Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Expression and characterization of a recombinant human factor x/protein c chimeric protein Stenberg, Leisa M. 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-464326.pdf [ 14.91MB ]
Metadata
JSON: 831-1.0099467.json
JSON-LD: 831-1.0099467-ld.json
RDF/XML (Pretty): 831-1.0099467-rdf.xml
RDF/JSON: 831-1.0099467-rdf.json
Turtle: 831-1.0099467-turtle.txt
N-Triples: 831-1.0099467-rdf-ntriples.txt
Original Record: 831-1.0099467-source.json
Full Text
831-1.0099467-fulltext.txt
Citation
831-1.0099467.ris

Full Text

EXPRESSION AND CHARACTERIZATION OF A RECOMBINANT HUMAN FACTOR X/PROTEIN C CHIMERIC PROTEIN by LEISA M. STENBERG B.Sc, The University of British Columbia, 1988 M.Sc., The University of British Columbia, 1993 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Biochemistry, Genetics Graduate Program) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA September 1999 © Leisa M. Stenberg, 1999 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of Piochtr* , Cf-{*\OtkcS 'P*t>ipce>m The University of British Columbia Vancouver, Canada Date /^tftctnbw 3 ^ If*}*? DE-6 (2/88) A B S T R A C T A fusion cDNA encoding the light chain domains and activation peptide of human factor X (fX; a procoagulant) and the serine protease domain of human protein C (PC; an anticoagulant) was constructed on the premise that the recombinant chimeric protein (fX/PC) would function as an anticoagulant: it was hypothesized that the protein would be targeted to the Tenase complex by the light chain of fX and there exhibit the proteolytic function of activated PC (APC). The fusion cDNA was expressed in BHK and HEK 293A cell lines and fX/PC was purified to homogeneity from conditioned medium by a two-step method employing an immunoaffinity resin and hydroxyapatite chromatography. Structural and functional analyses of the purified protein revealed that BHK cells were not efficient in performing the post-translational modifications necessary to generate an active fX/PC protein. Incomplete removal of both the propeptide (concomitant with hydrolysis at alternate sites nearby) and internal tribasic peptide, spurious cleavages, and inefficient 7-glutamyl carboxylation were observed. These problems were overcome by a combination of site-directed mutagenesis to improve the —2 propeptide cleavage site (by replacing Thr with Arg), the use of a HEK 293A cell line for expression, and minor modification of the purification protocol. In this way, homogeneous and properly post-translationally modified preparations were obtained. The chimeric zymogen, fX(T_2R)/PC, could be activated by both RVV-X and Protac to an amidolytically active serine protease, although the extent and rate of activation by both activators was lower than for PC. The K m of Protac-activated fX(T~2R)/PC for the substrate Spectrozyme PCa (0.14 mM) was comparable to that of APC. The zymogen form of fX(T"2R)/PC had no effect on clotting time in APTT assays, whereas the Protac-activated enzyme extended the clotting time in a dose-dependent manner. However, compared with APC, the anticoagulant activity of the chimeric protein was much reduced, suggesting that it may have functioned merely as a competitor for the binding site of either fX within the Tenase complex or activated fX within the Prothrombinase complex. Thus, it can be concluded that, despite substitution of the light chain and activation peptide of PC with those of fX, the fX(T R)/PC chimeric protein retained some essential features of PC but did not function as hypothesized. Table of Contents Abstract ii List of Tables vi List of Figures vii List of Abbreviations viii Acknowledgements x 1.0 INTRODUCTION .. „ 1 1.1 The Coagulation Cascade 1 1.1.1 Role of the Coagulation Cascade in Hemostasis 1 1.1.2 Initiation and Maintenance of the Coagulation Response 3 1.1.3 Fibrin Formation and Fibrinolysis 6 1.1.4 Regulation of the Clotting System 6 1.1.4.1 Activated Protein C 7 1.1.4.2 Tissue Factor Pathway Inhibitor 7 1.1.4.3 Antithrombin 7 1.2 The Tenase and Prothrombinase Complexes 8 1.2.1 Components of the Tenase Complex 8 1.2.1.1 Factor IX 8 1.2.1.2 Factor VITi 9 1.2.1.3 Factor X 11 1.2.1.4 A Model for the Tenase Complex 12 1.2.2 The Prothrombinase Complex 14 1.3 The Protein C Anticoagulant Pathway 16 1.3.1 Protein C 16 1.3.2 Activation of PC by the Thrombin-Thrombomodulin Complex 16 1.3.3 ProteinS 18 1.3.4 Proteolysis of Factors Villa and Va by APC 20 1.3.5 Other Functions of Protein C 22 1.3.6 Inhibition of Protein C 22 1.4 Molecular Defects in the Anticoagulant System 23 1.4.1 Antithrombin Deficiency 24 1.4.2 Protein C Deficiency 24 1.4.3 Protein S Deficiency 25 1.4.4 Activated Protein C Resistance 25 1.5 Prevention and Treatment of Thrombotic Disorders 26 1.5.1 Heparin, Low Molecular Weight Heparin, and Oral Anticoagulants 26 1.5.2 Direct Inhibitors of Thrombin 27 1.5.3 Inhibitors of Thrombin Generation 27 1.5.4 Protein C and Activated Protein C 28 iv 1.6 The Trypsin-Like Family of Serine Proteases 29 1.6.1 Common Domain Structure 29 1.6.2 Gene Organization 29 1.6.3 Evolution 31 1.7 Structural Aspects of Factor X and Protein C 32 1.7.1 Primary Sequences 32 1.7.2 Post-Translational Modifications 32 1.7.3 Secondary Structure and Domains 34 1.7.4 Three-Dimensional Structures 36 1.8 Aim of This Study 38 2.0 M A T E R I A L S a n d M E T H O D S 39 2.1 Recombinant DNA Techniques 39 2.1.1 General Materials for Recombinant DNA Methods 39 2.1.2 Vectors 41 2.1.3 Bacterial Strain and Growth Media 42 2.1.4 Oligodeoxyribonucleotides 42 2.1.5 Digestion of DNA with Restriction Endonucleases 42 2.1.6 Agarose Gel Electrophoresis 44 2.1.7 Ligation of DNA Fragments 44 2.1.8 Transformation of E. coli 44 2.1.9 Amplification of DNA by the Polymerase Chain Reaction 45 2.1.10 DNA Sequence Analysis 45 2.1.11 Isolation of genomic DNA from Mammalian Cells 46 2.1.12 Preparation of a Radiolabeled DNA Probe 47 2.1.13 Southern Blot Analysis of Transfected Mammalian Cells 47 2.2 Construction of fX/PC Expression Vectors 48 2.2.1 Construction of pNUT-fX/PC 48 2.2.2 Construction of pNUT-fX(T"2R)/PC 50 2.2.3 Construction of pCI-neo-fX(T~2R)/PC 51 2.3 Transfection and Culture of Mammalian Cells 52 2.3.1 General Materials for Culturing Mammalian Cells 52 2.3.2 Mammalian Cell Lines, Cell Culture Media and Reagents 52 2.3.3 Transfection and Selection of Mammalian Cell Lines 53 2.3.4 Large-Scale Expression of FX/PC and FX(T~2R)/PC in Mammalian Cells 54 2.4 Purification of recombinant fX/PC Proteins 55 2.4.1 Immunoaffinity Chromatography 55 2.4.2 Hydroxyapatite Chromatography 56 2.5 General Protein Analysis Methods 57 2.5.1 SDS-PAGE 57 2.5.2 Western Blot Analysis 58 2.5.3 N-terminal Amino Acid Sequence Analysis 59 2.5.4 Determination of Protein Concentration 59 2.6 Assays of Purified fX/PC and fX(T~2R)/PC 60 2.6.1 General Materials used for Assays 60 2.6.2 Activation by R V V - X 60 2.6.3 Activation by Protac 61 2.6.3.1 Gel Assays 61 2.6.3.2 Amidolytic Assays 61 2.6.3.3 Kinetic Analysis of afX/PC, afX(T~2R)/PC and APC 62 2.6.4 Activated Partial Thromboplastin Time Assays 62 3.0 RESULTS 62 3.1 Expression of pNUT-fX/PC in BHK Cells 62 3.1.1 Construction of pNUT-fX/PC 62 3.1.2 Transfection and Selection of Cell Lines Expressing pNUT-fX/PC 63 3.1.3 Southern Blot Analysis of Genomic DNA from B H K Cell Lines 69 3.1.4 Purification of fX/PC Expressed in BHK Cells 69 3.1.5 Activation of fX/PC-BHK by R V V - X 76 3.1.6 Activation of fX/PC-BHK by Protac 76 3.1.7 APTT Assays with fX/PC-BHK 79 3.1.8 Kinetic analysis of fX/PC-BHK 79 3.2 Expression of pNUT-fX(T" 2R)/PC in BHK Cells 79 3.2.1 Construction of pNUT-fX(T~ 2R)/PC 79 3.2.2 Transfection and Selection of Cell Lines Expressing pNUT-fX(T" 2R)/PC 82 3.2.3 Purification and Analysis of fX(T~2R)/PC Expressed in B H K Cells 82 3.3 Expression of pCI-neo-fX(T"2R)/PC in H E K 293A cells 85 3.3.1 Construction of pCI-neo-fX(T"2R)/PC 85 3.3.2 Selection of H E K 293A Cell Lines Expressing pCI-neo-fX(T~2R)/PC... 85 3.3.3 Purification of fX(T" 2R)/PC-HEK 86 3.3.4 Activation of fX(T~ 2R)/PC-HEK by R V V - X Activator 93 3.3.5 Activation of fX(T" 2R)/PC-HEK by Protac 96 3.3.6 Kinetic Analysis of fX(T~ 2R)/PC-HEK 96 3.3.7 APTT assays with a fX(T" 2R)/PC-HEK 100 4.0 DISCUSSIO N 101 BIBLIOGRAPHY 112 vi List of Tables Table 1 Oligodeoxyribonucleotides 42 Table 2 N-terminal amino acid sequences obtained from fX/PC-BHK 74 Table 3 Activated partial thromboplastin time assays with fX/PC-BHK 79 Table 4 N-terminal amino acid sequences obtained from fX(T~2R)/PC-HEK 89 Table 5 Activated partial thromboplastin time assays with fX(T"2R)/PC-HEK 100 List of Figures Fig. 1 The coagulation cascade 3 Fig. 2 A model for the Tenase complex of the intrinsic pathway 12 Fig. 3 The protein C anticoagulant pathway 16 Fig. 4 Schematic models of the activation and inactivation of factors Va and Villa 20 Fig. 5 Members of the family of trypsin-like serine proteases 29 Fig. 6 Structures of human fX and human PC 36 Fig. 7 Hypothetical mode of action of the recombinant fX/PC chimeric protein 38 Fig. 8 Experimental design 63 Fig. 9 The DNA and amino acid sequences of the fX/PC cDNA construct 65 Fig. 10 Western blot analysis of medium from fX/PC-BHK cell clones 67 Fig. 11 Southern blot analysis of the BHK-fX/PC-5 clonal cell-line 69 Fig. 12 Effect of Gentle Elution Buffer on the amidolytic activity of APC 70 Fig. 13 Purification of fX/PC expressed in B H K cells 72 Fig. 14 Chromatograph of fX/PC-BHK separated on hydroxyapatite 73 Fig. 15 Activation of fX/PC-BHK by R V V - X 76 Fig. 16 Activation of PC and fX/PC-BHK with Protac 77 Fig. 17 Comparison of the rate of hydrolysis of SPCa by afX/PC-BHK and APC 80 Fig. 18 Chromatographic profile comparisons of fX/PC-BHK and fX(T~ 2R)/PC-BHK separated on hydroxyapatite 82 Fig. 19 SDS-PAGE analysis of purified fX(T~ 2R)/PC-BHK 83 Fig. 20 Chromatographic profile comparisons of fX/PC-BHK, fX(T~ 2R)/PC-BHK and fX(T" 2R)/PC-HEK separated on hydroxyapatite 86 Fig. 21 SDS-PAGE and western blot analyses of purified fX(T" 2R)/PC-HEK 87 Fig. 22 Yields of amino acid derivatives obtained during N-terminal sequence analysis of fX(T" 2R)/PC-HEK 90 Fig. 23 Time related changes in the degree of y-carboxylation of fX(T~ 2R)/PC-HEK as observed by hydroxyapatite chromatography 91 Fig. 24 Rapid purification of fX(T" 2R)/PC-HEK that included PMSF 93 Fig. 25 Time-course of activation of fX, PC and fX(T~ 2R)/PC-HEK by R V V - X 94 Fig. 26 Time-course of activation of PC and fX(T" 2R)/PC-HEK by Protac 96 Fig. 27 The rate of activation of fX(T~ 2R)/PC-HEK and PC by Protac 97 Fig. 28 Comparison of the rate of hydrolysis of SPCa by afX(T" 2R)/PC-HEK and APC. . 98 Fig. 29 Dose-response curve for afX(T" 2R)/PC-HEK in an APTT assay 100 List of Abbreviations viii [« - 3 5 S] -dATP 2'-deoxyadenosine 5'-triphosphate labeled with radioactive sulfur [cc-32P]-dCTP 2'-deoxycytidine 5'-triphosphate labeled with radioactive phosphorus afX/PC-BHK Activated fX/PC-BHK afX(T~ 2R)/PC-HEK Activated fX(T" 2R)/PC-HEK Amp Ampicillin - the semi-synthetic penicillin antibiotic Anti-fX L C A mouse anti-human fX monoclonal antibody specific for an epitope on the light chain of human fX Anti-PCHc A mouse anti-human PC monoclonal antibody specific for an epitope on the heavy chain of human PC APTT Activated Partial Thromboplastin Time assay ATP Adenosine 5'-triphosphate APC Activated protein C BCIP 5-Bromo-4-chloro-3-indolyl phosphate (disodium salt) B H K A Syrian Baby Hamster Kidney cell line bp Basepairs (of DNA) BSA Albumin isolated from bovine plasma CAPS The buffer 3-(cyclohexylamino)-l-propane-sulfonic acid cDNA Complementary DNA dATP 2'-deoxyadenosine 5'-triphosphate dCTP 2'-deoxycytidine 5'-triphosphate dGTP 2'-deoxyguanosine 5 '-triphosphate d H 2 0 Distilled water dNTPs A mixture of dATP, dCTP, dGTP and dTTP dTTP 2'-deoxythymidine 5'-triphosphate ddATP 2',3'-dideoxyadenosine 5'-triphosphate ddCTP 2',3'-dideoxycytidine 5'-triphosphate ddGTP 2',3'-dideoxyguanosine 5'-triphosphate ddNTPs A mixture of ddATP, ddCTP, ddGTP and ddTTP ddTTP 2',3'-dideoxythymidine 5'-triphosphate DX-9065A An active site inhibitor of factor Xa. E D T A Ethylenediamine-tetra acetic acid (disodium salt) E G F Epidermal growth factor FPLC Fast Phase Liquid Chromatography fX Human factor X derived from plasma (unless otherwise stated) fX/PC A chimeric protein comprising the light chain and activation peptide of fX and the serine protease domain of PC fX/PC-BHK FX/PC expressed in B H K cells fX(T~2R)/PC FX/PC with a Thr to Arg substitution at position -2 in the propeptide fX(T" 2R)/PC-BHK FX(T~ 2R)/PC expressed in B H K cells fX(T" 2R)/PC-HEK FX/(T _ 2R)/PC expressed in H E K cells G-418 G-418 sulfate (Geneticin) - an aminoglycoside antibiotic Gla y-Carboxyglutamic acid ix HEK 293A An adenovirus transformed human embryonic kidney cell line HEPES The buffer 4-(2-hydroxyethyl)piperazine-l-ethanesulfonic acid IPTG Isopropylthio-/J-galactoside - an inducer of the lac promoter ITSAK A supplement for mammalian cell culture containing insulin, transferrin, selenium, albumax and vitamin K kDa KiloDaltons Kbp Kilobasepairs (of DNA) K m The Michaelis constant - equivalent to the substrate concentration that yields half-maximal velocity (Vm a x) of a reaction KSRK An additive (Knockout SR) for mammalian cell culture supplemented with vitamin K LB Luria-Bertani medium for culturing Escherichia coli MTX Methotrexate - an analog of folate NBS Newborn calf serum - a supplement for mammalian cell culture NBT Nitro Blue Tetrazolium (2'2'-di-/?-nitrophenyl-5,5'-diphenyl-3,3'-[3,3' -dimethoxy-4,4' -diphenylene] ditetrazolium chloride PC Human protein C derived from plasma (unless otherwise stated) pCI-neo A mammalian expression vector containing a heomycinR marker PCR Polymerase Chain Reaction PMSF Phenylmethylsulfonyl fluoride - an inhibitor of serine and thiol proteases pNUT A mammalian expression vector containing a methotrexate resistance marker PPACK D-Phe-Pro-Arg chloromethylketone Protac A protein C-activating enzyme purified from the venom of the southern copperhead snake (Agkistrodon contortix) PVDF Polyvinylidene difluoride (membrane) r-PC Recombinant human protein C (unless otherwise stated) r-fX Recombinant human factor X (unless otherwise stated) RVV-X A factor X-activating enzyme purified from the venom of Russell's viper, (Vipera russelli) SDS Sodium dodecyl sulfate - an anionic detergent SDS-PAGE Sodium dodecyl sulfate-polyacrylamide gel electrophoresis SSC Standard saline citrate solution Taq Thermus aquaticus DNA polymerase TAE A buffer comprising 0.04 M Tris-acetate/1 mM EDTA, pH 8.0 TBE A buffer comprising 90 mM Tris-borate/2 mM EDTA, pH 8.0 TBS Tris-buffered saline (150 mM NaCl/10 mM Tris-HCl, pH 7.5) TE A buffer comprising 10 mM Tris-HCl and 1 mM EDTA, prepared at various pH values TEMED NJSJST ,AP -tetramethylethylenediamine Tris The buffer tris(hydroxymethyl)aminomethane Vmax The limiting maximal velocity of a reaction that would be observed when all the enzyme is present as an enzyme/substrate complex X-Gal 5-bromo-4-chloro-3-indolyl-j3-D-galactoside - a colorimetric substrate for /J-galactosidase Acknowledgements / wish to express my warmest thanks to: -Ross MacGillivray, my wonderful supervisor, who could always make me laugh and who made me realize that a bad hair day was not advantageous; -Cedric Carter, the closest thing to a celebrity that I will ever know; -Rob McMaster and Peter Candido for their guidance; -Alexis Maxwell, a fellow Aquarian, who sees things the way they are; -Pat Robertson for proving that Murphy's Law is really true; -Hugh Hoogendorn for providing me with affinity resins and advice; -Linda and Jeff Stenberg, my beloved siblings; -Mark Brown, the love of my life, for his brain, among other things; Adelaide Stenberg, my mother, and the other love of my life, and to whom I dedicate this thesis. 1.0 INTRODUCTION 1 . 1 The Coagulation Cascade 1.1.1 Role of the C o a g u l a t i o n Cascade i n Hemostasis The hemostatic mechanism is designed to arrest bleeding from damaged blood vessels in a rapid and localized fashion without compromising the fluidity of circulating blood. To achieve this, a complex interaction among blood vessels, platelets, and the coagulation cascade is required to form a stable seal at the site of injury (a clot) that subsequently undergoes slow removal by fibrinolysis. This is a complicated process involving tightly integrated systems of activation and inhibition to minimize both excessive bleeding and unwanted thrombosis and thus the ability to maintain hemostasis can be viewed as a remarkable biophysical achievement. Injury to the vascular endothelium results in rapid vasoconstriction and the adherence of platelets to collagenous components of the subendothelial connective tissue (Majerus, 1987). The adhesion and subsequent spreading of platelets on the subendothelium is mediated through an interaction between the glycoprotein Ib/IX complex on the platelet cell membrane and von Willebrand factor released from endothelial cells at the site of injury (Rock and Wells, 1997). Activation of the attached platelets by various agonists such as thrombin, ADP and epinephrine stimulates the secretion of a vast array of constituents stored in dense bodies (serotonin, Ca2 +, ATP, ADP, pyrophosphate) and alpha granules (including fibrinogen, thrombospondin, /?-thromboglobulin, platelet factor 4, albumin, von Willebrand factor, fibronectin, factor V, ctvmacroglobulin, vitronectin, a rantitrypsin, histidine-rich glycoprotein and platelet-derived growth factor) (Goyette, 1997; Rock and Wells, 1997). Platelet activation also involves the Ilb/IIIa complex on the cell surface, which acts as a receptor for fibrinogen, fibronectin and von Willebrand factor. Binding of fibrinogen to Ilb/IIIa complexes present on adjacent platelets leads to platelet aggregation and the formation of a platelet plug. This primary hemostatic mechanism temporarily slows bleeding until the platelet plug can be reinforced by fibrin strands (Tuddenham and Cooper, 1994b). The formation of a fibrin clot, a process that reinforces the hemostatic plug until vessel wall integrity is restored, is termed secondary hemostasis and involves the coagulation cascade. During the platelet aggregation phase of hemostasis, negatively charged phospholipids (especially phosphatidylserine) located inside the platelet cell membrane are translocated to the outer membrane surface. Presentation of these phospholipids initiates the assembly of two protein complexes on the cell surface that are key components in the generation of thrombin, i.e. the "Tenase" complex, comprising activated factor IX (fTXa) and a cofactor, activated 2 factor Villa (fVIIIa), and the "Prothrombinase" complex, comprising activated factor X (fXa) and a cofactor, activated factor V (fVa) (Monroe et al, 1994). The thrombin that is subsequently generated participates in multiple processes; it cleaves soluble fibrinogen to insoluble fibrin which spontaneously polymerizes to form the basis of a stable clot (Davie et al., 1991), it proteolytically activates factor XIII, an enzyme involved in cross-linking the fibrin polymers (Friezner Degen, 1995), it amplifies the generation of more thrombin by proteolytically activating factors V and VIII, and it activates platelets by specifically cleaving two cell surface receptors (Bahou et al, 1994; Coughlin et al., 1992; Vu et al., 1991). 1.1.2 Initiation and Maintenance of the Coagulation Response The process of blood coagulation comprises a cascade-like series of proteolytic reactions which serve to amplify a small initial stimulus by the sequential conversion of inactive zymogens to active serine proteases (Davie, 1995). These reactions are catalyzed on negatively charged phospholipid membranes and are accelerated by protein cofactors that act either by altering the conformation of the zymogen or by binding active enzymes and their zymogen substrates in close proximity on the membrane (Mann et ah, 1988). Historically, the initiation of the clotting cascade was divided into two series of reactions termed the intrinsic (Davie and Ratnoff, 1964; MacFarlane, 1964) and extrinsic (Nemerson and Pitlick, 1972) pathways, both of which converge at the point of activation of fX (Fig. 1). For many years it was proposed that the intrinsic pathway was the primary initiator of the coagulation cascade, triggered by exposure of the plasma 'contact' factors fXII, high molecular weight kininogen (HMWK) and prekallikrein (PK) to a negatively charged surface, with the subsequent activation of fXI to fXIa leading to activation of fIX. In the common portion of the pathway, fTXa (in the presence of fVIIIa, Ca 2 + and phospholipid) activates fX which then assembles on a phospholipid membrane in a complex with fVa and Ca 2 + and converts prothrombin to thrombin (Davie etal, 1991). However, because the role of the coagulation cascade is to prevent excessive bleeding after tissue damage, the intrinsic pathway could not account for the observation that patients lacking factor XII, prekallikrein or HMWK are asymptomatic and that patients with a deficiency of factor XI have a much milder tendency to bleed excessively than those patients with factor VIII or factor IX deficiencies (Luchtman-Jones and Broze, 1995). This, in addition to the clinical observation that patients with severe factor VII deficiency are prone to episodes of excessive bleeding (Chaing et al., 1994; Triplett et al, 1985), and experimental evidence that the fVIIa-tissue factor complex activates both fIX and fX (Nemerson, 1966; 0sterud and Rapaport, 1977), suggested that the extrinsic pathway was in fact the critical pathway initiating the formation of fibrin. Intrinsic Pathway Extrinsic Pathway Cross-linked fibrin FIGURE 1. The coagulation cascade. Coagulation is initiated via the extrinsic pathway following vascular injury and the exposure of tissue factor (TF) to the blood. In vitro, the cascade can be initiated via the intrinsic pathway following the exposure of the plasma 'contact' factors (XII, HMWK, PK) to a negatively charged surface. Initiation of coagulation results in a cascade-like series of proteolytic reactions which serve to amplify a small initial stimulus by the sequential conversion of inactive zymogens (XII, XI, VII, IX, X and prothrombin) to active serine proteases (Xlla, XIa, Vila, IXa, Xa and thrombin). These reactions are catalyzed on negatively charged phospholipid membranes (PL), are accelerated by protein cofactors (Villa and Va) and require calcium (Ca2+). The final effector enzyme of both pathways is thrombin which cleaves fibrinogen to form fibrin. Fibrin spontaneously polymerizes to form the basis of the insoluble clot. Although the extrinsic pathway is critical in the inititation of fibrin formation, the intrinsic pathway may play a role in maintaining fibrin formation as tissue regeneration occurs. It is now generally accepted that the main physiological initiator of blood coagulation is tissue factor (TF) acting via the extrinsic pathway (Broze, 1992). TF is an integral membrane glycoprotein of the endothelium that becomes exposed to the blood circulation after vascular injury, its extracellular domains then functioning as a receptor for fVII and fVIIa (0sterud, 1997). TF catalyzes the activation of fVII in a Ca2+-dependent reaction (Inoue et al, 1996; Wildgoose et al, 1993) and although the enzyme(s) responsible for this activation event in vivo has not been clearly identified, studies suggest that it may be effected by trace amounts of either factors IXa or Xa (Bajaj et al, 1981; Masys et al, 1982; Wildgoose and Kisiel, 1989), fVIIa (Neuenschwander et al, 1993; Pedersen et al, 1989) or thrombin (Radcliffe and Nemerson, 1975). TF is also an essential cofactor in the fVIIa-mediated activation of fIX and fX (Nemerson, 1966; 0sterud and Rapaport, 1977). According to the current model, an initial burst of fXa production provides sufficient thrombin to induce the local aggregation of platelets and activation of the critical cofactors fV and fVIII (Broze, 1992; Hoffman et al, 1995). This initial group of fXa molecules is rapidly inhibited by tissue factor plasma inhibitor (TFPI) (Rapaport, 1989) which, in association with fXa, complexes with fVIIa-TF and prevents further production of fIXa and fXa. However, the fIXa that has already been 2+ generated, in concert with fVIIIa and Ca , provides an ongoing supply of fXa that is necessary to ensure that sufficient thrombin is generated to sustain the response (Hoffman et al, 1995). It has been suggested by Broze (1995) that the initial quantity of fIXa generated by fVIIa-TF before its inhibition by TFPI may be inadequate under certain conditions (e.g. at sites of high fibrinolytic activity) and that additional fIXa generated by the action of fXIa may be needed for normal hemostasis. Consistent with this, it has been shown that thrombin can activate factor XI in the presence of a negatively charged surface and that, in the presence of dextran sulfate, auto-activation of factor XI can occur (Gailani and Broze, 1993; Naito and Fujikawa, 1991). The formation and slow turnover of fibrin is important as tissue regeneration and remodeling occurs. During this gradual process of fibrin degradation it is likely that the intrinsic pathway actively maintains the clot structure (Davie et al, 1991). Thus, although the extrinsic pathway is critical in the initiation of fibrin formation, the intrinsic pathway may play a role in promoting and maintaining fibrin formation. 5 1.1.3 Fibrin Formation and Fibrinolysis The final effector enzyme of both the extrinsic and intrinsic coagulation pathways is thrombin, the protease responsible for cleaving fibrinogen to form fibrin (Davie et al., 1991). Fibrinogen is an elongated dimeric molecule containing two identical halves, each of which comprises three disulfide-linked polypeptides; the ce(A), /3(B) and /chains (Blomback and Blomback, 1972). Thrombin cleaves a peptide bond in each of the two a and B chains of fibrinogen to release four fibrinopeptides (two are denoted as fibrinopeptide A and two as fibrinopeptide B) (Blomback, 1996). Release of fibrinopeptides A and B from fibrinogen exposes charged binding sites in the amino-terminal region of the fibrin monomer that mediate polymerization. Polymer assembly commences with the formation of double-stranded fibrils in which fibrin molecules, by virtue of non-covalent inter-molecular interactions, are arranged into a staggered overlapping structure (Crabtree, 1987; Mosesson, 1992). Once fibrin is formed it accelerates the activation of fXIII by thrombin (a Ca2+-dependent reaction). In the presence of fXIIIa, the fibrin is cross-linked by e-(/-Glu)Lys isopeptide bonds, which form initially between the /chains and, later, between the Cf chains. These reactions generate the insoluble fibrin clot which maintains the integrity of the circulatory system following perforation of the vessel wall (Davie et al., 1991; Mosesson, 1992). Both the formation and turnover of fibrin is important as tissue regeneration and remodeling occurs. Dissolution of the fibrin clot (fibrinolysis) is initiated when fibrin is formed, with plasmin accounting for the majority of the fibrinolytic activity. Plasmin circulates in plasma as a zymogen, plasminogen. Plasminogen has a high affinity for fibrin and is activated, after it binds to fibrin, by the endothelial protein, tissue-type plasminogen activator (t-PA). Plasmin specifically cleaves each of the three chains of fibrin to release a variety of degradation products (Collen and Lijnen, 1987; Crabtree, 1987). This fibrinolytic system is regulated mainly by the plasmin inhibitor ctrantiplasmin, and the t-PA inhibitor, plasminogen activator inhibitor-1 (PAI-1) (Blomback, 1996). 1.1.4 Regulation of the Clotting System In normal hemostasis, the procoagulant system is in balance with anticoagulant systems involved in termination of the hemostatic reaction and with the fibrinolytic system. The anticoagulant systems comprise the protein C pathway and several stoichiometric protease inhibitors, including tissue factor pathway inhibitor and antithrombin. 6 1.1.4.1 Activated Protein C Activation of the circulating zymogen protein C (PC) is a principal system regulating the coagulation cascade (Dahlback, 1995b). PC is activated to a serine protease (activated protein C; APC) by a complex comprising thrombin and thrombomodulin that is located on the endothelial surface. APC functions as an anticoagulant by inactivating both fVa (Kalafatis et ai, 1994a) and fVIIIa (Fay et al., 1991b) by limited proteolysis. This system is mentioned in detail below (see section 1.3). 1.1.4.2 Tissue Factor Pathway Inhibitor The initiation of coagulation by the extrinsic pathway is controlled by tissue factor pathway inhibitor (TFPI). TFPI inhibits fXa directly (Baugh et al., 1998; Rapaport, 1989) and, in a fXa-dependent manner (Valentin and Schousboe, 1996), instigates feedback inhibition of the fVIIa-TF complex to attenuate further generation of fIXa and fXa (Broze, 1992; Rapaport and Rao, 1995). Through the action of TFPI, activation via the extrinsic pathway is probably a short-lived event. 1.1.4.3 Antithrombin Antithrombin (AT), also called antithrombin III, is one of the most abundant and active circulating inhibitors of the serine proteases that are involved in coagulation. The main targets of AT are thrombin and fXa (Sheffield et ah, 1995), although recent studies have revealed that AT can also inhibit the fVIIa bound to TF (Rao et al, 1995; van't Veer and Mann, 1997). AT belongs to the serpin (serine protease inhibitor) family of proteins which contain an exposed surface loop that mimics an ideal substrate for the target protease (Stone and Hermans, 1995). Cleavage of this loop results in formation of an equimolar covalent complex between the active site of the protease and the reactive centre of AT. In the presence of heparin (a complex glycosaminoglycan), the inhibitory activity of AT is increased several thousand-fold (Edens et al., 1995). Heparin does not occur naturally in the circulation but is thought to have a physiological counterpart in heparan sulfate, found on the surface of endothelial cells (Pratt and Church, 1992). It should be mentioned that other protease inhibitors that may play an important role in the regulation of coagulation are a2-macroglobulin (Sottrup-Jensen, 1987), and the serpins heparin co-factor II (Church et al, 1995), a,\-antitrypsin (Carrell and Travis, 1985; Marlar et al, 1993) and protein C inhibitor (Suzuki, 1993). 1.2 T h e Tenase a n d P r o t h r o m b i n a s e Comp lexes The interaction of platelets and coagulation factors is essential for normal coagulation and hemostasis. Activated platelets promote the rate of two key reactions in the coagulation cascade: the activation of fX to fXa by a complex of fIXa, fVIIIa, and Ca 2 + ions termed the Tenase complex (Ahmad et al, 1992), and the activation of prothrombin to thrombin by a 2+ complex of fXa, fVa, and Ca ions denoted the Prothrombinase complex (Krishnaswamy et al, 1993). 1.2.1 Components of the Tenase Complex 1.2.1.1 Factor IX The serine protease factor IX, certain mutations in which give rise to hemophilia B, is synthesized in the liver and secreted into the plasma as a single-chain zymogen. During hemostasis, fIX may be activated by either the fVIIa-TF complex or fXIa in the presence of Ca 2 + (Bajaj and Birktoft, 1993). Activation occurs in two steps. First, the Argl45-Alal46 peptide bond in fIX is hydrolyzed to produce a two-chain inactive intermediate, fIXa, comprising a light chain (residues 1-145) disulfide-bonded to a heavy chain (residues 146-415). This cleavage is thought to expose a binding site for fVIIIa (Lenting et ah, 1995). Second, the heavy chain of fIXa is cleaved at the Argl80-Vall81 bond to release a heavily glycosylated 35-residue activation peptide (Agarwala et al., 1994), thereby forming the active protease fIXa£ (fIXa) (Di Scipio et al, 1978). The extreme N-terminal domain of the light chain of human fIX contains y-carboxy-glutamic acid (Gla) residues resulting from post-translational modification of the first 12 glutamyl residues to the dicarboxylic form by a vitamin K-dependent carboxylase (Galeffi and Brownlee, 1987; Stenflo etal, 1975; Suttie, 1985). Adjacent to the "Gla" domain are two epidermal growth factor-like domains (EGF1 and EGF2). The heavy chain contains the serine protease domain. Existing evidence indicates that the Gla domain participates in binding to phospholipids on the surface of endothelial cells (Cheung et al, 1996; Freedman et al, 1996; Toomey et al, 1992) and activated platelets (Ahmad et al, 1989b, 1995; Rawala-Sheikh et al, 1992). In vitro, these surfaces can be mimicked by negatively charged phospholipid vesicles (London and Walsh, 1996). The Gla domain (Schwalbe et al, 1989), the EGF1 domain (Astermark et al, 1991; Handford et al, 1995), and the protease domain (Astermark et al, 2+ 1994; Bajaj et al, 1992) have all been shown to bind Ca . Considerable experimental data suggests that the heavy chain and both EGF-like domains of the light chain interact with fVIIIa in the Tenase complex (Astermark and Stenflo, 1991; Bajaj et al, 1985; Christophe et al, 1998; Lin etal, 1990; Rees etal, 1988). 1.2.1.2 Factor VIII Factor VIII is a non-enzymatic cofactor of the Tenase complex that accelerates the activation of fX by fFXa and which is inactive or absent in individuals with hemophilia A (Antonarakis, 1995) . FVIII is synthesized as a single -300 kDa polypeptide and its primary structure exhibits three distinct structural regions; a triplicated region comprising three ~330-amino acid 'A domains', a connecting region of 980 amino acids (the 'B domain'), and a carboxy-terminal duplicated region comprising two 150-amino acid 'C domains'. The domains are arranged in the order A1-A2-B-A3-C1-C2 (Vehar et al, 1984). Factor VIII circulates in blood as a mixture of inactive hetero-dimers resulting from proteolysis at the B-A3 junction and at sites within the B domain (Fay, 1993). The circulating molecule contains a light chain comprising the A3-C1-C2 domains that is non-covalently linked by a divalent metal ion to a heavy chain (minimally represented by the A1-A2 domains but variable in size due to the presence of some or all of the B domain) (Fay and Smudzin, 1992). The B domain of fVIII has no known function. Recombinant variant fVIII molecules lacking this domain possess normal coagulant activity (Toole et al, 1986) and recombinant chimeras in which the B domain has been exchanged for the corresponding (although highly dissimilar) domain of fV have activities similar to that of wild-type fVIII (Pittman et al, 1994). Thus the B domain may function simply to separate the heavy and light chains of fVIII prior to its activation. In vivo, fVIII circulates in a non-covalently bound complex with von Willebrand factor (vWf) (Meyer and Girma, 1993) and this interaction is necessary to prolong its survival in the circulation (Koppelman et al, 1996). The light chain of fVIII contains binding sites for vWf (Foster et al, 1988), APC (Walker and Fay, 1990), fIXa (Fay et al, 1994; Lenting et al, 1996) and phospholipid (Gilbert and Baleja, 1995). In addition, there is evidence that fVIII can specifically bind to protein S (Koppelman etal, 1995). Upon initiation of the coagulation cascade both thrombin and fXa activate fVIII by limited proteolysis. However, since fXa has only about 20% of the efficiency of thrombin for this reaction (Lollar et al, 1985), and is unable to activate the pool of fVIII bound to vWf (Koedam et al, 1990), it has been suggested that thrombin is the sole activator of fVIII in TF-activated plasma (Pieters et al, 1989). Activation of fVIII by thrombin is the result of cleavages at the junctions of the A1-A2 (Arg372) and A2-B (Arg740) domains of the heavy chain, and within the A3 domain of the light chain (at Argl689) (Eaton et al, 1986). Factor Villa is a hetero-trimer in which the A2 subunit associates weakly with the divalent metal ion-linked A1/A3-C1-C2 dimer, possibly by interacting with acidic residues in the C-terminus of 9 the A l domain (Fay et al, 1991a). The activity of fVIIIa is markedly labile due to spontaneous decay and this most likely reflects dissociation of the A2 subunit (Fay et al, 1991a). Factor IXa and phospholipid both stabilize fVIIIa, possibly by tethering sites within the A1/A3-C1-C2 dimer and the A2 subunit (Fay et al, 1996; Lamphear and Fay, 1992). The functions of the thrombin-mediated cleavages in fVIII are not particularly well understood. However, cleavage of the light chain releases vWf (Hill-Eubanks et al, 1989), a large glycoprotein which inhibits fVIII from associating with phospholipids (Andersson and Brown, 1981) and activated platelets (Nesheim et al, 1991), and thereby allows the C2 domain to bind to phospholipid (Foster et al, 1990b). Membrane-bound fVIIIa provides high affinity binding sites for fIXa on the surface of platelets (Ahmad et al, 1989a,c) and phospholipid vesicles (Duffy et al, 1992), and the assembly of a functional Tenase complex, a Ca2+-dependent process, depends directly on the binding of fIXa to a high affinity site in the A3 domain of fVIIIa (Lenting et al, 1996). In addition, two fIXa recognition sites have also been identified within the A2 domain (Fay et al, 1994; Fay and Koshibu, 1998) and suggests that regions in both the heavy and light chains of fVIIIa participate in formation of the Tenase complex. Although fIXa can activate fX in the absence of fVIIIa, phospholipid, and C a 2 + ions, the reaction rate is extremely slow. Using purified bovine components, van Dieijen (1981) 2+ showed that addition of Ca to a reaction mixture containing fIXa and fX had little effect on either the affinity of the enzyme for the substrate (i.e. the Michaelis constant or K m ) or the velocity of the reaction ( V m a x ) . Inclusion of phospholipid had little effect on V m a x but decreased the apparent K m by 3000-fold, presumably by effectively concentrating fIXa and fX on the vesicular surface (Mann et al, 1988). Addition of fVIIIa to the reaction mixture caused a dramatic 200,000-fold increase in V m a x , an effect reflecting the binding of fVIIIa to both fIXa and fX and hence increasing the forward rate constant. Similar kinetic studies with the human proteins have noted that fVIIIa causes a dramatic increase in V m a x but only modestly decreases the K m for fX activation (Hultin, 1982; Rawala-Sheikh et al, 1990). One explanation for its pronounced effect on V m a x is that fVIIIa binds to fIXa and induces a conformational change in the enzyme which increases its activity toward the scissile bond in fX. Direct evidence for such an allosteric mechanism was provided by studies employing a fIXa derivative which had been fluorescently labeled at the active site: fVIIIa was observed to induce a conformational change in the active site without altering its distance from the phospholipid surface (Duffy et al, 1992; Mutucumarana et al, 1992). 10 1.2.1.3 Factor X The substrate for the Tenase complex, fX, is synthesized in the liver as a single-chain polypeptide and secreted into the plasma as a two-chain glycosylated zymogen with a molecular mass of -59 kDa (Di Scipio et al, 1977a,b; Fung et al, 1985; Leytus et al, 1984). Its concentration in plasma is approximately 10 fig/ml (Furie and Furie, 1988) and its half-life 40-48 hours (Furie et al, 1977; Roberts et al, 1965; Xi et al, 1989). Circulating fX consists of a light chain (-17 kDa) and a heavy chain (-42 kDa) bonded through a single cystine. Like flX, the light chain of fX possesses an amino-terminal Gla domain (containing 11 Gla residues; Di Scipio et al, 1977b) that is connected by a short stretch of hydrophobic amino acids to two EGF-like domains (EGF1 and EGF2). The heavy chain contains the serine protease domain. Activation of fX can occur at either at the Tenase complex of the intrinsic pathway or at the fVIIa-TF complex of the extrinsic pathway (Davie etal, 1991). Both complexes activate fX to fXaa (fXa) by cleaving the amino-terminal end of the heavy chain at the Arg52-Ile53 bond (corresponding to Arg 194—Ile 195 in the single-chain precursor), thereby releasing a small (-14 kDa) activation peptide of 52 amino acids (Di Scipio et al, 1977a). The Arg52-Ile53 bond can also be hydrolyzed by the fX-activating protein from Russell's viper venom (RVV-X) (Gowda et al, 1994; Kisiel et al, 1976b). The activation peptide of human fX is heavily glycosylated and contains both AMinked and O-linked carbohydrate (Di Scipio et al, 1977a; Inoue and Morita, 1993). These carbohydrate structures may be involved in the recognition and cleavage of fX by the Tenase and fVIIa-TF complexes since a drastic reduction in the rate and extent of activation of human fX is observed following enzymatic removal of sialic acid (Inoue and Morita, 1993; Sinha and Wolf, 1993). Furthermore, the removal of both sialic acid and 0-linked carbohydrate (but not Af-glycans) from bovine fX reduces its rate of activation by the fVIIa-TF complex and R V V - X (Inoue and Morita, 1993). Other studies have also indicated that the activation peptide plays a role in the activation of fX by the Tenase complex. Duffy and Lollar (1992) employed a novel derivative of porcine IX in which 49 residues had been enzymatically removed from the amino-terminus of the activation peptide. This modified fX zymogen contained no detectable enzymatic activity but could be activated by the Tenase complex and RVV-X. Kinetic analysis revealed that residues P 4 - P 5 2 of the activation peptide (relative to the site of cleavage) do not contribute to the initial formation of the enzyme-substrate complex (the K m for activation of the fX derivative did not differ from that of native fX) but that residues amino-terminal to the P 3 residue do participate in the rate-limiting catalytic step in fX activation (the rate of activation of the derivative by the Tenase complex was reduced relative to native fX). In a 11 study using the isolated fX activation peptide, lino et al. (1994) observed that the activation peptide could mediate interactions between fX and fIXa within the Tenase complex in a carbohydrate-dependent manner. However, other researchers have found that removal of sialic acid has no detectable effect on activation of human fX (Bharadwaj et al., 1995) and that removal of the first 49 residues of the activation peptide (and, hence, the attached carbohydrate), has no significant effect on the recognition of human fX by the fVIIa-TF complex (Baugh and Krishnaswamy, 1996). The reason for these conflicting observations is not clear. Although not well characterized, a second sub-form of fXa, factor XaB, results from auto-catalytic cleavage of fXaa at an Arg-Gly bond near the carboxy-terminus of the heavy chain which releases a 4 kDa fragment termed the j3-peptide (Jesty et al, 1974, 1975). Studies comparing the activities of the fXa sub-forms are contradictory. While one report suggests that fXaa has greater specific activity than fXa/? (Jesty and Esnouf, 1973), others have reported similar activities for the two sub-forms (Fujikawa et al, 1972; Jesty et al, 1974, 1975). More recent studies have proposed that auto-proteolysis or plasmin-mediated cleavage of fXacu exposes a plasminogen binding site on the molecule and alters its role in hemostasis from a procoagulant to a profibrinolytic component (Pryzdial and Kessler, 1996a); that is, fXaa is predominantly responsible for thrombin generation whereas its conversion to fXa/? coordinates coagulation and the initiation of fibrinolysis at sites at which the prothrombinase complex has been assembled (Pryzdial and Kessler, 1996b). 