with many features of X-inactivation appearing together in a brief window of time after XIST expression during development. This model system now allows us to investigate more rigorously how XIST RNA may function independent of complete X-inactivation, as well as how individual features of Xinactivation are affected by induced XIST expression.  40  1.4 Thesis Goals In an effort to utilize a unique somatic hybrid cell model to dissect and investigate individual features of X-inactivation, I have attempted the following: i)  Verify the demethylated somatic hybrid cell lines as an useful model system for studying the role of XIST in X-inactivation independent of gene silencing;  ii)  Investigate the role of macroH2A in XIST localization, and X-inactivation in general, using the model system;  iii)  Characterize the histone acetylation status, another epigenetic feature of Xinactivation, in this model system.  41  CHAPTER 2: Materials & Methods  2.1 Tissue Culture Methods  2.1.1 Cell Lines The human/rodent hybrid cell lines were originally either obtained from H.F. Willard (Case Western Reserve University) and S. Hansen (University of Washington), or they were generated by S. Baldry using somatic cell fusion techniques described elsewhere 152,156,157 Once thawed from our lab stocks, cells were grown at 37C in alpha-Minimal Essential Medium (alpha-MEM) purchased from Gibco/BRL. To collect cell pellets for DNA and/or RNA extractions, the growth medium was first removed and the cells rinsed once with phosphate saline buffer (PBS). 0.25% trypsin-EDTA was used to release cells from the bottom of the culture flask, and these were resuspended in lOmL of growth medium. This cell suspension was spun down, and the supernatant aspirated leaving the cell pellets.  2.1.2 Freezing Cells The protocol for freezing cell lines in liquid nitrogen is simply a slight modification of the above protocol for obtaining cell pellets. Once the trypsin and normal growth medium has been removed, the cell pellet was resuspended in alpha-MEM enriched with 15% fetal calf serum (FCS) and 10% dimethyl sulfoxide (DMSO). This was then transferred to appropriate cryotubes, and placed at -70C in an isopropanol-filled container to allow for gradual cooling before long-term storage in liquid nitrogen.  42  2.2 Examining Gene Methylation Status In order to determine whether genes were methylated at their promoters, genomic DNA was first extracted from the cells of interest. This DNA was then digested with appropriate enzymes, before being used as a template for polymerase chain reactions using suitable primers.  2.2.1 DNA Extraction To obtain DNA samples, cell pellets were resuspended in 10 mL of TE (lOmM Tris pH7.5-8.0; ImM EDTA) and 1/20 volume of 20% sodium dodecyl sulfate (SDS). A pipette-tip-full of proteinase K (6mg) was added and the whole solution was incubated at room temperature overnight. The SDS (a detergent) and proteinase K (a proteolytic enzyme) works to rupture cell membranes and digest proteins, allowing the release of genomic DNA into solution. The following day, 0.8mL of 5M NaCl was added and incubated at 37C for 2 hours until in solution, after which 3.3mL more of 5M NaCl was added. The whole solution was shaken vigorously for 30 seconds, then centrifuged at 2500 rpm for 15 minutes. The supernatant was transferred to a 50mL tube, followed by the addition of 0.3mL of 20% SDS and 3.3mL 5M NaCl. The solution was shaken vigorously for 30 seconds before it was centrifuged at 2500rpm for 15 minutes. The supernatant was transferred to a fresh 50mL tube, and 2x volume of ethanol was added to precipitate the DNA. The DNA was gently spooled and transferred to a fresh tube, where it was resuspended in double distilled water (ddH20) and stored at 4C.  43  2.2.2 Methylation-sensitive Restriction Digests Genomic DNA from cells of interest was first pre-digested using EcoRI in order to cut the DNA strands into smaller fragments, followed by phenol/chloroform extraction and ethanol precipitation. Roughly 20-200ng of the pre-digested genomic DNA was incubated at 37C overnight in a reaction mix (total volume 20uL) with luL of a methylation-sensitive restriction enzyme (10 Units) and luL of lOx of the appropriate buffer. Methylation sensitive enzymes Hpall (NEB) and Hhal (NEB) were used; these enzymes will not cut if there is methylation of the C in CpG within the recognition sites. In the case of Hhal digestion, the reaction mix was supplemented with lOOug/mL bovine serum albumin (BSA). luL (lOOng) of the digestion product was then used as a template for subsequent PCR reactions. Species-specific primers were designed to flank the enzymes' recognition sites without flanking EcoRI sites (see Table 2-1).  44  in ft >/oX) >n  Tf  2 bo  os  CN  CN  xCL  n.  ft X CN os ro  00 ro ft OJ ro X CN OS  rep  a. x  CL  rep  o  =J CD "5 N  X  Tf  CN  -a  - .3 ^  W  PH bo  a.  J3  cu  O  £  Os  >/->  1  t~-  £  £  os >n r~  c c e  £ £ 1  — — CN I I I VI O N  C\ m r-  O  u < < U E— U U  S  Q « «S a ©  .S PH  c c e  £  E £ £ — — CN I I I Tf CN  £ — —i CN I I I Tf T f CN Os  £  >n f~  as m r~  PC  X  CS  CS ft  PC  PC  c c e E E E — —' CN I I I Tf Tf CN  os m  c c e E  E E ^ H CN I I I Tf Tf CN  —i  os in  s  E o  E o  U  a  ixi  X  ft PC  2 E  E  m  <  g '8  •**  c c e  s  OX)  s-  PC  PC  CS  ro  £ — - H (N I cnI ooI CN  E  CifJ  PC  PC  CS  o  c c e  2  o  PC  X  ft  ro  N I I I Tf Tf CN •H  -  E  cs X!  co ft  CS ft  o  ro  Of!  °<5  PC  PC  =tfc " O  so  cd  X  CO  eu  a* „ 00  t>  < a u u  u a u u  H < H  H U H U H U  a a < u a < u  a <  <  «  u o a < < a < a < o  <  O H U <  u a H U H H  a a o u u u  H U  o < < u u  a H a u a < a < u u a H u < < a < u u H  < U H U U  a H U  a o a < < o to. H U O  U U H U U H U  < u H U  a < u u < u u < u u  u a EU  a a a a  EH U <  u a u u u u o  E-  H  o  "C OH PH  os CN  < u  [:  <  u a u < u a  a < u a < u a a a < o  H  u < u a o u u  a  < H U  U U <  a < u o a a  a < H U  <  H  a a < a < u u u a  a  H U <  u u  < u  a  E  ft UU  <D E  T3  sc ft  x  so X  in H  ?s u a  H U  LH  ft  a < u u <  <  a o u  H U  CQ  <  <  x  ><  >H  C U "3 B  a < u u a < a u  i  CM  C/5  <  o  <  <u fi  < u u a u <c  ft  o  E  rx  T3  CN T3  a  a  -H  CL, E  ft E  ft ft SO so E  E  45  2.2.3 Polymerase Chain Reaction (PCR) Generally, PCRs were carried out in 25uL volumes containing lOOng template, 20mM dNTPs, 1.5mM MgC12, 2.5uL of lOx PCR buffer, luM of the appropriate primers, and 0.625 Units of Taq DNA polymerase. All reagents were from Gibco/BRL. The PCR mixtures were overlaid with 20uL of mineral oil to prevent evaporation, and were then cycled in a Techne Genius thermocycler. Default conditions for PCR cycling were as follows: 30 cycles of 94C - 1 minute, 54C - 1 minute, and 72C - 2 minutes.  IOUL  of the finished reactions were electrophoresed on a 2% agarose gel, and were visualized by staining with ethidium bromide. Cycling conditions were modified to optimize particular reactions [see Table]. For example, annealing temperature was raised and MgC12 concentration was lowered if too much background was observed in the PCR products. Weak amplification of CpG-rich regions was adjusted by the addition of betaine (Sigma), which reduced formation of secondary structures and improved PCR amplification 158  2.3 Examining Gene Expression Status To determine which genes were transcriptionally active in cells of interest, an RNA extraction was performed to provide a template for complementary-DNA (cDNA) creation using reverse PCR. This cDNA was then used as a template for PCR with suitable primers; a positive result indicated the presence of RNA in the cells and thus expression of the gene of interest.  46  2.3.1 RNA Extraction Cell pellets were obtained as per the protocol for DNA extraction. The cells were then resuspended in Solution D (4M guanidinium thiocyanate; 25mM sodium citrate, pH7.0; 0.5% sarcosyl; 0.1M 2-mercaptoethanol) and vortexed until in solution in order to disrupt the cell membranes. The guanidinium forms complexes with RNA molecules and becomes water-soluble, while DNA and proteins remain insoluble. To denature any contaminating proteins, an equal volume of diethyl pyrocarbonate-treated (DEPC) ddH20 saturated phenol plus 1/10 volume of 2M sodium acetate (pH4.0) were added, followed by inversion and vortexing. Immediately, 2/5 volume of chloroform was added and the mixture vortexed in order to remove traces of phenol from the previous step. After being placed on ice for 5-15 minutes, the preparation was then centrifuged for 10 minutes at 13 500rpm to separate the aqueous (upper) and organic (lower) layers. The upper layer containing the RNA was transferred to fresh tubes, leaving the DNA and proteins in the interphase and organic layer. An equal volume of isopropanol was added to the RNA containing solution, and the whole mixture was allowed to sit at -20C overnight. The next day the samples were centrifuged at 13 500rpm for 10 minutes to precipitate the RNA molecules, which were then washed with 70% ethanol and resuspended in 10-100uL of DEPC-ddH20 (stored at -20C).  2.3.2 DNase Treatment of RNA Following RNA extraction, DNase treatment was performed to remove contaminating DNA. A 1/20 volume of porcine RNase Inhibitor and a 1/10 volume of DNase were added to the RNA sample and incubated at 37C for one hour. The total  47  volume of the solution was then increased to 150uL with DEPC-H20, followed by the addition of an equal volume of 1:1 phenol/chloroform. This was vortexed for 45 seconds, and then centrifuged at 13 500rpm for 8 minutes. The upper aqueous layer containing RNA was transferred to a fresh tube, into which an equal volume of chloroform was then added. The mixture was vortexed again for 45 seconds followed by an 8 minute centrifugation at 13 500rpm. The upper aqueous layer was then transferred to another fresh tube. An equal volume of isopropanol and 1/10 volume of 2M sodium acetate were added and the whole solution left at -20C overnight. The solution was centrifuged the next day, followed a 70% ethanol wash, and the RNA pellet resuspended in DEPCddH20.  2.3.3 ReverseTranscription (RT) In order to create complementary DNA for use in normal PCR, extracted RNA was reverse transcribed using RT enzymes which synthesize complementary DNA strands using RNA as a template. In a general, randomly primed 20uL RT-PCR reaction, 5ug of RNA in DEPC-ddH20 was mixed with 4uL of 5x first strand buffer, 2uL of 1.25mM dNTPs, 2uL of 0.1 M dithiothreitol (DTT), luL of random hexamer primers, and luL of Moloney Murine Leukemia virus reverse transcriptase (M-MLV-RT). All reagents were purchased from Gibco/BRL. 0.5uL of RNase Inhibitor was also added to protect against RNA degradation. The solution was allowed to sit at room temperature for 10 minutes before it was incubated at 42C for 2 hours. The active enzymes were then heat-killed at 65C for 20 minutes, and the cDNA stored at -20C.  48  2.3.4 PCR using cDNA Species-specific primers for different genes were used in normal PCR, but with cDNA as a template, in order to detect the expression status of those genes, (see Table 22, Table 2-3)  49  o •73  N  g  bo  7  V3  c .2 rt o ^3  -H  I  — (N I  I  £o E  m "— 1  t  I  I  EES —, — fN I I I  T) (N (S  ^  E E E  E E E  tN  — —" fN I I I  -H  -H  I  I  I  EBB — —< fN I I I  r*~  E E E  E B E  ^ ^ fN  — — fN I I I  2 E o  2 E  I  I  I  bt) a  • 3 S  o o H o u o < < o o  as  ta ^  Q v ° a  ©  0 8  H E—  "> ta  S  ta  o  w  H  CJ  H  OH S  3  < O  <  < O  CJ  <  <  < u o  H H  o o Eu o  < o CJ CJ E-  cj  G  CJ < CJ CJ  E-  o o o  o o o  CJ  E—  EG H O  G H  < bCJ  O G  G  G O  G  U CJ  CJ E-  o  CJ CJ  CJ  H  E-  H  CJ  G G t—  <  o  o  H  CJ  o  E<  o  E< O <  CJ  H  o  O  CJ  SH < O H H G H O < O H  CJ CJ  o o  o <  o o < o  CJ  H G G G < H H ECJ  H  G  G  < CJ  G  o <  <  H G G  w  CS  H  o  B °3 "G rt  rt  <J  cj  G  H  ft.  G ft.  CJ  s  G  O. ft.  G ft. ft.  X  Q  ft.  O D ft.  o-  <  3  t—  E-  x  3 2 a  -  I  a  a  s  50  o  2  ex x oo  Cu X  cu n  -d  ro CN  Os  Cu X  OH  X  Cu X ro  o  CN CN  Tf  O  CN  OH 00  X,  o  u c .2  ro  1 1 £  —• —' CN I I I Tf CN Os m t"-  3  u  © ro  ©  c c e E E £ —' —' CN I I I Tf Tf CN os in r-~  O ro  c c e £ £ E — — CN I I I Tf Tf CN Os in C  o  ro  e c £ E I I  E  Tf Tf  OS  wo  E  E CN I I I Tf Tf CN OS Wl  c c c E £ £ <-i — CN I I I Tf Tf CN os in r-  u  u  a < u <  <  <  o  < H U U  H  a a a u  a < u o < u u a  CU  CZ3  H U  u  E<  H  a  u <  a < a u < < u o (u a  UH UH  CC3  OH OH  X ro CN X  H  u  o £ o  a <c a u H a  a  <  H U  a u a u u a  u u H  a  H U H  <  a u < u a o a  u u  H  u a a a  O  u u  u a  H O <  <  a a < u u  u H  X  D E  X  ^2 00 CH  a  E-  < u a  u u  u  u < u <  < o u a a  H  ^  SO  CU,  EU  N  x  CL, E  < < u o Eu  a H U  a < u  H U  H <  a <  a o u a a <  H  a H U  < < E-  U  u H a u u  1  a <e a  C<3 X T3 Cu, E  CS  13  N E  H U  o  N  a. E  EU < <  <  x  ©  EU  u H o  EEO  a < u  a u  a  U  a  < u  u <c  < o  a <  H < U H  oo  x  2  o < u a  a  < <  a  X E  o  a a o  H O H U  CU  fl  <  3  x  CU  E  X -O CL, E  X T3 0* E  2.4 Cloning Several methods involving the use of bacteria were utilized in order to clone a green fluorescent protein (GFP) onto a protein of interest, due to bacteria's wellestablished role as a convenient and efficient vessel for "storing" and selecting for particular plasmids.  