UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Amber suppression in the archaebacterium Haloferax volcanii 1994

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata


ubc_1994-0144.pdf [ 1.78MB ]
JSON: 1.0099106.json
JSON-LD: 1.0099106+ld.json
RDF/XML (Pretty): 1.0099106.xml
RDF/JSON: 1.0099106+rdf.json
Turtle: 1.0099106+rdf-turtle.txt
N-Triples: 1.0099106+rdf-ntriples.txt

Full Text

AMBER SUPPRESSION IN THE ARCHAEBACTERRJM HAL OFERAX VOLCANII by Josephine Yau Hon. B.Sc., The University of Waterloo, 1991. A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTERS OF SCIENCE in THE FACULTY OF GRADUATE STUDIES Department of Biochemistry and Molecular Biology We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA February 1994 © Josephine Yau, 1994 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. (Signature) ___ ___ ___ ___ ___ ___ Department of Pcc OLE(LLL&L, OLO y The University of British Columbia Vancouver, Canada Date DE-6 (2188) 11 ABSTRACT The purpose of this project was to test whether amber suppression can occur in Haloferax volcanii or not, and if so, to construct a H. volcanii strain that can suppress amber mutations. To achieve this goal, a putative amber suppressor was constructed from the tyrosine transfer RNA of H. volcanii. Its ability to recognize an amber stop codon and to restore the wild type function of an amber mutated gene was tested. The gene coding for tyrosine tRNA of H. volcanii DS2 was cloned and sequenced. Site-directed mutagenesis was carried out to change the anticodon of the tRNA gene from GUA to CUA, which recognizes the tyrosine codon UAU and UAC, and the amber stop codon UAG respectively. The hisC gene of wild type H. volcanii was obtained and recloned into pGEM7(-). Site directed mutagenesis was carried out to change the DNA sequence of its first tyrosine codon (TAC) to an amber stop codon (TAG). I attempted to replace the wild type hisC gene in the H. volcanii WFD11 genome with the hisC gene carrying the amber mutation. However, although the construct carrying the hisC(Am) gene and an antibiotic resistance marker integrated into the genome at the correct place, displacement of the wild type gene through reverse recombination did not occur. An attempt to test amber suppression in H. volcanii was carried out. The hisC(Am) gene was introduced into the genome of a mutant strain of H. volcanii WR256 (his, argj with the antibiotic selection marker mevinolin. The transformants were then transformed again with a plasmid that carries the putative amber suppressor (the tRNATY1 gene with the mutated amber anticodon) and the other antibiotic selection marker novobiocin. Transformants were then selected with both antibiotics and then tested for restoration of histidine auxotrophy. All transformants still required histidine for growth. Southern hybridization showed that the hisC(Am) gene was not integrated into the genome. Mevinolin resistance in the transformants was due to a double crossover recombination event of the antibiotic resistance gene into the genome to replace the wild type gene. Therefore I was not able to conclude whether amber suppression can occur in H.volcanii or not. 111 iv TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iv LIST OF TABLES vi LIST OF FIGURES vii ABBREVIATIONS viii ACKNOWLEDGEMENTS xi DEDICATIONS xii I. INTRODUCTION 1 1.1. Purpose of the project 1 1.2. The genetic code 1 1.3. Transfer ribonucleic acid 4 1.4. Mutations 6 1.5. Suppression 6 1.6. Amber suppression 8 1.7. Archaebacteria 10 1.8. The experimental approach 17 II. MATERIALS AND METHODS 18 2.1. Bacterial strains, plasmid constructions and oligonucleotide sequences 18 2.2. Media and culture conditions 18 2.3. General techiques of molecular biology 21 2.3.1. Preparation of plasmid DNA 21 2.3.2. Preparation of double stranded DNA for sequencing 21 2.3.3. Restriction endonuclease digestion of DNA 21 2.3.4. Gel electrophoresis 22 2.3.5. DNA restriction fragment preparation 22 2.3.6. Oligonucleotide purification 22 2.3.7. Dephosphorylation of identical cohesive termini of vector DNA 22 2.3.8. Ligations 22 2.3.9. Competent cells and transformation 23 2.3.10. Preparation of single-stranded DNA 23 V2.3.11. Generation of deletions by exonuclease.24 2.3.12. Sequencing 24 2.3.13. Labelling of oligonucleotide probes 24 2.3.14. Southern hybridization 24 2.4. Molecular biology techniques for HALOFERAX VOLCANII 25 2.4.1. Competent cells and transformation 25 2.4.2. Preparation of genomic DNA 26 2.4.3. Preparation of plasmid DNA 26 2.4.4. Shuttle vectors for Hvo 27 2.5. Mutagenesis 27 2.6. Autoradiograph scanning 28 Ill. RESULTS 29 3.1. Cloning of the tyrosine tRNA gene 29 3.2. The tyrosine tRNA sequence 32 3.3. Mutagenesis of the tyrosine tRNA gene 36 3.4. The hisC gene 36 3.5. Mutagenesis of thehisC gene 41 3.6. Strategy for construction of hisC(Am) strain 41 3.7. Test for incorporarion of the pHC12M construct 45 3.8. Test for natural amber suppression 48 3.9. Test for differential growth rate 48 3.1O.Plasmid construction 49 3.11.Test for amber suppression in Haloferax volcanii 49 IV. DISCUSSION 4.1. The tyrosine tRNA 54 4.2. Modification pattern 56 4.3, The hisC gene 57 4.4. Gene replacement experiments 58 4.5. Plasmids construction 59 4.6. Test for amber suppression in Haloferax volcanii 60 4.7. Conclusion 61 V. REFERENCES 63 vi LIST OF TABLES Table 1: The genetic code .2 Table 2: Bacterial strains, plasmid constructions and oligonucleotide sequences 19 Table 3: Construction of plasmids that carry either the hisC(Arn) gene or the putative amber suppressor in pGOT vectors 50 Table 4: Attempts to construct a plasmid which contains both the amber suppressor and the hisC(Am) gene 50 Table 5: Control experiment to test for incorporation of the putative amber suppressor into pHC12 51 vii LIST OF FIGURES Figure 1: The structure of transfer RNA 5 Figure 2: Gene replacement in Haloferax volcanii 16 Figure 3: Tyrosine transfer RNA sequence 30 Figure 4: Southern hybridization of wild type genomic restricted DNA to detect for presence of tyr tRNA gene 31 Figure 5: Restriction mapping of plasmid pTl 33 Figure 6: The plasmid pTl 34 Figure 7: DNA sequence of the tyrosine tRNA gene 35 Figure 8: Plasmid construction of pT2.l, pT2.2 and pT3 37 Figure 9: Site- directed mutagenesis of tyrosine tRNA 38 Figure 10: DNA and derived amino acid sequences of the H. volcanii hisC gene.39 Figure 11: Construction of plasmid pHC and pHC12 40 Figure 12: Site-directed mutagenesis of the hisC gene 42 Figure 13: Strategy for constructing the his C(Am)H. volcanii strain 43 Figure 14: Southern hybridization to test for the incorporation of pHC12M into WFD11 46 Figure 15: Predicted result of Southern hybridization when the construct is integrated into the hisC locus 47 Figure 16: Southern hybridization to test for the incorporation of pHC12M into WR256 53 Figure 17: Comparison of halobacterial tRNA 5’-flanking regions 55 viii ABBREVIATIONS A adenosine ATP adenosine triphosphate bop bacteriorhodopsin bp base pair degrees centigrade (Celcius) C cytosine CsC1 cesium chloride D dihydroxyuridine dH2O distilled, sterile water DNA deoxyribonucleic acid DNase deoxyribonuclease dNTP deoxynucleoside triphosphate EDTA ethylene diamine tetraacetic acid G guanosine his histidine H v o Haloferax volcanii kbp kilobase M molar mev mevinolin mevr mevinolin resistant .d microlitre ix ml millilitre mRNA messenger ribonucleic acid nov novobiocin flovr novobiocin resistant O.D. optical density oligo oligonucleotide p plasmid PEG polyethylene glycol PNK polynucleotide kinase pmol picomole RNA ribonucleic acid RNase ribonuclease rpm revolutions per minute rRNA ribosomal RNA S Svedberg unit of sedimentation coefficient SDS sodium dodecyl sulphate ss single-stranded su suppressor T thymidine TE 10mM Tris-Ci, 1mM EDTA tyr tyrosine tRNA transfer ribonucleic acid U uridine u unit ura uracil P pseudouridine YT 8g/1 Bacto trytone, 5g/1 Bacto yeast extract, 5g/1 NaC1 x xi ACKNOWLEDGMENTS I thank the members of my supervisory committee, Dr. R. T. A. McGillivray and Dr. P. Candido, for their help and advice during the course of my studies. I also thank my supervisor, Dr. P. P. Dennis, for his advice and the opportunity to work in his lab. I thank the members of the lab (Luc Bissonette, Janet Chow, Peter Durovic, Phalgun Joshi, Daiqing Liao, Shanthini Mylvaganam, Simon Potter and Janet Yee) for their support and advice. I also thank Deidre de Jong-Wong for her technical help. Special thanks to Mark M. K. Lee for helping me with the computer scanning. I also thank the M. Smith lab, especially CM-Yip Ho for advice and help with site directed mutagenesis. Last, but not least, I would like to thank Dr. R. Redfield for her help and advice. I would also like to acknowledge the financial support of the Natural Science and Engineering Research Council. DEDICATION This thesis is dedicated to my parents, Paul and Molly Yau, and to Eric Leung, for their support and encouragement. xii 1INTRODUCTION 1.1 PURPOSE OF THE PROJECT The goal of this project was to study amber suppression in the archaebacterium H. volcanii. Amber suppression has been widely used in E. coli for studying gene function and expression by providing a system to isolate conditional mutants in an essential gene. To understand amber suppression, some general background on the genetic code, transcription and translation, transfer RNA properties and functions, and suppression of mutations will be discussed in the following sections. Haloferax volcanii is a member of the archaebacteria, a group only recently recognized as a separate line of evolutionary descent from a common primordial ancestor, apart from the eubacteria and eukaryotes (Woose et at., 1990). The study of archaebacteria helps us to better understand the universal ancestor and the evolution of cells. Although recent advances in the development of archaebacterial genetics have led to a better understanding of the unique phenotypic and genetic characteristics of the group, our knowledge is still very limited. The development of an amber suppressing archaebacterial strain would be useful for the study of archaebacterial gene functions and the manipulation of genetic material in the future. 1.2 THE GENETIC CODE The genetic code (Table 1) uses the nucleotide sequence of genomic DNA to specify the order of amino acids in protein produced by a cell or organism (Crick, 1966). The vast array of different proteins possess both structural and catalytic properties that determine the cell’s unique abilities, relating to metabolism, growth U C A C UUU1 UCU UAU1 UGU1 Uj Phe UAC j Tyr UGC j CysU UUA 1 L UCA er UAA* Stop UGA* Stop A UUG J U UCG UAG* Stop UGG Trp C CUU CCU CAU1 . CGU U CUC CCC CAC j CGC CC CUA Leu CCA Pro CAA 1 CGA Arg A CUG CCG CAG j Gin CGG G AUU 1 ACU AAU 1 AGU 1 U AUC He ACC ? j Asn AGC j Ser cA AUA i ACA Thr AAA 1 AGA 1 A AUGt Met ACG AAG] Lys AGG j Arg G GUU GCU GAUl GGU U GUC GCC GAC J ‘ GGC CG GUA Val GCA Ala CAA 1 GGA Gly A GUGt GCG GAG J Glu GGG G TABLE 1: The Genetic Code Taken from Watson et at (1987), p.437 2 3and division. The characteristic features used to encode protein sequence information were first elucidated for the organism E. coli and are now recognized to be nearly universal and therefore generally applicable to all other organisms. The code consists of triplets; three successive nucleotide base pairs in DNA specify one of the twenty different amino acids found in protein. Triplet codons are non-overlapping, read sequentially in a 5’ to 3’ direction, and when read in sequence specify the order of amino acids from the N (amino) to the C (carboxyl) terminus of the protein. The genetic code is degenerate; using the standard bases found in DNA and RNA, there are sixty-four different triplet combinations, but there are only twenty amino acids found in protein. Examination of the codon assignments indicates that the third base in the triplet is least important and often carries little or no information. They are given the name wobble bases. For example, the amino acid glycine is specified by four codons which differ only in the third position: GGG, GGC, GGA, and GGU. These properties help to minimize the deleterious effects of mutations that occur at the third codon position and simplify the decoding process. The genetic information carried in DNA is not decoded directly. Instead the sequence from the coding strand of the DNA is first transcribed onto messenger RNA. The mRNA is then decoded on the ribosomes by a series of interactions with amino acylated transfer RNA molecules (Hoagland et at., 1957). Four of the sixty four codons are used as signals to punctuate the code. Aside from specifying the amino acid methionine, the codon AUG is also recognized by a special initiator methionine tRNA to signal the site within the mRNA where translation is to begin (Adams and Capecchi,1966). Three codons, UAA (ochre), UAG (amber) and UGA (opal), do not specify amino acids and are not recognized by any tRNA. Instead they signal the end of translation and are recognized by proteins called releasing factors. 