1.2.1.4 A Model for the Tenase Complex The determination of the three-dimensional structure of porcine fIXa allowed the formulation of an interesting model of the membrane-bound Tenase complex (Brandstetter et al, 1995). This is represented schematically in Fig. 2. The model depicts both fIXa and fX arching across fVIIIa from opposite sides so that the active site of fIXa is juxtaposed with the scissile bond of fX. This arrangement is compatible with predictions of the various inter-molecular contacts formed within the Tenase complex. FVIIIa possesses a high affinity binding site for fIXa in the A3 subunit (Lenting et al, 1996) and sites with weaker affinities in the A2 subunit (Fay et al, 1994; Fay and Koshibu, 1998). Lapan and Fay (1997) provided evidence that the A l subunit of fVIIIa contains a primary fX binding site that contacts the heavy chain of fX. In addition, both the light and heavy chains of fIXa, and especially the EGF2 and catalytic domains, have been shown to interact with fVIIIa (Astermark et al, 1992; Bajaj et al, 1985; Hertzberg et al, 1992; Lin et al, 1990). These interactions may force the catalytic modules of fIXa and fX together, FIGURE 2. A model for the Tenase complex of the intrinsic pathway. The model depicts both fIXa and fX arching across fVIIIa from opposite sides so that the active site of fIXa is juxtaposed with the activation cleavage site of fX. This arrangement is compatible with predictions of the various inter-molecular contacts formed between fVIIIa and the E G F 2 and catalytic domains of fIXa. 13 modulating the conformation of the active site of fIXa and enhancing its catalytic rate. This could explain why in the absence of phospholipid fVIIIa greatly enhances V m a x but minimally affects the K m of fX activation, since the energy of cofactor binding could be used to adjust the conformation of the active site of fIXa. The presence of phospholipid would reduce the degrees of freedom by 'pre-orienting' the factors for complexation and thus lead to a reduction in K m and a further enhancement of V m a x (Brandstetter et al, 1995). The interaction of fX with the Tenase complex may be preceded by its binding to a non-specific "zymogen binding site" on activated platelets (Scandura and Ahmad, 1996) as studies indicate that platelet-bound fX is preferentially activated on the surface of activated platelets (Scandura and Walsh, 1996). This suggests that IX reaches platelet-bound fIXa via a coupled, two-step mechanism: fX first diffuses to the surface from three dimensions and then diffuses to the Tenase complex in two dimensions rather than colliding directly with platelet-bound flXa from the fluid phase (McGee et al, 1992; Scandura and Walsh, 1996). 1.2.2 The Prothrombinase Complex The proteolytic conversion of prothrombin to thrombin is a requisite step of the coagulation cascade. This reaction is catalyzed by the Prothrombinase complex, comprising fXa, fVa and C a 2 + ions, which is assembled on membranes containing acidic phospholipids (Jackson and Nemerson, 1980; Mann et al, 1988, 1990). Thus, as in the Tenase complex, protein-protein, protein-metal ion and protein-membrane interactions are involved in assembly of the prothrombinase complex and expression of its activity (Krishnaswamy et al, 1993). FXa activates human prothrombin by two sequential proteolytic cleavages. The first, at the Arg271-Thr272 bond, releases a large activation peptide (prothrombin fragment 1+2) containing the Gla domain and two "kringle" domains. A second cleavage at the Arg320-Ile321 bond produces the enzymatically active dimer, a-thrombin, which contains light and heavy chains joined by a single disulfide bond (Tuddenham and Cooper, 1994a). At a physiological concentration of prothrombin, the rate of thrombin formation by fXa is increased by a factor of 105—106 when fXa is assembled into the Prothrombinase complex (Mann et al, 1988; Nesheim et al, 1979). Kinetic measurements made under steady 2+ state conditions have generally shown that membranes, in the presence of Ca , decrease the K m of fXa for prothrombin 100-1000-fold whereas in the absence of phospholipid, fVa increases V m a x for the reaction about 1000-fold (Kane and Davie, 1988; Krishnaswamy et al, 1987; Nesheim et al, 1979). It has been proposed that fVa binds directly to platelets and provides at least part of the receptor for fXa (Miletich et al, 1979; Tracy et al, 1981) although more recent work suggests that platelets may also possess other fXa receptor elements (Larson etal, 1998). Factor V, which does not bind to fXa prior to its activation, circulates as a single-chain polypeptide of -330 kDa comprising three A domains, two C domains, and a connecting B region (Suzuki et al, 1982). Although thrombin is the main physiological activator of fV, initial activation in the presence of C a 2 + and phospholipid is most likely due to fXa generated by the fYIIa-TF complex, since no thrombin is present at this stage to promote feedback activation reactions (Monkovic and Tracy, 1990). Thrombin cleaves fV at three sites to release the B domain (in the form of a 170 kDa activation peptide) with the concomitant generation of cofactor activity (Kalafatis et al, 1993). FVa is composed of a heavy chain (the A1-A2 2+ domains) and a light chain (the A3-C1-C2 domains) and these are held together by Ca ions (Kane and Davie, 1988). In the presence of C a 2 + , fXa forms a one-to-one complex with fYa on phospholipid surfaces and this binding event is not dependent on the substrate prothrombin (Krishnaswamy, 1990; Krishnaswamy et al, 1987; Tracy et al, 1981). Contributions from the heavy and light chains of fVa appear to be important in this interaction (Kalafatis et al, 1994b; Kojima et al, 1998) and it has been demonstrated that the EGF2 and serine protease domains of fXa are sufficient to effect binding (Chattopadhyay et al, 1992; Hertzberg et al, 1992). Determinants within the second kringle domain of prothrombin are involved in its interaction with fV a (Kotkow etal, 1995). Because fXa and prothrombin can both bind to fV a, the increase in catalytic rate conferred by the cofactor suggests that it may allosterically modulate the active site of fXa. It may do so by inducing a conformation that is more complementary to the transition state and/or altering the structure around the scissile bond of prothrombin (Jackson and Nemerson, 1980 ; Mann et al, 1988). Such allosteric alterations to the active site of fXa have been inferred from studies using fluorescence energy transfer (Husten et al, 1987). However, a study of the reaction of fXa with a fluorescent peptidyl chloromethyl ketone inhibitor, both in the presence and absence of the other prothrombinase components, did not detect an alteration in the catalytic residues of fXa and suggests that fV a may instead induce conformational changes at sites remote from the catalytic residues (Krishnaswamy et al, 1994). In addition to these allosteric alterations, the interaction of fXa with fYa appears to alter the distance of its active site relative to the membrane, the effect of which, could also contribute to the proper alignment of the protease with its substrate, prothrombin (Husten et al, 1987). 1 . 3 T h e P r o t e i n C A n t i c o a g u l a n t P a t h w a y The protein C (PC) anticoagulant pathway is one of the main regulatory mechanisms responsible for controlling the coagulation cascade (Fig. 3). It exerts this control by selectively inactivating the coagulation cofactors fVa and fVIIIa through the action of activated protein C (APC) (Dahlback, 1995b; Esmon, 1992). APC is formed after thrombomodulin, an integral membrane protein found primarily in endothelial cells, binds thrombin, an interaction that changes the substrate specificity of thrombin from fibrinogen to PC and thus imparts an anticoagulant rather than procoagulant activity upon thrombin (Esmon et al, 1982; Kisiel et al, 1977; Marlar et al, 1982). By inactivating fVa and fVIIIa, APC thereby controls the formation of fXa and thrombin. For expression of optimal anticoagulant activity, APC requires at least one cofactor, protein S (Walker, 1984), and perhaps also a second, fV (Dahlback and Hildebrand, 1994). 1.3.1 Protein C Human PC is a glycosylated vitamin K-dependent serine protease that is synthesized in the liver as a zymogen and secreted into the blood (Foster and Davie, 1984; Plutzky et al, 1986; Stenflo, 1976). The plasma concentration of PC is approximately 4 flglvsA (Griffin et al, 1982) and it has a half-life in the circulation of 7-10 hours (Marlar, 1985b; Okajima et al, 1990b). Although a portion (5-15%) of PC circulates as a single polypeptide chain (Greffe et al, 1989; Marlar, 1985a), like fX, the majority is converted to a two-chain form before its secretion into the plasma. Dimeric PC comprises a heavy chain (-41 kDa) linked by a single cystine to a light chain of -21 kDa (Di Scipio et al, 1977b; Esmon, 1984; Kisiel, 1979; Stenflo, 1984). The light chain possesses a Gla domain containing nine Gla residues that are essential for Ca2+-dependent membrane binding and physiological function, and two EGF-like domains (EGF1 and EGF2) (Di Scipio and Davie, 1979). The serine protease domain is located in the heavy chain. 1.3.2 Activation of PC by the Thrombin-Thrombomodulin Complex Thrombin activates dimeric PC, the main circulating form, by cleaving a single peptide bond near the amino-terminus of the heavy chain (Argl2-Leul3) to release a 12-residue activation peptide of 1.4 kDa (Kisiel, 1979). Thrombin can also cleave the same bond in single-chain PC to yield a two-chain molecule which, despite retaining the activation peptide, has enzymatic properties indiscernible from those of molecules lacking this peptide (Foster et al, 1990a; Marlar, 1985a; Oppenheimer and Wydro, 1988). Although thrombin per se can activate PC, Vascular endothelium FIGURE 3. The protein C anticoagulant pathway. This anticoagulant system is initiated when thrombin (Th) binds to a high affinity receptor, thrombomodulin (TM), that is present on the surface of endothelial cells. Interaction with TM changes the substrate specificity of thrombin and alters its function from that of a procoagulant to an anticoagulant protease capable of activating PC. Activated protein C (APC) inactivates the membrane-bound coagulation factors Villa of the Tenase complex and Va of the Prothrombinase complex by limited proteolysis, thereby inhibiting coagulation. The anticoagulant activity of APC is potentiated by calcium ions, a phospholipid surface and a cofactor, protein S (PS). Recent evidence suggests that fV (V) may function as an additional cofactor in the degradation of fVIIIa. 17 the rate is too slow to be physiologically relevant (Kisiel et al, 1976a) and is decreased further 2+ by the presence of Ca (Esmon et al, 1983). However, binding of thrombin to a high-affinity receptor termed thrombomodulin in a 1:1 complex enhances the rate of thrombin-mediated PC activation in a Ca2+-dependent fashion at least 1000-fold (Esmonera/., 1983). Thrombomodulin (TM) is an endothelial membrane glycoprotein of -65 kDa organized sequentially as follows: an amino-terminal extracellular domain (with some similarity to lectins), six EGF-like domains, a region rich in serine and threonine that contains O-linked carbohydrate, a transmembrane domain, and a small carboxy-terminal cytoplasmic tail (Dittman and Majerus, 1990). The function of the lectin-like domain is unknown. The fourth EGF-like domain appears to be involved in switching the specificity of thrombin from fibrinogen to PC, while the fifth and sixth EGF-like domains are involved in binding thrombin (Esmon, 1989). In addition, a glycosaminoglycan in the serine/threonine-rich region of T M interacts directly with thrombin and is necessary for full activity (Ye et al., 1994). Although the residues in thrombin involved in its interaction with T M are not clearly delineated, binding is inhibited by a synthetic peptide corresponding to residues Thrl47-Serl58 of the thrombin B-chain (Suzuki etal, 1990). Equilibrium between the procoagulant and anticoagulant functions of thrombin is critical to maintain the hemostatic balance. Although T M may be distributed throughout the entire vascular system, if it is assumed that the number of T M molecules per endothelial cell is independent of vessel diameter, the T M concentration would increase as the surface area-to-blood volume ratio rises. Therefore, most of the vascular thrombomodulin would be contained in the capillaries that comprise greater than 99% of the endothelial surface area. Thus, in the large blood vessels most thrombin molecules may be free to promote blood clotting, whereas in the microcirculation most of the thrombin may be bound to T M , thereby enhancing the activation of PC and maintaining the fluidity of blood in the microvasculature (Esmon, 1992). 1.3.3 Protein S Protein S (PS) is a single-chain vitamin K-dependent glycoprotein of -70 kDa which is synthesized mainly in the liver and which functions as a cofactor for APC in the inactivation of membrane-bound fVa and fVIIIa (Di Scipio and Davie, 1979; Walker, 1984). In human plasma, -60% of PS is bound non-covalently to C4b-binding protein (C4BP), a regulator of the complement system (Tuddenham and Cooper, 1994c). As only the free form (-40%) of PS can act as a cofactor to APC, complexation with C4BP indirectly regulates coagulation (Dahlback, 1991) and an imbalance in the PS/C4BP equilibrium can lead to thrombotic disease (Comp et al, 1986). 18 PS contains several domains found in other vitamin K-dependent serine proteases but possesses no known enzymatic function (Hoskins et al, 1987; Lundwall et al, 1986). The primary structure of the mature protein encodes an amino-terminal Gla domain (Di Scipio et al, 1977b), followed by a 29-residue thrombin-sensitive region that is unique to protein S (Dahlback et al, 1986a; Lu et al, 1997), four EGF-like domains (Dahlback et al, 1986b), and a carboxy-terminal domain that is similar to sex steroid binding proteins (Gershagen et al, 1987). In addition to Gla, PS also contains one /J-hydroxylated aspartyl residue in the EGF1 domain and three /3-hydroxylated asparaginyl residues, one in each of the EGF2, EGF3 and EGF4 domains (Stenflo et al, 1987). The Gla and /?-hydroxylated residues of PS bind C a 2 + and confer stability and phospholipid-binding properties to the protein (Dahlback et al, 1990; Stenberg et al, 1997a,b; Sugo et al, 1986). The precise function of the EGF-like domains and steroid hormone-binding region is not known, but the EGF-like domains appear to interact with APC (Dahlback et al, 1990; Greengard et al, 1995; He et al, 1995). PS exerts its effects by accelerating the APC-mediated inactivation of fVa (Walker, 1980) and fVIIIa (Koedam et al, 1988; Walker et al, 1987) in the presence of negatively charged phospholipid membranes and C a 2 + ions. Although it is not clear how PS enhances APC activity, its physiological importance is demonstrated by the increased risk of recurrent venous thrombosis in individuals with hereditary PS deficiency (Comp and Esmon, 1984; Schwarz et al, 1984). Two mechanisms have been proposed to account for these observations. One is that PS enhances the binding of APC to phospholipid membranes (Walker, 1981), endothelial cells (Hackeng et al, 1993) and (bovine) platelets (Harris and Esmon, 1985), thereby localizing and/or orienting APC near its substrates. The second is that it acts by abrogating the ability of fXa to protect fVa (Solymoss et al, 1988) and, likewise, fIXa to protect fVIIIa (Regan et al, 1994), from inactivation by APC. However, it has been suggested that in the human system, a role in promoting the binding of APC to membranes may be of minor importance because PS stimulates APC-mediated fV a inactivation approximately two-fold, independent of the phospholipid concentration or composition (Bakker et al, 1992). Thus, PS may function primarily by increasing the susceptibility of fVa and fVIIIa to proteolysis by APC. In addition to its role as a cofactor for APC, PS has also been reported to exhibit APC-independent anticoagulant activity in purified systems. This appears to involve the direct binding of PS to fV, fVa, fXa and fVIII, thus inhibiting the activation of prothrombin and fX (Heeb et al, 1993, 1994; Koppelman et al, 1995). It has also been suggested that fV may act as a synergistic cofactor with PS to stimulate the inactivation of fVIIIa by APC (Dahlback et al, 1993; Shen and Dahlback, 1994; Varadi etal, 1996). However, this proposal currently remains controversial (Heeb et al, 1995; Sun et al, 1994). 19 1.3.4 Proteolysis of Factors Villa and Va by APC APC specifically inactivates membrane-bound fVIIIa and fVa by cleaving the heavy chain subunits of these proteins (Fig. 4). In both cofactors, a binding site for APC resides within the C-terminal end of the A3 domain (in the A3-C1 junction) (Walker et al, 1990) and this site appears to become exposed after activation of the proteins, since the unactivated cofactors are poor substrates for APC (Fay et al, 1991b; Kalafatis et al, 1994a). APC cleaves fVIIIa rapidly at Arg562 in the A2 subunit and slowly at Arg336 in the A l subunit, resulting in the release of a C-terminal acidic peptide from the A l subunit and weakening the affinity of the A2-dimer interaction (Eaton et al, 1986; Fay et al, 1991b). While cleavage at either Arg336 or Arg562 can occur first, cleavage of Arg562 is most closely correlated with a loss of cofactor activity and is therefore believed to be the primary mechanism by which fVIIIa is inactivated (Regan et al, 1996). However, in the presence of fIXa, cleavage at Arg562 is inhibited so that the peptide bonds at Arg336 and Arg562 are hydrolyzed at the same rate, suggesting that cleavage at Arg336 may be important for inactivating fVIIIa within the Tenase complex (Regan et al, 1994). Indeed, a single cleavage at Arg336 can inactivate fVIIIa and therefore cleavage at this site may also be physiologically relevant (Fay et al, 1996; Lamphear and Fay, 1992). The exact mechanism by which cleavage of fVIIIa leads to its inactivation is not well understood. However, cleavage in either the A l or A2 subunits does not decrease the affinity of the cofactor for fIXa, but rather affects the orientation of fVIIIa relative to the active site of fIXa. Furthermore, cleavage of the A l subunit results in a reduced affinity for fX (Regan et al, 1996). Thus, the function of FVIIIa in the Tenase complex appears to be destroyed by APC by two different mechanisms. Proteolytic inactivation of fVa by APC is associated with the cleavage of three peptide bonds in the heavy chain located at Arg306, Arg506 and Arg679 (Kalafatis et al, 1995). It has been proposed (Kalafatis et al, 1994a) that the inactivation of membrane-bound fVa is an ordered and sequential event with cleavage occurring first at Arg506, then at Arg306, and finally at Arg679; the latter being required for full inactivation. Although fVa isolated from individuals who lack the APC cleavage site at Arg506 (due to an Arg506Gln substitution) can still be inactivated by cleavage at Arg306 and Arg679, the rate of inactivation is much slower than occurs with wild-type fVa and this suggests that cleavage at Arg506 promotes, but is not essential for, cleavage at the other two sites (Kalafatis et al, 1995). However, in time-course assays using low concentrations of fVa and f V a R 5 0 6 Q , Nicolaes et al. (1995) found that cleavage at Arg506 and Arg306 is not necessarily sequential but that cleavage at Arg506 20 to > E o a m i p H H > o —• CM < < CO o CM < + + O CM O O < CO < o D_ < > O o o m s CC CO E o s in-rr o < • g T3 e e ^  x _, '6b £ 3 .2 0 o a CM P "o m W cdU fax .a ^ - L 8 g» u OB > Ctj cu 22 CM •~< cd I On p — S > -CN O NO cd <n T3 c cd CN j§ C rj c < C < .g-S<J O > O 1 3 . 8 -n "+-1 - CU O co co O CJ H—I CJ CJ cd > CJ (D S 3 < c _o '•HJ > §3-c d 3 ca C '3 B o -a < 8 s i ^ • 3 o co jd 3 > O p_ °^ cu -3 CO JO 3 CO 13 C S3 n o ' H W cd _> CJ cd CJ 3 .3 cd CO CO Cd - " H -, to M cd 1-H cu •U T3 B o u 13 co O O CU i 1 CO cd —i .„ n =2 a? C rH |_| CU T3 51 cd 8 o S S cu -J= H W rn H—H O O H . 3 O ,cd o o CH.H U U cj T3 O 2 *3 HH .a«g s •W O ft cd 6 CJ -a o - f 2 T3 cj CO O & H s O CJ u _ o a cu <, cu i—( CO &iH <u «u tr U cd O O J H CO g CO W o OX) O . cd co -£2 fcH *3 O ^ O CN .cd U HHH I o 1 „ cn cu HH ^ O cd co cu 13 id a cu •H C i — i " i n O H 6 S"H !> O I .3 y m cn S " 3 CU 21 occurs more rapidly than at Arg306. They proposed that the inactivation of fVa is a biphasic reaction with rapid hydrolysis at Arg506 resulting in an intermediate with a reduced ability to function as a cofactor, followed by slow hydrolysis at Arg306 (in both the intermediate and native fV a) to completely inactivate the cofactor. The apparent discrepancies between these two studies may be due to differences in the assay conditions employed to measure the loss of fV a activity; the use of high concentrations of fXa resulting in a lower apparent rate of inactivation (Nicolaes etal, 1995). Experiments investigating the effects of PS and fXa on the inactivation of membrane-bound fV a and fV a R 5 0 6 Q indicate that PS accelerates inactivation by APC about 20-fold by specifically enhancing cleavage at Arg306, whereas fXa protects fV a from inactivation by blocking the cleavage site at Arg506 (Rosing et al, 1995). These two opposing effects appear to function independently of one another. Interestingly, this study also indicated that in the presence of fXa and PS, cleavage of Arg306 by APC could be the most important step in the inactivation of fV a. 1.3.5 Other Functions of Protein C In addition to being a potent anticoagulant, there is evidence that APC possesses anti-ischemic (Snow etal., 1991), anti-inflammatory (Esmon et al, 1991) and fibrinolytic activity (Comp and Esmon, 1981). However, it it is possible that APC merely appears to be profibrinolytic because it inhibits activation of prothrombin and thus reduces thrombin-mediated activation of TAFI (thrombin-activatable fibrinolysis inhibitor; (Bajzar etal, 1995, 1996). 1.3.6 Inhibition of Protein C In plasma, the half-life of APC is only about 23 minutes (Okajima et al, 1990b), the majority being rapidly neutralized by two members of the serpin family of proteins: protein C inhibitor and a,-antitrypsin (Heeb and Griffin, 1988; Marlar and Griffin, 1980; Suzuki et al, 1983). The serpins are thought to trap APC by presenting a reactive site as an ideal substrate. Cleavage of this site leads to the formation of a 1:1 complex with the protease and renders it inactive towards its normal substrate (Carrell and Travis, 1985; Potempa et al, 1994). The serpin/enzyme complex is subsequently removed from the circulation and catabolized in the liver and spleen. Because the complex is stable to SDS treatment, this association is believed to be of a covalent nature (Potempa et al, 1994). 22 Protein C inhibitor (PCI) is a single-chain glycoprotein of -57 kDa (Marlar and Griffin, 1980). Similar to antithrombin and heparin cofactor II, the inhibitory effect of PCI is accelerated by heparin as much as 50-fold (Pratt and Church, 1992). Although 10-50% of circulating APC is bound and inhibited by PCI, knowledge of the biological importance of the inhibitor is lacking as a patient deficiency has not been documented (Espana et al, 1991; Heeb and Griffin, 1988). Studies by Rezaie et al. (1995) have suggested that PCI is also a potent inhibitor of the thrombin-TM complex and it may therefore inhibit activation of the PC zymogen. These findings are supported by a report that thrombin, especially in the presence of T M , is a much better target for PCI than is APC (Elisen et al, 1998). A second major inhibitor of APC is a!-antitrypsin (Espaha et al, 1991; Heeb and Griffin, 1988). a{-Antitrypsin is a heparin-independent serpin with broad specificity, inactivating several of the hemostatic enzymes (Carrell and Travis, 1985; Marlar et al, 1993). Compared to PCI, arantitrypsin inactivates APC 100-1000-fold more slowly but because of its high plasma concentration (55 jiM vs. 90 nM), its relative contribution to APC inhibition is significantly increased (Heeb and Griffin, 1988). Other known inhibitors of APC in vivo are a2-macroglobulin and the serpin Cf2-antiplasmin (Heeb et al, 1990; Hoogendorn et al, 1991). The extent to which each inhibitor contributes to the regulation of APC appears to depend on the concentration of APC in the plasma (Marlar et al, 1993). 1.4 Molecular Defects in the Anticoagulant System Venous thrombosis is a major human affliction arising when normal clotting becomes unregulated and causes vascular occlusion (Miletich et al, 1993). Each year, about 1 in 1000 people are affected by venous thromboembolism, which includes deep-vein thrombosis and pulmonary embolism (Dahlback, 1995b). Although this hyper-coagulable state primarily affects patients with an inherited predisposition to thrombosis, the risk is compounded or triggered by an increase in venous stasis resulting from immobilization, obesity, surgery, pregnancy, or the use of oral contraceptives (Schafer, 1994). Genetic deficiencies of either antithrombin, PC, or PS have been found in up to 15% of thrombotic patients (Zoller et al, 1997) and APC resistance (Dahlback et al, 1993), caused by a point mutation in the fV gene (Bertina et al, 1994; Greengard et al, 1994b; Zoller and Dahlback, 1994), occurs in up to 60% of such cases (Koster et al, 1995; Svensson and Dahlback, 1994). Individuals with any of these inherited genetic defects have a lifelong increased risk of venous thrombosis (Pabinger and Schneider, 1996; Zoller and Dahlback, 1994). 1.4.1 Antithrombin Deficiency The primary direct inhibitor of thrombin, and a main inhibitor of fXa, is the heparin-dependent serpin, antithrombin (AT) (Sheffield et al, 1995). A severe deficiency of A T at birth results in massive thrombosis and death during very early infancy (Sheffield et al, 1991). An inherited heterozygous deficiency of AT is associated with an increased risk of venous thrombosis and has been observed in -5% of patients with thrombotic disease. However, these thrombotic events are believed to occur predominantly in association with other predisposing factors (Blajchman et al., 1992). Two types of heterozygous AT deficiency are recognized: type I, characterized by low levels of functional AT antigen, and type II, in which the immunological level is normal but AT activity is greatly reduced. The vast majority of mutations underlying A T deficiency are due to minor insertion/deletions and single base substitutions in the AT gene (Lane et al., 1994). 1.4.2 Protein C Deficiency The physiological importance of PC is demonstrated most strongly in individuals who are homozygous or compound heterozygous for PC deficiency and who consequently have undetectable levels of PC activity and/or antigen. This is a rare condition affecting 1 in 200,000-1 in 400,000 people (Marciniak et al, 1985; Marlar and Neumann, 1990; Seligsohn et al, 1984). Such individuals develop life-threatening massive venous thrombosis within the first few hours or days of life that is frequently associated with disseminated intravascular coagulation. In addition, unless treated early with fresh plasma or PC concentrates, infants will develop irreversible eye or brain damage (Dreyfus et al, 1991, 1995). PC deficiency may arise from either acquired or genetic factors. Acquired PC deficiency is usually consumptive and often observed in patients with disseminated intravascular coagulation, venous thrombosis and infection (Castelino and Salem, 1997). Congenital PC deficiency is observed in up to 5% of thrombotic patients and studies of affected families have suggested an autosomal dominant mode of inheritance (Dahlback, 1995a; Reitsma et al, 1991). However, given the high prevalence (0.2-0.5%) of heterozygous PC deficiency in the non-thrombotic general population (Miletich et al, 1987; Tait et al, 1995), and the observation that the same gene defect occurs in both symptomatic and asymptomatic individuals (Reitsma et al, 1991), heterozygous PC deficiency may not be an important risk factor per se, but rather compounded by additional genetic or extrinsic factors (Dahlback, 1995a). 24 Phenotypically, two types of PC deficiency are recognized. Type I deficiency, the most common, is characterized by a parallel reduction of PC activity and antigen levels due to the reduced synthesis or stability of a normal PC molecule. Type II deficiency is characterized by a reduction in the specific activity of PC due to synthesis of an abnormal protein (Reitsma et al., 1995). Over 150 different lesions in the PC gene leading to a state of PC deficiency have been reported (Reitsma et al., 1995). Most are missense mutations, with the remainder comprising nonsense, splice site and frame-shift mutations, and one gross deletion. 1.4.3 Protein S Deficiency Homozygous PS deficiency is very rare. Only two cases have been described and both individuals suffered massive thrombosis and death in the neonatal period (Marlar and Neumann, 1990). Heterozygous PS deficiency is detected in up to 5% of patients with unexplained venous thrombosis, but its prevalence in the general population appears to be lower than that of PC deficiency (Tuddenham and Cooper, 1994c). The clinical manifestations of PS deficiency are similar to those of PC or AT deficiency (Comp and Esmon, 1984; Schwarz et al., 1984) and in nearly half of such patients, other thrombotic factors can be identified (Zoller et al., 1995). Both qualitative and quantitative PS deficiencies have been described. Type I deficiency is characterized by reduced levels of functional PS, type II by dysfunctional PS and normal antigen levels, and type III by normal total PS levels but a reduced concentration of free PS (Castelino and Salem, 1997; Comp et al., 1986). Two point mutations, a frame-shift mutation and two major deletions in the PS gene have been described (Dahlback, 1995a). 1.4.4 Activated Protein C Resistance APC resistance (Dahlback and Hildebrand, 1994) is a hyper-coagulable state which, depending on the criteria used for assessment, may be found in 20-60% of subjects with venous thrombosis. It is relatively common (5-10%) in the general population (Bertina et al., 1994; Dahlback, 1995c; Svensson and Dahlback, 1994). The phenotype is associated with either homozygosity or heterozygosity of a point mutation in the fV gene, producing an Arg506Gln substitution that makes fV resistant to cleavage by APC (Bertina et al., 1994; Sun et al., 1994). This may result in increased generation of thrombin, augmenting the risk of thrombosis. The penetrance of thrombosis in APC-resistant individuals is highly variable (Greengard et al., 1994a) and is dependent on the genotype; i.e. homozygosity is associated with a higher risk of thrombosis (50-100-fold) than heterozygosity (5-10-fold) (Bertina et al., 1994; Rosendaal et al, 1995). However, not all individuals homozygous for the Arg506Gln mutation are affected. 1.5 Prevention and Treatment of Thrombotic Disorders Given the importance of thrombin in the pathogenesis of venous thrombosis, the goal of most antithrombotic strategies is to control the generation or action of thrombin (Carter, 1996). 1.5.1 Heparin, Low Molecular Weight Heparin, and Oral Anticoagulants The anticoagulant agents most commonly used for prevention and treatment of thromboembolic disease are the heparins and oral anticoagulants. Standard heparin and low molecular weight heparin fractions (LMWH) exert their effects by catalyzing the inactivation of thrombin and fXa by antithrombin (AT). Their action is essentially instantaneous. Standard heparin is a heterogeneous mixture of sulfated polysaccharide chains with a mean mass of -15 kDa (Weitz, 1994). The chains contain a randomly distributed pentasaccharide sequence that binds to and induces a conformational change in AT, thereby accelerating its interaction with fXa and thrombin. Whereas the pentasaccharide is sufficient to promote inhibition of fXa, additional saccharide units are required to enhance the inhibition of thrombin (Sheffield et al, 1995). LMWH (mean mass 4-5 kDa) is obtained by chemical or enzymatic treatment of heparin and more effectively inhibits fXa than it does thrombin (Hull and Pineo, 1994). Although standard heparin is the drug of choice for prophylaxis and short-term treatment of pulmonary embolism, it has a low bioavailability and a short half-life, and the variable response in patients necessitates careful monitoring. LMWH, which has a greater bioavailability and longer half-life, acts more predictably (Hull and Pineo, 1994). However, like heparin, LMWH may induce hemorrhage—an effect which may be dose-related and mediated by direct effects on platelets (Carter, 1996). In addition, a major drawback to the use of heparins is that they do not effectively inhibit fibrin-bound thrombin and this can remain enzymatically active and thrombogenic at sites of pathological thrombus formation. Oral anticoagulants are used mainly to prevent venous thrombosis in high-risk patients and in long-term treatment of pulmonary embolism (Agnelli, 1995). The most widely used oral anticoagulant in North America is warfarin, a 4-hydroxycoumarin that indirectly inhibits the y-carboxylation of vitamin K-dependent proteins, including those involved in hemostasis (Suttie, 1993). A major disadvantage of warfarin is the high degree of individual variability in the response to the drug that necessitates frequent monitoring and adjustment of doses. Hemorrhage is the most serious complication of warfarin therapy but warfarin-induced skin necrosis can also occur, primarily in patients with PC or PS deficiency (Brigden, 1996; Ginsberg, 1996). 1.5.2 Direct Inhibitors of Thrombin Direct thrombin inhibitors such as hirudin and hirulog inactivate both free and clot-bound thrombin. They have been shown to markedly reduce the frequency of deep-vein thrombosis and pulmonary embolism after surgery (Harker et al, 1997). Hirudin, the most potent and specific inhibitor of thrombin identified to date, was initially extracted from the European medicinal leech but is now produced by recombinant methods (Carter, 1996). Hirudin has two distinct domains: an N-terminal region that binds and blocks access to the active site of thrombin, and a C-terminal region that blocks thrombin's fibrinogen-binding site (Lefkovits and Topol, 1994). Circulating hirudin has a half-life of -50 minutes, and therefore the high doses that are required can lead to bleeding complications. However, recently Syed et al. (1997) reported the expression of a fusion protein of hirudin linked via its C-terminus to albumin and showed that the chimeric protein had potent anti-thrombin activity and an extended half-life (-4.5 days). Hirulog is a synthetic polypeptide consisting of the N- and C-terminal regions of hirudin joined by a linker (Lefkovits and Topol, 1994). It functions similarly to hirudin but may inhibit clot-bound thrombin more effectively (Biemond et al., 1996). Unlike hirudin, hirulog is cleaved by thrombin, albeit slowly, thus reducing its usefulness. This has led to the development of hirudin derivatives with non-cleavable bonds (Cappiello etal., 1996; Tsudaera/., 1994). 1.5.3 Inhibitors of Thrombin Generation Alternative strategies for controlling thrombin activity are becoming available through the isolation and development of agents that selectively inhibit key enzymes at different points in the coagulation cascade. Potent peptide inhibitors of fXa have been isolated, including tick anticoagulant peptide (from the soft tick) and antistatin from the Mexican leech (Betz et al, 1997; Krishnaswamy et al, 1994; Mao et al, 1995; Ohta et al, 1994). These peptides have displayed a safe and impressive antithrombotic efficacy, perhaps by inhibiting fXa in the Tenase complex while permitting the formation of small, but hemostatically important, amounts of thrombin via the extrinsic pathway. Development of orally bioavailable antagonists of fXa is presently underway (Harker et al, 1997; Lefkovits and Topol, 1994). Several other inhibitors in this class have been studied. These include inactivated fIXa (which competes with normal fIXa), inactivated fVIIa (which competitively inhibits TF-dependent generation of thrombin), recombinant TFPI, variant soluble TF proteins (which act as specific antagonists of the extrinsic pathway), and antibodies against the thrombin receptor on platelets (Harker et al, 1997; Lefkovits and Topol, 1994). 1.5.4 Protein C and Activated Protein C Both PC and APC are attractive as antithrombotic agents because of their endogenous origins and specific modes of action. Administration of PC is an effective antithrombotic treatment in animal models and in humans (Dreyfus et al, 1991; Okajima et al., 1990a; Taylor et ah, 1987). However, although the circulating half-life of the human zymogen is 7-10 hours (Marlar, 1985b; Okajima et al, 1990b), its use is limited primarily to treatment of individuals with acquired or genetic PC deficiencies and microvascular thrombosis because it is activated mostly in the microvasculature, where T M is present at high concentrations. The utility of APC for antithrombotic treatment has been tested by direct infusion of the enzyme into animals. These studies suggest that following a thrombotic challenge the effectiveness of APC is comparable to hirudin and superior to heparin, but that quantities close to the physiological levels of the zymogen (PC) must be administered in conjunction with an equimolar dose of PS (Arnljots etal, 1994; Arnljots and Dahlback, 1995; Gruber etal, 1989, 1990). Furthermore, the use of APC is limited by its short half-life in the circulation (-23 minutes; (Okajima etal, 1990b). To try to overcome these limitations, an altered form of PC (FLIN-Q3) that is activated more efficiently by thrombin, and independently of T M , was engineered by mutating two inhibitory acidic residues near the thrombin cleavage site and removing the glycosylation site at position 313 (Kurz et al, 1997; Richardson et al, 1992). Because of a reduced requirement for T M cofactor activity, thrombin-mediated activation of FLIN-Q3 in the presence of C a 2 + was 60-fold greater than wild-type PC in vitro, and unlike native PC, FLIN-Q3 was activated by the thrombin generated in clotting human plasma. Studies comparing the activities of APC and the zymogens HPC and FLIN-Q3 after infusion into guinea pigs suggested that sufficient amounts of HPC and FLIN-Q3 remained in the circulation to allow their thrombin-mediated activation after a second round of thrombotic challenge, whereas APC concentrations declined toward control levels (Kurz et al, 1997). These results suggest that molecules such as FLTN-Q3 may be a more practical form of an "on demand" antithrombotic than APC, especially in the large blood vessels. 1.6 The Trypsin-Like Family of Serine Proteases Factors VII, IX and X, prothrombin and PC bare marked structural and functional similarities to the digestive serine proteases chymotrypsin and trypsin (Fig. 5). However, unlike chymotrypsin and trypsin, which function in the small intestine, the hemostatic serine proteases function in the vasculature. Thus, precise regulatory mechanisms are required to restrict their activities to the area of tissue injury. 1.6.1 Common Domain Structure Members of the trypsin-like family of serine proteases possess a C-terminal proteolytic domain that contains a catalytic triad of residues (comprising serine, histidine and aspartic acid) which is critical to their mechanism of catalysis (Stroud et al, 1975). Although the catalytic domains of the hemostatic serine proteases in this family exhibit a marked sequence and structural homology to trypsin, the enzymes have a high degree of substrate specificity as compared to digestive enzymes. In addition, they contain non-catalytic modular elements that are attached to the amino-terminus of the trypsin-like region (Bode et al, 1997; Patthy, 1985). Prothrombin, fVII, flX, fX and PC all possess an N-terminal Gla domain. In prothrombin, two disulfide-knotted kringle domains link the Gla and catalytic domains and the catalytic domain is released when the zymogen is converted to a-thrombin. In contrast, in factors VII, IX, X and PC, two EGF-like domains separate the Gla and catalytic domains, and the Gla and EGF-like domains remain covalently linked to the proteolytic region after activation. This allows the activated proteases to remain associated with the cell surface and confines coagulation to the site of injury while greatly enhancing the frequency of encounters between the enzymes and their substrates. Both trypsin and the hemostatic serine proteases are ordinarily maintained in their zymogen forms until the active enzymes are required. Activation by specific cleavage of an Arg-X bond (X is usually Ile) results in insertion of the new free N-terminus into the body of the serine protease domain, converting the zymogen to an active enzyme (Patthy, 1985). 