Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Role of immunoregulation in the development of dermal fibrosis in tight-skin mice Wong, Connie 2000

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2000-566439.pdf [ 10.6MB ]
Metadata
JSON: 831-1.0099538.json
JSON-LD: 831-1.0099538-ld.json
RDF/XML (Pretty): 831-1.0099538-rdf.xml
RDF/JSON: 831-1.0099538-rdf.json
Turtle: 831-1.0099538-turtle.txt
N-Triples: 831-1.0099538-rdf-ntriples.txt
Original Record: 831-1.0099538-source.json
Full Text
831-1.0099538-fulltext.txt
Citation
831-1.0099538.ris

Full Text

ROLE OF IMMUNOREGULATION IN THE DEVELOPMENT OF DERMAL FIBROSIS IN TIGHT-SKIN MICE By CONNIE WONG B.Sc, The University of British Columbia, 1995 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY In THE FACULTY OF GRADUATE STUDIES Department of Experimental Medicine We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA July 2000 © Connie Wong, 2000  In  presenting  degree freely  at  this  the  available  copying  of  department publication  of  in  partial  fulfilment  University  of  British  Columbia,  for  this or  thesis  reference  thesis by  this  for  his thesis  and  study.  scholarly  or for  her  of I  I further  purposes  gain  shall  requirements  agree  that  agree  may  representatives.  financial  the  be  It not  of  £~XP6RlM6MTAL  The University of British C o l u m b i a Vancouver, Canada  Date  DE-6  (2/88)  J"M,L/tP-G ,2^TPT>  Library  by  understood be  Ng6/Q>Q£  an  allowed  advanced  shall  permission for  granted  is  permission.  Department  that  the  for  the that  without  make  it  extensive  head  of  copying my  my or  written  ABSTRACT The tight-skin (Tsk/+) mutant mouse serves as an experimental model for human scleroderma, a connective tissue disorder characterized by excessive deposition of collagen and other extracellular matrix molecules predominantly within the dermal regions, leading to the development of fibrosis. The pathogenesis underlying this disease is currently unclear; however, cells of the immune system have been proposed to be involved in the regulation of fibrosis in both mouse and man. Thus, the potential contribution of immunoregulatory factors in disease development were examined using the Tsk/+ model.  These studies identified a crucial role for  CD4+ T-helper 2 (Th2) cells in regulating the development of dermal fibrosis in the Tsk/+ mutant mice. The ability of CD4+ Th2-cell derived cytokines, in particular IL-4, to modulate dermal collagen deposition in Tsk/+ mice was demonstrated using in vitro and in vivo approaches. Specifically, inhibiting IL-4, a Th2 cell-derived cytokine and a requisite factor in the induction CD4+ Th2 cell differentiation, prevented the development of dermal fibrosis in Tsk/+ mice. These studies suggested a pivotal role for Th2 cells and/or Th2-derived EL-4 in the Tsk/+ disease process. Furthermore, augmentatation of CD4+ Th2 responses, via deletion of the genes for either IL-12 or IFN-y, increased dermal collagen deposition within Tsk/+ mice, also supporting a model in which CD4+ Th2 cell activity is required for dermal pathology in these mice.  Moreover, the emergence of a Th2 immune response apparently required for dermal  fibrosis in Tsk/+ mice appears to require the contribution of yS T cells as the absence of these  ii  cells prevented the evolution of the Tsk/+ dermal fibrosis. These studies will help to provide a framework in understanding the role of Th cells in the development of the fibrotic disease in Tsk/+ mice, with potential relevance to human scleroderma.  iii  TABLE OF CONTENTS  ABSTRACT  ii  TABLE OF CONTENTS  iv  LIST OF FIGURES AND TABLES  vii  PUBLICATIONS OBTAINED DURING THESIS  ix  ACKNOWLEDGEMENTS  x  CHAPTER 1 1.1  1.2  CHAPTER 2  Introduction The tight-skin mutant: a putative model of human scleroderma 1.1.1  Genotypic characteristics  1.1.2  Phenotypic characteristics  CD4+T-helper cells  1  15  1.2.1  Development of CD4+ T-helper cells  1.2.2  Regulatory roles for Thl/Th2 cells in diseases  Thesis Objectives  25  2.1  Regulation of dermal fibrosis by IL-4 in Tsk/+ mice  2.2  Inhibition of CD4+ T h l T-cell development will augment Th2 immune responses that appear to be responsible for enhanced dermal fibrosis in 7 W + mice  2.3  Role of yd T cells in the regulation of CD4+ Th2 immune response in Tsk/+ mice  CHAPTER 3  Materials and Methods  26  iv  3.1  Cell culture 3.1.1  Dermal fibroblasts  3.1.2  CD4+T cells  3.2  Collagen Assay  3.3  Purification of anti-IL-4 antibodies  3.4  Mice 3.4.1  Tight-skin (7W+)  3.4.2  Tsk/+ 1L-12'-  3.4.3  Tsk/+ IFN-Y  3.4.4  7W+ TcrS  A  A  3.5  Tissue histology  3.6  Staining and flow cytometry  3.7  Immunoassays 3.7.1  Stimulation of CD4+ T cells  3.7.2  Cytokine determination by ELISA  3.7.3  Intracellular cytokine staining  CHAPTER 4  Regulation of dermal fibrosis by IL-4 in Tsk/+ mice  4.1  Introduction  4.2  Results 4.2.1  38  IL-4-mediated effects on collagen synthesis by dermal  44  fibroblasts 4.2.2  Anti-IL-4 treatment prevented development of dermal  46  fibrosis in 7W+ mouse 4.3  Discussion  CHAPTER 5  52  Inhibition of CD4+ Thl T-cell development augments Th2 immune responses that appear to be responsible for the enhanced dermal fibrosis in Tsk/+ mice  5.1  Introduction  5.2  Results  5.3  58  5.2.1  Increased dermal fibrosis in Tsk/+ IL-12' mice  5.2.2  Increased dermal fibrosis in Tsk/+ IFN-y mice  70  A  A  Discussion  78 83  v  CHAPTER 6  Role of yd T cells in the regulation of CD4+ Th2 immune response in Tsk/+ mice  6.1  Introduction  6.2  Results 6.2.1  Role of y5 T cells in the generation of dermal fibrosis  90 94  in Tsk/+ mice 6.3  CHAPTER 7  Discussion  Summary and Future Directions  7.1  Regulation of dermal fibrosis by IL-4 in Tsk/+ mice  7.2  Inhibition of C D 4 + T h l T-cell development augments Th2  101  106  immune responses that appear to be responsible for the enhanced dermal fibrosis in 7 W + mice 7.3  Role of y8 T cells in the regulation of C D 4 + Th2 immune response in Tsk/+ mice  7.4  CHAPTER 8  Pathogenesis of Tsk/+ dermal fibrosis - a model  References  115  LIST O F F I G U R E S A N D T A B L E S Chapter 1 Figure 1.1  Schematic representation of protein motifs encoded by normal and Tsk/+ mutant fibrillin-1 transcripts  Figure 1.2  CD4+ T cell differentiation model  Table I  Summary of classical and nonclassical T-cell subsets as defined by surface marker expression, cytokine secretion and function  Chapter 4 Figure 4.1  IL-4Ra expression on primary embryonic and dermal fibroblast cell lines  Figure 4.2  Collagen production by dermal fibroblasts upon IL-4 stimulation  Figure 4.3  Dermal histology of anti-IL-4 treated Tsk/+ mice  Figure 4.4  Dermal collagen thickness of anti-IL-4 Tsk/+ mice  Figure 4.5  Pulmonary pathology of anti-IL-4 treated Tsk/+ mice  Figure 4.6  IL-4 production from Tsk/+ CD4+ T cells following anti-CD3 stimulation  Chapter 5 Figure 5.1  Dermal histology of Tsk/+ IL-12 mice  Figure 5.2  Dermal collagen thickness of Tsk/+ IL-12'' mice  Figure 5.3  Pulmonary pathology of TskZ+IL-lT'' mice  Figure 5.4  IL-4 and EFN-y production by Tsk/+ IL-12 CD4+ T cells A  vii  Figure 5.5  Intracellular cytokine staining of stimulated Tsk/+ IL-12 CD4+ T cells  Figure 5.6  Dermal histology of Tsk/+ IFN-y mice  Figure 5.7  Dermal collagen thickness of Tsk/+1FN-y mice  Figure 5.8  Pulmonary pathology of Tsk/+ IFN-y mice  Figure 5.9  IL-4 and IFN-y production by Tsk/+ IFN-y  A  A  A  A  CD4+ T cells Intracellular cytokine staining of Tsk/+ IFN-y  A  Figure 5.10  Chapter 6 Figure 6  1  CD4+ T cells  Dermal histology of Tsk/+ TcrS mice A  Figure 6 2  Dermal collagen thick ness of Tsk/+Tcr8' mice  Figure 6 3  Pulmonary histology of Tsk/+ Tcr8' mice  Figure 6 4  IL-4 and IFN-y production by Tsk/+ TcrS CD4+  A  A  A  T cells Figure 6.5  Intracellular cytokine staining of Tsk/+ TcrS CD4+ A  T cells  Chapter 7 Figure 7.1  Model of CD4+ Th2 cell involvement in the development of dermal fibrosis in Tsk/+ mice  viii  PUBLICATIONS OBTAINED DURING THIS THESIS  Wong, C ,  Janzen, N., and Jirik, F. R. Gamma delta T cells regulate CD4+ T-helper 2  mediated dermal fibrosis in tight-skin mice, (manuscript in preparation).  Helgason, C. D., Kalberer, C ,  Wong, C ,  Rosten, P. M . , Grewal, R., Jirik, F. R., McManus,  B. M . , Magil, A., and Humphries, R. K. Inflammation and immune complex mediated glomerulonephritis in aging SHIP knockout mice (manuscript in preparation).  Ong, C. J., Ip, S., Teh, S. J.,  Wong, C ,  Jirik, F. R., Grubsby, M . J., and Teh, H. S. A role for  T helper 2 cells in mediating skin fibrosis in tight-skin mice. Cellular Immunology, 196: 6068 (1999).  Wong, C ,  Ong. C , Roberts, C. R., Teh, H. S., and Jirik, F. R. Anti-IL-4 treatment prevents  dermal collagen deposition in the tight-skin mouse model of scleroderma. European Journal of Immunology, 28: 2619-2623 (1998).  ix  ACKNOWLEDGEMENTS  I am indebted to many people who supported and encouraged me during the course-of my thesis. To my supervisor, Frank Jirik, to whom I am grateful for all his support, motivation and encouragement during these last 5 years. I have learned so much from you and I only hope to follow in your footsteps to become a successful scientist with the courage to imagine and explore the unknown. To Nicole Janzen, I am so fortunate to have worked with such a great person and friend who not only displays true scientific commitment but who has also provided continuing emotional support during these last few years. To all my wonderful colleagues in the lab, thank you for making the lab an enjoyable place to work, play and make lifetime friendships. Finally, I would like to dedicate this work to my loving family whose continued support and understanding has meant so much during these past 5 years.  x  CHAPTER 1  Introduction  1.1  The tight-skin mutant: a putative model of human scleroderma Tight-skin (Tsk), the result of an autosomal dominant mutation (Green et al.,  1976), results in cutaneous hyperplasia, connective tissue abnormalites in the internal organs including the heart and lungs as well as development of autoantibodies against a number of autoantigens, such as topoisomerase I. Tsk has been proposed as a model of several human diseases: The increased expression of collagens found in the enlarged heart makes Tsk/+ mice models for the study of myocardial hypertrophy (Bashey et al., 1993;  Chapman and Eghbali, 1990; Osborn et al., 1987). Tsk mice serve as a model for  hereditary emphysema, a condition which develops by 1 month of age (Gardi et al., 1989; Martorana et al., 1989; Rossi et al., 1984; Szapiel et al., 1981). Tsk have also been proposed as a model for hereditary connective tissue disorders, including congenital fascial dystrophy (Jablonska et al., 1989) and other related stiff-skin syndromes (Esterly, 1971). In this study, the Tsk serves as a model for systemic sclerosis or scleroderma (Green et al., 1976; Kasturi et al., 1994), a connective tissue disease characterized by excessive extracellular matrix deposition in the skin and various internal organs (Christner et al., 1998; Dorner et al., 1987; Menton and Hess, 1980; Osborn et al., 1983; Rosenberg et al., 1984; Sgonc, 1999; Strehlow and Korn, 1998).  1.1.1 Genetic characteristics The Tsk mutation, identified over 25 years ago in the inbred mouse strain B10.D2(58N)/Sn, is an autosomal dominant disorder (Green et al., 1976).  While  heterozygote mice have a normal life-span, mice homozygous for the Tsk mutation degenerate and die between 8 to 10 days in utero (Green et al., 1976). Although a candidate gene mutation has been identified (see below), the cause of phenotype in Tsk/+ heterozygotes remains to be established with certainty.  While the mutation was  originally observed in the B10.D2 strain, the Tsk/+ phenotype also develops in mice of various genetic backgrounds including (H-2 ), C 3 H (H-2 ) and C57B1/6 (H-2 ) d  k  b  demonstrating that the Tsk/+ phenotype is independent of genetic background (Green et al., 1976). Genetic mapping of the Tsk mutation (Doute and Clark, 1994; Everett et al., 1994; Siracusa et al., 1993) has localized the Tsk region to mouse chromosome 2, between markers B2m and Ilia, in a region syntenic with a region within human chromosome 15. The gene encoding the microfibrillar glycoprotein fibrillin 1 (Fbn-1) resides within this region on human chromosome 15q21 (Lee et al., 1991; Magenis et al., 1991). Cytogenetic studies have confirmed that Fbn-1 is mapped to mouse chromosome 2, band F (Li et al., 1993) and previous determination that Fbn-1 lies between B2m and Ilia on mouse chromosome 2 suggested its candidacy for the Tsk mutation. Fibrillin-containing microfibrils are a ubiquitous class of connective tissue structural component responsible in large measure for the biomechanical properties of tissue, such as the dermis. The importance of microfibrils was illustrated by the linkage of their principal structural component fibrillin-1, to Marfan's syndrome, a heritable  disorder with pleiotropic effects on the cardiovascular, skeletal and ocular systems (Goldstein et al., 1994; Reinhardt et al., 1995; Reinhardt et al., 1996). The product of the Fbn-1 locus is a large 350-kD secreted glycoprotein that is an integral component of 10- to 12-nm noncollagenous microfibrils present in the extracellular matrix (Cleary and Gibson, 1983). Fbn-1, and the highly related Fbn-2 proteins (Lee et al., 1991; Zhang et al., 1994), participate in microfibril assembly and provide a structural foundation for microfibril formation, acting as templates for tropoelastin deposition in elastic tissues. They provide anchoring roles in nonelastic tissues. While the fibrillins participate in the structure and function of microfibrils, they may also influence cell function and growth (Ramirez and Pereira, 1999). Of relevance to the Tsk phenotype, fibrillin microfibrils appear to act as an organizing scaffold in the continuous elastic network of skin. They are present in dermis as microfibril bundles, devoid of measurable elastin, which extend from the dermal-epithelial junction and also as components of the thick elastic fibers present in the deep reticular dermis (Kielty and Shuttleworth, 1997). Fibrillin-1 belongs to a family of cysteine-rich glycoproteins composed for the most part of multiple repeats homologous to the calcium-binding epidermal growth factor (EGF-CB) module, and a second motif observed in transforming growth factor beta 1binding protein (TGF-bp) (Ramirez and Pereira, 1999). In addition to E G F - C B and TGFP-binding protein motifs, Fbn-1 has R G D domains which may serve to anchor cells to microfibrils (Yin et al., 1995). A mutation in the microfibrillar glycoprotein gene fibrillin-1, Fbn-1 (Siracusa et al., 1996) has been proposed as the defect responsible for Tsk. Initial studies had reported  the identification of a genetic marker in the Fbn-1 gene that was able to distinguish Tsk/+ mutants from controls (Kasturi et al., 1997). A unique T.sA:-related polymorphism was present in the Fbn-1 gene, and further R N A and P C R analysis and sequence determination of the mutant gene demonstrated that the Fbn-1 gene polymorphism was due to an intragenic duplication of a segment of the gene coding for 3.0 K b of mRNA sequence (Kasturi et al., 1997). Thus, the Tsk chromosome harbors a 30- to 40-kb tandem genomic duplication within the Fbnl gene between exons 17 to 40 on band F of chromosome 2 that results in a larger than normal in-frame fibrillin-1 transcript as illustrated in Fig. 1.1.  -hH  III  Fbnl—f  mutant Fbnl  FIG. 1.1.  11  HI  [$}$K~"> [HlKy  Schematic representation of protein motifs encoded by normal and mutant Tsk/+ fibrillin  transcripts. Regions A - E indicate the five domains of the Fbn-1 protein. "Fbnl" indicates the wild-type Fbn-1 protein and "mutant Fbnl" indicates the Tifc-specific protein. The dashed lines indicate the region duplicated in the Tskspecific transcript and the arrow indicates the single junction resulting from the duplication. Symbols represent the corresponding structural motifs: (patterned rectangles) cysteine-rich EGF-like repeats; (white rectangles) EGF-CB repeats; (dark shaded circles) Fib motif; (light shaded circle) Fib-like motif; (dark shaded ovals) TGF-bp repeats; (patterned oval) TGF-bp-like repeats; (asterisks) RGD domain; (horizontal thick bars) proline-rich region (adapted from Lee et al, 1991; Zhang et al 1994).  4  The genomic duplication within the Fbn-1 gene in Tsk/+ mice occurs downstream of the splice donor site at the 3' end of exon 40 and upstream of the splice acceptor site at the 5' end of exon 17 (Siracusa et al., 1996). Intragenic duplication of the Fbn-1 gene results in a polymorphic band in Tsk D N A when digested with various restriction enzymes and hybridized to the Fbn-1 probe (4720-5446), and also in the generation of a transcript which is 3 kb larger than that of wild-type Fbn-1 R N A (Saito et al., 1999). The 7s£:-specific Fbn-1 transcript contains a perfect inframe duplication of exons 17-40, and is predicted to encode a mutant 418-kD polypeptide instead of the wild-type 312-kD polypeptide (Siracusa et al., 1996). The mutant Fbn-1 protein is predicted to have one additional R G D domain, two additional TGF-binding protein (bp) repeats, 18 additional EGF-CB repeats and one additional Fib motif (Siracusa et al., 1996). The tandem duplication within Fbn-1 does not appear to alter the expression of normal or mutant Fbn-1 transcripts, as shown by the comparable steady-state levels of both transcripts in Tsk tissue (Siracusa et al., 1996). The synthesis and secretion of wildtype Fbn-1, however, is higher than that of the mutated Fbn-1 protein, excluding the possibility that Tsk genetic defect is due to a loss of the wild type allele (Saito et al., 1999). Significant correlation between the inheritance of mutant Fbn-1 gene and the development of dermal fibrosis has been observed in 7 W + mice. The accumulation of massive microfibrils that lacked periodicity and an abundance of elastic fibers (Sakai et al., 1986) was noted in the mid-dermis (Phelps et al., 1993), coupled with the disorganization and fragmentation of elastic fibers in the lungs (Gardi et al., 1989). These results suggest that Fbn-1 secretion and incorporation into extracellular microfibrils is not grossly impaired. Furthermore, dermal fibroblasts from Tsk/+ mice  synthesized and secreted both normal and mutant fibrillin-1 in comparable amounts. The incorporation of Tsk mutant Fbn-1 into microfibrils along with the normal Fbn-1 protein suggests that some of the phenotypic alterations in Tsk/+ mice arise because the mutant protein alters microfibril assembly, structure, function, and/or degradation. The expression of Fbn-1 occurs at 8.5 days beginning at the eight-cell stage in the embryo that precedes the time of death of Tsk/Tsk embryos and may account for the recessive lethality (Siracusa et al., 1996). Northern blot analysis revealed that the 14-kb Ts^-specific transcript is detectable in all tissues that normally express the 11-kb wildtype Fbn-1 transcript. Expression levels of the mutant and wild type Fbn-1 transcripts appeared the highest in skin, heart and lungs, whereas expression levels of both transcripts were lower in brain and spleen (Siracusa et al., 1996). Moreover, tissues that showed severe abnormalities in Tsk/+ mice (skin, heart and lungs) also exhibited the highest levels of Fbn-1, supporting the hypothesis that the 7s£-specific Fbn-1 transcript may be associated with and/or contribute to Tsk phenotypes. Since the duplicated Fbn-1 gene codes for one additional R G D , a motif involved in anchoring cells to the microfibrillar network and which has a role in cell adhesion, migration, and differentiation. The presence of a second R G D motif could potentially influence cell adhesion and/or cell shape by modifying integrin binding (Siracusa et al., 1996). Altered integrin binding, in turn, may lead to intracellular signals that govern a cascade of events resulting in increased extracellular matrix synthesis. Alterations in integrin binding might be involved in the immunoregulatory abnormalities observed in Tsk/+ mice.  The two additional TGF-P-binding protein (bp) motifs in the mutant Fbn-1 might contribute to the occurrence of skin sclerosis in Tsk/+ mice. The TGF-J3 family of proteins have roles in development, inhibition of cell proliferation, differentiation, wound healing, inflammation, and fibrosis (Inagaki et al., 1994). The presence of additional TGF-P-bp domains in the mutant Fbn-1 protein might increase the activity of TGF-P. TGF-P is capable of binding to both wild type and mutated Fbn-1. The amount of bound TGF-P was found to be higher in mutated than wild-type Fbn-1 and appears related to the number of TGF-P binding motifs (Saito et al., 1999). This is supported by increased TGF-P transcripts in the skin of Tsk/+ mice (Phelps et al., 1993) and the ability of TGFP to upregulate the transcription of the a collagen I gene (Inagaki et al., 1994). The latent transforming growth factor-beta binding proteins (LTBP) are a recently identified family of widely expressed multidomain glycoproteins that range in size from 125 kDa to 240 kDa (Sinha et al., 1998). Four L T B P genes have been described (LTBP 1, 2, 3, 4) and the homology of latent transforming growth factor-beta binding proteins molecules to the fibrillins has resulted in their inclusion in the so-called 'fibrillin superfamily'. They form intracellular covalent complexes with latent TGF-P and target these growth factors to the extracellular matrix (Sinha et al., 1998). L T B P proteins have a critical role in the association of TGF-P with the extracellular matrix and may also modulate the release of TGF-P from the matrix. The mutant Fbn-1 protein may mimie the action of L T B P proteins, resulting in excessive TGF-P activity that can lead to the tissue fibrosis observed in Tsk/+ mice. The number of E G F calcium binding (CB) domains, which are involved in the binding of calcium during the packing of fibrillin monomers to generate structural  ,7  integrity of microfibrils, are also increased in Tsk Fbn-1. The functional significance of this may rest not only with their importance for aggregation of fibrillin into microfibrils, but also with their ability to bind other proteins or growth factors that can convey signals to neighboring cells (Reinhardt et al., 1995).  1.1.2 Phenotypic characteristics The Tsk/+ mutation in the mouse leads to dermal connective tissue abnormalities reminescent of those observed in human scleroderma. Aberrance of matrix biosynthesis characterized by excessive deposition of collagen appears as the predominant feature in these heterozygous animals that develop skin fibrosis shortly after birth, providing a valuable model to investigate the sequence of events leading to fibrosis. The tightness of the skin is readily detectable at 7 days of age and is manifested by difficulty in gathering a fold of skin in the interscapular region. At 2 months of age, there is a hunched posture and prominent skin thickening with a pronounced hump in the interscapular region. The dermal thickening was associated with a decrease in pliability of the skin of Tsk/+ mice (Green et al., 1976). Electron microscopy revealed changes in the connective tissue architecture of the dermis, including irregular spatial organization of collagen fibrils, which were of small diameter and were tightly packed (Kielty et al., 1998). Furthermore, abundant deposition of fine microfibrillar material in the deep dermis was observed.  Light microscopy studies of skin from Tsk/+ mice showed  generalized dermal thickening and replacement of adipose tissue by collagen bundles (Green et al., 1976). Extensive replacement of the subcutaneous tissue by fibrosis was  observed in the dorsal, lateral, and ventral thoracic regions, abdominal region, and in the fore and hind limbs. The histological evidence suggesting an increase in collagen content and a possible alteration in its structure in the 7 W + mouse has been confirmed by biochemical studies. The average total collagen content of skin from Tsk/+ mice was 2.5-fold greater than that of control skin (Osborn et al., 1983). No qualitative differences in the collagens were found in the skin of Tsk/+ mice, similar to results reported in biochemical studies of affected skin from scleroderma patients showing increased collagen content but no significant alteration in the proportions of various collagen types (Jimenez et al., 1996). Glycosaminoglycans (GAG) are the other major connective tissue component of the dermis and examination of Tsk/+ revealed significant increases in total hexosamine and uronic acid for a given skin surface area (Dorner et al., 1987; Ross et al., 1983), similar to findings in scleroderma (Moller et al., 1985).  Further in vitro studies of collagen  biosynthesis and its regulation have been conducted with dermal fibroblast cultures established from Tsk/+ and normal littermate control mice.  Collagen synthesis was  examined by incorporation of C-proline and production of C-hydroxyproline by Tsk/+ 14  14  and control fibroblast cultures. Both parameters showed a greater than two-fold increase in the Tsk/+ cultures (Jimenez et al., 1986). A l l of the increase was observed in the highly soluble fractions secreted into the culture medium (Jimenez et al., 1986). These findings are similar to results described in several studies of collagen and protein biosynthesis in cultures of scleroderma dermal fibroblasts (Buckingham et al., 1978; Leroy, 1972; Perlish et al., 1976).  At the molecular level, in situ R N A hybridization has revealed that the fibrotic process in 7 W + mice results from the persistence of high procollagen ocl(I), cc2(I), and al(III) by a subpopulation of fibroblasts which produces significantly greater amounts of 14  C-hydroxyproline than their normal counterparts (Jimenez et al., 1986). In more recent  studies, elevated type V I collagen m R N A levels were also found in cultured Tsk/+ fibroblasts. The presence of increased numbers of dermal fibroblasts containing high levels of procollagen mRNA and fibrotic phenotype of Tsk/+ has been confirmed neither to be due to increased fibroblast proliferation nor defective apoptosis (Pablos et al., 1997). Therefore, transcriptional activation of extracellular matrix genes appears more relevant in the pathogenesis of Tsk/+ fibrosis. Abnormal pulmonary development characterized by greatly distended lungs, which are present from birth, are seen in Tsk/+ mice (Gardi et al., 1989; Martorana et al., 1989; Rossi et al., 1984; Szapiel et al., 1981). Histologically, the alterations in the lung resemble human emphysema and no fibrosis is evident. In Tsk lungs, alveolar spaces are markedly dilated with thin, disrupted walls with significant elastin destruction, suggestive of an elastolytic process (O'Donnell et al., 1999). The cause of the pulmonary pathology is poorly understood but may be attributed to the mutant fibrillin protein, as this molecule plays a critical role in elastin microfibril assembly during lung septation (Cleary and Gibson, 1983; Sakai et al., 1986). The immune system appears to also play a role in the disease pathogenesis and/or expression. Evidence for systemic immune activation in Tsk/+ mice has come from reports of elevated levels of circulating TJL-2 and IL-2 receptors on lymphocytes, as well as an upregulation of M H C class II molecule expression (Bocchieri et al., 1991).  ,10  Autoantibodies against topoisomerase I are detectable in the sera of individuals with scleroderma (Muryoi et al., 1992) as well as in approximately half of Tsk/+ mice over 8 months of age (Bocchieri et al., 1991; Hatakeyama et al., 1996; Kasturi et al., 1997). In addition, autoantibodies against fibrillin-1 have been detected in Tsk/+ mice (Murai et al., 1998). Anti-Fbn-1 IgG autoantibodies are present in high titer in many Tsk/+ mice. Specificity of these antibodies was confirmed by competitive inhibition assays and Western blotting analysis using recombinant human Fbn-1 protein. Tsk+ autoantibodies recognize a conserved epitope present in the C region of Fbn-1 (Murai et al., 1998). These results indicate the presence of Fbn-1 specific T and B cells in Tsk/+ mouse repertoire. Serum autoantibodies to fibrillin 1 have also recently have been reported in patients with systemic sclerosis, but not in patients with other connective tissue diseases (Arnett et al., 1999; Tan et al., 1999).  Among a population of Choctaw Native  Americans with the highest prevalence of SSc yet described, a chromosome 15q haplotype containing the fibrillin-1 gene has been strongly associated with SSc (Tan et al., 1999). With a recombinant human fibrillin-1 protein, autoantibodies to fibrillin-1 were detected in the sera of Native American SSc patients that correlated significantly with disease. A b specificity for fibrillin-1 was demonstrated by the lack of binding to a panel of other purified autoantigens (Tan et al., 1999). The results presented demonstrate for the first time the presence of high levels of an ti-fibrillin-1 Abs in a significant portion of patients with SSc. A role for immune system cells in dermal fibrosis was suggested by adoptive transfer studies involving unfractionated Tsk/+ bone marrow or splenic cells, but not purified B or T lymphocyte populations. Introdution of cells into normal syngeneic mice  lfl  led to a delayed Tsk-like dermal phenotype, associated with increased transcription of a l (I) collagen genes and the appearance of autoantibodies with scleroderma-like specificities (Phelps et al., 1993; Walker etal., 1989). Despite the inability of purified T cells to induce disease on passive transfer, there is evidence of a role for CD4+ T lymphocytes in the development of the Tsk/+ phenotype, as a marked reduction in dermal fibrosis was observed on crossing Tsk/+ onto a CD4" background (Wallace et a l , 1994). A  Interesting, the involvement of CD4+ T lymphocytes in scleroderma has been similarly suggested by the strong association of disease occurrence with distinct H L A class II alleles. Recent studies suggest that scleroderma is a disease of major histocompatibility complex (MHC)-associated autoantibody responses, which have specific clinical correlates (Reveille, 1995). Both the anti-centromere and anti-topoisomerase I (anti-topo I) antibody responses have been linked to H L A - D Q B 1 alleles, although recent data suggest that certain H L A - D R B 1 alleles are important for the anti-topo I response and that H L A - D P B 1 alleles also may have a role.  