Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Ribonucleoprotein particles guide 2’-O-ribose methylation of rRNA in the Archaeal genus Sulfolobus Omer, Arina Dana 2002

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2002-732274.pdf [ 14.55MB ]
Metadata
JSON: 831-1.0099674.json
JSON-LD: 831-1.0099674-ld.json
RDF/XML (Pretty): 831-1.0099674-rdf.xml
RDF/JSON: 831-1.0099674-rdf.json
Turtle: 831-1.0099674-turtle.txt
N-Triples: 831-1.0099674-rdf-ntriples.txt
Original Record: 831-1.0099674-source.json
Full Text
831-1.0099674-fulltext.txt
Citation
831-1.0099674.ris

Full Text

RIBONUCLEOPROTEIN PARTICLES GUIDE 2'O-RIBOSE M E T H Y L A T I O N O F r R N A IN T H E A R C H A E A L G E N U S  SULFOLOBUS  by  ARINA D A N A OMER B . S c , Polytechnic Institute of Bucharest, Romania, 1989  A THESIS SUBMITTED IN P A R T I A L F U L F I L L M E N T OF THE REQUIREMENT FOR THE D E G R E E OF  DOCTOR OF PHILOSOPHY In  THE F A C U L T Y OF G R A D U A T E STUDIES Department of Biochemistry and Molecular Biology We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH C O L U M B I A January 2002 copyright Arina Dana Omer, 2002  In  presenting  this  degree at the  thesis  in  University of  freely available for reference copying  of  department  this or  partial  fulfilment  British Columbia, and study.  thesis for scholarly by  his  or  her  of  the  I agree  purposes  may be It  publication of this thesis for financial gain shall not  Department of  £>\Q(LV\E ^ A V S T R U ^  The University of British Columbia Vancouver, Canada  Date  DE-6 (2/88)  ,3,0\.2.OO2-  that the  I further agree  representatives.  permission.  requirements  for  an  advanced  Library shall make it  that permission for extensive granted  is  by the  understood be  that  allowed without  head  of my  copying  or  my written  11 ABSTRACT  In Eukaryotes, specific methylation of 2'-0 ribose moieties in ribosomal R N A (rRNA) is guided by the C/D box family of small nucleolar RNAs (snoRNAs). These RNAs function in association with several nucleolar proteins including fibrillarin (the putative 2'-0 ribose methylase), Nop56, Nop58 and the U4/U6-U5 tri-snRNP protein 15.5kDa/Snul3p. Although significant progress has been made in identifying the protein components of the C/D box snoRNPs, the precise role of each of these proteins in the assembly and methylation function of the complex is poorly understood. In this study, homologs of snoRNA genes were initially identified in both branches of the Archaea. Eighteen small sno-like RNAs (sRNAs) were cloned from the archaeon Sulfolobus  a c i d o c a l d a r i u s by co-immunoprecipitation with aFD3 and aNOP56,  the archaeal homologs of eukaryotic snoRNA-associated proteins. A probabilistic model was trained on these sRNAs to search for more sRNAs in archaeal genomic sequences. Over 200 additional sRNAs were identified in seven archaeal genomes representing both the Crenarchaeota and the Euryarchaeota. The genes encoding the Sulfolobus  solfataricus  homologues of eukaryotic  proteins that are known to be present in C/D box small nucleolar ribonucleoprotein (snoRNP) complexes were cloned and the proteins (aFIB, aNOP56 and aL7a) were expressed and purified. The purified proteins along with an in vitro Sulfolobus  methylation guide sRNA were reconstituted in vitro,  transcript of a  into a RNP complex.  The order of assembly of the three proteins onto the RNA was aL7a, aNOP56 and aFIB. The complex was active in targeting S-adenosyl methionine (SAM)-dependent sitespecific 2'-0-ribose methylation to a short fragment of ribosomal. R N A  (rRNA).  The  presence of aFIB was essential for methylation as suggested by the finding that variant proteins having site-specific amino acid replacements in the putative S A M binding motif of aFIB were able to assemble into an RNP complex but the resulting complexes were defective in methylation activity. These results define the minimal number of components and the conditions required to achieve in vitro, methylation of a R N A target.  R N A guide directed 2'-0-ribose  iii TABLE OF CONTENTS  ABSTRACT  ii  T A B L E OF CONTENTS  iii  LIST OF FIGURES  vii  LIST OF TABLES  ix  ABBREVIATIONS  x  CHAPTER 1 - INTRODUCTION  1  1.1  Ribosome biogenesis in Eukarya  1  1.2  SnoRNPs function in the eukaryotic ribosome biogenesis  1  1.2.1  SnoRNAs  2  1.2.1.1 Classification  2  1.2.2  1.3  1.2.1.1.1  C/D box snoRNAs  2  1.2.1.1.2  H / A C A box snoRNAs  4  1.2.1.1.3  SnoRNAs associated to cleavage events  4  1.2.1.2 Biogenesis of snoRNAs  5  SnoRNA-associated proteins  6  1.2.2.1 C/D box-associated proteins  6  1.2.2.1.1  Fibrillarin  6  1.2.2.1.2  Nop56/Nop58  7  1.2.2.1.3  Snul3p/15.5kDa  7  1.2.2.2 H / A C A box-associated proteins  9  1.2.2.2.1  Garlp  9  1.2.2.2.2  Cbf5p  9  1.2.2.2.3  Nh2pandNopl0p  9  SnoRNAs function in the modification of other classes of cellular RNAs  10  1.4  Ribosome biogenesis in Archaea  11  1.5  Project objectives  12  1.6  References  13  iv  CHAPTER 2 - MATERIALS AND METHODS  22  2.1 Bacterial strains and oligonucleotides  22  2.2 Identification, Cloning and Expression of the S.acidocaldarius Fibrillarin and Nop56 Homologues  32  2.2.1  Media and Growth Conditions for Sulfolobus species  32  2.2.2  Identification of Fibrillarin Gene in S.acidocaldarius  33  2.2.3  Cloning of the S.acidocaldarius Fibrillarin and NOP56 Genes  34  2.2.4  Expression and Purification of the Recombinant Proteins  35  2.3 Polyclonal Antibodies Preparation and use  37  2.3.1  Animal Immunization  37  2.3.2  Immunological Procedures  38  2.4 Identification and cloning oi S.acidocaldarius small RNAs  40  2.5 In vitro transcription of guide and target RNAs  41  2.6 Gel-retardation assays  41  2.7 In vitro methylation assays  42  2.8 T L C analysis of modified nucleotides  42  2.9 Standard Molecular Biology Techniques  43  2.9.1  Polymerase Chain Reaction (PCR)  43  2.9.2  DNA Sequencing  43  2.9.3  End Labeling and Tailing of Nucleic Acids  44  2.9.4  RNA Extraction  45  2.9.5  Primer Extension  45  2.9.6  Gel Electrophoresis  46  2.9.7  Computer-Related Applications  47  2.9.8  Graphics, Figures and Illustrations  47  2.10 References  47  CHAPTER 3 - INITIAL IDENTIFICATION OF SMALL RNAs IN ARCHAEA Summary Introduction Sulfolobus acidocaldarius has aFIB, aNOP56 and C/D box sRNAs Methylation sites in Ribosomal RNA A Computational Screen for Additional Archaeal sRNAs sRNAs in Both Main Branches of the Archaea Pyrococcal sRNA families Conserved Sites of Methylation in 16S and 23S rRNA Features of archaeal sRNAs Evolutionary origin and divergence of C/D box sRNAs Acknowledgements References  CHAPTER 4 - ANALYSIS AND DISCUSSION OF A R C H A E A L SMALL RNAs FUNCTION Introduction Discovery of methylation guide sRNAs in Archaea Mining archaeal genome sequences Genomic context of sRNA genes Is growth temperature related to rRNA methylation? Do sRNAs guide methylation to tRNAs? Are methylation sites in rRNA phylogenetically conserved? Evolutionary divergence of archaeal methylation guide sRNAs Acknowledgements References  vi CHAPTER 5 - RECONSTITUTION AND ACTIVITY OF A C/D BOX METHYLATION GUIDE  97  Summary  97  Introduction  97  Binding of aL7a to archaeal sRl methylation guide sRNA  99  Higher order RNP complexes containing aL7a, aNOP56/58 and aFIB  100  Methylation activity of in vitro reconstituted C/D box RNPs  101  Importance of the Watson-Crick base-pairing at the site of methylation  102  Specificity of the methylation reaction  103  Perspectives  104  Acknowledgements  106  References  106  CHAPTER 6 - FUTURE PESPECTIVES  118  6.1 The mechanism of the in vitro methylation reaction  118  6.2 In vivo analysis and plasticity of the methylation guide machinery  118  6.3 Crystal structure determination of the core methylation guide sRNP complex from S. solfataricus  119  References  121  APPENDICES  126  Vll  LIST OF FIGURES Figure 1.1  Structural features of two major classes of eukaryotic snoRNAs  Figure 1.2  3  Predicted secondary structure of the RNA  motif  binding the 15.5kDa protein Figure 3.1  8  Glycerol gradient sedimentation of aFIB and aNOP56 containing particles present in S. acidocaldarius cell 62  free extracts Figure 3.2  Detection and 5' end mapping of sRNAs from S. acidocaldarius and S. solfataricus  65  Figure 3.3  Detection of 2'-0-ribose methylation sites in rRNA  68  Figure 3.4  Guide region sequence similarity in archaeal sRNA  69  Figure 4.1  Evolutionary divergence of sRNA genes in Archaea  87  Figure 4.2  Overlap between the 3' end of the aspartate amino transferase gene and the sRl genes in S. solfataricus and S. acidocaldarius  91  Figure 4.3  Predicted methylation sites in archaeal tRNAs  92  Figure 4.4  Conservation of sites of 2'-0-ribose methylation within functionally important domains of the SSU and LSU RNAs of Eukarya, Archaea and Bacteria  Figure 5.1  In vitro assembly of archaeal sRl sRNA into a ribonucleoprotein complex  Figure 5.2  sequences  116  Thin-layer chromatographic separation of the hydrolysis products of the target RNA  Figure 6.2  114  Effects of nucleotide substitution in the methylation guide and target RNA  Figure 5.4  112  RNP guide-dependent methyl incorporation into a complementary target RNA  Figure 5.3  95  117  Sequence of the wild type and mutant S. solfataricus sRl RNA  overlapping the 3'end of the aspartate amino  transferase gene  122  viii Figure 6.3  RNA substrates tested for the ability to assemble with aL7a and with aL7a-aNop56-aFib  Figure 6.4  In vitro assembly of the minimal C'/D' box RNA with the aL7a protein  Figure 6.5  123  124  In vitro assembly of the minimal sR13 C/D box RNA with the aL7a protein  125  IX  LIST OF TABLES  Table 2.1.1  Bacterial strains genotypes  23  Table 2.1.2  Oligonucleotide sequences and description  23  Table 3.1  Small RNAs cloned from Sulfolobus acidocaldarius  64  Table 3.2  Annotations of Sulfolobus acidocaldarius sRNAs  66  Table 4.1  Putative or confirmed sRNA genes in archaeal genomes  89  Table 4.2  Linkage between Pyrococcus sRNA genes  93  Table 4.3  Methylation at homologous positions within small and large subunit rRNAs  94  ABBVREVIATIONS  A/I  adenosine to inosine  ATP  adenosine triphosphate  bp  base pair  cDNA  complementary D N A  cpm  counts per minute  dNTP  deoxyribonucleotide triphosphate  DTT  dithiothreitol  EDTA  etylenediamine tetraacetic acid  ETS  external transcribed spacer  GAR  glycine-arginine rich  IPTG  isopropyl-/3-D-thiogalactopyranoside  ITS  internal transcribed spacer  kDa  kilodaltons  mRNA  messenger R N A  Nop  nucleolar protein  nt  nucleotide  ORF  open reading frame  PCR  polymerase chain reaction  PVDF  polyvinylidene fluoride  rpm  revolutions per minute  r-protein  ribosomal protein  rRNA  ribosomal  RT  reverse transcriptase  Sac  Sulfolobus  snoRNA  small nucleolar R N A  snRNA  small nuclear R N A  sRNP  small ribonucleoprotein particle  Sso  Sulfolobus  RNA  acidocaldarius  solfataricus  1  CHAPTER 1 INTRODUCTION 1.1  RIBOSOME BIOGENESIS IN E U K A R Y A The biosynthesis of ribosomes is of fundamental importance to all living cells. In  eukaryotes, the biogenesis of cytoplasmic ribosomes is localized in a specialized subnuclear compartment, the nucleolus. Often referred to as the ribosome factory, the nucleolus harbors most steps in the production pathway of mature ribosomes, including transcription, modification, processing, folding and assembly of ribosomal RNAs (rRNAs) into ribosomal subunits. In most species the organization of r R N A genes is similar, with the small subunit (18S) and two of the three large r R N A subunits (5.8S and 25S/28S) forming an operon, repeated several hundred times in the genome. R N A polymerase I cotranscribes the ribosomal R N A genes into a large precursor from which the external 5' and 3' transcribed spacers (ETSs) and the two internal transcribed spacers (ITS1 and ITS2) are removed through a series of endo- and exonucleolytic processing events. The 5S rRNA gene has nuclear localization and is transcribed by the R N A polymerase III. Available evidence suggests that before processing of the primary transcript is completed, the mature rRNAs are heavily modified mainly by 2'-0-ribose methylation and by pseudouridylation at more than 100 sites in mammals and yeast (1, 2). Neither processing nor covalent modification takes place on naked R N A ; instead they accompany the assembly with ribosomal proteins (r-proteins) and other trans-acting factors (non-ribosomal proteins and RNAs) that contribute to the formation of large RNP (ribonucleoprotein) particles and that are the precursors to the small and large ribosomal subunits. The final steps of ribosomal subunit maturation occur in the cytoplasm.  1.2  SnoRNPs F U N C T I O N I N R I B O S O M E B I O G E N E S I S It is now well established that along with rRNA precursors, the nucleolus contains  an impressive number of small, metabolically stable RNAs, generically termed snoRNAs (small nucleolar RNAs). They range in size from 67 to 280 nucleotides in metazoans and 85 to 605 nucleotides in unicellular organisms (3). In vertebrates the abundance of  2 individual snoRNAs ranges from 2 x l 0 (for U3) to 1-2x10 copies per cell; in yeast the 5  4  snoRNAs are 10-100 times less abundant (3, 4, 5, 6). Most of these noncoding snoRNAs function in various aspects of ribosome biosynthesis including folding, cleavage and nucleotide modification of the rRNA substrate. The snoRNAs act in association with specific proteins and form discrete small ribonucleoprotein particles (snoRNPs).  1.2.1  SnoRNAs  1.2.1.1 Classification The vast population of snoRNAs can be divided into three main subgroups that are structurally and functionally distinct.  1.2.1.1.1  C/D box snoRNAs  Most of the C/D box snoRNAs guide the 2'0-ribose methylation in rRNA. A l l members of this  family contain two  short consensus motifs  designated  box  C ( R U G A U G A ) and D(CUGA) situated respectively, near the 5'- and 3'-end of the molecule (7, 8, 9 and Figure 1.1a). Additionally, more degenerate versions of the C and the D boxes are present in the middle of the molecule and are referred to as C'and D ' boxes (10). Most C/D box RNAs contain a 4-5 nucleotide terminal hairpin that is important for bringing the C and D motifs into close proximity. This terminal stem likely acts as recognition signal for the binding of protein factors required during snoRNA biosynthesis and nucleolar localization (8, 11, 12). For the C/D box snoRNAs that lack the terminal helical motif, the juxtaposition of the C and D elements is mediated by an internal stem flanking the boxes (13, 71). The characteristic feature defining the box C/D methylation guide snoRNAs is the 10-21 nucleotide long guide sequence located upstream the of D or D ' box that is complementary to the r R N A and spans the site of methylation. (14, 15). Target selection relies on the canonical duplex formation between the guide region of the snoRNA and the rRNA target, such that the residue to be methylated in the target R N A base-pairs with the fifth nucleotide upstream of the start of the D, or D ' box. This is the N plus five rule (7-10). Initial studies identified fibrillarin as the signature protein cofactor that associates with all C/D box snoRNAs. As presented below, the repertoire of snoRNA-associated proteins includes now additional members.  3  (a)  Box C/D  5'  —  1  (b)  Box H/ACA  3'  Figure 1.1 Structural features of two major classes of eukaryotic snoRNAs. The C/D box and H / A C A box snoRNAs use antisense guide elements to target ribose methylation and pseudouridylation in rRNA. (a) The C/D box snoRNAs often contain one or two regions of complementarity to rRNA that are positioned 5' to the D or D' box; 2'-0-ribose methylation is directed to the nucleotide in rRNA that participates in a Watson-Crick base pair 5 nucleotides upstream of the D' or D box. Most of these RNAs have a short terminal hairpin. (b)  The H / A C A  box  snoRNAs  contain one  or two  regions  of  hyphenated  complementarity to r R N A that are within the bulge regions of the 5' or 3' helices; base pairing to rRNA positions the uridine nucleotide to be modified in a pocket between the hyphenated regions of rRNA-snoRNA complementarity.  4 1.2.1.1.2  H/ACA box snoRNAs  A second class of snoRNAs, the H / A C A snoRNAs, directs the conversion of uridine to pseudouridine in the rRNA. Representatives of this class fold into a typical hairpin-hinge-hairpin-tail secondary structure (Figure 1.1b). Within this structure, the box H ( A N A N N A , where N can be any nucleotide) is positioned in the single-stranded hinge region, and the conserved A C A triplet is invariably located in the single-stranded tail, ending three nucleotides from the 3'-terminus of the molecule (16, 17). Like the C/D box snoRNAs, the H / A C A box members base pair with the r R N A target by forming two short 4-8 nucleotide duplexes that surround the residue to be isomerized. The uridine target remains unpaired within the 'pseudouridylation pocket', situated 14-17 nucleotides upstream the H or A C A box (16, 17). Like the C and D box motifs the H and A C A boxes play critical roles in processing, accumulation and localization of snoRNAs (18). A l l H / A C A snoRNAs specifically associate with the nucleolar protein Garlp and several other proteins as detailed further below.  1.2.1.1.3  SnoRNAs associated with cleavage events  The third group of snoRNAs includes a single member, the R N A component of the RNase M R P . This R N A is related by homology to the R N A component of RNase P. In association with nine protein components this R N A forms a ribonucleoprotein particle responsible for the endonucleolytic cleavage of pre-rRNA upstream of the 5.8S rRNA (19). Eight of the RNase M R P protein components are also shared with the RNase P complex, that generates endonucleolytically the mature 5'-end  of tRNAs (20).  Remarkably, the M R P R N A is the only snoRNA with demonstrated endonucleolytic activity (21). The M R P RNP complex is also involved in mitochondrial D N A replication (70).  In addition to methylation and pseudouridine modification, several C/D and H / A C A box snoRNAs (U3, U14, snRlO snR30 in yeast and U3, U8, U14, U17, E3 and U22 in vertebrates) have been linked to the cleavage reactions in the primary rRNA transcript although none of these seems to possess intrinsic nuclease activity (3).  5 Amongst these, U3 and U14 interact directly with the pre-rRNA and are believed to contribute to the correct folding and presentation of the precursor r R N A substrate (22).  1.2.1.2 Biogenesis of snoRNAs Generally, snoRNA genes are found in two distinct genomic contexts, either within independent, mono- or polycistronic transcription units or within introns of housekeeping genes that belong to the 5'- terminal oligopyrimidine (5'TOP) family (22, 23). Within the independently transcribed class, most genes are single copy and transcribed by R N A polymerase II (yeast, vertebrates) or by R N A polymerase III (plants) (24, 25). Most snoRNA-containing primary transcripts undergo processing events that are required to produce the mature snoRNAs. The mechanism of snoRNA maturation depends on the genomic organization of the snoRNA encoding sequences. Maturation of the intronic snoRNAs occurs by two different pathways. The large majority of intron-encoded snoRNAs, including all vertebrate and a few yeast members, are excised by a splicing-dependent mechanism (26). This process includes linearisation of the spliced lariat by the debranching enzyme, Dbrlp, followed by sequential 5'- and 3'-exonucleolytic trimming involving the exonucleases Ratlp or X m l p and the exosome (27). In contrast, two snoRNAs from yeast and Xenopus (U16 and U18) are generated by a splicing-independent mechanism. This involves an initial endonucleolytic cleavage of the host pre-mRNA at sites that are mutually exclusive with splicing, followed by trimming to generate the mature 5' and 3' ends (28). A large number of snoRNAs are synthesized from independent transcription units that can be monocistronic or polycistronic. Amongst enzymatic activities required for processing of the yeast transcripts are the endonuclease Rntlp (homologue of bacterial RNase III), which liberates individual pre-snoRNA and Ratlp or X m l p exonucleases that trim the primary snoRNA transcript (27). In addition, Senlp, a putative R N A helicase, has been shown to participate in the production of C/D box snoRNAs (29). The expression and maturation of different  classes of snoRNAs appears  coordinated with the biosynthesis of factors involved in the translational apparatus and with the production of mature rRNA. A large majority of genes that host snoRNAs in  6 their intronic sequences encode ribosomal proteins, nucleolar factors or protein synthesis factors. However, there are examples of snoRNA host genes that are unrelated to ribosome function or that lack protein encoding potential (30). Nonetheless, there is a unifying feature characteristic to all genes harboring snoRNA encoding sequences - the presence of a C at the start of the transcript and the presence of a long polypyrimidinerich sequence, around the transcription start site, that is indicative of genes whose expression is coupled to ribosome biogenesis (31). Studies done in yeast revealed that the enzymes required for pre-rRNA processing are also responsible for the maturation of snoRNAs (27). Taken together, these data point to the intricate nature of the network of interactions established between different steps of ribosome biogenesis. Analysis of the primary structure of snoRNAs showed that three types of modification occur at their 5'-end, while all end with a simple 3'-OH group. Several snoRNAs in vertebrates and most members in yeast that originate from independent monocistronic units, posses a 2, 2, 7 trimethyl-guanosine cap at the 5'-end. The cap structure is added to the 5'-terminus of the primary transcript and either is present in the mature snoRNA, as in the unprocessed yeast snR4 and snR13 snoRNAs, or is removed following Rntpl cleavage, as in the yeast snR36, snR43, snR46 snR47 snoRNAs (64, 65). A particular example of capped snoRNA is present in plants where a y-monomethyl phosphate is added to the Pol III transcript of U3 (3). In contrast, snoRNAs recovered from introns always have an unmodified 5'-phosphate at their 5'-terminus. A unique case is the M R P R N A which is transcribed as an independent unit and has a triphosphate 5'end (3).  1.2.2  SnoRNA-associated proteins  1.2.2.1 C/D box-associated proteins 1.2.2.1.1  Fibrillarin  Fibrillarin (Noplp in yeast), is an evolutionarily conserved and highly abundant, 34 kDa protein localized to the fibrillar center of the nucleolus. This protein has been shown to associate with most C/D box snoRNAs (3, 16). Consistent with its R N A binding, Fibrillarin contains two putative R N A binding domains (RBDs) and a glycine and arginine rich (GAR) domain of undefined function at the N-terminus. Fibrillarin is  7 essential for cell viability and is involved in different aspects of ribosome biosynthesis including processing and post-transcriptional modification of the pre-rRNA, and efficient assembly of the r R N A with ribosomal proteins (32). These and other studies suggested a methyltransferase function for Fibrillarin (66). This prediction has been strengthened recently by the elucidation of the crystal structure of an archaeal Fibrillarin orthologue (33). To date Fibrillarin is considered the best candidate for the C/D box associatedmethyltransferase, despite the fact that this activity has not yet been unambiguously identified, mainly due to the lack of an in vitro assay system.  1.2.2.1.2  Nop56/Nop58  The Nop56 and Nop58 (Nop5p) are essential proteins originating from paralogous genes and that were initially identified in yeast through a screen of synthetic lethal Noplp mutants (34, 35). The two proteins share 45% sequence identity and contain a K K D / E signature sequence at their carboxy-terminus that is also present in other nucleolar proteins (35). Both proteins are found in stoichiometric amounts with each other and with Fibrillarin; depletion of any of the three proteins led to the depletion of all box C/D snoRNAs. More intriguing, Nop56/Nop58 are also required for the accumulation of several box C/D snoRNAs; this suggests a coupling between the snoRNA maturation pathway and the ribosome biosynthetic pathway (36).  1.2.2.1.3  Snul3p/15.5 k D a protein  The human 15.5 kDa protein is a highly conserved protein that specifically binds to the conserved 5'-loop structure of the spliceosomal U4 snRNA and plays an essential role in the first step of splicing (37). The yeast orthologue, Snul3p protein has also been copurified with the U4/U6-U5 tri-snRNP complex (38). The 15.5 kDa protein belongs to a family of proteins that includes human ribosomal proteins L7a and SI 2, yeast ribosomal protein L30 and the ribosomal proteins HS6 from Haroarcula marismortuii. A l l these proteins share a homologous region that corresponds to residues 35-90 in the 15.5 kDa protein that is postulated to contain a novel R N A binding motif (66). In support of this hypothesis, G38K and A57F amino acid replacements introduced in the 15.5 kDa protein abolished U4 snRNA binding (37). In addition, the crystal structure of the 15.5 kDa  8 protein bound to the 5'-stem-loop structure of U4 snRNA has been solved (67). Comparison with the three dimensional structure of the yeast L30 ribosomal protein bound to R N A revealed striking similarities (68). In both complexes, the R N A binding motif consists of an asymmetric (2+5 nucleotides) loop in which residues occupying equivalent positions establish similar contacts with the corresponding protein (see Figure 1.2. A , below); the 15.5 kDa protein and L30 ribosomal protein exhibit structural homology and both proteins use the same regions of their surfaces to contact a common R N A structural motif. Overall, these structural studies identified a general principle for the interaction of proteins belonging to the 15.5 kDa/L30 protein family with their cognate R N A substrate. V4 snRNA 5'-steni-loop  A  3  iff  c-/ A  c\\ A G UrjU  )  B  A-U G • C  C box  U • UL U<  box  D  _ *<> N 5  ,  Figure 1.2. Predicted secondary structure of the R N A motif binding the 15.5 kDa protein. (A) The conserved 5-stem loop structure of the spliceosomal U4 snRNA. (B) The C/D box consensus sequence present in the C/D box snoRNAs. (Diagrams adapted from: "Crystal structure of the spliceosomal  J5.5 kDa protein  bound  to a U4 snRNA fragment." Vidovic I., Nottrott S., Hartmuth K . , Luhrmann R. and Ficner R. (2000) M o l . Cell. 6(6): 1331-1342).  In a separate study, the small Snul3p protein was found together with Noplp, Nop56/Nop58 in the pool of proteins specifically associated with a typical C/D box snoRNA, the yeast U3 R N A (39). Like Fibrillarin, this protein proved to associate in vivo with all C/D box snoRNAs. Unlike Fibrillarin, the protein was able to bind directly to any C/D box snoRNA in vitro, implying that Snul3p is the C/D box R N A core binding protein. Mutational analyses in the C and D motifs revealed that these sequences are  9 essential for Snul3p/15.5 kDa protein binding. Based on these observations, Watkins et al. showed that C/D box snoRNAs can adopt a secondary structure where the C and D boxes become part of a asymmetric loop similar to the R N A binding motif present in U4 snRNA (see figure 1.2.B, above).  1.2.2.2 H/ACA box-associated proteins 1.2.2.2.1  Garlp  Garlp protein is a 23 kDa nucleolar protein initially identified based on its association with all H / A C A box snoRNAs (40). The protein contains G A R domains at the N - and C-termini. This domain is suspected to contribute to the stabilization of the snoRNA-rRNA complex. The RNA-binding domain of Garlp that is responsible for the interaction with H / A C A snoRNAs resides in the conserved central region of the protein (41).  1.2.2.2.2  Cbf5p  Initially identified in yeast as a DNA-binding protein, Cbf5p protein exhibits significant sequence similarity with the pseudouridine synthase truB, that catalyzes pseudouridine formation at position 55 in E.coli tRNAs (42, 43). In vivo, Cbf5p depletion resulted in drastic reduction processing and pseudouridylation of pre r R N A as well as a decrease in the stability of H / A C A box snoRNAs. These data designate Cbf5p as the putative H / A C A box-associated pseudouridine synthase, although direct catalytic activity of the protein has not yet been demonstrated. Interestingly, mutations in the metazoan Cbf5 homologue induce severe defects, causing dyskeratosis in human - an inherited X linked disorder (44). Mutation in the Drosophila Cbf5 encoding gene induces pleiotropic effect including developmental delay and reduced female fertility (45). Together, these observations highlight the importance of pseudouridylation for r R N A biosynthesis.  1.2.2.2.3  Nhp2p and NoplOp  Nhp2p and NoplOp are two additional protein components that coprecipitate with epitope-tagged Garlp and constitute core proteins of all H / A C A box snoRNAs (46). In addition, electron micrographs of purified box H / A C A snoRNPs allowed visualization of  10  the particle structure and predicted that the stoichiometry of the complex consists of two protein copies of each Garlp, Cbf5p, Nhp2p and NoplOp for each snoRNA molecule; this is consistent with the presence of two similar structural motifs in each H / A C A box R N A (47).  