UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigation of kalilo-like plasmids in Neurospora and Gelasinospora He, Cynthia Yingxin 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-0424.pdf [ 3.27MB ]
Metadata
JSON: 831-1.0099068.json
JSON-LD: 831-1.0099068-ld.json
RDF/XML (Pretty): 831-1.0099068-rdf.xml
RDF/JSON: 831-1.0099068-rdf.json
Turtle: 831-1.0099068-turtle.txt
N-Triples: 831-1.0099068-rdf-ntriples.txt
Original Record: 831-1.0099068-source.json
Full Text
831-1.0099068-fulltext.txt
Citation
831-1.0099068.ris

Full Text

INVESTIGATION  OF KALILO-LIKE PLASMIDS  IN  NEUROSPORA AND GELASINOSPORA  by CYNTHIA YINGXIN HE B.Sc, Nankai University, 1993  A THESIS SUBMITTED IN PARTIAL FULLFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in  THE FACULTY OF GRADUATE STUDIES (Department of Botany)  We accept this thesis as conforming to the reajiired standard  THE UNIVERSITY OF BRITISH COLUMBIA July, 1996 ©Cynthia Yingxin He, 1996  In  presenting this  degree at the  thesis  in  University of  partial  fulfilment  of  the  requirements  British Columbia, I agree that the  for  an advanced  Library shall make it  freely available for reference and study. I further agree that permission for extensive copying  of  department  this thesis for scholarly purposes may be granted or  by  his  or  her  representatives.  It  is  by the  understood  that  head of copying  my or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of  IJQT&fi  The University of British Columbia Vancouver, Canada  Date  DE-6 (2/88)  > 6.  firm  Abstract  Mitochondrial DNA plasmids sharing great sequence homology with the senescenceinducing kalilo plasmid have been identified in natural isolates of Neurospora crassa, Neurospora intermedia, Neurospora tetrasperma, Neurospora discreta and a Neurospora-related genus Gelasinospora. Restriction enzyme analysis and sequence analysis have revealed that these plasmids are closely related by descent from a common ancestral plasmid. The phylogenetic tree constructed on the basis of the terminal inverted repeat sequences of the kalilo-like plasmids correlates well with the established taxonomy of their host fungi. The attempt to transfer kalilo-like plasmids to standard lab strains of N. crassa has had limited success. Only a few transferrants were obtained and they all proved to be unstable. Therefore, the comparison of plasmid function can not yet be made at the plasmid level with identical mitochondrial D N A and nuclear DNA background. However, the comparison of plasmid TIR sequences reveals some interesting features which may be relevant to the plasmid function. The failure of plasmid transfer indicates that horizontal transfer must be a rare event, though it may be evolutionarily significant as to contribute to the current distribution pattern of kalilo-related plasmids.  ii  Table of Contents  Abstract  ii  Table of Contents  iii  List of Tables  vi  List of Figures  vii  Acknowledgement  viii  Chapter 1 Introduction  1  A general introduction to the genus Neurospora  1  The mating types and heterokaryon incompatibility in Neurospora  1  Fungal plasmids  2  Fungal senescence  3  The kalilo plasmid: its genetic organization and relation to the onset of senesence phenotype Kalilo-like plasmids found in other species of Neurospora and Gelasinospora Objectives of these studies Chapter 2 Investigation of Kalilo-like Plasmids in Natural Isolates of Neurospora  4 7 8 9  Introduction  9  Materials and methods  11  Strains and cultural conditions  11  Isolation of plasmid DNA  12  Southern blot analysis  12  Detection of plasmid insertion into mtDNA  12  DNA sequencing  13  Computer analysis  13  Results  13 Visualization of kalilo-like plasmids  13  Sequencing analysis of kalilo-like plasmids and senescence studies of Neurospora strains containing kalilo-like plasmids Sample sequence analysis of ORFs of kalilo-like plasmids Discussion  16 21 22  Chapter 3 Transfer of Kalilo-related Plasmids to Standard Lab Strains of Neurospora crassa  30  Introduction  30  Materials and methods  31  Fungal strains  31  Methods for plasmid transfer  32  Dot-blot hybridization  34  Results  34 Hyphal contact  34  Spheroplast fusion  35  Cross and heterokaryon formation  35  Discussion  36  Summary  39  Biblilography  41  Appendix I Sequence Alignments of the TIR of Kalilo Plasmid with the TIRs of Other Kalilo-like Plasmids.  46  Appendix II D N A Sequence Alignment of Kalilo DNA, Gel-kalilo DNA and LA-kalilo DNA in the ORFs.  53  Appendix Ha DNA sequence alignment of ORF1  53  Appendix lib DNA sequence alignment of ORF2  58  iv  Appendix III Alignment of the TIR Sequences of Kalilo DNA, LA.-kalilo DNA, Short kalilo DNA and Gel-kalilo DNA  63  Appendix Ilia Computer-made alignment  63  Appendix Illb Hand-made alignment  66  V  List of Tables  Table 1 Neurospora strains used for study of kalilo-related DNA plasmids  11  Table 2 Previous survey of kalilo-like plasmids in Neurospora and  related fungal isolates  19  Table 3 Summary of species distribution and senescence of kalilo-like plasmids  20  Table 4 N. crassa lab strains used as recipients in the plasmid transfer experiments  32  vi  List of Figures  Fig. 1 The overall structure of kalilo plasmid  5  Fig. 2 Restriction maps of kalilo plasmid, LA-kalilo plasmid and Gel-kalilo plasmid  10  Fig. 3 Southern hybridization of kalilo-like plasmids,  15  Fig. 4 Restriction analysis of kalilo-like plasmids by EcoRI  16  Fig. 5 Comparison of the 60 bp region in the TIRs of kalilo and LA-kalilo D N A  18  Fig. 6 Comparison of the TIRs of kalilo-like plasmids  21  Fig. 7 Sequencing sample regions of the ORFs of the LA-kalilo plasmid  22  Fig. 8 A n unrooted phylogenetic tree for kalilo-related plasmids based on their TIR sequences  24  Fig. 9 A n unrooted phylogenic tree for kalilo-like plasmids superimposed with fungal distribution of the plasmids  24  Fig. 10 Sequence alignment of a 52 bp region flanking the proposed transcription initiation site in kalilo-related plasmid  28  vii  Acknowlegement  This study was supported by NSERC research grant A6599 to Dr. A . J. F. Griffiths.  I am grateful to Drs. Anthony J. F. Griffiths, Louise Glass and Jim Kronstad for their advice and help throughout this study. I thank Xiao Yang, Yuewang Wei and Jin-woo Bok for their technical assistance, and Natasja de Groot for her work on the test of fungal senescence.  This thesis is dedicated to my parents.  Chapter 1  Introduction  A general introduction to the genus Neurospora Neurospora is a genus belonging to the class Ascomycetes, sub-class Pyrenomycetes. It has long been established as a model organism for eukaryotic genetics studies. It possesses a spectrum of nuclear, mitochondrial and plasmid genetic systems that are amenable to analyses by molecular biology methods. It is capable of heterokaryon formation, and mutants are easily obtained. During the vegetative life cycle of Neurospora, there are haploid nuclei with only one set of seven chromosomes in each nucleus. The Neurospora genome is relatively small compared with other eukaryotes. It contains about 47 million nucleotide pairs; of these, 93% are unique sequences. The Neurospora mitochondrial genome is one of the best studied of all fungi. The mitochondrial DNA of Neurospora crassa (74-OR23-1A) has been cloned and the nucleotide sequence of 94% of its genome has been determined (For review, see Griffiths et al., 1995). Numerous mitochondrial plasmids have been found in natural isolates of Neurospora, which has resulted in a new area of genetic research.  The mating types and heterokaryon incompatibility in Neurospora The life cycle of Neurospora allows both sexual and asexual reproduction. For sexual reproduction, some Neurospora species are heterothallic, such as Neurospora crassa, in which case crosses must involve direct interaction between strains of opposite mating types. Some species such as Neurospora terricola , are homothallic, or self-fertile. Others such as Neurospora tetrasperma, are pseudohomothallic. In Neurospora tetrasperma, individual ascospores are usually (but not always) heterokaryons that contain haploid nuclei of opposite mating types (Dodge, 1927; Perkins, 1992). The mating types of Neurospora, designated as A and a, are determined by codominant idiomorphs (Glass et al.,1988; reviewed by Metzenberg and Glass, 1990) located  1  on linkage group I (Perkins et al., 1982). The mating-type genes have a dual function: strains of opposite mating types are required for sexual reproduction, but only strains of the same mating type can form stable vegetative heterokaryons. The inability to make heterokaryons between specific strains is called heterokaryon incompatibility. It may be expressed as death or weak growth. Besides difference in mating type, heterokaryon incompatibility can also be a result from allelic differences at heterokaryon incompatibility loci (het loci). Strains are compatible only when alleles at all het-loci are identical (Perkins, 1988). Studies in N. crassa suggest that the het-gene polymorphism is widespread in natural populations (Mylyk, 1976).  Fungal plasmids Plasmids are small extragenomic DNA molecules that can reproduce inside living cells or organelles. They can replicate separately from the genome, or integrate into the genome and replicate as part of the genomic DNA. Plasmids were originally discovered in bacteria. They have also been found in eukaryotes including fungi and plants ( reviewed by Meinhardt et al. 1990). Mitochondrial plasmids have been found in many different fungal cultures isolated directly from natural populations (reviewed by Griffiths, 1995). They are linear or circular D N A elements which may contain sequences coding for products that are involved in replication of the plasmids. The origin and function of these fungal plasmids are still unclear. In a few cases, the mitochondrial plasmids were found to be associated with a specific phenotype, such as the senescence-inducing plasmids kalilo and maranhar in Neurospora, but most fungal plasmids do not have any detectable effect on the phenotype of their host strains.  2  Fungal senescence The phenomenon of fungal senescence has been best studied in Podospora and Neurospora. In the context of fungi, senescence may be defined as the progressive loss of growth potential culminating in death (Griffiths, 1992). It is different from the sporadic fungal organismal death regularly encountered in lab studies in that senescence has a more predictable and repeatable death pattern. Senescence can be measured by the growth of parallel fungal cultures in race tubes or in serial subcultures where symptoms are expressed and cultures die after a strain-specific distance or a strain-specific number of subcultures. The senescence symptoms include morphological abnormalities, such as hyphal tip swelling, and mitochondrial dysfunction, such as cytochrome abnormalities and rearranged mitochondrial DNAs. In this way, senescence resembles the phenotype of other mitochondrial mutants such as the poky and stopper mutants of Neurospora. All natural isolates of Podospora species die (Esser et al., 1980). The senescence is concomitant with the appearance of new mtDNA-derived elements in mitochondria and rearrangement of mtDNA. Some nuclear and mitochondrial mutants have been found to prolong the lifespans of Podospora strains, such as the standard mitochondrial chloramphenicol-resistant marker as described by Belcour and Begel (1980) and the morphological double mutant incoloris and vivax (Tudzynski and Esser, 1979). In Neurospora, senescence has only been found in natural field-isolated strains. The two best studied cases are the kalilo strains of Neurospora intermedia, and the maranhar strains of Neurospora crassa.  3  The kalilo plasmid: its genetic organization and relation to the onset of senescence phenotype in  Neurospora  intermedia  Approximately 30% of N. intermedia strains isolated from the Hawaiian island of Kauai show senescent phenotype (Griffiths and Bertrand,1984; Griffiths et al.1986; Debets et al., 1995). Molecular studies of these senescent strains led to the discovery of a 8.6 kb linear mitochondrial plasmid, which is named "kalilo", meaning "dying" in the Hawaiian language. The kalilo plasmid resides in mitochondria either as a free plasmid or as a mitochondrial insertion sequence. The free plasmid has no detectable effect on the N. intermedia host. However, at some point, the kalilo plasmid may insert into mitochondrial DNA (mtDNA) and lead to mitochondrial dysfunction. The normal mtDNA is then progressively replaced by the insertion type. Therefore, it is reasonable to infer that senescence is a result of progressive loss of normal mitochondrial functions caused by plasmid insertion into mtDNA. Some kalilo-plasmid-containing strains were found to escape senescence by the function of nuclear suppressors (Griffiths st al., 1992; Yang and Griffiths, 1993). The suppressor may either inhibit the plasmid insertion or eliminate the plasmid to a barely detectable level. The complete nucleotide sequence of the kalilo plasmid is now available (Chan et al., 1991). It turned out to be a 8643 bp linear DNA fragment with an organization typical of eukaryotic linear plasmids (Meinhardt et al., 1990; Griffiths et al., 1995). It has perfect terminal inverted repeats on both ends and two large open reading frames running in opposite directions towards the centre. There are also 120 kd terminal proteins covalently bound at its 5' ends. The overall structure of kalilo is shown in Fig. 1. The various features are described further:  4  ORF1  (3 —' ORF2 Fig. 1 The overall structure of kalilo plasmid Terminal inverted repeats Open reading frames (Arrows show the translational direction) Terminal proteins  a. The open reading frames (ORFs): The kalilo plasmid is known to be transcribed, though no translational product has been identified. Multiple transcripts of different sizes were found in all the developmental stages . Two transcripts of 4.4- and 4.8-Kb correspond to the two ORFs in size, position and polarity (Vickery and Griffiths, 1993). The two non-overlapping ORFs were proposed to be translated in the Neurospora mitochondrial genetic code (Nargang et al.,1984). ORF 1 codes for a putative protein 811 amino acids long that shows regional homology to bacteriophage T7 RNA polymerase, and ORF 2 codes for a putative protein 970 amino acids long that shares motifs of virus and bacteriophage DNA polymerases, and with putative proteins of ORFs of other eukaryotic plasmids (Chan et al., 1991).  b. The terminal proteins (TPs):  r• The 5' end of kalilo DNA bears a covalently bound 120 kd protein that protects the plasmid from digestion by 5' exonucleases (Vierula et al., 1990). Such a large protein is  unlikely to be encoded by one of the kalilo ORFs. The source of this protein remains unknown. The function of the TP is also unknown, but it is believed to be at least partially responsible for the replication, as well as integration of the plasmid (Chan et al., 1991). The role of the terminal protein in replication and integration would be best addressed with in vitro assays using purified components or by an in vivo system that permits the generation and analysis of mutants of the multicopy plasmid. But neither of these options is available yet for the kalilo plasmid of Neurospora.  