4They are the sites where translation stops and the newly synthesized polypeptide is released from the ribosome. 1.3. TRANSFER RIBONUCLEIC ACID All tRNAs share some common sequence and structural features and can be folded into a compact L-shaped configuration (Holley et al., 1965; Rich and RajBhandary, 1976) (figure 1). Transfer RNAs contain a large number of unusual bases such as dihydrouracil, pseudouracil, 4-thiouracil, methyl or dimethyl guanine and methyl adenine, which are normally not found in other RNA species. These bases are generated by enzymatic modification after transcription and are found in the ioop region of the tRNA structure. Their functions are still not fully understood (reviewed in Singer and Kroger, 1979). Nishimira (1979) suggests that the modified nucleosides in the anticodon region may stabilize and enhance certain anticodon codon base pairing interactions or act as wobble bases. They might also be involved in stabilizing the conformation of the tRNA or its binding to the ribosome, or might enhance its resistance to degradation by ribonuclease or the specificity of recognition of aminoacyl-tRNA synthetase. All tRNAs contain four stems: the acceptor stem, the D stem, the anticodon stem, and the TNIC stem. In some species, an extra arm 3 to 15 bases long may be present between the TcC stem and the anticodon stem. The anticodon loop contains the anticodon which recognizes and base pairs with codons during transcription. The end terminal CCA region of the acceptor stem is the site where the corresponding amino acid is attached by aminoacyl synthetases (reviewed in Saks et a!., 1994). The amino acyl tRNAs read the triplet codon on the mRNA by base pairing with the complementary tRNA anticodon loop, and sequentially insert amino acids onto the growing peptide. 5FIG 1: The Structure of Transfer RNA a. Primary structure of yeast phenylalnine tRNA b. The compact L-shape molecule of tRNA Taken from Darnell et at (1986), p.112 al Amino acd Am.no acid a(mS. I TCG a.m 0 loon •1 Amino acid arm 5 end mG. TdCG lo — C 4- Y end .niodon loQ Ajcodon Codon C C 0 C C 61.4 MUTATIONS A mutation is a change in any DNA base pair and can occur in many forms: substitution, deletion or insertion. Within coding regions, synonymous mutations represent third position substitution between codons specifying a single amino acid; they do not affect the phenotype of the organism, and are often not detected. Non- synonymous mutations are alterations that cause an amino acid replacement in the encoded protein. The resulting polypeptide product is often still functional or partly functional. Insertions and deletions are often deleterious since they often change the reading frame on the messenger RNA. This produces a protein with an aberrant amino acid sequence beyond the site of the frameshift, giving rise to a dysfunctional product. However, when the number of inserted or deleted bases is a multiple of three, the reading frame is not disturbed, and the resulting protein contains either fewer or extra amino acids at the site of the deletion or insertion. Nonsense mutations are usually recovered less frequently than the other mutations (Garen, 1968). This type of mutation changes an amino acid specific codon to a chain terminating codon, and results in premature termination of translation and production of a truncated polypeptide product. The length of the polypeptide translated depends on the position of the mutation within the gene. Incomplete polypeptide fragments generated by nonsense mutations are usually non-functional because they do not contain all the essential structure required for activity. Since the products of nonsense mutations are usually non-functional, they are very useful in the elucidation of biochemical pathways and protein functions. 1.5 SUPPRESSION 7Reversion of a mutation in a gene is often a result of a back mutation to specify the original amino acid. In other cases, it involves second site mutations which can be either intragenic or intergenic. Intergenic suppression can be a result of missense or nonsense suppression. A missense mutation can be suppressed by a second missense mutation within the same gene (Hill, 1975). When the first missense mutation alters the three dimensional structure of the protein, which is essential for its activity, a second missense mutation may restore the three dimensional structure and hence the biological activity of the protein. Missense suppression is usually inefficient and only partial in its restoration of function. Therefore it is not commonly used in genetic analysis. In nonsense suppression, a mutant tRNA molecule has an anticodon complementary to a chain terminating codon ( reviewed in Lewin, 1974). The mutant tRNA then inserts a functional amino acid at the site of the nonsense mutation to prevent premature termination. The mutation is suppressed and the wild type phenotype will be restored. Suppressors which utilize the UGA, UAA, and UAG stop codons are known as opal, ochre and amber suppressors, respectively (Hirsh, 1971; Garen, 1968; Engelhardt et al., 1965). The nature of opal suppression is still not fully understood, since its mode of action is different from the model proposed for the other nonsense suppressors (Hirsh, 1971; Hirsh and Gold, 1971). The tryptophan tRNA suppressor is not mutated at the anticodon region but at position 24 of the tRNA, where a G is replaced by an A. This affects the three dimensional structure of the tRNA, which allows moderate suppression of the opal UAG codon. Normal tryptophan tRNA with anticodon CCA can also read the opal stop codon UGA but at a much lower 8frequency. The ochre suppressor is much weaker than the other two suppressors (Garen, 1968). The ochre codon UAA is the most frequently used stop codon in vivo and its suppression is clearly deleterious. Cells that carry the ochre suppressor usually grow poorly and therefore an efficient ochre suppressor cannot be isolated. 1.6 AMBER SUPPRESSION The amber suppressor system is the most widely used and best understood nonsense suppressor system. The suppression of amber mutations is an intergenic nonsense suppression which occurs at the level of translation of mRNA (Engelhardt et at., 1965). The codons UAU and UAC specify the amino acid tyrosine, whereas the amber stop codon UAG specifies termination of messenger ENA translation. In a non-permissive system (one lacking an amber suppressor tRNA), a change in the third base of the tyrosine codon from a U or a C to a G results in premature termination of translation which gives rise to an incomplete and usually non-functional protein product. However, in a permissive system, the minor species of the tyrosine tRNA is mutated in the anticodon from GUA to CUA (the amber suppressor). It can now recognize the UAG stop codon and insert tyrosine at that position, preventing termination. A complete protein product is then formed (Goodman et at., 1968). In E. coli, amber suppressors can be derived from single base mutations in the anticodon region of several different species of tRNA. They can be formed by mutating the third base in the anticodon of glutamine (CUC), glutamic acid (CUG) and lysine (CULT) tRNAs, or the second base of leucine (CAA) and serine (CGA) 9tRNAs. However, amber mutants formed by a mutation in the first base position of the tyrosine anticodon (su3) are most widely used and understood. The system utilizes two species of genes which code for tyrosyl-tRNA, a major and a minor one. The major gene is responsible for the synthesis of most of the tyrosyl-tRNA. The minor one consists of two copies of tyrosyl-tRNA genes and either one or both of them is mutated to form a suppressor (Russel et al., 1969). In this way, the system still has an abundant amount of tyrosyl-tRNA for normal translation. The minor species is mapped close to the attachment site of phage 80; therefore it can be packaged into the phage to promote excess synthesis of the minor tRNA (Abelson et at., 1970; Smith et at., 1970). Lewin (1974) summarized the efficiency of 12 amber suppression systems and concluded that the amber suppressor su3 showed the most efficient suppression as measured in the suppression of four different genes (T4 head protein, alkaline phosphatase, 13-galactosidase and ornithine transcarbamylase). Amber suppression has been widely studied and utilized in E. coti for analyzing gene expression. Stretton and Brenner (1965) used the amber system to demonstrate that genes and proteins are colinear. Abelson et at. (1970) and Smith et at. (1970) isolated mutants of tyrosyl-tRNA to study the relationship between sequence change and the functional defects in the molecule. They were able to draw conclusions regarding the structural and functional roles of particular sequences of tRNAs. Amber suppression provides a convenient genetic system by which the expression of an amber mutated gene can be turned “on” or “off” easily (Gesteland et at., 1967). This provides a way for conditional mutants in an essential gene to be isolated. Suppression competes with chain termination. Each suppressor gene is characterized by the relative frequency of amino acid insertion compared to termination, which ranges from less than 1% to about 60% (Smith et at., 1966). 10 1.7 ARCHAEBACTERIA Archaebacteria are a group of organisms that exhibit prokaryotic-like cell structure and organization but at the same time possess a number of eukaryotic features (Dennis, 1986). The discovery and studies of archaebacteria provide us with a new perspective on early events in the evolution of cells, and help us to understand better the universal ancestor and to develop a more accurate concept of eukaryotic origins. Before the recognition of the archaebacterial kingdom, life on earth was divided into two primary kingdoms: the eukaryotes and the prokaryotes, which includes the eubacteria and the archaebacteria. The archaebacteria are now believed to be more closely related to the eukaryotes (Woese, 1981), and comprises one of the three newly defined domains: the eukaryotes (Eucarya), eubacteria (Bacteria) and archaebacteria (Archaea) (Woose et a!., 1990). Archaebacteria propagate at biological extremes of temperature, pH and salt concentration. The group is diverged into two branches: the methanogenic halophilic and the sulfur-dependent thermophilic branch. The former is composed of groups with two distinct phenotypes: anaerobic methane producers and aerobic halophiles. Halophiles grow at slightly elevated temperatures of 350C to 500C and salt concentrations of 1.5 to 5M NaCl. They have a sequence complexity comparable to that ofE. coli, with a high G+C content and their genome sizes range between 5x10 to io bp (Moore and McCarthy, 1969a). In Halobacterium halobium, the G+C content of the chromosomal DNA and the satellite DNA are 66 to 68 mole percent and 57 to 60 mole percent, respectively (Moore and McCarthy, 1969b). Halophiles also possess a restriction-modification system similar to those found in eubacteria (Daniels and Wais, 1984). Their metabolism and physiology are similar to those of eubacteria, with some unusual features such as the synthesis of isoleucine from pyruvate and acetyl-CoA instead of from threonine (Eikmarins and Thauer, 1984). 