2.4.1 Plasmid Preparations from Bacteria Bacteria containing the desired plasmid were grown on a shaker overnight in 2mL LB (Luria-Bertani; per 1L: lOg tryptone, 5g yeast extract, lOg NaCl, pH7.0) media with the appropriate antibiotic (50ug/mL). 0.7mL of this culture was mixed with 300uL of 50% glycerol into a cryotube, and frozen at -70C for storage. 1.3mL of the culture was transferred to a large eppendorf tube and centrifuged at 13 OOOrpm for 2 minutes to pellet cells. The supernatant was aspirated off, and lOOuL of Solution 1 (Lysosome buffer: 50mM glucose; lOmM EDTA; 25mM Tris-Cl, pH 8.0) was added. The tube was vortexed vigorously to resuspended the cell pellet, after which 200uL of alkaline SDS (0.2N NaOH; 1.0% SDS in ddH20) was added. The tube was inverted several times to mix, allowing the cell membranes to be ruptured and peppered with holes through which the plasmid DNA could escape. This solution was not allowed to sit for more than 5 minutes, otherwise the disruptions in the membranes will be too large and contaminating genomic DNA may leak out. 150uL of 3M KOAc (pH6.0) was added to the tube, and the mixture was inverted several times to mix. After 8 minutes of centrifugation (13 OOOrpm), the supernatant containing the plasmid DNA was transferred to a new tube. The tube was filled with cold 95% EtOH and mixed well, and the solution was allowed to  52  sit at -20C overnight to allow for precipitation of DNA. The next day, the tube was centrifuged at 13 OOOrpm at room temperature for 5 minutes to pellet the plasmid DNA. The supernatant was removed, and the pellet resuspended in lOOuL of TE (Tris EDTA pH buffer). 200uL of cold 95% EtOH was added, and the whole solution was mixed well. This was allowed to sit at room temperature for 5 minutes, after which it was centrifuged for 5 minutes and the ethanol supernatant aspirated off. The plasmid pellet was air dried before it was resuspended in lOOuL of ddH20.  2.4.2 Bacterial Transformation All transformations were performed using Library Efficiency DH5-alpha Competent Cells purchased from Gibco/BRL. Transformation of these cells with plasmid DNA was based on the company's suggested protocol, and is briefly summarized here. Roughly lOng of plasmid DNA was added to 30uL of DH5-alpha cells in a 1.5mL eppendorf tube. The tube was tapped gently to mix, and was immediately placed on ice. The cell/plasmid mixture was incubated on ice for 45 minutes, every 5 minutes of which the tube was tapped gently to mix. The cells were then heat-shocked by placing the tube in a 42C water bath for 2 minutes (no shaking), and was immediately returned to ice for a further 30 minute incubation. Next 0.5mL of LB media was added, followed by a 30 minute incubation at 37C. 200uL of this cell suspension was spread onto LB plates containing lOOug/mL of the appropriate antibiotic, and was incubated overnight at 37C. The next day, single colonies from the plates were isolated and grown in 2mL of LB media in culture tubes. Plasmid preparations were performed, and the plasmid DNA analyzed/confirmed before freezing a bacteria stock at -70C.  53  2.4.3 Cloning Inserts into Vectors  2.4.3.1 Inserts The mRNA sequence for the insert of interest was found using UniGene on NCBI's website (http://www.ncbi.nlm.nih.gov/UniGene). Several EST clones for the gene were identified from the EST database, and were subsequently ordered from Research Genetics. These clones (IMAGE#38464, 1961044, 2294145) were plated on LB plates with appropriate antibiotic, and individual colonies were transferred and grown in 2mL LB with appropriate antibiotic. Plasmid preparatons were performed, and the EST vectors were verified with restriction digests and gel electrohoresis. Once the desired vector had been isolated, unique primers were used to amplify the insert sequence using PCR. The primers were designed from the 5' and 3' ends of the insert sequence, and were subsequently modified to include additions of unique restriction enzyme sites useful for cloning into desired vectors (see Table 2-4, Figure 2-1). Instead of using regular Taq polymerase for PCR, an alternate polymerase with an intrinsic proof-reading ability (Platinum Pfx DNA Polymerase; Gibco/BRL) was used in order to reduce errors in DNA amplification. The end result is the amplified insert DNA sequence modified with unique restriction enzyme sites on both ends.  54  .2  w  .2 4> (50 <  o rt  o  8«  U H  < O H  a <  H  < U <  U  C/3 '  a H a H a a u u  w  H H < < H  i-i  o a H  U  u H H  a o u u  <  a  o  o o rt  a <  IT)  OH  H <  U <  o <u  u u o  Q  E-  Q w  < <  < < < o  a a H a a u a u u  w  H  E—  < .:  H  U H  U  a < u H  U  o H  E— < U E—  O  EU E— E-  1  o u <  E—  1  5 H  U H  O U  w  u  IT)  u  EGFPN1 ~\ \ \  \  21 bp  y ED5EC0 *  r  macroH2A1.2 m R N A  ATG  _L_ ^  =-fc—  1 T  ED3AGE  ^ A  \  \  G  \  EGFPC1 EGFPN1 \  \ \  5C1ECO  ATG i  i  6 bp  macroH2A1.2 mRNA  TAG 3C1KPN \ \  \ EGFPC1  Figure 2-1: Primers for Amplifying macroH2A1.2 Inserts All the primers used for amplifying macroH2A1.2 for cloning into EGFP vectors have restriction enzyme sites artificially incorporated into them. These sites correspond to appropriate sites with the EGFPN1/EGFPC1 vectors' multiple cloning sites.  56  2.4.3.2 Vector Insertions The inserts and vectors were cut with restriction enzymes in order to create matching ligation overhangs. The enzymes used were purchased from either Gibco/BRL or New England Biolabs (NEB). After the restriction digest, the products were subjected to gel electrophoresis and were gel purified using QIAquick Gel Extraction Kit. Sometimes the amplified insert from PCR failed to cut properly, as the restriction sites were too close to ends of the DNA fragment resulting in inefficient enzyme activity. In such instances, the insert wasfirstcloned into the pKRX vector via A/T overhangs, before being subjected to restriction enzyme digestion. To add A/T overhangs, PCR was done as above on the insert sequence using the Platinum Pfx DNA polymerase. The PCR product was immediately placed on ice, and 20uL of it was transferred to a new tube. 0.3uL of regular Taq polymerase (Gibco/BRL) was added, and the whole solution was incubated at 72C for 8 minutes; this allowed the Taq to add A/T overhangs to the ends of the insert fragments. Next, 2uL of 3M NaOAc and 40uL EtOH was added, before the mixture was centrifuged at 13 OOOrpm for 5 minutes and the supernatant aspirated off. The pellet was resuspended in 20uL TE buffer. The pKRX vector was linearized using the restriction enzyme Xcml (creating A/T overhangs), with afinalconcentration of 50ng/uL of linearized plasmid. For ligation, a 3:1 insertplasmid ratio was employed, with the ligation reaction (12uL) containing 1.5uL of insert, 7.5uL of ddH20, luL of pKRX vector, luL T4 DNA ligase enzyme and luL ligation buffer (Gibco/BRL). The reaction mixture was incubated at 16C overnight at room temperature. The ligated product was cut with the appropriate restriction enzymes to create inserts with proper  57  overhangs, and was gel electrophoresed and gel purified using QIAquick Gel Extraction Kit. Once the insert and the vector had been properly cut to create ligation overhangs, the insert was cloned into the vector using a 3:1 insertplasmid ratio. For 50ng/uL linearized plasmid, a typical ligation reaction contained the following: luL of insert from PCR, 7.5uL of ddH20, luL of linearized vector, luL of T4 DNA ligase and luL of ligation buffer (Gibco/BRL). The reaction was incubated at 16C overnight at room temperature.  2.4.3.3 Construct Verification To check for successful ligations, the plasmids were first transformed into bacteria for proper selection using appropriate antibiotic and long-term storage. Plasmid preparations from colonies that survived the selection process were checked by PCR using original primers used for insert amplification, as well as by restriction digestions. To check whether the insert sequence was in frame with the vector sequence, sequence analysis was performed (by UBC NAPS unit) over the ligation junction (see Appendix).  2.5 Lipofection In order to express a plasmid of interest in mammalian cells, the plasmid construct was transformed into target cells via lipofection. Lipofectamine 3000 from Gibco/BRL was used for this protocol. Cells were grown at 37C in 60mm plates until 50%-80% confluency was reached; optimal cell density varied with cell type. On the day of transfection, two solutions (for each transfection plate) were prepared first. The DNA  58  solution was made with 3-6ug of the plasmid suspended in 300uL of OPTI-MEM serum free media (gibco/BRL). A lipid solution was prepared by diluting 6-75uL of cationic lipid reagent (Lipofectamine) into 300uL of OPTI-MEM media. The two solutions were combined and mixed gently, and was incubated at room temperature for 45 minutes to allow DNA-lipid complexes to form. During this incubation, the plated cells were rinsed with serum-free media to remove residue serum that might interfere with the lipofection. 2.4mL of the OPTI-MEM media was then added to the DNA-lipid complexes, and the diluted solution was overlaid onto the rinsed cells. The cells were incubated with the complexes for 5 hours at 37C, after which 3mL of growth media containing twice the normal concentration of serum was added. After an overnight incubation at 37C, the media was replaced with fresh complete growth media, and selective antibiotic was added.  2.6 Chromatin Immunoprecipitation (ChIP) Assay Cells of interest were harvested with 5 drops of 0.25% trypsin for 2 minutes, and were then washed with lxPBS. lmL of 0.37% formaldehyde in alpha-media was added, and suspension incubated at 37C for 10 minutes in order for DNA and histones to be cross-linked. After incubation, the cells were kept on ice as much as possible to prevent denaturing of proteins. The cells were then washed twice with lxPBS, each time accompanied with 1/100 dilution of proteinase inhibitor cocktail (Sigma). The suspension was centrifuged at 2500rpm for 4 minutes at 4C, and the supernatant aspirated off. To lyse the cells, the pellet was resuspended in 200uL of SDS lysis buffer (Upstate) and 2uL of proteinase inhibitor cocktail, and placed on ice for 10 minutes. To allow for  59  greater lysis efficiency, the suspension was mixed by several cycles of drawing up and releasing the solution through a 25 gauge needle. The suspension was then sonicated for 7 pulses, each at 50% power for 10 seconds; a 1 minute incubation on ice was allowed between each pulse to help reduce the temperature and the build-up of foam. After sonication, most of the protocol was done according to the recommended  '  procedures that came with the ChIP Kit from Upstate Biochemicals. The sonicated solution was centrifuged at 13 OOOrpm (4C) for 10 minutes, and the supernatant was then transferred to a new tube (20uL was removed from this for checking the amount of input DNA via spectrophotometry). 