Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Functional analysis of the gene bli-4 in caenorhabditis elegans Burgstrome Jones, Alana Kristine 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-0203.pdf [ 8.24MB ]
Metadata
JSON: 831-1.0099159.json
JSON-LD: 831-1.0099159-ld.json
RDF/XML (Pretty): 831-1.0099159-rdf.xml
RDF/JSON: 831-1.0099159-rdf.json
Turtle: 831-1.0099159-turtle.txt
N-Triples: 831-1.0099159-rdf-ntriples.txt
Original Record: 831-1.0099159-source.json
Full Text
831-1.0099159-fulltext.txt
Citation
831-1.0099159.ris

Full Text

FUNCTIONAL ANALYSIS OF THE GENE bli-4 IN CAENORHABDITIS ELEGANS by ALANA KRISTINE BERGSTROME JONES B.Sc, Simon Fraser University, 1994 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Medical Genetics) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA March 1997 © Alana Kristine Bergstrome Jones f 1997 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for. scholarly purposes may be granted by the head of my department or . by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of Vlg&iCAi- ^ e M g n c ^ . The University of British Columbia Vancouver, Canada Date T % \ U DE-6 (2/88) 11 ABSTRACT Many biologically active compounds are first formed as inactive precursors. Their activation results from proteolytic cleavage, largely accomplished by a group of enzymes known as KEX2/subtilisin-like proprotein convertases, or kexins. This family of enzymes has been described in a number of species, from prokaryotes (B. subtilis), to unicellular eukaryotes (S. cerevisiae), as well as multicellular organisms (Drosophila, mouse, human). Recently, an additional member of this convertase family was identified in the nematode Caenorhabditis elegans (Peters et al, 1991). The gene encoding the proprotein protease (bli-4) produces four distinct protein isoforms, all of which show sequence similarity to members of the kexin family. The purpose of the series of experiments reported here was twofold. First, to determine whether there was a conservation of function between the four isoenzymes produced by the gene bli-4 and kexin members from S. cerevisiae and humans. In order to achieve this goal, I have tested two putative homologues of bli-4, K E X 2 and hfur, for functional rescue of the viable blistering mutation in bli-4. The second goal of this research was to analyze the control of bli-4 expression. To address this question, deletion analysis of the 5' flanking D N A was performed, searching for critical regions that may function in the control of timing and tissue specificity of bli-4. The approach taken to address the question of functional conservation of the four isozymes of bli-4 and other members of the kexin family took advantage of the ability to genetically transform C. elegans through germline injection. A genomic fragment containing the yeast gene K E X 2 (provided by R. Fuller, Stanford, C A ) and a c D N A clone of the human gene hfur (provided by G. Thomas, Portland, OR) were cloned into an ectopic expression vector carrying a heat-shock Ill promoter (provided by A. Fire, Carnegie). The heat shock promoter (P. Candido, University of British Columbia) expresses in many of the same tissues as bli-4. A cDNA clone of one of the BLI-4 isoforms was used as a positive control. These constructs were injected into the gonad of bli-4(e937) homozygous hermaphrodites. Progeny of injected worms were heat-shocked to induce expression of the transgenes, and then screened for phenotypic rescue. In addition to this approach, functional rescue of S. cerevisiae KEX2 deletion mutants using one bli-4 isoform was tested. The isoform chosen has a predicted structure similar to the native yeast kex2p. However, this construct, when expressed in yeast, did not rescue KEX2 mutants, even though the control experiment using a KEX2 clone did rescue the mutants. Analysis of the 5' flanking region of bli-4 was performed by creating serial deletions in a bli-4/lacZ fusion construct. These vectors were then injected into wild-type worms and transgenics stained with Xgal to determine location of expression. This analysis revealed that there are a possible five signals controlling both tissue specificity and timing of bli-4 expression. The results of this series of experiments show 1) that the functional role of bli-4 is conserved with yeast KEX2 and human hfiir, and 2) that the control of expression of bli-4 can be at least partly explained by sequences in the 5' flanking DNA region. These conclusions emphasize the importance of C. elegans as a model organism for the study of the kexin family of convertases. iv T a b l e o f C o n t e n t s Abstract ii Table of Contents iv List of Tables vii List of Figures viii Acknowledgements x Introduction 1 The genetics of bli-4 1 Molecular structure of bli-4 4 The kexin family of convertases 7 Regulation of expression of bli-4 10 C. elegans as an experimental system for kexin regulation 12 Materials and Methods 13 Nematode culture conditions and strains 13 Preparing male stocks 15 Agarose gel electrophoresis 15 Polymerase chain reaction amplification of DNA samples 16 Cloning PCR products 17 Restriction enzyme digestions 18 Ligations 18 Gel purification of DNA samples 19 Minipreparations of plasmid DNA 20 Preparation of DNA for injection 20 Injections 21 Confirmation of the presence of injected plasmids in transgenic worms 22 Integrating transgenic arrays 22 Staining transgenic worms harbouring lacZ constructs 25 DNA sequence analysis 26 Transformations 26 Yeast growth media 28 Yeast transformant analysis 28 Construction of full-length blisterase D cDNA 29 Cloning yeast KEX2 and human hfur into the hsp 16-2 expression vector 31 Heat-shock induction of KEX2 and hfur transgenics and phenotypic rescue of blistering 32 Preparation of deletion constructs for analysis of the 5' end of bli-4 36 Results Section I. S. cerevisiae KEX2 mutant rescue analysis 40 A. KEX2-deficient yeast are rescued by transformation with endogenous KEX2 40 B. KEX2-deficient yeast is not rescued by Blisterase D 41 C. Expression of Blisterase D in transgenic yeast 41 Section II. C. elegans transformation rescue with KEX2 and hfur 44 A. Blisterase A cDNA rescues blistering in e937 homozygotes 44 B. KEX2 rescues blistering in e937 homozygotes 44 C. hfur rescues blistering in e937 homozygotes 45 Section III. Analysis of the 5' end of bli-4 47 A. Deletion of various regions upstream of bli-4 differentially affect gene expression 47 1. pCeh288 49 2. pCeh289 49 3. pCeh291 56 4. Control constructs 57 B. Sequence analysis of the subregions in the 5' end of bli-4 57 Discussion Evolutionary conservation of function between C. elegans, yeast and human kexin family members Transgenic rescue of S. cerevisiae mutants Transformation rescue of C. elegans mutants Regulation of expression of bli-4 Conclusions References Appendix I Appendix II Appendix III Appendix IV vi 64 64 66 70 73 79 81 89 91 92 97 Vll List of Tables 1. Alleles of bli-4 2 2. Intragenic complementation patterns of bli-4 alleles 5 3. Abbreviations used in this thesis 14 4. Primers used to test transgenic strains 23 5. Summary of bli-4(e937) transgenic rescue results 46 6. Summary of deletion staining patterns 50 7. Summary of unique C. elegans cosmid homologies in pCeh289 61 8. Summary of BLAST search results 62 9. Promoter predictions resulting from NNPP searches 63 viii List of Figures 1. Mutant phenotypes of bli-4 3 2. Molecular structure of bli-4 6 3. Kexin family members 9 4. Transgenic integration screen 24 5. Construction of pCeh228 (full-length bli-4 D cDNA) 30 6(a). Construction of pCeh295: cloning S. cerevisiae KEX2 into the hsp 16-2 expression vector 33 6(b). Construction of pCeh296: cloning human hfur into the hsp 16-2 expression vector 34 6(c). Construction of pCeh297: cloning bli-4 A cDNA into the hsp 16-2 expression vector 35 7. Preparation of deletion constructs 37 8. Summary of deletion constructs 38 9. Experimental scheme for the rescue of KEX2-deficient S. cerevisiae 42 10. Rescue of KEX2-deficient S. cerevisiae with Blisterase D 43 11. Summary of deletion constructs used in this thesis 48 12(a). pCeh289 transgenic staining pattern in eggs 51 12(b). pCeh289 transgenic staining pattern in larvae 52 13(a). pCeh291 transgenic staining pattern in eggs 53 13(b). pCeh291 transgenic staining pattern in larvae 14. KR3324/KR3325 Xgal staining pattern 15. Schematic representation of TESS and NNPP analyses results 16. Alignment of carboxy-terminal sequences from KEX2 and bli-4 Acknowledgements Many people were critical in my pursuit of this degree. I would like to thank my supervisor, Dr. Ann Rose; thanks to assorted lab members, particularly Colin Thacker, for instruction, guidance and for keeping me on the right track; thanks to Dr. Charlie Boone and Kelly Blundell for direction and assistance; thank you to Diana Janke for injections and transgenic strains; thanks to my family for believing that I could do this; and mostly thanks to my husband David, for everything you are and for everything you do. You know I couldn't have done this without you. INTRODUCTION 1 The Genetics of bli-4 The Caenorhabditis elegans gene bli-4 was originally identified in 1974 by Sydney Brenner, the pioneer of C. elegans research. In the process of screening for mutant phenotypes, he discovered a recessive, loss-of-function mutation (e937), that when homozygous gave rise to fluid-filled separations (or blisters) of the adult cuticle (Figure 1). This blistering phenotype resulting from the e937 mutation is only 80-90% penetrant in an isogenic population. Subsequent to the isolation of the e937 allele, mutant screens have resulted in twelve additional alleles of bli-4 (Table 1) (Rose and Baillie, 1980; Howell et al, 1987; Peters et al, 1991; Thacker et al, 1995), all of which produce lethality when homozygous, with arrest in early development (Figure 1). Complementation studies of bli-4 have revealed a complex pattern of Table 1 Alleles of bli-4 Allele name Homozygous phenotype e937 85% blistered h42 arrested 3-fold embryos hl99 arrested 3-fold embryos h254 arrested 3-fold embryos h384 arrested 3-fold embryos H427 arrested 3-fold embryos 1x520 arrested 3-fold embryos h670 arrested 3-fold embryos h791 arrested 3-fold embryos hlOW arrested 3-fold embryos hl403 arrested 3-fold embryos q508 arrested 3-fold embryos s90 embryonic/Ll lethal 3 Figure 1 Mutant Phenotypes of bli-4 Nomarski photomicrographs of: a) Class I blistered phenotype of e937 homozygote; b) Class II c/508 homozygote arresting in late embryogenesis; c) Class III s90 homozygote arresting as an L l larva (70% of Class III homozygotes arrest at late embryogenesis. as in b)). 4 interactions, and have established three complementation groups (summarized in Table 2) among the alleles of bli-4 (Peters, 1991). The original mutation, e937, defines the first group, Class I. Eleven non-complementing lethal alleles, all of which arrest during the three-fold stage of embryogenesis, define the second group, Class II. These alleles, when heteroallelic with e937, result in the blistered phenotype. Penetrance of the trait generally (with the exception of hl99) increases to 100%. The twelfth lethal allele (s90), which represents Class III, has a terminal phenotype of arrest in embryogenesis, or at the Ll larval stage of development, when homozygous. When s90 is in heteroallelic combination with any of the eleven Class II lethal alleles, worms arrest in early embryogenesis. However, when s90 is heteroallelic to e937, the resulting phenotype is wild-type. This is a classic case of intragenic complementation, and defines bli-4 as a complex gene. Molecular Structure of bli-4 Cloning of the bli-4 locus was initiated by Ken Peters (1992), thus revealing the complex nature of the gene (Figure 2). The gene, bli-4, is composed of at least twenty-one exons, spanning approximately thirteen kilobases of DNA. Isolation of cDNAs indicated that there are at least four distinct protein isoforms produced by bli-4. These four isoforms all share a common region at the 5' end of the gene, but as a result of alternative splicing at the 3' end they all differ at their carboxy termini. Molecular characterization of the alleles of bli-4 has shown that the viable blister-causing mutation (e937) is the result of a deletion spanning 3.5 kb, which removes a single exon unique to one of the four isoforms. Further studies (Thacker et al, 1995) showed that the transcript containing this single 5 Table 2 Intragenic complementation patterns of bli-4 alleles Class Ia Class II" Class HIC Class Ia Blistered (85%)d Class IIb Blistered (100%)d Arrest 3-fold Class IIIC Wild-type Arrest 3-fold Arrest 3-fold/Ll larvae The complementation pattern for the twelve lethal alleles and the viable allele, e937, is shown. All lethal alleles (both Class II and Class III) arrest development in late embryogenesis; however, approximately 30% of s90 (Class III) homozygotes survive past hatching but arrest as LI larvae (Peters 1992; Thacker et al 1995). aClass I represented by e937 bClass II represented by hi 010 and q508 cClass III represented by s90 Percentage of blistered animals shown in parentheses. 6 hl010::Tcl ikb Xb Xh E q508 e937 mkmH E Sal Sal ESal X h P E E E K K E E P — 4 ' 1 ] ^{ Y fcV i i - i i y BlisteraseA BlisteraseB BlisteraseC BlisteraseD SLl fu_—« Figure 2 Molecular structure of M - ¥ The molecular structure of is shown, as well as the alignment of the four cDNA clones representing the transcripts of bli-4. In addition, the causative mutations for e937 as well as the Class II alleles hi010 and q508 are shown. e937 is a 3.5 kb deletion removing exon 13. hlOlO is a Tel transposon insertion mutant mapped to exon 9 of the common region. q508 is a small deletion that removes the 5' end of exon 12 (modified from Thacker et al, 1995). The dotted region encodes the protease domain. Shading in the 3' exons reflects the use of each in the four distinct Blisterase products. 7 exon is absent in e937 homozygotes, suggesting that it is the loss of this one isoform that is responsible for the blistered phenotype. Mapping of the causative mutations in the lethal alleles has placed all of the Class U alleles within the first twelve exons of the common region (Thacker et al, 1995; Thacker, unpub. results). These results suggest that at least one of the bli-4 functions is essential for C. elegans viability. Sequence analysis of the four products of bli-4 shows a high degree of structural similarity to the KEX2/subtilisin-like family of proprotein convertases (Thacker et al 1995). Furthermore, the first twelve exons, shared by all transcripts, have significant sequence similarity to the catalytic domain of serine endoproteases. This family of enzymes has been shown to be of importance in the enzymatic processing of many biologically important precursor proteins. Based on the mutant phenotypes of bli-4, it is reasonable to expect that the products of this gene are involved in the proteolytic activation of proteins essential for the early development of the worm and for the production or maintenance of the adult cuticle. The Kexin Family of Convertases An important requirement in all biological systems is the regulation of gene function. One level of regulation is protein activation. In many cases, proteins are first produced within the cell as inactive precursors, and do not become active until the product has been appropriately localized (in space or time). One mechanism that has evolved to control the activity of a number of gene products involves the activation of precursor molecules through proteolytic cleavage by another molecule. Examples of this mechanism were first suggested with the 8 discovery that pituitary hormones (Chretien and Li, 1967) and insulin (Steiner et al, 1967) are synthesized first as inactive precursors. Activation has been shown to be accomplished by a group of enzymes collectively known as the KEX2/subtilisin-like family of proprotein convertases, now often referred to as kexins (Figure 3). This family of enzymes recognizes a minimal amino acid sequence of two basic amino acids (lysine and/or arginine), and cleaves the substrate molecule at the carboxy end of this dibasic pair. For most members of the family, the recognition sequence can be expanded around this essential pair of basic residues, but in all cases tested, each can effectively cleave any substrate molecule containing only the most rudimentary recognition sequence. Sequence analysis of the four products of bli-4 has shown that the first twelve exons, shared between all four isoforms, encode a catalytic domain with significant sequence similarity to this family of proprotein convertases. The prototypic member for this family of enzymes is kex2p in the budding yeast Saccharomyces cerevisiae. This serine endoprotease is a calcium-dependent, membrane-bound molecule, localized to the late Golgi apparatus, that processes the inactive precursors of the pheromone a-mating factor and the M] killer toxin (Fuller et al, 1989a). Mammalian members of the kexin family have been discovered in mouse and human. These include PCSK1, also known as PC3 (Seidah et al, 1991; Smeekens et al, 1991), PCSK2 (Seidah et al, 1990; Smeekens and Steiner, 1990), PCSK4 (Nakayama et al, 1992; Seidah et al, 1992), PCSK5, also known as PC6 (Lusson et al, 1993; Nakagawa et al, 1993), PACE4 (Keifer et al, 1991), PCSK7 (Seidah et al, 1996) and furin (Roebroek et al, 1986; Fuller et al, 1989b). In Drosophila, at least two members of the kexin family have been defined, Furl and Fur2 (Roebroek et al, 1992), both of which show sequence similarity to the human member furin. Members of the family have been classified into two groups based on the secretory pathway in which they function. Some members 9 BlisteraseA BlisteraseB BlisteraseC BlisteraseD PCSK4 PCSK1/PC3 PCSK2 r n — n m | 670 | 730 m 1 827 1 II ii 1 1 4 943 W I 794 969 915 i n noi XI 1 8.4 1680 Figure 3 Members of the kexin family of proprotein convertases Shown are a subset of the members of the kexin family of convertase enzymes, including the prototype member kex2p from S. cerevisiae, furin from human, the Drosophila furin homologues Furl and Fur2, mammalian PCSKs and PACE4, as well as the predicted structures of the four Blisterase products (the vertical line represents the boundary of sequence shared by all four Blisterases). Shaded regions represent the protease domain, with percentage identity to the Blisterase products. Cross-hatched regions are Cys-rich. Diagonal regions are transmembrane domains . Dotted regions are secretion signal sequences (modified from Thacker et al, 1995). 