UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The nomad element Whalen, James H. 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-390012.pdf [ 11.3MB ]
Metadata
JSON: 831-1.0099426.json
JSON-LD: 831-1.0099426-ld.json
RDF/XML (Pretty): 831-1.0099426-rdf.xml
RDF/JSON: 831-1.0099426-rdf.json
Turtle: 831-1.0099426-turtle.txt
N-Triples: 831-1.0099426-rdf-ntriples.txt
Original Record: 831-1.0099426-source.json
Full Text
831-1.0099426-fulltext.txt
Citation
831-1.0099426.ris

Full Text

T H E NOMAD ELEMENT by JAMES H. W H A L E N B.Sc, University College of the Cariboo in conjunction with the University of British Columbia, 1991 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR T H E DEGREE OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF GRADUATE STUDIES (Department of Zoology) We accept this thesis as conforming to the required standard THE UNIVERSITY'OF BRITISH COLUMBIA January, 1999 © James H. Whalen, 1999 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. 1 further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada DE-6 (2/88) Abstract The E(var)45-19 mutation of Drosophila melanogaster was isolated in a genetic screen for P-element induced enhancers of the variegating rearrangement, wm^. Remobilization of the P-element in E(var)45-19 resulted in a loss of its ability to enhance position-effect variegation (PEV) of wm^, indicating that the P-element in this mutant resulted in the E(var) phenotype. An allele of E(var)45-19, Su(var)r27, was isolated following mobilization of the P-element. Su(var)r27 was demonstrated to have sex-specific effects on the variegating rearrangements wm^ and bw^e^. In addition to its effect on PEV, Su(var)r27 was shown to enhance the mutant phenotype associated with the retroelement-induced allele w^l, suggesting that this locus is involved in the regulation of both chromatin structure and retroelement expression. The P-element insert in E(var)45-19 was located in cytogenetic region 63A by in situ hybridization. The P-element was shown to be inserted into the 3'LTR of a novel retrovirus-like transposon, which I named nomad. DNA sequence analysis showed that nomad contained three long ORFs that were similar to the gag, pol and env genes of retroviruses and the copia-like elements of Drososphila melanogaster. The nomad element terminates with 519 base pair long terminal repeats, each of which contains eukaryotic consensus transcription initiation and termination signals, nomad elements are located at approximately 10-15 sites within the euchromatic arms of the genome and at the chromocenter as shown by in situ hybridization. The host DNA sequence T A N A was duplicated on each side of the nomad element and appears to be a prefered target site for insertion of nomad elements. Analysis of the zinc finger motif in the pol gene product of retrotransposons known to have target site preference suggests involvement of the integrase subunit in target site selection for retrotransposons that display insert site specificity. A comparison of the predicted amino acid sequence of the pol-hke genes of several known retrotransposons was made and the phylogenetic relationship between nomad and other retrovirus-like mobile elements was determined. It was clear from this conceptual protein ii analysis and from analysis of structural characteristics that retrotransposons of the gypsy class can be generally classified as members of one of two distinct groups. The phylogenetic relationships of these groups are also discussed. The level of nomad transcription in the E(var)45-19 and Su(var)r27 mutations was shown to correlate with their effect on PEV, suggesting that the nomad element may be directly involved in the regulation of chromatin structure. In conclusion, a number of speculative models are presented to explain the effect of mutations in the nomad element on PEV and retroelement expression. iii Table of contents Abstract ii Index of Tables vi Index of Figures vii List of abbreviations ix Acknowledgments x Chapter 1 Chromosome structure in D. melanogaster 1 1.1 Euchromatin 1 1.2 Heterochromatin 3 1.3 Retrotransposons as elements of chromatin structure 4 1.4 Position-Effect Variegation as an assay for genes affecting chromatin structure 6 1.4.1 The phenomenon of PEV 6 1.4.2 Modifiers of Position-Effect Variegation 9 1.4.3 Genetic loci which modify PEV 10 Chapter 2 Isolation and genetic characterization of dominant Enhancers of PEV 16 Introduction 16 Materials and Methods 19 Drosophila stocks 19 Establishment of conditions for ry+ selection 19 Rates of mobility for the pUChsneory4" P-element 19 Screen for P-element induced E(var)s 21 Tests for co-segregation of the new E(var) mutation and the ry+ P-insert 24 Analysis of effects of E(var)s on eye color phenotypes 27 Recessive lethality and complementation tests .....30 Fertility tests 30 Reversion analysis 33 Maternal effect crosses 33 Crosses to white alleles 36 Results 36 2.1 A method of selection for P-element transposition events using purine selection 36 2.2 Screen for P-element induced E(var)s 39 2.2.1 Isolation and genetic characterization of dominant E(var)s 39 2.2.2 Reversion analysis 45 2.2.3 Generation of a new allele of E(var)45-19 50 2.3 Further genetic characterization of E(var)45-19 and Su(var)r27 51 2.3.1 Effect of E(var)45-19 and Su(var)r27 on PEV affected genes wm4 and bwVDe2 51 2.3.2 Phenotypes associated with Su(var)r27 58 2.3.3 Effect of Su(var)r27 on the retrotransposon-induced allele w^ 58 Discussion 58 iv Chapter 3 Molecular characterization of the nomad retrotransposon 69 Introduction 69 Materials and Methods 70 Drosophila stocks 70 Isolation of D. melanogaster genomic DNA and Southern blot analysis 70 Isolation of cosmid and cDNA clones containing nomad sequences 71 D N A sequencing and analysis 72 RNA isolation and Northern blot analysis 73 RT-PCR of nomad transcipts 73 In situ hybridization to polytene chromosomes 74 Results and Discussion 74 3.1 Localization of P-element in E(var)45-19 by in situ hybridization to the 63A region 74 3.2 Cloning of genomic DNA flanking the P-element in E(var)45-19 by plasmid rescue 76 3.3 Structure of the nomad retrotransposon 79 3.3.1 Structure of the nomad L T R 79 3.3.2 tRNA primer binding site 83 3.3.3 5' leader region 83 3.3.4 gag, pol, and env genes 83 3.4 Analysis of nomad transcripts 90 3.5 Isolation of fusion cDNAs 92 3.6 Mobility of the nomad retrotransposon in different strains of Drosophila 94 3.7 Target site preference of the nomad retrotransposon 94 3.8 Phylogenetic relationship of nomad to other retrovirus-like elements 97 Chapter 4 The effect of the nomad element on chromatin structure and retroelement expression in D. melanogaster 102 Introduction 102 Results 103 4.1 nomad transcript abundance correlates with modification of PEV of wm4 in the mutant lines E(\ar)45-19 and Su(var)r27 103 4.2 Distribution of nomad elements on the left arm of the third chromosome in different strains of D. melanogaster 104 Conclusions 104 4.3 Models proposed to explain the effect of the nomad retroelement on PEV 104 Future considerations 114 References 116 v Index of Tables Chapter 2 Table I Purine concentration vs. lethality of ry flies 38 Table II Rates of excision and insertion for three inserts of the pUChsneory+ element, including raw data 40 Table HI Effect of the newly isolated E(var)s on penetrance of the Su-var(2)13^ mutation 43 Table IV Summary of preliminary genetic analysis of newly isolated E(var)s 44 Table V Rates of remobilization of the P-element in those E(var)s tested 48 Table VI Revertant lines and their associated phenotypes for the E(var)45-19 57 Table VII Effect of the mutation Su(var)r27 on alleles of white 61 Table Vffl Summary of phenotypes associated with the mutations E(var)45-19 and Su(var)r27 68 vi Index of Figures Chapter 1 Figure 1. PEV as an assay for changes in chromatin structure 8 Chapter 2 Figure 2. Genetic cross to establish the purine concentration required for purine selection of ry+ flies 20 Figure 3. Genetic crosses to mobilize X-chromosome inserts of the ry+ vector to determine mobilization frequencies (rates of excision and insertion) 22 Figure 4. Screen for P-element induced E(var)s 23 Figure 5.1. Genetic crosses establishing balanced stocks of second chromosome P-inserts 25 Figure 5.2. Genetic crosses establishing balanced stocks of third chromosome P-inserts 26 Figure 6.1. Genetic crosses for determination of co-segregation of the r y + P-element with the E(var) for second chromosome inserts 28 Figure 6.2. Genetic crosses for determination of co-segregation of the ry+ P-element with the E(var) for third chromosome inserts 29 Figure 7.1. Genetic crosses (balanced populations) to determine pleiotropic phenotypes of homozygotes (lethality and fertility) for second chromosome E(var)s 31 Figure 7.2. Genetic crosses (balanced populations) to determine pleiotropic phenotypes of homozygotes (lethality and fertility) for third chromosome E(var)s 32 Figure 8. Remobilization crosses for second chromosome inserts 34 Figure 9. Remobilization crosses for third chromosome inserts 35 Figure 10. Genetic crosses to 37 Figure 11. Purine selection data 38 Figure 12.1. Genetic complementation crosses between second chromosome pUC E(var)s 46 Figure 12.2. Genetic complementation crosses between third chromosome pUC E(var)s 47 Figure 13. Schematic diagram of variegating rearrangements bw^e^ and wm4 52 Figure 14. Genetic crosses to bw^e^ 53 Figure 15. Effect of Su(var)r27 mutation on the bwVDe2 rearrangement 54 Figure 16. Effect of the mutations E(var)45-19 and Su(var)r27 on the wm4 rearrangement 55 Figure 17. Schematic diagram of the w^l allele 59 Figure 18. Effect of nomad mutations on the \M rearrangement 60 Chapter 3 Figure 19. in situ localization of P-element to 63A region in E(var)45-19 75 Figure 20. Plasmid rescue schematic diagram for E(var)45-19 77 Figure 21. Genomic Southern blot demonstrating single copy of pUC in genome of E(var)45-19 78 Figure 22. Sequence of the complete nomad element 80 Figure 23. Schematic diagram of the nomad LTR 81 Figure 24. Schematic diagram of the P-insert locus in 63A 82 Figure 25. Diagram of tRNA binding site vs. that of related retrotransposons 84 Figure 26.1. Sequence alignment of the predicted Gag protein of the nomad retrotransposon vs. those of other retroelements 86 Figure 26.2. Sequence alignment of the predicted Pol protein of the nomad retrotransposon vs. those of other retroelements 87 vii Figure 26.3. Sequence alignment of the predicted Env protein of the nomad retrotransposon vs. those of other retroelements 88 Figure 27. Schematic diagram of retroelement structure comparisons 89 Figure 28. Schematic diagram illustrating the intron/exon boundaries in the nomad element transcripts 91 Figure 29. Fusion cDNAs isolated 93 Figure 30. In situ hybridization showing distribution of nomad in different strains 95 Figure 31. Diagram showing the target site preference of the nomad transposon 96 Figure 32. Phylogenetic tree I have proposed for the relationship between several retrotransposons 98 Chapter 5 Figure 33. Northern blot probed with P-rescue shows transcript abundance altered in mutant lines 105 Figure 34. In situ hybridization to polytene chromosomes showing distribution of nomad elements in OR-R and E(var)45-19 106 Figure 35. The model which I have proposed to explain the effects of nomad mutants on P E V and w^l 108 viii List of abbreviations A adenosine BDGP Berkeley Drosophila Genome Project BLAST Basic Local Alignment Search Tool bw brown (gene) C celcius D. Drosophila DNA deoxyribonucleic acid EDGP European Drosophila Genome Project env envelope (gene) E(var) enhancer of position effect variegation (gene) H . Howard In integrase kb kilobase pairs K P 0 4 potassium phosphate LCR locus control region LTR long terminal repeat Mb megabase pairs mdg midgut min minute mM millimolar MoMuLV Moloney murine leukemia virus mRNA messenger R N A NaOAc sodium acetate NaOH sodium hydroxide NCBI National Center for Biotechnology and Information nm nanometer nt nucleotide ORF open reading frame OR-R Oregon R PAUP phylogenetic analysis using parsimony pbs primer binding site PCR polymerase chain reaction PEV position effect variegation pol polymerase (gene) RNA ribonucleic acid RNase ribonuclease rst roughest (gene) RT reverse transcriptase ry rosy (gene) SSC sodium citrate (buffer) SDS sodium dodecyl sulfate Su(var) suppressor of position effect variegation (gene) TE tris-EDTA (buffer) tRNA transfer R N A UTP uridine triphosphate UV ultra violet w white (gene) Zn zinc IX Acknowledgments I would like to thank my supervisor, Tom Grigliatti, for his encouragement and support throughout the years over which this study was conducted. I would also like to thank him for allowing me the freedom to pursue those avenues which I found interesting. I would also like to thank my supervisory committee for their participation in this study and critical reviews of this thesis: Tom Beatty, Dave Holm, Linda Matsuuchi and George Spiegelman. A special thanks to Hugh Brock, who was always up for discussion and never willing to pull the punches that tempered my opinions. There have been a number of people in or around the lab who made the trial of graduate study enjoyable (most days). Thanks to Mike O'Grady, Erick James, Mike Harrington, Randy Mottus, Tom Milne and all the others who climbed aboard the same ship to explore those questions to which we may never know the answers. I would also like to acknowledge and thank Gunter Reuter whose acquaintance I had the pleasure of making and who supplied me the tools with which I conducted this study. On a personal note, I would like to thank Mom, Dad, Shannon, Sean, Corey and Chris who put this work into perspective. x Chapter 1 Chromosome structure in D. melanogaster 1.1 Euchromatin The primary order of chromatin condensation has been extensively studied in a number of organisms and is highly conserved across even vastly divergent species. The majority of D N A in the nucleus is compacted into subunits, each defined by a histone octamer around which 146 bp of D N A is wrapped (reviewed by Bradbury et al. 1981). These "core particles" are arranged along long stretches of D N A like "beads on a string" which were originally visualized by electron microscopy as a 10 nm fiber. Two of each of the highly conserved histone proteins H2A, H2B, in addition to the less highly conserved H3 and H4 form the histone octamer. The incorporation of histone HI at high salt concentrations in vitro leads to the formation of a 30 nm solenoid which is interpreted as supercoiling of the DNA/histone complex into a higher order structure. Despite the considerable condensation afforded by compacting of D N A into nucleosomes, it is still clearly inadequate to allow efficient organization of the complete genome in the nucleus. D N A must be further compacted into higher order structures in order to meet the size requirement defined by the nucleus. One of the primary obstacles to our understanding of chromatin organization is that the chromatin of interphase nuclei (when most transcription occurs) is so diffuse as to make visualization of the chromosome impossible. The chromosomes of most species are only visible by microscopy at metaphase- a time at which the majority of chromatin is highly condensed and transcriptionally inert. The organism D. melanogaster possesses polytene chromosomes in some tissues which are unique in that they are readily visualized by phase contrast microscopy throughout interphase. In addition to the other benefits that D. melanogaster affords researchers, this has led to the use of the fruit fly as a model organism for understanding the higher order structures of chromatin in higher organisms, including vertebrates. 1 The total genome size of D. melanogaster is 165 Mb, which is organized into four pairs of chromosomes. The chromosomes are divided into at least two distinct domains: euchromatin and heterochromatin. 120 Mb of the genome is contained within euchromatin. The euchromatic arms of D. melanogaster may be observed cytologically by examination of the polytene chromosomes of the larval salivary glands. Euchromatin appears banded in polytene chromosomes. These regions are highly replicated in polytene tissues and contain the vast majority of genetic loci. Local gene densities in "typical" euchromatic regions are variable. The 1.4 Mb of X-chromosomal euchromatin currently sequenced by the European Drosophila Genome Project (EDGP) is nearly twice as gene dense as the 2.8 Mb from the 34D-36A region of the second chromosome sequenced by the Berkeley Drosophila Genome Project (BDGP)(Rubin 1998). The bands of polytene chromosomes, or chromomeres, of D. melanogaster are thought to be the result of local differences in chromatin condensation. Despite the efforts of numerous researchers, the factors which determine the boundaries of chromomeres are still an enigma. While the factors responsible for establishing chromomeres remain a mystery, recent work has identified a number of D N A sequences that may be involved in the establishment of chromatin boundaries and in some cases protein components of the boundary elements have been identified. In vertebrates the Locus Control Region (LCR) of the fi-globin genes has been shown to act as an insulator. A number of proteins which interact with the L C R have been identified and are thought to be required for insulator function (Igarashi et al. 1998). Interestingly, the chicken L C R also has been shown to work as an insulator in Drosophila (Chung et al. 1993). This suggests functional conservation of LCR-binding insulator proteins in vastly divergent species. In Drosophila, a set of elements called ses and ses' elements flank one of the hsp70 loci in D. melanogaster (Udvardy et al. 1985) and appear to function like the L C R elements. When the ses and ses' elements are placed on either side of a transgene construct, they appear to insulate transgenes against chromosomal position effects (Kellum and Schedl 1991). The 2 BEAF-32 protein has been shown to interact with ses' sequences and is probably required for insulator function (Hart et al. 1997; Zhao et al. 1995). The gypsy retroelement also seems to be involved in the formation of transcriptional boundaries in D. melanogaster. This retrotransposon contains 12 copies of a DNA sequence motif known as the Su(Hw) binding site. This DNA motif forms a complex with the Su(Hw) and Mod(mdg4) proteins (Gerasimova et al. 1995; Smith and Corces 1992; Spana et al. 1988). Formation of this DNA/protein complex prevents communication between enhancer elements and transcriptional promoters when copies of the Su(Hw) binding site are inserted between them (Parkhurst and Corces 1986; Smith and Corces 1992). This complex has also been shown to insulate transgenes against chromosomal position effects (Roseman et al. 1993). The identification of a retrotransposon as a potential boundary element suggests that such mobile elements are an important, dynamic component of chromatin organization and reorganization. This will become a central issue in my thesis and final discussion. 1.2 Heterochromatin The heterochromatin is associated with the centromere on each of the four chromosomes of D. melanogaster and encompasses about 25% of the total genome (Spradling and Rubin 1981). Heterochromatin was first defined as the densely staining regions of D. melanogaster polytene chromosomes. These regions often remain condensed throughout much of interphase. Heterochromatin is itself heterogeneous. The heterochromatin at the base of the X-chromosome contains both regions that are highly replicated and regions that are under-replicated in polytene nuclei. Much of the undereplicated a-heterochromatin consists of simple sequence repeats, or "satellite DNA", so named because of differential migration from genomic DNA in density gradient centrifugation. A detailed structural analysis of the minichromosome Dpi 187 (derived from the X-chromosome of D. melanogaster) has 3 revealed that the a-heterochromatin which surrounds the centromere consists of large blocks of simple sequence repeats and a number of intact transposable elements (Le et al. 1995; Sun et al. 1997). Replicated, or ^-heterochromatin contains many middle repeated sequences including the tandem repeats of the rRNA genes in the proximal heterochromatin of the X-chromosome (Ritossa and Spiegelman 1965). While heterochromatin is not devoid of genes, few genetic loci appear to be located within heterochromatin (Hilliker 1976; Hilliker and Holm 1975; Marchant and Holm 1988). Among those heterochromatic genes which have been extensively characterized are light (Devlin et al. 1990) and rolled (Hilliker and Holm 1975) in the heterochromatin of the second chromosome and bobbed, the genetic locus for the rRNA genes in the heterochromatin of the X-chromosome (Ritossa and Spiegelman 1965). Transpositions of heterochromatic loci to euchromatic regions results in mutant phenotypes for those loci near to the rearrangement. Conversely, transpositions of euchromatic loci to heterochromatic regions results in mutant phenotypes resulting from transcriptional inactivation of these loci. These results suggest that the chromatin environment of euchromatic and heterochromatic loci differs and that chromatin structure is important for proper gene regulation. At least one well characterized locus, su(f) (Mitchelson et al. 1993) resides in the boundary between the euchromatin and heterochromatin of the X-chromosome. Transpositions of the su(f) locus to euchromatic regions display a wild-type phenotype indicating that its normal regulation is not dependent on its location at the boundary. However, sequences flanking the coding regions of the su(f) conceptual protein product may be involved in regulating its transcriptional competence when flanked by heterochromatin. 1.3 Retrotransposons as elements of chromatin structure 4 Retrovirus-like transposable elements have been identified in the genomes of every eukaryotic organism examined to date. The genome of Drosophila melanogaster contains more than 30 different classes of transposable elements, accounting for approximately 10% of the genome (Rubin 1983). Extensive studies have been done on the distribution of transposable elements in the genome of D.melanogaster. All retrotransposons tested to date, with the exception of jockey, have been shown to be present in both heterochromatin and euchromatin. In fact, 6-heterochromatin is characterized by a number of repetitive elements, including retrotransposons. Transpositions of mobile DNA sequences are a source of high spontaneous mutation rates (Green 1988) and genetic variation (Tchurikov et al. 1989). In addition to altering genome structure, retrotransposons have been shown to affect the transcription of nearby genes (Modollel et al. 1983; Tanda and Corces 1991; Wilanowski et al. 1995). These results suggest an important role for mobile genetic elements in generating genetic variation by creating novel patterns of expression for nearby genes. The insertion of mobile elements into or near genetic loci typically results in mutant phenotypes due to the disruption of local transcription. The mutant phenotype associated with the \M mutation is due to the insertion of a blood retrotransposon into an intron of the white gene. This prevents the efficient transcription of full-length white transcripts (Bingham and Chapman 1986). Screens for dominant modifiers of the w^l allele have led to the identification of a number of genetic loci which enhance the vM phenotype (Bhadra and Birchler 1996; Bhadra et al. 1997; Birchler et al. 1994; Csink et al. 1994; Frolov et al. 1998). Most of these modifiers have also been shown to affect the transcription of a number of unrelated wild-type genes, indicating that they play a more general role in regulating transcription. By contrast, the Lighten up (Lip) locus appears to modify the w^ phenotype by promoting transcription of the blood retrotransposon, decreasing the production of white transcripts which must proceed through the mobile element (Csink et al. 1994). Interestingly, Lip and several of the other enhancers of w& have also been 5 shown to be modifiers of position-effect variegation (PEV) (Bhadra et al. 1998; Bhadra and Birchler 1996; Bhadra et al. 1997; Birchler et al. 1994; Csink et al. 1994; Frolov et al. 1998). This suggests an overlap in the regulation of retroelement expression and chromatin structure. 1.4 Position-Effect Variegation as an assay for genes affecting chromatin structure 1.4.1 The phenomenon of PEV The phenomenon of position-effect variegation (PEV) was first described by Muller in 1930. Euchromatic genes exhibit variegated expression when chromosomal rearrangements place them next to a broken segment of heterochromatin (reviewed by Grigliatti 1992; Henikoff 1990; Spofford 1976). Analysis of revertant strains of variegating rearrangements demonstrated that the mutant phenotype is a result of placing the locus next to heterochromatin rather than somatic mutation or some other alteration. The rst^ allele is the result of an inversion of the X-chromosome which brings the euchromatic gene rst next to a breakpoint in heterochromatin (Gruneberg 1935). Ionizing radiation was used to induce revertants of rsfi (Kaufman 1942). Reversion of the variegation of the rst+ gene occurs when a further chromosomal rearrangement moves the rst gene away from the heterochromatic breakpoint. This implies that it is the position of the rst+ gene that results in its mosaic expression and that the phenotype is not due to mutation or somatic loss of the rst+ gene in variegating strains (Gruneberg 1937; Kaufman 1942). Recombination experiments performed by Judd (1955) proved that the variegating allele must be cis to the heterochromatic breakpoint. Several lines of evidence suggest that the mutant phenotypes of euchromatic loci involved in variegating rearrangements results from a spreading of the heterochromatic domain past the breakpoint. In the variegating strain wm^, the white+ gene is more proximal to a breakpoint in heterochromatin than is th.er.sr locus, rst variegation can be 6 induced by factors which modify PEV but is never seen in absence of white variegation . (Grigliatti 1992). This is interpreted as a "spreading" of the heterochromatic domain past the breakpoint, that must heterochromatinize loci in a polar fashion from the loci proximal to the breakpoint to loci more distal to the breakpoint. In variegating rearrangements such as wm4, factors which have been shown to modify PEV have been correlated with an effect on the spread of the heterochromatic domain, as seen in preparations of polytene chromosomes. Factors that suppress PEV (for example increased temperature during development) have also been shown to correlate with decreased numbers of nuclei that appear to have packaged the 3C band (the cytogenetic location of the white+ gene) as heterochromatin (Hartmann-Goldstein 1967). This variability correlates with the mosaic phenotypes of euchromatic loci, whose products are cell-autonomous, that are juxtaposed to a heterochromatic breakpoint, for example, the white gene of the X-chromosome (Baker 1968). In the variegating strain wm4, an inversion of the X-chromosome places the white+ gene next to the proximal heterochromatin. In nuclei where the packaging of heterochromatin proceeds beyond the breakpoint and into the white locus, a mutant phenotype is observed. In other nuclei the white+ gene remains euchromatic and these cells show a white+ phenotype (red). Once made, this decision to be euchromatic or heterochromatic is propagated in daughter cells giving rise to mutant white sectors on a wild-type red (white+) background (Figure 1). This decision and its propagation provides at least one example of cellular imprinting analogous to X-chromosome inactivation in mammals (Jeppesen and Turner 1993) and determination of the active states of the genes in the Bithorax Complex of D. melanogaster (Jeppesen and Turner 1993; Paro and Hogness 1991; Zink and Paro 1989). In variegating rearrangements, the normally euchromatic D N A shows variable banding in preparations of polytene chromosomes, even in nuclei from the same larva. Henikoff (1981) examined the banding patterns in polytene chromosomes for a strain that has a translocation of the third and Y-chromosomes in D. melanogaster [T(Y:3)]. This 7 euchrornatiri/heterochromatin eye junction m4 , w ;+ white+ m.4 c , , w ;iw( vary white+ Suppressors- prevent the spread of heterochromatic domain past the breakpoint wm^;E( var) white Enhancers- facilitate the spread of heterochromatin past the breakpoint, transcriptionally inactivating euchromat ic loci proximal to the breakpoint. Figure 1. Modifiers of position-effect variegation. 