Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Conversion of subtilisin E to thiolsubtilisin by site-directed mutagenesis Chen, Lu 1994

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1994-0258.pdf [ 2.45MB ]
Metadata
JSON: 831-1.0099112.json
JSON-LD: 831-1.0099112-ld.json
RDF/XML (Pretty): 831-1.0099112-rdf.xml
RDF/JSON: 831-1.0099112-rdf.json
Turtle: 831-1.0099112-turtle.txt
N-Triples: 831-1.0099112-rdf-ntriples.txt
Original Record: 831-1.0099112-source.json
Full Text
831-1.0099112-fulltext.txt
Citation
831-1.0099112.ris

Full Text

CONVERSION OF SUBTILISIN E TO THIOLSUBTILISINBY SITE-DIRECTED MUTAGENESISbyLU CHENB.Sc. (Chemistry), Shanghai TeacherstUniversity, Shanghai, China, 1984A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTSFOR THE DEGREE OF MASTER OF SCIENCEinTHE FACULTY OF GRADUATE STUDIES(Department of Food Science)We accept this thesis as conformingto the required standardTHE UNIVERSITY OF BRITISH COLUMBIAApril 1994© Lu Chen, 1994In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.(Signature)Department of CC2 JE!iThe University of British ColumbiaVancouver, CanadaDate /I2,,l’ /DE6 (2/88)AbstractThis thesis presents a procedure of site specific mutagenesis of subtilisin E for reducing itsproteolytic activity while retaining its ligase activity in peptide synthesis. A host-vectorsystem was chosen to conduct the DNA manipulation and the gene expression. SubtilisinB gene (aprE) cloned on the plasmid DNA pAP65 was subcloned to a phagemid DNApUC1 18 to facilitate KunkePs oligonucleotide directed mutagenesis. A new plasmid DNApAP65D was developed from pAP65 and used to harbor subtilisin E gene andthiolsubtilisin gene. As a host cell, the B. subtilis DB428 strain, which is deficient in threemajor extracellular protease genes, was transformed with the plasmid DNA for expressingsubtilisin E gene and thiolsubtilisin gene. By using this procedure, one of the catalyticactive site residues on subtilisin E, serine 221, was replaced by a cysteine residue; thus amutant product, thiolsubtilisin, was obtained. DNA sequencing confirmed both thesubtilisin E gene on pAP65D8 and thiolsubtilisin gene on pAP65D8M. An improvedtransformation method with higher transformation efficiency was derived.The proteolytic activities of subtilisin E and thiolsubtilisin were compared. The B.subtilis transformants with pAP65D8 containing aprE and pAP65D8M containingthiolsubtilisin gene, developed halos around the colonies on skim milk agar plates.However, the halo produced by colonies with thiolsubtilisin gene was smaller than thosewith aprE. Subtiisin E and thiolsubtilisin secreted into the culture media were thensubjected to a proteolytic activity assay. The proteolytic activity measurement, by usingSuccinyl-Ala-Ala-Pro-Phe-p-nitroanilide as a substrate, showed that the proteolyticactivity of thiolsubtilisin was about 30% of that of subtiisin E, when culture supernatantswere assayed.The ligase activity of subtilisin E and thiolsubtilisin was initially planned to bemeasured by using a solid phase detection method. However, the solid phase detectionmethod failed in this case due to the fact that the enzymes react with the antibody used inthe method. As a preliminary test, the ligase activities of subtilisin E and subtilisinCarlsberg were investigated. It was found that both enzymes can catalyze the formation ofthe dipeptide Z-L-Phe-Met-O-Me. HPLC was found to be able to detect such formation.Further study on the ligase activity of subtilisin B and thiolsubtilisin is suggested.IITable of ContentsAbstract.iiTable of Contents iiiList of Tables viList of Figures viiAcknowledgments ixChapter 1 Introduction 11.1. Background 11.1.1. Protein Engineering for Peptide Synthesis 11.1.2. Long-Term Objective 31.2. Thesis Objective 4Chapter 2 Literature Review 62.1. Subtiisin 62.1.1. SubtilisinE 62.1.2. The Catalytic Properties of Subtiisin 62.1.3. Use of Subtilisin for Enzymatic Peptide Synthesis 72.1.4. Thiolsubtilisin 102.1.5. Other Studies Of Thiolsubtilisin 132.2. Protein Engineering of Subtilisin 152.2.1. Site-Directed Mutagenesis 152.2.2. Kunkel’s Site-directed Mutagenesis 162.2.3. Vector and Host 172.2.4. Site-directed Mutagenesis for the Studies of Subtilisin 182.3. Proteolytic Activity Assay 222.4. Detection of Peptide Bond Formed by Enzymatic Synthesis 221112.5. DNA Sequencing.23Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 253.1. Materials 253.1.1. Plasmid DNA, Bacterial Strain, and Bacteriophage 253.1.2. Enzymes 253.1.3. Chemicals 263.2. Methods 273.2.1. Media Preparation 273.2.2. DNA Digestion with Restriction Endonucleases 273.2.3. Agarose Gel Electrophoresis 273.2.4. Plasmid DNA Preparation 273.2.5. Purification of DNA Fragments from Restriction Enzyme Digestion 313.2.6. Ligation of DNA Fragment to Vector 333.2.7. Transformation of Escherichia coli 343.2.8. Transformation of Bacillus subtilis 353.2.9. Site Directed Mutagenesis 383.2.10. DNA Sequencing 413.2.11. Proteolytic Activity Assay 433.2.12. SDS-PAGE Electrophoresis (Phast System) 451) Production of crude enzymes 452) Preparation of crude enzyme from culture supernatant 463) SDS-PAGE electrophoresis 463.3. Results and Discussion 473.3.1. Site-Directed Mutagenesis 471) Construction of pLC658 472) Mutation and Mutant 523.3.2. Expression of Subtilisin E Gene and Thiolsubtilisin Gene 57iv1) P1asmidDNApAP65D .572) Plasmid DNA pAP65D8 and pAP65D8M.593.3.3. DNA Sequencing 643.3.4. Production of Subtilisin E and Thiolsubtilisin 673.3.5. Proteolytic Activity Comparison 72Chapter 4 Ligase Activity Assay Method 754.1. Materials 754.2. Detection Methods for Peptide Formation 754.2.1. HPLC Method for Dipeptide Formation Detection 754.2.2. Solid Phase Method for Dipeptide Formation Detection 764.3. Results and Discussion 824.3.1. HPLC Detection of the Phe-Met Bond Formation 824.3.2. The Failure of the Solid Phase Detection 94Chapter 5 Conclusions and Recommendations 96References 99Appendix 107A. Composition of Media and Buffers 107A.1. Media 107A.2. Buffers 108B. Glossary 109C. DNA Sequence of Subtilisin E and Thiolsubtilisin Genes 110D. Blue Script KS plus Map 113VList of TablesTable 3.1: Composition of the solutions used in the plasmid DNA preparation 30Table 3.2: Media composition for Bacillus subtilis transformation 37Table 3.3: Nucleotide sequences of two primers used for site-directedmutagenesis 55Table 3.4: Proteolytic activity comparison 74Table 4.1: Buffers and solutions for solid phase detection 79Table 4.2: Solid phase detection: absorbance at 492 nm 95viList of FiguresFigure 3.1: Nucleotide sequence of aprE and amino acid sequence 48Figure 3.2: Construction route for pLC658 49Figure 3.3: Gene features of pUC1 18 50Figure 3.4: Gel electrophoresis of pLC658 digestion pattern 53Figure 3.5: Comparison of digestion patterns of pLC658 and pLC658M 56Figure 3.6: Hind III digestion pattern of pAP65 58Figure 3.7: Construction route of pAP65D8 and pAP65D8M 61Figure 3.8: Agar plate pictures of transformants 62Figure 3.9: Hind ifi and Nsi I digestion pattern of pAP65 and pAP65D, 63pAP65D8 and pAP65D8M.Figure 3.10: Recombinant plasmid construction route for DNA sequencing 65Figure 3.11: DNA sequence of subtilisin E and thiolsubtilisin genes at 221 site 66regionFigure 3.12: Growth and protease production curves of B. subtilis 69transformantsFigure 3.13a: Subtilisin E and thiolsubtilisin on SDS-gel electrophoresis 70Figure 3.13b: Subtilisin Eon SDS-gel electrophoresis 71Figure 4.1: Reaction scheme for coupling Met on the Covalink”>NH” plate 80Figure 4.2: Enzymatic DNP-Phe-Met formation scheme 81Figure 4.3: HPLC chromatogram of mobile phase with gradient 0-65% 84acetonitrileFigure 4.4: HPLC chromatogram of 20 IlL 80% methanol with gradient 0-65% acetonitrile 85Figure 4.5: HPLC chromatogram of 20 tL 1.63 mg/mL Met-O-Me in 80%methanol with gradient 0-65% acetomtrile 86viiFigure 4.6: HPLC chromatogram of 20 pL 6.99 mg/mL Z-L-Phe in 80%methanol with gradient 0-65% acetonitrile 87Figure 4.7: HPLC chromatogram of 20 .tL 7.57 mg/mL Met-O-Me and 1.70mg/mL Z-L-Phe in 80% methanol with gradient 0-65% acetonitrile 88Figure 4.8: HPLC chromatogram of the reaction control of Z-L-Phe-Met-OMe enzymatic synthesis (without subtilisins) 89Figure 4.9: HPLC chromatogram of the reaction control of Z-L-Phe-Met-OMe enzymatic synthesis (without substrates, Met-O-Me, and Z-LPhe but with subtilisin E) 90Figure 4.10: HPLC chromatogram of the reaction control of Z-L-Phe-Met-OMe enzymatic synthesis (without substrates, Met-O-Me, and Z-LPhe but with subtilisin Carlsberg) 91Figure 4.11: HPLC chromatogram of enzymatically synthesized Z-L-Phe-Met0-Me catalyzed by subtilisin E 92Figure 4.12: HPLC chromatogram of enzymatically synthesized Z-L-Phe-Met0-Me catalyzed by subtilisin Carlsberg 93Figure C. 1: DNA sequence of subtilisin E around 221 site 111Figure C.2: DNA sequence of thiolsubtilisin around 221 site 112vifiAcknowledgmentsI would like to express gratitude to my supervisors, Dr. S. Nakai and Dr. E.C.Y.Li-Chan. Their guidance and encouragement have made this project an enjoyableexperience and their financial assistance has allowed me to participate in this project.I would express my appreciation to other members in my committee: Dr. R.T.A.MacGillivray and Dr. R.A.J. Warren.Thanks are due to all members and visitors of the Department of Food Science,especially to Dr. A. Matsuyama and Dr. R. Yada for their helpful guidance, suggestionsand discussions. Many thanks to Mr. S. Yee and Mrs. V. Skura for providing lab suppliesand equipments and to Ms. A. Maxwell of the Department of Biochemistry for her helpwith the DNA sequencing. Thanks to Mrs. A. Gerber for her proofreading of this thesis.Also, I would like to thank the R&D division of Kikkoman Corporation, OsakaUniversity, the Department of Biochemical Science at the University of Calgary and theDepartment of Biochemistry at the University of British Columbia for the materialsreceived.Finally, I wish to thank my husband, Jian-ming, for his patience and support.ixChapter 1Introduction1.1. Background1.1.1. Protein Engineering for Peptide SynthesisPeptide synthesis is used for improving the functional properties and the nutritional qualityof food proteins. This synthesis can be achieved by both chemical and enzymatic methods.However, the enzymatic synthesis of peptides is preferable to the chemical approach, sinceenzymes promote chemical reactions with an enhanced reaction rate and provide uniquestereo- and regio-specificity. Therefore, in the case of enzymatic synthesis, the reactionsneed no protection from production of side reaction products, which may facilitate thepurification procedures for the reaction products. In addition, the enzymatic reaction canbe carried out under mild conditions, thereby, being favorable in meeting the requirementsof food safety regulation.Unfortunately, it is still controversial whether the enzymatic synthesis, whichmediates in vivo peptide bond formation, can be achieved in preparative scale. Further toother drawbacks, there is no commercial enzymatic production of peptides. In the pastdecade, the enzymatic peptide synthesis has been attempted by using proteases(proteolytic enzymes) as catalysts. Although for nearly a century, the proteases have beenutilized mainly for their proteolytic activity, they also possess an ability to catalyze thesynthesis of peptide bonds. The activity of proteolytic enzymes used for the peptidesynthesis is often referred to as ligase activity. There are a number of reports of successfulprotease-catalyzed peptide synthesis (for recent reviews, see Kullmann, 1987 and Wong,1992).However, the formation of peptide bonds using catalysis by proteolytic enzymesoften suffers from low efficiency due to the proteolytic nature of these enzymes. There1Chapter 1 Introduction 2have been many attempts made to improve the efficiency of the enzymatic peptidesynthesis including the use of optimized reaction conditions as well as the equilibriumcontrolled and kinetically controlled reactions.Lee (1992) synthesized sweet aspartyl dipeptide analogs Z-L-Asp-Tyr-OMe andZ-L-Asp-Met-OMe by catalysis with thermolysin. However, the optimized yields ofdipeptide synthesis were 2 % for Z-L-Asp-Tyr-OMe and 9 % for Z-L-Asp-Met-OMe.Subtilisin has frequently been used for peptide synthesis. For example, subtilisin BPN’ wasused for ribonuclease A resynthesis (Homandberg and Laskowski, 1979), and recently forthe N- and 0-linked glycopeptides (Wong et al., 1993). Although increasingconcentrations of organic solvents were used, the peptide yields were still low.The study on thiolsubtilisin, a mutant subtilisin at its active site 221, has firstrevealed the different catalytic activity from subtilisin for peptide hydrolysis (for a review,see Philipp and Bender, 1983). Later, this variant subtilisin bearing the mutation of Ser221 with Cys, was found to be a potential enzyme for the peptide synthesis, because itretained some of the ligase activity, while it greatly reduced the proteolytic activity(Nakatsuka, 1987). Thiolsubtilisin was originally produced from subtilisin BPN’ through achemical modification process.It is now feasible to introduce any specific changes in the amino acid sequence of aprotein via site-directed mutagenesis. Site-directed mutagenesis can create a novel proteinwith the smallest possible change in structure that nature would allow: the substitution ofone amino acid side chain with another. The general procedures of site directedmutagenesis are: the synthetic mutagenic oligonucleotide, usually containing a newrestriction site for later selection, is annealed to the template DNA containing the gene tobe mutated. A DNA polymerase (Klenow fragment, lacking the proofreading function) isthen used in in vitro complementary strand synthesis and DNA ligase is used to ligate thenascent chain to the end of the mutagenic oligonucleotide forming a partial heteroduplex.The DNA is then transferred to competent Escherichia coil giving rise to colonies withChapter 1 Introduction 3either the mutant or wild type gene. The colonies are then randomly selected for analysisof the DNA by digestion with restriction enzymes, followed by agarose gelelectrophoresis. Finally, the colonies with the mutated gene are selected.In 1991, in order to study the peptide synthesis activity of thiolsubtilisin, one moremutation was introduced at site 225 on thiolsubtilisin from subtilisin BPN’, and it wasfound that the double mutant in which two amino acids are mutated (S221C and P225A)showed 10-fold higher peptide ligase activity along with at least 100-fold lower amidaseactivity than the original thiolsubtilisin (Abrahmsen et al., 1991).1.1.2. Long-Term ObjectiveThe long-term objective of our research group is to apply a computer-aided optimizationto protein engineering techniques in order to modify enzymes for peptide synthesis.Subtilisin £ was chosen as our study subject for the following reasons: First, subtilisin Ebelongs to the subtilisin family. Its DNA sequence is 80% homologous to the Bacillusamyloliquefaciens subtilisin gene, and the translated mature coding sequence is 85%homologous to the protein sequence of subtilisin BPN1 (Stahl and Ferrari, 1984). Recently,subtilisin E has shown its use in the protein engineering study. Secondly, the availability ofsubtilisin E gene enabled us to start the subtiisin modification immediately. Furthermore,subtilisin E can meet the requirements for the study of structure-function relationship,because it has a known three-dimensional structure, an available expression system for theprotein, a well characterized mechanism, a relatively simple, accurate and precise assayand a variety of different substrates (Alvaro and Russell, 1991).At the moment, the following objectives were set for our research group, 1)Subtilisin E was to be converted into thiolsubtilisin by site-directed mutagenesis; 2)Thiolsubtilisin would be further mutated by random mutagenesis; 3) Based on theinformation collected in 1) and 2), optimization is to be applied to direct the mutagenesisto produce more efficient mutants for peptide synthesis.Chapter 1 Introduction 41.2. Thesis ObjectiveThe objective of my M.Sc. thesis was to convert subtilisin E to thiolsubtilisin by site-directed mutagenesis. To achieve this conversion, the following specific objectives were tobe met: 1) Subtiisin E was to be converted to thiolsubtilisin; 2) The proteolytic activity ofsubtilisin E and thiolsubtilisin was to be measured and compared by using the tetrapeptideSuccinyl-Ala-Ala-Pro-Phe-p-NA as a substrate; and 3) The ligase activity of subtiisin Eand thiolsubtilisin was to be measured and compared by using a solid-phase detectionmethod.Thiolsubtilisin was produced by converting the catalytic site of subtilisin E Ser 221to Cys. Kunkel’s oligonucleotide mediated mutagenesis was used to generate the mutantgene of subtiisin E. In the host-vector system, the plasmid DNA pUC 118 and Escherichiacoli were used as a cloning vector to manipulate subtilisin E gene in vitro. The bacterialstrain Bacillus subtilis DB428 deficient in three major extracellular protease genes wasused as a host cell to express the gene in vivo. In addition, the DNA sequences ofsubtilisin E gene and thiolsubtilism gene were sequenced by the S anger sequencingmethod.The proteolytic activity of the wild type and mutant enzyme was measured by thechanges in absorbance at 410 nm over time upon the hydrolysis of the tetrapeptidesuccinyl-Ala-Ala-Pro-Phe-pNA in the presence of the enzymes (Delmar et al., 1979).Since the solid phase detection method was not successful to measure the ligaseactivity, the Phe-Met bond linkage formation through the activity of commerciallyavailable subtilisin E and subtilisin Carlsberg was investigated using the HPLC detectionmethod instead, due to the time limition. The Phe-Met bond was chosen to be studied,because this bond is present in ic-casein, a polypeptide which is 169 residues in length. ICcasein is specifically hydrolyzed by chymosin between Phe 105 and Met 106 into twoChapter 1 Introduction 5fragments, para ic-casein and glycomacropeptide. Our group has attempted to usesubtilisin to resynthesize the ic-casein, but has not yet succeeded in the condensation ofthese large fragments. Because of the time limitation in this thesis, only Phe-Met dipeptidebond formation using the activity of subtilisin was investigated.Chapter 2Literature Review2.1. Subtilisin2.1.1. SubtilisinESubtiisin is a group of bacterial serine proteases that are produced by the Bacillus genus.There are several kinds of subtilisins including subtilisin BPN’ from Bacillusamyloliquefaciens, subtilisin Carlsberg from Bacillus lichenfonnis and Bacillus pumilis,and subtilisin Amylosacchariticus from Bacillus amylosacchariticus (Maridand, Jr. andSmith, 1971). Recently, subtilisin J from Bacillus stearothermophilus was cloned (Jang etal., 1992). Among these subtilisins, subtilisin BPN’ and Carlsberg have been well studied.One important industrial application is to use subtilisins as additives in detergents.Subtilisin E gene (aprE) was cloned and sequenced in 1984 from the Bacillussubtilis 1168 strain. It was found that the DNA sequence of the gene is 80% homologousto the Bacillus amyloliquefaciens subtilisin structural gene, and the