Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Expression, purification and properties of papaya mosaic virus capsid protein in Escherichia coli Rampersaud, Anand 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-0105.pdf [ 5.23MB ]
Metadata
JSON: 831-1.0099138.json
JSON-LD: 831-1.0099138-ld.json
RDF/XML (Pretty): 831-1.0099138-rdf.xml
RDF/JSON: 831-1.0099138-rdf.json
Turtle: 831-1.0099138-turtle.txt
N-Triples: 831-1.0099138-rdf-ntriples.txt
Original Record: 831-1.0099138-source.json
Full Text
831-1.0099138-fulltext.txt
Citation
831-1.0099138.ris

Full Text

Expression, P u r i f i c a t i o n and Properties of Papaya Mosaic Virus Capsid Protein i n Escherichia coli. by Anand Rampersaud Hon. B.Sc, The University of Western Ontario, 1993. A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science i n THE FACULTY OF MEDICINE Department of Biochemistry and Molecular Biology We accepted t h i s thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA January, 1997 © Anand Rampersaud, 1997 I n p r e s e n t i n g t h i s ' ' t h e s i s i n p a r t i a l f u l f i l m e n t o f t h e r e q u i r e m e n t s f o r a n a d v a n c e d d e g r e e a t t h e U n i v e r s i t y o f B r i t i s h C o l u m b i a , I a g r e e t h a t t h e L i b r a r y s h a l l m a k e i t f r e e l y a v a i l a b l e f o r r e f e r e n c e a n d s t u d y . I f u r t h e r a g r e e t h a t p e r m i s s i o n f o r e x t e n s i v e c o p y i n g o f t h i s t h e s i s f o r s c h o l a r l y p u r p o s e s m a y b e g r a n t e d b y t h e h e a d o f m y d e p a r t m e n t o r b y h i s o r h e r r e p r e s e n t a t i v e s . It is u n d e r s t o o d t h a t c o p y i n g o r p u b l i c a t i o n o f t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l n o t b e a l l o w e d w i t h o u t m y w r i t t e n p e r m i s s i o n . D e p a r t m e n t o f % ><3cWx^y&V-H^ CK^> H o l e . C ^ C K F O \o c j ^ T h e U n i v e r s i t y o f B r i t i s h C o l u m b i a V a n c o u v e r , C a n a d a D a t e 3>i D E - 6 ( 2 / 8 8 ) A b s t r a c t Potexviruses are composed of a single species of capsid (coat) protein (CP) which encapsidates a single positive-sense genomic RNA (gRNA) and is also implicated in cell-to cel l movement. Several potexviruses have been reconstituted from their individual purified components and, of these, papaya mosaic virus (PMV) has been most extensively characterized. Capsid protein mutants that affect encapsidation and/or movement usually cannot, however, be efficiently recovered from plants. Accordingly, an alternative system was designed to permit the generation of a broad range of mutant CPs for the systematic investigation of the role of potexviral CP in assembly which would otherwise be impossible i n planta. To test the general feasibility of this approach, I have overexpressed PMV CP and CYMV CP in E. coli. The PMV CP has been purified to approximately 90 % purity using only four steps: centrifugation at 30,000 x g, ammonium sulphate precipitation to 40 % saturation, anion exchange chromatography and gel f i l tration chromatography. Recombinant CP was assayed for its in vitro reconstitutive ability with genomic PMV RNA via electron microscopy and local lesion host infectivity. Reconstitution was demonstrated, but i t was suboptimal as evidenced by the formation of partial rods and the inability of reconstituted viral particles exposed to Tl RNase to infect a local lesion host. i i Table of Contents Page Abstract i i Acknowledgements Xt Table of Contents f\f List of Figures \)(\ List of Tables * y|" . List of Abbreviations \J[\ j Chapter 1 - Introduction 1 1.1 Overview 1 1.2 Positive-sense ssRNA Plant Viruses 2 1. Classification 2 2. Particle Structure 2 3 . Genome Structure 2 4. Common Functions of Plant Virus Proteins.. 8 5. Replication 10 1.3 Tobacco Mosaic Virus 12 1. TMV Structure . 13 2. Self Association of TMV Capsid Protein. . . . 13 3. Capsid Protein Structure Within the Double Disk 14 4. TMV Capsid Protein Interactions Within the Double Disk 17 5. Differences Between the Double Disk and the Virus Structures 19 6. Interactions Between the Capsid Protein and the RNA Within the Virus 19 7. Assembly: Initiation 20 8. Assembly: Elongation 21 1.4 Potexviruses 24 1. General Characteristics of Potexviruses... 24 2. Transmission 26 3. Cytopathology 26 4. Genome Structure and Organization 27 5. Replication and Translation of Potexviruses 33 ifl 6. Encapsidation 34 7. Goals of the Research 40 Chapter 2 - Materials and Methods 42 2.1 Enzymes and Chemicals 42 2.2 Strains and Plasmids 42 2.3 Recombinant DNA Techniques 42 1. Media and Growth Conditions 44 2. Purification of Plasmid DNA from E. coli.. 44 3. Restriction Enzyme Digestions 44 4. Electrophoretic Separation of D N A . . . . . . . . . 44 5. Polymerase Chain Reaction (PCR) 45 6. Ligations 46 7. Transformations 47 8. DNA Sequencing 47 2.4 Capsid Protein Overexpression and Purification 48 1. SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) 48 2. Protein Concentrations 49 3. Western Blot Analysis 49 4. Acetic Acid Extraction 50 5. Overexpression and Preliminary Fraction-ation of Extracts 50 6. Anion Exchange Chromatography 52 7. Size Exclusion Chromatography 52 2.5 Viral Reconstitution 52 1. Assembly Reactions 53 2. Electron Microscopy 53 3. Inoculation of Plants 53 Chapter 3 - Results 55 3.1 Strategy 55 3.2 Subclone Construction.... 55 3.3 Overexpression 58 3.4 Western Blot Analysis 63 3 .5 Sequencing. . 63 3.6 Recombinant PMV CP Purification 68 3.7 Native PMV CP Purification 76 3.8 RNase Assays 80 N 3.9 Viral Reconstitution 80 3.10 Infectivity Assays 83 Chapter 4 - Discussion 84 4.1 Sequencing 84 4.2 Purification and Properties of PMV capsid protein.. 84 4.3 Reconstitution 86 4.4 Perspectives 88 References 89 List of Tables Table Description Page 1.1 Completely or partially sequenced potexviruses 25 2.1 Synthetic oligonucleotides used in this study 43 3.1 Differences between the PMV CP sequence obtained from pPMVCP and that obtained from pSQlDA3P3 67 3.2 Purification of PMV recombinant capsid protein 79 v/i List of Figures Figure Description Page 1.1 Classification of positive-sense ssRNA viruses into supergroups 3 1.2 Classification of plant virus groups based on morphology and genome strategy 5 1.3 Side view of a sector through the TMV double disk 15 1.4 Lateral interactions between subunits in one layer of the TMV double disk 15 1.5 Model predicting the mechanism of TMV assembly 22 1.6 Genome coding organization of potexviruses 28 1.7 Model showing the interaction between the f irst 40 nucleotides of PMV RNA and the PMV capsid protein double disk 37 3.1 Analysis of PCR amplification products 56 3.2 Schematic representation of CYMV and PMV ORF 5 expression plasmids pCYMVCP and pPMVCP 59 3.3 Analysis of PMV and CYMV CP expression 61 3.4 Identification of PMV CP expressed in E. coli by Western blot analysis 64 3.5 Sequencing strategy 66 3.6 Elution profile of PMV CP during anion exchange chromatography 70 3.7 Elution profile of PMV CP during size exclusion chromatography 72 3.8 Analysis of the PMV purificationof PMV CP from bacterial whole cel l extracts by 15 % SDS-PAGE 74 3.9 A comparison of the purity of PMV nCP and rCP 77 3.10 Electron microscopic assessment of the reconstitution of PMV 81 List of Abbreviations °c degree Celsius A angstrom Ala alanine Arg arginine Asn asparagine Asp aspartic acid ATP adenosine triphoshpate BaMV bamboo mosaic virus BMV brome mosaic virus BSA bovine serum albumin cDNA complementary DNA CMV cucumber mosaic virus CCMV cowpea chlorotic mosaic virus CP capsid protein CPMV cowpea mosaic virus C-terminus carboxy-terminus CsCl cesium chloride CTP cytidine triphosphate CVX cactus virus X CyMV cymbidium mosaic virus CYMV clover yellow mosaic virus dd dideoxy DEPC diethyl pyrocarbonate dNTP deoxyribonucleotide triphosphate DNA deoxyribonucleic acid D-RNA defective RNA ds double-stranded DTT dithiothreitol DVX daphne virus X E. coli E s c h e r i c h i a coli EDTA ethylenediaminetetraacetate FMV foxtail mosaic virus Glu glutamic acid GTP guanosine triphosphate HC helper component ICR internal control region IPTG isopropyl-/3-thiogalactopyranoside kb kilobase kDa kilodalton LB Luria-Bertani broth LIC laminated inclusion component LR left radial helix LS left slew helix LVX l i l y virus X /xCi microcurie /xg microgram Ml microliter /zm micrometer M molar mg milligram ml mi l l i l i t er mM millimolar mRNA . messenger RNA MW molecular weight nm nanometer NMV narcissus mosaic virus N-terminus amino-terminus NMR nuclear magnetic resonance nt nucleotide NTP nucleoside triphosphate OD optical density 0RF open reading frame PAGE polyacrylamide gel electrophoresis PaMV potato acuba mosaic virus P/C/I phenol/chloroform/isoamyl alcohol PCR polymerase chain reaction P1AMV plantago asiatica mosaic virus pmole picomole PMV papaya mosaic virus poly(A) polyadenylate Pro proline PVX potato virus X PVY potato virus Y RdRP RNA-dependent RNA polymerase RF replicative form Rl replicative intermediate RNase ribonuclease SD Shine-Dalgarno SDS sodium dodecyl sulphate Ser serine sgRNA subgenomic messenger RNA SMYEAV strawberry mild yellow edge-associated virus S S single-stranded TBE tris-borate-EDTA Thr threonine TMV tobacco mosaic virus TBSV tomato bushy stunt virus Tris tri(hydroxymethyl)aminomethane TTP ' thymidine triphosphate TVX ' tulip virus X UTP uridine triphosphate U.V. ultraviolet u unit V volume V volts v0 void volume Val valine VPg virus protein-genome linked w weight WC1MV white clover mosaic virus Acknowledgements T h i s w o r k c o u l d n o t h a v e b e e n a c c o m p l i s h e d w i t h o u t t h e h e l p a n d s u p p o r t o f n u m e r o u s p e o p l e t o whom I owe many t h a n k s . F i r s t a n d f o r e m o s t , I w o u l d l i k e t o t h a n k my S U P E R v i s o r G e o r g e M a c k i e . I t h a s t r u l y b e e n a l e a r n i n g e x p e r i e n c e G e o r g e ( f o r b o t h o f u s ) . T h a n k y o u f o r e v e r y t h i n g . N e x t I h a v e t o t h a n k Da " O n t a r i o " B o y z ( K e n n y G ( S t a r S t u d ) , X - m a n ( Y o u r s e c r e t i s s a f e w i t h me, X m a r k s t h e g r e a s y l i t t l e s p o t ) a n d G l e n " B i g C o u n t r y , t h e G i m p , M r . B l o n d " C o b u r n ( C o b e s ) ) a n d t h e r e s t o f M a c k i e s L a c k i e s p a s t a n d p r e s e n t ( S t e p h a ( t h e R o s e among t h e t h o r n s - w h a t c o l o u r w i l l y o u r h a i r be t o d a y ? ) , C o r m a c k , J u l i e G . ( a n d M o r g a n ) , T a n n i s , J e n n i f e r B . , Newman, A n d y W h i t e , L e s l e y , L y n d a , L a a r a , A l a n , N i t z , B a l , G u r j i t , L y n e t t e , Doug a n d , o f c o u r s e , M i c h e l e (who t a u g h t me a l m o s t e v e r y t h i n g I know i n t h e L a b ) ) . S p e c i a l t h a n k s t o my c o - s u p e r v i s o r J o h n B a n c r o f t a t W e s t e r n , my E . M . f r i e n d s E l a i n e a n d M i k e a t U . B . C a n d R o n a t W e s t e r n , a n d t h e B o y z a t 34 ( e s p e c i a l l y t h e "two a n d o u t c l u b " ( t h e S h o o t z , M r . M o r e a n d L i t t e r i c k ) ) . I w o u l d a l s o l i k e t o t h a n k t h e v a r i o u s c h a r a c t e r s b o t h w i t h i n a n d o u t s i d e o f t h e d e p a r t m e n t t h a t h a v e j o i n e d me o n my V a n c o u v e r " T r i p " . T h a n k y o u t o T r e v D o g , D r . U . , t h e C r o a t i o n S e n s a t i o n ( D o m e s t i c ) , W h i t e Z o m b i e , V a c L e v a c , G a s , M a r g e , T i m S i t , t h e r e s t o f t h e R o c h o n l a b , t h e DUTCHMAN ( y o u h a v e no c h a n c e l ! ! ! ) , t h e s o c c e r b o y z , N e e n a , R o h d e , Amy, C h r i s t i e , D e b , Mo J o R i s i n g , t h e M i g h t y T w i t c h , J . B . ( B r u n s t e i n ) , N i p p l e B o y , Gowdy ( D a n g e r B o y - n o l o n g e r ) , D u n c a n , t h e G o o d G r a d R e p , L e g g e t , A N D Y , Tom K i m , Swede B o y , B e n g t ( p l a t i n g a l l d a y ) , E i l i s h , S u z y , U n c l e B u d d y a n d my c o u s i n s D e r e k a n d C r a i g ) , B r e t t a t t h e P i t , M e l a n i e , J e n n i f e r C . , J o h n n y B a k o , t h e S e m p l e B o y z ( e s p e c i a l l y Y o u n g M r S e m p l e ) , a n d o f c o u r s e t h e K i k m e i s t e r ( G r a n d p a J u r g e n s o n ) . L a s t b u t , d e f i n i t e l y n o t l e a s t , I w o u l d l i k e t o t h a n k my mom a n d d a d a n d my b r o t h e r A l v i n f o r t h e i r l o v e , s u p p o r t a n d p a t i e n c e . I l o v e y o u g u y s . T h a n k y o u on e a n d a l l , A r m a n d o , M o o k i e , B l a c k D i a m o n d , R a m p e r , R o t o r s a u d , A n a n d o r w h a t e v e r y o u c a l l me. Chapter 1 1 Introduction 1. Overview Plant viruses comprise an important group of plant pathogens. To date over 1,000 plant viruses have been identified. Most of these have been placed in one of the over 40 genera recognized by the International Committee on Taxonomy of Viruses. Plant viruses usually obtain their names by combining the name of the host in which the disease they cause was f irst discovered and the symptoms produced in that host, e.g. Tobacco Mosaic Virus (TMV) (Shaw, 1996) . Crop plants throughout the world are subject to significant losses as a result of viral infections. In fact, plant viruses rank second only to fungi in terms of the damage they cause to commercial crops (Matthews, 1991). Viral infections can be particularly serious with long-lived plants because considerable time may be required for replacements to become productive (Shaw, 1996) . Plant viral genomes are highly efficient and often small. This makes plant viruses ideal candidates for the investigation of fundamental biological processes of the plant ce l l such as replication, transcription and translation (Mushegian and Shepherd, 1995) . Single-stranded (ss) and double-stranded (ds) DNA plant 2 viruses do exist, but more than 90 % of plant viruses have RNA genomes and most of these are positive-sense (coding) ssRNA viruses (see Figure 1) . By contrast the majority of vertebrate viruses have DNA genomes and most fungal viruses have dsRNA genomes (Zaitlin and Hull, 1987). The following sections concentrate on the study of positive-sense ssRNA plant viruses. 2. Positive-Sense ssRNA Plant Viruses 2.1 C l a s s i f i c a t i o n Positive-sense ssRNA viruses have been classified into supergroups, comprising both plant and animal viruses, based on their genomic organization and similarities among the amino acid sequences of their encoded proteins (see Figure 1.1) (Goldbach et a l . , 1991; Zaccomer et al.,1995). 