10 exhibit restricted expression patterns in vivo, and participate in the regulated secretory pathway. For example, PCSK1/PC3 and PCSK2 are expressed only in endocrine and neuroendocrine tissues (Seidah et al, 1990, 1991; Smeekens and Steiner, 1990) and PCSK4 is restricted to the testes (Nakayama et al, 1992; Seidah et al, 1992). Conversely, some members are expressed in a large number of tissues and participate in the constitutive secretory pathway (Roebroek et al, 1986; van den Ouweland et al, 1990; Van de Ven et al, 1990; Bresnahan et al, 1990; Keifer et al, 1991). In particular, furin seems to have a ubiquitous role, able to functionally activate precursor substrates in most tissue types (Molloy et al, 1992). For furin, catalytic activity may be controlled by intracellular compartmentalization. Furin is a membrane-bound enzyme, localized to the trans-Go\g\ network (TGN) (Molloy et al, 1994). Like all members of the kexin family, furin is first synthesized as an inactive precursor (Leduc et al, 1992; reviewed in Seidah and Chretien, 1992). It becomes activated upon release from the endoplasmic reticulum and during transportation to the TGN. Substrate targets are activated by furin while being cycled via clathrin-coated vesicles from the TGN to the cell surface. Signals that may be important in this cycling are encoded in the cytoplasmic end of furin (Molloy et al, 1994; Schafer et al, 1995). Regulation of Expression of bli-4 An additional level of control in the proteolytic activation processes is the regulation of expression of the convertases themselves. Substrate specificity is largely dependent on co-localization of both substrate and enzyme molecules within a cell type. Little is known about the tissue specific control of any of the kexin convertases, and about bli-4 in particular. Previous analyses of regulation 11 of expression (Aamodt et al, 1991; Okkema et al, 1993; Egan et al, 1995) in C. elegans have made use of reporter vector constructs, particularly lacZ and, more recently, green fluorescent protein (GFP) (Chalfie et al, 1994). Fragments of DNA from the 5' end of the gene of interest are fused in frame with the reporter gene and the construct injected into the gonad of N2 hermaphrodites. Deletions within this 5' fragment may also be injected in order to delineate subregions that may contain critical sequences which drive expression in a temporal and tissue specific manner. Several factors important in transcriptional, post-transcriptional, translational and post-translational control have been identified (reviewed by Krause, 1995). Most C. elegans genes studied thus far have proven to be transcribed by RNA Polymerase II, one of three polymerase molecules that are active in transcriptional processes. A T A T A consensus binding sequence is usually found approximately 30 bp upstream of the transcriptional start site of genes transcribed by RNA Polymerase II (Krause, 1995). Specific promoter sequences have also been identified for genes with particular tissue expression. For endodermal gene regulation, a G A T A sequence is generally required (Krause, 1995; Egan et al, 1995). Control of gene expression at the post-transcriptional level is also being studied. A number of Un genes (cell lineage control) have been shown to produce RNA transcripts that are complementary to the rnRNA of the genes they regulate, indicating RNA-RNA binding interactions that are responsible for controlling gene expression (Lee et al, 1993). In addition, 3' end processing is important for the regulation of expression. Polyadenylation in C. elegans usually begins about 13 nucleotides downstream of a consensus sequence (AAUAAA) (Krause, 1995). The 3' poly-A signal of the gene unc-54 has been shown to provide stability to the mature rriRNA (Mello and Fire, 1995), and is thus often used in artificial gene expression constructs. 12 C . elegans a s a n E x p e r i m e n t a l S y s t e m f o r K e x i n R e g u l a t i o n Understanding the biological function of these proprotein convertases can be greatly facilitated by studying genetic mutations. Experimental manipulation of the gene and observation of its function can be done in vivo with C. elegans. In this system, regulation of activation, which may be controlled by localization and expression of the convertases, can be studied. To date, only yeast and C. elegans kexin mutants have been reported. In the case of bli-4, not only is a wide set of mutations available for analysis, but the four gene products of bli-4 each resemble convertase members from both the regulated secretory pathway and the constitutive secretory pathway (Thacker et al, 1995). Clearly, this gene represents a powerful tool for understanding the function of kexin convertases in vivo. In addition, the C. elegans system as a model organism is easily exploited with its amenable genetics and molecular biology. Thus, bli-4 should provide much information about the enzymatic processing of precursor molecules not only in C. elegans, but also in a number of other organisms, including humans. The analysis performed in this study is aimed at revealing the signals that control not only the tissue specificity of expression of bli-4, but also the timing. This investigation can be carried further by examining the control of expression of each of the four isoforms produced by bli-4. bli-4 represents an important tool for understanding the regulation of kexin convertases, both at the level of gene expression and tissue regulation. It will also serve to provide information on the evolutionary importance of these levels of regulation within the kexin family of convertase enzymes. MATERIALS AND METHODS 13 Nematode Culture Conditions and Strains All C. elegans strains used during the course of this study were maintained on 5 cm petri plates containing nematode growth media (NGM) streaked with Escherichia coli OP50 at 20°C, unless otherwise indicated (Brenner, 1974). The standard wild-type nematode strain (+/+) is C. elegans, var. Bristol, strain N2. Mutations in C. elegans are assigned both a gene name describing the genetic locus, and an allele designation representing the mutational event which gave rise to the associated phenotype. One of the genetic mutants used in this study, e937, gives a blistered phenotype (worms with blistered cuticles), and is one allele of the gene bli-4; thus, this mutation is written as bli-4(e937). Generally, the nomenclature guidelines (Horvitz et al, 1979) require that gene names are italicized while phenotypes are not. When referring to gene products, capital letters are used; for example, the products of bli-4 are called BLI-4 isoforms. Nomenclature of strains and materials used in this thesis is outlined in Table 3. 14 Table 3. Nomenclature abbreviations used in this thesis. Abbreviation Description bli mutations in these genes give rise to a blistered cuticle Bli the Blistered phenotype; fluid-filled separations of the cuticle dpy • mutations in these genes result in a dumpy phenotype Dpy the Dumpy phenotype; short, fat body morphology rol mutations in these loci result in a rolling phenotype Rol the Roller phenotype; helical twisting of the body around the longitudinal axis, resulting in a rolling motion as the worms moves h the Rose laboratory allele designation. A l l alleles, extrachromosomal arrays, chromosomal rearrangements and D N A constructs designed in this laboratory are issued an h number K R the Rose laboratory strain designation. A l l C. elegans strains isolated in the Rose laboratory are issued a K R number K R p all oligonucleotides, or primers, designed in the Rose laboratory for the purpose of Polymerase Chain Reaction are issued a K R p number pCeh D N A constructs are identified as plasmids subcloned from Caenorhabditis elegans in the Rose (h) laboratory In designation for extrachromosomal D N A that has been integrated into the nematode genome hEx the exogenous D N A construct present within a nematode strain transformed via microinjection in the Rose (h) laboratory 15 Preparing male stocks Although the primary sexual form of C. elegans is hermaphroditic, males do arise by non-disjunction of the X chromosome in natural populations with a frequency of approximately 1 in 500 (Hodgkin et al, 1979). To maintain populations with a high frequency of males, mating plates are established with between ten and twenty males and one or two hermaphrodites in order to encourage mating. Since hermaphrodites give rise to populations that are essentially isogenic, male stocks allow the transfer of genetic information between strains. Agarose gel electrophoresis Products of PCR amplification and restriction enzyme digestion were visualized by agarose gel electrophoresis. Aliquots of 1 pJ were diluted in 9 pJ distilled water, with lx loading buffer (Sambrook et al, 1989). Each sample was then loaded into wells of an agarose gel (between 0.5% and 1.5% w/v in 0.5x TBE buffer or lx T A E buffer), containing roughly 0.1 p:g/ml ethidium bromide. The samples were electrophoresed through the gel at approximately 5V/cm for at least one hour, or until the DNA had run far enough for the individual bands to be distinguished. When excision of bands was required for purification, the above process was performed with low-melting-point agarose. 16 P o l y m e r a s e C h a i n R e a c t i o n A m p l i f i c a t i o n o f D N A S a m p l e s Idaho Technologies Thermocycler 1605 Amplification of DNA samples using the Idaho Technologies Thermocycler was performed in 25 ul volumes in sealed silicon glass capillary tubes. In each case, 5 pJ of the appropriate DNA sample was combined with the desired concentration of M g + + , lx buffer (supplied by Idaho Technologies), 5 pM dNTPs, 0.2 p,g of each of two primers, and 0.75 units Taq Polymerase (Promega) or 1 unit Pfu polymerse (Stratagene). Amplification of whole worm DNA required lysis as described for the Perkin-Elmer protocol below, followed by addition of the above described reaction mixture. Reactions were carried out with twenty-five second denaturing at 94°C, twenty-five second annealing at the appropriate temperature determined for each pair of primers, followed by one minute extension at 72°C (longer amplification products were given 5 minute extension times). Each reaction was carried out over thirty cycles. Samples from completed reactions were transferred from the capillary tubes to microfuge tubes and stored at -20°C until further use. All samples were checked for the correct product by running a 1 ul aliquot on an agarose gel in 0.5x TBE buffer at approximately 5V/cm. DNA bands were visualized by staining with ethidium bromide (Sigma) and illuminating with UV (300 nm) light. Perkin-Elmer for whole worm DNA amplification Amplification reactions on whole worms carried out in a Perkin-Elmer Thermal Cycler were performed in 30 pi volumes in polystyrene microfuge tubes. Individual worms were first lysed in 5 pJ lysate mixture containing 1.5 mM M g + + , 17 lx PCR Thermo Buffer (Promega), and 60 (Xg/ml Proteinase K. The samples were frozen at -70°C for at least ten minutes (or up to one week), then thawed and overlaid with 30 mineral oil to prevent evaporation. The samples were then incubated for one hour at 57°C followed by fifteen minute incubation at 95°C to inactivate the Proteinase K. After lysis, a mixture of lx PCR Thermo Buffer, appropriate concentration of Mg + + , 0.2 mM dNTPs, 0.2 Ltg of each of two primers and 0.75 units of Taq Polymerase (Promega) was added to each sample. Amplification reactions were carried out over thirty cycles, with forty-five second denaturation at 94°C, annealing at the appropriate temperature for each primer pair with a time determined based on the size of the predicted product, followed by one minute extension at 72°C. As before, samples were tested for the expected product by running a 1 [il aliquot in an agarose gel in 0.5x TBE buffer at approximately 5V/cm. Bands were again visualized by staining with ethidium bromide (Sigma) and illuminating with UV (300 nm) light. Cloning PCR Products DNA amplified through the PCR process was cloned into pBluescript (Stratagene) to allow for further manipulation. To ensure the purity of the DNA product, bands were first excised from agarose gels and purified as described below. When Taq polymerase was used in the amplification reaction, PCR products were treated for thirty minutes at room temperature with T4 DNA polymerase (1 unit) in lx manufacturer's supplied buffer (New England Biolabs) with excess (0.5 mM) dNTPs in a total volume of 50 jil. The "polished" DNA was purified by phenol extraction (see below), and cloned into Smal-cut pBluescript as 18 described below. If Pfu polymerase (Stratagene) was used for DNA amplification, the DNA fragment was cloned directly into Smal-cut pBluescript. Restriction Enzyme Digestions Restriction enzyme digests of DNA samples (plasmids, PCR amplification products) were done by incubating DNA with 0.5 Lil (1-5 units) of the appropriate enzyme and the manufacturer's supplied enzyme buffer at the suggested concentration, as well as lx bovine serum albumin (New England Biolabs) in 15 |il total volume. Double digests were either done concurrently (in 15 or 20 pJ total volume) if the two enzymes are optimally active in the same buffer solution; otherwise, the first digest was done as described, followed by phenol extraction of the DNA, and the second digest subsequently performed. Overhang ends remaining after digestion were blunt ended in one of two ways: 3' overhangs were treated with T4 DNA polymerase (New England Biolabs) while 5' overhangs were blunted by the Klenow fragment (Pharmacia). Each procedure involved thirty minute incubations at room temperature with the manufacturer's supplied buffer, if necessary. Ligations Ligation of DNA fragments was performed by aliquoting at least a 3:1 molar ratio (estimated qualitatively) of insert DNA to vector DNA with 0.5 |il (200 units) of T4 DNA Ligase (New England Biolabs; Bethesda Research Laboratories) and the manufacturer's supplied lx buffer in a total volume of 10 pJ. The ligation 19 mixture was incubated overnight at either 16°C or 18°C, then stored at -20°C until further use. Gel Purification of DNA Samples Qiagen Gel Purification kit Purification of DNA samples from agarose gels using the Qiagen Qiaex U extraction protocol followed the manufacturer's suggested guidelines. Bands were excised from gels using clean, sterile razor blades, trimmed of most agarose and transferred to a 1.7 ml centrifuge tube. Following the supplied protocol, the DNA is purified by adhesion to the Qiaex FJ beads, followed by several washing steps to remove residual agarose and salts. The DNA was subsequently eluted into 20 |il Tris-EDTA (pH 8.0) buffer or drl^O, then stored at -20°C until further use. Phenol/CIA with NaOAc/EtOH precipitation An alternate method for purifying DNA samples from agarose gel involved excising the desired bands, as described above, then extracting the DNA in steps with phenol, phenol in chloroform:isoamyl alcohol (CIA), and finally CIA alone. The extracted DNA was then precipitated with sodium acetate and 95% ethanol at -70°C and the pellet subsequently washed in 70% ethanol, air-dried, and resuspended in dH^O. 20 Minipreparations of Plasmid DNA Bacterial transformant colonies grown on selective Ampicillin-containing . Luria-Bertani medium (LB) plates were subsequently treated, following the methods of Sambrook et al (1989) , to extract the plasmid DNA. Individual colonies (from the transformation protocol described below) were used to inoculate 1 ml LB broth containing 100 Lig/ml Ampicillin in 15 ml glass centrifuge tubes, then incubated overnight at 3 7 ° C in a rotating incubator. Overnight cultures were then spun down and the supernatant removed. The pellet was resuspended in 1 0 0 ul Solution I (Sambrook et al, 1989), then 1% SDS and 0.2 M NaOH were added to lyse the bacterial walls during a five minute incubation on ice. The proteinaceous elements were then precipitated by adding Solution HI (Sambrook et al, 1989) and incubating on ice for an additional five minutes. The solutions were then spun down, and the