Antibodies to the nucleolar specificity  toposiomerase I have consistently been linked to the H L A - D R B 1*0301, D Q A1*0501, and DQB 1*0201 haplotypes (Kuwana et al., 1993; Morel et al., 1995). Antibodies against fibrillarin, another nucleolar specificity, have been linked to certain H L A DQB1*06 alleles (Arnett et al., 1996), suggesting a role for CD4+ T cells in disease pathogenesis in autoantibody generation (Arnett et al., 1996). Interestingly, although dermal pathology was unaltered in Tsk/+ mice lacking CD8+ T cells, serum anti-topoisomerase activity was absent (Wallace et al., 1994), suggesting that different subsets of immune cells may be responsible for the divergent aspects of the Tsk/+ phenotype. Pulmonary abnormalities remained unchanged in the  ;i2  absence of either CD4 or CD8 T cells, indicating that this pathological process was not mediated by immune system dysfunction (Wallace et al., 1994). Chronic inflammatory conditions can lead to fibrosis that is often associated with an increase in the number of mast cells near or within the granulation tissue. Indeed, in Tsk/+ animals, the dermal pathology was associated with increased numbers of mast cells (Walker et al., 1985). This raised the possibility that mast cells might be involved in the pathogenesis of fibrosis. However, development of Tsk/+ fibrosis was not affected by the lack of mastocytes in Tsk/+ W/W mice (Everett et al., 1995). The W locus encodes the c-kit tyrosine kinase receptor, and mice homozygous for this mutations exhibit several phenotypic abnormalities, including a virtual absence of mast cells in all organs and tissues (Tsai etal., 1991). The contributions of B lymphocytes to the 7 W + disease process was assessed by studying the backcross progeny obtained by breeding Tsk/+ J " (Fl) mice with J "'" mice +/  H  H  or FI Tsk/+ R A G 2 " mice with RAG2"'" mice, all of which demonstrated significant +/  correlation between the inheritance of the defective Fbn-1 gene and the development of dermal fibrosis (Kasturi et al., 1997). The heavy chain variable regions of the immunoglobulin chain are constructed from three gene segments. The diversity (D) and J (joining) gene segments join, then the V (variable) gene segment joins to the combined DJ sequence. Loss of any one of these gene segments, including J , prevents the H  assembly of the heavy chain of the immunoglobulin complex and results in the lack of immunoglobulin producing cells and a deficiency in B cell formation (Hertz and Nemazee, 1998; Nemazee, 2000). The recombinase activating genes (RAG1 and RAG2) encode nuclear proteins that directly mediate the mechanism V(D)J recombination  13  process that occurs in T- and B-lymphocytes. The expression of R A G 1 and R A G 2 is required for the proper development of both maturing B and T lymphocytes (Ohmori and Hikida, 1998). Analysis of the F2 progeny from the backcross between Tsk/+ J " (Fl) +/  H  and J ' H  /_  mice clearly suggest that the absence of mature B lymphocytes does not  abrogate the development of cutaneous hyperplasia and/or the induction of the biochemical alterations present in the skin since all J " progeny inheriting the defective /_  H  Fbn-1 gene developed dermal fibrosis whereas +/+, J " mice did not show such _/  H  abnormality (Kasturi et al., 1997). The effect of the lack of both mature T and B cells on the development of 7s£-associated dermal fibrosis was addressed by examining the progeny obtained from the backcross between Tsk/+ RAG2 " FI mice and RAG2"'" mice +/  (Kasturi et al., 1997). However, progeny exhibiting the Tsk/+ RAG2"'" phenotype was not obtainable from this backcross since both Fbn-1 and R A G 2 genes are located on the same chromosome on loci too close to permit a high frequency of recombination between them . Therefore, the inheritance of a parental chromosome 2 bearing the Tsk mutation as well as RAG2" genes is precluded. A  ':>14 l  1.2  CD4+ T-helper (Th) cells  1.2.1 Development of CD4+ T-helper cells A key functional characteristic of CD4+ T-helper cells is their capacity to secrete cytokines when stimulated with peptides presented by M H C class II molecules. The recognition that immune responses can be directed by two functionally polarized subsets of CD4+ T-helper cells (Thl and Th2) in mice and humans has been an important development in modern immunology (Romagnani, 1999). During an immune response, naive CD4+ T helper (Th) cells undergo a differentiation process to give rise to two cytokine-producing effector cell types. Type 1 T helper cells produce interferon-gamma (IFN-y), interleukin (IL)-2, and tumor necrosis factor (TNF)-beta, which activate macrophages and are responsible for cell-mediated immunity and phagocyte-dependent protective responses (Romagnani, 1999). B y contrast, type 2 Th cells produce IL-4, EL-5, IL-10, and IL-13, which are responsible for strong antibody production, eosinophil activation, and inhibition of several macrophage functions, thus providing phagocyteindependent protective responses (Romagnani, 1999). T h l and Th2 cells develop from common precursors known as Thp cells which secrete only IL-2. A third CD4+ subset, called ThO cells, have also been described as lymphocytes which exhibit an unrestricted cytokine profile, being able to produce a mixture of both T h l and Th2 cytokine patterns (Firestein et al., 1989).  It has been suggested that this phenotype represents an  intermediate stage of differentiation from their respective precursors into either the type 1 or type 2 cell. Identification of specific cell-surface markers that can distinguish type-1 from type-2 cytokine producing cells has been difficult. However, a number of candidates  15  have been proposed as markers of Thl-specific cells, including: the expression of IL12R(32 submit (Shevach et al., 1999); the expression of Txk, a member of the Tec family of nonreceptor tyrosine kinases (Kashiwakura et al., 1999); as well as several chemokine receptors such as C X C R 3 and CCR5 (Annunziato et al., 1999; Bonecchi et al., 1998; Syrbe et al., 1999) which were found preferentially on T cells producing type-1 cytokines. Conversely, candidate markers for type-2 cytokine dominant cells includ3: CD30 (Del Prete et al., 1995; Gattei et al., 1999; Horie and Watanabe, 1998; Romagnani et al., 1997), a member of the tumor necrosis factor-nerve growth factor receptor superfamily; ST2L (Xu et al., 1998), a newly discovered cell membrane bound molecule originally designated T l , DER4, or Fit, that is expressed constitutively and stably on the surface of murine Th2 cells, but not T h l cells. Recently, it has been suggested that OX40/OX40L interactions may promote type 2 responses (Akiba et al., 2000; Lane, 2000; Ohshima et al., 1998; Roos et al., 1998). OX40 (CD134) is preferentially upregulated on T cells by IL-4 and binds to OX40L, which is expressed by B cells. In vitro studies suggest that O X 4 0 L interactions promote the development of IL-4producing T cells but the full significance of OX40/OX40L interactions during in vivo type 2 response to pathogens still requires further evaluation. A strong association has also been observed with the expression of certain chemokine receptors, in particular, CCR3 expression by T cells that express type-2 cytokines, but not type-1 cytokines (Gerber et al., 1997; Lloyd et al., 2000; Sallusto et al., 1997). Recent studies have tried to determine if certain chemokines preferentially cause migration of either type-1 or type-2 cytokine-dominant cells. Initial reports suggest that type-1 cytokine-producing T cell are preferentially  responsive to the chemokines R A N T E S , M l P - l a  •M6  and M I P -  1(3 (Trumpfheller et al., 1998). Previously, secretion of these three chemokines has also been reported to correlate with Thl-like human T cells. Conversely, the chemokine eotaxin specifically binds to the CCR3 receptor found preferentially on T cells expressing type-2 cytokines, as well as on eosinophils (Gerber et al., 1997). To explain the Thl/Th2 differentiation paradigm, it was initially hypothesized that the two subsets were derived from either two different pools of precursor cells or a common precursor. Data obtained from limiting dilution analysis and studies in T C R transgenic mice have clearly shown that naive CD4 T-helper precursor cells have the capacity to differentiate into either T h l or Th2 effector cells (Romagnani, 1999) and that this process is critically influenced by a number of factors. The mechanisms that may influence the T-helper cell differentiation include (a) the affinity of the T cell receptor (TCR) for a particular immunodominant peptide, (b) the nature and dose of peptide ligand antigen, (c) the interactions of costimulatory molecules and extracellular matrix microenvironment, (d) the individual genetic background differences and in particular, (e) the cytokine profile of 'natural immunity' present within the local milieu evoked by different offending agents (Romagnani, 1999). While the influential effects of cytokines on Thl/Th2 differentiation are well documented, it is less clear why a dichotomy of effector cytokine production would initiate from antigen-specific lymphocytes. Nevertheless, in defined experimental systems, the interaction between T-cell receptor (TCR), peptide and major histocompatibility complex (MHC) can determine Thl/Th2 dominance (Murray, 1998). In particular, T C R affinity and ligand density might interface with innate forces in the selection of CD4+ T-cell functions (Chaturvedi et al., 1996; Tao et al., 1997). Using a  17  transgenic mouse model with reduced M H C class II expression on both B cells and dendritic cells, T helper cell differentiation in vivo was influenced by the density of expression of M H C class II (DiMolfetto et al., 1998). Although priming and expansion of antigen-specific T cells were normal in these mice, T cell responses were dominated by the Thl-associated cytokine IFN-y, with reduced levels of the Th2 cytokine IL-4 compared to controls. These results provide direct evidence that the efficiency of antigen presentation in vivo can determine effector cell phenotype. A correlation between the binding affinity of a peptide for M H C or TCR has also been shown with an increasing affinity leading to an enhancement of priming for T h l cells while decreasing the affinity of the peptide for M H C or T C R below baseline affinity leads to enhanced priming for Th2 cells (DiMolfetto et al., 1998; Tao et al., 1997). Although the dose of the antigen represents another important contribution involved in the priming of CD4+ T cells, there is major conflict found within the literature.  These results suggest no clear-cut  conclusions regarding whether "high" or "low" doses of antigen are best suited to induce each type of immune response (Rogers and Croft, 1999). However, one key difference among all these studies is the type of antigen used. It is interesting to note that most of the studies in which low doses of antigen induced Thl-like responses used parasites as immunogens whereas low doses of soluble proteins tended to skew toward Th2-type cells, suggesting that the nature of the antigen can influence the type of response initiated (London et al., 1998). The role of an antigen-presenting cell (APC) in shaping the differentiation pathway of a naive Th cell is potentially powerful because the A P C provides the precursor Th cell with its first activation signals. A feature of A P C that makes them  •18  potential candidates for skewing immune responses is their selective expression of costimulatory molecules.  CD28 and C T L A - 4 are disulfide-linked homodimeric  glycoproteins that serve as receptors on T cells for the B7 family of costimulatory molecules (Greenfield et al., 1998).  A putative role for CD28 in the differential  regulation of Thl/Th2 CD4+ T cell subsets has suggested their support in promoting Th2 differentiation whereas C T L A - 4 is a critical and potent inhibitor of Th2 differentiation (Keane-Myers et al., 1997; Oosterwegel et a l , 1999; Oosterwegel et al., 1999). The corresponding costimulatory ligands, B7-1 (CD80) and B7-2 (CD86) can also influence the development of type-1 or type-2 cytokine-producing T cells from T-helper precursor cells (Harris and Ronchese, 1999). Under certain experimental conditions, B7-1 acts as a costimulatory molecule for the generation of T cells producing type-1 cytokines, and antibodies against B7-1 inhibit such type-1 T cells. The converse occurs with B7-2 and T cells producing type-2 cytokines.  Furthermore, recent reports have suggested that  molecules such as CD4, OX-40 in addition to CD28 support Th2 differentiation and suppress T h l differentiation, whereas others such as L F A - 1 support T h l responses and suppress Th2 responses (Rogers and Croft, 2000). Interestingly, the signaling of OX40, a CD4 activation antigen expressed on naive CD4+ T cells, is largely dependent on CD28 signaling. It has been suggested that individual receptors do not intrinsically regulate one cytokine phenotype or another, suggesting that differentiation is controlled by the level of expression of multiple accessory molecule pairs integrated with the number and affinity of peptide/MHC complexes. The cytokine environment has been put forth as the major variable influencing Thelper cell development. The initial studies examining the influence of cytokines on Th  19  differentiation into T h l / 2 effector cells used polyclonal stimulants such as P M A (polymyristate acid), lectin concanavalin A (ConA) or anti-CD3 to activate small resting T cells from naive donors (HayGlass et al., 1996). The cells were stimulated for 2-7 days in the presence of different cytokines and then recultured with the stimulant alone to induce the production of effector cytokines. The data obtained using these approaches were later supported by in vitro studies using T C R transgenic T cells stimulated with cognate antigen (Croft and Swain, 1992). Together, IL-12 and IFN-y are thought to be the major cytokines promoting T h l differentiation (Adorini, 1999; Billiau et al., 1998; Constant and Bottomly, 1997; Germann and Rude, 1995; Jouanguy et al., 1999; O'Garra, 1999; Schmitt et al., 1997; Sinigaglia et al., 1999; Sutterwala and Mosser, 1999; Trinchieri, 1995; Trinchieri and Gerosa, 1996). IL-12 has several effects on T h l cells. It can induce the proliferation of certain T h l cells in combination with IL-2. Furthermore, IL-12 in combination with EL2, enhances the TCR/CD3-induced synthesis of IFN-y of several T h l clones (Germann and Rude, 1995; Trinchieri, 1995; Trinchieri and Gerosa, 1996). Finally, IL-12 in combination with IL-2 induces homotypic cell aggregation of T h l clones. This type of cell aggregation depends on the participation of L F A - 1 and ICAM-1 molecules (Germann and Rude, 1995). The presence of IL-12 during priming directly augments T h l differentiation (Adorini, 1999; Schmitt et al., 1997; Sinigaglia et al., 1999; Trinchieri, 1995). By contrast, in the case of IFN-y, its effect may be to prevent the outgrowth of Th2 cells rather than to promote directly the selective development of T h l cells. Interestingly, unlike IFN-y, IL-12 has no effect on Th2 development (Billiau et al., 1998; O'Garra, 1999).  20  Using the same in vitro priming system, IL-4 was demonstrated to have the greatest influence in driving Th2 differentiation (Cheever et al., 1995; de Vries et al., 1999; Gause et al., 1999; Haas et a l , 1999; Romagnani, 1999; Salmon-Ehr et a l , 1994). The ability of primed CD4+ T cells to produce IL-4 upon restimulation was directly correlated with the concentration of exogenous IL-4 added to the primary culture, with IFN-y producing Th cells being suppressed at the higher doses of IL-4 (de Vries et al., 1999; Gause et al., 1999). Moreover, the inclusion of anti-IL-4 mAb during priming completely abrogates the generation of Th2 cells (Cheever et al., 1995), suggesting that the presence of some IL-4, even i f endogenously derived, is essential for Th2 differentiation (Fig. 1.2). yf*"^  FIG. 1.2.  ^ >  M0 > " ^jr^  Sources of IL-4 Mast cells  CD4+ T cell differentiation model. Schematic representation of the immunoregulatory factors  involved during CD4+ T cell differentiation which influence the development of naive CD4+ T cells into either Thl or Th2 effector cells. In particular, Thl cell generation is critically dependent on the presence of IL-12 production by antigen-presenting cells, especially macrophages, which is positively regulated by natural killer (NK) cell-derived IFNy. In contrast, IL-4 appears to be crucial for the development of Th2 cells, from which a number of candidate sources have been suggested. These differentiated T helper subsets can generate specific cytokine patterns with differential effects on a wide variety of cells, including fibroblasts.  '''•21  Based on both in vitro and in vivo studies, the window of time available before a precursor Th cell becomes committed to a single effector cell phenotype has been estimated to be only a few days. Therefore, in vivo, the relevant cytokine will need to be present at the site of T cell/antigen contact within hours of infection or antigen administration in order to exert any influence on priming. One potential source of these cytokines is cells that form part of the innate arm of immunity. Candidate cell types involved in T h l differentiation include N K cells for IFN-y production (Biron et al., 1999; Leite-de-Moraes and Dy, 1997; Mond and Brunswick, 1987), resulting in upregulation of IL-12 production from antigen-presenting cells such as macrophages. On the other hand, basophils or mast cells represent potential cellular sources for IL-4 production (Haas et al., 1999; Mekori and Metcalfe, 1999). In addition, CD4+ T cells bearing the NK1.1 surface marker (Poynter et al., 1997; Yoshimoto et al., 1995) as well as y$ T cells (Ferrick et al., 1995) can release significant levels of IL-4 within a few hours after in vivo administration of anti-CD3 (Table I).  Table I.  Summary of classical and nonclassical T-cell subsets as defined by surface marker expression, cytokine secretion and function. TM Thl Surface markers  Th2  Tel  C04  CD4  COS  *0 TcR  »P TcR  ipTcR  Tf5  Tc2  Trl  coa  COS aP TcR  otP TcR  C04  C04  C04  C04SRB-  aPTcfl  ySTcfl  C04'  C08  yS TcR  ySTcR  Cytokine secretion IFN-y IL-2 IL-4 IL-5 lt-6 11-10 H-13 TGF-p Function  +++ +++  -  +++ +++  -+ +  +++ +++ +++ +++ ++  -+ +  8-cell help  Immunity  DTH CM  -+ + +  Allergy Asthma  -  to viruses  -+ + +  +++ +++ +++ +++ ++  Immune suppression  -  -  +  -+  -+ +  -  -+  -+ + +  -+ + +  -+ + + -+  Suppression  Induces  Suppression  -+ + + -+ + + -Early  +++ +++  -Tolerance of  +++ +++  -  -Tolerance of  of EAE in  tolerance in  of Thl  source of  respiratory  respiratory  rat through  mouse  responses:  1-4  TGF-P  models of  induces  antigens through  antigens through  EAE and  tolerance in  secretion of  secretion of  colitis  mouse  IFN-y:  IFN-y  through  models of  early  TGF-p  EAE and  source of  colitis  IFN-y  through IL-10  22  1.2.2 Regulatory roles for CD4+ Thl/Th2 cells in diseases In addition to playing different roles in protection, polarized Thl-type and Th2type responses are also responsible for different types of immunopathological reactions. Thl-dominated responses are potentially effective in eradicating infectious agents, including those hidden within the host cells. A distinct Thl/Th2 divergence determine resistance versus susceptibility to diseases such as Leishmaniasis  (Himmelrich et al.,  1999; Launois et al., 1998; Locksley and Scott, 1991; Louis et al., 1998; Reiner and Locksley, 1995) and Toxoplasmosis (Kasakura, 1998) in mice. In allergic diseases such as atopic dermatitis (Kasakura, 1998; Romagnani, 1996) and allergic asthma (Kon and Kay, 1999; Umetsu and DeKruyff, 1997), allergen-specific T cells acquired the Th2 phenotype. When the T h l response is poorly effective or exhaustively prolonged, it may result in host damage. T h l cells are involved in the pathogenesis of organ-specific autoimmune disorders, such as: experimental autoimmune uveitis (Druet et al., 1995; Singh et al., 1999), experimental allergic encephalomyelitis (Lafaille, 1998; Liblau et al., 1995; Singh et al., 1999), or insulin-dependent diabetes mellitus (Heurtier and Boitard, 1997; Lafaille, 1998; Liblau et al., 1995), Crohn's disease (Bhan et al., 1999; Pena and Crusius, 1998), Helicobacter py/on-induced peptic ulcer (Pena and Crusius, 1998), acute kidney allograft rejection (Romagnani, 1999), in addition to resistance susceptibility to diseases such as Leishmaniasis  and Toxoplasmosis  versus  in mice and  unexplained recurrent abortions. In contrast, Th2 responses are apparently insufficient to protect against the majority of infectious agents, but can provide some protection against parasites (Else and Finkelman, 1998). Th2 cells tend to limit potentially harmful T h l mediated responses. Thus, Th2 cells may be regarded as a part of down regulatory (or  >,23  suppressor) mechanism for exaggerated and/ or inappropriate T h l responses. Th2-cell predominance has been found in the skin of patients with chronic graft-versus host disease (Blazar et al., 1997; Kasakura, 1998), progressive systemic sclerosis (Lafaille, 1998; Romagnani, 1999), systemic lupus erythematosus (Del Prete, 1998; Furukawa, 1997), and allergic diseases such as atopic dermatitis (Kasakura, 1998; Romagnani, 1996) and allergic asthma (Kon and Kay, 1999; Umetsu and DeKruyff, 1997). Moreover, Th2 responses against still unknown antigens predominate in Omenn's syndrome (Romagnani, 1999), idiopathic pulmonary fibrosis (Romagnani, 1999), and progressive systemic sclerosis (Lafaille, 1998; Romagnani, 1999). Finally, the prevalence of Th2 responses may play some role in a more rapid evolution of human immunodeficiency virus infection to AIDS (Romagnani et al., 1994; Smith et al., 1995). It is of note that in experimental models in animals, a number of diseases can be prevented by switching immune responses from T h l to Th2 or from Th2 to T h l (Gemmell and Seymour, 1994; Hassig et al., 1998; Lafaille, 1998). Moreover, the T h l / T h 2 concept suggests that modulation of the relative contribution of T h l - or Th2-type cytokines makes possible to regulate the balance between protection and immunopathology, as well as the development and/or the severity of some immunologic disorders. The Thl/Th2 paradigm also provides the rationale for the development of new types of vaccines against infectious agents and of novel strategies for the therapy of allergic and autoimmune disorders.  24  CHAPTER 2  Thesis Objectives  Hypothesis: Development of the dermal fibrotic disease is mediated by a CD4+ Th2-dominated immune response in tight-skin (Tsk/+) mice 2.1  Regulation of dermal fibrosis by IL-4 2.1.1  In vitro role of IL-4 on collagen production by Tsk/+ fibroblasts  2.1.2  In vivo role of IL-4: Inhibition of IL-4 and its effects on the development of CD4+ Th2 immune response and dermal fibrosis in 7 W + mice  2.2  Inhibition of CD4+ Thl T-cell development augmentsTh2 immune responses that appear to be responsible for the dermal fibrosis in Tsk/+ mice 2.2.1  Enhancement of CD4+ Th2 T-cell immune response in Tsk/+ mice deficient in IL-12, a critical cytokine involved in the generation of Thl cells: Consequences on dermal fibrotic development  2.2.2  Augmentation of CD4+ Th2 cell development by preventing the recruitment of T-cells into the Thl pathway and/or releasing Th2 development from inhibitory influences in Tsk/+ mice deficient in IFN-y  2.3  Role of y<5 T cells in the regulation of CD4+ Th2 immune response in Tsk/+ mice 2.3.1  In vivo role of y8 T cells as the cellular source of initial IL-4 production required for induction of CD4+ Th2 cell development: Consequences on dermal fibrosis in Tsk/+ Tcr8'~ mice  -.25  CHAPTER 3 Materials and Methods  3.1  Cell Culture  3.1.1  Dermalfibroblastcultures The control and Tsk/+ cell lines were derived from the dermis tissue of C57B1./6  and Tsk/+ mice respectively. Briefly, dermal tissue explants from the interscapular region were harvested from 2-month-old animals and minced into small pieces, followed by digestion with 1 mg/mL collagenase/dispase (Boehringer Mannheim Canada, Laval, Quebec) for 30 min at 37°C.  The digest was then washed three times in D M E M  (StemCell Technologies, Vancouver, B C ) and cultured in the presence of D M E M supplemented with 10% (v/v) FCS containing 2 m M glutamine, 100 |ig/mL streptomycin and 100 U / m L penicillin.  After approximately 1 week incubation at 37°C in an  atmosphere of 5% C 0 , fibroblasts were detached by brief trypsin-EDTA (Gibco-BRL, 2  Burlington, ON) treatment and resuspended in D M E M . Fibroblasts were then transfected by the calcium phosphate method at the second passage with a plasmid encoding the SV40 large T antigen and the neomycin resistance gene. Approximately 16h later, cells were washed with PBS and incubated in fresh cc-MEM (StemCell Technologies) supplemented with 10% (v/v) FCS. Approximately 36h later, cells were washed again with PBS, briefly exposed to trypsin, and then replated into 60-mm tissue culture dishes containing oc-MEM supplemented with 10% FCS and 200 ixg/mL G418. The resultant  .26  G418 resistant cells were maintained in culture by continuous passage in complete D M E M . Cells were passaged every 4 or 5 days and reseeded at 3 X 10 cells/180 cm . s  2  Adherent monolayers of fibroblasts were dissociated with 0.25% trypsin/1 m M E D T A (Gibco-BRL). Fibroblast cells were obtained from 12-day-old embryos as follows: control and Tsk/+ mouse embryos, identified by the presence or absence of black eye pigmentation, were minced with scissors and then cultured in D M E M supplemented with FCS and antibiotics as described above.  3.1.2  CD4+T cells Spleens were removed from 2-month old age- and sex-matched animals and  dispersed into a single-cell suspension, followed by red blood cell lysis by incubation with mouse red blood cell removal buffer (MRCRB) for 3 min at 37°C. CD4+ cells were purified from splenocytes by positive selection using magnetic cell sorting (MACS) colloidal super-paramagnetic microbeads coupled to rat anti-mouse C D 4 (L3T4) (Miltenyi Biotech, Auburn, C A ) as described by the manufacturer.  F A C S analysis  performed using PE-conjugated anti-CD4 and FITC-conjugated anti-CD8 (Pharmingen, San Diego, C A ) , revealed that CD4+ populations were -95% pure. To induce T-cell activation and proliferation, CD4+ cells were cultured at 3 x 10 cells/mL in RPMI 1640 6  (Stem Cell Technologies) with 10% FCS supplemented with 3% X063 mouse IL-2conditioned medium on tissue culture dishes (Nunc, Naperville, IL) that were precoated with anti-CD3 (145-2C11, Pharmingen, Mississauga, ON). Anti-CD3-coated plates were prepared by incubating 1 u,g/mL anti-CD3 in PBS on 24-well plates (Nunc) for 2h at  .'•27  37°C, followed by three PBS washes.  After a 48h incubation, CD4+ T cells were  removed from anti-CD3 -coated dishes and allowed to proliferate in the presence of 3% mouse IL-2-conditioned medium. CD4+ T cells were harvested for experiments (below) following 4 d in culture.  3.2  Collagen Assay Collagen production was quantitated in cell culture supernatants by direct ELISA  as described previously (Terato et al., 1996). Briefly, 6-well plates (Nunc, Burlington, ON) were seeded with 10 cells/well and incubated at 37°C overnight in complete 6  D M E M ; 24h later, cells were washed twice with PBS and then incubated in the presence of 0.5 mL serum-free D M E M for a further 24h. Cells were then stimulated with 10 u,g/mL synthetic IL-4 or IL-4 plus 11B11 (anti-IL-4 mAb) at 10 u,g/mL, in 0.5 mL serumfree D M E M and cultured at 37°C. Cell supernatants were then harvested at 72h, a time found to be optimal for assessing collagen secretion. Collagen-containing supernatant samples were then solubilized with pepsin (Sigma, St. Louis, M O ) under acidic conditions and then further digested with elastase (Sigma) at neutral p H according to the manufacturer's protocol (Chondrex, Redmond, W A ) . To assay for soluble, monomelic collagen in the samples, 96-well plates (Falcon, Franklin Lakes, NJ) were coated overnight at 4°C with cell supernatants diluted 1:100 in 0.15M potassium phosphate buffer, p H 7.6, or with standards (Chondrex), washed 24h later with 0.02% Tween-20 in PBS, and blocked with PBS containing 0.05% skimmed milk powder for l h at 4°C. After washing, wells were incubated with 10 ug/mL rabbit anti-mouse type I collagen (Biodesign International, Kennebunk, M E ) at 4°C for 4h. Bound primary antibody was  detected with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody diluted 1:2000 in blocking buffer and allowed to incubate for l h at room temperature. Plates were then washed and bound peroxidase-conjugated antibody was detected using the 2,2'-azino-bis(3-ethylbenzthiazoline)-6-sulfonate (ABTS) substrate system (Sigma). Absorbance was read with a microplate reader at 405 and 490 nm. The amount of collagen was assessed by comparing the A ^  4 9 0  values to standard titrations obtained with  purified mouse type I collagen concentrations ranging from 0-50 u,g/mL.  3.3  Purification of anti-IL-4 antibodies The rat mAb 11B11 (IgGl) which neutralizes mouse IL-4 and 3B2 (rat IgGl), an  isotype-matched control mAb which recognizes rabbit Ig, were isolated from the conditioned media of hybridomas. 1 IB 11 hybridomas were cultured in roller bottles with R P M I 1640 medium supplemented with L-glutamine and 10% FCS. 3B2 hybridomas were similarly grown in RPMI 1640 supplemented with 10% FCS and 2% 10X 3T3 cellconditioned medium.  A b were purified from conditioned media using protein G -  Sepharose, dialyzed against P B S , pH 7.4, and A b concentrations were quantitated spectrophotometrically.  3.4 3.4.1  Mice Tight-skin (Tsk/+) mice Tsk/+ and pa/pa mutant mice on a C57B1/6 background were obtained from the  Jackson Laboratory (Bar Harbor, M E ) . Tsk/+ mice were originally backcrossed onto C57B1/6 females and Tsk/+ progeny was identified by three criteria. First, P C R  -29  amplification of a 200 bp PCR product corresponding to a 7!s£-specific genomic sequence spanning the breakpoint of duplication between exons 17 and 40 within the mutant fibrillin  gene.  The  oligonucleotide  primers  are:  1)  5'  G T G A A C G G G G G A A A T A A T T G C A T G 3'-specific for exon 40 of the Fbn-1 gene and 2) 5' C C T T T C C T G G T A A C A T A G G A A G C  3'-specific for Fbn-1 intron 17-specific  sequence. Tsk/+ progeny were also identified by the characteristic loss of skin pliability during palpation of the dermis as well as the abnormal pulmonary pathology resembling emphysematous-like changes associated with Tsk/+ mice. Only the Tsk/+ males were used for breeding as the females were unable to undergo the pregnancy process due to the excessive collagen deposition, rendering child birth a very difficult process. A l l Tsk/+ animals used throughout theses studies are female and age-matched. The Tsk/+ colony has been backcrossed >20 generations onto the C57B1/6 background. Viral antibody-free mice were maintained within a barrier facility in accordance with institutional guidelines.  