11 The structure and catalytic properties of many of their enzymes closely resemble those of either the eubacteria or the eukaryotes. The halophiles possess many unique genetic characteristics. The chromosomal and extrachromosomal DNA of H. halobium are genetically and physically very unstable. Plasmid rearrangements are frequent and complex, and insertions and deletions occur at high frequency. This instability is due to the presence of repetitive sequences and abundant insertion elements. There are at least 500 repetitive sequences in H. halobium (Doolittle, 1985), and there are also abundant multiple repetitive sequences in Haloferax volcanii. Comparative analysis of both 5S rRNA and 16S small subunit RNA shows that archaebacteria form a unique and coherent phylogenetic group as reviewed in Dennis (1993). Analysis of the 16S rRNA shows that archaebacteria appear to be more closely related to the common ancestor than either the eubacteria or the eukaryotes (Woese et a!, 1983). The RNA polymerase found in archaebacteria most closely resembles the eukaryotic ENA polymerase II and III in amino acid sequence. Only a single polymerase has been found in any archaebacterium (Zillig et a!, 1985) whereas eukaryotes possess three nuclear RNA polymerases. In archaebacteria, three rRNAs are present: 5S, 16S, and 23S. The ribosomes dissociate into two components: 30S and 50S. Ribosomal RNA sequences are extensively diversified within the archaebacteria; however, there is a clear distinction between those of the archaebacterial kingdom and those of eubacteria and eukaryotes. Although the general secondary structure of archaebacterial tRNA is similar to the eubacterial and eukaryotic tRNAs (Gupta, 1985), they possess many unique structural details. The archaebacterial tRNA genes lack the 3’-CCA terminal end 12 (Wich et al, 1984; Hui and Dennis, 1985). This sequence is added as a post transcriptional modification by tRNA terminal transferase. The consensus TTAA motif of all archaebacterial promoters appear to be related to the TATA box of the eukaryotic ENA polymerase II promoters (Reiter et a!, 1990; Thomm and Wich, 1988; Thomm et a!, 1989). Archaebacterial transfer RNAs have a characteristic pattern of post- translational modification which is distinctly different from the corresponding eubacterial and eukaryotic patterns. The modified bases T and m7G found commonly in eubacteria and eukaryotes are absent in all archaebacteria examined (Gupta and Woese, 1980). Modified nucleosides present in the H. volcanii tyrosine tRNA include pseudouridine (‘P), 1-methylpseudouridine(mP), 2-methylcytidine (Cm), 5-methylcytidine (m5C) and 1-methylguanosine (m’G) (Gupta, 1984). At position 54, instead of the nucleoside T found in most eubacterial and eukaryotic tRNAs, pseudouridine is present in most archaebacterial tRNAs. In the tyrosine tRNA of H. volcanii, it is modified to m1’P. 1-Methylpseudouridine and T have similar molecular profiles and base pairing properties and could be an example of an evolutionary convergence of structures (Gupta, 1985). The modified nucleosides ‘1’ and m1P could be involved in binding tENAs to ribosomes (Sprinzl et a!., 1976). A methylated G (m1G) is present at position 37. Nishirura (1979) proposed that the modified base right next to the anticodon may help stabilize the codon-anticodon interaction. At position 56 of all examined archaebacterial tRNAs, the modified base methylated cytosine Cm is present. Cm may also be present at position 32. Position 57 of many H. volcanii tRNAs consists of a methylated inosine, which is also a unique characteristic of archaebacterial tRNAs. With the increasing interest in the study of the molecular biology of the archaebacteria, new genetic tools and selection systems are needed for the analysis of 13 gene structure, function and regulation. The halophilic archaebacterium H.volcanii was discovered by Benjamin E. Volcani and was later isolated and studied (Mullakhanbhai and Larsen, 1975). The optimum sodium chloride requirement of the organism is 1.7M, which is close to that found in the Dead Sea. They have a high tolerance for magnesium chloride and are basically disc-shaped; however, the size and shape of the cells vary with the culture conditions and from cell to cell in the same culture. The cells are very fragile and are easily ruptured by mechanical treatments (Muriana,et at, 1987) and can be lysed in a hypotonic solution. The DNA has a high GC content (63%), which is characteristic of a halobacterium. The cells of H. volcanii are orange to red in color due to carotenoids, and have a characteristic odor. The H.volcanii DS2 genome consists of a 2920 kbp chromosome and four plasmids: a 690 kbp pHV4, a 442 kbp pHV3, a 86 kbp pHV1, and a 6.4 kbp pHV2. By ethidium bromide treatment, Charlebois and co-workers (1987) cured the pHV2 plasmid from DS2 to generate a new strain, WFD11. This strain has no visible difference in growth rate or phenotype compared to DS2. It transforms efficiently with the plasmid pHV2 and an artificial construct, pHV2693. Using the WFD11 strain, a PEG-mediated spheroplast transformation system was derived (Cline et al., 1989). The efficiency of uptake and expression was comparable to the efficiency of transfection of H. halobium with phageH DNA (Cline and Doolittle, 1987). Spheroplasts are generated by addition of EDTA to chelate Mg2 ions. The cells regenerate when Mg2+ levels in the growth medium are returned to normal. Archaebacteria are insensitive to most commonly used antibiotics (Boch and Kandler, 1985). They are found to be sensitive to mevinolin and novobiocin. Spontaneous mutants of H. volcanii resistant to the two antibiotics were isolated. This made the development of vectors with selectable markers possible (Holmes 14 and Dyall-Smith, 1991; Holmes et al., 1991; Lam and Doolittle, 1989). Novobiocin inhibits the activity of eubacterial DNA gyrase by binding to the GyrB subunit and blocking the access of ATP to its binding site on the subunit (Mizuuchi et al, 1978). It is thought that halobacteria are similarly inhibited (Holmes and Dyall-Smith, 1991). Resistant H. volcanii have been shown to produce a gyrase that binds novobiocin less avidly (Thiara and Cundliff, 1988). Mevinolin is an inhibitor of the enzyme 3 - hydroxyl - 3 methylgiutaryl coenzyme A reductase (Cabrera et al, 1985), which is essential in the mevalonate pathway for synthesis of isoprenoid lipids (Kates et a!, 1968). Cells are inhibited due to decreased mevalonate availability instead of a generalized toxic effect. With the development of an efficient transformation system and the availability of selectable markers, shuttle vector systems were developed (Lam and Doolittle, 1989; Holmes et a!., 1991). This provides a convenient system to move DNA back and forth between the H. volcanii and E. coli systems and greatly simplifies DNA propagation and sequence manipulation. The shuttle vectors contain the origin of replication in plasmids isolated from different strains of H.volcanii, such as pHK2 from strain Aa 2.2 (Holmes et a!, 1991) and pHV2 from DS2 (Lam and Doolittle, 1989). This provides the essentials for replication and maintenance in the H. vo!canii system. The selectable antibiotic resistant genes (mev” or novr) are present so that transformants can be isolated efficiently. Fragments of E. coli plasmids constitute the rest of the vector, providing the necessary sequences for plasmid selection and maintenance in E. coli. A wide selection of shuttle vectors are now available. The newer versions are considerably reduced in size so that larger fragments of DNA can be transformed efficiently (Bissonette and Dennis, unpublished). The organism H. volcanii was chosen for study because an efficient plasmid transformation and selection system was already made possible with a number of 15 cloning vehicles. It seems to be genetically more stable than other members of the halophiles due to the presence of fewer insertion sequences (Doolittle, 1985). The genome of H. volcanii DS2 has been collected as minimally overlapping fragments of about 36 kbp produced by partial digestion with MluI (Charlebois et at, 1991). The collection covers 96% of the whole genome and is available as cosmid clones (Cohen et a!., 1992). Furthermore, H. volcanii grows readily on defined basal salt media with glycerol and succinate as carbon energy source. Since this species is prototrophic, auxotrophic mutants can be readily isolated. A natural system of genetic exchange (Mevarech and Werczberger, 1985) and gene replacement (Krebset at, 1993) in halobacteria has been discovered. Genetic transfer between H. votcanii cells requires cell-to-cell contact and is insensitive to DNase. Transfer is bi-directional and believed to be through cytoplasmic bridges between the two participants of a mating event (Rosenshine and Mevarech, unpublished result cited in Dennis, 1993). Gene replacement is achieved by DNA uptake and integration by homologous recombination of non-replicating DNA into the chromosome (reviewed in Dennis, 1993). Linear DNA can be recombined into the chromosome by two crossing-over events, resulting in gene replacement (Fig 2a), whereas circular DNA is integrated into the chromosome through a single cross-over event, generating a tandem duplication (Fig 2b) (Lam and Doolittle, 1989). Mutant sequences along with a selectable marker on a circular molecule can be put into the chromosome. The clones are then transferred to non-selective media, and the chromosome will readily undergo a second recombination event to expel one of the duplicate sequences. Ideally, in 50% of all cases, the original inserted DNA fragment will be excised. In the other 50% of the cases, the wild type sequence will be excised to produce the replacement. Krebs and co - workers (1993) had successfully utilized this method to introduce deletions into the chromosomal bop gene of H. 16 -F a. LinearDNA recombined into the chromosome by two cross-over events L///7] y ,i V b. Circular DNA recombined into the chromosome by a single cross-over event FIG 2. GENE REPLACEMENT IN Haloferax volcanii Products of homologous recombination between a chromosomal sequence and a linear or circular DNA fragment. Homologous DNA sequences are represented by the shaded area. Chromosomal DNA is represented by broken lines. The positions of recombination are indicated by crosses. This figure is adapted from Dennis, 1993 17 halobium. The bop gene activity of the isolated mutants ranged from 0% to 56% activity as compared to the wild type. 1.8 THE EXPERIMENTAL APPROACH To test whether amber suppression can occur in H. volcanii , the tyrosine transfer RNA was cloned and its anticodon region changed from GTA to CTA (RNA sequence GUA to CUA) by site-directed mutagenesis, making it complementary to the amber stop codon UAG. The putative amber suppressor was then tested for its ability to recognize the amber stop codon and to restore wild type function in an amber mutated gene. Originally, the uradil auxotrophy gene was chosen as the candidate for testing the ability of the altered tRNA to suppress amber mutations since it has a convenient positive selection system for auxotrophs (Kondo et al, 1991). However, after several attempts to clone the gene and reviewing the results of other experiments performed by Dennis (unpublished), we concluded that the H. volcanii urtr mutants that we obtained from the Doolittle lab exhibit partial activity in the mutant protein and therefore cannot be used in the cloning of the gene. The hisC gene of H. volcanii (Conover and Doolittle, 1990) was then used for testing the amber suppression system. It contains an open reading frame which encodes histidinol-phosphate aminotransferase, the eighth enzyme of the histidine biosynthetic pathway. By generating an amber mutation in the gene and then putting the two (his(Am) gene and the putative amber suppressor tRNA) together in the H. volcanii system, we tested for the possibility of amber suppression in H. volcanii. 18 MATERIALS AND METHODS 2.1 BACTERIAL STRAINS, PLASMID CONSTRUCTION AND OLIGONUCLEOTIDE SEQUENCES The bacterial strains, plasmid constructions and oligonucleotide sequences that were used are described in Table 2. 2.2 MEDIA AND CULTURE CONDITIONS All E. coli strains were grown either in YT media (5g/l Bacto-yeast extract, Sg/l Bacto-tryptone, 5g/l NaCl, pH7.5), 2xYT or minimal salts (M9) media (6g/l Na2HPO4, 3g/l KH2PO4, 0.5g/l NaC1, lg/l NH4C1) supplemented with glucose (0.2%), MgSO4 (2mM), CaC12 (0.1mM) and thiamine (0.5ig/ml). Solid media were prepared by addition of Bacto-agar (15g/l). All strains were grown at 370 C. When required, antibiotic concentrations used were: ampicillin (100pg/ml) and kanamycin (50pg/ml). Haloferax volcanii was grown in the basal salt medium SWG (3.32M NaCl, 0.1M MgSO4.7H20, 0.08M MgC12.6H2O, 0.07M KC1, 6.8mM CaCl2.2H2O, 4.9mM NaBr, 2.4 mM NaHCO3) supplemented with 0.5% yeast extract (Oxoid). When minimal media were prepared, the following components were added to 1L of the salt media instead of yeast extract: 5 ml 1M NH4C1, 45 ml of 10% glycerol, 5 ml of 10% sodium succinate, 1 ml of trace elements and 2 ml of 0.5M K2HPO4(Mevarech and Werczberger, 1985). Solid media were prepared by addition of 15g/l agar technical (agar no. 3; Oxoid). Histidine or arginine supplements were added at a concentration of 5Opg/ml when needed. All strains were grown at either 37°C or 420C. The antibiotics mevinolin and novobiocin were added at concentrations of 50.tM and 0.2 pg/ml respectively when needed. 