Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Genetically-engineered populus hybrids and metalliferous soil remediation Schmidt, Monica A. 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-464180.pdf [ 11.37MB ]
Metadata
JSON: 831-1.0099446.json
JSON-LD: 831-1.0099446-ld.json
RDF/XML (Pretty): 831-1.0099446-rdf.xml
RDF/JSON: 831-1.0099446-rdf.json
Turtle: 831-1.0099446-turtle.txt
N-Triples: 831-1.0099446-rdf-ntriples.txt
Original Record: 831-1.0099446-source.json
Full Text
831-1.0099446-fulltext.txt
Citation
831-1.0099446.ris

Full Text

GENETICALLY-ENGINEERED POPULUS HYBRIDS AND METALLIFEROUS SOIL REMEDIATION by MONICA A. SCHMIDT B.Sc, University of Windsor, 1993 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Genetics Graduate Program) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA June 1999 © Monica A. Schmidt, 1999 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of ( r7<f /7<f 'flCS The University of British Columbia Vancouver, Canada Date DE-6 (2/88) ABSTRACT With global heavy metal pollution increasing, there is a need for innovative metal decontamination processes. Plants that have the ability to sequester metal contaminants within their tissues promise to be a cost-effective soil remediation practice. A poplar hybrid clone, Populus alba x P.tremula (INRA clone 717-1B4), was selected for this soil metal remediation research due to its large biomass and extensive deep tap root system that enables it to encounter many contaminants within its surroundings. The response of poplar to heavy metal stress, primarily cadmium and copper, was studied at the molecular level as a means to assess its metal stress-induced defense mechanisms. Metal toxicity tests and chemical inhibition studies to limit the formation of phytochelatins indicate that this metal-chelating compound plays a role in conferring tolerance to both Cd and Cu stress. Metallothioneins were seen to be constitutively expressed in all tissue regardless of metal stress conditions. Conversely, the production of phytochelatins, as monitored by the expression of the glutathione synthetase gene, was seen to be strongly induced by both Cd and Cu-stress in leaf and stem tissue and weakly induced in root tissue. Genetically-engineered poplar hybrids, that express the fission yeast Schizosaccharomyces pombe vacuole transporter gene, HMT, were produced. After exposure to cadmium stress, it was found that the transformants analyzed did not exhibit an enhanced level of metal tolerance nor did they accumulate elevated levels of metal ions within their tissues. It was hypothesized that in order for this particular poplar hybrid to be engineered to have the metal-accumulating phenotype that both the HMT vacuole membrane transporter and the up-regulation of phytochelatins in roots would be needed. T A B L E OF C O N T E N T S Abstract 1 1 Table of Contents i i i List of Tables vii List of Figures viii Abbreviations Used x Acknowledgements xv Chapter 1: L i terature Review 1.1 Global Pollution 1 1.2 Heavy Metal Pollution 2 1.3 Conventional Remediation Practices 3 1.4 Bioremediation 4 1.5 Phytoremediation 5 1.5.1 Phytovolatiziation, Rhizofiltration and Phytostabilization 5 1.5.2 Hyperaccumulators 7 1.5.3 Metal Tolerance Mechanisms in Plants 14 1.5.3.1 Metal Chelating Compounds 15 1.5.3.1.1 Metallothionein 15 1.5.3.1.2 Phytochelatins 17 1.5.3.1.3 Organic Acids 21 1.5.3.1.4 Histidine ...23 1.5.3.1.5 Root Exudates 23 1.5.3.1.6 Cytochrome P-450/ Glutathione-conjugates 25 iii 1.5.3.2 Metal Transporters 27 1.5.3.2.1 Plasma Membrane Metal Transporters 27 1.5.3.2.2 Vacuole Membrane Metal Transporters 28 1.6 Other Heavy Metal Accumulating / Detoxifying Biotechnology Research 31 1.6.1 Cadmium-accumulating Transgenic Metallothionein Tobacco 31 1.6.2 Mercury-detoxifying Transgenic Arabidopsis and Yellow Poplar 32 1.7 Poplar-based Phytoremediation Research 33 1.8 Research Objectives 34 1.9 References •..35 Chapter 2 - Phytochelatins and Metallothioneins in Poplar 2.1 INTRODUCTION: Metal-chelating compounds in plants 47 2.2 METHODOLOGY: 2.2.1 Cell Cultures and Plant Growth 51 2.2.2 Protein Profiles 52 2.2.2.1 Protein Extraction from Metal Stressed Suspension Cultures 52 2.2.2.2 SDS-Polyacrylamide Gel Electrophoresis 52 2.2.3 Differential Display 53 2.2.3.1 RNA Isolation from Metal Stressed Tissue 53 2.2.3.2 cDNA Synthesis and Radioactive PCR 53 2.2.4 The Cloning of a Portion of a Poplar Glutathione Synthetase Gene 54 2.2.5 Southern Blot Analysis 55 2.2.5.1 DNA Isolation and Southern Blot 55 2.2.5.2 Hybridization using Glutathione Synthetase Gene Fragment as a Probe 57 iv 2.2.5.3 Hybridization using Metallothionein-like cDNA as a Probe 58 2.2.6 Stress Induction 58 2.2.6.1 Cadmium and Copper Toxicity Tests 58 2.2.6.2 Cadmium and Copper Toxicity Using BSO to Inhibit Phytochelatin Production 59 2.2.6.3 RT-PCR 60 2.2.6.4 Northern Blots 61 2.2.6.4.1 RNA Extraction from Metal Stressed Tissue 61 2.2.6.4.2 Northern Blot 61 2.2.6.4.3 Glutathione Synthetase Gene Induction 63 2.2.6.4.4 Metallothionein-like Gene Induction 63 2.3 RESULTS: 2.3.1 Presence of Metal-chelating Compounds in Poplar 64 2.3.2 Stress Induction of Metal-chelating Compounds 73 2.4 DISCUSSION 82 2.5 References 87 Chapter 3 - The Determination of Cadmium Accumulation Ability of Poplar Hybrids Transformed with the Yeast Vacuole Transporter HMT Gene 3.1 INTRODUCTION 91 3.2 MATERIALS AND METHODS 96 3.2.1 Modification of Codons in the HMT gene for its Expression in Plants 96 3.2.2 Construction of 7/MT-containing Agrobacterium Binary Vector 98 3.2.3 Transformation / Regeneration 102 3.2.3.1 Sterilization of Plant Material 102 3.2.3.2 Agrobacterium-mediated Transformation and Selection / Regeneration of Plants 102 3.2.4 Genomic PCR to Identify Putative Transformants 103 3.2.4.1 DNA Isolation 103 3.2.4.2 PCR Amplification 105 3.2.5 Northern Blot Analysis 106 3.2.5.1 RNA Extraction from Poplar Tissue 106 3.2.5.2 RNA Extraction from Schizossacharomycespombe 107 3.2.5.3 Northern Blot 107 3.2.6 Cadmium Stress of Poplar Plantlets 107 3.2.7 Quantification of Cadmium by Graphite Furnace Atomic Absorption Spectrophotometry 110 3.3 RESULTS 110 3.3.1 Results of Transformation Experiments 112 3.3.2 Confirmation of Transgenics 112 3.3.2.1 Genomic PCR 112 3.3.2.2 Northern Analysis for the Transcription of HMTgene 120 3.3.3 Morphological Effects of Cadmium Stress on Poplar Plantlets 116 3.3.4 Quantification of the Metal Accumulation Ability of HMT-Transformants 118 3.3.5 Tissue Distribution of Accumulated Cadmium Ions in HMT-Transformants 124 3.4 DISCUSSION 126 3.5 References 134 Chapter 4 - General Conclusions and Recommendations 140 vi LIST OF TABLES TABLE PAGE 1.1: Metal Accumulating Ability of the More Notable Hyperaccumulator Species 10 1.2: Metallothionein-like Genes in Plants 17 1.3: Various Phytochelatin Structures of Plant Types 17 3.1: Other Research Involving Agrobacterium-mediated Transformation of the Genus Populus 94 3.2: Particulars of the Graphite Furnace Atomic Absorption Spectrophotometry 108 3.3: Parameters of Graphite Furnace Atomic Absorption Spectrophotometry Readings 109 3.4: Cd Concentrations Accumulated in Tissue of Nontransformants and //MT-transformants 119 3.5: Analysis of Variance to Determine the Significance Between Pair-Wise Comparisons of the Mean Values of Cd Accumulation Between HMT-transformants and Nontransformants 123 vii LIST O F FIGURES FIGURE P A G E 1.1: The Relationship Between Hyperaccumulators, Metal Indicators and Metal Excluders 9 1.2: Heavy Metal Tolerance Mechanisms in Plants 14 1.3: The Phytochelatin Biosynthetic Pathway 19 1.4: The Yeast Vacuole Transporter, HMT, and its Role in Heavy Metal Tolerance 30 2.1 Amino Acid Sequence Comparisons of Glutathione Synthetase Gene from Seven Phylogenetically Distant Species 66 2.2 Nucleotide Sequence Alignment of a Poplar Glutathione Synthetase Gene Fragment to Arabidopsis and Brassica Glutathione Synthetase Genes 69 2.3 Southern Blot Analysis to Detect the Presence of the Glutathione Synthetase Gene in the Poplar Genome 71 2.4 Southern Blot Analysis to Detect the Presence of the Metallothionein-like Gene in the Poplar Genome 72 2.5 Toxicity Growth Curves of Poplar Suspension Culture's Response Over Time to Different CdCl2 and CuS04 Concentrations 74 2.6 Toxicity Response of Poplar Suspension Cultures to a Range of CdCl2 and CuS04 Concentrations 75 2.7 Toxicity Response of Poplar Suspension Cultures to Different CdCl2 and CuS04 Concentrations Under Chemical Inhibition of Phytochelatin Production 77 2.8 Reverse Transcription PCR to Detect the Induction of Glutathione Synthetase Production in Cd and Cu Stressed Samples 78 2.9 Northern Blot Analysis to Detect the Induction of GS and MT-like Genes in Cd-stressed Poplar Tissue 80 viii LIST OF FIGURES FIGURE PAGE 2.10 Northern Blot Analysis to Detect the Induction of GS and MT-like Genes in Cu-stressed Poplar Tissue 81 3.1: The Fission Yeast Schizosaccharomycespombe's Heavy Metal Tolerant (HMT) Gene 96 3.2: Construction of the //MTpBI121 Binary Vector for use in Agrobacterium-mediated Transformation of Poplar 101 3.3: Selection of Transformed Poplar Explants 111 3.4: Molecular Screening of Poplar Transformants 113 3.5: Analysis of the Expression of HMT Gene in Poplar Transformants 115 3.6: The Gross Morphological Effects of Cd Stress on a Poplar Hybrid 117 3.7: Cd Accumulation in Root Tissue of 7/MT-transformants 120 3.8: Cd Accumulation in Leaf Tissue of //MT-transformants 121 3.9: Cd Accumulation in Stem Tissue of //MT-transformants 122 3.10: Distribution of Cd Ions within the Tissues of //MT-transformants 125 ix Abbreviations Used A - adenine AAS - atomic absorption spectrophotometry Ala - alanine Ag- silver Al - aluminum amp - ampicillin Arg - arginine As - arsenic Asn - asparagine Au - gold Bi - bismuth bp - base pair BSO - L-buthionine sulfoximine C - cytosine CaMV35S - cauliflower mosaic virus 35S promoter Cd - cadmium CdCl2 - cadmium chloride cDNA - complementary deoxyribonucleic acid Co - cobalt Cr - chrominum Cs - cesium CsCl - cesium chloride CTAB - cetyltrimethylammonium bromide Cu - copper CuS04 - copper sulfate Cys - cysteine dH20 - distilled water dATP - deoxyadenosine dCTP - deoxycytidine dGTP - deoxyguanosine dNTP - mixture of deoxynucleotides dTTP - deoxythymidine ddTTP - dideoxythymidine DNA - deoxyribonucleic acid EDTA - ethylene diamine tetra acetic acid Fe - iron G - guanine Gin - glutamine Glu - glutamic acid GS - glutathione synthetase His - histidine H 20 2 - hydrogen peroxide Hg - mercury HMW-Cd - high molecular weight Cd-phytochelatin complex in vacuole HPLC - high pressure liquid chromatorgraphy He - isoleucine kan - kanamycin kb - kilobase kDa - kilodalton Leu - leucine Lys - lysine LMW-Cd - low molecular weight Cd-phytochelatin complex in cytosol Ni - nickel nm - nanometer Mn - manganese Met - methionine mm - millimeters mRNA - messenger ribonucleic acid MT - metallothionein OD6 0 0 - optical density at 600 nm 02' - superoxide PC - phytochelatin PCR - polymerase chain reaction PHA - polyhydroxyalkanoates PHB - poly-D-(-)-3-hydroxybutyrate xii Phe - pheylalanine Pb - lead Pro - proline PVP - polyvinylprolidone RNA - ribonucleic acid rpm - revolutions per minute RT - room temperature Sb - antimony SDS - sodium dodecyl sulphate Se - selenium Ser - serine S 0 2 - sulfur dioxide SSC - sodium chloride / sodium citrate St - strontium T - thymine TCA - trichloroacetic acid TCE - trichloroethylene Te - tellurium Thr - threonine Tris - tris-(hydroxymethyl)-aminoethane Tyr - tyrosine UV - ultraviolet xiii Val - valine W - tungsten w/w - weight per weight w/v - weight per volume Zn - zinc ACKNOWLEDGMENTS "The universe is full of magical things patiently waiting for our wits to grow sharper" - Eden Philpotts "Basic research is when I'm doing what I don't know I'm doing" - Werner Von Braun The above quotations reflect the philosophy on scientific research that I have formulated during the completion of my dissertation. There are many people who made it possible for me to embark on my scientific journey to whom I will forever be indebted - both as a scientist and as a person. I am thankful to my supervisors, Drs. Carl Douglas and John Carlson for giving me the opportunity to work on this project and for being patient as I tried to discover a few "magical things." Many thanks also to my supervisory committee members, Drs. Tony Glass and Brian Holl, for their encouragement, wisdom, and valued comments and suggestions on my thesis. I would also like to express my gratitude to my colleagues at UBC, especially to members of the Douglas and Kronstad laboratories, who, through daily interactions, have made me a better scientist. I would surely be remiss if I did not extend a special thank you to those people who aided in this work in a non-academic sense. The amount of unwavering support, enthusiasm and motivation that I have received from both friends and family have made this accomplishment possible. Words cannot express the depth of my appreciation to these people and I only hope that in my future endeavours I have the opportunity to return the favour. X V CHAPTER 1 - LITERATURE REVIEW 1.1 Global Pollution Currently, global population is tipping the scales at 5.8 billion people and growing at a pace of 80 million each year (Greep, 1998). Global economy has expanded from $5 trillion of output in 1950 to $29 trillion in 1997 (Brown, 1997). The combined demand set by this population growth and global economy are rapidly depleting the Earth's finite natural resources. The result is a bleak picture. It is estimated that forests are being cut at an alarming yearly rate of 6.1 million hectares of deciduous forests and 4.6 million hectares of tropical forests (Brundtland, 1989). Nutrient-rich top soils are being eroded and desert lands are spreading at the yearly rate of 60,000 square kilometers (Brundtland, 1989). The result is an elimination of habitats which is undoubtedly a major contributing factor in driving an estimated 150-200 species of both plants and animals to extinction each and every day (Brundtland, 1989). In addition to these assaults on the global environment there are also the problems of global warming, ozone depletion, falling water tables, collapsing fisheries, acid rain and, water and air pollution. It seems that the conflict between human activities and environmental constraints cannot be resolved by merely perpetuating present day patterns. As the challenging dynamics of global change gradually become clearer, the role of scientific researchers in shaping our common future becomes more pivotal. Sound scientific assessments on the state of global environmental problems are called for as well as innovative technologies to remediate them. 1 1.2 Heavy Metal Pollution Environmental pollution caused by the release of toxic heavy metals can ultimately be traced to the domestication of fire (Nriagu, 1996). Afterwards, with the development of mining and metal-based technologies, the association between metal pollution and humans was fixed. Over the past century, many different countries and regions have undergone an industrial revolution as a means to enhance the standard of living. As a direct result, currently the annual emissions of heavy metals exceed those of radioactive and organic wastes combined (Nriagu and Pacyna, 1988). Moreover, since the destruction of heavy metals by either biological or thermal oxidation is not feasible, as it is with organic pollutants, metals persist almost indefinitely in the environment (Patterson, 1990). As a consequence, today, by a conservative estimate, one quarter of the world soils are contaminated with heavy metals (Kruckeberg and Kruckeberg, 1990). Heavy metals are used in a number of consumer and agricultural products, such as phosphate fertilizers, batteries, stabilizers in plastics and synthetics, as well as in many industrial applications, such as extracting and refining non-ferrous metals and the burning of coal for fuel (Arnold et al., 1997). In Canada there are approximately 875 million tonnes of mining wastes and 185 million tonnes of radioactive tailings (Mclntyre and Lewis, 1997). The estimated cost to clean-up toxic metal pollution by conventional remediation practices in Canada is CAN $6 billion (Mclntyre and Lewis, 1997) and in the United States it is US $300 billion (Raskin et al, 1997). In addition to economic costs, a major concern regarding the presence of toxic metals in soils is the role that they play in a number of adverse health effects (Nwosu et al, 1995; Arnold et al, 1997). For example, cadmium has been implicated in several human diseases including, but by no means limited to, hypertension, birth defects, renal disorders, emphysema, arteriosclerosis and cancer (Ryan et al, 1982; Nwosu et al, 1995). 2 1.3 Conventional Remediation Practices Conventional practices to remediate heavy metal contaminated soils are largely engineering-based and usually involve extreme disruption to the site (Higgins et al, 1997; Macdonald, 1997). There are primarily three such methodologies to remediate contaminated soils: landfilling, incineration and electrokinetics (Cunningham et al, 1995). Toxic metal laden soils may simply be excavated and relocated to a landfill site. Prior to burial at the landfill site, cement is often added to the soil as a means to reduce overall volume and to prevent leaching of contaminants (Gray and Sotir, 1996). Landfilling as a remediation method is often criticized because it does not alleviate the problem but rather, concentrates and relocates the problem (Cunningham et al., 1995). Contaminated soils are often removed, isolated, incinerated and the residue returned to the site as barren soil (Higgins et al, 1997). Lastly, electrokinetics involves the use of electrodes that are plunged into contaminated soils and are used to create high enough temperatures to burn-off toxic heavy metals (Li et al, 1997; Reddy et al, 1997a; Reddy et al, 1997b). A common criticism of both incineration and electrokinetics is that they simply transform soil contamination into air pollution (Jakob et al, 1995; Vesterinen and Martti, 1996). Air contamination is often perceived to be more difficult to contain and, hence remediate, than is soil pollution (Jakob et al, 1995; Vesterinen and Martti, 1996). Typically the clean-up for such engineering methods to remediate one acre of metal contaminated soils can cost anywhere from CAN $600,000 to $2.5 million depending on the soil depth (Mclntyre and Lewis, 1997). This high economic cost and the desire to completely alleviate the problem prompted many researchers to investigate the use of biota-based soil remediation methods. 3 1.4 Bioremediation Every organism can be viewed as a collection of solutions that its species and progenitor species have evolved in response to problems it encountered during its struggle for survival. The efforts of researchers to exploit those solutions are promising new processes of remediating the global pollution problem. Attempts to identify organisms that can metabolize environmental pollutants have focused on organisms that have a rapid generation time - microorganisms. There has been much progress in the discovery of microorganisms that are able to degrade organic pollutants, including chlorinated compounds, polychloryl biphenyls, and polyaromatic hydrocarbons [see(Hoyle, 1993; McCarty, 1993)]. The in situ application of such bacteria would involve the stimulation of pollutant-degrading bacteria that are inherent to the area - referred to as biostimulation - or the introduction of toxin-degrading foreign bacteria -bioaugmentation (Gadd and White, 1993). The latter process is often done using bacteria which are encapsulated in ceramic beads and then the beads are shot into the soil (Renner, 1997). Bacteria-based heavy metal remediation has also been demonstrated. Much is known about the molecular mechanisms used by bacteria to alter the ionization states of metals and metal-chelating constituents of the bacterial cell have been identified [for review (Silver and Phung, 1996)]. However, since metals are not degraded, as are organic pollutants, the query of how microscopic bacteria sequestering toxic metals could efficiently and effectively be removed from the soils must be answered. This would be of paramount importance to ensure that the metals do not simply enter back into the soil. 1.5 Phy to remediation Phytoremediation refers to the use of plants and their root-associated microorganisms to remove, degrade or sequester organic pollutants and/or heavy metal contaminants from their ambient environment (Raskin et al, 1994; Chaney et al, 1997). A distinction has been drawn by some researchers that would further categorize types of phytoremediation according to the mechanisms phytovolatilization, rhizofiltration, phytostabilization, hyperaccumulation, tolerance (chelation), exclusion, and sub-cellular compartmentation. 1.5.1 Phytovolatilization, Rhizofiltration and Phytostabilization Phytovolatilization is used to describe the employment of plants to convert water or soil pollutants into innocuous gaseous compounds (Raskin et al., 1997). Currently, certain Populus hybrids are being used in field trials to remediate soils contaminated with the organic pollutant trichlorethylene (TCE), a dry-cleaning by-product, since previous laboratory experiments indicated that they are able to metabolize up to 90% of TCE into carbon dioxide and water (Newman a/., 1997). Recently, genetically-engineered Arabidopsis containing a modified version of a bacterial mercuric reductase gene, merA, was shown to convert the highly deleterious ionic form of mercury, Hg+2, to its relatively inert less toxic elemental gaseous form, Hg° (Rugh et al, 1996). In situations where a pollutant is completely converted through phytovolatilization into harmless compounds, the release of such compounds into the atmosphere is of no particular consequence. In the case of mercury contamination, the elemental form is not entirely benign, raising the question of whether using phytovolatilization to treat mercury-contaminated soil is the best strategy, especially considering that elemental mercury can undergo oxidation in the atmosphere to its ionic toxic form. 5 Rhizofiltration is a technique that has been used to clean-up both terrestrial and aqueous contamination (Dushenkov et al, 1995; Raskin et al, 1997). It takes advantage of the ability of certain microbes within the rhizosphere, as well as the capacity of a number of plant species to accumulate pollutants, predominantly heavy metals. A number of plant species have been shown to accumulate heavy metals preferentially within their root systems (Beauford et al, 1977), yet the use of these plants to remediate soils has seemingly little practical value since retrieving the roots would prove to be very ineffective in a large-scale project (Raskin et al, 1997). On the other hand, rhizofiltration may prove to be very effective at remediating aqueous environments. In areas surrounding Chernobyl, Ukraine, the use of Compositae species' labyrinth root systems as a filter to remove radioactive Cs and St from contaminated water has yielded promising and compelling preliminary results (Raskin et al, 1997). Lastly, phytoextraction refers to the sequestration of pollutants, mostly heavy metals, in above-ground plant tissues (Kumar et al, 1995; Raskin et al, 1997). In this manner, plants would accumulate and retain the heavy metals within their tissues and thereby not only remove them from the environment but also concentrate them in their tissues where they could be harvested, extracted and possibly re-used by industry. This process of recycling toxic heavy metals and thereby maintaining a constant level of such contaminants in the environment, as opposed to current practices which result in ever-increasing amounts released by industrial activities, is called biorecovery (Smith, 1991). The plants often used in phytoextraction programs are ones that inherently have the ability to accumulate heavy metals within their tissues: hyperaccumulators. 6 1.5.2 Hyperaccumulators The conjunction of two concepts suggested that phytoremediation could be a potentially aesthetically-pleasing and economically-attractive alternative to conventional remediation methods. Firstly, plants possess a number of unique physiological and morphological attributes that should facilitate their ability to access environmental contaminants. Plant root systems fertilize and aerate the soil and work in combination with soil microbes to mobilize minerals from the soil medium (Stomp et al, 1993). Furthermore, plant and tree roots have the ability to penetrate deeply into soils, up to 20-60m in some Eucalyptus species (Stone and Kalisz, 1991), and to achieve phenomenal surface areas, as much as 387 million miles of roots/hectare for a rye field (Dittmer, 1937). The mere physical presence of this extensive root system helps control soil erosion and also contributes to the detainment and localization of soil contaminants (Dix et al., 1997). This attribute of plant roots has been exploited for years as constructed wetlands consisting primarily of cattails (Typha latafolia) and duckweed (Lemna minor) have been used to retain aqueous contaminants from entering larger bodies of water (Smith, 1991; Salt et al., 1995a). Extensive root systems ensure that plants have a substantially larger surface area in contact with the soil medium. This enables plants to encounter more soil pollutants. Plants are able to transpire vast quantities of groundwater; some Populus species have been documented to transpire as much as 150 L of water/day (Stomp et ah, 1993). This means that plants have the potential ability to access pollutants that may be present in the groundwater. Plants also possess physiological traits that might aid them in soil remediation programs. Namely, the process of photosynthesis may provide biochemical reducing power to drive enzymatic reactions that could convert some metals, like Cu + 2 , Pb+2 and Hg+2, to their less toxic elemental forms (Rugh et al., 1996; Raskin etal, 1997). 7 Secondly, it has long been known that ecotypes of certain plant species growing on metalliferous soils absorb, and subsequently concentrate, heavy metals within their tissues to levels far exceeding that present in their surrounding environments (Peterson, 1971; Simon, 1977). Since plants form the basis of most food chains, they are often considered to be the ultimate source of the dietary exposure of humans to toxic metals (Ryan et al, 1982; Nwosu et al, 1995). For this reason, the ability of plants to concentrate metal ions within their tissues was considered a severely detrimental trait. Within the past decade or so, however, there has been a renewed interest in hyperaccumulators with respect to exploiting their "biomining" ability to remediate metalliferous soils through phytoremediation (Cunningham et al, 1995). This ability of hyperaccumulators to maintain a substantially higher metal concentration in their tissues relative to their soil conditions is the feature that distinguishes them from other metal tolerant plant groupings such as metal indicators and metal excluders (Figure 1.1) (Baker and Walker, 1990). 8 tilalui A m b i e n t So i l Heavy M e t a l Concen t ra t ion Figure 1.1: The Relationship Between Hyperaccumulators, Metal Indicators and Metal Excluders. The relationship between the metal concentration in the soil and that within plant tissue can he used to categorize a given plant species as a metal indicator, metal excluder or a hyperaccumulator (adapted from Baker and Walker. 1990). All plants have the ability to accumulate from their surroundings those metals which are essential for their growth and development, yet some hyperaccumulators have the ability to accumulate non-essential heavy metals, such as Cd. Pb and Cr. Still others accumulate toxic levels of metal micronutrients, such as Zn, Ni, Cu, Se and Fe (Baker and Brooks, 1989; Raskin et al, 1994)(Table 1.1). Hyperaccumulator species are strictly defined as plants that contain more than 1.0 mg/g (0.1%) Co, Cu, Cd, Pb or Ni or 10.0 mg/g (1.0%) Mn or Zn in their dry biomass (Baker and Brooks, 1989). Some hyperaccumulators contain up to 5% metals in their shoot dry biomass (Raskin et al, 1997) but one outstanding tree, Sebertia acuminata, has been shown to be 9 able to achieve a staggering level of 25% Ni in its sap (Jaffre et al., A 976). In some circumstances, this extent of metal concentration means that hyperaccumulators possess one or two orders of magnitude higher metal concentrations than are present in their surroundings. Table 1.1: Metal Accumulating Ability of the More Notable Hyperaccumulator Species Metal Plant Species Tissue Concentration (% dry weight) * "Natural" Soil Concentration 1 (%dry weight) * Cadmium Thlaspi caerulescens 0.11%2'3 Chromium Sutera fodina 0.24%3 0.25% Cobalt Haumaniastrum robertii 1.02%3 0.03% Copper Ipomoea alpina 1.23%3 0.002% Manganese Macadamia neurophylla 5.18%3 0.10% Nickel Psychotria douarrei 4.75%3 0.25% Sebertia acuminata 25.00% (sap)4 Selenium Astragalus spp. 1.00%5 Lead Brassica juncea 1.56 - 3.45%7-8 0.001% Thlaspi rotundifolium 0.82%3 Zinc Thlaspi calaminare 3.36%9 0.04% 1 calculated from (Baker and Brooks, 1989) 6 (Watanabe, 1997) 2 (Brown era/., 1995) 7 (Kumar et al., 1995) 3 (Baker and Brooks, 1989) 8 (Raskin et al., 1994) 4 (Jaffre et al., 1976) 9 (Brown et al., 1994a) 5 (Peterson, 1971) Of the currently known hyperaccumulator species, most are endemic to metalliferous soils (Baker and Brooks, 1989). In fact, hyperaccumulator species have frequently been used the past by prospectors as signs of the presence of certain metal ores. The restricted growth of Haumaniastrum robertii to metalliferous soils, for instance, resulted in this taxon being 10 colloquially referred to as "copper flower" (Baker and Brooks, 1989). Moreover, the majority of hyperaccumulator species in nature are found in only a few geographic localities: Ni accumulating plants are found predominantly in New Caledonia, Philippines, Brazil and Cuba (Baker and Brooks, 1989). Soils contaminated by anthropogenic means have also been seen to promote the growth of hyperaccumulators (Sieghardt, 1990; Shaw and Albright, 1990; Brown and Brinkmann, 1992; von Frenckell-Insam and Hutchinson, 1993). Antonovics and colleagues studied heavy metal tolerance in the grass species Anthoxanthum odoratum growing near a mine which was surrounded by lead- and zinc-contaminated soil (see Freeman and Herron, 1998). They discovered that the level of metal tolerance in the sampled plants directly correlated with the soil metal ion concentration which was indirectly correlated with the distance from the mine. These accounts of site-specific growth of hyperaccumulators indicate that the ability to sequester metal ions within plant tissue may very well be an ecophysiological adaptive mechanism that evolved independently in certain plant species that have been consistently exposed to heavy metal stress. Support for evolutionary independent origins of metal accumulation comes from the observation that there is seemingly no phylogenetic relationship among hyperaccumulator species. For example, the 145 known Ni hyperaccumulators are found in 6 superorders, 17 orders and 22 families (Baker and Brooks, 1989). Thus, it seems that the ability to accumulate heavy metals is the only common characteristic among this diverse group of plant species. Presently, the evolutionary significance of metal accumulation in plants is unknown and debated, yet several other theories have been put forward to account for this phenomenon, namely: disposal of toxic metals from plant tissue, drought resistance, a competitive interaction with neighbouring plants and as a, defense strategy against herbivores (Boyd and Martens, 1994) and/or pathogens (Boyd et al, 1994). Finally, toxic metals may simply be taken up from the soil 11 inadvertently while the plant is sequestering essential nutrients (Hagemeyer and Waisel, 1989; Raskin etal., 1997). At first glance, it would seem as if hyperaccumulators are ideal for phytoremediation. Nonetheless, despite their ability to accumulate toxic metals without incurring any harm unto themselves, there are some practical limitations in employing hyperaccumulators to remediate metalliferous soils. An often-cited shortcoming of most hyperaccumulators is that they are slow-growing, low biomass species that have a shallow root system (Cunningham and Ow, 1996). For example, T. caerulescens is only 8-12 inches tall at maturity (Knight et al, 1997). Hence, most hyperaccumulators do not readily lend themselves to large-scale harvesting which would be needed in major phytoremediation projects and, at best, these plants could only remediate the first few top inches of soil. Additionally, there is the consideration that a low biomass species would take a long period of time to remediate a given contaminated site. For example, it would take T. caerulescens approximately 16 yr. to remove Zn and Cd contaminants that were present in soils at 2,000 kg Zn/ha and 20-30 kg Cd/ha (a "typical" site estimate), since it is estimated to remove these pollutants at a rate of 125 kg/ha/yr. and 2 kg/ha/yr., Zn and Cd respectively (Brown et al, 1994b). There are however some species with somewhat larger biomass, such as Brassica juncea, that are able to accumulate metals. As such, these seem to be likely candidates to be used as harvestable species in field phytoremediation programs (Salt et al, 1995b; Blaylock et al, 1997; Raskin etal, 1997). Another limitation in utilizing hyperaccumulators in phytoremediation studies is that in most soil contaminated sites, there are a number of pollutants present at toxic levels, including organic compounds and several heavy metals. Yet, most hyperaccumulators only exhibit tolerance to one metal (see Table 1.1) (Cunningham and Ow, 1996) and do not detoxify organic pollutants. 