UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Two investigations in molecular pathophysiology Orban, Paul C. 1993-09-18

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
831-ubc_1993_fall_phd_orban_paul.pdf [ 8.89MB ]
Metadata
JSON: 831-1.0098814.json
JSON-LD: 831-1.0098814-ld.json
RDF/XML (Pretty): 831-1.0098814-rdf.xml
RDF/JSON: 831-1.0098814-rdf.json
Turtle: 831-1.0098814-turtle.txt
N-Triples: 831-1.0098814-rdf-ntriples.txt
Original Record: 831-1.0098814-source.json
Full Text
831-1.0098814-fulltext.txt
Citation
831-1.0098814.ris

Full Text

TWO INVESTIGATIONS IN MOLECULAR PATHOPHYSIOLOGYbyPAUL CHRISTOPHER ORBANB. Med. Sc., The University of New South Wales, 1981M.B., B.S., The University of New South Wales, 1984BA., The University of Sydney, 1984A THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OFDOCTOR OF PHILOSOPHYinTHE FACULTY OF GRADUATE STUDIES( Genetics Programme )We accept thi thesis as conformingto the ^required standardTHE UNIVERSITY OF BRITISH COLUMBIAAugust 1993© Paul Christopher Orban, 1993In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.(Signature) Department of ^itA-c_occAL^C.rt 4_3 The University of British ColumbiaVancouver, CanadaDate^3 ,o^tq /3DE-6 (2/88)iiABSTRACTThis thesis is in two discrete parts. The first part deals with the mechanism of auto-stimulatorygrowth in the pathogenesis of malignant neoplasia. Experiments were undertaken to investigatethe question of whether antagonism of growth-factor activity can lead to the death of the cells of amurine model of auto-stimulatory leukemia. Although many previous workers have examined theability of growth-factor antagonists to inhibit the growth of the cells of human leukemias and ofanimal leukemia models, none have documented the complete blockage of growth, and nonehave documented the death of such cell populations. A model of auto-stimulatory leukemia wasgenerated by transfecting a mouse IL-2-dependent cell line with vectors designed to causeexpression of IL-2 in these cells. One series of clones was derived which grew in the absence ofexogenous IL-2, and produced tumours in syngeneic mice. Cells of these clones produced verysmall amounts of IL-2, but their growth was not completely inhibitable by antibodies to IL-2 or theIL-2 receptor. Another clone was derived, which produced no detectable IL-2, but grewindependently of exogenous IL-2. The growth of cells of this clone was completely inhibited byantibody, and death of the cells resulted. The experiments described here represent the firstdemonstration that antibody antagonists of the growth factor can induce the death of cells thatgrow by auto-stimulatory mechanisms. They support the hope that cytokine antagonists may finduse as therapeutic reagents in the treatment of auto-stimulatory neoplasms.The second part of the thesis presents a new technique in gene targetting, which has broadapplications in the study of gene function. Using a bacterial recombinase under the control of atissue-specific developmentally regulated promoter, transgenic animals were derived, in which atarget gene was deleted in thymocytes and their daughter cells, but no other tissues. Thistechnique circumvents the impediment embryonic lethality may present in some gene deletionexperiments, and allows questions of tissue-specifc function of genes in pathogenesis and normaldevelopment to be addressed.iiiTABLE OF CONTENTSAbstract^ iiTable of contents^ iiiList of figures ivList of abbreviations^ viiAcknowledgement ixForeword^ ixPart 1: Autostimulatory mechanisms in leukemogenesisIntroduction^ 1Results 17Discussion^ 68Bibliography 78Appendices^ 90Part 2: A new technique in gene deletionForeword^ 99Introduction 99Results^ 118Discussion 153Bibliography^ 158Appendices 165Materials and Methods^ 173ivLIST OF FIGURESFigure^ TITLE PAGE1.1. Factor responses of FD.C/2 cells maintained in IL-2 and IL-3 181.2. Factor responses of FD.C/2 cells maintained in IL-2 or IL-3 191.3. The proviral construct used to make I2-3.1 cells 221.4. FD.C/2T cells showed some response to IL-2 and IL-3 241.5. Response of FD.C/2T cells to IL-2 and IL-3 was more obviousat lower initial cell density 251.6. Comparison of responses of FD.C/011.1 cells with those of theparental FD.C/2 cells 261.7. Density-dependence curves for 2 FD.C/2T clones 281.8. Plating efficiency of FD.C/2 cells 291.9. IL-2 activity in the supernatants of FD.0/2'P cells 301.10. Response of FD.C/2 cells to FD.C/2T cell supernatants 321.11. Re-assay of FD.C/2T supernatants 321.12. IL-3 activity in the supernatants of FD.C/011 cells 331.13. IL-3-mediated response of FDC-P1 cells to FD.C/2W.1 supematant 341.14. GM-CSF-mediated response of FDC-P1 cells to FD.0/2'P.1 supernatant 351.15. Rabbit antibodies to IL-3 and GM-CSF partly abolish the effect ofFD.0/2'P.1 supernatant on FDC-P1 cells 371.16. IL-6 activity in the supernatant of FD.C/2 111.1 cells 381.17. Supematant of FD.C/2 cells contains no IL-2 detectable IL-2 activity 391.18. Specificity assay for the preparation of PC61 antibodies used in these studies 421.19. Specificity assay for the preparation of DMS antibodies used in these studies 421.20. PC61 antibody significantly and specifically inhibits the growth of FD.C/2T cells 441.21. DMS antibody significantly and specifically inhibits the growth of FD.C/2T cells 441.22. Growth-factor response of stained FD.C/2 cells is similar to that of unstained cells 461.23. Assessment of the ability of FD.C/2W.1 cells to support the growth of FD.C/2 cells 461.24. The vector used to confer hygromycin resistance upon FD.C/2Hyg cells 481.25. Growth-factor responsiveness of FD.C/2Hyg cells is similar to that of FD.C/2 cells 501.26. FD.C/2T cells support the survival of FD.C/2Hyg cells at highstimulator:responder ratios 521.27. FD.C/2T cells have a dramatic advantage over FD.C/2 cells in antibody resistance 541.28. FACS analyses of IL-2-receptor p55 on FD.C/2 and FD.C/2T cells 55V1.29. The integrating expression vector, pPO1 LhIL2, used to attempt to makeauto-stimulatory derivatives of FD.C/2 cells 581.30. Effect of zinc concentration on growth of FD.C/2Hyg cells 611.31. The episomally replicating expression vector, pBMGNeoLhIL2, used tomake auto-stimulatory derivatives of FD.C/2 cells 621.32. Zinc-dependence of FD.C/2pBLhIL2 cells 621.33. Density-dependence of FD.C/2pBLhIL2 cells 651.34. IL-2 activity is not detectable in the supematant of FD.C/2pBLhIL2 cells 661.35. IL-3 activity in the supernatant of FD.C/2pBLhIL2 cells 661.36. Antibody antagonists of IL-2 can completely inhibit the growth ofFD.C/2pBLhIL2 cells 671.37 Typical growth-factor responses of R6X cells 911.38. Typical growth-factor response of HT-2 cells 911.39. Typical growth-factor responses of FDC-P1 cells 921.40. Typical growth-factor response of 41 E5 921.41. Apparent decrease of bio-activity with duration of assay 931.42. ELISA monitoring of affinity-column purification of DMS antibodies 961.43. Specific inhibtory activity of the 11B11 antibody preparation used in these studies 961.44. Specific inhibtory activity of the 6B4 antibody preparation used in these studies 971.45. Specific inhibtory activity of the Rab7 antibody preparation used in these studies 971.46. Specific inhibtory activity of the Rab39 antibody preparation used in these studies 982.1. Topology of recombinations mediated by the conservative site-specificrecombinases 1042.2. Sequences of various Lox sites found in the bacteriophage P1 life cycle 1092.3. Transfection construct of Sauer and Henderson 1132.4. Potential stem-loop structure in the RNA resulting from transcription through aLoxP site 1132.5. p1017CRE 1192.6. Creation of pLOX2 1212.7. Determined sequence of a portion of the vector pLOX2 1222.8. pLOX2BGAL 1222.9. p1017L0X2BGAL 1232.10. Sub-cloned fragments used for probes 1252.11. Controls for dot-blots 1272.12. An alignment of the mouse and human growth hormone cDNA sequences 1282.13. Examples of dot-blots used to genotype transgenic progeny 130vi2.14. A portion of the genealogical tree of the mice used in these experiments^1302.15. Southern analysis of tail DNA from a CRE and a LOX-f3GAL-LOX transgenicmouse^ 1322.16. Illustration of head-to-tail integration arrays of the two transgene constructs ^1332.17. Two of the Southern analyses used for approximate densitometric quantitationof transgene copy number^ 1342.18. Illustration showing expected band sizes from Southern analyses of transgeneconstructs and the expected recombination result^ 1352.19. Southern analysis of thymocyte DNA samples 1372.20. Southern analyses showing the results of recombination in doubly transgenicCRE/L0X-BGAL-LOX thymocyte DNA^ 1382.21. Southern analysis of tail and thymocyte DNAs from another doubly transgenicmouse^ 1392.22. Southern analysis of DNA showing the recombination result with the Stul/Mscldigest^ 1402.23. Southern analysis of PCR amplified fragments from CRE transgenic and doublytransgenic mice^ 1422.24. Restriction enzyme analysis of PCR-amplified fragment fromCRE/LOX-BGAL-LOX doubly transgenic mouse thymocyte DNA^ 1432.25. Tissue distribution of CRE expression ^ 1442.26. Tissue distribution of recombination 1462.27. Southern analysis of DNA from spleen and spleen-derived T-cells of a doublytransgenic mouse^ 1472.28. Southern analysis of thymocyte DNAs showing recombination results in threemore doubly transgenic mice^ 1492.29. Southern analyses showing CRE-mediated recombination of target sequence inanother chromosomal context^ 1512.30. Southern analyses of the nature of the LOX-I3GAL-LOX integration in the 87 line ^1522.31. PCR amplification of RNA from LOX-BGAL-LOX thymocytes^ 1662.32. Western analysis of thymocyte samples for detection of hGH 166VIILIST OF ABBREVIATIONSAb.^ antibodyAML acute myelogenous leukemiaby^ base pair(s)cDNA complementary DNACM^ conditioned mediumCML chronic myelogenous leukemiaDNA^ deoxyribonucleic acidEBV Epstein-Barr virusE. coli^ Escherichia coliES cell embryo stem cellG-CSF^ granulocyte colony-stimulating factorGM-CSF granulocyte/macrophage colony-stimulating factorhGH^ human growth hormonehIL-2 human IL-2IL^ interleukinkbp kilo base pairsLTR^ long terminal repeatM molarM.A.