Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Expression patterns of nitrate transporter genes (AtNRT) in Arabidopsis thaliana Okamoto, Mamoru 2002

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2002-732258.pdf [ 12.84MB ]
Metadata
JSON: 831-1.0099687.json
JSON-LD: 831-1.0099687-ld.json
RDF/XML (Pretty): 831-1.0099687-rdf.xml
RDF/JSON: 831-1.0099687-rdf.json
Turtle: 831-1.0099687-turtle.txt
N-Triples: 831-1.0099687-rdf-ntriples.txt
Original Record: 831-1.0099687-source.json
Full Text
831-1.0099687-fulltext.txt
Citation
831-1.0099687.ris

Full Text

Expression Patterns of Nitrate Transporter Genes (AtNRT) in Arabidopsis thaliana. by Mamoru Okamoto B.Sc , Tokyo University of Agriculture and Technology, 1992 M . S c , Tokyo University of Agriculture and Technology, 1994 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF G R A D U A T E STUDIES (Department of Botany) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH C O L U M B I A April 2002 © Mamoru Okamoto, 2002 In present ing th i s thes is in pa r t i a l f u l f i lmen t of the requirements for an advanced degree at the Un ivers i ty of B r i t i s h Columbia, I agree that the L ibrary sha l l make i t f r ee l y ava i lab le for reference and study. I fur ther agree that permission for extensive copying of t h i s thes is for scho la r ly purposes may be granted by the head of my department or by h is or her representat ives. It i s understood that copying or pub l ica t ion of t h i s thes is for f i nanc ia l gain sha l l not be allowed without my wr i t ten permission. Department of The Un ivers i ty of B r i t i s h Columbia Vancouver, Canada Date Aprt/ 2.2 , Z&oZ. Abstract Higher plants possess both high- and low-affinity nitrate transporters. Since the first Arabidopsis thaliana low-affinity nitrate transporter gene, AtNRTl.l (CHL1), was isolated (Tsay et al., 1993), three low-affinity (NRT1), and seven high-affinity (NRT2) nitrate transporter gene homologues have been identified in this species. We investigated the transcript abundances of all eleven genes both in shoot and root tissues in response to NO3" provision, by relative quantitative RT-PCR method. Based upon their patterns of expression following NO3" provision, the genes were classified into three groups: 1. nitrate-inducible, 2. nitrate-repressible, and 3. nitrate-constitutive. AtNRTl.l, 2.1, and 2.2, representatives of the first group, were strongly induced, by 1 mM NO3", peaking at 3 to 12 hours, and declining during 3 subsequent days. By contrast AtNRT2.4 showed only modest induction both in shoots and roots. Expression of AtNRT2.7, one of the nitrate-repressible genes from the second group, was strongly suppressed by nitrate provision in both roots and shoots. The last group, characterized by a constitutive expression pattern, contains the largest membership, including AtNRTl.2, 1.4, 2.3, 2.5, and 2.6. Tissue-specific expression patterns of limited number of AtNRT genes were observed by using GUS reporter D N A fusion lines. In the root tip regions, AtNRTl.l, 2.1 and 2.4 were expressed, while in the epidermal cells of mature roots, AtNRT2.1, 2.2, 2.4, and 2.6 were expressed. Expression of AtNRT2.1 was also found in the cortex and endodermal cells. In shoots AtNRTl.l showed expression in leaves and flowers, while AtNRT2.6 was specifically expressed in pollen grains. l ^ N C ^ -influx from 100|iM and 5mM [NO3"], chosen to examine high-affinity and low-affinity transport, respectively, corresponded closely with the expression patterns of AtNRT2.1 and i i respectively. These results indicate that despite the close homology among members of the NRT2 and NRT1 families, individual members appear to be differently regulated, and may therefore perform different functions with respect to nitrate transport. iii Table of Contents Abstract i i Table of Contents iv List of Tables v List of Figures vi List of Abbreviations viii Acknowledgments ix Chapter 1. General Introduction. 1 Chapter 2. Gene Structure and Predicted Protein Sequence Analysis of the AtNRT Gene Families 8 2.1 Introduction 8 2.2 Methods 9 2.3 Results and Discussion 11 Chapter 3. Expression Patterns of Nitrate Transporter AtNRT Genes 38 3.1 Introduction 38 3.2 Materials and Method 40 3.3 Results 43 3.4 Discussion 57 Chapter 4. Tissue-Specific Expression Patterns of AtNRT Genes 63 4.1 Introduction 63 4.2 Materials and Method 65 4.3 Results 67 4.4 Discussion 80 Chpater 5. Functional Aspects of Nitrate Transporters 86 5.1 Introduction 86 5.2 Materials and Method 89 5.3 Results and Discussion 91 Chpater 6. Conclusion and Future Prospective 113 References 117 iv List of Tables Table 2-1. NRT (nitrate transporter) families in Arabidopis. 10 Table 2-2. Prediction of membrane topology on the NRT2 members with seven methods. 23 Table 3-1. Gene specific primers and conditions of RT-PCR. 42 Table 3-2. AtNRT Genes and hypothesized nitrate transport systems. 61 Table 5-1. Coefficients of determination (r2) for the relationships between AtNRT gene expressions and two nitrate transport systems. 95 V List of Figures Figure 2-1. Physical map of AtNRTl and AtNRT2 gene family members. 12 Figure 2-2. D N A and deduced amino acid sequences of the AtNRTl. 1 gene. 13 Figure 2-3. D N A and deduced amino acid sequences of the AtNRTl. 2 gene. 14 Figure 2-4. D N A and deduced amino acid sequences of the AtNRT2.3 gene. 15 Figure 2-5. D N A and deduced amino acid sequences of the AtNRT2.4 gene. 17 Figure 2-6. D N A and deduced amino acid sequences of the AtNRT2.5 gene. 19 Figure 2-7. D N A and deduced amino acid sequences of the AtNRT2.6 gene. 20 Figure 2-8. D N A and deduced amino acid sequences of the AtNRT2.7 gene. 21 Figure 2-9. Amino acid sequence alignments of AtNRT2 family. 24 Figure 2-10. D N A and deduced amino acid sequence of the AtNRTl.l gene. 27 Figure 2-11. D N A and deduced amino acid sequence of the AtNRTl.2 gene. 30 Figure 2-12. D N A and deduced amino acid sequence of the AtNRTl. 3 gene. 32 Figure 2-13. D N A and deduced amino acid sequence of the AtNRTl.4 gene. 33 Figure 2-14. Amino acid sequence alignments of A tNRTl family. 36 Figure 3-1. Estimated relative expression levels of AtNRT genes. 45 Figure 3-2. Expression patterns of nitrate-inducible AtNRT2 genes. 47 Figure 3-3. Expression patterns of nitrate-inducible AtNRTl genes. 49 Figure 3-4. Expression patterns of nitrate-repressible AtNRT genes. 51 Figure 3-5. Expression patterns of nitrate-constitutive AtNRT2 genes. 52 Figure 3-6. Expression patterns of nitrate-constitutive AtNRTl genes. 53 Figure 4-1. Analysis of GUS activity in AtNRT2.1 promoter-GWS' Arabidopsis plants. 70 Figure 4-2. Analysis of GUS activity in AtNRT2.2 promoter-GUS Arabidopsis plants. 73 Figure 4-3. Analysis of GUS activity in AtNRT2.4 promoter-GUS Arabidopsis plants. 74 Figure 4-4. Analysis of GUS activity in AtNRT2.6 promoter-CrMS" Arabidopsis plants. 76 Figure 4-5. Analysis of GUS activity in AtNRTl.l promoter-GcTS Arabidopsis plants. 78 Figure 5-1. Time-course of nNC>3" influx into Arabidopsis roots at high-affinity range. 92 Figure 5-2. Time-course of 1 3 N03 _ influx into Arabidopsis roots at low-affinity range. 93 Figure 5-3. Phylogenetic tree of NRT2 family. 102 Figure 5-4. Phylogenetic tree of NRT1 family. 103 Figure 5-5. D N A and deduced amino acid sequences of the AtNar2.1 gene. 105 Figure 5-6. D N A and deduced amino acid sequences of the AtNar2.2 gene. 106 Figure 5-7. Amino acid sequence alignment of AtNar2.1 and AtNar2.2. 107 Figure 5-8. Expression patterns of AtNAR2.1 gene. 109 Figure 5-9. Correlation between AtNRT2.1 and AtNAR2.1 expression levels in roots. 110 Figure 5-10. Expression patterns of AtNAR2.1 gene and their correlation with AtNRT2.1 in shoots. I l l vii List of Abbreviations C : Carbon cHATS : Constitutive high-affinity transport system CK2 : Casein kinase 2 cLATS : Constitutive low-affinity transport system C R L R : Calcitonin-receptor-like-receptor GFP : Green fluorescent protein GOGAT : Glutamate synthase GS : Glutamine synthetase GUS : (3-glucuronidase iHATS : Inducible high-affinity transport system iLATS : Inducible low-affinity transport system K + : Potassium MFS : Major facilitator superfamily N : Nitrogen N i R : Nitrite reductase NNP : Nitrate/nitrite porter NOS : Nopaline synthase N R : Nitrate reductase ORF : Open reading frame PKC : Protein kinase C PTR : Peptide transporter R A M P : Receptor-activity-modifying protein RT-PCR : Reverse transcription-polymerase chain reaction TMS : Trans-membrane-spanner WT : Wild-type X-Gluc: 5-bromo-4-chloro-3-indolyl-P-D-glucoronide cyclohexylamine v i i i Acknowledgement First of all, I thank God for leading and protecting me during my journey of life. I would like to thank my supervisor professor Anthony D . M . Glass, for his intellectual and financial supports. His encouragement and passion in science and music made my Ph.D. study fruitful and enjoyable. I also would like to thank Dr. M . Yaeesh Siddiqi for his bottomless help. His appropriate advice and feedback were always helpful. I wish to thank members of my committees, professors George Haughn, and Paul J. Harrison for their inspiration; Drs. Yuji Kamiya, and Ken Shirasu for encouraging me to study abroad; and my former supervisor, professor Yasuhiro Arima for introducing me to the scientific path. This work has also been supported with generous help from members of the Glass lab from past and present. Especially, I would like to thank to Brent Kaiser, Anshuman Kumar, Suman Rawat, Salim Silim, Manuela Simon, Degen Zhuo, and John Vidmar. I also thank to collaborators professors Jim Kinghorn, and Sheila Unkles for heterologous expression systems, and professor Nigel M . Crawford for providing AtNRTl.l(CHLl)-GUS line. I would like to thank my parents for their support and encouragement. This work could not have been done without them. Finally, I wish to thank my wife Julie Okamoto, whose love, belief, and support have kept me strong mentally and physically. ix 1 General Introduction Nitrogen (N) constitutes a large proportion (-3-5%) of the dry weight of most plants and hence it is required in large quantities. By virtue of its relative scarcity in natural systems, its availability commonly limits plant growth, while among agricultural species also, nitrogen is the one of the most influential factors controlling rates of plant growth and absolute crop yield. In order to sustain current high levels of crop productivity global N fertilizer use has risen to ~10 H kg per annum, yet estimates of N use efficiency suggest values of 30 to 40% for cereals, the major crops with respect to fertilizer consumption (Raun and Johnson, 1999). In temperate agricultural soils, under aerobic conditions nitrate (NO3") is commonly the principal form of available N , since ammonium (NH4+) is quickly nitrified to NO3" under those conditions. Because of its chemical nature (negatively charged), NO3" is hardly retained on soil surfaces, which are usually negatively charged. Therefore NO3" in soil solution would be mobile, moving in soil according to mass flow, which is affected by 1 transpiration and irrigation. Excessive fertilization can cause environmental damage. Unabsorbed free NO3" can leach from soils and contaminate surface and/or ground water, escape to lakes, rivers, and oceans, and cause eutrophication. However, i f N fertilizer were reduced by an appropriate amount, it is claimed that plant growth might be maintained with minimum N losses from the soil (Raun and Johnson, 1999; Andersson et al., 2001; Mclsaac et al., 2001). The processes involved in nitrate acquisition by higher plants have therefore been of considerable interest to plant scientists and been extensively studied for several decades. Nitrate utilization by higher plants starts at the root surface where nitrate is absorbed into root cells through the plasma membrane. In many species both roots and shoots have the capability to assimilate nitrate into organic nitrogen compounds. Thus, in those species undertaking significant assimilation of nitrate (NO3") in the shoots, there is a requirement to transfer NO3" to the stele, and on to the leaves, either in the transpiration-driven ascent of sap, or by means of root pressure. In such cases there is a need to re-absorb NO3" from the leaf apoplast. Whether in roots or in shoots, NO3" is reduced to nitrite (NO2") by the enzyme nitrate reductase (NR) in the cytosol. Nitrite is then rapidly transported into plastids (i.e., proplastids in non-photosynthetic tissues, chloroplasts in photosynthetic tissues), and converted into ammonium ( N H / ) by the enzyme nitrite reductase (NiR). Ammonium is incorporated into amino acids by glutamine synthetase (GS) and glutamate synthase (GOGAT), and amino acids are the precursors of higher molecular weight organic nitrogen compounds such as" proteins, nucleic acids, coenzymes, or secondary metabolites (Marschner, 1995). 2 Nitrate uptake has been classified according to kinetic criteria as occurring as a result of three discrete transport systems: a constitutive high-affinity transport system (cHATS), an inducible high-affinity transport system (iHATS), and a low-affinity transport system (LATS) (Glass and Siddiqi, 1995; Crawford and Glass, 1998; Forde, 2000). The cHATS and iHATS typically operate in the range of 10 to 250 u,M N0 3 " , while the LATS only becomes evident above these concentrations. At such concentrations total uptake rates for NO3" are the sum of these three transporter activities (Siddiqi et al., 1990; Glass et al., 1992). The first high-affinity nitrate transporter gene, NrtA (originally called c r n A ) , was isolated from a filamentous fungus, A s p e r g i l l u s n i d u l a n s (Unkles et al., 1991). An A . n i d u l a n s mutant with a defective NrtA absorbed NO3" at roughly 20% the rate of WT (Unkles et al., 2001). Although this suggests that NrtA is the principal transporter, a second transporter (NrtB) absorbs NO3" with a much higher affinity (Km value of 11 | i M compared to 108 | i M for NrtA), suggesting that this transporter may be important for scavenging NO3" from low external concentrations. In C h l a m y d o m o n a s r e i n h a r d t i i there are also two high-affinity NO3" transporters and these exhibit differences in Km values of the same magnitude as observed in A . n i d u l a n s (Galvan et al., 1996). Genes encoding nitrate-inducible high-affinity transporters have been cloned from various higher plants, including A r a b i d o p s i s t h a l i a n a , using the reported sequences of the A . n i d u l a n s and C. r e i n h a r d t i i high-affinity transporter genes (Forde, 2000). In A . t h a l i a n a , representatives of the high-affinity nitrate transporter (AtNRTI) family, AtNRT2.1 and AtNRTI.2, were first isolated by use of degenerate primers based 3 upon the NrtA homologues (Zhuo et al., 1999), and by a differential display method (Zhuo et al., 1999; Filleur and Daniel-Vedele, 1999). The Arabidopsis genome project unveiled five more putative high-affinity nitrate transporters in the family (The Arabidopsis Genome Initiative, 2000). Preliminary experiments showed that all seven members were expressed in roots (Glass et al., 2001). It is well established that AtNRT2.1 is induced by N 0 3 " (Filleur and Daniel-Vedele, 1999; Lejay et al., 1999; Zhuo et al., 1999; Gansel et al., 2001), as are other NRT2 genes in barley (Trueman et al.; 1996; Vidmar et al., 2000), TV. plumbaginifolia (Quesada et al., 1997; Krapp et al., 1998), soybean (Amarasinghe et al., 1998), and tomato (Ono et al., 2000). The transcript abundances of AtNRT2.1 and the patterns of high-affinity nitrate influx under different conditions of N provision showed high correlations, suggesting that AtNRT2.1 is primarily responsible for iHATS activity (Zhuo et al., 1999; Lejay et al., 1999). This conclusion was substantiated by the recent finding that a T-DNA mutant, lacking AtNRT2.1 and a part of .2.2, lost about 70% of high-affinity NO3" uptake capacity compared to the WT plants, while LATS transport was unaffected (Filleur et al., 2001). Studies of expression patterns of AtNRT2.1 and HtNRT2.1, in response to treatments with amino acids and various inhibitors of NO3" assimilation strongly suggest that NRT2.1 is regulated at the transcript level by glutamine (Zhuo et al., 1999; Vidmar et al., 2000). Nevertheless, there is evidence to suggest that NO3" influx may be also regulated at the post-translational level (Forde, 2000; Vidmar et al., 2000). Therefore correlations between transcript abundance and NO3" influx must be interpreted with caution. Characterizations of other members of the NRT2 family (i.e., AtNRT2.3-2.7) and their functional determination await investigation. 4 Low-affinity NO3" transport is thought to be mediated by members of separate (unrelated) family, the NRT1 family, which belongs to a larger peptide transporter family (PTR, also called POP), which contains 51 or 52 members (http://www.cbs.umn.edu/arabidopsis). The first member of this family of putative low-affinity nitrate transporter genes, AtNRTl.l (originally designated CHL1), was isolated from an Arabidopsis mutant that was resistant to chlorate, a toxic NO3" analogue (Tsay et al., 1993). The AtNRTl family contains at least four members, including AtNRTl.l(CHLl), AtNRTl.2{NTL1), AtNRTl.3(NTP3), and AtNRTl .4{NTP2) that were isolated by homology searches using AtNRTl.l against the EST database (Hatzfeld and Saito, 1999; Huang et al., 1999; Forde, 2000). The present study has focused on these four members (i.e., AtNRTl.l, 1.2, 1.3, and 1.4). Although the AtNRTl family is generally designated as encoding L A T S , as stated above, it may express both HATS and LATS activities (Liu et al., 1999; Wang et al., 1998). Interestingly, the latest findings suggested that AtNRTl.l might also be involved in organogenesis (Guo et al., 2001). In this study I have characterized 11 members of NRT gene families in Arabidopsis thaliana (i.e., 4 AtNRTl; 7 AtNRTl). First of all, gene and predicted protein structures of AtNRT families were analyzed. These analyses provided the fundamental information upon which subsequent genomic analysis relied. Additional bioinformatics data will be presented in order to predict gene regulation and functional aspects of gene products (Chapter 2). Chapters 3 and 4 will focus on the expression patterns of AtNRT family members in total tissue extraction, and intact tissues, respectively. In Chapter 3, the transcript abundances were analyzed quantitatively by RT-PCR in both roots and shoots, in response to the provision of NO3" following a 7-day period of N 0 3 " deprivation. Gene expression 5 patterns of all 11 NRT genes were revealed with the sensitive RT-PCR method. The patterns were grouped into three categories, namely, nitrate-inducible, nitrate-repressible, and nitrate-constitutive. These expression patterns were then used to predict possible roles in nitrate uptake of the nitrate transporters in the species. In Chapter 4, tissue-specific expression patterns are presented using transgenic plants which carry AtNRT promoter regions fused with G U S reporter DNA. Previous in situ hybridization studies showed that A t N R T l . 1(CHL1) is expressed in epidermal and endodermal cells in the root tip region, and endodermal cells in mature root region, while expression of A t N R T l . 2 is primarily in epidermal cells and root hairs regardless of the stages of root development (Huang et al., 1996). In N i c o t i a n a p l u m b a g i n i f o l i a a high-affinity nitrate transporter NpNRT2 expression was found primarily in epidermal and endodermal cells in root tips, and in lateral root primordia in mature roots. To date, however, no information is available for the NRT2 family of genes in Arabidopsis. Therefore this is the first report showing the localization of expression of four high-affinity nitrate transporter genes (AtNRT2.1, 2.2, 2.4, and 2.6) in A . t h a l i a n a . Molecular analysis can predict possible gene and protein structures, and expression analysis provides clues concerning the regulation of genes at the in vitro and in situ levels. Subsequent questions relate to how these genes and/or gene products function. Do they function in isolation, or do they need to be coordinated with other proteins to generate functional transporters? In Chapter 5, NO3" influx studies were performed in parallel to compare patterns of influx in response to provision of NO3" after 7 days of N-deprivation, with patterns of gene expression. The kinetic study confirmed that Arabidopsis had four nitrate transport systems (i.e., iHATS, cHATS, inducible LATS, and constitutive LATS). 6 Nitrate transporter genes were then assigned to these systems based upon their expression patterns. The ultimate goal of this thesis is to elucidate the function of each of the nitrate transporters by integrating molecular and physiological information. 7 2 Gene Structure and Predicted Protein Sequence Analysis of the AtNRT Gene Families 2.1 Introduction Since the first nitrate transporter gene, AtNRTl.l (previously called CHL1), was isolated from higher plants (Tsay et al., 1993), three more genes were identified as AtNRTl homologues in A. thaliana. Although A t N R T l proteins are considered to be nitrate transporters, this family also belongs to a family of peptide transporters (PTR) (Pao et al., 1998). Seven AtNRT2 members encode high-affinity nitrate transporters, belonging to the nitrate/nitrite porter (NNP) (Pao et al., 1998) family, which is a subfamily of the major facilitator superfamily (MFS) (Pao et al., 1998). Typical MFS members possess 400-600 amino acid residues with 12-trans-membrane-spanner (TMS) which consists of two sets of 6-TMS. 8 As genome projects have developed, a huge genome information base has been built up from viruses and bacteria to eukaryotes including Homo sapience, and higher plants (e.g., Arabidopsis thaliana, and Oryza sativa). In order to interpret and apply those enormous biological databases, biological informatics (so called bioinformatics) has been developing rapidly. The advantage of bioinformatics is that we can characterize and predict the function of genes and gene products from various perspectives prior to initiating experiments. This is helpful for proteins such as membrane proteins, which are difficult to work with because of their hydrophobicity. In this chapter, gene structures and predicted protein sequences of all 11 members of AtNRT families will be presented. As well, further bioinformatic searches including cis-elements, signature motifs, transmembrane topology, and phylogenic analyses were carried out based on the gene and protein sequences using a computational approach. 2.2 Methods Bioinformatics D N A and predicted amino acid sequences were obtained from previous reports or from the online databases (accession numbers are provided in Table 2-1). AtNRTl.l and 2.2 were isolated by our group (Zhuo et al., 1999), and Filleur and D-Vedele (1999), and the sequence of AtNRT2.1 was used for a homology search, which was carried out on the B L A S T server (http://www.ncbi.nlm.nih.gov/blast). Nucleotide motifs of exacting regulatory D N A elements were searched with the P L A C E database (Higo et al., 1999; http://www.dna.affrc.go.jp/htdocs/PLACE). C L U S T A L W or X was used for an initial 9 I 2 CO CP I .03 CD o Q. CO c co CD SB or z CM Q) .Q CD CO 0 O c CD CD E 3 C C g 'co CO CD o o < c CD -4—» p c CD T3 CO •g o CO o c E < CD E o CO _ i l o co <=. o o O -J CD E CO c CD > co CD E c © 5 CD S <" 22 i - O l * J CD m — Z ® 3 O = . C L i . N O l O l ro N co C i oo 00 00 Ol Oi CM 00 oo o o CD LO LO o o 1^ -CO CO T— 00 O < O m CO CO < < < < < < CO 00 o oo o i o LJ. < o l Tj-o> o Li. < O 1^ o oo CN LO o CO < CM LO o CO < CM Ol co co oo CM co oo T ~ CM a: a: o o E CM z 5. CM CO CM CM 1 1 i i i -CM co <y> oo CO < O CM oi Oi CO LO co < < o i C l •<* eo TJ- oo co Tt" CO LO O CN Ol 1^ CO CM CM CO CM CO CM Ol O LO LO LO LO Tj- LO LO IO LO LO CO T -C l O i CD CD O i O i O i CO Ol c ro O O CO o C l LO LO oo LO CO E >2 K i _ AtN E AtN z i -.. 1 Z <=C o i O i O i CD o Oi LO p! CM CO 2 o i o i O l CD .CD B B ro ro X I o CO CM CM 00 CO O N- o CO co CM oo CM LO CO CM o Oi AAA AAC BAB AAB T— CM LO oo to co o • LO co CM T— CM OO CO Oi co o o O LO o O o O o LL CQ O < O < < < co oo LO CO CM P- P-alignment analysis (Thompson et al., 1994). Transmembrane prediction was performed by H M M T O P (Tusnady and Simon, 1998), M E M S T A T (Jones et al., 1994), SOSUI (Hirokawa et al., 1998), T M A P (Persson and Argos, 1994), T M H M M (Sonnhammer et al., 1998), TMpred (Hofmann and Stoffel, 1992), and Toppred2 (Claros and von Heijne, 1994). Other bioinformatic programs including Bioedit (Hall, 1999), GeneDoc (Nicholas and Nicholas, 1997), Sequence Assistant (http://www2s.biglobe.ne.jp/~haruta/), AnnHyb (http://annhyb.fTee.fr), and Altemis (http://www.sanger.ac.uk/Software/altemis) were also employed to support the analysis. 2.3 Results and Discussion Gene Structure of the AtNRT2 Family Besides the first two AtNRT2 genes (AtNRT2.1, and 2.2) cloned experimentally (Filleur and Daniel-Vedele, 1999; Zhuo et al., 1999), five more homologues were retrieved by a homology search against the database generated by the Arabidopsis genome project (Table 2-1). Three genes (i.e., AtNRT2.1, 2.2, and 2.7) are located on chromosome 1, where AtNRT2.1 and 2.2 are closely located in a tail-to-tail configuration (Zhuo et al., 1999). AtNRT2.3, 2.4, and 2.5, were found on chromosome 5, with AtNRT2.3 and 2.4 in tandem 3.8 kb apart (Forde, 2000) (Figure 2-1). The open reading frames (ORF) of AtNRT2.1, 2.2 and 2.3, which were interrupted by two introns in the same positions, encode 530 (57.7 kD), 522 (56.7 kD), and 539 (58.2 kD) amino acid residues, respectively (Figures 2-2, 2-3, and 2-4). The AtNRT2.4 gene has 11 T6D22 NRT2.1 NRT2.2 J ^ ~ ^ — F13K23i NRT2.7 1 NRT1.4 F18A8 sssss*avssssssssssssssssssssss,rssssss* A / R 7 1 3 MIL23 ^ F14D17 NRT2.6 si-///////////;wx***MMtsf**J7w:f*zf*^ 4 <r7777771^SS7SSSSSSSSSS//S////S//M^ NRT2.5 NRT2.4 NRT2.3 T15N1 Figure 2-1. Physical map of AtNRTl and AtNRTl gene family members. Chromosomes and centromeres are indicated in stripes and dots, respectively. B A C clones are indicated in arrows. 