12 There is considerable focus in the phytoremediation arena to overcome these technical hurdles that presently lie in the way of applying this research to large-scale industrial soil remediation projects. The collective solution seems to be to find or produce a large biomass hyperaccumulator species that could withstand the harsh conditions that are typically present in polluted soils. To this end, efforts have been divided into two camps - the use of classical genetic techniques, such as breeding (Gustafson and Ross, 1990; Florijn and Beusichem, 1993; Pollard and Baker, 1995; Tilstone and Macnair, 1997) and mutant screening (Penner et al, 1995; Larsen et al, 1998), and the use of biotechnology techniques, such as genetic engineering (Misra and Gedamu, 1989; Maiti et al, 1991; 1992; Yeargan et al, 1992; Brandle et al, 1993; Hasegawa et al, 1997). The ultimate goal of this type of research is the elucidation of how hyperaccumulators acquire, translocate, sequester and/or metabolize contaminants and subsequently to identify the underlying genes responsible for this ability and to transfer these genes to high biomass plants. Although efforts are underway, progress has been slow and there is currently little known about the physiology, biochemistry and molecular biology of hyperaccumulators. 13 1.5.3 Metal Tolerance Mechanisms in Plants Figure 1.2: Heavy Metal Tolerance Mechanisms in Plants Exclusion and chelation of metals to outer cell wall components are two ways that plants might be tolerant to heavy metals. The uptake of protons may alter the pH of the soil and thereby make metal ions less bioavailable for plants. The release of organic acids may chelate metal ions within soils and make them less bioavailable for plants. Intracellular metal-chelating mechanisms include cytochrome P-450, glutathione S-transferase. phytochelatins. and metallothionein-like proteins. Metal ions complexed with some chelating compounds, like organic acids and phytochelatins, are sequestered within the vacuole. (Adapted from Coleman et al, 1997) 14 1.5.3.1 Metal-chelating Compounds 1.5.3.1.1 Metallothionein In vertebrates, cyanobacteria, and some fungi, heavy metals are stably sequestered in the cell cytosol by a class of proteins, termed metallothioneins (MT) (Tomsett and Thurman, 1988). Exposure to toxic metals, such as Hg, Cu, Cd, Zn, Co and Ni, causes rapid de novo synthesis of MT in mammalian cells, suggesting that MT plays a role in metal detoxification, metabolism and/or homeostasis (Karin et al., 1984). The mammalian MTs have been extensively studied and their properties are well documented (Hamer, 1986). Structurally, MTs are low molecular weight proteins (typically 8-5 kDa) with a characteristically high cysteine content (usually about 30%) (Tomsett and Thurman, 1988). The majority of cysteine residues are seen within two motifs: cys-x-cys or cys-cys (Hamer, 1986). The conserved location and spacing of cysteine residues within MT proteins from numerous mammalian species indicates a functional role for these cysteine residues (Lange et al, 1990). Indeed, heavy metals have been found to exclusively bind to MT through these cysteinyl side chains (Hamer, 1986). Further structural analysis of mammalian MT reveals two domains: a and p. The alpha domain forms the carboxy terminal portion of the molecule, contains eleven cysteines and has been shown to bind four metal ions. In addition, the beta domain binds three metal ions to its nine cysteine residues (Tomsett and Thurman, 1988). Moreover, the alpha domain has been shown to display a remarkably high affinity for cadmium; indeed, it displays a 10,000-fold higher affinity for cadmium than for any other metal ion (Pan et al., 1993). Proteins having a strong similarity to MTs are not found in plants; however, cDNAs corresponding to putative MT-like proteins have been cloned from Mimulus guttatus (Miranda et al, 1990), maize (Framond, 1991), soybean (Kawashima et al, 1991), broad bean (Foley et al, 15 1997), tomato (Whitelaw et al, 1997), white spruce (Dong and Dunstan, 1996), Douglas-fir (Chatthai etal, 1997), barley (Okumura et al, 1991), wheat (Lane et al, 1987), pea (Evans et al, 1990), rice (Yu et al, 1998), coffee (Moisyadi and Stiles, 1995) and Arabidopsis (Karin et al, 1984). The metal-binding role played by the proteins encoded by MT-like genes recently identified in plants is controversial. Yu et al. (1998) reported very strong metal-induced expression of the rice MT gene. An Arabidopsis Cu-sensitive mutant, cupl-1, was seen to accumulate substantially higher levels of Cu and, to a much lesser extent, Cd in its root tissue compared to wildtype plants (Vliet et al, 1995). The Cu-sensitive phenotype is correlated with altered expression of a Cu-inducible root-specific metallothionein gene, MT2a; MT2a is expressed in the cup-1 mutant roots under conditions that it is not expressed in wildtype (Vliet et al., 1995). Furthermore, the function of a pea MT gene was analyzed by expressing the pea MT protein in both Escherichia coli and Arabidopsis (Evans et al, 1992). In both cases, the pea MT gene conveyed an enhanced level of tolerance to Cu but not to Cd or Zn. It was also found that there was a 7-8 fold increase in the amount of Cu accumulated in the transgenic individuals compared to their wildtype counterparts. In addition, Zhou and Goldsbrough (1994) demonstrated that two different Arabidopsis MT genes are capable of complementing a deletion of the yeast MT gene Cupl. These findings indicate that plant MT genes have a functional role in metal detoxification, specifically chelating and accumulating Cu ions. In contrast to these results, evaluation of the induction of MT genes in some plant species have revealed that the proteins are constitutively present (Evans et al, 1990) or that they are negatively-regulated by the presence of toxic metals, especially Cu ions (Miranda et al, 1990). In still other species, MT genes do not seem to be expressed in relation to metal stress but are developmentally regulated, indicating a role in metal homeostasis rather than metal tolerance (Kawashima et al, 1992; Dong and Dunstan, 1996). 16 Table 1.2: Metallothionein-like Genes in Plants Plant Species Transcript Induction in Relation to Metal Stress Reference Mimulus guttatus decrease (Miranda et al, 1990) Arabidopsis increase (Karin etal, 1984) Soybean decrease (Kawashima et al, 1991) Barley increase (Okumura et al, 1991) Wheat increase (Lane etal, 1987) Douglas-Fir increase (Chatthai et al, 1987) Maize constitutive (root) (Framond, 1991) Pea constitutive (root) (Evans etal, 1990) Rice increase (shoots) decrease (roots) (YuetaL, 1998) 1.5.3.1.2 Phytochelatins Many plants and some fungi, respond to excess metals by producing a class of small metal-binding peptides, the phytochelatins (PCs) (Rauser, 1990; Rauser, 1995). Derived from glutathione, PCs have the general structure (y-glutamyl-cysteine)n glycine where n is from 2 to 11 (slight variations of this structure exist, Table 1.3) (Grill et al, 1985; Rauser, 1995). As indicated by the presence of the y-glutamic acid linkages in the peptide chain, PCs are not direct gene products but, rather, are products of a three-enzyme biosynthetic pathway (Rauser, 1995)(see Figure 1.3). Table 1.3 - Various Phytochelatin Structures of Plant Types General Structure [yGluCys]nGly ; n= 2 to 11 Monocots [yGluCys]nSer Legumes [yGluCys]n(3Ala Maize [yGluCys]nGlu Yeast and Maize [yGluCysL Adapted from Rauser (1995) 17 The first step in the synthesis of PCs from glutathione is the joining of a cysteine residue to glutamic acid and this is catalyzed by y-glutamylcysteine synthetase (Jackson et al, 1987). Following this, glutathione synthetase catalyzes the reaction of the addition of glycine to y-glutamylcysteine. Lastly, PC synthase, an enzyme constitutively present in plant cells, elongates the peptide to produce a peptide consisting of 2-11 y-glutamylcyteine residues and a glycine (Grill et al, 1989) . Presumably, metal ions activate PC synthase to initiate PC production. The resultant PCs, in turn, eventually deactivate PC synthase by chelating the heavy metal cofactors (Grill etal, 1989). 18 S H I H COO-Figure 1.3: The Phytochelatin Biosynthetic Pathway. The synthesis of phytochelatins is initiated by the formation of a cvsteine-glutamate diaminoacid which is then repeated a number of times with the final peptide ending in a single glycine molecule. (Adapted from Ishikawa et al, 1997) 19 The finding that fission yeast Schizosaccharomyces pombe mutants defective in PC synthesis are more sensitive to metal ions than wildtype strains supports the hypothesis that PCs are functionally analogous to MT and, hence, play a role in metal tolerance (Mutoh and Hayashi, 1988). Consistent with this hypothesis, is the finding that over 200 plant species, encompassing representative species of all the plant classes, produce phytochelatins (Gekeler et al, 1989) and that most are induced under some sort of heavy metal stress (Steffens, 1990). Often when plants are subjected to heavy metal stress not only is the production of PCs activated but there is also an initial decline in the cellular level of glutamine (Scheller et al., 1987). The principle cadmium-chelating compounds isolated from metal-stressed green alga Chlamydomonas reinhardtii was found to be PCs (Howe and Merchant, 1992). Additionally, treatment of Lycopersicum esculentum and Rauvolfia serpentina suspension cell cultures with butathionine sulfoximine, a specific inhibitor of glutathione synthetase, decreased PC production and impaired growth on cadmium-containing media (Steffens, 1990). Also, an Arabidopsis mutant, cad-1, that exhibited an increased sensitivity to cadmium and mercury, but only a slight intolerance to Cu and Zn, was found to have an inability to accumulate PCs (Howden and Cobbett, 1992). Upon further analysis the mutants were found to produce wild-type levels of glutathione, the precursor to PCs, but displayed a deficiency in the activity of PC synthase, as revealed by enzyme assays (Howden et al, 1995). These results give compelling evidence that PCs play a pivotal role in cadmium tolerance in plant cells. In fission yeast cells there is evidence that two forms of PC- metal complexes are formed in response to heavy metal stress: a low molecular weight, 3-4 kDa, PC-Cd complex and a high molecular weight, 6-9 kDa, PC-Cd-S"2 complex (Murasugi et al, 1983). Mutoh and Hayashi (1988) found that yeast strain mutants that were defective in the production of the PC-Cd-S"2 20 ^ complex displayed a hypersensitivity to cadmium. Also, this high molecular weight complex has also been found in Se-tolerant wild mustard Brassica juncea (Speiser et al., 1992) and tomato, Lycopersicon esculentum (Reese et al, 1992). Spectroscopic analysis of the tomato PC-Cd-S"2 complex showed that it consists of a CdS crystalline core with a particle diameter of 2.0 run and PC peptides bound around this core (Reese et al, 1992). It has been hypothesized that the addition of sulfur to the PC-Cd complex adds a higher binding capacity and an enhanced stability to the structure, thereby explaining the role of this high molecular weight complex in conferring heavy metal tolerance (Reese and Winge, 1988). 1.5.3.1.3 Organic Acids It has long been observed that organic acids chelate heavy metals, but there is conflicting evidence regarding the role of organic acids in the metal accumulating ability of hyperaccumulators (Lee et al, 1977). In numerous Ni accumulating species, such as Serberia acuminata, Homalium francii, Homalium kanaliese, Hybanthus austrocaledonicus and Hybanthus caledonicus an association of organic acids and heavy metal tolerance has been seen (Lee et al., 1977). Additionally, Cu and Zn resistant mutants of Nicotianaplumbagnifolia have elevated levels of citrate and malate in comparison to wildtype plants, and they only display this phenotype when in the presence of heavy metals (Kishinami and Widholm, 1987). Also, when citrate or malate, but not fumarate or succinate, were added to the culture medium, they conferred Cu and Zn tolerance to wildtype cells (Kishinami and Widholm, 1987). This result is consistent with the idea that N. plumbagnifolia is metal resistant, at least in part, because of its ability to accumulate the metal chelators citrate and malate. 21 In contrast to these findings, Shen et al. (1997) found constitutively elevated concentrations of malate in the shoots of both a known hyperaccumulator, Thlaspi caerulescens and a nonhyperaccumulator T. ochroleucum. Thus, they concluded that although malate may play a role in heavy metal chelation, due to the constant high levels of malate in both species studied, it cannot explain the species specificity of metal tolerance and the hyperaccumulator ability. With the use of computer/ thermodynamic modeling, Wang et al. (1991) devised a mechanism to explain the interaction between organic acids and heavy metals within Nicotiana tabacum cell cultures. Specifically, the model shows that citrate has a high potential for complexing cadmium over the entire typical range of vacuolar pH values (pH 4.3 -7), complexing as much as 60% of the available cadmium at pH 5. Based on their computer-generated findings, the researchers paint a scenario where in tobacco cell cultures under low or mild cadmium metal toxicity conditions, i.e. 4 hr exposure to 45 pM Cd, vacuolar citrate-bound cadmium would be the predominant form of accumulated cadmium. Under more severe cadmium stress, i.e. 4 hr exposure of 90-600 pM, they predict that the synthesis of metal-chelating peptides would be induced and the majority of accumulated cadmium within the tobacco cell would then exist bound to phytochelatin peptides sequestered within the vacuole. This model is consistent with the findings that heavy metal stress does not induce the production of organic acids in tobacco suspension cultures (Krotz et al, 1989), whereas phytochelatin production does seem to be induced under certain levels of metal stress (Steffens, 1990). 22 1.5.3.1.4 Histidine The affinity between nickel and histidine has been known for many years and has been exploited as a means to isolate and purify recombinant proteins that are expressing a six-histine tag to a matrix of immobilized nickel. Kramer and collegues (1996) investigated the idea that the Ni hyperaccumulating ability of a member of the Brassicasceae family, Alyssum lesbiacum, might be attributed to an enhanced production of the amino acid histidine. To this end, the researchers quantified the amount of histidine in the xylem sap of Alyssum lesbiacum and compared it to the close relative non-hyperaccumulator species, Alyssum montanum. After exposure to toxic Ni concentrations, the plants were analyzed and it was found that Alyssum lesbiacum produced a 36-fold increase in the amount of xylem L-histidine in comparison to that of Alyssum montanum. Moreover, modeling of the ligand-complex was performed in Alyssum lesbiacum xylem exudates and it was found that approximately 98% of the histidine produced was indeed bound to nickel. Lastly, the non-hyperaccumulator Alyssum montanum was exposed to toxic Ni concentrations and treated simultaneously with histidine. The result was a substantial increase in both its nickel tolerance and its capacity to transport nickel to its shoot tissue. Collectively these results are consistent with the idea that the enhanced production of histidine is responsible for the Ni hyperaccumulating ability in Alyssum lesbicum. 1.5.3.1.5 Root Exudates An exclusion mechanism for metal tolerance in plants renders the metals present in the ambient environment less bioavailable. It has been postulated that if certain metal-chelating compounds could be excreted by plant roots then the metals could, and would, no longer enter into the root apex (Kochian, 1995). Indeed, recent experimental evidence indicates that metal-binding ligands, such as organic acids, are released into the rhizosphere by certain plant species, 23 including snapbean (Miyasaka et al, 1991), maize (Pellet et al, 1995), wheat (Delhaize et al, 1993; Basu et al, 1994) and Arabidopsis (Larsen et al, 1998), and that the level of metal tolerance is directly correlated to the release of such ligands. For example, an Al-tolerant mutant of Arabidopsis, air, was shown to release greater amounts of citrate (slight increase), malate (2-fold) and pyruvate (3-fold) compared to wildtype (Larsen et al., 1998). This result suggests that the Al-tolerance phenotype is caused by the enhanced organic acid exudation. The exact mechanism that led to the release of organic acids remains to be experimentally determined. Furthermore, the expression of Pseudomonas aeruginosa''s citrate synthase gene in tobacco (Nicotiana tabacum) and papaya (Carica papaya) resulted in both the overproduction of citrate in the plants' root tissues and tolerance up to 300pM Al whereas control plants were sensitive to 50 pM Al (Fuente et al, 1997). This finding illustrates that the production, and subsequent secretion, of the organic acid citrate is a mechanism for Al tolerance in plants. Another mechanism of metal exclusion that has frequently been alluded to but has only recently been demonstrated by experimentation is rendering toxic metals less bioavailable by an elevation in the pH of the rhizosphere adjacent to the root apex. Degenhardt et al. (1998) identified an aluminum resistant mutant, air-104, in Arabidopsis that was shown by microelectrode system to display a 2-fold increase in net H + influx in the root tip compared to measurements taken in wildtype plants. This increased flux raised the root surface pH by 0.15 units - an increase that was shown in toxicity assays to make a substantial difference in the level of Al tolerance exhibited in plants. 24 1.5.3.1.6 Cytochrome P-450/ Glutathione-conjugates Cytochrome P-450 is a class of heme-containing proteins that carries out oxidative reactions. Cytochrome P450 enzymes catalyze the non-selective oxidative metabolism of many foreign compounds (Coleman et al, 1997). This enzyme system does not act independently, but, rather, is part of an electron transport chain found in the endoplasmic reticulum (Coleman et al, 1997). Numerous cytochrome P-450 enzymes have been identified - over 60 in Arabidopsis (Coleman et al, 1997). Cytochrome P-450s can be involved in heavy metal detoxification. It is thought that in some cases the initial step in the detoxification process would be for cytochrome P-450 to oxidize metal compounds in order to form a suitable functional group that would allow them to form a covalent linkage to an endogenous hydrophilic molecule, such as glutathione (Coleman et al, 1997). If the metal compound is transported into the cell already harbouring a functional group that will facilitate the conjugation to glutathione, then cytochrome P-450 is not needed. Glutathione [N-(N-L-glutamyl-L-cysteinyl)glycine], an ubiquitous tripeptide, plays an important role in the cellular detoxification of electron-rich contaminants (Field, 1996; Ishikawa et al., 1997). It forms a non-toxic water soluble conjugate with metal ions through the activity of glutathione S-transferase (Ishikawa et al, 1997). Next, this conjugate would be exported from the cytosol into the vacuole by membrane transporters in order to compartmentalize the contaminant (Martinoia, 1993). Li et al. (1996), found that the yeast cadmium factor gene, YCF1, from Saccharomyces cerevisae encodes a vacuolar glutathione S-conjugate pump. A disruption in YCF1 results in highly Cd-sensitive cells that are unable to shuttle glutathione-Cd complexes from the cytosol into the vacuole. Using the yeast gene as a homolog, a glutathione S-conjugate transporter, AtMRPl, and a multi-purpose ABC (ATP binding cassette) vacuole transporter, AtMRP2, were cloned from Arabidopsis and subsequently shown to transport chelated compounds into yeast vacuoles (Lu et al, 1997; Lu et al, 1998). Interestingly, there is 25 some evidence that such vacuolar compartmentalization of contaminants may be a function that is unique to certain plant cell types. Blake-Kalff et al. (1997) noticed that in barley cells the xenobiotic-glutathione conjugate accumulated in mesophyll vacuoles but in epidermal cells the conjugate was formed and remained in the cytosol. This suggests that the vacuole membrane residing glutathione-conjugate transporter may be tissue-specific and as such would render some cells more adept at detoxifying xenobiotics. In mammalian cells, the glutathione S-conjugate is ultimately transported out of the cell. Whether or not this occurs in plant cells is not clear. It may be that the conjugates remain in plant vacuoles (Ishikawa et al., 1997) or that they are acted upon by carboxypeptidase that would remove the glycine residue from the glutathione as well as a dipeptidase that would catalyze the removal of the amino terminal glutamic acid (Coleman et al., 1997). The result of these two enzymatic steps would be a cysteine conjugate, that has been theorized to be exported back into the cytosol where it could be acted upon by cysteine S-lyases (Coleman et al, 1997). The end result would be metabolites that could be exported to the apoplast where they may remain bound to cellular constituents such as lignin or cellulose (Coleman et al, 1997). Hence, it appears that in the case of heavy metal contaminants, the detoxification mechanism involving cytochrome P-450, glutathione, glutathione S-transferase is not a permanent solution in combating heavy metal stress, but, instead is a temporary storage and/or transport system for toxic metal ions in plant cells. Nevertheless, elevated levels of glutathione and glutathione S-transferase have been observed when plants have been exposed to heavy metal stress (Scheller et al, 1987). In the green alga Chlamydomonas reinhardtii, for example, it was found that the principal thiol-containing compound induced under Hg+2 stress was glutathione (Howe and Merchant, 1992). Ulmasov et al. (1995) studied the induction of the glutathione/ glutathione S-transferase 26 detoxification pathway by analyzing transcriptional activation of the soybean (Glycine max) GH2/4 gene that encodes for a glutathione S-transferase. In order to detect the responsiveness of this gene to the presence of various contaminants, the researchers produced a fusion gene of the GH2/4 promoter to the P -glucuronidase reporter gene and subsequently produced transgenic tobacco. They found the promoter to be induced under many conditions including treatment with auxin, peroxide and cadmium ions. These findings are consistent with the hypothesis that glutathione/ glutathione S-transferase are an important part of plant responses to a variety of environmental stresses. 1.5.3.2 Metal Transporters In order to engineer a high biomass plant that is able to accumulate heavy metals as a means to remediate metalliferous soils, more fundamental research regarding the molecular biology of metal transport in plant cells must first be conducted. Some plant transporters have recently been identified but most of the progress has occurred in simpler, easier to manipulate, organisms such as yeast (Ow, 1996). 1.5.3.2.1 Plasma Membrane Metal Transporters The transport of metal ions across plant plasma membranes plays an essential role in many physiological processes including mineral nutrition, cell expansion, the transduction of environmental signals and adaptation to environmental stresses (Schachtman et al., 1997). Due in large part to the Arabidopsis genome sequencing project, a few metal transporters have recently been identified from this model plant through sequence homology to bacterial or yeast metal transporters. To date, four zinc transporters, ZIP 1-4, (Grotz et al, 1998) and a putative 27 metal-transporting P-type ATPase, PAA1, have been cloned (Tabata et al, 1997). As well, three members of a metal transporter family, OSNRAMP 1-3, were isolated from Oryza sativa and displayed a distinct homology to known yeast manganese transporter genes (Belouchi et al, 1997). Although research is presently ongoing to verify the function of these genes, the isolation of these plant metal transporters is a major step in the direction of elucidating mechanisms of metal ion accumulation and homeostasis in plants, in particular in hyperaccumulators. Another mechanism that has been fruitful in the isolation of plant metal transporters is functional complementation. Kampfenkel et al (1995) isolated an Arabidopsis cDNA by complementation of a mutant yeast strain defective in high affinity copper uptake that encodes for a putative copper transporter. Additionally, the IRT1 (iron-regulated transporter) gene of Arabidopsis encoding a probable Fe+2 transporter was cloned by functional expression in an iron-defective yeast strain (Eide et al, 1996). Further analysis in this plant, as well as Pisum sativum, revealed that the expression of this iron transporter is induced under Fe+2 deficient conditions and that the transporter might facilitate the uptake of other divalent metal cations, such as Cd+2 and Zn+2 (Cohen et al, 1998). The identification of such a non-selective transporter would be significant in the field of phytoremediation since the toxic metals that contaminate soils are often non-essential to plant growth and, thus, it is unlikely that any plant would possess a transporter that is specific to these non-essential toxic ions. However, they might have evolved to transport essential metal ions and under conditions of polluted soils serve as entry points of potentially toxic non-essential metals. 28 1.5.3.2.2 Vacuole Membrane Metal Transporters The ability to compartmentalize toxic ions and thereby remove them from the cytosol where they are liable to disrupt important cellular functions, may be an important strategy of metal tolerance/ sequestration. Aside from the aforementioned glutathione S-conjugate transporters found in vacuole membranes there has also been the discovery of a phytochelatin-cadmium complex vacuolar transporter in yeast. Ortiz et al. (1992) isolated a gene, HMT1 (heavy metal tolerant -1) from the fission yeast, Schizosaccharomyces pombe, that complemented Cd-sensitive yeast mutants that were deficient in the production and accumulation of a sulfide containing phytochelatins-Cd complex. The HMT1 protein is an ABC-type membrane transporter and immunoblot analysis of subcellular fractions indicated that the HMT protein was localized in the vacuole membrane (Ortiz et al., 1995). Overexpression of the HMT1 gene in yeast strains resulted in a significant heightening of the tolerance to Cd ( 0.025 mM to 0.75 mM CdS04) as well as a higher intracellular level of cadmium. In vitro transport of radioactively labelled substrates in isolated vacuole membrane vesicles indicated that HMT is involved in the transport of phytochelatins, phytochelatin-Cd complex and Cd ions. These findings indicate the importance of HMT 1 in mediating the transportation and sequestration of Cd in the vacuole of yeast cells. 29 Cd A D P + P cytosol Figure 1.4: The Yeast Vacuole Transporter, HMT, and its Role in Heavy Metal Tolerance. Once Cd ions enter into a yeast cell, they are chelated in the cytosol to phytochelatins (PC) resulting in the formation of a low molecular complex (LMW-Cd). This complex is then shuttled into the vacuole by the activity of the HMT1 protein. In the vacuole, the LMW-Cd complex is bound to more Cd ions, more phytochelatins and sulfur to form the high molecular weight complex (HMW-Cd). (From Rauser. 1995) 30 1.6 Other Heavy Metal Accumulating/ Detoxifying Biotechnology Research 1.6.1 Cadmium-accumulating Transgenic Metallothionein Tobacco The mammalian metallothionein has been extensively characterized and it is known that the carboxy-terminus, the alpha domain, displays a substantial ability to bind to cadmium ions (Pan et al., 1993). In an effort to produce transgenic tobacco plants that were able to accumulate cadmium from contaminated soils, Pan et al. (1993) produced a chimeric gene that contained 12 tandemly repeating copies of the alpha-metallothionein gene and expressed it in tobacco cells. They found a 10-fold increase in cadmium tolerance in the transgenic lines compared to non-transformed lines. Further work in this area then focused on the possibility of partitioning accumulated Cd into nonconsumed portions of transgenic tobacco plants (Yeargan et al., 1992; Brandle et al, 1993; Elmayan and Tepfer, 1994; Hattori et al, 1994). The reduction in leaf accumulation of toxic metals was desired since the dietary intake of metals can result in both acute and chronic illnesses in humans. Some researchers noticed up to a 70% lower Cd concentration in shoots of transgenics compared to nontransformed plants when tobacco was transformed with the mammalian MT gene under the control of the cauliflower mosaic virus 35S promoter (Elmayan and Tepfer, 1994; Hattori et al, 1994; Deborne et al, 1998). These results indicate that Cd can be sequestered in root tissue as Cd-metallothionein complex and that this would effectively reduce the Cd content in harvestable, edible plant tissues. Also, these findings illustrate the feasibility of producing metal-accumulating plants and the ease of manipulating the localization of the accumulated metals. 31 1.6.2 Mercury-detoxifying Transgenic Arabidopsis and Yellow Poplar Of all metal contamination, mercury is often cited as being the most detrimental (D'ltri and D'ltri, 1977). Like many metals, mercury exists in the environment in different ionic states and its toxicity varies depends on its ionic status - reactive, toxic Hg + 2 and somewhat inert, less toxic Hg 0 (Rugh et al., 1996). Some gram negative bacteria have developed electrochemical reduction detoxification mechanisms to combat toxic Hg+2 (Summers, 1986). The bacterial gene merA, for instance, encodes for a mercuric ion reductase which is able to convert Hg+2 to Hg° (Summers, 1986). Rugh et al. (1996) modified this bacterial mer A gene to contain plant-specific codons, put the gene under plant-regulatory elements and, in turn, expressed the gene in Arabidopsis. Transgenic seedlings expressing the mer A gene were able to thrive on media containing levels of mercury, up to 100 pM HgCl2, that were toxic to wildtype plants. As well, the transgenics were able to volatilize 50 ng Hg°/g of seedling tissue compared to only 15 ng Hg°/g of the nontransformed seedlings. Lastly, the rate of Hg° expelled and the level of mercury resistance were directly proportional to the merA mRNA levels, strongly indicating that the phenotype exhibited by the transgenic seedlings is due solely to the expression of the bacterial mercuric ion reductase. These researchers have recently transferred this mercury-reducing ability into a large biomass plant species, specifically, yellow poplar (Liriodendron tulipifera), and again have produced transformed plantlets that not only are tolerant to the heavy metal mercury but are also able to reduce its ionic form to its elemental form at a rate at least 10 times that of wildtype plantlets (Rugh et al. 1998). These experimental results clearly display the potential of biotechnology approaches to produce plants that can remediate metalliferous soils. 