^ medium alone ( no growth factor added )mIL-2 murine IL-2ml^ millilitre(s)mM millimolarmRNA^ messenger RNAPCR polymerase chain reactionPDGF^ platelet-derived growth factorRNA ribonucleic acidVIII°GAL^ beta-galactosidase.1-19 microgram(s)1-1,1^microliter(s)°C^ degrees CelsiusAlthough the convention of naming genes in italics has been adhered to, in general, all transgenefragments have been named in upright capital letters in this work.ixACKNOWLEDGEMENTI wish to express my gratitude to my supervisor, Dr. John Schrader, whose enthusiasm andbreadth of knowledge were a source of inspiration, and without whose open-mindedness andgenerosity of spirit, project two would not have been undertaken. In addition, I am deeplyindebted to Dr. Jamey Marth of the Biomedical Research Centre, who supervised the workdescribed in the second part of the thesis, and to Daniel Chiu, who assisted with much of thework reported in the second part. I should also like to acknowledge Dr. Hermann Ziltener of theBiomedical Research Centre, who supplied several antibodies, and taught me some of the basictechniques of working with them, Dr. Ian Clark-Lewis, of the Biomedical Research Centre, whosupplied synthetic growth factors, and Dr. Allen Delaney of the Biomedical Research Centre whoprovided computer software and hardware support for this work.FOREWORDMaterials and methods aside, this thesis is in two parts, each dealing with a hypothesis and theexperiments carried out to test it. The first part of the thesis deals with a project proposed by mysupervisor. The second part deals with a project devised by myself. The link between the two isnot obvious from the purely scientific point of view, but the historical path from the first to thesecond was quite simple. The coincidence of three factors influenced me in conceiving thesecond project: 1) reading a review relating to the first project ( see introduction to Part 2 ), 2)general reading of scientific journals, and 3) the arrival of a new scientific technology at theBiomedical Research Centre ( where this work was carried out ). The materials and methodshave been presented as a single section, since many of the techniques there described wereused in both parts of the work.During the initial stages of work on project two, it became clear that there would be considerablecompetition from the group which donated the reagents essential to this project. The author'sefforts were therefore diverted towards completing project two as rapidly as possible.1AUTOSTIMULATORY MECHANISMS INLEUKEMOGENESISINTRODUCTIONThere is an abundant literature on the subject of autostimulatory tumours. Many relevant reviews havebeen published ( e.g. Sporn and Roberts, 1985; Lang and Burgess, 1990 ). Rather than attempting acomprehensive review of all the relevant publications, or simply providing an additional general review,the aim of this introduction is to make clear the reason for undertaking yet another study ofautostimulatory neoplasia - to identify the unanswered questions that prompted the present work.1) BACKGROUNDIn vitro, proliferation of mammalian cells depends on the presence of poly-peptide growth factors, andit is thought that the same growth factors regulate cell growth in vivo. More than 30 years ago, it wassuggested that production of a growth factor by a cell that would respond to it might be a componentof tumourigenesis ( Hsu, 1961 ). Secretion of growth factor that could then act on the secreting cellsreceptors was termed "autocrine secretion" by Sporn and Todaro, 1980. In this original sense, theterm "autocrine" strictly implied secretion of a factor which acted directly on the cell secreting it. Sincethe coining of this term, others have proposed alternative mechanisms of growth factor mediated self-support in tumours. In particular, the "paracrine" mechanism is an indirect mechanism involvingsecretion of a factor which induces surrounding cells to in turn secrete a factor that stimulates growthof the tumour cells ( e.g. Griffin et al., 1987; Leslie et al., 1991 ). The first suggestions regardingautostimulatory mechanisms implied action of growth factor on receptors displayed at the cell surface,however, many workers ( see below ) have more recently proposed that growth factors may functionfrom within the cell on receptors that are not exposed to the extra-cellular environment making specificantagonsim of the autostimulatory factor more difficult. Growth factor antagonists could clearly have arole in intervention in paracrine loops, however, the present work concerns the possibly more difficultproblem of direct mechanisms, in which factor and receptor are present in ( or on ) the same cell. Toallow for the possibility of intracellular function, but make clear the distinction from the paracrinemechanism of self-supporting growth factor loops, the term "autostimulation" is used here.Tumourigenesis has long been considered to be a multi-step process ( Foulds, 1958; Hunter, 1991 ),involving several genetic lesions in a cell that gives rise to a malignancy. Any given genetic lesion or2phenotypic trait of a tumour ( such as autostimulatory growth factor production ) may, however, beepiphenomenal with respect to the mechanism of tumourignesis. It is only by examining thefrequency of the occurence of the trait in tumours of a given type, or by observing the effect ontumourigenesis when the trait is reversed, that one could make claims about the involvement of thetrait in the tumourigenic process. The first part of this introduction will be concerned with the basis ofthe claim that autostimulatory mechansims are significant in tumourigenesis.Early suggestions as to the presence of autostimulatory factors in tumourigenic cells came fromTodaro and De Larco ( 1978 ). These workers found that mouse fibroblastoid cells transformed to thetumourigenic phenotype by various means, including transfer of DNA from human tumour tissue,released "transforming growth factors" into their conditioned medium. These factors would in turnstimulate growth of non-transformed cells. Since then, however, it has become apparent that theproduction of these two factors, termed TGF alpha and TGF beta, is not specific for tumour cells, andmany cell types in normal animals produce them ( Sporn and Roberts, 1985 ).One of the first direct pieces of evidence that production of an autostimulatory factor could have acausal role in oncogenesis involved platelet-derived growth factor ( PDGF ). As its name suggests, thisfactor is normally derived from platelets, which release it when activated. It is therefore present inserum used for much mammalian tissue culture, many cell types in culture requiring the presence ofthis factor for growth. The transforming protein of the simian sarcoma virus ( SSV ), encoded by theoncogene v-sis, is very closely related to a portion of one form of PDGF, and the presence of thisoncogene is essential to the tumourigenic activity of the virus ( Doolittle et al., 1983; Waterfield et al.,1983 ). Production of PDGF-like molecules occurs in several human tumours, e.g. osteosarcomas( Graves et al., 1983; Betsholtz et al., 1984) glioma ( Nister et al., 1984 ), and the bladder carcinomaline T24 ( Bowen-Pope et al., 1984 ), many of which also have functional PDGF receptors. In additionsome simian virus 40 ( SV40 ) -transformed cells as well as mouse fibroblasts transformed by murinesarcoma viruses produce PDGF-like molecules, and in some of these latter cells, neutralising antibodyto PDGF reduces the growth of the lines in vitro ( Bowen-Pope et al., 1984 ). Additionally, acorrelation was observed between the amount of PDGF produced by simian sarcoma virus ( SSV )-transformed cells and their growth rate in nude mice ( Huang et al., 1984 ). Johnsson et al. ( 1985 )were able to demonstrate some reduction in the ability of SSV to transform fibroblasts in the presenceof high concentrations of neutralising antibody to PDGF. It has since been shown that arterial smoothmuscle cells isolated from normal young rats also release biologically significant amounts of thesefactors into their culture medium ( reviewed in Sporn and Roberts, 1985 ). This puts into question thesuggestion that the production of PDGF-like substances is always aberrant in a tumour cell, rather thana simple part of the physiology of the corresponding normal cell type.3Autocrine loops in other tumours and the tumour models discussed below may indeed be reflectionsof physiological events. Nevertheless, one may still propose the autocrine loop as a mechanism in thepathogenesis and maintenance of these tumours. Cells which would otherwise pass through a stageof differentiation in which autostimulation was physiological might, in the process of mutation resultingin the genesis of the tumourigenic clone, be "frozen" at this stage of differentiation. Alternatively,mature cells might lose their normal ability to down-regulate a physiological autostimulaton. T-cells, forexample, when stimulated by antigen in the presence of appropriate cooperative signals, will up-regulate interleukin-2 ( IL-2) receptor levels, and secrete IL-2 ( reviewed in Dinarello, 1991 ). Variousmechanisms subsequently operate to down-regulate both the IL-2 production and the level ofreceptor, and the loss of such mechanisms would lead to pathological autostimulation. Of course,tumour cells may well acquire alternative mechanisms of autonomous growth, irrespective of whetherthey have passed through an autostimulatory stage during differentiation, or lost their ability to down-regulate an autostimulatory loop. Such cells may be producing a potentially autostimulatory growthfactor as an epiphenomenon.This consideration stresses the importance of showing more than thesimple presence of growth factor production and of the corresponding receptor on the cells of atumour, in order to establish the autocrine loop as essential to the tumour's viability. Studies aimed atinhibiting growth with growth factor antagonists therefore acquire greater importance in suggestingthe involvement of autostimulatory mechanisms in tumourigenesis.An example of spontaneous tumours that displayed autostimulation and susceptibility to inhibitionwas that of the human small-cell carcinomas of the lung that produce gastrin-releasing-peptide, themammalian equivalent of bombesin ( reported by Cuttitta et al.,1985, and others ). Gastrin-releasing-peptide ( GRP) is a poly-peptide hormonal factor usually produced by foregut-derived tissue, butaberrant production of hormones is a quite common feature of small-cell lung cancers, and manyinstances involve the production of GRP. Neutralising monoclonal antibodies to bombesin signifcantlyinhibited growth of the tumours in vitro. When transplanted into nude ( geneticallyimmunocompromised ) mice, cells of this tumour are able to proliferate and metastasise. Treatment ofsuch mice with neutralising antibodies to GRP results in a significant, although temporary inhibition ofthe proliferation of these cells. The tumours eventually adapt to the presence of antibody, possibly byoutgrowth of some of the cells with