1.6.2 Gene Organization The structure and organization of the genes encoding fVII (O'Hara et al, 1987), flX (Yoshitake et al, 1985), fX (Leytus et al, 1986) and PC (Foster et al, 1985; Plutzky et al, 1986) are highly similar and, except for PC, contain eight exons and seven introns (Fig. 5). In the PC gene, there is an additional ninth exon containing 53 basepairs of 5'-non-coding DNA. 29 c o X o> •o co + H ca c cnn za & — o Q_ CD Q_ 3 c '3 6 o _co "5b oo co c o c3 > co 00 o 6 N o T3 CO o t 3 ~ s O H u CO c g .O E •c CO 00 O H CO & c 00 eo O H CO O H O o cd E O TJ ia P H g £ tS O N O T J CD -4—» H—I *»« &o O CD TJ t3 td co S •5 > C H T J „ . c 3 U Q 2 7 ? ^ W O H - C H ^ H 3 H—( o t i o C H £ CL) 00 CD co •5 B o H _ co < ; o -3 toflf^ co O 3 t - 1 3 co -^ 3 . -a o T3 > co C 00 03 JJ r j 00 ^ § o 2 cu w £ [ H -3 HH a ° t o ^ PH ^ 3 3 § x 2 <U c3 <U T3 <u S.S § a*3 % .9 H3 3 ^ o M C g 3 S ^3 S' ~ 3 <D 2 2 .5 5P C H T H C3 _ 0 ^ 3 >> g ° T-) £ 1 b 3 cu cl t i ^ 3 -y £ 5 <U CHH • C„ '3 M £ 3 K w « O O . co 5P " T J co 3 O £ £ O 3 p co cu ? ^ & 3 '53 ( U 1 C U cd SSI C H <u 1 - 1 3 £ ^ * c i co • § - ° M . . . 2HT3 O D S u g g c 73 c3 S3 O H 3 o Aside from the 5'-non-coding exon of PC, each of the eight exons of these genes can be considered as a module encoding a homologous domain, with exon I encoding the signal peptide, exon II the propeptide and Gla domain, exon III the aromatic amino acid stack, exons IV and V the E G F domains, exon VI the activation peptide and cleavage site, and exons VII and VIII the catalytic domain. Intron boundaries conform to the G T - A G rule and occur in similar positions in all four genes (Patthy, 1987). However, the introns located at corresponding positions in these genes differ considerably in length and sequence, suggesting that they have diverged significantly (Long, 1986). 1.6.3 Evolution The evolution of more complex circulatory systems appears to have been associated with an increase in the number of plasma factors involved in hemostasis. In higher organisms, these extra clotting factors amplify the hemostatic reaction, thereby extending its potential activity to meet the demand imposed by an increased circulatory efficiency and higher blood pressure (Iwanaga, 1993). The mechanisms by which hemostatic proteins and the genes specifying them have evolved to meet these demands remain an area of intense study. The advent of recombinant DNA technology facilitated the isolation of cDNA and genomic DNA encoding many of the human hemostatic factors and has proven invaluable for identifying the homologous structural and functional domains among them. Independent phylogenetic relationships for the Gla, kringle, EGF-like, and protease modules of the various serine proteases have been constructed to better understand their evolutionary relationships (Patthy, 1985). Evolutionary trees based on analysis of the Gla and catalytic modules suggest that the proteases of the coagulation cascade are closely related with prothrombin and PC forming one sub-group, and fIX and fX another. Plasminogen, tissue-type plasminogen activator and urokinase appear to be more closely related to each other than to any of the blood coagulation enzymes. Reconciliation of the phylogenetic trees for each module resulted in a combined evolutionary tree with an ancestral trypsin-like protease containing a signal peptide and zymogen domain at its root, and with all other modules being inserted later as a result of gene duplication, exon shuffling and intron sliding (Doolittle and Feng, 1987; Neurath, 1984; Patthy, 1985, 1990). 1.7 Structural Aspects of Factor X and Protein C 1.7.1 Primary Structures F X and PC are synthesized in the liver as single-chain polypeptides. Human PC comprises 461 amino acids and contains a 42-amino acid leader sequence followed by a 155-amino acid light chain that is connected by a dibasic peptide to a heavy chain of 262 amino acids (Foster and Davie, 1984; Plutzky et al, 1986). Human fX comprises 488 amino acids with a leader sequence of 40 amino acids and a 139-amino acid light chain connected by a tribasic peptide to a heavy chain of 306 amino acids (Fung et al., 1985; Leytus et al, 1984, 1986). The domains of the two proteins are arranged in the following sequence: signal peptide, propeptide, Gla domain, aromatic stack domain, tandem EGF-like domains, activation peptide, and catalytic domain. 1.7.2 Post-Translational Modifications Before being secreted by hepatocytes in their mature forms, fX and PC undergo a considerable degree of post-translational processing. The single-chain precursors of fX and PC contain signal peptides of 23 and 18 amino acids, respectively, that are essential for their translocation from the cytoplasm into the endoplasmic reticulum (Foster et al., 1987; Gierash, 1989; Racchi et al., 1993 ; Watzke etal, 1991). The signal peptide is removed by a signal peptidase situated on the periplasmic side of the endoplasmic reticulum membrane prior to, or during, translocation. The first 11 (human fX) or 9 (human PC) N-terminal glutamyl residues in the Gla domain are converted to 7-carboxyglutamic acid, a modification required for biological activity (Foster et al, 1987; Furie and Furie, 1988). This modification is specified by the presence of a propeptide that is typical of the vitamin K-dependent serine proteases and the propeptides of PC, fVII, and fIX are exchangeable with regard to directing 7-carboxylation (Geng and Castellino, 1996). Deletion or site-directed mutagenesis of specific residues in the propeptides of PC (Foster et al, 1987), fIX (Jorgensen et al, 1987) and prothrombin (Huber et al, 1990) leads to impaired 7-carboxylation and suggests that the propeptide contains a recognition element which marks the vitamin K-dependent proteins for 7-carboxylation. Removal of the propeptide occurs after completion of 7-carboxylation. Recently, cDNAs encoding putative propeptidases have been cloned and the proteins expressed, most notably PACE/furin (Wise et al, 1990). PACE (paired basic amino acid cleavage enzyme) is a subtilisin-like serine protease homologous to the yeast Kex2 enzyme that is involved in 32 processing a-prohormone-mating factor (Bresnahanetal, 1990; Foster etal, 1991). PACE preferentially cleaves bonds that follow an Arg^-Xxx-Lys /Arg^-Arg - 1 recognition sequence (Bentley et al, 1986; Drews et al, 1995). The importance of these basic amino acids for substrate recognition by PACE is emphasized by naturally occurring missense mutations in flX (Bentley et al, 1986; Diuguid et al, 1986), PC (Lind et al, 1997; Reitsma et al, 1995) and PS (Gandrille et al, 1995) that result in secretion of improperly processed proteins with a severely reduced function. Both fX and PC are glycosylated. In human fX the activation peptide contains N-linked carbohydrate attached to Asn39 and Asn49 (Di Scipio et al, 1977a) and 0-linked carbohydrate has been identified at Thrl7 and Thr29 (Inoue and Morita, 1993). The role of glycosylation at these residues remains controversial (see section 1.2.1.3). Human PC contains 23% carbohydrate by weight and has four potential Af-linked glycosylation sites with the consensus sequence Asn-Xxx-Ser/Thr. These are located at Asn97 in the light chain, and Asn248, Asn313 and Asn329 in the heavy chain (Kisiel, 1979). The role of glycosylation at each of the four potential sites has been examined by site-directed mutagenesis (Grinnell et al, 1991). This study revealed that glycosylation of Asn97 is critical for efficient secretion and also affects the degree of core glycosylation at Asn329, whereas glycosylation at Asn248 is important for the intracellular removal of the Lys-Arg dipeptide connecting the light and heavy chains. Mutating Asn313 to Gin significantly accelerated the activation of PC by the thrombin-TM complex and elimination of any of the glycosylation sites in the heavy chain resulted in a two- to three-fold increase in anticoagulant activity. Both plasma-derived and recombinant human PC preparations contain various forms of the heavy chain, designated a, (5, and y which result from heterogeneous glycosylation (Grinnell et al, 1989; Yan et al, 1990). It has been proposed that the site at Asn313 is always glycosylated and that the a, j8, and ysub-forms represent tri-, di-, and mono-glycosylated heavy chains, respectively (Grinnell etal, 1991). Asp63 in fX and Asp71 in PC are modified to erythro-/Mrydroxyaspartic acid (Hya) by aspartyl ^-hydroxylase (Drakenberg etal, 1983, 1996; McMullen etal, 1983). These residues are located in the EGF1 domain which contains a high-affinity Ca -binding site (Dahlback et al, 1990; Ohlin et al, 1988). Although there is strong evidence that the hydroxyl group of the Hya residue may function as a ligand for C a 2 + in conjunction with nearby Asp residues (Dahlback et al, 1990; Gianelli et al, 1991; Handford et al, 1991; Ohlin et al, 1988; Stenflo, 1991; Sugo et al, 1984), this remains a matter of debate. Studies in which the hydroxyl group was substituted with a hydrogen atom (i.e. substitution of Hya with Asp) revealed only a slight reduction in C a 2 + affinity (Selander Sunnerhagen et al, 1993). Thus jS-hydroxylation at this site may serve other structural or biological functions, such as in intra- or inter-protein interactions (Selander-Sunnerhagen et al, 1992; Valcarce etal, 1993). 33 Before being secreted, the single-chain precursors of fX and PC are converted to two-chain zymogens by proteolytic removal of an internal peptide that is, in the case of fX, tribasic (Lysl40-Argl41-Lysl42), and in PC, dibasic (Lysl56-Argl57) (Foster et al, 1990a, 1991). In both cases, excision of the basic peptides creates a mature dimeric molecule containing heavy and light chains linked by a single cystine residue. Studies have suggested that P A C E is the endoprotease that performs this proteolytic modification (Foster et al, 1990a, 1991; Stanton and Wallin, 1992). Although fX contains an optimal Arg-Arg-Lys-Arg PACE recognition sequence immediately prior to the cleavage site, the corresponding sequence in PC is His-Leu-Lys-Arg. Thus a sub-optimal PACE recognition element in PC may account for the fact that up to -15% of PC in plasma is found as the single-chain form whereas 100% of human fX circulates as a dimer. This is consistent with the results of several studies in which recombinant fX and PC were expressed in a variety of cell lines (Foster et al, 1987; Grinnell etal, 1987; Rudolph etal, 1997). Although the order in which some of the post-translational modifications of fX and PC are performed is unknown, a biosynthetic study of recombinant human PC expressed in the human embryonic kidney cell line 293 suggested the following: that y-carboxylation occurs after core glycosylation in the early endoplasmic reticulum, that these two modifications are not coupled, and that they need not proceed sequentially (McClure et al, 1992). In addition, y-carboxylation and processing of the iV-linked core in the endoplasmic reticulum, but not in the Golgi compartment, were required for efficient Ca2+-dependent secretion. Subsequent events, including cleavage of the internal Lys-Arg dipeptide and probably the propeptide, 2+ appeared to occur in the Golgi compartment and to be Ca -dependent. 1.7.3 Secondary Structure and Domains F X and PC have a very similar domain structure and pattern of disulfide linkages. The Gla domains of these proteins are highly conserved, as are those of all known vitamin In-dependent hemostatic proteins (Drakenberg et al, 1996). In both fX and PC, approximately 10 calcium ions bind to the Gla domain with low affinity under physiological conditions. Calcium binding displays a high degree of cooperativity and is essential for inducing a conformational change in the Gla domain that is required for phospholipid interactions and functional activity (Mann et al, 1990). Consequently, removal of the Gla domain from fX or PC by limited proteolytic treatment results in a complete loss of biological activity (Esmon et al, 1983; Morita and Jackson, 1986; Sugo et al, 1984). Likewise, administration of warfarin, which • inhibits the y-carboxylation process, leads to the synthesis of biologically inactive molecules (Xi etal, 1989). The number of Gla residues varies among the hemostatic vitamin K-dependent proteases. However, there is a strict conservation in the positions of three pairs of Gla residues (at positions 6 and 7, 19 and 20, and 25 and 26) and three single Gla residues (at positions 14, 16, and 29). Studies in which the Gla residues of PC and fX were altered on an individual basis revealed that the presence of Gla at positions 16, 26 and 29 is critical for the normal function of these proteins (Christiansen et al, 1994; Larson et al, 1998; Zhang and Castellino, 1992, 1993; Zhang et al, 1992). However, the Gla domains of the various serine proteases may function similarly since exchanging the Gla domain of PC for that of either fVII (Geng and Castellino, 1997), fIX (Geng et al, 1995) or prothrombin (Smirnov et al, 1998) does not hinder the chimeric proteins from binding to phospholipid in a Ca2+-dependent manner. Historically, the interaction of the Gla domain with membranes was believed to be primarily electrostatic in nature, with C a 2 + acting as a central bridging ion between the Gla residues and the polar head groups of the membrane phospholipids (London and Walsh, 1996; Mann et al, 1990; McGee et al, 1998; Schwalbe et al, 1989; Zhang and Castellino, 1993). However, more recent work has indicated that hydrophobic forces may also be important in this interaction (Atkins and Ganz, 1992; Jalbert et al, 1996; Sunnerhagen et al, 1995; Zhang and Castellino, 1994). A comparison of the structures of the Ca2 +-free and Ca2 +-loaded forms of the Gla domain of bovine fX was made possible following X-ray crystallographic and nuclear magnetic resonance (NMR) spectroscopic studies (Selander etal, 1990; Soriano-Garcia et al, 1989, 1992; Sunnerhagen et al, 1995). These studies indicate that C a 2 + binding causes the first nine N-terminal residues of the Gla domain to form a horseshoe loop with the hydrophobic side-chains of Phe4, Leu5 and Val8 exposed to the solvent. In the Ca2 +-free form, these hydrophobic side-chains face toward the interior of the Gla module and the side-chains of Gla6 and Gla7 are exposed to solvent. Thus, in the presence of C a 2 + ions (i.e., as in blood) hydrophobic as well as electrostatic associations could contribute significantly to the interaction between the Gla domain and phospholipid membranes (Sunnerhagen et al, 1995). This notion is consistent with the finding that substitution of Leu5 in PC (a strictly conserved residue in the vitamin K-dependent serine proteases) with Gin greatly reduces its anticoagulant activity even though it is capable of adopting the Ca2+-dependent conformation required for binding phospholipid (Jalbert et al, 1996; Zhang and Castellino, 1994). In both fX and PC, a helical (aromatic/hydrophobic) stack domain is located adjacent to the Gla domain. Although this domain appears to be important for interaction of the Gla domain with C a 2 + (Colpitts and Castellino, 1994), it is thought to have a generalized functional role as replacing the Gla/helical stack unit of PC with that of fIX does not adversely affect its Ca2+-dependent properties (Christiansen and Castellino, 1994). 35 The tandem EGF-like domains of fX and PC are located at the C-terminal end of the Gla-helical stack units of the proteins. In fX, each EGF-like domain contains three intra-chain disulfide linkages (bonded in the order 1-3, 2-4, 5-6) that are characteristic of this type of structure (Stenflo, 1991). In PC, the EGF1 domain is unusual in containing four disulfide bonds, but the additional bond may not greatly distort the fold of this domain. In both proteins, the EGF1 domain contains a single high-affinity Ca2+-binding site, occupancy of which causes a conformational change in the molecules (Esmon et al, 1983; Ohlin et al., 1988; Selander-Sunnerhagen et al., 1992; Sugo et al., 1984). There is much evidence that the function of this conformational change is to shift the Gla and EGF1 domains into a biologically active orientation (Hogg et al, 1992; Medved et al, 1994; Ohlin et al, 1990; Orthner et al, 1989; Sunnerhagen et al, 1995, 1996; Valcarce et al, 1994). Studies with a chimera comprising the Gla and EGF1 domains of flX linked to the EGF2 and serine protease domains of fX suggest that the EGF2 domain mediates binding to fVIIIa and fV a and that this interaction may be enhanced by the EGF1 domain (Hertzberg et al, 1992; Skogen et al, 1984). The serine protease domains of fX and PC contain the catalytic triad residues involved in proton transfer during substrate hydrolysis (His236, Asp282 and Ser379 in human fX and His211, Asp257 and Ser 360 in human PC) (Stroud et al, 1975). In addition, the catalytic domains possess a Ca2+-binding site, utilizing three acidic residues as ligands, which is critical for activation of the zymogens (Padmanabhan et al, 1993; Persson et al, 1993; Rezaie and Esmon, 1994; Rezaie et al, 1992, 1993, 1994). Following activation and the concomitant release of the activation peptides, the new N-terminal residue of the heavy-chain (i.e., Ile in fX and Leu in PC) participates in formation of the substrate binding pocket by forming a salt bridge with a conserved aspartate immediately preceding the active site serine (Bode et al, 1997; Stroud et al, 1975). This results in the transition from zymogen to active protease. 1.7.4 Three-Dimensional Structures Using X-ray crystallography it has been possible to determine, albeit at a low resolution (around 3 A), most of the three-dimensional structure of the inhibited Gla domain-less forms of human fXa and APC (Mather et al, 1996; Padmanabhan et al, 1993). A comparison of the three-dimensional models reveals a high degree of structural conservation between the proteins (Fig. 6). The EGF2 domain is located diametrically opposite to the active site and has a structure typical of this type of module. The C-terminal portion of the light chain forms a short segment of anti-parallel /?-sheet and then curves toward the serine protease domain near to the location of the single inter-chain disulfide bond. Intimate contacts between the EGF2 and catalytic domains suggest that they may operate as a single unit. F I G U R E 6. Structures of human fX and PC. Diagrams on left (modified from Davie et al, 1991) show the positions of cystines, Gla residues (Y), P-hydroxylated aspartic acid (R-OH), and the three catalytic triad residues in the active site (indicated by bullets). Arrows indicate the site of the proteolytic cleavage (by fLX in the case of fX, and by thrombin in the case of PC) that is required to activate the proteins. Diagrams on right represent the three-dimensional structures of the activated proteins as determined by X-ray crystallography (Padmanabhan et al., 1993; Brandstetter et al, 1995,1996; Mather et al., 1997). The positions of p-strands (arrow heads at the C-terminal end) and a-helices are indicated. Catalytic triad residues are indicated as space-filled atoms. The atomic coordinates for fX (3 A resolution) were obtained using a preparation of protein lacking the Gla domain and which had been inhibited with DX-9065A. The N-terminal EGF-like domain of the light chain and 16 residues at the C-terminus of the heavy chain were disordered in the structure and were not modelled. The coordinates for PC (2.8 A resolution) were obtained from a preparation lacking the Gla domain and which had been inhibited with PPACK. Residues 147-155 at the C-terminus of the light chain and residues 245-254 at the C-terminus of the heavy chain were disordered in the structure and were not modelled. Rightmost diagrams were generated from entries 1FAX (fX) and 1AUT (PC) in the Protein Databank of the Brookhaven National Laboratory. The structures were aligned using Swiss-PdbViewer for the Macintosh (available at http://www.chimie.nindp.ac.be/cr^  and rendered with QuickDraw 3D (Apple Computer, Inc.). Note that only residues 96 and onwards of the light chain of PC are shown for comparison with the data available for fX. The serine protease domain has a structure typical for a trypsin-like protease. It comprises two six-stranded anti-parallel /3-barrels interspersed with loops which form the surface of the domain. Structural features of the catalytic domain which are common to both fXa and APC include a trypsin-like active site containing a catalytic triad (His, Asp and Ser) located at the junction of the /3-barrels, a buried ion pair formed between the amino-terminus of the heavy chain and the aspartyl residue which immediately precedes the active site serine, a C a 2 + 70-80 binding loop, three conserved intra-chain disulfide bonds, and two surface helical segments. Despite their highly similar architecture, the hemostatic serine proteases display major differences in their specificity and activity. Thus, although the three-dimensional structures of the polypeptide backbones of these proteases are similar, the substitution of amino acids located on their surfaces may define their unique mechanisms of substrate recognition, cofactor binding and membrane interaction (Furie et al., 1982). 1.8 A i m o f T h i s S t u d y The aim of this study was to test the hypothesis that a recombinant chimeric protein (fX/PC) comprising the light chain and activation peptide of factor X and the serine protease domain of protein C would function as an anticoagulant. The rationale for this study was that the chimeric fX/PC zymogen might be targeted to the Tenase complex via the factor X light chain, which contains the Gla and EGF-like domains, thus enabling it to bind to the Tenase complex. Subsequent activation by factor IXa would be expected to produce a functional protease with APC-like substrate specificity, hence leading to inactivation of factor Villa rather than translocation to the Prothrombinase complex (Fig. 7). The production of an inactive, biologically stable PC-like agent that could be activated at the Tenase complex would represent a novel approach to the treatment and prevention of thrombotic disease. FIGURE 7. Hypothetical mode of action of the recombinant fX/PC chimeric protein. It was hypothesised that fX/PC would mimic the binding of fX to the Tenase complex located on the surface of endothelial cells. Subsequent cleavage of the fX activation peptide of fX/PC by fIXa would activate the recombinant protein and result in the degradation of fVIIIa. 2.0 MATERIALS and METHODS 2.1 Recombinant DNA Techniques 2.1.1 General Materials for Recombinant DNA Methods All chemicals employed were of the highest analytical grade. Restriction endonucleases, calf intestinal alkaline phosphatase, T4 DNA ligase, and associated buffers were purchased from Life Technologies (Burlington, ON) and New England Biolabs (Mississauga, ON). T7 DNA polymerase (Sequenase version 2.0) was purchased from Amersham Pharmacia Biotech (Baie d'Urfe, QC). A Geneclean kit was purchased from BIO 101 Inc. (La Jolla, CA). Plasmid "miniprep" purification kits were purchased from Promega Corp. (Madison, WI) and Qiagen Inc. (Chatsworth, CA). A DNA Clean-up kit was purchased from Promega. Recombinant Thermus aquaticus DNA polymerase was prepared in the laboratory according to published methods (Desai and Pfaffle, 1995; Engelke etal, 1990). Deoxyribonucleosides (dNTPs), i.e. 2'-deoxyadenosine 5'-triphosphate (dATP), 2'-deoxycytidine 5'-triphosphate (dCTP), 2'-deoxyguanosine 5'-triphosphate (dGTP) and 2'-deoxythymidine 5'-triphosphate (dTTP), and dideoxyribonucleosides (ddNTPs), i.e. 2',3'-dideoxyadenosine 5'-triphosphate (ddATP), 2',3'-dideoxycytidine 5'-triphosphate (ddCTP), 2',3'-dideoxyguanosine 5'-triphosphate (ddGTP) and 2',3'-dideoxythymidine 5'-triphosphate (ddTTP) were purchased from Sigma-Aldrich Canada Ltd. (Mississauga, ON). The radioactively labeled 2'-deoxyribonucleoside 5'-triphophates [a- 3 5S]-dATP and [a- 3 2P]-dCTP were purchased from Amersham Pharmacia Biotech. Agarose, DNA molecular mass markers, urea and Tris base (Tris(hydroxymethyl)-aminomethane) were purchased from Life Technologies. Acrylamide, bis-acrylamide (N,N'-methylene-bis-acrylamide), ammonium persulfate, T E M E D (Af,Af,Af',Af'-tetramethylethylene-diamine), bromophenol blue and xylene cyanol FF were from Bio-Rad Laboratories (Canada) Ltd. (Mississauga, ON). Sodium chloride and boric acid were purchased from Fisher Scientific Canada (Nepean, ON) and E D T A (ethylenediamine-tetra acetic acid, disodium salt) from B D H Inc. (Toronto, ON). Ficoll, polyvinylpyrrolidone and bovine plasma albumin (Fraction V) were from Sigma-Aldrich Canada Ltd. Concentrated acids and bases were purchased from Fisher Scientific Canada and BDH Inc. 40 2.1.2 Vectors The plasmid pcHX14 (Fung et al., 1985), which contains a cDNA encoding near full-length human factor X (lacking the 5'-untranslated region and the codons specifying the first 12 residues of the signal peptide, i.e. amino acids -40 to -29), was provided by Dr. R.T.A. MacGillivray. The plasmid pUC-PC, which contains a cDNA encoding full-length human protein C, was obtained from Dr. R.T.A. MacGillivray and H. Kirk (unpublished data). The phagemid pBluescriptIIKS+ (2961 bp), used for subcloning DNA fragments, was from Stratagene (La Jolla, CA). This vector contains a pMBl origin of replication (Ori) for episomal propagation in E. coli and a bla gene encoding /3-lactamase as a selectable marker for ampicillin resistance. The multiple cloning site is located downstream of the inducible lac promoter and within the portion of the lacZ gene encoding the N-terminal region (a-peptide) of /3-galactosidase. This allows color selection of recombinant phagemids by a-complementation if the vector is transformed into cells containing /acZAM15 in the F' region and transformants are plated onto the appropriate indicator plates. The -6.5 Kb mammalian expression vector pNUT (Palmiter et al., 1987) was provided by Dr. R. Palmiter. The unique Not I cloning site of pNUT is located immediately downstream of an inducible metallothionein I promoter and the polyadenylation tail region of the bovine growth hormone gene has been inserted downstream of the cloning site to increase the stability and processing of transcribed messenger RNA. The vector has a pMB 1 Ori and a bla gene as a selectable marker in E. coli. To allow selection of transfected mammalian cells with the folate analog methotrexate, pNUT contains a mutant murine dihydrofolate reductase cDNA that encodes a variant enzyme with a greatly reduced affinity for methotrexate. Expression of the variant enzyme is driven by the simian virus 40 (SV40) promoter/ori. The mammalian expression vector pCI-neo (5474 bp) was from Promega Corp. In this vector, constitutive transcription of inserted cDNAs or genes is directed by the human cytomegalovirus (CMV) immediate-early enhancer/promoter region. The vector contains a chimeric j8-globin/IgG intron upstream of the multiple cloning site and the SV40 late polyadenylation tail sequence downstream. A bla gene allows selection of transformed E. coli and a neomycin phosphotransferase gene, which confers resistance to aminoglycosides such as geneticin, permits selection of stably transfected mammalian cells. The vector contains an E. coli Ori, and a SV40 Ori for transient transfection of mammalian cells. 41 2.1.3 Bacterial Strain and Growth Media The Escherichia coii strain DH5aF' (Genotype: F' ((()80d/acZAM15) endW hsdRl7(rK-, m K + ) supE44 X~ thi-l recAl gyrA96 relAl A(/acZYA-a/-gF)U169 deoR was used for routine propagation of all vectors and was purchased from Life Technologies. Bacto-tryptone, bacto-yeast extract and agar were purchased from Difco Laboratories (Detroit, MI). Ampicillin as its sodium salt (Amp), isopropylthio-/3-galactoside (IPTG), and 5-bromo-4-chloro-3-indolyl-/?-D-galactoside (X-Gal) were purchased from Life Technologies. Luria-Bertani medium (LB), used for growth of the untransformed DH5ccF' strain, comprised 10 g / L bacto-tryptone, 5 g / L bacto-yeast extract and 10 g / L NaCl, dissolved in distilled water (dH20) and adjusted to pH 7.0 with NaOH (Sambrook et al, 1989). LB agar plates contained 15 g / L agar (Difco) in LB medium. LB/Amp liquid medium and LB/Amp agar plates contained 100 //g/ml Amp. LB/Amp/IPTG/X-Gal plates were made by adding 100 jig/ml Amp, 25 jUg/ml IPTG, and 50 fig/ml X-Gal to LB agar medium (Sambrook et al., 1989). 2.1.4 Oligodeoxyribonucleotides Oligodeoxyribonucleotides were synthesized on an Applied Biosystems 391 DNA synthesizer (Mississauga, ON) according to the manufacturer's instructions. After synthesis, the oligonucleotides were cleaved from the solid phase support and deprotected (to remove protective moieties from the oligonucleotide) by incubation in fresh 14.8 M ammonium hydroxide at 55 °C overnight, and then lyophilized, in vacuo, in a Speed Vac Concentrator (Savant Instruments, Inc., Farmingdale, NY). Oligonucleotide concentrations were determined by dissolving the lyophilized DNA in dH20 and measuring the absorbance at 260 nm. An absorbance of 1.0 (1 cm light path) was taken to represent a concentration of 33 flglml (Sambrook et al, 1989). The Oligonucleotides that were used in this study are listed in Table 1. 2.1.5 Digestion of DNA with Restriction Endonucleases All digestions of DNA were performed using conditions recommended by the manufacturer. Typically 1 U of enzyme was used to digest 1 fig of DNA and the incubations were carried out for at least 2 h at 37 °C in a buffer supplied by the manufacturer. TABLE 1. Oligodeoxyribonucleotides. Oligo. Sequence and relevant restriction Application(s) endonuclease sites fX-A 5 ' -GGACACCTCGAAAGAGAGTG-3 ' Sequence analysis of fX cDNA fX-B 5 1 -TTCCAGGGTCTGTTTCCCA- 3 ' Sequence analysis of fX cDNA Not I Met + 1 5'-GGTGGCGGCCGCCACACCATGGGGCGC CCACTGCACCTCGTCCTGCTCAGTGCC TCCCTGGCTGGCCTCCTGCTGCTCGGG GAAAGTCTG-3' Forward primer for PCR amplification of cDNA fragment encoding the light chain and activation peptide of fX, PCR-mediated colony screening fX-(T2R) fX-Y fX/PC-rll PC-1 PC-2 PC-fill PC-rlV pNUT 3' pNUT 5' Xcm I 5'-GAGCAGGCCAACAACATCCTGGCGAGG GTCCGGAGGGCCAATTCC-3' Bsp EI 5'-ATATGATGCAGCCGACCTGG-3' Cla I 5'-CCCATCGATGAGCCTGGTGAGGTTGTT GTCGCCCC-3' 5'-GACCTGGACATCAAGGAGGTCTT-3' 5'-CACCAGGCCCACCAGGAACCAGG-3' Cla I 5'-CTCATCGATGGGAAGATGACCAGG-3 Not I -TTTGCGGCCGCCCCGGGTTACTAAGGT GCCCAGCTCTTCTGGGGGGCTTC-3' -CCCCAGTGCCTCTCCTGGCCCT-3 5'-ACTATAAAGAGGGCAGGCTG-3' Forward primer for PCR-mediated mutagenesis of fX cDNA sequence (substitution of Thr - 2 for Arg) Sequence analysis of fX/PC cDNA Cla I fusion region Reverse primer for PCR amplification of cDNA fragment encoding the light chain and activation peptide of fX, PCR-mediated colony screening Sequence analysis of PC cDNA Sequence analysis of PC cDNA Forward primer for PCR amplification of cDNA fragment encoding the serine protease domain of PC Reverse primer for PCR amplification of cDNA fragment encoding the serine protease domain of PC Sequence analysis of 3'-flanking region of fX/PC construct in pNUT vector, PCR-mediated colony screening Sequence analysis of 5'-flanking region of fX/PC construct in pNUT vector, PCR-mediated colony screening T 3 5 ' -ATTAACCCTCACTAAAG-3 ' Sequence analysis of fX and PC cDNA fragments in pBluescriptIIKS+ phagemid T 7 5 ' -AATACGACTCACTATAG-3 ' Sequence analysis of fX and PC cDNA fragments in pBluescriptIIKS+ phagemid 43 2.1.6 Agarose Gel Electrophoresis DNA fragments were resolved by submarine gel electrophoresis in 0.8% (w/v) agarose gels prepared in 0.04 M Tris-acetate/1 mM E D T A (TAE) containing 1 jUg/ml ethidium bromide. Samples were prepared for electrophoresis by adding 0.2 vol. of a loading buffer comprising 0.25% (w/v) bromophenol blue/0.25% (w/v) xylene cyanol FF/30% (v/v) glycerol (Sambrook et al., 1989). Electrophoresis was typically carried out for 60 min at 70 V using T A E as the electrophoresis buffer. The DNA was visualized by irradiation with an ultraviolet (260 nm) light source. 2.1.7 Ligation of DNA Fragments DNA fragments were ligated into the appropriate vectors using bacteriophage T4 DNA ligase. Ligation reactions (15 fll total volume) were performed in 66 mM Tris-HCl, pH 7.5/ 5 mM MgCl 2 / 5 mM dithiothreitol/1 mM ATP (Ligase Buffer) containing -100 ng of vector DNA, -300 ng of insert DNA and 1 U of T4 DNA ligase. The reactions were incubated at room temp, for 2 h or at 15 °C overnight, after which they were used to transform E. coli. 2.1.8 Transformation of E. coli DH5aF' E. coli cells were made competent for transformation using a modification of the protocol of Sambrook et al. (1989). DH5«F' cells were used to inoculate 5 ml L B medium in a sterile capped tube and the culture was incubated at 37 °C overnight in a shaking incubator at 300 rpm. An aliquot of 200 fjl of the overnight culture was used to inoculate 50 ml LB in a sterile Erlenmeyer flask and the cells were grown as above until the optical density (OD) at 600 nm was between 0.6 and 0.8. The cells were centrifuged at 1500 g at 4 °C for 5 min and the pellet resuspended in 20 ml 100 mM CaCl 2 . The resuspended cells were incubated overnight at 4 °C, then centrifuged at 1000 g for 5 min and the pellet resuspended in 1 ml sterile 50mM CaCl2/20% (v/v) glycerol. Aliquots of 50 fi\ of the competent cells were snap-frozen in liquid N 2 and stored at -70 °C until use. For transformations, -50 ng plasmid DNA or a ligation reaction mixture (10-15 /il) was mixed with 50 jA thawed competent cells and incubated on ice for 30 min. The suspension was heat-shocked at 42 °C for 2 min in a water bath and placed back on ice for 2 min. LB broth (150 jA) was added and the culture incubated at 37 °C for 30 min in a shaking incubator at 200 rpm to allow the cells time to begin expressing ^-lactamase. The culture was then spread on LB/Amp plates (sometimes also containing IPTG and X-Gal) and incubated at 37 °C overnight. 44 2.1.9 Amplification of DNA by the Polymerase Chain Reaction DNA fragments were amplified by the polymerase chain reaction (PCR) using a DNA Thermal Cycler (Perkin Elmer Cetus, Mississauga, ON). Each amplification mixture contained, in a total volume of 50 jA, 100 ng of double-stranded DNA as the template, 20 pmoles each of 'forward' and 'reverse' primers and 10 nmoles each of dATP, dCTP, dGTP, and dTTP in a buffer comprising 10 mM Tris-HCl/50 mM KC1/1.5 mM MgCl2/0.001% (w/v) gelatin, pH 8.3. The amplification mixture was overlaid with a drop of mineral oil and heated at 94 °C for 5 min to thoroughly denature the template DNA. Approx. 2 U of Thermus aquaticus (Taq) DNA polymerase was added to each reaction and amplification was carried out for 30 cycles, each cycle comprising a denaturation step at 94 °C for 30 s, an annealing step at 50 °C for 30 s, and an extension step at 72 °C (for 30 or 60 s depending on the length of the fragment to be amplified). At the end of 30 cycles, the reactions were incubated for an additional 10 minutes at 72 °C to ensure complete extension of the amplified fragment. 2.1.10 DNA Sequence Analysis DNA sequence analysis was performed by a modification of the dideoxynucleoside-mediated chain-termination method (Sanger et al., 1977) using a Sequenase Version 2.0 kit (Amersham Pharmacia Biotech) according to the manufacturer's instructions. Briefly, ~5 jig double-stranded plasmid DNA was denatured in 0.2M NaOH/0.2 mM E D T A at 37 °C for 30 min. The DNA was then precipitated by the addition of 0.1 vol. 3 M sodium acetate, pH 4.8 and 4 vol. 95% ethanol and collected by centrifugation at 12,000 g for 10 min. The pellet was washed once with 70% aqueous ethanol and air-dried. To the dried pellet was added 6 jA dH 2 0, 2 jA 0.2 M Tris-HCl, pH 7.5/0.1 M MgCl2/0.25 M NaCl and 2 jA (-30 ng) sequencing primer and the solution was incubated for 20 min at 37 °C to allow dissolution of the DNA and annealing to the primer. After incubation, 1 jA 0.1 M dithiothreitol, 2 /A Labeling Mix (1.5 fM dGTP/1.5 jiM dCTP/1.5 fM dTTP), 0.5 jA (0.5 jid) [a- 3 5S]-dATP and 2 jA (3 U) T7 DNA polymerase were added and the solution was incubated at room temp, for 2-5 min to allow extension from the annealed primer. Aliquots of 3.5 fA of the extension mixture were added to 2.5 /A of each of four (ddATP, ddCTP, ddGTP, ddTTP) "Termination Mixes" that had been pre-warmed to 37 °C. Each Termination Mix contained 50 mM NaCl, 80 JiM dATP, 80 (AA dCTP, 80 jiM dGTP, 80 [AsA dTTP and 8 fAsA of the appropriate ddNTP. The termination reaction was incubated at 37 °C for 5 min, at which time 5 /A Stop solution (95% (v/v) formamide/20 mM EDTA/0.05% (w/v) bromophenol blue/0.05% (w/v) xylene cyanol FF) was added. 45 The samples were heated at 80 °C for 3 min and electrophoresed in an 8% (w/v) polyacrylamide gel containing urea. Each gel (31 cm width x 38.5 cm height x 0.4 mm thick) was prepared by dissolving 37.5 g urea in a mixture containing 7.5 ml of lOx T B E buffer (0.9 M Tris-borate/20 mM EDTA, pH 8.0), 25 ml dH 2 0 and 15 ml of 40% (w/v) acrylamide solution (38% (w/w) acrylamide/2% (w/v) bis-acrylamide). Polymerization was initiated by the addition of 495 jl\ ammonium persulfate and 22.5 fll TEMED. Gels were electrophoresed in lx T B E buffer at constant power of 50W in a model 52 vertical electrophoresis apparatus (Life Technologies) until the xylene cyanol band reached the bottom of the gel (~2 h). The gels were laid on 3MM Chr paper (Whatman International Ltd., Maidstone, England), covered with plastic wrap and dried under vacuum for 60 min at 80 °C. The plastic wrap was removed, and the dried gels overlaid with Kodak X A R film (Eastman Kodak Co., Rochester, NY). After incubation overnight at room temp, the film was developed in a M35A X-Omat processor (Eastman Kodak Co.). 2.1.11 Isolation of genomic DNA from Mammalian Cells High molecular mass DNA was isolated from wild-type and transfected B H K (Syrian baby hamster kidney) cells according to the method of Sambrook et al. (1989). Cells of each type were cultured in three 75-cm tissue culture flasks in D-MEM/F-12 medium containing 5% (v/v) newborn calf serum until they reached confluency (see section 2.3 for details of methods used for cell culture). The medium was removed by aspiration, the cells overlaid with a trypsin solution (0.25% (w/v) trypsin/1 mM EDTA in Hanks' balanced salt solution without CaCl 2 , MgCl 2 or MgS0 4), and after 1 min, the solution was removed by aspiration. Cells from all three flasks were harvested in ice-cold TBS (10 mM Tris-HCl/30 mM NaCl, pH 7.5) and pooled (total vol. 4 ml). The cells were centrifuged at 1500 g for 10 min at 4 °C, the supernatant discarded, and the cells washed by resuspending them in 10 ml ice-cold TBS and centrifuging as before. After repeating the wash step, the cells were resuspended in 1 ml T E buffer (10 mM Tris-HC1/1 mM EDTA, pH 8.0) then mixed with 7.5 ml Lysis Solution (6 M guanidine-HCl/ 0.1 M sodium acetate, pH 5.5) and incubated in a capped tube at room temp, for 1 h on a Roto-Torque vertical rotater (Cole-Parmer Instruments Co., Chicago, IL). The cell suspension was carefully pipetted beneath 18 ml 95% ethanol in a glass tube (Corex brand; Fisher Scientific Canada) and the DNA recovered onto a hooked pasteur pipette by slowly stirring the interface between the cell lysate and the ethanol layer with the pipette. The DNA, present as a gelatinous mass attached to the hooked tip of the pipette, was rinsed briefly in 5 ml of 95% ethanol and rehydrated (while still attached to the pipette) by incubating it in 1 ml T E buffer, pH 8.0 overnight at 4 °C. The pipette was then removed and the DNA incubated at 4 °C on a vertical rotater until completely dissolved (3 days). 46 2.1.12 Preparation of a Radiolabeled DNA Probe A 775-bp cDNA fragment encoding the heavy chain of human PC was amplified by PCR using the primers PC-fill and PC-rlV (Table 1) as described above (see section 2.1.9). The DNA fragment was electrophoresed in a 0.8% (w/v) agarose gel, purified using a Geneclean kit (BIO 101 Inc.), and the DNA dissolved in T E buffer, pH 8.0. Approx. 25 ng of the DNA 32 fragment was radiolabeled with [a- P]-dCTP using a T7 Quick Prime Kit (Amersham Pharmacia Biotech) according to the manufacturer's protocol. Briefly, the purified PCR product was denatured by boiling for 3 min. To a 1 /il aliquot (-25 ng) of the denatured sample was added 33 fA dH 2 0, 10 /il Reagent Mix (dATP, dGTP, dTTP and random oligodeoxyribonucleotides of primarily 9 nucleotides in length), 5 fA (50 /iCi) of [ce-32P]-dCTP and 1 /il (4 U) T7 DNA polymerase. The solution was incubated at 37 °C for 15 min and the radiolabeled probe purified to remove unincorporated nucleotides using a D N A Clean-up kit (Promega Corp.). The purified probe was dissolved in 100 fA dH 2 0. 2.1.13 Southern Blot Analysis of Transfected Mammalian Cells Southern blotting (Southern, 1975) was performed as described by Sambrook et al. (1989). Approx. 20 fig of the pNUT-fX/PC plasmid and -30 fig of genomic DNA prepared from wild-type B H K cells, B H K cells stably transfected with pNUT, and B H K cells stably transfected with pNUT- fX/PC were each digested with 75 U Not I overnight at 37 °C. The digested DNA was purified using a DNA Cleanup-kit (Promega Corp.), dissolved in 100 /il dH 2 0, and the concentration determined by measuring the absorbance at 260 nm, assuming an absorbance of 1.0 (1 cm light path) to represent a DNA concentration of 50 /Jg/ml (Sambrook etal, 1989). Four fig of each of the digested genomic DNA preparations, and 93 pg, 465 pg, 930 pg and 1860 pg of digested pNUT-fX/PC (the equivalent of 10, 50, 100 and 200 copies of the plasmid) were electrophoresed in a gel comprising 0.8% (w/v) agarose dissolved in 0.5x T B E (44.5 mM Tris-borate/1 mM EDTA, pH 8.3) at 120 V for 4 h using 0.5x T B E as the electrophoresis buffer. After electrophoresis, the DNA was denatured for 45 min by immersing the gel in two changes of 0.5 M NaOH/1.5 M NaCl and the denaturing solution was then neutralized by incubating the gel in two changes of 1.5 M NaCl/1 M Tris-HCl, pH 7.5 (for 30 min and 15 min, respectively). The DNA was transferred to Hybond-N+ nylon membrane (0.45 fim; Amersham Pharmacia Biotech) by capillary blotting for 16 h at room temp, using transfer buffer comprising 1.5 M NaCl/0.15 M sodium citrate, pH 7.0 (lOx SSC). The membrane was rinsed in 0.3 M NaCl/0.03 M sodium citrate, pH 7.0 (2x SSC), air-dried, and the DNA fixed by microwaving the membrane at 700 W for 90 s (Angeletti et al, 1995). Hybridization of the [a- P]-labeled PC cDNA probe (section 2.1.12) to the membrane-bound genomic DNA was performed according to Sambrook et al. (1989). The membrane was incubated for 2 h at 68 °C in 10 ml of Pre-hybridization Solution comprising 0.9 M NaCl/0.09 M sodium citrate, pH 7.0 (6x SSC) containing 0.5% (w/v) SDS, 0.2% (w/v)polyvinylpyrrolidone, 0.2% (w/v) Ficoll, 0.2% (w/v) bovine serum albumin (Fraction V) and 0.01 % (w/v) fragmented and denatured salmon sperm DNA (prepared according to Sambrook et al, 1989) in a sealed glass bottle in a model Micro-4 rotating hybridization oven (Hybaid Ltd., Ashford, Middlesex, UK). The Pre-hybridization Solution was then replaced with 10 ml Hybridization Solution comprising 0.9 M NaCl/0.09 M sodium citrate, pH 7.0 containing 0.5% (w/v) SDS, 0.01 % (w/v) fragmented and denatured salmon sperm DNA, and the radiolabeled cDNA probe (the probe was denatured by heating at 100 °C for 5 min prior to its addition to the Hybridization Solution). Hybridization was performed for 2 h at 65 °C as above and the membrane was then washed as follows: twice for 15 min each with 75 ml per wash of 0.3 M NaCl/0.03 M sodium citrate, pH 7.0 (2x SSC) containing 0.1% (w/v) SDS, once for 30 min with 75 ml of 0.15 M NaCl/15 mM sodium citrate, pH 7.0 (lx SSC) containing 0.1% (w/v) SDS, and once for 10 min with 75 ml of 15 mM NaCl/1.5 mM sodium citrate, pH 7.0 (O.lx SSC) containing 0.1% (w/v) SDS. All wash steps were done at 68 °C using solutions that had been pre-heated to that temperature. The membrane was then enclosed in plastic wrap, overlaid with X-Omat AR film (Eastman Kodak Co.) and an intensifier screen, and incubated at -70 °C for 6 h. The exposed film was developed in a M35A X - O M A T processor (Eastman Kodak Co.). The membrane was also exposed to a Phosphorlmager screen for 30 min and analyzed in a model SI Phosphorlmager (Molecular Dynamics Inc., Sunnyvale, CA) to generate a standard curve of signal intensity versus DNA copy number. The copy number of pNUT-fX/PC was calculated from this standard curve. 