c. The terminal inverted repeats (TIRs): The 1366 bp perfect TIRs of kalilo are the longest known to-date for a mitochondrial plasmid. Nucleotides 6 to 25 inwards from either end of the plasmid form short, imperfect palindromes (Chan et al. 1991). The TIRs also contain some very short ORFs, but none of them has been shown to be translated. The ability to integrate into mtDNA and cause mitochondrial dysfunction is one of the unique properties of the kalilo plasmid. Almost full-length fragments insert into the mitochondrial genome by a mechanism that creates giant inverted repeats of mtDNA flanking the inserting sequence. A 5 bp match is found between the terminal sequence of kalilo plasmid and its insertion point in mtDNA. This 5 bp random sequence could be anywhere within the terminal 20 bp of the TIRs. Short segments of DNA (5-18 bp) distal to this 5 bp region are lost from both ends of the plasmid upon integration (Dasgupta et al., 1988) Interestingly, the inserted form of maranhar, another linear senescence-inducing plasmid of Neurospora, is also flanked by very long inverted repeats of mtDNAs. But unlike kalilo, maranhar does not have terminal palindrome structure, and it integrates into the mtDNA without losing nucleotides from either terminus (Court et al., 1991). In addition, maranhar has no nucleotide sequence homology to either the host mtDNA or the kalilo DNA.  6  Comparison between these two Neurospora plasmids suggests that the integration of these plasmids occurs via a mechanism that may involve a panhandle structure formed by pairing of the nucleotides in the TIRs. The TIRs may also provide recognition sequences for the integration of the elements into mtDNA (Chan et al., 1991). The resolution of this problem might be achieved by the development of either an in vitro integration assay or an in vivo mutant system.  Kalilo-like plasmids found in other species of Neurospora and in Gelasinospora Linear plasmids that show strong sequence homology to kalilo DNA have been found in natural isolates of N. crassa, N. discreta and N. tetrasperma. One kalilo-like plasmid was also found in Gelasinospora. The discovery of these new plasmids provides an opportunity to study the function and evolution of the kalilo plasmid. Two of these kalilo-like plasmids had been studied intensively prior to the present work. LA-kalilo plasmid The LA-kalilo DNA was first identified in two Louisiana strains of N. tetrasperma (Marcinko-Kuehn et al., 1994). It showed strong nucleotide homology to kalilo DNA by Southern hybridization analysis. Besides, the LA-kalilo plasmid has a restriction map almost identical to that of kalilo DNA, only the termini were thought to be shorter by approximately 100 bp. Many LA-kalilo-bearing strains senesced, but the presence of this plasmid does not guarantee senescence. The senescence phenotype is inconsistent and atypical when compared with that of kalilo-containing strains: the symptoms are slower to develop and parallel cultures often show differences in the expression or the time of death. Furthermore, LA-kalilo DNA does not insert into mtDNA.  7  Gel-kalilo plasmid The Gel-kalilo DNA was found in a sample of Gelasinospora isolates from Louisiana soil. Sequence analysis of this plasmid shows remarkable similarity to kalilo D N A (Yuewang et al., 1996). Besides the identical genetic organization, the sequence similarity is 100% over large regions, and approximately 95% overall in the ORFs. The main differences are in the intergenic region and in the terminal inverted repeats. Both Gel-kalilo plasmid-containing and plasmid-free strains were grown in race tubes to investigate senescence. All the strains examined showed senescence. Therefore, it is impossible to correlate the possession of Gelkalilo DNA with senescence.  Objectives of these studies The work on the kalilo-like plasmids as described in the following chapters was performed in an attempt to answer the following questions. 1. What is the exact difference between kalilo and other kalilo-like plasmids? What is(are) the consequence(s) of this difference? Why do they have such different behavior in regards to insertion and senescence? Is it a difference of the plasmids, or a difference between their fungal hosts? 2. How did kalilo-like plasmids become distributed among Neurospora and Gelasinospora strains, by in situ evolution or horizontal transfer? 3. Is plasmid insertion the only determining factor of fungal senescence? 4. How do the terminal inverted repeats work during insertion? Answers to these questions would help in the comprehension of the function and evolution of the kalilo plasmids, as well as the function of the TIR. Possession of perfect TIRs is a common feature of all eukaryotic plasmids (Meinhardt et al., 1990; Griffiths et al., 1995).  8  Chapter 2  Investigation of  Kalilo-like Plasmids in Natural Isolates of Neurospora  Introduction Several DNA elements sharing sequence homology with kalilo D N A have been found in the heterothallic species N. intermedia, N. crassa and N. discreta, the pseudohomothallic species N. tetrasperma and a homothallic species of a Neurospora-related genus Gelasinospora. The entire sequence of the kalilo-like plasmid in Gelasinospora (Gel-kalilo DNA) is available (Yuewang et al., 1996). The similarity of the LA-kalilo DNA in JV. tetrasperma with the prototypic kalilo DNA has been well characterized by restriction enzyme digestion and Southern hybridization analysis (Marcinko-Kuehn et al., 1994). Restriction enzyme analysis (Fig. 2) suggests that the LA-kalilo plasmid is more similar to kalilo DNA than is Gel-kalilo DNA. However, the LA-kalilo plasmid is slightly shorter than kalilo DNA in the TIRs, so a sequencing analysis was necessary to identify the exact difference between kalilo and LA-kalilo DNA. The existence of other kalilo-homologous DNAs in N. crassa, N. discreta and N. tetrasperma was detected by dot-blots and Southern hybridization (Arganoza et al., 1994). The discovery of kalilo-like DNA in Neurospora and Gelasinospora raised interest in studying senescence in these.fungal strains and characterizing these kalilo-like D N A elements by gel electrophoresis, restriction enzyme analysis and sequencing analysis. This would enable a comparison to be made among the plasmid sequences which might help to understand the function and evolution of the kalilo plasmid.  9  3  4  5  7  _L  _L  _L  _L  0 Kb  Xba I EcoR I  C  Bgl II Hind III  El B2  C  E  G  EcoR V  X2a  X2b  XI  X3  8  E2  E3 B4  B3  Bl  |  Kl  K2  Kpn I Pst I Fig. 2a  Xbal EcoR I EcoRV Bgl II Hind III Kpn I Pst I Fig. 2b  Fig. 2 Restriction maps of kalilo plasmid, LA-kalilo plasmid and Gel-kalilo plasmid. Restriction cutting sites are represented by vertical lines. Letters and numbers in Fig. 2a represent the codes used in subcloning. a: Restriction map of kalilo DNA (Chan et al., 1991) and LA-kalilo D N A (Marcinko-Kuehnetal., 1994) b: Restriction map of Gel-kalilo DNA (Yuewang et al., 1996)  10  Materials and Methods Strains and culture conditions The LA-kalilo-containing Neurospora tetrasperma strain (P4495) was collected and isolated from Louisiana soil samples by Dr. D. Jacobson. It was classified as Neurospora tetrasperma by the criteria established by Perkins et al. (1976). Other Neurospora strains were ordered from the Fungal Genetics Stock Center (FGSC). According to Arganoza et al. (1994), they all contain kalilo-related plasmids. Information on all the strains used in this work is listed in Table 1.  Table 1 Neurospora strains used for study of kalilo-related DNA plasmids  Fungus  Location  N. crassa  Haiti Haiti Haiti Ivory Coast Florida Papua New Guinea Thailand Ivory Coast Hawaii Hawaii Hawaii Hawaii Moorea-Tahiti Moorea-Tahiti Louisiana  N. discreta  N. intermedia  N. tetrasperma  FGSC stock# 4709 4710 4711 4832 5923 6784 6790 6794 3718 3721 3722 5014 6583 6591 P4495  Mating a A A a a a a A A a A. a A+a A+a A+a  type  Reference  Fungal Genetics Newsletter  No.41, 1994 supplement  All culturing and strain manipulation used standard techniques devised for Neurospora, as summarized by Davis and deSerres (1970).  11  Isolation of plasmid DNA The plasmid D N A was co-purified with mitochondrial DNA using the small scale mtDNA method described by Myers (1988). Proteinase K digestion was necessary prior to phenol/chloroform extraction of proteins. For sequencing analysis, plasmid D N A needed to be further treated by Pst I and X exonuclease. The restriction enzyme Pst I does not have any cutting site in all the kalilo-related DNA known so far (Yang and Griffiths, 1993), and the 5'TPs protect the plasmids from being digested by X exonuclease. Therefore, the plasmid DNA remained intact while the mtDNA was completely degraded by Pst I and X exonuclease. Enzymes and small fragments of mtDNA were removed by phenol/chloroform extraction and ethanol/NH4AC precipitation. Plasmid DNA purified this way can be used directly as a template for sequencing analysis.  Southern blot analysis: The Southern hybridization methodology was similar to that described by Maniatis et al. (1982). The 8.2 kb Kpn I restriction fragment which encompassed most of the kalilo plasmid was cloned in the pUC18 vector and used as probe to detect kalilo-homologous sequences. The DNA probe was labelled with P - d C T P using an oligolabelling kit available 32  from Pharmacia.  Detection of plasmid insertion into mtDNA: The mtDNA samples were digested by Pst I. Since Pst I does not have restriction site in the kalilo-like DNA, plasmid insertion can be detected by the presence of linear kalilohomologous D N A fragments bigger than free plasmids (Yang and Griffiths, 1993). These fragments represent plasmid DNA flanked by mtDNA ending with Pst I sites.  12  DNA sequencing: The DNA sequence was determined using an automated sequencing system (Applied Biosystems 377 Automated DNA Sequencer). Sequencing primers were synthesized oligonucleotides designed on the basis of the kalilo sequence (Chan et al., 1991) and sequencing data obtained in the present work. Plasmid DNA purified as described above was used as the template for sequencing. The first round of sequencing was primed by a primer close to the inner end of TIR. The DNA sequence of the rest of TIR was determined by primer walking, which was a series of unidirectional sequencing reactions in which the primer used in one reaction was designed on the basis of the outermost sequence of the previous reaction. The DNA sequence of the TIR was hence determined until additional sequence could not be obtained, and this was presumed to be the terminus of the plasmid (Yuewang et al., 1996). Computer Analysis: The DNA sequencing data were analyzed by computer programs including Assembly LIGN, MacVector, blastsearch (http://www.ncbi.nlm.nih.gov/Recipon/blast_search.shtml), PHYLIP (Joseph Felsenstein, Department of Genetics SK-50, University of Washington, Seattle, W A 98195) and the Wisconsin Sequence Analysis Package - Version 8 from Genetics Computer Group, Inc. (Devereux et al., 1984).  Results Visualization of kalilo-like plasmids Sixteen Neurospora isolates were proposed to contain kalilo-like plasmids by Arganoza et al. (1994). MtDNA of 14 of the 16 strains (Table 1) was extracted and run on 0.8% agarose gels. Plasmids were visualized as distinct bands after ethdium bromide staining (data not shown). The DNA was then transferred to nylon membrane and probed with the large kalilo Kpnl fragment cloned in pUC18. The vector DNA does not have any homology with the fungal DNA, so anything hybridizing to the probe has homology with kalilo DNA.  13  As shown in Fig. 3, DNA plasmids showing strong homology to the kalilo probe were found in some but not all of the Neurospora strains being studied. Strains that do not have kalilo-homologoUs sequence either do not contain a kalilo-like plasmid, or they contain a low level of kalilo-like plasmid that was barely detectable by Southern hybridization. Interestingly, the kalilo-like plasmids in the two N. discreta strains are smaller than kalilo, while other kalilo-like plasmids in the N. crassa and N. tetrasperma strains are approximately of the same size as kalilo. Restriction analysis using EcoRI (Fig.4a) and Xbal showed that the smaller size of the N. discreta kalilo plasmid is due to its shorter terminal inverted repeats (a restriction map is shown in Fig. 4b). The existence of the TIR sequences in these kalilolike plasmids was confirmed by digesting plasmid DNA samples with Hind III. Hind III cuts all the kalilo-like DNA only once and generates two fragments of different sizes. Southern hybridization was then performed using a cloned terminal kalilo fragment (C) (Fig. 2) as probe. Both Hind III fragments showed homology to the kalilo probe, confirming the existence of terminal repeat sequences on both ends (data not shown).  14  • Fig. 3 Southern In bridization anal) sis of kalilo-like plasmids. Numbers cross the top are F G S C numbers of the Neurospora strains being studied. Numbers on the left side show the sizes of plasmid bands in k b .  0.5-  r'iii. 4a  15  Prototypic kalilo DNA Kalilo-like DNA in N.crassa, N. intermedia and N. tetrasperma  Kalilo-like DNA in N. discreta  4.0  1.3  1.9  1-3  1.9  4.0  1.9  4.0  0.5  1.3  1.3  Fig. 4b  Fig. 4 Restriction analysis of kalilo-like plasmids by EcoRI. a. Restriction fragments probed by a cloned kalilo Kpnl fragment. b. EcoRI restriction maps of kalilo-related plasmids. The horizontal bars represent D N A plasmids. The vertical lines represent EcoRI restriction cutting sites. The size of each fragment is shown in Kb above the corresponding rectangule.  Sequencing analysis of TIRs of kalilo-like plasmids and senescence studies of Neurospora strains containing kalilo-like plasmids The TIRs of the kalilo-like plasmids were sequenced and the sequences were then aligned with the TIR sequence of the prototypic kalilo DNA (nucleotide sequence alignments are shown in Appendix I). Senescence was tested by both serial subculturing and race tube growth (de Groot, 1995). Onset of the senescent phenotype was characterized by slowing of hyphal growth in a race tube, or mycelial death in serial subcultures. This experiment lasted for 2 months. Strains did not show any senescent phenotype within 53-day race tube growth or 20 serial subcultures were classified as non-senescent. By looking at the sequence alignments and the senescence phenotype, the kalilo-like plasmids can be grouped into four major types.  16  Type I: Original kalilo This is the prototypic kalilo sequence represented by the kalilo plasmid found in N. intermedia strains from the Hawaiian islands (Griffiths and Bertrand, 1984). Another version showing identical restriction map overall in the plasmid and 100% sequence identity in the TIRs was also found in a N. tetrasperma strain (6583) from Moorea-Tahiti. The kalilo plasmid in N. intermedia was also transferred to standard N. crassa strains with Oak Ridge background (Griffiths etal., 1990). All kalilo-containing strains show senescent phenotype accompanied by plasmid insertion into mtDNA (Bertrand et al., 1985; Griffiths et al., 1990; this study, data not shown).  