1.3  SnoRNAs FUNCTION IN T H E MODIFICATION OF OTHER CLASSES  OF C E L L U L A R RNAs The mature spliceosomal snRNAs U l , U2, U4, U5 and U6 contain approximately 30 positions of 2'-0-ribose methyl modification and 24 positions of pseudouridine modification (48). Tycowski et al. identified two methylation guide snoRNAs that direct modification to two distinct positions in U6 snRNA (49). Later, snoRNA guides responsible for eight more 2'-0 methylation and three pseudouridine modifications in U6 were identified (50). Together, these observations led to the conclusion that U6 snRNA modification is partially i f not solely mediated by snoRNPs. In human and Drosophila, U85 snoRNA is a hybrid snoRNA carrying both C/D box and H / A C A box motifs that associates with both box C/D and box H/ACA-specific snoRNP proteins. This guide is functional in vivo and guides ribose methylation and pseudouridylation in U5 snRNA (51). The list of snRNA substrates for snoRNA-guided modification continues to increase with the discovery of novel snoRNA members that are predicted to target modification sites in U l , U2, U4 and U5 snRNAs (52). The presence of many snoRNA guides with no obvious complementarity to any known stable R N A has led to the speculation that modification might also be targeted to mRNA sequences. This has been confirmed with the discovery of brain-specific methylation guide snoRNAs in human and rodents (53, 54). In human, the genes encoding these snoRNAs are located in a 1.5 Mb region of chromosome 15qll-ql3 involved in the neurogenetic Prader-Willi syndrome (PWS). Normally, the expression of genes situated in the PWS region, including the brain-specific snoRNA genes, is paternally imprinted. Dysfunction in the expression of the paternally inherited alleles occurs 1 in 15,000 births and results in severe developmental symptoms including hypotonia, obesity and mental retardation (55). The genomic context of the snoRNA loci revealed an unusual organization with one type of snoRNA gene tandemly repeated  11 several dozen times within an intronic sequence, while the adjacent exons have no protein encoding potential. With one exception, none of the brain-specific snoRNAs displays obvious complementarity to known RNAs. However, the MBII-52/HBII-52 snoRNA displays a perfect 18 nt complementarity region to the serotonin receptor 5HT-2C message (53). Based on the N plus five rule, the nucleotide to be methylated by this guide maps precisely to one of the five known sites for A/I editing in the 5HT-2C m R N A (56). Since A/I editing is tissue-specific and most abundant in brain m R N A (57), it is tempting to speculate that ribose methylation at the editing site plays a regulatory role. Additionally, ribose methylation could interfere in the utilization of an upstream alternate splice site present in the 5HT-2C mRNA. The alternatively spliced variant of 5HT-2C is most abundant in the choroid plexus brain area where the methylation guide MBII-52 is absent (58).  1.4  RIBOSOME BIOGENESIS IN ARCHAEA Archaea have been defined as a phylogenetically distinct group of prokaryotic  organisms that comprise two main branches: the Euryarchaeota that includes the methanogens and the extreme halophiles, and the Crenarchaeota that includes the sulfur dependent thermophilic acidophiles (59, 60). A trait common to all these archaeal organisms is the presence of mosaic bacterial and eukaryal features (61). Archaea are bacterial-like for features such as cell structure, genome organization and structure and function of enzymes involved in basic metabolism, but they are eukaryal-like for features involved in information storage and transfer, (i.e., the machineries used for D N A replication, R N A transcription and protein translation) (62). In this context, the rRNA operon structure and pre-rRNA processing are two eloquent examples. Especially true for the Euryarchaeota subdivision, the structure of archaeal rRNA primary transcript closely parallels that of pre-rRNA in Bacteria. This is marked by the presence of tRNA and 5S rRNA sequences in the primary transcript containing the 16S and the 23S rRNA subunits. Like in Bacteria, in both branches of Archaea the mature small and large rRNA cistrons are surrounded by long inverted  12 repeats that form extended stem structures and contain the signals for endonucleolytic cleavage by the bulge-helix-bulge nuclease (62). In contrast, the rRNA modification apparatus in Archaea appears more similar to that present in Eukarya in terms of the type and extent of the modification and associated factors required for the reaction. For example, in E.coli rRNA, base methylation is prevalent, whereas, only four residues are subject to 2'-0 ribose methylation. In the crenarchaeon Sulfolobus solfataricus  67 sites carry this ribose methyl modification, a  number comparable to the 55 detected ribose methyl modifications in yeast (63). Unlike Bacteria, Archaea encode at least two proteins that display a high degree of sequence similarity to the eukaryotic sno-RNA associated proteins: the archaeal Fibrillarin and archaeal Nop56 (69). Based on these findings, it has been speculated that Archaea use a mechanism homologous to the one found in eukaryotes for the ribose methyl modification of the pre-rRNA and that this process might be mediated by sno-like RNAs.  1.5  PROJECT OBJECTIVES Based on the aforementioned observations and with the assumption that archaeal  Fibrillarin and NOP56, like the eukaryotic homologues, play essential roles in ribosome biogenesis, the initial goal of this study was to identify and characterize these proteins in the hyperthermophilic archaeon Sulfolobus  acidocaldarius.  Next, the two archaeal  proteins were to be used as a tool to access other components of the processingmodification machinery in S. acidocaldarius,  including eukaryotic-like snoRNAs. As  pre-rRNA processing and modification is much less complicated in Archaea than it is in the eukaryotic nucleolus, information obtained in Sulfolobus was to be used in the attempt to generate an in vitro system for the study of ribose methylation of the ribosomal R N A . Since Archaea are recognized as the closest surviving relatives to the earliest eukaryotic cells, the results of this study will serve as a useful model to understand the structure and the molecular mechanisms of the methylation guide machinery present in eukaryotic cells.  13 1.6  REFERENCES  1. Maden B E H . (1990) The modified nucleotides in ribosomal R N A of man and other eukaryotes. In Chromatography and Modification of Nucleosides. Gehrke C W and Kuo K C T (eds). Amsterdam: Elsevier, B265-B301.  2. Maden B E H . (1990) The numerous modified nucleotides in eukaryotic ribosomal R N A . Prog. Nucleic Acid Res. Mol. Biol. 39: 241-303.  3. Maxwell ES and Fournier M J . (1995) The small nucleolar RNAs. Annu. Rev. Biochem. 64: 897-934.  4. Tyc K and Steitz JA. (1989) U3, U8 and U13 comprise a new class of mammalian snRNPs localized in the cell nucleolus. E M B O J. 8(10): 3113-3119.  5. Wise JA, Tollervey D, Maloney D, Swerdlow H , Dunn EJ and Guthrie C. (1983) Yeast contains small nuclear RNAs encoded by single copy genes. Cell 35(3 Pt 2): 743-751.  6. Riedel N , Wise JA, Swerdlow H , Mak A and Guthrie C. (1986) Small nuclear RNAs from Saccharomyces cerevisiae: unexpected diversity in abundance,  size, and  molecular complexity. Proc. Natl. Acad. Sci. U S A . 83(21): 8097-8101.  7. Kiss-Laszlo Z, Henry Y , Bachellerie J-P, Caizergues-Ferrer M and Kiss T. (1996) Site-specific ribose methylation of preribosomal R N A : a novel function for small nucleolar RNAs. Cell. 85(7): 1077-1088.  8. Cavaille J, Nicoloso M , and Bachellerie J-P. (1996) Targeted ribose methylation of R N A in vivo directed by tailored antisense R N A guides. Nature. 383(6602): 732-735.  9. Nicoloso M , Qu L - H , Michot B , and Bachellerie J-P. (1996). Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to  14 their direct role as guides for the 2'-0-ribose methylation of rRNAs. J. M o l . Biol. 260(2): 178-195.  10. Z. Kiss-Laszlo Z, Henry Y and Kiss T. (1998) Sequence and structural elements of methylation guide snoRNAs essential for site-specific ribose methylation of prerRNA. E M B O J. 17(3): 797-807.  11. Caffarelli E, Losito M , Giorgi C, Fatica A and Bozzoni I. (1998) In vivo identification of factors interacting with the conserved elements of box C/D small nucleolar RNAs. Mol. Cell. Biol. 18(2): 1023-1028.  12. Samarsky D A , Fournier M J , Singer R H and Bertrand E. (1998) The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization. E M B O J. 17(13): 3747-3757.  13. Watkins NJ, Leverette RD, X i a L , Andrews M T and Maxwell ES. (1996). Elements essential for processing intronic U14 snoRNA are located at the termini of the mature snoRNA sequence and include conserved nucleotide boxes C and D. R N A . 2(2): 118133.  14. Bachellerie JP, Michot B, Nicoloso M , Balakin A , N i J and Fournier M J . (1995) Antisense snoRNAs: a family of nucleolar RNAs with long complementarities to rRNA. Trends. Biochem. Sci. 20(7): 261-264.  15. Bachellerie J-P and Cavaille J. (1998) Small nucleolar RNAs  guide ribose  methylation of Eukaryotic rRNAs. In: Modification and Editing of R N A . Grosjean H and Benne R (eds). Washington DC: American Society for Microbiology, 255-272.  16. Balakin A G , Smith L and Fournier M J . (1996) The R N A world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell. 86(5): 823-834.  15  17. Ganot P, Bortolin M L and Kiss T. (1997) Site-specific pseudouridine formation in preribosomal R N A is guided by small nucleolar RNAs. Cell. 89(5): 799-809.  18. Bortolin M L , Ganot P and Kiss T. (1999) Elements essential for accumulation and function of small nucleolar RNAs directing site-specific pseudouridylation of ribosomal RNAs. E M B O J. 18(2): 457-469.  19. Morrissey JP and Tollervey D. (1995) Birth of the snoRNPs: The evolution of RNase M R P and the eukaryotic pre-rRNA-processing system. Trends. Biochem. Sci. 20(2): 78-82.  20. Chamberlain JR, Lee Y , Lane WS and Engelke DR. (1998) Purification and characterization of the nuclear RNase P holoenzyme complex reveals extensive subunit overlap with RNase M R P . Genes Dev. 12(11): 1678-1690.  21. Lygerou Z, Allmang C, Tollervey D and Seraphin B. (1994) Accurate processing of a eukaryotic precursor ribosomal R N A by ribonuclease M R P in vitro. Science. 272(5259): 268-270.  22. Tollervey D and Kiss T. (1997) Function and synthesis of small nucleolar RNAs. Current Opp. Cell Biol. 9(3): 337-342.  23. Amaldi F and Pierandrei-Amaldi P. (1997) TOP genes: A translationally controlled class of genes including those coding for ribosomal proteins. Prog. M o l . Subcell. Biol. 18: 1-17.  24. Filipowicz W, Pelczar P, Pogacic V and Dragon F. (1999) Structure and biogenesis of small nucleolar R N A s acting as guides for ribosomal R N A modification. Acta Biochim. Pol. 46(2): 377-389.  16 25. Brown JWS and Shaw PJ. (1998) Small nucleolar RNAs and pre-rRNA processing in plants. The Plant Cell. 10: 649-657.  26. Petfalski E, Dandekar T, Henry Y and Tollervey D. (1998) Processing of the precursors to small nucleolar RNAs and rRNAs requires common components. M o l . Cell. Biol. 18(3): 1181-1189.  27. Venema J and Tollervey D. (1999) Ribosome synthesis in Saccaromyces  cerevisiae.  Annu. Rev. Genet. 33: 261-311.  28. Caffarelli E, Fatica A , Prislei S, De Gregorio, Fragapane P and Bozzoni I. (1996) Processing of the intron-encoded U16 and U18 snoRNAs: The conserved C and D boxes control both the processing reaction and the stability of the mature snoRNA. E M B O J. 15(5): 1121-1131.  29. Ursic D, Himmel K L , Gurley K A , Webb F and Culbertson M R . (1997) The yeast SEN1 gene is required for the processing of diverse R N A classes. Nucleic Acids Res. 25(23): 4778-4785.  30. Tycowski K T , Shu M - D and Steitz JA. (1996) A mammalian gene with introns instead of exons generating stable R N A products. Nature. 379(6564): 464-466.  31. Bachellerie J-P, Cavaille J and Qu L - H . (2000) Nucleotide modifications in eukaryotic rRNAs: the world of small nucleolar R N A guides revisited. In: The Ribosome: structure, function, antibiotics, and cellular interactions. Garrett R A , Douthwaite, SR, Liljas A , Matheson A T , Moore P B , and Noller H F , (eds). A S M Press, Washington, DC, 191-203.  32. Tollervey D, Lehtonen H , Jansen R, Kern H and Hurt E C . (1993) Temperaturesensitive mutations demonstrate roles for yeast fibrillarin in pre-rRNA processing, pre-rRNA methylation, and ribosome assembly. Cell. 72(3): 443-457.  17  33. Wang H , Boisvert D, K i m K K , K i m R, K i m SH. (2000) Crystal structure of a fibrillarin homologue from Methanococcus jannaschii, a hyperthermophile, at 1.6 A resolution. E M B O J. 19(3): 317-323.  34. Wu P, Brockenbrough JS, Metcalfe A C , Chen S and Aris JP. (1998) Nop5p is a small nucleolar ribonucleoprotein component required for pre-18 S r R N A processing in yeast. J. Biol. Chem. 273(26): 16453-16463.  35. Gautier T, Berges T, Tollervey D and Hurt E. (1997) Nucleolar K K E / D repeat proteins 56p and 58p interact with lp and are required for ribosome biogenesis. Mol. Cell. Biol. 12(12): 7088-7098.  36. Lafontaine D L J and Tollervey D. (2000) Synthesis and assembly of the box C+D small RNPs. Mol.Cell. Biol. 20(8): 2650-2659.  37. Nottrott S, Hartmuth K , Fabrizio P, Urlaub H , Vidovic I, Ficner R and Luhrmarm R. (1999) Functional interaction of a novel 15.5 kDa [U4/U6.U5] tri-snRNP protein with the 5' stem-loop of U4 snRNA. E M B O J. 18(21): 6119-6133.  38. Gottschalk A , Neubauer G, Banroques J, Mann M Luhrmann R and Fabrizio P. (1999) Identification by mass spectrometry and functional analysis of novel proteins of the yeast [U4/U6.U5] tri-snRNP. E M B O J. 18(16): 4535-4548.  39. Watkins NJ, Segault V , Charpentier B, Nottrott S, Fabrizio P, Bachi A , Wilm M , Rosbash M , Branlant C and Luhrmann R. (2000) A common core RNP structure shared between the small nucleolar box C/D RNPs and the spliceosomal U4 snRNP. Cell.l03(3): 457-466.  18 40. Bousquet-Antonelli C, Henry Y , G'elugne JP, Caizergues-Ferrer M , Kiss T. (1997) A small nucleolar RNP protein is required for pseudouridylation of eukaryotic ribosomal RNAs. E M B O J. 16(15): 4770-4776.  41. Bagni C and Lapeyre B . (1998) Garlp binds to the small nucleolar R N A snRlO and saR30 in vitro through a nontypical R N A binding element. J. Biol. Chem. 273(18): 10868-10873.  42. Weinstein L B and Steitz JA. (1999) Guided tours: from precursor snoRNA to functional snoRNP. Current Opp. Cell Biol. 11: 378-384.  43. Lafontaine D L , Bousquet-Antonelli C, Henry Y , Caizergues-Ferrer M and Tollervey D. (1998) The box H+ACA snoRNAs carry Cbf5p, the putative pseudouridine synthase. Genes Dev. 12(4): 527-537.  44. Heiss NS, Knight SW, Vulliamy TJ, Klauck S M , Wiemann S, Mason PJ, Poustka A and Dokal I. (1998) X-linked dyskeratosis congenita is caused by mutation in a highly conserved gene with putative nucleolar function. Nature Genet. 19(1): 32-38.  45. Giordano E , Peluso I, Senger S and Furia M . (1999) Minifly, a Drosophila gene required for ribosome biogenesis. J. Cell. Biol. 144(6): 1123-1133.  46. Henras A , Henry Y , Bousquet-Antonelli C, Noaillac-Depeyere J, Gelugne JP and Caizergues-Ferrer M . (1998) Nhp2p and NoplOp are essential for the function of H / A C A snoRNPs. E M B O J. 17(23): 7078-7090.  47. Watkins NJ, Gottschalk A , Neubauer G, Kaster B , Fabrizio P, Mann M and Luhrmann R. (1998) Cbf5, a potential pseudouridine synthase, and Nhp.2p, a putative RNA-binding protein, are present together with Garlp in all H box/ACA-motif snoRNPs and constitute a common bipartite structure. R N A . 4(12): 1549-1568.  19 48. Reddy R and Busch H . (1988) Small nuclear RNAs: R N A sequences, structure and modification. In: Structure and function of major and minor small nuclear ribonucleoprotein particles. Bimstiel M L (ed.) Springer-Verlag, Berlin, Germany, 137.  49. Tycowski K T , Y o u Z H , Graham PJ, Steitz JA. (1998) Modification of U6 spliceosomal R N A is guided by other small RNAs. M o l Cell. 2(5): 629-638.  50. Ganot P, Jady B E , Bortolin M L , Darzacq X , Kiss T. (1999) Nucleolar factors direct the 2'-0-ribose methylation and pseudouridylation of U6 spliceosomal R N A . M o l Cell Biol. 19(10): 6906-6917.  51. Jady B E , Kiss T. (2001) A small nucleolar guide R N A functions both in 2'-0-ribose methylation and pseudouridylation of the U5 spliceosomal R N A . E M B O J. 20(3): 541-551.  52. Huttenhoffer A , Kiefmann M , Meier-Ewert S, O'Brien J, Lehrach H , Bachellerie J-P, and Brosius J. (2001) RNomics; an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. E M B O J. 20(11): 29432953.  53. Cavaille J, Buiting K , Kiefmann, M , Lalande M , Brannan CI, Horsthemke B , Bachellerie J-P, Brosius J and Huttenhofer A . (2000) Identification of brain-specific and imprinted small nucleolar R N A genes exhibiting an unusual  genomic  organization. Proc. Natl. Acad. Sci. U S A . 97(26): 14311-14316.  54. De los Santos T, Schweizer J, Rees C A , Francke U . (2000) Small evolutionarily conserved R N A , resembling C/D box small nucleolar R N A , is transcribed from PWCR1, a novel imprinted gene in the Prader-Willi deletion region, which is highly expressed in brain. Am. J. Hum.Genet. 67(5): 1067-1082.  20 55. Filipowicz W. (2000) Imprinted expression of small nucleolar RNAs in brain: time for RNomics. Proc. Natl. Acad. Sci. U S A . 97(26): 14035-14037.  56. Burns C M , Chu H , Rueter S M , Hutchinson L K , Canton H , Sanders-Bush E, Emeson RB. (1997) Regulation of serotonin-2C receptor G-protein coupling by R N A editing. Nature. 387(6630): 303-308.  57. Paul M S , Bass B L (1998) Inosine exists in m R N A at tissue-specific levels and is most abundant in brain mRNA. E M B O J , 17(4): 1120-1127.  58. Canton H , Emeson R B , Barker EL, Backstrom JR, L u JT, Chang M S , Sanders-Bush E. (1996) Identification, molecular cloning, and distribution of a short variant of the 5-hydroxytryptamine2C receptor produced by alternative splicing. M o l . Pharmacol. 50(4): 799-807.  59. Olsen GJ and Woese CR. (1997) Archaeal Genomics: A n overview. Cell. 89(7): 991994.  60. Fox G E , Stackebrandt E, Hespell R B , Gibson J, Maniloff J, Dyer T A , Wolfe RS, Balch W E , Tanner RS, Magrum L J , Zablen L B , Blakemore R, Gupta R, Bonen L , Lewis B J , Stahl D A , Luehrsen K R , Chen K N , Woese CR. (1980) The phylogeny of prokaryotes. Science. 209(4455): 457-463.  61. Kandler O and Zillig W. (1986) Archaebacteria '85. Stuttgart: Gustav Fisher.  62. Dennis PP. (1997) Ancient Ciphers: Translation in Archaea. Cell. 89(7): 1007-1010.  63. Noon K R , Bruenger E and McCloskey JA. (1998) Posttranscriptional modifications in 16S and 23 S rRNAs of the archaeal hyperthermophile Sulfolobus solfataricus. J. Bacteriol. 180(11): 2883-2888.  21 64. Chanfreau G, Legrain P, Jacquier A . (1998) Yeast RNase III as a key processing enzyme in small nucleolar RNAs metabolism. J. Mol. Biol. 284(4): 975-988.  65. Fatica A , Mariangela M , Bozzoni I. (2000) Yeast snoRNA accumulation relies on a cleavage-dependent/polyadenylation-independent  3'-processing apparatus. E M B O J.  19(22): 6218-6229.  66. Koonin E V , Bork P and Sander K . (1994) A novel RNA-binding motif in omnipotent translation termination, ribosomal proteins and ribosome modification enzymes? Nucleic Acids Research. 22(11): 2166-2167.  67. Vidovic I, Nottrott S, Hartmuth K , Luhrmann R and Ficner R. (2000) Crystal structure of the spliceosomal 15.5 kDa protein bound to a U4 snRNA fragment. M o l . Cell. 6(6): 1331-1342.  68. Mao H , White SA and Williamson JR. (1999) A novel loop-loop recognition motif in the yeast ribosomal protein L30 autoregulatory complex. Nature Struct. Biol. 6(12): 1139-1147.  69. Lafontaine D L J and Tollervey D. (1998) Birth of the snoRNPs: the evolution of the modification-guide snoRNAs. TLBS. 23: 383-388.  70. Stohl L L and Clayton D A . (1992)  Saccharomyces  cerevisiae  contains an RNase M R P  that cleaves at a conserved mitochondrial R N A sequence implicated in replication priming. Mol.Cell. Biol. 12(6): 2561-2569.  71. Darzacq X and Kiss T. (2000) Processing of intron-encoded box C/D small nucleolar RNAs lacking a 5',3'-terminal stem structure. M o l . Cell. Biol. 20(13):4522-4531.  22  CHAPTER 2 MATERIALS AND METHODS Sulfolobus  a c i d o c a l d a r i u s (Sac) strain DSM#639 was acquired from the Deutsche  Sammlung collection. Sulfolobus  solfataricus  (Sso) strain P2 and Sso cosmid 33,  containing the Sso fibrillarin and NOP56 homologs, were kindly provided by Rob Charlebois at the University of Ottawa. All  restriction  enzymes were obtained from Pharmacia.  The P W O D N A  Polymerase was obtained from Roche Molecular Biochemicals, while other modification enzymes were purchased from Pharmacia, Gibco B R L , New England Biolabs and Promega. The Thermo Sequenase Radiolabeled Terminator Cycle Sequencing Kit was supplied by United States Biochemicals. The cloning vectors pGEM-3Zf(+), pGEM-7Zf(+) and pSP72 were purchased from Promega. The expression vectors pET3a-d and pET28a were obtained from Novagen. E . c o l i strain JM109 was purchased from Promega; E . c o l i strains BL21(DE3), BL21(DE3)pLysS and BL21(DE3)pLysE were purchased from Novagen. A l l radioactive nucleotides were obtained from Dupont N E N Research, while non-radioactive nucleotides were supplied  by Pharmacia.  Oligonucleotides  were  synthesized by Gibco B R L , by the Nucleic Acid and Protein Sequencing (NAPS) facility, in the Biotechnology Laboratory at U B C and in collaboration with Sean Eddy, at Washington University. Hybond N hybridization membranes used for Southern blots were obtained from Amersham. Polyvinylidene fluoride (PVDF) Immobilon-P membranes used for Western blotting were purchased from Millipore. Acrylamide/Bisacrylamide was obtained from BioRad. Yeast extract, Bacto tryptone and Bacto agar were purchased from Difco Laboratories. Incomplete/complete Freund's adjuvant was supplied by Sigma. Other chemicals were obtained from Pharmacia, Sigma, Fisher.Scientific and Aldrich.  23 2.1  BACTERIAL STRAINS AND OLIGONUCLEOTIDES The genotypes of E. coli strains used for plasmid propagation and protein  expression are listed in Table 2.1.1  Table 2.1.1. Bacterial strains genotypes Strain  Genotype  JM109  endAl,  recAl,  gyrA96,  thi, hsdR17(r -M +), k  k  relAl,  supE44, A(lac-proAB), [f, traD36, proAB, lacqzAM15] BL21(DE3)pLysS  F", ompT, hsdS (r -m -), gal, dcm (DE3), pLysS (Cm )  BL21(DE3)pLysE  F", ompT, hsdS (r -m -), gal, dcm (DE3), pLysE (Cm )  K  B  B  B  K  B  B  B  The oligonucleotides used for P C R amplification, sequencing and primer extension are listed below, in the Table 2.1.2.  Table 2.1.2 Oligonucleotide sequences and description Oligo  Sequence  Description  A03  5'-GGGAATTCCCATGGTGAAAAT  Complementary to the (+) strand  ATACCTAATTGAGCA-3'  of the Sso contiguous sequence lam 49_RC_between positions 10779-10804.  A04  5'-CGGGGAGATCTTAGAATTTGG  Complementary to the (-) strand of  C ATTGT A T A T T G C - 3 '  the Sso contiguous sequence lam 49_RC_between positions 125132-125111.  A05  5'-ATTTTTTGAACCCTTC A C T A T A  Complementary to clone PD1238  GG-3'  containing Sac FIB and NOP56 genes, between positions 29032880. Primer used for sequencing.  A06  5'-ACT A T T A A T T T ATTTTC A G A G A  Complementary to clone PD1238  GAC-3'  between 1878-1902. Primer used for sequencing.  24 A07  5'-CCGGTACCATATGTCTGAAATC  Complementary to 5'-end of Sac  G A A A A A G T TA C A A A G A C G - 3 '  FIB ORF, between 1-30. Underlined is the Ndel site used for cloning into pET3a vector.  A09  5 '-CTTTGT A A C T T T T T C G T T T C A G  Complementary between 3745-  ACAT-3'  3719 to clone PD1238. Primer used for sequencing.  AO10  5 '-GCTGCT A G G G T G G A C T A C T T C A Complementary between 2463G-3'  2486 to clone PD1238. Primer used for sequencing.  A013  5'-CGGCACCTCTTAACTTTCTTC-3'  Complementary between 18181797 to clone PD1238. Primer used, for sequencing.  A014  5'-CATTGAGGACGATGTTGTATCT  Complementary between 4021-  G-3'  4044 to clone PD1238. Primer used for sequencing.  A015  5'-CGAGAAAGGAACACCATTACC  Complementary between 1061-  GAGC-3'  1626 to clone PD1238. Primer used for sequencing.  A016  5 '-C A G G A A A A T G A A T A C T A T A C C  Complementary between 1932-  ATTCTC-3'  1905 to clone PD1238. Primer used for sequencing.  A019  5 ' - C G C G G A T C C T C A C T TA T A C T T T  Complementary to 3'-end of Sac  CT A C T A T C ATGGC-3'  fibrillarin gene, between 670-696. Contains stop codon and BamHI (underlined) for cloning in pET3a.  AO20  5'-GCTCTAGACATATGAAGATAT  Complementary to 5'-end of Sac  ATTT A G T G G A A C ATG-3'  NOP56 ORF, between 1-25. Contains Ndel site for cloning in pET3a (underlined).  25 A021  5'-CGCGGATCCTTCTCTCCTTCC  Complementary to 3'-end of Sac  CCTTTTTT ACC-3'  NOP gene, between 1217-1240. Contains stop codon and BamHI (underlined) for cloning in pET3a.  AO30  5'-CTCG^ GA 7LTGGATCCGGG-3'  Anchor primer used for Sac small R N A cloning; contains Xhol (double underlined), B g l l l (italics) and BamHI (underlined) restriction sites.  A031  5'-CCCGGATCCAGATCTCGAG-3'  Antisense to AO30 used in sRNA reverse transcription and PCR.  A032  5'-GCGAATTCrGC4GTTTTTTTTT  Sense primer used in combination with A031 to PCR-amplify cDNAs; contains EcoRI (underlined) and PstI (italics) sites for cloning.  si  5 '-T A T C A G A G C A T G G G A G T T A A G  Complementary to s R l R N A  C-3'  between 55-34; used in primer extension to map 5'-end sRNA.  s2  5 '-TTC A G T T C G C A G T G A C C T C T T  Complementary to sR2 R N A  C-3'  between 53-32; used in primer extension to map 5'-end sRNA.  s3  5'- G A T C A G C C G A G A C A G G T T A T A  Complementary to sR3 R N A  TC-3'  between 53-31; used in primer extension to map 5'-end sRNA.  s4  5'-CCTCAGACCTGGCCACTTTC-3'  Complementary to sR4 sRNA between 53-34; used in primer extension to map 5'-end sRNA.  s5  5 '-TGTC A G T C C G C A A A C AATTC-3'  Complementary to sR5 R N A between 55-36; used in primer extension to map 5'-end sRNA.  26 s6  5'-GTCAGTTGAGGTGCATTTCTT  Complementary to sR6 R N A  C-3'  between 49-28; used in primer extension to map 5'-end sRNA.  s7  5'-GTGGCTGCCCACAAAATTAG-3'  Complementary to sR7 R N A between 54-35; used in primer extension to map 5'-end sRNA.  s8  5'-AGCCTCGGGTTCCCTCTTC-3'  Complementary to sR8 R N A between 49-31; used in primer extension to map 5'-end sRNA.  s9  5'-TCAGTTTCGGGTTACGACAT  Complementary to sR9 R N A  C-3'  between 58-38; used in primer extension to map 5'-end sRNA.  slO  5'-GCTCGCGCTTTTTGTCATC-3'  Complementary to sRIO R N A between 48-29; used in primer extension to map 5'-end sRNA.  sll  5'-CTCAGCCGGAGATAATCTCAT  Complementary to s R l 1 R N A  C-3'  between 56-35; used in primer extension to map 5'-end sRNA.  sl2  5'-CACATCGATCTGACGAACAAC  Complementary to sR12 R N A  C-3'  between 60-39; used in primer extension to map 5'-end sRNA.  sl3  5'-TGCGTCAGTAGTCGGACTCAT  Complementary to sR13 R N A  C-3'  between 55-34; used in primer extension to map 5'-end sRNA.  sl4  5'-CTCTGAGCTTTGGCCCTTC-3'  Complementary to sR14 R N A between 54-36; used in primer extension to map 5'-end sRNA.  sl5  5'-CAGAGCAGAGCGTCGAAGC-3'  Complementary to sRl 5 R N A between 52-34; used in primer extension to map 5'-end sRNA.  27 sl6  5'-TCATCAGTATTAACCGTTTCG  Complementary to sR16 R N A  C-3'  between 54-33; used in primer extension to map 5'-end sRNA.  sl7  5'-CAGTGCGAGACGTCGTCATC-3'  Complementary to sR17 R N A between 54-35; used in primer extension to map 5'-end sRNA.  sl8  5'-CAGTTCTCACACGCTCTATC-3'  Complementary to sR18 R N A between 51-31; used in primer extension to map 5'-end sRNA.  E19  5'-CAGCCGAGGACCACTACATC-3'  Complementary to sR19 R N A between 50-31; used in primer extension to map 5'-end sRNA.  E20  5'-CAGTATTTCCAGCGGTCATC-3'  Complementary to sR20 R N A between 49-30; used in primer extension to map 5'-end sRNA.  E21  5 '-C A G T T A T C C A G G G C T C A A T C - 3 '  Complementary to sR21 R N A between 55-36; used in primer extension to map 5'-end sRNA.  E22  5'-CAGCGAGTAACCGCATCCTC-3'  Complementary to sR22 R N A between 54-35;.used in primer extension to map 5'-end sRNA.  E23  5'-CTGACCCTGTTTCTCTCATC-3'  Complementary to sR23 R N A between 51-32; used in primer extension to map 5'-end sRNA.  E24  5 '-C A G C A A G G A T C C A G G A C ATC-3'  Complementary to sR24 R N A between 49-30; used in primer extension to map 5'-end sRNA.  E25  5'-CAGTACGCTCAGCGTCATC-3'  Complementary to sR25 R N A between 47-29; used in primer extension to map 5'-end sRNA.  28 E26  5 '-C A G T A G G T A G A G G T T C A T C A T  Complementary to sR26 R N A  C-3'  between 55-37; used in primer extension to map 5'-end sRNA.  E27  5 '-C A G C A A A A A G T T C T T C A T C A  Complementary to sR27 R N A  C-3'  between 54-36; used in primer extension to map 5'-end sRNA.  E28  5'-CAGCACACGTGCCTTTCATC-3'  Complementary to sR28 R N A between 53-34; used in primer extension to map 5'-end sRNA.  E29  5 '-C A G A G T G C T C A G C T A C ATC-3'  Complementary to sR29 R N A between 49-31; used in primer extension to map 5'-end sRNA.  A035  5 '-GTT A G C C A C G T G T T A C T C A G C  Complementary to Sac 16S r R N A  C-3'  between 112-91; used to map U52 ribose methylation by primer extension.  AO40  5'-CCGGGCCTGGCCGGTTCCCCCG  Complementary to Sac 7S R N A  GTCAAC-3'  between 203-176; used to map G143 ribose methylation by primer extension.  A041  5*-CTTTCACCCTCTATGGGCCCCC  Complementary to Sac 23 S r R N A  GTTC-3'  between 392-367; used to map G334 ribose methylation by primer extension.  A042  5'-ATGGTGAGGT A G G G T G G A G G  Complementary to Sac IS R N A  G-3'  between 1-21; used together with AO40 for P C R amplification.  A043  5 '-GGTGG A T G G C T C G G C T C G G G  Complementary to Sac 23S r R N A  C-3'  between 30-50; used for P C R amplification.  29 A044  5'-GTTGTTCCCCTTTTGCCACC-3'  Complementary to Sac 23 S r R N A between 1138-1119; used to map G l 114 ribose methylation by primer extension.  A045  5'-CGGCCTTCGGTGGGGCTTCG  Complementary to Sac 23 S r R N A  C-3'  between 2051 -2031; used to map G1995 ribose methylation by primer extension.  