UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Development and characterization of herpes simplex virus type 1 vectors expressing m1 muscarinic acetylcholine… Atkinson, Leone Sheila 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-250121.pdf [ 13.41MB ]
Metadata
JSON: 831-1.0099211.json
JSON-LD: 831-1.0099211-ld.json
RDF/XML (Pretty): 831-1.0099211-rdf.xml
RDF/JSON: 831-1.0099211-rdf.json
Turtle: 831-1.0099211-turtle.txt
N-Triples: 831-1.0099211-rdf-ntriples.txt
Original Record: 831-1.0099211-source.json
Full Text
831-1.0099211-fulltext.txt
Citation
831-1.0099211.ris

Full Text

D E V E L O P M E N T A N D C H A R A C T E R I Z A T I O N O F H E R P E S S I M P L E X V I R U S T Y P E 1 V E C T O R S E X P R E S S I N G m l M U S C A R I N I C A C E T Y L C H O L I N E R E C E P T O R S by L E O N E S H E I L A A T K I N S O N B. S c . , the University of British Co lumb ia , 1989 M.D. , the University of British Co lumb ia , 1996 A T H E S I S S U B M I T T E D IN P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F D O C T O R O F P H I L O S O P H Y in T H E F A C U L T Y O F G R A D U A T E S T U D I E S (Department of Genet ics) W e accept this thesis as conforming to the required standard T H E U N I V E R S I T Y O F BRIT ISH C O L U M B I A May , 1997 © Leone She i l a Atk inson, 1997 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of QjS?r\o i-JC S The University of British Columbia Vancouver, Canada Date Ock 10 ) 1<T?7 DE-6 (2788) ABSTRACT This work focuses primarily on the express ion of a neurotransmitter receptor gene, the m l muscar in ic acety lchol ine receptor gene from HSV-1 recombinant v i ruses. The herpes s implex virus type-1 (HSV-1) has a number of b io log ica l features that make it an attractive vector for gene transfer into neurons: the virus is neurotropic, has a large genet ic carrying capaci ty, produces high stock titers, a n d has the ability to establ ish latency in neurons. V i ra l -expressed m l receptors were character ized with regards to v i ra l -assoc iated effects on exp ress ion , pharmaco log ica l properties, and functional activity in t issue culture cel ls . H S V - 1 recombinant v i ruses were made repl icat ion-defect ive by delet ion of the a 4 g e n e s encod ing the major regulatory protein ICP4. The el imination of ICP4 exp ress ion was found to enhance viral-directed m l receptor express ion from these recombinant v i ruses. The 5' noncoding region of the m l receptor gene wh ich contains three potential ICP4 repressor sites was shown to mediate ICP4 effects on viral-directed m l receptor express ion . The viral host shutoff protein (vhs) was a l so el iminated in HSV-1 recombinants, and these recombinant v i ruses demonst ra ted reduced v i ra l -associated effects on host polypept ide synthesis and slightly h igher levels of viral-directed m l receptor express ion . Viral ly exp ressed m l receptors mainta ined their pharmaco log ica l and functional propert ies. A n H S V - 1 recombinant virus defective in both ICP4 and vhs express ion was used to ana l yze viral-directed m l receptor express ion in primary cortical neuron cultures. The developmenta l age of the cultures inf luenced m l receptor express ion and function in infected neurons. Infected ten-day-old cultures demonstrated max imum viral-directed m l receptor express ion , and overexpress ion of m l receptors in these cultures produced an increase in functional response fol lowing muscar in ic agonist-st imulation. Investigations of m l receptor activities in neurons util izing the H S V - 1 recombinant virus were limited by cytopathic effects assoc ia ted with viral infection and the lack of an avai lable antibody against the m l receptor. i i -In an effort to overcome these limitations, an HSV-1 ampl icon vector express ing ant igenic-tagged m l receptors was deve loped. This vector offered two advantages: firstly, the ampl icon vector did not express any viral proteins, and therefore, avo ided cytopathic effects assoc ia ted with the recombinant v i ruses; a n d secondly , the attachment of an antigenic tag to the receptor enab led ant ibody recognit ion, and therefore, b roadened the potential methods of examin ing viral-directed m l receptor express ion. In addit ion, these studies enab led compar ison of the advantages and d isadvantages of HSV-1 recombinant v i ruses and H S V - 1 ampl icon vectors. i i i TABLE OF CONTENTS Title Copyright Abstract ^ Acknowledgements x l v Table of contents i v List of tables v i i List of figures v l i i Abbreviations used in this work x i 1.0 LITERATURE REVIEW 1 1.1 Neurotransmitter receptors 1 1.1.1 G protein-coupled receptors 1 1.1.2 Muscarinic acetylcholine receptors 4 1.1.3 m l muscarinic acetylcholine receptors 7 1.1.4 Exogenous expression of m l receptors 13 1.2 Gene delivery into neurons 13 1.2.1 Vectors for gene transfer into neurons 14 1.2.2 Promoter control and vector administration into neurons 15 1.2.3 "Naked" D N A , l iposomes and molecular conjugates 17 1.2.4 Adenov i rus, adeno-assoc ia ted virus and lentivirus vectors . . . . 18 1.3 Herpes simplex virus type 1 vectors 26 1.3.1 Structure, life cyc le and cl inical pathology of herpes s implex virus type 1 27 1.3.2 Recombinant herpes simplex viruses 34 1.3.3 Herpes simplex virus amplicon vectors 39 2.0 EXPERIMENTAL OBJECTIVES AND STRATEGY 43 3.0 METHODS AND MATERIALS 45 i v 4.0 CONSTRUCTION OF RECOMBINANT HERPESVIRUS VECTORS EXPRESSING M1 MUSCARINIC ACETYLCHOLINE RECEPTORS 57 4.1 Introduction 57 4.2 Results 59 4.2.1 Generat ion of HSV-1 recombinant viruses 59 4.2.2 Southern analysis of HSV-1 recombinant v i ruses 60 4.2.3 Analys is of viral replication competency 64 4.2.4 Analys is of polypeptide synthesis 67 4.2.5 Modif icat ion of the 5' noncoding region of the m l receptor gene 69 4.3 Discussion 73 5.0 EXPRESSION OF M1 MUSCARINIC ACETYLCHOLINE RECEPTORS FROM RECOMBINANT HERPES VIRUS VECTORS 78 5.1 Introduction 78 5.2 Results 79 5.2.1 Transcription of m l receptor 79 5.2.2 Ligand binding analysis 81 5.2.3 Binding affinity analysis 85 5.2.4 Compar i son of [ 3 H ] N M S and [ 3 H ] Q N B l igand binding 87 5.2.5 Functional activity 89 5.3 Discussion 91 6.0 RECOMBINANT HERPESVIRUS VECTOR INFECTION OF PRIMARY CORTICAL NEURON CULTURES 96 6.1 Introduction 96 6.2 Results 98 6.2.1 Immunofluoresence study 98 6.2.2 Ligand binding analysis 100 V 6.2.3 Functional activity 105 6.2.4 Cytotoxic effects 107 6.3 Discussion 109 7.0 EXPRESSION OF AN ANTIGENIC TAGGED M1 RECEPTOR FROM AN HSV-1 AMPLICON VECTOR 114 7.1 Introduction 114 7.2 Results 115 7.2.1 Generat ion of HSV-1 amplicon vectors 115 7.2.2 Immunofluorescence studies 117 7.2.3 Ligand binding analysis 119 7.3 Discussion 123 8.0 GENERAL DISCUSSION AND CONCLUSION 129 9.0 REFERENCES 141 v i LIST OF TABLES P a g e Tab le 1-1 Funct ional propert ies of m l muscar in ic acetylchol ine receptors 10 Tab le 1-2 Pharmalog ica l propert ies of m l muscar in ic acety lchol ine receptors 12 Tab le 1-3 Kinetic c l asses of herpes s implex genes and their funct ions 31 v d i LIST OF FIGURES P a g e F ig . 4 -1 . Insertion of the human m l muscar in ic acety lchol ine receptor gene into an HSV-1 genome 61 F ig . 4-2. Recombinant HSV-1 genomes express ing the human m l muscar in ic acety lchoine receptor 62 F ig . 4-3 . Southern analys is of the m l muscar in ic acety lchol ine receptor gene 6 3 F ig . 4-4. Southern analys is of the ICP4 genes in the recombinant HSV-1 vectors 65 F ig . 4-5. Detect ion of viral replication by dot blot analys is 6 6 F ig . 4-6. Cel lu lar and viral polypeptide synthesis of HSV-1 recombinants 68 F ig . 4-7. The 5' noncoding sequence of the human m l muscar in ic acety lchol ine receptor gene 7 0 F ig . 4-8. Construct ion of a m l muscar in ic acetylchol ine receptor gene with a deleted 5' noncoding s e q u e n c e 71 F ig . 4-9 S e q u e n c e analys is of the 5' end of the 8-5' m l muscar in ic acety lchol ine receptor gene and the antigenic tagged m l muscar in ic acetylchol ine receptor gene 72 v i i i Fig . 5-1. Detect ion of m l A c h R m R N A express ion from recombinant HSV-1 vectors 80 F ig . 5-2. Quanti f icat ion of sur face muscar in ic acetylchol ine receptor express ion from recombinant HSV-1 vectors us ing l igand binding a s s a y s 82 F ig . 5-3. Quanti f icat ion of sur face muscar in ic acety lchol ine receptor express ion from a recombinant HSV-1 vector containing a m l A c h R gene with a deleted 5' noncoding region 84 F ig . 5-4. Saturat ion curves and scatchard analys is of m l muscar in ic receptors exp ressed from recombinant HSV-1 vectors 86 F ig . 5-5. Quanti f icat ion and compar ison of sur face versus intracellular m l muscar in ic acetylchol ine receptors in recombinant HSV-1 vector infected Vero cel ls 88 F ig . 5-6. Funct ional activity of m l muscar in ic acetylchol ine receptors exp ressed from recombinant HSV-1 vectors 9 0 F ig . 6-1. Recombinant HSV-1 vector infection eff iciency of neurons 99 F ig . 6-2. (3-Galactosidase staining of recombinant HSV-1 infected primary cort ical neuron cultures 101 Fig . 6-3. T imecourse of sur face muscar in ic acetylchol ine receptor express ion from a recombinant HSV-1 vector in primary cort ical neuron cultures 102 F ig . 6-4. Compar i son of sur face m l receptor express ion in 10 day-o ld primary cort ical neuron 104 F ig . 6-5. Funct ional activity of m l receptors exp ressed from a recombinant HSV-1 vectors in primary cortical neuron cultures 106 F ig . 6-6. Morpholog ica l changes assoc ia ted with recombinant H S V - 1 vector infection 108 F ig . 7-1. Amp l i cons containing the m l muscar in ic acety lchol ine receptor gene and the antigenic tagged m l muscar in ic acety lchol ine receptor gene. 116 F ig . 7-2. Genera t ion of HSV-1 packaged ampl icons 118 F ig . 7-3. Immunof luorescence studies of the antigenic tagged m l receptor. 120 Fig. 7-4. Detect ion of sur face muscar in ic acetylchol ine receptor expression from amplicon vectors. 122 F ig . 7-5. Immunof luorescence analys is of VA-HA /hm1 infected Vero cel ls to est imate ampl icon stock titer 124 X LIST OF ABBREVIATIONS a a amino ac id A A V adeno-assoc ia ted virus A S O R as ia l oo rosomuco id P-gal p -ga lac tos idase B B B blood brain barrier B S A bovine serum albumin C cytos ine C M V cy tomegalov i rus C O S c o s m i d C P E cytopathic effect c p m counts per minute C y s cyste ine d day(s) D N A deoxyr ibonuc le ic ac id D N T P s deoxynucleot ide t r iphosphates ds double s t randed E D T A ethylenediaminetetraacet ic ac id F B S fetal bovine serum FITC f luoresc iene isoth iocyanate G g u a n o s i n e G D P guanos ine d iphosphate G P C R G-protein coup led receptors G R K G-protein coup led receptor k inase G T P guanos ine t r iphosphate H A haemagglu t in in hpi hours post infection hr hour(s) H S V - 1 herpes s implex virus type 1 ICP infected cel l protein IE immediate-ear ly x i IP3 inositol 1,4,5-tr iphosphate kb k i lobase pairs K D a k i lodal tons L A P latency assoc ia ted promoter L A T latency assoc ia ted transcript m A b monoc lona l ant ibody m A c h R muscar in ic acety lchol ine receptor M E M modif ied Eag le ' s med ium min minute(s) MOI multiplicity of infection m R N A messenge r r ibonucleic ac id N-terminal amino- terminal N M S N-methy lscopo lamine N P 4 0 Nonidet P-40 O R F open reading frame P A G E polyacry lamide gel e lect rophores is P B S phosphate buffered sa l ine P D L poly-d- lys ine P F U plaque-forming unit(s) PI phospho inos i t ide P L C phospho l ipase C P L L poly- l - lys ine P ro prol ine P T X pertussis toxin P Z P p i renz ip ine Q N B qu inuc l idny lbenz i la te R N A r ibonucleic ac id R P M revolutions per minute S D S sod ium dodecy l su lphate s s s ingle s t randed T C A tr ichloroacetic ac id tk thymidine k inase x i i T M t ransmembrane ts temperature sensi t ive UL unique long region of the herpes s implex virus g e n o m e U s unique short region of the herpes s implex virus g e n o m e vhs virion host shutoff V S V ves icu lar stomatitis virus V S V - G 6 vesicular stomatitis virus glycoprotein G w/v weight /vo lume w/w weight/weight x i i i ACKNOWLEDGEMENTS This thesis would not have been poss ib le without the support and gu idance of severa l individuals. First and foremost, I would like to thank my superv isor , Dr. F. Tufaro for the opportunity to work under his tutelage. He has acted as both mentor and fr iend, and has contributed greatly to my professional and personal development . I would a lso like to thank members of my thesis commit tee, Dr. R. M°Master, Dr. T. Snutch , and Dr. C . E a v e s for their sound adv ice through the years ; Dr. M . C y n a d e r for introducing me to my thesis topic; Dr. P. Re iner and members of his laboratory for their ass is tance with the primary cortical neuron cultures; and members of the Tufaro laboratory, past and present for helpful d iscuss ions and many good memor ies . In addit ion, I would like to acknowledge my fr iends and family who have been my advocates , my motivators and are largely responsib le for my ach ievements . x i v 1.0 LITERATURE REVIEW 1.1 NEUROTRANSMITTER RECEPTORS Neurons differ from other cel ls in their advanced ability communica te with one another. Thei r ability to integrate input from severa l sources into one appropriate response enab les the most remarkable activities of the brain, including memory and learning. T h e s e complex functions are mediated largely by neurotransmitters and neurotransmitter receptors. Neurotransmitters include severa l different c l a s s e s of mo lecu les and more than 20 subs tances . However, most neurotransmitters that have been identified fall into one of four groups of compounds : acety lchol ine, a derivative of cholestero l ; monamines , der ived from aromatic amino ac ids ; pept ides, which are short chain amino ac ids ; and amino ac ids themselves. Neurotransmitter receptors are divided into two main famil ies: ionotropic receptors or l igand-gated ion channe ls , and metabotrobic receptors or GTP-b ind ing protein (G-protein) coup led receptors. A single neurotransmitter may activate both types of receptors. For example , acety lchol ine is a physio logic agonist for both the nicotinic and muscar in ic receptors which are complete ly different entit ies. Nicotinic acetylchol ine receptors are multi-subunit, l igand gated ion channe ls , whi le muscar in ic acetylchol ine receptors are single-subunit , G-protein coup led receptors. Th is work focuses on the express ion and function of the latter from an H S V - 1 recombinant vector. 1.1.1 G protein-coupled receptors The G protein-coupled receptor ( G P C R ) superfamily cons is ts of severa l hundreds of receptors, of which the muscar in ic receptors form a smal l but important cluster. A vast array of subs tances act through G P C R s including neurotransmitters, hormones , sugar and alkaloid tatants, volati le organic odorants, ca lc ium ions, and photons of v is ible and U V light. Members of the G P C R s superfamily t ransduce these extracel lular s ignals to intracellular effector molecu les v ia their interaction with G-proteins. The nature of G -protein/receptor interaction enab les amplif ication of s ignal t ransduct ion and a sensi t ive, 1 rapid response. G P C R s share a similar structure, act through G-proteins, and undergo simi lar mechan i sms of receptor regulation. A . G protein-coupled receptor structure G P C R s are character ized by a single protein molecule that contains seven hydrophobic domains each consist ing of approximately 20 amino ac ids that are be l ieved to form a-he l ices traversing the membrane (TM l-VII). The t ransmembrane domains are connec ted by three extracel lular and three intracellular loops. There is a n ^ extracel lular amino-terminal domain (often glycosylated), and a cy top lasmic carboxy-terminal (often palmitoylated). The amino-terminus does not have a s ignal s e q u e n c e , instead the s ignal sequence consis ts of multiple regions of the t ransmembrane domains . Transport to the p lasma membrane has been shown to only require T M l-lll (Maggio, et a l . , 1996). The carboxy terminus contains severa l phosphorylat ion sites and is involved in regulation of receptor respons iveness. The primary functional assoc ia t ion of a G P C R with its speci f ic G-protein is v ia its third intracellular loop, but regions of the s e c o n d loop and cytop lasmic tail have been shown to contribute to G-protein coup le specif ici ty. B. G protein activation The G-proteins are heterotrimeric proteins, consist ing of a , (3, and y subuni ts. Act ivated G-protein receptors cata lyze replacement by guanos ine tr iphosphate ( G T P ) of guanos ine d iphosphate ( G D P ) bound to the Goc subunits, caus ing d issociat ion of the G a - G T P and Py subunits. T h e s e activated subunits relay the s ignal to downst ream effectors, either cel lular enzymes or ion channels (Onrust et a l . , 1997). T h e oc-subunit is responsib le for most known pathways of second messenge r act ivat ion. The Py-subunit ~ is essent ia l for cooperat ing with receptors to enable oc-subunit act ivat ion, and it is a lso be l ieved to play a role in s ignal regulation, most notably in tyrosine k inase receptor ^ activation of mitogen-act ivated protein k inase ( M A P K ) (Onrust et a l . , 1997; L o p e z -l l asaca et a l . , 1997). Severa l dozens of G-protein types and subtypes have been isolated, and each speci f ic G-protein interacts with a speci f ic group of receptor subtypes. O n e G-protein subtype may be activated by different neurotransmitters, hormones, etc. 2 Ultimately, the G-protein/receptor relationship maintains the specif icity offered by the diversity of receptor subtypes, but a lso provides s o m e redundancy to the sys tem. Recepto r promiscuity, when a st imulated G P C R differentially coup les to multiple G-proteins to activate multiple c a s c a d e s , is more pronounced with s o m e agonis ts , pharmaco log ica l ana logues to neurotransmitters, than with others, and is be l ieved to be exacerba ted by receptor overexpress ion (Kenakin, 1995a). High eff icacy agonis ts appear to activate multiple G-proteins in this situation, while the low eff icacy agonis ts only act ivate the most efficiently coupled G-protein (Kenakin, 1995b). Th is concept is ca l led agonist trafficking. Mates ic and coworkers demonstrated the effects of differential affinity of act ivated muscar in ic receptors for G-proteins fol lowing stimulation with different agonists (Matesic et a l . , 1991). The possibil i ty of receptor promiscuity and agonist trafficking must be taken into considerat ion when investigating G-protein receptor funct ions, especia l ly in receptor overexpress ion sys tems. C . G protein-coupled receptor regulation Most G-protein coupled receptors are known to undergo s o m e form of desensi t izat ion, down-regulat ion or adaptat ion in response to pro longed or repeated st imulat ion. Agonis t -dependent phosphorylat ion of receptors p lays a pivotal a role in this phenomenon . It is mediated by a family of ser ine/threonine protein k inases cal led G-prote in-coupled receptor k inases ( G R K s ) . Speci f ic G-protein receptor desensi t izat ion by agonis t -dependent G R K phosphorylat ion has been demonstrated in many model sys tems , including muscar in ic receptors (Benovic et a l . , 1991; Premont et a l . , 1995). The actual mechan ism of G R K catalytic activation by receptor over-st imulat ion is complete ly unknown; however, progress has been made elucidat ing the mechan i sm by which G R K s inactivate receptors. G R K phosphorylat ion si tes have been local ized to the third intracellular loop and carboxyl terminal tail of G-protein receptors. G R K phosphory la ted receptors become targets for the binding of an arrestin protein, which renders the receptor inactive by preventing the binding and subsequent activation of G -proteins. Arrest in binding not only functionally uncouples G P C R s , but is a lso thought to mediate receptor sequestrat ion (reviewed by Ferguson et a l . , 1996a). 3 G P C R sequestrat ion promotes the removal of agonist-act ivated receptors from the p l a s m a membrane to endosoma l compartments. Sequestrat ion not only results in downregulat ion of sur face receptors, but is a lso bel ieved to play a primary role in receptor resensit izat ion. Th is process has been best character ized with p-adrenergic receptors, but has a lso been well character ized in muscar in ic receptors (Koenig and E d w a r d s o n , 1996). The precise endocytot ic mechan ism of sequestrat ion remains controvers ia l , but the participation of G R K phosphorylat ion and arrestin binding in mobi l iz ing receptors to endocytot ic organel les is general ly accep ted (Ferguson et a l . , 1996b; T s u g a et a l . , 1994). G P C R internalized in endosomes are be l ieved to undergo acidi f icat ion, which enab les the re lease of bound l igands and the st imulation of G P C R -directed phosphatase activity (Pippig et a l . , 1995; Gar land et a l . 1996). Resens i t i zed receptors are then mobi l ized back to the p lasma membrane by an unknown mechan i sm . 1.1.2 Muscarinic acetylcholine receptors Numerous physio logical responses both within the central and per ipheral nervous sys tems are evoked by acetylchol ine stimulation of muscar in ic acety lchol ine receptors (Nathanson, 1987). Muscar in ic receptors play key roles in a variety of complex activit ies, including learning, memory, arousa l , motor and sensory modulat ion, regulation of heart beat, developmental plasticity, and mi togenesis (Felder et a l . , 1993; Trejo and Brown, 1991; Conk l in et a l . , 1988). Muscar in ic receptors have a lso been impl icated in severa l central nervous sys tem disorders, such as A lzhe imer ' s d i sease , Park inson 's d i sease , depress ion and sch izophren ia (Hung et a l . , 1993; Ni tsch et a l . , 1991; Dubois et a l , 1983; Nathanson, 1987). The role muscar in ic receptors play in modulat ing these complex activities and d i seases are largely unknown. However , much has been learned about the b iochemical nature of these receptors and their induction of s ignal t ransduct ion pathways. Through an increased understanding of the molecu lar biology of these receptors, we may ach ieve an understanding of their physio logical activit ies. A . Pharmaco log ica l c lassi f icat ion of muscar in ic receptors 4 Initial character izat ion of muscar in ic receptors was b a s e d on pharmaco log ica l data. Pharmaco log ica l tools were used to define subtypes of the muscar in ic family. First, p irenzipine (PZP) binding studies were used to separated muscar in ic receptors into one of two categor ies, M1 or M2 (Hammer et a l . , 1980). M1 receptors were loca l ized primarily in the brain and bound P Z P , while M 2 receptors did not bind P Z P and were local ized primarily in card iac t issue. Further subtypes were def ined by measur ing the individual binding affinities of severa l other muscar in ic antagonists. Kinet ic studies of the non-select ive antagonists [ 3H] N-methylscopolamine ( [ 3 H]NMS) and [ 3H] quinucl id inylbenzi late ( [ 3 H]QNB) enab led the differentiation of three pharmaco log ica l subtypes (Waelbroeck et a l . , 1986 & 1987). The development of more muscar in ic antagonists such as A F - D X 116, h imbacine, methroctamine, 4 - D A M P and p F H H S i D expanded the pharmacolog ica l c lassi f icat ion to four subtypes, des ignated M 1 - M 4 (Hammer et a l . , 1986; Wae lb roeck et a l . , 1990). Unfortunately, none of the muscar in ic antagonists proved to be completely select ive for any one subtype. Th is m e a n s that a part icular subtype was def ined by dissociat ion constants for a range of se lect ive antagonist and classi f icat ion was based on relative binding affinities. B. Muscar in ic receptor subtypes Mo lecu la r biological methods have revealed five subtypes of muscar in ic receptors, each encoded by an unique gene. The first muscar in ic receptor, des ignated m l , was c loned by the N u m a laboratory in 1986, and within a year the m2, m3 , m4 and m5 subtypes were isolated (Kubo et a l . , 1986; Pera l ta et a l . , 1987a & 1987b; Bonner et a l . , 1987 & 1988). E a c h subtype has been character ized as to its anatomical local izat ion, pharmacolog ica l propert ies and functional activit ies in cel l culture mode l sys tems (reviewed by Hulme et a l . , 1990 & Brann et a l . , 1993). Coincidental ly , m l receptor pharmacolog ica l properties are similar to that of the original M 1 , and m2 those of M 2 . Funct ional ly, the five subtypes fall into two gross subc lasses , the odd (m1,m3,m5) and the even (m2,m4). The odd subtypes preferentially couple to the pertussis toxin (PTX)- insensi t ive G proteins, G q and G n . , which activate phospho l ipase C , and ultimately result in e levated inositol 1,4-5 t r isphosphate (IP 3) and diacylg lycerol (DAG) 5 levels. The even subtypes act v ia the PTX-sens i t i ve G proteins, G o and G,.. Gj inhibits adenylate cyc lase , resulting in dec reased cycl ic adenos ine monophospha te ( c A M P ) levels. Funct ional di f ferences within these subc lasses have not yet been found. Unique subtype funct ions may exist in the context of these receptors natural neuronal environment or during speci f ic developmental per iods, but neither of these situations have been well s tudied. C . Structure/function relat ionships of muscar in ic receptors Structure/function relat ionships of muscar in ic receptor subtypes have been well charac ter ized using label ing with covalent l igands, si te-directed mutagenes is , and ch imer ic receptors. The functional domains assoc ia ted with l igand binding and G protein interaction have been well def ined. L igand binding to muscar in ic receptors appears to involve an intricate network of hydrogen bond interactions between the l igand and multiple regions of severa l t ransmembrane domains . Mutat ional studies have identified a ser ies of threonine and tyrosine res idues located about 1-2 hel ical turns away from the membrane sur face on T M III, V , VI and VII, that are involved in forming hydrogen bonds critical to agonist binding, but not antagonist binding (Wess et a l . , 1991). Label ing with covalent l igands revealed an interaction between an asparag ine residue in T M III and the posit ively charged amino head group of muscar in ic l igands, which was conf i rmed us ing si te-directed mutagenes is (Birdsall et a l . , 1993; F raser et a l . , 1989). The receptor domains involved in antagonist binding have not been well mapped . However , p i renzip ine selectivity has been local ized to T M IV and the third extracel lular loop, and an asparag ine residue in T M VI has been shown to play a role in antagonist b inding, but not agonist binding (Wess et a l . , 1992; Bluml et a l . , 1994) G-protein coupl ing to muscar in ic receptors has been mapped to multiple regions of the s e c o n d , third and fourth intracellular domains; however, studies employ ing chimer ic muscar in ic receptors have demonstrated that the i3 loop is sufficient to determine the G-protein specif icity of a given muscar in ic receptor subtype (Lechlei ter et 6 al . , 1990; W e s s et a l . , 1990). There is a great deal of sequence variat ion between the i3 loops in muscar in ic receptor subtypes; however, there is conservat ion of a smal l number charged amino ac ids at the amino- and caboxy-termini of the i3 loop and the correct posit ioning of these residues was found to be essent ia l for G-protein recognit ion and activation (Arden et a l . , 1992; Kunke l and Peral ta, 1993). A s few as 22 amino ac ids of the i3 amino- and carboxy-termini were found to confer G protein specif icity (Kunkel and Pera l ta , 1993). Mult iple regions of i2 and i4 domains, particularly an asparag ine residue at the beginning of i2, have been found to contribute to more efficient G-protein coupl ing of all subtypes (Fraser et a l . , 1989). S tud ies with truncated and chimer ic muscar in ic receptors suggest that muscar in ic receptors assoc ia te with one another within the p lasma membrane, and are capab le of affecting e a c h other's function. W h e n truncated receptors consist ing of T M 1-V were coexp ressed with gene fragments encoding T M VI, VII and the carboxy terminal functional receptors were formed (Maggio et a l . , 1993). The ability of muscar in ic receptors to function as multiple autonomous folding units was conf i rmed by S c h o n e b e r et a l . in 1995. Recent ly , a large fragment of the i3 loop, not required for G protein coupl ing or receptor trafficking, has been found to mediate the interaction between truncated and chimer ic receptors (Maggio et a l . , 1996). The physio logical role of muscar in ic receptor interactions within the p lasma membrane is entirely unknown. It has been specu la ted, however, that the interaction of different receptor subtypes cou ld provide a means c ross communicat ion between different s ignal ing pathways. 1.1.3 ml muscarinic acetylcholine receptors A . Local izat ion m l receptors m l muscar in ic acetylchol ine receptors are present in the central and per ipheral nervous sys tem, as well as in exocr ine g lands. The anatomical local izat ion of m l receptors, in relation to other muscar in ic subtypes, has been determined by in situ autoradiography and immunohistochemistry. In the C N S , the m l subtype is the 7 predominant muscar in ic receptor in the cortex, striatum, thalmic nuclei and h ippocampus , represent ing 3 5 - 4 5 % of the muscar in ic populat ion. It is fo l lowed, in order of dec reas ing protein abundance, by the m2, m4, m3 and m5 subtypes (Levey, 1992; W a n g et a l . , 1993). m l receptors are in particularly high abundance in forebrain cortex, the pyramidal cel l layers of the C A 1 subfield of the h ippocampus, the granular cel l layer of the dentate gyrus , the habenular nuc leus, and the arcuate hypothalamic nuc leus (Chabot et a l . , 1996). In the P N S , m l receptors were found to be coexp ressed , with m2, m3 and m4 receptors, in most autonomic gangl ion cel ls (Buckley, 1990). Outs ide of the nervous sys tem, m l receptors can be found coexpressed with m3 receptors in exocr ine g lands (Culp et a l . , 1996). In vivo responses specif ic to m l receptor activity in these regions have been difficult to determine due to the absence of a m l receptor speci f ic agonist . B. Structure of m l receptors T h e m l receptor is highly conserved among mammal ian spec ies ; there is 9 5 % amino ac id identity between human, rat and porcine m l receptors. In relation to other muscar in ic subtypes, the m l receptor has approximately 7 9 % and 3 8 % amino acid identity with the odd (m3, m5) and even (m2,m4) subtypes, respect ively (Bonner, 1989). The m l receptor gene, like all other muscar in ic receptor genes , does not contain any introns, but does have a potential spl ic ing site in the 5' noncoding s e q u e n c e (Bonner, 1987). The est imated s ize of the m l receptor protein is 70 to 80 k D a (Haga and H a g a , 1983). There are two potential glycosylat ion sites on the extracel lular amino-terminus; however , neither the glycosylat ion pattern nor its re levance to receptor function have been a s s e s s e d in neurons. In short, the extracellular N-terminus has no known function, but a poss ib le role in cel l targeting has been proposed (Hulme et a l . , 1990). T ransmembrane domains involved with l igand binding are as d i scussed in prev ious sect ion. The only character ized l igand interaction contributed mainly to m l receptors is P Z P selectivity local ized to T M IV and the third extracellular loop (Wess et a l . , 1992). The i3 loop of the m l receptor has the least amount of sequence homology with other muscar in ic subtypes. Only the carboxy-terminal s e q u e n c e s of this region are well conse rved among all muscar in ic subtypes, and the amino-terminal 15-20 amino ac ids 8 are conserved within its functional c lass ( m l , m3 and m5). Interestingly, the m l receptor 's i3 loop is considerable shorter than the i3 loops of other members of its funct ional c lass , but the re levance of this difference is unknown (reviewed by Bonner , 1989; Hu lme et a l . , 1990; Brann, 1993). C . Funct ions of m l receptors T h e functional responses to m l receptor stimulation have been wel l s tudied in t ransfected model sys tems and cel l l ines endogenous ly express ing muscar in ic receptors. In most cel l types, m l receptors, like m3 and m5, couple to PTX- insens i t i ve G proteins ( G q / n ) to stimulate phosphoinosi t ide (PI) hydrolysis. Th is response is mediated by G q / n activation of the (31 subunit of phospho l ipase C ( P L C ) (Berstein et a l . , 1992) . Act ivat ion of P L C results in the hydrolysis of phosphatidyl inositol 4 ,5 -b iphosphate and generat ion of inositol 1,4,5-triphosphate (IP3) and d iacy lg lycero l ( D A G ) ; IP3 subsequent ly triggers the re lease of C a 2 + from intracellular s tores, whi le D A G st imulates protein k inase C ( P K C ) (Berridge, 1993). The only cel ls tested which do not demonstrate this response to m l receptor stimulation are oocytes. Other m l effector m e c h a n i s m s are highly cel l- type speci f ic (Table 1-1). They include adeny l cyc lase stimulation and re lease of arachidonic ac id , stimulation of CI" channe ls , inhibition of M current, inhibition of the de layed rectifier K+ channe l , and stimulation of vol tage-independent C a 2 + channe ls (Hulme et a l . , 1990; McDona ld et a l . , 1993; Huang et a l . , 1993) . Mult iple s ignal pathways can potentially be act ivated by m l receptors s imul taneously v ia activation of phospho l ipases A 2 , C or D, as well as tyrosine k inase (reviewed by Felder , 1995). T h e physiological functions of m l receptors in neurons are less well character ized, m l speci f ic functions are difficult to del ineated from other muscar in ic subtype functions in primary cultures or t issue preparat ions. R e s p o n s e s are attributed to m l receptors if they can be b locked with P Z P ( P Z P ) . Cort ical neurons have been shown to undergo PI hydrolysis, P K C activation and M-current inhibition in response to st imulation of a high affinity P Z P receptor; and h ippocampal neurons have been demonst ra ted to undergo PI hydrolysis, M-current inhibition, inhibition of C a 2 + a c t i v a t e d 9 Table 1 - 1 . Functional properties of ml muscarinic acetylcholine receptors Effector mechanisms Expression System PI hydrol -ysis cAMP stimul a-tion Release of arachidonic acid Increase of intra-cellular Ca 2 + Activation of Opening of C a 2 + CI" channels dependent K+ channels Inhibition of M current References A9 * * * * * Brann et al. (1987), Jones et al. (1988a,b), Conklinet al. (1988) Kidney cells * * Peralta et al. (1988) B82 * Lai et al. (1988) RAT -1 * Steinet et al. (1988) NG108 * * * * Fukuda et al. (1988), Bujo et al. (1988), Neker et al. (1988) Xenopus oocyte * Fukuda et al. (1987), Bujo et al. (1988), CHO * Askenazi et al. (1988) K + channe ls and reduction of a C a 2 + current (McCormic and Pr ince, 1985). Other m l receptor assoc ia ted functions that have been demonstrated in t issue culture mode ls have not been well character ized in neurons. D. Pharmaco logy of m l receptors Muscar in ic l igand binding analys is is based on a s ingle-si te binding per receptor model sys tem, but this model sys tem is compl icated by the inf luence of the activity state of the receptors, ie. receptor/G protein relat ionships, on l igand binding affinities. Consequen t l y , both agonist binding curves and antagonist binding affinities will be dependent upon the nature of the receptor/G protein interaction which may vary as a function of cel l type and/or accord ing to exper imental condit ions. Th is variabil ity between express ion sys tems has been well documented. In genera l , antagonist affinity va lues for a g iven subtype and a given antagonists vary approximately four fold between different studies. The variability of antagonist affinities for m l receptors in different exper imenta l sys tems are shown in Table 1-2. Th is variabil ity may be contr ibuted to by variability in a s s a y condit ions, particularly changes in the ionic strength of buffers (Pedder et a l . , 1991). The practical s igni f icance of this estab l ished variabil ity is that a dif ference in antagonist affinity of less that 4-fold between receptors in different sys tems shou ld not be taken as an indication of altered receptor propert ies. There do not s e e m to be any major d iscrepanc ies between affinities determined by l igand binding a s s a y s within an exper imental sys tem (reviewed by Buck ley , 1990 and Caul f ie ld , 1993). Tradit ionally, antagonists have been used to character ize muscar in ic receptor subtypes and est imate receptor numbers. None of the muscar in ic antagonists exhibit greater than a 3-fold selectivity for one subtype over all other subtypes. P Z P demonstrates the highest antagonist selectivity for m l receptors. T h e highest antagonist binding affinities for m l receptors are seen with the nonselect ive antagonists, [ 3 H ] N M S , [ 3 H ] Q N B and atropine. Affinity va lues for A F - D X 116 and hexahydrosi ladi fenidol (HS) are highly var iable between express ion sys tems, but as a rule these antagonists are more select ive for m2 and m3 receptors, respectively. A compar ison of antagonist 11 Table 1 - 2 . Pharmalogical propertices of ml muscarinic acetylcholine receptors Experimental System NMS (pM) QNB (pM) Atropine (nM) PZP (uM) AF-DX (uM) 4-DAMP (uM) Meth. (uM) Himb. (uM) Hulme et al., 1990 CHO cells mammalian tissue 10.2 9.7 -10.0 9.5 7.8 7.9 5.9 6.4 8.9 7.8 7.1 7.0 Fukuda et al., 1987 Xenopus oocytes - 81 1.4 10.0 1.8 - - -Peralta et al., 1987 mammalian tissue - 22.8 3.3 0.5 6.8 - - _ Bonner et al., 1987/8 CHO cells COS - 7 cells 65 32 - 15 1.3 - - -Matsui et al., 1994 COS - 7 cells 9.9 - - 8.1 - ; 8.9 6.8 7.1 binding affinities to m l receptors as def ined by var ious investigators is shown in Tab le 1-2 (reviewed by Buck ley , 1990 and Caul f ie id , 1993). 1.1.4 Exogenous expression of ml receptors T o elucidate the role m l receptors play in modulat ing complex neuronal activit ies, it would be useful to alter the express ion of this receptor in neurons and to deduce assoc ia ted effects on functional activit ies. O n e approach is to exogenous ly express the receptor from a gene transfer vector. The m l receptor has many advantages for the examinat ion of exogenous express ion. Firstly, the m l receptor gene does not contain any introns, and therefore, express ion of the protein in t issue culture cel ls is not compl ica ted by any requirements for m R N A spl ic ing and p rocess ing . Second ly , the pharmacolog ica l propert ies of the m l receptors are well character ized, and many pharmaco log ica l tools are avai lable to quantitate express ion and a s s e s s funct ional activity. Thirdly, functional activities have been a s s e s s e d in var ious exper imental sys tems , and although many of these are cell type specif ic, agonist induced phosphoinosi to l hydrolysis has been estab l ished as a reliable measu re of m l receptor activity in most experimental sys tems. Unfortunately, their is a lack of avai lable ant ibodies directed against the m l receptor, which limits character izat ion of m l receptor express ion by immunof luorescence, immunoprecipi tat ion, and Wes te rn blotting techn iques. However , this limitation can be overcome by attaching an ant igenic tag to the exogenous ly exp ressed receptors. There is currently a number of gene transfer sys tems being deve loped for gene delivery into neurons, e a c h having its advan tages and d isadvantages. Th is study util izes herpes s implex virus type 1 vectors to exogenous ly express m l receptors. 1.2 GENE DELIVERY INTO NEURONS Molecu la r genet ic technologies have enab led the identif ication, isolat ion and character izat ion of speci f ic genes underlying neurological d i sease p rocesses , and it is 13 the promise of molecular genet ics not only to understand d i sease but a lso to deve lop more definitive therapy. The concept of gene therapy is that d i sease can and shou ld be approached at the level of underlying genetic mechan isms . Its s u c c e s s is dependent upon efficient and safe transfer of genetic material into somat ic cel ls fo l lowed by appropriate express ion of gene products for control or cure of d i sease . Ideally, vectors del iver ing genet ic material should provide long-term regulated gene express ion at therapeut ic levels, targeted in a cel l -speci f ic fashion, in the a b s e n c e of harmful cyotoxic or immunologica l s ide effects. G e n e therapy for neurological d i sease is further compl ica ted by the non-proliferative nature of most neurons, neuronal sensit ivity to toxic insults, and the ex is tence of the blood-brain barrier. At present, while the tools and techn iques for therapeutic delivery of genet ic material into neurons are inadequate for therapeut ic gene transfer and express ion , the evolution of gene transfer technology has and cont inues to il luminate d i sease mechan isms and advances the deve lopment of faithful d i sease models . 