Type II: LA-kalilo The first example of this type is the kalilo-like plasmid found in two N. tetrasperma strains from Louisiana (Marcinko-Kuehn et al., 1994). A similar plasmid showing an identical restriction map overall in the plasmid and over 99% sequence similarity in the TIR was found in this study in a N. crassa strain (4711) from Haiti. The LA-kalilo-type plasmids shows the greatest similarity with type I kalilo DNA among all the kalilo-like plasmids. The only major difference lies in a 60 bp regions in the TIRs (Fig. 7). D N A alignment of this 60 bp in both kalilo and LA-kalilo is shown in Fig. 5. Compared with kalilo DNA, the LA-kalilo plasmid has a 15 bp insertion and 50 bp deletion which result in a slightly shorter TIR as noticed by Marcinko-Kuehn et al.(1994). A blast search of the 15 bp insertion fragment did not reveal any significant matches in the gene data bank.  17  7 860  GCACGTAGCA  TIR of kalilo DNA  ******GCTT  TIR of LA-kalilo DNA  AACTTATTGT  TATCCTTTCC  TCTTTCATTT  CTTACTATGT A-  7 900  GCGTACAATT  TIR of kalilo DNA TIR of LA-kalilo DNA  ACGGTTTACA  TTATTATGAG  ___**•*•****  **  ,i Q * * * *  Fig. 5 Comparison of the 60 bp region in TIRs of kalilo and LA-kalilo DNA - Deletion in LA-kalilo DNA. * Identical nucleotide between the two sequences. Sequence underlined represent the 15 bp insertion. Numbers shown above the sequences correspond to numbers in Fig. 6.  The senescent phenotype in LA-kalilo-containing strains is not so predictable as that in kalilo-containing stains. In the two LA-kalilo-containing N. tetrasperma strains, senescent symptoms are slower to develop and parallel cultures often show differences in the expression or the time of death (Marcinko-Kuehn et al., 1994). The senescent phenotype was not observed in the LA-kalilo-containing N crassa strains (de Groot, unpublished result). Besides, LA-kalilo plasmids do not insert into mtDNA as shown by Pst I treatment (Marcinko-Kuehn, 1994; unpublished observations).  Type III: Short kalilo The senescent phenotype was not observed in N. discreta strains carrying short kalilo DNA (de Groot, 1995). Compared with kalilo DNA, short kalilo plasmid has a big deletion in the TIRs. Based on the results of previous surveys of kalilo-like DNA in Neurospora and related fungal isolates (Table 2), the short kalilo DNA has so far only been detected in N. discreta strains.  18  Table 2 Previous survey of kalilo-like plasmids in Neurospora and related fungal isolates  Fungal isolates investigated  Detection method  Results  Reference  82 N. intermedia isolates collected from Hawaiian islands 38 world-wide collection of N. crassa and N. intermedia 39 N. crassa and 14 N. tetrasperma isolates collected from Louisiana 225 worldwide collection of Neurospora and related fungal isolates 16 kalilo-containing strains proposed by Arganozaetal., 1994  Dot-blot  38% contain the senescenceinducing kalilo DNA  Debets et al., 1995  Southern hybridization kalilo plasmid was only detected in N. intermedia strains from Hawaiian islands Only two N. tetrasperma dot-blot and Southern hybridization strains contain LA-kalilo DNA  Yang and Griffiths, 1993 Marcinko-Kuehn etal., 1994  Arganoza et al., kalilo-homologous plasmids dot-blot Southern hybridization were found in 16 Neurospora 1994 strains Southern hybridization Two N. discreta strains contain short kalilo DNA, while some other strains contain kalilo or LA-kalilo DNA.  This paper  Type IV: Gel-kalilo The kalilo-like plasmid found in two Gelasinospora strains from Louisiana (Yuewang et al., 1996) is the only member in this group. It shows the biggest divergence from the original kalilo plasmid. Its full DNA sequence has been published and all Gelasinospora strains were shown to be senescent, whether they contain the plasmid or not (Yuewang et al., 1996). Restriction enzyme analysis using Pst I did not show any sign of plasmid insertion into mitochondrial genome (data not shown). In this case, senescence must be caused by mechanisms other than plasmid integration.  The results of the plasmid and senescence studies in kalilo-like DNA-containing fungal strains are summarized in Table 3. A comparison of the four types of TIRs is shown in Fig. 6.  19  Table 3 Summary of species distribution and senescence of kalilo-like plasmids  Type of kalilo  Occurrence  Senescence observed  References  kalilo  N. N. N. N.  Yes Yes Yes Not consistent  Debetsetal., 1995 This paper Griffiths et al., 1990 Marcinko-Kuehn et al., 1994 This paper This paper  LA-kalilo  Short kalilo  intermedia (Hawaii) tetrasperma (Moorea-Tahiti) crassa (Oak Ridge) tetrasperma (Louisiana) a  N. crassa (Haiti) N. discreta (Thailand) N. discreta (Ivory Coast) Gelasinospora (Louisiana)  No No  0  Gel-kalilo  All Gelasinospora Yuewang et al., isolates show 1996 senescent phenotype.  a: The kalilo plasmids was transmissed to N. crassa from N. intermedia by hyphal contact, b: Nucleotide sequence for short kalilo in this strain is not available yet.  20  7278 I  8643bp 1  Kalilo  7855 7912  LA-kalilo  >95%  >99%  Short kalilo  7760  I  t  8503  k \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ l 95%  Gel-kalilo  7757  8163  8322  i  1 80%  8497  K W W M  93%  90%  i  70%  Fig. 6 Comparison of the TIRs of kalilo-like plasmids. The figure shows only one of the perfect TIRs of each plasmid. Numbers above the bars represent locations of fragments relative to kalilo DNA. Percentages below the bars represent degree of sequence homology to kalilo DNA. |  ~ | Kalilo sequence  kSSSSSM  Deletion Deletion + Insertion  Sample sequence analysis of ORFs of kalilo-like plasmids Approximately 2 kb sequences of the ORFs of LA-kalilo DNA from N. tetrasperma strain P4495 were analyzed. The regions sequenced are shown by locations of the primers in Fig. 7. Nucleotide sequence alignments of these regions for kalilo DNA, LA-kalilo D N A and Gel-kalilo D N A are shown in Appendix II. The amino acid sequence alignments of the Gelkalilo ORFs to the prototypic kalilo ORFs have been published (Yuewang et al., 1996), but the amino acid sequence alignments of the LA-kalilo ORFs to the kalilo ORFs are not yet available due to the lack of entire sequence of LA-kalilo DNA. At the nucleotide sequence level, LA-kalilo DNA show more than 99% similarity with kalilo DNA in the sampled ORF regions while Gel-kalilo DNA shows approximately 95% similarity with kalilo D N A overall in the ORFs (Y uewang et al., 1996).  21  Kb  0  1  2  3  4  5  6  7  8  1  1  1  1  1  1  1  1  1  ORF2"*- •  Kalilo  ORF1  Fig. 7 Sequencing sample regions of the ORFs of the LA-kalilo plasmid Sequencing primers  gggSS  TIRs  Discussion Several kalilo-like plasmids have been identified in a world-wide collection of strains of Neurospora and a related genus Gelasinospora. Discovery of these kalilo-like plasmids raised our interest in the evolution of these plasmids and their host strains. Studies on the kalilo plasmid family could also provide useful information on the structure and function of TIRs, which are common features of linear eukaryotic plasmids (Meinhardt et al., 1990; Griffiths, 1995). The kalilo-like plasmids found so far are all linear DNA elements with identical terminal inverted repeats on both ends. Their resistance to X exonuclease suggested the presence of terminal proteins (TPs) covalently bound to the 5'-ends (Vierula et al., 1990), which is a common structure of eukaryotic linear plasmids (Meinhardt et al., 1990; Griffiths, 1995). In addition, all of the kalilo-like plasmids show strong cross-hybridization with kalilo DNA at the DNA level. The LA-kalilo plasmids have a restriction map almost identical to that of kalilo DNA. Sample sequences in ORFs of LA-kalilo show more than 99% identity to kalilo ORFs. The Gel-kalilo DNA has a very different restriction map to kalilo, but its  22  sequence shows remarkable similarity. When compared with kalilo plasmid, the ORF1 sequence of Gel-kalilo is 95% similar at the DNA level and 91% similar at the amino acid level; the ORF2 sequence shows 93% similarity to kalilo DNA excluding length mutations (Yuewang et al., 1996). The short-kalilo plasmids have a restriction map identical to kalilo D N A in the ORF regions. These features make it reasonable to conclude that these kalilo-like plasmids are related by descent from a common ancestral plasmid. An unrooted phylogenetic tree of the kalilo-like plasmids was then constructed based on the sequences of their TIRs. The TIR sequences of the prototypic kalilo plasmid (Chan et al., 1991), the LA-kalilo plasmid in N. tetrasperma strain P4495, the short kalilo plasmid in N. discreta strain 6790 and the Gelkalilo plasmid (Yuewang et al., 1996) were aligned by the multi-sequence alignment programs as described in the methods. This alignment (as shown in Appendix Ilia) shows neither the big deletion regions in the middle of the TIRs of short kalilo and Gel-kalilo plasmids, nor the sequence similarity in the temini of all kalilo-related plasmids. Therefore, the TIR sequences were re-aligned manually ( alignment as shown in Appendix Illb, the alignment of Gel-kalilo DNA to kalilo DNA was taken from YueWang et al., 1996). This hand-made alignment matched up all corresponding regions including the terminal ends (as in Fig. 6) and the big deletions in Gel-kalilo DNA and short kalilo DNA were shown as big gaps in the middle of the TIRs. However, when both sequence alignments were subject to phylogenetic analyses by the PHYLIP programs (including a parsimony tree generated on the basis of bootstrap resampled data, and a UPGMA tree based on DNA distance matrix) and the Wisconsin Sequence Analysis programs, phylogenetic trees with identical branching pattern were obtained, though the branch lengths varied from tree to tree. A phylogenetic tree with identical branching pattern was also obtained when only the inner 500 bp of the TIRs were analyzed. The branching order information obtained from all the trees as described above was summarized in the unrooted phylogenetic tree shown in Fig. 8. The plasmid distribution pattern is superimposed to it in Fig. 9 to view the evolution better.  23  •Kalilo 100  100  "LA-kalilo  -Short kalilo  1  Gel-kalilo  Fig. 8 A n unrooted phylogenetic tree for kalilo-related plasmids based on their TIR sequences. The TIR sequence of kalilo DNA was taken from Chan et al. (1991). The TIR sequence of Gel-kalilo DNA was taken from Yuewang et al. (1996). TIR sequences of LA-kalilo and short kalilo DNAs were obtained as described in this paper. In the tree shown above, the branching order is informative but the branch length is not. Numbers above lines show the percentage of bootstraped data sets supporting the branching pattern.  Kalilo (N. intermedia; N. tetrasperma 6583)  LA-kalilo (JV. tetrasperma P4495 and P4460; N. crassa 4711)  Short kalilo (N. discreta 6790 and 6794)  Gel-kalilo (Gelasinospora)  Fig. 9 A n unrooted phylogenetic tree for kalilo-like plasmids superimposed with fungal distribution of the plasmids. The branching order is imformative but the branch lengths do not reflect the actual distance between strains  24  This phylogeny of the kalilo-related plasmids coincides with the established taxonomy of the genera Neurospora and Gelasinospora based on morphological characters (Wehmeyer, 1975) in that all Neurospora species are placed on a different branch away from Gelasinospora. The same taxonomy is also supported by other molecular phylogenetic studies of Taylor et al. (1990) using rDNA internal spacer. The intergeneric nucleotide substitution was found to be 2-3% while the interspecific rate was 0.5%. This phylogeny of the kalilo-related plasmids also coincides to the phylogenetic relationship of Neurospora species established by Randall and Metzenberg (1995) using DNA sequences of mating type genes (mt-Al genes) in that N. crassa, N. tetrasperma and N. intermedia are more closely related to each Other than to N. discreta . However, the tree based on TIR sequences of kalilo-like plasmids suggests a different placement of N. tetrasperma in relation to N. crassa and N. intermedia from that proposed by Randall and Metzenberg (1995). Their tree based on mt-Al genes suggested that N. intermedia and N. tetrasperma are closely related and N. tetrasperma may be descended from TV. intermedia or be one of its recent ancestors. However, our tree based on kalilo-like plasmids showed a close affinity of N. tetrasperma to both N. crassa and N. intermedia. N. tetrasperma may have evolved through two different routes from N. crassa and N. intermedia. Therefore, N. tetrasperma may not be truly monophyletic as proposed by Taylor and Navtig (1989) based on mitochondrial DNA RFLP analysis of some N. tetrasperma strains (not including those strains from Louisiana and Moorea-Tahiti used in this work). Substantial genetic differences within a subgroup of N. tetrasperma strains from Louisiana were observed in the phylogenetic studies by Merino et al. (1996) using nuclear DNA RFLP analysis and this may also suggest different ancestral origins of N. tetrasperma strains. The good correlation between the phylogeny of the kalilo-like plasmids with that of their host fungi is a strong evidence that the kalilo-like plasmids may have evolved before the divergence of Neurospora/Gelasinospora genera and Neurospora species. The current distribution pattern of kalilo-related plasmids was formed by long-time in situ evolution of the 25  plasmids. Plasmids were lost in some strains by chance or by suppressor mutations (Griffiths et al., 1992). The differences between kalilo-related plasmids reflect differences between their genetic background. The more similar two plasmids are to each other, the more similar their genetic backgrounds should be, and the closer their host strains are related. Therefore, the kalilo plasmid family, and maybe also other mitochondrial plasmid families (Navtig et al., 1984), could be used as markers for phylogenic relationship between different fungal strains. However, the plasmid distribution pattern may also be explained by horizontal transfer. When we look at the distribution pattern of kalilo and LA-kalilo plasmids, kalilo type plasmids were found in natural isolates of N. intermedia from Hawaii and N. tetrasperma from MooreaTahiti; while LA-kalilo type plasmids were found in N. tetrasperma from Louisiana and N. crassa from Haiti. Hawaii and Moorea-Tahiti, and Louisiana and Haiti are both geographically close pairs of locations that may allow transfer of plasmids through direct contact of different strains. The feasibility of both in situ evolution and horizontal transfer has been discussed at length by Taylor et al.(1985, 1986), Navtig et al. (1984) and Yuewang et al. (1996). It is still difficult to determine which model accounts for the distribution of kalilolike plasmids, though both possibilities might be ture.  