2.2 Construction of FX/PC Expression Vectors 2.2.1 Construction of pNUT-fX/PC A 734-bp partial cDNA encoding 8 bp of the 5'-untranslated region, the signal peptide, propeptide, EGF-like domains and activation peptide of human factor X (fX) was amplified by PCR (as described in section 2.1.9) using the primers fX-fl and fX/PC-rll (Table 1), the plasmid pcHX14 as template, and an extension step of 60 s. Similarly, a 775-bp partial cDNA 48 encoding the heavy chain (less the activation peptide) of human protein C (PC) was amplified using the primers PC-fill and PC-rlV (Table 1) and the vector pUC-PC as template. The amplified fX and PC fragments were precipitated by adding 0.5 vol. 7.5 M ammonium acetate, pH 7.5 and 2 vol. 95% ethanol to the amplification mixtures. The precipitates were centrifuged at 12,000 g for 10 min at room temp, and the supernatant discarded. The DNA pellets were washed with 70% ethanol and the supernatant discarded, after which the pellets were air-dried and the DNA dissolved in dH 2 0. The amplified fX and PC fragments were each digested with Not I and Cla I and electrophoresed in 0.8% (w/v) agarose gels containing ethidium bromide. The fragments were excised from the gel and purified using a Geneclean kit. The 719-bp fX fragment and the 759-bp PC fragment were ligated separately into the phagemid pBluescriptIIKS+ that had been prepared by digestion with Not I and Cla I and treatment with calf intestinal alkaline phosphatase to remove terminal 5'-phosphates (2 U/fig phagemid DNA for 1 h at 37 °C). The ligation mixtures were used to transform DH5ceF' E. coii and the cells were plated on LB/Amp/X-Gal/IPTG agar plates and grown overnight at 37 °C. E. coii colonies displaying a white phenotype were streaked on LB/Amp plates and after overnight incubation at 37 °C, single colonies Were used to inoculate LB/Amp medium and the cultures were grown at 37 °C overnight in a shaking incubator. Phagemid DNA was isolated using a Wizard Plus Miniprep DNA purification kit (Promega Corp.), digested with Not I and Cla I, and electrophoresed in agarose gels. Phagemids that contained an insert of the correct size were subjected to DNA sequence analysis by the chain termination method (see section 2.1.10) using the primers T7 and T3, which anneal to sequences in pBluescriptIIKS+ flanking the Not I and Cla I cloning sites respectively, and the primers PC-1 and PC-2 (Table 1). The sequence of the entire insert and flanking regions was determined and plasmids bearing a fX or PC insert with the correct sequence were designated BSKS+-fX and BSKS+-PC. The BSKS+-fX and BSKS+-PC phagemids were each digested with both Not I and Cla I and the fX and PC fragments purified from agarose gels using a Geneclean kit. The purified fX and PC fragments were simultaneously ligated into the mammalian expression vector pNUT that had been prepared by digestion with Not I and treatment with alkaline phosphatase as described above. The ligation mixture was used to transform DH5ceF' E. coii and the cells were spread on LB/Amp agar plates and incubated overnight at 37 °C. 49 Ten of the resultant colonies were screened directly by PCR to detect those harboring vectors with inserts of the correct size. For this step, single colonies on the LB/Amp agar plates were picked with a sterile pipette tip and patched to another LB/Amp agar plate. The residual cells on the pipette tip were transferred into a PCR reaction mixture (25 fil final volume) containing the primers pNUT 5' and pNUT 3' in a 0.65-ml microfuge tube. The mixture was overlaid with a drop of mineral oil and heated at 94 °C for 5 min to lyse the bacterial cells and denature the template DNA. Taq DNA polymerase was added and amplification was performed for 30 cycles as described in section 2.1.9 using a 60 s extension step. The PCR products were analysed by electrophoresis in 0.8 % (w/v) agarose gels and colonies harboring plasmids with the 1486-bp fX/PC insert, as indicated by PCR, were cultured in LB/Amp medium and the plasmids isolated using a DNA purification kit (Promega). The plasmids were digested separately with Eco Rl, Not I and Cla I and the fragments resolved in 0.8% (w/v) agarose gels to determine which plasmids contained the hybrid fX/PC cDNA in the desired orientation. The sequences of the 5' and 3' Not I junctions, and the internal Cla I fusion region, of the fX/PC cDNA insert were determined by the chain termination method (see section 2.1.10) using the primers pNUT 5', pNUT 3', and fX-Y, respectively (Table 1). The vector containing the hybrid fX/PC cDNA free of sequence errors and in the desired orientation was designated pNUT-fX/PC. 2.2.2 Construction of pNUT-fX(T~2R)/PC A mutation specifying a Thr to Arg substitution at position -2 (i.e. within the propeptide region) of the chimeric fX/PC protein was incorporated by PCR-mediated site-directed mutagenesis. Amplification was performed as described in section 2.1.9 using the phagemid B S K S + - f X as the template, the primers fX-(T"2R) and fX/PC-rll (Table 1), and an extension step of 60 s. The 630-bp amplified fragment was purified from the PCR reaction mixture using a DNA Clean-up kit (Promega Corp.), digested with Xcm I and Eco Rl, and electrophoresed in a 0.8% (w/v) agarose gel. A 136-bp Xcm I—Eco Rl fragment encoding the Thr to Arg substitution was excised from the gel and the DNA recovered using an Ultrafree-MC Centrifugal Filter Device (Millipore Corp., Bedford, MA). The purified fragment was ligated to BSKS + - fX that had been prepared by digestion with Xcm I and Eco R l and treatment with calf intestinal alkaline phosphatase (2 U//ig phagemid DNA for 1 h at 37 °C). The ligation mixture was used to transform DH5aF' E. coli and the cells were spread on LB/Amp/X-Gal/IPTG agar plates and grown overnight at 37 °C. Because a Bsp EI restriction site had been incorporated into the fX-(T~2R) primer (a silent change with respect to the amino acid sequence), E. coii colonies were screened directly by PCR to detect those harboring vectors with inserts encoding the Thr to Arg mutation. Single colonies displaying a white phenotype were picked with a sterile pipette tip and patched to an LB/Amp agar plate. The residual cells on the pipette tip were transferred into a PCR reaction mixture (25 fjl final volume) containing the primers fX-fl and fX-rll and amplification was performed, after a 5 min 'hot start', for 30 cycles using an extension step of 60 s as described in section 2.1.9. An aliquot of 10 (A of each amplification mixture was electrophoresed in a 0.8% (w/v) agarose gel to confirm that a 728-bp fragment had been amplified. To the remaining 15 [A of appropriate amplification mixtures was added 2.5 (A of dH 2 0, 2 fll of restriction enzyme buffer (lOx concentration) and 0.5 jA (5 U) of Bsp EI. After incubation at 37 °C for 1 h, the digestion reactions were electrophoresed in a 0.8% (w/v) agarose gel. Colonies that harbored a vector with a fX insert encoding the Thr to Arg substitution were thus identified by analyzing the pattern of Bsp EI restriction fragments. Phagemids were isolated from appropriate colonies using a Wizard Plus Miniprep DNA purification kit and the sequence of the entire fX insert and flanking regions was determined using the primers T3, T7, fX-A and fX-B (Table 1 and section 2.1.10) to confirm that no additional mutations had been incorporated. The resultant phagemid, designated BSKS +-fX(T~ 2R), and the phagemid BSKS + -PC, were each digested with Not I and Cla I and the fX and PC cDNA inserts purified, ligated simultaneously to Not I-digested pNUT, and used to transform DH5aF' E. coii as described above. Plasmids were isolated from transformed E. coii using a Wizard Plus Miniprep DNA purification kit and analyzed by restriction digestion. The sequences of the 5' and 3' Not I junctions and the internal Cla I fusion region of the mutated fX/PC cDNA insert were determined (see section 2.1.10) using the primers pNUT 5', pNUT 3', and fX-Y, respectively (Table 1). The vector containing the mutated fX/PC cDNA free of sequence errors and in the desired orientation was designated pNUT-fX(T~ 2R)/PC. 2.2.3 Construction of pCI-neo-fX(T"2R)/PC The hybrid fX(T"2R)/PC cDNA construct was excised from the vector pNUT-fX(T"2R)/PC by restriction digestion with Not I and electrophoresed in a 0.8% (w/v) agarose gels. The 1478-bp cDNA fragment was purified using a Geneclean kit (BIO 101 Inc.) and ligated to pCI-neo that had been prepared by digestion with Not I and treatment with calf intestinal alkaline phosphatase (2 VI fig vector DNA for 1 h at 37 °C). The ligation mixture was used to transform DH5aF' E. coii and the cells were spread on LB/Amp agar plates, incubated at 37 °C overnight, and single colonies patched to another LB/Amp agar plate and grown overnight at 37 °C. Plasmids were isolated from several transformants using a Wizard Plus Miniprep DNA purification kit and analyzed by digestion with a series of restriction endonucleases to determine the orientation of the inserts and that concatenation had not occurred. The vector containing the fX(T"2R)/PC cDNA construct in the desired orientation was designated pCI-neo-fX(T"2R)/PC. 2.3 Transfection and Culture of Mammalian Cells 2.3.1 General Materials for Culturing Mammalian Cells All plasticware used for culturing mammalian cells was purchased from Corning Inc. (Corning, NY) and Becton Dickinson Canada Inc. (Mississauga, ON). Plastic cryogenic storage vials (Nalgene brand) were purchased from Nalge Nunc International (Rochester, NY). Sterile filtration devices (0.22 (im) were purchased from Pall Gelman Sciences (Saint Laurent, QC). Mammalian cells that were propagated in dishes and flasks were grown in an incubator equipped with a temperature and C 0 2 controller (Forma Scientific, Inc., Marietta, OH) at 37 °C in a humid atmosphere containing 5% C 0 2 . Cells propagated in roller bottles were grown in a rotating incubator (Hotpack, Philadelphia, PA) at 37 °C after first blowing 5% C 0 2 into the flasks from a gas cylinder and sealing them airtight. All cell culture procedures were performed aseptically in a Class II Type A biological safety cabinet (NUAIRE, Plymouth, MN). 2.3.2 Mammalian Cell Lines, Cell Culture Media and Reagents A Syrian Baby Hamster Kidney tk~ (BHK) cell line was provided by R. Palmiter (Palmiter et al, 1987). A Human Embryonic Kidney cell line (HEK 293A) was obtained from Quantum Biotechnologies Inc. (Laval, QC). Dulbecco's Modified Eagle Medium:Nutrient Mixture F-12 (1:1) (D-MEM/F-12; purchased as a powder containing L-glutamine and Phenol Red indicator but no HEPES buffer or sodium bicarbonate), Knockout SR serum-free medium, newborn calf serum (NBS), Albumax supplement, Geneticin (G-418 sulfate) and Trypsin-EDTA Solution (0.25% (w/v) trypsin/1 mM E D T A in Hanks' balanced salt solution without CaCl 2 , MgCl 2 or MgS0 4) were purchased from Life Technologies. Bovine insulin, human apo-transferrin, sodium selenite, dimethyl sulfoxide (Hybrimax brand), ethanolamine, benzamidine-HCl and phenylmethylsulfonyl fluoride (PMSF) were purchased from Sigma-Aldrich Canada Ltd. Methotrexate was purchased from Faulding (Vaudreuil, QC), vitamin KI from Abbott Laboratories (Montreal, QC), and calcium chloride from Fisher Scientific Canada. 52 Standard cell culture medium (denoted D-MEM/F-12/NBS) comprised 12 g/L D-MEM/F-12, 2.4 g/L NaHC0 3 and 5 % (v/v) newborn calf serum, adjusted to pH 7.4 with HC1. Serum-free media (pH 7.4) contained either 12 g/L D-MEM/F-12, 2.4 g/L NaHC0 3 , 0.5 % (v/v) Knockout SR and 10 //g/ml vitamin K (denoted D-MEM/F-12/KSRK) or 12 g/L D-MEM/F-12, 2.4 g/L NaHC0 3 , 10 mg/L insulin, 5 mg/L transferrin, 6.8 //g/L sodium selenite, 2 mg/L ethanolamine, 200 mg/L albumax and 10 flg/ml vitamin K l (denoted D-MEM/F-12/ITSAK). For selection of cells transfected with the pNUT vector and its derivatives, the D-MEM/F-12/NBS medium was supplemented with 0.44 mM methotrexate. For selection of cells transfected with the pCI-neo vector and its derivatives, the D-MEM/F-12/NBS medium was supplemented with G-418 sulfate (750 fig G-418 sulfate/ml medium). 2.3.3 Transfection and Selection of Mammalian Cell Lines Transfections of B H K and HEK 293A cells were carried out by a modification of the calcium phosphate-mediated protocol of Chen et al. (1988). Each transfection was performed in duplicate with controls comprising transfection with an equivalent amount of the appropriate vector that contained no insert, and mock transfection with dH 2 0. Solutions were sterilized using 0.22 fim filtration devices. Cells were grown to confluency in D-MEM/F-12/NBS medium in culture flasks (25 cm 2 bottom surface area). On the day before transfection, the medium was removed by aspiration and the cells overlaid with Trypsin-EDTA Solution for 30-60 s. The Trypsin-EDTA Solution was aspirated off, the cells detached and suspended in 2 ml D-MEM/F-12/NBS, and 0.25 ml aliquots of the suspended cells dispensed into 25 mm x 100 mm culture dishes (78.5 cm 2 bottom surface area) containing 10 ml D-MEM/F-12/NBS. The cells were grown overnight to a confluency of -70% and transfected as below. For each transfection, 20 fig of vector DNA was precipitated by the addition of 0.5 vol. 7.5 M ammonium acetate, pH 7.5 and 2 vol. 95% ethanol and collected by centrifugation at 12,000 g for 10 min. The DNA was air-dried aseptically in a biological safety cabinet, redissolved in 450 fi\ dH 2 0, then 50 fll 2.5 M calcium chloride was added and the solution was thoroughly mixed. Following the addition of 500 fll of 2x Hepes Buffered Saline (274 mM NaCl/10 mM KC1/1.4 mM Na 2HP04 (anhydrous)/l 1 mM dextrose/42 mM HEPES, pH 6.95), the solution was gently mixed and incubated at room temp, for 20 min. The solution (1 ml) was then added to the medium in a culture dish containing cells at -70% confluency (prepared as above) and mixed by gently swirling the dish. Selection was commenced 12 h later by rinsing the cells three times with D-MEM/F-12 and replacing the medium with D-MEM/F-12/NBS containing either 0.44 mM methotrexate or 750 //g/ml G-418 sulfate, depending on the vector employed for transfection. 53 During selection, the cells were incubated at 37 °C and the medium was replaced every 2-3 days. As the non-transfected cells expired, colonies resistant to the selection agent could be observed with a microscope, becoming visible to the naked eye after 10-14 days. At this time, individual colonies were selectively detached from the dishes by topical treatment with Trypsin-EDTA Solution and transferred to separate wells of a 6-well culture plate containing 2 ml per well D-MEM/F-12/NBS and the appropriate selection agent (0.44 mM methotrexate or 750 /Jg/ml G-418 sulfate). The colonies were grown to confluency before transferring the cells to 25-cm2 culture flasks. To identify stably transfected cell lines expressing the highest levels of the —2 recombinant fX/PC and fX(T R)/PC proteins, the cells were passaged at least twice and then grown to confluency in a 25-cm2 culture flask. The medium was removed by aspiration and the cells treated with Trypsin-EDTA Solution and suspended in 2 ml D-MEM/F-12/NBS as described above. The cell number (cells/ml) was quantitated with a hemocytometer and 5 x 105 cells were seeded into a 25-cm culture flask and grown for 48 h in D-MEM/F-12/NBS. The medium was then removed, the cells rinsed three times with D-MEM/F-12 and 3 ml serum-free medium (D-MEM/F-12/KSRK or D-MEM/F-12/NBS/ITSAK) was added. The conditioned medium was collected after 24 h and assayed by western blot analysis using monoclonal antibodies to fX and PC (see section 2.5.2). Frozen stocks of stably transfected clonal cell lines were prepared by suspending cells grown to confluency in D-MEM/F-12/NBS containing 10% (v/v) dimethyl sulfoxide and aliquoting them in plastic cryogenic vials. The cells were frozen gradually by incubating the vials in a sealed polystyrene container in a freezer at -70 °C overnight. The frozen stocks were then stored in liquid nitrogen. When starting cultures from frozen stocks, the cells were thawed rapidly in a water bath at 37 °C and immediately added to flasks containing D-MEM/F-12/NBS and cultured as above. 2.3.4 Large-Scale Expression of fX/PC and fXfrtiyPC in Mammalian Cells The production of larger volumes of conditioned medium for use in the purification of the —2 2 fX/PC and fX(T R)/PC proteins was achieved by scaling up expression to 75- and 175-cm culture flasks, and roller bottles (1700 cm 2 surface area). Stably transfected clonal cell lines expressing fX/PC and fX(T~2R)/PC were grown to confluency in 25- or 75-cm2 flasks in D-MEM/F-12/NBS containing the appropriate selection agent (either 0.44 mM methotrexate or 54 750 /ig/ml G-418 sulfate). The cells were detached from the flasks by treatment with Trypsin-E D T A Solution, suspended in D-MEM/F-12/NBS (containing methotrexate or G-418 sulfate as appropriate), and transferred to larger flasks or roller bottles. In general, each 75-cm flask 2 2 was seeded with half of the cells from a confluent 25-cm flask; a 175-cm flask was seeded with cells pooled from two 25-cm flasks; and a roller bottle was seeded with cells pooled from four 75-cm flasks. The cells were grown to confluency, rinsed three times with D-MEM/F-12, and serum-free medium was added (either D-MEM/F- 12/KSRK or D-MEM/F- 12/NBS/ITSAK; see 2 2 section 2.3.2) in the following volumes: 15 ml/75-cm flask; 25 ml/175-cm flask; 250 ml/roller bottle. Conditioned medium was collected from the flasks and roller bottles every 2-3 days (i.e. after the color of the Phenol Red indicator in the medium had changed from red to orange) and replaced with fresh D-MEM/F-12/KSRK or D-MEM/F-12/NBS/ITSAK. Upon collection, the serine protease inhibitor Benzamidine-HCl was added to the conditioned medium to a final concentration of lOmM and the medium was passed through a 0.22 (im filter and either processed immediately as below or frozen at -20 °C and used later. In later expression experiments, the serine and thiol protease inhibitor phenylmethylsulfonyl fluoride (PMSF) was also added to the conditioned medium, at the time of collection, to a final concentration of 0.1 mM. 2.4 Purification of recombinant fX/PC Proteins 2.4.1 Immunoaffinity Chromatography The recombinant fX/PC and fX(T~2R)/PC proteins were isolated from conditioned cell culture medium by batch adsorption to immunoffinity resins. Two immunoaffinity resins, comprising polyclonal antibodies to human protein C and human factor X covalently linked to Sepharose beads, were kindly provided by Dr. Hugh Hoogendorn of Affinity Biologicals Inc. (Hamilton, ON). Conditioned medium (250 ml) was concentrated to 30 ml at 4 °C under pressure from nitrogen gas in a stirred cell filtration unit equipped with a 30 kDa cut-off Diaflo Ultrafilter PM30 membrane (Amicon, Beverly, MA). To the concentrated medium was added 1.2 ml 5 M NaCl, 0.8 ml 1 M Tris-HCl, pH 7.4 and 8 ml deionized dH 2 0 (thus giving a final concentration of 20mM Tris) and the medium was adjusted to pH 7.4 with weak HCI and filtered through a 0.45 jim syringe filter. 55 A thick slurry (-12 ml) of either anti-human factor X-sepharose or anti-human protein C-sepharose (suspended in 150 mM NaCl/20 mM Tris-HCl, pH 7.4) was added to the concentrated medium and the mixture was incubated in a capped tube at 4 °C for 2 h on a Roto-Torque vertical rotater. The mixture was then poured into a 25 mm x 130 mm chromatography column (Bio-Rad Laboratories (Canada) Ltd) and the medium drained slowly from the column outlet until the resin had settled into a compact bed (-10 ml bed volume). The resin was washed with 300 mM NaCl/20 mM Tris-HCl, pH 7.4 by gravity feed (-0.5 ml/min) until the A 280nm of the effluent neared zero, followed by a further wash with 40 ml 50 mM NaCl/20 mM Tris-HCl, pH 7.4. The fX/PC or fX(T"2R)/PC proteins were eluted by adding 30 ml Gentle Elution Buffer (Pierce, Rockford, IL) and 1.5-ml fractions were collected at -0.5 ml/min. Those fractions with the highest absorbance (A28o nm) were pooled, concentrated, and dialyzed into 20 mM Tris-HCl, pH 7.4 in a stirred cell filtration unit as detailed above. The solution was then concentrated to 1 ml in a 30 kDa cut-off Ultrafree centrifugal filter device (Millipore Corp., Bedford, MA) and either processed as below or snap-frozen in liquid nitrogen and stored at -70 °C for later use. 2.4.2 Hydroxyapatite Chromatography Samples of immunoaffinity-purifed fX/PC and fX(T~2R)/PC were dialyzed into 10 mM sodium phosphate buffer, pH 7.2 and chromatographed at room temp, on a 5-ml Econo-Pac CHT-II hydroxyapatite column (Bio-Rad Laboratories (Canada) Ltd., Mississauga, ON) according to the manufacturer's instructions. A model LCC-500 Plus Fast Phase Liquid Chromatography (FPLC) apparatus (Amersham Pharmacia Biotech, Baie d'Urfe, QC) was used for this purpose. Proteins were loaded onto the hydroxyapatite column (pre-equilibrated in 10 mM sodium phosphate buffer, pH 7.2) at a flow rate of 0.25 ml/min and the column was washed with the same buffer at 3 ml/min until the A 2 8 0 n m of the flow-through solution fell to below 5% of the peak absorbance observed during loading. The bound proteins were eluted with a 20-ml linear gradient of sodium phosphate buffer, pH 6.8 (10-500 mM) at a flow rate of 0.5 ml/min. Fractions corresponding to distinct peaks in the absorbance profile of the eluate ( A 2 8 0 n m ) w e r e pooled separately, concentrated and dialyzed into 150 mM NaCl/20 mM Tris-HCl, pH 7.4 using 30 kDa cut-off centrifugal filter devices (Millipore Corp.), snap-frozen in liquid nitrogen and stored at -70 °C until being analyzed. 2.5 General Protein Analysis Methods 2.5.1 SDS-PAGE Acrylamide, bis-acrylamide (MA^-methylene-bis-acrylamide), ammonium persulfate, T E M E D (A ,^MA '^^ V'-tetramethylethylenediamine), Coomassie Brilliant Blue R-250 and bromophenol blue were purchased from Bio-Rad Laboratories (Canada) Ltd. Tris base (Tris(hydroxymethyl)aminomethane) was purchased from Life Technologies. Glycine, sodium dodecyl sulfate (SDS) and methanol were purchased from Fisher Scientific Canada. Pre-stained protein molecular mass standards comprised a mixture of the following proteins (apparent molecular mass given in parentheses): myosin (H-chain; 214.2 kDa); phosphorylase B (111.4 kDa); bovine serum albumin (74.25 kDa); ovalbumin (45.5 kDa); carbonic anhydrase (29.5 kDa); /3-lactoglobulin (18.3 kDa); lysozyme (15.4 kDa). Purified plasma factor X and purified plasma protein C were purchased from Haematologic Technologies Inc. (Essex Junction, VT). Electrophoresis was carried out in a SE 250 Mighty Small Vertical Slab Unit (Hoefer Pharmacia Biotech Inc., San Francisco, CA). Samples for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) were treated to denature the proteins and reduce disulfide bonds by adding 0.25 vol. of Sample Buffer (62.5 mM Tris-HCl, pH 6.8/2% (w/v) SDS/5% (v/v) /3-mercaptoethanol/10% (v/v) glycerol/0.00125% (w/v) bromophenol blue) and heating them at 100 °C in a heating block for 3 minutes. The treated samples were resolved in SDS-polyacrylamide 'mini' slab gels (1.5 mm thickness) using the discontinuous buffer system of Laemmli (1970). Resolving gels comprising 12% (w/v) polyacrylamide/0.375 M Tris-HCl, pH 8.8/0.1 % (w/v) SDS and stacking gels comprising 4.5% (w/v) polyacrylamide/0.125 M Tris-HCl, pH 6.8/0.1% (w/v) SDS were prepared from a 30% (w/v) stock solution of 36.5:1 (w/w) acrylamide-/bisacrylamide. The gels were polymerized by the addition of 0.05% (w/v) ammonium persulfate and either 0.05% (v/v) T E M E D (for resolving gels) or 0.2% (v/v) T E M E D (stacking gels). Electrophoresis was carried out at room temp, at a constant voltage of 175 V for approx. 60 min in an electrode buffer comprising 0.25 M glycine/0.1% (w/v) SDS/25 mM Tris base, pH 8.3. The separated proteins were visualized by immersing the gel for 60 min in 0.25% (w/v) Coomassie Blue R-250/45% (v/v) methanol/10% (v/v) glacial acetic acid followed by de-staining in several changes of 45% (v/v) methanol/10% (v/v) glacial acetic acid. 2.5.2 Western Blot Analysis Nitrocellulose membrane (pore size 0.45 /im) was purchased from Schleicher and Schuell (Keene, NH). Mouse monoclonal antibodies to human factor X and human protein C were purchased from Affinity Biologicals Inc. (Hamilton, ON). Alkaline phosphatase-conjugated goat anti-mouse IgG antibodies (H+L chains) were from Life Technologies. NBT (i.e. Nitro Blue Tetrazolium: 2'2'-di-/7-nitrophenyl-5,5'-diphenyl-3,3 '-[3,3'-dimethoxy-4,4'-diphenylene]ditetrazolium chloride), BCIP (5-Bromo-4-chloro-3-indolyl phosphate), Tween 20 and bovine plasma albumin (Fraction V) were from Sigma-Aldrich Canada Ltd. Electroblotting was carried out in a T E 22 Mighty Small Transphor Tank Transfer Unit (Hoefer Pharmacia Biotech Inc.). Protein samples and pre-stained protein molecular mass standards were denatured, reduced, and resolved in SDS/12.5% (w/v) polyacrylamide gels as described in section 2.5.1. The proteins were electroblotted to nitrocellulose membrane at a constant current of 400 mA for 60 min using a transfer buffer comprising 0.01% (w/v) SDS/2 mM EDTA/20 mM Tris-acetate, pH 7.4. After transfer, unoccupied binding sites on the nitrocellulose were blocked by incubating the membrane in 10 mM Tris-HCl/30 mM NaCl, pH7.5/0.005% (v/v) Tween 20 (Tris Buffered Saline/Tween 20 solution, i.e. TBS/T) containing 5% (w/v) skim milk powder and 1% (w/v) bovine plasma albumin for 60 min on a rocking platform (New Brunswick Scientific Co. Inc., New Brunswick, NJ). The blocked membrane was rinsed briefly two times with TBS/T and incubated in 5 ml primary antibody solution (mouse anti-human factor X or mouse anti-human protein C antibodies; 5 //g/ml in TBS/T) for 90 min at room temp, in a capped 50-ml conical tube on a Roto-Torque vertical rotater. The membrane was washed with TBS/T two times, for 1 min each, followed by four times, for 5 min, each and then incubated for 60 min in 10 ml secondary antibody solution (alkaline phosphatase-conjugated goat anti-mouse IgG diluted 1:5000 in TBS/T). The membrane was washed with TBS/T (two times, for 1 min each, followed by four times for 5 min each) and developed by incubating it in 10 ml 100 mM Tris-HCl , pH 9.5/100 mM NaCl/5 mM MgCl 2 to which had been added 66 /d NBT stock solution (50mg/ml NBT in 70% (v/v) dimethylformamide) and 33 /d BCIP stock solution (50 mg/ml BCIP in dimethylformamide). Color development was terminated by rinsing the membrane with 0.2 M EDTA, pH 8.0. 58 2.5.3 N-terminal Amino Acid Sequence Analysis All solutions were prepared using distilled deionized water and were filtered (0.2 fim pore size) before use. Purified recombinant fX/PC and fX(T"2R)/PC proteins were resolved in SDS/12.5% (w/v) polyacrylamide gels as described in section 2.5.1 except that before loading the gels, the samples were heated at 37 °C for 15 min instead of at 100 °C for 3 min. After electrophoresis the gel was equilibrated in two changes (15 min each) of Transfer Buffer (10 mM 3-(cyclohexylamino)-l-propane-sulfonic acid (CAPS), pH 11/10% (v/v) methanol). The proteins were then electroblotted (see section 2.5.2), using the protocol of Matsudaira (1987), to Immobilon-PSQ polyvinydene difluoride membrane (Millipore Corp., Bedford, MA) in Transfer Buffer at a constant current of 400 mA for 90 min. The electroblotted proteins were stained by immersing the membrane in 0.025% (w/v) Coomassie Blue R-250/40% (v/v) methanol for 5 min and the membrane destained in several changes of 50% (v/v) methanol. The membrane was blotted dry and the protein bands excised for analysis. N-terminal amino acid sequences were determined either by the Nucleic Acid-Protein Service Unit, University of British Columbia, or the Biotechnology Laboratory, Institute of Molecular Biology, University of Oregon. 2.5.4 Determination of Protein Concentration The concentrations of purified recombinant fX/PC and fX(T~2R)/PC proteins were determined colorimetrically by the method of Bradford (1976) using a kit purchased from Bio-Rad Laboratories (Canada) Ltd. according to the manufacturer's instructions. Purified human fX and purified human PC were purchased from Haematologic Technologies Inc. After color development, the A 5 9 5 n m of the samples was measured in a model Lambda 3B UV/VIS spectrophotometer (Perkin Elmer Corp., Norwalk, CT). The concentration of the fX/PC and fX(T R)/PC proteins was determined by reference to a standard curve generated using purified fX after first confirming (1) that the concentration of fX specified by the manufacturer matched that calculated from its reported extinction coefficient (A280nm '*> 1 cm light path = 11.6) (Di Scipio et al., 1977) and (2) that when using fX as the standard protein, the concentration of purified PC determined by the Bradford assay was close (within 3%) to that specified by the manufacturer. Molar concentrations were calculated using the following molecular masses: human fX, 59 kDa (Di Scipio etal, 1997a,b); human PC, 62 kDa (Kisiel, 1979); fX/PC and fX(T"2R)/PC, 71 kDa. The molecular masses of fX/PC and fX(T~2R)/PC were based on the sum of the reported values for the light chain (17 kDa) and activation peptide (14 kDa) of human fX (Di Scipio et al, 1997a) and the heavy chain (41 kDa) less the activation peptide (1.4 kDa) of human PC (Kisiel, 1979). 2.6 Assays of Purified fX/PC and fX(T 2R)/PC 2.6.1 General Materials used for Assays Protac™ and a chromogenic substrate of activated protein C, H-D-(y-carbobenzoxy)-lysyl-prolyl-arginine-/?-nitroanilide diacetate salt (Spectrozyme® PCa), were purchased from American Diagnostica Inc. (Greenwich, CT). Plasma-derived human protein C (PC), plasma-derived human factor X (fX) and Russell's Viper Venom-X activator (RVV-X) were purchased from Haematologic Technologies Inc. Actin® FSL Activated PTT reagent and calcium chloride were purchased from Dade Behring (Mississauga, ON). Protein C-deficient plasma (Biopool, Burlington, ON) was kindly provided by Dr. Cedric Carter (University of British Columbia). Microtiter plates (96-well) were purchased from Nalge Nunc International and GelCode Blue Stain Reagent from Pierce. Fibrin sample cups were from VWR. 2.6.2 Act ivat ion by R V V - X To determine whether purified fX/PC (expressed in B H K cells) could be activated by R V V - X , 30 pmoles of purified fX/PC was incubated with either 3 pmoles or 30 pmoles R V V - X in 20 mM Tris-HCl/150 mM NaCl/8mM CaCl 2 , pH 7.5 at 37 °C (40 pl total vol.). Aliquots of 20 were removed at 5 min and 15 min and quenched by the addition of 200 mM EDTA, pH 8.0 to a final concentration of 8 mM. The activation products were visualized by western blot analysis using a monoclonal antibody to the heavy chain of human PC (see section 2.5.2). —2 To compare the time-course of activation of purified fX(T R)/PC (expressed in H E K 293A cells) with that of fX and PC, 300 pmoles of each protein was incubated with 30 pmoles R V V - X in 20 mM Tris-HCl/150 mM NaCl/8 mMCaCl2, pH 7.5 at 37 °C (120 /zl total vol.). At timed intervals (0, 15, 60, 120, 240, 360 min and 24 h), a 20 fjl aliquot was removed from the reactions and quenched by the addition of 100 mM EDTA, pH 8.0 to a final concentration of 8 mM. Samples were resolved by SDS-PAGE (see section 2.5.1) and the separated proteins visualized with GelCode Blue stain according to the manufacturer's instructions. 60 2.6.3 Activation by Protac 2.6.3.1 Gel Assays To determine whether purified fX/PC (expressed in B H K cells) could be activated by Protac (Stocker et al., 1987), 45 pmoles of fX/PC and PC were each incubated with 0.1 U Protac in 20 mM Tris-HCl/150 mM NaCl/1 mg.ml-1 BSA, pH 7.5 at 37 °C (60 fA total vol.). Aliquots of 20 /A were removed after 1 h and 4 h and the reactions quenched by the addition of SDS-PAGE sample buffer. The activation products were visualized by western blot analysis using a monoclonal antibody to the heavy chain of human PC (see section 2.5.2). To compare the time-course of activation of purified fX(T~2R)/PC (expressed in H E K 293A cells) with that of PC, 105 pmoles of each protein was incubated with 0.7 U Protac in 20 mM Tris-HCl/150 mM NaCl, pH 7.5 at 37 °C (140 fll total volume). At timed intervals (0, 15, 60, 120, 240, 360 min and 24 h), aliquots of 20 (A were removed and quenched by the addition of SDS-PAGE sample buffer. The activation products were visualized by western blot analysis using a monoclonal antibody to the heavy chain of human PC. 2.6.3.2 Amidolytic Assays The rate of activation by Protac of fX(T~2R)/PC and PC was followed by using the chromogenic substrate Spectrozyme PCa (SPCa). Because the Protac reactions could not be quenched for these measurements, solutions containing 10.8 nM fX(T"2R)/PC or PC in 21.5 mM Tris-HCl/161.5 mM NaCl, pH 7.5 (total vol. 3.575 ml) were kept on ice and aliquots of 325 fA were removed at timed intervals during a 6 h period and incubated with 25 (A of lU/ml Protac at 37 °C. After removal of the final "0 time" aliquot at 6 h, the extent of activation was measured by adding 100 jA of each sample to 100 fA of a solution comprising 0.8 mM SPCa/20 mM Tris-HCl/150 mM NaCl, pH 7.5 in a 96-well microtiter plate. Hence, the amidolytic reactions contained 5 nM of fX(T~2R)/PC or 5 nM PC, 0.035 U/ml Protac and 0.4 mM SPCa. The rate of hydrolysis of SPCa was followed by measuring the release of p-nitroanilide at 405 nm for 30 min at room temp, with a M R X Plate Reader (Dynatech Laboratories Inc., Ashford, Middlesex, UK). Each assay was performed in triplicate and values for a control containing 0.035 U/ml Protac and 0.4 mM SPCa were subtracted from the data. 2.6.3.3 Kinetic Analysis ofaJX/PC, afX{T2R)/PC and APC To determine kinetic parameters for the amidolytic reactions, fX/PC, fX(T 2R)/PC, or PC (20 nM) was incubated with 0.15 U/ml Protac in 20 mM Tris-HCl/150 mM NaCl, pH 7.5 (2.0 ml total vol.) at 37 °C for 6 h. Aliquots (50 fA) of each sample were then added to 150 (A SPCa in 20 mM Tris-HCl/150 mM NaCl, pH 7.5 in a 96-well microliter plate such that the final concentration of the substrate ranged from 47 fiM to 1.5 mM. The final concentration of the activated proteins was 5 nM and each assay was performed in triplicate. The rate of hydrolysis of SPCa was followed by measuring the release of p-nitroanilide at 405 nm for 30 min at room temp, with a M R X Plate Reader. K m and V m a x parameters for the reactions were determined using Lineweaver-Burke plots. 2.6.4 Activated Partial Thromboplastin Time Assays FX/PC, fX(T~2R)/PC, and PC were tested in APTT assays to determine whether addition of the zymogen forms of the proteins to plasma extended the clotting time. Each protein was made 160 nM or 800 nM in 0.5 ml 20 mM Tris-HCl/150 mM NaCl/1 mg.ml-1 BSA and held at room temp, prior to performing the APTT assay. A 100 /il-aliquot of protein C-deficient plasma (which had been reconstituted in 1.5 ml dH 20 and held at room temp, for 20 min prior to the assay) and 100 (A of the zymogen were added to a fibrin sample cup pre-heated to 37 °C. An aliquot of 100 /A of FSL APTT reagent (pre-warmed to 37 °C) was added and the solution was gently mixed and incubated for exactly 3 min at 37 °C, at which time 100 fA CaCl 2 (0.20 mM; and pre-warmed to 37 °C), was added. Hence, the final concentration of the zymogen in each reaction was either 40 nM or 200 nM. The time for clot formation was measured in a Fibrometer Coagulation Timer (Becton Dickinson Canada, Inc.). Each clotting assay was performed in triplicate and the time for clot formation was compared to a control in which 100 fA buffer was added to the APTT assay. To test the anticoagulant activity of the Protac-activated forms of fX/PC, fX(T"2R)/PC and PC, aliquots of each were made 80 nM, 160 nM and 320 nM in 20 mM Tris-HCl/150 mM NaCl/1 mg.ml-1 BSA (0.5 ml total vol.) and incubated, respectively, with 0.165 U/ml, 0.3 U/ml, or 0.68 U/ml Protac at 37 °C for 6 h. An aliquot of 100 {A of each activated sample was used in an APTT assay as described above. Hence, the final concentration of each Protac-activated protein in the APTT assay was either 20 nM, 40 nM or 80 nM. Each clotting assay was performed in triplicate and the time for clot formation was compared to a control in which 100 fA buffer containing 0.68 U/ml Protac was added to the APTT assay. 3.0 RESULTS 3.1 Expression of pNUT-fX/PC in BHK Cells A general outline of the scheme used for construction of the hybrid fX/PC cDNA and its expression in mammalian cells is outlined in Figure 8. 3.1.1 Construction of pNUT-fX/PC To construct the mammalian expression vector pNUT-fX/PC, a cDNA encoding 8 bp of the 5'-untranslated region, and the signal peptide, propeptide, EGF-like domains and activation peptide of human fX was amplified by PCR using the plasmid pcHX14 (Fung et al., 1985) as template. Because pcHX14 lacked the sequence encoding the 5'-untranslated region and first 12 amino acids of the signal peptide of fX, the forward PCR primer (fX-fl) was designed to include nucleotides -8 to +72 of human fX (Leytus et al., 1986). Similarly, a cDNA encoding the heavy chain (less the activation peptide) of human PC was amplified by PCR. In order to ligate together the partial fX and PC cDNA fragments, a Cla I restriction endonuclease site was engineered into the 3' end of the fX portion and the 5' end of the PC portion by introducing a silent nucleotide substitution in the codon specifying Ile 196 of the chimeric fX/PC protein (corresponding to Ile 171 of PC). Likewise, Not I restriction sites were incorporated at the 5' end of the fX portion and at the 3' end of the PC portion. After subcloning the fragments into pBluescriptIIKS+ and confirming the sequence of each insert, the partial cDNAs were excised with Not I and Cla I and ligated simultaneously into the Not I cloning site of pNUT. DNA sequence analysis of the 5', 3', and Cla I junctions of the chimeric fX/PC cDNA confirmed that the vector had been properly constructed. The sequence of the chimeric protein and the positions of oligonucleotide priming sites are shown in Figure 9. 