additional or pre-existing mutations which allow growthindependently of GRP.Several examples of the role of insulin-like growth factor-1 ( IGF-I ), in human tumours have beenreported, in which antibodies to this factor have slowed growth of the tumour cells in vitro. Theseinvolved neoplasms of the lung ( Minuto et al., 1988 ) and breast ( Huff et al., 1986 ), andosteosarcoma ( Blatt et al., 1984 ). IGF-I was also more recently the subject of another experimental4strategy to interfere with an autostimulatory loop in a spontaneously arising tumour ( Trojan et al,1992 ). Cells of the transplantable rat glioma C6 were found to produce IGF-I, and the receptors for thisfactor. Cells of this glioma were transfected with a plasmid that produced an anti-sense IGF-I transcriptand thereby caused a significant reduction of the amount of IGF-1 produced in the cells. C6 cellstransfected with the anti-sense plasmid were unable to produce tumours in syngeneic rats, whereascells transfected with empty vector were tumourigenic.Trojan et al. ( 1993) subsequently observedthat injection of anti-sense transfected C6 cells could cause regression of existing control C6 tumoursand found lymphocytic infiltration at the sites of tumour regression. This suggested that an immuneresponse was responsible for the death of tumour cells, and that the production of IGF-I may haveacted to overcome such an immune response. Since these authors make no claim as to the effect ofthe anti-sense plasmids on in vitro growth, it is at least conceivable that the IGF-I produced by thesecells was acting not as a growth factor, but simply as a mechanism of avoiding the immune response. Amore likely explanation of these findings might be that the growth-promoting activity of IGF-I wasallowing the tumour cells to overwhelm the response. The autocrine action of IGF-1 in these tumourcells may also be an indirect reflection of physiological events - there is some evidence to suggest thatcentral nevous system precursors of glial cells may produce IGF-1 in their normal proliferation anddifferentiation during fetal ontogeny ( Drago et al., 1991 ).Human melanomas liberate a factor, termed MGSA ( for "melanoma growth stimulating activty" ) whichstimulates the growth of normal melanocytes and melanoma cells. Indeed this factor was purified andcharacterised from the supernatant of a melanoma line. ( Richmond et al., 1988; Richmond andThomas, 1988 ). In the case of one such tumour, changes in growth rate of the cells could becoorrelated with changes in the level of messenger RNA for the factor present. ( Bordoni et al., 1989 ).In addition to the data reviewed above, there is a further body of evidence from which one could inferthat autostimulatory mechanisms might be involved in the development of malignant neoplasms.Several oncogenes have been described that act as constitutively active receptors for growth factors.The v-erb-B gene, for instance, encodes a truncated and activated epidermal growth factor receptor( Downward et al.,1984 ), and the v-fms gene is also constitutively activated by virtue of a mutation thatdistinguishes it from its cellular counterpart c-fms ( Sher et al., 1985 ), the receptor for macrophagecolony-stimulating factor ( CSF-1). A constitutively activating mutation also makes oncogenic anothergrowth factor receptor, the c-kit gene product ( Geissler et al., 1988 ). Constitutively activated receptorsignal transducers, such as mutated ras gene products, are also found widely distributed amongstspontaneous tumours ( reviewed in Barbacid, 1987, and Hunter, 1991 ). These examples support thenotion that the constitutive activity of a growth factor response pathway is a common mechanism intumourigenesis.5With the exception of the in vivo work of Trojan et al., no instance of autostimulation in a solid tumourhas been reported in which tumour cells have died as the result of growth factor antagonism.Eradication of malignancies in man generally requires destroying tumour cells - most tumours do notdisplay any evidence of being immunogenic, and the occurence of spontaneous regression oftumours is so rare as to merit report in a journal in every instance where documentation is sufficient.Normal cells of the hemopoietic system, however, display the unique property of being absolutelydependent on growth factors for not only proliferation, but also survival. This is true of cells in vivo aswell as in vitro ( Crapper et al., 1984; Savill et al., 1989; Koury and Bondurant, 1990 ). When thegrowth factor is completely removed from culture, or not available to the cells in vivo, such cells die.Moreover, in contrast to cells of solid tumours, malignant cells of hemopoietic origin are commonlyexposed to the circulation directly, rather than occuring in masses with some cells only poorlyaccessible from the circulation. For these reasons, hemopoietic tumours are more likely than solidtumours to be amenable to therapy with growth factor antagonists.2) AUTOSTIMULATION IN HEMOPOIETIC NEOPLASIAHemopoietic precursors as well as mature cells are relatively easy to obtain from patients andexperimental animals. In the right conditions, precursors can be made to differentiate in vitro. As aresult, much is known about the factors that support the growth, differentiation and function ofhemopoietic cells. Amongst the known factors are the granulocyte-macrophage, granulocyte, andmacrophage colony stimulating factors ( GM-CSF, G-CSF, and M-CSF or CSF-1 ), erythropoietin,interleukins ( ILs ) 1 to 13, interferons, and steel-factor ( for a recent overview, see Schrader, 1992 ).There is also considerable evidence for the role of autostimulatory loops both in malignancies and thenormal physiology of the hemopoietic system.The first evidence of an autostimulatory loop in the pathogenesis of a leukemia was the discovery of aspontaneously factor-independent derivative of an interleukin-3 ( IL-3) -dependent mouse cell line. Incontrast to cells of human or even other rodent origins, mouse cells have a marked tendency to giverise to immortal clones of cells in culture. Such cell lines, if of hemopoietic origin, generally remaindependent on hemopoietic growth factors for survival and proliferation. In this instance, culture of alarge number of cells in the absence of factor permitted the emergence of a single clone which grewautonomously. Whereas the parental IL-3-dependent cells died on injection into syngeneic mice inthe absence of an artificial source of IL-3, the autonomous cells gave rise to leukemia in mice withoutan IL-3 source. In vitro, the autonomous cells grew more rapidly at higher cell density, suggesting the6presence of an autostimulatory mechanism. IL-3 was detectable in the supernatant of the cells inculture, and in the serum of the leukemic mice ( Schrader and Crapper, 1983 ). Since theseobservations were made, numerous examples of autocrine loops in human tumours have beenreported.Interleukin-1 ( IL-1 ), a cytokine present in many mammalian cells appears to be responsible forautostimulation of some freshly explanted adult T-cell leukemic cells ( Shirakawa et al., 1989 ). Whencultured at sufficiently low density for the effect to be observed, such cells proliferate in response to afactor present in their own conditioned medium. ( At higher densities no effect was observedsuggesting that the concentration of autostimulatory factor was then saturating with respect to theproliferative capacity of the cells.) A rabbit neutralising anti-serum to IL-1 specifically inhibited thisresponse, although it did not completely inhibit proliferation of the cells. This autostimulatory loop mayreflect a physiological phenomenon, since activated T-cells produce IL-1, and respond to IL-1 inconjunction with antigenic stimulation, by upregulating IL-2 and IL-2 receptor production, in thecourse of an immune response.Several laboratories have reported that IL-1 is involved in the autostimulatory growth of Epstein-BarrVirus ( EBV ) -transformed cells. Though not tumourigenic in healthy hosts, EBV-infected cells,present in the circulation of more than 90% of the general population over 30, may give rise to B-cellleukemias in immunocompromised patients. When removed from the circulation and placed intoculture, some EBV infected cells give rise to immortal "B-lymphoblastoid" cell lines, which continue togrow apparently independently of hemopoietic growth factors. Scala et al. ( 1987 ), Wakasugi et al.( 1987 ), and Vandenabeele et al. ( 1988) have reported observations on three B-lymphoblastoidlines which produced a factor that promoted their own growth ( again, at lower densities ). Thesefactors had physical and biological characteristics of IL-1, and in two of the three instances,neutralising antibody to IL-1 was able to inhibit, to some extent, the growth of the cells. Bertoglio et al.( 1989 ) studied a further 12 B-lymphoblastoid lines, and found a strict correlation between thepresence of IL-1 mRNA and IL-1 receptor, consistent with an autostimulatory role of the IL-1.Many groups have attempted to account for the apparent factor-independence of EBV-tansformedcells. Interleukin 5, ( IL-5 ), originally described as a growth and differentiation factor produced by T-cells and acting on eosinophils and B-cells ( Takatsu et al., 1988 ; Sanderson et al., 1988 ), has beenshown to be involved in an autostimulatory loop in some lymphoblastoid lines ( Paul et al., 1990;Baumann and Paul, 1992 ). These workers demonstrated production and high-affinity binding of IL-5by the EBV-transformed cells, and showed that neutralising antibodies to IL-5 partially inhibitedgrowth of these cells. Interleukin 6 ( IL-6 ), known for its B-cell growth promting activities ( reviewed in7Kishimoto et al., 1992 ), was used by another group in transfection of EBV-transformed lines ( Scala etal., 1990 ). Expression of IL-6 in these cells caused a striking increase in growth rate at very low celldensities, secretion of detectable IL-6 into the culture medium, and the development of tumours inimmunocompromised mice from these cells, which were not tumourigenic in the absence of IL-6expression.IL-6 has come to prominence within the field of autostimulatory loops, as a growth factor involved inthe pathogenesis of multiple myeloma, a tumour of plasma cell origin. Kawano et al ( 1988) reportedan IL-6-dependent autostimulatory loop in cells freshly isolated from patients. They observedproduction of and response to IL-6, as well as some inhibition of in vitro growth with neutralisingantibody to IL-6. However, the presence of contaminating marrow cells in these myeloma samplescould not be