Comparison of the TIRs of kalilo, LA-kalilo, short kalilo and Gel-kalilo plasmids reveals some interesting features. The inner 500 bp of TIR This region contains the translational start site of the ORFs (Chan et al., 1991). It is highly conserved among the kalilo-like plasmids. This region may contain important sequences or structures for the translation and function of the ORFs, which have not yet been studied.  26  The terminal 140 bp This is a less conserved region. It has been proposed that transcription of the kalilo plasmid is initiated at 101 nucleotide from the termini and elongates towards the center (Vickery and Griffiths, 1993). A further sequence comparison was made in a 52 bp region flanking the transcription initiation site (alignment is shown in Fig. 10). The sequence identity is shown to be approximately 90% among all the kalilo-related plasmids in this region. The sequence upstream of the proposed initiation site is AT-rich while the sequence downstream forms a short imperfect palindrome which is part of a bigger palindrome sequence as noticed by Chan et al. (1991). Since not much information is yet known about the promoter sequences in kalilo plasmid, this 52 bp region could be a very good place to start searching. The terminal 20 bp region in the termini of kalilo plasmid was proposed to be important in the integration of the plasmid into mitochondrial genome (Chan et al., 1991). In fact, kalilo and LA-kalilo have an almost identical terminal sequence, but they show a substantial difference in insertion behavior. This suggests that the terminal 20 bp may be necessary but not sufficient for integration. Other factors may be involved. A n example is the nuclear suppressors which were found to inhibit the senescence-inducing ability of kalilo plasmid in some N. intermedia strains. The suppressors may be functioning by inhibiting plasmid insertion or by eliminating the plasmid DNA to an almost undetectable level ( Griffiths et al., 1992; Yang and Griffiths, 1993). Such suppressors may also exist in other fungal strains. Besides, plasmid insertion may not be the only reason leading to senescence as in the case of Gelasinospora . Fungal senescence is a far more complicated process than had been thought. It may involve interaction between the mtDNA and the plasmid DNA and it may also involve certain factors from the nuclei. A good way to study the senescence mechanism is to transfer the kalilo-like plasmids into one Neurospora strain and compare their function in a new genetic background. This attempt will be discussed in detail in Chapter 3.  27  8557  8543  kalilo/LA-kalilo  TTTTCATTTT  TATACCACAC  CCTAATGGGG  Short kalilo  * * * * * * _ * * *  * * f j * * * * * * *  * * * * * * * * * *  Gel-kalilo  * * * * * * j ^ * * *  * * * * * * * * * i j i  8527  * * * * * * * * * *  ***Q*T***A  8506  kalilo/LA-kalilo  CTTTATCGCC  CC  Short kalilo  **********  **  * * * * * * I J I * * *  *  Gel-kalilo  **********  AGATAAACGT  *  Fig. 10 Sequence alignment of a 52 bp region flanking the proposed transcription initiation site in kalilo-related plasmids. The C at position 8543 is the transcription initiation site proposed by Vickery and Griffiths (1993). Sequence from nucleotides 8506 to 8531 forms a short imperfect palindrome. * Identical nucleotide as in kalilo DNA - Deletion compared with kalilo DNA  The 740 bp region in the middle of TIRs. This region has the most divergence among the kalilo-like plasmids. This suggests that the region may be functionally unimportant. Differences in this region include insertions, deletions and several point mutations. A blast search of the insertion sequences in LA-kalilo and Gel-kalilo did not reveal any significant matches in the gene data bank. The origin of these unique sequences remains mysterious. A possibility is that these sequences were from mtDNA through recombination between plasmid and mtDNA during insertion. But there is no  28  evidence that these sequences show homology with N. crassa mtDNA (Dr. Rick Collins, personal communication). Interestingly, a 200 bp kalilo sequence, which is not present in short-kalilo, was amplified by PCR from mtDNA sample of N. discreta strain 6790 (unpublished observations). This may suggest the interaction between mtDNA and plasmid D N A , which may be a source of variation for both molecules.  29  Chapter 3 Transfer of Kalilo-related Plasmids to Standard Lab Strains of Neurospora crassa  Introduction One of the characteristic properties of kalilo DNA is its ability to insert into the mtDNA and cause progressive loss of normal mitochondrial functions leading to fungal senescence. The mechanism of insertion and senescence is of great interest. As discussed in Chapter 1 and Chapter 2, the terminal inverted repeats flanking the kalilo plasmid may play an important role in the integration events. Since all the kalilo-like plasmids known so far differ from the original kalilo DNA mainly in the TIR region, they serve as useful natural mutants to study the function and mechanism of the TIRs. The kalilo-related plasmids were found in four different Neurospora species and two Gelasinospora strains from around the world, and they have different effects in their hosts, i.e. some insert and cause senescence while others do not. Fungal senescence is a complicated process which may involve interaction between nuclear DNA,.mtDNA and plasmid DNA. These features make it hard to study the function by making comparisons only on the plasmid level. Ideally, if all the kalilo-related plasmids could be transferred into the same Neurospora species, comparison could be made in the same genetic context. Neurospora crassa is the best studied Neurospora species in terms of physiology, cytology and genetics. Many modern molecular biology techniques are applicable to this well , characterized organism. The sequence of its mtDNA is available. In addition, the original kalilo D N A was transmitted successfully from N. intermedia to standard lab strain of N. crassa with an Oak Ridge background by hyphal contact (Griffiths et al., 1990). Its function as an "inducer" of senescence was hence confirmed in both of these Neurospora species.  30  In this chapter, the attempts to transfer kalilo-like plasmids, particularly the LA-kalilo plasmid, to standard lab strains of N. crassa will be discussed in detail. Although the plasmid transfer project has had only limited success so far, some interesting phenomena were observed during the experiments. These may provide insight into plasmid stability in different genetic backgrounds and into horizontal transfer of mitochondrial plasmids between different Neurospora species.  Materials and methods Fungal strains The transfer of kalilo-like plasmids was attempted using the LA-kalilo plasmid, which shows the greatest similarity to the prototypic kalilo DNA. The LA-kalilo plasmid-containing N. tetrasperma strain P4495 (A+a) was used as plasmid donor strain, and several N. crassa lab strains with different auxophic markers were used as plasmid recipients (Table 4). After the discovery of the LA-kalilo plasmid in a natural isolate of N. crassa from Haiti (4711), the transfer was also attempted intraspecifically in N. crassa.  31  Table 4 N. crassa lab strains used as recipients in the plasmid transfer experiments  Transfer methods  N. crassa  recipient strains used  Genotype  Hyphal contact  24-3  a, ad-3A, al-2, his-3, nic-2, pan-2  1  5  1-32-14  a, ad-SB, al-2, leu-3, arg-l, tol, cDE  1-33-2  a, ad-3B, al-2, leu-3, arg-l, tol, cDE  1-34-6  A, ad-3A, nic-2, al-2, tol  2  Spheroplast fusion  704  Cross  2-17-825  A, ad-3A  12-21-17  A, ad-3B, al-2, cot-1, pan-2  1423  A, al-2, pan-1, CDE  a, his-1 3  and heterokaryon formation  4  1424  A, al-2, pan-1, CdE  1425  A, al-2, pan-1, cDE  1426  A,.al-2, pan-1, cdE  1. 24-3 is derived from a cross between N. crassa lab strains 74A-Y112-M15, ad-3A and 74OR21-la, his-3, nic-2, al-2,pan-2 (Griffiths etal., 1974). 2. 1-32-14,1-33-2 and 1-34-6 are stocks derived by A . M . deLange. 3. 2-17-825 is a nitrous acid-induced ad-3A mutant arising from a base-pair substitution (Mailing and deSerres, 1968). 4. 1423, 1424, 1425 and 1426 are FGSC stocks.  Methods for plasmid transfer: The plasmid transfer has been attempted using different methods as described below. 1. Hyphal contact. Transfer of a linear mitochondrial plasmid was observed between distantly related fungi upon hyphal contact (Kempken, 1995). The plasmid-containing Ascobolus immersus strain 2/1 was grown together with the plasmid-free Podospora anserina strain s- in petri dishes. An incompatible reaction between the two strains was observed as a clear cut zone at  32  the hyphal contact region. P. anserina mycelia were removed at different timepoints for DNA analysis. The mitochondrial plasmid was found transferred from A. immersus to P. anserina independent of mitochondrial DNA and nuclear DNA, though its stability in the new host was low. The transfer of kalilo plasmid from N. intermedia to N. crassa was accomplished in a similar way (Griffiths et al., 1990). Nonsenescent auxotrophs of N. crassa were grown together with a kalilo-containing auxotrophic N. intermedia strain (2360 his). No true heterokaryons were formed, but the strains grew together and the mycelia intertwined. The kalilo plasmid was later found transferred to the N. crassa strain independent of mtDNA and nuclear DNA. A procedure similar to the ones described above was adapted to transfer LA-kalilo D N A from N. tetrasperma to N. crassa. The plasmid-containing N. tetrasperma strain P4495 was grown together with N. crassa auxotrophs (Table 4) on both slants and petri dishes on supplemented medium. Since the N. crassa strains showed more vigorous growth than the N. tetrasperma strain on supplemented medium, the N. tetrasperma strain was inoculated 12-24 hours prior to the inoculation of the N. crassa strains to synchronize the growth. Yang and Myers (unpublished result) also minimized the growth of auxotrophic N. crassa strains by decreasing the amount of supplements to the medium. N. crassa strains were picked out by testing the auxotrophic markers and existence of kalilo DNA was tested by dot-blot probing.  2. Spheroplast fusion. The mycelial cell wall was removed by Novozyme treatment. Mycelial cells were used because the N. tetrasperma strain made very few conidia. The cell wall-free spheroplasts of plasmid-containing N. tetrasperma (P4495) and plasmid-free N. crassa (704, to,a)were mixed in 40% PEG4000, 0.01M C a C l and 0.05 Tris-glycine, PH 7.6 and incubated at 30 °C 2  to induce cell fusion (Dr. H. Bertrand, personal communication). It was hoped that the L A kalilo plasmid could be transferred through this direct cell contact as in other cases of 33  mitochondrial plasmids, such as the transfer of pClB4 plasmid between Claviceps purpurea strains (Gessner-Ulrich and Tudzynski, 1994). Protoplasts of the C. purpurea plasmid donor strain were mixed with protoplasts of the C. purpurea recipient strain at aratioof 10:1 in 30% P E G 6000, 0.75 mM CaCl^ 0.05 mM glycine, PH 7.5. After 10 minutes incubation at 28 °C, the protoplasts were diluted and plated on appropriate regenerating medium. Plasmid transfer was then detected by mitochondrial DNA analysis. Five transferrants were recovered in 300 colonies tested.  3. Crossing and heterokaryon formation Since LA-kalilo was also found in a N. crassa strain from Haiti (4711), the transfer experiment has been tried intraspecifically. The LA-kalilo-containing wild type N. crassa strain was used as a maternal parent in a cross to an auxotrophic N. crassa strain of Oak Ridge background (2-17-825 ad-3A, a). The plasmid should hence be passed to all ascospore progeny. The ascospore progeny with the auxotrophic marker could then be used to make forced heterokaryons with N. crassa lab strains with different auxotrophic markers (Table 4). The plasmid was expected to be transferred through heterokaryon formation or transient hyphal fusion.  Dot-blot hybridization: Total D N A was extracted by grinding mycelia harvested from overnight liquid culture with acid-washed sand. Cells and mitochondria were lysed with L E T S buffer (0.1 M Li CI, lOmM E D T A , lOmMTris-HCl and 0.5% SDS). Sand and cell wall debris were removed by centrifugation at 12,000rpm for 5 minutes. The supernatants containing fungal D N A were then transferred to nylon membrane using a dotblot apparatus from BioRad.  32  P-dCTP  labelled kalilo DNA 8.2 Kb Kpn I fragment cloned in pUC 18 vector was used to probe the filter.  34  Results The attempt to transfer LA-kalilo plasmid to lab strains of N. crassa has had limited success so far. Some N. crassa transferrants have been obtained, but they all proved to be unstable.  Hyphal contact: When the wild-type plasmid donor strain was grown together with auxotrophic N. crassa strains on supplemented medium, the N., crassa strains always grew much faster and better than the N. tetrasperma strain and they soon dominated the culture. This may be due to faster hyphal growth or better conidiatioh of'N. crassa strains. The excess amount of N. crassa conidia also made the dot-blot screening for plasmid transferrants laborious work. About 2000 N. crassa colonies were isolated and tested by dot-blot hybridization. However, no plasmid transferrant was detected. It is possible that the N. tetrasperma strain died out before any hyphal interaction could take place to allow the plasmid transfer. Spheroplast fusion: Over 300 N. crassa regenerants were tested by dot-blotting. Six possible LA-kalilo plasmid transferants were identified by a positive signal on dotblot hybridization (data not shown). When these potential transferants were subcultured and subject to mtDNA analysis, no plasmid DNA was detected even by Southern hybridization (data not shown). Cross and heterokaryon formation: An auxotrophic marker ad-3A was introduced into the LA-kalilo-plasmid-containing strain by crossing the wild type N. crassa strain 4711 to an adenine-requiring lab strain 2-17825 (a, ad-3A). The plasmid-containing strain was used as maternal parent. Six ascospore progeny with the ad-3A marker and the appropriate mating type were selected and used to make forced heterokaryons with a N. crassa lab strain containing ad-3B and cot markers (Table 4). No heterokaryon was formed though limited hyphal growth of the N. crassa strain was observed in some tubes. This limited growth could be due to either back mutation of the  auxotrophic markers, or cross-feeding between different strains. The growing N. crassa mycelia were subcultured and subject to dot-blot hybridization analysis, but no plasmid transfer was detected. Plasmid transfer was also attempted using Gel-kalilo DNA (X. Yang and G.A. Kuldau, unpublished results). Both methods of hyphal contact and spheroplast fusion were tried and proved to be unsuccessful.  