2.2 P a r t i c l e Structure Positive-sense ssRNA viruses are helical (e.g. TMV) or icosahedral (e.g tomato bushy stunt virus (TBSV)) particles which are non-enveloped (see Figure 1.2). Usually, the capsid shell of the virus consists of a single type of CP subunit (e.g. potexviruses); however, in some cases there are two CPs (e.g. cowpea mosaic virus (CPMV)) (Shaw, 1996). 2.3 Genome structure The genomic RNAs of positive-sense ssRNA plant viruses can 3 Figure 1.1 Supergroup c l a s s i f i c a t i o n of positive-sense ssRNA viruses The four present supergroups are underlined. (Goldbach et a l . , 1991; Zaccomer et a l . , 1995). 4 Positive-sense ssRNA Viruses Picorna Sindbis Alpha Luteo (includes TMV and potexviruses) Carmo Sobemo 5 Figure 1.2 C l a s s i f i c a t i o n of plant virus groups based on morphology and genome strategy. Drawn approximately to scale; from Matthews (1991). 6 | ds - DNA~1 o CAUUMOVIRUS | ss - DNA | C O GEMlNfVIRUS o1 REOV1RI0AE ds - RNA o CRYPTOV1RUS | ss • RNA (•) | without envelopes rzzi TOBRAVIRUS T06AM0VIRUS • I 1 R R C M R U S rCRDEMRUS POTEXVTRUS CARLAVTRUS CAPIULOVIRUS POTYVFHJS CtOSTHFOvWS with envelopes | ss • RNA (-T~l | ss - RNA "±~| Or 1 1 1 1 ? i f i 1 1 1 1 1 1 1 r* RHABOOV1RJDAH Tomato Sponed Will Virus 0 Maize Chl orotic Dwarf Virus LurreovRus TYMOVIRUS TObeUSVTtUS SCeEMOVHJS NECROVRJS CARMOVHUS MARAF (VIRUS Parsnip Yellow Fleck Virus 0 0 CCMOVRJS FABAVIRtJS NEPOVFUS Pea Enation Mosaic Virus DWNTVOVWUS 0 0 0 CUCUMOVKUS BHOMOV1RUS LARVIRUS OOOo AltaHa Mosaic Virus 7 range from ~4 kb (e.g. carmoviruses) to over 10 kb in size (e.g. furoviruses). They may be monopartite, carrying their entire genome on a single molecule of nucleic acid (e.g. potexviruses), or multipartite, dividing their genome among multiple molecules (e.g. cucumber mosaic virus (CMV)) (see Figure 1.2). For multipartite viruses, in which the RNAs are packaged separately, a l l RNAs must enter the host for complete infection to occur (Zaitlin and Hull, 1987; Shaw, 1996). Characteristic structures are found at the 5'and 3 1-termini of many plant v iral ssRNA genomes. The RNA genomes of several plant viruses (e.g. potexviruses) exhibit a cap structure at their 5'-termini which is similar to that found at the 5'-termini of eucaryotic mRNAs. This structure consists of a 7-methylguanosine residue (m7Gppp) covalently linked by a 5'-5'triphosphate linkage to the f irst nucleotide of the gRNA. It plays a role in viral infectivity, stability and translational efficiency (Matthews, 1991). Several other plant viral genomic RNAs are covalently linked to a small protein known as a VPg (viral protein, genome-linked) at their 5'-termini. A l l VPg proteins are viral ly encoded. The 5'-VPg acts as a primer during replication of picorna-like viruses and has been shown to be essential for the infectivity of some viruses within this supergroup (e.g. nepoviruses) (Jaegle et a l . , 1987; Zaccomer et a l . , 1995). Polyadenylate sequences have been identified at the 3•-termini of several positive-sense ssRNA viruses including potexviruses, potyviruses and comoviruses. These sequences are required for the 8 stability and/or replication of some plant viral RNAs. Most plant viruses possessing a 3'-poly(A) sequence also contain an AAUAAA polyadenylation signal which precedes this sequence. It is believed that such viruses are polyadenylated enzymatically after positive-strand synthesis, most likely by a host ce l l poly(A) polymerase (Mushegian and Shepherd, 1995). Some plant viruses have a tRNA-like structure at their 3'-termini (e.g. tobamoviruses). Models of these structures suggest that they may feature a pseudoknot (Dumas et a l . , 1987; van Belkum et a l . , 1988). (Pseudoknots form in RNA when a single-stranded loop region forms Watson-Crick base pairs with a region of complementary sequence outside the loop.) These structures can accept specific amino acids. It is possible that these structures may act as a replicase recognition site or a means of stabilizing the 3'-termini. 2.4 Common Functions of Plant Virus Proteins Plant virus genomes code for several proteins. For most, i f not a l l , plant viruses these include one or more proteins required for replication, one or two CPs and one or more proteins involved in cel l -to-cel l movement (Zaitlin and Hull, 1987). Positive-sense ssRNA viruses show strong sequence conservation in domains of several non-structural proteins which are involved in replication of the genome. One of these domains contains the amino acid sequence Gly-Asp-Asp (GDD) (Kamer and Argos, 1984). The protein harbouring this motif has been shown to be a component of 9 the v iral RNA-dependent RNA polymerase (RdRp) complex. Accordingly, this motif is referred to as the "polymerase domain" (David et a l . , 1992). A second consensus sequence found in one of the non-structural proteins of plant RNA viruses is centred around the amino-acid sequence GxxGxGK(S/T) and is characteristic of NTP-binding proteins. Plant viral proteins containing this sequence are thought to possess a helicase activity (Gorbalenya et a l . , 1988, 1989). Interestingly, luteo-like viruses lack such a motif while several alpha-like viruses possess a second NTP-binding motif in a group of partially overlapping genes termed the "triple gene block". In some plant viruses the polymerase and helicase domains are located on the same polypeptide (e.g. potexviruses) while in others, the two domains are located on two separate polypeptides (e.g. comoviruses) (Zaccomer et a l . , 1995). A methyltransferase motif, DxxR, is located on the same polypeptide that harbours the helicase domain of the RdRp complex in alpha-like viruses. Viral proteins containing this motif may be involved in the capping of viral RNAs (Rozanov et a l . , 1992). Capsid proteins are required in high levels during plant v iral infection and are often encoded by a subgenomic RNA (sgRNA) of high translational potential. They are usually classified based on the shape adopted by their virus (icosahedral, rod-shaped or filamentous). Rod-shaped and filamentous CPs can also be classified based on primary structure. Sequence comparisons have revealed that rod-shaped and filamentous CPs belong to two separate and distinct groups; however, these two groups are believed to form 10 analogous salt bridges (Dolja et a l . , 1991). Most, i f not a l l , plant viruses are believed to encode one or more proteins required for cel l-to-cel l movement within their hosts. Plant viruses move from one cel l to another via intercellular cytoplasmic connections called plasmodesmata. Two different mechanisms proposed for such movement involve virus-induced modifications of the plasmodesmata. In the f irst mechanism, illustrated by TMV, the virus encodes a movement protein which acts as a molecular chaperone. Molecules of the movement protein bind to the RNA and facilitate its movement by increasing the size exclusion limit of the plasmodesmata. In the second mechanism, illustrated by CPMV, the virus moves as an intact virion through tubular structures that assemble in the cytoplasm and extend through the plasmodesmata. The f irst mechanism does not require CP, but the second does (Deom et a l . , 1992). Other proteins encoded by plant viruses may include VPgs (see section 2.2.3); helper component (HC), a protein required for vector transmission; and/or proteinases, which are required by RNA viruses that encode polyproteins as a gene expression strategy (Matthews, 1991). 2.5 Replication After viral particles enter a host ce l l , they must be uncoated to release their nucleic acid before they can be replicated. Some positive-sense ssRNA viruses, including TMV and potexviruses are uncoated by cytoplasmic ribosomes, from 51 to 3', during 11 translation (Wilson, 1985; Wilson et a l . , 1987). Direct evidence for cotranslational disassembly comes from the observation of striposomes, structures comprising partially uncoated viral particles associated with ribosomes, in vivo. Some icosahedral plant viruses have been shown to swell under physiological conditions, relaxing protein-protein interactions in the capsid and allowing translation to occur (Brisco et a l . , 1986). Translation, resulting in the expression of the RdRp, is essential for subsequent viral replication. The replication of positive-sense ssRNA plant viruses has been reviewed (Palukaitis and Zaitl in, 1986; David et a l . , 1992). The process begins with the binding of the viral replicase complex to the 3'-end of the gRNA. This is followed by synthesis of complementary negative-sense RNA on the genomic template, and subsequently the synthesis of positive-sense RNA progeny on the negative-sense templates. Structures termed replicative intermediates (RIs) are observed during the course of RNA replication. These structures are branched chains composed of fu l l length negative-sense RNA to which are bound partially synthesized positive-sense RNA strands that are being elongated. Replicative forms (RFs) are a second type of structure observed during replication. RFs are composed of fu l l length double-stranded RNA molecules which may be artifacts formed during RNA extraction due to deproteinization of protein RNA replication complexes (Garnier et a l . , 1980). 3'-terminal tRNA-like structures have been shown to be !2 necessary for negative strand synthesis in several plant viruses (e.g. brome mosaic virus (BMV)). These structures do not require aminoacylation for this process. Other cis-acting elements that may be required for plant viral replication include VPgs, poly(A) tracts, 31-pseudoknots and internal control region (ICR)-like sequences (similar to the eukaryotic RNA polymerase III ICR 2) (Zaccomer et a l . , 1995). Several positive-sense ssRNA viruses uti l ize sgRNAs to express their distal ORFs. These sgRNAs are synthesized when the viral polymerase recognizes internal "promoter" sequences within the negative-sense RNA (Miller et a l . , 1985; French and Alquist, 1988). In addition to its role in the expression of distal ORFs, sgRNA synthesis plays a role in the temporal and quantitative pattern of protein expression. TMV expresses two of its proteins via sgRNAs. The longer sgRNA, which is required for the expression of the 3 0 kDa movement protein, is synthesized in small amounts early in infection whereas synthesis of the shorter CP sgRNA increases linearly, reaching high levels late in infection. Primary and secondary structure within both gRNA and sgRNA promoters may be involved in such differences in sgRNA synthesis (Leheto and Dawson, 1990) . 3 . Tobacco Mosaic Virus Tobacco mosaic virus (TMV) is the type member of the tobamovirus genus. TMV was the f irst virus to be discovered and the f irst to be isolated. It has since become one of the most 13 well-characterized viruses in terms of structure and assembly (Voet and Voet, 1995) and wil l be discussed here in some depth in view of its relevance for understanding capsid assembly in other viruses such as the potexviruses. 3.1 TMV Structure TMV is a rod-shaped virus that is approximately 3 00 nm in length and 18 nm in diameter, with a central cavity that measures 4 nm in diameter (Namba and Stubbs, 1986). It has approximately 214 0 identical copies of capsid protein subunits that are arranged in a hollow right-handed helix of pitch 23 A with 16 1/3 subunits/turn. The single-stranded RNA, which is approximately 6400 nt in length, is intercalated within the turns of the protein helix such that 3 nucleotides are bound to each protein subunit (Butler, 1984). 3.2 Self Association of TMV Capsid Protein The TMV CP monomer can aggregate in solution. Aggregation is entropy-driven, with polymerization being favoured by increasing temperature and accompanied by the release of bound water and ions. Ionic strength and pH also affect the degree of aggregation and, more importantly, influence the type of polymer formed (Durham et a l . , 1971). At low ionic strengths and high pH values, the capsid protein exists as a mixture of monomer and small aggregates which are collectively known as "A-protein". At approximate neutrality and at high ionic strengths, the subunits associate to form a 14 double layered disk of 17 subunits/layer that sediments at approximately 2OS. At neutral pH and low ionic strength, the subunits form short helices of slightly more than two turns (with 16 1\3 or 17 1\3 subunits\layer). These aggregates are called "protohelices" or "lockwashers". If the pH of these protohelices is shifted to approximately 5, they form "nicked" (imperfectly stacked) helices that eventually anneal to form indefinitely long helical rods that, although they lack RNA, resemble intact virions (Durham et al., 1971; Hirth and Richards, 1981; Voet and Voet, 1995) . 3.3 Capsid Protein Structure Within the Double Disk The structure of the capsid protein within the double disk has been resolved to a resolution of 2.8 A (see Figure 1.3) (Bloomer et al., 1978). The capsid protein is folded into a single domain within which the folding of the amino and carboxyl halves of the polypeptide chain is quite similar. Between radii of 40 and 70 A (i.e, on the inner face of the capsid) , the subunit consists of four a-helices which are held together at their outer ends by a small five-stranded 6-sheet. The four a-helices are referred to as the left and right slewed helices (LS and RS) and the left and right radial helices (LR and RR) (see Figure 1.3 and Figure 1.4, extreme left subunit). Outside the 70 A radius the polypeptide is less regular and both the amino and carboxy termini are found at the outside of the subunit, on the surface of the aggregate (Champness et al., 1976; Bloomer et al., 1978) 15 Figure 1.3 Side view of a sector through the TMV double disk Axial contacts between subunits in the two layers are shown. See text for further details. From Bloomer et al.(1978). Figure 1.4 L a t e r a l i n t e r a c t i o n s between subunits i n one layer of the TMV double disk Four adjacent subunits within one layer are shown viewed from above. The interface between subunits contains alternating patches of polar residues, indicated by stippling, and of hydrophobic residues, indicated by solid shading. The hydrophobic patch at higher radius is continuous with the hydrophobic girdle which extends the whole width of a subunit and across the interface, forming a continuous belt around the double disk layer. From Bloomer et al.(1978). 