3.4.2  In vivo anti-IL-4 mAb treatment of Tsk/+ mice Beginning on postnatal day 7, control (3B2) and anti-IL-4 (11B11) Ab were  administered once per week by an intraperitoneal (i.p.) injection of 0.75 mg for 8 weeks and the mice were then killed by carbon dioxide inhalation. Doses of 1 IB 11 in the range of 0.5-1.0 mg per week have been typically employed to bring about complete neutralization of IL-4 in vivo.  3.4.3  Generation of Tsk/+ mice deficient in IL-12 gene  •30  The IL-12 p40'' mice on a C57B1/6 background were obtained from the Jackson Laboratory (Bar Harbor, M E ) . Male Tsk/+ mice were mated with female IL-12 p40'' mice to generate heterozygous Tsk/+ IL-12 ~ animals. Male Tsk/+ IL-12 ~ mice were +/  then  +/  mated with female IL-12'*' mice to obtain mice homozygous for the IL-12''  mutation. The IL-12'' genotype was confirmed by PCR amplification of targeted alleles from genomic D N A according to a protocol provided by the Jackson Laboratories. The oligonucleotide  primers  are  as  5 ' G G G G AA A G A T G G T C G T G C T A GAT3 '  follows:  1576S:  and  1 97 8 A :  5 ' G C A G G T C C A G A G A C T G G A A T G A C 3 ' amplify a 399 bp from the endogenous JL-12 allele;  NeoS:  5' A C G A G G C A G C G C G G C T A T C 3 '  and  NeoA:  5 ' C G G C T T C C A T C C C A G T A C G 3 ' amplify a 260 bp product from the neomycin insert. To verify (in addition to P C R genotyping of tail D N A ) that functional IL-12 was not being produced by the IL-12'' and Tsk/+  IL-12'' mice, bone-marrow-derived  macrophages from these mice were stimulated with lipopolysaccharide. As determined by capture E L I S A , IL-12 p40"'' and Tsk/+ IL-12 p40''mice produced negligible amounts of IL-12, whereas control and Tsk/+ mice generated large quantities of this cytokine upon in vitro LPS stimulation (data not shown).  3.4.4 Generation of Tsk/+ mice deficient in IFN-y gene Tsk/+ and IFN-y''mice were bred to generate Tsk/+ IFN-y"' mice. Male Tsk/+ IFN-y " mice were mated with female IFN-y'' mice to obtain mice homozygous for the +/  IFN-y'' mutation. The IFN-y'' genotype was confirmed by P C R amplification of targeted alleles from genomic D N A according to a protocol provided by the Jackson Laboratories.  •;31  The  oligonucleotide  primers  are  as  follows:  oIMR126:  and  oIMR127:  5'AGAAGTAAGTGGAAGGGCCCAGAAA3'  5' A G G G A A A C T G G G A G A G G A G A A A T A T 3 ' amplify a 220 bp product from the endogeneous IFN-y allele; oIMR128: 5 ' T C A G C G C A G G G G C G C C C G G T T C T T T 3 '  and  OIMR129: 5' A T C G A C A A G A C C G G C T T C C A T C C G A 3 ' amplify a 375 bp product from the targeted IFN-y allele.  3.4.5  Generation of Tsk/+ mice deficient in Ter8gene Tsk/+ and Ter8'' mice were bred to generate Tsk/+ TcrS ~mice. +/  Male Tsk/+  Tcrfr'' mice were mated with female Tcr8'~ mice to obtain mice homozygous for the Tcr8'~ mutation. The Tcr8'~ genotype was confirmed by P C R amplification of targeted alleles from genomic D N A according to a protocol provided by the Jackson Laboratories. The  oligonucleotide  primers  CTTGGGTGGAGAGGCTATTC3' amplify  a  280  bp  product  are  3.5  follows:  oIMR013:  and oIMR014: A G G T G A G A T G A C A G G A G A T C 3 ' from  the  5 ' C AA A T G T T G C T T G T C T G G T G 3 '  5'GTCAGTCGAGTGCACAGTTT3'  as  neomycin and  insert;  oIMR015: 0IMROI6:  amplify a 200 bp product from the Tcr5 gene.  Tissue Histology For histological analysis, ~1 cm skin fragments, which included subcutaneous 2  tissue and deep fascia, were removed from the shoulder (interscapular) region of the dorsal midline of 2-month old female animals as previously described. Briefly, samples were fixed in 10% buffered formalin for 24h before processing for light microscopy.  32  Longitudinal strips, 2-3 mm wide were cut, dehydrated by successive changes in ethyl alcohol and xylene and embedded in paraffin according to routine histological methods. Sections were cut perpendicular to the skin surface and stained with Masson's trichrome (collagen bundles stain blue-green). Measurement of dermal collagen thickness was assessed in two ways. First, using a calibrated ocular micrometer, the dermal collagen thickness, represented by the blue-green-stained region between the epidermis and adipose tissue layer on Masson-treated sections, was measured at three different sites on each of three different non-contiguous skin sections per tissue sample per mouse. Alternatively, alcian blue/picrosirius red stained sections (picrosirius red will specifically stain collagen) were analyzed using the Bioview Image Analysis System (InfraScan Inc., Richmond, B C ) coupled to a Nikon photomicroscope. Tissue collagen content was expressed as the percentage of a tissue area stained by picrosirius red. For lung fixation, tracheae were intubated and the lungs inflated with 10% phosphate-buffered formalin at 10 cm of pressure prior to processing for light microscopy.  Tissue sections were stained with hematoxylin/eosin and examined either  by conventional light microscopy or using the Bioview Image Analysis system to determine the average interalveolar distances (mean linear intercept, Lm). The total tissue area analyzed was 25 mm per animal using this imaging method. A l l tissue 2  sections were coded and read by two independent observers. Differences between groups were analyzed using an unpaired, two-tailed Student's t-test. Serum samples were extracted from animals following the cardiac puncture protocol. Collected blood samples were centrifuged at 10,000 rpm for 5 min and the serum was removed from the upper layer and stored at -20°C until assayed for cytokines  "33  by ELISA. A number of other tissues included for histological analysis, including heart, kidney, liver, thymus and spleen were surgically removed and fixed in 10% buffered formalin before further processing for light microscopy analysis. 3.6  Staining and flow cytometry The standard protocol used for immunofluorescent staining of cell surface  antigens is described as follows. For the analysis of cell surface expression of C D 4 and C D 8 receptors on unfractionated and purified populations of splenic populations, single cells were harvested either from freshly extracted spleens or from purified cells in culture and washed twice with 1 mL ice-cold F A C S buffer (PBS containing 1% fetal calf serum). Cell pellets were resuspended in F A C S buffer at a concentration of 5 x 10 cells/mL and 6  200 u,L of this (1 x 10 cells) was transferred to the appropriate tubes and incubated at 6  4°C for l h with rat anti-mouse CD4 (L3T4) mAb conjugated to phycoerythrin (PE) and rat anti-mouse CD8 (Ly-2) mAb conjugated to fluorescein isothiocyanate (FITC) at 1 u,g/10 cells (Pharmingen). Cells were then washed twice with 500 uJL ice-cold F A C S 6  buffer and resuspended in 500 \\L volume for immunofluorescence analysis on a FACScan flow cytometer equipped with Cellquest software (Becton Dickinson, Mountain View, C A ) . The forward and side scatter gates were set to exclude any dead cells from the analysis; 10,000 events within this gate were acquired per sample. Cell  surface  immunofluorescence.  IL-4 receptor  expression  was  determined  by indirect  Cultured embryonic and dermal fibroblast cell lines were  harvested at confluency by brief trypsinization for 1 min and were then resuspended at 10 cells per sample in F A C S buffer. Individual samples were incubated at 4°C for l h 6  34  with rat anti-mouse IL-4R a-chain-specific mAb (0.5u.g/10 cells) (Genzyme, 6  Cambridge, M A ) . Samples were then washed three times with cold F A C S buffer and then incubated at 4°C for l h with FITC-conjugated goat anti-rat Ig (1:10000 dilution in F A C S buffer) secondary antibody.  Unbound secondary antibody was removed by  triplicate washes with cold F A C S buffer. The cell pellet was resuspended in 500 u L for immunofluorescence analysis on a FACScan flow cytometer equipped with Cellquest software (Becton Dickinson, Mountain View, CA). The forward and side scatter gates were set to exclude any dead cells from the analysis; 10,000 events within this gate were acquired per sample.  3.7 Immunoassays 3.7.1  Stimulation of CD4+ T cells Purified CD4+ T cells were restimulated in 24-well tissue culture plates (Nunc,  Naperville, IL) that had been precoated with anti-CD3 at 0.5 or 1.0 jxg/mL, at 5 x 10  5  cells/well in 1 mL R P M I medium with 10% FCS supplemented with 3% mouse IL-2conditioned medium. Culture supernatants were harvested after 24h and stored at -20°C until assayed for IL-4 and IFN-y concentrations by E L I S A . Data represent the mean of triplicate cultures of 3 pooled spleens for each experimental group.  3.7.2  Cytokine determination by ELISA The cytokine levels of IL-4 were assessed in serum, in conditioned media from  primary embryonic and dermal fibroblast cell lines from C57B1/6 control and Tsk/+ mice, and in purified CD4+ T cell culture supernatants. In brief, 96-well plates (Nunc,  35  Roskilde, Denmark) were coated with 2 u,g/mL primary rat anti-mouse IL-4 (11B11) capture mAb (Pharmingen) diluted in 0.1 M N a H P 0 overnight at 4°C. Plates were 2  4  washed three times with PBS containing 0.05% Tween-20 (Fisher Scientific, Fair Lawn, NJ) and blocked with PBS containing 10% FCS for 2h at 37°C. Culture supernatants were incubated overnight at 4°C, washed again, and wells were then incubated with 2 Ug/mL biotin-conjugated rat anti-mouse IL-4 detecting mAb (Pharmingen). Following a l h incubation at 37°C , plates were washed six times and then a horseradish peroxidasestreptavidin conjugate (Pharmingen), diluted at 1:1000 in blocking/Tween-20 buffer, was added and incubated for 30 min at room temperature. Plates were then washed eight times and 3,3',5,5'-tetramethylbenzidine (TMB) substrate (Sigma, St. Louis, M O ) was added.  After developing, the absorbance was determined at 405 and 490 nm and  concentrations extrapolated from the recombinant standard curve generated from 15-2000 pg/mL.  The paired capture and biotinylated antibodies used were rat anti-mouse IL-4  (11B11) and rat anti-mouse EL-4 (BVD6-24G2) (Pharmingen). Similarly, the cytokine levels of IFN-y were measured from the CD4+ T cell culture supernatants following the protocol described above. The paired capture and biotinylated antibodies used were rat anti-mouse IFN-y (R4-6A2) and rat anti-mouse IFN-y (XMG1.2) (Pharmingen).  The concentration of IFN-y was determined by  comparison to standard curves generated with recombinant cytokines from 15-2000 pg/mL.  3.7.3  Intracellular cytokine staining  •36  Purified CD4+ lymphocytes (obtained as described above) which had been primed for 2 d with anti-CD3 in the presence of 3% EL-2 and then allowed to rest for 4 d, were stimulated at 1 x 10 cells/mL for5h at 37°C and 5 % C 0 with 1 ug/mL plate-bound 6  2  anti-CD3 (145-2C11, Pharmingen) and 1 ug/mL anti-CD28 (37.51, Pharmingen) in the presence of 2 u M Brefeldin A (Pharmingen). Immediately after the 5h stimulation, cells were collected and processed  according to the protocol described in the  Cytofix/Cytoperm Plus K i t (Pharmingen).  Staining was performed using standard  procedures with phycoerythrin-conjugated (PE) rat anti-mouse IL-4 (11B11, Pharmingen) and FITC-conjugated rat anti-mouse IFN-y (XMG1.2, Pharmingen), which were added at a concentration of 0.5 u.g/10 cells. After a l h incubation, cells were washed twice with 6  staining buffer (PBS + 2% FCS) and finally resuspended in 300 uJL of staining buffer prior to F A C S analysis. To ensure the specificity of the staining procedure, each antibody was preincubated with a molar excess of unlabeled mAb and used to set quadrant gates for negative control cytokine staining. Samples were analyzed on a FACScan flow cytometer equipped with Cellquest software (Becton Dickinson). The forward and side scatter gates were set to exclude any dead cells from the analysis; 10,000 events within this gate were acquired per sample.  3.8  Statistical analysis Differences between experimental groups were analyzed using the standard  formula for the calculation of unpaired, two-tailed Student's t-test. Differences between the groups were considered to be statistically significant when the P-value was below 0.05.  37  CHAPTER 4 Regulation of dermal fibrosis by IL-4 in Tsk/+ mice  4.1  Introduction  IL-4 - Structure and cellular sources Interleukin (IL)-4 is a pleiotropic and multifunctional cytokine produced by a subset of CD4+ activated T cells designated Th2 cells (Gause et al., 1999; Romagnani, 1999), and by mast cells and basophils (Haas et al., 1999; Mekori and Metcalfe, 1999) in response to receptor-mediated activation events.  In addition, eosinophils (Kasakura,  1998; Romagnani, 1999) as well as a specialized subset of T cells that express NK1.1+ and appear to be specific for C D - I (Chen and Paul, 1997; Poynter et al., 1997; Yoshimoto et al., 1995; Yoshimoto and Paul, 1994), have also been reported to produce JL-4. Recently, y5 T cells have been demonstrated to produce IL-4 as mice lacking these cells fail to develop IL-4-dependent airway hypersensitivity upon immunization with ovalbumin in alum (Barcena et al., 1991; Ferrick et al., 1995; Gorczynski et al., 1996; Yamashita et al., 1999; Zuany-Amorim et al., 1998). The IL-4 gene is located within a cytokine gene cluster on murine chromosome 11 and is tightly linked to a number of other Th2-associated cytokines including IL-3, IL-5, IL-13 and G M - C S F .  IL-4 - immune functions IL-4 plays a central role in regulating the differentiation of antigen-stimulated naive T cells and the outcome of an immune response by facilitating type 2 Th cell  •38  differentiation and the production of IL-4 and a series of other cytokines including IL-5, IL-10 and IL-13 (Hsieh et al., 1992; Seder et al., 1992). It powerfully suppresses the differentiation of IFN-y-producing CD4+ T h l cells, exhibiting potent negative crossregulatory effects on T h l development and thereby favoring humoral immune responses. A second function of major physiologic importance is the ability of IL-4 to regulate specificity of immunoglobulin class-switching. IL-4 induces class-switching to IgE and IgG4 (in human B cells) (Gascan et al., 1991) and to IgE and I g G l (in mouse B cells) (Coffman et al., 1986; Vitetta et al., 1985). Indeed, in IL-4 (Kuhn et al., 1991) and IL-4 receptor (Noben-Trauth et al., 1997) knockout mice as well as in mice that lack the principal substrate for the IL-4 receptor, signal transducer and activator (Stat)6 (Kaplan et al., 1996; Shimoda et al., 1996), IgE production is diminished by a factor of 100-fold or more. IL-4 receptor knockout mice (Noben-Trauth et al., 1997) and Stat-6 knockout mice (Kaplan et al., 1996) are also deficient in the development of IL-4-producing T cells in mice infected with the helminthic parasite Nippostrongylus  brasiliensis.  These  physiologic functions of IL-4 give it a preeminent role in the regulation of protective immune responses to helminths and other extracellular parasites. In addition to its direct involvement in regulating immune responses, IL-4 also exerts a wide variety of effects on hemopoietic and nonhemopoietic cells. It enhances the expression of CD23 (Defrance et al., 1987) and class II M H C molecules (Noelle et al., 1984) in B cells and upregulates surface expression of the receptor complex for IL-4 (Ohara and Paul, 1988) and in association with lipopolysaccharide, allows B cells to express T h y l (Snapper et al., 1988). It also acts as a comitogen for B cell growth (Howard et al., 1982). Although not a growth factor by itself for resting lymphocytes, it  39  can substantially prolong the lives of T and B lymphocytes in culture (Hu-Li et al., 1987) and can prevent apoptosis by factor-dependent myeloid lines that express JJL-4 receptors (Dancescu et al., 1992; Zamorano et al., 1996). IL-4 also has an important role in tissue adhesion and inflammation. It acts with TNF to induce expression of V C A M - 1 (vascular cell adhesion molecule 1) on vascular endothelial cells (Thornhill et al., 1991) and downregulates the expression of E-selectin (Bennett et al., 1997) - thereby changing the adhesive characteristics of endothelial cells. The altered adhesive characteristics of endothelial cells facilitate tissue infiltration by allergic inflammatory cells, such as eosinophils. Receptors for IL-4 are expressed on hemopoietic cells and a range of nonhemopoietic cells including epithelium, endothelium, muscle, liver and fibroblasts (Lowenthal et al., 1988; Ohara and Paul, 1987). On hemopoietic cells, the receptor complex for IL-4 is composed of a 140 kDa high-affinity ligand-binding chain known as the IL-4-receptor a chain (IL-4Ra) and the so-called common y chain (yC) that is shared by other cytokines including IL-2, IL-7, EL-9 and EL-15 (Leonard et al., 1994; Russell et al., 1993). Although homodimerized IL-4Ra can generate biological signals within the cell (Fujiwara et al., 1997; L a i et al., 1996), physiologic signaling requires heterodimerization of the IL-4Roc and the accessory chain (yC). Neither JJL-4Ra nor yC, both belonging to the hematopoietin receptor superfamily, contains intrinsic kinase activities. However upon stimulation by IL-4, tyrosine kinases are activated, resulting in the phosphorylation of cellular substrates and the initiation of signaling cascades. Three members of the Janus kinase (Jak) family - Jak-1, Jak-2 and Jak-3- have been shown to be activated and to associate with the components of the receptor complex for IL-4 (Ihle,  40  1995). Jak-1 has been proposed to bind IL-4Ra whereas Jak-3 associates with the yC chain (Miyazaki et al., 1994; Russell et al., 1994). In certain cell lines, Jak-2 has been shown to associate with IL-4Rcc (Murata et al., 1996). IL-4 engagement of the IL-4Ra chain results in tyrosine phosphorylation of Jak-1 and Jak-3. Activation of IL-4Rassociated kinases leads to the tyrosine phosphorylation of the I L - 4 R a chain itself (Smerzbertling and Duschl, 1995) at five conserved tyrosine residues - Tyr497, Tyr575, Tyr603, Tyr631 and Tyr713. After tyrosine phosphorylation, these conserved tyrosine residues become potential docking sites for downstream signaling molecules containing Src-homology-domain 2 (SH2) or phosphotyrosine-binding (PTB) domains, as well as attracting the Stat6 complex (Nakanishi et al., 1996). Activation and homodimerization of the Stat6 complex results in its translocation to the nucleus where it can bind TL-4responsive elements.  Downstream mitogenic effects upon IL-4 signaling have been  shown to involve activation of 4PS (IRS-2) (Wang et al., 1992), while IL-4-specific gene induction involves Stat6 (Nakanishi et al., 1996). Amongst its various activities, IL-4 is essential for the differentiation and commitment of CD4+ precursor T lymphocytes towards the Th2 lineage. The effects of IL-4 in inducing Th2 development are dominant over T h l polarizing cytokines (Hsieh et al., 1993; Seder and Paul, 1994), such that i f IL-4 levels reach a certain threshold at the beginning of an immune response, Th2 cells will differentiate, leading to increased IL-4 production. This may explain why chronic stimulation, particularly in the absence of inflammatory signals delivered during the innate immune response, as well as the magnitude of an immune response, may drive Th2 responses (Abbas et al., 1996). Following priming with IL-4, Th2 populations become progressively more stable to  reversal by Thl-inducing cytokines and IL-4 production becomes independent of extrinsic IL-4 (Gause et al., 1999). Loss of DL-12RP2 expression by Th2 cells may also explain early Th2 stability (Shevach et al., 1999; Szabo et al., 1997). Recently, IL-4independence for Th2 cytokine production by fully differentiated T helper cells has been reported (Jankovic et al., 2000; Noben-Trauth et al., 1997). IL-4 - Profibrotic properties In addition to effects on hemopoietic cells, IL-4 exerts regulatory effects on collagen synthesis by fibroblasts. Fibroblasts possess IL-4 receptors (Sempowski et al., 1994) and this cytokine has been shown capable of stimulating extracellular matrix protein, type I and III collagen as well as fibronectin biosynthesis in these cells (Gillery et al., 1992; Ishibashi et al., 1995; Lee et al., 1996; Nakazato et a l , 1996). Elevation of steady-sate levels of types I and III procollagen and fibronectin mRNAs in EL-4-treated cells suggests that this cytokine regulates extracellular matrix biogenesis by pretranslational mechanisms. IL-4, which has been detected in the sera of patients with scleroderma (Hasegawa et al., 1997), is also capable of stimulating fibroblast collagen gene expression (Fertin et al., 1991; Gillery et al., 1992; Sempowski et al., 1994), and has been shown to have a mitogenic effect on these cells (Fertin et al., 1991; Sempowski et al., 1994). Similar stimulatory effects of IL-4 on collagen synthesis have been observed in fibroblasts obtained from patients with scleroderma as well as from unaffected individuals (Fertin et al., 1991).  In contrast, IFN-y, a cytokine associated with  commitment of CD4+ T cells towards the T h l lineage (Abbas et al., 1996) and which is also produced by this subset, inhibits fibroblast collagen synthesis (Mallat et al., 1995; Varga et al., 1990). Interestingly, a role for another Th2-associated cytokine in the  •42  regulation of fibrotic processes has recently been described. As IL-13 shares many functional activities with IL-4 (Chomarat and Banchereau, 1998), and uses similar receptor subunits for signaling (Murata et al., 1998), it is possible that many of the effects mediated by EL-4 also involve the actions of IL-13. The capacity of IL-4 to exert both profibrotic effects on fibroblast collagen synthesis as well as immune influences in directing CD4+ T cells towards Th2 lineage development prompted the investigation of whether the fibrotic process occurring in Tsk/+ mice was mediated by the effects of IL-4 or perhaps, Th2 cell-derived IL-4. Consistent with this hypothesis, increased levels of IL-4 have been detected in the skin and sera of patients with scleroderma, suggesting a potential role for this cytokine in the pathology of this fibrotic disorder.  >43  4.2  Results  4.2.1  IL-4 mediated effects on collagen synthesis by dermal fibroblasts  IL-4R expression To determine the potential role of IL-4 in the dermal pathology of Tsk/+ mice, the expression of IL-4R on primary embryonic and dermal fibroblast cell lines were assessed. Immunofluorescent staining with murine IL-4Rcc antibody demonstrated modestly elevated levels on both Tsk/+ primary embryonic and dermal fibroblasts as compared to control fibroblasts as illustrated by Fig. 4.1.  FIG. 4 . 1 .  Control embryonic fibroblast  7 W + embryonic fibroblast  Control dermal fibroblast  Tsk/+ dermal fibroblast  I L - 4 R a expression on primary embryonic and dermal fibroblast cell lines. Immunofluorescence  analysis of primary embryonic fibroblasts of control and Tsk/+ mouse origin and of control and Tsk/+ dermal fibroblasts. Cells were stained by indirect immunofluorescence with a rat anti-mouse I L - 4 R a mAb, followed by FITCconjugated goat anti-rat IgG (solid curves). Staining with the secondary reagent alone (shaded curved area) indicates background fluorescence. Ten thousand live cells were analyzed per sample.  44  The mean fluoresecence intensities (MFI) of primary control and Tsk/+ embryonic fibroblasts were 31 and 55 respectively, with background fluorescence of 18 and 28, suggesting an approximate two-fold increase in IL-4Ra expression level. Similarly, the expression of IL-4Ra on Tsk/+ dermal fibroblasts was two-fold higher compared with control dermal fibroblasts with M F I values of 87 and 54 with background M F I values of 31 and 23 respectively. Thus, Tsk-dthved fibroblasts express modestly increased cell surface IL-4Ra chains. IL-4-mediated collagen production The function of the IL-4 receptors on the primary embryonic cells and dermal fibroblast cell lines was then analyzed by measuring the levels of type I collagen secreted by these cells following IL-4 stimulation. In primary embryonic control and Tsk/+ fibroblasts, type I collagen in the supernatants, both before and after IL-4 stimulation was undetectable by E L I S A (data not shown). The dermal fibroblast cells lines, on the other hand, displayed readily detectable basal levels of type I collagen secretion in the culture supernatants. Under basal conditions, Tsk/+ dermal fibroblasts secreted a two-fold increase in collagen production (1830 ± 205 u,g/mL) compared with control dermal fibroblasts (960 ± 106 |Xg/mL). Following IL-4 stimulation at 10 Ug/mL, collagen synthesis in both control and Tsk/+ fibroblast cultures was elevated at a similar intensity beyond two-fold to 2332 ± 175 u,g/mL and 4100 ± 220 u.g/mL respectively. This increase was inhibited by the simultaneous presence of the neutralizing anti-IL-4 A b (11B11) in the culture, indicative of an IL-4-specific response as shown (Fig. 4.2).  5000  CNT  FIG. 4.2.  IL-4 IL-4+11B11  Collagen production by dermal fibroblasts upon IL-4 stimulation. Treatment of dermal fibroblast  cell lines with IL-4 increase type I collagen production by both control and 7W+ cells. Secretion of collagen by cells was measured using a direct ELISA assay following incubation with 10 p-g/mL IL-4 or 10 |xg/mL IL-4 together with 10 P-g/mL anti-IL-4 (11B11) antibody for 72 h. Vertical error bars indicate 1 SEM. The response to IL-4 was significant; p<0.01.  There was no significant difference in either cell proliferation or viability at the end of the stimulation period as compared with untreated controls (data not shown). Thus, Tsk/+ dermal fibroblasts were shown basally to secrete larger amounts of collagen and were capable of responding to IL-4 stimulation with increased secretion of type I collagen compared with controls. 4.2.2  Anti-IL-4 mAb treatment prevented development of dermal fibrosis in Tsk/+  mice To investigate the possible role of IL-4 in the Tsk/+ phenotype in vivo, young Tsk/+ mice were treated with anti-IL-4 (11B11) mAb and assessed for the development  .46  of dermal fibrosis. Treatments consisted of weekly i.p. injections of either 11B11 at 0.75 mg per injection, or an isotype-matched control Ab (3B2) for a period of 8 weeks. Effect on dermal collagen deposition in anti-IL-4 treated Tsk/+ mice Histological analyses of dermal sections reveals several distinct layers: the uppermost epidermis followed by the blue-green-staining dermal collagen layer, the adipose fat layer and the underlying muscle area. Generally, Tsk/+ mice display an approximately two-fold increase in the dermal collagen histology over normal skin. Anti-IL-4 treatment of Tsk/+ mice resulted in a marked reduction in dermal collagen thickness as compared to untreated Tsk/+ mice as illustrated in Fig. 4.3.  Control  F I G . 43.  7W+  treated with anti-IL-4 mAb  Dermal histology of anti-IL-4-treated Tsk/+ mice.  accumulation in the superficial dermis of Tsk/+ mice.  Anti-IL-4 treatment prevents  collagen  Representative photomicrographs (magnification 40X) of  Masson-stained skin and dermis obtained from the dorsal midline region of an untreated Tsk/+ mouse, a control littermate, an isotype control antibody-treated 7W+  mouse, an anti-IL-4 (11B11) antibody-treated Tsk/+ mouse, as  indicated. The anti-IL-4 m A b -mediated reduction in Tsk/+ dermal collagen content (stained blue-green) is associated with a corresponding increase in the thickness of the adipose layer.  47  Dermal collagen pathology of anti-IL-4 treated Tsk/+ mice was similar to that of the control littermates. No changes were detectable following treatment of Tsk/+ mice with the control 3B2 Ab, as dermal collagen thickness in these animals was identical to that of untreated Tsk/+ mice. As dermal collagen content varies somewhat from site to site, histological measurements of collagen thickness were confined to three different regions of the dorsal midline (interscapular, midback, proximal tail) as depicted in Fig. 4.4. I  0.6-  S c  0.5H  Shoulder  .a  0.4  &  0.3H  8  0.2-  6  0.1 -  <u  Q  _  Midback  Tail  T  0 Skin Region 50Shoulder  Midback  Tail  40 H  i f  30  E .£ a > a§  20H  a  ioH  M  Skin Region FIG. 4.4.  Dermal collagen thickness of anti-IL-4 treated Tsk/+ mice.  Increased deposition of  collagen in the superficial dermis of Tsk/+ mice is prevented by anti-IL-4 Ab administration. (A) Shows thickness measurements, using an ocular micrometer, from Masson-stained sections of subcutaneous tissue obtained from three different regions of two month old 7W+ mice. (B) Dermal collagen content quantitation of alcian blue/picrosirius redstained subcutaneous tissue sections using the Bioview Image Analysis System. Control littermate (n=6) mice (open bars), untreated Tsk/+ (n=5) mice (black bars), isotype-matched control Ab-treated (n=5) Tsk/+ mice (hatched bars) and 11B11 anti-IL-4 Ab-treated 7W+ (n=6) mice (gray bars). *p<0.05. Error bars represent the SD.  •. 48  When compared to control Ab-treated Tsk/+ mice (n=5; 0.364 ±0.032 mm, 0.353 ± 0.021 mm, 0.314 ± 0.030 mm) or untreated Tsk/+ mice (n=5; 0.382 ± 0.037 mm, 0.402 ± 0.083 mm, 0.381 ± 0.030 mm), the anti-IL-4-treated Tsk/+ exhibited a marked decrease in the dermal collagen thickness in all three regions (n=6; 0.188 ± 0.022 mm, 0.175 ± 0.015 mm, 0.166 ± 0.015 mm) (p< 0.05, unpaired two-tailed Student's t-test). Indeed, Tsk/+ mice treated with 11B11 demonstrated collagen thickness levels similar to those of their normal littermates (n=5; 0.209 ± 0.006 mm, 0.203 ± 0.010 mm, 0.204 ± 0.016 mm) (p< 0.05) as illustrated in Fig. 4.4A. Quantitation of the relative amounts of subcutaneous collagen per field of view using the Bioview Image Analysis system closely paralleled the morphometric results (Fig. 4.4B), demonstrating normalization of subcutaneous collagen content in anti-IL-4 Ab-treated Tsk/+ mice.  In summary, anti-IL-4 Ab  administration prevented the progression of dermal fibrosis in Tsk/+ mice. Effect on development of pulmonary defects and production of anti-topoisomerase I autoantibodies in anti-IL-4 treated Tsk/+ mice The effect of anti-IL-4 Ab administration on Tsk/+ associated pulmonary changes in lung architecture was examined by comparison of histological sections of inflated lung samples. Untreated, anti-IL-4 (1 IB 11) -treated, and control Ab-treated Tsk/+ mice all displayed markedly dilated alveolar spaces, with fewer alveolar walls compared with control mice as shown by Fig. 4.5. This observation was confirmed by morphometric assessment of the average inter-alveolar distance (mean linear intercept, Lm), which produced values of L m = 46.96 ± 1.45 ujm for untreated 7 W + , L m = 48.94 ± 0.80 u,m for control 3B2 Ab-treated 7 W + , and L m = 46.62 ± 2.51 u.m for HBll-treated Tsk/+ mice. In comparison, the normal control littermates demonstrated a L m = 31.90 ± 1.66 \im  49  (p<0.05, unpaired two-tailed Student's t-test). Thus, the 7W+-associated abnormality in lung architecture was unaltered by anti-IL-4 Ab administration.  