12 1419 GAGCTCATCGAAATAGTTGACTTTTTCACAATTTAGACATGAAATTTTTGTCTTTTATCAAATCCCAACTTGTTGGAAATTT 1337 GACACGTCAGCGAGATTGATCGATACGCACTTAGTCGTTTGACTTTTTCAAATACCCATCGCTACAAGAGTACGGAAATTTG 1255 CGTGCAACCACATTCTAATTATACGCATATCTACATATCAATCCACCGCACCGTCTAATCTACTCTATGATATTTTCAAGAC 1173 CTTTTCAAAAATTCAGATCCGCTAGCTACTACGAAAATCTAAATGACTAAAATAAAACTCTTAATCGTTAACTASA1ATGTT 1091 TCTATAATAATATATGTATATCATACTGTTTTATTTAGTTTGCCGTTTTTCTTTGTTCTAAAGTTTTTTTTTGGTGTGTTTA 1009 ACACTAGTAATTTTTTTGTTCTTTTTAATGTTAAAATA2ATATTTTCACCATCACATATACATTGACATACGTATCTAGGGT - 92 7 TTAGATGAAGACATGTACACACACGATATTGAT^TTTAACTATGTGTTTTTCCTTAATCAACGATTTCAATTTTTCACACCG - 8 4 5 AAAATGACATATGAAATCAATAAAATAGTTCTACTAAAAGTCCTATATATGCAATCGTAAGCAATTTGAAGAGACAACTAAT - 7 6 3 GTGCAGCTAAGGCCACTCTAAATCCGACCGCCAAGGAGATCAATTAGTTTATTCACTAAAGGATCATCTTCCCCTTTTGTGA - 6 81 ATACTATTTATTACC AAAAC AAAAC AAAAAAAACTATTCACAGTTACAATGAC AAAGATAACCCTCCATAATTAATTAGGAT - 5 9 9 P A T A G A P T A G T A A r C A T T C A T A T A n A A A A T A T T ' G T P G P P G T T A P T T A P f ^ T A G C r ' T R A A T G A T A A C T P A T C y A G T P A T G C T G T - 517 TACAGCAGTTCAAATTAAGTGTCCAGGTTATGACTTGGTGAAAGAGGACCAAACTTTTAAACCTTAAGAAAAGAAGAGGAAA - 4 3 5 AAAACAATTAGCCTATCCTGTATCACTGTATGTAACCAGACTTATGTTTGGTTTCCACGCAATTTGACGGATACATGTTTCT - 3 5 3 ATGAT^TAATAATGATAGTTTTATTACTAACACAACCATATTGTTGACTATCCATCCATAAATCATTAAATCGCAAGATGA - 2 71 GGGAAGGGTAGAGCGGTCATTTGGAAGG^TATCGGCAACCTTTGGTG^TAAGCGAGAGACTAGGAAGATGCTTGCGGCGAAA -18 9 ATGGATTCCTCGAAAATTAATATTTAAATCGM^GTTAACCGTTGAGAATCTCCAAAGAATGCTTTTTTCATTGTCAACACT -10 7 GGCTAGGAACCCiaiAXSAGCCATCGTGTGATTAATATTCAGACATCGATCAAATAAACTTGAATCAAATCTCAAACTTGCA - 2 5 AAGAAACTTGAAATATTTTATAACAATGGGTGATTCTACTGGTGAGCCGGGGAGCTCCATGC ATGGAGTCACCGGTAGAGAA M G D S T G E P G S S M H G V T G R E 19 58 CAAAGCTTTGCTTTCTCGGTGCAATCACCAATTGTGCATACCGACAAGACGGCCAAGTTCGACCTTCCGGTGGACACAGAGC Q S F A F S V Q S P I V H T D K T A K F D L P V D T E H 4 7 140 ATAAGGCAACGGTTTTCAAGCTCTTCTCCTTCGCCAAACCTCACATGAGAACGTTCCATCTCTCGTGGATCTCTTTCTCCAC K A T V F K L F S F A K P H M R T F H L S W I S F S T 74 222 ATGTTTTGTCTCGACTTTCGCAGCTGCACCACTTGTCCCTATCATCCGGGAGAATCTCAACCTCACCAAACAAGACATTGGA C F V S T F A A A P L V P I I R E N L N L T K Q D I G 101 304 AACGCCGGAGTTGCCTCTGTCTCTGGGAGTATCTTCTCTAGGCTCGTGATGGGAGCCGTGTGTGATCTTTTGGGTCCCCGTT N A G V A S V S G S I F S R L V M G A V C D L . L G P R Y 129 386 ACGGTTGTGCCTTCCTTGTGATGTTGTCTGCCCCAACGGTGTTCTCCATGAGCTTCGTGAGTGACGCAGCAGGCTTCATAAC G C A F L V M L S A P T V F S M S F V S D A A G F I T 156 468 GGTGAGGTTCATGATTGGTTTTTGCCTGGCGACGTTTGTGTCTTGTCAATACTGGATGAGCACTATGTTCAACAGTCAGATC V R F M I G F C L A T F V S C Q Y W M S T M F N S Q I 183 550 ATTGGTCTGGTGAATGGGACAGCAGCCGGATGGGGAAACATGGGTGGCGGCATAACGCAGTTGCTCATGCCCATTGTGTATG I G L V N G T A A G W G N M G G G I T Q L L M P I V Y E 211 632 AAATCATTAGGCGCTGCGGTTCCACAGCCTTCACGGCCTGGAGGATCGCCTTCTTTGTACCCGGTTGGTTGCACATCATCAT I I R R C G S T A F T A W R I A F F V P G W L H I I M 238 714 GGGAATCTTGGTGCTCAATCTAGGTCAAGATCTGCCAGATGGAAATCGAGCTACCTTGGAGAAAGCGGGAGAAGTTGCCAAA G I L V L N L G Q D L P D G N R A T L E K A G E V A K 265 796 GACAAATTCGGAAAGgtatatttatctatataaatatatattccttaataatttaggctgcttatgttacagatggatcaaa D K F G K intron I 270 878 agattaactcgtgatatcgtataaatgttgtagATTCTGTGGTATGCCGTTACAAACTACAGGACTTGGATCTTCGTTCTTC I L W Y A V T N Y R T W I F V L L 2 87 960 TCTACGGATACTCCATGGGAGTTGAGTTGAGCACTGATAATGTTATCGCCGAGTACTTCTTTGACAGgtttgtttttgatct Y G Y S M G V E L S T D N V I A E Y F F D R 309 1042 cgattggaaaatagaagaattaaattataacataagagtaaaactaatgtatacatcatacatggtttgtccagGTTTCACT intron II F H L 312 1124 TGAAGCTCCACACAGCAGGGCTCATAGCAGCATGTTTCGGAATGGCCAATTTCTTTGCTCGTCCAGCAGGAGGCTACGCATC K L H T A G L I A A C F G M A N F F A R P A G G Y A S 339 1206 TGACTTTGCAGCCAAGTACTTCGGGATGAGAGGGAGGTTGTGGACGTTGTGGATCATACAGACGGCTGGTGGCCTCTTCTGT D F A A K Y F G M R G R L W T L W I I Q T A G G L F C 366 1288 GTGTGGCTCGGCCGCGCCAACACCCTTGTAACTGCCGTTGTGGCTATGGTGCTCTTCTCTATGGGGGCACAAGCTGCTTGCG V W L G R A N T L V T A V V A M V L F S M G A Q A A C G 394 1370 GAGCCACCTTTGCAATTGTGCCCTTTGTCTCCCGGCGAGCTCTAGGCATCATCTCGGGTTTAACCGGGGCTGGAGGGAACTT A T F A I V P F V S R R A L G I I S G L T G A G G N F 421 1452 TGGATCAGGGCTCACACAACTCCTCTTCTTCTCGACCTCACACTTCACAACTGAACAAGGGCTAACGTGGATGGGAGTGATG G S G L T Q L L F F S T S H F T T E Q G L T W M G V M 448 1534 ATAGTCGCTTGCACGTTACCTGTGACCTTAGTTCACTTTCCTCAATGGGGAAGCATGTTCTTGCCTCCTTCCACAGATCCAG I V A C T L P V T L V H F P Q W G S M F L P P S T D P V 476 1616 TGAAAGGTACAGAGGCTCATTATTATGGTTCTGAGTGGAATGAGCAGGAGAAGCAGAAGAACATGCATCAAGGAAGCCTCCG K G T E A H Y Y G S E W N E Q E K Q K N M H Q G S L R 503 1698 GTTTGCCGAGAACGCCAAGTCAGAGGGTGGACGCCGCGTCCGCTCTGCTGCTACGCCGCCTGAGAACACACCCAACAATGTT F A E N A K S E G G R R V R S A A T P P E N T P N N V 530 1780 TGATCATACATTCCACCCACGGTGGAATGGTGAAGGATGATCGCATATAAGAATATGTCACACAGTGAAAAAAAAAAATGCA * 1862 AATGTTATCAATGCTTGCATAACATTACTATCTATCTTTCATTTACTAAACAAACCTTTTGCTTTTTGCCTTGAAATCTTTT 1944 TATTATATATCAAAATATATCTCTATGTCTTGAGATTTG Figure 2-2. DNA and deduced amino acid sequences of the AtNRT2.1 gene. The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. GATA boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 13 -13 2 6 TCAAACCCCAACAGGCCTCAACAGAGGGAACACCGGCCACGTCACCAAGATTGATGTATATACGCTAGTGGCACGGAAATGG -12 4 4 TACGGCATAAAATATACGAATACAACTACTTTTTCTTGTTATATTTAAGACGTCATCTACAACTACATTGTAATATATTTTG -116 2 GGTTATAATTTAGAACAAGACGTATAGCTCTACCTATCAATTCGCAGGAGTCGATTTAATACCTACCTATTTCTTTATGTAA - 9 9 8 GTCTGAGTTGTTTAATCAAATTTCCAAAGCAGCAACCATTTTTCCAGCAACTGAAACCATTTAAAACAAAATTTACCCAAAA - 916 AATTAAGAAGATTTTGAATTTCGAAATCAGACCACCTCAAAAGTCAAATCTTATATATTTTATGTTTATATCCAAGCATAAT - 8 3 4 C y T A T A T A T T T T C A T A G T T T G T f l G G A A A T C C A A A G T T T C T A A A T T T A T T P AAATTAAAGTCATTAATTAATCCATGTTTAAAT -7 5 2 AATCAAAGGACATGTGAAATTGCTAATGCCAGTCAAATTACATTACAACCAACTAAAATATCGAACAAATTAAGTTATGTCT -67 0 ATATGTGCTATACAAAATTATCTAATTTTTACAGTGTTATATATGGAAAATATATGATAAGTTTGTTGAAGTAATAAGCTTA -5 8 8 TTGATTTTTTAGAGACAACTAATGTGCAGCTAAGGCCACAACAAATTAAATCGTCCAGGAGACAGCAGTTTATTCACCACAA - 5 0 6 TCATTCCTATTCTTGATACGATGTGATATAGAATTACATTGATACCCTTAAGAAATTATGAAGAATATATGGTCTAAAAGAG - 4 2 4 AATCACAATGACATCGCTTAAAAATTATTTAAATATGGATTTTAATGAGTTCACGATGTGGTGCTTGATCCTGTTATAAGAT - 3 4 2 AATATGTATTACAGACATGTAAAAAAAAAATCCACTTCTGAAACACAAAAGGAGAAAAGGATACAGTTGTCACTTGTCATCT - 2 6 0 GAGAGGTGAATATCGGTAACCTTTGGGGATTAGCGAGAGAGTGGGAAAGATGCTTGCGGCGAATATGGATTCCTCGAAAAAA -17 8 ATGTATTTTTAATATTGTTTAGTTAGCCGTTGAGAATCTCCAAAGAATACTTTTTCTTTTTTTTTTTGAAATTGTCAAAGCT - 9 6 ATACGAATCCTATATAATCCCTCGTGTGACTAATATCTAGTACATCAATCAXAJ^MCTTGAATTTTCTCAAAGGAACTTGA -14 TACGTTTAAAATACATGGGTTCTACTGATGAGCCCGGAAGTTCCATGCATGGAGTTACCGGTAGAGAACAGAGCTATGCTTT M G S T D E P G S S M H G V T G R E Q S Y A F 23 69 CTCGGTAGATGGTAGTGAGCCGACCAACACAAAGAAAAAGTACAATCTGCCGGTGGACGCGGAGGATAAGGCAACGGTTTTC S V D G S E P T N T K K K Y N L P V D A E D K A T V F 50 151 AAGCTCTTCTCCTTCGCCAAACCTCACATGAGAACGTTCCACCTCTCGTGGATCTCTTTCTCCACATGTTTTGTTTCGACGT K L F S F A K P H M R T F H L S W I S F S T C F V S T F 7 8 233 TCGCAGCTGCACCACTTATCCCGATCATCAGGGAGAATCTTAACCTCACCAAACATGACATTGGAAACGCTGGAGTTGCCTC A A A P L I P I I R E N L N L T K H D I G N A G V A S 105 315 CGTCTCGGGGAGTATCTTCTCTAGGCTCGTGATGGGAGCCGTGTGTGATCTTTTGGGTCCTCGTTACGGTTGTGCCTTCCTT V S G S I F S R L V M G A V C D L L G P R Y G C A F L 132 397 GTGATGTTGTCTGCCCCAACGGTGTTCTCCATGAGCTTCGTGAGTGACGCAGCAGGCTTCATAACGGTGAGGTTCATGATTG V M L S A P T V F S M S F V S D A A G F I T V R F M I G 160 479 GTTTTTGCCTGGCGACGTTTGTGTCTTGTCAATACTGGATGAGCACTATGTTCAACAGTCAGATCATCGGTCTGGTGAACGG F C L A T F V S C Q Y W M S T M F N S Q I I G L V N G 187 561 GAC AGC AGCCGGATGGGGAAACATGGGTGGCGGCATAACGCAGTTGCTCATGCCC ATTGTGTATGAAATCATTAGGCGCTGC T A A G W G N M G G G I T Q L L M P I V Y E I I R R C 214 643 GGATCAACAGCGTTCACGGCCTGGAGGATCGCCTTCTTTGTCCCCGGTTGGTTGCACATCATCATGGGAATCTTGGTGCTCA G S T A F T A W R I A F F V P G W L H I I M G I L V L T 242 725 CGCTAGGTCAAGATCTGCCAGGTGGAAACAGAGCTGCCATGGAGAAAGCGGGAGAAGTTGCCAAAGACAAATTCGGAAAGgt L G Q D L P G G N R A A M E K A G E V A K D K F G K 268 807 atatctctatctacatgaatatgtcaaaacaagttaggctaactatgtcatagatggatcggatataataggctaactcgtg intron I 889 atatcgtataaatcgtgtagATTCTATGGTACGCCGTTACAAATTACAGGACTTGGATTTTCGTTCTTCTGTATGGATATTC I L W Y A V T N Y R T W I F V L L Y G Y S 2 89 971 CATGGGAGTTGAGTTAAGCACAGACAATGTTATCGCCGAGTACTTCTTTGATAGgtttgttttctgtctcgattggaaattg M G V E L S T D N V I A E Y F F D R 308 1053 acaacttcacatatattcaggaataacataagagtaaaatttatattcccttttatttttattttgtcaatcgttccctttt intron II 1135 atttaaaataaaaaaatggtatgttcagGTTTCACTTGAAGCTTCACACAGCGGGGATTATAGCAGCATGTTTCGGAATGGC F H L K L H T A G I I A A C F G M A 325 1217 CAATTTCTTTGCTCGTCCAGCAGGAGGCTGGGCATCTGACATTGCAGCCAAGCGCTTCGGAATGCGAGGGAGGTTGTGGACT N F F A R P A G G W A S D I A A K R F G M R G R L W T 352 1299 TTGTGGATCATTCAGACGTCCGGTGGTCTCTTTTGTGTGTGGCTCGGACGTGCCAACACCCTCGTCACTGCCGTTGTATCTA L W I I Q T S G G L F C V W L G R A N T L V T A V V S M 380 1381 TGGTCCTCTTCTCTTTAGGAGCACAAGCCGCTTGCGGAGCCACCTTTGCTATCGTGCCCTTTGTCTCCCGGCGAGCTCTAGG V L F S L G A Q A A C G A T F A I V P F V S R R A L G 407 1463 CATTATCTCGGGTTTAACCGGGGCTGGAGGGAACTTTGGGTCAGGACTCACACAGCTCGTCTTTTTCTCGACTTCGCGCTTC I I S G L T G A G G N F G S G L T Q L V F F S T S R F 434 1545 ACAACTGAAGAAGGGCTAACGTGGATGGGAGTGATGATAGTTGCTTGCACGTTGCCTGTTACCTTAATCCACTTTCCTCAGT T T E E G L . T W M G . V M I V A C T L P V T L I H F P Q W 462 1627 GGGGAAGCATGTTCTTCCCTCCTTCCAACGATTCGGTCGACGCTACGGAGCACTATTATGTTGGCGAATATAGTAAGGAGGA G S M F F P P S N D S . V D A T E H Y Y V G E Y S K E E 489 1709 GCAGCAGATTGGCATGCATTTAAAAAGCAAACTGTTTGCTGATGGAGCCAAGACCGAGGGAGGCAGCAGCGTCCACAAAGGG Q Q I G M H L K S K L F A D G A K T E G G S S V H K G 516 1791 AACGCAACCAACAATGCTTGATCATGTGTCATTGATATC AAGAAATTAATAATTTCACTTATGTGAAATGGACATAAACTGT N A T N N A * .522 1873 TGGAAAATAAAGAACCATTTCTTTCATCATTTGCTTTTA Figure 2-3. DNA and deduced amino acid sequences of the AtNRT2.2 gene. The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. G A T A boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 14 • 14 6 2 T A T A T A T A T A G A A C T A A A A C C A T T A C A A A A A G A A A A G A T T T C G C C T T T T T A A T G A T G G A T A A T T C T A A A G C C T A T A A G A C T T • 1 3 8 0 A A A C T T T T A T T T A A A A T C T A C A G T T T G T T G C C C A A A T A A A A T G T G A T A A G T A T A G A G A T A A C A A A A T A T A A A A T T A T T T C T T • 1 2 9 8 A C C A A A A A A A A A T A T A T A T A T A T A T A T A T A A G A C T A T T T T A C C G T A A T T T A T T G A T G A T T G C A G A C A A T A C A A G A T A T C T C T - 1 2 1 6 A G T T T A C A A A A A T A T C A T C A A C A A T A T T C G A G A G A A T A G T T C T T T T G A G T A T T T G C G G A T G G C C G G A A A C A A C A A C A C T T A G - 1 1 3 4 A A A T C A T A T T T A G T A A A G A A T T A T G T T T A G A G T T T A G A C T T T A T A G C T T A T A T A T T A T A T T G A G A T G A T A G A T G A T T A T A A G - 1 0 5 2 G A A A A A C A T A A G G A A G T C A A C T T A T C A T A A C G C T T C A T T G T A A G G A T A T G C G A A T A T C A A A G G C G G A A A G A T T T A G A A T A A G - 9 7 0 T G A A T A A C C C A T A A T T T C A T A A A C G T T A G A G C A T T T T T T T A G G A A A T T A T T T T A A G A T A G C A A T T A T T T C A T T T G G T G A G T C - 8 8 8 G A C C A C A T G G A A T C C T C A A G A G A C A A A T G A A A A A T A A T T A G A C T T T T T G A C G A T T T T T G C C T T C A T T G A T A C G T A C G G C C T C - 8 0 6 T T A G G C T T T T T A G C T A T T T C C A A T G C C A A C T G T C A A C A T T C G T A T C T C T T T C G C C A T T T T A G T G A A A T T C C A C A A A G T C A T T - 7 2 4 A T C T T T G A T G T A T A T A A C T T G C C A G G C T G C T A C T A T A C C A A A T A G A T T T A T A A A T A T T A T T T T T A G A T T T C T T T T C C A T A C T - 6 4 2 T T T T A A T T C T C A A A C G A A A C T T T A T G C A A A G T T G A A A T A A A G T T T T C T T C T G C A T T T C A C T T A A A A T T A T A A T T T G T C A A A C - 5 6 0 A G A A G T G C A A A C A T T G A T T T T C T G A C T G A A A A T T T T T C A A C C T T A C A A A A G T T G C T T G A A C T T T G T T T A G A A A A A A G A A A A T - 4 7 8 A C T A A T A C T T G A T A A A C C C T C A C G G T T C C T A T T T T A A A A C C A A A A C C T T C A A A T C A A A G A C T C A A G A A T C A A T T C A T A A A T G - 3 9 6 T G T G A G A C A A A A C T C A T A A C C C A A A T A T G G T A C A C G T A C G T A T G A A A C G T A C T T A A A T G C T A C A A A A G A A T A A T A T G T T T A G - 3 1 4 T T C T C A A A T T T A A A T A A T T T T T T C C T T C T A T C A T T A C T A A T C A A A A T T A C A A C T C A T A T C T A T A C T A A A T G C T A T T A T C A G C - 2 3 2 T A A C A A T A A T A A A A T T T T C A C A A A T T G G T A A A G T C C T T A T T A A C T T T T A C T T A T C T T A T T C A A A T C T C A T T A T T G G A C C C A C - 1 5 0 C T A A C C C T A C C C A C C A T A T G A T A T T G G T A T C C C C T C T G G C C T C T A T A T A A A C T T T G C A T T T C T C T A A T C T C C A A C T T A C A C C - 6 8 A A C A A A A C A C A A C A A A G A C C A T T A G C C T T C T C T C C C A C T C A G A G T C T T T C A T C T C A C T C T C G C C T T A A A T G A C T C A C A A C C A M T H N H 5 1 5 T T C T A A T G A A G A A G G C T C C A T T G G A A C C T C C T T G C A T G G A G T T A C A G C A A G A G A A C A A G T C T T C T C T T T C T C C G T C G A T G C T S N E E G S I G T S L H G V T A R E Q V F S F S V D A 32 9 7 T C G T C T C A A A C A G T C C A A T C A G A C G A T C C A A C A G C T A A A T T C G C C C T T C C G G T T G A T T C C G A A C A T C G A G C C A A A G T G T T C A S S Q T V Q S D D P T A K F A L P V D S E H R A K V F N 6 0 1 7 9 A C C C A C T C T C T T T T G C T A A A C C T C A C A T G A G A G C C T T C C A C T T A G G A T G G C T C T C A T T C T T C A C A T G C T T C A T C T C C A C C T T P L S F A K P H M R A F H L G W L S F F T C F I S T F 87 2 6 1 C G C G G C A G C A C C A T T A G T C C C C A T C A T C C G C G A C A A C C T C G A C C T C A C T A A A A C C G A C A T T G G A A A C G C C G G A G T C G C A T C C A A A P L V P I I R D N L D L T K T D I G N A G V A S 1 1 4 343 G T C T C T G G T G C C A T T T T C T C A A G G T T A G C C A T G G G A G C G G T T T G T G A T C T C C T C G G T G C A C G A T A T G G G A C T G C C T T C T C C C V S G A I F S R L A M G A V C D L L G A R Y G T A F S L 1 4 2 4 2 5 T C A T G C T A A C C G C C C C A A C C G T C T T C T C A A T G T C G T T T G T G G G T G G C C C T A G C G G A T A C T T A G G C G T C C G G T T C A T G A T C G G M L T A P T V F S M S F V G G P S ' G Y L G V R F M I G 1 6 9 5 0 7 A T T C T G T C T C G C C A C G T T T G T A T C A T G C C A G T A T T G G A C C A G C G T T A T G T T C A A C G G T A A G A T C A T A G G A C T A G T G A A C G G C F C L A T F V S C Q Y W T S V M F N G K I I G L V N G 1 9 6 5 8 9 T G T G C A G G C G G G T G G G G T G A T A T G G G C G G T G G A G T G A C T C A A C T C C T A A T G C C G A T G G T C T T C C A C G T C A T C A A A C T T G C C G C A G G W G D M G G G V T Q L L M P M V F H V I K L A G 2 2 4 6 7 1 G A G C C A C T C C G T T C A T G G C C T G G C G G A T A G C T T T C T T C G T T C C C G G A T T T C T T C A A G T T G T T A T G G G C A T T C T C G T C C T C A G A T P F M A W R I A F F V P G F L Q V V M G I L ' V L S 2 5 1 7 5 3 T C T C G G C C A A G A T C T C C C T G A C G G T A A C C T A A G T A C C C T T C A G A A G A G T G G T C A A G T C T C T A A A G A C A A A T T C T C C A A G G T A L G Q D L P D G N L S T L Q K S G Q V S K D K F S K 2 7 7 83 5 cttttctatatatatatatttctgtctcatcttcaaatatataacaaatccagaccaagaagaatatggctctcattaaaag intron I 9 1 7 aatcttgcaaacattaaacatactcatgaagttttgcaataaattcgtgaagaactatttcgtttatttagttaaataaatt 9 9 9 tctagtgtctaaaggtttttcttgttatagGTTTTCTGGTTTGCTGTGAAGAACTACAGAACATGGATTTTATTCGTTCTTT V F W F A V K N Y R T W I L F V L Y 2 9 5 1 0 8 1 ATGGATCTTCCATGGGAATTGAATTAACTATCAACAACGTTATCTCCGGATATTTTTACGACAGg ttcgatttcttattcgt G S S M G I E L T I N N V I S G Y F Y D R 3 1 6 1 1 6 3 taaaacccaactgatgaacttacttacttctgtcacaaggtaataaccttaatttgttttcttgttctctacgtatttatca intron I I 1 2 4 5 gGTTTAACCTTAAGCTTCAAACAGCTGGTATAGTAGCAGCCAGCTTTGGAATGGCTAACTTCATCGCCCGTCCCTTCGGTGG F N L K L Q T A G I V A A S F G M A N F I A R P F G G 3 4 3 1 3 2 7 T T A C G C T T C T G A T G T A G C G G C T C G G G T T T T T G G C A T G A G A G G C C G G T T A T G G A C C T T A T G G A T C T T T C A A A C C G T A G G A G C T Y A S D V A A R V F G M R G R L W T L W I F Q T V G A 3 7 0 1 4 0 9 C T T T T C T G T A T C T G G C T A G G T C G A G C T A G T T C A C T T C C C A T A G C A A T C C T A G C A A T G A T G C T C T T C T C A A T C G G T A C A C A A G L F C I W L G R A S S L P I A I L A M M L F S I G T Q A 3 9 8 1 4 9 1 C A G C T T G C G G A G C C C T C T T C G G A G T T G C A C C T T T T G T C T C G C G C C G C T C T C T A G G G C T C A T A T C G G G A C T A A C C G G C G C A G G A C G A L F G V A P F V S R R S L G L I S G L T G A G 4 2 5 1 5 7 3 A G G A A A C T T C G G G T C C G G T T T G A C T C A A C T G C T T T T C T T C T C A T C A G C G A G G T T T A G T A C A G C T G A G G G A C T C T C A T T G A T G G N F G S G L T Q L L F F S S A R F S T A E G L S L M 4 5 2 1 6 5 5 G G C G T T A T G G C G G T T T T G T G C A C A C T C C C A G T T G C G T T T A T A C A T T T T C C G C A A T G G G G A A G C A T G T T T T T A A G A C C G T C G A G V M A V L C T L P V A F I H F P Q W G S M F L R P S T 4 8 0 1 7 3 7 C C G A T G G A G A A A G A T C A C A G G A G G A A T A T T A T T A C G G T T C T G A G T G G A C G G A G A A T G A G A A A C A A C A A G G A T T G C A C G A A G G D G E R S O . E E Y Y Y G S E W T E N E K Q Q G L H E G 5 0 7 1 8 1 9 A A G C A T C A A A T T T G C A G A G A A T A G T A G G T C A G A G A G A G G C C G G A A A G T A G C T T T G G C T A A C A T T C C A A C G C C G G A G A A C G G A S I K F A E N S R S E R G R K V A L A N I P T P E N G 5 3 4 1 9 0 1 A C T C C A A G T C A T G T T T G A A G A C A A A A C T T A C A A G A G A T T T T C C T T T T A C A T T A A A T C C C T T T T T A A T A G T T T C A T A C T C C A C T P S H V * 5 3 9 1 9 8 3 T C A T A T A T G T A C C G A G T A A G A C C T T T T C T G T G A T A G G T A A G G A T C G A T G A G C T T G G T A C T T T A G T A T A A A T T A T T G T A A T G T 2 0 6 5 C A T C A G A A T G T T C A A C T A C T C T T T T T T C T G C A C C A A T A A G C T T T A T G T T C A A T C A G A T T T A C A T G T C A A G T G A A A A A A A C A A ' 2 1 4 7 A A A A A G T C T C T G T T T A C G G T G T G T G A A A T G C T A A G A G A G T C C A C A T G A A G A A A A C T T T A T G G A C A A G G A C C A Figure 2-4. DNA and deduced amino acid sequences of the AtNRT2.3 gene. The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. G A T A boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 15 3 introns and 4 exons, containing introns 2 and 3 in the same position as those of AtNRT2.1-2.3 (Figure 2-5). AtNRT2.5 and 2.6 have one short intron (Figures 2-6 and 2-7). The ORF of AtNRT2.5 encodes 493 amino acids (52.7 kD) which is the smallest protein among the NRT families, whereas AtNRT2.6 encodes the largest transporter (58.6 kD) in the NRT2 family. AtNRT2.6 shares the same intron position as the first intron of AtNRT2.1-2.3. Two introns were found in the AtNRT2.7 gene, the second intron having the same position as that of AtNRT2.5, while the first one is unique (Figure 2-8). Putative T A T A and G A T A boxes were found in the promoter regions of all members of the NRT2 genes. Some G A T A boxes were separated by 2-22 bp except in AtNRT2.7. Rastogi et al. (1997) found that the important region of spinach NiR promoter contained G A T A consensus sequences located 24 bp apart, harboring a potential binding site for a NIT2-like transcriptional factor. Nitrate-dependent transcription motifs (an AT-rich region followed by [AG]-[CG]-T-C-A) (Hwang et al., 1997) were observed in all AtNRT2 family members at -500 to -1000 bp from the start codon. However, those positions might be too far upstream. In the cases of nitrate reductase (NR) and nitrite reductase(NiR), the motifs were found at -140 to -250 bp upstream in Arabidopsis (Hwang etal., 1997). The seven AtNRT2 members encode predicted proteins consisting of 493-539 amino acids, which are typical membrane proteins. Membrane spanning regions and topologies were analyzed with prediction programs including HMMTOP (Tusnady and Simon, 1998), M E M S T A T (Jones et al., 1994), T M H M M (Sonnhammer et al., 1998), TMpred (Hofmann and Stoffel, 1992), and Toppred2 (Claros and Von Heijne, 1994). Although it is generally 16 1666 AAAACTCATCATTCCACAATATGTACATACGAAATAAGTTATGGAATAGM^TTTATCTTAATGAAGATTTCTCTTTTAAAA 1584 AAAAAACTAAAGCACAAAAGTGCTAACTAGAAAAAAGTTCTCGTTCACA&AArRTAAA&GTPATTAACTCATTACGAATTAA 1502 GAATAATGGACTTAATATAATGTTAAAGGTAAACAAGATCAAACAATAGCACTGTTGCACGTTTCCTCTGGAGTTTCTTAAG 1420 GACAAAAAAGGTTTTTATTTGTGAAGGTACAACTGTTATTGCTGTTACAATCTTCCTAAGCATAATTAGGGATCTGATTACA 133 8 TCATCACAACTTTAGTTTAATAAGTGAAAATCTATATATTATTTTGTTTATTTCAATAACATTCTATTATATTAACAAAAAA 1256 AAAAAAAAAATCAAATGGAACCTTTGAATCCATGCAAAGACATAGTCACATAGAGAGAGAGAGGACCCACCGGACTCGTTCA 1174 CATGTATGAATATGGATTGATTTTTATTTCTCTTTTTAAAAAAAAATATGGATCGATTATTGCATCCCATCATGTGGAAATA 1092 GCTCATTACCAAGAAAAAAAAAATTACAATGAAATTTTCTTAGATTAATCTCCGAAGTCTGTAGTAGTTAAGCTTACAAACT 1010 TCAAGGAAAATCACCTAATAAAAATTCGTGGATTTATTCCATGAGTATGGAGCTATAATTATAAACTTATTAAATAGAGAAT - 9 2 8 AGACTTGATAACTCGCAGTTGATAATGCCTCATGGTACAATCTCTGAAAACATCGATCGAGGTTCGAAATACCACCACAGCA - 8 4 6 ACGCAAAAAGCGTTGGCAAAATGCCAAAATCTCATGATTCTTTGGATTTAATTACTTCACCCAAGTTTAACGATTTTTATCG - 7 6 4 TTAATTTTCTTTAGGTAATGCTCTTTTGTAATATCTTTACATTTCATTTTCATGATACTAACATTCATAGCAAAACAAAATT - 6 8 2 ATATATTAAATAATGATTTTAAGAAGTAAACATGATTTTTTTTTTCTGTAACTGTAAGACTATGTTATTTATTTTTTATCTG - 6 0 0 AGAAAAAAAAACTTAGAAAGAAAAGGAATCATATAGAAAAGAGATTACATCATGCGCTGCGACATATAAAGTTTCAAATTAT - 51 8 ACCGCCGATCTTTATTATATTG_A|£AGTAAACTCTATGAGGATTTGCTGTATTAGACATGAAAAGAAATCGTTGTAAACAGAA - 4 3 6 CCAGAAAGTAGTTTCTCGTTTGAGAAAAAAAAAAAAAAAAAAAACTTCCTAGATATATGGACAGTTTAGTAATATTATATTG - 3 5 4 TTGATAAATACTAAATTGGAATATAAGTGAAAGTGAACCTTTGGGACGTATGACCAGGCTAAATTCTCGTGTTTGCATGCTC - 2 7 2 GCGGCGAAAGTGAATATTCCATACTATTAATATAAAGACACAACTTGTATAATTGTAATCAATCTCACATAAACAACTTTGA -19 0 ATCATTAATTATCGTTAAGAACTATACTATTATAGTATCATTTACGTAAAACGAATCCCACTTATAGCCTTTTCGAATCTCC -10 8 ATCGGCTCTTACGAAGTCAACTTTCGTATCTCT^IAXMAACCATTCTTCTCCTTCTTGTTCCCTAAACCAAGACCACAAGA -2 6 AAAAAACATAAAAAAATATTCACAAAATGGCCGATGGTTTTGGTGAACCGGGAAGCTCAATGCATGGAGTCACCGGCAGAGA M A D G F G E P G S S M H G V T G R E 19 57 ACAAAGCTATGCATTCTCTGTCGAGTCTCCGGCAGTTCCTTCCGACTCATCAGCAAAATTTTCTCTCCCCGTGGACACCGAA Q S Y A F S V E S P A V P S D S S A K F S L P V D T E 46 13 6 CACAAAGCCAAAGTCTTCAAACTCTTATCCTTTGAAGCTCCACATATGAGAACTTTCCATCTTGCTTGGATCTCATTCTTCA H K A K V F K L L S F E A P H M R T F H L A W I S F F T 7 4 221 CTTGCTTC ATTTCCACTTTCGCTGCTGCTCCTCTTGTCCCCATC ATTAGAGATAACCTTAATCTCACAAGACAAGATGTCGG C F I S T F A A A P L V P I I R D N L N L T R Q D V G 101 303 AAATGCTGGTGTTGCTTCTGTCTCTGGCAGTATCTTCTCTAGGCTTGTTATGGGAGCAGTTTGTGATCTCCTTGGGCCACGT N A G V A S V S G S I F S R L V M G A V C D L L G P R 128 385 TATGGCTGTGCTTTCCTCGTCATGCTCTCTGCTCCAACCGTCTTCTCCATGTCTTTCGTTGGTGGTGCCGGAGGgtaagcat Y G C A F L V M L S A P T V F S M S F V G G A G G 153 467 t c t t g t g a a t t g t a a a a t t t c t c a a a a a a c t t a a g a t t a a c t t c a c t t a g t c c t a t a t a a a t a t a t g t a c t a a t g t a c a t a t 54 9 gatatgcagttattgaaacaattttaaaagcatttttctaaaaaaccaaaggatttcatctcaaaattaattgacaataagg 631 aaagtagtttatataatggattattcttaatgtgggtttctaacaatattttggccatatatagGTACATAACGGTGAGGTT i n t r o n I Y I T V R F 159 713 CATGATCGGGTTCTGCCTGGCGACTTTCGTGTCATGCCAGTATTGGATGAGCACAATGTTCAATGGTCAGATCATAGGTCTA M I G F C L A T F V S C Q Y W M S T M F N G Q I I G L 186 795 GTGAACGGGACAGCGGCAGGGTGGGGGAACATGGGCGGTGGGGTCACTCAGTTGCTCATGCCAATGGTCTATGAGATCATCC V N G T A A G W G N M G G G V T Q L L M P M V Y E I I R 214 877 GACGGTTAGGGTCCACGTCCTTCACCGCATGGAGGATGGCTTTCTTCGTCCCCGGGTGGATGCACATCATCATGGGGATCTT R L G S T S F T A W R M A F F V P G W M H I I M G I L 241 959 GGTCTTGACTCTAGGGCAAGACCTCCCTGATGGTAATAGAAGCACACTCGAGAAGAAAGGTGCAGTTACTAAAGACAAGTTC V L T L G Q D L P D G N R S T L E K K G A V T K D K F 268 1041 T C A A A G g t a c t t t a t t a g t a c t t a a g t a a a a t a a a t g t t a a t t c t t c t t g g a t c c t t t g a t t c t t a g t c t t a t a t a t t a g g g S K i n t r o n II 270 1123 t c t g c a g a t c g t t g t c t a a a t t a t a t t a t t t t c a t t g a a t a t a t a a a g a a g g t t g t t c t g a t a t a g a t c t t a g a t t a a c a t t 1205 tagatagagacattaaattaatccaagaaagcgattcgactaactaaaaaaaaaaaaaaaaaacaattacgttttcatatag 1287 a a a a a g c g a a a t c c t t a t a a t a c t c t t c c a t a g a t t t t t t g t t t t c t c t t t t t t t t t t t t g t t a t a g a t c t t t t t a t t t g g t 1369 taagagtaagactcacagttttctggtggacaaattaaccagGTTTTATGGTACGCGATCACGAACTATAGGACATGGGTTT V L W. Y A I T N Y R T W V F 284 1451 TCGTGCTGCTATATGGATACTCCATGGGAGTAGAGCTCACAACCGATAACGTCATCGCTGAGTACTTTTTCGACAGgtataa V L L Y G Y S M G V E L T T D N V I A E Y F F D R 309 1533 ttattaaaactggtatataatttatcgaatccatagtcagtcagtctctaaagtataaacaataataacaagggtttgattg 1615 c t t t t a g c a t a t a t a g t a c t a t t a t t a t t g c a a t a t a c a a g g a t t t t g g t t t t t t c c t a a c c a t t a a a a t c a a t t t a a t t a a 1697 cgtcaatgccgcgtgttaattgtagtagacagtaaaactcaaactcaaatttgttgataccttgcatgtcgatttactacca i n t r o n I I I 1779 c a a t g t t t t a g c c a a a a a a c a t a t a t t t t t g a a a a a t g t a t t c t a c t c a t g a a a a t g a t t c t t g t t a a g c t t t c t t t a c a t t 1861 t c t g t t t t t g t a a a t c c a c t a c t t a c a t t t c a t t t a t t t g t t a c c g a g t a g a c c c t a a a t a t a t a a a t t a c t t c t a t g g a t c 1943 aaagactcaatacatggcgatcatttttcagGTTCCATCTTAAGCTTCATACCGCCGGTATAATCGCGGCAAGCTTTGGTAT F H L K L H T A G I I A A S F G M 326 2 025 GGCAAACTTCTTTGCCCGTCCTATTGGTGGTTGGGCCTCAGATATTGCGGCTAGACGCTTCGGCATGAGAGGCCGTCTCTGG A N F F A R P I G G W A S D I A A R R F G M R G R L W 353 2107 ACCCTATGGATCATCCAAACCTTAGGCGGTTTCTTCTGCCTATGGCTAGGCCGAGCCACCACGCTCCCGACCGCGGTTGTCT T L W I I Q T L G G F F C L W L G R A T T L P T A V V F 3 8 1 2189 TCATGATCCTCTTCTCTCTCGGCGCTCAAGCCGCTTGTGGAGCTACCTTTGCTATCATACCTTTCATCTCACGCCGCTCCTT M I L F S L G A Q A A C G A T F A I I P F I S R R S L 408 2 271 AGGGATCATCTCTGGTCTTACTGGAGCTGGTGGAAACTTCGGCTCTGGTTTGACCCAACTCGTATTCTTCTCGACCTCAACG G l I S G L T G A G G N F G S G L T Q L V F F S T S T 435 2353 TTCTCCACGGAACAAGGGCTGACATGGATGGGGGTGATGATTATGGCGTGTACATTACCCGTCACTTTAGTGCACTTCCCGC F S T E Q G L T W M G V M I M A C T L P V T L V H F P Q 4 63 Figure 2-5 DNA and deduced amino acid sequences of the AtNRT2.4 gene. 17 2435 AATGGGGAAGCATGTTTTTGCCTTCCACGGAAGATGAAGTGAAGTCTACGGAGGAGTATTATTACATGAAAGAGTGGACAGA W G S M F L P S T E D E V K S T E E Y Y Y M K E W T E 490 2517 GACCGAGAAGCGAAAGGGTATGCATGAAGGGAGTTTGAAGTTCGCCGTGAATAGTAGATCGGAGCGTGGACGGCGCGTGGCT T E K R K G M H E G S L K F A V N S R S E R G R R V A 517 2 599 TCTGCACCGTCTCCTCCGCCGGAACACGTTTAAGAGTTTTTAAATGTACATGTTGTATCAGTTTCTATATATTTCTCCAAAT S A P S P P P E H V * 5 2 7 2 681 GTGTAATTAGTTGATCGAATTGCATGCTTTAATTTCTTTTAAAGGATATGCTACTCTTCATGTAATTTCGTAACAATTATAT 2763 TGTTTTTTTAAATTTCGTA Figure 2-5. (continued). The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. GATA boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 18 1426 CTAGATTATCAGTTCCTGCAGTTGTCATCCGTACTGCTGTGGAGTGTAATGAGGCAGAGAAATCTTCCCCTGTGAACGACAA 1344 CGACAAACCCAGACGCGCTGCTACATCAAAGCCAGACCGGAAACCCAAATCCACAGCCTCTAAACTGATTGCGACACAGAAG 1262 GAAGAGGAGGCACTCGAATCCATTGCTCCAGAAGAAACTTCAGCTGAATGTGGTGAGATACTGAAGCAGGACGGGAAGCTAA 1180 AATCCGTTTCTCCCAAAAACAATAGCACTGCTTCTAACCTAGTATCATTTTCAAAAGCTAAGAAATCAACTATGAAGGAGAA 1098 TCTATCAGAGAACAAGGCTGAAGAGAGTGCATCGGTTAGTACCCGAAAACTGAAAATAGGAACGGAGATGACAGCCACGGTC 1016 GACCATGTTCGAGCCCTTGGATTGGTTCTTGATTTAGGTGGTGAAATCCGCGGTATGTACATATTCCAGGTATGTTTCAGTA -9 3 4 AATTCTCCTTTGACTTGTTCTCCCATTTTCTTGAGTTAACTTTTGAGGCGATATACTTAATTCTTGCTTTGTATTGATATTG - 8 5 2 TGTACTATGAATGAGTACAGGGAGATAAAGATAAGTTCAAAAAAGGAGACACATTGCGAGTGAAATGTACAAGTTTTAACAC - 7 7 0 CAAAGGAGTCCCTGTGATGGCTTTGGTTGACGAAGAGGGAGAAGAATAGTGGTAAACTCTCTTTCCTTTCTACAAGGTTTTT - 6 8 8 TCAACCCAAGGGATCATGTGGAGTCGATCATATGGATCATACGAGAGTTTTGCTTGAAATGTTTTTATCATACGGATCGAAT - 6 0 6 CAAGAGATGCTCGTTAGCTGCTTTTGGTGAGCAAATCTTGGTAGATGGATAGATTCATTGGCGTCACAACTTGAGGAAAGCT -524 AATGAACTCGGTTAGGTAACTAGTCTTTTACTTTGGCCTTGTGATGTGCCATTTTGTTTCTCTTTTATTGGGGGGGTTTTGT - 4 4 2 GGAACCGAAAGTGGATTGTATTGTTTAGTGTCTTAGTAACTGACGTCTGAAAGGTGCGTAACGCAAGTTTCATCATTTTTGT - 3 6 0 CCAATTTTTACAAAAATACAAAAGCACCAAAAACCCAAGTCGGCAGCTAAAGATAGAAACTACGCATCCCAATGGCATTCTT - 2 7 8 GATAGATATTATTTGTCCGAATATATTTTCTTCTAAATTACAAATTCATTTCAACAATTGACGTCAAAAATTAATTTAAGCC -19 6 AAGAGACGAGGAACTAAAATTGAATTTCACATTTTGATTGAGCATTTGGGTTTGAATTAAGATTACTCGAAAGTTGCCAAAA -114 GTTTGCCTCTGAGTCATTTTATTGTTCATGAAAGATTTAAATTCAAAGATAATGTTCATTGATTGGGTGGTCGTGTAAGTAA - 3 2 GAGTCGTCAGCGAGTTTTCTTCTCCGAGAGTAATGGAGCCATCTCAACGCAACACCAAACCGCCGTCGTTTTCAGATTCCAC M E P S Q R N T K P P S F S D S T . 