supernatant, containing both DNA and RNA, transferred to a fresh 1.7 ml centrifuge tube. The DNA was either precipitated using 9 5 % ethanol, or was first extracted in phenol and chloroform/isoamyl alcohol, and then subsequently precipitated. In all cases, the DNA pellets were washed with 7 0 % ethanol, then air-dried and dissolved in 2 0 LU Tris-EDTA containing 5 0 Lig/ml RNAse A. All samples were stored at - 2 0 ° C until further use. Preparation of DNA for Injection Preparation of plasmid DNA for injection was performed following the prescribed protocol of the Qiagen plasmid purification kit. Overnight cultures 21 grown in 2 ml LB containing 100 Lig/ml Ampicillin were transferred to a microfuge tube and pelleted. The cells were then resuspended in the supplied buffer containing RNase, then lysed and neutralized. The resulting precipitate was pelleted and the supernatant passed over the Qiagen extraction membrane. After washing, DNA was eluted from the membrane with 100 ill Tris-EDTA pH 8.0. Approximate DNA concentration was determined by running an aliquot of a restriction digest on an agarose gel (as described) adjacent to DNA markers of known concentration. More accurate measurements were obtained by UV spectrophotometry. Injections Germline transformation of C. elegans is performed by injection of DNA into the distal arm of one or both gonad arms in adult hermaphrodites following the method of Mello, et al (1991, 1995). This procedure was graciously performed by Diana Janke (Simon Fraser University). Plasmid DNA constructs were co-injected at a total concentration of 100 ng/|il with the plasmid pCesl943 which carries the dominant allele of rol-6 (sul006). Worms carrying this marker exhibit the Roller phenotype, rolling around their longitudinal axis as they move in a circular motion pattern. These worms are easily recognizable among a population of non-Rollers, whose movement pattern is sinusoidal. The co-injected plasmids carry regions of homology (for example, the Ampicillin resistance gene) which allows recombination between the marker plasmid and the plasmid of interest. As a result, the presence of the Roller phenotype is generally indicative of the presence of the plasmid of interest. Injected worms were plated individually and their progeny scored for the Roller 22 phenotype. This procedure was performed in the strain CB937 using yeast KEX2, human hfur and a C. elegans bli-4 cDNA encoding Blisterase A in an ectopic expression vector using the heat shock 16-2 promoter. Additional scoring for the presence or absence of the blistered phenotype was also required. This protocol was also used with bli-4 5' upstream DNA deletion lacZ constructs, injected into N2 worms. Confirmation of the Presence of the Plasmid of Interest in Transgenic Worms Transgenic lines are identified by the presence of Roller individuals in each generation. Coinjection of the rol-6 (sul 006) marker plasmid, however, does not guarantee that the marker phenotype coincides with the presence of the plasmid of interest. In order to confirm that a heritable transgenic line carries the desired plasmid, a PCR assay was used. Primers were designed (using the Amplify 1.0 program for Apple Macintosh computers) to anneal to specific regions within each transgene (Table 4). Other previously designed primers were also used. PCR products would only be amplified if the plasmid of interest was carried in the transgenic strain. Integrating Transgenic Arrays Extrachromosomal arrays carried by transgenic worms were integrated into the genome using UV irradiation (Figure 4). Approximately fifty L4 to early adult worms exhibiting the Rol-6 phenotype were exposed to UV light for 25 seconds. 2 3 Each worm was then picked to individual plates and allowed to lay eggs. These progeny were then screened for the Rol-6 phenotype. F1 rollers were transferred Table 4 Primers used in this study to test transgenic strains Primer Name Primer Sequence KRpl38 5' GGT GCG GGC CTC TTC GCT ATT A 3' KRp29 5' TAC TCA CCC ATA TCA GTC AC 3' KRp25 5' GTG CTC CCA CCC CCT ATT 3' KRp26 5' CCC AAA CCT TCT TCC GAT 3' Universal (-21) 5' TGT AAA ACG ACG GCC AGT 3' KRpl38 anneals within lacZ and KRp29 anneals to the first exon of bli-4. These were used to test the bli-4 5' end//acZ deletion transgenics. KRp25 and KRp26 anneal to the 3' UTR of unc-54, and were used to test all transgenics used in the functional conservation rescue assays. The Universal (-21) primer anneals to sequences in the plasmid backbone. 24 +/+; hEx Rol-6 F 2 +/+; hEx In/In In/+ Figure 4 Transgenic Integration Screen Legend: transgenic worms carrying free extrachromosomal arrays are designated by hEx, while worms with integrated copies of the arrays are designated by In (see Table 3). 25 to separate plates, and their progeny screened for the marker phenotype. Since F2 rollers may be either heterozygous or homozygous for the integrated transgene, F3 progeny were evaluated for lack of wild type segregants. Staining Transgenic Worms Harbouring lacZ Constructs Integrated transgenic worms exhibiting the Rol-6 phenotype were picked to a drop of distilled water on a depression slide and allowed to dessicate at room temperature. Animals were then fixed to the slide by immersion in chilled acetone at -20°C for two minutes, then air dried. Fifty microlitres staining solution (prepared as outlined below) was added, the slides placed on a 5% agar (in 2 mM EDTA pH 7.5) plate and incubated at 37°C overnight. Staining Solution: 0.2 M sodium phosphate pH 7.5 1 mM MgCl 2 Redox solution: 0.5 mM potassium ferricyanide 0.5 mM potassium ferrocyanide 0.004% SDS 10 p:g/ml Kanamycin 1 |ig/ml DAPI distilled H 2 0 3% Xgal (dissolved in dimethyl formamide) 26 DNA Sequence Analysis Restriction mapping of DNA sequences was performed with the DNA Strider program for the Apple Macintosh computer. Analysis of DNA sequences was achieved by searches in GENBANK and other databases using the BLAST network service (e-mail address: blast@ncbi.nlm.nih.gov). Computations for these searches were performed at the National Centre for Biotechnology Information (NCBI). Analysis of the promoter region of bli-4 was done using the University of Pennsylvania's Transcription Element Search Software (TESS) and the Neural Network Promoter Prediction program (NNPP) (Reese, 1994; Reese and Eeckman, 1995; Reese et al, 1996) (access to these analysis engines can be achieved through the internet address http://dot.imgen.bcm.tmc.edu:9331/seq-search/gene-search.html). Transformations DH5oc for cloning Cloning and maintaining stocks of plasmid DNA makes use of E. coli strain DH5oc for propagation. Transformation of competent E. coli (GIBCO-BRL) was achieved by incubating 50 |il cells, thawed on ice, with 2.5 or 3 p:l of either plasmid DNA or ligation mixture (in the case of plasmid construction) in chilled 15 ml centrifuge tubes on ice for at least thirty minutes. Cells were then heat-shocked at 37°C for thirty seconds, followed by an additional two minute incubation on ice. SOC (Sambrook et al 1989) medium (0.45 ml) was then added to the centrifuge tube, and the cells were incubated at 37°C in a shaking incubator for one hour. 27 Transformed cells were then plated (in 50 or 200 |il volumes) on LB agar plates containing 50 pig/ml Ampicillin. In some cases, selection for the presence of DNA inserted into the pBluescript backbone vector was determined by plating on selective medium containing X-gal. Recombinant plasmids produce colourless colonies due to interruption of the (3-galactosidase gene in the vector, while non-recombinants produce blue colonies (Hanahan, 1983). Plates were incubated overnight at 37°C. S. cerevisiae Competent S. cerevisiae cells (strain Y143: MAToc, KEX2A::URA3) were used for transformations involving the BLI-4 isoform most similar to kex2p (Blisterase D). Five to 10 pi of plasmid DNA (not treated with RNAse) was added to 100 pi cells thawed on ice. If DNA was RNA-free, 5 pi of boiled and cooled salmon testes DNA was added to aid the transformation efficiency. An equal volume of 70% polyethylene glycol (PEG) was added and the cells then mixed gently, followed by at least thirty minutes incubation at 30°C. Cells were then heat-shocked at 42°C for 5-15 minutes. PEG was removed by spinning down cells and removing supernatant; subsequently, the pellet was resuspended in 400 pi YEPD+ADE (see Yeast Growth Media) and incubated for twenty minutes at 30°C. Following this incubation, cells were spun down and the supernatant removed, and the pellet resuspended in 1 ml Tris-EDTA+sorbitol. 300 pJ volumes were plated on SD-TRP (see Yeast Growth Media) plates and incubated for three days at 30°C. As a result of using selective media (lacking tryptophan), only those cells carrying the plasmid will grow. 28 Yeast Growth Media YEPD+ADE lOg yeast extract 20g peptone 120 mg adenine dH20 to 1 litre 2% glucose SD-TRP 6.7g bacto-yeast nitrogen 2g "drop-out" medium (all amino acids except tryptophan) 20g agar (for plates) dH20 to 1 litre 2% glucose SGAL-TRP 6.7g bacto-yeast nitrogen 2g "drop-out" medium (all amino acids except tryptophan) 20g agar (for plates) dH20 to 1 litre 2% galactose YEPGAL lOg yeast extract 20g peptone dH20 to 1 litre 2% galactose Yeast Transformant Analysis Transformed yeast colonies grown on the selective SD-TRP media were streaked onto minimal media plates (YEPD), then streaked in patches onto doubly 29 selective SGAL-TRP (see Yeast Growth Media) plates. The presence of galactose in the media induces the GAL promoter to transcribe the transgene. After overnight growth, the patches were replica-plated onto YEPGAL (see Yeast Growth Media) plates with a lawn of MATa-type yeast (strains 2625 and 2488). Functional rescue is indicated by the presence of halos of non-growth surrounding the patch. This work was done in collaboration with Kelly Blundell in C. Boone's laboratory (Simon Fraser University). Construction of full-length Blisterase D cDNA In order to address the question of conservation of functionality between bli-4 and KEX2, I initially attempted functional rescue of S. cerevisiae strains mutant in KEX2 with one of the four BLI-4 isoforms most structurally similar to kex2p. The largest of the four isoforms, BLI-4D, has elements similar to those of kex2p, including a transmembrane domain (Figure 3). A yeast vector (YCp50) that makes use of the G A L promoter (Rose et al, 1987) was used to carry a full-length cDNA for blisterase D. The cDNAs previously isolated (Thacker et al, 1995) included a partial D isoform transcript which lacked the 5' region, including part of the common region. In order to prepare a full-length BLI-4D cDNA, the 5' sequence missing from the existing partial transcript was transferred from another of the isoforms' (BLI-4A) cDNA (Figure 5). The partial D cDNA carried in pBluescript, (pCeh 196), was digested with EcoRl to excise the cDNA fragment and the ends were blunt-ended using the Klenow fragment. Meanwhile, the A cDNA, also carried in pBluescript (pCehl95), was digested with Ncol at a site within the region of overlap between the two cDNAs. In addition, pCehl95 was 30 Figure 5 Construction of pCeh 228 (full-length bli-4 D cDNA) 31 cut with Sma\ at a site within the Bluescript vector. The effect of these two digests was to remove the region shared by the two isoforms. pCehl96 was also cut with Ncol to produce homologous sticky ends between the two cDNA fragments. The resulting 1940 bp linear fragment was isolated by gel extraction purification as described. In addition, the 1126 bp fragment from the Smal/Ncol double digest of pCehl95 was also gel purified. These two fragments were ligated together (as described) using T4 DNA ligase (New England Biolabs) to create a full-length cDNA for the BLI-4D isoform, carried in pBluescript (pCeh228). Cloning yeast KEX2 and human hfur into hsp 16-2 expression vector To address the question of whether kexin family members KEX2 (S. cerevisiae) and hfur (human) show evolutionary conservation of function with bli-4 in C. elegans, these were used to genetically transform bli-4 mutants. A genomic fragment of yeast KEX2 in a YCp50-based vector, kindly provided by Bob Fuller (University of Michigan Medical Center), was digested with BamHl to release the 3.3 kb fragment and cloned into the BamHl site in pBluescript. This construct was subsequently digested with Kpnl and Sacl and ligated into the C. elegans heat shock 16-2 (P. Candido, University of British Columbia) promoter-containing expression vector pPD49.78 (provided by A. Fire, Carnegie Institute of Technology) which had been digested at the same sites within the multiple cloning region (Figure 6a). A cDNA clone of the human gene hfur contained in a pUC19 vector (generously provided by Gary Thomas, Oregon Health Sciences University) was digested with Xbal and Sacl and ligated into the hsp 16-2 expression vector that 32 had been cut with Nhel (which has compatible ends with Xbal) and Sad within the multiple cloning site (Figure 6b). A positive control construct was designed to use a cDNA clone of the Blisterase A isoform, which has previously been shown as capable of rescuing the blistering phenotype in transgenic bli-4(e937) animals (Srayko, 1995). The cDNA clone (pCehl95) was digested first with Kpnl. This initial digest was followed by a partial digest with Sacl, which has one internal site in the cDNA. The appropriately sized fragment (2.2 kb) representing the complete cDNA was gel purified using the Qiagen protocol (described above). This was subsequently ligated into KpnI/Sacl-digested pPD49.78 (Figure 6c). All three constructs were prepared for injection as described previously. Heat-shock induction of KEX2 and hfur transgenics and phenotypic rescue of blistering Transgenic worms carrying heat shock expression constructs of yeast KEX2 and human hfur were maintained on Modified Youngren's Only Broth (MYOB) plates. Worms were first developmentally staged by allowing single hermaphrodites to lay eggs overnight at 20°C and then removing the adult. The eggs were then allowed to develop such that the resulting population was approximately synchronous. Alternatively, plates were starved to induce formation of dauer larvae; chunks of agar were transferred to new plates for two to three hours. The dauer larvae thus transferred developed into adults within 12 to 15 hours (Lewis and Fleming, 1995). Late L4 larval populations were heat shocked at 30°C for two hours, then returned to 20°C. Phenotypic rescue of bli-4 33 BamHl BamHl BamHl Figure 6(a) Construction of pCeh295: Cloning S. cerevisiae KEX2 into the hsp 16-2 expression vector pPD49.78 34 hsp 16-2 Nhel Sacl Figure 6(b) Construction of pCeh296: Cloning human hfur into the hsp 16-2 expression vector pPD49.78 Figure 6(c) Construction of pCeh297: Cloning bli-4 A cDNA into the hsp 16-2 expression vector pPD49.78 36 (e937) homozygotes by yeast KEX2 and human hfur transgenes was measured by scoring adults for presence or absence of the blistering phenotype. Non-transgenic bli-4 (e937) worms were used as controls, in addition to the control strains. Transgenic worms carrying pCeh297 were used as positive controls, while a transgenic line carrying pPD49.78 was used as a negative control. In order to establish a baseline level of blistering, transgenic worms not exposed to heat shock conditions were also scored. In addition, non-transgenic worms (strain CB937) were exposed to both experimental conditions. P r e p a r a t i o n o f d e l e t i o n c o n s t r u c t s f o r a n a l y s i s o f t h e 5 ' e n d o f bli-4 Previous analysis of the expression patterns of bli-4 (Thacker et al, 1995) made use of expression vectors (provided by A. Fire) into which the 5' end of bli-4, as well as part of the first exon (the Xbal to Clal fragment as illustrated in Figure 7) were cloned in frame with the E. coli gene lacZ. This vector system also utilizes a nuclear localization signal for ease of identification of cells in which the promoter drives expression. This original fusion construct contained approximately 5 kb of bli-4 upstream sequence. In order to further define sub-regions critical for determination of timing and tissue specificity of bli-4 expression, a limited deletion analysis was undertaken. Three separate deletions were prepared as shown in Figure 8 (a fourth was also attempted, but was discarded for reasons outlined in Appendix I). Each of these was achieved by digesting the parent plasmid (pB45.28) with two restriction enzymes in compatible buffer (as described earlier), followed by fill-in reactions. Each sample was run out on a low-melting-point agarose gel to ensure complete digestion. The digested linear plasmid was cut out of the gel and purified by Qiagen as described. 37 Xbal BlpI Bglll Xhol Clal digest parent plasmid with 2 enzymes (eg:BlpI and Xhol); fill-in end overhangs Xbal BlpI Xhol Clal gel-purify appropriate fragment; re-circularize with T4 D N A ligase Xbal Clal Figure 7 Schematic representation of deletion construct preparation 38 c) j -J pCeh254. AXbal-XhoI | — 1 pCeh288: AXbal-Bglll j 1 pCeh291: ABlpI-XhoI j 1 pCeh289: ABglll-XhoI Figure 8 Summary of deletion constructs used in the promoter analysis Legend: a) genomic region spanning the bli-4 coding region. Exons are denoted by rectangles, b) DNA from an Xbal site upstream of the bli-4 coding region to a Clal site in the first exon of bli-4, contained in a lacZ reporter plasmid vector, c) deletions of the bli-4 upstream DNA fragment contained in the lacZ vector. 