Control Ab-treated Tsk/+  FIG. 4.5.  Anti-IL-4 treated Tsk/+  Pulmonary pathology of anti-IL-4 treated Tsk/mice.  Anti-IL-4 A b treatment fails to inhibit  development of abnormal lung architecture in Tsk./+ mice. Representative photomicrographs (magnification 40X) of Masson-stained sections of inflated perfused peripheral lung obtained from an untreated Tsk/+ mouse, isotype-matched control Ab-treated Tsk/+ mouse, control littermate and anti-IL-4 Ab-treated 7W+ mouse, as indicated.  Anti-topoisomerase I A b was not detectable in any of the 2-month old animal groups using a commercially available E L I S A system (Advanced Biological Products SCL-100, Brampton, Ontario) (data not shown), a finding consistent with previous reports that anti-nuclear Ab were not present in young Tsk/+ mice. Systemic IL-4 production As anti-IL-4 A b treatment inhibited the progression of dermal fibrosis in Tsk/+ mice, these mice were examined for evidence of IL-4 production. To determine whether  50  Tsk/+ fibroblasts produced either excessive or ectopic IL-4, the protein levels of IL-4 were measured by E L I S A in serum as well as in conditioned media from embryonic and dermal fibroblast cell lines derived from Tsk/+ and control mice. IL-4 protein was below detectable levels in serum as well as in the fibroblast conditioned media samples of both control and Tsk/+ mice (data not shown). Crosslinking of the CD3 chains of the T C R complex induces cell proliferation as well as cytokine production, including IL-4. Thus, the production of IL-4 from purified control and Tsk/+ CD4+ T cells stimulated with immobilized anti-CD3 was evaluated. Purified CD4+ T cells from Tsk/+ mice produced significantly greater amounts of IL-4 compared with control littermates as measured by ELISA (Fig. 4.6), suggesting that increased IL-4 production was an intrinsic property of 7 W + CD4+ T cells.  1250-T  1  T  1000-  Control  FIG. 4.6.  7W+  IL-4 production from 7W+ CD4+ T cells following anti-CD3 stimulation. Pooled CD4+ T cells  isolated from the spleens of control (n=3) and Tsk/+ (n=3) mice were stimulated with plate-bound anti-CD3 at 3 x 10  6  cells/mL in the presence of 3% IL-2 in primary culture for 2 days. Following a 3-day period in the absence of antiCD3, cells were restimulated with anti-CD3 at 5 x 10 cells/mL at the concentration indicated. Culture supernatants 5  were harvested after 24h and assayed for IL-4 by ELISA. Data represent the mean of triplicate cultures.  4.3  Discussion Pathological fibrosis, which characterizes human scleroderma and its variants, has  been correlated with the elevated expression of a number of different cytokines including IL-4. This cytokine is of particular interest owing to its ability to regulate collagen and extracellular matrix production by fibroblasts (Fertin et al., 1991; Gillery et al., 1992; Makhluf et al., 1996; Postlethwaite et al., 1992; Sempowski et al., 1994; Wegrowski et al., 1995). Furthermore, increased levels of IL-4 have been detected in the skin and sera of patients with scleroderma. These results implicate a direct role for Th2-derived EL-4 in causing skin fibrosis in Tsk/+ mice. Expression of IL-4R by Tsk/+ fibroblasts, and the response of these cells to this cytokine, suggested that IL-4 might be capable of directly mediating a pro-fibrotic effect in these mice. As fibroblasts from Tsk/+ mice have been described to produced increased levels of collagen when compared with control cells (Jimenez et al., 1986), an additional increase brought about by IL-4 might be highly significant with respect to the Tsk/+ dermal pathology, which is characterized by a progressive accumulation of collagen. The significance of the modestly increased level of DL-4R expressed on Tsk/+ embryonic and dermal fibroblasts, as compared to control cells, is unknown. IL-4 is an essential factor involved during the differentiation of CD4+ precursor T lymphocytes towards the Th2 lineage (Romagnani, 1999). Indeed, previous studies have demonstrated that blockade of IL-4 inhibits the differentiation of precursor CD4+ T cells into Th2 cells (Abbas et al., 1996; Cheever et al., 1995). Thus, the fibrotic manifestations of Tsk/+ mice may be mediated by this particular subset. This is consistent with the correlation of Th2 cell activity and the occurrence of fibrosis in the immune response  .52  against certain infectious agents (Cheever et al., 1994). Similarly, the administration of anti-IL-4 Ab to young Tsk/+ mice prevented the development of dermal fibrosis. AntiIL-4 Ab treatment of Tsk/+ mice may thus act by shifting a predominantly Th2dominated response towards a more innocuous phenotype mediated by T h l cells. Recent understanding of the role of T cell-derived cytokines during immune responses and the regulation of their production has thus led to the concept of "immune deviation" as a potential therapeutic modality for various infections as well as autoimmune disorders (Finkelman, 1995; Rocken et al., 1996).  This involves selectively modifying the  differentiation and cytokine expression patterns of effector T cells that are associated with specific diseases via the use of specific cytokines or cytokine-blocking agents. According to this model, treatment with anti-IL-4 Ab would result in a deficiency of Th2 cells and/or Th2-derived cytokines that may play a pivotal role in regulating dermal fibrosis in Tsk/+ mice. Anti-IL-4 A b treatment failed to alter the development of pulmonary abnormalities in Tsk/+ mice. In keeping with this result, pulmonary pathology remained unchanged in Tsk/+ CD4~'~ mice (Wallace et al., 1994). The dermal and pulmonary components of the Tsk/+ phenotype can therefore be dissociated in vivo. Tsk/+ mice contain a tandem duplication of the Fbn-1 gene (Siracusa et al., 1996), a major component of elastin-associated microfibrils, and displays an accumulation of abnormal fibrils. The abnormal Fbn-1 gene product is likely responsible for the alveolar wall abnormalities exhibited by Tsk/+ mice as Fbn-1 plays a critical role in elastin microassembly during lung development (Reinhardt et al., 1995).  Thus, while the  immune system appears critical for the expression of the dermal fibrotic aspect of the  53  Tsk/+ phenotype, the Fbn-1 gene mutation is probably responsible for the developmental pulmonary abnormalities, the loss of cutaneous elasticity and the embryonic lethality of Tsk/Tsk mice. It seems unlikely that IL-4 alone is capable of generating a Tsk-like phenotype as various lines of IL-4 overexpressing transgenic mice have not been reported to develop a Tsk-like phenotype.  Instead, mice overexpressing IL-4 developed immune complex  glomerulonephritis, autoantibodies, and immune-mediated hemolytic anemia (Erb et al., 1997; Tepper et al., 1990). No evidence of a 7W+-like phenotype was described. Thus, even when overexpressed, IL-4 appears unable to induce dermal fibrosis, suggesting that the Tsk/+ mutation must be present for the pro-fibrotic effects of this cytokine to become apparent. The importance of IL-4 in the Tsk/+ disease process was further confirmed by demonstrating the consequences of interfering with Th2 development through disruption of the IL-4 or the IL-4 receptor activated transcription factor, Stat6, gene on dermal fibrosis (Ong et al., 1999).  Ablation of either of these two genes alleviated the  development of skin fibrosis in Tsk/+ mice, consistent with the hypothesis that Th2 cells are involved in this process.  Heterozygosity of the IL-4 or Stat6 null mutation also  resulted in a significant reduction in the development of dermal fibrosis in Tsk/+ mice. Deficiency of either IL-4 or Stat6 did not affect the production of IFN-Y by polarized CD4+ T h l cells yet, the production of IL-4 by polarized Th2 cells from either IL-4^' or Tsk/+ Stat6' mice was completely abrogated. The production of IL-4 by polarize Th2 A  cells from both heterozygous animals was also significantly reduced relative to the wildtype controls. Thus, a reduction of effective IL-4 levels or signaling mediated through  54  the IL-4 receptor is sufficient to skew the effects of the local milieu during T helper cell commitment in a manner that favors the development of T h l over Th2 cells. Interestingly the development of lung emphysematous-like alterations in the Tsk/+ mice lacking either IL-4 or Stat6 genes was unaffected, supporting further the notion that the pulmonary component is not dependent on CD4+ T cells or a functional immune system. Interestingly, a role for another Th2-associated cytokine in the regulation of the fibrotic process has recently been described. IL-13 shares many functional activities with IL-4 as well as using similar receptor subunits for signaling, thus, it is possible that many of the effects mediated by IL-4 may also involve the actions of IL-13.  IL-13 is a  pleiotropic regulatory cytokine that shares many of the characteristics with IL-4 and are both predominantly produced by Th2 cells (Chomarat and Banchereau, 1998; Murata et al., 1998). Both cytokines are involved in growth promoting effects on B cells and induction of IgE and IgG4 synthesis. Both cytokines exert anti-inflammatory activities by downregulating proinflammatory cytokines and chemokines. IL-13, like IL-4, may, through its capacity to downregulate cytokines that direct T h l development such as EL-12 and IFN-y production, favoring the generation of Th2 responses. They are also important in upregulating M H C class II and CD23 expression on monocytes, enhances the proliferative responses to anti-IgM and anti-CD40 antibodies, induces anti-CD40dependent IgE class switch and induces IgG and I g M synthesis in B cells. With the recent development of IL-13 transgenic and knockout mice (Bancroft et al., 1998; Emson et al., 1998), as well as soluble IL-13 antagonists (Carballido et al., 1995), the unique functional activities of IL-13 are being delineated and suggests that IL-13 possesses many important functional activities that are distinct from EL-4. For example, unlike EL-4, EL-  ,55  13 does not directly act on human T cells and does not have any effect on growth and differentiation of T cells (Chomarat and Banchereau, 1998; Murata et al., 1998). This is consistent with the notion that T cells do not express IL-13R (Murata et al., 1998). For this reason, the Th2-inducing capacity of IL-4 is a direct effect of EL-4 on T cells. The IL-13 receptor complex is composed of at least 3 distinct components, including the I L - 4 R a chain, the low-affinity binding chain I L - 1 3 R a l and the highaffinity binding chain IL-13Ra2 (de Vries et al., 1999; Murata et al., 1998). It is expressed on B cells, natural killer cells, monocytes, endothelial cells, but not on T cells. The IL-13Ral chain consists of a protein of 427 amino acids and binds specifically IL-13 with low affinity. The IL-13Rcc2 is a 380 amino acid protein that binds EL-13 with high affinity in the absence of the IL-4Roc chain. Binding of IL-13 to the heterodimeric IL13R complex or commonly designated type II EL-4 receptor, composed of the IL-4Ra chain and the I L - 1 3 R a l chain on hemopoietic cells, activates the recruitment and phosphorylation of J A K - 1 , J A K - 2 and Tyk-2 tyrosine kinases to the receptor complex and to induce phosphorylation of the IL-4oc chain. This provides a docking site for Stat6 on its intracellular domain and thus provides a mechanism by which the biological effects of IL-4 and IL-13 are very similar. This would indicate that although EL-4 and IL-13 share a large number of properties, precise mechanisms of regulation are also present to guarantee their distinct functions. Recently, it has been demonstrated that perturbations in the Thl/Th2 cytokine balance, particularly of IL-13, can significantly effect the extent of tissue fibrosis in S. mansoni-infected mice (Chiaramonte et al., 1999; Fallon et al., 2000). Both IL-4 and IL13 play redundant roles in granuloma formation, which explains the ability of IL-4-  .5,6  deficient mice to form granulomas. More importantly, these studies demonstrated that IL-13 is the dominant Th2-type cytokine regulating fibrosis. IL-13 is capable of stimulating procollagen I and procollagen III mRNA expression in fibroblasts (Oriente et al., 2000) and specific inhibition of IL-13 led to more pronounced reduction in fibrosis than that observed in IL-4-deficient mice (Chiaramonte et al., 1999). This emphasizes the potentially important contribution of IL-13 in the fibrotic process. The ability of IL-4 to regulate fibroblast collagen synthesis in Tsk/+ mice both in vitro as well as in vivo suggests that the 7 W + fibrotic process may be dependent on the development of a Th2-mediated immune response. This is consistent with the association of a predominantly Th2 immune phenotype and the occurrence of scleroderma in patients as elevated levels of IL-4 (Hasegawa et al., 1997; Ihn et al., 1995) as well as Th2associated markers, such as CD30 (D'Elios et al., 1997; Giacomelli et al., 1997; Mavalia et al., 1997) have been observed. Collectively, these results suggest that a skewed immune response towards one dominated by Th2 cells may predispose to the development of the fibrotic disorder in 7 W + mice.  57  CHAPTER 5 Inhibition ofCD4+ Thl T-cell development augments Thl immune responses that appear to be responsible for the dermal fibrosis in Tsk/+ mice  5.1  Introduction As strategies that interfered with Th2 cell development were successful in  preventing collagen accumulation in Tsk/+ mice (Ong et al., 1998; Ong et al., 1999), we was hypothesized that the reciprocal induction of Tsk/+ Th2 cell-mediated immune responses would, alternatively, result in an exacerbation of dermal fibrosis in these animals. To establish the conditions favoring the generation of Th2 immune responses, 7 W + mice were crossed with mice lacking functional EL-12 or EFN-y genes. IL-12 - Structure and cellular source  Interleukin-12 (IL-12) is a 75 kDa heterodimeric cytokine composed of two disulfide-linked subunits designated p35 and p40, that is produced primarily by antigenpresenting cells and exerts immunoregulatory effects on T and natural killer (NK) cells (Adorini, 1999; Germann and Rude, 1995; Trinchieri, 1995). The genes for the TL-12 subunits p35 and p40 reside at independent loci in the human genome on chromosome 3pl2-3ql3.2 and 5q31-33, respectively (Sieburth et al., 1992). The genes encoding the mouse IL-12 p35 and p40 subunits have been localized to chromosomes 3 and 11,  .58  respectively (Tone et al., 1996). No sequence homology exists between the IL-12 p35 and p40 subunits. However, the 35-kDa subunit of IL-12 shares homology with IL-6, G CSF, and has, similar to many other cytokines, an cc-helix-rich structure. Interestingly, the 40-kDa subunit is not homologous to other cytokines, but belongs to the hemopoietin receptor family, and most resembles the extracellular domain of the IL-6 receptor a subunit and the ciliary neurotrophic factor receptor (Germann and Rude, 1995). Neither IL-12 subunit alone was found to display significant biologic activity over a large range of concentrations although p40 homodimers may function as IL-12 antagonists that bind to the EL-12R but does not mediate a biologic response (Trinchieri, 1995). IL-12 has been shown to be produced by macrophages upon their encounter with many microbial products, including lipopolysaccharide and components of viruses, intracellular bacteria such as Listeria  monocytogenes and Mycobacteria,  and protozoa  such as Toxoplasma via as yet undefined mechanisms (Hsieh et al., 1993; Jouanguy et al., 1999).  Dendritic cells are professional antigen-presenting cells (APC) specialized in  antigen capture, migration to secondary lymphoid organs, and T cell priming, which can under certain conditions also produce IL-12 (Shevach et al., 1999; Trinchieri and Gerosa, 1996). Recent studies have demonstrated that ligation of CD40 by the CD40 ligand and/or class II on dendritic cells can induce the production of high levels of IL-12 (Gagro and Gordon, 1999; Maranda and Robak, 1998; Rea et al., 1999; Skok et al., 1999). IL-12R  DL-12 receptors are primarily expressed on activated T and N K cells (Gately et al., 1998). The cDNAs for the two IL-12R subunits have been cloned from human and mouse T cells and designated as EL-12RP1 and JJL-12R|32. Both of these subunits belong  \:59  to the gpl30 subgroup of the cytokine receptor superfamily. For both the human and the mouse species, the IL-12RP2 subunit appears to function as the signal transducing component of the high-affinity receptor complex. Thus, in the mouse system, the (31 subunit appears to provide most of the binding activity whereas the 02 subunit is necessary for signal transduction (Gately et al., 1998). In contrast, in the human system, both the (31 and (32 subunits contribute to IL-12 binding activity, while the (32 subunit functions as the primary signal transducing component. The IL-12R|32 chain in particular, is likely to act as a docking site for Stat4 SH2 domain since, in contrast to the EL-12R(3l, the 02 chain has a cytoplasmic domain that contains three sites for tyrosine phosphorylation (Gately et al., 1998). The IL-12Rp2 is not expressed on naive T cells but is induced at low levels after engagement of the T C R by the antigen. The initial expression of functional EL-12Rs is further enhanced when IL-12 is present at the time of priming. In the absence of IL-12, IL-12R(32 is expressed at very low levels and becomes undetectable a few days after T-cell stimulation. IL-12 plays an important role in upregulating its own receptor. Thus, re-exposure of T h l cells to EL-12 results in a strong upregulation of the EL-12RP2, even in the absence of antigen stimulation associated with the presence of several functional and specific Stat4 binding sites within the EL-12Rp2 promoter region (Shevach et al., 1999). Recent evidence suggests that the expression of both the human and mouse EL-12R|32 proteins may be confined to T h l cells and that EL12RJ32 expression correlates with IL-12 responsiveness in these cells (Shevach et al., 1999).  Following differentiation, Th2 cells express I L - 1 2 R p l but not IL-12Rp2.  Likewise, in comparison to expression of EL-12RP1, expression of the EL-12Rp2 subunit appears to be more highly regulated by cytokines such as EL-10, EL-4 and TGF-P (Gollob  SO  et al., 1997; Szabo et al., 1997). Thus, control of IL-12R|32 expression may constitute a pivotal mechanism for regulating IL-12 responsiveness. Upregulation of IL-12R(3l on activated B and Th2 cells in the absence of IL-12RP2 suggests that this receptor subunit may serve some as-yet-to-be-identified function, in addition to its role as an essential component of the high-affinity IL-12R. IL-12 — Immune function The most distinctive, and perhaps the most important effect of IL-12 is its ability to regulate the balance of type 1 and type 2 helper T cells (Adorini, 1999; Schmitt et al., 1997; Shevach et al., 1999; Sinigaglia et al., 1999; Skok et al., 1999; Sutterwala and Mosser, 1999; Trinchieri, 1995; Trinchieri and Gerosa, 1996). In vitro studies in both human and murine systems have shown that IL-12 facilitates the emergence of T h l responses in three ways: (a) it promotes the differentiation of naive T cells, during initial encounter with an antigen, into a population of Thl-cells capable of producing large amounts of IFN-y following activation, (b) it serves as a costimulus required for maximum secretion of IFN-y by differentiated T h l cells responding to specific antigen, and (c) it stimulates the development of IFN-y-producing T h l cells from populations of resting memory T cells upon re-challenge with the antigen to which they been previously exposed. Several lines of evidence have led to the conclusion that IL-12-driven T h l differentiation requires the IL-12-responsive transcription factor signal transducer and activator of transcription (Stat)4 (Sinigaglia et al., 1999) while Th2 differentiation requires the IL-4-responsive transcription factor Stat6 (Murata et al., 1998). IL-12 selectively activates Stat4 in T h l but not in Th2 cells. Gene deletion of IL-12 or Stat4 shows that IL-12 signaling through this pathway is required in vivo since both result in  ,61  markedly reduced T h l responses (Kaplan et al., 1998; Magram et al., 1996; Mattner et al., 1996).  In addition to Stat4, other transcription factors may be important in  influencing development of T h l responses. The IFN regulatory factor-1 (IRF-1) has been suggested as a candidate since IRF-1 deficient mice have a striking defect in the development of T h l cells (Lohoff et al., 1997). However, analysis of IRF-1 mRNA expression in T h l and Th2 cells did not reveal significant differences between the two subsets. Notably, IL-12 induced a strong upregulation of IRF-1 transcripts in T h l , but not in Th2 cells, suggesting that some of the IL-12-induced effector functions of T h l cells may be mediated by IRF-1. The property of IL-12 to induce the production of large amounts of EFN-y from resting and activated T and N K cells is central to many of the effects seen when IL-12 is administered in vivo and provides a mechanism whereby EL-12 plays an important role in innate, as well as adaptive, immunity (Aste-Amezaga et al., 1994; Gazzinelli et al., 1993). In eliciting the production of EFN-y by T and/or N K cells, EL-12 synergizes with a variety of cytokines and other lymphokine-activating agents, including TNF-cc, EL-1 and EL-2; on the other hand, EL-12-induced EFN-y production has been reported to be downregulated by EL-4, EL-10 and TGF-P (Aste-Amezaga et al., 1994). IL-12 can also enhance the lytic activity of N K and lymphokine-activated killer ( L A K ) cells, promote specific cytolytic T lymphocyte (CTL) responses and act as a short-term growth factor for activated T and N K cells, and synergize with stem cell factor and, to a lesser extent, with some of the other colony stimulating factors to induce the proliferation and differentiation of hemopoietic stem cells (Gately et al., 1998). IL-12-associated factors  ;62  Recently, it was reported that in addition to IL-12, type I interferons (IFN-I, which include I F N - a and IFN-P) play an important role in human but not mouse, T h l development (de Waal Malefyt, 1997). There is evidence in vitro and in vivo that the presence of IFN-I can favor development of human T h l cells and increase the number of T h l cell-derived IFN-Y secreting cells. IFN-I has also been shown to induce a strong and rapid tyrosine phosphorylation of Stat4 in both human T h l and Th2 cells (Rogge and al, 1998). Thus, IFN-I can induce T h l development independently of IL-12. Recently, an important species difference was documented such that in contrast to human cells, IFN-I was unable to activate Stat4 in mouse T cells and consequently, unable to induce in vitro development of mouse T h l cells. Sequence variations in the Stat-binding region of the mouse versus human IFN-I receptor have been discovered and may account for the inability of the mouse IFN-I to activate Stat4 in mouse T cells (Rogge and al, 1998). Although IL-12 and IFNs are undoubtedly key factors in directing the development of T h l cells from naive precursors, recent studies have suggested a role for IL-18 as a cofactor in T h l development (Dinarello, 1999; Dinarello, 1999; Dinarello et al., 1998). EL-18 is a cytokine, belonging to the IL-1 cytokine family, which is produced by monocytic cells, Kupffer cells, macrophages, T cells, B cells, osteoblasts, keratinocytes, dendritic cells, astrocytes and microglia. It was shown to enhance the cytolytic activity of N K cells as well as to act synergistically with IL-12 to induce IFN-y production by established T h l and not in Th2 cells since exogenous JJL-18 alone failed to drive the differentiation of naive CD4+ T cells to T h l cells. This synergism is mediated by induction of the IL-18 receptors on the surface of naive T cells by IL-12 and subsequent reciprocal upregulation of their receptors. IL-18R is selectively expressed on  )63  the cell surface of T h l cells but not of Th2 cells and therefore can be considered as a cell surface marker distinguishing T h l from Th2 cells. A n important role for IL-18 in vivo was shown by targeted disruption of the IL-18 gene. EL-18-deficient mice were found to have a significant reduction in LPS-induced EFN-y production following priming with antigen (Sakao et al., 1999). Further, in crossing IL-18-deficient mice to EL-12-deficient mice, the partial deficiency in IFN-y production found in either strain was exaggerated to generate a much more severe defect in EFN-y production in the double cytokine-deficient mice (Dinarello, 1999). A proposed mechanism for IL-18's actions suggests that the major effect of IL-18 is to directly upregulate IL-12RJ32 expression, facilitating the subsequent induction of IFN-y production by IL-12. Although IL-18 is involved in T h l cell development, a recent study revealed a strong induction of the Th2 cytokine, EL-13, by EL-18 in N K and T cells in synergy with IL-2.  When IFN-y is suppressed, IL-18 can  be a cofactor in the development of humoral immune response by inducing EL-13. Thus, depending on the cell type, IL-18 might act as strong coinducer of T h l or Th2 cytokines. IFN-y- Structure and cellular sources Interestingly, the type II immune interferon, IFN-y, but not type I IFNs, has been shown to be an important co-factor for mouse T h l development (Billiau et al., 1998; O'Garra, 1999). The IFN-y molecule is a noncovalent homodimer that consists of two identical 17-kDa polypeptide chains encoded on human chromosome 12 or murine chromosome 10 (Bach et al., 1997). EFN-y is secreted primarily by thymus-derived T cells such as activated T h l cells and CD8+ cytotoxic cells of the T e l phenotype under certain conditions of activation and by natural killer (NK) cells. In T cells, the main inducer of EFN-y is cross-linking of the T cell receptor complex, subject to other regulatory  •64  conditions imposed by the differentiation state of the responding cell. In N K cells, IFN-y production is stimulated by macrophage-derived cytokines, especially TNF-cc and IL-12 and is autostimulated by IFN-y itself. Mice with disrupted IFN-y or IFN-y receptor genes showed many subtle failures in immune function that became explicit when the mice were challenged with infectious organisms (Bach et al., 1997). Increased susceptibility to many intracellular pathogens such as Leishmania major, Listeria monocytogenes, mycobacteria and different viruses have been reported (Jouanguy et al., 1999; Launois et al., 1998). Aberrant expression of IFN-y in transgenic mice under the control of various tissue-specific promoters generates sites of inflammation with susequent tissue destruction (Bach et al., 1997). EFN-y interacts with a specific cell surface receptor, which is ubiquitously but not uniformly expressed on all nucleated cells at modest levels. The receptor is most highly expressed outside the lymphoid system (Aguet, 1990; Bach et al., 1997; Darnell et al., 1994; de Waal Malefyt, 1997). The IFN-y receptor consists of two subunits, the 90-kDa a-chain, exhibiting the high affinity ligand binding properties, and the 314 aa P-chain, required primarily for signaling. The human JJFN-y receptor a chain is encoded by a 30kb gene located on the long arm of chromosome 6 (Bach et al., 1997). The murine homologue is a 22-kb gene present on chromosome 10 (Bach et al., 1997). Each chain is constitutively associated with a Janus kinase (the a-chain with J A K 1 and the P-chain with JAK2). Signal transduction starts with an interaction of the IFN-y homodimer with two receptor a-chains, thereby inducing a-chain dimerization.  The consequent  association of two P-chains with the IFN-y-receptor a-chain complex leads to transphosphorylation and reciprocal activation of the J A K s .  The activated J A K s  phosphorylate tyrosine residues 440 in both receptor a-chains, creating two juxtaposed binding sites for the SH2 domains of latent, cytosolic S T A T l a .  Phosphorylation of  bound S T A T l a at position 701 leads to a rapid dissociation of the receptor-STATla complex and to the formation of STATla-homodimers which then translocate into the nucleus where it is able to bind to defined D N A sequences and initiate transcription of IFN-Y  responsive genes (Aguet, 1990; Bach et al., 1997; Darnell et al., 1994; de Waal  Malefyt, 1997). IFN-y- Immune functions IFN-y induces varied effects on a wide range of target cells and its pleiotropic actions have been well characterized (Billiau et al., 1998; Boehm et al., 1997; O'Garra, 1999). These include effects that promote both specific and nonspecific mechanisms of host defense against infectious agents and tumors. IFN-y possesses weak antiviral activity, and is also to exert antiproliferative effects on a variety of normal and neoplastic cells. However, compared to the type I interferons, IFN-y is primarily acknowledged for its comprehensive role in immunomodulation. IFN-y is one of the major cytokines responsible for upregulating M H C class I protein expression and for inducing M H C class II proteins on a wide variety of cell types. IFN-y has been shown to be the major cytokine responsible for regulating the activities of mononuclear phagocytes. In addition, the cytokine regulates humoral immune responses by effecting IgG heavy chain switching primarily towards complement fixing isotypes. Finally, IFN-y regulates the production of a variety of other immunomodulatory or proinflammatory cytokines such as IL-12 and T N F - a . The status of IFN-y as an inducer of Th phenotype during primary Th stimulation is  66  controversial (Boehm et al., 1997).  