1 7 51 TATCCCGGTTGATTCCGATGGTCGAGCCACCGTCTTCCGACCATTCTCTCTCTCCTCGCCACACTCACGAGCCTTTCACCTA I P V D S D G R A T V F R P F S L S S P H S R A F H L 44 133 GCTTGGCTCTCACTCTTCTCATGCTTCTTCTCCACCTTCTCCATCCCTCCTCTGGTCCCCGTCATCTCCTCCGACCTCAACC A W L S L F S C F F S T F S I P P L V P V I S S D L N L 7 2 215 TCTCTGCCTCCACCGTATCCGCCGCCGGAATCGCTTCCTTCGCTGGCTCCATCTTCTCTCGCCTCGCTATGGGACCACTCTG S A S T V S A A G I A S F A G S I F S R L A M G P L C 99 297 TGATCTCATCGGACCACGTACTTCCTCAGCGATTCTCTCTTTTCTCACCGCTCCTGTAATCCTCTCCGCCTCACTCGTCTCC D L I G P R T S S A I L S F L T A P V I L S A S L V S 126 379 TCTCCGACGTCCTTCATCCTCGTCCGTTTCTTCGTCGGCTTCTCGCTCGCTAATTTCGTAGCCAATCAATACTGGATGTCCT S P T S F I L V R F F V G F S L A N F V A N Q Y W M S S 154 461 CCATGTTCTCCGGTAACGTCATTGGTCTCGCTAACGGTGTCTCAGCCGGTTGGGCTAACGTCGGCGCCGGTATCTCTCAGCT M F S G N V I G L A N G V S A G W A N V G A G I S Q L 181 543 CCTTATGCCTCTCATATACTCCACCATAGCCGAATTCCTTCCACGCGCCGTCGCCTGGCGCGTGTCCTTCGTATTTCCCGCC L M P L I Y S T I A E F L P R A V A W R V S F V F P A 208 625 ATTTTTCAGGTTACAACGGCCGTCCTCGTTCTCCTCTACGGCCAAGATACTCCCCACGGTAACAGAAAAAACTCGAACCAGA I F Q V T T A V L V L L Y G Q D T P H G N R K N S N Q N 236 707 ACAAACTCACAATTCCTGAAGAAGAAGAAGTACTAGTAGTTGAAGAAGACGAACGTTCCAGTTTCGTCGAGATCCTAATCGG K L T I P E E E E V L V V E E D E R S S F V E I L I G 263 789 CGGACTTGGAAATTACAGAGCGTGGATCTTAGCGCTGCTCTACGGATACTCGTACGGCGTCGAGCTAACGACGGACAACGTG G L G N Y R A W I L A L L Y G Y S Y G V E L T T D N V 290 871 ATCGCCGGATATTTCTACGAGAGATTTGGAGTGAATCTGGAGGCGGCGGGGACGATCGCGGCGAGTTTCGGGATATCGAACA I A G Y F Y E R F G V N L E A A G T I A A S F G I S N I 318 953 TTGCGTCGCGACCGGCGGGAGGGATGATATCGGATGCGCTGGGGAAGAGATTCGGTATGAGAGGGAGGCTGTGGGGGCTATG A S R P A G G M I S D A L G K R F G M R G R L W G L W 345 1035 GATCGTGCAATCGGTGGCTGGGTTGTTGTGCGTGTTACTCGGACGAGTCAACTCGCTCTGGGGATCAATCCTCGTCATGTGG I V Q S V A G L L C V L L G R V N S L W G S I L V M W 372 1117 GTCTTCTCTGTTTTCGTTCAAGCTGCTTCTGGCCTTGTATTTGGCGTGGTCCCTTTCGTCTCCACGCGgCtagtttaaagtC V F S V F V Q A A S G L V F G V V P F V S T R 3 95 1199 taccaatccggt t t t tgc taataat t t cggt t tgg t t t taa t t tgg t t t tg t t ta taatgacagATCGTTAGGAGTGGTGGC i n t r o n S L G V V A 401 1281 GGGAATTACGGGAAGCGGCGGTACGGTTGGTGCGGTGGTGACGCAGTTTCTGTTGTTTTCCGGTGATGATGTTCGAAAACAG G I T G S G G T V G A V V T Q F L L F S G D D V R K Q 428 1363 AGAAGCATTTCACTTATGGGTTTGATGACTTTTGTGTTTGCTCTTTCTGTTACATCAATTTACTTTCCACAATGGGGTGGAA R S I S L M G L M T F V F A L S V T S I Y F P Q W G G M 456 1445 TGTGTTGTGGGCCTTCGTCATCTTCCGAAGAAGAAGATATTTCTCGGGGACTCCTTGTAGAAGACGAAGATGAAGAAGGTAA C C G P S S S S E E E D I S R G L L V E D E D E E G K 483 1527 AGTGGTTAGTGGTAGTCTACGTCCCGTTTGTTGAGTTAGTTTAAAGTCTACCAATCCGGTTTTTGCTAATAATTTCGGTTTG V V S G S L R P V C * 493 1609 GTTTTAATTTGGTTTTGTTTATAATGACAGATCGTTAGGAGTGGTGGCGGGAATTACGGGAAGCGGCGGTACGGTTGGTGCG 1691 GTGGTGACGCAGTTTCTGTTGTTTTCCGGTGATGATGTTCGAAAAC AGAGAAGCATTTCACTTATGGGTTTGATGACTTTTG 1773 TGTTTGCTCTTTCTGTTACATCAATTTACTTTCCACAATGGGGTGGAATGTGTTGTGGGCCTTCGTCATCTTCCGAAGAAGA 1855 AGATATTTCTCGGGGACTCCTTGTAGAAGACGAAGATGAAGAAGGTAAAGTGGTTAGTGGTAGTCTACGTCCCGTTTGTTGA 1937 TGTCGCATTTGAACTGCTGGCCCA Figure 2-6. DNA and deduced amino acid sequences of the AtNRT2.5 gene. The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. GATA boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 19 142 6 TTTCATATCTTATGGTATTATTGGGTAATTGAAAGCAAAAAAAAAAAAATGAATTTTTGAATAAAGTTGATACAACTATTTC 1344 CAAAAGTAAAATTAATTTGATGAGTCGACCACATGGAATACACAAAAGACAAACTGCAATTATTTTTAGAAGAATGAGCTTT 1262 TTACAATGAACCGTACGATCTCATAGTCTCATTGACCTTTGGTTGATGTCAAATGTCAAACATTTGTCTCTCCATAAAGATA -118 0 TTCTTGTACTTAGATGACTCTATAACAAAAAAATAAAAAGAATAAGAAGATATTCTCGTAAATTAACAATATTTATATATAA -10 9 8 TGTATAAGTATAACCATTAAACAAAAAGATCAACAATATTTTCAAAATATTATAGTAAGCTGGAAACATCAATGCATTAGGT -1016 AAGACACATGCATGTTGTACATTAGCTACGGATGCGCAAAATGGACGCTAAGCCGGCGGTGAAAGAGACACGTTGTTCTTCT - 9 3 4 GCATTTTATTCCATTCGTACGTAATAGTTAATTCTATAAAGTTATATAATGTTTCGACTTGATAGAGATATGGTACAAGTAG - 8 5 2 ICAATGAAACGTATTTTCTAATTAAGTTAAGTTATAAACATTTTAATAGTAAATGGAGCACGTAATTTGCATTATGCAAAAA - 7 7 0 CACACATATGCTTAGTTCTAATAGGATATTCTCTTTTCCGAATGAACTATTTTTGGAGCGGTGGACTTTTTTTTTTTATTAA - 6 8 8 CCGATATTAATTAGATAAAATTTAGGAGAGCCATTCATAATAATGTTATTTATATATGTTATATGATGCAGTTCGGTATAGA - 6 0 6 TTTTTCGTGTCAAATTGTCCGTTTTGATATTTGCACTACGAAAGATTAAAGATAAAGAAAAGCTAGTGAACTTTCTCTTATC - 52 4 GTTTCGTAATTTTTCTTCTGATCATTCGGTTATACGTGAACTTTCTCTTATCCTTCGTAATTTTTCTTCTGATAATTCGGTT - 3 6 0 TGCTATTGAAAACGTTTGCAAAAACCTACAAAGAGACTACATCTAAAATGTACAAGAGACTTTACATATTGATTGTTTTCTA - 2 7 8 CCAATAAATTTCGTAATACTATTTCACCAAAAAAAAAATTAAAACAAAAAGCCATCGCTCATTTCATTTCACGTAGTATTAT -19 6 TCAACTCTTATTATTGGATCCACCTAACCGTACCCACCAAAAATCTCTATAAATACTATGCAACTCATCTTCTCCAACTTAC -114 ACCAAAAACAGAAAACAACAAAGGCCACAAAGAAGAAGAAAACCTTCTTCAACGTTTAAAGTCTCTTCTCTCTCTCTCTCTT - 3 2 AACTTCTCCCATTTTCTTTGAACTAAAGATCAATGGCTCACAACCATTCTAATGAAGACGGCTCTATTGGAACCTCCTTGCA M A H N H S N E D G S I G T S L H 17 51 TGGAGTCACGGCAAGGGAGC AAGTCTTCTCCTTCTCCGTCCAAGAAGATGTCCCTTCATCTCAAGCCGTCCGAACAAACGAT G V T A R E Q V F S F S V Q E D V P S S Q A V R T N D 44 133 CCAACGGCTAAGTTTGCCCTACCAGTGGACTCCGAACATAGGGCAAAAGTGTTCAAACCACTATCATTCGCTAAACCACATA P T A K F A L P V D S E H R A K V F K P L S F A K P H M 7 2 215 TGAGAGCCTTCCACTTAGGATGGATCTCTTTCTTCACTTGCTTCATCTCCACCTTCGCAGCCGCACCTCTAGTCCCCGTCAT R A F H L G W I S F F T C F I S T F A A A P L V P V I 99 297 TCGCGACAATCTCGACCTGACCAAAACCGACATCGGAAATGCTGGAGTTGCATCAGTTTCCGGCGCCATTTTCTCGAGACTC R D N L D L T K T D I G N A G V A S V S G A I F S R L 126 379 GCTATGGGTGCTGTATGTGACCTTCTAGGGGCACGTTATGGAACCGCCTTCTCACTTATGCTTACAGCTCCAGCAGTTTTCT A M G A V C D L L G A R Y G T A F S L M L T A P A V F S 154 461 CCATGTCGTTCGTAGCTGACGCGGGAAGCTACTTAGCCGTAAGGTTCATGATCGGTTTTTGCTTAGCAACGTTCGTATCATG M S F V A D A G S Y L A V R F M I G F C L A T F V S C 181 543 TCAGTACTGGACGAGTGTTATGTTCACTGGAAAGATTATCGGACTCGTTAACGGATGTGCTGGAGGGTGGGGAGATATGGGA Q Y W T S V M F T G K I I G L V N G C A G G W G D M G 208 625 GGAGGAGTGACTCAGCTACTAATGCCAATGGTCTTCCACGTCATCAAACTCACCGGAGCCACTCCCTTCACGGCTTGGAGGT G G V T Q L L M P M V F H V I K L T G A T P F T A W R F 236 707 TCGCCTTCTTCATCCCCGGCATTCTTCAGATAGTTATGGGTATTCTCGTTCTCACTCTCGGCCAAGATCTTCCCGATGGTAA A F F I P G I L Q I V M G I L V L T L G Q D L P D G N 263 789 CCTCAGTACTCTCCAAAAGAGTGGTCAAGTTTCTAAAGACAAATTCTCCAAGgtaatatatt'aaacatgatcaatattttta L S T L Q K S G Q V S K D K F S K 280 871 ggacaatactagcaataatgcatgtggttctaattacaatt t tgtt t tgtt taatagGTCTTTTGGTTCGCTGTGAAAAACT i n t r o n V F W F A V K N Y 289 953 ATAGAACATGGATCTTATTCATGCTCTATGGATTTTCTATGGGAGTTGAATTAACGATCAACAACGTTATATCTGGATACTT R T W I L F M L Y G F S M G V E L T I N N V I S G Y F 316 1035 CTACGATAGGTTTAACCTTACGCTTCACACAGCTGGTATTATAGCAGCCAGCTTTGGTATGGCAAACTTCTTTGCCCGTCCT Y D R F N L T L H T A G I I A A S F G M A N F F A R P 343 1117 TTTGGTGGCTACGCTTCAGATGTAGCTGCACGGCTCTTCGGTATGAGGGGACGGTTATGGATCTTGTGGATCTTACAAACTG F G G Y A S D V A A R L F G M R G R L W I L W I L Q T V 371 1199 TTGGAGCTCTCTTTTGCATCTGGCTTGGTCGTGCTAGTTCACTACCTATAGCTATCTTAGCCATGATGCTTTTTTCCATGGG G A L F C I W L G R A S S L P I A I L A M M L F S M G 398 1281 CACACAAGCTGCTTGTGGAGCTCTCTTTGGTGTTGCTCCTTTTGTTTCCCGCCGTTCTCTTGGACTTATCTCGGGATTAACT T Q A A C G A L F G V A P F V S R R S L G L I S G L T 425 1363 GGTGCTGGTGGAAATTTTGGGTCGGGAGTTACTCAACTTCTTTTCTTCTCTTCCTCGAGGTTTAGTACGGCGGAAGGACTAT G A G G N F G S G V T Q L L F F S S S R F S T A E G L S 453 1445 CGTTGATGGGCGTTATGGCTGTTGTGTGCTCTCTTCCGGTTGCGTTTATACATTTTCCGCAGTGGGGAAGCATGTTCTTGAG L M G V M A V V C S L P V A F I H F P Q W G S M F L ' R 480 1527 GCCATCACAAGATGGAGAGAAATCAAAGGAAGAGCATTACTATGGAGCGGAATGGACAGAGGAAGAGAAGAGCTTAGGACTA P S Q D G E K S K E E H Y Y G A E W T E E E K S L G L 507 1609 CACGAAGGAAGCATTAAATTTGCTGAAAACAGCCGGTCAGAGAGAGGCCGCAAGGCGATGTTGGCTGATATTCCAACGCCGG H E G S I K F A E N S R S E R G R K A M L A D I P T P E 535 1691 AAACCGGATCTCCGGCTCATGTCTAGTGAAGGATAGTCAC ATTACATCTTTTTCCACATATAAATAACCCTC AAACTTAGCT T G S P A H V * 542 1773 TTATGTTTGCATGTTTTATGTTCCTCTTATGAGAGATGTACCGAGTAAGATCCTGACTTGATAAGTGAGGTTCAGTGAGCTC 1855 GGTGCTCATGATGTACAATGTCGTTTGATATAAGACTTATGCATCAGTTTTCTCTCTGTTTTATCAACAAGCCGTGTCTTTA 1937 AAAGTCTTCCAAGATCATATTATTGATTTAACAAAATCGATCAAATACTGAAAATGAGAAGAGTGTTTTGAGGCACAACTAG 2 019 TCATACCTTAAGAAGAAGCAATTGACTTTAGTAATCTTTACGTCTCAGAAACAGATCACATTAAAGAATCTGGAAAGAGTAA 2101 GAAGCAACTTAACTAG Figure 2-7. DNA and deduced amino acid sequences of the AtNRT2.6 gene. The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. GATA boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 20 -14 2 6 ACATATATATATATATATATATATATATGTAAAGCATATTAATTGATATGTAAATAACTATTATAAGATTTTAAGAGTAAAT -13 4 4 AAATAGTATGCCAAAACAATAATTTGAATACTTATACTACTATTTTGAGTTTTTGATTTTCAATTAAACATTCAATGACAAA -12 6 2 AAC AAAAAGGGAACT AATTGAATTATTGCATCTTATGC AT AT ACTATATTTCATAGATCCAACATTAAAATAAACTAACTGT -118 0 TATTTTAGACCATTGTTTTCTTTAAAATAATTGTTGCTTTTTGCCCACAGAAATTAATAATGTXjTTGTTTTAGGATTTTAGT -1098 GTAAATTCTGATAAATAATGTCTAAACTTTCTCTATATAAATTAATGAAAATATGAAATAAATTTTTTCTTCTTAATTCGCT -1016 TGAAAATAAAAAAAAATGACATGAATATGGAAAACATCATTGTGAATTTTTTTGTTAGTTAGTCAGTTAAAGTAAAGATTAT - 9 3 4 GGAAGTTTTGTTTTGGTAAACTTACAAAAACAAATATTAATTGTAACAAAAATTGATTTCAAACTCTCTCTCTTTCTCATTT - 85 2 ATATAACTTTATTTTTCACAAATCACAATGCACAACTCAAAAAAATTAGAATGTTTAAAGTAGATAATGCAAACAAAAAACT - 77 0 CTCAAATCGATTTGATATTAATTAAATGAATCTCTTGATCTTCAAATTGAGTTACAATCTAACCTTTTCTATTTAGATAAAA -688 TGTGAAAATTTATTTTAGAACTTATACTGAACACAGAGACGTAACGAAGAGAAACAGAAAACTAAAAAATATGTTGTAAATA - 6 0 6 CGACAAAAGACTATAAAAGTTAATGACATTCACGAAATTTACACGTTCTAATGGTCGATGACACAAGGAAACTTTCAATGTT - 5 2 4 GCCACAAGTGAATTGAGATCTCAAGTCAGCCTCCAATACTTCTGAAAGAGCGGTGCTAACCCTCTTAATACAAAATTTATAT - 4 4 2 ATCTAAACAAAACACCGTACTAAACCAAACAATCTTAGATTCAATCGCGGTGCTTACAATCTAACTTAGTTATAACAAAATT - 3 6 0 TATATATCTAAACGAAAACTAAACACC ACATTAAACTCAACCATCTTAGATTCAATCAAAACCAAGATTTAATATATTTTAT - 2 7 8 TTTTCATCTAGAAAGAAAAACCAGAAAACCTTTATGTAATGATTCAAGTTTTTTTTTATACCATCACACTAAAAATAAAAAG -19 6 ATAGCATTCAAAATCCAAAAATAAATAAATATTAAAATGATTACATCAACGCTTCACAAGAACATAAATCCATGAAAATGTC -114 A C A G C T T T A A C A C T C T C C T T C T C T A T A A A T A C T C A T A A C C T C A A A C C T G A G A T T C C T C A T T C C T T A A A C C C C T A A A C C T C C A -32 AAATTCTCTGAACCTTCACAAAGATCACAAAAATGGAGGTCGAAGGCAAAGGAGGAGAAGCTGGAACCACCACCACAACCGC M E V E G K G G E A G T T T T T A 17 51 ACCTCGGAGGTTCGCACTTCCGGTGGACGCGGAGAACAAAGCAACAACTTTCCGACTATTCTCAGTCGCTAAACCTCACATG P. R R F A L ' P V D A E N K A T T F R L F S V A K P H M 44 133 AGAGCTTTCCATCTCTCATGGTTTCAATTCTTTTGCTGCTTCGTCTCCACTTTCGCAGCTCCGCCTCTCCTCCCTGTTATCC R A F H L S W F Q F F C C F V S T F A A P P L L P V I R 7 2 215 GTGAAAATCTTAACCTCACCGCCACCGACATCGGAAACGCCGGAATAGCCTCTGTCTCCGGCGCTGTTTTCGCTCGTATCGT E N L N L T A T D I G N A G I A S V S G A V F A R I V 99 297 CATGGGCACGGCATGTGATCTTTTCGGTCCACGTCTAGCCTCCGCCGCTTTGACGCTCTCCACCGCTCCCGCCGTCTATTTC M G T A C D L F G P R L A S A A L T L S T A P A V Y F 126 379 ACCGCCGGGATAAAGTCTCCGATCGGGTTTATCATGGTGAGATTCTTCGCCGGATTCTCTCTCGCCACTTTCGTCTCGACTC T A G I K S P I G F I M V R F F A G F S L A T F V S T Q 15.4 461 AGTTCTGGATGAGCTCCATGTTCTCTGGACCCGTCGTGGGTTCGGCTAACGGAATCGCCGCCGGGTGGGGTAACCTCGGAGG F W M S S M F S G P V V G S A N G I A A G W G N L G G 181 543 AGGCGCGACGCAGCTGATCATGCCCATCGTGTTCTCGTTGATTCGTAATATGGGAGCCACCAAGTTCACCGCGTGGAGGATC G A T Q L I M P I V F S L I R N M G A T K F T A W R I 208 625 GCTTTTTTCATCCCCGGTCTCTTTCAGACTCTCTCTGCTTTCGCCGTTCTCTTGTTCGGTCAGgtaacaaaccaatcacact A F F I P G L F Q T L S A F A V L L F G Q 229 707 c a c c g g t t c a g t t a t t t t g g t t t t t t c a a c t a a t c c g g t t t t g a g a a t t t a t c a c c a a g t t a t t t t t t g t t t t g g t t a a a t t 789 tactttctttgtatagtcagtttatcctgttctatataaatgattaaaccgattcgtttaggtgcaaacccggtttattgat intron I 871 accggtttgggtcgtctagtagagtctttagtcggttaatcatggtcgagtttcagtggatatggacaataactgtttaatc 953 atctaagttgtgtctattacaaggaatagtaaaaggatacatttgttttgtcttatgtttgctatatgtttttggaaatgag 1035 tagGATCTTCCTGATGGAGATTATTGGGCGATGCATAAATCTGGAGAGAGGGAGAAAGATGATGTGGGGAAAGTGATATCTA D L P D G D Y W A M H K S G E R E K D D V G K V I S N 256 1117 ATGGAATCAAAAACTATAGGGGATGGATAACAGCATTAGCATATGGCTATTGTTTTGGAGTAGAGCTTACCATTGACAACAT G I K N Y R G W I T A L A Y G Y C F G V E L T I D N I 283 1199 CATCGCAGAATATTTCTTCGATAGATTCCATTTAAAGCTCCAGACAGCAGGGATTATAGCAGCGAGTTTTGGACTAGCCAAT I A E Y F F D R F H L K L Q T A G I I A A S F G L A N 310 1281 TTTTTCGCTAGACCTGGAGGAGGAATTTTCTCTGATTTTATGTCGAGACGGTTTGGGATGAGAGGAAGGTTGTGGGCTTGGT F F A R P G G G I F S D F . M S R R F G M R G R L W A W W 338 1363 GGATTGTGCAAACATCAGGAGGTGTATTATGCGCATGTCTTGGCCAGATTTCTTCCTTGACAGTGTCTATAATTGTTATGCT I V Q T S G G V L C A C L G Q I S S L T V S I I V M L 365 1445 TGTCTTCTCTGTATTCGTCCAAGCCGCTTGTGGACTTACCTTTGGCGTTGTTCCCTTTATTTCTAGAAGgtaacatacattt V F S V F V Q A A C G L T F G V V P F I S R R 388 1527 tggtattgagttgcttgattggttattcaacatttttgcttacaaaagtttgtttatgcagATCTCTTGGGGTGGTATCGGG i n t r o n l l S h G V V S G 395 1609 AATGACTGGTGCGGGAGGCAATGTAGGCGCGGTCTTAACACAGTTGATATTCTTCAAAGGATCGACATACACGAGAGAGACG M T G A G G N V G A V L T Q L I F F K G S T Y T R E T 422 1691 GGTATAACTCTAATGGGGGTAATGTCAATCGCATGTTCATTACCAATATGCTTGATTTACTTTCCGCAATGGGGAGGTATGT G I T L M G V M S I A C S L P I C L I Y F P Q W G G M F 450 1773 TTTGTGGACCCTCTTCCAAAAAAGTAACTGAAGAAGACTATTATCTCGCCGAATGGAACGATGAAGAGAAAGAAAAGAACTT C G P S S K K V T E E D Y Y L A E W N D E E K E K N L 477 1855 ACATATCGGAAGCCAAAAATTTGCGGAAACCAGCATTAGCGAAAGAGGTCGAGCCACAACGACTCATCCCCAAACTTGAAAT H I G S Q K F A E T S I S E R G R A T T T H P Q T * 502 1937 ATATAAATTCCAAAAGGTTGATATCACCGTTTCCAAAAAATAAACAAGCAAAAAGACAGATTTACGTGATAATACTTCATAA 2019 TAGGATGCGAGATGTTAGTTTCAAAGTTATAGATCAAATCAGTGAAATGAGATTTTGGTAAGTGTGTTATATAGTTCTTAAA 2101 AATCTGGAATCCCGTATCATCTTTTCTTATATAGTTCTTACATCTTAACATATATATTTGTTATTTCTATATTGGTGGTTTT 2183 ATATTTGCTTGAGTTCATAAACTTCTTGATAAGATTCATAAACCGTCTTTGAAAACAAACCATCAAAATGGTCCCTCTTCTT 2265 GTTTCTTTGAAAAGATCATTTCATACAAGCGATATAGACAAAGCATTTAAGAAACAACAAGTTGAGAAGTTTTGTAACACGT 2347 ACGTTGTTGTAACAAAAAAAAAAAAAAAAAAGAGTAAAGACTTTGCCAAAGTTTTCGAAGACTTTACCTTTGCCATGGTTAA Figure 2-8. DNA and deduced amino acid sequences of the AtNRT2.7 gene. The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. GATA boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 21 accepted that the MFS has 12 TMS and a cytoplasmic N-terminus, predicted TMS numbers varied from 9 to 12 (Table 2-2). The average numbers settled between 11 and 12. AtNRT2.1, 2.2 and 2.4 are highly homologous at the protein level, sharing 89% and 82% identity between AtNRT2.1 and 2.2, or 2.1 and 2.4, respectively (Table 1). AtNRT2.3 and 2.6 proteins also show high homology, with values of 89% identity and 93% similarity between the two. The middle regions of the proteins have even higher degrees of similarities, whereas N - and C-termini, which mostly consist of hydrophilic residues, share less homology within the family (Figure 2-9). In TMS5 all AtNRT2 family members have a sequence, [AG]-G-W-[GA]-[ND]-x-G, which is highly related to a signature motif found in the NNP family (Pao et al., 1998;Trueman et al., 1996). Another conserved sequence, R-[PA]-x-G-G-x-x-[SA]-D, was identified between TMS8 and TMS9. This is not only found within plant members of the NRT2 family but it is also well conserved in all known NNP family members including NrtA (formerly called crnA) in Aspergillus nidulans (Unkles et al., 1991), YNT1 in Hansenula polymorpha (Perez et al., 1997), and narK from E.coli (Rowe et al., 1994). Half of this sequence (G-x-x-[SA]-D) is closely related to a part of the MSF specific sequence motif, G-[RKPATY]-L-[GAS]-[DN]-[RK]-[FY]-G-R-[RK]-[RKP]-[LIVGST]-[LIM], which is located between TMS2 and TMS3 (Pao et al., 1998). It is notable that the longest conserved sequence, F-G-M-R-G-R-L-W, was found at the beginning of TMS9 in all AtNRT2 members (Figure 2-9). This sequence is also well conserved in other photosynthetic species including Chlamydomonas reinhardtii, and Chlorella sorokiniana (data not shown), suggesting that the sequence could be applied to clone the homologues from other species. AtNRT2.5 protein, the least homologous among the seven AtNRT2 members, has the longest hydrophilic loop predicted between TMS6 and 22 \ Table 2-2 Prediction of membrane topology of the NRT members by seven methods Protein H M M T O P M E M S T A T SOSUI T M A P T M H M M TMpred* Toppred AtNRT2.1 12 out 12 out 8 n/a 10 n/a 11 in 12 out 12 in AtNRT2.2 10 out 12 out 8 n/a 10 n/a 11 in 12 out 12 in AtNRT2.3 12 in 11 out 10 n/a 10 n/a 11 in 11 in 12 in AtNRT2.4 12 in 12 out 9 n/a 10 n/a 12 in 12 in 12 in AtNRT2.5 12 in 12 out 10 n/a 10 n/a 10 in 12 out 12 in AtNRT2.6 12 in 11 out 11 n/a 10 n/a 11 in 12 out 12 in AtNRT2.7 12 out 11 out 8 n/a 10 n/a 11 out 11 in 12 in AtNRTl. 1 12 in 11 out 12 n/a 12 n/a 11 out 12 in 12 in AtNRTl .2 12 in 9 out 13 n/a 12 n/a 12 in 12 in 12 in AtNRTl.3 12 in 10 out 12 n/a 12 n/a 11 out 12 out 12 in AtNRTl .4 12 in 11 out 12 n/a 12 n/a 12 in 12 out 12 in Predicted number of transmembrane helixes and the location of N-terminus (in=cytoplasmic, out=exoplasmic). * With minimum length of 17, maximum length of 29, other programs were used with default setting. 23 H Ul H CD H C l CO o o\ o o iH co r-iH rH i—l H ^ (N "I1 H f VO H H H H OJ O) Ul Cfi (N O M N M r l H <J (N r l 1< IO n H rH H O J ( N CTl O m m cn cn m O J cn r- L O r~- r- o~t U J (N (N IN f l f l O ' r-1 ft ft ft ft ft ft ft >ca> > >KI> j j j j j j ft ft OJ CM CU ft E a a i n co l H i I O o o o B. I 0 . [fl CQ O I OC3 w < ft O n i a i Q > u w I I I I Q E. 2 i i i i w w O S H n * n w > ui OJ OJ OJ CN OJ CNJ CN H fn H H H H H Oi CU Cr! B! Bi Oi Oi S3 2 2 2 2 2 2 i J JJ OJ 4J JJ 4J U < < < < < < < o CM c^  cn C N oj m n C N C N -a* o cn m in cn L O in in fl CN CN OJ CN OJ OJ OJ H H H H H H E-> .. .. .. g 2 Bi 2 4J JJ JJ -U < < < < 01 Oi 2 2 JJ 4J < < OJ OJ OJ OJ OJ OJ OJ Ir" EH H H H H H 4J 4J 4J 4J 4J 4J 4J < < < < < < < OJ OJ OJ OJ OJ OJ OJ EH H E-i E-! H E-; H , Bi 2 Bi 2 4J U 4J 4J OJ JJ U < < a: < < < < c+-t <N H <+H o •*-> S3 • i-H u o a CD c/l O o c '§ <: ON I W VH 3) 24 CD 5 .g CO CD • CD 53 IS CN +- u n /serine: a /serine: a ed v /serine: U +^ o ine, s, indi hreon P H CD <u '3 fl H CO Cl o O CD O CJO CD cn )H O O CD i - i O o Id 'So o quei >> CO CD CO , and .expa :rved cd ~0 CD 1 O CD as i CN CD l H CD c, -4-* 'm-t I CCS CD a o CD CD CD CD 25 TMS7 (Figure 2-9). This long loop is more evident in NrtA (Unkles et al., 1991), and YNT1 (Perez etal., 1997). Some protein kinase C (PKC) phosphorylation sites (motif: [ST]-x-[RK]), and casein kinase 2 (CK2) phosphorylation sites (motif: [ST]-x-x-[DE]), were found in the cytosolic domains (Figure 2-9). The P K C sites before TMS11 and at the N - and C-termini were well conserved, whereas most of the CK2 sites were restricted to both termini with less conservation. It is intriguing that the conserved threonine residue in the N-terminus (i.e., Thr-16 in AtNRT2.1) is a phosphorylation site of both P K C and CK2. N-glycosylation sites, where the consensus pattern is (N-{P}-[ST]-{P}), were found among TMS1 and TMS2 in five of the proteins (Figure 2-9). Neither PSORT (Nakai and Kanehisa, 1992) nor SignalP (Nielsen et al., 1999) were able to find N-terminal signal sequences within the AtNRT2 members. Gene Structure of the A t N R T l Family The gene structures of AtNRTl. 1(CHL1) and 1.2(NTL1) had been characterized previously (Tsay et al., 1993; Huang et al., 1999), and a brief characterization of AtNRTl. 3 (NTP3) and 1.4(NTP2) was also reported earlier (Hatzfeld and Saito, 1999). Briefly, AtNRTl.l and 1.2 are located on chromosome 1, whereas AtNRTl.3 and 1.4 are on chromosome 3 and 2, respectively (Figure 2-1). The AtNRTl.l gene possesses four introns in which the first three are 94 to 185 bp in length, whereas the fourth is 1650 bp (Figure 2-10). The nitrate-dependent transcription motif was found, at 237 and 246 bp upstream from the start codon. The promoter region 26 -17 5 4 GGGACTCTTCATTGTGACTTTTTTGTTCTCGCTCTTCCACAATCTTTGGATGTGTACAAAATAATCGATTGTTGGGGATATT -16 7 2 ATAGTAAATTTAGCAATATGAAACTAGCAACGAAGAAAGTGTTTATTGATGGGTTCAAAATTTCATCGATCTGCATATCAAT -15 9 0 AACTCGGAAAGAGATGGATCATGACACATAGTATACAATAAATTTTATAAATTTCGAAAATTAACTAATTGAGGATAGAAAT -15 0 8 TCATCAATTACTTAATAAATAAATAAAAAACTGATTCAAATGTATGTTTTACTTCTGTAACATACAATTTCTTGCTTTTCTT -14 2 6 GAAAATTGACTCGTTTTTTATATTGGATATTTTACATAGACTTTGAGACTTATTAATAAAACTAACTAACCATCTCTTACAA -13 4 4 ATTGTTGGAATAAATTATTTTTATTTTTCTGTTGGCTCTATAAAATGAAAATGACCTTTGTTCTTCTTCTTTATACTCCTAT -12 6 2 ATATGTTTTCTCCAGAGAGAAAGAGAACCATTGAAGTTGCGAGACTTCCAATTATATATATAGTTCATGAAAGTCCTGTGAC -118 0 CATGCTCTTTATTTATTTTATTTCACTATACGTTAAATAAATGGAAAGTAGGGTAATAATCATATTGCAGCATGATTCATTT -10 9 8 TAGTGGCGTCTAAGAAGCATTCATTTTGAGCCATTAAATCTCAAGGTAGACTTTCCCATTAACACAAAAGAAGAAAAAATTG -1016 GTACGTAATCATACCAACATCTACAAATCTTTGGTTTCAATTTTGTAACAAAGACCTAGATTGTTGACAAACAAAAAGCAAA - 9 3 4 TACCTAAAAGGACTTTTATTGACTTCTATAAAGATGTTTTGATTGAAATTTCATATAATTTAATAGTTTCCTCAAACTATAT - 8 5 2 GCAATAAAATTATAATTTGATAATTACATGTGAAAGAAAACATGACTCTCAAATTAATATGAGTCGATTATCAATAAATTTT - 7 7 0 TGTGATATGGCTGTGCTGCAGAACAACTGAATGGGCCTAGAAGTAAAGTTGATATTGAGCAAACAAAAAACGAAATAGATTT - 6 8 8 TTTTTTTCTTTTGGGCAAACTCAAAAAACGAAATAGATATGCCTCGACAATACTACAAAATCTCAAATGAACAATATTGATG - 6 0 6 AAAATGCGTTTGTAACACAGAAATCAATTATTTTGAATTATTTTCCATATATAGTACAGACGTAAAAAACATACTGTATTAT - 5 2 4 CTTTCATGGAAGTAAAATAATTTTCCAAGAAATAGAACAAATGTAAAACAGGTGGTGGCTAAAACTGGTGCTTTTAATGGCT - 4 4 2 AATGCCATTGAATCACTGACAAAATGACCGATGACTTCAACTTAAAAGTTCAAGCCCACAGTTCCAAAGGTAGAGGAAGTGG - 3 6 0 TAAAATTTAGGTATGGTCTCTTTCTCTCTCTCTCAATTTTCTCTTTCTACAAATATATACTACAGTTACAGTAGTAGTTATT -19 6 A T G A A T A A A A A A T C A A A A T A A A A C A A T A A A A A C T T T T T T A A C T T G G C T A G T T T C C C A G T A T A A A T A G A T G T A T C A A C G A A C A -114 CATTTAAGACCACAAAAGAAACCAAGAGCTCTCAAACAAAACAGCCTTTTACATAAGAACAAACACCCCCAAAAACTGCAAA - 3 2 AAAAAGAGAGAGATCATTAATCCATCTTCAAGATGTCTCTTCCTGAAACTAAATCTGATGATATCCTTCTTGATGCTTGGGA M S L P E T K S D D I L L D A W D 17 51 CTTCCAAGGCCGTCCCGCCGATCGCTCAAAAACCGGCGGCTGGGCCAGCGCCGCCATGATTCTTTgtaagtataatcacata F Q G R P A D R S K T G G W A S A A M I L C 39 133 a taaaagt tc tagagaaaagctaccaacaatatacatgc tgaagacaagaat tgaaact t t t taatggcat t tac taagt ta i n t r o n I 215 t a a g t t t c t t a t g g c t a t c a t t c t t a t t c t t t t a t g t a t t c t c g a t g t a t c c a a c t t t a t c a t t a a c a a a a t t t t a t t g t g t 297 gaagGTATTGAGGCCGTGGAGAGGCTGACGACGTTAGGTATCGGAGTTAATCTGGTGACGTATTTGACGGGAACTATGCATT I E A V E R L T T L G I G V N L V T Y L T G T M H L 6 5 37 9 TAGGCAATGCAACTGCGGCTAACACCGTTACCAATTTCCTCGGAACTTCTTTCATGCTCTGTCTCCTCGGTGGCTTCATCGC G N A T A A N T V T N F L G T S F M L C L L G G F I A 92 461 C G A T A C C T T T C T C G G C A G g t t t g t c t a t a a a t a t a t t t a t a t t t a c t t a a c t a a a a t c a t t c a g a t t c t t t t t a a a a t a t t a D T F L G R i n t r o n II 98 543 atttgagttcattcattttgttttgtatagGTACCTAACGATTGCTATATTCGCCGCAATCCAAGCCACGgtaaggacctca Y L T I A I F A A I Q A T 111 625 aaagtccct t tc tcc t taccaaaact ta tacccaagaaaacgaagaaaataaaaatat tg tc tagtcaataaacaaatcgaa 707 a t a g t a a a c a g c a t a a g t c g t t a t t t t t g t t a t a g t t t t c c g a a a a a t a a t a t c c g t g t t a t g a a c t a t g a t g c t a t c a g G G i n t r o n I I I G 112 789 TGTTTCAATCTTAACTCTATCAACAATCATACCGGGACTTCGACCACCAAGATGCAATCCAACAACGTCGTCTCACTGCGAA V S I L T L S T ' I I P G L R P P R C N P T T S S H C E 139 871 CAAGC AAGTGGAATACAACTGACGGTCCTATACTTAGCCTTATACCTCACCGCTCTAGGAACGGGAGGCGTGAAGGCTAGTG Q A S G I Q L T V L Y L A L Y L T A L G T G G V K A S V 167 953 TCTCGGGTTTCGGGTCGGACCAATTCGATGAGACCGAACCAAAAGAACGATCGAAAATGACATATTTCTTCAACCGTTTCTT S G F G S D Q F D E T E P K E R S K M T Y F F N . R F F 194 1035 CTTTTGTATCAACGTTGGCTCTCTTTTAGCTGTGACGGTCCTTGTCTACGTACAAGACGATGTTGGACGCAAATGGGGCTAT F C I N V G S L L A V T V L V Y V Q D D V G R K W G Y 221 1117 GGAATTTGCGCGTTTGCGATCGTGCTTGCACTCAGCGTTTTCTTGGCCGGAACAAACCGCTACCGTTTCAAGAAGTTGATCG G I C A F A I V L A L S V F L A G T N R Y R F K K L I G 249 1199 GTAGCCCGATGACGCAGGTTGCTGCGGTTATCGTGGCGGCGTGGAGGAATAGGAAGCTCGAGCTGCCGGCAGATCCGTCCTA S P M T Q V A A V I V A A W R N R K L E L P A D P S Y 276 1281 TCTCTACGATGTGGATGATATTATTGCGGCGGAAGGTTCGATGAAGGGTAAAC AAAAGCTGCCACACACTGAACAATTCCGg L Y D V D D I I A A E G S M K G K Q K L P H T E Q F R 303 1363 t a c g a t t c t t t t a a t t a a c t c a t c a t t t g c t t t c c a c g t a c g a t c c t c a a a a c t t a c a a t g a t t t a a a t t t t a a g a t a a a a g 1445 t t t t a a a a t t t t t c t t t t t c t t t t c c a t t t a a g g g t t a a t t g a a a t a a t t g a g g t a c t g g t t c c c t t a a t t a a a t g t g a t a g 1527 ta tcagtagact t taaaaatgtgaaat taaaagtggggt tg tg tgggtgagaaataactcgaaatgc tcgtg tcc t t taat t 1609 a t a g t g g g a c c g t a a a t a t t t c t c a t t a t a t g c c t a c t t g g c a t t a g a a a t c a t t t t t t t t t g a c a g c c a t t a t a a a t t a a t 1691 t a a a a g g t g t t g a a t a t c t t t c t t t g t c t t t t g t t a c g g g g a a a a t a a a t t a t t t t c a t a a t a t t a t t a c t c g a c c a t a c a g 1773 c g a a a c t g g t c c a g g a t a c g a a t t a t a c a g c t a a t t a c a a c a t t t t t g g a t t t t t g g g t t c a a a g t c c c t a c t t t g g c a t t t 1855 t a t a t t g t a t a t t t t t t c c t t a a a a t c c t a t g t g t g t g t g c a t g t g t a t a t c t t t g t t a g a t a a c a c g t t a a g t t c g g t t c a 1937 tagaataggtaggaaaataaaagtagtctctcggaattagtcggaaagataaagtaattcagataaacaaatgaataagtat 2019 a t g c a a g t g a t a t c a a g t g g g g t a a a a t t c t c c a t c t t t a c t t t t t g c c t a t a a a a a a t t t c a c a c c c a c t c g t a g a a t a t t 2101 t g g t t t t t a c a g a a a g a g t a t c t t c a t c a t t g c g g a a a a t t a a a t a c a c c a a t t t g c t a t t t t a t c t t t a t t a t a g t a t t a t 2183 a a t t a t g a t t a t g a t t c t a a t g c c t t a t a a c t t t a a a t a c a c a t a c a c t g a c a c a c a t a t a t c t a t a t t t a t a t t c c c c t g a i n t r o n IV 2265 c t c g t g a g t t t t c c c c c t t t a a g t a c g g t a t c t t t t a t t t t t g c t a a c t t a a g t a c a g t a t c t t t t a t c c a t c a a t c c c t a t 2347 gca tacc taca tagaaataaaagaatccaaaggaatcaa t t t t t c t t ta taccaga taa t t ta tggaaaatc ta t t tagca t 242 9 ctctagatattggaatccctt tctcggaaataaaactaataaagaagaagagacgagaagttagggtagggaggcaggtgtt 2511 t tg tc tg tag tgaaaacgatcaaata tcg tg tcg tagcacc tccac tac t t tacacc t tcaccgggacagacccaaagt tag 2593 g c a t a a t t a a g a a c c c t a g c g t c a c a t g c a c g a c a c g t g c t t t g c g t g c t c g g t g c t t e a t t a a a t t t c t c t t t c g t t t g g g Figure 2-10. DNA and deduced amino acid sequence of the AtNRTl. 1 gene. 27 2 675 t c t c t c t a a a a g g t a g t t g a a a a c t a a a g a a a a a a c c t t t t a c a c t t t t c c a t a a a t t c a a a c t c t t a a c t t t t t t t t g c c t 2757 a c a c t a t t t t a a a a g c a a t t a c g t a t t t g t c a t g c a t g t g t g t g a a g g a t a t a c c a t c t t g a a a a g a t t c c a c g t a a c t a t c 2 839 t ccacaaca tg t tga t t caaa ta t t caa tgcg taagc ta ta t t ccaaaaaaagaaacaatg ta t ta t tga ta tgaaat t t ca 2921 a taaa tagggacac t t ca taa t t t t c taa g a a a ca ca ca a a a g a t c t t t g g t t t g a a a a a t ca g a t a c t t a t c t t t a a t cca 3 003 a t a t a t g t a a a a t a t t t t a t c t c c a t t t t a c a t a a t t t a c t a t t a t a t t c t a a t t a t t c c t t a t a t c a t t t t t g a t g c c a c a 3 085 gTTCATTAGATAAGGCAGCAATAAGGGATCAGGAAGCGGGAGTTACCTCGAATGTATTCAACAAGTGGACACTCTCAACACT S L D K A A I R D Q E A G V T S N V F N K W T L S T L 330 3167 AACAGATGTTGAGGAAGTGAAACAAATCGTGCGAATGTTACCAATTTGGGCAACATGCATCCTCTTCTGGACCGTCCACGCT T D V E E V K Q I V R M L P I W A T C I L F W T V H A 357 3249 CAATTAACGACATTATCAGTCGCACAATCCGAGACATTGGACCGTTCCATCGGGAGCTTCGAGATCCCTCCAGCATCGATGG Q L T T L S V A Q S E T L D R S I G S F E I P P A S M A 385 3331 CAGTCTTCTACGTCGGTGGCCTCCTCCTAACCACCGCCGTCTATGACCGCGTCGCCATTCGTCTATGCAAAAAGCTATTCAA ~ V F Y V G G L L L T T A V Y D R V A I R L C K K L F N 412 3495 CTACCCCCATGGTCTAAGACCGCTTCAACGGATCGGTTTGGGGCTTTTCTTCGGATCAATGGCTATGGCTGTGGCTGCTTTG Y P H G L R P L Q R I G L G L F F G S M A M A V A A L 439 3 57 7 GTCGAGCTCAAACGTCTTAGAACTGCACACGCTCATGGTCCAACAGTCAAAACGCTTCCTCTAGGGTTTTATCTACTCATCC V E L K R L R T A H A H G P T V K T L P L G F Y L L I P 467 3 659 CACAATATCTTATTGTCGGTATCGGCGAAGCGTTAATCTACACAGGACAGTTAGATTTCTTCTTGAGAGAGTGCCCTAAAGG Q Y L I V G I G E A L I Y T G Q L D F F L R E C P K G 494 3741 TATGAAAGGGATGAGCACGGGTCTATTGTTGAGCACATTGGCATTAGGCTTTTTCTTCAGCTCGGTTCTCGTGACAATCGTC M K G M S T G L L L S T L A L G F F F S S V L V T I V 521 3 823 GAGAAATTCACCGGGAAAGCTCATCCATGGATTGCCGATGATCTCAACAAGGGCCGTCTTTACAATTTCTACTGGCTTGTGG E K F T G K A H P W I A D D L N K G R L Y N F Y W L V A 549 3 905 CCGTACTTGTTGCCTTGAACTTCCTCATTTTCCTAGTTTTCTCCAAGTGGTACGTTTACAAGGAAAAAAGACTAGCTGAGGT V L V A L N F L I F L V F S K W Y V Y K E K R L A E V 576 3 987 GGGGATTGAGTTGGATGATGAGCCGAGTATTCCAATGGGTCATTGATCATGAATTCATGATCATGATCATGATGATGAACAT G I E L D D E P S I P M G H * 590 4069 TATGCATGTCTATGTTGATATGTTTGAATTTGATTTTGAGTTTTGTTTGTATATTTTATGATGCTTTTCTTAATTACCTCTT 4151 GTTTCCGAGTCGACAAATAATGGACCGACCGATAAGGGATAAAAGTTAAAGTTTTCCC ATCAGGTTCTGTATAAAAGCAGAA 4233 ATTGTAACATTTCTTAAGATTTGACGCAATTAACGTCTTTTTGTCTTCAATTTCCATTTTTCATTTTTTCCCAGTAAATTAT 4315 CATACCATTCAACGTTTGTTTTCTCACTTGTTTTGGTATCGTTTGTTTTCGAATATGTGAATAATTTGGACCAGAACTAGGC 4397 GTCTAGGCCACTAGCTAGTGCCTAGTGGACTATCAC Figure 2-10. (continued). The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. GATA boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 28 also contains a putative T A T A box (-138) and several G A T A boxes. The open reading frame (ORF) of AtNRTl.1 consists of 1770 bp, encoding 585 amino acids (64.9kD). By comparison between the genomic D N A (AC010675) from the B A C clone (T17F3) and the cDNA (AF073361) sequences, the AtNRTl.2 is interrupted by four introns (130, 135, 1365, and 75 bp from 5'to 3'), and the ORF which consists of five exons (3, 106, 219, 431, and 996 bp) encodes 585 amino acids with a predicted M W of 63.9 kD (Figure 2-11). The promoter region of AtNRTl.2 also contains two nitrate-dependent transcription motifs, as well as putative T A T A and G A T A boxes. In AtNRTl.3 three introns (83, 78, 79 bp from 5'to 3') are located at the beginning of the gene, resulting in four exons of 3, 118, 218, and 1431 bp (Figure 2-12). The ORF encodes 590 amino acids (65.2 kD), which is same length as that of AtNRTl. 1. Five potential nitrate-dependent transcriptional motifs were observed in the 5' upstream region between -893 and -635 bp. The AtNRTl.4 gene consists of 6 introns and 7 exons, spanning about 4.1 kb in the genome (Figure 2-13). The ORF of the gene is 22 bp longer than was originally reported (Hutzfeld and Saito, 1999). The full length of 1758 bp encodes a sequence of 586 amino acids with M W of 64.5 kD. Among the four A t N R T l members, sequence identities (between 33 to 51 % at the protein level), were not particularly high (Table 2-1). A t N R T l . 