39 Ligation reactions to recircularize the plasmids were performed overnight, and competent E. coli transformed with the ligation mixture. Transformants were screened for the presence of the recircularized deleted plasmid. Positive colonies were grown overnight in LB containing 100 p,g/ml Ampicillin and the DNA extracted and prepared for injection as described. RESULTS 40 L S. cerevisiae KEX2 Mutant Rescue Analysis A. KEX2-defIcient yeast are rescued by transformation with endogenous KEX2 Transformation of KEX2-deficient S. cerevisiae using a genomic clone of KEX2 was performed as outlined in Figure 9. The yeast genomic fragment, under the control of the GAL promoter in a plasmid vector provided by Bob Fuller (University of Michigan Medical Center), was induced by growing the transformant strain on galactose-containing media. When this strain was patched on a lawn of opposite mating type yeast, a halo formed (Figure 10), indicating that the extrachromosomally derived kex2p was expressed and activated. This experiment demonstrated that the expression vector activation and the test substrate were functional. 41 B. KEX2-deficient S. cerevisiae is not rescued by Blisterase D Transformation of KEX2-deficient S. cerevisiae with a cDNA clone encoding the Blisterase D isoform of bli-4 was performed (Figure 9) to determine whether this C. elegans gene product was able to functionally substitute for the missing endogenous yeast convertase. The bli-4 cDNA clone was expressed through induction of the GAL promoter by growing transformants on medium containing galactose. Activity of the Blisterase D convertase was assayed by production of the active form of the a-mating factor which is a substrate of kex2p. This pheromone requires proteolytic cleavage by kex2p before being secreted. Cleavage of pro-a-mating factor is measured experimentally by the production of a halo around a patch of transformant cells plated on a lawn of opposite mating type yeast (Julius et al, 1984). These experiments were performed in C. Boone's laboratory with the assistance of Kelly Blundell (Simon Fraser University). KEX2-deficient yeast transformed with the Blisterase D cDNA did not produce a halo in the described assay (Figure 10), indicating that cleavage of the a-mating factor precursor did not occur. C Expression of Blisterase D in transgenic yeast In order to confirm that the exogenous transgene does express the Blisterase D protein, Western analysis of protease-deficient transformed yeast was done. The Blisterase D-GST fusion antibody used for detection of the C. elegans gene product did not indicate that Blisterase D was present in the transgenic yeast. 42 GAL Transform strain Y143 (MATcc, KEX2A::UPvA3) T MATcx, KEX2A::URA; bli-4 (D) Grow on galactose to induce expression; plate transformants on lawn of MATa yeast (strains 2625, 2488) T Score for the presence of a halo (as in b); this indicates cleavage of pre-a-mating factor Figure 9 Experimental Scheme for Rescue of KEX2-deficient S. cerevisiae Figure 10 Transformation of KEX2-deficient yeast with Blisterase D The two patches on the left half of the plate are transformants expressing the endogenous K E X 2 from a GAL-dr iven vector. The two patches on the right half of the plate are transformants containing the C. elegans bli-4 c D N A encoding Blisterase D . 44 D. C. elegans Mutant Rescue Analysis A. bli-4(e937) mutants are rescued by the Blisterase A cDNA (pCeh297) Previous work aimed at determining the roles of the individual products of bli-4 (Srayko, 1995; Thacker et al, 1995) has demonstrated that one of the four isoforms, Blisterase A, is able to rescue the blistering phenotype in bli-4(e937) mutant worms. As a consequence, a cDNA clone of the Blisterase A isoform (pCehl95), under the control of the heat shock promoter hsp 16-2, was injected into CB937 (e937/e937) hermaphrodites and stable transgenic lines established. This strain allows a baseline level of rescue to be established against which the abilities of KEX2 and hfur to rescue the blistering phenotype may be evaluated. Late L4 larval animals were exposed to 30°C heat for two hours, inducing expression of the extrachromosomal cDNA construct. Upon subsequent scoring, worms exposed to the heat shock conditions blistered only 43.0% of the time, while 72.7% of those not exposed to heat shock exhibited the blistered phenotype. These results are summarized in Table 5. B. S. cerevisiae KEX2 (pCeh295) can rescue bli-4(e937) mutants Genetic transformation of C. elegans is often used to evaluate the potential of exogenous products to phenotypically rescue mutants. In order to examine the ability of S. cerevisiae KEX2 to phenotypically rescue bli-4(e937) mutants, a yeast genomic clone (provided by R. Fuller, University of Michigan Medical Center), under the control of the C. elegans hsp 16-2 heat shock promoter (P. Candido, University of British Columbia; constructed by A. Fire, Carnegie 4 5 Institute of Technology), was injected into CB937 (e937/e937) hermaphrodites by D. Janke (Simon Fraser University), and stable transgenic lines were obtained. Transgenic worms in the last half of the fourth larval stage (pre-adult) were exposed to 30°C for two hours to induce expression of the transgene. After heat shock, worms were scored for the presence or absence of the blistering phenotype. Transgenic worms not exposed to this heat shock treatment exhibited the blistered phenotype 72.4% of the time, while only 8.9% of those exposed to heat shock developed blisters. These results are summarized in Table 5. -The transgenic strain carrying the yeast KEX2 clone occasionally segregated worms with a dumpyish (Dpy) phenotype. Individual Dpy worms were followed through to subsequent generations; however, the phenotype was never heritable. The appearance of these worms may be the result of stochastic environmental effects, and may not reflect any properties of the yeast KEX2 transgene. C. Human hfur (pCeh296) can rescue bli-4(e937) mutants A human member of the kexin protease family, furin, is known to be expressed in a wide variety of tissue types and able to process a number of different substrate molecules. Both in vivo and in vitro experiments have shown furin to be able to cleave non-specific target molecules that contain a cleavage motif of R-X-K/R-R (Molloy et al, 1992). As a result of its widespread and ubiquitous activity, it was reasonable to evaluate the ability of furin to substitute for the lack of Blisterase A in C. elegans bli-4(e937) mutants. A cDNA clone of the human gene hfur (provided by G. Thomas, Oregon Health Sciences University), under the control of the heat shock promoter hsp 16-2, was injected into CB937 hermaphrodites and stable transmitting lines established as above. 46 Table 5 Summary of bli-4(e93 7) transgenic rescue results Construct Rescue % Bli (heat shock) %Bli (non-heat shock) pCeh295 + 8.9 72.4 (KEX2) (41/459) (416/575) pCeh296 + 16.3 91.4 (hfur) (90/551) (655/717) pCeh297 + 43.0 72.7 (bli-4 A cDNA) (276/642) (611/841) pPD49.78 - 34.6 41.7 (negative control) (191/552) (221/530) CB937 - 79.3 74.1 (658/1488) (705/1656) Summary of the results of the transgenic rescue experiment using S. cerevisiae KEX2 and human hfur in the inducible hsp 16-2 heat shock vector. pPD49.78 is the heat shock 16-2 vector without any insert. Numbers in parentheses are the total number of Rol-6 transgenic worms counted for each measurement of blistering (for CB937, numbers represent total worms counted). Chi-squared statistical analysis is presented in Appendix II. Each transgenic strain, except the negative control (carrying pPD49.78), was back-crossed to another stock of CB937 in order to remove any potential mutations accumulated during strain maintenance. 47 Late L4 larval transgenics were exposed to two hour heat shock (30°C) to induce expression of the transgene. The worms were subsequently scored for the presence or absence of the blistering phenotype. Control animals not exposed to heat shock blistered 91.4% of the time, while 16.3% of those exposed to the 30°C temperatures developed blisters. These results are summarized in Table 5. DX Analysis of the 5' end of bli-4 A, Deletion of various regions upstream of bli-4 differentially affect gene expression Previous analysis of the controlling regulatory elements of bli-4 (Thacker etai, 1995) determined that an approximately five kilobase region upstream of the coding region was sufficient to drive expression of lacZ in a fusion reporter construct. This plasmid was subjected to deletions through restriction digestion as described in Materials and Methods in order to further define the regions within the five kb upstream DNA that contain important regulatory information. Three deletions were prepared (Figure 11), and the individual constructs (pCeh288, pCeh289 and pCeh291) were injected into N2 hermaphrodites. Stable transmitting lines were established for each of the three constructs. Two of the three lines were then treated with UV to induce chromosomal breakage and thereby encourage integration of the extrachromosomal arrays. Individual animals (egg to adult) from each integrated line and the one non-integrated line were then stained with Xgal to detect expression of the bli-4/lacZ fusion protein. In addition, worms were stained with DAPI to allow localization of nuclei. Transgenic worms carrying the intact upstream region (KR3324 and KR3325) were 48 c) j 1 pCeh254: AXbal-XhoI | • 1 pCeh288: AXbal-Bglll j 1 PCeh291: ABlpI-XhoI | 1 PCeh289: ABglll-XhoI Figure 11 Deletions constructs prepared for analysis of the 5' end of bli-4 Legend: a) genomic region spanning the bli-4 coding region. Exons are denoted by rectangles, b) DNA from an Xbal site upstream of the bli-4 coding region to a Clal site in the first exon of bli-4, contained in a lacZ reporter plasmid vector, c) deletions of the bli-4 upstream DNA fragment contained in the lacZ vector. 49 used as positive controls, while those with 4 kb of the upstream DNA deleted (KR3002) were used as negative controls. KR3002 has been shown previously (Srayko, 1995) to exhibit no Xgal staining, indicating that essential regulatory elements are within the four kilobases of DNA deleted in the construct carried by that strain. The staining patterns of each strain, as well as the two control strains, are summarized in Table 6. 1. pCeh288 Approximately 3 kb of DNA between Xbal and BgRl (see Figure 11) is deleted in pCeh288, leaving roughly 2 kb of DNA immmediately upstream of bli-4 fused to the bacterial reporter gene lacZ. The non-integrated transgenic strain carrying pCeh288 (KR3205) exhibited no Xgal staining at any developmental stage. This suggests that required promoter elements that drive bli-4 expression may be found within the 3 kb region between Xbal and BgUI upstream of the bli-4 A T G start codon. 2. pCeh289 The reporter construct carrying lacZ fused to DNA upstream of bli-4 is deleted between BgRl and Xhol in pCeh289, leaving approximately 3 kb between Xbal and BgRl upstream of the bli-4 coding region (see Figure 11). The non-integrated transgenic line carrying pCeh289 (KR3207) exhibited Xgal staining in embryos and early larval stages (L1-L2). Some limited staining was seen in older larval worms but none was observed in adults. Embryonic staining appears at the three-fold stage in a number of cells, identified as hypodermal by DAPI nuclear 50 Table 6 Summary of Xgal staining patterns in bli-4 upstream deletion construct transgenics. Construct Staining patterns pCeh288 (inKR3205) no staining visible at any developmental stage pCeh289 (inKR3207, KR3275, KR3276) embryos, L l and L2, limited staining at L3 pCeh291 (inKR3209, KR3277) embryos, larvae pCeh254 (inKR3002) no staining visible at any developmental stage pCeh320 (inKR3324, KR3325) staining throughout development: hypodermal and vulval cells and ventral nerve cords 51 f Figure 12(a) pCeh289 transgenic staining pattern: Nomarski photomicrograph of representative KR3276 eggs 52 J Figure 12(b) pCeh289 transgenic staining pattern: Nomarski photomicrograph of KR3276 larvae Figure 13(a) pCeb.291 transgenic staining pattern: Nomarski photomicrograph of representative KR3277 eggs 54 Figure 13(b) pCeh291 transgenic staining pattern: Nomarski photomicrograph of representative KR3277 larvae 55 Figure 14 Staining patterns of positive control transgenic adult hermaphrodite (KR3324) 56 positioning. In both the LI and L2 larvae, staining appears in seam hypodermal cells in the head and tail, and along the body length. A pair of hyp 10 hypodermal cells appear consistently stained in the tails of L3 and L4 worms. Two integrated lines (KR3275 and KR3276) were also stained with Xgal and DAPI. Both show much the same pattern as the non-integrated line; however, one of these integrated strains also exhibits adult staining. This difference may be attributed to transcriptional interference at the site of integration. The results nevertheless suggest that the approximately 1 kb of DNA deleted in this construct contains information important in driving later (adult) expression of bli-4. Photomicrographs of embryos and larvae are shown in Figure 12 (a) and (b). 3. pCeh291 The plasmid pCeh291 has been deleted between Blpl and Xhol (see Figure 11), thus removing 2kb of DNA just upstream of bli-4. The construct contains only the 2 kb most distal to the bli-4 coding region. Strain KR3209, which carries pCeh291 in a non-integrated extrachromosomal array, shows Xgal staining in both embryos and larvae. The staining appears in hypodermal cells as indicated by nuclear positioning by DAPI staining. An integrated strain (KR3277) shows the same Xgal staining pattern. This suggests that the 2 kb of DNA most upstream of bli-4, as retained in this construct, contains elements important in the regulation of bli-4 expression in embryogenesis and early larval development, and further suggests that the 1 kb between Blpl and BgRl may carry regions important for expression in adult development. Figure 13 shows representative staining patterns for KR3209 and KR3277. 57 4. Control constructs Transgenic worms with the complete bli-4/lacZ fusion construct (pCeh320; provided by C. Thacker) containing approximately 5 kb of upstream DNA show extensive Xgal staining, as shown in Figure 14. The staining appears in hypodermal cells, vulval cells and in the ventral nerve cords. Staining is first detected at the three-fold stage of embryogenesis. Deletion of most of the 4 kb upstream DNA results in a total loss of expression as detected by Xgal staining (Srayko, 1995; this thesis). B. Sequence analysis of the sub-regions upstream of bli-4 The deletion analysis described above allowed investigation of particular regions within the DNA upstream of bli-4. Fragments of the DNA sequence corresponding to each of the deletion constructs was sent by e-mail to the National Center for Biotechnology Information (NCBI) BLAST server (blast@ncbi.nlm.nih.gov) for comparison to other known sequence databases. The BLAST server detects homologies between the submitted DNA and known gene sequences. Thus, analysis by the BLAST server may suggest possible sites for DNA-DNA or DNA-protein interactions. The DNA upstream of bli-4 contained in pCeh288 displayed homology with snRNA when aligned with sequences in the Eukaryotic Promoter Database, possibly suggesting RNA-DNA interactions within this region. However, the BLAST score for this alignment was insignificant (p=0.97), suggesting homologies only with small motifs not indicative of any biological relevance. 58 The bli-4 upstream DNA in pCeh289 displayed sequence homology with a number of other sequences when aligned within the non-redundant GenBank, EMBL, DDBJ and PDB databases. These include undefined 5' promoter regions from other organisms (yeast and the slime mold D. discoideum), erythroid-specific enhancer proteins (R. norvegicus), RNA polymerases (Borrelia burgdorferi and Spiroplasma citri) and zinc finger proteins {Rattus rattus and C.elegans). These alignments suggest at least one, but possibly more, sites for DNA-protein interactions in this region upstream of bli-4. As mentioned above, however, the probability values for each of these alignments are fairly low (p>0.0029), and may not be reflecting relevant interactions. The bli-4 upstream DNA carried in the plasmid pCeh291 has approximately 75% overlap with that in pCeh289 and therefore a similar alignment with the non-redundant databases at NCBI. However, some regions unique to the non-overlapping DNA showed homology with C. elegans cosmids (listed in Table 7) identified through the sequencing projects (Cambridge and St. Louis). Some predicted genes of interest (as identified by ACeDB) include helicases, phosphatases and protein kinases. The sequence search results are summarized for each of the three deletion constructs in Table 8. Analysis of each of the three sub-regions defined by the deletion constructs was also done using the University of Pennsylvania Computational Biology and Informatics Laboratory's Transcription Element Search Software (TESS). The TESS search program searches for alignments between sample sequences and transcription factor sequences contained in the Transfac database. This search engine defined many transcription factor binding motifs in each deletion construct's sequence (see Appendix IV). Sites of relevance were 59 Xb E Xh E E E P E Sal Sal E S a l X h P E E E K K E E P + + * Elements (based on TESS and NNPP results) Figure 15 Schematic representation of predicted promoters based on the TESS and NNPP search results Legend: each * represents a putative promoter site based on the NNPP analysis results; each + represents a site with multiple transcription factor binding motifs as identified by TESS. 60 chosen based on multiple binding factors in one region. The results of the TESS analysis are consistent with the staining patterns described above. Additional information was provided by the Neural Network Promoter Prediction (NNPP) program, which analyzes DNA sequences both for the presence of TATA-box motifs and surrounding sequence which is compatible with known promoters. NNPP analysis predicted six putative promoter motifs upstream of bli-4, all occurring within the 3 kb most proximal to the bli-4 coding region. The NNPP results are summarized in Table 9. A representation of all search results is shown in Figure 15. 