19 TABLE 2: BACTERIAL STRAINS. PLASMID CONSTRUCTIONS AND OLIGONUCLEOTIDE SEQUENCES Strain Description E. coli DH5c F- recAl endAl gyrA96 thi hsdRl7 supE44 relAl 2- HB2151 K12 ora 8(lac-pro) thi/F’ proA+B+ lacZ 8M15 JM1O1 supE thi 3(lac-proAB), jF’ traD36 proAB lacIZ8M15J RZ1032 Zbd-2791lysA(61-62)J, duti, ungi, thil, rell, supE44,Tnl 0 H. volcanii DS2 wild type Haloferax volcanii consisting of a 2920 kbp chromosome and 4 plasmids: pHV1-4 WFD1 1 strain DS2 lacking the plasmid pHV2 WR256 mutagenised WFD11 his arg Plasmid Description pT4C 2.7 kbp SacI-MluI fragment containing hisC gene in SmaI site of pGS18 obtained from the Doolittle lab. pHC 2.7 kbp BamHI-EcoRJ fragment containing hisC gene subclone from pT4C in pGEM7(-) pHC12 a derivative of pHC containing the mutation TAC to TAG in codon 12 of hisC pTl 4.5 kbp SmaI fragment containing the H. volcanii tyrosine tRNA gene in pGEM7(-) pT2.1 800bp SmaI-EcoRI fragment containing the H. volcanii tyrosine tENA gene in pGEM7(-) 20 pT2.2 800bp SmaI-EcoRI fragment containing the H. volcanii tyrosine tRNA gene with an altered anticodon GUA to CUA pT3 1.5 kbp Smal fragment in pGEM7(-) containing the putative amber suppressing tyrosine tRNA gene Oligonucleotide Description 01 TCCGCTCTCCCCGATIT/C a minus strand sequence complementary to position 73 to 57 within the tyrosine tRNA gene 02 AGAGCAGCCGACTGTAG a plus strand sequence identical to position 21 to 37 within the tyrosine tRNA gene 03 CTGCTCAAACCGGCTCG a minus strand sequence complementary to the region 17 bp 3’ downstream of tyr tRNA 04 CGATCTAGAGTCGGCTGCTCT a minus strand sequence complementary to position 41 to 21 within the tyrosine tRNA gene except at position 34, where a G is present instead of aC 05(JMH) ACGCTCCCTAGGTACCCGGCCG a plus strand sequence identical to position 26 to 47 within the hisC gene except at position 36, where a G is present instead of a C 06(JSH) TCGGTCGTCGCGTCCCCAAC a plus strand sequence identical to position 70 to 89 within the hisC gene 21 07(JSH2) TGGGCGGTCTrCGGGTAGAC a minus strand sequence complementary to position 200 to 180 within the hisC gene 2.3 GENERAL TECHNIQUES OF MOLECULAR BIOLOGY General recombinant DNA techniques were carried out according to Sambrook et at. (1982) unless otherwise specified. 2.3.1 PREPARATION OF PLASMID DNA Small scale preparation of plasmid DNA was done by the alkaline lysis method (Sambrook et at., 1982) or one-step miniprep method (Chowdhury, 1991). Large scale DNA was prepared using alkaline lysis (Sambrook et at., 1982), with the following modifications: the supernatant was not filtered through layers of cheesecloth. The final DNA pellet was dissolved in 97% CsC1 (97g/lOOml dH2O) and banded in a CsC1-ethidium bromide gradient at 50,000 rpm overnight. The DNA obtained after removal of EtBr was diluted in three volumes dH2O and then precipitated with 95% EtOH. 2.3.2 PREPARATION OF DOUBLE STRANDED DNA FOR SEQUENCING Double stranded DNA was either prepared as described in Saunders and Burke (1990) using CsC1 or with the Magic miniprep DNA purification system supplied by Promega. Reactions were carried out according to manufacturer’s protocol. 2.3.3 RESTRICTION ENDONUCLEASE DIGESTION OF DNA Restriction enzymes used were purchased from Pharmacia Inc., Bethesda 22 Research Laboratories (BRL) or New England Biolabs. Digestions were carried out according to the instructions of suppliers. 2.3.4 GEL ELECTROPHORESIS Samples of DNA were separated by electrophoresis on agarose gels (0.7% or 1%) in TBE buffer (89mM Tris, 89mM boric acid, 2.5mM Na2EDTA) in the presence of 0.25 mg/mi ethidium bromide. 2.3.5 DNA RESTRICTION FRAGMENT PREPARATION Bands of restricted DNA, stained with ethidium bromide, were excised from agarose gels and recovered using Sephaglas BandPrep Kit (Pharmacia) 2.3.6 OLIGONUCLEOTIDE PURIFICATION Oligonucleotides were purified as described in Sawadogo and Dyke (1991) and the concentrations were determined by spectrophotometry. 2.3.7 DEPHOSPHORYLATION OF IDENTICAL COHESIVE TERMINI OF VECTOR DNA Identical cohesive termini of vector DNA were dephosphorylated with shrimp alkaline phosphatase (SAP) (United States Biochemical) by using 3u of enzyme per microgram of DNA. The reaction was incubated in SAP buffer (20mM Tris-Cl pH8.0, 10mM MgC12) for 1 hour at 37°C to prevent religation. The enzyme was then heat inactivated at 65°C for 15 minutes. 2.3.8 LIGATIONS Cohesive-end ligations were incubated at 14-160Covernight or 2 hours at room temperature. 23 For blunt-end ligations, incubations were at room temperature overnight or 2 hours with 5% PEG8000. 2.3.9 COMPETENT CELLS AND TRANSFORMATION Competent cells (DH5c or HB2151) were made by treatment with CaC12 (Sambrook et al, 1982). Frozen competent cells were prepared as above and resuspended in ice-cold 100mM CaC12 containing 15% glycerol. The suspension was incubated on ice for 1 hour and then aliquoted into lOOp.! stocks. These were then frozen in dry ice and stored at -70°C until needed. Transformation of plasmid DNA was carried out by incubating competent cells with DNA on ice for 30 minutes. The cells were then heat shocked at 37°C for 2 minutes, plated on selective media and incubated for 12-16 hours. 2.3.10 PREPARATION OF SINGLE -STRANDED DNA Single stranded DNA template can be made from a host carrying a phagemid by superinfection using a helper phage. The plasmid pGEM7(-) can be used as a phagemid since it contains the fi origin of replication. A single colony of freshly grown HB2151 on M9 plates containing the plasmid pGEM7(-) with the appropriate inserts was inoculated into 2xYT media. The culture was grown to mid-exponential phase. It was then infected with either phage R408 or M13K07 and incubated for 6 hours with good aeration. Cells were then spun down and the phage particles and DNA were precipitated in 4% PEG8000 and 0.7M NH4OAc. The pellet was resuspended in TESDS(lOOmM Tris, 10mM EDTA, 0.1%SDS) and incubated with proteinase K for 30 minutes. The sample was then extracted with phenol and chloroform until no protein interface was observed and then precipitated and washed with ethanol. 24 2.3.11 GENERATION OF DELETIONS BY EXONUCLEASE Exonuclease deletion was performed as described in the Promega protocols and application guide(1991), p90-98, at 32.50C. Samples were taken every 30 seconds. After treatment with Klenow and dNTPs, the samples were loaded on a 1% agarose gel to determine the efficiency and extent of deletion. The bands were then recovered as described in 2.3.5, the ends were religated to form a circular plasmid and then transformed into DH5x. 2.3.12 SEQUENCING Sequencing was performed according to the instructions supplied with the Deaza G/A T7 Sequencing Kit (Pharmacia) with the exception that the primer was added to the double stranded DNA template before denaturing in 0.2M NaOH. Furthermore, the template/primer/NaOH mixture was denatured by boiling in a water bath for 5 minutes and then quickly quenched on ice. 2.3.13 LABELING OF OLIGONUCLEOTIDE AND FRAGMENT PROBES Oligonucleotide probes were end-labeled using bacteriophage T4 polynucleotide kinase (PNK) and [y-32PJATP (sp. act. 3000 Ci/mmol, 10.tCi/pi). Bacteriophage T4 PNK was inactivated by heating to 65°C for 10 minutes. Restriction fragments purified as in section 2.3.5 were radiolabeled using the Random Primers DNA Labeling System (BRL). The labeling reaction was carried out at 250C for 1 hour. The enzyme was then inactivated by addition of Sjil of stop buffer and boiled for 5 minutes in a water bath. Approximately bOng of DNA fragment was used in each reaction and half of the labeled reaction mixture was used in each Southern Hybridization. 2.3.14 SOUTHERN HYBRIDIZATION 25 Southern hybridization was carried out either on Hybond paper or using the dried-down agarose gel. DNA was transferred and probed on Hybond paper as described in the protocol: Blotting and hybridization protocols for HybondTM membranes supplied by Amersham. The transfer was carried out overnight. Prehybridization was carried out at 400C or 65°C and hybridization at 50°C for labeled oligonucleotide probes or 65°C for fragment probe respectively. When oligonucleotide probes were used, the third wash was not carried out. Hybridization with genomic DNA was done in a dried gel. The 1% agarose gel was dried under vacuum at room temperature for 1 hour and then at 60°C for another 30 minutes or until the gel is dried. The gel was then denatured for 30 minutes in 0.5M NaOH/0.15M NaCl and neutralized twice for 15 minutes in 0.15M Tris/0.15M NaCl. The gel was hybridized to the probe by heating to the estimated Tm(melting temperature) of the probe for 30 minutes and then cooled slowly down to room temperature. The hybridized gel was then washed with 6xSSC (175.3g/L NaCl. 88.2g/L Na.citrate.2H20, pH7) to remove any non-specific binding of probe. Autoradiography was then carried out on the membrane or gel. 2.4 MOLECULAR BIOLOGY TECHNIQUES FOR HALOFERAX VOLCANII 2.4.1 PREPARATION OF COMPETENT CELLS AND TRANSFORMATION Competent cells of WFD11 or other strains of halobacteria were prepared by pelleting 1 ml of culture in mid or late exponential phase(O.D.= 0.5-1.5) and then resuspending in 200p.l spheroplast generation solution (0.8 M NaC1, 27mM KC1, 50mM Tris-HC1, 15% glycerol, 15% sucrose). The cells can either be used immediately or frozen at -70°C. Spheroplasts were formed by addition of 20il 0.5M EDTA and incubated with 26 the DNA solution. Then 240ii1 of HFPEG(6m1 PEG600 and 4ml spheroplast generation solution) was added and mixed gently until a homogenous solution was obtained. Cells were regenerated by adding 1 ml of solution R (3.4M NaCl, 175mM MgSO4.7H20, 34mM KC1, 7mM CaCl2.2H20, 50mM Tris-HC1, 15% sucrose) and grown in SWGR (SWG supplemented with yeast extract and 15% sucrose) for 6 hours before plating on appropriate media(Cline et al, 1989). The plates were incubated at 42°C for 5-14 days. 2.4.2 PREPARATION OF GENOMIC DNA The pellet from 3mls of a H. volcanii culture was resuspended in 0.4 ml lysis buffer(4OmM Tris, 20mM EDTA and 10mg/mi lysozyme), vortexed vigorously and incubated at 37°C for 30 minutes. Then 0.1 ml of 5% SDS with lOOj.tg/ml RNase was then added and incubated for 5 minutes at 45-60°C. The clear, viscous solution was then extracted with phenol twice and then with chloroform: isoamyl alcohol once. The aqueous phase was transferred to a fresh tube containing 15.tl of 5M NaCl and mixed well. To precipitate the DNA, cold 95% ethanol was added and mixed gently until DNA threads were visible. The DNA was spooled onto a sealed pasteur pipette and rinsed by dribbling 1 ml of 70% ethanol over the pipet tip. The DNA was then dried by standing the tip up for 10 minutes and resuspended by swirling the tip in 0.2m1 TE warmed to 37°C. 2.4.3 PREPARATION OF PLASMID DNA One milliliter of H. volcanii culture was pelleted and resuspended in 100jil of HFNTh (1M NaC1, 50mM Tris, 10mM EDTA, pH8). Cells were lysed by adding 5 ill of 5% deoxycholic acid, followed by 200il of alkaline lysis solution II (0.2N NaOH and 1% SDS) and solutionifi (294.5 g/L potassium acetate and 115 ml/L acetic acid). It was then centrifuged and the supernatant was recovered. DNA was ethanol precipitated 27 and resuspended in TE. Proteins were differentially precipitated by adding ammonium acetate to a final concentration of 2M. 2.4.4 SHUTTLE VECTORS FOR H. VOLCANII Shuttle vectors were used throughout the experiments to move DNA back and forth between E. coli and H. volcanii for genetic manipulation and in vivo gene exprssions respectively. The pGOT series of shuttle vectors used are as described in Bissonnette and Dennis (unpublished). 2.5 MUTAGENESIS Uracil containing single stranded DNA template was synthesized in RZ1032, and prepared as described in 2.3.10. Mutagenesis (Kunkel, 1985; Kunkel et a!, 1987; Ner et al,1988) was carried out with oligo 4 on tyr tRNA gene and with oligo 5 on his C gene. One microgram of uracil containing single stranded DNA template was annealed with 5 pmol of the corresponding phosphorylated oligonucleotide in lox annealing buffer (100mM Tris-HC1 pH8, 500mM NaCl, 100mM MgC12 and 10mM DTT). The mixture was heated to 750C for 10 minutes and cooled slowly to room temperature. Extension and ligation were then performed by addition of one-fifth volume of 5x polymerase mix (100mM Tris-HC1 pH8.8, 10mM DTT, 50mM MgCl2, 5mM ATP and 2.5mM each of dATP, dTTP, dGTP, dCTP) and 2U of T4 DNA ligase and 2 u Klenow. The mixture was left on ice for 5 minutes, then incubated at room temperature for 2 hours. Further aliquots of Klenow (2u) and ligase (2u) were added to the mixture and incubated at 370C for another 2 hours. One-tenth of the reaction mixture was transformed into E.coli DH5oc and colonies formed were individually picked and sequenced. Only the G and C sequencing reactions were performed in the initial screening of the mutagenized clones to avoid redundant sequencing. 2.6. AUTORADIOGRAPH SCANNING All autoradiographs obtained from Southern hybridizations and sequencing reactions were scanned using a flatbed scanner (Hewlett Packard ScanJet Plus). The images were printed with a scanning program onto a laser printer. 