3.1.2 Transfection and Selection of Cell Lines Expressing pNUT-fX/PC In initial expression experiments, baby hamster kidney (BHK) cells were transfected with the pNUT-fX/PC vector. For control transfections, pNUT vector DNA or water were used. After selection with methotrexate for 10-14 days, colonies had formed from B H K cells transfected with pNUT-fX/PC or pNUT (up to -100 per plate) whereas no colonies were observed for the water control. Ten colonies of pNUT-fX/PC-transfected cells and one colony of pNUT-transfected cells were selected for further analysis. All clonal cell lines had a typical fibroblast-like appearance and similar doubling times (-24 h) suggesting that integration events had not disrupted genes essential for normal growth and development. Non Factor X cDNA SP Pro Gla EGF-like Domains RKR AP Serine Protease Domain 5'-UTR Protein C cDNA SP Pro Gla EGF-like Domains KR AP Serine Protease Domain I amplify fX and PC cDNA fragments, I digest cDNAs with Not 1 and Cla 1, I clone into pBluescriptl IKS+, sequence to verify, | subclone into pNUT and pCI-neo, sequence to verify Factor X/Protein C hybrid cDNA Nof\ SP Pro Gla EGF-like Domains RKR AP Serine Protease Domain transfect mammalian cells, isolate clonal cell lines, purifiy fX/PC protein and analyze P-OH-Asp 22 kDa 55 kDa 1—K—r CHO A CHO FIXa F I G U R E 8. Outline of experimental design for the construction of a hybrid fX/PC cDNA and its expression in mammalian cells. Partial cDNAs encoding 8 bp of the 5'-untranslated region (UTR), the signal peptide (SP), propeptide (Pro), Gla domain, EGF-like domains, tribasic peptide (RKR) and activation peptide (AP) of fX, and the serine protease domain of PC were amplified by PCR and inserted separately into the phagemid pBluescriptIIKS+. After verification by DNA sequence analysis, the fX and PC cDNAs were excised from the phagemids, ligated, and inserted into the mammalian expression vectors pNUT and pCI-neo. The fX/PC expression vectors were used to transfect baby hamster kidney (BHK) and human embryonic kidney (HEK 293A) cells and after isolating clonal cell lines expressing the fX/PC chimeric protein, the protein was purified from conditioned culture medium and analyzed. ^Notl g c g g c c g c c a c a c c -1 ATG Met GGG G l y CGC A r g CCA Pro CTG Leu CAC H i s CTC Leu GTC V a l CTG Leu CTC Leu AGT Ser ACC Thr TCC Ser CTG Leu GCT A l a GGC G l y CTC Leu CTG Leu CTG Leu CTC Leu 60 -21 fX-fl Xcm I GGG GAA AGT CTG TTC ATC CGC AGG GAG CAG GCC AAC AAC ATC CTG GCG AGG GTC ACG AGG " 120 G l y G l u Ser, fx-cr 2 R) „ ,Leu Phe I l e A r g A r g G l u • Signal peptide cleavage site G i n A l a Asn Asn I l e Leu A l a A r g V a l Thr Arg, °ropeptide cleavage site * i ^ GCC A l a AAT Asn TCC Ser TTT Phe CTT Leu GAA G l u y GAG G l u Y ATG Met AAG Lys AAA Lys GGA G l y CAC H i s CTC Leu GAA G l u Y AGA A r g GAG G l u Y TGC Cys (22) ATG Met GAA G l u Y GAG G l u Y 180 +20 ACC Thr TGC Cys (17 TCA Ser TAC Tyr GAA G l u Y GAG G l u Y GCC A l a CGC A r g GAG G l u Y GTC V a l TTT Phe GAG G l u Y GAC Asp AGC Ser GAC Asp AAG Lys ACG Thr AAT Asn GAA G l u Y TTC Phe 240 +40 TGG Trp AAT Asn AAA Lys TAC Tyr AAA Lys GAT Asp GGC G l y GAC Asp CAG G i n TGT Cys (61) GAG G l u ACC Thr AGT Ser CCT Pro TGC Cys (70 CAG G i n AAC Asn CAG G i n GGC G l y AAA Lys 300 + 60 TGT Cys (50) AAA Lys GAC Asp P GGC G l y CTC Leu GGG G l y GAA G l u TAC Tyr ACC Thr TGC Cys (55) ACC Thr TGT Cys (81) TTA Leu GAA G l u GGA G l y TTC Phe GAA G l u GGC G l y AAA Lys AAC Asn 360 + 80 TGT Cys (72) GAA G l u TTA Leu TTC Phe ACA Thr CGG A r g AAG Lys CTC Leu TGC Cys (200) AGC Ser CTG Leu GAC Asp AAC Asn GGG G l y GAC Asp TGT Cys (109 GAC Asp CAG G i n TTC Phe TGC Cys (89) 420 + 100 CAC H i s GAG G l u GAA G l u CAG G i n AAC Asn TCT Ser GTG V a l GTG V a l TGC Cys (96) TCC Ser TGC Cys 124 GCC A l a CGC A r g GGG G l y TAC Tyr ACC Thr CTG Leu GCT A l a GAC Asp AAC Asn 480 + 120 GGC G l y AAG Lys GCC A l a TGC Cys 111) ATT l i e CCC Pro ACA Thr GGG G l y CCC Pro TAC Tyr CCC Pro TGT Cys (302) GGG G l y AAA Lys CAG G i n ACC Thr CTG Leu GAA G l u CGC Arg^ AGG A r g 540 +140 AAG hys AGG TCA Ser GTG V a l GCC A l a CAG G i n GCC A l a ACC Thr AGC Ser AGC Ser AGC Ser GGG G l y GAG G l u GCC A l a CCT Pro GAC Asp AGC Ser ATC H e ACA Thr C H O TGG Trp 600 +160 AAG Lys CCA Pro TAT Tyr GAT Asp GCA A l a GCC A l a GAC Asp CTG GAC CCC Leu Asp Pro fX/PC-rll ACC Thr C H O GAG G l u AAC Asn CCC Pro TTC Phe GAC CTG Asp Leu Cla I CTT Leu GAC TTC 660 Asp Phe +180 PC-fill AAC Asn C H O CAG G i n ACG Thr CAG G i n CCT Pro GAG G l u AGG A r g GGC G l y GAC Asp AAC Asn AAC Asn C H O CTC Leu ACC Thr AGG Arg^ CTC ATC GAT GGG AAG ATG 72 0 ,Leu I l e Asp G l y Lys Met +200 • Activation peptide cleavage site ACc" Thr AGG A r g CGG A r g GGA G l y GAC Asp AGC Ser CCC Pro TGG Trp CAG G i n GTG V a l GTC V a l CTG Leu CTG Leu GAC Asp TCA Ser AAG Lys AAG Lys AAG Lys CTG Leu GCC A l a 780 +220 TGC Cys (237) GGG G l y GCA A l a GTG V a l CTC Leu ATC I l e CAC H i s CCC Pro TCC Ser TGG Trp GTG V a l CTG Leu ACA Thr GCG A l a GCC A l a CAC H i s • TGC Cys (221 ATG Met GAT Asp GAG G l u 840 +240 TCC Ser AAG Lys AAG Lys CTC Leu CTT Leu GTC V a l AGG A r g CTT Leu GGA G l y GAG G l u TAT Tyr GAC Asp CTG Leu CGG A r g CGC A r g TGG Trp GAG G l u AAG Lys TGG Trp GAG G l u 900 +260 CTG Leu GAC Asp CTG Leu GAC Asp ATC l i e AAG Lys GAG G l u GTC V a l TTC Phe GTC V a l CAC H i s ccc Pro AAC Asn C H O TAC Tyr AGC Ser AAG Lys AGC Ser ACC Thr ACC Thr GAC Asp 960 +280 AAT Asn GAC Asp • ATC l i e GCA A l a CTG Leu CTG Leu CAC H i s CTG Leu GCC A l a CAG G i n CCC Pro GCC A l a ACC Thr CTC Leu TCG Ser CAG G i n ACC Thr ATA I l e GTG V a l ccc Pro 1020 +300 FIGURE 9. Continued overleaf. ATC TGC CTC CCG GAC AGC GGC CTT GCA GAG CGC GAG CTC AAT CAG GCC GGC CAG GAG ACC 1080 I l e Cys Leu Pro Asp Ser G l y Leu A l a G l u A r g G l u Leu Asn G i n A l a G l y G i n G l u Thr +320 (132) CTC GTG ACG GGC TGG GGC TAC CAC AGC AGC CGA GAG AAG GAG GCC AAG AGA AAC CGC ACC 1140 Leu V a l Thr G l y T r p G l y Tyr H i s Ser Ser A r g G l u Lys G l u A l a Lys A r g Asn A r g Thr +340 C H O TTC GTC CTC AAC TTC ATC AAG ATT CCC GTG GTC CCG CAC AAT GAG TGC AGC GAG GTC ATG 12 00 Phe V a l Leu Asn Phe I l e Lys I l e Pro V a l V a l Pro H i s Asn G l u Cys Ser G l u V a l Met +360 C H O (3 70) AGC AAC ATG GTG TCT GAG AAC ATG CTG TGT GCG GGC ATC CTC GGG GAC CGG CAG GAT GCC 12 60 Ser Asn Met V a l Ser G l u Asn Met Leu Cys A l a G l y I l e Leu G l y Asp A r g G i n Asp A l a +380 (355) TGC GAG GGC GAC AGT GGG GGG CCC ATG GTC GCC TCC TTC CAC GGC ACC TGG TTC CTG GTG 1320 Cys G l u G l y Asp Ser G l y G l y Pro Met V a l A l a Ser Phe H i s G l y Thr T r p Phe Leu V a l +400 (409) • GGC CTG GTG AGC TGG GGT GAG GGC TGT GGG CTC CTT G l y Leu V a l Ser T r p G l y G l u G l y Cys G l y Leu Leu (382) GTC AGC CGC TAC CTC GAC TGG ATC CAT GGG CAC ATC V a l Ser A r g T y r Leu Asp Trp I l e H i s G l y H i s I l e Not I ^ AGC TGG GCA CCT t a g t a a cccggggcggccgc 1472 Ser T r p A l a Pro *** *** +444 FIGURE 9. The DNA and deduced amino acid sequences of the hybrid fX/PC cDNA construct. The positions of the oligodeoxyribonucleotide primers used to amplify the fX and PC cDNA fragments by PCR are indicated along with the restriction endonuclease sites that were incorporated into the primers to facilitate subcloning and ligation of the fragments. Nucleotides numbered -8 to -1 correspond to a portion of the 5'-untranslated region of the fX cDNA (Leytus et ai, 1986). The primer labeled fX(T R) was used to change the codon specifying Thr at position -2 (ACG) to one specifying Arg (CGG): an alteration that enhances the removal of the propeptide from recombinant fX expressed in mammalian cells (Rudolph et al., 1997).The sites of cleavage of the signal peptide, propeptide, tribasic peptide (shaded) and activation peptide are indicated by thick arrows, y, Glu residues that are y-carboxylated in fX. (3, the (3-hydroxylated Asp residue (Asp63) found in fX. CHO, sites of carbohydrate chain attachment in the activation peptide of fX and the heavy chain of PC. Bullets denote the residues forming the catalytic triad in the active site of PC (His236, Asp282, Ser385). Italicised numbers in parentheses below each Cys residue indicate the location of the amino acid with which it is known or predicted to form a disulfide bond based on the structures of fX and PC. The main structural domains of the protein comprise the following amino acids: -40 to -18, signal peptide; -17 to -1, propeptide; 1 to 39, Gla domain; 40 to 46, aromatic amino acid stack domain; 47 to 84, EGF1; 85 tol28, EGF2; 143 to 194, activation peptide; 195 to 444, serine protease domain. CAC AAC TAC GGC GTT TAC ACC AAA 13 80 H i s Asn T y r G l y V a l T y r Thr Lys +42 0 ^ PC-rlV AGA GAC AAG GAA GCC CCC CAG AAG"1440 Arg Asp Lys G l u A l a Pro G i n Lys +440 66 To identify clonal lines secreting the highest levels of recombinant fX/PC, culture plates were seeded with an equal number of cells from each clonal line and grown to confluency. The medium was replaced with D-MEM/F 12/ITSAK (a serum-free medium) and analyzed by western blotting 24 h later. With the exceptions of clone 2, the untransfected B H K cell line, and the pNUT-transfected cell line, a total of three polypeptides in each sample of conditioned medium were recognized by one or both of two monoclonal antibodies; one that binds to an epitope on the heavy chain of PC (anti-PCnc) and the other to an epitope on the light chain of fX (anti-fXLc) (Fig. 10). The apparent molecular masses of the polypeptides and their pattern of cross-reactivity were consistent with those expected for the recombinant fX/PC protein. An -75 kDa-polypeptide was recognized by both antibodies and its mass corresponds to that expected for single-chain fX/PC, from which the internal tribasic peptide (Argl40-Lysl41-Argl42) has not been removed. An -55 kDa-polypeptide that cross-reacted only with anti-PCnc (Fig- 10A) corresponded to the expected mass of the heavy chain of fX/PC, which, due presumably to the presence of the glycosylated activation peptide of fX, is larger than the heavy chain of PC (-45 kDa). As expected, a polypeptide of -22 kDa with a mobility similar to the light chain of fX was recognized only by anti-fXix (Fig. 10B). It should be noted that the doublet observed for the heavy chain of plasma-derived PC (Fig. 10A) is typical of this protein and has been attributed to a- and /3-glycoforms (Grinnell et al., 1991). Neither antibody cross-reacted with conditioned medium collected from untransfected B H K cells or cells transfected with pNUT. This indicated that the BHK cells did not secrete detectable levels of endogenous fX or PC and that the D-MEM/F-12/ITSAK medium used for expression did not contain detectable levels of these proteins. Together, these results provided strong evidence that the fX/PC chimeric protein was expressed and secreted by most of the clonal cell lines tested. In addition, they suggested that a significant amount of the recombinant protein was processed to the two-chain form, as occurs with fX and PC in vivo. Variation in the levels of fX/PC in the conditioned medium was observed among the cell lines, based on visual inspection of western blots. Although not quantified, clone 5 (denoted BHK-fX/PC-5) appeared to secrete the highest levels of fX/PC and was chosen for further analysis. chain B § $ & § s ^ ^ Cr « * fi £ & & Clone # (15 pl) kDa / / / / / 1 2 3 4 5 6 7 8 9 10 Single-chain f — Light chain F I G U R E 10. Western blot analysis of conditioned medium from fX/PC-BHK cell clones. Conditioned medium (15 |il) from controls, and each of 10 B H K clonal lines transfected with pNUT-fX/PC, was collected as described in Materials and Methods section 2.3.3. Samples were reduced with P-mercaptoethanol, electrophoresed in SDS-12% poly-acrylamide gels and western blotted using the monoclonal antibodies anti-PC H C (A) and ant i -FX L C (B). PC; plasma-derived protein C. FX; plasma-derived factor X. B H K ; conditioned medium from non-transfected BHK cells. BHK-pNUT; conditioned medium from B H K cells transfected with pNUT. Clone # 1-10; medium from B H K clonal cell lines transfected with pNUT-fX/PC. Bands corresponding to the single-chain form, and the heavy and light chains of fX/PC are indicated, as are the a- and P-glycoforms of the PC heavy chain. Clone #5 (BHK-fX/PC-5) appeared to secrete the highest levels of fX/PC and was selected for further analysis. 68 3.1.3 Southern Blot Analysis of Genomic DNA from BHK Cell Lines Southern blotting was used to confirm that the fX/PC cDNA had been integrated intact into the genome of the BHK-fX/PC-5 cell line and to determine the copy number (Fig. 11). A radiolabeled cDNA encoding the heavy chain of PC hybridized to a single -1500 bp band in Not I-digested genomic DNA from BHK-fX/PC-5 cells. The probe did not hybridize to genomic DNA from untransfected cells or those transfected with pNUT. This indicated that the 1478 bp fX/PC cDNA had been integrated successfully in this clonal cell line. Densitometric analysis of autoradiographs indicated that the BHK-fX/PC-5 haploid genome contained -10 copies of the fX/PC cDNA. Multiple integrations such as this are commonly observed when employing pNUT as a vector and can arise either from multiple recombination events at the time of transfection or amplification of the copy number during methotrexate selection (Alt et al., 1978; Palmiter et al, 1987; Simonsen and Levinson, 1983). 3.1.4 Purification of fX/PC Expressed in BHK Cells For large-scale expression of fX/PC, the BHK-fX/PC-5 clonal line was cultured in roller bottles in D-MEM/F 12/ITSAK serum-free medium and conditioned medium was collected every two days. When using this medium, the cells remained viable long enough for only two or three collections to be made. Repeated attempts to purify recombinant fX/PC by adsorption to barium citrate and subsequent ion-exchange chromatography resulted in very low yields. However, the protein could be effectively purified in higher yield by a two-step protocol employing, firstly, batch-adsorption to an immunoaffinity resin and elution at near neutral pH with Gentle Elution Buffer (GEB), and secondly, hydroxyapatite column chromatography. Immunoaffinity resins conjugated with polyclonal antibodies to either human PC or human fX were equally effective. Before subjecting the recombinant protein to the immunoaffinity procedure, the effect of prolonged incubation in GEB on the amidolytic activity of APC was tested (Fig. 12). After exposure of APC to GEB for 60 min, -80% of the amidolytic activity was retained as compared to APC incubated in Tris-HCl buffer, pH 7.4. This was deemed an acceptable retention of activity for several reasons: APC is a serine protease and, as such, would be expected to be inherently less stable than its zymogen; the APC was prepared from purified PC and had therefore already undergone several rounds of purification prior to this test; immunoaffinity purification would be expected to substantially increase yields of the recombinant fX/PC protein; and the actual time the fX/PC zymogen would be exposed to GEB during the immunoaffinity step would be much shorter (-20 min) than used for the test. Kbp 7 f MM M ^ eg eg eg 7 7 / io so Copy # 100 200 F I G U R E 11. Southern blot analysis of the BHK-fX/PC-5 clonal cell-line. Aliquots (4 (ig) of Not I-digested genomic DNA isolated from wild-type BHK cells, B H K cells transfected with pNUT, BHK-fX/PC-5 (transfected with pNUT-fX/PC), and 93, 465, 930 and 1860 pg of Nor I-digested pNUT-fX/PC plasmid (the equivalent of 10, 50, 100 and 200 copies) were electrophoresed in a 0.8% (w/v) agarose gel, denatured, neutralized, and transferred to Hybond-N+ membrane by capillary blotting (see Materials and Methods section 2.1.13). An [oc-32P]-labeled PC cDNA probe was incubated with the membrane-bound D N A and the membrane was exposed to autoradiography film for 6 h at -70 °C prior to development. BHK; genomic D N A isolated from non-transfected B H K cells. B H K - p N U T ; genomic D N A isolated from B H K cells transfected with pNUT. pNUT-fX/PC-BHK-5; genomic D N A isolated from B H K clonal cell line #5 transfected with pNUT-fX/PC. The probe hybridized to an -1.5 Kbp-band as indicated. The copy number of pNUT-fX/PC cDNA integrated into the BHK-fX/PC-5 genome was determined by exposing the membrane to a Phosphorimager screen for 30 min and analyzing the image obtained with a model SI Phosphorlmager (Molecular Dynamics Inc.). [APC] V0(Tris)_ VQ(GEB)_ V Q (GEB)/ (nM) (AA 4 0 5 .min _ 1 ) (AA^.miiT 1 ) VQ(Tris) 10 0.05 0.04 0.80 20 0.11 0.09 0.82 FIGURE 12. Effect of prolonged incubation in Gentle Elution Buffer on amidolytic activity of activated PC. Samples of activated plasma-derived PC were incubated in 20 mM Tris-HCl, pH 7.4 (Tris buffer) or Gentle Elution Buffer (GEB; pH 6.6) for 60 min at 4 °C. and the samples were then diluted 1:167 in Tris buffer. The amidolytic activity of the samples (final cone. 5 nM) was assayed using the chromogenic substrate Spectrozyme PCa (0.4 mM) at room temp, and the rate of release of p-nitroanilide measured at 405 nm as described in Materials and Methods section 2.6.3.2. Each point on the graph represents the mean of three replicates and vertical bars indicate ± 1 sample standard deviation. The velocities observed during the first 5 min of the amidolytic reactions are given below the graph. After incubation in Gentle Elution Buffer for 60 min, the activity was approx. 80% of that observed following incubation in Tris buffer. 71 Figure 13 shows the results of SDS-PAGE and western blot analyses of samples from various stages in the purification of fX/PC expressed in B H K cells (denoted fX/PC-BHK). The recombinant protein was not detected in concentrated conditioned medium by SDS-PAGE (Fig. 13A) and only the light chain could be observed on western blots, possibly due to masking of the single-chain form and heavy chain by large amounts of albumin in the medium (Fig. 13B,C). Batch-adsorption immunoaffinity chromatography effected a substantial purification of the recombinant protein from conditioned medium in a single step. Some contamination by an -70 kDa polypeptide (probably albumin) that was not recognized by either the anti-fXtc o r anti-PCnc antibodies was evident in the immunoaffinity-purified material. However, the contaminant failed to bind to hydroxyapatite and was eluted in the wash phase during subsequent hydroxyapatite column chromatography. A typical elution profile obtained during chromatography of fX/PC-BHK on hydroxyapatite is shown in Figure 14. Two distinct peaks were observed; one that was eluted in the wash phase (peak I) and a second (peak Ha) at -110 mM phosphate with a shoulder on the trailing side (lib). The material in fractions from peaks I and Ha, and the shoulder lib, was pooled separately and contained 180, 220, and 110 jig of protein, respectively (as determined by a Bradford assay). SDS-PAGE and western blotting demonstrated that polypeptides corresponding to the single-chain (band 1), heavy chain (band 2), and light chain (band 3) of fX/PC-BHK were present in all three pools (see Fig. 13). Additional Coomassie-stained polypeptides that cross-reacted with the anti-PCnc or anti-fXLc antibodies were observed at -42 kDa (band a), 38 kDa (band b), 27 kDa (band c), 18 kDa and 14 kDa (Fig. 13). Several of the polypeptides in the purified fX/PC-BHK preparation were electroblotted to PVDF membrane and subjected to N-terminal sequence analysis (Table 2). This unequivocally confirmed that the purified protein represented the recombinant fX/PC fusion protein but also highlighted improper proteolytic processing and spurious cleavage of the protein. The -55 kDa polypeptide (band 2, Fig. 13) produced a single sequence identical to that expected for the heavy chain of the recombinant protein, thus indicating that the internal tribasic peptide (Argl40-Lysl41-Argl42) could be excised from the single-chain precursor. However, this processing event was inefficient, with 20-30% of the protein being secreted as the single-chain form. Polypeptides corresponding to the -75 kDa single-chain form (band 1, Fig. 13) and the -22 kDa light chain (band 3) were heterogeneous. Analysis of the pmole yields of amino acid derivatives indicated that in only about 25% of the recombinant protein was the propeptide excised correctly and -25% retained the 17-residue propeptide. The remaining -50% had been cleaved between amino acids Lys9-Lysl0 of mature fX. The -42 kDa and -38 kDa polypeptides (bands a and b, Fig. 13) comprised heterogeneous fragments of fX/PC-BHK arising from spurious cleavage of the heavy chain between residues Arg202-Arg203, Lysl99-Met200, and at least one other unidentified site in the C-terminus. 72 c E _P o ft/. Of ^ ft 0j a c £ <-H CN Cd £> II I I ca « *t Tt I/) U a ca C/5 O K T H - -G . T3 S -~ U s § 73 V, -° l l l o 45 »i ca 'C o | i | X3 co ca ^ " u i s a 3 ca co ^ t . ! -2 -9 U S w -3 — > 2 e al cj a u 3 * ¥ i n P C O • » <D " \ 5 tn -G 73 -5 cu C O O t> — 1 — i "3 <P U o M *0 t5 1 S 5 .JL, ca ca -JH u 3 a §•« ; o 2 B « 8 1.5 ° I - M J ^1 N i a M S « ? i r 3 fi 1 S S 2.3 | 3 >>:S "3 1 o 8 S 8 I CJ OH CSS 3 3 > O 3 eu 73 3 3 M 3 cj a •£ ' T3 U 3 a 4 O i — 1 co CJ OH U CO CJ u 3 CJ 3 cr CJ 3 PQ 13 3 t O C O op g o o 3 73 ca [IT FIGURE 14. Chromatographic profile obtained on a hydroxyapatite column for fX/PC expressed in BHK cells. A sample of fX/PC-BHK that had been purified by immunoaffinity chromatography from 1100 ml of conditioned cell culture medium was chromatographed as described in Materials and Methods section 2.4.2. Material that was eluted during the wash phase (peak I), at -110 mM phosphate (peak Ha), and in the trailing side of peak Ha (lib) was pooled separately and analyzed by SDS-PAGE and western blotting (refer Fig. 13). TABLE 2. N-terminal amino acid sequences obtained from purified fX/PC that had been expressed in BHK cells. Banda Identity Apparent N-terminal sequence(s)b mass (kDa) +10 -17 +1 Band 1 Single chain 75 K-G-H-L-E-R > L-F-I-R-R-E = A-N-S-F-L-E +143 Band 2 Heavy chain 55 S-V-A-Q-A-T +10 -17 +1 Band 3 Light chain 22 K-G-H-L-E-R > L-F-I-R-R-E = A-N-S-F-L-E +203 +200 Band a Fragments 42 R-G-D-S-P-W > M-T-R-R-G-D (heavy chain) +143 +200 Bandb Fragments 38 S-V-A-Q-A-T > M-T-R-R-G-D (heavy chain) Band c Fragment(s) 27 Sequence could not be determined Samples of immunoaffirnty-purified fX/PC-BHK were denatured and reduced, resolved by SDS-PAGE, and electroblotted to PVDF membrane. Polypeptides were detected with Coomassie Blue R-250 and the bands excised for sequence analysis as described in Materials and Methods section 2.5.3. The expected amino-terminal sequences of the single-chain form, and the heavy and light chains of fX/PC are shown in bold type. The location of the first amino acid of each sequence in the primary structure of fX/PC is given in the table (refer to Fig. 9). aBands correspond to those indicated in Fig. 13. bWhere multiple sequences were detected, the relative abundance of each sequence is indicated (>, greater than; =, equals) based on the yields of the derivatized amino acids. 3.1.5 Activation of fX/PC-BHK by RVV-X Experiments were performed to determine whether, like fX, the recombinant fX/PC-BHK protein could be activated by Russell's Viper Venom-X activator (RVV-X). The chimeric protein was incubated with different molar ratios of the activator for 5 min and 15 min. Visualization of the polypeptides on western blots using the monoclonal antibody anti-PCnc revealed that a -40 kDa-band corresponding to the apparent molecular mass of the heavy chain of APC was generated after 5 min when using an equimolar amount of R V V - X (Fig 15). This indicated that a substantial amount of fX/PC-BHK had been activated by the snake protease. After incubation for 15 min, there appeared to be no discernible difference in the extent of activation effected by molar ratios of R V V - X : fX/PC of 0.1 or 1.0. Although diffuse, the heavy chain of activated fX/PC-BHK appeared to be a doublet, likely due to heterogeneous glycosylation, as has been observed for PC and APC (Grinnell etal., 1991). N-terminal amino acid sequence analysis of the doublet at -40 kDa yielded a sequence identical to that of the heavy chain of APC (L-I -D-G-K) , indicating that R V V - X could recognize and properly cleave fX/PC-BHK between the Argl94-Leul95 peptide bond to release the 52-amino acid activation peptide. Although this clearly demonstrated that fX/PC-BHK could be activated by RVV-X, even when incubated with R V V - X at a 1:1 molar ratio for 15 min the chimeric protein was not fully activated, as indicated by the persistence of unactivated single-chain and heavy chain polypeptides. 3.1.6 Activation of fX/PC-BHK by Protac Both PC and fX/PC-BHK were incubated with Protac, an activator specific for PC, for 60 min and 240 min and the activation products were visualized by western blotting using the antibody anti-PCnc (Fig- 16). By 60 min, a polypeptide derived from fX/PC-BHK was apparent that had a molecular mass (-38 kDa) corresponding to the (3-glycoform of the heavy chain of APC but the chimeric protein was not fully activated by this time. This contrasted with PC, which appeared to be fully activated after 60 min, as indicated by a reduction in the apparent molecular mass of the heavy chain doublet by -2 kDa (due to excision of the 12-amino acid activation peptide). It should be noted that BSA in the reaction buffer appeared to mask the epitope for anti-PCnc o n the single-chain and heavy chain of unactivated fX/PC-BHK. However, the intensity of single-chain form did not decrease by 60 min, indicating that dimeric fX/PC-BHK was a better substrate for Protac. By 240 min, the chimeric protein appeared to be fully activated but masking of the presence of any remaining unactivated single-chain or heavy chain fX/PC-BHK could not be ruled out. 46 5 min 15 min # & # , 9 £ £ £ > C? Cr" v? # # ^  # # w /"W / w /O^ # # # # # 3 * , r / Sr Sr kDa ? r ? r ? ? 7 i n 74 - Single-chain - Heavy chain - Activated heavy chain 30 F I G U R E 15. Activation of fX/PC-BHK by RVV-X. Samples containing 30 pmoles of fX/PC-BHK were activated with either 3 pmoles or 30 pmoles RVV-X in the presence of C a 2 + as described in Materials and Methods section 2.6.2. Aliquots (15 pmoles) from each reaction were removed after 5 min and 15 min, quenched with EDTA, and reduced with (3-mercaptoethanol. The samples were resolved in a SDS-12% polyacrylamide gel and western blotted using the monoclonal antibody anti-PCH C. PC; plasma-derived protein C (15 pmoles). FX/PC-BHK; 15 pmoles of unactivated protein. Bands corresponding to the single-chain, heavy chain, and activated heavy chain of f X / P C - B H K are indicated. N-terminal amino acid sequence analysis of the diffuse doublet at -40 kDa produced the sequence expected for the heavy chain of the activated protein. 77 PC B fX/PC-BHK kDa 111 74 46 f * 1 J r r 7 7 ? f 7 — oc, Activated — (3 J heavy chain — Single-chain — Heavy chain P Activated heavy chain F I G U R E 16. Activation of plasma-derived PC (A) and fX/PC-BHK(B) with Protac. An aliquot (45 pmoles) of PC or fX/PC-BHK was activated with 0.1 U Protac as described in Materials and Methods section 2.6.3.1. Aliquots (15 pmoles) from each reaction were removed at 0, 60 and 240 min, quenched, and electrophoresed in a SDS-12% poly-acrylamide gel under reducing conditions. The separated proteins were western blotted using the monoclonal antibody anti-PCHC The single-chain, heavy chain and activated heavy chain forms (a, p) are indicated. 78 3.1.7 APTT Assays with fX/PC-BHK The effect of fX/PC-BHK on clotting time was tested in activated partial thromboplastin time assays. Material eluted during hydroxyapatite chromatography in peaks I and Ila, and the shoulder lib (see Fig. 14), and plasma PC, were activated with Protac for 6 h and assayed at a final concentration of 40 nM, similar to the plasma concentration of fX and twice that of PC. Compared to the buffer control and the unactivated proteins, none of the fX/PC-BHK preparations (nor the plasma-derived PC zymogen) extended the clotting time (Table 3). 3.1.8 Kinetic analysis of fX/PC-BHK Recombinant fX/PC-BHK was activated with Protac and its amidolytic activity toward the synthetic substrate Spectrozyme PCa (SPCa) was measured and compared to that of Protac-activated PC. Material that was eluted in peak lib during hydroxyapatite column chromatography (see Fig. 14) was used for the assay because it was presumed that this peak was most likely to contain y-carboxylated fX/PC-BHK due to its binding characteristics on the hydroxyapatite column. Activated fX/PC-BHK (denoted afX/PC-BHK) possessed less than 10% of the activity of APC (Fig. 17). This was reflected by both a 10-fold lower V m a x and a four-fold higher K m for the chromogenic substrate than APC (inset to Fig. 17). 3.2 Expression of pNUT-fX(T"2R)/PC in BHK Cells 3.2.1 Construction of pNUT-fX(T 2R)/PC As observed by N-terminal amino acid sequence analysis (see Table 2), a majority of fX/PC secreted by B H K cells either retained the propeptide or was cleaved improperly at the Lys9-LyslO peptide bond. In an attempt to overcome this problem, PCR-mediated site-directed mutagenesis was used to change the codon specifying Thr at position -2 within the propeptide to one specifying Arg (as described in Materials and Methods section 2.2.2). This substitution has been shown to enhance removal of the propeptide from recombinant fX expressed in mammalian cells (Rudolph et al., 1997) TABLE 3. Activated partial thromboplastin time assays with purified fX/PC that had been expressed in BHK cells. Clotting time (s) Sample - Protac + Protac Control (Buffer) 38 7 ± 2 . 3 36.6 ± 0 . 9 PC 39 6 ±1 .8 No clota fX/PC-BHK (Peak I) 39 1 ± 1.5 37.6 ± 0 . 8 fX/PC-BHK (Peak Ila) 37 7 ± 0 . 8 36.4 ± 0 . 9 fX/PC-BHK (Shoulder lib) 38 4 ± 2 . 0 38.2 ± 1.3 Recombinant fX/PC-BHK that had been purified by immunoaffinity chromatography and fractionated on a hydroxyapatite column (refer to Fig. 14) was tested for its ability to prolong the clotting time in an activated partial thromboplastin time assay as described in Materials and Methods section 2.6.4. Samples of fX/PC-BHK and protein C (40 nM final concentration) that had been either activated with Protac (+ Protac) or not (- Protac) were incubated with phospholipid and protein C-deficient human plasma at 37 °C and clotting was initiated by the addition of calcium chloride to the samples. Clotting times were measured with a Fibrometer Coagulation Timer. Each assay was performed in triplicate and values are given as the mean ± 1 sample standard deviation. aNo clot had formed after 10 min. 1.5 1.0 0.5 H «X)-/afX/PC 4<XI-2<X)-APC -4 -2 0 2 4 6 8 1/[S] APC [Spectrozyme PCa] o 1.5 mM • 1.0 mM • 0.5 mM • 0.25 mM o 0.125 mM Time (min) FIGURE 17. Comparison of the rate of hydrolysis of Spectrozyme PCa by activated fX/PC and activated PC. Samples of purified recombinant fX/PC (expressed in BHK cells) and plasma-derived PC (20 nM) were activated with 0.15 U/ml of Protac for 6 h at 37 °C. Aliquots of the activated proteins (5 nM final concentration) were incubated with various concentrations of the chromogenic substrate Spectrozyme PCa at room temp, and the rate of release of p-nitroanilide measured at 405 nm as described in Materials and Methods section 2.6.3.3. Each of the points represents the mean of three replicates and vertical bars indicate ± 1 sample standard deviation. The inset graph shows Lineweaver-Burke plots for the data obtained during the first 5 min of the amidolytic reactions. The K m values obtained were 0.85 mM and 0.21 mM for afX/PC and APC, respectively, and V m a x values (A405 units.min-1) were 0.007 and 0.06 for afX/PC and APC, respectively. 3.2.2 Transfection and Selection of Cell Lines Expressing pNUT-fXCrtiyPC B H K cells were transfected with pNUT-fX(T R)/PC and ten methotrexate-resistant clonal cell lines were tested for expression of fX(T~2R)/PC by western blot analysis of conditioned medium using the monoclonal antibodies anti-fXLc and anti-PCnc- Based on visual inspection of the western blots, the clonal line secreting the highest levels of fX(T~2R)/PC was chosen for production of the chimeric protein. The methodology employed was similar to that covered in section 3.1.2 above. 3.2.3 Purification and Analysis of fX(T"2R)/PC Expressed in BHK Cells The p N U T - f X ( T R)/PC-transfected clonal cell line was grown to confluency in roller bottles and the medium replaced with D-MEM/F-12/ITSAK serum-free medium. The recombinant protein (denoted fX(T" zR)/PC-BHK) was purified from conditioned medium by sequential immunoaffinity and hydroxyapatite chromatography steps, as used for purification of fX/PC (see section 3.1.4). A typical elution profile obtained during hydroxyapatite chromatography is shown in Figure 18. Because the chromatograph was similar to that obtained for fX/PC-BHK, material contained in peak Ila and its trailing side (lib) was pooled for analysis. SDS-PAGE resolved bands corresponding to the single-chain form, and the heavy and light chains of fX(T~2R)/PC as well as possible fragments (Fig. 19). Some non-specific degradation of the protein was also apparent. N-terminal sequence analysis of the electroblotted single-chain polypeptide of —2 fX(T R)/PC-BHK was carried out to determine the efficiency of removal of the propeptide from the recombinant protein. Two sequences were obtained in approximately similar yields. One sequence ( A - N - S - F - L - E ) , corresponding to the N-terminus of the light chain of mature fX (refer Fig. 9), indicated that cleavage had occurred in the proper position in -50% of the molecules. However the other sequence (L-F-I -R-R-E) indicated that in -50% of the protein the signal peptide, but not propeptide, had been removed. Thus, although the Thr to Arg substitution at position -2 reduced the improper cleavage of the Lys9-Lysl0 peptide bond that had been observed with fX/PC (see section 3.1.4), and increased the amount of protein possessing the correct N-terminus from -25% to -50%, about half of the protein still retained the propeptide. Therefore further characterization of fX(T~ 2R)/PC-BHK was not pursued. FIGURE 18. Comparison of chromatographic profiles obtained on a hydroxyapatite column for fX/PC (A) and fX(T~2R)/PC (B) expressed in BHK cells. Samples of the proteins that had been purified by immunoaffinity chromatography from 1100 ml of conditioned cell culture medium were chromatographed as described in Materials and Methods section 2.4.2. In the case of fX(T~ R)/PC, material that was eluted in peak Ua (at ~ 110 mM phosphate) and in the trailing side of peak Ua (Tib) was pooled for analysis. 83 .4s / / f 7 f 7 f 214 111 74 46 Single-chain — Heavy chain 30 18 — Light chain F I G U R E 19. SDS-PAGE analysis of purified f X ( T " 2 R ) / P C - B H K . Recombinant fX(T R)/PC was expressed in B H K cells and the chimeric protein purified from conditioned medium by immunoaffinity and hydroxyapatite chromatography (as described in Materials and Methods section 2.4). An aliquot of the purified protein contained in Peak Ila/IIb (see Fig. 18, B) was reduced with R-mercaptoethanol and electrophoresed in a SDS-12% polyacrylamide gel. Polypeptides were detected with GelCode Blue stain. PC; plasma-derived protein C. FX; plasma-derived factor X. The positions of the single-chain form and the heavy and light chains of fX(T~ 2R)/PC-BHK are indicated. 3.3 Expression of pCI-neo-fX(T" 2R)/PC in HEK 293A cells Initially, baby hamster kidney cells were utilized for expression of the chimeric fX/PC and fX(T R)/PC recombinant proteins because these cells are known to efficiently express the homologous coagulation proteins, factor VII and prothrombin (Cote et al, 1994; Kazama et al., 1993). However, as shown above, the B H K cell line was found to be inefficient for the production of correctly processed fX/PC and fX(T~2R)/PC. Other studies have reported severe limitations in the use of B H K cells for expression of recombinant fX, including inefficient proteolytic processing and incomplete y-carboxylation (Larson et al, 1998; Wolf etal, 1991). Therefore, the chimeric fX(T R)/PC protein was expressed in a human embryonic kidney cell line (HEK 293 A) which has recently been shown to express fully functional recombinant fX (Rudolph etal, 1997). 3.3.1 Construction of pCI-neo-fX(T~ 2R)/PC The hybrid fX(T"2R)/PC cDNA construct was excised from the vector pNUT-fX(T" 2R)/PC by digestion with Not I and ligated into the Not I restriction site of the mammalian expression vector pCI-neo as described in Materials and Methods section 2.2.3. The vector pCI-neo contains a chimeric jS-globin/IgG intron upstream of the multiple cloning site. Inclusion of an intron in the cDNA sequence has been shown to increase the expression levels of several recombinant proteins (e.g. Rafiq et al, 1997). 3.3.2 Selection of HEK 293A Cell Lines Expressing pCI-neo-fXCrttyPC Using similar methodology to that employed for fX/PC-BHK and fX(T" 2R)/PC-BHK (see _2 above), H E K 293A cells were transfected with pCI-neo-fX(T R)/PC and 10 clonal cell lines that were resistant to G-418 were screened for expression of fX(T R)/PC. Western blot analysis of conditioned medium using the monoclonal antibodies anti-fXLc a n d anti-PCnc indicated that only three of the clonal lines expressed fX(T~2R)/PC at detectable levels and the levels were similar among all three (data not shown). One cell line was arbitrarily chosen for _2 production of the recombinant protein and was denoted fX(T R)/PC-HEK. 3.3.3 Purification of fX(T 2 R)/PC-HEK ' The H E K 293A cell line was found to detach readily when cultured in roller bottles and so the fX(T~ zR)/PC-HEK clonal line was instead cultured in 175-cm2 tissue culture flasks for large-scale production of the recombinant protein. Cells were grown to confluency and the medium was replaced with 25 ml D-MEM/F-12/KSRK. The conditioned medium was collected and pooled every two days. Compared to the viability of B H K cells cultured using D-MEM/F-12/ITSAK medium (4-6 days), the H E K cell line cultured in D-MEM/F-12/KSRK appeared healthy and continued to grow and divide for up to two weeks, at which point the cells began to slough off. The two-step purification protocol employed previously, comprising sequential immunoaffinity and hydroxyapatite chromatography steps, was employed for purification of fX(T~ 2R)/PC-HEK. The elution profile obtained during hydroxyapatite chromatography was significantly different from that obtained with the recombinant protein expressed in B H K cells (Fig. 20). In addition to peaks I and II observed previously, a third major peak was eluted later from the column at -190 mM phosphate (Fig. 20C). This occurred reproducibly with different batches of immunoaffinity-purified protein. Fractions corresponding to peaks I, II and III were pooled separately and contained 105, 81 and 148 fig protein, respectively (as determined by a Bradford assay). The samples were analyzed by SDS-PAGE and western blotting using the monoclonal antibodies anti-fXLC and anti-PCnc (Fig- 21). All three peaks contained polypeptides with apparent molecular masses similar to the heavy chain of fX(T~ R)/PC-HEK (Fig. 21A). However, western blot analyses indicated that much of the material in peak I (eluted during the wash phase) was not derived from the recombinant protein, as judged by its weak cross-reaction with anti-fXix and anti-PCnc- Furthermore, in peak I, the light chain polypeptide appeared to be degraded. This peak also contained a doublet at -35 kDa of unknown origin. The majority of the recombinant protein appeared to have been processed to the dimeric form, as only a small amount of putative single-chain form (-75 kDa) was detected in peak II on western blots and none was visible in the GelCode Blue-stained gel. This contrasted with expression in the B H K cell lines, in which -30% of the recombinant protein was secreted as a single-chain precursor. However, as was observed with expression in B H K cells, a small amount of breakdown product was present at -38 and -42 kDa. o 00 < o 00 o 90 < 0.007 0.006 0.005 0.004 0.003 0.002 0.001 0 0.007 0.006 0.005 0.004 0.003 0.002 0.001 0 B I / / / / / / / Ha' / / / \ / Vjlb 0 10 20 30 40 50 60 0.007 70 350 300 250 CS -S a 200 CA o J= a, 150 E g 100 e E2. 50 i i 0 350 300 250 CJ a xs a. 200 CA o si a. 150 £ 3 '•3 100 O 2. 50 i i 0 350 300 250 V 4^ C3 JS a. 200 CA o a 150 E •3 100 o t/2 k — '50 1 1 0 FIGURE 20. Comparison of chromatographic profiles obtained on a hydroxyapatite column for fX/PC (A) and fX(T"2R)/PC (B) expressed in BHK ceUs, and fX(T"2R)/PC expressed in HEK293A cells (C). Samples of the proteins that had been purified by immunoaffinity chromatography from 1100 ml of conditioned cell culture medium were chromatographed as described in Materials and Methods section 2.4.2. Analysis of peaks labelled I, II and HI in (C) revealed that only peak EI observed for protein expressed in HEK293Acells contained substantial amounts of y-carboxylated glutamic acid (see Fig. 22 for details). u (9, ft fe 3 r<?3 a 'Pill U •I: r<s  u 3 **** 3 f fl8 7 / ^ f e ej fe * I o CO i4 I D CU ca ca cu > - CU CD ' — " CU C PH'-3 E-H " 3^  Si 2 ?L u * " &b cT^£ | o >,13 U * e u CU •«jj - +J >>'3 cd a 1-H 81 CU T3 ca cu o c cu 3 CP CU ca - 0 ^ cu 53 CU 4H -a ^ u rr c ca CU U c 3 £ '53 CU T3 ' CU 3 > S 9 U S 53 ^^2<N > d, cvr-1 cu P ca CU = ca O > > O "3 0 S o ca .s-i cu o -a i g cu ££ S3 S 6 o o -a 3 3 ca cd cu ca S J CU O c <u It CU ca 88 N-terminal sequence analysis was performed after electroblotting the proteins contained in each peak (Table 4). This confirmed that the polypeptides were derived from fX(T~ 2R)/PC-HEK and provided information on processing of the protein. The -55 kDa heavy chain polypeptide from each peak had a single N-terminal sequence corresponding to the activation peptide of fX. This indicated that the tribasic peptide (Argl40-Lysl41-Argl42) had been excised correctly from the single-chain precursor. Sequence analysis of the -22 kDa light chain polypeptide from each peak revealed that the propeptide had been removed correctly and there was no evidence of cleavage at alternate sites or retention of the propeptide. The -42 and -38 kDa breakdown products produced identical sequences to those obtained when expressing the recombinant protein in B H K cells, indicating that spurious cleavage of the heavy chain had occurred between residues Arg202-Arg203, Lysl99-Met200, and at least one other unidentified site in the C-terminus. Information on the extent of y-glutamyl carboxylation of the recombinant fX(T _ 2 R)/PC-HEK contained in each peak was obtained by analyzing the repetitive yields of amino acid derivatives obtained during N-terminal sequence analysis of the light chain (Fig. 22). Gla residues, because of their increased acidity, are not efficiently extracted from the sequencer cartridge and therefore do not appear on a normal column chromatogram (Kuwada and Katayama, 1983; Vo et al., 1999). Hence, by comparing the pmole yield of Glu observed at a given cycle to the expected yield, an estimate of the percentage of Glu residues that have been y-carboxylated can be obtained. The yields obtained from fX(T R)/PC-HEK contained in peaks I and II suggested that the glutamyl residues at positions 6 and 7 (which are normally converted to Gla in fX) were not 7-carboxylated. In contrast, at least 90% of the Glu at these positions in the peak III protein appeared to be 7-carboxylated, consistent with its elution later in the phosphate gradient. Protein that was eluted in peak III was therefore used in all further analyses. It should be mentioned that the small amount of Glu found at positions 6 and 7 for the peak III protein could have arisen from decarboxylation, a reaction known to occur under the acidic conditions used in Edman degradation (Bajaj et ah, 1982; Hauschka et ah, 1980; Price, 1984). Alternatively, a small amount of contamination from material in peak II could have been present in the preparation. Interestingly, changes in the relative amounts of recombinant protein that was eluted in peaks I, II and III were observed when processing batches of conditioned medium collected sequentially from the same cultured cells (Fig. 23). The ratio of y-carboxylated fX(T~ 2R)/PC-HEK in the medium (i.e. peak III) relative to hypo-carboxylated protein (peaks I and II) decreased with time. TABLE 4. N-terminal amino acid sequences obtained from purified fX(T~ R)/PC expressed in HEK293A cells. Band3 Hydroxyapatite column peak from which band derived Identity Apparent mass (kDa) N-terminal sequence(s)b Band 1 I, II, IIIC Heavy chain 55 +143 S-V-A-Q-A Band 2 I Light chain 22 +1 A-N-S-F-L-E Band 2 II Light chain 22 +1 A-N-S-F-L-E-E-M-K-K-G Band 2 III Light chain 22 +1 A-N-S-F-L-E-E-M Band a Bandb III III Fragments (heavy chain) Fragments (heavy chain) 42 38 +203 +200 R-G-D-S-P-W > M-T-R-R-G-D +143 +200 S-V-A-Q-A-T > M-T-R-R-G-D 2 Irnmunoaffinity-purified fX(T~ R)/PC-HEK was chromatographed on a hydroxyapatite column and samples of protein eluted in each of the three major peaks (I, II and HI; see Fig. 20C) were denatured and reduced, resolved by SDS-PAGE, and electroblotted to PVDF membrane. Polypeptides were detected with Coomassie Blue R-250 and the bands excised for sequence analysis as described in Materials and Methods section 2.5.3. The location of the first amino acid of each sequence in the primary structure of fX/PC is given in the table (refer to Fig. 9). aBands correspond to those indicated in Fig. 21. bWhere multiple sequences were detected, the relative abundance of each sequence is indicated (>, greater than) based on the yields of the derivatized amino acids. c A n identical N-terminal sequence was obtained from Band 1 for all three column peaks. Sequencer Cycle FIGURE 22. Yields of amino acid derivatives obtained during N-terminal sequence analysis of the light chain of fX(T^R)/PC expressed in HEK293A ceUs. Samples of fX(T~2R)/PC eluting in peaks I (A), II (B), and HI (C) from a hydroxyapatite column (refer Fig. 20) were resolved by SDS-PAGE and electroblotted to PVDF membrane. Bands corresponding to the light chain of the proteins were excised for sequence analysis as described in Materials and Methods section 2.4.2. Filled points in the graphs (corresponding to amino acids that are relatively stable during the sequencing process) were used to determine a line of best fit for the expected repetitive yield. The yield of Glu for peak m (C) at cycles 6 and 7 was substantially lower than expected, indicating the presence of Gla at these positions. 