A046  5'-CTAAACCCAGCTCACGCTCC  Complementary to Sac 23S r R N A  C-3'  between 2728-2708; used to map U2692 ribose methylation by primer extension.  A047  5-CCTTTTCGTTGGCACTTAGC-3'  Complementary to Sac 23 S rRNA between 1188-1168; used to map A l 134 ribose methylation by primer extension.  AO50  5'-CCCCCTCGAGAATGACGAAAT  Anneals upstream the Sso  GATTT A G A T A T AGC-3'  aminotransferase A T G codon, between 287 and 261; contains Xhol (underlined) site for cloning.  A051  5'-GGGGATCTGC4GCAAGGCTAT  Anneals between 333-310  TTGGCC A C AAGAG-3'  downstream Sso aminotransferase stop codon; contains Pstl_(italics) site for cloning.  A053  5'-CGAGATCTGAGGATTTGCCCCT  Complementary to Sso 16S r R N A  AC-3'  between 668-644; used to map U605 ribose methylation by primer extension.  30 A054  5'-GATGATGAATTCCCGATAGTA  Complementary to the Sso  CGATTGATGAGCTAGGTCACTGC  aminotransferase gene between  GAACTGA-3'  1190-1244; contains mutated Sso sRl such that the D box guide sequence has been replaced by Sac sR2 D box guide.  A057  5'- G A T G A T G A A T T C C C G A T A G T A  Complementary to the Sso  CGATTGATGAGCTAAACACTCCC  aminotransferase gene between  ATGGCTG-3'  1190-1244; used to PCR-amplify mutant Sso s R l AA1236.  A058  5 '-TT A A G A T T A A G T T T T G C T G T G A  Complementary to the Sso  ACG-3'  aminotransferase gene between 1116-1140; used to verify Sso s R l mutant sequences.  A059  5'-GATGATGAATTCCCGACAGTA  Complementary to the Sso  CG-3'  aminotransferase gene between 1190-1212; used to PCR-amplify mutant Sso sRl containing T1206C.  A066  5'- A G A A T T C C C A T G G A C G C G A T G  Forward primer used to PCR-  TC A A A A G C T AG-3'  amplify Sso aL7a ORF; underlined is the Ncol site used for cloning into pET3d vector.  A067  5'- T T A G G A T C C T T A A C T T G A A G T  Reverse primer used to PCR-  TT T A C C T T T A A T C - 3 '  amplify Sso aL7a ORF; underlined is the BamHI site used for cloning into pET3d vector.  AO70  5'- A A A G A T C T C C A T G G C T G A A G T  Forward primer used to PCR-  AATTACCGTAAAAC-3'  amplify Sso aFIB ORF; underlined is the Ncol site used for cloning into pET3d vector.  31 A071  5'- T T A G G A T C C C T A C C C T T T A T A T  Reverse primer used to PCR-  TTGCT A A G A A C - 3 '  amplify Sso aFIB ORF; underlined is the BamHI site used for cloning into pET3d vector.  SZ102  5'-CCGATATCCATGGTGAAAATA  Forward primer used to PCR-  TA C C T A A T T G A - 3 '  amplify Sso aNOP56 ORF; underlined is the Ncol site used for cloning into pET28a vector.  SZ103  5'-CCGAATTCTCACTTTCTTTTAC  Reverse primer used to PCR-  CTCTTCTCT-3'  amplify Sso aNOP56 ORF; underlined is the EcoRl site used for cloning into pET28a vector.  HE70  5'- G G T C T T A T A T T T A G G T G T T G C T  Forward primer used in PCR  T C T G G A A C T A C A A T A A G -3'  mutagenesis to generate Sso aFIB A85V; mutated nucleotide is underlined.  HE71  5*- C T T A T T G T A G T T C C A G A A G C A  Reverse primer (anti-HE70) used  AC ACCT A A A T AT AAGACC-3'  in PCR mutagenesis to generate Sso aFIB A85V;  HE83  5'-GGAGGCCTAATATCTTTGTACT  Forward primer used in PCR  A T T G G C T G A T G C AAG-3 •  mutagenesis to generate Sso aFEB P129V; mutated nucleotide is underlined  HE84  5'- C T T G C A T C A G C C A A T A G T A C A  Reverse primer (anti-HE83) used  AAGATATTAGGCCTCC-3'  in PCR mutagenesis to generate Sso aFEB P129V.  A063.1  5'-GTAATACGACTCACTATAGGG  Forward primer used to PCR-  ATAAGCCATGGGAG-3'  amplify the D N A template for transcription of the wild type target R N A ; T7 promoter is underlined.  32 A065  5 '-T ATTT A G G T G A C A C T A T A G G T  Reverse primer used to PCR-  T A G C C A C G T G T T A C T C AGCC-3'  amplify the D N A template for transcription of the wild type target R N A . Complementary to the T7  5 '-T A A T A C G A C T C A C T A T AGGG-3'  T7  promoter region. HE45  5'- G T T A T C A G A C C A [ A ] G G G A G T T  Reverse primer used in  AAG-3'  combination with T7 primer to PCR-amplify the template for mutant guide R N A synthesis; substituted nucleotide is bracketed.  0SZ117  5'- G G G A G T G T A A G A C T C C C [ T ] T G  Used in combination with T7, as  GCTTATCCCTATAGTGAGTCGTA  partially single stranded D N A  TTA-3'  template to transcribe mutant target R N A ; T7 promoter is underlined; the complement of the expected site for methylation is bracketed.  2.2  IDENTIFICATION,  CLONING  AND  EXPRESSION  OF  THE  S.acidocaldarius F I B R I L L A R I N A N D NOP56 H O M O L O G U E S  2.2.1  Media and Growth Conditions for Sulfolobus species  S. acidocaldarius (strain D S M 639) was grown aerobically at 80°C in a 2 liter Perkin-Elmer glass fermenter, in 1 x modified De Rosa medium containing: 22.5 m M K H P 0 , 20 m M ( N H ) S 0 , 800 /iMgSO »7H 0, 2.25 mMCaCh, 0.1% yeast extract, 2  4  4  2  4  4  2  0.1%) Bactotryptone and supplemented with 0.01%) trace metal mix. The trace metal mix contained: 3.5 uM C u S 0 » 7 H 2 0 , 15/iMVOS0 »2H 0, 30/*MCuCl »2H O, 4  4  2  2  2  75uM  Z n S 0 » 7 H 0 875 uM M n C l » 4 H 0 , and 1.25 uM N a B O » 1 0 H O . The medium was 4  2  2  2  2  4  7  2  adjusted to pH 3.5 with H S 0 prior to inoculation and then continuously adjusted to this 2  4  33 pH value during growth. Growth was determined from the apparent absorbance at 600 nm. In these conditions the culture attained a maximum density of 0.7, as reflected by the OD600  value with a doubling time of 4 hours. Based on the observation that S.  acidocaldarius grown in 2 x modified De Rosa medium can reach an ODeoo of 1.4, these were the conditions used when high cell density was required. S. solfataricus (strain P2) was grown under vigorous aeration at 80°C in complex medium containing: 20 m M K H P 0 , 100 m M ( N H ) S 0 , 10 mMgSO »7H 0, 5 m M 2  4  4  2  4  4  2  CaCi2, 30 m M glutamic acid, 1% yeast extract, 2% glucose. The medium was adjusted to pH 3.5 with H S 0 . 2  4  Cells were harvested during logarithmic growth phase at an OD600 of 0.4-0.7, rapidly cooled to 10°C and pelleted by centrifugation at 5000 rpm for 10 minutes, in a Sorvall GS-3 rotor. The cell paste was either stored at -70°C or resuspended in the appropriate buffer for immediate use (50 m M Tris-HCl buffer, pH 7.5, 40 m M M g C l  2  and 10 m M DTT).  2.2.2  Identification of Fibrillarin Gene in S. acidocaldarius  Sequence information derived from the S. solfataricus genome project (NC 002754) was initially used to design specific primers for the PCR-amplification of Sso Fibrillarin gene. The P C R fragment generated was used as a heterologous probe in Southern analysis to identify the Fibrillarin gene homologue in S. acidocaldarius.  Synthesis of the probe by PCR Briefly, 10 ng of Sso cosmid 33 were used in a 100 ul reaction containing 30 pmoles of primer A 0 3 and A 0 4 respectively, l x P C R buffer [10 m M Tris pH 8.85, 25mM KC1, 5 m M ( N H ) S 0 , 2 m M M g S04], 200 u M of each dCTP, dGTP, dTTP and 4  2  4  8 ixM dATP, 50 uci P-dATP and 2.5 u PWO D N A Polymerase. The 1.8 kbp P C R 32  fragment contained the entire Sso Fibrillarin gene and the 3'-end of the NOP56 gene.  Southern analysis The method was as described by Sambrook et al.(\). Essentially, 5-10 jug of genomic Sac D N A was digested with restriction enzymes and the D N A fragments  34 separated on a 07-0.8% native agarose gel at constant 2V/cm for 12-14 hours. To increase the transfer efficiency, the D N A was first depurinated by immersion of the gel in a 0.25 M HC1 solution for 10 minutes, followed by denaturation of the D N A  30 minutes in a  solution containing 0.5 M NaOH and 1.5 M NaCl. The gel was next equilibrated in the transfer buffer (1.5M  NaCl and 0.25 M NaOH) for at least 1 hour and then subjected to  capillary transfer to the Hybond N membrane; the transfer proceeded 12-14 hours. After transfer, the membrane was dried for 10 minutes at 80°C followed by crosslinking of the D N A to the matrix by 2 minutes exposure to U V light. The membrane was next pre-hybridized for at least 2 hours in the hybridization solution (5xSSPE, 5xDenhardt's, 0.5% SDS, 20 jUg/ml heat-denatured salmon sperm DNA),  at 50-60°C. The  denatured probe was added to the prehybridization solution and hybridization proceeded for 12-16 hours, at the preset temperature, with light agitation. The membrane was then washed once in low stringency conditions, in a solution containing 2 x SSPE, 0.1% SDS, for  10 minutes at room temperature. The next wash was done in medium stringency  conditions (1 x SSP, 0.1% SDS for 15 minutes at the hybridization temperature), before exposing the membrane to film for autoradiography.  2.2.3 Cloning of the S. acidocaldarius Fibrillarin and NOP56 Genes 20/xg  of S. acidocaldarius genomic D N A  were digested with Xbal restriction  enzyme and subjected to electrophoresis on a 0.7%> preparative agarose gel. As determined previously by Southern analysis, an approximately 5 kbp positive restriction fragment was cut out of the gel and the D N A recovered by electroelution. The D N A was next ligated into the pGEM-7Zf(+) vector linearized by Xbal and dephosphorylated by shrimp alkaline phosphatase. The ligation mixture was used to transform E. coli strain JM109. In the pool of transformants, clones carrying S. acidocaldarius Fibrillarin and Nop56 homologs were selected by Southern blotting using again the S. solfataricus Fibrillarin-containing probe. The positive clones were next sequenced as described in section 2.9.2.  35  2.2.4  Expression and Purification of Recombinant Proteins  S.acidocaldarius Fibrillarin and NOP56 proteins  Sac Fibrillarin and NOP56 ORFs were amplified using oligonucleotides A 0 7 , A O 19 and AO20, A 0 2 1 , respectively. Briefly, 14 ng of Sac genomic D N A served as template in a standard P C R reaction as described in section 2.9.1. The P C R products were cloned between the Ndel and BamHI sites of the pET3a vector and propagated into E.coli strain JM109. Individual colonies were picked and used first to verify the insert sequence. Next, plasmids containing the correct Fibrillarin and NOP56 sequences were transformed into E. coli strain BL21(DE3)pLysS, for protein expression. Individual colonies were inoculated in 2 ml Y T media, grown at 37°C to an ODgoo of 0.4-0.6 when protein synthesis was induced by addition of 0.4 m M LPTG. Three hours after induction, cells were harvested by low speed centrifugation (5000 rpm for 5 minutes), washed once in buffer 1 (50 m M Tris-HCl, pH 8 and 2 m M EDTA) resuspended in the same buffer 1 (200 jul) and frozen at -20°C for at least 1 hour. When thawed the cells lysed. To decrease solution viscosity the lysate was briefly sonicated. The clear lysate was next separated from the cell debris by a 10 minutes centrifugation at 12000 rpm. Both Sac Fibrillarin (aFIB) and NOP56 (aNOP56) proteins were recovered in the supernatant and further purified, based on their thermostability. The clear lysate was heated for 5 minutes at 65°C followed by centrifugation 10 minutes at 12000 rpm. Aliquots of the soluble and insoluble fraction were loaded on a SDS-PAGE gel revealing that most of the overexpressed Sac proteins (80%) remain soluble at high temperature.  S. solfataricus proteins aL7a, aFIB (wild type and mutants) and aNOP56.  The genes encoding the S. solfataricus proteins aL7a, aFIB and aNOP56 (accession numbers S75397, NP342426 and AAK41215) were amplified by P C R and cloned between the Ncol and BamHI sites of pET3d (aL7a, aFIB) or Ncol and EcoRI sites of pET28a (aNOP56). The aL7a gene was amplified with primers AO66 and A 0 6 7 , the aFIB gene was amplified with primers AO70 and A071 and the aNOP56 gene was  36 amplified with primers SZ102 and SZ103. As a consequence of Ncol cloning, the three respective proteins contain the following amino acid replacements at the cloning site: N2D, S2A and M 2 V . Following expression and thermo-precipitation, the lysate containing the heat soluble aL7a protein was applied to a 20 ml DEAE-Sepharose column (Pharmacia) equilibrated in buffer C (50 m M Bis-Tris buffer, pH 6.5, 50 m M NaCl, 10 m M DTT). In these conditions most of the E. coli proteins were retained on the column while the aL7a protein (predicted pi, 7.01) was recovered in the flow-through, concentrated on centrifugal filters (Centricon, Millipore) and applied to a size exclusion column (Superdex 75, 10/30, Pharmacia). Peak fractions containing the purified aL7a protein were pooled and concentrated (8.3 uM; calculated molecular weight of 14.4 kDa). To purify aFEB protein (predicted pi, 8.33), the induced cell lysate was heatdenatured and clarified by centrifugation; the heat soluble protein was loaded on a 20 ml bed DEAE-Sepharose column (Pharmacia) equilibrated in buffer B (50 m M Tris-HCl, p H 8.5, 50 m M NaCl, 10 m M DTT). The aFIB protein, collected in the flow-through, was applied to a gel filtration column as described above. Fractions containing purified aFIB were pooled and concentrated (96 uM; calculated molecular weight of 27 kDa). Similarly, aNOP56 protein (predicted pi, 9.85) from the induced cell lysate was separated by heat-denaturation, clarified by centrifugation and loaded on to a 20 ml DEAE-Sepharose column equilibrated in buffer D (50 m M Tris-HCl buffer, pH 7.5, 200 m M NaCl, 10 m M DTT). Approximately 75% of the total aNOP56 was retained on the column and recovered at 400mM NaCl using step elution. The protein was further purified by gel filtration as described above (10 u M ; calculated molecular weight 48 kDa). The recombinant aL7a, aFEB and aNOP56 proteins were stored at 4°C up to two months with no apparent loss of activity. Site-specific mutations in the S. solfataricus aFEB gene were generated by multistep P C R mutagenesis. In each case two primers complementary to each other and containing the desired mutation were synthesized. For each mutant, the reverse mutagenic primer was used in combination with a forward primer derived from the 5' end of the aFIB gene and the forward mutagenic primer was used in combination with a  37 reverse primer from the 3' end of the aFEB gene. The two P C R products, representing overlapping 5' and 3' fragments of the gene were gel purified, mixed together and used as template along with the 5' and 3' primers in a third P C R reaction. In both cases the product was sequenced and shown to be a full length Fibrillarin gene containing the desired mutation. The mutant genes were digested with Ncol and BamHI and cloned into the pET3d expression vector linearized with the same restriction enzymes. The two mutagenic primers used to generate the A85V mutation were HE70 forward and HE71 reverse. The two mutagenic primers to generate the P129V mutation were HE83 forward and HE84 reverse. The two primers at the 5' and 3' end of the fibrillarin gene were AO70 and A 0 7 1 . The recombinant proteins were expressed in E. coli BL21(DE3) (aNOP56), E. coli BL21 (DE3)pLysS (aFEB) or E. coli BL21 (DE3)pLysE (aL7a) and initially separated from the majority of host E. coli proteins by thermoprecipitation, as described above.  2.3  POLYCLONAL ANTIBODIES PREPARATION AND USE  2.3.1  Animal Immunization Five New Zealand, white female rabbits were used for immunization at the U B C  Animal Care Center. Two rabbits were immunized with S. acidocaldarius Fibrillarin antigen and three other animals received S. acidocaldarius NOP56, S. solfataricus aL7a and S. solfataricus aFib antigens. Recombinant proteins were produced in large scale cultures (1-2L) and partially purified as described in section 6.2.4, resulting in 0.5-1 mg/ml overexpressed protein. The purified material was loaded on a preparative 10-12% SDS-PAGE gel, and the overexpressed proteins visualized by copper staining of the gel. This method proved to be a more sensitive method compared to the Coomassie brilliant blue staining. Essentially, after electrophoresis the gel was rinsed briefly with distilled water over 30 seconds. Longer washes would elute the traces of Tris buffer and SDS required for the reaction with CuCEi stain solution. The gel was then incubated at room temperature with 5 volumes of 0.3 M CuCl2, under continuous agitation, for 5 minutes. As the CuCl2 enters  38 the gel, a white precipitate formed in the regions where proteins are not present, while protein bands appeared clear, leaving a negative image of the polypeptide separation pattern. The gel was flushed several times with distilled water, the bands corresponding to overexpressed fibrillarin and NOP56 observed against a dark background and excised. The residual CuCb was removed during the next hour by incubating the gel slices in a solution containing 0.25 M E D T A and 0.25 M Tris, pH 9. The excised gel fragments were lyophilized, ground to a fine powder in a mortar and prepared as a 0.5 ml slurry with PBS buffer (130 m M NaCl, 8 m M N a H P 0 , pH 2  4  7.2). The slurry was emulsified with an equal volume of Complete (initial immunization) or Incomplete (subsequent injections) Freund's adjuvant and used for injection. During each immunization 100-150 fig of overexpressed protein were injected subcutaneously (initially) or intramuscularly (boost injections) into the rabbits. Four injections were administrated and test blood samples were collected ten days after each immunization. After the fifth immunization the animals were exsanguinated and the blood collected and processed for sera separation. The serum was divided in 1.5 ml fractions and stored at -20°C.  2.3.2  Immunological Procedures  Immunoblotting Protein samples were separated on a 12% SDS-PAGE and electroblotted onto Immobilon P membrane (Millipore) by wet transfer using a Trans-Blot electrophoretic transfer cell (BioRad). After transfer, the membrane was flush-rinsed in distilled water and incubated for 1 hour in the blocking agent: 5% skim milk in PBS-T (PBS buffer containing 0.1 % Tween 20). The membrane was washed once for 15 minutes and two times for 5 minutes in PBS-T buffer and next immersed for 1 hour in PBS-T buffer containing the primary antibody. The optimum dilution for the Sac and Sso anti-aFIB sera was 1/10000, while a 1/25000 dilution of the Sac anti-aNOP56 sera and Sso anti-aL7a was required. Following the three times wash procedure described above, the blot was incubated for one additional hour in PBS-T buffer containing 1/2000-1/40000 secondary antibody (donkey anti-rabbit Ig, coupled to horseradish peroxidase, Amersham). The  39 washing cycles were repeated and the membrane subjected to detection using the Amersham E C L detection kit.  Immunoprecipitation of cellular complexes  Total S. acidocaldarius extract (10-15 mg proteins/ml) and individual fractions obtained after fractionation of the cell lysate on glycerol/sucrose gradients were subjected to immunoprecipitation using Protein A Sepharose™ 6 M B (Pharmacia) coupled to the appropriate anti-sera. The procedure was as described by Aris et al. (2). Essentially, 50250 ul of settled ProteinA Sepharose beads were incubated with shaking, 12 hours at 4°C, in presence of 20-100 pd of antibody solution, in PJPA buffer: 50 m M Tris-HCl, pH 7.5, 150 m M NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate and 0.1% SDS. Following three times washes in the RLPA buffer, the antigen-containing material was added and incubation was continued for 12-14 hours, at 4°C. The Sepharose-protein complexes were washed with RLPA buffer and either resuspended in SDS gel-loading buffer (50mM Tris-Cl, pH 6.8, 100 m M DTT, 2% SDS, o.l%> bromophenol blue and 10% glycerol) for analysis of imunoprecipitated proteins, or deproteinizated by phenol/chloroform extraction, for analysis of the RNAs coimmunoprecipitated by the antibodies.  Immunoprecipitation o f in vitro reconstituted complexes, containing a F i b mutants  The s R l transcript (1 pmole), 3' end labeled with [ P]-pCp as described in 32  section 2.9.3, was incubated with various combinations of aL7a, aNOP56, and either wild type aFIB or one of the aFib mutants (20 pmoles of each protein) at 70°C for 15 min in a 100 ul reaction volume. Rabbit anti-&o aFIB sera (20 ul) was incubated for two hours at room temperature with 100 ul of settled protein A-sepharose suspension in the binding buffer: 25 m M phosphate buffer, pH 7, 100 m M NaCl and I m M M g C l . Excess unbound 2  antibodies were removed by three 10 minutes washes in the same buffer. The complexes resulting from different RNA-protein combinations were then added to the preformed protein A-anti aFIB beads in the binding buffer and incubation was continued for 30 minutes at room temperature. Unbound material was removed by three 10 minutes washes in the same buffer. The R N A present in the bound material was recovered  40 following phenol/chloroform extraction, run on a denaturing polyacrylamide gel and visualized by autoradiography.  2.4  I D E N T I F I C A T I O N A N D C L O N I N G O F S. acidocaldarius S M A L L R N A s  Coimmunoprecipitated RNAs were 3'-end labeled using the method described in section 2.9.3, separated on a 6% polyacryalmide gel containing 8 M urea and visualized by autoradiography. For cloning, a RT-PCR procedure was employed. Based on the R N A profile observed on the autoradiogram, the RNAs extracted from immunoprecipitates were separated on a preparative denaturing 6% polyacryalmide gel and selected by size. The gel region containing RNAs between 50 and 150 nucleotides was cut and the RNAs were recovered by electroelution. 40-70 pmoles of primer AO30 were used to anchor the purified RNAs at their 3'-end. To direct the anchor uniquely at the R N A 3'-end, the primer was 5'-phosphorylated using A T P and T4 Polynucleotide Kinase and next, 3'blocked. In the 3'-end blocking reaction ddCTP was 3'-end ligated to the AO30 primer using the Terminal Deoxynucleotidyl Transferase (GibcoBRL), following the procedure indicated by the manufacturer. The modified AO30 primer was subsequently ligated to R N A . A n equivalent amount, 40-70 pmoles of antisense oligonucleotide A 0 3 1 was next used to initiate reverse-transcription of the D N A - R N A chimera. The specific reaction conditions included an annealing step 4 minutes at 65°C, followed by the reverse transcription using the Thermoscript™ RT-PCR System (Gibco-BRL). The reaction was conducted for 30 minutes at 55-58°C and terminated by shifting the temperature to 85°C, for 5 minutes. The R N A template was degraded by the addition of RNase H and further incubation at 37°C, for 20 minutes. The first cDNA strand was next poly-A tailed in the presence of dATP and Terminal Deoxynucleotidyl Transferase. Finally, the c D N A was amplified in a standard PCR reaction using the primers A031 and A 0 3 2 .  41 2.5  In vitro T R A N S C R I P T I O N O F G U I D E A N D T A R G E T RNAs  The clone pPD1260 containing the S. acidocaldarius s R l c D N A inserted between the EcoRI and BamHI sites of plasmid p G E M 3Zf(+) was linearized with BamHI and used as template in a T7 R N A polymerase transcription reaction to generate s R l sRNA. Uniformly labeled s R l transcript was generated by reducing the appropriate NTP concentration to 13 [iM and including 10 juCi of the corresponding ct-[ P]-NTP in the 32  reaction. End-labeled s R l was generated using [ P]-cytidine-5', 3'-bis-phosphate (pCp) 32  and T4 R N A ligase as described in section 6.9.3. To generate target R N A , a 112 bp fragment of r D N A spanning the predicted site of methylation (position U52) was amplified by P C R from S. acidocaldarius genomic D N A using primers A063.1 and A065. The product was cleaved with Smal (at position 69 in rDNA). The resulting 51 bp fragment was purified by gel electrophoresis and used as a template in a T7 transcription reaction. The sequence of the generated target R N A product is 5 ' - G G G A U A A G C C A [ U ] G G G A G U C U U A C A C U C C C - 3 ' where the expected site for methylation is bracketed. The T7 templates used to transcribe mutant guide R N A were generated by P C R using plasmid pPD1260 as template and T7 and HE45 primers. The T7 template used to transcribe mutant target R N A was generated from a partially single stranded D N A template, by annealing the T7 promoter primer to the oligonucleotide OSZ117. Where required, P C R products were sequenced to insure that they contained the expected substitutions or alterations.  2.6  GEL-RETARDATION  ASSAYS  A constant amount of uniformly labelled S. acidocaldarius s R l R N A (0.2 pmoles) was either mock treated or mixed with serial dilutions of recombinant aL7a protein (0.25, 0.5, 1, 2, 4, or 8 pmoles) in binding buffer A (25 m M phosphate buffer, pH 7, 100 m M NaCl and I m M MgCl ) in a 10 fil volume reaction. After 10 minutes incubation at 70°C, 2  1 ill of the loading buffer (1% bromophenol blue, 10% glycerol) was added and 5 /zl of the mixture were loaded on a 10 % nondenaturing polyacrylamide gel containing 25 m M  42 phosphate buffer, pH 7. The gel was run in 50 m M phosphate buffer, pH 7 at 150V, for 2 hrs at room temperature. The distribution of free (sRl) and retarded R N A (sRl-aL7a; complex I) was visualized by autoradiography. The nonspecific R N A binding activity of aL7a was tested using in vitro transcribed S. acidocaldarius  RNase P R N A , tRNA Gly or  R N A transcribed from the polylinker region of pGEM3Zf(+). Competition assays contained aL7a protein (1 pmole), radiolabeled s R l (0.2 pmole) and competitor R N A (0.02 to 20 pmoles of non radioactive s R l or RNase P RNA). The same procedure as described above was used to assemble higher order complexes consisting of sRl-aL7aaNOP56 (complex II) and sRl-aL7a-aNOP56-aFEB (complex III), except that the amount of each of the included proteins was 1 pmole. These larger complexes were routinely resolved on a 6% nondenaturing polyacrylamide gel prepared as described above.  2.7  In vitro M E T H Y L A T I O N A S S A Y S  Equimolar amounts (720 pmoles) of sRl guide R N A and target R N A were mixed (final volume of 30 ju.1, in 25 m M phosphate buffer, pH 7 and 50 m M NaCl ), denatured by incubating for 1 min at 95°C and renatured by cooling rapidly to 55°C. The RNAs were added at 0°C to a 90 ul volume containing aFIB, aNOP56 and aL7a (24 pmoles of each) and [ H]-methyl S A M (360 pmoles, 3.9 Ci/mmol, Amersham) in the same buffer 3  supplemented with MgCl2 to I m M . Aliquots (20 ul) were removed and transferred to 70°C. after 10, 20 30, 60 or 120 minutes the individual 20 ul samples was removed and precipitated at 0°C for 10 minutes with 5% trichloroacetic acid. The precipitates were collected on 0.2 um nitrocellulose filters (Sartorius), dried and radioactivity was measured by scintillation counting.  2.8  T L C ANALYSIS OF MODIFIED NUCLEOTIDES  Target R N A was transcribed in vitro in the presence of a-[ P]-GTP or -UTP. Guide and 32  radiolabeled target RNAs were mixed in 20 ul reactions in the standard methylation assay and incubated at 70°C for one hour. In the reaction using o>[ P]-UTP labelled target 32  R N A , radiolabeled [ H]-methyl S A M was used as substrate to generate a product R N A 3  43 that contained both [ P]- and [ H]-radioactivity. The RNAs were extracted with 32  3  phenol/chloroform from the reaction mixes, precipitated and resuspended in 4ul of 50 m M Na acetate, pH 5.2 and digested with 20 units of RNase T2 (GibcoBRL) or 0.3 units of PI (Roche Diagnostics GmbH) for 12 hours at 37°C. Digested RNAs were mixed with 5 nmoles of pU(methyl)G dinucleotide standard (Dharmacon Research Inc., Lafayette CO) and analyzed by 2D-TLC on thin-layer cellulose plates (10cm x 10 cm, Merck) using  the  following  chromatographic  system:  first  dimension,  isobutyric  acid/concentrated NH4OH/H2O (66:0.5:33.5. v/v/v); second dimension, 0.1M sodium phosphate,  pH 6.8/ammonium  sulphate/n-propanol  (100:60:2,  v/w/v). Unlabeled  dinucleotide was detected by U V irradiation and [ P]- radiolabeled spots were identified 32  by autoradiography using standard 2D-TLC maps as described (3). In the double label experiment showed in Figure 5.4 D, page 117, the spots designated as pU(methyl)G, Y and G M P were excised from the plates and [ H]-methyl content was analyzed by 3  scintillation counting.  2.9  STANDARD M O L E C U L A R BIOLOGY TECHNIQUES  2.9.1  Polymerase Chain Reaction (PCR)  The reaction was routinely used to amplify genes from Sso and Sac and to engineer new constructs. A n ERICOMP Twin Block™ Thermocycler was used and although specific parameters varied depending on the particular experiment, the program constantly included: first, a denaturation step at 95°C, for 30 seconds; second, an annealing step two degrees below the melting temperature of the primer (calculated as the sum of 2x[number of A+T] and 4x[number of C+G]), usually 40 seconds; and third, an extension step at 72°C , for 45-60 seconds. The high fidelity PWO D N A polymerase was used in all the studies involving gene amplification.  2.9.2  D N A Sequencing  A l l D N A sequencing reactions were performed using the dideoxy chaintermination method developed by Sanger. Sequencing was done using the Thermo  44 Sequenase Radiolabeled Terminator Cycle Sequencing Kit (United States Biochemicals), following the manufacturer's procedure.  2.9.3  End Labeling and Tailing of Nucleic Acids  5'-End labeling of DNA Oligonucleotide and D N A fragments were 5'-end labeled using [Y^PJATP and the T4 Polynucleotide Kinase (Gibco BRL). The buffer was supplied by the manufacturer. A typical kination reaction containing 10 pmoles of primer, 30 /xci [y^PJATP (10 pmoles, specific activity 3000 Ci/mmol) and 10 U of T4 Polynucleotide Kinase was incubated in a 25 /xl reaction volume for 30 minutes at 37°C. Ammonium acetate (0.5 M final concentration) and glycogen (10 /Jg/ml) were then added and the volume was adjusted to 200 / i l with dfkO. The labeled primer was precipitated in 95% ethanol, dried and resuspended in an appropriate volume (50 (il) of QH2O, based on the apparent incorporation of isotope. The same general procedure was applied to phosphorylate the oligonucleotide AO30, with the modification that nonisotopic A T P served as phosphate donor instead of the radiolabeled nucleotide.  