28 29 RESULTS 3.1 Cloning of tyrosine tRNA gene The sequence of the tyrosine tRNA was determined by Gupta (1984), (fig3). To clone the tyrosine tRNA gene, Southern hybridization was carried out on genomic digests of DS2 DNA to detect the gene. Fragments from the region where a positive signal was obtained were then cloned into a vector to obtain a size-fractionated partial library. The library was then rescreened to obtain an individual clone which carries the gene. Oligonucleotides 1 and 2 were used for detecting for the presence of the tyrosine tRNA gene of H. volcanii. Oligonucleotide 1 is complementary to the tRNA sequence (fig 3) at the 3’ end from position 73 to 57, with a degenerate 3’ end at position 57. Oligonucleotide 2 is identical to the RNA sequence from position 21 to 37, which includes the anticodon region. Genomic DNAs from H. volcanii DS2 and WFD11 were digested with different restriction enzymes and separated on a 1% agarose gel. Southern hybridization was carried out using radiolabeled oligonucleotide 1 to detect the location of the tyrosine tRNA gene (fig 4). Positive signals were further confirmed by hybridization with oligonucleotide 2. The results obtained from the DS2 and WFD11 DNA digests were identical. A Smal genomic fragment of about 1.5kbp in length hybridized to both oligonucleotides. To clone the fragment, DNA from this region of the gel (1.4 to 1.6kbp) was eluted, purified, shotgun cloned into the dephosphorylated Smal site of pGEM7(-) and transformed into E. coli DH5a. Plasmid DNA from the transformants was analyzed in pools of 4 and screened for the presence of the gene by Southern hybridization using oligonucleotide 2 as probe. Individual transformants from 30 AOH C C A C-G C-G G-C C-G U-A C-G U-A UA U GGGGC A CXA A 11111 m’I C CUCG CCCCG Cm U 1111 C m’PP G GAGC U GCA A U G G-C U C-G C-G G-C A-P (C)Cm A U mTG GUA FIG 3. Tyrosine transfer RNA sequence (adapted from Gupta, 1984) Transfer RNAs of H. volcanii were separated by two-dimensional gel electrophoresis and sequenced. Gupta (1984) presented the RNA sequence of 41 H. volcanii tRNAs including the tyrosine tRNA as shown. They resemble the general structure and sequence of eubacterial and eukaryotic tENAs. 31 kbp 11.5 4.7 — 2.8 — 2.0 — 1.7 — 1.15 — 0.85 — FIG 4: Southern hybridization of restricted wild type genomic DNA to detect the presence of the tyrosine transfer RNA gene Genomic DNA of wild type Hvo DS2 was digested with various restriction enzymes: Lanes: 1, MboI; 2, RsaI; 3,BglI; 4,Hindffl; 5,EcoRI; 6,BamFll; 7,PstI; 8 Sail; 9, Smal; 10, XhoI; 11, TaqI; 12, NcoI; 13, NarI; 14, Msp1; 15, MiuI;, 16, Asp718. Arrow shows the positive signal at 1.5kbp of the Smal digest. Oligonucleotidel was used as probe. 4 5 6 7 8 9 10 11 13 14 15 1 32 positive pools were rescreened in order to obtain the correct clone. 3.2 The tyrosine tRNA sequence The positive clone pTl was chosen for further study. By restriction mapping (fig 5), the structure of plasmid pTl was analyzed. When the plasmid was digested with Smal, a 4.5 kbp band and two bands around 1.5kbp were observed. When digested with EcoRI, 2.1 kbp and 5.1 kbp fragments were observed. When the plasmid was digested with both enzymes, a 3 kbp vector band, two 1.5 kbp bands, a 0.8 kbp band and a 0.6 kbp band were observed. Southern hybridization showed that the tyrosine tRNA gene is contained in the 1.5kbp Smal, the 5.lkbp EcoRI and the 0.8kbp EcoRI-SmaI fragments. The plasmid pTl contained three 1.5 kbp fragments in pGEM7(-). The first Smal site was lost since Smal gives blunt ends. The tyrosine tRNA coding region is contained in the middle fragment 38 bp downstream from the EcoRI site (fig 6). The DNA sequence of the tyrosine tRNA gene was determined using oligonucleotide 2 and oligonucleotide 3 as primers (fig 7). At position 15, where the nucleotide is undefined from the published ENA sequence, the DNA sequence contained a G residue. Furthermore, the methylated inosine at position 57 was determined to have come from the nucleotide A. The putative promoter was present as the TTAA box at position -32. The putative terminator was also present as a stretch of Ts followed by As. Upstream consensus promoter elements were also identified at positions -44, -38 and -13. The EcoRI site was present as part of the promoter element at position -38. The terminal sequence CAA is absent in the DNA sequence of the gene. 33 Lanes: 3 8 12 - —- - b FIG 5: Restriction mapping of plasmid pTl. (a) Plasmid pTl was digested with different restriction enzymes and fractionated by electrophoresis. Lanes: 1, uncut; 2, Asp718; 3, EcoRI; 4, MiuI; 5, NcoI; 6, Sail; 7 Sau3A; 8, SmaI; 9, SphI; 10, SstI; 11, PstI; 12, EcoRI+S maT; 13, Ec0RV+SmaI; 14, MiuI+SmaI; 15, NcoI+SmaI; 16, SaiI+SmaI; 17, Sau3A+SmaI. It was then transferred to nitrocellulose and probed with 32P labeled oligonucleotide2. The location of the tyrosine tRNA gene within each digest is shown in (b). Size markers ( DNA cut with PstI) are indicated by arrows from top to bottom: 11.5, 5.1, 4.5, 2.8, 2.0, 1.7, 1.2, 0.8, 0.4 kbp. a 34 FIG 6 :The plasmid pTl I Tyr tENA gene The plasmid pTl contains three 1.5 kbp fragments cloned from genomic SmaI digested DS2 DNA. The tyrosine transfer RNA gene is located in the middle fragment 32 bases downstream of the EcoRI site, which starts approximately 0.6 kbp downstream of the secondSmal site. The first SmaI site was lost during religation of blunt ends. Smal EcoRl 35 —41 —38 —32 CGTCGGGCGCTTCGCCGCGfiTGAftftTTCTTRA GTCTGCCCGTGGATT —13 +1 6 AG AT TCTCT TGA CC GC TCTT AGCTCA GCCTGG CAGAGC A GCCGA C TGTA +75 GATCGGCTTGTCCCCCGTTCAAATC6666AGAGCGGRTTTT GCTTGCAAAA FIG 7: DNA Sequence of the tyrosine tRNA gene The sequence of the tyrosine transfer RNA gene was determined by sequencing using oligo 2 and 3 as primers. The gene is only 73 base pairs in length. The upstream consensus promoter elements are identified at positions -44, -38 and -13. The promoter sequence TTAA is present at position -32 and the terminator sequence 1ffI at position 75. 36 3.3 Mutagenesis of tyrosine tRNA gene The 0.8 kbp SmaI-EcoRI fragment from plasmid pTl was subcloned into pGEM7(-) (pT2.1)(Fig 8a). The smaller fragment permits sequencing through the whole gene with the universal primer. The possibility of incorporation of wrong nucleotides into the upstream region during site-directed mutagenesis is also eliminated. Site-directed mutagenesis (Smith, 1986) was carried out on pT2.1 using oligonucleotide 4. The anticodon region was mutated from GUA to CUA(fig 9), which in principle should allow the tENA to recognize the amber stop codon TAG (pT2.2; fig 8a). The mutated 0.8 kbp fragment was then excised using HindIII and EcoRI and religated with the upstream 0.6 kbp Smal EcoRI fragment into the HindIII Smal site of pGEM7(-) to reform the entire gene with complete upstream promoter elements. This clone containing the putative tyrosine tRNA amber suppressing gene was designated pT3 (fig 8b). 3.4 The hisC gene A clone of the hisC gene of H. volcanii (Conover and Doolittle, 1990) (fig 10) was obtained as pT4C, which contains a 2.7kbp fragment in pBGS18, a kanamycin resistant derivative of pUC18 (Spratt et al, 1986). Since the vector pGEM7(-) was used throughout the project, the hisC gene was recloned into the vector for consistency and convenient manipulation. The plasmid pT4C was cut using BamHI and EcoRI and the 2.7 kbp fragment containing the hisC gene was ligated into the BamHI-EcoRI site of pGEM7(-) to form pHC(fig 11). 37 a. plasmid pT2.1/pT2.2 containing 0.8 kpb insert in pGEM7(-) I Tyr tRNA gene b. plasmid pT3 containing 1.5 kpb insert in pGEM7(-) I Tyr tRNA gene FIG 8: Plasmid construction of pT2.l, pT2.2 and pT3 Plasmid pT2.1 was constructed by cloning the 0.8 kbp EcoRI-SmaT fragment from pTl into the EcoRI-SmaI site of pGEM7(-). Site- directed mutagenesis was carried out on pT2.1 to change the anticodon region from GTA to CTA, the resultant plasmid was named pT2.2. The mutated 0.8 kbp fragment from pT2.2 was recovered by cutting with EcoRI and HindIll and religated to the 0.6 kbp SmaI-EcoRI fragment from pTl. The fragment was cloned into the SmaI-HindIII site of pGEM7(-) to form pT3. EcoRl Smal EcoRl 38 C T .A G C TAG FIG 9: Site-Directed Mutagenesis of tyr tRNA The two panels are: (a) DNA sequence of the anticodon region of the tyrosine tRNA before site-directed mutagenesis. The DNA sequence of the anticodon is GTA, which give rise to tRNAs that recognize the tyrosine codon UAC or UAU; and (b) DNA sequence of the anticodon region of the tyrosine tRNA after site-directed mutagenesis. The DNA sequence of the anticodon is changed to CTA, which in principle should give rise to tRNAs that recognize the amber stop codon UAG 39 AGTCGTTCGGGCGGCCCTCGGCTGACGGCCGTCGGTCGTCGCG TCCCCAACCCGACCCCCTACCGCCACGTCCGACCCGGAGTACGCACCCTTAAGAACCGCGACCCGCATTTTCCGACC +1 ATG CAA CCA CGG GAC CTC TCC GCG CAC GCT CCC TAC GTA CCC GGC CGC GGG ACA GAG M Q P R D L S A H A P V P G R G T E GAG CTC GCC CGC GAA CTC GGA ATG GAC CCC GAG GAC CTG ACG AAA CTC TCC TCG AAC E V A R E L G M D P E D L T K L S S N GAG AAC CCC CAC GGC CCG AGT CCG AAC GCG GTC GCC GCC ATC GAA GAC GCC GCG CCG E N P H G P S P K A V A A I E D A A P ACC GTG AGC GTC TAC CCG AAG ACC GCC CAC ACG GAC CTG ACC GAA CGC CTC GCC GAC T V S V Y P K T A H T D L T E R L A D AAG TGG CCC CTC GCA CCC CAA CAG GTG TGG GTG TCT CCC CCC GCG GAC GCC TCT ATC K W G L A P E Q V W V S P G A D G S I GAC TAC CTG ACC CGC GCG GTG CTC GAA CCG GAC GAC CGG ATT CTC GAA CCC GCG CCC D Y L T R A V L E P D D R I L E P A P GGC TTT TCG TAC TAC TCG ATG AGC GCC CGC TAC CAC CAC GGC GAC GCC GTC CAG TAC G F S Y Y S M S A R Y H H G D A V Q Y GAG GTG TCG AAG GAC GAC GAC TTC GAA CAG ACC GCC GAC CTC GTC CTC GAC GCC TAC E V S K D D D F E Q T A D L V L D A Y GAC CGC GAG CGC ATG GTC TAC CTC ACA ACG CCC CAC AAC CCC ACC GGT TCC GTG CTC D G E R M V Y L T T P H N P T G S V L CCG CGG GAG GAA CTC GTC GAA CTG GCC GAG TCG GTC GAA GAG CAC ACG CTC CTC GTC P R E E L V E L A E S V E E H T L L V GTC GAC GAG CCC TAC GGC GAG TTC GCC GAG GAG CCG TCG GCC ATC GAC CTC TTG TCG V D E A Y C E F A E E P 5 A I D L L S GAG TAC GAC AAC GTC GCG GCC CTG CGG ACG TTC TCG AAC GCG TAC GGG CTC GCC GGC E Y D N V A A L R T F S K A Y G L A G CTC CGC ATC GGC TAC GCC TGC GTG CCC GAG GCG TGG GCC GAC GCC TAC GCC CGC CTC L R I G Y A C V P E A W A D A Y A R V AAC ACG CCG TTC GCC GCC AGC GAG GTC GCC TGC CGC GCC GCG CTC GCC GCG CTC GAC N T P F A A S E V A C R A A L A A L D GAC GAG GAA CAC GTC GAG AAA TCC GTC GAG TCG GCC CGG TGG TCC CGC GAC TAT CTC D E E H V E K S V E S A R W S R D Y L CGC GAA CAC CTC GAC GCG CCG ACG TGG GAA AGC GAG GGC AAC TTC GTC CTC GTC GAG R E H L D A P T W E S E G N F V L V E GTC GGC GAC GCC ACG GCC GTC ACC GAG GCC CCC CAG CGC GAG CGC GTC ATC GTC CGC V G D A T A V T E A A Q R E G V I V R CAC TCC CCC ACC TTC CCC CTG CCG GAG TGC ATC CGC CTC TCC TGC GGC ACG GAA ACC D C G S F G L P E C I R V S C G T E T CAG ACC AAG CGC GCC GTG GAC GTG CTC AAC CGC ATC GTC TCG GAG GTG CCG ACG GCG Q T K R A V D V L N R I V S E V P T A TGA GAGACGACGACACCGGCACGCCCGGCACCGGAAAGACCACGGCGACCGAGCCGGTCGCCGCCGACCTCGACC end TCGACGTGGTCCACCTCAACCGACTCGTGAAAGACGAGG FIG 10: DNA and derived amino acid sequences of the H. volcanii hisC gene The putative promoter TTAA is identified in bold and the first tyrosine codon (TAC) is underlined. The figure is adapted from Conover and Doolittle, 1990. 40 • HIsC gene Scale: I I 1kb FIG 11: Construction of plasmid pHC and pHC12 Plasmid pHC12 was constructed by cloning the 2.7 kbp BamHI-EcoR[ fragment from pT4C into the BamHI-EcoRI site of pGEM7(-). Site directed mutagenesis was carried out on pHC to change the 12th codon from TAC to TAG. The resultant plasmid is named pHC12 AfihI NruI NotI 41 3.5 Mutagenesis of the hisC gene The first tyrosine triplet in the hisC gene occurs at codon position 12. This codon was chosen for mutation to an amber stop codon because termination will occur close to the site of initiation, giving rise to a very short polypeptide product which should be totally non-functional. Furthermore, a tyrosine codon was chosen because suppression with the altered tRNA will give rise to the wild type amino acid sequence. Figure 12 showed the result of site-directed mutagenesis on the plasmid pHC. Oligonucleotide 5 was used to change the first tyrosine codon to an amber codon by changing the C residue at position 36 to a G. The resulting plasmid was named pHC12. 