It is not disputed that IL-12 is the primary  determinant of T h l differentiation, and IFN-y has been implicated in T h l cell development through its ability to optimize IL-12 production from macrophages and IL12 receptor expression on activated T cells. Nevertheless, the presence of endogenously synthesized IFN-Y during the in vitro priming of naive CD4+ T cells both accelerates and enhances the Thl-differentiating effects of IL-12. Thus, it appears that IFN-y is a necessary but not sufficient factor for T h l development. EFN-y may act at two levels: (a) on APCs to enhance the induction of EL-12 by pathogens such as Listeria monocytogenes or (b) at the level of the T cells. Recently it has been shown that in the mouse, presumably synergistically with T cell receptor engagement, IFN-y induces expression of the IL-12R and in particular, of the IL-12R01 chain on naive T cells and even in cells cultured with EL-4 and hence, to promote the responsiveness of T cells to EL-12 (Gollob et al., 1997; Szabo et al., 1997). Together, these findings indicate that in mice, IFN-y provides a signal for initiating T h l development, the full progression of which requires EL-12 signaling. Interestingly, IFN-y exhibits cross-regulatory properties on Th2 development, in particular Th2 development (Morel and Oriss, 1998; Paludan, 1998). The addition of EFN-y to cultures containing optimal amounts of IL-4 failed to inhibit the priming of CD4+ T cells from T C R transgenic mice to develop into IL-4-producing T cells. However, when suboptimal concentrations of EL-4 were used for priming, EFN-y caused a significant decrease in the amount of IL-4 produced after re-stimulation (Boehm et al., 1997). This result is consistent with the observation that few IL-4-producing T cell clones emerge from a culture containing IFN-y.  67  IFN-y can indeed regulate the  development of T h l cells independently of IL-12 and, at relatively low concentrations, inhibits the proliferation of murine Th2 clones stimulated with antigen, mitogens, or antiTCR antibodies; however, secretion of lymphokines, including IL-4, in response to these stimuli is not affected. IFN-y also inhibits proliferation of murine Th2 clones exposed to IL-2 or IL-4. Although not absolute, the inhibitory effect of IFN-y on proliferation of murine Th2 cells is significant and seems to be sufficient to limit the clonal expansion of such cells. While IFN-y does not inhibit lymphokine secretion by stimulated Th2 cells, IFN-y blocks many effects of these cytokines. For example, IFN-y inhibits proliferation of murine bone marrow cells stimulated with EL-3, IL-4 and granulocyte/macrophage colony-stimulating factor (GM-CSF). In addition IFN-y can inhibit IL-4-dependent B cell differentiation. More importantly, the proliferation of Th2 clones is also inhibited by IFN-y (Billiau et al., 1998). IFN-y- Anti-fibrotic properties IFN-y  n a s  also been shown to regulate the expression of collagen and other extracellular  matrix molecules in fibroblasts (Billiau et al., 1998; Mallat et al., 1995). In contrast to the actions of IL-4, IFN-y suppresses fibroblast collagen synthesis of types I and III collagen, particularly that induced by IL-4. JJFN-y inhibits the IL-4-dependent stimulation of collagen at a pre-translational level. Previous studies have reported that IFN-y was also able to suppress the activation of collagen gene expression by TGF-p (Billiau et al., 1998; Germann and Rude, 1995; Gollob et al., 1997). The negative fibrotic effects exerted by IFN-y may depend, at least in part, on a decreased expression of the IL-4Ra by fibroblasts at the m R N A and protein levels (Billiau et al., 1998). This may explain why fibroblasts incubated with IFN-y become less responsive to the stimulation of  ;68  collagen synthesis induced by EL-4. It is interesting to note that the inhibition of the IL4 R a expression by IFN-y is parallel to that of collagen. IFN-y could primarily affect the stability and turnover of the newly synthesized collagen mRNAs. On the other hand, it has been suggested that the inhibition of collagen gene expression in fibroblasts incubated with IFN-y could result in the downregulation of the transcription factor NF-1 (Paludan, 1998). No information is available about the presence of a consensus binding sequence for NF-1 in the promoter region of the IL-4Ra gene. If such a sequence was actually present, it could explain how collagen and EL-4Roc gene expression may be simultaneously decreased in cells incubated with IFN-y.  Thus, it appears that  lymphocyte-derived products can regulate fibroblast activity, providing potential mechanisms for exerting control over the degree of fibrosis associated with inflammation. The importance of IL-12 and IFN-y in promoting the differentiation and development of the T h l cell lineage provides us with powerful tools to manipulate immune responses. As our previous study suggested that interference with Th2 cell development was capable of preventing collagen accumulation in Tsk/+ mice, it was speculated that the reciprocal inhibition of T h l cell development with the subsequent skewing of the immune response towards one dominated by Th2 cells, would enhance the extent of dermal fibrosis observed in Tsk/+ animals. This hypothesis was tested through the generation of Tsk/+ mice deficient in either EL-12 or EFN-y.  •#9  5.2  Results  5.2.1  Increased dermalfibrosisin Tsk/+ IL-12'' mice  IL-12 deficiency is associated with increased dermalfibrosisin Tsk/+ mice Histological examination of skin samples derived from the interscapular region of EL-12deficient Tsk/+ mice revealed a significant increase in dermal collagen layer thickness as compared with Tsk/+ mice. Indeed, an almost complete elimination of the subcutaneous adipose layer was seen in Tsk/+ IL-12'' mice. The superficial collagen layer thickness of Tsk/+ / L - i 2 " mice was approximately a 2.5 fold greater than that of normal C57B1/6 skin y  as illustrated in Fig. 5.1 by the differences in the blue-green stained band lying between the epidermis and the subcutaneous muscle layer.  C57B1/6 control  FIG. 5.1.  IL-12 ' V  Dermal histology of Tsk/+ IL-12'' mice. IL-12 deficiency is associated with increased dermal  fibrotic pathology in Tsk/+ mice. Representative photomicrographs (magnification lOOx) of dermis obtained from the interscapular region of control C57B1/6, IL-12^' Tsk/+ and Tsk/+ IL-12'' animals. For this analysis, - 1 cm skin 2  fragments, which included subcutaneous tissue and deep fascia, were removed from the interscapular region of the dorsal midline. Sections were cut perpendicular to the skin surface and stained with the Masson's trichrome (collagen bundles are stained blue-green).  70  Dermal collagen layer pathology of IL-12 p40'' mice was similar to that of controls, indicating that the lack of this cytokine did not increase dermal collagen content under normal conditions. To quantitate the increase in dermal collagen thickness in the Tsk/+ IL-12'' mice, measurements of this layer were determined using a calibrated ocular micrometer (Fig. 5.2). When compared to Tsk/+ mice, which already exhibit a ~2-fold increase in dermal collagen thickness (n=8; 0.415 ± 0.023 mm) over control C57B1/6 (n = 4; 0.221 ± 0.019 mm) and IL-12'' mice (n = 6; 0.225 ± 0.003 mm), Tsk/+ IL-12'' mice demonstrated an additional -30% increase in collagen layer thickness (n = 9; 0.572 ± 0.012 mm) (p < 0.05, unpaired two-tailed Student's t-test). Thus, a lack of IL-12 was associated with an increased amount of dermal fibrosis in Tsk/+ mice.  O.8-1  0.6-1 0.4 H  -  0.2H  C57BL/6  FIG. 5.2.  IL-U-'-  Tsk/+ Tsk/+IL-12-  A  Dermal collagen thickness of Tsk/+ IL-12 ' mice. Collagen thickness of control C57B1/6 (n=4), IL1  12'' (n=6), Tsk/+ (n=8) and Tsk/+ IL-12'' (n=9) animals was determined using a calibrated ocular micrometer to measure the blue-green stained collagen layer between the epidermis and the adipose layer on Masson's stained sections of the skin. Multiple sites on each of three different skin sections cut perpendicular to the skin surface per mouse was performed as described previously (Ong et al., 1998). * p<0.05.  -*71  Pulmonary pathology remains unaltered in Tsk/+ IL-12'' mice Histological examination was also employed to assess the effects of IL-12 and deficiency on Tsk/+ lung structure.  Sections taken from Tsk/+ mice typically  demonstrate emphysematous-like changes consisting of distended lungs and dilated alveolar spaces due to thinned and disrupted alveolar walls. Both Tsk/+ and Tsk/+ IL-12' '' mice demonstrated similar degrees of abnormal pulmonary pathology (Fig. 5.3), indicating that the lung disease process was unaffected by the lack of IL-12.  Tsk/+  FIG. 53. Tsk/+  Tsk/+ IL-1T  Pulmonary pathology of Tsk/+ IL-12'' mice. Abnormal pulmonary pathology remains unaltered in  IL-12'' mice. Representative photomicrographs (magnification lOOx) of hematoxylin/eosin-stained sections of  inflated lung obtained from control C57B1/6,  Tsk/+,  IL-12'' and  Tsk/+  IL-12^' animals as indicated. The prominent  presence of enlarged and dilated alveolar spaces are still detectable in Tsk/+ animals lacking the IL-12 gene, suggesting the abnormal pulmonary development in 7W+ mice is independent of IL-12 influences.  72  CD4+ T cells isolated from Tsk/+ IL-12''' and IL-12''' mice produce increased levels of IL-4 following anti-CD3 antibody stimulation To determine whether IL-12 deficiency was indeed associated with a generalized augmentation of Th2 cell development in Tsk/+ mice, purified CD4+ T cells (initially primed with plate-bound anti-CD3 antibody and allowed to proliferate in the presence of IL-2 for 4 d) were restimulated with anti-CD3 antibody. Culture supernatants from these cells were then assessed for IL-4 and IFN-y concentrations by ELISA. As shown in Fig. 5.4A and 5.4B, purified CD4+ T cells from Tsk/+ mice produced significantly greater amounts of both IL-4 (951 ± 1 5 pg/mL), and IFN-y (4950 ± 303 pg/mL), as compared to control C57B1/6 mice (16 ± 3 pg/mL, and 1710 ± 211 pg/mL, respectively). This finding raised the possibility of an expanded ThO-like population in the Tsk/+ mice capable of producing a mixture of T h l and Th2 cytokines. EL-4 production by IL-12''mice (706 ± 40 pg/mL), was also elevated over that of control CD4+ cells, consistent with the expansion of the Th2 cell compartment in these mice. Interestingly, in Tsk/+ IL-12'' mice, IL-4 production was further increased to ~2 fold (2259 ± 1 1 4 pg/mL) above that of Tsk/+ mice alone. IFN-y production, on the other hand, was suppressed in both 7L-72- (413 ± 64 pg/mL) and Tsk/+ IL-12'' (976 ± 62 A  pg/mL) mice, consistent with a key role of EL-12 in the generation of EFN-y-producing Tcells (21). Particularly when compared to IL-4 secretion from CD4+ cells of control mice, T-cells from Tsk/+ IL-12''mice displayed a dramatic increase in IL-4 production following in vitro stimulation with anti-CD3 antibody, suggesting the importance of IL12 in regulating Th2 cell and cytokine generation, and in particular, EL-4 production.  .'73  FIG. 5.4.  IL-4 and IFN-y production by Tsk/+ IL-12 -mice. 1  CD4+ T cells isolated from Tsk/+ IL-12'' and  IL-12' ' mice produce increased levels of IL-4 following anti-CD3 antibody stimulation. CD4+ cells were isolated from 1  three pooled spleens of control C57B1/6 (n=4),  (n=6), Tsk/+ (n=8) and Tsk/+ IL-H''' (n=9), and stimulated with  1 ng/mL plate-bound anti-CD3 at 3 X 10 cells/mL in the presence of 3% IL-2 in primary culture for 2d. Following a 6  4d period in the absence of anti-CD3, 5 x 10 cells/mL were restimulated with 1 u,g/mL anti-CD3. Culture supernatants s  were harvested after 24h and assayed for (A) IL-4 and (B) IFN-y by ELISA. Enhanced IL-4 protein was detectable in the supernatants from Tsk/+ animals deficient in the IL-12 gene, suggesting an association between an exacerbated Th2 immune response and augmented dermal fibrosis in these animals. Data represents the mean of triplicate cultures, and the 'n' values refer to the number of independent experiments (each containing CD4+ cells from three pooled spleens) that were performed.  Intracellular cytokine staining reveals expansion of a polarized Th2-cell population within anti-CD3 antibody-stimulated Tsk/+ IL-12'' CD4+ T-cells Assessment of cytokine levels within supernatants of bulk cultures does not reveal whether a given cytokine is being expressed by a single polarized subset, or from more than one subset, such as the CD4+ ThO cells. Thus, immunofluorescent staining of intracellular IL-4 and IFN-y in combination with flow cytometry was employed to evaluate cytokine production at the single cell level. We were especially interested in whether the increased production of IL-4 and IFN-y seen in Tsk/+ CD4+ cell supernatants was the result of either an increase in polarized T h l and Th2 populations, or an expansion of ThO cells. Intracellular staining revealed that anti-CD3/anti-CD28 antibody stimulation of purified CD4+ T-cells generated an increased percentage of polarized IL-4-producing cells from Tsk/+ mice (10.5%), as compared to controls (6.2%) as shown in Fig. 5.5. Similarly, an increased proportion of Tsk/+ CD4+ T cells developed into IFN-y singleproducing cells (19.9%), as compared to controls (11.5%). This observation correlated well with the E L I S A data where Tsk/+ T-cell supernatants contained elevated levels of both IL-4 and IFN-y, as compared to control supernatants. A proportional expansion of a putative ThO population (positive for both intracellular IL-4 and IFN-y) was also observed within the Tsk/+ CD4+ T-cell population. Thus, ThO-like cells generated from the stimulated Tsk/+ CD4+ populations was ~2-fold greater (4.9%) as compared to controls (2.3%), proposing the ideas that an expanded ThO population may also contribute to the increased levels of IL-4 and IFN-y observed in stimulated Tsk/+ T-cell supernatants. IL-12''mice  generated a higher proportion of IL-4-producing Th2 cell  75  IL-12-/Fig. 5.5.  Tsk/+ IL-12-/-  Intracellular cytokine staining of stimulated Tsk/+ IL-12-/- CD4+ T cells.  Intracellular cytokine staining reveals expansion of a polarized Th2-cell population within anti-CD3 antibody-stimulated Tsk/+ IL-12-/- CD4+ T-cells. Purified 8wk old splenic CD4+ T cells were examined for intracellular IL-4 and IFN-Y staining by flow cytometry. Representative panels obtained from control C57B1/6, Tsk/+, rL-12"/- and Tsk/+ IL-12'/' mice are shown. Consistent with E L I S A data, Tsk/+ IL-12'^' animals demonstrated an elevated Th2 cytokine profile characterized by elevated EL-4 and diminished IFN-y cytokine producing cells within a simulated population of CD4+ splenic T cells. Comparable results were obtained from three different mice of each genotype in three independent experiments.  (25.6%) compared to both control and Tsk/+ CD4+ cells as well as reduced percentages of both the IFN-Y-producing (4.4%) and ThO-like (1.5%) cell populations. Interestingly, anti-CD3/anti-CD28 antibody-stimulation of Tsk/+ IL-12' T-cells led to a further elevation in the percentage of polarized IL-4-producing cell population (38.0%) when compared to the IL-12'' mice. Similar to the IL-12'' cells, the percentages of Thl-like (3.2%) and ThO-like cell populations (1.5%) were both greatly diminished in Tsk/+ IL-12' '' cells. These observations, which are consistent with the E L I S A data presented above  76  (Fig. 5.4), suggest that a Th2-dominated immune response mediated by the effects of JJL4, likely prevails in Tsk/+ IL-12'' mice, a scenario that may be causally linked to the increased dermal collagen observed within this cross.  ••77  5.2.2 Increased dermal fibrosis in Tsk/+ IFN-y'' mice IFN-y deficiency exacerbates dermal fibrosis in Tsk/+ mice The enhancement of dermal collagen deposition in Tsk/+ IL-12'' mice suggests that skewing towards a CD4+ Th2-cell polarized immune response may be capable of regulating dermal fibrosis in Tsk/+ mice. To assess the potential role of other T h l associated cytokines in the development of dermal fibrosis, Tsk/+ mice deficient for the IFN-y gene were generated and analyzed. Examination of histological skin sections derived from the interscapular region of Tsk/+ IFN-y'' mice demonstrated an enhanced deposition of collagen within the dermal layer, similar to that observed in the Tsk/+ IL-12''mice (Fig. 5.6).  Tsk/+  FIG. 5.6.  Dermal histology of  Tsk/+ IFN-y''  Tsk/+ IFN-y''  mice. IFN-y deficiency exacerbates dermal fibrosis in  mice. Representative photomicrographs (magnification lOOx) of dermis obtained from control C57B1/6, IFN-y'', and  Tsk/+ IFN-y''  Tsk/+ Tsk/+  animals. Skin sections were processed as described in Figure land stained with Masson's trichrome  to allow visualization of dermal collagen layer. The lack of IFN-y in  Tsk/+  mice resulted in a dramatic deposition of  collagen within the dermal layers of the skin excessive of that observed in Tsk/+ animals alone with a subsequent loss of dermal fat content.  78  Increased thickness of dermal collagen layer in Tsk/+ IFN-y'' mice was approximately 2.5 fold greater compared to control and IFN-y'' mice and approximately 30% beyond that observed in Tsk/+ mice. Dermal collagen layer thickness of IFN-y'' mice (n=7; 0.171±0.01 mm) was similar to controls (n=7; 0.181±0.02 mm), consistent with the observation that the lack of IL-12 or IFN-y genes alone does not result in an increase in dermal collagen content (Fig. 5.7). In contrast, Tsk/+ IFN-y'' displayed an expanded dermal collagen layer (n=7; 0.556+0.01 mm) compared with Tsk/+ animals alone (n=ll; 0.408+0.02 mm) (p < 0.05, unpaired two-tailed Student's t-test). Thus, IFN-y, another Thl-associated cytokine, appears to play an important regulatory role in the development of dermal fibrosis in Tsk/+ mice.  0.8-1  0.6H  a  0.4H  00  J3 "o U  0.2  H  C57B1/6  IFN-r'-  Tsk/+  Tsk/+ IFN-y  FIG. 5.7. Tsk/+ IFN-y''  Dermal collagen thickness of  Tsk/+ IFN-y''  •/-  mice. Enhancement of dermal collagen thickness in  animals. Collagen thickness of control C57B1/6 (n=7), IFN-f' (n=7), Tsk/+ (n=ll) and Tsk/+  IFN-y'  (n=7) animals was determined using a calibrated ocular micrometer. Multiple sites on each of three different skin sections cut perpendicular to the skin surface per mouse was performed as described previously (Ong et al., 1998). *p<0.05.  79  Pulmonary abnormalities unaffected in Tsk/+ IFN-y'' mice  Histological examination  of lung sections from Tsk/+ and Tsk/+ IFN-y'' mice  demonstrated similar degrees of abnormal pulmonary pathology compared with control C57B1/6 and IFN-y"'" samples (Fig. 5.8), indicating that the lung disease process was unaffected by the lack of either the IL-12 or IFN-y genes.  C57B1/6  IFN-y* [~ 7 I  v.  Jiff'?  2* .»I**  * -  <1  •4.  Tsk/+ F I G . 5.8 .  7 W +  Pulmonary pathology of Tsk/+ IFN-y'' mice. Abnormal pulmonary pathology remains unaltered in  Tsk/+ IFN-y'' mice. Representative photomicrographs (magnification lOOx) of hematoxylin/eosin-stained sections of inflated lung obtained from control C57B1/6, Tsk/+, IFN-y'' and Tsk/+ IFN-Y' animals as indicated.  Th2-dominated cytokine patterns generated by CD4+ T cells from Tsk/+ IFN-y mice  To examine the effect of IFN-y deficiency on the generation of a Th2 cell-mediated immune response, EL-4 and IFN-y production by stimulated purified CD4+ T cells were  30  measured.  A n increased production of IL-4 was detectable by E L I S A from purified  CD4+ T cells of IFN-y'' mice (1645 ± 115 pg/mL) compared with control C57B1/6 (120 ± 6 pg/mL) and Tsk/+ mice (1105 ± 88 pg/mL) as shown in Fig. 5.9A, suggesting that naive CD4+ T cells expand to develop into Th2 cells in the absence of IFN-y. Interestingly, Tsk/+ IFN-y' ' mice produced similar levels of IL-4 (1651 ± 66 pg/mL) 1  compared to IFN-y" " mice, with no further augmentation of IL-4 production observed. 7  Undetectable levels of EFN-y were observed by E L I S A as shown in Fig. 5.9B from both IFN-y'' and Tsk/+ IFN-Y' mice, in contrast to the robust levels produced by both C57B1/6  control (1213 ± 79 pg/mL) and 7 W + mice (2948 ± 266 pg/mL).  2500  FIG. 5.9.  IL-4 and IFN-y production by Tsk/+ IFN-y''CD4+ T cells. CD4+ Th2-dominated cytokine patterns  generated by CD4+ T cells from Tsk/+ IFN-y'' mice. CD4+ cells were isolated from three pooled spleens and culture supernatants from stimulated cells of control C57B1/6 (n=7), IFN-y'' (n=7), Tsk/+ (n=ll) and Tsk/+ IFN-y'' (n=7) were harvested after 24h and assayed for (A) IL-4 and (B) IFN-g by ELISA. CD4+ T cells of Tsk/+ mice deficient in IFN-y were capable of generating robust amounts of IL-4 but defective IFN-y protein upon anti-CD3 stimulation. Data represents the mean of triplicate cultures of n number of independent experiments.  :8i  These results are consistent with intracellular cytokine levels in which an increased percentage of polarized IL-4-producing cells from IFN-y'' mice (13.88%) and 7 W + IFN-y'' mice (13.92%) were generated compared with control (4.40%) and Tsk/+ mice (8.96%) (Fig. 5.10). Similarly, intracellular IFN-y-producing cells were suppressed in both IFN-y'' and Tsk/+ IFN-y'' mice as anticipated whereas C57B1/6 control (7.63%)  and Tsk/+ mice (10.23%) generated moderate IFN-y single-cell producers. Collectively, these results suggest that a deficiency of IFN-y in Tsk/+ IFN-y'' mice proceeded in the generation of a skewed Th2 immune response characterized by high IL-4 production, which may be associated with worsening of dermal fibrosis in these mice.  vo  1 4.40 n o in ** 1, . EN  IB-  e o  JBSKHWFI  7J63  • llllll  HUlll  U  10' IFN-y-J-  C57B1V6  o  ]  e  8.96  «  « :  s?  *  c  0  10° 10* IO IO FHhflFlTC 2  Fig. 5.10.  •  •a  " * J | | t-J'l  o  13.9:  3  19  10'  JO If? 2  10  Intracellular cytokine staining of Tsk/+ IFN-g-/- CD4+ T cells. Intracellu-lar cytokine staining  reveals expansion of a polarized Th2-cell population within anti-CD3 antibody-stimulated 7W+ IFN-y-/- CD4+ Tcells. Intracellular cytokine production of EL-4 and IFN-y by Tsk/+ IFN-y-/- CD4+ T cells. Purified 8wk old splenic CD4+ T cells were examined for intracellular IL-4 and IFN-y staining by flow cytometry. Representative panels obtained from control C57B1/6, Tsk/+, IFN-y-/- and Tsk/+ IFN-y-/- mice are shown. Tsk/+ animals lacking IFN-y displayed skewed cytokine production by single cell populations including enhanced IL-4 producing cells with a major compromise in the number of IFN-y producing cells. Comparable results were obtained from three different mice of each genoype in three independent experiments.  82  5.3  Discussion Previously, an essential role for IL-4, and the activated EL-4 receptor-associated  transcription factor, Stat6, in the development of dermal fibrosis in Tsk/+ mice was demonstrated as this disease process was inhibited in both Tsk/+ TL-4'~ and Tsk/+ Stat-6'' mice (Ong et al., 1999), as well as by repetitive administration of neutralizing anti-IL-4 antibodies (Ong et al., 1998). Since EL-4 is predominantly produced by effector Th2 cells and is also critical for the differentiation and commitment of naive CD4+ T-cells towards the Th2 lineage (Constant and Bottomly, 1997; Haas et al., 1999; Romagnani, 1999), these studies have indicated a role for Th2 cells in the development of dermal fibrosis in Tsk/+ mice. Herein, via the use of a genetically-based "immune deviation" strategy employing mice deficient in IL-12 or IFN-y production, we provide additional evidence of a role for Th2 cells in regulating dermal fibrosis in Tsk/+ mice. EL-12 and IFN-y are key cytokines involved in the development of the CD4+ T h l cell lineage. EL-12, a cytokine produced primarily by activated monocytes and dendritic cells, enhances proliferation and cytolytic activity of N K and T-cells, stimulating the release of cytokines, such as IL-12 itself, as well as EFN-y (Adorini, 1999; Trinchieri, 1998; Trinchieri and Scott, 1999). IL-12 is required for optimal T h l cell development, both in vitro (Hsieh et al., 1993; Manetti et al., 1994) and in vivo (Afonso et al., 1994; Mountford et al., 1999; Scharton-Kersten et al., 1995). Early secretion of IL-12 during the initial phase of an innate immune response sets the stage for the ensuing antigenspecific immune response, favoring the development of T h l cells while at the same time inhibiting the generation of Th2 cells (Trinchieri and Scott, 1999). The regulation of IL12 is positively influenced by the production of IFN-y from natural killer cells during the  .83  immediate aspecific phase of host defense (Trinchieri, 1998), which stimulates macrophages to produce IL-12 involved in driving the differentiation of the CD4+ T h l cell lineage. In the subsequent antigen-specific phase of the immune response, IFN-y acts as a regulator of antigen presentation and of proliferation and differentiation of lymphocyte populations and is primarily produced by the CD4+ T-helper 1 (Thl) subset of cells (Billiau et al., 1998). Given the significant roles that IL-12 and IFN-y play in regulating T h l lineage commitment, we hypothesized that DL-12 or IFN-y deficiency in Tsk/+ mice would hinder T h l cell development with a compensatory increase in the magnitude of the putative pathogenic Th2 immune response responsible for dermal fibrosis. This could occur as a result of either an increased recruitment of CD4+ T-cells into the Th2 developmental pathway, a diminished inhibitory effect of Thl-derived cytokines on emerging Th2 responses, or a combination of both. The net effect, based on the assumption that Th2 cells are responsible for regulating dermal fibroblast activity in Tsk/+ mice, would be an increased degree of dermal fibrosis in both Tsk/+ IL-12'' and Tsk/+ IFN-y''mice. In support of this hypothesis, as shown in Figs. 5.1 and 5.2, the dermal collagen layer of Tsk/+ IL-12^' mice was -30% thicker than that of Tsk/+ mice. While 30% might be considered a relatively modest change, when this increase in the collagen layer is multiplied over the entire surface area of the animal, it represents a substantial accumulation of collagen and other extracellular matrix molecules in these mice. Indeed, in Tsk/+ 1L-12 ' mice, the adipose layer between the epidermis and the superficial muscle V  layer was almost completely replaced by the fibrous tissue (Fig. 5.1), suggesting that obliteration of this fat cell layer might represent an upper limit to the Tsk/+ fibrotic  784  process. Similarly, the dermal histology observed in Tsk/+ IFN-y mice, depicted in Figs. 5.6 and 5.7, closely paralleled the observations made in Tsk/+ IL-12'' mice. The extent of dermal collagen deposition observed in Tsk/+ IFN-y'' mice was increased by an additional -30% compared with Tsk/+ mice, similar to the observations made in 7 W + IL-12''mice.  Interestingly, despite the presence of increased polarization of anti-CD3  antibody-stimulated T-cells towards a Th2-like phenotype, IL-12'' and IFN-y''mice failed to exhibit an increase in dermal collagen content when compared to control mice. This suggests that the potential for a generalized increase in Th2-dominated immune responses alone is insufficient for the induction of dermal fibrosis. However, in the presence of the Tsk/+ mutation, the development of dermal fibrosis in these mice appears to be regulated by Th2-cell activity since a skewed immune response in the absence of EL-12 or EFNy genes was capable of enhancing the dermal fibrotic process. These observations raise a number of possible hypotheses, including two that are not mutually exclusive: the first being that dermal fibrosis results from an antigen(s)-specific Th2-dominated autoimmune response that is peculiar to Tsk/+ mice that directly, or indirectly, drives fibroblast extracellular matrix molecule synthesis; and secondly, that dermal fibroblasts of 7 W + mice, possibly due to abnormalities in their extracellular matrix environment, are uniquely regulated by 'generic' Th2 immune responses against common environmental antigens. Perhaps in support of the latter, it is noteworthy that Tsk/+ mice do not show evidence of significant immunopathology, such as lymphadenopathy, splenomegaly, or obvious lymphoid cell infiltrates in affected tissues (data not shown), as would be predicted to accompany systemic autoimmunity.  •*85  Tsk/+ cells express an abnormal fibrillin 1 protein, resulting from an in-frame duplication of the FBN1 gene, which in turn leads to aberrant microfibril structure (Kielty et al., 1998; Siracusa et al., 1996). Fibrillin 1, an RGD-containing 350-kDa molecule that is present in the extracellular matrix of various tissues (such as arteries and dermis), is a major component of microfibrils which are embedded within the cores of elastic fibers (Reinhardt et al., 1995; Reinhardt et al., 1996). Given the close relationship between cells of the immune system and molecules of the extracellular matrix (Lider et al., 1995), it is conceivable that the abnormal matrix of Tsk/+ mice may not only alter fibroblast function, but also perturb immune responses. In keeping with this idea, it is notable that the Tsk/+ FBN1 gene encodes a protein possessing an additional R G D site (Siracusa et al., 1996) which may serve as important mediators in eliciting crucial interactions between extracellular matrix molecules and the immune system  components.  Interestingly, a chromosomal region associated with a form of scleroderma appears to be tightly linked to the human FBN1 locus (Tan et a l , 1999; Tan et al., 1998), raising the possibility that the FBN1 gene mutation might be linked to the human fibrotic disease. Emphysematous abnormalities were observed in the lungs of both Tsk/+ IL-12'' (Fig. 5.3) and TskZ+IFN-y'' (Fig. 5.8) mice, similar to the distorted pulmonary architecture present in Tsk/+ mice. As this pathology was also unaltered in Tsk/+ CD4~'' (Wallace et al., 1994) , 7 W + IL-4''and Tsk/+ State'' mice (Ong et al., 1998; Ong et al., 1999), it suggests that the pulmonary changes may instead be associated with the mutant FBN1 gene expression. Fibrillin 1 is critical for elastin microfibril assembly during lung development (Mariani et al., 1997). Thus, while there is a link between the immune  86  system and Tsk/+ dermal fibrosis, it appears that the pulmonary abnormality may be related to the abnormal fibrillin 1 protein encoded by Tsk/+ FBNL When cytokine production from stimulated Tsk/+ IL-12''"and 7 W + IFN-y''CD4+ cells was evaluated either by E L I S A of cell culture supernatants (Figs. 5.4 and 5.9), or by intracellular staining (Figs. 5.5 and 5.11), a significant elevation of IL-4 production, accompanied by a sharp reduction or absence of IFN-y production, was observed. This pattern of high IL-4 and low IFN-y in the stimulated CD4+ cells suggests that a similar polarization may be occurring in vivo, during the putative Th2 immune response associated with Tsk/+ dermal fibrosis. The increased dermal fibrosis in Tsk/+ IL-12'' and Tsk/+ IFN-y'' mice raises the possibility that IL-12 and IFN-y, or potentially cytokines generated by T h l cells, may play a negative regulatory role with respect to Tsk/+ dermal fibrosis.  