8 translocation places 87C (the cytogenetic location of hsp70) next to a breakpoint in the heterochromatin of the Y-chromosome. It was noted that in some nuclei the 87C band was not seen, although adjacent bands were clearly seen to extend from the Y-heterochromatin. In other nuclei, the 87C band was clearly visible. This is interpreted as a spreading of the heterochromatic domain past the breakpoint and into the flanking euchromatin of the third chromosome in some cells, while in other cells the heterochromatic domain does not spread past the breakpoint. It has been hypothesized that the spread of the heterochromatic domain into the flanking rearranged euchromatin results in the transcriptional inactivation of those normally euchromatic loci. Henikoff (1981) examined the formation of nascent transcripts at 87C (as mentioned, the site of hsp70) in a variegating rearrangement. Following heat-shock, salivary glands were incubated in [3H]uridine. Nascent RNA chains could be visualized as silver grains in autoradiographs, representing active transcription in polytene chromosome preparations. In nuclei where the 87C band was visible there was also noted a visible puff (indicative of the 87C band following heat-shock) and silver grains, indicating active transcription of the hsp70 locus. In nuclei where the 87C band was not visible, no puff or silver grains were noted (Henikoff 1981). These results suggest that heterochromatinization of the 87C band results in transcriptional inactivation of the genetic loci in this region. Modifiers of PEV have been characterized and appear to be involved in chromatin condensation and establishment of the chromatin domains following D N A replication. 1.4.2 Modifiers of Position-Effect Variegation Temperature is a classic modifier of PEV (Hartmann-Goldstein 1967; Michailidis et al. 1988). Rearing variegating strains at increased temperatures results in suppression of variegation while decreased temperatures enhance the variegated phenotype. This effect on variegation is thought to be due to a change in the developmental time (Michailidis et al. 1988). At low temperatures developmental time is prolonged, thereby affecting formation 9 of the raultimeric protein complexes that define the heterochromatic domains. High temperatures result in a decrease in developmental time thereby preventing variegation (transcriptional suppression) caused by assembly of the heterochromatic protein complexes. The amount of Y-chromatin is another modifier of PEV, with additional Y -chromosomes ( X Y Y males) suppressing variegation and lack of Y-chromosomes (XO males) enhancing variegation for affected loci (Dimitri and Pisano 1989; Spofford 1976). The Y-chromosome of D. melanogaster is largely heterochromatic. Presumably the protein complexes that compose the X , Y and autosomal heterochromatin overlap at least in part. This assumption allows us to speculate on the effect of the amount of Y-chromatin on PEV. The addition of the extra heterochromatic domain (i.e.: the Y-chromosome in X Y Y males) may titrate some of the multimeric heterochromatin specific complex responsible for its condensation from the variegating chromosome thereby decreasing the heterochromatinization of loci proximal to the breakpoint (Dimitri and Pisano 1989). Conversely, in X O males there are more heterochromatin forming complexes available, increasing the likelihood of the heterochromatic domain spreading past the breakpoint and into the flanking euchromatic reporter gene. Y-chromatin, like temperature, modifies PEV by increasing or decreasing chromatin condensation. n-Butyrate is another non-genetic modifier of PEV (Mottus et al. 1980). n-Butyrate has been shown to inhibit histone deacetylation (Candido et al. 1978). Acetylation of histones has been implicated in the control of gene regulation, possibly by facilitating nucleosome relaxation allowing transcription. Deacetylation of histone lysines has recently been demonstrated to be involved in transcriptional silencing in yeast (Braunstein et al. 1996). By inhibiting histone deacetylation n-butyrate inhibits chromatin condensation, suppressing PEV for the affected loci (Mottus et al. 1980). 1.4.3 Genetic loci which modify PEV 10 Removal of 50% of the structural genes for the core histones strongly suppresses PEV (Moore et al. 1979). The mechanism by which deletion of the histone coding region suppress PEV is unknown but it has been speculated that it is due to the different time of D N A replication in euchromatin and heterochromatin. Euchromatic D N A replicates earlier in the cell cycle than does heterochromatic DNA. As a result the histones may titrated by the euchromatic domain, thereby decreasing condensation of heterochromatin. Although perhaps as much as 50% of chromatin is composed of non-histone chromosomal proteins, little progress has been made in understanding how they contribute to chromatin structure or how they regulate chromatin condensation following D N A replication. Mutations in genes whose products are involved in chromatin condensation should modify PEV in variegating strains by affecting the spread of heterochromatin past the breakpoint and transcriptionally silencing affected loci in some cells (variegation). Many screens have used the variegating strain wm^ (an inversion of the X-chromosome of D, melanogaster that places the euchromatic white+ gene next to a breakpoint in the proximal heterochromatin) as a reporter for changes in chromatin structure (Locke et al. 1988; Sinclair et al. 1983; Sinclair et al. 1989; Wustmann et al. 1989). Ionizing irradiation was used to isolate deficiencies and duplications of loci that modified PEV (Wustmann et al. 1989). Analysis of these modifier loci has revealed an interesting relationship between at least two classes of modifier loci. Analysis of segmental duplications and deletions of the autosomes demonstrated that some regions suppress PEV when haploid (deficiencies) and enhance PEV when triploid (duplications). Other regions have the opposite effect. These regions display enhancement of PEV when haploid and suppression of PEV when triploid. Estimates of the number of loci that modify PEV in a dose-dependent manner may be as high as 20-30 for the entire autosome complement (Locke et al. 1988). Locke et al. (1988) proposed a model to explain the mechanism by which these loci modify PEV. He termed Class I modifiers those that display dominant suppression of PEV 1 1 (Su(var)) when haploid and enhancement of PEV when triploid. In this model, Class I modifiers are those whose gene products encode structural proteins for heterochromatin formation or factors involved in chromatin condensation. Deficiencies for these loci decrease the amount of this component of the heterochromatic domain, thereby decreasing the heterochromatinization of loci near heterochromatic breakpoints. Duplications for these same loci supply more of this heterochromatin forming factor, allowing the spread of the heterochromatic domain past the breakpoint. Those loci which he termed Class II modifiers are those loci that enhance PEV (E(var)) when haploid and suppress PEV when triploid. The gene products of these loci should be involved in chromatin decondensation and gene regulation, as well as determination of the transcriptional competence of the chromatin domain affected. At least four modifiers of the Class I type have been cloned and their role in PEV modification characterized. Su(var)205 encodes HP-1, a heterochromatin specific protein (Eissenberg et al. 1990). Deficiencies and point mutations for this locus show dominant suppression of PEV (Sinclair et al. 1983), presumably because its protein product is a limiting factor in heterochromatin formation. Analysis of the protein sequence has revealed a region of homology between HP-1 and another protein product of a gene involved in gene repression, Polycomb (Paro and Hogness 1991). The Polycomb (Pc) locus has been shown to regulate genes in the Bithorax Complex of D. melanogaster (Lewis 1978; Zink and Paro 1989). The Bithorax Complex (BX-C) is involved in determination of segments in Drosophila pattern formation. The product of the Pc locus represses expression of genes in the B X - C by forming an oligomeric repression complex. The similarity exhibited in the protein products of two loci involved in determination of the transcriptional competence of genes whose chromatin domains they affect has implications for models of determination. The connection between Su(var)s and genes involved in the determination of the transcriptional states of the homeotic genes is not limited to Su(var)205 and Pc. Su(var)3-9 encodes a protein containing both the chromodomain, common to Su(var)205 and Pc 12 protein products, and the SET domain which is shared by the trx protein product (Tschiersch et al. 1994). Enhancer of Poly comb (E(Pc)) has also been shown to be a suppressor of PEV (Sinclair et al. 1998). In addition to their role in modification of chromatin condensation, such modifiers may be involved in establishment and maintenance of chromatin domains following D N A replication-a necessary prelude to gene expression. The protein product of Su(var)3-7 is thought to be a heterochromatin specific zinc-finger protein (Reuter et al. 1990). Based on the identification of this well characterized DNA-binding motif, Reuter et al. (1990) proposed that the protein could be involved in maintaining higher order chromosomal structure by making contacts with heterochromatin at points through the zinc-fingers. Between each histidine pair there was also identified a potential phosphorylation site, in addition to several other potential phosphorylation sites. Based on this, the authors postulated that phosphorylation of the Su(var)3-7 product could regulate its binding to heterochromatin (Reuter et al. 1990). This provides us with the possibility that phosphatases and kinases could act as epistatic regulators of chromatin condensation. In fact a suppressor of PEV, Su(var)3-6, has been shown to encode a protein phosphatase I catalytic subunit (Baksa et al. 1993). In addition to their effect on PEV, Su(var)3-6 mutants display defects in mitosis (Baksa et al. 1993). Work on the suppressors of PEV has provided some insight into the mechanisms of chromatin condensation and transcriptional regulation. A number of E(var)s have also been cloned and seem to be even more heterogeneous than the Su(var)s. While the protein products of Su(var)s appear to be involved in the formation of repressive chromatin, the E(var)s generally seem to be involved in transcriptional activation. Mutations in the E2F transcriptional activator and cell cycle regulator have been shown to enhance PEV (Seum et al. 1996). It has long been known that acetylation of histones is associated with transcriptionally active chromatin. It is therefore not surprising that mutations in the gene which encodes the RPD3 histone deacetylase also enhance PEV (De Rubertis et al. 1996). 1 3 As with the Su(var)s, there are a number of similarities between E(var)s and genes involved in regulation of the homeotic complexes. Mutations in Trl ,which encodes the G A G A transcriptional activator, are enhancers of PEV (Farkas et al. 1994). Asx has also been shown to be an enhancer of PEV in addition to its role in segmental determination (Sinclair et al. 1998). E(var)3-93D (or mod(mdg4)) has been shown to encode a protein which contains a BTB domain and which associates with several hundred sites on the euchromatic arms of polytene chromosomes (Dorn et al. 1993). The Mod(mdg4) protein has been shown to be involved in the formation of the gypsy insulator element (section 1.1). Aside from their effect on PEV, mutations in E(var)3-93D appear to affect the transcriptional state of homeotic genes (Dorn et al. 1993). It is clear from the genetic and molecular analysis of the E(var)s that regulation of chromatin structure in D. melanogaster is a complex, multigenic process. The further isolation of these mutants and molecular characterization of their protein products should provide insight into the processes of chromatin assembly, specifically the establishment of chromatin domains. 1.5 Overview of Chapters 2 to 4 Given the proposed roles of E(var)s in modification of chromatin structure and establishment of chromatin domain boundaries (Grigliatti 1992; Locke et al. 1988), I attempted to clone a novel E(var) and genetically characterize its effect on PEV as the subject of my thesis. In the following chapters I describe in detail the methods employed to achieve this goal. Chapter 2, describes a screen for P-element induced enhancers of wm4 variegation. It also explains how I demonstrated that at least two of the E(vars) mutations isolated in this screen were likely induced by insertion of a P-element. As my goal was to clone and characterize only one E(var), I made a decision at this point to focus on one of these, which I refer to as E(var)45-19. The last sections of chapter 2 focus on the further genetic characterization of E(var)45-19 and alleles which I induced by remobilization of the P-element insert in the 1 4 E(var)45-19 line. The results of the work described in chapter 2 led me to conclude that I had isolated a enhancer of PEV on the third chromosome of D. melanogaster that was induced by the insertion of a P-element construct. In chapter 3,1 describe the methods employed to clone the genomic D N A flanking the P-element insert in E(var)45-19.1 localized the P-element insert in E(var)45-19 to the 63 A region of the third chromosome by in situ hybridization to polytene chromosomes. I show in this chapter that the P-element in E(var)45-19 is inserted into the 3' LTR of a novel retrotransposon which I have named nomad. The main body of chapter 3 focuses on the structure of the nomad retrotransposon and its comparison to a number of other cloned retrotransposons. In Chapter 3 I also describe the phylogenetic analysis I conducted for nomad and suggest that it is a close relative of the gypsy retrotransposon in D. melanogaster. I also discuss in this chapter the phylogenetic relationship between LTR-containing retrotransposons in Drosophila and the retroviruses into which they appear to have evolved. In the final chapter I have presented speculative models to explain the effect of the nomad element on chromatin structure. I will examine the possible roles of nomad in regulating chromatin structure in light of current models of chromatin regulation and dynamics. In conclusion I present a number of unanswered questions about the role of nomad in modification of chromatin structure and propose future experiments to address these. 15 Chapter 2 Isolation and genetic characterization of dominant enhancers of P E V Introduction Work done by a number of labs over the last twenty years has led to a fairly clear understanding of the primary order of chromatin condensation. However, relatively little is known about the organization of D N A in the nucleus into structures of an order higher than the 10 nm fiber. The phenomenon of position-effect variegation has been used successfully to identify genes which encode protein products that appear to be involved in estabhshing and/or maintaining chromatin structure. Position-effect variegation (PEV) occurs when chromosomal rearrangements place euchromatic genes next to breakpoints in heterochromatin. Transcriptional inactivation of the euchromatic gene is thought to occur in cells where the euchromatin is packaged as heterochromatin due to a spreading of the heterochromatic elements past the breakpoint into the flanking rearranged region (reviewed by Grigliatti 1992; Henikoff 1990; Spofford 1976). The variegating strain wm^ is characterized by an inversion of the X-chromosome which brings the euchromatic white gene close to a breakpoint in the proximal heterochromatin (Baker 1968). Transcriptional inactivation of the white gene occurs when it is packaged as heterochromatin. The white gene in this rearrangement may be thought of as a reporter gene for changes in chromatin structure. Screens for modifiers of wm^ variegation have revealed two different classes of loci, those which suppress and those which enhance PEV. Several suppressors of PEV (Su(var)s) have been cloned and seem to encode factors involved in chromatin condensation (Baksa et al. 1993; Eissenberg et al. 1990; Reuter et al. 1990; Seum et al. 1996; Sinclair et al. 1998; Tschiersch et al. 1994). Genetic analysis of enhancers of PEV suggested that these loci would be found to encode proteins involved in the formation and/or maintenance of euchromatin (Locke et al. 1988; Wustmann et al. 1989). To date at 1 6 least five E(var)s have been cloned and seem to encode proteins which are generally involved in transcriptional activation, rather than the establishment of chromatin structure per se (De Rubertis et al. 1996; Dorn et al. 1993; Farkas et al. 1994; Seum et al. 1996; Sinclair et al. 1998). Identification of the protein products of those E(var)s that are not yet cloned should provide insight into the regulation of higher order chromatin structure in Drosophila. A similar situation exists for second-site modifiers of retroelement-induced alleles. Screens for trans-acting modifiers of the white locus have led to the identification of a number of loci which modify the penetrance of mutant phenotypes associated with retroelement-induced alleles (Bhadra and Birchler 1996; Bhadra et al. 1997; Birchler et al. 1994; Csink et al. 1994; Frolov et al. 1998). These loci have been isolated based on their ability to modify either the whiteaPr^cot (wa) or whitebl°°d (w^) mutant alleles. The wa and wbl alleles are associated with insertions of the copia and blood retroelements respectively (Bingham and Judd 1981; Zachar and Bingham 1982). In addition to modifying the phenotype of these retroelement-induced alleles, most of these loci have also been shown to affect the transcription of a number of other genetic loci (Bhadra et al. 1998; Bhadra and Birchler 1996; Bhadra et al. 1997; Birchler et al. 1994; Frolov et al. 1998). These results suggest that these mutations, which were isolated based on their effect on retroelement-induced alleles, are factors which have general roles in transcriptional activation. This supports the notion that retroelements utilize host factors for transcription. The mechanism by which modifiers of retroelement-induced alleles affect the mutant white phenotypes is unknown. However, an important clue comes from the analysis of white transcripts produced by the wa allele. The insertion of a copia insert into the transcribed region of the white structural gene in this allele results in the production of a number of transcripts which are fusions of the copia and white transcripts (Birchler et al. 1994). This inhibits the production of full-length white+ transcripts, resulting in a mutant white phenotype. The mutations Lighten up (Lip) and Weakener of white (Wow) were both 1 7 isolated following screens for modifiers of retroelement-induced alleles of white and affect the phenotype of the wa allele (Birchler et al. 1994; Csink et al. 1994). Both of these mutations were shown to affect both the steady state level of copia transcripts and the relative levels of copia/white fusion transcripts produced by the wa allele (Birchler et al. 1994; Csink et al. 1994). These results suggest that at least part of the effect of Lip and Wow on retroelement-induced alleles of white is due to an effect on retroelement expression. In addition to modifying the penetrance of retroelement-induced alleles, several of the mutations isolated following these screens have been shown to modify PEV. The identification of modifier loci which affect both retroelement-induced alleles and PEV indicate some overlap in the mechanisms that regulate retroelement expression and chromosome structure. P-element mediated mutagenesis is a useful way to induce readily cloned mutations in D. melanogaster, provided the mutation is due to an insert of the P-element into or near a gene. A screen for P-induced E(var)s was undertaken and several new mutations affecting PEV were isolated. Some of these were tested for their ability to revert the mutation by remobilization of the P insert. One of them, E(var)45-19, reverted following P-element remobilization, indicating that it was a P-induced mutant. Alleles of the E(var)45-19 locus were induced by remobilizing the P-element in the original mutant. Individual flies containing chromosomes that lacked the P-element but retained the ability to modify PEV were recovered. These may represent new mutations resulting from imprecise excisions of the P-element. One of them, designated Su(var)r27, was shown to be both a dominant maternal-effect suppressor of PEV of the wm^ variegating rearrangement and a female-specific suppressor of the bw^e^ variegating allele. In addition, Su(var)r27 was shown to be an enhancer of the retroelement-induced allele w^, suggesting that this locus is involved in the regulation of retroelement expression as well as chromatin structure in D. melanogaster. 1 8 Materials and Methods Drosophila stocks Descriptions of all mutations and special chromosomes used in this study can be found in Lindsley and Zimm (1992) or, where appropriate, in the text below. Drosophila stocks were maintained at 25 °C on standard medium containing cornmeal, sucrose, dextrose, yeast, agar and Tegosept (Sigma) fungicide to inhibit mold. Unless otherwise stated, the results of crosses were based on at least 200 F i progeny scored. Establishment of conditions for ry+ selection The pUChsneory+ transposon contains the entire coding region for the rosy+ (ry+) gene. Flies which lack a functional ry+ gene die on media supplemented with purine (Chovnick et al. 1971; Finnerty et al. 1970). To determine the concentration of purine required to select for ry+ gene function conferred by the pUChsneory"1" vector, females which lack ry+ function were mated to males carrying a single X-chromosomal copy of the element and allowed to lay eggs for 3-4 days at 22°C (Figure 2). The bottles were then cleared and the media supplemented with 1.5 ml of purine solutions of concentrations varying from 0-0.11%. The flies were raised at 22°C and F i adults scored phenotypically for ry+ 2-3 days post-eclosion. The Fi males from this cross did not receive the ry+ X-chromosomal insert from their fathers and therefore lacked ry+ function. The F i females all receive the X(pUChsneory+) chromosome from their fathers and should therefore be able to metabolize purine at moderate levels. Rates of mobility for the pUChsneory+ P-element The ability of the pUChsneory+ element to mobilize upon the introduction of a source of transposase was determined under dysgenic conditions. Females homozygous 1 9 + . ^ y 5 0 6 X(pUChsneory +) . + . ry506 + ry506 Y + ry506 1 eggs laid 3-4 days, adults cleared, and media supplemented with 1.5 mis of 0-0.11% purine, 1.0% sucrose solution X(pUChsneory +) + ryr>06 ry+ gene function confers ability to metabolize purine X + ry506 ^06 ry mutants unable to X . * metabolize purine and die Y ' + ' 506" o n supplemented media Figure 2. Selection for wild-type rosy gene function by supplementing media with purine solution. 2 0 for an X-chromosomal insert of the pUChsneory4" transposon were crossed en masse to males heterozygous for the A2-3Sb chromosome, a stable source of transposase. The F i dysgenic males from this cross mobilized the modified P-element in their germ-line (Figure 3). Single F i dysgenic males were then crossed to five ry mutant females. As the F 2 male progeny from the dysgenic male outcross received their X-chromosome from their mothers, the F 2 Sb+ry+ males represented males which received an autosomal insert of the pUChsneory4" element (Figure 3). The female progeny in the F 2 should have received the pUChsneory4" element on the X-chromosome from their F i fathers unless the ry+ element excised from the X-chromosome. Therefore, those F 2 females that were Sb+ry represented remobilizations of the X-chromosome inserts of the pUChsneory4" element (Figure 3). Screen for P-element induced E(var)s Mutations in genes affecting PEV in the variegating strain wm4 were induced using dysgenic males carrying the pUChsneory4" P-element vector inserted on the X -chromosome. This single element was mobilized in the germ-line of dysgenic males which were generated by crossing females homozygous for the pUChsneory4" insert en masse to males heterozygous for the A2-3Sb chromosome-a potent source of transposase. F i male progeny carrying the Stubble (Sb) marker, indicating heterozygosity for the stable transposase construct, mobilized the X-linked pUChsneory4" transposon in their germline (Figure 4). Bottle crosses were established between ten F i dysgenic males and twenty-five wm4:Sco Su-var (2)1301/Cy Su-var(2)ln;ry506 females. Females were allowed to lay eggs for 3-4 days and then transferred to fresh bottles. This was repeated three times for each bottle before the F i progeny were discarded. A total of 1300 bottle crosses were established each of which was turned three times. Based on a conservative estimate of 300 progeny derived from each of the bottle crosses, this represent a total of (1300 bottle crosses)x(300 progeny per bottle)x(4 turns per bottle)=1.56 million total F 2 progeny 2 1 X(pUChsneory+) + . ry506 X + A2-3 Sb ry+ M M H ^ M ^ ^ ^ ^ ^ ^ ^ ^ ^ M ^ ^ M , , ^ ^^^^^ X m—m ' ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ Y + ^06 X(pUChsneory+) + ry506 X X Sp CyO ' ry506 ry506 x X(pUChsneory+) . + A2-3 Sb ry + 5 ? + Sb+ F 2 ry+ males X Y X pUChsneory + + ry 506 Sp or Cyo ,506 + ry506 ry-pUChsneory4" Sp or Cyo ry 506 New autosomal inserts of pUChsneory4" ry females X(ry revertant) X Sp or Cyo ry*®6 Excisions of ry506 pUChsneory4" ry4" females ry males X(pUChsneory+) + ry506 X Sp or Cyo ry>{ 06 X + ry5" Sp or Cyo ry-'1 06" Classes expected if pUChsneory4" is not mobilized Figure 3. Mobilization of X-chromosome inserts of the pUChsneory4" element. The F 2 of dysgenic males was scored for presence of the ry4" phenotype associated with pUChsneory4" element. The results of this were used to determine the rate of mobilization of this P-element (Table II). 