excluded, thus admitting of the possibilty that the IL-6 detected in these samples wasnot produced by the myeloma cells themselves, but by such contaminating cells. Another group,( Klein et al., 1989 ) found that neither of two established human myeloma lines expressing receptorsfor IL-6 produced biologically detectable IL-6 or IL-6 mRNA. Moreover, anti-IL-6 antibody did not effectthe growth of these cells. When these workers compared bone marrow samples of patients withfulminant multiple myeloma and control marrow samples, they found that stromal cells in myelomapatients, rather than the myeloma cells themselves were secreting IL-6, suggesting a possibleparacrine growth loop. These workers also showed a correlation between in vitro responsivenes to IL-6, and in vivo proliferative status in 13 patients studied ( Zhang et al., 1989 ). However, Schwab et al,using one of the same lines ( nominally ) used by Klein et al., were able to show secretion andresponse to IL-6, as well as the presence of IL-6 message. They also showed a 70% inhibition of thegrowth of the cells in the presence of a neutralising antibody to IL-6. The findings of severallaboratories in relation to IL-6 and multiple myeloma have led to clinical trials ( e.g. Klein et al., 1991) ofneutralising monoclonal antibodies in myeloma patients, with some success in inhibition of myelomagrowth in vivo.Although no reports have described an activating mutation in the IL-6 gene in human multiplemyeloma cells, Blankenstein et al. ( 1990) have described the insertion of an intracisternal A particle( IAP ) in the IL-6 gene of a mouse myeloma-like tumour, the plasmacytoma MPC11. An IAP is atransposable DNA sequence with some features of the retroviral long terminal repeats ( LTRs ), and iscapable of activating genes by insertion 5' of the coding sequence. The presence of thisrearrangement supported the hypothesis that activation of IL-6 production was involved in thepathogenesis of the plasmacytoma. Additionally, plasmacytosis occurs in transgenic mice expressingIL-6 specifically in B-cells, and in the presence of an immortalising mutation ( such as an activation ofthe c-myc gene ), these mice develop plasmacytomas ( Suematsu et al., 1989; and 1992 ).8The human immunodeficiency virus ( HIV) has also provided an example of autostimulatory growth intumour development. The HIV tat gene product has a growth-promoting role in Kaposi's sarcomacells. These tumour cells produce IL-6 and the growth-promoting activity of the tat product can bespecifically reversed, at least in part, by anti-sense oligonucleotides to IL-6 ( Miles et al., 1990 ).In view of the physiological autostimulatory loop mediated by IL-2 in T-cells ( mentioned above ), it isnot surprising that such a mechanism appears to operate in some T-cell leukemias. Indeed one of theearliest reports suggesting an autostimulatory loop in hemopoietic neoplasms ( Gootenberg et al.,1981 ), described cells of several human cutaneous T-cell lymphoma lines producing and respondingto what was then known as "T-cell growth factor". Subsequently, Duprez et al. ( 1985) reported theestablishment of a line from a T-cell lymphoma, which secreted and responded to human IL-2. Thegrowth of this line was strictly density-dependent, and the cells prodcued very little IL-2 ( 0.6 units perml in a 25 x concentrated cell-culture supernatant ). Neutralising antibody to IL-2 was able to inhibit thegrowth of these cells by 90%. The same workers later showed that the autostimulatory loop in thesecells could be blocked by Cyclosporin A, which blocked IL-2 transcription ( Dautry-Varsat et al., 1988 ).Physiological production of myeloid growth factors has been demonstrated for several myeloid celltypes. Macrophage/monocyte lineage cells secrete GM-CSF, CSF-1 and G-CSF in response toinflammatory stimuli, and can respond to GM-CSF and CSF-1 ( reviewed in Moore, 1991 ). Eosinophilsand neutrophils can secrete GM-CSF and IL-3 when stimulated with other cytokines ( Kita et al., 1991;Moqbel et al., 1991 ). Mast cells can be stimulated, by cross-linking of cell-surface antibodies withantigen, to produce IL-3, GM-CSF, IL-4, and IL-5 ( Burd et al, 1989; Plaut et al, 1989; Wodnar-Fillipowicz et al., 1989; Razin et al., 1991 ), and can respond to IL-3 and IL-4. In all these situations,some form of ligand-mediated physiological stimulation of cell-surface receptors is required to inducesecretion of growth factor. Such stimuli function through intracellular pathways that share commoncomponents and some components of these pathways are activated by oncogenic mutations.Activating mutations of the N-ms gene, for example, are found in many acute myeloid leukemias ( Boset al., 1987 ). Therefore, it is conceivable that oncogenic mutations may secondarily activate theproduction of potentially autostimulatory growth factors, which do not participate in the survival orproliferation of the tumour cells. This highlights the importance of studies using growth factorinhibition before drawing conclusions as to the role of autostimulatory factors in the genesis oftumours in cell types that display a variety of physiological autostimulatory mechanisms.For many years, it was thought that culture of human acute and chronic myeloid leukemic ( AML andCML ) cells required the addition of exogenous growth factors ( reviewed in Metcalf, 1989 ). Culture ofAML blasts at high density, however, ( e.g.over 106 per ml ) permits growth of purified leukemic blast9populations in the absence of exogenous factor. Such density-dependence is consistent with theactivity of an autostimulatory mechanism in these cells. Many workers have described the production,in blast-cell enriched populations of myeloid leukemias, of factors known to stimulate the growth of thecorresponding normal cells ( e.g.Young and Griffin, 1986; Young et al., 1987; Young et al, 1988;Sakai et al., 1987; Oster et al, 1989; Reilly et al., 1989; Freedman et al., 1992 ). Several of thesereports simply described this finding of growth factor production, or of growth factor message, infreshly isolated cells, without attempting to establish the requirement for autostimulation inmaintenance of growth and many reports were subject to the criticism that it was possible that thegrowth factor detected was present not in the leukemic cells themselves, but in contaminating normalcells present in the isolates. Nevertheless, it is clear that some populations enriched for leukemic cellsproduce GM-CSF in vitro, and that neutralising antibody to GM-CSF reduces the growth rate of suchcells ( Young and Griffin, 1986 ). Similarly, there is good evidence for the presence of IL-1 in suchpopulations, and again, in vitro inhibition of IL-1 activity with antibodies, or more recently, with thenaturally occurring IL-1 antagonist IL-1ra has slowed growth in cultured cells ( Cozzolino et al., 1989;Rodriguez-Cimadevilla et al., 1990, Bradbury et al., 1990; Rambaldi et al., 1991; Estrov et al, 1992 ).With respect to IL-1, at least, there is evidence from in situ hybridisation studies showing that mRNAfor IL-1 is present in the leukemic blasts themselves ( Nakamura et al., 1990 ). In the case of GM-CSF,however, there is some evidence that the growth factor is produced by non-proliferating progeny ofthe blasts present in leukemic isolates ( Murohashi et al., 1989 ). This would be consistent with aparacrine rather than an autocrine mechanism, in which IL-1 stimulates production of GM-CSF in suchpopulations, and evidence for this has been reported in human AML ( Delwel et al., 1989; Estrov etal., 1992 ), and in a spontaneous mouse myelo-monocytic leukemia ( Leslie et al., 1991 ).The techniques used for isolating leukemic blasts themselves may induce the production of growthfactors ( Kaufman et al., 1988 ). These blasts represent cells at various stages of differentiation of themyeloid pathway, and it has not yet been determined what features of the apparent autostimulatoryand paracrine loops are physiological in cells at these various differentiation stages. Although generearrangements, particularly translocations, are common in leukemic cells, there are no data tosuggest that any such rearrangement has directly activated a growth factor gene. The inability todetect autostimulatory factors need not necessarily imply that they are functionally absent - very smallamounts may suffice to induce proliferation ( reviewed in Lang and Burgess, 1990, and Thomson,1991; and the data presented here ). For these reasons, it will be important in subsequent studies ofleukemic ( and normal ) hemopoiesis to attempt, perhaps by sensitive in situ polymerase chainreaction ( PCR ) techniques to demonstrate the presence of cytokine production in cells that are well-characterised with respect to differentation and function.10With respect to CML, there is no good evidence to suggest the involvement of autostimulatorymechanisms in the pathogenesis of the disease. The hallmark of this disease is the presence of thePhiladelphia chromosome ( an abnormal chromosome 22 resulting from a balanced translocationbetween chrmosomes 14 and 22 ), This results in the formation of a protein-encoding gene fusionbetween the bcr (for breakpoint cluster region ) and abl genes. This latter is the cellular equivalent ofthe oncogene found in the Abelson murine leukemia virus. Although its precise function is unclear,the c-abl product is a tyrosine kinase thought to be involved in pathways of signal transduction fromcell surface receptors. The fusion product function in a constitutively activated manner with respect toits tyrosine kinase activity. Thus, if a growth factor pathway were involved in leukemogenesis resultingfrom expression of a constitutively activated c-abl product, the mechanism would be more likely toinvolve short-circuiting the growth factor response, bypassing the need for ligand to bind to receptor,rather than inducing a truly autostimulatory loop. When the bcr/abl product was expressed in immortalmurine factor-dependent myeloid cells, these cells acquired the ability to produce IL-3, and becameindependent of exogenous factor ( Hariharan et al., 1988 ). This may simply reflect the action of theactivated kinase in mimicking a physiological stimulus, which would normally induce IL-3 production.Moreover, others have reported similar experiments in which no autostimulatory factor production wasdetected ( Laneuville et al., 1991 ). The relevance of hemopoietic growth factor production to thepathogenesis of CML has not been established, indeed one group has reported negative evidencewith respect to autostimulatory factors in CML cells ( Otsuka et al., 1991 ).3) ANIMAL MODELS OF AUTOSTIMULATORY HEMOPOIETIC NEOPLASIAMuch work in autostimulatory neoplasia has been carried out in animal model systems. These have thegreat advantage that autostimulatory loops can be constructed so that the existence and requirementof autostimulation for proliferation of cells can be ascertained. These autostimulatory loops can bemanipulated in vitro and the effects of such manipulations can be studied in cells returned to animals.Amongst the earliest work with animal models of autostimulatory leukemia is that of Adkins et al.