0.007 o 90 © X I < © 00 0.010 0.008 0.006 0.004 0.002 0 0.014 0.012 0.010 0.008 0.006 0.004 0.002 0 10 20 30 40 50 60 B I I i / / / / / / J \ / \ / \ / \ / \ / \ / m 0 10 20 30 40 50 60 70 350 300 250 08 J= 200 ft VI OJS 150 a, B 9 100 '•5 o 21 50 i i 0 350 300 250 "a? « 200 o 150 s 9 100 •3 o C/3 50 1 1 0 350 300 250 200 a. VI O J= 150 ft a 9 100 •3 O c «50 1 1 0 FIGURE 23. Chromatographic profiles of fX(T~ R)/PC separated on a hydroxyapatite column. Samples of fX(T"2R)/PC that had been purified by immunoaffinity chromatography from 1100 ml of conditioned cell culture medium were chromatographed as described in Materials and Methods (section 2.4.2). Medium (-600 ml) was collected from cells cultured in flasks each 2 days and replaced with fresh medium. The profiles were obtained using fX(T~2R)/PC purified from pooled medium collected at 2 and 4 days (A), 6 and 8 days (B), and 10 and 12 days (C). Analysis of the three major peaks labeled I, II and III revealed that only peak HI contained substantial amounts of Y<:arboxylated glutamic acid (see Fig. 22 for details). 92 To obtain a rough estimate of the relative amounts of protein contained in peaks I, II and III, the peaks were cut from the chromatographic traces and weighed. By this method, the proportion of peak III relative to the total for all three peaks appeared to decrease from -0.36 for medium collected from 0^1 days, to -0.31 for medium collected from 5-8 days, to -0.1 for medium collected from 9-12 days. Thus, although the total amount of fX(T~ 2R)/PC-HEK secreted by the cells during each 4-day period increased with time (presumably as a result of increasing cell numbers), a lower proportion of the protein was 7-carboxylated. In an attempt to reduce the extent of degradation of the recombinant protein observed during expression in either BHK or HEK 293A cells, the serine and thiol protease inhibitor phenylmethylsulfonyl fluoride (PMSF) was added to conditioned medium at the time of collection, in addition to the serine protease inhibitor, benzamidine. Furthermore, purification was started immediately after collection of each batch of medium rather than freezing each batch and processing the pooled material at a later time. These measures substantially reduced degradation of fX(T _ 2 R)/PC-HEK so that cleavage products were not observed either by SDS-PAGE or western blotting with the antibodies anti-PCnc or anti-fXix (Fig. 24). Thus, the cleavage products previously observed appeared to result from cleavage of the chimeric protein by endogenous proteases in the medium rather than improper intracellular processing. 3.3.4 Activation of fX(T"2R)/PC-HEK by R V V - X Activator The time-course of activation of 2.5 yM each of fX(T" 2R)/PC-HEK, fX and PC by 0.25 /JM R V V - X was visualized by SDS-PAGE and staining with GelCode Blue (Fig. 25). By 120 min, fX seemed to have been fully activated to fXace (-35 kDa) with subsequent autocatalytic cleavage occurring over 24 h to produce fXa/? (-31 kDa), as has been reported previously (lesty et al., 1975; Rudolph et al., 1996; Wolf et al., 1991). By contrast, only a small amount of PC had been activated after 6 h and it had not been fully activated by 24 h. In the case of fX(T~ 2R)/PC-HEK, a portion of the molecules appeared to have been activated after 15 min and the amount increased with time. However, the recombinant protein had not been fully activated even after 24 h. Although diffuse, the doublet observed for the heavy chain of activated fX(T~ 2R)/PC-HEK appeared to correspond to the a (42 kDa) and B (38 kDa) glycoforms of the heavy chain of APC. N-terminal sequence analysis of the doublet yielded an identical sequence for both polypeptides (Leu-Ue-Asp-Gly-Lys) that indicated the recombinant protein had been properly cleaved by R V V - X between Argl94-Leul95 to release of the 52-amino acid activation peptide. 93 t) i) r<§5 i) r<?3 a Pit, u t i u DC U t J I ^ H • f | V D T t O CO VO o co ca s xv o Q cj .3 cj - o . S K U S o S -O X oo J 6 0 „ 6 jgC 0 0 o ta e .« .2 *o 'o •9 '-a i s a fj T3 3 i/j ca So cj u «J 00 3 O o u o e o 1 ca 0 0 C O CD T - I 3 PH 0 0 ^ D a w X 2 5 C H T 1 . ! 3 3 cj o CJ CA 3 O C H CJ T3 lH CJ OcN | H _ o y -a 5 • OO •i § CJ O 3 cj c« ca •*H ca ca cj •S.S - H T 3 O " 3 O 3 o ca 4—» - -o O oo iQ cj O M O 00 *H fll «) O H > O u t2 C J If I«1 * C J +-> ca an ~ C H H . „ ca .3 § 3 Is f—H O CH oo 5 -3 a, 9. "9 "a JTX) 3 2 x 3 ^ . 3 ca g e cj cj ca cjyn2 - U 6 « U .1 a i §r3 ^ a 1 1 3 2H * 1 oo J3 ca au OO J ca P-c cj u'J <+C T-H »H i - H ca w ow 3 T 3 ^ C H O Pi - 3 c N 5H r-HvS 3 - •> .2 * ta X> CJ X 3 ta v, SL§ a^  3 . CH 0 0 - 3 R O oo .a O H T 3 ^ < U 3 3 ^ ca-3 — CJ ^ fH ^oo-o s x ca C j -tC X 3 H 3 " O "2 - 1 3 cj o - T - I . H O X3 8 a <- o o >>-3 • cj t j . H 3 O S v ^ 00 fli J J= c3 C O Cfl PH CJ w u pi 7 8 a cd > < 09^ %4 u U ft c u I Og, 0f>, V , PQ < a eo. u i m u a ca 1 % • m • > • § 1 • * • Hi * m • a ea 1 1 u I II i • II # II • • * • t i o oo S I in « o C o > CU co On * c CJ O 'Q ca " • C O g r-1 tn 3 X O C O CU o .5 4-» O OH ca " t l 42 " o IH O -a! x) 3 ! l d l H i co 4 3 >-« ™ C Q . cu Ci « 4 3 5 o cu «u 1 H4 CI W 3 3 u « 5 -P CS O I H co ^jf X ) CJ 0H CJ 3 cu CO O «u 6 • f l 7 3 ^ - N CU co •H 3 CU P C/3 i—^ • °3 c3 > M ^ X J a d 3 xi a m pi Er sT H . ^ S O H X ! g o d o & £ g cu -d cu <-> ! 3 5 ' co 4 3 cu CJ 4 2 2> X > CU "O , 0 0 cu O - £ J 2 * cd C4-H O CJ C O cj oo C . 3 On-g . CN > R o cr^2 -d 3 c« 4 3 Q / - N • T ) ? W > o 3 3.3.5 Activation of fX(T 2R)/PC-HEK by Protac Human plasma-derived PC and recombinant fX(T" 2R)/PC-HEK were activated with Protac for various times and the activation products visualized by western blotting using the monoclonal antibody anti-PCnc (Fig- 26). PC appeared to be almost fully activated after 15 min, as indicated by a reduction in the apparent molecular mass of the heavy chain doublet by -2 kDa. However, little fX(T - 2 R)/PC-HEK was activated by this time and even after 24 h, full —2 activation of fX(T R)/PC-HEK was not apparent. Whereas the predominant activation product of PC corresponded to the a form of the heavy chain, the main activation product of fX(T" 2R)/PC-HEK had an apparent molecular mass that was similar to the (3 form of the APC heavy chain. Over time, a polypeptide that appeared to correspond to the APC a form was generated from fX(T~ 2R)/PC-HEK. The rate of activation of fX(T~ 2R)/PC-HEK and PC by Protac was followed by measuring the rate of hydrolysis of the chromogenic substrate Spectrozyme PCa (SPCa) (Fig. 27). Consistent with the results of western blot analyses, PC was more efficiently activated by Protac than was fX(T~ 2R)/PC-HEK. PC obtained near maximal activity after 15 min incubation with Protac whereas the activity of fX(T~ 2R)/PC-HEK continued to markedly increase over the entire 360 min of the incubation period. However, a plot of the initial rate of hydrolysis by afX(T~ 2R)/PC-HEK against the time of incubation with Protac demonstrated that the slope of the line began to decrease with time (inset to Fig. 27). 3.3.6 Kinetic Analysis of fX(T" 2R)/PC-HEK The amidolytic activity of Protac-activated fX(T R)/PC-HEK and Protac-activated plasma PC was compared using the chromogenic substrate SPCa (Fig. 28). The recombinant protein exhibited only -50% of the activity of APC, reflected in a two-fold lower V m a x for afX/PC-HEK. However, K m values for afX(T~ 2R)/PC-HEK (0.14 mM) and APC (0.20 mM) with this substrate did not differ greatly, indicating that the affinity of the recombinant protein for SPCa was similar to, if not slightly higher than, APC. P C •5" •S' kDa C j C J S to V l > (VJ fi Activated o ] heavy F chain B fX(T R)/PC-HEK •>s> 7 7/ 7/ 777 UA Activated _ 3 ]heavy H chain F I G U R E 26. Time-course of activation of PC (A) and fX(T~ 2 R)/PC-HEK (B) by Protac. PC and fX(T R)/PC-HEK (-105 pmoles each) were each incubated with 0.7 U Protac as described in Materials and Methods 2.6.3.1. At timed intervals (0, 15, 60, 120, 240, 360 min and 24 h) an aliquot of 15 pmoles was removed from the reaction, and quenched and reduced with P-mercaptoethanol. The samples were electrophoresed in SDS-12% poly-acrylamide gels and western blotted using the monoclonal antibody anti-PCHC- Bands corresponding to the unactivated (UA), and activated heavy chain polypeptides (a and P forms) of PC and fX(T _ 2 R)/PC-HEK are indicated. 97 0 10 20 30 Time (min) FIGURE 27. Comparison of the rate of activation of recombinant fX(T~2R)/PC (expressed in HEK293A cells) and plasma-derived PC by Protac. Samples of fX(T 2R)/PC and PC (10 nM each) were activated with 0.07 U/ml of Protac for various times and the rate of hydrolysis of the chromogenic substrate Spectrozyme PCa measured as described in Materials and Methods section 2.6.2.2. The final amidolytic reactions contained 5 nM fX(T~ R)/PC or PC and 0.4 mM Spectrozyme PCa. Each of the points represents the mean of three replicates and vertical bars indicate + 1 sample standard deviation. The inset graph shows the values for afX(T~ R)/PC plotted as the initial rate of hydrolysis of Spectrozyme PCa after incubation with Protac for various times. The slopes were determined by linear regression analysis of the data from the first 5 min of the reactions. 98 °A/l o t N . o 7 s 1 cu E H PH S - - o " o < o a Cfl IT) 3 ^ o s £ N 7 3 73 81 S a S i S 3 c« CJ CJ HHS C M M ° m irrr> &o ca - ~ 9T.J c*> I a DH CJ i - 1 • CO O ^ 3 -S<4-H o CO c j 3 > T3 - C c j M-H o <D +-* T3 .s s <D i, c^ : b cj t 3 _ § i 3 . 3 & « . . CD ccj ' - i - fe! cj o O- I J C/J ^ cj O O CO <b 5 a E S5 "3! t 3 O 3 Lo PQ d 3.3.7 A P T T assays with a f X ( T " 2 R ) / P C - H E K Activated Partial Thromboplastin Time (APTT) assays were carried out using unactivated and Protac-activated fX(T" 2R)/PC-HEK and plasma-derived PC (Table 5 and Fig. 29). When compared to the buffer control, neither of the zymogens prolonged the clotting process, even when assayed at a final concentration of 200 nM (more than 5 times the normal plasma concentration of fX). After activation with Protac for 6 h, afX(T R)/PC-FfEK extended the clotting time compared to the controls and this was shown to be dose-dependent (Fig. 29). However, compared to APC, the recombinant protein was far less effective in prolonging the clotting time, even when present at concentrations 8-fold higher than APC. 100 TABLE 5. Activated partial thromboplastin time assays with purified fX(T"2R)/PC that had been expressed in HEK293A cells. Sample Cone. (nM) Clotting time (s) - Protac + Protac Control (Buffer) - 40.7 ± 1 . 3 34.2 ± 0 . 3 PC 10 236.5 ± 17.9 PC 20 No clota PC 40 41.2 + 0.8 No clot3 PC 200 42.1 ± 0 . 8 -fX(T~2R)/PC-HEK 20 - 63.1 ± 2 . 1 fXCT2R)/PC-HEK 40 42.6 ± 0 . 8 78.9 ± 3 . 5 fXCr 2R)/PC-HEK 80 - 138.7 ± 12.0 fX(T-2R)/PC-HEK 200 42.8 ± 2 . 2 -2 Recombinant fX(T~ R)/PC-HEK that had been purified by immunoaffinity chromatography and fractionation on a hydroxyapatite column (peak III in Fig. 20) was tested for its ability to prolong the clotting time in an activated partial thromboplastin time assay as described in Materials and Methods section 2.6.4. Various concentrations of fX(T~ 2R)/PC-HEK and protein C that had been either activated with Protac (+ Protac) or not (- Protac) were incubated with phospholipid and protein C-deficient human plasma at 37 °C and clotting was initiated by the addition of calcium chloride to the samples. Clotting times were measured with a Fibrometer Coagulation Timer. Each assay was performed in triplicate and values are given as the mean ± 1 sample standard deviation. aNo clot had formed after 10 min. FIGURE 29. Dose-response curve for Protac-activated fX(T" 2R)/PC in an APTT assay. Data was plotted from Table 5 above. Vertical bars represent ± 1 sample standard deviation from the mean. 150-125 -3UII 100-00 c 75-o u 50-25-Concentration (nM) 4.0 D I S C U S S I O N The intent of this study was to investigate the potential anticoagulant function of a recombinant chimeric protein comprising the light chain and activation peptide of the procoagulant protein, human fX, joined to the serine protease domain of the anticoagulant protein, human PC. To achieve this, a fusion cDNA encoding the chimeric protein (fX/PC) was constructed and expressed in mammalian cell lines. The recombinant protein was purified and its structural and functional properties characterized. In initial work, the expression vector pNUT (Palmiter et al, 1987) was utilized for expression of fX/PC in B H K cells. Analysis of conditioned medium from clonal cell lines by western blotting with two monoclonal antibodies (one specific for an epitope on the light chain of human fX and the other for an epitope on the heavy chain of human PC) provided evidence that the chimeric protein (denoted fX/PC-BHK) could be expressed and secreted by B H K cells. Polypeptides were detected that had apparent molecular masses corresponding to those predicted for the single-chain form (-75 kDa), and the light chain (-22 kDa) and heavy chain (-55 kDa) of the dimeric form of fX/PC. Consistent with these results, Southern blot analysis indicated that the fusion cDNA had been integrated intact into the genome of the B H K cells. Final confirmation that the recombinant fX/PC protein was being expressed was obtained by purifying the protein and subjecting it to N-terminal sequence analysis (see below). Repeated attempts to purify the recombinant fX/PC-BHK protein by adsorption to barium citrate followed by anion-exchange chromatography resulted in extremely low yields. This is a protocol that has been commonly used to purify coagulation factors from plasma and conditioned medium (Cote etal, 1994; Rudolph etal, 1997; Walker, 1980). The method exploits the selective adsorption of Gla-containing proteins to barium citrate as an initial capture step (Bajaj et al, 1981b) and it has been shown that a minimum of 6 or 7 Gla residues are required for efficient adsorption of prothrombin (Cassen and Malhotra, 1980). Thus, the problems encountered at this stage when attempting to adsorb fX/PC-BHK almost certainly arose from inefficient 7-carboxylation of the protein. Later work based on N-terminal sequence analysis and chromatography on a hydroxyapatite support indicated that fX/PC was expressed by the B H K cell line in a hypo-carboxylated form (see Results section 3.3.3). In addition, it is also possible that structural aspects of the fX/PC protein itself contributed to the low yields obtained. For example, efficient secretion of recombinant PC depends on the presence of TV-linked carbohydrate at Asn97 in the light chain (Grinnell et al, 1991); a moiety not present in fX/PC, which instead contains the light chain of fX. The recombinant fX/PC protein was successfully purified in a higher yield by employing a protocol similar to that recently described by Larson et al. (1998) for the purification of fully y-carboxylated recombinant human fX from conditioned medium. This protocol employed sequential steps of immunoaffinity chromatography and fractionation on a hydroxyapatite column. The use of immunoaffinity resins comprising Sepharose-conjugated anti-fX or anti-PC polyclonal antibodies was effective for an initial capture step by batch adsorption and achieved a high degree of purification of fX/PC from conditioned medium. The bound protein could be eluted at near-neutral pH with Gentle Elution Buffer (Pierce), an elution agent routinely used to detach plasma coagulation factors from affinity resins without adversely affecting their activities (Dr. Hugh Hoogendorn, Affinity Biologicals Inc., Hamilton, ON and Dr. Jeffrey Weitz, McMaster University, Hamilton, ON; personal communication). The second purification stage utilized hydroxyapatite, an inorganic support that has been shown to bind with high affinity, proteins containing as few as three Gla residues (Price and Johnson, 1980). Immunopurified.fX/PC-BHK was eluted from the hydroxyapatite column as two distinct species; one that was eluted in the wash stage, and the second at ~110 mM phosphate with a shoulder on its trailing side. This elution profile suggested that the first species contained little or no y-carboxylated material. The degree of y-carboxylation of the second species was unknown. However, based on the observation that fully y-carboxylated material is eluted at higher phosphate concentrations (Larson et al., 1998), fractions from the shoulder on the trailing side of the second peak were pooled and treated separately for subsequent analysis. In addition, the hydroxyapatite step removed an -70 kDa contaminant (presumably albumin) that was present in immunoaffinity-purified preparations of fX/PC. Although, N-terminal sequence analyses of fX/PC-BHK revealed that the heavy chain possessed the correct amino-terminal sequence, it also revealed that most of the protein either retained the propeptide or had been cleaved at an alternate site in the light chain (the Lys 10-Lysl 1 peptide bond). This would be expected to seriously affect the function of the recombinant protein by reducing the ability of the Gla domain to interact with membranes. It is not readily apparent why the LyslO-Lysl 1 bond was hydrolyzed but PACE/furin, the enzyme proposed to be responsible for cleaving the propeptide from coagulation factors, preferentially cleaves the sequence Arg^-Xxx-Lys /Arg _ 2 -Arg _ 1 (Drews et al., 1995; Foster et al., 1987, 1990a; Wasley et al., 1993). The corresponding sequence in the light chain of human fX is Arg^-Xxx-Thr~ 2 -Arg - 1 and this may account for the cleavage observed at the dibasic LyslO-Lysl 1 site located nearby. Determination of the amino-terminal sequences of the minor -38 and -42 kDa polypeptides observed in purified fX/PC-BHK revealed that spurious cleavage had occurred within the heavy chain in at least three locations, including the Arg202-Arg203 and Lysl99-Met200 peptide bonds. Inspection of the three-dimensional structure of PC (Mather et al., 1996) revealed that these residues are exposed on the surface of the molecule and could thus be susceptible to the action of proteases in the conditioned medium. The fragmentation was prevented in later experiments by adding PMSF to the conditioned medium at the time of collection and immediately processing each batch when it was collected. About 20-30% of fX/PC-BHK was found to comprise the single-chain precursor, from which the tribasic peptide Argl40-Lysl41-Argl42 had not been excised. Variation in the ability of different cell lines to process recombinant human fX and PC to their dimeric forms has been reported (Foster et ah, 1987, 1990a; Grinnell et al., 1987). B H K cells have been observed to secrete a majority (-80%) of recombinant PC as a single chain whereas H E K 293 cells process the precursor to a dimer with -80% efficiency. This again has been attributed to the preference of PACE/furin for substrates with a basic amino acid in the —4 position relative to the site of cleavage (Foster et al, 1990a, 1991). PC has a histidinyl residue at the -4 position and is therefore considered to be a relatively poor substrate for PACE. In contrast, fX, which has an arginyl residue at this position, is almost completely processed to the dimer in both B H K and H E K 293 cell lines. The recombinant fX/PC-BHK protein contained the tribasic peptide derived from fX and this presumably accounted for the much higher efficiency of conversion to the dimeric form than has been observed for recombinant PC. The purified fX/PC-BHK protein could be activated by Russell's Viper Venom-X activator (RVV-X), a metalloproteinase that specifically activates fX by hydrolyzing the same peptide bond (Argl94-Ilel95) as factors IXa and Vila (Furie and Furie, 1976; Takeya et al., 1992). Western blot and N-terminal sequence analyses of the heavy chain of RVV-X-activated fX/PC-BHK demonstrated that the snake protease was capable of recognizing and cleaving the Argl94-Leul95 bond to release the 52-amino acid activation peptide from the chimeric protein. However, activation of fX/PC-BHK was much less efficient than observed for recombinant fX (Rudolph et al., 1997) and complete activation was not observed even after 24 h. Full activation of fX by R V V - X requires the presence of C a 2 + ions and an intact Gla domain (Takeya et al., 1992). Naturally occurring mutations in fX that specify the substitution of Gly for Gla at residue 7 (fXst. Louis n) or 14 (fXKetchikan) result in significantly lower rates of activation by R V V - X (Kim et al., 1995; Rudolph et al, 1996). Thus, fX/PC-BHK would not be expected to constitute an ideal substrate for this protease, since in addition to possessing the sub-optimal (Argl94—Leu 195) cleavage site of PC, much of the protein exhibited retention or improper cleavage of the propeptide and incomplete y-carboxylation. F X / P C - B H K could also 104 be activated by the PC-specific activator Protac, a protease isolated from venom of Agkistrodon contortix (Stocker et al, 1987). Dimeric fX/PC-BHK appeared to be a better substrate for Protac than the single-chain form and this is consistent with the observation that single-chain PC is resistant to cleavage by Protac (Lee et al, 1996). Activated partial thromboplastin time (APTT) assays were performed with hydroxyapatite-fractionated fX/PC-BHK to test whether the recombinant protein extended clotting time. This is a standard hematological assay that has evolved from partial thromboplastin time techniques (Langdell et al., 1953) and relies on the recalcification of plasma in the presence of plasma-like phosphatides (partial thromboplastins) and an activator of the contact factors of the intrinsic coagulation pathway (e.g. ellagic acid). The addition of plasma deficient in any of the clotting factors necessary for the intrinsic activation of prothrombin, or the addition of APC to the assay, will extend the clotting times relative to normal control plasma. None of the fX/PC-BHK species that were eluted in peaks I, Ila, or the shoulder lib during hydroxyapatite chromatography prolonged the clotting time whether activated with Protac or not prior to their addition to the assay. Aside from the possibility that the chimeric protein lacked serine protease activity (and hence the ability to inactivate fVIIIa and fVa), the inability of activated fX/PC-BHK to extend the clotting time indicated that the recombinant protein was not able to even bind to the Tenase complex: had it been able to do so, it would have been expected to compete with fX for its binding site. That competitive inhibition was not seen in the clotting assays most probably relates to the deficiencies in post-translational processing observed for fX/PC-BHK (i.e. improper cleavage or complete retention of the propeptide and hypo-carboxylation). This is a reasonable assumption considering that naturally occurring point mutations in PC (within the propeptidase recognition site) have been characterized that result in PC molecules which are elongated by one amino acid at the N-terminus of the Gla domain and are consequently dysfunctional (Lind et al., 1997). Furthermore, a mutation resulting in retention of part of the propeptide of flX causes hemophilia B (Bentley et al., 1986) and retention of the propeptide in recombinant flX directly inhibits binding to membrane surfaces (Bristol et ah, 1994). These mutations do not affect y-carboxylation of the molecules but instead appear to prevent the burial of the N-terminus in the folded Gla domain structure that is necessary for full stabilization of the phospholipid-binding conformation (Freedman et al, 1995; Jacobs et al, 1994; Lind et al., 1997; Soriano-Garcia et al, 1992). Inefficient y-carboxylation of the recombinant protein would also severely restrict its ability to interact with phospholipids since a lack of Gla at even one of several critical positions in the Gla domain can result in undetectable or reduced functional activity (Gianelli et al., 1991; Larson et al., 1998; Ratcliffe etal, 1993; Zhang and Castellino, 1993). The activated fX/PC-BHK protein exhibited only limited amidolytic activity towards the PC substrate SPCa. Kinetic analysis revealed a ten-fold lower V m a x and four-fold higher K m for this substrate compared to APC, suggesting that the catalytic pockets of the activated chimeric protein and APC may have been quite different. Because ehromogenic substrates such as SPCa generally have small molecular masses (>1 kDa), the light chains of the activated vitamin K-dependent proteins are thought to have little effect on the accessibility of the ehromogenic substrate to the active site. Even the removal or replacement of entire domains in the light chain may not perturb interactions with ehromogenic substrates (Grinnell et al, 1987; Hertzberg et al, 1992; Morita and Jackson, 1986; Rudolph et al, 1996; Yu et al, 1994). Therefore, the relatively poor kinetic parameters obtained for activated fX/PC-BHK most likely reflected structural perturbations involving the serine protease domain. A number of factors could contribute to alter the catalytic pocket and reduce the amidolytic activity of the chimeric protein. Because -20-30% of purified fX/PC-BHK was present as a single-chain polypeptide, its activation would result in a dimeric protein in which the activated heavy chain was disulfide-linked to a light chain that still retained the activation peptide. In the case of PC, retention of the activation peptide does not affect its functional activity since, once activated, the single-chain form isolated from either human plasma or recombinant cell lines has similar properties to that of the dimer (Marlar, 1985a; Oppenheimer and Wydro, 1988). Furthermore, preparations of mutated recombinant PC comprising 100% two-chain or 100% single-chain molecules are fully active in an amidolytic assay and display nearly identical kinetics (Foster et al, 1990a). However, it is possible that the activated single-chain form of fX/PC-BHK had kinetic characteristics different from those of activated single-chain PC. The activation peptide in the chimeric protein comprises 52 amino acids and is heavily glycosylated in fX, as compared to the non-glycosylated, 12-amino acid activation peptide of PC. Thus, the accessibility of the active site pocket could have been sterically hindered if this peptide was retained. In addition, a substantial amount of the fX/PC-BHK protein had been improperly cleaved, resulting in Met200 or Arg203 at the N-terminus of the heavy chain. This would probably result in either a non-functional protein or one with reduced amidolytic activity because the creation of the substrate binding pocket in activated vitamin K-dependent serine proteases is dependent on formation of a salt bridge between the new N-terminus of the heavy chain (Leu or Ile; Leul95 in the case of fX/PC) and an aspartyl residue adjacent to the active site serine (Bode et al, 1997; Stroud et al, 1975). Another factor that could have led to reduced activity was the observed cleavage occurring near the C-terminus of the serine protease domain of fX/PC-BHK. Even minor alterations to the heavy chain can result in a complete loss of amidolytic activity, as results from the naturally occurring point mutation fXFriuii. m which a serine is substituted for proline334 (Kim et al, 1996). 106 In an effort to enhance proteolytic removal of the propeptide from fX/PC and reduce cleavage at the LyslO-Lysl 1 peptide bond, PCR-mediated site-directed mutagenesis was employed to substitute Arg for Thr of the recombinant protein. This was done to create a dibasic sequence at the propeptide cleavage site, as is preferred by PACE/furin (Drews et al, 1995; Foster et al, 1987, 1990a; Wasley et al, 1993). The recombinant protein (denoted fX(T R)/PC) was expressed in B H K cells and purified from conditioned medium as done previously for fX/PC. The elution profile obtained for immunoaffinity-purified fX(T~ 2R)/PC-BHK during hydroxyapatite chromatography was similar to that observed for fX/PC-BHK. SDS-PAGE revealed the presence of both single-chain and dimeric protein in the preparation as well as the spurious cleavage products seen with fX/PC-BHK. N-terminal sequence analysis of the single-chain precursor indicated that -50% of the chimeric molecules retained the propeptide but that the remainder had been processed at the correct propeptide cleavage site. The retention of the propeptide by such a large proportion of the molecules contrasts with observations in which the removal of the propeptide from recombinant fX (also expressed in a B H K cell line) was seen to proceed with 100% efficiency (Rudolph et al, 1997). The reason for this discrepancy is not clear but may represent differences in the phenotype of the particular B H K cell lines employed for expression. However, the B H K cell line used here has been routinely employed in this laboratory to express fully functional prothrombin. Thus, the efficiency with which the propeptidase processes the various vitamin K-dependent proteins appears to be dependent, at least in part, on the nature of the substrate protein, rather than merely on the host cell line. Because of the difficulties encountered in expressing the chimeric protein in B H K cells in a properly post-translationally modified form, a decision was made to test the efficacy of a different cell line for expression of fX(T"2R)/PC. Published studies reporting the expression of recombinant fX are scarce. One study has noted problems in the activation of fX expressed in Chinese hamster ovary cells (Wolf et al, 1991) and Rudolph et al. (1997) reported that recombinant fX expressed in BHK cells had reduced clotting activity due to incomplete y-carboxylation. However, human embryonic kidney cells have been employed to express fully functional PC (Grinnell et al, 1987, 1989) and this cell line has recently been used successfully for the expression of recombinant wild-type and mutated fX proteins (Larson et al, 1998; Rudolph et al, 1997). Therefore, the cDNA encoding fX(T"2R)/PC was subcloned into the vector pCI-neo and used to transfect H E K 293A cells. The recombinant protein (denoted fX(T" 2R)/PC-HEK) was purified by immunoaffinity and hydroxyapatite chromatography, as was used for the protein expressed in B H K cells. The elution profile obtained when fX(T Z R)/PC-HEK was chromatographed on a hydroxy apatite column contained a major peak (III) that was not observed for either fX(T~2R)/PC or fX/PC expressed in BHK cells. This peak eluted later in the phosphate gradient than the peaks (I and II) observed previously and the chromatograph resembled that reported for recombinant variants of fX expressed in HEK 293 cells (Larson et al, 1998). SDS-PAGE and western blot analysis revealed that, unlike the protein expressed in B H K cells, fX(T~ zR)/PC-HEK was almost completely processed to a dimer. Only a minor amount of the single-chain form was detected in peak II by western blotting. When the protein contained in each of the three peaks was subjected to N-terminal sequence analysis, the heavy chain yielded the expected amino-terminal sequence, indicating proper excision of the tribasic peptide from the single-chain precursor. In all three cases, the light chain polypeptide produced a single sequence corresponding to the amino-terminus of mature fX and there was no evidence of cleavage at additional sites or retention of the propeptide as observed with the B H K cell line. Thus, there appeared to be a difference in the substrate specificity of the propeptidase in the two cell lines. This might be expected because the cell lines were derived from different species. As observed for the chimeric protein expressed in B H K cells, -38 and -42 kDa breakdown products were apparent but this fragmentation was prevented in later preparations by adding PMSF as well as benzamidine to the harvested medium and immediately purifying the protein. In this way it was possible to obtain highly purified fX(T" 2R)/PC-HEK for functional analyses. An estimate of the extent of 7-carboxylation present in fX(T~2R) / P C - H E K was obtained from N-terminal sequence analysis of the light chain polypeptide. In the case of protein contained in peaks I and II eluted during hydroxyapatite chromatography, Glu was found at positions 6 and 7 in yields that suggested that little, if any, of the protein had been 7-carboxylated at these positions. By contrast, the protein eluted in peak III produced a very low yield of Glu at these positions and the small signal that was present may have arisen through decarboxylation during sequence analysis (Bajaj et al, 1982; Hauschka et al, 1980; Price, 1984). This suggests that most, or all, of the protein in peak III had been 7-carboxylated at these positions. Although limited, the results are consistent with studies of the 7-carboxylation status of recombinant fX variants expressed in H E K cells (Larson et al, 1998). The variants exhibited a similar elution profile from hydroxyapatite to fX(T" 2R)/PC-HEK, with major peaks eluted at -125 and -225 mM phosphate. HPLC analysis of alkaline hydrolysates of the material contained in each peak indicated that they contained non- and fully 7-carboxylated protein, respectively. Furthermore, plasma fX was observed to elute at the same position as the fully 7carboxylated recombinant fX. 108 The study by Larson et al. (1998) appears to lend support to the notion (Morris et al., 1995) that modification by the y-glutamyl carboxylase proceeds to completion once initiated, otherwise material with an intermediate Gla content should have been detected. However, several forms of partially y-carboxylated prothrombin have been isolated from the plasma of warfarin-treated cows (Cassen and Malhotra, 1980). Furthermore, studies involving PC expressed in H E K cells (Grinnell et al, 1989; Yan et al, 1990), and fX or prothrombin expressed in B H K cells (Rudolph et al, 1997; Vo et al, 1999), reported the presence of both fully and partially y-carboxylated material. Here, the structural differences between fX(T~ 2R)/PC-HEK contained in peaks I and II that lead to their separate elution are not obvious but it is possible that the peak I protein (which did not bind to hydroxyapatite) represented non-ycarboxylated material and that peak II contained severely hypo-carboxylated protein. Why some vitamin K-dependent proteases are not completely y-carboxylated by these host systems is not clear but, at least in the case of PC expressed in H E K 293 cells, this does not appear to be associated with high-level expression of the recombinant protein (Grinnell et al, 1989). Instead it may be a reflection of the nature of the substrate, the carboxylating enzyme itself, and the unnatural environment in vitro. It is of interest to note that the affinities of different propeptides for the carboxylase appear to vary over a considerable range and that the propeptide of fX has an ~ 100-fold higher affinity than the propeptides of PC and prothrombin (Stanley et al, 1999). This may have a significant role in determining the levels of the biologically active forms of these proteins in vivo. The yield of apparently fully y-carboxylated fX(T~ 2R)/PC-HEK (i.e. protein contained in peak III) was -130 fig per liter of conditioned medium. This compares favorably with the reported recovery of fully y-carboxylated recombinant fX expressed in H E K 293 cells (90 /ig/L) (Larson et al, 1998). However, the proportion of fX(T~ 2R)/PC-HEK in peak III relative to peaks I and II was observed to decrease with each successive harvest of conditioned medium (although cell numbers continued to increase) and this was seen repeatedly. As far as this author is aware, this phenomenon has not been reported for other recombinant vitamin K-dependent proteins, perhaps because it is common practice to pool medium from successive harvests prior to purification, and an initial barium citrate precipitation step, which selectively isolates y-carboxylated protein, is often employed. 109 The cause of this decrease is unclear but it suggests a progressive decline in the ability of the cells to y-carboxylate the protein as the culture aged. It is possible that, although vitamin K is essential for the y-carboxylation process, the presence of high concentrations of the vitamin in the medium leads to down-regulation of this process. Conversely, vitamin K deficiency or administration of warfarin in rats leads to an increase in ycarboxylase activity (Carlisle et al, 1980). Cytotoxicity is not observed in cells cultured in medium containing less than 50 ^Ug/ml vitamin K (Berkner, 1993) but it may be significant that the 10 ^ g/ml concentration of vitamin K used in this study, which is consistent with that routinely added to cell cultures (Berkner, 1993; McClure et al, 1992), is about 20,000 times higher than levels in the plasma of adult humans (0.4-0.54 ng/ml; Ferland et al, 1993). Thus, a detailed study of this phenomenon might provide information useful for optimizing yields of fully y-carboxylated protein. SDS-PAGE and N-terminal sequence analyses indicated that, while R V V - X recognized and correctly cleaved the fX(T~ 2R)/PC-HEK zymogen to its activated form, only -75% of the chimeric protein was activated by this protease. In addition, activation occurred at a much slower rate than seen for plasma-derived fX. This has been observed by others in studies involving recombinant fX (Wolf et al, 1991, Larson et al, 1998). As mentioned above, this could relate to the sub-optimal R V V - X cleavage site possessed by fX(T - 2 R)/PC-HEK. Alternatively, the degree of glycosylation may have been a factor if carbohydrate moieties on the recombinant molecule sterically hindered access by R V V - X . There are seven potential glycosylation sites in the chimeric protein; three in the heavy chain and four in the activation peptide. As observed in R V V - X activation studies, the rate and extent of activation of the chimeric zymogen by Protac was greatly reduced compared to plasma-derived PC and it did not appear to be fully activated even after 24 h. After treatment with Protac for 6 h, fX(T" 2R)/PC-HEK possessed -50% of the amidolytic activity of Protac-activated PC toward the substrate SPCa. However, it exhibited a similar K m (0.14 mM) to that of the plasma-derived protein (0.20 mM) indicating that both enzymes had about the same affinity for this substrate. Given the similar K m values and the obvious fact that V m a x relies, in part, on the concentration of active enzyme added to an assay, the two-fold difference in amidolytic activity between fX(T~ 2R)/PC-HEK and APC was most probably due to differences in the relative proportions of activated protein in the preparations. Thus, for all intents and purposes, a fully activated fX(T R)/PC molecule might display amidolytic activity comparable to that of APC. 110 It had been hypothesized that the chimeric protein would be activated by the Tenase complex and subsequently function to inactivate fVIIIa. In APTT assays, the zymogen form of fX(T" 2R)/PC-HEK (and PC) did not affect the clotting time, even when added at a concentration (200 nM) that was five times greater than that of fX in plasma. This indicated not only that the fX(T _ 2 R)/PC-HEK zymogen failed to be activated by the Tenase complex, but also that it was incapable of associating with this complex and competing for binding with fX. Upon activation, the protein extended the clotting time in a dose-dependent manner, although its anticoagulant activity was limited compared to APC. The dose-dependent inhibition of clotting effected by the activated chimeric protein may indicate that the catalytic domain possessed a limited ability to proteolytically inactivate either fVIIIa or fV a. This was not examined in this study but could be investigated directly by monitoring any cleavage of the cofactors in the presence of the chimeric protein with western blots. An alternative possibility is that in its activated form, fX(T~ 2R)/PC-HEK functioned strictly as a competitor for the binding site of either fX within the Tenase complex or fXa within the Prothrombinase complex. As such, it would be able to bind to one or both complexes but not be enzymatically active because of improper orientation of its active site relative to the APC cleavage sites on the cofactors. This is conceivable since studies employing fluorescence resonance energy transfer have determined that the active sites of fIXa, fXa, and APC are not identically distanced above the membrane surface (Husten et al, 1987; Mutucumarana et al, 1992; Yegneswaran et al, 1999). In the case of membrane-bound fXa, its active site is located an average of 61 A above the surface in the absence of factor Va but this changes to 69 A in the presence of factor Va (Husten et al, 1987). The active site of membrane-bound APC is located an average of 94 A above the surface and is relocated to an average of 84 A upon association with its cofactor PS (Yegneswaran et al, 1999). Based on these observations, it is likely that the active site of activated fX(T~ 2R)/PC-HEK would not be correctly distanced above the membrane for its proper orientation since substitution of the light chain of PC with that of fX would result in an activated chimeric protein with 16 fewer amino acids than that of APC. It is interesting to note that recent studies in which the Gla domain and aromatic stack portion of APC were replaced with the corresponding domains of prothrombin resulted in a chimeric protein with an enhanced activity towards factor Va. Its activity was found to be independent of protein S as a result of the active site being relocated to an elevation above the phospholipid surface similar to that of APC/PS complex (Smirnov et al, 1998; Yegneswaran et al, 1999). In addition to structural changes in the chimeric protein that could affect the orientation of its active site, more general conformational changes could also result in reduced anticoagulant function. A number of structure-function studies have indicated that the EGF2 and serine protease domains of the vitamin K-dependent clotting factors are closely integrated (Brandstetter et al, 1995; Mather et al, 1996; Padmanabhan et al, 1993). At least in the case of HX (Lapan and Fay, 1997; Lin et al, 1990) and fX (Chattopadhyay et al, 1992; Hertzberg et al, 1992), both domains are necessary to confer the specificity required for interaction with their respective cofactors. With regards to APC, peptide inhibition studies have identified potential factor Va interaction sites in the heavy chain, as well as two in the light chain; between the EGF1 and EGF2 domains, and at the C-terminus (Mesters et al, 1991, 1993a,b). Therefore, while the chimeric protein fX(T~ 2R)/PC-HEK may possess the appropriate fX domains necessary for calcium-dependent binding to phospholipid, it may lack critical regions located in the light chain of PC that are required for its proper interaction with fVIIIa and fV a. In summary, fusion cDNAs encoding the chimeric proteins fX/PC and fX(T R)/PC were constructed and expressed in mammalian cell lines. The recombinant proteins were purified from conditioned medium by a two-step method involving batch-adsorption and elution from an immunoaffinity support followed by hydroxyapatite chromatography. The purified proteins were characterized by structural and functional analyses which highlighted problems involving the post-translational modifications necessary for functional activity of the chimeric proteins, and spurious cleavage of the molecules. These were overcome by a combination of site-directed mutagenesis, the use of an alternate cell line for expression, and modification of the purification protocol. In this way, homogeneous and properly post-translationally modified preparations were obtained. The purified chimeric zymogens could be activated by R V V - X and Protac to amidolytically active serine proteases and in the case of activated fX(T"2R)/PC, K m for the substrate SPCa was comparable to that of APC. Whereas the fX(T~2R)/PC zymogen had no effect on clotting time in APTT assays, the Protac-activated protein extended the clotting time in a dose-dependent manner. However, the anticoagulant activity of the chimeric protein was far lower than that of APC. Therefore, it can be concluded that, despite substitution of the light chain and activation peptide of PC with those of fX, the fX(T~2R)/PC chimeric protein displayed features similar to PC although it did not function as hypothesized. BIBLIOGRAPHY Agarwala, K. L. , Kawabata, S., Takao, T., Murata, H., Shimonishi, Y. , Nishimura, H. and Iwanaga, S. (1994) Activation peptide of human factor LX has oligosaccharides O-glycosidically linked to threonine residues at 159 and 169. Biochemistry 33, 5167-5171 Agnelli, G. (1995) Anticoagulation in the prevention and treatment of pulmonary embolism. Chest 107 Suppl., 39S-44S Ahmad, S. S., Rawala, R., Cheung, W. F., Stafford, D. W. and Walsh, P. N. (1995) The role of the second growth-factor domain of human factor FXa in binding to platelets and in factor-X activation. Biochem. J. 310, 427—431 Ahmad, S. S., Rawala-Sheikh, R., Ashby, B. and Walsh, P. N. (1989a) Platelet receptor-mediated factor X activation by factor fXa. High-affinity factor IXa receptors induced by factor VIII are deficient on platelets in Scott syndrome. J. Clin. Invest. 