2 2 G 0 X(pUChsneory+) + ry506 X + A2-3 Sb ry+ X(pUChsneory +)' + ' ry506 Y ' + ' ^06 F l w m 4 ScoSu-var(2)1301 ry506 „ X(pUChsneory+). + .42-3 5fc ry+ ' CySu-var(2)ln . Y ' + ' ry™ 0.08% Purine selection for ry+ transformants F 2 Males recovered: • S c o Su-v^)!^ ryS06 Y ' + ' ^06 wm4 CySu-var(2)ln ry506 Y ' + ; ^06 Figure 4. Screen for P-induced E(var)s using the pUChsneory4" rescue vector. Sfr+males recovered in the F 2 represent new autosomal inserts of the ry4" P-element which have survived purine selection. Their wild-type rosy gene activity allows metabolism of purine supplemented medium which kills ry flies. 2 3 derived from the dysgenic crosses. New inserts of the transposon into the autosomes were selected in the male progeny of dysgenic males by supplementing the media with 0.08% purine solution. The only Sb+ F 7 male progeny recovered were those that had received the pUChsneory+ transposon by mobilization to an autosome in the germ-line of their dysgenic fathers. The F 2 male progeny that represented new inserts (ry + ) also carried one of two dominant suppressors of PEV and the wm^ rearrangement in the background which they received from their F i mothers (Figure 4). These F 2 males were examined for the degree of variegation of the wm^ chromosome. Those males that showed an E(var) phenotype (white or mottled eyes) should indicate mutations in loci affecting PEV that revert the Su(var) phenotype (red eyes). The second chromosome P-inserts were balanced by crossing them to a CyO/Sp;ry506 stock (Figure 5.1). F i males and females with Curly wings were intercrossed, generating stocks which were mixed wm^/+ populations. Isogenic wm^ stocks were generated from mixed stocks by selecting and crossing males and females from the population which had white eyes. The third chromosome P-inserts were balanced by crossing them to a +;Df(3L)C7ry/TM3SbryRK stock (Figure 5.2). F i males and females with Sb bristles were intercrossed, generating stocks which were mixed wm^/+ populations. Isogenic wm^ stocks were generated from mixed stocks by selecting and intercrossing males and females from the population which had white eyes. Tests for co-segregation of the new E(var) mutation and the ry+ P-insert To determine whether the new E(var)s were associated with a P-element, the balanced ry+ P-insert stocks were tested for co-segregation of the E(var) phenotype with the ry+ P-element. This was done by crossing males from the balanced ry+ P-insert stocks to females from the same wm4;Sco,Su(var)2-1301/Cy,Su(var)2-ln;ry506 stock used in the screen (Figure 4, F 2 ) to isolate dominant E(var)s. The F i of these crosses was scored to determine if the ry+ phenotype associated with the new P-insert and the E(var) 2 4 GO _X_ X CyO Sp ry-506 ry 506 X Efvarjry4' m4 o r Y CyO w m 4 E(var)ry+ ry 506 ry 506 ry 506 506 Sco or Cy Su-var ry-male and female progeny which showed CyOry+ phenotype were intercrossed to generate balanced stocks of the second chromosome inserts Figure 5.1. Establishment of stocks of second chromosome P-element inserts. Go males were those exceptional males isolated in the screen for P-induced E(var)s. These males were crossed to females which carry the second chromosome balancer CyO. 2 5 X X F l + Df(3L)C7ry + 'TMSSbryRK X wm4 or Y + + w m4 Sco or Cy Su-var E(var)ry+ TM3SbryRK E(var)ry+ ry506 male and female progeny which showed Sbry + phenotype were intercrossed to generate balanced stocks of the third chromosome inserts Figure 5.2. Establishment of stocks of third chromosome P-element inserts. Go males were those exceptional males isolated in the screen for P-induced E(var)s. These males were crossed to females which carry the third chromosome balancer TM3. 26 phenotype co-segregated from the dominantly marked balancer chromosome as shown in Figure 6.1 for second chromosome inserts and Figure 6.2 for third chromosome inserts. At least 150 Fi flies were scored for each cross. Analysis of effects of E(var)s on eye color phenotypes The effect of the newly isolated E(var)s on eye color phenotypes was estimated by side-by-side comparison of the E(var)/+ males to their Balancer/+ male siblings. Such comparisons are an effective method of determining differences in eye color between genotypes without performing pigment assays which are commonly used to measure the degree of white+ reporter expression (Sass and Henikoff 1998). In cases where there was no phenotypic overlap between genotypes, the effect could be stated unequivocally. In order to quantify the difference in wm4 variegation between genotypes, three phenotypic classes were established. Those flies which displayed 0-30% pigment were assigned a phenotypic value of one (Class 1). Similarly, those flies which displayed 31-60% and 61-100% pigment were assigned values of two and three respectively (Classes 2 and 3). The number of flies in each class, derived from the crosses shown in Figures 6.1 and 6.2, were scored and this number was multiplied by the value which the class had been assigned. The sum of these values for each genotype was divided by the total number of flies of that genotype. The number derived from this calculation indicates the mean phenotypic value for that genotype. Example: [nj(l)+n2(2)+ri3(3)]/N «;=number of flies in Class 1 «2=number of flies in Class 2 ft3=number of flies in Class 3 A=total number of flies of that genotype Sample calculation: for the mutation E(var)5c-22 in Su-var(2)13^i genetic background (as shown in Figures 6.1 and 6.2). [38(l)+150(2)+15(3)]/(38+150+15)=1.89 2 7 wm4 Sco Su-var(2)1301 ry506 v wm4 E(var)ry+t ry506 wm4 c y Su-var(2)lU ' ry506 Y ' CyO ry 506 w m4 t E(var)ry^ ry 506 w m 4 Q r Y ScoSu-var(2)13 For positive retest: Enhanced 01 ry 506 m.4 CyO ry-506 Suppressed w m 4 o r Y ScoSu-var(2)1301 ' ry506 Figure 6.1. Determination of co-segregation of r y + P-element with the E(var) phenotype. Males from stocks balanced for r y + (Figure 5.1) were crossed to females which carried both the wm4 rearrangement and the dominant Su-var(2)13®l. Comparison of the Sco,CyO F i with Sco F i progeny reveals whether or not the r y + and E(var) phenotypes both segregate with the second chromosome. 2 8 $ $ 0*0* G 0 wm4 Sco Su-var(2)1301 .ry506 v wm4 + £(var)ry+ wm4 'CySu-var(2)ln ' ry506 Y ' + ' TM3SbryRK Fi wm4 Sco Su-var(2)1301 . E(var)ry+ w m 4 Q r Y + ' ry506 y For positive retest: Enhanced w m 4 Sco Su-var(2)1301 TM3SbryRK Suppressed wm4 or Y + 1 ry^o-Figure 6.2. Determination of co-segregation of ry+ P-element with the E(var) phenotype. Males from stocks balanced for r y + (Figure 5.2) were crossed to females which carried both the wm4 rearrangement and the dominant Su-var(2)1301. Comparison of the Sco, SbV\ with Sco F i progeny reveals whether or not the ry+ and E(var) phenotypes both segregate with the third chromosome. 29 The phenotypic value of 1.89 which was assigned to E(var)5c-22 indicates that most of the flies which carry this mutation, in addition to the mutation Su-var (2)1301, were classified as either Class 1 or Class 2. Recessive lethality and complementation tests The subset of second chromosome E(var)& which were recessive lethal was determined by crossing E(var)/CyO females to their E(var)/CyO siblings as shown in Figure 7.1. Recessive lethality was indicated by the absence of CyO+ progeny in the F i of this cross. The subset of third chromosome E(var)s which were recessive lethal was determined by crossing E(var)/TM3SbryRK females to their E(var)/TM3SbryRK siblings as shown in Figure 7.2. Recessive lethality was indicated by the absence of Sb+ progeny in the Fi of this cross. At least 150 F i flies were scored for both the second and third chromosome mutants. Genetic complementation among the new recessive lethal E(var)s isolated was determined by crossing two mutant strains, each of which were heterozygous for a dominantly marked balancer chromosome (CyO for second chromosome mutants and TM3Ser for third chromosome mutants). Failure to complement for the second chromosome mutations was indicated by the absence of CyO+ progeny in a minimum of 150 flies scored. Failure to complement for the third chromosome mutations was indicated by the absence of Ser+ progeny in a minimum of 150 flies scored. In those cases where two mutations complemented for recessive lethality (CyO+ for second chromosome mutants and Ser+ for third chromosome mutants), the transheterozygotes were examined for visible phenotypes and tested for fertility. Fertility tests Fertility tests were performed at 22°C and 25°C. The fertility of males was determined by crossing 5 test males to 25 virgin +/+ (Oregon R) control females. The 3 0 ¥9 G 0 wm4 E(var)ry+ r y 5 0 6 ,m4 ' CyO wm4 E(var)ry+ ry 506 ry 506 Ratio expected: F l w m4 t E(var)ry+ ry 506 wm4 o r Y ' E(var)ry+ ' ry506 wm4 E(var)ry+ ry506 m 4 or Y CyO ry 506 506 CyO ry-Absence of this class indicates a recessive lethal mutation. Males and females of this class which did survive were tested for fertility. Figure 7.1. Determination of pleiotropic phenotypes associated with second chromosome E(var)s. Females heterozygous for the E(var) were crossed to their sibling brothers of the same genotype. Absence of homozygotes in the F i was taken as an indication that the E(var) chromosome also bears a recessive lethal mutation. Those E(var)s that did survive as homozygotes were examined for any obvious defects and tested for fertility. 3 1 ?9 G 0 m.4 m.4 + + E(var)ry+ TM3SbryRK Ratio expected: w m4 w m.4 o r Y m.4 w m4 o r Y + + + + E(var)ry TM3SbryRK t E(var)ry+ 'E(var)ry+ E(var)ry+ ,TM3SbryRK Absence of this class indicates a recessive lethal mutation. Males and females of this class which did survive were tested for fertility. Figure 7.2. Determination of pleiotropic phenotypes associated with third chromosome E(var)s. Females heterozygous for the E(var) were crossed to their sibling brothers of the same genotype. Absence of homozygotes in the F i was taken as an indication that the E(var) chromosome also bears a recessive lethal mutation. Those E(var)s that did survive as homozygotes were examined for any obvious defects and tested for fertility. 3 2 fertility of females was determined by crossing 5 test females to 5 Oregon R males and/or their siblings. Cultures were examined 2-3 days later to determine if 1 s t instar larvae were present. Those cultures which had larvae present were cleared of adults after 10 days and were then observed to determine if viable progeny eclosed as adults. At least 50 flies of each test class were tested for male and female fertility. Reversion analysis The second chromosome P-element inserts were remobilized by crossing P-insert males to females heterozygous for the A2-3Sb chromosome-a potent source of transposase. The F i dysgenic males were collected and outcrossed to females lacking ry+ function and the F2 scored for ry mutant progeny, which would represent excisions of the ry+ element (Figure 8). Balanced lines were generated from single CyO ry F 2 males by crossing them to a wm4;CyO/Sp;+ stock. The third chromosome P-element inserts were remobilized in dysgenic males by crossing E(var) males to females heterozygous for the A2-3Sb transposase source. The Fi dysgenic males from this cross were collected and outcrossed to females lacking ry+ gene function. The Sb ry progeny from this final cross represent excisions of the ry+ element (Figure 9). Balanced lines were generated from single Sb ry F2 males by crossing them to a wm4;+;Ly/TM3Ser stock. Rates of mobilization for both the second and third chromosome inserts were estimated by dividing the number of ry+ revertants by the total number of F2 progeny in which reversion could have been detected (Table V). Maternal effect crosses In order to determine the pattern of inheritance of Su(var)r27, females of the genotype wm4;+;Su(var)r27/TM3Ser were outcrossed to wm4 males. The F i was scored for modification of PEV of the wm4 chromosome and then allowed to mate inter se. The 3 3 06 G0 X • S p • A 2 - 3 S b x X . E(var)ry+ ry5, X ' CyO ' TMf5 Y ' CyO ' W p t X . + , ^ y 5 0 6 x _ X _ . E(var) ry+ . z!2-3 Sb X 'CyO ' ^506 Y ' Sp ' ,y506 I F 2 X (ry+revertant) r y ^ X o r Y ' CyO ' r y 5 0 6 Figure 8. Scheme used to remobilize the pUChsneory"1" P-element for second chromosome inserts. The ry+ P-element was mobilized in the germ-line of dysgenic F i males and the F 2 scored for the presence of ry flies which represent those in which the pUChsneory+has been mobilized. 34 G 0 X _ + A2-3Sb wm4 + . E(var)ryH X + ry5' 0f5 . Y + TM3 F i X + TM3SbryRK X • + . fffvar) r y + ^ . 1 ; iy— > ~ , Dysgenic males X + Y + A2.3Sb X + (ry + revertant) X or Y + TM3 Sb r y 7 ^ Figure 9. Scheme used to remobilize the pUChsneory+ P-element for third chromosome inserts. The ry+ P-elementwas mobilized in the germ-line of dysgenic F i males and the F2 scored for the presence of ry flies which represent those in which the pUChsneory+has been mobilized. 3 5 reciprocal outcross was also set up-wm4;+;Su(var)r27/TM3Ser males crossed to wm4 females, Fi scored for modification of PEV of wm4 and then allowed to mate inter se. The F2 of both of the crosses were scored for modification of PEV of wm4. Results were based on at least 200 Fi and F2 progeny scored for each of the crosses. Confirmation of the results obtained from the Fi intercrosses was obtained by crossing the wm4;+;Su(var)r27/+ (Ser+) F\ females from each of the reciprocal crosses to wm4;+; + males. At least 200 F2 progeny from each of these crosses were scored for the effect on wm4 variegation. Crosses to white alleles The effect of the mutants E(var)45-19 and Su(var)r27 on the mutant phenotypes associated with several alleles of the white gene was determined as follows. Five females homozygous for one of the white alleles whitebl°°d (V^)(Bingham and Chapman 1986; Zachar and Bingham 1982), whiteaPricot fw«XBingham and Judd 1981; Gehring and Paro 1980), and whiteivory (V'XCollins and Rubin 1982; Karess and Rubin 1982) were crossed to E(var)45-19/TM3Ser and Su(var)r27/TM3Ser males (as illustrated for w^l in Figure 10). A l l the F\ males from this cross carried the mutant white alleles on the X-chromosome which they received from their mothers. The effect of E(var)45-19 or Su(var)r27 on the phenotype associated with the white allele was determined by side-by-side comparison of the color of the eyes of Ser+ (mutant chromosome) Fi males to their Ser (balancer chromosome) brothers. At least 100 members of each class were examined. Results 2.1 A method of selection for P-element transposition events using purine selection Supplementing Drosophila media with low concentrations of purine (0.01-0.07% w/vol.) allowed the survival of a few of the Fi males which lack ry+ function (Table I, 3 6 G 0 bl bl 9? + + + 0*0* w m4 + + Su(var)r27 TM3Ser bl Y bl + + Su(var)r27 + TM3Ser Result: Enhanced wild-type Figure 10. Genetic crosses to w^l. The effect of Su(var)r27 on the retrotransposon-induced allele was determined by crosses between stocks bearing these mutations. F i Ser males were compared to their sibling brothers to assess the effect of Su(var)r27 on the w^l phenotype (See Figure 18). 3 7 Table I Establishment of purine concentration for ry+ selection purine concentration survival of r y + females survival of ry males (%w/vol) (%) (%) 0 100 100 0.01 100 100 0.02 94.4 91.9 0.03 109.3 25.6 0.04 103.5 0.2 0.05 97.8 0.5 0.06 95.6 0 0.07 79.5 0.2 0.08 65.5 0 0.09 50.6 0 0.1 44.1 0 0.11 42.6 0 Results obtained for survival of flies grown on purine supplemented media. Adult flies were allowed to lay eggs on standard Drosophila media for 2-3 days. The adults were cleared and the media was supplemented with 1.5 mis of purine solution. Percent survival was determined by counting the number of eclosed adults and dividing by the expected number of survivors (1204 for females and 664 for males). See text for details. survival (% of expected) purine concentration (% w/vol) Figure 11. Survival of ry+ and ry flies on increasing doses of purine supplemented media based on the data presented in Table I. Flies lacking r y + gene function do not eclose as adults at doses higher than 0.08% purine. 38 Figure 11). A purine concentration of 0.08% was determined to be sufficient for selection of females ectopically expressing r y + from the X-chromosome insert of the pUChsneory4" element (Table I, Figure 11). Even at this concentration, only 65.5% of Fi ry+ females survived purine selection (Table I). Supplementing media with purine concentrations higher than 0.08% resulted in increasing lethality of ry4" females. Previous work demonstrated that supplementing Drosophila media with 0.2% purine was sufficient to kil l all ry flies without significantly affecting the survival of wild-type flies (Chovnick et al. 1971; Finnerty et al. 1970). Clearly my data differ somewhat from that of Finnerty et al. (1970) and Chovnick et al. (1971). The increased sensitivity to purine among the flies tested here may be due to the reduced expression of the ry+ gene in the P-element relative to that of the endogenous ry+ gene. Before attempting to screen for mutations induced by insertion of the pUChsneory4" element, the rate at which this element will insert into a new cytological location was determined. Analysis of the F 2 progeny of the crosses shown in Figure 3 allowed determination of the rate at which I could reasonably expect the pUChsneory4" element to induce mutations. The frequency of mobilization for the three X-chromosome inserts ranged from approximately 7 to 18% (Table II). The efficiency of reinsertion was defined as the number of male progeny in the F 2 which had received an autosomal insert of the ry+ element (Sb+ry+ males) divided by the number of mobilization events (Sb+ry females and Sb+ry+ males). The efficiency of reinsertion onto an autosome ranged from approximately 16 to 31% (Table H). 2.2 Screen for P-element induced E(var)s 2.2.1 Isolation and genetic characterization of dominant E(var)& The number of progeny screened for new inserts of the pUChsneory4" was estimated at approximately 1.56 million total progeny derived from the Fi cross shown in Figure 4. Only one fourth of these were males of the Sb+ genotype-those in which new 3 9 Table U Rates of excision and reinsertion for three inserts of the pUChsneory"1" element X-chromosome Sbry+ insert females males Sb+ry females males Sb+ry+ females males frequency of excision frequency of reinsertion 55/3 234 266 47 240 248 9 15.93% 16% 18/3-2 190 190 46 179 207 9 18.18% 16% 18/3-1 259 289 24 296 320 11 6.98% 31% Results obtained from scoring the F 2 of the dysgenic crosses in Figure 6. The total number of flies of the genotypes scored is shown. The frequency of excision was estimated as the number of Sb+ry females by the total number of Sb+ females. The frequency of reinsertion was estimated as the number of Sb+ry+ males divided by the number of Sb+ry females and Sb+ry+ males. 4 0 autosomal insertions of the P-element could be detected. 5502 new inserts of the pUChsneory4" transposon were recovered. This represents a rate of autosomal insertion of (5502/390,000)=1.41xl0"2 for the pUChsneory4" P-element. This rate of transposition is of the same order of magnitude as that found in a similar screen (Dorn et al. 1993) using a similarly modified construct. Of these new inserts, thirty-six showed reversion of the Su(var) phenotype. Of these, eleven were sterile. Four of the new P-element insert lines were sick and were subsequently lost due to poor viability. The remaining twenty putative E(var) stocks were balanced with respect to the ry4" phenotype conferred by the pUChsneory4" element. To determine whether the new E(var)s were associated with a P-element, the balanced ry4" P-insert stocks were tested for co-segregation of the E(var) phenotype with the ry4" P-element. This was done by crossing the balanced ry4" P-insert stocks to the same wm4;ScoSu(var)2-1301/CySu(var)2-lI1;ry^06 stock used in the screen to isolate dominant E(var)s. The F i of these crosses was scored to determine if the ry4" phenotype associated with the new P-insert and the E(var) phenotype co-segregated from the dominantly marked balancer chromosome. In addition to determining if the E(var) phenotype co-segregated with the ry4" P-element insert, these crosses allowed me to determine the effect of the E(var)s on the penetrance of two different Su(var)s. These two Su(var)s do not have an equal effect on wm4 variegation. Su-var(2)13®l is a relatively weak Su(var) and displays a wide degree of phenotypic variation in males but almost complete suppression in females. In contrast, Su-var(2)l^ is a fairly strong suppressor and displays little phenotypic variation (all flies display almost complete suppression of wm4 variegation). None of the newly isolated E(var)s showed reversion of the phenotype associated with Su-var(2)l^ in either males or females (data not shown). Similarly, none of the newly isolated E(var)s showed reversion of the phenotype associated with Su-var(2)13®l in females. Given that Su-var(2)1301 displays phenotypic variation among male flies of the same genotype, it was possible for me to determine the effect of the newly isolated E(var)s on this mutation by 4 1 quantifying the shift in phenotypic variation. This was accomplished by side-by-side comparisons of the eye color of wm4;E(var)ry+/+ F\ males from the crosses shown in Figures 6.1 and 6.2 to their wm4;Balancer/+ male siblings. This allowed me to successfully demonstrate segregation of the E(var) phenotype with the P-insert chromosome for sixteen of the twenty newly isolated E(var)s. The results of these crosses are summarized in Table III. Of the E(var)s which contained second chromosome P-inserts, E(var)s 36b-ll, 51c-2, 35-13 and 47-7 failed to show co-segregation of the ry+ and E(var) phenotypes from the CyO balancer chromosome. The three second chromosome E(var)s 51b-18,19-25, and 15c-11 all showed segregation of the ry+ phenotype with the second chromosome. A l l of the third chromosome E(var)s were shown to co-segregate with the ry+ element. The results are summarized in Table IV. These observations suggest that these putative E(var) strains contain a pUChsneory4" construct on the E(var) chromosome and therefore the E(var) phenotype may be due to an insert of this transposon. I also undertook a preliminary genetic analysis of the newly isolated P-element insert lines to determine if any of them exhibited any interesting phenotypes. Inter se crosses were carried out among balanced heterozygotes for each new E(var) to identify pleiotropic phenotypes associated with homozygotes following the protocols shown in Figures 7.1 and 7.2. Three of the second chromosome P-inserts and four of the third chromosome P-inserts were recessive lethal, indicating that they are associated with mutations in genes required for viability. The results of this analysis is summarized in Table IV. Those E(var)s which were shown to be lethal as homozygotes were tested for complementation for recessive lethality. Each new recessive lethal E(var) was crossed to the other newly isolated recessive lethal E(var)s and to either the second chromosome recessive lethal E(var)s 182, (2)15, (2)13, (2)14 and (2)1 or the third chromosome recessive lethal E(var)s (3)5, (3)4 and (3)10 isolated by the Reuter lab (Dorn et al. 1993) to 4 2 Table HI Effect of the newly isolated E(var)s on penetrance of the Su-var(2)13^ mutation Second chromosome P-inserts Pigment determination Number of individuals mutation CyO Sco Su-varmiS01 Class 1 Class 2 Class 3 CyO+ Sco Su-var(2)1301 Class 1 Class 2 Class 3 ratio (CyO/CyO+) scored N(CyO) /N(CyO+) 51b-18 18 144 66 37 159 24 (2.21/1.94) 228/220 15c-ll 16 128 92 28 142 62 (2.31/1.91) 236/232 19-25 12 154 64 22 182 28 (2.22/2.04) 230/232 36b-ll 9 80 43 6 78 49 (2.24/2.32) 132/133 51c-2 10 93 48 6 87 49 (2.25/2.26) 151/142 35-13 12 110 60 7 104 67 (2.26/2.33) 182/178 47-7 10 97 54 12 108 51 (2.25/2.22) 161/171 CyO mean: 2.25+0.02 Third chromosome P-inserts Pigment determination Number of individuals Sb Sco Su-var(2)1301 Sb+ Sco Su-var(2)1301 ratio scored Class 1 Class 2 Class 3 Class 1 Class 2 Class 3 ( Sb/Sb+) N(Sb) IN(Sb+) 5c-22* 9 124 62 38 150 15 (2.27/1.89) vmm 44c-17* 10 92 51 31 110 19 (2.27/1.93) 153/160 45-19* 12 119 56 20 150 24 (2.23/2.02) 187/160 3-3 7 65 38 20 75 11 (2.28/1.05) 182/194 lb-9* 15 140 76 59 151 14 (2.27/1.80) 231/224 42d-U* 11 160 89 38 200 31 (2.30/1.97) 260/269 lc-1 12 126 66 45 137 16 (2.26/1.85) 204/198 5b-11 11 136 95 17 192 41 (2.35/2.09) 242/250 29b-24 16 126 71 27 170 18 (2.26/1.96) 213/215 6b-15 10 118 93 13 146 54 (2.38/2.19) 221/213 2c-24 13 127 63 32 141 36 (2.25/2.02) 203/209 47b-9 16 133 84 90 130 13 (2.29/1.70) 233/233 45-3 10 115 95 26 152 39 (2.38/2.06) 220/217 Sb mean: 2.29 ±0.04 Summary of the results obtained from the crosses shown in Figures 6.1 and 6.2. Numbers in columns labeled Class 1-3 represent the number of individuals scored in each class as defined in Materials and Methods. *These mutations were observed to have a white eye phenotype in the wm4;E(var)ry+/Balancer stock. 4 3 Table IV Summary of preliminary genetic analysis of newly isolated E(var)s Second chromosome P-inserts viability of fertility of cosegregation of ry mutation homozygotes homozygotes and E(var) 51b-18 recessive lethal * n.a. yes 15 c-11 viable fertile yes 19-25 viable fertile yes 36b-11 recessive lethal n.a. no 51c-2 recessive lethal n.a. no 35-13 viable fertile no 47-7 viable fertile no Third chromosome P-inserts mutation 5c-22 recessive lethal n.a. yes 44c-17 viable fertile yes 45-19 viable fertile yes 3-3 viable fertile yes lb-9 recessive lethal n.a. yes 42d-ll recessive lethal n.a. yes lc-1 viable fertile yes 5b-11 viable fertile yes 29b-24 viable fertile yes 6b-15 recessive lethal n.a. yes 2c-24 viable fertile yes 47b-9 viable fertile yes 45-3 viable fertile yes n.a.=non-applicable 4 4 determine if any of them were allelic (Figures 12.1 and 12.2). The results of these complementation crosses indicate that the recessive lethal mutations that I had isolated complemented each other and all but one of the recessive lethal E(var)s previously characterized. The recessive lethality associated with E(var)182 (Dorn et al. 1993) failed to complement the recessive lethality of my E(var)51b-18. This may indicate that these two E(var)s are alleles of the same gene. 2.2.2 Reversion analysis I had isolated four second chromosome and thirteen third chromosome putative E(var)s which were associated with a ry+ P-element (Table IV). It should be pointed out that the mobilization of P-elements often results in molecular lesions in sites that are not associated with a P-element insert. This raises the possibility that either the recessive lethality or dominant E(var) phenotypes are not due to the P-insertion even though they both segregate with the same chromosome. Remobilization of the P-element should revert both the recessive lethality and E(var) phenotypes for those mutuations which were truly P-induced. Before attempting rescue of genomic D N A flanking the new insert, I wished to determine if any were indeed induced by P-insertion. The P-induced modifiers of PEV were tested for reversion by remobilization of the transposon (Figures 8 and 9). A l l reversions were based on the ability to revert the ry+ phenotype associated with the modified P-element. Correlation of remobilization (ry + gene function loss) with E(var) reversion indicated those E(var)s that were indeed P-induced. Given the amount of work involved in performing the reversion analysis, only six E(var)s were chosen for reversion analysis to determine the subset of E(var)s that were P-induced and as such could be readily cloned. Three second chromosome mutations (E(var)s 51b-18,19-25, and 15c-ll) and three third chromosome mutations (E(var)s 5c-22, 45-19 and 44c-17) were arbitrarily selected for reversion analysis. Remobilization rates varied significantly for the second and third chromosome inserts (Table V). Chromosomes which . 