1 and 1.2 are the most dissimilar, and AtNRT 1.3 and 1.4 are located between 1.1 and 1.2. The A t N R T l members share only 3-10 % identities with members of the AtNRT2 family at the protein level. Membrane spanning regions and topologies were also analyzed. Four programs (i.e., HMMTOP, T M A P , TMpred, and Toppred) predicted 12 TMS in all NRT1 members. Two 29 1423 TCTTGTATCCATGCCATGATAATGGTTACTTTGTTGTTTTATTGTCTATTATTTCTATTATATATGAACTTTCAATTTGAAT 1341 TTTAGATATATTGGCAGTACAAATACAAAAATTACTTTAACCACTATAGCTCCTCCGAGCATTCGTCACTGATC AGTGAGTG 1259 TGTGTTTATATATGCGATATTAAATTAAATAAGTTTTTCTTCACACTGTGTGTGTGTGTGTGTTTGTGTGCGTGGTAACAAT 1177 AAAGTTCTGCGTAGACGACACGTATCCAATATTAATGGAGTTCCGAAAGAAAGATCTTCTGGCAAAACCATCATATATAGAG 1095 ACAACAGTTTATTTTATCTTTTAAACAAAAATACGATCACATTTTTTTTACCTAAATTGCTAATAAAAAGTACATAGAAAAT 1013 GGTTTACAAATATCAGCCATTAACATATATAGTTCAATATTACCCGACAAACAAAAACATAGTTTATTTATGATTCTATCTC - 9 31 AAAAGAATTTAAGACGTCAAAAGAGGTAATTAGTAACATCATTTTATTGGAGATATTTTGCAATGAAAACTGCCATGAATAG - 8 4 9 AAAGAGGAGGAATCAGTAGGTCTAGATTAAGTGAATGTTCTACTTCA3TTTTGTTTTAGg^AAAAGATAGTTTCACTAAAT - 7 6 7 TTATTTTAAAGCCATTAAGTGGAGGGCTTGATTCCTTCCATCACCTTTATCTTGCCCTCAACTTTTTTTTTTTGGATTTACT - 6 8 5 TGCATCCTTCTCCATTAAACAAACCAAACCCAAATATAGTGTGTATTTTATTTAATAATTATGACCAGATAAATGTGGTAGA - 6 0 3 CTAAAAGTTTATTTTACGTGAAACAATCTATGTCATTCTTTAACTATCTAGAAGAATTTAGTGTTCATTAACATGTAAATGT - 521 GAACGAATAATATAATGTGAGTAATCGATATGCAATCAATCCTTAAACTTTGTTACCACTATACCTTGTAGAGAATAATAGA - 4 3 9 ACAAAATCAATTCTCATATGTTAATTGGTATTGGAAACCCCATTTCAAAATCAACTTGCATATTAAGTAAAGGGAAAACAAA - 3 5 7 CATGATTGATTAGTCTTTATTCCACCACTATATTACTAGCTTTATAAATTCTTGGAATTAATATCATCTTTAGTGCCCTAAA - 2 7 5 AACAAAGAAATAAAGCTAGTTTTCTCTAGAGGAGAAGAAAACAATGTTATTTCCTAAGAAGAGCATAAAGAAAAC^^AACA -19 3 TGAAGTCATTTTCTAATAATAAAGAGGGCCCAAATTCTTCTTTCTTCTCACCCAATTGGACCCTTCCTCAATCCCTTCTCCT -111 CTCCTCTCTTTAAATTCCGCTAATACCCTTCTCACTTTCACTCTTATATTTCATAAAAACCTTTTTTTATATCTCCTCTACC -29 TCAAAGTTTGAGAGAAAGAAAGAGAGAGAATGgtgggttcttgaagcttctcacattattttcCtcatcgttcaagaaatca M 1 54 at a t t t g a t g a t g t t t c c t t t t a t a g a a a t a t a t g t c t t t t t c t c a a a g t c t t g t t t t g t t c t t t g c c a t a t t a t t a c a g G A intron I E 2 136 AGTGGAAGAAGAGGTCTCAAGATGGGAAGGCTACGCCGATTGGAGAAACAGAGCAGCCGTGAAAGGCCGTCACGGTGGCATG V E E E V S R W E G Y A D W R N R A A V K G R H G G M 29 218 CTCGCCGCCTCTTTCGTCTTAGgtcagtttcaaaattccaaatttacccctcgattctcttaatgcatctttttctttatca L A A S F V L V 37 300 tccacacatttatattaagaacgattctctaatggatcattgtgattgattcatatatatttgtctcttatgaagTGGTGGA intron II V E 39 382 GATATTAGAGAATCTAGCGTATTTGGCGAATGCGAGTAATCTTGTGCTATACCTAAGAGAATACATGCACATGTCTCCATCA I L E N L A Y L A N A S N L V L Y L R E . Y M H M S P S 66 464 AAATCGGCAAATGACGTCACCAATTTCATGGGCACAGCTTTTCTCCTAGCTCTCCTCGGTGGTTTCCTCTCCGACGCTTTCT K S A N D V T N F M G T A F L L A L L G G F L S D A F F 9 4 546 TCTCCACTTTTCAAATCTTCCTCATCTCAGCTTCCATCGAGTTTTTGGtaaacctctcttaatcattcttataatcacttca S T F Q I F L I S A S I E F L G 110 628 tttttttacattttgttaatctttaaaatttctaaacttaacaaggaacaacaaatcaaactccacttataaaaatattcag 710 a a a c t t t g t t a t c c a t t a g a t t a c t t t a g t t t t c t t t t c t c t a t c g c t t a a g t t t t a a g t t a c t a c c g t t g a c t t t t g t t t t 792 taatggctaagccaccacaatcataaatccgttcacattaaaatagatcccacatgtatatctatacaattattagcataaa 874 agaaaattatcacacatgaaaatatggttgtagcaaaaaaaaatccaacgaaccatgcgtgcattaggatgctgataaaaag 956 gacaaaagcaaagaggagcgtgactttgatacggtaccgtatccgtatctataagcaatgctttgttttgatcctaacacga 1038 cacatacgtgataacatctataaaaaatccgtatgttaaggtcgggacccaaacgtatttttatcagttttaactgtcactg 1120 tctcagggttaaaagaggaaatttaaaaactctttcttgggtttcagtaacacagcaagctttttattttattttgttatct 1202 tgtctttacgtatgatagggtatgaaactataatgtccacttatataacatctgccactcgtaccctcgtgactctgcaact intron III 1284 taatgttacaaaagacaaaacaaacttgtagttctaaagtacagttggggctcttaatgctttgtgggtagcgtttggccgg 1366 acgcaaacgcaaacgctcactcttctacttcccattatggatagagatattgatggttcatgtatacctatacactatcata 1448 acttcattagaaaacttataacagattacaagaaaatatatatagctgacttaacttataatctccttgtcactttttatag 1530 atttgagtcatttacttgtatgatatgaagtatttatattccatatacattcatctagaatcaacatatatcaatatatgat 1612 tggataatgtatactagagtccaaaacttttaaaaccctggtgttacgtcagtgtaaccgaagttatttcttcaagaaaagg 1694 cagtggccaatgaggcgaccacacgaaaattaggctttgtccatacctcatttaataacgaacgacgtttcatcgttcataa 1776 cggtttcaattatttgtatcacgtcgctgatctgactctcacgaaccacaagggttaaaatctctcacgtgcccctggtccc 1858 attcccatactattctttgctaatcccaaaaaaataaccgtctctagttaatgattttaacaaatcaataggattaaaattt 1940 tatttgggaaacgtgcaggGATTGATCATACTCACAATTCAAGCTCGGACACCATCCTTAATGCCTCCATCGTGCGATAGTC L I I L T I Q A R T P S L M P P S C D S P 131 2022 CCACATGTGAAGAAGTGAGTGGTTCGAAGGCAGCGATGCTATTCGTGGGGTTGTACCTTGTAGCTTTGGGTGTGGGAGGGAT T C E E V S G S K A A M L F V G L Y L V A L G V G G I 158 2104 CAAAGGTTCATTAGCATCTCACGGAGCAGAACAGTTTGATGAGAGTACACCTAAAGGTCGGAAACAAAGGTCAACGTTCTTT K G S L A S H G A E Q F D E S T P K G R K Q R S T F F 185 2186 AACTACTTCGTGTTTTGTCTTGCTTGTGGAGCACTAGTTGCTGTCACGTTTGTAGTTTGGTTAGAAGACAACAAAGGATGGG N Y F V F C L A C G A L V A V T F V V W L E D N K G W E 213 2268 AATGGGGATTCGGTGTTTCTACCATTGCTATCTTCGTCTCTATTCTCATCTTTCTCTCTGGATCAAGATTTTATAGGAACAA W G F G V S T I A I F V S I L I F L S G S R F Y R N K 240 2350 GATTCCATGTGGAAGTCCTCTCACCACAATCTTGAAGGTTtgttttgacctctttagctcttattggagattgacgtgtgcc I P C G S P L T T I L K V intron IV 253 2432 ctaagttatgtatatgatttctttattcaggttCTTCTTGCGGCTTCGGTTAAGTGCTGCTCGAGTGGAAGTTCAAGCAATG L L A A S V K C C S S G S S S N A 270 2514 CGGTTGCGAGTATGTCCGTGAGTCCCTCAAATCATTGCGTATCAAAGGGGAAAAAAGAAGTTGAATCACAAGGAGAATTGGA V A S M S V S P S N H C V S K G K K E V E S Q G E L E 297 2596 AAAGCCACGTCAAGAAGAAGCTTTGCCTCCTCGGGCACAACTAACTAACAGTTTGAAAGTATTAAATGGAGCTGCGGATGAA K P R Q E E A L P P R A Q L T N S L K V L N G A A D E 324 2678 AAACCTGTCCATAGATTGTTAGAATGCACAGTCCAACAAGTGGAAGATGTGAAGATTGTCTTGAAAATGCTTCCGATATTTG K P V H R L L E C T V Q Q V E D V K I V L K M L P I F A 352 2760 CTTGCACTATCATGCTTAACTGTTGCTTAGCTCAGCTCTCTACATTCTCCGTCCAACAAGCTGCTTCCATGAACACAAAGAT C T I M L N C C L A Q L S T F S V Q Q A A S M N T K I 379 Figure 2-11. DNA and deduced amino acid sequence of the AtNRT 1.2 gene. 30 2 842 AGGAAGCCTAAAGATACCTCCAGCTTCCTTACCGATCTTCCCCGTCGTTTTCATAATGATCCTCGCACCTATCTACGACCAT G S L K I P P A S L P I L P V V F I M I L A P I Y D H 406 2 924 CTCATTATCCCATTCGCTAGAAAAGCTACCAAGACCGAAACAGGAGTCACTCATCTACAAAGAATCGGAGTAGGTTTAGTTC L I I P F A R K A T K T E T G V T H L Q R I G V G L V L 434 3 006 TTTCGATATTAGCAATGGCGGTTGCAGCTCTAGTTGAGATTAAACGAAAGGGAGTGGCTAAAGACTCCGGCTTGCTTGACTC S I L A M A V A A L V E I K R K G V A K D S G L L D S 461 3 088 GAAAGAAACCTTACCCGTGACTTTCCTATGGATCGCACTTCAGTATCTTTTCCTAGGGTCAGCCGATCTATTCACACTAGCT K E T L P V T F L W I G L Q Y L F L G S A D L F T L A 4 88 3170 GGACTACTAGAGTATTTCTTCACGGAAGCACCTTCCTCAATGAGATCTCTCGCAACATCGCTCTCGTGGGCTTCTTTGGCTA G L L E Y F F T E A P S S M R S L A T S L S W A S L A M 516 3252 TGGGGTATTACCTAAGCTCAGTGATCGTGTCCATAGTAAACAGCATCACAGGAAGCTCAGGGAACACACCTTGGCTCAGAGG G Y Y L S S V I . V S I V N S I T G S S G N T P W L R G 543 3334 AAAAAGCATAAACCGTTACAAACTAGACTACTTCTATTGGCTAATGTGTGTTCTTAGTGCAGCTAACTTCTTGCACTACCTC K S I N R Y K L D Y F Y W L M C V L S A A N F L H Y L 570 3416 TTTTGGGCAATGCGTTACAAGTATAGATCAACTGGTTCAAGAAGCTAAAATTGGATGGGCAACTTTTGAGTTTTTTTTTTGT F W A M R Y K Y R S T G S R S * 585 3498 TTTTAATTAGAGCAGAAAATGTTTTTACTTGAGCGGCTGTTATATAAGAGATGATAAATGGGGGTAAGTAGTAATGTTGTGA 3580 TCAGGTATATATTGGGGTTTGAAGTTTTTATCGTTGGACAAGTAATGTACAGCGAATGATATTAACTTGCTTTAAGTCTTTC 3 662 TTTTGTT Figure 2-11. (continued). The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. GATA boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 31 -13 4 4 TTTAATGTATTTGCTGCTTTCTTGACTTATATTGCTAACATCATTTCAAGTAGAGGGATCAATTCATTAACATGTACAGCTT -12 6 2 TTTAATCAGTGGATCTCTCTAAGTAAATATCTTCCTCCATTTCATGGATTTTTTTACATGTCATATTCACCTTGATTACAGT -118 0 CACTTTCGAATATTACTTATAACGGAAATAATATGTTTTTTTTTTGCTTTACACATCTCTGGTTGAATACGCAATTCGTAAT -10 9 8 TTCCTATGTGACACCTGAAATCTTGTATCTTTCTTAAAAGTTATAGACTAGCTTCTTGTGGATCTAACAAATCCTTTTAGCT -1016 AAAAATAATCCATTAAACCTAGTTCCAAATGATTCAACATTTTGGTATACTAAATTACTAAGTGTATGTCCTAGGGATGTTG - 9 3 4 TGAACAAAAACCAGTCTGATTTAAACATACTCTTGGTGATATATATATATAGTCATAATTTTCTTAATCAAGTACAAATTGG - 8 5 2 TTCATGATTTTTTGATCCACCAAAACATTTCTAATGAAACGAAATACTCATTAAAGAACAACACTCACACTAATGATTGAAC -770 ATTAATATGAACCATGTGATATTGAAGTGAAAGCACTAACTTTAATGCTTAACAAGT£A,TCCCAAAATATTAGAGACCATGC - 6 8 8 ATATTTGTACCAGTGAGAGTTCAGATTAATCTTGAACCTTj^GTGTATAACECAGTAAAAACTGTCCACGTGGTAGATCAAT - 6 0 6 AAACAACCACAATCTGGCACACATGATATAAAGACAAAGATTTTTGATATGTCTCCAATTAATGTAAAATCTTAACAATAAA - 5 2 4 AAACAATTCTATAGTATGGATGGTAAGAGATTTGTTGAAGGAGAAGAGGACGTGGGAAAAATACAAAGAAGCTAAAAAAAAA - 4 4 2 CTCATTGCAACCACAAACAAAATGGTATAAAGAGACAAAAGAGAGTAATGGACATGGGGAATTACAAAGAAGCAGAAAACCT - 3 6 0 TGCAACCACATGAAATAAACAAATGTCTTTGTCATAAGATAATGAAATCACACTGTTGTCTCAATGTTTGTTTAGATCTATC - 2 7 8 TGATCATATATCGCTGAAACAACCACACAAAAAGCAAAGCCACATTTTATATAAAGACCCATCATATATCAATCAATCCCCA -19 6 TCTCTCTTCACATGCCCATTTGAATCGTATCTCCTCTCATTTCTTCTTTTGTTTTGTTGGAGTTAGATAAAATCAAAGGTCT -114 AATAAAAGTGTCAAAACCCTTATCGCTATAACCTCCACTACCATCTTAAACTTCTCCTTATAACTCACGCTTCTCTGCTTTC -32 TTCTCTCAGAGTCTAACTGCTCAAATAAGAAAATGgtgagttaaaaagttttttctctctgttttttttttgtttcctctgt M intron I 1 51 ttcttatgttCttaatggttttgcttgtctCtaaagGTTCATGTGTCATCATCTCATGGAGCCAAAGATGGCTCTGAAGAAG V H V S S S H G A K D G S E E A 1 7 133 CCTATGATTACAGAGGAAACCCACCAGATAAGTCTAAAACCGGTGGATGGTTAGGCGCCGGTTTAATTTTAGgtaaagtctt Y D Y R G N P P D K S K T G G W L G A G L I L G 41 215 aattcttaatgtgaaaaaagagtgactcctctgtttctaacactcctctgtatcttcttaatgtgaagGGAGCGAGCTATCA intron II S E L S 45 297 GAGAGAATATGCGTGATGGGCATATCAATGAATCTAGTGACGTACCTTGTTGGAGATTTACACATCTCATCAGCTAAATCAG E R I C V M G I S M N L V T Y L V G D L H I S S A K S A 7 3 379 CGACCATAGTCACCAACTTCATGGGAACTCTTAACCTTCTAGGGCTTCTCGGTGGTTTTTTGGCTGACGCTAAACTCGGTCG T I V T N F M G T L N L L G L L G G F L A D A K L G R 100 461 CTACAAGATGGTTGCAATCTCAGCTTCTGTCACAGCTCTGgtaagctcttaaaccacgtacttgtagctcgattggcttgag Y K M V A I S A S V T A L intron III 113 543 actttCtagctCtaattccttgtttctgtgaaaacagGGAGTGTTGCTTTTGACGGTGGCTACAACTATCTCAAGCATGAGA G V L L L T V A T T I S S M R 128 625 CCACCAATATGTGACGATTTCAGGAGACTTCATCATCAGTGCATAGAAGCAAACGGACACCAGTTGGCTCTTCTCTATGTTG P P I C D D F R R L H H Q C I E A N G H Q L A L L Y V A 156 707 CTCTCTATACC ATAGCTCTAGGCGGAGGAGGAATCAAATCCAACGTCTCTGGTTTTGGGTCTGACCAGTTCGATACTAGTGA L Y T I A L G G G G I K S N V S G F G S D Q F D T S D 183 789 TCCTAAAGAAGAGAAACAGATGATTTTCTTCTTCAACAGATTCTATTTCTCCATCAGCGTCGGCTCTCTCTTCGCCGTGATT P K E E K Q M I F F F N R F Y F S I S V G S L F A V I 210 871 GCTCTTGTTTACGTTCAGGACAACGTCGGGAGAGGCTGGGGTTACGGGATCTCTGCCGCGACTATGGTGGTTGC AGCCATTG A L V Y V Q D N V G R G W G Y G I S A A T M V V A A I V 238 953 TTTTACTCTGCGGAACGAAACGGTACCGTTTCAAGAAACCTAAAGGAAGCCCTTTTACAACAATATGGAGGGTTGGTTTCTT L L C G T K R Y R F K K P K G S P F T T I W R V G F L 265 1035 GGCTTGGAAGAAAAGAAAGGAGAGTTACCCTGCGCATCCAAGTCTTTTGAACGGTTATGACAACACCACGGTTCCACACACA A W K K R K E S Y P A H P S L L N G Y D N T T V P H T 292 1117 GAGATGCTTAAGTGTTTAGACAAAGCCGCAATTTCCAAGAACGAGAGCTCTCCTAGCTCGAAGGACTTCGAAGAGAAGGATC E M L K C L D K A A I S K N E S S P S S K D F E E K D P 320 1199 CGTGGATCGTTTCGACTGTTACACAAGTCGAAGAAGTGAAACTCGTGATGAAATTGGTACCGATTTGGGCAACGAACATTCT W I V S T V T Q V E E V K L V M K L V P I W A T N I L 347 1281 TTTCTGGACGATTTACTCCC AAATGACGACTTTCACGGTCGAACAAGCGACGTTTATGGACCGAAAACTCGGATCTTTCACT F W T I Y S Q M T T F T V E Q A T F M D R K L G S F T 374 1 3 6 3 GTTCCTGCAGGCTCTTACTCTGCTTTCCTCATACTCACAATTCTCCTCTTCACTTCCCTTAACGAGAGAGTCTTTGTTCCTT V P A G S Y S A F L I L T I L L F T S L N E R V F V P L 402 1445 TAACAAGAAGGCTCACAAAAAAGCCTCAAGGAATCACAAGCCTACAGAGAATCGGAGTAGGGCTAGTATTCTCAATGGCTGC T R R L T K K P Q G I T S L Q R I G V G L V F S M A A 429 1527 AATGGCTGTAGCCGCGGTTATAGAGAACGCTAGACGCGAGGCAGCGGTTAACAACGATAAGAAAATAAGCGCGTTTTGGTTG M A V A A V I E N A R R E A A V N N D K K I S A F W L 456 1609 GTTCCACAATATTTCTTAGTCGGTGCGGGTGAGGCCTTTGCTTACGTTGGACAGCTTGAGTTCTTTATAAGAGAAGCACCAG V P Q Y F L V G A G E A F A Y V G Q L E F F I R E A P E 484 1691 AGAGGATGAAATCGATGAGCACCGGATTGTTTCTAAGCACGATATCGATGGGATTCTTCGTGAGTAGCTTGCTTGTTTCGCT R M K S M S T G L F L S T I S M G F F V S S L L V S L 511 1773 TGTTGATAGGGTTACAGACAAAAGCTGGCTTAGAAGTAACCTTAACAAAGCGAGATTGAACTACTTCTACTGGTTACTTGTT V D R V T D K S W L R S N L N K A R L N Y F Y W L L V 538 1855 GTCTTGGGAGCATTGAACTTCTTGATTTTTATTGTGTTTGCCATGAAACATCAGTATAAAGCTGATGTGATTACTGTTGTTG V L G A L N F L I F I V F A M K H Q Y K A D V I T V V V 566 1937 TGACTGATGATGATTCAGTGGAGAAGGAAGTGACGAAGAAAGAGAGCTCTGAATTTGAGCTTAAGGACATTCCTTGAAACCA T D D D S V E K E V T K K E S S E F E L K D I P * 590 2019 GATTTAGAAGAAGAAAAAAAACCTCTGGTTTTGTTATTTGCTTTGAAGATTTCATTTTGTCTTTGTATTTTTAGTATATTGT 2101 GTGTATGAAATAGAAAGATTACTATATGGTTTGGATTGTATTTTTTTTTGTAAGATTTTTAAAAATTTAGTTACTATAGTTT Figure 2-12. DNA and deduced amino acid sequence of the AtNRTl.3 gene. The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. G A T A boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. ^ 7 -17 5 4 T G A A T G G A T A G T T G A T A G T T C A A T C C G G A G A A C T T T T G A G C T A T A T A C C A A T A A A A G G G A G T T T A A T G T T G T C T A G C T T A A A -16 7 2 G G G A A T T T A G T T T T G G G A C T T G A A A A G A A A A A A T A T G T T C G A C A A G A T T G T A A A T T T A A C A T C A A A A C T T T A G C T C G T A A T G -15 9 0 T C T A T C T A G C T T A T A G G G A A A T T T A G T T T T G G G A T T T A A A A A G A G T A A A A A T G T T C G A C A A G G A T T T A A C A C T C C A G A A G A C -15 0 8 A T T G T A C A T T T C G A C A A A A A A A A A G A A G A C A T T G T A C A T T T T T G T C T C T C T T T T T T C T T T T T C T T T T T T T C T T G G T G A A C C C -14 2 6 C G T A A C T T G C A T T A A T T A T C T T G T T T G T T T A G T T T T T T T T C A C A A A G C T G T A T A A G G C G T G A C T G G T A C T C T T T C G G C A T A T -13 4 4 T T T T G A T T G A T T T C G A G A G T T T C T T T T G G T C T C G G C A T T T A G A G T A A A A T C T G A T T T G G G A T G A T T T T T T T G A A G A A C A C T A -12 6 2 A T G T A G T A G A G T C A A A G C T T A C A T A T T T T T A G T A G T T G G A A A A T T A T T T G A A C A T C T T T A A T A T G A A T G C A A G T T C C C G T C T -118 0 G C A A G C C T C T T T A T T T G C C T T T G T T T T C A T T T T T G G T T T G A A T A C A A G C A A A T G T C A A A T A T G G A A C A T A T T G A T A T C T G T A -10 9 8 C T T T G T T T T T A A T A T C A A T T G G G A C A A A C A A A A C C A A A T A G T C G A C C G T G C A T T T A A A G G A T T T T T A G A A A T A T T T G G C T C C -1016 T T T G C A C A T T T C C A C A T T A C C T C A T C C A T T T T T G C T C C G T G C A T A T A T T C A T T A T A T T A C T T T T G A G T A A C T T T C T C G T G C C -934 T T C T C C G A A T T C C G T C A T G T A T T T C T C A T A T T A T T T C C T A G T G A T T C T C A A C A G C C A T G C A A T C C A A A T T A C C T C A G A A A C T -85 2 T T C C T T T G A T A T G A T C C G A T C C A T A T C A A G C C A A A T A G A C C T A G T T T G A C C C C T A T T A C T A T G T A A G A A G C T C C A G A C A A T T - 7 7 0 T T T A A C C T A G T A T T T G T T T A C G C T T T T T C T T C T A A G T T T T G T C T A A G T G T T T A A G A G G G A C T T A C A A G A C T T C A A C T A C A T T - 6 8 8 T G T G A T G A C G A T C T T A T C A T T T C A T C C A G C T T A G T A A T A T A A T G T T A T G C T C G A A A C G T G T T T G A T A A A G G G G T T A G A C C A A - 6 0 6 A T T T C A A A A A C G T T T T T T C T T A C T T A A C C A G T A T G A A T T A G T G G A C T A C T A A G T G A C A T T G T T T T C A A T G C T C T A G T T A G C A - 52 4 A A T C A A A G T T T A G C T A A T T A A G T G A T C A A T G A A G T T A T T T G T C A T G A A A G T G G A T T A A T C T T G T T T G A G C G T T K X : A A G A T T A - 4 4 2 T A T A A C A C T A C G T T G T T G C T T A A T G A A T G T C T T A G C A T G A A A A T T A T T T T T T C T A T C T T A T C T T A C G A A T T A T C T T C C C C A T - 3 6 o G A T C A A T T G T T T G T T T A T T T C T T G A T T T G C C T A G T A A A C C T T C T A G T T T T T G G T T A T A A A T T T A T A A G T T T C A C C C T C C A G G - 2 7 8 G T T T G A G T C T T C T T G G A A A C A A A T A T C A C A T C C T T G T G G A A A G T T T G G G T T T A G G C C A A A G G C C A A A A C A T T C C A G A A A T T A -19 6 T T C C A A A T T A G G C G G G T A A A G C C C T T T T C T A C T A G T A T A T G T T C G A T A T T C T T C T T A T T T G G A A A A A A A A A C A T A T G T C A T A -114 T T C T A C T A T A T G T T C T C A T T C C T A T T C T T C T T A G T T A G G C A A A A G A T C T C A T T G C T A T T C T T C T T C T T A T T T A G G C A A A A G A -32 TATATATATATATATTTATATTTATATCAAATATGGTTCGTTTTTCAATAGTTAGTGGAGAAataaaaaaaaaataaaaatt M V R F S I V S G E 10 51 ggaaac taa tag taa tgaacc tcg t tgagaa tc t t ta t t tga tc t cgccaaa ta t t t ta tggaaaaa ta tgcaag tg t tg t t 133 t ca tga tccaaag t t c t cgc tc ta tg ta tg tg tc t t tgggacccagag t t tggg tcgaa taaa taag t ta t ca tca taaaag 215 agaaaatttacaacaaataagaaaatagaaaattaaagaaaaaaattaaaaagagccaaaaataatttcgaaatataaatta 297 agaaata t t t taaagt tggggaaaaaagtg tgatgaacc ta tc tcaaagat t t cacgt t t t tgcgata tg tcccaaatcaca i n t r o n I 379 t a t a g t g g a a g g t c g g t g c t a g c c c t c t t t c a t t c a t t t t g t g g c t a t a a a a a g g c a g t c t c c t g t c c a t c a t t a t t t g c t t 461 ctgtggctaacaaagagcaaacaaacacttagaagaaactaagaatactctcatcaaggcgatatagaaaaaaatggtttgg 543 a t a a t c t t t t t c t t c t t a c t c g t a a a c t a t t g g t t a t a a g a t t c g g g a a c t t t g g a t t g a c g t a c g t c g t t g t t t t c a g G A G E 11 625 AGCAAAGGGAGTTGGACAGTGGCTGATGCCGTAGACTACAAAGGACGACCTGCCGACAAATCCAAAACCGGTGGTTGGATCA S K G S W T V A D A V D Y K G R P A D K S K T G G W I T 3 9 707 C T G C C G C T C T C A T T C T T G g t t c g t c t t c t t c t t t t c t a c t t g a c a t a t a t a t a t a t a t a t a t a t a t a c a t t t g g t c c t c a t g A A L I L G 45 789 t a c a t a a t a g a t a t g c c a t t t t t t t t g t g t g t g c a c a t a t a c t t a t g c c a t t a t c a a t a a g a a t c t g t g t g a a a t t t a t t c a 871 c a g a a g t c c t a g t t a a t t a g c t a a a a a t g a a c t c t t t t t t t a t a g c t a a a a a c g a a c t t c t t t t t c t t c t t t a t t t a a c t g c 953 a t g c t t t t t t a t c t t t c t t t t t t t a c t a a a a t c t t c g t t t c t t a c t t c a t g t g a c a t g c a t t a c t a c t a t a t a t t t a t a t t a 1035 t t taa ta t t c tg taaa tgaagaaaataca tc ta tca tccaca ta t tggcagagtag tca t tag tgaa taca taca tacaac t 1117 t a t a c g t a a t t a a t t t g a t c a a g a g g g t g t a g t t c a t g c g t a t a a g t t t t a a a t t c c a t a a g t t g t a t a a t t t g t g a a t a c a 1199 tggtgagaaacaaaagagactcat t t t caaatcagtcacactcacacatgcatgata tgat tgaaataaata ta t t tg ta ta 1281 taaaaatatgaaatgtcgttgt tctgaatctcgctgattgaaagaaagataaagagaaaaggaacacgccacatggctcccc i n t r o n II 1363 a t c t c g c t t a t c c a a t c a t a a t a a c a t t t t t t t t t c t t t t t t a a a a t t t a a t c a t t c t g a a a a a c a a t a t t g a t t a g a a a g a 1445 gaaaaacgaaaactggat t ta ta tc tg ta t tcacgtg tc tac t tagggagcagaaaatgccgacc tccaaaccc t tg t t t tg 1527 t t c c t t a a t a t t c t c t t a c a a a a a g t a c c a g t t g t c t t a a t t a a a a t t a g t c c g g a t a a t c c a a a a t t t a g t t t t g t t g c t t 1609 c t a a g t t t a a a a c t g a t a a t a t a t c t c c t t c a c t t c c t t a c t t t t t t a a a g g a c a a a a a g a t t g a a t g t t a c a t c c a t a a c t 1691 t a t c a t g a a t a t t c a t t t a t g t t t a t c a a t a c t t t a t a t t t t a t t t t g t t g g c c a a a t t a a t a g t t g g a g a a t g a a a g g t c t 1773 a t g t t a t t t t c g t a t t a a t t t a c c t t a a a a c a a t c a a a c t t g t t a a t c a g c t t a t g g c t g c t t a c t a g t t a a g g a t t a t t c t 1855 ac t ta ta tg ta tgaaatggactcaccaat taact tggaacatatgtacaaaactacaaatgt tgacacat taaaaatgaaac 1937 atatattgcagGGATAGAAGTTGTGGAGAGGCTATCAACAATGGGAATAGCAGTGAATTTGGTAACATATTTGATGGAGACA I E V V E R L S T M G I A V N L V T Y L M E T 68 2 019 ATGCATCTCCCAAGTTCAACCTCTGCCAACATTGTCACTGATTTCATGGGCACTTCCTTCCTCCTATGCTTGCTCGGTGGTT M H L P S S T S A N I V T D F M G T S F L L C L L G G F 9 6 2101 TTCTCGCTGACTCCTTCCTCGGCCGTTTCAAAACCATCGGCATTTTCTCAACCATTCAAGCTCTGg taagac tc t a t c taaa L A D S F L G R F K T I G I F S T I Q A L 117 2183 a t c t t a t a t a t a g t t t t a a a a a g g t c a t t g t g a t t a g t t g g t t t t a c c a t c t a g t a g t a g a t g c g t c t a a g a g a a t a a a t a a 2265 c c t g t a t t t t t c t c c a a g a t c t c c g a t t c t a a a a c t a c t a t t a t a a g c a a a t t a t c a a t t a g a g c t c t a t t a a a a a a a t t c a i n t r o n I I I 2347 c t tagaaaaaatcaaacaaaatg t tcgc ta tcaaatc tgc taaggtcg t taac t tag t tggagtc t tggagacggt t t taa t 242 9 atCttgtatacagGGAACTGGTGCTCTAGCGGTAGCAACTAAGCTGCCAGAGCTACGTCCACCAACATGCCATCATGGAGAA G T G A L A V A T K L P E L R P P T C H H G E 140 2511 GCTTGCATACCCGCGACCGCCTTCCAAATGACAATTCTTTATGTTTCGCTTTACCTTATAGCCCTTGGAACTGGTGGTCTTA A C I P A T A F Q M T I L Y V S L Y L I A L G T G G L K 168 2593 AATCTAGTATCTCTGGATTTGGGTCTGACCAGTTTGATGACAAAGATCCTAAAGAGAAAGCTCACATGGCTTTCTTCTTCAA S S I S G F G S D Q F D D K D P K E K A H M A F F F N 195 2675 C A G g t t a g g t t t a g a g t t t a t t t t c a t g c a t g g a a t t a t a a c a t t g t t a t a g t g t t c c c t t t t t c a a a t a a a a t t t t a a t t g R i n t r o n IV 196 2757 gcacatgcagGTTCTTCTTCTTTATTAGTATGGGGACATTATTGGCTGTGACTGTTTTAGTTTACATGCAAGATGAAGTGGG F F F F I S M G T L L A V T V L V Y M Q D E V G 220 Figure 2-13. DNA and deduced amino acid sequence of the AtNRTl.4 gene. 33 2 83 9 AAGATCTTGGGCTTATGGAATCTGCACTGTCTCTATGGCTATAGCTATTGTAATATTCTTGTGTGGGACTAAGAGATACCGT R S W A Y G I C T V S M A I A I V I F L C G T K R Y R 247 2921 TATAAGAAGAGCCAAGGAAGTCCCGTTGTGCAAATATTTCAGGTCATAGCAGCTGCGTTCCGAAAGAGGAAAATGGAACTAC Y K K S Q G S P V V Q I F Q V I A A A F R K R K M E L P 275 3 003 CTCAAAGCATTGTTTATCTTTATGAAGATAACCCTGAAGGCATTAGAATTGAACATACTGATCAGTTTCAgtgagtttCtca Q S I V Y L Y E D N P E G I R I E H T D Q F H 298 3085 gttcaatct t tacaaagaggaagtaaattaaagtaaatt t tgtatctaataaaatct tgtgtgtagCTTGTTGGACAAGGCG i n t r o n V L L D K A 303 3167 GCCATAGTTGCAGAAGGAGATTTTGAACAAACCCTTGATGGAGTTGCAATCCCAAACCCTTGGAAGCTAAGCTCAGTGACCA A I V A E G D F E Q T L D G V A I P N P W K L S S V T K 331 3249 AAGTTGAGGAAGTAAAAATGATGGTTAGGCTTTTGCCTATTTGGGCAACAACTATAATTTTTTGGACAACATATGCCCAAAT V E E V K M M V R L L P I W A T T I I F W T T Y A Q M 358 3331 GATTAC ATTCTCTGTTGAGCAAGCTTCAACTATGAGACGTAACATTGGAAGCTTTAAGATCCCAGCTGGTTCCCTCACCGTG I T F S V E Q A S T M R R N I G S F K I P A G S L T V 385 3413 TTTTTCGTTGCGGCTATTCTCATAACTCTAGCTGTCTACGACCGTGCCATAATGCCTTTTTGGAAGAAATGGAAAGGAAAAC F F V A A I L I T L A V Y D R A I M P F W K K W K G K P 413 3495 C A G g t g a c a t a a g a t t c a t a g a t t c a t a t a t c t a t t c t t t t t t c a t a t a t g t c t c t c a g c t a t a t a t t c a c a t g c a t t a a c a G i n t r o n VI 414 3577 tttcagGTTTCTCTAGCCTACAAAGAATAGCTATTGGATTGGTCTTATCAACCGCTGGAATGGCAGCTGCAGCTCTAGTAGA F S S L Q R I A I G L V L S T A G M A A A A L V E 439 3659 GCAAAAGCGTTTATCCGTTGCGAAATCTAGTTCACAAAAAACATTGCCTATAAGTGTGTTTTTACTTGTTCCACAATTCTTC Q K R L S V A K S S S Q K T L P I S V F L L V P Q F F 466 3741 TTAGTAGGAGCTGGGGAAGCCTTTATCTAC ACTGGCCAACTTGATTTCTTCATAACACAATCGCCTAAGGGAATGAAAACTA L V G A G E A F I Y T G Q L D F F I T Q S P K G M K T M 494 3 823 TGAGCACTGGACTCTTCTTGACCACTTTATCACTAGGTTTCTTTGTCAGCAGTTTCTTGGTCTCAATCGTCAAGAGGGTCAC S T G L F L T T L S L G F F V S S F L V S I V K R V T 521 3905 TTCAACTTCTACTGATGTAGGATGGCTGGCTGATAACATTAACCACGGCCGACTCGATTACTTTTATTGGCTTTTAGTCATT S T S T D V G W L A D N I N H G R L D Y F Y W L L V I 548 3 987 CTCAGTGGAATTAACTTCGTTGTCTATATCATATGTGCCTTGTGGTTTAAGCCAACGAAGGGTAAAGACTCAGTAGAGAAGG L S G I N F V V Y I I C A L W F K P T K G K D S V E K E 576 586 L S G I N F V V Y I I C A L W F K l ' T i \ < j ^ i J o v i , ^ ^ 4069 AAAATGGCAAGGGATTTTCAGTTGAAGACTGCTGAATTTTGTTTTGCAATAATTGTCTTGTGTACAATATTATCTTGCAACA N G K G F S V E D C * 4151 ATGTCGCTTTCC AATTATGTTTCTTGTATATTAAGCAATTGGCTTGTTTTTAGATTCCTCCCGGTCTCAAATATTGTGTCTT 4233 TACCGTTTATGTTATTCACTCTTTTTTTTTGCATCGTGAAAAATAATTATTTAACGAAGTATACTTTTAATTTTCTW3TTAC 4315 GTCCTGTCGCGATCCGATTAATCTCCTTTTTTTTTCGATTAATCTTTTAGGTTTTATGCTTTAGTAGGTCGAGAAGATGAGA 4397 TCCACATTTAGGCCTTTAGCTATTTCATATCTCTTTACCTTTGTGATCTAGTGTCCGGAACATTGTAGAACTGTGGAGAACA A inn mnmmili-i it n » MTliTlR J\ HPiMTir'l'IfPP'T'Tl Figure 2-13. (continued). The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. GATA boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 34 PTR signature sequences: PTR1: [GA]- [GAS]- [LIVMFWAHLIVM]- [GAS]-D-x-[LIVMFYWT]-[LIVMFYW]-G-x 3 -[TAV]-[IV]-x 3 -[GSTAV]-x-[LIVMF]-x 3 -[GA] between TMS2 and TMS3, and PTR2: [FYT]-x 2 -[LMFY]-[FYV]-[LIVMFYWA]-x-[IVG]-N-[LIVMAG]-G-[GSA]-[LIMF] [FYT]-x 2 -[LMFY]-[FYV]-[LIVMFYWA]-x-[IVG]-N-[LIVMAG]-G-[GSA]-[LIMF] within TMS5, are well conserved among the four A t N R T l members (Figure 2-14). The PTR family was not included within the MFS because of insufficient homology between the two families (Pao et al., 1998). However, PTR members possess some features in common with those of MFS: The four A t N R T l members possess sequences of 592 amino acids on average, which are 70 residues longer than those of AtNRT2 proteins, and they are also predicted to have 12 TMS. The A t N R T l members commonly have cytosolic N - and C-termini and a relatively long cytosolic loop, approximately 100 amino acids, between TMS6 and TMS7. In the loops at least one phosphorylation site was found in each protein. A conserved protein kinase C (PKC) phosphorylation site was also found at the end of TMS6. Putative N-glycosylation sites were found between TMS1 and TMS2 of A t N R T l . 1 and 1.2. Because predicted TMS1 of AtNRTl.2 , M-34 to A-53, is shifted upstream compared to A t N R T l . 1, the N-54 becomes a possible glycosylation site (Figure 2-14). T M H M M and M E M S T A T were evaluated as the finest performance prediction programs for known and un-known proteins (Moller et al., 2001). However, both programs predicted that only one third of NRT members should possess 12 TMS. Rather, Toppred, considered to be one of the less powerful performance programs, predicted that all of 11 members should have 12 TMS and cytoplasmic N-terminus (Table 2-2). These 35 oq vo r-o o o cn OJ OJ OJ rH oj r- t/i oj o cn cn o ro OJ OJ ro cd 3 < CN • H *r ro 01 H T n 01 i-i ^ m OJ H ^ m (N r-t ro O J r l n CJ E-« JJ OJ JJ JJ < < < < JJ J J 4J 4J < < < < Ci j j xJ J J J J < < *C < discrepancies might be due to insufficient information of the MFS proteins. Clearly larger data sets and experimental evidence are essential for more accurate predictions. Introns found in the AtNRT gene families carry conserved sequences at 5' and 3' ends, G-T-[AT]-[ATC] and [CTJ-A-G, respectively. These sequences match with the consensus sequences for splicing in eukaryotes (Keller and Noon, 1984; Padgett et al., 1986). The position and length of introns become a key factor for designing primers of RT-PCR. This detail will be discussed in the next chapter.' 37 3 Expression patterns of Nitrate Transporter A tNRT Genes 3.1 Introduction It has been demonstrated that genes belonging to the NRT2 family are induced in response to nitrate provided externally. Among lower eukaryotes, this family includes representation in Aspergillus nidulans NrtA and NrtB (Unkles et al., 2001), Chlamydomonas reinhardtii CrNRT2.1 and 2.2 (Quesada et al., 1998), and the diatom Cylindrotheca fusiformis NAT1 and NAT2 (Hildebrand and Dahlin, 2000). In higher plants, the barley HvNRT2.1 (BCH1) was one of the earliest identified NRT2 members that showed rapid induction in response to nitrate provision. In this species the transcript was detectable within 30 min of NO3" provision (Trueman et al., 1996). Subsequently, cloned NRT2 genes from other species also showed nitrate inducibility with 1 to 4 h for the peak of induction. These include Arabidopsis thaliana AtNRT2.1 and AtNRT2.2 (Filleur and Daniel-Vedele, 1999; Lejey et al., 1999; Zhuo et al., 1999), Nicotiana plumbaginifolia NpNRT2.1 (Quesada et a l , 1997; 38 Krapp et al., 1998), Glycine max GmNRT2 (Amarasinghe et al., 1998), and Lycopersicon esculentum LeNRT2 (Ono et al., 2000). However, additional members of the NRT2 family from A. thaliana, identified from searches of the Arabidopsis genome data bank, AtNRT2.3-2.7, have not been characterized yet. NRT1 family genes, on the other hand, respond to nitrate provision in two ways, either they are nitrate-inducible, or nitrate-constitutive. AtNRTl.1 (CHL1), the first nitrate transporter gene isolated from higher plants, was induced by nitrate and acidic pH (Tsay et al., 1993). Nitrate-inducible NRT1 genes have also been identified from Brassica napus BnNRT1.2 (Zhou et al., 1998), G. max GmNRT1.2 (Yokoyama et al., 2001), and L. esculentum LeNRT1.2 (Lauter et al., 1996; Ono et al., 2000). By contrast, nitrate-constitutive genes, such as AtNRTl.2, are expressed independently of external nitrate. These genes were also observed in G. max GmNRT1.3 (Yokoyama et al., 2001), L. esculentum LeNRTl.l (Lauter et al., 1996; Ono et al., 2000), and Oryza sativa OsNRTl (Lin et al., 2000). The expression patterns of AtNRTl.3 and 1.4 are unknown. Significant portions of incoming NO3 proceed from roots to shoots to be reduced and metabolized and/or stored (Marschner, 1995). Indeed, in some species virtually all nitrate reduction occurs in leaf tissue, and hence NO3" absorption by leaf cells is of crucial importance. Yet, there is little information concerning NO3" transport systems in shoots. Although loading of NO3" into xylem vessels is considered to be passive, the absorption of NO3" from the leaf apoplast by leaf mesophyll cells is necessarily against the electrochemical potential gradient (Glass and Siddiqi, 1995). This NO3" flux might be anticipated to involve LATS based upon typical values of xylem N 0 3 " (Glass and Siddiqi, 1995). Notwithstanding the importance of absorbing NO3" into leaf cells, expression levels 39 of AtNRTl.1,1.2, and 2.1 in shoots were shown to be significantly lower than those in roots (Tsay et al., 1993; Huang et al., 1999; Zhuo et al., 1999). However, Guo et al. (Guo et al., 2001) showed strong expression of AtNRTl. 