translated maturecoding sequence is 85% homologous to the published protein sequence of subtilisin BPN’(Stahl and Ferrari, 1984). Like subtilisin BPN’ (Power et al., 1986), subtilisin E issynthesized in Bacillus subtilis as a zymogen (i.e. a preprosubtilisin), and later secretedextracellularly as a mature subtilisin. The preprosubtilisin E consists of a 29-amino-acidsignal peptide “pre” sequence, a 77-amino-acid “pro” sequence which is a hydrophilicfragment with 36% charged residues, and a 275-amino-acid mature protein. Wong andDoi (1986) determined the signal cleavage site in the preprosubtilisin of Bacillus subtilis.2.1.2. The Catalytic Properties of SubtilisinSubtilisins are proteases with both esterolytic and proteolytic activity. The chemical andphysical properties of subtilisins were well described in the book written by Markiand and6Chapter 2 Literature Review 7Smith (1971). They have a broad substrate specificity with the preference for aromaticamino acid residues in the P1 site of their substrate.Subtilisin catalyzes the hydrolysis of amides and esters by a mechanism whichinvolves a catalytic triad of residues comprising a serine, a histidine and an aspartic acidside chain and obeys typical Michaelis-Menten kinetics (Kraut, 1977). The reaction isthought to involve a tetrahedral oxyanion transition state which in subtilisin is stabilized bytwo hydrogen bonds: one from the catalytic Ser 221 main chain amide, and the other fromthe side chain of Asn 155. This catalytic apparatus provides subtilisin with a catalyticturnover rate constant kcat that is at least l0910b0 greater than the first orderspontaneous hydrolytic rate for amide substrates. Kinetic analysis of the subtilisin BPN’mutants demonstrated that the residues within the triad interact synergistically toaccelerate amide bond hydrolysis by a factor of —2 x 106 (Carter and Wells, 1988).Recently, the study of the effects of organic solvents on the catalytic mechanismrevealed that the serine residue in the triad is catalytically important in both water andorganic solvents (Chatterjee and Russell, 1992).2.1.3. Use of Subtilisin for Enzymatic Peptide SynthesisHomandberg and Laskowski (1979) reported that ribonuclease A could be resynthesizedfrom bovine pancreatic ribonuclease S by the enzyme subtilisin BPN’. In their experimentbovine pancreatic ribonuclease S was incubated with subtilisin BPN’ at pH 6.2 in partiallynon-aqueous solutions containing 0-95% (vlv) glycerol. The solutions were monitored atvarious times for the presence of ribonuclease A by enzymatic assay in the presence of40% (vlv) dioxane, where ribonuclease S is inactive, and by SDS gel electrophoresis.Although the maximum amount of synthesis was only 4.3% in water, this synthesis wasincreased to 50% by increase in the concentration of glycerol to as much as 90%.Other examples where subtilisin BPN’ was used for peptide synthesis including theinvestigation carried out by Isowa et al. (1977a, 1977b). Dipeptides of the general formChapter 2 Literature Review 8Z-Phe-X-OH served as carboxyl components and the dipeptide HPheValOBut was usedas the amine component throughout the studies. Only moderate yields were obtained atpH 7.2 when the X-position was occupied by valine, tyrosine or N-nitro-arginine moieties.With glycine and serine residues located in the X-site, condensed products were notproduced at all (Isowa et al., 1977a).In another study by Isowa’s group, two conventionally prepared angiotensinfragments, namely, the dipeptide Boc-Val-Tyr(Bzl)-OH and the tetrapeptide H-ValHis(Bz)-Pro-Phe-OEt were used as the substrates to be coupled by using subtilisin BPN’.However, the resulting hexapeptide, which was obtained in a good yield, lacked the C-terminal ethyl ester due to a side reaction, which was obviously caused by an esteraseactivity elicited by subtilisin BPN’ (Isowa et al., 1977b).As a logical extension of enzymatic peptide synthesis, subtilisin BPN’ was used forthe coupling of glycopeptides by Wong et al. (1993). N- and 0-linked glycopeptidefragments were used as carboxyl and amino groups for the coupling reaction. In theirstudy, N-acetylglucosamine 13-linked to the side chain of asparagine was chosen as acentral structure unit for N-glycopeptide synthesis. 0-glycopeptide synthesis wasperformed using substrates containing either xylosyl serine as a characteristic element ofthe proteoglycans of the extracellular matrix and of the connective tissue, or oc-mannosylthreonine as a typical core unit of 0-glycoproteins found in yeast. A kinetically controlledapproach in which N- and 0-linked glycopeptide esters were used as substrates, wasapplied to transfer the acyl moiety of a peptide or glycopeptide donor to various aminoacid peptides, and glycopeptide derivatives. Reactions were performed either in aqueoussolution or in aqueous dimethylformamide (DMF) solution. For the substrates studied,various yields were obtained from 0-60% (Wong et al, 1993).Many attempts have been made to improve the enzymatic peptide synthesisefficiency for many years. Protease catalyzed peptide synthesis reaction may be carried outin one of two categories, namely equilibrium controlled reaction and kinetically controlledChapter 2 Literature Review 9reaction. In equilibrium controlled synthesis, reversal of the proteolytic reaction is used topromote the peptide bond formation. In kinetically controlled peptide synthesis, the estersubstrate used as acyl-donor reacts with the enzyme, yielding a highly electrophilic acylenzyme intermediate. The acyl-enzyme complex can be deacylated by water, giving theacid product (ester hydrolysis), or by the amino group of another amino acid, yielding thecondensation product. One prominent parameter under investigation for improvingenzymatic peptide synthesis has been the use of organic solvents. For example,Homandberg and Laskowski (1979) used glycerol to increase the ribonuclease A yield.Wong et al. (1993) also investigated the influence of using dimethylformamide (DMF) onthe synthesis efficiency, because the use of organic solvents with low water contentprovides a marked effect on both equilibrium and kinetically controlled reaction: it shiftsthe thermodynamic equilibrium towards synthesis and suppresses the hydrolytic sidereactions. Moderate concentrations of water-miscible organic solvents have been used formany years (Jakubke et al., 1985). In recent years, there have been some successfulexamples regarding the use of organic solvents for subtilisin catalysed peptide synthesis(Ferjancle et al., 1990 and Wong et al., 1990).Other studies have looked for the effective nucleophilic moiety for the acylation ofthe enzymes. Morihara and Oka (1981) investigated the influence of the chemicalcomposition of various carboxyl and amino components on subtilisin catalyzed synthesis.The efficiency of the acyl group donors, which were N-protected, but ct-carboxylateunprotected, increased with growing chain length. Amino acids were the best choice asacceptor nucleophiles whereas amino acid amides and esters were inadequate, even if theirconcentration exceeded that of the respective carboxyl component by more than ten times.Another study to fmd more suitable substrates for the peptide synthesis was done byVoyushina et al. (1985) according to a review paper by Kuilmann (1987). The researchgroup used N-protected di- and tri-peptide methyl esters and amino acid p-nitroanilides ascarboxyl and amino components, respectively, to prepare a series of tn- and tetrapeptidesChapter 2 Literature Review 10via subtilisin catalyzed synthesis. When Z-Ala-Ala-Leu-OMe served as the carboxylcomponent, they found that the coupling efficiency was strongly influenced by thechemical nature of the amino components in the following order: H-A1a-pNA > H-ValpNA > H-Leu-pNA > H-Phe-pNA. And they found that if the above esterified acyl groupdonors were replaced by those having a free o-carboxyl group, the product yields weresignificantly reduced.The studies of enzymatic peptide synthesis reaction have lasted for many years.Although organic solvents have been widely used as one approach for the improvement ofpeptide synthesis efficiency, it has been reported that subtilisin may be insoluble and oftenless stable in high concentration of organic solvents (Wong et al., 1990). In recent years,the investigations of peptide synthesis has included engineering of subtilisin for peptidesynthesis. Modification of subtilisin for peptide synthesis can be generally divided intothree classes: 1) To increase the subtiisin’s stability in organic solvents (Wong et al.,1990); 2) To increase substrate binding affinity or substrate specificity of subtilisin (Wellset al., 1987 and Bonneau et al., 1991); and 3) To change the catalytic activity of theenzymes (Abrahmsen et al., 1991).2.1.4. ThiolsubtilisinThiolsubtilisin, a subtilisin mutant at its active site Ser 221, was first obtained through achemical modification procedure from subtilisin BPN’ (Neet and Koshland, 1966). Thechoice of Cys as a mutation substitute at Ser 221 site was that Ser 221 is involved directlyin the catalysis, thus any changes in Ser 221 may cause dramatic changes in catalyticactivity. Therefore, it was desirable to convert the Ser 221 to a residue more nearly similarto that of the original serine. Such a residue is cysteine since its SH group of cysteinepossesses steric and chemical properties similar to those of the OH group of serine. As aserine protease that has the same catalytic mechanism as chymotrypsin, subtilisin was usedas a substitute of chymotrypsin for studying the functional role of serine residue on theChapter 2 Literature Review 11enzyme, because subtilisin contains no sulfhydryl group in the molecule, which eased theconversion process. After the hydroxyl group was converted to a sulfhydryl group, theactivity of the modified enzyme was tested against a variety of substrates to determine anychanges in activity. It was seen that the activity of the thiol enzyme toward nitrophenylacetate was an appreciable percentage, about 33% of the activity of the native enzymetoward this same reagent. However, no activity was detected for the thiolsubtilisin againstother ester and peptide substrates of subtilisin. Acetyl tyrosine ethyl ester, tosylargininemethyl ester, glutarylphenylalanine p-nitroanilide, and the proteins albumin and casein,which present many pepticle bonds susceptible to subtilisin action, were not significantlyhydrolyzed by the thiolsubtilisin. Furthermore, thiolsubtilisin was tested on those peptidesthat are not substrates for subtilisin, and no activity was observed here either.Thiolsubtilisin was found to have lower esterase and peptidase activity than the nativesubtilisin.Later, the purification of chemically modified subtilisin, that is thiolsubtilisin wasimproved by Polgar (1976). The properties of this variant were examined and comparedwith the wild type subtilisin. By using kinetic and spectroscopic methods, the active siteconformation of thiolsubtilisin was compared with that of subtilisin (Tsai and Bender,1979). Three major investigations were carried out, including using carbobenzyloxy-Lalanylglycyl-L-phenylalanine chioromethyl ketone to inhibit the thiolsubtilisin and pHdependence of inhibition, comparison of native chromophoric aryl-acryloyl-thiolsubtiiisinand arylacryloyl-subtilisin intermediates to their denatured form, and comparison of thedeacylation rate of arylacryloyl-thiolsubtilisins with the analogous arylacryloyl-subtilisinsin 30% (v/v) dioxane and their pH dependence profile. Their conclusion was that theactive-site conformation remains intact on conversion from subtilisin to thiolsubtilisin. Thelow esterase and peptidase activities of thiolsubtilisin are most likely due to the relativelylow basicity of the -SH group as compared with the -OH group. At the same time, Philippet al. (1979) reported the comparison of the kinetic specificity of subtilisin andChapter 2 Literature Review 12thiolsubtilisin toward n-alkyl p-nitrophenyl esters. In this study, the p-nitrophenyl esters ofstraight-chain fatty acids were used as substrates of subtilisin and thiolsubtilisin. Amongthe substrates tested, both enzymes showed highest specificity with p-nitrophenyl butyrate.It was found that subtilisin is more sensitive to changes in substrate chain length than isthiolsubtilisin. Second-order acylation rate constants were remarkably similar for bothenzymes. However, thiolsubtilisin deacylation rate constants and Km values were lowerthan analogous subtilisin constants. Thus the thiolsubtilisin was then called “semi-synthetic” enzyme (Brocklehurst and Maithouse, 1981). They suggested that the lack ofcatalytic activity of thiolsubtilisin towards specific substrates may be due to aninappropriately located proton-distribution system. In a review paper written by Philippand Bender (1983), it is concluded that both enzymes have a similar level of activitytowards activated nonspecific peptide amides and esters. However, thiolsubtilisin isinactive towards highly specific peptide amides and esters. Thus, thiolsubtilisin may not beable to stabilize the transition state during acylation by specific substrates.Nakatsuka et al. (1987) reasoned that thiolsubtilisin, a mutant protease, was“damaged” in such a way that it acts as a poor catalyst for peptide hydrolysis, but whichretains the ability to be acylated at its active site by a peptide active ester and hence to bedeacylated through attack by the N-terminal amino group of another peptide segment.This could have important applications in the development of a general methodology forpeptide segment condensation. Since thiolsubtilisin is a very poor protease, the peptidebonds formed in the course of coupling are not significantly hydrolyzed. p-chlorophenylesters were considered as the most suitable esters for the coupling, and it was also foundthat: 1) The L and D isomers of Phe employed as the acyl component were strictlydistinguished by thiolsubtilisin and only the L isomer was reactive; 2) Protection of thehydroxyls of Ser and Tyr and the C-terminal carboxyl group of the acyl acceptor wasunnecessary; and 3) The substrate specificity of thiolsubtilisin was quite broad. They wenton to test thiolsubtilisin’s activity toward large peptide fragment condensations by couplingChapter 2 Literature Review 13[Leu5] enkephalin amide from Z-Tyr-Gly-Gly-Phe-O-C6H4C1 p and Leu-NH2, and thefragment of ribonuclease T1 corresponding to residues 12-23 of ribonuclease fromFMOC-Ser-Ser-Ser-Asp-Val-Ser-Thr-Ala-O-C6H4I p and Gin-Ala-Ala-Gly. Theyobtained a yield of ribonuclease T1 of 47%.Recently, protein engineering techniques have played major roles in thiolsubtiisincatalyzed peptide synthesis. One of the greatest achievements was made by Abrahmsen etal. (1991). Subtilisin BPN’ was converted into a double mutant in which the catalytic Ser221 was converted to Cys (S221C) and Pro 225 converted to Ala (P225A) throughprotein engineering techniques. It was found that the double mutant has 10 fold higheractivity than thiolsubtiisin for the peptide synthesis, and 100-fold lower activity thanthiolsubtilisin for peptide hydrolysis. The 1.5-A X-ray crystal structure of an oxidizedderivative of the double mutant showed that the additional mutation of P225A partlyrelieves the steric crowding expected from the thiolsubtilisin, which accounts for theimproved catalytic efficiency. They also prepared stable and synthetically reasonable alkylester peptide substrates for the double mutants that rapidly acylate the mutant enzyme, andfound that the anilnolysis of the resulting thioacyl-enzyme intermediate by various peptidesis strongly preferred over hydrolysis. In their elaborate study, they further engineered thedouble mutant to obtain greater flexibility in the choice of coupling sites on the enzymeand the specificity of these derivatives was studied.2.1.5. Other Studies Of ThiolsubtilisinThe study of thiolsubtiisin had shed light on the modification of subtilisin for peptidesynthesis. Many study groups went further to study this subtilisin variant directly orindirectly for the peptide synthesis. Subtilisin BPN’ was mutated in six sites: Met 50 toPhe, Gly 169 to Ala, Asn 76 to Asp, Gin 206 to Cys, Tyr 217 to Lys and Asn 218 to Ser(Wong et al., 1990). The mutant was called subtilisin 8350 and was found to be 100 timesmore stable than the wild enzyme in aqueous solution at room temperature and 50 timesChapter 2 Literature Review 14more stable than the wild type in anhydrous dimethylformamide (DMF). Differentsubstrates - ester, thioester, amide and transition state analogue inhibitor, were used forthe kinetic study, which showed that the wild type and the mutant enzymes have verysimilar specificities and catalytic properties. Moreover, it was shown that the mutantenzyme binds the reaction transition state more strongly than the wild type. In the study ofsingle amino acid polymerization, it was found that subtiisin 8350 was more effective inhigher concentration of dimethylformamide (50%). Subtilisin 8350 was also used for thesynthesis of di- and oligopeptides via aminolysis of N-protected amino acid and peptideesters. The yields of the reactions ranged from 50% to 95%. Therefore, it was concludedthat the lack of amidase activities of the mutant and the improvement of productsolubilities under the high concentration of DMF are perhaps the major reasons forsuccessful peptide synthesis under the study (Wong et al., 1990).Later, subtilisin 8350 was further engineered to subtilisin 8397, in which only 5mutation sites were maintained while site 217 was changed back to a Tyr residue. Thenew variant subtilisin 8397 was found to have a half-life of 350 hours in DMF and 1600hours in aqueous solution. When used for the peptide synthesis in 50% DMF , it wasfound that the subtilisin 8397 was about 10 times more efficient than the wild-typeenzyme, while the subtilisin 8350 was about 5 times more efficient than the wild-typeenzyme (Zhong et al., 1991).The mutant subtilisin 8397 was further studied by Wong et al. (1993) in theDepartment of Chemistry of the Scripps Research Institute. They introduced the thiolgroup at the active site on subtilisin 8397, that is, in addition to the 5 mutation sites onsubtilisin 8397, Ser 221 was mutated to Cys. The newly derived variant was calledthiosubtilisin. The group used the thiosubtilisin and the subtilisin 8397 for the synthesis ofN- and 0-linked glycopeptides and found that subtilisin 8397 was good for the peptidesynthesis in polar organic solvents such as DMF, while the thiosubtilisin was good forpeptide synthesis in aqueous solution.Chapter 2 Literature Review 15The study of subtilism has included introduction of non-natural catalytic prostheticgroups into the enzyme. Since the organic chemistry of selenoenzymes is extensive and ofsynthetic importance, subtilisin was converted at its active Ser 221 site into aselenocysteine. Like thiolsubtilisin, selenosubtilisin was a poor catalyst of amidehydrolysis, however, it had a higher aniinolysis-to-hydrolysis ratio of the intermediatecomplex than subtilisin and thiolsubtilisin. Therefore, it was suggested to be useful for thesynthesis of amide bonds (Wu and Hilvert, 1989).2.2. Protein Engineering of