45 0*0* G 0 m4 E(var)l ry-w m4 506 CyO ry 506 t w m 4 E(var)2 ry506 wm4 E(var)l ry506 wm4 or Y ' E(var)2 ' ry506 wm4 E(var)l ry506 wm4 or Y CyO ' ry506 wm4 E(var)2 ry506 wm4 or Y ' CyO ' ry506 CyO ry-506 CyO+ CyO Figure 12.1. inter se complementation crosses between second chromosome P-element induced E(var)s. F i transheterozygotes were scored for pleiotropic phenotypes. 4 6 G o • + • E(var)l wm4 ' + ' TM3Ser w m.4 + E(var)2 ~ ' TM3Ser F l wm4 o r y wm4 + E(var)l wm4 or Y ' + E(var)2 wm4 + E(var)l wm4 o r Y ' + ' TM3Ser wm4 + E(var)2 + TM3Ser Ser+ Ser Figure 12.2. inter se complementation crosses between third chromosome P-element induced E(var)s. Fi transheterozygotes were scored for pleiotropic phenotypes. 47 Table V Summary of remobilization data for pUChsneory+E(var)s Mutant Frequency of ry+ Number of potential Number of revertant stocks mobilization revertant chromosomes established scored 15c-11 H .5% 922 27 19-25 22.4% 817 22 51b-18 50% estimated 500 29 44c-17 77.3% 1014 3 0 45-19 94% 881 28 5c-22 0% estimated 1000 0 The frequency of ry + mobilization was taken as the number of F2 progeny which lost ry+ function divided by the total number of progeny which could have lost the ry+ P-element. 4 8 lacked the ry+ phenotype were recovered from the three second chromosome E(var) lines and the third chromosome E(var)& E(var)45-19 and E(var)44c-17, following introduction of a source of transposase (Table V). However, no putative revertants were recovered from the third chromosome E(var)5c-22. This may have been a result of a rearrangement in the transposon during the original mobilization. The lines generated by remobilization of the pUChsneory4" element were tested for reversion of the E(var) phenotype to determine if any of the E(var)s were associated with the P-element insert. These lines were generated in a wm4 background (as described in Materials and Methods), making it possible for me to score the effect of the remobilization chromosome on the wm4 variegating rearrangement in a segregating population. None of the chromosomes generated by excision of the second chromosome P-inserts E(var)s 15c-11,19-25 or 51b-18 were associated with reversion of the E(var) mutation. Typically, P-elements precisely excise at rates as high as 13% per generation when exposed to a strong source of transposase (Engels et al. 1990). Given the frequency with which precise excisions of P-elements occur, it is unlikely that E(var) revertants could be isolated by obtaining more ry+ revertant chromosomes from these lines. This indicates that these E(var)s were not associated with an insert of the pUChsneory4" element. By contrast, loss of ry+ function in E(var)44c-17 and E(var)45-19 were associated with reversion of the E(var) phenotype. These results indicated that these E(var)s were indeed induced by insertion of the P-element into or near a gene involved in modification of PEV. The goal of my thesis was to identify and clone an E(var) which I had induced in a P-element mediated mutagenesis screen. Given the time required to conduct a molecular analysis for even a single gene, I made an arbitrary decision to focus on the characterization of E(var)45-19 rather than E(var)44c-17. I performed a detailed analysis of the lines generated by remobilization of the pUChsneory4" element in the E(var)45-19. Twenty-eight independent lines were established from single F 2 ry males (Figure 9) which were generated by excision of the P-4 9 element and each line was tested for its effect on variegation of wm4. As noted above, mutations which are caused by the insertion of a P-element typically revert at a rate of 1.3xl0_ 1 when exposed to a strong source of transposase (Engels et al. 1990). The rate at which E(var)45-19 reverted following the introduction of transposase was calculated as the number of complete revertant stocks divided by the total number of remobilization stocks multiplied by the rate of excision of the P-insert in E(var)45-19. Of the twenty-eight individual lines generated by excision of the P-element in E(var)45-19, three independent lines no longer enhanced PEV of wm4. Based on these data, the rate of reversion of the E(var)45-19 mutation, following introduction of transposase, was [(3/28)x94%]=10"1, indicating that E(var)45-19 is a mutation induced by insertion of the pUChsneory4" P-element. 2.2.3 Generation of a new allele of E(var)45-19 The mobilization of P-elements often results in small deletions or rearrangements at the site where the P-element originally resided. These chromosomal aberrations presumably result from imprecise excision of the P-element. Such cases may induce either new mutant alleles of the P-tagged gene or mutations in nearby genetic loci. In order to determine if there were any genetic phenotypes induced by remobilization of the P-element in E(var)45-19,1 examined the remobilization lines for any obvious visible defects or abnormalities. One of the lines generated by remobilization of the P-element had a Su(var) phenotype. This is probably a new allele of E(var)45-19 which resulted from the imprecise excision of the P-element. I refer to this new mutation as Su(var)r27. The association of a Su(var) mutation with loss of the P-element in E(var)45-19 presented me with the intriguing possibility that mutations in this particular locus can act as either suppressors or enhancers of PEV. To date, no locus has been described for which both a Su(var) and an E(var) allele have been isolated. However, duplications of loci which are loss-of-function E(var)s 5 0 typically suppress PEV. One interpretation of this is that the E(var) and Su(var) phenotypes are the result of hypomorphic and hypermorphic alleles of a particular locus. Given the interesting nature of the mutations E(var)45-19 and Su(var)r27,1 decided to perform a more detailed functional genetic analysis on these lines. 2.3 Further genetic characterization of E(var)45-19 and Su(var)r27 2.3.1 Effect of E(var)45-19 and Su(var)r27 on PEV affected genes wm4 and W r o e 2 The variegating allele wm4 used to screen for E(var)s is one of a number of variegating rearrangements which have been shown to be sensitive to modifiers of PEV. General modifiers of PEV have also been shown to modify the phenotype of a variety of different variegating strains, among them the bw^e^ allele (Figure 13). In order to determine if the mutations E(var)45-19 and Su(var)r27 are general modifiers of PEV, these mutations were crossed to the bwVDe2 allele (Figure 14). Examination of the eye color of the F i of this cross demonstrated that the mutation Su(var)r27 is a strong female-specific suppressor of the brown phenotype associated with the bw^e^ variegating rearrangement (Figure 15). Interestingly, the E(var)45-19 mutant had no effect on the bw^e^ allele. The modification of the bw VE>e2 a n f j wm4 alleles by Su(var)r27 suggests that mutations in the E(var)45-19 locus are general modifiers of PEV (Figures 15 and 16). 2.3.2 Phenotypes associated with Su(var)r27 In order to determine the genetic basis for the Su(var) phenotype associated with the revertant line Su(var)r27, generated by excision of the pUChsneory+ element in E(var)45-19,1 examined this line in more detail. As mentioned, the Su(var) phenotype of Su(var)r27 was identified in a segregating, balanced population of the genotype wm4;+;(ry revertant)/TM3Ser (section 2.2.3). This presented the possibility that the Su(var) mutation resulted from a mutation in a second site. To determine the genetic basis for the Su(var) phenotype, females of the genotype wm4;+;Su(var)r27/TM3Ser were outcrossed to wm4 5 1 Figure 13. Schematic diagrams of the wm4 and bwVDe2 rearrangements. The PEV mutations are both chromosomal rearrangements which juxtapose a euchromatic gene next to centric heterochromatin. In each case, the mutant phenotype is thought to be caused by a spread of heterochromatic domain into flanking euchromatin, transcriptionally inactivating nearby euchromatic loci. The arrows indicate the inversion breakpoints. 5 2 o*o* G 0 CyO+ F i X bw V D e 2 X CyO X m4 w X m4 X + + w m4 + bwVDe2 + + + + bwVDe2 Su(var)r27 + TM3Ser + X fayVPg2 Su(var)r27 + bw V D e 2 TM3Ser + Su(var)r27 TM3Ser Result: suppressed variegated variegated variegated Figure 14. Effect of Su(var)r27 on b w ^ e 2 variegation. Genetic crosses were carried out between Su(var)r27 and the b w ^ e 2 rearrangement. The F i was scored for the brown phenotype. Results indicate that.Sw(var)r27 is a female-specific suppressor of jjWVDe2 variegation (See Figure 15). 5 3 Figure 15. Effect of the Su(var)r27 mutation on bwVDe2. Shown are typical phenotypes associated with the bwVDe2 a l l eie. The eyes of \yyfVDe2;Balancer/+ female flies appear brown. In contrast, the eyes of their their bw^^e2;Su(var)r27/+ female siblings appear wild-type (suppressed). Despite some phenotypic variation among flies of the same genotype, there was no phenotypic overlap between flies of different genotypes. The muta-tion Su(var)r27 displays strong female-specific suppression of the bw phe-notype associated with the mutation. 54 Figure 16. Effect of the E(var)45-19 and Su(var)r27 mutations on the variegat-ing rearrangement. Shown are typical phenotypes associated with the wm4 allele. The eyes of wm4;+ flies appear mottled. In contrast, the eyes of wm4;Su(var)r27 flies appear wild-type (suppressed), while the eyes of wm4;E(var)45-19 flies appear white (enhanced) The P-induced mutant E(var)45-19 was shown to be a dominant enhancer of the white phenotype. The Su(var)r27 allele, generated by excision of the P-element insert in the E(var)45-19 line, was shown to be a maternally inherited suppressor of PEV associated with the wm4 mutation. 55 males. A l l of the Fi progeny from this cross showed a Su(var) phenotype regardless of whether or not the Fi individuals carried the Su(var)r27 allele. In contrast, none of the F i progeny from the reciprocal cross showed a Su(var) phenotype. These results indicated that the Su(var) phenotype associated with this mutation was not inherited in the classical Mendelian fashion. Opposing results obtained from reciprocal crosses typically indicate maternal-effect genes. Indeed this seemed to be the case. The F 2 progeny, which were obtained from the intercrosses of the Fi resulting from the outcrosses of the Su(var)r27 line described above, were examined. 50% of the F 2 derived both of the Fi intercrosses showed a Su(var) phenotype, indicating that the genotype of the mother is responsible for the Su(var)r27 phenotype. The maternal-effect was confirmed by crossing the Fi Su(var)r27/+ females from each of the reciprocal crosses to +/+ males. A l l of the F 2 males and females resulting from both of these crosses showed a Su(var) phenotype, indicating that the genotype, not the phenotype, of the mother is responsible for the Su(var) phenotype of her progeny. From these results I concluded that the Su(var) phenotype associated with this allele was dominant and maternally inherited. To determine whether there were any obvious phenotypes associated with homozygotes for the Su(var)r27 mutation, males and females were tested for fertility. The Su(var)r27 chromosome was shown to carry a mutation which resulted in male sterility when homozygous, presumably due to a mutation in the E(var)45-19 locus. In contrast, homozygous females were fertile. In addition, observation of the time required for development at 25 °C revealed that male and female homozygotes took 2-3 days longer to eclose as adults than their heterozygote siblings in the balanced, segregating population. The results of the genetic analysis conducted for the lines generated by excision of the P-element in E(var)45-19 are summarized in Table VI. 5 6 Table VI Individual lines generated by remobilization of the P-element in E(var)45-19 ry stock d plieotropic phenotypes of / T T P U + u i - \ Effect on w m 4 homozeotes (pUChsneory+ remobilizations) nomozgoie5> 10,22,13 E(var)+ none 31,32,11,34,37,38,21,14,2 8,2,40,18,23,26,18,9 E(var) none 17,19,30,5 E(var) recessive lethal 27 Su(var) male sterile development delayed by 2-3 days Summary of analysis of the effect of remobilization of the pUChsneory"1" element in the E(var)45-19 line. The isolation of the lines rlO, 22, and 13, which have reverted for the E(var) phenotype, suggests that that E(var)45-19 is a P-induced mutation. 57 2.3.3 Effect of Su(var)r27 on the retrotransposon-iriduced allele w^ A number of modifiers of PEV have also been shown to modify the mutant phenotype of the retroelement-induced allele w^K The mutant phenotype of the w^l allele of the white gene results from an insertion of the blood retrotransposon into the second intron of the white structural gene (Bingham and Chapman 1986)(Figure 17). The demonstration that the w^ allele is modified by a number of genes which also modify PEV suggests that the mechanisms governing retroelement expression and chromatin structure overlap to some degree (Csink et al. 1994). This raised the possibility that mutations in E(var)45-19 and Su(var)r27 may also modify the phenotype of the w^l allele. To test this possibility, I crossed the mutants E(var)45-19 and Su(var)r27 to the w^ mutation (Figure 10) and to the white alleles wa and wl. The effects of the E(var)45-19 and Su(var)r27 mutations on retroelement induced alleles of white was determined by side-by-side comparisons of male flies derived from the crosses shown in Figure 10. No differences were noted between genotypes for the alleles wa and (data not shown). In contrast, male flies of the genotype wbl;Su(var)r27 had far less red pigment than their w^;TM3 male siblings (Figure 18). There was no phenotypic overlap between genotypes, indicating that Su(var)27 is a strong enhancer of the w^l phenotype. The results of these crosses are summarized in Table VII. E(var)45-19 appeared to have no effect on w^l, wa or wK Discussion Twenty new enhancers of PEV were isolated following a P-element mediated mutagenesis screen. Given the amount of time required to analyze all of these mutations in detail, only six were tested for reversion of the mutation under dysgenic conditions. The third chromosome mutations E(var)45-19 and E(var)44c-17 were shown to revert following remobilization of the P-element inserts in these lines. Although the remaining fourteen new E(var)s were not tested for reversion, analysis of the six that were suggests that several more of the newly isolated E(var)s may have been mutations caused by the 5 8 blood retrotransposon white gene exon 1 exon 2 exons 3 4 5 6 Figure 17. Schematic diagram of the w01 allele. The wbl phenotype results from the insertion of a blood retrotransposon into the second intron of the white* gene. The insertion of this element prevents efficient production of full-length white* transcripts. 59 Figure 18. Effect of the Su(var)r27 mutation on the retrotransposon induced allele wbK Shown are typical phenotypes associated with the vM allele. The eyes of w^;Balancer/+ flies are darker than their wM;Su(var)r27/+ siblings. Despite some phenotypic variation among flies of the same genotype, there was no phenotypic overlap between flies of different genotypes. The mutant allele Su(var)r27 was shown to be a strong enhancer of the phenotype associated with the YM mutation. 60 Table VH Effect of the mutation Su(var)r27 on alleles of white Allele Interaction Molecular basis of white locus mutation Reference wa none copia retrotransposon insertion in intron 2 Gehringand Paro (1980); Bingham and Judd (1981) wbl enhancement blood retrotransposon insertion in intron 2 Zachar and Bingham (1982); Bingham and Chapman (1986) wl none duplication of sequences from intron 1 to start of exon 3 Collins and Rubin (1982); Karess and Rubin (1982) wm4 suppression chromosomal inversion which places white locus near centric heterochromatin Muller (1930) Males of the genotype Su(var)r27/TM3Ser were crossed to females carrying the various white alleles (except for wm4 which is described in section 2.3.2). Fi Su(var)r27/+ males were compared to their TM3Ser/+ brothers. 61 insertion of a P-element. This degree of success has not been achieved by other screens for P-induced modifiers of PEV. Three different screens for E(var)s, using strains containing a large number of defective P-elements as mutator agents, failed to recover any E(var)s that reverted following the introduction of A2-3 transposase (Dorn et al. 1993; Locke et al. 1988; M . Harrington personal communication). In contrast, a screen performed by selecting first for chromosomes which contained new P-element inserts and then assaying these for their effect on PEV resulted in the isolation of several E(var)s which are thought to be due to the insertion of P-elements (Dorn et al. 1993). As outlined in Materials and Methods, the screen described in the current study also involved selection for new P-inserts and assaying of these for modification of wm4 variegation. Given the tendency for P-elements to generate second-site mutations, the results obtained from these two different screens suggests that isolation of true P-induced mutations may be favored by employing a similar technique. An obvious disadvantage of using 0.08% (w/vol.) purine to select for new autosomal insertions of the r y + P-element is that new insertions which display low levels of r y + expression may not survive purine selection. In fact, based on the data I presented in Table I, I expected survival of only 65.5% of those new inserts which produced as much r y + gene product as the original X-chromosome insert of the pUChsneory"1" element. For this reason, researchers interested in using a similar selection protocol may wish to use a lower concentration of purine to select for new inserts. This would increase the likelihood of survival of flies containing new inserts of the P-element which express low levels of the rosy+ gene product. The increased rate of isolating false positives as a result of using a lower purine concentration would have to be weighed against the benefit of selecting new inserts. None of the newly isolated E(var)s showed reversion of the phenotype associated with Su-var(2)lH. Similarly, none of them showed reversion of the phenotype associated with Su-var(2)1301 in females. However, I was able to demonstrate that most of them 6 2 were able to shift the phenotypic variation associated with Su-var(2)13^ in males. I also crossed the newly isolated E(var)s to the mutation Su(var)205-another strong suppressor of wm4 variegation. None of the E(var)s resulted in reversion of the phenotype associated with Su(var)205 (data not shown). Two possibilities which may explain these observations are as follows: 1) these E(var)s are suppressors of Su-var(2)13^ specifically, and 2) these E(var)s are weak enhancers whose effects cannot be detected in the presence of a strong suppressor of PEV. I favor the latter explanation for a number of reasons. First, although the newly isolated E(var)s were able to shift the phenotypic variation associated with Su-var(2)13^1 males, they appeared to have no effect on Su-var(2)13^^ females which display little phenotypic variation. It seems reasonable that this is due to the fact that Su-var(2)13^ has a stronger effect on females (almost complete suppression) than on males (in which suppression can vary anywhere from 20% to 100% between individuals). If these are indeed weak E(var)s, this may also explain why they were unable to revert the suppression of PEV associated with stronger Su(var)s (Su(var)205 and Su-var(2)l^)m either males or females. Second, it seems unlikely that given the number of E(var)s isolated, all of them are specific suppressors of Su-var(2)1301 and none are general enhancers of PEV. Third, the E(var)s 5c-22, 44c-17,45-19, lb-9 and 42d-ll all display a white eye phenotype in the wm4- E(var)ry+/Balancer stocks. This is typical of such E(var) stocks. Fourth, the recessive lethality associated with E(var)51b-18 failed to complement the recessive lethality associated with E(var)182, which was isolated in an independent screen for E(var)s (Dorn et al. 1993). Finally, further genetic analysis of E(var)45-19 and an allele presumed to result from the imprecise excision of the P-element in this line, Su(var)r27, suggests that at least this locus is a general modifier of PEV (see below). Taken together, these observations suggest that the newly isolated E(var)s represent a group of weak E(var)s which may not have been isolated in a screen utilizing a strong Su(var). While these are interesting academic arguments, the further analysis of E(var)45-19 and Su(var)r27 would prove to be a more significant qualifier of the success of this screen. 6 3 Su(var)r27 was shown to be a dominant maternal-effect suppressor of wm4 variegation but a dominant female-specific suppressor of bw^e2 variegation. Although differences in expressivity have been observed between males and females for a few Su(var)s (T. Grigliatti, personal communication), all-or-none sex-specific phenotypes have not been noted for any of the approximately 30 Su(var) loci which have been extensively genetically characterized. Typically, those Su(var)s which suppress wm4 variegation affect }jWVDe2 variegation in a similar manner. Despite this generalization, the Su(var)s 212, 329 and 324 all show a greater degree of suppression of b w ^ e 2 in females than males. While the basis for these differences awaits molecular cloning of these Su(var)s, it is possible that the difference is due to the effect of the Y chromosome on PEV (reviewed in section 1.4.2). The differences in expressivity displayed for the mutation Su(var)r27, in addition to the sterility associated with males homozygous for the Su(var)r27 mutation, suggests that the expression of this locus may be regulated in a sex-specific manner. As pointed out in section 2.3.2, Su(var)r27 has a maternal effect on wm4 variegation. The products of maternal-effect genes in Drosophila are typically deposited in the egg or developing embryo by nurse cells of the mother. Therefore, the genotype of the mother determines the phenotype of her progeny-as was demonstrated by the reciprocal crosses performed for Su(var)r27. Whether or not the product of the E(var)45-19/Su(var)r27 locus is expressed in the germ-line of adult Drosophila is therefore of considerable interest. The analysis of deficiencies and duplications for regions which contain modifiers of PEV has revealed an interesting relationship between the dosage of these loci and their effect on variegation. Those loci which are loss-of-function E(var)s (i.e. deficiencies), typically suppress PEV when duplicated (Locke et al. 1988; Wustmann et al. 1989). This dependence on dosage has been interpreted in the following manner. E(var) loci are thought to encode protein products which are involved in the establishment and/or maintenance of euchromatin. A decrease in the dose of any of these loci may compromise the ability of the 6 4 normally euchromatic region to protect itself against the spread of invasive heterochromatin. This would lead to variegation of euchromatic genes which have been juxtaposed to a heterochromatic breakpoint (enhancement of PEV). Conversely, an increase in the dose of any of these loci (duplications) would facilitate either the establishment or maintenance of euchromatin, preventing the spread or limiting the extent of heterochromatin and thus suppressing the gene silencing caused by PEV. This model, based on the dose-dependence exhibited by E(var)s, allows us to speculate on the nature of the E(var)45-19 and Su(var)r27 mutations. Assuming that these mutations are in the same genetic locus, a dose-dependent model predicts that they represent hypomorphic and hypermorphic alleles. Molecular cloning of this locus should allow us to address the question of whether or not E(var)45-19 and Su(var)r2 7 represent such allelic states of the same gene. As noted in the introduction, several loci have been identified in screens for modifiers of the retroelement-induced alleles wa and wbK Further genetic analysis of the mutations isolated in these screens revealed that many of these loci also modify PEV (Bhadra and Birchler 1996; Bhadra et al. 1997; Birchler et al. 1994; Csink et al. 1994; Frolov et al. 1998). Analyses of mutations in these loci have established an important overlap in the factors which govern retroelement expression and chromatin structure in Drosophila. In addition to modification of PEV, Su(var)r27 was shown to enhance the mutant phenotype associated with the retroelement-induced allele wbl. However, Su(var)r27 did not modify the mutant phenotypes associated with other white alleles, including wa , which (like w°l) is a mutant allele caused by the insertion of a retroelement into the second intron of the white gene (Table VII). Only one other locus has been identified in Drosophila which specifically modifies both PEV and retroelement-induced alleles of white, Lip (Csink et al. 1994). Lip has been shown to affect the level of transcription of the blood retroelement, thereby interfering with the production of full-length white* transcripts from the wbl allele (Csink et al. 1994). This is presumed to be the molecular basis for its effect on the penetrance of the w^l phenotype. Unlike Su(var)r27, 6 5 Lip has been shown to modify the other retroelement-induced alleles of white which I tested (Csink et al. 1994), suggesting that Lip is a more general modifier of retroelement expression than Su(var)r27. It has long been known that performing dysgenic crosses to mobilize a particular class of mobile element often results in the mobilization of other families of mobile elements. Although the basis for this phenomenon is unknown, it is likely that it is mediated by host genes, rather than an interaction between different families of mobile elements. An intriguing characteristic of this type of event is that specific retroelements from different families often mobilize in the same dysgenic cross without any observed increase in the mobility of other retroelement families. It is possible that this specificity is a reflection of the host factors that are shared by different retroelement families. Given the observation that a few of the modifiers of retroelement-induced alleles, including Su(var)r27, exhibit specificity for alleles induced by particular classes of mobile elements (Rabinow and Birchler 1990), it seems reasonable to speculate that these modifier loci may identify host factors which are responsible for co-mobilization of different families of retroelements. Molecular cloning of the D N A sequences at the eucliromatinmeterochromatin junctions of three rearrangements which display white variegation has revealed an interesting common feature of the heterochromatin at the breakpoint. In each case, the white gene has been juxtaposed to heterochromatic regions which contain retroelement-related sequences (Tartof et al. 1984). Spradling and Karpen (1990) proposed an explanation for the variegation of euchromatic genes juxtaposed to such heterochromatic regions. They suggested that transcription from a promoter within the heterochromatin (such as in a transposable element) may interfere with transcription from the nearby euchromatic locus (Spradling and Karpen 1990). This may explain why so many modifiers of retroelement-induced alleles are also modifiers of PEV. 6 6 Given the genetic data obtained for the mutations E(var)45-19 and Su(var)r27, which is summarized in Table VIEt, molecular cloning of this locus was considered an attainable goal and should indicate a gene product involved in both chromatin structure and retroelement expression. 