32 1.7 Poplar-based Phytoremediation Research Interest in the plant genera Nicotiana and Arabidopsis has culminated in their use as model systems in plant genetics. In a similar manner, members of the Populus genus are increasingly being considered as a model system for angiosperm tree species. The hybrid poplar clone, Populus alba x P. tremula (INRA clone 717-1B4) was selected as the organism of choice in this research since aspects of poplar physiology are well-studied and transformation and tissue-culture based regeneration methodologies of many poplar hybrids and species are currently known (Stettler et al, 1996; Kim et al, 1997; McCown, 1997). As well, trees belonging to the Populus genus have a relatively small genome size (550Mb) which has facilitated the construction of saturated genetic maps of a number of hybrids and species (Bradshaw et al, 1994; Bradshaw and Stettler, 1995). These hybrids are also well-known for their rapid growth rates, short rotation cycles, capacity to propagate vegetatively and for their ability to form extensive and deep tap root systems (Schnoor et al, 1995). Indeed, for these very reasons, poplar trees have become an important source for pulp and paper in the Pacific Northwest. These structural characteristics of poplar also make it an attractive candidate for soil remediation since it would have ample opportunity to encounter soil contaminants. Only recently has poplar's potential as a phytoremediation tool been recognized. Field trials are currently underway that utilized poplar's inherent ability to metabolize certain organic environmental pollutants. For instance, the U.S. Army is currently using hybrid poplars to remediate ammunition sites that contain elevated levels of 2,4,6-trinitrotoluene (TNT) (see Boyajian and Carreira, 1997). Hybrid poplars have also been used to remediate other organic soil contaminants, such as the pesticide atrizine (Burken and Schnoor, 1997) and the dry-cleaning by-product trichloroethylene (Newman et al, 1997). 33 1.8 Research Objectives The goal of this thesis was to investigate the potential use of poplar in heavy metal phytoremediation. The first objective was to define the response of the poplar hybrid Populus alba x P. tremula (INRA clone 717-1B4) to heavy metal stress at the molecular level, as a means to determine poplar's repertoire of heavy metal stress-induced defenses. A second objective was to test the ability to heighten poplar's tolerance to heavy metal stress by generating genetically-engineered poplar hybrids that express the Schizossacharomyces pombe vacuole transporter gene, HMT-23. This gene has been shown to confer an enhanced tolerance to heavy metal stress in yeast (Ortiz et al., 1992). Ultimately, the feasibility of employing such transgenic poplar hybrids to remediate metalliferous soils was determined. 34 1.9 References Arnold, T., P. Chevalier, J. Clarke, S. Hill, C. Humphrey, S. Jones and L. Trip (1997). The Status of Cadmium, Lead and Mercury in Canada, Environment Canada. Baker, A. J. M. and R. R. Brooks (1989). "Terrestrial higher plants which hyperaccumulate metallic elements - A review of their distribution, ecology and phytochemistry." Biorecovery 1: 81-126. Baker, A. J. M. and P. L. Walker (1990). Heavy Metal Tolerance in Plants: Evolutionary Aspects. CRC Press, New York. Basu, U., D. Godbold, and G.J. Taylor (1994). "Aluminum resistance in Triticum aestivum associated with enhanced exudation of malate." Journal of Plant Physiology 144: 747-753. Beauford, W., J. Barber, and A.R. Barringer (1977). "Uptake and distribution of mercury within higher plants." Physiologia Plantarum 39: 261-265. Belouchi, A., T. Kwan, and P. Gros (1997). "Cloning and characterization of the OSNRAMP family from Oryza sativa, a new family of membrane proteins possibly implicated in the transport of metal ions." Plant Molecular Biology 33: 1085-1092. Blake-Kalff, M. M. A., R. A. Randall, and J.O.D. Coleman (1997). Compartmentalization of detoxified xenobiotics in plant cells. In Regulation of Enzymatic Systems Detoxifying Xenobiotics in Plants. Kluwer Academic Publishers, Dordrecht. Blaylock, M. J., D. E. Salt, S. Dushenkov, O. Zakharova, C. Gussman, Y. Kapulnik, B.D. Ensley and I. Raskin (1997). "Enhanced accumulation of Pb in indian mustard by soil-applied chelating agents." Environmental Science & Technology 31: 860-865. Boyajian, G. E. and L. H. Carreira (1997). "Phytoremediation: a clean transition from laboratory to marketplace?" Nature Biotechnology 15: 127-128. Boyd, R. S. and S. N. Martens (1994). "Nickel hyperaccumulation by Thlaspi montanum var. montanum is acutely toxic to an insect hebivore." Oikos 70: 21-25. Boyd, R. S., J. J. Shaw, and S.N. Martens (1994). "Nickel hyperaccumulation defends Streptanthuspolygaloides (Brassicasceae) against pathogens." American Journal of Botany 81: 294-300. Bradshaw, H. D. and R. F. Stettler (1995). "Molecular genetics of growth and development in Populus. IV. Mapping QTLs with large effects on growth and phenology traits in a forest tree." Genetics 139: 963-973. 35 Bradshaw, H. D., M. Villa, B.D. Watson, K.G. Otto, S. Stewart, and R.F, Stettler (1994). "Molecular genetics of growth and development in poplulus. III. A genetic linkage map of a hybird poplar composed of RFLP, STS and RAPD markers." Theoretical and Applied Genetics 89: 167-178. Brandle, J. E., H. Labbe, J. Hattori, and B.L. Miki (1993). "Field performance and heavy metal concentrations of transgenic flue-cured tobacco expressing a mammalian metallothionein-P-glucoronidase gene fusion." Genome 36: 255-260. Brown, L.R. (1997) State of the World 1997 - A Worldwatch Institute Report on Progress Toward a Sustainable Society. W.W. Norton, New York Brown, M. and K. Brinkman (1992) "Heavy metal tolerance in Festuca ovina L. from contaminated sites in the Eifel Mountanins, Germany" Plant and Soil 143: 239-247. Brown, S. L., R. L. Chaney, J.S. Angle, and A.J. M. Baker (1994a). "Phytoremediation potential of Thlaspi caerulescens and bladder campion for zinc- and cadmium-contaminated soil." Journal of Environmental Quality 23: 1151-1157. Brown, S. L., R. L. Chaney, J.S. Angle, and A.J.M. Baker (1994b). "Zinc and cadmium uptake by Thlaspi caerulescens and Silene vulgaris in relation to soil metals and soil pH." Journal of Environmental Quality 23: 1151-1157. Brown, S. L., R. L. Chaney, J.S. Angle, and A.J.M. Baker (1995). "Division S-4 soil fertility and plant nutrition: Zinc and cadmium uptake by hyperaccumulator Thlaspi caerulescens grown in nutrient solution." Soil Science Society of America Journal 59: 125-133. Brundtland, G. H. (1989). "Global change and our common future." Environment 31: 17- 21. Burken, J. G. and J. L. Schnoor (1997). "Uptake and metabolism of atrazine by poplar trees." Environmental Science & Technology 31: 1399-1406. Chaney, R. L., M. Malik, Y.M. Li, S.L. Brown, E. P. Ewer, J. S. Angle, and A. J. M. Baker (1997). "Phytoremediation of Soil Metals." Current Opinion in Biotechnology 8: 279-284. Chatthai, M., K.H. Kaukinen, T.J. Tranbarger, P.K. Gupta, and S. Misra (1997) "The isolation of a novel metallothionein-related cDNA expressed in somatic and zygotic embryos of Douglas-fir: regulation by ABA osmoticum and metal ions. Plant Molecular Biology 34: 243-254. Cohen, C. K., T. C. Fox, D.F. Garvin, and L.V. Kochian (1998). "The role of iron-deficiency stress responses in stimulating heavy-metal transport in plants." Plant Physiology 116: 1063-1072. 36 Coleman, J. O. D., M. M. A. Blake-Kalff, and T.G.E. Davies (1997). "Detoxification of xenobiotics by plants: chemical modification and vacuolar compartmentation." Trends in Plant Science 2: 144-151. Cunningham, S. D., W. R. Berti, and J.W. Huang (1995). "Phytoremediation of contaminated soils." Trends in Biotechnology 13: 393-397. Cunningham, S. D. and D. W. Ow (1996). "Promises and Prospects of Phytoremediation." Plant Physiology 110: 715-719. Deborne, F. D., T. Elmayan, C. Deroton, L. Dehys, and M. Tepfer (1998). "Cadmium partitioning in transgenic tobacco plants expressing a mammalian metallothionein gene." Molecular Breeding 4: 83-90. Degenhardt, J., P. B. Larsen, S.H. Howell, and L.V. Kochian (1998). "Aluminum resistance in the Arabidopsis mutant air-104 is caused by an aluminum-induced increase in rhizosphere pH." Plant Physiology 117: 19-27. Delhaize, E., P. R. Ryan, and P.J. Randall (1993). "Aluminum tolerance in wheat (Triticum aestivum L.) II. Aluminum-stimulated excretion of malic acid from root apices." Plant Physiology 103: 695-702. D'ltri, P. A. and F. M. D'ltri (1977). Mercury Contamination: A Human Tragedy. Wiley-Interscience. Dittmer, H. J. (1937). "A quantitative study of the roots and root hairs of a winter rye plant (Secale cereale)." American Journal of Botany 24: 417-420. Dix, M. E., N. B. Klopfenstein, J. Zhang, S.W. Workman, and M. Kim (1997). Potential Use of Populus for Phytoremediation of Environmental Pollution in Riparian Zones. In Micropropagation, genetic engineering, and molecular biology of Populus. N. B. Klopfenstein, Y. W. Chun, M. Dong, J. Z. and D. I. Dunstan (1996). "Expression of abundant mRNAs during somatic embryogenesis of white spruce (Picea glauca (moend) voss)." Planta 199: 459-466. Dushenkov, V., P. B. A. N. Kumar, M. Motto, and I. Raskin (1995). "Rhizofiltration - the use of plants to remove heavy metals from aqueous streams." Environmental Science and Technology 29: 1239-1245. Eide, D., M. Broderius, J. Fett, and M.L. Guerinot (1996). "A novel iron-regulated metal transporter from plants identified by functional expression in yeast." Proceedings of the National Academy of Sciences of the U.S.A. 93: 5624-5628. Elmayan, T. and M. Tepfer (1994). "Synthesis of a bifunctional metallothionein/ beta-glucuronidase fusion protein in transgenic tobacco plants as a means of reducing leaf cadmium levels." The Plant Journal 6: 433-440. 37 Evans, I. M., L. N. Gatehouse, J.A. Gatehouse, N.J. Robinson, R.R.D. Coy (1990). "A gene from pea (Pisum sativum L.) with homology to metallothionein genes." FEBS Letters 262: 29-32. Evans, K. M., J. A. Gatehouse, W. P. Lindsay, J. Shi, A.M. Tommey, and N.J. Robinson (1992). "Expression of the pea metallothionein-like PsMTa in Escherichia coli and Arabidopsis thaliana and analysis of trace metal ion accumulation: implications of PsMTa function." Plant Molecular Biology 20: 1019-1028. Field, J. A. (1996). "Glutathione conjugation and contaminant transformation." Environmental Science and Technology 30: 1413-1418. Florijn, P. J. and M. L. v. Beusichem (1993). "Uptake and distribution of cadmium in maize inbred lines." Plant and Soil 150: 25-32. Foley, R.C., Z.M. Liang, and K.B. Singh (1997) "Analysis of type I metallothionein cDNAs in Viciafaba" Plant Molecular Biology 33: 583-591. Framond, A.J.D. (1991). "A metallothionein-like gene from maize (Zea mays): cloning and charactization." FEBS Letters 290: 103-106. Freeman, S. F. and J. C. Herron (1998). Evolutionary Analysis. Upper Saddle River, NJ, Prentice Hall. Fuente, J.M., V. Ramirez-Rodriguez, J.L. Cabrera-Ponce, and L. Herrera-Estrella (1997). "Aluminum tolerance in transgenic plants by alternation of citrate synthesis." Science 276: 1566-1568. Gadd, G. M. and C. White (1993). "Microbial treatment of metal pollution - a working biotechnology." Trends in Biotechnology 11: 353-359. Gekeler, W., E. Grill, E.L. Winnacker, and M.M. Zenk (1989). "Survey of the plant kingdom for the ability to bind heavy metals through phytochelatins." Zeitschrift fur Naturforschung 44c: 361-369. Gray, D. H. and R. B. Sotir (1996). Biotechnical and soil bioengineering slope stabilization : a practical guide for erosion control. John Wiley and Sons, New York. Greep, R. O. (1998). "Whither the global population problem." Biochemical Pharmacology 55: 383-386. Grill, E., S. Loffler, E. Winnacker, and M.H. Zenk (1989). "Phytochelatins, the heavy metal binding peptides of plants, are synthesized from glutatione by a specific gamma-glutamylcysteine tripeptidyl transpeptidase (phytochelatin synthase)." Proceedings of the National Academy of Sciences of the U.S.A. 86: 6838-6842. 38 Grill, E., E. Winnacker, and M.H. Zenk (1985). "Phytochelatins: the principal heavy metal complexing peptides of higher plants." Science 230: 674-676. Grotz, N., T. Fox, E. Connolly, W. Park, M.L. Guerinot, and D. Eide (1998). "Identification of a family of zinc transporter genes from Arabidopsis that respond to zinc deficiency." Proceedings of the National Academy of Sciences of the U.S.A. 95: 7220-7224. Gustafson, J. P. and K. Ross (1990). "Control of alien gene expression for aluminum tolerance in wheat." Genome 33: 9-12. Hagemeyer, J. and Y. Waisel (1989). "Uptake of Cd and Fe by excised roots of Tamarix aphyllar Physiologia Plantarum 77: 247-253. Hamer, D.H. (1986) "Metallothionein" Annual Review of Biochemistry 55: 913-951. Hasegawa, I., E. Terada, M. Sunairi, H. Wakita, F. Shinmachi, A. Noguchi, M. Nakajima, and J. Yazaki (1997). "Genetic improvement of heavy metal tolerance in plants by transfer of the yeast metallothionein gene (CUPI)." Plant and Soil 196: 277-281. Hattori, J., H. Labbe, and R.L. Miki (1994). "Construction and expression of a metallothionein-beta-glucuronidase gene fusion." Genome 37: 508-512. Higgins, T. E., A. R. Halloran, and J.C. Petura (1997). "Traditional and innovative treatment methods for Cr(VI) in soil." Journal of Soil Contamination 6: 767-797. Howden, R. and C. S. Cobbett (1992). "Cadmium-sensitive mutants of Arabidopsis thaliana." Plant Physiology 99: 100-107. Howden, R., P. B. Goldbrough, CR. Andersen, and C.S. Cobbett (1995). "Cadmium-senstive, cadi mutants of Arabidopsis thaliana are phytochelatin deficient." Plant Physiology 107: 1059-1066. Howe, G. and S. Merchant (1992). "Heavy metal-activated synthesis of peptides in Chlamydomonas reinhardtur Plant Physiology 98: 127-136. Hoyle, R. (1993). "Off to a fast start ~ and a promising, if uncertain, future." Trends in Biotechnology 11: 460-463. Ishikawa, T., Z. Li, Y. Lu, and P.A. Rea (1997). "The GS-X pump in plant, yeast and animal cells: structure, function and gene expression." Bioscience Reports 17: 189-207. Jackson, P. J., C. J. Unkeefer, J.A. Doolen, K. Watt, and N.J. Robinson (1987). "Polyfy-glutamylcysteinyl)glycine: its role in cadmium resistance in plant cells." Proceedings of the National Academy of Sciences of the U.S.A. 84: 6619-6623. Jaffre, T., R. R. Brooks, J. Lee, and R.D. Reeves (1976). "Sebertia acuminata: a nickel-accumulating plant from New Caledonia." Science 193: 579-580. 39 Jakob, A., S. Stucki, and P. Kuhn (1995). "Evaporation of heavy metals during the heat treatment of municipal sold waste incinerator fly ash." Environmental Science and Technology 29: 2429-2436. Kampfenkel, K., S. Kushnir, E. Babiychuk, D. Inze, and M. Vanmontagu (1995). "Molecular characterization of a putative Arabidopisis thaliana copper transporter and its yeast homologue." The Journal of Biological Chemistry 270: 28479-28486. Karin, M., R. Najarain, A. Haslinger, P. Valenzuela, J. Welch, and S. Fogel (1984). "Primary structure and transcription of an amplified gene locus: The CUP1 locus of yeast." Proceedings of the National Academy of Science of the U.S.A. 81: 337-341. Kawashima, I., Y. Inokuchi, M. Chino, M. Kimura, and N. Shimizu (1991). "Isolation of a gene for a metallothionein-like protein from soybean." Plant and Cell Physiology 32: 913-916. Kawashima, I., T. D. Kennedy, M. Chino, and B.G. Lane (1992). "Wheat Ec metallothionein genes: like mammalian Zn metallothionein genes, wheat Zn metallothionein genes are conspicuously expressed during embryogenesis." European Journal of Biochemistry 209: 971-976. Kim, M., N. B. Klopfenstein, and Y.W. Chun (1997). Agrobacterium-mediated transformation of Populus species. In, Micropropagation, genetic engineering and molecular biology of Populus. N. B. Klopfenstein, Y. W. Chun, M. Kim and M. R. Ahuja. Fort Collins, CO, US Department of Agriculture, Forest Service, Rocky Mountain Research Station: 326. Kishinami, I. and J. M. Widholm (1987). "Characterization of Cu and Zn Resistant Nicotiana plumbaginifolia." Plant and Cell Physiology 28: 203-210. Knight, B., F. J. Zhao, S.P. Mcgrath, and Z.G. Shen (1997). "Zinc and cadmium uptake by the hyperaccumulator Thlaspi caerulescens in contaminted soils and its effect on the concentration and accumulation speciaton of metals in soil solution." Plant and Soil 197: 71-78. Kochian, L. V. (1995). "Cellular mechanisms of aluminum toxicity and resistance in plants." Annual Review of Plant Physiology and Plant Molecular Biology 46: 237-260. Kramer, U., J. D.Cotter-Howells, J.M. Charnock, A.J.M. Baker, and J.A.C. Smith (1996). "Free histidine as a metal chelator in plants that accumulate nickel." Nature 379: 635-638. Krotz, R. M., B. P. Evangelou, and G.J. Wagner (1989). "Relationships between cadmium, zinc, cd-peptide and organic acid in tobacco suspension cells." Plant Physiology 91: 780-787. Kruckeberg, A. R. and A. L. Kruckeberg (1990). Heavy Metals Tolerance in Plants: Evolutionary Aspects. CRC Press, New York. 40 Kumar, P. B. A. N., V. Dushenkov, H. Motto, and I. Raskin (1995). "Phytoextraction: The use of plants to remove heavy metals from soils." Environmental Science and Technology 29: 1232-1238. Lane, B., R. Kajioka, and T. Kennedy (1987). "The wheat-germ Ec protein is a zinc-containing metallothionein." Biochemical and Cellular Biology 65: 1001-1005. Lange, B. W., C. H. Langley, and W. Stephan (1990). "Molecular evolution of Drosophila metallothionein genes." Genetics 126: 921-932. Larsen, P. B., J. Degenhardt, C. Tai, L.M. Stenzler, S.H. Howell, and L.V. Kochian (1998). "Aluminum-resistant Arabidopsis mutants that exhibits altered patterns of aluminum accumulation and organic acid release from roots." Plant Physiology 117: 9-18. Lee, J., R. D. Reeves, R.R. Brooks, and T. Jaffre (1977). "Isolation and identification of a citrato-complex of nickel from nickel-accumulating plants." Phytochemistry 16: 1503-1505. Li, Z., J. W. Yu, and I. Neetrieks (1997). "Removal of Pb(II), Cd(II) and Cr(III) from sand by electromigration." Journal of Hazardous Materials 55: 295-304. Li, Z. S., M. Szczypka, Y.P. Lu, D.J. Thiele, and P.A. Rea (1996). "The yeast cadmium factor protein (YCF1) is a vacuolar glutathione S-conjugate pump." Journal of Biological Chemistry 271: 6509-6517. Lu, Y. P., Z. S. Li, Y.M. Drozdowicz, S. Hortensteiner, E. Martinoia, and P.A. Rea (1998). "ATMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites - functional comparisons with ATMRP1." The Plant Cell 10: 267-282. Lu, Y. P., Z. S. Li, and P.A. Rea (1997). "ATMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump - isolation and functional definition of a plant ATP-binding cassette transporter gene." Proceedings of the National Academy of Sciences of the U.S.A. 94: 8243-8248. Macdonald, J. A. (1997). "Hard times for innovative cleanup technology." Environmental Science and Technology 31: 560A-563A. Maiti, I. B., G. J. Wagner, and A.G. Hunt (1991). "Light inducible and tissue-specific expression of a chimeric mouse metallothionein cDNA gene in tobacco." Plant Science 76: 99-107. Martinoia, E. (1993). "An ATP-dependent glutathione S-conjugate "export" pump in the vacuolar membrane of plants." Nature 364: 247-249. McCarty, P. L. (1993). "In situ bioremediation of chlorinated solvents." Current Opinion in Biotechnology 4: 323-330. 41 McCown, B. H. (1997). Poplar shoot cultures: their generation and use in biotechnology. In, Micropropagation, genetic engineering, and molecular biology of Populus. N. B. Klopfenstein, Y. W. Chun, M. Kim and M. R. Ahuja. Fort Collins, CO, US Department of Agriculture, Forest Service, Rocky Mountain Research Station: 326. Mclntyre, T. and G. M. Lewis (1997). "The Advancement of Pytomediation as an Innovative Environmental Technology for Stabilization, Remediation, or Restoration of Contaminated Sites in Canada: A Discussion Paper." Journal of Soil Contamination 6: 227-241. Miranda, J. R. d., M. A. Thomas, D.A. Thurman, and A.B. Tomsett (1990). "Metallothionein genes from the flowering plant Mimulus guttatus." FEBS Letters 260: 277-280. Misra, S. and L. Gedamu (1989). "Heavy metal tolerant transgenic Brassica napus L. and Nictotiana tabacum L. plants." Theoretical and Applied Genetics 78: 161-168. Miyasaka, S. C , J. G. Buta, R.K. Howell, and CD. Foy (1991). "Mechanism of aluminum tolerance in snapbeans. Root exudation of citric acid." Plant Physiology 96: 737-743. Moisyadi, S. and J. I. Stiles (1995). "A cDNA encoding a metallothionein I-like protein from coffee leaves (Coffea arabica)." Plant Physiology 107: 295-296. Murasugi, A., C. Wada, and Y. Hayashi (1983). "Occurrence of acid-labile sulfide in cadmium-binding peptide 1 from fission yeast" Journal of Biochemistry 93: 661-664. Mutoh, N. and Y. Hayashi (1988)."Isolation of mutants of Schizosaccharomyces pombe unable to synthesize cadystin, small cadmium-binding peptides" Biochemical and Biophysical Research Communications 151: 32-39. Newman, L. A., S. E. Strand, N. Choe, J. Duffy, G. Ekuan, M. Ruszaj, B. B. Shurtleff, J. Wilmoth, P. Heilman, and M. P. Gordon (1997). "Uptake and biotransformation of trichloroethylene by hybrid poplars." Environmental Science and Technology 31: 1062-1067. Nriagu, J. O. (1996). "A History of Global Metal Pollution." Science 272: 223-224. Nriagu, J. O. and J. M. Pacyna (1988). "Quantitative assessment of worldwide contamination of air, water and soil by trace metals" Nature 333: 134-138. Nwosu, J. U., A. K. Harding, and G. Linder (1995). "Cadmium and lead uptake by edible crops grown in a silt loam soil." Bulletin of Environmental Contamination and Toxicology 54: 570-578. Okumura, N., N. Nishizawa, Y. Umehara, and S. Mori (1991). "An iron deficiency-specific cDNA from barley roots having two homologous cystein-rich MT domains." Plant Molecular Biology 17: 531-533. 42 Ortiz, D. F., L. Kreppel, D.M. Speiser, G.Scheel, G. McDonald, and D.W. Ow (1992). "Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter." EMBO Journal 11: 3491-3499. Ortiz, D. F., T. Ruscitti, K.F. McCue, and D.W. Ow (1995). "Transport of metal-binding peptides by HMT1, a fission yeast ABC-type vacuolar membrane protein." The Journal of Biological Chemistry 270: 4721-4728. Ow, D. W. (1996). "Heavy metal tolerance genes - prospective tools for bioremediation." Resources. Conservation and Recycling 18: 135-149. Pan, A., F. Tie, M. Yang, J. Luo, Z. Wang, X. Ding, L. Li, Z. Chen, and B. Ru (1993). "Construction of multiple copy of alpha-domain gene fragment of human liver metallothionein la in tandem arrays and its expression in transgenic tobacco plants." Protein Engineering 6: 755-762. Patterson, J. W. (1990). Metals Speciation, Separation and Recovery. New York, Lewis Publisher. Pellet, D. M., D. L. Grunes, and L.V. Kochian (1995). "Organic acid exudation as an aluminum tolerance mechanism in maize {Zea mays L.)." Planta 196: 788-795. Penner, G. A., J. Clarke, L.J. Bezte, and D. Leisle (1995). "Identification of RAPD markers linked to a gene governing cadmium uptake in durum wheat." Genome 38: 543-547. Peterson, P. J. (1971). "Unusual accumulation of elements by plants and animals." Science Progress (Oxford) 59: 505-536. Pollard, A. J. and A. J. M. Baker (1995). "Quantitative genetics of zinc hyperaccumulation in Thlaspi caerulescens." New Phytologist 132: 113-118. Raskin, I., P. B. A. N. Kumar, S. Dushenkov, and D.E. Salt (1994). "Bioconcentration of heavy metals by plants." Current Opionion in Biotechnology 5: 285-290. Raskin, I., R. D. Smith, and D.E. Salt (1997). "Phytoremediation of Metals: Using Plants to Remove Pollutants from the Environment." Current Opinion in Biotechnology 8: 221-226. Rauser, W. E. (1990). "Phytochelatins." Annual Review of Biochemistry 59: 61-86. Rauser, W. E. (1995). "Phytochelatins and Related Peptides: Structure, Biosynthesisand Function." Plant Physiology 109: 1141-1149. Reddy, K. R. and U. S. Parupudi (1997a). "Removal of chromium, nickel and cadmium from clays by in-situ electrokinetic remediation." Journal of Soil Contamination 6: 391-407. 43 Reddy, K. R, U. S. Parupudi, S.N. Devulapalli, and C.Y. Xu (1997b). "Effects of soil composition on the removal of chromium by electrokinetics." Journal of Hazardous Materials 55: 135-158. Reese, R. N., C. A. White, and D. R. Winge (1992). "Cadmium-sulfide crystallites in Cd-(yEC)nG peptide complexes from tomato." Plant Physiology 98: 225-229. Reese, R. N. and D. R. Winge (1988). "Sulfide stabilization of the cadmium-y-glutamyl peptide complex of Schizosaccharomyces pombe" Journal of Biological Chemistry 263: 12832-12835. Renner, R. (1997). "On the trail of bioremediating microbes." Environmental Science and Technology 31: 188A-189A. Rugh, C. L., H. D. Wilde, N.M. Stack, D.M. Thompson, A.O. Summers, and R.B. Meagher (1996). "Mercuric ion reductase and resistance in transgenic Arabidopsis thaliana plants expressing a modified bacterial merA gene." Proceedings of the National Academy of Sciences of the U.S.A. 93: 3182-3187. Rugh, C.L., J.F. Senecoff, R.B. Meagher, and S.A. Merkle (1998) "Development of transgenic yellow poplar for mercury phytoremediation" Nature Biotechnology 16:925-928. Ryan, J. A., M. R. Pahren, and J.B. Lucus (1982). "Controlling cadmium in the human food chain: a review and rationale based on health effects" Environmental Research 28: 251 -302. Salt, D. E., M. Blaylock, N.P.B.A. Kumar, V. Dushenkov, B.D. Ensley, I. Chet, and I. Raskin (1995a). "Phytoremediation: a novel strategy for the removal of toxic metals from the environment using plants." Bio/technology 13:468-474. Salt, D. E., R. C. Prince, I.J. Pickering, and I. Raskin (1995b). "Mechanisms of cadmium mobility and accumulation in indian mustard." Plant Physiology 109: 1427-1433. Schachtman, D. P., R. Kumar, J.I. Schroeder, and E.L. Marsh (1997). "Molecular and functional characterization of a novel low-affinity cation transporter (LCT1) in higher plants." Proceedings of the National Academy of Sciences on the U.S.A. 94: 11079-11084. Scheller, H. V., B. Huang, E. Hatch, and P.B. Goldsbrough (1987). "Phytochelatin synthesis and glutathione levels in response to heavy metals in tomato cells." Plant Physiology 85: 1031-1035. Schnoor, J. L., L. A. Light, S.C. McCutcheon, N.L. Wolfe, and L.H. Carreira (1995). "Phytoremediation of organic and nutrient contaminants." Environmental Science and Technology 29: 318A-323A. 44 Shaw, A.J. and D.L. Albright (1990) "Potential for the evolution of heavy metal tolerance in Bryum argenteum, a Moss II: Generalized tolerances among diverse populations." The Bryologist 93: 187-192 Shen, Z. G., F. J. Zhao, and S. P. McGrath (1997). "Uptake and Transport of Zinc in the Hyperaccumulator Thlaspi caerulescens and the non-hyperaccumulator Thlaspi ochroleucum." Plant. Cell and Environment 20: 898-906. Sieghardt, H. (1990). "Heavy-metal uptake and distribution in Silene vulgaris and Minuartia verna growing on mining-dump material containing lead and zinc." Plant and Soil 123: 107-111. Silver, S. and L. T. Phung (1996). "Bacterial heavy metal resistance: new surprises." Annual Review in Microbiology 50: 753-789. Simon, E. (1977). "Cadmium tolerance in populations of Agrostis tenuis and Festuca ovina" Nature 265: 328-331. Smith, B. M. (1991). An inter- and intra-agency survey of the use of plants for toxicity assessment. Philadelphia, American Society of Testing and Materials. Speiser, D. M., S. L. Abrahamson, G. Banuelos, and D.W. Ow (1992). "Brassicajuncea produces a phytochelatin-cadmium-sulfide complex." Plant Physiology 99: 817-821. Steffens, J. C. (1990). "The heavy metal-binding peptides of plants." Annual Review of Plant Physiology and Plant Molecular Biology 41: 553-575. Stettler, R. F., H. D. Bradshaw, P.E. Heilman Jr., and T.M. Hinckley (1996). Biology of Populus and its implications for management and conservation. Ottawa, Ontario, Canada, NRC Research Press. Stomp, A. M., K.H. Han, S. Wilbert, and M.P. Gordon (1993). "Genetic improvement of tree species for remediation of hazardous wastes." In Vitro Cellular Developmental Biology 29P: 227-232. Stone, E. L. and P. J. Kalisz (1991). "On the maximum extent of tree roots." Forest Ecology and Management 46: 59-102. Summers, A. O. (1986). "Organization, expression, and evolution of genes for mercury resistance." Annual Review of Microbiology 40: 607-634. Tabata, K., S. Kashiwagi, H. Mori, C. Ueguchi, and T. Mizuno (1997). "Cloning of a cDNA encoding a putative metal transporting P-type atpase from Arabidopsis thaliana." Biochimica et Biophysica Acta 1326: 1-6. 45 Tilstone, G. H. and M. R. Macnair (1997). "Nickel tolerance and copper-nickel co- tolerance in Mimulus guttatus from copper mine and serpentine habitats." Plant and Soil 191: 173-180. Tomsett, B. and D. A. Thurman (1988). "Molecular biology of metal tolerances of plants." Plant. Cell and Environment 11: 383-394. Ulmasov, T., A. Ohmiya, G. Hagen, and T. Guilfoyle (1995). "The soybean GH2/4 gene that encodes a glutathione S-transferase has a promoter that is activated by a wide range of chemical agents." Plant Physiology 108: 919-927. Vesterinen, R. and F. Martti (1996). "Organic emissions from co-combustion of RDF with wood chips and milled peat in a bubbling fluidized bed boiler." Chemosphere 32: 681-689. Vliet, C. v., C. R. Andersen, and C.S. Cobbett (1995). "Copper-sensitive mutant of Arabidopsis thaliana." Plant Physiology 109: 871-878. von Frenckel-Insam, B.A.K. and T.C. Hutchinson (1993) Occurrence of heavy metal tolerance and co-tolerance in Deschampsia cespitosa (L.) Beauv. from European and Canadian populations" New Phytologist 125: 555-564. Wang, J., B. P. Evangelou, M.T. Nielsen, and G.J. Wagner (1991). "Computer-stimulated evalution of possible mechanisms for quenching heavy metal ion activity in plant vacuoles. I. Cadmium." Plant Physiology 97: 154-1160. Watanabe, M. E. (1997). "Phytoremediation of the brink of commercialization." Environmental Science and Technology 31: 182A-186A. Whitelaw, C. A., J. A. Lehuquet, D.A. Thurman, and A.B. Tomsett (1997). "The isolation and characterization of type II metallothionein-like genes from tomato {Lycopersicon esculentun L.)." Plant Molecular Biology 33: 503-511. Yeargan, R., I. B. Maiti, M.T. Nielsen, A.G. Hunt, and G.J. Wagner (1992). "Tissue partitioning of cadmium in transgenic tobacco seedlings and field grown plants expressing the mouse metallothionein I gene." Transgenic Research 1: 261-267. Yu, L., M. Umeda, J. Liu, N. Zhao, and H. Uchimiya (1998). "A novel MT gene of rice plants is strongly expressed in the node portion of the stem." Gene 206: 29-35. Zhou, J. and P. B. Goldsbrough (1994). "Functional homologs of fungal metallothionein genes from Arabidopsis." The Plant Cell 6: 875-884. 