1 in shoots using GFP/GUS fusion lines. The foregoing emphasizes the importance of NO3" transport systems in shoots. Therefore, I have characterized the expression patterns of 11 AtNRT family members in both roots and shoots, in response to the provision of NO3" following a 7-day period of NO3" deprivation. The transcript abundances were analyzed quantitatively by RT-PCR. 3.2 Materials and Method Plant growth condition Arabidopsis plants (ecotype Columbia) were grown hydroponically under non-sterile conditions as described in earlier papers (Gibeaut et al., 1997; Lejay et al., 1999). Briefly, lA inch thick Styrofoam was fitted to an 8L container as a floating platform to support plant growth. Each platform contained 30 holes (diameter 1.5 cm) covered with nylon mesh at the bottom surface and these holes were filled with clean sand. Seeds were imbibed in a cold room at 4 °C for 3-5 days, and sown directly on the moistened sand in the platform. The nutrient solution which was used to support plant growth contained: ImM KH2PO4, 0.5mM M g S 0 4 , 0.25mM CaS0 4 , 20uM Fe-EDTA, 25uM H 3 B O 3 , 2uM ZnS0 4 , 2 u M MnS0 4 , 0.5uM CuS0 4 , 0.5uM (NH 4 ) 6 Mo 7 02 4 , and 0.5mM N H 4 N 0 3 . For the induction study, 5-week-old plants were transferred to - N solution for one week (other nutrients remained as before), then re-induced with 0.5mM Ca(NC>3)2 for from 0 to 72 hours. pH of 40 the nutrient solution was maintained with CaC03 around 6.2. The walk in environment chamber was maintained under the following conditions: light/dark=8/16 hrs, 25/20 °C; RH=70 %. Light was provided from fluorescent tubes (VITA-LITE, 150 jiiE m"2sec~'). A l l flux determinations and plant harvesting for R N A extraction were undertaken at 4 hours after the light period began, and all pretreatments were appropriately staggered to meet this requirement. A l l experiments were repeated at least twice. The means of those experiments were used as physiological data, and some data such as gel pictures were representatives of the experiments. RNA isolation and relative quantitative RT-PCR R N A was isolated using TRIzol Reagent (Life Technology, Grand Island, N Y ) according to the manufacturer's method followed by additional chloroform isolation and sodium acetate precipitation steps. Total R N A concentrations were determined by U V spectrophotometry. RT-PCR was carried out using OneStep RT-PCR Kit (Qiagen Inc., Mississauga, ON) with QuantumRNA 18S Internal Standards (Ambion, Inc., Austin, TX) under the following conditions: 50 °C for 30 min; 95 °C for 15 min; 19-37 cycles (Table 3-1) of 94 °C for 30 s, 65 °C for 30 s, 72 °C for 1 min; 72 °C for 10 min. Total RNA, 25 to 250 ng (Table 3-1), was added to the reaction mixture containing 400 uM dNTP, 0.6 uM of gene specific primers (Table 3-1), 0.4 uM of the QuantumRNA 18S primers, 0.2 jj.g of hexamers, as well as buffer and enzymes according to the manufacturer's protocol, and RNase-free water was added to make a final volume of 12.5 ul. The RT-PCR products were electrophoresed on 1.3 % agarose gels and stained with SYBRGold (Molecular Probes, Inc., Eugene, OR) for 41 CD E C o >s O CN CN O CO o CO CD CN CD CNl co CM CD CM c o o cc < Z LO CN LO CM o LO CM o LO CM O LO CM O LO CM LO CM o LO CM LO CM LO CM O LO CM CD E 3 C 0 O O c a CM CO CO co CO CO CO CN CN CO CO CM CM CO CM CM CM o o n CO CC O LO CM o LO CM O LO CM O LO CM O LO CN O LO CM O LO CM O LO CM O LO CM O LO CM O LO CM CU N CO o o CO CO CO o CM LO CO o LO LO o LO CO C D o 00 CO CD cn o CO CM CD a : o 0_ h-a : co c o 'i3 c o o T3 c CO J2 CD E 1— a. o 'o CD Q. CO CD c CD o CD E CO .o CO CD c CD O I CM I CO i ei i LO ei 1 CO ei cc 2 i CM I -1 CO I -1 30 minutes. The signals of the targeted gene products on the stained gels were captured and densitometry analyzed with an Alphalmager™ 1200 (Alpha Innotech Corp., San Leandro, CA). For each gene, the optimization of RT-PCR was strictly carried out as follows: 1. Preliminary RT-PCR trials to determine the specificities of the gene specific primers and the presence of the gene expression (e.g. product size and its sequence, and approximate expression levels among the samples); 2. Determination of the PCR cycle number which gave linear range of gene amplification, choosing one sample in which the target gene was expected to be the most abundant. After the RT step, aliquots were taken every two cycles in the PCR step. Signal intensities were then plotted versus cycle numbers on a log scale. A cycle number in the linear range was chosen for the subsequent experiments (Table 3-1). 3. The amounts of the 18S rRNA internal standard primers were determined according to the manufacture's protocol in order to amplify both the target gene and the 18S at a similar level. 3.3 Results Expression of Two NRT families by Relative Quantitative RT-PCR A unique feature of the transport of nitrate, compared to other inorganic nutrients is that nitrate (NO3") is both a substrate for transport and also for the induction of nitrate transport systems at the gene and at the physiological levels (Glass and Siddiqi, 1995; Forde, 2000). Therefore, as the first step in characterizing members of the two NO3" transporter families, their responses to induction by NO3" were examined by means of time-course experiments. 43 Five-week-old Arabidopsis plants were nitrogen starved for 7 days, in order to de-induce NO3" transport (Siddiqi et al., 1989). Preliminary experiments showed that NO3" was undetectable in roots by 4 days after removing exogenous NO3", while shoot NO3" was reduced by >70 % by 7 days. The starved plants were then transferred to nutrient solution supplemented with ImM N 0 3 " for up to 3 days. Gene expression in response to this renewed NO3" provision was analyzed using relative quantitative RT-PCR method. Designing the gene specific primer is the first and perhaps the most important step of the entire RT-PCR method. Some online programs are helpful to seek ideal primer sets by using information such as GC contents, Tm value, primer length, size of the product, and location on the gene. The final decision, however, has to be based on the need to select unique sequences. Table 3-1 shows the gene specific primer sets used in the study. The primers were designed either to flank half of a primer lay in one exon and the second half in the next exon to eliminate genomic D N A amplification, or to flank a region that contains intron(s) to indicate genomic D N A contamination (i.e., genomic D N A would be amplified in larger product size than that of cDNA due to intron(s)). The product sizes of the gene specific primers were aimed to be more than 300 bp since the internal standard primer sets produced about 300 bp fragment (Table 3-1). The specificities were confirmed by the sizes and sequences of the products. PCR conditions including amount of R N A template and PCR cycle numbers were optimized after several trials. Figure 3-1 shows a relative expression level among the AtNRT family genes. The values were calculated by the amount of R N A used for RT-PCR, and the PCR cycle numbers (Table 3-1). Although quantitative relative RT-PCR does not count absolute copy number of an R N A transcript, it still provides a simple estimation of the relative expression 44 High Shoots Roots NRT2.1 NRT2.2 on level NRT1.2 NRT1.3 on level NRT1.1 NRT1.3NRT1.4 NRT2.7 CO NRT1.2 o NRT2.5 NRT1.1 NRT1.4 X 0 0 NRT2.3 NRT2.4 NRT2.1 NRT2.7 > ">4—» NRT2.5 NRT2.6 Rela NRT2.6 Rela NRT2.2 NRT2.3 NRT2.4 Low Figure 3-1. Estimated relative expression levels of AtNRT genes. Relative value =1/ (ax2n), where a is amount of R N A used in the RT-PCR; n is PCR cycle number. Y-axis is expressed in logarithmic scale. level among the genes. Typically, expression levels of all genes, with the exceptions of AtNRTl.1, AtNRTl.4 and AtNRT2.5, were higher in roots than shoots. Within root tissues, the following four genes (listed in order of decreasing transcript abundances) were more highly expressed than in shoots, and more highly expressed than all other genes whether in roots or shoots: AtNRTl.1 > 2.2 > 1.2 = 1.3. On a relative scale, based upon the number of PCR cycles required and quantities of template R N A used to obtain a similar signal, and assigning an arbitrary value of 100% for root expression levels of AtNRT2.1, AtNRT 2.2, AtNRTl.2 and AtNRTl.3, their expression levels in shoots and expression levels of all other genes in roots or shoots were ~5 to 10%. By contrast, within shoot tissues, all members of the AtNRTl family were expressed in greater abundance than AtNRT2 genes (Figure 3-1). Despite diverse levels of transcript abundances it was possible to detect expression patterns of all eleven NO3" transporter genes (Figures 3-2 to 3-6). From the responses to NO3" exposure, genes were categorized into three groups, namely, nitrate-inducible, nitrate-repressible, and nitrate-constitutive. In all of the following, plants that had been grown for 5 weeks with ammonium nitrate were N-deprived for 1 week and then re-exposed to 0.5 mM Ca(N0 3 ) 2 for up to 72h. Nitrate-inducible Genes Three genes in this category, AtNRT2.1, AtNRT2.2 and AtNRTl.1 showed very strong induction (>3 to 5-fold increases) in root tissues following exposure to 1 mM NO3", while other genes showed only modest increases in roots or shoots under the same conditions. In 46 Shoot Root A Duration of induction (hour) 0 3 6 12 24 48 72 AtNRT2.1 #*• 6N§ • • • *'•««• 4 18S * . - • • , , , , » s B Duration of induction (hour) 0 3 6 12 24 48 72 200 AtNRT2.2 + 18S • 00 200 150 £j 100 I 50 0 I I *•. • — • — • 0 24 48 72 Time (hour) 24 48 72 Time (hour) Figure 3-2. Expression patterns of nitrate-inducible AtNRTl genes. RT-PCR products were obtained from 6-week-old Arabidopsis plants, which were grown hydroponically for 5 weeks and supplied with 0.5 m M N H 4 N 0 3 . Plants were N deprived for 1 week (Oh), and then re-supplied with 0.5 m M Ca(N0 3 ) 2 for 3-72h. Relative values were obtained by the ratio of the gene specific amplicon over the 18S amplicon. The values shown are means of three RT-PCR replicates. Bars indicate SE. AtNRTl.l in shoot (A), root (B), AtNRTl.l in shoot (C), root (D). 47 Shoot Duration of induction (hour) 3 6 12 24 48 72 AtNRT2.4 18S 200 co ^ 150 h 100 or £ 50 0 X AtNRT2.3+~ 18S+~ 24 48 Time (hour) Root Duration of induction (hour) 3 6 12 24 48 72 0 24 48 Time (hour) 72 Figure 3-2 (continued). AtNRT2.4 in shoot (E), root (F); AtNRT2.3 in shoot (G). 48 Shoot Duration of induction (hour) A 0 3 6 12 24 48 72 AtNRTl.l — mmm *•*•» «•«"* mmm ~ m 18S * ~ — — — 200 2 150 £ 100 I | 50 0 B AtNRTl.l 18S —i i i 24 48 72 Time (hour) Figure 3-3. Expression patterns of nitrate-inducible AtNRTl genes. RT-PCR products were obtained from 6-week-old Arabidopsis plants, which were grown hydroponically for 5 weeks and supplied with 0.5 m M NH4NO3. Plants were N deprived for 1 week (Oh), and then re-supplied with 0.5 m M Ca(N03)2 for 3-72h. Relative values were obtained by the ratio of the gene specific amplicon over the 18S amplicon. The values shown are means of three RT-PCR replicates. Bars indicate SE. AtNRTl.l in shoot (A), root (B). Root 400 49 AtNRTl.3 18S 250 co 200 CO CO Shoot Duration of induction (hour) 0 3 6 12 24 48 72 D AtNRT1.4 18S 250 CO 200 flHP M i M B 4 M f l l W * 1 24 48 Time (hour) 72 Figure 3-3 (continued). AtNRTl.3 in shoot (C); AtNRTl.4 in shoot ( D ) . CO CD 100 50 0 Shoot Duration of induction (hour) 0 3 6 12 24 48 72 • B AtNRT2.7 18S 150 oo oo > 100 | 50 Root WHV *MW* mmm 4HW AtNRTl.3 18S Root 24 48 Time (hour) Figure 3-4. Expression patterns of nitrate-repressible AtNRT genes. RT-PCR products were obtained from 6-week-old Arabidopsis plants, which were grown hydroponically for 5 weeks and supplied with 0.5 m M NH4NO3. Plants were N deprived for 1 week (Oh), and then re-supplied with 0.5 m M Ca(N03)2 for 3-72h. Relative values were obtained by the ratio of the gene specific amplicon over the 18S amplicon. The values shown are means of three RT-PCR replicates. Bars indicate SE. AtNRT2.7 in shoot (A), root (B); AtNRTl.3 in root (C). 51 A AtNRT2.5 18S co 200 CO \ 150h io £ 1001 0 Shoot Duration of induction (hour) 0 3 6 12 24 48 72 I w • • * H U H f t • i 1 i Root Duration of induction (hour) ..... Ms* 4Mto4 IWWI 200 150 100 50 0 co 200 CO \ 150 C O 100 § 50 0 24 48 Time (hour) 72 AtNRT2.3 18S 24 48 Time (hour) Figure 3-5. Expression patterns of nitrate-constitutive AtNRT2 genes. RT-PCR products were obtained from 6-week-old Arabidopsis plants, which were grown hydroponically for 5 weeks and supplied with 0.5 m M NH4NO3. Plants were N deprived for 1 week (Oh), and then re-supplied with 0.5 mM Ca(N03)2 for 3-72h. Relative values were obtained by the ratio of the gene specific amplicon over the 18S amplicon. The values shown are means of three RT-PCR replicates. Bars indicate SE. AtNRT2.5 in shoot (A), root (B); AtNRT2.6 in shoot (C), root (D); ArNRT2.3 in root (E). 52 AtNRTl.2 18S co 150 oo CM 100 | 50 0 Shoot Duration of induction (hour) 0 3 6 12 24 48 72 B Root Duration of induction (hour) h H j — . 1 — i 0 24 48 Time (hour) 0 3 6 12 24 48 72 • 4 M B S M i *• • * - » i • i • V I M * mm « M » 72 c AtNRT1.4 18S CO oo 24 48 72 Time (hour) Figure 3-6. Expression patterns of nitrate-constitutive A t N R T l genes. RT-PCR products were obtained from 6-week-old Arabidopsis plants, which were grown hydroponically for 5 weeks and supplied with 0.5 mM NH4NO3. Plants were N deprived for 1 week (Oh), and then re-supplied with 0.5 m M Ca(N03)2 for 3-72h. Relative values were obtained by the ratio of the gene specific amplicon over the 18S amplicon. The values shown are means of three RT-PCR replicates. Bars indicate SE. AtNRTl.2 in shoot (A), root (B); AtNRTl.4 in root (C). 53 the AtNRTl family, AtNRTl.1 showed the strongest induction by NO3" in roots (Figure 3-2B). By three hours of NO3" provision, the expression level had reached > 5 fold that of Oil-plants. This peak was sustained for up to 24h, followed by a gradual reduction to about half of the peak level by 72h. In shoots, on the other hand, there was only a small enhancement in the expression of AtNRTl. 1 after 3h of exposure to NO3", followed by rapid down-regulation after 6h, until by 24 h the level was lower than it had been at Oh. Transcript level in shoots was less than 1% of that observed in roots based on the fact that shoot PCR required 7 times the number of PCR cycles and 10 times more R N A template than root PCR (Figure 3-2A, Table 3-1). AtNRT 1.1 was also induced by N 0 3 " both in roots and shoots. As was the case for AtNRTl.1, this was more pronounced in roots where 4 fold increases in transcript abundance were evident by 3h. However, after this peak, expression levels were quickly down-regulated and returned to a value that was close to the original level by 24h (Figures 3-2C and 3-2D). This rapid down-regulation was different from that observed for AtNRTl. 1, although the expression level of AtNRTl. 1 was initially similar to 1.1 as we described earlier. AtNRTl.1 in shoots as well as AtNRTl.4 in both in shoots and roots showed similar expression patterns which were characterized by modest increases culminating in peaks at 3h followed by declines that stabilized by 24h (Figures 3-2C, 3-2E, and 3-2F). AtNRTl.1 also showed a strong induction by N C V i n roots. The induction peaked rapidly, as early as the third hour of NO3" provision, and reached a maximum level that was 2.5 times that of the Oh. This high level of transcript was sustained from 12h to 48h (Figure 3-3B). The expression of AtNRTl.1 in shoots showed a similar pattern to that of AtNRTl. 4, namely a small spike at 3 hours, followed by a return to a level that was as low as the 54 original level (Figure 3-3A). Interestingly, unlike AtNRTl.I, the expression level of AtNRTl.1 was equal to, or even higher in shoots than roots considering both the PCR cycle numbers and R N A template provided (Table 3-1, Figures 3-3A, and 3-3B). There were three genes, AtNRTl.3 = 1.4 > 1.3, which were induced by nitrate only in shoots (Figure 3-2G, 3-3C, and 3-3D). The expression patterns of those genes in the roots will be described later. AtNRTl.3 was induced slowly, reaching peak expression that was 90% higher than at time 0 h, only after 48 h of NO3" provision (Figure 3-2G). AtNRTl.3 expression level in the shoots was much lower than that in the roots (based on a requirement for 10 times as many PCR cycle numbers as in the roots) (Table 3-1). In fact, within shoot transcript abundance of this gene was among the lowest of all of the NRT family of genes. AtNRTl.3 expression level was also gradually induced, increasing to more than 2 fold at 48h, although there was a slight decline during the first 6 hours. However, there was subsequently a significant down-regulation, which began at 48h, reducing transcript abundance to a level that was similar to that at 24 h (Figure 3-3C). Another NRT1 family member, AtNRTl.4 also had a slow induction pattern, reaching the plateau after 48h, a level that was maintained for the next 48 hours (Figure 3-3D). Nitrate-Repressible Genes In contrast to NO3"-inducible genes, there were some genes whose transcript abundances were actually reduced by nitrate provision. AtNRTl.7 conformed to this pattern, in both roots and shoot, while this pattern was only observed in roots for AtNRTl.3. Highest levels 55 of AtNRT2.7 were evident prior to the provision of nitrate (Oh). By 3-6 h after exposure to ImM NO3", transcript abundances had declined to 50% (shoots) and 25% (roots) of the Oh values (Figures 3-4A and 3-4B). Although both shoots and roots shared a similar response pattern, roots responded more rapidly than shoots. It is also notable that the transcript abundance in roots was more than 100 times higher than that of the shoots at Oh (Table 3-1, Figures 3-1). AtNRTl.3 also revealed a repressible pattern in the roots, although gene expression was induced by NO3" in the shoots (Figures 3-3C and 3-4C). The initial response to nitrate provision was as rapid as that of AtNRT2.7 in the roots. However, after 6h, expression level decreased, reaching a value that was about 30 % of the initial (Oh) value by 48h (Figure 3-4C). Nitrate-Constitutive Genes The third group of nitrate transporter genes is described as constitutively expressed. A characteristic pattern of this group is that substantial transcript abundance was already present even under NO3"-starved conditions (Oh), and the expression levels did not change substantially during 72 h of exposure to NO3". AtNRT2.5 and 2.6 in the NRT2 family, and AtNRTl.2 in the NRT1 family showed such a constitutive expression pattern both in shoots and roots, wherein the fluctuations of expression levels were less than ± 50 % (Figures 3-5 and 3-6). Interestingly, the expression level of AtNRT2.5 in the shoot was higher than that in the roots (Figures 3-1, 3-5A, and 3-5B). This is unique in the AtNRT2 family because all other members had greater transcript abundance in roots (Figure 3-1). Although AtNRTl.2 56 expression level in shoots was -10% of that in roots, this gene was among the most highly expressed of shoot-expressed genes. Given that the AtNRTl.2 is constitutively expressed, overall, this is one of the most highly expressed nitrate transporter genes throughout the plant during all stages of our investigation. As mentioned earlier, AtNRT2.3 showed a nitrate-inducible pattern in the shoots, but its expression in roots was essentially constitutive, although a slight down-regulation was observed during the first 6 hours (Figure 3-5E). Besides differences in root/shoot expression patterns, expression levels were also significantly different (i.e., root levels were typically -10 times higher than those of the shoots) (Figure 3-1). The expression of AtNRTl.4 in the roots also showed a constitutive pattern (Figure 3-6C). This insensitivity to NO3" did not match its shoot expression where the gene was induced by NO3" provision (Figure 3-3D). Similar to AtNRT2.5 and AtNRTl.l, AtNRTl.4 was the third gene whose expression levels were higher in shoots than in roots (Figure 3-1). 3.4 Discussion The present study using RT-PCR clearly showed that all 11 NO3" transporter genes were expressed in roots and shoots, whereas previous reports have claimed that expression levels of nitrate transporters in the shoots were either extremely low or undetectable. This applies specifically to AtNRT2.1 (Filleur and Daniel-Vedele, 1999; Zhuo et al., 1999), AtNRT2.2 (Zhuo et al., 1999), AtNRTl.l (Tsay et al., 1993), and AtNRTl.2 (Huang et al., 1999). Our successful demonstration of shoot expression of these genes, though in low abundance, is 57 probably due to the greater sensitivity of the RT-PCR method but might also result from differences in plant growth conditions among different laboratories. In previous reports plants were grown in sterilized systems where sucrose was added in the media (Tsay et al., 1993; Huang et al., 1999; Zhuo et al., 1999). Sucrose additions to growth media have been documented to produce significant effects at both the physiological and molecular levels. Hanisch and Breteler (1981) showed that exogenous sucrose application restored the decreased nitrate uptake rate and nitrate reductase activity to 83 % and 108 % of the level of the intact plants, respectively, in decapitated dwarf bean roots. This indicated that carbon metabolites normally provided through photosynthesis could be compensated for by sugar supplement via root tissues. In Arabidopsis 1 % sucrose in the media stimulated transcripts of A t N R T l . 1 and AtNRT2.1, and nitrate influx during dark periods (Lejay et al., 1999). On the other hand, photosynthetic genes were down-regulated by sugars in isolated maize mesophyll protoplasts (Sheen, 1990). Furthermore, Krapp and Stitt (1995) demonstrated that a cold-girdle treatment on spinach leaves led to an increase of sugar contents in the leaves, and inhibition of the rate of photosynthesis and expression of photosynthetic genes. In addition, when sucrose is provided via roots, any carbon limitation upon NO3" reduction and assimilation is removed and in contrast to plants growing without sucrose, it is reasonable to expect that there might be greater root than shoot assimilation of nitrate. Therefore, it is obvious that the presence of sucrose in the growth media has effects on N -and C-metabolism, the localization (root versus shoot) of these activities, and its expression levels of genes involved in these processes at the gene and physiological levels, although the mechanisms of the interactions between sucrose and nitrate transporters are not clear (Coruzzi and Bush, 2001). 58 Although the patterns of, and extents of, expression levels of the genes were variable, we grouped all members into three categories in order to organize the information generated. Most of those genes investigated had similar expression patterns in roots and shoots. However, in specific cases, such as AtNRT2.3, and 1.3, expression patterns were quite different between roots and shoots (Figures 3-2 to 3-5). Another example of different expression patterns within the same plants was observed through a split-root experiment. The expression level of AtNRT2.1 in one portion of the roots under steady state condition was up-regulated by N-depriving the other portion of the roots where NRT2.1 expression was slowly down-regulated (Gansel et al., 2001). The result indicated that NRT2.1 was controlled not only by local N-supply but also shoot-root signals of N demand (Gansel et al., 2001). Interestingly, the authors observed a different response with respect to A t A M T l . l expression which seemed to be controlled primarily by local conditions. In the present study, the N-pool size within the plant tissues changed during the period following re-provision of nitrate. These changes of nitrate concentration as well as amino acid pools are probably important in the regulation of some NRT genes, resulting in different expression patterns within the plant. To date, since little is known about the nitrate transporters and transport systems in shoots, we are not able to define the roles of specific NRT genes in shoots, other than the stated importance of absorbing NO3" into leaf cells from the leaf apoplasm. Yet, further proposed functions of the NRT nitrate transporters will be discussed in chapter 5. On the basis of correlations between physiological patterns of NO3" influx and corresponding patterns of gene expression, it has been suggested that the NRT2 proteins probably play a major role in inducible HATS in A r a b i d o p s i s (Zhuo et al., 1999; Lejay et 59 al., 1999), N. p l u m b a g i n i f o l i a (Krapp et al., 1998), soybean (Amarasinghe et al., 1998), and barley (Glass et al., 2001). In this study A t N R T 2 . 1 , 2.2 and 2.4 showed nitrate-inducible patterns, suggesting that these genes might be involved in iHATS activity (Table 3-2). However, it is evident from the foregoing results, that not all members of the NRT2 family of genes can be characterized as nitrate-inducible. The present findings demonstrate that "nitrate-inducible" is not a universal characteristic of the NRT genes. Rather it appears that two other characteristics, nitrate-constitutive, and nitrate-repressible must be included in the characteristics of these gene families. It is also apparent that Arabidopsis has substantial NO3" uptake capacity even prior to exposure to NO3" (Zhuo et al., 1999). Therefore, genes, which show nitrate-constitutive properties such as AtNRT2.3, 2.5, and 2.6, might have roles in cHATS activity (Table 3-2). AtNRT2.4 showed significant transcript abundance even in un-induced plants, although this gene was considered to be nitrate-inducible because of its expression pattern (Figure 3-2F). According to physiological studies by Aslam et al. (1992) and Kronzucker et al. (1995), the constitutive flux of NO3" into roots of barley and white spruce was increased by exposure to NO3". Therefore a feature of the gene(s) encoding this NO3" flux would be (a) constitutive expression that is (b) increased by exposure to NO3". Thus, AtNRT2.4 might also be involved in the cHATS. Wang et al. (Wang and Crawford, 1996) isolated a mutant, which was impaired only in the cHATS transport in roots of A r a b i d o p s i s . It will be interesting to see i f this mutation is located in one of the above-proposed candidates. In the same way, low-affinity nitrate transporter (AtNRTl) family members are predicted to have a role in iLATS and cLATS, according to their nitrate-inducible, and nitrate-constitutive patterns, respectively (Table3-2). A Ml mutant study showed that 60 Table 3-2. AtNRT Genes and hypothesized nitrate transport systems Gene Response to Nitrate (root) Transport System AtNRT2.1 Inducible iHATS AtNRT2.2 Inducible iHATS AtNRT2.3 Constitutive cHATS AtNRT2.4 Inducible iHATS, cHATS AtNRT2.5 Constitutive cHATS AtNRT2.6 Constitutive cHATS AtNRT2.7 Repressible ? AtNRTl.l Inducible iLATS , HATS AtNRTl.2 Constitutive cLATS AtNRTl.3 Inducible iLATS AtNRTl.4 Constitutive cLATS 61 NH4NO3 grown mutant plants had about 75 % less nitrate influx, compared to WT in the LATS range (Touraine and Glass, 1997), and this defect was found even at cHATS and iHATS activities (Wang et al., 1998b; Liu et al., 1999). As a consequence it has been suggested that AtNRTl.l may encode both high- and low-affinity transporters. In the present study AtNRTl.l(CHLl) and 1.3 in roots showed nitrate-inducible patterns. Therefore, these genes are candidates for iLATS activity (Table 3-2). AtNRTl.2 showed a nitrate-constitutive expression partem and this is consistent with an earlier report, which demonstrated that transgenic plants expressing antisense AtNRTl.2 showed reduced levels of low-affinity nitrate transport (Huang et al., 1999). Given that AtNRTl.4 also displayed a similar expression pattern, these two genes are predicted to be involved in cLATS activity (Table 3-2). The third category of nitrate-repressible genes represents the most puzzling group. This response is largely unknown at the physiological level, except that it might be speculated that when NO3" is removed from the external medium there begins a net transfer of NO3" from vacuole to cytoplasm (Zhen et al., 1991; Glass and Siddiqi, 1995). Normally this transfer exhausts the vacuolar reserve within 3-4 d (van der Leij et al., 1998 and references therein; Okamoto, unpublished data). When NO3" is re-supplied, the [NO3"] of the vacuole restored. It is possible that genes encoding transporters involved in the transfer of NO3" from vacuole to cytoplasm are down-regulated when NO3" is re-supplied in order to restore vacuolar [NO3"] to its normal level. However, it is unclear from the molecular perspective whether members of the NRT2 family might function as tonoplast transporters since there is no indication of the appropriate signal peptide to direct expression of the transporter to the tonoplast (Chapter 2). 62 4 Tissue-Specific Expression Patterns of AtNRT Genes 4.1 Introduction It is reasonable to presume that nitrate absorption occurs mainly from the rhizosphere where most nutrients are available. In the present study, I have documented that six genes out of the seven NRT2 family members are expressed more dominantly in roots than shoot (Chapter 3). The expression patterns of, and levels of expression genes of the NRT families were diverse. However, whole root and whole shoot analysis leave many questions unanswered. For example, how is the expression of NRT genes localized within different tissues? Is there any correlation between the expression patterns from total R N A analysis of roots or shoots and tissue-specific expression patterns? A t N R T l . 1(CHL1) was the first gene among the NRT families of genes to be investigated with respect to its tissue-specific expression by using in situ hybridization (Huang et al., 1996). A t N R T l . 1 mRNA accumulation was observed primarily in the epidermal tissues in young roots, while mainly in the cortex or endodermal cells in mature roots. Similar results were also obtained by GUS/GFP fusion lines, where the 5' flanking 63 and partial coding regions of the AtNRTl.l were fused in frame with either green fluorescent protein (GFP) or ^-glucuronidase (GUS) reporter DNAs (Guo et al., 2001). The authors, furthermore, found that AtNRTl.l was expressed in nascent organs in both roots and shoots, including flowers. The findings were also verified with immunolocalization using polyclonal antibodies raised against the A t N R T l . l protein (Guo et al., 2001). In contrast to AtNRTl.l, AtNRTl.2 was highly expressed in the epidermis and root hairs regardless of the stage of root development (Huang et al., 1999). These locations are consistent with the belief that NRT1 genes are involved in NO3" uptake. As well, it is possible that AtNRTl. 1(CHL1) has a role in early organ development (Guo et al., 2001). Among cloned NRT2 genes, NpNRT2.1 from Nicotiana plumbaginifolia was the only gene that has been analyzed for its tissue-specific expression pattern. The accumulated mRNA was localized in the epidermal and endodermal cells of the root tip, while lateral root primordia were the main targets in mature roots (Krapp et al., 1998). To date, no publication is available detailing the tissue localization of the NRT2 gene expression in Arabidopsis. Therefore, this work was particularly focused on the NRT2 family genes. To investigate NRT2 gene expression at the cellular level, transgenic plants were produced, which carry the promoter regions of AtNRT2 genes fused to GUS reporter genes. Four gene constructs (i.e., AtNRT2.1-GUS, 2.2-GUS, 2.4-GUS, and 2.6-GUS) showed GUS signals. Predominant expression was observed in roots as expected, but each gene had an unique expression pattern. AtNRT2.1 and AtNRT2.6 were also expressed in shoots. The significance of each expression pattern will be discussed. 