( 1984 ). These workers were investigating transformation of normal chicken myeloid cells byoncogenic retroviruses. A virus carrying a single oncogene ( either v-myb or v-myc ) was able toimmortalise primary cells, which still required a growth factor ( chicken myelomonocytic growth factor,cMGF, a distant relative of IL-6 and G-CSF ) for continued proliferation in vitro. When super-infectedwith a second virus carrying a src-family oncogene ( a constitutively activated form of a signal-transducing tyrosine kinase ), the cells started to produce cMGF, and became independent ofexogenous factor. The subsequent growth of such cells could be inhibited, to some extent, by11neutralising anti-serum to cMGF. Graf et al. ( 1986 ) extended these results by showing that the v-miloncogene product ( also involved in signal-transduction pathways ) would similarly induce v-myc-transformed cells to produce cMGF, and would cooperate with v-myc in forming leukemias in vivo.Somewhat related are the observations of Baumbach et al. ( 1987 ) on tumours arising after infectionof mice with a retrovirus containing the c-myc gene. All the tumours obtained were of the monocyte-macrophage lineage, and they showed various phenotypes with respect to production of GM-CSFand CSF-1. The growth of one of these tumours was partially inhibited by neutralising antibody toCSF-1. This tumour was shown to have a CSF-1 gene rearrangement, suggesting that this mutation,resulting in the aberrant expression of CSF-1, cooperated with the myc gene in the genesis of thetumour. Another interesting set of experiments relating to the idea of cooperative events intumourigenesis were those of Andrejauskas and Moroni ( 1989 ), who transfected a mouse immortalIL-3-dependent line with a vector containing an activated v-H-ras gene under the control of aninducible promoter. In transfected cells, induction of expression of the activated ras gene correlatedwith loss of dependence on exogenous IL-3 and with production of IL-3 by the cells, a provocativeobservation in the light of the role of the ras gene products in many signal-transduction pathways thatmight be involved in the physiological induction of IL-3 production in reponse to appropriate stimuli.Strong support was given to the notion that acquisition of an autostimulatory mechanism might be afrequent cooperative factor in the formation of tumours from otherwise immortal cells by theobservations of Stocking et al. ( 1988 ). These workers produced 11 autonomous variants of a factor-dependent mouse cell line by random insertional mutagenesis with a retrovirus. Ten of the 11 clonesproduced one of the two growth factors to which the parental line responded ( GM-CSF or IL-3 ), andin most cases these workers were able to demonstrate the insertion of the retrovirus in proximity to theGM-CSF or IL-3 genes, which induced production of the factors. Similarly, Duhrsen et al. ( 1990 )observed that another mouse factor-dependent myeloid line, also responsive to both IL-3 and GM-CSF, spontaneously gave rise to tumours when injected into irradiated syngeneic mice. The cells ofabout one third of the tumours they isolated displayed production of either GM-CSF or IL-3, and in themajority of these cases it could be shown that this growth factor production was due to the insertion ofan IAP in the proximity of the relevant gene.When transfected with vectors that determine expression of the product of cDNAs of the relevantgrowth factors, mouse immortal factor-dependent cell lines are reproducibly converted toindependence of exogenous growth factor. Such experiments have been performed by manyworkers, and in some cases, density-dependence and the ability of neutralising antibody to growthfactor or receptor to inhibit growth has been examined.12Lang et al. ( 1985 ) conferred the ability to express GM-CSF on cells of a GM-CSF-dependent immortalline, and showed that the resultant cells were autonomous and tumourigenic. Although the amountof GM-CSF in the supernatant of these cells cultured at low density was too small to be able to supportthe growth of untransfected factor-dependent cells, the autostimulatory cells showed no density-dependence and were not inhibited by antibody to GM-CSF. These latter observations led theauthors to suggest the possibility that the engagement of ligand and receptor took place intracellularlyin these autostimulatory cells. ( This suggestion and other evidence relating to it are dealt with in somedetail in the discussion section of this portion of the thesis.) Laker et al. ( 1987 ), however, usingsimilar expression vectors and the same cell-line, observed that GM-CSF-producing autostimulatorycells were indeed density-dependent, at least for some period following transfection. Neutralisinganti-serum to GM-CSF significantly inhibited the growth of these cells, although cell death was notdocumented. These workers made the additional observation that such clones underwent a transitionto a state in which their growth was no longer density-dependent, nor inhibitable by antibody. Thistransition occured more rapidly in clones initially secreting higher amounts of GM-CSF, although noexplanation for this was apparent. Clearly, although an autostimulatory mechanism was involved in thegeneration of these cells, in the post-transition state they could not be shown to be autostimulatory,despite continued production of GM-CSF. These observations highlight the possibility of suchprogressions in the pathogenesis of spontaneous leukemias.At least two groups have made IL-2 dependent models of autostimulatory growth. Taniguchi et al.( 1987 ) using a retroviral vector and a human IL-2 cDNA, obtained clones that produced IL-2, from anIL-2-dependent cytotoxic T-cell line. These cells grew autonomously, but appeared no longer torespond to exogenous IL-2 ( except for some inhibition of growth at higher concentrations of IL-2 ).These workers were able to achieve some inhibition of growth of such cells with a neutralisingantibody to the IL-2 receptor. Cells of these clones were able to induce lymphomas in syngeneicmice. Karusayama et al., using a different vector system, and another IL-2 dependent line, obtainedIL-2 producing clones that, while capable of growth without exogenous IL-2, were still responsive toexogenous IL-2. Moreover, these clones proliferated in a density-dependent manner, and theirgrowth could be significantly, but not completely, inhibited by neutralising antibodies to IL-2 or to theIL-2 receptor. It is worth noting that this group used the mouse anti-human monoclonal antibody DMS-1 to apparently inhibit the action of mouse IL-2. The DMS-1 monoclonal antibody preparationgenerated by the present author (see results section ) did not appear to be able to neutralise mouseIL-2 ( data not shown ). These authors also observed that all of the autostimulatory clones they hadgenerated ,except the clone producing the least IL-2, were capable of inducing tumours in mice, andthat the latency of tumour induction was inversely correlated with the level of IL-2 production by theclones in vitro.13Several groups have generated autostimulatory cells in mouse IL-3-dependent cell lines, ( Hapel et al,1986; Jirik et al., 1987; Wong et al., 1987 ). In these cases, autostimulatory clones were tumourigenic,but density-dependence and the effects of neutralising antibodies to IL-3 were not documented.Dunbar et al, ( 1989) performed an elegant set of experiments in an IL-3 dependent autostimulatorymodel, which are discussed later. Cells of an IL-5-dependent line spontaneously acquired the abilityto produce IL-5 during culture, as a result of the activating insertion of an IAP 5' of the IL-5 gene.Proliferation of these autostimulatory cells was partially inhibited by a neutralising monoclonal antibodyto IL-5 ( Tohyama et al., 1990 ).Some salient observations resulting from this considerable body of investigation in the field ofautostimulatory hemopoietic tumourigenesis are as follows:1. The weight of the evidence suggests that autostimulatory mechanisms are probably involved in thepathogenesis of acute myeloid leukemia, and may be involved in the development of otherneoplasms.2. In instances where attempts have been made to inhibit the growth of autostimulatory cells withantagonists of the growth factor or its receptor, investigators have either failed to see any inhibition, orobtained incomplete inhibition. In no instance has growth factor antagonism been reported to result inthe death of the autostimulatory cells.These observations have prompted the present investigation into the inhibition of autostimulatorygrowth with growth factor antagonists. The answer to the question of whether blocking the action ofgrowth factor can lead to the death of the cells of an autostimulatory tumour has clear implications forthe feasibility of developing growth factor antagonists as therapeutic agents in some forms ofmalignant neoplasia.4) EXPERIMENTAL STRATEGYIn its most general form, the question that this project was designed to address can be stated simplyas: can specific antagonism of the relevant growth factor result in the death of growth factor-dependent autostimulatory cells? Underlying this question is the hope that a positive answer mightencourage the development of substances that could find clinical application in inhibiting the growth14of human tumours that have an autostimulatory component, with minimal non-specific toxicity. Inchoosing an experimental model, the following criteria were considered:1) The model should be as near to clinical relevance as practicable. The cells should be ofmammalian origin, preferably, and the autostimulatory cells should produce malignant tumoursin animals.2) The cells should for practical reasons be "immortal" in vitro, allowing repeated studies ofcells of essentially homogeneous phenotype.3) The growth factor requirements of the cells used should be well understood ( in so far as itis possible to say this of any mammalian cells ), and the required growth factor(s) should not