1.2.1 Vectors for gene transfer into neurons The intitial attempts at gene therapy principally involved modulat ing neuronal activity by transplanting genetical ly modif ied cel ls into targeted regions of the central nervous sys tem. Tradit ional methods of gene transfer, including ca lc ium-phosphate transfect ion, retroviral-mediated gene transfer and electroporat ion, were used to modify immortal ized cel l l ines (Horellou et a l . , 1990), primary f ibroblasts (Takayama et a l . , 1995), myoblasts (Dai et a l . , 1992; J iao et a l . , 1993), S c h w a n n cel ls (Schinst ine et a l . , 1995) and astrocytes (Casti l lo et a l . , 1994; Cunn ingham et al . , 1994) in vitro prior to transplantat ion. T h e s e ex vivo studies met with some s u c c e s s in modulat ing neuronal activity in animal models , but were limited by their inability to directly affect neuronal gene express ion . They were a lso p lagued with tumour formation, graft rejection and d e c r e a s e d gene express ion over t ime. Addit ional ly, transplantat ion into human brain w a s assoc ia ted with significant morbidity and mortality. Direct gene transfer into neurons requires, first and foremost, vectors capab le of efficiently penetrating and express ing in nonproliferating ce l ls . The two genera l 14 approaches under development are nonviral and viral mediated gene transfer. Nonvira l sys tems include direct injection of D N A , particle bombardment , D N A / l i p o s o m e comp lexes and molecular conjugates. T h e s e sys tems avoid most of the toxicity and immune response issues assoc ia ted with viral mediated sys tems. Present ly , all of the nonviral sys tems rely on pass ive delivery of D N A to the nucleus and are only capab le of transient express ion . T h e s e problems may be overcome in the future v ia the incorporat ion of viral nuclear translocat ion s ignals , and integration or ep isoma l ma in tenance s e q u e n c e s on del ivered p lasmids (reviewed by Ridet and Privat, 1995; Y a n g and S u n , 1995). The nonviral sys tems employ ing l iposomes or molecu lar conjugates are progressing rapidly in their ability to target speci f ic cel l or t issue types; unfortunately, there is currently no means of specif ical ly targeting gene del ivery to neurons (reviewed by Sor ia , 1989; Cr ist iano and Roth, 1995). The greatest limitation to all nonviral mediated gene transfer is the low eff iciency of induced gene express ion in vivo. Viral mediated sys tems have proven to be much more efficient at del iver ing D N A into neurons than the present nonviral sys tems. Viral vectors capi ta l ize on the elegant mechan i sms of cel l entry, nuclear translocation and D N A stabi l ization that v i ruses have acqui red through their evolution. The four primary viral mediated gene transfer sys tems being deve loped for use in the nervous sys tem are adenovi rus, adeno-assoc ia ted virus, lentivirus and herpesvirus vectors. E a c h of these v i ruses have character ist ics that can be an advantage or d isadvantage for use as a vector, such as t issue/cel l t ropism, carry ing capaci ty for insert D N A , longevity of express ion , ep isomal ma in tenance or integration into the host genome, viral protein effects of toxicity or antigenicity, and the amenabi l i ty to m a s s production and quality control (reviewed by Smi th , 1995; Karpat i et a l . , 1996). The development of these viral mediated gene transfer sys tems not only relies upon, but a lso contributes to an increased understanding of v irus-host interact ions. 1.2.2 Promoter control and vector administration into neurons 15 Most research in the field cont inues to be in the a rea of individual vector development ; however, important work appl icable to all vector sys tems is being done on promoter control and vector administrat ion. A n ideal promoter would provide control lable gene express ion and a lso offer cel l -speci f ic activity. Seve ra l neuronal speci f ic promoters have been isolated, including promoters for neurof i lament light cha in (Beaudet , et a l . , 1992), neuron-speci f ic eno lase (Andersen et a l . , 1993), tyrosine hydroxy lase (Banerjee et a l . , 1992), and Ta1 -tubulin (Gloster et a l . , 1994). Unfortunately, very few promoters have been isolated that are speci f ic for a part icular cel l subpopulat ion. O n e example is the dopamine p-hydroxylase promoter which is act ive only in catecholaminerg ic neurons (Kobayash i et a l . , 1992). Another approach to conferr ing neuron speci f ic activity is to employ neuronal-restr ict ive s i lencer e lements ( N R S E ) in conjunction with a strong, constitutive promoter. N R S E e lements have been demonstrated to permit transcriptional activity only in neuronal cel ls (Mori, et a l . , 1992; Li et a l . , 1993). The incorporation of enhancer / s i lencer e lements may a lso be beneficial in broadening the limited spectrum of inducible promoter sys tems which will enab le more tightly regulated gene express ion . T h e relative importance of promoter specif icity is dependent upon the route of administrat ion of the vector. The inaccessibi l i ty of the central nervous sys tem and p resence of the blood-brain barrier pose significant cha l lenges to administer ing optimal concentrat ions of vectors to the desired targets. There are four poss ib le routes of administrat ion; direct stereotaxic-guided injection, retrograde axonal- transport , the subarachno id space/ventr ic le sys tem or v ia intravascular d isseminat ion. Direct s tereotaxic-guided del ivery enab les targeting of speci f ic populat ions of neurons, but neighbour ing gl ia cel ls are still suscept ib le to gene transfer. Th is method is limited in the number of cel ls access ib le to the injected vectors, and even with improved d ispersa l mechan i sms (i.e. latex beads) only smal l regions can be reached. Ret rograde axona l -transport is useful for vector delivery to spinal or brainstem neurons, and may be comb ined with direct injection to del iver vectors to speci f ic pathways (i.e. injection into the anterior striatum results in gene transduction in the substant ia nigra). Vec to r del ivery v ia cerebra l fluid circulation through the subarachnoid s p a c e and ventr ic les has fai led to t ransduce cel ls beyond the ependymal or subependymal l ining. The blood-brain barrier 16 (BBB) is one of the greatest obstac les to systemic intravascular del ivery. Disruption of the B B B with hyperosmolar agents, such as mannitol, s u c c e e d e d in gene transfer only to subendothel ia l astrocytes (Doran et a l . , 1995). Conjugat ing the vectors to molecu les such a s transferrin may aid in their delivery to neurons ac ross the B B B , as sugges ted by inc reased del ivery of nerve growth factor when conjugated to transferrin (Fr iden et a l . , 1993). Sys temic delivery to the central nervous sys tem remains problematic, and a greater understanding of B B B transport and improved targeting mechan i sm are required before it can become a viable route. 1.2.3 "Naked" DNA, liposomes and molecular conjugates A . Naked D N A delivery T h e delivery of naked D N A to neurons is accompl i shed by either direct micro-injection of D N A or part ic le-mediated gene transfer sys tems. Both sys tems are limited mainly to in vitro neuronal studies. Micro-injection is a powerful technique for studying effects of gene express ion at the single cel l level, and is often used in electrophysiological studies. It is n o t , however, appl icable to the study of neuronal populat ions. Part ic le-mediated gene transfer has been used to transfect primary neuron cultures (Jiao et a l . , 1993) and brain sl ice cultures (Lo et a l . , 1994). D N A molecu les are quantitatively coated onto gold particles (1-3 mm in size) in a precipitated, chemica l ly dry form, and then accelerated at high velocity toward target cel ls or t issue. T h e most c o m m o n mechan ism for accelerat ing the particles is a hel ium pulse gun (Lo et a l . , 1994; Y a n g and W e n n , 1995), but a gun powder blast (Klein et a l . , 1987) and a high vol tage d ischarge (Yang et a l . , 1990) have a lso been used as pressure sources . T o successfu l ly t ransduce its target, the gold particles must penetrate into the nuc leus , or the D N A must d isassoc ia te from the particle and enter the nucleus v ia pass ive transport. T i ssue damage is a concern with this sys tem and is minimized by use of a nylon m e s h to baffle against the hel ium shock wave and by cool ing the t issue prior to bombardment . Par t ic le-mediated gene transfer has limited potential for gene del ivery into neurons, but this technique has become popular for in vivo vacc ine and cytokine D N A del ivery into musc le t issue for the purpose of immunizat ion (Nabel et a l . , 1994). 17 B. L iposomes L iposomes offer greatly increased transfection eff iciency rates over naked D N A del ivery, but are still less efficient than viral mediated sys tems. They do, however , have severa l advantages over viral mediated sys tems; they are biological ly inert, non immunogen ic and have the ability to del iver multiple large f ragments of D N A . In l iposome-mediated gene transfer, posit ively charged lipids interact with the negat ively charged phosphate groups on D N A , resulting in DNA/ l ip id comp lexes . The mechan i sm of uptake of these complexes is unknown; it may occur by endocytos is or by pass ive fusion with the cel l membrane. The properties of these comp lexes can be modif ied through the cho ice of speci f ic cationic or anionic lipid and the inclusion of neutral co- l ip ids such a s d io leoylphosphat idy lethanolamine ( D O P E ) to max im ize membrane fusion and re lease of the D N A into the transfected cel l . In vitro, t ransfect ion eff iciency is optimal when there is a net posit ive charge on the DNA/ l ip id comp lex which may be due to the cat ionic l iposome's high D N A encapsulat ion eff iciency (Behr et a l . , 1989; C r e s p o et a l . , 1996). Other important parameters are the ratio of cat ionic lipid to D O P E , the ratio of lipid to D N A and the total amount D N A per transfect ion. Ce l l type and cel l cyc le stage are a lso a factor in transfection eff iciency. In vivo l iposome transfect ion eff ic iencies are dramatical ly lower than those seen in in vitro s tudies. Th is may in part be due to c learance of l iposomes by the reticuloendothelial sys tem, but is thought to be mainly due to instability of the DNA/ l ip id complexes , and their inactivation by se rum proteins. The most commonly used l iposome formulations include Lipofect in, L ipofectamine, Cel l fect in, DC-Cho les te ro l , D M R I E - D O P E , and a novel cytofect in, G S 2888 . Of the former five l iposome formulations tested for gene del ivery in an in vivo sys tem (subcutaneous human tumour xenografts in S C I D mice), DC-Cho les te ro l was found to have the highest transfection efficiency. Unfortunately, even under opt imized condi t ions the eff iciency was only 0 .3% (Egi lmez et al . , 1996). Transfect ion eff ic iencies are a lso known to be reduced in the presence of se rum. However , G S 2888 cytofect in, a 18 2:1 formulation of D O P E and the cationic lipid G S 2 8 8 8 , transfection eff ic iency was shown by Lewis and coworkers to be virtually unaffected by the p resence of se rum (Lewis et a l . , 1996). Progress has a lso been made in stabi l izing the DNA/ l ip id comp lexes . Hof land et a l . found that by complex ing the cat ionic lipids with D N A in the p resence of detergent micel le, they were able to coat the D N A / lipid comp lex with addit ional lipid (Hofland et a l . , 1996). The resulting comp lexes were found to have an longer shelf-l ife ( improved from 24 hr to 90 d at 4°C) and improved res is tance to serum inactivation (30% activity in 1 5 % fetal calf serum compared to 0% activity of traditional comp lexes in 2 % serum). It remains to be seen if G S 2888 cytofectin and/or the more stable DNA/ l ip id comp lexes will translate into more success fu l in vivo t ransfect ion ef f ic iencies. T o date, systemic or intravascular delivery of l iposomes to the central nervous sys tem has not been success fu l . Intravascular infusion of DNA/ l ip id comp lexes success fu l l y targeted to lung, liver, musc le and tumour have been reported v ia incorporation of cel l specif ic l igands into the l iposome (Zhu et a l . , 1993). Unfortunately, traditional l iposome formulations cannot c ross the B B B , and administrat ion of l iposomes to the nervous sys tem has been limited to direct injection. S a h e n k and coworkers reported low transfection eff iciencies of spinal motor neurons fol lowing DNA/ l ipofect in complex injection into the sciat ic nerve (Sahenk et a l . , 1993). O n o and coworkers a lso reported low transfection eff iciency of neurons fol lowing direct intracerebral injection in which express ion was only apparent for up to 3 weeks (Ono et a l . , 1990). Current ly, l iposomes have few appl icat ions for gene transfer into neurons. Future prospects are dependent upon the development of neuronal targeting mechan i sms capab le of c ross ing the B B B , and improved gene express ion through the incorporation of viral nuc lear t ranslocat ion s igna ls , and integration or ep isomal main tenance s e q u e n c e s on del ivered D N A . C . Mo lecu la r conjugates Another means of nonviral gene transfer is v ia molecular conjugates which cons is t of a l igand for receptor-mediated endocytos is , a D N A binding agent s u c h as 19 poly-L- lys ine (PLL) , and a p lasmid for gene express ion . G e n e express ion fol lowing receptor-mediated endocytos is is dependent upon endosoma l re lease and pass ive nuc lear uptake of the prote in/DNA complexes (Beltinger, C et a l , 1995). E n d o s o m a l lysis agents such as chloroquine (Cotten, M et a l , 1990), repl icat ion-defect ive adenov i rus (Curiel et a l . , 1991), and pept ides based on the membrane lysis portion of the inf luenza virus hemagglut inin H A 2 (Wagner, E et a l . 1992; Rata lsk i et a l , 1991) have been coup led to the molecular conjugates to dec rease their endosoma l degradat ion and increase their endosoma l re lease. The replication defect ive adenov i rus thus far has proven to be the most effective agent (Crist iano, R et a l . 1993). Unfortunately, the inclusion of the virus in the conjugate has a lso increased nonspeci f ic uptake and toxicity (Crist iano, R et a l . 1993; Wagner , E et al . 1992). The main advantage of this sys tem is the ability to target speci f ic cel l types using l igands whose receptors are exp ressed exclusively in the target populat ion of ce l ls . T h e best example to date is the use of the glycoprotein, as ia loorosomuco id ( A S O R ) to target liver parenchymal cel ls , which almost exclusively express receptors to A S O R (Wu and W u , 1988). There are no publ ished f indings to date which explore the potential of this sys tem for gene transfer into neurons. Sys temic delivery would, of course , be limited by the B B B . ) . The development of an efficient, nontoxic and universal endosoma l agent and the incorporation of nuclear translocat ion s ignals are crucial to the future s u c c e s s of this sys tem. 1.2.4 Adenovirus, adeno-associated virus and lentivirus vectors A . Adenov i ra l vectors Adenov i ruses are large (70 -90 nm), nonenve loped v i ruses contain ing a wel l character ized 36 kb d s D N A genome. Despite their natural t ropism for respiratory tract epi thel ium, adenov i ruses can infect a broad range of cel l and t issue types, including nondividing cel ls (Le G a l L a Sa l le et a l . , 1993; Trapnel l and Gorz ig ia , 1994). S tab le recombinant adenov i ruses can be reliably produced at high titers ( 1 0 1 0 - 1 0 1 1 infectious 2 0 units/ml), which enab les high eff iciency gene transfer. The construct ion of recombinant adenov i ruses involves dividing the viral genome into two p lasmids constructs, inserting the foreign D N A into one of the p lasmids and cotransfect ing both p lasmids into cultured cel ls (Graham and Smi ley , 1977; G r a h a m , 1984). The original adenov i rus recombinant v i ruses could accommodate up to 8 kb of foreign D N A ; however, the development of packag ing constructs and cel l l ines is rapidly increasing the vector 's D N A carry ing capac i ty . Recombinan t adenovi rus vectors are rendered replication defect ive by delet ion of the transactivat ing genes E 1 a and E1b . Propagat ion of these recombinant v i ruses requires the 293 cel l l ine, a human embryonic kidney cell line which stably exp ress E1 genes in trans (Graham and Smi ley, 1977; G r a h a m , F.L., 1984). In the first generat ion of recombinant adenov i ruses, the gene of interest was inserted into the E1 region of the g e n o m e and often the E 3 region was deleted to enable the genome to accommoda te more foreign D N A . Products of the E 3 region are nonessent ia l for virus growth, but they are important in modulat ing the host immune response and function by blocking c lass 1 M H C presentat ion of viral ant igens (Gooding, L.R. et a l . , 1990). W h e n used in vivo , these first generat ion recombinant v i ruses were found to elicit a C D 8 + cytotoxic T cel l (CTL) response that el iminates virus-infected cel ls within 28 d of infection. In addit ion, the development of neutral izing ant ibodies to the primary infection severe ly limits infection eff ic iencies upon subsequent administrat ion ( Y a n g et a l . 1994,1995, Trapnel l and Gorz ig l ia , 1994). The inflammatory response to these recombinant adenov i ruses is bel ieved to be due in part to the absence of the E 3 region, and more importantly, to low levels of viral protein express ion and viral replication, resulting from E1 independent promoter activity or contaminat ion with E1 express ing virus (Yang et a l . . 1994,1995). A s e c o n d generat ion of adenovi rus recombinant v i ruses is under deve lopment . The goal is to generate recombinant v i ruses with addit ional defects in other essent ia l genes to further reduce replication capabi l i t ies. The first approach taken w a s to incorporate a temperature-sensi t ive mutation in the E 2 a region, which encodes a s s D N A binding protein essent ia l for viral replication. In vivo s tudies with this s e c o n d generat ion recombinant resulted in dec reased immune response and pro longed gene express ion ; 21 however , residual viral gene express ion was detected (Yang et a l . , 1994b). T h e subopt imal per formance of this recombinant was attributed to leak iness of the ts mutation at 37°C. T h e development of a 293 -E4 express ing cel l line by W a n g et a l . in 1995 enab led the creat ion of an adenovi rus recombinant with delet ions in both the E1 and E 4 regions (Wang et a l . , 1995; W a n g and Finer, 1996). The E 4 region contains 7 open reading f rames ( O R F s ) , of which only O R F 6 and O R F 3 are essent ia l for viral repl ication. Prote ins encoded by this region are a lso responsib le for the transport of viral transcripts from the nuc leus to the cytoplasm, and for the shutoff of host protein synthes is . Prel iminary results of A E 1 / A E 4 recombinant adenovi rus injection into immunocompetent mice suggest prolonged express ion the p-galactosidase gene for up to 6 months, and a signif icant reduction in the host cel lular immune response (unpubl ished results reported in W a n g and Finer, 1996). The development of this second generat ion adenov i rus vector holds great promise for adenovirus mediated gene transfer. The technology, however , is still hampered by the potential for homologous recombinat ion between the deleted virus and the complement ing cel l line creating an act ive viral genome . Resea rche rs in this field are currently trying to generate a complementary cel l line that does not contain over lapping sequences with the A E 1 / A E 4 recombinant adenov i rus . S tud ies are a lso underway to develop a new type of recombinant adenov i rus which is deleted in all viral open reading f rames, and contains only the long terminal repeats , the 5' packaging sequences and the foreign D N A of interest F isher et a l . (1996) constructed a min imized recombinant, ca l led A rAd . S i nce a packag ing cel l line that exp resses all essent ia l viral genes in trans is not avai lable, propagat ion of A rAd requires coinfect ion with a helper adenovi rus. Viral particles containing the A r A d genome , which sediment at a lower density than the helper adenov i rus, are isolated by us ing a ces ium gradient. Unfortunately, molecular analys is of the low densi ty viral bands revealed multiple rearrangements of the ArAd genome, formation of conca tamers , and recombinat ion with helper virus D N A . Helper virus genomes with large delet ions were a lso found to comigrate with A rAd-based genomes (Fisher et a l . , 1996). The s u c c e s s of this gene transfer sys tem is dependent upon improved methods of 22 purification and increased production eff iciency of the desi red form of A r A d . T h e effect of the A rAd genomic rearrangements on express ion of the del ivered gene has not yet been invest igated, and may differ with each construct. The present unpredictabil i ty of the del ivered genet ic material is this sys tems greatest limitation. O n e of the main obstac les to initiating adenoviral vector cl inical trials for treatment of human neurological d i seases is the potential of activating a destruct ive immune response . First-generat ion vectors stimulate a strong local inf lammatory react ion when inoculated directly into the striatum of the brain, and also st imulate a weaker immune response at distant regions synaptical ly l inked to the site of injection (Byrnes et a l . , 1995). The early inf lammatory reaction phase of the immune response occurs independent of viral or insert gene express ion , whereas the later T-cel l media ted phase is be l ieved to be directed against adenoviral proteins (Wood et a l . , 1996). T h e immune response to second generat ion and fully deleted adenovi rus recombinant v i ruses has not yet been fully explored. Inactivation of f irst-generation vectors with U V light, sugges ts that complete shut down of viral protein express ion avo ids the T-cel l mediated response to the vector and minimal reactivation of inf lammation at the original site of inoculat ion fol lowing a peripheral reinoculation (Byrnes et a l . , 1996). T h e product ion of neutral iz ing ant ibodies against U V inactivated virus and second-genera t ion vectors still occurs . Further investigations of immunogenici ty and strategies for immunotherapy to control the early inf lammatory response are underway. B. Adeno-assoc ia ted viral vectors A A V is a very smal l (20-25 nm), nonpathogenic human parvovirus containing a l inear s s D N A genome of 4680 nucleot ides. Its smal l s ize may be responsib le for its stability, but limits its D N A carrying capacity to 4.5 kb. Wild-type A A V contains just two genes ; rep, which encodes four nonstructural proteins involved in viral repl ication and integration, and cap , which encodes the three viral structural proteins (Sr ivastava et a l . , 1983). T h e s e v i ruses are dependent upon helper virus co- infect ion, with either an adenov i rus or herpesvi rus, for their own replication and packag ing . Adeno -assoc ia ted virus (AAV) mediated gene transfer has many similarit ies to the min imized recombinant 2 3 adenovi rus, in that A A V recombinant v i ruses (rAAV) are deleted of all viral genes and retain only terminal repeats and packag ing sequences ; however, the g e n o m e s of these recombinant v i ruses are much more stable than the ArAd genomes . Recombinant A A V has many attractive qualit ies for therapeutic gene transfer. A A V has a broad host range and can infect both replicating and nonrepl icat ing ce l ls . r A A V have been shown to infect and express exogenous genes in neurons (Kaplitt et a l . , 1994), and in photoreceptors (AN et a l . , 1996). Wild-type A A V integrates into the host genome in a si te-specif ic manner into ch romosome 19 between q13.3 and qter, and therefore, offers the possibil i ty of long-term gene express ion . There have been no identified c o n s e q u e n c e s to host cel l function due to this site speci f ic integration. The r A A V retains the ability to integrate, but the site-specif icity is lost in the a b s e n c e of the rep protein; consequent ly , there is a potential for cel lular gene disruption by r A A V integration (Linden et a l . , 1996). The virus is nonpathogenic, and does not tr igger a strong immune response. In addit ion, rAAV retain the viral propert ies of efficient cel l entry and translocat ion to the nuc leus, yet does not express any viral proteins. Propagat ion of r A A V is cumbersome, requiring the p resence of the r A A V genome, p lasmids express ing rep and cap proteins and helper adenovi rus. The recombinant v i ruses are harvested from cel l lysates, and must be purified from cel lular contaminants and helper adenovi rus. Ear ly purification techniques resulted in r A A V s tocks that were frequently contaminated with helper adenovi rus. Unfortunately, extens ive purif ication of the s tocks resulted in poor recovery of functional rAAV, related to both poor t ransduct ion eff iciency and poor titer recovery. Recent work, from the laboratory of J . M . Wi l son , demonst ra ted that the E1 and E 4 adenovi rus proteins dramatical ly enhance gene express ion from r A A V vectors (Fisher, et a l . , 1996; We i tzman et a l . , 1996). A variety of agents known to inf luence cel l D N A synthesis or D N A repair pathways were a lso found to increase r A A V transduction (Alexander, I.E. et a l . , 1994). A more efficient m e a n s of propagat ing r A A V and an innovative approach for enhanc ing gene transduct ion are necessa ry for the A A V mediated gene transfer sys tem to meet its full potential as a gene therapy vector. The use of this vector sys tem will likely cont inue to be limited by its max imum of 4.5 kb D N A carrying capaci ty 24 C . Lentiviral vectors Lentiviral vectors are the newest gene transfer sys tem appl icable for use in neurons. It is a sys tem based on the human immunodef ic iency virus (HIV), wh ich, unlike the traditional retrovirus sys tem based on the murine leukemia virus, is ab le to integrate into the genome of nonproliferating cel ls. Naldini and coworkers generated these novel vectors by cotransfect ing 293T human kidney cel ls with three p lasmids: a packag ing construct express ing all required viral proteins, but lacking the c is-act ing s e q u e n c e s crucial for packag ing, reverse transcription, and integration; a construct express ing the enve lope protein (G glycoprotein) of the ves icu lar stomatitis virus ( V S V - G ) ; and a vector construct, which contains all c is-act ing sequences , a truncated gag gene, an env gene and a p-galactos idase gene (Naldini et a l . , 1996a). The env gene was deleted in later constructs, and the resulting vector maintained both production and transduct ion eff ic iencies (Naldini et a l . , 1996b). V S V is a neurotropic rhabdovirus, and the incorporat ion of V S V - G into the enve lope of the packaged HIV-based vector enab les efficient infection of neurons. V S V - G a lso increases stability of the particle and enab les its isolation and concentrat ion by ultracentrifugation. S tocks were concentrated from approximately 5 x 1 0 5 t ransducing units /ml to 2-4 x 1 0 8 , enabl ing high titer in vivo studies (Naldini et a l . , 1996b). The V S V - G pseudotyped HIV vectors were found to infect and t ransduce both neurons and gl ia cel ls fol lowing injections into the corpus striatum and h ippocampus of adult rat brain (Naldini et a l . , 1996a,b). Transduct ion eff ic iencies were enhanced 2-fold by incubating vector s tocks with d N T P s , polyspermine and spermine prior to injection which st imulates reverse transcription within the virion (Naldini et a l . , 1996b; Z h a n g et a l . , 1995 & 1996). (3-galactosidase express ion from these lentiviral vectors was still present 3 months after injection, and no assoc ia ted cytopathology or ev idence of immune response was detected. Integration into the genome w a s found to be essent ia l for t ransduct ion (Naldini et a l . , 1996b). The integration property of these vectors is benef ic ial in that it offers the potential of long-term gene express ion , but may be 2 5 detr imental in that integration may disrupt an essent ia l gene or c a u s e mal ignant t ransformat ion. Th is gene transfer sys tem requires further development in the a reas of biosafety and product ion eff iciency. There is a potential for generat ing active HIV or vectors express ing HIV proteins v ia recombinat ion between the vector and packag ing construct. However , the des ign of the packaging construct is such that multiple recombinat ions would be required to produce active virus, and the absence of the env gene prevents generat ion of wildtype HIV. Naldini et a l . detected no repl icat ion-competent viral part icles in serial ly p a s s a g e d t ransduced cel ls . T ransduced cel ls tested negat ive for the express ion of the viral proteins, tat and gag , suggest ing that recombinat ion of packag ing s e q u e n c e s into the packag ing construct did not occur (Naldini et a l . , 1996a). Product ion eff iciency is h indered by the cotransfect ion-based sys tem. Stab le HIV packag ing cel l l ines have been generated (Carrol et a l . , 1994; P o e s c h l a et a l . , 1996); unfortunately, the generat ion of a packag ing cel l line for V S V - G pseudotyped HIV vectors is difficult b e c a u s e V S V - G induces cell lysis. However , Danei l et a l . have deve loped a re t rov i rus /VSV G packag ing cel l line by placing the V S V G encod ing gene under an inducible, tetracycl ine-regulated promoter in gag-pol express ing 293 ce l ls , demonstrat ing the generat ion of a H I V / V S V G packaging cel l line is poss ib le (Daniel et a l . , 1996). Th is gene transfer sys tem is well underway to overcoming many of its technical difficulties, and most future work in this field will be focused on obtaining long-term gene transduct ion of the gene or genes of interest. 1.3 HERPES SIMPLEX VIRUS TYPE 1 VECTORS Herpes s implex virus type 1 (HSV-1) has a number of biological features that make it an attractive vector for gene transfer into neurons. It is a neurotropic virus, capab le of infecting most types of neurons efficiently. It es tab l ishes life-long latency in neurons, a state in which the viral genome remains as an ep isomal e lement in the nuc leus and the metabol ic functioning of the host cel l is apparent ly undisturbed. In addit ion, it a lso has a large t ransgene capaci ty. There are currently two different types of 2 6 H S V - 1 - b a s e d gene transfer sys tems under development; recombinant genomic vectors, which have delet ions in viral genes assoc ia ted with viral replication and cytotoxicity, and H S V - 1 ampl icon vectors, which are HSV-1 packaged p lasmids contain ing an H S V - 1 origin of replication and packag ing sequence . 1.3.1 Structure, life cycle and clinical pathology of herpes simplex virus type 1 A . Structure of herpes s implex virus type 1 H S V - 1 belongs to the family Herpesvi r idae , the subfamily alphaherpesvirinae, and the genera simplexvirus. It is a large, highly complex enve loped virus with a m a s s of 1450 M D a and a diameter of 120-300 nm (Hay et a l . , 1987; R o i z m a n and Fur long, 1974). The virion has four structural components : (a) a core containing the genome, (b) an icosahedra l caps id encas ing the core, (c) a tegument surrounding the caps id , and (d) an outer enve lope . (a) T h e genome A tightly, paral lel packed genome forms the core of the vir ion, which is s e e n under electron microscopy as a 30-75 nm dense spher ical mass (Booy et a l . , 1991). The genome within the virion exists as a linear double-st randed D N A , approx imate ly 152 kb in length and is G / C rich (68%) (Ro izman, 1993). It consis ts of two segments containing unique sequences ; a long, 126 kb (U[_) and a short, 2 kb (Us) segment . T h e s e segments can be covalent ly joined in either orientation. U|_ and Us are both f lanked by inverted repeats which contain the viral packag ing s ignals , des ignated a-b and a-c which are 9 kb and 6.5 kb, respectively (Ro izman, 1996). The genome has three origins of repl ication, one in each c repeat and two in Ui_. The genome contains 83 known O R F s , 38 of which are essent ia l for growth in culture and 45 of which are d ispensab le (Ro i zman , 1996). (b) T h e caps id 2 7 Electron microscopy studies revealed that that the HSV-1 icosahedra l caps id is about 100 nm in diameter, and is c o m p o s e d of 162 capsomers . In the longitudinal sect ions there are 150 hexamer ic capsomers (9.5 X 12.5 nm) and at the vert ices there are 12 pentamer ic capsomers of unknown d imens ions (Ro izman , 1993). (c) The Tegument T h e tegument, a termed co ined by Ro izman and Fur long, is the protein containing s p a c e between the caps id and the envelope, which appears to be f ibrous in negat ively s ta ined samp les (Ro izman and Fur long, 1974; Morgan et a l . 1968). The th ickness of the tegument is var iable and frequently distributed asymmetr ical ly (Ro izman , 1993). The tegument conta ins severa l important regulatory proteins, including the transact ivator V P 1 6 and the viral host shut off protein, V H S which function to create a conduc ive environment for initiation of viral replication (Naume et a l . , 1992). T race amounts of other viral regulatory proteins, such as ICP4 , have been detected in the tegument, but the activity of these proteins following infection has not been demonstrated. (d) The Enve lope T h e enve lope of the virion is acquired as the mature caps id buds from the nuc leus into the cy top lasm; and therefore, is der ived from the inner nuc lear membrane of the host cel l . The enve lope is primarily composed of l ipids, and has the typical tr i laminar appearance of cel lular membranes (Asher et a l . , 1969; Eps te in , 1962). The enve lope supports numerous glycoproteins, which are seen as 8-24 nm long sp ikes with electron microscopy (Stannard et a l . , 1987). There are 11 known H S V - 1 glycoproteins, and the relative concentrat ion of each glycoprotein var ies greatly between viral part ic les. T h e s e glycoproteins modulate viral entry and egress , but only g B , gD , g H and gL are essent ia l for viral infection in culture (Ro izman, 1996). The prec ise mechan i sms by which glycoproteins determine host range and interact with the immune sys tem are still unknown . B. L i fecycle of herpes s implex virus type 1 28 In culture, HSV-1 is general ly highly cytopathic, has a relatively short replicative cyc le (<24 hr), and spreads rapidly (Ro izman, 1993). HSV-1 lytic infection in culture cel ls results in efficient, rapid synthesis and disseminat ion of viral progeny at the expense of the host cel l . The lytic life cyc le of HSV-1 has been extensively studied in cultured cel ls and can be broken down into three s tages: viral entry, viral replication and viral eg ress . Viral entry cons is ts of viral attachment fol lowed by viral penetrat ion, viral genome uncoat ing, and nuclear translocat ion. Viral attachment is mediated by assoc ia t ion of H S V - 1 glycoproteins with heparan sulfate proteoglycan structures located on the cel l sur face. Th is enab les stable interaction of viral glycoproteins with cel lular receptors (WuDunn and Spear , 1989; Gruenhe id et a l . , 1993). The enve lope then fuses with the cel l membrane to re lease the caps id into the cytop lasm. The hypothesis that viral penetrat ion is mediated by membrane fusion rather than phagocytos is is suppor ted by the p resence of virion envelope receptors on the cel l sur face immediately fol lowing viral infection and by the observat ion that endocytosed vir ions are rendered noninfect ious (Johnson et a l . , 1988; P a r a et a l . , 1982; Campade l l i -F iume et a l . , 1988). Dur ing penetrat ion the tegument proteins are re leased into the cy top lasm. The cel lular cytoskeleton probably mediates the transport of HSV-1 caps ids to nuc lear pores, and at this t ime, uncoat ing of caps id from the viral genome occurs by s o m e unknown mechan i sm (Dales and Chardonnet , 1977; Kr is tensson et a l . , 1986). T h e uncoated, l inear D N A genome is re leased into the nucleus through nuclear pores (Batterson et a l . , 1983; Tognon et a l . , 1981). Viral proteins, present in the tegument of the virion and del ivered into the host cel l upon infection, function to create a favorable environment for viral gene express ion and replication. A viral tegument protein, ca l led the virion host shutoff protein or vhs is act ive early in infection, prior to viral gene express ion, vhs mediates the shutoff of host protein synthes is and the degradat ion of host m R N A s to create an environment in which viral transcripts can monopol ize host cel l machinery (Kwong and Frenke l , 1989; R e a d and Frenke l , 1993). Viral protein synthesis begins concomitant ly with the shutoff of host protein synthes is . Viral gene express ion is induced by another tegument protein ca l led 2 9 V P 1 6 . V P 1 6 interacts with cel lular R N A polymerase II and accesso ry cel lular factors, such as Oct-1 to initiate viral gene transcription (reviewed in Spec to r et a l . , 1993). Ce l lu lar factors, such as Oct-2 present in sensory neurons, can a lso suppress viral gene express ion and replication by blocking the transactivating activity of V P 1 6 (Lil lycrop et a l . , 1991&1994) . Under favorable host cell condit ions, V P 1 6 forms a complex with the cel lular factors and binds to the T A A T G A R A T T C motifs present in all of the first kinetic c l ass of viral genes cal led the a genes (Preston, 1988). Viral gene express ion p roceeds in a very tightly regulated c a s c a d e of events. The program of express ion involves the sequent ia l turning on of three kinetic c l asses of genes : a genes (encoding immediate-early proteins), (3 genes (encoding early proteins) and y genes (encoding late proteins). There are six immediate-early (IE) proteins encoded .by a genes : ICP4 , ICPO, I C P 2 7 , I C P 2 2 , Us1 .5 and I C P 4 7 (Table 1-3). ICP4 is the major regulatory protein which is largely responsib le for the transition from a to p gene express ion , and is essent ia l for viral replication. It participates in the formation of DNA-prote in comp lexes at var ious regulatory sites of p and y genes to sequential ly activate these genes , and it represses its own express ion and the express ion of other a genes by directly binding its high affinity sequence , 5 ' - A T C G T C - 3 ' (Faber and Wi lcox, 1986; Kat tar -Cooley and Wi lcox, 1989; A thanas ios et a l . , 1991). ICPO is not an essent ia l gene; however , it e levates the levels of viral gene express ion , enabl ing high titer stock product ion (Everette, 1984; C a i and Schaffer, 1992). ICPO has been found to e levate both H S V and n o n - H S V promoter activity ( O 'Hare and Hayward , 1985; Nabe l et a l . , 1988). I C P 2 7 regulates viral and cel lular m R N A process ing events (Sandr i -Gold in et a l . , 1995), modulates ICP4 and ICPO activity (Rice and Knipe, 1988), and is required for efficient viral D N A replication (Uprichard and Knipe, 1996). ICP22 enhances ICPO and late gene express ion in a very cell-type speci f ic manner, and is not essent ia l for growth in most cel l types (Sears et a l . , 1985; Purves , et a l . , 1993). ICP22 has a lso been shown to be required for viral modif ication of host R N A po lymerase 11 and efficient viral transcript ion (Rice et a l . , 1995). Us1 .5 is a truncated version of ICP22 that co loca l izes with ICP22 and is be l ieved to share in its function (Carter and Ro i zman , 1996). The only known role of I C P 4 7 is in blocking antigen presentation to C D 8 + cel ls (York et a l . , 1994). The synthes is of IE proteins reaches peak rates at approximately 2-4 hr post- infect ion, but 3 0 Table 1-3. Kinetic classes of herpes simplex genes and their functions Designations Gene Proteins Function of gene product Immediate-early (IE, alpha) aO *a27 *a4 Us^.5 a22 a47 ICPO ICP27 ICP4 US1.5 ICP22 ICP47 Promiscuous transactivatior, requires ICP4 for optimal activity, null mutants debilitated at low multiplicty of infection Regulatory protein required for late gene expression and negatively regulates early genes, causes redistribution of snRNPs, inhibits RNA splicing Sequence specific DNA binding regulates most b and g gene positively, and itself, aO and ORF P negatively Regulatory protein, may share function with ICP22 Regulatory protein required for optimal expression of ICPO and a subset of g proteins Binds to TAP1/TAP2 and blocks antigen presentation Early (E, beta) UL2 *UL5 *UL8 L//.12 *UL28 *UL29 *UL30 UL39 L//.40 *UL42 t7/_50 *UL52 U& ICP36 ICP8 ICP6 Uracil DNA glycosylase Forms complex with U|_8 and UL.52 proteins Component of helicase/primase complex Exonuclease Thymidine (nucleoside) kinase Binds to ssDNA cooperatively, required for viral DNA replication DNA polymerase, forms complex with ICP8 and UL42 Large subunit of ribonucleotide reductase Small subunit of ribonucleotice reductase dsDNA binding protein, aids DNA polymerase activity dUTPase Component of helicase/primase complex Protein kinase Late (L, gamma) (7/.41 *UL_48 VHS VP16 ICP25 aTlF gB.gC, ...etc. ICP5 VP23 ...etc. Causes nonspecific degradation of mRNA, shuts off host protein synthesis Tegument protein, induces a genes glycoproteins, 10 known, possibly 11 (gJ?) L//.18 + other structural proteins, tegument proteins packaging proteins, etc. Other LATU LATs transcripts found in latently infected neurons, function unknown * viral proteins required for growth in cell culture 31 cont inues to accumulate throughout infection and R o i z m a n , 1974). Fol lowing a gene express ion, but prior to viral replication is the express ion of the more complex populat ion of p genes . Most of these products are involved in priming the cel l for viral D N A replication ( Table 1-3). Examp les of proteins e n c o d e d by p genes include a viral D N A po lymerase, an exonuc lease , a r ibonucleotide reductase and thymidine k inase (tk). Viral tk is of particular importance, not so much for its role in enabl ing viral D N A replication in nondividing cel ls by phosphorylat ing a variety of nuc leos ide ana logues , but because it is the target for antiviral drugs and provides a se lec tab le marker for genetic recombinat ion (Klemperer et a l . , 1967; Darby et a l . , 1981). The p genes reach peak synthesis at about 5-7 hr post-infection (Honess and R o i z m a n , 1974) . T h e express ion of y genes , which mainly encode viral structural componen ts , is dependent upon initiation of viral D N A replication, in addit ion to a and p gene express ion (Wagner, 1983). Viral replication occurs v ia a rolling circle mechan i sm producing head to tail concatemers of the 152 kb genomes (reviewed in R o i z m a n and S e a r s , 1996). Viral replication is detectable at 3 hr post-infection and cont inues for at least another 9-12 hr within a central compartment inside the host nuc leus (de Bruyn K o p s and Kn ipe , 1988). Th is a rea is distinct from the compartment contain ing proteins involved in assembl ing immature caps ids , where the genome conca temers are subsequent ly c leaved and packaged to form mature caps ids (Ward et a l . , 1996). Mature viral caps ids appear in the nucleus within 6 hr post- infect ion. T h e s e caps ids attach to patches on the inner nuclear membrane containing viral proteins, and bud through these regions, to acquire their envelope. The enve loped viral part icles move through the endop lasmic reticulum and Golg i where the o l igosacchar ide cha ins of the numerous glycoproteins are modif ied. Mature vir ions are then transported to the p l asma membrane in ves ic les to be re leased by exocytos is . The H S V exocytot ic pathway appears to be regulated by both cel lular and viral proteins whose roles vary accord ing to cel l type (Avitabile et a l . , 1995). 