Indeed, in the example of Tsk/+ IL-4'' and Tsk/+ Stat6''mice,  where the  generation of polarized T h l immune responses would be anticipated to occur, dermal fibrosis was prevented (Ong et al., 1999). It is notable that the relationship between Th2 immune responses and fibrosis is not limited to Tsk/+ mice as the Th2 subset has been implicated in the fibrotic responses to specific infectious agents (Boros and Whitfield, 1999; Chiaramonte et al., 1999; Kunkel et al., 1996). Interestingly, the enhancement in EL-4 production by Tsk/+ IL-12^' mice was more striking than in Tsk/+ IFN-y'' mice, although the same degree of dermal collagen layer thickening was observed. This may be due to differential regulation of dermal collagen deposition by the two Thl-associated cytokines, IL-12 and EFN-y. Since IL-12 is not only essential for normal T h l cells development but also for the induction of IFN-y production from these cells (Trinchieri, 1998), it is plausible that the dermal pathology  -:87  observed in Tsk/+ IL-12'mice  results in part from a deficiency of circulating IFN-y, a  cytokine which is known to potently inhibit fibroblast collagen synthesis in vitro (Gillery et al., 1992) and in vivo (Granstein et al., 1990; Jaffe et al., 1999). The lack of IL-12 abrogates T h l development and suppresses IFN-y production, resulting in a heightened Th2 response mediated by IL-4. As 7 W + fibroblasts have previously been demonstrated to be highly responsive to IL-4 stimulation, the potent effects of Th2-cell derived EL-4 on collagen production may lead to the development of exaggerated dermal fibrosis. As Tsk/+ IL-12'' mice are still capable of generating relatively small numbers of IFN-yproducing cells in vitro (Figs. 5.4 and 5.5), and therefore potentially in vivo as well, the consequences of the Tsk/+ IFN-y'' cross on dermal fibrosis was evaluated and compared. As IFN-y contributes to the regulation of IL-12 production and hence indirectly CD4+ T h l cell differentiation as well as exhibiting negative effects on collagen production, the outcome of IFN-y deficiency in Tsk/+ animals would include deregulation of T h l immune responses in combination with an abrogation of its inhibitory effects on collagen-producing activity by fibroblasts.  As previous studies have demonstrated  normal T h l differentiation in the absence of IFN-y, the phenotype observed in 7 W + IFN-y'' animals may be the consequence of an enhanced Th2 immune response, although not at the same level as that generated in an EL-12'" setting, in combination with the loss of IFN-y's potent inhibitory influences on collagen production. These events within Tsk/+ IFN-y''mice may explain their similarity to Tsk/+ IL-12'' animals, with respect to dermal fibrosis. Induction of an exaggerated Tsk/+ Th2 cell-mediated immune response through the generation of Tsk/+ animals deficient in either one of the Thl-promoting cytokines,  .'88  IL-12 or IFN-y, was associated with an increased level of dermal fibrosis in these animals. In agreement with our previous study demonstrating the ability to inhibit Tsk/+ dermal fibrosis upon inhibition of Th2 cell development, these results further support a model in which CD4+ Th2 cells and/or its derived lymphokine products, including IL-4, are important in mediating the development of the fibrotic manifestations observed in the Tsk/+ mutant mouse.  CHAPTER 6  Role of yd T cells in the regulation response  6.1  in Tsk/+  of CD4+ T h l  immune  mice  Introduction The identification of an immunoregulatory role for CD4+ Th2 cells in the  development of Tsk/+ dermal fibrosis is strongly suggested by our previous studies in which manipulation of Th2 lineage progression was able to regulate the disease process. Since the differentiation of naive T cells towards the Th2 phenotype seems to be crucially dependent upon the particular cytokines present at the early stages of an immune response, factors driving Th2 differentiation and in particular, the so-called 'early IL-4', seems to play an important role. However, there is some controversy over the extent to which it is required and also its cellular source. It was originally thought that IL-4 was only produced by differentiated T helper cells, and yet this factor is required early in an immune response for the development of Th2 cells. There are now several candidates for EL-4 production early in an immune response, which may be responsible for Th2 differentiation (Ricci et al., 1997); these include major histocompatibility complex ( M H C ) class Il-restricted CD4+ T cells (memory and possibly naive), the NK1.1+ subset of CD4+ and double negative (DN) T  90  cells, LACK-specific CD4+ T cells expressing V(34, Vp8 TCRs, y8 T cells, and non-T cell sources, such as mast cells, basophils, and eosinophils. One of these candidates, y8 T-cells, represent a minor subpopulation of T lymphocytes are capable of generating robust amounts of IL-4 early during an immune response (Ferrick et al., 1995; Haas et al., 1999), but their precise role(s) in normal and diseased conditions remain to be fully defined. There are clear indications, however, that y5 cells can perform a wide array of immune effector functions in antimicrobial immunity as well as in chronic inflammatory reactions (Hayday and Geng, 1997; Hayday, 2000). T cells expressing the y8 T C R share many characteristics with their 0$ counterparts, such as cytotoxicity and association of the T C R with C D 3 . However, their ontogeny, distribution, and functional roles are significantly different. T C R 0$ knockout mice have been instrumental in the study of the ability of y5 T cells to supplement functions of the TCR oc(3 T cells during immune responses (Hayday, 2000). TCR y8 T cells, for example, have been found to provide B-cell help in antibody class switching and germinal center formation in the absence of T C R aP T cells. They can also enhance activation of APCs such as macrophages by increasing nitric oxide production, as well as regulating naturalkiller (NK) cell and classical T C R a|3 T-cell activity in vivo. T C R y5 T-cell clone fall into several categories: (a) CD8" CD4" clones, which appear to display a type 1 phenotype with high levels of IFN-y and IL-2 production, (b) CD4+ clones which conform to a classical type 2 phenotype, associated with elevated IL-4 production, and (c) CD8+ clones which are predominantly of the type 1 phenotype. In co-culture experiments with B cells from TCR8 knockout mice, type 2 y6 T cells were found to promote I g G l immunoglobulin production by B cells and type 1 y8 T cells to promote IgG2a, a pattern  •91  identical to that seen with type 1 and type 2 T C R a(3 T cells (Hayday, 2000; Wen et al., 1998). In addition, the relationship between CD4 expression and type 2 differentiation was identified by comparing R N A levels from freshly isolated CD4+ and CD4" T cell TCR y8 populations (Yamashita et al., 1999). These findings demonstrated that CD4+ y8 T cells expressed greater than 10-fold more IL-4 and EL-10 than conventional CD4" cells, which expressed significantly more IFN-y (Wen et al., 1998). Many lines of research have proposed y8 T cells as a first line of defense during infection (Hayday and Geng, 1997; Hayday, 2000). Combined with the evidence of the existence of type 1 and type 2 T C R y5 T cells, displaying comparable function to their a{3 counterparts, this raises the question of what roles such novel T-cell subsets play in the initiation of a primary immune response. T C R y8 and T C R a p T cells in mice infected with either the intracellular bacterium Listeria monocytogenes, which promotes T h l responses, or the extracellular parasite Nippostronglus brasiliensis, which promotes Th2 responses, exhibited increased IFN-y in both y8 and a p T cells during Listeria monocytogenes infection, although y8 T cells were responsible for the early release of the type 1 cytokine (Hayday and Geng, 1997; Hayday, 2000).  A n early and sustained  increase in EL-4 production was seen during Nippostronglus brasiliensis infection almost solely from y8 T cells, thus suggesting a role for type 1 and type 2 y5 T cells in determining the direction of an immune response. Therefore, this novel T-cell subset could be responsible for releasing cytokines that are able to enhance or suppress the activity of A P C s together with providing the appropriate influence on surrounding classical T C R a P T cells. This provides the start of a cascade of differentiation towards type 1 or type 2 that is dependent on the nature of the antigen encountered.  92  The initial accumulation of y8 T cells early during an immune response through their localization and recognition of antigens directly in tissue without the need of professional antigen-presenting cells as well as the presence of these T cells predominantly within the epidermis (Hayday, 2000; McVay et al., 1991) makes them attractive candidates for regulating CD4+ T-helper differentiation and may potentially be involved in the development of dermal fibrosis in Tsk/+ mice. Interestingly, many cutaneous disorders, including scleroderma, have been associated with an increased percentage and localization of y5 T-cells in affected skin regions (Giacomelli et al., 1998; Yurovsky et al., 1994), yet their exact mechanism remains unclear. Thus, y8 T cells may contribute to the establishment of a Th2-skewed immune response through its capacity to generate IL-4, which may be causally responsible for the development of dermal fibrosis in Tsk/+ animals.  93  6.2 Results 6.2.1 Role of yS T cells in the generation of dermal fibrosis in Tsk/+ mice IL-4 is produced by multiple cell types including Th2 cells, mast cells, basophils, CD4+ NK1.1 T cells as well as y8 T cells (Brown and Hural, 1997; Haas et al., 1999). To investigate the potential contribution of y8 T cells to the development of dermal fibrosis, through its regulation of CD4+ T-helper differentiation, Tsk/+ mice were bred with TCR8  A  mice that are deficient in functional y8 T cells. Histological examination of skin samples derived from the interscapular region of  TCR8-deficient Tsk/+ mice revealed a significant reduction in dermal collagen layer thickness compared with Tsk/+ mice. The degree of superficial collagen present in Tsk/+ TCRS  A  mice was similar to that observed in control C57B1/6 and TCRS  A  Measurements of collagen layer thickness in Tsk/+ TCRS  A  mice (Fig. 6.1).  mice confirmed the  histological observations (Fig. 6.2) and suggested that the dermal collagen layer thickness of Tsk/+ TCR8  A  mice (n=9; 0.289 ± 0.024 mm) was comparable to both the thickness  observed in control C57B1/6 (n=4; 0.221 ± 0.019 mm) and TCRd  A  mice (n=ll; 0.263 ±  0.024 mm). Tsk/+ mice, in contrast, exhibited a ~2-fold enhanced dermal collagen layer thickness (n=8; 0.451 ± 0.023 mm) when compared with control C57B1/6, TCRd  A  and  Tsk/+ TCRS' animals, (p < 0.05, unpaired two-tailed Student's t-test). Thus, the absence A  of y8 T cells in Tsk/+ mice prevented excessive collagen deposition and development of dermal fibrosis.  -94  C57B1/6  TcrS-/-  Tsk/+  Tsk/+  FIG 6.1.  Tcrh-/-  Dermal collagen histology of Tsk/+ Tcr8-/- animals. Dermal sections from the dorsal region  of C57B1/6 control, Tsk/+, Tcrd-/- and Tsk/+ Tcr8-/- animals were removed as previously described and processed for routine histological analysis. Excessive collagen within the dermal layer was evidently diminished in Tsk/+ mice lacking yd T cells, to amounts comparable to that observed in both C57BL/6 control and TcrS-/- animals.  95  FIG.  6.2.  Dermal collagen thickness measurements of Tsk/+ Tcr5~'~ animals.  The statistical  determination of dermal collagen thickness was performed on dermal sections of C57B1/6 control, Tsk/+, Tcr5~/~ nd Tsk/+ Tcr8~^' animals. The dermal collagen thickness of Tsk/+ TcrS'^' animals was dramatically a  reduced to normal levels similarly observed in the dermal sections of C57B1/6 control and TcrS'^' mice. Multiple siteson each of three different skin sections cut perpendicular to the skin surface per mouse was performed as described previously (Ong et al., 1998). *p<0.05.  Abnormal pulmonary pathology observed in Tsk/+ TCRS'' mice Histological examination of lungs to assess the effect of yS T cell deficiency in Tsk/+ mice revealed no change in the emphysematous-like changes. Thus, distended lungs and dilated alveolar spaces were observed in both Tsk/+ and Tsk/+ TCRS'' mice, but were absent in control C57B1/6 and TCRS animals (Fig. 6.3), demonstrating that the A  lung disease process did not require the presence of y5 T cells.  C57BI/6  7cr8-/-  Tsk/+  FIG 6.3.  Tsk/+ Tcrd-/-  Pulmonary histology of Tsk/+ Tcrd-/- mice. Pulmonary architecture remains unchanged  in Tslc/+ TcrS-/- animals. Lung histology of Tsk/+ TcrS-/- animals displayed distorted emphysematous-like pulmonary structures as in Tsk/+ mice, suggesting the independence of lung pathological development on y5 T cell-mediated effects.  97  Suppression of both Thl- and Th2-associated cytokine production by CD4+ T cells from Tsk/+ TCRS'' mice To examine whether cytokine production by CD4+ T cells from Tsk/+ TCRS'' mice was altered, levels of IL-4 and IFN-y secretion as determined by E L I S A as well as by intracellular staining. Secreted IL-4 in the supernatants of stimulated CD4+ T cells from control C57B1/6 mice (114 ± 7 pg/mL) was similar to that of TCRS'' mice (189 ± 17 pg/mL), in comparison to the elevated levels observed from Tsk/+ mice (1026 ± 82 pg/mL) as depicted in Fig. 6.4A. By contrast, the deficiency of y8 T cells in Tsk/+ TCR8' '' mice resulted in a marked diminution in IL-4 production (243 ± 12 pg/mL). Similarly, IFN-y production was reduced in Tsk/+ TCRS'' mice (1765 ± 65 pg/mL), to levels comparable to control C57B1/6 (1955 ± 125 pg/mL) and TCR8'' mice (1800 ± 105 pg/mL) (Fig. 6.4B). This is strikingly different to the IFN-y levels generated by Tsk/+ mice (3405 ± 2 1 0 pg/mL) which displayed an approximately ~2-fold enhancement. Consistent with the E L I S A data, CD4+ cells positive for intracellular EL-4 and EFN-y in Tsk/+ TCRS''' mice were diminished (Fig. 6.5).  The percentage of polarized IL-4-  producing (6.38%) and EFN-y-producing cells (5.32%) in Tsk/+ TCR8'' mice resembled that of control C57B1/6 (IL-4, 5.06%; IFN-y, 8.67%) and TCRS'' (EL-4, 6.74%; IFN-y, 6.43%) mice.  Tsk/+ mice, on the other hand, generated increased IL-4-producing  (12.42%) as well as IFN-y-producing (13.75%) cells. These results suggest that a deficiency in y8 T cells alters the immune response in Tsk/+ mice by suppressing the production of both EL-4 and EFN-y cytokines. This cytokine alteration may, in turn, prevent the development of the immune-mediated dermal fibrotic disease in Tsk/+ TCRS' '' mice.  :.9S  A  1500  1200 H  C57B1/6  Tcr5-/-  Tsk/+  Tsk/+  TcrS-/-  FIG.  6.4.  IL-4 and IFN-y production by 7 W + TcrS^' CD4+ T cells. Suppression of IL-4  and IFN-y cytokine production in Tsk/+ Tcr5~^~ animals. Cytokine assay of supernatants from anti-CD3 stimulated populations of CD4+ T cells revealed diminished production of both IL-4 and IFN-y from 7 W + TcrS'^' mice compared with 7 W + animals. This suggests that y8 T cells may play a role in regulating the development and differentiation of CD4+ T cells and its effector functions in cytokine production in Tsk/+ mice.  .99  0'  j O' j  m *~ CUM  »  i  "  1 jiff tV(k\  tcr  FIG. 6.5.  6.38  2*1  ]  1  on  6.74  to'  icr  O  t nun  fe  j I Hill]  ft—»f—— 3r~~ d to io i<r tcr  tcr  ,  ,  u  IFN-gFITC  IFN-gFITC  TcrS-/-  Tsk7+ Tcr5-/-  icr  Intracellular cytokine staining of Tsk/+ Tcrd-A CD4+ T cells. Diminished IL-4 and IFN-y-  producing CD4+ T cells in Tsk/+ mice lacking y8 T cells. Intracellular cytokine-staining of stimulated CD4+ T cells from C57B1/6 control, Tsk/+, Tcrd-A and Tsk/+ Tcr5-/- animals demonstrated significantly reduced populations of both IL-4-producing and IFN-y-producing cells in Tsk/+ Tcr8-/- mice, consistent with E L I S A data on the supernatants.  100  6.3 Discussion The ability of a Tsk/+ CD4+ Th2 immune response to regulate the development of dermal fibrosis is suggested from the present study through the analysis of Tsk/+ animals deficient in Thl-promoting cytokines including IL-12 or IFN-y. Since IL-4 is essential in the development of a Th2-dominated immune response, a potential cellular source of IL-4 production, which may contribute to the Tsk/+ process, was investigated. Recently, a role for y8 T cells as immunoregulators controlling both innate and antigenspecific adaptive immune responses have been reported (Ferrick et al., 1995; Hayday and Geng, 1997; Wen and Hayday, 1997), likely mediated by the cytokines produced by yS T cells (Ferrick et al., 1995; Hayday and Geng, 1997). Thus, y8 T cells, when stimulated under certain conditions, possess the ability to produce robust amounts of cytokines such as IL-4 to ensure the establishment of an appropriate T-helper response.  It was  hypothesized that in the context of the Tsk/+ setting, y8 T cells would contribute to the development of a Th2-dominated immune response via IL-4 generation. Thus, in the absence of yS T cells, the generation of a Th2 cellular response would be impaired, thus leading to decreased dermal collagen production. Indeed, examination of dermal architecture from Tsk/+ TCR8 mice revealed A  normal skin pathology resembling that observed in both control C57B1/6 and TCR8  A  animals (Fig. 6.1). This is in marked contrast to the proportion of collagen deposition within the dermal layers present in Tsk/+ mice. This amelioration of dermal pathology may be related to the corresponding suppression in Th2-associated IL-4 production (Figs. 6.4 and 6.5) by CD4+ T cells in Tsk/+ TCRS mice. In contrast, the abnormal pulmonary A  aspect of the Tsk/+ disease remained unchanged in animals deficient in y8 T cells, further  101  confirming the notion that the mechanisms responsible for the dermal and pulmonary components of this disease can be dissociated. Thus, the absence of y5 T cells prevented the development of dermal fibrosis in Tsk/+ mice. These observations suggest that y8 T cells may be responsible for directing the differentiation of CD4+ T cells towards a predominantly Th2 response through its influence on IL-4 cytokine production. This would be consistent with the lack of skin pathology in Tsk/+ CD4~'~ animals (Wallace et al., 1994) since the "crosstalk" between y 8 T cells and CD4+ cc|3T cells would be abrogated. Recently, y8 T cell clones have been phenotypically characterized using the Thl/Th2 classification scheme and this may suggest that a specialized subset of yS Th2like cells may be responsible for the development of the Tsk/+ disease (Wen et al., 1998). Interestingly, CD4 expression is a strong correlate of Th2-like y8 cell activity and may contribute to Th2 commitment (Wen et al., 1998; Yamashita et al., 1999). There is emerging evidence for the presence of a y8 subset of cells that coexpress the CD4+ surface marker and these cells have been demonstrated to generate robust amounts of IL4  (Wen  et  al.,  1998),  which  may  be  involved  in  influencing  the  differentition of Th2 lineage. Consequely, the lack of skin pathology observed in Tsk/+ CD4"'' mice may be the due to the loss of CD4+ yS T cells which possess Th2-like activity and are responsible for the early IL-4 generation. Alternatively, the presence of yS T cells within epithelial surfaces (Hayday, 2000) and in particular, the skin, makes them attractive candidates for playing a direct role in regulating dermal collagen production via production of cytokines. In this scenario, yS T cell-derived EL-4 may act directly to induce collagen production by surrounding dermal fibroblasts in the course of their response to some unknown antigenic stimulus.  ...102  It was shown that y8 T cell activation may require more than stimulation through the T cell antigen receptor, and that costimulatory signals mediated by the vitronectin receptor may play an important role (Lynch and Shevach, 1992; Roberts et al., 1991). The vitronectin receptor, also known as the alphaVbeta3 (aVP3) integrin, is expressed on a wide variety of cell types and is capable of interacting with fibrillin as a cell surface receptor (Horton, 1997; Schvartz et al., 1999). Within the hemopoietic system, this receptor is present, and has been shown a have a functional role in macrophages, osteoclasts, dendritic cells, thymocytes and T-cells, cytotoxic T cells, N K cells B cells as well as y8 T cells (Roberts et al., 1991). The vitronectin receptor, which is able to associate into focal contacts, is able to mediate cell attachment and spreading on fibrillin1, phenomena that are indicative of an interaction with the cytoskeleton. Binding of fibrillin to this receptor seems to be largely mediated by the RGD-containing region of fibrillin as antibodies against the R G D sequence was able to inhibit binding (Pfaff et al., 1996). The possibility that the mutant fibrillin protein in Tsk/+ mice may regulate immune responses is another proposed mechanism underlying the pathogenesis of this disease. Indeed, tandem duplication observed in the Tsk/+ mutant Fbn-1 gene results in a molecule with two R G D motifs, a sequence within fibrillin shown to be an integrin binding site.  Interestingly, there is evidence that extracellular matrix molecules  containing R G D motifs, such as laminin and fibronectin, may be critical to murine Thelper cell activation, differentiation, and cytokine production (Pfaff et al., 1996). It is thus conceivable that matrix microfibrils containing the abnormal fibrillin-1 protein may  •103  serve as antigenic stimuli that can activate y8 T cells, via the costimulatory vitronectin receptor, in a Th2-dependent manner, leading to the development of fibrosis. In addition, y8 T cells may act as growth-factor producing cells, maintaining epithelial integrity through their production of fiboblast growth factor V U (keratinocyte growth factor-KGF) (Boismenu and Havran, 1994). Thus, it is possible that yS cells may operate to influence not only CD4+ Th2 differentiation, but also activation of the vitronectin receptor may induce y8 T cells to produce fibroblast growth factors, which themselves might regulate dermal fibrosis in Tsk/+ mice. In support of a regulatory role for yS T cells in the human condition, an accumulation of this subset of T cells in scleroderma skin and lungs has been reported (Giacomelli et al., 1998; Yurovsky et al., 1994), suggesting that these cells may play an significant role in both the mice and humans. Recently, it has been suggested that the expansion of y8 T cells (or at least a subset thereof) in vivo depends upon the activity of a|3 T cells. This effect appears to be mediated via the secretion of lymphokines by CD4+ cells and in particular, IL-4 generated from the CD4+ cells of the Th2 subtype (Rosat et al., 1995). Inasmuch as CD4- CD8- a(3+ NK1.1 cells have been shown to produce significant levels of IL-4 upon T C R crosslinking, it is possible that Th2-type cytokines produced by these cells account for the failure of CD4+ T-cell depletion to completely abrogate expansion of these cells. These results are supported by studies in vitro on growth requirements of y8 T cells. For example, it has been shown that exogenous cytokines, receptor ligation, and priming in vivo were necessary for the expansion of avian peripheral y8+ T cells isolated from Listeria-infected mice (Hayday and Geng, 1997). Furthermore, IL-4 is known to drive  104  immature double-negative thymocytes toward the y8+ phenotype (Hayday, 2000). These observations suggest that, initially, activation of y8 T cells may be required for establishing CD4+ Th2 cell development in Tsk/+ mice. The maintenance of a skewed T-helper 2 response, can in turn, positively regulate the subsequent expansion of y5 T cells, thus perpetuating the cycle and perhaps, the severity of the dermal fibrotic disease. The implications of an in vivo y8 T cell involvement in promoting CD4+ Th2 development in Tsk/+ animals and given the parallels with respect to the potential role of Th2 cells in the pathogenesis of scleroderma (D'Elios et al., 1997; Mavalia et al., 1997) as well as Ts^-associated dermal fibrosis, manipulation of y8 T cell function on Th2 cell differentiation might be of potential therapeutic utility in the human disease.  •105  CHAPTER 7  Summary and Future Directions The development of an appropriate immune response against specific antigens can be efficiently directed by functionally distinct subsets within the immune system. In particular, activation of the CD4+ subset of T cells is crucial for the establishment of cellular-mediated immune responses in the eradication of certain pathogens including Leishmania and allergens. This is effectively mediated by the generation of polarized subsets of CD4+ T-helper cells into T h l and Th2 cells respectively, a process that is critically dependent on the cytokines present in the local microenvironmental. A pivotal role for IL-12 has been established in the development of T h l immune responses while IL-4 appears to be critically involved in Th2 cell generation.  The Thl/Th2 concept  suggests that modulation of relative contributions of T h l - or Th2-type cytokines can regulate the balance between protection and immunopathology, as well as the development and/or the severity of some immunologic disorders, including scleroderma. This thesis focuses on highlighting the contribution of immunoregulation to the development of dermal fibrosis in Tsk/+ mutant mice, an experimental model of scleroderma. Interestingly, in both species, the immune system appears to play a role in disease pathogenesis and development. This work has provided evidence of a role for CD4+ T-helper 2 subset of immune cells in the regulation of dermal disease development in Tsk/+ mice, findings which provide further insight into the understanding of the  106  pathogenesis of scleroderma which may be potentially useful in the design of drugs for therapeutic intervention.  7.1  Regulation of dermal fibrosis by IL-4 in Tsk/+ mice CD4+ T-helper cells had been previously demonstrated to play an essential role in  the regulation of excessive dermal collagen deposition as a marked reduction in dermal fibrosis was observed in Tsk/+ mice deficient in CD4+ T cells. These results indicate that the complex interplay of different cell types may be required for the subcutaneous fibrosis to occur. Here, further evidence is provided to support the role of CD4+ T-helper cells in the fibrotic process by identifying the importance for IL-4-secreting CD4+ Thelper 2 cells in altering the immune response and consequently, in regulating dermal fibrosis in Tsk/+ animals. As IL-4, a product of differentiated CD4+ T-helper 2 cells, is capable of regulating the synthesis of various matrix molecules, including type I collagen, by fibroblasts in vitro, the potential role of IL-4 in mediating Tsk/+ dermal fibrosis was investigated. Confirming that Tsk/+ fibroblast cells are capable of responding to EL-4, receptors for this cytokine were detectable on both Tsk/+ embryonic and dermal fibroblast cell lines derived from these mice. Furthermore, IL-4 receptors on Tsk/+ fibroblasts were functional since IL-4 stimulation in vitro increased type I collagen secretion from these cells. These in vitro studies demonstrated the potential for EL-4 to be directly involved in the excessive deposition of collagen in Tsk/+ mice. Critical insight into the role played by IL-4 in mediating the dermal phenotype was obtained following the administration of neutralizing anti-IL-4 antibodies to Tsk/+ mice. This  i  .107  treatment prevented the development of dermal fibrosis, leading to normalization of dermal collagen content.  Given the requirement for CD4+ T cells in Tsk/+ dermal  fibrosis and the ability of the CD4+ Th2 subset to generate large amounts of IL-4, these results suggest that Th2 cells and/or factors elaborated by this T cell subset, including EL4, may play a key role in regulating dermal collagen content in Tsk/+ mutant mice. To further validate this hypothesis, the effect of skewing the immune response towards one dominated by CD4+ Th2 cell activity on the development of dermal disease was evaluated in Tsk/+ animals.  7.2  Inhibition of CD4+ Thl T-cell development will augment Th2  immune responses that appear to be responsible for the enhanced dermal fibrosis in Tsk/+ mice The development of CD4+ T cell immune responses can be classified into two functionally polarized responses mediated by either the CD4+ T h l or the Th2 subset of cells. A number of factors are responsible for the polarization of specific immune responses into predominant T h l or Th2 profile, however, the cytokine environment of the local milieu appears to contribute significantly to the development of polarized Th subsets. A pivotal role for IL-12 and IFN-y has been established in the development of T h l immune responses while IL-4 appears to be critically involved in Th2 cell generation. As previous studies revealed an important role for CD4+ Th2 cells and its elaborated cytokines, in particular IL-4, in regulating the development and progression of dermal fibrosis in Tsk/+ animals, the consequences of inducing an enhanced Th2 immune  ,:408  response on dermal fibrosis was evaluated. We provide further evidence for a role of CD4+ Th2 cells in regulating the development of Tsk/+ dermal fibrosis as both Tsk/+ IL12''' and Tsk/+ IFN-y'' mice demonstrated a significant exacerbation in dermal collagen layer thickness which correlated with an augmented generation of polarized Th2 cells and activity.  Given the significant roles that IL-12 and IFN-y play in regulating T h l  commitment, IL-12 or IFN-y deficiency would be predicted to hinder T h l cell development with a compensatory increase in the magnitude of the putative pathogenic Th2 immune response responsible for dermal fibrosis. Indeed, the increased degree of dermal fibrosis observed in Tsk/+ animals lacking either IL-12 or IFN-y appeared to be mediated by an increased recruitment of CD4+ T-cells into the Th2 developmental pathway, a diminished inhibitory effect of Thl-derived cytokines on emerging Th2 responses, or a combination of both. These studies further suggest a pivotal role played by CD4+ Th2 cells in the mediating the fibrotic disease development in Tsk/+ mutant animals.  Since IL-4 is essential in the differentiation and development of a Th2-  dominated immune response, the cellular source of initial EL-4 production was evaluated.  7.3  Role of yS T cells in the regulation of CD4+ Thl immune response in Tsk/+ mice A diverse number of cell types are capable of generating the "early EL-4" required  for the differentiation of naive CD4+ ThO cells into the Th2 lineage, including y8 T cells. Activated y8 T cells have been documented to accumulate within the dermal regions of scleroderma patients that are oligoclonally expanded, suggesting this process'may be antigen-driven (Yurovsky et al., 1994). Recently, a role for y5 T cells as important  '109  immunoregulators controlling both innate and antigen-specific adaptive immune response has been reported, likely to be mediated by the cytokines produced by these cells which may influence the differentiation of CD4+ T-helper cells. Specifically, y8 T cells are capable of producing robust amounts of IL-4 when stimulated under certain conditions that can influence the differentiation and development of CD4+ ThO cells into the Th2 lineage. Thus, y5 T cells may contribute to the establishment of the Th2-dominated immune response through its generation of IL-4, which may result in the development of dermal fibrosis in Tsk/+ mice. Analysis of Tsk/+ TcrS"'" mice revealed a novel role for yS T cells in the regulation of fibrotic pathology as the absence of these cells prevented dermal fibrosis in these animals. This was associated with an alteration in the cytokine profile generated by CD4+ T cells, suggesting that the absence of y5 T cell influences may prevent the development of this immune-mediated dermal fibrotic disease. The implications for an in vivo y8 T cell role in promoting Th2 development in Tsk/+ animals suggests that this disease may be mediated by a Th2-dominated immune influences. These results also demonstrate the unique interaction between cells of the innate and adaptive immune system in the regulation of a disease process.  