64 4.2 Materials and Method Construction of NRT2-GUS Fusion Genes The NRT2.1 promoter region was obtained from a plasmid pCRN2.1pro which contained 1.2 kb upstream flanking sequences and the start codon of A t N R T 2 . 1 . To fuse the promoter region to the GUS reporter gene, a Hindlll-Ncol fragment from pCRN2.1pro was cloned into the corresponding sites of pBI320X. A Hindlll-SacI fragment from the pBI320X, consisting of the NRT2.1 promoter region, GUS, and NOS3' , was then ligated into the corresponding sites of a binary vector pMOG402. The promoter regions from the rest of NRT2 gene family members were cloned by PCR. Primers used to amplify each 5' franking region were: N2.2P5 (5'-A A G C T T C A A C A G A G G G G A A C A C C G G C C A C G ) , andN2.2P3 (5'-G G G C T C A T C A G T A G A A C C C A T G G A T T T T A A A G C ) for N R T 2 . 2 , N2.3P5 (5'-), and N2.3P3 (5' - A C A A A C A T T A A A A T C C A G T G G C A G C C A T G G T A A ) for N R T 2 . 3 , N2.4P5A (5' -TCT A A G C T T C C A G T T T A A A T T T C T AT A T A A T T G AG), andN2.4P3 (5'-C A T C G G G C C A T G G T G T G A A T A T T T ) for NRT2.4,2.5P5-1 (5'-A A G C T T T C C A T C C T C A C C C T G C A G A A G C A C ) , and2.5P3-l (5'-G C A A A A C A A G A C A T G G T T A G T T T G T A T C C A A A A ) for NRT2.5, N2.6P5 (5'-A A G C T T T C T A A A A T A T G A G T T T A C G T T C C A A ) , andN2.6P3 (5'-G T G A G C C A T G G A T C T T T A G T T C A A A G A ) for NRT2.6, andN2.7P5 (5'-A A G C T T C T G A T C C C C G A T C T C A A G T A T T G A C T ) , andN2.7P3 (5'-C C A T G G T T G T G A T C T T T G T G A A G G T T C A G A G A A T T T T G ) for NRT2.7. These primer 65 sets amplified the promoter regions of 1.2-2.0 kb. PCR was carried out using Expand High Fidelity PCR System (Roche, Laval, QC) under the following conditions: 94 °C for 2 min; -10 cycles of 94 °C for 15 s, 65 °C for 30 s, 72 °C for 2 min; 20 cycles of 94 °C for 15 s, 65 °C for 30 s, 72 °C for 2 min + cycle elongation of 5 s for each cycle; 72 °C for 7 min. The fragments were cloned into pCR2.1. A Ncol-Xhol fragment in the pCR2.1 was introduced to pBI320.X, and resulting fusion gene, NRT2.X-GUS-3 'NOS, was cloned into pBIN+ (NRT2.1, 2.2, and 2.4) or pMOG402 (NRT2.3, 2.5, 2.6, and 2.7). Plant Transformation Binary vectors, which contained the fusion genes, were transformed into A g r o b a c t e r i u m tumefaciens strain GV3102. Transformation into Arabidopsis plants was carried out according to Clough and Bent (Clough and Bent, 1998). Overnight cultures of A g r o b a c t e r i u m ( IL LB) grown at room temperature ( O D 6 0 0 - 0.8-1.0) were harvested and re-suspended in 500mL of inoculation media, containing 5% sucrose and 0.005% Silwet lu-ll (Lehle Seeds, Round Rock, TX). A r a b i d o p s i s plants (ecotype Columbia) were grown in soil (Redi-Earth Potting Soil, Grace-Sierra Horticultural Co., Lansing, MI) until flowering stage in a controlled-environment chamber with 24/18°C at 16/8h of light/dark cycle. Whole shoots of 4-5 week-old plants (flowering stage) were dipped in the inoculation media containing appropriate A g r o b a c t e r i u m strain for 60 sec twice. The whole plants were then covered with a plastic bag to maintain moisture for the next two days. Seeds (Tl generation) were harvested when sliques turned yellow to brown. T l seeds were selected on respective selection substrates (i.e., 25mg L" 1 kanamycin for N R T 2 . 1 , 2.2, 2.4 on petri 66 plates; 25mg L" 1 Basta with 0.02% Silwet L-77 for NRT2.3, 2.5, 2.6, 2.7 applied by spray on soil grown plants). Basta selection was also performed on petri plates with lOmg L" 1 Basta. The selection media for plates contained Vi MS medium (Murashige and Skoog, 1962), 1% sucrose, 0.8% agar, 0.5g M E S in IL, pH 5.7. Subsequent GUS analysis was based on the T2 generation. GUS Staining T2 seeds were germinated on selection plates after surface sterilization, and resistant plants were transferred onto growth plates (i.e., same as selection plates without kanamycin or Basta) for up to 2 weeks for vegetative stage or 3 weeks for flowering stage. The plants were then grown on a N-free plate (nutrient composition was the same as for the hydroponic solution in Chapter 3, omitting sucrose) for 1 week before plants were induced with l m M N 0 3 " . Harvested plant materials were washed with water and placed in a 24-well plate or in small petri dishes. X-Gluc solution (0.5 mM 5-bromo-4-chloro-3-indolyl-P-D-glucoronide cyclohexylamine salt (Rose Scientific Ltd., Edmonton, AB) , lOOmM sodium phosphate buffer pH 7, 0.1% Triton X-100, 2mM ferricyanide (K 3Fe(CN) 6), 2mM ferrocyanide (K4Fe(CNV3H20)) was added until whole plants were submerged. After vacuum infiltration, the solutions with plants were incubated at 37°C for 4-5 hours or overnight. The plants were "bleached" with a series of EtOH solutions (20% to 95%). 67 Cross-Sectioning and Histochemical Analysis GUS stained roots were investigated more thoroughly after sectioning in transverse and/or longitudinal planes. The root tissues fixed in 80% EtOH were dehydrated in a scintillation vial as follows: 30 min in 90% EtOH, 30 min in 95% EtOH, 3 times 30 min in 100% EtOH (molecular sieve-treated to get rid of traces of H2O). Subsequently, the tissues were embedded in Spurr's resin (J.B. E M Service Inc. Dorval, QE) prepared by following the manufacture's manual. The specimens were given an additional 100% EtOH change (1ml) before the embedding process. The concentration of resin was raised gradually as follows: one drop of resin was added into the vial and gently mixed for 5 min; two drops of resin were added and mixed for 5 min; the last step was repeated; two drops of resin were added and mixed for 45 min. One half of total volume of the resin/EtOH solution (=0.55 ml) was removed and replaced with the same volume of resin (mixing for 90 min). This was repeated once more and left on a rotary shaker overnight. On the subsequent day, the solution was replaced with 100% resin and mixed for 5h. Then the resin was refreshed once, and the solution was mixed overnight without cap, but with aluminum foil as a cap to let EtOH evaporate from the solution. After the incubation period, the solution was replaced with new resin. Finally, the tissues in the solution were transferred to an aluminum-weighing dish with fresh resin, and arranged in the appropriate orientation under a dissecting microscope. The polymerization of resin was achieved in an oven at 60 °C overnight. A trimmed polymerized block was sectioned in 2-4 urn thickness with a microtome (Reichert, Model OM-U3, Austria). Images of the samples were captured in digital formats with a SPOT system (Diagnostic Instruments Inc. Sterling Heights, MI). 68 4.3 Results Tissue-Specific Expression Patterns of NRT Genes To visualize the specific expression patterns of AtNRT2 genes within the tissue, the promoter regions of each member of the family were fused to GUS reporter gene. AtNRT2.3, 2.5 and 2.7 were unable to be used as subjects for further analysis either because no GUS activity was shown or an insufficient number of positive transformants were observed. Therefore only AtNRT2.1, 2.2, 2.4, and 2.6 were investigated in detail. A transgenic line which carried AtNRTl.1(CHL1)-GUS (Guo et al., 2001), donated by the authors was also analyzed for comparison. Since AtNRT2.1, 2.2, 2.4, and / . / are nitrate-inducible, the plants were first N-deprived for lweek, and then, re-induced by 0.5 mM Ca(N03)2 for 6 h (see detail in Materials and Method). More than eight lines of transformants from each construct were examined, and the studies that showed the reproducible results, were repeated at least three times. The pictures in the figures are representative of those experiments. AtNRT2.1 In 3-week-old plants, blue GUS staining was found in entire roots, with stronger staining in the mature region of the root and in the root tip. By contrast, staining was minute or absent from the root cap and distal region close to the hypocotyls zone (Figures 4-1). The gradient of GUS activity is evident along the younger part of the root (Figure 4-1 A). From the meristematic to elongation zones GUS staining is lighter than in the mature region. In the 69 ire 4-1. Analysis of GUS activity in AtNRTl.1 promoter-GtTS'Arabidopsis plants. GUS histochemical staining in a root of an A t N R T l . 1 promoter-GcTS plant. Bar = 0.5 mm. Close up of root tip. Bar = 200 um. Basal region of a plant. Bar - 1 mm Close up of a lateral root near the basal region. Bar=0.5 mm. 70 Figure 4-1. (continued). (E) Longitudinal section close to a root tip. Low level of GUS expression in the outer most layer of the root cap. Bar = 50 um. (F) Cross-section of a root (5 mm from a root tip), c, cortical cells; e, epidermal cells; en, endodermal cells. Bar = 50 um. (G) Fully expanded leaf. GUS staining is seen in hydathodes indicated with arrows. (H) High magnificication near a leaf hydathode. Bar = 200 um. more mature roots, developing lateral roots showed stronger GUS activity than the parental root (Figure 4-ID). To look at more detail of the localization, sectioning of the fixed samples was carried out (Figures 4-1 D and E). GUS activity was seen in epidermal cells, cortex, and endodermal cells, although the strongest signals were observed in the epidermal cells. In shoots GUS staining was especially evident in leaf hydathodes (Figures 4-1G and F). AtNRT2.2 GUS expression in an AtNRT2.2 promoter-GUS plant is shown in Figure 4-2. GUS staining was found in recently developed roots, but was absent in the tissue close to the root tip (Figure 4-2A). When lateral roots appeared, GUS activity was found in the newly developing root, whereas the parental root showed only faint GUS staining (Figure 4-2B). Once lateral roots developed to a certain stage where root hairs start appearing, the blue GUS staining in the parental root completely disappeared (Figure 4-2C). However, the intensity of GUS activity was not uniform. Figure 4-2D shows this irregular pattern along a root, and the GUS staining was primarily in epidermal cells and root hairs. There was no GUS activity in shoots including leaves, stems and flowers (data not shown). AtNRT2.4 GUS activity was primarily seen in developing or recently developed roots (Figure 4-3). Similar to that of AtNRT2.2, GUS staining in A t N R T 2 . 4 - G U S plants was absent in the region of the primary root where lateral roots grew (Figure 4-3A). In a developing lateral root GUS staining was strong, although in the regions of the apical meristem and the root 72 Figure 4-2. Analysis of GUS activity in AtNRT2.2 promoter-GcTS Arabidopsis plants. (A) GUS histochemical staining in a root of an AtNRT2.2 promoter-GUS plant. Bar = 0.5 mm. (B) GUS staining in a lateral root. Bar = 100 um. (C) GUS staining is localized in secondary roots. Bar = 1 mm. (D) High magnification of GUS staining in the root hair zone. Bar =100 um. 73 Figure 4-3. Analysis of GUS activity in AtNRT2.4 promoter-Gc/S Arabidopsis plants. (A) GUS histochemical staining in roots of an AtNRT2.4 promoter-GC/S plant. Bar = 2 mm. (B) Lateral root. Bar = 200 um. (C) GUS staining in root close to a root tip. Bar = 100 pm. (D) Longitudinal section of root close to a root tip. Bar = 100 um. (E) and (F) No GUS activity in flowers (E), or leaves (F). 74 tip were not the targets for the expression (Figure 4-3B). Developed roots showed GUS activity in the root tip region, where the staining was placed in one to two layers of cells from the surface i.e., the root cap (Figures 4-3C and D). Shoot tissues showed no GUS activity (Figures 4-3E and F). AtNRT2.6 GUS activity in A t N R T 2 . 6 - G U S plants was seen both in roots and shoots (Figure 4-4). In roots, the zone of maturation (including root hairs) showed the strongest GUS staining, although the expression was absent from the basal region, and from the root tip and zone of elongation (Figures 4-4A and B). Cross-sections of the region close to the root tip showed that GUS activity was primarily seen in the epidermis, endodermis, and pericycle (Figure 4-4C). In shoots, GUS staining was specifically seen in the anthers of flower buds (Figures 4-4D). Under N-starvation the anthers of opened flowers also showed GUS activities, while N-fed plants seemed to have less or no GUS activity in the anthers (Figures 4-4E and F). Higher magnification and dissection analysis revealed that GUS staining was localized in pollen grains (Figures 4-4F and G). AtNRTl. 1(CHL1) A t N R T l . 1 promoter-Gt/5 plants obtained from Guo et al. (2001) were also induced by 1 m M NO3" for 6 h, and subjected to GUS staining. Strong GUS activities were noticeable in root tips and leaves (Figure 4-5). GUS expression in a newly developed root was primarily seen in outer layers (Figures 4-5A and B). The layers were verified as epidermal cells and 75 Figure 4-4. Analysis of GUS activity in AtNRT2.6 p romo te r -Arab idops i s plants. (A) GUS histochemical staining in a root of an AtNRTl. 6 promoter-GITS' plant. Bar = 0.5 mm. (B) Middle section of a root. GUS staining is fading out toward the basal (to the left in the picture) section. Bar = 100 um. (C) Cross section of a root 1 cm from the tip. c, cortical cells; e, epidermal cells; en, endodermal cells; p, pericycle. Bar = 50 um. 76 Figure 4-4. (continued). (D) GUS staining in a flower bud of an AtNRT2.6 promoter-GUS plant. GUS activity is seen in anthers. Bar = 200 um. (E) GUS staining in uninduced plants. Flower buds as well as opened flowers (indicated with arrows) show some GUS activities. (F) GUS expression in nitrate-induced plants. GUS staining is concentrated in developing flower buds, and diminished in opened flowers. (G) Higher magnification of an anther from a flower bud. GUS staining is seen in pollen grains. Bar = 100 um. (H) Higher magnification of pollen grains from a dissected anther. Bar = 50 um. 77 Figure 4-5. Analysis of GUS activity in AtNRTl.l promoter-Gc/S' Arabidopsis plants. (A) GUS histochemical staining in a root of an AtNRTl.l promoter-GCZS plant. Bar = 0.5 mm. (B) Strong GUS staining around a root tip. Bar = 200 um. (C) High magnification of mature section of a root. GUS staining is seen in the epidermal cells. Bar = 200 um. 78 ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ Figure 4-5. (continued). (D) GUS staining in leaves of an AtNRTl.l promoter-GiVS" plant. (E) Close up of a leaf. GUS staining is stronger along the vascular system. (F) Higher magnification of leaf surface. (G) GUS staining in a petiol. (H) GUS staining in a sepal. (I) Higher magnification of a sepal. Bars in (E), (G), and (H) = 200 urn, (F), and (I) - 50 urn. 79 cortex in previous studies (Huang et al., 1996; Guo et al., 2001). The GUS activities in these regions gradually disappeared toward the basal of the roots. Instead, the center region of the root took over the localization of GUS expression (Figures 4-5A and C). The region was claimed to correspond to endodermal cells by in situ hybridization (Huang et al., 1996). In shoots, GUS activity was seen in whole leaves, and stronger (dark staining) in the vascular system (Figures 4-5D and E). On the surface of a leaf, GUS activity was also observed in guard cells (Figure 4-5F). This characteristic was clearly visible in petioles and sepals (Figures 4-5G to I). 4.4 Discussion Analysis of GUS activity controlled by AtNRT promoter genes revealed that each gene member of AtNRT families has a unique tissue-specific expression pattern. Every AtNRT gene, examined in the present GUS study showed GUS expression in roots. This evidence is consistent with the belief that NRT genes are involved in NO3" uptake. AtNRTl.l, 1.1, and 1.4 showed high sequence similarity, and similar expression patterns as nitrate-inducible genes as revealed by RT-PCR with total tissue R N A (Chapters 2 and 3). This highly homologous trio also displayed some similarities in the GUS expression patterns. For example, strong GUS activities were observed in epidermal cells and root hairs for all three genes. AtNRTl.l and AtNRTl.l had less or no GUS activity in meristematic and elongation zones (Figures 4-1B and 4-3C), while AtNRTl.l and AtNRTl.4 showed no GUS expression in the older regions of roots where lateral roots emerged (Figures 4-2C and 4-80 3A), and AtNRT2.1-GUS expression was localized in both young and mature root regions (Figure 4-1). This expression pattern perhaps explains why AtNRT2.1 showed the highest expression level among the NRT2 gene family by RT-PCR in whole root studies (Chapter 3). No GUS staining was found in leaves of AtNRT2.2, 2.4, and 2.6, although RT-PCR could show the expression patterns of the genes in the shoots (Chapter 3). These discrepancies could be due to their lower gene expression levels (Table 3-1, Figure 3-1), and GUS reporter system might not be sensitive enough to visualize the expression patterns. In N i c o t i a n a p l u m b a g i n i f o l i a , using in situ hybridization, high-affinity nitrate transporter NpNRT2 was expressed in root tip, and epidermal and endodermal cells in developing roots, while in older roots the transcript was primarily localized in the lateral root primordial, and there was little expression in the parental root (Krapp et al., 1998). This tissue-specific expression pattern is similar to that of AtNRT2.4, although Northern blot analysis showed that NpNRT2 expression pattern was more similar to that of AtNRT2.1. These results therefore indicate that expression patterns revealed from total R N A and from tissue-specific methods may differ among species. Characterization of additional NRT2 homologues in N. p l u m b a g i n i f o l i a or other species will solve this issue. Plant roots experience biochemical gradients both in the longitudinal and the radial axes. Zhen et al. (1991) observed a longitudinal gradient of nitrate concentration in barley roots. The five-day-old roots were grown in 10 m M NO3" and divided into three regions i.e., from the tip, 0-2.5 cm, between 2.5 and 5.0 cm, and >5.0 cm. The middle section (2.5-5.0 cm) had 113.9 mM [NO3"], whereas the root tip and >5.0 cm regions possessed 90.9 and 93.3 mM, respectively. Siebrecht et al. (1995) also measured [NO3"], as well as, NO3" uptake and nitrate reductase (NR) activity along the barley root axis. Net NO3" uptake rates 81 by root tips of 7-day-old plants were half of those of the middle and basal zones. However, nitrate absorbed by root tips was translocated to older root zones, and induced NO3" uptake there. Furthermore, within 20 mm from the tip maximum NR. activity (on a weight basis) was seen at 1mm behind the apex (Siebrecht et al., 1995). These results indicate that nitrate absorption and metabolism in the root tip region may impact upon the rest of the root, although NO3" uptake per se was not high. Among low-affinity nitrate transporters A t N R T l . l was expressed in both mature and lateral root tips (Guo et al., 2001; this study), and A t N R T l . 2 was expressed in epidermal cells in the root tips (Huang et al., 1999). As well, among high-affinity transporters, AtNRT2.1 and 2.4 were expressed in the root tips (the present work). These multiple genes expressed in the root tips might indicate the significance of this region for NO3" uptake or NO3" sensing. In the soil environment nutrient availability varies depending on mass flow, nutrient diffusion, and interception by root growth (Marschner, 1995), resulting in great soil heterogeneity in nutrient availability (Jackson and Caldwell, 1993; Wo It, 1994). The root tip region, as a "frontier", may have more chance to deal with higher nitrate concentrations in the media than mature regions of the roots, which create a gradient of the nutrient concentration surrounding the roots as a result of withdrawing NO3". In this case, the region close to the root tips might be well served by low-affinity nitrate transporter(s), while older regions of the roots are the zones where high-affinity transporter(s) becomes more important. High-affinity transporters AtNRT2.2 and 2.6 might be involved only in the latter case, since both genes were specifically expressed in older regions of the roots (Figures 4-2A and 4-4A). 82 There are two pathways for nutrients to traverse the root in the radial direction. One is called the symplasmic pathway where nutrients enter root tissues through epidermal cells and move through plasmodesmata within the cytoplasm toward the stele. The other pathway is apoplasmic. The solutes enter the cell wall space and can travel through cell walls and intercellular spaces until reaching endodermal cells. Because a suberized Casparian strip is located in endodermal cell walls, solutes are blocked from entering the stele via the apoplasm. Therefore the nutrients need to be absorbed at endodermal cells. A l l of AtNRT genes in the present study were expressed in the epidermal cells, and AtNRT2.1, 2.6 and 1.1 (Huang et al., 1996) were also expressed in endodermal cells, indicating that all these genes are involved in symplasmic transport, and the latter group of genes may contribute in apoplasmic transport. Interesting findings involved the expression patterns of NRT genes in shoots. Quantitative relative RT-PCR using total tissue R N A extractions revealed that the AtNRTl family of genes and AtNRT2.5 had substantial levels of expressions in shoots (Chapter 3). This was consistent with the results from transgenic lines which carry A t N R T l . 1 promoter-GFP/GUS genes. AtNRT 1.1(CHL1) mutant analysis indicated that A t N R T l . 1 is not only involved in NO3" uptake, but also in the growth of nascent organs both in roots and shoots (Guo et al., 2001). However, the role of gene expression in the guard cells as revealed by GUS expression remains unsolved. It is well known that potassium ion fluxes in and out of the guard cells to open/close the stomata by osmotic effects. Nitrate, an anion, may act as a counter ion when K + moves into the guard cells in order to maintain electrical neutrality across the plasma membrane. 83 GUS staining in pollen grains of AtNRT2.6-GUS plants was a novel finding (Figures 4-4D to H). Pollen is rich in nitrogen (N), ranging from 2.5 to 61 % of protein contents (Roulston et al., 2000), and/or micro-molar concentrations of amino acids can be stored (Schwacke et al., 1999). In fact, flowers are an important diet for some animals because of the high protein content of pollen grains (van Tets and Hulbert, 1999). N-sources in pollen are most likely utilized for pollen development and for producing enzymes which are essential for pollen germination and pollen tube formation. In tomato pollen, proline is a dominant free amino acid (> 70 %), and a proline transporter L e P r o T l was observed to be expressed in mature and germinating pollens (Schwacke et al., 1999). On the other hand, GUS activity in an A t N R T 2 . 6 - G U S plant was found primarily in pollen grains in flower buds, suggesting that nitrate might be important for pollen development. One might argue that plants can grow and reproduce without nitrate as a N-source. However, nitrate can be stored at concentrations exceeding 100 m M in tissues (Glass and Siddiqi, 1995), whereas ammonium, another major N-source, may be toxic when accumulated to this level (Brito et al., 2001). Therefore, given that pollen requires large amounts of N during its entry developmental stage, it might be advantageous for plants to have nitrate transporter in pollen in order to gain high concentration of N when it is available. Further investigation needs to be done to address this hypothesis. In conclusion, the NRT genes investigated in this study and reported data of A t N R T l . 2 showed different tissue-specific expression patterns. In other words, the NRT gene family members are not genetically redundant. Rather, each nitrate transporter seems to be involved in a specific localized function. Of course some regions of roots are targets for more than a one gene (e.g., A t N R T l . l , 2.1, and 2.4 in the root tips; A t N R T 2 . 1 , 2.4, and 84 2.6 in epidermis and cortex cells in mature regions of roots). Each encoded transporter might have different Km and Kmax values (as distinct from the differences between high- and low-affinity transporters). A s p e r g i l l u s n i d u l a n s contains two high-affinity nitrate transporters, NrtA and N r t B , which show 61 % identity (Unkles et al., 1991, 2001). Mutant analysis revealed that Km values for the NrtA and NrtB transporters were 108 u M and 11 uM, respectively (Unkles et al., 2001). C h l a m y d o m o n a s r e i n h a r d t i i also has two high-affinity nitrate transporters, CrNRT2.1 and CrNRT2.2, with Km values of 1.6 and 11.0 uM, respectively (Galvan et al., 1996). The role of such closely related proteins (apparently) differing only in their kinetic properties is still unclear. 85 5 Functional Aspects of Nitrate Transporters 5.1 Introduction Nitrate transport systems fall into three groups, constitutive high-affinity transporter system (cHATS), inducible high-affinity transporter system (iHATS), and low-affinity transporter system (LATS). The cHATS and iHATS typically operate in the range of 10 to 250 uM NO3", while the LATS only becomes evident above these concentrations. At such concentrations total uptake rates for NO3" are the sum of these three transporter activities (Siddiqi et al., 1990; Glass et al., 1992). The induction pattern of HATS would vary depending on external NO3" concentration, growth condition, and species or even varieties (Siddiqi et al., 1989). A typical NO3" induction period to maximize NO3" influx is 6-12 hours in barley (Siddiqi et al., 1989; Vidmar et al., 2000). In spruce it took three days to induce maximum NO3" influx (Kronzucker et al., 1995). 3-week-old Arabidopsis plants (ecotype Columbia), grown on ammonium citrate, showed a peak of NO3" influx from 100 UM NO3" after 3 h induction by ImM NO3" (Zhuo et al., 1999), whereas 6-week-old 86 Arabidopsis (ecotype Wasselewskija) displayed a peak NO3" HATS influx after 12 h of induction with 4mM NO3" (Cerezo et al., 2001). The transcript abundances of A t N R T l . 1 and the patterns of high-affinity nitrate influx showed high correlations, suggesting that A i N R T l . l is primarily responsible for iHATS activity (Zhuo et al., 1999; Lejay et al., 1999). This conclusion was substantiated by the recent finding that a T-DNA mutant, lacking AtNRT2.1 and a part of 2.2, lost about 70% of high-affinity NO3" uptake capacity compared to the WT plants, while LATS transport was unaffected (Filleur et al., 2001). The green alga C h l a m y d o m o n a s r e i n h a r d t i i has at least three genes that are involved in high-affinity nitrate transport, CrNRT2.1, CrNRT2.2, and NAR2, located within the same gene cluster containing other nitrate-regulated genes (Quesada et al., 1994; Galvan et al., 1996). CrNRT2.1 and CrNRT2.2 show high homology with N r t A , a high-affinity nitrate transporter in A s p e r g i l l u s n i d u l a n s , while NAR2 is a much smaller gene sharing no sequence homology with the NRT2 or NRT1 families. A C h l a m y d o m o n a s mutant lacking CrNRT2.1, CrNRT2.2, and NAR2 was incapable of high-affinity NO3" transport. When this null mutant was transformed with various combinations of these three genes, it was reported that high-affinity NO3" transport was restored by combination of NAR2 together with either CrNRT2.1 or 2.2. Thus NAR2 appears to be obligatory for high-affinity transport by NRT2.1 and NRT2.2, although the manner of the interaction between these two gene families is unknown. NO3" influx in the LATS range increases linearly along with external [NO3"]. As well, LATS was considered to be repressible but not inducible (Glass and Siddiqi, 1995). In Arabidopsis, however, LATS appeared to have two components, namely a constitutive LATS (cLATS) and an inducible LATS (iLATS) (Huang et al., 1999). Recent observations 87 with chll mutants exhibiting defective L A T S , suggest that NOV uptake at concentrations typical of the HATS range (<250 uM) is also reduced, leading the authors to propose that the so-called LATS transporters, formerly considered to be low-affinity, may function both as LATS and HATS (Huang et al., 1996; Wang et al., 1998). To characterize the functions of particular gene products, one common approach is the use of heterologous expression systems. NrtA from A . n i d u l a n s was expressed in Xenopus oocytes, and caused cell membrane depolarization when oocytes were subjected to NO3" treatment, suggesting that NO3" was transported across the cell membrane (Zhou et al., 2000). However, plant NRT2 genes failed to cause membrane depolarization or nitrate uptake when expressed in oocytes (Forde, 2000). As well, expressing A t N R T l . l in A . n i d u l a n s failed to complement a nitrate transport defective mutant (nrtA nrtB) (Okamoto et al., unpublished). These results suggest that the plant NRT2 nitrate transporters may not function by themselves. Similar experiments were undertaken to express CrNRT2.1, a high-affinity NO3" transporter from C. r e i n h a r d t i i in Xenopus oocytes (Zhou et al., 2000). When C r N R T l . l mRNA was injected into oocytes, NO3" transport activity was not detected. However, when C r N R T l . l was co-expressed with N A R 1 , the oocytes showed NO3" uptake. Interestingly, expressing NAR1 alone in oocytes resulted in increased mortality of oocytes (Zhou et al., 2000b). These circumstantial lines of evidences suggest that some NRT2.1 transporter(s), but apparently not the A . n i d u l a n s transporter, require co-expression of NAR2-like proteins in order to be functional. Interestingly, A t N R T l . l - or A t N R T l . 