61 Table 7 C. elegans cosmids identified by BLAST analysis in the DNA unique to pCeh289 Cosmid Predicted or known genes T19D2 protein-tyrosine phosphatase C05B5 ATP/GTP-binding site motif A (P-loop) C18B2 unidentified cDNAs T02C5 unc-2 F15A2 collagen, trehelase precursor, serine/threonine protein kinase, worm-specific proteins B0457 ATP-dependant RNA helicase, ATP-dependent helicases, G-protein coupled receptor protein K07E12 no known or predicted genes ZC302 guanine nucleotide binding protein Summary of BLAST search results for the DNA unique to the deletion construct pCeh289. Predicted or known genes listed here were identified using the C. elegans database ACeDB. 62 Table 8 Summary of BLAST search results for sub-regions in the DNA upstream of bli-4. Construct Unique BLAST search homologies pCeh288 snRNA pCeh289 promoters, zinc finger, tissue specific enhancer, RNA polymerase pCeh291 C. elegans cosmids Summary of BLAST search results for sub-regions defined by deletions of the bli-4 upstream DNA. Relevant homologies unique to each region carried in the plasmids listed above are reported here. 63 Table 9 Promoter predictions provided by the NNPP search engine. pCeh# Promoter Sequence Position 288 TACAGTACTCTTTAAAGGCGCACACCCATTCAC ATTTAACAGAACATTT 566-616 CCGGCTACCGTATATATGGGGCAAAATGTTGCA TTTTAACGCTCCTCATC 626-676 TCCAATCGAATAAATAAATCGTGTTTGACCCA TAGCGTGAAAATCCCATG 932-982 289 TTCGACTGCGTATACTGCCGCAATTTCTGGAAA TCATACTTAGATTACT 1993-2043 TGAGATATAAATCTCAAAATTCCTTCTTTCCCC CTAATCAATTGTGAAT 2195-2245 GTGATCTGTGTATAACTGGTGGCCAATATCAGT TTCTGGTGATCAATGTT 2275-2325 GGAAAACCTATATAAAATGTGTTAATAAACTG GTGTTTTTTATTCTATG 2405-2455 TATTTAATCTATTAAAAATTCAGCGAGCGAGG TAAAGATTAGTCATGGTA 2823-2873 ATTTCCCCCATTTAAATCTCGACGCAATCTGTT TCTTTCTCTTTACTCTT 2872-2922 291 TATTTAATCTATTAAAAATTCAGCGAGCGAGG TAAAGATTAGTCATGGTA 343-393 ATTTCCCCCATTTAAATCTCGACGCAATCTGTT TCTTTCTCTTTACTCTT 392-442 TACAGTACTCTTTAAAGGCGCACACCCATTCAC ATTTAACAGAACATTTT 1126-1176 CCGGCTACCGTATATATGGGGCAAAATGTTGCA TTTTAACGCTCCTCATC 1186-1236 TCCAATCGAATAAATAATCGTGTTTGACCCAT AGCGTGAAAATCCCATG 1492-1542 DISCUSSION 64 Evolutionary Conservation of Function Between C. elegans. Yeast and Human Kexin Family Members Many diverse examples of proteolytic activation of precursor molecules can be found throughout the animal kingdom. Following initial experiments three decades ago (Chretien and Li, 1967; Steiner et al, 1967), much information has been gathered regarding regulation of cellular processes through proteolysis. The kexin family of proprotein convertases, originally described by work with S. cerevisiae, is known to accomplish this kind of activation. The yeast KEX2 gene product, kex2p, is a Golgi-localized, calcium-dependent transmembrane protein that activates precursor forms of the oc-mating factor (an essential pheromone for mating) and of the Mi. killer toxin during transport to the cell surface for secretion. A human member of this family of serine endoproteases (furin) has also been extensively studied (Molloy et al, 1992; Molloy et al, 1994; Schafer et al, 1995; Pei and Weiss, 1995). Like kex2p, furin is a membrane-bound molecule, localized to the trans-Go\g\ network (TGN) (Molloy et al, 1994). It cleaves substrate molecules during a cycling process from the endoplasmic reticulum to 65 the cell surface. Furin is expressed in many tissue types, functioning as a ubiquitous activator of a number of substrate targets (Molloy et al, 1992; Pei and Weiss, 1995). Members of the kexin family can be classified as one of two types: those widely expressed in different tissue types (membrane-bound) and those expressed in tissue-specific patterns (non-membrane-bound). Structurally, both furin and kex2p are similar to two of the products of bli-4, Blisterase C and Blisterase D, suggesting that these two Blisterases may also be expressed in many tissue types. Conversely, the A and B isoforms are more similar to kexin family members known to be expressed in a tissue-specific manner (PCSK1/3, PCSK2 and PCSK4) (Smeekens et al, 1992; Thacker er a/, 1995). All kexin proprotein convertase family members cleave substrate molecules on the carboxy end of a pair of basic amino acid residues (lysine or arginine), thereby releasing the active form (Steiner, 1991; Seidah and Chretien, 1992). This minimal requirement for substrate recognition appears to be sufficient to induce in vitro cleavage of a substrate by any kexin. The prototypic family member, kex2p, cleaves substrate molecules containing only this dibasic motif. However, cleavage motifs can be expanded beyond this iriinimal recognition sequence, suggesting that regulation of this proteolytic activation process lies, at least in part, in very specific enzyme-substrate interactions. Yet since in vitro biochemical assays have shown that any kexin can cleave any molecule that contains the miiiimal dibasic residue motif, this suggests that a higher level of control, regulating the interaction between kexins and their substrates, must exist. There is likely to be gene regulation controlling tissue specificity of kexin protease expression. Clearly, proteolytic activation of a substrate molecule will only happen if it co-expresses with the catalytic enzyme. In unicellular organisms like S. cerevisiae, this kind of control is not possible. It may be that control of activation in these organisms is achieved through determining subcellular co-66 localization, or through timing of expression. This indicates the importance of C. elegans as a model system for understanding the endogenous roles of kexin family members. Much of our current knowledge of this enzyme family comes from work in yeast with KEX2. However, this can not tell us about regulation through tissue specificity. The four kexin products encoded by bli-4 can tell us a great deal about the processes involved in regulation of interactions with substrate molecules. Thus, direct confirmation that the bli-4 gene products exhibit conservation of function with the prototypic kexin kex2p and with the higher kexin member from humans (furin) is essential in proving the value of C. elegans as an important model system in the study of kexin convertases. Transgenic Rescue of S. cerevisiae Mutants Transgenic rescue of mutant phenotypes has been used in many cases to demonstrate functional homology of gene products between diverse species. Previous attempts to phenotypically rescue S. cerevisiae KEX2 mutants with exogenous transgenes have been unsuccessful (Steiner, 1991; C. Boone, personal communication). However, genetic transformation of other yeast mutants with non-yeast transgenes (including C. elegans genes) has been achieved (Chaudhuri etal, 1992; Chen et al, 1993; Gavin etal, 1995; Leggetera/, 1995). In this thesis, yeast carrying a deletion of KEX2 were transformed with a plasmid containing a cDNA for one of the C. elegans bli-4 products. A goal of this thesis was to demonstrate evolutionary conservation of function between known kexin family members, kex2p and furin, and the C. elegans putative members, the blisterases. Study of the kexin family of proprotein convertases has been largely limited to cell culture analysis for multicellular systems. Proof of functional identity between the 67 blisterases and other members of the kexin family would provide a useful model for understanding the functional role of kexin convertases in multicellular systems. The bli-4 isoform chosen (Blisterase D) is predicted through sequence analysis to be the most structurally similar to the native kex2p (see Figure 3). A cDNA encoding this single isoform was cloned into a yeast plasmid vector, placing it under the control of the inducible GAL promoter. However, induced transformants producing Blisterase D did not exhibit rescue of the mutant phenotype. As mentioned earlier, native kex2p is localized sub-cellularly to the Golgi apparatus, where it exists as a transmembrane protein, activating substrate molecules in the secretory pathway cycle between the Golgi and the cell surface. Thus, accurate localization of the exogenous molecule is essential in order for it to function. Previous studies of KEX2 have shown that kex2p is a relatively long-lived protein, with a half life of approximately eighty minutes (Wilcox et al, 1992). Following its synthesis, kex2p is transported to the late Golgi apparatus. The carboxy-terminal cytosolic tail of kex2p contains a signal required for retention in the Golgi. Both kex2p and pro-a-mating factor are co-localized to a processing vesicle, which develops into a secretory vesicle that delivers mature mating factor to the cell surface. Mutations in the cytoplasmic tail of kex2p have detrimental effects on the half-life, total cellular activity and localization of the protease. The localization or retention signals provided by Blisterase D may be sufficiently different (see Figure 16) so that transport to and retention in the Golgi apparatus either does not occur, or takes place slowly. One explanation could be that foreign proteins may be degraded through proteolysis, suggesting that the Blisterase D molecules degrade before localization can occur. To test this hypothesis, transformation of protease-deficient KEX2 mutants may be done, allowing for Blisterase D to be appropriately transported to the Golgi apparatus without degradation. This kind of analysis may determine whether Blisterase D 68 Comparison of: (A) bli-4 (B) K E X 2 using matrix file B L O S U M 5 0 32.3% identity in 31 aa overlap; ink: 43, opt: 49 bli-4 G D P F L D T I T Y F L Y H S E T T R T T I R L K R A I V E R L D : : : X : . . . . : : . . : X . . . : K E X 2 G A T F L V L Y F M F F M K S R R R T J R R S R A E T Y E F D Figure 16 Alignment of carboxy-terminal sequences from KEX2 and bli-4 Local fasta alignment of bli-4 amino acid sequence with the Golgi localization and retention signal of K E X 2 . The sequence on top is from bli-4, while the bottom sequence is of K E X 2 . The bold residue in the K E X 2 sequence represents an essential residue for appropriate localization of K E X 2 in yeast. 69 shows conservation of function with kex2p in yeast. It is not likely that lack of substrate-enzyme specificity is responsible for the non-rescue, since it has been shown biochemically that any substrate containing the minimal recognition sequence will be appropriately cleaved by any kexin; however, this experiment has not been done using pro-a-mating factor. In vivo co-expression studies using other proprotein convertase family members (Thomas et al, 1988; de Bie et al, 1995) have shown that this redundancy also exists in biological systems. Fusion of the catalytic domain from bli-4 with the intracellular localization signals of KEX2 would demonstrate the ability of Blisterase D to function in vivo in transformed yeast. The fusion protein would be appropriately localized intracellularly, allowing analysis of the functional equivalency of Blisterase D and kex2p. The failure to rescue the KEX2 mutant phenotype could also be the result of a number of experimental errors; as a result, it would be necessary to confirm that Blisterase D was expressed in the transgenic yeast in order to understand why rescue did not occur. The cDNA may not be transcribed or the RNA message may not be translated. Alternatively, the transgenic protein may be degraded before localization could take place. Western analysis of transgenic protease-deficient yeast was performed in order to determine whether or not mature Blisterase D protein was present. Protein extracts were stained with a GST-fusion Blisterase D-specific antibody. The results of this analysis were inconclusive, with much non-specific binding also detected. An alternate approach for confirming expression of Blisterase D in the transgenic yeast might take advantage of the reverse transcriptase PCR technique, which would determine whether or not the transgene is being transcribed. 70 Transformation Rescue of C. elegans Mutants Transformation rescue of C. elegans mutants by non-nematode genes has been highly successful. There are many examples of genetic rescue by yeast, Drosophila and human transgenes (Vaux et al, 1992). This suggested that there was the potential to test for the abilities of yeast KEX2 and human hfur to phenotypically rescue bli-4. Germline injection of C. elegans is an often used and well-described method (Fire, 1986; Mello et al 1991; Mello and Fire, 1995) for genetic transformation. The ideal approach for transgenic rescue is to create an expression vector containing the promoter of the gene being replaced, thereby ensuring that the transgene will be expressed in the same manner in space and time as the endogenous form. Since this is not always possible (due to limited understanding of the regulatory elements for any particular gene), pre-constructed vector systems (A. Fire, Carnegie Institute of Technology) are often used. These vectors have been designed for a number of applications, from reporter assays (as described later) to expression vectors as used in this thesis. The heat-shock hsp 16-2 (P. Candido, University of British Columbia) inducible expression vector (A. Fire, Carnegie Institute of Technology) contains the promoter elements of a heat-shock specific gene, one of three discovered through homology with known Drosophila heat shock systems (Snutch and Baillie, 1984; Jones et al, 1986; Stringham et al, 1992). The promoter is followed by a multiple cloning site which allows the transgene of interest to be readily cloned into the plasmid backbone. The 3' untranslated region of the C. elegans gene unc-54 occurs downstream of the cloning site. This region provides post-transcriptional modification information, and has been well-studied (Okkema et al, 1993). Thus, the heat shock promoter, induced by 30°C temperatures, initiates transcription of 71 the transgene. The complete message will carry the 3' UTR of unc-54, and should maintain stability long enough to be translated. In order to analyze the evolutionary conservation of function between the Blisterases and other kexin family members, the prototypic member, S. cerevisiae KEX2, and the ubiquitously expressed human member, hfur, were cloned into the heat shock vector and the constructs injected into CB937. Since the human kexin family member, furin, is expressed widely in vivo, it may be more closely related in function to the C. elegans Blisterases. Stable transgenic lines were exposed to heat shock temperatures as described in Materials and Methods and subsequently evaluated to determine whether or not they developed blisters. The strains carrying KEX2 and hfur developed reduced blistering in the Rol-6 animals without being exposed to high temperatures (data not shown). This is not an expected consequence, since the hsp 16-2 promoter is only active when induced by high temperatures. There is no evidence for genetic interactions between bli-4 and rol-6, although the ROL-6 protein, which is expressed in the cuticle, does contain the cleavage motif predicted to be recognized by the Blisterases. However, this aberrant response was not observed in previous studies using rol-6'as an injection marker in CB937 worms (Srayko, 1995; Thacker et al, 1995). It is possible that the strain used for injection may have accumulated mutations while being maintained. Consequently, the extrachromosomal array was crossed into a new CB937 stock, thereby eliminating the possibility of carrying any additional mutations. Nevertheless, it is clear that both KEX2 and hfur are able to phenotypically rescue the blistering mutation in bli-4, reducing the frequency of blistering by 60 to 75%. However, blistering is not completely eliminated. The extrachromosomal array is not integrated into the genome and may not be present in every cell. This might allow for the formation of a blister to initiate in any cell lacking the exogenous convertase (kex2p or furin). Since scoring is simply for the presence or absence of 72 blisters, these animals may be counted as blistered even though the foreign protein may be able to rescue the phenotype in other cells. In addition, since the blistered phenotype is adult-specific, the worms must be exposed to high temperatures at a particular time-interval when production of the adult cuticle is in process. If heat shock is too early, the exogenous protein may be degraded by the time