32 In v ivo, HSV-1 infection is initiated in epithelial cel ls of skin or mucous membrane, sp reads to the nerve terminal of sensory neurons, and travels retrogradely in the axon to the cel l body where it pursues one of two pathways: it either enters the lytic and p roduces viral progeny, or establ ishes latency as a circular ep isomal e lement within the nuc leus of the sensory gangl ion neuron (reviewed by Pere i ra , 1996). La tency is def ined as the absence of infectious particles in t issues or cel ls that harbor the virus. In the latent state, the viral genome is assoc ia ted with histones, primarily H 1 , and its D N A is structurally al tered. In this form there is no express ion of any of the immediate-ear ly, early or late viral genes (reviewed in Ro i zman and S e a r s , 1996). The latent genome does , however, have the ability to reactivate viral express ion in response to environmental cues such as axotomy, U V light, hyperthermia, and nerve growth factor deprivation (Perna et a l , 1987; Sawtel l & Thompson , 1992; Tense r et a l . , 1988; Wi lcox & J o h n s o n , 1987). The mechan ism by which express ion from a latent viral genome is induced is unknown. Immune response agents, particularly interferons (De S tas io and Taylor , 1990) and neuronal speci f ic cel l factors (Margol is et a l . , 1992) are thought to be the major p layers in establ ishment, maintenance and reactivation of latent viral g e n o m e s . T h e only gene expressed from a latent H S V genome is the L A T gene . Two la tency-assoc iated transcripts (LATs) , a 2 and a 1.5 kb R N A , accumula te in the nucleus of latently infected neurons. Stud ies deleting the L A T region show that L A T transcripts are not necessa ry for establ ishing latency, but are required for efficient reactivation from latency (Leib et a l . , 1989; Hill et a l . , 1990). The L A T transcripts map to repeat regions f lanking the unique long (U|_) component of the genome (Stevens et a l . , 1987). T h e s e R N A s appear to be highly stable introns shar ing the s a m e 5' end . A protein encoded by either one of the transcripts has not been identified (Spivack et a l . , 1991; W a g n e r et a l . , 1987). A n 8.5 kb m R N A from the L A T region has been reported by Dobson et a l . and may be the precursor for the L A T s (Dobson et a l . , 1989). T w o latency-act ive promoters respons ib le for L A T s express ion have been identified and des ignated L A P 1 and L A P 2 . L A P 1 s e q u e n c e s include a T A T A box and a number of upst ream potential binding si tes, including binding si tes which confer higher activity in certain types of neurons (Wechester et a l . , 1988; Dobson et a l . , 1989; Zwaagst ra et a l . , 1990; Batche lor and 3 3 O'Hare , 1992). L A P 2 lacks a consensus T A T A box and is highly G C rich (Goins et a l . , 1994) . L A P 1 is bel ieved to be primarily responsib le for L A T express ion during latency, whi le L A P 2 is primarily responsib le for L A T express ion during lytic infection (Chen et a l . , 1995) . The activity of L A P 1 in latency is bel ieved to be a function of both the promoter 's composi t ion and its posit ion (Lokensgard et a l . , 1994). C . C l in ica l pathology of herpes s implex virus type 1 H S V - 1 infection rates among human beings are high, affecting 7 0 - 9 0 % of the populat ion worldwide (Ro izman, 1993). HSV-1 infections range from minor nu isances to l i fe-threatening d i sease . In immunocompetent individuals, primary H S V - 1 infections are often asymptomat ic , but painful recurrent mucocutaneous les ions are c o m m o n . S e v e r e cl in ical H S V problems such as keratoconjunctivit is, sk in infect ions, encephal i t is and d isseminated d i sease are rare, but have high morbidity and mortality r isks. At present, el imination of the virus from neurons is not poss ib le . However , its mucocu taneous express ion can be control led safely and effectively with acyc l ic guanos ine ana logues , such as Acyc lov i r and Famcic lov i r . The activity of these drugs is dependent upon the presence of viral thymidine k inase (tk), and therefore, are not effective against H S V tk deficient mutants (Pottage and Kess le r , 1995). A therapeut ical ly approved H S V vacc ine is not currently avai lable, but severa l vacc ine cand idates are in, or near cl inical trials. 1.3.2 Recombinant herpes simplex viruses All of the desirable features of HSV-1 for therapeutic gene transfer into the nervous sys tem, namely its neurotropism, large genet ic carrying capaci ty , and ability to establ ish latency are retained in recombinant HSV-1 vectors. Unl ike the H S V - 1 ampl icon vectors, recombinant vectors maintain the majority of the viral genome, and thus maintain the v i ruses ability to ach ieve latency in neurons. Repl icat ion-defect ive H S V - 1 created by the deletion of essent ia l genes have been demonstra ted to retain their ability to establ ish latency in neurons (Fink et a l . , 1996). Therefore, this gene transfer sys tem has the potential of enabl ing long-term express ion of inserted genes 34 from the latent viral genome, without compromis ing the host genome with integration. U V irradiated HSV-1 particles are not toxic to cel ls; and therefore, viral assoc ia ted cel lu lar toxicity is bel ieve to be due mainly to viral gene express ion fol lowing infection (Johnson et a l . , 1992). The two main problems faced by this gene transfer sys tem are the necess i ty to el iminate viral genes assoc ia ted with viral replication and viral assoc ia ted toxicity, and the dominant effects of viral proteins and regulatory mechan i sms on gene express ion from the viral genome. Tradit ional ly, the generat ion of H S V recombinant v i ruses has been more difficult and labour intensive than other recombinant v i ruses due to the v i rus 's large 152 kb genome. In vitro manipulat ion of the HSV-1 genome was not poss ib le , but more recently, in vitro c loning has been done using a cosmid -based sys tem where the entire genome is encoded on a set of four or five cosmids . The traditional method of generat ing recombinant v i ruses is based on homologous recombinat ion be tween infectious viral D N A and a plasmid containing the gene of interest f lanked by the target viral D N A sequences . Viral D N A is cotransfected with p lasmid D N A into cultured cel ls , homologous recombinat ion occurs intracel lu lar^, and the result ing viral progeny are p laqued purified and extensively sc reened for the desi red gene insert. T h e more recent method for generat ing recombinant v i ruses util izes a ser ies of over lapping cosm ids . Th is method w a s originally deve loped by van Zijl et a l . for another oc-herpesvirus, pseudorab ies virus (PRV) (van Zijl et a l . , 1988). E a c h cosmid contains a large H S V - 1 D N A fragment, and together they represent the entire genome. Fore ign genes can be c loned into the HSV-1 sequences of a cosmid in a site speci f ic manner and are invariably present in the resulting viral progeny. The over lapping H S V - 1 D N A inserts are cotransfected into cell cultures, and viral progeny are produced at a very low eff iciency rate v ia recombinat ion between over lapping D N A fragments (Cunn ingham and Dav ison , 1993: Zi tvogel et a l . , 1995). Both procedures suffer from genet ic rearrangements due to transfection and recombinat ion, and it is est imated that as much as 3 0 % of recombinant v i ruses contain addit ional mutations (Ro izman , 1996). However , des i red recombinant v i ruses can be genotypical ly and phenotypical ly charac ter ized , and subsequent ly stably passaged to high titers. 3 5 Recombinant HSV-1 vectors are rendered replication defect ive by delet ion of essent ia l genes . The primary targets for deletion are the a genes which encode the immediate-ear ly proteins responsible for initiating the lytic cyc le of the virus. T h e s e proteins include ICP4 , ICP27 , ICPO, ICP22 (Us1.5), and ICP47 . On ly ICP4 and I C P 2 7 are essent ia l for viral replication in culture, but ICPO and ICP22 have been shown to have toxic effects in transfected cel ls (Johnson et a l . , 1994). Another gene w h o s e el imination may be required to reduce cel lular toxicity is U L 4 1 . U L 41 e n c o d e s the virus host shutoff protein (vhs) which is local ized in the tegument of the infecting virion and acts ear ly in infection to destabi l ize host cell m R N A and monopol ize host protein machinery for the production of viral proteins (Kwong and Frenke l , 1987 &1989) . T h e a gene t ransducing factor or V P 1 6 may a lso be a target for el imination, but its role in promoting gene express ion from the viral genome is not entirely understood (Batterson and R o i z m a n , 1983; Tr iezenberg et a l . , 1988). Consequent ly , el iminating V P 1 6 activity in a gene defect ive recombinant v i ruses may offer few benefits and reduce express ion of the des i red gene insert. Large stretches of nonessent ia l viral genes may be removed to make s p a c e for gene insertion (at least 40 kb); however, the genome s ize and structural composi t ion required for the establ ishment of latency is not yet known. T h e first generat ion of replication-defective HSV-1 recombinant vectors are deficient in the major regulatory protein, ICP4 . De luca and coworkers deve loped severa l ICP4 deficient mutants in 1985, with the most widely uti l ized, des ignated d120 (Deluca et a l . 1985). d120 is der ived from the HSV-1 strain K o s and conta ins a 4.1 kb delet ion in both cc4 genes . The virus is propagated in an ICP4 express ing Ve ro cel l l ine, ca l led E 5 cel ls . In the absence of ICP4 , d120 overexpresses all other a genes , a (3 gene I C P 6 , the r ibonucleotide reductase large subunit., and the L / S T s (OrfP) ( D e L u c a et a l . , 1985; Y e h and Schaffer, 1993). Infection with the d120 replication-deficient mutants c a u s e s ch romosoma l aberrat ions and cel l death contributed mainly to the activit ies of the IE proteins (Johnson et a l . , 1992 & 1994). In recent years efforts have focused on generat ing HSV-1 mutants deficient in other IE proteins. A ser ies of second generat ion HSV-1 recombinant vectors has been deve loped that are deficient in the following IE proteins: ICP4 and I C P 2 7 (d92), ICP4 and I C P 2 2 3 6 (d96), and ICP4 , ICP27 and ICP22 (d95) (Samaniego et a l . , 1995; W u et a l . , 1996). Product ion of theses mutants was made poss ib le by the development of complement ing cel l l ines. The Vero-der ived cell l ines which provide IE proteins in trans are E 5 ( ICP4), E 8 ( ICP27) and E 2 6 ( ICP4 and ICP27) (Deluca et a l . , 1985; S a m a n i e g o et a l . , 1995; W u et a l . , 1996). The mutants d92 and d96 showed toxicity simi lar to that seen fol lowing infection with d120. The mutant deficient in ICP4, ICP27 and ICP22 (d95) w a s less toxic, retaining relatively normal morpholgy, and both viral and cel lular gene exp ress ion . Cul ture cel ls infected with this mutant were, however, inhibited in their cel lu lar D N A replication and cel lular div is ion. Viral proteins still exp ressed by d95 are I C P 6 , ICPO, I C P 4 7 and Or fP . Examinat ion with electron microscopy revealed large circular abnormal i t ies within the nucleus of d95 infected cel ls which were shown to be accumulat ions of ICPO (Wu et a l . , 1996). Marconi et a l . report robust express ion of p-ga lac tos idase (p-gal) driven from the human cytomegalovi rus promoter ( H C M V P ) from within the U L 41 region of a similar ICP4 , ICP27 and ICP22 deleted mutant in both infected cort ical neuron cultures (2 wks) and intracranial inoculat ions (4 wks) (Marconi et a l . , 1996). T h e s e researchers suggested that el imination of the IE proteins may enable promoters to e s c a p e the natural s i lencing mechan isms character ist ic of H S V latency. Prel iminary data on p-gal express ion from a newly deve loped H S V - 1 mutant, deficient in ICP4 , I C P 2 7 and express ing H C M V driven p-gal from an interrupted ICPO locus (d97), indicates a dramatic dec rease in gene express ion from this g e n o m e (N.A. D e L u c a personal communicat ion). Infection with d97 a lso results in cel lular toxicity bel ieved to be assoc ia ted with ICP22 , s ince the ICP22 promoter is the only viral promoter with detectable activity during infection (personal communicat ion with N. Deluca) . ICPO is a promiscuous transactivator which upregulates a variety of viral and cel lu lar promoters, and its absence may result in dec reased express ion from many of the promoters used to drive gene insert express ion. Development of a mutant deficient in ICP4 , ICP27 , ICP22 and ICPO is underway, and this mutant may provide a means of a s s e s s i n g gene transduction from the vector in the absence of cel lular toxicity. The results to date suggest that a greater understanding of the effects of viral proteins and regulatory mechan isms on gene express ion from the viral genome is required before H S V - 1 recombinant v i ruses can be used for therapeutic gene transfer. 3 7 A great deal of work in this field has been and cont inues to be focused on generat ing promoters that are active in a latent HSV-1 genome. Reporter gene express ion from a variety of promoters, including HSV-1 glycoprotein C , H C M V immediate-ear ly , mammal ian neurofi lament, and neuron-speci f ic eno lase promoters, w a s only short-term (less than a week) from first generat ion HSV-1 recombinant v i ruses fol lowing intracranial inoculat ion. Latent HSV-1 genomes were found to persist in neurons after the absence of detectable express ion (Fink et a l . , 1992; Ramakr i shnan et a l . , 1994; Marcon i et a l . , 1996). Efforts are underway to use la tency-assoc ia ted promoter e lements shown to be active during latency, to enable long-term t ransgene express ion . L A P 1 is bel ieved to be primarily responsib le for L A T transcript express ion during latency, but its activity is augmented by the presence of L A P 2 (Chen et a l . , 1995). Relocat ing L A P 1 elements to an ectopic site on the viral genome fai led to result in persistent t ransgene express ion (Margol is et a l . , 1993; Lokensgard et a l . , 1994). L A P 2 is only weakly active when moved to an ectopic site on the genome (Goins et a l . , 1994). A |3-gal gene driven by the mouse Moloney leukemia virus ( M M L V ) long terminal repeat (LTR) promoter inserted directly upstream from the L A P promoter region was exp ressed at low levels for at least 18 months in dorsal root gangl ion neurons (Carpenter and S tevens , 1996). Both the composi t ion and position of the L A P s appear to contribute to transcript ional activity during latency, and it is unclear if this activity can be augmented to enab le therapeut ic gene express ion . Future studies examin ing t ransgene express ion potential from latent HSV-1 IE protein-deficient recombinant v i ruses will determine the s u c c e s s of this gene transfer sys tem for long-term therapies. The majority of investigations involving HSV-1 recombinant vector deve lopment have focused on reporter gene, namely {3-gal, express ion from recombinant backbones . It is a lso important to a s s e s s for appropriate modif ication and function of gene products exp ressed from HSV-1 recombinant vectors. Ear ly investigations of gene express ion from thymidine kinase-def ic ient recombinant v i ruses suggest that gene products exp ressed from a HSV-1 backbone behave differently than their endogenous counterparts (Smibert and Smi ley , 1990). O n c e generated recombinant vectors are capab le of providing high titer stock enabl ing evaluat ion of gene function in entire 38 populat ions of cultured cel ls , including neuronal cel l cultures. A greater understanding of express ion of endogenous neuronal genes from HSV-1 recombinant vectors would provide the groundwork for therapeutic appl icat ion of these vectors, if or when , investigators s u c c e e d at eliminating all cytotoxic viral protein express ion from H S V - 1 repl ication-deficient mutants. 1.3.3 Herpes simplex virus amplicon vectors H S V - 1 ampl icon vectors are a p lasmid-based sys tem in which p lasmids , contain ing a eukaryot ic transcription unit and a HSV-1 origin of replication (ori s) and c leavage /packag ing s ignal , are packaged into HSV-1 vir ions ( Spae te and Frenke l , 1982; Ge l le r and Breakef ie ld, 1988). Th is p lasmid-based sys tem offers the advantage of being easi ly manipulated by standard recombinant D N A techn iques. Theoret ical ly , this sys tem a lso has the advantage of providing gene ampli f icat ion, s ince H S V - 1 packag ing mechan i sms should enable concatamers of the p lasmid, up to 152 kb, to be packaged into HSV-1 caps ids . However , the actual quantity of D N A per ampl icon has not yet been a s s e s s e d . The ampl icon part icles do not encode any further viral s e q u e n c e s . Consequent ly , ampl icon vectors avoid cel lular toxicity i ssues assoc ia ted with viral gene express ion , but unfortunately, they also lose the ability to ach ieve latency in neurons. The structural components and other viral functions required for generat ing an ampl icon particle must be provided by a packaging sys tem. In the first generat ion of HSV-1 ampl icon vectors, the trans -acting viral funct ions required for replication and packag ing of ampl icon p lasmids were provided by a helper virus. The helper virus was usual ly a replication-defective HSV-1 mutant, deficient in either ICP4 or ICP27 (Gel ler and Breakef ie ld, 1988; L im et a l . , 1996; P e c h a n et a l . 1996). Amp l i cons were generated by co-transfect ing ampl icon p lasmid D N A with helper virus D N A into cultured cel ls . The helper virus provided the necessa ry structural components , but helper virus genomes would compete with ampl icon p lasmid D N A for packag ing . The ratio of helper virus to ampl icon vector y ie lded by this method was neither predictable nor reproducible, often leading to lower titers of ampl icon vector than 39 helper virus. Contaminat ing helper virus in ampl icon vector s tocks resulted in the s a m e v i ra l -assoc ia ted cytopathic effects noted in first generat ion HSV-1 recombinant vectors. Recent ly , a helper virus-free method for packag ing ampl icon vectors has been deve loped . In this packaging sys tem, the trans -acting viral functions are provided by a set of H S V - 1 cosmids deleted in their D N A c leavage/packag ing s ignals (Fraefel et a l . , 1996). The HSV-1 cosmid set, generated by Cunn ingham and Dav ison (1993), is c o m p o s e d of f ive overlapping cosmids : cos6 , cos28 , cos14 , cos56 , and c o s 4 8 . E a c h cosm id contains a large HSV-1 D N A fragment, and together, they provide the entire H S V - 1 genome. Fraefel et a l . (1996) introduced delet ions into c o s 6 and c o s 4 8 , removing the D N A c leavage/packag ing s ignals and creat ing the cosmid set, c o s 6 A a , c o s 2 8 , cos14 , cos56 , and c o s 4 8 A a . Th is cosmid set provides all of the HSV-1 protein funct ions, but the HSV-1 sequences are not packaged into vir ions (Fraefel et a l . , 1996). Co-t ransfect ion of this cosmid set and ampl icon p lasmid D N A into cultured cel ls results in pure s tocks of ampl icon vectors. The generat ion of contaminat ing infectious virus would require recombinat ion between the D N A c leavage /packag ing s igna ls on the ampl icon p lasmids and the cosmids ; however, the s e q u e n c e s f lanking the s ignals do not over lap with sequences f lanking the cosmid delet ions. The main limitation of this method is the low stock titers, usual ly between 1 0 5 and 1 0 6 part ic les/ml, result ing from its dependency on co-transfect ion of all five cosmids and ampl icon D N A . Present ly , ampl icon vector s tocks can be concentrated to 1 0 7 - 1 0 8 part ic les/ml, but the large sca le of production required is expens ive and labor intensive. Efforts to increase stock titers, by inducing transfected cel ls to form sync ica , and thereby increasing the numbers of ampl icon vector producing cel ls , are underway. T h e prototype HSV-1 ampl icon vector is pHSVIac . Th is ampl icon exp resses a p-ga lac tos idase (f3-gal) gene from the HSV-1 IE 4/5 promoter and has a S V 4 0 ear ly region polyadenylat ion site Th is ampl icon was used to establ ish the t ransducing capabi l i t ies of this vector sys tem in both neuron cultures, and fol lowing intracranial inoculat ion (Gel ler and Breakef ie ld, 1988; Gel le r and F reese , 1990). The ampl icon s tocks used in these studies were contaminated by helper virus, but Lowenste in et a l . demonstrated that gene express ion from ampl icon vectors in neurons occurred independent of coinfect ion 4 0 with helper virus. Severa l studies have been done replacing the p-gal gene of this ampl icon with other genes of interest, including nerve growth factor (Federoff et a l . , 1992), human nerve growth factor receptor (p75) (Batt leman et a l . , 1993), g lucose transporter gene (GLUT-1) ( Ho et a l . , 1993; Lawrence et a l . , 1995), G l u R 6 receptor subtype (Bergold et a l . , 1993), adenylate cyc lase (Gel ler et a l . , 1993), and tyrosine hydroxy lase (Gel ler et a l . , 1995). In each c a s e , the gene of interest was a s s e s s e d for short-term express ion and demonstrated function. Interpretation of funct ional activit ies in these studies, however, is compl icated by the low infection eff ic iencies result ing from low ampl icon vector titers and by undetermined helper virus inf luences. Durat ion of gene express ion from ampl icon vectors in vivo has not yet been adequate ly a s s e s s e d . Stud ies examin ing long-term express ion from first generat ion ampl icon vectors have been hampered by cytopathic effects assoc ia ted with coinfect ion of cel ls with helper virus. Attempts have been made to separate express ion pattern from cytopathological effects in vitro. L im et al . reported early shutdown of the IE 4/5 promoter of p H S V I a c in cort ical neuron cultures, while Smith et a l . showed long-term (10 wks) express ion from the IE 4/5 promoter in cultured sensory neurons (Smith et a l . , 1995; L im et a l . , 1996). Differential regulation of an HSV-1 IE promoter (E3) by host proteins within speci f ic neuronal phenotypes has been demonstrated in t ransgenic mice (Mitchel l , 1995). The IE 4/5 promoter of pHSVIac has been replaced by both the neuron-speci f ic eno lase and rat pre-proenkephal in promoters, and their express ion patterns a s s e s s e d fol lowing intracranial injections into rats. T h e s e promoters, especia l ly the pre-proenkephal in promoter, appear to direct preferential neuronal express ion of p-gal which persists in s o m e cel ls for weeks (Anderson et a l . , 1993; Kaplitt et a l . , 1994). The inf luence of helper virus in studies is undetermined. In vitro exper iments a s s e s s i n g p-gal express ion driven by the rat tyrosine hydroxylase promoter suggest that this promoter preferentially exp resses in peripheral sympathet ic neuron cul tures, rather than sensory neuron cultures, but does not provide data on duration of express ion from this promoter (Young et a l . , 1996). The potential express ion duration of HSV-1 ampl icon vectors in neurons remains to be determined in the context of a helper virus-free sys tem, but the f indings above suggest that promoter regulation will inf luence this potential. 41 H S V - 1 ampl icon vectors packaged by the helper virus-free sys tem provide a convenient means of assess ing the cel lular function of many genes of interests in neurons without the interference of assoc ia ted viral protein express ion . The remaining major limitations of this gene transfer sys tem are: low stock titers, and transient gene express ion due to an inability of ampl icon genomes to ach ieve latency. 4 2 2.0 Experimental Objectives and Strategy The major goal of this thesis was to test the hypothesis that H S V - 1 vectors can be useful tools for the express ion and character izat ion of G-prote in-coupled receptors in both nonneuronal and neuronal cel ls . Exogenous ly express ing m l muscar in ic acetylchol ine receptors from HSV-1 vectors has many advan tages . T h e m l receptor gene does not contain any introns, and therefore, express ion of the protein in t issue culture cel ls is not compl icated by any requirements for m R N A spl ic ing and process ing . The pharmacologica l propert ies of the m l receptors are well character ized, and many pharmacologica l tools are avai lable to quantitate express ion and a s s e s s functional activity. Funct ional activities have been a s s e s s e d in var ious exper imental sys tems, and although many of these are cel l type speci f ic , agonist induced phosphoinosi to l hydrolysis has been es tab l i shed as a rel iable measure of m l receptor activity in most exper imental sys tems. A s endogenous m l receptors are exp ressed almost exclusively in neurons, with the except ion of exocr ine g lands, the express ion of this protein from H S V - 1 recombinant vectors provides an opportunity to examine exogenous express ion of a neural speci f ic protein in neurons. The studies in this thesis focused primarily on the development and character izat ion of HSV-1 recombinant v i ruses express ing m l receptors. The main object ives were two-fold; firstly, to determine the effects of el iminating the major viral regulatory protein, ICP4 and the viral host shutoff protein (vhs), on m l receptor express ion from the viral genome, and secondly , to character ize viral-directed receptor express ion and function in neurons. ICP4 is required for viral replication and induction of most viral proteins, and vhs inhibits host polypept ide synthes is ; therefore the elimination of these proteins has the potential to reduce H S V - 1 recombinant virus- assoc ia ted cytopathic effects. The approach w a s to generate a ser ies of HSV-1 recombinant v i ruses express ing m l receptors that were var ied in their express ion of ICP4 and vhs , and then to systemat ical ly 4 3 evaluate e a c h viral protein's effect on viral-directed m l receptor express ion . Accura te and sensi t ive quantitation of virally exp ressed m l receptors was accomp l i shed by measur ing receptor binding of a muscar in ic antagonist, [3H] N-methy l -scopolamine. Funct ional activity was deduced by measur ing inositol 1,4,5-tr iphosphate (IP3) accumulat ion in response to agonist-st imulat ion. T h e pharmaco log ica l and functional propert ies of the virally exp ressed m l receptors were initially character ized in t issue culture cel ls . A n HSV-1 recombinant deficient in both I C P 4 and vhs express ion was chosen to examine viral-directed m l receptor express ion in primary cortical neurons cultures. Cul tures ranging from seven to 14 d-old were infected, and examined for both endogenous muscar in ic receptor and viral-directed m l receptor express ion and function to a s s e s s for age-re lated effects. V i ra l -assoc ia ted cytopathic effects on endogenous muscar in ic receptor express ion and function were determined by compar ing cultures infected with an ICP4-def ic ient control virus with mock infected cultures. The third objective of this thesis was to develop and character ize an HSV-1 ampl icon vector which expressed ant igenic-tagged m l receptors. There is a lack of avai lable ant ibodies directed against the m l receptor, which prevents character izat ion of express ion by immunof luorescence, immunoprecipi tat ion, and Weste rn blotting techniques. The attachment of an antigenic tag to the m l receptor enab led antibody recognit ion of virally exp ressed m l receptors. In addit ion, these studies enab led compar ison of the advantages and d isadvantages of exogenous gene express ion from HSV-1 ampl icon vectors versus H S V - 1 recombinant v i ruses. 44 3.0 Materials and Methods Materials Atropine, 2,2 ' -azinodi-2-ethylbenzthiazol ine sul fonic ac id , 5-bromo-2 ' -deoxycyt id ine, bovine serum ( B S A , fraction five), cytosine arab inos ide, D N a s e , prote inase K, human g a m m a globulin, human g a m m a globul inoxotremorine, P Z P , and soybean trypsin inhibitor were from S i g m a C o . (St. Lou is , M O ) . 5-bromo-4-chloro-3-indoly l -3-D-galactopyranoside (X-Gal ) , l ipofectamine, and most restriction endonuc leases were from Canad ian Life Techno log ies (Burl ington, O N ) with the except ion of P a d which was from New Eng land B io labs. Scinti l lat ion cockta i ls (Ready Sa fe and R e a d y Protein ), and all ultracentrifuge rotors and tubes were from B e c k m a n (Palo Alto, C A ) . Al l radioactive reagents were purchased from D u p o n t - N E N , M i s s i s s a u g a , O N with the except ion of the D-myo-inositol 1,4,5-tr iphosphate [ 3H] a s s a y sys tem which was from Amersham (Oakvil le, O N ) . Al l t issue culture reagents, d ishes , and conjugated secondary ant ibodies were from C a n a d i a n Life Techno log ies (Burl ington, O N ) . The anti-hemagglutinin monoclonal antibody, 1 2 C A 5 w a s from B a b c o (R ichmond, C A ) . The monoclonal antibody to HSV-1 ICPO was a kind gift from R. Everett, Institute of Virology, G lasgow, Scot land. Tissue culture cells and virus Afr ican green monkey kidney (Vero) cel ls from the Amer ican Type Cul ture Col lect ion (Rockvi l le, MA) , the Vero-der ived cel l line, E 5 which provides I C P 4 in trans from N.A. D e L u c a (University at Pittsburg, P E ) , and the Vero-der ived cel l l ine, 2-2 which provides I C P 2 7 in trans from R . M . Sandr i -Gold in (University of Cal i forn ia, Irvine, C A ) were maintained in Du lbecco Modif ied Eag le Med ium ( D M E M ) with 1 0 % fetal bovine se rum in 5 % CO2 a tmosphere. Al l v i ruses are der ived from the HSV- I strain K O S . HSV-1 strain K O S was obtained form D. C o e n , Harvard Med ica l S c h o o l , Bos ton , M A . V h s A was generously provided by J im R. Smi ley , M c M a s t e r Universi ty at Hami l ton, O N (Smibert and Smi ley , 1990). The ICP4-def ic ient HSV-1 virus, d120 and 4 5 its complementary E 5 cel l line were kindly provided by Nei l A . D e L u c a , Pit tsburg University at Pit tsburg, P E (Deluca et. a l . , 1985). Primary cortical neuron cultures Pr imary cort ical neuron cultures were prepared from t imed-pregnant Sp rague -Dawley rats at 16-18 d of gestat ion. Brain t issue was removed from embryos under steri le condi t ions. The cerebral cort ices were carefully d issec ted from h ippocampus , basa l forebrain and olfactory bulbs, and the meninges were removed (Soderback et a l . , 1989). Cort ical cel ls were d issociated by incubation in 0 .025% trypsin in M E M at 3 7 " C for 10 min and mild trituration in 0 . 0 1 % D N A s e and 0 .05% soybean trypsin inhibitor solut ion in M E M (both from S i g m a Chemica ls ) . Ce l l s were gently pel leted at 200 g for 5 min. and suspended in plating medium c o m p o s e d of M E M ; g lucose , 9 g/l; cyst ine, 96.1 mg, penici l l in/streptomycin, 100 | iG/ml ; 1 0 % fetal bovine se rum; and 5 % horse se rum. Approximately 2.5 x 1 0 6 cel ls were s e e d e d onto poly-D- lys ine coa ted 12 well d ishes (30 mm). After 48 hr, medium was removed and replaced with D M E M contain ing N2 supplements (G ibco /BRL) and 10 (xM cytosine arab inos ide to inhibit repl icat ion of non-neuronal cel ls . Plasmid constructs T o construct a p lasmid bearing a m i receptor express ion casset te f lanked by HSV-1 thymidine k inase (tk) sequences which would enable recombinat ion into the viral genome, the following cloning procedures were performed. A 2 kb PvuW D N A fragment from p T K S B , kindly provided by J . Smi ley (McMaste r University), contain ing the HSV- I tk gene with a 200 nt deletion at the Sst I was inserted into a vector pBluescr ipt II S K (Stratagene), resulting in the p lasmid, p T K B s . p T K B s w a s c leaved with SamHI and Pac I, deleting 536 bp, to introduce a 1 kb BamHI-Pac I D N A fragment, from R C / C M V (Invitrogen), containing the human cytomegalovi rus major immediate early gene promoter ( C M V p ) , a multicloning site and a polyadentylat ion s ignal for the bovine growth hormone gene ( B G H poly A) . Final ly, the human m l muscar in ic acety lchol ine receptor gene, obtained from T. Bonner , Nat ional Institute of Menta l Heal th, Be thesda , M A , originally inserted into the BamHI site of the p U C 19 vector (Gibco), w a s c loned into the multicloning site of T K B C 1 using Hind\\\ and E c o R 1 si tes. 4 6 The m l receptor express ion casset te was oriented to transcr ibe in the opposi te direction of the tk promoter. The resulting p lasmid was des ignated phml . T h e 5' noncoding sequence of the m l receptor gene of p h m l was modif ied in the fol lowing manner. A 58 nt primer, designated LG1 which encodes a Hindl l l site, a A T G site, the hemagglut inin (HA) epitope ( Y P V D V P D V G ) and recognizes a 20 nt s e q u e n c e downst ream of the A T G start site, and a 20 nt primer, des ignated L G 2 which recognizes the m l receptor sequences +520 to +500 nts in the ant isense direction were used to generate a 270 bp P C R product. Po lymerase chain reactions cons is ted of 1u.M of e a c h primer, 2 ng of p h m l , 1x P C R buffer (Tr is -HCL 50 m M pH 8.3, Nonidet P-40 0 .05%, Tween -20 0 .05%, M g C l 2 0.5 mM), d N T P 50 | i M and 1 unit of Thermus aquaticus (Taq polymerase) . Ampli f icat ions were carr ied out with 35 cyc les of denaturat ion at 92°C for 45 sec . primer anneal ing at 55°C for 30 sec , and extension at 72°C for 1 min. The ampli f ied P C R product was digested with HindW and Kpn\, and ran on a 1.5% agarose gel . A 270 kb fragment was isolated and c loned into Hindi/Kpn\ s i tes on p h m l ; thereby replacing the 5' noncoding sequence of the m l receptor gene with the P C R product. T w o different p lasmids were der ived from this procedure, which were des ignated pHA/hm1 and p35'hm1. pHA/hm1 bears the expected P C R product, and e n c o d e s an A T G start site, the hemagglut inin epitope and the m l receptor gene with the exc lus ion of its first methionine codon . p35'hm1 was derived from the anneal ing of LG1 to a 13 nt sequence 5 nt upstream of the m l receptor A T G start site; therefore, p35'hm1 is deleted in the 283 nt 5' noncoding region of the m l receptor gene and instead has a 63 nt sequence , der ived from LG1 and the remaining 5 nts, ahead of the m l receptor start site (Fig. 3-7). The modif icat ions of pHA/hm1 and p35'hm1 were determined by s e q u e n c e analys is as per standard procedures (Sambrook et a l . , 1989). Recombinant viruses To generate the recombinant v i ruses, vhm1.1 and v35 'hm1.1 , the recombinat ion vectors, which were either l inearized p h m l or p95'hm1, were cotransfected with V h s A D N A into Ve ro cel ls using a calc ium phosphate-mediated precipitation method 4 7 [Sambrook, 1989]. Ca lc ium chloride was added to 5 | ig of p lasmid and 5 \ig of viral D N A in disti l led H2O to a final concentrat ion of 0.25 M. Th is solution was then added dropwise to an equal vo lume of 2 x Hepes buffer (Hepes 0.04 M, NaCI 274 m M , K C L 10 m M , N a 2 H P 0 4 , Dextrose 12 m M , pH 7.05). Vero cell monolayers at 7 0 % conf luency were overlaid with the transfection mixture and incubated at 37°C for 4-6 hrs, after which time the mixture was removed, and the cel ls were mainta ined in D M E M with 5 % fetal bovine serum containing 100 ug/ml 5-bromo-2' -deoxycyt id ine to suppress the parental virus replication. P laques were a l lowed to deve lop for three days , s tocks were harvested, f rozen in al iquots, and titered. Viral c lones were then p laque purified under 5-bromo-2'-deoxycyt id ine select ion and 0 .5% g a m m a globulin (Connaught ) , and sc reened for m l receptor express ion with l igand binding a s s a y s speci f ic for muscar in ic receptor express ion . Posi t ive c lones were plaque purified three t imes and a s s e s s e d for the m l gene insertion using Southern blot analys is . The recombinant v i ruses, vhm1.2 and v35'hm1.2 were generated by coinfect ing cel ls with donor and recipient virus, al lowing homologous recombinat ion to occur between v i ruses, and select ing for the desi red phenotype. E 5 cel ls at 8 0 % conf luency were infected with d 120 at a multiplicity of infection (MOI) of 3 and either v h m l .1 or v35'hm1.1 at a MOI of 0.5. The virus was left to grow in medium containing 100 ug/ml 5-bromo-2'-deoxycyt id ine. W h e n cultures reached 1 0 0 % cytopathic effect, s tocks were harvested, f rozen in aliquots and titered. The resulting viral stock was used to infect 80 % confluent E 5 monolayers in eight 96 well d ishes at 0.5 to 1 pfu/well. Infected cel ls were again subjected to 5-bromo-2'-deoxycyt id ine se lect ion. T h e result ing progeny were sc reened for the ability to grow on E 5 cel ls, but not Vero cel ls by infecting paral lel 96 wel l d ishes . F rom the vhm1.1 and d120 coinfect ions, 13 posit ive isolates were found, whi le eight posit ives were isolated from v95'hm1.1 and d120 infected cul tures. Al l posi t ives were sc reened for the p resence of m l receptor express ion us ing l igand binding a s s a y s . Four of the 13 and six of the eight isolates tested posit ive for m l receptor express ion . A n isolate der ived from vhm1.1 and d120, and an isolate der ived from v95'hm1.1 and d120 were plaque purified three t imes and des ignated vhm1.2 and v35 'hm1.2, respect ively. 48 The recombinant, vhm1.3 was der ived by coinfecting E 5 cel ls with V h s A at a MOI of 3 and vhm1.2 at a MOI of 0.5, and growing the virus under 5-bromo-2'-deoxycyt id ine se lect ion. The resulting s tocks were used to infect 96 well d ishes of E 5 monolayers at 0.5-1 pfu/well, as stated above. E a c h isolate was sc reened for p-ga lactos idase activity. Posi t ive isolates were plaque purif ied, sc reened again for p-ga lactos idase activity, m l receptor express ion , and the ability to grow only in E 5 cel ls . A c lone posit ive for all three phenotypes was plaque purified three t imes, phenotypes were reconf i rmed, and the result ing recombinant was designated vhm1.3. The recombinant viral genome was conf i rmed by restriction endonuc lease digest ion and Southern blotting. Viral stock production Subconf luent monolayers of Vero or E 5 cel ls growing in jumbo d ishes (177 c m 2 ) were inoculated with virus at an MOI of 0.05 pfu/cell. After 1 hr absorpt ion at 37°C, the inoculum w a s removed, and the infected cultures were overlaid with D M E M contain ing 1 0 % F B S and incubated at 37 "C for 3-4 d. W h e n cel ls showed s igns of genera l i zed cytopathic effect ( C P E ) , the infected cel ls were scraped-off the d ish , cel ls and medium were transferred to 50 ml conica l tubes and cel l debris was pel leted at low-speed centrifugation (250 rpm for 15 min at 4°C in an l E C - C e n t r a 8 R centrifuge). To determine viral titer, p laque a s s a y s were performed in dupl icate. Conf luent Vero or E 5 cel ls in 6-well c luster d ishes were washed with P B S (10 m M N a 2 H P O , 15 m M KH2PO4, 1.4 M NaCI and 25 m M K C L , pH 7.4), and inoculated with ser ial 1:10 dilutions of virus in D M E M containing 5 % F B S . After 1 hr absorpt ion at 37°C, the viral inoculum was removed, and the cel ls were overlaid with D M E M containing 5 % F B S and 0 . 1 % human g a m m a globul in. P laques were counted and v isua l ized after 3 d by staining for 5 min with 4 % methylene blue solution in 7 0 % methanol . Production of amplicon vectors The ampl icon p lasmids, pA-hm1 and pA-HA/hm1 were constructed by inserting the human m l receptor gene and the HA- tagged m l receptor gene, respect ively, into the Hindi 11 and EcorRI si tes of the parental ampl icon p lasmid, p H S V / P v p u c (Fig. 7-1). T h e cosmids cons is ted of over lapping fragments of the HSV-1 genome c loned into Bacter iophage lambda particles. The set of cosmids used in these exper iments, 4 9 referred to c o s 6 A a , cos28 , cos14 , cos56 , and c o s 4 8 A a were generated by Cunn ingham and Dav ison (1993) and the a sites containing the D N A c l eavage / packag ing s ignals were deleted from cos6 and cos48 by Fraefe l et a l . (1996). The cosmid set and p H S V / P v p u c were gifts from A . Gel ler , Harvard University, Bos ton , M A . T o package the ampl icon p lasmids, the cosmids were d igested with P a d to exc i se the HSV-1 inserts, and purified by phenol extraction and ethanol precipitat ion. T h e result ing f ragments were cotransfected into 2-2 cel ls with ampl icon p lasmid D N A using l ipofectamine (G ibco /BRL) . the 2-2 cel l line was chosen for its high transfect ion eff iciency, these cel ls were found to transfect with higher eff iciency than Ve ro cel ls (Fraefel et a l . , 1996). 