bephysiologically present in the circulation in concentrations that would support growth of thesecells.4) In order to facilitate the interpretation of results, the nature of the cells should be such thatinterference with the factor-receptor interaction to the extent of factor starvation would lead tocell death, rather than merely growth arrest, i.e. the cells should be factor-dependent ratherthan merely factor-responsive.5) The proposed autostimulatory growth factor cDNA should be available, so that it would bepossible, given an appropriate expression vector, to introduce this cDNA into the chosencells and thereby render them autostimulatory. This would offer the advantage that one mightbe able to regulate the level of production of growth factor by using an inducible promoter,permitting one to address the question of whether varying the amount of factor producedwould vary the resistance of the autostimulatory loop to antagonists.6) The proposed autostimulatory growth factor should be one to which neutralisingantagonists that function by interfering with the interaction between the factor and its cell-surface receptor would be readily available.Of all mammalian cell types that have been studied and manipulated in vitro, those best conforming tocriteria 1-4 are those of the hemopoietic system. Since almost all reports of putative pathologicalautostimulatory loops in hemopoietic neoplasias have concerned myeloid cells, the criterion of clinicalrelevance determined the choice of a myeloid cell line. Given the availability of cell lines, and therelative ease of manipulation of the animal in the laboratory, cells of murine origin were deemed to be15most suitable for these studies. At the time of initiating these studies, the only known specifichemopoietic growth factor antagonists were antibodies. In view of the size of these molecules, relativeto most pharmacological therapeutic reagents, hemopoietic cells provided an ideal model, since theyare, in general, readily accessible to substances present in the circulation.The following subsidiary criteria were established to determine the system finally selected for study:a) The cells should be responsive to more than one growth factor so that optimal controls fornon-specific toxicity of antibody preparations could be performed. Thus, an antibodypreparation which inhibited proliferation of the cells in the presence of growth factor A, couldbe shown to have no effect on the same cells in the presence of growth factor B atconcentrations at which its inhibitory effect was specific.b) The growth factor requirement of the cells should be such that one of the factors to which itwould be responsive could be anatagonised by antibodies of a species in which one couldproduce tumours using the auto-stimulatory cells. In the assessment of the inhibition oftumour growth in vivo, one might otherwise expect significant interference with the activity ofinjected antibodies due to immune response to xenogeneic protein.c) It would be desirable to select a system in which inhibitory antibodies to the receptor, as wellas to the growth factor were available, as this would allow a second line of attack shouldantagonism by anti-factor antibody alone prove insufficient to prevent survival ofautostimulatory cells.A system was designed conforming to all these criteria, in which cells of the imortal cell line FD.C/2were made autostimulatory using a human IL-2 cDNA. Le Gros et al. ( 1985 ) derived the IL-2responsive clone, FD.C/2, from an IL-3-dependent murine myeloid cell line ( FDC-P2, Dexter et al.,1980 ). The cells of this line can be grown in either IL-2 or IL-3 and human IL-2 is an effective ligand forthe mouse IL-2 receptor ( see, e.g., Taniguchi et al, 1986, and references therein ). Hybridomasproducing murine neutralising monoclonal antibodies to human IL-2 ( DMS-1 and DMS-2, Smith et al.,1983 ), and rat neutralising monoclonal antibodies to the mouse IL-2 receptor ( PC61, Lowenthal etal., 1985) were readily available. A human IL-2 ( hIL-2) cDNA had been cloned and expressed, using aretroviral vector, in an immortal mouse IL-2-dependent T-cell line, rendering infected cellsautostimulatory and tumourigenic ( Yamada et al., 1987 ). Neither IL-2 nor IL-3 are present in themouse circulation at levels sufficient to support the proliferation of physiologically responsive cellsother than those in the immediate micro-vicinity of the source of these factors, except in conditions of16severe immunological stress such as hyperimmunisation or graft-versus host disease ( Kuziel andGreene, 1991, Schrader, 1991 ). Thus, autostimulatory derivatives of FD.C/2 cells would most likelygrow as tumours by an autostimulatory mechanism in mice of the strain of origin ( DBA/2 ). Althoughthis system would involve stimulation of myeloid cells with IL-2, which is traditionally thought of as alymphoid-cell stimulatory factor ( see e.g. Smith, 1988, Kuziel and Greene, 1991 ), severalpublications have reported data on the presence of IL-2 receptor molecules on myeloid cell lines ( LeGros et al., 1985, Koyasu et al., 1986, Le Gros et al., 1987) on monocytes ( Hermann et al., 1985,Armitage et al., 1986, Rambaldi et al, 1987, Hotter et al., 1987 ), and on the blasts of acute myeloidleukaemias ( Hermann et al., 1985, Armitage et al., 1986, Yamamoto et al., 1986) by the time ofcommencement of this project. These data suggested at least the possibility that IL-2 might serve asan autostimulatory growth factor in some stage of the pathogenesis of myeloid leukaemias, increasingthe clinical relevance of the proposed model system.17RESULTS1. CREATION AND CHARACTERISATION OF AUTOSTIMULATORY CLONESA) CHARACTERISTICS OF FD.C/2 CELLS.i) IL-2 and IL-3 growth responses.Prior to any attempt to create autostimulatory clones, the growth of FD.C/2 cells in response to variousconcentrations of IL-2 and IL-3 was determined. When cells were maintained in medium containingboth IL-2 and IL-3, growth responses were as represented in figure 1.1. Ample responses to both IL-3and IL-2 were observed, but the IL-3 response tended to be stronger than the IL-2 response, in termsof maximal thymidine incorporation. When cells were grown in IL-3 in the absence of IL-2 for 10passages ( 50 days ), the proliferative response to IL-2 was very poor in comparison to the response toIL-3 ( fig. 1.2A ). When such IL-3-passaged cells were washed free of IL-3 and replated in IL-2 alone,the cell population was observed to undergo a crisis such that there was a net decrease of viable cellnumbers, with death of some 90% of the population over 2 weeks. Most of this death was apparent inthe first 48 hours, followed by the outgrowth of the remaining cells. Cells that had been "converted" toIL-2-dependent growth in this manner showed similar maximal responses to IL-2 and IL-3 in 3H-thymidine incorporation assays ( fig. 1.2B) . Moreover such IL-2-passaged cells did not undergo acrisis when reconverted to IL-3-dependent growth, but continued to proliferate in the absence of IL-2( but the presence of IL-3 ) without any evidence of cell death, or decline in proliferation rate. Theseresults are consistent with the findings of Le Gros et al. ( 1985 ), who examined the conversion of theparent IL-3-dependent cells ( FD.C/1 ) into FD.C/2 cells. These authors were unable to detect the p55chain of the IL-2 receptor on the surface of the FD.C/1 cells, but after the conversion crisis, theresulting growing cells, which they designated FD.C/2, displayed "readily detectable" levels of p55 asdetermined by FACS analysis. Furthermore, addition of IL-3 to these FD.C/2 cells growing in thepresence of IL-2 did not affect levels of cell-surface p55, whereas withdrawal of IL-2 and replacementwith IL-3, while allowing continued growth, resulted in a 50% decline of cell-surface p55 within 20hours ( ibid. ).Very high concentrations of murine IL-4 permitted the survival of some FD.C/2 cells for a few days,yielding a 3H-thymidine-incorporation curve as seen in figure 1.1, part B. The cells could not,however, be maintained in passage medium containing IL-4 alone.120000100000 -—0-- thIL-2 (100U/ml)CACA (44M°20000 -CPMA18Factor dilutionB 30002000 -CPM —a— miIL-4 (10000/m1)1000 -I^12^4^16 32 64 128 256 512 MA.Factor dilution2^4^8 16 32 64 128 256 512 M.A.Fig. 1.1. Factor responses of FD.C/2 cells maintained in IL-2 and IL-3 A) FD.C/2 cells that had beenpassaged in a mixture of IL-2 and IL-3 were plated at 500 cells per 10 per well in Terasaki HLAmicrotiter plates on titrations of IL-3 ( CACA - a synthetic murine IL-3 kindly provided by Dr. IanClark-Lewis of the Biomedical Research Centre ) or IL-2 ( recombinant human IL-2 ). After 48 hoursof incubation, wells were pulsed with 3H-thymidine and incubation continued a further 12 hours beforeharvesting. B) FD.C/2 cells that had been passaged in a mixture of IL-2 and IL-3 were assayed forproliferative response to mouse IL-4. 48 hour incubation followed by 12 hour 3H-thymidine pulse. Theconcentrations of factor indicated in the legend represent the final concentration in the first well of thetitration. The units given are as calculated from the manufacturers specifications ( see Appendix 1 ).Error bars in this and all subsequent 3H-thymidine assays show standard error of the mean of .triplicates. M.A. indicates medium alone - i.e. without growth-factor.B--a-- CACA (2114/m1)(100U/n1)CPM14000 ^12000 -10000 - 4000 -2000 -019A20000CPM 10000 - CACA (211g/m1)--e r-- rhtL-2 (100U/m1)2^4^8 16 32 64 128 256 512 M.A.Factor dilution2^4^8 16 32 64 128 256 512 MA.Factor dilutionFig. 