16 17 The inner ends of the a-helices are joined together into two pairs by loops of the polypeptide chain. The loop between the lower pair of a-helices (LR and RR) , residues 89-114, is not visible in the electron density map of the protein (Bloomer et al., 1978). Nuclear magnetic resonance. (NMR) has shown that this region is in rapid motion in A-proteins or double disks, but not in the protein helix or in the virus (Bloomer et al., 1978; Jardetsky et al., 1978). 3.4 TMV Capsid Protein Interactions Within the Double Disk The atomic model built by Bloomer et al. (1978) also shows the nature of the bonding both within and between protein subunits in the double disk (see Figure 1.3). The inside of each subunit, between the four a-helices, is largely hydrophobic. A region of hydrophobicity also exists between radii of 70 and 80 A. The hydrophobic contacts, in this latter region, continue outside the individual subunit to its two neighbours in the same layer, to form a "hydrophobic girdle" around the circumference of each layer of the double disk (Figure 1.4). The subunits in the two capsid protein layers of the disk have three regions of interaction, two of which are hydrophilic and one which is hydrophobic. A l l of these occur at the higher-radius end of the molecule, but are separated. The outermost consists of hydrogen bond interactions between serines 147 and 148 in the upper layer and Thr 59 in the lower layer (see Figure 1.3; dashed lines to the right). A small hydrophobic patch where Ala 74 and Val 75 18 in the upper layer both interact with Pro 54 in the lower layer (see Figure 1.3; solid line) and an extended-salt bridge system (see Figure 1.3; further dashed lines) occur at lower radi i . The extended salt-bridge system involves the only two lysine residues and four acidic groups, from three segments of the main chain in the lower layer with Asn 127, Glu 131 and Arg 134 from the LR helix in the upper layer. Almost a l l hydrogen bond capabilities are utilised in this complex 3-dimensional network, in which two water molecules also participate. Adjacent subunits within a layer are linked at low radius by a simpler salt-bridge system involving Arg 122 and Asp 88. In this case also, most of the hydrogen-bonding potential of the arginine is utilised, with additional links to Thr 89 in the neighbouring subunit and to peptide carbonyl groups of residues 41 and 33 in the same subunit. At higher radius in the same molecular interface, the region of polar interaction has an intra-subunit salt link involving Arg 71 and Asp 77 with additional hydrogen bonds to Thr 81, Ser 49, and an inter-subunit link to Thr 28 (Bloomer et a l . , 1978). The strong tendency of TMV capsid protein to aggregate can now be understood in terms of its surface properties. The hydrophobic patches on the molecular surface of the coat protein would only be expected in a component of a larger assembly, not in a monomeric protein. These patches only occur within the lateral interface. This interface comprises hydrophobic and salt interactions which would be favoured by higher temperatures, and indeed, TMV is a classical example of an entropically driven system (Bloomer et a l . , 19 1978; Butler, 1984). 3.5 Differences Between the Double Disk and the Virus Structures The capsid protein structure within the virus is very similar to that in the double disk. However, the disordered loop, discussed above, adopts a definite comformation in the virus. Lateral protein-protein interactions appear to be similar in a l l aggregates; however, the axial protein-protein interactions in the virus are completely unrelated to those in the disk. This is partly because of the very different t i l t s of the subunits that exist in the two aggregates, leading to much closer packing in the virus. The primary reason is that in the virus, each subunit is displaced about a third of a subunit to the left of its lower neighbour, whereas in the disk, each subunit is displaced about a fifth of a subunit to the right. Thus, Glu 22-Arg 134 is an axial intersubunit salt bridge in the double disk, whereas Glu 22 does not make intersubunit interactions in the virus, and Arg 13 4 forms an intersubunit salt bridge with Glu 50 (Namba and Stubbs, 1986; Namba et a l . , 1989). 3.6 Interactions Between the Capsid Protein and the RNA Within the Virus The RNA binding site is effectively bipartite, being formed by the top of one subunit and the bottom of the next. The three bases associated with each coat protein subunit form a claw that grips the LR helix of the upper subunit. In a l l strains of the virus a hydrogen bond probably exists between the ribose 21-OH of the two 20 external bases and the two aspartate residues present at positions 115 and 116. The middle base of each triplet may hydrogen bond to serine 123. The second part of the RNA binding site is mostly on the RS helix of the lower subunit. Two phosphate groups form ion pairs with Arg 90 and Arg 92. The third phosphate appears to form a hydrogen bond with Thr 37. Arg 41 extends towards the same phosphate as Arg 90 but does not approach as closely (Namba and Stubbs, 1989; Namba et a l . , 1989; Matthews, 1991). 3.7 Assembly: I n i t i a t i o n The nucleation complex in TMV assembly is the association of a double disk with a specific segment of TMV RNA (Butler and Klug, 1971; Butler, 1984) . This RNA segment forms a hairpin loop whose 18-nucleotide apical sequence, AGAAGAAGUUGUUGAUGA, has a G at every third residue but no C s . This hairpin loop (loop 1) is located towards one end of the RNA, approximately 900 residues from the 3'-end and close to two other hairpin loops (loops 2 and 3) which are situated slightly upstream from loop 1 (Zimmern and Wilson, 1976; Guilley et a l . , 1979; Zimmern, 1983b). The binding of loop 1 during nucleation is mainly due to the regularly spaced G residues. (Turner and Butler, 1986; Turner et a l . , 1988; Mathews, 1991). TMV's high binding affinity for this initiation sequence is explained, in part, by observations that CP subunits bind every third nucleotide in the unusual syn conformation and that G assumes this conformation more easily than any other nucleotide (Voet and Voet, 1995) . 21 The structure of the double disk and the secondary structure near the 3'-end of the TMV RNA led to a model (see Figure 1.5) which predicts that nucleation occurs by insertion of loop 1 into the central cavity of the nucleating disk (Butler et a l . , 1977). After insertion of loop 1 (see Figure 1.5A), the single-stranded RNA at the end of the loop is predicted to bind into the RNA-binding site between the rings of the disks, with the weakly base-paired hairpin melting to allow binding of a complete turn of RNA (see Figure 1.5B). This protein-RNA interaction is then predicted to cause dislocation of the double disk into a protohelix with consequent closing together of the subunits and entrapment of the RNA (see Figure 1.5C) (Butler et a l . , 1977; Lebeurier et al.,1977) . 3.8 Assembly: E l o n g a t i o n Elongation follows nucleation and consists of the addition of double disks to the nucleation complex. Evidence for this comes from investigations of the lengths of RNA protected from nuclease attack during assembly (Butler and Lomonossoff, 1978). Elongation occurs in both directions simultaneously, however, elongation in the 5'-direction proceeds substantially faster than that in the 3 1-direction. Elongation in the 5'-direction is believed to occur as the loop of RNA receives successive double disks and the 5'-tai l of the RNA is drawn through the central cavity (see Figure 1.5 D-H). The mechanism for the coating of the 3'- tai l is unknown (Voet and Voet, 1995). 22 Figure 1.5 Model p r e d i c t i n g the mechanism of TMV assembly A-C initiation; D-H elongation. See text for further details. From Butler et a l . (1977). 23 24 4. Potexviruses 4.1 General C h a r a c t e r i s t i c s of Potexvirus Potexviruses constitute a diverse group of flexuous filamentous RNA viruses. Table 1.1 l ists several confirmed potexviruses which have been completely or partially sequenced. Potexviruses are between 470-580 nm in length and approximately 13 nm in width (Koenig and Lesemann, 1978). Their type member is Potato Virus X (PVX) and they are composed of a monopartite, single-stranded, positive-sense (coding) genomic RNA which is encapsidated by 1000-1500 molecules of a single species of CP (White et a l . , 1994). The gRNA has a molecular weight which ranges from 2.1 x 106 to 2.6 x 106 daltons and which constitutes approximately 5 to 7 % of the particle weight (Koenig and Lesemann, 1978). Other viruses with which the potexvirus group has homologies are considered to be alpha-like (Goldbach and Wellink, 1988; Goldbach et a l . , 1991) Potexviruses are usually found in high concentrations in the sap of systemically infected hosts (Lesemann and Koenig, 1977). They occur worldwide, but the geographic range of individual viruses in the group is dependent on that of their hosts (White et a l . , 1994). They cause diseases in a wide range of mono- and dicotlyedoneous plants; however, the natural host range of each individual member is limited. Chlorotic mottle or mosaic patterns and/or stunting of hosts are characteristic symptoms produced by potexviral infections Table 1 . 1 Completely o r p a r t i a l l y sequenced p o t e x v i r u s e s 1 2 Member* Particle length (nm) gRNAb (nt) coat protein6 (kDa) BaMV 490 6366 25.0 CYMV 540 7015 23.5 CyMV ,475 6800-7500d 23.6 FMV 500 6151 23.7 LVX 550 - 21.6 NMV 550 6955 26.1 PMV 530 6656 23.0 PaMV 580 8000" 26.0 P1AMV 510 6128 21.8 PVX 515 6435 25.1 SMYEAV 480 5966 25.7 WC1MV 480 5845 20.7 'Full name described in the l i s t of abbreviations. bSize of genome determined from sequenced cloned cDNAs. Molecular weight predicted from deduced amino acid sequence. dSize of genome estimated from mobility in gel electrophoresis. 1. Rouleau (1994) 26 (Short and Davies, 1987). These symptoms usually range from undetectable to moderate. Nevertheless, some members of the group are economically significant. Cassava mosaic virus infections may reduce crop yields by 30 % (Costa and Kitajima, 1972) . Yield reduction by PVX alone is usually low (-10 %) , but may be considerable in mixed infections with Potato Virus Y, a potyvirus, (up to 60 % in some potato cultivars) (Koenig and Lesemann, 1989) 4.2 T ransmiss ion Potexviruses have no known natural insect or fungal vector. Transmission of PVX by the fungus Synchytrium endobioticum and the grasshoppers Melanoplus differentialis and Tettigonia viridissima has been reported. The grasshoppers probably transmit the virus mechanically on their mouthparts. PVX has been shown to infect some dodder species (rootless parasitic plants which lack chlorophyll) , but whether or not the virus is transmissible by dodder is inconclusive (Koenig and Lesemann, 1989). White clover mosaic virus (WC1MV) exhibits a low degree of transmission by aphids (Goth, 1962) and some potexviruses which infect legumes are transmitted to a portion of the seed (Koenig and Lesemann, 197 8), but, for the most part, potexviruses are transmitted by mechanical contact, especially with horticultural or agricultural equipment (Koenig and Lessemann, 1978; Koenig and Lesseman, 1989). 4.3 Cytopathology Cytological studies show that potexviruses accumulate to high levels in cells during infection (Lesemann and Koenig, 1977; Rouleau et al., 1994; Rouleau et al., 1995). There seems to be no cytological alteration common to the group as a whole. Viral particles often form large aggregates, termed inclusion bodies, without specific organization; however, banded inclusion bodies, in which large viral particles appear as an array of parallel intertwined fine elements are also prevalent (Lesemann, 1985; Rouleau et al., 1994). Spindle-shaped inclusion bodies can be observed in infections of some members of the group (e.g. tulip virus X (TVX)). Inclusion bodies are usually found in the cytoplasm, but have also been observed in the nucleus (e.g. during cactus virus X (CVX) infection) (Lesemann, 1985). PVX induces, in addition to virus particle masses, the formation of cytoplasmic laminated inclusion components (LIC). The LIC are proteinaceous sheets 3 nm thick which are often associated with bead-like structures 11 to 14 nm in diameter. LICs are not serologically related to the PVX CP and their function is unknown. (Shalla and Shepherd, 1972). PVX and several other potexviruses also induce a proliferation of the endoplasmic reticulum in infected cells (Lesemann, 1985). 4.4 Genome S t r u c t u r e and O r g a n i z a t i o n The general coding organization of potexviruses is shown in Figure 1.6. The 5'-and 31-termini of several potexviruses including: PVX (Sonenberg et al., 1978; Morozov et al., 1987), PMV (AbouHaidar and Bancroft, 1978b) and CYMV (AbouHaidar, 1983) have 28 Figure 1.6 Genome coding organization of potexviruses (A). General coding organization of the capped (m7Gppp) and polyadenylated ( A J genomic RNA which ranges from 5.8 to 8.0 kb. The relative positions of ORFs 1 to 5 are shown. 0RF 1 encodes the putative v iral component of the replicase complex, ORFs 2, 3, and 4 (the triple gene block) encode proteins involved in cel l to ce l l movement and ORF 5 encodes the capsid protein. The two most abundant sgRNAs are shown below the genomic RNA. They range from 1.9 to 2.1 kb and 0.1 to 0.9 to 1.0 kb and are employed in ORF 2 and ORF 5 expression, respectively. (B). Sequences l ikely to be important for assemnly initiation (nucleotides 38 to 47 at the 5'-terminal) or replication (m7GpppGAAACAAAAC..; . .ACUTJAA.. ; . .GGTJUAA. .) . From White (1992) . 29 POTEXVIRUS gRNA m7Gppp. ORF1 0 •An sgRNAs m7Gppp -An m7Gppp J L A n ORIGIN OF ASSEMBLY I 5'-ORF1 A m7GpppGAAAACAAAAC. 5 \ .GGUUAA.. T|4i s -L-An t s 5'..ACUUAA.. 