1.8mL of ChIP Dilution Buffer was added along with 20uL of proteinase inhibitor cocktail. Next 80uL of Salmon Sperm DNA/Agarose Slurry was added, and the whole mixture was agitated on a mechanical rocker for 30 minutes at 4C, in order to bind and remove non-specific DNA sequences (reduce background). The mixture was then touch-spun (1 OOOrpm) for 10 seconds to gently collect beads at the bottom of the tube, and the supernatant was transferred to 2 new tubes (2xlmL). lOug of the desired histone-specific antibody was added to one tube, while the other tube served as a negative control. Both tubes were left at 4C on a mechanical rocker overnight. The following day, 60uL of Salmon Sperm DNA/Agarose Slurry was added to the tubes with the antibodies, and rocked for 1 hour at 4C. The tubes with no antibodies were left at 4C until a later step (see below). After the brief incubation, the mixture was subjected to a series of washing steps (touch spin before and after each wash): lmL Low Salt Immune Complex, 3-5 min rocking at 4C lmL High Salt Immune Complex, 3-5 min rocking at 4C lmL LiCl Immune Complex, 3-5 min rocking at 4C  60  lmL TE Buffer, 3-5 min rocking at 4C lmL TE Buffer, 3-5 min rocking at 4C Next, 250uL of elution buffer (12.5uL 20% SDS; 25uL 1M NaHC03; 212.5uL ddH20) was added to the washed beads, and the mixture vortexed briefly to mix. After a 15min rocked incubation at room temperature, the tube was centrifuged and the supernatant (250uL) transferred to a new tube. Another 250uL of elution buffer was added and the subsequent steps repeated, with the ultimate supernatant transferred to the same tube (total volume 500uL). To uncrosslink the chromatin from proteins, 20uL of 5M NaCl was added followed by a 65C incubation for 4 hours. The previous tubes containing the "no antibody" controls were added into the protocol at this uncrosslinknig step. Immediately after, lOuL of 0.5M EDTA, 20uL of 1M Tris-HCl, and 2uL of proteinase K (lOmg/mL) were all added to the tubes and left at 45C for an hour. A phenol/chloroform extraction was performed to isolate the DNA, and thefinalproduct diluted to 25ug/uL for use as template in PCR reactions.  2.6.1 PCR ChIP Results Primers flanking sequences near the 5' end of genes were used to amplify sequences obtained through ChIP, as these regions have been shown to be associated with modified histones (see Table 2-5).  61  CTTCATTGGTTGTGGAGCCC  294bp  510bp  278bp  392bp  67bp  485bp  Cycles  ro  Me4Lo  94 - Imin 54 - Imin 72 - 2min  94 - Imin 54 - Imin 72 - 2m in  94 - Imin 54 - Imin 72 - 2min  95- Imin 50- Imin 72 - 2min  95 - Imin 58- Imin 72 - 2min  94 - Imin 54 - Imin 72 - 2min  Product Size  o  1.5mM  1.5mM  1.5mM  l.OmM  l.OMm  1.5mM  [MgC12]  Cycling Conditions  ro ro  GAACTCCTGCCAATTGAGGG  GGAGAGAAACCACGGAAGAA  TAAAGGTCCAATAAGATGTCAGAA  AGGAGCCCAATTGGGTATGG  GTGCTGTGTTAAAGGATAGC  CGCTGTCGACGATGGTCT  TGCCAAAGCCCTAAGGTCA  CCAAGCTGAGTAGACAGGC  CCCTTGGGTTCTGCACTGA  ATCAGCAGGTATCCGATACC  TTTCTTACTCTCTCGGGCT  Sequence 5' -» 3'  ro ro  Me4Up  mXist  ZFX  ARAF  TIMPl  XIST  Gene  ro ro  XlLo  XlUp  ZFX2  ZFX!  ARAFM4  ARAFMl  TIMP5'B  TIMP5'A  XIST29r  XISTA5  Primer Pair  ro ro o  ro  C N OH  u  S  62  2.7 Microscopy All the cells examined were observed under a Zeiss Axioplan Fluorescent Microscope (Bio-Rad), and digital images were captured using digital cameras and imported onto a computer for further analysis. Cells were either i)live under a drop of alpha-media on a slide, or ii)fixed using paraformaldehyde.  2.7.1 Cremer Preparations (Fixing Cells) Cells were grown on slides up to 80% confluency. The cells were rinsed twice with lxPBS, and then were overlaid with 4% paraformaldehyde (lOmL 16%paraformaldehyde; 4mL lOx PBS, 26mL ddH20) for 10 minutes at room temperature. The paraformaldehyde was then suctioned off and the cells were rinsed twice with lxPBS. The cells were then overlaid with 0.1M HCl for 10 minutes at room temperature, before suctioning off the HCl and rinsing the cells again twice with lxPBS. 8uL of Slowfade AntiFade with DAPI (Molecular Probes) was added onto the cells before covering with a coverslip. The edges of the coverslip was sealed onto the slide using rubber cement, since nail polish has been shown to quench GFP fluorescence.  63  CHAPTER 3: Characterization of Hybrid Model System  3.1 Introduction Although some interesting observations have resultedfromexperiments generating mouse/human Xa-containing somatic cell hybrids, very limited efforts have been given to characterize in greater detail the X-linked genes in these cells. The initial Tinker 153 study examined expression status of 8 human X-linked genes, while the Hansen 154 study only characterized 2 human genes in their hamster/mouse hybrids. In order to confidently use such hybrid model systems for studying the role of XIST independent of X-inactivation, the expression status of X-linked genes in these cells needs to be characterized in greater detail. This is especially true in light of a recent study by Hall 38, which demonstrated that induced X-inactivation might be possible even in differentiated cells. In an attempt to verify that the induced XIST RNA from demethylation of these cells failed to promote any X-linked gene silencing, I examined the methylation status of X-linked gene promoters alongside the actual expression status of X-linked genes. Much like the rest of the genome, methylation at CpG islands of genes on the inactivated X chromosome has been shown to tightly correlate with the respective genes' expression status. In fact, the methylation of a gene is often used as a reliable indicator of the gene's silenced state 159. Several methods exist for easy detection of gene methylation, and the one used for this investigation involves a combination of restriction enzyme digestions and standard PCR reactions. Genomic DNA extracted from the hybrid cells were first digested with Hpall and/or Hhal, enzymes that are methylation-  64  sensitive; they will only cut the DNA if their recognition sequence (containing a CpG dinucelotide) is not methylated at the C of the CpG dinucleotide. The DNA resulting from the restriction enzyme digestion was then subjected to standard PCR using primers that flank the restriction recognition site within the 5' end of the gene of interest. Only if the DNA sequence was protected by a methylation mark (and thus no DNA cleavage) would a PCR product of the gene fragment result. Thus, a positive PCR result would indicate methylation at a gene, and ultimately its lack of expression. I chose 4 human Xlinked genes and 3 X-linked mouse genes for this analysis, all of which had either Hpall and/or Hhal recognition sites located at the 5' end of these genes (see Figure 3-1). Methylation status of these genes in cells before demethylation was compared to that of genes in cells after demethylation. The methylation status of X-linked genes in these hybrid cells would definitely support the overall characterization, but a complete examination of gene expression status would not be sufficient without an actual analysis of mRNA levels using RT-PCR. Since the hybrid cells contain only one human active X chromosome and one mouse active X chromosome, any X-linked gene RNA presence detected would be due to the gene's expression. For this analysis, I examined 7 human X-linked genes and 6 mouse X-linked genes, all of which together represented a range of loci with varying distances from the XIC (see Figure 3-1).  65  22.3 22.; 22.1 21  11.4 11.2'  PDHA1 (Xp22.1-p22.2) ZFX (Xp21.3) ARAF1 (Xpll.2-pll.4) TIMPl (Xpll.23pll.3) AR(Xqll.2-ql2) XIST (Xql2) PHKA1 (Xql2-ql3) PGKl (Xql3) XPCT (Xql3.2) FMR (Xq27.3)  X  Figure 3-1: Location of Human X-linked Genes  3.2 Results  3.2.1 Methylation Status A standard methylation-sensitive restriction enzyme digest determined the presence/absence of methyl groups on the cytidine of CpG dinucleotides located near the 5' promoter sequences of X-linked genes. The DNA from the human female GM7039 was used as a control for the analysis of human X-linked genes, whereas the genomic DNA of a mouse sample was used as a control for the mouse genes analysis. Primers designed to flank 5' promoter regions of certain X-linked genes were used. Overall the methylation patterns observed were as expected (see Figure 3-2). All the human X-linked genes examined, with the exception of XIST, were subject to cutting by either Hpall and/or Hhal as shown by the lack of PCR products from both AHA11 aB 1 and AHA-11 aB 1 -A52b-4C 1 DNA digestions. Only the XIST gene demonstrated a change in methylation status due to 5-azadC treatments; whereas the gene DNA sequence from AHA-1 laBl cells was protected from Hhal digestion, the gene sequence from AHA-1 laBl-A52b-4Cl hybrids was not. These results were reflected in the mouse Xlinked genes examined as well. Whereas the Pgkl and G6pd gene sequences were not methylated in any hybrid tested, the Xist gene showed a loss of methylation in AHAllaBl-A52b-4Cl cells.  67  m G 6 p d  Figure 3-2: Methylation Status of X-linked Genes PCR results using DNA from different hybrid cell lines digested with methylation sensitive restriction enzymes as template. Only XIST/Xist showed a change in methylation between the different hybrids. Human/mouse genomic DNA was used as a control. (*HhaI was used for analysis of XIST gene)  68  3.2.2 Expression Status RNA extraction from AHA-1 laBl and AHA-1 laBl-A52b-4Cl hybrid cells and subsequent RT-PCR were performed as described in Chapter 2. Initially, the human Xlinked genes AR, PGKl, and TIMPl were tested first due to a ready supply of cDNA specific primers. A positive result for gene transcription was observed for all three genes, in both pre- and post-demethylated hybrids (see Figure 3-3). Much like the methylation results, the XIST gene demonstrated a different result; in AHA-1 laBl cells no RNA for the gene was detected, while the AHA-1 laBl-A52b-4C1 cells had readily detected XIST RNA. In order to verify the expression status of X-linked genes in these cells more extensively, three more genes were examined. The human genes PHKA1 and XPCTare located relatively closer to the XIST gene, whereas the PDHA1 gene is situated near the distal end of the X's p-arm. Despite the variation in distance from the XIST gene, none of the 3 additional genes examined showed repression of expression in the demethylated hybrids. A similar analysis was performed to test expression of mouse X-linked genes in the different hybrid cell lines (see Figure 3-4). Once again, no change in expression status was observed for most of the genes tested (Ubel, Pgkl, Zfic, Pdhal, and Phkal), all except Xist, which demonstrated reactivation in the AHA-1 laBl-A52b-4Cl hybrids.  69  X I S T  Figure 3-3: Expression Status of Human X-linked Genes RT-PCR results using RNA preparations from different hybrid cell lines. Only XIST demonstrated reactivation in the demethylated hybrids. A human female cDNA preparation was used as a positive control, and each RT reaction had a negative control.  +  Figure 3-4: Expression Status of Mouse X-linked Genes RT-PCR results using RNA preparations from different hybrid cell lines. Only Xist demonstrated reactivation in the demethylated hybrids. A mouse female cDNA preparation was used as a positive control, and each RT reaction had a negative control.  71  3.2.3 Acetylation Status To ascertain the core histone acetylation status associated with X-linked genes in these hybrids, chromatin immunoprecipitation assays were performed. Once the target DNA fragments have been precipitated using antibodies directed against acetylated H3 they were used as template for PCR. Primers flanking regions 5' to the X-linked genes of interest were used in the PCR reactions, since modified core histones are usually found in these regions. Genes associated with acetylated H3 will have the corresponding primers amplify and produce positive PCR results. In most genes examined, acetylation at H3 was observed in all hybrid cell lines, indicating that reactivated XIST/Xist expression had no effect on this particular histone modification (see Figure 3-5). No acetylation at H3 was observed for the XIST/Xist gene loci in the hybrids examined except the reactivated AHA-A52b-4C1 hybrids.  72  o  mm  e  o  IM ^  <^ ^  ^  XIST TIMP Am  RLA F  mMeCP2 Figure 3-5: Acetylation of H3 Status of X-linked Genes PCR results using ChIP results as template. Only XIST and Xist showed a difference between AHA-1 laB 1 cells and AHA-1 laB 1-A52b-4C1 cells. A no-antibody control lane was also performed for each gene, and none showed any detectable PCR product.  