Discussion The transfer of mitochondrial plasmids independent of mtDNA and nuclear DNA has been reported both intraspecifically (Debets, et al., 1994; Gessner Ulrich and Tudzynski, 1994; Collins and Saville, 1990) and interspecifically (Griffiths etal., 1990) in filamentous fungi. Recent work by Kempken (1995) showed that the mitochondrial plasmid could also be transferred between distantly related fungi, such as the discomycete Ascoblolus immersus and the pyrenomycete Podospora anserina, though the plasmid had low stability in the new host strain. These studies suggest that mitochondrial plasmids can be transferred independent of mitochondrial and nuclear DNA upon rare and unstable hyphal interaction. Therefore it is conceivable that horizontal transfer may contribute to the current distribution pattern of linear plasmids in fungi. However, in the present work, the attempt to transfer LA-kalilo plasmid from N. tetrasperma to standard lab strains of N. crassa with Oak Ridge background proved to be unsuccessful. Three different methods were used. These were: hyphal contact, spheroplast fusion, and heterokaryon formation following introduction of a suitable forcing marker. Altogether 2300 N. crassa colonies were screened and only 6 possible plasmid transferants were picked up by dot-blot probing. But when these possible transferrants were subcultured and subjected to mtDNA analysis, no plasmid DNA could be detected by Southern hybridization. If this observation is not due to an artifact of the dot-blot procedure, it must reflect the extremely unstable nature of LA-kalilo plasmid in the new host. Similar findings 36  was also reported by Kempken (1995). In his work of transferring a mitochondrial plasmid between two distantly related fungi, the plasmid had a considerably lower copy number in the new host fungus, and the amount was soon reduced to a level that was detectable,only by PCR amplification. The low stability of transferred plasmids suggests that maintenance of a plasmid in a certain fungal host may require compatibility between mitochondrial DNA, nuclear DNA and plasmid. It is possible that maintenance of the kalilo plasmid requires certain products from the mitochondrial DNA, such as the replication machinery since there is yet no evidence that the kalilo plasmid is using its own DNA polymerase for replication. Plasmid incompatibility due to failure in replication has long been noticed. In bacteria, when two plasmids are both present in a cell and their replication is subject to a common regulation, either one will be lost (Broda, 1979). Plasmid incompatibility with mtDNA was observed in yeast (Gunge and Yamane, 1984). The linear killer plasmids p G K L l and pGKL2 from Kluyveromyces lactiswere stable when transferred to a [rhoP] petite mutant of Saccharomyces cerevisiae lacking mitochondrial DNA.  But they became unstable and were lost when mitochondria of a wild type strain  ([rho ]) of S. cerevisiae was introduced into the same cell. Incompatibility between plasmids +  from K. lactis and mitochondrial DNA from S. cerevisiae was a reasonable explanation for this phenomenon. It was proposed that a replication advantage of mitochondrial D N A over p G K L plasmids may account for this incompatibility between mtDNA and foreign plasmid. Incompatibility may also occur between plasmid and nuclear genes. One example is the plasmid suppressors found in the nuclei of Neurospora that may eliminate plasmids to a barely detectable level. The molecular mechanism underlying this process is not clear yet (Griffiths et al., 1992; Yang and Griffiths, 1993). Other examples are the nuclear morphological mutants which have life-prolonging effect in Podospora, such as the double mutants incoloris vivax (i viv) and grisea vivax (gr v/v). Small amounts or even no senescence-inducing mitochondrial DNA elements could be detected in these strains (Tudzynski and Esser, 1979; Tudzynski et al., 1980). 37  In addition to plasmid incompatibility with the mitochondrial DNA and nuclear DNA, another possible reason for the failure in obtaining LA-kalilo plasmid transferrants in the present work is the wide-spread heterokaryon incompatibility between different fungal strains. Reduced horizontal transfer efficiency was noticed in previous work on the transfer of kalilo plasmid between incompatible JV; intermedia strains and between incompatible N. crassa strains (Debets et al., 1994). The same phenomenon was also observed in the horizontal transfer of a virus-like double-stranded RNA between incompatible strains of the chestnut blight ascomycete Cryphomectria parasitica (Anagnostakis, 1982). Heterokaryon incompatibility is an ubiquitous phenomenon in filamentous fungi. Studies in N. crassa showed that the heterokaryon genes are highly polymorphic in the natural populations (Mylyk, 1976). It was proposed that heterokaryon incompatibility may provide an efficient way to inhibit the spread of harmful cytoplasmic elements among populations (Caten, 1972; Begueret etal, 1994). In summary, due to the failure in transferring kalilo-like plasmids into standard lab strains of N. crassa, comparison of plasmid function can not yet be made only at the plasmid level. The mechanisms of plasmid insertion and senescence remain open questions. Stable plasmid horizontal transfer must be a rare event as shown by previous and present work. The transfer efficiency can be greatly reduced by the widespread vegetative incompatibility between different fungal strains. Transferred plasmids may also be eliminated from the new host due to its incompatibility with the mitochondrial genome or nuclear genome. Hence, although horizontal transfer between incompatible strains and different species remains a distinct possibility, the present results suggest that this is not a common occurrence even under conditions designed to maximize transfer. Therefore, it is unconvincing to involve horizontal transfer as an explanation of present distribution pattern of kalilo-related plasmids in nature.  38  Summary Four types of kalilo-related plasmids have been identified in world-wide collected isolates of Neurospora andGelasinospora (Table 3). The phylogeny of these kalilo-related plasmids coincides roughly to the established taxonomy of their host strains based on morphological and molecular studies. This is a strong evidence for the in situ evolution of kalilo-related plasmids with their fungal hosts. Transfer of kalilo-like plasmids to Neurospora crassa standard lab strains has had limited success in the present work. Only six unstable transferrants were selected by dotbloting hybridization in a sample size of 2300 colonies. The plasmid was lost during subculture. The failure to obtain stable plasmid transferrants may be due to plasmid incompatibility with mitochondrial genome or nuclear genome. The widespread heterokaryon incompatibility in filamentous fungi could also inhibit the efficient horizontal transfer of mitochondrial plasmids. Based on these observations, it may be concluded that the distribution pattern of kalilorelated plasmid was formed by long-time in situ evolution starting before the divergence of Neurospora!Gelasinospora genera and the divergence of Neurospora species. Plasmids were then lost from some strains by chance or by suppressor mutations (Griffiths et al., 1992; Yang and Griffiths, 1993). However, horizontal transfer may contribute to the distribution of plasmids in a few cases, especially plasmid distribution in closely related species ( such as kalilo plasmid and LA-kalilo plasmid in N. intermedia, N. crassa and N. tetrasperma) and in a population of one single species (such as the distribution of kalilo plasmid among the Hawaiian islands population of iV. intermedia).  Due to the failure in transferring kalilo-like plasmids into standard lab strains of N. crassa, comparison of plasmid function can not yet be made at the plasmid level. The mechanisms of plasmid insertion and senescence remain open questions. So far only the type I kalilo plasmids showed consistent correlation with the onset of insertion-induced senescent  39  phenotype. The correlation between senescence and other kalilo-like plasmids is not clear. Senescence may be caused by reasons other than plasmid insertion as observed in the cases of LA-kalilo-containing N. tetrasperma (Marceko-Kuehn et al., 1994) and Gel-kalilo-containing Gelasinospora (Yuewang et al., 1996). Senescence is a complicated process. Beside the plamid, certain genes in mtDNA and nuclear DNA may also be involved.  40  Bibliography Anagnostakis S.L., 1982. Biological control of chestnut blight. Science 215:466-471 Arganoza M.T., Min J., Hu Z. and Akins R.A., 1994. Distribution of seven homology groups of mitochondrial plasmids in Neurospora: evidence for widespread mobility between species in nature. Curr. Genet. 26:62-73 Begueret J., Beatrice T. and Corinne C , 1994. Vegetative incompatibility in filamentous fungi: het genes begin to talk. Trends in Genetics 10(12):441-446  Belcour L . and Begel O., 1980. Life-span and senescence in Podospora anserina. J. Gen. Microbiol. 119:505-515 Bertrand H . , Chan B. and Griffiths A.J.F., 1985. Insertion of a foreign nucleotide sequence into mitochondrial DNA causes senescence in Neurospora intermedia. Cell 41:877884 BrodaP., 1979. Plasmids. pp47-76. W.H.Freeman and Company Ltd.  Caten C . E . , 1972. Vegetative incompatibility Microbiol. 72:221-229  and cytoplasmic infection in fungi. J. Gen.  Chan B.S., Court D.A., Vierula P.J. and Bertrand H.,1991. The Kalilo linear senescenceinducing plasmid of Neurospora is an invertron and encodes DNA and RNA polymerases. Curr. Genet. 20:225-237  Collins R.A. and Saville B.J., 1990. Independent transfer of mitochondrial chromosomes and plasmids during unstable vegetative fusion in Neurospora. Nature 345:177-179  Court D.A., Griffiths A.J.F., Kraus S.R., Russell P.J. and Bertrand H . , 1991. A new senescence-inducing mitochondrial linear plasmid in field-isolated Neurospora crassa strains from India. Curr. Genet. 19:129-137 Dasgupta J., Chan B.S., Keith M.A. and Bertrand H . , 1988. Kalilo insertion sequences from the senescent strains of Neurospora intermedia are flanked by long inverted repeats of mitochondrial DNA. Genome 30 (Suppl. 1):318  Davis R.H., deSerres F.J., 1970. Genetic and microbiological crassa. Meth. Enzymol. 17A:79-143  techniques for  Neurospora  41  Debets F., Yang X. and Griffiths A.J.F., 1994. Vegetative incompatibility in Neurospora: its effect on horizontal transfer of mitochondrial plasmids and senescence in natural populations. Curr. Genet. 26:113-119 Debets F., Yang X. and Griffiths A.J.F., 1995. The dynamics of mitochondrial plasmids in a Hawaiian population ofN. intermedia. Curr. Genet. 29:44-49 . Devereux J., Haeberli P. and Smithies O., 1984. A comprehensive set of sequence analysis programs for the VAX. Nuc. Acids Res. 12(l):387-395 Dodge B.Q., 1927. Nuclear phenomena associated with heterothallism and homothallism in  the ascomycetes Neurospora. J. Agric. Res. 35:289-305 Esser K., Tudzynski P., Stahl U.and Kuck U.,1980. A model to explain senescence in the filamentous fungus Podospora anserina by the action ofplasmid-like DNA. Mol. Gen. Genet. 178:213-216 Gessner-Ulrich K. and Tudzynski P., 1994. Studies on Junction and mobility of mitochondrial plasmids from Claviceps purpurea. Mycol. Res. 98(5):511-515  Glass N.L., Vollmer S.J., Staben C , Grotelueschen J., Metzenberg R.L. and Yanofsky C , 1988. DNAs of the two mating-type alleles of Neurospora crassa are highly dissimilar. Science 241:570-573  Griffiths A.J.F., 1992. Fungal senescence. Annu. Rev. Genet. 26:351-372 Griffiths A.J.F., 1995. Natural plasmids of filamentous fungi. Microbiol. Rev. 59(4):673685 Griffiths A.J.F., and Bertrand H, 1984. Unstable cytoplasms in Hawaiian strains of  Neurospora intermedia. Curr. Genet. 8:387-398  Griffiths A.J.F., Collins R.A. and Nargang F.E., 1995. Mitochondrial genetics of Neurospora. The Mycota II, genetics and biotechnology, pp 93-105 Springer-Verlag Berlin Heidelberg. Griffiths A.J.F., deLange A.M. and Jung .J.H., 1974. Identification of a comples chromosome rearrangement in Neurospora crassa. Can. J. Genet. Cytol. 16:805-822  Griffiths A.J.F., Kraus S.R, Barton R , Court D.A., Myers C.J. and Bertrand H., 1990. Heterokaryotic  transmission of senescence plasmid DNA in Neurospora.  Genet. 17:139-145  Curr.  42  Griffiths A.J.F., Kraus S.R., Bertrand H., 1986. Expression of senescence in Neurospora intermedia. Can. J. Genet. Cytol. 28:459-467  Griffiths A.J.F., Yang X., Barton R. and Myers C , 1992. Suppression of cytoplasmic senescence in Neurospora. Curr. Genet. 21:479-484 Gunge N. and Yamane C , 1984. Incompatibility of linear DNA killer plasmids pGKLl and, pGKL2 from Kluyyveromyces lactic with mitochondrial DNA from Saccharomyces cerevisiae. J. of Bacterid. 159(2):533-539 Jacobson D.J., 1991. Control of mating type heterokaryon incompatibility Neurospora crassa and N. tetrasperma. Genome 35:347-353 Kempken F., 1995. Horizontal transfer of a mitochondrial plasmid. 248:89-94  by the tol gene in  Mol. Gen. Genet.  Mailing H.V. and deSerres F.J., 1968. Correlation between base-pair transition and complementation patterns in nitrous acid-induced ad-3B mutants of Neurospora crassa. Mutation Res. 5:359-371  ManiatisT., Fritsch E.F., Sam brook J., 1982. Molecular cloning: a laboratory manual. Cold Spring harbor Laboratory, Cold Spring Harbor, New York Marcinko-Kuehn M . , Yang X . , Debets F , Jacobson D.J. and Griffiths A.J.F., 1994. A Kalilo-like linear plasmid in Lbusisiana field isolates of the pseudohomothallic fungus Neurospora tetrasperma. Curr. Genet. 26:336-343 Meinhardt F, Kempken, KamperJ. and Esser K., 1990. Linear plasmids among eukaryotes:fundamentals and application. Curr. Genet. 17:89-95  Merino S.T., Nelson M.A., Jacobson D.J. and Natvig D.O., 1996. Pseudohomothallism evolution of the mating-type chromosome in Neurospora tetrasperma. Genetics 143:789-799  and  Metzenberg R.L. and Glass N.L., 1990. Mating type and mating strategies in Neurospora. BioEssays 12:53-59 Myers C.J., 1988. Transmission of Kalilo DNA in senescent strains of Neurospora intermedia. Ph.D. thesis, the University of British Columbia, Canada  43  Mylyk O.M., 1976. Heteromorphism for heterokaryon incompatibility populations of Neurospora crassa. Genetics 83:275-284  genes in natural  Nargang F . E . , Bell J.B., Stohl L . L . and Lambowitz A . M . , 1984. The DNA sequence and genetic organization of a Neurospora mitochondrial plasmid suggest a relationship to i ntrons and mobile elements. Cell 38:441-453 Navtig D.O., May G. and Taylor J.W., 1984. Distribution and evolutionary significance of mitochondrial plasmids in Neurospora spp. J. Bacteriol. 159(l):288-293 Perkins D.D.,1988. Main features of vegetative incompatibility Genetics Newsletter 35:44-46  in Neurospora.  Perkins D.D., 1992. Neurospora: the organism behind the molecular revolution. 130:687-701  Fungal  Genetics  Perkins D.D., Radford A , Newmeyer D and Bjorkman M , 1982. Chromosomal loci of Neurospora crassa. Fungal Genetics Newsletter 33: 15 Perkins D.D., Turner B.C. and Barry E . G . , 1976. Strains of Neurospora collected from nature. Evolution 30:281-313  Randall T.A. and Metzenberg R.L., 1995. Species-specific and mating type-specific regions adjacent to mating type idiomorphs in the genus Neurospora. Genetics 141:119-136  DNA  Taylor J.W., Bruns T.D., White T.J., 1990. Unusual rate of molecular evolution in the ribosomal DNA intermal transcribed spacer region of Sordariaceae? Mycological Society of America Newsletter 41:40-41  Taylor J.W. and Natvig D.O., 1989. Mitochondrial DNA and evolution of heterothallic pseudohomothallic Neurospora species. Mycol. Res. 93(3):257-272  and  Taylor J.W., Smolich B.D. and May G., 1985. An evolutionary comparison of homologous mitochondrial plasmids DNAs from three Neurospora species. Mol. Gen.Genet. 