Subtilisin2.2.1. Site-Directed MutagenesisProtein engineering study was made feasible when recombinant DNA technology andDNA sequencing methods were developed. The protein engineering thus involved the useof genetic manipulations to alter the coding sequence of a cloned gene and thefunctionality study of proteins. The methods used for genetic manipulation in vitro can bebroadly grouped into random mutagenesis and site-directed mutagenesis. Usually therandom mutagenesis is used for the identification of location and boundaries of a particularfunction. Once the region of a protein function has been located, the alteration andimprovement of the function is investigated by site-directed mutagenesis (Zoller andSmith, 1984).Many methods are now used for site-directed mutagenesis with little difference inprinciple from the techniques used by Hutchison et al. (1978). However, there has been asuccession of significant improvements to virtually all technical aspects of the procedure.These include: 1) A better understanding of the conditions for hybridization of mismatchedoligonucleotides; 2) A significant increase in the efficiency with which mismatchedheteroduplexes can be generated in vitro; 3) The development of techniques to screenbacteriophage plaques for the desired mutation by oligonucleotide hybridization; 4) TheChapter 2 Literature Review 16development of a versatile set of bacteriophage Ml 3 vectors; and 5) The invention ofgenetic methods to reduce the frequency of bacteriophages that carry nonmutant DNAs.As a consequence, it is now possible to introduce virtually any desired changes into aknown sequence of DNA (Sambrook et al. 1989).Site-directed mutagenesis uses synthetic oligonucleotides as mutagenic agents todirect the mutation. The principles were first brought up by Hutchison and Edgell (1971).However, the systematic technique of site-directed mutagenesis using syntheticoligonucleotide was developed by Hutchison et al. (1978). The procedure is similar to theprimer extension reaction used in DNA sequencing. A synthetic oligonucleotide, typically15-20 bases long, is made to be complementary to the gene in the region of interest exceptfor deliberate mismatches which direct the mutation. A maximum of three mismatchedbases could be possible to produce any substitutions of one amino acid. The mutagenicoligonucleotide is first annealed to a single stranded DNA template usually produced byrecombinant M13 DNA polymerase I, Klenow enzyme is then used in the presence of fourdeoxynucleoside 5’-triphosphates (dNTPs) to extend the oligonucleotide in vitro. BecauseKlenow enzyme lacks 5’—*3’ exonuclease activity, the mismatches within theoligonucleotide are not removed by the polymerase. After the treatment with DNA ligase,a double stranded closed circular DNA is made. Although most parts of the two strands ofDNA are complementary to each other, there are mismatches introduced from theoligonucleotide. The new circular DNA is then to be transformed into Escherichia coli.Wild type and mutant colonies are then further distinguished by different methods.2.2.2. Kunkel’s Site-directed MutagenesisThe basis of Kunkel’s method is the performance of site-directed mutagenesis using aDNA template which contains a small number of uracil residues in place of thymine. Theuracil-containing DNA is produced with an Escherchia coli dur ung strain. Escherichiacoli dut- mutants lack the enzyme dUTPase and therefore contain elevated concentrationsChapter 2 Literature Review 17of dUTP which effectively compete with TTP for incorporation into DNA. Escherchiacoli ung mutants lack the enzyme uracil N-glycosidase which normally removes uracilfrom DNA. In the combined dur ung mutant, uracil is incorporated into DNA in place ofthymine and is not removed. Thus, standard vectors containing the sequence to bechanged can be grown in a dur ung host to prepare uracil-containing DNA templates forsite-directed mutagenesis (Kunkel et al., 1987).Usually the uracil containing DNA template is produced by using Escherichia coliCJ236 strain, which is dur ung F’ (Kunkel et al., 1987). The synthetic oligonucleotide isannealed to the DNA template to carry out in vitro synthesis of the second strand DNA asfor ordinary site-directed mutagenesis. After a ung+ Escherichia coli strain is transfectedor transformed with this in vitro derived heteroduplex, the original template strand withwild type gene sequence is greatly degraded, because it contains uracil residues. Thus themajority of progeny arises from the strand synthesized in vitro. The efficiency of thismethod is usually higher than 50%.2.2.3. Vector and HostpUC1 18 is a phagemid DNA. In addition to the replicon that is required for the replicationin Escherichia coli bacteria cells, it carries the sequences required in cis for initiation andtermination of bacteriophage DNA synthesis and for packaging of DNA intobacteriophage particles. It can be used as a plasmid DNA to accept segments of foreignDNA and can be propagated as plasmids. However, when the cells are infected with asuitable filamentous bacteriophage, copies of one strand of the pUC 118 DNA aresynthesized and packaged into progeny bacteriophage particles (Vieira and Messing,1982).There are several advantages of using pUC plasmid DNAs in the molecularcloning: 1) They are stable vectors, and have high yields of DNA as plasmids; 2) There isno need of subcloning DNA fragments from plasmid to filamentous bacteriophage vectors;Chapter 2 Literature Review 18and 3) They are usually small in size and can take up to 10 kb of foreign DNA fragment toproduce single-strand DNA. However, phagemid vectors often have poor and generallyirreproducible yields of single-strand DNA that are obtained after infection with helperbacteriophage (Sambrook et al., 1989).Bacillus subtilis has been used as host cells because it can secrete proteins into thegrowth medium. Many proteins have been successfully expressed in Bacillus subtilisincluding human tissue-type plasminogen activator and rice a-amylase gene (He et al.,199 ib). Because Bacillus subtilis produces copious amounts of proteases, such as majorneutral protease E, alkaline protease E, minor proteases, and bacillopeptidase F etc. (He etal., 1991 a), the construction of protease-deficient strains facilitates the expression as wellas subsequent purification of not only mutants of its own proteases but also foreignproteins (prokaryotic and eukaryotic).DB428 is a Bacillus subtilis strain deficient in neutral protease, alkaline proteaseE, minor proteases, and bacillopeptidase F. It was derived from DB403 which is deficientin neutral protease E, alkaline protease E and minor proteases. Although DB403 isdeficient in major proteases, it stifi contains about 1% of the extracellular protease activityof the wild-type Bacillus subtilis strain. After the fourth protease gene of DB403 wasfurther deleted, that is, bacillopeptidase F, the extracellular protease activity of the strainwas significantly reduced. No halos could be observed when the DB428 strain was grownon casein agar plates for 4 days (He et al., 1991b).2.2.4. Site-directed Mutagenesis for the Studies of SubtiisinSite-directed mutagenesis has been widely used for the study of subtilisin, especially forsubtilisin BPN’. Because Met 222 site was proven to be a primary site for oxidativeinactivation of subtilisin, 19 amino acid substitutions were made on Met 222 site by usinga cassette mutagenesis method. It was found that mutants containing nonoxidizable aminoacids (i.e. Ser, Ala, and Leu) were resistant to inactivation by 1 M H20, whereas MetChapter 2 Literature Review 19and Cys enzymes were rapidly inactivated (Estell et a!., 1985). Subtilisin BPN’ was alsoengineered for tailoring the pH dependence of enzyme catalysis using site-directedmutagenesis. Asp 99 residue was chosen to be changed to Ser 99 in subtilisin BPN’.Although such change was just the change of one surface charge, it had a significant effecton the pH dependence of the enzyme. The experiment also provided the basis for refmingtheoretical calculations of electrostatic effects in catalysis (Thomas et al., 1985). Site-directed mutagenesis was used for testing a hypothesis on subtilisin. In the transition stateof the enzyme-substrate complex formed during the catalysis, the carbonyl group of thepeptide bond to be hydrolyzed was believed to adopt a tetrahedral configuration ratherthan the ground-state planar configuration, and furthermore, stabilization of this activatedcomplex was accomplished in part through the donation of a hydrogen bond form theamide side group of Asn 155 to the carbonyl oxygen of the peptide substrate. Leucineresidue replaced the Asn at 155 position in the site-directed mutagenesis, and it was foundthat although the Leu enzyme had the same Km value, kcat was reduced by a factor of200-300 when assayed with a peptide substrate. This therefore, proved the hypothesis forthe transition-state stabilization of enzyme catalysis (Bryan et al., 1986).In 1986, two double-site mutants were produced by site-directed mutagenesis inorder to investigate the stability of subtilisin BPN’. Thr 22 and Ser 87 were replaced byCys residues in one mutant, as were Ser 24 and Ser 87 in the second mutant. Therefore, adisulfide bond was introduced in both mutants approximately 24A away from the catalyticsite. It was found that the disulfide bond had no detectable effect on either the specificactivities or the pH optima of the mutants. The stabilities of Cys 24/Cys 87 and wild-typeenzymes to autolysis were the same; however, Cys 22/Cys 87 was less stable to autolysis(Wells and Powers, 1986).Again the Thr 22 and Ser 87 sites were replaced with the Cys residue and thestability of the mutant was studied by Pantoliano et al. (1987). Not surprisingly, themutant enzyme had activity essentially equivalent to that of the wild-type enzyme (WellsChapter 2 Literature Review 20and Powers, 1986). However, other measurements of the enzymes showed that the mutanthad a melting temperature 3.1°C higher than that of wild type and 5.8°C higher than thatof the reduced form (-SH HS-) of the mutant, which suggested the mutant obtained higherstability than the wild type.The Gly 166 site of subtilisin BPN’ was replaced with 12 nonionic amino acids by acassette mutagenesis method to probe steric and hydrophobic effects on enzyme-substrateinteractions. The mutants showed large changes in specificity toward substrates ofincreasing size and hydrophobicity. As a result, the catalytic efficiency (kcatlKm) towardsmall hydrophobic substrates was increased up to 16-fold by hydrophobic substitutions atposition 166 in the binding cleft. However, if the optimal binding volume of the cleft (—160 A) was exceeded by enlarging either the substrate side chain or the side chain atposition 166, the catalytic efficiency (kcat/Km) was reduced by up to 5000-fold because ofthe steric hindrance (Estell et al., 1986).Site-directed mutagenesis was used for designing substrate specificity of subtilisinBPN’ in 1986. Two different sites at positions 156 and 166 in the substrate binding cleft ofthe enzyme were replaced with the amino acid residues that are complementary to thecharge of the amino acid in the substrates used for assay. The results showed that if thecomplementary charges were introduced to the enzyme, then an increased catalyticefficiency (kcat/Km) was observed, and vice versa, that is if similar charges wereintroduced to the enzyme, the catalytic efficiency (kcat/Km) was decreased (Wells andPowers, 1986).Further study on the substrate specificity was carried out by Bonneau et al. (1991).For substrates such as N-tosyl-L arginine methyl ester (TAIVIE), the hydrophobicenvironment of the P1 binding site (the Gly 166 residue mainly responsible for the binding)could not offer efficient binding between the enzyme and the substrate. Thus residues tohelp in the binding, such as Asn and Ser, were used to replace the Gly at position 166. Inthis study, the P1’ site binding residue Tyr 217 for the p-nitroanilide was also studied, andChapter 2 Literature Review 21it was found that with the smaller side chain residue Leu substitution at site 217, the pmtroanilide group was better accommodated in the P1. Met 222 was replaced with Phe,and showed reduced volume of the P1’ pocket, which showed a reduction in amidehydrolysis rate without affecting catalysis of esters. This study suggested the use of thismutant for peptide synthesis applications. In addition, the residues at three sites 156, 169,and 217 on subtilisin BPN’ were replaced with the corresponding amino acid residues onsubtilisin Carlsberg. The mutant showed Carlsberg-like properties for amide hydrolysis;however, the mutant did not confer the properties for ester substrates (Bonneau et al.,1991).The His 64 site was studied in 1987 for its involvement in the catalysis. Thecatalytic group of subtilisin BPN’ was first removed by site-directed mutagenesis causinginactivation. Then the activity of the enzyme was partially restored by substratescontaining the missing catalytic functional group. His 64 within the catalytic triad ofsubtilisin was replaced by Ala first, and it was found that the catalytic efficiency (kcat/Km)was reduced by a factor of a million when using N-succinyl-L-Phe-L-Ala-L-Ala-L-Phe-pnitroanilide as a substrate. However, when N-succinyl-L-Phe-L-Ala-L-His-L-Phe-pnitroanilide was used as a substrate, the catalytic activity was regained by up to 400 times.Thus, the His64Ala mutant enzyme could recover partially the function of the lost catalytichistidine at the active site by a His residue side chain on the substrate (Carter and Wells,1987).Other studies involving protein engineering of the subtilisin have investigated therole of Pro 239 in the catalysis and heat stability of subtilisin E (Takagi et al., 1989), andthe improvement in the alkaline stability of subtilisin BPN’ using an efficient randommutagenesis and screening procedure (Cunningham and Wells, 1987).Chapter 2 Literature Review 222.3. Proteolytic Activity AssayThe proteolytic activity was assayed by using urea-denatured hemoglobin as a substrate inthe late 60’s and early 70’s. The degradation of casein to trichioroacetic acid-solubleproducts was frequently used. In some laboratories, there are examples of using clupeinand milk-clotting test (Ottensen and Svendsen, 1970).DelMar et al. (1979) synthesized a tetrapeptide in the study of the substratespecificity of human pancreatic elastase II. This tetrapeptide, succinyl-L-Ala-L-Ala-L-ProL-Phe-p-nitroanilide, was originally designed as a substrate for chymotrypsin. Analysisshowed that the substrate is readily soluble and stable to hydrolysis in Tris buffer at pH 8.The method was shown to be a sensitive method for detecting low levels of chymotrypsin(as low as 1.0 ng of the enzyme).The tetrapeptide was first used as a substrate for subtilisin activity by Wells et al.(1983). Because subtilisin and chymotrypsin have similar substrate specificity, thistetrapeptide was later used as a standard substrate for subtilisin activity assay (Stahl andFerrari, 1984; Estell et al., 1985; Thomas et al., 1985; Wells and Powers, 1986; Bryan etal., 1986; Ikemura et al., 1987; Abrahmsen et al., 1991; Jang et al., 1992).The substrate is usually prepared to give a fmal concentration between 0.0 1-0.3mM in 0.1 M TrisHC1 buffer pH 8, with or without 0.01 M CaCl2. The enzyme is thenadded to the substrate solution at room temperature in the cuvettes in aspectrophotometer to measure the absorbance changes at 410 nm over a period of time.The activity of the enzyme is usually expressed as Aabsorbance/min.mg.2.4. Detection of Peptide Bond Formed by Enzymatic SynthesisThere are several methods to detect the peptide bond formed either by enzymatic synthesisor chemical synthesis. The most commonly used method is to separate the substrates andthe product by a reverse phase high performance liquid chromatography (RP-HPLC),Chapter 2 Literature Review 23followed by nuclear magnetic resonance (NMR) analysis of the product peak (Nakatsukaet aL, 1987; Abrahmsen et al., 1991). Although the method works well for most peptideproducts and it can provide accurate and reproducible qualitative and quantitativeinformation regarding to the synthesis reaction, it usually involves the time-consuming andtedious laboratory preparation of the samples for HPLC and for NMR.Other methods to detect or measure peptide bonds were usually simple and fast,but not adequately accurate. These include 2, 4, 6,-trinitrobenzene 1-sulfonic acid (TNBS)(Kwan et al., 1983), ortho-phthalaldehyde (OPA) method (Hernández et al, 1990) andthin-layer chromatography (TLC) (Lee, 1992).Some other methods still, used for the enzymes and other biologically activepeptides synthesized from large fragments measure the activity of such enzyme andpeptide. Other methods which could be beneficial measure the size of the proteins or thepeptides.There was an attempt to develop an easy and fast method for the detection of thepeptide bond formed (Yue, 1993). Although the reproducibility and sensitivity of themethod is still being improved now, the idea of the method is to use an enzyme linkedimmunosorbent assay method (Elisa) to detect the formation of peptide bonds on amicrotitre plate. The peptide bonds formed on plate are marked with a specific group andmeasured by an antibody.2.5. DNA SequencingThe enzymatic method of DNA sequencing was introduced by Sanger et al. (1977). Withthe development of single-stranded DNA cloning vectors, the enzymatic DNA sequencinghas been improved a great deal. This method involves the in vitro synthesis of a DNAstrand by DNA polymerase using a single-stranded DNA template. Synthesis is initiated atonly the one site where an oligonucleotide primer anneals to the template. The synthesisChapter 2 Literature Review 24reaction is terminated by the incorporation of a nucleotide analog that will not supportcontinued DNA elongation. The chain-termination nucleotide analogs are the 2’, 3’-dideoxynucleoside 5’-triphosphates (ddNTPs). These lack the 3’-OH group necessary forDNA elongation. When proper mixtures of deoxynucleoside 5’-triphosphates (dNTPs) andone of the four ddNTPs are used, enzyme-catalyzed polymerization will be terminated in afraction of the population of chains at each site where the ddNTP can be incorporated.Four separate reactions, each with a different ddNTP, give complete sequenceinformation. A radioactively labeled nucleotide is also included in the synthesis, so thelabeled chains of various length can be visualized by autoradiography after separation byhigh resolution electrophoresis.Double stranded DNA can be used for the DNA sequencing. Automatedsequencers are also frequently used.Chapter 3Conversion of Subtilisin E to Thiolsubtilisin3.1. Materials3.1.1. Plasmid DNA, Bacterial Strain, and Bacteriophage• The plasmid DNA pAP65 was provided by Dr. Imanaka (Osaka University,Osaka, Japan).• The plasmid DNA pUC1 18 was purchased from Takara Biochemicals (TakaraShuzo Co. Ltd., Shijo-Higashinotoin, Shimogyo-ku, Kyoto 600-9 1, Japan).• Bacillus subtilis DB428 strain was provided by Dr. Wong, S.-L. ofDepartment of Biochemical Science, University of Calgary.