2-2 cel ls were plated at a density of 4 x 1 0 6 cel ls per 60 mm dish and used for transfection the following day. For each transfected 60 mm dish, 200 ng of each cosmid fragment and 500 ng of ampl icon p lasmid D N A were diluted in a final vo lume of 200 pJ of O p t i M E M (G ibco /BRL) . L ipofectamine was diluted 6 u.l in a final vo lume of 200 uJ of O p t i M E M , and was added dropwise to the D N A mixture. T h e D N A / l ipofectamine solution was incubated for 45 min at room temperature before the addit ion of 1.6 ml O p t i M E M . The cel ls were washed twice with O p t i M E M , over laid with 2.0 ml of the D N A / l ipofectamine solution, and incubated at 37°C with 5 % CO2 for 4 hr. After the incubat ion, the DNA/ l ipofectamine solution was removed, cel ls were over laid with 3 ml D M E M with 5 % F B S , and incubated at 34°C with 5 % C 0 2 for 2.5-3.5 d until max imum cel l conf luency. To harvest the ampl icon vectors, cel ls were sc raped from the three d ishes transfected in paral lel , and transferred with the med ium to a 15 ml con ica l . S u s p e n d e d cel ls were f rozen and thawed three t imes, son icated, and the cel l debr is was removed by centrifugation (10 min at 500 x g). Ampl i con s tocks were concentrated from the supernatant by centrifugation for 4 hr at 22,000 R M P in a B e c k m a n S W 4 1 rotor through a 2 ml 3 0 % sucrose cushion (30% suc rose in 10 m M T r i s - H C L pH 7.8). Viral pellets were gently r insed once with P B S and resuspended for 4 hr at 4°C in D M E M . R e s u s p e n d e d ampl icon stocks were al iquoted and stored at -70°C. Detection of 13-galactosidase activity 50 p-Ga lac tos idase activity was examined 24 hr postinfection fol lowing infection with the var ious H S V - 1 recombinant v i ruses and parental strains. Infected cel l mono layers were w a s h e d once in P B S , f ixed in 4 % paraformaldeyde in P B S for 10 min, and over la id with 5-bromo-4-chloro-3- indolyl- f3-D-galactopyranoside (X-Gal ) 1.0 mg/ml in X - G A L staining buffer (sodium deoxycholate 0 .01%, Nonidet P-40 0 .02%, potass ium ferr icyanide 5 m M , potassium ferrocyanide 5 m M , MgCI in P B S ) . The cel ls were incubated with X - G A L at 4°C overnight, washed with P B S , and a s s e s s e d for blue s ta in ing. Isolation of viral DNA Vero monolayers at 8 0 % conf luency were infected with virus at a multiplicity of infection (MOI) 0.5 were harvested for viral D N A when cultures reached 1 0 0 % cytopathic effect. Infected cel ls were washed with ice-cold P B S , and lysed on ice in met- lysis buffer (1% N P - 4 0 , 1% sodium deoxychol ic ac id , 150 m M sod ium chlor ide and 10 m M T r i s - H C L pH 7.60) for 10 min. Nuclei were pel leted in a microcentr i fuge at 1500 rpm, and the supernatant isolate. Prote inase K and E D T A were added to the supernatant at final concentrat ions of 50p,g/mg and 50 m M , respect ively. S a m p l e s were incubated at 37°C for 4 hr, and subsequent ly , extracted twice with an equa l vo lume of phenol saturated with T E (10 m M T r i s - H C L , pH 7.5; 2 m M E D T A ) . S a m p l e s were further extracted with equal vo lumes of 1:1 phenol/chloroform, fo l lowed by two chloroform extractions. The viral D N A was recovered from each samp le by ethanol precipitation (Sambrook et a l . , 1989). D N A pellets were a l lowed to resuspend slowly overnight in T E at 4°C. Southern and dot blot analysis Approximate ly 5 x 1 0 6 Ve ro or E 5 cel ls s e e d e d into a 100-mm dish were infected at a MOI of 3 pfu per cel l , harvested at 24 hr postinfection, and D N A was isolated as descr ibed above. For Southern analys is , equal amounts of total D N A s were d igested with the appropriate restriction enzyme, subjected to e lectrophoresis on a 0 .8% T A E / a g r o s e gel , stained with ethidium bromide, photographed, and transferred to a nitrocel lulose membrane as previously descr ibed by E. M Southern (1975). Fo r dot blot ana lys is , Ve ro and E 5 cel ls were infected with each recombinant, lysed in met- lysis 51 buffer at 12 hr postinfection, and total D N A was isolated as descr ibed above . S a m p l e s were serial ly diluted by 1/10 and blotted onto a nitrocel lulose membrane us ing a dot blot apparatus ( G i b c o - B R L , Life Technolog ies) . P robes were labeled with 3 2 P by using the Nick Translat ion Sys tem (Canad ian Life Technolog ies) accord ing to instructions provided by the manufacturer. P robes for Southern blots were der ived from either the 1.9 kb BamH1 fragment of the human m l receptor gene, the p lasmid p K X 2 contain ing the entire ICP4 gene (DeLuca and Schaffer, 1985) or the p lasmid pBluescr ip t SKII contain ing the p-galactos idase gene (Stratagene). Dot blots were probed with labeled wt H S V - 1 K O S D N A . Prehybr id izat ion, hybridization and wash ings were performed accord ing to standard protocols (Sambrook et a l . , 1989; Southern, 1975). SDS-PAGE analysis Conf luent Vero cel ls were infected with the appropriate virus at an MOI of 10 pfu/cel l , after 1 hr at 37°C inoculum was removed and cel ls were over la id with complete med ium. At 4 hr postinfection, cel ls were w a s h e d once with methionine-free med ium and incubated 50 [ iCi [ 3 5 S]meth ion ine in methionine-free med ium contain ing 5 % d ia lyzed F B S . . At 7 hr postinfection 10 u.g of Act inomycin D w a s added to the labell ing med ium. Ce l l lysates were harvested at 8 hr post infect ion, by wash ing the mono layers with cold P B S and lysing the cel ls in protein samp le buffer (2% S D S , 50 m M T r i s - H C L [pH 7.0], 5 % p-mercaptoethanol , 0 .005% bromophenol blue, 5 % sucrose) and separated on a 9 % S D S - P A G E gel . The gel was dried under vacuum and exposed to Kodak R - P film. RNA isolation and RNase Protection Assays Approximate ly 5 x 1 0 6 Vero cel ls seeded in a 100-mm dish were infected at a MOI of 3 pfu per cel l and harvested at the indicated t imes postinfection. The total R N A was extracted by using Tr iazol (Canad ian Life Technolog ies) as sugges ted by the manufacturer. R N a s e protection a s s a y s were performed by using an Amb ion R P A II R N a s e protection assay kit (Amersham). To generate the probe for the R N a s e protection assay , a 1.2 kb fragment containing 280 bp of the h C M V IE promoter and 830 bp of the 5' sequence of the m l receptor gene was c loned into a pBluescr ipt SKII vector (Stratagene). After digestion with S S f I and exonuc lease , a 3 2 P - l a b e l e d R N A 52 probe w a s generated using T 3 R N A po lymerase. The resulting 326 nt probe w a s hybr id ized with total cel lular R N A isolated from vhm1.1 infected Vero ce l ls , and then subjected to R N a s e A and R N a s e T1 digest ion. Protected f ragments were separa ted from any undigested full-length probe on a 8 M urea/polyacry lamide gel and v isua l ized by autoradiography. Sequenc ing react ions, used as a marker, were performed with double-s t randed pBluescr ipt S K II D N A templates, using a B R L double-s t randed D N A sequenc ing kit (Canad ian Life Techno log ies) . Ligand Binding Assays. Intact cel l binding a s s a y s were used in all l igand binding exper iments. Approx imate ly 3 x 1 0 5 Vero or E 5 cel ls were s e e d e d in 35 mm d ishes , and were infected with the var ious HSV-1 recombinant v i ruses at a MOI of 3 pfu per cel l . Fo r l igand binding a s s a y s performed in primary cortical neuron cultures, approximately 2 x 1 0 6 ce l ls were s e e d e d into 30-mm d ishes, and at the indicated deve lopmenta l s tages , were infected at a MOI of 3 pfu per cell with the appropriate virus. At var ious t ime points of postinfect ion, the infected cel l monolayers were w a s h e d once with phosphate-buf fered sal ine ( P B S ) , and overlaid with 1 ml of P B S supp lemented with 0.75 m M MgCI , 0.5 m M CaCI (PBS+) and 1 n M [ 3 H]N-methy lscopo lamine ( [ 3 H]NMS) , 80.4 C i /mmo l . Ce l l s were then incubated in binding buffer at 37°C for 1 hr un less otherwise stated. In exper iments compar ing [ 3H]quinucl idinyl benzi late ([ 3H] Q N B , 43.0 Ci /mmol) and [ 3H] N M S binding in intact cel ls 1 n M of each l igand was used , and incubat ions were performed at 37 "C for 90 min. In exper iments examin ing saturation ana lys is of [ 3H] N M S , var ious concentrat ions of l igand ranging from 10-500 p M in a final vo lume of 2 ml were incubated with cel ls at 37°C for 90 min. After all incubat ions, cel ls were washed three t imes with ice cold P B S and lysed with 0.5 ml of 1% (v/v) Triton X - 1 0 0 and 1% S D S . The cel ls were sc raped into scinti l lation v ia ls, the dish was w a s h e d once with 0.25 ml lysis buffer, and the pooled lysate was measured for radioactivity by liquid scintil lation count ing. Nonspeci f ic binding was def ined as the amount of radiol igand bound in the p resence of 1 u,M atropine and ranged from 5 -10% of total radioactivity bound for.[ 3H] N M S , and 2 5 - 3 0 % for [ 3H] Q N B . E a c h datum point is the average of triplicate plates, and standard errors of the mean < 5 % in most c a s e s or < 1 0 % in all c a s e s . Saturation curve data were t ransformed using the method of 5 3 Sca tcha rd and est imates of K p and B m a x obtained using unweighted l inear regress ion ana lys is of the transformed data. Phosphoinositide turnover Approximate ly 2 x 1 0 5 Vero cel ls or 2 x 1 0 6 primary cort ical neurons were s e e d e d in 30 -mm d ishes, and were infected with v h m l .3 at a MOI of 3 pfu per ce l l . At 11.5 hr post infect ion, cel ls were pretreated with 10 m M lithium chlor ide in a Hanks ' ba lanced salt solut ion for 30 min at 37°C prior to addit ion of the muscar in ic agonist. Ce l l s were then incubated with 10 | i M oxotremorine at 37°C for 1 hr. Incubations were terminated by wash ing the cel l monolayers three t imes with ice cold P B S , and adding 0.25 ml of 7 . 5 % (w/v) ice cold tr ichloroacetic ac id . Samp les from two 30 mm d ishes were poo led, the d ishes were washed once with 0.1 ml ice cold P B S , and the w a s h e s were added to the samp le pool . Tr ichloroacet ic ac id in the samp les was extracted with water-saturated diethyl ether ( 3 x 4 ml), and levels of IP3 were determined using a D-myo-inositol 1,4,5-tr isphosphate [^H] a s s a y sys tem (Amersham) as sugges ted by the manufacturer. Indirect immunofluorescence Pr imary cortical neurons (2 x 1 0 6 cel ls / 30 mm dish)were plated on P D L coated g lass covers l ips. Ten day old cultures were infected with v h m l .3, and at 20 hr post infect ion, were r insed two t imes with prewarmed P B S and f ixed in P B S containing 4 % paraformaldehyde for 10-15 min. Ce l l s were r insed three t imes in P B S , permabi l ized in 0 . 1 % Triton X - 1 0 0 / P B S solut ion, r insed aga in , and b locked in 2 % B S A / P B S for 30 min. Pr imary ant ibodies, rabbit polyclonal anti-rat eno lase (Po lysc ience, Inc.) and monoclonal an t i - ICPO ( a gift of R. Everett, Institute of Virology, G lasgow) , were diluted 1:2000 and 1:5000, respectively, in 2 % B S A / P B S and appl ied overnight at 4°C. The secondary ant ibodies ( f luorescein-conjugated goat ant i -mouse and rhodamine-conjugated goat anti-rabbit) were diluted 1:100 and appl ied for 1 hr at room temperature. After wash ing in P B S , stained cultures were mounted in 5 0 % g l y c e r o l / P B S and photographed using a Ze i ss mic roscope with ep i f luorescence opt ics. 54 Vero cel ls were s e e d e d on g lass covers l ips, and either t ransfected with pA-HA/hm1 or infected with v A - H A / h m 1 . At 12 hr following transfect ion, t ransfected cel ls were infected with HSV-1 K O S to up-regulate express ion from the H S V - 1 IE 4/5 promoter. At 24 hr postinfection with vA-HA/hm1 and at 12 hr postinfection of the pA-HA/hm1 transfected cel ls, cel ls were r insed two t imes with P B S , and f ixed in 2 % paraformaldehyde in P B S for 10 min. Ce l l s were r insed three t imes in P B S , and b locked in 2 % B S A / P B S for 30 min. The cel ls were then incubated with a 1:200 dilution of ant i-hemagglut inin monoc lonal antibody, 1 2 C A 5 in 1% B S A / P B S with 0 . 1 % sapon in , and /or with a 1:500 dilution of anti-hemagglutinin polyclonal ant iserum (see below) in 1% B S A / P B S with 0 .25% sapon in . Pr imary ant ibody incubat ions were left at 4°C overnight, w a s h e d extensively, and then 1:100 dilution of secondary ant ibodies F I T C and T e x a s red-conjugated goat ant i -mouse IgG in 1% B S A / P B S . Covers l i ps were then washed and mounted in a 5 0 % glycerol , 100 m M T r i s - H C L , p H 7.8. Images were photographed using a Ze i ss mic roscope with ep i f luorescence opt ics. Production of polyclonal antiserum A synthetic peptide consist ing of the nine amino ac id hemagglut in in epi tope (Huse et a l . , 1989) and the first two amino ac ids of the N-terminus of the m l receptor, Pro and A s p ( N H 2 - T y r - P r o - T y r - A s p - V a l - P r o - A s p - T y r - G l y - P r o - A s p - C y s - C O O H ) conjugated to the multiple antigen peptide (MAP) was acqui red from R e s e a r c h Gene t i cs , Huntsvi l le, A L . A rabbit was injected in multiple subcu taneous sites with a total of 1 mg of peptide conjugate in complete Freund's adjuvant and boosted intramuscular ly three t imes at 4 week intervals with 500 pig peptide conjugate in complete Freund 's adjuvant. The rabbit was then bled, and se rum was separa ted from hematocri t and diluted 1:5 in P B S . The rabbit se ra was sc reened for antipeptide ant ibodies by E L I S A using polyvinyl microtiter plates (Nunc/Gibco) on which the synthetic M A P conjugated peptide had been absorbed. S e r a was serial ly diluted in P B S containing 1% B S A , and 50 |il were transferred to the coated microtiter d ishes . After at least 3 hr at room temperature, the wells were w a s h e d three t imes with 1% B S A / P B S and bound IgG was detected by adding perox idase-coup led goat-anti-rabbit ant ibody and incubating for 1 hr before wash ing. Bound perox idase was a s s a y e d by H202-med ia ted oxidation of 2,2 ' -azinodi-2-ethylbenzthiazol ine sul fonic ac id , and the 55 reaction product was detected by absorpt ion at 414 nm. S e r a taken from the rabbits prior to immunizat ion were a lways included as controls. To a s s e s s specif ici ty of the antipeptide ant ibodies, 50 | iL of a 1:200 dilution of the ant iserum was incubated with 50 u,l of ser ial dilutions of the unconjugated peptide for 30 min at room temperature, transferred to microtiter plates coated with the MAP-con juga te pept ide, and the above procedure was repeated. Background was minimal with 400 pmol/ml of compet ing unconjugated peptide. Ultimately, the 1:500 dilution of ant iserum used in immunof luorescence studies was determined by examin ing indirect-immunof luorescence labell ing with ser ial dilutions of the ant iserum. Evaluation of cell viability Ce l l viability of infected primary cortical neuron cultures was determined us ing a L i ve /Dead kit (Molecular P robes / Cambr idge b iosc ience) . A s s a y s were performed on mock, vhm1.3 , and d120 infected 10 day-old neuron cultures grown on covers l ips . At 12 hr, 20 hr and 48 hr postinfection, cultures were incubated for 15 min. at 37°C with ca lce in A M and ethidium homodimer in neuronal growth med ium. Under a Ze i ss m ic roscope with ep i f luorescence optic, v iable cel ls stain green and non-v iable red. 56 4.0 Construction of recombinant herpesvirus vectors expressing ml muscarinic acetylcholine receptors 4.1 Introduction HSV-1 recombinant v i ruses have a number of biological features that make them attractive vectors for gene transfer into neurons. HSV-1 is a neurotropic virus capab le of efficiently infecting and establ ishing life-long latency in most types of neurons. In the latency state, the viral genome remains as an ep isomal e lement in the nuc leus of the apparently otherwise undisturbed host cel l . In addit ion, HSV-1 has a large t ransgene capaci ty which not only can accommodate large gene inserts, but a lso multiple gene inserts. The main cha l lenges of this gene transfer sys tem are the necessi ty to (1) el iminate viral replication genes and viral assoc ia ted toxicity genes , and (2) the dominant effects of viral proteins and regulatory mechan isms on gene express ion of the desired insert. In this study, we constructed a ser ies of HSV-1 recombinant v i ruses, including replicative and replicative-defective v i ruses, that exp ressed the m l muscar in ic acety lchol ine receptor. The objective was to develop HSV-1 vectors capable of express ing the m l receptors with high eff iciency and to study the effects of different H S V - 1 genomes on m l receptor gene express ion . The technique used to generate the first recombinant was based on the observat ion that cel ls cotransfected with intact viral D N A and a fragment bearing mutated viral D N A sequences resulted in a smal l fraction of the progeny viral population carrying the mutated sequences (Post and Ro i zman , 1981; R o i z m a n and Jenk ins , 1985). Foreign D N A insertion into the viral genome occurs v ia homologous recombinat ion between intact viral D N A and target viral D N A sequences f lanking the gene of interest on the cotransfected D N A fragment. In this study, a m l receptor gene, under the control of the human cytomegalov i rus major (CMV) immediate early gene promoter, was inserted into the HSV-1 Ui_23 gene 57 (thymidine kinase). The thymidine k inase gene is a convenient target site for gene insertion s ince its disruption can be se lec ted for by growth in medium containing bromouraci l deoxyr iboside or bromocytos ine deoxyr iboside (Darby et al . ,1981). Subsequen t recombinant v i ruses bear ing the m l receptor express ion casset te within the U|_23 locus, as well as other viral gene modif icat ions, were generated by select ing for homologous recombinat ion between the original recombinant virus and a desired recipient virus. Recent ly , this method of generat ing recombinant v i ruses by viral coinfection and select ion has been used in other reports to generate viral recombinant v i ruses with multiple mutations (Saman iego et a l . , 1995; W u et al . , 1996). The two primary recipient v i ruses used to construct m l receptor-expressing recombinant v i ruses were the replication competent virus V h s A , and the replication-defective virus d120. V h s A is a HSV-1 K O S P A A r 5 derivative in which the U|_41 gene, encoding the virion host shutoff protein, was inactivated by insertion of a p-galactosidase gene under the control of the HSV-1 I C P 6 promoter (Smibert and Smi ley, 1990; Goldste in and Wel ler , 1988). The virion host shutoff protein is packaged in the tegument of the virion and upon infection inhibits host translation and causes degradat ion of cel lular m R N A s (Read and Fenke l , 1983; Kwong and Frenkel , 1987 & 1988; Smibert et a l . , 1992). The P A A r 5 mutation affects the viral D N A po lymerase gene and reduces the inc idence of spontaneous thymidine kinase-deficient mutations (Hall et a l . , 1984). d120 is a HSV-1 K O S derivative made replication-defective by a 4.1 kb deletion in both a 4 genes which encode ICP4. ICP4 is a major regulatory protein that represses its own express ion and that of other a genes by binding to the consensus A T C G T C sequence , and act ivates express ion of p and y genes by unknown interactions with probably multiple cel lular transcription factors (O'Hare and Hayward , 1987; G u and De luca , 1994). Instead of express ing the wildtype 175 k D a ICP4 protein, d120 expresses a 40 kDA protein with no D N A binding and transactivation capabi l i t ies (Deluca, 1985; Saman iego et al . , 1996). The d120 recipient virus and its recombinant derivatives can only be propagated in an ICP4 express ing cel l l ine. 58 T h e s e two HSV-1 v i ruses, V h s A and d120 provided the backbone for a ser ies of HSV-1 recombinant v i ruses that express the m l receptor. These recombinant v i ruses contain var ious combinat ions of modif icat ions to genes encoding ICP4 , vhs and the m l receptor. The phenotypes of the recombinant v i ruses with regards to their ICP4 and vhs mutat ions were character ized, as were the genotypes of the m l receptor gene insertion and ICP4 encoding genes delet ions. In addit ion, the 5' noncoding region of the m l receptor gene which contains three potential ICP4 repressor si tes was deleted in two recombinant v i ruses to enable studies of ICP4 effects on m l receptor express ion. A total of five HSV-1 recombinant v i ruses express ing m l receptors were generated in this study. 4.2 RESULTS 4.2.1 Generat ion of HSV-1 recombinant v i ruses Initially, three different HSV-1 recombinant v i ruses were constructed to express m l receptors from the complete human m l muscar ine acetylchol ine receptor gene. E a c h recombinant was different with regards to its express ion of the HSV-1 proteins, ICP4 and vhs. The express ion casset te for m l receptor express ion in each recombinant was kept constant: express ion of m l receptors in all recombinant v i ruses was driven by the human cytomegalov i rus major immediate early gene promoter (CMVp) and the polyadenylat ion signal was provided by the bovine growth hormone gene ( B G H ) polyadenylat ion sequence . The m l receptor express ion casset te was targeted to the U|_23 locus of all recombinant v i ruses; therefore, all recombinant v i ruses were deficient in HSV-1 thymidine k inase express ion . To generate the first recombinant, a p lasmid des ignated p h m l , containing the m l receptor express ion ( C M V p : m l ) casset te f lanked by thymidine k inase 5' and 3' sequences , was constructed, p h m l was cotransfected into Vero cel ls with infectious V h s A D N A and the cotransfected cel ls were overlaid with 5-bromo-2'-59 deoxycyt id ine to select for the growth of tk-deficient virus (Fig. 4-1). The isolated recombinant, cal led vhm1.1 conta ined the C M V p : m l gene casset te within the U|_23 locus. vhm1.1 a lso conta ined the (3-galactosidase gene under control of the HSV-1 ICP6 promoter (ICP6:[3-gal) within the U|_41 locus which was der ived from the parental virus, V h s A (Smibert and Smi ley , 1990). The second recombinant, v h m l .2 was generated by coinfection of v h m l .1 and d120, and select ion for tk-deficient virus. Progeny were sc reened for the ability to grow on E 5 cel ls , but not Vero cel ls. vhm1.2 contained the C M V p : m l gene casset te , and was defective in ICP4 express ion by virtue of the d120 4.1 kb deletion in both a 4 genes . (De luca , 1985). The third recombinant, v h m l .3 was generated by coinfect ion of vhm1.2 and V h s A . Progeny were sc reened for (3-gal activity and the ability to grow on E 5 cel ls, but not Ve ro cel ls. vhm1.3 conta ined the C M V p : m l gene casset te within the Ui_23 locus, the ICP6:(3-gal gene casset te within the U L41 locus, and the d120 derived delet ions in the oc4 genes . Al l three recombinant v i ruses were plaque purif ied, and retested for the appropriate phenotypes. Figure 4-2 shows schemat ic drawings of the recombinant genomes as predicted by the phenotypes 4.2.2 Southern blot analys is of HSV-1 recombinant v i ruses To a s s e s s the insertion of the C M V p : m 1 casset te into the U|_23 locus of the recombinant v i ruses, viral D N A was isolated from infected Vero and E 5 cel ls, and digested with EcoRI . The E c o R I restriction map of HSV-1 K O S D N A has been well character ized, and the U|_23 locus has been identified within the 2.1 kb E c o R I fragment, designated the N band (Goldin et al . , 1981). This band was absent in the recombinant D N A , and a new 4.9 kb band was present (Fig. 4-3). Southern analys is showed that the new 4.9 kb E c o R I band hybridized to a 1.9 kb BamH1 fragment from the m l receptor gene, confirming the insertion of the m l receptor gene into the U|_23 locus. (Fig. 4-3). 60 5' 3' selection for tk- virus Fig. 4-1. Insertion of the human ml muscarinic acetylcholine receptor gene into an HSV-1 genome by homologous recombination. The cytomegalovirus major immediate early promoter (CMVP), a multicloning site and a BGH polyadenylation site from pRC/CMV, was inserted into the HSV-1 thymidine kinase (tk) gene of the plasmid pTKSB. The ml muscarinic acetylcholine receptor gene (ml AchR) was then cloned into the multicloning site's Hind\ 11 and EcoR1. The resulting plasmid, phml contained the CMVP:m1 AchR gene cassette flanked by the tk gene, phml was cotransfected into Vero cells with HSV-1 VhsA DNA. tk -deficient recombinants were selected using bromodeoxycytidine, plaque purified and tested for ml receptor gene insertion into locus U|J28. 61 0.2 0.4 0.6 0.8 1.0 mu vhm1.1 U l 4 J L * , ICP6:p-gal ^ r UU28 la b I y X_ > < |b' a1 | c1 | 1 c I TRL ^ ^ F K ~~~ ~~- ~ ~ ~ I R L IRS TRS ^ ^ UL24 ~T — ^ - ^ S m a 1 P a d BamH1 B g i r l P v u l l - t H YT-^ ^ 536 bp deletion \ ^ ATG 2.8 kb ^ CMV . . . D BGH promoter m 1 nriACnH p o | y A vhm1.2 ICP4 4.1 kb deletion \ * > Ul28 \ / b' a1 TRL ^ tk ~~~ ^ IRL IRS TRS UL24 . --^ Sma 1 | Pacl BamH1 BgrT1 Pvu~11 ^. ^  " 5 1 ! bp deletion""" \ ATG 2.8 kb ^ CMV I . . _ BGH promoter m 1 m A C n K polyA vhm1.3 UL41  I C P 4 ' 4.1 kb deletion ^ICP6:p-gal x X , ^ - i t -, , t 7 L 2 S ^ ^ ^ ^ ' \ / \ . TRL ^ ^ tk ~~~ ^ |RL IRS TRS , ^ ^ UL24 ~~ Sma 1 Pacl BamH1 B g l i l PvJJII ^. 536 bp deletion \ ^ ^ ^ ATG 2.8 kb ^ CMV , D B G h f " promoter m l n iACnr i p o | y A Fig. 4-2. Recombinant virus genomes expessing the human ml muscarinic acetylcholine receptor. Recombinants were generated by coinfecting vhml withd120, an ICP4- HSV-1 virus, and allowing homologous recombination to occur. The resulting viral stock was selected for thymidine kinase(f/c) deficiency, and screened for the ability to grow on ICP4 expressing E5 cells, but not on Vero cells. vhm1.2 both expresses hmlAchRs and plaques only on E5 cells. vhm1.2 was coinfected with vhsA, vhm1.1's parent HSV-1 strain, and the resulting viral stock was selected for tk deficiency, the ability to grow only on E5 cells, and p-galactosidase expression. vhm1.3 has all three of these properties. 62 Fig. 4-3. Southern blot analysis of the HSV-1 recombiant virus ml muscarinic acetylcholine receptor gene. . Viral DNA was isolated from infected Vero cells, digested with either EcoRI or SamHI overnight, and 1 ug of each sample was separated on a 0.8% agrose gel. The gel was Southern blotted and hybridized with the 1.9 kb SamHI fragment of the ml receptor gene. The probe recognized a 4.9 kb EcoRI fragment (a) and a 1.9 kb SamHI fragment (b) that were unique to the vhml .1 genome. 63 T h e p resence of d 120 derived 4.1 kb deletion in both a 4 genes of v h m l .2 and vhm1.3 was determined by hybridizing viral D N A digested with S a m H I with the entire a 4 gene. The deletion in d120 spans two SamHI sites and created a unique 1.1 kb SamHI fragment. Both vhm1.2 and vhm1.3 genomes were posit ive for the 1.1 kb SamHI fragment; whereas, the V h s A and vhm1.1 SamHI d igested g e n o m e s were posit ive for the 5.3 kb fragment characterist ic of the intact a 4 gene (Fig. 4-4). T h e s e results verif ied that not only do vhm1.2 and vhm1.3 have a ICP4 deficient phenotype, but they a lso carry the d120 4.1 kb deletion in their a 4 genes . 4.2.3 Ana lys is of viral replication competency Both vhm1.2 and vhm1.3 recombinant v i ruses were unable to form p laques on Ve ro ce l ls , indicating that infectious part icles were not produced fol lowing infection with these recombinant v i ruses. The parental virus of these recombinant v i ruses, d120, has been shown to be replication defective (De luca et a l . , 1985). To determine if viral replication was a lso inhibited in vhm1.2 and vhm1.3 , viral replication in Vero cel ls was compared to viral replication in the complementary E 5 cel l line using dot blot ana lys is . Viral replication was a s s e s s e d at 12 hr post infect ion: wild-type HSV-1 replication was detectable at 3 hr postinfect ion and cont inued until 12-18 hr postinfection. Background viral D N A resulting from the viral g e n o m e s of the inoculum was determined by examin ing infected Ve ro cel ls at 1 hr post infect ion (Fig. 4-5). In Vero cel ls infected with v h m l .2 and v h m l .3, the levels of detectable viral D N A at 12 hr postinfection were equivalent to background; whereas V h s A and vhm1.1 both demonstrated high levels of viral replication. Equivalent pfu of vhm1.2 and vhm1.3 were used to infect E 5 cel ls which resulted in robust viral replication (Fig. 4-5). T h e s e results indicate that defective ICP4 express ion in vhm1.2 and vhm1.3 dramatical ly inhibited viral replication in n o n l C P 4 express ing ce l ls . 64 6 hr exposure o / n exposure Fig. 4-4. Southern analysis of the ICP4 genes in the recombinant HSV-1 vectors. Viral DNA was isolated from infected E5 cells, digested with Bam H1, and 1 ug of each sample was ran on a 0.8% agrose gel. The gel was Southern blotted and probed with the entire ICP4 gene. Arrow (a) indicates a 5.3 kb fragment and arrow(b) indicates a 1.1 kb fragment. 65 vhsA vhm1.1 vhm1.2 vhm1.3 B • • f • • • • • • vhm1.1 vhm1.2 vhm1.3 # • vhsA • • # vhm1.1 vhm1.2 • • # vhm1.3 Fig. 4-5. Detection of viral replication by dot blot analysis. Vero cells (B) and E5 cells (C) were infected with either VhsA, vhml .1, vhml .2 or vhml .3, and lysed in met-lysis buffer at 12 hr postinfection. Total DNA was isolated from each sample, serially diluted by 1/10 and blotted onto a nylon membrane using a dot blot apparatus. The blots were then probed with wt HSV-1 DNA. Background levels resulting from the infecting DNA was determined in Vero cells at 1 hr postinfection (A). 66 4.2.4 Ana lys is of polypeptide synthesis To determine the effects of the viral host shutoff protein (vhs) and ICP4 on both viral and cel lular polypeptide synthes is , S D S - P A G E analys is was performed. Vero cel ls were mock infected or were infected with K O S , V h s A , v h m l .1 , v h m l .2, vhm1.3 or d120 at a MOI of 10 pfu/cell . Proteins were labeled with [ 3 5 S]meth ion ine from 4 hr postinfection to 8 hr postinfection. Act inomycin D was added to the med ium at 7 hr postinfection blocking further transcription of HSV-1 y genes , but al lowing the translation of proteins from the performed viral m R N A s . Harvest ing the cell lysates at 8 hr postinfection and adding act inomycin D at 7 hr postinfection min imized the amount of late polypeptide synthesis and enab led eas ie r interpretation of the S D S - P A G E protein profile. The resulting S D S - P A G E profile depicted immediate-early and early viral polypeptide synthesis , as well as a limited amount of late viral polypeptide synthesis , from the parental and recombinant v i ruses (Fig. 4-6). Vero cel ls infected with the ICP4-def ic ient recombinant v i ruses, vhm1.2 and vhm1.3 , exp ressed only four detectable viral proteins: the immediate-ear ly polypept ides ICPO, ICP22 , ICP27 and the early polypept ide ICP6 (Fig. 4-6). T h e s e f indings were consistent with those of De luca and coworkers who showed that S D S - P A G E profiles of Vero cel ls infected with the ICP4-def ic ient mutant, d120 only contain these four viral proteins (Deluca et al. ,1985). Vero cel ls infected with K O S , V h s A and vhm1.1 contained ICP4 , in addition to the previously ment ioned immediate-ear ly proteins. It should be noted that the immediate-early proteins Us1 .5 and ICP47 were not detectable by this method. K O S , V h s A and v h m l .1 infected cel ls a lso contained severa l early polypept ides bes ides ICP6 , including ICP8 , ICP11 and ICP36 . ICP36 which has been identified as thymidine k inase was present in K O S and V h s A infected cel ls , but was absent in vhm1.1 infected cel ls. A few late viral polypeptides, such as I C P 5 , ICP20 and I C P 2 5 , were also present in K O S , V h s A and vhm1.1 infected cel ls . Identified viral polypept ides synthes ized by either the parental or recombinant v i ruses are labeled in Figure 4-6. 67 68 Label ing cel ls infected with the parental and recombinant v i ruses 4 to 8 hr postinfection a lso demonstrated the effect of vhs on cel lular protein synthesis , vhs mediated the primary phase of HSV-1 shutoff of host protein synthesis which occurs approximately 0 to 8 hr postinfection (Kwong et a l . , 1988). The secondary phase of shutoff function required viral gene express ion , and began approximately 8 hr postinfection (Kwong and Frenkel , 1987). Inocula of 10 pfu/cell were used s ince the degree of v i r ion-associated host shutoff was dependent on the input number of virus particles per cel l , and the effects of vhs were not readily apparent in S D S - P A G E profiles following infections with low MOIs . Vero cel ls infected with K O S , vhm1.2 or d120 showed reduced cel lular protein synthesis as compared to Vero cel ls infected with V h s A , vhm1.1 or vhm1.3 (Figure 4-6). T h e s e results were consistent with the expected vhs-deficient phenotypes of V h s A , v h m l .1 or vhm1.3. 4.2.5 Modif ication of the 5' noncoding region of the m l receptor gene The 5' noncoding sequence of the human m l muscar in ic acetylchol ine gene is 283 bp in length and contains three potential HSV-1 ICP4 binding sites (Fig. 4-7). The ICP4 high affinity binding site is 5 ' - A T C G T C - 3 ' and is known to be degenerate, al lowing ICP4 binding to hexanucleot ide sequences that differ from the consensus site by one nucleotide (Faber and Wi lcox, 1986; Kat tar -Cooley and Wi lcox, 1989; Athanas ios et al . , 1991). ICP4 represses promoters containing the high affinity binding site near the start site of transcription (Michael and Ro izman , 1993; G u et a l . , 1993). In the presence of these sites, ICP4 forms a tripartite complex with the basal transcription factors TATA-b ind ing protein (TBP) and TFIIB which mediates its ability to repress transcription (Gu et a l . , 1995). The m l receptor 5' noncoding sequence containing the potential ICP4 repressor sites was removed by insertion of a 63 bp P C R product between the m l receptor coding sequence and C M V promoter of the recombinat ion p lasmid , p h m l (Fig. 4-8). P C R product insertion and removal of the 5' noncoding sequence was conf i rmed by sequence analys is (Fig. 4-9). The resulting p lasmid was des ignated 69 Hind III i CMV-P ATG KPf1' mlAchR Hind III, Kpn I digest + 273 bp PCR product with HA epitope sequence at 5' end ATG mlAchR CMV-P YPYDVPDYG B 5' GATCAAGCTTATGTACCCGTACG * 5' GATCAAGCTTATGTACCCGTACGACGTTCCGGACTACGGT 3' 5'- - CCAACCCCAGCCCCACCTAGCCACCATGAACACTTCAGCCCCACCTGCTGTCAG- ~3' Fig. 4-8. Construction of a ml muscarinic acetylcholine receptor gene with a deleted 5' noncoding sequence. Figure A illustrates the removal of the 5' noncoding sequence of the mlAchR gene via the addition of a PCR product encoding an antigenic tag. Figure B shows the anealing of the primer, LG1 to homologous sequences near the ml mAchR gene' ATG site. The LG1 primer encodes a Hind 111 site, the hemaglutinin epitope (YPVDVPDVG), and the first 20 nt following the ATG site of the mlAchR gene. The anealing temperature used for the PCR reaction was 55°C. The stared LG1 primer (*) shows the permissive anealing of the primer to a 13 nt sequence 5 nt upstream of the ATG site. This second site of annealing resulted in the construction of a mlAchR gene with a deleted 5' noncoding sequence. p - O M V A C G T • ^ 1 i p-l A 3 A C G T B p - C M V A C G T p-l A 3 A C G T p A T G - > m ATG-A T G ^ - * * t Fig. 4-9. Sequence analysis of the 5' end of the 5-5' ml muscarinic acetylcholine receptor gene and the antigenic tagged ml muscarinic acetylcholine receptor gene. DNA was isolated from the recombinant virus, v 5-5'hm1 (B) and from a plasmid containing the antigenic tagged ml AchR gene. The primer, p-CMV was used to sequence the 5' end of the two genes 5' to 3'. The primer, LA-3 was used to sequence 3' to 5' and initiated 100-150 bp downstream of the ml AchR ATG site. 72 pd5'hm1. The recombinant virus, vd5'hm1.1 was generated by cotransfect ing p95'hm1 D N A with V h s A D N A , and select ing for tk-deficient virus. A c lone express ing m l receptors and p-galactos idase was isolated and p laque purif ied. Southern blot analys is conf i rmed the insertion of the modif ied m l receptor gene into the U|_23 locus and the I C P 6 : p-gal casset te into the U|_41 locus. S e q u e n c e ana lys is of the recombinant 's m l receptor gene was ana logous to pd5'hm1 and conf i rmed the removal of the 5' noncoding region and insertion of a P C R product (data not shown). Another recombinant virus, vd5'hm1.2 was generated by coinfect ing E 5 cel ls with v95'hm1.1 and d120, and select ing for tk-deficient virus. P rogeny were sc reened for m l receptor express ion and the ability to grow on E 5 cel ls , but not Vero cel ls . The resulting c lone was plaque purif ied, extensively tested for the desi red phenotypes and designated vd5 'hm1.2. v35'hm1.1 and v85'hm1.2 had ana logous phenotypes to vhm1.1 and vhm1.2, but differ in their modif icat ion to the 5' noncoding sequence of their m l receptor genes . 4.3 DISCUSSION In this chapter, severa l different HSV-1 strain K O S recombinant v i ruses contain the m l muscar in ic acetylchol ine receptor gene were generated. Phenotypica l ly , all recombinant v i ruses were thymidine k inase deficient. vhm1.1 and vd5'hm1.1 were replication competent; whereas vhm1.2, v95 'hm1.2, and v h m l .3 were replication-defective by virtue of their ICP4 def ic iency, v h m l .1 , vd5'hm1.1 and vhm1.3 were defective in their viral host shutoff protein function and exp ressed p-galactos idase. v95'hm1.1 and v95'hm1.2 were ana logous to vhm1.1 and vhm1.2 respectively, except for their modif ication to the 5' noncoding region of the m l receptor gene. ICP4 has multiple effects on gene express ion from the H S V - 1 genome, including regulation of other viral regulatory proteins, and it is often difficult to differentiate between the direct and indirect effects of this protein on gene express ion . In this chapter, severa l recombinant v i ruses were deve loped which 7 3 would enable investigation of the effects of ICP4 on viral-directed m l receptor express ion . Recombinant v i ruses which exp ressed m l receptors in either the p resence or absence of viral ICP4 express ion were generated, as were recombinant v i ruses which were either posit ive or negative for potential ICP4 repressor sites within the 5' noncoding region of the m l receptor gene. In addit ion, cel l l ines which differed only in their ability or inability to express ICP4 from a ch romosoma l site were avai lable. Recombinant v i ruses generated v ia coinfect ion with d120 and select ion for ICP4-def ic ient propert ies demonstrated viral replication and viral polypept ide synthesis patterns analogous to the parental d120 virus. T h e s e recombinant v i ruses did not produce infectious viral progeny following infection of Ve ro cel ls , and dot blot analysis of viral D N A isolated from infected Vero cel ls indicated that viral D N A replication in these cel ls was dramatical ly reduced. The only viral proteins detected in Vero cel ls infected with these recombinant v i ruses using [ 3 5 S]meth ion ine labeling and S D S - P A G E ana lys is were ICPO, ICP22 , I C P 2 7 and ICP6 . The immediate-early protein ICP47 and the Orf P protein were not detected by this method, but other studies on d120 infected Vero cel ls suggest that these viral proteins are a lso produced in the a b s e n c e of ICP4 (Wu et a l . , 1996). Fol lowing infection of cel ls with ICP4-def ic ient v i ruses the express ion of the other immediate-early proteins are actually upregulated due to the absence of ICP4 repression of their gene express ion (DeLuca et a l . , 1985; Faber and Wi lcox, 1986; Kat tar-Cooley and Wi lcox, 1989; A thanas ios et a l . , 1991). ICPO has severa l potential effects on gene express ion and host cell function in these cel ls. ICPO is a promiscuous transactivator of both H S V and n o n - H S V promoters. It has a lso been implicated in cytoplasmic functions affecting host translational machinery v ia interactions with cel lular elongation factors (Kawaguch i et al . , 1997). Cy top lasmic funct ions of ICPO in cel ls infected with ICP4-def ic ient recombinant v i ruses may be particularly important s ince the proportion of cytoplasmic to nuclear ICPO is increased in the absence of ICP4 (Saman iego et a l . , 1995). ICP27 has been shown to affect spl icing and poly (A) usage of m R N A s and appears to play a role in 74 secondary shutoff of host protein synthesis (McCar thy et al . , 1989; R ice and Knipe, 1990). Neither ICP22 nor ICP47 as been shown to affect gene express ion when deleted from an otherwise wild type HSV-1 genome; however, deletion of ICP22 from an ICP4 and ICP27 deficient virus has been shown to dramatical ly reduce viral assoc ia ted cytopathic effects and enable more efficient viral and cellular gene express ion (Mavromara-Nazos et a l . , 1986 ; Post and Ro izman , 1981; W u et a l . , 1996). The mechan ism of ICP22 assoc ia ted effects in cel ls infected with ICP4-deficient v i ruses is unknown. ICP47 is a cytop lasmic protein that has been shown to affect the processing of major histocompatibil i ty complex c lass I molecu les, and is not bel ieved to alter gene express ion or c a u s e cytopathic effects (York et a l . , 1994). The multiple regulatory funct ions of the remaining immediate-ear ly proteins, especia l ly ICPO, ICP27 and ICP22 have the potential to alter genet express ion from our ICP4-def ic ient recombinant v i ruses, and induce cytopathic effects in infected cel ls , even in the absence of viral repl ication. The effects of the other viral proteins, namely ICP6 and Orf P expressed from ICP4-def ic ient v i ruses have not been well character ized. The express ion of the early protein, ICP6 which is the large subunit of viral r ibonucleotide reductase is reduced approximately three to four fold in cel ls infected with ICP4-def ic ient virus and has no known affect on gene express ion . El iminat ion of ICP6 from a ICP4-deficient virus resulted in no detectable changes in viral; or cel lular gene express ion (N.A. D e L u c a , personal communicat ion) . The L /ST promoter of Orf P is normally repressed by ICP4 ; therefore, in the absence of ICP4 , Orf P express ion is increased (Kuddas et a l . , 1995). Relat ively little is known about the effects of the Orf P protein on gene express ion and host function, but it is known to interact with a component of the S F 2 / A S F spl ic ing factor and consequent ly , may effect both gene express ion and host cell funct ions (Bruni and R o i z m a n , 1996). It is clear, that the limited viral gene express ion from our ICP4-def ic ient recombinant v i ruses may inf luence both m l receptor express ion and host cell function in cel ls infected with these recombinant v i ruses. It will be interesting to determine the influence of each of these viral proteins on m l receptor express ion 7 5 from HSV-1 recombinant v i ruses. Regard less of the precise nature of these effects, the interpretation of m l express ion data from ICP4-def ic ient v i ruses must take into account potential inf luences of these viral proteins. In addit ion, exper iments utilizing recombinant v i ruses to investigate m l receptor function must include the appropriate controls for viral protein express ion from an ICP4-def ic ient virus. The potential effect of vhs on m l express ion from our recombinant v i ruses is less complex than that of ICP4. vhs is a tegument protein that is re leased into the cytop lasm upon infection and supp resses host protein synthesis and induces accelerated turnover of both viral and cel lular m R N A s (Kwong et a l . , 1988). The only known associat ion of vhs with another viral protein is its interaction with the transcriptional activator V P 1 6 , another tegument protein. Smibert et al . suggested that this interaction may play a structural role in the assemb ly of H S V virions and modulate the activity of vhs during infection (Smibert et a l . , 1994). It is unlikely that vhs could directly affect m l receptor express ion from HSV-1 recombinant v i ruses, but it has the potential of influencing m l receptor m R N A stability and translation, vhs may cause more rapid degradat ion of m l receptor m R N A and its reduced translation, or it may actually enable higher levels of m l receptor due to increased availability of host translational machinery, resulting from reduced cel lular m R N A load. Regard less of the effects of vhs on m l receptor express ion, the elimination of vhs effects on host protein synthesis would be beneficial for decreas ing cytopathic effects assoc ia ted with HSV-1 recombinant v i ruses. Recombinant v i ruses which carr ied the vhs mutation had notably less virus assoc ia ted shutoff of host protein synthesis than the vhs-express ing recombinant v i ruses in S D S - P A G E profiles. In this experiment, Vero cel ls were infected with MOIs of 10 pfu/cell . The degree of v i r ion-associated host shutoff was dependent on the input number of virus particles per cel l . There was essent ial ly no difference in the amount of detectable host protein synthesis in mock infected cel ls and cel ls infected with a MOI of 2 pfu/cell as determined by [ 3 5 S ] methionine label ing fol lowed by T C A protein precipitation or S D S - P A G E analys is (Kwong and Frenkel , 1989). There was , however, a sharp transition in the degree of host shutoff 7 6 observed when wt K O S HSV-1 inoculum was increased from MOIs of 2 to 10 pfu/cell (Kwong and Frenkel , 1989). The vhs mutation in exper iments using MOIs of 3 did not inf luence host cell protein synthesis as detected by S D S - P A G E analys is (data not shown). In all exper iments examining m l receptor express ion and function in the fol lowing chapters, recombinant viral infections were carr ied out at three pfu/cell, a MOI chosen to ensure the infection of every cel l without the addit ion of excess viral particles. Subt le effects of the vhs mutation on m l receptor express ion from recombinant v i ruses will be more detectable with the highly sensi t ive l igand binding a s s a y s speci f ic for m l receptor express ion than by gross analys is of host protein synthesis. This ser ies of HSV-1 recombinant v i ruses, each containing the m l receptor gene within the U L 28 locus, was des igned to enable quantif ication of foreign gene express ion from HSV-1 genomes defective in ICP4 and/or vhs express ion . The construct ion of HSV-1 recombinant v i ruses with multiple mutations has traditionally been a laborious and t ime-consuming task that was dependent upon sequent ia l cotransfect ions with appropriate p lasmids and viral D N A . Prior to these studies, there were no publ ished reports document ing the use of homologous recombinat ion between coinfected viral genomes and select ion by phenotype to generate multiple mutations in viral genomes . This method proved to be an effective and efficient way to generate recombinant v i ruses and has s ince been used to develop multiple mutations in HSV-1 genomes in other reports (Samaniego et a l . , 1995; W u et a l . , 1996). 