110  7.4  Pathogenesis of Tsk/+ dermalfibroticprocess - A model In summary, the work generated in this thesis has led to the identification of a  crucial role for CD4+ Th2 cells in regulating the development of dermal fibrosis in the Tsk/+ mutant model of human scleroderma. Specifically, the analysis of both the in vitro and in vivo contributions of the Th2 subset of immune cells mediated by their cytokine production, in modulating dermal collagen deposition strongly suggests a pivotal role for this subset in the development of fibrotic diseases, including scleroderma. It has become clear that IL-4 plays a important role not only in eliciting the downstream effector functions of Th2 cells including the induction of collagen synthesis by target fibroblast cells, but is also a requisite factor involved in driving the differentiation of naive CD4+ T cells into the Th2 lineage (Fig. 7.1). Moreover, the emergence of a Th2-dominated immune response in Tsk/+ mice appears to be influenced by the presence of yd T cells, a subset of T cells possessing innate immune properties including the ability to recognize antigens independent of antigen-presenting cells. A model for the contributions of CD4+ Th2 cells in this disease process is presented in Figure 7.1.  Indeed, the human disease has been recently  suggested to conform to a classical Th2-type disease phentoype since elevated levels of Th2 cells and their activity appear to dominate within scleroderma patients. Thus, the regulation of dermal fibrosis by the 7 W + immune system serves as a fitting model to parallel events that may be occurring in the human disease. Several interesting questions arise from the work presented in this thesis. The description for a role of CD4+ Th2 cells presented here in the establishment of the fibrotic disease has been attributed to the actions of the cytokines elaborated by this  111  FIG. 7.1.  Model of CD4+  Th2 cell involvement  in the development of dermal fibrosis in Tsk/+  mice. The development of dermal fibrosis in Tsk/+ mice appears to require the presence of a dominantly  CD4+ Th2 immune response mediated primarily  through the actions of  EL-4. EL-4 is not  only a requisite factor in the differentiaition and development of Th2 effector cells but can also exert potent fibrotic influences on collagen production by fibroblast cells, thus suggesting a dual mechanism for EL-4 in the development of Tsk/+ dermal fibrosis. The identification of a role for y8 T cells in the regulation of this disease process may be due to its capacitiy to generate large amounts of "early EL-4" during the initial primary immune response. It is interesting to speculate the "antigens" which may be involved in eliciting the specific Tsk/+ immune response, including Tsk/+ mutant fibrillin (Fbn-1) as a potential candidate target  subset, in particular, IL-4. As IL-13 shares many similar properties with IL-4 with overlapping functions and is also a Th2-cell derived cytokine itself, it would be interesting to investigate the contributions of this latter cytokine to the disease process and to assess whether any redundancy in immune contributions occur. Thus, it would be  -'112  beneficial to study the effects of IL-13 deficiency or IL-4/IL-13 deficienty on the development of dermal fibrosis in Tsk/+ animals to assess the redundant roles of these two cytokines. In addition, the novel role for yd T cells in regulating CD4+ Th2 cell differentiation in Tsk/+ mice via its ability to generate large amounts of early IL-4 leads to questions on the possible antigens responsible for eliciting the Tsk/+ immune response. One probable candidate antigen is the mutant fibrillin-1 molecule found to be associated with the Tsk/+ mutation since the abnormal Tsk/+ fibrillin-1 is incorporated into microfibrils along with the normal Fbn-1 protein, suggesting that some of the phenotypic alterations in Tsk/+ mice may arise because the mutant protein alters microfibril assembly, structure, function, and/or degradation.  As Tsk/+ mice also produce  autoantibodies to the abnormal fibrillin-1 protein, the mutant Fbn-1 molecule may serve as a self-antigen in these animals that can be recognized by yd T cells residing within the skin regions. This may led to activation of yd T cells or specific subset of yd T cells and the subsequent differentiation and establishment of a Th2 immune response.  This  hypothesis can be tested with a transgenic model expressing Tsk Fbn-1 and assessing whether fibrosis can be generated under the influence of this mutant protein. Furthermore, the consequences of inhibiting Tsk Fbn-1 interactions using blocking antibodies on the immune response and subsequently, dermal fibrosis, will allow a better understanding of the importance of this protein in the development of this disease. Interestingly, serum autoantibodies to fibrillin 1 have recently been reported in patients with systemic sclerosis, but not in patients with other connective tissue diseases, suggesting that a potential parallel mechanism of fibrotic disease development may exist in humans.  Thus, identification of the antigen(s) involved in activating the Tsk/+  «3  immune system will allow a better understanding of the mechanisms underlying the pathogenesis of this disease in both mouse and humans.  114  CHAPTER 8 References  Abbas, A . K . , Murphy, K . M . , and Sher, A . (1996). Functional diversity of helper T lymphocytes. Nature 383, 787-793.  Adorini, L . (1999). Interleukin-12, a key cytokine in Thl-mediated autoimmune diseases. Cell M o l Life Sci 55, 1610-25.  Afonso, L . C , Scharton, T. M . , Vieira, L . Q., Wysocka, M . , Trinchieri, G., and Scott, P. (1994). The adjuvant effect of interleukin-12 in a vaccine against Leishmania major. Science 263, 235-237.  Aguet, M . (1990). The interferon-gamma receptor: a comparison with other cytokine receptors. J Interferon Res 10, 551-8.  Akiba, H., Miyahira, Y . , Atsuta, M . , Takeda, K., Nohara, C , Futagawa, T., Matsuda, H . , Aoki, T., Yagita, H., and Okumura, K . (2000). Critical contribution of OX40 ligand to T helper cell type 2 differentiation in experimental leishmaniasis. J Exp Med 191, 375-380.  Annunziato, F., Cosmi, L . , Galli, G., Beltrame, C , Romagnani, P., Maneti, R., Romagnani, S., and Maggi, E. (1999). Assessment of chemokine receptor expression by human T h l and Th2 cells in vitro and in vivo. J Leukoc Biol 65, 691-699.  Arnett, F. C , Reveille, J. D., Goldstein, R., Pollard, K . M . , Leaird, K . , Smith, E . A . , Leroy, E. C , and Fritzler, M . J. (1996). Autoantibodies to fibrillarin in systemic sclerosis (scleroderma). A n immunogenetic, serologic, and clinical analysis. Arthritis Rheum 39, 1151-1160.  Arnett, F. C , Tan, F. K., Uziel, Y . , Laxer, R. M . , Krafchik, B . R., Antohi, S., and Bona, C. (1999). Autoantibodies to the extracellular matrix microfibrillar protein, fibrillin 1, in patients with localized scleroderma [In Process Citation]. Arthritis Rheum 42, 2656-9.  Aste-Amezaga, M . , D'Andrea, A., Kubin, M . , and Trinchieri, G . (1994). Cooperation of natural killer cell stimulatory factor/interleukin 12 with other stimuli in the induction of cytokines and cytotoxic cell-associated molecules in human T and N K cells. Cell Immunol 156, 480-492.  Bach, E . A . , Aguet, M . , and Schreiber, R. D . (1997). The I F N gamma receptor: a paradigm for cytokine receptor signaling. Annu Rev Immunol 15, 563-91.  Bancroft, A . J., McKenzie, A . N . , and Grencis, R. K . (1998). A critical role for IL-13 in resistance to intestinal nematode infection. J Immunol 160, 3453-61.  Barcena, A . , Sanchez, M . J., de la Pompa, J. L . , Toribio, M . L . , Kroemer, G . , and Martinez, A . C. (1991). Involvement of the interleukin 4 pathway in the generation of functional gamma delta T cells from human pro-T cells. Proc Natl Acad Sci U S A 88, 7689-93.  Barnett, A . J., Tait, B . D., Barnett, M . A . , and Toh, B . H . (1989). T lymphocyte subset abnormalities and H L A antigens in scleroderma (systemic sclerosis). Clin Exp Immunol 76, 24-29.  Bashey, R. I., Philips, N . , Insinga, F., and Jimenez, S. A . (1993). Increased collagen synthesis and increased content of type V I collagen in myocardium of tight skin mice. Cardiovasc Res 27, 1061-5.  Bennett, B . L . , Cruz, R., Lacson, R. G., and M . , M . A . (1997). Interleukin-4 suppression of tumor necrosis factor alpha-stimulated E-selectin gene transcription is mediated by STAT-6 antagonism of NF-kappaB. J Biol Chem 272, 10212-10219.  Bhan, A . K., Mizoguchi, E., Smith, R. N . , and Mizoguchi, A . (1999). Colitis in transgenic and knockout animals as models of human inflammatory bowel disease. Immunol Rev 169, 195-207.  .1.17  Billiau, A . , Heremans, H . , Vermeire, K . , and Matthys, P. (1998). Immunomodulatory properties of interferon-gamma. A n update. Ann N Y Acad Sci 856, 22-32.  Biron, C. A . , Nguyen, K . B . , Pien, G . C., Cousens, L . P., and Salazar-Mather, T. P. (1999). Natural killer cells in antiviral defense: function and regulation by innate cytokines. Annu Rev Immunol 17, 189-220.  Blazar, B . R., Korngold, R., and Vallera, D . A . (1997). Recent advances in graft-versushost disease (GVHD) prevention. Immunol Rev 157, 79-109.  Bocchieri, M . H., Henriksen, P. D., Kasturi, K . N . , Muryoi, T., Bona, C. A . , and Jimenez, S. A . (1991). Evidence for autoimmunity in the tight skin mouse model of systemic sclerosis. Arthritis Rheum 34, 599-605.  Boehm, U . , Klamp, T., Groot, M . , and Howard, J. C. (1997). Cellular responses to interferon-gamma. Annu Rev Immunol 15, 749-795.  Boismenu, R., and Havran, W. L . (1994). Modulation of epithelial cell growth by intraepithelial gamma delta T cells. Science 2(5(5, 1253-1255.  Bonecchi, R., Bianchi, G., Bordignon, P. P., D'Ambrosio, D . , Lang, R., Borsatti, A . , Sozzani, S., Allavena, P., Gray, P. A . , Mantovani, A . , and Sinigaglia, F. (1998).  Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (This) and (Th2s). J Exp Med 1871, 129-134.  Boros, D. L . , and Whitfield, J. R. (1999). Enhanced T h l and dampened Th2 responses synergize to inhibit acute granulomatous and fibrotic responses in murine schistosomiasis mansoni. Infect Immun 67, 1187-1193.  Buckingham, R. B . , Prince, R. K . , Rodnan, G . P., and Taylor, F. (1978). Increased collagen accumulation in dermal fibroblast cultures from patients with progressive systemic sclerosis (scleroderma). J Lab Clin Med 92, 5-21.  Carballido, J. M . , Schols, D., Namikawa, R., Zurawski, S., Zurawski, G . , Roncarolo, M . G., and de Vries, J. E . (1995). IL-4 induces human B cell maturation and IgE synthesis in SCED-hu mice. Inhibition of ongoing IgE production by in vivo treatment with an IL4/IL-13 receptor antagonist. J Immunol 155,4162-70.  Chapman, D . , and Eghbali, M . (1990). Expression of fibrillar types I and III and basement membrane collagen type I V genes in myocardium of tight skin mouse. Cardiovasc Res 24, 578-83.  Chaturvedi, P., Y u , Q., Southwood, S., Sette, A., and Singh, B . (1996). Peptide analogs with different affinities for M H C alter the cytokine profile of T helper cells. Int Immunol 8, 745-755.  119  Cheever, A . W., Finkelman, F. D., and Cox, T. M . (1995). Anti-interleukin-4 treatment diminishes secretion of Th2 cytokines and inhibits hepatic fibrosis in murine schistosomiasis japonica. Parasite Immunol 17, 103-9.  Cheever, A . W., Williams, M . E., Wynn, T. A., Finkelman, F. D., Seder, R. A., Cox, T. M . , Hieny, S., Caspar, P., and Sher, A . (1994). Anti-IL-4 treatment of Schistosoma mansoni-infected mice inhibits development of T-cells and non-B, non-T cells expressing Th2 cytokines while decreasing egg-induced hepatic fibrosis. J Immunol 153, 753-759.  Chen, H . J., and Paul, W. E. (1997). Cultured NK1.1(+)CD4(+) T cells produce large amounts of IL-4 and IFN-gamma upon activation by anti-CD3 or C D 1 . J Immunol 159, 2240-2249.  Chiaramonte, M . G., Donaldson, D . D., Cheever, A . W., and Wynn, T. A . (1999). A n IL13 inhibitor blocks the development of hepatic fibrosis during a T-helper type 2dominated inflammatory response. J Clin Invest 104, 777-85.  Chomarat, P., and Banchereau, J. (1998). Interleukin-4 and interleukin-13: their similarities and discrepancies. Int Rev Immunol 17, 1-52.  Cleary, E . G . , and Gibson, M . A . (1983). Elastin-associated microfibrils and microfibrillar proteins. Int Rev Connect Tissue Res 10, 97-209.  Coffman, R. L., Ohara, J., Bond, M . W., Carry, J., Zlotnik, A., and Paul, W. E. (1986). B cell stimulatory factor-1 enhances the IgE response of lipopolysaccharide-activated B cells. J Immunol 136, 4538-4541.  Constant, S. L . , and Bottomly, K . (1997). Induction of T h l and Th2 CD4+ T cell responses: the alternative approaches. Annu Rev Immunol 15, 297-322.  Croft, M . , and Swain, S. L . (1992). Analysis of CD4+ T cells that provide contactdependent bystander help to B cells. J Immunol 149, 3157-3165.  DElios, M . M . , Romagnani, P., Scaletti, C , Annunziato, F., Manghetti, M . , Mavilia, C , Parronchi, P., Pupilli, C , Pizzolo, G., Maggi, E., Del Prete, G . F., and Romagnani, S. (1997). In vivo CD30 expression in human diseases with predominant activation of Th2like T cells. J Leukoc Biol 61, 539-44.  Dancescu, M . , Rubio-Trujillo, M . , Biron, G., Bron, D., Delespesse, G., and Sarfati, M . (1992). Interleukin 4 protects chronic lymphocytic leukemic B cells from death by apoptosis and upregulates Bcl-2 expression. J Exp Med 176, 1319-1326.  Darnell, J. E . , Jr., Kerr, I. M . , and Stark, G . R. (1994). Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264, 1415-21.  ,1421  de Vries, J. E., Carballido, J. M . , and Aversa, G . (1999). Receptors and cytokines involved in allergic TH2 cell responses. J Allergy Clin Immunol 103, S492-6.  de Waal Malefyt, R. (1997). The role of type I interferons in the differentiation and function of T h l and Th2 cells. Semin Oncol 24, S9-94-S9-98.  Defrance, T., Aubry, J. P., Rousset, F., Vanbervliet, B . , Bonnefoy, J. Y . , Arai, N . , Takebe, Y . , Yokota, T., Lee, F., Aria, K . , and al, e. (1987). human recombinant interleukin 4 induces Fc epsilon receptors (CD23) on normal human B lymphocytes. J Exp Med 755, 1459-1467.  Del Prete, G. (1998). The concept of type-1 and type-2 helper T cells and their cytokines in humans. Int Rev Iinmunol 16, 427-55.  Del Prete, G., Maggi, E., Pizzolo, G., and Romagnani, S. (1995). CD30, Th2 cytokines and HIV infection: a complex and fascinating link. Immunol Today 16, 76-80.  DiMolfetto, L . , Neal, H . A . , Wu, A . , Reilly, C , and L o , D . (1998). The density of the class II M H C T cell receptor ligand influences IFN-gamma/IL-4 ratios in immune responses in vivo. Cell Immunol 183, 70-79.  •122  Dinarello, C. A . (1999). IL-18: A TH1-inducing, proinflammatory cytokine and new member of the JJL-1 family. J Allergy Clin Immunol 103, 11-24.  Dinarello, C. A . (1999). Interleukin-18. Methods 19, 121-32.  Dinarello, C. A . , Novick, D., Puren, A . J., Fantuzzi, G., Shapiro, L . , Muhl, H . , Yoon, D . Y., Reznikov, L . L . , Kim, S. H . , and Rubinstein, M . (1998). Overview of interleukin-18: more than an interferon-gamma inducing factor. J Leukoc Biol 63, 658-64.  Dorner, R. W., Osborn, T. G., and Ross, S. C. (1987). Glycosaminoglycan composition of tight skin and control mouse skins. J Rheumatol 14, 295-8.  Doute, R. C , and Clark, S. H . (1994). Tight-skin (Tsk) maps on mouse chromosome 2 within the region of linkage homology with human chromosome 15. Genomics 22, 223-5.  Druet, P., Sheela, R., and Pelletier, L . (1995). T h l and Th2 cells in autoimmunity. Clin Exp Immunol 101 Suppl 2, 9-12.  Else, K . J., and Finkelman, F. D . (1998). Intestinal nematode parasites, cytokines and effector mechanisms. Int J Parasitol 28, 1145-58.  •1,23  Emson, C. L . , Bell, S. E . , Jones, A . , Wisden, W., and McKenzie, A . N . (1998). Interleukin (IL)-4-independent induction of immunoglobulin (Ig)E, and perturbation of T cell development in transgenic mice expressing IL-13. J Exp Med 188, 399-404.  Erb, K . J., Ruger, B . , von Brevern, M . , Ryffel, B . , Schimpl, A . , and Rivett, K . (1997). Constitutive expression of interleukin (IL)-4 in vivo causes autoimmune-type disorders in mice. J Exp Med 185, 329-339.  Esterly, N . B . (1971). The stiff skin syndrome. Birth Defects Orig Artie Ser 7, 306-8.  Everett, E . T., Pablos, J. L . , Harley, R. A . , LeRoy, E . C , and Norris, J. S. (1995). The role of mast cells in the development of skin fibrosis in tight- skin mutant mice. Comp Biochem Physiol A Physiol 110, 159-65.  Everett, E . T., Pablos, J. L . , Harris, S. E . , LeRoy, E . C , and Norris, J. S. (1994). The tight-skin (Tsk) mutation is closely linked to B2m on mouse chromosome 2. Mamm Genome 5, 55-7.  Fallon, P. G . , Richardson, E . J., McKenzie, G . J., and McKenzie, A . N . (2000). Schistosome infection of transgenic mice defines distinct and contrasting pathogenic roles for EL-4 and EL-13: EL-13 is a profibrotic agent. J Immunol 164, 2585-91.  • 124  Ferrick, D . A., Schrenzel, M . D., Mulvania, T., Hsieh, B., Ferlin, W. G., and Lepper, H . (1995). Differential production of interferon-gamma and interleukin-4 in response to T h l - and Th2-stimulating pathogens by gamma delta T cells in vivo. Nature 373, 255-7.  Fertin, C , Nicolas, J. F., Gillery, P., Kalis, B., Banchereau, J., and Maquart, F. X . (1991). Interleukin-4 stimulates collagen synthesis by normal and scleroderma fibroblasts in dermal equivalents. Cell Mol Biol 37, 823-9.  Finkelman, F. D . (1995). Relationships among antigen presentation, cytokines, immune deviation, and autoimmune disease. J Exp Med 182, 279-282.  Firestein, G . S., Roeder, W. D., Laxer, J. A., Townsend, K . S., Weaver, C. T., Horn, J. T., Linton, J., Torbett, B . E . , and Glasebrook, A . L . (1989). A new murine CD4+ T cell subset with an unrestricted cytokine profile. J Immunol 143, 518-525.  Fujiwara, H . , Hanissian, S. H . , Tsytsykova, A . , and Geha, R. S. (1997). Homodimerization of the human interleukin 4 receptor alpha chain induces Cepsilon germline transcripts in B cells in the absence of the interleukin 2 receptor gamma chain. Proc Natl Acad Sci U S A 94, 5866-5871.  Furukawa, F. (1997). Animal models of cutaneous lupus erythematosus and lupus erythematosus photosensitivity. Lupus 6, 193-202.  125  Gagro, A . , and Gordon, J. (1999). The interplay between T helper subset cytokines and IL-12 in directing human B lymphocyte differentiation. Eur J Immunol 29, 3369-79.  Gardi, C , Martorana, P. A., de Santi, M . M . , van Even, P., and Lungarella, G. (1989). A biochemical and morphological investigation of the early development of genetic emphysema in tight-skin mice. Exp Mol Pathol 50, 398-410.  Gascan, H . , Gauchat, J. F., Roncarolo, M . G., Yssel, H . , Spits, H . , and de Vries, J. E . (1991). Human B cell clones can be induced to proliferate and to switch to IgE and IgG4 synthesis by interleukin 4 and a signal provided by activated CD4+ T cell clones. J Exp Med 173, 747-750.  Gately, M . K . , Renzetti, L . M . , Magram, J., Stern, A . S., Adorini, L . , Gubler, U . , and Presky, D. H . (1998). The interleukin-12/interleukin-12-receptor system: Role in normal and pathologic immune responses. Annu Rev Immunol 16,495-521.  Gattei, V., Degan, M . , Rossi, F. M . , de Iuliis, A., Mazzocco, F. T., Serraino, D., Zagonel, V., Aldinucci, D., and Pinto, A . (1999). CD30 ligand (CD30L)-expressing acute myeloid leukemias: a new model of paracrine interactions for the regulation of blast cells proliferation. Leuk Lymphoma 35, 21-35.  ,126  Gause, W. C , Ekkens, M . , Nguyen, D., Mitro, V . , Liu, Q., Finkelman, F. D., Greenwald, R. J., and Urban, J. F. (1999). The development of CD4+ T effector cells during the type 2 immune response. Immunol Res 20, 55-65.  Gazzinelli, R. T., Heiny, S., Wynn, T. A., Wolf, S., and Sher, A . (1993). Interleukin-12 is required fo the T-lymphocyte-independent induction of interferon gamma by an intracellular parasite and induces resistance in T-cell-deficient hosts. Proc Natl Acad Sci U S A 90,6115-6119.  Gemmell, E., and Seymour, G. J. (1994). Cytokines and T cell switching. Crit Rev Oral Biol Med 5, 249-79.  Gerber, B . O., Zanni, M . P., Uguccioni, M . , Loetscher, M . , Mackay, C. R., Pichler, W. J., Yawalkar, N . , Baggiolini, M . , and Moser, B . (1997). Functional expression of the eotaxin receptor CCR3 in T lymphocytes co-localizing with eosinophils. Curr Biol 7, 836-843.  Germann, T., and Rude, E. (1995). Interleukin-12. Int Arch Allergy Immunol 108, 10312.  Giacomelli, R., Cipriani, P., Lattanzio, R., D i Franco, M . , Locanto, M . , Parzanese, I., Passacantando, A . , Ciocci, A . , and Tonietti, G . (1997). Circulating levels of soluble CD30 are increased in patients with systemic sclerosis (SSc) and correlate with serological and clinical features of the disease. Clin Exp Immunol 108, 42-6.  -rl27  Giacomelli, R., Matucci-Cerinic, M . , Cipriani, P., Ghersetich, I., Lattanzio, R., Pavan, A., Pignone, A . , Cagnoni, M . L . , Lotti, T., and Tonietti, G. (1998). Circulating Vdeltal+ T cells are activated and accumulate in the skin of systemic sclerosis patients. Arthritis Rheum 47,327-34.  Gillery, P., Fertin, C , Nicolas, J. F., Chastang, F., Kalis, B., Banchereau, J., and Maquart, F. X . (1992). Interleukin-4 stimulates collagen gene expression in human fibroblast monolayer cultures. Potential role in fibrosis. FEBS Lett 302, 231-4.  Goldstein, C , Liaw, P., Jimenez, S. A., Buchberg, A . M . , and Siracusa, L . D . (1994). Of mice and Marfan: genetic linkage analyses of the fibrillin genes, F b n l and Fbn2, in the mouse genome. Mamm Genome 5, 696-700.  Gollob, J. A . , Kawasaki, H . , and Ritz, J. (1997). Interferon-gamma and interleukin-4 regulate T cell interleukin-12 responsiveness through the differential modulation of highaffinity interleukin-12 receptor expression. Eur J Immunol 27, 647-52.  Gorczynski, R. M . , Chen, Z., Hoang, Y . , and Rossi-Bergman, B . (1996). A subset of gamma delta T-cell receptor-positive cells produce T-helper type-2 cytokines and regulate  mouse  skin graft  rejection  following  preimmunization. Immunology 87, 381-9.  j!28  portal venous  pretransplant  Granstein, R. D . , Flotte, T. J., and Amento, E . P. (1990). Interferons and collagen production. J Invest Dermatol 95, 75S-80S.  Green, M . C., Sweet, H . O., and Bunker, L . E. (1976). Tight-skin, a new mutation of the mouse causing excessive growth of connective tissue and skeleton. A m J Pathol 82, 493512.  Greenfield, E. A., Nguyen, K . A., and Kuchroo, V . K . (1998). CD28/B7 costimulation: a review. Crit Rev Immunol 18, 389-418.  Haas, H., Falcone, F. H., Holland, M . J., Schramm, G., Haisch, K., Gibbs, B . F., Bufe, A., and Schlaak, M . (1999). Early interleukin-4: its role in the switch towards a Th2 response and IgE-mediated allergy. Int Arch Allergy Immunol 119, 86-94.  Harris, N . L., and Ronchese, F. (1999). The role of B7 costimulation in T-cell immunity. Immunol Cell Biol 77, 304-311.  Hasegawa, M . , Fujimoto, M . , Kikuchi, K . , and Takehara, K . (1997). Elevated levels of interleukin 4 (IL-$), EL-10, and EL-13 in patients with systemic sclerosis. J Rheumatol 24, 328-332.  ^29  Hassig, A . , Kremer, H . , Liang, W. X . , and Stampfli, K . (1998). The role of the Th-1 to Th-2 shift of the cytokine profiles of CD4 helper cells in the pathogenesis of autoimmune and hypercatabolic diseases. Med Hypotheses 51, 59-63.  Hatakeyama, A . , Kasturi, K . N . , Wolf, I., Phelps, R. G., and Bona, C. A . (1996). Correlation between the concentration of serum anti-topoisomerase I autoantibodies and histological and biochemical alterations in the skin of tight skin mice. Cell Immunol 167, 135-40.  Hayday, A . , and Geng, L . (1997). Gamma delta cells regulate autoimmunity. Curr Opin Immunol 9, 884-9.  Hayday, A . C. (2000). yd cells: A Right Time and a Right Place for a Conserved Third Way of Protection. Annu Rev Immunol 18, 975-1026.  HayGlass, K . T., Wang, M . , Gieni, R. S., Ellison, C , and Gartner, J. (1996). In vivo direction of CD4 T cells to T h l and Th2-like patterns of cytokine synthesis. Adv Exp Med Biol 409, 309-16.  Hertz, M . , and Nemazee, D. (1998). Receptor editing and commitment in B lymphocytes. Curr Opin Immunol 10, 208-213.  130  Heurtier, A . H . , and Boitard, C. (1997). T-cell regulation in murine and human autoimmune diabetes: the role of TH1 and TH2 cells. Diabetes Metab 23, 377-85.  Himmelrich, H . , Launois, P., Tacchini-Cottier, F., and Louis, J. A . (1999). Some of the early events underlying Th2 cell maturation and susceptibility to Leishmania major infection in B A L B / c mice. Biol Chem 380, 909-14.  Horie, R., and Watanabe, T. (1998). CD30: expression and function in health and disease. Semin Immunol 10, 457-70.  Horton, M . A . (1997). The alpha v beta 3 integrin "vitronectin receptor". Int J Biochem Cell Biol 29, 721-725.  Howard, M . , Farrar, J., Hilfiker, M . , Johnson, B., TAkatsu, K., Hamaoka, T., and Paul, W. E . (1982). Identification of a T cell-derived B cell growth factor distinct from interleukin 2. J Exp Med 155, 914-923.  Hsieh, C. S., Heimberger, A . B . , Gold, J. S., O'Garra, A . , and Murphy, K . M . (1992). Differential regulation of T-helper phenotype development by interleukin-4 and interleukin-10 in an alpha-beta-T-cell-receptor transgenic system. Proc Natl Acad Sci U S A 89, 6065-6069.  43 1  Hsieh, C. S., Macatonia, S. E., Tripp, C. S., Wolf, S. F., O'Garra, A . , and Murphy, K . M . (1993). Development of T h l CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 2 6 0 , 547-549.  Hu-Li, J., Shevach, E . M . , Mizuguchi, J., Ohara, J., Mosmann, T., and Paul, W. E . (1987). B cell stimulatory factor 1 (interleukin 4) is a potent costimulant for normal resting T lymphocytes. J Exp Med 1 6 5 , 157-172.  Ihle, J. N . (1995). The Janus protein tyrosine kinase family and its role in cytokine signaling. Adv Immunol 6 0 , 1-35.  Ihn, FL, Sato, S., Fujimoto, M . , Kikuchi, K., and Takehara, K . (1995). Demonstration of interleukin-2, interleukin-4 and interleukin-6 in sera from patients with localized scleroderma. Arch Dermatol Res 2 8 7 , 193-7.  Inagaki, Y . , Truter, S., and Ramirez, F. (1994). Transforming growth factor-beta stimulates alpha 2(1) collagen gene expression through a cis-acting element that contains an Spl-binding site. J Biol Chem 2 6 9 , 14828-34.  Ishibashi, FL, Karube, S., Yamakawa, A . , and Koshihara, Y . (1995). Interleukin-4 stimulates pro-alpha 1(VI) collagen gene expression in cultured human osteoblast-like cells. Biochem Biophys Res Commun  2 1 1 , 1 2 1 - 3 4 .  !-32  Jablonska, S., Schubert, H . , and Kikuchi, I. (1989). Congenital fascial dystrophy: stiff skin syndrome—a human counterpart of the tight-skin mouse. J A m Acad Dermatol 21, 943-50.  Jaffe, H . A . , Gao, Z., Mori, Y . , L i , L . , and Varga, J. (1999). Selective inhibition of collagen gene expression in fibroblasts by an interferon-gamma transgene. Exp Lung Res 25, 199-215.  Jankovic, D., Kullberg, M . C , Noben-Trauth, N . , Caspar, P., Paul, W. E . , and Sher, A . (2000). Single cell analysis reveals that IL-4 receptor/Stat6 signaling is not required for the in vivo or in vitro development of CD4+ lymphocytes with a Th2 cytokine profile. J Immunol 164, 3047-3055.  Jimenez, S. A., Hitraya, E., and Varga, J. (1996). Pathogenesis of scleroderma. Collagen. Rheum Dis Clin North A m 22, 647-74.  Jimenez, S. A., Williams, C. J., Myers, J. C , and Bashey, R. I. (1986). Increased collagen biosynthesis and increased expression of type I and type III procollagen genes in tight skin (TSK) mouse fibroblasts. J Biol Chem 261, 657-62.  Jouanguy, E . , Doffinger, R., Dupuis, S., Pallier, A . , Altare, F., and Casanova, J. L . (1999). IL-12 and IFN-gamma in host defense against mycobacteria and salmonella in mice and men. Curr Opin Immunol 11, 346-51.  Kaplan, M . H . , Schindler, U . , Smiley, S. T., and Grusby, M . J. (1996). Stat-6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 4, 313-319.  Kaplan, M . H . , Wurster, A . L . , and Grusby, M . J. (1998). A signal transducer and activator of transcription (Stat)4-independent pathway for the development of T helper type 1 cells. J Exp Med 188, 1191-6.  Kasakura, S. (1998). [A role for T-helper type 1 and type 2 cytokines in the pathogenesis of various human diseases]. Rinsho Byori 46, 915-21.  Kashiwakura, J., Suzuki, N . , Nagafuchi, H . , Takeno, M . , Takeba, Y . , Shimoyama, Y . , and Sakane, T. (1999). Txk, a nonreceptor tyrosine kinase of the Tec family, is expressed in T helper type 1 cells and regulates interferon gamma production in human T lymphocytes. J Exp Med 190, 1147-1154.  Kasturi, K . , Muryoi, T., Shibata, S., Hatakeyama, A . , Murai, C , Simakoshi, Y . , and Bona, C. (1997). Functional properties and molecular characteristics of autoantibodies associated with tight skin syndrome. Ann N Y Acad Sci 815, 253-62.  Kasturi, K . N . , Hatakeyama, A., Murai, C , Gordon, R., Phelps, R. G . , and Bona, C. A . (1997). B-cell deficiency does not abrogate development of cutaneous hyperplasia in mice inheriting the defective fibrillin-1 gene. J Autoimmun 10, 505-17.  134  Kasturi, K . N . , Shibata, S., Muryoi, T., and Bona, C. A . (1994). Tight-skin mouse an experimental model for scleroderma. Int Rev Immunol 11, 253-71.  Keane-Myers, A., Gause, W. C , Linsley, P. S., Chen, S. J., and Wills-Karp, M . (1997). B7-CD28/CTLA-4 costimulatory pathways are required for the development of T helper cell 2-mediated allergic airway responses to inhaled antigens. J Immunol 158, 2042-2049.  Kielty, C. M . , Raghunath, M . , Siracusa, L. D., Sherratt, M . J., Peters, R., Shuttleworth, C. A., and Jimenez, S. A . (1998). The Tight skin mouse: demonstration of mutant fibrillin-1 production and assembly into abnormal microfibrils. J Cell Biol 140, 1159-66.  Kielty, C. M . , and Shuttleworth, C. A . (1997). Microfibrillar elements of the dermal matrix. Microsc Res Tech 38, 413-27'.  Kon, O. M . , and Kay, A . B . (1999). T cells and chronic asthma. Int Arch Allergy Immunol 118, 133-5.  Kuhn, R., Rajewsky, K., and Muller, W. (1991). Generation and anlysis of interleukin-4 deficient mice. Science 254, 707-710.  1(35  Kunkel, S. L . , Lukacs, N . W., Strieter, R. M . , and Chensue, S. W. (1996). T h l and Th2 responses regulate experimental lung granuloma development. Sarcoidosis Vase Diffuse Lung Dis 13, 120-8.  Kuwana, M . , Kaburaki, J., Okano, Y . , Inoko, H . , and Tsuji, K . (1993). The H L A - D R and D Q genes control the autoimmune response to D N A topoisomerase I in systemic sclerosis (scleroderma). J Clin Invest 92, 1296-301.  