• Escherichia coli JM1O9, CJ 236, MC 1061 were provided by Research &Development Division, Kikkoman Corporation (399 Noda, Noda city, ChibaPref 278, Japan).• M13K07 was prepared by Research & Development Division, KikkomanCorporation (399 Noda, Noda city, Chiba Pref 278, Japan).3.1.2. Enzymes• T4 DNA ligase, Klenow fragment polymerase, T4 polynucleotide kinase, calfintestinal alkaline phosphatase, RNAse, restriction endonucleases and subtilisinE were purchased from Boebringer Mannheim Biochemica (BoehringerMannheim Canada, 201 Boulevard Armand Frappier Laval, Quebec H7V4A2).• Site-directed Mutagenesis Kit and Gene 32 protein were purchased from BioRad Company (Bio-Rad Laboratory, Life Science Group, 2000 Alfred NobelDrive, Hercules, California 94547).25Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 26• DNA sequencing material was provided by Dr. R.T.A. MacGillivray,Department of Biochemistry, University of British Columbia.3.1.3. Chemicals• Chemicals, antibiotics, 2 DNA Hind III digest (solution in 10 nth’I TrisHC1,pH 8.0, 1 mM EDTA), and subtilisin Carlsberg were purchased from SigmaChemical Company (P.O. Box 14508, St. Louis, MO, U. S. A. 63178-0016),Fisher Scientific, Pharmacia, and Boehringer Mannheim Biochemica(Boebringer Mannheim Canada, 201 Boulevard Armand Frappier Laval,Quebec H7V 4A2).• DEAE-cellulose membrane was purchased from Schleicher & Schuell (D-3354Dassel, W. Germany).• SDS-PAGE gel Gradient 10-15 and buffer strips were purchased fromPharmacia Biotech Inc. (500 Boul-Morgan Blvd, Baie d’Urfe, Quebec, H9X3V 1).Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 273.2. Methods3.2.1. Media PreparationLB medium and 2xYT media (see Appendix A for composition) were made according toSambrook et al. (1989). Whenever necessary, addition to media were made as follows:ampicillin 100 jig/mL; tetracycline 20 jig/mL; skim milk 1.5%; X-gal (5-bromo-4-chloro-3-indolyl-j3-D-galactoside) 50 pg/mL; IPTG (isopropylthio-J3-D-galactoside) 25 Jig/mL.Solid media contained 1.5% agar.3.2.2. DNA Digestion with Restriction EndonucleasesThe reaction was carried out according to the enzyme supplier’s directions. Usually thetotal reaction mixture was 20 p.L, composed of 10 jiL plasmid DNA, 1 J.LL RNAse (stockconcentration 0.4 mg/mL, working concentration 20 igImL), 1 tL (about 1 unit)restriction enzyme and 1 .tL lOx buffer (supplied with the restriction enzyme) for eachrestriction enzyme and water. In the case of the buffers for enzymes being different, thereactions were carried out sequentially. Usually, the reaction which requires a buffer withlower salt concentration was carried out first.3.2.3. Agarose Gel ElectrophoresisDNA fragments produced by restriction enzyme digestion were separated on 0.7% or1.0% agarose gel using Tris-Borate-EDTA (TBE buffer, see Appendix A forcomposition). Ethidium bromide was added to the agarose gel at a fmal concentration of0.1 pg/rnL before the gel was solidified.3.2.4. Plasmid DNA PreparationAlkaline lysis method was used for the plasmid DNA preparation. Generally, the methodinvolves the addition of three solutions: solution I, solution II, and solution III. Table 3.1shows the cnmpositioa of these sn1iitinn However, the preprnfinn of pAP65 and itsChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 28derivatives from B. subtilis is different from the one of pUC 118 and derivatives from E.coli.The preparation for the plasmid DNA pAP65 can be described by the followingprocedures.• Small scale plasmid DNA pAP65 and its derivatives were prepared from a 10mL culture. In the culture, the Bacillus subtilis transformant, which carriedpAP65 or its derivatives, was grown in a LB medium that contained 10jig / jiL tetracycline at 37°C with vigorous shaking (200 rpm/mm.) overnight.• The cell pellets were collected by centrifuging the culture at 2,500 xg for 30minutes in a Beckman GS-6 centrifuge, washed by 2.5 mL ice cold STEsolution (see Appendix A for composition), and then recovered again.• 120 jiL of ice-cold solution I and 1.2 mg lysozyme were added into the cellpellets. The mixture was gently vortexed and kept at room temperature for 10minutes.• 240 jiL of freshly-made solution II was added to the mixture and kept at roomtemperature for 5 minutes.• 180 jiL of ice-cold solution ifi was fmally added and mixed. The mixture waskept on ice for 30 minutes.• The mixture was centrifuged at 2,500 xg for 30 minutes in the centrifuge andthe supematant was transferred to a sterile microcentrifuge tube. 1 mL ofethanol (about twice the volume of the supernatant) was added to the tube andthe mixture was stored at -20°C for about 10 minutes.• DNA was recovered by centrifuging the fmal solution at 12,000 xg for 5minutes in Eppendorf centrifuge (5415C) and then resuspended in 300 p.L TEsolution pH 8.0 (see Appendix A).• 300 jiL of 5 M LiC1 was added to the DNA solution and mixed well.Impurities were removed by centrifuging the mixture at 12,000 xg for 10Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 29minutes in Eppendorf centrifuge (541 5C). The supernatant was transferred to aclean sterile microcentrifuge tube.• DNA was recovered by adding 600 j.tL of ice cold isopropanol, andcentrifuged at 12,000 xg for 10 minutes in Eppendorf centrifuge (5415C). TheDNA pellets were rinsed with 70% ethanol, dried at room temperature for afew minutes, and dissolved in 40 j.IL sterile distified water.pUC 118 and its derivatives were obtained using the same procedure as describedabove with the following exceptions:• 1.2 mL of the Escherichia coli transformant culture that carried the plasmidDNA pUC1 18 or its derivatives was used to prepare plasmid DNA.• 100 jiL of ice cold solution I, 200 j.tL of freshly made solution II, and 150 iLof ice cold solution III were used.• The resulting DNA was fmally dissolved in 100 p.L sterile distilled water.By using the above procedure, the purity of the resulting plasmid DNA wassatisfactory and no further purification was needed for later restriction enzyme digestionand DNA sequencing.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 30Table 3.1: Composition of the solutions used in the plasmid DNA preparationSolutions Composition CommentsI Glucose: 50 mM Prepared in 100 mL, autoclaved for 15TrisCl (pH 8.0): 25 mM minutes at 10 lb/sq.in on liquid cycle,EDTA (pH 8.0): 10 mM and stored at 4°C.II 0.2 N NaOH, 1% SDS 0.2 N NaOH freshly diluted from a 10 NNaOH stock.III 5 M potassium acetate: 60 The resulting solution is 3 M withmL respect to potassium and 5 M withGlacial acetic acid: 11.5 mL respect to acetate.H90: 28.5 mLChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 313.2.5. Purification of DNA Fragments from Restriction Enzyme DigestionTwo methods were used to purify DNA fragments: 1) electroelution and 2) DEAEcellulose membrane. The former was mainly used for the larger DNA fragments (> 3 kb insize) and the latter was for the smaller DNA fragments (< 3 kb in size). Vector DNAswere prepared by electroelution. The main procedure can be described as follows:• After digestion with appropriate restriction enzymes, vector DNA moleculeswere treated with calf intestinal alkaline phosphatase at 37°C for 5 minutes.• The digestion mixture was loaded on agarose gel (0.7%), which containedethidium bromide (0.1 jiglmL), to separate the DNA fragments byelectrophoresis.• Upon completion of electrophoresis, the DNA digestion pattern was visualizedunder ultraviolet light. A small slice of the gel containing the DNA band ofinterest was cut off from the gel and transferred into a dialysis bag. The entireagarose gel without the band of interest was then photographed.• As much as 300 iL of TE (pH 8.0) solution was added to a dialysis bag whichcontained the gel slice. The bag was sealed, without trapping any air bubbles,using clamps.• This small gel slice was moved to one side of the bag and this side of the bagwas placed close to the negative pole of the electrophoresis unit. The bag wasimmersed in a shallow layer of TBE buffer in the electrophoresis tank andelectrophoresis was continued for 20 minutes. During this time, the DNAfragment of interest was eluted out from the gel to the buffer in the bag. It waschecked with the UV light to ensure that all the DNA molecules in the gel wereeluted into the TE solution in the bag.• The TE solution was transferred to a sterile microfuge tube, and the dialysisbag was washed twice with gentle massage using 75 j.tL of 7.5 M ammoniumacetate (pH 7.5). The TE solution and the ammonium acetate washings wereChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 32pooled together in a microfuge tube and 1 mL 95% ethanol (about twovolumes of the solution) was added.• The mixture was centrifuged in an Eppendorf centrifuge (5415C) at 12,000 xgfor 10 minutes to recover the DNA molecules. The DNA pellets were thenrinsed with 70% of ethanol, dried at room temperature for a few minutes, anddissolved in 20 jiL of sterile distilled water. 2 jiL of the purified DNAfragment was loaded on an agarose electrophoresis gel to estimate the DNAconcentration.Those DNA fragments that were shorter than 3 kb were purified by electrophoresisusing DEAE-cellulose membranes. This method was described by Sambrook et al. (1989)and the main procedure with modifications are described as follows:• The plasmid DNA molecules were digested with appropriate restrictionenzymes at 37°C for about one hour to generate DNA fragments. The digestedmixture was then loaded on an agarose gel and the DNA fragments wereseparated by electrophoresis as described above.• Upon completion of the separation, the digestion pattern was photographed asdescribed before. The DNA fragment of interest was located on the agarose gelwith the ultra violet light. An incision was made using a scalpel directly in frontof the leading edge of the band of the DNA fragment.• A piece of DEAE-cellulose membrane that is about the same area as theincision, was cut and inserted into the incision without trapping any airbubbles. Electrophoresis was continued for 20 minutes, during which the DNAmolecules on the gel were transferred to DEAE—cellulose membrane.• The fluorescent DNA fragment trapped on the DEAE-cellulose membrane wasvisualized under the UV light. The cellulose membrane was then taken out andrinsed using 5—10 mL low salt wash solution (see Appendix A) to remove theagarose gel attached on the membrane.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 33• The cellulose membrane was folded and put into a clean microfuge tube. 150pL of high salt elution buffer (see Appendix A) was added into the tube andincubated at 65°C for 30 minutes.• The DEAE-cellulose was taken into another clean microfuge tube and anotheraliquot of 150 !IL high salt elution buffer was added to a tube that had themembrane and the tube was incubated for another 15 minutes at 65°C. Thesolutions from two incubation were pooled together.• The membrane was checked under the UV light to ensure no visible fluorescentDNA molecule was left on the membrane. The combined eluted solutions wereextracted with phenol. To the aqueous phase, 60 j.LL 10 M ammonium acetate(pH 7.5) and 700 I.iL ethanol was added.• The mixture was centrifuged at 12,000 xg for 10 minutes at room temperature.The pellets were then rinsed with 70% ethanol, dried a few minutes at roomtemperature, and dissolved in 12 j.tL sterile distilled water. 2 jiL of the purifiedDNA fragment was loaded on the agarose gel electrophoresis to estimate theDNA concentration.3.2.6. Ligation of DNA Fragment to VectorThe ligation reaction was carried out by adding• 9 jiL purified DNA fragment from DEAE-cellulose membrane method,• 1 iL purified vector DNA from electroelution,• ljiLof2OmMATP,• 3 p.L 5xligase buffer (usually supplied with the purchase of T4 DNA ligase, thecomposition is shown in Appendix A) and• 1 jiL of T4 DNA ligase.The mixture was incubated at 16°C overnight. The mixture was then used fortransformation of Bacillus subtilis or Escherichia coli bacteria strains.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 343.2.7. Transformation of Escherichia coliThe transformation of Escherichia coli was carried out following the method described bySambrook et al. (1989) with modifications. Competent cells were made in advance by thefollowing procedure and stored at -86°C freezer.• In a 1 L flask with 100 mL LB medium, 1 mL of a freshly grown (16 to 20hours) preculture of an E. coli strain was added and the flask was incubated at37°C with vigorous shaking (200 rpm/mm.) in a waterbath for about 3 hours.(Usually, the viable cells in the culture was less than 108 cells/mL.)• The E. coli cells were pelleted in a Sorvall RC2-B centrifuge (GSA rotor) at2,500xg for 10 minutes at 4°C, and resuspended in a 10 mL 0.1 M CaC12solution. This solution was stored on ice for 30 minutes.• The E. coli cells were recovered by centrifuging in the centrifuge at 4,000 xgfor another 10 minutes at 4°C. The cells were resuspended in a 1.7 mL solutioncontaining 1.5 mL 0.1 M CaCl2 solution and 0.2 mL glycerol. The suspensionwas kept on ice and 100 j.tL aliquots were pipetted into sterile microfugetubes.• The tubes were quickly placed into a container containing a mixture ofmethanol and dry ice, and then transferred and stored in a -86°C freezer.The transformation can be described as follows:• 5—iS jiL plasmid DNA was added into the microfuge tube that contained the100 iL competent cells. The cell-plasmid DNA mixture was stored on ice for30 minutes and transferred into a test tube containing 2.5 mL LB medium.• The test tube was shaken vigorously (200 rpm/mm.) at 37°C in a waterbath forone and a half to two hours. Then a 100 .tL aliquot of cell suspension wereplated on an LB agar plate containing ampicillin (60 jiglmL), X-gal (50 tChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 35gImL), and IPTG (25 IgImL). The plate was incubated in a 35°C incubatorovernight.3.2.8. Transformation of Bacillus subtilisBacillus subtilis was transformed with pAP65 and its derivatives. The transformationmethod used in the present experiments was developed by Spizizen (1958) andrecommended by Dr. Imanaka (1993). The original protocol provided by Dr. Imanaka(1993) for transformation of B. subtilis was found to have relatively low efficiency. Bydecreasing the volume of the LB medium used for the transformation, an increasedefficiency of 5-fold was observed in the present experiments. Two transformation mediaTF I and TF II were used. Table 3.2 describes the composition of transformation mediaand Spizizen’s solution. The improved protocol can be described as follows:• 20 mL TF I was inoculated with 1 mL (5%) overnight B. subtilis DB428culture. The culture was incubated at 37°C with vigorous shaking for about 3—4 hours.• Before the culture entered the stationary phase, 4 mL of the TF I culture wastransferred aseptically to TF II medium, and incubated at 37°C with vigorousshaking for one and a half hours.• 1 mL of the TF II culture was transferred to a sterile microfuge tube containing5-10 I.IL plasmid DNA molecules from small plasmid DNA preparation. Themicrofuge tube was shaken at 37°C vigorously for 30 minutes, and thencentrifuged in a Beckman GS-6 centrifuge at 2,500 xg for 10 minutes at roomtemperature. The supernatant was discarded, and the cell pellets wereresuspended in 100 jiL of LB medium. The cells were shaken at a speed of200 cycles per minute at 37°C for about 30-45 minutes.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 36100 IlL aliquot of cell suspension were plated on the skim milk LB agar platesthat contained tetracycline with the concentration of 10 jiLImL. The plateswere incubated in a 35°C incubator overnight.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 37Table 3.2: Media composition for Bacillus sublilis transformationNote:Transformation Medium TF I (mL) TF II (mL)Spizizen’s Salt Solution(10x)* 2.0 3.6Casamino Acid (2%) 0.2 0.18Amino Acid (1 mg/mLforeach) 1.0 0.18Glucose(5%), MgSO4.7H20(0.2%) 2.0 3.6Distilled water 14.8 28.44Total Volume 20 36Chemicals Amount (in 1 L H90)(NH4)2S0 20 gK9HPO4 140 gKH,PO4 60 gNa-citrate 10 g• Amino acid solution was made by dissolving 10 mg each of 20 amino acids in10 mL of water and filter sterilized. The solution was stored at -20°C freezer.• Casamino acid solution was made by dissolving 1 g casamino acid in 50 niLdistilled water. The solution was autoclaved at 121°C for 15 minutes andstored at 4°C.• Glucose with Mg504 solution was made by dissolving 5 g glucose and 0.2 gMgSO4.7H20in 100 niL water. The solution was autoclaved at 121°C for 15minutes and stored at 4°C.*Spizizenhs Solution Composition (lOx)Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 383.2.9. Site Directed MutagenesisThe procedure consists of three major steps: premutation preparation, site-directedmutagenesis, and screening the mutant.1. Premutation preparationThe preparation includes synthetic oligonucleotide purification, the production ofbacteriophage, and single-stranded DNA preparation. The synthetic oligonucleotidepurification can be described by the following steps:• The oligonucleotide DNA was synthesized in the Department of Biochemistry,University of British Columbia.• The synthetic oligonucleotide DNA was purified by using a Sep-Pak C-18reverse phase column. The column was washed with 10 mL acetonitrilefollowed by 10 mL sterile distilled water.• The crude oligonucleotide was dissolved in 3.0 mL 0.5 M animonium acetatesolution, and the solution was then slowly loaded to the column through asyringe.• The column was washed with 10 mL of sterile distilled water. In order to avoidunexpected loss of the DNA molecules during the wash, the effluent wascollected in sterile Eppendorf tubes.• 3 mL of 20% acetonitrile elution buffer was loaded to the column and theeffluent of each mL of the buffer was collected in sterile Eppendorf tubes.• 50 tL of the first 1 mL effluent was diluted to 1 mL with 20% acetonitrile.The concentration of oligonucleotide was determined on the UVspectrophotometer by measuring the absorbance at 260 nm (1 A269 = 50 ig/mL). The sample was then vacuum dried. The dried sample was dissolved in20 iL sterile distilled water and stored in a -20°C freezer.The production of bacteriophage can be described by the following steps:Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 39• Escherichia coli CJ236 was transformed with a phagemid containing partialsubtilisin E gene of to obtain DNA molecules that contained uracil residues.Then the transformants were used for single stranded DNA production.• 2.5 mL 2XYT medium that contained ampicillin (100 j.tg/mL) was inoculatedwith the CJ236 transformant and incubated at 37°C with vigorous agitation forabout 2—3 hours.• 3—5 pL of M13K07 helper phage was added to the culture and incubated at37°C with vigorous shaking overnight.The single-stranded DNA preparation contains the following steps:• 1 mL supernatant of the above overnight infected culture was collected bycentrifuging the above overnight infected culture at 5,000 xg for 5 minutes in aEppendorf centrifuge (541 5C).• 150—200 jiL of 20% polyethyleneglycol (PEG 8000) in a 2.5 M NaC1 solutionwas added to the supernatant. The mixture was stored in a cold room (4°C) for30 minutes and then centrifuged at 12,000 xg for 10 minutes. The supernatantwas then completely decanted. The remaining droplets in the microfuge tubewere wiped off by using small pieces of Whatman paper without touching theDNA pellet at the bottom of the tube.