3'-End labeling of RNA R N A specieswere 3'-end labeled using T4 R N A Ligase (New England BioLabs) and [5- P]pCp ( P-cytidine-5', 3'-bis-phosphate). The standard reaction contained 10 /xci [5'- P]pCp (3000 Ci/mmol), 1/ig R N A , 10 U T4 R N A Ligase, 50 m M HEPES, pH 32  8.3, 0.1 m M ATP, 10 m M M g C l , 3.3 m M DTT, 10% D M S O and 20 U RNase inhibitor. 2  The reaction was incubated for 24 hours at 4°C, phenol/chloroform extracted, ethanol precipitated and redisolved in gel sample loading buffer. The same basic procedure was employed to ligate single stranded D N A (5'-phosphorylated oligonucleotide AO30) to R N A moieties.  45 2.9.4  R N A Extraction 200 ml of exponentially growing Sac or Sso culture was routinely used for total  R N A extraction. The cells were permeabilized by the addition of 20% ethanol and 1% phenol, final concentration. Next, the cells were pelleted by centrifugation at 5,000 rpm for 10 minutes, washed once in DEPC treated-dH 0 and resuspended in the lysis 2  solution: 4 M guanidinium thiocyanate, 25 m M sodium citrate, 0.5% N-Lauryl Sarcosine and 0.1 M 2-mercapto-ethanol. The clear lysate was mixed with 0.5 volumes of 2 M sodium acetate p H 4-5, then phenol/chloroform extracted, precipitated, resuspended a second time in the lysis solution and the phenol extraction/ precipitation repeated. Finally, the R N A pellet was resuspended in 500 id of DEPC treated-dt^O and the yield and purity estimated on 1% agarose gel, by comparison with an R N A standard.  2.9.5  Primer Extension Typical primer extension experiments were used to detect and map 5'-ends of  R N A ; primer extension performed in conditions of limited nucleotide concentration served to map ribose methylated nucleotides in rRNA. Primers sl-sl8, E19-E29 helped to map the in vivo ends of small RNAs aFLB/aNOP56-associated. Approximately 0.2-0.5 pmoles of 5'-end labeled primer was coprecipitated with 3-5 fig of S. acidocaldarius  total  R N A and resuspended in 10 til of 50 m M Tris-HCl pH 8.3, 75 m M KC1, 10 m M DTT. A n annealing step was included and consisted in incubating the mixture at the primer's Tm for 4 minutes. c D N A synthesis was started by adding to the annealed mix 200 U Moloney Murine Leukemia Virus reverse transcriptase ( M - M L V RT, Gibco B R L ) in the buffer supplied by the manufacturer and I m M dNTPs. The reaction proceeded 30 minutes at 37°C. The extension products were precipitated, dried and redisolved in 10-20 JU.1 of gel loading buffer prior to separation on a 6-8% poyacrylamide-urea gel. In parallel, a sequence ladder was generated and run alongside the extension products. The ladder was obtained using the same primer utilized in the primer extension and the c D N A clone as template. Primers A 0 3 5 , AO40, A041 and A044-A047 were used to map methylation sites present in R N A . For this purpose, the basic condition for the primer extension remained unchanged, while the nucleotide concentration in the reaction was lowered to 4  46 uM. In these conditions when the R N A template contained a ribose methylated nucleotide, the reverse transcriptase paused one nucleotide before the modified site, resulting in a shorter extension product.  Alkaline hydrolysis of R N A This experimental approach served as a second method to map methylation sites on the rRNA. 3-6 ug of total R N A was hydrolyzed prior to the standard primer extension, by incubation in 50 m M Na C03 at 95°C for 5 minutes. 2  2.9.6  Gel Electrophoresis  Native gels Agarose slab gels (1-2%) were routinely used for resolving D N A fragments over 100 bp in length. Electrophoresis was performed in a Pharmacia GNA-200 Gel Electrophoresis Apparatus in 0.5xTBE (45 m M Tris-Borate, pH 8.5 and 1 m M EDTA), containing ethidium bromide for visualization of nucleic acids by U V light. Samples were electrophoresed at 100-150 V using a Pharmacia EPS 500/400 Power Supply. D N A fragments smaller than 100 bp were resolved on 6-10% non-denaturing polyacryalmide gels, in 0.5xTBE buffer, using the BioRad Mini Protean II system. D N A fragments were then stained by soaking the gel in an ethidium bromide solution (10 jLtg/ml), for 15 minutes. Both agarose gels and non-denaturing polyacryalmide gels were used for the isolation and purification of D N A restriction fragments or R N A species. The ethidium bromide-stained bands were excised from the gel, introduced in dialysis tubing (Spectrum Spectra/Por molecular porous membrane) and electroeluted in 0.5xTBE buffer, at 100 V for 0.5-2 hours, depending on the fragment size. The eluted material was extracted with phenol/chloroform, ethanol precipitated, dried and resuspended in dHjO. As size markers 1 kbp, 100 bp or 50 bp ladders (Pharmacia) were used.  47 Denaturing Gels 6-8% polyacrylamide gels containing 8 M urea were used to separate small RNAs, primer extension products and D N A sequences. Samples were boiled for 2 minutes prior to loading on the gels, in the sample buffer'containing bromophenol blue and xylene cynol dye markers. Samples were electrophoresed in 0.5xTBE buffer using Pharmacia ECPS 3000/150 Power Pack at 32 W constant power (1800-2000 V ) . Gels were then transferred to Whatmann filter paper and dried on the BioRad Model 583 Gel Dryer.  2.9.7  Computer-Related Applications  Database Searches Homology searches for the cloned Sac small RNAs were performed using B L A S T N program against the nonredundant nucleotide database. The algorithm for searching genomic sequences for 2'-0-ribose methylation guide snoRNA genes was developed by Todd Lowe in Sean Eddy's laboratory, at Washington University School of Medicine (4).  2.9.8  Graphics, Figures and Illustrations  Autoradiograms were scanned using a U M A X Astra 600S scanner with transparency adapter. Image contrast and brightness was adjusted, and images cropped using Corel Photo-Paint 9.0. Images and figures were labeled using Corel Draw 9.0.  2.10  REFERENCES  1. Sambrook J, Fritsch EF and Maniatis T. (1989) Molecular cloning - a laboratory manual. Cold Spring Harbor Laboratory Press, pp 9.31-9.57.  48 2. Wu P, Brockenbrough JS, Metcalfe A C , Chen S, Aris JP. (1998) Nop5p is a small nucleolar ribonucleoprotein component required for pre-18 S r R N A processing in yeast. J. B i o l . Chem. 273(26): 16453-16563.  3. Keith G. (1995) Mobilities of modified ribonucleotides on two-dimensional cellulose thin-layer chromatography. Biochimie. 77(1-2):142-144.  4. Lowe T M , Eddy SR. (1999) A computational screen for methylation guide snoRNAs in yeast. Science. 283(5405): 1168-1171.  49  CHAPTER 3 INITIAL IDENTIFICATION OF SMALL RNAs IN ARCHAEA Summary In eukaryotes, dozens of post-transcriptional modifications are directed to specific nucleotides in ribosomal RNAs (rRNAs) by small nucleolar RNAs (snoRNAs). We have identified homologs of snoRNA genes in both branches of the Archaea. Eighteen small sno-like RNAs (sRNAs) were cloned from the archaeon Sulfolobus  a c i d o c a l d a r i u s by co-  immunoprecipitation with aFEB and aNOP56, the archaeal homologs of eukaryotic snoRNA-associated proteins. A probabilistic model was trained on these sRNAs to search for more sRNAs in archaeal genomic sequences. Over 200 additional sRNAs were identified in seven archaeal genomes representing both the Crenarchaeota and the Euryarchaeota. Small nucleolar R N A based rRNA processing was, therefore, probably present in the last common ancestor of Archaea and Eukarya, predating the evolution of a morphologically distinct nucleolus. Introduction Ribosome biogenesis in Eukarya occurs in the nucleolus. Several proteins, including fibrillarin, Nop56 and Nop58, and dozens of snoRNAs are involved in this process (1-4). The snoRNAs can be divided into two major classes: C/D box and H / A C A box RNAs (see Figure l a and b, p. 3). The C/D box snoRNAs are efficiently precipitated with antibodies against fibrillarin. Most C/D box snoRNAs are involved in targeting ribose methylation within rRNA, whereas most H / A C A box RNAs are involved in targeting the conversion of uridine to pseudouridine within rRNA (5-11). The  general mechanism whereby C/D box snoRNAs target ribose methylation has  been well established. Each snoRNA contains a 9 to 21 nucleotide (nt) long sequence located 5' to the D or D' box motif that is complementary to an r R N A target sequence. Methylation is directed to the rRNA nucleotide that participates in the base pair 5 nt upstream from the start of the D or D ' box. It is likely that most, i f not all, r R N A ribose methyl modifications are guided by snoRNAs. In the yeast Saccharomyces  cerevisiae,  50 methylation guide snoRNAs have been assigned to all but four of the 55 rRNA ribose methylation sites (12). SnoRNAs, ubiquitous in Eukarya, have not been found in Bacteria or Archaea. Interestingly, the r R N A of the archaeon Sulfolobus  solfataricus  (Sso) has been shown to  contain 67 ribose methylation sites, a number similar to that found in eukaryotes (13). Even though Archaea are unicellular prokaryotic organisms that lack a nucleolus, their genomes encode homologs to the essential eukaryotic nucleolar proteins, fibrillarin and NOP56/58 (14, 15). Based on these observations, we decided to examine Archaea for the presence of sno-like RNAs.  Sulfolobus acidocaldarius has a F I B , a N O P 5 6 and C / D box s R N A s  To isolate sno-like RNAs from the archaeon Sulfolobus  a c i d o c a l d a r i u s (Sac),  we  cloned the archaeal homologs to the eukaryotic fibrillarin (aFIB) and NOP56/58 (aNOP56) proteins using sequence information from a related species, S. solfataricus  and  following the procedure described in sections 2.2.2 to 2.2.4, in Chapter 2. The cloned genes were expressed in E s c h e r i c h i a coli and the recombinant proteins were purified (see Appendix 1, page 126) and used to raise polyclonal antibodies in rabbits (see section 2.3.1, Chapter 2). The two antibody preparations were each highly specific and recognize single polypeptides of the predicted size in total S. a c i d o c a l d a r i u s cell extracts (Figure 3.1 A , control lanes). To achieve a partial purification of aFEB and aNOP56 containing complexes, an ammonium sulfate-glycerol gradient fractionation of crude cell lysate was used. Following the sedimentation step, the antibodies were used first to monitor the size distribution of particles containing aFEB and aNOP56 in the gradient (Figure 3.1 A ) (16). Both aFEB and aNOP56 sedimented as a large heterogeneous complex ranging from about 4S to greater than 50S in size. To  detect RNAs that associate with aFIB- and aNOP56-containing complexes,  aliquots from gradient fractions were immunoprecipitated with either anti-aFIB or antiaNOP56 antibodies. Total R N A was extracted with phenol from the supernatants and the pellets, and a portion from each was 3' end-labeled with P-cytidine-5',3'-bis-phosphate 32  (pCp)  and displayed by denaturing P A G E (Figures 3.1 B and C). Only about 0.1% of the  R N A in each fraction was coprecipitated with the antibody, while the bulk of the  RNA  51 was  retained  in the  supernatant. The most  abundant  RNAs  that were  co-  immunoprecipitated appear as a family of discrete bands ranging in length from about 5070 nt. This size class of RNAs, which is substantially shorter than eukaryotic C/D box snoRNAs, was invisible when total cellular R N A was labeled with pCp (compare "total R N A " lane with P lanes in Figure 3.1 B and C). To obtain c D N A clones, the RNAs precipitated from fraction 5 with anti-aFLB and from fractions 6-8 and 10-13 with antiaNOP56 were gel purified, ligated to the oligonucleotide oAO30, and used as template for RT-PCR, as described in section 2.4 in Chapter 2 (17). The products were cloned between the PstI and Xhol sites of plasmid pSP72. A total of 104 clones from the two immunoprecipitated R N A pools was sequenced. From these, one or more representatives of 18 different sequences that exhibited features characteristic of eukaryotic C/D box snoRNAs were recovered (Table 3.1) (5-10). Other clones contained small fragments of S. acidocaldarius  16S, 23S and 5S rRNAs. Three of  the sRNA clones, Sac sR5, sR14, and sR18, were independently recovered from the two different immunoprecipitations. This was expected since anti-aFLB coprecipitates aNOP56 and anti-aNOP56 coprecipitates aFIB from crude cell extracts (see Appendix 2, page 127). A l l 18 clones contained well-defined and highly conserved C ( A U G A U G A ) and D (CUGA) box motifs located near their 5' and 3' ends, respectively. A l l contained recognizable internal C and D' box motifs, giving the RNAs a dyad repeat structure characteristic of eukaryotic methylation guide snoRNAs (18). Primer extension analysis was used to confirm the presence of the sRNAs in total R N A extracted from S. acidocaldarius  (Figure 3.2). Primers were designed to overlap the  common D box motif and extend through the unique guide region and into the C box motif of s R l to sR17 (the clones of sR18 were recovered later and not verified). Extension products were obtained for all sRNA-specific primers. A subset of these is illustrated in Figures 3.2 A and B. The lengths of the products for all sRNAs were within two nucleotides of the 5' ends of the c D N A except for sR3, 4, 6 and 8 that were between three and five nucleotides longer than the respective c D N A  clones. Southern  hybridizations have confirmed the existence of single copy genes for s R l , sR2, sR5, and sR13 in S. acidocaldarius  genomic D N A (see Appendix 3, pagel28).  To find additional homologs of the cloned S. acidocaldarius  sRNA genes, we ran  52 BLASTN  on each c D N A clone against the non-redundant  nucleotide database  (http://ncbi.nlm.nih.gov. 06/15/99) (19) and recovered two weak hits against sequences in other Sulfolobus  species: Sac sR3 had a hit near the Sulfolobus  shibatae  top6B  topoisomerase II gene (score 40.1 bits, expect value 0.038), and Sac s R l had a hit near the S. solfataricus  aspartate aminotransferase gene (score 38.2 bits, expect value 0.15).  Although these candidates contained canonical C and D boxes, their authenticity as true sRNAs remained questionable due to their low scores. We tested for the presence of the Sac s R l homologue by primer extension analysis using S. solfataricus  R N A as template.  A product with a length similar to that of Sac s R l was detected (Figure 3.2 C), and was designated Sso sRl. Primer extension products for cloned S. a c i d o c a l d a r i u s RNAs s R l sR17  and the apparent S. solfataricus  s R l homologue clearly demonstrate the existence  of archaeal snoRNA-like C/D box sRNAs.  Methylation sites in Ribosomal R N A To determine i f these sRNAs might function as guides for ribose methylation as in eukaryotes, the sRNAs were examined for potential guide sequences by comparison to S. a c i d o c a l d a r i u s rRNA (20-24). Regions complementary to r R N A and adjacent to the D or D' boxes were identified for 14 of the sRNAs (Table 3.2, see legend for guide criteria). Using the D/D' box plus 5 nt rule, we predicted the locations of potential ribose methyl modifications in rRNA and experimentally tested for some of these sites using the deoxy nucleotide triphosphate (dNTP) concentration-dependent primer extension assay (12, 25 and section 2.9.5 in Chapter 2). In this assay, characteristic ribose 2'-0-methyl sites cause pauses that are displayed in the reverse transcriptase reactions at low- but not at high-dNTP concentrations. We identified characteristic pause sites at six predicted sites of methylation in S. a c i d o c a l d a r i u s rRNA (Table 3.2). Several examples are shown in Figure 3.3. Both Sac s R l and Sso s R l were predicted to target methylation to position U52  in the respective 16S rRNAs; pause sites were detected at this position in both  rRNAs (Figure 3.3 A ) . Two of the Sac sRNAs, sRIO and sR14, exhibit strong complementarities to S. solfataricus  tRNAs (Table 3.2). The target nucleotide for sR14 is  C34, the anticodon "wobble" base, which is commonly ribose methylated in eukaryotes (26). Not all eukaryotic C/D box snoRNAs containing complementary regions participate  53 in ribose methylation (i.e., U3 and U8), so methylation guide function should not be assumed for all archaeal C/D box sRNAs. Gene disruption systems for S. a c i d o c a l d a r i u s and most other Archaea are currently not available; consequently, we were not able to verify loss of predicted methylation sites upon disruption of sRNA genes. However, our evidence suggests that many of these sRNAs function as guides for ribose methylation, as in eukaryotes.  A Computational Screen for Additional Archaeal sRNAs We next asked whether sRNAs are found in other Archaea. We "retrained" a previously developed eukaryotic snoRNA search program with the verified S. acidocaldarius  sRNA genes (this part of the work was done by Todd Lowe, at  Washington University)(12). We first searched the genome sequence of the closely related archaeon S. solfataricus  (33 a).  The program identified dozens of sRNA  candidates, each of which had the potential to target a modification to a particular position in rRNA. Primers were designed against the 20 top-scoring candidate sRNAs and primer extensions, using S. solfataricus  R N A as template, were performed to detect  stable RNAs (Todd Lowe, unpublished results). Ten (sRl to sRIO) all ranking within the top 13 candidates by score, generated products of anticipated' size, 2 to 6 nucleotides upstream of the predicted C box. A n alignment of the 10 verified S. solfataricus  sRNAs,  plus three high-scoring, untested sRNA predictions ( s R l l to sR13) is available as supplemental information at www. sciencemag.org/feature /data/1047007.shl; all newly identified  archaeal  snoRNAs  and  annotation  are  also  available  at  ma.wustl.edu/snoRNAdb/. Six predicted target ribose methylation sites were assayed with the dNTP concentration-dependent primer extension assay, and four showed reverse transcription pauses characteristic of ribose methylation (Figure 3.3). Three additional target site predictions are known to be modified at the homologous position in S. a c i d o c a l d a r i u s 16S rRNA (20).  sRNAs in Both Main Branches of the Archaea Sulfolobus  is a member of the Crenarchaeota, one of the two main phyla of Archaea  (14); the other phylum, the Euryarchaeota, is evolutionarily distant. Complete genome  54 sequence data are available from Archaeal species covering a wide range of genera, including both the Crenarchaeota (33 b), and the Euryarchaeota (33 c-g). In searching these genomes for guide sRNAs, we found strong candidates in six of the seven species (supplemental information). The searches of the M. jannaschii (Mja) and A. fulgidus (Afu) genomes gave eight and four strong sRNA hits, respectively; guide regions in most of these candidates exhibit complementarity to rRNA (supplemental information). The presence of all eight sRNAs Mja sRNA was confirmed by primer extension on M. jannaschii total RNA(supplemental information). We attempted to verify seven of the ribose methylation sites predicted by the Mja sRNAs. Five sites showed concentration-dependent pauses indicative of ribose methylation, and the two other sites showed concentration-independent  pauses,  inconclusive for ribose methylation. As an example pause site predicted by Mja-sR6  at  position C2034 in 23S r R N A is shown (Figure 3.3 D). The D box guide region of MjasR8 predicts methylation of the anticodon wobble base for the intron-containing precursor of tRNA-Met. We did not test any tRNAs for ribose modifications, although the wobble base in tRNA-Met is known to be ribose methylated within another hyperthermophilic crenarchaeon (27). The sRNA complementarity spans the tRNA exon/intron junction. The search of the Aeropyrum pernix (Ape) genome produced 23 candidate sRNAs (supplemental material). There were no strong sRNA hits in the genome of M.  thermoautotrophicum.  Pyrococcal s R N A families The genomes of three Pyrococcus  species have been sequenced: P. horikoshii  (Pho), P. furiosus (Pfu), and P. abyssi (Pab). These related sequences enabled us to infer support for sRNA predictions using comparative sequence analysis. From separate genome searches followed by comparative analysis, we identified 57 groups of homologous Pyrococcus sRNA genes (for each Pyrococcus group, the sequence identity for end-to-end alignments of interspecies members was 80-98%). Forty-seven groups were found in all three species, eight were found in only two species, and two were unique to single species. Examples of two of these groups, sR3 and sR4, are illustrated (Figure 3.4), and the complete set is available online, as are the alignment, annotation,  55 and genomic distribution of the candidate sRNAs found in P. h o r i k o s h i i (supplemental material).  Conserved Sites of Methylation in 16S and 23S rRNA We asked whether predicted rRNA methylation sites occurred at homologous rRNA positions in different archaeal genera. We view our site predictions with caution, as the sRNA complementarities are short and few have been experimentally tested. Nonetheless, on the basis of an rRNA multiple alignment (28), a total of 19 predicted methylation sites were conserved between two or more genera. Figure 3.4 A shows 16S rRNA Um52, a confirmed modification in Sulfolobus, in Sulfolobus  which we predict is guided by s R l  and by sR4 in P y r o c o c c u s . However, Sulfolobus  s R l and P y r o c o c c u s sR4  also have dissimilar D' associated guide sequences that are predicted to target methylation to nonhomologous positions (16S Um33 in S. solfataricus  and 16S Am361  in P y r o c o c c u s ) . Figure 3.4 B shows that the predicted guide sequences for a site in 23S rRNA (Sac U2692, Ape U2714, and Pho U2673) contain four separate nucleotide substitutions that are matched by compensatory substitutions in 23S rRNA, strong evidence that this sRNA/rRNA interaction is evolutionarily conserved. In nearly all cases, the intergenera sequence similarity between sRNAs that predict methylation at a homologous site is limited to the interacting guide region. In only one instance, we detected some end-to-end sequence similarity between two sRNAs from different archaeal genera: P/zo-sR39 and A//a-sR6 (Figure 3.4 C). Moreover, the guide sequences can be either both in the same position (i.e., both D box associated) or in different positions (i.e., one D' and the other D box associated; see Figure 3.4 B). Therefore, simple relationships of homologous sRNAs with homologous methylation sites are not obvious, and it remains uncertain whether sRNA guide sequences directing methylation to a homologous site are related to each other by common ancestry or by sequence convergence.  Features of archaeal sRNAs In general, all the archaeal sRNAs we identified are small, usually 50 to 60 nt in  56 length, whereas human and yeast methylation guide snoRNAs average roughly 75 and 100 nt, respectively (12, 18). A much larger proportion of archaeal sRNAs appear to have the ability to guide methylation from both D ' and D boxes as "double guides." On the basis of program predictions and comparative sequence analysis among  Pyrococcus  groups, we estimate that the majority of verified and putative archaeal sRNAs have two guide regions, whereas only 20% of human and yeast snoRNAs have been reported to be double guides (12, 18). Often, the predicted target sites of double-guide sRNAs are within the same R N A molecule, and often, they are closely linked. For example, & o - s R l appears to direct methylation with D ' and D box guides to positions U33 and U52 in 16S rRNA (Figure 3.4 A). This is in contrast to yeast snoRNA double guides, in which there is no apparent correlation between molecules targeted by the same snoRNA. The number of sRNAs revealed by the search program seems to correlate with the optimum growth temperature of the organism: Pyrococcus species (95°C) have more than 50 putative sRNAs, whereas M. thermoautotrophicum  (65°C) has no easily recognizable  sRNAs. This may imply that a larger number of methylation modifications in r R N A might be required to fold or stabilize rRNA at high temperature (13) or that sRNAs are easier to recognize in hyperthermophiles because their gene features are more canonical. In eukaryotes, snoRNAs do not act solely on rRNA. A number of cellular and viral RNAs transit through the nucleolus during maturation and at least one of these, the spliceosomal snRNA U6, is a substrate for snoRNA guide-directed methylation (29, 30). Three cloned, verified Sac sRNAs (Table 3.2) do not appear to target any known stable RNAs (supplemental material), and several archaeal sRNAs exhibit complementarity to various tRNAs. Four of the sRNAs we identified (the Pyrococcus  sR40 genes and Afu  sR3) reside within the intron of the genes encoding tRNA-Trp. Our program detected these putative intronic sRNAs because they appeared to be capable of targeting methylation to sites within rRNA (18). However, Daniels and co-workers (31, 32) have independently identified these sRNAs and suggest that the D ' and D box guides are targeting methylations to positions C34 and C39 within the intron-containing precursor tRNA. These observations suggest that both ribosomal and non-ribosomal RNAs may be substrates for sRNA guide-directed methylation in Archaea.  57 Evolutionary origin and divergence of C/D box sRNAs Thus, it appears that an RNA-based guide mechanism for directing specific R N A 2'-0-ribose methylations was an established feature in the common ancestor of Archaea and Eukarya (14). In Bacteria, there is a low abundance of 2'-0-methylation and pseudouridylation in rRNA, and neither a fibrillarin homologue nor C/D box sRNAs have been described. Nonetheless, the existence of sRNA-directed modifications in bacterial stable RNAs remains a possibility.  Acknowledgements I am grateful to Todd M . Lowe and Sean R. Eddy from the Dept. of Genetics, Washington University School of Medicine for their valuable contributions to this work. I also thank Anthony G. Russell, Holger Ebhardt for expert technical assistance. Special thanks are addressed to Patrick P. Dennis for his insight and guidance. I thank J.W. Brown for generously providing M. jannaschii  total R N A used in verifying sRNA  predictions. I also thank the editors of Science magazine for the permission to reproduce this material. This chapter has been published in a modified vesion as: "Homologs of small nucleolar RNAs in Archaea". Omer, A.D., Lowe, T.M., Russell,'A.G., Ebhardt, H., Eddy, S.R., and Dennis P.P. (2000). Science. 288: 517-522.  References 1. Maxwell ES and Fournier M J . (1995) The small nucleolar RNAs. Annu. Rev. Biochem. 64: 897-934.  2. Balakin A G , Smith L and Fournier M J . (1996) The R N A world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell. 86(5): 823-834.  3. Tollervey D , Lehtonen H , Jansen R, Kern H and Hurt E C . (1993) Temperaturesensitive mutations demonstrate roles for yeast fibrillarin in pre-rRNA processing, pre-rRNA methylation, and ribosome assembly. Cell. 72(3): 443-457.  58  4. Gautier T, Berges T, Tollervey D and Hurt E. (1997) Nucleolar K K E / D repeat proteins 56p and 58p interact with lp and are required for ribosome biogenesis. Mol. Cell. Biol. 12(12): 7088-7098.  5. Cavaille J, Nicoloso M , Bachellerie JP. (1996) Targeted ribose methylation of R N A in vivo directed by tailored antisense R N A guides. Nature. 383(6602): 732-735.  6. Kiss-Laszlo Z, Henry Y , Bachellerie J-P, Caizergues-Ferrer M and Kiss T. (1996) Site-specific ribose methylation of preribosomal R N A : a novel function for small nucleolar RNAs. Cell. 85(7): 1077-1088.  7. Bousquet-Antonelli C, Henry Y , G'elugne JP, Caizergues-Ferrer M , Kiss T. (1997) A small nucleolar RNP protein is required for pseudouridylation of eukaryotic ribosomal RNAs. E M B O J. 16(15): 4770-4776.  8. N i J, Tien A L and Fournier M J . (1997) Small nucleolar RNAs direct site-specific synthesis of pseudouridine in ribosomal R N A . Cell. 89(4):565-573.  9. Michot B , Joseph N , Mazan S, Bachellerie JP. (1999) Evolutionarily conserved structural features in the ITS2 of mammalian pre-rRNAs and potential interactions with the snoRNA U8 detected by comparative analysis of new mouse sequences. Nucleic Acids Res. 27(11): 2271-2282.  10. Tycowski K T , Smith C M , Shu M D and Steitz JA. (1996) A small nucleolar R N A requirement for site-specific ribose methylation of rRNA in Xenopus. Proc. Natl. Acad. Sci. U S A . 93(25): 14480-14485.  11. Weinstein L B and Steitz JA. (1999) Guided tours: from precursor snoRNA to functional snoRNP. Curr. Opin. Cell. Biol. 11(3): 378-384.  59 12. Lowe T M and Eddy SR. (1999) A computational screen for methylation guide snoRNAs in yeast. Science. 283(5405): 1168-1171.  13. Noon K R , Bruenger E and McCloskey JA. (1998) Posttranscriptional modifications in 16S and 23S rRNAs of the archaeal hyperthermophile Sulfolobus solfataricus. J. Bacteriol. 180(11): 2883-2888.  14. Woese CR, Kandler O, Wheelis M L . (1990) Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. U S A . 87(12): 4576-4579.  15. Amiri K A . (1994) Fibrillarin-like proteins occur in the domain Archaea. J. Bacteriol. 176 (7): 2124-2127.  16. Chamberlain JR, Lee Y , Lane WS and Engelke DR. (1998) Purification and characterization of the nuclear RNase P holoenzyme complex reveals extensive subunit  overlap  with  RNase  MRP.  Genes  Dev.  12(11):  1678-1690.  17. Wu P, Brockenbrough JS, Metcalfe A C , Chen S and Aris JP. (1998) Nop5p is a small nucleolar ribonucleoprotein component required for pre-18 S r R N A processing in yeast. J. Biol. Chem. 273(26): 16453-16463.  