Kuwana, M . , Medsger, T. A . J., and Wright, T. M . (1995). T and B cell collaboration is essential for the autoantibody response to D N A topoisomerase I in systemic sclerosis. J Immunol 155, 2103-2114.  Lafaille, J. J. (1998). The role of helper T cell subsets in autoimmune diseases. Cytokine Growth Factor Rev 9, 139-51.  Lai, S. Y . , Molden, J., L i u , K . D., Puck, J. M . , White, M . D . , and Goldsmith, M . A . (1996). Interleukin-4-specific signal transduction events are driven by homotypic interactions of the interleukin-4 receptor alpha subunit. E M B O J 15, 4506-4514.  Lane, P. (2000). Role of OX40 signals in coordinating CD4 T cell selection, migration, and cytokine differentiation in T helper (Th)l and Th2 cells. J Exp Med 191, 201-206.  136  Launois, P., Tacchini-Cottier, F., Parra-Lopez, C , and Louis, J. A . (1998). Cytokines in parasitic diseases: the example of cutaneous leishmaniasis. Int Rev Immunol 17, 157-80.  Lee, B . , Godfrey, M . , Vitale, E., Hori, H . , Mattei, M . G., Sarfarazi, M . , Tsipouras, P., Ramirez, F., and Hollister, D . W. (1991). Linkage of Marfan syndrome and a phenotypically related disorder to two different fibrillin genes [see comments]. Nature 352, 330-4.  Lee, K . S., Ro, Y . J., Ryoo, Y . W., Kwon, H . J., and Song, J. Y . (1996). Regulation of interleukin-4 on collagen gene expression by systemic sclerosis fibroblasts in culture. J Dermatol Sci 12, 110-7.  Leite-de-Moraes, M . C , and Dy, M . (1997). Natural killer T cells: a potent cytokineproducing cell population. Eur Cytokine Netw 8, 229-37.  Leonard, W. J., noguchi, M . , and Russell, S. M . (1994). Sharing of a common gamma chain, gamma c, by the EL-2, IL-4 and LL-7 receptors: implications for X-linked severe combined immunodeficiency (XSCTD). Adv Exp Med Biol 365, 225-232.  Leroy, E. C. (1972). Connective tissue synthesis by scleroderma skin fibroblasts in cell culture. J Exp Med 135, 1351-62.  137  L i , X . , Pereira, L., Zhang, H . , Sanguineti, C , Ramirez, F., Bonadio, J., and Francke, U . (1993). Fibrillin genes map to regions of conserved mouse/human synteny on mouse chromosomes 2 and 18. Genomics 18, 667-72.  Liblau, R. S., Singer, S. M . , and McDevitt, H . O. (1995). T h l and Th2 CD4+ T cells in the pathogenesis of organ-specific autoimmune diseases [see comments]. Immunol Today 16, 34-8.  Lider, O., Hershkoviz, R., and Kachalsky, S. G . (1995). Interactions of migrating T lymphocytes, inflammatory mediators, and the extracellular matrix. Crit Rev Immunol 15, 271-283.  Lloyd, C. M . , Delaney, T., Nguyen, T., Tian, J., Martinez-A, C., Coyle, A . J., and Gutierrez-Ramoz, J. C. (2000). C C chemokine receptor (CCR)3/eotaxin is followed by CCR4/monocyte-derived chemokine in mediating pulmonary T helper lymphocyte type 2 recruitment after serial antigen challenge in vivo. J Exp Med 191, 265-21 A.  Locksley, R. M . , and Scott, P. (1991). Helper T-cell subsets in mouse leishmaniasis: induction, expansion and effector function. Immunol Today 12, A58-61.  Lohoff, M . , Ferrick, D., Mittrucker, H . W., Duncan, G . S., Bischof, S., Rollinghoff, M . , and Mak, T. W. (1997). Interferon regulatory factor-1 is required for a T helper 1 immune response in vivo. Immunity 6, 681-9.  ,€38  London, C. A., Abbas, A . K., and Kelso, A . (1998). Helper T cell subsets: heterogeneity, functions and development. Vet Immunol Immunopathol 63, 37-44.  Louis, J. A., Conceicao-Silva, F., Himmelrich, H . , Tacchini-Cottier, F., and Launois, P. (1998). Anti-leishmania effector functions of CD4+ T h l cells and early events instructing Th2 cell development and susceptibility to Leishmania major in B A L B / c mice. Adv Exp Med Biol 452, 53-60.  Lowenthal, J. W., Castle, B . E., Christiansen, J., Schreurs, J., Rennick, D., Arai, N . , Hoy, P., Takebe, Y . , and Howard, M . (1988). Expression of high affinity receptors for murine interleukin 4 (BSF-1) on hemopoietic and non-hemopoietic cells. J Immunol 140, 456464.  Lynch, F., and Shevach, E . M . (1992). Activation requirements of newborn thymic gamma delta T cells. J Immunol 149, 2307-2314.  Magenis, R. E., Maslen, C. L . , Smith, L., Allen, L., and Sakai, L . Y . (1991). Localization of the fibrillin (FBN) gene to chromosome 15, band q21.1. Genomics 11, 346-51.  Magram, J., Sfarra, J., Connaughton, S., Faherty, D., Warrier, R., Carvajal, D., Wu, C. Y . , Stewart, C , Sarmiento, U . , and Gately, M . K . (1996). IL-12-deficient mice are defective but not devoid of type 1 cytokine responses. Ann N Y Acad Sci 795,60-70.  139  Makhluf, H . A . , Stepniakowska, J., Hoffman, S., Smith, E . , LeRoy, E . C , and Trojanowska, M . (1996). IL-4 upregulates tenascin synthesis in scleroderma and healthy skin fibroblasts. J Invest Dermatol 107, 856-859.  Mallat, A., Preaux, A . - M . , Blazejewski, S., Rosenbaum, J., Dhumeaux, D . , and Mavier, P. (1995). Interferon alpha and gamma inhibit proliferation and collagen synthesis of human Ito cells in culture. Hepatology 21.  Manetti, R., Gerosa, F., Giudizi, M . G., Biagiotti, R., Parronchi, P., Piccinni, M . P., Sampognaro, S., Maggi, E., Romagnani, S., Trinchieri, G., and al, e. (1994). Interleukin12 induces stable priming for interferon gamma (IFN-gamma) production during differentiation of human T helper (Th) cells and transient IFN-gamma production in established Th2 cell clones. J Exp Med 179, 1273-1283.  Maranda, E . , and Robak, T. (1998). [Biological properties and clinical significance of interleukins 12 (EL- 12)]. Postepy Hig Med Dosw 52, 489-506.  Mariani, T. J., Sandefur, S., and Pierce, R. A . (1997). Elastin in lung development. Exp Lung Res 23, 131-145.  140  Martorana, P. A . , van Even, P., Gardi, C , and Lungarella, G. (1989). A 16-month study of the development of genetic emphysema in tight-skin mice. A m Rev Respir Dis 139, 226-32.  Mattner, F., Magram, J., Ferrante, J., Launois, P., D i Padova, K . , Behin, R., Gately, M . K., Louis, J. A . , and Alber, G. (1996). Genetically resistant mice lacking interleukin-12 are susceptible to infection with Leishmania major and mount a polarized Th2 cell response. Eur J Immunol 26, 1553-9.  Mavalia, C., Scaletti, C , Romagnani, P., Carossino, A . M . , Pignone, A . , Emmi, L . , Pupilli, C , Pizzolo, G., Maggi, E . , and Romagnani, S. (1997). Type 2 helper T-cell predominance and high CD30 expression in systemic sclerosis. A m J Pathol 151, 1751-8.  McVay, L . D., Hayday, A . C , Bottomly, K . , and Carding, S. R. (1991). Thymic and extrathymic development of human gamma/delta T cells. Curr Top Microbiol Immunol 173, 57-63.  Mekori, Y . A . , and Metcalfe, D . D . (1999). Mast cell-T cell interactions. J Allergy Clin Immunol 704,517-23.  Miyazaki, T., Kawahara, A . , Fujii, H . , Nakagawa, Y . , Minami, Y . , L i u , A . , Oishi, I., Silvennoiene, O., Witthahn, B . A., Ihle, J. N . , and al, e. (1994). Functional activation of  141  Jakl and Jak3 by selective association with IL-2 receptor subunits. Science 266, 10451047.  Moller, R., Serup, J., and Ammitzboll, T. (1985). Glycosaminoglycans in localized scleroderma (morphoea). Connect Tissue Res 13, 227-36.  Mond, J. J., and Brunswick, M . (1987). A role for IFN-gamma and N K cells in immune responses to T cell- regulated antigens types 1 and 2. Immunol Rev 99, 105-18.  Morel, P. A . , Chang, H . J., Wilson, J. W., Conte, C , Falkner, D . , Tweardy, D . J., and Medsger, T. A . , Jr. (1995). H L A and ethnic associations among systemic sclerosis patients with anticentromere antibodies. Hum Immunol 42, 35-42.  Morel, P. A., and Oriss, T. B . (1998). Crossregulation between T h l and Th2 cells. Crit Rev Immunol 18, 275-303.  Mountford, A. P., Coulson, P. S., Cheever, A . W., Sher, A., Wilson, R. A., and Wynn, T. A . (1999). Interleukin-12 can directly induce T-helper 1 responses in interferon-gamma (IFN-gamma) receptor-deficient  mice, but requires IFN-gamma signaling to  downregulate T-helper 2 responses. Immunology 97, 588-594.  Murai, C , Saito, S., Kasturi, K . N . , and Bona, C. A . (1998). Spontaneous occurrence of anti-fibrillin-1 autoantibodies in tight-skin mice. Autoimmunity 28, 151-5.  ,142  Murata, T., Noguchi, P. D., and Puri, R. K . (1996). IL-13 induces phosphorylation and activation of J A K 2 Janus kinase in human colon carcinoma cell lines: similarities between EL-4 and EL-13 signaling. J Immunol 156, 2972-2978.  Murata, T., Obiri, N . I., and Puri, R. K . (1998). Structure of and signal transduction through interleukin-4 and interleukin-13 receptors (review). Int J M o l Med 1, 551-7.  Murray, J. S. (1998). How the M H C selects Thl/Th2 immunity. Immunol Today 19, 157163.  Muryoi, T., Kasturi, K . N . , Kafina, M . J., Cram, D. S., Harrison, L . C , Sasaki, T., and Bona, C. A . (1992). Antitopoisomerase I monoclonal autoantibodies from scleroderma patients and tight skin mouse interact with similar epitopes. J Exp Med 175, 1103-9.  Nakanishi, K., Yoshida, N . , Kishimoto, T., and Akira, S. (1996). Essential role of Stat-6 in EL-4 signaling. Nature 380, 627-630.  Nakazato, Y . , Okada, H . , Tajima, S., Hayashida, T., Kanno, Y . , Suzuki, H., and Saruta, T. (1996). Interleukin-4 modulates collagen synthesis by human mesangial cells in a type-specific manner. A m J Physiol 270, F447-53.  Nemazee, D. (2000). Receptor editing in B cells. Adv Immunol 74, 89-126.  Noben-Trauth, N . , Shultz, L . D., Brombacher, R , Urban, J. F. J., Gu, H., and Paul, W. E. (1997). A n interleukin 4 (IL-4)-independent pathway for CD4+ T cell IL-4 production is revealed in IL-4 receptor-deficient mice. Proc Natl Acad Sci U S A 94, 10838-10843.  Noelle, R., Kramme, R. P., Ohara, J., Uhr, J. W., and Vitetta, E . S. (1984). Increased expression of la antigens on resting B cells: an additional role for B-cell growth factor: an additional role for B-cell growth factor. Proc Natl Acad Sci U S A 81, 6149-6153.  O'Donnell, M . D., O'Connor, C. M . , FitzGerald, M . X . , Lungarella, G., Cavarra, E., and Martorana, P. A . (1999). Ultrastructure of lung elastin and collagen in mouse models of spontaneous emphysema. Matrix Biol 18, 357-60.  O'Garra, A . (1999). Checkpoints for regulation of development and IFN-gamma production by T h l cells in TCR-transgenic models. Immunol Lett 65, 41-4.  Ohara, J., and Paul, W. E. (1987). Receptors for B-cell stimulatory factor-1 stimulatory factor-1 expressed on cells of the hemopoietic lineage. Nature 325, 537-540.  Ohara, J., and Paul, W. E. (1988). Up-regulation of interleukin 4/B-cell stimulatory factor 1 receptor expression. Proc Natl Acad Sci U S A 85, 8221-8225.  J 44  Ohmori, FL, and Hikida, M . (1998). Expression and function of recombination activating genes in mature B cells. Crit Rev Immunol 18, 221-235.  Ohshima, Y . , Yang, L . P., Uchiyama, T., Tanaka, Y . , Baum, P., Sergerie, M . , Hermann, P., and Delespesse, G . (1998). OX40 costimulation enhances interleukin-4 (IL-4) expression at priming and promotes the differentiation of naive human CD4(+) T cells into high IL-4-producing effectors. Blood 92, 3338-3345.  Ong, C., Wong, C., Roberts, C. R., Teh, H . S., and Jirik, F. R. (1998). Anti-IL-4 treatment prevents dermal collagen deposition in the tight- skin mouse model of scleroderma. Eur J Immunol 28, 2619-29.  Ong, C. J., Ip, S., Teh, S. J., Wong, C., Jirik, F. R., Grusby, M . J., and Teh, H . S. (1999). A role for T helper 2 cells in mediating skin fibrosis in tight-skin mice. Cell Immunol 196, 60-8.  Oosterwegel, M . A . , Greenwald, R. J., Mandelbrot, D . A . , Lorsbach, R. B . , and Sharpe, A . H . (1999). C T L A - 4 and T cell activation. Curr Opin Immunol 11, 294-300.  Oosterwegel, M . A . , Mandelbrot, D . A . , Boyd, S. D., Lorsbach, R. B . , Jarrett, D . Y . , Abbas, A . K . , and Sharpe, A . H . (1999). The role of C T L A - 4 in regulating Th2 differentiation. J Immunol 163, 2634-2639.  .145  Oriente, A . , Fedarko, N . S., Pacocha, S. E . , Huang, S. K . , Lichtenstein, L . M . , and Essayan, D. M . (2000). Interleukin-13 modulates collagen homeostasis in human skin and keloid fibroblasts. J Pharmacol Exp Ther 292, 988-94.  Osborn, T. G., Bashey, R. I., Moore, T. L . , and Fischer, V . W . (1987). Collagenous abnormalities in the heart of the tight-skin mouse. J M o l Cell Cardiol 19, 581-7.  Osborn, T. G., Bauer, N . E., Ross, S. C , Moore, T. L . , and Zuckner, J. (1983). The tightskin mouse: physical and biochemical properties of the skin. J Rheumatol 10, 793-6.  Pablos, J. L., Carreira, P. E., Serrano, L., Del Castillo, P., and Gomez-Reino, J. J. (1997). Apoptosis and proliferation of fibroblasts during postnatal skin development and scleroderma in the tight-skin mouse. J Histochem Cytochem 45, 711-9.  Paludan, S. R. (1998). Interleukin-4 and interferon-gamma: the quintessence of a mutual antagonistic relationship. Scand J Immunol 48,459-68.  Pena, A . S., and Crusius, J. B . (1998). Food allergy, coeliac disease and chronic inflammatory bowel disease in man. Vet Q 20, S49-52.  Perlish, J. S., Bashey, R. I., Stephens, R. E., and Fleischmajer, R. (1976). Connective tissue synthesis by cultured scleroderma fibroblasts. I. In vitro collagen synthesis by normal and scleroderma dermal fibroblasts. Arthritis Rheum 19, 891-901.  •'146  Pfaff, M . , Reinhardt, D . P., Sakai, L . Y . , and Timpl, R. (1996). Cell adhesion and integrin binding to recombinant human fibrillin-1. FEBS Lett 384, 247-250.  Phelps, R. G., Daian, C , Shibata, S., Fleischmajer, R., and Bona, C. A . (1993). Induction of skin fibrosis and autoantibodies by infusion of immunocompetent cells from tight skin mice into C57BL/6 Pa/Pa mice. J Autoimmun 6, 701-18.  Postlethwaite, A . E . , Holness, M . A . , Katai, H . , and Raghow, R. (1992). Human fibroblasts synthesize elevated levels of extracellular matrix proteins in response to interleukin 4. J Clin Invest 90, 1479-85.  Poynter, M . E., M u , H . H . , Chen, X . P., and Daynes, R. A . (1997). Activation of NK1.1+ T cells in vitro and their possible role in age-associated changes in inducible IL-4 production. Cell Immunol 179, 22-9.  Ramirez, F., and Pereira, L . (1999). The fibrillins. Int J Biochem Cell Biol 31, 255-9.  Rea, D., Schagen, F. H . , Hoeben, R. C , Mehtali, M . , Havenga, M . J., Toes, R. E., Melief, C. J., and Offringa, R. (1999). Adenoviruses activate human dendritic cells without polarization toward a T-helper type 1-inducing subset. J Virol 73, 10245-53.  . J.47  Reiner, S. L . , and Locksley, R. M . (1995). The regulation of immunity to Leishmania major. Annu Rev Immunol 13, 151-77.  Reinhardt, D . P., Chalberg, S. C , and Sakai, L . Y . (1995). The structure and function of fibrillin. Ciba Found Symp 192, 128-43.  Reinhardt, D . P., Keene, D . R., Corson, G . M . , Poschl, E., Bachinger, H . P., Gambee, J. E., and Sakai, L . Y . (1996). Fibrillin-1: organization in microfibrils and structural properties. J M o l Biol 258, 104-16.  Reveille, J. D . (1995). Molecular genetics of systemic sclerosis. Curr Opin Rheumatol 7, 522-8.  Ricci, M . , Matucci, A . , and Rossi, O. (1997). Source of IL-4 able to induce the development of Th2-like cells. Clin Exp Allergy 27, 488-500.  Roberts, K., Yokoyama, W. M . , Kehn, P. J., and Shevach, E. M . (1991). The vitronectin receptor serves as an accessory molecule for the activation of a subset of gamma/delta T cells. J Exp Med 173, 231-240.  Rocken, M . , Racke, M . , and Shevach, E. M . (1996). EL-4-induced immune deviation as antigen-specific therapy for inflammatory autoimmune disease. Trends Immunol 17.  148  Rogers, P. R., and Croft, M . (2000). CD28, Ox-40, L F A - 1 , and CD4 modulation of Thl/Th2 differentiation is directly dependent on the dose of antigen. J Immunol 164, 2955-2963.  Rogers, P. R., and Croft, M . (1999). Peptide dose, affinity, and time of differentiation can contribute to the Thl/Th2 cytokine balance. J Immunol 163, 1205-1213.  Rogge, L., and al, e. (1998). The role of STAT4 in species-specific regulation of Th cell developement by type I IFNs. J Immunol 161, 6567-6574.  Romagnani, S. (1996). T h l and Th2 in human diseases. Clin Immunol Immunopathol 80, 225-35.  Romagnani, S. (1999). Thl/Th2 cells. Inflamm Bowel Dis 5, 285-94.  Romagnani, S., Del Prete, G., Manetti, R., Ravina, A . , Annunziato, F., De Carli, M . , Mazzetti, M . , Piccinni, M . P., D'Elios, M . M . , Parronchi, P., and et al. (1994). Role of TH1/TH2 cytokines in HIV infection. Immunol Rev 140, 73-92.  Romagnani, S., Parronchi, P., D'Elios, M . M . , Romagnani, P., Annunziato, F., Piccinni, M . P., Manetti, R., Sampognaro, S., Mavilia, C , De Carli, M . , Maggi, E., and Del Prete, G. F. (1997). A n update on human T h l and Th2 cells. Int Arch Allergy Immunol 113, 153-6.  149  Roos, A . , Schilder-Tol, E . J., Weening, J. J., and Aten, J. (1998). Strong expression of C D 134 (OX40), a member of the T N F receptor family, in a T helper 2-type cytokine environment. J Leukoc Biol 64, 503-510.  Rosat, J. P., Conceicao-Silva, F., Waanders, G. A., Bernann, F., Wilson, A., Owen, M . J., Hayday, A . C , Huang, S., Aguet, M . , MacDonald, H . R., and al, e. (1995). Expansion of gamma delta+ T cells in Balb/C mice infected with Leishmania major is dependent upon Th2-type CD4+ T cells. Infect Immun 8, 3000-3004.  Ross, S. C , Osborn, T. G., Dorner, R. W., and Zuckner, J. (1983). Glycosaminoglycan content in skin of the tight-skin mouse. Arthritis Rheum 26, 653-7.  Rossi, G. A., Hunninghake, G . W., Gadek, J. E., Szapiel, S. V . , Kawanami, O., Ferrans, V . J . ; and Crystal, R. G . (1984). Hereditary emphysema in the tight-skin mouse. Evaluation of pathogenesis. A m Rev Respir Dis 129, 850-5.  Russell, S. M . , Johnston, J. A., Noguchi, M . , Kawamura, M . , Bacon, C. M . , Friedmann, M . , Berg, M . , Mc Vicar, D . W., Witthuhn, B . A . , Silvennoinen, O., and al, e. (1994). Interaction of EL-2R beta and gamma-c chains with Jakl and Jak3: implications for XSCJD and X C I D . Science 266, 1042-1045.  .150  Russell, S. M . , Keegan, A . D., Harada, N . , Nakamura, Y . , Noguchi, M . , Leland, P., Friedmann, M . C , Miyajima, A . , Puri, R. K . , and Paul, W. E . (1993). Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science 262, 1880-1883.  Saito, S., Nishimura, H., Brumeanu, T. D., Casares, S., Stan, A . C , Honjo, T., and Bona, C. A . (1999). Characterization of mutated protein encoded by partially duplicated fibrillin-1 gene in tight skin (TSK) mice. M o l Immunol 36, 169-76.  Sakai, L . Y . , Keene, D . R., and Engvall, E . (1986). Fibrillin, a new 350-kD glycoprotein, is a component of extracellular microfibrils. J Cell Biol 103, 2499-509.  Sakao, Y., Takeda, K., Tsutsui, H., Kaisho, T., Nomura, F., Okamura, H . , Nakanishi, K . , and Akira, S. (1999). IL-18-deficient mice are resistant to endotoxin-induced liver injury but highly susceptible to endotoxin shock. Int Immunol 11, 471-80.  Sallusto, F., Mackay, C. R., and Lanzavecchia, A . (1997). Selective expression of the eotaxin receptor CCR3 by human T helper 2 cells. Science 277, 2005-2007.  Scharton-Kersten, T., Afonso, L . C , Wysocka, M . , Trinchieri, G . , and Scott, P. (1995). IL-12 is required for natural killer cell activation and subsequent T helper 1 cell development in experimental leishmaniasis. J Immunol 154, 5320-5330.  Schmitt, E., Rude, E., and Germann, T. (1997). The immunostimulatory function of EL-12 in T-helper cell development and its regulation by TGF-beta, IFN-gamma and IL-4. Chem Immunol 68, 70-85.  Schvartz, L , Seger, D., and Shaltiel, S. (1999). Vitronectin. Int J Biochem Cell Biol 31, 539-544.  Seder, R. A., and Paul, W. E. (1994). Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu Rev Immunol 10, 385-409.  Seder, R. A., Paul, W. E., Davis, M . M . , De, S. T., and Groth, B . F. (1992). The presence of interleukin-4 during in vitro priming determines the lymphokine-producing potential of CD4+ T cells from T-cell receptor transgenic mice. J Exp Med 176, 1091-1098.  Sempowski, G . D., Beckmann, M . P., Derdak, S., and Phipps, R. P. (1994). Subsets of murine lung fibroblasts express membrane-bound and soluble EL-4 receptors. Role of EL4 in enhancing fibroblast proliferation and collagen synthesis. J Immunol 152, 3606-14.  Shevach, E. M . , Chang, J. T., and Segal, B . M . (1999). The critical role of EL-12 and the IL-12R beta 2 subunit in the generation of pathogenic autoreactive T h l cells. Springer Semin Immunopathol 21, 249-62.  *1'52  Shimoda, K . , van Deursen, J., Sangster, M . Y . , Sarawar, S. R., Carson, R. T., and al, e. (1996). Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat-6 gene. Nature 380, 630-633.  Sieburth, D., Jabs, E. W., Warrington, J. A., L i , X . , Lasota, J., LaForgia, S., Kelleher, K . , Huebner, K . , Wasmuth, J. J., and Wolf, S. F. (1992). Assignment of genes encoding a unique cytokine (IL12) composed of two unrelated subunits to chromosomes 3 and 5. Genomics 14, 59-62.  Singh, V . K . , Mehrotra, S., and Agarwal, S. S. (1999). The paradigm of T h l and Th2 cytokines: its relevance to autoimmunity and allergy. Immunol Res 20, 147-61.  Sinha, S., Nevett, C , Shuttleworth, C. A . , and Kielty, C. M . (1998). Cellular and extracellular biology of the latent transforming growth factor-beta binding proteins. Matrix Biol 17, 529-45.  Sinigaglia, F., D'Ambrosio, D., Panina-Bordignon, P., and Rogge, L . (1999). Regulation of the IL-12/IL-12R axis: a critical step in T-helper cell differentiation and effector function. Immunol Rev 170, 65-72.  Siracusa, L . D., Christner, P., McGrath, R., Mowers, S. D., Nelson, K . K . , and Jimenez, S. A . (1993). The tight skin (Tsk) mutation in the mouse, a model for human fibrotic  153  diseases, is tightly linked to the beta 2-microglobulin (B2m) gene on chromosome 2. Genomics 17, 748-51.  Siracusa, L . D., McGrath, R., M a , Q., Moskow, J. J., Manne, J., Christner, P. J., Buchberg, A . M . , and Jimenez, S. A . (1996). A tandem duplication within the fibrillin 1 gene is associated with the mouse tight skin mutation. Genome Res 6, 300-13.  Skok, J., Poudrier, J., and Gray, D . (1999). Dendritic cell-derived IL-12 promotes B cell induction of Th2 differentiation: a feedback regulation of T h l development. J Immunol 163, 4284-91.  Smerzbertling, C., and Duschl, A . (1995). Both interleukin-4 and interleukin-13 induce tyrosine phosphorylation of the 140 kD subunit of the interleukin-4 receptor. J Biol Chem 270, 966-970.  Smith, K . J., Skelton, H . G., and Wagner, K . F. (1995). Pathogenesis of HJ.V-1 disease. IntJ Dermatol 34, 308-18.  Snapper, C. M . , Hornbeck, P. V . , Atasoy, U . , Pereira, G . M . , and Paul, W. E . (1988). Interleukin 4 induces membrane Thy-1 expression on normal murine B cells. Proc Natl Acad Sci U S A 85, 6107-6111.  154  Sutterwala, F. S., and Mosser, D . M . (1999). The taming of IL-12: suppressing the production of proinflammatory cytokines. J Leukoc Biol 65, 543-51.  Syrbe, U . , Siveke, J., and Hamann, A . (1999). Thi/Th2 subsets: distinct differences in homing and chemokine receptor expression? Springer Semin Immunopathol 21, 263285.  Szabo, S. J., Dighe, A . S., Gubler, TJ., and Murphy, K . M . (1997). Regulation of the interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Thl) and Th2 cells. J Exp Med 185, 817-24.  Szapiel, S. V., Fulmer, J. D., Hunninghake, G. W., Elson, N . A., Kawanami, O., Ferrans, V . J., and Crystal, R. G . (1981). Hereditary emphysema in the tight-skin (Tsk/+) mouse. A m Rev Respir Dis 123, 680-5.  Tan, F. K . , Arnett, F. C , Antohi, S., Saito, S., Mirarchi, A . , Spiera, H . , Sasaki, T., Shoichi, O., Takeuchi, K . , Pandy, J. P., Silver, R. M . , LeRoy, C , Postlethwaite, A . E., and Bona, C. A . (1999). Autoantibodies to the extracellular matrix microfibrillar protein, fibrillin-1, in patients with scleroderma and other connective tissue diseases. J Immunol 163, 1066-72.  Tan, F. K . , Stivers, D . N . , Foster, M . W., Chakraborty, R., Howard, R. F., Milewicz, D . M . , and Arnett, F. C. (1998). Association of microsatellite markers near the fibrillin 1  155  gene on human chromosome 15q with scleroderma in a Native American population. Arthritis Rheum 41, 1729-37.  Tao, X . , Constant, S., Jorritsma, P., and Bottomly, K . (1997). Strength of T C R signal determines the costimulatory requirements for T h l and Th2 CD4+ T cell differentiation. J Immunol 159, 5956-5963.  Tao, X . , Grant, C , Constant, S., and Bottomly, K . (1997). Induction of EL-4-producing CD4+ T cells by antigenic peptides altered for TCR binding. J Immunol 158, 4237-4244.  Tepper, R. I., Levinso, D . A . , Stanger, B . Z., CAmpos-Torres, J., Abbas, A., and Leder, P. (1990). IL-4 induces allergic-like inflammatory disease and alters T cell development in transgenic mice. Cell 62, 457-467.  Terato, K . , Y e , X . J., Miyahara, H . , Cremer, M . A . , and Griffiths, M . M . (1996). Induction by chronic autoimmune arthritis in D B A / 1 mice by oral administration of type II collagen and Escherichia coli lipopolysaccharide. Br J Rheumatol 35, 828-838.  Thornhill, M . FL, Wellicoms, S. M . , Mahiouz, D . L . , Lanchbury, J. S., Kyan-Aung, U . , and Haskard, D . O. (1991). Tumor necrosis factor combines with EL-4 or IFN-gamma to selectively enhance endothelial cell adhesiveness for T cells. The contribution of vascular cell adhesion molecule-1-dependent and -independent binding mechanisms. J Immunol 146, 592-598.  M56  Tone, Y . , Thompson, S. A . , Babik, J. M . , Nolan, K . F., Tone, M . , Raven, C , and Waldmann, H . (1996). Structure and chromosomal location of the mouse interleukin-12 p35 and p40 subunit genes. Eur J Immunol 26, 1222-7.  Trinchieri, G . (1998). Interleukin 12: a cytokine at the interface of inflammation and immunity. Adv Immunol 70.  Trinchieri, G . (1995). Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu Rev Immunol 13, 251-76.  Trinchieri, G., and Gerosa, F. (1996). Immunoregulation by interleukin-12. J Leukoc Biol 59, 505-11.  Trinchieri, G . , and Scott, P. (1999). Interleukin-12: basic principles and clinical applications. Curr Top Microbiol Immunol 238.  Trumpfheller, C , Tenner-Racz, K . , Racz, P., Fleischer, B . , and Frosch, S. (1998). Expression of macrophage inflammatory protein (MIP)-l alpha, M l P - l b e t a , and R A N T E S genes in lymph nodes from HIV+ individuals: correlation with a Thl-type cytokine response. Clin Exp Immunol 112, 92-99.  Tsai, M , Shih, L . S., Newlands, G. F., Takeishi, T., Langley, K . E., Zsebo, K . M . , Miller, H . R., Geissler, E . N . , and Galli, S. J. (1991). The rat c-kit ligand, stem cell factor, induces the development of connective tissue-type and mucosal mast cells in vivo. Analysis by anatomical distribution, histochemistry, and protease phenotype. J Exp Med 174, 125-31.  Umetsu, D. T., and DeKruyff, R. H . (1997). T h l and Th2 CD4+ cells in the pathogenesis of allergic diseases. Proc Soc Exp Biol Med 215, 11-20.  Varga, J., Olsen, A . , Herhal, J., Constantine, G., Rosenbloom, J., and Jimenez, S. A . (1990). Interferon-gamma reverses the stimulation of collagen but not fibronectin gene expression by transforming growth factor-beta in normal human fibroblasts. Eur J Clin Invest 20, 487-493.  Vitetta, E. S., Ohara, J., Myers, C. D., Layton, J. E., Krammer, P. H . , and Paul, W. E. (1985). Serological, biochemical, and functional identity of B cell-stimulatory factor 1 and B cell differentiation factor for I g G l . J Exp Med 162, 1726-1731.  Walker, M . , Harley, R., Maize, J., DeLustro, F., and LeRoy, E . C. (1985). Mast cells and • their degranulation in the Tsk mouse model of scleroderma. Proc Soc Exp Biol Med 180, 323-8.  Walker, M . A . , Harley, R. A . , DeLustro, F. A . , and LeRoy, E . C. (1989). Adoptive transfer of tsk skin fibrosis to +/+ recipients by tsk bone marrow and spleen cells. Proc Soc Exp Biol Med 192, 196-200.  Wallace, V . A., Kondo, S., Kono, T., Xing, Z., Timms, E., Furlonger, C , Keystone, E., Gauldie, J., Sauder, D . N . , Mak, T. W., and et al. (1994). A role for CD4+ T cells in the pathogenesis of skin fibrosis in tight skin mice. Eur J Immunol 24, 1463-6.  Wang, L . M . , Keegan, A . D., L i , W., Lienhard, G . E., Pacini, S., Gutkind, J. S., and Pierce, J. H . (1992). IL-4 activates a distinct signal transduction cascade from EL-3 in factor-dependent myeloid cells. E M B O J 11, 4899-4908.  Wegrowski, Y . , Paltot, V., Gillery, P., Kalis, B., Randoux, A., and Maquart, F. X . (1995). Stimulation of sulphated glycosaminoglycan and decorin production in adult dermal fibroblasts by recombinant human interleukin-4. Biochem J 307, 673-8.  Wen, L . , Barber, D . F., Pao, W., Wong, F. S., Owen, M . J., and Hayday, A . (1998). Primary gamma delta cell clones can be defined phenotypically and functionally as Thl/Th2 cells and illustrate the association of CD4 with Th2 differentiation. J Immunol 160, 1965-74.  Wen, L., and Hayday, A . C. (1997). Gamma delta T-cell help in responses to pathogens and in the development of systemic autoimmunity. Immunol Res 16, 229-41.  ).159  X u , D., Chan, W. L., Leung, B . P., Huang, F. P., Wheeler, R., Piedrafita, D., Robinson, J. H., and Liew, F. Y . (1998). Selective expression of a stable cell surface molecule on type 2 but not type 1 helper T cells. J Exp Med 187, 787-794.  Yamashita, T., Miyata, H., Miyaji, C , Watanabe, H., Abo, T., Kobayakawa, T., Kaneko, A., and Sendo, F. (1999). CD4+ and/or gammadelta+ T cells in the liver spontaneously produce IL-4 in vitro during the early phase of Leishmania major infection in susceptible B A L B / c mice. Acta Trop 73, 109-19.  Yin, W., Smiley, E., Germiller, J., Sanguineti, C , Lawton, T., Pereira, L . , Ramirez, F., and Bonadio, J. (1995). Primary structure and developmental expression of Fbn-1, the mouse fibrillin gene. J Biol Chem 270, 1798-1806.  Yoshimoto, T., Bendelac, A . , Watson, C , Hu-Li, J., and Paul, W. E . (1995). Role of NK1.1+ T cells in a TH2 response and in immunoglobulin E production. Science 270, 1845-1847.  Yoshimoto, T., and Paul, W. E. (1994). CD4pos, N K l . l p o s T-cells promptly produce Interleukin-4 in response to in-vivo challenge with anti-CD3. J Exp Med 179, 1285-1295.  A60  Yurovsky, V . V . , Sutton, P. A . , Schulze, D . H . , Wigley, F. M . , Wise, R. A . , Howard, R. F-, and White, B . (1994). Expansion of selected V delta 1+ gamma delta T cells in systemic sclerosis patients. J Immunol 153, 881-891.  Zamorano, J., Wang, H . Y . , Wang, L . M . , H . , P. J., and Keegan, A . D . (1996). IL-4 protects cells from apoptosis via the insulin receptor substrate pathway and a second independent signaling pathway. J Immunol 157, 4926-4934.  Zhang, H . , Apfelroth, S. D., Hu, W., Davis, E. C , Sanguineti, C , Bonadio, J., Mecham, R. P., and Ramirez, F . (1994). Structure and expression of fibrillin-2, a novel microfibrillar component preferentially located in elastic matrices. J Cell Biol 124, 855863.  Zuany-Amorim, C , Ruffie, C , Haile, S., Vargaftig, B . B . , Pereira, P., and Pretolani, M . (1998). Requirement for gamma delta T cells in allergic airway inflammation. Science 280, 1265-1267.  161  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099538/manifest

Comment

Related Items