73  3.3 Discussion In order to verify the demethylated human/mouse hybrid cells as a good model system for studying X-inactivation in the absence of gene silencing, it is important to confirm XIST/Xist reactivation and to characterize certain heterochromatic features of Xlinked genes in these cells. The methylation, acetylation, and expression analyses all demonstrated that XIST and Xist were reactivated in the AHA-1 laBl-A52b-4Cl hybrid cells. It is important to note once again that although expressed, the XIST RNA in these hybrids is delocalized; and since active association with the X chromosome has been implicated in past studies as being crucial for inactivation, it is not surprising that no silencing of any X-linked genes examined was observed. Presumably, this derealization of XIST RNA is due to the lack of certain species-specific factors, and that the absence of the XIST RNA coating contributed to the failure to inactivate X-linked genes. Yet in the AHA-1 laBl-A52b-4Cl hybrids, where the mouse Xist RNA is localized properly, no silencing of the mouse X-linked genes was observed either. The methylation, acetylation, and expression analyses conducted on the numerous genes in this thesis lend support for the notion that X-inactivation must occur within a certain developmental time "window"; once a cell is differentiated past this window of opportunity, it becomes insensitive to any XIST/Xist-induced inactivating effects. A recent study by Hall et al. 38, however, provided the first convincing piece of evidence that the whole "developmental time window" theory may be incorrect, or at least incomplete. In their study ectopic XIST was expressed in a human fibrosarcoma cell line (HT1080) and, despite being differentiated, the XIST RNA was able to inactivate in  74  cis the corresponding autosomal region containing the integrated XIST gene. Moreover, the XIST RNA was localized to the Barr body, and the inactive state of the affected region was confirmed by lack of hybridization of labeled Cot-I probes to heterogeneous nuclear RNA. The researchers thus concluded that differentiated human cells are still able to responsive to inactivation by (localized) XZSTRNA. This of course remains to be proven with an actual X chromosome; there is evidence that the X chromosome harbors unique features that are not found on autosomes, which makes the X chromosome more responsive to XZST-mediated inactivation. (e.g. high frequency of LINEs, etc.) In addition, it is quite possible that this situation may be different in murine cells; no experiments in the past utilizing induced Xist expression have been able to inactivate the X chromosome in differentiated cells. This leads back to the recurring theme of speciesspecific factors that may affect such a "time window" for inactivation, raising the possibility that perhaps some feature within the human XIST and/or the human X chromosome allows for inactivation past cellular differentiation. One particular problem with Hall's results is that the HT1080 cells are tumor cells, and cancer cells in general have a less stable genome and are more prone to abnormal chromatin changes. The induced inactivation observed may thus only be an artifact arising from a tumor cell background. The hybrid cells examined here have thus been confirmed as a model system containing unique attributes. By looking at genes on the X chromosome that had varying distances from the XIC, even a very limited spread of inactivation would have been detected. The human XIST gene is expressed, but delocalized. The mouse Xist gene is also expressed, but demonstrates proper localization. In both cases, no X-linked gene  75  silencing occurs. However, the two situations appear to be a result of different factors; in the case of the mouse X chromosome, the improper stage of cellular development seems to be the cause of the lack of X-inactivation despite proper Xist RNA localization. In the case of the human X chromosome, the inability for XIST RNA to physically associate in cis seems to be the main reason for lack of X-inactivation, as recent evidence suggests that the differentiation stage of human cells may not be a factor for inactivation. One can use this system then, to examine more closely i)the missing factor(s) necessary for proper human .A75T localization, and possibly ii)the developmental factors involved in mouse Xinactivation.  76  CHAPTER 4: MacroH2A1.2  4.1 Introduction With the proper verification of the model system, the next step is to investigate the role of XIST independent of gene silencing. The initial approach I chose to use is to examine the many features of X-inactivation individually; ideally now that gene silencing (and ultimate X-inactivation) has been separated from the presence of XIST RNA in the cell, one can pick a particular feature and dissect its relationship with XIST. The first feature of X-inactivation I chose to investigate is the accumulation of macroH2A1.2 on the inactive X chromosome, since macroH2A1.2 represents the primary candidate for being involved in XIST RNA localization. As already discussed, experimental data from studies of demethylated hybrids indicate that XIST derealization may be a result of some species-specific factor(s) that are missing from these cells 153 j e gene(s) for such factor(s) are presumably located n  within autosomal regions, the human complement of which is missing in the mouse/human cells studied. The apparently intimate correlation between XIST localization and macroH2A localization immediately identifies the histone variant as a prime candidate for the missing human factor. For example, mouse cells hosting targeted deletions of Xist demonstrate an inability to form MCBs despite retention of silencing and other features of Xi 132 hile cells that were induced to express Xist caused ? w  macroH2A1.2 localization even when silencing was not induced 17. This hypothesis has previously been briefly tested using a series of different mouse and/or hamster hybrid cells that retained different human chromosomes 37. Using either cytogenetic and/or  77  molecular techniques, it was confirmed that the presence of no single human chromosome in the hybrid cells was able to confer XIST localization. This includes human chromosomes 5 and 10, within which contains the DNA sequence for macroH2Al and macroH2A2 respectively. However, such results are not very conclusive as there are several explanations for the observations. Firstly, there may well be more than one "missing human factor" required for proper XIST localization and encoded on different autosomes, in which case no single human chromosome compliment in the hybrids would have been expected to restore XIST localization. Secondly, unseen disruptions to the gene(s) involved may have occurred that prevented expression. For example, small rearrangements may have removed the "missing factor" gene, or perhaps aberrant silencing of human genes in the hybrid cells could have occurred. Such scenarios would have escaped detection by conventional cytogenetic and molecular techniques geared towards identifying whole chromosomes. Thus, it is still possible that hybrids containing chromosomes 5 and 10 may not be expressing macroH2Al and macroH2A2, and that these histone variants may actually be a "missing factor" for XIST localization. To address this question, expression of the histone variants was directly tested by performing RT-PCR on RNA extractions from different hybrid cell lines (see Table 2-2). In order to investigate macroH2A1.2's localization pattern in the hybrid model system, the green fluorescent protein (GFP) was used as a visualizing marker. The attachment of GFP to macroH2Al .2 has been used extensively in the past to produce striking images of tight macroH2A1.2 localization to the inactive X chromosome in human and mouse cells 144. Although no evidence has been found to suggest any  78  disruptions in native macroH2A function due to GFP attachment, in most of these studies the GFP molecule had been preferentially cloned onto the C-terminal end of macroH2A 144. For this thesis, constructs with GFP attachment to the N-terminal end or C-terminal end of macroH2A1.2 were both created and used for localization studies. The most striking evidence of a close relationship between XIST and macroH2A1.2 is the complete abolishment of MCB formations when the Xist gene was deleted 132. However, no study has yet been able to prove a direct interaction between the XIST RNA and the macroH2A1.2 protein. The unique hybrid model system characterized in Chapter 3 provides a setting in which one can observe macroH2A1.2 localization patterns in the presence of XIST expression butXZSTRNA derealization. Any direct physical interaction (or indirect physical interaction, e.g. the intervention of chaperon proteins) between XIST RNA and macroH2A1.2 will result in a lack of MCB formation in the demethylated hybrids. However, if macroH2Al .2 localization on the inactive X chromosome is dependent solely on XIST expression, MCBs should form despite the drifting off of XIST RNA molecules. For these localization studies the human tetraploid cell line BOSC 23 was used as a positive human control to show what normally localized macroH2A1.2-GFP fusions look like.  4.2 Results  4.2.1 Missing Human Factor? To determine whether the different variants of macroH2A were present in different hybrid cell lines that demonstrated delocalized XIST RNA, RT-PCR was  79  performed using RNA preparations from each cell line (see Table 4-1). A mouse, human, and hamster female RT+ were included in each analysis to confirm the specificity of the primers for human macroH2A variants (see Figure 4-1). Only one hybrid cell line (X86TG SI) seemed to express both macroH2Al.l and macroH2A1.2; the CHO-derived cell line only showed macroH2A1.2 expression, and the tHM 34-3az-la cells had no detectable macroH2Al. 1 or macroH2Al .2 expression. The primers designed for detecting human macroH2A2 failed to amplify even the controls, and thus no analysis was available.  80  T A B L E 4-1: H y b r i d C e l l Lines Containing H u m a n X i and other Chromosomes  The three cell lines used to determine whether macroH2A1.2 is the missing human factor were in either a mouse or hamster background. The human chromosomes contained in these cells have been previously confirmed cytogenetically/molecularly. *The absence of other human chromosomes has not been confirmed for this cell line. Cell Line Cell Background Human Chromosomes Contained (confirmed) tHM 34-3az-la Mouse 5 10 Xi X8-6TGS1 Hamster 5 Xi CHO-14160-07* Hamster 9 Xi  81  mH2Al.l  mH2A1.2  — O  ©  «S! O N im  fl P QO * fl  o  i l i 1 ° ° 8 ^  o 0  w  Q  +  i  a a JO  s S3  H HS * B « S A  C3 / H  A  S 2 § s  s  oo oo ffi S £5 5 iS & ta X M w  x K 0 0 S S S " PH I  t< *  Figure 4-1: Expression of human macroH2Al variants in Specific Hyrbids RT-PCR results using RNA preparations of different hybrid cell lines, each containing different human chromosomes. MacroH2Al.l and 1.2 were both expressed in the X8 hybrids despite the cells' delocalized XIST RNA.  82  4.2.2 MacroH2Al.2 - GFP Constructs The human mRNA sequence for macroH2A1.2 was isolated from the NCBI UniGene database (GenBank entry AF054174; GI:3341991). Several EST clones were then identified using the GenBank sequence (GI's: 793187, 820417, 4094524, 4703824), and these were subsequently ordered from Research Genetics. Primers with specific restriction enzyme sites incorporated at the ends were used to amplify the insert sequence. Two GFP vectors were obtained courtesy of Dr. Robert Kay; one made for adding proteins of interest to N-terminal of GFP (EGFPN1), and one made for C-terminal addition of proteins of interest (EGFPC1). Initial attempts to ligate amplified inserts into the EGFP vectors proved unsuccessful; the restriction enzyme digests failed to create the necessary overhangs. To eliminate the potential problem of having the restriction sites too close to the ends of the insert sequence, amplified macroH2 A 1.2 wasfirstcloned into pKRX vector using simple A/T overhangs created by non-proof-reading Taq polymerase. Once the insert was in a vector, the restriction enzyme digests cut much better, and ligation into EGFP vectors were subsequently successful. Thefinalconstructs, macroH2A1.2-GFPNl and GFPCl-macroH2A1.2, were both used for the actual localization experiments, with no significant differences in their function.  4.2.3 Localization In order to better understand the relationship between XIST and macroH2Al .2, a series of transfections into different cell types were done. First, an original EGFPN1 or EGFPC1 vector was transfected into the cells of interest to demonstrate what it would look like with just pure GFPs expressed. Next, the vector containing the macroH2A1.2-  83  EGFPN1 or macroH2A1.2-EGFPCl constructs were transfected into different cells of the same cell lines, and localization of the green fluorescence signals was observed. There were no differences in experimental results obtained from the two macroH2A1.2-GFP (i.e. EGFPN1 vs. EGFPC1) constructs in any of the cell lines tested. As a general lipofection control, these results were compared to cells transfected with a Su(var)39EGFPN1 construct (obtained from Sarbjit S. Ner), which has previously been shown to demonstrate multiple distinct localization spots. These also provided a rough reference as to where and how large the nuclei of the cells were. The tetraploid human cell line BOSC 23 was used as a control throughout these transfections, since it should provide a normal human cell background for proper native macroH2Al .2 function (see Figure 4-2). Transfection of BOSC 23 cells with a simple EGFPN1/C1 vector resulted in cells giving off a dull green signal throughout the cytoplasm, reflecting a general diffuse GFP distribution. In contrast, within each of the cells transfected with macroH2A1.2-GFP, two bright and distinct GFP signals were observed within each nucleus. Although sometimes the two signals within a particular cell did not always appear on the same plane, they all resided within the nucleus of the cells and showed tight localization. When these images were compared to the same cells stained with DAPI, the macroH2A1.2-GFP signals overlapped precisely with the two brightly DAPI stained bodies (Barr bodies). The two spots correlate with the presence of two inactive X chromosomes in these tetraploid cells, and thus confirm that the GFP attachment did not interfere with native macroH2A1.2 localization to the inactive X. BOSC 23 cells transfected with the Su(var)39-EGFPN1 construct were also nuclearly localized, and demonstrated the expected multiple foci of intense GFP signals.  