it is needed. Conversely, if the worms are treated too late, the cuticle will already have been formed and the transgenic protein may be useless. Despite these potential confounding factors, the reduction in blistering frequency is sufficient to demonstrate functional conservation between the gene products of bli-4 with kex2p and furin. It is possible that kex2p rescues bli-4(e937) mutants more fully than furin; however, the mosaicism of expression of non-integrated transgenes and their variable heritability make this difficult to test. The controls used for transformation rescue of bli-4(e937) mutants provided somewhat unexpected results. As shown in Table 5, e937 homozygotes (strain CB937) develop blisters approximately 80% of the time. Yet surprisingly, only roughly 40% of the negative control transgenic worms, which carry only the plasmid vector without any coding information, developed blisters. This may be an unforeseen consequence of the injection process itself. The positive control transgenic worms, which carry a cDNA encoding the Blisterase A isoform, exhibited less complete rescue of the blistering phenotype than did either the KEX2 or hfur transgenic worms. Previous analyses of bli-4 (Srayko, 1995; Thacker et al, 1996) have suggested a level of redundancy among the products of bli-4. It may be that over-expression of Blisterase A alone, as in the positive control transgenic worms, is not sufficient for full phenotypic rescue. Knowledge of specific motifs recognized by the four Blisterases is not yet known. As mentioned previously, kex2p most efficiently cleaves substrate molecules containing only a pair of basic amino acids, while the preferred cleavage motif 73 recognized by furin is more complex (R-X-K/R-R or, less commonly, R-X-X-R) (Molloy et al, 1994; Shafer et al, 1995). This may suggest that the Blisterases also recognize a simpler motif of dibasic residues in their substrate targets. This cleavage specificity may be examined by biochemical enzymatic assays, measuring the ability of the Blisterases to cleave substrate molecules containing variations on the rudimentary dibasic motif (as reviewed in Seidah and Chretien, 1992) . Functional identity with any of the individual Blisterases is not yet known. As more is learned about the regulatory signals of bli-4, we may be able to determine if particular elements determine each isoform's expression. These could be used in a vector system as described above to drive expression of KEX2 and hfur in the manner of each particular bli-4 gene product. Regulation of Expression of bli-4 Regulation of gene expression is under hierarchical levels of control. Global regulation through chromatin structure (Dixon et al, 1990; reviewed by Krause, 1995) is important in determining access of transcriptional machinery to areas of the genome. Transcriptional regulation of gene expression is under the control of RNA polymerases. In C. elegans, most genes are transcribed by RNA polymerase II, which binds a TATA consensus sequence generally found approximately 30 bp upstream of the transcriptional start site. Other transcriptional factors are being identified through sequence homologies as the sequencing project covers more of the genome. Control elements, such as enhancers, specific to one gene or a class of genes are also being identified. Gut-specific (Aamodt et al, 1991; Egan et al, 1995) and myosin-specific (Okkema et al, 1993) elements are also being identified by the use of transgenic strains carrying 74 reporter genes like lacZ and GFP fused to the promoter of interest. Further control of gene expression is exercised post-transcriptionally, through message splicing and 3' end processing. The final mature message is then subject to translational regulation. RNA-RNA interactions, such as that between lin-4 and lin-14 (Lee et al, 1993), demonstrate the kinds of control mechanisms acting on modified RNA molecules, lin-4 produces a pair of small RNA molecules (22 and 61 nucleotides long) that are complementary to several regions in the 3' untranslated region of the lin-14 message, suggesting that the lin-4 RNAs act to down-regulate expression of lin-14 by preventing translation of its RNA message. Currently, little is known about translational machinery in C. elegans. Nonetheless, C. elegans is progressively becoming a more useful system for dissecting many kinds of regulatory elements for genes of interest. Fragments of upstream or downstream DNA can be used in vector systems as mentioned above to control expression of reporter genes. The control elements regulating expression of bli-4 have been studied in this thesis. It is reasonable to expect that there is more than one signal directing bli-4 expression, since it is expressed in a variety of tissue types at different developmental stages. The collections of mutants in bli-4 also indicate complex regulatory elements, specifying expression in embryogenesis, early larval development and at the adult moulting. In order to address these issues, approximately 5 kb of upstream DNA, as well as the first coding exon of bli-4, was fused in frame with the bacterial reporter gene lacZ. A series of three deletions were created and the reporter constructs injected into N2 in order to examine the roles of each sub-region in regulating bli-4 expression. The extrachromosomal arrays in each of the deletion-carrying transgenic lines were integrated into the genome following brief exposure to UV. Worms at all developmental stages from the integrated strains, as well as from an integrated line carrying the entire 75 upstream fragment (KR3324) and a non-integrated line with most of the upstream DNA deleted (KR3002), were stained with Xgal to examine the expression patterns. In the transgenic line carrying the full, non-deleted upstream fragment (pCeh320), staining is seen in a number of cell types. Adult and larval transgenic animals show expression in all hypodermal cells, the vulva and the ventral nerve cords (Thacker et al, 1995; this thesis). Expression is first detected in hypodermal cells at the two-fold stage of embryogenesis, just prior to the developmental arrest stage in the bli-4 lethal mutants (Thacker et al, 1995). In KR3002, in which 4 kb of upstream DNA has been deleted, no staining is detected at any developmental stage, confirming that regulatory elements essential in controlling bli-4 expression are within this region. Sub-regions as defined by the series of deletions described in Materials and Methods (see Figure 11) show varying staining patterns. KR3205 non-integrated transgenic animals (carrying pCeh288) also show no staining at any time during development. Thus, essential required elements for expression lie in the most distal 3 kb of upstream DNA. Transgenic animals which retain this most distal fragment (pCeh289), show Xgal staining in a variety of hypodermal cells in embryos and larvae, but not in adults, suggesting the presence of an adult-specific transcriptional cue in the 1 kb region between BgUl and Xhol (see Figure 11). Staining appears to be similar to that in the non-deleted transgenic strain in the embryos and early larval stages, with expression detected in hypodermal seam cells. However, older larvae (L3 and L4) show restricted tissue expression patterns, with staining limited to a pair of hypodermal cells (hyp 10) in the tail as well as a pair of hypodermal cells in the pharyngeal region. Two independent integrated lines carrying pCeh289 (KR3275 and KR3276) were analyzed by Xgal staining. The staining patterns are essentially the same, although one (KR3276) also shows some adult expression. It 76 is unclear which staining pattern reflects the true expression pattern of bli-4 and whether the expression pattern in either one of the integrated lines is being influenced by the site of integration. However, since non-integrated transgenic worms carrying pCeh289 (KR3207) show no staining in adult animals, it is likely that the integrant showing adult staining is exhibiting an aberrant expression pattern. Alternatively, the mosaic pattern of expression of this non-integrated array may be reponsible for lack of detection in adult worms. Antibody staining may be done in order to confirm the wild-type expression pattern of bli-4. Staining in KR3209 transgenics and in the integrated strain KR3277, which retain the most distal 2 kb of upstream DNA, appears both in embryos and larvae, suggesting that there may be at least one additional cw-acting factor directing adult-specific expression, located in the 1 kb region between BgUl and Xhol (see Figure 11). These results suggest that there are at least three signals important in regulating expression of bli-4. In addition, the results indicate that at least one c/s-acting factor may be required to act in concert with other regulatory elements for adult-specific expression. Further detailed analysis of this region must be done in order to define these regulatory signals. Sequential deletions through these regions should allow identification of small fragments whose sequence can be analyzed in more detail. Analysis of the sequences of each of the sub-regions upstream of bli-4 made use of the NCBI BLAST server as well as the University of Pennsylvania's Transcription Element Search Software (TESS) and the Neural Network for Promoter Predictions (NNPP). The National Center for Biotechnology Information's BLAST server is a heuristic search algorithm used to assign significance to search tool findings using the statistical methods of Karlin and Altschul (Altschul et al, 1990). The BLAST server is most appropriate for sequence similarity searches but is not generally useful for motif-style searching. 77 Nonetheless, BLAST analysis of the sub-regions upstream of bli-4 may provide some insight into the regulatory elements important in bli-4 expression. Sequence homologies defined by the BLAST search engine include polymerases, tissue-specific enhancers, zinc fingers and other DNA-interacting proteins. However, none of the alignments had particularly high scores (see Appendix III), and may not reflect alignments of any biological interest. As mentioned above, the NCBI BLAST server provides alignments of sequence rather than searching for particular motifs; consequently, TESS and NNPP programs were used to more appropriately analyze the upstream DNA. The University of Pennsylvania's Transcription Element Search Software (TESS) is designed for locating and displaying transcription factor binding sites in DNA sequence (see Appendix IV for output). TESS utilizes the Transfac database, searching for matches between strings in the sequences provided and all transcription factor sequences contained in the database. TESS analyses of each of the sub-regions defined in the deletion analysis described above identify a number of putative transcription factor binding sites (see Appendix IV). Potential sites of interest may be regions where multiple transcription factor binding domains are identified. Such regions were detected throughout the four kilobases of DNA analyzed in this deletion approach, as shown in Figure 15. These areas showing high sequence identity with transcription factor binding motifs are possible sites for transcription initiation. However, many more potential binding sites are identified by the TESS search program than are likely to be of biological interest. More refined deletions, or possibly site-directed mutagenesis, may allow for further elucidation of the roles of these binding motifs. The Promoter Prediction by Neural Network (NNPP) program is designed to locate both prokaryotic and eukaryotic promoters in a given DNA sequence (Reese, 1994; Reese and Eeckman, 1995; Reese et al, 1996). The basis of the 78 NNPP program is a time-delay neural network that consists primarily of two layers, one that recognizes the TATA-box and one that recognizes the region spanning the transcription start site. As before, each of the sub-regions described by the deletion analysis were searched using the NNPP program in order to locate potential promoter motifs. NNPP predicted six distinct promoter sites upstream of bli-4, none of which occur within the approximately two kilobases of DNA most distal to the bli-4 coding region (Figure 15). All six predicted promoter sites fall between BlpI and BgRl, the same region defined by the reporter construct deletion analysis to contain information important for driving embryonic and larval expression of bli-4. In addition, these results may be supported by the TESS search software output. Three regions that contain multiple transcription factor binding motifs correspond with the locations of potential promoters identified by the NNPP program (Figure 15). Other multiple binding sites do not correspond to any predicted promoters and may instead be indicative of cis-acting factor binding sites. However, as mentioned above, it will be necessary to perform a more detailed deletion analysis of the bli-4 upstream region in order to clarify the factors involved in tissue-specific and developmental regulation of expression. The analysis of bli-4 regulation described here provides an initial insight into the processes involved in the control of expression. However, it is important to note that only the 5' upstream DNA has been examined. There is much evidence to suggest that regulatory factors may also be found downstream of genes, as well as internally within introns. As a result, the analysis presented in this thesis must be supplemented with detailed examinations of 3' and internal influences on expression. A possible approach that will allow insight into all elements required to control expression may be cloning a non-disruptive reporter tag construct in frame into bli-4, thereby ensuring that all regulatory information 79 within and around the gene remain intact. Comparison of expression patterns using such a construct with those reported here may indicate whether important control elements were missing in this analysis. Despite these potential confounding factors, the analysis described here provides unique information about the regulation of bli-4. This is the first such analysis performed for a member of the kexin family of proprotein convertases, and may be useful for understanding regulation in other family members. Sequencing of the genome of the related nematode C. briggsae is currently underway, and comparison of the upstream region of the C. briggsae homologue of"bli-4 may provide clues about evolutionary conservation not only of function between kexin family members but also of regulation. It is likely that the entire control process of bli-4, and of other kexin family members, is as complex as the enzymatic roles of the convertases themselves. Both tissue-specific and developmental timing of expression must be closely regulated, suggesting that a number of transcriptional initation molecules and processes may be involved. The analyses presented in this thesis represent a first step towards eventual understanding of these processes, in C. elegans and in other organisms of interest. CONCLUSIONS The goals of this thesis have been to investigate the evolutionary conservation of function between the products of the Caenorhabditis elegans gene bli-4 and kexin proprotein convertases from S. cerevisiae (kex2p) and humans (furin). The results shown here demonstrate that the four Blisterase products of bli-4 are functionally conserved with both the yeast and human 80 homologues. In addition, this thesis has investigated some of the regulatory elements controlling expression of bli-4. The preliminary results reported here indicate that at least three, but possibly more, transcriptional regulators are involved in determining developmental and tissue specific expression patterns of bli-4. These results underline the importance of C. elegans and bli-4 as a model system for understanding the biological roles of kexin family members throughout the animal kingdom. 81 REFERENCES Aamodt, E.J., Chung, M A . and McGhee, J.D., 1991. Spatial control of gut-specific gene expression during Caenorhabditis elegans development. Science 252:579-582. Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. Barr, P.J., 1991. Mammalian subtilisins: the long-sought dibasic processing endoproteases. Cell 66:1-3. Bresnahan, PA., Leduc, R., Thomas, L., Thorner, J., Gibson, H.L., Brake, A.J., Barr, P.J. and Thomas, G., 1990. Human fur gene encodes a yeast KEX2-like endoprotease that cleaves pro-beta-NGF in vivo. J. Cell Biol. 111:2851-2859. Chaudhuri, B., Lathan, S.E. and Stephan, C , 1992. A mutant Kex2 enzyme with a C-terminal HDEL sequence releases correctly folded human insulin-like growth factor-1 from a precursor accumulated in the yeast endoplasmic reticulum. Eur. J. Biochem. 210:811-822. Chalfie, M. Tu, Y , Euskirchen, G., Ward, W.W., and Prasher, D.C., 1994. Green fluorescent protein as a marker for gene expression. Science 263:802-805. Chan, S.J., Oliva, Jr. A.A., LaMendola, J., Grens, A., Bode, H. and Steiner, D.F., 1992. Conservation of the prohormone convertase family in metazoa: analysis of cDNAs encoding a PC3-like protein from hydra. Proc. Natl. Acad. Sci. 89:6678-6682. Chen, W., Lim, H.H. and Lim, L., 1993. The CDC42 homologue from Caenorhabditis elegans. Complementation of yeast mutation. J. Biol. Chem. 268:13280-13285. Chretien, M. and Li, C.H., 1967. Isolation, purification and characterization of gamma-lipotropic hormone from sheep pituitary glands. Can. J. Biochem. 