46 C H A P T E R 2 - P H Y T O C H E L A T I N S A N D M E T A L L O T H I O N E I N S I N P O P L A R 2.1 I N T R O D U C T I O N - Metal-chelating compounds in plants Many heavy metals, including Cu and Zn, play essential roles in cellular processes, such as enzyme cofactors, hence they are considered to be essential plant micronutrients (Baker and Brooks, 1989). Plants have mechanisms that enable them to readily absorb such essential elements from their surrounding environments through their root systems (Tomsett and Thurman, 1988). Although some heavy metals are fundamental for plant life at low concentrations, almost all metals are toxic at elevated levels. Metal toxic soils have become more prevalent in the present environment due in large part to pollution from mining, smelting and agricultural run-off (Cunningham et al, 1995). Many plant species have evolved physiological mechanisms that enable them to thrive in metalliferous soil conditions that occur naturally (Tomsett and Thurman, 1988; Baker and Brooks, 1989). Identification of genes that confer metal tolerance to these metal resistant plant species is of interest from an academic perspective, but could also lead to the possibility of engineering metal resistance into heavy metal sensitive plant species. Metal tolerance research in plants has largely focused on metal-binding compounds and/or vacuole sequestration as detoxification mechanisms (Tomsett and Thurman, 1988). The principle classes of intracellular metal-binding ligands are organic acids, the amino acid histidine, phytochelatins (PCs) and metallothioneins (MTs). In certain plant species, a strong correlation has been observed between the amount of organic acids, primarily malate and citrate, and the level of heavy metal tolerance. A gene involved in the production of citric acid, citrate synthetase, was isolated from Pseudomonas aeruginosa and constitutively expressed in both tobacco (Nicotiana tabacum) and papaya (Carica papaya). These transgenic plants displayed a substantially higher level of tolerance to heavy metals, in particular to Al toxicity (Fuente et al., 47 1997). In a similar manner, the amount of histidine in xylem exudates has been shown to play a pivotal role in the Ni hyperaccumulating ability of Alyssum lesbiacum (Kramer et al, 1996). Quantification of the metal complexes in Alyssum lesbiacum xylem exudates revealed that 98% of the histidine produced was chelated to nickel (Kramer et al., 1996). Aside from the role organic acids and histidine may play in the metal tolerance of certain plant species, the focus of most metal tolerance research has been on the plant metal-chelating compounds phytochelatins and metallothioneins. Many plants, and some fungi, respond to cytotoxic levels of heavy metals by the production of a class of small, cysteine-rich heavy metal binding peptides known as phytochelatins (Grill et al, 1985). These peptides have the general structure (yGlu-Cys)n-Gly, where n can vary from 2-11 depending on the plant species and the metal induction conditions (Grill et al, 1987; Rauser, 1995). The presence of a y-glutamyl linkage in these peptides indicates that they are not the direct result of gene transcription and translation but are instead the result of a biochemical pathway (Grill et al., 1985). The enzymatic pathway that gives rise to phytochelatins utilizes glutathione. This finding resulted from the observation that yeast cells deficient in the production of glutathione also failed to produce phytochelatins in response to heavy metal stress (Mutoh and Hayashi, 1988). Glutathione is synthesized in two ATP-dependent enzymatic steps. Firstly, the dipeptide y-glutamylcysteine is produced from glutamate and cysteine by the activity of y-glutamylcysteine synthetase (Grill et al, 1985). Secondly, glutathione is produced from the addition of glycine to the C-terminal of y-glutamylcystein by the catalytic activity of glutathione synthetase (Hayashi et al, 1991). An Arabidopsis cDNA encoding for glutathione synthetase was isolated by functional complementation of metal-sensitive mutants of both Escherichia coli (Rawlins et al, 1995) and Saccharomyces cerevisiae (Ullmann et al, 1996). Finally, by using glutathione as a substrate phytochelatins are produced 48 through the enzymatic activity of phytochelatin synthase (refer to Figure 1.3 for detailed biosynthetic pathway) (Grill et al, 1989). Although the gene that encodes for phytochelatin synthase has yet to be isolated, the phytochelatin synthase enzyme has been isolated from suspension cultures of Silene cucubalus and it is proposed to be responsible for the in vivo metal-induced formation of phytochelatins (Grill et al, 1989). Metallothioneins are low molecular weight, metal-chelating proteins that are directly encoded by genes (Hamer, 1986). Although first discovered in mammalian cells, M T genes have since been found in bacteria, some fungi and related sequences have been discovered in plant species. Plant MT-like gene sequences do not show a strong similarity to other MT-like genes isolated from other organisms (Robinson et al, 1993). Furthermore, among the plant M T proteins there seem to be two distinct classes, or isoforms - one class contains the Cys-X-Cys motif that is typical of the mammalian M T protein and the other class contains two motifs Cys-Cys and Cys-X-X-Cys (Zhou and Goldsbrough, 1994). The metal chelating role of mammalian M T proteins has been extensively documented but the role of plant MT-like proteins is still controversial (Robinson etal, 1993). Since the discovery of phytochelatin peptides and metallothionein-like proteins in plants, the question of whether these compounds are functionally analogous to the mammalian metallothioneins, in that they chelate heavy metals with a high affinity thereby preventing the metals from binding to cellular constituents, has been raised (Karin, 1985; Grill et al, 1987; Jackson et al, 1987; Robinson et al, 1993). The finding that numerous plant species produce phytochelatins when exposed to some kind of heavy metal stress (Ag + , As 5 + , A u 1 + , B i 3 + , Cd 2 + , Cu 2 + , Hg 2 + , N i 2 + , Pb 2 +,Sb 4 +, Se 4 +, Te 4 +, W 6 + , Zn 2 +) supports the notion that PCs do have a metal detoxification function (Grill et al, 1987; Grill et al, 1989). However, predominantly only Cd or Cu ions have been shown to be actually chelated to PCs in vivo (Jackson et al, 1987; Reddy 49 and Prasad, 1992; Howe and Merchant, 1992). Likewise, induction of metal hypersensitivity to metals in plant cell cultures by the addition of L-buthionine sulfoximine (BSO), a specific inhibitor of glutathione synthetase, also indicates a detoxification mechanism of PCs (Grill et al, 1987; Scheller et al, 1987; Mendum et al, 1990). Interestingly, inhibition of PC production through the use of BSO in Nicotiana tabacum suspension cell cultures resulted in a sensitivity to Cd but had no effect on Cu tolerance (Steffens, 1990). Additionally, despite the Arabidopsis cad-1 mutant's inability to accumulate PCs due to a deficiency in PC synthase, it does not exhibit a sensitivity to all metal ions, but, rather, is sensitive to specific metals. Thus, this PC synthase mutant is sensitive to Cd and Hg but displays a wildtype level of tolerance to Cu (Howden et al, 1995b). Conversely, MT mutants of the fungus Candida glabrata were found to be sensitive to Cu stress but not to Cd stress (Mehra et al, 1988). Similarly, Schat et al. (1992) found that both Cu tolerant and nontolerant lines of Silene vulgaris suspension cell cultures produce comparable levels of PCs upon the exposure to metal stress. Also, the expression of a pea (Pisum sativum) MT-like cDNA in both E.coli and Arabidopsis increased tolerance to Cu toxicity but did not alter the level of tolerance in these organisms to either Cd of Zn ions (Evans et al, 1992). The extent of metal induction of the Arabidopsis' MT2 transcript was seen to strongly correlate with Cu-tolerance in 10 different ecotypes studied (Murphy and Taiz, 1995). Thus, upon close inspection of the metal induction conditions under which PC and MT-like proteins are produced in plants, a trend seems to appear: Cd tolerance seems to be correlated with the production of PC peptides and Cu tolerance seems to be correlated with MT-like proteins. In contrast to these findings, the maize MT-like gene seems to be constitutively expressed (Framond, 1991). Soybean MT-like gene is negatively regulated by Cu ions (Kawashima et al, 1991), while in spruce (Dong and Dunstan, 1996) and Douglas-fir (Chatthai et al, 1997) MT-like genes both seem to be strongly developmentally regulated. 50 The objective of the research described in this chapter was to investigate the conditions that induce expression of the metal chelating compounds PCs and MT-like proteins in poplar. Suspension cultures of the poplar hybrid, Populus trichocarpa x P. deltoides clone (HI 1) and intact in vzYro-grown plants of the poplar hybrid P. alba x P. Pemula clone (INRA clone 717-1B4) were used for these studies. 2.2 METHODS AND MATERIALS 2.2.1 Cell Cultures and Plant Growth Suspension cultures of Populus trichocarpa x P. deltoides (HI 1) were maintained in liquid nutrient media [in de-ionized dH20, 30g/l sucrose, 4.3 g/1 Murashige & Skoog Salt Mixture (BRL), 1 ml/1 lOOOx vitamin solution, pH 5.7; lOOOx vitamin solution being O.lg/lOOml nicotinic acid, lg/lOOml thiamin acid, O.lg/lOOml pyridoxine HCL, lOg/lOOml myoinositol]. Note that Murashige & Skoog Media contains CuS04 5 H20 at 5 mg/L concentration. The suspension cultures were maintained at 150 rpm at 24°C in darkness. Inoculations of cultures were performed every 7 days by aseptic transfer of 5 ml of culture into 40 ml of new media. Plantlets of the poplar hybrid, P. alba x P. tremula clone (INRA clone 717-1B4), were grown in shoot-inducing media [McCown's Woody Plant Basal Media (Sigma), 0.5% phytoagar (Gibco BRL), 3% sucrose, 200 mg/L L-glutamine, 0.1 pM thidiazuron (TDZ; Sigma); plant hormones were added after autoclaving the media] in a growth chamber (16 hr light, 8 hr dark, 22°C, light intensity 35 pmols'm"2). Note that Woody Plant Media contains CuS04 5H20 at a concentration of 0.25 mg/L. 51 2.2.2 Protein Profiles 2.2.2.1 Protein Extraction from Metal Stressed Suspension Cultures Populus trichocarpa x P. deltoides (HI 1) suspension cultures were stressed with 100 pM CdCl2 for 3 hr. Total protein was extracted from these cultures by first filtering the cells to concentrate them and then grinding the cells in liquid nitrogen. Approximately 100 pl of cells were added to 1 ml of protein extraction buffer (200 mM Tris HC1 pH 7.5, 5% SDS, 7.5% p-mercaptoethanol and 1 mM PMSF). The mixture was spun in a tabletop microcentrifuge at 13,000 rpm for 5 min at room temperature. The supernatant was transferred to a new tube and 1/10 volume of TCA (33g/15 ml) was added, mixed by vortexing and centrifuged at 13,000 rpm for 5 min in a tabletop microcentrifuge. The resultant crude protein pellet was resuspended in 100 mM Tris pH 7.5, 4.5% p-mercaptoethanol. Quantification of proteins was performed by spectrophotmetric readings at 595 nm of a sample mixture (750 pl dH20, 200 pl Bio-rad protein assay dye, 50 pl protein sample). 2.2.2.2 SDS-Polyacrylamide Gel Electrophoresis A 12% resolving gel was formed by making a solution of 40% acrylamide/bisacrylamide (Biorad) (15 ml for a 50 ml gel), 12.5 ml/50 ml gel 1.5M Tris HC1 pH 8.8, 21.75 ml/50 ml gel of dH20. The solution was mixed and degassed under vacuum for about 5 min and then 0.5 ml 10% SDS, 25 pl TEMED and 250 pl 10% ammonium persulphate (APS) were quickly added and the gel was poured. A thin layer of water was poured onto the gel and the gel was allowed to polymerize for at least 1 hr. The layer of water was removed and a stacking gel was poured on top of the resolving gel. A 4% stacking gel consisting of 2.5 ml/75 ml gel 40% acrylamide/bisacrylamide solution, 6.3 ml/75 ml gel 0.5 M Tris-HCl pH 6.8 and 15.9 ml dH20 was degrassed under vacuum for 15 min and then 250 pl 10% SDS, 25 pl TEMED and 125 pl 52 10%APS were added and the gel then promptly poured. Protein samples were loaded along with a protein molecular weight marker (Biorad) and the gel was run in lx SDS buffer at 50 V in the stacking gel and 130 V in the resolving gel for a total of 6 hr. The gel was fixed in 3:1:1 methanol: acetic acid: dH20 solution and stained in 2% coomassie blue and destained overnight in 7% acetic acid. 2.2.3 Differential Display 2.2.3.1 RNA Isolation from Metal Stressed Tissue Suspension cultures of Populus trichocarpa x P. deltoides (HI 1) were stressed with lOOpM CdCl2 for 3 hr. Total RNA was extracted from cultures that were metal-stressed and from control cultures that were not metal-stressed. The suspension culture solutions were filtered, then frozen and ground in liquid nitrogen. RNA extraction was performed using RNeasy Plant RNA extraction Kit (Qiagen) as per the manufacturer's instructions. 2.2.3.2 cDNA synthesis and radioactive PCR For each RNA sample, four reaction mixtures were prepared - one for each degenerate oligo(dT) primer [T12(G,A,C)G, T12(G,A,C)A, T12(G,A,C)T, T12(G,A,C)C]- to produce cDNA. For a 20 pl total volume, the reverse transcriptase reaction was as follows: 4 pl 5X Superscript II reverse transcriptase buffer (BRL), 2 pl 0.1 M DTT, 1.6 pl 250 pl 4 dNTP mix, 2 pl of 10 pM degenerate oligo dT primer set, 0.2 pg total RNA, and dH20 to bring the volume to 19 pl. The tubes were incubated at 65°C for 5 min to denature the mRNA secondary structures and after a 10 min incubation at 37°C, 1 pl of 200 U/pl Superscript II reverse transcriptase (BRL) was added to each tube. The reaction proceeded for 1 hr at 37°C followed by incubation at 95°C for 5 min to inactivate the reverse transcriptase enzyme. A 20 pl PCR reaction was set-up as follows: 9.2 53 pl dH20, 2ul lOx PCR buffer, 1.6 pl 25 pM 4 dNTP mix, lpil 10 uCi/ul [a-35S]dATP, 2 pl 2 pM decamer, 2 pl 10 pM degenerate anchored oligo(dT) primer set, 2 pl cDNA, 0.2 pl 5 U/pl Taq DNA polymerase (Boehringer Mannheim). The reactions had 25 pl of mineral oil overlaid on them and then PCR was carried out under the following conditions: 40 cycles of 94°C for 30 sec, 40°C for 2 min, 72°C for 30 sec, then one cycle of 72°C for 5 min. The products were stored in -20°C freezer until the reactions were run on a gel. The radioactive PCR reactions were prepared for electrophoresis by mixing 3.5 pl of the PCR reactions with 2 pl of formamide loading buffer (95% formamide, 0.09% bromphenol blue, 0.09% xylene cyanol FF) and incubating at 80°C for 2 min. The samples were loaded onto a 6% polyacrylamide gel and run at 60 W for approximately 3 hr. The gel was transferred onto Whatmann 3MM filter paper, covered with Saran Wrap and dried approximately 1 hr in a gel dryer. Radioactive ink marks were made on the gel/filter prior to exposure to X-ray film as a means to align the film and gel. The gel was exposed to X-ray film (Kodak) overnight. 2.2.4 The Cloning of a Portion of a Poplar Glutathione Synthetase Gene Primers were designed by considering codon usage and from the conserved amino acid regions of the glutathione synthetase gene from seven taxonomically distant species (see Figure 2.2) [forward primer: 5'AA(A/G)CC(T/A)CAG(A/C)G(G/A)GA(G/A)GG (C/A)GG(C/A)GG(C/A)3' reverse primer: 5'(T/G)CCAAA(T/G)CCAGCAGC(A/G) AC(G/T)CC(G/T)CC3']. The PCR amplification reaction was as follows: 1 pg of P. alba x P. tremula genomic DNA as template, lx PCR buffer (lOmM Tris-HCl, pH 8.3; 50mM KC1), 0.2 mM dNTP mix, 1.0 pM primer mixture, 0.75 Unit/50 pl Taq DNA polymerase (Boehringer Mannheim). Cycling parameters were 95°C for 5 min, 35 cycles of 94°C for 30 sec, 42°C for 45 sec, 72°C for 1 min, completed by one 72°C for 10 min elongation period. T-tail cloning of the 54 resultant amplification product was performed (Holton and Graham, 1991) by ligation into an EcoRV-digested ddTTP (dideoxyTTP) pBluescript SKIT vector plasmid (Stratagene). A 1:10 dilution of the ligation solution was transformed by heat shock (Sambrook et al, 1989) into sub-cloning efficiency competent Escherichia coli strain DH5a cells (Gibo BRL), which were plated on ampicillin and X-gal containing LB media [10g/l tryptone (Bacto), 5g/l yeast extract (Bacto), 10g/l NaCl, 15g/l agar (Bacto); pH 7.0, lOOpg/ml ampicillin (Gibco BRL), 40 pg/ml X-Gal (5-bromo-4-chloro-3-indolyl-P -galactoside; Gibco BRL), 4 pg/ml IPTG (isopropylthio-P -D-galactoside (Gibco BRL) - antibiotics added after autoclaving]. Liquid cultures of any resultant ampicillin-resistant white colonies were grown overnight in LB media with lOOpg/ml ampicillin (Gibco BRL) at 37°C 200 rpm. Minipreps of the cultures were performed as in (Zhou et al, 1990) as a means to identify transformed E.coli containing the GS-pBluescript plasmid. A double restriction digest with EcoRI/Hindlll was then performed on the isolated GS-pBluescript plasmid. Plasmids containing an insert were sequenced (NAPS, UBC) and the homology to known nucleotide sequences was determined (Blast sequence similarity, Genbank). 2.2.5 Southern Blot Analysis 2.2.5.1 DNA Isolation and Southern Blot The isolation of total genomic DNA from poplar leaf tissue was based on the Doyle and Doyle (1990) protocol followed by a cesium chloride (CsCl) ultracentrifugation procedure as per (Sambrook, et al, 1989). In a 50 ml Falcon tube, approximately 6-8 g of frozen ground leaf tissue was added to 7.5 ml/g of tissue of extraction buffer (3% cetyltrimethyl ammonium bromide (CTAB), 1.4 M NaCl, 20 mM ethylenediaminetetra acetic acid (EDTA), lOOmM Tris-HC1, pH 8.0,1% polyvinylpyrolidone (PVP) and 0.2% P-mercaptoethanol added after autoclaving and immediately prior to use) and subsequently incubated at 60°C for at least 2 hr. 55 Two chloroform: isoamyl alcohol (24:1) treatments were then carried out in succession by adding one volume to the DNA samples, inverting and centrifuging at 1600g for 5 min at room temperature using an Omnifuge RT (Canlab). After the second extraction was complete, the aqueous (top) phase was transferred to a new tube and 2/3 volume of cold (-20°C) isopropanol was added, the tube inverted to mix and incubated at room temperature for 30 min and then centrifuged at 1500g for 15 min at room temperature. The supernatant was discarded and the pellet washed twice by adding an aliquot of cold (-20°C) 70% ethanol and centrifuging at 13,000 rpm for 20 min at -4°C using a refrigerated tabletop microcentrifuge. The ethanol was aspirated and the pellet was allowed to air dry in a laminar flow hood. The resultant DNA pellet was dissolved in 30-50 pl of TE and was allowed to incubate overnight at 4°C to facilitate resuspention. Five ml of a CsCl solution (9.7 g CsCl in 9 ml of TE, pH 8) was added to each DNA sample and incubated at 55°C for approximately 30 min. After the DNA pellet was completely resuspended, the mixture was incubated on ice for 30 min and then spun for 10 min at 8000 rpm using a 4°C Beckman model J2-21 centrifuge with JA20 rotor. The supernatant was transferred to a new 30 ml corex tube, 250 pl of 10 mg/ml ethidium bromide was added and the mixture was incubated on ice for 30 min. After centrifugation for 10 min at 8000 rpm in a 4°C Beckman J2-21 centrifuge, the supernatant was transferred to a 5 ml quick seal tube (Beckman). Ultracentrifugation was performed in a Beckman Vti-65 rotor at 20°C, 60,000 rpm for 16-24 hr. The genomic DNA bands in the CsCl prep were detected under ultraviolet light and were extracted with a syringe. Ethidium bromide was removed from the DNA samples by extraction 3-4 times with water-saturated n-butanol. Ethanol precipitation was then performed by adding 2/3 volume of cold (-20°C) 100% ethanol and incubating at -20°C for 3 hr. The samples were 56 spun at 5000g for 20 min at room temperature, and the resultant DNA pellets were dissolved in approximately 30 pl dH20. Ten pg of genomic DNA was digested with 2 pl of 10 Units/pl Bglll restriction enzyme in the appropriate corresponding buffer at 37°C overnight. As the glutathione synthetase gene has already been isolated from Arabidopsis (Rawlins et al., 1995), DNA from this plant was extracted and used as a positive control in the Southern blot. Likewise, the pea (Pisum sativum) metallothionein-like gene has been isolated (Evans et al., 1990), so pea DNA was extracted from germinated seedlings and was used as a positive control on the metallothionein Southern blot. The digested DNA samples along with 4 pg of 1 pg/pl Hindlll lambda DNA molecular weight standard (Gibco BRL) were run on a 1.5% agarose gel at 22 Volts overnight. The gel was washed in water and stained in 0.5 pg/ml ethidium bromide for 1 hr and subsequently destained in water for 0.5-1 hr until discrete bands could be seen in the marker lane. A Southern blot was prepared (Sambrook et al., 1989)- using Hybond N + (Amersham) and 0.5M NaOH as the transfer buffer. Capillary transfer of the DNA samples to the membrane occurred overnight. The membrane was then marked with pencil, washed briefly in 2x SSC and subsequently dried between two sheets of Whatman 3MM paper at 80°C for 2 hr. 2.2.5.2 Hybridization using Glutathione Synthetase gene fragment as a probe Hybridization was performed as in the method of Church and Gilbert (1984). Prehybridization of the membrane was carried out in 10 ml phosphate buffer [0.25 M phosphate buffer (pH 7.2), ImM EDTA, 1% sodium dodecylsulfate (SDS), 7% bovine serum albumin (BSA)] at 65°C for at least 30 min. A gel purified (GeneClean, BIO101) 490 bp EcoRI / Hindlll double digest portion of the GS-containing plasmid was used as a template in the random priming labeling kit (Gibco) along with a32P-dATP (Amersham) to produce a probe labeled to a specific activity of 1-2 xlO8 57 cpm/pg with unincorporated nucleotides removed. The probe was denatured by boiling at 100°C for 5 min. Hybridization was conducted at 65°C for 16 hr. Post-hybridization treatment of the membrane consisted of three initial washes in 2x SSC, 0.1% SDS for 15 min at room temperature, followed by a wash in 2X SSC, 0.1% SDS for 1 hr at 65°C and a final wash in 0.2X SSC, 0.1% SDS for 1 hr at 65°C. The resultant membrane was covered with Saran Wrap and exposed to audoradiography film (Kodak) in a cassette containing two intensifying screens at 80°C overnight. 2.2.5.3 Hybridization using pea Metallothionein-like cDNA as probe Hybridization conditions were as stated above in GS hybridization protocol, but instead of a GS probe a 650 bp pea metallothionein-like cDNA (Evans et al, 1990) was used as a heterologous probe. A plasmid containing the pea cDNA was a gift from Marta Evans (University of Durham, England). 2.2.6 Stress Induction 2.2.6.1 Cadmium and Copper Toxicity Tests Toxicity tests to investigate the growth effect of Cd and Cu on the suspension cultures were performed by dry weight measurements. Segments of approximately 15cm x 15 cm Whattman 3MM paper were dried in an 80°C for 2 hr, labelled, massed and these pre-weighed measurements were noted. Suspension cultures were exposed to either no metals (negative control), 20 uM CdCl2, 100 uM CdCl2, 20 pM CuS04 or 100 pM CuS04. Two ml aliquots were removed from these samples at approximately 6 hr intervals for a duration of 2 days after the addition of the metal ions. Sample values were taken in triplicate. The sample aliquots were 58 placed on labelled pre-weighed paper, dried in an 80°C oven for 2 hr and subsequently weighed. The weight of the samples were then calculated by subtracting the original weight of the paper from the final weight of the paper plus the samples. Sample values were then normalized by considering the non-metal stressed samples as a base value and denoting it a 100% growth value. Consequently, any value above 100 for the sample values indicates an enhancement of growth due to metal stress and conversely, a value under 100 would indicate a retardation of growth. Toxicity tests were performed by exposing suspension cultures to a range (OpM, 20 pM, 50 pM, 100 pM, 200 pM, 300 pM, 400 pM, 500 pM) of CdCl2 or CuS04 concentrations and measuring the growth response of the cultures at 12 hr after the introduction of the metal stress. Growth response curves were generated by weighing cells from 2 ml aliquots of culture samples and by standardizing growth relative to the OpM metal controls exhibiting a 100% growth rate. 2.2.6.2 Cd and Cu Toxicity Tests Using BSO to Inhibit Phytochelatin Production Growth response of suspension cultures of P. trichocarpa x P. deltoides (HI 1) were monitored as a way to investigate the effect of Cd or Cu stress when the production of phytochelatins was inhibited by the addition of L-buthionine sulfoximine (BSO). Suspension cultures were exposed to one of ten treatments: no metal + no BSO; no metal + 100 pM BSO; 20 pM CdCl2 + 0 pM BSO; 20 pM CdCl2 + 100 pM BSO; 100 pM CdCl2 + 0 pM BSO; 100 pM CdCl2 + 100 pM BSO; 20 pM CuS04 + 0 pM BSO; 20 pM CuS04 + 100 pM BSO; 100 uM CuS04 + 0 uM BSO; 100 pM CuS04 + 100 pM BSO. Samples were exposed to these metal treatments for 12 hr after which 2 ml aliquots were removed and dry weight measurements were taken (protocol as above) as an indication of cell density and therefore growth rate. Sample values were taken in triplicate. 59 2.2.6.3 RT-PCR Total RNA was extracted from P. trichocarpa x P. deltoides clone (HI 1) suspension cultures using Trizol™ (Gibco BRL) reagent. Cultures were exposed to either no metal stress, 20 pM CdCl2, 100 pM CdCl2, 20 uM CuS04 or 100 uM CuS04 for 3 hr. Suspension cultured cells were harvested by filtering the cultures and then freezing and grinding the cells in liquid nitrogen. One ml of Trizol™ was added to 100 pl of pelleted cells and subsequently mixed by extensive pipetting. The solution was spun at 12,000 rpm for 5 min at 4°C in a refrigerated tabletop microcentrifuge. The pelleted cell debris was discarded and the supernatant was transferred to another tube to which 200 pl of chloroform was added. After sitting at room temperature for 3 min, the mixture was centrifuged at 12,000 rpm for 15 min at 4°C in a refrigerated tabletop microcentrifuge. The aqueous layer was transferred to a new tube and 600 pl of isopropanol was added. The mixture was incubated at room temperature for 10 min and then centrifuged at 12,000 rpm for 10 min at 4°C in a refrigerated microcentrifuge. The RNA pellet was washed in 1 ml 75% ethanol, vortexed and centrifuged at 12,000 rpm for 5 min at 4°C in a refrigerated microcentrifuge. The ethanol was decanted and the tube inverted in a laminar flow hood until the pellet dried (approximately 10-15 min). The resultant white RNA pellet was dissolved in 20-30 pl of DEPC-treated dH20 depending on the size, and incubated at 55°C for 10-15 min to aid in resuspension. Quality and quantity of the RNA samples was determined spectrophotometrically. mRNA was then isolated using a Qiagen mRNA isolation kit according to the manufacturer's instructions. Reverse transcription of the mRNA samples was performed by first making a reaction mixture for each sample as follows: 4 pl 5X Superscript II reverse transcriptase buffer (BRL); 2 pl 0.1 DTT; 1.6 pl 250 pM dNTP mix; 1 pl mRNA (0.1 pg/pl); 2 pl 10 pM T 1 8 oligo; dH20 to final reaction volume of 19 pl. The reaction mixtures were then incubated at 65°C for 5 min and 60 then at 37°C for 10 min. One pl of 200 U/u.1 of Superscript II reverse transcriptase (BRL) was added to each tube and further incubated at 37°C for 1 hr. PCR amplification was performed using T 1 8 oligo and a GS specific primer designed from the GS Arabidopsis gene sequence (5'AAACCTCAGAGGGAAGGCGGCGGA 3') according to the following parameters: 2 pl cDNA mixture (produced above), lx amplification buffer (lOmM Tris-HCl, pH 8.3; 50mM KC1), 2 pM dNTP mix, 2 pl of lOpM GS primer, 2 pl of 10 pM T l g oligo, 0.5 pl 5 U/pl Taq DNA polymerase (Boehringer Mannheim). Cycling parameters were 95°C for 5 min, 35 cycles of 94°C for 30 sec, 50°C for 30 sec, 72°C for 1.5 min, completed by one 72°C for 10 min elongation period]. A second round of PCR amplification was performed using 2 pl of the amplification product from the first PCR reaction as a template and a nested GS primer (5'CCTCAGAGGGAAGGCGGCGGAAAT 3') and Tlgoligo. As a positive PCR control, GS-specific primers were used to amplify the GS-containing plasmid as a template. All reaction mixtures and cycling parameters were as stated above for the first round of PCR. The resultant PCR amplification products were resolved by subjecting them to 1.5% agarose gel electrophoresis for approximately 1 hr at 80 V. The gel was stained with ethidium bromide and photographed under UV transillumination. 2.2.6.4 Northern Blots 2.2.6.4.1 RNA Extraction from Metal Stressed Tissue Total RNA was extracted from suspension cultures using Trizol™ (Gibco BRL) reagent as stated above. Cultures were exposed to either no metal stress, 20 pM CdCl2100 pM CdCl2, 20 pM CuS04 or 100 pM CuS04 over a range of time periods (1 hr - 3 days). Total RNA was also extracted from leaf, stem and root tissue of the P. alba x P. tremula clone (INRA clone 717-1B4) 61 plantlets that were grown in media containing either 100 uM CdCl2 or 100 pM CuS04 for 5 days using the RNeasy Plant Total RNA kit (Qiagen). Approximately 0.1 g of tissue was ground in liquid nitrogen and immediately added to the RLT lysis extraction buffer supplied with the kit. The resultant RNA pellet was suspended in 30 pL of 0.1% DEPC-treated water (1ml of diethyl pryrocarbonate added to 11 of dH20, vigorously shaken, allowed to sit overnight and then autoclaved) and quantified by spectrophotometry means. 2.2.6.4.2 Northern Blot Ten pg of total RNA of Cd-stressed and Cu-stressed samples along with 3 pl lpg/pl RNA marker (Gibro BRL) were dissolved in freshly prepared sample buffer (500pl/ml formamide, 170 ul/ml 37% formaldehyde, 100 pl lOx MOPS; with lOx MOPS consisting of 200 mM MOPS (3-[n-morpholino]propanesulfonic acid), 50mM NaOAC, lOmM EDTA, pH 7) to bring the final volume of each sample to 40 pl. Samples were then incubated at 65°C for 15 minutes, placed on ice and 4pl of 2x loading buffer was added. A formaldehyde-agarose gel was formed by boiling a 1.2% agarose solution, cooling the solution to 60°C and then adding 10% lOx MOPS and 20% formaldehyde (37%). The formaldehyde gel was run in a fume hood using lx MOPS as running buffer and run at 120 V for 1.75 hr. The gel was washed in water and stained in 0.5 pg/ml ethidium bromide for 1 hr and subsequently destained in water for 3-4 hr until discrete bands could be seen in the marker lane. A photograph was taken of the gel under an ultraviolet transilluminator with a fluorescent ruler to aid in the determination of band size. A northern blot was prepared (Sambrook et al, 1989)- using Hybond N (Amersham) as the membrane and 10X SSC (20x SSC 3M NaCl, 0.3M sodium citrate; pH 7.0) as the transfer buffer. Capillary transfer of the RNA samples to the membrane occurred overnight. The 62 membrane was then marked with pencil, washed briefly in 2x SSC and subsequently dried between two sheets of Whatman 3 MM paper at 80°C for 2 hr. 2.2.6.4.3 Glutathione Synthetase Gene Induction Hybridization was performed as in the method of Church and Gilbert (1984). Prehybridization of the membrane was carried out in 10 ml phosphate buffer [0.25 M phosphate buffer (pH 7.2), ImM EDTA, 1% sodium dodecylsulfate (SDS), 7% bovine serum albumin (BSA)] at 65°C for at least 30 min. A gel purified (Geneclean, BIO 101) 490 bp EcoRI/ Hindlll double digest portion of the bluescript KS+ (Stratagene) plasmid containing a fraction of a poplar GS gene was used as a probe. Post-hybridization treatment of the membrane consisted of three initial washes in 2x SSC, 0.1% SDS for 15 min at room temperature, followed by a wash in 2X SSC, 0.1% SDS for 1 hr at 65°C. The resultant membrane was covered with Saran Wrap and exposed to audoradiography film (Kodak) in a cassette containing two intensifying screens at 80°C for 3 days. The membrane was stripped (boiling solution of 0.05x SSC, 0.1% SDS poured onto membrane and cooled to room temperature) and then re-hybridized using a soybean 18S rRNA gene as a probe. 2.2.6.4.4 Metallothioein-like Gene Induction The conditions under which northern blot analysis was performed for the investigation of the induction of the poplar metallothionein gene were the same as those stated above for the analysis of the induction of the GS gene except that a 650 bp pea MT-like cDNA was used as a heterologous probe. 