84  In AHA-1 laBl hybrid cells, the macroH2Al .2-GFP fusion proteins failed to localize to any one specific region (see Figure 4-3). The GFP signals were still coming from within the nucleus (when compared to DAPI stained cells), but there were no single concentrated bright spots within each cell. Closer examination of the images suggests that there may be tiny concentrations of GFP signals spread throughout the nucleus, but the random distribution is quite vast and diluted. This is to be expected, as these Xa containing hybrids are not demethylated and the XIST and Xist genes are transcriptionally silent. In AHA-1 laBl-A52b hybrids, where the human XIST gene has been reactivated and expressed, the macroH2Al.2-GFP fusion proteins also failed to form any clear distinct MCBs (see Figure 4-4). There were relatively large regions with slightly brighter GFP signals than the rest of the nucleus, and these more intense regions were usually found near the periphery of the nucleus. The most unexpected results, however, came from transfections of the AHA11 aB 1 -A52b-4C 1 hybrid cells. These cells express both human XIST and mouse Xist genes, with the human XIST RNA delocalized and Xist RNA localized normally at the mouse active X chromosome. The GFP signals observed in these cells transfected with macroH2A1.2-GFP appear to reflect a condensed region of concentrated macroH2A1.2GFP located just peripheral to the cell nucleus (see Figure 4-5). These bright spots appear relatively larger than the ones observed in the BOSC 23 cells, and in most of the AHA-1 laBl-A52b-4C1 cells analyzed only a single one of these regions was observed in each cell. These bright GFP spots do not seem to colocalize to the X chromosome at all, at least not in a tightly coating manner.  85  More interestingly, transfection of mouse embryonic fibroblasts (MEFs) with the same macroH2Al .2-GFP constructs produced similar results as the AHA-1 laBl-A52b4C1 transfected cells. MEFs are normal murine cells with no human chromosomes, and they express Xist RNA that coats the inactive X chromosome. The same, single large concentration of GFP signals appeared in each MEF observed, and the localization of this region reflected the peripheral tendency found in the hybrid transfections. Thus it appears that, in a mouse cell that expresses Xist, the human macroH2Al .2 proteins tend to cluster in a specific spot just peripheral to the nucleus.  86  u  co u O co  u  "TD  s  GO  o TD Q CQ o2  <u DX <u  HH  PH  <  Q  5'S O c T3  '3  GO  T3  d  C .o u J? if-  a  u H  r»j U  O  oil m  _ T3 tu  N  >  s  i3 t C  03 O O1  e O-  fN .S3 ^ < T3 fN rx X  s  -o <u  T3 <U tU N C  T3 a  o  o T3 T3 U <U •c<— • >  <u  3 tU  CJ U  tO CJ  O  03  C 03  u O  CJ 3  oo  c GO _o  -t-» C O o  CO  tx>  CO  O GO PP d o o3  4  rt  U  U  ,«> rt  ri  +-» o  ,<u  p-  o  ,<u  rtoo  rt rt c  CQ O O fN  <u rt  rl X  E  CO  rt c rt  * « tU  T3  d 3 <U CJ  U CO  O  CQ  tu  l  rt rr03 o  T3 <U T3 -t-< tU +-» o o ,<u  O o  rtO rt G OO C 03  d 03 <u CJ  87  3 "3  S  <  s.  *  3  B  u |  i—i . 3a  3  '>  CJ  2 (ft «  Cft  > 3 i_ T3 JO £ O o CJ  a a >  T3 a « PC 0 -a E '3 a ° T3 C 1 3 •§ cd H ^ cd "2 fe £ °fe •a 9 U o<U 5u 2 N ,a cj 1  8  0 0  S  2  «(-!  <N  Cft  a  2  E  p)  n  h  DO  a  8  tj «OJ *i cj  *  H CQ  3 •  < X < •  rr  •o o c •a ca  T3  I  a m c co cd (ft a o co a. o a o CM . 2 Cft  =E O  3 OD  < cd  £  u £ a  fe .5  OJ  3 D. o fS 1- 4= •OH O  1/5  OJ  ac  a "S |  c 43 .3  <-> a o o tfi CJ cn -rt c a e « cd 3 •o is OJ c  OJ T3  *-i  ,OJ 8 4 - 1  Cft 13 o  c is ffi  i s W 2 > 3 < e co ^ c U -A CN  o  <s &  Q & 03 X)  -a S  £ .CS 9  «fi  a. o CJ  •o  00  c 5 ?3 CJ  O  I-  *-  O  T 3 fl  GO  c O  SJ S4—•  Of) C  2  H  fN  fe  a  oo  ca S3 fl <U o 6J0  'GO  X)  fe 2  <N 9 00 ,3  Q .  3 SS s x -a _o  s  ca cs  l-H  < <  4)  00 C  ca  o  33 fl  7 3  o >  cu rv tj E  s-i  i2 ca ta 00  u .a 2 -fl 60 g  <O <o flC ca — S3 O 1 3  o  "8 1 3  M  'S  cj cu  fls S  °  CD  CJ CJ  c 1 s <u o .S is •>-* o o O  •I-* — -fl T3 oo o SS 3 £ CU CJ CU cj O X CU  U  2  3  DG  fN >n  < CQ  15  cu  0=  T 3  a  CJ T3  fl 3  C  CJ  _N  <  * -It) "ca o  <  "C fN X •—  00  5  & _o _JJ  g  "H.  2  >  o  "O  -rt  CJ  « <u 3— cu o £ oo o o£ o X CJ fN fl M  <  2  g  00  GO  "c3  CU O  X  s  C O  CH  - O 3  89  5  g I .  u  o  _Cu  CD  3 3  CJ  03 *-»  5 a 2 °< ^ •4-»  I—H  !fe  < e  a &o  Q 03  S oo  £ -O  «  OH PH  O  a -a 3 <o —< N  O  CU  CO •*-»  £ c+s © fl ccj>H s, Cu u ^  • •H  *-> CJ  .33  3  S •~  s°  +H C CJ  tn cS _0 fe  a c o CJ  H  y  CQ  CO  3 3  cu 00  cS CJ  i£  U CO C  ^H  2 "3  O  CJ W  2^  «N •  -  fe DC •3  CS £  o ON CO  C  o  cs  •S >  i  s a  3  c  03  J  j T3 CU  >-  CU  00  < X < •  s3 DC • PM  +-I  00  O  ^  CU  pa  2 fe €  OH  fN  ;  g< DC  cS  s 3  00 C  CS  b  > cu  H->  cn  ° -  O  cu C  3  ,5  CS  t+a  "io  73  °  O  U  cu c T3  O  O 3  es  T3  Cu  3  s 3 S  co ^ 1— o30«3 3 " S1 T cj a cs co  yo £ CU  TJ"  00 3  3  CJ  O  4.5 Discussion To immediately tackle the question of whether macroH2A is the missing human factor responsible for proper XIST RNA localization, the expression status of different macroH2A variants was examined in various hybrids that had delocalized XIST RNA. The variable expression of macroH2Al.l/macroH2A1.2 (determined by RT-PCR) seen in the different hybrids failed to provide definite answers. While some hybrids showed the presence of macroH2Al.l/macroH2A1.2 mRNA, others didn't. The hybrids expressing macroH2Al .2 proved that macroH2Al .2 by itself is not the lone factor responsible for XIST RNA localization; otherwise it would have restored proper XIST RNA localization. However, there are still a couple of possible explanations. MacroH2Al.l/macroH2A1.2 may not be important at all for XIST  A localization;  while past experiments have shown that XIST expression is necessary for MCB formation, it does not mean that macroH2A expression is required for XIST RNA localization. If indeed macroH2Al. l/macroH2Al .2 does have a role in XIST localization, it is likely neither of the histone variants is solely sufficient for XIST coating of the X chromosome. However, it cannot be ruled out that macroH2Al .2 may still play a crucial part in a multi-factor process. The localization studies involving the macroH2Al.2-GFP constructs provided some insights towards the relationship between XIST and the histone variant, while at the same time prompted a number of intriguing mysteries. As mentioned before, previous work in the literature has demonstrated that prevention of Xist expression resulted in lack of MCB formations. However, in the demethylated AHA-1 laBl-A52b hybrid cells examined here, MCBs were not formed despite having XIST expression. This leads to the  91  conclusion that XIST gene expression alone is not sufficient for MCB formation. Most likely, the physical association of XIST to the X chromosome is required for proper macroH2Al .2 localization, as reflected in the normal MCB formation seen in the transfected BOSC 23 cells. Alternatively, macroH2A1.2 localization may be dependent on i)XIST expression, and ii)some other species-specific factor that directly brings macroH2Al .2 to the X chromosome, which is absent in the hybrid cells. It is also possible that this same species-specific factor may be responsible for proper XIST RNA localization. In either case, the possibilities all point towards the existence of some ribonucleoprotein complex involving X75T RNA, macroH2A1.2, and other factor(s). Upon closer comparison of the images taken from transfected AHA-1 laBl and AHA-1 laBl-A52b hybrids, the distribution of GFP signals in the two cell lines appeared to be slightly different. As expected, the macroH2A1.2-GFP fusion proteins demonstrated a diffuse pattern of distribution within the nuclei of non-demethylated hybrids (i.e. no XIST expression). In the X/ST-reactivated AHA-11 aB 1 -A52b hybrids, however, there seems to exist small regions of slightly higher density of GFP signals. Although no true MCBs were formed it is possible that, according to the ribonucleoprotein complex theory, the macroH2A1.2-GFP proteins are somehow interacting with XIST RNA. Since in these hybrids XIST RNA has been shown to be delocalized, and to drift off into a more dispersed region away from the X chromosome, the GFP signal patterns observed here could be reflecting the drifting off of macroH2A1.2 associated with XIST RNA. The observations strongly support the theory that XIST expression alone is not sufficient for MCB formation, and that macroH2A1.2 localization to the X chromosome requires XIST RNA colocalization as well.  92  The most startling result came from the AHA-1 laBl-A52b-4C1 transfections. The main difference between these hybrids and the AHA-1 laBl-A52b hybrids is the expression of Xist, and the proper localization of the Xist RNA, in the 4C1 cells. Yet the macroH2A1.2-GFP fusion proteins demonstrated a drastic change in its localizing behavior. Initially, it was hypothesized that the introduction of localized Xist RNA would provide a different result than the presence of delocalized XIST. Combined with the fact that human and mouse macroH2A1.2 share a high sequence similarity, and that histones and histone variants are well conserved between the two species, it was expected that perhaps the localized Xist RNA will bring about proper MCB formation. The large signal seen at the periphery of the cell nucleus, which is 2-3 times the size of normal MCBs seen in BOSC 23 cells, raises several possibilities. Firstly, the dispersed "pseudoMCB" could reflect an incomplete formation of a proper MCB. For some reason, the human macroH2Al .2-GFP cannot fully respond to the Xist RNA that is coating the X chromosome. Although it is assumed that the macroH2Al .2 is highly conserved between the two species, it is still possible for small species-specific differences within the nonhistone tail to have a slight interfering effect on proper interaction with other proteins and/or RNA molecules. It is worth noting that the X chromosomes in these hybrids are still active; thus, unlike the inactive X chromosomes in normal cells, the active X chromatin may not have the same degree of compact packaging. So even with proper Xist localization, the more "loose" chromatin of the active X chromosome might also contribute to the larger MCBs observed. However, further investigation using mouse embryonic fibroblasts suggests that there are very likely subtle species-specific factors involved in MCB formation.  