• The pellets were dissolved in a 100 tL TE solution and extracted with 100 jiLphenol. After being vortexed for several seconds, the mixture was centrifugedat 5,000 xg for 5 minutes. The aqueous layer was transferred to a newmicrofuge tube and mixed with 25 jiL 10 M sodium acetate and 300 jiL of95% ethanol (two volumes of the aqueous solution). The solution was storedat -20°C overnight or longer.• After the single stranded DNA was recovered by centrifuging the ethanolsolution at 16,000 xg for 10 minutes, the single stranded DNA was washedwith 70% ethanol, dried for several minutes at room temperature, andChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 40dissolved in 20 tL sterile distilled water. The DNA solution concentration wasestimated by the UV spectrophotometer or by the agarose gel electrophoresis.2. Site-directed mutagenesisThe Bio-Rad mutagenesis kit was purchased for site-directed mutagenesis.Included in the kit are: T4 DNA polymerase, T4 DNA ligase, lOx Synthesis buffer, lOxAnnealing buffer and T4 DNA Polymerase dilution buffer (the compositions for buffersare shown in Appendix A). The site-directed mutagenesis consists of the phosphorylationof oligonucleotide, annealing of the oligonucleotide to the single stranded DNA, in vitrosynthesis of the second strand DNA, and transformation.The purified oligonucleotide was phosphorylated in a 10 p.L mixture that consistedof:• 10 pmol oligonucleotide,• 1 I.tL l0xkinase buffer (see Appendix A),• 1pLof1OmMATP,• 1 jiL (1 unit) of kinase, and• water.The mixture was then incubated at 37°C for 30 minutes, 65°C for 10 minutes, and thenstored at -20°C.The annealing reaction was carried out in a 10 j.iL mixture of• 1 pmole of phosphorylated oligonucleotide,• 0.05 to 0.1 pmole of single stranded DNA,• 1 j.tL 10 x annealing buffer, and• water.The reaction mixture was incubated at 80°C for 5 minutes, cooled down to and incubatedat 30°C for 30 minutes and then stored on ice.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 41The in vitro synthesis of the second strand DNA was conducted through theextension reaction. This reaction was carried out in a mixture that consisted of• 1 pL 1 Oxsynthesis buffer,• 0.5 jiL T4 DNA ligase (2.5 units),• 0.25 i.L Gene 32 protein (1 jig),• 0.25 j.tL of T4 DNA polymerase (1 unit), and• 10 j.tL of annealing mixture.This mixture was incubated on ice for 5 minutes, at room temperature for 5 minutes, andat 37°C for one and half hours.In the transformation of E. coli MC1O61, 5 jiL of the above synthesized doublestranded DNA was used.The mutant plasmid DNA molecules were prepared from the E. coli MC1O61transformants. To analyze the DNA, the DNA was screened by digesting it with restrictionenzymes. Since the mutagenesis introduced a new restriction site on the mutant DNA, thedifference between the digestion patterns of the original DNA and the mutant DNA can beobserved by agarose gel electrophoresis.3.2.10. DNA SequencingDouble stranded DNA sequencing method was used. The sequencing process containsthree parts: the double stranded DNA denaturation, annealing of the denatured DNA witha sequencing primer, and the DNA sequencing.Recombinant plasmid DNA from blue script KS plus (see Appendix D), whichcontained gene fragment containing 221 position on subtilisin E or thiolsubtilisin wasdenatured. The following mixture was made:• 15 IlL double stranded DNA (—30 jig),• 2.4 j.tL 2.5 mM EDTA,• 3.0 IlL 2M NaOH, andChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 429.6jiLH2O.The mixture was incubated for 30 minutes at 37°C and neutralized with 3 iL (0.1 volumeof the mixture) 3 M sodium acetate (pH 4.8). The denatured double stranded DNA wasprecipitated by adding 120 p.L 95% ethanol (2-4 volumes of the denatured solution). TheDNA pellets were washed with 70% ethanol and dried at room temperature for a fewminutes.The denatured double stranded DNA was annealed with a primer DNA. Thefollowing reagents:• 7 tL distilled water,• 2 IlL sequenase reaction buffer (see Appendix A), and• 2 iL primer (-60 ng)were added to an eppendorf microfuge tube containing the pellets of the denatured doublestranded DNA and kept on ice. The mixture was then kept at 37°C for 25 minutes andcooled down to room temperature for 5—10 minutes.Extension reaction mixture was made and added to the 11 p.L annealing mixture.For each reaction, the extension reaction mixture was composed of• 1p.L0.1MDTT,• 2 IlL ixA mixture (5xA mixture = 7.5 iM dGTP, 7.5 iM dCTP, 7.5 pMdTTP),• 0.5pLdATP35S,• 2 IlL sequenase (1.5 units/pt), and• 0.5 jiL distilled water.A microtitre plate which contained 2.5 IlL termination mix per well was prepared.Each temination mix was made of• 80 IIM dGTP, 80 IIM dATP, 80 IIM dCTP, 80 jiM dTTP,• 80 jiM of one ddATP, ddGTP, ddCTP, or ddTTP for each well,• 50 mM NaC1.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 43The microtitre plate was prewarmed on a thermal block at 37°C--42°C. The 3.5 jiL aliquotextension mixture was transferred to four wells on the microtitre plate. Sequencingreaction was completed by incubating the microtitre plate at 37°C—42°C for 5 minutes.The reaction was stopped by adding 4.5 j.tL stopping dye that consisted of• 95%formamide,• 20 mM EDTA,• 0.05% Bromophenol blue, and• 0.05% xylene Cyanol FFto each well. The microtitre plate was kept on boiling water for 2 minutes and then storedon ice. 2.5—3 iL sample from each well was loaded on the sequencing gel to carry out theelectrophoresis.For DNA sequencing, 8% sequencing gel was prepared by mixing the followingchemicals in a flask:• 37.5 gurea,• 15.0 mL acrylamide (40% with the ratio of acryl to bisacryl 38:2),• 7.5 mL 1OxTBE buffer, and• 25.OmLHThe chemicals in the mixture were dissolved by warming the flask to 50°C for about 5minutes, then the flask was cooled down to room temperature or slightly below. 495 ilL10% APS (ammonium persulfate) and 22.5 IlL TEMED (N, N, N’, N’-tetramethylethylenediamine) were then added. The gel was delivered by a syringe to the space betweentwo glass plates which were fit to a vertical electrophoresis apparatus. The gel wassolidified at room temperature.3.2.11. Proteolytic Activity AssayThe proteolytic activity of subtilisin and its mutant was assayed by using two substrates,azocasein and succinyl-Ala-Ala-Pro-Phe-p-NA (suc-AAPF-pNA) alternatively. TheChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 44azocasein method, which was initially used for the proteolytic measurement of microflorain milk (Ewings et al., 1984), was used in the present experiments for monitoring theproduction of subtilisin during the Bacillus subtilis growth. This method was adaptedbecause subtilisin has a broad range of substrate specificity and because casein waspreviously used as a substrate for subtilisin proteolytic assay (Hagihara et al., 1958). Theazocasein assay procedure can be described by the following steps:• 1.5% azocasein was made in a 0.1M Tris•HC1 pH 7.5 buffer and the solutionwas boiled for a few minutes to dissolve azocasein completely. The solutionwas filtered through Whatman #1 paper and kept at 4°C.(Note: The solution should not be prepared for longer than one or two daysbefore the experiment to avoid microbial growth.)• 1.0 mL 0.1 M Tris•HC1 pH 7.5 buffer and 0.2 mL culture supernatant thatcontained the enzymes were added to 1.0 mL of 1.5% azocasein solution.The absorbance of each solution was measured at 366 nm and recorded asA0. The blank reaction was carried out by mixing 1.2 mL 0.1 M TrisHC1 pH7.5 buffer with 1.0 mL of 1.5% azocasein solution. The absorbance of eachsolution was measured and recorded as B0.• The mixtures (both reaction mixture and blank mixture) were incubated at 37°C for one hour.• 2 mL of 15% (WIV) trichioroacetic acid was added to the mixture to stop thereaction. The resulting solution containing precipitants was stored on ice bathfor about 15 minutes. The precipitates were removed by centrifuging thesample in Beckman GS-6 centrifuge at 2,500 xg for 30 minutes at roomtemperature.• The absorbance of the supernatant was measured at 366 nm on the Shimadzu260 UV spectrophotometer as A1; while the blank reading was recorded asB1.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 45The enzyme activity can be expressed as the change between the absorbance ofthe samples minus the change between the absorbance of the blank over the period of onehour:[A, —A0] [B1—B0]Activity =1 HourThe suc-AAPF-pNA assay method, which was developed by Delmar et al. (1979),was used to measure the proteolytic activity of subtilisin. Because the substrate, sucAAPF-pNA, contains a Phe residue at its P1 cleavage site which is preferred by subtilisinfor proteolysis, this method has widely been used as a sensitive assay for subtilisin and itsmutant. The suc-AAPF-pNA assay procedure can be described by the following steps:• 0.1 mM of suc-AAPF-pNA was prepared in a 0.O1M sodium phosphatebuffer (pH 8.0). The solution was filtered by using a 0.45 !Im filter.• 2 mL aliquots of solution were transferred to each of the reference andsample cells in the Shimadzu 260 UV spectrophotometer.• 1 mL 2xYT sterile culture medium was added to the reference cell and 1 mLof culture supernatant to the sample cell at room temperature. Theabsorbance at 410 nm during the next 60 seconds was recorded at 10 secondintervals.The proteolytic activity can be expressed as the change in absorbance at 410 nm over oneminute.3.2.12. SDS-PAGE Electrophoresis (Phast System)1) Production of crude enzymesB. subtilis transformants carrying plasmid DNAs pAP65 derivatives that contain theenzyme genes were inoculated in 2xYT medium with tetracycline added at a concentrationof 10 ig / mL The culture was grown at 37°C with vigorous shaking (300 rpm/mm.) for24 hours. During this time, the absorbance of the culture suspension was measured toChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 46monitor the bacterium growth, and the proteolytic activity of the culture supernatant wasassayed to monitor the production of the protease along with this growth.2) Preparation of crude enzyme from culture supernatantCulture supernatant was collected by pelleting the cells in the Beckman GS-6 centrifuge at2,500 xg for 30 minutes at room temperature. Then the supernatant was dialyzed against0.01 M phosphate buffer pH 6.2 for 24 hours at 4°C with four changes of buffer. Dialyzedsupernatant was frozen at -20°C overnight and lyophilized. Dried matter was used forSDS-PAGE electrophoresis.3) SDS-PAGE electrophoresis.The procedure of SDS-PAGE electrophoresis can be described as follows:• 5 mg dried matter prepared previously was dissolved in a 80 iiL 0.01 Msodium phosphate buffer (pH 6.2). 20 pL 10% SDS and 2 tL -mercaptoethanol were then added.• The mixture was heated in boiling water for 5 minutes. After cooling down themixture, 1 iL 1 % bromophenol blue was added.• 3 tL sample was loaded on a 10—15 % gradient gel to carry out theelectrophoresis on the Phast system.• The gel was then transferred to the development chamber and silver stainingwas used to stain the gel.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 473.3. Results and Discussion3.3.1. Site-Directed Mutagenesisfl Construction of pLC658The nucleotide sequence of the subtilisin E structural gene (aprE) and the inferredtranslated amino acid sequence are shown in Figure 3.1. Four restriction enzymerecognition sites: two Hpa I sites, one Hind III site, and one Pvu II site were utilized inlater experiments. The Ser22 1 site, which is to be changed to Cys, is indicated in thefigure.In order to carry out the site-directed mutagenesis, the DNA fragment containingthe mutation site has to be linked to a vector DNA that can be propagated in E. coli. Thusa recombinant plasmid DNA pLC658 was made in the present experiments for thispurpose. The construction route is shown in Figure 3.2.The plasmid DNA pAP65 that contained aprE was used as the starting material forthe construction of pLC658. As indicated in Figure 3.2, pAP65 carries a tetracyclineresistance gene (Tcr) and an origin (On) for the replication in Bacillus subtilis. Thecoding region for aprE is highlighted on the map.Plasmid DNA pUC1 18 was used as a vector DNA in the present experiments.Some properties and features of this plasmid DNA are shown in Figure 3.3. pUC1 18 hasan origin (On) for the replication in E. coli, a selectable marker for ampicihin resistance(amp’), an amino-terminal fragment (lac) the lacZ gene (3-galactosidase) to facilitate ocomplementation, and a major intergenic region from Ml 3 (filamentous bacteriophage) forinitiation and termination of the viral DNA synthesis.Chapter 3 Conversion of Subtilisin E to ThiolsubtilisinFigure 3.1: Nucleotide sequence of aprE and amino acid sequence(from Stahl and Ferrari, 1984).481a—100fMet Arg Ser Lys Lys Leu Trp Tie Ser Leu Leu Phe Ala Leu Thr Leu101 TCTACTCTGAATTTTTTTAAAAGGAGAGCGTAAAGA CTG AGA AGC AAA AAA TTG TGG ATC AGC TTG TTG TTT CCC TTA ACG TTA--_-70Al Phe Ser AsnCCC TTC ACt ARC—90Tie185 ATCGly260 GGA—40Gin335 CAAPro410 CCGI le485 ATTAsp560 CAtC ly635 CCCPro710 CCAf le785 ATTLyS860 AAASer935 ACtArg1010 AGAGly1085 GGA5cr1160 TCTPhe1235 TTCPhe Thr MetTTT ACG ATG—60Phe Lys Gin Thr MetTTT AAA CAG ACA ATGLys Gin Phe Lys TyrAAG CAA TTT AAG TAT—105cr Val Ala Tyr ValAGC GTT GCA TAT GTGLys Ala Pro Ala LeuAAA CCC CCG GCT CTT40Ser 5cr His Pro AspTCT TCT CAT CCT CAt645cr 5cr His Gly ThrACT TCT CAC GGT ACG90Ser Ala 5cr Leu TyrACt GCA TCA TTA TATGlu Trp Ala lie SerGAG TGG GCC ATT TCC140Thr Val Val Asp LysACA GTC GTT GAC AAAThr Ser Thr Val ClyACA AGC RCA GTC GGC190Ala Ser Phe Ser 5crGCT TCA TTC ICC AGCGly Thr Tyr Giy AlaGGC ACT TAC CCC GCT240Lys His Pro Thr TrpAAG CAC CCG ACT TGGTyr Tyr Cly Lys GlyTAt TAT GGA AAA GGG—80Met 5cr Ala Gin Ala Ala Gly Lys 5cr 5cr Thr Glu Lys Lys Tyr lie ValAIG TCT CCC CRC GCT GCC GCA RAR AGC AGT ACA GAA AAG AAA TAC ATT GTC—50Ser Ala Met Ser 5cr Ala Lys Lys LysAsp Val lie 5cr Glu Lys Gly Cly Lys ValAGI GCC ATG AGT TCC GCC AAG AAA AAG CAT GIT ATT TCT GAA AAA CCC GGA AAG GTT—30 —20Val As,, Ala Ala Ala Ala Thr Leu Asp Clu Lys Ala Vai Lys Giu Leu Lys Lys AspCTT AAC GCC CCC GCA GCA RCA TTG GAT CAR AAA GCT GTA AAA GAA TTG AAA AAA CATHpcI—1 1 10lu Glu Asp His lie Ala His Glu Tyr Ala Gin 5cr Val Pro Tyr Gly lie 5cr GinGAA GAA CAT CAT ATT GCA CAT GAA TAT GCG CAA TCT GIl CCT TAT CCC ATT TCT CAA20 30 32His 5cr Gin Gly Tyr Thr Gly Ser Asn Val Lys Val Ala Vai Tie Asp Ser Cly lieCAC TCT CAA CCC TAC ACA CCC TCT AAC CTA AAA CTA GCT GTT ATC CAt AGC 6CR ATT50 60Leu Asn Val Arg Gly Gly Ser Phe Vai Pro Ser Glu Thr Asn Pro Tyr Gin AspTTA AAC GTC AGA GGC GGA GCA ACt TTC GTA CCI TCT CAR ACA AAC CCA TAC CRC CRC70 80His Val Ala Giy Thr Tie Ala Ala Leu Asn Asn 5cr Ne Giy Val Leu Gly Val 5crCAT GTA CCC GGT ACG ATT CCC GCT CTT RAT ARC TCA ATC CGT GTT CTG GGC GIT ACt100 110Ala Val Lys Vai Leu Asp Ser Thr Giy Ser Gly Gin Tyr 5cr Trp lie lie Asn GlyGCA CIA AAA GTG CTT CAT TCA RCA GGA AGC CCC CRA TAT AGC TGG ATT ATT AAC CCC120 130Asn Asn Met Asp Val lie Asn Met 5cr Leu Gly Gly Pro Thr Giy 5cr Thr Ala LeuARC AAT ATG CAT GTT ATC ARC ATC AGC CTT GGC GGA CCI ACT GGT TCT RCA GCG CTG150 160Ala Val Ser 5cr Cly lie Val Val Ala Ala Ala Ala Gly Asn Glu Gly 5cr 5cr GlyGCC CTT ICC AGC GGT ATC GTC GTT CCT CCC GCA CCC GGA RAt GAA GGT TCA ICC GGA170 180Tyr Pro Ala Lys Tyr Pro 5cr Thr Tie Ala Val Gly Ala Val Asn 5cr Scr Asn GinTAC CCT 6CR AAA TAT CCT TCT ACT ATT GCA CIA GGT CCC CIA RAt AGC ACt ARC CAA200 210Ala Gly 5cr Giu t.eu Asp Val Met Ala Pro Gly VaT 5cr lie Gin 5cr Thr Leu ProGCA CCI TCT GAG CTT CAT GIG ATG GCT CCT CCC GTG TCC ATC CAR AGC ACA CTT CCI220 221 230Tyr Asn Giy Thr 5cr Met Ala Thr Pro His Val Ala Gly Ala Ala Ala Lcu lie LeuTAT RAt 6CR ACG TCC ATC 6CC ACT CCT CRC GTT CCC GGA GCA GCA CCC ITA ATT CIT250 260Thr Asn Ala Gin Vai Arg Asp Arg Leu Glu 5cr Thr Ala Thr Tyr Leu Gly Asn 5crRCA ARC CCC CAR GTC CCT CAT CCI TTA CAR AGC ACT GCA ACA TAT CTT GGA AAC TCT270Leu lie Asn Val Gin Ala Ala Ala Gin OCTTA ATC ARC CIA CAR GCR GCT GCA CAA TRA TAGTARAAAGAAGCAGGTTCCTCCATACCTCCTICPvIAJL13181418 ACAAGCRCCGGAGGATCAACCTGCTCAGCCCCGTCACGGCCAAATCCTCAAACGTTTTAACACTGGCTTCTCTGTTCTCTGTCChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 49Figure 3.2: Construction route for pLC658.Hpa IHind ifiPvu 0.67 kb0.33 kbHindill -I I Digestion with HpaIPurification of 1.7kb DNA fragmentLigate ISmaI/HpaIHind IIIPvu II0.67 kbHind IIISmal/ Hpa IEcoR IHind III1.3 kb Hpa IaprEpAP6516 kb1.8 TCrHind III0.7 kbHpaI_______________HpaIpUCII8 H1.7kbSmal digest_jlac ZpLC6584.9kbapr EChapter 3 Conversion of Subtilisin E to ThiolsubtilisinFigure 3.3: Gene features of pUC118 (from Sambrook et al. 1989).2674 EcoOlO9.2622 AatIl2501 SspI2299AfIflI 8061000504 5 6 1 2 3 4 5 6 7 8 9 10 Ii 12 13 14Asn Set Set Set Vat Pro Gly Asp Pro teo Glu Ser Thr Cys Arg HisACG AAT TCG AGC TCG GTA CCC GGG GAT CCI CIA GAG TCG ACC TGC AGG CATl_ I_______l________ _______EcoRt Sad Kpnl Smal BamHl Xbal Sail PstlXmal AcclHincll4 1 2 3 4 5 6 7 8 9 10 II 12 13 14 15 16 17 18 5 6 7 8Thr Pro Set Leu His Ala Cys Arg Set Thr Leu Giu Asp Pro Arg Vat Pro Set Se’ Ass Set Leu AlaACG CCA AGC TTG CAT GCC TGC AGG TCG ACT CIA GAG GAl CCC CGG GIA CCG AGC TCG AAT TCA CIG GCC___I _ ___ __I__ ___l_HindlIl Sphl Pstl Sail Xbal BamHI SmaI Kpnl Sad EcoRIAcct XmalHinclIIn pUCI18, the EcoRI site lies immediately downstream from Pjac. In pUCI19, the Hindlll site ties immediately downstream from Iac•1 2 3Thr Met lieATG ACC ATG ATTPolyclonlng SitespUCII8I 2 3Thr Met lieATG ACC MG ATTpucligBgII 1830AvaIl 183815 16 17 18 7 8Ala Set Leu Ala Leu AlaGCA AGC TIG GCA CTG GCC___ISpht HindIlIChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 51The process and the results are summarized as follows:• B. subtilis DB428 was first transformed with pAP65 and the transformantswere used for the preparation of pAP65. About 1.5 jig of pAP65 wasobtained from a 10 mL B. subtilis culture and was then dissolved in 20 jiLsterile distilled water.• E. coli MC1O61 was transformed with pUC1 18 and pUC1 18 was preparedfrom 2.5 mL E. coli. About 7.5 jig pUC1 18 was obtained and dissolved in100 jiL sterile distilled water.• pAP65 was digested with restriction enzyme Hpa I while pUC1 18 wasdigested with restriction enzyme Sma I.• The 1.7 kb interested DNA fragment from pAP65 and cut open vector DNApUC 118 were purified after the agarose gel electrophoresis.The digestion of pAP65 with Hpa I resulted in four DNA fragments having thefollowing sizes: 13 kb, 1.7 kb, 1.3 kb, and 0.2 kb. The 1.7 kb fragment that containedaprE was purified by using DEAB-cellulose elution method from the agarose gel. Thedigestion of pUC1 18 resulted in a linearized DNA pUC1 18. The linearized pUC1 18 wasextracted from the gel by the electroelution. The resulting DNA fragments from pAP65with Hpa I, and from pUC1 18 with Sma I were both blunt ended. Therefore the purifiedlinearized pUC 118 and 1.7 kb fragment were ligated at 16°C overnight.The resulting DNA produced by ligation was named pLC658 as indicated in Figure3.2. E. coli JM1O9 was transformed with pLC658. Two white colonies and many bluecolonies were formed after an overnight incubation at 3 5°C. The two white colonies wereselected and used for preparing plasmid DNA pLC658. About 5.0 jig pLC658 wasobtained from 2.5 mL E. coli culture. 