63 2.3 RESULTS 2.3.1 Presence of Metal-chelating compounds in poplar Profiles of total proteins expressed in poplar suspension cultures subjected to metal stress (CdCl2 or CuS04) for 3 hours were compared to those proteins produced in unstressed cultures. The protein extracts were run on a one-dimensional SDS-PAGE. No discernible difference was seen between the total protein banding patterns that resulted in the metal stressed and unstressed samples (data not shown). The presence of metal-induced transcripts in poplar suspension cultures was then investigated by differential display analysis of RNA from both Cd-stressed samples and unstressed samples. This technique combines both the elevated sensitivity of radioactive PCR and the high resolving power of a 12% denaturing gel. Differential display analysis was performed on the RNA samples using a decamer that was designed from the conserved regions of the plant MT-like genes. Radioactive PCR was performed using this MT-decamer, degenerate T l g oligo primers and a a35S nucleotide. Side-by-side comparisons were made between Cd-stressed and unstressed samples. Of the reactions that were performed, no discernible difference was seen between the differential display banding patterns between Cd-stressed and unstressed samples (data not shown). That is, no discrete bands which would represent transcripts induced under metal stress were observed. Since these techniques failed to identify potential metal-induced proteins or genes, a more direct approach was taken to identify possible phytochelatins and metallothionein-like genes in poplar. Specifically, a comparison of the predicted amino acid sequences of glutathione synthetase gene (a key enzyme in the production of phytochelatin peptides) isolated from a number of phylogenetically distinct species was performed (see Figure 2.1). Regions highly 64 conserved between all of the species were used to design two degenerate primers. Genomic PCR amplification was subsequently performed using this pair of degenerate GS primers and poplar DNA as a template. The resultant 490 bp amplification product was cloned and sequenced. Sequence analysis and homology investigations revealed that the 490 bp product likely consisted of a 312 bp glutathione synthetase exon that displayed significant sequence homology at the nucleotide level to numerous known glutathione synthetase genes (i.e. 64% and 60% similarity to Arabidopsis and Brassica, respectively) (see Figure 2.2 for nucleotide sequence alignment of this putative exon with that of the cDNA from Arabidopsis thaliana and Brassica juncea). 65 o o o o o Cu Cu Q SsS PS 2 J > D J Q <c Cu J Q O W 0 £ Du S W W >-• z a > z E-i PS EH EC W 0 2 >l J Q 0 s w 2 >H 3 5 J H >H 0 P i OS a <; Cd J J fa C O C O Q « !>S M CU Q 2 > H 0 J o 5; cq aj x co H (N ^ ^ h o o o o o o o J Z CU a 0 w > a; Pu i—i CO < 0 CD 2 0 Q cu a z PS H > J E-i W CU EH J Q CO fa s E- i Cu DS H Z u Q O I I I OS C M I I I J C O a cu z > H J EH 0 w to < PS W H >H EH < >H t-H fa w EH a fa tx> o LO o to •rH to CO 3 0 C> 3 TS O H CD 10 - S 0, 0) S 3 0 13 t] 0 5 O «1 1 B, to .Q CQ KC S; aq x co r~i CM ro LO ix) r-C O m C M CM CM tl O _ • H 73 CO CO XI o o o o CTl r~ o r - CO r o CO U") ro ro ro CM ro > 1 1 1 O 0 0 ct CC PH CH EH fa 1 1 1 IX) > > HH1 HH S H i l l r o > 0 HH1 HH HH- > J i l l J J > > > > > 0 1 1 1 0 0 0 o 0 0 0 W i l l X X t l ] O X fa 1 1 1 J J < < HH < W i l l CO CO HH HH HH HH J i l l CO co "=5 fi. •3! < EH 1 1 1 S S 2 CM CU 1 1 1 > > a Q Q a Q 0 1 1 1 J J H HH > H i l l IX) < a. < < < < < a i i i a a Oi Oi a M 0 PS 1 1 1 r o >H >H o HH Cu < i i i LO > > < < < < 0 H i l l J j HH HH HH HH W 1 1 1 r o w w w W w HH S i l l a a w W HH PH Q 1 1 1 > > HH HH HH HH H-1 CO 1 1 1 fa fa a a o HH o W i l l 0 w ^ o EH 1 1 1 a Q EH c u J i l l a a a Q a a EH Cu 1 1 1 fa j a O a >H CS 1 1 1 w w H^ l HH H< CU 1 1 1 w w H M HH H HH W i l l H fa j CO CO Q H 0 1 1 1 r o a a O O 0 Q W CS 1 1 1 . r o j fa 15 s 0 1 1 1 o H H CO CO H J 1 0 1 1 1 r o CU CU EH EH EH Q 1 ft. 1 1 1 r o w W 1 S I I I CU a IS 1 J i l l CO CO 1 CO 1 1 1 Z 1 1 1 W w 1 o 1 t 1 0 1 1 1 2 2 I H 1 1 1 PS 1 1 1 EH | ) o 1 f 1 EH 1 1 1 J | 1 CJ 1 t 1 W i l l CO | 1 > 1 1 1 0 1 1 1 CO | 1 HH 1 1 1 0 1 1 1 J | t 1 1 1 a i i i IX) u | 1 1 1 1 1 Cu 1 1 1 H PS | 1 fx 1 1 1 H i l l r o J 1 1 O 1 1 1 PS 1 1 1 i n Cu | 1 O i l 1 1 < 1 1 1 H cu | I a 1 1 1 J i l l r o cS | 1 HH 1 1 ] O 1 1 1 w | I PH 1 1 1 >H 1 1 1 CM" | I sC 1 1 1 cu i i i J | 1 PH 1 1 1 > 1 1 1 z | 1 H 1 1 1 CU 1 1 1 J | I 1 1 1 W i l l | 1 Q 1 1 1 0 1 1 1 fa | 1 s 1 1 t Q 1 1 1 H | 1 HH l 1 1 > 1 1 1 fa | I S 1 1 1 > 1 1 1 H CO | 1 o 1 1 1 J i l l o a | 1 EH 1 1 1 > 1 1 1 r o Cu 1 1—1 1 1 1 DS 1 1 1 O z | 1 CO 1 1 1 W i l l o J ( 1 > 1 1 1 a i i i r o w J I CM 1 1 1 0 1 1 1 J | I j 1 1 Q 1 1 1 CO | 1 1 1 1 w i l l CO 1 2 1 1 1 H i l l CO t 1 1 1 1 < 1 1 1 J J 1 M 1 1 1 CU 1 1 1 H | I w 1 1 1 J i l l EH I CM 1 1 1 5H 1 1 1 EH | | H 1 1 1 Z 1 1 1 < | j CJ 1 1 1 a i i i CX> H | I EH 1 ] 1 <5 i i i CO fa | I CM 1 1 1 S i l l CM EH • CO 1 1 1 0 1 1 1 IT) CO | 1 EH 1 1 , >H 1 1 1 CO CO | I > 1 1 1 OS 1 1 1 CM CO | 1 1 1 1 H 1 1 1 CO | I H 1 1 1 0 1 1 1 >H | 1 w t 1 1 K i l l CO | 1 EH I 1 1 W i l l J | 1 H J t 1 1 E- i 1 1 1 co | 1 1 1 1 J i l l co | I Q 1 1 1 EH 1 1 1 u | 1 O 1 1 1 W i l l 0 j 1 H I 1 1 1 < 1 1 1 0 | 1 M 1 1 1 H i l l H > | 1 Q 1 1 1 > 1 1 1 i — 2 | I HH 1 1 1 0 1 1 1 CM 1 1 1 0 1 I 1 to • H to CO 3 0, - I 3 to q to CD - H • H •> Q , 0) m to to I CO TH. to CO 3 m a I-H O 3 • H • a to • H CD 0 m to o o to - H Q| S; tci a: x co H CM ro J^i LO X^) [— CO X ) 3 m m g cq S; co a: >< co H CM r o LD ix) r -66 H T O* ^ ^ [— cs] i—i ro i—i i—I i—i rH rH rH rH rH rH OD LD O LO O O LO LO O O CS] o o o CM CM CM LO CM CM CM H cn r~ CM CM <o 00 [""- CM CJt [-~ [ CTl CO CM LO CM CM CM CM » « H I D H H > J rH CD LO OD CD LD CO co co CD oo co co o 2 2 0 0 0 Q in to Hi B W W W i>S fcC O J hi hi O > > > > . . i*S 0 o o o u> to ra K K K K ' ' ' >H >H K K cd Cd hi hi 31 X <o a a CM fH < LO by by 0 0 0 0 hi J g H <; rt u u hi hi M H LO d CM CO LO £H E-< CO e> 2 OS > OS hi co rH Q rH |-1 LO 0 CO O 0 0 hrf h. CO CO CO PJ PJ H CO CO CO PJ hi hi hi > H H H PS K hi i*S Cd CO CO 0 CO co <; <C <C co Q bl [d Cd Cd M i l l 0 0 0 K W Ol > > <; co Q EH EH ^ 1-1 EH . . hi CO >J 2 EH EH hi 0 I LO hi H X o Q Q 0 0 X >H co co as cs hi hi hi hi CO CO CT O x x i-i hi o i H a EH CO I PJ K H K EH CO PS X, X X co PS hi hi hi 0 > Cu CO co w a " h i Ol > O X >< LO PS PS PS CT X X X X & 5 5 5 < < < < PJ PJ PJ PJ PJ EH P I !H S O X co O LO I rH I CD I 0 0 > EH hi EH 0 Q w rH X O > LO OS O 0 O bl LO EH bl > bl hi CO LO H 00 > LO I—I 5; S a bi i a i i 0 i 0 a > a M a hi bj &J hi Cd Pi Q PS bl 2 O O > Q co hi co 0 bl 0 hS OS bl bl 0 0 PS bS bl bl CO CO > H Q Q bl bl by by PS EH LO hi hi hi hi hi hi hi LO > > EH EH EH EH > LO 2 2 o Cd w M H hi EH hS as hi hi PJ PS PS PS CO 31 31 hS 2 £2 2 2 •^p PS PS CO CO CO CO hi LO hS hS I bj E E hi by >H 0 CO < < < < CO bl bl PS l-H hi a D Q Q by hi hi hi hi hi > PS OS Q PJ pj S s s bl 0 <c 0 0 0 0 0 hi hi hi < EH a a o O  P 1 Pi CM 0 0 0 0 0 > H hi > > > > > > > Cu bj Cu Cu CK b b co CO bl bl Q < < CO CO CO CO CO CO CO CO CO CO 2 O q > 0 0 < < < > hi hi Cd < < < < < << CO CO CO CO CO CO S hi > O o a o> o a Cd H H H H H H H X as rH 2 i*s Cd w bl bl > rH Pj Pj !H EH EH Pj rH c* o (Y, cn 3 s hi hi by bj OD 2 2 2 2 ~ p p <y ro >H >H hi hi hi hi < 1^ S s 1—1 M t-H i—i E LO e o CO < < EH < "=5 0 o W bl W bl bl w w o a g CA w w CO CO CO y, CO l—l l—l H M H H > r~ 2 M ro pj CU PJ PJ PJ Ol Cu o> a a a Ol a o LO K S 2 Cu by > > > > H hi hi hS hS hi NS hS Cd bl 2 PJ 0 PJ PJ hi PJ > hi hi hi hi hi hi 0 Q bl CdEH EH CO CO CO CO co co co <C <C < rt! 0 CM CM hi PJ PJ pj PJ PJ PJ CM NS 2 hi hi Pi PJ i—i o O Cd hi hi by Cu by hi bj EH EH co co CO EH Cu > > O hi hi hi hi hi hi hi 1 1 0 0 0 0 CO > M < < EH EH EH < EH 1 1 a Q Q a Q > H H H by Cu bj by M 1 1 < < < ca- 1 hi PJ PJ PJ pj Pj bl Cd 0 CO CO ps Q hi LO < < < < < < H LD bl bl 0 0 PS 0 O LO p. > r- X X >H >H bj O CD a a a a Ol Q X LO > ro s 2 EH EH CO CO EH ^ hi hi by bj Cu bj > LO LO s hi > > > > < LO S S S S S LO CM PJ IS 0 0 > > > > H CD P P >j P p LO 2 2 < CO > > a a Q 2 a Q Q • Q Q Q LO CO 0 0 i i i 1 PS CO pu CO CO CO CO CO 1 1 1 Pl PJ i i i 1 1 OS K Pi OS OS (u 1 I 1 > > i i i 1 1 X X 2 2 2 2 E 1 I 1 EH 2 i i i 1 1 hi hi hi hi hi H > 1 I 1 0 0 co co co co 0 o o O o O o O 1 | 1 co co co co co co Cd hi hi hi hi hi hi hi 1 I 1 PS hi CO CO EH 2 h< PS PS Cu bj by by CO 1 1 1 Ot O pj PJ PJ PJ CO 1—1 H > > > > hi 1 1 1 X >H X 2 W CO > Cd a EH EH EH bl PJ 1 1 1 rH EH EH a hS a Cd co rH Cd Cd a Ot a a o rH 1 | 1 LO hS i*S < <C CO hS hi LO OS h<S < < < EH Cu "=3i 1 I 1 ro Q Q CO CO EH EH Cd t>S h< H H H 0 a LO 1 1 1 CO to to 1 •H to •H to 'H CO CO to to 3 to CO 3 a - i q to a -H q to CO a -H CJ o cu •H 0) 0 0 3 0) •iH CD 0 O 3 •H TJ CJ •H 'H > •CI •H •a 0 •H •H > •9 •iH. •a 0 CO •H to -H D. £• to •H to -H Q, CD to •H CO CO -Q 3 0 o CO q 3 0 ft) CO o to •q 3 to V s o to -H D. CO to CJ CO -H D. to to E5 ij >H >H CQ ^ bl a: to ai bl \ CO CP «s rH CM ro LO CO r- rH CM 00 ^ Ji LO CD r- rH CM ro e e H M §§ bl bl h<S hS Cd bl o i a < < O CO rH, LO O b fa hi 31 31 0 CO CO PJ pj pj W KC Cd sC rtj H hi hi -< < < a Cd Cd hH < <d > H > H < i a a I Q Q i 0 0 fa fa PS Ol co Q PJ PJ ' 2 < hi hi «< t< Cd > < PS H > M < < 0 CH Cd bl Q a K 0 0 0 fa Q bl Pl t<s bl bj hi bl bl bl CO 0 a s Cd Cd bl Cd 0 0 S > Cd PS Cd CM 0 EH Q 9 9 9 9 9 9 9 CO CO S >H hi hi 0 0 < < fa fa 0 EH CO CO >J >H hi hi hi 0 0 0 ' EH CO CM >J >J < <fa fa EH EH fa fa EH EH pi pi S S § O hi hi hS hS LO < < M H Q Q a w i Cd Cd CM PJ hi H > PS PS < <C < O bl bl PJ PJ hi bl 2 2 0 0 0 a 0 Q Q CM CM CM CM bl S J hi hi hi J hi by by hi hi hi Cu by O^hHPS^ eCShSPS r- Cd W M <o hi hi hi rH >H 00 Q LO pS a i i i i cd bi a a a a CO CO CO ft, hi bl " 2 2 CO EH >J >H >H >J O O O Q co co os a CM CM 31 Q 2 CO •H to CO 3 CO to 0, -H q to 0 0 3 01 -H CD •H TJ 0 -H is .q to -H to i-H Q, CD g to JQ 3 O to ta o to fa E= 0 to ~i a M SH . . . . . cq ^ S; bi a: ><: to <H CM oo ^ LO LO r-67 o ro iH r— CM t— r-iH o LO r- ^ co LO "^r ^ r- -a1 CO CO H H Z 3 5 S 03 cC Q X PC PC S > > > >-< >< M > > E-i o o o b j Cu J H 2 H o o o J hi H w w w CO CO Q H H > o o > CT W Q > CO by > > CT PC < a, Qj Pj CO CO O 0 PJ p_i O GO by U U U S Z 2 2 2 Pi a; W co by by bj > pj pj Pj h< K W 0j OJ P-I In (n H H H H Pi Pi X Pj PJ w ia H H 2 w w w u w w w DC « CT o J hi PS Pi fcl W K ( J U CD o o o o >H >H >-l >H >J >-* >H H H i-q by J J EH o o o u o u o o o s s a 0 0 0 PJ PJ P j fetf ^ S 5 P o o •H "a to H CO to O U 15 O o o o o O O CD O a a a a 0 0 0 01 PJ p j PJ PJ W W &L1 W n l J h i J > > > > to q to •H -H i> -Q i D, Hi 6 O <0 to o O 10 M Q, &q * to r- r- cn r- r- cr* ^ ^ r^1 ^ CO CO U W W W ^ CO < > H H H iC 5 s a e» gj 3 w w * w w w * E) Ej Ej H H H K 0! 0! « (U Oi K hi hi hi hi hi hi hi hi 00 hJ to •H to to 3 <0 Ci M O CV 3 to -H CO -Q tO W to q to - . > CO M Q, <D 3 O <B <0 rH CN ro LO >^ r-_ . o to -H a M M • • • • • 03 ^ X t*\ * * W rH CM ro ^ LO >i> r-C L P -S 68 IX) CTl LO LO CO -=H LO ro «qi r- CM ro LX> rH CM ro ro rH rH rH rH rH rH o EH O < < < o < LO FX 0 e> EH EH EH ro EH ro FX < EH EH EH EH LO EH rH 0 0 o rH EH EH EH rH CJ «S < < CJ CJ CD CJ 0 u u U 0 CJ EH 0 o <; CD CD CJ CJ EH EH CD CD CD ft u EH 0 O >3 CD < 0 < < < < 0 0 0 CD CD CD CJ IX> < < < CP ft < CJ <x> CD ro o 0 EH CM 0 CJ CJ rH < ro EH EH EH O CJ o LO CJ rH EH o 0 rH o CJ CJ rH CJ LO EH u CD LO EH EH EH LO tf\ ro EH EH EH CM CD CJ CD rH FX ro O o 1 •^ r 0 < EH LO ft rH EH EH LH rH EH EH EH rH EH < EH EH CJ CD FX O O EH ft, FX I D 0 EH EH EH EH FX < < EH EH EH < 03 0 0 CD CJ CD EH 0 0 0 EH EH EH EH 1 1 LH <c CD < CD t—i 0 o EH rH CJ CJ U rH F £ CM <C < CD rH ft F-C 1 o ro 0 0 CD FX FX -5 LO FX i—t EH EH EH rH PX 5 rH CJ ro oo C M O rH rH in CD ro LO 00 CM [— O rH LO r- ro O CJ CM EH ro ft rH CJ EH ft CJ <C CD CD EH <x> <; O EH ro CJ LO < O C J ro r£ CJ CJ < <—i CD en CJ CM CJ rH CJ CM CD eC EH 0 ft < CJ CD EH ft < < CD CD ft, 0 CD CD CJ CJ EH EH o CM CJ CD ft CD <C CD <C CJ EH CO CJ r- CJ CM CD rH ft LO ft CJ EH < EH EH CJ EH EH EH CJ EH CD EH CM ft rH CJ CO •H < CJ EH EH ft EH O CJ EH ft CJ CD CJ CD fll CJ CJ CD CJ CJ ft CJ CJ CJ CJ CJ CJ CD <C CJ CJ CD < ft CJ CJ ft ft CJ CJ EH EH CJ CJ CJ O CJ ft < < < CJ EH ft EH EH o EH EH EH CJ EH EH CJ ft CO a to o u x) • H B O XI co i—I co it) a H M O < m cu rH CM rO CJ CJ < < EH CJ ft ft EH EH CJ CJ CJ CJ CJ E-i ft O CJ < ft CJ cj o ro «C ft rH CJ CJ CO •H CO a. to o o X) -H •H (0 (0 X! (0 rH 10 CO rU M O <C CQ CU rH C M ro < < EH CJ EH CJ CJ CJ CJ CJ EH EH C J C J < ft C J C J C J C J <c ft o C J O EH CJ CD CD CJ CJ CJ CJ CJ CJ ft CJ EH ft ft CJ CJ EH CJ 0 H M O < PH C U CM CO o E-i EH O 0 0 1 o CM 1 EH | rH ft ft 1 o IX) 1 0 j r- FX FX 1 CO rH ft ft I rH F^ FX 1 rH CJ 0 I EH EH 1 < <c I EH EH 1 CJ 0 | 1 0 1 EH EH I 1 EH 1 EH EH 1 1 EH 1 <? I 1 0 1 1 0 0 1 CD CJ 0 I CD EH EH 1 CD O EH EH | CD E-I EH 1 CO CX> CJ E-I I CD 0 0 1 r-rH EH EH 1 rH 0 0 1 rH LO ft < 1 LO EH EH 1 LO O EH EH I CT) E-I EH 1 CO LX> EH EH 1 CD 0 0 1 rH EH EH I rH EH EH 1 rH < < I EH EH 1 CJ 0 | 0 0 1 CJ 0 | EH EH 1 < < I 1 0 1 u 0 | 1 < 1 ft < I 0 EH 1 CD 0 I EH EH 1 rH CD 0 I rH EH EH 1 rH CTl EH E-i I CO 0 0 1 LO EH EH I CO EH EH 1 rH CJ 0 rH EH EH 1 rH o E-i EH 1 O 0 EH 1 o CTl CD 0 I 00 EH EH 1 LO < 0 < CD EH EH 1 rH CJ 0 0 rH 0 0 1 rH CD 0 0 0 0 1 EH 0 EH 1 EH 1 EH < EH EH EH 1 EH EH EH EH EH 1 EH EH 0 ft < 1 0 0 0 EH 0 1 0 0 0 EH EH 1 CO EH EH EH CD EH EH 1 CD r- CJ 0 0 CD 0 0 1 LO LO 0 0 0 CD 0 0 1 t— rH < E-i EH rH E-i EH 1 rH lO 0 0 O lO 0 0 1 LO t— 0 0 0 CD 1 0 1 LO lO E-i E-i EH CD 1 EH 1 r— rH EH EH EH rH < < 1 rH 0 0 0 EH EH 1 o EH ft EH EH 1 0 0 0 ( EH 1 0 0 0 | 0 1 O EH ft 1 EH 1 0 0 0 I < 1 0 0 0 I 0 1 rH «5 «S ^ rH EH EH 1 rH CD fit! LO EH EH 1 LO 0 0 0 CD ^ 1 r-rH EH EH < rH < 1 rH O < < 0 o 0 E-i 1 o IX) 0 0 0 m EH EH 1 •31 LO < < EH CD < r-rH 0 0 0 rH 0 rfi i rH EH EH F£ EH EH 1 fit! FX 0 0 1 0 0 FX < 0 1 EH EH 0 EH EH 1 < 0 EH ft r=C 1 0 0 0 0 0 1 0 EH 0 0 EH 1 CD 0 0 O CD <f! ft. 1 CD EH EH 0 ro F^ 3 1 CM LO < 0 0 CD 1 EH 1 t— rH 0 0 0 rH 0 ft 1 rH LO tfj <i LO < < 1 LO FX ro 0 0 1 CM LO 0 fiC 0 CD EH EH 1 r-rH 0 0 0 rH E-I EH 1 rH ft <c EH ft 1 0 0 < 0 0 1 0 0 0 1 ft 1 0 0 < 1 0 1 0 0 0 1 EH 1 EH EH EH ft 1 ft < < 0 1 rH 0 EH rH EH EH 1 rH ro EH EH EH CM < «C 1 rH LO 0 0 o CD 0 0 1 r-rH EH EH 0 rH 0 0 1 rH to CO -H •H to CO a ID o X) -H XI rt) ft C Q C U rH CM ro a ft) o 0 T ) - H M •H CO ft) X) CO rH ft) ft) Qj U M 0 <C C Q C U rH C M C O o ro C M C M CO rH X) -H W •H 10 ft) X! CO rH ft) ft) CU H M O ft C Q Cu rH CM rO r-l C D a •a o O H-> o t/5 fN s M) 69 Southern blot analysis was then performed using this GS gene fragment as a means to confirm the presence of this gene in the poplar genome. Total genomic DNA was isolated from both poplar and Arabidopsis, subjected to Southern blot hybridization using the GS poplar PCR product as a probe (Figure 2.3). Since the GS gene from Arabidopsis was previously isolated (Ullmann et al., 1996), the Arabidopsis DNA on this Southern served as a positive control. Consequently, the presence of the two expected discrete bands in the Arabidopsis sample when digested with Bglll, indicates that the hybridization reaction conditions were stringent enough to ensure that only the GS gene would be detected. Likewise, the presence of two discrete bands in the poplar sample indicates the presence of the GS gene in the poplar genome. In a similar manner, a Southern blot was performed in order to test for the presence of a MT-like gene(s) in the poplar genome. Total DNA from poplar and pea was extracted, digested with the restriction enzyme EcoRI, resolved on an agarose gel and blotted on a nylon membrane (Figure 2.4). Hybridization was performed using the 650 bp pea MT-like cDNA (kindly provided as a gift from Marta Evans, University of Durham, England) as a heterologous probe. The detection of discrete bands in both the pea and poplar samples on the Southern blot indicates that the gene is present in the genome of both of these plant species. Metallothioneins exist as a small gene family in certain plant species, but this remains to be determined in poplar. 70 probe: 650 bp GS poplar PCR product Figure 2.3: Southern blot analysis to detect the presence of the glutathione synthetase gene in the poplar genome. DNA samples from Populus alba x P. tremula and Arabidopsis thaliana were digested with Bglll, resolved on an agarose gel, blotted on nylon membrane and probed with a 490 bp GS gene fragment from poplar. The position of molecular weight markers are indicated with arrows. 71 Figure 2.4: Southern blot analysis to detect the presence of the metallothionein-like gene the poplar genome. DNA samples from Populus alba x P. tremula and pea (Pisum sativum) were digested with EcoRI, resolved on an agarose gel, blotted on nylon membrane and probed with a 650 bp pea cDNA MT-like gene. Molecular weight markers are indicated with arrows. 72 2.3.2 Stress Induction of metal-chelating compounds Metal toxicity tests were performed using suspension cultures of P. trichocarpa x P. deltoides (HI 1) subjected to varying concentrations of CdCl2 or CuS04. Growth of metal-stressed samples was compared to growth of non-stressed control cultures. Growth response curves to Cu-stress indicate that both 20 pM and 100 pM concentrations are equally toxic to the cell cultures as seen in the decline of growth in these two samples compared to the non-stressed control sample (see Figure 2.5). For Cd-stressed samples, however, a 20 pM concentration seems to be toxic to the cell cultures, but the 1 OOpM concentration at least initially, seemed to actually stimulate cell growth. The toxicity effects of a range of Cd or Cu concentrations was then investigated by subjecting poplar suspension cultures to metal ion concentrations ranging from 0- 500 uM. All concentrations of CuS04 seemed to be toxic, as indicated by the reduction in cell growth compared to the control (non-stressed) samples. All concentrations of CdCl2, except for 100 pM, also caused a reduction in cell growth and therefore can be considered toxic. Again, the 100 pM CdCl2 treatment, seemed to enhance cell growth by approximately 150% (see Figure 2.6). The importance of the phytochelatins in poplar's ability to tolerate heavy metals was investigated through the use of L-butathione sulfoximine (BSO), a specific chemical inhibitor of glutathione synthetase, and thereby an inhibitor of phytochelatin biosynthesis. To this end, poplar suspension cultures were exposed to 20 pM and 100 pM concentrations of CdCl2 or CuS04 with and without the presence of BSO. Growth of the metal stressed cultures was compared to the non-stressed control samples. In all treatments, the metal stressed cultures including BSO displayed significantly less growth than did the metal stressed samples without 73 Ol I I I I I 0 6 12 24 36 48 Time after Metal stress (hrs) Figure 2.5: Toxicity growth curves of poplar suspension culture's response over time to different CdCI2 and CuS04 concentrations. P. trichocarpa x P. deltoides suspension cultures were exposed to either no metals (black line), 20 uM CdCl2 (purple line), 20 uM CuS04 (green line), 100 uM CdCl2 (red line) or 100 uM CuS04 (hlue line) Dry weight measurements were taken as an indication of growth in time intervals. Values were taken in triplicate. Bars indicate the standard deviation. 74 Cadmium (CdCL) l"Copper (CuSOJ 50 100 200 300 400 500 Metal Concentration (nM) Figure 2.6: Toxicity response of poplar suspension cultures to a range of ( d( l ; and CuS04 concentrations Five-day old P. trichocarpa x P. deltoides suspension cultures were subjected to various concentrations of either CdCl: (light boxes) or CuS()4 (dark boxes) for 12 hr. Cell growth measurements were taken on a dry weight basis. Values were normalized by considering the "Cf stressed samples as indicative of 100% growth Values were taken in triplicate and bars indicate standard deviation. 15 BSO (see Figure 2.7). This finding suggests that phytochelatins play some role in combating both Cd and Cu stress in poplar suspension cultures. The possible metal-induced synthesis of phytochelatins was examined by performing reverse transcriptase PCR on mRNA samples isolated from 20 pM and 100 pM CdCl2 or CuS04 stressed poplar suspension cultures. Primers specific to a portion of the poplar glutathione synthetase gene were designed from the cloned fragment of this gene. PCR was performed on cDNA samples with a GS-specific primer along with an oligo T 1 8 primer used in the first round of PCR. An aliquot from the first PCR reactions was used as a template in a second round of PCR. The second round of PCR was performed using a nested GS-specific primer and an oligo T 1 8 primer. As well, a positive control for the PCR reaction was the 490 bp poplar GS clone as a template for the two GS-specific primers. A 490 bp product was seen in the positive control lane and the Cd-stressed sample lanes (see Figure 2.8). This indicates that glutathione synthetase, and thus possibly phytochelatins, are induced under Cd stress but not Cu stress in P. trichocarpa x P. deltoides suspension cultures. The metal-induced expression of glutathione synthetase (GS) and metallothionein (MT) genes was investigated in suspension cultures and intact plant tissue through the use of northern blot analysis. Suspension cultures were subjected to 20 pM CdCl2, 100 pM CdCl2, 20 pM CuS04,100 pM CuS04 over a range of time periods (1 hr - 3 days). In vitro propagated plantlets of Populus alba x P. tremula clone (INRA clone 717-1B4) were grown in media containing either 100 pM CdCl2 or 100 pM CuS04 for 5 days. Total RNA was extracted from these plant tissues and 10 pg of this RNA was resolved by formaldehyde-agarose gel electrophoresis, blotted onto a nylon membrane and hybridized in turn with a GS probe (490 bp poplar PCR fragment), a MT probe (650 bp pea MT cDNA) and a rRNA probe (1.8 kb soybean 18S). Expression of GS or MT could not be detected on northern blots containing RNA isolated from suspension cultures. 76 50 1 • -BSO +BSO 4S Sin I s p *» o °I0 5 0 r • • • • • - 1 -Control 20 yiM CdCI2 100 ,uM CdCI2 20 yM CuSO4100 iaM CuSO« Metal Concentration (mM) Figure 2.7: Toxicity response of poplar suspension cultures to different C d C h and C"uS04 concentrations under chemical inhibition of phytochelatin production Five-day old P. trichocarpa x P. deltoides suspension cultures were subjected to either no metals (control) or 20 uM CdCh, 100 uM CdCl 2 , 20 pM CuS0 4 or lOOuM CuSC)4. Within each metal treatment, the inhibition of the production of phytochelatins by the use of butathione sulfoximine (BSO, purple boxes) was compared to the production of phytochelatins (no BSO. blue boxes). Cell growth measurements were taken on a dry weight basis. Values were taken in triplicate. Bars indicate standard deviation. 77 mRNA 5' j A A A n X r e v e r s e t r a n s c r i p t a s e Figure 2.8: Reverse transcription PCR to detect the induction of glutathione synthetase production in Cd and Cu stressed samples. The presence of the glutathione synthetase transcript was investigated in mRNA samples isolated from 0 pM, 20 pM CdCl2, 100 pM CdCl2, 20 uM CuS04, and 100 pM CuS04 poplar suspension cultures. Water and a fragment of poplar's GS gene were used as negative and positive PCR controls, respectively. A molecular weight ladder is shown at either end of the gel. 78 As seen in Figure 2.9, in Cd-stressed plants glutathione synthetase was strongly induced in both stem and leaf tissue but appears to be expressed at low levels in root tissue. As well, in Cd-stressed tissue, the metallothionein transcript seems to be constitutively expressed in all tissues to essentially the same extent (see Figure 2.9). In Cu-stressed samples, as in Cd-stressed samples, the glutathione synthetase transcript was strongly induced in stem and leaf tissue but appeared to be constitutively expressed at a low level in root tissue (Figure 2.10). The pattern of metallothionein expression in Cu-stressed samples also corresponded to that seen in Cd-stressed samples in that the MT transcript appears to be constitutively expressed at roughly equal levels in all tissues (see Figure 2.10). These findings indicate that the glutathione synthetase and metallothionein expression is responsive to both Cd and Cu stress in a similar manner. 79 stem Tj CD - o CD CO CO CD CD H +-> C 3 leaf CD cL) 5--4—» • CD 00 LO CD i -• M CO C 3 root -a "CD CD oo on cu '— -«-> C/3 GO co CD CO C =5 probe: — 490 bp GS probe: 1 650 bp Mt pea probe: » rRNA soybean i r V Figure 2.9: Nor thern blot analysis to detect the induction on GS and MT- l i ke genes in Cd-stressed poplar tissue. Total RNA isolated from stem, leaf or root tissue from Populus alba x P. tremula that was either Cd-stressed (100 u M CdCh for 5 days) or unstressed. The samples were resolved on a formaldehyde-agarose gel, blotted onto nylon membrane and probed with the 490 bp GS gene fragment from poplar (top), the 650 bp MT-l ike cDNA from pea (middle) and the 1.8 kb 18S ribosomal soybean genes (bottom). 80 s t e m <D l e a f o> CD c/a C/a +-> c/a r/a c/a CD * s c/a § w c/a r o o t 1 3 CD CD c/a c/a CD c/a H d c/a 2 TT— c/a w c/a CD D tya c/a CD c/a H d M P probe: ^ 490 bp GS poplar ^ i • probe: 650bp Mt pea probe: • ribosomal soybean Figure 2.10: Nor thern blot analysis to detect the induction o f GS and MT-like genes in Cu-stressed poplar tissue. Total RNA isolated from stem, leaf or root tissue from Populus albax P. tremula that was either Cu-stressed (100 u.M C U S O 4 for 5 days) or unstressed was resolved on a formaldehyde-agarose gel, blotted onto nylon membrane and probed with the 490 bp GS gene fragment from poplar (top), the 650 bp MT-l ike cDNA from pea (middle) and the 1.8 kb 18S ribosomal soybean genes (bottom). 81 2.4 DISCUSSION The glutathione synthetase gene which is involved in the biosynthesis of glutathione and ultimately phytochelatins, has been cloned from a number of phylogenetically distinct species. Amino acid alignment of the known glutathione synthetase proteins revealed two glycine-rich domains which display a significantly high level of homology. Degenerate PCR was used to isolate and clone the region between these two conserved domains in a hybrid poplar clone, P. alba x P. tremula (INRA clone 717-1B4). Sequence analysis revealed that the resultant PCR product was indeed a portion of a glutathione synthetase gene. Southern blot analysis using this PCR amplification product as a probe also indicated that the GS gene exists in the poplar genome. In a similar manner, the presence of genes encoding for the other primary metal-chelating compound in plants, MT, was investigated by Southern blot analysis. The presence of discrete bands in the poplar DNA lane of the Southern blot using the pea MT-like gene as a heterologous probe indicated the presence of this gene in the poplar genome. The effects of various concentrations of Cd and Cu on Populus trichocarpa x P. deltoides (HI 1) suspension cultures were examined. All concentrations of Cu ions tested (up to 500 uM) proved to be toxic as was seen by the inhibition of growth of the cell cultures. Likewise, most concentrations of Cd ions were toxic; however, surprisingly, the 100 pM CdCl2 treatment seemed to stimulate cell growth as these cultures exhibited approximately 150% growth when considering the non-stressed control samples as 100% growth. As Cd2 + is a non-essential heavy metal with no known cellular function, the finding that it at least transiently enhances cell growth, as opposed to the expected growth inhibitory effect, was puzzling. Hirt et al. (1989) also described a similar phenomenon in Nicotiana tabacum suspension cells when exposed to 82 moderate Cd stress (50-150 uM). They found that not only cell growth was enhanced at these concentrations of Cd2+ but that there was a significant stimulation of RNA and protein synthesis (about 160%). The authors reasoned that the most likely explanation of this stimulatory effect of moderate Cd concentrations is that, due to their similar ionic charges, sizes and chemical behaviour, Cd ions may mimic Zn ions. In this respect, Cd ions may, for example, replace Zn ions in Zn-finger transcription factors and thereby alter the rate of transcription and, in turn, protein synthesis. This hypothesis is supported by the findings that (a) only the application of Cd and Zn ions resulted in cell growth stimulation (Hirt et al, 1989), (b) competition studies imply that Cd and Zn ions may bind to the same cellular sites (Nocentini, 1987) and, (c) that changes in chromatin structure occur in pea seedlings exposed to Cd stress (Hadwiger et al, 1973). This growth stimulatory effect may only be seen at moderate Cd concentrations because at lower concentrations, intracellular Cd ions would all be bound to metal-chelating compounds and at higher concentrations, Cd ions would cause cell death. Moderate levels of Cd ions may not be lethal to the cell thereby allowing some Cd ions to be free to interact with Zn-finger transcription factors. The induction of heavy metal chelating compounds in poplar was explored in both suspension cultures and intact plantlets. The results of other metal toxicity studies in plants have suggested that the detoxification of heavy metals such as Cd and Hg is different from the tolerance mechanisms for heavy metals such as Cu and Zn. For example, cadmium-tolerant mutants in tomato {Ly copersicon esculentum) (Huang et al, 1987) and Thlaspi sp. (Baker and Brooks, 1989) do not exhibit a cross-tolerance to other metals. Mutants of the fission yeast Schizosaccharomyces pombe deficient in their production of glutathione, and therefore PCs, are hypersensitive to Cd but have a wildtype level of tolerance towards Cu (Mutoh and Hayashi, 1988). Also, studies performed by Reese and Wagner (1987) in which the synthesis of 83 phytochelatins was inhibited by BSO in tobacco suspension culture cells showed that BSO-treated cells display a heightened sensitivity to Cd, but not to Cu or Zn. Three metal-sensitive mutants, cadi, cad2 and cupl have been identified in Arabidopsis. Similar to yeast, both cadi (Howden and Cobbett, 1992; Howden et al, 1995b) and cad2 (Howden et al, 1995a) mutants seem to have a heightened sensitivity to both Cd and Hg but display a wildtype level of tolerance towards Cu. Conversely, Arabidopsis cupl mutants are hypersensitive to Cu stress but display wildtype levels of tolerance to both Cd and Hg (Vliet et al, 1995). Through extensive HPLC analysis, enzyme activity assays and double mutant analysis, the researchers hypothesized that the mutants cadi and cad2 are both deficient in their PC biosynthesis (Howden et al, 1995a; Howden et al., 1995b), whereas cupl is a mutant in its metallothionein production (Vliet et al., 1995). Likewise, it appears that the yeast Candida glabrata responds to Cd stress by the induction of PCs and to Cu stress by the induction of MTs (Mehra et al, 1988). In this study, BSO was used in conjunction with Cd and Cu toxicity tests in order to see if the level of metal tolerance exhibited by poplar suspension cultures would be altered by inhibition of phytochelatin synthesis. Indeed, all samples, whether stressed with Cd or Cu, displayed a heightened level of metal sensitivity with the addition of BSO. This finding indicates that PCs play a role in conferring tolerance to both Cd and Cu ions in poplar suspension cultures, in contrast to the studies cited above. These results are similar to others however, in which the suppression of phytochelatin synthesis by BSO enhances the toxic effect of Cd (Reese and Wagner, 1987; Hirt et al, 1990; Ruegsegger et al, 1990), Ag (Grill et al, 1987), and Cu (Salt et al, 1989) ions. Thus, different plants appear to have different mechanisms for Cu and Cd tolerance; in poplar, phytochelatins appear to be involved in both Cd and Cu tolerance. The induction profiles of both MT and GS genes in poplar were determined by northern analysis of intact plants. The finding that GS, and therefore likely phytochelatin production, is 84 induced in stem and leaf tissue upon both Cd and Cu stress in intact plants supports the conclusion from the BSO experiments that phytochelatins contribute to tolerance of these two ions in poplar. The finding that GS, and therefore likely phytochelatin synthesis, is induced under both Cd and Cu stress in some poplar tissue is in contrast to the aforementioned findings in some plant and yeast species, where PC production seemed to be specifically induced under Cd stress and not under Cu stress. However, the findings are similar to results in Rubia tinctorum roots where phytochelatins are induced by numerous metal ions including both Cd and Cu (Maitani et al, 1996). Likewise, the induction of phytochelatins both by Cd2+ and Cu2+ as well as by Hg2+, Pb2+, Zn2+, Ag , +, Au1+, Bi3 +, Sb3+, Sn2+, Ni 2 + has been reported in a number of different plant suspension cell cultures (Grill et al, 1987). The induction of GS, and therefore the production of PCs, under Cd and Cu stress in poplar suspension cultures was analyzed by RT-PCR. The presence of the positive amplification product in Cd stressed samples and the lack of this product in the Cu stressed samples suggests that PCs are produced in poplar suspension cultures in a metal-specific manner. This finding conflicts with the northern analysis performed on intact plants that indicated that PC synthesis is induced under both Cd and Cu stress in stem and leaf tissue. This discrepancy may be due to the fact that suspension cultures respond differently to metal stress than do intact plants. This hypothesis is supported by the finding that in Arabidopsis, the cupl mutant diplays a Cu sensitive phenotype in tissues of whole plants but not in undifferentiated callus (Vliet et al, 1995). MT-like genes of some plant and yeast species were previously reported to be induced under Cu stress but not under Cd stress (Mehra et al, 1988; Vliet et al, 1995). However, in this research, northern analysis of RNA isolated from both Cd and Cu stressed poplar plantlets showed that MT transcripts accumulate in stem, leaf and root tissue regardless of whether or not 85 the tissue was exposed to metal stress. In a similar manner, MT transcripts have been seen to be constitutively expressed in pea (Evans et al., 1990), maize (Framond, 1991), and coffee (Moisyadi and Stiles, 1995). Two MT genes have been isolated from Arabidopsis - MT1 and MT2. In seedling tissue, MT1 was shown to be uniformly expressed in all treatments (Zhou and Goldsbrough, 1994) whereas MT2 was shown to be induced by Cu2+, Ag1+, Cd2+, Zn2+, Ni2 +, and to be heat stress induced (Murphy and Taiz, 1995). Thus, the metal induction profile determined for the poplar MT transcript parallels that of the Arabidopsis MT1 transcript. And, since it has not yet been determined if MT genes constitute a gene family in poplar, it cannot yet be determined if there are other isoforms of MT in poplar that do respond to metal stress. Note that the MT induction profile in poplar was determined by performing northern blot analysis using the constitutively expressed pea MT-like cDNA as a heterologous probe. Therefore, it is likely that the MT transcript in poplar that had the strongest homology to that of the pea MT-like gene would be detected and does not exclude the possibility of other MT isogenes that did not hybridize to the pea MT-like probe. Prima facie it would seem that plants might possess different mechanisms to combat stress induced by non-essential and essential heavy metals. This research, however, revealed that hybrid poplar seems to respond to both Cd, an non-essential metal, and Cu, an essential metal, in a similar manner. This finding suggests that the metal utilization mechanisms of poplar may also function as tolerance mechanisms. 