6 7 Table V I H Summary of genetic data for E(var)45-19 and Su(var)r27 Mutant t / t t e c t o n F b V Effect on wbi Pleiotropic phenotypes wm4 bwVDe2 o f h o m o z y g ° t e s 45-19 E(var) none none none r27 maternal-effect female-specific Enhancer -male sterile Su(var) Su(var) -development delayed by 2-3 days 68 Chapter 3 Molecular characterization of the nomad retrotransposon Introduction Retrovirus-like transposable elements have been identified in the genomes of every eukaryotic organism examined to date. The genome of Drosophila melanogaster contains more than 30 different classes of transposable elements, accounting for approximately 10% of the genome (Rubin 1983). Transposition of mobile D N A sequences are a source of high spontaneous mutation rates (Green 1988) and genetic variation (Tchurikov et al. 1989). In addition to altering genome structure, retrotransposons have been shown to affect the transcription of nearby genes (Modollel et al. 1983; Tanda and Corces 1991; Wilanowski et al. 1995). These results suggest an important role for mobile genetic elements in generating genetic variation by creating novel patterns of expression for nearby genes. Extensive studies have been done on the distribution of transposable elements in the genome of Drosophila melanogaster. A i l retrotransposons tested to date, with the exception of jockey, have been shown to be present in both heterochromatin and euchromatin. In fact, 6-heterochromatin is characterized by a number of repetitive elements, including retrotransposons. A few transposable elements have been shown to have insert site specificity. The transposons 297, 17.6 and torn insert preferentially at the nucleotide sequence (T)ATAT (Ikenaga and Saigo 1982; Inouye et al. 1984; Tanda et al. 1988). The mechanism by which these elements select insert sites with such fidelity is unknown, but is likely conferred by the integrase subunit of the Pol protein. I report here the identification and molecular characterization of the nomad element of Drosophila melanogaster. The P-element insert in the mutant line E(var)45-19 (described in chapter 2) was shown to be inserted into the 3'LTR of a copy of nomad, and this LTR was used to isolate clones of the complete nomad element. Results demonstrate that nomad is a retrovirus-like transposable element which is closely related to the yoyo retrotransposon of Ceratitis capitata and the gypsy element of Drosophila melanogaster. 6 9 nomad produces a 7.6 kb and a 3.0 kb transcript and is distributed in the genome in a pattern that resembles the distribution patterns of the majority of retrotransposons. D N A sequence analysis of several different nomad inserts identify a target site sequence of T A N A . I also performed a detailed analysis of the D N A binding domains of the integrase coding region of transposons known to exhibit target site specificity and suggest that this region is responsible for insertion site selection. In addition to the 7.6 kb and 3.0 kb transcripts predicted from the complete D N A sequence of the nomad element, probes specific to nomad sequences detected a 12 kb message which is thought to result from the fusion of a portion of a nomad element transcript to an uncharacterized host gene. Materials and Methods Drosophila stocks Drosophila stocks were maintained at 25°C on standard medium containing cornmeal, sucrose, dextrose, yeast, agar and Tegosept (Sigma) fungicide to inhibit mold. Isolation of D. melanogaster genomic D N A and Southern blot analysis 100-200 adult flies were ground in liquid N 2 with mortar and pestie. The resultant powder was transferred to a Dounce homogenizer and homogenized in 5 ml of 10 mM Tr isCl (pH 7.5), 60 mM NaCl, 10 mM EDTA, 0.15 mM Spermidine, 0.15 mM Spermine, 5% sucrose homogenization solution. This was briefly centrifuged at 1000 rpm for 1 min. The supernatant was removed, transferred to a new tube and centrifuged at 8000 rpm for 5 min. The supernatant was poured off and the pellet resuspended in 0.5 ml of homogenization solution. 5 ul each of Proteinase K@ 10 mg/ml and RNaseH@ 10 mg/ml were added and mixed. 50 pi of 10% SDS was added and mixed by gentle swirling. This mixture was incubated at 37 °C for one hour. This was then extracted twice with phenol and twice with chloroformisoamyl alcohol (24:1). 3 M NaOAC (pH 6.8) was then added to a 7 0 final concentration of 300 mM, followed by the addition of two volumes of 100% ethanol. The genomic D N A was spooled out with a glass hook, rinsed in 70% ethanol and air-dried. The pellet was resuspended in 100 ul of TE buffer (pH 8.0). 10 pg of genomic D N A was digested with 20 units of each restriction endonuclease for 12 hrs@37°C. The digested fragments were separated in 0.8% agarose, l x T A E gels. The gels were briefly denatured in 0.5 M NaOH, blotted onto Hybond-N membrane (Amersham) with 20xSSC and U V fixed for 2-3 min. Hybridizations were done at 60°C using an f- l l -dUTP labeled pUC18 D N A probe, prepared using the random hexamer labeling method (Amersham). Hybridization buffer was 25mM KPO4 pH 7.4, 5xSSC, 5x Denhardt's solution, 25 pg/ml sheared herring sperm DNA, 10% dextran sulfate. Stringency washes were as follows: 10 min in 2xSSC at 60°C; 10 min in lxSSC at 60°C; followed by 2 x 10 min in 0.5xSSC at 60°C. Detection of f-11-dUTP probes was done by chemi-luminescence as described for the E C L D N A labeling and detection kit (Amersham). Isolation of cosmid and cDNA clones containing nomad sequences A D N A fragment containing the nomad LTR was cloned by plasmid rescue (Stellar and Pirotta 1985) of the genomic D N A flanking the P-element insert in E(var)45-19 (described in Chapter 2). This fragment was used as a probe to screen genomic D N A clones containing nomad sequences from a cosmid library made from D. melanogaster genomic D N A in the pWE15 vector (Clonetech). 1.25xl05cfu were plated on L B agar medium supplemented with 50 pg/ml ampicillin on 3, 150 mm petri plates. cDNA clones were isolated from two different lambda phage libraries, each of which was made from polydT primed D. melanogaster Canton S embryo RNA, one library in the A Z A P H vector (kindly supplied by C. Thummel) and one in the A,gtl0 vector (Clonetech). D N A sequencing and analysis 7 1 Sequencing of the nomad element in cosm5 was accomplished by digestion of the cosmid with EcoRI endonuclease and subcloning the resulting fragments into the EcoRI site of pBKS(+) plasmid vector (Stratagene). Sequencing of the cosmid subclones was performed using using DyeDeoxy Terminator Cycle Sequencing (Perkin Elmer, ABI) using T3,17, or KS oligonucleotides that prime out from the pBKS(+) vector. Gaps were filled by generating synthetic oligonucleotides and sequencing with them. The subclones were oriented using a restriction map of cosm.5 generated using BamHI, EcoRI, HindlJJ and Sail endonucleases. Host D N A sequences at the sites of nomad element insertions were determined using primers specific to 5' and 3' end sequences. The primer used to determine 5' host D N A sequences was C C A C C A C T A 1 1 1 1 1 A C G C A C , a minus strand primer at nt 600-585. The primer used to determine 3' host D N A sequences was T C A C T A A T C T G C G G G A C G , a plus strand primer at nt 6974-6991. Sequences were assembled using Mac Vector (Oxford Molecular Group PLC) and AssemblyLIGN (International Biotechnologies, Inc. New Haven, CT ) sequence analysis software. Sequence database searches were performed on the National Center for Biotechnology and Information (NCBI) network server using the Basic Local Alignment Search Tool (BLAST) (Altschul et al. 1990). Multiple protein sequence alignments were performed by Clustal W (Thompson et al. 1994). Maximum parsimony and protein distance analyses were performed using PAUP version 3.1.1 written by D.L. Swofford (Smithsonian Institution, Washington, D.C.). Parsimony and distance analyses were based on 1000 bootstrap replicates. Unweighted maximum parsimony analysis was carried out by 100 rounds of random stepwise addition random searches with tree bisection reconnection (TBR) branch swapping using PAUP. Protein distance analyses were based on complete alignments of the predicted Pol proteins. These were performed both including the transposons 1731 and copia and also excluding these two as the order of the RT and integrase domains in these two is reversed relative to 7 2 that found in other retrotransposons. The protein distance values obtained by these two methods were similar and more importantly resulted in a branching order identical to the clades suggested in Figure 31. The predicted Pol proteins of the mdgl and 297 elements which were used in the alignments were determined by conceptual translation from their D N A sequences which were obtained from Genbank. RNA isolation and Northern blot analysis Total R N A was isolated from 50-100 adult flies following the manufacturer's protocol for Trizol reagent (Gibco BRL). PolyA+ RNAs (1 pg/lane) were separated in 1.2% agarose, lxMOPS formaldehyde-denaturing gels, blotted using 20xSSC onto Hybond-N membrane and U V fixed 2-3 min. Hybridizations were done at 42°C using a 3 2 P labeled 1.6 kb EcoRI fragment which corresponds to nt 1524-3240 of the nomad element, prepared using the random hexamer labeling method (Amersham). Hybridization buffer was 25 mM K P O 4 pH 7.4, 5xSSC, 5x Denhardt's solution, 25 pg/ml sheared herring sperm DNA, 10% dextran sulfate in 50% formamide. Stringency washes were as follows: 10 min in 2xSSC at 65°C; 10 min in lxSSC at 65°C; followed by 2 x 10 min in 0.25xSSC at 65°C. RT-PCR of nomad transcipts RT-PCR was carried out on 1 pg of adult P o l y A + RNA following the manufacturer's protocol for the TITAN one tube RT-PCR kit (Boehringer Mannheim). The first strand synthesis primer was C G G G A T C C C G C A G A T T A G T G A G C C T T G , a minus strand primer corresponding to nt 6968-6986 with a BamHI linker, and the second strand primer was C G C G G A T C C T G A C C A A C G T G G T G A C , a plus strand primer corresponding to nt 1620-1637 with a BamHI linker. The RT first strand synthesis was performed at 55°C for 40 min and then 40 PCR amplification cycles were carried out as follows: 2 min.@94°C followed by 30 sec@55°C and then 4 min@68°C. The final extension step 7 3 was extended by an additional 3 min@68°C. The RT-PCR products were cloned into the BamHI site of the pBKS(+) vector and sequenced as described above. In situ hybridization to polytene chromosomes Polytene chromosome squashes were prepared by dissecting the salivary glands from 3 r d instar larvae in 45% acetic acid, transferring to a drop of 3:2:1 acetic acid:H20:lactic acid on a siliconized coverslip for 4-5 minutes and then squashing onto precleaned glass slides. The slides were stored at 4°C overnight to promote flattening. Coverslips were removed by plunging into liquid N2 and flipping off with a razor blade. The squashes were dehydrated by submerging in 95% ethanol for 10 minutes and air-drying. Hybridizations were done at 37°C using a f- l l -dUTP labeled D N A fragments, prepared using the random hexamer labeling method (Amersham). D N A probes were made from pUC18 D N A sequences and from a 1.6 kb EcoRI fragment which corresponds to nucleotides 1524-3240 of the nomad element. Hybridization buffer was the same as described for Northern blot analysis. Stringency washes were as follows: 2 x 20 min. in 2xSSC, 0.1%SDS at 60°C, followed by 2 x 10 minutes in 0.5xSSC, 0.1%SDS at 65°C. Detection was as described by Amersham for the D N A Color Kit. Results and Discussion 3.1 Local izat ion of P-element in E(var)45-19 by in situ hybridizat ion to the 63A region In order to determine the cytogenetic location of the P-element insert in E(var)45-19,1 performed an in situ hybridization to polytene chromosomes using a pUC18 D N A probe. Results of the in situ hybridization indicate that there was a single insert of the pUChsneory4" P-element at 63A on the left arm of the third chromosome (Figure 19). This confirmed the genetic data that demonstrated cosegregation of the E(var) and ry4" 7 4 Figure 19. In situ localization of the P-element in the E(var)45-I9 mutant line. The results of in situ hybridization of pUC sequences to polytene chromosomes reveals that there is a single pUChsneory"1" element in the 63A region on the left arm of the third chromosome. 7 5 phenotypes with the third chromosome (section 2.2.1). Taken together with the results of remobilization of the pUChsneory4" element (section 2.2.2), these data suggested that E(var)45-19 was a P-induced E(var) in the 63A region of the third chromosome. I decided to perform recovery of the genomic D N A flanking the P-insert in this line by plasmid rescue. 3.2 Cloning of genomic DNA flanking the P-element in E(var)45-19 by plasmid rescue The pUChsneory4" transposon (Figure 20) was constructed from the pUChsneo rescue vector (Stellar and Pirotta 1985). The pUChsneo vector contains a derivative of the pUC8 E. coli cloning vector. This allows rescue of the genomic D N A flanking new inserts of the intact P-element by plasmid rescue (Figure 20). A 5.3 kb EcoRI fragment was detected by a pUC 8 probe in Southern blot analysis of genomic D N A from the mutant line E(var)45-19 which was not detected in Oregon R control D N A (Figure 21). In addition to the pUChsneory4" sequences, this fragment contains approximately 1.5 kb of genomic D N A 3' to the P-insert (Figure 20). The genomic D N A flanking the P-insert in E(var)45-19 was cloned by plasmid rescue following digestion of genomic D N A with EcoRI endonuclease. This fragment was subsequently used as a probe to screen genomic and cDNA libraries of wild-type D. melanogaster to obtain clones of the E(var)45-19 locus. The 5'- and 3'-end sequences of each of the cDNA clones were determined and searches performed of the Genbank database for D N A and protein sequences with significant homology to the newly isolated cDNAs (as described in Materials and Methods). Results indicated that five of the cDNAs contained ORFs which contained similarity to either the Pol or Env proteins of the yoyo retrotranspsoson in Ceratitis capitata. Given that the intended goal of this study was to clone the E(var)45-19 locus, it may intuitively seem that the description of a novel retrotransposon which follows is a digression. However, the structural and phylogenetic analysis of this retroelement, which I 76 5 ' P pUChsneory4" transposon p U C 8 5SSSS 3'P 0 Genomic DNA EcoRI 5.3 kb EcoRI fragment t EcoRI EcoRI digestion of genomic DNA with EcoRI, ligation and transformation of competent E. coli genomic DNA fragment cloned by plasmid rescue used to probe Northern blots and screen cDNA and genomic DNA libraries Figure 20. Cloning of the genomic DNA flanking the P-insert in E(var)45-19. A 1.5 kb fragment of genomic DNA 3' to the pUChsneory4" insert was cloned by plasmid rescue. 77 DNA sample: OR-R E(var)45-19 >—< I I—i OB ai ^ >-< I-H restriction enzyme: ^ !z <^ Figure 21. E(var)45-19 contains a single copy of the pUChsneory element. Genomic D N A from OR-R and E(var)45-19 adults probed with pUC 18 D N A reveals that there is a single copy of the modified P-element in the genome of E(var)45-19. 7 8 have named nomad, would prove critical to my proposal of the mechanism by which the mutations E(var)45-19 and Su(var)r27 may modify PEV. 3.3 Structure of the nomad retrotransposon 3.3.1 Structure of the nomad LTR The molecular structure of the nomad LTR was determined by D N A sequence analysis using a cosmid clone (cosm5) containing the entire nomad element (Figures 22 and 23). A l l of the retrotransposons identified in Drosophila can be placed into two different classes based on a short inverted repeat sequence at the terminal nucleotides in the LTRs: those that are bounded by the nucleotides 5TG. .CA 3'; and those that are bounded by the nucleotides 5'AG(T/A)..A(C/T)T 3' (Yuki et al. 1986). The nomad element was shown to terminate with 519 bp direct repeats with the same D N A sequence which are bounded by the imperfect inverted repeats 5'AG(T /A) and 3'A(C/T)T, characteristic of the torn element of D. ananassae (Tanda et al. 1988) and the 297,17.6, and gypsy elements of D. melanogaster (Inouye et al. 1986; Marlor et al. 1986; Saigo et al. 1984). Each of the nomad LTRs contains eukaryotic consensus sequences for transcription initiation and termination. These include a putative CATT box and T A T A box which as for many transposons may be non-functional, and a polyadenylation signal, A A T A A A (Figures 22 and 23). Both LTRs also begin with a 112 bp D N A sequence which is tandemly repeated in each LTR. Duplication of specific sequences in the U3 regions of LTRs has been noted for the 297 and 17.6 elements (Kugiyama et al. 1983) although the reason for these large tandem duplications is unknown. The position of the P-element insert in E(var)45-19 was determined by comparison of the sequence flanking the 3'P-end (obtained by sequencing of the rescue plasmid shown in Figure 20) to that of the nomad element. Comparison of these sequences revealed that the pUChsneory+ P-element in E(var)45-19 was inserted into the 3'LTR of a copy of the nomad element (Figure 24). 7 9 A G T T AA GAAC C C T C T T C T T G C G C T C T T C G T C A G O A C T C AC C J ^ C GCTC GGC T C 120 G A A C C C T C T T C T T O C O C T C T T C O T C i O O A C T C A C C i C K O C T C O a C T C T C O T O T T T T C M 240 a AACAAGTGC C OTTOOTC GCAC TCAGGGT GAGGGGTC AAC GGGGGAAGC GGA>$g!£g$3)£Ej3 CAGCGGGG C GGGAGAA GAGGC C C C AGTCTCOAAC GGACAC A T A A C GOAAC C GGTAG CAGAT 3 60 C G C G A A C T G A A T C T T A A A A T A A A G C T A A T C O T A A A C T C G A A C C T T C T T A A C T A T C T T G A C T A T T A T T T O G A G A A C C A C A G C A T O T T G G T T G T C A T A T C A A G G T G A G G T A T G C G G C A G G G A 480 OTGCCOAaAACCCTGATOCAAGTaxiAACTTG^raTTAAC^ 6 00 LTB J C GTGGTQTOCATAAGTCAQATTAAOATCTQAAATCCATAAATGAAAAAGAAGTOCTGCGTGAGCTGTGTATAAAATOATAAAATAGCAATTACCCGCTGCCGGGGGGAACTACOCCCATCC 7 20 r n n n n r n r x x r x x x T A T T Q C A T A A T T C A A T A A A A G G T Q T A A A A T T T C T ^ ^ B40 O A C G C C A C G T C G C C C A T G C C G A G C G C A A A A G T T G T A C G A T A C C T A T A A C A T A A T T A A A A C A C G A T C A A C C C A C T G C G G C G G T A C G G C T T G T G G G A A A A T T T T T T T T T T T T T C T C T C C T T G 9 60 CCAATTCGCGAGTGCAAAAGATTGTGTATAATAAAC C A A T A A T T A A C C A T T G C A G C A G T T T A C C T G C GGCAGTACGAGTAATATGAGCGCC CAGAGTGATAAGGTGGTGTGTGOCAGCTT 1080 GTTG GATAC GTTAAGTGGTG TOOAATGC ACCCAAAAAAAACCGCCCAACAAGTTGTGTGGCGGCCGTACCTTAGTAGGCAACCAGCCAAAAGGGATATTACGGAACCACCGTGCC CAGTG 1200 C C GAAATAAATTAGAGGTCA TCAATAAAAAACTGTAACAGCACG CAC GCAAGGAAAAAATATTGCAAAATGGAATAGC GCACAAAAATTGT A T A A A C A C ATGCACAA CACCACAA T T C A A 1320 X f i n x x x x r x x x X T A T T C A T Q C T Q T A Q O O Q T A C A A C C T A A A C Q A C O A A A A C T A A T A A A G A Q C A T A C A ^ 1440 x > x , T - x x x r i x x x x x r i r - x » > r i x x n x x r x n x T ' x n ^ T ^ T T ^ x ^ ^ 1560 - ORF1 • intron C G C A A A C T A A A A A T C A A A A T G G A A G A G A C C C T G C G T G C T C T T A G C G A G T C C C T C A A T G C C C T G A C C A A C G T G G T G A C A G G C A T T A A G G A A G A T A T T A A G A A A A A T A A T G A T A G G T T G G C T 1680 M E E T L R A L S E S L N A L T N V V T G I K E D I K K N N D R L A > A T T T T A G A A C A G G A G C G C G G G A A C G C T G A C C C T A C G G T C G A C C A A C C G C A A C C C C T G G T G C G C G C A C G C A C C G A G TATGAGCTaAGAGAGA T A T C G G T C C T C C C T G A C T G C G T C A A A G A A 1800 I L E Q E R G N A D P T V D Q P Q P L V R A R T E Y E L R E I S V L P D C V K E > C T G C A G G C G T T C G A A G G A C G G C A G G A G G C T T A C C T G T C T T G G A T A A A C A G G G C A C A G T C A A T A C T G A C C G A A T A T G A C T T G A T T A A A A C C A G A C C C C T G T A T A G G G C A A T T G T C T T G C A T 1920 L Q A F E G R Q E A Y L S W I N R A Q . S I L T E Y D L I K T R P L Y R A I V L B > A T T A G A C A G A A A A T A A G G G G A C A C GC C G A C A T G G C C T T G G C G G C C T A T G G C G T C C A A G A C G A C G A T T G G G A C G A C A T A A A A C G A G T C T T G G C G C T G C A T T A C G C A G A C A A A C G A G A C T T A 2040 I R Q K I R G B A D M A L A A Y G V Q D D D H D D I K R V L A L B T A D K R D L > C G T A C G C T T G A G C A T G A G C T T G G C G C T A T G T G C C A A G G T T C T A G A C C A C T A G A T A G G T T C T A T A T G G A C G T T A A T G G C C A T C T C T C G T T G A T C T T A A A T A A C T T G A A G G C C A G A A A C C A C 2160 R T L E 8 E L G A M C 0 . G S R P L D R P Y M D V N G H L S L I L N N L K A R N H > C C T C G T G A A G T A G T C A A C G C T T T G A T A G A A A C C T A T A G A G A C A A G G C T T T G G A T G T T T T A T T C C G A G G A G T G G G G A G A G A T T G T T C C A A A C A C T T A C T T G T C C G C A G C C G G A G G A T T C T A 2260 P R E V V N A L I E T Y R D X A L D V L F R G V G R D C S K H L L V R S R R I L > C C A G A G G C T T A C T C T T T T T G T A T G G G A T T G C A G A A T G T A A T G T C A A G A A A T T T C A C A G T T C A G A A C T A T C A A C C G T C A G G T G C C C C A A G A T T C G C A G G C C C A T A T C A A C A T C A G G C C A G G 2400 P E A Y S F C M G L Q N V H S R N F T V Q N Y Q P S G A P R F A G P Y Q B Q A R > C C A C C G T T C C G A A C C C C T T T T T C T C C T G G T T C A G G C A G A T T T T C G C A A A A C T C C T A C A G A A C T C A G G G T C C T A G A C A G G C C A T A A A A A T G G A A T C C A A T C G G T C G G G T C A A T C T T A C C A A 2 520 P P F R T P P S P G S G R F S Q N S Y R T Q G P R O J L I K M E S N R S G Q S Y Q > T C A G G A T A C A G T G G T C G C C A G G A A O A A G G C T C C G G T A T T A A G A G A A T G T C C G A A G G A A A C A A C C C A T T C C A A A A G G C A C A A A G A T T G T A C C A C A T G G A A T T G G C A C C A C C C C C G C T A G C C 2 640 S G Y S G R Q E E G S G I K R H S E G H H P F Q K A Q R L Y B H E L A P P P L A > C C G G C G G C T A G T G G A G A T A A C C A A G G A C O T T C A C A C G A G G G T T A C T A T G A T G A C G A G T C T C A A G C T G T C G A G A G A A G C A A C A A T T A T C C T C C G C A G A A A A A C G T G G A A G G A G T T A C A G A T 27 60 P A A S G D M Q G R S H E G Y Y D D E S Q A V E R S H N Y P P Q K N V E G V T D > , ^ ORF2 O R F 1 ^ 1 G C T C C A C A T A A C C T T G A G A C T G A G G G A G G G G C A A A T T T T A T G A C C A A C G C C T C T C C A G T G T A C C G T A C T T A G A G T A T G C T A C G G A G A G G G G A G A A A G G C T G A A G T T T T T G A T C G A C A C G G 2 680 A P H N L E T E G G A N F M T N A S P V Y R T * G R G K F Y D Q R L S S V P Y L E Y A T E R O E R L K P L I D T > G G G C G A A C A A A A A C T T T A T T A a C C G A A G A C T T G C A G C C G G G T G T A C C A C A G T C C G T A A A C C C T T C T C C G T A C T G T C C G C T G C O G G T A A C A T C A T G A T A A C G C A C C G C C T A G T T G G T A A A T 3 000 G A N K H F I S R R L A A G C T T V R K P P S V L S A A G N I M I T B R L V O K > T C T T C A A A C C A C T A G G G A A C G A C T C G G A T A T T A C C T T T T T C G T A C T A C C G A A T T T A C A T T C C T T T G A T G G T A T C A T T G G C G A C G A T A C T C T C A A A G A C T T A A A A G C C A T A G T G G A T A G G A 3120 P P K P L G N D S D I T P F V L P N I I H S F D G I . I G D D T L K D I J K A J . V D R > A A A A C A A T T G T T T G A T A A T A A C C C C A G G A A T T A A A A T C C C T C T T T T G G C G A G A G C T T C A A T A A A C G T T A A C C C G C T A C T C G C C G C C G A A C A C C C A G A T G G T A C A C A A G A A A T T T T G A A T T 3240 K N N C L I I T P G I K I P L L A R A S I N V N P L L A A E B P D G T Q E I L N > C C C T T C T C G G G G A A T T T C C C C G C A T C T T C G A G C C C C C C T T A T C T G G A A T G T C C G T G G A G A C G G C C G T C A A G G C T G A A A T C C G G A C A A A C A C A C A A G A C C C G A T C T A T G C T A A A A G T T A T C 3 360 S L L G E P P R I P E P P L S G H S V E T A V K A E I R T N T Q D P I Y A K S Y > C T T A C C C A G T C A A C A T G C G C G G A G A A G T C G A A C G T C A A A T C G A T G A A C T G C T G C A O G A C G G T A T A A T T C G A C C C T C T A A T A G C C C T T A C A A T T C C C C T A T C T G G A T A G T C C C G A A G A A A C 3480 P Y P V N M R G E V E R Q I D E L L Q D G I I R P S N S P Y N S P I W I V P K K > C T A A A C C A A A C G G A G A A A A A C A A T A T C G C A T G G T A G T C G A T T T C A A G C G G T T A A A T A C C G T C A C C A T A C C C G A C A C T T A C C C C A T C C C A G A T A T A A A C G C T A C G C T A G C C A G C C T T G G C A 3600 P K P N G E K Q Y R M V V D P K R L N T V T I P D T Y P I P D I N A T L A S L G > A T G C C A A A T A C T T T A C C A C C C T A G A T T T G A C T T C T G G A T T C C A T C A A A T C C A C A T G A A G G A A A G C G A C A T T C C A A A G A C A G C T T T C T C T A C T C T A A A T G G A A A G T A C G A A T T C C T C C G T C 37 20 N A K Y P T T L D L T S G F H Q I B M K E S D I P K T A F S T L N G K Y E F L R > T A C C A T T C G G T T T G A A G A A T G C A C C T G C A A T C T T C C A A A G A A T G A T C G A T G A T A T T T T G C G C G A G C A T A T T G G C A A G G T C T G C T A C G T T T A T A T T G A C G A T A T C A T C G T C T T C A G T G A A G 3 640 L P P G L K N A P A I P Q R M I D D I L R E H I G K V C Y V Y I D D I I V P S E > A T T A T G A C A C A C A C T G G A A A A A T C T C C G A T T G G T A T T A G C G A G T T T A T C A A A A G C T A A C C T C C A A G T G A A C C T T G A G A A G T C G C A T T T T T T A G A C A C G C A G G T A G A A T T T T T A G G A T A T A 3 960 D Y D T H W K N L R L V L A S L S K A N L Q V N L E K S B P L D T Q V E P L G Y > TCGTCACGGCCGATGGCATTAAGGCAGATCCGJLAAAAGGTCAGAGCGATTAGCGAAATGCCTCCTCCG^ 4 060 I V T A D G I K A D P K K V R A I S E M P P P T S V K E L K R F L G M T S Y Y R > A G T T C A T T C A G G A C T A T G C G A A G G T T A G C A A A G C C C C C T T A C A A A C T T T G A C G C G T G G A T T G T A C G C T A A T A T A A A G T C T T C A C A A T C A A G C A A A G T G C C A A T T A C A T T A G A C G A G A C G G 4200 K P I Q D Y A K V S K A P L Q T L T R O L Y A N I K S S Q S S K V P I T L D E T > C C C T A C A G T C T T T T A A T G A T T T A A A A T C A A T T C T C T G G T T C C T C C T G A A A T A C T G G C G T T C C C C A T G T T T C A C T A A A C C T T T C C A T C T A A C C A C O G A C G C T T C T A A C T G G G C C A T C G G A G 4 320 A L Q S P N D L K S I L W P L L K Y W R S P C F T K P F H L T T D A S N W A I G > C T G T C C T C T C A C A G G A C G A C C A G G G T A G A G A T A G G C C G A T A G C G T A C A T T T C C C G T T C A T T A A A T A A G A C G G A G G A A A A C T A C G C T A C T A T C G A A A A G G A A A T G C T C G C G A T A A T T T G G T 4440 A V L S Q D D Q G R D R P I A Y I S R S L H K T E E H Y A T I E K B H L A I I W > C A T T G G A C A A T C T T C G G G C T T A C T T A T A T G G C G C T G G T A C T A T T A A A Q T A T A T A C T G A C C A T C A A C C T C T A A C G T T T G C C C T A G G C A A C A G A A A T T T C A A T G C G A A G C T A A A A C G C T G G A 4 560 S L D N L R A Y L Y G A G T I K V Y T D H Q P L T F A L G N R N F N A K L K R W > A G G C T C O T A T A G A G a A A T A C A A C T O C a A A C T C A T C T A C A A G C C T a G G a A A T C T A A T G T G a T O X K T G A C 4680 K A R I E E Y N C E L I Y K P G K S N V V A D A L