10 jiL pLC658 (about 500 ng) was digested withEcoR I and BamH I, and the same amount of pLC658 was digested with Hind III. Figure3.4 shows the digestion pattern of pLC658 on agarose gel. Lane 2 and 4 showed a 1.7 kbfragment when the DNA was digested with EcoR I and BamH I; while lane 3 and 5Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 52showed a 1.0 kb fragment when the DNA was digested with Hind III. Thus it is suggestedthat 1.7 kb DNA fragment from pAP65 was inserted on pUC1 18.However, the above process could result in two possible pLC658 with theopposite directions of inserted 1.7 kb DNA fragment. The one with subtilisin E genedirection that is the same as that of the replication of pUC 118 was chosen for the laterexperiments. This choice was made based on the DNA sequencing results (which wasperformed by Dr. A. Matsuyama, 1993).2’) Mutation and MutantKunkel’s site-directed mutagenesis method was used to conduct the mutation. The methodstarted with the transformation of E. coli CJ236 with pLC658 DNA and the singlestranded DNA preparation. About 0.2.ig of single stranded DNA from pLC658 wasobtained and prepared in 10 IlL sterile distilled water. This single stranded DNA was usedas the template DNA for mutagenesis.Two oligonucleotide primers were used in the site-directed mutagenesis. The DNAsequence of these two primers are shown in Table 3.3. Primer 1 was used to direct themutation, while primer 2, which is a universal primer for DNA sequencing, was used hereto increase the mutagenesis efficiency. The primer 1 is complementary to the singlestranded DNA template in the Ser221 region on subtilisin E gene with two mismatches (asindicated by * in Table 3.3). On this primer, a restriction Nsi I site (underlined in Table3.3) which is absent in the original template DNA was also included. This site was laterused as an indicator of the mutation. If the mutation is introduced, DNA is to be cut byNsi I; whereas if no mutation is introduced, DNA is not to be cut by Nsi I. The mutagenicprimer 1 in fact changed two codons, TCC —> TGC and ACG —> ACA. However, only thechange of TCC — TGC resulted in the change of translated amino acid from Ser to Cys.Because both ACG and ACA code for Thr residue, the change of ACG — ACA couldnot result in any change of amino acid in subtilisin E.Chapter 3 Conversion of Subtilisin E to ThiolsubtilisinFigure 3.4: Gel electrophoresis of pLC658 digestion pattern.53Lane DNA with Enzyme1 Molecular marker (DNA Hind III digest)2 Sample 1 digested with EcoR land BamHI.3 Sample 1 digested with Hind III.4 Sample 2 digested with EcoR I and BamHI.5 Sample 2 digested with Hind III.(Note: Sample 1 and sample 2 were white colony transformants)1234523,l3Obp —__9,416bp6,557 bp4,361 bp2,322 bp2,027 bp0,564 bp A.7 kb1.0 kbChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 54The phosphorylated two primers were annealed with 5 IlL (100 ng) single strandedtemplate DNA. After in vitro DNA synthesis and ligation, the heteroduplex was used forthe transformation of E. coli MC1O61, the transformant colonies were picked randomlyfor screening.The screening for the mutant was conducted by digesting the plasmid DNAprepared from the transformants with Nsi I and EcoR I. Because the original plasmidDNA does not have a Nsi I site, the digestion with Nsi I and EcoR I can only result in oneband. However, the mutant, which is named as pLC658M has a Nsi I site, therefore thesame digestion can result in two cuts on the plasmid DNA. Figure 3.5 shows the digestionpatterns of pLC658 and its mutant pLC658M. Three digestions were conducted: 1) withNsi I and EcoR I; 2) with Hind III; 3) with EcoR I and BamH I. Lanes 2, 4, and 6 are forpLC658M, and Lane 3, 5, and 7 are for pLC658. The digestion patterns are the samewhen the DNA was digested either with Hind III or with EcoR I and BamH I. However,pLC658M (Lane 2) shows an extra 0.9 kb fragment when digested with Nsi I and EcoR I.This indicates that the new restriction site Nsi I was introduced to pLC658M, thus amutation was introduced to the pLC658M. Therefore, pLC658M contains thethiolsubtilisin gene.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 55Table 3.3: Nucleotide sequences of two primers usedfor site-directed mutagenesis.Primer Sequence1 3?TTGCCTTGT*AC*GTACCGCT 5’2 3’CAGCACTGACCCTTTTG5’Chapter 3 Conversion of Subtilisin E to ThiolsubtilisinFigure 3.5: Comparison of digestion patterns of pLC658 and pLC658M.56Lane DNA with Enzyme1 Molecular marker.2 pLC658M digested with mixture of Nsi I and EcoR I.3 pLC658 digested with mixture of Nsi I and EcoR I.4 pLC658M digested with Hind III5 pLC658 digested with Hind III6 pLC658M digested with EcoR I and BamH I.7 pLC658 digested with EcoR I and BamH I.123456723,l3Obp —9416bp ____—6:557 bp4,361 bp2,322 bp2,027 bp ___-_———0,564 bp_______1.7kb1.0kb0.9 kbChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 573.3.2. Expression of Subtilisin E Gene and Thiolsubtilisin Gene1 Plasmid DNA pAP65DIn order to express genes in B. subtilis, a plasmid DNA having a replication origin in B.subtilis is required. In the present experiment, the plasmid DNA pAP65D was made frompAP65 by deleting all Hind III fragments on it and was then used for the expression ofsubtilisin and thiolsubtilisin genes in B. subtilis.pAP65 has four Hind III sites (their relative positions are shown in Figure 3.2).Therefore, the complete digestion of pAP65 would result in four DNA fragments with theapproximate lengths of 0.7 kb, 1.0 kb, 2.3 kb, and 12.0 kb (as calculated from therestriction map in Figure 3.2). Figure 3.6 lane 1 is the Hind III digestion pattern of pAP65(four bands were clearer on original photo).The largest fragment (about 12 kb) was purified from agarose gel, and ligated invitro to become a circular plasmid DNA. The resulting plasmid DNA was named aspAP65D. The B. subtilis DB428 transformants with pAP65D produced colonies withouthalos on skim milk LB agar plates containing tetracycline (10 j.tg/mL) as shown in Figure3. 8d, after 12— 16 hours incubation at 3 5°C. It is known that if the plasmid DNA containsany active protease gene, the transformant (for example, pAP65) will produce haloesaround the colonies as shown in Figure 3.8c. Since no halo was found around its colony., itcan be concluded that pAP65D contained no active subtilisin E gene. pAP65Dtransformants were propagated as described for plasmid DNA pAP65 preparation. Thepartial restriction map is shown in Figure 3.7. pAP65D was then used to harbor activesubtilisin B and thiolsubtilisin genes.Chapter 3 Conversion of Subtilisin E to ThiolsubtilisinFigure 3.6: Hind HI digestion pattern of pAP65.58Lane DNA with Enzyme1 pLC65 digested with Hind III.2 Molecular marker.—12.0 kb________2.3 kb__1.0 kb0.7 kb23,130 bp4,361 bp2,322 bp2,027 bp0,564 bpChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 592) Plasmid DNA pAP65D8 and pAP65D8MThe plasmid DNA pAP65D8 and pAP65D8M were those used for the expression ofsubtilisin £ and thiolsubtilisin. pAP65D8 was made by ligating the 1.0 kb Hind IIIfragment from pLC658 (which contains the active site gene of subtilisin E) with pAP65D,while pAP65D8M (which contains the active site gene of thiolsubtilisin) was made byligating 1.0 kb Hind III fragment from pLC658M with pAP65D. Figure 3.7 is theconstruction route for pAP65D8 and pAP65D8M.In the construction, pAP65D was cut open by Hind III digestion and purified fromthe agarose gel electrophoresis using the electroelution method. Two 1.0 kb Hind IIIfragments isolated from pLC658 and pLC658M were purified from agarose gel usingDEAE-cellulose elution method. Both fragments were then ligated with linear pAP65Dindividually. Both ligation mixtures were used for the transformation of B. subtilis DB428.The plasmid DNA pAP65D and pAP65 were used as the controls for the transformation.In Figure 3.7, it is noticeable that pAP65D contains a small portion of the subtilisinE gene (as indicated by the shaded area in the figure). This portion contains promoter andprepro region genes from aprE. 1.0 kb DNA fragments from pLC658 and pLC658Mwould have two possible opposite insertions. However, only when the insertion whichlinks the active site gene region to the small portion gene region on pAP65D, will theactive subtilisin E be expressed. The successful expression can be shown by thetransformants on the skim milk agar plate, that is, if the right insertion of the 1.0 kbfragment occurred, the active subtilisin E gene would be formed and the transformantwould produce a halo on an agar skim milk plate.The transformants with pAP65D8, pAP65D8M, pAP65D, and pAP65 weretransferred to four different new plates and incubated for approximately 12 hours. Figure3.8 presents the pictures of four plates after incubation. The halo formation around thetransformants of pAP65 and pAP65D8 was expected, since both plasmid DNA carry thesubtilisin E gene. It was known that the transformant of pAP65D cannot produce a haloChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 60around the colony (as stated earlier in this section). The results from transformation withpAP65D8M showed that the transformant did produce a halo around its colony, and thehalo size was smaller than that of pAP65 and pAP65D8 transformants.The reason that the pAP65D8M transformant produces a smaller halo may be dueto the mutation that was introduced at the active site on pAP65D8M. Mutant enzyme,thiolsubtilisin has the lower proteolytic activity than subtilisin, and this lower proteolyticactivity causes thiolsubtilisin to digest the skim milk on the plate less effectively thansubtilisin E.The plasmid DNAs prepared from the transformants were further analyzed.pAP65, pAP65D8, pAP65D8M, and pAP65D were digested with Hind III and Nsi Iseparately. Figure 3.9 shows the digestion patterns of the plasmid DNA prepared. It wasfound that pAP65D8M (Lane 5 and 6) had an extra band when digested with Nsi I thandid pAP65D8. Therefore, one may conclude that the pAP65D8M carries the thiolsubtilisingene.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 61Figure 3.7: Construction route of pAP65D8 and pAP65D8M.pLC658MHind ifi49kb,fIIIHpa IpLC658Z’HifldHpa IHpaI .Purification of 1.0 kbHind ifi fragmentHindlil PvuII ndllIPvu IIHind Ill Hind ifiChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 62Figure 3.8: Agar plate pictures of transformants.Note: Each of the plates contains: LB medium, 1.5% Agar, 1.5% skim milk andtetracyline (10 LImL).(a) B. Subtilisin DB428 transformants with plasmid DNA pAP65D8M and pAP65D8.(b) B. Subtilisin DB428 transfonnants with plasmid DNA pAP65D8M and pAP65.(c) B. Subtilisin DB428 transformants with plasmid DNA pAP65 and pAP65D8.(d) B. Subtilisin DB428 transformants with plasmid DNA pAP65D.(a) (b)pAP65(c) (d)Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 63Figure 3.9: Hind III and Nsi I digestion pattern of pAP65 and pAP65D,pAP65D8 and pAP65D8M.Lane DNA with Enzyme1 pAP65 digested with Nsi I.2 pAP65D digested with Nsi I.3 & 4 pAP65D8 digested with Nsi I.5 & 6 pAP65D8M digested with Nsi I.7 pAP65 digested with Hind III.8 pAP65D digested with Hind III.9 & 10 pAP65D8 digested with Hind III.1 l&12 pAP65D8M digested with Hind Ill.13 Molecular marker.1 2 3 4 5 6 7 8 9 1011121323,130 bp9,416 bp6,557 bp—-------- 4,361bp____—2,322 bp2,027 bp0,564 bpChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 643.3.3. DNA SequencingThe genes on the plasmid DNA pAP65D8 and pAP65D8M were sequenced around themutation site (221 site). In the sequencing, DNA fragments containing the subtilisin Egene from pAP65D8 and the thiolsubtilisin gene from pAP65D8M were constructed onplasmid Blue Script for DNA sequencing. Such a process is shown in Figure 3.10.Figure 3.11 is the DNA sequence of subtilisin E gene and thiolsubtilisin gene attheir active 221 site region. 3’ strand DNA of the genes were illustrated on the figure,which was complementary to 5’ strand DNA sequence shown in Figure 3.1. DNAsequencing confirmed that the codon TCC at the active site was changed to TGC on themutant gene, that is, Ser221 on subtilisin E was replaced by Cys. The result also showsthat the codon ACG was changed to ACA, which could not result in the change of Thrresidue on the wild type subtilisin E. Therefore, thiolsubtilisin contains only one mutationsite ( Ser 22lCys).The sequencing for the entire subtilisin E gene and thiolsubtilisin gene was alsoconducted by Dr. A Matsuyama (1993). His results, shown in Appendix C, haveconfirmed the present observations.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 65Figure 3.10: Recombinant plasmid construction route for DNA sequencing.Hind IIIHpa IPurification of 1.0kbDNA fragmentHind IIIV Hind IIIpBS KSSac IHind IIIHinc IIHinc II____________________Hind IIIPurification of 0.7 kbHincil fragmentHinc II Hinc II_____pBSKSI Ligate VdigestpBSKSHc Sad(To be usedfor DNA sequencing)Kpn IChapter 3 Conversion of Subtilisin E to ThiolsubtilisinFigure 3.11: DNA sequence of subtilisin E and thiolsubtilisin genesat 221 site region.Mutant WildtypeA C G T A C G TNote:The small arrows shown in the picture indicate the mutation sites.The sequences in the region indicated by two brackets read as:mutant: GGAGTCGCCATGCATGTT.wildtype: GGAGTCGCCATGGACGTT.661•I ].._.•Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 673.3.4. Production of Subtilisin E and ThiolsubtilisinSubtilisin E and thiolsubtilisin were produced by growing the B. subtilis DB428transformants of pAP65D8 and pAP65D8M. 2xYT medium containing tetracycline (10 ji.gImL), was inoculated with 1% overnight preculture and shaken at 37°C vigorously for 24hours. The B. subtilis DB428 transformants of pAP65D and pAP65 were grown in thesame condition as controls. Figure 3.12 shows protease production and growth curves ofthe B. subtilis transformants with pAP65D8, pAP65D8M, pAP65D, and pAP65. Theazocasein method was used to monitor the protease production. The growth curves ofthese cultures were obtained by measuring the absorbance of the culture medium at 610nm. The growth of bacterium entered an exponential phase after about 3 hours, andreached to a stationary phase after another 3 hours. The subtilisin E and thiolsubtilisinproduction as indicated in Figure 3. 12b, 3. 12c, and 3. 12d, started from the lateexponential phase and continued during the stationary phase. The production of theseenzymes may continue for another 12 hours and then fall off (Jang et al., 1992). However,the proteolytic activity was not observed in the culture supernatant of pAP65Dtransformant as shown in Figure 3. l2a. This was expected since pAP65D did not carry theactive subtilisin E gene.Crude enzymes were prepared from the culture supernatant after 24 hours growthand analyzed on SDS-polyacrylamide gel electrophoresis. Figure 3.13a and 3.13b areresults form the SDS gel electrophoresis using silver staining. DB428 strain and thepAP65D DB428 transformant showed similar pattern (lane 2 and lane 3, smear shownhere, faint pattern can be seen on original gel). However darkened bands were shown inlane 4 and lane 5, which were absent from lane 2 and lane 3. Both bands appeared in lane4 and lane 5 at below 3 lkd (as indicated by arrows) were probably correspond tothiolsubtilisin and subtilisin E expressed by pAP65D8M and pAP65D8. There weredifficulties to locate the enzymes on gel, because subtilisin E (purchased) did not show anyband at all. However, subtilisin Carlsberg (lane 6) showed two bands on the gel, the oneChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 68near 31 kd (indicated by a arrow) might be the active subtilisin Carlsberg. According to apaper by Takagi et al. (1988), purified subtilisin E showed lower molecular weight thansubtilisin Carlsberg on SDS-PAGE electrophoresis gel. The subtilisin E produced by thetransformant with pAP65 was also observed near 31 kd region (Lane 3 in Figure 3.13b).The SDS gel electrophoresis pattern exhibited by pAP65 was the same as the one bypAP65D8 (Lane 2 and 3 in Figure 3.1 3b).From the SDS-PAGE gel electrophoresis pattern of crude samples, pAP65 andpAP65D8 showed a wide range protein bands and so did pAP65D8M. This may be due tosamples used for the SDS-PAGE gel electrophoresis were the crude protein complexesproduced by the bacterium, which may contain proteins with a wide range of molecularweight.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 69Figure 3.12: Growth and protease production curves of B. subtilis transformants.&owth Production(a) pAP65DC4’Co0 10 20 30lime (Ihir)CIowth -— Production. .C.CCUq0 10 20 30Thne (Ihir)0 10 20 30lime (Ihir)&oh -— Production(b) pAP65D8MjCC,,<0 10 20 30lime (Ihir)&owth Production(c) pAP65D8 (d) pAP65Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 70Figure 3.13(a): Subtiisin E and thiolsubtilisin on SDS-gel electrophoresis.(Gel concentration = 10-15%)200 kdll6kd97.4 kd66kd45kd3lkd21.5 kd14.5 kd6.5 kdLane Protein1 Molecular marker.2 DB428 culture.3 DB428 transformant with pAP65D.4 DB428 transformant with pAP65D8M.5 DB428 transformant with pAP65D8.6 Subtilisin Carlsberg (used as standard).Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 71Figure 3.13(b): Subtifisin E on SDS-gel electrophoresis.(Gel concentration = 10-15%)Lane Protein1 Molecular marker.2 DB428 transformant with pAP65D8.3 DB428 transformant with pAP65.200 kdll6kd97.4 kd —--66kd45kd3lkd21.5 kd14.5 kd6.5 kdChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 723.3.5. Proteolytic Activity ComparisonThe proteolytic activity of pAP65, pAP65D8, pAP65D8M, and pAP65D transformantswas measured. The transformants were inoculated in a 2xYT medium and incubated at 37°C with vigorous shaking for 24 hours. The culture supernatants were dialysed and usedfor proteolytic activity measurements. The proteolytic activity of enzymes was assayed byusing a tetrapeptide succinyl-Ala-Ala-Pro-Phe-p-NA as a substrate. From three otherexperiments, 22 mg dried matters from 10 mL cultures were always obtained afterlyophylization.Table 3.4 shows the results of proteolytic activity of enzymes produced by thetransformants containing pAP65, pAP65D8, pAP65D8M, and pAP65D, based on theassumption of that the culture supernatants contain same concentration of enzymes. It wasfound that the proteolytic activity of subtilisin produced from pAP65D8 and pAP65transformants was at the same level. However, the proteolytic activity found in thethiolsubtilisin (produced from pAP65D8M) of culture supernatant is about 30% that ofsubtilisin E produced from pAP65D8 and pAP65. This proteolytic activity assay furtherconfirmed that the lower proteolytic activity of thiolsubtilisin observed on skim milk agarplate. However, purified enzymes from the culture supernatants are suggested to bemeasured and compared.The proteolytic activity of purchased subtilisin E and subtilisin Carlsberg were alsomeasured. By examining the subtilisin E, it was found that in 1 mL culture supernatant,there contained about 0.5 mg, which was about half of the maximum yield (1 mg/mL)(Wells and Estell, 1988).Thiolsubtilisin prepared from subtilisin BPN’ by chemical modification wasobserved to have a lower proteolytic activity than the native subtilisin BPN’ (Neet andKoshland, 1966). Thiolsubtilisin prepared from subtilisin E by protein engineeringtechniques in this study also exhibited a lower proteolytic activity than its native enzymesubtilisin E. Many studies suggested that the lower proteolytic activity, resulting mainlyChapter 3 Conversion of Subtilisin E to Thiolsubtilisin 73from low acylation rate, was due to the relatively low basicity of the -SH group ascompared with the -OH group (Tsai and Bender, 1979) and an inappropriately locatedproton distribution system (Brocklehurst and Malthhouse, 1981). When thiolsubtilisinprepared from subtilisin BPN’ was used for the peptide synthesis, it showed that themutant enzyme retained its activity toward peptide synthesis (Nakatsuka et al., 1987). Infact, the lower proteolytic activity of the mutant enzyme has greatly reduced the ratio ofhydrolysis over aminolysis of peptides synthesized.Chapter 3 Conversion of Subtilisin E to Thiolsubtilisin 74Table 3.4: Proteolytic activity comparison.Activity ActivityCulture Supernatant (AA4iWmin.mL) (AA410/min.mg)(1 mL) Measured Data Mean Value Mean ValueDB428 0.0027, 0.0020, 0.00 15 0.002 1 —DB428/pAP65D 0.0015, 0.0008, 0.0013 0.0012 —DB428/pAP65D8M 0.0500, 0.0378, 0.0398 0.0425 0.0 193DB428/pAP65D8 0.1356, 0.1472, 0.1490 0.1439 0.0654DB428/pAP65 0.1408, 0.1350, 0.1376 0.1378 0.626Subtilisin E (1 mg) 0.2896, 0.2778, 0.2988 — 0.2887Subtilisin Carlsberg(1 mg) 0. 