86 2.5 References Baker, A. J. M. and R. R. Brooks (1989). "Terrestrial higher plants which hyperaccumulate metallic elements - A review of their distribution, ecology and phytochemistry." Biorecovery 1: 81-126. Chatthai, M., K. H. Kaukinen, T.J. Tranbarger, P.K. Gupta, and S. Misra (1997). "The isolation of a novel metallothionein-related cDNA expressed in somatic and zygotic embryos of Douglas-fir : Regulation by ABA, osmoticum and metal ions." Plant Molecular Biology 34: 243-254. Cunningham, S. D., W. R. Berti, and J.W. Huang (1995). "Phytoremediation of contaminated soils." Trends in Biotechnology 13: 393-397. Dong, J. Z. and D. I. Dunstan (1996). "Expression of abundant mRNAs during somatic embryogenesis of white spruce (Picea glauca (moend) voss)." Planta 199: 459-466. Evans, I. M., L. N. Gatehouse, J.A. Gatehouse, N.J. Robinson, and R.R.D. Coy (1990). "A gene from pea ( Pisum sativum L.) with homology to metallothionein genes." FEBS Letters 262: 29-32. Evans, K. M., J. A. Gatehouse, W. P. Lindsay, J. Shi, A.M. Tommey, and N.J. Robinson (1992). "Expression of the pea metallothionein-like PsMTa in Escherichia coli and Arabidopsis thaliana and analysis of trace metal ion accumulation: implications of PsMTa function." Plant Molecular Biology 20: 1019-1028. Framond, A. J. d. (1991). "A metallothionein-like gene from maize (Zea mays): cloning and charactization." FEBS Letters 290: 103-106. Fuente, J. M. d. 1., V. Ramirez-Rodriguez, J.L. Cabrera-Ponce, and L. Herrera-Estrella (1997). "Aluminum tolerance in transgenic plants by alternation of citrate synthesis." Science 276: 1566-1568. Grill, E., S. Loffler, E. Winnacker, and M.H. Zenk (1989). "Phytochelatins, the heavy metal binding peptides of plants, are synthesized from glutatione by a specific gamma-glutamylcysteine tripeptidyl transpeptidase (phytochelatin synthase)." Proceedings of the National Academy of Sciences of the U.S.A 86: 6838-6842. Grill, E., E. Winnacker, and M.H. Zenk (1985). "Phytochelatins: the principal heavy metal complexing peptides of higher plants." Science 230: 674-676. 87 Grill, E., E. Winnacker, and M.H. Zenk (1987). "Phytochelatins, a class of heavy metal binding peptides from plants, are functionally analogous to metallothioneins." Proceedings of the National Academy of Sciences of the U.S.A84: 439-443. Hadwiger, L. A., S. Broemsbsen, and R. Eddy (1973). "Increase template activity in chromatin from Cd treated pea tissues." Biochemical and Biophysical Research Communication 50: 1120-1128. Hamer, D. H. (1986). "Metallothionein." Annual Review of Biochemistry 55: 913-951. Hayashi, Y., C. W. Nakagawa, N. Mutoh, M. Isobe, and T. Gotto (1991). "Two pathways in the biosynthesis of cadystins (EC)nG in the cell free system of the fission yeast." Biochemical and Cellular Biology 69: 115-121. Hirt, H., G. Casari, and A. Barta (1989). "Cadmium-enhanced Gene Expression in Suspension-Culture Cells of Tobacco." Planta 179: 414-420. Hirt, H., D. Sommergruber, and A. Barta (1990). "Effects of cadmium on tobacco: synthesis and regulation of cadmium-binding peptides." Biochemie und Physiologie der Pflanzen 186: gl53-163. Holton, T. A. and M. W. Graham (1991). "A simple and effective method for the direct cloning of PCR products using ddT-tailed vectors." Nucleic Acids Research 19: 1156. Howden, R., C. R. Andersen, P.B. Goldsbrough, and CS. Cobbett (1995a). "A cadmium-sensitive, glutathione-deficient mutant oi Arabidopsis thaiiana." Plant Physiology 107: 1067-1073. Howden, R. and C. S. Cobbett (1992). "Cadmium-sensitive mutants of Arabidopsis thaiiana." Plant Physiology 99: 100-107. Howden, R., P. B. Goldbrough, CR. Andersen, and CS. Cobbett (1995b). "Cadmium-sensitive, cadi mutants of Arabidopsis thaiiana are phytochelatin deficient." Plant Physiology 107: 1059-1066. Howe, G. and S. Merchant (1992). "Heavy metal-activated synthesis of peptides in Chlamydomonas reinhardtii." Plant Physiology 98: 127-136. Huang, B., E. Hatch, and P. Goldsbrough (1987). "Selection and characterization of cadmium tolerant cells in tomato." Plant Science 52: 211-221. Jackson, P. J., C. J. Unkeefer, J.A. Doolen, K. Watt, and N.J. Robinson (1987). "Poly(y-glutamylcysteinyl)glycine: its role in cadmium resistance in plant cells." Proceedings of the National Academy of Sciences of the U.S.A 84: 6619-6623. Karin, M. (1985). "Metallothioneins: proteins in search of function." Cell 41: 9-10. 88 Kawashima, I., Y. Inokuchi, M. Chino, M. Kimura, and N. Shimizu (1991). "Isolation of a gene for a metallothionein-like protein from soybean." Plant and Cell Physiology 32: 913-916. Kramer, U., J. D.Cotter-Howells, J.M. Charnock, A.J.M. Baker, and J.A.C. Smith (1996). "Free histidine as a metal chelator in plants that accumulate nickel." Nature 379: 635-638. Maitani, T., H. Kubota, K. Sato, M. Takeda, and K. Yoshihira (1996). "The composition of metals bound to class III metallothionein (phytochelatin and its desglycyl peptide) induced by various metals in root cultures of Rubia tinctorumr Plant Physiology 110: 1145-1150. Mehra, R. K., E. B. Tarbet, W. Gray, and D.R. Winge (1988). "Metal-specific synthesis of two metallothioneins and glutamyl peptides in Candida glabrata." Proceedings of the National Academy of Sciences of the U.S.A 85: 8815-8819. Mendum, M. L., S. C. Gupta, and P.B. Goldsbrough (1990). "Effect of glutathione on phytochelatin synthesis in tomato cells." Plant Physiology 94: 484-488. Moisyadi, S. and J. I. Stiles (1995). "A cDNA encoding a metallothionein I-like protein from coffee leaves (Coffea arabica)." Plant Physiology 107: 295-296. Murphy, A. and L. Taiz (1995). "Comparison of metallothionein gene expression and nonprotein thiols in ten Arabidopsis ecotypes." Plant Physiology 109: 945-954. Mutoh, N. and Y. Hayashi (1988). "Isolation of mutants of Schizosaccharomyces pombe unable to synthesize cadystin, small cadmium-binding peptides." Biochemical and Biophysical Research Communications 151: 32-39. Nocentini, S. (1987). "Inhibition of DNA replicatin and repair by Cd in mammalian cells: protective interaction of Zn." Nucleic Acids Research 15: 4211-4225. Rauser, W. E. (1995). "Phytochelatins and Related Peptides: Structure, Biosynthesis and Function." Plant Physiology 109: 1141-1149. Rawlins, M. R., C. J. Leaver, and M.J. May (1995). "Characterization of an Arabidopsis thaliana cDNA encoding glutathione synthetase." FEBS Letters 376: 81-86. Reddy, G. N. and M. N. V. Prasad (1992). "Characterization of cadmium binding protein from Scenedesmus quadricauda and Cd toxicity reversal by phytochelatin constituting amino acids and citrate." Journal of Plant Physiology 140: 156-162. Reese, R. N. and G. J. Wagner (1987). "Effects of buthionine sulfoximine on Cd-binding peptide levels in suspension-cultured tobacco cells treated with Cd, Zn or Cu." Plant Physiology 84: 574-577. Robinson, N. J., A. M. Tommey, C. Kuske, and P.J. Jackson (1993). "Plant metallothioneins." Biochemical Journal 295: 1-10. 89 Ruegsegger, A., D. Schmutz, and C. Brunold (1990). "Regulation of glutathione synthesis by cadmium in Pisum sativum L." Plant Physiology 93: 1579-1584. Salt, D. E., D. A. Thurman, A.B. Tomsett, and A.K. Sewell (1989). "Copper phytochelatins of Mimulus guttatus." Proceedings of the Royal Society of London Series B: Biological Sciences 236: 79-89. Sambrook, J., E. F. Fritsch, and T. Maniatis (1989). Molecular Cloning: A laboratory manual, 2nd Edn. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press. Schat, H. and M. M. A. Kalff (1992). "Are phytochelatins involved in differential metal tolerance or do they merely reflect metal-imposed strain?" Plant Physiology 99: 1475-1480. Scheller, H. V., B. Huang, E. Hatch, and P.B. Goldsbrough (1987). "Phytochelatin synthesis and glutathione levels in response to heavy metals in tomato cells." Plant Physiology 85: 1031-1035. Steffens, J. C. (1990). "The heavy metal-binding peptides of plants." Annual Review of Plant Physiology and Plant Molecular Biology 41: 553-575. Tomsett, B. and D. A. Thurman (1988). "Molecular biology of metal tolerances of plants." Plant. Cell and Environment 11: 383-394. Ullmann, P., L. Gondet, S. Potier, and T.J. Bach (1996). "Cloning of Arabidopsis thaiiana glutathione synthetase (GSH2) by functional complementation of a yeast gsh2 mutant." European Journal of Biochemistry 236: 662-669. Vliet, C. v., C. R. Andersen, and CS. Cobbett (1995). "Copper-sensitive mutant of Arabidopsis thalianar Plant Physiology 109: 871-878. Zhou, C , Y. Yang, and A.Y. Jong (1990) "Minipreps in ten minutes". Biotechniques 8: 172-173. Zhou, J. and P. B. Goldsbrough (1994). "Functional homologs of fungal metallothionein genes from Arabidopsis." The Plant Cell 6: 875-884. 90 CHAPTER 3 - THE DETERMINATION OF CADMIUM ACCUMULATION ABILITY OF POPLAR HYBRIDS TRANSFORMED WITH THE YEAST VACUOLE TRANSPORTER HMT-23 GENE 3.1 INTRODUCTION The use of plants to remediate environmental pollution is known as phytoremediation. The plant species that could be successfully used in large-scale commercial phytoremediation projects would have a large biomass, including an extensive root system, and would be able to accumulate metals in harvestable above-ground tissue. Some researchers are involved in breeding (Gustafson and Ross, 1990; Florijn and Beusichem, 1993; Pollard and Baker, 1995; Tilstone and Macnair, 1997) or mutant screening (Penner et al, 1995; Larsen et al, 1998) as a means to identify a large-biomass hyperaccumulator species while others are applying biotechnology techniques to genetically engineer the desired metal accumulating phenotype (Misra and Gedamu, 1989; Maiti et al, 1991; Yeargan et al, 1992; Brandle et al, 1993; Hasegawa et al, 1997; Rugh et al, 1998). This research has involved applying biotechnology techniques to attempt to produce a metal-sequestering poplar tree that could be used in metal soil decontamination programs. Poplar's potential use in environmental remediation has only recently been explored. The discovery of poplar's intrinsic ability to metabolize certain organic contaminants has been exploited in field trials. For instance, certain poplar hybrids seem to respond well to irrigation with diluted wastewater from municipal sewage lagoon treatment systems. In fact, the wastewater treated plants exhibited an increase of 187% in height and a 1200% increase in dry mass production in comparison to control plants (Licht, 1990). Moreover, Newman et al. (1997) found that the poplar hybrid Populus trichocarpa x P. deltoides clone (HI 1-11) can take up the dry-cleaning solvent trichloroethylene (TCE) and degrade it into non-toxic metabolic products 91 and carbon dioxide. The U.S. Army is also presently conducting phytoremediation field studies using hybrid poplars to remediate 2,4,6-trinitrotoluene (TNT) contaminated sites (Boyajian and Carreira, 1997). Lastly, researchers have demonstrated that poplar cuttings (Populus deltoides x P. nigra DN34, Imperial Carolina) are able to take up and metabolize as much as 20% of the pesticide atrizine that is present in their surroundings (Burken and Schnoor, 1997). A short-coming of the use of tree species for commercial phytoremediation projects is that the introduction of novel traits by conventional tree breeding methods is time consuming due to their long generation time (typically 8 -20 yr. to reach sexual maturity in poplar) (Weigel and Nilsson, 1995). However the development of Agrobacterium-based methodologies for poplar transformation have given rise to the ability to rapidly introduce genes specifying novel traits into poplar by genetic engineering techniques. To date, numerous genes have been transformed into poplar resulting in the alteration of some important and fundamental traits such as herbicide resistance (Fillatti et al., 1987; DeBlock, 1990), pest resistance (Howe et al., 1994; Leple et al, 1995), wood characteristics (Baucher et ai, 1996) and flowering time (Weigel and Nilsson, 1995)(see Table 3.1). The objective of the research in this chapter is to test the use of genetic engineering to heighten the heavy metal sequestration ability of a poplar hybrid, Populus alba x P. tremula (INRA clone 717-1B4) using the fission yeast (Schizosaccharomyces pombe) vacuole heavy metal transporter gene, HMT1 (refer to Figure 1.4). Ortiz et al. (1992), demonstrated that the overexpression of the HMT1 gene in yeast cells results in both a 30-fold increase in Cd ion tolerance and an enhanced level of vacuole compartmentalized intracellular Cd ions. If the expression, and subsequent activity, of this gene in poplar cells parallels that which has been seen in yeast cells, then it was predicted that transgenic poplars expressing the HMT gene will be able to sequester Cd ions within their vacuoles without exhibiting any toxic effects. If so, the 92 resultant transformed plants would certainly be potential candidates for commercial phytoremediation projects. Possibly, with the advent of new engineering techniques, Cd ions sequestered within the tissues of these trees could be recovered in the pulping process, allowing the metal to be re-used by industry. If this proved to be practical on a large scale, Cd in the environment would remain at a constant level instead of constantly increasing. 93 Table 3.1 Other Research Involving Agrobacterium-mediated Transformation of the Genus Populus Populus spp. Transgene Reference P. nigra GUS, NPT-II (Confalonieri etal., 1995) GUS, NPT-II, HPT (Confalonieri etal., 1994) P. tremuloides GUS, NPT- II (Tsaiera/., 1994) P. tremula Ac, rolC, NPT-II (Ahuja and Fladung, 1996) P. deltoides GUS, NPT-II (Dinus etal., 1995) P. tomentosa CAT, NPT-II (Wang etal, 1990) P. alba x P. glandulosa T-DNA (Chung etal, 1989) P. trichocarpa x P. deltoides bar, NPT-II (DeBlock, 1990) GUS, NPT-II (Kim etal, 1997) P. alba x P. grandidentata aroA, NPT-II (Fillatti etal, 1987) CAT, NPT-II (Klopfenstein et al, 1991) Pnos-NPT-II (Klopfenstein, 1995) aroA, NPT-II (Donahue et al, 1994) Ac, Bt, HPT, NPT-II (Howe etal, 1994) PIN2, NPT-II (Kim etal, 1997) P. alba x P. tremula bar, NPT-II (DeBlock, 1990) P. tremula x P. alba GUS, NPT-II (Brasileiro etal, 1991) crs 1-1, NPT-II (Brasileiro etal, 1992) bar, NPT-II (Devillard, 1992) GUS, NPT-II (Leple etal, 1992) IPT, NPT-II (Schwartzenberg et al, 1994) CAD (Bauchere/a/., 1996) gshl (Noctor etal, 1996) gshll (Strohm etal, 1995) P. deltoides x P. nigra T-DNA (Chareste'a/., 1992) PIN2, NPT-II (Kim etal, 1997) P. nigra x P. maximowiczii T-DNA (Chareste'a/., 1992) P. sieboldii x P. grandidentata iaaM, GUS, NPT-II (Kim etal, 1997) prxAl, GUS, NPT-II (Kajitae/a/., 1994) GR, NPT-II (Kim etal, 1997) P. tremula x P. tremuloides luxF2, HPT, NPT-II (Nilsson et al, 1992) OCI, NPT-II (Leple etal, 1995) P. tremula x P. tremuloides iaaH, iaaM, HPT, NPTII (Tuominen et al, 1995) LFY, NPT-II (Weigel and Nilsson, 1995) 94 Populus spp. Transgene Reference Ac, rolC, NPT-II (Ahuja and Fladung, 1996) GUS, NPT-II (Nilsson etal, 1996a) rolC, NPT-II (Nilssonera/., 1996b) phyA, phyB, NPT-II (Kim e t a l . , 1997) GUS= P glucuronidase; NPT-II = neomycin phosphotransferase; Ac = activator transposable element from maize; rolC = gene responsible for hairy root disease from Agrobacterium rhizogenes; CAT = chloramphenicol; T-DNA = Agrobacterium tumefaciens genes flanked by border sequences; bar = phosphinotricin; aroA = bacterial 5-enolpyruvylshikimate-3-phosphate synthase;Pnos-NPT-II = bacterial nopaline synthase promoter linked to NPT-II; Bt = endotoxin gene from Bacillus thuringiensis; HPT = hygromycin phosphotransferase; PIN2 = potato proteinase inhibitor II gene; crsl-1 = acetolactate synthase; IPT = agrobacterial isopentenyltransferase; CAD = cinnamyl alcohol dehydrogenase (sense and antisense); gshl = y-glutamylcysteine synthetase; gshll = bacterial gluathione synthetase; iaaM = agrobacterial tryptophan; iaaH = agrobacterial indoleacetamide hydrolase; prxA = peroxidase; GR = glutathione reductase; luxF2 = luciferase; OC1 = cystein proteinase; LFY = flower-meristem-identify; phyA & B = phytochrome genes. (modified from Kim et al, 1997) 95 3.2 MATERIALS AND METHODS 3.2.1 Modification of codons in the HMT gene for its expression in plants Modification of the HMT-encoding gene from the fission yeast Schizosacharomyes pombe to incorporate plant codons was done by the collaborating laboratory of Dr. David Ow (Plant Gene Expression Centre; Albany, CA) by site directed mutagenesis. The modified codons are as follows: 87-lys (AAA-AAG), 105-ser (TCA-TCC), 228-lys (AAA-A AG), 229-ser (TCA-TCC), 232-lys (AAA-AAG), 233-lys (AAA-AAG), 236-asp (GAT-GAC), 237-lys (AAA-AAG), 258-asn (AAT-AAC), 359-lys (AAA-AAG), 364-val (GTT-GTC), 365-leu (TTG-CTG), 368-leu (TTA-TTG), 369-thr (ACT-ACC), 370- lys (AAA-AAG) (see Figure 3.1 for HMT sequence). The version of the HMT-gene that contains plant codons is referred to as HMT-23. GTCAAACCAAATTAGCAATTGAAGCAGTAACAATTTAAAATTATCAAGTTACTTTTACCTAAAGTTTTATTAATCAAACTGGCATTTCTTTTTTGA TTTTTTTGTA 10/1 ATG GTT CTA CGT TAC AAC AGC CCA CGC CTC Met v a l l e u arg t y r asn ser pro arg l e u 70/21 GGA TTT TTT AGT ATT GGG TCC TTG AAC TTA gl y phe phe ser i l e g l y ser l e u asn l e u 130/41 TAT CGT AGG AAA AAT CGC TTC GGC AAA GAA t y r arg arg l y s asn arg phe g l y l y s g l u 190/61 GGA ATT GCA TTA ACC TAC GTC GTT GAT ATC gly i l e a l a l e u t h r t y r v a l v a l asp i l e 250/81 CCA AAT TGG TGG CCC TGT AAA ACC ACT GTT pro asn t r p t r p pro cys l y s t h r t h r v a l AAG 40/11 AAT ATT CTT GAG CTG GTC CTT CTA TAT GTC asn i l e l e u g l u l e u v a l l e u l e u t y r v a l 100/31 CTG CAG AAA AGG AAA GCT ACT TCT GAT CCT leu g i n l y s arg l y s a l a t h r ser asp pro 160/51 CCT ATA GGA ATA ATT TCC TGG TGG ATA TTG pro i l e g l y i l e i l e ser t r p t r p i l e l e u 220/71 AGC AAT CTT GTC ATC TAC GCA TTG GCA GTT ser asn l e u v a l i l e t y r a l a l e u a l a v a l 280/91 GTC TGT TTA ATT CTC TTC CTT TTA TTT TGG v a l cys l e u i l e l e u phe l e u l e u phe t r p 310/101 340/111 ATA ATT GTA CTT ATC TCA TGC GCA GAT TCT AAA GCT CTT CCA AAA AAT GCG GAT TCC ATA i l e i l e v a l l e u i l e ser cys a l a asp ser l y s a l a l e u pro l y s asn a l a asp ser i l e TCC 370/121 CTA AAG GCC TAC CGC CTT AGC GTC TTG TAC leu l y s a l a t y r arg l e u ser v a l l e u t y r 430/141 ATT TTC ATT GTC TAC AGT CCT CAT CCA AAT i l e phe i l e v a l t y r ser pro h i s pro asn 490/161 CAT GTA GCC CGA TTG GTC TTA TGT GTT TTC hi s v a l a l a arg l e u v a l l e u cys v a l phe 550/181 AAG AGA CAT ACG CAC GAT CCC CTG GAT TTT l y s arg h i s t h r h i s asp pro l e u asp phe 610/201 GTT AAT GAG AAT GCT ATC TCT CAA AAT CCC va l asn g l u asn a l a i l e ser g i n asn pro 670/221 400/131 GTT TGG GCT ATA GAC ATT GTA TTT GAA ACA v a l t r p a l a i l e asp i l e v a l phe g l u t h r 460/151 GAA ACA TTT CAA GGA ATT GTA TTG GCG GAC glu t h r phe g i n g l y i l e v a l l e u a l a asp 520/171 GCT ACA GCT ATA TAT CTA ACT TAT AGA CGA a l a t h r a l a i l e t y r l e u t h r t y r arg arg 580/191 GAG GAG CGT CAA TTA ACA GAA GAG TCA AAC gl u g l u arg g i n l e u t h r g l u g l u ser asn 640/211 TCG ACC GTT CAG CTC GGT GTA TCG GCA TCA ser t h r v a l g i n l e u g l y v a l ser a l a ser 700/231 96 ACC TCG AAT TTT GGT ACA CTC AAA TCA ACA t h r ser asn phe g l y t h r l e u l y s ser t h r AAG TCC 730/241 GAA TAT TTC CGT TCT TTC TCT ACT TTA CTT glu t y r phe arg ser phe ser t h r l e u l e u 790/261 CTT CAG TTT CAG ATT TTC ATT TGC ATA GTT leu g i n phe g i n i l e phe i l e cys i l e v a l 850/261 CTT GCT CCC CGA CAA CTG GGT GTG TTA ACT l e u a l a pro arg g i n l e u g l y v a l l e u t h r 910/301 CCT TGG TCT GAT GTT ATT CTA TTC GTT ATC pro t r p ser asp v a l i l e l e u phe v a l i l e 970/321 ATT GGT TCT CTT CGA TCT TTC TTA TGG GTT i l e g l y ser l e u arg ser phe l e u t r p v a l 1030/341 TCA ACT AAG GCT TTG AGA CAT GTT CTA AAC ser t h r l y s a l a l e u arg h i s v a l l e u asn 1090/361 GCT GGT GAG GTT TTG ACC GCC TTA ACT AAA a l a g l y g l u v a l l e u t h r a l a l e u t h r l y s GTC CTG TTG ACC AAG 1150/381 GTT GTG TTT CAG ATT GGG CCT GTT TTG TTG v a l v a l phe g i n i l e g l y pro v a l l e u l e u 1210/401 ATT AAG TTT GAC ATT TAT TTT ACG CTT ATT i l e l y s phe asp i l e t y r phe t h r l e u i l e 1270/421 GTT ACG GTC AAA ATT ACA TCT TGG CGT ACC v a l t h r v a l l y s i l e t h r ser t r p arg t h r 1330/441 CGC GAG AGT TAT GCT GTG CAA AAT GAC GCG arg g l u ser t y r a l a v a l g i n asn asp a l a 1390/461 GAT GCA GAT GAC TTT GAA AAT GAA CGA TAC asp a l a asp asp phe g l u asn g l u arg t y r 1450/481 GAG CGG AAG GTA CTA TTT AGC CTT AAT TTT glu arg l y s v a l l e u phe ser l e u asn phe 1510/501 TTC AGC TTG GCA ATT GCT TGT CTA TTA AGT phe ser l e u a l a i l e a l a cys l e u l e u ser 1570/521 GTC GGT GAT TTT GTC ATA CTT TTG ACA TAC v a l g l y asp phe v a l i l e l e u l e u t h r t y r 1630/541 TTC GGA ACT TTA TAT CGT TCA TTG CAA AAT phe g l y t h r l e u t y r arg ser l e u g i n asn 1690/561 ATT TTT GAG GAG AAA CCT ACT GTG GTG GAG i l e phe g l u g l u l y s pro t h r v a l v a l g l u 1750/581 CAA GGT AAG GTA ATA TTC TCT CAT GTT TCA gin g l y l y s v a l i l e phe ser h i s v a l ser 1810/601 TCA GAT ATC AAT TTT GTT GCA CAA CCA GGA ser asp i l e asn phe v a l a l a g i n pro g l y 1870/621 GGT GGG AAA TCT ACA ATT ATG AGA ATT CTT g l y g l y l y s ser t h r i l e met arg i l e l e u 1930/641 ATA ACC ATT GAT GAT CAA GAC ATA CGA AAT i l e t h r i l e asp asp g i n asp i l e arg asn 1990/661 GGT GTA GTT CCC CAA GAT AGT ACC CTT TTT gl y v a l v a l pro g i n asp ser t h r l e u phe TCG AAA AAA CCT AGT GAT AAA TCT TGG GCA ser l y s l y s pro ser asp l y s ser t r p a l a AAG AAG GAC AAG 760/251 CCC TAT CTC TGG CCG ACA AAA GAT TAC CGA pro t y r l e u t r p pro t h r l y s asp t y r arg 820/271 TTA CTC TTT TTG GGG CGA GCT GTT AAC ATA leu l e u phe l e u g l y arg a l a v a l asn i l e 880/291 GAA AAG CTC ACA AAA CAT AGT GAG AAA ATT glu l y s l e u t h r l y s h i s ser g l u l y s i l e 940/311 TAT CGT TTT TTG CAA GGA AAT ATG GGA GTA t y r arg phe l e u g i n g l y asn met g l y v a l 1000/331 CCT GTC TCT CAA TAT GCT TAT AGA GCG ATA pro v a l ser g i n t y r a l a t y r arg a l a i l e 1060/351 CTG TCA TAC GAT TTT CAT TTG AAT AAA CGT leu ser t y r asp phe h i s l e u asn l y s arg AAC AAG 1120/371 GGA AGT TCG TTG AAT ACG TTT GCA GAA CAA g l y ser ser l e u asn t h r phe a l a g l u g i n 1180/391 GAT TTG GGA GTA GCC ATG GTA TAC TTT TTT asp l e u g l y v a l a l a met v a l t y r phe phe 1240/411 GTG TTA ATT ATG ACA CTT TGT TAC TGT TAC v a l l e u i l e met t h r l e u cys t y r cys t y r 1300/431 GAG GCT AGA AGA AAG ATG GTT AAT ACG TGG glu a l a arg arg l y s met v a l asn t h r t r p 1360/451 ATT ATG AAT TTC GAA ACC GTT AAA AAT TTT i l e met asn phe g l u t h r v a l l y s asn phe 1420/471 GGT CAT GCT GTG GAT ATT TAT CTT AAG CAA g l y h i s a l a v a l asp i l e t y r l e u l y s g i n 1480/491 TTA AAT ATC GTT CAA GGT GGA ATA TTT ACA leu asn. i l e v a l g i n g l y g l y i l e phe t h r 1540/511 GCT TAT AGA GTA ACA TTC GGC TTT AAC ACT a l a t y r arg v a l t h r phe g l y phe asn t h r 1600/531 ATG ATT CAG CTA CAG CAG CCT CTT AAT TTT met i l e g i n l e u g i n g i n pro l e u asn phe 1660/551 AGC ATC ATC GAT ACA GAA AGA CTA CTT GAA ser i l e i l e asp t h r g l u arg l e u l e u g l u 1720/571 AAA CCA AAT GCC CCA GAT CTT AAA GTC ACT l y s pro asn a l a pro asp l e u l y s v a l t h r 1780/591 TTT GCA TAT GAT CCA CGA AAA CCT GTT TTA phe a l a t y r asp pro arg l y s pro v a l l e u 1840/611 AAA GTT ATT GCG TTA GTG GGA GAA TCA GGT l y s v a l i l e a l a l e u v a l g l y g l u ser g l y 1900/631 TTA CGA TTC TTC GAT GTC AAC TCG GGA TCC leu arg phe phe asp v a l asn ser g l y ser 1960/651 GTT ACG TTG TCT AGT CTT CGA TCT TCA ATA v a l t h r l e u ser ser l e u arg ser ser i l e 2020/671 AAT GAT ACT ATT CTT TAC AAT ATT AAA TAT asn asp t h r i l e l e u t y r asn i l e l y s t y r 97 2050/681 GCT AAA CCT a l a l y s pro TCT ser GCG a l a ACC t h r AAT asn GAG g l u GAG g l u ATT i l e 2080/691 TAT GCT GCT t y r a l a a l a GCT a l a AAG l y s GCT a l a GCT a l a CAA g i n ATT i l e CAC h i s 2110/701 GAT CGT ATA asp arg i l e TTA l e u CAA g i n TTC phe CCA pro GAT asp GGT g l y TAT t y r 2140/711 AAT TCT CGT asn ser arg GTC v a l GGA g l y GAA g l u AGA arg GGC g l y TTA l e u AAG l y s 2170/721 TTA AGC GGT leu ser g l y GGT g l y GAA g l u AAA l y s CAA g i n CGT arg GTA v a l GCA a l a 2200/731 GTT GCC AGA v a l a l a arg GCT a l a ATC i l e TTA l e u AAA l y s GAT asp CCT pro TCA ser 2230/741 ATT ATC CTT i l e i l e l e u CTC l e u GAT asp GAA g l u GCT a l a ACT t h r TCT ser GCT a l a 2260/751 CTG GAC ACA l e u asp t h r AAT asn ACT t h r GAG g l u CGA arg CAA g i n ATC i l e CAG g i n 2290/761 GCA GCC TTG a l a a l a l e u AAT asn AGA arg CTT l e u GCA a l a TCT ser GGC g l y CGA arg 2320/771 ACT GCT ATA th r a l a i l e GTA v a l ATC i l e GCT a l a CAC h i s AGG arg CTC l e u TCC ser 2350/781 ACC ATC ACC th r i l e t h r AAT asn GCA a l a GAC asp TTA l e u ATT i l e CTT l e u TGT cys 2380/791 ATT TCG AAT i l e ser asn GGT g l y AGA arg ATC i l e GTT v a l GAG g l u ACT th r GGC g l y 2410/801 ACA CAC GAA th r h i s g l u GAG g l u TTA l e u ATA i l e AAG l y s CGT arg GAC asp GGC g l y 2440/811 GGA CGT TAC g l y a rg t y r AAA l y s AAA l y s ATG met TGG t r p TTT phe CAA g i n CAA g i n 2470/821 GCA ATG GGA a l a met g l y AAA l y s ACT t h r TCT ser GCT a l a GAA g l u ACT t h r CAT h i s 2500/831 TAA TCT AAG CAT AAT AAC AAC GGT TTA CTA 2530/841 ATT TTG GTA GTT ATG ACT AAT TTA AAA GGA 2560/851 GAA TTA AAA TAC ACT AAC TTT GAT TGT GAG 2590/861 TAA TGC TGC TCC TTT CAC AGA AAC ATT ATG 2620/871 GTA CAA AAA TTT TAT CAC TAA ATT CCA TAC 2650/881 CAA TGA ATT TGT Figure 3.1: The Fission Yeast Schizosaccharomyces pombe's Heavy Metal Tolerant (HMT) Gene. The coding DNA sequence with its corresponding protein sequence is shown. The modified codons for the expression of this gene in plants is denoted in bold under the protein sequence. 3.2.2 Construction of HMT-23-contaimngAgrobacterium binary vector All DNA recombinant techniques were performed according to standard methods (Sambrook et al, 1989). Flanking primers 5'BamHI and 3'SstI were constructed against the HMT coding region and were used to amplify the gene by the polymerase chain reaction (PCR) [50ng of plasmid template, lx PCR buffer (lOmM Tris-HCl, pH 8.3; 50mM KC1), 0.2 mM dNTP mix, 0.5 pM primer mixture, 0.5 Unit/50 pl Taq DNA polymerase (Boehringer Mannheim)]. Cycling parameters were 95°C for 5 min., 30 cycles of 94°C for 30 sec, 50°C for 30sec, 72°C for 1.5 min., completed by one 72°C for 10 min elongation period. T-tail cloning of the resultant amplification product was performed (Holton and Graham, 1991) by ligating it into an EcoRV digested ddTTP (dideoxyTTP) pBluescript SKII+ vector plasmid (Stratagene). A 1:10 dilution 98 of the ligation solution was transformed by heat shock (Sambrook et al, 1989) into sub-cloning efficiency competent Esherichia coli strain DH5a cells (Gibo BRL). Ampicillin resistance and X-gal selection on LB media [10g/l tryptone (Bacto), 5g/l yeast extract (Bacto), 10g/l NaCl, 15g/l agar (Bacto); pH 7.0, lOOpg/ml ampicillin (Gibco BRL), 40 pg/ml X-Gal (5-bromo-4-chloro-3-indolyl-P -galactoside; Gibco BRL), 4 pg/ml IPTG (isopropylthio-P -D-galactoside (Gibco BRL) - antibiotics added after auotclaving] were used to detect transformed E.coli cells. Liquid cultures of ampicillin-resistant colonies were grown overnight in LB media with lOOpg/ml ampicillin (Gibco BRL) at 37°C 200rpm. Minipreps of the cultures were performed as in Zhou et al. (1990) as a means to identify transformed E.coli containing the HMT-pBluescript plasmid. A double restriction digest with BamHI/SstI was then performed on the isolated .HMT-pBluescript plasmid. The gel purified (Geneclean; BIO101) //MT-encoding fragment was ligated into a double digested BamHI/SstI pBI121 binary vector (Clonetech). This ligation reaction would put the HMT gene under plant regulatory elements, namely the cauliflower mosaic virus promoter (CaMV 35S) and the nopaline synthase (Nos) terminator. This pBI121 binary vector contains the neomycin phosphotransferase gene (NPT-II); thus, the plasmid confers kanamycin resistance to transformed cells. Competent E.coli strain DH5a cells were transformed with the a 1:10 dilution of the ligation solution and plated on LB plates containing 50 mg/1 kanamycin and incubated overnight at 37°C. Colonies able to grow on this selection media were then grown in liquid LB media containing 50 pg/ml kanamycin overnight at 37°C 200rpm. DNA minipreps were prepared as per (Zhou et al, 1990), followed by BamHI/SstI double digests to identify the correctly constructed plasmid. The HMT-pBU2\ binary vector was subsequently transformed into competent Agrobacterium tumefaciens strain LBA4404 by electroporation using Bio-Rad Gene Pulser™ according to the manufacturer's instructions. Cells were plated on LB agar containing 50mg/l kanamycin and incubated at 28°C 99 for 2-3 days. Kanamycin-resistant A.tumefaciens cells were then grown in liquid LB media with 50 mg/1 kanamycin for 2 days at 28°C 150rpm. Minipreps were prepared and restricted to confirm that the cells contained the correctly modified binary vector (see Figure 3.2 for plasmid construction). 