S R I P P Q L N Q L S T D L D > C T A A T C C C G A G G A T G A C A T G C A G T C T T T G G C T A C T G C C C A T A G C G C T T T A C A T G A C A G T T C A C G A T T G A T T C C C C A C O T T G A A T C T C C A A T C A A C G T T T T C A A G A A T C A A C T C A T T T T T G 4 800 A N P E D D H Q S L A T A H S A L H D S S R L I P H V E S P I H V F K H Q L I F > A C A C A A C C A G G T C A A A A T A C T T A T G C G A G C A C C C G T T C C C A G G T T A T A C T C G C C A T C T G A T T C C T C T C A A A Q & C G 4 920 D T T R S K Y L C E H P P P G Y T R B L I P L K D G S L A D L T N S L Q S C L R > C T G T A A T A A T T A A C G G C G T C A A A A T C C C G G A A G C A C A T T T G C A A C G C T T T C A G T C C A T C T G C T T A G C G A A T T T T C T T T T A T A C A A A A T T C G G A T A A C G C A G C G C C T A G T G G C G G A C G T G T 5040 P V I I N G V K I P E A B L Q R F Q S I C L A N F L L Y K I R I T Q R L V A D V > C T G G C G C A G A G G A A A T T T G T G A A A T A A T T G A A A A A G A A C A C C G T A G A G C A C A T A G G G G C C C T A C G G A G A T T C G T C T C C A A C T T T T A G A A A A A T A T T A T T T C C C G C G A A T G T C C A G T A C G A 5160 S G A E E I C E I I E K E H R R A H R G P T E I R L Q L L E K Y Y P P R M S S T > T C C G T C T G C A A A C T T C C T C A T G T C A G T G T T G C A A A C T C T A C A A G T A C G A G A G A C A C C C T A A C A A A C C A A A C C T A C A A C C T A C G C C A A T T C C T A A C T A C C C A T G T G A A A T A C T T C A C A T C G 5280 I R L Q T S S C Q C C K L Y K Y E R B P N K P N L Q P T P I P N Y P C E I L H I > A C A T T T T T G C G C T C G A A A A A A G G T T A T A C C T A A G T T G T A T T G A C A A A T T T A G C A A G T T T G C C A A A C T T T T C C A T C T G C A G T C A A A A O C A T C T G T G C A T T T G C G A G A A A C T T T G G T G G A G G 5400 D I P A L E K R L Y L S C I D K F S K F A K L P H L Q S K A S V B L R E T L V E > C C C T A C A T T A C T T C A C C G C C C C T A A G G T C T T G G T T T C G G A T A A C G A G C G A G G G T T G T T A T G C C C C A C A G T G C T C A A C T A T C T T C G G T C T C T A G A T A T C G A T C T G T A T T A T G C T C C A A C C C 5 520 A L B Y P T A P K V L V S D N E R G L L C P T V L N Y L R S L D I D L Y Y A P T > AGAAGAGCGAAGTAAATGGTCAAGTCGAGAOJlTTCCACTCTACGTTCCTAGrAAATT^ 5640 Q K S E V N G Q V E R P B S T P L E I Y R C L K D E L P T P K P V E L V B I A V > o « F 2 - ^ 1 ACCGCTACAACACTTCCGTTCACTCGGTAACGIAATCGJULAACCIAGCAGACGTTTT^ 5760 D R Y N T S V B S V T H R K P A D V F F D R S S R V K L S G P * G G A C A T C A A G G G C T T A A T T G A G T A T A A G C A A A T T A G A G G T A A T A T G G C T C G G A A T A A A A A T A G G G A C G A G C C A A A G T C T T A T G G G C C G G G A G A T G A A G T T T T T G T T G C A A A T A A G C A A A T 5 880 introny A A A A A C A A A G G A A A A A G C G A G G T T C A G A T G C G A A A A G G T A C A G G A A G ^ C A A C A A M 6 000 v-iw\r\'iw\\*\*\ei*\\ctira\\**\a\\r\\cax\Aav*\v\\\\anaav^ 6120 AAAAAAAAAAAAAAAAAAAAAAAAAATQAGTTAAftAAATACAAAAAGAAATArAAAltXAAAr™^^ 6 240 A A A A A A T A A A A A T A T A A G T A C A C A A A A T G T A C C G T A C C C C C A C A C A C T A C G T A G T C T T A G A A C A A C T T A G A C G A C C A G A T A T T T A C G A A T T G T C T T T T T G T A A G C G C G A T T T C T G C A T G C 6360 GGC G C A A A T C C C G C T C A C T G G A C T G G C T G G G G T C G G C T T G G A A A T G G G T A G C T G G A T C T C C A G A T G C T G C T G A T T G G A A C G C C G T C T T G G C C G C G C A A G C G A C G G C T T C G A G G A A C T G C A 6480 | ^ 0HF3 A A A A C T O G A G G A G G C T A G C T G T A T C C C T C G X J C T A C T G J L A G T A A C C A A C G A G T G G T T A A G C A A G T C 6600 S N Q R V V K Q V D D G M L L L T N F | N O T | L R T A A > A G A A C T A C G A C C T G A T C G G C T C C T T T A T C A T C C A A T T C G A C A A T G A G A C G A T A A T G G T C A A C G G T C A A A A C T A T T C C ^ 67 20 E N Y D L I G S F I I Q F D itt E T | I H V N O Q , N Y 3, S Y S V S H L M A M P A V L > G C C A C A T A A C G G C C A G C A A C T T T C A A C T T T C T C T G G A A T A C G T C C A C G A C G T G A G C A T G A A G A A T T T G G A A A A G A T G T C C A A C A T G G C G A G T G A G C T A C T A G C C T C T C T T C T C A C C G A G G 6840 S B I T A S N P Q L S L E Y V B D V S M K N L E K M S N M A S E L L A S L L T E > CGGCACTCGCAATCTGCATATTCCTAGGCTTTTATTTCCTATGGAAGlAAGCTaATGTCCACCJLAAGGCATGCCC 6 960 A A L A I C I F L G F Y P L W K K L M S T K G M P D V R E I A A N L H A L G Q T > 0 R F 3 ^ , . ^ LTR A G C T G A A C A A G G C T C A C T A A T C T G C G G G A C G C A G A T CTTd&33$iJtil!UiS(|AG A T A A G A A C C C T C T T C T T G C G C T C T T C G T C A G G A C T C A C C A G C G C T C G G C T C T C O T G T T T T C G G G C C C C 7 080 E L N K A B * d G T C A G C A G G C G A C T C G G G G C C T G T C T A G T A A C A T G T T C G T G T A A G T T A A G A A C C C T C T T C T T G C G C T C T T C G T C A G G A C T C A C C A G C G C T C G G C T C T C G T G T T T T C G G G C C C C G T C A G C A 7 200 G G C G A C T C G G G G C C T G T C T A G G A A C A T G T T T G T G T A T G T G T G C A T T C G G A A C A A G T G C C G T T G G T C G C A C T C A G G G T G A G G G G T C A A C G G G G G A A G C G G A T A T A A A A G C A G C G G G G C G G G 7 320 A G A A G A G G C C C C A G T C T C G A A C G G A C A C A T A A C G G A A C C G C T A G C A G A T C G C G A A C T G A A T C T T A A j ^ f c f t t t & G C T A A T C G T A A A C T C G A A C C C T C T T A A C T A T C T T G A C T A T T A T T T G G A 7 440 e G A A C C A C A G C A T G T T G G T T G T C A T A T C A A G G T G A G G T A T G C G G C A G C C ^ G T G C C G A G A A C C C T G A T G C A A G T G G A A C T A G C G T T A A C T 7528 L T R ^ 1 Figure 22. Nucleotide sequence of the nomad element. The plus strand nucleotide sequence and predicted amino acid sequences of the nomad element are shown. The nucleotide sequences corresponding to the putative CAT box, Hogness box, primer binding site, polypurine tract and polyadenylation signal are indicated as a, b, c, d and e respectively. The weak consensus Su(Hw) protein binding sites in the leader region are underlined. The nucleotide sequences containing the three ORFs are aligned with the predicted amino acid sequences and endpoints are indicat-ed by arrows. Putative N-glycosylation sites in ORF3 which conform to the N-X-S/T consensus are bracketed. 80 U3 112 bp repeat 112 bp repeat 7 R U5 C A T T box nt 233 T A T A box P o l y A + P o l y A + signal site Figure 23. Schematic diagram of the nomad LTR. The nomad element contains LTRs of a U3, R, U5 structure typical of typical retrovirus-like elements. Structural elements were determined by D N A sequence analysis. The U5 boundary was determined by sequence analysis of polyadenylated cDNAs. 81 pUChsneory"1" Figure 24. Structure of the nomad element in the 63A region in E(var)45-19. The pUChsneory"1" P-element has inserted into the 3'LTR of a copy of the nomad retrotransposon. 8 2 3.3.2 tRNA primer binding site The internal D N A sequence of retrovirus-like transposons begins with the putative tRNA binding site immediately following the 5'LTR (Finnegan and Fawcett 1986). The primer tRNAs of a few retrotransposons in Drosophila have been cloned and divide the majority of well characterized transposons into phylogenetic groups based on primer binding site sequence. In order to determine the relationship between nomad and other retrotransposons the tRNA primer binding sites of cloned retrotransposons were compared to the nomad sequence. The putative tRNA binding site was found to be most similar to the D N A sequences in the tRNA binding region of the transposons gypsy, burdock, and yoyo (Figure 25). It has been noted that this region bears homology to Drosophila tRNA L y s (Marlor et al. 1986). The transposons gypsy, nomad, burdock and yoyo represent a separate class based on this putative primer binding site consensus, suggesting a common ancestor. 3.3.3 5' leader region There is a long leader region between the primer binding site and the beginning of the first long ORF which was examined for known regulatory regions. Three weak D N A binding site consensus sequences for the Su(Hw) protein were found in the leader region (Figure 22) in an A-rich region, a characteristic of the gypsy transposon (Smith and Corces 1992). 3.3.4 gag, pol, and env genes The nomad element contains D N A sequences coding for putative Gag, Pol, and Env protein homologues, indicated in Figure 22 as ORF1, ORF2 and ORF3 respectively. The order of these putative coding sequences is the same as that observed for both vertebrate retroviruses and other retrotransposons in D. melanogaster. ORF1 and ORF2 overlap slightly and are out of phase by +2. The D N A sequence in the area of overlap 83 5'LTH -nomad Ad$33a^Q2&AM2£2S&AQCG& gypsy AcwGmccaMCcm<zwK-,m yoyo AC^^^3MM^CTCCA(^CG : burdock hCWGP&XCM*m^AWJA Figure 25. Primer binding site consensus for the gypsy-like transposons. Arrows indicate the beginning and end of the primer binding site (PBS) and 5'LTR repectively. Genbank accession numbers are gypsy (M12927), yoyo (U60529), burdock (U89994). 84 between 0RF1 and ORF2 contains the sequence A A A l ' l ' l T , which is similar to the consensus C G A A A A T T T T C observed in the transposons torn, 17.6 and 297 and may facilitate ribosomal frame shifting. The predicted amino acid sequence of each of the ORFs are most similar to those predicted from the gag-like, pol-hke and mv-like genes of the yoyo transposon of Ceratitis capitata suggesting that the nomad and yoyo retrotransposons are phylogenetically closely related (Figures 26.1, 26.2, and 26.3). The pol gene of Moloney murine leukemia virus (MoMuLV) encodes a multimeric protein with protease, reverse transcriptase, RNaseH and integrase domains (Schinnick et al. 1981). It was therefore of interest to determine if ORF2 shared these domains. Indeed, the predicted amino acid sequence of ORF2 is homologous to these enzyme domains and their relative order is consistent with that of MoMuLV and all other retrotransposons with the exception of the 1731 and copia transposons in which the relative order of the reverse transcriptase and integrase domains is reversed (Figure 27). The integrase domains of retroviruses and retrotransposons are similar to bacterial resolvases which have been shown to possess both D N A binding and DNase activities (Abdel-Meguid et al. 1984). The predicted protein product of the nomad ORF2 derived integrase was examined for known motifs and was found to contain a putative Cys2-His2 zinc finger D N A binding motif next to the highly conserved DDE motif which is characteristic of the active sites of integrases (Polard and Chandler 1995). The nucleotide sequence between ORF2 and ORF3 contains a very A-rich region. The third ORF is similar to the env-like gene of the yoyo and gypsy transposons although the predicted nomad Env protein is much shorter (Figure 26.3). The short ORF was also sequenced in cosm.2 and cosm.6, which contain nomad elements, in addition to cDNAs isolated from two independently generated cDNA libraries and confirmed that the sequence shown in Figure 22 is not that of a defective copy of the nomad element. The predicted protein product of the env-like gene of nomad was examined for known motifs. The Env protein of the gypsy transposon has been shown to be N -glycosylated (Song et al. 1994) like the Env protein of retroviruses. Three putative N -85 nomad yoyo gypsy nomad yoyo gypsy nomad yoyo gypsy nomad yoyo gypsy nomad yoyo gypsy nomad yoyo gypsy nomad yoyo gypsy nomad yoyo gypsy M A H N D I l J R MJSW A H N Y M@E T LIR~A| LS[E]S[L|N [A I^TNIW T]<3 IK E [D~JK K N[5|D R - -PSMLASAP R_A A A P P LQ P N PL Q P N P P TS A N AT PE L R[N| I^ IIR D K v K V|E]Y E S E D SW|I]E E|Q v G Q|A L|GR|P L D|S A TV|D 3J T M D P N Q IQ A L|JD N - 32 L 49 A 54 P Q P - - t V R A[R]T E Y E[L]R E I S V L P I B J D Q I I E E | R J F R D N [ L J T D M D K S L Q V E A P Q I K I Y E K V S V N P D D V R D V R C D I P L D 1 1 INRJAJQ S| I LJ T EIYJD L IK TR| K K|S|V E R| I L|K I|YJE[P|N M G S [PJY N|Q S IY A Y E L FK P|L Y R A IV] L H I R|QJK IR Oj P|K|Y|FG1 J E N V| IR N K I{V]G| S A H Y Q A V|A I LJR NK IRS E LS L I L N NJ LKAR N@ ALHYADKRDL T M|H YAP K R D L ILARLDC TYSDKTS — p RIEIVVNA B LS II I L N | K I A C["1 D I N E [ E | A M R J K K L T LV T[NJK Iv[M|TgE -Q EGAD TYRDKALDV T Y R D K A L D T LILNAEVRADALH E L G A[5]C Q G|S[RJP L D R F Y Q]M T C 1 1 Q G|R[R|TV H E F Y QJG L E|M]V R Q G D L P L M Q]Y L[F]R[G]V G R[D|C[S|K H[L]LV R S R R if: F v G[GJL S G|PJL[S R|L[LJG M K E P A A[F] I S G L K K A L[R|A VVFPAQPKD nomad PEA Y S F E | M yoyo PEA L H L|C] I gypsy LPS A L A L A V M S[R]N F TV Q Q N F[R|T I H A N MS IE R S M F A R F[A]G P Y Q|H Q|A R[P~ LLP L[G]M H H_Q H K P A KTV E E R[A|H S G[A]N|GJK S R F Q G K[ N Y Q - -fp|S - -G[A P N Q[Y]S L|P|R K P N LIP N S[YJ F R IP Q R N INK NKEEQG - -- -T| N N Q P F P F SIPIG S G YWQ LA Q D R N P H F P IN R F S|QJH P Q Y GQTNKDTQ AIQJ H QYQY HP P M E V D[|]S S R FR]Q Q prii • N A[F|K IQIAVI [QJP F l NN PlFQ K A[Q NFTIP PR P IQ - - L Y H M E LA P P P LA K P P I P M E V D E S L Q T P - - - R R Q R LN N V V Q P Q Y Q Q[Q]Q R FR P N R TE H Y[QJN H P N E S P IVPSNQ IR E Y E K T A K A A • E R K Q V E E ID N N N N IN I x| E Y A|V S A A |P Q P Q -PSD G G A[N]F M S N D[N| I L D[SJL N F L ^ G A P G C R S L N - - D G W I i G E P K N V E G V T E Q T[S]K D Y Y A P H N LE TE i Q Y SAQDNN! TNASPVYRT LEE NEYE FSD 72 92 108 278 307 319 330 361 370 374 413 414 417 467 451 Figure 26.1. Protein sequence alignment for the predicted G A G protein of nomad with those of the gypsy and yoyo transposons. Boxes indicate regions where >65% of amino acids are identical and shading indicates regions where >55% of amino acids are homologous. 86 F a » 7 nomad •—^•-Protease K c l L l x . [ p 7 g l a T R KH -• i r e Lf^] r Q N B R C K V L T 3 H - F F S L P I H N T I C X V r T S N • n o L _ J l ON T S TV I H T aw .'p M T B K N S r i l R R - L A A O C T 1 1 I 5 P N - L V K N S l|p]M I D • I 9 Y I R P V K I L K N _ ] Y I Q P L P F . L X N X » I | _ J I S~Ofl|Q Q _ J T X Q a L S T L f L I H C t X N A A I P Y I Q 0|lja Q Q X X Q 3 R Q Q T F I I I Q T O K T V I P H D | £ ] L N - D L X M L P R N 3 I [ F ] X X T - - X P[FTY V K E I S B H Y D 8 l i t M I N Ijffj L X V N K 9 . l l . l t a X I Lj N X M X T H R L V O K FJ K I K X T H U T F X D I f 1 I K H K C L H K T V K S L H_Jc 8 1 V I Q K C F I K L_]N T l H X V P N N F P I P Q D O I i a L D F I K K Y N C I L E F H D Q I D W | ? | T D K N 7 f i t CDGIIQIE'F I K K I N C Q I D L N 0 I I D »_Jl R T F K P L 0 I I - - ID I TJF OLK - - D - - 18 L XDF J H H i | - a «r QJF f L H D r * D D Y -U H F T I I N I -P V L P N L K 3 P -F V L [ P ] T L K S F -F L . L D S L M A F -L llols K L 98 O R X L 62 X X L 96 B T I £[<jJL D l T L R P K N P R N - I N I P I I H T - I, D N K I I L P A R S X X E _ ] N N L K F F I Y I F I A Y S S O I N T T L L P A R S lij.i ILlKH t O I V I M I KB D T V * X. I D Q T l K L l f 111 - - f R l g l Iv Y I P I P E l i t 3 a D Q I I I X KLST 8 0 F X L 0 8 L N Q IXTF X - - - - 170 torn LNKAQOI I H Y K T H T I T L F D K T Y F L I P T D S - - NKCiQFFYTQ D S Y E K P I P - - - I I.D KX I D 7« P f KL DM t - S P I I T Y K - - - - 131 17-.0 U IXKKTI IVKDOKVTi .YNlK l IKI . r i a U T U I Q I K t Q NVNHXPCTMLR Q FNKISP I L I I D U R L Z H LHNIIRQR 172 nomad L KDLKAIVD II K I N C L I I T P 0 X K I P L I i A l l S I NTI - - P I I AA I K P D O T J I I 150 yoyo LKQLKAIX F T S K N H M L I K N K I K I A I K Q Q N JTSVNNTD I I I H I T T D I Q A U 159 Oypmy L T g A O V K L I I I j A I O I L I I C - I I M K L K y r i - - CP ! :Y I f I D V,B D 1 VVPDSVKRI 120 odrdocK U_K S a N A T t D P I I I K t i m N - I I l V I I I Q F L K - - - CD S V I t AK I I N I V7P N Q I I N K 151 mdg-l I V I R R i g L I I T D t H V L Z P N Q I l O t l l l I A I A L V S T Q N V I i I k l I R f t 1 K D A I V S 8 A I I I 8 I I t D D y D V T M A N I I N I A Q K T I I V L K L L K - - FP a LFKSD 22G US 0 V V > A L H H I * D » N U I t N g i i a t 9 n v » I T I A I I 8 N T I V R I L N M D I D Q L VNIDTIK Y 1 t I, I I V IVVf l A l l I H RNXTVLSQLKKNFPILFKaQ 278 S9T~ yoyo oypmy 472 N K F K D L Q Y F I (ijaJR L I I T NT I Q K Y H D I Q Y H I Q D X L T F T M Q T o n n IIFTF. P P I S a TPs V X T A V • Reverse transcriptase nqxrrrip» xpito 4 6 0 " " t B Y A D 4 2 1 C[P N F A D 4ei , _lo D Y A K 440 L P [ L K D Y A K 449 >TlK D F l l 4 1 1 I K D F A 3 442 [ X H F T X 517 CJKBF[XjD 569 gypmy tu it• I, >. - A SOT T 7 . » T K T I K H T K T I R HIY T K T P R H| L9N1 R Kjli K 8 U i l l t i A It O X ' " A I> KB VAINH IIJW All I H yoyo gypmy I > 11111< > c Ac mdgf •** 7 .2 FQID • I Q 1 D -I IRV QJTJQIH a] 4 0 S L AITJAJH -  q  al -• A A T i l H aj -• I A 1 iUjpJ-* a QRNTCAO - A I I P N I N I -A VI DMN D t - A I X D U B DLIj -A, L N l I IR I X - DI I I t QI PYT1 • I L I L T - YTJTHTD • I I I IT • r T T J I T I n i l Q U I F X I I RJ P H V X S • I X L I I I I I - K I N I K M | P | N I I I L K V T T R F Q I K Q X - S 9 K 1 Q L D L 0 K Q T K X I A S Rl i I NLK KfRa W L H K L K K J P I f L Y F A L a N RINI T y A L 8 NX M T A V A D R Nt Y A V 8 D R N P N| Y L F 3 H R N pffl T i n s M v|j__a si NJYfpJK X[Q]I I F I K : XJQjI M XX ID Q H a V R Q T T VJFiO N -S ITT IHYNNM TV INAKQFJLjLDKF X a S D K W K V X Y»TT VXtYjL fA D A L S R A D A L fl X V X D A L S X y|v A » „ viv A F I X Y. -- - L hlT F NEJO VI. F 3 K 3 P P D - I X V T KY - - I N|V 1 K(N Q L IF D T T R - S K Y I C I R P - - I NJA U N O I I I K TAQ T 8 SY Q F L I P - - L tlC FRNQXILXAARFPLKRHLV L|F|R " " VttJCUJR Nfl l V I DIBT A IQVIN HI DA KKY'VXLKXDXKXC LJiK R N V Y K V I TtiflS IV R K V V T L Q L SB 8 X C L Q K H I L ¥ • I I T T I Q Y D V I T I H AKS XTLIL D H U H I 1NHH1I 632 I X K H F fl X 593 II T Y L 3 1 - 633 3 L N fl L I TDLDAN 634 1 Q DO INS - - LT - 634 9 LWA LQNI 594 V IX v L I S I 625 3XLKAINR Q 694 I T a - t 746 R S L F i r i L X M V O f l Y * - X S L I - R 8 T X • I T 0 I IL N S V S S I A L ! L K H ' I T T Y A yv A D V I O A I I M D V D F I I V Q R A H - XXX V W T T Y Tlx V I - -VIDADFXXXLTAY-RXIXWPIYTJXVrT - -I IDADVIVXQAAH - K L . A I N T K Y T K I L - -OVXXPIAHLQXFQSXCLAHFLLYK XX - -A I I T D D H I L O R I 0 N X H P X H F S F X R I X Y T R X T V X D L V R X S A I K C D L F T L A S P Q H D L X A X F F A T Q F R - * H C K H V V L D X T D K N AIHCXLPVLAFXQN8LVNDFPATTFR H T M K M V S D l F N Q I N i n g T O l l F I I O I F i r V T I R N FpTTK K O N X I L K N L K I A I L I L N K V T K I D X I D I I Q l K N A t N X X I M H V I I D t Ttxkj N O I I I U N L X V A [ L J L M P V T Q X N -STTKIH F Q X a T U J M P F X [RHP q Kl L P Q K 0 I •TIT PUjT - T L H T P I T T PlNlpflKC R T ^ J I I TlR T ILB« T x xx F v_yfrraY s i x DDE domain POH RDSFV I D I Y S I I OX K X 'JL l f lT PJKlPXXCXXXFR I D I Y B I t O X " I P N Y t C I I L K I D I FALXKX VIP 1 Y P O I IV H I DI Y HI N O R I M V H I D I J F 8 T S P I S I V O X T L H I D J F S T a T ( F | A T A F D x v L»^Ep r o p L p R H X T Q IJTY D I H T R I K A l Q I j l j I D H I C a - KK9ALYI 710 - - O Y TlR H L X P L RD QILADLTNSLQSCLRFVXXN 717 -TYH1RH I IRRPIYT1RK L TNHLXRYLNPSVTN 710 R H L X 8 F T D - - X B W t L X T L K K V V N P D V V N 672 T F V rjjfj O IKTJRKLXQFLD - - K l T L J IQRIRDVVKPDVVN 703 " " 1 X 0 I I TJR I D l t N I Y I N l I IDLDQFFQRLNIFAR3 789 i  K I I AUJ Y SVaDLYTNOILDLDQFLQXLKLOAOI 842 Zinc finger i f t n i K L i,[Tr|p[ffli c H F K X XjX L ft Abl 7 KJEjTl I T A R I X l X K 1 H R R VKRU XR * A I K N R I |V I L I B N I L S K Y H IL 3 T L II A Hi p D F s i a o H JIQKKTKL X Q K T T X L P1II R L 0 A T 1 1 X A 0 K A A 0 I N I K 0 RAAQXNVX0 T L p m F X ! F O X L L I U I tJ HTlFThi B H Hfi F IB S X L Q |D D P I 0 O otejTbJl T K T L A R V X R Y F V c c c WTPIII FfAl i ofilx TH3D W x x c x NJA LJM R X F N I Q U T 8 D i l l CKNAtHRIPD K ELUK U D N I I C X StA L X 1 I F I S iqFJA T L A T Ii D | K Flfl XtFix X L F K L Q D]X T\B id Q A R I V X X T A T I D I R L F I C I six FJS KJYJA I V Q P V V 8 RTIVDIT A KIFUll V 0 PlIlO S IL T I TD L I PfAJ I X X S V A B A X T V A X T\3Y D L T J K Y L V T V C O L 11 id Y L V A I J 0 L a HQ: IiG A L U I I I QDLLTSFC _LQIXIII .F1 IM0LMNFFI AJIFINFILKY F X 8 F I L K ] L LfTlQ N I I N : ONI I N QNI IN I L 0 I I Il N X I X X .Xx I V V A 0 I A A T F V I X AfTIS I Y V I X YJIJX I Y V R - Q L L K AJEIR D LLLIADRD qLLKADRD V 3 I N I t X I V J C N I 3T V Y C D N X dTIFCDNI dTITTON-Q T F I T _ | H -297" i y.o 472 F s[a]L A L K R WfLJK -F S S L A L K 3 W L X • F S _ J I i A L K K W L Z L> 1/C PT .VLNHR L ttma * x v F r^ LJz i t. N| III t V T I ' l t N(j_ 1 1 1 X 8 1 E Y K H Q X I D ! I Y K NIX I T 1 DDE domain EI IV1LQLNTAXMOVAP - - IVTRI L p 3 XTT] I tJxlx i l IXOVILQLMTAKTOVAD- W t W J rtj KlTJ I NJEJK I I I S V I L O L N T T K T O Y A D - - ^ J * M H T H ^ J 1 T T * 3J • L D I D L I I A t T g R I I V t JYS'JI'X. F X T F F Y T I B V N B r a XDXVNAP P L I a S S K I tHVDIANAP F LI IT I t i OJQl If K X X X N I T a T A H H H Q T L G | T J V I R | S | H J R | T | P N | Z 1 Y i L X I X N I T B TA H S H Q T v|_vlv« yldldRlTI L t_fj Y I I I 8 I D D I 1 V I L 8 X I I T I L I T Y X I N l a X N D X X X L O X M X N I L Y X X I I K T S P C I I T K L O K M B T V I , N I Y CLXDSLPTFXPVZbVHXAVDFlYrt C T R A H T l l l F I I L L I I I K K Y I f C L R L D I I T N D T V I L I LRXTXl j CLXLDSOMNDTVNLX L Q AT I SYI IVDKT-DMDIW I Y I I T D X T - D N D V I : i L o A T r BIXK -• I 0 Y I T Y C FIN -IL0 YFVYC Fl_ -O I I L Y A S H F I L D T H X F L Y AO Q P T L D A AH I F L Y A i 3 Q P I L . D T ADVFFDX I I I I F F 9 I I r i v v H t o A I D I I H I I C Y l L V F S R L P R Q r i D Y I L V F 8 R T S N L P K H S X 975 Q X 936 9 0 Figure 26.2. Protein sequence alignment for the predicted Pol protein of the nomad element against those of other retrotransposons. Boxes indicate regions where >65% of amino acids are identical and shading indicates regions where >55% of amino acids are homologous. The regions which correspond to the protease, reverse transcriptase, zinc finger and DDE domains are indicated by arrows. DNA accession numbers for those not listed in Figure 25 are 297 (X03431), torn (Z24451), 17.6 (1335613), mdgl (X59545), 412 (X04312). 87 nomad gypsy yoyo nomad gypsy yoyo nomad gypsy yoyo nomad gypsy yoyo Q P N S ~ S | N 2 R V V K Q V D D G M L S H L R E I N P V B D G V V H J H I P R H E L I T P | G I I I I N N F E A D Y E O T I1 I 2 0 Y L V T I1 * "PI T I M V N G Q - - - N Y 1 A T I N G s E F V N Ii S I T I » R T Y K N F N0 T Ii R T A A E N Y D L I A A H V S T D G S P E T L I •=0 N I V " M ~ N D N I R I M N S V S H Ii M E M P A V " L " K T L s K Q P G i V R S P L f J P V M K V M P H 1 A Q P T nomad s H I T A S N F Q L s L E | Y V H D V S M K N L gypsy N I V G H D P V L 3 I P L L H R M S N E N Ii yoyo p I E E S I T K L Xi s Ii E J A L S E L N V N Y P T E P R S S I T A A jjij] A I Ii W F V A Transmembrane domain LU* c G V \ A A N L | ~ E | A Q R T I D T N Q L Q [ ¥ ] I L G Q F N M I T E A T E T E L G F L N F M A S K A H H K L E T R Y F L - - W [K K G L I G S L A A I N Y F H L II Ii Y L A | K K | T K I S T K I N N Q T L E D K R F 3 3 348 362 67 385 372 H L L A S L 104 D V E S E G 422 H R T V N R 436 153 480 502 Figure 26.3. Protein sequence alignment for the predicted ENV protein of nomad with those of the gypsy and yoyo transposons. Boxes indicate regions where >65% of amino acids are identical and shading indicates regions where >55% of amino acids are homologous. The region which corresponds to the hydrophobic transmembrane domain is indicated by arrows. 88 Figure 27. Conserved structural features of retrotransposons (not to scale). The three structurally different groups of trans posons are represented. The major distinctions are the relative order of the protease (P), reverse transcriptase (RT), ribonu clease H (RNaseH) and integrase (I) subunits of the Pol pro tein and the presence of an ORF which corresponds to an env gene. 8 9 glycosylation sites which conform to the N-X-S/T concensus in ORF3 are indicated in Figure 22. The predicted Env protein also has a number of hydrophobic residues in the same relative position as the transmembrane domain of the gypsy Env protein (Pelisson et al. 1994) which suggests functional conservation of this domain (Figure 26.3). Collectively, these results demonstrate that nomad is a typical retrotransposon and that it shares structural characteristics common to endogenous retroviruses. 3.4 Analysis of nomad transcripts The nomad element produces two transcripts, 7.6 kb and 3.0 kb in length, which were detected in Northern blots. To determine the polyadenylation site of the genomic nomad transcript, cDNA clones from libraries generated by polydT priming of Drosophila RNAs were isolated and their D N A sequences were determined. The cDNAs isolated were shown to result from polyadenylation of the nomad transcript at position nt 7412, 16 bp downstream from the polyadenylation signal (Figure 22). The 3.0 kb transcript detected in Northern blots (Figure 28) is the same size as the subgenomic transcript produced by the splicing together of ORF1 and ORF3 for translation of the Env protein by the torn element and was presumed to result from the same kind of processing of the 7.6 kb nomad transcript. To demonstrate this experimentally, RT-PCR was performed on adult RNA using primers which flank the intron/exon boundaries of the nomad transcript. In addition to the 5.3 kb product expected from amplification of the full-length nomad transcript, a 1.0 kb product was recovered which resulted from amplification of the spliced subgenomic transcript. This RT-PCR product was sequenced, allowing determination that the 3.0 kb transcript detected in Northern blots resulted from the removal of an intron which spans the nt 1640-5942 of the nomad element (Figures 28 and 22). This type of processing of a primary transcript has been demonstrated for the gypsy, torn and 7AM retrotransposons in Drosophila (Leblanc et al. 1997; Pelisson et al. 1994; Tanda et al. 1994) and a number of retroviruses. 9 0 7.5 kb Figure 28. Intron/exon boundaries of the nomad transcript. Northern blot analysis of nomad transcripts demonstrates that nomad produces a 7.5 kb primary transcript which is processed into a 3.0 kb subgenomic transcript. The intron/exon boundary was determined by RT-PCR of adult RNA, followed by sequencing of the products as outlined in text, (note: the 12 kb and 7.5 kb transcripts are not well-resolved in this example) 91 3.5 Isolation of fusion cDNAs In order to determine if all of the cDNAs isolated were from transcripts of the nomad element, the nine cDNA clones isolated were subjected to D N A sequence analysis. The 5'- and 3'- end sequences of each of the cDNA clones were determined using vector primers. The comparison of sequences obtained from different cDNAs revealed heterogeneity in their structure (Figure 29). A l l of the cDNAs share a roughly 250 bp 3' terminus which corresponds to the D N A sequence of the nomad LTR. The 5' termini of several of the cDNAs were different. In order to determine if any of the isolated cDNAs contained sequences homologous to known gene sequences, I performed searches of the Genbank database using the B L A S T algorithm for identifying sequence similarity. The results of these searches revealed that in addition to the cDNAs which correspond to partial nomad transcripts (represented by the gt2 and IA cDNAs of Figure 29), a number of the cDNAs contained D N A sequences which contain 5' end sequences with no similarity to any Drosophila sequence in the Genbank database (represented by 2, gt3, and gt5 in Figure 29). Although no further characterization of these cDNAs has been done, I have interpreted the results of the sequence analysis of the 5'- and 3'-termini of the cDNAs in the following manner: the cDNAs gt2 and IA are both partial cDNAs of the nomad retrotransposon, and the other cDNAs are the result of fusion transcripts between uncharacterized Drosophila sequences and this novel transposon. Fusion transcripts of this general type have been shown to result from the insertion of transposable elements into transcribed genes (Csink et al. 1994; Wilanowski et al. 1995). The 12 kb message which was detected by Northern analysis (Figure 28) is much larger than the size of the message predicted for a full-length nomad transcript and is presumed to be the result of such a chimaeric transcript (this will be re-examined in Chapter 4). 