45:1164-1174. 82 De Bie, I., Savaria, D., Roebroek, A.J.M., Day, R., Lazure, C, Van de Ven, W.J.M. and Seidah, N.G., 1995. Processing specificity and biosynthesis of the Drosophila melanogaster convertases dFurinl, dFurinl-CRR, dFurinl-X, and dFurin2. J. Biol. Chem. 270 (3): 1020-1028. Dixon, D.K., Jones, D., and Candido, E.P., 1990. The differentially expressed 16-kD heat shock genes of Caenorhabditis elegans exhibit differential changes in chromatin structure during heat shock. DNA Cell Biol. 9:177-191. Egan, C.R., Chung, M.A., Allen, F.L., Heschl M.F.P., van Buskirk, CL. and McGhee, J.D., 1995. A gut-to-pharynx/tail switch in embryonic expression of the Caenorhabditis elegans ges-1 gene centers on two GATA sequences. Dev. Biol. 170:397-419. Fire, A., 1986. Integrative transformation of Caenorhabditis elegans. EMBO J. 5 (10):2673-2680. Fire, A., Kondo, K. and Waterston, R., 1990. Vectors for low copy transformation of C. elegans. Nucleic Acids Research 18 (14):4269-4270. Fuller, R.S., Brake, A. and Thorner, J., 1989. Yeast prohormone processing enzyme (KEX2 gene product) is a Ca2+-dependent serine protease. Proc. Natl. Acad. Sci. 86:1434-1438. Fuller, R.S., Brake, A.J. and Thorner, J., 1989. Intracellular targeting and structural conservation of a prohormone-processing endoprotease. Science 246:482-485. Fuller, R.S., Brenner, C , Gluschankof, P. and Wilcox, C.A., 1991. The yeast prohormone-processing Kex2 protease, an enzyme with specificity for paired basic residues. Methods Prot. Seq. Anal. 205-214. Gavin, K.A., Hikada, M. and Stillman, B., 1995. Conserved initiator proteins in eukaryotes. Science 270:1667-1671. Gluschankof, P. and Fuller, R.S., 1994. A C-terminal domain conserved in precursor processing proteases is required for intramolecular N-terminal maturation of pro-Kex2 protease. EMBOJ. 13 (10):2280-2288. Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580. 83 Hodgkin, J., Horvitz, H.R. and Brenner, S., 1979. Nondisjunction mutants of the nematode Caenorhabditis elegans. Genetics 91:67-94. Horvitz, H.R., Brenner, S., Hodgkin, J. and Herman, R.K., 1979. A uniform genetic nomenclature for the nematode Caenorhabditis elegans. Molec. gen. Genet 175:129-133. Howell, A.M., Gilmore, S.G., Mancebo, RA. and Rose, A.M. 1987. Genetic analysis of a large autosomal region in Caenorhabditis elegans by the use of a free duplication. Genet. Res. 49:207-213. Johnstone, I.L., 1993. The cuticle of the nematode Caenorhabditis elegans: a complex collagen structure. BioEssays 16 (3):171-178. Jones, D., Russnack, R.H., Kay, R.J., and Candido, E.P., 1986. Structure, expression, and evolution of a heat shock gene locus in Caenorhabditis elegans that is flanked by repetitive elements. J. Biol. Chem. 261:12006-12015. Julius, D., Brake, A., Blair, L., Kunisawa, R., and Thorner, J., 1984. Isolation of the putative structural gene for the lysine-arginine-cleaving endopeptidase required for the processing of yeast prepro-alpha-factor. Cell 37:1075-1089. Keifer, M.C., Tucker, J.E., Joh, R., Landsberg, K.E., Saltman, D. and Barr, P.J. 1991. Identification of a second human subtilisin-like protease gene in the fes/fps region of chromosome 15. DNA Cell Biol. 10:757-769. Krause, M., 1995. in Epstein, H.F. and Shakes, D.C. (eds.), Methods in Cell Biology 48. Caenorhabditis elegans: modern biological analysis of an organism. Academic Press. Leduc, R., Molloy, S.S., Thorne, B.A., and Thomas, G., 1992. Activation of human furin precursor processing endoprotease occurs by an intramolecular autoproteolytic cleavage. J. Biol. Chem. 267:14304-14308. Lee, R.C., Feinbaum, R.L. and Ambros, V., 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75:843-854. 84 Legget, D.S., Jones, D. and Candido, E.P., 1995. Caenorhabditis elegans UBC-l, a ubiquitin-conjugating enzyme homologous to yeast RAD6/UBC2, contains a novel carboxy-terminal extension that is conserved in nematodes. DNA Cell Biol. 14:883-891. Lusson, J., Vieau, D., Hamelin, J., Day, R., Chretien, M. and Seidah, N.G. 1993. cDNA structure of the mouse and rat subtilisin/kexin-like PC5: a candidate proprotein convertase expressed in endocrine and nonendocrine cells. Proc. Natl. Acad. Sci. 90:6691-6695. Mello, C C , Kramer, J.M., Stinchcomb, D. and Ambros, V., 1991. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBOJ. 10 (12):3959-3970. Mello, C C . and Fire, A., 1995. DNA Transformation, p. 451-482, in Epstein HF and Shakes DC (eds), Methods in Cell Biology 48. Caenorhabditis elegans: modern biological analysis of an organism. Academic Press. Molloy, S.S., Bresnahan, P.A., Leppla, S.H., Klimpel, K.R. and Thomas, G., 1992. Human furin is a calcium-dependent serine endoprotease that recognizes the sequence Arg-_Y-_Y-Arg and efficiently cleaves Anthrax toxin protective antigen. J. Biol. Chem. 267 (23): 16396-16402. Molloy, S.S., Thomas, L., VanSlyke, J.K., Stenberg, P.E. and Thomas, G., 1994. Intracellular trafficking and activation of the furin proprotein convertase: localization to the TGN and recycling from the cell surface. EMBO J. 13 (l):18-33. Mumberg, D., Muller, R. and Funk, M., 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156:119-122. Nakayama, K. 1993. Identification and functional expression of a new member of the mammalian Kex2-like processing endoprotease family: its striking structural similarity to PACE4. J. Biochem. 113:132-135. Nakayama, K., Kim, W.-S., Torii, S., Hosaka, M., Nakagawa, T., Ikemizu, J. Baba, T., and Murakami, K. 1992. Identification of the fourth member of the mammalian endoprotease family homologous to the yeast Kex2 protease. J. Biol. Chem. 267:5897-5900. 85 Okkema, P.G., Harrison S.W., Plunger, V., Aryana, A. and Fire, A., 1993. Sequence requirements for myosin gene expression and regulation in Caenorhabditis elegans. Genetics 135:385-404. Okkema, P.G. and Fire, A., 1994. The Caenorhabditis elegans NK-2 class homeoprotein CEH-22 is involved in combinatorial activation of gene expression in pharyngeal muscle. Development 120:2175-2186. Park, E-C. and Horvitz, H.R., 1986. Mutations with dominant effects on the behavior and morphology of the nematode Caenorhabditis elegans. Genetics 113:821-852. Pei, D. and Weiss, S.J. 1995. Furin-dependent intracellular activation of the human stromelysin-3 zymogen. Nature 375:244-247. Peixoto, C.A. and De Souza, W., 1992. Cytochemical characterization of the cuticle of Caenorhabditis elegans (Nematoda: Rhabditoidea). J. Submicrosc. Cytol. Pathol. 24 (3):425-435. Peters, K., McDowall, J. and Rose, A.M., 1991. Mutations in the bli-4(I) locus of Caenorhabditis elegans disrupt both adult cuticle and early larval development. Genetics 129:95-102. Peters, K.W., 1992. A genetic and molecular characterization of the bli-4 locus of Caenorhabditis elegans, an essential gene encoding kex2-like subtilisin-type serine endoproteases. Ph.D. Thesis, University of British Columbia, Vancouver, BC, Canada. Redding, K., Holcomb, C. and Fuller, R.S., 1991. Immunolocalization of Kex2 protease identifies a putative late Golgi compartment in the yeast Saccharomyces cerevisiae. J. Cell Biol. 113 (3):527-538. Reese, M.G., 1994. Diploma Thesis, German Cancer Research Center, Heidelberg. Reese, M.G., and Eeckman, F.H., 1995. Novel neural network algorithms for improved eukaryotic promoter site recognition. Seventh International Genome Sequencing and Analysis Conference, Hilton Head Island, S. Carolina. 86 Reese, M.G., Harris, N.L. and Eeckman, F.H., 1996. Large scale sequencing specific neural networks for promoter and splice site recognition. In Proceedings of the Pacific Symposium on Biocomputing, eds. Hunter, L. and Klein, T., Kona, Hawaii, January 2-7, 1996. Roebroek, A.J.M., Schalken, J.A., Leunissen, J.A.M., Onnekink, C , Bloemers, H.P.J., and Van den Ven, W.J.M. 1986. Evolutionary conserved close linkage of the c-fes/fps proto-oncogene and genetic sequences encoding a receptor-like protein. EMBOJ. 5:2197-2202. Roebroek, A.J.M., Creemers, J.W.M., Pauli, I.G.L., Kurzik-Dumke, U., Rentrop, M., Gateff, E.A.F., Leunissen, J.A.M., and Van den Ven, W.J.M. 1992. Cloning and functional expression of Dfurin2, a subtilisin-like proprotein processing enzyme of Drosophila melanogaster with multiple repeats of a cysteine motif. J. Biol. Chem. 267:17208-17215. Rose, A.M., and Baillie, D.L., 1980. Genetic organization of the region around unc-15(1), a gene affecting paramyosin in Caenorhabditis elegans. Genetics 96:639-648. Rose, M.D., Novick, P., Thomas, J.H., Botstein, D. and Fink, G.R., 1987. A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector. Gene 60:237-243. Sambrook, J., Fritsch, E.F. and Maniatis, T., 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Schafer, W., Stroh, A , Berghofer, S., Seiler, J., Vey, M„ Kruse, M-L, Kern, H.F., Klenk, H-D. and Garten, W., 1995. Two independent targeting signals in the cytoplasmic domain determine trans-Go\gi network localization and endosomal trafficking of the proprotein convertase furin. EMBO J. 14 (ll):2424-2435. Seidah, N.G., Gaspar, L., Mion, P., Marcinkiewicz, M., Mbikay, M., and Chretien, M., 1990. cDNA sequence of two distinct pituitary proteins homologous to Kex2 and furin gene products: tissue-specific mRNAs encoding candidates for pro-hormone processing proteinases. DNA Cell Biol. 9:415-424. Seidah, N.G., Marcinkiewicz, M., Benjannet, S., Gaspar, L., Beaubien, G., Mattei, M.G., Lazure, C , Mbikay, M., and Chretien, M., 1991. Cloning and primary 87 sequence of a mouse candidate prohormone convertase PCI homolgous to PC2, furin and Kex2: distinct chromosomal localization and messenger RNA distribution in the brain and pituitary compared to PC2. Mol. Endocrinol. 5:111-122. Seidah, N.G. and Chretien, M., 1992. Proprotein and prohormone convertases of the subtilisin family: recent developments and future perspectives. TEM3 (4): 133-140. Seidah, N.G., Day, R., Hamelin, J., Gaspar, A., Collard, M.W., and Chretien, M , 1992. Testicular expression of PC4 in the rat: molecular diversity of a novel germ cell-specific kex2/subtilisin-like proprotein convertase. Mol. Endocrinol. 6:1559-1570. Seidah, N.G., Hamelin, J., Mamarbachi, M., Dong, W., Tardos, H., Mbikay, M., Chretien, M., and Day, R., 1996. cDNA structure, tissue distribution, and chromosomal localization of rat PC7, a novel mammalian proprotein convertase closest to yeast kexin-like proteinases. Proc. Natl. Acad. Sci. 93:3388-3393. Smeekens, S.P., and Steiner, D.F., 1990. Identification of a human insulinoma cDNA encoding a novel mammalian protein structurally related to the yeast dibasic processing protease Kex2. J. Biol. Chem. 265:2997-3000. Smeekens, S.P., Montag, A.G., Thomas, G., Albiges-Rizo, C , Carroll, R., Benig, M., Phillips, L.A., Martin, S., Ohagi, S., Gardner, P., Swift, H.H. and Steiner, D.F. 1992. Proinsulin processing by the subtilison-related proprotein convertases furin, PC2, and PC3. Proc. Natl. Acad. Sci. 89:8822-8826. Snutch, T.P., and Baillie, D.L., 1984. A high degree of DNA strain polymorphism associated with the major heat shock gene in Caenorhabditis elegans. Mol. Gen. Genet. 195:329-335. Srayko, M., 1995. A structure function analysis of the complex gene, bli-4, in Caenorhabditis elegans. M.Sc. Thesis, University of British Columbia, Vancouver, BC, Canada. Steiner, D.F., 1991. Prohormone convertases revealed at last. Current Biology 1 (6):375-377. 88 Steiner, D.F., Cunningham, D., Spigelman, L., and Aten, B., 1967. Insulin biosynthesis: evidence for a precursor. Science 157:697-700. Stringham, E.G., Dixon, D.K., Jones, D., and Candido, E.P., 1992. Temporal and spatial expression patterns of the small heat shock (hsp 16) genes in transgenic Caenorhabditis elegans. Mol. Biol. Cell 3:221-233. Thacker, C , Peters, K., Srayko, M. and Rose, A.M., 1995. The bli-4 locus of Caenorhabditis elegans encodes structurally distinct kex2/subtilisin-like endoproteases essential for early development and adult morphology. Genes and Development 9:956-971. Thomas, G., Thorne, B.A., Thomas, L., Allen, R.G., Hruby, D., Fuller, R. and Thorner, J., 1988. Yeast KEX2 endopeptidase correctly cleaves a neuroendocrine prohormone in mammalian cells. Science 241:226-230. Van den Ven, W.J.M., Voorberg, J., Fontijin, R., Pannekoek, H., van den Ouweland, A.M.W., van Duijnhoven, H.L.P., Roebroek, A.J.M., and Siezen, R.J., 1990. Furin is a subtilisin-like proprotein processing enzyme in higher eukaryotes. Mol. Biol. Rep. 14:265-275. van den Ouweland, A.M., van Duijnhoven, H.L., Keizer, G.D., Dorssers, L.C., and Van den Ven, W.J.M., 1990. Structural homology between the human fur gene product and the subtilisin-like- protease encoded by yeast KEX2. Nuc. Acids Res. 18:664. Vaux, D.L., Weissman, I.L., and Kim, S.K., 1992. Prevention of programmed cell death in Ceanorhabditis elegans by human bcl-2. Science 258:1955-1957. Wilcox, C.A., Redding, K., Wright, R. and Fuller, R.S., 1992. Mutation of a tyrosine localization signal in the cytosolic tail of yeast Kex2 protease disrupts Golgi retention and results in default transport to the vacuole. Mol. Biol. Cell 3:1353-1371. 89 A P P E N D I X I Analysis of the 5' DNA upstream of bli-4 has made use of reporter constructs, fusing fragments of upstream DNA with a reporter gene. In this thesis, three such deletions were prepared and evaluated using the bacterial gene lacZ as an indicator for determining expression patterns. A fourth deletion was also attempted, in order to break the four kilobases between Xbal and Xhol upstream of bli-4 into approximately 1 kb sub-units. The procedure used was identical for all deletions; however, in attempting to create a deletion between BlpI and Xbal, a number of difficulties were encountered. The initial step required double restriction enzyme digestion of the parent plasmid (pCeh320) with BlpI and Xbal in compatible buffer. The sticky ends were filled in and the DNA size-separated by gel-electrophoresis. The appropriately sized linear fragment was re-circularized by ligation of the blunt ends and used to transform competent DH5a bacterial cells. Transformant colonies were treated as described in Materials and Methods to purify the plasmid DNA. Purified DNA was tested by restriction enzyme digestion to ensure that the correct plasmid had been maintained. The same DNA was subsequently used for micro-injection as described in Materials and Methods. Each transgenic line created was tested by PCR for confirmation of the presence of the extrachromosomal array; however, none of the transgenic lines produced the expected product by PCR analysis. A second micro-injection procedure was performed, but again none of the lines were positive for the presence of the digested plasmid. The stock DNA used for micro-injection was tested by restriction digest to confirm its identity. Unfortunately, the results indicated that the DNA used for injection was not the same as had been confirmed previously; consequently, this deletion was not pursued for further analysis in this thesis. It is possible that the gel fragment purified from agarose 90 following restriction digestion also contained un-cut parent plasmid (pCeh320), which was selectively maintained during bacterial transformation. Alternatively, contamination of the DNA (at restriction digestion, gel purification, transformation) may have occurred such that the desired plasmid was not purified and maintained for use in micro-injection. 91 APPENDIX II Chi-squared statistical analysis of heat shock rescue results: H o = no rescue (expected frequency of blistering is the same as that for non-heat shock worms within the same strain) df = 4 in all cases Construct oa eb d c d2 X1 pCeh295 (KEX2) 8.9 72.4 , -63.5 4032.25 55.7 pCeh296 (hfur) 16.3 91.4 -75.1 5640.01 61.7 pCeh297 (bli-4 A) 43.0 72.7 -29.7 882.09 12.1 pPD49.78 34.6 41.7 -7.1 50.41 1.2 CB937 79.3 74.1 5.2 27.04 0.4 aObserved bExpected cDeviation The value of %2 for pCeh295 is sufficiently high (pO.Ol) that the null hypothesis may be rejected; in other words, KEX2 does rescue blistering. The value of %2 for pCeh296 is also sufficiently high (pO.Ol) that the null hypothesis may be rejected; as above, hfur is capable of rescuing the blistered phenotype. The value of %2 for pCeh297 gives a probability of approximately 0.01. This may be accepted as rejection of the null hypothesis, but higher numbers of worms may be necessary for conformation that the cDNA encoding Blisterase A does rescue the blistered phenotype. The value of %2 for both the negative control construct (pPD49.78) and the non-transgenic strain CB937 give p values greater than 0.99 and 0.8, respectively; thus, the null hypothesis must be accepted. There is no rescue of blistering in either strain. 92 APPENDIX III BLAST analysis of the 5' region upstream of bli-4 Sequences producing High-scoring Segment Pairs: High Score gb|M55332|DDIDISIG D.discoideum discoidin I gamma gene 162 dbj|D50338|DDIRIPR Slime mold DNA for ribosomal protein. 129 gb|U40411 |CELB0403 Caenorhabditis elegans cosmid B0403 167 emb|X00325|DDGAMMAl Dictyostelium discoidum discoidin I-162 emb|X85120|ASPDXD3H Artificial sequences cloning vector 162 emb|X851211ASPDXD3C Artificial sequences cloning vector 162 gb|U56960|CELF25H10 Caenorhabditis elegans cosmid F25H10. 