201:161-167  Taylor J.W., Smolich B.D. and May G , 1986. Evolution of mitochondrial Neurospora crassa. Evolution 40:716-739  DNA in  Tudzynski P. and Esser K., 1979. Chromosomal and extrachromosomal control of senescence in the ascomycete Podospora anserina. Mol. Gen. Genet. 173:71-84  44  Tudzybnski P., Stahl U., Esser K., 1980. Transformation to senescence withplasmid-like DNA in the ascomycete Podospora anserina. Curr. Genet. 2:181-184 Vierular P.J., Cheng C.K., Court D.A., Humphrey R.W., Thomas D.Y. and Bertrand H . ,  1990. Tlve kalilo senescence plasmid of Neurospora intermidia has covalently-linked 5' terminal proteins. Curr. Genet. 17:195-201  Vickery D.B. and Griffiths A.J.F., 1993. Transcription of the kalilo linear senescence plasmid from Neurospora intermedia. Plasmid 29:180-192 Wehneyer L . E . , 1975. Garden.  The Pyrenomycetous fungi, pp 127-132, The New York Botanical  Yang X. and Griffiths A.J.F., 1993. Plasmid suppressors active in the sexual cycle of Neurospora intermedia. Genetics 135:993-1002 Yuewang W., Yang X. and Griffiths A.J.F., 1996.  Structure of a Gelasinospora linear  plasmid closely related to the Kalilo plasmid of Neurospora intermedia. Curr. Genet. 29:150-158  45  Appendix I Sequence alignments of the TIR of kalilo plasmid ( sequence data taken from Chan et al., 1991) with the TIRs of other kalilo-like plasmids. a. b. c. d.  the TIR the TIR the TIR the TIR  of LA-kalilo plasmid in N. tetrasperma strain P4495. of kalilo-like plasmid in N. crassa strain 4711 of kalilo-like plasmid in N. tetrasperma strain 6583 of kalilo-like plasmid in N. discreta strain 6790.  * Identical nucleotide as in kalilo plasmid - Deletion . Nucleotide sequence not determined in the present work Numbers shown above the sequences correspond to numbers in Fig. 6.  Sequence alignment of a and b with TIR of kalilo: 7327 Kalilo  a  GGTTGCGTGC GAATTCCTCA TATTAATGCG ATAATTGAAA  ********** ********** ********** ***_******  AAAGAAAATT  **********  b 7377 Kalilo  a  TGCTCATGAT AAAAATATTT AATATAAATT ATGTTCTTTT ACGTCGTAGC  ********** ********** ********** **********  **********  b 7427 Kalilo b  CTTTCTATAC ACTCCATTTA GTTTTGGAAA TAAGGCACCC TTTCCTCTAA ********** ********** ********** ********** ********** ***** **********  Kalilo .  GATAATGGGG GCGGATAAAA  b  ********** ********** ********** **********  Kalilo  AGATCCCATA CCTCACGGTA TGGATAATTC GGCATTTCAG TAGACGACTT  b  ********** ********** ********** **********  Kalilo _ b  TTTTGTTTAA GATTTTTTTG GGAAAACCCA AAAGTGATAA ACAACTAGCC ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  Kalilo  AGATTCTCCC CAATTATGGC CGTGCCTTAT ACTTTTTATC ATATACTAGG  b  ********** ********** ********** **********  Kalilo  a  GACTTATATA ATAAAATTCT AGTATAGTTT TGTCACCAAT ATTTTAAGAA  ********** ********** ********** **********  **********  b  ********** ********** ********** **********  **********  a  7477  a  CATAAAAGCC ACTTTCCCCC AAGCGGGCGT  ********** ********** ********** **********  **********  ********** 7527  a  ********** ********** ********** **********  **********  ********** 7577  7627  a  ********** ********** ********** **********  **********  ********** 7677  46  7727  Kalilo a' b  TCAGTCTACC CTCTACAATT GAATAGATTG TTATATGAAA AATAAAATTT ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  Kalilo a b  CTTATAAGTC TATTTATTTC TTTTTTATTT TTGGTTTCTA CCCTTTTATT ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  Kalilo a b  AAATTGGATT CTTTCGGGTC CCATTCATAA TCAACCTACA GGTTATGGTC ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  7827  Kalilo Vj  TTTCACCACT TCCCCGCTCA CTGCATTGAC CGCACGTAGC AAACTTA-T*C******** ********** * * * * * * * * * * IJ>^*****_** _ T T * * * * C * A * Q * * * * * * * * * * * * * * * * * * * * * * * * * * * * >pA***** —** _ipip****c*^  7875  A  7777  7924  Kalilo a  TGTTATCCTT TCCTCTTTCA TTTGCGTACA ATTACGGTTT ACATTATTA** _,**** ***** Q  Kalilo a b  TGAGTAGATT TCAGCTCCCT TCACGCCACT AATTGCTATT GGGGTCATCT ********** ********** ********** ********** **********  7974  Kalilo a b  ACGGACCT-C TTCTCCCCCT TTCACCATAC AGGTACTTCG TTTTGCTTTT **^*****C* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * **^*****C* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *  8023  Kalilo a b  CCCTGTAGAT TACTTGCACT TTAGGTTCTC TTACTCAGTC TGCGGTACTT ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  8073  Kalilo a b  CTTAGACAAT ACTGTACTCA CAGGCCTTTC TTCGCTGCTC AGTTCTAAAG ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  8123  Kalilo a b  TTAGTCCTGG TTGATTTATT TACTGTTACT TTTGGTTTCC TTTTTAATAA ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  8173  Kalilo a b  AAATTGGGAT TTTTTCTATT TATCAAGTCG AGGGTTCGTT CTGGTTCATT ********** ********** ******************** ********** ********** ********** ********** ********** **********  8223  ***j^  **********  ****  **********  **********  **********  *****  (j  **********  47  Kalilo a  b  ACTATCGATC ACCGTACTCT GTTTTCTGGA TATTCTAAGC CTCAGTTATT ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  Kalilo a  GGCCTTCAGA TTCCCCAGCC CTGCGCCTTC AATAGTGGGA TGTTCTAGAA ********** ********** ********** ********** **********  8323  b  ********** ********** ********** **********  Kalilo a  TAAATCTTCC AGTTCGCTTA AATTCACTCA TGGACATTAC ATTGAATACT ********** ********** ********** ********** ********** ********** ********** ********** *********£ **********  b  **********  TTCCCTTAGC AACCGTGTGT CTCTTAGACA ATACCACACA ********** ********** ********** ********** ********** ********** ********** **********  Kalilo a  TACCCAGATT TAATAATGCT ACCCACTACC CTGATTGTAT CCCTGGAATC ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  Kalilo a  ATTACTCAAG GTGGGATATT CTACCCCACC ATGGGGCGAT AAAGACGTTT ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  Kalilo a  ATCTCCCCAT TAGGGTGTGG TATAAAAATG AAAAAATCAA AAAGAGAGAG ********** ********** ********** ********** ********** ********** ********** ********** ********** **********  b  b  b Kalilo a  b Kalilo a  8373  8423  Kalilo a  b  8273  CGTACACCGG ********** **********  8473  8523  8573  TACTAGAAAT GATAAAAAGA TCACAAAGGG TTAAAATAGG AACAAAAGGG ********** ********** * * * * * * Q * * * ********** ********** * * * * * * * * * * ********** ***** * * **********  * * * * * *ip* * *  GTCAGTGGTG CCCCTTACAC ********** ********** **GC****** **TA******  8643  48  Sequence alignment of c with TIR of kalilo plasmid: AAAGAAAATT  7327  Kalilo c  GGTTGCGTGC GAATTCCTCA TATTAATGCG ATAATTGAAA  Kalilo c  TGCTCATGAT AAAAATATTT AATATAAATT ATGTTCTTTT ACGTCGTAGC  Kalilo c  CTTTCTATAC ACTCCATTTA GTTTTGGAAA TAAGGCACCC TTTCCTCTAA  Kalilo  GATAATGGGG GCGGATAAAA  Q  ********** ********** ********** ********** **********  7377  7427  Kalilo  CATAAAAGCC ACTTTCCCCC AAGCGGGCGT  AGATCCCATA CCTCACGGTA TGGATAATTC GGCATTTCAG TAGACGACTT  7477  7527  Q  ********** ********** ********** ********** **********  Kalilo  TTTTGTTTAA GATTTTTTTG GGAAAACCCA AAAGTGATAA ********** ********** ********** **********  Kalilo  AGATTCTCCC CAATTATGGC CGTGCCTTAT ACTTTTTATC ATATACTAGG ********** ********** ********** ********** **********  c  Kalilo c  ACAACTAGCC **********  GACTTATATA ATAAAATTCT AGTATAGTTT TGTCACCAAT ATTTTAAGAA ********** ********** ********** ********** **********  7577  7627  7677  7727 Kalilo c  TCAGTCTACC CTCTACAATT GAATAGATTG TTATATGAAA AATAAAATTT  Kalilo c  CTTATAAGTC TATTTATTTC TTTTTTATTT TTGGTTTCTA CCCTTTTATT ********** ********** ********** ********** **********  Kalilo  AAATTGGATT CTTTCGGGTC CCATTCATAA TCAACCTACA GGTTATGGTC  ********** ********** ********** **********  ********** 7777  7827  Q  ********** ********** ********** ********** **********  Kalilo  TTTCACCACT TCCCCGCTCA CTGCATTGAC CGCACGTAGC AAACTTATTG ********** ********** ********** ********** **********  c  7877  7927 Kalilo c  Kalilo c  TTATCCTTTC CTCTTTCATT TGCGTACAAT TACGGTTTAC ATTATTATGA ********** ********** ********** ********** **********  GTAGATTTCA GCTCCCTTCA CGCCACTAAT TGCTATTGGG GTCATCTACG ********** ********** ********** ********** **********  7977  49  8027 Kalilo  GACCTCTTCT CCCCCTTTCA CCATACAGGT ACTTCGTTTT GCTTTTCCCT  Kalilo  GTAGATTACT TGCACTTTAG GTTCTCTTAC TCAGTCTGCG GTACTTCTTA  el  * * * * * * * * * *  Kalilo  GACAATACTG TACTCACAGG CCTTTCTTCG CTGCTCAGTT CTAAAGTTAG  C  * * * * * * * * * *  Kalilo  TCCTGGTTGA TTTATTTACT GTTACTTTTG GTTTCCTTTT TAATAAAAAT ********** ********** ********** ********** **********  r>  ********** ********** ********** **********  **********  8077  C  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  8127  * * * * * * * * * *  8177  8227 Kalilo c  TGGGATTTTT TCTATTTATC AAGTCGAGGG TTCGTTCTGG TTCATTACTA ********** ********** ********** ********** **********  Kalilo  TCGATCACCG TACTCTGTTT TCTGGATATT CTAAGCCTCA GTTATTGGCC  <1  * * * * * * * * * *  Kalilo c  TTCAGATTCC CCAGCCCTGC GCCTTCAATA GTGGGATGTT  CTAGAATAAA  ********** ********** ********** **********  **********  Kalilo  TCTTCCAGTT CGCTTAAATT CACTCATGGA CATTACATTG AATACTTTCC  Kalilo  CTTAGCAACC GTGTGTCTCT TAGACAATAC CACACACGTA CACCGGTACC ********** ********** ********** ********** **********  r>  c  **********  * * * * * * * * * *  **********  * * * * * * * * * *  **********  * * * * * * * * * *  **********  8277  * * * * * * * * * *  8327  8377  **********  8427  8477 Kalilo c  CAGATTTAAT AATGCTACCC ACTACCCTGA TTGTATCCCT GGAATCATTA  Kalilo  CTCAAGGTGG•GATATTCTAC CCCACCATGG GGCGATAAAG ACGTTTATCT  c  **********  Kalilo  CCCCATTAGG GTGTGGTATA AAAATGAAAA  AATCAAAAAG  AGAGAGTACT  Kalilo <-•  AGAAATGATA AAAAGATCAC AAAGGGTTAA AATAGGAACA ********** ********** ********** **********  AAAGGGGTCA **********  Kalilo (-  GTGGTGCCCC TTACAC ********** ******  ********** ********** ********** **********  ********** 8527  **********  **********  **********  **********  8577 r-  ********************  **********  **********  **********  8627  8643  50  Sequence alignment of d with TIR of kalilo plasmid:  7327 Kalilo d  GGTTGCGTGC GAATTCCTCA TATTAATGCG ATAATTGAAA  AAAGAAAATT  Kalilo d  TGCTCATGAT AAAAATATTT AATATAAATT ATGTTCTTTT ACGTCGTAGC **********  Kalilo d  CTTTCTATAC ACTCCATTTA GTTTTGGAAA TAAGGCACCC TTTCCTCTAA ********** ********** ********** ********** **********  Kalilo d  GATAAT-GGG GGCGGATAAA ACATAAAAGC CACTTT-CCC CCAAGCGGGC ******Q*** ********** ********** ******£*** **********  Kalilo d  GTAGATCCCA TACCTCACGG TATGGATAAT TCGGCATTTC AGTAGACGAC ********** ********** ********** ********** **********  Kalilo  — T T T T T T G T TTAAGATTTT TTTGGG-AAA ACCCAAAAGT  GATAAACAAC  ip>Jl * * * * * * * *  * * * * * * * * * *  7377  7427  * * *  **J^**  * * * * * * ^ * * *  * Q * * * * * * * *  Kalilo d  TAGCCAGATT CTCCCCAATT ATGGCCGTGC CTTATACTTT TTATCATATA ********** ******_*** ********** ********** **********  Kalilo  CTAGGGACTT ATATAATAAA ATTCTAGTAT AGTTTTGTCA CCAATATTTT  Kalilo d  AAGAATCAGT CTACCCTCTA CAATTG-AAT AGATTGTTAT ATGAAAAATA ********** ********** ********** ********** ***** *  Kalilo d  AAATTTC-TT ATAAGTCTAT TTATTTCTTT TT-TATTTTT GGTTTCTACC * * * _ * * * * * j ^ ********** * * _ * * * * * * * * * ^ * I J > * * *  Kalilo d  CTTTTATTAA ATTGGATTCT TTCGGGTCCC ATTCATAATC AACCTACAGG . '—:  Kalilo d  TTATGGTCTT TCACCACTTC CCCGCTCACT GCATTGACCG  Kalilo d  ACTTATTGTT ATCCTTTCCT CTTTCATTTG CGTACAATTA CGGTTTACAT  Kalilo d  TATTATGAGT AGATTTCAGC TCCCTTCACG CCACTAATTG CTATTGGGGT  d  **********  **********  **Q*******  **********  7475  7525  7572  7622  7672  **********  CACGTAGCAA  7721  7769  7819  7869  7919  7969  51  Kalilo d  CATCTACGGA CCTCTTCTCC CCCTTTCACC ATACAGGTAC TTCGTTTTGC • •  8019  Kalilo d  TTTTCCCTGT AGATTACTTG CACTTTAGGT TCTCTTACTC AGTCTGCGGT  8069  Kalilo d  ACTTCTTAGA CAATACTGTA CTCACAGGCC TTTCTTCGCT GCTCAGTTCT  8119  Kalilo d  AAAGTTAGTC CTGGTTGATT TATTTACTGT TACTTTTGGT TTCCTTTTTA  8169  Kalilo d  ATAAAAATTG GGATTTTTTC TATTTATCAA GTCGAGGGTT CGTTCTGGTT •  8219  Kalilo d  CATTACTATC GATCACCGTA CTCTGTTTTC TGGATATTCT AAGCCTCAGT  8269  Kalilo d  TATTGGCCTT CAGATTCCCC AGCCCTGCGC CTTCAATAGT GGGATGTTCT  8319  Kalilo d  AGAATAAATC TTCCAGTTCG CTTAAATTCA CTCATGGACA TTACATTGAA  8369  Kalilo d Kalilo d  TACTTTCCCT TAGCAACCGT GTGTCTCTTA GACAATACCA CACACGTACA : CCGGTACCCA GATTTAATAA TGCTACCCAC TACCCTGATT GTATCCCTGG _  Kalilo d  AATCATTACT CAAGGTGGGA TATTCTACCC CAGCATGGGG CGATAAAGAC —T***—**** * * * * * * * * * *  Kalilo d Kalilo  GTTTATCTCC CCATTAGGGT GTGGTATAAA AATGAAAAAA -TCAAAAAGA * * * * * * * * * * * * * * * * * * * * *****Q*_** * * * * * * * * * * Q*******ipc  d  GAGAGTACTA GAAATGATAA AAAGATCACA AAGGGTTA-A AAT-AGGAAC ***Q****** ********** ***A*AA**T *T***-**C* ***A*TT**A  Kalilo d  AAAAGGGGTC AGTGGTGCCC CTTACAC  ****  8419  8469  8519  8568  8616  8643  **** *_*******_ _*  52  Appendix II DNA sequence alignment of kalilo DNA, Gel-kalilo DNA and LA-kalilo D N A in the ORFs. The kalilo sequence was taken from Chan et al. 1991. The Gel-kalilo sequence was taken from Yuewang et al., 1996. The sample sequences of LA-kalilo D N A were obtained as described in Chapter 2. a: D N A sequence alignment of ORF1 b: D N A sequence alignment of ORF2 * Identical nucleotide as in kalilo plasmid - Deletion . Nucleotide sequence not determined in the present work Numbers shown above the sequences correspond to numbers in Fig. 6.  