9 2 POL E N V LTR gt2 Figure 29. cDNAs isolated from XZAPII and XgtlO libraries. A l l cDNAs share the 3' end, which is the LTR of the nomad transposon. 93 3.6 Mobility of the nomad retrotransposon in different strains of Drosophila The genome of Drosophila contains a number of retrotransposons. Each retrotransposon is usually present in multiple copies that are distributed throughout the genome. In situ hybridization results demonstrate that nomad D N A sequences hybridize to 10-15 sites in euchromatin and heavily, and therefore presumably to multiple sites, within 6-heterochromatin (Figure 30). This pattern of distribution is a reiteration of that found for the majority of mobile elements in Drosophila (Finnegan and Fawcett 1986). To determine whether the nomad element was mobile, I compared the location of nomad elements in two wild-type strains of D. melanogaster. Analysis of the distribution of euchromatic nomad elements in the wild-type strains Oregon R and Canton S by in situ hybridization revealed that these strains appeared to have five insertions at the same cytogenetic location on the X-chromosome. The remaining X-chromosome inserts appeared to be unique to each strain. In addition, the Canton S strain appeared to have three euchromatic insertions of the nomad element on the left arm of the second chromosome. In contrast, no nomad elements were detected on the left arm of the second chromosome in the Oregon R strain. This distribution of euchromatic nomad inserts in these two wild-type strains suggests that the nomad element is indeed mobile (Figure 30). 3.7 Target site preference of the nomad retrotransposon Insert site specificity has been demonstrated for a number of retrotransposons in Drosophila. The transposons 297, 17.6 and torn have been demonstrated to insert preferentially at the nucleotide sequence (T)ATAT (Ikenaga and Saigo 1982; Inouye et al. 1984; Tanda et al. 1988). Given the high degree of sequence similarity between nomad and other retrotransposons in Drosophila it was of interest if nomad shares a preference for target sites. The genomic D N A flanking several unique nomad inserts was sequenced and the sequence T A N A was found at the hosXJnomad junction in each case (Figure 31). The 94 Figure 30. In situ hybridization to polytene chromosomes using nomad sequences. The distribution of the nomad retrotransposon is shown in the strains Canton S and Oregon R strains. For each strain the X chromosome and the left arm of the second chromosome are indicated.The white triangles represent nomad elements that appear identical in both strains. The shaded triangles represent nomad elements whose locations differ in the two strains. The star shape indicates where the base of the right arm of chromosome 2 has been detached from the chromocenter in preparing the slide. 9 5 5' nomad 3' cosm. 5 cosm.2 gt2 plas. 45 cosm. 6 ATATATATACA ^GT AATAACATATA VGT TATAACAATATAAGT ACT ACT ACT ACT rACATATATATACACACA TATATTTAATTAGT TATATATTTATATA TAAATATAGCTCCAACT Figure 31. Target sitdnomad junctions. The D N A sequences flanking several different nomad inserts are shown. In each case the sequence T A N A flanks the nomad element. 9 6 identification of another transposable element which shares the same target site preference suggests that the mobilization of these elements may result in the insertion of any one of a number of transposons into a potential target site. This may explain why some loci seem to be particularly susceptible to spontaneous mutation by insertion of transposable elements (Tchurikov et al. 1989). I performed a detailed sequence comparison of the putative zinc finger motifs in the integrase domains of several different Drosophila retrotransposons. Those elements which prefer to insert at T A T A sites share several perfectly conserved amino acids in the putative D N A binding region (Figure 26.2). The transposons gypsy and nomad display a less specific preference for insert sites and encode a putative zinc finger that differs in the spacing of the His residues by one amino acid from the spacing of these residues in torn, 297, and 17.6. A number of residues between the putative His2-Cys2 zinc ion coordination sites are also conserved between members of the same group, but not between groups. 3.8 Phylogenetic relationship of nomad to other retro virus-like elements In order to further investigate the phylogenetic relationship between nomad and other cloned retrotransposons a computer-assisted analysis of the predicted amino acid sequences of the pol gene products was done (Figures 32 and 26.2). Together with the analysis of data by other investigators, these analyses allowed me to conclude that the gypsy-like elements, which include gypsy, nomad, burdock and yoyo, represent a class of retrotransposons separate from both the copia-like elements and the 297,17.6, and torn group (Figure 32). The phylogenetic tree is supported by a number of other characteristics. The retrotransposons copia, 1731, mdgl and 412 share the following characteristics: 1) all are bounded by the terminal inverted repeat 5TG. .CA 3' characteristic of every retrovirus studied to date, 2) all lack an ORF which corresponds to an env-like gene, and 3) they display no appreciable target site specificity. In addition, the putative primer tRNAs for these elements have been cloned and it has been proposed that copia and 1731 elements 97 99 »'J*yy CD. melanogaster) torn CD. ananassae) / 7 . 6 CD. melanogaster) 100 98 74 90 1 00 1 00 90 .nomad CD. melanogaster) yoyo (Geratitls capltata) gypsy CD. melanogaster) — burdock CD. melanogaster) mdg 1 CD. melanogaster) copia CD. 1 / CD. melanogaster) Figure 32. Cladogram based on pol-likc gene product similarity. Length of branches indicates the degree of divergence between the predicted amino acid sequences of the pol-\ike genes of the retrotransposons. Maximum likelihood bootstrap values are indicated at each node. The branching order between these clades was identical for all methods. Genbank accession num-bers for those not listed in Figure 25 or Figure 26.2 are 1731 (X07656), copia (X02599). 9 8 share the same primer tRNA (Fourcade-Peronnet et al. 1988), while the same is true for the mdgl and 412 elements (Yuki et al. 1986). A l l of these data suggest a common lineage between this group. This notion is supported by the pol-like gene based phylogenetic tree proposed in Figure 32. It should be pointed out that the unrooted phylogenetic tree suggested by my analysis of the predicted Pol proteins doesn't reflect the important observation that the order of the reverse transcriptase and integrase domains is reversed in the copia and 1731 elements relative to the order observed in other retrotransposons (Figure 27). This places the mdgl and 412 elements closer to the gypsy-like elements than copia or 1731. The closest phylogenetic relationships suggested by analysis of the pol-like genes is between the transposons 17.6, 297, and torn. This close relationship is in accordance with the findings of others (Tanda et al. 1988) and is supported by a number of other findings. A l l of these transposons are: 1) bounded by the terminal inverted repeats 5'AGT..ACT 3', 2) have an ORF which corresponds to an mv-like protein, 3) share a target site preference for T A T A sequences, and 4) these elements share a common primer binding site (Tanda et al. 1988). It is interesting that the closest phylogenetic relationship between any of the transposons analyzed is between the transposons 297 and torn. The close relationship between two transposons in different species of Drosophila suggests a recent horizontal transfer between these sibling species of this class of element (Whalen and Grigliatti 1998). The pol-hke gene product of the nomad element was found to be most closely related to that of the yoyo retrotransposon of C. capitata and was placed in a separate group with the gypsy and burdock elements. These elements all terminate in the terminal inverted repeats 5 A G T . . A C T 3', possess an ORF which corresponds to an env-like gene (with the exception of burdock), and in the case of gypsy (Freund and Meselson 1984; Song et al. 1994) and nomad target site preference has been demonstrated. Analysis of the putative primer binding sites for these transposons suggests that these share the same primer tRNA (Figure 25). Based on these findings I have defined members of this class as the true 9 9 gypsy-hke elements and suggest that they all share a common ancestor (Whalen and Grigliatti 1998). The fact that both gypsy and nomad have an ORF which corresponds to an env-like gene and the presence of the terminal inverted repeat 5'AGT..ACT 3' with target site preference suggests that these transposons share a common ancestor with the 297,17.6 and torn transposons. What is most striking is that the most closely related members of this group are in different species, nomad is most similar to yoyo from C. capitata and 297 from D. melanogater is most similar to torn from D. ananassae. Recently it was demonstrated that the gypsy and torn elements make subgenomic transcripts that produce Env proteins (Pelisson et al. 1994; Tanda et al. 1994). It has been suggested that this gene product may facilitate horizontal transfer of the gypsy element (Song et al. 1994). The phylogenetic analysis done here suggests that horizontal transfer may also have occurred for the nomad element rather recently. This hypothesis is supported by the fact that nomad also makes a 3.0 kb transcript that could encode a short Env protein, like that produced by the gypsy and torn elements. These findings are of particular interest given that it has been proposed that the gypsy retrotransposon is indeed an infectious retrovirus of invertebrates (Kim et al. 1994; Song et al. 1994). Most retrotransposons in Drosophila have been classified as members of either the copia-Tyl or gypsy-Ty3 group (Finnegan 1994), a distinction based upon the relative order of the protein domains and their sequence similarity. The results of the phylogenetic analyses suggest that members of the gypsy group fall into one of two distinct groups: 1) the T A T A target site specific retrotransposons 17.6, 297, and torn and 2) the true gypsy-like retrotransposons which include gypsy, nomad, yoyo and burdock (Whalen and Grigliatti 1998). I have identified and characterized a new member of the gypsy class of retrotransposons and have generated a phylogenetic tree that strongly suggests that a member of this group (yoyo or nomad) has recently been transferred across genus boundaries. 1 0 0 The identification of another retrotransposon that appears to have made the "jump" from endogenous to exogenous retrovirus may help to illuminate for us the evolutionary connection between vertebrate retroviruses and the LTR containing retrotransposons from which they appear to have evolved. 101 Chapter 4 The effect of the nomad element on chromatin structure and retroelement expression in D. melanogaster Introduction The enhancer of position-effect variegation E(var)45-19 was isolated following a screen for P-induced enhancers of wm4 variegation as described in Chapter 2. The E(var)45-19 mutation appears to be caused by a P-insert since remobilization gives rise to complete revertants when exposed to a source of transposase. In addition, remobilization of the P-element in E(var)45-19 gave rise to Su(var)r27 which was presumed to be the result of an imprecise excision. This presented the possibility that alleles of the E(var)45-19 locus could have opposing effects on P E V . Opposite effects on P E V have long been known to occur for duplications and deficiencies for many E(var) loci. Deficiencies for such E(var)s enhance P E V while duplications result in suppression of P E V (Locke et al. 1988; Wustmann et al. 1989). This has classically been interpreted in the following manner. E(var)s are thought to encode protein products involved in the establishment and/or maintenance of euchromatin (Locke et al. 1988; Sinclair et al. 1989). Deficiencies for such loci would limit the formation of euchromatin, thereby allowing heterochromatin to spread past the euchromatin/heterochromatin breakpoint in variegating rearrangements (enhancement). Duplications for these loci would facilitate euchromatin formation, thereby preventing the spread of heterochromatin (suppression)(Locke et al. 1988; Wustmann et al. 1989). In addition to its effect on P E V , the Su(var)r27 allele of the E(var)45-19 locus was shown to be an enhancer of the retroelement-induced allele w^l (Chapter 2). This suggests that the E(var)45-19 locus has a role in regulation of retroelement expression as well as chromatin structure. Interestingly, the P-insert in E(var)45-19 was shown to be located in the 3'LTPv of a novel retrotransposon, nomad, in the 6 3 A region of the third chromosome of D. melanogaster (Chapter 3). Two distinctly different possibilities which may explain 102 the basis of the P-induced mutation E(var)45-19 are as follows: 1) the mutation is due to transcriptional disruption of a host gene near to the nomad element in the 63 A region or 2) the mutation is due to a disruption of the nomad retrotransposon in 63A. The second possibility is more intriguing as it implies that a mutation in the nomad element in 63A may effect the blood retroelement in the \M allele in trans. Results presented here demonstrate that nomad transcription correlates with the degree of modification of PEV in the mutants E(var)45-19 and Su(var)r27. Taken together with the genetic analysis performed in Chapter 2, this suggests that the nomad retrotransposon is involved in regulation of both chromatin structure and retroelement expression in D. melanogaster. The implications this may have on our understanding of the basis of PEV will be discussed. In addition, I present speculative models to explain the effect of nomad mutations on chromatin structure. Materials and Methods are as described in Chapters 2 and 3. Results 4.1 nomad transcript abundance correlates with modification of PEV of wm4 in the mutant lines E(var)45-19 and Su(var)r27 The mutation of genes by P-elements is typically a result of the insertion of the element into either a regulatory region responsible for controlling transcription of the gene or into the coding region of the gene. The results presented in Chapter 3 demonstrated that the P-element in E(var)45-19 was inserted into the 3'LTR of the nomad retrotransposon. In order to determine if the insertion of the P-element affected transcription of the nomad retrotransposon, Northern analysis was conducted on the E(var)45-19 mutant line. Given the results of the genetic analysis described in Chapter 2, which suggested that Su(var)r27 was an allele of the E(var)45-19 locus, Northern analysis was also performed on this line. 1 0 3 Probes specific to nomad D N A sequences detected three different transcripts in Northern blots in each of the different lines used (Figure 33). The sizes of the transcripts were 12 kb, 7.5 kb and 3 kb. It was clear from this analysis that the mutant lines E(var)45-19 and Su(var)r27 had altered levels of both the 12 kb and 7.5 kb transcripts. What is most interesting is that the abundance of these transcripts was lower in E(var)45-19 and increased in Su(var)r2 7 relative to the levels of the transcripts in the OR-R control (Figure 33). These data demonstrate a direct correlation between the level of nomad transcripts in the E(var)45-19 and Su(var)r27 lines and their effect on wm4 variegation. Decreased transcription correlates with enhancement and increased transcription correlates with suppression of variegation. Taken together with the genetic data this strongly suggests that one or both of these transcripts are involved in the modification of PEV of the wm4 allele. 4.2 Distribution of nomad elements on the left arm of the third chromosome in different strains of D. melanogaster The distribution of nomad retroelements on the distal end of the left arm of the third chromosome was determined by in situ hybridization. The wild-type Drosophila strain Oregon-R did not contain an insert of the nomad element in the 63A region. In contrast, the mutant Une E(var)45-19 contained a nomad element at 63A, the cytogenetic location of the pUChsneory+ element in this line (Figure 34). Conclusions 4.3 Models proposed to explain the effect of the nomad retroelement on PEV A l l of the genetic and molecular data indicate that mutations which alter the level of nomad transcription also modify PEV. Although they are speculative, I envision at least two different models to explain the effect of nomad mutants on PEV and retroelement 104 Figure 33. Northern blot analysis of nomad mutants. PolyA 4" RNA isolated from adults probed with nomad DNA sequences. Results show a reduction of 12 kb and 7.5 kb transcripts in E(var)45-19, and an increase of these transcript levels in Su(var)r27. The same RNA blot was reprobed with a probe made from ribosomal protein 49 (RP49) DNA sequences. The signal obtained from use of the RP49 probe was used as an internal control to allow quantification of RNA samples between lanes. 105 Figure 34. In situ localization of nomad and P-element sequences on the left arm of the third chromosome. The Oregon R strain does not contain a nomad element in the 63A region, the site of the P-element insert in E(var)45-19. Shaded triangles indicate hybridization signal in 63A region. White triangles indicate hybridization signal at other nomad sites in 3L. 106 expression. In one model nomad retroelements are directly involved in modification of local chromatin structure, while in another model nomad transcription indirectly leads to a change in chromatin structure. In the direct model, the nomad locus in 63A is involved in the formation of boundaries to chromatin condensation at the sites of nomad and perhaps other retroelement inserts. In this model, the nomad locus produces a gene product involved in the formation of a functional boundary to repressive chromatin formation (Figure 35). This kind of model could be employed to explain all of the genetic and molecular data I have demonstrated (Table VU). Overexpression of the transcript in Su(var)r27 would increase the amount of the protein product, thereby promoting formation of the boundary and preventing the spread of heterochromatin into the white locus in wm4 (suppression). Decreased expression in E(var)45-19 would result in depletion of its functional "boundary protein", allowing the spread of heterochromatin. A requisite of the direct model I have proposed is that nomad mutations modify only those variegating genes that are in close proximity to a nomad element. However, the fact that Su(var)r27 modifies the retroelement induced allele w°^ (section 2.3.3) suggests that a nearby nomad element may not be required. In fact, one possible interpretation is that nomad is able to affect the transcription of other retroelements in trans. The direct model predicts that the effect of Su(var)r27 on the phenotype was due to binding of the nomad "boundary protein" to the blood insert in the w°l allele, thereby interfering with the production of full-length white* transcripts. It is possible that the effect of nomad mutations on PEV and w^l are due to an indirect effect of the altered expression levels of the retroelement, mediated by host genes. Co-regulation of the mobility of retrotransposons has been described for the gypsy and copia elements (Song et al. 1994) and for the blood and copia elements (Csink et al. 1994). In fact, it has long been known that dysgenic crosses conducted to mobilize a particular mobile element often result in the mobilization of other families of elements. These data 107 Figure 35. A retrotransposon based model for the establishment of chromatin domains. nomad gene product involved in the establishment of transcriptional boundary at the sites where an insert is present, preventing the spread of repressive chromatin. 108 suggest that the host factors which regulate the mobility of these elements are shared by a large number of different elements. My data suggest that the nomad and blood retrotransposons may be co-regulated. Elucidation of the mechanism by which this occurs could help us to understand how interactions between the retrotransposon and host factors lead to mobilization of several classes of mobile elements in dysgenic crosses. The finding that Su(var)r27 modifies both PEV and w^l suggests an important link between chromatin structure and retroelement expression. The data that I have presented does not make clear how a mutation in a single copy of the nomad element in the 63 A region could have such a profound effect on the global expression of nomad transcription. The real quandry is that there are 10-15 additional nomad elements in the genome. Assuming that a substantial proportion of these nomad elements are intact, it would be expected that mutations in one of these elements should lead to a decrease in total nomad transcription by no more than 10%. Yet, E(var)45-19 showed a decrease of nomad transcription by about 50% relative to the OR-R control strain (Figure 33). This suggests that the nomad element at 63A is the only intact or functional element, which is unlikely, or that the nomad element in the 63A region regulates the expression of other nomad elements in trans. The most obvious evidence of this is that Su(var)r27 affects the mutant phenotype of the vM allele, presumably by a trans interaction with the blood transposon. As described in chapter 2, the allele contains a blood retroelement in the second intron of the white* gene. The effect of second-site modifiers on the penetrance of the w°l allele is presumed to result from an increase in blood and blood/white fusion transcripts, thereby interfering with the production of full-length white* transcripts. The combined results of in situ hybridization experiments and Northern blot analysis in light of the identification of putative fusion transcripts between the nomad LTR and uncharacterized Drosophila sequences shown in Figure 29 suggest that Su(var)r27 may mediate a similar effect on nomad/host fusion transcripts. 109 The isolation of putative nomad/host fusion transcripts from cDNA libraries (described in Chapter 3) suggests that the mRNAs from which they originate should be detectable in Northern blots using nomad LTR sequences as probes. Indeed, the 12 kb transcript detected in Northern blots (Figure 33) by probes made from nomad LTR sequences is much larger than the 7.3 kb transcript predicted by the sequence of the complete nomad element, which was also detected in Northern blots. These data suggest (but by no means prove) that the 12 kb transcript is an RNA which results from fusion of nomad sequences to an uncharacterized Drosophila gene. With this as a working hypothesis, I carefully re-examined the results of in situ hybridization experiments that had been performed to localize nomad sequences on polytene chromosomes. The strain OR-R, which expressed the 12 kb transcript (Figure 33), did not contain nomad sequences in the 63A region (Figure 34). This suggests that the 12 kb transcript (if it is indeed a fusion transcript) does not originate from the 63A region. Yet, both E(var)45-19 and Su(var)r27, which presumably are mutations in the nomad element in 63A, seemed to affect the expression level of the 12 kb transcript. E(var)45-19 displayed reduced,while Su(var)r27 displayed increased expression of the 12 kb and 7.3 kb transcripts. Collectively these data suggest that the mutations in nomad in 63A are able to influence the regulation of other nomad-related transcripts in the genome. While this is certainly not proof of a trans-effect mediated by nomad on other copies of itself, it may eventually help us to understand the mechanism by which E(var)45-19 and Su(var)r27 modify PEV. Although it is probably not entirely surprising to find that mutations which altered nomad expression also effected the blood retroelement, this does not explain the effect of these mutations on PEV. In this regard, it is interesting to note that the heterochromatic D N A sequences responsible for inducing PEV have been investigated in Drosophila. Tartof and his colleagues (1984) examined the D N A sequences at the junction of euchromatin and heterochromatin for three rearrangements which display white variegation. Comparison of the heterochromatic D N A at each of these breakpoints revealed that in each case the white 1 1 0 gene has been juxtaposed to heterochromatic regions which contain retroelement-related sequences (Tartof et al. 1984). Spradling and Karpen (1990) proposed an explanation for the variegation of euchromatic genes juxtaposed to such heterochromatic regions. They suggested that transcription from a promoter within the heterochromatin (such as in a transposable element) may interfere with transcription from the nearby euchromatic locus (Spradling and Karpen 1990). This may explain why so many modifiers of retroelement-induced alleles are also modifiers of PEV. Regardless of the explanation, all of the results discussed so far indicate that retroelements play an important dynamic role in regulating chromatin structure in Drosophila. The data I have presented for the nomad mutations are reminiscent of the phenomena of paramutation and cosuppression in plants. Both of these epigenetic effects: 1) have been shown to involve transposons or other repetitive D N A sequences; 2) involve both a silencing allele which autonomously ds-inactivates, in addition to a target allele which is inactivated in trans following association with the silencing allele; and 3) result in stable repression of affected genes (reviewed in Martienssen 1996; Matzke and Matzke 1998). Recently, an example of cosuppression has been described in Drosophila (Pal-Bhadra et al. 1997). Interestingly, stable gene silencing was shown to be dependent on Pc (Pal-Bhadra et al. 1997). The requirement for a gene known to be involved in the formation of repressive chromatin in maintenance of cosuppression suggests that these processes share common mechanisms. Paramutation, cosuppression, Pc-mediated gene silencing and PEV all result in gene repression which is faithfully propagated through subsequent cell divisions. Given the striking similarities between the factors which contribute to paramutation/cosuppression and the interaction between nomad mutations and the variegating alleles wm4 and bw^e2, it is possible that nomad exerts its effect on PEV by mechanisms shared by these other gene silencing phenomena. It should be pointed out that much of the interpretation of results is based on the assumption that Su(var)r27 is indeed an allele of E(var)45-19. E(var)45-19 was found to 1 1 1 contain a P-element in the 3'LTR of nomad but the molecular lesion associated with Su(var)r27 has not been determined. The global level of nomad transcription correlates with the genetic