30 been examined. In each case the presence of a 5'm7GpppG cap structure and a 3'poly(A) tract of variable length were found suggesting that such structures exist in a l l potexviruses. These terminal structures are required for infectivity as white clover mosaic virus (WC1MV) RNA transcripts without cap structures are only 4 % as infectious as those with cap structures (Beck et a l . , 1990) and the infectivity of CYMV transcripts lacking cap structures is completely abolished (Holy and AbouHaidar, 1993). The infectivity of WC1MV transcripts lacking poly(A) tracts is also greatly diminished and is completely abolished in transcripts which, in addition to lacking a poly (A) tract, have had their polyadenylation signal mutated to a non-functional sequence (Guilford et a l . , 1991). Additional evidence for the requirement of poly(A) tracts for the infectivity of potexviruses comes from studies of PVX which show that a portion of the poly(A) tract is copied in negative strand synthesis (Dolja et a l . , 1987). A 51-untranslated region which is variable in length (80 to 107 nucleotides) and is rich in adenosine and cytosine leads into five principal open reading frames (ORFs). These ORFs are relatively well conserved in position and sequence between members of the group (White et a l . , 1994). ORF 1, the largest 0RF, encodes a protein product of 150-180 kDa depending on the group member. This protein appears to be a component of the viral replicase (RdRp) since i t contains the polymerase motif -GDD-, an NTP-binding/helicase motif which is centred around the amino acid sequence -GxxGxGK(S/T)-, and the 31 methyltransferase domain centred around the sequence -DxxR-. These motifs are found in the putative replicases of many other plant and animal viruses (Morozov et a l . , 1989; Ding et al-., 1990). The products of ORFs two through five are encoded by sgRNAs. These ORFs are located in the 3 • half of the gRNA and would otherwise be poorly expressed (Matthews, 1991). ORFs 2, 3, and 4 slightly overlap and constitute the "triple gene block". They encode gene products of 24-26, 11-14, and 6-13 kDa, respectively. These proteins are believed to participate in cel l to cel l movement, through the plasmodesmata. (Beck et a l . , 1991; White et a l . , 1994). Counterparts of the triple gene block exist in the genomes of carla-, furo- and hordeiviruses. These genes are related in both sequence and function (Rouleau et a l . , 1994). The foxtail mosaic virus (FMV) ORF 2 gene product, p26, binds ATP, CTP, and RNA and demonstrates an ATPase activity which is not RNA-dependent. Immunocytochemical analysis of infected C h e n o p o d i u m quinoa leaves infected with FMV indicate that p26 is exclusively associated with cytoplasmic inclusions, making contact with aggregates of v iral particles. Since p2 6 is an RNA-binding protein, i t is possible that the p26 inclusions contain sequestered viral RNA and that such inclusions are involved in the modification of v iral RNA prior to transport or assembly (Rouleau et a l . , 1994) . ORF 3 and ORF 4 code for small proteins which contain highly hydrophobic regions. With the exception of ORF 4 in PVX (Hefferon et a l . , 1994), the expression of ORFs 3 and 4 has not been demonstrated convincingly. Indirect evidence for the expression of 32 ORFs 3 and 4 comes from mutational analysis of WC1MV. Point mutations in ORFs 3 and 4 destroyed the ability of WC1MV to spread in host plants, while replication in protoplasts was not affected, indicating that the expression of these two ORFs is necessary for viral movement (Beck et a l . , 1991). Three potexviruses do not contain a canonical triple gene block arrangement. ORF 3 and ORF 4 sequences do not overlap in FMV (Bancroft et a l . , 1991), strawberry mild yellow edged associated virus (SMYEAV) lacks an ORF 2 initiating codon (Jelkmann et a l . , 1992) and l i l y virus X (LVX) lacks an initiation codon for ORF 4 (Memelink et a l . , 1990). ORF 5 encodes the CP which ranges from 21-2 6 kDa in size. In addition to its structural function (see section 1.4.6), the CP also likely plays a role in both cel l-to-cel l and long distance movement (Chapman et a l . , 1992; Rouleau et a l . , 1995). A comparison of the predicted amino acid sequence of nine potexviruses has revealed that only 10 of an average of 230 amino acid residues are absolutely conserved (Bancroft et a l . , 1991). These residues may be important in viral assembly and/or movement. Interestingly, PVX CP is known to be post-translationally modified. Its N-terminal residue is acetylated (Miki and Knight, 19 68) and i t is believed to be glycosylated in areas of one or both of its termini. These modifications may confer protection from proteolysis, stabilization of protein-protein interactions and/or targeting to subcellular compartments (Tozzini et a l . , 1994). Whether analogous modifications occur in other potexviral capsid proteins is not known. 33 4.5 R e p l i c a t i o n and T r a n s l a t i o n o f P o t e x v i r u s e s Potexvirus replication is believed to occur as described in section 1.2.6. Evidence for this model comes from the identification of ds gRNA intermediates in plants infected with PVX (Dolja et a l . , 1987), PMV and FMV (Mackie et a l . , 1988). Potexviruses contain conserved c i s acting motifs both at their termini and internally which may be required for RdRp complex recognition during replication (Skyrabin et a l . , 1988b). A nucleotide sequence that conforms closely to the sequence 5•GAAAACAAAAC...3'and the hexanucleotide sequence 5 1 . . .ACUUAA...3' have been found at the 51-and 3'-termini, respectively, of a l l potexviruses sequenced to date (see Figure 1.6B) (Skyrabin et a l . , 1988a; 1988b; White et a l . , 1992b). A CYMV defective RNA (D-RNA) has been used to test the hypothesis that the hexanucleotide sequence is required for replication. This D-RNA requires the presence of fu l l length infectious CYMV (helper virus) for its replication and encapsidation and therefore can serve as a reporter for these functions. When host plants were co-inoculated with D-RNAs containing point mutations in the hexanucleotide sequence and helper virus, the ability of the D-RNA to accumulate was destroyed indicating that the hexanucleotide sequence plays an important role in v iral replication (White et a l . , 1992b). A third conserved cis acting motif, . . . GGUUAA. . . , has been identified in the gRNA of several potexviruses, 51 to the initiation sites of sgRNA synthesis (see Figure 1.6B) (Skyrabin et a l . , 1988b; S i t et a l . , 1990). This sequence may represent a core element of sgRNA promoters. 34 During potexvirus infection the gRNA serves as an mRNA for the expression of ORF 1. The production of sgRNAs is required for the expression of potexviral 3'ORFs. Two major sgRNAs, 1.9-2.1 kb and 0.9-1.0 kb in length, are produced in potexviral infections (see Figure 1.6). These sgRNAs are predicted to be required for the expression of ORF 2 and ORF 5 (CP) , respectively (Bendena and Mackie, 1986; Bendena et a l . , 1987). Additional sgRNAs, between 1.0 and 2.0 kb in length, have been found in PVX (Dolja et a l . , 1987) and daphne virus X (DVX) (Guilford and Forster, 1986) infections. These sgRNAs may be involved in ORF 3 and ORF 4 expression. Alternatively, some potexviruses may depend on internal ribosome binding for expression of ORF 3 and ORF 4 (Hefferon et a l . , 1994). 4.6 E n c a p s i d a t i o n Several potexviruses have been reconstituted from their individual purified components (e.g. PVX (Goodman et a l . , 1975), CYMV (Bancroft et a l . , 1979) and PMV (AbouHaidar and Bancroft., 1978) . Of these, the assembly of PMV is the best characterized (reviewed by AbouHaidar and Erickson, 1985). PMV assembly demonstrates both similarities to and differences from that of TMV; however, much less detail on PMV assembly exists since, unlike TMV, the three dimensional structure of PMV CP has not been established to high resolution. Like TMV, the CP of PMV self-assembles into a variety of polymers depending on such factors as pH, ionic strength, protein 35 concentration and temperature (Erickson et a l . , 1976; Erickson and Bancroft, 1978) . A 14S polymer dominates over a wide range of these parameters. This 14S species contains 18.2 ± 1.9 CP subunits which is consistent with a double disk structure, similar to that of TMV, containing two rows of 9 subunits each (Tollin et a l . , 1979) . Electron microscopy of PMV subassembly aggregates confirms the existence of such a structure (Erickson et a l . , 1983). Assembly of PMV in vitro occurs at pH 8.0 in 10 mM Tris and consists of two steps. The f irst step is a rapid initiation, or nucleation, step in which a CP aggregate, most likely the 14S double disk, interacts with 4 0 to 50 contiguous nucleotides at the 5'-terminus of the genomic RNA. The products of this step are particles of approximately 50 nm in length. This step is completed very rapidly (less than 20 seconds) and is temperature-independent between 1° and 25°C (AbouHaidar and Bancroft, 1978). Elongation, the second step, is much slower, is entropically driven, and does not proceed at 1°C. Unlike the initiation step, this step is not sequence-specific at pH 8.0. Elongation consists of the addition of smaller CP polymers to the initiated 50 nM particle allowing capsid growth unidirectionally towards the 3'-terminus of the gRNA (Erickson and Bancroft, 1978; Erickson et a l . , 1978). PMV assembly differs from that of TMV in that i t is unidirectional, and is initiated at the 5'terminus of the gRNA, whereas TMV assembly is bidirectional and internally initiated. The 5'-terminal sequence of PMV gRNA is very rich in adenosines and relatively poor in uridines. This is not surprising 36 since PMV CP encapsidates poly(A) and poly(C), but not poly(U) or poly(I) (Erickson et a l . , 1978). Although the high adenosine content may be important for PMV assembly, this cannot be the only factor governing CP-RNA interactions since the RNA poly(A) tract does not undergo initiation. This finding suggests that a free 5'-terminus is required for initiation (Lok and AbouHaidar, 1986). The 5'-sequence is further characterized by the presence of eight consecutive repeated pentamers (essentially GCAAA), extending from nucleotide 1 to 40. Lok and AbouHaidar (1986) suggested a model for initiation of PMV assembly in which each of the capsid protein subunits within one layer of the double disk is associated with one of the pentamers (see Figure 1.7). This model predicts that during initiation the f irst layer of the helix does not contain RNA and the cap structure is situated between the- f irst two layers of the helix. Initiation complexes exhibit a much lower density and lower RNA to protein ratio than native virus consistent with this model (AbouHaidar and Bancroft 1978; AbouHaidar and Erickson, 1985). This model may not apply to potexviruses in general since other potexviruses (e.g. PVX and CYMV) do not contain repeating pentamers at their 5'-termini. A l l of the available structures do contain a cap structure followed by GAAAA at their 5'-termini. However, this sequence has been ruled out as a general site required for potexvirus assembly by a recent study which narrows the specific site of assembly in PMV to nucleotides 38 to 47 (Sit et a l . , 1994) . The specificity of PMV assembly is pH dependent. At pH 8.0 only PMV and CYMV genomic RNAs can be encapsidated by PMV CP. At lower 37 Figure 1.7 Model showing the inte r a c t i o n between the f i r s t 40 nucleotides of PMV RNA and the PMV capsid protein double disk The f irs t layer of protein subunits, which is presumed to be free of RNA, is not shown for c lari i ty . See text for further details. From Lok and AbouHaidar (1986). 38 39 pH, pH 6.0 to 7.5, the CP forms "kinked" helical particles with both homologous and heterologous RNAs as well as DNA (Erickson et a l . , 1978). Certain ehacteristics of the primary structure of the CP may be functionally important for viral encapsidation (AbouHaidar, 1988). Basic amino acids are clustered in three regions (near each of the termini and in the centre of the protein) and may be involved in CP-RNA binding through the formation of ionic bonds with the negatively charged phosphates of the RNA backbone. A prominent hydrophobic region is located near the N-terminus while less prominent hydrophobic regions are more central in location. These regions may be responsible for the axial and/or lateral contacts between subunits in the PMV 14S double disk, similar to the involvement of hydrophobic regions of TMV capsid protein in the subunit contacts within the TMV double disk (Bloomer et a l . , 1978). The f lexibi l i ty of PMV particles is likely dependent on the existence of an axial interaction gradient between CP subunits in the rod, with the highest density of interaction existing at low radius (AbouHaidar and Erickson, 1985). Tritium planigraphy, antibody analysis and mutational analysis have been used to predict the regions of the potexvirus CP that are involved in assembly. Tritium planigraphy and monoclonal antibody analysis support a spatial model of PVX in which the N-terminus of PVX CP is exposed at the virus particle surface while the C-terminus is buried within the particle (Baratova et a l . , 1992). Such a model differs from that proposed for other filamentous plant 40 viruses, such as potyviruses, where both the N- and C-termini are situated at the surface of the viral particle. Mutational analysis of capsid proteins of PVX (Chapman et a l . , 1992) and WC1MV (Forster et a l . , 1992) has revealed that the deletion of the N-terminal 31 residues (PVX) and the C-terminal 31 residues (WC1MV) does not prevent assembly. However, in each case assembly produced atypical v iral morphology. 4.7 Goals of the Research The study of the multifunctionality of the CP of potexviruses ( i .e . , its role in encapsidation and movement) is limited in vivo. Capsid protein mutants that affect encapsidation and/or movement usually cannot be efficiently recovered from plants due to reduced viral yield. This thesis was undertaken to develop an in vitro system for the systematic investigation of the role of the capsid protein in assembly without the constraints of encapsidation and movement. The specific goals of this study were to overexpress a potexviral CP in E. coli and purify i t in an active form for viral reconstitution in vitro, thus producing a system for subsequent site-directed mutagenesis and/or crystallography of the CP. Precedents for this idea were found in the literature, albeit with differing outcomes. The overexpression of TMV CP (Hwang et a l . , 1994) and CCMV CP (Zhao et al., 1995) in E. coli produced contrasting results. TMV CP formed non-helical stacked aggregates in E. coli and was incapable of reassembly with TMV gRNA, whereas 41 CCMV CP was easily partially purified and produced viral particles in vitro, with CCMV RNA transcripts, that were indistinguishable from native particles. Therefore, there was no guarantee that a potexviral CP would be easily overexpressed in and purified from E . coli in an active form. Chapter 2 42 Materials and Methods 1 . Enzymes and Chemicals A l l chemicals were of reagent grade and were purchased from Bio-Rad, BDH, Fisher, or Sigma. [35S]-dATP was purchased from Amersham. T4 DNA ligase, T4 polynucleotide kinase, T7 DNA polymerase, Taq DNA polymerase, calf intestinal alkaline phosphatase, RNase A, Tl RNase, and restriction enzymes were purchased from Pharmacia, Promega or New England Biolabs. Oligonucleotides in this study were synthesized using an Applied Biosystems model 380A or 391 DNA synthesizer and are listed in Table 2.1. 