Appendix Ila Kalilo Gel-kalilo LA-kalilo  4950 ACTAATCATA TATTTCCCCA TATCTCTTAT ATCTTCAACG TTCAATTG— * * * * * * * * * *  * * * * * i p * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  ***AT 4999 -CCCCATTTG AGGAAGGACT GGTAAAGGTA AATATTCATA TCTTTTGTTA * * * * * * * * * * ********** *****rp**** ****j^***** ****Q(J*Q**  Kalilo Gel—kalilO LA—kalilo  <Ji*********  Kalilo Gel—kalilo LA—kalilo  5049 CCTTTTATTT TAACAAAATC CTCACCATTT TTATTAACAA TCTCTATTTT * * * * * * * * * * ********** j * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ********** ********** * * * * * * * * * * * * * * * * * * * *  Kalilo Gel-kalilo LA-kalilo  5099 ATAATCTTTT AAATTTTCCC TGAATTTATA ATCAATTTTA. TTTAAAAAAT * * * * * * * * * * * * * * * * * * * * * * * * * * * * Q * * * * * * * * * * * c********* * * * * * * * * * * ********** ********** * * * * * * * * * * * * * * * * * * * *  Kalilo Gel-kalilo LA-kalil  5149 CATTTTTAGA GTATAATAAA ATAAAACACT CTCTAACTTG TTCAGCCAAT * * * * * * * * * * ********** ********** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ********** ********** * * * * * * * * * * * * * * * * * * * *  Kalilo Gel-kalilo LA-kalilo  5199 TTATACATAT CATTAGGATG AGTACCAAAA CACTCATGTA TAGGTAAGAT * * * A * * * * * * * * * * * * * * * * T * * T * * * * * * **A******* *T*****A** * * * * * * * * * * ********** ********** **j^******* * * * * * * * * * *  Kalilo Gel-kalilo LA—kalilo  5249 ATAAGAATCT CAACTATCAA TTATCATTGT TAAGTGTGAT GCATCTAATG * * * * * * * * * * ********** * * * ^ * * * * * G ********c* * * * * * * * * * * * * * * * * * * * * ********** ********** * * * * * * * * * * * * * * * * * * * *  Kalilo Gel-kalilo LA—kalilo  5299 AATGAATAAT ATTAGGGATG ATTGCTTGGA CCTCTCTTCT ACTATCTTTT * * * * * * * T * * * * * * * * * * * A * * Q * * * Q * * * *ip******** *********^ * * * * * * * * * * ********** ********** * * * * * * * * * * * * * * * * * * * *  * * * * * * * * _ *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  53  5349  Kalilo Gel-kalilo LA-kalilo  TCATTAACTC AAGATCTTAA TACTGCTGTT CTATTTTTCC CTAGGAAATT ********** ********** ********** ********** ********** ********** ********** ********** **********  Kalilo Gel-kalilo LA-kalilo  TATAGTTAAT TTTTTAACCT TAGATAGATT ATATCTTTGT GTTAACTCTA * * * * * * * * * * ****(;***ip* ******^*** * * * * * * * * * * * * * * * * * * * * ********** ********** ********** ********** **********  Kalilo Gel-kalilo LA—kalilo  AACCATCGGG TGTAGATCAT GATAAAGGAA TATCTAACTT TAAATAGATT *******A** ******_**Q ****TC**** ******Q*** c*****ip*** ********** ********** ********** ********** **********  Kalilo Gel-kalilo LA-kalilo  TTAGCTAAGC GAGTAAGATA GTCATAAATA GAGTGAAGTT TAGGGAATTG ****ip***** * * * * * * * * * * C********* * * * * * * * * * * * * * * * * * * * * ********** ********** ********** ********** **********  Kalilo Gel-kalilo LA-kalilo  ATTGAATATA TTATCATTAA TAATACTAGC CAGAGTTTCA ACTTCAAAGG * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ip********* * * * * * * * * * * ********** ********** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *  Kalilo Gel-kalilo LA-kalilo  TGTCTAGGAC AACAAAGTCACCATTTTTAG TAGGAACTAA ATAATCATAA * * * * * * * * * * ******ip*ip* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ********** ********** ********** ********** **********  Kalilo Gel-kalilo LA-kalilo  ACTTTTATTT CTTTCCCCTTTGAAATAACT ATTTTCTCTA CTTTTTCCAA * * * * * * * * * * * * * * * * * * * * ********ip* * * * * * * * * * * * * * * * * * * * * ********** **********  Kalilo Gel-kalilo LA-kalilo  TTTACTTTTT AACTGTTCTGTAATACCATA TGTAGTAACA TTATAACTTT ******C*** **ip******* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *  Kalilo Gel-kalilo LA-kalilo  TAGTCATAAT AACTTTTTTA AGTAAACTTC TATTAAGAGA GATATCCGAA ********** ********** ********** ********** **********  Kalilo Gel-kalilo LA-kalilo  AATTTAAGAT TTTTAAATTT TTTTTCAGCA GATTCGTTAA TAGCTTTATT *******C** ****^***** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *  Kalilo Gel-kalilo LA-kalilo  5399  5449  5499  5549  5599  5649  5699  5749  5799  5849  TATTGCAGGA ATAAGTTGAG AATAGAAATC GTTTACACTC TCACCACTAT * * * * * * * * * i p  * * * * * * * * r p *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  54  5899 Kalilo Gel-kalilo LA-kalilo  TAATAAGATT AACATATTTT CCCAACTCAA GGTCAAGAAG CATTGCGGCA ********** Q********* ********** *^******** ********** *  Kalilo Gel-kalilo LA_kalilo  AAATGTTGAA CACCACTACA TGTTGCATCA, AGG-AAAATA ********** ********** ********** ********** ********_* ******Q*** ********** ***^******  Kalilo  CTGGGTAATC AGGATTTTCT TTTAATTTCC TCATAGTTAA ACAGAAAGCT G*********  **********  LA—kalilo  ********** ********** ********** **********  **********  Kalilo Gel-kalilo LA—kalilo  GCAAATAATG TTGGAGATTC AGCTTTTAAT ATAAACTCCT TATCCATAGC ********** ********** ********** *****^**** ********** ********** ********** ********** ********** **********  Kalilo Gel-kalilo LA-kalilo  TATTATATTA TCTAAATTTT CAACCACTCA GTTGAATCTA TCTTGAAATG ********** ********** ********** ********** **********  Kalilo Gel-kalilo LA—kalilo  ATTTTTTACT AAATTTACCA CCATCATTAT AAATATTAGC CCCATATAGA ********** * * * * * * * * * * * * I J I * * * * * G * * * * * * * * * * * . * * * * * * * * * * ********** ********** ********** ********** **********  Kalilo Gel-kalilo LA-kalilo  TAGAAAAAGA ATAAACCCTT CTCATCTAAT TTCTTACCTT CAAATAAATT ********** *********Q ^********* ****G***** ********** ********** ********** ********** ********** **********  Kalilo  TATTAAAGCT AAAGATAATT CAGATCCTTG ATAATCAAGA  5948 GGATTAAAAA **********  **********  5998 Gel-kalilo  ******G*** * * * * * * * * * *  **********  6048  6098' ********** ********** ********** **********  **********  6148  6198  6248 Gel—kalilo  **********  **********  **********  ***GC*****  TAGAAAGATT **********  LA—kalilo  ********** ********** ********** **********  **********  Kalilo Gel-kalilo LA-kalilo  GAGTGTAAAT ACGCCCTCTT CAATCTATAT TAACATTTAA ATAAAAGGGA ********** ********** ********** ********** **********  Kalilo  GTATTCAAAT AAGTTCTAGC AATATCTATA GTAATCATAT TATTAATATA  6298 ********** ********** ********** **********  **********  6348 Gel-kalilo  **********  **********  **********  LA-kalilo  ********** ********** ********** **********  *****T****  ********^*  **********  Kalilo Gel-kalilo LA—kalilo  AGTATCTTTT TTAGTATTTT TATAAAAATC TAGAATGAAA  GACCCCTCAT  ********** ********** ********** **********  *****_****  6398  * * * * * * * * * Q *****Q****  ********** **^*******  *****^****  55  Kalilo Gel-kalilo LA-kalilo  6448 TTTGAAGATA AGATAATAAA TCACCATTAA TTTTAAATTT GAAAGCATTT * * * * * * * * * *  * * * * * £ * * * *  * * * Q * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  Kalilo Gel-kalilo LA-kalilo  6498 AATTTATTAA TTACATTATA CAACTTATCA GTTATTGCTA TTTTATGTCT ********** * * * * * * * * * * * * * * * * * * * * Q * * * * * * * * * ********** * * * * * * * * * * * _ * * * * * * * * * * * * * Q * * * * _ * * * * * * * * *  Kalilo  6548 ATGATGAAAT GATCCAACCA CTAAAGATTC ATCTTGAGTA TCAGTTAAAT  Gel-kalilo  *******J^**  **********  **********  *******_**  Q***QC*T**  ***T******  LA—kalilo  ********** ********** ********** Q * * * * * * * * *  Kalilo Gel-kalilo LA-kalilo  6598 TTATAAGATT TCCTCCCCTT ATACCATGTC CTCATGGTAA TGGTGGACAT * * * * * *Q*Q* ********** ********** 2^****jfl<*** ********** ********** ********** ***  Kalilo Gel-kalilo LA-kalilo Kalilo Gel-kalilo LA-kalilo Kalilo Gel-kalilo LA-kalilo Kalilo Gel-kalilo LA-kalilo Kalilo Gel-kalilo LA-kalilo Kalilo Gel-kalilo LA-kalilo Kalilo Gel-kalilo LA-kalilo  **********  6648 CCATTGGAAG AGCTTTTGGA GATATAACTA AACTTTCCAT AATTTCATTT  **********  **********  **********  **********  ********j±*  6698 TCATATTCCT TATTTATTTT TAAAGAATAA ATTTCATTTT CAAACACCCT * * * * * * * * T * ********** ********** ********** ********** 6748 CTCAAAAATA GGATTAAGGG GTGATGTGAA GGTATTAATA AAAATATCAC * * * * * * i p * * *  * * * * * * * * j ^ *  * * * * * * * ^ * *  * * * * * * * * * *  * * * * * * * * * *  6798 CCAATTTTAC AAAAAACCCT ACATCAAATT TATTATAGTT TGAGAAATCA ********** ********** *&******** *******c*c G*G******T 6848 TCAAAGCTCA TAAACTCATC TTTATAGTAT TCTGTGTAAA TATGTCTAGT * * * * * * * * * *  ****_****ip  * * * * * * * Q * *  * * * £ * * * * * *  * * * * * * * * * *  6898 AATACTATAA CCAATTCTAT AGTCTAAATT TGTTAAAGAT GATTTACTAT * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * Q * * * * * * *  * * * * * * * * * *  6948 AACTAGCTAA TAAGTATGAT CATGCGATAA AAATAAATTT CTCATTCACA * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  i p * * * * * * * * *  6998 Kalilo Gel-kalilo LA-kalilo  ATATAATCTT TTAGTGATTT AGATATTTTA TTAAGATTAC CATTACTTTT ********** *********^ ********** ********** ********** : . ..........  Kalilo  ATAAAGCTTT AGAAGATCAA  Gel-kalilo  **********  7048 **********  ATGCTCTATC ATGTATTAAC CTGTGTTTGG ********£*  *********T  **C*******  LA-kalilo  7098 Kalilo  TATACATAGT TGATGTAATA TCAGATTTAA CATCAGTTGA AGGTGTAGCT  Gel-kalilo  Q*********  ****T*****  ********T*  *****A****  **********  LA-kalilo  7148 Kalilo  AGCTTCAATC ATTCCCTCTC AATAATCTCT TGAGCCTTAT GTAGATCCTT  Gel-kalilo  *A********  *****G****  G*********  **G*******  ^A********  TTGAAACATT ATTTAGGAAT  AATGATAATT  ******^***  **********  LA-kalilo  7198 Kalilo  TTTATGCTCA GAAAGAATTT  Gel-kalilo  **********  ********£*  *G********  LA-kalilo  7248 Kalilo  TAGGGTCGCG TTTCTTTTCA GAAGAAAAGT TACGAATATT TTTAAACTCC  Gel-kalilo  ****C**AGA  ***T******  *T********  **********  ***ip*rpTG**  LA-kalilo  7298 Kalilo Gel-kalilo LA-kalilo  GAGTAATTAA ACTTAATAAA ACGGAGGCTG GTTGCGTGCG AATTCCTCAT ********** ********** ********** ********^^ ********** . ..  Kalilo  ATTAATGCGA TAATTGAAAA AAGAAAATTT  Gel-kalilo  **********  7334 **********  **********  GCTCAT *A****AATA  AAATTTTTAA  LA-kalilo  7334 Kalilo Gel-kalilo LA-kalilo  :  ATAAATATTC TGTTCTTTTA CGTCGTAGCC TTTCTATACA CTCCAT  57  Appendix lib Kalilo Gel-kalilo ATGGAGTGTA TAGAAAGGCT ACGACGTAAA AGAACAGAAT ATTTATTTAA LA-kalilo  1309 AAATTTTATT  1369  kalilo ATGAGCAAAT TTTCTTTTTT CAATTATCGC ATTAATATGA GGAATTCGCA Gel-kalilo * * * * T * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * T T C A LA-kalilo  CGCAACCTTG **********  Kalilo GGAAGCCTCC CTTGTTTTAT Gel-kalilo * C * * * * * * * * * * A * * * * * * * LA-kalilo  TAAGTTTAAT **********  TATTTATCTT **********  CCTCTTCACA ******T*A*  CTCAAAATTT ******T***  Kalilo TATAGTACTT Gel-kalilo * * * * * * * * * * LA-kalilo  ACCCATGGGA **********  CATATTGTAT **********  CAGCTAGTAA **********  ATCTTCATGA **********  1429  1489 CAACTGATTC **********  1549  Kalilo TATAATTATT ATTCACATAA AAATTATGAT CCTTTAACAA GAGAATCATT TCATGATGAA ********** ***J^**T**C CTTTT***** AG*AA***** Gel-kalilo LA-kalilo  * * * * * * * * * * T****QipQ**  1609 Kalilo CTAAGAGCCT TTATTTCATT ATATAAAAAA CAATTCAAAG AAGAAAAGTT Gel-kalilo * * * * * * * * * * * * * * * * * * * * ********** LA-kalilo  TTTTTTTATG  Kalilo CTAAGAGGCT TTATTTCATT Gel-kalilo * * * * * * * * * * * * * * * * * * * * LA-kalilo  TTTTTTTATG  ********** ********** ****j^***** 1669  ATATAAAAAA CAATTCAAAG AAGAAAAGTT * * * * * * * * * *  * r p * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  GAGGCTATTA *CC***T***  ATTCAATTTA *********_  TATG—CATA *_*******_  Kalilo CACATACAGG GATTAGTGAG GCTGTTTCAG AACCATTTGA GTATGAGCTC _T**TC**** ********** *******Q** Gel-kalilo * _ * * * C C - LA-kalilo  TTTAGTTTAG  Kalilo ACTGACCCAC TAGAAGTTTT ACGTCTTCTA *AA****A** Gel-kalilo LA-kalilo  ******ip**ip *ip***^****  1727  1787  *^*******«ji * * *ipc* * * *c 1847  Kalilo GAGATGGTTT ACCAAAAGGA AATATTATTT TCACTTTTAA ACCTACAAGT AATCCTAGTA G e l - k a l i l o CTA******* ********** ********** ********** * * * * * * * * j ^ * * * * * * * * j _ ^ g LA-kalilo  1907 Kalilo TTAAAACAAA ATATGAAGCA CATAAATCAA ATATTAAAAG AAATAAAAAT ATTAATTTAT GC******** Gel-kalilo * * * * * * * * * * * * * * * * * ^ A * *T**TG**** *GGA*****T * * * * * * * * * * LA-kalilo  58  1967 CTAAGAAAAA TCCTCTTAAC AAATTTAAGT ATAATGGTTA TACTATACCA AATACCATGG Kalilo * * ^ * * * * * * * Gel-kalilo * * * * * * * * * * * * * * * * * * * * * * Q * * * * * * * * * * * * * * * * * * * * * * * * * * * LA-kalilo 2027 ATCTTTCACA ATGACCCAAC ATTCATTTTA Kalilo Gel-kalilo * * * * * * * * * * ********** * * * * * * * A * * LA-kalilo  TAAATGATGG TAAAAATGCT *T******C* G*********  GTGTCTTTGA **********  2087 ATAATATTAT TAAATCAGGG GTTGATAATA TGACCCTTTC Kalilo Gel-kalilo * * * * * * * * * * ********** A A * * * * * * * * * * * * * * * * * * LA-kalilo  TTTCTTTATC * * * * * * * * * *  ACTATTAACA *******c**  2.147  AAAAATATAA TGAAATTACT GTTTTATTGA ATAATACACC TATTTTCAAG ATTAAAGATG Kalilo ********** G e l - k a l i l o **ipTT*T*** * * * * * * * c * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * LA-kalilo 2207  AAAAAATAAT GTCTGAAGAT GATTTATCTT CTTTTAAAAG AACAATTACA GAAAATGAAC Kalilo ******* *GA*A***** ********** ********** ********** ********** Gel-kalilo LA-kalilo 2267 AGGATAAAGT TTATGTTTTT GAAAATGGAG AAATGGTTTT CTTCAGTGAG AATGTTAAAA Kalilo Gel-kalilo * * * * * * * * * * ********** * * * * * * * * T A * * * * * * * * * * * * * * * c * * * * * * * * * * * * * * LA-kalilo 2327 CTAGTTTTAT AAAGAAAATA ACTCGTCAAG ACTTAATTAA TTTTGAAAAT CCTAAAATTA Kalilo G e l - k a l i l o *G*C****** ***A****** *A******** ********** ********** ********** LA-kalilo 2387  TAACCTTAGA TCTTGAAACT AGAAGTGTTC CAATACATCC TATAAAAGAA GGAAAGGATG Kalilo G e l - k a l i l o ********** ********** ********** ********** ********** ********** LA-kalilo Kalilo Gel-kalilo LA-kalilo  2447 GGAAGGAAGG AAAAGTTGAC TCAATTATGT TTCCTATACT.TATGTCAGTA TACAATGGAA ********AA *******A** *****G**** ********G* *******A** ********** 2507  AATTTGTTAA ATCTTTTCTT TTTAGTCAAT CAGCATGAGA GACTGAAATG ATGAACGCAT Kalilo G e l - k a l i l o ********** ********** ******************** ********** ********** LA-kalilo 2567 TTAAATCTAT TATGTTGAGA AAATATGATG GTTACAAAGT TTATACTCAT AATTTCTCAT Kalilo * * * * * * A * * * * * * * * * * * * * Gel-kalilo * * * * * * * * * * ********** ********** ********** LA-kalilo  59  2627  ATTTTGATGG AATTTTCATC ATTGACATCC TTTCAAGACT CGGTGAGGTA AAACCATTTA Kalilo Gel-kalilo ********** ********** ********** ********** ********** ********** LA-kalilo  2687  TGAGAAATGG TAAAATTTTA AAACTAACTT TTAATTTTAC ACTACCAAAC TCCAAAAGAA Kalilo Gel-kalilo ********** ********** ********** ********** ********** ********** LA-kalilo  2747  AATATACACT TTATTTTATG GATTCTCTGC TTATTTTACC AGATTCTTTG GATAAATTAT Kalilo Gel-kalilo ********** *c*A****** ********** ********** ********** * * j ^ * * * * * * * LA-kalilo 2807  Kalilo CAAATTTTTT TAACAATAAA GTTAAGAAAT TGTTTTTTCC CCATTCATTC CTAGATGATA Gel-kalilo **TTA***r** ********** ****rp****^ GC ******** ********** ********** LA-kalilo 2867  ATACTATTCC CATAAATTAT GTTGGAAAAT GCCCTGATTA TAAGTATTTT CCAAAGGCTT Kalilo Gel-kalilo ***G****T* ********** ********** ********** ********** * * * * * j ^ * * * * LA-kalilo 2927  ATACTGAAGA TTTCACAATT GAACAATATC AAGAATATGC TAATAAATTT AAAAATAATA Kalilo Gel-kalilo G****^**** ********** ***^****** ********** cGG******* ********** LA-kalilo 2987  ATTGAGATTT AAAAAAAGAA TTAATTAAAT ATTGTGAAAT TGATACTATA GCACTTTATC Kalilo Gel-kalilo ********** ********** ********** ********** ********** ********** LA-kalilo 3047  Kalilo AAGTTTTAGT AAGTTTTCAA AGAAAAATTT ATGATAAATT TATGATAGAT TGTACTAAAT Gel-kalilo ********** * *j^* ***** Q * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * LA-kalilo 3107  Kalilo ATCCAACAAT TCCTTCATTA GCATTTGCTA TTTTTAGAAA AAAATATCTT GTTGAAGATA Gel-kalilo ********** ********** ********** ********** ***rp****** *****T**** LA-kalilo 3167  TGATTCCCAA TATTAAATCT AAACTTCATA ATATTATTAA ACTTAGTTAT TTTGGTGGAA Kalilo Gel-kalilo ********** ********** ********** ********** **g******* ********** LA-kalilo 3227  TCTGTGAGCT ATATAAACCA TTCGGAGTTA ATATCAAATC ATATGATGTT AATTCACTTT Kalilo Gel-kalilo ********** ********** * CT ******* ********** ********** ********** LA-kalilo  60  Kalilo ACCCATTCGC CATGAAATAC.TTCAAAATGC CATCTGGAAT TCCTAAATAT *ip******** * * * * * * * * * * Gel-kalilo * * * * * * * * * Q ********fp* LA-kalilo  3287 GTTAAAGGAA  *********Q  3344 Kalilo CGTTACAAAA CATTGTAAGA TTCACA G ATTCTATTTG TGAAGTCCCA TTTGGATTTT G e l - k a l i l o **A**G**** T***AG**A* ****T***** ******c*GA ***GA***** ********** LA-kalilo 3404 Kalilo ATAATGTAAA GGTAAAAACC CCTTTAAATT TAGATAAACC TTTTCTTCCT ACAAGACTTA Gel-kalilo * * * * * * * * * * * * * * * * * Q * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * LA-kalilo 3464 Kalilo ATACACCAGC CGGGACAAGA ACAGCTTTCC CACTTGGTCA ATGAGAAGGT TGATATTTCT G e l - k a l i l o *****g**** ********** ***AT***** ********** ********** ********** ***A****** *********T * * * * * * * * * * * * * * * * * * * * LA-kalilo 3524 Kalilo CTGAGGAAAT ATTGAATGCT ATGAAGCATG GTTATGAATT TGAATTTATA GAGGGTTATT * ******* *c* * * * * *G*<p* * G e l - k a l i l o ********** ********** * * * * * *<p* *********** L A - k a l i l o ********** * * * * * * * * * * ********** ********** * * * * * * * * * * ********** 3584 Kalilo TATTTGAAGA ATCATCTATG TTTGATGAAT ATATAGATCT TTTATACAAT ATTAAAAAAA G e l - k a l i l o ********A* *****A**** *****G***A ********** ********** ********** L A - k a l i l o ********** *****A**** ********** ********** ********** ********** 3644 Kalilo ATTCTCCTAA GGAGTCTCCC TGATACTATA TTTCTAAACT CCTTATGAAC TCTTTATATG G e l - k a l i l o ********** ********** ********** ********** ********** ********** L A - k a l i l o ********** ********** ********** ********** ********** ********** 3704 Kalilo GTCGATTTGG ATTAAATCCC GAGGGGGAGG AAATCTTTAT TACTAGTGAA GAAGAGGGAG G e l - k a l i l o * *A* ****** ********** ********** * * * * *A* * * *********** ********** L A - k a l i l o ********** ********** ********** ********** ********** ********** 3764 Kalilo ATGCAATTAT AGCAACAAAG GAGTATGTAA CAATTACACC TTTATCAAGC GGTAATGTTT G e l - k a l i l o * *AA*C* * * * * *A* * * * *T* ********** ********** • * * * * T * * * i p ********** L A - k a l i l o * * *A* ***** ********** ********** ********** * * * * * * * * * * ********** 3824 Kalilo TAATTTCAGC TAAATTACCT GAAGAAGCAT TTGGAGATAT GAATATATCA GTACCCATTT G e l - k a l i l o ******* * *;p ********** ********** * * * * Q * * * * * ********** ********** L A - k a l i l o ********** ********** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ********** 3884 Kalilo CATCAGCTAT TGCTGCATAC TCTCGAATAC ATATGTCACA TTTTTTAACT AAATATTCAA G e l - k a l i l o ********** ********** * * *A* ***** ********** ******* *A* ********** L A - k a l i l o * * * * * * * * * * * * * * * * * * * * ********** * * * * * * * * * * ********** * * * * * * * * * *  61  3944  Kalilo ATAACATTTA TTATATTGAT ACTGACGGTA TTAAAGTTGA TATCGATCTT GATAAAGATG G e l - k a l i l o ********** ********** ********** ********** ********** ********** L A - k a l i l o ********** ********** ********** ********** ********** **********  4004  Kalilo AAGTTGATTC AAAAGAGTTA GGAAAAATGA AATATGAATA TGTCTTTGAA GAATACACTA G e l - k a l i l o ********** ip* * ******* * * Q * * * * * * * ********** * * * * * * Q * * * * * * * * * *GC* L A - k a l i l o ********** * * * * * * * * * * * * * * * * * * * * ********** * * * * * * * * * * * * * * * * * * * * 4064  GTTTAGGACC TAAAGTTTAC GGTGGATTAT TGTATGATAA AAAAGGTAAG TTAACAGAAT Kalilo ********** ********** ********** ********** G e l - k a l i l o ********** ********** * * * * **************** ********** ********** LA-kalilo * * * * * * * *  *>p  * * * * * * * * * *  4124  Kalilo  TAGTAAAACT TAGAGGTTAT AGCTCAAAAC TCCCTTATAA TAAGTTAAAA GAGGGATTGG  Gel-kalilo  **********  **********  **********  **********  ***A******  **********  LA-kalilo 4184  Kalilo TAAAAGACCA TACGTTAGAA TTGACTCAGA AAAAATGAAA AAGAAAATTA TCAGAGTCTA Gel-kalilo * * > J * A * * * * * **A******* * * * * * * * * * * ********** *****^**** LA-kalilo * * * * * * * r p * *  4219  Kalilo  CTGTTTACTT GAAGAACAAC CATTTACTGT TTCTG  Gel-kalilo  **A*******  LA-kalilo  **********  **********  *****  62  Appendix III Alignment of part of the TIR sequences of the prototypic kalilo DNA from N. intermedia, the LA-kalilo D N A from the N. tetrasperma strain P4495, the short kalilo D N A from the N. discreta strain 6790 and the Gel-kalilo DNA from Gelasinospora. The sequences of kalilo DNA and Gel-kalilo D N A were taken from Chan et al. 1991 and Yuewang et al., 1996, respectively. a:The alignment was made by using the multi-sequence alignment program from the Baylor College of Medicine on internet. b:The alignment made manually. Sequence homology of all corresponding regions are shown as in Fig. 6. * Identical nucleotide as in Kalilo plasmid - Deletion Numbers shown above the sequences correspond to numbers in Fig. 6. Appendix Ilia Kalilo LA-kalilo Short k a l i l o Gel-kalilo  7461 CACCCTTTCC TCTAAGATAA T-GGGGGCGG ATAAAACATA AAAGCCACTT ********** ********** ********** ********** ********** * * * * * * * * * *  * * * * * * * * * *  * Q * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * Q *  * * * * * * * * * *  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  T-CCCCCAAG ********** *C******** *C********  CGGGCGTAGA ********** ********** **********  TCCCATACCT ********** ********** **********  CACGGTATGG ********** ********** *****£****  7510 ATAATTCGGC ********** ********** **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  ATTTCAGTAG ********** ********** **********  ACGACTTTTT ********** ********** *********£  TGTTTAAGAT ********** *T*G*TTA** **********  TTTTTTGGG********** A********A **** **G  7559 AAAACCCAAA ********** ****G***** ****A**CG*  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  AGTGATAAAC ********** ********** **********  AACTAGCCAG ********** ********** **********  ATTCTCCCCA ********** *********_ **********  ATTATGGCCG ********** ********** T*ATG*C*GT  7609 TGCCTTATAC ********** ********** AA********  7658 -TTTTTATCA TATACTAGGG ACTTATATAA TAAAATTCTA GTATAGTTTT ********** ********** ********** ********** **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  A*c******* ********** ********** * * * * * * £ * * *  *********^  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  GTCACCAATA ********** ********** **********  7707 -AATAGATTG ********** ^********* **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  * * * * * * * * * *  * * * * * * * * * *  TTTTAAGAAT ********** ********** **********  * * * * * * * * * *  CAGTCTACCC ********** ********** **********  * * * * * * Q * * *  TCTACAATTG ********** ********** **********  * * * * * * * * * *  7757 TTATATGAAA AATAAAATTT CTTATAAGTC TATTTATTTC TTTTTTATTT ********** ********** ********** ********** ********** * * * * * * * * * _ * * * * * * £ ^ * _ * * * * * * * * * * * * i p * *CT ****A*T*** * * * * * * * * * _  * * * * * * * ^ * *  * * * * * * * * * *  * * * * * r p * * * ( J  * * * * * ^ ^ p * Q *  63  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  T  TGGT TTCTACCCTT TTATTAAATT GGATTCTTTC  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  CATAATCAAC **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  TTGACCGCAC **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  ACAATTACGG TTTACATTAT TATGAGTAGA TTTCAGCTCC * *AGTTTAC** ********** c*********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  ********** ********** ********** **********  7802 GGGTCCCATT  **********  *CCAGGG*CG A*AA*GA*G* ****CTCCCC ATTAGGG*GT **TGTAA*A* * T T T T A * T T * * * A * T T T T * * A*T**1"T*** T C C * * T * * * T A * T * A T A * * C  CTACAGGTTA **********  TGGTCTTTCA CCACTTCCCC ********** **********  7852 GCTCACTGCA **********  G*A**AAGT* AA*A*TCGAG TCC*CC**CT A * T * *  G*TA**AGA* ATGA*AAAAA —__**G**T  AAAA***ATG *AATCG*AGT  GTAGCAAACT TATTGTTATC C T T T C C T G T T ** Q* * *C**AC***GGT**AAATA A*TAA***AA GG*CA*GG*G *C*. **C*GT*TTA *GGCAT**TA * C * C C * * * —  7902 TCATTTGCGT  7952 CTTCACGCCA  **********  -AG** *G*TT*G***  GAG*C*AG*T  *GATCGTA*C  CTAATTGCTA  TTGGGGTCAT CTACGGACCT  -CTTCTCCCC  8001 CTTTCACCAT  *A****CTCT  **C**A*T*A T**TTCTAGC A* *AGAA*TA AGGGATAG * A  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  ACAGGTACTT **********  8.051 CGTTTTGCTT TTCCCTGTAG ATTACTTGCA CTTTAGGTTC ********** ********** ********** **********  TA*CTAGT*C  **GAC*TT*G  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  TCTTACTCAG TCTGCGGTAC ********** **********  CA*AT*CT*A AGATT*T*TG GAGAG**C*G *GCTC*AT*A  T**CCAAA**  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  TCTTCGCTGC TCAGTTCTAA AGTTAGTCCT ********** ********** **********  GGTTGATTTA **********  8151 TTTACTGTTA **********  CTC*TT*G*A  AACCCCA*AC  CCC*A**G*G  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  CTTTTGGTTT CCTTTTTAAT AAAAATTGGG ********** ********** **********  . 8201 ATTTTTTCTA TTTATCAAGT ********** **********  GGA*ATTC*A  *********G  ********** ********** ********** c********* **********  *T*A*G**T*  *GA*T*TGG*  G**T*AGTGT TAGGTCA*AG  TTCTTAGACA ATACTGTACT ********** **********  *—*GA*T**  *T****A*TA *********T  8101 CACAGGCCTT **********  **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  8250 CGAGGGTTCG TTCT-GGTTC ATTACTATCG ATCACCGTAC TCTGTTTTCT ********** ********** ********** ********** ********** **********  * * * *G* * * * *  ****** * *ip*  **********  * * * * * * * * *g 8300  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  GGATATTCTA AGCCTCAGTT ATTGGCCTTC AGATTCCCCA ********** ********** ********** **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  TTCAATAGTG GGATGTTCTA ********** **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  TCACTCATGG ACATTACATT GAATACTTTC * * * * * * * * * * ***** *^* * * * * * * * * * * * *  CCTTAGCAAC **********  C*C*ATTA**  ***G*AA**A A*A* *A*TAA  Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo  **********  **********  **********  ******* * *Q  GCCCTGCGCC ********** AG**CT***T  8346 GAATA A ATCTTCCAGT TCGCTTAAAT ********** ********** **********  * *Q* * *QG** * * * * * * * * * * CCTC*CCAGG GGTGATA*A* A * * T A * C T C *  8396  *TG*GGT**A A*TATGAAAA  CGTGTGTCTC **********  8446 TTAGACAATA CCACACACGT ACACCGGTAC CCAGATTTAA TAATGCTACC ********** ********** ********** ********** ********** AA*A*GG*** AA*A*TTAAA  *GGCT*A**A AT*ACAA*** **G*GGGAG C  8496 CACTACCCTG ATTGTATCCC TGGAATCATT ACTCAAGGTG GGATATTCTA ********** ********** ********** ********** ********** TGG**T**CT TACAACA 8546 CCCCACCATG GGGC GATAAA GACGTTTATC TCCCCATTAG GGTGTGGTAT **********  **********  **********  **********  **********  8596 AAAAATGAAA AAATCAAAAA GAGAGAGTAC TAGAAATGAT AAAAAGATCA ********** ********** ********** ********** **********  8643 CAAAGGGTTA  AAATAGGAAC AAAAGGGGTC AGTGGTGCCC  * * * * * * * * * * * * * * * * * * * * *********g  CTTACAC c********T A******  65  Appendix Illb  Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel K a l i l o Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo short-Kalilo Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo  CACCCTTTCC ********** ********** **********  TCTAAGATAA ********** ********** **********  T-GGGGGCGG ********** *Q******** **********  ATAAAACATA ********** ********** **********  7461 AAAGCCACTT ********** ********** **********  7510 T-CCCCCAAG CGGGCGTAGA TCCCATACCT CACGGTATGG ATAATTCGGC ********** ********** ********** ********** ********** *C******** ********** ********** ********** ********** *T********  **********  *****A****  *****£****  **********  7559 ATTTCAGTAG ACGACTTTTT TGTTTAAGAT TTTTTTGGG- AAAACCCAAA ********** ********** ********** ********** ********** ********** ********** *ip*Q*^"pA** A********A ****G***** **********  **********  **********  ****  ***A ****_**CG*  7609 AGTGATAAAC AACTAGCCAG ATTCTCCCCA ATTATGGCCG TGCCTTATAC ********** ********** ********** ********** ********** **********  **********  *********_  **********  **********  ********** ********** ********** T*ATG*C*GT AA******** 7658 -TTTTTATCA TATACTAGGG ACTTATATAA TAAAATTCTA GTATAGTTTT ********** ********** ********** ********** ********** **********  **********  **********  ******Q***  **********  A*C*******  **********  **********  ******A***  **********  7707 GTCACCAATA TTTTAAGAAT CAGTCTACCC TCTACAATTG -AATAGATTG ********** ********** ********** ********** ********** **********  ********** j^* ******** ********** ***Q****** **********  **********  **********  **********  **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  TTATATGAAA **********  AATAAAATTT **********  CTTATAAGTC T A T T T A T T T C T T T T T T A T T T ********** ********** **********  *********_ *********_  ******Q A*A******* ******* j^** **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  TTGGTTTCTA **********  CCCTTTTATT **********  *  TTT*A**T** TT***TTT*A T**C*TTT*T  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  -ATCAACCTA  7757 *****ip**QT *****IJI***G  ****A*T*** *****AT*G*  7806  T***A*T  AAATTGGATT CTTTCGGGTC ********** **********  CCATTCATA********** TT*G*T***A  7852 CAGGTTATGG  ********** ********** TC**C***C*  T C — T T T C A C CACTTCCCCG **********  *****Q****  CTCACTGCA**********  *TAT*C**T* C*TGAA**-G T*G**T*AGT G*T*GG***T  Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA—kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA—kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo  7900 TTGACCGCAC GTAGCAAACT TATTGTTATC CTTTCCTCTT TCATTTG—C * * * * * T A * * * ** G** *C**AC***r —— AAT*TCT*CT TA**ATTGT* *GGA*AG*G* *-GAGC**GA **G*ACCCAA 7948 GTACAATTAC GGTTTACATT AT—TATGAG TAGATTTCAG CTCCCTTCAC *** _********* G**** ********** ********** A*T*TC**T* **A***_*** **TC**GC*C ****AC*A**  —GGA*AG*A  7997 GCCACTAATT GC-TATTGGG GTCATCTACG GACCTCTTCT CCCCCTTTCA **********  **********  *********A  **********  **********  TAACTAGT*C CGGAC**TT* TGAC*T*GG* *TTTCAG*G* TAGGTCA*-* 8044 CCATACAGGT AC TTCGT TTTGCTTTTC CCTGTAGATT ACTTGCACTT ********** ********** ********** ********** ********** G****TCC-*  *AAGA**-** **G*AGAGAG  **GAGCTCGA  T*A*A*C*AA  8093 TAGGTTCTCT TACTCAGTC- TGCGGTACTT CTTAGACAAT ACTGTACTCA ********** ********** ********** ********** ********** -*—******  *T*GG*T*AA * * * _ T * * A - *  GA*TCT-**C C*CA***C*C  8143 CAGGCCTTTC TTCGCTGCTC AGTTCTAAAG TTAGTCCTGG TTGATTTATT ********** ********** ********** ********** ********** A*T*GTGGGA *ATT**A 8192 TACTGTTACT TTTGGTTTCC TTTTTAATAA AA-ATTGGGA TTTTTTCTAT ********** ********** ********** ********** ********** :  * **********  * *A* * * * *T*  ********  QQ  8241 TTATCAAGTC GAGGGTTCGT TCT-GGTTCA TTACTATCGA TCACCGTACT ********** ********** ********** ********** ********** *********_  **********  ***Q******  *******ip**  **********  8290 CTGTTTTCTG GATATTCTAA GCCTCAGTTA TTGGCCTTCA GATTCCCC-A ********** ********** ********** ********** ********** • * * * * * * * * Q * ********** ********** ********** ********c* :  8340 Kalilo LA-kalilo Short k a l i l o Gel-kalilo  GCCCTGCGCC  * * * * * _ * * *T  * *G** *G** *  **********  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  TTAAATTCAC  TCATGGACAT  TACATTGAAT  TTCAATAGTG  GGATGTTCTA  GAATAAATCT  TCCAGTTCGC  ********** ********** ********** ********** **********  8390  Kalilo LA-kalilo Short k a l i l o Gel-kalilo Kalilo LA-kalilo Short k a l i l o Gel-kalilo  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  ACTTTCCCTT  AGCAACCGTG  ********** ********** ********** ********** **********  8440 TGTCTCTTAG ACAATACCAC ACACGTACAC CGGTACCCAG ATTTAATAAT ********** ********** ********** ********** **********  8490 GCTACCCACT ACCCTGATTG TATCCCTGGA ATCATTACTC AAGGTGGGAT ********** ********** ********** ********** **********  8540 ATTCTACCCC ACCATGGGGC GATAAAGACG TTTATCTCCC CATTAGGGTG * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * i p * * * *  _ * * * _ * * * * *  * * * * * * * * * *  * * * * * * * * * *  * * * * * * * * * * * * * * * * * * * *  **lji*  ****Q***_ip  * * * * * * i p * * *  * ^ * Q * * * * * *  * * * * * * * _ * *  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  TGGTATAAAA * * * * * * * * * *  ATGAAAAAAT * * * * * * * * * *  CAAAAAGAGA * * * * * * * * * *  GAGTACTAGA * * * * * * * * * *  A A T G A T A A A A * * * * * * * * * *  * * * * Q * * * * *  i p Q A * * * * * G *  * * * * * * I J I Q * *  * Q * * * * * * * *  * * * * * * * * * *  * * * * * * * * * *  *******CQ*  G*****A***  * T A * T A A * A *  * * G * * * * * * *  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  AGATCACAAA GGGTTAAAAT * * * * * * * * * i p *********^ *A*AA**T*T ****AC**** *AT*A*A*GG CT*A****TA  AGGAACAAAA ********** *ATT*A**** *CA*TA*C**  GGGGTCAGTG *****QC*** A**T CA** ****GAGTG*  8590  Kalilo LA-kalilo Short k a l i l o Gel-kalilo  8643 CA-C***** *_*  **A*A  8640 GTGCCCCTTA *****TA*** *****T TAT***-***  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099068/manifest

Comment

Related Items