100 Perform PCR using 5'BamHI and 3'SstI HMT-specifie primers on a yeast expression cassette containing the HMT gene BamHI T-tail clomng of HMT-23 PCR amplification product into ypbluescript ks+ pBI 121 used as binary' vector in Agrobacterium transformation ( H I S BamHI / SstI double I restriction enzyme digest S s U (not used) J BamHI / SstI double restriction enzyme digest Figure 3.2: Construction of the HMT-23 pBI 121 binary vector for use inAgrobacterium-mediated transformation of poplar. Both 5'BamHI and 3 'SstI HMT-23 specific primers were used in PCR as a means to generate an HMT-23 coding region that was flanked with these two restriction sites, the binary vector pBI 121 was used as the primary vector. A double digest of this vector with both BamHI/SstI was performed as a means to create the appropriate sites to insert the HMT-23 gene. The double digested BamHI/SstI fragment containing the HMT-23 coding region was ligated into the pBI 121 binary vector. The resultant plasmid put the HMT-23 gene under the control of the CaMV35S promoter and the Nos terminator, the plasmid also contains the npt-II gene which confers resistance to kanamycin. 101 3.2.3 Transformation / regeneration 3.2.3.1 Sterilization of Plant Material One to two cm long stem internodes were cut from greenhouse grown plants of Populus alba x P. tremula clone (INRA 717-1B4). Surface sterilization of the explants was performed in a sterile falcon tube in a solution of 10% bleach (stock bleach solution of 6% sodium hypochlorite) and 5pl of 0.1% tween-20 for 20-30 min. with slight agitation. The sterilizing solution was decanted and replaced with a solution of 70% ethanol and gently agitated for 15 min. The ethanol wash was followed by three washes in sterile water each for a duration of 10 min. with slight agitation. The explants were aseptically removed, blotted dry on sterilized whatmann 3MM paper and placed on MS agar [Murashige + Skoog Salt Mixture (Gibco BRL), 3% sucrose, 1% phytoagar (Gibco BRL)]. Explants were placed in petri dishes or magenta boxes that were wrapped with parafilm and placed in a growth chamber (photoperiod of 16 h. light, 8 h. dark, 22°C, light intensity 35 pmols"'m"2). 3.2.3.2 Agrobacterium-medinted Transformation and Selection / Regeneration of Plants Poplar stem explants and 1 cm x 1 cm leaf sections were excised using sterile utensils and placed on pre-conditioning media (McCown's Woody Plant Basal Salt Mixture (Sigma), 0.5% phytoagar (Gibco BRL), 3% sucrose (Gibco BRL), 200 mg/L L-glutamine (Sigma), 1 pM BAP [6-benzylaminopurine (Sigma)], 0.5 pMNAA [a-naphthalenacetic acid (Sigma)]; plant hormones were added after autoclaving) for two days in a growth chamber. A culture of the Agrobacterium tumefaciens LBA4404 disarmed strain containing the HMT-23-b'mary vector was diluted in MS liquid media to an OD660= 0.3 (approximately 1:25 dilution). Leaf and stem sections were transferred from pre-conditioning media to the Agrobacterium diluted culture. Co-102 cultivation in a liquid medium of the poplar sections and the Agrobacterium diluted culture proceeded at 27-30°C at 150 rpm for 16-24hr. Poplar explant samples were then aseptically removed from the culture, blotted dry on sterilized paper towels, and placed on shoot-inducing media (SIM) [McCown's Woody Plant Basal Media (Sigma), 0.5% phytoagar (Gibco BRL), 3% sucrose, 200 mg/L L-glutamine, 0.1 pM thidiazuron (TDZ; Sigma); plant hormones were added after autoclaving the media] and placed in a growth chamber for two days. Sections were then transferred onto SIM containing 500 mg/L carbenicillin (Sigma) and 400 mg/L cefotaximine (Sigma) and incubated for two weeks in a growth chamber. Finally, sections were transferred to selection media consisting of SIM containing 50 mg/L kanamycin and allowed to incubate in a growth chamber. In order to maintain selection pressure, explants were transferred to fresh SIM/kanamycin media every two weeks. Regenerated green shoots were considered putative transformants whereas photobleached and necrotic sections were considered untransformed (see Figure 3.3). Shoots were transferred to root-inducing media [McCown's Woody Plant Basal Media (Sigma), 0.5% phytoagar, 1.5% sucrose, 200 mg/L L-glutamine, and 1% activated charcoal] and incubated in a growth chamber until extensive root systems were formed. 3.2.4 Genomic PCR to identify putative transformants 3.2.4.1 DNA Isolation The small-scale isolation of total genomic DNA from poplar leaf tissue was primarily based on the Doyle and Doyle (1990) protocol. In a 1.5 ml Eppendorf tube, approximately 0.1 g of frozen ground leaf tissue was added to 1 ml of extraction buffer (3% cetyltrimethyl ammonium bromide (CTAB), 1.4 M NaCl, 20 mM ethylenediaminetetra acetic acid (EDTA), lOOmM Tris-HCl, pH 8.0, 1%> polyvinylpyrolidone (PVP) and 0.2% P-mercaptoethanol added after autoclaving and immediately prior to use) and subsequently incubated at 60°C for at least 30 min., and not longer 103 than 2 hr. Prolonged incubation at this step should be avoided as it proved to result in DNA degradation. RNase treatment was then performed by adding RNase A (Sigma) to a final concentration of 10 pg/ml, briefly vortexed and incubated at 37°C for 30 min. Two chloroform: isoamyl alcohol (24:1) treatments were then carried out in succession by adding one volume to the DNA samples, inverting and centrifuging at 1600g for 5 min. at room temperature using a tabletop microcentrifuge. After the second extraction was complete, the aqueous (top) phase was transferred to a new tube and 2/3 volume of cold (-20°C) isopropanol was added, the tube inverted to mix and incubated at room temperature for 30 min. After incubation, the samples were centrifuged at 1500g for 15 min. at room temperature in a tabletop microcentrifuge. Supernatant was discarded and the pellet washed twice by adding an aliquot of cold (-20°C) 70% ethanol and centrifuging at 13,000 rpm for 20 min. at room temperature using a refrigerated tabletop microcentrifuge. The ethanol was aspirated and the pellet was allowed to air dry in a laminar flow hood. Excessive drying by the use of a speed vacuum at this step may lead to difficulty in resuspending the DNA pellet. The resultant DNA pellet was resuspended in distilled water (dH20). The volume of dH20 used in the resuspension varied according to the size of the pellet but it typically did not exceed 20pl for an extraction procedure that initiated with 0.1 g of plant tissue. Gel quantification was performed as a means to determine the concentrations of the DNA solutions since quantification by absorbency values obtained spectrophotometrically would be unreliable due to interference from the residual CTAB molecules. A 1:10 dilution was made in TE buffer (lOmM Tris, ImM EDTA; pH 8.0) for all of the DNA samples. The diluted DNA samples along with lambda DNA samples of known concentrations ranging from 5 to 250 ng/ml were run on a 1.5% agarose gel in lxTAE (0.04M Tris-acetate, 0.001M EDTA) running buffer for approximately 45 min. at 100 V. The gel was stained with ethidium bromide for 104 approximately 30 min. and then photographed under an ultraviolet transilluminator. Estimations of the concentrations of the DNA samples were then made by comparing the intensities of the known lambda markers to that of the unknown poplar DNA samples. Quantified DNA samples were kept at 4°C for short term storage and -20°C for long term storage. 3.2.4.2 PCR Amplification Each PCR reaction contained the following components: lOOng of template DNA, 0.5pM for each NPT-II-sveciiic primer, 10 mM dNTP mixture, 2.3 mM MgC12, IX PCR Buffer II (lOmM Tris-HCl, pH 8.3; 50mM KC1), and 0.5 U/50pl Taq DNA polymerase (Boehringer Mannheim). Prior to the initiation of the PCR cycling, 50 pl of mineral oil was overlaid on the samples. In addition to the putative transgenic poplar DNA samples, DNA from a non-transformed poplar was used as a negative control. Plasmids used in the Agrobacterium-mediated transformation of poplar were used as positive controls. PCR amplification parameters were as follows: initial denaturation at 95°C for 5 min., followed by 35 cycles of 94°C for 30 sec, 55°C 1.5 min., 72°C for 2.5 min.; amplification cycles were followed by a final extension of 72°C for 10 min. After amplification, 20 pl aliquots of the PCR reactions were added to 2 pl of 2x loading buffer (6x = 0.25% bromophenol blue, 0.25% xylene cyanol FF, 40% sucrose in water) and run on a 1.5% agarose gel in lx TAE buffer (0.04M Tris-acetate, 0.001M EDTA), for 1.0 hr at 80 V. Gels were stained with ethidium bromide, destained in water and photographed on an ultraviolet transilluminator (see Figure 3.4). 105 3.2.5 Northern blot analysis 3.2.5.1 RNA Extraction From Poplar Tissue Total RNA was extracted from poplar leaf samples as previously described in Materials and Methods of Chapter 2. 3.2.5.2 RNA Extraction From Schizossacharomyces pombe Total RNA was extracted from the fission yeast Schizossacharomyces pombe using Trizol™ (Gibco BRL). A glycerol stock of S. pombe was inoculated into 50 ml sterile YEP media (Sambrook and Fritsch (1989)) and grown for two days at 30°C at 200 rpm. Approximately 1.5 ml of the culture was aliquoted into an Eppendorf tube and quickly spun in a tabletop microcentrifuge to pellet the cells. One ml of Trizol was added to 100 pl of pelleted cells and the mixture was extensively pipetted up and down (at least 20x) to lyse the cells. The solution was spun at 12,000rpm for 5 min. at 4°C in a refrigerated tabletop microcentrifuge. The pelleted cell debris was discarded and the supernatant was transferred to another tube where 200 pl of chloroform was added. After sitting at room temperature for 3 min., the mixture was centrifuged at 12,000rpm for 15 min. at 4°C in a refrigerated tabletop microcentrifuge. The aqueous layer was transferred to a new tube and 600 pl of isopropanol was added. The mixture sat at room temperature for 10 min. and then it was centrifuged at 12,000 rpm for 10 min. at 4°C in a refrigerated microcentrifuge. The RNA pellet was washed in 1 ml 75% ethanol, vortexed and centrifuged at 12,000rpm for 5 min. at 4°C in a refrigerated microcentrifuge. The ethanol was decanted and the tube inverted in a laminar flow hood until the pellet dried (approximately 10-15 min.). A white RNA pellet was observed on the side of the tube. This pellet was outlined in marker since upon drying the pellet became colourless and thereby difficult to detect. The RNA pellet was dissolved in 20-30 pl of DEPC-treated dH20 depending on the size, with heating at 55°Cfor 10-15 min. 106 3.2.5.3 Northern Blot Formaldehyde-agarose gel electrophoresis, capillary transfer of RNA samples to a membrane, and hybridization were all performed as described in Materials and Methods of Chapter 2. In this case, the 2.4 kb BamHI / Sst I double digested portion of the HMT-23 containing-plasmid was used as a probe. 3.2.6 Cadmium Stress of Poplar Plantlets Three clonal replicates of each of four /YMT-transformed lines, along with nontransformed poplars, were grown in vitro in root-inducing media [McCown's Woody Plant Basal Media (Sigma), 0.5% phytoagar (Gibco BRL), 1.5% sucrose, 200 mg/L L-glutamine, 0.1 pM thidiazuron (TDZ; Sigma)] and then transferred to lOOpM CdCl2-containing media and incubated for 5 days in a growth chamber (16 h light, 8 h dark, 22°C). These plants, in addition to control non-transformed plants grown on media not containing Cd, were then harvested, separated into leaf, stem and root tissue and frozen in liquid nitrogen. The samples were then freeze dried for two days. Plant tissue samples were stored at room temperature in zip-lock bags until analyzed for heavy metal ion content. 3.2.7 Quantification of Cd by Graphite Furnace Atomic Absorption Spectrophotometry Graphite furnace atomic absorption spectrophotometry (AAS) was performed in the Earth and Ocean Sciences Department (UBC) with the aid of Kathy Gordon. Approximately 5-10 mg of each plant tissue from the three replicates of each of the four lines of /7MT-transformants, along with non-transformed plants (both Cd stressed and unstressed) were weighed, and placed in 6 ml Teflon PFA digest vials along with 1.4 ml 12 M nitric acid (HN03). As the amount of root tissue 107 was scarce, no distinction was made between tap and lateral roots and root hairs. Prior to the addition of the samples, the digest vessels were cleaned using 12 M HN03 and placed in a CEM 205 microwave with pressure monitor for 7 min at 100% power and then at 20 min. at 50% power once the maximum pressure had been obtained (ie. 55 psi). Vials containing the samples were then placed in larger vessels with a small amount of water at the bottom of the vessels used to absorb acid fumes that may be produced during the digestion process. The samples were digested in a CEM 205 microwave with pressure monitor for 7 min. at 100% power to obtain maximun pressure reading of 50 psi and then for 40 min. at 50 psi. Graphite furnace atomic absorption spectrophometry (Varian) was used to quantitate the amount of Cd ions sequestered within the plant samples. The parameters under which the readings were taken are described in detail in Tables 3.2 and 3.3. Table 3.2 Particulars of the Graphite Furnace AAS Instrument mode Absorbance Calibration mode Concentration Measurement mode Peak Area Lamp position 2 Lamp current (mA) 4 Slit width (nm) 0.5 Slit height Reduced Wavelength 228.8 Sample introduction Sampler Automixing Time constant 0.05 Measurement time (sec) 1.0 Replicates 2 Background correction On Maximum absorbance 0.70 Reslope rate 8 108 Table 3.3: Parameters of Graphite Furnace AAS Readings Step Number Temperature Time (sec) Gas Flow Read CO (L/min) Command 1 300 8.0 3.0 No 2 300 30.0 3.0 No 3 500 5.0 3.0 No 4 500 3.0 3.0 No 5 500 1.0 0.0 No 6 2000 0.8 0.0 Yes 7 2000 2.0 0.0 Yes 8 2000 1.0 3.0 No 9 2300 2.0 3.0 No 10 40 13.3 3.0 No Prior to the sample readings, the graphite furnace AAS was calibrated by producing a standard curve using a blank (2 M HN03) and three standards of known Cd ion concentrations (0.6 ppb, 1.2 ppb and 2.4 ppb). The machine was recalibrated by performing a reslope procedure every 8 samples to ensure reading accuracy and precision. Accuracy of the readings was also determined by taking multiple readings of a lobster hepatopancreas certified sample (National Research Council of Canada) for trace metals. The certified reading of this sample is given as 26.3 +/- 2.1 ppm Cd, while the experimentally determined reading from 10 replicates was determined to be 21.78 +/- 1.86 ppm. The graphite furnace used has a detection limit for Cd of 0.11 ppm. The Cd ion readings of the three replicates of a given line and tissue type were averaged and the standard deviations calculated. Analysis of variance was performed to determine if there was a significant difference between the mean value of the amount of Cd accumulated within the tissues of HMT transformants compared to nontransformants. 109 3.3 RESULTS 3.3.1 Results of the Transformation Experiments The yeast HMT-23 gene was subcloned into a plant expression T-DNA binary vector, pBI121, placing it under the control of the CaMV35S promoter which directs constitutive expression in plants and the Nos 3' polyadenylation signal. This construct was then transformed into the bacterial host strain Agrobacterium tumefaciens LBA4404 and subsequently, through Agrobacterium-medxaiQd transformation, into the genome of a poplar hybrid, Populus alba x P. tremula (INRA clone 717-1B4). The selection during regeneration was kanamycin resistance specified by the binary plasmid vector. Typically, approximately 3-4 months after the initiation of an Agrobacterium-mediated transformation of poplar experiment, green shoots were produced on media containing 50mg/l kanamycin. These kanamycin-resistant shoots were considered putative poplar transformants (Figure 3.3). It was noticed that green shoots that regenerated on kanamycin-containing media along side brown and necrotic explants were typically found to be "escapes". However, green shoots neighbouring white bleached explants usually contained the gene of interest (discussed below). "Escapes" refers to plants that are able to regenerate in tissue culture in the presence of a selecting antibiotic but are not transgenic and do not contain the gene(s) of interest. Also, it was observed that green shoots regenerated on kanamycin-containing media were initiated more efficiently from 1-2 cm long stem internodes rather than from 1 x 1 cm leaf sections that were used in Agrobacterium-mediated transformations. Root formation in the regenerated putative transgenic plants was problematic. Only after adding activated charcoal to the media was any substantial root system formed on the putative transgenic plants. 110 Figure 3.3: Selection of Transformed Poplar Explants Shoot regeneration alter Agrobactehum-mt'cclion. Leaf explants were selected on kanamycin-containing media (50 mg/1 kanamycin). Nontransformcd explants became bleached and necrotic. i n 3.3.2 Confirmation of Transgenics 3.3.2.1 Genomic PCR PCR on genomic DNA isolated from the putative trangenic poplar lines using primers specific for the gene that confers kanamycin resistance (NPT-II gem) was used as a method to detect transformants. A small scale DNA isolation procedure modified from Doyle and Doyle (1990) was performed on approximately lOOmg of young leaf tissue of tissue culture grown putative poplar transformants. This extraction method resulted in DNA yields of up to 250 ng which would be sufficient to run 2-3 PCR reactions on each sample. Figure 3.4 displays the results from the PCR test of some of the putative HMT-23 poplar transformants. The presence of a 790 bp amplification product indicates a sample that contains the NPT-II gene. Positive controls of binary vectors, pBI121 and HMT-2 3-vBI\2l construct, and a previously transformed tobacco plant containing pBI121 all yielded the expected 790 bp band. Also as anticipated, both the water sample, which was used as a PCR negative control, and DNA isolated from an untransformed poplar as a negative control against the specificity of the NPT-II primers did not produce the 790 bp band. Of the six tested putative transgenic poplars shown in Figure 3.4, only DNA from two samples, #2 and #3, produced the positive amplification product. This result indicates that lines 2 and 3 of the putative transgenic poplars were transformants. The remaining four lines tested in this particular experiment seem to be escapes, since they were able to regenerate under kanamycin selection in tissue culture but do not seem to be truly transformed. In a similar manner, all kanamycin resistant green shoots obtained in similar experiments were tested by PCR. In total eight lines of NPT-II transformed poplars were obtained. 112 Figure 3.4: Molecular Screening of Poplar Transformants Transformants were identified by isolating genomic DNA from putative poplar transformants (#1-6) and performing PCR using NPT-II specific primers. The presence of the expected 790bp amplification product indicates a positive sample. pBI 121 and pHMT-23 are both constructed plasmids that contain the NPT-II gene and were used as positive controls. As well, a previously confirmed transformed tobacco DNA sample was used as a positive control. The presence of a 790bp PCR product in the poplar samples #2 and #3 indicate that they are transformants. 113 3.3.2.2 Northern Analysis for the Transcription of HMT-23 Gene Total RNA was prepared from independent transgenic lines that gave a positive result in the NPT-II PCR experiment. The RNA samples were analyzed by northern blots, which were hybridized to a 2.4 kb HMT-23 probe. After the autoradiography, the membrane was stripped and hybridized to a 1.8 kb 18S rRNA soybean gene as an RNA loading control. The results of the northern analysis of two lines of the transformed poplars is shown in Figure 3.5. The total RNA extracted from S. pombe was used as a positive control for expression of the HMT-23 gene. As expected, a 2.4 kb band is seen in the S. pombe RNA lane. RNA from untransformed poplar was used as a negative control and showed no hybridization to the probe. The two independent transgenic lines tested in Figure 3.5 both display a discrete band approximately 2.4 kb in size, indicating that the HMT-23 transgene is expressed. In total, of the eight lines that exhibited a positive result in the NPT-II PCR molecular analysis, six lines also expressed HMT-23, as detected by northern analysis. Variation in the level of the HMT-23 gene expression between different transgenic lines was observed (eg. lines #1 and #2, Figure 3.5) and could be attributed to the location of the insertion of T-DNA fragment into the genome. 114 Transgenic poplars ^ • y y H M T | m 2.4 kb rRNA Figure 3.5: Analysis of the Expression of HMT-23 Gene in Poplar Transformants Total RNA was extracted from transgenic poplars and subjected to northern analysis in order to examine the expression of the HMT-23 gene in these plants. Ten pg of total RNA from two lines of transgenic poplars is in Lane 1 and 2 while RNA from an untransformed poplar is in Lane 3 and RNA from Schizosaccharomyces pombe is in Lane 4. Upper Blot) Northern analysis using HMT-23 gene as a probe. Lower Blot) Northern analysis using 18S rRNA soybean gene as a probe. 115 3.3.3 Morphological Effects of Cadmium Stress on Poplar Plantlets To ascertain the toxic effects of cadmium stress on the poplar hybrid P. alba x P. tremula, tissue culture grown plantlets were subjected to lOOpM CdCl2 for five days. The roots of all Cd-stressed plants readily became brown and necrotic in appearance when compared to that of unstressed plantlets (Figure 3.6). In contrast, within the time period tested, the presence of Cd in the growth media did not seem to cause any morphological abnormalities in the above-ground tissues of poplar plantlets in comparison to non-metal stressed plantlets. In a similar manner, the four //MT-transformed poplar lines analyzed also exhibited a browning of root tissue when they were exposed to Cd-stress but did not seem to display any differences in their stem or leaf tissue in comparison to non-transformed Cd-stressed poplar control plantlets. 116 I Figure 3.6:The Gross Morphological Effects of Cadmium Stress on a Poplar Hyb r id Plantlets of the poplar hybrid Populus alba x P. tremula were subjected to five days of growth in media containing 100 uM CdCl 2 in order to ascertain the effect of toxic Cd metal ions on plant morphology. Shown on the left is a plantlet that was subjected to metal stress compared to the plant on the right which was not grown on Cd-containing media. 117 3.3.4 Quantification of the Metal Accumulation Ability of /JMT-transformants //MT-transformed plantlets and non-transformed control plantlets were grown in tissue culture on media containing 100 uM CdCl2 for 5 days. The amount of Cd sequestered within the plants was determined by graphite furnace AAS. Cd ion levels were calculated in ppm, equivalent to pgCd/g of tissue on a dry weight basis. The Cd concentrations were determined by averaging the values from three replicates of a given sample. As shown in Figure 3.7, roots of Cd-stressed control plants contained over 10-fold higher Cd levels than un-stressed controls. However, the Cd levels in roots of HMT transgenic plants were not significantly different from those in the untransformed control plants. As shown in Figure 3.8, leaves of Cd-stressed control plants contained almost 2-fold higher Cd levels than unstressed controls. However, the Cd levels in leaves of HMT transgenic plants were not significantly different from those in the untransformed control plants. Finally, Figure 3.9 shows that in stems Cd levels were not significantly higher in the Cd-treated control plants, and that Cd levels in Cd-treated //MT-transformants were similar to those of the Cd-treated control. 118 Table 3.4 Cd Concentrations in Tissues of Nontransformants and /fMJ-transformants Poplar Line Tissue Type Cd Concentration (ppm) no Cd, nontransformant root 34.06 +/- 9.04 leaf 45.00 +/- 4.69 stem 17.38+/-6.74 Cd-stressed nontransformant root 492.07 +/- 277.42 leaf 73.82 +/- 19.75 stem 22.11 +/-8.63 Cd-stressed, HMT line 1 root 469.73 +/- 73.17 leaf - 55.09 +/- 23.84 stem 16.64+/-7.02 Cd-stressed, HMT line 2 root 640.72+/-216.16 leaf 43.03 +/-21.43 stem 13.39+/-3.48 Cd-stressed, HMT line 3 root 476.24+/- 127.07 leaf 55.56 +/- 18.55 stem 18.02+/- 9.61 Cd-stressed, HMT line 4 root 648.69 +/- 101.65 leaf 48.15+/- 19.03 stem 20.02 +/- 7.32 119 900, 800 700 6001 no Cd Cd-stressed line 1 line 2 line 3 line 4 nontransformants Cd- stressed //.l/7"-transformants Figure 3.7: Cd Accumulat ion in Root Tissue of //A/jT-transformants Root tissue of three replicate clones of non-Cd stressed non-transformants. Cd-stressed non-transformants, and Cd-stressed Wt/r-transformation lines 1, 2, 3, and 4 were analyzed by graphite furnace atomic absorption spectrophotometry. The metal-stressed plantlets were stressed with 100 uM CdCb for 5 days. Root samples were freeze dried for 2 days. The values represent an average of three replicate readings and the bars indicate strandard deviation. 120 100. 90-80-no Cd Cd-stressed line 1 line 2 line 3 line 4 nontransformants Cd- stressed //.l/r-transformants Figure 3.8: Cd Accumulation in Leaf Tissue of //3/7"-transformants Leaf tissue of three replicate clones of non-Cd stressed non-transformants. Cd-stressed non-transformants, and Cd-stressed /YM7'-transformation lines 1, 2, 3, and 4 were analyzed by graphite furnace atomic absorption spectrophotometry. The metal-stressed plantlets were stressed with 100 pM CdCL for 5 days and then freeze dried for 2 days. The values represent an average of three replicate readings and the bars indicate strandard deviation. 121 35 Figure 3.9: Cd Accumulation in Stem Tissue of /JM7-transformants Stem tissue of three replicate clones of non-Cd stressed non-transformants, Cd-stressed non-transformants, and Cd-stressed HMT-transformation lines 1, 2, 3, and 4 were analyzed by graphite furnace atomic absorption spectrophotometry. The metal-stressed plantlets were stressed with 100 juM CdCh for 5 days and then freeze dried for 2 days. The values represent an average of three replicate readings and the bars indicate strandard deviation. 122 Table 3.5: Analysis of Variance to Determine the Significance Between Pair-Wise Comparisons of the Mean Values of Cd Accumulated Between //MJ-transformants and Nontransformants Significant at 95% confidence Tissue Type Mean, Mean2 F value level a0.os = 7.71 d.f.4 Root no Cd nontransformant Cd-stressed nontransformant 8.17 Yes Cd-stressed Cd-stressed 0.02 No nontransformant HMT line 1 Cd-stressed Cd-stressed 0.54 No nontransformant HMT line 2 Cd-stressed Cd-stressed 0.01 No nontransformant HMT line 3 Cd-stressed Cd-stressed 0.84 . No nontransformant HMT line 4 Leaf no Cd nontransformant Cd-stressed nontransformant 7.80 Yes Cd-stressed Cd-stressed 1.10 No nontransformant HMT line 1 Cd-stressed Cd-stressed 3.35 No nontransformant HMT line 2 Cd-stressed Cd-stressed 1.36 No nontransformant HMT line 3 Cd-stressed Cd-stressed 2.60 No nontransformant HMTline 4 Stem noCd nontransformant Cd-stressed nontransformant 0.13 No Cd-stressed Cd-stressed 0.17 No nontransformant HMT line 1 Cd-stressed Cd-stressed 0.46 No nontransformant HMT line 2 Cd-stressed Cd-stressed 0.09 No nontransformant HMT line 3 Cd-stressed Cd-stressed 0.02 No nontransformant HMT line 4 123 3.3.5 T i s s u e D i s t r i b u t i o n o f A c c u m u l a t e d C a d m i u m Ions i n / / M T - t r a n s f o r m a n t s In both leaf and root tissue, Cd accumulated to significantly higher levels within the tissues of the Cd-stressed non-transformants compared to the non-stressed non-transformants, indicating that poplar plantlets have the ability to accumulate Cd within leaf and root tissue (Figure 3.7 and Figure 3.8). In contrast, since there was no significant difference between the Cd levels in stems of Cd-stressed and the non-stressed non-transformants, the stem tissue does not have any capacity to accumulate Cd. Figure 3.10 shows that the level of Cd in roots of Cd-stressed plantlets was far greater than the level of Cd in the above-ground tissues, indicating that poplar plantlets seem to preferentially accumulate Cd within their root tissue and that Cd is not readily translocated to other tissues. For example, //MT-transformed line 2 accumulated 14.8 times more Cd within its roots than within its leaves. 124 100%r • stem • leaf • root noCd Cd-stressed line 1 line 2 line 3 line 4 nontransformants Cd-stressed //A/r-transformants Figure 3.10: Distribution of Cadmium Ions Within the Tissues of //.1/7-transformants Tissue of three replicate clones of non-Cd stressed non-transformants, Cd-stressed non-transformants. and Cd-stressed //M7-transforrnation lines 1,2, 3, and 4 were analyzed by graphite furnace atomic absorption spectrophotometry. The metal-stressed plantlets were stressed with 100 uM CdCl 2 for 5 days and then freeze dried for 2 days. The values represent an average of three replicate readings. The Cd levels in root (blue), leaf (brown) and stem (yellow) tissue is displayed as a percentage of total cadmium accumulated. 125 3.4 DISCUSSION For over two decades the susceptibility of poplar to the soil bacterium Agrobacterium tumefaciens has been known (DeCleene and DeLay, 1976) and Agrobacterium-mediated transformation was employed in this research as a means to introduce the fission yeast heavy metal tolerance (HMT-23) gene into poplar. Using A.tumefaciens strain LBA4404, the transformation efficiency was seen to approximate that cited in other research: 6-29% (Confalonieri et al, 1995). The source of poplar explants can affect the efficiency of poplar transformation (Leple et al, 1992; Kim et al, 1997). Many different tissues, such as stem, leaf, root, callus and protoplasts, could be used for Agrobacterium infection. In this research, both leaf sections and stem internodes were used. It was observed that the efficiency of stem internodes regeneration into transformants far exceeded that of leaf sections. Stem internodes of P. tremula x P. alba have also been reported to form transformed callus at a much high frequency then did leaf sections (Leple et al, 1992). Also, studies involving the Agrobacterium susceptibility of various tissues of P. tremuloides demonstrate that stem internodes were the most susceptible while leaf sections were the least susceptible (Kim et al, 1997). Expression of an introduced gene in transgenic plants can vary between transformants. In this transformation experiment, of the eight explants that contained the NPT-II gene, six expressed the HMT-23 gene. In a similar manner, Confalonieri et al. (1995) transformed P. nigra with a plasmid containing the NPT-II gene and the uidA gene (encoding for the B-glucuronidase reporter enzyme) and found that only 50%) of the explants exhibiting kanamycin resistance also expressed the reporter gene. Various parameters like nucleotide composition and methylation can reduce, alter or even completely eliminate the expression of an introduced gene in transformed plants. The presence of rare codons in the introduced gene may result in the gene 126 being incompatible for expression in a plant system. In an effort to circumvent this potential problem, certain codons in the S. pombe HMT gene (see Figure 3.1) were altered prior to poplar transformation. Also, gene silencing in transgenic plants may arise through methylation of the introduced gene. CpG dinucleotides seem to serve as methylation sites in plants and, therefore the higher the GC content in a gene, the higher the likelihood of a methylation, and silencing, event. Because of this, some non-plant genes have to be modified in their GC content to facilitate expression in plants (Rugh et al, 1996). Consistent antibiotic exposure during the regeneration of transformed plants has also been shown to result in a higher frequency of genome-wide methylation events (Schmitt et al, 1997). This increase in methylation events has been reported to result in a higher frequency of silencing of introduced genes. In addition to methylation, the total copies of transgenes and the site of insertion of the gene in the plant's genome have also been indicated as causal agents in transgene silencing (Matzke and Matzke, 1995; Matzke etal, 1996; Pawlowski and Somers, 1996). The poplar hybrid Populus alba x P. tremula (INRA clone 717-1B4) used in these studies accumulated Cd predominantly within its roots; up to 95% of the accumulated Cd was sequestered within roots of wild-type and transgenic lines. The Cd levels were about 15-fold higher in roots than in shoots. Sensitivity of roots to heavy metals has been reported in a number of plant species and has often been used as a means to evaluate the degree of toxicity of various metal compounds (Cheung et al, 1989; Brown and Brinkman, 1992). The asymmetrical distribution of metal ions in roots compared to shoots is a characteristic shared by a number of plant species. Approximately 95% of Hg accumulation in pea (Pisum sativum) was within the roots (Beauford et al, 1977). The ability of sunflower (Helianthus annus) roots to accumulate high levels of Pb up to 10% on a dry weight basis, is currently being employed to filter out radioactive metal ions from groundwater near Chernobyl, Ukraine (Raskin et al, 1997). 