93  Essentially, a female MEF transfected with the same macroH2A1.2-GFP construct demonstrated a diffused GFP signal identical to the ones seen in the AHA-1 laBl-A5 2b4C1 hybrid transfections. In this case, human macroH2A1.2 seems to exhibit this unexpected localization despite being in a cell that has proper Xist expression, Xist localization, and X-inactivation. The MEF transfections thus provide greater support for the theory that slight species-specific differences in macroH2A1.2 do in fact affect the effectiveness of MCB formations. Another factor for consideration is the possible role of centrosomes in these hybrids. As has been previously demonstrated, macroH2Al .2 proteins are initially "stored" at centrosomes just prior to the beginning of X-inactivation in a cell, before its eventual migration to the inactive X chromosome within the nucleus. It is possible that XIST/Xist expression triggers some signal to direct an upregulation of expression, and concentration of macroH2A at the centrosome in anticipation of X-inactivation 160 j^g dispersed MCBs observed in the MEFs and AHA-1 laBl-A52b-4C1 hybrids may be reflecting a concentrating of macroH2A1.2 at the centrosome near the periphery of the nucleus, presumably persisting there due to some incompatibility between human macroH2Al .2 and mouse Xist RNA (or some other factor) resulting in an inability to migrate to the inactive X chromosome. Alternatively, the large GFP signal could also simply be a reflection of heterochromatic "junk" accumulating in unhealthy and/or dying cells. The lipofection procedure is quite straining on cells, and it possible that after transfection many of the cells observed are critically damaged. However, since all cell types were subjected to the same procedures, one would expect that such "heterochromatic globs" be present at a  94  certain frequency in all the hybrids examined. This is obviously not the case, as the dispersed MCBs were only observed in the AHA-1 laBl-A52b-4Cl hybrids. Taking these results together, it is clear that: i)XIST expression alone is not sufficient for MCB formation, and that other factor(s) such as XIST RNA localization is (are) important; ii)A7STRNA probably has some physical interaction with macroH2A1.2 either directly or indirectly via a ribonucleoprotein complex; iii)species-specific differences exist within the sequence of human and mouse macroH2Al .2 that affects proper MCB formations. Any species-specific differences probably acts either by interfering with direct interactions between Xist RNA and human macroH2A1.2, or by affecting a third-party protein/factor.  95  CHAPTER 5: Discussion and Future Directions The initial goal for this study was to characterize in greater detail the hybrid model system proposed for the study of X-inactivation. Previous work has established the human/mouse hybrids containing an active X chromosome as unique cell systems where XIST/Xist can be reactivated, and where the XIST RNA demonstrates abnormal localization 37. The DNA methylation, H3 acetylation, and gene expression experiments in this study confirmed that despite having reactivated XIST/Xist, no silencing of any Xlinked genes was observed as a consequence of the reactivation. This hybrid model system thus provides several advantages and disadvantages for the study of the role of XIST/Xist independent of gene silencing. The primary advantage to this system is of course the presence of XIST/Xist expression without a final inactivated state of the X chromosome. In essence, the primary major observable step in the X-inactivation process has been "teased" out of and separated from some of the tightly linked cascade of events leading to heterochromatin formation. We can thus begin to investigate more rigorously what immediate effects XIST/Xist RNA have by identifying what these functional RNAs interact with. The fact that the human XIST RNA is delocalized in this system provides a further advantage in studying XIST function; some factor(s) important in physically localizing the RNA to the Xi must be deficient in these cells, and thus these cells provide perfect vessels for introducing and testing candidates for such "missing factors". However, the delocalized XIST in these cells is also indicative of a defective X-inactivation system. Because the human Xi is in a mouse cell background, many other factors encoded on autosomal regions will be missing in these cells. Therefore, there will always be an uncertainty  96  about whether an abnormal behavior of XIST (and inactivation in general) in these cells is due to some unknown factor. Nevertheless, this study has demonstrated that these hybrid cells are useful tools in studying certain aspects of X-inactivation. More specifically, factor(s) that may have a direct physical interaction with XIST can be investigated in these cells. Proteins considered to be candidates for being participants in the ribonucleoprotein complex with XIST RNA can be introduced into this hybrid system, and any change in XIST localization can be examined. Moreover, any such factors identified will likely be species-specific, since Xist RNA localizes normally in these cells. A more exciting possibility for this hybrid system is the study of factors involved in the potential for Xinactivation beyond the "developmental window" 38, Once again, one can complement these cells with human specific candidate factors, and look for signs of XIST localization and other features of X-inactivation, such as DNA methylation and, histone acetylation. This study investigated macroH2A1.2 as the first candidate for possible interaction with XIST RNA. The results, although not completely conclusive, confirmed and further defined the nature of the relationship between the histone variant and XIST RNA. XIST localization appears to be required for proper MCB formation, which suggests a physical relationship with macroH2Al .2. The aberrant localization of macroH2Al .2 in response to Xist expression identifies that there may be species-specific factors involved in this relationship. Immediate follow-up experiments to this study include further ChlPs targeting mH2Al.l and mH2A1.2 to confirm if there is a direct physical interaction with XIST/Xist RNA. More sophisticated cytogenetic techniques must also be used to clarify the images presented in this study, such as FISH labeling of  97  the X chromosome in order to pinpoint more accurately where the GFP signals are distributed, as well as RNA-FISFf to visualize XIST RNA localization simultaneously. One consideration for future investigation into macroH2A1.2's functional role in mammalian silencing of the X chromosome is the imprinted version of X-inactivation. In some mammals, cells undergoing early development are subject to imprinted Xinactivation, in that the paternally inherited X chromosome is preferentially inactivated, and these cells eventually give rise to the extra-embryonic tissues 161. Past experimental evidence has shown that macroH2A1.2 colocalization on the inactive X chromosome occurs much earlier in the imprinted form of X-inactivation 162 The significance of this difference between the two types of X-inactivation remains unknown, although it does suggests that perhaps the role of macroH2A1.2 is more important in one than the other. Could it be that macroH2A1.2 is important in imprinted inactivation of the paternal X chromosome, thus is recruited immediately after XIST RNA coating, and that MCB formation in random X-inactivation is simply a non-crucial "residual" effect? Indeed, the fact that the loss of macroH2A1.2 on the inactive X does not lead to reactivation supports the hypothesis that macroH2A1.2's role may not lie in the actual maintenance of the inactive state 163 There has also been skepticism about the actual uniqueness of macroH2A1.2 localization to the inactive X chromosome. Perche et al. recently showed that many different histones, and not just macroH2A, were found to be much more concentrated on the inactive X chromosome than on autosomes 164. Their staining technique revealed higher signal intensities for H2A, H2B, and H3, and suggested that macroH2A only appears to be tightly associated with the inactive X chromosome because of the highly  98  heterochromatic packaging of the chromatin. This claim was soon challenged by experiments using epitope-tagged H2A and H2B showing no significant increase in intensely staining on the inactive X chromosome 165. Another factor to consider is that it is very probably that macroH2Al .2's role in the mammalian cell extends beyond Xinactivation. The very fact that abundant expression of macroH2Al has been observed in both sexes is indicative of functions that are not involved in X-inactivation 128 The main problem thus remains: most experiments on macroH2A have been involved in visually characterizing localization patterns. Although these studies are all important in identifying the possible existence of an intimate role in X-inactivation, the identification of interacting factors (possibly from the hypothetical ribonucleoprotein complex) will be needed in order to fully dissect the true relationship between XIST RNA and macroH2A.  99  REFERENCES 1. 2. 3. 4. 5.  6. 7.  8. 9.  10. 11.  12. 13. 14. 15. 16. 17.  18. 19.  Lyon, M.F. Gene action in the X-chromosome of the mouse (Mus musculus L.). Nature 190, 372-373 (1961). Heard, E., Clerc, P. & Avner, P. X-chromosome inactivation in mammals. Annu. Rev. Genet. 31, 571-610 (1997). Gartler, S.M. & Riggs, A.D. Mammalian X-chromosome inactivation. Ann. Rev. Genet. 17, 155-190(1983). Sharman, G.B. Late DNA replication in the paternally derived X chromosome of female kangaroos. Nature 230, 231-232 (1971). Cooper, D.W., VandeBerg, J.L., Sharman, G.B. & Poole, W.E. Phosphoglycerate kinase polymorphism in kangaroos provides further evidence for paternal X inactivation. Nature New Biol. 230, 155-157 (1971). Graves, J.A.M. Mammals that break the rules: genetics of marsupials and monotremes. Annu. Rev. Genet. 30, 233-260 (1996). Carrel, L., Cottle, A.A., Goglin, K.C. & Willard, H.F. A first-generation Xinactivation profile of the human X chromosome. Proc. Natl. Acad. Sci., USA 96, 14440-14444(1999). Disteche, C M . Escape from X inactivation in human and mouse. Trends in Genet. 11, 17-22(1995). Rastan, S. Non-random X-chromosome inactivation in mouse X-autosome translocation embryos-location of the inactivation centre. J. Embryol. Exp. Morph. 78, 1-22 (1983). Lee, J.T. & Jaenisch, R. Long-range cis effects of ectopic X-inactivation centres on a mouse autosome. Nature 386, 275-279 (1997). Brown, C.J. et al. A gene from the region of the human X inactivation centre is expressed exclusively from the inactive X chromosome. Nature 349, 38-44 (1991). Borsani, G. et al. Characterisation of a murine gene expressed from the inactive X chromosome. Nature 351, 325-329 (1991). Brockdorff, N. et al. Conservation of position and exclusive expression of mouse Xist from the inactive X chromosome. Nature 351, 329-331 (1991). Brown, C.J. & Willard, H.F. Molecular and genetic studies of human X chromosome inactivation. Adv. Dev. Biol. 2, 37-72 (1993). Clerc, P. & Avner, P. Role of the region 3' to Xist exon 6 in the counting process of X-chromosome inactivation. Nat. Genet. 19, 249-253 (1998). Lee, J.T., Davidow, L.S. & Warshawsky, D. Tsix, a gene antisense to Xist at the X-inactivation center. Nat. Genet. 21, 400-404 (1999). Rasmussen, T.P., Wutz, A., Pehrson, J. & Jaenisch, R. Expression of Xist RNA is sufficient to initiate macrochromatin body formation. Chromosoma 110, 411-420 (2001). Lyon, M.F. X-chromosome inactivation: a repeat hypothesis. Cytogenet. Cell Genet. 80,133-137 (1998). White, W.M., Willard, H.F., Van Dyke, D.L. & Wolff, D.J. The spreading of X inactivation into autosomal material of an X;autosome translocation: evidence for  100  20.  21.  a difference between autosomal and X-chromosomal DNA. Am. J. Hum. Genet. 63, 20-28 (1998). Riggs, A.D. DNA methylation and late replication probably aid cell memory, and type I DNA reeling could aid chromosome folding and enhancer function. Phil. Trans. R. Soc. Lond. 326, 285-297 (1990). Hong, Y.K., Ontieros, S.M., Chen, C , and Strauss, W.M. A new structure for the murine Xist gene and its relationship to chromosome choice/counting during Xchromosome inactivation. Proceedings of the National Academy of Science USA  22.  23.  24.  25.  26. 27.  28. 29. 30. 31.  32. 33. 34. 35. 36.  96, 6829-6834 (1999). Hong, Y.K., Ontiveros, S.D., and Strauss W.M. A revision of the human XIST gene organization and structural comparison with mouse Xist. Mammalian Genome 11, 220-224 (2000). Brown, C.J. et al. The human XIST gene: analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell 71, 527-542(1992). Brockdorff, N. et al. The product of the mouse Xist gene is a 15kb inactive Xspecific transcript containing no conserved ORF and located in the nucleus. Cell 71,515-526 (1992). Clemson, C M . , McNeil, J.A., Willard, H.F. & Lawrence, J.B. XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. J. Cell Biol. 132, 259-275 (1996). Beard, C , Li, E. & Jaenisch, R. Loss of methylation activates Xist in somatic but not in embryonic cells. Genes & Dev. 9, 2325-2334 (1995). Hendrich, B.D. & Willard, H.F. Epigenetic [^regulation of gene expression: the effect of altered chromatin structure from yeast to mammals. Hum. Mol. Genet. 4, 1765-1777(1995). Penny, G.D., Kay, G.F., Sheardown, S.A., Rastan, S. & Brockdorff, N. Requirement for Xist in X chromosome inactivation. Nature 379, 131-137 (1996). Avner, P. & Heard, E. X-chromosome inactivation: counting, choice and initiation. Nature Reviews: Genetics 2, 59-67 (2001). Cattanach, B.M. & Papworth, D. Controlling elements in the mouse V. Linkage tests with X-linked genes. Genet. Res. 38, 57-70 (1981). Migeon, B.R., Chowdhury, A.K., Dunston, J.A. & Mcintosh, I. Identification of TSIX, encoding an RNA antisense to human XIST, reveals differences from its murine counterpart: implications for X inactivation. Am. J. Hum. Genet. 