2. Strains and Plasmids E s c h e r i c h i a coli strains MV1190 (A(lac-pro), th i , supE, A(srl -recA) 306::Tnl0 (tetR) [F • : traD36, proAB, lac IqZAll5]) and BL21(DE3) (F~ompT Ion, hsdSB, rB~ mB~ (\ DE3)), an E.coli B strain carrying the T7 RNA polymerase gene on the X DE3 prophage, were purchased from Bio-Rad and Novagen, respectively. Plasmid pET 11 which contains a gene for ampicillin resistance and a T7 promoter was purchased from Novagen. 3. Recombinant DNA Techniques 43 T a b l e 2 . 1 . S y n t h e t i c o l i g o n u c l e o t i d e s used i n t h i s study Oligo-nucleotide Sequence1,2 5' Coordinate F/R3 CYMV 1102 5'ccggaggatccaggaggttatacatATGA--CAGACACTAAGAAGA 3' 6240 F CYMV 997 5'gacgggatccGGTGGTTGGTTACTCCGGG--CCT 3' 6887 R PMV 1103 5'gacgcggatccaggaggttatacatATGT--CTAAGTCAAGTATGTCC 3' 5889 F PMV 916 5'gacgggatccGGTCAAGTGTCTTTATTCG--GGG 3' 6548 R PMVCP1 5'TGTCATAGCAGAAGTTAACC 3' 6096 R PMVCP2 5'TCATGGTAGCTGCTAAGGTT 3' 6022 F PMVCP3 5'CCAATAATCTGGAATCTGAGGA 3' 6222 F PMVCP4 5'CAATGCTACCAACAAACAGGTG 3' 6398 F Footnotes: 1. Upper case letters represent viral sequences whereas lower case letters correspond to additional non-viral sequences. 2. The underlined nucleotide in each sequence represents the 5' most nucleotide which is identical or complementary to the viral sequence. 3. Forward (F) oligonucleotides are of identical sense to viral genomic RNA, while reverse (R) oligonucleotides are complementary. 44 3.1 Media and Growth Conditions E. coli strains were grown in Luria-Bertani medium (10 % (w\v) bactotryptone, 5 % (w/v) yeast extract, 5 % (w/v) NaCl, 0.2 % (w/v) glucose, 1 mM MgCl2) . Solid media were prepared by the addition of Bacto-agar (15 g/1). When selection was required, ampicillin or carbenicillin (an ampicillin analog) was added (50 jug/ml) . 3.2 Purification of Plasmid DNA from E. coli A standard alkaline lysis procedure (Birboim and Doly 1979; Maniatis et a l . , 1983) or a Wizard™ Plus kit (Promega) were used for rapid small scale plasmid preparation. Large scale plasmid DNA isolation was performed by growing 250 ml cultures with aeration at 37°C overnight followed by alkaline lysis of the harvested cells. The crude plasmid was further purified by equilibrium centrifugation in a CsCl-ethidium bromide gradient (Sambrook et a l . 1989). 3.3 Restriction Enzyme Digestions Restriction digests were carried out using 3-5 units of enzyme per /xg of DNA in the buffer suggested by the manufacturer at 37°C for no less than 3 hours. Reactions were stopped by the addition of 1/4 volume of gel loading buffer (50 % (v/v) glycerol, 50 mM EDTA (pH 8.0), 0.075 % (w/v) xylene cyanol and bromophenol blue). 3.4 Electrophoretic Separation of DNA. Separation of DNA by size under non-denaturing conditions was 45 carried out in horizontal 0.8 % (w/v) agarose gels in TAE running buffer (40 mM Tris, 20 mM sodium acetate, 1 mM EDTA, pH 8.0) or in vertical 6 % (w/v) native polyacrylamide gels (29:1, acrylamide:bisacrylamide) in TBE running buffer (90 mM Tris , 90 mM boric acid, 2mM EDTA, pH 8.0) (Sambrook et al. 1989). Electrophoresis was performed at 70 volts for agarose gels and 150 volts for polyacrylamide gels using a Mandel Scientific Company Ltd. EC105 power pack. Following electrophoresis, gels were stained with 0.5 u.q/Tb.1 ethidium bromide in H20 and DNA was visualized under ultraviolet light. Sequencing reactions were resolved in 8 % (w/v) polyacrylamide gels (19:1, acrylamide:bisacrylamide) containing 8 M urea. Electrophoresis was conducted in 1 X TBE at 1600 V for 2.5 to 5 hours. Gels were fixed in a solution of 5 % acetic acid and 5% ethanol for 5 minutes, soaked in H20 a further 5 minutes, dried and exposed to Kodak X-OMAT™ AR autoradiography film overnight. 3.5 Polymerase Chain Reaction (PCR) PCR reactions were conducted in a Hypercell Biologicals PTC-100 thermocycler. The reaction volume was 100 / i l . Each reaction contained 100 pmol of each primer, 0.2 /xg linear template DNA, 12.5 mM of each of the four deoxyribonucleotide triphosphates, and 2.5 u Taq polymerase in a buffer containing 50mM KC1, 10 mM Tris-HCl (pH 9.0), 15 mM MgCl2, 0.01 % gelatin (w/v), and 0.1 % (w/v) Triton X-100. To prevent evaporation each reaction mixture was overlayed with 100 /il of paraffin o i l . The DNA was amplified by an in i t i a l 46 denaturation at 94 °C for 5 minutes, annealing at 50 °C for 2 minutes, extension at 72°C for 5 min followed by 27 additional cycles for 1.5, 2, and 2 minutes respectively and finally by denaturing for 1 minute, annealing for 2 minutes and extending for 10 minutes at the given temperatures. Products were checked by polyacrylamide gel electrophoresis. Amplified DNAs were prepared for ligation by successive extraction with chloroform/isoamyl alcohol (C/I,24:l) and phenol/chloroform/isoamyl alcohol (P/C/I,25:24:1) followed by precipitation with ethanol. The recovered DNA was digested with the appropriate restriction enzyme and the products were resolved by electrophoresis (see section 3.4). After electrophoresis the products were localized by exposure to U.V. light and excised from the gel. The gel slice containing the desired product was crushed and the DNA was eluted by incubation in a buffer containing 500 mM ammonium acetate, 10 mM magnesium acetate, 1 mM EDTA, 0.1 % (w/v) SDS, and 10 nq/ml yeast RNA at 37°C overnight. The DNA products were separated from pieces of polyacrylamide by passing the eluate through siliconized glass wool. DNA was purified further by extraction with P/C/I and 2-butanol, followed by concentration by precipitation with ethanol. A portion was analyzed for quality and recovery by polyacrylamide gel electrophoresis (see section 2.3.4) 3.6 Ligations Linearized plasmid DNA (5 jug) , prepared as in section 3.3, was dephosphorylated in a 50 jul reaction volume with 0.2 u of calf 47 intestinal alkaline phosphatase in 50 mM NaCl, 10 mM Tris-HCl (pH 7.9 @ 25 C) , 10 mM MgCl2, and 1 mM DTT at 37°C for 30 minutes. The enzyme was inactivated at 85°C for 15 minutes. Linearized, dephosphorylated plasmid DNA and purified, digested target DNA in a 1:5 molar ratio were incubated with 1 u of T4 DNA ligase in the buffer recommended by the manufacturer at 15°C for 15 to 18 hours. Reaction volumes were 10 / i l . 3.7 Transformations Competent cells were prepared by the calcium chloride method (Sambrook et a l . , 1989). The cells were aliquoted and either used immediately or stored at -70°C for later use. Transformations were performed by incubating competent cells (300 /il) with DNA (plasmid or ligation mixtures) for 60 minutes on ice. This mixture was then subjected to heat shock at 42°C for 3 minutes and chilled on ice for a further 5 minutes. One ml of LB medium was added and the cells were incubated at 37°C for 1 hour. Cells were then plated on LB agar/ampicillin plates to select for resistance. 3 . 8 DNA Sequencing DNA was sequenced by the chain-termination cycle sequencing method (Smith et a l . , 1990; Huibregtse et a l . , 1991) using the ATaq Cycle Sequencing kit from Amersham. Sequencing was carried out in two steps. In the in i t ia l labeling step, 0.5 pmol of primer was extended with 5 /zCi [a-35S] dATP and 1 /il each of two of the three remaining deoxynucleotide triphosphates (supplied in the kit; 48 concentrations not given) depending on template sequence by 8 u ATaq Version 2.0 DNA Polymerase in the buffer recommended by the manufacturer (the properties of this polymerase include activity at high temperature and absence of associated exonuclease activity). The reaction volume was 17.5 jul and each reaction contained 0.1 /xg plasmid DNA. This mixture was overlayed with 10 fil mineral o i l and thermally cycled between 95 °C (30 seconds) and 60 °C (40 seconds) , 100 times. In the second chain termination step, 4 jul of each of the dideoxynucleotide termination mixes (15 jtiM each of the 4 dNTPs and 300 J U M ddATP or 150 /xM ddCTP or 22.5 J U M ddGTP or 450 J U M ddTTP) were placed in 4 separate micro centrifuge tubes and 3.5 /il of the labeling reaction was added to each. Again, each mixture was overlayed with 10 /ul mineral o i l and thermally cycled between 95 °C (30 seconds) and 72 °C (90 seconds), 3 0 times] . The reactions were denatured by the addition of stop solution (95 % (w/v) formamide, 20 mM EDTA, 0.05 % (w/v) bromophenol blue and xylene cyanol) and 3 minutes of boiling before being analyzed on a 12 % denaturing polyacrylamide gel (refer to section 3.4). 4. Capsid Protein Overexpression and P u r i f i c a t i o n 4.1 SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) Protein samples were analyzed by SDS-polyacrylamide gel electrophoresis (Laemmli, 1970). Various protein samples were dissolved in 1 X SDS sample buffer (50 mM Tris (pH 6.8), 2 % (w/v) SDS, 50 mM DTT, 10 % (v/v) glycerol, 0.1% (w/v) bromophenol blue), boiled for 3 minutes and separated by electrophoresis in 15 % (w/v) polyacrylamide (36:1, acrylamide:bisacrylamide)/0.1 % SDS gels in Laemmli's running buffer (25 mM Tris, 192 mM glycine, 0.1 % (w/v) SDS). Proteins were visualized by Coommassie blue staining. 4.2 Protein Concentrations Protein concentrations were determined by the Bradford dye-binding method (Bradford, 197 6) using the Bio-Rad Protein Assay Kit. BSA was used as the standard. 4 .3 Western Blot Analysis Proteins separated on SDS-polyacrylamide gels were electro-phoretically transferred to nitrocellulose membranes in a Bio-Rad mini-transblot system. Transfer was for 1.5 hours at a constant current of 0.25 A in a buffer containing 10 mM NaHC03, 3 mM Na2C03 (pH 9.9), and 20 % (v/v) CH30H (Dunn, 1986). Membranes were then agitated in PTBN buffer (20 mM Na phosphate (pH 7.0) , 0.1 mM bovine serum albumin, 0.85 % (w/v) NaCl, 0.05 % (v/v) Tween-20, 1 mM NaN3 (pH 7.4)) containing 5 % (w/v) casein for 1 hour at room temperature to block non-specific sites (Rouleau et al., 1994). Primary antibody was added in a 1:1,000 dilution and the membranes were agitated for a further 2 hours. Membranes were washed for 15 minutes in three changes of PTBN and then agitated in Phosphate Buffered Saline (PBS) (Harlow and Lane, 1988) containing the secondary antibody (alkaline phosphatase conjugated goat anti-50 rabbit IgG antibodies) in a 1:3,000 dilution for 1.5 hours. The membranes were washed for 15 minutes in three changes of PBS and equilibrated in development buffer (0.1 M Tris (pH 9.5), 1 mM MgCl2) for 5 minutes with shaking. Bound antibodies were detected by the addition of nitroblue tetrazolium and 5-bromo-4-chloro-3-indoyl phosphate as specified by the manufacturer (Bio-Rad). 4.4 Acetic Acid Extraction Native viral capsid protein was partially purified by a modification of the acetic acid extraction method (Fraenkel-Conrat, 1957). Two volumes of glacial acetic acid were added to concentrated virus on ice and the mixture was stirred for 1 hour. Precipitated RNA was removed by centrifugation at 4°C in a JA-2 0 rotor (Beckman) at 27,200 X g for 1 hour. The supernatant was dialyzed against several changes of 10 mM Tris, pH 9.5 to remove the acetic acid and to disassemble any helices which are known to form as the pH of the solution rises past pH 4 (Erickson and Bancroft, 1978a). 4.5 overexpression and Preliminary Fractionation of Extracts Transformed E. coli BL21(DE3) cells were grown at 30°C in 250 ml LB/Cb media until an OD600 of 0.5 was reached. LB/Cb was added to a final volume of 500 ml and T7 RNA polymerase expression, and hence recombinant protein expression, was induced with 0.4 mM isopropyl /3-thiogalactopyranoside (IPTG) for 4.5 hours. At 1.5 hours post induction small samples, typically 1.5 ml, were boiled, 51 suspended in 1 X SDS sample buffer, briefly sonicated to reduce viscosity and analysed for protein expression by SDS-PAGE. At 4.5 hours post induction the cultures were chilled and the cells were harvested by centrifugation in a JA-14 rotor (Beckman) at 4,000 x g for 10 minutes. A l l subsequent steps were performed at 4°C. Cell pellets were washed with 200 ml of buffer A (0.05 M Tris (pH 7.5), 0.01 M MgCl2, 0.05 M NH4C1, 0.5 mM EDTA), weighed, resuspended in 3.0 ml of buffer A containing 1 mM DTT and 5% (v/v) glycerol/gram of pelleted cells, and stored at -70°C overnight. The cells were thawed in the presence of 0.1 mM DTT, 0.2 mM PMSF, 2 /ixg/ml aprotinin, 0.8 /ug/ml leupeptin, 0.8 jug/ml pepstatin A and 2 0 /ig/ml DNase I were added. The cells were lysed by two passages through an Amicon French pressure cel l at 8,000 psi . The cel l lysate was placed on ice for 15 minutes to allow digestion of DNA and then unbroken cells and debris were pelleted by centrifugation @ 30,000 x g for 45 minutes in a JA-20 rotor. The pellet was discarded and the supernatant (S30) was diluted with one volume buffer A containing 0.1 mM DTT, 5 % (v/v) glycerol and protease inhibitors at the concentrations listed above. Powdered ammonium sulfate was dissolved with stirring in the S3 0 solution to 40 % saturation. Salted-out proteins were collected by centrifugation at 17,400 X g for 20 minutes in a JA-2 0 rotor. The supernatant was discarded and the pelleted material was resuspended in buffer A containing 0.1 mM DTT and 5 % (v/v) glycerol to the original volume of the S30. Concentration and buffer exchange of protein fractions was 52 performed in Ultrafree-15 centrifugal devices as specified by the manufacturer (Millipore). 4.6 Anion Exchange Chromatography A l l chromatography was conducted by FPLC™ using programs specified by Pharmacia. Protein samples were loaded onto a Resource Q anion exchange column in 10 ml of a mixture consisting of 82 % buffer B (10 mM Tris (pH 9.0), 1 mM DTT, 0.1 mM EDTA) and 18 % buffer C (10 mM Tris (pH 9.0), 1 M NaCl, ImM DTT, 0.1 mM EDTA). Buffer C was then injected as an increasing gradient to 100 % C over the next 15 ml. The flow rate was 1 ml/minute and 1 ml fractions were collected. 4 .7 Size Exclusion Chromatography A Superdex 75 gel f i ltration column was equilibrated with two column volumes (50 ml) of buffer D (50 mM sodium phosphate, 150 mM NaCl, 1 mM DTT, 0.1 mM EDTA, pH 6.4) at a flow rate of 0.5 ml/minute. Protein samples were then applied to the column and eluted with 30 ml of the same buffer. The flow rate was 0.45 ml/minute and 0.45 ml fractions were collected. A standard curve for elution was determined using BSA (66 KDa), ovalbumin (45 KDa), carbonic anhydrase (31 KDa), STI (21.5 KDa) and lysozyme (14.4 KDa) . 