1.2. Factor responses of FD.C/2 cells maintained in IL-2 or IL-3 A) FD.C/2 cells that had beenpassaged in IL-3 were assayed for response to IL-2 and IL-3 as in figure 1.1. After 36 hours ofcultivation, wells were pulsed with 3H-thymidine and incubation continued a further 6 hours beforeharvesting. B) FD.C/2 cells that had been passaged in IL-2 were assayed for response to IL-2 and IL-3.20In the absence of exogenous IL-2 or IL-3, FD.C/2 cells were not only unable to incorporate 3H -thymidine ( M.A. in figure 1.1 ), but died within 24 hours of withdrawal of growth factor. This conclusionwas supported by phase-contrast microscopic inspection of proliferation assays such as that shown infigure 1.1, and by a separate experiment in which cells were washed free of factor-containing passagemedium, and replated in 5 ml cultures in medium without factor at 10 5 cells/ml. After 24 hours, thesecultures were harvested by centrifugation and the cells resuspended in 10 pi of medium. Ten pl ofeosin ( 2 cultures ) or trypan blue ( 2 cultures ) were added and the suspensions were examined bylight microscopy. In no instance were dye-excluding cells seen, confirming the absolute dependenceon FD.C/2 cells for exogenous growth factor for maintenance of viability. FD.C/2 cells did notdemonstrate detectable responses to GM-CSF or IL-6.While the FD.C/2 cells grow in "suspension", i.e. do not adhere to tissue culture dishes, their densityand physical characteristics are such that they will roll or otherwise accumulate under the influence ofgravity at the lowest point in a culture well or plate, and proliferation from a single cell at the edge of anundisturbed culture vessel will give rise to a "carpet" of adjacent cells. These characteristics facilitatedassays involving assessment of growth in 96-well culture plates, and cloning procedures, describedbelow.ii) Determination of G418 resistance of FD.C/2 cells.Preliminary experiments to determine the level of G418 to be used in selection of transfectants weredesigned as follows: 2 x 103 cells were plated in 1 ml of medium containing IL-2 in the wells of a 24 wellculture plate. G418 was added to the wells so as to achieve final concentrations ranging from 0 to2000 pg per ml in increments of 200 pg/ml. The cells were observed daily with a phase-contrastmicroscope. At concentrations of 1000 p.g/m1 and above, there was no apparent proliferation and allcells appeared dead by 48 hours. At concentrations of 400 pg/m1 and below, surviving cells wereapparent at up to 4 days of culture. By day 6, however, all cells appeared dead at 400 p.g/ml. On thebasis of this titration, it was decided that 500 pg/m1 G418 be used for subsequent selection oftransfectants.B) ISOLATION OF TRANSFECTED CLONES.The 112-3.1 cell line is a mouse fibroblastoid cell line that produces infectious but packaging-defectiveretrovirus, which contains hIL-2 and neomycin-resistance sequence, from the transposon Tn5 ( fig.211.3, Yamada et al., 1987 ). Cells infected with this virus can be selected in the neomycin analogueG418, and the expression of G418-resistance and of hIL-2 are under the control of Moloney leukemiavirus LTR in such cells. T2-3.1 cells were cocultivated with FD.C/2 cells in tissue-culture treated Petridishes in conditions such that a given dish might be left for 5 days without overgrowth of either cellpopulation. 2 x 105 cells of the 'F2-3.1 line were seeded onto dishes, and allowed to adhereovernight. The following day, dishes were gently agitated by hand, and the medium was removedalong with any dead or otherwise non-adherent cells. The medium was replaced with mediumcontaining mIL-2, in which were suspended 4 x 10 5 FD.C/2 cells. After 5 days, the non-adherent cellswere aspirated, washed by centrifugation twice, and plated at a density of 50 cells/m1 in soft agar withmedium containing mIL-2 and G418 at 500 µg/ml. Colony growth was observed over the next 10 - 14days, and 8 individual colonies were plucked with a pulled Pasteur pipette, and plated into individualwells of a 24-well plate, each containing 1 ml of mIL-2 medium and G418 at 50011g/ml.Cells were allowed to grow out of the agar into the liquid medium, and when the cells formed a carpetof over half the floor of the well, the contents of each well were gently resuspended and 500 ttl of thecontents of each well were transferred to an empty well, and 5000 of medium containing G418, butno IL-2, was added to these fresh wells. This process of weaning from exogenous IL-2 in thepresence of G418, was continued until, between two and three weeks after the initial plucking ofcolonies, the contents of a well were resuspended and washed free of any remaining exogenous IL-2that might have been carried over from the original plating, and replated in fresh medium containingG418, but no IL-2, at a density of 2 x 10 5 cells per ml. This high density was selected on the basis ofthe density tolerated by parental cells in super-saturating levels of IL-2, and in the expectation that theclones would show density-dependent growth ( see Hoffer et al., 1987, and section D, below ). Of the8 colonies initially plucked, 5 survived this weaning process, the remaining 3 dying within the firstweek of weaning. The cells of these surviving populations resembled the parental FD.C/2 cellsmorphologically ( under phase-contrast microscopy ), and showed no tendency to adhere to tissue-culture plastics. These 5 clones were designated FD.0/2'P.1 through '11.5.After this weaning process, cells were passaged in medium without IL-2 by 1:1 dilution every secondor third day, following inspection of the plates. While such passages were routinely performed in theabsence of G418, a succession of three passages in the presence of 500 µg/ml G418 wereperformed approximately once every two months, with little or no apparent cell death attributable tothe presence of G418.H h11.-2 cDNA 1Fig. 1.3. The proviral construct used to make IF2-3.1 cells. LTR - Moloney Murine Leukaemia VirusLTR, NeoR - Neomycin resistance gene from Tn5, SV40 on - origin of replication of SV40 virus, pBRon - bacterial origin of replication.23C) GROWTH CHARACTERISTICS OF AUTOSTIMULATORY CLONES.i) Confirmation of FD.C/2 derivation of FD.C/2T cells - response to exogenous growth factors.The morphology of the resultant cloned cells, and the process in which they were created ( since non-transformed fibroblasts, such as the 11,2-3.1 cells, are unable to grow in agar ), made it unlikely that theclones were of other than FD.C/2 origin. Assays of the response of these clones to exogenous IL-2and IL-3 were performed to confirm that these cells were FD.C/2 derived and that IL-2 and IL-3responsiveness were maintained, despite growth in the absence of exogenous IL-2 or IL-3. Initialexperiments using the same cell-density as used in bio-assays of parental FD.C/2 cells ( 500 cells in10111 per well of a Terasaki microtiter tray ), while revealing some apparent response to IL-2 and IL-3,showed that such response might be largely concealed by the degree of proliferation evident in theabsence of added factors ( fig. 1.4 ). The bio-assays were repeated at lower cell-densities ( 200cells/100well ) , and over a broader range of IL-2 and IL-3 doses to increase the likelihood of coveringthe range of concentrations at which an effect would be apparent. The results showed that all 5 lineswere responsive to exogenous IL-2 and IL-3 ( fig. 1.5 ). A comparison with IL-2-passaged parentalFD.C/2 cells of the responsiveness to IL-2 and IL-3 was undertaken. The results of this comparison inone clone are shown in figure 1.6. Interestingly, while responses to exogenous IL-3 were qualitativelysimilar, the shape of the IL-2 response curve of the FD.0/2'P.1 cells was very different from that of theparental FD.C/2 cells - significantly less IL-2 being needed to achieve maximal growth stimulation ofthe 'PA cells. Figures 1.4, 1.5 and 1.6 show that the FD.0/2'P cells are capable of incorporating 3H-thymidine in the absence of any exogenous factor.ii) Density dependence of FD.C/2 111 clones.Although proliferation continued in the absence of exogenous IL-2 for many passages ( over 100 forsome of the clones ), a few dead cells ( up to 5% of the total cell number ) were often observed at thetime of passage. When populations were depleted of the majority of dead cells, by Ficoll gradientcentrifugation, it was possible to maintain a higher level of viability ( > 98% viable cells, as judged byeosin uptake ) by passaging daily on a 2:1 dilution basis ( 2 volumes of existing culture to 1 volume offresh medium ). Parental cells maintained in IL-2 ( or IL-3, or IL-3 + IL-2) could be maintained at >99.5% viability when cell density was kept low enough to keep cells in log-phase growth ( belowapproximately 5 x 105 cells/ml ). Allowing cells of autostimulatory clones to fall to lower densities thanthose produced by the above passage conditions ( i.e. to below approximately 1 x 10 4 cells per ml ),resulted in decreased viability of these cell populations.ACPM2^4^8^16 32 64 128 256 512 M.A.Factor dilutionB90000 ^80000 -70000 -60000 -50000 -40000 -30000 -20000 -10000 -0 CPM Psi.4Psi.52^4^8^16 32 64 128 256 512 M.A.Factor dilutionFig. 1.4. FD.C/2`1' cells showed some response to IL-2 and IL-3 Cells of two of the FD.C/2T clones( Psi.4 and Psi.5 ) were assayed for responsiveness to exogenous IL-2 ( A ) and IL-3 ( B ). 500 cellsper well. 48 hours incubation followed by 12 hour 3H-thymidine pulse. The growth-factors were usedin the form of supematants and the highest concentrations were above the level required to giveoptimal responses in the FD.C/2 line ( and other IL-2 responsive cells ). In this and subsequentfigures where units of activity are not given, growth-factor has been applied from sources withoutprevious calculation of the units of activity, since interpretations of the results shown rely on internalcomparisons ( see Appendix 1 ).Psi.4Psi.5coO a) <0CO 0.<0 OfFactor dilutiondilution("1 .^.^.0 2 2 2C;<0COCO04 sr <0 CO 01 sr CO 10 OA stl7 10 Of 4114- 01 40 0CO CO`41- Of0 004 srA25PSI.2PSI.3PSI.4PSI.5B• -■^-PSI.1PSI.2PSI.3PS1.4PS1.504 st <0 410 01 sr cotn co os (0 N^co ID 01 ..1* co cD oi111^04 st 03 CO CO CO CI^. . .• OMMM01 10 0 0 0(0▪ 40 s-01 sr 173 40<I <0 COFactor dilutionFig. 1.5. Response of FD.C/2W cells to IL-2 and IL-3 was more obvious at lower initial cell densityCells of the FD.C/2,11 lines were assayed for responsivenes to exogenous IL-2 ( A ) and IL-3 ( B ). 