84, 824-828 Ahmad, S. S., Rawala-Sheikh, R. and Walsh, P. N. (1989b) Comparative interactions of factor IX and factor IXa with human platelets. J. Biol. Chem. 264, 3244-3251 Ahmad, S. S., Rawala-Sheikh, R. and Walsh, P. N. (1989c) Platelet receptor occupancy with factor IXa promotes factor X activation. J. Biol. Chem. 264, 20012-20016 Ahmad, S. S., Rawala-Sheikh, R. and Walsh, P. N. (1992) Components and assembly of the factor X activating complex. Semin. Thromb. Hemost. 18, 311-320 Alt, F. W., Kellems, R. E . , Bertino, J. R. and Schimke, R. T. (1978) Selective multiplication of dihydrofolate reductase genes in methotrexate-resistant variants of cultured murine cells. J. Biol. Chem. 253, 1357-1370 Andersson, L . O. and Brown, J. E. (1981) Interaction of factor VHI-von Willebrand Factor with phospholipid vesicles. Biochem. J. 200, 161-167 Angeletti, B., Battiloro, E. , Pascale, E. and D'Ambrosio, E. (1995) Southern and northern blot fixing by microwave oven. Nucleic Acids Res. 23, 879-880 Antonarakis, S. E. (1995) Molecular genetics of coagulation factor VUI gene and hemophilia A. Thromb. Haemost. 74, 322-328 Arnljots, B., Bergqvist, D. and Dahlback, B. (1994) Inhibition of microarterial thrombosis by activated protein C in a rabbit model. Thromb. Haemost. 72, 415-^ +20 Arnljots, B. and Dahlback, B. (1995) Protein S as an in vivo cofactor to activated protein C in prevention of microarterial thrombosis in rabbits. J. Clin. Invest. 95, 1987-1993 Astermark, J., Bjork, I., Ohlin, A. K. and Stenflo, J. (1991) Structural requirements for C a 2 + binding to the y-carboxyglutamic acid and epidermal growth factor-like regions of factor LX. Studies using intact domains isolated from controlled proteolytic digests of bovine factor IX. J. Biol. Chem. 266, 2430-2437 Astermark, J., Hogg, P. J., Bjork, I. and Stenflo, J. (1992) Effects of y-carboxyglutamic acid and epidermal growth factor-like modules of factor IX on factor X activation. Studies using proteolytic fragments of bovine factor IX. J. Biol. Chem. 267, 3249-3256 Astermark, J., Hogg, P. J. and Stenflo, J. (1994) The y-carboxyglutamic acid and epidermal growth factor-like modules of factor IXa/3. Effects on the serine protease module and factor X activation. J. Biol. Chem. 269, 3682-3689 Astermark, J. and Stenflo, J. (1991) The epidermal growth factor-like domains of factor IX. Effect on blood clotting and endothelial cell binding of a fragment containing the epidermal growth factor-like domains linked to the 7-carboxyglutamic acid region. J. Biol. Chem. 266, 2438-2443 Atkins, J. S. and Ganz, P. R. (1992) The association of human coagulation factors VIII, IXa and X with phospholipid vesicles involves both electrostatic and hydrophobic interactions. Mol. Cell. Biochem. 112, 61-71 Bahou, W. F., Kutok, J. L . , Wong, A., Potter, C. L. and Coller, B. S. (1994) Identification of a novel thrombin receptor sequence required for activation-dependent responses. Blood 84, 4195-4202 Bajaj, S. P. and Birktoft, J. J. (1993) Human factor IX and factor IXa. Meth. Enzymol. 222, 96-128 Bajaj, S. P., Price, P. A. and Russell, W. A. (1982) Decarboxylation of y-carboxyglutamic acid residues in human prothrombin: stoichiometry of calcium binding to y-carboxyglutamic acid in prothrombin. J. Biol. Chem. 257, 3726-3731 Bajaj, S. P., Rapaport, S. I. and Brown, S. F. (1981a) Isolation and characterization of human factor VII. Activation of factor VII by factor X a . J. Biol. Chem. 256, 253-259 Bajaj, S. P., Rapaport, S. I. and Maki, S. L . (1985) A monoclonal antibody to factor IX that inhibits the factor VIII:Ca potentiation of factor X activation. J. Biol. Chem. 260, 11574-11580 Bajaj, S. P., Rapaport, S. I. and Prodanos, C. (1981b) A simplified procedure for purification of human prothrombin, factor IX and factor X. Prep. Biochem. 11, 397-412 Bajaj, S. P., Sabharwal, A. K., Gorka, J. and Birktoft, J. J. (1992) Antibody-probed conformational transitions in the protease domain of human factor IX upon calcium v binding and zymogen activation: putative high-affinity Ca2+-binding site in the protease domain. J. Biol. Chem. 222, 152-156 Bajzar, L . , Manuel, R. and Nesheim, M . E. (1995) Purification and characterization of TAFI, a thrombin-activable fibrinolysis inhibitor. J. Biol. Chem. 270, 14477-14484 Bajzar, L. , Nesheim, M . E. and Tracy, P. B. (1996) The profibrinolytic effect of activated protein C in clots formed from plasma is TAFI-dependent. Blood 88, 2093-2100 Bakker, H. M . , Tans, G., Janssen-Claessen, T., Thomassen, M . C. L. G. D., Hemker, H. C , Griffin, J. H. and Rosing, J. (1992) The effect of phospholipids, calcium ions and protein S on rate constants of human factor Va inactivation by activated protein C. Eur. J. Biochem. 208, 171-178 Baugh, R. J., Broze, G. J. J. and Krishnaswamy, S. (1998) Regulation of extrinsic pathway factor Xa formation by tissue factor pathway inhibitor. J. Biol. Chem. 273, 4378-4386 Baugh, R. J. and Krishnaswamy, S. (1996) Role of the activation peptide domain in human factor X activation by the extrinsic Xase complex. J. Biol. Chem. 271, 16126-16134 Bentley, A. K., Rees, D. J., Rizza, C. and Brownlee, G. G. (1986) Defective propeptide processing of blood clotting factor FX caused by mutation of arginine to glutamine at position -4. Cell 45, 343-348 Berkner, K. L . (1993) Expression of recombinant vitamin K-dependent proteins in mammalian cells: factors IX and VII. Meth. Enzymol. 222, 450^177 Bertina, R. M . , Koeleman, B. P., Koster, T., Rosendaal, F. R., Dirven, R. J., de Ronde, H., van der Velden, P. A. and Reitsma, P. H. (1994) Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 369, 64-67 Betz, A., Vlasuk, G. P., Bergum, P. W. and Krishnaswamy, S. (1997) Selective inhibition of the prothrombinase complex: factor Va alters macromolecular recognition of a tick anticoagulant peptide mutant by factor Xa. Biochemistry 36, 181-191 Bharadwaj, D., Harris, R. J., Kisiel, W. and Smith, K. J. (1995) Enzymatic removal of sialic acid from human factor IX and factor X has no effect on their coagulant activity. J. Biol. Chem. 270, 6537-6542 Biemond, B. J., Friederich, P. W., Levi, M . , Vlasuk, G. P., Buller, H. R. and ten Cate, J. W. (1996) Comparison of sustained antithrombotic effects of inhibitors of thrombin and factor Xa in experimental thrombosis. Circulation 93, 153-160 Blajchman, M . A., Austin, R. C , Feraandez-Rachubinski, F. and Sheffield, W. P. (1992) Molecular basis of inherited human antithrombin deficiency. Blood 80, 2159-2171 Blomback, B. (1996) Fibrinogen and fibrin—proteins with complex roles in hemostasis and thrombosis. Thromb. Res. 83, 1-75 Blomback, B. and Blomback, M . (1972) The molecular structure of fibrinogen. Ann. N.Y. Acad. Sci. 202, 77-97 Bode, W., Brandstetter, H., Mather, T. and Stubbs, M . T. (1997) Comparative analysis of haemostatic proteinases: structural aspects of thrombin, factor Xa, factor IXa and protein C. Thromb. Haemost. 78, 501-511 Bradford, M . M . (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254 Brandstetter, H., Bauer, M . , Huber, R., Lollar, P. and Bode, W. (1995) X-ray structure of clotting factor LXa: active site and module structure related to Xase activity and hemophilia B. Proc. Natl. Acad. Sci. USA 92, 9796-800 Bresnahan, P. A., Leduc, R., Thomas, L. , Thorner, J., Gibson, H. L . , Brake, A. J., Barr, P. J. and Thomas, G. (1990) Human fur gene encodes a yeast KEX2-like endoprotease that cleaves pro-/3-NGF in vivo. J. Cell Biol. I l l , 2851-2859 Brigden, M . L. (1996) Oral anticoagulant therapy. Postgrad. Med. 99, 81-102 Bristol, J. A., Freedman, S. J., Furie, B. C. and Furie, B. (1994) Profactor IX: the propeptide inhibits binding to membrane surfaces and activation by factor XIa. Biochemistry 33, 14136-14143 Broze, G. J., Jr. (1992) The role of tissue factor pathway inhibitor in a revised coagulation cascade. Semin. Hematol. 29, 159-169 Broze, G. J. J. (1995) Tissue factor pathway inhibitor and the revised theory of coagulation. Ann. Rev. Med. 46, 103-112 Cappiello, M . , Vilardo, P. G., Lippi, A., Criscuoli, M . , Del Corso, A. and Mura, U. (1996) Kinetics of human thrombin inhibition by two novel peptide inhibitors (Hirunorm IV and Hirunorm V). Biochem. Pharmacol. 52, 1141-1146 Carlisle, T. L. , Shah, D. V. and Suttie, J. W. (1980) Species variation, induction, and subcellular localization of the liver vitamin K-dependent carboxylase. In Vitamin K Metabolism and Vitamin K-dependent Proteins, Suttie, J. W., ed., University Park Press, Baltimore, Maryland, pp. 443-449 Carrell, R. and Travis, A. (1985) Ofj-antitrypsin and the serpins: variation and countervariation. Trends Biochem. Sci. 10, 20-24 Carter, C. J. (1996) New developments in acute anticoagulant therapy: what improvements over traditional heparin are on the horizon? Postgrad. Med. 99, 129-136 Cassen, J. and Malhotra, O. P. (1980) Isolation of multiple forms of dicoumarol-induced prothrombins from bovine liver. In Vitamin K Metabolism and Vitamin K-dependent Proteins, Suttie, J. W., ed., University Park Press, Baltimore, Maryland, pp. 388-391 Castelino, D. J. and Salem, H. H. (1997) Natural anticoagulants and the liver. J. Gastroenterol. Hepatol. 12, 77-83 Chaing, S., Clarke, B., Sridhara, S., Chu, K., Friedman, P., VanDusen, W., Roberts, H. R., Blajchman, M . , Monroe, D. M . and High, K. A. (1994) Severe factor VII deficiency caused by mutations abolishing the cleavage site for activation and altering binding to tissue factor. Blood 83, 3524-3535 Chattopadhyay, A., James, H. L. and Fair, D. S. (1992) Molecular recognition sites on factor Xa which participate in the prothrombinase complex. J. Biol. Chem. 267, 12323-12329 Chen, C. A. and Okayama, H. (1988) Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA. BioTechniques 6, 632-638 Cheung, W. F., van den Born, J., Kuhn, K., Kjellen, L . , Hudson, B. G. and Stafford, D. W. (1996) Identification of the endothelial cell binding site for factor IX. Proc. Natl. Acad. Sci. USA 93, 11068-11073 Christiansen, W. T. and Castellino, F. J. (1994) Properties of recombinant chimeric human protein C and activated protein C containing the y-carboxyglutamic acid and trailing helical stack domains of protein C replaced by those of human coagulation factor IX. Biochemistry 33, 5901-5911 Christiansen, W. T., Tulinsky, A. and Castellino, F. J. (1994) Functions of individual y-carboxyglutamic acid (Gla) residues of human protein C. Determination of functionally nonessential Gla residues and correlations with their mode of binding to calcium. Biochemistry 33, 14993-15000 Christophe, O. D., Lenting, P. J., Kolkman, J. A., Brownlee, G. G. and Mertens, K. (1998) Blood coagulation factor IX residues Glu 7 8 and Arg 9 4 provide a link between both epidermal growth factor-like domains that is crucial in the interaction with factor VIII light chain. J. Biol. Chem. 273, 222-227 Church, F. C , Shirk, R. A. and Phillips, J. E. (1995) Heparin cofactor II. In Molecular Basis of Thrombosis and Hemostasis, High, K. A. and Roberts, H. R., ed., Marcel Dekker, Inc., New York, pp. 379-392 Collen, D. and Lijnen, H. R. (1987) Fibrinolysis and the control of hemostasis. In The Molecular Basis of Blood Diseases, Stamatoyannopoulos, G., Nienhuis, A. W., Leder, P. and Majerus, P. W., ed., W. B. Saunders Co., Philadelphia, pp. 662-688 Colpitts, T. L . and Castellino, F. J. (1994) Calcium and phospholipid binding properties of synthetic y-carboxyglutamic acid-containing peptides with sequence counterparts in human protein C. Biochemistry 33, 3501-3508 Comp, P. C , Doray, D., Patton, D. and Esmon, C. T. (1986) An abnormal plasma distribution of protein S occurs in functional protein S deficiency. Blood 67, 504-508 Comp, P. C. and Esmon, C. T. (1981) Generation of fibrinolytic activity by infusion of activated protein C into dogs. J. Clin. Invest. 68, 1221-1228 Comp, P. C. and Esmon, C. T. (1984) Recurrent venous thromboembolism in patients with a partial deficiency of protein S. N. Engl. J. Med. 311, 1525-1528 Cote, H. C , Stevens, W. K., Bajzar, L. , Banfield, D. K., Nesheim, M . E. and MacGillivray, R. T. (1994) Characterization of a stable form of human meizothrombin derived from recombinant prothrombin (R155A, R271A, R284A). J. Biol. Chem. 269, 11374-11380 Coughlin, S. R., Vu, T.-K. H., Hung, D. T. and Wheaton, V. I. (1992) Characterization of a functional thrombin receptor. J. Clin. Invest. 89, 351-355 Crabtree, G. R. (1987) The molecular biology of fibrinogen. In The Molecular Basis of Blood Diseases, Stamatoyannopoulos, G., Nienhuis, A. W., Leder, P. and Majerus, P. W., ed., W. B. Saunders Co., Philadelphia Dahlback, B. (1991) Protein S and C4b-binding protein: components involved in the regulation of the protein C anticoagulant system. Thromb. Haemost. 66, 49-61 Dahlback, B. (1995a) Molecular genetics of venous thromboembolism. Ann. Med. 27, 187-192 Dahlback, B. (1995b) The protein C anticoagulant system: inherited defects as basis for venous thrombosis. Thromb. Res. 77, 1-43 Dahlback, B. (1995c) Resistance to activated protein C, the A r g 5 0 6 to Gin mutation in the factor V gene, and venous thrombosis. Functional tests and DNA-based assays, pros and cons. Thromb. Haemost. 73, 739-742 Dahlback, B., Carlsson, M . and Svensson, P. J. (1993) Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: prediction of a cofactor to activated protein C. Proc. Natl. Acad. Sci. USA 90, 1004-1008 Dahlback, B. and Hildebrand, B. (1994) Inherited resistance to activated protein C is corrected by anticoagulant cofactor activity found to be a property of factor V. Proc. Natl. Acad. Sci. USA 91, 1396-1400 Dahlback, B., Hildebrand, B. and Linse, S. (1990) Novel type of very high affinity calcium-binding sites in /J-hydroxyasparagine-containing epidermal growth factor-like domains in vitamin K-dependent protein S. J. Biol. Chem. 265, 18481-18489 Dahlback, B., Lundwall, A. and Stenflo, J. (1986a) Localization of thrombin cleavage sites in the amino-terminal region of bovine protein S. J. Biol. Chem. 261, 5111-5115 Dahlback, B., Lundwall, A. and Stenflo, J. (1986b) Primary structure of bovine vitamin K-dependent protein S. Proc. Natl. Acad. Sci. USA 83, 4199^1203 Davie, E. W. (1995) Biochemical and molecular aspects of the coagulation cascade. Thromb. Haemost. 74, 1-6 Davie, E. W., Fujikawa, K. and Kisiel, W. (1991) The coagulation cascade: initiation, maintenance, and regulation. Biochemistry 30, 10363-10370 Davie, E. W. and Ratnoff, O. D. (1964) Waterfall sequence for intrinsic blood clotting. Science 145, 1310-1312 Desai, U. J. and Pfaffle, P. K. (1995) Single-step purification of a thermostable DNA polymerase expressed in Escherichia coli. BioTechniques 19, 780-784 Di Scipio, R. G. and Davie, E. W. (1979) Characterization of protein S, a y-carboxyglutamic acid containing protein from bovine and human plasma. Biochemistry 18, 899-904 Di Scipio, R. G., Hermodson, M . A. and Davie, E. W. (1977a) Activation of human factor X (Stuart factor) by a protease from Russell's viper venom. Biochemistry 16, 5253-5260 Di Scipio, R. G., Hermodson, M . A., Yates, S. G. and Davie, E. W. (1977b) A comparison of human prothrombin, factor IX (Christmas factor), factor X (Stuart factor), and protein S. Biochemistry 16, 698-706 Di Scipio, R. G., Kurachi, K. and Davie, E. W. (1978) Activation of human factor IX (Christmas factor). J. Clin. Invest. 61, 1528-1538 Dittman, W. A. and Majerus, P. W. (1990) Structure and function of thrombomodulin: a natural anticoagulant. Blood 75, 329-336 Diuguid, D. L . , Rabiet, M . J., Furie, B. C , Liebman, H. A. and Furie, B. (1986) Molecular basis of hemophilia B: a defective enzyme due to an unprocessed propeptide is caused by a point mutation in the factor IX precursor. Proc. Natl. Acad. Sci. USA 83, 5803-5807 Doolittle, R. F. and Feng, D. F. (1987) Reconstructing the evolution of vertebrate blood coagulation from a consideration of the amino acid sequences of clotting proteins. Cold Spring Harbor Symp. Quant. Biol. 52, 869-874 Drakenberg, T., Fernlund, P., Roepstorff, P. and Stenflo, J. (1983) /?-hydroxyaspartic acid in vitamin K-dependent protein C. Proc. Natl. Acad. Sci. USA 80, 1802-1806 Drakenberg, T., Sunnerhagen, M . and Stenflo, J. (1996) Generation of calcium-binding sites in proteins by formation of ycarboxyglutamic acid and /?-hydroxyaspartic acid//3-hydroxyasparagine. In Mechanisms of metallocenter assembly, Hausinger, R. P., Eichhorn, G. L . and Marzilli, L. G., ed., V C H Publishers, Inc., New York, pp. 41-76 Drews, R., Paleyanda, R. K., Lee, T. K., Chang, R. R., Rehemtulla, A., Kaufman, R. J., Drohan, W. N. and Lubon, H. (1995) Proteolytic maturation of protein C upon engineering the mouse mammary gland to express furin. Proc. Natl. Acad. Sci. USA 92, 10462-10466 Dreyfus, M . , Magny, J. F., Bridey, F., Schwarz, H. P., Planche, C , Dehan, M . and Tchernia, G. (1991) Treatment of homozygous protein C deficiency and neonatal purpura fulminans with a purified protein C concentrate. New Engl. J. Med. 325, 1565-1568 Dreyfus, M . , Masterson, M . , David, M . , Rivard, G. E. , Muller, F . -M. , Kreuz, W., Beeg, T., Minford, A., Allgrove, J., Cohen, J. D., Cristoph, J., Bergmann, F., Mitchell, V. E. , Haworth, C , Nelson, K. and Schwarz, H. P. (1995) Replacement therapy with a monoclonal antibody purified protein C concentrate in newborns with severe congenital protein C deficiency. Semin. Thromb. Hemost. 21, 371-381 Duffy, E. J. and Lollar, P. (1992) Intrinsic pathway activation of factor X and its activation peptide-deficient derivative, factor Xdes-143-191- J- Biol. Chem. 267, 7821-7827 Duffy, E . J., Parker, E. T., Mutucumarana, V. P., Johnson, A. E. and Lollar, P. (1992) Binding of factor Villa and factor VIII to factor IXa on phospholipid vesicles. J. Biol. Chem. 267, 17006-17011 Eaton, D., Rodriguez, H. and Vehar, G. A. (1986) Proteolytic processing of human factor VIII. Correlation of specific cleavages by thrombin, factor Xa, and activated protein C with activation and inactivation of factor VIII coagulant activity. Biochemistry 25, 505-512 Edens, R. E. , Fromm, J. R., Fromm, S. J., Linhardt, R. J. and Weiler, J. M . (1995) Two-dimensional affinity resolution electrophoresis demonstrates that three distinct heparin populations interact with antithrombin III. Biochemistry 34, 2400-2407 Elisen, M . G. L . M . , von dem Borne, P. A. K., Bouma, B. N. and Meijers, J. C. M . (1998) Protein C inhibitor acts as a procoagulant by inhibiting the thrombomodulin-induced activation of protein C in human plasma. Blood 91, 1542-1547 Engelke, D. R., Krikos, A., Bruck, M . E. and Ginsburg, D. (1990) Purification of Thermus aquaticus DNA polymerase expressed in E. coii. Anal. Biochem. 191, 396-400 Esmon, C. T. (1984) Protein C. Prog. Hemost. Thromb. 7, 25-54 Esmon, C. T. (1989) The roles of protein C and thrombomodulin in the regulation of blood coagulation. J. Biol. Chem. 264, 4743^1746 Esmon, C. T. (1992) The protein C anticoagulant pathway. Arterioscler. Thromb. 12, 135-145 Esmon, C. T., Taylor, F. B., Jr. and Snow, T. R. (1991) Inflammation and coagulation: linked processes potentially regulated through a common pathway mediated by protein C. Thromb. Haemost. 66, 160-165 Esmon, N. L. , DeBault, L . E . and Esmon, C. T. (1983) Proteolytic formation and properties of y-carboxyglutamic acid-domainless protein C. J. Biol. Chem. 258, 5548-5553 Esmon, N. L. , Owen, W. G. and Esmon, C. T. (1982) Isolation of a membrane-bound cofactor for thrombin-catalyzed activation of protein C. J. Biol. Chem. 257, 859-864 Espaha, F., Gruber, A., Heeb, M . J., Hanson, S. R., Harker, L. A. and Griffin, J. H. (1991) In vivo and in vitro complexes of activated protein C with two inhibitors in baboons. Blood 77, 1754-1760 Fay, P. J. (1993) Factor VIII structure and function. Thromb. Haemost. 70, 63-67 Fay, P. J., Beattie, T., Huggins, C. F. and Regan, L. M . (1994) Factor Vil la A2 subunit residues 558-565 represent a factor IXa interactive site. J. Biol. Chem. 269, 20522-20527 Fay, P. J., Beattie, T. L. , Regan, L. M . , O'Brien, L . M . and Kaufman, R. J. (1996) Model for the factor VIHa-dependent decay of the intrinsic factor Xase. Role of subunit dissociation and factors IXa-catalyzed proteolysis. J. Biol. Chem. 271, 6027-6032 Fay, P. J., Haidaris, P. J. and Smudzin, T. M . (1991a) Human factor VIII a subunit structure. Reconstitution of factor VIIIa from the isolated A1/A3-C1-C2 dimer and A2 subunit. J. Biol. Chem. 266, 8957-8962 Fay, P. J. and Koshibu, K. (1998) The A2 subunit of factor Villa modulates the active site of factor IXa. J. Biol. Chem. 273, 19049-19054 Fay, P. J. and Smudzin, T. M . (1992) Characterization of the interaction between the A2 subunit and A1/A3-C1-C2 dimer in human factor VIIIa. J. Biol. Chem. 267, 13246-13250 Fay, P. J., Smudzin, T. M . and Walker, F. J. (1991b) Activated protein C-catalyzed inactivation of human factor VUI and factor Villa. Identification of cleavage sites and correlation of proteolysis with cofactor activity. J. Biol. Chem. 266, 20139-20145 Ferland, G., Sadowski, J. A. and O'Brien, M . E. (1993) Dietary induced subclinical vitamin K deficiency in normal human subjects. J. Clin. Invest. 91, 1761-1768 Foster, D. and Davie, E. W. (1984) Characterization of a cDNA coding for human protein C. Proc. Natl. Acad. Sci. USA 81, 4766-47670 Foster, D. C , Holly, R. D., Sprecher, C. A., Walker, K. M . and Kumar, A. A. (1991) Endoproteolytic processing of the human protein C precursor by the yeast Kex2 endopeptidase coexpressed in mammalian cells. Biochemistry 30, 367-372 Foster, D. C , Rudinski, M . S., Schach, B. G., Berkner, K. L. , Kumar, A. A., Hagen, F. S., Sprecher, C. A., Insley, M . Y. and Davie, E. W. (1987) Propeptide of human protein C is necessary for y-carboxylation. Biochemistry 26, 7003-7011 Foster, D. C , Sprecher, C. A., Holly, R. D., Gambee, J. E. , Walker, K. M . and Kumar, A. A. (1990a) Endoproteolytic processing of the dibasic cleavage site in the human protein C precursor in transfected mammalian cells: effects of sequence alterations on efficiency of cleavage. Biochemistry 29, 347-354 Foster, D. C , Yoshitake, S. and Davie, E. W. (1985) The nucleotide sequence of the gene for human protein C. Proc. Natl. Acad. Sci. USA 82, 4673^1677 Foster, P. A., Fulcher, C. A., Houghten, R. A. and Zimmerman, T. S. (1988) An immunogenic region within residues Val 1 6 7 0 - G l u 1 6 8 4 of the factor VUI light chain induces antibodies which inhibit binding of factor VIII to von Willebrand factor. J. Biol. Chem. 263, 5230-5234 Foster, P. A., Fulcher, C. A., Houghten, R. A. and Zimmerman, T. S. (1990b) Synthetic factor VTTT peptides with amino acid sequences contained within the C2 domain of factor VIII inhibit factor VIII binding to phosphatidylserine. Blood 75, 1999-2004 Freedman, S. J., Blostein, M . D., Baleja, J. D., Jacobs, M . , Furie, B. C. and Furie, B. (1996) Identification of the phospholipid binding site in the vitamin K-dependent blood coagulation protein factor IX. J. Biol. Chem. 271, 16227-16236 Freedman, S. J., Furie, B. C , Furie, B. and Baleja, J. D. (1995) Structure of the metal-free 7-carboxyglutamic acid-rich membrane binding region of factor IX by two-dimensional NMR spectroscopy. J. Biol. Chem. 270, 7980-7987 Friezner Degen, S. J. (1995) Prothrombin. In Molecular Basis of Thrombosis and Hemostasis, High, K. A. and Roberts, H. R., ed., Marcel Dekker, Inc., New York, pp. 75-99 Fujikawa, K., Legaz, M . E. and Davie, E. W. (1972) Bovine factor X i and X2 (Stuart factor). Isolation and characterization. Biochemistry 11,4882-4891 Fung, M . R., Hay, C. W. and MacGillivray, R. T. A. (1985) Characterization of an almost full-length cDNA coding for human blood coagulation factor X. Proc. Natl. Acad. Sci. USA 82, 3591-3595 Furie, B., Bing, D. H. , Feldmann, R. J., Robison, D. J., Burnier, J. P. and Furie, B. C. (1982) Computer-generated models of blood coagulation factor Xa, factor IXa, and thrombin based upon structural homology with other serine proteases. J. Biol. Chem. 257, 3875-3882 Furie, B. and Furie, B. C. (1988) The molecular basis of blood coagulation. Cell 53, 505-518 Furie, B., Greene, E. and Furie, B. C. (1977) Syndrome of acquired factor X deficiency and systemic amyloidosis: in vivo studies of the metabolic fate of factor X. N. Engl. J. Med. 297, 81-85 Furie, B. C. and Furie, B. (1976) Coagulant protein of Russell's viper venom. Meth. Enzymol. 45, 191-205 Gailani, D. and Broze, G. J., Jr. (1993) Factor XH-independent activation of factor XI in plasma: effects of sulfatides on tissue factor-induced coagulation. Blood 82, 813-819 Galeffi, P. and Brownlee, G. G. (1987) The propeptide region of clotting factor IX is a signal for a vitamin K dependent carboxylase: evidence from protein engineering of amino acid -4. Nucleic Acids Res. 15, 9505-9513 Gandrille, S., Borgel, D., Eschwege-Gufflet, V. , Aillaud, M . , Dreyfus, M . , Matheron, C , Gaussem, P., Abgrall, J. F., Jude, B., Sie, P., Toulon, P. and Aiach, M . (1995) Identification of 15 different candidate causal point mutations and three polymorphisms in 19 patients with protein S deficiency using a scanning method for the analysis of the protein S active gene. Blood 85, 130-138 Geng, J.-P., Christiansen, W. T., Plow, E. F. and Castellino, F. J. (1995) Transfer of specific endothelial cell-binding properties from the procoagulant protein human factor IX into the anticoagulant protein human protein C. Biochemistry 34, 8449-8457 Geng, J. P. and Castellino, F. J. (1996) The propeptides of human protein C, factor VII, and factor IX are exchangeable with regard to directing gamma-carboxylation of these proteins. Thromb. Haemost. 76, 205-207 Geng, J. P. and Castellino, F. J. (1997) Properties of a recombinant chimeric protein in which the gamma-carboxyglutamic acid and helical stack domains of human anticoagulant protein C are replaced by those of human coagulation factor VII. Thromb. Haemost. 77, 926-933 o Gershagen, S., Fernlund, P. and Lundwall, A. (1987) A cDNA coding for human sex hormone binding globulin: homology to vitamin K-dependent protein S. FEBS Lett. 220, 129-135 Gianelli, F., Green, P. M . , High, K. A., Sommer, S., Lillicrap, D. P., Ludwig, M . , Olek, K., Reitsma, P. H., Goossens, M . , Yoshioka, A. and Brownlee, G. G. (1991) Haemophilia B: database of point mutations and short additions and deletions — second edition. Nucleic Acids Res. 19, 2193-2219 Gierash, L . M . (1989) Signal sequences. Biochemistry 28, 923-930 Gilbert, G. E. and Baleja, J. D. (1995) Membrane-binding peptide from the C2 domain of factor VIII forms an amphipathic structure as determined by NMR spectroscopy. Biochemistry 34, 3022-3031 Ginsberg, J. S. (1996) Management of venous thromboembolism. N. Engl. J. Med. 335, 1816-1828 Gowda, D. C , Jackson, C. M . , Hensley, P. and Davidson, E. A. (1994) Factor X-activating glycoprotein of russell's viper venom. Polypeptide composition and characterization of the carbohydrate moieties. J. Biol. Chem. 269, 10644-10650 Goyette, R. E. (1997) An approach to patients with disorders of hemostasis. In Hematology. A Comprehensive Guide to the Diagnosis and Treatment of Blood Disorders, ed., Practice Management Information Corporation, Los Angeles, pp. 731-763 Greengard, J. S., Eichinger, S., Griffin, J. H. and Bauer, K. A. (1994a) Brief report: variability of thrombosis among homozygous siblings with resistance to activated protein C due to an Arg—>Gln mutation in the gene for factor V. N. Engl. J. Med. 331, 1559-1562 Greengard, J. S., Fernandez, J. A., Radtke, K.-P. and Griffin, J. H. (1995) Identification of candidate residues for interaction of protein S with C4b binding protein and activated protein C: Biochem. J. 305, 397-403 Greengard, J. S., Sun, X., Xu, X., Fernandez, J. A., Griffin, J. H. and Evatt, B. (1994b) Activated protein C resistance caused by Arg506Gln mutation in factor Va. Lancet 343, 1361-1362 Greffe, B. S., Manco-Johnson, M . J. and Marlar, R. A. (1989) Molecular forms of human protein C: comparison and distribution in human adult plasma. Thromb. haemost. 62, 902-905 Griffin, J. H. , Mosher, D. F., Zimmerman, T. S. and Kleiss, A. J. (1982) Protein C, an antithrombotic protein, is reduced in hospitalized patients with intravascular coagulation. Blood 60, 261-264 Grinnell, B. W., Berg.D.T., Walls, J. and Yan, S. B. (1987) Trans-activated expression of fully gamma-carboxylated recombinant human protein C, an antithrombotic factor. Bio/Technology 5, 1189-1192 Grinnell, B. W., Walls, J. D., Berg, D. T., Boston, J., McClure, D. B. and Yan, S. B. (1989) Expression, characterization, and processing of recombinant human protein C from adenovirus-transformed cell lines. In Genetics and Molecular Biology of Industrial Microorganisms, Hersberger, C , Hegman, G. and Queener, S. W., ed., American Society for Microbiology, Bloomington, Indiana, pp. 226-237 Grinnell, B. W., Walls, J. D. and Gerlitz, B. (1991) Glycosylation of human protein C affects its secretion, processing, functional activities, and activation by thrombin. J. Biol. Chem. 226, 9778-9785 Gruber, A., Griffin, J. H. , Harker, L. A. and Hanson, S. R. (1989) Inhibition of platelet-dependent thrombus formation by human activated protein C in a primate model. Blood 73, 639-642 Gruber, A., Hanson, S. R., Kelly, A. B., Yan, B. S., Bang, N., Griffin, J. H. and Harker, L. A. (1990) Inhibition of thrombus formation by activated recombinant protein C in a primate model of arterial thrombosis. Circulation 82, 578-585 Hackeng, T. M . , Hessing, M . , van't Veer, C , Meijer-Huizinga, F., Meijers, J. C , de Groot, P. G., van Mourik, J. A. and Bouma, B. N. (1993) Protein S binding to human endothelial cells is required for expression of cofactor activity for activated protein C. J. Biol. Chem. 268, 3993-4000 Handford, P., Downing, A. K., Rao, Z., Hewett, D. R., Sykes, B. C. and Kielty, C. M . (1995) The calcium binding properties and molecular organization of epidermal growth factor-like domains in human fibrillin-1. J. Biol. Chem. 270, 6751-6756 Handford, P. A., Mayhew, M . , Baron, M . , Winship, P. R., Campbell, I. D. and Brownlee, G. G. (1991) Key residues involved in calcium-binding motifs in EGF-like domains. Nature 351, 164-167 Harker, L . A., Hanson, S. R. and Kelly, A. B. (1997) Antithrombotic strategies targeting thrombin activities, thrombin receptors and thrombin generation. Thromb. Haemost. 78, 736-741 Harris, K. W. and Esmon, C. T. (1985) Protein S is required for bovine platelets to support activated protein C binding and activity. J. Biol. Chem. 260, 2007-2010 Hauschka, P. V., Henson, E. B. and Gallop, P. M . (1980) Quantitative analysis and comparative decarboxylation of aminomalonic acid, /3-carboxyaspartic acid, and y-carboxyglutamic acid. Anal. Biochem. 108, 57-63 He, X., Shen, L. and Dahlback, B. (1995) Expression and functional characterization of chimeras between human and bovine vitamin-K-dependent protein-S-defining modules important for the species specificity of the activated protein C cofactor activity. Eur. J. Biochem. 227, 433^140 Heeb, M . J. and Griffin, J. H. (1988) Physiologic inhibition of human activated protein C by ax-antitrypsin. J. Biol. Chem. 263, 11613-11616 Heeb, M . J., Gruber, A. and Griffin, J. H. (1990) Identification of divalent metal ion-dependent inhibition of activated protein C by o^-macroglobulin and o^-antiplasmin in blood and comparisons to inhibition of factor Xa, thrombin, and plasmin. J. Biol. Chem. 266, 17606-17612 Heeb, M . J., Kojima, Y., Greengard, J. S. and Griffin, J. H. (1995) Activated protein C resistance: molecular mechanisms based on studies using purified Gln506-factor V. Blood 85,3405-3411 Heeb, M . J., Mesters, R. M . , Tans, G., Rosing, J. and Griffin, J. H. (1993) Binding of protein S to factor Va associated with inhibition of prothrombinase that is independent of activated protein C. J. Biol. Chem. 268, 2872-2877 Heeb, M . J., Rosing, J., Bakker, H. M . , Fernandez, J. A., Tans, G. and Griffin, J. H. (1994) Protein S binds to and inhibits factor Xa. Proc. Natl. Acad. Sci. USA 91, 2728-2732 Hertzberg, M . S., Ben-Tal, O., Furie, B. and Furie, B. C. (1992) Construction, expression, and characterization of a chimera of factor DC and factor X. The role of the second epidermal growth factor domain and serine protease domain in factor Va binding. J. Biol. Chem. 267, 14759-66 Hill-Eubanks, D. C , Parker, C. G. and Lollar, P. (1989) Differential proteolytic activation of factor VHI-von Willebrand factor complex by thrombin. Proc. Natl. Acad. Sci. USA 86, 6508-6512 Hoffman, M . , Monroe, D. M . , Oliver, J. A. and Roberts, H. R. (1995) Factors IXa and Xa play distinct roles in tissue factor-dependent initiation of coagulation. Blood 86, 1794-1801 Hogg, P. J., Ohlin, A. K. and Stenflo, J. (1992) Identification of structural domains in protein C involved in its interaction with thrombin-thrombomodulin on the surface of endothelial cells. J. Biol. Chem. 267, 703-706 Hoogendorn, H. , Toh, C. H. , Nesheim, M . E . and Giles, A. R. (1991) a2-Macroglobulin binds and inhibits activated protein C. Blood 78, 2283-2290 Hoskins, J., Norman, D. K., Beckmann, R. J. and Long, G. L . (1987) Cloning and characterization of human liver cDNA encoding a protein S precursor. Proc. Natl. Acad. Sci. USA 84, 349-353 Huber, P., Schmitz, T., Griffin, J., Jacobs, M . , Walsh, C , Furie, B. and Furie, B. C. (1990) Identification of amino acids in the 7-carboxylation recognition site on the propeptide of prothrombin. J. Biol. Chem. 265, 12467-73 Hull, R. D. and Pineo, G. F. (1994) Low molecular weight heparin treatment of venous thromboembolism. Prog. Cardiovasc. Dis. 47, 71-78 Hultin, M . B. (1982) Role of human factor VIII in factor X activation. J. Clin. Invest. 69, 950-958 Husten, E. J., Esmon, C. T. and Johnson, A. E. (1987) The active site of blood coagulation factor Xa: its distance from the phospholipid surface and its conformational sensitivity to components of the prothrombinase complex. J. Biol. Chem. 262, 12953-12961 lino, M . , Takeya, H. , Nishioka, J., Nakagaki, T., Tamura, K. and Suzuki, K. (1994) The role of human factor X activation peptide in activation of factor X by factor IXa. J. Biochem. 116, 335-340 Inoue, K. and Morita, T. (1993) Identification of 0-linked oligosaccharide chains in the activation peptides of blood coagulation factor X. The role of the carbohydrate moieties in the activation of factor X. Eur. J. Biochem. 218, 153-163 Inoue, K., Shimada, H., Ueba, J., Enomoto, S., Tanaka-Saisaka, Y., Kubota, T., Koyama, M . and Morita, T. (1996) High-affinity calcium-binding site in the 7-carboxyglutamic acid domain of bovine factor VII. Biochemistry 35, 13826-13832 Iwanaga, S. (1993) Primitive coagulation systems and their message to modern biology. Thromb. Haemost. 70, 48-55 Jackson, C. M . and Nemerson, Y. (1980) Blood Coagulation. Ann. Rev. Biochem. 49, 765-811 Jacobs, M . , Freedman, S. J., Furie, B. C. and Furie, B. (1994) Membrane binding properties of the Factor IX ycarboxyglutamic acid-rich domain prepared by chemical synthesis. J. Biol. Chem. 269, 25494-25501 Jalbert, L. R., Chan, J. C. Y., Christiansen, W. T. and Castellino, F. J. (1996) The hydrophobic nature of residue-5 of human protein C is a major determinant of its functional interactions with acidic phospholipid vesicles. Biochemistry 35, 7093-7099 Jesty, J. and Esnouf, P. (1973) The preparation of activated factor X and its action on prothrombin. Biochem. J. 131, 791-799 Jesty, J., Spencer, A. K., Nakashima, Y., Nemerson, Y. and Konigsberg, W. (1975) The activation of coagulation factor X. Identity of cleavage sites in the alternative activation pathways and characterization of the COOH-terminal peptide. J. Biol. Chem. 250, 4497^504 Jesty, J., Spencer, A. K. and Nemerson, Y. (1974) The mechanism of action of factor X. Kinetic control of alternative pathways leading to the formation of activated factor X. J. Biol. Chem. 249, 5614-5622 Jorgensen, M . J., Cantor, A. B., Furie, B. C , Brown, C. L. , Shoemaker, C. B. and Furie, B. (1987) Recognition site directing vitamin K-dependent y-carboxylation resides on the propeptide of factor IX. Cell 48, 185-191 Kalafatis, M . , Bertina, R. M . , Rand, M . D. and Mann, K. G. (1995) Characterization of the molecular defect in factor V R 5 0 6 Q . J. Biol. Chem. 270, 4053^1057 Kalafatis, M . , Krishnaswamy, S., Rand, M . D. and Mann, K. G. (1993) Factor V. Meth. Enzymol. 222, 224-237 Kalafatis, M . , Rand, M . D. and Mann, K. G. (1994a) The mechanism of inactivation of human factor V and human factor Va by activated protein C. J. Biol. Chem. 269, 31869-31880 Kalafatis, M . , Xue, J., Lawler, C. M . and Mann, K. G. (1994b) Contribution of the heavy and light chains of factor Va to the interaction with factor Xa. Biochemistry 33, 6538-6545 Kane, W. H. and Davie, E. W. (1988) Blood coagulation factors V and VIII: structural and functional similarities and their relationship to hemorrhagic and thrombotic disorders. Blood 71, 539-555 Kazama, Y., Pastuszyn, A., Wildgoose, P., Hamamoto, T. and Kisiel, W. (1993) Isolation and characterization of proteolytic fragments of human factor Vila which inhibit the tissue factor-enhanced amidolytic activity of factor Vila. J. Biol. Chem. 268, 16231-16240 Kim, D. J., Girolami, A. and James, H. L. (1996) Characterization of recombinant human coagulation factor Xpnuii- Thromb. Haemost. 75, 313-317 Kim, D. J., Thompson, A. R. and James, H. L . (1995) Factor XKetchikan: A variant molecule in which Gly replaces a Gla residue at position 14 in the light chain. Hum. Genet. 95, 212-214 Kisiel, W. (1979) Human plasma protein C: isolation, characterization, and mechanism of activation by ce-thrombin. J. Clin. Invest. 64, 761-769 Kisiel, W., Canfield, W. M . , Ericcson, L. H. and Davie, E. W. (1977) Anticoagulant properties of bovine plasma protein C following activation by thrombin. Biochemistry 16, 5824-5831 Kisiel, W., Ericcson, L. H. and Davie, E. W. (1976a) Proteolytic activation of protein C from bovine plasma. Biochemistry 15, 4893—4900 Kisiel, W., Hermodson, M . A. and Davie, E. W. (1976b) Factor X activating enzyme from Russell's viper venom: isolation and characterization. Biochemistry 15, 4901-4906 Koedam, J. A., Hamer, R. J., Beeser-Visser, N. H., Bouma, B. N. and Sixma, J. J. (1990) The effect of von Willebrand factor on activation of factor VIII by factor Xa. Eur. J. Biochem. 189, 229-234 Koedam, J. A., Meijers, J. C , Sixma, J. J. and Bouma, B. N. (1988) Inactivation of human factor VHI by activated protein C. Cofactor activity of protein S and protective effect of von Willebrand factor. J. Clin. Invest. 