5. V i r a l Reconstitution 53 5.1 Assembly Reactions Reaction volumes were 50 /ul. Native or recombinant PMV CP, 1 mg/ml, was equilibrated for 5 minutes at 25°C in 10 mM Tris-HCl (pH 8.0). Assembly was then initiated by the addition of RNA to a final concentration of 0.05 mg/ml and was allowed to continue for at least 30 minutes before reactions were examined by electron microscopy (Erickson and Bancroft, 1978). In reactions where Tl RNase resistance was assayed, 1 u of Tl RNase was either added to the RNA 15 minutes prior to the addition of capsid protein, or to the entire assembly reaction 3 0 minutes after the addition of capsid protein. 5.2 Electron Microscopy Assembly reactions were examined for morphology in the electron microscope. If necessary, samples were diluted with 10 mM Tris-HCl, pH 8.0. Samples were pipetted onto 0.3 % piolaform coated copper grids and negatively stained with 2 % uranyl acetate. Specimens were observed using transmission electron microscopy (Zeiss EM10C). 5.3 Inoculation of Plants The infectivities of assembly reactions were assayed on Gomphrena g l o b o s a , a local lesion host for PMV (Purcifull and Hiebert, 1970). Leaves were lightly dusted with carborundum before inoculation with assembly reactions. Prior to inoculation, assembly reactions (50 /ul) were combined with one volume of ice-54 cold inoculation buffer (1 % sodium pyrophosphate (pH 9.0), 1 % celite). C h a p t e r 3 55 Results 1. Strategy The goal of our experiments was to develop an in vitro system to study the assembly of potexviruses. Such a system would ultimately permit the generation of a broad range of mutant capsid proteins which would otherwise be impossible to do in planta. Init ial ly two potexviruses, CYMV and PMV, were chosen for investigation. 2 . Subclone Construction Plasmids containing capsid protein coding sequences, namely ORF 5 of CYMV (p6153) and of PMV (pSQlDA3P3), gifts from K.A. White and M.G. AbouHaidar respectively, were used as templates for PCR (see section 2.3.5). In each case the 5'-primer (oligonucleotides CYMV 1102 or PMV 1103, see Table 2.1) was designed to include an optimal Shine-Dalgarno sequence, an initiation codon and a BamEI site near the 5'-end. The 3'-primer (oligonucleotides CYMV 997 or PMV 916) was designed to include a BamHI site near the 3' -end. Amplified DNA of the anticipated size was obtained in both cases (Figure 3.1, lanes 2 and 3). This DNA was cleaved with BamHI (see section 2.3.3) and cloned into the unique BamHI site of pET 11 (see section 2.3.6). The vector pET 11 was chosen to obtain regulated protein overexpression in E. coli as cloned sequences are under the 56 Figure 3.1 Analysis of PCR amplification products A cDNA fragment containing an optimal Shine-Dalgarno sequence fused to the CYMV or PMV ORF 5 sequence was generated by PCR (see section 2.3.5) using primer pairs CYMV 1102/CYMV 997 and PMV 1103/PMV 916 (see Table 2.1). Samples were separated by size on a 6 % polyacrylamide gel (see section 2.3.4) Lane 1 is a size marker (bp) (M) and lanes 2 and 3 show the amplified PCR products from a CYMV or a PMV template, respectively. 57 58 control of the T7 RNA polymerase promoter. To determine the orientation of the inserts relative to the promoter, putative recombinant plasmids were digested with EcoRV (for inserts from PMV) or Aval (for inserts from CYMV). Fragment sizes of approximately 0.3, 2.9 and 3.3 kb for recombinant plasmids containing CYMV ORF 5 and 0.6, 1.6 and 4.2 kb for recombinant plasmids containing PMV ORF 5 signified the correct orientation. The resulting expression plasmids, pCYMVCP and pPMVCP, are schematically represented in Figure 3.2. 3. Overexpression BL21(DE3) cells were transformed with either pCYMVCP or pPMVCP (see section 2.3.7) and recombinant capsid coat protein over-expression was induced with IPTG for 4.5 hours (see section 2.4.5) . Total cellular proteins from induced and non-induced pCYMVCP and pPMVCP transformed cells were analyzed by SDS-PAGE (Figure 3.3). Prominent polypeptides of approximately 23 kDa and 21 kDa were present in induced cultures of pPMVCP- and pCYMVCP-transformed cells, respectively (Figure 3.3, lanes 4 and 7), but not in non-induced cultures (Figure 3.3, lanes 3 and 6) or non-transformed cultures (data not shown). The apparent sizes are greater than those predicted from the DNA sequence but, the electrophoretic mobilities are identical to those of PMV and CYMV native (authentic) capsid proteins (nCPs) (Figure 3.3, lanes 2 and 5). The latter contain significant levels of breakdown products (Figure 3.3, lanes 2 and 5). The protein product of ~31 kDa (Figure 3.3, 59 Figure 3.2 Schematic representation of CYMV and PMV ORF 5 expression plasmids pCYMVCP and pPMVCP PCR generated fragments were cleaved with BamHI (see section 2.3.3) and ligated into the BamHI restriction site of the bacterial expression vector pET 11 (see section 2.3.6). The relative position of the start and stop codons, the Ba.mHI restriction sites, the Shine-Dalgarno sequence (SD) , the T7 lac promoter, the l a c operator and the T7 terminator are shown. 60 ATG TAA SD ORF 5 T7 promoter lac O T7 terminator Bam HI BamHl 61 Figure 3.3 Analysis of PMV and CYMV CP expression Boiled whole ce l l extracts (CE) ("20-50 jug) from BL21(DE3) transformed with pPMVCP (lanes 3 and 4) or with pCYMVCP (lanes 6 and 7) were prepared as described in section 2.4.5, separated by 15 % SDS-PAGE, and visualized by staining with Coomassie blue. Lanes 3 and 6 show samples prepared from non-induced cultures (-) whereas lanes 4 and 7 show extracts harvested 4.5 hours after induction with IPTG (+). Lane 1 is a size marker (kDa) (M); lanes 2 and 5 show native (authentic) PMV (nP) and CYMV CPs (nC) respectively. PMV CYMV M nP CE nC CE IPTG - + " + 63 lanes 5 and 7) is believed to be jS-lactamase. Once i t was established that we could overexpress the CPs of both PMV and CYMV in E. coli we decided to continue our experiments with PMV, whose assembly is the better characterized of the two (AbouHaidar and Erickson, 1985). 4. Western Blot Analysis The identity of the overexpressed protein observed in induced pPMVCP-transformed cells was confirmed by western blot analysis using anti-PMV rabbit raised polyclonal antibodies (Figure 3.4; see section 2.4.3). The rabbit serum reacted with the protein in question (Figure 3.4, lane 2) and with a higher molecular weight E. coli protein (Figure 3.8, lanes 1 and 2) which was equally abundant in induced and non-induced cultures. This contaminant was removed later during the purification procedure (Figure 3.4, lane 3). A small amount of capsid protein was also identified in non-induced cultures, presumably due to leakiness of the T7 RNA polymerase promoter (Figure 3.4, lane 2). 5 . Sequencing Considerable difficulty was encountered during attempts to determine the complete sequence of the insert in pPMVCP. One reason may be the relatively high G + C content in regions of ORF 5. In an effort to circumvent this problem we resorted to a cycle sequencing method suggested to us by Dr. Patrick Dennis. The sequencing strategy used to sequence pPMVCP is shown in Figure 3.5 64 Figure 3.4 I d e n t i f i c a t i o n of PMV CP expressed i n E.coli by Western b l o t analysis Proteins (from boiled cel l extracts or the completed purification; see further) were separated by 15 % SDS-PAGE, electrophoretically transferred to nitrocellulose membranes and immunoreacted with anti-PMV polyclonal antibodies (see section 2.4.3). Lane 1 shows the immunoreactivity of a non-induced extract (-) (20-50 /jg) , lane 2 shows that of an induced extract (+) (20-50 ng), and lane 3 shows that of the sample after the purification procedure (P) ("5 /xg) . Size markers (kDa) (M) are indicated on the left. Contaminant PMV CP 66 Figure 3.5 Sequencing strategy PMV ORF 5 in pPMVCP was sequenced by the chain-termination cycle sequence method (see section 2.3.8). Sequencing primers (see Table 2.1) are shown as thick horizontal arrows -+ or *- to indicate the priming direction. The relative primer locations are shown, not to scale. 67 PMV CP1 -, ATG TAA 3' ORF 5 3' PMV CP3 PMV CP2 PMV CP4 Table 3.1. Differences between the PMV CP sequence obtained from pPMVCP and that obtained from pSQ!DA3P3!. Nucleotide position Nucleotide change Amino acid change 6080 C - U silent 6167 U - C silent 6170 U -+ C silent 6200 A - G silent 6275 U - C silent 6368 U - C l ie -+ Thr 6404 U - C silent 6456 A - G Thr Ala 6506 A - C silent 1. Sit et a l . , 1994. 68 (see section 2.3.8). A comparison of the published sequence, which contains six possible heterogeneities, (AbouHaidar, 1988) and that obtained from pPMVCP revealed nine previously uncharacterized nucleotide substitutions, two of which cause amino acid changes (see Table 3.1). The nucleotide sequence of PMV coat protein (ORF 5) in pSQlDA3P3, the starting plasmid, was also determined. No differences were found between the ORF 5 sequence in pSQlDA3P3 and that in pPMVCP eliminating the possibility that the nucleotide substitutions had been made during PCR amplification. This result implies that errors may have been committed during the original sequence determination or that these substitutions are due to the sequencing of two different PMV strains. 6 . Recombinant Capsid Protein Purification Following induction of cultures of BL21(DE3) (pPMVCP), cells were lysed by french pressure lysis and the cel l lysate was fractionated by centrifugation at 30,000 x g (see section 2.4.5). At this point the recombinant CP (rCP) was found in the soluble fraction (S30) of the cel l lysate indicating that i t did not form inclusion bodies (Figure 3.8, lane 5). The S30 (Fraction I) was further fractionated by ammonium sulfate precipitation to 40 % saturation. Salted-out proteins, which included rCP, were collected by centrifugation and resuspended as described in section 2.4.5. (Fraction II) This procedure eliminated most E. coli proteins of lower molecular weight and many of higher molecular weight (Figure 3.8, lane 6). 69 Fraction II was concentrated in buffer B, loaded onto a resource Q column and eluted from the column in a gradient of NaCl (see section 2.4.6). Conditions were chosen so that the rCP did not bind to the column while the majority of the contaminants did. As a result the rCP and a few contaminants were eluted in the flow-through and were observed as a single peak in the absorbance profile (Figure 3.6). SDS-PAGE analysis revealed that the rCP was located in fractions 2, 3, and 4 (Figure 3.6, inset). Fractions containing the rCP were pooled and concentrated in buffer D (Fraction III). A small amount of the pool was analyzed by SDS-PAGE (Figure 3.8, lane 7) and the rest was applied to a Superdex 75 gel f i ltration column where the remaining proteins in the sample were separated by size exclusion (see section 2.4.7). Most of the capsid protein was eluted from the column as a single peak (Figure 3.7). SDS-PAGE analysis revealed that the rCP was located in fractions 20 to 2 6 of this peak and that gel f i l tration had eliminated most of the remaining contaminants (Figure 3.7, inset). By comparison to molecular weight standards, the rCP was eluted from the column with a v/VQ consistent with a molecular weight of 4 0-44 kDa. This suggested that the rCP was behaving as a dimer in solution since SDS-PAGE analysis has shown that the nCP has a molecular weight of 2 3 kDa. Fractions containing the rCP in high concentration, fractions 21 to 24, were pooled and concentrated in H20 (Fraction IV). A small amount of the pool was analyzed by SDS-PAGE (Figure 3.8, lane 8) and the rest was stored at -70°C for use in assembly assays. A 70 Figure 3 .6 E l u t i o n p r o f i l e of FMV CP during anion exchange chromatography Proteins from Fraction II (500 / i l , 5.4 mg/ml) concentrated in buffer A, were separated by anion exchange chromatography (see section 2.4.6). A typical U.V. absorbance profile is shown. Fractions (1.0 ml) are indicated by broken lines. Samples were taken from the fractions corresponding to the major peak of absorption at 280 nm and and separated by SDS-PAGE (inset). Fraction # 1 2 3 4 5 6 PiVIV CP Volume (mL) Figure 3.7 Elution profile of PMV CP during size exclusion chromatography Proteins from fraction III (500 /ul, 6.5 mg/ml), concentrated in buffer D, were separated by size exclusion chromatography (see section 2.4.7). A typical U.V. absorbance profile is shown. Samples were taken from the fractions corresponding to the major peak of absorption at 280 nm and separated by SDS-PAGE (inset). A standard curve for elution was determined using BSA (66 kDa), ovalbumin (45 kDa), carbonic anhydrase (31 kDa), STI (21.5 kDa), and lysozyme (14.4 kDa). Fractions (0.5 ml) are indicated by broken lines. Arrows indicate the fractions containing the peak of each standard and the fraction containing the peak of native PMV CP. *3 Fraction # 20 21 22 23 24 25 26 ^ PMV CP 9 r3 c ft £ o us © O c J 3a ^  C e > I ^ i = 1 a -Q r Sc. T — r o Volume (mL) 74 Figure 3.8 Analysis of the p u r i f i c a t i o n of PMV CP from b a c t e r i a l whole c e l l extracts by 15 % SDS-PAGE A l l samples were separated by 15 % SDS-PAGE and visualized by staining with Coomassie blue. The expression of PMV CP is shown by a comparison of non-induced cultures (lane 3) (CE-) versus cultures induced for 4.5 hours (lane 4) (CE+) (see section 2.4.5). Lane 5 shows soluble proteins after centrifugation at 30,000 x g (Fraction I) and lane 6 shows a 40 % ammonium sulfate precipitation of Fraction I (Fraction II; see section 2.4.5). Fraction III (lane 7) consists of pooled, concentrated fractions obtained from anion exchange chromatography of Fraction II (see section 2.4.6) . Fraction IV (lane 8) consists of pooled, concentrated fractions obtained from size exclusion chromatography of Fraction III (see section 2.4.7). Lane 1 is a size marker (kDa) (M) and lane 2 shows native PMV CP (nP) (the lower band is a breakdown product). M nP CE I II III IV IPTG PMV CP 1 2 3 4 5 6 7 8 76 summary of the effectiveness of the purification is illustrated in Figure 3.8. The rCP sample appeared to be homogeneous at this stage; however, when a larger scale rCP purification was performed, a few protein contaminants of bacterial origin were s t i l l present. The abundance of these contaminants varied among preparations, but the rCP was estimated to be greater than 90 % pure by SDS-PAGE (see section 2.4.1; Figure 3.9, lane 3) in every case. Approximately 1 mg of rCP was purified from a 1 l i t re culture of BL21(DE3) cells transformed with pPMVCP (see section 2.4.2; Table 3.2). Although some losses occur during pooling i t is clear that significant losses of material must be occurring during the preparations of fractions III and IV, possibly during the concentration steps. 