3.6 Strategy for construction of hisC(Am) strain We wished to construct a hisC(Am) H. volcanii strain by displacing the wild type hisC gene from WFD11 with the hisC(Am) mutant gene so that the resultant construct would contain only one copy of the gene. Since H. volcanii is relatively active in recombination, this will reduce the possibility of restoration of function by recombination between two copies of mutant hisC genes. The scheme for the gene replacement strategy is shown in figure 13. To introduce the hisC(Am) gene into the genome, a non-replicating plasmid carrying the gene with a selectable marker was constructed. The 2.7 kbp BamHI EcoRI fragment containing the mutated hisC gene from plasmid pHC12 was cloned into the BamHI EcoRI site of pGOT1 to form pHC12M. The plasmid pGOT1 was constructed by Bissonette (unpublished) by cloning a 2.Okbp DNA fragment which contains the mevinolin resistance gene of H.volcanii into the XhoI Asp718 site at C C FIG 12: Site-directed mutagenesis of the hisC gene Panel (a) shows the DNA sequence of the wild type hisCgene from position 31 to 42. Site-directed mutagenesis was carried out to change the residue C to a G at position 36 so that the twelve codon is changed from a tyrosine to an amber stop codon. Panel (b) shows the DNA sequence of the hisC(Am) gene from position 31 to 42 after site-directed mutagenesis. The resultant plasmid is named pHC12. C TAG 42 C C C A T G C A T C C C C A T G G A T C a C C b 43 hisC (Am) gene Transform WFD1 1 mevr pHC12M hisC gene Smal chromosomal DNA Rec+ Integration into chromosomal DNA, select for mev’ mevr Smal Reverse recombation hisC (Am) in chromosomal DNA Colonies are mev5, his w.t hisC gene FIG 13: Strategy for constructing the his (Am) H. volcanii strain 44 the Fl origin of pGEM3(-). The plasmid pHC12M was then transformed into the wild type Haloferax volcanii WFD11 and selected for on mevinolin plates. Since the circular plasmid lacks an origin for replication in H. volcanii, it was expected to integrate into the bacterial chromosome by a single crossover event as in figure 2. Transformed cells which are mevinolin resistant will carry two copies of the hisC gene and the mevinolin resistance gene in the chromosome. The plasmid can integrate into one of the two loci, the mevinolin gene locus, or the hisC gene locus. Ideally, 50% of the time it should integrate into the hisC locus, giving rise to a tandem repeat of hisC gene flanking the mevinolin resistance gene. By releasing the antibiotic selection, the cells can undergo reverse recombination (Krebs et at, 1993) between the repeated sequences. In the case where the construct has gone into the mev locus, one of the mev genes (w.t. or mevr) will be lost together with the hisC(Am) gene, giving rise to colonies which are still prototrophic for histidine. Depending on the position of recombination within the repeats, some of the colonies will then lose resistance to mevinolin while the others remain mevr. In the other case where the construct goes into the hisC gene locus, either copy of the hisC gene will be excised together with the mevinolin resistance gene, giving rise to mevinolin sensitive colonies. Half of the colonies will be his, when the hisC(Am) gene is lost, and the rest his. These will be H. volcanii strains which have lost the wild type hisC gene and now carry only one copy of the gene with an amber mutation in the first tyrosine codon. In other words, the H. volcanii hisC(Am) strain will be his and mevs. Two separate attempts were carried out to displace the wild type hisC gene 45 together with the antibiotic resistance gene from the genome by removing the antibiotic selection pressure. In the first trial, the pooi of transformed colonies was grown in rich medium until stationary phase was reached (1 week). Ten microlitres of the culture was then inoculated into another 2Oml rich medium and grown until stationary phase was reached again. In the second trial, the transformed colonies were grown to stationary phase in rich medium with mevinolin. Then they were transferred to rich media without the antibiotic and grown as above through three more dilutions. The final cultures in both trials were then spread onto rich plates to isolate individual colonies. The colonies were then tested for histidine auxotropy and mevinolin sensitivity. In trial 1, about 10% of the colonies obtained were mevinolin sensitive. In the second trial, about 50% of the colonies were mevinolin sensitive but in both attempts, no histidine auxotrophs were isolated. 3.7 Test for incorporation of the pHC12M construct To determine whether the non-replicating plasmid pHC12M had actually inserted into the hisC locus, Southern hybridization was carried out on genomic DNA digested with Smal obtained from 8 individual mevinolin resistant transformants of WFD11. The hisC and mev probes used were a 2.5kbpSmal-EcoRI fragment from pHC12 (fig. 11), and a 2.Okbp Asp718-XhoI fragment from pBZL5 ( Bissonette and Dennis, unpublished). Figure 14 shows the hybridization pattern of Smal digested genomic DNA of WFD11 and the mevinolin resistant colonies, A novel band of approximately 8 kbp in size which hybridizes to both probes was observed in the transformants. In addition, the hisC probe hybridized to a 4.7kbp band in both the wild type and the transformants, whereas a band of around 10 to 11 kbp was observed using the mev probe. All of the 8 colonies examined showed the same hybridization pattern. This result is consistent with integration at the hisC 46 Lanes: 1 2 1 2 kbp 11.5 — 5.1 — 4.7 4.5 — 2.8 —2.6 2.5 a b FIG14: Southern hybridization to test for the incorporation of pHC12M into WFD11 Genomic DNA of wild type WFD11 digested with Smal (lane 1) and WFD11 transformants with pHC12M digested with Smal (lane 2) are fractionated by electrophoresis, transferred to nitrocellulose, and probed with &2P labeled restricted fragment containing the hisC gene (a) or the mevinolin resistance gene (b). In(a), a band of 4.7kbp in size was observed in both lanes, and a band of about 8 kbp as indicated by the arrow in lane 2. In b), a band of 10 to 11 kbp in size is observed in both lanes, and a band of about 8 kbp is observed in lane 2 as indicated by the arrow. 47 Sm al a. I I hisC gene probe Smal Smal I I b. I I m ev probe I 7.7kbp I hisC gem I in ev gen.e FIG 15: Predicted result of Southern hybridization when the construct is integrated into the hisC locus (a) shows the genomic DNA around the hisC locus in the wild type H. volcanii WFD11. When the construct pHC12M is correctly integrated into the hisC locus, two copies of the gene will be present with a mevinolin resistant gene in between(b). Southern hybridization on SmaI digested genomic DNA using hisC as probe will give a band of undetermined size in both (a) and (b). An additional band of 7.7kbp(3.Okbp vector + 2.7 kbp hisC gene + 2.0 kbp mevr gene) as indicated will be observed in (b). This band should also hybridize to the mev probe. 48 locus (fig 15). However, it seems that none of the colonies had undergone gene displacement by excising the wild type hisC gene. Therefore, I was unable to construct a hisC(Am) mutant. 3.8 Test for natural amber suppression One possible reason why the construction of the hisC(Am) strain was not successful could be due to the fact that a natural amber suppressor is already present in the wild type genome. Therefore even if the hisC(Am) gene was introduced, the resultant colonies would still be his. To test this hypothesis, I transformed WR256(his, arg), a derivative of WFD11 that is auxotrophic for histidine and arginine, with plasmid p24H (hisC(Am) gene in pGOT24). Transformants were selected on rich mevinolin plates. The resultant colonies were streaked individually onto minimal plates with mevinolin and arginine and either with or without histidine to test for auxotrophy. All colonies required histidine for growth. This indicates that all the colonies were still his, therefore there appears to be no natural amber suppressor in H. volcanii. 3.9 Test for differential growth rate In order to confirm that the result obtained in the gene replacement experiments was not due to differential growth of his+ or his strains in the same culture, WFD11 and WR256 were inoculated into rich media in a ratio of 1:1 in l000x dilution and grown together for 10 days until stationary phase was reached. Individual colonies from the culture were then tested on minimal plates. Out of 50 colonies tested, 16 were his+, leading to the conclusion that there is no significant 49 difference in the growth rate of the two strains. 3.10 Plasmid construction Various plasmids were constructed during the course of this project for transformation and for future use. Plasmids that carry the amber suppressor or the hisC(Am) gene with antibiotic resistance marker (mevinolin or novobiocin) were constructed (table 3). In all cases, the amber suppressor was purified as a 1.5 kbp fragment from plasmid pT3 (fig 8), and the hisC(Am) gene as a 2.7kbp fragment from pHC12 (fig 11). Various attempts to construct a plasmid which contains both the amber suppressor and the hisC(Am) gene were carried out (table 4). The fragments were ligated together overnight and transformed into DH5cz. In all cases, no transformants were observed. A control experiment was then carried out with the pHC12-amber suppressor construct as in table 5, ligations in T4 DNA ligase were carried out in all reactions overnight and then transformed into DH5c. Again, no colonies were observed when the ligation mixture was transformed into DH5z. When transformed into JM1O1, hundreds of colonies were observed on the plate. However, none of the colonies analyzed contained the 1.5kbp fragment. 3.11 Test for amber suppression in Haloferax volcanii Since the attempts to displace the wild type hisC gene from WFD11 with hisC(Am) gene had failed, an alternative to test whether amber suppression can occur is to put the hisC(Am) gene into the genome of a his strain and then test for 50 Plasmid amber sup. hisC(Am) mevr flOVr Hvo on, remark p24H X X X Bam/Xba/pGOT25 p24T X X X Bam/Xba/pGOT24 pHC12M X X Bam/Eco/pGOT1 p44H X X X Bam/Xba/pGOT44 p44T X X X Bam/Kpn/pGOT44 pN7 X X nov fragment from pMDS1O (BstYI/Nsil) in pHC12 TABLE 3: Construction of plasmids that carry either the hisC(Am) gene or the putative amber suppressor in pGOT vectors Crosses indicate presence of the gene/fragment. vector-cut with amber suppressor-cut with hisC(Am)-cut with pGOT25-EcoRI/XbaI BamHI/ XbaI Sau3A/ EcoRI pGOT44-XbaI/ SphI BamHI/ XbaI Sau3A / SphI pGEM7-EcoRI/ XbaI BamHI/ XbaI Sau3A/ EcoRI pHC12-SmaI Smal TABLE 4: Attempts to construct a plasmid which contains both the amber suppressor and the hisC(Am) gene In all trials, the vector, hisC(Am) gene and the putative amber suppressor were cut with the indicated restriction enzymes. All fragments were then ligated overnight in T4 DNA ligase and transformed into DH5a. 51 Colonies Control 1 pHC12/SmaI +++ Control 2 pHC12/SmaI dephosphorylated Ligation mix. pHC12/SmaI dephosphorylated+1 .5kb fragment containing the amber suppressor TABLE 5: Control experiment for incorporation of the putative amber suppressor into pHC12 The plasmid pHC12 was cut with Smal, dephosphorylated and then incubated with Smal fragments containing the amber suppressor in T4 DNA ligase. The controls and the ligation mixture were then transformed into DH5. Hundreds of colonies were observed in control 1. No colony was observed in the other two cases. 52 restoration of hisC gene function by putting in the putative amber suppressor. The plasmid pHC12M (hisC(Am) and mevinolin resistance gene with no replication origin) was transformed into WR256 (his, argj. Transformants were designated WR256.H12. WR256.H12 was then transformed with plasmid p44T (pGOT44 containing the altered tyrosine tRNA gene). Transformants were selected on mevinolin plus novobiocin plates. Individual transformants were then tested for histidine auxotrophy by growing restoration of hisC gene function by putting in the putative amber suppressor. The plasmid pHC12M (hisC(Am) and mevinolin resistance gene with no replication origin) was transformed into WR256 (his, argj. Transformants were designated WR256.H12. WR256.H12 was then transformed with plasmid p44T (pGOT44 containing the altered tyrosine tRNA gene). Transformants were selected on mevinolin plus novobiocin plates. Individual transformants were then tested for histidine auxotrophy by growing on minimal plates with arginine . All transformants required histidine for growth. Southern hybridization was carried out on genomic DNA digested with Smal to confirm the presence of the hisC(Am) gene in WR256.H12. Probes used were the hisC gene probe and the mev probe as in illustrated in figure 15. Using the hisC gene probe, a single band of 4.7 kbp was observed in both the wild type DS2 DNA and the WR256.H12. A single band of 10 to 11 kbp was also observed in all lanes when the mev gene was used as the probe (fig 17). The result showed that the hisC(Am) gene apparently did not integrate into the genome of WR256.H12, and only one copy of the mev gene was present. Therefore no conclusion about amber suppression in H. volcanii can be drawn yet. 53 Lanes: 1 2 Lanes: 1 2 a b FIG 16: Southern hybridization to test for the incorporation of pHC12M into WR256 Genomic DNA of wild type WFD11 digested with SmaI (lane 1) and WR256 transformants with pHC12M digested with SmaI (lane 2) are fractionated by electrophoresis, transferred to nitrocellulose, and probed with 32P labeled restricted fragment containing the hisC gene (a) or the mevinolin resistant gene (b). In(a), a band of 4.7kbp in size was observed in both lanes. In (b), a band of 10 to 11 kbp in size is observed in both lanes. 