3469, 0.3328, 0.3505 — 0.3434Note: The activity expressed as AA410/min.mg for DB428/pAP65D8M,DB428/pAP65D8, and DB428/pAP65 was converted to per mg dried matter from 1 mLculture supematant. Subtilisin E and subtilisin Carlsberg were prepared in 1 mg/mL.Chapter 4Ligase Activity Assay Method4.1. Materials• Covalink >NH plate (Gibco Canada Inc., 2270 Industrial Street, Burlington, Ontario)• Polymeric reversed phase HPLC column ODP-50 (4.6x150 mm) was purchased fromAsahi Chemical Industry Co., Ltd., Gel Separation Development Department. 1-3-2Yako Kawasaki-ku, Kawasaki-shi, 210, Japan.• Rabbit anti-DNP antibody horse-radish peroxidase conjugate (Dako Corporation,6392 Via Real Carpinteria, CA 93013)4.2. Detection Methods for Peptide Formation4.2.1. HPLC Method for Dipeptide Formation DetectionThe HPLC method includes two parts: Z-L-Phe-Met-O-Me formation (catalyzed by eithersubtilism E or subtilism Carlsberg) and HPLC detection. The enzymatic Z-L-Phe-Met-OMe formation was carried out according to the method described by Nakanishi et al.(1986) with modifications. The procedure can be described as follows:• This first step was to prepare the solvent of the reaction. The ethyl acetatesaturated solution was prepared by adding water and ethyl acetate to aseparatory funnel until two layers were formed. The mixture was shaken toobtain maximum dissolution. After standing, two layers were formed againand the bottom layer was collected.• 80 mM Z-L-Phe and 80 mM Met-O-MeHCl were dissolved in 4 mL of theethyl acetate saturated solution that was adjusted to pH 8.0. The chemicalswere added slowly and then vortexed to dissolve chemicals completely.75Chapter 4 Ligase Activity Assay Method 76• 10 mglmL stock solution of subtilisin E and of subtilisin Carlsberg wereprepared in 0.01 M pH 6.2 phosphate buffer individually and stored at -20°Cin a freezer. 0.1 mL subtilisin E and 0.1 mL subtilisin Carlsberg wereprepared. 0.1 mL in phosphate buffer was prepared as a blank.• 0.9 mL mixture of Z-L-Phe and Met-O-Me•HC1 was added into each of thetubes containing subtilisin E, subtilisin Carlsberg or phosphate buffer. Themixtures were incubated at 37°C for one hour. 5 jiL of trifluroacetic acid wasadded to stop the reaction.• After centrifuging the mixture at 12,000 xg for 5 minutes, the supernatantwas decanted and the precipitate was dried at room temperature for 30minutes.• The precipitate was redissolved in 1 mL 80% methanol solution. The solutionwas filtered with a 0.45 p.m filter. 20 jiL sample was applied on a HPLC witha polymeric reversed phase ODP-50 (6.Ommxl50mm) HPLC column(AsahiPak).Peptides were eluted with a 0—65% acetonitrile/water gradient in 0.1% TFA at aflow rate of 0.9 mL/min for 45 minutes. Absorbance was detected by a UV detector at214nm.4.2.2. Solid Phase Method for Dipeptide Formation DetectionSolid phase detection was initially intended to measure the Phe-Met peptide formationcatalyzed by recombinant subtilisin E and thiolsubtilisin. However, the present work foundthat this detection method cannot be used. Nevertheless, the method is described here fordiscussion.A special microtitre plate, Covalink >NH plate, was used for the detection. On theplate, there are “>NH” groups that had been grafted on the surface of the plastic materialby the manufacturer. The detection method involved two coupling steps: 1) the couplingChapter 4 Ligase Activity Assay Method 77of “— C00” of Met with >NH” on the plastic surface. This reaction was catalyzed by 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC). In the present work, this couplingstep was assumed to reach 100% since excess amount of Met was used and all H>NH?Igroups could be coupled with Met; 2) the coupling of “— C00” of Phe with -NH2 groupon Met. This reaction was carried out in the presence of subtilisin E or subtilisinCarlsberg. The Phe residue used for second coupling step was Phe-DNP, which allowedthe quantitative measurement of the amount of peptide bonds coupled between Phe andMet by using an anti-DNP antibody. All buffers and solutions used are summarized inTable 4.1. The following steps were carried out in the experiments:Figure 4.1 shows the reaction mechanism of the first coupling step. 100 p.L ofMet/NHS solution (0.25 mg/mL Met and 0.184 mg/mL sulfo-Nhydroxysuccinimide (sulfo-NHS)) was delivered to each of the wells on theplate followed by 100 jiL EDC solution (1.23 mg/mL in water). The plate wasincubated at room temperature for two hours and washed with the coval bufferthree times. The coval buffer was kept on the plate for 15 minutes after thethird wash. This step assumes that 100% coupling would take place, since theexcess amount of Met was used (the amount of Met used was 1.68x107mol,while the amount of ‘5NH’T in each well was 4.69x1011 mol).The intended reaction in the second coupling step was an enzymatic peptideformation. “-NH2t’group on Met and “— C00” on Phe-DNP were intendedto be coupled by the catalysis of subtilisin E and subtilisin Carlsberg separatelyas shown in Figure 4.2. Each of the wells on the plate (previously coupled withMet) was pipetted with 100 jiL Phe-DNP (0.5 mg/mL in water) followed by100 jiL subtilisin (10 mg/niL in 0.01 M phosphate buffer pH 6.2). Afterincubating for 2 hours at 37°C, the plate was washed by the coval buffer threetimes. The coval buffer was then allowed to incubate on the plate for 15minutes. The plate also contained two types of blanks: 1)100 jiL Phe-DNPChapter 4 Ligase Activity Assay Method 78and 100 j.tL sterile distilled H20, and 2)100 jiL sterile distilled water and 100iL subtilisin, and one chemically catalyzed reaction control: 100 iL Phe-DNPand 100 IlL EDC solution.• 150 IlL blotto (0.5% skim milk in PBS) was applied to each of the wells as theblocking agent. The plate was incubated at room temperature for 30 minutesand was washed with the coval buffer three times. The coval buffer stayed onthe plate for 15 minutes after the third wash.• 100 I.tL Rabbit anti-DNP antibody horse radish peroxidase conjugate solutionwas added to each of the wells and the plate was incubated for one hour atroom temperature. After the plate was washed three times with the covalbuffer and once with the distilled water, 100 IlL substrate solution was addedto the plate the colour development was permitted for about 25 minutes.• The substrate reaction was fmally stopped by adding 100 IlL 1 M H2504 Theabsorbance of each well was read on the SLT-LABINSTRUMENTS EASYREADER, EAR 400 (Australia), at a wavelength 492 nm with 620 nm as areference wavelength.Chapter 4 Ligase Activity Assay Method 79Table 4.1: Buffers and solutions for solid phase detectionSolution DescriptionsMetINHS 5 mg Met was dissolved in 1 mL 60% DMSO solution; 0.5 mL ofthe solution was transferred to 10 mL Sulfo-NHS solution (0.184mglmL)Conjugate 5.2 mglmL Rabbit anti-DNP antibody horse-radish peroxidaseSolution conjugate in coval buffer. Freshly prepared.Substrate 60 mg OPD and 50 j.tL H20 (30%), in 100 mL citrate-phosphatebuffer. Freshly prepared.Coval buffer 116.9 g NaC1, 10 g MgSO4, and 0.5 mL Tween 20 in 1 Liter ofPBS.PBS 8.0 g NaC1, 0.2 g KC1, 1.15 g Na2HPO4.2H0and 0.2 gKH2PO4in 1 L H20. pH adjusted to 7.2 with HC1 or NaOH.Citrate- 7.3g citric acid and 11.86 g Na2HPO4HOin 1 L distilledPhosphate water. pH adusted to 5 with HC1 or NaOH.BufferChapter 4 Ligase Activity Assay Method 80Figure 4.1: Reaction scheme for coupling Met on the Covalink’5NH” plate.0IIMet— C—OH1(EDC)0IIMet—CHN—R1—0—C ÷IIN—R2O—R1IIIIN—R2HO-JI8 2CR3+HRANS4fto%b0IIMet—C(NHS)(Covalink NH)(NHS)-O-‘I,CH3Met— C —NChapter 4 Ligase Activity Assay Method 81Figure 4.2: Enzymatic DNP-Phe-Met formation scheme.o CH3 0H2N— Met — — + DNP — phe — C —0EnzymeDNP—Phe—C —NH— Met—C —NNote:In the presence of EDC instead of enzyme, the U—onDNP — Phe was activated and the dipeptide bond formationin such a situation was considered as 100%.Chapter 4 Ligase Activity Assay Method 824.3. Results and Discussion4.3.1. HPLC Detection of the Phe-Met Bond FormationThe column (ODP-50, Ashahipak, Polymeric reversed phase HPLC column) wasequilibrated with 65% acetonitrile as recommended by the manufacturer. However, whena gradient mobile phase (0-65% acetonitrile) was run in 45 minutes, the chromatogramshowed a peak at about 7 to 8 minutes retention time as shown in Figure 4.3. When 20 jiL80% methanol was injected, the chromatogram showed extra peaks around 3 to 4 minutesas shown in Figure 4.4. Standard samples were applied to the HPLC as well, the resultsare shown in Figure 4.5, Figure 4.6 and Figure 4.7. Figure 4.5 shows the chromatogramwhen 20 pL 1.63 mg/mL Met-O-Me prepared in 80% methanol was applied to the HPLC.Figure 4.6 is the chromatogram when 20 jiL 6.99 mg/mL Z-L-Phe was injected to theHPLC. While Figure 4.7 is the chromatogram when 20 p.L of mixed Met-O-Me (7.568mg/mL) and Z-L-Phe (1.697 mg/mL) was subjected to the HPLC. Because of the timelimitation for this thesis, the detection for the dipeptide Z-L-Phe-Met-O-Me was limited tothe qualitative analysis. The dipeptide Z-L-Phe-Met-O-Me catalyzed by subtilisin E orsubtilsin Carlsberg was prepared as described and detected by HPLC. Figure 4.8 - 4.12illustrate the chromatographic results. Figure 4.8, 4.9, and 4.10 are the control reactionresults: Figure 4.8 conesponds to the reaction when no enzyme was included during theincubation; Figure 4.9 and 4.10 show the results for reactions with no substrates (Met-OMe and Z-L-Phe), but subtilisin E or subtilisin Carlsberg was added for incubation. Figure4.11 and 4.12 are enzymatic peptide synthesis catalyzed by subtilisin E and subtilisinCarlsberg respectively. There is a peak appearing on both chromatograms at about 43minutes retention time. Although in this thesis Z-L-Phe-Met-O-Me was not synthesizedchemically and the peak components were not tested on the nuclear magnetic resonance,the peak retention time for Z-L-Phe-Met-O-Me appeared at 43 minutes which was similarto that of Z-L-Asp-Tyr-O-Me and Z-L-Asp-Met-O-Me. Both dipeptides were synthesizedby catalysis of themiolysin through the same procedure as that for Z-L-Phe-Met-O-MeChapter 4 Ligase Activity Assay Method 83(Lee, 1992). Furthermore, as Figure 4.8 is compared with Figure 4.11 and 4.12, it isnoticable that the Met-O-Me peak was reduced in Figure 4.11 and 4.12, with theappearance of the peak at 43 minutes, while the same amount of Met-O-Me and Z-L-Phewere used in these experiments.Finally, it is noticable by comparing the peak sizes at 43 minutes shown in Figure4.11 and 4.12 that the amount of Z-L-Phe-Met-O-Me formed from the subtilisin Carlsbergcatalysis is higher than that of the subtilisin E. This implies that subtilisin Carlsberg hashigher ligase activity than that of subtilisin E. It is necessary to point out that since theabsolute amount of Z-L-Phe-Met-O-Me formed from catalysis is unknown, furtherinvestigation is needed.Chapter 4 Ligase Activity Assay Method 84Figure 4.3: HPLC chromatogram of mobile phase with gradient 0-65% acetonitrile.START7.798InTOPChapter 4 Ligase Activity Assay Method 85Figure 4.4: HPLC chromatogram of 20 iLL 80% methanolwith gradient 0-65% acetonitrile.START816.95726.52347. 183Chapter 4 Ligase Activity Assay Method 86Figure 4.5: HPLC chromatogram of 20 p.L 1.63 mg/mL Met-O-Mein 80% methanol with gradient 0-65% acetonitrile.START9. 387Cl)38. 183Chapter 4 Ligase Activity Assay Method 87Figure 4.6: HPLC chromatogram of 20 ILL 6.99 mg/mL Z-L-Phein 80% methanol with gradient 0-65% acetonitrile.37.493START3.8637.59828.38342.89TOPChapter 4 Ligase Activity Assay Method 88Figure 4.7: HPLC chromatogram of 20 tL 7.57 mg/mL Met-O-Me and 1.70 mg/mLZ-L-Phe in 80% methanol with gradient 0-65% acetonitrile.STiRT3.8475.77.6529.06316.933t:L).37.442Chapter 4 Ligase Activity Assay Method 89Figure 4.8: HPLC chromatogram of the reaction control of Z-L-Phe-Met-O-Meenzymatic synthesis (without subtilisins).3.3873.8484.5435.2856.1677.5179.22216. 18316.733Cl)kflF37. 183Chapter 4 Ligase Activity Assay Method 90Figure 4.9: HPLC chromatogram of the reaction control of Z-L-Phe-Met-O-Meenzymatic synthesis(without substrates, Met-O-Me, and Z-L-Phe but with subtilisin E).SIR R T3.955903C’,1)-.DChapter 4 Ligase Activity Assay Method 91Figure 4.10: HPLC chromatogram of the reaction control of Z-L-Phe-Met-O-Meenzymatic synthesis(without substrates, Met-O-Me, and Z-L-Phe but with subtilisin Carlsberg).START3.7738.0289.88310. 382.Chapter 4 Ligase Activity Assay Method 92Figure 4.11: HPLC chromatogram of enzymatically synthesizedZ-L-Phe-Met-O-Me catalyzed by subtilisin E.3.3323.8525.2586.1177.5939.36716.825C,)0 19.96?28. 95822.797E 23.43324.95tr) 25.57532. 81735. 467ZZ 37.22348. 5 9842.758Chapter 4 Ligase Activity Assay Method 93Figure 4.12: HPLC chromatogram of enzymatically synthesizedZ-L-Phe-Met-O-Me catalyzed by subtilisin Carlsberg.36.9583.3173.8426.1153829.21514. 81716.8516.617. 61718. 19228.2526.6327.49235.22242. 525Chapter 4 Ligase Activity Assay Method 944.3.2. The Failure of the Solid Phase DetectionWith the solid phase detection method, Phe-DNP with various concentrations was appliedto the Met saturated wells on the plate with both subtilisin E and subtilisin Carlsberg.Table 4.2 shows the absorbance of the reaction mixtures for: 1) two blanks: withoutsubtilisin or without Phe-DNP (4.2a), 2) various Phe-DNP concentrations (4.2b), and 3)EDC reactions (4.2c). The values shown in the table are averaged from 8 replicates. TheEDC reaction was considered as a maximum coupling. In the EDC blank reaction, no PheDNP was added. This data indicates that once subtilisin is added in the reaction, anti-DNPantibody fails to recognize Phe-DNP group. The background reading is even higher thanso called maximum EDC coupling. Therefore, the ligase activity of subtilisin E andsubtilisin Carlsberg cannot be determined from the solid phase detection method due tothe cross reaction of the antibody with subtilisin.Chapter 4 Ligase Activity Assay Method 95Table 4.2: Solid phase detection: absorbance at 492 nm(a) BlanksReactions Absorbance at 492 nm(mean_value_of 8_replicates)Blankl: Reaction without subtilisin 0.0238±0.0024Blank 2: Reaction without Phe-DNP 0.0497±0.0053(b) Subtilisin catalyzed reactions with various Phe-DNP concentrations(Note: lxPhe-DNP concentration is 0.1275 mg/mL.)Absorbance at 492 nmConcentration (mean value of 8 replicates)1 0.0544±0.00471/2 0.0590±0.00491/4 0.0571±0.00481/8 0.0535±0.00501/16 0.0496±0.0032(c) EDC reactionReactions Absorbance at 492 nm(mean_value_of 8_replicates)1 xPhe-DNP concentration 0.0475±0.0046No Phe-DNP 0.0126±0.0011Chapter 5Conclusions and RecommendationsIn order to engineer subtilisin E to an enzyme that can exert the ligase activity with theleast proteolytic activity, subtiiisin E was converted to thiolsubtilism by site-directedmutagenesis. Thiolsubtilisin produced from other subtilisins, such as subtilisin BPN’ andsubtilisin Carlsberg by chemical modifications and protein engineering, showed the enzymeligase activity was retained after the proteolytic activity of the enzyme was greatlyreduced. In this thesis, thiolsubtilisin was produced by changing the codon of serine 221on subtilisin E through Kunkel’s mutagenesis method. The method worked well for thesuccessful conversion of subtilisin E to thiolsubtilisin. Recombinant thiolsubtilisin from thisthesis showed a reduced proteolytic activity when compared to wild type subtilisin E. Only30% proteolytic activity of the wild type was observed, when culture supernatants wereassayed.As a preliminary step of protein engineering for improving the ligase activity ofsubtilisin, the conversion has established a systematic procedure for engineering proteasesproduced by B. subtilis. This procedure can be summarized as a host-vector system. Thesystem mainly involved two steps: 1) Cloned enzyme genes are constructed on vectorDNAs to facilitate the subsequent mutagenesis. In this thesis, a cloned aprE gene waslinked on pUC 118 first. Site-directed mutagenesis was then carried out on the resultingDNA pLC658 to change the gene codon serine 221. 2) Modified genes on vectors areexpressed in host cell B. subtilis that usually is a gene deficient strain. It is required thaton the genome of the strain, the gene to be expressed be deleted. It is also desirable that B.subtilis be deficient in its major extraceilular protease genes on its genome, becauseproteases produced by B. subtilis tend to cause the hydrolysis of the expressed enzyme. Inthis thesis DB428 strain was used, which is a three extracellular proteases deficient strain.96Chapter 5 Conclusions and Recommendations 97In addition to subtilisin E gene, neutral protease B and bacillopeptidase F genes were alsodeleted on its genome.Because of the time limitation for this thesis, the activities of recombinant subtilisinE and thiolsubtilisin produced by this thesis in peptide synthesis were not investigated.However, HPLC and solid phase methods for detecting peptide bonds formed fromenzymatic reaction were tested. The Phe-Met was formed by both catalysis of purchasedsubtilisin E and subtilisin Carlsberg. It is concluded that 1) the solid phase detectionmethod needs to be improved; 2) Phe-Met dipeptide can be formed by the activity ofsubtilisin E or subtilisin Carlsberg.Suggestions for further study are as follows:• Phe-Met formation catalyzed by subtilisin E and subtilisin Carlsberg should befurther studied on a quantitative scale, that is, the synthesis efficiency of PheMet bond formed by subtilisin E and subtilisin Carlsberg need be measured.This may be achieved by using a HPLC detection method.• The recombinant subtilisin E and thiolsubtilisin produced by the present workshould be further purified. This includes: 1) to maximize the production ofenzymes by enlarging the scale of fermentation, 2) to purif’ the enzyme by thegel filtration, ion exchange column and other techniques.