7. Native PMV CP purification Native PMV CP was extracted from PMV virions supplied by Dr. J.B. Bancroft using a modification of the acetic acid extraction method (see section 2.4.4). SDS-PAGE analysis (see section 2.4.1) revealed the presence of a low molecular weight species which is believed to be a degradation product of the CP (data not shown). The majority of this species was removed by size exclusion chromatography (see section 2.4.7; Figure 3.9, lane 2). Native PMV CP was eluted from the column in a single peak with a v/V 0 consistent with that of rCP (40-44 KDa) indicating that i t also behaves as a dimer in solution (see Figure 3.7). Fractions containing nCP were pooled, concentrated in H20 and stored at -70°C for use in assembly assays. 77 Figure 3.9 A comparison of the purity of PMV nCP and rCP PMV nCP and rCP preparations were purified as described in the text, separated by 15 % SDS-PAGE, and visualized by staining with Coomassie blue. Lane 1 is a size marker (kDa) (M), lane 2 shows nCP and lane 3 shows rCP. 78 M nCP rCP 200 — • 116 mm 66 ZZl PMV CP 79 Table 3.2 P u r i f i c a t i o n of PMV recombinant capsid protein Fraction #* Volume (ml) Concentration (mg/ml) Total protein from 1 l i t re (mg) I 26.0 10.9 250.0 II 13.0 5.4 70.0 III 1.2 6.5 7.8 IV 1.0 1.3 1.3 Footnotes: 1. Fractions I, II, III, and IV are described in section 3.6 and Figure 3.8. 80 8. RNase Assays. Purified rCP and purified nCP were assayed for RNase activity against a synthetic 3 2P-labelled S20 mRNA substrate using the methods described by Mackie (1991). In both cases the substrate was degraded over time (50 % disappearance in 30 min; data not shown), but the addition of 25 jug/ml yeast RNA to the assay slowed this process by 2 to 3 fold or more (data not shown). 9. Viral Reconstitution. To assess the functional integrity of the purified rCP, i n vitro reconstitution was performed using the methods by Erickson and Bancroft (1978). In their hands, assembly of biologically active PMV can be achieved by mixing CP and viral RNA (20:1 by mass) in 10 mM Tris-HCl, pH 8.0. A slightly modified procedure is given in section 2.5.1. The products were monitored for the formation of v iral rods by electron microscopy (see Figure 3.10). When either rCP or nCP was mixed with PMV gRNA in 10 mM Tris-HCl, pH 8.0 incomplete viral rods that reach between 200 to 300 nm in length were formed. Similar results were obtained with the addition of 25 /xg//il yeast RNA (to suppress RNase activity) to such assays. No rods were observed when PMV gRNA, rCP or nCP were individually assayed in assembly conditions. When rCP or nCP were mixed with E. coli RNA in assembly conditions, suprisingly, rods between 500 and 600 nm were formed (data not shown). When Tl RNase was added to PMV gRNA before the addition of either rCP or nCP, no 81 Figure 3.10 Electron microscopic assessment of the r e c o n s t i t u i t i o n of PMV PMV CP (A. rCP, B. nCP) was incubated under conditions described in section 2.5.1, diluted with lOmM Tris (pH 8.0), pipetted onto 0.3 % piolaform coated copper grids, stained with 2% uranyl acetate and examined by electron microscopy. Arrows indicate typical well resolved particles. Bar represents 100 nm. 83 rods were observed and when Tl RNase was added to partially formed rods (either the rCP or nCP species), the rods were degraded into smaller particles ranging from 2 0 to 3 0 nm in length. Taken together, i t appears that assembly of an RNA-protein complex is occurring, but that the product resembles the "kinked" rods which have been documented to occur under suboptimal conditions (Erickson et a l . , 1978). 10. Infectivity Assays. As an alternative to electron microscopy for assaying the effectiveness of v iral reconstitution, we tested the ability of reconstituted particles to form local lesions on susceptible host plants (Gomphrena globosa). Unfortunately, ideal greenhouse conditions were not available (we were forced to use a window in our laboratory), therefore, only a few pilot experiments could be performed. One plant was used for each experiment and each plant was assayed on four leaves; two leaves were tested with native virus to check host susceptibility and inoculation technique and two leaves were tested with controls or assembly reactions. Leaves assayed with carborundum alone or carborundum and inoculation buffer produced no lesions, those assayed with gRNA or reconstituted particles (with nCP or rCP) did produce lesions, and those assayed with gRNA or reconstituted particles (with nCP or rCP) , but subsequently exposed to Tl RNase produced no lesions. This is further evidence of incompletely formed viral particles. C h a p t e r 4 84 Discussion 1 . Sequencing Sequencing of the ORF 5 insert in pPMVCP revealed nine previously uncharacterised nucleotide substitutions, two of which cause amino acid changes. The sequence obtained here is likely correct since that of the starting plasmid, pSQlDA3P3, agrees with i t . The high G + c content in regions of PMV ORF 5 could explain why errors were made in earlier reports. 2. P u r i f i c a t i o n and Properties of PMV Capsid Protein The purification of PMV rCP from E. coli was surprisingly straightforward. The protein was soluble, i t did not exibit any apparent toxicity, and i t could be purified to approximately 90% purity by four simple steps (centrifugation at 30,000 x g, ammonium sulphate precipitation to 40 % saturation, anion exchange chromatography, and gel f i ltration chromatography). Capsid proteins from several other positive-sense ssRNA plant viruses including TMV CP (Hwang et a l . , 1994) and CCMV CP (Zhao et a l . , 1995), have been expressed in E. coli. Despite attempts to overcome its poor behaviour, TMV CP formed non-helical stacked aggregates in E. coli, was difficult to purify, and was inactive for in vitro assembly with TMV RNA. CCMV CP, on the other hand, could be purified at least partially and formed viral particles i n 85 vitro with CCMV RNA transcribed from ful l length cDNAs. These particles were indistinguishable from native particles purified from native plants. Also, Zhao et a l . (1995) were able to recover mutant CP from E. coli and assay such mutants for reconstitution. It is interesting that PMV CP appears to behave as a dimer in solution. Both rCP and nCP were eluted from a gel f i l tration column with a v/V 0 consistent with a molecular weight almost double that demonstrated by SDS-PAGE analysis. It should be noted that no independent evidence that the capsid protein is a dimer exists and that the existence of a highly elongated monomer cannot be ruled out. If correct, our observation has interesting implications. First, models for assembly envisage CP monomers forming disks or double disks which act as intermediates in assembly (Lok and AbouHaidar, 1986). Our observation suggests that dimers rather than monomers are more likely the form in which CP enters assembly. Second, the formation of a stable dimer (or a stable elongated monomer) at high concentrations, rather than a higher aggregate begs the question of how disk structures form during the assembly process in planta. Previous data from this laboratory has implicated the product of ORF 2 from FMV, p26, as a possible assembly factor (Rouleau et a l . , 1994). PVX CP has been shown to be post translationally modified. The capsid protein from different strains of PVX displayed anomalous migration in SDS-PAGE too large to explain by differences in primary structure of the CP from these strains. Therefore, differential post-translational modification was susupected and 86 ultimately proven. Indeed, PVX CP is both acetylated (Miki and Knight, 1968) and glycosylated (Tozzini et a l . , 1994). If such modifications do occur in the case of PMV CP, they are unlikely to be necessary for viral reconstitution since PMV nCP and rCP demonstrate similar reconstitutive properties in this study and since i t is unlikely that the recombinant CP would be modified in E. coli. Moreover, PMV rCP and PMV nCP demonstrate very similar mobilities in SDS-PAGE. 3. R e c o n s t i t u t i o n PMV rCP appears to be reconstitutively active. At pH 8.0 in 10 mM Tris-HCl i t forms partial rods with purified PMV genomic RNA that reach between 200 and 300 nm in length. Similar results were obtained with PMV nCP. Full length particles (530 nm) should be formed under these conditions as demonstrated previously with the nCP (Erickson and Bancroft, 1978) but, great difficulty was experienced in obtaining optimal assembly conditions during this study. The limited availability of purified, intact v iral RNA prevented the fu l l exploration of variables such as pH and ionic strength which are known to affect assembly (Erickson and Bancroft, 1978). Moreover, assays were conducted several times and protein concentration was varied over a 2-fold range. The reasons for obtaining incomplete particles are, therefore, not clear, but suboptimal pH in the reconstitution incubation is a likely contributor for the following reasons. Previous work has shown that heterologous RNA can be encapsidated at pH lower than 8.0 87 (Erickson et a l . , 1978). Significantly, both PMV rCP and PMV nCP would encapsidate E. coli RNA in this study. Furthermore, the addition of Tl RNase to partial rods obtained with both rCP and nCP resulted in the degradation of such particles, indicating that the capsid protein in each case was not completely protecting the RNA. This suggests the formation of "kinked" rods, a behaviour known to occur between pH 6.0 and pH 7.5 (Erickson and Bancroft, 1978). Although great care was taken in preparing the buffer used in the reconstitution assays, i t is possible that contaminants in either the RNA or the protein preparations are responsible for inducing the formation of discontinuous rather than continuous rods. Attempts were also made to assay CP reconstitution by band shift (using a 3 2P-labelled transcript of the 5'-terminus of PMV RNA), however, optimum conditions were not found. When purified rCP and nCP were assayed for RNase activity against a synthetic 3 2P-labelled S-20 mRNA substrate, the substrate was degraded over time indicating the presence of RNases. The addition of 25 /xg//il of yeast RNA to such assays slowed this process by 2 to 3 fold or more; however, addition of yeast RNA to reconstitution assays in the same concentration had no effect on particle length. Thus, yeast RNA was omitted from a l l subsequent reconstitution assays. This indicates that the failure to form fu l l length PMV particles in this study may not be due to the presence of RNases in the preparations of CP. Plants inoculated with PMV RNA, or with partially formed rods from reconstitution assays with either rCP or nCP formed local 88 lesions. In contrast, plants inoculated with PMV RNA exposed to Tl RNase or with partially formed rods from RNA inoculated with either rCP or nCP and susequently exposed to Tl RNase did not form lesions. This shows that the PMV RNA used in this study was biologically active and rules out the possibility that i t was completely degraded prior to or during assembly assays. 4 . Perspectives This study has produced a system for the production of PMV CP. The protein appears to be reconstitutively active and, with a few minor adjustments, fu l l length viral particles should be attainable. Since the rCP and the nCP behave similarily in terms of v iral reconstitution, i t should be possible to conduct a systematic investigation of PMV assembly through the synthesis of mutant CPs in this system and the subsequent in vitro testing of such CPs for reconstitution with PMV gRNA. Finally, i t should also be possible to attempt to crystallize PMV CP and, i f successful, determine its three dimensional structure. R e f e r e n c e s 89 AbouHaidar, M.G., and Bancroft, J.B. (1978) The initiation of papaya mosaic virus assembly. Virology 90, 54-59. AbouHaidar, M.G. (1983) The structure of the 5'and 31 ends of clover yellow mosaic virus RNA. Can. J. Microbiol. 29, 151-156. AbouHaidar, M.G., and Erickson, J.W. (1985) Structure and in vitro assembly of papaya mosaic virus. In Molecular Plant Virology, Vol I, Davies, J.W. ed., CRC Press, Boca Raton, Florida, pp. 85-121. AbouHaidar, M.G. (1988). Nucleotide sequence of the capsid protein gene and 3' non-coding region of papaya mosaic virus RNA. J . G e n . Virol. 69, 219-226. Bancroft, J . B . , AbouHaidar, M.G., and Erickson, J.W. (1979). The assembly of clover yellow mosaic virus and its protein. Virology 89, 121-130. Bancroft, J . B . , Rouleau, M., Johnston, R., Prins, L . , and Mackie, G.A. (1991). The complete nucleotide sequence of foxtail mosaic virus RNA. J. Gen. Virol. 72, 2173-2181. Beck, D.L. , Forster, R.L.S . , Bevan, M.W., Boxen, K.A. , and Lowe, S.C. (1990). Infectious transcripts and nucleotide sequence of cloned cDNA of the potexvirus white clover mosaic virus. Virology 177, 152-158. Beck, D.L. , Guilford, P . J . , Voot, D.M., Anderson, M.T., and Forster, R.L.S. (1991). Triple gene block of white clover mosaic potexvirus are required for transport. Virology 183, 695-702. Bendena, W.G., and Mackie, G.A. (1986). Translational strategies in potexviruses: products encoded by clover yellow mosaic virus, foxtail mosaic virus and viola mottle virus RNAs in vitro. Virology 153, 220-229. Bendena, W.G., Bancroft, J . B . , and Mackie, G.A. (1987). Molecular cloning of clover yellow mosaic virus RNA: identification of coat protein coding sequences in vivo and in vitro. Virology 157, 276-284. Birnboim, H.C. , and Doly, J . (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic A c i d s Res. 7, 1513. Bloomer, A . C . , Champness, J . N . , Bricogne, G. , Staden, R. and Klug, A. (1978) . Protein disk of tobacco mosaic virus at 2.8 A resolution 90 showing the interactions within and between subunits. Nature (London) 276, 362-368. Brisco, M . J . , Hull, R. , and Wilson, T.M.A. (1986). Swelling of isometric and bascilliform plant virus nucleocapsids is required for virus-specific protein synthesis in vitro. Virology 148, 210-217. Butler, P .J .G . , Finch, J . T . , and Zimmern, D. (1977). Configuration of tobacco mosaic virus RNA during virus assembly. Nature (London) 265, 217-219. Butler, P.J.G. and Lomonossoff, G.P. (1978) . Quantized incorporation of RNA during assembly of tobacco mosaic virus from protein disks. J. Moi. Biol. 126, 877-882. Butler, P.J.G. (1984). The current picture of the structure and assembly of tobbacco mosaic virus. J. Gen. Virol. 