18. Z. Kiss-Laszlo Z, Henry Yand Kiss T. (1998) Sequence and structural elements of methylation guide snoRNAs essential for site-specific ribose methylation of prerRNA. E M B O J. 17(3): 797-807.  19. Altschul SF, Madden TL, Schaffer A A , Zhang J, Zhang Z, Miller W and Lipman DJ. (1997) Gapped B L A S T and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25(17): 3389-3402.  60 20. Olsen GJ, Pace NR, Nuell M , Kaine BP, Gupta R and Woese CR. (1985) Sequence of the  16S rRNA gene from the thermoacidophilic archaebacterium  solfataricus  Sulfolobus  and its evolutionary implications. J. Mol. Evol. 22(4): 301-307.  21. Stahl DA, Luehrsen KR, Woese C R and Pace NR. (1981) A n unusual 5S rRNA, from Sulfolobus  a c i d o c a l d a r i u s , and its implications for a general 5S rRNA structure.  Nucleic Acids Res. 9(22): 6129-6137.  22. Dams E, Londei P, Cammarano P, Vandenberghe A and De Wachter R. (1983) Sequences of the 5S rRNAs of the thermo-acidophilic archaebacterium  Sulfolobus  solfataricus  Bacillus  (Caldariella  a c i d o c a l d a r i u s and Thermus  acidophila) aquaticus.  and the thermophilic eubacteria  Nucleic Acids Res. 11(14): 4667-4676.  23. Durovic P, Dennis PP. (1994) Separate pathways for excision and processing of 16S and 23 S rRNA from the primary rRNA operon transcript from the hyperthermophilic archaebacterium  Sulfolobus  acidocaldarius:  similarities to  eukaryotic  rRNA  processing. Mol. Microbiol. 13(2): 229-242.  24. Durovic P, Kutay U, Schleper C and Dennis PP. (1994) Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium  Sulfolobus  a c i d o c a l d a r i u s . J. Bacteriol. 176(2): 514-517.  25. Maden B E , Corbett M E , Heeney P A , Pugh K and Ajuh P M . (1995) Classical and novel approaches to the detection and localization of the numerous modified nucleotides in eukaryotic ribosomal RNA. Biochimie. 77(1-2): 22-29.  26. Steinberg S, Misch A and Sprinzl M . (1993) Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 21(13): 3011-3015.  61 27. Gupta R. (1984) H a l o b a c t e r i u m v o l c a n i i tRNAs. Identification of 41 tRNAs covering all amino acids, and the sequences of 33 class I tRNAs. J. Biol. Chem. 259(15): 94619471.  28. Thompson JD, Higgins D G and Gibson TJ. (1994) C L U S T A L W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22(22): 4673-4680.  29. Tycowski K T , You Z H , Graham PJ and Steitz JA. (1998) Modification of U6 spliceosomal R N A is guided by other small RNAs. M o l . Cell. 2(5): 629-638.  30. Pederson T. (1998) The plurifunctional nucleolus. Nucleic Acids Res. 26(17): 38713876.  31. C. Daniels, personal communication.  32. Armbruster D W and Daniels CJ. (1997) Splicing of intron-containing tRNATrp by the archaeon Haloferax volcanii occurs independent of mature tRNA structure. J Biol. Chem. 272(32): 19758-19762.  33. Web sites for accessing archaeal genomes are as follows: a.  S. solfataricus  at niji.imb.nrc.ca/sulfolobus/  b.  A e r o p y r u m pernix  c.  M e t h a n o c o c c u s j a n n a s c h i i and A r c h a e o g l o b u s fulgidus  d.  M e t h a n o b a c t e r i u m thermoautotrophicum  at www.mild.nite.go.jp/APEK 1 / at www.tigr.org/tdb/  at www.biosci.ohio-  state.edu/~genomes/mthermo/  e.  P y r o c o c c u s h o r i k o s h i i at www.bio.nite.go.ip/ot3db index.html  f.  P y r o c o c c u s abyssi  g.  P y r o c o c c u s furiosus  at www.genoscope.cns.fr/Pab/ at www.genome.utah.edu/sequence.html  62  Chapter 3 Figures and Tables  A.  30S  50S  i  Fraction number  2  aNOP56 (47 kD)  4  6  1  ?  T  8  Control  10 12 14 16 18 20  aN aF  aFIB  (27 kD)  Fraction number  B.  . . 4C  Total RNA S P T  4 S  6 P  S  P  8 S  P  10 S  P  12 S  P  14 S  P  ,  Pooled RNA  n  tRNA  sRNA  c.  Fraction number  , . . . 4C Total RNA  S P  4 S  6 P  S  P  8 S  P  10 S  P  12 S  P  14 S  P  _ ,  Pooled RNA  I Figure 3.1  Glycerol gradient sedimentation of aFIB and aNOP56 containing  particles present in & acidocaldarius cell free extracts. A sonicated cell extract was precipitated by addition of 35% ammonium sulfate, redisolved in buffer (50 m M Tris, pH 8), layered onto a 35 ml 10-30% glycerol gradient in the same buffer, and sedimented in an SW27 rotor (10°C, 17 K , 16 hr). Fractions (1.5  63  ml) were collected. (A) Aliquots of every second fraction between 2 and 20 were simultaneously analyzed by Western blotting for the presence of aFIB and aNOP56 using the two antibodies prepared against the recombinant proteins expressed and purified from E. coli (see immunoblotting procedure described in section 2.3.2). The positions of 30S and 5 OS ribosomal subunits in the gradient are indicated. In the control, the aFIB and aNOP56 antibodies were shown to be highly specific for single polypeptides of the expected size (27kD and 48kD respectively) in a S. acidocaldarius crude cell extract (right). (B) Aliquots from every other gradient fraction between 4 and 14 were immunoprecipitated with anti-aFLB (2.3.2, Chapter 2), and R N A was recovered by phenol extraction from the precipitates (P) and the supernatants (S). As a control (4C), an aliquot of fraction 4 was immunoprecipitated with pre immune serum. To visualize the precipitated RNAs, aliquots (0.005% and 2.5% of the total RNAs recovered from the supernatant and pellets, respectively) were pCp end-labeled with R N A ligase (see 3'-end labeling of R N A , 2.9.3, Chapter 2) and displayed on an 8%> denaturing polyacrylamide gel. The positions of tRNA and sRNA are indicated on the left. The precipitated R N A recovered from fraction 5 was separated on an 8% denaturing polyacrylamide gel and recovered by electroelution. A n aliquot of the R N A recovered after electroelution was end-labeled and displayed on an 8% denaturing polyacrylamide gel (right). (C) Aliquots from every other gradient fraction between 4 and 14 were immunoprecipitated with antiaNOP56. Other details are as described above except that recovered RNAs from fractions 6-8 and 10-13 were pooled. A n aliquot of the pooled R N A was end-labeled and displayed on an 8% denaturing polyacrylamide gel (right).  64  D' box  C box Sac  SR1 SR2 SR3 SR4 SR5 SR6 SR7 SR8 SR9 SR10 SR11 SR12 SR13 SR14 SR15 SR16 SR17 SR18 SR19 SR20 SR21 SR22  CAG GA AGG G GAA GG G G GUUAAAAUA GA GAAU GA AGG GCU A GA AGA A AA G A G CUGAAA  UUGAUGA GUGAUGA AUGACGA UUGAUGA AUGAUGA AUGAUGA AUGAUGA AUGAUGA AUGAUGA AUGAUGU GUGAUGA AUGAAGA AUGAUGU GUGAAGA GUGAUGA AUGAAGA AUGAAGA GUGAUGA AUGAUGA AUGAUGA AUGAUGA AUGAUGA  GAAGUUAAAAAA GACGAGCGCUAA GACCCAAAAUA GCACAUUCUUUU ....AUGGUCGACGGAA CCAAAUAGA CAAAGAGCCGAA - - - •AGCCCGCCAUCAA CUAACUCCAAUA GGAAUCCGGGAU - - - -UGGGUCGAUGUUA ACCCAACCUUAU - - - -ACUUUCACCCUCA -•••CGCUAGACUUAGA - - -GGAACCAACGAGAG CGUUCCACCCGA CUAAAAAACCGG CAGAACCCCGGC - - - -ACGCGGAGUACGA AAAGAGGGUCGC UUUUCACUGGGCAGGGC - - - -AUUUUAGGGGAGC  G CG A U CAGA - GAGAG UUGA A -UUUAA CUGA - -CCUA CGGA CUGA - - A AG A UGGA U CAGA - -UAAG CUGA - -CCAA - - - GAA CUGA CUGA - UUAGU CUGA -GGUUA CUGA - -AAGG - -CUCA CUGA CUAG . . - . U U GCGA G CUGA G A U A A G UUGA - - AAGA CUGA - -GGUA AUGA - - UA GA A A G A - - - - UU CUGA - -GAUG  D box  C box GGAUGA UGAAGA CGAUGA UGAAGA UGAAGA UGAAGA UAGUGA UGAAGA UGAUGU UGAUGA UGAUGA UGAUGA UGAGGA UGAUGA UGAUGG UGAUGA UGAUGA UGAUAG UGAUGU UGAUGA UGAUGA UGAGGA  GCUUAACUCCCAUGGU GGUCACUGCGAA UAUAACCUGUCUCGG AAGUGGCCAGGU - - -AUUGUUGCCGGA AAUGCACCUCAA CAUCUAAUUUUGUGGGCAGCCA GGGAACCCGAGG CGUAACCCGAAA CAAAAAGCGCGAGCG GAUUAUCUCCGG CAGGUUGUUCGU UGAGUCCGACUA AGGGCCAAAGCU CUUCGACGCUCUGCU GCGAAACGGUUAAUA CGACGUCUCGCA AGCCGUGUGAGAA AGUGGUCCUCGG CCGCUGGAAAUA UUGAGCCCUGGAUAA UGCGGUUACUCG  CUGA CUGA CUGA CUGA CUGA CUGA CUGA CUGA CUGA CUGA CUGA CAGA CUGA CAGA CUGA CUGA CUGA CUGA CUGA CUGA CUGA CUGA  UAAC AG A A A UCAGU GGUAG CAAAC CUAAA U A G AG GAAU AUAAA UUAUA GAAU UCGAUGUGA CGCAA GCAAAC AA UGAUG UC UCAAU GA AAA AA U UUAUG AGAUA  Table 3.1 Small R N A s cloned from Sulfolobus acidocaldarius *  The sequences of S. a c i d o c a l d a r i u s (Sac) c D N A clones are aligned using the C,  D', C , and D boxes as anchors. Dashes are gaps in the alignment. The Genbank accession numbers for the sRNA sequences are AF195095 through 195112.  65  A.Sac s R l  SacsR2  B.  U G C A PE U G C A PE  C.Sso s R l  li"G"c A ai oi  at  ai  ei  ai ai u  li G C A PE  Figure 3.2 Detection and 5' end mapping of sRNAs from S. acidocaldarius and S. solfataricus. Primers specific for the D box guide region of Sac s R l to sR17 were 5' end labeled with y P ATP and polynucleotide kinase and used in extension reactions with total R N A (10 32  ug) isolated from S. acidocaldarius  as template (procedure described in section 2.9.5,  Chapter 2). (A) The extension products obtained with Sac s R l and sR2 specific oligonucleotide primers were run alongside a  P - D N A sequence ladder generated with  the same primers and Sac s R l or sR2 cDNAs as template; the c D N A templates were obtained as described in section 2.4 in Chapter 2; the poly-U tract present in the c D N A ladder sequence corresponds to the tail added by cloning. (B) The extension products obtained with Sac sR8, sR14, sR3, sR5, sR6, sR16 and sRIO specific primers and run with the D N A sequence ladder generated with Sac sR8 c D N A clone. The main sR8 extension product is three nucleotides longer than the 5' end of the sR8 c D N A clone. For each extension reaction, the major extension product (>) and the approximate positions of the 5' terminal nucleotide in the corresponding cDNA clone (•) are indicated beside the lane. (C) The primer extension reaction was as in (A) except that the primer was specific to Sso s R l and total R N A from S. solfataricus was used as template. The D N A ladder was generated using Sac s R l primer and the Sac s R l c D N A clone as template. The Sac and Sso primers are complementary to the same region but differ at two internal positions.  66  Sac sR1  A b * P E Conf** G u i d e - Target t + 16S U52 . D F  Notes § Match t C DP.Mod 11/0  sR2  F  +  D  23S C1914  11/0  CDP  sR3  F  +  D  23S G2739  10/0  No Pause  sR4  N  +  D  23S G1995  10/0  sR5  F,N  +  D  16S G1056  12/0  sR6  F  +  D  23S G2666  9/1  23S G2649 23S U2692  9/0 10/0  CDP.Mod  sR7  F  +  D D  sR8  N  +  D" D  23S U2972 23S G334  9/1 12/1  sR9  F  +  D'  16S G926  8/0  sR10  F  +  D' D  tRNA G l y - C C C C 5 0 23S C2539  12/0 9/0  sR11  F  +  D' D  23S A2618 23S A724  10/2 11/1  sR12  F  +  D' D  23S G1114 23S A1134  11/0 10/1  No Pause CDP  sR13  N  +  D' D  23S G385 23S C2746  10/1 10/0  CDP  D  t R N A G l n - U U G U34  10/0  1  sR14  F,N  +  sR15  F  +  NF  sR16  N  +  NF  sR17  F  +  NF  sR18  F,N  D'  23S G140  CDP No Pause  9/1  Table 3.2 Annotations of Sulfolobus acidocaldarius sRNAs. *  The precipitates from which the respective sRNAs were recovered: F, anti-aFIB; N , anti-aNOP56.  ** The presence of the sRNA in total cellular R N A was verified by primer extension, t  The position of the guide within the sRNA (D or D' box associated) and the predicted site of methylation in the target R N A are indicated. The D' guide in sRIO is also  67  predicted to methylate numerous other tRNAs including tRNA Pro C G G and G G G at the homologous C position in the stem of the Tv|/C arm. The D box guide in sR14 is predicted to methylate the wobble base in tRNA Gin. A l l the tRNA sequences are from S. |  solfataricus.  The number of matches and mismatches in the complementarity between the guide and target sequence are indicated. Proposed complementarity to R N A targets are based on the following criteria: Watson/Crick base pair at position -5 (site of methylation); a minimum of eight bp with no more than two G:U bp. one mismatch permitted at positions other than -5.  §  "CDP", dNTP concentration-dependent primer extension pause observed at predicted site of methylation, indicating likely ribose 2'-0-methyl. "No Pause", no pause was detected at either high or low dNTP concentrations. "Mod", known site of nucleotide modification of unknown type in S. a c i d o c a l d a r i u s 16S r R N A and S. solfataricus  5S  rRNA. Guides without notation were not experimentally examined. NBFrom the total of 22 Sac sRNAs cloned and showed in Table 3.1, only the first 18 sRNAs were initially analyzed and are presented in Table 3.2.  68  Sac .  dNTPs  <-23S C1914  SsosRIDbox  GC U A AACUCC C[A] U GGA CUGA  u m  i  SacsR2Dbox  in  i  I I I I I  SaosRIDbox  GCUUAACUCC  I  I  I  I I I  c[7]u GGU  G A G G U C A C U [_GJ C G A A I I I I I I  16SU52 — • 3' CUGAGG GFUIA CCGA 5'  23SA1914  I  I  CUGA  III  3' A C C A G U G A{C]G  C U G 5'  CUGA  Mja  D. U  G  C A  <— 23S C2034  SacsR12Dbox 23SA1134  ->3'  C A G G U U G[UJU CGU I I I I I I I I I A C C C A A C 0 A G G G  CAGA I G A 5'  MjasR6D'box  AC A A U U U C[GJ C U A U CUGA I I I I I  23SC2034  I  I  I  II  I  II  3' CUUAAA G[c]G AUG GAA 5'  Figure 3.3 Detection of 2'-0-ribose methylation sites in r R N A . Positions of ribose methylation in rRNA were detected using the dNTP concentration dependent primer extension pause assay described in section 2.9.5 of Chapter 2. Total RNA from S. a c i d o c a l d a r i u s , S. solfataricus  or M. j a n n a s c h i i was used as template. The  sequence ladders were generated from either D N A or R N A templates using the same primers used in the pause reactions. The position of pausing is indicated on the right. The sequence of the sRNA guide and the complementary rRNA target are shown below each panel; the site of methylation in rRNA (boxed) is base paired to the nucleotide in the guide R N A positioned precisely five nucleotides upstream of the start of the D or D ' box (boxed).  69  G  G  c  u  G U33 (NH)  - U  I  CGGAACAG GAG G CAUAAGGG AGGAUGGG GAGUUGGG  U52 (H) C - 5'Sso 16S rRNA  AUGAUGA UUGAUGA UGAUGA AUGAUGA AUGAUGA AUGAUGA  C  D' box  G G G G C ^ A U C G  C box Sso sR1 Sac sR1 Arch. cone. Pfu sR4 Pab sR4 Pho sR4  A  G  I I I I I I I I I AUUCCC G[A]U S U GAAGUU A A AA A A  ACGA GCGA GA CAGA CCGA CCGA  A  , urcr . u_| y_  U CGG AGGAGA A G G A G A, U U U CGG U CGG GGGAGA I I I I II I I I C C U C C A[A] A GC G I G A361 (NH)  - -. .u - ---u - GGUG - AAGG - GUGG  3' - C  box  UGAUGA GGAUGA GA GA UGAAGA UGAGGA UGAGGA  5' Pho 16S rRNA  I G U G A G G G 0 A C C I I I I I I I III G C U A A A C U C C cfAlu G G A GCUUAACUCCC A UGGU ACUCX C A U GG G A C U C G C A U GGG A A C U C G C A U GGG - - - -GACUCG CIAJU GGG I I I I I I I I III C U G A G C GQJ] A C C 3'-A I GU52 (H)  3 - C 1  D' o r D box  C or C b o x Sac sR7 (D box) ApesR19(D box) Arch. cone. Mja sR1 (D box) Pfu sR3 Pab sR3 Pho sR3  G CGGCG AGGCG UGGCG  AUGAUGA AUGAUGA AUGAUGA AUGAUGA AUGAUGA  UAGCA A G C C CUGA GUAGCA A G C CGG CUGA AUAGCAA G CCAC CUGA -AGAG GUAGCAA G CCAC CUGA -CCUA A U A G C A A |_GJ C C A G C U G A - AGAG I I I I I I I II A U C G U u[c]G G C I C - 5 Pho 23S rRNA C C2612 (H) U C G C U G UCGGCUCUCCCCAUC  C  box  CGCCC I I I I I AUUUUGUGGG -CGAGGCGGG GXGXX  C box Pho sR39 Arch. cone. Mja sR6  GGGG GG G GGCG  GUGAUGA UGAUGA AUGAUGA  C2064 (H) I UUAAAG[C]GAU  D box CUGA CUGA CUGA CUGA CUGA CUGA  UUAGC UAAC CCACC CCUUU CCUUU  5' Pho 16S rRNA  U2692 (H) I G - 5' Sac 23S rRNA G[U]C G G D box I l_ I II C G CCA CUGA C G C C U UUGA C CUGA X CC  - - -GGUGAA C CCC C CCC - - -GGUGAA C CCC - - -AGUGAA I I I I I I I I I I I C A C U U G[0]G G G G I 3' - C U2673 (H)  UGAUGA UGAUGA UGAUGA  1  3' - C  A  CUGGCCCUGCAGCAGGGG C C A  A  CUGA CUGA CUGA  GCCUA GCCAA GCCUA  G  G - 5' Pho 23S rRNA D'box  I I I I I I I I I I G G A A A A U U U cfGlc U A G C U G A AGUGAAAGA A A U U U C G C UA CUGA - - - C A A U U U C [ G J C U AU CUGA UUCUG I U U A A A G 0 G A U G 3' - C I G - 5' Mja 23S rRNA C2034 (H)  C  D box  box  uf5]  GCCUA AU ACCC G CAA GCC A UAC C C G CA GCCAA C U A C U C cfclG C A G I I I I I GAUGGG GI"G|C G I 3' - A C - 5' Mja 23S rRNA G1317(NH)  UGAUGA UGAUGA UGAUGA  CCGA C GA CUGA  Figure 3.4 Guide region sequence similarity in archaeal sRNA. Three sets of sRNAs that are predicted to direct 2'-0-ribose methylation to homologous sites in 16S or 23S r R N A are aligned either over their entire length or over their D ' or D box guide regions. The guide complementarities to regions of 16S or 23S rRNA are shown above and below the guide regions; predicted sites for methylation within the rRNAs that are homologous (H) or non-homologous (NH). are boxed. A n archaeal consensus is included with each set of aligned sequences. (X) in the consensus indicates the presence of compensatory nucleotide substitutions in the sRNA guide and r R N A target region.  70  CHAPTER 4  A N A L Y S I S A N D DISCUSSION O F A R C H A E A L S M A L L RNAs FUNCTION Introduction The biosynthesis of ribosomes in Eukaryotes occurs within a highly specialized organelle, the nucleolus (reviewed in 3, 5, 18, 22 and summarized in section 1.1, Chapter 1). During the transcription, folding, and maturation processes, up to a hundred or more post-transcriptional nucleotide modifications are introduced at specific positions within the eukaryotic rRNAs. The two most frequent types of modification are methylation at the 2'-0 position of ribose (about 55 and 107 in yeast and humans, respectively) and isomerization of uridine to pseudouridine (about 44 and 95 in yeast and humans, respectively) (20). Although the function of these modifications remains largely enigmatic, it is clear that virtually all of them are confined to the most conserved and functionally important regions of the rRNA. How are the large number of ribose methylations and pseudouridine modifications targeted to specific nucleotide positions within eukaryotic rRNAs? Early clues came from the observation that the eukaryotic nucleolus contains a very large number of small nucleolar RNAs (snoRNAs), many of which contain one or more antisense elements that are complementary to sequences in r R N A (4, 33). Almost all of these snoRNAs fall into one of two distinct classes as described in section 1.2.1.1.1 and 1.2.1.1.2 and illustrated in Figure 1, p. 3 (6). The C/D box snoRNAs usually have a short-terminal hairpin, associate with several essential proteins (fibrillarin and NOP56 and NOP58 and 15.5 kDa protein; 12, 39) and function to guide methylations using the antisense elements located 5' to either the D or D' (D box-like) motifs. Methylation is directed to the r R N A nucleotide that participates in the basepair 5 nucleotides upstream from the start of the D or D' box (17, 35). There is some evidence to suggest that fibrillarin mediates methylation; it contains a weak match to an S-adenosyl methionine-binding motif and amino acid substitutions in this motif exhibit a temperature sensitive defect in global r R N A  71 methylation (34, 37). The NOP56 and NOP58 proteins are paralogs (the result of a gene duplication) with an essential but uncharacterized function (12). The H / A C A box snoRNAs associate with a different set of essential proteins (see section 1.2.2.2) (38). Duplex formation places the uridine to be modified into a conserved higher order structure termed the pseudouridylation pocket (9, 10, 24). The Garlp protein binds directly to the H / A C A RNAs in vitro, and the Cbf5p protein is almost certainly the pseudouridine synthetase; it has high sequence similarity to the protein that catalyzes the formation of \\i55 in Escherichia  coli tRNAs. The function of C/D box and H / A C A box  snoRNAs in guiding 2'-0-ribose methylation and pseudouridylation has been elegantly demonstrated (9, 17, 24). These site-specific methyl and pseudouridine modifications are believed be involved in one or more of the following functions: enhancing R N A structural stability, providing unique features for binding of ribosomal proteins, or enhancing the activity of the rRNA within the assembled ribosome. In addition, it has been suggested that the base pairing between snoRNAs and the nascent r R N A transcript may have a chaperone function whereby the folding of the r R N A is constrained to a productive as opposed to a dead end pathway (26, 33). In this case, the modification might be a benign byproduct of the chaperone function and simply a signal for dissociation of the guide R N A / r R N A complex. In contrast to this rather complex situation, the rRNA of a typical bacterium, E. coli, contains only four ribose methylation and ten pseudouridine modifications; all of these appear to be protein directed with no evidence for involvement of an R N A cofactor (14, 26).  Discovery of methylation guide sRNAs in Archaea Archaea are prokaryotic organisms that lack a nucleus but possess D N A replication transcription and translation machineries that more closely resemble those of Eukarya than those of Bacteria (8, 27). As mentioned earlier, two observations suggested that Archaea might contain homologues to the C/D box family of eukaryotic snoRNAs. First, all sequenced archaeal genomes contain two open reading frames (ORFs) that encode the protein homologues of the eukaryotic nucleolar proteins fibrillarin and NOP56/58 (2, 28). Second, mass  spectrometry analysis of the r R N A  of the  72 hyperthermophilic archaeon Sulfolobus  solfataricus  revealed the presence of 67 sites of  ribose methylation, a number similar to that found in eukaryotes (25). The positions of the ribose-methylated nucleotides in the 16S rRNA are currently being determined. In contrast to the large number of ribose methyl modifications, the number of pseudouridine modifications is small (about eight), similar to the number found in E. coli and considerably fewer than the number found in yeast or humans. The first demonstration of archaeal C/D box small RNAs (sRNAs) took advantage of the fact that in eukaryotes, these C/D box snoRNAs are in ribonucleoprotein (RNP complexes) containing fibrillarin, NOP56 and NOP58 proteins (28). As described in Chapter 3, the archaeal genes encoding homologues of these proteins (aFLB and aNOP56) were cloned from Sulfolobus  a c i d o c a l d a r i u s and expressed in E. coli; the  expressed proteins were purified and used to generate polyclonal antibodies in rabbits. Immunoprecipitates of an S. a c i d o c a l d a r i u s cell extract that had been fractionated on a glycerol gradient were used to selectively purify associated RNAs. The RNAs were subjected to RT-PCR and the products were used to generate c D N A libraries. Thus far, representatives of 29 different sequences that exhibit features characteristic of eukaryotic C/D box snoRNAs have been recovered from the libraries. Although somewhat shorter than typical eukaryotic C/D box snoRNAs (a median length of 57 nucleotides compared with a median greater than 70 nucleotides in length), the S. a c i d o c a l d a r i u s sRNAs exhibit the characteristic dyad structure with well-defined C, D ' , C and D box motifs, and often contain one or two rRNA antisense guide elements positioned 5' to the D ' and/or D box motifs. Few of the S. a c i d o c a l d a r i u s C/D box sRNAs appear to have the short-terminal hairpin that is commonly present in eukaryotic C/D box snoRNAs. The presence of many of these sRNAs has been confirmed by primer extension (see Figure 3.2, Chapter 3), and/or Northern hybridization analysis (data not shown) (for a summary of this information, see: rna.wustl.edu/snoRNAdb/). Support for sRNA methyl guide function requires mapping the modification state of target RNAs. Unambiguous detection of positions of ribose methyl modification in large RNAs is tedious, requiring fingerprint or mass spectrometry analysis of isolated oligonucleotides. Other more convenient assays such as partial alkaline hydrolysis or dNTP concentration-dependent primer extension pause reactions are quick and simple but  73 less reliable for unambiguous identification and detection of methyl modifications (21 and discussed in 3). Our examinations of the rRNA antisense guide elements in the 29 S. acidocaldarius sRNAs predict 26 different sites of r R N A methylation using the eukaryotic D / D ' box plus five base pair methylation guide rule. Two of our predictions (U52 and G1056 in 16S rRNA) are known from oligonucleotide fingerprint analysis to have some type of nucleotide modification (references cited in 28). To confirm our predictions, we used the dNTP concentration-dependent pause reaction, and to a lesser extent, the alkaline hydrolysis reaction (see section 2.9.5 in Chapter 2); a number of the candidate sites exhibit the expected pause product, whereas others did not (see: rna.wustl.edu/snoRNAdb/). In these negative instances, it is unclear whether the assay has failed to detect the methyl modification on the R N A template, or whether the site is indeed unmodified. In eukaryotes, alteration or disruption of snoRNAs or snoRNAencoding genes has been used to demonstrate the direct involvement of these guide RNAs in rRNA modification (17, 19). Due to the lack of sophisticated experimental genetic systems, similar disruption or epigenetic experiments with Sulfolobus and other Archaea are not yet feasible. Examination of the S. acidocaldarius sRNA sequences revealed that only about half of the potential guide regions exhibit complementarity to rRNA. If all rRNA methyl modifications are guide directed and i f the number of modifications is similar to that of a related species, S. solfataricus (67 sites), then we expect that there should be between 60 and 70 C/D box sRNAs in S. acidocaldarius. The possible significance of guides without complementarity ("unassigned guides') is discussed below.  Mining archaeal genome sequences A similarity search ( B L A S T N ; 1) using each of the S. acidocaldarius sRNA genes against the non-redundant nucleotide database resulted in only two weak hits, both within the partial genome sequence of the related organism, S. solfataricus. This result indicated that B L A S T N analysis was not an effective tool for detecting sRNA gene homologues because the sequences are short and apparently diverge very rapidly from each other (see below). As an alternative, we retrained a previously developed eukaryotic snoRNA search program with the sequences of the verified S. acidocaldarius sRNA  74 genes (this part of the work was performed by Todd Lowe at Washington University). This program was very effective in identifying previously unknown C/D box snoRNA genes in the yeast genome (19). The retrained program was used to search the partial genome sequence of S. solfataricus and the complete genome sequence from nine other archaeal species (Table 4.1). A n up-to-date list of these sRNA sequences along with annotations of their methylation target sites is available at rna.wustl.edu/snoRNAdb/. In some genomes, more than 50 putative sRNA genes were detected, whereas in other genomes, few or no high probability candidates were found. The genomes of three closely related species of Pyrococcus have been sequenced and analyzed for sRNA genes by combining sRNA gene searches (performed by Todd Lowe at Washington University) with comparative interspecies genome analysis (11, 28). Using this strategy, a total of 60 groups of homologous sRNA genes were identified. Fifty groups have representatives in all three species, eight are represented in only two species, and two are unique to single species. Examples of several of these homology groups are illustrated in Figure 4.1; the entire set can be viewed at the snoRNA database website (rna.wustl.edu/snoRNAdb/). In each homology group, the sequence identity for end-to-end alignments (from the 5' end of box C to the 3' end of box D) of interspecies members is between 75% and 98%. The least conserved region is the short connector segment between the D ' and C boxes; the rate of divergence of the connector is roughly equal to that of the non-coding flanking sequences. The box features (C, D ' , C and D) are well conserved with consensus motifs identical to those found in eukaryotic C/D box snoRNAs. As demonstrated in eukaryotes, the positions of the D ' and D boxes appear to guide methylation to the fifth upstream base pair, within the helix formed by the rRNA and the antisense guide. The strong intrafamily conservation of the C and D boxes plus high similarity to the eukaryotic motifs suggests that the C and D boxes play a similar role in Archaea for sRNA association with aFIB and aNOP56. Pyrococcus sRNAs are generally between 50 and 60 nucleotides in length and exhibit the characteristic snoRNA dyad structure. More than half of the sRNAs have rRNA antisense elements associated with both the D ' and D box motifs, whereas only about 20% of eukaryotic C/D box snoRNAs have double guide function. Also in contrast to eukaryotes, the predicted methylation targets are often in close proximity within the  75 same molecule. If both guides pair simultaneously to the nascent rRNA, a stabilizing complex could be generated (see Figure 4.1 C-E and further discussed below). Genomic context of sRNA genes The availability of a large number of sRNA genes within sequenced genomes makes it possible to assess their location relative to protein coding genes. In eukaryotes and particularly in mammals, most snoRNA genes are encoded in the introns of translation-related protein encoding genes, and are generated by post-transcriptional processing of the pre-mRNA (3). Some mammalian snoRNAs are even found in the introns of host genes that are transcribed by R N A polymerase II and processed, but apparently never translated into proteins (29, 32, 35). In yeast, most snoRNAs are transcribed from their own promoter. These snoRNAs are generated by endo- and exonucleolytic processing of the mono- or polycistronic transcripts. One particular transcriptional unit encodes seven distinct C/D box snoRNAs (30). Based on the current collection, archaeal sRNAs appear to be encoded on both strands of the D N A , usually unlinked, and distributed around the entire circular chromosome (for genomic positions of sRNA genes, see: ma.wustl.edu/snoRNAdb/). Furthermore, they are almost always positioned within the short spacer regions between protein encoding ORFs. Between 10% and 20%> of the sRNA genes appear to overlap the 3' ends of protein-encoding ORFs. The translation termination codon of the O R F often falls in the 5' half of the sRNA, within the C box ( R U G A U G A ) , D ' box (CUGA) or the guide region between them. A well-characterized example of an overlap with the 3' end of an ORF is the s R l gene from S. a c i d o c a l d a r i u s and S. solfataricus  shown in Figure  4.2. Remarkably, the most highly conserved portion of these sRNA genes is the 3' half that lies outside the ORF. It contains the D box antisense element that is used to guide methylation to position U52 in 16S rRNA. The 5' half of the s R l gene is poorly conserved and is reflected in numerous amino acid replacements in the C-terminus of the encoded aspartate amino transferase protein. The translation termination codons, although offset by three nucleotides, are both located within the complementary guide region associated with the D ' box. The Sso s R l D ' guide is predicted to direct methylation to position U33 in 16S rRNA, whereas the Sac s R l D ' guide does not have any strong complementarity to rRNA. The D box guide of the P y r o c o c c u s sR4 family  76 also directs methylation to position U52 in 16S rRNA (see Figure 3.4 A , Chapter 3). In this instance, the Pho, Pfu and Pab sR4 genes are located entirely within the intergenic space between two ORFs that encode uncharacterized proteins.  