77 5.0 Expression of ml muscarinic acetylcholine receptors from recombinant herpesvirus vectors 5.1 Introduction A ser ies of HSV-1 recombinant v i ruses that bear the m l muscar in ic acetylchol ine receptor gene within their U L 28 locus were generated. T h e s e HSV-1 recombinants were des igned to enable a systemat ic evaluat ion of the effects of ICP4 and the viral host shutoff protein (vhs) on m l receptor gene express ion from the viral genome. The study descr ibed in this chapter focuses on the quantification of m l receptor express ion from each recombinant virus genome, and the character izat ion of the virally exp ressed receptors with regards to their pharmacolog ica l and functional propert ies. The m l muscar in ic acetylchol ine receptor 's pharmacolog ica l propert ies are well character ized, and a number of pharmacolog ica l tools are avai lable to quantitate express ion and a s s e s s functional activity. The muscar in ic antagonist, N-methy lscopolamine (NMS) is a posit ively charged hydrophil ic molecu le that recognizes m l receptors present only on the sur face of intact cel ls , and therefore, this l igand provides an est imate of the functional receptor populat ion (Galper et a l . , 1987; Nathanson et a l . , 1992). Sur face to intracellular comparat ive local ization of virally expressed m l receptors is made possib le by the use of another muscar in ic antagonist, quinucl idinylbenzi late (QNB) . Unl ike N M S , Q N B is substantial ly more soluble in lipid bi layers due to an addit ional phenol group and ether l inkage, and high lipid solubility permits it to penetrate both p l asma membrane and intracellular ves ic les of intact cel ls (Nathanson, 1983). There are a lso severa l muscar in ic agonists avai lable with which to stimulate m l receptor activity. Two of the most commonly used are carbachol and oxotremorine. Carbacho l induces a stronger m l receptor response than oxotremorine, but a lso results in a higher rate of 78 receptor downregulat ion than oxotremorine and is more prone to nonspeci f ic activation of multiple G-proteins in receptor over-express ion sys tems (Eva et a l . , 1989; Kenak in , 1995). Al l investigations in this chapter were performed in Vero cel ls, a kidney cell line which do not express any endogenous muscar in ic receptors. T i ssue culture cell l ines, including kidney cell l ines, t ransfected with the m l receptor gene have been shown to express m l receptors that retain their l igand binding propert ies and are capab le of agonist-st imulated response (Brann et a l . , 1987; Peral ta et a l . , 1988; A s k e n a z i et al . , 1988). Therefore, this exper imental sys tem was appropriate for determining the expression profiles of m l receptors from the ser ies of HSV-1 recombinant v i ruses, and for examin ing the functional and pharmacolog ica l propert ies of virally expressed m l receptors. 5.2 Results 5.2.1 Transcript ion of m l receptor In this study, temporal express ion of the m l receptor gene under control of the C M V promoter from within a (3 gene locus was examined at the level of transcription to determine if its onset of express ion fol lowed the (3 gene express ion pattern of its inserted locus. To a s s e s s transcription patterns of the m l receptor gene from the HSV-1 genome, Vero cel ls were infected with vhm1.1 , total cel lular R N A was isolated at var ious t imes postinfection, and m l receptor m R N A was ana lyzed using an R N A a s e protection assay . A 326 nt radiolabeled R N A probe complementary to 265 nt at the 5' end of the expected m l receptor transcript was hybridized to the samples . RNase- res is tant hybrids represent ing m l receptor transcripts were subjected to polyacry lamide gel e lectrophoresis fol lowed by autoradiography to quantify gene express ion . This a s s a y showed that m l receptor transcripts were detectable by 4 hr postinfection, and persisted throughout the course of infection (Fig 5-1). This pattern of temporal regulation is similar to 7 9 Fig. 5-1. Detection of ml receptor mRNA expression from recombinant HSV-1 vectors. Expression of ml AchR transcripts from the CMV promoter was detected using a ribonuclease protection assay. A 326 nt labelled RNA probe was synthesized from the T3 promoter of pBluescript/KS(-) that recognizes the 5' end of the ml AchR mRNA and overlaps with the 3' end of the CMV promoter. The probe was added to samples of total cellular RNA isolated from vhml infected Vero cells 2-20 hr postinfection. The samples were allowed to hybridize, and then subjected to RNase A and RNase T digestion. Protected fragments were separated on a 8M urea/polyacrylamide gel and visualized by autoradiography. The expected protected fragment is 265 nt. Sequencing reactions, used as a marker, were performed using pBluescript SK 11 DNA templates. 80 that of a viral (3 gene. There were no protected R N A spec ies larger than the 265 nt band predicted by C M V promoter driven transcript ion, and therefore, all m l receptor m R N A s were der ived from the s a m e transcript ional initiator (Fig 5-1). This suggests that the C M V promoter and not a downstream viral promoter was driving m l receptor transcription. 5.2.2 L igand binding analys is To quantify m l receptor express ion in cel ls infected with the var ious recombinant v i ruses, l igand binding analys is with the muscar in ic antagonist, [ 3 H]N-methy l -scopolamine (NMS) was performed. N M S is a posit ively charged l ipophobic l igand which only detects receptors on the cel l sur face of intact cel ls (Galper et a l . , 1987; Nathanson, 1992). Rad io labe led N M S has the s a m e half-maximal saturat ion curve as nonradio labeled N M S , indicating that [ 3 H ] N M S is the biological equivalent to the nonradioact ive drug, and as such can be used to quantitate muscar in ic receptors (Yamamura and Snyder , 1974). E a c h [ 3 H ] N M S molecule interacts with a single receptor site, and therefore, binding directly reflects the number of receptor units. Mono layers of Vero cel ls were infected with either v h m l .1 , v h m l .2 or v h m l .3, and were assayed at var ious time points postinfection for the speci f ic binding of [ 3 H ] N M S to m l receptors. In all recombinant infected cel ls , m l receptors were first detectable on the cel l sur face at 6 hr postinfection (Fig. 5-2A). Receptor express ion from the ICP4 express ing recombinant, vhm1.1 was markedly lower than express ion from the ICP4-def ic ient recombinant v i ruses, vhm1.2 and vhm1.3. Vero cel ls infected with vhm1.1 reached a max imum receptor express ion of approximately 25 fmols per 1 0 6 cel ls by 12 hr postinfection, whereas vhm1.2 and vhm1.3 infected Vero cel ls did not obtained their max imum receptor levels of about 125 and 135 fmols per 1 0 6 ce l ls , respectively, until 20 hr postinfection (Fig. 5-2A). The vhs and ICP4-def ic ient recombinant, vhm1.3 demonstrated a smal l , but consistent increase of m l receptor express ion over the vhs express ing I C P 4 -deficient recombinant, vhm1.2. 81 hours postinfection Fig. 5-2. Quantification of surface muscarinic acetylcholine receptor expression from recombinant HSV-1 vectors using ligand binding assays. Vero cells (A) and E5 cells (B) were infected with either vhm1.1,vhm1.2 or vhm1.3, and were then tested at 6,10,12,16, 20 and 24 hours postinfection for the ability to selectively bind the radiolabeled muscarinic receptor antagonist, n-methyl-scopolamine ([3H]NMS). At the desired timepoint, infected cells were incubated at 37° for 1 hr inlnM [3H]NMS. Background counts were determined, both by ligand binding in mock infected cultures and by competative inhibition with 1uM atropine, and were subtracted from the values. Data are shown as mean ± SEM (n=4) with each experiment being performed in triplicate. Note the change in scale in figure A and B. 8 2 To determine if the more than five fold increase in m l receptor express ion seen in v h m l .2 and v h m l .3 versus v h m l .1 infected Vero cel ls was due to the absence of ICP4 express ion from the former two recombinant v i ruses, l igand binding a s s a y s were repeated in the ICP4-express ing Vero cel l line, E 5 . Receptor express ion in vhm1.2 and vhm1.3 infected E 5 cel ls was greatly reduced, and actual ly lower than vhm1.1 m l receptor express ion in E 5 cel ls (Fig. 5-2B). All infected E 5 cel ls demonstrated near max imum receptor levels by 12 hr postinfection. T h e s e results, together with the recombinant infected Vero cell data, suggest that ICP4 either directly or indirectly reduced m l receptor express ion from HSV-1 recombinant v i ruses. To a s s e s s whether the ICP4-assoc ia ted reduction of m l receptor express ion from HSV-1 recombinant v i ruses was a result of ICP4 binding to the potential ICP4 binding sites in the 5' noncoding region of the m l receptor gene, l igand binding a s s a y s were performed on Vero and E 5 cel ls infected with recombinant v i ruses deleted in the 5' noncoding region of the m l receptor gene (v 5'hm1.1 and v 5'hm1.2). Receptor express ion in Vero cel ls infected with v 5'hm1.1 and v 5'hm1.2 was even higher than in v h m l .2 and v h m l .3 infected Ve ro cel ls (Fig. 5-3A). The express ion of ICP4 in v 5'hm1.1 infected Vero cel ls did not result in lower receptor levels than those seen in the absence of ICP4 in v 5'hm1.2 infected Vero cel ls (Fig. 5-3A). E 5 cel ls infected with v 5'hm1.1 and v 5'hm1.2 a lso demonstrated high levels of m l receptor express ion ; receptor express ion from both of these recombinant v i ruses in E 5 cel ls was only reduced to approximately 8 5 % of that seen in Vero cel ls (Fig. 5-3B). Taken together, these results indicate that the ICP4-assoc ia ted repression of viral ly-directed m l receptor express ion was mediated by the 5' noncoding region of the m l receptor gene. The presence of potential ICP4 binding sites in this region strongly suggests that ICP4 directly binds to these si tes, caus ing downregulat ion of m l receptor gene transcript ion. 83 0 J ^ , , , 4 8 12 16 20 24 30 hr postinfection Fig. 5-3. Quantification of surface muscarinic acetylcholine receptor expression from a recombinant HSV-1 vector containing a ml AchR gene with a deleted 5' noncoding region. Vero cells (A) and E5 cells (B) were infected with either vhml .1, vhml .2, vhml .3, v8-5'hm1.1, or v8-5'hm1.2, and were then tested at 8,12, 20 and 24 hr postinfection for the ability to selectively bind [3H]NMS. Background counts were determined, both by ligand binding in mock infected cultures and by competitive inhibition withl u.M atropine. Data are shown as mean ± SEM (n = 3) with each experiment being performed in triplicate. Note the change in scale in A and B. 84 5.2.3 Binding affinity analys is To confirm that the m l receptors expressed from the recombinant v i ruses maintained their normal pharmacolog ica l propert ies, and that the [ 3 H ] N M S ligand bindings reflected the true number of m l receptors present on the sur face of infected cel ls, l igand binding kinetic studies were performed. Receptor numbers and binding affinity constant were est imated by Sca tchard analys is of [ 3 H ] N M S saturation curve data. A linear plot indicates that the l igand binds to a single receptor site and each site has an equal affinity to the l igand. The s lope is a direct measure of the affinity of the l igand to the receptor (slope = -1/KQ). The equil ibrium constant, KQ represents the concentrat ion of the l igand that half-maximally occup ies the receptor at equil ibrium, and is most commonly used to cite the affinity of the receptor (Hol lenberg and Cua t recasas , 1979; Klotz, 1982). The total number of receptor si tes present ( B m a x ) theoretically, can only be calculated at infinite concentrat ions of l igand, but experimental ly, can be obtained from the x intercept of the Sca tchard plot (Hol lenberg and Cua t recasas , 1979). Saturat ion curves were generated by incubating [ 3 H ] N M S concentrat ions, ranging from 10 to 500 pM with Vero cell monolayers infected with either vhm1.1 or v h m l .3 at 20 hr postinfection. Incubations were carr ied out for 90 min. at 37°C. Scatchard analys is of saturation curves of vhm1.1 and vhm1.3 infected Vero cel ls showed that [ 3 H ] N M S bound with high affinity to a s ingle c lass of binding sites present on the sur face of the infected cel ls (Fig. 5-4). The apparent KQ for v h m l .1 and vhm1.3 expressed receptors in infected Vero cel ls was 5.2 and 4.9 p M , respectively. T h e s e va lues reflected binding affinities that were higher than most publ ished affinities, but were well within the range of accep ted variation in antagonist binding affinities in different experimental sys tems (Hulme et a l . , 1990; Matsui et a l . , 1994). The derived B m a x va lues for v h m l .1 and v h m l .3 were 26.8 and 164.4 f m o l / 1 0 6 cel ls , which translated into approximately 3 x 1 0 5 and 1.8 x 1 0 6 receptors per cell exp ressed at 20 hr postinfection. 85 1 Fig. 5-4. Saturation curves and Scatchard analysis of ml muscarinic receptors expressed from recombinant HSV-1 vectors. Saturation analysis of [3H]NMS binding to vhml .1 infect (A) and vhml .3 infected (B) Vero cells was performed at 20 hrs postinfection. Ligand concentrations ranged from 10 to 500 pM in 2 ml PBS with 0.75 mM CaCI and 0.5 mM MgCI (PBS+) per 60 mm dish. The infected cells were incubated with ligand for 1.5 hr at 37°C. Experiments were performed in triplicate (n = 2). Data were transformed using the method of Scatchard, and estimates of KD and Bmax obtained using unweighted linear regression analysis of the transformed data. 8 6 5.2.4 Compar ison of [ 3 H ] N M S and [ 3 H ] Q N B l igand binding It has been reported previously that [ 3 H ] Q N B is able to diffuse through, intact cel l membranes and bind to intravesicular and intracellular receptors as well as cel l sur face receptors; whereas [ 3 H ] N M S only binds receptors on the cell sur face (Galper et a l . , 1982; Nanthason et a l . , 1987). Both l igands have similar pH (7.4-7.6) and ionic concentrat ion opt imums, and therefore can be a s s a y e d under the s a m e buffer condit ions. [ 3 H ] Q N B , however, is a slowly dissociat ing l igand and theoretical ly requires incubation per iods of extreme length to reach equi l ibr ium. The commonly used incubation condit ions for [ 3 H ] Q N B are for 90 min at 37°C (Nathanson et a l . , 1992). T h e s e condit ions represent a compromise between obtaining complete equil ibrium of [ 3 H ] Q N B , and preventing degradat ion of the receptor; fortunately, incubations of 37°C for 90 min are a lso appropriate for [ 3 H ] N M S binding. The binding of the muscar in ic antagonists [ 3 H ] Q N B and [ 3 H ] N M S to intact cel ls infected with the recombinant vhm1.3 was compared by incubating infected monolayers with each l igand for 90 min at 37°C. Fol lowing the incubat ions, the monolayers were washed three t imes for 10 min with ice-cold P B S , lysed, and ana lyzed by liquid scintil lation spect roscopy. The speci f ic binding of both l igands was saturable, and demonstrated a single apparent receptor affinity c lass (data not shown). At l igand concentrat ions of 1 n M , approximately 8 0 % of [ 3 H ] N M S and 6 0 % of [ 3 H ] Q N B binding were speci f ic as measured by d isp lacement with 1 uM atropine (data not shown). A compar ison of [ 3 H ] N M S versus [ 3 H ] Q N B binding, using l igand concentrat ions of 1 n M , revealed that at 12 hr postinfect ion, approximately 90 fmols of [ 3 H ] N M S bound specif ical ly to the m l receptors of 1 0 6 infected Vero cel ls as compared to 285 fmol of [ 3 H ] Q N B per 1 0 6 cell (Fig. 5-5). Assum ing that [ 3 H ] Q N B is recogniz ing intracellular and intravesicular m l receptors as well as surface receptors; these results suggest that approximately 30 -40% of the total number of m l receptors expressed from v h m l .3 were present on the cel l sur face. 87 co o CO © 400 300 • mock • vhm1.3 e o E 200 100 • [3H]QNB [3HJNMS Fig. 5-5. Quantification and comparison of surface versus intracellular ml muscarinic receptors in recombinant HSV-1 vector infected Vero cells. Ligand binding assays were performed on vhml .3 infected Vero cells at 20 hr Dostinfection. Infected cells were incubated with either 1nM [3H]NMS or 1 nM 3H]quinuclidinyl benzilate ([3H]QNB) in PBS with 0.75 mM CaCI and 0.5 mM VlgCI at 37°C for 90 min. Background was determined by ligand binding in mock infected cells and is shown in the figure (mock). Data are shown as mean ± SEM (n =3) with each experiment being performed in triplicate. 88 5.2.5 Funct ional activity Examinat ions of s ignal t ransduct ion and effector mechan isms coup led to stimulation of m l receptors in stably t ransformed mammal ian cel ls have demonstrated that m l receptors couple to PTX- insens i t ive G proteins (Gq /n ) to st imulate phosphoinosi t ide hydrolysis (Bonner et a l . , 1987; Brann et a l . , 1987; Pera l ta et a l . , 1988; Askenaz i et a l . , 1988). In an effort to measure the physiological respons iveness of virally exp ressed m l receptors, agonist-st imulated PI turnover was a s s e s s e d in recombinant infected cel ls . IP3 accumulat ion is a convenient m e a n s of measur ing functional activity s ince radiolabeled IP3 binding proteins are now avai lable and enable sensi t ive detection of IP3 (Palmer et a l . , 1989). Recyc l ing of IP3 v ia the inositol phosphate pathway can be b locked by treating cel ls with lithium chlor ide just prior to receptor stimulation, and IP3 accumulat ion for the entire duration of stimulation can be determined. At 20 hr postinfection, vhm1.3 infected, d120 and mock infected Vero cel ls were treated with 10 m M lithium chlor ide for 30 min, and then incubated with the m l receptor agonist oxotremorine at 10 pM in M E M for one hour in the p resence or absence of P Z P . The production of IP3 in response to oxotremorine stimulation was then determined by isolating organophosphates using tr ichloroacetic acid extraction and measur ing IP3 accumulat ion using an A m e r s h a m D-myo-inositol 1,4,5-triphosphate [ 3H] assay sys tem, v h m l .3 infected cel ls demonstrated an approximately 5-fold increase in IP3 accumulat ion over basa l levels in response to saturating concentrat ions of oxotremorine (Fig. 5-6). Th is response in vhm1.3 infected Vero cel ls was absent without agonist stimulation and was inhibited by the m l antagonist, P Z P . Vero cel ls infected with the parental d120 virus showed no increase in IP3 accumulat ion, support ing the conc lus ion that IP3 production was a result of m l receptor express ion and not a virally induced response (Fig. 5-6). 5.3 Discussion 89 CD CJ CD O A + PZP B + PZP C + PZP + oxotremorine C + PZP no agonist Fig. 5-6. Functional activity of ml muscarinic acetylcholine receptors expressed from recombinant HSV-1 vectors. At 12 hr postinfection, mock (A), d120 (B) and vhm1.3 (C) infected Vero cells were treated with 10 mM lithium chloride for 30 min at 37°C, prior to the addition of 10 uM oxotremorine. Agonist stimulation was carried out in DMEM at 37°C for 1 hr in the absence or presence of PZP. IP3 accumulation in vhml .3 infected Vero cells in the absence of oxotremorine stimulation is shown by C, no agonist. Data are shown as mean ± SEM (n =3) with each experiment being performed in triplicate. 9 0 In all of the HSV-1 recombinant v i ruses, express ion of the m l receptor gene receptor gene was driven by the immediate-ear ly C M V promoter from within the U|_23 locus of the HSV-1 genome. Ana lys is of m l receptor transcripts from an HSV-1 recombinant showed that transcripts in infected Vero cel ls were first detectable at 4 hr postinfection and reached peak levels by 8 hr postinfection. Th is express ion pattern is ana logous to the p gene express ion pattern of its inserted locus. T h e s e results are consistent with the f indings of Smibert and Smi ley(1990) which demonstrated a p gene express ion pattern for the p globin gene from its endogenous promoter from within the U|_23 locus; and support the hypothesis that temporal regulation from the HSV-1 genome is inf luenced more by posit ional effects, perhaps due to D N A packaging and structure, than by promoter specif icity (Smibert and Smi ley, 1990, Smibert et a l . , 1992). Ce l l sur face m l receptors were not detectable in any of the recombinant infected cel ls until 6 hr postinfection. A minimum of 0.75 fmols of surface m l receptors was required before l igand binding analys is with [ 3 H ] N M S could detect m l receptor express ion levels in intact cel ls above background. After 6 hr postinfection, dif ferences in the levels of sur face m l receptor express ion from the recombinant v i ruses were substant ia l . T h e s e dif ferences were most pronounced in regards to effects of the HSV-1 major regulatory protein, ICP4. The express ion of ICP4 from a viral genome or from a chromosomal site resulted in a more than 5-fold dec rease in sur face m l receptor express ion from the HSV-1 recombinant v i ruses. In the p resence of ICP4 , max imum surface m l receptor levels were reached by 12 hr postinfect ion; whereas , in the absence of ICP4, receptor express ion cont inued to increase until late in infection. Th is downregulat ion of m l receptor express ion in the p resence of ICP4, is simi lar to ICP4 mediated downregulat ion of HSV-1 a genes . ICP4 represses a gene express ion by binding to the c o n s e n s u s sequence 5 ' - A T C G T C - 3 ' near the a gene promoters and associat ing with basa l transcription factors to terminate transcription. The presence of three potential ICP4 binding sites in the 5' 91 noncoding region of the m l receptor gene made this a promising mechan ism for ICP4-assoc ia ted down regulation of m l receptor express ion . Express ion of m l receptors from recombinant v i ruses deleted in the 5' noncoding region of the m l receptor gene did not demonstrate ICP4-assoc ia ted downregulat ion. The ICP4-express ing and the ICP4-def ic ient recombinant v i ruses bear ing the 5' noncoding region deletion expressed similar amounts of m l receptors. ICP4 express ion from a chromosomal site resulted in only a 1 5 % dec rease in express ion from both of these recombinant v i ruses. In infected Vero ce l ls , receptor express ion from these recombinant v i ruses was 7-fold greater than the ICP4-express ing recombinant, vhm1.1 and about 1.5-fold greater than the ICP4-def ic ient recombinant v i ruses, v h m l .2 and v h m l .3. The increase of receptor express ion over the ICP4-def ic ient recombinant v i ruses bear ing the wildtype 5' noncoding sequence may be due to either the trace amounts of ICP4 found to be packaged in the vir ions during propagat ion of these recombinant v i ruses in E 5 cel ls , or the presence of repressor sites for other regulatory proteins within the 5' noncoding region of the m l receptor gene. Never the less, l igand binding data from these recombinant v i ruses indicated that ICP4 repression of m l receptor express ion is mediated by binding si tes in the gene 's 5' noncod ing region. The absence of vhs express ion in the HSV-1 recombinant virus, vhm1.2 resulted in a smal l increase in viral-directed m l receptor express ion . The effects of vhs on host protein synthesis are not detectable using [ 3 5 S]meth ion ine labeling fol lowed by S D S - P A G E or T C A protein precipitation ana lys is in cel ls infected with low numbers of infectious particles (Kwong and Frenkle, 1989). In all exper iments, inocula of 3 pfu/cell were used to ensure the infection of every cel l without the addition of excess viral recombinant v i ruses. Despi te the low number of infectious particles used in the exper iments, the vhs-express ing recombinant vhm1.2 showed a slight decrease of approximately 5 % in receptor express ion compared to the vhs-deficient recombinant, vhm1.3. T h e s e results suggest that vhs does not enhance the viral-directed express ion of m l receptors, but instead slightly dec reases express ion levels. The elimination of vhs from HSV-1 recombinant vectors, 92 therefore, does not appear to reduce optimal express ion of gene inserts, and aids in reducing potential negative viral effects on host cel l metabol ism. It should be noted that receptor express ion levels for the recombinant v i ruses vhm1.1 , vhm1.2 and vhm1.3 in the t imecourses performed in parallel with the recombinant v i ruses v 5'hm1.1 and v 5 'hm1.2 (Fig. 5-3) were lower than the original t imecourse data for these recombinant v i ruses (Fig. 5-2). Th is difference was attributed to loss of specif ic activity of the [ 3 H ] N M S stock during storage time between the sets of exper iments. However, the relative dif ferences in receptor express ion between recombinant v i ruses were a lways consistent, as indicated by the smal l S E M values. The receptor levels seen in the original t imecourse exper iments in figure 4-2 are consistent with receptor levels as determined by kinetic analys is of the virally expressed m l receptors. Sca tchard analys is of saturation curves performed on vhm1.1 and vhm1.3 infected Vero cel ls, demonstrated the expected single c lass of binding sites of [ 3 H ] N M S for m l receptors. The apparent KD va lues for v h m l .1 and v h m l .3 expressed m l receptors in infected Vero cel ls were 5.2 and 4.9 p M , respectively. Pub l ished KQ va lues for the mammal ian m l receptor vary greatly between experimental sys tems; in fact, more then 4-fold dif ferences in affinity constants have been reported (reviewed by Buckley, 1990 and Caul f ie ld , 1993). The calcu lated KD va lues in figure 5-4 indicated binding affinities that were within the reported range, but were higher than most publ ished binding affinities. B e c a u s e of the high level of express ion from the recombinant v i ruses these results may reflect a more reliable measure of binding affinity. The total number of receptor si tes present on v h m l .1 and v h m l .3 infected Vero cel ls as determined by Scatchard analys is were 26.8 and 164.4 fmo l /10 6 cel ls, respectively. T h e s e va lues translated into approximately 0.3 x 10^ receptors pervhm1.1 infected Vero cel l , and 1.8 x 1 0 6 receptors per vhm1.3 infected Vero cel l , during max imum levels of express ion. T h e s e va lues, together with the relative ratios of m l receptor express ion derived from l igand binding t imecourse data, 93 enabled the estimation of 2.9 x 1 0 6 receptors/cel l present in v 5'hm1.1 infected Vero cel ls at max imum express ion levels. Dif ferences in m l receptor express ion from the HSV-1 recombinant v i ruses were determined by measur ing receptors present on infected cel l sur faces, s ince this population of receptors most c losely represents the number of functional receptors. The proportion of sur face receptors to intracellular receptors present in recombinant infected cel ls was est imated by compar ing l igand binding a s s a y s using the hydrophil ic [ 3 H ] N M S with those using the lipophilic muscar in ic antagonist, [ 3 H]QNB. Unlike [ 3 H ] N M S , [ 3 H ] Q N B is able to diffuse through cell membranes and bind to intracellular and intravesicular m l receptors (Yamamura and Snyder , 1974). Ga lper et a l . (1982) demonstrated that [ 3 H ] Q N B detected two populat ions of muscar in ic receptors in intact cel ls with different affinities for the l igand; a population of receptors that bound the l igand at high affinity and a population that bound the l igand with a lower affinity [ 3 H ] Q N B . The presence of the lower affinity receptor populat ion was dependent on the p resence of agonist, and was bel ieved to reflect receptors that had been endocy tosed fol lowing receptor stimulation with agonist. There was no muscar in ic agonist present during the l igand binding a s s a y s , and therefore, the a s s a y s reflected one homogenous population of m l receptors. Compar i son of [ 3 H ] Q N B and [ 3 H ] N M S l igand binding data provided an est imated proportion of surface to total m l receptors of 30-40%. The functional activity of the sur face m l receptor populat ion expressed from the HSV-1 recombinant v i ruses was determined by measur ing phosphoinosi to l hydrolysis following receptor stimulation with oxotremorine. Oxotremor ine is a partial agonist for muscar in ic receptors. It st imulates a more potent response from m l receptors than acetylchol ine, but a less potent response than carbacho l . Carbacho l was not used , because high eff icacy agonists are thought to be more prone to nonspeci f ic activation of multiple G-proteins in receptor overexpress ion sys tems (Matesic et al . , 1991; Kenak in , 1995a & 1995b). S a v a r e s e et a l . (1992) showed that a stably transfected C H O cell c lone express ing m l receptors demonstrated a 4.5 fold maximal increase in PI hydrolysis over basa l levels in 94 response to saturating levels of oxotremorine. In Vero cel ls infected with the recombinant, vhm1.3 stimulation with oxotremorine resulted in a 5-fold accumulat ion of IP3 over basal levels. The detected IP3 accumulat ion was a true reflection of m l receptor function and not a reflection of viral effects, s ince the accumulat ion did not occur in the absence of oxotremorine or in cel ls infected with the parental virus, d120, and was effectively b locked by the addition of the m l speci f ic agonist, P Z P . Character izat ion of m l receptor express ion from HSV-1 recombinant v i ruses in Vero cel ls showed that v i ra l ly-expressed receptors maintained their pharmacologica l properties and physiological activity. The amount of m l receptor express ion was dependent upon the viral backbone from which it was exp ressed . The generated ser ies of HSV-1 recombinant v i ruses demonstrated increasing m l receptor express ion levels in the fol lowing order: vhm1.1 < vhm1.2 < vhm1.3 < v 5'hm1.1 v 5 'hm1.2. m l receptor gene express ion was found to be downregulated by the presence of ICP4 , most likely v ia binding to repressor sites in the m l receptor gene 's 5' noncoding region. The absence of vhs express ion was actually shown to confer a smal l advantage in receptor express ion . The recombinant v h m l .3 was an attractive candidate further studies of m l receptor express ion from HSV-1 recombinant v i ruses, s ince it was nonrepl icat ive, deficient in vhs express ion, expressed moderate levels of m l receptors and its expressed receptor population was shown to elicit a functional response in the host cel l . B a s e d on these propert ies, vhm1.3 was chosen to examine virus-directed express ion of m l receptor express ion and v i ra l -associated effects in primary cortical neuron cultures. 9 5 6.0 Recombinant herpesvirus vector infection of primary cortical neuron cultures 6.1 Introduction HSV-1 is a neurotropic virus with var ious biological features that make it attractive for development as an efficient gene transfer sys tem into neurons. H S V -1 repl icates to high titers, infects postmitotic cel ls , accepts large inserts of foreign D N A (Knipe et a l . , 1978), and estab l ishes latency in neurons as an ep isomal e lement within the neuron's nucleus (Cook et a l . , 19741; S tevens et a l . , 1989). HSV-1 recombinant vectors express ing the marker gene p-galactos idase have been used to successfu l ly demonstrate efficient gene delivery into neurons (Dobson et a l . , 1990; Johnson et al . , 1992; Fink et a l . , 1992 &1996). The exogenous express ion of functional neuronal speci f ic proteins has not been well character ized. In this work, a repl ication-defective HSV-1 recombinant express ing m l muscar in ic receptors was used to examine the express ion and function of these neurotransmitter receptors in primary cortical neuron cultures. Pr imary t issue culture enab les an in vitro cel lular approach for the study of HSV-1 neuron infection. This environment permits one to control the cell number, to uniformly infect all cel ls s imul taneously and to observe effects on the entire neuron, including its extensive p rocesses . In genera l , primary cortical neuron cultures appear to require more stringent growth requirements than other cel ls. However , under appropriate condi t ions, primary cortical neuron cultures grow and display features of mature cortical neurons. Morphological studies of mature cortical neuron cultures suggest that these neurons are very similar to their counterparts in the mature cortex in that they develop neuronal outgrowths, form synapt ic connect ions and exhibit myelenat ion (Yavin and Yav in , 1977; Dichter, 1978; Swa iman et a l . , 1982; Kr iegstein and Dichter, 1983; Kos ik and F inch , 1987). 96 Exper iments utilizing primary cortical cultures are affected by developmenta l changes of these neurons, and are limited by the culture's short l i fespan. It takes almost seven days for neuronal outgrowths to form and establ ish synapses , and after two weeks in culture, the neurons begin to deteriorate (Dudai and Yav in , 1978; Swa iman et a l . , 1982; Kos ik and F inch, 1987). Therefore, exper iments involving assessmen t of neuronal function need to be performed between the 7th and 14th d of culture growth. Detect ion of virally exp ressed m l receptors in primary neuronal cultures is compl icated by the p resence of multiple subtypes of endogenous muscar in ic receptors. Pr imary cortical neuron cultures have been shown to develop functionally active chol inergic synapses (Eva et a l . , 1987; A lho et a l . , 1988). These cultures p o s s e s s acety lchol ine-synthesiz ing neurons and neurons with an array of muscar in ic receptors coupled to var ious effector sys tems. The most abundant muscar in ic receptors in cortical neurons are m l and m3 receptors, but m2, m4 and m5 receptors are a lso present in decreas ing proportions (Bonner et a l . , 1987; Peral ta et a l . , 1988; Fukuda et a l , 1988). The express ion of muscar in ic receptors appears to coinc ide with synapse formation and maturation and so they are detectable approximately 1 week after plating. Their express ion then increases over the next week until their numbers resemble those of mature cortical neurons (Dudai and Yav in , 1978). In this chapter, primary cortical neuron cultures at var ious developmental s tages were infected with an HSV-1 recombinant, and were a s s e s s e d for m l receptor express ion and function. Muscar in ic receptor express ion levels were determined using l igand binding a s s a y s with [ 3H] N-methy l -scopolamine, and functional activity was determined by agonist-st imulated IP3 product ion. To differentiate m l receptors from other muscar in ic subtypes, p i renzepine was used as a specif ic competitor for m l receptors in both l igand binding a s s a y s and agonist-st imulated functional studies (Peral ta, 1987b; Hulme et a l . , 1990). The proportion of exogenous m l receptors exp ressed from the HSV-1 recombinant v i ruses to endogenous m l receptors was est imated by compar ing m l receptor 97 express ion and function in recombinant infected and mock infected cultures. A s a control, the parental ICP4-def ic ient virus d120 was used to infect cultures and a s s e s s for v i ra l -associated effects on endogenous m l receptor express ion and function (DeLuca , 1985). A lso , infection eff iciency of HSV-1 recombinant v i ruses in these cultures was establ ished using immunof luorescence techniques against HSV-1 proteins. 6.2 Results 6.2.1 Immunof luoresence study HSV-1 v i ruses have been shown to infect primary cortical neuron cultures, at both early and late developmental s tages (Lowenstein et a l . , 1994). However , the infection and transduct ion eff iciencies of HSV-1 v i ruses in these neurons has been var iable. Neuronal cel ls were found to express HSV-1 genes at a lower eff iciency than glial cel ls. It is unclear whether this lower eff iciency is due to dec reased infection or dec reased viral-directed gene express ion in neurons (Kemp et a l . , 1990; Lowenste in et a l . , 1994). Indirect immunof luorescence was used to establ ish both percentage of neurons in the primary cortical neuron cultures and infection efficiency of the HSV-1 recombinant, v h m l .3 in these cel ls . Ten-day-o ld primary cortical neuron cultures were inoculated with vhm1.3 at a MOI of 3 pfu/cell, and examined for the percentage of HSV-1 infected neurons at 20 hr postinfection. The anti-neuron speci f ic eno lase antibody was used to identify neurons, and the anti- ICPO antibody was used to detect the immediate-ear ly protein, ICPO which is expressed abundantly in vhm1.3 infected cel ls . Greater than 8 5 % of the cel ls stained positive for neuron speci f ic eno lase , and of these about 7 5 % a lso stained posit ive for HSV-1 ICPO (Fig. 6-1). The majority of the remaining non-neuronal cel ls in the cultures, bel ieved to be glial cel ls , were infected. In separate exper iments, viral ly-directed p-galactos idase activity was detected in about 9 0 % of cel ls, which a lso suggests that the majority of neuronal 98 Fig. 6-1. Recombinant HSV-1 vector infection efficiency of neurons. The efficiency of recombinant HSV-1 vector infection was established by indirect immunofluorescence using anti-neuron specific enolase (NSE) antibody to identify neurons, and anti-ICPO antibody, which detects an immediate early HSV protein. Primary cortical neurons were plated on PDL coated coverslips. Ten-day-old cultures were infected with vhml .3, and at 20 hr postinfection, were fixed in 4% paraformaldehyde in PBS. Cells were permabilized with 0.1% Triton X in PBS for 10 min, and incubated with both anti-NSE and anti-ICPO antibodies. In the immunofluorescence micrograph on the left, HSV-1 infected cells, positive for ICPO are seen as green and neurons, positive for NSE are seen as red. The phase-contrast image of the same cells is shown on the right. cel ls and most non-neuronal cel ls in the culture were infected with this virus (Fig.6-2). Due to the lack of good ant i -muscar inic receptor ant ibodies, populat ions of neurons express ing m l receptors or any of the other muscar in ic subtypes in the primary cortical cultures could not be character ized using immunof luorescence studies. 6.2.2 L igand binding analys is To quantify both endogenous muscar in ic and viral-directed m l receptor express ion in primary cortical neuron cultures at different developmenta l s tages, 7, 9, 10 and 14-day-old cultures were mock infected, infected with control virus or vhm1.3 , and a s s a y e d for muscar in ic receptor express ion at 20 hr postinfection. Endogenous muscar in ic receptor express ion, as seen in the mock infected cultures, was very low in the immature 7 to 9-day-old cultures. L igand binding a s s a y s revealed only about 3.0 fmols of bound [ 3 H ] N M S per 30 mm dish in these cultures. By day 10 to 11 these cultures expressed almost 8-fold more muscar in ic receptors than the earlier cultures, and these levels remained constant in the 14 to 15-day old cultures (Fig. 6-3A). Viral-directed m l receptor express ion var ied greatly within different developmental s tages; levels increased steadily from 11 to 80 fmol bound [ 3 H ] N M S per 30 mm dish in day 7 to 10 infected cultures, but decreas ing back to moderate levels in day 14 infected cultures (Fig. 6-3A). Infection with the control virus, d120 had a negat ive effect on endogenous muscar in ic receptor express ion, general ly decreas ing express ion almost 0.5-fold. Ten-day-o ld cultures were chosen for further studies, s ince these cultures demonstrated an establ ished endogenous muscar in ic receptor populat ion, and showed the highest increase in receptor express ion fol lowing infection with the recombinant virus. Ten-day-o ld cortical cultures were a s s e s s e d for m l receptor express ion from 12 to 48 hr postinfection following infection with either control virus or v h m l .3. Muscar in ic receptor express ion in vhm1.3 infected cultures increased from approximately 60 fmol of bound [ 3 H ] N M S per 30 mm dish at 12 hr 100 Fig. 6-2. I'.-Galactosidase staining of recombinant HSV-1 infected primary cortical neuron cultures. Ton-day-old primary cortical neuron cultures were infected with vhml .3 and at 24 hr postinfection stained for f.-galactosidaso activity. The figure on the left was taken at a magnfication of 40X and the figure on the right at a magnficalion of I OX. 80 • E E o co =5- 60-o E T3 C V) I—1 X CO 40 . 