157 emb|X74778|HSREPC4 H.sapiens simple repeat region (clon... 154 gb|L230771RATZFP15A Rattus rattus zinc finger protein, c... 126 emb|X13203|GHLEA29 Cotton set 5A Lea gene for seed prot... 154 gb|U38750|ESU38750 Ectocarpus siliculosus ribulose bisp... 151 emb|Z49908|CEC07E3 Caenorhabditis elegans cosmid C07E3 131 emb|X04775|DDCPRO2U Dictyostelium discoideum DNA up 151 gb|L04272|MSQNCATR Anopheles quadrimaculatus NADH de 132 gb|U01010|U01010 Herpetomonas megaseliae kinetoplast... 131 gb|U41029|CELF47G3 Caenorhabditis elegans cosmid F47G3. 128 gb|U02970|PWU02970 Prototheca wickerhamii 263-11 comple.. 126 gb|U60168|DDU60168 Dictyostelium discoideum proteasome ... 145 gb|L39752|DR029DC3Z Drosophila melanogaster (subclone D2 145 gb|J01283|DDIDISIB Slime mold (D.discoideum) discoidin-... 144 gb|U64603|CELC09B7 Caenorhabditis elegans cosmid C09B7. 130 gb|J01284|DDIDISICl Slime mold (D.discoideum) discoidin-... 144 emb|Z11874|CHEGZ Euglena gracilis Z Chloroplast DNA 122 gb|L36887|YSCMTCG03 Saccharomyces cerevisiae mitochond 133 emb|X52177|PFCRPOBC Plasmodium falciparum circular DNA 116 gb|U67599|MJU67599 Methanococcus jannaschii from bases ... 118 gb|U42846|CELT19D2 Caenorhabditis elegans cosmid Tl 9D2. 143 gb|U30821|CPU30821 Cyanophora paradoxa cyanelle, comple... 118 gb|L36899|YSCMTCG15 Saccharomyces cerevisiae mitochondri. 142 emb|Z70204|CECl 1G6 Caenorhabditis elegans cosmid Cl 1G6 118 emb|X85791|RNLTPKG R.norvegicus erythroid-specific enha... 141 gb|L48488|BORRPOB Borrelia burgdorferi RNA polymerase ... 141 gb|U43281|SCU43281 Saccharomyces cerevisiae chromosome .. 141 Smallest Sum Probability P(N) N 0.0045 2 0.0055 2 0.0093 1 0.022 0.024 0.024 0.061 0.084 0.10 0.10 0.16 0.17 0.17 0.19 0.23 0.34 0.45 0.46 0.46 0.49 0.51 0.51 0.51 0.57 0.59 0.59 0.60 0.66 0.67 0.69 0.73 0.74 0.74 emb|Z77135|CET16A9 Caenorhabditis elegans cosmid T16A9 130 0.75 2 gb|U55376|CELF16Hl 1 Caenorhabditis elegans cosmid F16H11. 116 0.76 4 dbj|D31785|HASMT Hansenula wingei mitochondrial DNA,... 130 0.77 2 emb|Z79605|CEZK678 Caenorhabditis elegans cosmid ZK678 131 0.78 2 emb Z70206|CEC49F8 Caenorhabditis elegans cosmid C49F8 152 0.78 3 gb|L34637|HUMPECAM07 Homo sapiens platelet/endothelial ce. 140 0.80 1 gb|M35027|VACCG Vaccinia virus, complete genome. 124 0.84 3 gb|U61957|CELAC7 Caenorhabditis elegans cosmid AC7 126 0.86 2 gb|U23182|CELF40B5 Caenorhabditis elegans cosmid F40B5 128 0.86 3 emb|Z71517|SCYNL241C S.cerevisiae chromosome XIV reading 138 0.90 1 lcl|EPD30010 (+) Sp snRNA U2 early; range -499 to 100. 100 0.90 1 emb|X57336|SCMET19 S. cerevisiae MET 19 gene for glucose... 138 0.91 1 gb|M34709|YSCG6PD S.cerevisiae glucose-6-phosphate deh... 138 0.91 1 emb|Z71518|SCYNL242W S.cerevisiae chromosome XIV reading 138 0.91 1 emb|Z69381|SCCXIV39K S.cerevisiae 38,855 bp segment of ch.. 138 0.91 1 gb|U46668|CELF38E9 Caenorhabditis elegans cosmid F38E9. 110 0.93 3 emb|Z68134|CET27A8 Caenorhabditis elegans cosmid T27A8 118 0.94 3 emb|X75544|XPFRNAPOL P.falciparum gene for beta subunit R.. 116 0.94 3 gb|U34610|MMCOL18A05 Mus museums alpha-1 (XVIII) collage 137 0.94 1 gb|U39690| Mycoplasma genitalium asnS, cfxEc, d... 137 0.95 1 emb|Z66499|CET01B7 Caenorhabditis elegans cosmid T01B7 137 0.95 1 gb|U41749|CELF09E 10 Caenorhabditis elegans cosmid F09E10. 150 0.95 2 gb|U31631 |DDU31631 Dictyostelium discoideum class II ap... 122 0.95 2 gb|U40414|CELF53B3 Caenorhabditis elegans cosmid F53B3. 121 0.95 4 emb|Z68160|CED1046 Caenorhabditis elegans cosmid D1046 117 0.95 4 emb|X70810|CLEGCGA E.gracilis chloroplast complete genome 111 0.96 5 lcl|EPD25078 (-) Bm chorion p. B.L4; range -499 to 100. 95 0.997 1 gb|M55298|DDIDDP2 Dictyostelium discoideum plasmid Ddp.. 136 0.97 1 emb|X51478|DDP2PLAS Dictyostelium discoideum Ddp2 plasmi 136 0.97 1 emb|A21622|A21622 Dictoselium plasmid Ddp2 REp gene 136 0.97 1 gb|U40958|CELF09F9 Caenorhabditis elegans cosmid F09F9. 136 0.97 1 gb|U41746|CELTl 8H9 Caenorhabditis elegans cosmid T18H9. 136 0.97 1 gbU20710|ONU20710 Ophraella notulata isolate 126 16S r... 135 0.97 1 gb|U258151SCU25815 ' Spiroplasma citri RNA polymerase bet... 116 0.98 gb|U01011 |U01011 Herpetomonas muscarum muscarum kinet... 135 0.98 1 emb|Xl 5917|MIPAGEN Paramecium aurelia mitochondrial com. 135 0.99 1 emb|X61660|PFLSRRN Plasmodium falciparum gene for a lar... 105 0.99 3 gb|U43145|PCU43145 Plasmodium chabaudi repeat organella... 138 0.990 3 gb|U00691|U00691 Dictyostelium discoideum plasmid Ddp... 126 0.991 3 gb|M28500|EUPMIC3 Euplotes crassus Gl micronuclear seq... 114 0.991 2 emb|X95275|PFCOMPIRA P.falciparum complete gene map of pi. 105 0.992 4 embZ72514|CET10B10 Caenorhabditis elegans cosmid T10B10 140 0.993 2 emb|X06424|MISCTRLP Yeast mit DNA for promoter upstream 133 0.996 1 94 gb|U40410|CELC54G7 Caenorhabditis elegans cosmid C54G7. 131 0.997 4 gb|K00539|YSCMTTGO3 Yeast (S.cerevisiae) mitochondrial c... 133 0.997 1 emb|Z74038|CEF58B4 Caenorhabditis elegans cosmid F58B4 121 0.997 3 emb|Z50176|CEC09Gl Caenorhabditis elegans cosmid C09G1 130 0.997 4 gb|U31083|PFU31083 Plasmodium falciparum erythrocyte me... 115 0.997 4 emb|V00693|MISC12 cap-oxil genes of yeast mitochondrion. 133 0.998 1 gb|L15359|YSJATPTRN Yarrowia lipolytica mitochondrial AT... 133 0.998 1 gb|M29112|DDIACTD D.discoideum actin A-3-sub-l gene, 5... 107 0.998 2 emb|Z47070|CET09B9 Caenorhabditis elegans cosmid T09B9 133 0.998 1 emb|Z19055|BATRYOPEAB.aphidicola tryptophan operon 115 0.998 2 gb|U67549|MJU67549 Methanococcus jannaschii from bases ... 116 0.9992 3 emb|Z69883|CEC27C12 Caenorhabditis elegans cosmid C27C12 118 0.9995 2 gb|J02451|PFDCG Bacteriophage fd, strain 478, comple... 132 0.9995 1 emb|V00602|INFDXX Genome of the bacteriophage fd (Inov... 132 0.9995 1 gb|U64834|CELF54Dll Caenorhabditis elegans cosmid F54D11. 112 0.9996 3 emb|Z77136|CEZC376 Caenorhabditis elegans cosmid ZC376 120 0.9996 5 emb|Z33164|MC228 M.capricolum DNA for CONTIG MC228 131 0.9996 1 gb|U09184|BAU09184 Buchnera aphidicola anthranilate syn... 114 0.9996 2 gb|U32857|SCU32857 Saccharomyces cerevisiae VAR1 gene,... 131 0.9999 1 gb|M88321|COTLEA14A Gossypium hirsutum group 4 late embr 131 0.9999 1 emb|Z71180|CEF22E12 Caenorhabditis elegans cosmid F22E12 131 0.9999 1 gb|M55332|DDIDISIG D.discoideum discoidin I gamma gene,... 162 0.0029 2 dbj|D50338|DDIRIPR Slime mold DNA for ribosomal protein. 129 0.0035 2 gb|U40411|CELB0403 Caenorhabditis elegans cosmid B0403 167 0.0074 1 emb|X003251DDGAMMA1 Dictyostelium discoidum discoidin I-162 0.018 1 emb|X85120|ASPDXD3H Artificial sequences cloning vector... 162 0.019 1 emb|X85121 |ASPDXD3C Artificial sequences cloning vector... 162 0.019 1 gb|U56960|CELF25H10 Caenorhabditis elegans cosmid F25H10. 157 0.049 1 gb|L23077|RATZFP15A Rattus rattus zinc finger protein, c... 126 0.056 3 emb|X74778|HSREPC4 H.sapiens simple repeat region (clon... 154 0.067 1 emb|Z49908|CEC07E3 Caenorhabditis elegans cosmid C07E3 131 0.11 2 gb|U38750|ESU38750 Ectocarpus siliculosus ribulose bisp... 151 0.13 1 gb|L04272|MSQNCATR Anopheles quadrimaculatus NADH de 133 0.13 2 gb|U01010|U01010 Herpetomonas megaseliae kinetoplast... 131 0.16 2 gb|U41029|CELF47G3 Caenorhabditis elegans cosmid F47G3. 128 0.20 3 gb|U02970|PWU02970 Prototheca wickerhamii 263-11 comple.. 126 0.27 3 gb|U64603|CELC09B7 Caenorhabditis elegans cosmid C09B7. 130 0.32 3 gb|U60168|DDU60168 Dictyostelium discoideum proteasome ... 145 0.38 1 gb|L39752|DR029DC3Z Drosophila melanogaster (subclone D2.. 145 0.39 1 emb|Z70204|CECHG6 Caenorhabditis elegans cosmid C11G6 118 0.41 4 gb|J01283|DDIDISIB Slime mold (D.discoideum) discoidin-... 144 0.42 1 gb|J01284|DDIDISICl Slime mold (D.discoideum) discoidin-... 144 0.43 1 gb|U55376|CELF16Hll Caenorhabditis elegans cosmid F16H11. 116 0.47 4 95 gb|U42846|CELT19D2 Caenorhabditis elegans cosmid T19D2. 143 0.52 1 emb|Z70206|CEC49F8 Caenorhabditis elegans cosmid C49F8 152 0.56 3 emb|Z77135|CET16A9 Caenorhabditis elegans cosmid T16A9 130 0.59 2 gb|L36899|YSCMTCG15 Saccharomyces cerevisiae mitochondri. 142 0.59 1 dbj|D31785|HASMT Hansenula wingei mitochondrial DNA,... 130 0.62 2 emb|Z79605|CEZK678 Caenorhabditis elegans cosmid ZK678 131 0.63 2 emb|X85791|RNLTPKG R.norvegicus erythroid-specific enha... 141 0.65 1 gb|L48488|BORRPOB Borrelia burgdorferi RNA polymerase ... 141 0.65 1 gb|U43281|SCU43281 Saccharomyces cerevisiae chromosome... 141 0.66 1 gb|U30821|CPU30821 Cyanophora paradoxa cyanelle, comple... 118 0.71 5 emb|X70810|CLEGCGA E.gracilis chloroplast complete genome 111 0.71 5 gb|U61957|CELAC7 Caenorhabditis elegans cosmid AC7 126 0.72 2 gb|L34637|HUMPECAM07 Homo sapiens platelet/endothelial ce.. 140 0.73 1 gb|U40414|CELF53B3 Caenorhabditis elegans cosmid F53B3. 121 0.75 4 gb|U46668|CELF38E9 Caenorhabditis elegans cosmid F38E9. 110 0.76 3 emb|Z68134|CET27A8 Caenorhabditis elegans cosmid T27A8 118 0.78 3 emb|X75544|XPFRNAPOL P.falciparum gene for beta subunit R... 116 0.78 3 emb|Z71517|SCYNL241C S.cerevisiae chromosome XIV reading 138 0.85 1 emb|X57336|SCMET19 S. cerevisiae MET 19 gene for glucose... 138 0.85 1 gb|M34709|YSCG6PD S.cerevisiae glucose-6-phosphate deh... 138 0.85 1 emb|Z71518|SCYNL242W S.cerevisiae chromosome XIV reading 138 0.85 1 emb|X52177|PFCRPOBC Plasmodium falciparum circular DNA r 116 0.85 3 emb|Z69381|SCCXIV39K S.cerevisiae 38,855 bp segment of ch... 138 0.85 1 gb|U41749|CELF09E10 Caenorhabditis elegans cosmid F09E10. 150 0.86 2 gb|U31631|DDU31631 Dictyostelium discoideum class II ap... 122 0.86 2 gb|U25815|SCU25815 Spiroplasma citri RNA polymerase bet... 116 0.87 3 gb|U34610|MMCOL18A05 Mus musculus alpha-1 (XVIII) colla 137 0.90 1 gb|U39690| Mycoplasma genitalium asnS, cfxEc, d... 137 0.90 1 emb|Z66499|CET01B7 Caenorhabditis elegans cosmid TO 1B7 137 0.90 1 emb|X61660|PFLSRRN Plasmodium falciparum gene for a lar... 105 0.91 3 gb|M35027|VACCG Vaccinia virus, complete genome. 124 0.91 2 gb|U43145|PCU43145 Plasmodium chabaudi repeat organella... 138 0.92 3 gb|U40410|CELC54G7 Caenorhabditis elegans cosmid C54G7. 131 0.93 4 emb|Z50176|CEC09Gl Caenorhabditis elegans cosmid C09G1 130 0.93 4 gb|M55298|DDIDDP2 Dictyostelium discoideum plasmid Ddp.. 136 0.94 emb|X51478|DDP2PLAS Dictyostelium discoideum Ddp2 plasm 136 0.94 emb|A21622|A21622 Dictoselium plasmid Ddp2 REp gene 136 0.94 gb|U41746|CELT18H9 Caenorhabditis elegans cosmid T18H9. 136 0.94 gb|U20710|ONU20710 Ophraella notulata isolate 126 16S r... 135 0.94 emb|Z77136|CEZC376 Caenorhabditis elegans cosmid ZC376 120 0.95 5 gb|M28500|EUPMIC3 Euplotes crassus Gl micronuclear seq... 114 0.95 2 emb|X95275|PFCOMPIRA P.falciparum complete gene map of pi 105 0.95 3 gb|U01011 |TJ01011 Herpetomonas muscarum muscarum kinet. 135 0.96 1 96 emb|Z74038|CEF58B4 Caenorhabditis elegans cosmid F58B4 121 0.96 3 emb|X15917|MIPAGEN Paramecium aurelia mitochondrial com 135 0.97 1 gb|U67549|MJU67549 Methanococcus jannaschii from bases ... 116 0.98 3 gb|M29112|DDIACTD D.discoideum actin A-3-sub-l gene, 5... 107 0.98 2 emb|Z19055|BATRYOPEAB.aphidicola tryptophan operon 115 0.98 2 emb|X06424|MISCTRLP Yeast mit DNA for promoter upstream 133 0.99 1 gb|K00539|YSCMTTGO3 Yeast (S.cerevisiae) mitochondrial c... 133 0.990 1 emb|V00693|MISC12 cap-oxil genes of yeast mitochondrion. 133 0.992 1 emb|Z69883|CEC27C12 Caenorhabditis elegans cosmid C27C12 118 0.993 2 gb|L36887|YSCMTCG03 Saccharomyces cerevisiae mitochondri.. 133 0.993 1 gb|Ll5359|YSJATPTRN Yarrowia lipolytica mitochondrial AT... 133 0.993 1 emb|Z47070|CET09B9 Caenorhabditis elegans cosmid T09B9 133 0.993 1 gb|J02451|PFDCG Bacteriophage fd, strain 478, comple... 132 0.998 1 emb|V00602|INFDXX Genome of the bacteriophage fd (Inov... 132 0.998 1 emb|Z33164|MC228 M.capricolum DNA for CONTIG MC228 131 0.998 1 emb|Z32679|CEC05B5 Caenorhabditis elegans cosmid C05B5 127 0.998 3 emb|X03991|HSGLUCG2 Human glucagon gene 129 0.999 2 gb|U67599|MJU67599 Methanococcus jannaschii from bases ... 118 0.9990 2 emb|Z68160|CED1046 Caenorhabditis elegans cosmid D1046 117 0.9990 3 gb|U32857|SCU32857 Saccharomyces cerevisiae VAR1 gene,... 131 0.9992 1 gb|U40413|CELC18B2 Caenorhabditis elegans cosmid C18B2. 120 0.9993 2 emb|Z72514|CET10B10 Caenorhabditis elegans cosmid Tl0B10 140 0.9993 3 gb|M88321|COTLEA14A Gossypium hirsutum group 4 late embr 131 0.9993 1 emb|X75545|PFTRNA P.falciparum gene for tRNA I,A,N,L,R... 105 0.9993 3 emb|Z71180|CEF22E12 Caenorhabditis elegans cosmid F22E12 131 0.9994 1 gb|U55374|CELT02C5 Caenorhabditis elegans cosmid T02C5. 116 0.9997 2 emb|Z70207|CEF15A2 Caenorhabditis elegans cosmid F15A2 136 0.9998 2 emb|X53420|AGGGLINE A.geoffroyi gamma-globin gene and Ll 130 0.9999 1 gb|L06178|AMFGENOM Apis mellifera mitochondrial genome. 115 0.9999 4 emb|Z54306|CEB0457 Caenorhabditis elegans cosmid B0457 130 0.9999 1 gb|U00054|CELK07E12 Caenorhabditis elegans cosmid K07E12 131 0.9999 3 emb|Z73978|CEZC302 Caenorhabditis elegans cosmid ZC302 129 0.9999 2 97 APPENDIX IV Sample output of TESS analysis of a 5' sub-region upstream of bli-4 pCeh288: 00001 CTACTCTCACAAGAGTATTTCTGTTCACTATTCTTTTTTTCTCTGAACTT .—>LVa (12.00 2.0000) < GR (16.00 2.0000) < PR (16.00 2.0000) < Hb (16.00 1.6000) <— Stell (15.00 1.5000) <-—GR (12.00 2.0000) 00051 CTGTGACTGAATGCACTCTCGGCACCAAATGAGAGAGATGCCTTACGAGG .—> GCN4 (12.00 2.0000) > NF-GMa (12.00 1.2000) 00101 GCGCGTACTTCCTTTTACCTACATGTATGTCTACCGAAACAAACAATATG > El A-F (14.00 2.0000) >Elk-l (13.00 1.3000) < — Tf-LFl (16.00 1.6000) > Stell (15.00 1.5000) >HNF-3 (12.00 1.7143) 00151 AGGCAAATTTTCATGGCTTTTGCTAATTTCACTTTCATAGTCCCTGTTAC >CCBF (14.00 1.1667) > Pit-i (14.00 2.0000) < HiNF-A (12.00 1.0000) < HNF-4 (14.00 1.1667) >PRDI-BF1 (16.00 1.6000) .—>IRF-1 (12.00 2.0000) .—>IRF-2 (12.00 2.0000) 00201 AAGCATATTATTTAGGTCAGGTGCTTGAAGTTTCAATTGATAATTTTGAG <_—PPAR (12.00 2.0000) > Rad-1 (14.00 2.0000) .—> c-Myb (12.00 2.0000) < HiNF-A (12.00 1.0000) <—- GATA-1 (12.00 2.0000) 98 00251 A A T T T G T A A A C T C G T C T A G T A A T T T A A A A C T C A T T C A G A T T C T G T A T A A T >MEF-2 (12.00 1.2000) <— Oct-1 (16.00 1.6000) < Qct-4 (16.00 1.6000) <- E4BP4 (13.00 1.3000) < NF-IL-2A (16.00 1.6000) < Oct-1 (16.00 1.6000) < Oct-2 (16.00 1.6000) 00301 GTAACACAAAATCGAAATTCAGGTAAAGCTCGATTATCCGGTCCCGACAA < Pit-i (14.00 2.0000) < N F -GMb (13.00 1.8571) < Hox-1.3 (14.00 1.4000) < GATA-1 (16.00 2.0000) 00351 GACAAATTTGTGTTAAATGCAAAAGAGTATGCGTCTTCAAAGAGTACTGT > Pit-1 (16.00 2.0000) <-—TFIID (12.00 2.0000) 00401 AGTTTCTACCTCTGCCGTTTTGATTGAGTTTCAATAGTTTTTCTCCCGAT .—>C-Myb (12.00 2.0000) >dl (12.00 1.2000) 00451 TCCTAAAAATTGCATGTGTTTATTTTAGTTTTTCAGTAGAGATTAAATTC < MEF-2 (12.00 1.2000) >SEF4 (12.00 1.7143) < Pit-1 (16.00 1.6000) -—>USF (12.00 2.0000) <-—muEBP-C2 (12.00 2.0000) < HiNF-A (12.00 1.0000) > PiM (14.00 2.0000) 00501 GTTTTCCATCGAAAACTCCGTATCAAAGATCAATGAAGTTTCCGCAGCTA 00551 CGAGGAGTTCGAGGTTACAGTACTCTTTAAAGGCGCACACCCATTCACAT > MEF-2 (12.00 1.2000) 00601 TTAACAGAACATTTTCGTTTCGAGACCGGCTACCGTATATATGGGGCAAA >AR (12.00 2.0000) >PR (12.00 2.0000) < QR (14.00 2.0000) < c-Ets-1 (16.00 1.6000) 99 >DTF-1 (20.00 1.6667) — . . . >E2BP (14.00 1.7500) 00651 ATGTTGCATTTTAACGCTCCTCATCGTCAATTTTCCCTGTCTAATTTATT >Oct-l (16.00 1.6000) >Oct-4 (16.00 1.6000) <-—ICP4 (12.00 2.0000) .—> QCN4 (12.00 2.0000) >MEF-2 (13.00 1.3000) 00701 TAGAGTGCTTTTAAAGTTAACTTTGAAAATATTATTAGAGAGTGACTGTG > HiNF-A (12.00 1.0000) -—> TFIID (12.00 2.0000) .—> QCN4 (12.00 2.0000) <-— GR (12.00 2.0000) 00751 ATGGGCAAACAGTCTAACGGAACAATCTTTCATTCCTCGACAATTGCTGA >HNF-3 (12.00 1.7143) < SAPl (14.00 2.0000) > NF-GMa (16.00 1.6000) < MCBF (14.00 2.0000) < NF-E2 (15.00 1.3636) 00801 GTCTCGCCACGAACAAGTCAGAAGACATAGCATATTCTTGAGAAAAGCCT > F-ACT1 (12.00 2.0000) < GCN4 (12.00 2.0000) -—> GR (12.00 2.0000) < su(Hw) (14.00 1.1667) 00851 TCAGTCCGATTTCACTTTCCATTGTTCCTTCCTCTCACACGCCTTCAGCA <_— H4TF-1 (12.00 2.0000) .—>IRF-1 (12.00 2.0000) -—>IRF-2 (12.00 2.0000) <_—NF-1 (12.00 2.0000) > GATA-1 (20.00 1.6667) <_—GR (12.00 2.0000) 00901 TCTTCTTCTTCTCGCCACAAGCTTCTCACTTTCCAATCGAATAAATAAAT <_— GR (12.00 2.0000) _____> F-ACT1 (12.00 2.0000) -—>IRF-1 (12.00 2.0000) .—> IRF_2 (12.00 2.0000) <_—NF-1 (12.00 2.0000) 100 -—> CCAAT-binding factor (12.00 2.0000) -—>CP1 (12.00 2.0000) -—> CTF (12.00 2.0000) < Hb (18.00 1.6364) > HiNF-A (12.00 1.0000) >TFIID (16.00 2.0000) < ETF (14.00 2.0000) < GC1 (16.00 1.6000) < Ph-i (16.00 1.6000) 00951 CGTGTTTGACCCATAGCGTGAAAATCCCATGAAATAACCTTTCGTTTTCT > c-Fos (14.00 2.0000) >c-Jun (14.00 2.0000) > ER (14.00 2.0000) > AhR (12.00 1.0000) > NF-kappaB(-like) (18.00 1.6364) ----->PTFl-beta (12.00 2.0000) 01001 AACTTTTTTATTTGAACTTTGTTTTAATTGTTCCTAGTTTCTACATATTG < HiNF-A (12.00 1.0000) >Hb (18.00 1.6364) >TBP (14.00 2.0000) .—> TFIID (12.00 2.0000) <-— GR (12.00 2.0000) >dl (12.00 1.2000) 01051 TATTTCTCGAG NNPP analyses of the 5' region upstream of bli-4 pCeh288: Start End Score Promoter Sequence 566 616 0.98 TACAGTACTCTTTAAAGGCGCACACCCATTCACATTTAACAGAACATTTT 626 676 0.98 CCGGCTACCGTATATATGGGGCAAAATGTTGCATTTTAACGCTCCTCATC 932 982 0.90 TCCAATCGAATAAATAAATCGTGTTTGACCCATAGCGTGAAAATCCCATG pCeh289: 101 Start End Score Promoter Sequence 1993 2043 0.84 TTCGACTGCGTATACTAGCCGCAATTTCTGGAAATCATACTTAGATTACT 2195 2245 0.87 TGAGATATAAATCTCAAAAATTCCTTCTTTCCCCCTAATCAATTGTGAAT 2275 2325 0.97 GTGATCTGTGTATAACTGGTGGCCAATATCAGTTTCTGGTGATCAATGTT 2405 2455 0.91 GGAAAACCTATATAAAATGTGTTAATAAACTGGTGTTTTTTATTTCTATG 2823 2873 0.97 TATTTAATCTATTAAAAATTCAGCGAGCGAGGTAAAGATTAGTCATGGTA 2872 2922 0.85 ATTTCCCCCATTTAAATCTCGACGCAATCTGTTTCTTTCTCTTTACTCTT pCeh291: Start End Score Promoter Sequence 1993 2043 0.84 TTCGACTGCGTATACTAGCCGCAATTTCTGGAAATCATACTTAGATTACT 2195 2245 0.87 TGAGATATAAATCTCAAAAATTCCTTCTTTCCCCCTAATCAATTGTGAAT 2275 2325 0.97 GTGATCTGTGTATAACTGGTGGCCAATATCAGTTTCTGGTGATCAATGTT 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099159/manifest

Comment

Related Items