65, 253-279. Chapman, S., Hi l l s , G. , Watts, J . , and Baulcombe, D. (1992). Mutational analysis of the coat protein gene of potato virus X: effects on virion morphology and viral pathogenicity. Virology 191, 223-230. Chapness, J . N . , Bloomer, A . C . , Bricogne, G. , Butler, P . J . G . , and Klug, A. (1976) . The structure of the protein disk of tobacco mosaic virus to 5 A resolution. Nature (London) 259, 20-24. Costa, A.S. , and Kitajima, E.W. (1972) Cassava common mosaic virus. CMI/AAB D e s c r i p t i o n s of Plant V i r u s e s , N° 90. David, C. , Radhia, G. , and Haenni, A. (1992). RNA replication of plant viruses containing an RNA genome. P r o g r e s s in Nucleic A c i d R e s e a r c h and Molecular B i o l o g y 42, 157-227. Deom, C M . , Lapidot, M. , and Peachy, R.N. (1992). Plant virus movement proteins. Cell 69, 221-224. Ding, S..-W., Gibbs, A. , and Keese, P. (1990). The nucleotide sequence of the genomic RNA of kennedya yellow mosaic tymovirus-Jervis Bay isolate: Relationships with potex- and carlaviruses. J . Gen. Virol. 71, 925-931. Dolya, V .V. , Grama, D.P., Morozov, S.Yu., and Atabekov, J .G. (1987). Potato virus X-related single- and double-stranded RNAs. F E B S Lett. 214, 308-312. Dolja, V.V. , Boyko, V.P. , Agranovsky, A.A. , and Koonin, E.V. (1991) Phylogeny of capsid proteins of rod-shaped and filamentous RNA plant viruses: two families with distinct patterns of sequence and probably structure conservation. Virology 184, 79-86. 91 Dumas, P., Moras, D. , Florentz, C. , Giege, R. , Verlaan, 0. , van Belkum, A. , and Plei j , C.W.A. (1987). 3D graphics modelling of the tRNA-like 3'-end of turnip yellow mosaic virus RNA: Structural and functional implications. J. Biomol. Struct. Dyn. 4, 707-728. Dunn, S.D. (1986). Effects of the modification of transfer buffer composition and the renaturation of proteins in gels in the recognition of proteins on western blots by monoclonal antibodies. Anal. Biochem. 157, 144-153. Durham, A.C.H. , Finch, J . T . , and Klug, A. (1971). States of aggregation of tobacco mosaic virus protein. Nature (London), New Biol. 229, 37-42. Erickson, J.W., Bancroft/ J . B . , and Home, R.W. (1976). The assembly of papaya mosaic virus protein. Virology 72, 514-517. Erickson, J.W., and Bancroft, J.B. (1978). The self-assembly of papaya mosaic virus. Virology. 90, 36-4 6. Erickson, J.W., AbouHaidar, M.G., and Bancroft, J .B. (1978). The specificity of papaya mosaic virus assembly. Virology 90, 60-66. Erickson, J.W., Hallet, F.R., and Bancroft, J .B. (1983). Subassembly aggregates of papaya mosaic virus protein. Virology 129, 207-211. Forster, R.L.S . , Beck, D.L. , Guilford, P . J . , Voot, D.M., van Dolleweerd, C . J . , and Andersen, M.T. (1992). The coat protein of white clover mosaic potexvirus has a role in fascilitating cell-to-cel l transport in plants. Virology 191, 480-484. Fraenkel-Conrat, H. (1957). Degradation of tobacco mosaic virus with.acetic acid. Virology 4, 1-4. Goldbach, R., and Wellick, J . (1988). Evolution of plus-strand RNA viruses. Intervirology 29, 260-267. Goldbach, R. , Le Gall , 0., and Wellink, J . (1991). Alpha-like viruses in plants. Seminars in Virology 2, 19-25. Goodman, R.M., Home, R.W., and Hobart, J.M. (1975). Reconstitution of potato virus X in vitro. Characterization of the reconstituted product. Virology 68, 299-308. Gorbalenya, A . E . , Koonin, E.V. , Donchenko, A.P. , and Blinov, V.M. (1988). A novel superfamily of nucleoside triphosphate-binding motif containing proteins which are probably involved in duplex unwinding in DNA and RNA replication and recombination. FEBS Lett. 235, 16-24. Gorbalenya, A . E . , Bliov, V.M., Donchenko, A.P. and Koonin, E.V. 92 (1989). An NTP-binding motif is the most conserved sequence in a highly diverged monophyletic group of proteins involved in positive-strand RNA replication. J. Moi. Evol. 28, 256-268. Goth, R.W. (1962). Aphid transmission of white clover mosaic virus. Phytopathology. 52, 1228. Guilford, P . J . , and Forester, R.L.S. (1986). Detection of polyadenylated subgenomic RNAs in leaves infected with the potexvirus daphne virus X. J. Gen. Virol. 67, 83-90. Guilford, P . J . , Beck, D.L. , and Forester, R.L.S. (1991) Influence of the poly(A) t a i l and putative polyadenylation signal on the infectivity of white clover mosaic potexvirus. Virology 162, 61-67. Guilley, H. , Jonard, G. , Kukla, B. and Richards, K.C. (1979). Sequence of 1000 nucleotides at the 31-end of tobacco mosaic virus RNA. Nucleic A c i d s Res. 6, 1287-1308. Harlow, E. and Lane, D. (1988). Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Hefferon, K . L . , Fakhrai, H . , and AbouHaidar, M.G. (1994). Initiation of translation of the potato virus X coat protein in transgenic potato plants by internal ribosome binding. Abstract W16-1, 13th annual meeting of the American Society for Virology, Madison, Wisconsin. Hirth, L . , and Richards, K.E. (1981). Tobacco mosaic virus: model for structure and function of a simple virus. A d v a n c e s in Virus R e s e a r c h 26, 145-199. Holy, S., and AbouHaidar, M.G. (1993) Production of infectious i n vitro transcripts from a full-length clover yellow mosaic virus cDNA clone. J. Gen. Virol. 74, 781-784. Huang, D, Roberts, I .M., and Wilson, T.M.A. (1994). Expression of tobacco mosaic virus coat protein and assembly of pseudovirus particles in E s c h e r i c h i a coli. Proc. Natl. Acad. Sci. 91, 9067-9071. Huibregtse, J . M . , and Engelke, D.R. (1991). Direct sequencing and footprint analysis of yeast DNA by primer extension. Methods in E n z y m o l o g y 194, 550-562. Jardetsky, 0., Akasaka, K., Vogel, D., Morris, S., and Holmes, K.C. (1978) . Unusual segmented f lexibil i ty in a region of tobacco mosaic virus coat protein. Nature (London) 273, 564-566. Jelkmann, W., Maiss, E . , and Martin, R.R. (1992) The nucleotide sequence and ggenome organization of strawberry mild yellow edge-associated potexvirus. J. Gen. Virol. 73, 475-479. 93 Kamer, G. and Argos, P. (1984) Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses. Nucleic A c i d s Res. 12, 7269-7280. Koenig, R., and Lesemann, D.-E. (1978) Potexvirus group. CMI/AAB D e s c r i p t i o n s of Plant V i r u s e s , N° 200. Koenig, R. , and Lesemann, D.-E. (1989). Potato virus X. CMI/AAB D e s c r i p t i o n s of Plant V i r u s e s , N° 354. Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Lebeurier, G. , Nicolaieff, A. , and Richards K . E . , (1977). Inside-out model for self-assembly of tobacco mosaic virus. PNAS, U.S.A. 74, 149-153. Lesemann, D.-E. (1985). Cytopathology. In The plant viruses, Vol 4., Milne, R.G. , ed., Plenum Press, New-York, pp. 179-235. Lesemann, D . - E . , and Koenig, R. (1977). Potexvirus (Potato Virus X) Group. In The Atlas of Insect and Plant V i r u s e s , Maramorosch, M., ed., Academic Press, New York, pp. 331-339. Lok, S., and AbouHaidar, M.G. (1986). The nucleotide sequence of * the 5*end of papaya mosaic virus RNA: site of in vitro assembly initiation. Virology 153, 289-296. Mackie, G.A., Johnston, R. , and Bancroft, J . B . , (1988). Single- and double-stranded viral RNAs in plants infected with the potexviruses papaya mosaic virus and foxtail mosaic virus. Intervirol. 29, 170-177. Mackie, G.A. (1991). Specific endonucleolytic cleavage of the mRNA for ribosomal protein S20 of E s c h e r i c h i a coli requires the product of the ams gene in vivo and in vitro. J. Bacterid. 173, 2488-2497 Maniatis, T . , Fritsch, E . F . , and Sambrook, J . (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Matthews, R.E.F. (1991). Plant virology. 3rd edition, Academic press, San Diego, California. Memelink, J . , van der Vlugt, C.I .M., Linthorst, H.J.M., Derks, A . F . L . M . , Asjes, C . J . , and Bol, J .F . (1990). Homologies between the genomes of a carlavirus ( l i ly symptomless virus) and a potexvirus ( l i ly virus X) from l i l y plants. J. Gen. Virol. 71, 917-924. Miki, T . , and Knight C A . (1968). The protein subunit of potato virus X. Virology 36, 168-173. 94 Morozov, S.Yu., Lukasheva, L . I . , Chernov, B.K., Skryabin, K.G. , and Atabekov, J .G. (1987). Nucleotide sequence of the open reading frames adjacent to the coat protein cistron in potato virus X genome. F E B S Lett. 213, 438-442. Morozov, S.Yu., Dolja, V.V. , and Atabekov, J .G. (1989). Probable reassortment of genomic elements among elongated RNA-containing plant viruses. J. Moi. Evol. 29, 52-62. Mushegian, A.R., and Shepherd, R.J. (1995). Genetic elements of plant viruses as tools for genetic engineering. Microbiol. Rev. 59, 548-578. Namba, K. , and Stubbs, G. (1986). Structure of tobacco mosaic virus at 3.6 A resolution: Implications for assembly. S c i e n c e 227. 773-776. Namba, K. , Pattanayek, R., and Stubbs, G. (1989). Visualization of protein-nucleic acid interactions in a virus. Refined structure of intact tobacco mosaic virus RNA at 2.9 a resolution by X-ray fibre diffraction. J. Moi. Biol. 208, 307-325. Purcifull, D.E. , and Hiebert, E. (1971). Papaya mosaic virus. C.M.I/A.A.B. D e s c r i p t i o n s of Plant V i r u s e s , N°.56. Rozanov, M.N., Koonin, E .V. , and Gorbalenya, A.E. (1992). Conservation of the putative methyltransferase domain: a hallmark of the "sindbis-like" supergroup of positive-strand RNA viruses. J . Gen. Virol. 73, 2129-2134. Rouleau, M. (1994). A study of foxtail mosaic potexvirus. Ph.D. Thesis, University of Western Ontario, Ontario, Canada. Rouleau, M. , Bancroft, J . B . , and Mackie, G.A. (1994). Partial purification and characterization of foxtail mosaic potexvirus RNA-dependent RNA polymerase. Virology 197, 695-703. Rouleau, M., Smith, R . J . , Bancroft, J . B . , and Mackie, G.A. (1995). Subcellular immunolocalization of the coat protein of two potexviruses in infected C h e n o p o d i u m quinoa. Virology 214, 314-318. Sambrook, J . , Fritsch, E . F . , and Maniatis, T. (1989) Molecular C l o n i n g : A Laboratory Manual. 2nd ed. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, New York. Schalla, T .A. , and Shepard, J . F . (1972). The structure and antigenic analysis of amorphous inclusion bodies induced by potato virus X. Virology 49, 654-667. Shaw, J .G. (1996). Plant viruses. In Fields Virology, Fields, D.M. ed., Raven Publishers, Philadelphia, pp. 499-532. 95 Short, M.N., and Davies, J.W. (1987). Host ranges, symptoms and amino acid compositions of eight potexviruses. Ann. Appl. Biol. 110, 213-219. Sit, T . L . , White, K.A, Holy, S., Padmanabhan, U. , Eweida, M. , Hiebert, M., Mackie, G.A., and AbouHaidar, M.G. (1990). Complete nucleotide sequence of clover yellow mosaic virus RNA. J . Gen Virol. 71, 1913-1920. Sit, T . L . , Leclerc, D. , and AbouHaidar, M.G. (1994). The minimal 5'dequence for in vitro initiation of papaya mosaic potexvirus assembly. V i r o l o g y 199, 238-242. Skryabin, K.G, Kraev, A.S. , Morozov, S., Yu. , Rozanov, M.N. , Chernov, B.K., Lukasheva, L . I . , and Atabekov, J .G. (1988a). The nucleotide sequence of potato virus X RNA. Nucleic A c i d s Res. 16, 10929-10930. Skryabin, K.G, Morozov, S., Yu., Kraev, A.S . , Rozanov, M.N. , Chernov, B.K., Lukasheva, L . I . , and Atabekov, J .G. (1988b). Conserved and variable elements in RNA genomes of potexviruses. F E B S Lett. 240, 33-40. Smith, D.P., Johnston, E.M., Lit t le , S.P., and Hsiung, H.M. (1990). Direct DNA sequencing of cDNA inserts from plaques using the linear polymerase chain reaction. B i o T e c h n i q u e s 9, 48-54. Sonenberg, N. , Shatkin, A . J . , Riccardi, R.P., Rubin, M. , and Goodman, R.M. (1978). Analysis of terminal structures of RNA from potato virus X. Nucleic A c i d s Res. 5, 2501-2521. Toll in, P., Bancroft, J . B . , Richardson, J . F . , Payne, N.C., and Beveridge, T . J . (1979). Diffraction studies of papaya mosaic virus. V i r o l o g y 98, 108-115. Tozzini, A . C . , Ek, B. , Palva, E . T . , and Hopp, H.E. (1991). Potato virus X coat protein: a glycoprotein. V i r o l o g y 202, 651-658. Turner, D.R., and Butler, P.J.G. (1986). Essential features of the assembly origin of tobacco mosaic virus RNA as studied by directed mutagenesis. Nucleic A c i d Res. 14, 9229-9242. Turner, D.R., Joyce, L . E . , and Butler P.J.G. (1988). The tobacco mosaic virus assembly origin RNA; Functional characteristics defined by directed mutagenesis. J. Moi. Biol. 203, 531-547. van Belkum, A. , Verlaan, P., Bing Kun, J . , Plei j , C , and Bosch, L. (1987). Temperature dependent chemical and enzymatic probing of the tRNA-like structure of TYMV RNA. Nucleic A c i d s Res. 16, 1931-1950. Voet, D. and Voet, J.D. (1995). B i o c h e m i s t r y , 1st ed. John Wiley and Sons, Inc.: Toronto, pp.1074-1074. 96 White, K.A. (1992) . Genome organization, replication and defective RNAs of clover yellow mosaic virus. Ph.D. thesis, University of Western Ontario, Ontario, Canada. White, K.A. , Bancroft, J . B . , and Mackie, G.A. (1992b) Mutagenesis of a hexanucleotide sequence conserved in potexvirus RNAs. Virology 189, 817-820. White, K.A. , Rouleau, M. , Bancroft, J . B . , and Mackie, G.A. (1994). Potexviruses. In The E n c y c l o p e d i a of Virology, Academic Press, New York. pp.1142-1147. Wilson, T.M.A.,(1985). Nucleocapsid disassembly and early gene expression by positive-strand RNA viruses. J. Gen. Virol. 66, 1201-1207. Wilson, T.M.A, and Shaw, J .G. (1987). Cotranslational disassembly of filamentous plant virus nucleocapsid in vitro and in vivo. In Positive strand R N A viruses, UCLA Symposia on Molecular and Cellular Biology New Series, Vol. 54, Brinton, M.A. and Rueckert, R.R. eds., Alan R. Liss, New york, pp. 159-181. Zaccomer, B. , Haenni, A. , and Macaya, G. (1995). The remarkable variety of plant RNA virus genomes. J. Gen. Virol. 76, 231-247. Zaitland, M., and Hull, R. (1987). Plant virus-host interactions. Annu. Rev. Plant Physiol. 38, 291-315. Zimmern, D. and Wilson, T.M.A. (1976). Location of the origin for v ira l assembly on tobacco mosaic virus RNA and its relation to stable fragment. F E B S Lett. 71, 294-298. Zimmern, D. (1983). An extended secondary structure model for the TMV assembly origin , and its correlation with protection studies and an assembly defective mutant. EMBO J. 2, 1901-1907. Zhao, X. , Fox, J.M. Olson, N.H., Baker, T.S . , and Young, M.J. (1995). In vitro assembly of cowpea chlorotic mottle virus from coat protein expressed in E s c h e r i c h i a coli and in vitro-transcribed v ira l cDNA. Virology 207, 486-494. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099138/manifest

Comment

Related Items