54 DISCUSSION 4.1 THE TYROSINE TRANSFER RNA The presence of the H.volcanii tyr tRNA gene was detected by Southern hybridization. It is present on the Smal genomic digest as a 1.5 kbp fragment. WFD11 and DS2 are essentially the same, except that WFD11 lacks the plasmid pHV2. Southern hybridization indicates that the location of the tyrosine tENA gene is identical in both genomes. A size-fractionated Haloferax volcanii genomic library constructed by cloning the 1.4 to 1.6kbp genomic Smal fragments was constructed. The recognition sequence of the restriction enzyme Smal is CCCGGG, and the enzyme cuts between the C and G to give blunt ends. The clone containing the plasmid pTl obtained by screening the library with oligonucleotide 1 and 2 was confirmed to contain the tyrosine tRNA gene by Southern hybridization. However, restriction mapping showed an insert of 4.5kbp in size. The plasmid pTl is shown in fig. 6. Since blunt end ligation was carried out, three 1.5kbp fragments were cloned into the dephosphorylated Smal site of pGEM7(-) and the first Smal site is lost during the religation process. The fragment which contains the tyrosine lENA gene lies in the middle fragment. An EcoRI site is present at O.6kbp from the first Smal site, and is 38 bp upstream of the tyrosine lENA coding sequence. The DNA sequence of this region is shown in fig 7. The gene is 74 bp long and agrees with the RNA sequence of the tyrosine transfer RNA (fig 3). Putative upstream promoter elements were identified, which show a high sequence homology as compared with the consensus sequence of upstream promoter regions of various other H. volcanii tRNA genes(fig 17) (Daniels et al, 1986). In the H. volcanii tyrosine tENA gene, the upstream 55 Upstream region of tyrosine tRMA: +1 CGCCGCGaTGA.aTTCTTARGTCT6CCC6TGGATTGA6ATTCTCTTGA CCC a, RGTA.ftftTC6AAACCCCTTTAR6AAAAATCGCCATACGA6AGAGT6CA6ACRGAACGAA. .66( b. CCAAGAAAGGAAAGTCTATTTACCCACCGGCAGTACGAGAGRTTGCRA 66( c. CTCGGARRTCGAAACGGATTAAACTATCCGCGAGAGAGGCARCAATGGAA 6CC d. GTRGTCC..ftTTCGAAA6CTTAAATTGTACCC6GACAACGGAGAGATGCGTCCGAACG6CA6GA Fig 17: Comparison of halobacterial tRNA 5’-flanking region The upstream promoter region of tyrosine tRNA gene is compared with various other tRNA genes already cloned: a. Trp; b. Lys; c.Ser; d. Va!. (adapted from Daniels et al., 1986). The TTAA putative promoter is identified and shown in bold letters. Other 5’-flanking consensus sequences are observed as GA rich regions (underlined). The first three nucleotides of the tRNA are also shown. The conserved sequence blocks GAA, GAA, TTAA and GAGAGA are observed in the upstream region nof all the tRNA examined here. Although the distances separating these blocks are variable, this conservation in sequence is remarkable. 56 elements GAA is present at positions -44 and -38, GAGA at position -13; the TTAA box is also observed at position -32, and is believed to be homologous to the TATA box in eukaroytes (Hausner et at., 1991; Reiter et at, 1990; Shimmin and Dennis, 1989; Thomm and Wich, 1988). The promoter region has a very high A+T content compared to the rest of the genome. RNA polymerase finds and binds to the promoter region. It unwinds the DNA helix to allow initiation of translation of the tRNAs. Since the A+T base pairs at the TTAA region are comparatively weaker than G+C base pairs, the region is more susceptible to “melting”, or formation of an open complex. The end of the gene is marked by a poly(T) tract at position +75. It consists of a stretch of 4 Ts, which is believed to be the termination sequence in archaebacteria (Shimmin and Dennis, 1989). Shimmin and Dennis (1989) showed by Si nuclease protection that the 3’ transcript end site of ENAs are located within runs of T residues and are often preceded by GC rich sequences. Long T clusters adjacent to yeast tRNA had been shown to efficiently terminate transcription by ENA polymerase Ill (Daniels and Hall, 1985). Since an RNA-DNA hybrid consisting of polyribo U and polydeoxy A is very unstable, the ENA chain will be expelled from the DNA duplex leading to termination of transcription. Since poly Ts are involved in termination, there is a strong preference to avoid codon with adjacent T residues and the TTT codon for phenylalanine is utilized sparingly in H.volcanii. On the other hand, in both non-coding regions and on the minus strand of coding regions, T runs are more prevalent. 4.2 MODIFICATION PATTERN Modified bases are very common in archaebacterial tRNAs. In the H. volcanii 57 tRNA, an unidentified nucleoside was observed from ENA sequencing at position 15. This is not found in any eubacterial or eukaryotic tENAs. DNA sequencing of the cloned gene indicates that it comes from a guanosine. Gupta and Woese (1980) proposed that it is a modified G whose pKa is considerably higher than that of an unmodified G. It could be a 2-amino, 6-oxypyrimidine, a pseudo-cytodine, a 2- aminopurine or some hypermodified base containing an exo-cyclic amino group at the 2-carbon position of the ring. The function of this modification is not known. An inosine can be formed by removing the NH2 group from a G or an A. In the tyrosine tRNA, an A was present at the corresponding position in the DNA sequence. Since modified nucleosides are constantly encountered in tENAs of different organisms, Nishimura (1979) suggests that they play an important role in tRNA functions, but no real proof has been discovered yet. As in the case with eukaryotic tRNAs, the CCA terminal is added to the tRNA molecule post-transcriptionally. Transfer RNA lacking the CCA end has been found in B. subtitis and the archaebactium Sulfolobus solfataricus (Vold, 1985). The 3’ terminal adenosine can become attached to the corresponding amino acid by covalently bonding with the carboxyl group of the amino acid. This reaction is catalyzed by aminoacyl-tRNA synthetase. 4.3 THE hisC GENE The hisC gene encodes histidinol phosphate aminotransferase (Conover and Doolittle, 1990), which is the eighth enzyme of the histidine biosynthetic pathway. It catalyzes the conversion of imidazole acetol phosphate to L-histidinol phosphate (Watsons et at, 1987). 58 The first tyrosine codon was chosen to be mutated to the amber stop codon so that only a very short polypeptide will be transcribed. This reduces the possibility of forming a partially functional polypeptide product. The DNA sequence of the region is changed from TAC to TAG, so that on the mRNA the corresponding tyrosine codon was changed from UAC to UAG. Theoretically, it can now be recognized by the anticodon CUA of the putative amber suppressor. 4.4 GENE REPLACEMENT EXPERIMENTS Two individual trials of the gene replacement experiment were carried out. In trial 1, only 10% of reverse recombination in the mev gene was observed. Another trial was then carried out where the process was carried out for a longer period of time over more generations to get a 50% mev reverse recombination rate. In both cases, 100 colonies were screened. However, no his colony was observed. This could be due to: 1) A natural amber suppressor might be already present in H. volcanii so that colonies that did undergo gene replacement were still his since the hisC(Am) gene is suppressed. 2) There is a significant difference in growth rate between his and his strains. During the process of growing the two strains together in rich media, the his strains might outgrow the his strains. This effect might be able to eliminate all the his- strains since they were grown together for more than 20 generations. 3) The hisC(Am) gene is polar. The hisC(Arn) gene may affect the expression 59 of any genes downstream of it so that displacement of the wild type gene to leave one copy of the hisC(Am) gene is unfavorable. In order to test whether a natural amber suppressor is already present in the system, the plasmid p24H (hisC(Am) gene in pGOT24) was transformed into WR256 (his, argj and transformants were selected on mevinolin plates. WR256 is a his strain in which the hisC gene is randomly mutated. If an amber suppressor is already present, this hisC(Am) gene will be suppressed, giving rise to his colonies. All colonies still required histidine for growth, leading to the conclusion that no natural amber suppressor is present in H. volcanii. The test for differential growth rate of his and his- strains indicates that when the two are grown together in rich media for a period of time, the ratio of them remains constant. Therefore the second reason is not correct since the his+ strains will not be able to outgrow the his strains in the same media. However, the 50% loss in mevinolin resistance indicated that reverse recombination did take place. The result from the Southern hybridization shows that the construct did go into the hisC gene locus. However, displacement of the wild type hisC gene did not occur. Since the gene replacement procedures were carried out in rich media, selection on histidine prototrophs should not exist. Another Southern hybridization for the genomic DNA of the colonies after the gene replacement experiments would indicate whether one or both copies of the hisC gene was present and might give a better insight on why the experiment was not successful. 4.5 PLASMID CONSTRUCTION 60 Plasmids carrying the putative amber suppressor or the hisC(Am) gene with mevinolin resistance or novobiocin resistance and with or without replicative origin in H. volcanii were constructed for further use (table 3). We attempted to construct a plasmid which carries both the amber suppressor and the hisC(Am) gene. By transforming the plasmid into the his- strain WR256, we hope to test whether the modified tRNA could suppress the hisC(Am) gene (table 4). However, we were unable to put the two genes together on the same plasmid. The reason for this failure is unclear. The genes on the plasmid pGEM7(-) should not be expressed by E.coli. We could not explain the fact that the ligation mixture pHC12+amber suppressor fragment transformed JM1O1 but not DH5cz. Transformed plasmids obtained from JM1O1 transformants were analyzed and no 1.5kbp Smal fragment was observed. However, we were able to recover the 2.7 kbp hisC gene fragment by cutting with BamHI and EcoRI, although the cutting efficiency was much lower than with the original clone, indicating that some rearrangement might have occurred. 4.6 TEST FOR AMBER SUPPRESSION IN HALOFERAX VOLCANII Southern hybridization indicates that the pHC12M construct did not recombine into the WR256 genome since only one copy of the hisC gene was present. Furthermore, only one copy of the mev gene was present. Since the transformants were selected on mevinolin plates, the mevinolin resistance gene must have replaced the wild type mev gene in WR256 by two crossover events (fig 2). According to Mevarech (personal communication), the mevinolin gene has a high tendency to recombine into the genome to give mevinolin resistant colonies. 61 However, the fact that pHC12M was successfully integrated into WFD11 in all analyzed colonies in the attempt to construct a hisC(Am)H. volcanii strain indicates that this approach is feasible. The problem might lie in the strain WR256 since it was mutagenised randomly, and no further study on the strain is available. The other antibiotic resistance gene, novobiocin, could be used in place of the mevinolin resistance gene to repeat the above experiment. In this case, the resultant flOVT colonies should be transformed again with a plasmid that carries the mev’ marker and the putative amber suppressor. The double transformants should then be tested for histidine auxotrophy, and hence the ability for amber suppression to occur in Haloferax volcanii. 4.7 CONCLUSION Since not much is known about the H. volcanii system, many difficulties were encountered during the course of the project. Some further experiments, however, are possible: 1. Gene replacement experiment: Southern hybridization to analyze the genome after the reverse recombination step. This might give further insight as to why the displacement of the wild type hisC gene was not successful. 