127 Plants may preferentially retain metal ions within their roots because root tissues may lack mechanisms to translocate these ions to above-ground tissues. If roots have a low tolerance threshold for potentially toxic ions, then that ion may simply accumulate within the damaged root. For example, As accumulates in tomato (Lycopersicon esculentum) roots 69-fold higher than in shoots (Carbonellbarrachina et al, 1996). This was hypothesized to be due to a limitation in upward transport of As from roots by the high toxicity of this metal to root radicular and transporter cells. In a similar manner, investigations on the uptake and translocation of phenols in barley (Hordeum vulgare) roots showed that phenols are not transported to shoot tissue but, rather, they remain in roots as glucosides (Glass and Bohm, 1971). These findings suggest that roots may act as a threshold barrier to some compounds. This means that in the absence of transport mechanisms, some compounds will simply remain within roots. The efficiency of translocation of toxic metal ions within a plant may depend upon the particular plant species and genotype in question. For example, Indian mustard, Brassica juncea, was reported to accumulate 6 times the amount of Cd in its root tissue compared to its shoot tissue (Salt et al, 1995), whereas Azollafiliculoides was found to equally distribute Cd within its root and shoot tissue (Sela et al, 1988). Likewise, notable differences in the pattern of Zn distribution were reported between the hyperaccumulator species Thlaspi caerulescens and the non-hyperaccumulator Thlaspi ochroleucum (Shen et al, 1997). When exposed to 500mmol/m Zn, T.caerulescens contained 57-73% more Zn within its shoot tissue and 10 times less Zn in its root tissue than T. ochroleucum. The variation of tissue distribution of Cd was studied in nineteen genotypically distinct lines of Zea mays (Florijn and Beusichem, 1993). The Cd concentrations in shoots showed a large genotypic variation, ranging from 2.5 to 56.9 pg/g dry weight when exposed to metal stress. The researchers further noted that, of the lines tested, the plants could be categorized as either "shoot excluders" (low Cd concentration in shoots 7.4 +/-128 5.3 pg/g, high levels in roots 206 +/- 71.2 pg/g) or "non-shoot excluders" (similar shoot and root concentrations of Cd, 54.2 +/- 3.4 pg/g and 75.6 +/- 11.2 pg/g, respectively). These findings demonstrate that the internal distribution of metals within plant tissue may be an important factor in determining overall metal tolerance. Also, and perhaps more importantly, the internal metal distribution can vary between plant species as well as between different genotypes within a species. The finding that the poplar hybrid used in this research accumulates Cd predominantly within roots means that this plant would have limited commercial applications since metal-contaminated roots would be difficult to excavate on a large-scale. Since the ability to translocate metal ions to harvestable tissue seems to be genotype specific in other plants, then poplar species or genotypes that readily translocate metal ions to above-ground tissue may easily be identified by merely screening individuals to find the desired phenotype. 7fMT-transformed poplar hybrids did not display an enhanced ability to accumulate Cd compared to non-transformed plants. Since overexpression of the HMT gene in the fission yeast, Schizosaccharomyces pombe, resulted in an increased ability to tolerate and sequester Cd ions within the vacuole (Ortiz et al, 1992), a similar metal-sequestering phenotype was expected in the poplar /YMT-transformants. Metal toxicity analysis was not formally performed since callus tissue was not regenerated from the transformed lines, and therefore the level of Cd sensitivity could not be determined for the //MT-transformants. It was, however, noticed that the HMT-transformants exhibited the same metal toxic symptoms as did control plants when exposed to Cd stress. When the amount of Cd sequestered within the tissue of the /YMT-transformants was quantified and compared to that of the control plants there was no significant difference in the amount of metal ions accumulated in any of the tissue types. The lack of a distinct difference in the amount of Cd accumulated in the HMT-transformants compared to the control plants could simply be attributed to the fact that only four 129 lines were analyzed. The four lines analyzed expressed the HMT gene to a similar extent. If more transformed lines were produced, a higher level of HMT gene expression might be achieved in some lines, and this higher expression level might result in the predicted metal-accumulating phenotype. For example, it was shown in transgenic Arabidopsis plants expressing a bacterial mercuric reductase gene, merA, that the level of mercury reduction was directly proportional to the steady state merA mRNA levels (Rugh et al, 1996). Another possible explanation for the lack of a Cd-accumulating phenotype of the HMT-transformants is that the transformants were regenerated under conditions that did not permit them to accumulate metal ions to their highest potential. Shen et al. (1997) reported that under conditions of Zn stress, followed by a period of no metal stress for 33 days, 89% of the Zn previously accumulated in the roots of T.caerulescens was translocated to the shoots. This illustrates the possibility of obtaining high concentrations of metal ions within shoot tissue by exposing plants to metal stress followed by a "relaxed" stress environment. Although such conditions may be impractical to duplicate in field phytoremediation projects, they may aid in enhancing metal accumulation rates in laboratory settings where plants are used to de-contaminant excavated soils. Soil amendments have also been shown to alter the metal accumulation ability of plants. Shoots of Zea mays accumulated 40 mgPb/kg when grown on soils containing 2,500 mgPb/kg (Huang and Cunningham, 1996) but when 2 g/kg N-(2-hydroxyethyl)ethylenediamine-triacetic acid (HEDTA) was added to the soil, corn shoots accumulated 10,600 mgPb/kg. Soil additives that render metal contaminants more bioavailable to plants could be used in conjunction with hyperaccumulating plants in order to hasten the soil de-contamination process in phytoremediation projects. Alternatively, another explanation for the non-Cd accumulating phenotype of the poplar transformants is that the HMT protein may not have been properly translated and/or targeted to 130 the plant vacuole membrane. Ideally, the detection of the functional HMT protein integrated into the plant vacuole membrane would be a definitive test that the poplar transgenics were properly expressing the introduced yeast gene. Unfortunately, antibodies specific against the HMT protein are not available (Ortiz et al, 1992). The original research involving the cellular localization of this protein in yeast was performed by using antibodies raised against the chimeric protein HMT-p-galactosidase (Ortiz et al, 1992). Since, no such fusion protein was used in this transformation research, the localization of the HMT protein in poplar could not be determined. Lastly, //MT-transformants may not have accumulated elevated levels of Cd within their tissues due to an inability of the plant expressed HMT protein to function properly. The cellular function of the HMT protein is such that it shuttles phytochelatin-metal complexes from the cytosol into the vacuole (Ortiz et al, 1992). Considering this, in order for high levels of Cd to be localized in the vacuole by the action of HMT, the metal ions must first be bound to phytochelatins. In the poplar hybrid used in this research, phytochelatins are not induced to any appreciable extent in root tissue under Cd stress (Chapter 2). Thus, a possible reason for the lack of Cd accumulation in //MT-transformants would be that the transformants cannot accumulate Cd-phytochelatin complexes in the vacuole due to the low level of formation of these complexes in the cytosol of root cells. This hypothesis could be verified by quantifying the amount of phytochelatin peptides in the root tissue of poplar transformants by performing high performance liquid chromatography (HPLC) analysis. Additionally, x-ray microanalysis could be performed to determine at the cellular level if there is a difference in the localization of metal ions in //MT-transformants compared to non-transformed control plants. This methodology may reveal differences in metal vacuole compartmentalization between transformants and non-transformants which cannot be detected by simply quantitating the amount of metal ions accumulated within bulk tissue. 131 Other research has been performed with the final objective of producing metal-accumulating plants. The expression of the metal-chelating compound metallothionein, MT, in plants has been shown to increase the level of metal tolerance to a number of plant species (Evans et al, 1992; Brandle et al, 1993; Elmayan and Tepfer, 1994; Hattori et al, 1994; Hasegawa et al, 1997). However, MT-transformed tobacco plants did not have enhanced levels of Cd sequestered within their tissues compared to nOn-transformed controls (Brandle et al., 1993). Yet, other researchers noticed that MT-transformed tobacco plants did display an altered tissue distribution of metal ions compared to that of non-transformed controls (Yeargan et al, 1992; Elmayan and Tepfer, 1994; Hasegawa et al, 1997). Specifically, MT-transformants contained about 24% lower Cd concentration in shoots and about 5% higher Cd concentration in roots than control seedlings (Yeargan et al, 1992). These findings in tobacco somewhat parallels my findings in poplar, in that there was no heightened ability of either type of transformant to accumulate Cd. Tobacco MT-transformants had a slightly altered tissue partitioning of metal ions, while no such pattern was noted in poplar //MT-transformants. Whether the //MT-transformants differ in their metal compartmentalization ability at the cellular level compared to non-transformants has yet to be determined. Other approaches have been used to achieve the objective of producing a plant that might be used in metal phytoremediation projects. Research involving the production of plants that tolerate metal ions within their ambient environment (Fuente et al, 1997) or de-toxify metal ions by converting them into their less toxic inert ionic forms (Rugh et al, 1996; Rugh et al, 1998) has been promising. These success stories of strategies to remediate metal environmental pollution through the application of plant biotechnology offer encouragement to refine the poplar-based metal-accumulating research attempted in this thesis. This phytoremediation work provides important insights into various factors that may limit the ability of poplar hybrids to be 132 used as a tool to remediate metalliferous soils. A better understanding of these factors should aid in the construction of genetically engineered poplars that in the future could be used to commercially remediate metal polluted soils. The use of plants to remediate metal pollutants is a promising technology that in time will become more developed and strengthened through the innovative application of biotechnology techniques. 133 3.5 References Ahuja, M. R. and M. Fladung (1996). Stability and expression of chimeric genes in Populus. Somatic cell genetics and molecular genetics of trees. M. R. Ahuja, W. Boerjan and D. B. Neale. Dordrecht, Netherlands, Klumer Academic Publishers pp. 89-96. Baucher, M., B. Chabbert, G. Pilate, J. Van Doorsselaere, M.T. Tollier, M. Petit Conil, D. Cornu, B. Monties, M. Van Montagu, D. Inze, L. Jouanin, and W. Boejan (1996). "Red xylem and higher lignin extractability by down-regulating a cinnamyl alcohol dehydrogenase in poplar." Plant Physiology 112: 1479-1490. Beauford, W., J. Barber, and A.R. Barringer (1977). "Uptake and distribution of mercury within higher plants." Physiologia Plantarum 39: 261-265. Boyajian, G. E. and L. H. Carreira (1997). "Phytoremediation: a clean transition from laboratory to marketplace?" Nature Biotechnology 15: 127-128. Brandle, J. E., H. Labbe, J. Hattori, and B.L. Miki (1993). "Field performance and heavy metal concentrations of transgenic flue-cured tobacco expressing a mammalian metallothionein-P-glucoronidase gene fusion." Genome 36: 255-260. Brasileiro, A. C. M., J. C. Leple, J. Muzzin, D. Ounnoughi, M.F. Michel, and L. Jouanin (1991). "An alternative approach for gene transfer in trees using wild-type Agrobacterium strains." Plant Molecular Biology 17: 441-452. Brasileiro, A. C. M., C. Tourneur, J.C. Leple, V. Combes, and L. Jouanin (1992). "Expression of the mutant Arabidopsis thaliana acetolactate synthase gene confers chlorsulfuron resistance to transgenic poplar plants." Trangenic Research 1: 133-141. Brown, G. and K. Brinkman (1992). "Heavy metal tolerance in Festuca ovina L. from contaminated sites in Eifel mountains, Germany." Plant and Soil 143: 239-247. Burken, J. G. and J. L. Schnoor (1997). "Uptake and metabolism of atrazine by poplar trees." Environmental Science and Technology 31: 1399-1406. Carbonellbarrachina, A. A., F. M. Burlocarbonell, and J.J. Xataixbeneyto (1996). "Strategies of tomato and bean plants tolerance to arsenic." Fresenius Envionmental Bulletin 5: 289-294. Charest, P. J., D. Stewart, and P.L. Budicky (1992). "Root induction in hybrid poplar by Agrobacterium genetic transformation." Canadian Journal of Forest Research 22: 1832-1837. Cheung, H., M. H. Wong, and N.F.Y. Tarn (1989). "Root and shoot elongation as an assessment of heavy metal toxicity and Zn equivalent value of edible crops." Hydrobiologia 188/189: 377-383. 134 Chung, K. H., Y. G. Park, E.R. Noh, and Y.W. Chun (1989). "Transformation of Populus alba x P. glandulosa by Agrobacterium rhizogenes." Journal of the Korean Forestry Society 78: 372-380. Confalonieri, ML, A. Balestrazzi, and S. Bisoffi (1994). "Genetic transformation of Populus nigra by Agrobacterium tumefaciens." Plant Cell Reports 13: 256-261. Confalonieri, M., A. Balestrazzi, S. Bisoffi, and R. Cella (1995). "Factors affecting Agrobacterium tumefaciens-mediated transformation in several black poplar clones." Plant Cell. Tissue and Organ Culture 43: 215-222. DeBlock, M. (1990). "Factors influencing the tissue culture and the Agrobacterium tumefaciens-mediated transformation of hybrid aspen and poplar clones." Plant Physiology 93: 111 0-1116. DeCleene, M. and J. DeLay (1976). "The host range of crown gall." The Botanical Review 42:389-466. Devillard, C. (1992). "Genetic transformation of aspen {Populus tremula x Populus alba) by Agrobacterium rhizogenes and regeneration of plants tolerant to herbicide." Comptes Rendus des Seances de FAcademic des Sciences 314: 291-298. Dinus, R. J., C. J. Stephens, and S. Chang (1995). Agrobacterium tumefaciens-mediated transformation of eastern Cottonwood (Populus deltoides). Proceedings of the international poplar symposium: poplar biology and its implications for management and conservation: 1995, August 20-25. Seattle, WA. Donahue, R. A., T. D. Davis, CH. Michler, D.E. Riemenschneider, D.R. Carter, P.E. Marquardt, N . Sankhla, D. Sankhla, B.E. Haissig, and J.G. Isebrands (1994). "Growth, photosynthesis, and herbicide tolerance of genetically modified hybrid poplar." Canadian Journal of Forest Research 24: 2377-2383. Doyle, J.J.,and J.L. Doyle (1990) Isolation of DNA from small amounts of plant tissue BRL Focus 12: 13-15 Elmayan, T. and M. Tepfer (1994). "Synthesis of a bifiinctional metallothionein/ beta-glucuronidase fusion protein in transgenic tobacco plants as a means of reducing leaf cadmium levels." The Plant Journal 6: 433-440. Evans, K. M., J. A. Gatehouse, W. P. Lindsay, J. Shi, A.M. Tommey, and N.J. Robinson (1992). "Expression of the pea metallothionein-like PsMTa in Escherichia coli and Arabidopsis thaiiana and analysis of trace metal ion accumulation: implications of PsMTa function." Plant Molecular Biology 20: 1019-1028. 135 Fillatti, J. J., J. Sellmer, B. McCown, B. Haissig, and L. Comai (1987). "Agrobacterium mediated transformation and regeneration of Populus." Molecular and General Genetics 206: 192-199. Florijn, P. J. and M. L. van Beusichem (1993). "Uptake and distribution of cadmium in maize inbred lines." Plant and Soil 150: 25-32. Fuente, J. M. d. 1., V. Ramirez-Rodriguez, J.L. Cabrera-Ponce, and L. Herrera-Estrella (1997). "Aluminum tolerance in transgenic plants by alternation of citrate synthesis." Science 276:1566-1568. Glass, A. D. M. and B. A. Bohm (1971). "The uptake of simple phenols by barley roots." Planta 100: 93-105. Gustafson, J. P. and K. Ross (1990). "Control of alien gene expression for aluminum tolerance in wheat." Genome 33: 9-12. Hasegawa, I., E. Terada, M. Sunairi, H. Wakita, F. Shinmachi, A. Noguchi, M. Nakajima, and J. Yazaki (1997). "Genetic improvement of heavy metal tolerance in plants by transfer of the yeast metallothionein gene (CUPI)." Plant and Soil 196: 277-281. Hattori, J., H. Labbe, and R.L. Miki (1994). "Construction and expression of a metallothionein-beta-glucuronidase gene fusion." Genome 37: 508-512. Holton, T. A. and M. W. Graham (1991). "A simple and effective method for the direct cloning of PCR products using ddT-tailed vectors." Nucleic Acids Research 19: 1156. Howe, G. T., B. Goldfarb, and S.H. Strauss (1994). "Agrobacterium-mediated transformation of hybrid poplar suspension cultures and regeneration of transformed plants." Plant Cell-Tissue and Organ Culture 36: 59-71. Huang, J. W. and S. D. Cunningham (1996). "Lead phytoextraction: species variation in lead uptake and translocation." New Phytologist 134: 75-84. Kajita, S., K. Osakabe, Y. Katayama, S. Kawai, Y. Matsumoto, K. Hata, and N. Morohoshi (1994). "Agrobacterium-mediated transformation of poplar using a disarmed binary vector and the overexpression of a specific member of a family of poplar peroxidase genes in transgenic poplar cell." Plant Science 103: 231-239. Kim, M., N. B. Klopfenstein, and Y.W. Chun (1997). Agrobacterium-mediated transformation of Populus species. Micropropagation, Genetic Engineering and Molecular Biology of Populus. N. B. Klopfenstein, Y. W. Chun, M. Kim and M. R. Ahuja. Fort Collins, CO, US Department of Agriculture, Forest Service, Rocky Mountain Research Station: 326. Klopfenstein, N. B. (1995). "Organ specific expression of the nos-NPT II gene in trangenic hybrid poplar." Journal of Korean Forest Society 84: 77-86. 136 Klopfenstein, N. B., N. Q. Shi, A. Kernan, H.S. McNabb, R.B. Hall, E.R. Hart, and R.W. Thronburg (1991). "Transgenic Populus hybrid expresses a wound-inducible potato proteinase inhibitor II - CAT gene fusion." Canadian Journal of Forestry Research 21: 1321-1328. Larsen, P. B., J. Degenhardt, C. Tai, L.M. Stenzler, S.H. Howell, and L.V. Kochian (1998). "Aluminum-resistant Arabidopsis mutants that exhibits altered patterns of aluminum accumulation and organic acid release from roots." Plant Physiology 117: 9-18. Leple, J. C, M. Bonade-Bittino, S. Augustin, G. Pilate, V. Dumanois Le Tan, A. Delplanque, D. Cornu, and L. Jouanin (1995). "Toxicity to Chrysomela tremulae (Coleoptera: chrysomelidae) of transgenic poplars expressing a cysteine proteinase inhibitor." Molecular Breeding 1: 319-328. Leple, J. C , A. C. M. Brasileiro, M.F. Michel, F. Delmotte, and L. Jouanin (1992). "Transgenic poplars: expression of chimeric genes using four different constructs." Plant Cell Reports 11: 137-141. Licht, L. A. (1990). Poplar tree buffer strips grown in riparian zones for biomass production and non-point source pollution control, University of Iowa. Ph.D. Dissertation. Maiti, I. B., G. J. Wagner, and A.G. Hunt (1991). "Light inducible and tissue-specific expression of a chimeric mouse metallothionein cDNA gene in tobacco." Plant Science 76: 99-107. Matzke, M. A. and A. J. M. Matzke (1995). "How and why do plants inactivate homolgous (trans)genes." Plant Physiology 107: 679-685. Matzke, M. A., A. J. M. Matzke, and W.B. Eggleston (1996). "Paramutation and transgene silencing: a common response to invasive DNA?" Trends in Plant Science 1: 382-388. Misra, S. and L. Gedamu (1989). "Heavy metal tolerant transgenic Brassica napus L. and Nictotiana tabacum L. plants." Theoretical and Applied Genetics 78: 161-168. Newman, L. A., S. E. Strand, N. Choe, J. Duffy, G. Ekuan, M. Ruszaj, B. B. Shurtleff, J. Wilmoth, P. Heilman, and M. P. Gordon (1997). "Uptake and biotransformation of trichloroethylene by hybrid poplars." Environmental Science and Technology 31: 1062-1067. Nilsson, O., T. Alden, F. Sitbon, C.H.A. Little, V. Chalupa, G. Sandberg, and O. Olsson (1992). "Spatial pattern of cauliflower mosaic virus 35S promoter-luciferase expression in transgenic hybrid aspen trees monitored by enzymatic assay and non-destructive imaging." Transgenic Research 1: 209-220. 137 Nilsson, O., C. H. A. Little, G. Sandberg, and O. Olsson (1996a). "Expression of two heterologous promoters, Agrobacterium rhizogenes rolC and cauliflower mosaic virus 35S in the stem of transgenic hybrid aspen plants during the annual cycle of growth and dormancy." Plant Molecular Biology 31: 887-895. Nilsson, O., T. Moritz, B. Sundberg, G. Sandberg, and O. Olsson (1996b). "Expression of the Agrobacterium rhizogenes rolC gene in a deciduous tree alters growth and development and leads to stem fasciation." Plant Physiology 112: 493-502. Noctor, G., M. Strohm, L. Jouanin, K.J. Kunert, CH. Foyer, and H. Rennenberg (1996). "Synthesis of glutathione in leaves of transgenic poplar overexpressing gamma-glutamylcysteine synthetase." Plant Physiology 112: 1071-1078. Ortiz, D. F., L. Kreppel, D.M. Speiser, G. Scheel, G. McDonald, and D.W. Ow (1992). "Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter." EMBO Journal 11: 3491-3499. Ortiz, D. F., T. Ruscitti, K.F. McCue, and D.W. Ow (1995). "Transport of metal-binding peptides by HMT1, a fission yeast ABC-type vacuolar membrane protein." The Journal of Biological Chemistry 270: 4721-4728. Pawlowski, W. P. and D. A. Somers (1996). "Transgene inheritance in plants genetically engineered by microprojectile bombardment." Molecular Biotechnology 6: 17-30. Penner, G. A., J. Clarke, L.J. Bezte, and D. Leisle (1995). "Identification of RAPD markers linked to a gene governing cadmium uptake in durum wheat." Genome 38: 543-547. Pollard, A. J. and A. J. M. Baker (1995). "Quantitative genetics of zinc hyperaccumulation in Thlaspi caerulescens." New Phytologist 132: 113-118. Raskin, I., R. D. Smith, and D.E. Salt (1997). "Phytoremediation of Metals: Using Plants to Remove Pollutants from the Environment." Current Opinion in Biotechnology 8: 221-226. Rugh, C. L., J. F. Senecoff, R.B. Meagher, and S.A. Merkle (1998). "Development of transgenic yellow poplar for mercury phytoremediation." Nature Biotechnology 16: 925-928. Rugh, C. L., H. D. Wilde, N.M. Stack, D.M. Thompson, A.O. Summers, and R.B. Meagher (1996). "Mercuric ion reductase and resistance in transgenic Arabidopsis thaiiana plants expressing a modified bacterial merA gene." Proceedings of the National Academy of Science of the U.S.A. 93: 3182-3187. Salt, D. E., R. C. Prince, I.J. Pickering, and I. Raskin (1995). "Mechanisms of cadmium mobility and accumulation in indian mustard." Plant Physiology 109: 1427-1433. Sambrook, J., E. F. Fritsch, and T. Maniatis (1989). Molecular Cloning: A laboratory manual, 2nd Edn. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press. 138 Schmitt, F., E. J. Oakeley, and J.P. Jost (1997). "Antibiotics induce genome-wide hypermethylation in cultured Nicotiana tabaccum plants." The Journal of Biological Chemistry 272: 1534-1540 Schwartzenberg, K., P. Doumas, L. Jouanin, and G. Pilate (1994). "Enhancement of the endogenous cytokinin concentration in poplar by transformation with Agrobacterium T-DNA gene ipt." Tree Physiology 14: 27-35. Sela, M., E. Tel-Or, E. Fritz, and A. Huttermann (1988). "Localization and toxic effects of cadmium, copper, and uranium in Azolla." Plant Physiology 88: 30-36. Shen, Z. G., F. J. Zhao, and E. Fritz, and A. Huttermann (1997). "Uptake and Transport of Zinc in the Hyperaccumulator Thlaspi caerulescens and the non-hyperaccumulator Thlaspi ochroleucum." Plant. Cell and Environment 20: 898-906. Strohm, M., L. Jouanin, K. J. Kunert, C. Pruvost, A. Polle, C. H. Foyer, and H. Rennenberg (1995). "Regulation of glutathione synthesis in leaves of transgenic poplar (Populus tremula x P. alba) overexpressing glutathione synthetase." The Plant Journal 7: 141-145. Tilstone, G. H. and M. R. Macnair (1997). "Nickel tolerance and copper-nickel co-tolerance in Mimulus guttatus from copper mine and serpentine habitats." Plant and Soil 191: 173-180. Tsai, C. J., G. K. Podila, and V.L. Chiang (1994). "Agrobacterium-mediated transformation of quaking aspen (Populus tremuloides) and regeneration of transgenic plants." Plant Cell Reports 14: 94-97. Tuominen, H., F. Sitbon, C. Jacobsson, G. Sandberg, O. Olsson, and B. Sundberg (1995). "Altered growth and wood characteristics in transgenic hybrid aspen expressing Agrobacterium tumefaciens T-DNA indoleacetic acid biosynthetic genes." Plant Physiology 109: 1179-1189. Wang, S. P., Z. H. Xu, and Z.M. Wei (1990). "Genetic transformation of leaf explants of Populus tomentosar Acta Botanica 32: 172-177. Weigel, D. and O. Nilsson (1995). "A developmental switch sufficient for flower initiation in diverse plants." Nature 377: 495-500. Yeargan, R., I. B. Maiti, M.T. Nielsen, A.G. Hunt, and G.J. Wagner (1992). "Tissue partitioning of cadmium in transgenic tobacco seedlings and field grown plants expressing the mouse metallothionein I gene." Transgenic Research 1: 261-267. Zhou, C , Y. Yang, and A.Y. Jong (1990)."Mini-preps in ten minutes" Biotechniques 8: 172-173. 139 CHAPTER 4 - GENERAL CONCLUSIONS AND RECOMMENDATIONS The overall objective of this dissertation was to assess the feasibility of using poplar as a tool in metal phytoremediation applications. Transformed hybrid poplars were produced that expressed the fission yeast HMT gene which encodes for a vacuole membrane transporter. It was expected that the production of this protein in poplar could result in plants having a potential use in metal phytoremediation. There were two possible successful outcomes of this research: metal-accumulating plants or metal tolerant plants. If the HMT poplar transformants produced in this research had been able to accumulate heightened levels of metal ions, growing the resultant transgenic plants on metal contaminated soils would help to de-contaminate the soil by sequestering the metals within their tissues. The tissue would then need to be harvested and processed to either recover the metal ions or to concentrate them prior to hazardous waste disposal. As an alternative to having elevated levels of toxic ions within plant tissues, the //MT-transformants could have simply been tolerant to metal ions within their surroundings. In this case, the plants could have been grown on inexpensive barren metal-contaminated soils. Although the metal contaminants in the soils would not be reduced after the plants were grown on a given polluted site, at least the site could be converted into an economically beneficial tree plantation. Unfortunately, the quantity of Cd ions found to be sequestered within the tissue of //MT-transformants was not significantly different from that of non-transformants. One explanation is that the level of the primary metal-chelating compound in poplar, phytochelatins, are produced at a low level in root tissue. This low level of phytochelatins could be a limiting factor in the sequestration of Cd ions in the vacuole of root cells since the HMT protein predominantly transports Cd-phytochelatin complexes. In this case, to successfully genetically engineer poplar to sequester metal ions, the level of phytochelatins would have to be elevated in the root tissue in addition to expressing the phytochelatin-metal conjugate vacuole membrane 140 transporter. Since phytochelatins are the product of three enzyme-mediated reactions, the genes that encode for these three enzymes must be isolated before phytochelatin production can be genetically manipulated. Unfortunately, one of the genes, phytochelatin syntase, has yet to cloned from any organism. Considering the wealth of information currently being collected from various yeast and plant genome sequencing projects, this gene may soon be identified. Once this gene is isolated, the up-regulation of the phytochelatin biosynthetic pathway in poplar hybrids could become a reality. The findings of this research suggests that the combination of an enhanced level of phytochelatins in a root-specific manner and the expression of the HMT vacuole membrane transporter could result in transformants that could be successfully used in commercial soil remediation projects. This thesis represents a first step towards this goal. Another goal of this research was to elucidate the metal tolerance mechanisms of poplar by studying molecular aspects of metal-induced responses. The findings in this aspect of the study contributed to a greater understanding of the issues, such as the induction profiles of metal-chelating compounds, that need to be addressed in future research to produce genetically altered metal-accumulating poplars. A detailed understanding of the metal tolerance mechanisms utilized by a given plant species is an essential foundation to subsequent genetic manipulation. Future work in the phytoremediation area will likely focus on answering questions pertaining to the basic understanding of the mechanisms of soil contaminant uptake, sequestration, transportation and possibly metabolism in plants. In particular, insights into the mechanisms that hyperaccumulators possess which enable them to concentrate toxic metals within their tissues would certainly be beneficial to the plant research scientific community - from both an academic and an applied perspective. Knowledge of these metal-plant interactions should reveal numerous novel avenues that can be pursued and applied to alleviate the environmental metal pollution problem. 141 Phytoremediation is an emerging innovative technology that shows considerable promise as a cost-effective alternative to conventional soil contamination site remediation methods. Prior to the successful commercialization of this technology, there must be further refinement of outstanding scientific and technical issues. These issues include health-risk assessment, public acceptance, ecological implications and metal-enriched tissue disposal. The advancement of phytoremediation research will require integrated collaborative efforts from a number of scientific disciplines, including silviculture, agronomy, toxicology, ecology, engineering, soil chemistry, microbiology and, finally, plant genetics and molecular biology. As phytoremediation is currently in its infancy, the role plant geneticists and molecular biologists play is presently largely dictating the progress of this environmentally-friendly remediation technology since the knowledge of basic plant processes are the corner-stone of this strategy. 142 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099446/manifest

Comment

Related Items