69, 951960 (2001). Sado, T., Wang, Z., Sasaki, H. & Li, E. Regulation of imprinted X-chromosome inactivation in mice by Tsix. Development 128, 1275-1286 (2001). Lee, J.T. Disruption of imprinted X inactivation by parent-of-origin effects at Tsix. Ce//103, 17-27 (2000). Lee, J.T. & Lu, N. Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell 99, 47-57 (1999). Johnston, C M . et al. Developmentally regulated Xist promoter switch mediates initiation of X inactivation. Cell 94, 809-817 (1998). Brown, C J . & Willard, H.F. The human X inactivation center is not required for maintenance of X inactivation. Nature 368, 154-156 (1994).  101  37.  38.  39.  40. 41. 42.  43.  44.  45.  46. 47. 48. 49. 50.  51.  52. 53. 54. 55.  Clemson, C M . , Chow, J.C, Brown, C J . & Lawrence, J.B. Stabilization and localization of Xist RNA are controlled by separate mechanisms and are not sufficient for X inactivation. J. Cell Biol. 142,13-23 (1998). Hall, L.L. et al. An ectopic human XIST gene can induce chromosome inactivation in postdifferentiation human HT-1080 cells. Proc. Natl. Acad. Sci. USA 99, 8677-8682 (2002). Stuckenholz, C , Kageyama, Y. & Kuroda, M.I. Guilt by association: non-coding RNAs, chromosome-specific proteins and dosage compensation in Drosophila. Trends Genet. 15, 454-458 (1999). Gilbert, S.L., Pehrson, J. & Sharp, P.A. XIST RNA associates with specific regions of the inactive X chromatin. J. Biol. Chem. 275, 36491-36494 (2000). Pehrson, J.R. & Fried, V.A. MacroH2A, a core histone containing a large nonhistone region. Science 257, 1398-1400 (1992). Wutz, A., Rasmussen, T.P. & Jaenisch, R. Chromosomal silencing and localization are mediated by different domains of Xist RNA. Nat. Genet. 30, 1-8 (2002). Beletskii, A., Hong, Y.-K., Pehrson, J., Egholm, M. & Strauss, W.M. PNA interference mapping demonstrates functional domains in the noncoding RNA Xist. Proc. Natl. Acad. Sci., USA 98, 9215-9220 (2001). Bestor, T., Laudano, A., Mattaliano, R., and Ingram V. Cloning and sequencing of a cDNA encoding DNA methyltransferase of mouse cells. Journal of Molecular Biology 203, 971-983 (1988). Okano, M., Xie, S., and Li, E. Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. Nature Genetics 19, 219-220 (1998). Razin, A., Riggs, A.D. DNA methylation and gene function. Science 210, 604610(1980). Jones, P. A., and Takai, D. The Role of DNA Methylation in Mammalian Epigenetics. Science 293, 1068-1070 (2001). Bird, A. The essentials of DNA methylation. Cell 70, 5-8 (1992). Cooper, D.N., and Krawczak, M. Cytosine methylation and the fate of CpG dinucleotides in vertebrate genomes. Human Genetics 83,181-188 (1989). Leonhardt, H., Page, A.W., Weier, H., and Bestor, T.H. A targeting sequence directs DNA methyltransferase to sites of DNA replication in mammalian nuclei. CW/71, 865-873 (1992). Lei, H., Oh, S.P., Okano, M., Juttermann, R., Goss, K.A., Jaenisch, R.,and Li, E. De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development 122, 3195-3205 (1996). Bestor, T.H. The DNA methyltransferases of mammals. Human Molecular Genetics 9, 2395-2402 (2000). Taylor, S.M., and Jones, P.A. Multiple new phenotypes induced in 10T1/2 and 3T3 cells treated with 5-azacytidine. Cell 17, 771-779 (1979). Jones, P.A. Altering gene expression with 5-azacytidine. Cell 40,485-486 (1985). Jutterman, R., Li, E. & Jaenisch, R. Toxicity of 5-aza-2'deoxycytidine to mammalian cells is mediated primarily by covalent trapping of DNA  102  56. 57.  methyltransferase rather than DNA demethylation. Proc. Natl. Acad. Sci. 91, 11797-11801 (1994). Jones, P A . & Laird, P.W. Cancer epigenetics comes of age. Nat. Genet. 21, 163167(1999). Tate, P.H., and Bird, A.P. Effects of DNA methylation on DNA-binding proteins and gene expression. Current Opinion in Genetics and Development 3, 226-231  58.  59. 60.  61. 62.  63. 64.  65.  66. 67. 68. 69.  70. 71. 72.  (1993). Boyes, J. & Bird, A. Repression of genes by DNA methylation depends upon CpG density and promoter strength: evidence for involvement of a methyl-CpG binding protein. EMBO J. 11, 327-333 (1992). Wolffe, A.P., and Pruss, D. Targeting chromatin disruption: Transcriptional regulators that acetylate histones. Cell 84, 817-819 (1996). Nan, X., Ng, H.H., Johnson, C.A., Laherty, CD., Turner, B.M., Eisenman, R.N., and Bird, A. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 393, 386-389 (1998). Li, E., Bestor, T.H. & Jaenisch, R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69, 915-926. (1992). Okano, M., Bell, D.W., Haber, D.A. & Li, E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Ce//99, 247-257(1999). Strachan, T.a.R., A.P. Human Molecular Genetics, (BIOS Scientific Publishers Limited, New York, 1996). Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251-260 (1997). Tse, C , Sera, T., Wolffe, A.P. & J.C, H. Disruption of higher-order folding by core histone acetylation dramatically enhances transcription of nucleosomal arrays by RNA polymerase III. Mol. Cell. Biol. 18, 4629-4638 (1998). Wolffe, A.P. Chromatin: Structure Function, (Academic Press, London, 1992). Marmorstein, R. Structure and function of histone acetyltransferases. CMLS 58, 693-70 (2001). Kuo, M.H. et al. Transcription-linked acetylation by Gcn5p of histones H4 and H4 at specific lysines. Nature 383, 269-272 (1996). Wang, L., Liu, L. & Berger, S.L. Critical residues for histone acetylation by Gcn5, functioning in Ada and SAGA complexes, are also required for transcriptional function in vivo. Genes Dev. 12, 640-653 (1998). Grant, P A . et al. Expanded lysine acetylation specificit of Gcn5 in native complexes. J. Biol. Chem. 274, 5895-5900 (1999). Timmermann, S., Lehrmann, A., Polesskaya, A. & Harel-Bellan, A. Histone acetylation and disease. CMLS 58, 728-736 (2001). Cress, W.D. & Seto, E. histone deacetylases, transcriptional control, and cancer. J. Cell Physiol. 184, 1-16(2000).  73.  Allfrey, V.G., Faulkner, R. & Mirsky, A.E. Acetylation and methylation of histones and their possible role in the regulation of RNA synthesis. Proc. Natl. Acad. Sci. USA 51, 786-794 (1964).  103  74.  75.  76.  77.  78.  79. 80. 81.  82.  83.  84. 85. 86. 87. 88.  89.  90.  Pogo, B.G.T., Allfrey, V.G. & Mirsky, A.E. RNA synthesis and histone acetylation during the course of gene activation in lymphocytes. Proc. Natl. Acad. Sci. USA 55, 6212-6222 (1966). Hebbes, T.R., Thorne, A.W. & Crane-Robinson, C. A direct link between core histone acetylation and transcriptionally active chromatin. EMBO J. 7, 1395-1403 (1988). Vettese-Dadney, M. et al. Acetylation of histone H4 plays a primary role in enhancing transcription factor binding to nucleosomal DNA in vitro. EMBO J. 15, 2508-2518 (1996). Turner, B., Birley, A. & Lavender, J. Histone H4 isoforms acetylated at specific lysine residues define individual chromosomes and chromatin domains in Drosophila polytene nuclei. Cell 69, 375-384 (1992). Lavender, J.S., Birley, A.J., Palmer, M.J., Kuroda, M.I. & Turner, B.M. Histone H4 acetylated at lysine 16 and other components of the Drosophila dosage compensation pathway colocalize on the male X chromosome through mitosis. Chromos. Res. 2, 398-404 (1994). Parekh, B.S. & Maniatis, T. Virus infection leads to localized hyperacetylation of histones H3 and H4 at the IFN-beta promoter. Mol. Cell 3, 125-129 (1999). Kadosh, D. & Struhl, K. Histone deacetylase activity of Rpd3 is important for transcriptional repression in vivo. Genes Dev. 12, 797-805 (1998). Jeppeson, P. & Turner, B. The inactive X chromosome in female mammals is distinguished by a lack of histone H4 acetylation, a cytogenetic marker for gene expression. Cell 74, 281-189 (1993). Belyaev, N.D., Keohane, A.M. & Turner, B.M. Differential underacetylation of histones H2A, H3 and H4 on the inactive X chromosome in human female cells. Hum. Genet. 97, 573-578 (1996). Wakefield, M.J., Keohane, A.M., Turner, B.M. & Graves, J.A.M. Histone underacetylation is an ancient component of mammalian X chromosome inactivation. Proc. Natl. Acad. Sci. 94, 9665-9668 (1997). Turner, B.M. Histone acetylation as an epigenetic determinant of long-term transcriptional competence. Cell Mol. Life Sci. 54, 21-31 (1998). Murray, K. The occurrence of epsilon-N-methyl lysine in histones. Biochemistry 3(1964). van Holde, K.E. Chromatin, (Springer-Verlag, New York, 1988). Rice, J.C. & Allis, C D . Histone methylation versus histone acetylation: new insights into epigenetic regulation. Curr. Opin. Cel. Biol. 13, 263-273 (2001). Byvoet, P., Shepherd, G.R., Hardin, J.M. & Noland, B.J. The distribution and turnover of labeled methyl groups in histone fractions of cultured mammalian cells. Arch. Biochem. Biophys. 148, 558-567 (1972). Baxter, CS. & Byvoey, P. Intercalating agents as probes of the spatial relationship betweenchromatin components. Biochem. Biophys. Res. Commun. 63, 286-291 (1975). Strahl, B.D. & Allis, C D . The language of covalent histone modifications. Nature 403, 41-45 (2000).  104  91.  92. 93.  Annunziato, A.T., Eason, M.B. & Perry, C A . Relationship between methylation and acetylation of arginine-rich histones in cycling and arrested HeLa cells. Biochemistry 34, 2916-2924 (1995). Reuter, G. & Spierer, P. Position effect variegation and chromatin proteins. Bioessays 14, 605-612 (1992). Karpen, G.H. Position-effect variegation and the new biology of heterochromatin. Curr. Opin. Genet. Dev. 4, 281-291 (1994).  94. 95. 96. 97.  98. 99.  100. 101.  102. 103.  104.  105.  106.  107. 108. 109.  Wakimoto, B.T. Beyond the nucleosome: epigenetic aspects of position-effect variegation in Drosophila. Cell 93, 321-324 (1998). Grewal, S.I. & Klar, A.J. Chromosomal inheritance of epigenetic states in fission yeast during mitosis and meiosis. Cell 86, 95-101 (1996). Cavalli, G. & Paro, R. The Drosophila Fab-7 chromosomal element conveys epigenetic inheritance during mitosis and meiosis. Cell 93, 505-518 (1998). Grewal, S.I., Bonaduce, M.J. & Klar, A.J. Histone deacetylase homologs regulate epigenetic inheritance of transcriptional silencing and chromosome segregation in fission yeast. Genetics 150, 563-576 (1998). Eissenberg, J.C. & Elgin, S.C. The HP1 protein family: getting a grip on chromatin. Curr. Opin. Genet. Dev. 10, 204-210 (2000). Jenuwein, T., Laible, G., Dorn, R. & Reuter, G. SET domain proteins modulate chromatin domains in eu- and heterochromatin. Cell. Mol. Life. Sci. 54, 80-93 (1998). Rea, S. et al. Regulation of chromatin structure by site-specific histone H3 methyltransferases. Jature 406, 593-599 (2000). Lachner, M., O'Carroll, D., Rea, S., Merchtier, K. & Jenuwein, T. Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 401, 116-120 (2001). Bannister, A.J. et al. Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410, 120-124 (2001). Wei, Y., Yu, L., Bowen, J., Gorovsky, M.A. & Allis, C D . Phosphorylation of histone H3 is required for proper chromosome condensation and segregation. Cell 97, 99-109 (1999). Cheung, P. et al. Synergistic coupling of histone H3 phosphorylation and acetylation in response to epidermal growth factor stimulation. Mol. Cel. 5, 905915 (2000). Lo, W.S. et al. Phosphorylation of serine 10 in histone H3 is functionally linked in vitro and in vivo to Gcn5-mediated acetylation at lysine 14. Mol. Cell. 5, 917926 (2000). Clayton, A.L., Rose, S., Barratt, M.J. & Mahadevan, L . C Phosphoacetylation of histone H3 on c-fos- and c-jun-associated nucleosomes upon gene activation. EMBOJ. 19,3714-3726(2000). Jenuwein, T. & Allis, C D . Translating the histone code. Science 293, 1074-1080 (2001). Dhalluin, C. et al. Structure and ligand of a histone acetyltransferase bromodomain. Nature 399,491-496 (1999). Winston, F. & Allis, C D . The bromodomain: a chromatin-targeting module? Nat, Struct. Biol. 6, 601-604 (1999).  105  110.  111.  112.  113.  114. 115. 116. 117.  118.  119. 120.  121. 122.  123.  124.  125.  126.  