1 -injected Xenopus oocytes were able to show membrane depolarization and (presumably) 88 nitrate uptake activities by themselves (Tsay et al., 1993; Huang et al., 1999). This further emphasizes differences between these two families of nitrate transporters. The aim of this Chapter is to present physiological responses of Arabidopsis plants to nitrate induction treatments, and to confirm the presence of each physiologically defined nitrate transporter systems (i.e., iHATS, cHATS, iLATS, and cLATS) by 1 3 N 0 3 " tracer experiments. Also, the occurrence and expression patterns of NAR2 homologues in A. thaliana were investigated. Finally an outlining hypothesis of a mechanism for NO3" transport depending upon co-regulation of NRT2 and NAR2 proteins will be discussed. 5.2 Materials and Method Plant growth condition Same as for Chapter 3. 1 3NC*3" influx experiments Nitrate influx using 1 3NC»3" was measured as described before (Zhuo et al., 1999). The basic components of the solution for pretreatment, influx, and washing were the same as those of the growth media. The plants were pretreated with solution containing either 100 u M or 5 m M 1 4 N 0 3 " for 5 min, then transferred for 10 min to the influx solution which had each NO3" concentration labeled with 1 3 N03 _ . After the influx period, plant roots were washed with "cold" solution (same as pretreatment) for 3 min to remove 13NC>3" from the cell wall, 89 followed by counting N contents with a y-counter (MlNAXI y Auto-Gamma 5000 series, Packard Instruments, Meriden, CT). RNA isolation and RT-PCR RT-PCR was performed according to the method described in Chapter 3. Primers sets, NAR2./Forward: 5' A G G A C C A G G T G T T G T T T T G G A T G C C , NAR2. /Reverse: 5' A C T G A A A C A G A T G G A G G C A A T A T C T A G G G A , amplifying a product size of 421bp. The amount of total R N A used in the PCR was 250 ug in the total volume of 12.5 ul of the reaction mixture. PCR cycle numbers for AtNAR2.1 were 21 and 30 for roots and shoots, respectively. Bioinformatics Phylogenetic analysis: C L U S T A L W or X was used for an initial amino acid sequence alignment analysis (Thompson et al., 1994, 1997). The alignments were then finely adjusted and gaps were removed with Bioedit (Hall, 1999). Phylogenetic analysis was carried out with PAUP 4.0b5 (http://www.lms.si.edu/PAUP) with following condition: bootstrap method with heuristic search; otimality criterion = distance; starting tree(s) obtained via neighbor-joining; branch-swapping algorithm = tree-bisection-reconnection (TBR). Tree View (http://taxonomy.zoology.gla.ac.uk/rod/rod.html) was employed to output the phylogenetic trees. Other methods: 90 Same as for Chapter 2. 5.3 Results and Discussion N03" Influx by H A T S and L A T S Nitrate influx by Arabidopsis roots was measured at low (100 uM) and high (5 mM) external NO3"concentrations, representative of the high- and low-affinity NO3" transporter systems (HATS, and LATS, respectively), using 1 3 N0 3 " , at intervals of time after the initial exposure to ImM NO3". Prior to exposure to 1 mM N0 3 " , there was already a substantial HATS influx of 2.5 umol g" ]FW h"1 at 100 u M NO3". This is considered to be due to the constitutive HATS (cHATS) (Figure 5-1 A). After provision of 1 mM NO3" in the external media, influx via the HATS increased continuously for 6h, peaking at a value that was 2.5 times the constitutive value. After 12 hours, the flux steadily decreased down to 2 umol g"1 FW h"1 by 72h, a value that was similar to the original (Oh) value (Figure 5-1). Figure 5-2A shows that nitrate influx from media containing 5 mM external NO3" also increased initially and subsequently declined. Both HATS and LATS are considered to contribute to NO3" influx at 5 mM (Glass et al., 1992; Lejay et al., 1999). To estimate LATS-mediated influx as distinct from the HATS influx, flux values due to the HATS activity were subtracted from those measured at 5 mM, corresponding to both HATS and LATS influx, presuming that the root influx from 100 u M was close to the for HATS influx, and that the HATS contribution remained unchanged at the two external concentrations (Figure 5-2B). These 91 h 8 5 I CO i o1—« • • l-^ 0 24 48 72 Duration of induction (hour) Figure 5-1. Time-course of 1 3NC»3" influx into Arabidopsis roots at high-affinity range. High-affinity nitrate influx measured with 100 uM NO3". 6-week-old plants were N deprived for 7 days before being transferred to ImM NO3" solution for 0 to 72 hours. The values are the means of 8 replicates, and vertical bars indicate SE. 92 15 A Duration of induction (hour) Figure 5-2. Time-course of 1 3NC»3" influx into Arabidopsis roots at low-affinity range. (A) Low-affinity nitrate influx measured with 5 mM NO3". 6-week-old plants were N deprived for 7 days before being transferred to ImM NO3" solution for 0 to 72 hours. (B) LATS activity at 5 m M NO3". To estimate LATS mediated nitrate influx, mean values at 100 u M (data from Figure 5-1) subtracted from those at 5mM. The values are the means of 8 replicates, and vertical bars indicate SE. 93 "corrected" values for LATS influx were initially < 1 umol g ! F W h"1 (at 0 h) but showed a rapid induction after NO3" provision, reaching a peak of 8 umol g ~ ! FW h"1, at 24 h. This was followed by a slow down-regulation (Figures 5-2A and 5-2B). In summary, the cHATS influx (Oh-plants) was higher than the constitutive LATS (cLATS). Induction of both HATS and LATS by NO3" was rapid, but times of peak activity and flux values were different. Furthermore, down-regulation in HATS appeared earlier and faster than that in LATS. AtNRT Families and High- and Low-affinity Nitrate Transport System iHATS Transport It is evident from the foregoing results, that not all members of the NRT2 family of genes can be characterized as nitrate-inducible. On the basis of correlations between physiological patterns of NO3" influx arid corresponding patterns of gene expression, it has been suggested that the NRT2.1 protein probably plays a major role in inducible HATS in A r a b i d o p s i s (Zhuo et al., 1999; Lejay et al., 1999), N. p l u m b a g i n i f o l i a (Krapp et al., 1998), soybean (Amarasinghe et al., 1998), and barley (Glass et a l , 2001). Our present data also showed that AtNRT2.1 transcript abundance in roots corresponded closely with the temporal patterns of 1 3 N03 _ influx in the HATS range following provision of NO3" to N O 3 -deprived plants (Figures 3-2B and 5-1). In fact, AtNRT2.1 was the only one which showed statistically significant positive correlation among NRT genes (Table 5-1). 94 Table 5-1. Coefficients of determination (r2) for the relationships between AtNRT gene expression levels and two nitrate transport systems. Gene r2' HATS LATS AtNRT2.1 0.55** 0.62 AtNRT2.2 0.22 0.04 AtNRT2.3 0.62** 0.17 AtNRT2.4 0.01 0.26 AtNRT2.5 0.03 0.18 AtNRT2.6 0.22 0.19 AtNRT2.7 0.11 0.72** AtNRTl.l 0.32 0.77** AtNRTl.2 0.04 0.16 AtNRTl. 3 0.00 0.27 AtNRTl.4 0.06 0.06 * Regressions were based on measurements of seven intervals (HATS; data from Figure 5-1), or six intervals (LATS; data from Figure 5-2) during nitrate induction period of 72 h. Negative correlations were underlined. **P<0.05 95 Recently, atnrt2, a T-DNA knockout mutant in which AtNRT2.1 and the 3' end of A t N R T 2 . 2 were deleted, has been characterized (Filleur et al., 2001; Cerezo et al., 2001). 15NC>3" influx associated with iHATS activity of this Arabidopsis mutant was reduced to ~ 30 % of that of WT plants, while the LATS activity was relatively intact (Filleur et al., 2001). Although the data presented did not allow the authors to categorically distinguish which of the two genes, AtNRT2.1 or A t N R T 2 . 2 , was the predominant contributor for iHATS at this stage, they were, nevertheless, able to conclude that these genes represent the major players (Cerezo et al., 2001). Our findings support this conclusion and further, as shown in Figure 3-2B, suggest that the pattern of AtNRT2.1 expression most closely corresponds with the pattern of iHATS influx. A t N R T 2 . 2 expression pattern did not match the iHATS profile except during the first 3 hours. After 3 hours of NO3" provision the expression of AtNRT2.2 was rapidly reduced compared to AtNRT2.1 (Figures 3-2D and 5-1). Thus, AtNRT2.1 appears to be a more likely candidate for iHATS influx. Despite the identification of two distinct families of genes, NRT1 and N R T 2 , encoding low- and high-affinity NO3" transporters, respectively, it has been suggested that A t N R T l . l (CHL1) should receive the status of a dual-affinity nitrate transporter (Crawford and Glass, 1998; Liu et al., 1999; Wang et al., 1998). This proposal is based on two observations: (1) Defective N03" transport by both the HATS and LATS in A t N R T l . l mutants grown on NH4NO3 (but not on KNO3), and (2) Heterologous expression of A t N R T l . l in Xenopus oocytes resulted in both HATS and LATS activities (Touraine and Glass, 1997; Wang et al., 1998; Liu et al., 1999). Since our observations were also based on NH4N03-grown plants, A t N R T l . l protein might also be involved in the measured iHATS activity (Figures 3-3B and 5-1). 96 cHATS Transport Figure 5-1 shows that A r a b i d o p s i s plants have substantial cHATS activity in un-induced plants (i.e., 2.5 umol g _ 1 FW h"1), as was the case in soybean plants (Amarasinghe et al., 1998) and in Steptoe barley (King et al., 1993). On the other hand, other barley varieties and spruce tend to have relatively small cHATS capacities (Siddiqi et a l , 1990; Glass and Siddiqi, 1995; Kronzucker et al., 1995). Despite the disruption of AtNRT2.1 and AtNRT2.2 in the atnrt2 mutant (Filleur et al., 2001), cHATS activity was almost the same as that of the WT in uninduced plants, suggesting that AtNRT2.1 and AtNRT2.2 make no contribution to cHATS activity. In N03'-treated plants, this cHATS was even slightly increased by NO3" treatment (Filleur et al., 2001; Cerezo et al., 2001), consistent with earlier reports in barley and white spruce (Aslam et al., 1992; Kronzucker et al., 1995). Surprisingly, when grown on 1 mM NH4NO3 for 5 weeks, and then on 1 mM N 0 3 " for 1 week, 1 5 N 0 3 " influx in the mutant was maximally reduced at -25 u M , while at lower (10 uM) and higher concentrations (100 uM) 15N03~ influx was not as strongly reduced. The authors interpreted these observations to suggest that transporters other than AtNRT2.1 and AtNRT2.2 contribute to influx at very low NO3" concentrations (Cerezo et al., 2001; Cerezo et al., 2001). CHATS candidates might be expected to satisfy two characteristics: (1) relatively high transcript abundance prior to exposure to NO3", and (2) modest up-regulation of this transcript following induction by NO3", the latter based on the documented increase of cHATS influx following this treatment (Aslam et al., 1992; Kronzucker et al., 1995). 97 Although several members of the NRT2 and NRT1 family, e.g. A t N R T l . 3 , 1 . 4 , 1 . 5 , 1 . 6 and 1.7 satisfy the first criterion, only A t N R T l . 4 also meets the second criterion, making it a viable candidate for the cHATS activity. Wang et al. isolated a mutant, which was impaired only in the cHATS transport in roots of Arabidopsis (1998). It will be interesting to see if this mutation is located in one of the above-proposed candidates. LATS Transport Low-affinity transporter systems were originally thought to be either constitutive or repressible on the basis of flux analysis in barley (Glass and Siddiqi, 1995). However, the A t N R T l . l (CHL1) gene, considered to encode a low-affinity NO3" transporter in Arabidopsis, was induced by nitrate (Tsay et al., 1993). These contradictory findings may have been resolved by the demonstration that Arabidopsis possessed both an inducible- and a constitutively-expressed member of the NRT1 family (Huang et al., 1996; Lejay et al., 1999; Liu et al., 1999). Our present findings confirm this, and also suggest that one member of the NRT1 family is nitrate-repressible. However, the function of a nitrate-repressible NRT1 gene is unclear at present given that our physiological evidence demonstrates only cLATS and iLATS (Figures 5-2A and 5-2B). As expected, A t N R T l . l showed a NO3"-inducible expression pattern in roots, and the pattern corresponded well with the observed LATS activity (Figures 3-3B and 5-2B). A t N R T l . l also showed the highest correlation (r2 values 0.77) against the LATS activity (Table 5-1). Other members of the NRT1 family were either constitutively ( A t N R T l . l and 1.4), or repressively expressed (AtNRTl.3), indicating that these three transporters are unlikely to be major contributors to the iLATS. Rather A t N R T l . l and/or AtNRT 1.4 may encode the cLATS. 98 According to Liu and Tsay (personal communications) the A t N R T l . 1 (CHL1), a putative dual affinity transporter, switches between high and low-affinity through protein phosphorylation. This surprising finding adds even greater complexity to the existing situation vis a vis the 7 NRT2 nitrate transporters and the 4 NRT1 transporters. In the present study, although at the transcript level AtNRT2.1 and AtNRTl. 1 behaved similarly, there were distinct differences between patterns of HATS and LATS influx: (1) the iHATS peaked at 18 hours earlier than the LATS; (2) the iHATS influx was reduced to the original influx value after 72 h of NO3" exposure, whereas LATS remained considerably higher (5.1 umol g _ 1 F W h"1) than its original value (<1 umol g ~ ! FW h"1) even after 72 h (Figures 5-1 and 5-2B). Thus at the physiological and molecular levels, the two nitrate transport systems (Wang and Crawford, 1996) not only co-exist but they appear to be differently regulated. Nevertheless, both HATS and LATS have constitutive and inducible systems. Shoot and Root Differences and Similarities Roots are considered to be the main organ for nitrogen uptake by terrestrial plants, and have consequently been the focus of attention in studies of N 0 3 " transport. By contrast, only a few studies have reported on ion transport by shoot tissue. Nitrate translocated to shoots is released from vascular tissue to the leaf apoplasm before being re-absorbed by leaf cells. In consideration of the thermodynamics of NO3" transport even when apoplasmic NO3" is in the high mM range (>20 mM) the NO3" re-absorption step in leaves would be active, requiring a source of free energy (presumably the proton motive force) and appropriate transporters (Glass and Siddiqi, 1995). Based upon typical analyses of apoplasmic [NO3"], 99 leaf re-absorption would most likely be mediated by low-affinity nitrate transporters. In fact, all members of AtNRTl family showed relatively high expression level in the shoots in our present study. Furthermore, a recent study of AtNRTl.l showed high levels of gene expression to be present in the developing organs of entire plants including leaves and flowers (Guo et al., 2001). These observations provide support for the rationale that nitrate uptake by shoot tissues is vitally important for the assimilation of NO3" by leaf tissues. Nevertheless, i f this is mediated by low-affinity transporters, the question remains: what is the relevance of the observed expression patterns of NRT2 transporters in shoots? In Limium and Bromus, the concentrations of leaf apoplastic nitrate varied from 0.11 mM to 2.38 m M in N-deficient and N-replete plants, respectively (J. Schjoerring, personal communication). This suggests the possibility that as apoplasmic NO3" declines from mM to u M concentrations, as for example under field conditions as external supplies of NO3" are depleted, high-affinity transport systems may be necessary to scavenge apoplasmic NO3" from the latter range of concentration. This argument suggests that both the NRT2 and NRT1 transporters may participate in the re-absorption of NO3" by leaf cells. Gene Structures and Functions- C a n we predict functions from sequence homology? 13 Using the differential patterns of gene expression and documented patterns of NO3" influx, we have attempted to attribute known transport functions (cHATS, iHATS, cLATS, and iLATS) to particular nitrate transporter genes identified from A. thaliana. Although we are as yet unable to ascribe functional roles to all members of the NRT1 and NRT2 families of genes, in a limited number of cases e.g. NRT1.1 and NRT2.1 and NRT2.2 (Cerezo et al., 100 2001) there is sufficient evidence to allow reasonable predictions concerning functions to be made. Genes with high sequence homology might be anticipated to perform similar functions. Figure 5-3 shows amino acid sequence comparisons among known NRT2 family members from various organisms. In A r a b i d o p s i s nitrate-inducible genes A t N R T l . I , 2.2, and 2.4 have high sequence similarity, and it is reasonable to assume that their functions might also share some similarities. Another homologous duo AtNRT2.3 and 2.6 also showed some similarities in the expression patterns, although the functions are unknown (Figures 3-5D and 3-5E). Most of the cloned NRT2 family members from higher plants (e.g. from N. p l u m b a g i n i f o l i a , soybean, A r a b i d o p s i s , and tomato (Amarasinghe et al., 1998) were nitrate inducible (Figure 5-3), and exhibited high sequence homology with AtNRT2.1 and 2.2 proteins. Thus these transporters may function as iHATS (Quesada et al., 1997; Trueman et al., 1996; Zhuo et al., 1999). Similarly, nitrate-inducible A t N R T l . I has high sequence similarity with BnNRT1.2 that is also induced by nitrate (Muldin and Ingemarsson, 1995; Zhou et al., 1998). Likewise, A t N R T l . 2 from A . t h a l i a n a (Huang et al., 1999; this work), O s N R T l . l from Oryza sativa (Lin et al., 2000) and G m N R T l . 3 from Glycine max (Yokoyama et al., 2001) are constitutive genes and these three genes encode proteins that have closely related amino acid sequences (Figure 5-4). Therefore, these transporters may serve as cLATS. Clearly greater details of function will be necessary in order to develop useful predictions. Gene Structures and Predicted Protein Sequences of AtNAR2 Genes NAR2 genes may be involved in nitrate transport system in higher plants as has been demonstrated for the alga C. reinhardtii. A homology search was performed using the 101 100 100 61 74 100 89 69 100 65 1001 95 100 HvNRT2.1 * HvNRT2.3* HvNRT2.4* 72r-TaNRT2.1 -n-TaNRT2.2 1 — TaNRT2.3 HvNRT2.2 * OsNRT2 i o o r - L e N R T 2 . 1 * 1 0 °P-LeNRT2.2* 1 — N p N R T 2 * 1 LeNRT2.3 ioo r~ G m N R T 2 * 95 | LJNRT2 54r-AtNRT2.1 * i o o p - A t N R T 2 . 2 * — — — BnNRT2.1 1 AtNRT2.4 * ioo r - AtNRT2.3 -L AtNRT2.6 -AtNRT2.7 AtNRT2.5-Chlorella CrNRT2.1 * ioo j - CfNATI * L CfNAT2 * NrtA(crnA)* A n N R T B * N.crassa Hebeloma YNT1* E.coli narK* 1001— Figure 5-3. Sequence relationships of NRT2 family. Amino acid sequences were aligned with C L U S T A L X and BIOEDIT, the neighbor-joining trees were generated with PAUP 4.0b8. Bootstrap values are shown in branching positions. Nitrate-inducible and nitrate-constitutive genes are indicated with asterisks and (-), respectively. Sequence sources: Arabidopsis thaliana (accession numbers: see Table 1); Aspergillus nidulans, NrtA(crnA)(M61125), NrtB(AF453778); Brassica napus, BnNRT2(CAC05338); Chlamydomonas reinhardtii, CrNRT2.1(Z25438); Chlorella sorokiniana (AY026523); Cylindrothecafusiformis, CfNATl(AF135038), CfNAT2(AF135039); Escherichia coli, nark(X15996); Glycine max, GmNRT2(AF047718); Hebeloma cylindrosporum (AJ238664); Hordeum vulgare, HvNRT2.1(U34198), HvNRT2.2(U34290), HvNRT2.3(AF091115), HvNRT2.4(AF091116); Lotus japonicus, LjNRT2(AJ292342); Lycopersicon esculentum, LeNRT2.1(AF092655), LeNRT2.2(AF092654), LeNRT2.3(AY038800); Nicotiana plumbaginifolia, NpNRT2(Y08210); Neurospora crawa(b8gl2_170 in the MIPS N.crassa database; http://mips.gsf.de/); Oriza sativa, OsNRT2(AB008519); Pichia angusta, YNT1(T43154); Triticum aestivum, TaNRT2.1(AF288688), TaNRT2.2(AF332214),TaNRT2.3(AY053452). 102 100 61 92 89 I 100 100 60 100 100 100 100 90 N p N R T H LeNRT1.1 -NpNRT1.2 LeNRT1.2* BnNRT1.2* • A t N R T l . 1 * OsNRT1.2 A tNRT l .4 A tNRT l .3 OsNRTI .1 -A tNRT l .2 -— GmNRT1.3-— OsNRT1.3 1001 i—GmNRT1.1 GmNRT1.2* GmNRT1.5 GmNRT1.4 Figure 5-4. Sequence relationships of NRT 1 family. Amino acid sequences were aligned with C L U S T A L X and BIOEDIT, the neighbor-joining trees were generated with PAUP 4.0b8. Bootstrap values are shown in branching positions. Nitrate-inducible and nitrate-constitutive genes are indicated with asterisks and (-), respectively. Sequence sources: Arabidopsis thaliana (accession numbers: see Table 1); Brassica hapus, BnNRT1.2(U 17987); Glycine max, GmNRTl.l(BAB19756), GmNRT1.2(BAB19757), GmNRT1.3(AB052786), GmNRT1.4(BAB 19759), GmNRT1.5(BAB19760); Lycopersicon esculentum, LeNRTl.l(X92853), LeNRT1.2(X92852); Nicotiana plumbaginifolia, NpNRTl.l(CAC00544), NpNRTl:2(AJ277085); Oriza sativa, OsNRTl . l (AF 140606), OsNRT1.2(AC037426), OsNRT1.3(AP003263). 103 sequence of the CrNAR2 protein against the Arabidopsis gene database, and two homologues were found, namely AtNAR2.1 and A t N A R 2 . 2 (Figures 5-5 and 5-6). AtNAR2.1 is located on chromosome 5. It is interrupted by one intron (291 bp), and encodes 210 amino acids with M W of 23.4 kD. In the promoter regions there are two nitrate-dependent transcriptional motifs at -78 and -325, a putative T A T A box, and several GATS boxes. AtNAR2.2 also consists of one intron (298 bp) and two exons (142, 485 bp), coding polypeptides of 209 amino acids (23.3 kD) on chromosome 4. The nitrate-dependent transcriptional motif was only observed far upstream (-1322) of the NAR2.2 gene. This may not be functioning because of the location (i.e., typically -140 to -250 bp upstream in Arabidopsis; Hwang et al., 1997). SignalP (Nielsen et al., 1999) predicted that both NAR2 proteins possess signal peptides, cleaving between amino acid 22 and 23. These predictions were also supported by PSORT program (Nakai and Kanehisa, 1992). One transmembrane region was predicted at the C-termini, leaving a long hydrophilic N -terminal end that is exoplasmic (Figure 5-7). NAR2.1 and 2.2 proteins share 61 % of identity and 76 % of similarity. In N-terminus TonB-dependent receptor protein signatures "TonB-Box", [DENF]-[ST]-[LIVMF]-[LIVSTEQ]-V-x-[AGP]-STANEQPK], were observed in NAR2.2 in high degree, and in NAR2.1 with less conservation (Figure 5-7). The function of TonB, a periplasmic protein in Gram-negative bacteria, has been suggested in following way. TonB, dimerizing at C-termini interacts with outer membrane receptor proteins providing energy, and the receptor proteins execute high-affinity binding and transport of substrates through the plasma membranes into the periplasmic space (Chang et al., 2001). The substrates include iron, colicin, and vitamin B12 (Bassford et al., 1976; 104 1500 CAGAGAAGAGGTACGAGTAAAAGAAACAAAAGTGACTTAGGAAACGCCATTGTTGGAGACTGCTCACTGGAAGATAGAGAGT 1418 CGTGAGAGACAGTGATAAAGCGTATCAAGTCATATAGAGGGTCTTCTTATCTTTTTCTTTAACATGTGAGGGTTGAGTTAAT 1336 TATGCGGGCTGATTATAGAGTTTTTAAATTGAATTTACGATTGTTTTTTTCTTACATATAAATGCAATCTATATTTGTGTTC 1254 GGAATAACCCATCTAATATTACTCCATGTATTAAACTAAAATATTTTGCATGTTTTGGTAGATCAACTTTTTGAATGATCAC 1172 AGACCTACAAACATCAACCCTCTAATTATCCAATTTTACCATAATCCACGAGCTCTTAAAATTCATTTTTAATATATATAAT 1090 TAAAATAGTTCAAACAGTTTAAACTTTGTGACCAAGTTAAAATATTTAAAATAGTTTGACTTTGTGATCAACATATTTAAAT 1008 ATAATCAATATTTTCATTTTTAAGCCGGAAAATCACGTCTTACAAATATATTTCTGATAGACACACCTATAATTCCAAAATT -9 2 6 TTGACTTTTAAAACAAACAAAAAAAAATCTCATTAATACCACTACATACGTTTTTACAAAAATACCATTAAAAGATATTTTT -844 TCAAATACTAAAAAAAACTAAAACTAAACTTTAAACCTATAAAACACTAAATCCTATAAAGTTTATATTCGAGTATAAACCT -762 TAAAAGTTCAACCCTAAATCCTGAAAGCAAGACCCTAAACCCAAACTCAAACTTTTAAATTATAAATCCTTAAACAAAATCA -680 TTTTTAGTCTTTATGGTATTTTTAGAGTTAACAGTTTGTAGTTGTATTTTTGAAAAAAAAACACTAGTGATAGGTTTTTAGA - 598 ATAAAAACTTAATTTAGTGGTATTGAGGATATTTCTCTAATAAAAATTATTCACAAAAAATATGTATTAAAGCAAAGTGCTA -516 TGCTTATTCCATGCAATCTTTTTTGAAAAAAAAAATATTTTCTAACCGATTAGTATATCTTCTAGAGGATTCATAGAAAAAG -4 3 4 AGGATACAATTACAATATGTAGAGTATCTTATAGGTGACGTAACCATGAAATATAGAATTCTTTGGAATCTGAAACTGAATT -352 ATTCAGTTGATAAATGATAAAACAAATACTCATATCTCATCCTTTGGCATGTTTAGGAGCCATCTCTCAGCTGGACGGAGAC -27 0 AACACAGACACTTGTGCCAGAGAGGGAACACAATCTTCCCAAGTCTTCGAAAGGGTAATCTCAGACCAAACCGTTGACTTTG -18 8 TTCTCATTAATTGTTTATGCTAAACCACAAGATATTTGGATCAAAAGTATTACCATAAATCACTATATAAAGACATAAATGT -10 6 GCACCCCACTTTTCTTATCAATCATAAAAGTCAGCAAAACACAAGGCATATTCCTCTTCTCTTCCTCAGCCTTATTTTTCTG -2 4 ATATTCAGTTTCAAGGATATATCCATGGCGATCCAGAAGATCCTCTTTGCTTCACTTCTCATATGCTCACTGATCCAATCCA M A I Q K I L F A S L L I C S L I Q S I 2 0 59 TCCACGGGGCGGAAAAAGTAAGACTCTTCAAAGAGCTGGACAAAGGTGCACTTGATGTCACCACTAAACCCAGCCGAGAAGG H G A E K V R L F K E L D K G A L D V T T K P S R E G 47 141 ACCAGGTGTTGgtatgtataattctcttcaaaacatctatcatttgctacttcattagccatgcottataaatgtgcgattt P G V V 51 223 tgctctaataccatgttagattttaaagctttatgaatgttaagacaaatttttatgagtgttggaaacattagttctcttt intron I 305 agtcgtttattacaacatcattagatcttatcctattaattagaattacttagaattaagtgatatgaatgatagtatgatc 387 taatatcaatttacaagaataagttggaattaatattttgaatgtttggtctttagTTTTGGATGCCGGCAAGGATACGTTG L D A G K D T L 59 469 AACATTACATGGACGCTAAGCTCGATTGGGTCTAAAAGAGAGGCTGAATTTAAGATCATCAAAGTTAAGCTATGCTACGCTC N I T W T L S S I G S K R E A E F K I I K V K L C Y A P 8 7 551 CACCTAGCCAAGTTGACCGACCATGGCGCAAAACCCATGACGAGCTCTTCAAAGACAAGACCTGCCCACACAAGATCATAGC P S Q V D R P W R K T H D E L F K D K T C P H K I I A 114 633 CAAGCCTTATGACAAAACACTTCAATCAACTACTTGGACTCTTGAGCGTGACATCCCCACCGGAACCTACTTCGTTCGTGCC K P Y D K T L Q S T T W T L E R D I P T G T Y F V R A 141 715 TACGCGGTTGATGCCATTGGCCATGAAGTTGCCTATGGACAGAGCACCGACGATGCCAAGAAAACCAATCTCTTCAGCGTTC Y A V D A I G H E V A Y G Q S T D D A K K T N L F S V Q 169 797 AGGCTATCAGTGGCCGCCACGCGTCCCTAGATATTGCCTCCATCTGTTTCAGTGTCTTCTCCGTCGTGGCTCTTGTCGTCTT A I S G R H A S L D I A S I C F S V F S V V A L V V F 196 879 CTTTGTCAATGAGAAGAGGAAGGCCAAGATAGAGCAAAGCAAATGAGTCGTTTACTTTGCGTATTTGTGACGTTGAACCCAA F V N E K R K A K I E Q S K * 210 961 AAAAAGTTGACTTTGAACTTTCTTGTTTACCAATTCCTTTTGTCTTGTTGCACACTTCTTCTTTCTTATATGCTTTTATTTA 1043 TGTGTTTGTACAATTAAGCCATTGATATGGAACAAAACTAATCCTACGGTGGTGATGCGTTTGTGTGCTTTATATATTTTTT 1125 ATACACCTTTTGATATATTCTTACACACTTTTTTCACAAAGATTGATATTTGCATAATTTGTGGTAATCATTCTCAAAATAC 1207 GGTATATATACTTCACCTCTTACTTTCAAAGAGAAATCATAAGTATAACTAAGCAATAATTCTATATATAGGGAATTATGAT 1289 ATAAAATTTATCCAAATTTTCAAAATATTAAACAAA Figure 5-5. D N A and deduced amino acid sequence of the AtNAR2.1 gene. The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. G A T A boxes are underlined. T A T A box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 105 1336 TTGCACTATGAGATAGTCATCAACTATCAGAGAGAAGACTCTTCCTCCAACAGACATTTTTTTGATGAGAAGCTGAATTGGT 1254 GATGTGGGCAGTAGCTCCTGTGTCTGGAAGACTGACTTTGATCTGACACCCTCATAGCAGCCAGAGCATTATGTAGATTTTC 1172 AGGCTGGTAGTCATGTTTTAAACCTGTTGTGACACTTGAATGCAGAGTGCCCATATCTACCACATATCTGACTTGTAGGTTT 1090 TTGTCCAGATCCAGAACCTGTGCTTGAACCTGATCCAAACTGTTGCTGGAAACCTCTACCACGGGAATCATTATAGCCTCCA 1008 CGAGTATAGTATGCTTTCTCAATGTGATATGCCATGTGAGGAGTGACTTCAGAGGGAGAATTAGCATAGGCTATTAACTTAT -92 6 AATCAAAGGCTGTGAGTTTATGCACCACATCATCAAAACAAGGACCAGGATAGAGATTTAGATAGTGCTCTATCACAGTTGC -844 CACAGACTCATGTTCCGTGCCTAATCCGTTTAGAACCCCATAAAAATTCTCTTGTACTTGTTCTCTTGATAAAACCTTCTGT -762 CGGAGGAAGAGTCTTCCCTCTGATATCAACAAGGCTTATGAGTTCGATTGCAAAGCAAATACTGTAGCCCGTTTTATGTAGC -680 AATTACTAATTTGATTCCAAATTTAGTAATTCCCTAGGAAGTAAGGAAAGTGTAACTGTCTTGCTGAATCCTTTTGGTGAGT -598 CTACACTTCACAGAAGTTCGGGGTTGAATCGAAGCAGTTGCAATCCTGTTTGTAATATTCACTAATAATTCACAAGTGCGTG -516 ATTCAAAAATGCTGCATAAGCCAACATCATAAAGAGAATTTATTGGGAGACTGCTTTAGCTAGCAAACTTAGTGCATACTTG -4 3 4 TTCTAGAGATATTTAAACTAGCACATAATTTTTTTTGATGGACCAACAATCAATCTCAGCAAAAGAAACTCAAAACCGGATT -352 TCCTGAATTAGATGTCTTCCTGAATGATCAATTATTAGATTTCCGGATTGGGATCTAAGTAAGTCCAATTGGTATGATGAGG -2 7 0 AGTTTTTTTTTTTTTTTTTTTTTTTTTCATTCTTGGGCATTGTTTTTCGTGACTGAACATTATTCGATAGATCAACTATGTT -18 8 CGTGTCGACTACCGAGTAATGGCGCCCGAAAATTCCCTTAAATTCTTCGCACTAAATGATCGCCGGTTCAAATATTGGCGTC -10 6 TAGTGGCGTTTATGTATTTAAAGATGGGCATTCTATAAATATGAGACACATGTGTGACACACATTTAGTCGTCCTCCCTTAC -24 CAAGATCACATTCTCATTCGGATCATGGCCATCCACACTCTCCTCTTCGTATCACTTCTCATATTCTCACTCATCGAGTCGA M A I H T L L F V S L L I F S L I E S S 2 0 59 GTAGTGGAGGAAAGAAAGATAGACTCTTCACCGATCTCCAAAACTCAATTGAGGTCACCGCTAAACCCGTTAAAGATAGCGG S G G K K D R L F T D L Q N S I E V T A K P V K D S G 47 141 A G g t t t g t g a a c c g t c t t a c c t t c t t t a t a a t t c a a a g a t t t t g t a c c t t a t c t a t t a t c t t t t c a a a t c c g c g a c t a a a g t V 48 223 g t g t a t t c a t a a g t a g t g a a g t t g c c c a c t a g g c t c t a a c t g t a g g t t a a g t a t a a a g a t a t a t t a c c t a t t t t a a t a c g g a i n t r o n I 305 a a a a a t a g t t a t t t t c g t t t a t a c a t c t c t a g a c t c t t t t t t t g g a a t a t a c a t g a t t t a t g a t t c a t c t c c a t a c t t g t a t 387 tat tat tat t t t tataaatctatatactcaaatt tgcacatggatgatct t tagTTTTAGAGGCTGGAAAAGATATGGTGAC L E A G K D M V T 57 469 AATTACATGGAAGCTAAAGTCGTCGTCAGCCAAGGTCGACACGGATACTGCCTTCAAGACAATCCAAGTCAAGCTTTGTTAT I T W K L K S S S A K V D T D T A F K T I Q V K L C Y 84 551 GCACCGATCAGCCAAGTTGATAGACCGTGGCGTAAGACTGATAACAAGCTCTTCAAGGACAGAAGTTGCCCTCATGAGATTG A P I S Q V D R P W R K T D N K L F K D R S C P H E I V 112 633 TGTCCAAGGCATACGACAAGACCCCCCAATCACTCGATTGGACAATCGGACTTGATATCCCCACTGGAACCTACTTCGTACG S K A Y D K T P Q S L D W T I G L D I P T G T Y F V R 139 715 TGCCTATGGAATCGATGGAGATGGCCACGAAGTTGCATACGGACAGAGCACGGATGAGGGAAGGACGACAAATCTCTTCAGT A Y G I D G D G H E V A Y G Q S T D E G R T T N L F S 166 797 GTTCATGCCATAAGTGGTCATCACGTGGGGCTAGACATAGCATCCACATTTTTCAGCGTCTTCTCCGTTGTTTCTCTGTTTG V H A I S G H H V G L D I A S T F F S V F S V V S L F V 194 879 TCTTCTTTGTCATGGAGAAGAGGAAGGCCAAGTTAGAGCAAAGGGAGTGAGTTGGATTAACTATGAGGTCTTTTGTTAAGTC F F V M E K R K A K L E Q R E * 209 961 GAATAAAAAAGCGTTTACGTCATAATTGTTCGTGTTTGTCGTTGTGAAGAAAATATATCCTTTCACTTTCCCAAAATCAATG 1043 TTAAAATGCAATAATCCTCCATATACATCTCATATAAACTAAATCTTACTTATAGAAAACCTTTTCACATAAACAAAAAGTG 112 5 AAAAGATATGATATTCAAAACAGTACTAAGTTCTCCTACGTTTTGTCACACTTT Figure 5-6. DNA and deduced amino acid sequence of the AtNAR2.2 gene. The number on the left starts at the proposed start codon, and the numbers on the right refer to amino acid residues. Intron sequences are shown in lower cases. GATA boxes are underlined. TATA box is indicated with thick underline. Nitrate-dependent transcription motifs are double underlined. 