Based on genome  annotations, a number of sRNA genes would appear to overlap the 5' end of proteinencoding ORFs. Many of these apparent overlaps may be artifactual, resulting from the incorrect assignment of the translation initiation codon that defines the 5' end of the ORF. We have observed only one case where an sRNA is encoded completely within another  gene: the Pyrococcus  sR40 family and their homologues  - including  Archaeoglobus fulgidus (Afu) sR3 - reside within the intron in the anticodon loop of the gene encoding tRNA-Trp. Daniels and co-workers (personal communication) have suggested that these sRNAs function in cis to guide methylation to positions C34 and C39 within the intron-containing tRNA-Trp precursor (see below). We identified the Pyrococcus sR40 group of sRNAs based on their hallmark features and D ' and D guide complementarities to rRNA (D':16S C1252; D: 23S C1117). It remains to be shown whether these sRNAs truly guide methylation to the proposed tRNA and r R N A positions. Within the Pyrococcus genomes there are five instances where two sRNA genes are closely linked (Table 4.2). For three pairs, the genes are on opposite strands and are divergently transcribed, separated by 1-130 bp. The remaining two pairs are oriented on the same strand, separated by 9-34 bp. In S. solfataricus, the sRIO and s R l l genes are also encoded on the same strand and separated by only five nucleotides. Primer extension and Northern hybridization analysis have shown that both the Sso sRIO/sRI 1 and the Pfu sR26/sR60 gene pairs are co-transcribed and at least partially processed to their monomeric size (see Appendix 4, pagel29). The question as to how isolated sRNA genes are transcribed and how their transcripts are processed has not been addressed. Two possibilities warrant consideration. Either sRNA genes are transcribed from sRNA-specific promoters - which in some cases would probably lie within protein-encoding ORFs - or the genes are co-transcribed from mRNA promoters. In the latter instance, the sRNA product would be salvaged from an intermediate in the m R N A degradation pathway. Primer extension with sRNA-specific primers frequently reveals what appear to be minor amounts of precursors with extra nucleotides at the 5' end (A. Omer, unpublished results).  77  Is growth temperature related to rRNA methylation? The number of methylation guide sRNAs that we detected in searches of archaeal genomes correlates with the optimum growth temperature (Table 4.1). In the genomes of Halobacterium  salinarium, a mesophile, and Methanobacterium  thermoautotrophicum,  a  moderate thermophile, no highly probable sRNA candidate genes were detected. Both genomes encode aFEB and aNOP56 homologous proteins, implying that these organisms may possess methylation guide sRNAs. The features of these hypothetical sRNAs genes would differ substantially from those used to train the search program, and thus could have escaped detection. In the hyperthermophilic Pyrococcus and Pyrobaculum  species  with optimum growth temperatures approaching 100°C, our searches revealed more than 50 easily recognizable and highly canonical sRNA genes (the Pyrococcus available at: ma.wustl.edu/snoRNAdb/; the Pyrobaculum  data are  data are currently unpublished  results). If we infer that the number of identified guide sRNAs is proportional to the true number of rRNA methylation sites, this would suggest that increased R N A methylation is important for life at high temperature. Advantages of increased r R N A methylation may include increased thermodynamic structural stability or augmented interactions with stabilizing ribosomal proteins. In the context of R N A stabilization by increased ribose methylation, an interesting question has been raised. Do hyperthermophilic Archaea regulate the extent to which they methylate their rRNA in response to the environmental growth temperature? In a profoundly interesting study, the number of ribose-methylated nucleotides in the r R N A of S. solfataricus grown at 60°C, 75°C and 83°C was observed to be 62.2, 67.5 and 69.6, respectively, an increase of about 12% (24). At the present time, it is unclear how significant and reproducible these values are. It is also unclear whether the increase in modifications reflects regulated activation of the methylation machinery by high temperature or is simply unregulated inhibition (cold sensitivity) at low temperature. Even i f the increase is concerted, its adaptive value in protecting organisms against rapid fluctuation in temperature is not immediately obvious' because only newly synthesized ribosomes (not pre-existing ribosomes) would be affected. If the system is concerted and has adaptive value, it would provide credibility to the proposed chaperone function of  78 these RNAs. It will be interesting and important to identify sites of regulated methylation, whether they exist, and to determine their role in ribosome assembly or activity.  Do sRNAs guide methylation to tRNAs? In many archaeal sRNAs, one or both of the D ' or D box guide regions lack complementarity to 16S or 23 S rRNA. We examined these unassigned guides for complementarity to other stable RNAs and noted that many exhibit complementarity to the tRNAs derived from the same organism (28; see also: ma.wustl.edu/snoRNAdb/). The predicted positions of methylation in tRNAs are summarized in Figure 4.3. The guides are most often specific to a single tRNA sequence. For example, sRNAs from eight different species appear to target unique methylations to U34 or C34, the wobble position within the anticodon of the tRNAs. This site is known to be ribose methylated in many tRNAs, including two archaeal tRNAs (tRNA-Trp and tRNA-Met in Haloferax volcanii; 13). In contrast, some sRNAs target a large number of tRNAs. For example, Ape sR17 is predicted to direct methylation at position G10 in 19 different tRNAs. Three Pae sRNAs (sR5, sR48 and sR34) appear to target methylation to the same G10 in a total of 16 different tRNAs. In the exceptional case of PholPfulPab sR40 and Afu sR3 (the sRNAs that reside in the intron of the tRNA-Trp genes), the sRNAs are believed to be required to direct methylation to positions C34 and C39 within the precursor before the intron can be excised (C. Daniels, personal communication). After excision, the Pyrococcus intronic sRNAs may also guide methylation to positions C1252 in 16S and C1171 in 23 S rRNA. Although newly synthesized eukaryotic tRNAs may transit through the nucleolus prior to nuclear export (40), there is no evidence to date that any of their numerous nucleotide modifications are snoRNA directed. For example, none of the identified C/D box snoRNAs from yeast (19) appear to have guides that are complementary to tRNA sequences. So why would hyperthermophilic Archaea use sRNAs to guide methylation in tRNAs? Ribose methylation increases base stacking, the single most important energetic interaction in R N A (7). We imagine that in high-temperature Archaea, pre-tRNAs assume the correct tertiary structure only after ribose methyl modification by the guideR N A - directed mechanism. Indeed, in the case of the intron containing pre-tRNA-Trp,  79 cis-guided methylation at positions C34 and C39 appears to be required before the pretRNA can refold into a structure that allows intron excision and exon ligation (C. Daniels, personal communication).  A r e methylation sites i n r R N A phylogenetically conserved?  Based on the complementary guide sequences in the available collection of sRNAs, a count of all potential sites of ribose methylation in archaeal r R N A has been compiled (Table 4.3). O f the 253 archaeal sites, 44 are used in more than one archaeal genus, whereas the vast majority, 209 sites, are so far unique to a single genus. We compared all these positions of predicted archaeal ribose methylation with the 36 methylated sites conserved between yeast and humans. Only nine of these are shared between the two organisms and three of the nine correspond to three of the four sites of methylation in E. coli rRNA (positions 16S C1402, 23S G2251 and 23S C2498; E. coli numbering). Positions of methylation in rRNA are confined to the common core regions and cluster somewhat to the functionally important regions. The distribution of archaeal, yeast/human and E. coli sites within three core regions are illustrated in Figure 4.3: the '530' translational fidelity stem loop and the 3' terminal decoding stem in SSU rRNA, and the peptidyl transferase center of L S U rRNA. For the nine yeast/human sites within these regions, three have not yet been predicted by sRNAs in any Archaea, four are predicted in only a single archaeal genus, and only two are predicted in more than one archaeal genus. Two of the positions, 23S G2251 and U2552, are among the three ribose methylation sites present in E. coli 23S rRNA. The loop region containing position G2251 has been implicated in interaction with the C C A 3' end of the P site tRNA. The loop containing position U2552 has been implicated in an interaction with the C C A 3' end of the A site tRNA (16, 23, 31). Thus, it appears that with only a few notable exceptions, there is little current evidence for selective pressure in maintaining positions of guide-directed-rRNA-ribose methylation both within Archaea and between Archaea and Eukarya. This suggests to us that the number and distribution of methylation sites that is, the number and distribution of predicted guide R N A - r R N A interactions - may be more important than their precise positioning in some critical areas. For example, of the  80 10 archaeal sites that are clustered in the 530 loop of 16S rRNA, where correct folding and structural stabilization are expected to be critical, only two are conserved between more than one genus. At this time, we cannot make any strong conclusions because we do not know the true positions of all or most rRNA modifications for any species of Archaea. Indeed, additional conserved sites may exist either because our identification of sRNAs is not complete or because these sites may be present but are modified in a guide RNA-independent manner.  Evolutionary divergence of archaeal methylation guide sRNAs The rate at which guide sequences diverge will depend on the selective advantage of the sRNA-rRNA interaction during ribosome biogenesis; high selection will minimize the probability that disruptive nucleotide substitutions become fixed in the population and visa versa. The general lack of conservation of predicted positions of methylation within rRNA between archaeal genera indicates that selection for methylation at most sites is relatively weak. Because selection is weak, nucleotide substitutions accumulate within guides and gradually erode their ability to base pair with the more conserved rRNA target sequence. Conceptually, this process could be divided into stages that may be exemplified in several of the Pyrococcus sRNA families (Figure 4.1). At an early stage, nucleotide substitutions may create G/U base pairs within the complementary region and mismatches that extend or shorten the length of the complementarity (Figure 4.1 B , D guide sequence).  In a following stage, further  nucleotide substitution  abolishes  complementarity (Figure 4.1 C, D ' guide sequence) ; the guide becomes nonspecific without apparent function and is now free to explore sequence space. In a final stage, a favorable complementarity to a new region in rRNA is eventually achieved, and a new site for methylation is generated. The D'-associated guide within Pyrococcus sR51 may be an example of this final stage (Fig. 4.1 D); Pfu and Pab members guide methylation to G1059 and A1131 in 16S rRNA respectively. Surprisingly, there are very few guides unassigned to rRNA targets in the collection of identified Pyrococcus sRNAs, whereas nearly half of the cloned S. acidocaldarius sRNA have no clear target. This may be a function of how the sRNAs were identified: the Pyrococcus sRNAs were all identified  81 computationally, based on at least one strong guide sequence; the  S.  acidocaldarius  sRNAs were all identified biochemically, thus are not biased for targeting known RNAs. We also compared the sRNAs from different archaeal genera that guide methylation to homologous positions within rRNA. For example, as shown in Figure 4.1 E, the D box guide of Sac sR7, position U2552  (E.  coli  Ape  sR19 and  Pho/Pfu/Pab  sR3 all target methylation to  numbering) that has been implicated in an interaction with the 3'  end of the A site tRNA (16, 23). It is interesting that within Archaea this important region of 23 S rRNA contains four separate nucleotide substitutions that are matched by compensatory substitutions in the guide regions of the sRNA. It is not possible to say whether the rRNA targets and the sRNA guides have coevolved from a common ancestor or whether the guide sequences have independently converged on a common r R N A target nucleotide. The D ' box guides of these sRNAs show little i f any sequence similarity. To summarize, the guide regions of most archaeal sRNA genes appear to be dynamic and in constant flux. Although there may be exceptions, selection - particularly at high temperature - appears to maintain the number and general distribution of guide sRNA-rRNA interaction/methylation throughout the conserved core regions of S S U and L S U rRNA rather than the precise positions of methylation. As a result, few positions of guide-directed methylation are conserved, even across short phylogenetic distances (i.e. between genera). Furthermore, homologous sRNA genes derived from a common ancestor are difficult to identify with any degree of certainty (except within closely related species). A challenge that remains is to distinguish between the chaperone and methylation functions of these amazing sRNAs and demonstrate their respective roles in ribosome biogenesis and ribosome structure function.  Acknowledgements I am grateful to Pat Dennis and Todd Lowe for their contribution to this work. I also thank the editors of Molecular Microbiology for the permission to reproduce this material. This chapter has been published in a modified vesion as: " A guided tour: small R N A function in Archaea." Dermis PP, Omer A and Lowe T. (2001) M o l . Microbiol. 40(3): 509-519.  82  References  1. Altschul SF, Gish W, Miller W, Myers E W and Lipman DJ.(1990) Basic local alignment search tool. J. Mol. Biol. 215(3): 403-410.  2. Amiri K A . (1994) Fibrillarin-like proteins occur in the domain Archaea. J. Bacteriol. 176 (7): 2124-2127.  3. Bachellerie J-P and Cavaille J. (1998) Small nucleolar RNAs  guide ribose  methylations of Eukaryotic rRNAs. In: Modification and Editing of R N A . Grosjean H and Benne R (eds). Washington DC: American Society for Microbiology, 255-272.  4. Bachellerie JP, Michot B , Nicoloso M , Balakin A , N i J and Fournier M J . (1995) Antisense snoRNAs: a family of nucleolar RNAs with long complementarities to rRNA. Trends. Biochem. Sci. 20(7): 261-264.  5. Bachellerie J-P, Cavaille J and Qu L - H . (2000) Nucleotide modifications in eukaryotic rRNAs: the world of small nucleolar R N A guides revisited. In: The Ribosome: structure, function, antibiotics, and cellular interactions. Garrett R A , Douthwaite, SR, Liljas A , Matheson A T , Moore P B , and Noller HF, (eds). A S M Press, Washington, DC, 191-203.  6. Balakin A G , Smith L and Fournier M J . (1996) The R N A world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell. 86(5): 823-834.  7. Davis DR. (1998) Biophysical and conformational properties of modified nucleotides in R N A (nuclear magnetic resonance studies). In: Modification and Editing of R N A . Grosjean H and Benne R (eds). Washington D C : American Society for Microbiology, 85-102.  8. Dennis P. (1997) Ancient ciphers: translation in Archaea. Cell. 89(7): 1007-1010.  83  9. Ganot P, Bortolin M L and Kiss T. (1997) Site-specific pseudouridine formation in preribosomal R N A is guided by small nucleolar RNAs. Cell. 89(5): 799-809.  10. Ganot P, Caizergues-Ferrer M and Kiss T. (1997) The family of box A C A small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for R N A accumulation. Genes Dev. 11(7): 941-956.  11. Gaspin C, Cavaille J, Erauso G and Bachellerie J-P. (2000) Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes. J. Mol. Biol. 297(4): 895-906.  12. Gautier T, Berges T, Tollervey D and Hurt E. (1997) Nucleolar K K E / D repeat proteins 56p and 58p interact with l p and are required for ribosome biogenesis. M o l . Cell. Biol. 12(12): 7088-7098.  13. Gupta R. (1984) Halobacterium volcanii tRNAs. Identification of 41 tRNAs covering all amino acids, and the sequences of 33 class I tRNAs. J. Biol. Chem. 259(15): 94619471.  14. Gustafsson C, Reid R, Greene PJ and Santi D V . (1996) Identification of new R N A modifying enzymes by iterative genome search using known modifying enzymes as probes. Nucleic Acids Res. 24(19): 3756-3762.  15. Henras A , Henry Y , Bousquet-Antonelli C, Noaillac-Depeyre J, Gelugne JP and Caizergues-Ferrer M . (1998 ) Nhp2p and NoplOp are essential for the function of H / A C A snoRNPs. E M B O J. 17(23): 7078-7090.  84 16. K i m DF and Green R. (1999) Base-pairing between 23S rRNA and tRNA in the ribosomal A site. M o l . Cell. 4(5): 859-864.  17. Kiss-Laszlo Z, Henry Y , Bachellerie J-P, Caizergues-Ferrer M and Kiss T. (1996) Site-specific ribose methylation of preribosomal R N A : a novel function for small nucleolar RNAs. Cell. 85(7): 1077-1088.  18. Lafontaine D L J and Tollervey D. (1998) Regulatory aspects of r R N A modifications and pre-rRNA processing. In: Modification and Editing of R N A . Grosjean, H . and Benne, R. (eds). Washington DC: American Society for Microbiology, 281-288.  19. Lowe T M and Eddy SR. (1999) A computational screen for methylation guide snoRNAs in yeast. Science. 283(5405): 1168-1171.  20. Maden B E . (1990) The numerous modified nucleotides in eukaryotic ribosomal R N A . Prog. Nucleic Acid Res. Mol. Biol. 39: 241-303.  21. Maden B E , Corbett M E , Heeney P A , Pugh K and Ajuh P M . (1995) Classical and novel approaches to the detection and localization of the numerous modified nucleotides in eukaryotic ribosomal R N A . Biochimie. 77(1-2): 22-29.  22. Maxwell ES and Fournier M J . (1995) The small nucleolar RNAs. Annu. Rev. Biochem. 64: 897-934.  23. Moazed D and Noller HF. (1989) Interaction of tRNA with 23S r R N A in the ribosomal A , P, and E sites. Cell. 57(4): 585-597.  24. N i J, Tien A L and Fournier M J . (1997) Small nucleolar R N A s direct site-specific synthesis of pseudouridine in ribosomal R N A . Cell. 89(4): 565-573.  85 25. Noon K R , Bruenger E and McCloskey JA. (1998) Posttranscriptional modifications in 16S and 23S rRNAs of the archaeal hyperthermophile Sulfolobus solfataricus. J. Bacteriol. 180(11): 2883-2888.  26. Ofengand J and Fournier M J . (1998) The pseudouridine residues in rRNA: number, location, biosynthesis, and function. In: Modification and Editing of R N A . Grosjean H and Benne R (eds). Washington DC: American Society for Microbiology, 229-253.  27. Olsen GJ and Woese CR. (1997) Archaeal genomes: an overview. Cell. 89(7): 991994.  28. Omer A D , Lowe T M , Russell A G , Ebhardt H , Eddy SR and Dennis PP. (2000) Homologs of small nucleolar RNAs in Archaea. Science. 288(5465): 517-522.  29. Pelczar P, Filipowicz W. (1998) The host gene for intronic U17 small nucleolar RNAs in mammals has no protein-coding potential and is a member of the 5'-terminal oligopyrimidine gene family. Mol. Cell. Biol. 18: 4509-4518.  30. Qu L H , Henras A , L u Y J , Zhou H , Zhou W X , Zhu Y Q , Zhao J, Henry Y , CaizerguesFerrer, M and Bachellerie J-P. (1999) Seven novel methylation guide small nucleolar RNAs are processed from a common polycistronic transcript by Ratlp and RNase III in yeast. M o l . Cell. Biol. 19(2): 1144-1158.  31. Samaha RR, Green R and Noller HF. (1995) A base pair between tRNA and 23S rRNA in the peptidyl transferase center of the ribosome. Nature. 377(6547): 309-314.  32. Smith C M and Steitz JA. (1998) Classification of gas5 as a multi-small-nucleolarR N A (snoRNA) host gene and a member of the 5'-terminal oligopyrimidine gene family reveals common features of snoRNA host genes. M o l . Cell. Biol. 18(12): 6897-6909.  86 33. Steitz J A and Tycowski K T . (1995) Small R N A chaperones for ribosome biogenesis. Science. 270(5242): 1626-1627.  34. Tollervey D, Lehtonen H , Jansen R, Kern H and Hurt E C . (1993) Temperaturesensitive mutations demonstrate roles for yeast fibrillarin in pre-rRNA processing, pre-rRNA methylation, and ribosome assembly. Cell. 72(3): 443-457.  35. Tycowski K T , Smith C M , Shu M D and Steitz JA. (1996) A small nucleolar R N A requirement for site-specific ribose methylation of r R N A in Xenopus. Proc. Natl. Acad. Sci. USA. 93(25): 14480-14485.  36. Tycowski K T , Shu M D and Steitz JA. (1996) A mammalian gene with introns instead of exons generating stable R N A products. Nature. 379(6564): 464-466.  37. Wang H , Boisvert D, K i m K K , K i m R, K i m SH. (2000) Crystal structure of a fibrillarin homologue from Methanococcus jannaschii, a hyperthermophile, at 1.6 A resolution. E M B O J. 19(3): 317-323.  38. Watkins NJ, Gottschalk A , Neubauer G, Kastner B , Fabrizio P, Mann M and Luhrmann R. (1998) Cbf5p, a potential pseudouridine synthase, and Nhp2p, a putative RNA-binding protein, are present together with Garlp in all H B O X / A C A motif snoRNPs and constitute a common bipartite structure. R N A . 4(12): 1549-1568.  39. Watkins NJ, Segault V , Charpentier B, Nottrott S, Fabrizio P, Bachi A , Wilm M , Rosbash M , Branlant C and Luhrmann R. (2000) A common core R N P structure shared between the small nucleoar box C/D RNPs and the spliceosomal U4 snRNP. Cell.l03(3): 457-466.  40. Bertrand E, Houser-Scott F, Kendall A , Singer R H and Engelke D R (1998) Nucleolar localization of early tRNA processing. Genes Dev. 12(16): 2463-2468.  87  A. CONSERVED GUIDES PMOSR24 Pfu sR24 PabsR24  ACCCU UCCCU GCCCU  3'  C1243 I A AU I I I  A  CUCG A I I I I I GAGAGCU GAGAGCU GAGAGCU  AUGAUGA AUGAUGA AUGAUGA  GAGA  U AA U AA U AA  C1221 I G A A U- U C C U A C p 5 l G A C I I I I I I I I I I I III  G UGAUGA UUAAAGGAU G Q C UGG G UGAUGA UUAGAGGAU G H C UGG U UGAUGA U U AG AGG AU G H C UGG  A UG A AUGA  • u .•  B. STAGE 1 DIVERGENCE PhosP.12 Pfu sR12 PabsR12  CUUGG AGGGG CUGGG  GC A A A I I I I I GCGUUU GCGUUU GCGUUU  AUGAUGA AUGAUGA AUGAUGA  C. STAGE 2 DIVERGENCE  G  U  U| I A A A  D  GAGGG U G U AG  CC A I I I GGU GGU GGU  C A G  GCUG GUUG GCUG  C  C  A  U  C  C  u I UGAUGA UGAUGA UGAUGA  U  U  U  A  A  G UCGGA ufolG AG I  A  C  III  G  A  G  U  G  C AC III UGU UGU UGU  C  U  C1246  I A UGCCCAC u f c ] G AC I l l l l l l l  GGCCU A Q C UCG GGCCAU C C C C U  AUGAUGA AUGAUGA  U1986 I G l e I I C Q C c Q c c H c  • AUGGCC I I I I I I U A U CGG UAC UGG CAUCGG  G1205 I  I I I I I I  PabsRSO Pfu sR50  G I C C C  I  GGGUG GGGUG GGGG A  CUAGU CCUUA CUAGU  /  III  GUGGGUG A Q C UGG GUGGGUG > H C UGG  CAUUU UACUU  U N A S S I G N E D GUIDE  D. STAGE 3 DIVERGENCE  A G G  PabsR51 Pfu sR51  UGUUG CUCCG  AUGAUGA AUGAUGA  G G GCGA C G  C A1131 I  A  U1165 I  AGC GGC I 1 11 1 1 UUG CGG •  ACUCGC U GUCUCG I I I I I I I I 1 1 CAGAG C M A GC C I A C G1059 G C C G C C C C  A  CCCGU AHJJG ACU GG 1 1 1 1 1I i i i i i I I AGGGCA u Q c UGG AG GGC A U H C UGG  UGAUGA AUGA UGAUGU  1 1 1 1 1I  1  T  UUUGG GGUGA  1 1 1 1 I I  CCCGU A[U]G ACU GG 6' 23S rRNA  G  1  U1165  A  G  G CG AC G  NEW GUIDE ASSIGNMENT  E. INTERGENRA DIVERGENCE  ACCC  U  G  G  A  G  G  U  G  C  A  G  C  U  G  C  C  U C  C (Ape: UNASSIGNED GUIDE) C  G2S49  C  I I I I I I  SacsR7 Ape SR19 Consensus Pfu sR3 PabsR3 PhosR3  G UUUGA G CGGCG AGG C G UGGCG  AUGAUGA AUGCUGAA AUG UGA AUGAUGA AUGAUGA AUGAUGA  G  5' Sac 23S rRNA  3 - C 1  UUCU c j | J G CU I  CGCCC I I I I I  III  C A A AG A G Q C GAA CUAUCAA U A CAC A A AUAGCA A GUAGCA A AUAGCA A  UAGUGA UGACGA  U AGAG CCUA AGAG  I I I I I I AUCGU u g J G G  I  C C U  C  5' Pho 23S rRNA  GA  UGAUGA UGAUGA UGAUGA  GUGGG CGAGGCGGG GXGXX - - - GGU G AA - - -GGUGAA - - -AGUGAA M i l l CACUU 3' - C  GCCU A GCCA A GCC U A  C2612  C  G  U2673 (E. coll U25S2) CU G UCGGCUCUCCCCAUCCUGGCCCUGCAGCAGGG G C C A  A  Figure 4.1 Evolutionary divergence of sRNA genes in Archaea. Archaeal sRNAs that guide methylation to homologous positions are aligned and the base pairing to their target sequence in 16S or 23 S rRNA are indicated. Positions of nucleotide substitution in the aligned sequences are in light grey. Where necessary straight lines (—) are used to connect uninterrupted sequences and stippled lines (- -) are used to indicate  88 sequences missing a small number of nucleotides. In (A) to (E), possible stages of evolutionary divergence are illustrated. In (A) and (B) both guides are functional and direct methylation to homologous positions. In (C), the D' guide in Pfu sR50 has no apparent R N A target. In (D), the D' guide of Pab and Pfu sR51 direct methylation to nonhomologous positions. In (E), the family of archaeal sRNAs that directs methylation to position U2552 in 23S rRNA is aligned. The sites of co-variation between the D guide and the r R N A target are indicated (X) within the consensus. The D' guide of Ape sR19 is unassigned, whereas the D' guides of Sac sR7 and Pyrococcus sR3 direct methylation to non-homologous positions 23S G2649 and C2612 respectively.  89  sRNA Gene  Optimum Growth Temperature  Crenarchaeota Sulfolobus  a c i d o c a l d a r i u s (Sac)  Sulfolobus  solfataricus  A e r o p y r u m pernix  a  75- 80  bc  75- 80  29  (Sso)  1 3  (Ape)  23  90--95  0  62--67  ryarchaeota M e t h a n o b a c t e r i u m thermoautotrophicum  (Mth)  C  M e t h a n o c o c c u s j a n n a s c h i i (Mja)  8  A r c h a e o g l o b u s fulgidus  4  (Afu)  80--85  C  65--70  C  P y r o c o c c u s h o r i k o s h i i (Pho)  51  95--100  P y r o c o c c u s abysii (Pab)  52  95 -100  P y r o c o c c u s furiosus  56  95 -100  H a l o b a c t e r i u m s a l i n a r i u m sp NRC1 (Hsa)  0  37 -42  P y r o b a c u l u m aerophylum  >50  (Pfu) (Pae)  C  d  95 -100  Table 4.1 Putative or confirmed sRNA genes in archaeal genomes. a) The sequence of the original set of 18 c D N A clones of S. a c i d o c a l d a r i u s sRNAs and their annotated targets have been published (see Table 2.1). A n additional 11 unique cDNA clones have been isolated and sequenced but have not been further characterized (see rna.wustl.edu/snoRNAdb/). b) Only about two thirds of the S. solfataricus  genome sequence was used for search  analysis. The small number of identified genes relative to the number of known ribose methylations in rRNA suggests either that large proportion of sRNA genes may be non-canonical and have been overlooked by our search program or that some of the methylations are non-guide R N A directed. c) In the searches for sRNA genes in archaeal genomes, we used rather conservative cutoff limits. As a consequence, it is likely that a number of authentic sRNA genes in at least some of the species have been excluded. Identification of these false negatives will require independent confirmation by primer extension, northern hybridization, or  90 some other techniques. In our search of the H. salinarium  genome, we screened for  the top ten candidate sRNAs (all had low confidence scores) by primer extension. None gave detectable extension products of the predicted length. The H.  salinarium  genome encodes aFEB and aNOP56 homologous proteins. This implies that the C D box sRNAs in halophiles may be very divergent and non-canonical compared to the sRNAs in non-halophilic species. In a preliminary screen of the P. aerophylum genome, we identified more than 50 putative sRNA genes. At present, the characterization of these sRNA is incomplete and the sequences have not yet been made available on the archaeal sRNA website.  Co  X2  < 3 o •• O N C N o - o •• CD m IO < - 3 . . 3 E E 3 3 - a - < •• < O —  an  < - 3 •• 3O CD o •• 3 —< •• < < •• < < 3 3 •• 3 O •• O  CU  <  O  o wo  3 3 z< <  "Si p-  CD  2 3  a C  1-  rf cu  < CD < O < <  UJ o  CD  O i i  53  CD  O  3 3  o b X  o  c  ed H-»  c  ea U  o  •*->  o  ^fi  ea  u  "I cu  CO  cu  t: cd OH CO ccS C O -fi H—1 <+ H O  HN  -d  ea  •<->  <  ca  < <|UJ 3  a  ea  JS  CD W  < a o < Z <  a  <  3— < O 3 U. 3 io  CO  fin  CO  rO  fi  o  q  u.  t—1  13  o  CO  co OH §• -—I  CO CO  00  CO < o CO CO o d C O CO •q CO •s CCS •e O Q d O d CO co CO CO pd o in H d JB CO CO 'EH d ta S o § co o CO co o o P, fi -1 ccj o Ci" c CO S o CO cci o CO C*-H co C3 CO o CO S3 d CM  a  1  < CO  f—I  CO  3  • 1—1  •M  • i-H  in  E3  c o  O &  CO  y  I  CJ  13  CO o  fi  CO  fi  cr C O CO  5b  CO  -fi  CO cC cO S Ui CO  1  CN  CO  o  13  ' f i  H—l  o co CO X)  CO ao "o C3 d d 00  CO  CO  CO  < I  H  E C O C O l-l  13  cua  «  1?,  O  13  CU  o  3  to fi  CO o pd i  d fi o .