Owen, D.J. et al. The structural basis for the recognition of acetylated histone H4 by the bromodomain of histone acetyltransferase gcn5p. EMBO J. 19, 6141-6149 (2000). Brasher, S.V. et al. The structure of mouse HP1 suggests a unique mode of single peptide recognition by the shadow chromo domain dimer. EMBO J19, 1587-1597 (2000). Cowieson, N.P., Partridge, J.F., Allshire, R.C. & McLaughlin, P.J. Dimerisation of a chromo shadow domain and distinctions from the chromodomain as revealed by structural analysis. Curr Biol 10, 517-525 (2000). Jacobson, R.H., Ladurner, A.G., King, D.S. & Tjian, R. Structure and function of a human TAFII250 double bromodomain module. Science 288, 1422-1425 (2000). Sun, Z.W. & Allis, C D . Ubiquitination of histone H2B regulates H3 methylation and gene silencing in yest. Nature 418, 104-108 (2002). Taylor, J.H. Rates of chain growth and units of replication in DNA of mammalian chromosomes. J. Mol. Biol. 31, 579-594 (1968). Huberman, J.A. & Riggs, A.D. On the mechanism of DNA replication in mammalian chromosomes. J. Mol. Biol. 32, 327-341 (1968). Jackson, D.A. & Pombo, A. Replicon clusters are stable units of chromosome structure: evidence that nuclear organization contributes to the efficient activation and propagation of S phase in human cells. J. Cell Biol. 140, 1285-1295 (1998). Ten Hagen, K.G., Gilbert, D.M., Willard, H.F. & Cohen, S.N. Replication timing of DNA sequences associated with human centromeres and telomeres. Mol. Cell. Biol. 10, 6348-6355 (1990). Taylor, J.H. Asynchronous duplication of chromosomes in cultured cells of Chinese hamster. Biophysic. Biochem. Cytol. 7, 455-463 (1960). Boggs, B.A. & Chinault, A.C. Analysis of replication timing properties of human X-chromosomal loci by fluorescence in situ hybridization. Proc. Natl. Acad. Sci. 91,6083-6087 (1994). Selig, S., Okumura, K., Ward, D.C. & Cedar, H. Delineation of DNA replication time zones by fluorescence in situ hybridization. EMBO J. 11, 1217-1225 (1992). Mohandas, T., Crandall, B.F., Sparkes, R.S., Passage, M.B. & Sparkes, M.C. Late replication studies in a human X/13 translocation: correlation with autosomal gene expression. Cytogenet. Cell Genet. 29, 215-220 (1981). Couturier, J. et al. Evidence for a correlation between late replication and autosomal gene inactivation in a familial translocation t(X;21). Hum. Genet. 49, 319-326(1979). Mohandas, T., Sparkes, R.S. & Shapiro, L.J. Genetic evidence for the inactivation of a human autosomal locus attached to an inactive X chromosome. Am. J. Hum. Genet. 34, 811-817 (1982). Taysi, K., Sparker, R.S., O'Brien, T.J. & Dengler, D.R. Down's syndrome phenotype and autosomal gene inactivation in a child with presumed (X;21) de novo translocation. J. Med. Genet. 19, 144-148 (1982). Sharp, A., Robinson, D.O. & Jacobs, P.A. Absence of correlation between latereplication and spreading of X inactivation in an X;autosome translocation. Hum. Genet. 109,295-302(2001).  106  127. 128.  129. 130. 131.  132.  133. 134. 135.  136.  137.  138. 139.  140.  141.  142.  143.  Lee, Y. et al. Isolation of cDNA clones encoding human histone macroH2Al subtypes. Biochimica et Biophysica Acta 1399, 73-77 (1998). Rasmussen, T.P. et al. Messenger RNAs encoding mouse histone macroH2Al isoforms are expressed at similar levels in male and female cells and result from alternative splicing. Nucleic Acids Re. 27, 3685-3689 (1999). Pehrson, J.R., Costanzi, C. & Dharia, C. Developmental and tissue expression patterns of histone macroH2Al subtypes. J. Cell Biochem. 65, 107-113 (1997). Costanzi, C. & Pehrson, J.R. MacroH2A2, a new member of the MacroH2A core histone family. J. Biol. Chem. 276, 21776-21784 (2001). Chadwick, B.P. & Willard, H.F. A novel chromatin protein, distantly related to histone H2A, is largely excluded from the inactive X chromosome. J. Cell Biol. 152, 375-384 (2001). Csankovski, G., Panning, B., Bates, B., Pehrson, J.R. & Jaenisch, R. Conditional deletion of Xist disrupts histone macroH2A localization but not maintenance of X inactivation. Nat. Genet. 22, 323-324 (1999). McKee, B.D. & Handel, M.A. Sex chromosomes, recombination, and chromatin conformation. Chromosoma 102, 71-80 (1993). McCarrey, J.R. & Dilworth, D.D. Expression of Xist in mouse germ cells correlates with X-chromosome inactivation. Nature Genetics 2, 200-203 (1992). Richler, C , Soreq, H. & Wahrman, J. X inactivation in mammalian testis is correlated with inactive X-specific transcription. Nature Genetics 2, 192-195 (1992). Salido, E.C., Yen, P.H., Mohandas, T.K. & Shapiro, L.J. Expression of the Xinactivation-associated gene XIST during spermatogenesis. Nature Genetics 2, 196-199(1992). Hoyer-Fender, S., Costanzi, C. & Pehrson, J.R. Histone macroH2Al .2 is concentrated in the XY-body by the early pachytene stage of spermatogenesis. Exp. Cell Res. 258, 254-260 (2000). Pehrson, J.R. & Fuji, R.N. Evolutionary conservation of histone macroH2A subtypes and domains. Nucleic Acids Res. 26, 2837-2842 (1998). Valentin, H.E., Zwingmann, G., Schonebaum, A. & Steinbuchel, A. Metabolic pathway for biosynthesis of poly(3-hydroxybutyrate-co-4-hydroxybutyrate) from 4-hydroxybutyrate by Alcaligenes eutrophus. Eur. J. Biochem. 227, 43-60 (1995). Dominguez, G., Wang, C Y . & Frey, T.K. Sequence of the genome RNA of rubella virus: evidence for genetic rearrangement during togavirus evolution. Virology 177, 225-238 (1990). Gorbalenya, A.E., Koonin, E.V. & Lai, M.M. Putative papain-related thiol proteases of positive-strand RNA viruses. Identification of rubi- and aphthovirus proteases and delineation of a novel conserved domain associated with proteases of rubi-, alpha- and coronaviruses. FEBS Lett. 288, 201-205 (1991). LaStarza, M.W., Lemm, JA. & Rice, C M . Genetic analysis of the nsP3 region of Sindbis virus: evidence for roles in minus-strand and subgenomic RNA synthesis. J. Virol. 68, 5781-5791 (1994). Wang, Y.F., Sawicki, S.G. & Sawicki, D.L. Alphavirus nsP3 functions to form replication complexes transcribing negative-strand RNA. J. Virol. 68, 6466-6475 (1994).  107  144.  Chadwick, B.P., Valley, CM. & Willard, H.F. Histone variant macroH2A contains two distinct macrochromatin domains capable of directing macroH2A to the inactive X chromosome. 29, 2699-2705 (2001). Changolkar, L.N. & Pehrson, J.R. Reconstitution of nucleosomes with histone macroH2A1.2. 41, 179-184 (2002). Vijay-Kumar, S., Chandra, N., Dharia, C. & Pehrson, J.R. Crystallization and preliminary X-ray crystallographic studies of nonhistone region of macroH2A. 1. 22, 290-292 (1995). Richler, C , Dhara, S.K. & Wahrman, J. Histone macroH2A1.2 is concentrated in the XY compartment of mammalian male meiotic nuclei. 89,118-120(2000). Turner, J.M.A., Burgoyne, P.S. & Singh, P.B. M31 and macroH2A1.2 colocalise at the pseudoautosomal region during mouse meiosis. J. 114, 3367-3375 (2001). Mermoud, J.E., Costanzi, C , Pehrson, J.R. & Brockdorff, N. Histone macroH2Al .2 relocates to the inactive X chromosome after initiation and propagation of X-inactivation. J. 147, 1399-1408 (1999). Mermoud, J.E., Tassin, A.M., Pehrson, J.R. & Brockdorff, N. Centrosomal association of histone macroH2A1.2 in embryonic stem cells and somatic cells. 268, 245-251 (2001). Littlefield, J.W. Selection of hybrids from matings of fibroblasts in vitro and their presumed recombinants. 29, 353-363 (1964). Willard, H.F., Brown, C.J., Carrel, L., Hendrich, B. & Miller, A.P. Epigenetic and chromosomal control of gene expression: molecular and genetic analysis of X chromosome inactivation. 58, 315-322 (1993). Tinker, A.V. & Brown, CJ. Induction of XIST expression from the human active X chromosome in mouse/human somatic cell hybrids by DNA demethylation. 26, 2935-2940 (1998). Hansen, R.S., Canfield, T.K., Stanek, A.M., Keitges, E.A. & Gartler, S.M. Reactivation of in normal fibroblasts and a somatic cell hybrid: abnormal localization of XIST RNA in hybrid cells. 95, 51335138 (1998). Hendrich, B.D., Brown, CJ. & Willard, H.F. Evolutionary conservation of possible functional domains of the human and murine genes. 2, 663-672 (1993). Hansen, R.S., Ellis, N.A. & Gartler, S.M. Demethylation of specific sites in the 5' region of the inactive X-linked human phosphoglycerate kinase gene correlates with the appearance of nuclease sensitivity and gene expression. 8, 4692-4699 (1988). Brown, CJ. & Willard, H.F. Noninactivation of a selectable human X-linked gene that complements a murine temperature-sensitive cell cycle defect. A m . J. Hum. 45, 592-598 (1989). Henke, W., Herdel, K., Jung, K., Schnorr, D. & Leoning, S.A. Betaine improves the PCR amplificaiton of GC-rich DNA sequences. 25, 39573958 (1997).  Nucl. Acids Res.  145. 146.  147.  148.  149.  150.  151. 152.  Biochem.  Proteins  Cytogenet.  Cell  Genet.  Cell Sci.  Cell Biol.  Exp. Cell Res.  Genomics  Cold Spring Harbor Quant. Symp. Biol.  153.  154.  155.  Nucl. Acids Res.  XIST  Genet.  156.  Proc. Natl. Acad. Sci. USA XIST  Hum.  Mol. Cell.  157.  Mol.  Biol.  Genet.  158.  Nucleic Acids Res.  108  159.  160.  161.  162.  163. 164. 165.  Carrel, L. et al. X inactivation analysis and DNA methylation studies of the ubiquitin activating enzyme El and PCTAIRE-1 genes in human and mouse. Hum. Mol. Genet. 5, 391-402 (1996). Rasmussen, T.P., Mastrangelo, M.A., Eden, A., Pehrson, J.R. & Jaenisch, R. Dynamic relocalization of histone macroH2Al from centrosomes to inactive Xchromosomes during X inactivation. J. Cell Biol. 150, 1189-1198 (2000). Takagi, N. & Sasaki, M. Preferential inactivation of the paternally derived X chromosome in the extraembryonic membranes of the mouse. Nature 256, 640642 (1975). Costanzi, C , Stein, P., Worrad, D.M., Schultz, R.M. & Pehrson, J.R. Histone macroH2Al is concentrated in the inactive X chromosome of female preimplantation mouse embryoes. Development 127, 2283-2289 (2000). Boumil, R.M. & Lee, J.T. Forty years of decoding the silence in X-chromosome inactivation. Hum. Mol. Genet. 10, 2225-2232 (2001). Perche, P.-Y. et al. Higher concentrations of histone macroH2A in the Barr body are correlated with higher nucleosome density. Curr. Biol. 10, 1531-1534 (2000). Chadwick, B.P. & Willard, H.F. Histone H2A variants and the inactive X chromosome: identification of a second macroH2A variant. Hum. Mol. Genet. 10, 1101-1113 (2001).  109  APPENDIX  Primer: L I G G F P 5'-TCTTGTTAGTTGCCGTCGTCCTT-3'  primer EGFPN1 I  mH2A1.2 306bp  Primer:  617bp  C1SEQ1  5'-ATGGACGAGCTGTACAAGTCCGGA-3'  primer  EGFPC1  mH2A1.2 1  15bp  872bp  Figure A - l : D i a g r a m of Sequencing Results  A unique primer was designed for each of the two macroH2A1.2-GFP constructs to be used in sequencing reactions. Both produced sequence data that overlapped the corresponding ligation junction and confirmed that the two protein fragments were in frame.  110  is  f a u — rib. u < fc 8 R y H° uH u O O < o < t - R C E<o u o H E- g u z < a o u a Ua Eu- 2E- u< E— H < y < E E- E— U R«§ Ru < o RP <a a 38« H Ea 3 E- < R a u u a a o u R < a g a ho H a a ^ a t <: < o 9 ° 8 Ea E- Ea a H E- < 2 fc < 3 a a fc O $ Or " ) E2- < E a P o E— o o f- < R < Z o a y o a a a u EH a o y a y HH a 2 < Efc u u o E— < <c o R u y &- u u Ua H EE— a a 2 EU Rub E - fc o E fc U ^ Eo S2£ o f— a o Za H R s< t- t U < u aa O O U H < t— t— O U u o a y a u E— oE - o u a H h h < a a fc ° < a a< ^ O a u ER o a u uo a U <R ^ < a  u  u  ai H  O H r j O P <  uo fc a E-  uu  E-  H U  < o a<  u o Ru < a o R a o  < R uz o< y H < E- y o ^ R z 3 o fc u R E- H < E- y 2 t R " fc E-u u EE -< 5 H E a u y a o < fcE— a 8«S a EEU -fc ^ u 3 u u a<c u< E — U a u H H U  y  II^II<u afc y a <: a ° oR< P  O  E—  Is ya U  E— E—  Ra 2 fc E- E— a 2 RS E— a a fc U U u fc O u E< R < fc o R ^ R o Ea 8 2 E E— •J u U H C U U u u o U R a u a ua E— CJ g o R H < a a UU U <; u H uu au uE- uE- uo o Eu z a u u — f E— ^ ya o o u o P< R E— u < a _ H < a u a o Ea f- U E- < fcU a o H o P fc < u <! u L_ E a < Ea Uo Oo E-y H < y P^ R rt E-U< f— <E - ^ a R  < — f  U  U  <  U  a  ig  uu  E—  U  < H O fc o u a u fc CJ o < < fc o a y O u O H u a y y E- o — f a P Et-  b %  E-  a au  o o fl fl  fc  y fc u rt o a<U  <E-U E- U <  u ^2 p fc o<u<; E— a <o < o a R u u a a 2 fc ua< o S u a u< < R ^ ER E- u u < R < o (— < < O o 5 R < E— < uu< < R H B u E- o u o E— a a a < R R U < <! O EEa ua uu oSU u E— R ooo < a u fc R Ea uo aa a < Euu< aa Ry SRfc U ^ E ^ o< o s— R o a a uo 0 S R Efc 5 u o ii fc < a •< g R ^ a a -11 a < < EE -- a u < E— a oooo E— u R^= uu E- g fc a < o R Oo < o < uSi < o pR oo O 3oU R o u E— a o u o5 <y <<y R < u a a <<o R o 1o a < R ° o y o S P o a fc cl < a o o oU -< < o <; < R < ^8 R a o au a < R < < <u o u < R <u R<fc u a E<R u a R a a fc: ^ < < o 3 ^ u a u HU UU u .E a ufc ^ u a u U EE— y u Efc Eo P g <<u fc < ouE — Eu- aU E— yfc oo a U y ^ Eut - fc y o< ufc oo a a a u << E - E - O u u < a E— u •< H 3 a o< < < E— u u E— E- a fc z  cn  cn  u  s  u cj o E fl A B cu  —  S «  U  CU  fl  A  ox g* sr S  cn cn  "0 —< >—' 71 W W  Iii  < << <o a  u  fc  E-  a < a E- a g o y u u E- i- ^ <; u R < 1*E - fc< E— E— Eo a < t— o u < P o a o << ua ° fc o ^ R y E- o aE - ofc i <; o H < o fc o o < R ^ <a E- a < 5 R u < o E- E- < f _ E— u a E- o o U y < < < o H f - fc 5< EZ E- E- o < „ E- < 2< <: fc ° rt O u o z a o o a U U O u- fcfc o EuuE— o < 2< R < o o < o < o uuao< E< oa y< fc R ^U O < EU- O ^ R <c<o < U UE - OU H a E- u ^ < PQ a o u u o H UO OU OU O O E— u o < u O < O E— E— U _2. E- U u  U  RH  o o  111  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099696/manifest

Comment

Related Items