20 . a b c Day 7 a b c a b c a b c Day 9 Day 10 Day 14 XI E E o co i2 o E »*— •o c 3 o CO 2 §• 20 co 0 80 60 40 B I b c 12 hpi 20 hpi 48 hpi Fig. 6-3. Timecourse of surface muscarinic acetylcholine receptor expression from a recombinant HSV-1 vector in primary cortical neuron cultures. (A) cortical cultures were mock infected (a), infected with d120 (b), or vhm1.3(c) at 7, 9,10 or 14 days after plating, and were assayed for muscarinic receptor expression at 20 hr postinifection (n =3). (B) ten-day-old cortical cultures were infected with either the control virus, d120 (b) or vhml .3 (d), and assayed for receptor expression at 12, 20 and 48 hr post-infection (n =2). In both figures, background was determined by competitive inhibition with 1 mM atropine and was subtracted from the above values. All experiments were done in triplicate, and data are shown as mean ± SEM. 102 postinfection to more than 80 fmols at 20 hr postinfection. The cultures expressed approximately the same number of receptors from 20 to 48 hr postinfection (Fig. 6-3B). Cul tures infected with control virus showed a slight increase in receptor express ion levels from 12 to 20 hr postinfection, suggest ing that endogenous muscar in ic receptor express ion had actually increased during this t ime f rame. T h e s e results were verified by examining muscar in ic receptor express ion in mock, d120, vhm1.1 and vhm1.3 cultures at 12 hr postinfection (Fig. 6-4A). At 12 hr postinfection, ten-day-old mock infected cultures expressed about 7 5 % of the number of receptors detected at 20 hr postinfection. Cul tures infected with control virus exp ressed almost 2 0 % fewer receptors than with mock infections at 12 hr postinfection. It should be noted that cultures infected with the recombinant v h m l .1 showed only a smal l (<2-fold) increase in receptor express ion when compared to mock infected cultures at 12 hr postinfection, and this recombinant was not used in further studies examining viral-directed m l receptor express ion and funct ion. To differentiate m l receptors from other muscar in ic subtypes in the l igand binding a s s a y s , P Z P was used as a speci f ic competitor for m l receptors. Mock, d120 and vhm1.3 infected primary cortical neuron cultures were a s s a y e d for [ 3 H ] N M S binding in the presence and absence of P Z P at 20 hr postinfect ion. Approximately 7 5 % of l igand binding was inhibited by P Z P in mock infected cultures, indicating that about 2 5 % of the endogenous muscar in ic receptors were subtypes other than m l . Greater than 9 0 % of the [ 3 H ] N M S binding to v h m l .3 infected cel ls was competed by P Z P , suggest ing that less than 1 0 % of the muscar in ic receptors exp ressed in these infected cel ls were subtypes other than m l (Fig. 6-4B). L e s s than half the amount of other endogenous muscar in ic subtypes were detected in the vhm1.3 infected cultures than in mock infected culture. Taken together, these results indicated that the proportion of exogenous m l receptors expressed from the HSV-1 recombinant to endogenous m l receptors in mock infected cultures was greater than 4-fold fol lowing infection of ten-day-old cultures at 20 hr postinfection. 103 •o E E o CD T3 C o CO X <2-50 25 I LL w E E o co iif o | C o C/) X CO 80 60 40 B X + PZP b + PZP c + PZP Fig. 6-4. Comparison of surface ml receptor expression in 10 day-old primary cortical neuron cultures. (A) cortical cultures were mock infected (a), infected with d120 (b), vhm1.3 (c) or vhm1.1(d), and were assayed for ml receptor expression at 12 hr postinifection. Background was determined by competitive inhibition with 1 mM atropine and was subtracted from the above values (n=4). (B) cortical cultures were either mock infected (a), infected with d120 (b), or vhm1.3 (c), and incubated with [3H]NMS with or without PZP at 20 hr postinfection (n=2). All experiments were done in triplicate, and data are shown as mean ± SEM. 104 6.2.3 Funct ional activity To determine if the overexpress ion of m l receptors from an HSV-1 recombinant in primary cortical neuron cultures resulted in increased activity of effector mechan isms coupled to stimulation of m l receptors, recombinant infected cultures were tested for activation of phosphoinosi t ide hydrolysis. Mock , d120 and vhm1.3 infected primary cortical neuron cultures were a s s a y e d for IP3 accumulat ion fol lowing stimulation with oxotremorine at 12 hr postinfect ion. Cul tures were tested at two different developmenta l s tages, seven and ten-days-old. Seven-day-o ld cultures had very low basa l IP3 levels that were almost 10-fold lower than those of ten-day-old cultures (Fig. 6-5A). St imulat ion with oxotremorine resulted in only a 0.5-fold increase in IP3 production over basa l levels in both mock and vhm1.3 infected seven-day-o ld cultures; whereas , in ten-day-old cultures, a 1-fold increase was seen in mock infected cultures, and more than a 2.5-fold increase in vhm1.3 infected cul tures (Fig. 6-5). In both seven and ten-day-old cultures, infection with control virus resulted in lower basa l IP3 levels, but the relative increase in IP3 accumulat ion fol lowing agonist stimulation was similar to mock infected cultures. These results indicated that the effector mechan isms coup led to the stimulation of muscar in ic receptors were not well deve loped in seven-day-o ld cultures. However , in ten-day-old cultures virally expressed m l receptors were able to interact with host cel l effector mechan isms, and were able to induce an increase in m l receptor mediated functional activity. To differentiate m l receptor mediated IP3 production from that induced by other endogenous subtypes, ie. m3 or m5, P Z P competi t ion of oxotremorine-st imulated IP3 production was determined. In ten-day-old cultures, P Z P blocked 9 5 % and 1 1 5 % of oxotremorine stimulated IP3 product ion in mock infected cultures and vhm1.3 infected cultures, respect ively (Fig. 6-5B). The fact that the presence of P Z P resulted in IP3 levels lower than that of basa l levels in v h m l .3 infected cultures sugges ted that P Z P , b locked not only oxotremorine st imulation, but a lso b locked endogenous acetylchol ine stimulation which contributed to basa l IP3 production. T h e s e findings were in agreement with those from P Z P competit ion of 105 co co a b c a b c a b c w 5 E 4 o CO 3 co 2 no agonist agonist agonist + PZP a b c a b c a b c no agonist agonist agonist + PZP Fig. 6-5. Functional activity of ml receptors expressed from a recombinant HSV-1 vectors in primary cortical neuron cultures. Seven day-old (A) and ten day-old (B) cortical cultures were mock infected (a), infected with d120 (b), or vhm1.3(c), and at 12 hr postinfection, were treated with 10 mM lithium chloride for 30 min at 37°C, prior to the addition of 10 uM oxotremorine. Agonist stimulation was carried out in DMEM at 37°C for 1 hr in the absence or presence of PZP. Data are shown as mean ± SEM with all experiments being preformed in triplicate (A, n=2) (B, n=3). 106 l igand binding assay , which sugges ted that other muscar in ic subtypes are downregulated in vhm1.3 infected primary cortical cultures. 6.2.4 Cytotoxic effects Vi ra l -associated cytotoxic effects were a s s e s s e d in primary cortical neuron cultures infected at seven-days old with the recombinant vhm1.3 at 12, 20, 48 and 72 hr postinfection. Ce l l viability at each time point postinfection was determined using an assay in which ca lce in A M detected living cel ls and ethidium homodimer detected dead cel ls. At 12 and 20 hr postinfection, both mock infected and v h m l .3 infected cultures were found to be more than 9 5 % viable; however, at 48 hr postinfection 9 5 % of mock infected cel ls remained viable, but viability of vhm1.3 infected cultures was reduced to 7 5 % . By 72 hr postinfection, v h m l .3 infected cultures were less than 5 0 % viable, while mock infected cel ls were still 9 5 % viable. Pr imary cortical neuron cultures infected with vhm1.3 maintained normal neuronal morphological features, which were indist inguishable from uninfected cultures for more than 24 hr postinfection (Fig. 6-6B). Morpholog ica l changes observed in primary cortical neuron cultures infected with the HSV-1 recombinant were first apparent at 48 hr postinfection. In these cultures, only subtle changes to the cellular p rocesses were evident. P r o c e s s e s appeared to have increased cytoplasmic blebbing and fewer contacts with other cel ls (Fig. 6-6C). At 72 hr postinfection the cel ls were pyknotic and cel lular p rocesses were almost completely degenerated (Fig. 6-6D). The t imecourses of v i ra l -assoc ia ted cytopathology indicated by these observat ions, together with the results of the viability assay , are in agreement with other studies examin ing ICP4-def ic ient recombinant infection of neuronal cultures (Johnson et a l . , 1992; Lowenste in et a l . , 1994). 6.3 Discussion 107 Fig. 6-6. Morphology changes associated with recombinant HSV-1 vector infection. Seven-day-old primary cortical neuron cultures were either mock infected (A) or vhm1.3 infected, and observed at 24 (B), 48 (C) and 72 (D) hr postinfection. Mock infected culture (A) is shown at 72 hr postinfection. The above images were photographed with phase-contrast microscopy. 108 The aim of this work was to character ize primary cortical neuron cultures infected with an HSV-1 recombinant express ing m l receptors. The HSV-1 recombinant demonstrated high eff iciency of infection in these cultures. Immunofluorescent studies demonstrated that 9 0 % of the cultures were infected with the recombinant fol lowing inoculation with 3 pfu/ cel l , and 7 5 % of these infected cel ls were neurons. Typical ly, about 9 0 % of cel ls in primary cortical neuron cultures differentiate into neurons (Ghosh and Greenberg , 1995). In our cultures, approximately 1 5 % of the cel ls were non-neuronal , and 100% of these cel ls appeared to be infected. Therefore, the non-neuronal cel ls , most of which morphological ly resembled glial cel ls , appear to be more suscept ib le to HSV-1 infection. T h e s e findings are in accordance with other studies demonstrat ing higher H S V infection eff ic iencies in glial cel ls than neurons (Lowenstein et a l . , 1994). Examinat ion of virally exp ressed m l receptors in neurons was made possib le by the purity of the primary cortical neurons cultures. In all subsequent studies, the results were der ived 7 5 % from infected neurons, 1 5 % from uninfected neurons, and 1 5 % from infected non-neuronal cel ls . Sur face muscar in ic receptor express ion in uninfected and infected primary cortical neuron cultures was determined by l igand binding studies using [ 3 H ] N M S . Overal l receptor express ion was determined for the entire culture, and levels were reported as specif ic binding per 30 mm dish. It was impossib le to translate l igand binding data to receptor express ion per cel l , s ince primary cort ical neuron cultures are heterogenous, with subpopulat ions of both neurons and glial cel ls express ing muscar in ic receptors. P Z P competit ion of [ 3 H ] N M S binding sugges ted that almost 7 5 % of endogenous ly expressed muscar in ic receptors in these cultures were of the m l subtype. Endogenous express ion of sur face muscar in ic receptors var ied with the developmental age of the cultures. Few endogenous receptors were detected in cultures less than ten-days-old; however, from d 10 to d 11, express ion levels increased almost 10-fold. After this developmental per iod, cultures appear to maintain this level of endogenous muscar in ic receptors. Th is t imecourse of muscar in ic receptor express ion in primary cort ical neuron cultures was consistent with the f indings of Dudai and Yav in (1978). 109 Exogenous m l receptor express ion from the HSV-1 recombinant virus was also affected by the developmental age of the cultures. Receptor express ion from the recombinant increased steadily in infected day seven to d 10 cultures. Max imum viral-directed express ion was noted in cultures infected on day ten; at this developmental stage, vhm1.3 infected cultures exp ressed almost 4-fold more receptors than mock infected cultures. In these cultures, almost 9 5 % of the muscar in ic receptors detected were of the m l subtype, indicating a dec rease in the amount of other endogenous ly exp ressed subtypes. Cul tures infected with vhm1.3 on day 14 demonstrated only moderate express ion levels that were less than half of those seen in day ten cultures; however, endogenous muscar in ic receptor levels in cultures mock infected on day 14 were similar to those of d 10. Taken together, these f indings strongly suggested that d 10 was a key developmental stage in which cel lular metabol ic activity was acce lerated to enable a rapid increase in both endogenous and viral-directed muscar in ic receptor express ion . The functional activity of the virally exp ressed m l receptors in primary cortical neuron cultures was a s s e s s e d by measur ing IP3 accumulat ion in the cel ls fol lowing stimulation with the muscar in ic agonist, oxotremorine. Oxotremor ine is not as potent as carbachol in stimulating PI hydrolysis; however, E v a et a l . (1989) demonstrated that carbachol st imulation results in signif icantly higher receptor desensi t izat ion and downregulat ion of muscar in ic receptors in primary cort ical neuron cultures than oxotremorine. Thus , carbacho l has a greater ability to stimulate PI breakdown, but a lso appears to stimulate a larger dec rease in receptor number than oxotremorine. A s a high eff icacy agonist, carbacho l stimulation may also result in greater receptor promiscuity, which is the activation of multiple G -proteins by high eff icacy agonists; and s ince receptor promiscuity is thought to be exacerbated in receptor overexpress ion sys tems, oxotremorine was chosen instead of carbacho l for receptor stimulation in this exper imental sys tem (Kenakin, 1995a & 1995b; Mates ic et al . , 1991). 110 The physiological respons iveness of both endogenous and viral-directed muscar in ic receptors was inf luenced by the developmental age of the primary cort ical neuron cultures. Seven-day-o ld cultures had very low basa l levels of phosphoinosi tol (PI) hydrolysis, which may be due to a general immaturity of IP3 second -messenger pathway. The limiting factor to IP3 production at this developmenta l stage was probably not a consequence of limited neurotransmitter receptor express ion, s ince a 4-fold increase of m l receptors in vhm1.3 infected cel ls only translated to a 0.5-fold increase in IP3 accumulat ion, which was equivalent to the increase observed in mock infected cultures. In 10-day-old cul tures, however, increased viral-directed m l express ion appeared to mediate a 2.5-fold increase in IP3 product ion. Oxotremorine-st imulat ion of mock infected 10-day-old cultures produced about a 1-fold stimulation of IP3 product ion, which was similar to the oxotremorine-st imulated PI hydrolysis reported by O h k u m a et a l . in 12-day-old primary cortical neuron cultures (Ohkuma et a l . , 1992). Therefore, ten-day-old primary cortical neuron cultures demonstrated expected levels of agonist-st imulated PI hydrolysis, and the over-express ion of m l receptors from a HSV-1 recombinant in these cultures potentiated this functional response. Interestingly, up-regulation of muscar in ic receptors in cort ical neurons has been shown by other investigators to result in a functional dec rease in PI turnover (Goodbar and Bartfai, 1986; O h k u m a et a l . , 1990 & 1992). In these studies, up-regulation of muscar in ic receptors was induced by expos ing cerebra l cortical cel ls , in vivo and in vitro, to the muscar in ic antagonist, atropine for severa l days prior to assess i ng agonist-st imulated PI hydrolysis. O h k u m a et al.(1992) demonstrated that G-protein activity in atropine treated cultures was reduced, and their f indings indicate that the up-regulation of muscar in ic receptors v ia long-term atropine exposure induces functional alterations in the G-protein itself and/or the coupl ing between the G-protein and phospho l ipase C . Up-regulat ion of muscar in ic receptors v ia exogenous express ion from HSV-1 recombinant v i ruses resulted in increased rather than dec reased PI turnover, which strongly sugges ts that the long-term exposure of the cultures to atropine, and not the actual increase in muscar in ic receptors, was responsible for the noted dec rease in PI turnover in these studies. 111 Infection of primary cortical neuron cultures with ICP4-def ic ient HSV-1 did appear to c a u s e a dec rease in both endogenous muscar in ic express ion and basa l levels of PI hydrolysis. A 3 0 % to 5 0 % dec rease in endogenous muscar in ic receptors occurred following infection of the cultures with the control virus, d120 at every developmental stage, and this dec rease was evident as early as 12 hr postinfect ion. Ten-day-o ld cultures infected with d120 a lso had lower basa l levels of IP3 product ion; however, these cultures still demonstrated a good response to agonist st imulation. Whether the viral induced effects were due to reduced protein synthesis v ia the virus host shutoff (vhs) protein or due to cytotoxicity mediated by the other viral proteins expressed from ICP4-def ic ient v i ruses is not known. However , the affect of vhs on protein synthesis at low MOIs in t issue culture cel ls is not detectable, and its effects are thought to be even less pronounced in neuronal cel ls (Kwong and Frenkle, 1989; J . Smi ley , personal communicat ion ). Lowenste in et a l . (1994) reported that protein synthesis in primary cortical neuron cultures at 24 hr postinfection with ICP4-def icient virus is dec reased by only 4 % at low MOIs and 6 0 % at high MOIs . The viral proteins responsib le for the reduction in protein synthesis in this study was not estab l ished. B e c a u s e primary cortical neuron cultures were infected at a low MOI in our exper iments, it s e e m s unlikely that viral effects on protein synthesis were primarily responsib le for the v i ra l -associated dec rease in endogenous muscar in ic receptor express ion and reduction in basa l levels of PI hydrolysis. It is more likely that the v i ra l -associated effects observed were c a u s e d by one or more of the HSV-1 immediate-ear ly proteins. The recombinant, v h m l .3 exp ressed all of the viral proteins exp ressed by the control virus, d120 with the except ion of vhs. They include ICPO, ICP22 , ICP27 , ICP47 , ICP6 , and Or fP (Deluca et a l . , 1985; Y e h and Schaffer, 1993; Lugunoff and Ro izman , 1994 & 1995). ICPO, ICP22 , ICP27 and Or fP have all been shown to affect gene express ion and host cel l metabol ism in cel ls infected with ICP4-deficient v i ruses (see Chapt . 4.3 for more detai ls)(Kawaguchi et a l . , 1997; Saman iego et al . , 1995; McCar thy et a l . , 1989; R ice and Knipe, 1990; Mavromara-N a z o s et a l . , 1986 ; Post and Ro izman , 1981; W u et a l . , 1996; York et a l . , 1994; 112 Bruni and Ro i zman , 1996). Determining the inf luence of each of these viral proteins on m l receptor express ion from HSV-1 recombinant v i ruses is beyond the scope of this work. However, it is c lear from the f indings presented in this chapter and other studies of HSV-1 recombinant v i ruses that most biological appl icat ions and potential gene therapy appl icat ions of these vectors for gene transfer in neurons are dependent upon further el imination of viral proteins exp ressed by HSV-1 recombinant v i ruses. The work in this chapter demonstrated that the HSV-1 recombinant, vhm1.3 efficiently infected neurons, and exp ressed an abundance of m l receptors capable of mediat ing a physiological response, despi te the negative-effects assoc ia ted with viral protein express ion . The potential appl icat ions of the HSV-1 recombinant, vhm1.3 in investigating muscar in ic-mediated functional responses in neurons is limited by assoc ia ted viral cytotoxicity. Negat ive viral effects on host cel l metabol ism can be control led for by compar ing effects with those observed with control virus infection; nevertheless, differentiating between receptor and viral protein mediated effects may be difficult. A practical appl icat ion for the high eff iciency m l receptor express ion from HSV-1 recombinant v i ruses is in the development of m l receptor specif ic pharmacologica l agents. A m l receptor speci f ic agonist has not yet been deve loped and is in demand for both research and therapeutic purposes. T issue culture cel l l ines that stably express m l receptors do not provide a cell sur face environment ana logous to neurons. HSV-1 recombinant infection of primary neuronal cultures provides of means of express ing high levels of m l receptors within a neuronal environment to enable character izat ion of m l receptor l igand binding propert ies of newly deve loped m l speci f ic agonists and assessmen t of their effects on receptor/G-protein coupl ing. 113 7.0 Expression of an antigenic tagged ml receptor from an HSV-1 amplicon vector 7.1 Introduction HSV-1 ampl icon vectors enable assessmen t of foreign gene express ion without the interference of assoc ia ted viral protein express ion . HSV-1 ampl icon vectors are a p lasmid-based system in which p lasmids, containing a eukaryot ic transcription unit, an HSV-1 origin of replication (ori s) and an HSV-1 c leavage /packag ing s ignal , are packaged into HSV-1 vir ions ( Spae te and Frenke l , 1982; Ge l le r and Breakef ie ld, 1988). Ampl icon vectors offer the advantage of being easi ly manipulated by standard recombinant D N A techniques. Recent ly, a helper virus-free method for packaging ampl icon vectors has been deve loped in which trans -act ing viral functions are provided by a set of five HSV-1 cosmids (Cunningham and Dav ison , 1993; Fraefel et a l . , 1996). Co-transfect ion of this cosmid set and ampl icon p lasmid D N A into cultured cel ls results in pure stocks of HSV-1 ampl icon vectors. Therefore, these vectors avoid cellular toxicity issues assoc ia ted with viral gene express ion . High quality ant ibodies against the wild-type m l receptor are in limited supply. Levey and coworkers have successfu l ly raised polyclonal ant ibodies against the m l receptor from peptide sequences from the third intracellular loop (Levey et al . , 1991, Dorje et al . , 1991; Mrzljak et al . , 1993). Unfortunately, these ant ibodies were not avai lable for our studies. The addit ion of an antigenic tag to the m l receptor gene provided a means of identifying and surveying m l receptors express ion from the HSV-1 ampl icon vectors. The nine amino acid hemagglut inin (HA) epitope was chosen as an antigenic tag primarily for its smal l s ize and the availabil ity of a monoc lonal antibody against it. This ant ibody has been used successfu l ly in immunof luorescence, immunoprecipi tat ion and Western blotting 114 techniques (Wilson et al . , 1984; Field et a l , 1988; Huse et a l . , 1989). The H A epitope tag was fused to the N-terminus of the m l receptor, because it is extracel lular and not required for l igand binding or receptor function (reviewed by Hu lme et a l . , 1990). This antigenic tag enab led antibody detection of m l receptors exp ressed from HSV-1 ampl icon vectors. Th is chapter focuses on the construct ion of an HSV-1 ampl icon vector encod ing an epitope/ m l receptor fusion protein, and the initial character izat ion of ant ibody recognit ion and muscar in ic-speci f ic l igand binding of this ampl icon exp ressed fusion protein. The work provides insight into the advantages and limitations of the HSV-1 ampl icon vector sys tem. Al l studies were performed in a t issue culture cell line, but they provide the basis for future investigations in neurons . 7.2 RESULTS 7.2.1 Generat ion of HSV-1 ampl icon vectors Two different ampl icon p lasmids were constructed (Fig. 7-1). The first, des ignated pA-hm1 contained the wild-type m l receptor gene, and the second , des ignated pA-HA/hm1 contained the m l receptor gene with the nine amino acid hemagglut inin (HA) epitope sequence attached to the 5' end . This H A epitope was first recognized by Green et al.(1982), and has been extensively character ized with regards to its use in epitope tagging and protein survei l lance by R.A. Lerner and coworkers (Wilson et al . , 1984; Field et a l . , 1988; Huse et a l . , 1989). The addition of the 5' antigenic tag was accompl ished by inserting a P C R product with an A T G site fol lowed by the H A epitope sequences just after the receptor's start site, effectively deleting the 5' non-coding sequence of the m l receptor gene (Fig. 3-9). To generate the ampl icon p lasmids, both of the m l receptor gene constructs were subc loned into the p lasmid p H S V / P v p u c , which is der ived from the prototype HSV-1 ampl icon p lasmid, pHSVIac (Gel ler and Breakef ie ld, 1988). p H S V / P v p u c 115 Fig. 7-1. Amplicons containing the ml muscarinic acetylcholine receptor gene and the antigenic tagged ml muscarinic acetylcholine receptor gene. The ml receptor gene (A) and a ml receptor gene with a nine amino acid, hemagglutinin epitope inserted at the 5' end (B) were cloned in to the amplicon, pHSV/Pvpuc using Hindi 11 and EcoRI sites. The resulting amplicons were designated pA-hm1 and pA-HA/hm1 respectively. pHSV/Pvpuc contains the HSV-1 packaging site and origen of replication which enables plasmid packaging into HSV-1 particles. The HSV-1 IE 3/4 promoter drives the expression of both genes. 116 contains three types of genetic e lements: (i) p B R 322 sequences , including the C o l E q origin of replication and ampici l l in res istance gene; (ii) HSV-1 s e q u e n c e s , including oris and the " a " sequence which contains the packag ing s ignal ; and (iii) s e q u e n c e s encod ing the HSV-1 immediate-ear ly (IE) 4/5 promoter, a p U C 19 mult icloning site, and the S V 4 0 early region polyadenylat ion site. The resulting ampl icon p lasmids , pA-hm1 and pA-HA/hm1 contain all of the aforement ioned genetic e lements and exp ress their respect ive m l receptor gene constructs from the HSV-1 IE 4/5 promoter. The ampl icon p lasmids were packaged into HSV-1 part icles using a c o s m i d -b a s e d , rather than helper v i rus-based sys tem. The set of HSV-1 cosmids provide all the viral genet ic information, with the except ion of D N A c leavage / packag ing s ignals (Cunn ingham and Dav ison , 1993; Fraefel et a l . , 1996). E a c h ampl icon p lasmid w a s cotransfected into cel ls with all five cosmids , which led to product ion of H S V - 1 ampl icon vectors devoid of contaminat ing helper virus or viral genomes . After 3 to 4 d, cel ls were lysed, and viral part icles were purified and concentrated by centrifugation through a suc rose cush ion (Fig. 7-2). The ampl icon p lasmid, p H S V / l a c which e x p r e s s e s p-ga lac tos idase instead of m l receptors was packaged as a control to provide an est imate of transfection and packag ing eff iciencies v ia measur ing p-ga lac tos idase staining. However , it should be noted that ampl icon packag ing eff ic iencies are notoriously var iable between constructs (A. Gel ler , personal communicat ion) . Never the less, H S V / l a c ampl icon vectors ach ieved titers ranging from 1 - 5 x 1 0 5 prior to concentrat ion, which conf i rmed the sys tem was working at the expected level of eff iciency. The titer of vA-HA/hm.1 ampl icon stock concentrated 1:30 was est imated by immunof luorescence studies to be 2.5 - 5 x 1 0 5 , which is almost 30 t imes lower than that der ived from p H S V / l a c ampl icon s tocks. 7.2.2 Immunof luorescence studies Initially, antibody recognit ion of the antigenic tagged receptors w a s character ized by indirect- immunof luorescence studies of Vero cel ls t ransfected with the p lasmid p A - H A / h m 1 . Low levels of posit ive staining were detected in permeabi l ized transfected cel ls using the anti-hemagglutinin mAb , 1 2 C A 5 (Babco) . In an effort to 117 O 0.2 0.4 0.6 0.8 1.0 mu I a D | | b ' a' | c | 1 c I lyse cells, purify and concentrate stock Fig. 7-2. Generation of HSV-1 packaged amplicons. The cosmid-based HSV-1 vector system enables the expression of HSV-1 proteins and the production of HSV-1 viral particles without the generation of packaged HSV-1 genomes. The entire viral genome is represented by five cosmids, designated cos6Aa, cos 28, cos 14, cos 56 and cos48Aa (Cunningham and Davidson, 1993). cos6Aa andcos48Aa contain deletions removing the HSV-1 "a" sequence (Fraefel et al., 1996). The plasmids are linearized with P a d prior to cotransfection with the amplicon. Cells which recieve all five cosmids and the amplicon will package the amplicon in viral particals. The cells were lysed three days posttransfection, and the stocks were purified and concentrated by centrifugation through a 30% sucrose cushion. 118 increase express ion of the protein, Vero cel ls were transfected with pA-HA/hm1 and then 24 hr later, superinfected with HSV-1 strain K O S . This led to increased express ion due to HSV-1 V P 1 6 , which up-regulated express ion from the HSV-1 immediate-early (IE) 4/5 promoter driving receptor express ion . At 12 hr postinfection, the cel ls were subjected to indirect immunof luorescence using the m A b 1 2 C A 5 , and posit ively labeled cel ls were easi ly d iscernib le (Fig. 7-3A2). T h e s e posit ively labeled cel ls a lso stained posit ive with polyclonal ant iserum raised against the H A epitope and the first two amino ac ids (Pro-Asp) of the N-terminus of the m l receptor (Fig. 7-3A3). It should be noted that the cel ls depicted in figure 7-3A were permeabi l ized using 0 .25% saponin with the primary antibody incubations, and that in the absence of sapon in posit ive cel ls were not readily detectable with either antibody. After confirming express ion and antibody recognit ion of the antigenic tag in pA-HA/hm1 transfected cel ls , receptor express ion from the ampl icon vector, vA-HA/hm1 was examined. Vero cel ls were infected with vA-HA/hm1 ampl icon stocks concentrated 1:20, and at 24 hr postinfection the infected cel ls were a s s e s s e d by indirect immunof luorescence with both the monoc lona l antibody 1 2 C A 5 and the polyclonal ant iserum. Ce l l s were cons idered posit ive if they co- labe led with both the monoclonal ant ibody and polyclonal serum (Fig. 7-3B). Covers l ips labeled in paral lel with the individual primary ant ibodies produced equivalent numbers of posit ively labeled cel ls . The polyclonal ant iserum produced a much stronger s ignal than the monoclonal antibody, relative to background. The f luorescence micrographs shown in figure 7-3 were photographed and p rocessed under similar condi t ions to enable gross compar ison of labell ing intensit ies. O n c e aga in , 0 .25% saponin was used to gently permeabi l ize the cel ls , and surface staining alone was not readily detectable. 7.2.3 L igand binding analys is To determine if the ant igenic tagged m l receptors exp ressed from HSV-1 ampl icon vectors were capab le of reaching the cel l sur face and recogniz ing muscar in ic antagonists, l igand binding analys is with the muscar in ic antagonist, [ 3H] N-methyl -scopolamine (NMS) was performed. N M S is a posit ively charged 119 Fig. 7-3. immunofluorescence studies of the antigenic tagged ml receptor. In figures A l , 2 and 3, Vero colls wore transfected with |)A-HAhml, and thou after 12 hr infected with HSV-1 KOS to upregulate HSV-1 IE3/4 promoter. Immunofluorescont Studies worn performed 12 hr postinfection. In figures B1,2 and 3, Vero cells were infected with the amplicon stock, vA-HAhm 1, arid immunofluorescence studies wore performed 24 hr postinfection. Figures A2 and B2 show labelling with the monoclonal antibody, I lGAh(Bftheo Antibodies) against the hemagglutinin epitope. Figures A3 and B3 show labelling with a polyclonal antiserum raised against the 9 amino acid tag plus the N-terminus Pro and Asp of the ml receptor. Figures A l and BI show phase-contrast mk;rographs of the oorrespoiidiiK) fluorescence micrographs. l ipophobic l igand which only detects receptors on the cell sur face of intact cel ls (Galper et a l . , 1987; Nathanson, 1992). E a c h [ 3 H ] N M S molecule interacts with a single receptor site, and therefore, binding directly reflects the number of receptor units; however, this assay ' s sensitivity is limited by nonspeci f ic l igand binding. L igand binding analys is of m l receptor express ion from the ampl icon vector was compl icated by the low stock titer relative to HSV-1 recombinant v i ruses. To est imate l igand binding sensit ivity for cultures in which only subpopulat ions of cel ls were infected, Vero cel ls were infected with serial dilutions of v h m l .3 ranging from 1 0 3 to 2.5 x 1 0 6 pfu per 35 mm dish containing 2 x 1 0 6 Vero cel ls , and [ 3 H ] N M S binding for each dilution was determined at 20 hr postinfection (Fig. 7-4A). This assay showed that l igand binding with [ 3 H ] N M S could detect as few as 1000 cel ls infected with v h m l .1; however, the standard error of mean ( S E M ) for this low level of [ 3 H ] N M S binding was almost 0.5-fold of the mean and the est imated receptor number per cell was 1 x 1 0 5 as compared to 3 x 1 0 5 as determined by saturation curve data and Sca tchard ana lys is (Fig. 4-4). Th is variabil ity dropped dramatical ly when 1 0 4 or greater cel ls were infected. At 1 0 4 infected cel ls est imated receptor number per cell was 2.9 x 1 0 5 and the S E M was negligible. Therefore, vA-hm1 and vA-HS/hm1 stocks were concentrated to titers which resulted in [ 3 H ] N M S binding greater or equal to that of 1 0 4 v h m l .3 infected cel ls. vA-hm1 and vA-HA/hm1 ampl icon vector s tocks util ized in l igand binding studies were generated under the s a m e transfection condit ions, and both stocks were concentrated 30 :1 . Approximately 2 x 1 0 6 Vero cel ls in a 35 mm dish were infected with ampl icon vector stock, and l igand binding a s s a y s were performed at 20 hr postinfection. The results show that the antigenic tagged m l receptors expressed from vA-HA/hm1 were capab le of reaching the cell sur face and recogniz ing the muscar in ic antagonist, N M S . However , vA-hm1 infected cultures expressed greater than 3-fold more receptors than vA-HA/hm1 infected cultures (Fig. 7-4B). This increased receptor express ion by vA-hm1 could be due to either greater titers resulting from more efficient packag ing of the pA-hm1 ampl icon 121 10 3 10 4 10 5 5x10 5 10 61.25x10 s pfu of vhm1.1 22.5 20.0 € 1 7 - 5 T3 E E 15.0 in co I 12.5 © CO co 10.0 7.5 5.0 2.5 B vA-HAhm1 vA-hm1 Fig. 7- 4. Detection of surface muscarinic acetylcholine receptor expression from amplicon vectors. Ligand binding sensitivity for low infected cell numbers was estimated by infecting Vero cells with serial dilutions of vhml .1 (A). Infections ranged from 103 to 1.25 x 106 pfu per 35 mm dish of confluent Vero cells, vphml and vpHAhml amplicon stocks were concentrated 30:1, and 100 ulof the concentrated stock was used to infect a 35 mm dish of Veros cell (B). The viral titre of these stocks was unknown. Ligand binding assays using 1nM [ 3H]NMS were performed at 20 hr postinfection. Background counts were determined, both by ligand binding in mock infected cultures and by competitive inhibition withl uM atropine (data not shown), and were subtracted from the values. Data shown as mean+SEM (n=3) with each experiment being performed in triplicate. 122 plasmid, more efficient express ion of the wild-type m l receptor gene, or dec reased l igand binding affinity for m l receptors bearing the H A epitope at their N-terminus. Unfortunately, the titer of vA-hm1 ampl icon vector stock was unknown s ince these vectors was not infectious units and could not be titered by plaque assays . In addit ion, there is no avai lable ant ibody against wild-type m l receptors to measure vA-hm1 infected cel ls by immunof luorescence. However, the titer of the vA-HA/hm1 ampl icon vector was est imated by counting cel ls staining posit ive for the H A antigenic tag under immunof luorescence. Equivalent Vero cell numbers used in the l igand binding a s s a y s were s e e d e d on to covers l ips and were infected with equivalent amounts of vA-HA/hm1 ampl icon vector stock. Indirect immunof luorescence analys is of these cel ls using both the monoc lona l antibody and the polyclonal ant iserum was performed at 20 hr postinfection. A total of 30 fields, each field containing approximately 50 cel ls, from five covers l ips were a s s e s s e d (Fig. 7-5). A n est imate of one cel l in 50-75 cel ls was infected with v A - H A / h m 1 , which translates into 2.7 - 4.0 x 1 0 4 infected cel ls per 35 mm dish. Therefore, l igand binding results in figure 6 -5B reflected a total of approximately 7.4 x 1 0 5 - 1.1 x 1 0 6 [ 3 H ] N M S molecu les bound to each vA-HA/hm1 infected cel l . 7.3 DISCUSSION HSV-1 ampl icon vectors were generated which either exp ress wild-type m l receptors or ant igenic-tagged m l receptors. T h e s e vectors were eas ier to construct than HSV-1 recombinant vectors; however, the ampl icon stocks were more difficult to produce and quantitate. The addition of the antigenic tag to the m l receptors expressed from vA-HA/hm1 enab led quantif ication of the ampl icon stock by immunof luorescence studies. The est imated vA-HA/hm1 stock titer was 1 0 4 -1.5 x 1 0 5 part icles/ml, and this stock was concentrated to a final titer of 2.5 - 5 x 1 0 5 part icles/ml. Without an antibody against the m l receptor, quantitative P C R was required to titer the vA-hm1 stock; however, this would not discr iminate between 123 4-Fig. 7-5. Immunofluorescence analysis of vA-HA/hm1 infected Vero cells to estimate amplicon stocK titer. Parellel 35 mm dishes of confluent Vero cells grown on coverslips were infected with 100 pi of vA-HA/hm1 stock. At 20 hr postinfection, vpHA/hm1 infected cells were assayed by indirect immunofluorescence using the monoclonal antibody, 12CA5 directed against the 9 amino acid hemagglutinin epitope (B), and using the polyclonal antiserum directed against the 9 amino acid tag plus the N-terminus Pro and Asp of the ml receptor (C). Figures A shows a phase-contrast micrograph of the corresponding fluorescence micrographs. A total of 30 fields on 5 seperate coverslips were assessed with approximately 50 cells per field, and an estimate of one cell infected with vpHA/hm1 per 50 to 75 cells was determined. infectious and noninfectious particles. Instead, this work focused on the character izat ion of the ant igenic-tagged m l receptors from v A - H A / h m 1 . The antigenic tagged receptor cons is ted of a nine amino acid hemagglut inin (HA) epitope l inked to the N-terminus of m l receptor. The amino terminus does not contribute to l igand binding propert ies or G-protein coupl ing of the receptor; therefore, the addition of the tag should not have affected receptor function (Wess et a l . , 1991 & 1992; Birdsal l et a l . , 1993) The tag could potentially interfere with glycosylat ion of the N-terminus. The N-terminus has three potential glycosylat ion sites which may regulate receptor transport and cel lular local izat ion. Li les et a l . (1986) demonstrated that inhibition of muscar in ic receptor glycosylat ion c a u s e d a specif ic deplet ion in cell surface receptor numbers, whereas Herron et a l . (1983) showed that glycosylat ion inhibition had no effect on receptor numbers. Stud ies examining inhibition of glycosylat ion of another G-prote in-coupled receptor, the |3-adrenergic receptor have found no resulting effect on receptor transport to the cel l surface (Dixon et a l . , 1987). In this study, it is c lear that the antigenic tag did not block receptor transport to the cell sur face. Ant ibody recognit ion of the ant igenic- tagged receptors was a s s e s s e d using indirect immunof luorescence studies. The commerc ia l ly avai lable antibody against the H A epitope (12CA5) demonstrated a weak, but speci f ic s ignal against H A epitope/ m l receptor fusion protein. Po lyc lonal ant iserum was raised against the H A epitope plus the first two amino ac ids of the m l receptor in an attempt to generate ant ibodies with a greater affinity for the tagged receptors. Indirect immunof luorescence staining with this serum produced a stronger s ignal than 1 2 C A 5 staining, but background levels were a lso higher. Never the less, posit ive staining co- loca l ized with 1 2 C A 5 staining, and was easi ly discernible from background. Affinity purification of the ant iserum should provide a quality antibody source for further immunof luorescence studies, and perhaps immunoprecipitat ion and Western blotting analys is . 