106 A t N a r 2 . 1 A t N a r 2 . 2 TonB Box 43 42 A t N a r 2 . 1 A t N a r 2 . 2 SREGPl VKDS- -BEg gTLNmgTJIs|lGS|SREAE- - g g l g l llMVTfflEKiKis S ASJVDTDT A@ST|C 84 83 A t N a r 2 . 1 A t N a r 2 . 2 fetsp i QVDRPWRK QVDRPWRKT QSHWT 127 126 A t N a r 2 . 1 A t N a r 2 . 2 170 169 A t N a r 2 . 1 A t N a r 2 . 2 LDIAS L.DIAS IC TF SSSFg Figure 5-7. Amino acid sequence alignment of AtNar2.1 and AtNar2.2. Arrow indicates predicted cleavage sites. Transmembrane regions predicted by T M H M M (Sonnhammer et al., 1998) are boxed. Potential protein kinase C and casein kinase 2 phosphorylation, and N-glycosylation sites, specified in bold letters with (*), (•), and ( A ) , respectively, were searched with the ProSite database (http://www.expasy.ch/prosite/). The serine-70 of AtNar2.1 is a recognition site for both PKC and CK2. Accession number: AtNar2.1 (BAB09391), AtNar2.2(T05562). TonB-dependent receptor signature (TonB Box) is underlined. 107 Lundrigan and Kadner, 1986; Schramm et al., 1987). The receptors fail to uptake substrates in the absence of TonB (Raynolds et al., 1980). Expression Patterns of AtNAR2.1 To examine the expression patterns of the AtNAR2 genes, relative quantitative RT-PCR was carried out. The expression patterns were revealed when PCR cycles reached at 21 and 30 in root and shoots, respectively in A t N A R 2 . 1 . For unknown reasons, AtNAR2.2 was undetectable even when cycle numbers were raised to 40 in the roots (data not shown). In roots the time-course expression patterns of AtNAR2.1 was similar to that of AtNRT2.1 (Figure 5-8). Linear regression analysis showed a strong correlation between the two gene expression patterns (r =0.86) (Figure 5-9). AtNAR2.1 expression patterns in shoots also displayed a similarity with that of AtNRT2.1 (Figure 5-10). It is possible that NRT2.1 and perhaps other members of the NRT2 family are unable to function independently i.e., in the absence of NAR2. Rather, they may require other gene product(s) which may act as a receptor, or a part of a signal transduction system in order to activate NRT2.1. The expression of AtNAR2.1, a candidate for this function, is highly correlated with AtNRT2.1 at the transcriptional level. Although many genes are regulated by nitrate (Wang et al., 2000a), and their expression patterns might correlate with that of N R T 2 . 1 , the evidence from C. r e i n h a r d t i i strongly support this hypothesis. Nevertheless, the function of NAR2 is still unknown. From the predicted 2-D structure, AtNAR2 possesses a single transmembrane domain at the C-terminus. Similarly, other proteins with single transmembrane domains are involved in membrane transport activities directly or indirectly. For instance, G m S A T l , 108 Duration of induction (hour) 0 3 6 12 24 48 72 0 ' — ' ' 1 1 0 24 48 7; Time (hour) Figure 5-8. Expression patterns of AtNAR2.1 gene in roots. RT-PCR products were obtained from 6-week-old Arabidopsis plants, which were grown hydroponically for 5 weeks and supplied with 0.5 m M NH4NO3. Plants were N deprived for 1 week (Oh), and then re-supplied with 0.5 m M Ca(NC>3)2 for 3-72h. Relative values were obtained by the ratio of the gene specific amplicon for the 18S amplicon. The values shown are means of three RT-PCR replicates. Bars indicate SE. 109 250 Q I I I I I I I 0 100 200 300 400 500 600 AtNRT2.1/18S Figure 5-9. Correlation between AtNRT2.1 and AtNAR2.1 expression levels in roots. Regression was based on 7 intervals during the time-course experiment (data of AtNRT2.1 from Figure 3-2B, AtNAR2.1 from Figure 5-8). Linear regression gives r value 0.86 (PO.01). 110 AtNAR2.1 18S Duration of induction (hour) 0 3 6 12 24 48 72 mma# (MM * I CO co 200 g 100 24 48 Time (h) 72 B co CO CM cc I 200 200 AtNRT2.1/18S Figure 5-10. Expression patterns of AtNAR2.1 gene and their correlation with AtNRT2.1 in shoots. (A) RT-PCR products were obtained from 6-week-old Arabidopsis plants, which were grown hydroponically for 5 weeks and supplied with 0.5 m M NH4NO3. Plants were N deprived for 1 week (Oh), and then re-supplied with 0.5 mM Ca(N03)2 for 3-72h. Relative values were obtained by the ratio of the gene specific amplicon for the 18S amplicon. The values shown are means of three RT-PCR replicates. Bars indicate SE. (B) Correlation between AtNRT2.1 and AtNAR2.1 expression levels in shoots. Regression was based on 7 intervals during the time-course experiment (data of AtNRT2.1 from Figure 3-2A, AtNAR2.1 from (A)). Linear regression gives r value 0.58 (PO.05). I l l soybean nodule ammonium transporter, has been proposed as a N H / transporter, although it has only single transmembrane region (Kaiser et al., 1998). The receptor-activity-modifying proteins (RAMPs), which have a single transmembrane domain, regulate the transport and ligand specificity of the calcitonin-receptor-like-receptor (CRLR) (McLatchie et al., 1998). AtNAR2 might perform these kinds of functions (i.e., it may transport substrates by itself, or modify and/or traffic other proteins) (Zhou et al., 2000). Furthermore, AtNAR2 also displays TonB-dependent receptor proteins signatures, suggesting that the gene products might also be involved in other protein-protein interactions at the outer surface of the plasma membrane. In other words, the function of the NRT2 nitrate transporters may require more complicated interaction with other proteins, rather than being independently functional membrane proteins. In any event, the function of the NRT2 nitrate transporters is still unclear, and needs to be explored further. 112 6 Conclusion and Future Prospective The present study has demonstrated that all putative nitrate transporters of the AtNRT2 and A t N R T l families, revealed by the A . t h a l i a n a genome project, could be detected in roots and shoots of this species by relative quantitative RT-PCR. In addition the use of GUS technology has proved information concerning the tissue-specific localization of a limited number of these genes. It was originally considered that NRT2 high-affinity nitrate transporter genes are nitrate-inducible (Crawford and Glass, 1998; Forde, 2000). However, it is evident from the forgoing results that not all members of the NRT2 family of genes can be characterized as nitrate-inducible. Rather, two genes (AtNRT2.5 and AtNRT2.6) showed constitutive expression, and there was one gene even suppressed by nitrate provision (AtNRT2.7). 113 Including classic nitrate-inducible genes (AtNRT2.1, 2.2, and 2.4), the NRT2 family members are perhaps components of the high-affinity nitrate transport systems. Similarly, low-affinity nitrate transporter AtNRTl family of genes showed three expression patterns in response to NO3" provision. Unlike barley or spruce, Arabidopsis possesses inducible LATS. This unique system showed correspondence with a nitrate-inducible low-affinity transporter AtNRT 1.1(CHL1). Tissue-specific expression patterns of four NRT2 genes were revealed in the present study AtNRT2.1, 2.2, and 2.4, a highly homologous trio, and also categorized as nitrate-inducible genes, showed some similarities in their tissue-specific localization (Chapter 4). Adding A t N R T l . 2 by Huang et al (Huang et al., 1999), localizations of six nitrate transporter genes have been confirmed, showing that those genes were expressed at least in the roots. This could support the belief that NRT genes are involved in NO3" uptake, although it may be too early to conclude their functions only from these localization patterns. In the GUS reporter gene analysis, AtNRT2.3, 2.5, and 2.7 failed to show expression patterns. The explanations for this might include: 1. The expression levels are too low to detect with current protocols. 2. The promoter regions chosen did not contain sufficient information to initiate transcriptions (Sieburth and Meyerowitz, 1997). 3. Technical difficulties. If the problem were caused by GUS reporter gene system itself, other systems such as green fluorescent protein (GFP) reporter DNA, in situ hybridization, in situ RT-PCR (Koltai and Bird, 2000), or immunolocalization analysis could be useful. In any cases, the localization of the rest of members of NRT genes probably will certainly be explored soon. 114 The current study showed both similarities and uniqueness among members of the NRT gene families. Surprisingly, genes showed identical expression patterns. Nevertheless, it may not be so simple to conclude that highly homologous multi-gene families are genetically redundant. Rather, each NRT gene may have unique functions such as specific localization, specific Km and values, or some roles other than NO3" uptake as shown in A t N R T l . 1(CHL1) (Guo et al., 2001). Screening mutants or generating mutant phenotypes is a well-established way to characterize the function of each nitrate transporter. Despite 11 nitrate transporters, only two mutants are identified (i.e., chll; Tsay et al., 1993; and atnrt2: Cerezo et al., 2000; Filleur et al., 2001). Protocols for mutant screening are improving steadily. The techniques include well established T-DNA insertion mutagenesis, or gene silencing by over expression of R N A i . In addition to large populations of T-DNA lines, a recent method using degenerate primers enhances the screening efficiency dramatically, and this method is suitable for multi-gene families such like AtNRT (Young et al., 2001). Advanced technique of anti-sense recently emerged, in which the transforming gene contains sense and anti-sense cDNA fused with introns under an ectopic promoter, such as the cauliflower mosaic virus 35S promoter. The transgenic lines produced with this technique silence mRNA more efficiently than ordinal anti-sense lines (Chuang and Meyerowitz, 2000; Smith et al., 2000). The function of the NRT genes might also be investigated by heterologous expression system. This was most effectively employed in the original study by Tsay et al., (1993) to investigate A t N R T l . 1(CHL1) function. Since expressing A t N R T l . 1 alone failed to restore nitrate transport in a double mutant of A s p e r g i l l u s n i d u l a n s incapable of nitrate 115 uptake, a co-expression study with A t N a r 2 . 1 has been undertaken. It will be interesting to see whether Nar2 is required in Arabidopsis nitrate transport. The A r a b i d o p s i s genome project unveiled 25,000 genes encoding proteins from 11,000 gene families, including 600 membrane transporters (The Arabidopsis genome initiative, 2000). Although microarray technique allows us to identify thousands of genes at once and to provide us with rudimentary ideas of gene regulation, follow up analysis is still necessary to arrive at more detail conclusions. It is encouraging that relative quantitative RT-PCR could identify and show the differential expression patterns of highly homologous gene copies as described in this study. It is also notable that the same primer sets, used in the quantitative RT-PCR analysis, are applicable for use in in situ RT-PCR for tissue-specific gene expression studies (Koltai and Bird, 2000). In summary, thanks to the A r a b i d o p s i s genome project, we now know the absolute number of gene copies in the NRT families, and I was able to characterize the gene expression patterns of all members. The results allowed to predict the physiological roles of the NRT transporters. Proving these hypothetical functions could be challenging. However, it may be feasible if we combine functional genomics and physiology. 116 References Amarasinghe, B.H.R.R., de Bruxelles, G.L., Braddon, M., Onyeocha, I., Forde, B.G., and Udvardi, M.K. (1998). Regulation of G m N r t 2 expression and nitrate transport activity in roots of soybean ( G l y c i n e max). Planta 206, 44-52. Aslam, M., Travis, R.L., and Huffaker, R.C. (1992). Comparative kinetics and reciprocal inhibition of nitrate and nitrite uptake in roots of uninduced and induced barley (Hordeum vulgare L.) seedlings. Plant Physiol. 99, 1124-1133. Cerezo, M., Tillard, P., Filleur, S., Munos, S., Daniel-Vedele, F., and Gojon, A. (2001). Major alterations of the regulation of root NO3" uptake are associated with the mutation of Nrt2.1 and Nrt2.2 genes in Arabidopsis. Plant Physiol. 127,262-271. Chang, C , Mooser, A., Pluckthun, A., and Wlodawer, A. (2001). Crystal structure of the dimeric C-terminal domain of TonB reveals a novel fold. J. Biol. Chem. 276,27535-27540. Chuang, C.F., Meyerowitz, E.M. (2000). Specific and heritable genetic interference by double-stranded RNA in A r a b i d o p s i s t h a l i a n a . Proc. Natl. Acad. Sci. USA 97,4985-4990. Claros, M.G. and Von Heijne, G. (1994). TopPred II: An improved software for membrane protein structure predictions. CABIOS 10, 685-686. Clough, S.J. and Bent, A.F. (1998). Floral dip: a simplified method for A g r o b a c t e r i u m -mediated transformation of A r a b i d o p s i s t h a l i a n a . Plant J. 16, 735-743. Coruzzi, G. and Bush, D.R. (200,1). Nitrogen and carbon nutrient and metabolite signaling in plants. Plant Physiol. 125, 61-64. Crawford, N .M. and Glass, A.D.M. (1998). Molecular and physiological aspects of nitrate uptake in plants. Trends Plant Sci. 3, 389-395. Filleur, S. and Daniel-Vedele, F. (1999). Expression analysis of a high-affinity nitrate transporter isolated from A r a b i d o p s i s t h a l i a n a by differential display. Planta 207,461-469. Filleur, S., Dorbe, M.F., Cerezo, M., Orsel, M., Granier, F., Gojon, A., and Daniel-Vedele, F. (2001). An A r a b i d o p s i s T-DNA mutant affected in Nrt2 genes is impaired in nitrate uptake. FEBS Lett. 489, 220-224. Forde, B.G. (2000). Nitrate transporters in plants: structure, function and regulation. Biochim. Biophys. Acta 1465, 219-235. 117 Galvan, A . , Quesada, A . , and Fernandez, E. (1996). Nitrate and nitrite are transported by different specific transport systems and by a bispecific transporter in C h l a m y d o m o n a s reinhardtii. J. Biol . Chem. 271, 2088-2092. Gansel, X., Munos, S., Tillard, P., and Gojon, A . (2001). Differential regulation of the NO3" andNFf/ transporter genes A t N r t 2 . 1 and A t A m t l . l in A r a b i d o p s i s : relation with long-distance and local controls by N status of the plant. Plant J. 26, 143-155. Gibeaut, D .M. , Hulett, J., Cramer, G.R., and Seem an n, J.R. (1997). Maximal biomass of A r a b i d o p s i s t h a l i a n a using a simple, low-maintenance hydroponic method and favorable environmental conditions. Plant Physiol. 115, 317-319. Glass, A .D.M., Brito, D.T., Kaiser, B.N., Kronzucker, H.J., Kumar, A . , Okamoto, M., Rawat, S.R., Siddiqi, M.Y., Silim, S.M., Vidmar, J.J., and Zhuo, D. (2001). Nitrogen transport in plants, with an emphasis on the regulation of fluxes to match plant demand. J. Plant Nutr. Soil Sci. 164, 199-207. Glass, A . D . M . , Shaff, J.E., and Kochian, L., V. (1992). Studies of the uptake of nitrate in barley IV. Electrophysiology. Plant Physiol. 99, 456-463. Glass, A . D. M. and Siddiqi, M . Y. (1995) Nitrogen absorption by plant roots. Srivastava, H. S. and Singh, R. P. In Nitrogen nutrition in higher plants. 21-56. New Delhi, India, Associated Publishing Co. Guo, F.Q., Wang, R., Chen, M., and Crawford, N .M. (2001). The Arabidopsis dual-affinity nitrate transporter gene A t N R T l . l (CHL1) is activated and functions in nascent organ development during vegetative and reproductive growth. Plant Cell 13, 1761-1777. Hall, T .A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41, 95-98. Hanisch ten Cate, C H . and Breteler, H. (1981). Role of sugars in nitrate utilization by roots of dwarf bean. Physiol. Plant. 52, 129-135. Hatzfeld, Y. and Saito, K. (1999). Identification of two putative nitrate transporters highly homologous to CHL1 from A r a b i d o p s i s t h a l i a n a (Accession Nos. AJ011604 and AJ131464) (PGR99-018). Plant Physiol. 119, 805. Hildebrand, M. and Dahlin, K. (2000). Nitrate transporter genes from the diatom C y l i n d r o t h e c a fusiformis (Bacillariophyceae): mRNA levels controlled by nitrogen source and by the cell cycle. J. Phycol. 36, 702-713. Hirokawa, T., Boonchieng, S., and Mitaku, S. (1998). SOSUI - classification and secondary structure prediction system for membrane proteins. Bioinformatics 14, 378-379. 118 Hofmann, K. and Stoffel, W. (1992). PROFILEGRAPH: an interactive graphical tool for protein sequence analysis. CABIOS 8, 331-337. Huang, N.C., Chiang, C.S., Crawford, N.M., and Tsay, Y.F. (1996). CHL1 encodes a component of the low-affinity nitrate uptake system in Arabidopsis and shows cell type-specific expression in roots. Plant Cell 8,2183-2191. Huang, N.C., Liu, K.H., Lo, H.J., and Tsay, Y.F. (1999). Cloning and functional characterization of an Arabidopsis nitrate transporter gene that encodes a constitutive component of low-affinity uptake. Plant Cell 11, 1381-1392. Hwang, C.F., Lin, Y., Dsouza, T., and Cheng, C L . (1997). Sequences necessary for nitrate-dependent transcription of arabidopsis nitrate reductase genes. Plant Physiol. 113, 853-862. Jones, D.T., Taylor, W.R., and Thornton, J.M. (1994). A model recognition approach to the prediction of all-helical membrane protein structure and topology. Biochemistry 33, 3038-3049. Kaiser, B.N., Finnegan, P.M., Tyerman, S.D., Whitehead, L.F., Bergersen, F.J., Day, D.A., and Udvardi, M.K. (1998). Characterization of an ammonium transport protein from the peribacteroid membrane of soybean nodules. Science 281, 1202-1206. Keller, E.B. and Noon, W .A. (1984). Intron splicing: A conserved internal signal in introns of aminal pre-mRNAs. Proc. Natl. Acad. Sci. USA 81, 7417-7420. King, B.J., Siddiqi, M.Y., Ruth, T.J., Warner, R.L., and Glass, A .D.M. (1993). Feedback regulation of nitrate influx in barley roots by nitrate, nitrite, and ammonium. Plant Physiol. 102,1279-1286. Koltai, H. and Bird, D.M. (2000). High throughput cellular localization of specific plant mRNAs by liquid-phase in situ reverse transcription-polymerase chain reaction of tissue sections. Plant Physiol. 123, 1203-1212. Krapp, A . , Fraisier, V., Scheible, W.R., Quesada, A . , Gojon, A . , Stitt, M., Caboche, M., and Daniel-Vedele, F. (1998). Expression studies of N r t 2 : l N p , a putative high-affinity nitrate transporter: evidence for its role in nitrate uptake. Plant J. 14, 723-731. Krapp, A . and Stitt, M. (1995). An evaluation of direct and indirect mechanisms for the "sink-regulation" of photosynthesis in spinach: changes in gas exchange, carbohydrates, metabolites, enzyme activities and steady-state transcript levels after cold-girdling source leaves. Planta 195, 313-323. Kronzucker, H., Glass, A .D.M., and Siddiqi, M. (1995). Nitrate induction in spruce: an approach using compartmental analysis. Planta 196, 683-690. 119 Lauter, F.R., Ninnemann, O., Bucher, M. , Riesmeier, J.W., and Frommer, W.B. (1996). Preferential expression of an ammonium transporter and of two putative nitrate transporters in root hairs of tomato. Proc. Natl. Acad. Sci. USA 93, 8139-8144. Lejay, L., Tillard, P., Lepetit, M. , Olive, F.D., Filleur, S., Daniel-Vedele, F., and Gojon, A. (1999). Molecular and functional regulation of two NO3" uptake systems by N - and C-status of A r a b i d o p s i s plants. Plant J. 18, 509-519. Lin, C M . , Koh, S., Stacey, G., Yu, S.M., Lin, T.Y., and Tsay, Y.F. (2000). Cloning and functional characterization of a constitutively expressed nitrate transporter gene, O s N R T l , from rice. Plant Physiol. 122, 379-388. Liu, K.H., Huang, C.Y., and Tsay, Y.F. (1999). CHL1 is a dual-affinity nitrate transporter of Arabidopsis involved in multiple phases of nitrate uptake. Plant Cell 11, 865-874. Marschner, H. Mineral nutrition of higher plants. 2nd ed. (1995). London: Academic Press Inc. McLatchie, L.M. , Fraser, N.J., Main, M.J., Wise, A., Brown, J., Thompson, N., Solari, R., Lee, M.G., and Foord, S.M. (1998). RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor. Nature 393, 333-339. Moller, S., Croning, M.D.R., and Apweiler, R. (2001). Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics 17, 646-653. Muldin, I. and Ingemarsson, B. (1995). A cDNA from B r a s s i c a napus L. encoding a putative nitrate transporter (GenBank U17987). Plant Physiol. 108, 1341. Murashige, T. and Skoog, F. (1962). A revised medium for rapid growth and bioassay with tobacco tissue cultures . Physiol. Plant. 15, 473-497. Nakai, K. and Kanehisa, M. (1992). A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics 14, 897-911. Nicholas, K.B. and Nicholas, H.B.Jr. (1997). GeneDoc: a tool for editing and annotating multiple sequence alignments. Distributed by the author. Nielsen, H., Brunak, S., and von Heijne, G. (1999). Machine learning approaches for the prediction of signal peptides and other protein sorting signals. Protein Eng. 12, 3-9. Ono, F., Frommer, W.B., and von Wiren, N. (2000). Coordinated diurnal regulation of low- and high-affinity nitrate transporters in tomato. Plant Biol. 2, 17-23. Padgett, R.A., Grabowski, P.J., Konarska, M.M., Seiler, S., and Sharp, P.A. (1986). splicing of messenger rna precursors. Ann. Rev. Biochem. 55,1119-1150. 120 Pao, S.S., Paulsen, I.T., and Saier, M.H. (1998). Major facilitator superfamily. Microbiol. Mol . Biol. Rev. 62, 1-34. Perez, M.D., Gonzalez, C., Avila, J., Brito, N., and Siverio, J.M. (1997). The YNT1 gene encoding the nitrate transporter in the yeast H a n s e n u l a polymorpha is clustered with genes YNI1 and YNR1 encoding nitrite reductase and nitrate reductase, and its disruption causes inability to grow in nitrate. Biochem. J. 321, 397-403. Persson, B. and Argos, P. (1994). Prediction of transmembrane segments in proteins utilising multiple sequence alignments. J. Mol. Biol. 237, 182-192. Quesada, A., Hidalgo, J., and Fernandez, E. (1998). Three Nrt2 genes are differentially regulated in C h l a m y d o m o n a s reinhardtii. Mol . Genet. Genomics. 258, 373-377. Quesada, A., Krapp, A., Trueman, L.J., Daniel-Vedele, F., Fernandez, E. , Forde, B.G., and Caboche, M. (1997). PCR-identification of a N i c o t i a n a p l u m b a g i n i f o l i a cDNA homologous to the high-affinity nitrate transporters of the c r n A family. Plant Mol . Biol. 34, 265-274. Quesada, A., Galvan, A., and Fernandez, E. (1994). Identification of nitrate transporter genes in C h l a m y d o m o n a s reinhardtii. Plant J. 5,407-419. Raun, W.R. and Johnson, G.V. (1999). Improving nitrogen use efficiency for cereal production. Agronomy J. 91, 357-363. Roulston, T. \ , Cane, J.H., and Buchmann, S.L. (2000). What governs protein content of pollen: Pollinator preferences, pollen-pistil interactions, or phylogeny? Ecological Monographs 70, 617-643. Rowe, J.J., Ubbink-Kok, T., Molenaar, D., Konings, W.N. , and Driessen, A.J. (1994). NarK is a nitrite-extrusion system involved in anaerobic nitrate respiration by E s c h e r i c h i a coli. Mol . Microbiol. 12, 579-586. Schwacke, R., Grallath, S., Breitkreuz, K.E. , Stransky, E., Stransky, H., Frommer, W.B., and Rentsch, D. (1999). LeProTl, a transporter for proline, glycine betaine, and gamma-amino butyric acid in tomato pollen. Plant Cell 11, 377-391. Sheen, J . (1990). Metabolic repression of transcription in higher plants. Plant Cell 2, 1027-1038. Siddiqi, M.Y., Glass, A.D.M., Ruth, T.J., and Fernando, M . (1989). Studies of the regulation of nitrate influx by barley seedings using 13N03~. Plant Physiol. 90, 806-813. Siddiqi, M.Y., Glass, A.D.M., Ruth, T.J., and Rufty, T .W., Jr. (1990). Studies of the uptake of nitrate in barley I. Kinetics of 1 3 NQ 3 " influx. Plant Physiol. 93, 1426-1432. 121 Siebrecht, S., Maeck, G., and Tischner, R. (1995). Function and contribution of the root tip in the induction of N03"uptake along the barley root axis. J. Exp. Bot. 46, 1669-1676. Sieburth, L.E. and Meyerowitz, E.M. (1997). Molecular dissection of the AGAMOUS control region shows that cis elements for spatial regulation are located intragenically. Plant Cell 9, 355-365. Smith, N.A., Singh, S.P., Wang, M.B., Stoutjesdijk, P.A., Green, A.G., and Waterhouse, P .M. (2000). Total silencing by intron-spliced hairpin RNAs. Nature 407, 319-320. Sonnhammer, E.L.L., von Heijne, G., and Krogh, A. (1998). A hidden Markov model for predicting transmembrane helices in protein sequences. Int. Conf. Intell. Syst. Mol . Biol. 176-182. The Arabidopsis Genome Initiative. (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796-815. Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). C L U S T A L W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-4680. Touraine, B. and Glass, A.D.M. (1997). N 0 3 " and C103~ fluxes in the chll-5 mutant of Arabidopsis thaliana. Does the CHL1-5 gene encode a low-affinity N 0 3 " transporter? Plant Physiol. 114, 137-144. Trueman, L.J. , Richardson, A., and Forde, B.G. (1996). Molecular cloning of higher plant homologues of the high-affinity nitrate transporters of Chlamydomonas reinhardtii and Aspergillus nidulans. Gene 175, 223-231. Tsay, Y.F., Schroeder, J., I, Feldmann, K.A., and Crawford, N . M . (1993). The herbicide sensitivity gene CHL1 of arabidopsis encodes a nitrate-inducible nitrate transporter. Cell 72, 705-713. Tusnady, G.E. and Simon, I. (1998). Principles governing amino acid composition of integral membrane proteins - application to topology prediction. J. Mol . Biol. 283,489-506. Unkles, S.E., Hawker, K.L., Grieve, C , Campbell, E., I, Montague, P., and Kinghorn, J.R. (1991). crnA encodes a nitrate transporter in Aspergillus nidulans. Proc. Natl. Acad. Sci. USA 88, 204-208. Unkles, S.E., Zhou, D., Siddiqi, M.Y., Kinghorn, J.R., and Glass, A.D.M. (2001). Apparent genetic redundancy facilitates ecological plasticity for nitrate transport. E M B O J. 20, 6246-6255. 122 van der Leij, M., Smith, S.J., and Miller, A.J. (1998). Remobilisation of vacuolar stored nitrate in barley root cells. Planta 205, 64-72. Vidmar, J.J., Zhuo, D.G., Siddiqi, M.Y., and Glass, A.D.M. (2000). Isolation and characterization of HvNRT2.3 and H v N R T 2 . 4 , cDNAs encoding high-affinity nitrate transporters from roots of barley. Plant Physiol. 122, 783-792. Wang, R. and Crawford, N.M. (1996). Genetic identification of a gene involved in constitutive, high-affinity nitrate transport in higher plants. Proc. Natl. Acad. Sci. USA 93, 9297-9301. Wang, R., Liu, D., and Crawford, N.M. (1998). The Arabidopsis CHL1 protein plays a major role in high-affinity nitrate uptake. Proc. Natl. Acad. Sci. USA 95,15134-15139. Wang, R., Guegler, K., LaBrie, S.T., and Crawford, N.M. (2000). Genomic analysis of a nutrient response in Arabidopsis reveals diverse expression patterns and novel metabolic and potential regulatory genes induced by nitrate. Plant Cell 12, 1491-1509. Yokoyama, T., Kodama, N . , Aoshima, H., Izu, H., Matsushita, K., and Yamada, M. (2001). Cloning of a cDNA for a constitutive NRT1 transporter from soybean and comparison of gene expression of soybean N R T l transporters. Biochim. Biophys. Acta 1518, 79-86. Young, J .C , Krysan, P.J., and Sussman, M.R. (2001). Efficient screening of arabidopsis T-DNA insertion lines using degenerate primers. Plant Physiol. 125, 513-518. Zhen, R.G., Koyro, H.W., Leigh, R.A., Tomos, A.D., and Miller, A.J. (1991). Compartmental nitrate concentrations in barley root cells measured with nitrate-selective microelectrodes and by single-cell sap sampling. Planta 185, 356-361. Zhou, J.J., Theodoulou, F.L., Muldin, I., Ingemarsson, B., and Miller, A.J. (1998). Cloning and functional characterization of a B r a s s i c a napus transporter that is able to transport nitrate and histidine. J. Biol. Chem. 273, 12017-12023. Zhou, J.J., Fernandez, E., Galvan, A., and Miller, A.J. (2000). A high affinity nitrate transport system from Chlamydomonas requires two gene products. FEBS Lett. 466, 225-227. Zhou, J.J., Trueman, L.J., Boorer, K.J., Theodoulou, F.L., Forde, B.G., and Miller, A.J. (2000). A high affinity fungal nitrate carrier with two transport mechanisms. J. Biol. Chem. 275, 39894-39899. Zhuo, D.G., Okamoto, M., Vidmar, J.J., and Glass, A.D.M. (1999). Regulation of a putative high-affinity nitrate transporter (Nrt2;lAf) in roots of Arabidopsis thaliana. Plant J. 17, 563-568. 123 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0099687/manifest

Comment

Related Items