• The activity of the purified recombinant subtilisin E and thiolsubtilisin shouldbe measured toward the Phe-Met bond formation by using the same method asfor the purchased subtilisin E and subtilisin Carlsberg.• Z-L-Phe-Met-O-Me bond formation is expected to be improved byoptimization, and then to be applied to the resynthesis of K-casein from para 1-casein and glycomacropeptide, because para 1-casein contains a Phe residue atits carboxylic terminal while glycomacropeptide contains a Met residue at itsamino terminal. The optimization will include optimization of the reaction time,temperature, solvents, and other variables to obtain the maximum coupling ofChapter 5 Conclusions and Recommendations 98the dipeptide (Lee, 1992). Furthermore, if it is achieved, the ligase activitydetection can be simplified by measuring the amount of higher molecularweight of K-casein gained after the reaction.• Thiolsubtilisin is shown to have lower proteolytic activity than its native one.Although the mutant has been reported to retain some activity towards peptidesynthesis, the activity is still very low. This low activity of thiolsubtilisin maybe caused by several factors, such as crowding of the sulfur atom introduced inthe active site region, or the inappropriate distribution of the proton system inthiolsubtilisin. To increase the peptide synthesis activity of thiolsubtilisin, itmay be desirable 1) to alleviate the crowding in the active region, and 2) toimprove the proton distribution system in the enzyme. According to otherstudies on subtiisin E, it has been found that the mutation in the proximity ofthe active site region could improve the activity of subtilisin E (Takagi et al.,1988). The work done by Abrahmsen et al. (1991) showed that theintroduction of mutation at its Pro 225 site to Ala could improve the ligaseactivity of thiolsubtilisin. Therefore it is recommended to introduce mutation inthe vicinity region of the catalytic site. One mutation site 11e3 1, which wasintroduced on subtilisin E by Takagi et al. (1988), could be introduced first onthiolsubtilisin. Then it is desirable to introduce more mutations along its activesite. The task could be achieved by using a computerized modelling system topredict the site to be mutated or through the random mutagenesis at its activeregion.• Other approaches to improve the ligase activity of subtilisin E arerecommended through the mutation of serine 221 to other residues, such asThr residue and others.References[1] Abrahmsen, L., Tom, J., Bumier, J., Butcher, K.A., Kossiakoff, A. and Wells, J.A.(1991), “Engineering Subtilisin and its Substrates for Efficient Ligation of PeptideBonds in Aqueous Solution,” Biochemistry, Vol.30, No.17, pp.4151-4159.[2] Alvaro, G. and Russell, J. (1991), “Modification of Enzyme Catalysis by EngineeringSurface Charge,” Methods in Enzymology, Vol.202, pp.620-43.[3] Bonneau, P.R., Graycar, T.P., Estell, D.A. and Jones, J.B. (1991), “Alteration of theSpecificity of Subtilisin BPN’ by Site-Directed Mutagenesis in its S1 and S1’ BindingSites,” J. Am. Chem. Soc. Vol.113,pp.1026-30.[4] Brocklehurst, K. and Maithouse, J.G. (1981), “Evidence that the Lack of HighCatalytic Activity of Thiolsubtilisin Towards Specific Substrates may be Due to anInappropriately Located Proton-Distribution System”, Biochem. J., Vol.193, pp.819-823.[5] Biyan, P., Pantoliano, M.W., Quill, S.G., Hsiao, H. and Poulos, T. (1986), “Site-Directed Mutagenesis and the Role of the Oxyanion Hole in Subtilisin,” Proc. Nati.Acad. Sci., USA, Vol.83,pp.3743-5[6] Carter, P. and Wells, J.A. (1987), “Engineering Enzyme Specificity by ‘Substrate-Assisted Catalysis”, Science, Vol.237, pp.394-399.[7] Carter, P. and Wells, J.A. (1988), “Dissecting the Catalytic Triad of a SerineProtease,” Nature, Vol.332, No.7, pp.564-8[8] Chatterjee, S. and Russell, A.J. (1992), “Activity of Thiolsubtilisin in OrganicSolvents,” Biotechnol. Prog. Vol.8, No.3, pp.256-8[9] Clapes, P. and Velencia, G. (1992), “Influence of Solvent and Water Activity onKinetically Controlled Peptide Synthesis,” Enzyme Microb. Technol., Vol.14,pp.575-80.99References 100[10] Cunningham, B.C. and Wells, J.A. (1987), “Improvement in the Alkaline Stability ofSubtilisin Using an Efficient Random Mutagenesis and Screening Procedure,”Protein Engineering, Vol.1, No.4,pp.319-25[11] DelMar, E.G., Largman, C., Brodrick, J.W. and Geokas, M.C. (1979), “A SensitiveNew Substrate for Chymotrypsin,” Analytical Biochemistry, Vol.99, pp.316-20.[12] Estell, D.A., Graycar, T.P. and Wells, J.A. (1985), “Engineering an Enzyme by Site-Directed Mutagenesis to Be Resistant to Chemical Oxidation,” The Journal ofBiological Chemistry, Vol.260, No.11,pp.6518-21[13] Estell, D.A., Graycar, T.P., Miller, J.V., Powers, D.B., Bumier, A.P., Ng, P.G. andWells, J.A. (1986), “Probing Steric and Hydrophobic Effects on Enzyme-SubstrateInteractions by Protein Engineering,” Science, Vol.233, No.8, pp.659-63[14] Ewings, K.N., O’Conner, R.E. and Mitchell, G.E. (1984), “Proteolytic Microflora ofRefrigerated Raw Milk in Southeast Queensland”, Aust. J. Dairy Technol., Vol.39,pp.65-68.[15] Ferjancle, A., Pulgserver, A. and Gaertner, H. (1990), “Subtilisin-Catalysed PeptideSynthesis and Esterification in Organic Solvents,” Appl. Microbiol. Biotechnol.,Vol.32, pp.651-657.[16] Hagihara, B., Matsubara, H., Nakai, M. and Okunuki, K. (1958), J. Biochem.(Tokyo), Vol.45,pp.185-6.[17] He, X.-S., Shyu, Y.-T., Nathoo, S., Wong, S. and Doi, R.H. (1991a), “Constructionand use of a Bacillus subtilis mutant deficient in multiple protease genes for theexpression of eukaryotic genes,” Annals New York Academy of Sciences:Recombinant DNA Technology J, Vol.646, ed. A. Prokop and R. K. Bajpai.[18] He, X.-S., Bruckner, R. and Doi, R.H. (1991b), “The Protease Genes of Bacillussubtilis,” Res. Microbiol. Vol.142, pp.797-803.References 101[19] Hernández, M.J.M., Camanas, R.M.V. and Alvarez-Coque, M.C.G. (1990),“Determination of Total Free Amino Acids with o-phthalaldehyde and N-Acetyl-LCysteine,” Microchem. J., Vol.42, pp.288-293.[20] Homandberg, G.A. and Laskowski, Jr., M. (1979), “Enzymatic Resynthesis of theHydrolyzed Peptide Bond(s) in Ribonuclease S,” Biochemistry, Vol.18, No.4,pp.586-592.[21] Hutchison, C.A. ifi and Edgell, M.H. (1971), “Genetic Assay for Small Fragments ofBacteriophage qx174 Deoxyribonucleic Acid,” J. Virol., Vol.8,pp.181-9[22] Hutchison, C.A. III, Phillips, S., Edgell, M.H., Gifiam, S., Jahnke, P. and Smith, M.(1978), “Mutagenesis at a Specific Position in a DNA Sequence,” The Journal ofBiological Chemistry, Vol.253, No.18, pp.655 1-6560.[23] ilcemura, H., Takagi, H. and Inouye, M. (1987), “Requirement of Pro-Sequence forthe Production of Active Subtilisin E in Escheichia coli,” The Journal of BiologicalChemistry, Vol.262, No.16, pp.7859-5864.[24] Imanaka, A. (1993), Personal communication, Osaka University, Osaka, Japan.[25] Isowa, Y., Obmori, M., Ichikawa, T., Kurita, H., Sato, M. and Mori, K. (1977a),“The Synthesis of Peptides by Means of Porteolytic Enzymes,” Bull. Chem. Soc.Jpn., Vol.50, pp.2762.[26] Isowa, Y., Ohmori, M., Sato, M. and Mori, K. (1977b), “The Enzymatic Synthesis ofProtected Valine-5 Angiotensin Amide-1,” Bull. Chem. Soc. Jpn., Vol.50, pp.2766.[27] Jakubke, H.-D., Kuhi, P. and Konnecke, A. (1985), “Basic Principles of ProteaseCatalyzed Peptide Bond Formation,” Angrew. Chem. mt. Ed. Engi. Vol.24, No.2.pp.85-93.[28] Jang, J.S., Kang, D.O., Chun, M.J. and Byun, S.M. (1992), “Molecular Cloning of aSubtiisin J Gene from Bacillus stearothermophilus and Its Expression in Bacillussubtilis,” Biochem. and Biophy. Research Communications, Vol.184, No.1, pp.2’T7-282.References 102[29] Kawamura, F. and Doi, R.H. (1984), “Construction of a Bacillus subtilis DoubleMutant Deficient in Extracellular Alkaline and Neutral Proteases,” Journal ofBacteriology, Vol.160, No.10, pp.442-444.[30] Kraut, J. (1977), “Serine Proteases: Structure and Mechanism of Catalysis”, Ann.Rev. Biochem., Vol.46,pp.331-58.[31] Kullmann, W. (1987), Enzymatic Peptide Synthesis, Boca Raton, FL: CRC Press.[32] Kunkel, T.A., Roberts, J.D. and Zakour, R.A. (1987), “Rapid and Efficient Site-Specific Mutagenesis without Phenotypic Selection,” Methods in Enzymology,Vol.154, pp.367-82.[33] Kwan, K.K.H., Nakai, S. and Skura, B.J. (1983), “Comparison of Four Methods forDetermining Protease in Milk,” J. Food Sci., Vol.48, pp.1418-1420.[34] Lee, G. (1992), “Application of Optimization for the Enzymatic Synthesis of SweetAspartyl Dipeptide Analogs Catalyzed by Thermolysin,” M.Sc. Thesis, University ofBritish Columbia. V[35] Markland, F.S. and Smith, E.L. (1971), The Enzymes , Vol.3, pp.561-608[36] Matsuyama, A. (1993), Personal discussion, Research & Development Division,Kikkoman Corporation, 399 Noda, Noda city, Chiba Pref 278, Japan.[37] Morihara, K. and Oka, T. (1981) “Peptide Bond Synthesis Catalyzed by Subtilisin,Papain, and Pepsin,” J. Biochem. Vol.89, pp.385.[38] Nakanishi, K., Kimura, Y. and Matsuno, K. (1986), “Kinetics and Equilibrium ofEnzymatic Synthesis of Peptides in Aqueous/Organic Biphasic Systems:Thermolysin-Catalyzed Synthesis of N-(benzyloxycarbonyl)-L-aspartyl-Lphenyalanine Methyl Ester,” Eur. J. Biochem. Vol.161,pp.541-4.[39] Nakatsuka, T., Sasaki, T. and Kaiser, E.T. (1987), “Peptide Segment CouplingCatalyzed by the Semisynthetic Enzyme Thiolsubtilisin,” J. Am. Chem. Soc.,Vol.109,pp.3808-10.References 103[40] Neet, K.E. and Koshland, D.E. Jr. (1966), “The Conversion of Serine at the ActiveSite Subtilisin to Cysteine: A ‘Chemical Mutation”, Biochemistry, Vol.56, pp.1606-1611.[41] Ottensen, M. and Svendsen, I. (1970), “The Subtilisins,” Methods in Enzymology,Vol. XIX, pp.199-221.[42] Pantoliano, M.W., Ladner, R.C., Bryan, P.N., Rollence, M.L., Wood, J.F. andPoulos, T.L. (1987), “Protein Engineering of Subtilisin BPN’: Enhanced Stabilizationthrough the Introduction of Two Cysteines to Form a Disulfide Bond,”Biochemistry, Vol.26,pp.2077-82[43] Philipp, M., Tsai, 1.-H. and Bender, M.L. (1979), “Comparison of the KineticSpecificity of Subtilisin and Thiolsubtilisin Toward n-Alkyl p-Nitrophenyl Esters,”Biochemistry, Vol.18, No.17,pp.3769-73[44] Philipp, M. and Bender, M.L. (1983), “Kinetics of Subtilisin and Thiolsubtilisin”,Molecular and Cellular Biochemistry, Vol.51, pp.5-32.[45] Polgar, L. (1976), “Modified Preparation of Thiolsubtilisins and Their Purification onAgarose-Mercurial Column,” Acta Biochim. et Biophhys. Acad. Sci. Hung., Vol.11,No.2-3, pp.81-6.[46] Power, S.D., Adams, R.M. and Wells, J.A. (1986), “ Secretion and AutoproteolyticMaturation of Subtilisin,” Proc. Nati. Acad. Sci. USA., Vol.83, pp.3096-100.[47] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989), Molecular Cloning - ALaboratory Manual, 2nd Edition.[48] Sanger, F., Nicklen, S. and Coulson, A. R. (1977), “DNA Sequencing with Chain-Terminating Inhibitors,” Proc. Nail. Acd. Sci. U. S. A., Vol.74,pp.5463-7[49] Stahl, L. and Ferrari, E. (1984), “Replacement of the Bacillus subtilis SubtilisinStructural Gene with an In Vitro-Derived Deletion Mutation,’ Journal ofBacteriology, Vol.158, No.2, pp.411-418.References 104[50] Spizizen, J. (1958), “Transfonnation of Biochemically Deficient Strains of Bacillussubtilis by Deoxyribonucleate,” Proc. Natl. Acad. Sci. U. S., 44, pp.1072-1078.[51] Takagi, H., Morinaga, Y., Ikemura, H. and Inouye, M. (1988), “Mutant Subtiisin Ewith Enhanced Protease Activity Obtained by Site-Directed Mutagenesis,” J.Biological chemistry, Vol.236, No.36, pp.19592-19596.[52] Takagi, H., Morinaga, Y., Ikemura, H. and Inouye, M. (1989), “The Role of Pro-239in the Catalysis and Heat Stability of Subtilisin E,” J. Biochem. Vol.105, pp.953-6.[53] Thomas, P.G., Russell, A.J. and Fersht, A.R. (1985), “Tailoring the pH Dependenceof Enzyme Catalysis Using Protein Engineering,” Nature, Vol.318, No.28, pp375-376.[54] Tsai, 1.-H. and Bender, M.L. (1979), “Conformation of the Active Site ofThiolsubtilisin: Reaction with Specific Chioromethyl Ketones andArylacryloylimidazoles,” Biochemistry, Vol.18, No.17, pp.3764-3768.[55] Vieira, J. and Messing, J. (1982), “The pUC Plasmids, an M13mp7-Derived Systemfor Insertion Mutagenesis and Sequencing with Synthetic Universal Primers,” Gene,Vol.19,pp.259-68.[56] Wells, J.A., Cunningham, B.C., Graycer, T.P. and Estell, D.A. (1987), “Recruitmentof Substrate-Specificity Properties from One Enzyme into a Related One by ProteinEngineering,” Proc. Natl. Acad. Sci. U. S. A., Vol. 84,pp.5167-71.[57] Wells, J.A., Ferrari, B., Henner, D.J., Estell, D.A. and Chen, E.Y. (1983), “Clong,Sequencing and Secretion of Bacillus amyloliquefaciens Subtilisin in Bacillussubtilis,” Nucleic Acids Research, Vol.11, No.22, pp.791 1-7925.[58] Wells, J.A. and Powers, D.B. (1986), “In Vitro Formation and Stability ofEngineered Disulfide Bonds in Subtilisin,” Journal ofBiological Chemistry, Vol.26 1,No.14,pp.6564-70References 105[59] Wells, J.A., Powers, D.B., Bott, R.R., Graycar, T.P. and Estell, D.A. (1987),“Designing Substrate Specificity by Protein Engineering of ElectrostaticInteractions,” Pro. Nail. Acad. Sci. USA, Vol.84, No.3,pp.1219-23[601 Wells, J.A. and Estell, D.A. (1988), “Subtilisin - An Enzyme Designed to BeEngineered,” Trends Biochem. Sci., Vol.3, pp.291-7[61] Wong, C.-H., Chen, S.-T., Hennen, W.J., Bibbs, l.A., Wang, Y.-F., Liu, J.L.-C.,Pantoliano, M.W., Whitlow, M. and Bryan, P.N. (1990), “ Enzymes in OrganicSynthesis: Use of Subtilisin and a Highly Stable Mutant Derived from Multiple Site-Specific Mutations”, J. Am. Chem. Soc., Vol.112, pp.945-53.[62] Wong, C.-H. (1992), “Engineering Enzymes for Chemoenzymatic Synthesis Part 2:Modifying Porteases for Peptide Synthesis,” TIBTECH, Vol. 10, pp.378-81.[63] Wong, C.-H., Schuster, M., Wang, P. and Sears, P. (1993), “Enzymatic Synthesis ofN- and 0-Linked Glycopeptides,” J. Am. Chem. Soc., Vol.115,pp.5894-901.[64] Wong, S.-L. and Doi, R.-H. (1986), “Detemination of the Signal Peptidase CleavageSite in the Preprosubtilisin of Bacillus subtilis,” The Journal of BiologicalChemistry, Vol.261, No.22,pp.10176-81[65] Wu, X.-C., Lee, W., Tran, L. and Wong, S.-L. (1991), “Engineering a Bacillussubtilis Expression-Secretion System with a Strain Deficient in Six ExtracellularProteases,” Journal ofBacteriology, Vol.173, No.16,pp.4952-8[66] Wu, Z.-P., and Hilvert, D. (1989), “Conversion of a Protease into an AcylTransferase: Selenosubtilisin,” J. Am. Chem. Soc., Vol.111, pp.45 13-4514.[67] Yue, E. (1993),”Development of a Simple and Rapid Solid-Phase Assay for theDetection of Di-Peptide Synthesis,” Personal Communication.[68] Zhong, Z., Liu, J.L.-C., Dinterman, L.M., Finkelman, M.A.J., Mueller, W.T.,Rollence, M.L., Whitlow, M. and Wong, C.-H. (1991), “Engineering Subtilisin forReactions in Dimethylformamide,” J. Am. Chem. Soc., Vol.113, pp.683-4.References 106[69] Zoller, M.J. and Smith, M. (1984),‘tOligonucleotide-Directed Mutagenesis: ASimple Method Using Two Oligonucleotide Primers and a Single-Stranded DNATemplate”, DNA, Vol.3, No.6, pp.479-488.AppendixA. Composition of Media and BuffersA.1. MediaMedia Composition ConditionLB (Luria-Bertani bacto-tryptone 10 g, bacto- at pH 7.0 in 1 LMedium) yeast-extract 5 g, NaC1 10 g. solution2xYT bacto-tryptone 16 g, bacto- at pH 7.0 in 1 Lyeast-extract 10 g, NaC1 5 g. solution107Appendix 108A.2. BuffersBuffer CompositionTE pH 8.0 10 mM TrisHCl (pH 8.0), 1 mlvi EDTA (pH 8.0).1OxTBE Buffers for Gel 54 g Tris base, 27.5 g boric acid, 20 mL 0.5 MEDTAElectrophonesis (pH 8.0) in 1 L solution.STE Solution for the 0.1 M NaC1, 10 mlvi TrisHC1 (pH 8.0), 1 mlvi EDTAplasmid DNA preparation (pH 8.0).from B. SubtilisLow Salt Wash Solution 50 mM Tris•HC1 (pH 8.0), 0.15 M NaCl, 10 mlviEDTA (pH 8.0).High Salt Elution Buffer 50 mlvi Tris•HC1 (pH 8.0), 1 M NaC1, 10 mM EDTA(pH 8.0).lOxAnnealing buffer 200 mM TrisHCl (pH 7.4), 20 mM MgC12, 500 mlviNaC1.T4 DNA dilution buffer 100 mM potassium phosphate (pH 7.0), 5 mM DTT,50% glycerol.l0xKinase buffer 0.7M Tris•HC1 (pH 7.6), 0. 1M MgCl2,5 mM DTT.Sequenase buffer 200 mM Tris•HC1 (pH 7.5), 100 mM MgC12,250 mMNaCl.loxBacteriophage T4 DNA 200 mM Tris•HC1 (pH 7.6), 50 mM MgC12, 50 mMLigase Buffer dithiothreitol.loxSynthesis Buffer 5 mlvi dATP, 5 mM dCTP, 5 mM dGTP, 5 mM TTP,10 mM ATP, 100 mM Tris•HC1 (pH 7.4), 50 mlviMgCl2,20 mM DTT.Appendix 109B. GlossaryThis is a list of the abbreviations used in the thesis.DEAE-cellulose diethylamino ethyl celluloseDMSO dimethylsulfoxideDNA deoxynucleic acidDNP dinitrophenyl groupdNTFs deoxynucleoside 5! triphosphateDTT dithiothreitolEDC 1 -Ethyl-3-(3-dimethylaminopropyl)-CarbodiimideEDTA ethylenediamine tetraacetic acidIPTG isopropylthio-3-D-ga1actosideNHS N-hydroxysuccinimide0But tert-butyl ester0-Et ethyl ester0-Me methyl esterOPD Ortho-phenylenediamine dihydrochiorideRNAse ribonucleaseSDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresisX-gal 5-bromo-4-ch1oro-3-indoly1-3-D-galactosideZ benzyloxycarbonylAppendix 110C. DNA Sequence of Subtilisin E and Thiolsubtilisin GenesThe DNA sequence for the entire subtilisin E gene and thiolsubtilisin gene produced by thepresent work was also conducted by Dr. A. Matsuyama at the Research & DevelopmentDivision, Kikkoman Corporation, 399 Noda, Noda city, Chiba Pref 278, Japan. His resultsare demonstrated by the following Figure C. 1 and C.2.Model373AVeision1.0.2-Saiipleo2DyeTem*iatorMyPthierJLane2SignalG79k69T6734Pbits3to8640Be1:883465MATRIXD-11LTue,Aug31903332PMX01o7674Y:Oto1200Page1of2TTKTIURUF4ffUIUUIUP(UUAUIIAUUiMI11AFP.AWiUAAUiLr1MI1Y,••.111‘CC00z—1.a)()a)CCd)—a)a)a.QCl)CCCd)Cl)0-a)C)a)L-iCACCGAjiTGGACAAAcGCCAAGICCOTOATCC3TTTAGAAAOOACTGCAACA(CTTOGAAACTOTTTCTTrTTTGGAAAAG.TAATCAACOTA6.AGCAOCTGCAC..ATAATAJiL&ATTJUTUA,....wITCTGAAA&ATpTNCACAAOCAGNAGOATCAACCTOOCTCA0000CQACACOGCCANNTCCN(DAAC03T1ITAANAGOG4TTO4NTTNTGOImN*MCNNACC(NNKK3NMAIIO(C’3MCNcXIANIKThANMWNTNTCAMAGDGI4CGCGCAACiTATAAMAWCOAAAANNTTTORNG*1ACMCOOCOQCrAAntHIccccicnTCCK1GCANC4OI_____22‘Pomts950to8644Be1:950Wed,Sep1,19936:36PMDyoTeminator{MyPrhj465MATRIXX0to9866Y:0to1200Model373ALane6Spackig:10.59Ve.3on1.2.0‘SignaLG.211A121T291C65VPage1of2OttNNTT11LkOAAOATTrOCATATGTTOO.GTOCTTTCT&ACGa1CACGO.CTT00000TTTOTCCALOT0000TQCTTAOA*AQAATTAA000IOCTQCI00000AAOOTOkOOAOTCUIJN&kdit’CJ11xC1CMC”C”01..—CM—.—CM—0CMzC”CM0CMC.’C.’zCMCM1)1)CM•-4CM0I-4_____IIACAOOCCAOOA0CCATCACATCAAIW,iHIi.fAOAATOAAOCTCTTTOTTGCTOCTC14015018017018020022030240AI)\JRUNIIHI(IUUjyf__________________________________________________________________________&IJJf1fl_H III_________________________hu____________________________________HiN1_____________________________________________________-II_____________&.b4_•_-.IUfl••••-It.—-•.wrACCOCACCIACFGGAATAGTAGAAOGAT,TTi.aooTAoccaAcToTacTToTacTTccGaATaAAccTTceTTTccoarocaGCAOCAPCOACQATAOCOOTQGAAA0000TITOIliA,.IMMuln,,,,”ATAATCCAONTATTTTGOCCNT390400410420430440450460470480490CftitIIIla4ONNCAICAANACTNNNNCINNATNTANTNATGNONTNOONONTA00000NQLACA0CNTtOANITATIA.*OAGI3IMNCNNCNNTTCANNF*4NNCCNNNMAANTNCCNCCCNNN1mG510520530540560560570580590800610820CD a.Scal7 IDBssHII619—SàcL657cl<pnL’BssHll79213PI(nWKSP.iSAACAGCTATGACCATQ7ATTAACCCTCACTAAAO6COAGGTCOACGGTATCG2Hthcli-DrillMETHü.1—,lCaIApalXholSlICliil4lndWEoRVEcoRlE.lSicHPillS.rIG.r,HlSpalXb.lNdiBilXISuP+—•lT7Pron’ot.tYCTAGOTOATCAACATCTS‘GATATCACTCAOCA?AA5ITGACCCGCAOCAAAATOSSKPruire,T7PrnruM13.20P,ir,,.r- CA)

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099112/manifest

Comment

Related Items