&  O  1  U  CU JS HH  o  5D co  rn co  •a c  3 —J 3  d  o  < < CD OC < a  de rived  < CC CD  X  ;twee  CD <  ccS CO to ccS Ul  «  CD • • CD  < (D CD 3 3 < < CD CD 3 CD 3 • •3 < < O o o o o 3 <  13 C  & o OJD U  isfe  M  co  T3  •  o E— CO > CO o •s o CO '-5 c3 + o-*  equen  O  -  UI  'co  CU  o •• O o - o •• o CD o •• o CD  cu a u ox  enes  o  CD  8 £  O a C«O d  X  CO  CO  o  CO  en  3 O  s  he KN  5  3 O  CD  as  ius.  to io  o  G C  cidoca  C/>  H->  S  •2,  O  < •• < 3 < 3 3 < •• <  2  5  ro  is  w GO  fer  CD  <  o re  W  Over  CO  40  VI  co ©  •d CO cc!  ea  QL  igure  2 o W o  <  13  T3 C  C  o  o -fi CO H^  o  ^d m ro  D co  "5 fi  &  92  A  c  C 73 C71 70 69 G67 66  Ape SR17D: 19 tRNAs P a e s R 5 D': 6 tRNAs Pae sR48 D: 2 tRNAs Pae sR34 D: 8 tRNAs PaesR46 D': 2 tRNAs  Afu sR3 D: 1 tRNA Afu sR4 D: 1 tRNA Mja sR8D': 1 tRNA Pab/Pho/Pfu sR31 D: 1 tRNA Pab/Pho/Pfu sR40 D: 1 tRNA Pae sR26 D: 1 tRNA Pae sR45 D': 2 tRNAs Pae sR51 D: 1 tRNA  HPae SR39 D': 1 tRNA 60 A -  T  V  U G  ^Pae sR37 D': 11 tRNAs 4Pae sR29 D': 3 tRNAs  U 43 42 41 40 C  Pae sR4 D': 1 tRNA Ape sR8 D': 16 tRNAs  A 57 C - * - | P a e sR35 D: 14 tRNAs  65 64 63 62 I I I I 49 C G G  Pho/Pfu/Pab sR32 D': 1 tRNA  >• C 15 A 17 13 U 11 G SsosR11 D': 1 tRNA I I I I Ape sR1 D': 5 tRNAs |>-G 22 23 24 25 • G 20 21 - G Pae sR11 D: 3 tRNAs 27 Pae sR51 D': 3 tRNAs 28 Pho/Pab sR59 D': 5 tRNAs 29 G Pae sR49 D': 1 tRNA G • C 33 Pho/Pfu/Pab sR23 D': 1 tRNA  4 Pae SR37 D: 3 tRNAs  •JSaosRIO D': 3 tRNAs J Pab/Pho/Pfu sR27 D : 1 tRNA 1  |Ape SR5 D': 4 tRNAs Afu sR3 D': 1 tRNA Pab/Pho/Pfu sR40 D': 1 tRNA  PaesR36 D: 1 tRNA iPab/Pho/Pfu sR60 D': 1 tRNA Pae sR27 D: 1 tRNA Ape sR21 D': 1 tRNA S a c s R 1 4 D : 1 tRNA  Figure 4.3 Predicted methylation sites in archaeal tRNAs. The structure of a tRNA is depicted in the standard cloverleaf configuration. The positions predicted to be methylated based on sRNA guide sequence complementarity are indicated by arrows. Other conserved tRNA nucleotides are indicated as letters. Variable nucleotides are indicated by number only.  93  sRNA gene pairs * Orientation  sR2/sR9 sR12/sR34 sR14/sR22 sR26/sR60 sR50/sR54  Opposite strand Opposite strand Opposite strand Same strand Same strand  Pho  Pfu  Pab  109 bp lbp 59 bp 7 bp NF  130 bp 49 bp 40 bp 9 bp 9 bp  116 bp I bp 56 bp II bp UL  Table 4.2 Linkage between Pyrococcus sRNA genes. *  The genomic location of sRNA genes is shown at rna.wustl.edu/snoRNAdb/.  NF  Not found; the sR50 gene is not found in P. horikoshii.  UL  Unlinked; the two sRNA genes are separated by over 300 kbp.  94  Homologous sites conserved between: Archaeal sites  Archaeal genera  6  Humans/ yeast 0  Archaea/ Eukarya  d  Archaea/ Eukarya/ Eukary E. coif  SSUrRNA  83  11  13  2  1  LSUrRNA  171  31  23  7  2  Table 4.3 Methylation at homologous positions within small and large subunit rRNAs. a) Sites that are predicted to be methylated based upon the eukaryotic rule (five nucleotides upstream of the D or D' box). The criteria for guide assignment are generally a minimum of eight base pairs with no more than one G / U base pair and one mismatch. For a few double guide sRNAs, where the targets are close to each other, a mismatch was permitted at positions 4, 5 or 6. In these instances, the complementarity with rRNA may form but the target base may not be methylated. For identification of target assignments, see rna.wustl.edu/snoRNAdb/. b) The number of homologous sites within rRNA that are targeted for methylation by a sRNA guide region in more than one archaeal genera. c) The number of sites of rRNA methylation that are shared between yeast and humans. d) The number of sites of rRNA methylation that are shared between yeast, human, and at least one species of Archaea. e) The number of sites of rRNA methylations that are shared between yeast, human, at least one species of Archaea and E. coli.  95  A  B  (531)  A U U G G C G OOGA  I I I I• • I II  AC cou udcu  c *  A  (1402)  UAGCCGffflAGGG • I I I I I•I I I ? GUCGGCGUCC A  • 1 • *  Single Archaeal genus Multiple Archaeal genera Yeast/Human E. coll  (2562)  Figure 4.4 Conservation of sites of 2'-0-ribose methylation within functionally important domains of the SSU and L S U RNAs of Eukarya, Archaea and Bacteria. The sequence and structure of the 530 translational fidelity stem loop (A) and the 3' terminal decoding stem (B) of SSU R N A and peptidyl transferase center (C) of L S U R N A of S. acidocaldarius are depicted. Potential sites of methylation in archaeal rRNAs based on guide sequence complementarity are mapped on this sequence and are boxed in intermediate gray (found in only one genus) or dark gray (found in more than one genus). The positions of methylation that are conserved between yeast and humans are boxed in  96 light gray. A n arrow indicates coincidence of conserved eukaryotic sites with one or more archaeal genera. The numbers represent the corresponding positions in E. coli rRNA and the asterisks (*) indicates that the sites are also methylated in E. coli rRNA. It is possible to map unambiguously virtually all archaeal and eukaryotic sites on the S. acidocaldarius rRNA sequences because virtually all methylations occur in common core regions that are easily aligned. The complete structure of the SSU and L S U R N A are available on the web at rna.wustl.edu/snoRNAdb/.  97  CHAPTER 5 R E C O N S T I T U T I O N A N D A C T I V I T Y O F A C/D B O X M E T H Y L A T I O N GUIDE RIBONUCLEOPROTEIN C O M P L E X Summary The genomes of hyperthermophilic Archaea encode dozens of methylation guide, C/D box small RNAs (sRNAs) that guide 2'-0- ribose methylation to specific sites in rRNA and various tRNAs. The genes encoding the Sulfolobus homologues of eukaryotic proteins that are known to be present in C/D box small nucleolar ribonucleoprotein (snoRNP) complexes were cloned, and the proteins (aFEB, aNOP56 and aL7a) were expressed and purified. The purified proteins along with an in vitro transcript of the Sulfolobus s R l sRNA were reconstituted in vitro, into an R N P complex. The order of assembly of the three proteins onto the R N A was aL7a, aNOP56 and aFEB. The complex was active in targeting S-adenosyl methionine (SAM)-dependent site-specific 2'-0-ribose methylation to a short fragment of ribosomal R N A (rRNA) that was complementary to the D box guide region of the s R l sRNA.  The presence of aFEB was essential for  methylation as suggested by the finding that variant proteins having site-specific amino acid replacements in the putative S A M binding motif of aFEB were able to assemble into an RNP complex but the resulting complexes were defective in methylation activity. These experiments define the minimal number of components and the conditions required to achieve in vitro, R N A guide directed 2'-0- ribose methylation of a target R N A .  Introduction The eukaryotic nucleolus is a highly specialized organelle where r R N A is transcribed, processed, folded and assembled along with ribosomal proteins into small and large ribosomal subunits (1-5).  During this process, up to a hundred or more  nucleotide modifications are introduced into the ribosomal R N A (rRNA) by two distinct families of snoRNP complexes. The snoRNAs in these RNP complexes contain short antisense guide elements that are used to target modifications to specific locations within the rRNAs. One guide family, the C/D box snoRNPs, targets site-specific 2'-0- ribose  98 methylation and the other guide family, the H / A C A snoRNPs, targets site-specific conversion of uridine to pseudouridine (8-11). The C/D box snoRNAs are characterized by a bipartite structure with conserved C box ( R U G A U G A ) and D box (CUGA) motifs near their respective 5' and 3' ends and related C ( U G A U G A ) and D ' (CUGA) motifs near the center of the molecule (see Figure 1 a, p. 3). The antisense elements are located upstream of the D or D ' motifs and are generally ten or more nucleotides (nts) in length. Methylation is directed to the rRNA nucleotide that participates in a Watson-Crick base pair five nucleotides upstream from the start of the D or D ' box. This is the N plus five rule (7-9). Although the general mechanism used by these RNP complexes in mediating modification has been deduced from in vivo biochemical and genetic observations, isolation and characterization of the structure and the in vitro activity of these guide complexes have not been described. The human C/D box snoRNAs associate with several essential proteins, including fibrillarin, NOP56 and NOP58 (paralogous proteins derived from a gene duplication event) and a 15.5 kDa protein (8, 12, 13, 18).  The corresponding proteins in  Saccharomyces cerevisiae are designated Noplp, Nop56p, Nop58p and Snul3p. Proteins of the fibrillarin family contain a conserved S-adenosyl methionine (SAM) binding motif (14, 15). Replacement of two amino acids in this motif (A157V and P219S) in the S. cerevisiae Noplp protein resulted in synthetic lethality and such mutants exhibit a dramatic reduction in methylation of nascent rRNA transcripts under restrictive conditions (16). The 15.5 kDa protein is a component of both the C/D box snoRNPs and the U4/U6'U5 tri snRNP and belongs to a larger family of related R N A binding proteins that include human L7a and S12 and yeast L30 ribosomal proteins (17-19).  These  proteins bind to a common R N A structural motif consisting of an internal purine rich loop with an unusual fold. The fold is generally characterized by two tandem G - A base pairs, a high degree of purine stacking and a single base rotated out of the R N A loop that inserts into a pocket of the protein (20, see Figure 3 and 6). This R N A structural motif is generated by the C and D box (or C and D') sequences of C/D box snoRNAs and is a highly conserved feature of the 5' stem loop of U4 snRNAs (see Figure 1.2 A and B , in Chapter 1). This R N A motif was described either as the "kink-turn", due to the sharp bend present in the phosphodiester backbone of the R N A axis or as the " G A motif,  99 based on the presence of a highly conserved G A dinucleotide in the asymmetric internal loop (21, 22). This R N A structure element, that defines a new R N A structural class, was recently identified in all three kingdoms of life (21, 22). Archaea are prokaryotic organisms, distinct from Bacteria and believed to be related to the earliest eukaryotes (23). B y employing biochemical and computational methods, the presence of up to 50 or more distinct C/D box sRNAs was demonstrated in several species of hyperthermophilic Archaea (24-26). The archaeal sRNAs appear to guide methylation not only to rRNA during ribosome biogenesis, but also to 21 different positions within various tRNAs.  The genome of the archaeon Sulfolobus solfataricus  encodes three proteins designated aFEB, aNOP56 and aL7a, that are the homologues of the human nucleolar proteins fibrillarin, NOP56/58 and 15.5 kDa. The Sulfolobus zLla protein has been annotated as a ribosomal protein although it exhibits greater sequence similarity to the human 15.5 kDa protein than to either of the paralogous human L7a or S12 ribosomal proteins. Archaeal sRNAs exhibit a bipartite structure with well-defined C and D box sequences near their respective 5' and 3' ends and related C and D ' sequences near the center of the molecules that can be modeled into structural motifs that are similar to those recognized by the human 15.5 kDa protein (20). Here we show that the aL7a protein binds directly to a Sulfolobus C/D box sRNA, and that together with aNOP56 and aFEB, form a RNP complex that is active in vitro in site-directed methylation of a fragment of rRNA.  Binding of aL7a to archaeal s R l methylation guide sRNA. The human 15.5 kDa protein has been shown to interact directly with the 5' stem loop of U4 snRNA and a similar structural motif generated by the interaction between the C and D box sequences in U3, U8 and U14 snoRNAs. Archaeal sRNAs can be modeled into structural motifs that are similar to the binding motifs of the human 15.5 kDa protein in U4 snRNA and U3, U8 and U14 snoRNAs (Figure 5.1 F) (18). A gel electrophoresis retardation assay was used to investigate whether purified, recombinant S. solfataricus aL7a (see Appendix 5 B , page 130) would bind to in vitro transcribed s R l sRNA (Fig. 5.1 A). Increasing amounts of protein caused a dramatic shift in the mobility of the s R l  100 sRNA (Fig. 5.1 A ) . electrophoretic  At higher protein concentrations, complexes with distinct  mobilities were  observed,  suggesting  that  there  are  multiple  conformational isomers of the s R l - aL7a complex. The presence of box C-like and D like motifs appeared to be required for the binding of aL7a to the R N A (Fig.5.1 A and C). For example, the mobility of the R N A component of S. acidocaldarius RNase P, which lacks these sequence motifs, was not altered by the presence of aL7a protein (Figure 5.1 B and D). Similarly, the aL7a protein failed to bind in vitro transcripts containing tRNAGly, a fragment of 16S rRNA or the polylinker region of pGEM7 (data not shown). The optimum temperature for assembly of this and higher order complexes (see below) was 70°C; this is slightly below the 75-80°C optimum growth temperature for Sulfolobus species. Once assembled the complexes were stable for several hours at room temperature.  Higher order R N P complexes containing aL7a, aNOP56 and aFIB. The observation that both eukaryotic and archaeal box C/D methylation guide RNAs can be coimmunoprecipitated with antibodies against NOP56/58 or fibrillarin implies that these proteins are components of the methylation guide RNP complex (24, 29-31). A gel electrophoresis retardation assay was used to determine i f the archaeal proteins (purified aNOP56 and aFIB; see Appendix 5 A and C, page 130) can bind directly to s R l sRNA or be assembled into C/D box RNPs. In contrast to aL7a protein, neither aFIB, aNOP56 nor the two proteins together, were able to retard the mobility of the s R l R N A (Figure 5.1 E , compare lane 1 with lanes 2-4). Since the aL7a protein binds s R l , we decided to investigate i f it could serve to nucleate the binding of aNOP56 and aFIB to the complex. When aNOP56 was added to the sRl-aL7a complex I, a clear supershift in the mobility of the complex was observed (Figure 5.1 E lane 6). This new species was designated complex II. In contrast, when aFIB was added to the sRl-aL7a complex I, no discernible shift was detected (Figure 5.1 E, lane 5). In a final experiment, aFIB was added to the preformed sRl-aL7a-NOP56 complex II. This resulted in an even greater retardation in mobility, indicative of aFIB binding to create the even larger complex III (Figure 5.1 E, lane 7). These experiments suggest that the aL7a protein is the  101 primary box C/D sRNA binding protein. When bound to the sRNA aL7a protein appears to nucleate the step-wise addition of first aNOP56, and then aFEB, to the complex.  Methylation activity of in vitro reconstituted C/D box RNPs. The crystal structure of the M e t h a n o c o c c u s j a n n a s c h i i fibrillarin protein has been determined (15). The carboxy-terminal region contains a motif that is structurally related to the S A M binding sites in several methyltransferase enzymes and thus, appears to be responsible for the methylation activity (14-16). We next asked whether in the presence of S A M and a suitable target RNA, our in vitro assembled complex has methyltransferase activity. The target R N A (29 nucleotides) was designed to contain the region of Sulfolobus  16S rRNA that is recognized in vivo by the D box guide of the s R l sRNA.  Methylation occurs at position EJ52 in the rRNA (24, 25). In the presence of target R N A and S A M radiolabeled at the methyl position, radioactivity was incorporated into acidinsoluble material (Figure 5.2 A). The methylation was dependent on both addition of a suitable complementary target R N A and on the presence of the aFEB protein in the complex. Ln control reactions where only RNAs and either single proteins, or combinations of only two proteins were added, radioactive methyl incorporation into acid-insoluble material was not detected (data not shown). The amount of product formed after 60 min (about 8 pmoles per reaction) was approximately two times the molar amount of aFIB present (4 pmoles per reaction). This implies that, under this reaction condition, each molecule of aFIB was, on average, able to participate in the methylation of two target RNAs. The plateau reached in the reaction appears to be a consequence of the degradation of the guide and target RNAs and the S A M substrate at the high temperature (70°C) required for catalysis, rather than a consequence of inactivation of the three proteins. Supplementation of the reaction after 45 min with additional guide and target RNAs (120 pmoles of each) and S A M (60 pmoles) resulted in a 50 to 100 percent increase in the production of methylated target whereas supplementation with 4 pmoles of each of the three proteins had no effect ( see Appendix 6, page 131). The mechanism for enzymatic turnover is currently unclear. Either multiple target RNAs are able to associate and dissociate from a single pre-assembled sRNP complex or the sRNP  102 complexes are dissembled after each methylation and reassembled prior to the next round of methylation. The supplementation result suggests that some reassembly may occur. A n S. cerevisiae mutant strain that contains replacement of two highly conserved amino acids in the putative S A M binding motif in the Noplp fibrillarin protein (A175V and P219S) exhibits temperature sensitivity and shows a dramatic reduction in methylation of nascent rRNA transcripts under restrictive conditions (16).  B y site-  directed mutagenesis, single amino acid replacements (A85V or P129V) were introduced at the corresponding positions in the Sulfolobus aFIB protein. The two mutant proteins were expressed, purified and mixed with one or both of the aNOP56 or aL7a proteins and s R l sRNA (3' end-labelled with [ P]-pCp) in an assembly assay (Figure 5.2 B). The 32  mixtures were immunoprecipitated with antibodies against aFIB and the presence of sRl sRNA in the precipitate was detected by gel electrophoresis. In the absence of aFIB protein, little or no s R l sRNA was detected in the precipitate. In contrast, both wild type and aFIB mutant proteins were able to assemble with comparable efficiencies, into s R l containing RNP complexes in the presence of aL7a and aNOP56 (Figure 5.2 B). When tested in the methylation reaction, the complex containing the A85V replacement in aFIB was inactive whereas the complex containing the PI29V replacement in aFIB was partially active (Figure 5.2 A). These results suggest (i) that the two aFIB mutants retain structural integrity and are able to assemble into RNP complexes, and (ii) that the putative S A M binding motif in the aFIB protein is essential for methylation of target R N A . This result provides further evidence that fibrillarin acts as the methyl transferase in the C/D box, R N A guide directed methylation.  Importance of the Watson-Crick base-pairing at the site of methylation. In vivo studies in eukaryotes have indicated that a Watson-Crick base pair between the guide and target is required at the site of methylation, five nucleotides upstream from the start of the D or D ' box (7). A n A to U mutation was introduced into the s R l D box guide at this position and a U to A mutation was introduced at the position equivalent to U52 in the rRNA target. Radioactive methyl incorporation was reduced to background in assays using either the mutant s R l guide and a wild-type target or a wildtype s R l guide and the mutant target (Figure 5.3). In contrast, when the mutant guide  103 and the mutant target were used together, base pairing at the predicted site of methylation was regenerated  due to the compensatory nature of the mutations and methyl  incorporation was restored to near the wild-type level.  Specificity of the methylation reaction. Based on the N plus five rule, the site of methyl modification within the target R N A is predicted to occur at the nucleotide position corresponding to U52 in 16S r R N A (1, 2). This residue within the target R N A is part of a unique U G dinucleotide. Nearest neighbor transfer of radioactive 5' phosphate (originating from o>[ P]-GTP used in the 32  synthesis of the transcript) to the nuclease resistant 5'U(methyl)Gp dinucleotide was used to confirm that methylation occurs at this site in the in vitro reaction. Control transcript and transcript incubated with the assembled s R l RNP complex in the presence of S A M , were digested with ribonuclease T2. The hydrolysis products from the two digestions were separated by two-dimensional T L C . In the control hydrolysate, radioactivity was found only in G M P , A M P and U M P and in an additional unidentified spot (Figure 5.4 A). With the target R N A that had been incubated with the s R l RNP complex in the presence of S A M , radioactivity was associated with an additional component that migrated at the position expected for U(methyl)Gp (28) (Fig. 5.4 B). The amount of this dinucleotide was small relative to the amount of radioactive G M P because only about 7 percent of the target R N A was methylated (8 pmoles of methylated product per reaction containing 120 pmoles of target substrate; Figure 5.2 A) in the reaction and because hydrolysis of one pmole of target R N A is expected to generate four pmoles of [ PJ-GMP. In a second experiment, target R N A labeled with a -[ P]-UTP, was incubated in 32  the presence of [ H]-methyl labeled S A M and preassembled s R l RNP complex. The control and methylated target RNAs were digested with nuclease PI and the hydrolysis products were again separated by T L C . In the control hydrolysate, [ P]-radioactivity was 32  only found in U M P (Figure 5.4 C) whereas in the methylated R N A hydrolysate, [ P]radioactivity was associated with two additional products (Figure 5.4 D). The first was pU(methyl)G dinucleotide as judged by comigration with standard and the second was likely pU(methyl), a product produced by complete digestion with PI nuclease. The spots labeled pU(methyl)G, Y and U M P in panel D were excised from the plates and [ H]3  104 methyl content was analyzed by scintillation counting for the presence of [ H]J  radioactivity. As expected, [ H]-radioactivity originating from the [ H]-methyl labeled S A M used in the reaction was detected in the pU(methyl)G (290 cpm) and Y (pUm, 1050 cpm) spots, whereas essentially no [ H]-radioactivity was observed in the G M P spot. 3  Together, these experiments provide strong evidence that the in vitro reconstituted archaeal C/D box RNP accurately directs methylation to the nucleotide in the target that forms a Watson-Crick base pair, five nucleotides upstream from the start to the D box.  Perspectives. Both eukaryotic and archaeal organisms possess small C/D box RNAs with complementary guide regions that are used to direct methylation to specific nucleotide positions in rRNA during ribosome assembly. The guide R N A - r R N A interaction and the associated methylation may have more than one function. The interaction may be used as a means to channel localised folding or mediate structural rearrangement within the rRNA during the assembly process. In addition, the deposition of the methyl group on the 2'-0 position of ribose may provide rigidity and structural stability to the r R N A within the assembled ribosome. Although the predicted positions of most methylations are not highly conserved, virtually all are confined to the structurally important core regions of small and large subunit rRNAs (23). Our attempts to reconstitute an RNP complex that is active in vitro in guidedirected methylation, has resulted in a remarkable observation: the core catalytic complex from Archaea is much simpler than anticipated. It requires only an sRNA and three proteins, the core R N A binding aL7a protein, the aNOP56 protein of largely unknown function, and the fibrillarin protein that appears to possess the methylase transferase activity. It is perhaps surprising that an R N A helicase has yet to be found in our partially purified in vivo sRNP complexes nor is it required for in vitro methylation in our reconstituted system (32). The absence of the helicase requirement may be related to the high temperature of the in vitro reaction (70°C), or to the small size of the R N A target used in the assay. In Sulfolobus cell extracts, C/D box sRNPs are large heterogeneous complexes that sediment between 10S and 50S in a sucrose or glycerol density gradient (24). The larger sedimentation values may reflect the in vivo association of the core RNP  105 complexes with additional proteins or with precursors of small and large ribosomal subunits. The number of easily identifiable C/D box sRNAs in particular archaeal species is correlated to the optimum growth temperature. Genera such as Pyrococcus,  Pyrobaculum  and Sulfolobus contain dozens of sRNAs with guides that are complementary to both rRNAs and tRNAs whereas mesophilic archaeal genera, such as Halobacterium,  contain  few i f any sRNAs (24, 25). The optimum growth temperature for Sulfolobus is between 75° and 80°C and is reflected in the high temperature requirements of the assembly and methylation reactions described here. A temperature of at least 60°C is required to reconstitute the RNP complex and efficient in vitro methylation occurs in a narrow range around 70°C (68°C used in the methylation assays). The narrow activity range likely reflects a combination of the temperature optimum of the proteins, the structural stability of the guide-target duplex, and the chemical stability of the RNAs and S A M substrate. The methylation guide machinery present in the hyperthermophilic Archaea is homologous to the machinery present in the nucleolus of the eukaryotic cell. Remarkably, as the eukaryotic 15.5 kDa/Snul3p homologue, the archaeal aL7a protein has dual function. Both these proteins are components of the core C/D box snoRNPs but each has a different additional role; while 15.5 kDa/Snul3p is part of the spliceosome the small aL7a a ribosomal protein has been identified in the crystal structure of the large subunit of the ribosome (33). Similarly to the 15.5 kDa/Snul3p, aL7a binds a k-turn motif in the R N A in both the ribosome and very probable also in the C/D box R N P complex (21). Taken together, these observations suggest a possible regulatory role of aL7a protein in co-ordinating rRNA biosynthesis with ribosome assembly and raise intriguing questions about the origins and evolution of the C/D box snoRNPs . In addition to rRNA, a large number of other cellular transcripts including tRNAs, snRNAs and mRNAs, transit through the nucleolus during their maturation, en route to their final cellular destination. At least some of these RNAs are substrates for guide directed methylation (34-39). The modifications, in addition to their influence on local R N A secondary structure (40), can play important roles in potentiating R N A / R N A and RNA/protein interactions (41-43). For example, methyl modification has been implicated as a possible switch for controlling A / I editing and splice site selection in brain specific  106 pre-rnRNAs (44). The experiments presented here demonstrate aFEB, aNOP56 and aL7a are sufficient for in vitro methylation. Our ability to reconstitute the archaeal methylation machinery from recombinant components opens the way for more detailed studies on the structure, mechanism and diverse biological functions of these complex RNP machines.  Acknowledgements I am grateful to Nick Watkins for sharing with us information on the properties of the human 15.5 kDa protein prior to publication and for suggesting a secondary structure for the archaeal s R l sRNA. I thank members of the laboratory, Sonia Ziesche and Holger Ebhardt for excellent technical assistance. Thanks go to Pat Dennis for critical reading of the manuscript. This chapter has been accepted for publication, in a modified form, as: " In vitro reconstitution and activity of a C/D box methylation guide ribonucleoprotein complex". Omer A D , Ziesche S, Ebhardt H and Dennis PP. (2001) PNAS.  References 1. Maxwell ES and Fournier M J . (1995) The small nucleolar RNAs. Annu. Rev. Biochem. 64: 897-934.  2. Lafontaine D L J and Tollervey D. (1998) Regulatory aspects of rRNA modifications and pre-rRNA processing. In: Modification and Editing of R N A . Grosjean, H . and Benne, R. (eds). Washington DC: American Society for Microbiology, 281-288.  3. Bachellerie J-P, Cavaille J and Qu L - H . (2000) Nucleotide modifications in eukaryotic rRNAs: the world of small nucleolar R N A guides revisited. In: The Ribosome: structure, function, antibiotics, and cellular interactions. Garrett R A , Douthwaite, SR, Liljas A , Matheson A T , Moore P B , and Noller H F , (eds). A S M Press, Washington, D C , 191-203.  4. Venema J and Tollervey D. (1999) Ribosome synthesis in Saccharomyces cerevisiae. Annu. Rev. Genet. 33: 261-311.  107  5. Filipowicz W, Pelczar P, Pogacic V and Dragon F. (1999) Structure and biogenesis of small nucleolar RNAs acting as guides for ribosomal R N A modification. Acta Biochim. Pol. 46(2): 377-389.  6. Weinstein L B and Steitz JA. (1999) Guided tours: from precursor snoRNA to functional snoRNP. Curr. Opin. Cell. Biol. 11(3): 378-384.  7. Cavaille J, Nicoloso M , and Bachellerie J-P. (1996) Targeted ribose methylation of R N A in vivo directed by tailored antisense R N A guides. Nature. 