125 Both the monoclonal ant ibody and the polyclonal ant iserum demonstrated diffuse cell surface and cytoplasmic staining. There were no apparent accumulat ions within the cy top lasm to suggest the tagged receptors were being retained within the endop lasmic reticulum or Golg i apparatus. Opt imal staining was ach ieved when saponin was included in the primary ant ibody incubat ions. Sapon in is a mild detergent which enab les cel lular penetration of the ant ibodies. In the absence of sapon in , cel l surface staining did not confer reliable detection of cel ls express ing the tagged receptors. Sensit ivity limitations of standard immunof luorescence requires ant ibody recognit ion of 1 0 6 to 1 0 7 molecu les per cell (Gary Keve lson , Pharmaceut ica l Discovery, C o . , personal communicat ion) . Ce l l surface express ion of the tagged receptors was conf i rmed with l igand binding analys is . The radiolabeled muscar in ic antagonist, [ 3 H ] N M S was used to detect cell surface express ion of the tagged receptors. The results indicated that 7.4 X 1 0 5 to 1.1 X 1 0 6 molecules of [ 3 H ] N M S bound to each Vero cell infected with v A - H A / h m 1 . S ince this l igand recognizes only receptors on the cel l sur face, these results demonstrated a large population of tagged m l receptors present on the surface of vA-HA/hm1 infected cel ls. The level of [ 3 H ] N M S binding per cel l w a s greater than that seen in Vero cel ls infected with the HSV-1 recombinant, vhm1.1 , but less than that seen in v h m l .3 infected cel ls. Taken together, these results a lso suggest that the tagged receptors retain their l igand binding propert ies. Al though l igand binding propert ies were not expected to be altered s ince all known l igand interactions involve the t ransmembrane domains , saturat ion curve analys is and/or competi t ive l igand analys is would be required to verify kinetics of l igand binding. L igand binding studies of wild-type m l receptors in cel ls infected with vA-hm1 ampl icon stocks demonstrated [ 3 H ] N M S binding 3-fold greater than that of cel ls infected with vA-HA/hm1 stocks. This increased binding in vA-hm1 infected samples could be due to higher titers of stock resulting from more efficient packaging of the pA-hm1 ampl icon p lasmid, more efficient express ion of the wild-type m l receptor gene, or dec reased l igand binding affinity for m l receptors bearing the H A epitope at their N-terminus. B e c a u s e vA-HA/hm1 infected cel ls 126 bound high levels of [ 3 H ] N M S , it s e e m s unlikely that the increase observed was a result of higher receptor number per cell or a result of dif ferences in l igand binding affinity. It s e e m s likely that the difference was due to higher vA-hm1 titers. The variability in titers of ampl icon stock titers was well demonstrated by the 5-fold difference between p H S V / l a c titers and vA-HA/hm1 titers. This chapter presented the generat ion of an HSV-1 ampl icon vector express ing m l receptors with a nine amino acid H A epitope at tached to their N-terminus. T h e s e receptors were recognized by both the monoclonal antibody 1 2 C A 5 and polyclonal ant iserum raised against the H A epitope and the first two amino ac ids of the m l receptor. Immunof luorescence studies indicated that the tagged-receptors were diffusely local ized in the cytoplasm and on cel l sur face of infected Vero cel ls, and the a b s e n c e of any juxtanuclear accumulat ions sugges ted that these receptors were not being retained in the host cel l 's protein transport machinery. L igand binding analys is with [ 3 H ] N M S demonstrated that the tagged receptors were recognized by the muscar in ic antagonist, and that a large population of these receptors were present on the surface of cel ls infected with the ampl icon vectors. These f indings establ ished that the vA-HA/hm1 ampl icon vector was appropriate for further character izat ion of the ant igenic-tagged m l receptors in primary neuron cultures. On the basis of the propert ies of these ampl icon vectors, potential future studies include the fol lowing: immunocytochemica l local izat ion of the tagged receptors in neurons using both f luorescence microscopy and electron microscopy, determination of duration of gene express ion from the ampl icon vectors, and examinat ion of ampl icon vector infected neurons for cytotoxic effects. In addit ion, affinity chromatography mediated protein purification of the receptors and assoc ia ted proteins from infected neuronal cultures to investigate neuronal targeting mechan isms of neurotransmitter receptor may also be poss ib le . Unfortunately, the low stock titers y ie lded by the current method of HSV-1 ampl icon vector propagation limits their potential appl icat ions. For example , functional analys is of ant igenic-tagged m l receptors exp ressed from vA-HA/hm1 ampl icon vectors by measur ing agonist-st imulated phosphoinosi to l turnover is 127 not feasible with low numbers of infected cel ls . Kinetic analys is of l igand binding is a lso impeded by the low infection eff ic iencies resulting from low ampl icon vector titers. In genera l , investigations requiring homogenous gene express ion in populat ions of cel ls are not well suited for gene transfer using the currently avai lable HSV-1 ampl icon vectors. However, efforts are underway to develop an efficient method for generating high titer s tocks of ampl icon vectors, and if success fu l , will broaden the exper imental potential of the HSV-1 ampl icon vectors generated in this work. 128 8.0 General Discussion and Conclusion Vector -mediated gene transfer into neurons enab les the study of genes underlying neuron-speci f ic activities, and has the potential to not only increase our understanding of the function of these genes , but a lso to develop more definitive therapies for assoc ia ted d iseased states. Its s u c c e s s is dependent upon efficient and safe transfer of genet ic material into neurons fol lowed by appropriate express ion of gene products. At present, viral mediated gene transfer has shown the greatest potential for gene transfer into neurons. The most promising viral vector sys tems under development are based on the adenovi rus, adeno-assoc ia ted virus, lentivirus and herpes s implex virus. To date, all of these vectors have exhibited some limitations, and it is likely that var ious strategies will have to be used to so lve particular biological or cl inical problems. The development of viral mediated gene transfer into neurons has and cont inues to il luminate our understanding of the v i ruses themselves, as well as neuron cel l biology and physiology. Our laboratory has been developing herpes s implex type 1 mediated gene transfer, including HSV-1 recombinant and HSV-1 ampl icon vector technology. The primary focus of my thesis was on the use of HSV-1 recombinants to express a neurotransmitter receptor, the m l muscar in ic acety lchol ine receptor. HSV-1 recombinants offer the advantage of neurotropism, large genet ic carrying capacity, high stock titers, and ability to establ ish latency in neurons; however, for use as a vector, the express ion of viral proteins responsib le for viral replication and viral assoc ia ted toxicity must be el iminated. The first repl ication-defective HSV-1 recombinant vectors deve loped were defect ive in the express ion of the major regulatory protein, ICP4 (DeLuca et a l . , 1985). O n e objective was to del ineate the effects of el iminating ICP4 and another viral protein assoc ia ted with cytopathicity, the viral host shutoff protein (vhs), on m l receptor express ion from the viral g e n o m e . 129 A ser ies of HSV-1 recombinants express ing m l receptors were generated containing var ious combinat ions of modif icat ions to genes encod ing ICP4 , vhs and the m l receptor. Character izat ion of m l receptor express ion from HSV-1 recombinants in Vero cel ls showed that v i ra l ly-expressed receptors maintained their pharmacological propert ies and physiological activity. Quantitat ion of m l receptor express ion using l igand binding a s s a y s demonstrated that the level of viral-directed m l receptor express ion was dependent upon the viral backbone from which it was expressed . The dif ferences in receptor express ion were most pronounced with regards to changes in ICP4 express ion within m l receptor express ion being dramatical ly e levated in the a b s e n c e of ICP4 (F ig . 5-3). The observat ion that exogenous express ion from an ICP4-def ic ient recombinant was increased was not ant ic ipated. T h e s e recombinants are replication-defective and gene express ion is only driven from one genome whereas repl icat ion-competent recombinants can potentially drive gene express ion from multiple progeny genomes . However , examinat ion of the 5' noncoding region of the m l receptor gene revealed three potential high affinity binding sites for ICP4 which could have provided a mechan ism for ICP4-media ted gene repression (F ig . 4-8). ICP4 represses a gene express ion by binding to its high affinity sites near the a gene promoters, and associat ing with basa l transcription factors to terminate transcription (Kattar-Cooley and Wi lcox, 1989; A thanas ios et a l . , 1991). E a c h potential binding site in the 5' noncoding region var ied from the ICP4 high affinity consensus sequence 5 ' - A T C G T C - 3 ' by one nucleot ide; however, this site is known to be degenerate (Faber and Wi lcox, 1986; W u and Wi lcox, 1990). The strength of ICP4 repression is dependent on the distance from and stereoaxial al ignment with the T A T A box, rather then sequence identity (Leopardi et al . , 1995; Kuddus et a l . , 1995). Recombinants deleted in the 5' noncoding region of the m l receptor gene did not exhibit ICP4-assoc ia ted downregulat ion of m l receptors express ion . This observat ion strongly supported the hypothesis that ICP4 repression of m l receptor express ion was mediated by ICP4 binding sites in the gene 's 5' noncoding region. 130 Of particular note, recombinants deleted in the 5' noncoding region of the m l receptor gene expressed significantly more receptors than the ICP4-def ic ient recombinants, indicating that either deleting the 5' noncoding region conferred an advantage other than that assoc ia ted with eliminating ICP4 repress ion, or that low levels of ICP4 were present (F ig . 5-4). There is ev idence that low levels of ICP4 are packaged with ICP4-def ic ient recombinants during propagat ion in the ICP4 express ing cell line, E 5 (Yao and Cour tney, 1989 and 1991; al though, functional activity of these proteins during viral infection has not been demonstrated. Other immediate-early proteins or cel lular transcription factors may be responsib le for mediat ing ICP4- independent gene repress ion v ia the 5' noncoding region, but there are no other known repressor si tes present. It is poss ib le that the 5' noncoding region of the m l receptor gene is responsib le for mediat ing endogenous receptor express ion levels, and that these regulatory mechan i sms affect viral-directed gene express ion . Further studies systemat ical ly deleting speci f ic sequences of the 5' region, together with foot printing studies, would confirm ICP4 mediated repression and potentially reveal other regulatory m e c h a n i s m s . In addition to ICP4-med ia ted repression of m l gene express ion , it was possib le that the increased express ion of m l receptors from ICP4-def ic ient recombinants could be due in part to increased express ion of ICPO by these v i ruses. ICPO is a promiscuous transactivator which has been shown to up-regulate a number of viral and nonviral promoters (O'Hare and Hayward , 1985; Nabe l et a l . , 1988; C a i and Schaffer , 1992). However, in the absence of the 5' noncoding region, the ICP4-exp ress ing recombinant actually exp ressed slightly more receptors than the ICP4-def ic ient recombinant (F ig . 5-4). T h e s e f indings suggest that increased express ion of ICPO from the ICP4-def ic ient recombinants did not result in increased m l receptor express ion . Taken together, the results of these studies suggest that ICP4 directly represses viral-directed m l receptor express ion v ia binding sites present in the 5' noncoding region, that other regulatory mechan isms may act v ia s e q u e n c e s in the 131 5' noncoding region, and that increased ICPO express ion from the ICP4-def ic ient recombinants was not responsib le for e levated receptor express ion observed in these recombinants. It should be noted that the effects of ICP4 on gene express ion from our recombinants were specif ic for the m l receptor gene. The express ion of foreign genes inserted into HSV-1 genome, therefore, is not only dependent upon the viral backbone and promoter from which it is exp ressed , but a lso upon regulatory sequences unique to the gene itself. The effect of virion host shutoff protein (vhs) on m l express ion from our recombinants was less pronounced than that of ICP4 . vhs is a tegument protein that inhibits host translation and induces acce lerated turnover of both viral and cel lular m R N A s (Kwong et al . , 1988; Smibert et a l . , 1992; Ze lus et a l . , 1996). In addit ion, vhs has been shown to interact with V P 1 6 which subsequent ly inf luences packag ing of the tegument proteins within the virion (Smibert et a l . , 1995). At high MOIs (ie. 10 pfu per cell), [ 3 5 S] methionine labell ing fol lowed by S D S - P A G E analys is showed that infection of Vero cel ls with recombinants defective in vhs express ion resulted in markedly less host protein shut off (F ig . 4-7). However , exper iments assess ing receptor express ion from the recombinants were performed at MOIs =3, and at low MOIs (ie. 2 pfu per cell), the effects of vhs on host protein synthesis were not obvious (Kwong and Frenke l , 1989). Never the less, a smal l but significant advantage of m l receptor express ion in the absence of vhs was observed at this low MOI (F ig . 5-3). T h e s e results suggested that the p resence of vhs reduced viral-directed express ion of m l receptors, perhaps by increasing degradat ion of the m l receptor m R N A or reducing its translat ion. The elimination of vhs from HSV-1 recombinant vectors, therefore, does not appear to reduce optimal express ion of gene inserts, and aids in reducing potential negative viral effects on host cell metabol ism. Select ion and isolation of all the HSV-1 recombinants generated in this study were based primarily on phenotype, and other than examining for the expec ted gene modif icat ions, we did not rule out the possibil i ty of addit ional mutations in the recombinant genomes. It is est imated that as much as 3 0 % of all HSV-1 recombinants 132 contain addit ional mutations (Ro izman, 1996). In fact, the parental ICP4-def ic ient virus d120 is thought to contain at least one other mutation in addition to delet ions in the oc4 genes (F. Tufaro, personal communicat ion). The influence of addit ional mutations can be determined by replacing each modif ication in each of the generated recombinants and a s s e s s i n g for changes in viral gene express ion and/or m l receptor express ion . Due to time constraints, this task was not done in the present study. Therefore, when interpreting results from exper iments utilizing these recombinants, the possibil i ty that undetected mutations could be present needs to be taken into considerat ion. Hav ing character ized m l express ion from the ser ies of HSV-1 recombinants in Vero cel ls , the next objective was to character ize viral-directed receptor express ion and function in neurons. The recombinant v h m l .3 was chosen for this task based on the following phenotypic features: it is repl ication-defective, it exp resses moderately high levels of m l receptors, and it does not express vhs. In addit ion, the levels of surface m l receptors exp ressed from this recombinant were found to produce a measurab le increase in phosphoinosi to l hydrolysis in response to agonist stimulation, which was 0.5-fold greater than that reported in C H O cel ls stably express ing exogenous m l receptors (Savarese et a l . , 1992). Investigating viral ly-directed m l receptor express ion in primary cortical neuron cultures posed severa l cha l lenges not encountered in our t issue culture cel l sys tem. Firstly, infection eff iciency with the recombinants had to be establ ished s ince these cultures were heterogeneous and more difficult to infect than Vero cel ls. Second ly , primary cort ical neuron cultures undergo developmenta l changes fol lowing plating, and experimental results were affected by the age of the culture. Thirdly, these cultures had a short life span ; they acqui red neuronal features of myelination and synapse formation about day s e v e n , reach full maturity at day 14 and thereafter, began to deteriorate (Dudai and Yav in , 1978; Swa iman et a l . , 1982; Kos ik and F inch, 1987). In addit ion, populat ions of primary cort ical neuron cultures expressed endogenous m l receptors as well as other muscar in ic subtypes, and this express ion varied with the developmental s tage of the cultures (Eva et a l . , 1987; A lho et al . , 1988). 133 Investigations of viral-directed and endogenous muscar in ic express ion in primary cortical cultures were performed from day seven to day 14 of culture growth. Very few endogenous receptors were detected in cultures less than ten-days-o ld ; however, from day ten to e leven express ion levels increased almost 10-fold, and after this period, cultures appeared to maintain constant levels of endogenous muscar in ic receptors (F ig . 6-3A) (Dudai and Yav in , 1978). Exogenous m l receptor express ion from the HSV-1 recombinant was similarly affected by the developmental age of the cultures. Viral-directed m l receptor express ion was lowest in day seven infected cultures and highest in day ten infected cultures. Whi le viral-directed m l express ion dec reased in day 14 cultures, endogenous receptor levels in day 14 mock cultures were mainta ined near max imum (F ig . 6-3A) . Taken together, these f indings strongly sugges ted that day ten was a key developmenta l s tage in which both endogenous and viral-directed muscar in ic receptor express ion was acce lera ted. Th is increase in receptor express ion could be the result of a general increase in eff iciency of polypeptide synthesis in the neurons at this developmental s tage, or the increase may be due to the express ion of speci f ic cel lular transcriptional factors which function to up-regulate both endogenous and viral m l receptor gene express ion . Age-re lated changes in neurotransmitter express ion of cortical neurons have been well documented, but the mechan isms involved are poorly understood (Lanius et al . , 1993). Further exper iments examining regulation of exogenous m l receptor express ion from an HSV-1 recombinant in day ten cultures could provide insight into the developmenta l regulation of these receptors. Viral-directed m l receptor express ion may a lso provide a means of investigating the regulatory p rocesses underlying receptor desensi t izat ion and downregulat ion. Viral-directed m l receptor express ion in primary cort ical neurons produced a net dec rease of other endogenous muscar in ic receptor subtypes expressed on the cell surface. In v h m l .3 infected ten day cultures, only 5 % of the muscar in ic receptors detected were subtypes other than m l ; whereas in mock infected cultures greater than 2 5 % of muscar in ic receptors were subtypes other 134 than m l . Direct compar ison of these populat ions revealed that less than 3 0 % of other muscar in ic subtypes present in mock infected cultures were present in v h m l .3 infected cultures. Th is dec rease was not due solely to v i ra l -associated effects, s ince cultures infected with control virus demonstrated a proportional dec rease in all endogenous muscar in ic subtypes that was approximately 8 0 % of mock (Fig. 6 -4B) . The downregulat ion of other muscar in ic subtypes in vhm1.3 infected cultures may be due to monopol izat ion of the host cell machinery by virally exp ressed m l receptors, which simply out compete other endogenous receptors. Alternatively, the downregulat ion may reflect a mechan ism for regulating cel l sur face receptor numbers, such as phosphorylat ion of the receptors by second messenger activated protein k inases or G-protein receptor k inases ( G R K S ) (reviewed by Ferguson et a l . , 1996). T h e s e possibi l i t ies can be del ineated by determining if m l receptor overexpress ion downregulates only other muscar in ic receptors, other G-protein coupled receptors, or all cell sur face receptors. The developmental age of the primary cortical neuron cultures a lso inf luenced the physiological respons iveness of both endogenous and viral-directed muscar in ic receptors. Seven-day-o ld cultures had very low basa l levels of phosphoinosi to l (PI) hydrolysis, which may be due to immaturity of this s e c o n d -messenge r pathway (Fig. 6 -6A) . The limiting factor to PI hydrolysis and inositol 1,4,5-triphosphate (IP3) production at this developmental stage was probably not a consequence of limited neurotransmitter receptor express ion , s ince increased numbers of m l receptors in vhm1.3 infected cel ls did not produce increased agonist-st imulated IP3 accumulat ion. In ten-day-old cultures, oxotremorine stimulation of mock cultures produced about a 1-fold stimulation of IP3 product ion over basa l levels, which is similar to the oxotremorine-st imulated PI hydrolysis reported by O h k u m a et al . (1992) in 12-day-old primary cortical neuron cultures. In these cultures, viral-directed m l receptor overexpress ion produced a 2.5-fold increase in IP3 production (Fig. 6 -6B) . It should be noted that cultures infected with control virus had lower basa l IP3 levels suggest ing that viral infection negatively inf luenced this second messenge r pathway. T h e s e results showed that virally expressed m l receptors were capab le of mediat ing functional responses in 135 primary cortical neuron cultures at least ten days old; however, v i ra l -associated effects of the HSV-1 recombinant a lso appeared to inf luence neuronal second messenge r sys tems which could interfere with further studies a s s e s s i n g m l receptor function utilizing this recombinant. The greatest limitation to investigating m l receptor mediated activities in neurons utilizing our HSV-1 recombinant is viral assoc ia ted toxicity. The viral vector itself is not toxic s ince UV-irradiated vir ions do not demonstrate any toxic effects (Johnson et a l . , 1992); however, viral proteins expressed from the ICP4-deficient recombinants are responsib le for disrupting severa l funct ions of host cell metabol ism. Fol lowing infection of cel ls with ICP4-def ic ient v i ruses the express ion of other immediate-early proteins, including ICPO, ICP27 , ICP22 and ICP47 are actually up-regulated due to the absence of ICP4 repression of their gene express ion (Deluca et a l . , 1985; Faber and Wi lcox, 1986; Kat tar -Cooley and Wi lcox, 1989; Athanas ios et a l . , 1991). The express ion of the viral protein, Orf P under the control of the L /ST promoter is a lso enhanced by the absence of ICP4 repression (Kuddas et a l . , 1995). In addit ion, low levels of ICP6 , which is the large subunit of viral r ibonucleotide reductase are a lso expressed from these recombinants (DeLuca , 1985). Cons iderab le progress has been made in del ineating many of the host cel l interactions of these proteins. ICPO is a promiscuous transactivator which can potentially affect cel lular gene express ion (O 'Hare and Hayward , 1985; Nabe l et a l . , 1988) and has a lso been implicated in cytoplasmic functions affecting host translat ional machinery v ia interactions with cel lular elongation factors (Kawaguchi et a l . , 1997). ICP27 has been shown to affect spl ic ing and poly (A) usage of m R N A s and appears to play a role in secondary shutoff of host protein synthesis (McCarthy et a l . , 1989; R ice and Knipe, 1990). The ICP22 assoc ia ted effects are less well character ized, but the elimination of this gene from an ICP4-def ic ient virus results in a substantial reduction in v i rus-assoc ia ted cytopathicity and enhanced cel lular gene express ion in the infected cel l (Mavromara-Nazos et a l . , 1986 ; Pos t and Ro i zman , 1981; W u et al . , 1996). ICP47 is a cytoplasmic protein that has been 136 shown to affect the processing of major histocompatibil i ty complex c lass I molecu les, and is not thought to alter gene express ion or cause cytopathic effects (York et a l . , 1994). Relatively little is known concern ing the effects of the Orf P protein on gene express ion and host function, but Orf P is known to interact with a component of the S F 2 / A S F spl icing factor and consequent ly , may effect both gene express ion and host cell functions (Bruni and R o i z m a n , 1996). The importance of el iminating express ion of each of these viral proteins from HSV-1 recombinant vectors will become clearer as recombinants deficient their express ion are deve loped . P rog ress is being made on developing a nontoxic HSV-1 recombinant vector. N. D e L u c a and coworkers have recently reported the development of an HSV-1 recombinant deficient in ICP4 , ICP27 and ICP22 express ion (Wu et a l . , 1996). This recombinant has markedly reduced effects on cell morphology and cellular gene express ion; however, host cell D N A synthesis in Vero cel ls is inhibited, and under electron microscopy, large accumulat ions of ICPO in the nucleus can be s e e n . Marconi et a l . (1996) report robust express ion of (3-ga lac tos idase (p-gal) driven from the human cytomegalovi rus promoter from within the U|_41 region of a similar ICP4 , ICP27 and ICP22 deleted mutant. Prel iminary data on (3-gal express ion from a newly deve loped HSV-1 mutant, deficient in ICP4 , ICP27 and express ing H C M V driven (3-gal from an interrupted ICPO locus, indicated a dramatic decrease in gene express ion from this genome (N. D e L u c a , personal communicat ion). The generat ion of an ICP4 , ICP27 , ICP22 and ICPO-deficient recombinant is the next step in this vector 's development . Difficulties anticipated with this recombinant include reduced express ion of inserted genes from the genome, a limited duration of inserted gene express ion , and poss ib le toxic effects assoc ia ted with Orf P express ion. Fol lowing development of a nontoxic recombinant, further work will be required to establ ish promoters and sites of gene insertion appropriate for speci f ic express ion requirements. Long-term express ion from these vectors requires a greater understanding of gene regulation during latency, but investigations 137 assess ing inserted gene express ion from promoter constructs based on the latency assoc ia ted promoters are making progress on this front (Chen et a l . , 1995; Carpenter and Stevens, 1996; Marconi et a l . , 1996). Short-term express ion from these vectors is a more attainable goal in the near future. However , it may be difficult to produce vectors which consistently mediate either a high, moderate or low express ion level of each inserted gene, s ince the inserted gene itself may confer regulatory e lements. Never the less, an attempt should be made to standardize express ion levels from a given vector and promoter sys tem to enable researchers to select an HSV-1 recombinant appropriate for their biological problem or therapeutic need . It would be worthwhile to examine express ion of the ant igenic- tagged m l receptors from an HSV-1 recombinant deficient in ICP4 , ICP27 , ICP22 and ICPO. A s demonstrated in this thesis, m l receptor express ion enab les sensi t ive quantitation of gene express ion from the viral genome and this gene would be useful for measur ing express ion levels from different promoters and inserted regions. The addition of the antigenic tag served two purposes ; first, it enabled antibody recognition of the virally exp ressed receptors, and s e c o n d , this gene construct was deleted in the 5' noncoding region of the m l receptor gene which contains potential regulatory si tes. In addition to aiding in vector development, these recombinants would be useful for analyz ing m l funct ional activities in neurons. Funct ional quest ions that were difficult to approach with our HSV-1 recombinant due to v i ra l -associated toxicity (i.e. m l receptor mediat ion of (3-amyloid processing) could be potentially answered. HSV-1 recombinant express ion of the ant igenic- tagged m l receptors in neurons would a lso enable isolation of neuronal proteins assoc ia ted with the receptor, including G-proteins, proteins involved in receptor sensit izat ion and desensi t izat ion, and proteins involved in targeting and transporting receptors to different locat ions on the cel l sur face. In this study, express ion of the ant igenic-tagged m l receptors was a s s e s s e d from HSV-1 ampl icon vectors. T h e s e p lasmid-based vectors offer two advantages; 138 they are relatively easy to construct, and they do not express any viral proteins. Util izing this vector sys tem, antibody recognit ion and l igand binding propert ies of the antigenic tagged m l receptors were estab l ished. Unfortunately, functional studies of these ampl icon-expressed receptors were hindered by the low titers of the ampl icon stock. This exempl i f ies the main limitation of HSV-1 ampl icon vectors in that although they are easy to construct, they are difficult to propagate and titer. At present, ampl icon stock titers are at least 100 t imes lower than HSV-1 recombinant stocks (ie. 5 x 1 0 5 part icles/ml as compared to 5 x 10 7 pfu/ml) . The ampl icon stocks can be concentrated to provide higher titers; however, large-scale production of ampl icon stocks would be needed to provide the vo lume of ampl icon stock required to produce enough high titer stock for functional studies. At present, practical appl icat ions for HSV-1 ampl icon vectors involve studies of inserted gene express ion in single cel ls or subpopulat ions of cel ls . Fol lowing optimization of these vector sys tems, researchers will still need to (1) establ ish parameters of eff iciency and duration of gene express ion from these vectors in speci f ic populat ions of neurons in vivo , and (2) investigate both short-term and long-term cytopathic effects assoc ia ted with gene express ion from these vectors in vivo. It is likely that the HSV-1 recombinants and the HSV-1 ampl icon vectors will ultimately confer different gene express ion profi les, and that the vectors will be useful for the analys is of a variety of biological or cl inical problems. The studies in this thesis a lso demonstrate how the process of viral vector development for gene transfer into neurons contributes to our understanding of the v i ruses themselves. The effect of the viral proteins, ICP4 and vhs on viral-directed m l receptor express ion was character ized, as was the functional activity of the virally exp ressed m l receptors. Developmenta l changes in primary cortical neuron cultures were shown to have an effect on both viral-directed m l receptor express ion and function. Overexpress ion of m l receptors in these cultures potentiated an increase in agonist-st imulated phosphoinosi to l hydrolysis, demonstrat ing that receptor numbers were not the limiting factor in this second messenger pathway. A lso , overexpress ion of m l receptors was found to cause a 139 downregulat ion of other muscar in ic subtypes in primary cortical neuron cultures. T h e s e f indings provide the basis for further investigations into severa l fundamental i ssues pertaining to m l receptor activit ies in neurons, such as developmenta l regulation of m l receptor, regulation of agonist-st imulated response, and regulation of cell surface muscar in ic receptor express ion . 140 REFERENCES Alexander , I.E., Russe l l , D.W. and Miller, A . D . (1994) DNA-damag ing agents greatly increase the transduct ion of nondividing cel ls by adeno-assoc ia ted virus vectors. Journal of Virology 68: 8282-8287. Andersen , J .K . , Fr im, D.M. , Isacson, O. and Breakf ie ld, X . O . (1993) Herpesvirus-mediated gene delivery into the rat brain: specif icity and efficiency of the neuron-speci f ic eno lase promoter. Cel lu lar Molecu lar Neurovirology 13: 503-515. Asher , Y . , Heller, M . and Becker , Y . (1969) Incorporation of lipids into herpes s implex virus particles. Journal of Genera l Virology 4: 65-76. Ashkenaz i , A . and Peral ta, E . G . , Wins low, J .W. , Ramachand ran , J . and C a p o n , D .J . (1989) Functional ly distinct G proteins select ively couple different receptors to PI hydrolysis in the s a m e cel l . Ce l l 56: 487-493. Avitabi le, E., Di Gae ta , S . , Torr isis, M.R., Ward , P. , Ro i zman , B. and Campade l l i -f iume, G . (1995) Redistr ibution of microtubules and Golg i apparatus in herpes s implex virus-infected cel ls and their role in viral exocytos is . Journal of Virology 69: 7472-7482. Banerjee, S .A . , Hoppe, P. , Brilliant, M. and Chikara ish i , D .M. (1992) 5' F lanking sequences of the rat tyrosine hydroxylase gene target accurate t issue-speci f ic , developmenta l , and transsynapt ic express ion in t ransgenic mice. Journal of Neurosc ience 12: 4460-4467. Batchelor, A . H . and O'Hare , P. (1992) Local izat ion of c/s-acting sequence requirements in the promoter of the la tency-assoc ia ted transcript of herpes s implex virus type 1 required for cell-type speci f ic activity. Journa l of Virology 66: 3573-3582 . Batterson, W. and Ro izman , B. (1983) Character izat ion of the herpes s implex v i r ion-associated factor responsible for the induction of a lpha genes . Journal of Virology 46: 371-377. Batterson, W. , Fur long, D. and R o i z m a n , B. (1983) Molecular genet ics of herpes s implex virus. VII. Further character izat ion of a ts mustant defective in re lease of viral D N A and in other s tages of viral reproductive cyc le . Journa l of Virology 45 : 397 -407 . Batt leman, D.S. , Gel ler , A.I. and C h a o , M.V. (1993) HSV-1 vector mediated gene transfer of the human nerve growth factor receptor p75bNGFR def ines high affinity N G F binding. Journal of Neurosc ience 13: 941-951 . Beaudet , L., Char ron, G . , Houle, D., Tretjakoff, I., Peterson, A . and Jul ien, J . P . (1992) Intragenic regulatory e lements contribute to transcriptional control of the neurofi lament light gene. G e n e 116: 205-214. 141 Behr, J . P . , Demeneix, B., Loeffler, J . P . and Perez-Mutu l , J . (1989) Efficient gene transfer into mammal ian primary edocr ine cel ls with l ipopolamine-coated D N A . Proceed ings of the National A c a d e m y of S c i e n c e s U S A 86: 6982-6986. Benovic , J .L . , Onorato, J . J . , Arr iza, J .L . , Stone, W . C . , Lohse , M.J . , Jenk ins , N.A., Gilbert, D.J . , Cope land , N .G. , Ca ron , M . G . and Lefkwoitz, R . J . (1991) C lon ing, express ion and chromosomal local izat ion of p-adrenergic receptor k inase 2. Journa l of Biological Chemist ry 266: 14939-14946. Bergold , P . J . , Casacc ia -Bonnef i l , P., X iu -L iu , Z . and Federoff, H .J . (1993) Transsynapt ic neuronal loss induced in h ippocampal s l ice cultures by a herpes s implex virus vector express ion the G l u R 6 subunit of the kainate receptor. P roceed ings of the National A c a d e m y of S c i e n c e s U S A 90: 6165-6169. Berr idge, M .J . (1993) Inositol t r isphosphate and calc ium signal l ing. Nature 361 : 315 -325 . Berste in, G . , Blank, J . , Smrcka , A . , Higashi j iwa, T., Sternweis, P. , Exton, J . and R o s s , E . M . (1992) Reconsti tut ion of agonist-st imulated phosphatidyl inositol 4,5-b isphosphate hydrolysis using purified m l muscar in ic receptor, G q / n , and phospho l ipase C - p 1 . Journal of Bio logical Chemis t ry 267: 8081-8088. B luml , K., Mutschler, E. and W e s s , J . (1994) Funct ional role in l igand binding and receptor activation of an asparag ine residue present in the sixth t ransmembrane domain of all muscar in ic acetylchol ine receptors. Journa l of Bio logical Chemist ry 269 : 18870-18876. Bonner , T.I. (1989) The molecular basis of muscar in ic receptor diversity. Trends in Neurosc ience 12: 148-151. Bonner , T.I., Young , A . C . , Brann, M.R. and Buck ley, N .J . (1988) C lon ing and express ion of the human and rat m5 muscar in ic acetylchol ine receptor genes . Neuron 1: 403-410. Bonner, T.I., Buckley, N.J . , Young , A . C . and Brann, M.R. (1987) Identification of a family of muscar in ic acetylchol ine receptor genes . Sc i ence 237: 527-537. Booy, F .P . , Newcomb, W.W. , Trus, B.L., Brown, J . C . , Baker, T . S . and Steven, A . C . (1991) Liquid-crystal l ine, phage-l ike packing of encaps i la ted D N A in herpes s implex virus. Ce l l 64: 1007-1015. Brann, M.R. , El l is, J . , Jo rgensen , H., Hi l l -Eubanks, D. and J o n e s , S . V . (1993) Muscar in ic acetylchol ine receptor subtypes: local izat ion and structure/function. Progress in Brain Research 98: 121-127. Bruni , R. and Ro izman , B. (1996) O p e n reading frame P- -a herpes s implex virus gene repressed during productive infection encodes a protein that binds a spl ic ing factor and reduces synthesis of viral proteins made from spl iced m R N A . Proceed ings of the National A c a d e m y of S c i e n c e s U S A 93: 10423-10427. 142 Buckley, N .J . (1990) Molecular pharmacology of c loned muscar in ic receptors. In: T ransmembrane Signal l ing. Intracellular messenge rs and implicat ions for drug development. S . R . Nahorsk i , E d . , John Wi ley & S o n s Ltd., London, U.K., pp. 11-30. Byrnes, A . P . , Rusby , J . E . , W o o d , M .J . and Char l ton, H .M. (1995) Adenov i rus- gene transfer causes inflammation in the brain. Neurosc ience 66: 1015-1024. Byrnes, A . P . , M a c L a r e n , R . E . and Char l ton, H .M. (1996) Immunological instability of persistent adenovi rus vectors in the brain: peripheral exposure to vector leads to renewed inf lammation, reduced gene express ion , and demyel inat ion. Journa l of Neurosc ience 16: 3045-3055. C a i , W . and Schaffer, P .A. (1992) Herpes s implex virus type 1 ICPO regulates express ion of immediate-early, early and late genes in productively infected cel ls. Journa l of Virology 66: 2904-2915. Campade l l i -F iume, G . , Arsenak is , M. , Farabegol i , F. and Ro izman , B. (1988) Entry of herpes s implex virus 1 in B J cel ls that constitutively express viral glycoprotein D is by endocytos is and results in the degradat ion of the virus. Journa l of Virology 62: 159-167. Carpenter , D .E . and S tevens , J . G . (1996) Long-term express ion of a foreign gene from a unique posit ion in the latent herpes s implex. Human G e n e Therapy 7(12): 1447-1454 . Carter, K.L. and Ro izman , B. (1996) The promoter and transcriptional unit of a novel herpes s implex virus 1 a lpha gene are conta ined in, and encode a protein in frame with, the open reading frame of the a lpha 22 gene. Journa l of Viro logy 70: 172-178. Cast i l lo, B., del Cerro, M. , Breakef ie ld, X . O . , Fr im, D.M. , Barnstable, C . J . , Dean , D.O. and Bohn , M . C . (1994) Retinal gangl ion cell survival is promoted by genetical ly modif ied astrocytes des igned to secrete brain-derived neurotropic factor. Brain Resea rch 647: 30-36. Caul f ie ld, M .P . (1993) Muscar in ic receptors-character izat ion, coupl ing and function. Pharmaco logy Therapeut ics 58: 319-379. Chabot , J . G . , Kar, S . and Quir ion, R. (1996) Autoradiographical and immunohis tochemical analys is of receptor local izat ion in the central nervous sys tem. Histochemistry Journal 28: 729-745. C h e n , X . , Schmidt , M . C , Go ins , W . F . and Glor ioso, J . (1995) Two herpes simplex virus type 1 latency-active promoters differ in their contributions to latency-assoc ia ted transcript express ion during lytic and latent infections. Journa l of Virology 69: 7899-7908. 143 Cook , M.L., Bastone, V . B . and S tevens , J . G . (1974) Ev idence that neurons harbor latent herpes s implex virus. Infection and Immunology 37: 946-951. Conkl in , B.R., Brann, M.R., Buckley, N .J . , M a , A .L . , Bonner, T.I. and Axel rod, J . (1988) Stimulation of arachidonic ac id re lease and inhibition of mi togenesis by c loned gene for muscar in ic receptor subtypes expressed in A 9 L cel ls . Proceed ings of the National A c a d e m y of S c i e n c e s U S A 85: 8698-8702. Cu lp , D.J . , Luo, W., R ichardson, L.A., Watson , G . E . and Latchney, L.R. (1996) Both m l and m3 receptors regulate exocr ine secret ion by mucous acini . Amer i can Journa l of Phys io logy 40: C 1 9 6 3 - C 1 9 7 2 . Cunn ingham, L.A., Short, M.P. , Breakef ie ld, X . O . and Bohn , M . C . (1994) Nerve growth factor re leased by t ransgenic astrocytes enhances the function of adrenal chromaffin cell grafts in a rat model of Park inson 's d i sease . Brain R e s e a r c h 658: 2 1 9 - 2 3 1 . Dai , Y . , Roman , M., Naviaux, R.K. and V e r m a , I.M. (1992) G e n e therapy v ia primary myoblasts: long-term express ion of factor IX protein following transplantation in vivo . Proceed ings of the National A c a d e m y of S c i e n c e s U S A 89: 10892-10895. Da les , S . and Chardonnet , Y . (1973) Ear ly events in the interaction of adenov i ruses with H e L a cel ls. IV. Assoc ia t ion with microtubles and the nuclear pore complex during vectorial movement of the inoculum. Virology 56: 465-483 . Danie l , S . O . , Neugeboren, B.A. and Mul igan, R . C . (1996) A stable human-der ived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes. Proceed ings of the Nat ional A c a d e m y of S c i e n c e s U S A 93: 11400-11406. Darby, G . , Fie ld, H .J . and Sal isbury, S . A . (1981) Al tered substrate specif icity of herpes s implex virus thymidine k inase confers acyclovir resistance. Nature 289: 81 -83 . D e L u c a , N.A. and Schaffer, P.A. (1985) Activat ion of immediate-early, early and late promoters by temperature-sensit ive and wild-type forms of herpes s imlex virus type 1 immediate early protein V P 1 7 5 . Journa l of Virology 36: 189-203. D e L u c a , N.A., McCar thy , A . M . and Schaffer, P .A. (1985) Isolation and character izat ion of deletion mutants of herpes s implex virus type 1 in the gene encoding immediate-early regulatory protein, ICP4. Journa l of Virology 56: 558-570 . De Stas io , P .R . and Taylor, M.W. (1990) Speci f ic effect of interferon on the herpes s implex virus type 1 transactivation event. Journal of Viro logy 64: 2588-2593. 144 Dichter, M.A. (1978) Rat cortical neurons in cel l culture: culture methods, cell morphology, electrophysiology, and synapse formation. Brain Resea rch 149: 279-2 9 3 . Dixon, R .A .F . , S iga l , I.S., Cande lo re , M.R., Register, R.B. , and Scat tergood, W. (1987) Structural features required for l igand binding to (3-adernergic receptor. E M B O Journa l 6: 3269-3275. Dobson , A T . , Margol is, T P . , Sedarat i , F., S tevens , J . G . and Fe ldman , L.T. (1990) A latent, nonpathogenic HSV-1 derived vector stably exp resses p-galactos idase in mouse neurons. Neuron 5: 353-360. Dobson , A T . , Sederat i , F., Dev i -Rao, G . , F lanagan, W . M . , Farrel l , M.F. , S tevens, J . G . , Wagner , E.K. and Fe ldman , L.T. (1989) Identification of the latency-assoc ia ted transcript promoter by express ion of rabbit p-glopin m R N A in mouse sensory nerve gangl ia latently infected with a recombinant herpes s implex virus. Journa l of Virology 63: 3844-3851 . Doran, S . E . , Ren , X . D . , Betz , A .L . , Page l , M.A., Neuwelt, E.A. , Roess ler , B . J . and Dav idson , B.L. (1995) G e n e express ion from recombinant viral vectors in the central nervous system after blood-brain barrier disruption. Neurosurgery 36: 965-970 . Dudai , Y . and Yav in , E. (1978) Ontogenes is of muscar in ic receptors and acety lchol inesterase in differentiating rat cerebral cel ls in culture. Brain Resea rch 155: 368-373. Eg i lmez , N.D., E w a n u m a , Y . and Bankert, R .B . (1996) Evaluat ion and optimization of different cationic l iposome formulations for in vivo gene transfer. Biochemistry and Biophysio logy R e s e a r c h Communica t ion 221 : 169-173. Epste in , N.A. (1962) Observat ions on the mode of re lease of herpes virus from infected H e L a cel ls. Journa l of Ce l l Biology 12: 589-597. Everett, R.D. (1984) Trans-act ivat ion of transcription by herpes virus products: requirement for two HSV-1 immediate-ear ly polypept ides for max imum activity. E M B O Journal 3: 3135-3141. Faber , S .W. and Wi lcox, K .W. (1986) Assoc ia t ion of the herpes s implex virus regulatory protein ICP4 with specif ic nucleot ide s e q u e n c e s in D N A . Nucle ic Ac ids Resea rch 14: 6067-6083. Federoff, H.J . , Geschw ind , M.D., Gel ler, A.I. and Kess ler , J .A . (1992) Express ion of N G F in vivo , from a defective HSV-1 vector, prevents effects of axotomy on sympathet ic neurons. Proceed ings of the National A c a d e m y of Sc iences U S A 89: 1636-1640 . 