82, 1236-1243 Kojima, Y., Heeb, M . J., Gale, A. J., Hackeng, T. M . and Griffin, J. H. (1998) Binding site for blood coagulation Xa involving residues 311-325 in factor Va. J. Biol. Chem. 273, 14900-14905 Koppelman, S. J., Hackeng, T. M . , Sixma, J. J. and Bouma, B. N. (1995) Inhibition of the intrinsic factor X activating complex by protein S: evidence for a specific binding of protein S to factor VIII. Blood 86, 1062-1071 Koppelman, S. J., Van Hoeij, M . , Vink, T., Lankhof, H., Schiphorst, M . E . , Damas, C , Vlot, A. J., Wise, R., Bouma, B. N. and Sixma, J. J. (1996) Requirements of von willebrand factor to protect factor VIII from inactivation by activated protein C. Blood 87, 2292-2300 Koster, T., Rosendaal, F. R., Briet, E. , Van der Meer, F. J. M . , Colly, L . P., Trienekens, P. H , Poort, S. R., Reitsma, P. H. and Vandenbroucke, J. P. (1995) Protein C deficiency in a controlled series of unselected outpatients: An infrequent but clear risk factor for venous thrombosis (Leiden thrombophilia study). Blood 85, 2756-2761 Kotkow, K. J., Deitcher, S. R., Furie, B. and Furie, B. C. (1995) The second kringle domain of prothrombin promotes factor Va-mediated prothrombin activation by prothrombinase. J. Biol. Chem. 270, 4551-4557 Krishnaswamy, S. (1990) Prothrombinase complex assembly: contributions of protein-protein and protein-membrane interactions toward complex formation. J. Biol. Chem. 265, 3708-3718 Krishnaswamy, S., Church, W. R., Nesheim, M . E . and Mann, K. G. (1987) Activation of human prothrombin by human prothrombinase. Influence of factor Va on the reaction mechanism. J. Biol. Chem. 262, 3291-3299 Krishnaswamy, S., Nesheim, M . E . , Pryzdial, E. L . and Mann, K. G. (1993) Assembly of prothrombinase complex. Meth. Enzymol. 222, 260-280 Krishnaswamy, S., Vlasuk, G. P. and Bergum, P. W. (1994) Assembly of the prothrombinase complex enhances the inhibition of bovine factor Xa by tick anticoagulant peptide. Biochemistry 33, 7897-7907 Kurz, K. D., Smith, T., Wilson, A., Gerlitz, B., Richardson, M . A. and Grinnell, B. W. (1997) Antithrombotic efficacy in the guinea pig of a derivative of human protein C with enhanced activation by thrombin. Blood 89, 534-540 Kuwada, M . and Katayama, K. (1983) An improved method for the determination of 7-carboxyglumatic acid in proteins, bone, and urine. Anal. Biochem. 131, 173-179 Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685 Lamphear, B. J. and Fay, P. J. (1992) Factor IXa enhances reconstitution of factor Villa from isolated A2 subunit and A1/A3-C1-C2 dimer. J. Biol. Chem. 267, 3725-3730 Lane, D. A., Olds, R. J. and Thein, S. L. (1994) Antithrombin III: summary of first database update. Nucleic Acids Res. 22, 3556-3559 Langdell, R. D., Wagner, R. H. and Brinkhous, K. M . (1953) Effect of antihemophilic factor on one-stage clotting tests. A presumptive test for hemophilia and a simple one-stage antihemophilic factor assay procedure. J. Lab. Clin. Med. 41, 637-647 Lapan, K. A. and Fay, P. J. (1997) Localization of a factor X interactive site in the A l subunit of factor Villa. J. Biol. Chem. 272, 2082-2088 Larson, P. J., Camire, R. M . , Wong, D., Fasano, N. C , Monroe, D. M . , Tracy, P. B. and High, K. A. (1998) Structure/function analyses of recombinant variants of human factor Xa: factor Xa incorporation into prothrombinase on the thrombin-activated platelet surface is not mimicked by synthetic phospholipid vesicles. Biochemistry 37, 5029-5038 Lee, T. K., Bangalore, N., Velander, W., Drohan, W. N. and Lubon, H. (1996) Activation of recombinant human protein C. Thromb. Res. 82, 225-234 Lefkovits, J. and Topol, E. J. (1994) Direct thrombin inhibitors in cardiovascular medicine. Circulation 90, 1522-1536 Lenting, P. J., ter Maat, H., Clijsters, P. P. F. M . , Donath, M.-J. S. H. , Van Mourik, J. A. and Mertens, K. (1995) Cleavage at arginine 145 in human blood coagulation factor FX converts the zymogen into a factor VIII binding enzyme. J. Biol. Chem. 270, 14884-14890 Lenting, P. J., Van de Loo, J. W. H. P., Donath, M . J. S. H., Van Mourik, J. A. and Mertens, K. (1996) The sequence G l u 1 8 n - L y s 1 8 1 8 of human blood coagulation factor VIII comprises a binding site for activated factor IX. J. Biol. Chem. 271, 1935-1940 Leytus, S. P., Chung, D. W., Kisiel, W., Kurachi, K. and Davie, E. W. (1984) Characterization of a cDNA coding for human factor X. Proc. Natl. Acad. Sci. USA 81, 3699-3702 Leytus, S. P., Foster, D. C , Kurachi, K. and Davie, E . W. (1986) Gene for human factor X: a blood coagulation factor whose gene organization is essentially identical with that of factor IX and protein C. Biochemistry 25, 5098-5102 Lin, S. W., Smith, K. J., Welsch, D. and Stafford, D. W. (1990) Expression and characterization of human factor IX and factor IX-factor X chimeras in mouse C127 cells. J. Biol. Chem. 265, 144-150 Lind, B., Johnsen, A. H. and Thorsen, S. (1997) Naturally occurring Arg - 1 to His mutation in human protein C leads to aberrant propeptide processing and secretion of dysfunctional protein C. Blood 89, 2807-2816 Lollar, P., Knutson, G. J. and Fass, D. N. (1985) Activation of porcine factor VIILC by thrombin and factor Xa. Biochemistry 24, 8056-8064 London, F. and Walsh, P. N. (1996) The role of electrostatic interactions in the assembly of the factor X activating complex on both activated platelets and negatively-charged phospholipid vesicles. Biochemistry 35, 12146-12154 Long, G. L. (1986) Structure and evolution of the human genes encoding protein C and coagulation factors VII, IX, and X. Cold Spring Harbor Symp. Quant. Biol. 51, 525-529 Lu, D., Xie, R.-L., Rydzewski, A. and Long, G. L . (1997) The effect of TV-linked glycosylation on molecular weight, thrombin cleavage, and functional activity of human protein S. Thromb. Haemost. 77, 1156-1163 Luchtman-Jones, L. and Broze, G. J. J. (1995) The current status of coagulation. Ann. Med. 27, 47-52 Lundwall, A. , Dackowski, W., Cohen, E. , Shaffer, M . , Mahr, A., Dahlback, B., Stenflo, J. and Wydro, R. (1986) Isolation and sequence of the cDNA for human protein S, a regulator of blood coagulation. Proc. Natl. Acad. Sci. USA 83, 6716-6720 MacFarlane, R. G. (1964) An enzyme cascade in the blood clotting mechanism and its function as a biological amplifier. Nature 202, 498^199 Majerus, P. W. (1987) Platelets. In The Molecular Basis of Blood Diseases, Stamatoyannopoulos, G., Nienhuis, A. W., Leder, P. and Majerus, P. W., ed., W. B. Saunders Co., Philadelphia, pp. 689-721 Mann, K. G., Jenny, R. J. and Krishnaswamy, S. (1988) Cofactor proteins in the assembly and expression of blood clotting enzyme complexes. Ann. Rev. Biochem. 57, 915-956 Mann, K. G., Nesheim, M . E. , Church, W. R., Haley, P. and Krishnaswamy, S. (1990) Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood 76, 1-16 Mao, S.-S., Huang, J., Welebob, C , Neeper, M . P., Garsky, V. M . and Shafer, J. A. (1995) Identification and characterization of variants of tick anticoagulant peptide with increased inhibitory potency toward human factor Xa. Biochemistry 34, 5098-5103 Marciniak, E. , Wilson, H. D. and Marlar, R. A. (1985) Neonatal purpura fulminans: a genetic disorder related to the absence of protein C in blood. Blood 65, 15-20 Marlar, R. A. (1985a) Plasma single chain protein C is functionally similar to the two chain form of plasma protein C. Thromb. Haemost. 54, 216 Marlar, R. A. (1985b) Protein C in thromboembolic disease. Semin. Thromb. Hemost. 11, 387-392 Marlar, R. A. and Griffin, J. H. (1980) Deficiency of protein C inhibitor in combined factor V/VIII deficiency disease. J. Clin. Invest. 66, 1186-1189 Marlar, R. A., Kleiss, A. J. and Griffin, J. H. (1982) Mechanism of action of human activated protein C, a thrombin-dependent anticoagulant enzyme. Blood 59, 1067-1072 Marlar, R. A., Kressin, D. C. and Madden, R. M . (1993) Contribution of plasma proteinase inhibitors to the regulation of activated protein C in plasma. Thromb. Haemost. 69, 16-20 Marlar, R. A. and Neumann, A. (1990) Neonatal purpura fulminans due to homozygous protein C or protein S deficiencies. Thromb. Haemost. 16, 299-309 Masys, D. R., Bajaj, S. P. and Rapaport, S. I. (1982) Activation of human factor VII by activated factors IX and X. Blood 60, 1143-1150 Mather, T., Oganessyan, V., Hof, P., Huber, R., Foundling, S., Esmon, C. and Bode, W. (1996) The 2.8 A crystal structure of Gla-domainless activated protein C. E M B O J. 15, 6822-6831 Matsudaira, P. (1987) Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes. J. Biol. Chem. 262, 10035-10038 McClure, D. B., Walls, J. D. and Grinnell, B. W. (1992) Post-translational processing events in the secretion pathway of human protein C, a complex vitamin K-dependent antithrombotic factor. J. Biol. Chem. 267, 19710-19717 McGee, M . P., Li , L . C. and Xiong, H. (1992) Diffusion control in blood coagulation. Activation of factor X by factors IXa/VIFIa assembled on human monocyte membranes. J. Biol. Chem. 267, 24333-24339 McGee, M . P., Teuschler, H. and Liang, J. (1998) Effective electrostatic charge of coagulation factor X in solution and on phospholipid membranes: implications for activation mechanisms and structure-function relationships of the Gla domain. Biochem. J. 330, 533-539 McMullen, B. A., Fujikawa, K., Kisiel, W., Sasagawa, T., Howald, W. N., Kwa, E. Y. and Weinstein, B. (1983) Complete amino acid sequence of the light chain of human blood coagulation factor X: evidence for identification of residue 63 as /2-hydroxyaspartic acid. Biochemistry 22, 2875-2884 Medved, L . V., Vysotchin, A. and Ingham, K. C. (1994) Ca2+-dependent interactions between Gla and EGE domains in human coagulation factor IX. Biochemistry 33, 478-485 Mesters, R. M . , Heeb, M . J. and Griffin, J. H. (1993a) Interactions and inhibition of blood coagulation factor Va involving residues 311-325 of activated protein C. Prot. Sci. 2, 1482-1489 Mesters, R. M . , Heeb, M . J. and Griffin, J. H. (1993b) A novel exosite in the light chain of human activated protein C essential for interaction with blood coagulation factor Va. Biochemistry 32, 12656-12663 Mesters, R. M . , Houghten, R. A. and Griffin, J. H. (1991) Identification of a sequence of human activated protein C (residues 390—404) essential for its anticoagulant activity. J. Biol. Chem. 266, 24514-24519 Meyer, D. and Girma, J. P. (1993) von Willebrand factor: structure and function. Thromb. Haemost. 70, 99-104 Miletich, J. P., Kane, W. H., Hofmann, S. L. , Stanford, N. and Majerus, P. W. (1979) Deficiency of factor Xa-factor V a binding sites on the platelets of a patient with a bleeding disorder. Blood 54, 1015-1022 Miletich, J. P., Prescott, S. M . , White, R., Majerus, P. W. and Bovill, E. G. (1993) Inherited predisposition to thrombosis. Cell 72, 477-480 Miletich, J. P., Sherman, L . and Broze, G. (1987) Absence of thrombosis in subjects with heterozygous protein C deficiency. N. Engl. J. Med. 317, 991-996 Monkovic, D. D. and Tracy, P. B. (1990) Activation of human factor V by factor Xa and thrombin. Biochemistry 29, 1118-1128 Monroe, D. M . , Roberts, H. R. and Hoffman, M . (1994) Platelet procoagulant complex assembly in a tissue factor-initiated system. Br. J. Haematol. 88, 364-371 Morita, T. and Jackson, C. M . (1986) Preparation and properties of derivatives of bovine factor X and factor Xa from which the y-carboxyglutamic acid containing domain has been removed. J. Biol. Chem. 261, 4015-4023 Morris, D. P., Stevens, R. D., Wright, D. J. and Stafford, D. W. (1995) Processive post-translational modification. Vitamin K-dependent carboxylation of a peptide substrate. J. Biol. Chem. 270, 30491-30498 Mosesson, M . W. (1992) The roles of fibrinogen and fibrin in hemostasis and thrombosis. Semin. Hematol. 29, 177-88 Mutucumarana, V. P., Duffy, E. J., Lollar, P. and Johnson, A. E. (1992) The active site of factor IXa is located far above the membrane surface and its conformation is altered upon association with factor Villa. A fluorescence study. J. Biol. Chem. 267, 17012-17021 Naito, K. and Fujikawa, K. (1991) Activation of human blood coagulation factor XI independent of factor XII. Factor XI is activated by thrombin and factor XIa in the presence of negatively charged surfaces. J. Biol. Chem. 266, 7353-7358 Nemerson, Y. (1966) The reaction between bovine brain tissue factor and factors VII and X. Biochemistry 5, 601-608 Nemerson, Y. and Pitlick, F. A. (1972) The tissue factor pathway of blood coagulation. Prog. Haemost. Thromb. 1, 1-37 Nesheim, M . , Pittman, D. D., Giles, A. R., Fass, D. N., Wang, J. H. , Slonosky, D. and Kaufman, R. J. (1991) The effect of plasma von Willebrand factor on the binding of human factor VIII to thrombin-activated human platelets. J. Biol. Chem. 266, 17815-17820 Nesheim, M . E . , Taswell, J. B. and Mann, K. G. (1979) The contribution of bovine Factor V and Factor Va to the activity of prothrombinase. J. Biol. Chem. 254, 10952-10962 Neuenschwander, P. F., Fiore, M . M . and Morrissey, J. H. (1993) Factor VII autoactivation proceeds via interaction of distinct protease-cofactor and zymogen-cofactor complexes. Implications of a two-dimensional enzyme kinetic mechanism. J. Biol. Chem. 268, 21489-92 Neurath, H. (1984) Evolution of proteolytic enzymes. Science 224, 350-357 Nicolaes, G. A. F., Tans, G., Thomassen, M . C. L . G. D., Hemker, H. C , Pabinger, I., Varadi, K., Schwafz, H. P. and Rosing, J. (1995) Peptide bond cleavages and loss of functional activity during inactivation of factor Va and factor Va R 5 0 6 Q by activated protein C. J. Biol. Chem. 270, 21158-21166 O'Hara, P. J., Grant, F. J., Haldeman, B. A., Gray, C. L. , Insley, M . Y., Hagen, F. S. and Murray, M . J. (1987) Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation. Proc. Natl. Acad. Sci. USA 84, 5158-5162 Ohlin, A. -K. , Bjork, I. and Stenflo, J. (1990) Proteolytic formation and properties of a fragment of protein C containing the 7-carboxyglutamic acid rich domain and the EGF-like region. Biochemistry 29, 644-51 Ohlin, A. -K. , Landes, G., Bourdon, P., Oppenheimer, C , Wydro, R. and Stenflo, J. (1988) /J-hydroxyaspartic acid in the first epidermal growth factor-like domain of protein C. Its role in C a 2 + binding and biological activity. J. Biol. Chem. 263, 19240-19248 Ohta, N., Brush, M . and Jacobs, J. W. (1994) Interaction of antistasin-related peptides with factor Xa: identification of a core inhibitory sequence. Thromb. Haemost. 72, 825-830 Okajima, K., Imamura, H. , Koga, S., Inoue, M . , Takatsuki, K. and Aoki, N. (1990a) Treatment of patients with disseminated intravascular coagulation by protein C. Am. J. Hematol. 33, 277-278 Okajima, K., Koga, S., Kaji, M . , Inoue, M . , Nakagaki, T., Funatsu, A., Okabe, H , Takatsuki, K. and Aoki, N. (1990b) Effect of protein C and activated protein C on coagulation and fibrinolysis in normal human subjects. 63,48-53 Oppenheimer, C. and Wydro, R. (1988) Cellular processing of vitamin K-dependent proteins. In Current Advances in Vitamin K Research, Suttie, J. W., ed., Elsevier Science Publishing Co., Inc., New York, pp. 165-171 Orthner, C. L . , Madurawe, R. D., Velander, W. H , Drohan, W. N., Battey, F. D. and Strickland, D. K. (1989) Conformational changes in an epitope localized to the NH2-terminal region of protein C. Evidence for interaction of protein C domains. J. Biol. Chem. 264, 18781-18788 Osteoid, B. (1997) Tissue factor: a complex biological role. Thromb. Haemost. 78, 755-758 0sterud, B. and Rapaport, S. I. (1977) Activation of factor IX by the reaction product of tissue factor and factor VII: additional pathways for initiating blood coagulation. Proc. Natl. Acad. Sci. USA 74, 5260-5264 Pabinger, I. and Schneider, B. (1996) Thrombotic risk in hereditary antithrombin III, protein C, or protein S deficiency. A cooperative, retrospective study. Arterioscler. Thromb. Vase. Biol. 16, 742-748 Padmanabhan, K., Padmanabhan, K. P., Tulinsky, A., Park, C. H. , Bode, W., Huber, R., Blankenship, D. T., Cardin, A. D. and Kisiel, W. (1993) Structure of human des(l-45) factor Xa at 2.2 A resolution. J. Mol. Biol. 232, 947-966 Palmiter, R. D., Behringer, R. R., Quaife, C. J., Maxwell, F., Maxwell, I. H. and Brinster, R. L. (1987) Cell lineage ablation in transgenic mice by cell-specific expression of a toxin gene. Cell 50, 435-443 Patthy, L. (1985) Evolution of the proteases of blood coagulation and fibrinolysis by assembly from modules. Cell 41, 657-663 Patthy, L. (1987) Intron-dependent evolution: preferred types of exons and introns. FEBS Lett. 214, 1-7 Patthy, L. (1990) Evolutionary assembly of blood coagulation proteins. Semin. Thromb. Hemost. 16, 245-259 Pedersen, A. H. , Lund-Hansen, T., Bisgaard-Frantzen, H., Olsen, F. and Petersen, L . C. (1989) Autoactivation of human recombinant coagulation factor VII. Biochemistry 28, 9331-9336 Persson, E. , Hogg, P. J. and Stenflo, J. (1993) Effects of C a 2 + binding on the protease module of factor Xa and its interaction with factor Va. Evidence for two Gla-independent Ca 2 + -binding sites in factor Xa. J. Biol. Chem. 268, 22531-22539 Pieters, J., Lindhout, T. and Hemker, H. C. (1989) In sita-generated thrombin is the only enzyme that effectively activates factor VIU and factor V in thromboplastin-activated plasma. Blood 74, 1021-1024 Pittman, D. D., Marquette, K. A. and Kaufman, R. J. (1994) Role of the B domain for factor VIII and factor V expression and function. Blood 84, 4214-4225 Plutzky, J., Hoskins, J. A., Long, G. L . and Crabtree, G. R. (1986) Evolution and organization of the human protein C gene. Proc. Natl. Acad. Sci. USA 83, 546-550 Potempa, J., Korzus, E. and Travis, J. (1994) The serpin superfamily of proteinase inhibitors: structure, function, and regulation. J. Biol. Chem. 269, 15957-15960 Pratt, C. W. and Church, F. C. (1992) Heparin binding to protein C inhibitor. J. Biol. Chem. 267, 8789-8794 Price, J. A. and Johnson, B. C. (1980) Reconstitution of vitamin K-dependent carboxylation activity. In Vitamin K Metabolism and Vitamin K-dependent Proteins, Suttie, J. W., ed., University Park Press, Baltimore, Maryland, pp. 500-504 Price, P. A. (1984) Decarboxylation of y-carboxyglutamic acid residues in proteins. Meth. Enzymol. 107, 548-551 Pryzdial, E. L. G. and Kessler, G. E. (1996a) Autoproteolysis or plasmin-mediated cleavage of factor X a a exposes a plasminogen binding site and inhibits coagulation. J. Biol. Chem. 271, 16614-16620 Pryzdial, E. L. G. and Kessler, G. E. (1996b) Kinetics of blood coagulation factor X a a autoproteolytic conversion to factor Xaf3. Effect on inhibition by antithrombin, prothrombinase assembly, and enzyme activity. J. Biol. Chem. 271, 16621-16626 Racchi, M . , Watzke, H. H , High, K. A. and Lively, M . O. (1993) Human coagulation factor X deficiency caused by a mutant signal peptide that blocks cleavage by signal peptidase but not targeting and translocation to the endoplasmic reticulum. J. Biol. Chem. 268, 5735-5740 Radcliffe, R. and Nemerson, Y. (1975) Activation and control of factor VII by activated factor X and thrombin. J. Biol. Chem. 250, 388-395 Rafiq, M . , Suen, C. K. M . , Choudhury, N., Joannu, C. L . , White, K. N. and Evans, R. W. (1997) Expression of recombinant human ceruloplasmin - an absolute requirement for splicing signals in the expression cassette. FEBS Lett. 407, 132-136 Rao, L . V. M . , Nordfang, O., Hoang, A. D. and Pendurthi, U. R. (1995) Mechanism of antithrombin III inhibition of factor Vila/tissue factor activity on cell surfaces. Comparison with tissue factor pathway inhibitor/factor Xa-induced inhibition of factor Vila/tissue factor activity. Blood 85, 121-129 Rapaport, S. I. (1989) Inhibition of factor Vila/tissue factor-induced blood coagulation: with particular emphasis upon a factor Xa-dependent inhibitory mechanism. Blood 73, 359-65 Rapaport, S. I. and Rao, L. V. (1995) The tissue factor pathway: how it has become a "prima ballerina". Thromb. Haemost. 74, 7-17 Ratcliffe, J. V., Furie, B. and Furie, B. C. (1993) The importance of specific y-carboxy-glutamic acid residues in prothrombin. Evaluation by site-specific mutagenesis. J. Biol. Chem. 268, 24339-24345 Rawala-Sheikh, R., Ahmad, S. S., Ashby, B. and Walsh, P. N. (1990) Kinetics of coagulation factor X activation by platelet-bound factor IXa. Biochemistry 29, 2606-2611 Rawala-Sheikh, R., Ahmad, S. S., Monroe, D. M . , Roberts, H. R. and Walsh, P. N. (1992) Role of ycarboxyglutarnic acid residues in the binding of factor LXa to platelets and in factor-X activation. Blood 79, 398^105 Rees, D. J., Jones, I. M . , Handford, P. A., Walter, S. J., Esnouf, M . P., Smith, K. J. and Brownlee, G. G. (1988) The role of /J-hydroxyaspartate and adjacent carboxylate residues in the first EGF domain of human factor IX. E M B O J. 7, 2053-2061 Regan, L . M . and Fay, P. J. (1995) Cleavage of factor VIII light chain is required for maximal generation of factor Villa activity. J. Biol. Chem. 270, 8546-8552 Regan, L. M . , Lamphear, B. J., Huggins, C. F., Walker, F. J. and Fay, P. J. (1994) Factor IXa protects factor VUIa from activated protein C. Factor IXa inhibits activated protein C-catalyzed cleavage of factor Villa at Arg 5 6 2 . J. Biol. Chem. 269, 9445-9452 Regan, L . M . , O'Brien, L. ML, Beattie, T. L. , Sudhakar, K., Walker, F. J. and Fay, P. J. (1996) Activated protein C-catalyzed proteolysis of factor Villa alters its interactions within factor Xase. J. Biol. Chem. 271, 3982-3987 Reitsma, P. H., Bernardi, F., Doig, R. G., Gandrille, S., Greengard, J. S., Ireland, H. , Krawczak, M . , Lind, B., Long, G. L . , Poort, S. R., Saito, H. , Sala, N., Witt, I. and Cooper, D. N. (1995) Protein C deficiency: a database of mutations, 1995 update. On behalf of the Subcommittee on Plasma Coagulation Inhibitors of the Scientific and Standardization Committee of the ISTH. Thromb. Haemost. 73, 876-889 Reitsma, P. H. , Poort, S. R., Allaart, C. F., Briet, E. and Bertina, R. M . (1991) The spectrum of genetic defects in a panel of 40 Dutch families with symptomatic protein C defiency type I: heterogeneity and founder effects. Blood 78, 890-894 Rezaie, A. R., Cooper, S. T., Church, F. C. and Esmon, C. T. (1995) Protein C inhibitor is a potent inhibitor of the thrombin-thrombomodulin complex. J. Biol. Chem. 270, 25336-25339 Rezaie, A. R. and Esmon, C. T. (1994) Asp-70 —> Lys mutant of factor X lacks high affinity C a 2 + binding site yet retains function. J. Biol. Chem. 269, 21495-21499 Rezaie, A. R., Esmon, N. L. and Esmon, C. T. (1992) The high affinity calcium-binding site involved in protein C activation is outside the first epidermal growth factor homology domain. J. Biol. Chem. 267, 11701-11704 Rezaie, A. R., Mather, T., Sussman, F. and Esmon, C. T. (1994) Mutation of Glu-80—>Lys results in a protein C mutant that no longer requires C a 2 + for rapid activation by the thrombin-thrombomodulin complex. J. Biol. Chem. 269, 3151-3154 Rezaie, A. R., Neuenschwander, P. F., Morrissey, J. H. and Esmon, C. T. (1993) Analysis of the functions of the first epidermal growth factor-like domain of factor X. J. Biol. Chem. 268, 8176-8180 Richardson, M . A., Gerlitz, B. and Grinnell, B. W. (1992) Enhancing protein C interaction with thrombin results in a clot-activated anticoagulant. Nature 360, 261-264 Roberts, H. R., Lechler, E. , Webster, W. P. and Penick, G. D. (1965) Survival of transfused factor X in patients with Stuart disease. Thromb. Diath. Haemorr. 13, 305-313 Rock, G. and Wells, P. (1997) New concepts in coagulation. Crit. Rev. Clin. Lab. Sci. 34, 475-501 Rosendaal, F. R., Koster, T., Vandenbroucke, J. P. and Reitsma, P. H. (1995) High risk of thrombosis in patients homozygous for factor V Leiden (activated protein C resistance). Blood 85, 1504-1508 Rosing, J., Hoekema, L. , Nicolaes, G. A. F., Christella, M . , Thomassen, L . G. D., Hemker, H. C , Varadi, K., Schwarz, H. P. and Tans, G. (1995) Effects of protein S and factor Xa on peptide bond cleavages during inactivation of factor Va and factor V a R 5 0 6 ° - by activated protein C. J. Biol. Chem. 270, 27852-27858 Rudolph, A. E. , Mullane, M . P., Porche-Sorbet, R. and Miletich, J. P. (1997) Expression, purification, and characterization of recombinant human factor X. Prot. Expr. Purif. 10, 373-8 Rudolph, A. E. , Mullane, M . P., Porche-Sorbet, R., Tsuda, S. and Miletich, J. P. (1996) Factor Xs t. Louis ii- Identification of a glycine substitution at residue 7 and characterization of the recombinant protein. J. Biol. Chem. 271, 28601-28606 Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Sanger, F., Niklen, S. and Coulson, A. R. (1977) DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467 Scandura, J. M . , Ahmad, S.S. and Walsh, P. N. (1996) A binding site expressed on the surface of activated human platelets is shared by factor X and prothrombin. Biochemistry 35, 8890-8902 Scandura, J. M . and Walsh, P. N. (1996) Factor X bound to the surface of activated human platelets is preferentially activated by platelet-bound factor IXa. Biochemistry 35, 8903-8913 Schafer, A. I. (1994) Hypercoagulable states: molecular genetics to clinical practice. Lancet 344, 1739-1742 Schwalbe, R. A., Ryan, J., Stern, D. M . , Kisiel, W., Dahlback, B. and Nelsestuen, G. L . (1989) Protein structural requirements and properties of membrane binding by 7-carboxyglutamic acid-containing plasma proteins and peptides. J. Biol. Chem. 264, 20288-20296 Schwarz, H. P., Fischer, M . , Hopmeier, P., Batard, M . A. and Griffin, J. H. (1984) Plasma protein S deficiency in familial thrombotic disease. Blood 64, 1297-1300 Selander, M . , Persson, E. , Stenflo, J. and Drakenberg, T. (1990) 'H NMR assignment and secondary structure of the Ca2+-free form of the amino-terminal epidermal growth factor like domain in coagulation factor X. Biochemistry 29, 8111-8118 Selander Sunnerhagen, M . , Persson, E. , Dahlqvist, I., Drakenberg, T., Stenflo, J., Mayhew, M . , Robin, M . , Handford, P., Tilley, J. W., Campbell, I. D. and Brownlee, G. G. (1993) The effect of aspartate hydroxylation on calcium binding to epidermal growth factor-like modules in coagulation factors IX and X. J. Biol. Chem. 268, 23339-23344 Selander-Sunnerhagen, M . , Ullner, M . , Persson, E. , Teleman, O., Stenflo, J. and Drakenberg, T. (1992) How an epidermal growth factor (EGF)-like domain binds calcium. High resolution NMR structure of the calcium form of the NH2-terminal EGF-like domain in coagulation factor X. J. Biol. Chem. 267, 19642-19649 Seligsohn, U., Berger, A., Abend, M . , Rubin, L. , Attias, D., Zivelin, A. and Rapaport, S. I. (1984) Homozygous protein C deficiency manifested by massive venous thrombosis in the newborn. N. Engl. J. Med. 310, 559-562 Sheffield, W. P., Fernandez-Rachubinski, F., Austin, R. C. and Blajchman, M . A. (1991) Molecular defects in human antithrombin III deficiency. In Recombinant Technology in Hemostasis and Thrombosis, Hoyer, L. W. and Drohan, W. N., ed., Plenum Press, New York, pp. 133-146 Sheffield, W. P., Wu, Y. I. and Blajchman, M . A. (1995) Antithrombin: structure and function. In Molecular Basis of Thrombosis and Hemostasis, High, K. A. and Roberts, H. R., ed., Marcel Dekker, Inc., New York, pp. 355-377 Shen, L. and Dahlback, B. (1994) Factor V and protein S as synergistic cofactors to activated protein C in degradation of factor Villa. J. Biol. Chem. 269, 18735-18738 Simonsen, C. C. and Levinson, A. D. (1983) Isolation and expression of an altered mouse dihydrofolate reductase cDNA. Proc. Natl. Acad. Sci. USA 80, 2495-2499 Sinha, U. and Wolf, D. L. (1993) Carbohydrate residues modulate the activation of coagulation factor X. J. Biol. Chem. 268, 3048-3051 Skogen, W. F., Esmon, C. T. and Cox, A. C. (1984) Comparison of coagulation factor Xa and des-(l-44)factor Xa in the assembly of prothrombinase. J. Biol. Chem. 259, 2306-2310 Smirnov, M . D., Safa, O., Regan, L. , Mather, T., Stearns-Kurosawa, D. J., Kurosawa, S., Rezaie, A. R., Esmon, N. L. and Esmon, C. T. (1998) A chimeric protein C containing the prothrombin Gla domain exhibits increased anticoagulant activity and altered phospholipid specificity. J. Biol. Chem. 273, 9031-9040 Snow, T. R., Deal, M . T., Dickey, D. T. and Esmon, C. T. (1991) Protein C activation following coronary artery occlusion in the in situ porcine heart. Circulation 84, 293-299 Solymoss, S., Tucker, M . M . and Tracy, P. B. (1988) Kinetics of activation of membrane-bound factor Va by activated protein C. J. Biol. Chem. 263, 14884-14890 Soriano-Garcia, M . , Padmanabhan, K., de Vos, A. M . and Tulinsky, A. (1992) The C a 2 + ion and membrane binding structure of the Gla domain of Ca-prothrombin fragment 1. Biochemistry 31, 2554-2566 Soriano-Garcia, M . , Park, C. H., Tulinsky, A., Ravichandran, K. G. and Skrzypczak-Jankun, E. (1989) Structure of C a 2 + prothrombin fragment 1 including the conformation of the Gla domain. Biochemistry 28, 6805-6810 Sottrup-Jensen, L . (1987) ct2-Macroglobulin and related thiol ester plasma proteins. In The Plasma Proteins, Putnam, F. W., ed., Academic Press, Orlando, FL, pp. 191-291 Southern, E. M . (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517 Stanley, T. B., Jin, D.-Y., Lin, P. J. and Stafford, D. W. (1999) The propeptides of the vitamin K-dependent proteins possess different affinities for the vitamin K-dependent carboxylase. J. Biol. Chem. 274, 16940-16944 Stanton, C. and Wallin, R. (1992) Processing and trafficking of clotting factor X in the secretory pathway. Effects of warfarin. Biochem. J. 284, 25-31 Stenberg, Y., Julenius, K., Dahlqvist, I., Drakenberg, T. and Stenflo, J. (1997a) Calcium-binding properties of the third and fourth epidermal-growth-factor-like modules in vitamin-K-dependent protein S. Eur. J. Biochem. 248, 163-170 Stenberg, Y., Linse, S., Julenius, K., Drakenberg, T. and Stenflo, J. (1997b) The high affinity calcium-binding sites in the epidermal growth factor module region of vitamin K-dependent protein S. J. Biol. Chem. 272, 23255-23260 Stenflo, J. (1976) A new vitamin K-dependent protein. Purification from bovine plasma and preliminary characterization. J. Biol. Chem. 251, 355-363 Stenflo, J. (1984) Structure and function of protein C. Semin. Thromb. Hemost. 10, 109-121 Stenflo, J. (1991) Structure-function relationships of epidermal growth factor modules in vitamin K-dependent clotting factors. Blood 78, 1637-1651 Stenflo, J., Fernlund, P., Egan, W. and Roepstorff, P. (1975) Vitamin K dependent modifications of glutamic acid residues in prothrombin. Proc. Natl. Acad. Sci. USA 71, 2730-2733 Stenflo, J., Lundwall, A. and Dahlback, B. (1987) /3-Hydroxyasparagine in domains homologous to the epidermal growth factor precursor in vitamin K-dependent protein S. Proc. Natl. Acad. Sci. USA 84, 368-372 Stocker, K., Fischer, H. , Meier, J., Brogli, M . and Svendsen, L. (1987) Characterization of the protein C activator Protac® from the venom of the southern copperhead (Agkistrodon contortrix) snake. Toxicon 25, 239-252 Stone, S. R. and Hermans, J. M . (1995) Inhibitory mechanism of serpins. Interaction of thrombin with antithrombin and protease nexin 1. Biochemistry 34, 5164-5172 Stroud, R. M . , Krieger, M . , Koeppe, R. E. , II„ Kossiakoff, A. A. and Chambers, J. L . (1975) Structure-function relationships in the serine proteases. In Proteases and Biological Control, Reich, E. , Rifkin, D. B. and Shaw, E. , ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, pp. 13-32 Sugo, T., Bjork, I., Holmgren, A. and Stenflo, J. (1984) Calcium-binding properties of bovine factor X lacking the y-carboxyglutamic acid-containing region. J. Biol. Chem. 259, 5705-5710 Sugo, T., Dahlback, B., Holmgren, A. and Stenflo, J. (1986) Calcium binding of bovine protein S. Effect of thrombin cleavage and removal of the y-carboxyglutamic acid-containing region. J. Biol. Chem. 261, 5116-5120 Sun, X., Evatt, B. and Griffin, J. H. (1994) Blood coagulation factor Va abnormality associated with resistance to activated protein C in venous thrombophilia. Blood 83, 3120-3125 Sunnerhagen, M . , Forsen, S., Hoffren, A. M . , Drakenberg, T., Teleman, O. and Stenflo, J. (1995) Structure of the Ca2+-free Gla domain sheds light on membrane binding of blood coagulation proteins. Nat. Struct. Biol. 2, 504-509 Sunnerhagen, M . , Olah, G. A., Stenflo, J., Forsen, S., Drakenberg, T. and Trewhella, J. (1996) The relative orientation of Gla and EGF domains in coagulation factor X is altered by C a 2 + binding to the first EGF domain. A combined NMR—small angle X-ray scattering study. Biochemistry 35, 11547-11559 Suttie, J. W. (1985) Vitamin K-dependent carboxylase. Ann. Rev. Biochem. 54, 459^177 Suttie, J. W. (1993) Synthesis of vitamin K-dependent proteins. FASEB J. 7, 445-452 Suzuki, K. (1993) Protein C inhibitor. Meth. Enzymol. 222, 385-399 Suzuki, K., Dahlback, B. and Stenflo, J. (1982) Thrombin-catalyzed activation of human coagulation factor V. J. Biol. Chem. 257, 6556-6564 Suzuki, K., Nishioka, J. and Hashimoto, S. (1983) Protein C inhibitor: purification from human plasma and characterization. J. Biol. Chem. 258, 163-168 Suzuki, K., Nishioka, J. and Hayashi, T. (1990) Localization of thrombomodulin-binding site within human thrombin. J. Biol. Chem. 265, 13263-13267 Svensson, P. J. and Dahlback, B. (1994) Resistance to activated protein C as a basis for venous thrombosis. N. Engl. J. Med. 330, 517-522 Syed, S., Schuyler, P. D., Kulczycky, M . and Sheffield, W. P. (1997) Potent antithrombin activity and delayed clearance from the circulation characterize recombinant hirudin genetically fused to albumin. Blood 89, 3243-3252 Tait, R. C , Walker, I. D., Reitsma, P. H., Islam, S. I. A. M . , McCall, F., Poort, S. R., Conkie, J. A. and Bertina, R. M . (1995) Prevalence of protein C deficiency in the healthy population. Thromb. Haemost. 73, 87-93 Takeya, H. , Nishida, S., Miyata, T., Kawada, S., Saisaka, Y., Morita, T. and Iwanaga, S. (1992) Coagulation factor X activating enzyme from Russell's viper venom (RVV-X). A novel metalloproteinase with disintegrin (platelet aggregation inhibitor)-like and C-type lectin-like domains. J. Biol. Chem. 267, 14109-14117 Taylor, F. B., Jr., Chang, A., Esmon, C. T., D'Angelo, A., Vigano-D'Angelo, S. and Blick, K. E. (1987) Protein C prevents the coagulopathy and lethal effects of Escherichia coli infusion in the baboon. 79, 918-925 Toole, J. J., Pittman, D. D., Orr, E. C , Murtha, P., Wasley, L. C. and Kaufman, R. J. (1986) A large region (-95 kDa) of human factor VIII is dispensable for in vitro procoagulant activity. Proc. Natl. Acad. Sci. USA 83, 5939-5942 Toomey, J. R., Smith, K. J., Roberts, H. R. and Stafford, D. W. (1992) The endothelial cell binding determinant of human factor LX resides in the y-carboxyglutamic acid domain. Biochemistry 31, 1806-1808 Tracy, P. B., Nesheim, M . E . and Mann, K. G. (1981) Coordinate binding of factor Va and factor Xa to the unstimulated platelet. J. Biol. Chem. 256, 743-751 Triplett, D. A., Brandt, J. T., Batard, M . A., Dixon, J. L. and Fair, D. S. (1985) Hereditary factor VII deficiency: heterogeneity defined by combined functional and immunochemical analysis. Blood 66, 1284-1287 Tsuda, Y., Cygler, M . , Gibbs, B. F., Pedyczak, A., Fethiere, J., Yue, S. Y. and Konishi, Y. (1994) Design of potent bivalent thrombin inhibitors based on hirudin sequence: incorporation of nonsubstrate-type active site inhibitors. Biochemistry 33, 14443-14451 Tuddenham, E. G. D. and Cooper, D. N. (1994a) Factor X. In The Molecular Genetics of Haemostasis and its Inherited Disorders, ed., Oxford University Press, New York, pp. 122-133 Tuddenham, E. G. D. and Cooper, D. N. (1994b) Introduction. In The Molecular Genetics of Haemostasis and its Inherited Disorders, ed., Oxford University Press, New York, pp. 1-19 Tuddenham, E. G. D. and Cooper, D. N. (1994c) Protein S, C4b-binding protein, and protein Z. In The Molecular Genetics of Haemostasis and its Inherited Disorders, ed., Oxford University Press, New York, pp. 164-174 Valcarce, C , Holmgren, A. and Stenflo, J. (1994) Calcium-dependent interaction between y-carboxyglutamic acid-containing and N-terminal epidermal growth factor-like modules in factor X. J. Biol. Chem. 269, 26011-26016 Valcarce, C , Selander-Sunnerhagen, M . , Tamlitz, A . - M . , Drakenberg, T., Bjork, I. and Stenflo, J. (1993) Calcium affinity of the NH2-terminal epidermal growth factor-like module of factor X. Effect of the y-carboxyglutamic acid-containing module. J. Biol. Chem. 268, 26673-26678 Valentin, S. and Schousboe, I. (1996) Factor Xa enhances the binding of tissue factor pathway inhibitor to acidic phospholipids. Thromb. Haemost. 75, 796-800 van't Veer, C. and Mann, K. G. (1997) Regulation of tissue factor initiated thrombin generation by the stoichiometric inhibitors tissue factor pathway inhibitor, antithrombin-III, and heparin cofactor-II. J. Biol. Chem. 272, 4367^1377 van Dieijen, G., Tans, G., Rosing, J. and Hemker, H. C. (1981) The role of phospholipid and factor VIII a in the activation of bovine factor X. J. Biol. Chem. 256, 3433-3442 Varadi, K., Rosing, J., Tans, G., Pabinger, I., Keil, B. and Schwarz, H. P. (1996) Factor V enhances the cofactor function of protein S in the APC-Mediated inactivation of factor VIII: influence of the factor V R 5 0 6 < 2 mutation. Thromb. Haemost. 76, 208-214 Vehar, G. A., Keyt, B., Eaton, D., Rodriguez, H., O'Brien, D. P., Rotblat, F., Oppermann, H. , Keck, R., Wood, W. I., Harkins, R. N. and et al. (1984) Structure of human factor VIII. Nature 312, 337-342 Vo, H. C , Britz-Mckibbin, P., Chen, D. D. Y. and MacGillivray, R. T. A. (1999) Undercarboxylation of recombinant prothrombin revealed by analysis of y-carboxyglutamic acid using capillary electrophoresis and laser-induced fluorescence. FEBS Lett. 445, 256-260 Vu, T.-K., Hung, D. T., Wheaton, V. I. and Coughlin, S. R. (1991) Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell 64, 1057-1068 Walker, F. J. (1980) Regulation of activated protein C by a new protein. A possible function for bovine protein S. J. Biol. Chem. 255, 5521-5524 Walker, F. J. (1981) Regulation of activated protein C by protein S: the role of phospholipid in factor Va inactivation. J. Biol. Chem. 256, 11128-11131 Walker, F. J. (1984) Protein S and the regulation of activated protein C. Semin. Thromb. Hemost. 10, 131-8 Walker, F. J., Chavin, S. I. and Fay, P. J. (1987) Inactivation of factor VIII by protein C and protein S. Arch. Biochem. Biophys. 252, 322-328 Walker, F. J. and Fay, P. J. (1990) Characterization of an interaction between protein C and ceruloplasmin. J. Biol. Chem. 265, 1834-1836 Walker, F. J., Scandella, D. and Fay, P. J. (1990) Identification of the binding site for activated protein C on the light chain of factors V and VIII. J. Biol. Chem. 265, 1484-1489 Wasley, L . C , Rehemtulla, A., Bristol, J. A. and Kaufman, R. J. (1993) PACE/furin can process the vitamin K-dependent pro-factor IX precursor within the secretory pathway. J. Biol. Chem. 268, 8458-8465 Watzke, H. H. , Wallmark, A., Hamaguchi, N., Giardina, P., Stafford, D. W. and High, K. A. (1991) Factor Xs a n to Domingo- Evidence that the severe clinical phenotype arises from a mutation blocking secretion. J. Clin. Invest. 88, 1685-1689 Weitz, J. (1994) New anticoagulant strategies: current status and future potential. Drugs 48, 485-497 Wildgoose, P., Foster, D., Schi0dt, J., Wiberg, F. C , Birktoft, J. J. and Petersen, L . C. (1993) Identification of a calcium binding site in the protease domain of human blood coagulation factor VII: evidence for its role in factor VU-tissue factor interaction. Biochemistry 32, 114-119 Wildgoose, P. and Kisiel, W. (1989) Activation of human factor VII by factors FXa and Xa on human bladder carcinoma cells. Blood 73, 1888-1895 Wise, R. J., Barr, P. J., Wong, P. A., Kiefer, M . C , Brake, A. J. and Kaufman, R. J. (1990) Expression of a human proprotein processing enzyme: correct cleavage of the von Willebrand factor precursor at a paired basic amino acid site. Proc. Natl. Acad. Sci. USA 87, 9378-9382 Wolf, D. L. , Sinha, U., Hancock, T. E. , Lin, P.-H., Messier, T. L . , Esmon, C. T. and Church, W. R. (1991) Design of constructs for the expression of biologically active recombinant human factors X and Xa: kinetic analysis of the expressed proteins. J. Biol. Chem. 266, 13726-13730 Xi , M . , Beguin, S. and Hemker, H. C. (1989) The relative importance of the factors II, VII, IX and X for the prothrombinase activity in plasma of orally anticoagulated patients. Thromb. Haemost. 62, 788-791 Yan, S. C. B., Razzano, P., Chao, Y. B., Walls, J. D., Berg, D. T., McClure, D. B. and Grinnell, B. W. (1990) Characterization and novel purification of recombinant human protein C from three mammalian cell lines. Bio/Technology 8, 655-661 Ye, J., Rezaie, A. R. and Esmon, C. T. (1994) Glycosaminoglycan contributions to both protein C activation and thrombin inhibition involve a common arginine-rich site in thrombin that includes residues arginine 93, 97, and 101. J. Biol. Chem. 269, 17965-17970 Yegneswaran, S., Smirnov, M . D., Safa, O., Esmon, N. L . , Esmon, C. T. and Johnson, A. E. (1999) Relocating the active site of activated protein C eliminates the need for its protein S cofactor. A fluorescence resonance energy transfer study. J. Biol. Chem. 274, 5462-5468 Yoshitake, S., Schach, B. G., Foster, D. C , Davie, E . W. and Kurachi, K. (1985) Nucleotide sequence of the gene for human factor IX (antihemophilic factor B). Biochemistry 24, 3736-3750 Yu, S., Zhang, L. , Jhingan, A., Christiansen, W. T. and Castellino, F. J. (1994) Construction, expression, and properties of a recombinant chimeric human protein C with replacement of its growth factor-like domains by those of human coagulation factor IX. Biochemistry 33, 823-831 Zhang, L. and Castellino, F. J. (1992) Influence of specific y-carboxyglutamic acid residues on the integrity of the calcium-dependent conformation of human protein C. J. Biol. Chem. 267, 26078-26084 Zhang, L. and Castellino, F. J. (1993) The contributions of individual 7-carboxyglutamic acid residues in the calcium-dependent binding of recombinant human protein C to acidic phospholipid vesicles. J. Biol. Chem. 268, 12040-12045 Zhang, L. and Castellino, F. J. (1994) The binding energy of human coagulation protein C to acidic phospholipid vesicles contains a major contribution from leucine 5 in the y-carboxyglutamic acid domain. J. Biol. Chem. 269, 3590-3595 Zhang, L. , Jhingan, A. and Castellino, F. J. (1992) Role of individual y-carboxyglutamic acid residues of activated human protein C in defining its in vitro anticoagulant activity. Blood 80, 942-952 Zoller, B. and Dahlback, B. (1994) Linkage between inherited resistance to activated protein C and factor V gene mutation in venous thrombosis. Lancet 343, 1536-1538 Zoller, B., He, X. and Dahlback, B. (1995) Homozygous APC-resistance combined with inherited type I protein S deficiency in a young boy with severe thrombotic disease. Thromb. Haemost. 73, 743-745 Zoller, B., Hillarp, A., Berntorp, E. and Dahlback, B. (1997) Activated protein C resistance due to a common factor V gene mutation is a major risk factor for venous thrombosis. Ann. Rev. Med. 48, 45-58 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099467/manifest

Comment

Related Items