383(6602): 732-735.  8. Kiss-Laszlo Z, Henry Y , Bachellerie J-P, Caizergues-Ferrer M and Kiss T. (1996) Site-specific ribose methylation of preribosomal R N A : a novel function for small nucleolar RNAs. Cell. 85(7): 1077-1088.  9. Nicoloso M , Qu L - H , Michot B , and Bachellerie J-P. (1996). Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-0-ribose methylation of rRNAs. J. M o l . Biol. 260(2): 178-195.  10. N i J, Tien A L and Fournier M J . (1997) Small nucleolar RNAs direct site-specific synthesis of pseudouridine in ribosomal R N A . Cell. 89(4): 565-573.  11. Ganot P, Bortolin M L and Kiss T. (1997) Site-specific pseudouridine formation in preribosomal R N A is guided by small nucleolar RNAs. Cell. 89(5): 799-809.  12. Ganot P, Caizergues-Ferrer M and Kiss T. (1997) The family of box A C A small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for R N A accumulation. Genes Dev. 11(7): 941-956.  108 13. Gautier T, Berges T, Tollervey D and Hurt E. (1997) Nucleolar K K E / D repeat proteins 56p and 58p interact with lp and are required for ribosome biogenesis. Mol. Cell. Biol. 12(12): 7088-7098.  14. Koonin E V , Tatusov R L and Rudd K E . (1995) Sequence similarity analysis of Escherichia coli proteins: functional and evolutionary implications. Proc. Natl. Acad. Sci. U S A . 92(25): 11921-11925.  15. Wang H , Boisvert D, K i m K K , K i m R, K i m SH. (2000) Crystal structure of a fibrillarin homologue from Methanococcus jannaschii, a hyperthermophile, at 1.6 A resolution. E M B O J. 19(3): 317-323.  16. Tollervey D , Lehtonen H , Jansen R, Kem H and Hurt E C . (1993) Temperaturesensitive mutations demonstrate roles for yeast fibrillarin in pre-rRNA processing, pre-rRNA methylation, and ribosome assembly. Cell. 72(3): 443-457.  17. Nottrott S, Hartmuth K , Fabrizio P, Urlaub H , Vidovic I, Ficner R and Luhrmann R. (1999) Functional interaction of a novel 15.5 kDa [U4/U6.U5] tri-snRNP protein with the 5' stem-loop of U4 snRNA. E M B O J. 18(21): 6119-6133.  18. Watkins NJ, Segault V , Charpentier B, Nottrott S, Fabrizio P, Bachi A , Wilm M , Rosbash M , Branlant C and Luhrmann R. (2000) A common core RNP structure shared between the small nucleoar box C/D RNPs and the spliceosomal U4 snRNP. Cell. 103(3): 457-466.  19. Mao H , White SA and Williamson JR. (1999) A novel loop-loop recognition motif in the yeast ribosomal protein L30 autoregulatory R N A complex. Nature Struct. Biol. 6(12): 1139-1147.  109 20. Vidovic I, Nottrott S, Hartmuth K , Luhrmann R and Ficner R. (2000) Crystal structure of the spliceosomal 15.5 kDa protein bound to a U4 snRNA fragment. Mol. Cell. 6(6): 1331-1342.  21. Klein DJ, Schmeing T M , Moore PB and Steitz TA. (2001) The kink-turn: a new R N A secondary structure motif.EMBO J. 20(15): 4214-4221.  22. Winkler W C , Grundy FJ, Murphy B A . and Henkin T M . (2001) The G A motif: an R N A element common to bacterial anti-termination systems, rRNA, and eukaryotic RNAs. R N A 7(8): 1165-1172.  23. Woese CR, Kandler O and Wheelis M L . (1990) Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. U S A . 87(12): 4576-4579.  24. Omer A D , Lowe T M , Russell A G , Ebhardt H , Eddy SR and Dennis PP. (2000) Homologs of small nucleolar RNAs in Archaea. Science. 288(5465): 517-522.  25. Dennis PP, Omer A and Lowe T. (2001) A guided tour: small R N A function in Archaea. Mol. Microbiol. 40(3): 509-519.  26. Gaspin C, Cavaille J, Erauso G and Bachellerie J-P. (2000) Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes. J. Mol. Biol. 297(4): 895-906.  27. England TE. and Uhlenbeck OC. (1978) 3'-terminal labelling of R N A with T4 R N A ligase. Nature. 275(5680): 560-561.  28. Keith G, (1995) Mobilities of modified ribonucleotides on two-dimensional cellulose thin-layer chromatography. Biochimie. 77(1-2): 142-144.  110 29. Lafontaine D L J , and Tollervey D. (1999) Nop58p is a common component of the box C+D snoRNPs that is required for snoRNA stability. R N A . 5(3): 455-467.  30. Wu P, Brockenbrough JS, Metcalfe A C , Chen S and Aris JP. (1998) Nop5p is a small nucleolar ribonucleoprotein component required for pre-18 S rRNA processing in yeast. J. Biol. Chem. 273(26): 16453-16463.  31. Schimmang T, Tollervey D, Kem H , Frank R and Hurt EC. (1989) A yeast nucleolar protein related to mammalian fibrillarin is associated with small nucleolar R N A and is essential for viability. E M B O J. 8(13): 4015-4024.  32. Daugeron M C , Kressler D, Linder P. (2001). Dbp9p, a putative ATP-dependent R N A helicase involved in 60S-ribosomal-subunit biogenesis, functionally interacts with Dbp6p. R N A . 7(9): 1317-1334.  33. Ban N , Nissen P, Hansen J, Moore PB and Steitz TA. (2000) The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science 289(5481): 905920.  34. Jady B E and Kiss T. (2001) A small nucleolar guide R N A functions both in 2'-0ribose methylation and pseudouridylation of the U5 spliceosomal R N A . E M B O J. 20(3): 541-551.  35. Ganot P, Jady B E , Bortolin M L , Darzacq X and Kiss T. (1999) Nucleolar factors direct the 2'-0-ribose methylation and pseudouridylation of U6 spliceosomal R N A . M o l Cell Biol. 19(10): 6906-6917.  36. Tycowski K T , You Z H , Graham PJ and Steitz JA. (1998) Modification of U6 spliceosomal R N A is guided by other small RNAs. M o l . Cell. 2(5): 629-638.  Ill 37. Bond V C and Wold B. (1993) Nucleolar localization ofrnyc transcripts. Mol. Cell. Biol. (6): 3221-3230.  38. Jacobson M R and Pederson T. (1998) Localization of signal recognition particle R N A in the nucleolus of mammalian cells. Proc. Natl. Acad. Sci. U S A . 95(14): 79817986.  39. Bertrand E, Houser-Scott F, Kendall A , Singer R H and Engelke D R (1998) Nucleolar localization of early tRNA processing. Genes Dev. 12(16): 2463-2468.  40. Davis DR. (1998) Biophysical and conformational properties of modified nucleotides in R N A (nuclear magnetic resonance studies). In: Modification and Editing of R N A . Grosjean H and Benne R (eds). Washington D C : American Society for Microbiology, 85-102.  41. BaidyaN and Uhlenbeck OC. (1995) The role of 2'-hydroxyl groups in an R N A protein interaction. Biochemistry. 34(38): 12363-12368.  42. Chowrira B M , Berzal-Herranz A , Keller CF and Burke J M . (1993) Four ribose 2'hydroxyl groups essential for catalytic function of the hairpin ribozyme. J. Biol. Chem. 268(26): 19458-19462.  43. Abramovitz D L , Friedman R A and Pyle A M . (1996) Catalytic role of 2'-hydroxyl groups within a group II intron active site. Science. 271(5254):  1410-1413.  44. Cavaille J, Buiting K , Kiefmann, M , Lalande M , Brannan CI, Horsthemke B , Bachellerie J-P, Brosius J and Ffuttenhofer A . (2000) Identification of brain-specific and imprinted small nucleolar R N A genes exhibiting an unusual organization. Proc. Natl. Acad. Sci. U S A . 97(26): 14311-14316.  genomic  112  Chapter 5 Figures jg  aL7a [pmole] 0  Z"  1  0.25 0.5 I  2  4 8  Molar excess of unlabeled sRl RNA  T 0.1 0.2 0.5 1 2 5 10 20 100  fc| M H  aL7a [pmole]  0 0.25 0.5  T\  1 2  4 8  Molar excess of unlabeled RNase P RNA  T 0.1 0.2 0.5 1 2 5 10 100  M  m  E aL7a aNOP56 aFIB  +  +++  -+-+-+ + + + +-+  G  G  A'  Tco? D' box •(}. c* C *>°  x  A-U* A-U  A A C U C C C  A A U  Complex III— Complex II -  u s  Sac sRl  A A  EH u c  G *A-U •G-C* U-Ut  Complex I j Transcript -  ' c '  c  3  .  Figure 5.1 In vitro assembly of archaeal s R l s R N A into a ribonucleoprotein complex. In vitro transcribed RNAs were uniformly labeled with ct-[ P]-ATP and used in gel 32  mobility retardation assays to monitor interaction with recombinant aL7a protein. S. acidocaldarius C/D box s R l sRNA (0.2 pmoles), (A), or RNase P R N A (1 pmole), (B), was mixed with increasing amounts of recombinant aL7a protein (0 to 8 pmoles per  113 assay) at 0°C, transferred to 70°C for 10 min, separated on a 10% non-denaturing polyacrylamide gel and visualized by autoradiography. The competition assays contained radiolabeled s R l R N A (0.2 pmoles), aL7a protein (1 pmole) and non radiolabeled competitor s R l (C) or RNase P (D) RNAs (0.02 to 20 pmoles). To detect higher order complexes, uniformly labeled s R l transcript (0.2 pmoles) was mixed with one or more of the proteins (1 pmole of each protein per reaction,) at 0°C, transferred to 70°C for 10 min, separated on a 6% non-denaturing polyacrylamide gel and visualized by autoradiography (E). The positions of free transcript, Complex I (sRl sRNA-aL7a), Complex II (sRl sRNA-aL7a-aNOP56) and Complex III (sRl sRNA-aL7a-aNOP56aFLB) are indicated. A secondary structural model of s R l s R N A is depicted (F). The aL7a protein is predicted to bind to the loops generated by the C/D or C ' / D ' motifs (indicated by *). The base predicted to rotate out of the loop and insert into the pocket of the protein is the first U residue in the C or C box sequence and is highlighted in black (20).  114  Figure 5.2 R N P guide-dependent methyl incorporation into a complementary target RNA. (A) RNP complex was assembled by renaturing in vitro transcribed s R l sRNA and target R N A ( 5 ' - G G G A U A A G C C A [ U ] G G G A G U C U U A C A C U C C C - 3 ' ; the expected site for methylation is bracketed) and mixing with aFIB, aNOP56, aL7a and [ H]-methyl-S3  adenosyl methonine at 0°C (see also section 2.7, Chapter 2). The reaction (120 ul containing 720 pmoles of s R l guide R N A , 720 pmoles of target R N A , 360 pmoles of radioactive S A M and 24 pmoles of each of the three recombinant proteins) was divided into 20 ul portions and transferred to 70°C. At time intervals, single 20 ul reactions were removed and precipitated at 0°C with 5% trichloroacetic acid. The precipitates were  115 collected on nitrocellulose filters, dried and radioactivity was determined by scintillation counting. The predicted secondary structure of the guide and target RNAs are indicated on the right and the kinetics of methyl incorporation are shown on the left. Note that the same activity curve was obtained whether no aFIB or A85V aFIB mutant is added to the reaction. (B) The wild type and the two mutant aFIB proteins (containing the single amino acid replacements A85V or P129V) were tested for their ability to assemble into RNP  particles  using  3'  end-labeled  sRl  sRNA  transcript  (1  pmole)  and  coimmunoprecipitation with antibodies against aFEB. The coprecipitated R N A s were displayed on a 6% denaturing polyacrylamide gel and detected by autoradiography.  116  Time [min|  Figure 5.3 Effects of nucleotide substitution in the methylation guide and target R N A sequences. Nucleotide substitutions were introduced into the s R l D box guide (A to U at the N plus five position relative to the start of the D box) and the r R N A target (U to A at position corresponding to U52 in 16S rRNA). Methylation assays, as described in the legend to Figure 5.2, were carried out using (i) wild-type guide and wild-type target, (ii) mutant guide and wild-type target, (iii) wild-type guide and mutant target or (iv) compensatory mutant guide and mutant target. The base pair at the methylation site for each assay is illustrated on the right and the incorporation kinetics for the four reactions is illustrated on the left. In panel A , the nucleotide expected to undergo methylation in the target R N A is indicated (*).  117  A  a  B  P  Gp  Ap  Gp  Up  Up Pi  Pi  UmGi  X  X  Figure 5.4 Thin-layer chromatographic separation of the hydrolysis products of the target R N A . The target RNAs were transcribed in the presence o f a - r P ] - G T P or a- r P ] - U T P (panels C and D) and used as control R N A (panels A and C) or as substrate for the methylation reaction (panels B and D). After 60 min, the RNAs were recovered and digested with either T2 nuclease (panels A and B) or PI nuclease (4 C and D). The products were separated by two-dimensional T L C (see section 2.8, Chapter 2) and [ P]-radioactivity was located by autoradiography. The spots predicted to be U(methyl)Gp (panel B . contains two radioactive phosphates) and pU(methyl)G (panel D) are indicated by arrows. The dashed circles represent the location of nonradioactive, U V detectable pU(methyl)G standard. The position of the phosphate at the 5' or the 3' position of the dinucleotide is not expected to affect mobility appreciably in the buffer system used. In panels A and B, X indicates a radioactive component of unknown identity; in Panel D, Y indicates the probable position of pU(methyl) that was generated by over-digestion with PI endonuclease.  118 CHAPTER 6  FUTURE PERSPECTIVES  Although much has been learned in this study about the structure, function and complexity of the methylation guide machinery in Archaea, there are still a number of outstanding questions that require attention. A number of these issues are currently being addressed and include (i) the mechanism of the methylation reaction, (ii) the in vivo function and plasticity of the methylation machinery and (iii) the structure of the core methylation guide RNP complex.  6.1 The mechanism of the in vitro methylation reaction. The work presented in Chapter 5 provides initial evidence that ribose methylation of the R N A can be targeted in vitro from recombinant components. However, the detailed mechanism of the catalytic cycle has not been entirely elucidated. Either multiple target RNAs are able to associate and dissociate from a single pre-assembled sRNP complex or the sRNP complexes are partially or completely dissociated after each methylation and reassembled prior to the next round of methylation. The supplementation results in which R N A , S A M or proteins are added 45 minutes after the start of the standard reaction, suggests that some reassembly may occur. Although not easy to resolve, this issue can be at least partially addressed by preassembling two types of complexes. In the first, a primary set of guide and target RNAs are assembled under conditions where the proteins are limiting and then adding a set of competitor guide and target RNAs before the reaction is started by addition of S A M . In the second, the primary and competitor guide and target RNAs are assembled together. Monitoring the total methylation as well as methylation of the primary and competitor RNAs in the two reactions should provide some insights relating to the stability of the RNP complex during the catalytic cycle.  6.2 In vivo analysis and plasticity of the methylation guide machinery. The availability of an in vitro methylation assay provides a powerful tool for studying the structure and function of the methylation machinery. However, ultimately it  119 will be necessary to confirm that the reconstituted system is an accurate reflection of the in vivo solfataricus  system. With the recent development of genetic systems for  Sulfolobus  it becomes feasible to consider the use of epigenetic expression to probe the  in vivo function and plasticity of the methylation guide machinery. Toward this end we have constructed a series of sRl sRNAs that contain alterations in the D box guide region and, assuming that the N plus five rule is correct, should produce new sites of methylation in r R N A (Figure 6.2). The new methylation sites correspond to positions Gm53 in 16S r R N A (Figure 6.2 b) (produced by the deletion of an A residue from the 3' end of the D box guide) and Cml914 in 23S rRNA (Figure 6.2 c) (produced by replacing the D box guide in S. solfataricus  with the D box guide of S. a c i d o c a l d a r i u s sR2).  Position C1914 in 23 S rRNA has been previously confirmed to be methylated in S. a c i d o c a l d a r i u s (see Figure 3.3 B , Chapter 3) but not normally methylated in S. solfataricus  (data not shown). In S. solfataricus  the s R l gene overlaps the 3' end of the  aspartate amino transferase (AAT) gene. The A A T gene and flanking regions containing the promoter and terminator regions has been cloned into a shuttle vector capable of replicating in both E. coli and S. solfataricus  (1, 2). The mutant s R l genes have been  cloned as a cassette into the 3' end of the A A T gene on this vector and in collaboration with Christa Schleper (University of Darmstadt, Germany) and Kenneth Stedmann (University of Portland) have been transformed into S. solfataricus.  To complete this  study, it will be necessary to demonstrate that the transformants contain the intact plasmid and to analyze their rRNAs for methylation at position U52 in 16S r R N A and C1914 in 23S r R N A using the concentration-dependent, primer extension pause assay. If in vivo  function of these altered sRNAs can be demonstrated, additional structure  function features of sRNAs can be probed by mutagenesis and in vivo expression.  6.3 Crystal structure determination of the core methylation guide sRNP complex from S. solfataricus The minimal methylation guide RNP machine in Archaea contains four components, the three proteins (aFIB, aNOP56 and aL7a) and the fifty to sixty nucleotide long guide sRNA. The reaction utilizes two substrates: the target R N A , that can be about 15 nucleotides or smaller and S A M , the methyl donor in the reaction. The parts list is  120 complete; to understand how the machine works will require a complete atomic level blueprint showing the contacts and interactions between all of the components. Toward this end we are initiating a collaborative project with Ralf Ficner (Max-Planck-Institute, Goettingen) to determine the X-ray crystal structures of the proteins and RNA-protein complexes. Our preliminary studies demonstrate the ability of stable and functional C/D box RNPs to assemble in vitro; our next goal is to identify the minimal R N A capable of assembling the three proteins into a complex, since full-length R N A molecules disrupt the homogeneity of protein-RNA crystals. From studies done with eukaryotic C/D box associated proteins, it seems clear that the 15.5 kDa protein binds to a structural motif formed by the C and D (or C and D') sequences of snoRNAs; our mutational studies with s R l and sR13 and the archaeal aL7a homologue confirm this. Moreover, we suspect that the aL7a nucleates the addition of the other two proteins to the complex and that their addition may depend on protein-protein interactions and not require direct R N A contact. To obtain a minimal R N A core for binding, several deletions of s R l and sR13 R N A were generated (Figure 6.3). These constructed RNAs lack either the C/D (sRl) or the C D ' (sRl and sR13) motifs and contain a connector region of variable length. Moreover they exhibit dramatic differences when tested for their ability to bind aL7a and to nucleate the subsequent addition of aFIB and aNOP56; only two of the truncated RNAs function as scaffolds for protein assembly (Figure 6.4 and 6.5). The C D ' stem-loop motif of sRl was sufficient for aL7a binding, but was deficient for higher order assembly with aNop56 and aFEB proteins (Figure 6.4). This construct will, however, be used together with the aL7a protein in crystallization trials, as the predicted secondary structure of this mini-RNA constitutes a putative novel' R N A binding motif. This motif consists of a unique stem and a loop, in contrast to the canonical stem-loop-stem structure adopted by a typical C/D box motif. The second R N A substrate to be used in crystallization trials will be sR13 del.3, containing the C/D motif and the shortest linker region between boxes. This R N A interacts with aL7a (Figure 6.5). In addition, sR13 del.3 also binds aNop56 and aFEB proteins (data not shown) and will be used for the assembly of the full RNP particle prior to crystallization.  121 Summary: Although this study has contributed in a small way to the understanding of the structure and mechanism of methylation guide machinery, there are still many questions that require attention. Among the most important of these are (i) the evolutionary origins, evolution and plasticity of the methylation guide machinery, (ii) the structure of the methylation machinery and mechanism of the catalytic reaction, (iii) the precise role of these methylations in the assembly and function of the translation apparatus, and (iv) the highly specialized functions of this machinery that has evolved within the eukaryotic nucleolus.  References 1. Cannio R, Contursi P, Rossi M and Bartolucci S. (1998) A n autonomously replicating transforming vector for Sulfolobus solfataricus. J. Bacteriol. 180(12): 3237-3240.  2. Stedman K M , Schleper C, Rumpf E, Zillig W. (1999) Genetic requirements for the function of the archaeal virus SSV1 in Sulfolobus solfataricus: construction and testing of viral shuttle vectors. Genetics. 152(4): 1397-405.  O S  <  I CS  cu  -fi  est  o u  id •— es  a o  a Q  ea CS  fi '5  eu -fi  •M  o M ft  TJ  ii n  cu  O O fi CD  ro cu 4=  U  -M  OX)  c  CM  O  'ft ft  CU  O  ,2  c  o  u  u  H  cu CJ  3  fi  s  CJ  fi cr  TS C  CJ CO CJ  es cu  B  S CO a  CL)  Jfi  CJ  .fi  co  •s w  fi 'cS 3 fi H  o  cj CN  5 H—<  CO  CJ  CJ  a •a,  fi  o  CJ  OX cj co  es  <  •-  3  es  00  +fi  CJ  il  o  CH-H  c  -a ccj CO  9 C  '5b •a  o  cj 43  cc! cu h CO  1 — 1  CO  i_2  3 CO  |  CU  cu  fi o cu cj fi  cr CJ CO  co  a  Q  a CO  O -M  c  •*-» fi  43 fo  cc!  C3  O fi O  o a co .fi cj  3 " '5b £» M  CJ  cu  a  -a ' f i  oo cu -fi H-»  cu 43 13  CU  H  H—>  <  00  fi O  a Pi  cu  oo  -o  CO  00  3  Q  fi  O  > CU M  C o  CM O 60  CO  fi  ro '5b O IT) cu a  Cj  ****  el  CL)  CN  19 fi <- •«  fi Se  o -a E « o 12  fi "3  oo  a o to  cu  u3  <  ' f i  Cf-H  ccj  C  *  CJ T3  co  CO M  <J  CJ  cu  O  <N m  to CO CJ  I  ,a .a S3 C C  'co (U  o  2  CU eu fi cu  J3  o  -a fi o o -fi co  5  122  fi  M  <  cu  CU CJ  to  E  S +-»  4CJ H  fi fi  0> 0) 10 "  O  CO  O  UJ  cu 4=  <  CJ  fi^  HW  SO cu i3 OX)  &H  Q ca -fi  I  C3  <N  CD M  43  43  0)  • f i  O ccj  CJ  03  CJ  H ^  oo  cu  fi  co  e a  00  M  'o  co  cci fi  O  'fi  o "EH HH» CJ  i  a  i i  CJ  o  so  s a-  o  CT CU  c  09  a  03 H-H  5-H -4—I  Hr3  O  CJ  -fi  CJ  CL)  fi  • o  1  2  c o  M  u CU  .-fi  co CU  > o c  123  Sac sRl CD' substrate  D'  nTcfv u  G  w  "C -  Q_c  box  C  box  A-U A-U 5" 3* Sac sRl dell  u* u o A A 0  Cbox j  c  c c  d  e  A-U G-C '  »  2  >fJ o G  ^ U  Sac sRl ,  u  B  A  G  G A-U G-C  ^  Dbox  C box j j " ' U  «feA*A ^* C C3' G A  A  Sac sRl del3 U G G  IS-  C G C-G " G-C A  D box  ^  4^>  U  C box  L >  U  A  A  c  C  3 '  b  o  x  <feA' % „ C C3' G U  A  G  5'°  Sso sR13 dell  C  G G  A  c  Sso sR13 del 2  C  e  A  G G  ffl A  U-A C-G u .u  fl  A  c 1 _ C A A A C -G u• U  c ^ . - .  u  u^  C G  u  A3'  5>  C G  G  Figure 6.3  Sso sR13 del 3  5  -  G  A3'  l££J _ A A A A C-G u •u  £k  Cbm  Dim  u_  C *A3' G 5'°  R N A substrates tested for the ability to assemble with aL7a and with aL7a-aNop56-aFib.  Different R N A substrates were generated either by chemical synthesis, S. a c i d o c a l d a r i u s sRl C D ' substrate (Sac s R l C D ' substrate), or in vitro transcribed from partially single stranded templates, S. a c i d o c a l d a r i u s s R l deletion 1, 2, 3 (Sac s R l del 1 to 3) and S. solfataricus  sR13 deletion 1, 2, 3 (Sso sR13 del 1 to 3). The C/D and C/D' residues are  indicated in gray ; the nucleotide corresponding to the position +5 relative to the D box is boxed; predicted hydrogen bonds formed between key residues of the C/D, C/D' boxes are represented with dotted line; additional important positions highlighted in black.  124  aL7a [pmoles]  Sac sR C'D'subs  Figure 6.4  In vitro assembly of the minimal C D ' substrate with the aL7a protein.  Chemically synthesized S. acidocaldarius s R l mutant R N A (Sac s R l C D ' substrate) was 3'-end labeled with pCp and used in combination with recombinant aL7a protein in a gel retardation assay. The predicted secondary structure of the R N A is illustrated on the left and the result of the gel retardation assay is shown on the right. Nucleotides corresponding to the C and the D' motifs are represented in dark gray. The R N A (0.2 pmoles) was mixed with increasing amounts of aL7a (0 to 4 pmoles per assay) at 0°C and transferred at 70°C for 10 minutes. The reaction was loaded on a 16% nondenaturing polyacrylamide gel and the R N A profile visualized by autoradiography.  125  aL7a [pmoles]  Sac sR13 del 3  A A A A C-G  0  0.25  0.5  1  2  4  u. u  G - C  Cbox  D box • Complex 1  tl*  U ° A C  A  3'  G G  5' Figure 6.5  In vitro assembly of the minimal sR13 C/D substrate with the aL7a protein.  Uniformly labeled S. solfataricus  sR13 deletion 3 R N A (Sso sR13 del 3) was used in  combination with recombinant aL7a in a gel retardation assay to test for protein binding ability. The predicted secondary structure of the R N A is illustrated on the left and the result of the gel retardation assay is shown on the right. Nucleotides corresponding to the C and the D motifs are represented in dark gray. The R N A (0.2 pmoles) was mixed with increasing amounts of aL7a protein (0 to 4 pmoles per assay) at 0°C and transferred at 70°C for 10 minutes. The reaction was loaded on a 14% nondenaturing polyacrylamide gel and the R N A profile visualized by autoradiography.  126 APPENDICES  Mk H L 103 76 49W  B  60* 50« 40|  I  33 28 191  ^ ^ H L  Sac 1  r  Sac NOP56  30  m  20  Appendix 1. S D S - P A G E analysis of partially purified recombinants', acidocaldarius proteins used for antibodies production. E. coli cell lysate containing overexpressed, recombinant Sac FIB (A) or Sac NOP56 (B) proteins were subjected to heat-denaturation by incubation at 65°C for 5 minutes, as described in section 2.2.4 of Chapter 2. A 10 [i\ aliquot of the soluble heat-denatured lysate (HL) was loaded on a 12% SDS polyacrylamide gel; the gel was stained with Coomassie Blue R-250. Position of individual size markers (Mk) is indicated on the left; identity and position of recombinant proteins is indicated by the arrows.  127  1  2  3  4  5  6  7  8  aFIB  Appendix 2. Coimmunoprecipitation of S. acidocaldarius aNOP56 by anti-aFIB antibodies. S. a c i d o c a l d a r i u s cell extracts were subjected to immunoprecipitation with pre-immune sera (lanes 3 and 6), anti-aFIB (lane 4) or with anti-aNOP56 (lane7) antibodies as described in section 2.3.2, Chapter2. As a control, immunoprecipitation with anti-aFIB (lane 5) or with anti-aNOP56 (lane8) antibodies was done in the absence of cell extracts. The proteins present in the immunoprecipitates, or in the S. a c i d o c a l d a r i u s cell extract (lane 2), or in an E . coli cell extract containing recombinant aFIB (lane 1) were separated on a 10% SDS-PAGE, transferred to a Immmobilon P and incubated in presence of antiaFIB antibodies in a standard Western blotting procedure as described in section 2.3.2 of Chapter 2. Position of the heavy (H) and light (L) chains of the IgG antibodies are indicated with an arrow on the right. Position of the aFIB protein is indicated with an arrow on the left.  128  A  B B  M B E H P X X h X  H  E  P HEXhPXXhH  P  X  B  P XXhXXhXh  C  M B E H P X X h X  H  E  P  X  P H E X h P X X h H P X X h X X h X h  D  B  H  E  P_ X  M BE H PXXhX PHEXhPXXhH PXXhXXhXh  B M B E H  PXXhXP  H  E  P  X_  II E X h P X X h H P X X h X X h X h  Appendix 3. Southern analysis of S. acidocaldarius s R N A genes. S. a c i d o c a l d a r i u s genomic D N A was digested with restriction enzymes (B, BamHI; E, EcoRl; H , Hindlll; P, PstI; X , Xbal; X h , Xhol; upper, underlined letter above the lanes indicate double digestions) separated on a 0.8% agarose gel, transferred to Hybond N membrane and used in Southern hybrydization as described in section 2.2.2 of Chapter 2. Hybridization was performed with a D N A probe prepared as described in section 2.2.2, Chapter 2 and complementary to (A) s R l , (B) sR2, (C) sR5 and (D) sR13 RNAs. M , radiolabeled D N A size marker; from the top to the bottom of lane M , individual fragment sizes were: 10, 8, 6, 5, and 4 Kbp.  129  Sso-sRIO  SsosRl I  TAGAOKiAAOAAmciirraxMBfc  SHS58  SHS57  "  SHS03  Appendix 4. Co-transcription of S. solfataricus sRIO and s R l l R N A genes. (A) S. solfataricus genomic sequence containing sRIO and s R l l R N A genes. The primers used for the analysis displayed in panels B and C are showed by the arrow, below the D N A sequence. (B) Primer extension was performed as described in section 2.9.5, in Chapter 2. The position of the sRIO-sRI 1 precursor and of the processed s R l 1 5'-end is showed with an arrow on the left. (C) Northern blot analysis showing the unprocessed precursor sRIO-sRI 1 transcript and the monomeric sRl 1 R N A (left arrows).  130  B Mk 103 76  F  Mk 76—  Mk  F  3 3  „ -  103 76  4"  49,  28  F  r,  28 119. Q  >° SSO -aL7a  49  ss  M  33  Sso <—NOP56  28  Appendix 5. S D S - P A G E analysis of purified recombinant S. solfataricus proteins used for the in vitro sRNP assembly. Recombinant S. solfataricus proteins were expressed and purified as described in section 2.2.4, in Chapter 2. Panel (A) Sso FEB, (B) Sso aL7a and (C) Sso NOP56 purified proteins. A n aliquot of the FPLC purified material (F) was loaded on a SDS-PAGE and the proteins stained with Coomassie Blue R-250. Position of individual size markers (Mk) is indicated on the left; identity and position of recombinant proteins is indicated by the arrows.  131  SAM+rRNA SAM+sRl+rRNA  x  *  Standard  40 Time[minj  80  Appendix 6. Effects of supplementation for the target RNA methylation. Five standard methylation reactions were initiated as described in section 2.7, in Chapter2. After 45 minutes incubation time, four of the reaction mixtures were supplemented with [ H]-methyl-SAM (filled circles), [ H]-methyl-SAM and guide s R l (filled triangles), [ H]-methyl-SAM and target rRNA (filled squares) or [ H]-methylS A M , guide s R l and target rRNA (filled diamonds). A non-supplemented, standard reaction was done in parallel (x). 3  3  3  3  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099674/manifest

Comment

Related Items