2. Test for amber suppression: The experiment can be repeated using novobiocin instead of mevinolin as the antibiotic selection marker in the first transformation since it has less tendency to recombine into the genome to form novobiocin resistant colonies. However, novobiocin transformants take more than two weeks to be visible and transformation efficiency is much lower than with the 62 mevinolin vectors. The mev vectors can then be used to put the putative amber suppressor into the transformants. Since the mev vector in the second transformation contains a H. volcanii origin, recombination of the mev gene to form mev’ colonies should be minimized. During this project, the tyrosine tRNA gene of H. volcanii was cloned and sequenced. A putative amber suppressor and a hisC gene that carries an amber stop codon were constructed. Although the attempts to construct a hisC(Am) H. volcanii mutant failed and the test for amber suppression was inconclusive, the established products and procedures of this project should provide the basic foundation for any further investigation of amber suppression in H. volcanii. 63 REFERENCES Abelson, J.N., Gefter, M. L., Barnett, L., Landy, A. Russell, R.L. and Smith, J.D. (1970). Mutant tyrosine transfer ribonucleic acids. J. Mol. Biol. 47, 15-28 Adams, J.M. and Capecchi, M.R. (1966). N-formylmethionyl-sRNA as the initator of protein synthesis. Proc. Natl. Acad. Sci. USA 55,147-155 Allison, D. S. and Hall, B. D. (1985). Effects of alternations in the 3’ flanking sequence on in vivo and in vitro expression of the yeast SUP4-o tRNATYr gene. EMBO. 4,2657-2664 Boch. A and Kandler,O. (1985). Antibiotic sensitivity of archaebacteria, p525-544. In Woese, O.R. and Wolfe, R.S. (ed), The Bacteria-a treatise on structure and function, vol 8, The Archaebacteria, Academic Press, N.Y. Cabrera, J. A., Bolds, J., Shields, P.E., Havel, C.M. and Watsons, J. A. (1985). Isoprenoid synthesis in Halobacterium halobium. J. Biol. Chem. 261, 3578- 3583 Charlebois, R. L., Lam, W. L., Cline, S. W. and Doolittle, W. F. (1987). Characterization of pHV2 from Halobacterium volcanii and its use in demonstrating transformation of an archaebacterium. Proc. Nati. Acad. Sci. 84,8530-8534 Charlebois, R. L., Schalkwyk, L.C., Hofman, J.D. and Doolittle, W.D. (1991). Detailed physical map and set of overlapping clones covering the genome of the archaebacterium Haloferax volcanii DS2. J. Mol. Biol. 222,509-524 Chowdhury, K. (1991). One step ‘miniprep’ method for the isolation of plasmid DNA. Nucleic Acid Res. 19, 2792 Cline, S. W. and Doolittle, W.F. (1987). Efficient transfection of the archaebacterium Halobacterium halobium. J. Bacteriol. 169, 1341-1344 Clime, S., Schalkwyk, L.C. and Doolittle, W.F. (1989). Transformation of the 64 archaebacterium Halobacterium volcanii with genomic DNA. J. Bacteriol. 171, 4987-4991 Cohen, A., Lam, W. L., Charlebois, RI., Doolittle, W. F. and Schalkwyk, L. C. (1992). Localizing genes on the map of the genome of Haloferax volcanii, one of the Archae. Proc. Nati. Acad. Sd. 89, 1602-1606 Crick, F. (1966). The genetic code. Cold Spring Harbor Symposia on Quantitative Biology. vol 8. The Genetic Code. Cold Spring Harbor, L.I., N.Y. Daniels, L.L. and Wais, A.C. (1984). Restriction and modification of halophage S45 in Halobacterium. Curr. Microbiol. 10, 133-136 Dennis, P.P. (1986). Molecular biology of archaebacteria. J. Bacteriol. 168, 471-478 Dermis, P.P. (1993). The molecular biology of halophilic archaebacteria,p255-288. In Vreeland, R.H. and Hochstein, L.I. (ed), The Biology of Halophilic Bacteria, CRC Press. Doolittle, W.F. (1985). Genome structure in archaebacteria, p545-564. In Woese, O.R. and Wolfe, R.S. (ed), The Bacteria-a treatise on structure and function, vol 8, The Archaebacteria, Academic Press, N.Y. Eikmanns, B. and Thauer, R.K. (1984). Catalysis of an isotopic exchange between CO2 and the carboxyl group of acetate by Methanosarcina barkeri grown on acetate. Arch. Microbiol. 138, 365-370 Engelhardt, D.L., Webster, R.E., Wilhelm. R.C. and Zinder, N.D. (1965). In vitro studies on the mechanism of suppression of a nonsense mutation. Proc. Nat!. Acad. Sci. 54, 1791-1797 Garen, A. (1968). Sense and nonsense in the genetic code. Science 160,149-159 Gesteland, R.F., Salser, W. and Bolle, A. (1967). In vitro synthesis of T4 lysozymes by suppression of amber mutations. Proc. Natl. Acad. Sci. 58,2036-2042 65 Goodman, H.M., Abelson J., Landy, A. Brenner, S. and Smith, J.D, (1968). Amber suppression: a nucleotide change in the anticodon of a tyrosine transfer RNA. Nature. 217, 1019-1024 Gupta, R. (1984). Halobacterium volcanii tRNAs. J. Biol. Chem. 259, 9461-9471 Gupta, R. (1985). Transfer ribonucleic acids of archaebacteria. p311-343. In Woese, O.R. and Wolfe, R.S. (ed), The Bacteria-a treatise on structure and function, vol 8, The Archaebacteria, Academic Press, N.Y. Gupta, R. and Woese, CR. (1980). Unusual modification patterns in the transfer ribonucleic acids of archaebacteria. Curr. Microbiol. 4, 245-249 Hausner, W., Gerhard, F. and Thomm, M. (1991). Control regions of an archael gene, a TATA box and an initiator element promote cell-free transcription of the tRNAVal gene of Methanococcus vannielii. J. Mol. Biol. 222, 495-508 Hill, C. W. (1975). Informational suppression of missense mutation. Cell. 6,419-427 Hirsh, D. (1971). Tryptophan transfer RNA as the UGA suppressor. J. Mo!. Biol. 58, 439-458 Hirsh, D. and Gold, L. (1971). Translation of the UGA triplet in vivo by tryptophan transfer RNA’s. J. Mol. Biol. 58, 459-468 Hoagland, M.B., Stephenson, M.L., Scott, J.F., HEcht, L.I. and Zamecnik, P.C. (1957). A soluble ribonucleic acid intermediate in protein synthesis. J. Biol. Chem. 231,241-257 Ho!ley, R. W., Apgaz, J., Everett, G. A., Madison J.T., Marquisee, M., Merri!, S.H., Penswich, J. R. and Zamir, A. (1965). Structure of a ribonucleic acid. Science 147:1462 Holmes, M. L. and Dyall-Smith, M. L. (1991). Mutations in DNA gyrase result in novobiocin resistant in halophilic archaebacteria, J. Bacteriol. 173, 642-648 66 Holmes, M.L., Nuttall, S.D. and Dyall-Smith, M.L. (1991). Construction and use of Halobacterial shuttle vectors and further studies on Haloferax DNA gyrase. J. Bacteriol. 173, 3807-3813 Hui, I. and Dennis. P (1985). Characteristic of the ribosomal RNA gene clusters in Halobacterium cutirubrum. J. Biol. Chem. 260,899-906 Kates, M., Wassef, M.K., and Kushner, D.J. (1968). Radioisotopic studies on the biosynthesis of the glyceryl diether lipids of Halobacterium cutirubrum. Can. J. Biochem. 46,971-977 Kleckner, N. (1981). Transposable elements in prokaryotes. Ann. Rev. Genet. 15,341- 404 Kondo, S., Yamagishi, A. and Oshima, T. (1991). Positive selection of the uracil auxotrophs of the sulfur-dependent thermophilic archaebacterium Sulfolobus acidocaldarius by use of 5-fluoroorotic acid. J. Bacteriol. 173, 7698- 7700 Krebs, MY., Mollaaghababa, R. and Khorana, A.G. (1993). Gene replacement in Halobacterium halobium and expression of bacteriorhodopsin mutants. Proc. Natl. Acad. Sci. 90, 1987-1991 Kunkel, T.A. (1985). Rapid and efficient site-specific mutagensis without phenotypic selection. Proc. Natl. Acad. Sci. 82, 488-492 Kunkel, T.A., Roberts, J.D. and Zakour, R.A. (1987). Rapid and efficient site-specific mutagensis without phenotypic selection. Meth. Enzymol. 154,367-382 Lam, W. L. and Doolittle, W. F. (1989). Shuttle vectors for the archaebacterium Halobacterium volcanii. Proc. Natl. Acad. Sci. 86, 5478-5482 Lewin, B. (1974). Gene expression, vol 1, Bacterial genomes, William Clowes & Sons Limited, London Mevarech, M. and Werczberger, R. (1985). Genetic transfer in Halobacterium 67 volcanii. J. Bacteriol. 162, 461-462 Mizuuchi, K., O’Dea, M. H. and Gellert, M. (1978). DNA gyrase: subunit structure and ATPase activity of the purified enzyme. Proc. Nati. Acad. Sci. 75, 5960- 5963 Moore, R.L. and McCarthy, B.J. (1969a). Characterization of the deoxyribonucleic acid of various strains of halophilic bacteria. J. Bacteriol. 99, 248-254 Moore, R.L. and McCarthy, B.J. (1969b). Base sequence homology and renaturation studies of the deoxyribonucleic acid of extremely halophilic bacteria. J. Bacteriol. 99, 255-262 Mullakhanbhai, M.F. and Larsen, H. (1975). Halobacterium volcanii spec. nov., a dead sea halobacterium with a moderate salt requirement. Arch. Microbiol. 104,207-214 Muriana, F. J. G., Sanchez, M.C., Rodulfo, J. D., Alvarez-Ossorio, M. C. and Relimpio, A. M. (1987). Optimization of the cell envelope of extremely halophilic bacteria. J. Biochem. Biophys. Meth. 14,19-28 Ner, S.S., Goodin, D.B. and Smith, M. (1988). Laboratory methods: a simple and efficient procedure for generating random point mutations and for codon replacements using mixed oligonucleotides. DNA 7,127-134 Nishimura, 5. (1979). Modified nucleosides in tENA, p59-79. In Schimmel, P.R., Soll, D. and Abelson, J.N. (ed),Transfer RNA: Structure, Properties, and Recognition, Cold Spring Harbor Laboratory Reiter, W., Hudepohl, U. and Zillig, W. (1990). Mutationalanalysis of an archaebacterial promoter: essential role of a TATA box for transcription efficiency and start-site selection in vitro. Proc. Natl. Acad. Sci. 87, 9509-9513 Rich, A. and RajBhandary, U.L. (1976). Transfer ENA: Molecular structure, sequence, and properties. Annu. Rev. Biochem. 45,805-860 68 Rosenshine and Mevarech, unpublished result cited in Dennis (1993). The molecular biology of halophilic archaebacteria,p255-288. In Vreeland, R.H. and Hochstein, L.I. (ed), The Biology of Halophilic Bacteria, CRC Press. Russell, R. L., Abelson, J. N., Landy, A., Gefter, M. L., Brenner, S. and Smith, J. D. (1969). Duplicate genes for tyrosine transfer RNA in Escherichia Coli. J. Mol. Biol. 47, 1-13 Saks, M. E., Sampsons, J. R. and Abelson, J. N. (1994). The transfer RNA identity problem: a search for rules. Science 263, 191-197 Sambrook, J., Maniatis, T. and Fritsch, E. (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Saunders, S. and Burke, J.F. (1990). Rapid isolation of miniprep DNA for double strand sequencing. Nucleic Acids Res. 18, 4948 Sawadogo, M. and Dyke, M.W.V. (1991). A rapid method for the purification of deprotected oligonucleotides. Nucleic Acids Res. 19, 674 Shimmin, L. C. and Dennis, P. (1989). Characterization of the Lii, Li, LiO and Li2 equivalent ribosomal protein gene cluster of the halophilic archaebacterium Halobacterium cutirubrum. EMBO J. 8, 1225-1235 Singer, B. and Kroger, M. (1979). Participation of modified nucleosides in translation and transcription. Prog. Nucleic Acid Res. Mol. Biol. 23, 151-194 Smith, J.D., Abelson, J. N., Clark, B.F. C., Goodman, H. M. and Brenner, S. (1966). Studies on amber suppressor tRNA, p479-485. In Cold Spring Harbor Symposia on Quantitative Biology. vol 8. The Genetic Code. Cold Spring Harbor, L.I., N.Y. Smith, J.D., Barnett, L. Brenner, S. and Russell, R.L. (1970). More mutant tyrosine transfer ribonucleic acids. J. Mol. Biol. 54, 1-14 69 Smith,M. (1986). Site Directed Mutagensis. Phil. Trans. R. Soc. Lond. A317,295-304 Spratt, B.G., Hedge, P.J., te Heesen, S., Edelman, A. and Broome-Smith, K. (1986). Kanamycin-resistant vactors that are analogues of plasmids pUC8, pUC9, pEMBL8 and pEMBL9. Gene, 41,337-342 Stretton, A.O.W. and Brenner, S. (1965). Molecular consequences of the amber mutation and its suppression. J. Mol. Biol. 12,456-465 Thiara, A.S. and Cundliffe, E. (1988). Cloning and characterization of a DNA gyrase B gene from Streptomyces sphaeroides that confers resistance to novobiocin. EMBO J. 7, 2255-2259 Thomm, M. and Wich, G. (1987). An archaebacterial promoter lelment for stable RNA genes with homology to the TATA box of higher eukaryotes. Nucleic Acids Res. 16,151-163 Thomm,M., Wich, G., Brown, J.W., Frey, G., Sherf,B. and Beckler, G.S. (1989). An archaebacterial promoter sequence assigned by RNA polymerase binding experiments. Can. J. Microbiol. 35,30-35 Watson, J.D., Hopkins, N.H., Roberts, J.W., Steitz, J.A. and Weiner, A.M. (1987). Molecular Biology of the Gene, 4th edition. The Benjamin/Cummings Publishing Company, Inc., Califonia. Wich, G., Jarsch, M. and Bock, A. (1984) Apparent operon for a 5S ribosomal RNA gene and for tRNA genes in the archaebacterium Methanococcus vannielii. Mol. Gen. Genet. 196, 146-151 Woese. C. R. (1987) Bacterial evolution. Microbiol. Rev. 51, 221-271 Woese, C.R. (1981). Archaebacteria. Sci. Amer. 244, 98-122 Woese, C.R., Gutell, R., Gupta, R. and Noller, H.F. (1983). Detailed analysis of the higher-order structure of 16S-like ribosomal ribonucleic acids. Microbiol. Rev. 47, 621-669 Woose, C. R., Kandler 0. and Wheelis, M.L. (1990). Towards a natural system of organisms: Proposal for the domains Archaea, Bacteria and Eucarya. Proc. NatL Acad. Sci. 87, 4576-4579 Zillig, W., Stetter, 0., Schnabel, R. and Thomm, M. (1985). DNA-dependent RNA polymerase of the archaebacteria, p499-524. In Woese, 0.R. and Wolfe, R.S. (ed), The Bacteria-a treatise on structure and function, vol 8, The Archaebacteria, Academic Press, N.Y. 70


Citation Scheme:


Usage Statistics

Country Views Downloads
United States 50 0
China 6 12
City Views Downloads
Washington 50 0
Beijing 6 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}


Share to:


Related Items