145 Field, J . , N ikawa, J - l , Broek, D., MacDona ld , B., Rodgers , L., Wi lson, I.A., Lerner, R.A. and Wigler, M. (1988) Purif ication of a R A S - r e s p o n s i v e adenylyl cyc lase complex from saccharomyces cervisiae by use of an epitope addition method. Molecu lar and Cel lu lar Biology, 8: 2159-2165. Fink, D., D e L u c a , N., Go ins , W . and Glor ioso, J . (1996) G e n e transfer into neurons using herpes s implex v i rus-based vectors. Annua l Rev iew of Neurosc ience 19: 265 -287 . Fink, D .J . , Sternberg, L.R., Weber , P . C . , Mata , M. , Go ins , W . F . and Glor ioso, J . C . (1992) In vivo express ion of (3-galactosidase in h ippocampal neurons by H S V -mediated gene transfer. Human G e n e Therapy 33 : 11-19. Fisher, K . J . , G a o , G - P . , Wei tzman, M.D., DeMatteo, R., Burda, J . F . and Wi lson, J . M . (1996) Transduct ion with recombinant adeno-assoc ia ted virus for gene therapy is limited by leading-strand synthesis. Journa l of Virology 70: 520-532. F isher , K .F . , C h o i , H., Burda, J . , C h e n , S . and Wi lson , J . M . (1996) Recombinant adenovirus deleted of all viral genes for gene therapy of cyst ic f ibrosis. Virology 217: 11-22. Fraefe l , C , S o n g , S . , L im, F., Lang , P., Y u , L , W a n g , Y . , Wi ld , P. and Gel ler , A.I. (1996) Helper virus-free transfer of herpes s implex virus type 1 p lasmid vectors into neural cel ls . Journal of Virology 70: 7190-7197. Fr iden, P . M . , Walus , L.R., Watson, P., Doctrow, S .R . , Kozar ich , J .W. , Backman , C . Bergman, H., Hoffer, B., B loom, F. and Granho lm, A - C . (1993) Blood-brain barrier penetration and in vivo activity of an N G F conjugate. Sc i ence 259: 373-376. Ga lper J . B . , Dz iekan L .C. , O 'Hara D.S. and Smith T .W. (1982) The biphasic response of muscar in ic chol inergic receptors in cultured heart cel ls to agonist: effects on receptor number and affinity in intact cel ls and homogenates. Journal of Biological Chemis t ry 247: 10344-10356. Gar land, A . M . , Grady, E.F. , Lovette, M. , V igna , S . R . , Frucht, M.M. , Krause, J . E . and Bunnett, N.W. (1996) Mechan i sms of desensi t izat ion and resensit izat ion of G -prote in-coupled neurokin in i and neurokinin2 receptors. Molecu lar Pharmaco logy 49: 438-446. Gel ler , A.I., During, M.J . , Haycock, J .W. , F reese , A . and Neve, R.L. (1993) Long-term inc reases in neurotransmitter re lease from neuronal cel ls express ing a constitutively active adenylate cyc lase from a HSV-1 vector. Proceed ings of the National A c a d e m y of Sc iences U S A 90: 7603-7607. Gel ler , A.I. and Breakef ie ld, X . O . (1988) A defect ive HSV-1 vector exp resses Escherichia coli (3-galactosidase in cultured peripheral neurons. Sc i ence 241 : 1667-1669 . 146 G h o s h , A . and Greenberg , M .E . (1995) Distinct roles for b F G F and NT-3 in the regulation of cortical neurogenes is . Neuron 15: 89-103. Gloster, A . , W u , W., Spee lman , A. , We iss , S . , Caus ing , C , Pozn iak , C , Reyno lds , B., C h a n g , E., T o m a , J . G . and Miller, F .D. (1994) The T a lpha 1 alpha-tubulin promoter speci f ies gene express ion as a function of neuronal growth and regenerat ion in t ransgenic mice. Journa l of Neurosc ience 14: 7319-7330. Go ins , W.F . , Sternberg, L.R., C roen , K.D., Krause, P.R. , Hendr icks, R.L., Fink, D.J . , St raus, S . E . , Levine, M. and Glor ioso, J . C . (1994) A novel latency-act ive promoter is conta ined within the herpes s implex virus type 1 U|_ f lanking repeats. Journal of Virology 68: 2239-2252. Go ld in , A .L . , Sandre-Go ld in , R .M . , Lev ine, M. and Glor ioso, J . C . (1981) C lon ing of herpes s implex virus type 1 s e q u e n c e s representing the whole genome. Journal of Virology 38: 50-58. Good ing , L.R. and Wo ld , W . S . M . (1990) Molecular mechan isms by which adenov i ruses counteract antiviral immune defenses . Crit ical Rev iew of Immunology 10: 53-71. G r a h a m , F.L. and Smi ley, J . (1977) Character is t ics of a human cel l line transformed by D N A from human adenovi rus type 5. Journa l of Genera l Virology 36: 59-74. G r a h a m , F.L. (1984) Covalent ly c losed circles of human adenovi rus D N A are infectious. E M B O Journal 3: 2917-2922. Gruenhe id , S . , Ga tzke , L., Meadows , H. and Tufaro, F. (1993) Herpes s implex virus infection and propagation in mouse L cell mutant lacking heparan sulfate proteoglycans. Journal of Virology 67: 93-100. G u , B., Kuddus , R. and D e L u c a , N.A. (1995) Repress ion of act ivator-mediated transcription by herpes s implex virus ICP4 v ia a mechan ism involving interactions with the basal transcription factors TATA-b ind ing protein and TFIIB. Molecu lar and Cel lu lar Bio logy 15: 3618-3626. G u , B., R ive ra -Gonza lez , R., Smith C . A . and D e L u c a , N.A. (1993) Herpes s implex virus infected cel l polypeptide 4 preferentially represses Sp1-act iva ted over basa l transcription from its own promoter. Proceed ings of the Nat ional A c a d e m y of S c i e n c e s U S A 90: 9528-9532. Haga , K. and Haga,T. (1983) Affinity chromatography of the muscar in ic acetylchol ine receptor. Journal of Bio logical Chemist ry 258 : 13575-13579. Hall , J .D . , C o e n , D.M., Fisher, B.L., Weissl i tz , M. , Randal l , S . , A lmy, R .E . , Ge lep , P.T and Schaffer, P .A. (1984) Generat ion of genetic diversity in herpes s implex virus: an antimutator phenotype maps to the D N A polymerase locus. Virology 132: 26-37. 147 Hammer , R., Berr ie, C P . , Birdsal l , N .J .M . , Burgen, A . S . V . and Hume, E . C . (1980) P i renzep ine dist inguishes between different subc lasses of muscar in ic receptors. Nature 283 : 90-92. Hammer , R., Gira ldo, E. , Sch iav i , G . B . , Monferini, E. and Landisnsky, H. (1986) Binding profile of a novel cardioselect ive muscar in ic receptor antagonist, A F - D X 116, to membranes of peripheral t issues and brain in the rat. Life S c i e n c e s 38: 1653-1662 . Herron, G . S . and Schimerl ik, M.I. (1983) Glycoprote in propert ies of solubi l ized atrial muscar in ic receptors. Journal of Neurochemistry 41 : 1414-1420. Ho, D.Y., Mocarsk i , E . S . and Sapo lsky , R . M . (1993) Altering central nervous sys tem physiology with a defective herpes s implex virus vector express ing the g lucose transporter gene. Proceed ings of the National A c a d e m y of S c i e n c e s U S A 90: 3655-3659. Hof land, H . E . J . , Shephard , L. and Sul l ivan, S . M . (1996) Format ion of stable cationic l ip id/DNA comp lexes for gene transfer. Proceed ings of the National A c a d e m y of S c i e n c e s U S A 93: 7305-7309. Hol lenberg, M.D. and Cua t recasas , P. (1979) Distinction of receptor from non-receptor interactions in binding studies. In: The receptors: a comprehens ive treatise. R.D. O'Br ien, E d . , P lenum Press , New York, N.Y., pp.193-214. Honess , R.W. and R o i z m a n , B. (1974) Regulat ion of herpesvirus macromolecu lar synthesis. I. C a s c a d e regulation of the synthesis of three groups of viral proteins. Journal of Virology 14: 8-19. Horel lou, P., Brundin, P. , Ka len , P., Mallet, J . and Bjorklund, A . (1990) In vivo re lease of dopa and dopamine from genetical ly engineered cel ls grafted to the denervated rat striatum. Neuron 5: 393-402. Hulme, E . C , Birdsal l , J . M . and Buckley, N .J . (1990) Muscar in ic receptor subtypes. Annua l Rev iew of Pharmaco logy and Toxico logy 330: 633-673 . Huse , W.D. , Sastry, L , Iverson, S .A . , Kang , A . S . , A l t ing-Mees, M., Burton, D.R., Benkov ic , S . J . and Lerner, R.A. Generat ion of a large combinator ial library of the immunoglobul in repertoire in phage lambda. (1989) S c i e n c e 246: 1275-1280. J iao , S . , Gurev ich , V . and Wolff, J .A . (1993) Long-term correction of rat model of Park inson 's d isease . Nature 362: 450-455. J iao , S . , C h e n g , L, Wolff, J . A . and Y a n g , N-S . (1993) Part ic le bombardment-mediated gene transfer and express ion in rat brain t issues. B io techn iques 11: 497 -502 . 148 J in , B.I., Bel loni , M. , Cont i , B., Federoff, H.J . , Starr, R., S o n , J . H . , Baker , G . and Joh , T . H . (1996) Pro longed in vivo gene express ion driven by a tyrosine hydroxylase promoter in a defective herpes s implex virus ampl icon vector. Human G e n e Therapy 7 (16): 2015-2024. Johnson , K .C . , Frame, M . C , L igas, M.W., C r o s s , A . M . and Stow, N.D. (1988) Herpes s implex virus immunoglobul in G F c receptor activity depends on a complex of two viral glycoproteins, g E and g l . Journal of Virology 62: 1347-1354. Johnson , P.A. , Miyanohara, A . , Lev ine, F., Cahi l l , T. and Fr iedmann, T. (1992) Cytotoxicity of a replication-defective mutant of herpes s imlpex virus type 1. Journa l of Virology 66: 2952-2965. Johnson , P.A. , Yosh ida , K., G a g e , F .H . and Fr iedman, T. (1992) Effects of gene transfer into cultured C N S neurons with a repl ication-defective herpes s implex virus type 1 vector. Molecular Brain Resea rch 12: 95-102. J o h n s o n , P.A. , W a n g , M .J . and Fr iedmann, T. (1994) Improved cell survival by the reduction of immediate-early gene express ion in repl ication-defective mutants of herpes s implex virus type 1 but not by mutation of the virion host shutoff function. Journa l of Virology 68: 6347-6362. Kaplitt, M . G . , Kwong, A .D . , K leopoulos, S . P . , Mobbs , C .V . , Rabk in , S . D . and Pfaff, D.W. (1994) Preproenkephal in promoter y ie lds region-specif ic and long-term express ion in adult brain after direct in vivo gene transfer v ia a defective herpes s implex viral vector. Proceed ings of the National A c a d e m y of S c i e n c e s U S A 91: 8 9 7 9 - 8 9 8 3 . Karpat i , G . , Lochmul ler, H., Nalbantoglu, J . and Durham, H. (1996) The principles of gene therapy for the nervous sys tem. Trends in Neurosc ience 19: 49-54. Kat ter-Cooley, P. and Wi lcox, K.W. (1989) Character izat ion of the DNA-b ind ing propert ies of herpes simpl lex virus regulatory protein ICP4. Journa l of Virology 63: 696 -704 . Kawaguch i , Y . , Bruni, R. and Ro izman , B. (1997) Interaction of herpes s implex virus 1 a regulatory protein ICPO with elongation factor 1y: ICPO affects translational machinery. Journal of Virology 71 : 1019-1024. Kenak in , T. (1995b) Agonist-receptor eff icacy. II. Agonist trafficking of receptor s ignals . Trends in Pharmaco log ica l S c i e n c e s 16: 232-238. Kenak in , T. (1995a) Agonist-receptor eff icacy. I. Mechan i sms of eff icancy and receptor promiscuity. Trends in Pharmaco log ica l S c i e n c e s 16: 188-192. Kle in, T . M . , Wolf, E.D. , W u , R. and Sanford, J . C . (1987) High-velocity microprojecti les for delivering nucleic ac ids into living cel ls . Nature 327 : 70-73. 149 Klemperer , H .G. , Haynes , G .R . , Sheddon , W.I .H. and Watson , D.H. (1967) A virus-speci f ic thymidine k inase in B H K 21 d cel ls infected with herpes s implex virus. Virology 31 : 120-128. Klotz, I.M. (1982) Numbers of receptor sites from Scatchard graphs: facts and fantasies. Sc i ence 217: 1247-1249. Kn ipe , D .M. , Ruyechan , W.T. , Ro i zman , B. and Hall iburton, J . W . (1978) Molecular genet ics of herpes s implex virus: demonstrat ion of regions of obligatory and nonobl igatory identity within diploid regions of the genome by sequence replacement and insertion. Proceed ings of the National A c a d e m y of S c i e n c e s U S A 75 : 3896-3900. Kobayash i , K., S a s a o k a , T., Morita, S . , Nagatsu, I., Iguchi, A . , Ku rosawa , Y . , Fujita, K., Nomura, T., K imura, M., Katsuki , M. and Nagatsu , T. (1992) Genet ic alteration of catecholamine specif icity in t ransgenic mice. P roceed ings of the National A c a d e m y of S c i e n c e s U S A 89: 1631-1635. Koen ig , J .A . and Edwardson , J . M . (1996) Intracellular trafficking of the muscar in ic acetylchol ine receptor: importance of subtype and cell type. Molecu lar Pharmaco logy 49: 351-359. Kosik , K .S . and F inch, E.A. (1987) M A P 2 and tau segregate into dendritic and axonal domains after the elaboration of morphological ly distinct neurites: an immunocytochemical study of cultured rat cerebrum. Journa l of Neurosc ience 7: 3 1 4 2 - 3 1 5 3 . Kr iegstein, A . R . and Dichter, M.A. (1983) Morphological c lassi f icat ion of rat cortical neurons in cell culture. Journa l of Neurosc ience 3: 1634-1647. Kr is tensson, K., Lycke, E. , Roytta, M., Svennerho lm, B. and Vah lne , A . (1986) Neuritic transport of herpes s implex virus in rat sensory neurons in vitro. Effects of subs tances interacting with microtubular function and axonal flow. Journa l of Genera l Virology 67: 2023-2028. Kuddas , R., G u , B. and D e L u c a , N.A. (1995) Relat ionship between TATA-b ind ing protein and herpes s implex virus type 1 ICP4 DNA-b ind ing si tes in complex formation and repression of transcription. Journa l of Viro logy 69: 5568-5575. Kunke l , M.T. and Peral ta, E . G . (1993) Cha rge amino ac ids required for signal transduction by the m3 muscar in ic acety lchoine receptor. E M B O Journal 12: 3 8 0 9 - 3 8 1 5 . Kwong , A . D . and Frenkel , N. (1987) Herpes s implex virus-infected cel ls contain a function(s) that destabi l izes both host and viral m R N A s . Proceed ings of the National A c a d e m y of S c i e n c e s U S A 84: 1926-1930. Kwong , A . D . and Frenkel , N. (1989) The herpes s implex virus virion host shutoff function. Journa l of Virology 63: 4834-4839. 150 Kwong , A . D . , Kruper, J . A . and Frenkel , N. (1988) Herpes s implex virus virion host shutoff function. Journa l of Virology 62: 912-921 . Lagunoff, M. and Ro i zman , B. (1995) The regulation of synthesis and propert ies of the protein product of open reading frame P of the herpes s implex virus 1 genome. Journa l of Virology 69: 3615-3623. Lagunoff, M . and Ro i zman , B. (1994) Express ion of a herpes s implex virus 1 open reading frame ant isense to the y-|34.5 gene and transcr ibed by an R N A 3' coterminal with the unspl iced la tency-assoc ia ted transcript. Journa l of Viro logy 68: 6021 -6028 . Lanius, R.A. , Pasqualot to , B.A. and Shaw, C . A . Age-dependent express ion , phosphorylat ion and function of neurotransmitter receptors: pharmacolog ica l implicat ions. Trends in Pharmolog ica l S c i e n c e s 14: 403-408. Lawrence, M.S. , Dora , Y . , Ho, R.D. and Sapo losky , R . M . (1995) Herpes s implex virus vectors overexpress ing the g lucose transporter gene protect against se izure-induced neuron loss. Proceed ings of the Nat ional A c a d e m y of S c i e n c e s U S A 92: 7 2 4 7 - 7 2 5 1 . Lechleiter, J . , Hel lmiss, R., Duerson, K., Ennulat, D., David, N., C l a p h a m , D. and Peral ta, E. (1990) Distinct sequence e lements control the specif icity of G protein activation by muscar in ic acety lchoine receptor subtypes. E M B O Journa l 9: 43381 -43390 . Le G a l L a Sa l le , G . , Robert, J . J . , Berrard, S . , Ridoux, V. , Stratford-Perricaudet, L.D., Perr icaudet, M. and Mallet, J . (1993) A n adenovi rus vector for gene transfer into neurons and glia in brain. Sc i ence 259: 988-990. Leopardi , R., Michae l , N. and Ro izman , B. (1995) Repress ion of the herpes s implex virus 1 a 4 gene by its gene product ( ICP4) is condit ioned by the distance and the stereoaxial al ignment of the ICP4 binding site relative to the T A T A box. Journa l of Virology 69: 3042-3048. Leopardi , R., Ward , P.L. , Og le , W . O . and Ro i zman , B. (1996) Assoc ia t ion of herpes s implex virus regulatory protein ICP22 with transcript ional comp lexes containing E A P , ICP4 , R N A polymerase II and viral D N A requires posttranslational modif ication by the U L 1 3 protein k inase. Journa l of Virology 71 : 1133-1139. Lesoon -Wood , L.A., K im, W . H . and K le inman, H.K. (1995) Sys temic gene therapy with p53 reduces growth and metastases of a malignant human breast cancer in nude mice. Human G e n e Therapy 6: 395-405. Levey, A . J . , Kitt, C .A . , S imonds , W.F . , Pr ice, D.L. and Brann, M. (1991) Identification and local izat ion of muscar in ic acetylchol ine receptor proteins in brain with subtype-speci f ic ant ibodies. Journa l of Neurosc ience 11: 3218-3226. 151 Levey, A . J . (1992) Immunological local ization of m1-m5 muscar in ic acetylchol ine receptors in peripheral t i ssues and brain. Life Sc i ences 52: 441-448 . Lewis, J . G . , L in, K., Kothavale, A . , F lanagan, W . M . , Matteucci, M.D., Depr ince, R.B. , Mook, R.A., Hendren, R.W. and Wagner , R.W. (1996) A serum-resistant cytofectin for cel lular del ivery of an t isense ol igodeoxynucleot ides and p lasmid D N A . Proceed ings of the National A c a d e m y of S c i e n c e s U S A 9: 3176-3181 . Li les, W . C . and Nathanson, N . M . (1983) Regulat ion of neuronal muscar in ic receptor number by protein glycosylat ion. Journal of Neurochemistry 46: 85-95. Lim, F., Hartley, D., Starr, P., Lang , P., Y u , L , W a n g , Y . and Gel ler, A.I. (1996) Generat ion of high-titer defect ive HSV-1 vectors using an IE2 delet ion mutant and quantitative study of express ion in cultured cortical cel ls. B io techniques 20: 460-469 . L inden, R .M . , Ward , P., G i raud, C , Winocour, E. and Berns, K.I. (1996) Si te-speci f ic integration by adeno-assoc ia ted virus. Proceed ings of the Nat ional A c a d e m y of Sc i ences U S A 93 : 11288-11294. Lo, D.C. , McAll ister, A . K . and Katz , L .C . (1994) Neuronal Transfect ion in Brain s l ices using part ic le-mediated gene transfer. Neuron 13: 1265-1268. Lokensgard , J . R . , B loom, D.C. , Dobson , A T . and Fe ldman, L.T. (1994) Long-term promoter activity during herpes s implex virus latency. Journa l of Vi ro logy 68: 7148 -7158 . Lopez - l l asaca , M., C respo , P. , Pel l ic i , G . P . , Gutki ind, J . S . and Wetzker , R. (1997) L inkage of G protein-coupled receptors to the M A P K signal ing pathway through PI -k inase y. S c i e n c e 275: 394-397 Maggio, R., Barbier, P., Fornal i , F. and Cors in i , G . U . (1996) Funct ional role of the third cytoplasmic loop in muscar in ic receptor dimerizat ion. Journa l of Bio logical Chemist ry 271 : 31055-31060. Maggio, R., Voge l , Z . and W e s s , J . (1993) Reconsti tut ion of functional muscar in ic receptors by co-express ion of amino- and carboxyl-terminal receptor f ragments. F E B S Letters 319: 195-200. Marconi , P., Krisky, D., Ol igino, T., Pol iani , P.L. , Ramakr ishnan, R., Go ins , W .F . , Fink, D.J . and Glor ioso, J . C . (1996) Repl icat ion-defect ive herpes s implex virus vectors for gene transfer in vivo . P roceed ings of the National A c a d e m y of S c i e n c e s U S A . 93: 11319-11320. Margol is, T . P . , Sedarat i , F., Dobson , A T . , Fe ldman, L.T. and S tevens , J . G . (1992) Pathways of viral gene express ion during acute neuronal infection with H S V - 1 . Virology 189: 150-160. 152 Mates ic , D.F., Manning, D.R. and Luthin, G . R . (1991) T issue-dependent assoc ia t ion of muscar in ic acety lchol ine receptors with guanine nucleot ide-binding regulatory proteins. Molecu lar Pharmaco logy 40: 347-353 . Mav romara -Nazos , P. , Acke rmann , M. and Ro i zman , B. (1986) Construct ion and propert ies of a viable herpes s implex virus 1 recombinant lacking coding sequences of the a 4 7 gene. Journal of Virology 60: 807-812. McCar thy , A . M . , M c M a h a n , L. and Shaffer, P .A. (1989) Herpes simplex virus type 1 ICP27 deletion mutants exhibit altered patterns of transcription and are D N A deficient. Journal of Virology 63: 18-27. McCormick , D.A. and Pr ince, D.A. (1985) Two types of muscar in ic responses to acetylchol ine in mammal ian cortical neurons. P roceed ings of the Nat ional A c a d e m y of S c i e n c e s U S A 82: 6344-6348. McDona ld , T.V. , Premack , B.A. and Gardner , P. (1993) F lash photolysis of caged inositol-1,4,5-tr iphosphate activates p lasma membrane ca lc ium current in human T cel ls . Journa l of Biological Chemist ry 268: 3889-3896. Michae l , N. and Ro i zman , B. (1993) Repress ion of the herpes s implex virus a 4 gene by its gene product occurs within the context of the viral genome and is assoc ia ted with all three identified cognate sites. P roceed ings of the Nat ional A c a d e m y of S c i e n c e s U S A 90: 2286-2290. Mitchel l , W . J . (1995) Neurons differentially control express ion of a herpes s implex virus type 1 immediate-ear ly promoter in t ransgenic mice. Journa l of Virology 69: 7 9 4 2 - 7 9 5 0 . Morgan , C , R o s e , H .M. and Medn is , B. (1968) Electron microscopy of herpes s implex virus 1 entry. Journal of Virology 2: 507-516. Mrzljak, L , Levey, A . J . and Go ldman-Rak ic , P . S . (1993) Assoc ia t ion of m l and m2 muscar in ic receptor proteins with asymmetr ic s y n a p s e s in the primate cerebral cortex: morphological ev idence for chol inergic modulat ion of excitatory neurotransmiss ion. Proceed ings of the National A c a d e m y of S c i e n c e s U S A 90: 5194 -5198 . Nabe l , G . J . , R ice , S .A . , Knipe, D.M. and Balt imore, D. (1988) Alternative mechan isms for activation of human immunodef iecency virus enhancer in T cel ls. S c i e n c e 239: 1299-1302. Naldini, L., Blomer, U., Gal lay, P., Ory, D., Mul l igan, R., G a g e , F., Ve rma , I.M. and Trono, D. (1996a) In vivo gene delivery and stable transduct ion of nondividing cel ls by a leniviral vector. Sc ience 272: 263-266. Naldini, L., Blomer, U., G a g e , F .H . , Trono, D. and V e r m a , I.M. (1996b) Efficient transfer, integration, and susta ined long-term express ion of the t ransgene in adult 153 rat brains infected with a lentiviral vector. Proceed ings of the National A c a d e m y of S c i e n c e s U S A 93: 11382-11388. Nathanson, N.M. , Go ldman , P . S . , Habecker , B.A., M igeon, J . C . , Morton, M .E . , Tietje, K . M . and van Koppen , C . J . (1992) Ana lys is of muscar in ic acetylchol ine receptor express ion and function. In: Methods in Neurosc ience, Vo l . 9. P . M . C o n n , E d . , A c a d e m i c P ress , Inc., pp. 116-133. Na thanson , N .M. (1987) Molecular propert ies of the muscar in ic acetylchol ine receptor. Annua l Rev iew of Neurosc ience 10: 195-236. Na thanson , N .M. (1983) Binding of agonists and antagonists to muscar in ic acetylchol ine receptors on intact cultured heart cel ls. Journa l of Neurochemistry 4 1 : 1545-1548. Naume , B., Gately, M. and Espevik , T. (1992) A comparat ive study of IL-12 (cytotoxic lymphocyte maturation factor), IL-2-, and IL-7-induced effects on immunomagnet ical ly purified C D 5 6 + N K cel ls. Journa l of Immunology 148: 2429-2436 . Ni tsch, R., S lack , B., Wur tman, R. and Growdon , J . H . (1992) Re lease of A lzhe imer amylo id precursor derivatives st imulated by activation of muscar in ic acetylchol ine receptors. Sc ience 258: 304-307. O 'Hare , P. and Hayward, G . S . (1985) Ev idence for a direct role for both the 175,000- and 110,000-molecular-weight immediate-ear ly proteins of herpes s implex virus in the transactivation of delayed-ear ly promoters. Journal of Virology 53: 751-760. O 'Hare , P. and Hayward, G . S . (1989) Compar i son of upstream sequence requirements for posit ive and negat ive regulation of a herpes s implex virus immediate-ear ly gene by three v i rus-encoded frans-acting factors. Journal of Viro logy 61 : 190-199. O h k u m a , S . , Kishi , M. , M a , F -H . and Kur iyama, K. (1992) Assoc ia t ion of functional alteration in intracellular s ignal transduct ion sys tems with the occur rence of up-regulation of muscar in ic receptors in primary cultured neurons. Progress ive Neuro-Psychopharma log ica l and Bio logical Psychiat ry 16: 413-424. O h k u m a , S . , Kishi , M., M a , F -H . and Kur iyama, K. (1990) Alterations in receptor-coup led second messenger sys tems at up-regulated muscar in ic receptors: analys is using primary cultured neurons. European Journa l of Pharmaco logy 189: 277 -285 . Onrust, R., Herzmark, P., Ch i , P., Garc ia , P .D. , Lichtarge, O., Kingsley, C . and Bourne, H.R. (1997) Receptor and (3y binding sites in the a subunit of the retinal G protein t ransducin. Sc i ence 275 : 381-384. 154 Palmer, S . , Hughes , K.T., Lee , D.Y. and W a k e l a m , M .J . (1989) Development of a novel , lns(1,4,5)P3-specific binding assay . Its use to determing the intracellular concentrat ion of lns (1 ,4 ,5 )P 3 in unstimulated and vasopress in-s t imulated rat hepatocytes. Cel lu lar Signal l ing 1: 147-156. Pa ra , M. , Baucke , R. and Spear , P . G . (1980) Immunoglobulin G (Fc)-binding receptors on vir ions of HSV-1 and transfer of these receptors to the cell surface. Journal of Virology 34: 512-520. Paterson, T. and Everett, R .D. (1988) Mutational d issect ion of the HSV-1 immediate-ear ly protein V m w 1 7 5 involved in transcript ional transact ivat ion and repression. Virology 166: 186-196. Pechan , P.A. , Fotaki, M., Tompson , R.L., Dunn, R., C h a s e , M., C h i o c c a , E.A. and Breakf ield, X . O . (1996) A novel piggyback packag ing vector sys tem for herpes s implex virus ampl icon vectors. Human G e n e Therapy 7(16): 2003-2013. Pedder , E.K. , Eve le igh, P. , Poyner , D., Hulme, E . C . and Birdsal l , N . J . M . (1991) Modulat ion of the structure-binding relat ionships of antagonists for muscar in ic acetylchol ine receptor subtypes. British Journa l of Pharmaco logy 103: 1561-1567. Peral ta, E . G . , Winstow, J .W. , Pererson, G.L . , Smith, D.H. , Ashkenaz i , A . , Ramachandran , J . , Schmerl ik , M . and C a p o n , D .J . (1987a) Pr imary structure and biochemical properties of an m2 muscar in ic receptor. S c i e n c e 236: 600-605. Peral ta, E . G . , Ashkenaz i , A . , Winstow, J .W. , Smith, D.H. , Ramachandran , J . , Schmerl ik , M. and C a p o n , D .J . (1987b) Distinct primary structures, l igand binding properties and t issue-speci f ic express ion of four human muscar in ic acetylchol ine receptors. E M B O Journal 6: 3923-3929. Pere i ra , F.A. (1996) Cont inue medical educat ion: Herpes s implex: evolving concepts . Journal of Amer ican A c a d e m y of Dermatology 35: 503-520. Perna , J . J . , Mannix, M.L., Rooney , J . F . , Notkins, A . L . and Straus, S . E . (1987) React ivat ion of latent herpes s implex virus infection by ultraviolet light: a human model . Journa l of Amer ican A c a d e m y of Dermatology 17: 473-478. Pippig, S . , Andexinger , S . and Lohse , M .J . (1995) Sequestrat ion and recycl ing of (32-adrenergic receptors permit receptor resensi t izat ion. Molecu lar Pharmaco logy 47: 666-676. Post , L .E . and Ro i zman , B. (1981) A genera l ized technique for deletion of specif ic genes in large genomes : a gene 22 of herpes s imlex virus 1 is not essent ia l for growth. Ce l l 25 : 227-232. Premont, R.T., Koch , W . J . , Inglese, J . and Lefkowitz, J . J . (1995) Protein k inases that phosphorylate act ivated G protein-coupled receptors. Journa l of Biological Chemist ry 269: 6832-6841 . 155 Preston, C M . , Frame, M . C and Campbe l l , M . E . M . (1988) A complex formed between cell components and an H S V structural polypeptide binds to a viral immediate-early gene regulatory D N A sequence . Ce l l 52: 425-434. Purves , F . C , Og le , W . O . and R o i z m a n , B. (1993) P rocess ing of herpes s implex virus regulatory protein a 2 2 mediated by the U L 1 3 protein k inase determines the accumulat ion of a subset of a and y m R N A s and protein in infected cel ls. Proceed ings of the National A c a d e m y of S c i e n c e s U S A 90: 6701-6705. Ramakr ishnan, R., Fink, D.J . , Gu ihua , J . , Desa i , P. , Glor ioso, J . C and Levine, M . (1994) Compet i t ive quantitative P C R analys is of herpes s implex virus t ype l D N A and L A T R N A in latently infected cel ls of the rat brain. Journa l of Virology 68 : 1864-1873 . R e a d , G . S . and Frenkel , N. (1983) Herpes s implex virus mutants defective in the vi r ion-associated shutoff of host polypept ide synthesis and exhibit ing abnormal synthesis of a lpha (immediate-early) viral polypept ides. Journa l of Virology 46 : 498 -512 . R ice , S .A . , Long , M . C , L a m , V . , Schaf fer , P .A . and Spencer , C A . (1995) Herpes s implex virus immediate-early protein ICP22 is required for viral modif ication of host R N A po lymerase 11 amd establ ishment of the normal viral transcription program. Journal of Virology 69: 5550-5559. R ice , S . A . and Knipe, D .M. (1990) Genet ic ev idence for two distinct transactivation functions of the herpes s implex virus a protein ICP27 . Journa l of Virology 64: 1704-1715 . R ice , S .A . and Knipe, D .M. (1988) Gene-spec i f i c transactivation by herpes s implex virus type 1 a lpha protein ICP27 . Journal of Virology 62: 3814-3823. Ro i zman , B. (1996) The function of herpes s implex virus genes : A primer for genetic engineer ing of novel vectors. P roceed ings of the National A c a d e m y of S c i e n c e s U S A 93: 11307-11312. Ro i zman , B. and Sea rs , A . E . (1996) Herpes s implex v i ruses and their replication. In: Fie lds ' virology, 3rd ed . B .N . Fie lds et al . , Eds . , Raven Press , New York, N.Y., pp .2231-2295 . Ro i zman , B. (1993) The family herpesvir idae: a brief introduction. In: The human herpesviruses. B. Ro izman et al . , Eds . , Raven Press , New York, N.Y., pp. 1-9. Ro izman , B. and Ba ines , J . (1991) The diversity and unity of Herpesviridae. Comprehens ive Immunology, Microbio logy, and Infectious D i seases 14: 6-79. Ro izman , B. and Jenk ins , F . J . (1985) Genet ic engineer ing of novel genomes of large D N A vi ruses. Sc i ence 129: 1208-1218. 156 R o i z m a n , B. and Fur long, D. (1974) The replication of herpes-v i ruses. In: Comprehens ive virology, Vo l .3 . H. Fraenkel -Conrat and R.R. Wagner , E d s . , P lenum P r e s s , New York, N.Y., pp. 229-240. Saman iego , L.A., Webb , A.I. and D e L u c a , N.A. (1995) Funct ional interactions between herpes s implex virus immediate-ear ly proteins during infection: gene express ion as a consequence of ICP27 and different domains of ICP4 . Journa l of Vi ro logy 69: 5705-5715. Sambrook , J . , Fri tsch, E .F . and Maniat is, T. (1989) Molecular c loning: a laboratory manual . 2nd ed . , Co ld Spr ing Harbor Laboratory P r e s s , Co ld Spr ing Harbor, N.Y. Sandr i -Go ld in , R . M . , Hibbard, M.K. and Hardwicke, M.A. (1995) The C-terminal repressor region of herpes s implex virus type 1 ICP27 is required for the redistribution of smal l nuclear r ibonucleoprotein part icles and spl ic ing factor S C 3 5 : however, these alterations are not sufficient to inhibit host cell spl ic ing. Journal of Viro logy 69: 6063-6076. Sawtel l , N .M. and Thompson , R.L. (1992) Rap id in vivo reactivation of herpes s implex virus in latently infected murine gangl ionic neurons after transient hyperthermia. Journal of Viro logy 66: 2150-2156. Schoneberg , T., L iu, J . and W e s s , J . (1995) P l a s m a membrane local izat ion and functional rescue of truncated forms of a G protein-coupled receptor. Journa l of Bio logical Chemist ry 270: 18000-18006. Sea rs , A . E . , Hall iburton, I.W., Meignier, B., Si lver, S . and Ro i zman , B. (1985) Herpes s implex virus 1 mutant deleted in the a lpha 22 gene: growth and gene express ion in permissive and restrictive cel ls and establ ishment of latency in mice. Journa l of Virology 55: 338-346. Shepard , A .A . , Imbalzano, A . N . and D e L u c a N.A. (1989) Separat ion of primary structural components conferr ing autoregulat ion, transact ivat ion, and DNA-b ind ing properties to the herpes s implex virus transcriptional regulatory protein ICP4 . Journa l of Virology 65: 787-795 . Smibert, C .A . , Popova , B., X iao , P., C a p o n e , J . P . and Smi ley, J . R . (1994) Herpes s implex virus V P 1 6 forms a complex with the virion host shutoff protein vhs . Journa l of Virology 68: 2339-2346. Smibert, C .A . , Johnson , D .C. and Smi ley , J . R . (1992) Identification and characterizat ion of the vir ion- induced host shutoff product of herpes s imlex virus gene U L 4 1 . Journal of Genera l Virology 73 : 467-479. Smibert , C . A . and Smi ley, J . R . (1990) Differential regulation of endogenous and t ransduced p-globin genes during infection of erythroid cel ls with a herpes s implex virus type 1 recombinant. Journa l of Viro logy 64: 3882-3894. 157 Smith, A . E . (1995) Viral vectors in gene therapy. Annua l Rev iew of Microbiology 49: 807-818. Soderback , N., Hansson , E., Tottmar, O . and Ronnback , L. (1989) Neurons in primary cultures from five defined rat brain regions: cel lular composi t ion and morphological appearance. Cel lu lar Molecu lar Bio logy 35: 1-16. Southern, E . M . (1975) Detection of specif ic s e q u e n c e s among D N A fragments separated by gel e lectrophoresis. Journal of Mo lecu lar Biology 98: 503-517. Spector , D., Purves , J . C . , K ing, R.W. and Ro i zman , B. (1993) Regulat ion of a and y gene express ion in cel ls infected with herpes s implex v i ruses. L. Ca r rasco et al . , Eds . , P lenum Press , New York, N.Y., pp. 25-42. Spivack, J . G , Woods , G . M . and Fraser, N.W. (1991) Identification of a novel latency-speci f ic spl ice donor s ignal within the herpes s implex virus type 1 2.0 k i lobase latency-associated transcript (LAT): translation inhibition of L A T open reading f rames by the intron within the 2.0 k in lobase L A T . Journal of Virology 65: 6800 -6810 . Sr ivastava, A . , Lusby, E.W. and Berns, K.I. (1983) Nucleot ide sequence and organizat ion of the adeno-assoc ia ted virus 2 genome. Journal of Virology 45: 555-564. Stannard, L .M. , Fuller, A . O . and Spear , P . G . (1987) Herpes s implex virus glycoproteins assoc ia ted with different morphological entities projection from the virion enve lope. Journal of Genera l Virology 68: 715-725 . Stevens, J . G . , Wagner , E.K., Dev i -Rao , G .B . , Cook , M.L. and Fe ldman, L.T. (1987) R N A complementary to a herpesvi ruses a gene m R N A is prominent in latently infected neurons. Sc ience 255 : 1056-1059. S tevens , J . G . (1989) Human herpesvi ruses: a considerat ion of the latent state. Microbiology Rev iew 53: 318-332. Swa iman , K .F . , Neale , E.A., Fi tzgerald, S . C . and Ne lson , P . G . (1982) A method for large-scale production of mouse brain cortical cul tures. Developmenta l Brain Resea rch 3: 361-369. Tenser , R.B. , Edr is, W.A . and Hay, K.A. (1988) Herpes simplex virus latent infection: reactivation and elimination of latency after neuroectomy. Virology 167: 302 -305 . Tognon, M., Fur long, D., Con ley , A . J . and R o i z m a n , B. (1981) Molecu lar genet ics of herpes s implex virus. V . Character izat ion of a mutant defective in ability to form plaques at low temperatures and in a viral function which prevents accumulat ion of core less caps ids at nuclear pores late in infection. Journa l of Virology 40: 870-880 . 158 Trapnel l , B . C . and Gorz ig l ia , M. (1994) G e n e therapy using adenovira l vectors. Current Opin ion of Biotechnology 5: 617-625. Trejo, J . and Brown, J . H . (1991) c-fos and c-jun are induced by muscar in ic receptor activation of protein k inase C but are differentially regulated by intracellular ca lc ium. Journal of Bio logical Chemist ry 266 : 7876-7882. Tr iezenberg, S . J . , LaMarco , K.L. and McKnight , S .L . (1988) Ev idence of D N A : protein interactions that mediate HSV-1 immediate-early gene activation by V P 1 6 . G e n e s and Development 2: 730-742. T s u g a , H., K a m e y a m a , K., Haga , T., Kurose , H. and Nagao , T. (1994) Sequestrat ion of muscar in ic acetylchol ine receptor m2 subtypes. Facil i tation by G protein-coupled receptor k inase ( G R K 2 ) and attenuation by a dominant-negat ive mutant of G R K 2 . Journal of Biological Chemist ry 269: 32522-32527. Tucek, S . and P roska , J . (1995) Al loster ic modulat ion of muscar in ic acetylchol ine receptors. Trends in Pharmaco log ica l Sc i ences 16: 205-212. Upr ichard, S .L . and Knipe, D .M. (1996) Herpes s implex ICP27 mutant v i ruses exhibit reduced express ion of speci f ic D N A replication genes . Journa l of Virology 70: 1969-1980. Waelbroeck, M., Gi l lard, M. , Robberecht , P. and Chr is tophe, J . (1986) Kinetic studies of the [ 3H] N-methylscopolamine binding to muscar in ic receptors in the rat central nervous sys tem: Ev idence for the ex is tence of three c l asses of binding si tes. Molecu lar Pharmaco logy 30: 305-314. Waelbroeck, M., Gi l lard, M. , Robberecht , P. and Chr is tophe, J . (1987) Muscar in ic receptor heterogeneity in rat central nervous sys tem. I. Binding of four select ive antagonists to three muscar in ic receptor subc lasses : A compar ison with M2 cardiac muscar in ic receptors of the C type. Molecular Pharmaco logy 332: 91-99. Waelbroeck, M., Tastenoy, M., C a m u s , J . and Chr is tophe, J . (1990) Binding of select ive antagonists to four muscar in ic receptors (M1-M4) in rat forebrain. Molecu lar Pharmaco logy 38: 267-273 . Wagner , E.K. (1983) Transcript ion patterns of H S V infections. In: A d v a n c e s in viral oncology, Vo l . 3. G . Klein, E d . , Raven P ress , New York, N.Y., pp. 239-271. Wagner , E.K., Dev i -Rao, G . , Fe ldman, L.T., Dobson, A T . , Zhang , Y . F . , F lanagan, W . M . and S tevens , J . G . (1987) Phys ica l character izat ion of the herpes s implex virus la tency-associated transcript in neurons. Journa l of Viro logy 62: 1194-1202. W a n g , Q . and Finer, M .H . (1996) Second-generat ion adenovirus vectors. Nature of Medic ine 2: 714-716. 159 W a n g , Q. , J i a , X - C . and Finer, N.H. (1995) A packaging cell line for propagation of recombinant adenovi rus vectors containing two lethal gene-region delet ions. G e n e Therapy 2: 775-783. Wang . , S .Z . , Zhu , S .Z . , M a s h , D.C. and E l -Fakagany , E . E . (1992) Compar i son of the concentrant ion of messenger R N A encoding four muscar in ic receptor subtypes in control and A lzhe imer brains. Molecular Brain R e s e a r c h 16: 64-70. Ward , P . L , Og le , W . O . and Ro izman , B. (1996) A s s e m b l o n s : nuclear structures defined by aggregat ion of immature caps ids and s o m e tegument proteins of herpes s implex virus 1. Journal of Virology 70: 4623-4631 . Wei tzman, M.D., F isher, K . J . and Wi lson, J . M . (1996) Recruitment of wild-type and recombinant adeno-assoc ia ted virus into adenovi rus replication centers. Journal of Virology 70: 1845-1854. W e s s , J . (1993) Molecular basis of muscar in ic acetylchol ine receptor function. Trends in Pharmaco log ica l Sc i ences 14: 308-313. W e s s , J . , Gdu la , D. and Brann, M.R. (1991) Si te-directed mutagenes is of the m 3 muscar in ic receptor: identification of a ser ies of threonine and tyrosine residues involved in agonist but not antagonist binding. E M B O Journa l 10: 3729-3734. W e s s , J . , Bonner, T.I., Dorje, F. and Brann, M.R. (1990) Del ineation of muscar in ic receptor domains conferr ing selectivity of coupl ing to guanine nucleot ide-binding proteins and second messengers . Molecu lar Pharmaco logy 38: 517-523. Wi lcox, C .L . , Crn ic , L .S . and Pizer , L.I. (1987) Nerve growth factor deprivation results in the reactivation of latent herpes simplx virus in vitro . Journal of Virology 61 : 2311-2315. Wi lson, I.A., N iman, H.L., Houghten R.A., Che renson , A . R . , Connol ly , M.L. and Lerner, R.A. (1984) The structure of an antigenic determinant in a protein. Ce l l 37: 767-778 . W u , N., Watkins, S . C . , Schaffer, P .A. and D e L u c a , N.A. (1996) Pro longed gene express ion and cell survival after infection by a herpes s implex virus mutant defective in the immediate-early genes encoding ICP4 , ICP27 , and ICP22 . Journal of Virology 70: 6358-6369. W u D u n n , D. and Spear , P . G . (1989) Initial interaction of herpes s implex virus with cel ls is binding to heparan sulfate. Journal of Vi ro logy 63: 52-58. Y a m a m u r a , H.I. and Snyder , S . H . (1974) Muscar in ic chol inergic binding in rat brain. Proceed ings of the National A c a d e m y of S c i e n c e s U S A 71 : 1725-1729. Y a n g , Y . , L i , Q. , Ertl, H . C . J , and Wi lson , J . M . (1995) Cel lu lar and humoral immune responses to viral ant igens create barriers to lung-directed gene therapy with recombinant adenov i ruses. Journal of Viro logy 69: 2004-2015. 160 Y a n g , Y . , Ertl. J . and Wi lson, J . M . (1994a) Cel lu lar immunity to viral ant igens limits E1-de le ted adenovi ruses for gene therapy. Proceed ings of the National A c a d e m y of S c i e n c e s U S A 91 : 4407-4411 . Y a n g , Y . , Nunes , F.A., Berencs i , K., G o n c o z o l , E., Engelhardt, J . F . and Wi l son , J . M . (1994b) Inactivation of E 2 a in recombinant adenov i ruses limits cel lular immunity and improves the prospect for gene therapy of cyst ic f ibrosis. Nature of Genet i cs 7: 3 6 3 - 3 6 9 . Y a n g , N.S. , Burkholder, J . , Roberts , B., Martinel l , B. and M c C a b e , D. (1990) In vivo and in vitro gene transfer to mammal ian somat ic cel ls by particle bombardment . P roceed ings of the National A c a d e m y of S c i e n c e s U S A 88: 217-228. Y a o , F. and Courtney, R . J . (1991) Assoc ia t ion of a major transcriptional regulatory protein, ICP4 , of herpes s implex virus type 1 with the p lasma membrane of virus infected cel ls . Journal of Virology 65: 1516-1524. Y a o , F. A n d Courtney, R . J . (1989) A major transcriptional regulatory protein (ICP4) of herpes simplex virus type 1 is assoc ia ted with purified vir ions. Journa l of Virology 63: 3338-3344. Yav in , Z . and Yav in , E. (1977) Synap togenes is and myel inogenes is in d issoc ia ted cerebral cel ls from rat embryo on polylysine coated sur faces. Exper imental Brain Resea rch 29: 137-147. Y e h , L. and Schaffer, P .A. (1993) A novel c lass of transcripts exp ressed with late kinetics in the absence of ICP4 spans the junction between the long and short segments of the herpes s implex virus type 1 genome. Journal of Virology 67: 7 3 7 3 - 7 3 8 2 . York, I., Roo , C , Andrews, D., Riddel l , S . , G r a h a m , F. and Johnson , D. (1994) A cytosol ic herpes s implex virus protein inhibits antigen presentation to C D 8 + T lymphocytes. Ce l l 77: 525-535. Ze lus , B.D. , Stewart, R . S . and R o s s , J . (1996) The virion host shutoff protein of herpes s implex type 1: messenger r ibonucleolyic activity in vitro. Journa l of Viro logy 70: 2411-2419. Zi tvogel, L , Tahara , H., Robbins, P .D. , Storkus, W . J . , C larke, M.R., Nalesnik, M.A. and Lotze M.T. (1995) C a n c e r immunotherapy of establ ished tumours with IL-12. Effective delivery b genetical ly engineered f ibroblasts. Journa l of Immunology 155: 1393-1403. Zhu , N., Liggit, D. and Liu, Y . (1993) Sys temic gene express ion after intravenous D N A delivery in mice. Sc ience 262: 209-211 . 161 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099211/manifest

Comment

Related Items