prediction of E(var)45-19 and Su(var)r27 being opposing hypomorphic and hypermorphic alleles of a gene. That is, E(var)45-19 and Su(var)r27 enhance and suppress PEV respectively, and E(var)45-19 is associated with a substantial reduction in the 7.5 kb nomad transcript while Su(var)r27 appears to increase the amount of this transcript. This strongly suggests but does not prove that both E(var)45-19 and Su(var)r27 are nomad alleles. The mobilization of P-elements often results in rearrangements in the region where the P-insert resided. These types of rearrangements include deficiencies which encompass part or all of the P-element as well as extending into the genomic D N A flanking the P-element. It is likely that Su(var)r27 is an allele of E(var)45-19 which resulted from the imprecise excision of the P-element in E(var)45-19. It is possible that Su(var)r27 is a mutation in another locus nearby the nomad element in 63A. In order to determine if there were any nearby transcripts which may have been affected by the P-element insert, the genomic D N A flanking the nomad element in 63A was cloned and used to probe Northern blots of RNA from all developmental stages. No transcripts besides those of the nomad element were detected, again strongly suggesting but not demonstrating that the PEV mutations were in the nomad 63A locus. Formally two possibilities remain. First, it is also possible that the mutations in nomad in 63A could effect another copy of nomad in the genome which is inserted into the true effector of PEV. Second, it is possible that the effects of E(var)45-19 and/or Su(var)r27 are due to an effect on a gene located in 63A but some distance away from the nomad element. The Northern blots described above would have revealed transcribed sequences within 1.5 kb of the nomad insert in 63 A but it is possible that the mutation E(var)45-19 is the result of the P-element in this line affecting a transcript further away. P-elements may exert effects on transcripts at distances greater than this but this is uncommon. Nonetheless, further experimentation would be required in order to rule these possibilities out. 112 An interesting structural feature of the nomad element is the presence of several weak consensus Su(Hw) protein binding sites in the 5' leader region. The presence of this D N A sequence motif has been shown to be necessary for the ability of the gypsy element to form functional insulator elements (Smith and Corces 1992; Spana et al. 1988). Cooperative binding of the Su(Hw) and Mod(mdg4) proteins at Su(Hw) binding sites in the 5' leader region of the gypsy element is also required for the formation of a functional boundary (Georgiev and Kozycina 1996; Gerasimova et al. 1995; Spana et al. 1988). It has been proposed that the formation of these boundaries results in localization of these sequences to several discrete subnuclear regions (Gerasimova and Corces 1998). Although I have not demonstrated that the weak consensus Su(Hw) protein binding sites in nomad are capable of binding Su(Hw) protein, it is known that the presence of this motif is sufficient to bind the Su(Hw) and Mod(mdg4) proteins in vitro (Spana et al. 1988). Su(Hw) has been shown to localize to 100-200 sites in euchromatin on polytene chromosomes (Spana et al. 1988) yet there are only 15-20 copies of the gypsy element per genome. Given that nomad is one of the closest relatives of the gypsy retrotransposon (Whalen and Grigliatti 1998), it would probably not be surprising to find colocalization of nomad elements with another 10-15 of the Su(Hw)/Mod(mdg4) complexes on polytene chromosomes. mod(mdg4) has also been identified as an enhancer of PEV (section 1.4.3)(Dorn et al. 1993). What significance this has is unknown, but it is possible the effect of nomad mutations on PEV which I have demonstrated is an indirect consequence of the involvement of su(Hw) or mod(mdg4), mediated by the Su(Hw) binding sites in the 5' leader region of nomad. The ability of the gypsy element to sequester host proteins to form boundaries capable of insulating against chromosomal position effects may reflect the uncanny ability of mobile elements to protect themselves against the unfortunate likelihood of insertion into repressive chromatin, such as that near the chromocenter. Characterization of the centric heterochromatin of the X-chromosome suggests that mobile elements in this region are 113 intact (Sun et al. 1997). In addition, recent work has demonstrated that mobile elements inserted into heterochromatin display mobilization frequencies that rival those of euchromatic inserts (Dominguez and Albornoz 1996). These results suggest that mobile elements have evolved various strategies to insulate themselves against chromosomal position effects. Future considerations Any model proposed to explain the effect of nomad on PEV will have to explain the variety of phenotypes associated with the Su(var)r27 line (Table VII). The seemingly contradictory types of inheritance exhibited by the Su(var) (i.e.. maternal-effect suppressor of wm4 variegation versus female-specific dominant suppressor of bwVDe2 variegation) suggest complex regulation of nomad expression. Maternal-effect genes are typically expressed in the germ line of females and deposited in the developing egg. A reasonable way to address the role of expression will be to examine R N A expression patterns of the nomad element in situ. Anti-sense RNA probes made from nomad sequences could be used to probe Drosophila larvae to determine its pattern of expression. The pattern of nomad expression in E(var)45-19 and Su(var)r27 could then be compared to that of a wild-type strain. The Northern analysis suggests that nomad transcription varies quantitatively in these lines (Figure 33). Examination of mutant expression patterns may provide some basis for this difference. Given that the genetic data from the analysis of Su(var)r27 suggests both male- and female-specific phenotypes (recessive male sterility and maternal-effect Su(var)), the patterns of nomad expression in the germ-line of developing Drosophila are of interest. In order to determine if the mechanism by which nomad modifies PEV is a direct effect of a protein product of nomad, an analysis of the protein products of the nomad element should be done. The direct model predicts a change in the levels of the Gag, Pol, and Env proteins produced by nomad in the mutant lines. To determine if these levels are 1 1 4 changed in the nomad mutants, antibodies to the putative protein products of nomad could be generated and used to perform Western analysis. These antibodies could also be used to determine if nomad is directly involved in establishing a transcriptional boundary at insert sites. If a protein product is involved, an antibody to it should localize to sites where I have already demonstrated the presence of nomad sequences (a prediction of the direct model). The Pol polyprotein consists of several subunits (Figures 27 and 26.2) that could be candidates for involvement in establishment of a chromatin boundary. I suggest that the integrase subunit is the best candidate for such a role. This is based on the observation that this subunit contains a zinc finger D N A binding motif and a DDE motif which has been shown to form the active site of the integrase subunit. For this reason, I suggest that generation of antibodies specific to this subunit should be done first. These antibodies should localize to sites of nomad elements on polytene chromosomes if indeed the integrase subunit is involved in forming a stable complex at these sites. The identification and analysis of mutations in the nomad element in 63A suggests what I believe is a novel mechanism for establishing boundaries to formation of repressive chromatin. Currently, the role of the other nomad inserts is as yet undetermined, but will probably reveal some insight into what appears to be a complex, multigenic mechanism. 115 References Abdel-Meguid SS, Grindley NDF, Templeton NS, and Steitz T A (1984) Cleavage of the site specific recombination protein y8 resolvase: The smaller of two fragments binds D N A specifically. Proc Natl Acad Sci USA 81:2001-2005 Altschul S, Gish W, Miller W, Meyers E, and Lipman D (1990) Basic local alignment search tool. J Moi Biol 215: 403-410 Baker W K (1968) Position-effect variegation. Adv Genet 14:133-69 Baksa K, Morawietz H, Dombradi V , Axton M , Taubert H , Szabo G, Torok I, Udvardy A , Gyurkovics H , Szoor B , and et al. (1993) Mutations in the protein phosphatase 1 gene at 87B can differentially affect suppression of position-effect variegation and mitosis in Drosophila melanogaster. Genetics 135:117-25 Bhadra U , Bhadra MP, and Birchler JA (1998) Interactions among dosage-dependent trans-acting modifiers of gene expression and position-effect variegation in Drosophila. Genetics 150:251-63 Bhadra U , and Birchler JA (1996) Characterization of a sex-influenced modifier of gene expression and suppressor of position-effect variegation in Drosophila. Moi Gen Genet 250:601-13 Bhadra U, Pal-Bhadra M , and Birchler JA (1997) A sex-influenced modifier in Drosophila that affects a broad spectrum of target loci including the histone repeats. Genetics 146:903-17 Bingham P, and Chapman C (1986) Evidence that white-blood is a novel type of temperature-sensitive mutation resulting from temperature-dependent effects of a transposon insertion on formation of white transcripts. E M B O J 5:3343-3351 Bingham P, and Judd B (1981) A copy of the copia transposable element is very tightly linked to the wa allele at the white locus of D. melanogaster. Cell 25:705-711 Birchler JA, Bhadra U, Rainbow L, Linsk R, and Nguyen-Huynh AT (1994) Weakener of white (Wow), a gene that modifies the expression of the white eye color locus and that suppresses position effect variegation in Drosophila melanogaster. Genetics 137:1057-70 Bradbury E, Maclean N , and Matthews H (1981) DNA, Chromatin and Chromosomes. Halsted Press,New York, USA . Braunstein M , Sobel RE, Allis CD, Turner B M , and Broach JR (1996) Efficient transcriptional silencing in Saccharomyces cerevisiae requires a heterochromatin histone acetylation pattern. Moi Cell Biol 16:4349-56 Candido EP, Reeves R, and Davie JR (1978) Sodium butyrate inhibits histone deacetylation in cultured cells. Cell 14:105-13 Chovnick A , Ballantyne G H , and Holm DG (1971) Studies on gene conversion and its relationship to linked exchange in Drosophila melanogaster. Genetics 69:179-209 116 Chung JH, Whiteley M , and Felsenfeld G (1993) A 5' element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila. Cell 74:505-14 Collins M , and Rubin G (1982) Structure of the Drosophila mutable allele, whitecrimson and its whitelvory and wild-type derivatives. Cell 30:71-79 Csink A K , Linsk R, and Birchler JA (1994) The Lighten up (Lip) gene of Drosophila melanogaster, a modifier of retroelement expression, position effect variegation and white locus insertion alleles. Genetics 138:153-63 De Rubertis F, Kadosh D, Henchoz S, Pauli D, Reuter G, Struhl K, and Spierer P (1996) The histone deacetylase RPD3 counteracts genomic silencing in Drosophila and yeast. Nature 384:589-91 Devlin RH, Bingham B, and Wakimoto BT (1990) The organization and expression of the tight gene, a heterochromatic gene of Drosophila melanogaster. Genetics 125:129-40 Dimitri P, and Pisano C (1989) Position effect variegation in Drosophila melanogaster: relationship between suppression effect and the amount of Y chromosome. Genetics 122:793-800 Dominguez A, and Albornoz J (1996) Rates of movement of transposable elements in Drosopila melanogaster. Moi Gen Genet 251:130-138 Dorn R, Krauss V , Reuter G, and Saumweber H (1993) The enhancer of position-effect variegation of Drosophila, E(var)3-93D, codes for a chromatin protein containing a conserved domain common to several transcriptional regulators. Proc Natl Acad Sci U S A90:11376-80 Dorn R, Szidonya J, Korge G, Sehnert M , Taubert H, Archoukieh E, Tschiersch B , Morawietz H, Wustmann G, Hoffmann G, and et al. (1993) P transposon-induced dominant enhancer mutations of position-effect variegation in Drosophila melanogaster. Genetics 133:279-90 Eissenberg JC, James TC, Foster-Hartnett D M , Hartnett T, Ngan V, and Elgin SC (1990) Mutation in a heterochromatin-specific chromosomal protein is associated with suppression of position-effect variegation in Drosophila melanogaster. Proc Natl Acad Sci U S A 87:9923-7 Engels W, Johnson-Schlitz D, Eggleston W, and Sved J (1990) High-frquency P-element loss is homolog dependent. Cell 62:515-525 Farkas G, Gausz J, Galloni M , Reuter G, Gyurkovics H, and Karch F (1994) The Trithorax-like gene encodes the Drosophila G A G A factor. Nature 371:806-8 Finnegan D, and Fawcett D (1986) Transposable elements in Drosophila melanogaster. In: N . Mclean (ed) Oxford surveys on eukaryotic genes, vol 3. Oxford University Press, Oxford, U.K. , pp 1-62 117 Finnegan DJ (1994) Retroviruses and transposons. Wandering retroviruses? Curr Biol 4:641-3 Finnerty V, Baillie D, and Chovnick A (1970) A chemical system for mass collection of virgin females or males. Dros Inform Serv 45:190 Fourcade-Peronnet F, dAuriol L , Becker J, and Best-Belpomme M (1988) Primary structure and functional organization of Drosophila 1731 retrotransposon. Nucl Acids Res 16:6113-6125 Freund R, and Meselson M (1984) Long terminal repeat nucleotide sequence and specific insertion of the gypsy transposon. Proc Natl Acad Sci USA 81:4462-4464 Frolov M V , Benevolenskaya EV, and Birchler JA (1998) Regena (Rga), a Drosophila homolog of the global negative transcriptional regulator CDC36 (NOT2) from yeast, modifies gene expression and suppresses position effect variegation. Genetics 148:317-29 Gehring W, and Paro R (1980) Isolation of a hybrid plasmid with homologous sequences to a transposing element of Drosophila. Cell 19:857-904 Georgiev P, and Kozycina M (1996) Interaction between mutations in the suppressor of Hairy wing and modifier of mdg4 genes of Drosophila melanogaster affecting the phenotype of gypsy-induced mutations. Genetics 142:425-36 Gerasimova TI, and Corces V G (1998) Polycomb and trithorax group proteins mediate the function of a chromatin insulator. Cell 92:511-21 Gerasimova TI, Gdula DA, Gerasimov D V , Simonova O, and Corces V G (1995) A Drosophila protein that imparts directionality on a chromatin insulator is an enhancer of position-effect variegation. Cell 82:587-97 Green M M (1988) Mobile D N A elements and spontaneous gene mutation. In: M . E. Lambert, J. F. McDonald, and B. I. Weinstein (ed) Eukaryotic transposable elements as mutagenic agents. Cold Spring Harbor Press, Cold Spring Harbor, New York, pp 41-50 Grigliatti T (1992) Position-effect variegation—an assay for nonhistone chromosomal proteins and chromatin assembly and modifying factors. In: B. Wakimoto, and S. Elgin (ed) Functional organization of the nucleus. Academic Press, Inc, San Diego, Calif, pp 587-627 Gruneberg H (1935) A new inversion of the X chromosome in Drosophila melanogaster. J Genet 31:163-184 Gruneberg H (1937) The position effect proced by a spontaneous reversion of the X chromosome in Drosophila melanogaster. J Genet 34:169-189 Hart C M , Zhao K, and Laemmli U K (1997) The ses' boundary element: characterization of boundary element- associated factors. Moi Cell Biol 17:999-1009 Hartmann-Goldstein IJ (1967) On the relationship between heterochromatization and variegation in Drosophila, with special reference to temperature-sensitive periods. Genet Res 10:143-59 118 Henikoff S (1990) Position-effect variegation after 60 years. Trends Genet 6:422-6 Henikoff S (1981) Position-effect variegation and chromosome structure of a heat shock puff in Drosophila. Chromosoma 83:381-93 Hilliker A (1976) Genetic analysis of the centromeric heterochromatin of chromosome 2 of Drosophila melanogaster. deficiency mapping of EMS-induced lethal complementation groups. Genetics 83:765-82 Hilliker A, and Holm D (1975) Genetic analysis of the proximal region of chromosome 2 of Drosophila melanogaster!. Detachment products of compound autosomes. Genetics 81:705-721 Igarashi K, Hoshino H , Muto A , Suwabe N , Nishikawa S, Nakauchi H , and Yamamoto M (1998) Multivalent D N A bunding complex generated by small Maf and Bachl as a possible biochemical basis for beta-globin locus control region complex. J Biol Chem 273:11783-90 Ikenaga H , and Saigo K (1982) Insertion of a movable genetic element, 297, into the T-A-T-A box for the H3 histone gene in Drosophila melanogaster. Proc Natl Acad Sci USA 79:4143-4147 Inouye S, Yuki S, and Saigo K (1986) Complete nucleotide sequence and genome organization of a Drosophila transposable element, 297. Eur J Biochem 154:417-425 Inouye S, Yuki S, and Saigo K (1984) Sequence-specific insertion of the Drosophila transposable element 17.6. Nature 310:332-333 Jeppesen P, and Turner B M (1993) The inactive X chromosome in female mammals is distinguished by a lack of histone H4 acetylation, a cytogenetic marker for gene expression. Cell 74:281-9 Judd B (1955) Direct proof of a variegated type position-effect at the white locus in Drosophila melanogaster. Genetics 40:739-744 Karess R, and Rubin G (1982) A small tandem duplication is responsible for the unstable whiteivory mutation in Drosophila. Cell 30:63-69 Kaufman B (1942) Reversion from roughest to wild-type in Drosophila melanogaster. Genetics 27:537-49 Kellum R, and Schedl P (1991) A position-effect assay for boundaries of higher order chromosomal domains. Cell 64:941-50 Kim A, Terzian C, Santamaria P, Pelisson A , Prud'homme N , and Bucheton A (1994) Retroviruses in invertebrates: The gypsy retrotransposon is apparently an infectious retrovirus ofDrosophila melanogaster. Proc Natl Acad Sci USA 91:1285-1289 Kugiyama W, Ikenaga H, and Saigo K (1983) Close relationship between the long terminal repeats of avian leukosis-sarcoma virus and copia-hkc movable genetic elements of Drosophila. Proc Natl Acad Sci USA 80:3193-3197 1 1 9 Le M H , Duricka D, and Karpen GH (1995) Islands of complex DNA are widespread in Drosophila centric heterochromatin. Genetics 141:283-303 Leblanc P, Desset S, Dastague B, and Vaury C (1997) Invertebrate retroviruses: 7AM a new candidate in D. melanogaster. EMBO J 16:7521-7531 Lewis EB (1978) A gene complex controlling segmentation in Drosophila. Nature 276:565-70 Lindsley D, and Zimm G (1992) The genome of Drosophila melanogaster. Academic Press,San Diego . Locke J, Kotarski M A , and Tartof KD (1988) Dosage-dependent modifiers of position effect variegation in Drosophila and a mass action model that explains their effect. Genetics 120:181-98 Marchant G, and Holm D (1988) Genetic analysis of the heterochromatin of chromosome 3 in Drosophila melanogaster. II. Vital loci identified through EMS mutagenesis. Genetics 120:519-532 Marlor R, Parkhurst S, and Corces V (1986) The Drosophila melanogaster gypsy transposable element encodes putative gene products homologous to retroviral proteins. Moi Cell Biol 6:1129-1134 Martienssen R (1996) Epigenetic phenomena: paramutation and gene silencing in plants. Curr Biol 6:810-3 Matzke M A , and Matzke AJ (1998) Epigenetic silencing of plant transgenes as a consequence of diverse cellular defence responses. Cell Moi Life Sci 54:94-103 Michailidis J, Murray N, and Graves J (1988) Genet Res 52:119-123 Mitchelson A, Simonelig M , Williams C, and O'Hare K (1993) Homology with Saccharomyces cerevisiae RNA14 suggests that phenotypic suppression in Drosophila melanogaster by suppressor of forked occurs at the level of RNA stability. Genes Dev 7:241-9 Modollel J, Bender W, and Meselson M (1983) Drosophila melanogaster mutations suppressible by the suppressor of Hairy-wing are insertions of a 7.3-kilobase mobile element. Proc Natl Acad Sci USA 80:1678-1682 Moore GD, Procunier JD, Cross DP, and Grigliatti T A (1979) Histone gene deficiencies and position-effect variegation in Drosophila. Nature 282:312-4 Mottus R, Reeves R, and Grigliatti T A (1980) Butyrate suppression of position-effect variegation in Drosophila melanogaster. Moi Gen Genet 178:465-9 Muller H (1930) Types of visible variations induced by X-rays in Drosophila. J Genet 22:229-335 Pal-Bhadra M , Bhadra U, and Birchler J (1997) Cosuppression in Drosophila: gene silencing of Alcohol dehyrogenase by white-Adh transgenes is Polycomb dependent. Cell 90:479-490 120 Parkhurst SM, and Corces V G (1986) Interactions among the gypsy transposable element and the yellow and the suppressor of hairy-wing loci in Drosophila melanogaster. Moi Cell Biol 6:47-53 Paro R, and Hogness DS (1991) The Polycomb protein shares a homologous domain with a heterochromatin- associated protein of Drosophila. Proc Natl Acad Sci U S A 88:263-7 Pelisson A, Song S, Prud'homme N , Smith P, Bucheton A, and Corces V (1994) gypsy transposition correlates with the production of a retroviral envelope-like protein under the tissue-specific control of the Drosophila flamenco gene. E M B O J 13:4401-4411 Polard P, and Chandler M (1995) Bacterial transposases and retroviral integrases. Moi Microbiol 15:13-23 Rabinow L, and Birchler J (1990) Interactions among modifiers of retrotransposon-induced alleles of the white locus of Drosophila melanogaster. : 141-151 Reuter G, Giarre M , Farah J, Gausz J, Spierer A , and Spierer P (1990) Dependence of position-effect variegation in Drosophila on dose of a gene encoding an unusual zinc-finger protein. Nature 344:219-23 Ritossa F, and Spiegelman S (1965) Localization of D N A complementary to the ribsomal RNA in the nucleolus organizer region of Drosophila melanogaster. Proc Nat Acad Sci USA 53:737-745 Roseman RR, Pirrotta V , and Geyer PK (1993) The su(Hw) protein insulates expression of the Drosophila melanogaster white gene from chromosomal position-effects. Embo J 12:435-42 Rubin G (1983) Dispersed repetetive DNAs in Drososphila. In: J. A. Shapiro (ed) Mobile genetic elements. Academic Press, New York, pp 329-361 Rubin G (1998) The Drosophila genome project: a progress report. Trends Genet 14:340-3 Saigo K, Kugiyama W, Matsuo Y , Inouye S, Yoshioka K, and Yuki S (1984) Identification of the coding sequence for a reverse transcriptase-like enzyme in a transposable genetic element in Drosophila melanogaster. Nature 312:659-661 Sass GL, and Henikoff S (1998) Comparative Analysis of Position-Effect Variegation Mutations in Drosophila melanogaster Delineates the Targets of Modifiers. Genetics 148:733-42 Schinnick T, Lerner A, and Sutcliffe J (1981) Nucleotide sequences of Moloney murine leukaemia virus. Nature 293:543-545 Seum C, Spierer A , Pauli D, Szidonya J, Reuter G, and Spierer P (1996) Position-effect variegation in Drosophila depends on dose of the gene encoding the E2F transcriptional activator and cell cycle regulator. Development 122:1949-56 Sinclair D, Milne T, Hodgson J, Shellard J, Salinas C, Kyba M , Randazzo F, and Brock H (1998) The Additional sex combs gene of Drosophila encodes a chromatin 121 protein that binds to shared and unique Polycomb group sites on polytene chromosomes. Development 125:1207-16 Sinclair D, Mottus R, and Grigliatti T (1983) Genes which suppress position-effect variegation in Drosophila melanogaster are clustered. Moi Gen Genet 216:326-33 Sinclair DA, Clegg NJ, Antonchuk J, Milne TA, Stankunas K, Ruse C, Grigliatti TA, Kassis JA, and Brock FTW (1998) Enhancer of Polycomb is a suppressor of position-effect variegation in Drosophila melanogaster. Genetics 148:211-20 Sinclair DA, Lloyd V K , and Grigliatti T A (1989) Characterization of mutations that enhance position-effect variegation in Drosophila melanogaster. Moi Gen Genet 216:328-33 Smith P, and Corces V (1992) The suppressor of Hairy-wing binding region is required for gypsy mutagenesis. Moi Gen Genet 233:65-70 Smith PA, and Corces V G (1992) The suppressor of Hairy-wing binding region is required for gypsy mutagenesis. Moi Gen Genet 233:65-70 Song S, Gerasimova T, Kurkulos M , Boeke J, and Corces V (1994) An Env-like protein encoded by a Drosophila retroelement: evidence that gypsy is an infectious retrovirus. Genes Dev 8:2046-2057 Spana C, Harrison DA, and Corces V G (1988) The Drosophila melanogaster suppressor of Hairy-wing protein binds to specific sequences of the gypsy retrotransposon. Genes Dev 2:1414-23 Spofford J (1976) Position-effect variegation in Drosophila. In: A. Ashburner, and E. Novitski (ed) Genetics and Biology of Drosophila, vol 2a. Academic Press, pp 955-1019 Spradling A, and Karpen G (1990) Sixty years of mystery. Genetics 126:779-784 Spradling A C , and Rubin G M (1981) Drosophila genome organization: conserved and dynamic aspects. Annu Rev Genet 15:219-64 Stellar H, and Pirotta V (1985) A transposable P-element vector that confers selectable G418 resistance to Drosophila larvae. E M B O J 4.167-171 Sun X , Wahlstrom J, and Karpen G (1997) Molecular structure of a functional Drosophila centromere. Cell 91:1007-19 Tanda S, and Corces V (1991) Retrotransposon-induced overexpression of a homeobox gene causes defects in eye morphogenesis in Drosophila. E M B O J 10:407-417 Tanda S, Mullor J, and Corces V (1994) The Drosophila torn retrotransposon encodes an envelope protein. Moi Cell Biol 14:5392-5401 Tanda S, Shrimpton A, Ling-Ling C, Itayama H, Matsubayashi H, Saigo K, Tobari Y , and Langley C (1988) Retrovirus-like features and site specific insertions of a transposable element, torn, in Drosophila ananassae. Moi Gen Genet 214:405-411 1 2 2 Tartof K D , Hobbs C, and Jones M (1984) A structural basis for variegating position effects. Cell 37:869-78 Tchurikov N , Gerasimova T, Johnson T, Barbakar N , Kenzior A , and Georgiev G (1989) Mobile elements and transposition events in the cut locus of Drosophila melanogaster. Moi Gen Genet 219:241-248 Thompson ID, Higgins GD, and Gibson TJ (1994) C L U S T A L W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl Acids Res 22:4673-4680 Tschiersch B, Hofmann A, Krauss V , Dorn R, Korge G, and Reuter G (1994) The protein encoded by the Drosophila position-effect variegation suppressor gene Su(var)3-9 combines domains of antagonistic regulators of homeotic gene complexes. Embo J 13:3822-31 Udvardy A, Maine E, and Schedl P (1985) The 87A7 chromomere. Identification of novel chromatin structures flanking the heat shock locus that may define the boundaries of higher order domains. J Moi Biol 185:341-58 Whalen J, and Grigliatti T (1998) Molecular characterization of a retrotransposon in Drosophila melanogaster, nomad, and its relationship to other retrovirus-like mobile elements. Moi Gen Genet 160:401-409 Wilanowski T, Gibson J, and Symonds J (1995) Retrotransposon insertion induces an isozyme of sn-glycerol-3-phosphate dehydrogenase in Drosophila melanogaster. Proc Natl Acad Sci USA 92:12065-12069 Wustmann G, Szidonya J, Taubert H, and Reuter G (1989) The genetics of position-effect variegation modifying loci in Drosophila melanogaster. Moi Gen Genet 217:520-7 Yuki S, Inouye S, Ishimaru S, and Saigo K (1986) Nucleotide sequence characterization of a Drosophila retrotransposon, 412. Eur J Biochem 158:403-410 Zachar Z, and Bingham P (1982) Regulation of white locus expression: the structure of mutant alleles at the white locus of Drosophila melanogaster. Cell 30:529-541 Zhao K, Hart C M , and Laemmli U K (1995) Visualization of chromosomal domains with boundary element-associated factor BEAF-32. Cell 81:879-89 Zink B, and Paro R (1989) In vitro binding of a ^rans-regulator of homeotic genes in Drosophila melanogaster. Nature 337:468-471 123 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099426/manifest

Comment

Related Items