200cells per well. 48 hours incubation followed by 12 hour 3 H-thymidine pulse. The C/21' clones arereferred to as simply "Psi.1", etc., in the legened.200000CPM 100000 -2^4^8^16 32 64 128 256 512 M.A.0A26Factor dilutionB2^4^8^16 32 64 128 256 512 M.A.Factor dilution—a--- FD.C/2—*-- C2Ps1.1—0— FD.C/2--•-- C2Psi.1Fig. 1.6. Comparison of responses of FD.C/2T.1 cells with those of the parental FD.C/2 cells  A) IL-2responses. B) IL-3 responses. Both cell lines were plated at 500 cells per well. 48 hour incubationplus 8 hour 3H-thymidine pulse. In the legend the letter "V is replaced by "Psi".27This apparent density-dependence of FD.0/2'F cells was confirmed by the following experiment.Passaged cells were washed by centrifugation and divided into medium alone or medium containingexogenous IL-2, at various cell densities. The cells were then plated out into the wells of 96-well flat-bottomed tissue-culture plates in 150121 of medium per well, and cultured for 6 weeks. Cultures wereinspected once a week, and wells scored for viable cells by phase-contrast microscopy. At higherdensities, viability of wells' contents was not determined by presence of live cells at the end of the 6week culture period, since in many cases cells in such wells had overgrown the culture medium, butby the presence of obvious proliferation at earlier time points. The results of these assays for 2 of theFD.C/2T clones are shown in figure 1.7. Although the clones differed in their ability to support theirown growth at different densities in these conditions, they all displayed a density-dependence thatwas abrogated by the presence of exogenous IL-2. In the presence of exogenous IL-2, the curves ofpercent growth-positive wells versus cell number plated per well resembled the curve constructed toassess the plating efficiency of the parental FD.C/2 cells in exogenous IL-2 ( fig. 1.8 ).iii) Production of growth factors by FD.0/2'P cells.The bio-assays used to assess production of cytokines by FD.0/2'P cells involve adding 5 of assaysample to 5 gl of target cell suspension, so the addition of spent medium ( such as that harvested fromthe FD.C/2q, clones ) to a final concentration of 50% of the contents of the first well in the proliferationassay titration, could be expected to mask the effect of small amounts of growth factor activity, due tothe relative depletion of essential nutrients in the medium of this first well. Earlier observations of thepassaging of the FD.C/2T cells ( see section ii above ) suggested that they might produce only smallamounts of IL-2 activity, and this was confirmed by preliminary experiments in which no IL-2 bioactivitywas detected in the unconcentrated supernatants of some clones. For these reasons, assays offactors produced by cells were routinely carried out on 10-fold concentrated culture supernatants.Cells were harvested from passage, washed 4 times in medium without growth factor, resuspended at2 x 105 cells/ml, and plated in 10 ml cultures in the absence of exogenous IL-2 or IL-3. After 3 days,the medium was harvested and concentrated 10-fold by Amicon ultrafiltration using a filter with amolecular weight cut-off of 5000 M r prior to performance of the bio-assays.As shown in figure 1.9, FD.0/2'P cells liberated a small but detectable amount of IL-2 into their culturemedium. These assays were performed on the T-cell line HT-2, which responds to IL-2 and IL-4 but tono other known cytokine ( Hermann et at, 1985, and see Appendix 1 ). This cell line has been widelyused to assay IL-2 activity, and was found to be somewhat more sensitive to IL-2 than the FD.C/2 cellsthemselves ( see Appendix 1 ).100 -80 -so40 -20 -% positivewells—a--- C2Psi.1 h1L2C2Psi.1. M.A.10^100^1000^10000Cells per well% positivewellsCells per wellFig. 1.7. Density-dependence curves for 2 FD.0/2'P clones. % positivewells0^.......,^• „^ —^.-^ 1 10^100^1000^10000Cells per wellFig. 1.8. Plating efficiency of FD.C/2 cells Plating efficiency was determined in the presence ofsaturating amounts of IL-2 as described in the text. The data shown for 0.33 cells per well and onecell per well represent the averages of per cent positive wells in 4 separate plates ( 384 wells ) ineach case.120000100000 -80000 -CPM 60000 -40000 -20000 -2^4^8^16 32 64 128 256 512 M.A.15000CPMC2PSI.1 CMC2PSI.3 CMC2PSI.4 CMC2PSI.5 CM2^4^8^16 32 64 128  256 512  M.A.Factor dilutionFactor dilutionFig. 1.9. IL-2 activity in the supernatants of FD.0/2'P cells A) 10-fold concentrated conditioned media( CM) of FD.C/241 cells were assayed on HT-2 cells in the presence of the neutralising anti-mlL-4antibody, 11B11. 1000 cells per well; 36 hour incubation followed by 12 hour 3H-thymidine pulse.B) Assay of responsiveness of HT-2 cells to IL-2, performed in parallel with the assays shown in partA. In the legend the letter "T" is replaced by "Psi".AB31To exclude the possibility that the result seen was due to the presence of IL-4 in the supernatants,the assay was performed in the presence of a specifically inhibitory concentration of anti-mlL-4monoclonal antibody 11B11 ( see Appendix 2 ). The stimulation of HT-2 cells by these supernatantswas no greater in the absence of this antibody and the signals seen on HT-2 cells were completelyabolished by specifically inhibitory amounts of the anti-hlL-2 antibody DMS-1 ( Smith et al., 1983, andAppendix 2 ), suggesting that the FD.0/2'P cells did not liberate any IL-4 into their culturesupernatants. The supernatants of FD.0/2'P cells were also able to stimulate the growth of parentalFD.C/2 cells, as shown in figure1.10.The retroviral construct which transferred the hIL-2 cDNA into the FD.C/2T cells, was so designedthat the production of hIL-2 and the neomycin-resistance enzyme would occur as a result of alternatesplicing of a single mRNA transcribed from the same ( 5' LTR ) promoter. As the factors controlling thissplicing are not well understood, and in particular, were not controllable or predictable within theFD.C/211' cells, it was expected that there might be variation with time, and between individual cells ofclones, as to the amount of hIL-2 produced. Additionally, temporary differences in IL-2 receptor andIL-2 consumption levels would affect the amount of IL-2 detectable in supernatants. Thesepredictions were confirmed in experiments in which supernatants were again collected from three ofthe cell lines some six months after the initial collections, similarly concentrated, and again subjectedto assay on HT-2 cells in the presence of 11B11 antibody ( fig. 1.11 ). While the amounts of IL-2activity were again small for all three clones, the relative levels of supernatant IL-2 activity produced bythe three clones were found to be different from those observed in the initial assessments.Since the parental FD.C/2 cells were known to respond to IL-3, the ( first set of ) FD.0/2P culturesupernatants were assayed for the presence of IL-3. In this instance, the culture supernatants wereassayed on R6X cells ( Schrader et al., 1983, see Appendix 1 ). A representative result is shown infigure 1.12. The apparent presence of IL-3 activity in the supernatant is confirmed by the abolition ofthe signal by a specifically inhibitory concentration of a rabbit anti-mIL-3 anti-serum, Rab7 ( kindlydonated by Dr. Hermann Ziltener, Biomedical Research Centre, see Appendix 2 ). The supernatantswere also assayed on the FDC-P1 cell line ( Dexter et al., 1980, see Appendix 1) which is known torespond to mIL-3 and to GM-CSF. Surprisingly, the activity from the supernatant detected with FDC-P1 cells was only partly abolished by Rab7 antibody, suggesting that the supernatant might alsocontain GM-CSF activity ( fig.1.13 ). Accordingly, specifically inhibitory concentrations of a rabbit anti-mGM-CSF anti-serum, Rab39 ( kindly donated by Dr. Hermann Ziltener, see Appendix 2 ), were alsoable to partially abolish the signal, confirming the presence of GM-CSF in the supernatant ( fig. 1.14 ).20000 CPM 10000 -I^I^12^4^8^16 32 64 ' 128 256 512 M.A.C2Psi.3 CMC2Psi.4 CMSupernate dilutionFig. 1.10. Response of FD.C/2 cells to FD.C/2W cell supernatants.  10-fold concentrated conditionedmedia of 2 FD.C/2,11 clones were assayed on FD.C/2 cells. 500 cells per well. 48 hour incubation plus12 hour 3H-thymidine pulse.CPM2^4^8^16 32 64 128 256 512 M.A.Factor dilutionFig. 1.11. Re-assay of FD.C/2111 supernatants 10-fold concentrated conditioned media of FD.C/2Tcells, from a separate collection to those used in figures 1.9 and 1.10, were again assayed on HT-2cells in the presence of the neutralising anti-mlL-4 antibody, 11B11. 1000 cells per well; 36 hourincubation followed by 8 hour 3H-thymidine pulse.C2 PSI.1 CMC2 PSI.3 CMC2 PSI.5 CMCPM80000 -60000 -40000 -20000 -0A2^4^8^16 32 64 128 256 512 M.A.33—ci— R6X—4■— R6X+Rab. 7Factor dilution100000I^I^I4^8^16 32 64 128 256 512 M.A.CPMFactor dilutionFig. 1.12. IL-3 activity in the supematants of FD.C/21' cells A) 10-fold concentrated conditionedmedium of FD.C/211.1 cells was assayed on R6X cells alone or in the presence of the neutralisinganti-mlL-3 antibody, Rab7. 500 cells per well. 60 hour incubation followed by 12 hour 3H-thymidinepulse. B) Assay of responsiveness of R6X cells to IL-3, performed in parallel to assays shown in partA.B,2A3420000 CPM 10000 -16 32 64 128 256 512 M.A.Factor dilution—a— FOCP-1FDCP-1+Rab.7B2^4^8^16 32 64 128 256 512 M.A.Factor dilutionFig. 1.13. IL-3-mediated response of FDC-P1 cells to FD.C/2.1 supernatant A) 10-fold concentratedconditioned medium of FD.C/2W.1 cells was assayed on FDC-P1 cells alone or in the presence of theneutralising anti-mlL-3 antibody, Rab7. 500 cells per well. 60 hour incubation followed by 12 hour 3H-thymidine pulse. B) Assay of responsiveness of FDC-P1 cells to IL-3, performed in parallel to assaysshown in part A.on FDCP-1P-1 in Rab.39--CPMA1200016 32 64 128 256 512 M.A.B2^4^8^16 32 64 128 256 512 M.A.Factor dilutionFaCtor dilutionFig. 1.14. GM-CSF-mediated response of FDC-P1 cells to FD.C/2,11.1 supernatant A) 10-foldconcentrated conditioned medium of FD.C/2T.1 cells was assayed on FDC-P1 cells alone or in thepresence of the neutralising anti-mGM-CSF antibody, Rab39. 500 cells per well. 48 hour incubationfollowed by 12 hour 3 H-thymidine pulse. B) Assay of responsiveness of FDC-P1 cells to GM-CSF,performed in parallel to assays shown in part A.36Purified antibodies from these rabbit anti-sera were not available at the time of these assays, and FDC-P1 cells were found to be slightly stimulated by rabbit serum, ( Dr. Hermann Ziltener, personalcommunication, and see figure 1.46 ). The inhibitory effect of Rab39 anti-serum in particular waspartially masked by this effect. This observation may explain the failure of a combination of Rab7 andRab39 to completely remove the signal seen on FDC-P1 cells as shown in figure 1.15 ).As a result of growing interest in IL-6 amongst workers in the interleukin field at the time of thesestudies, the FD.C/2111 supernatants were assayed on the IL-6-responsive line, 41 E5, derived by Dr.Hermann Ziltener at the Biomedical Research Centre ( see Appendix 1 ). The supernatants werefound ( fig. 1.16) to contain an activity that stimulated growth of these cells and was completelyremoved by specifically inhibitory concentrations of the anti-mIL6 monoclonal antibody 6B4 ( Vink etal., 1988, see Appendix 2 ). Exogenous sources of IL-6 activity did not, however, stimulate growth ofeither the parental FD.C/2 cells or the FD.C/211 cells.The supernatant of the parental FD.C/2 cells revealed the identical profile of growth-factor activities,with the exception of IL-2, which was not detected in 25-fold concentrated supernatant of FD.C/2cells grown in IL-3 ( fig. 1.17 ). The production of IL-3 by FD.C/2 cells is consistent with the detectionof traces of IL-3 mRNA in these cells ( Dr. J.D. Watson, personal communication }.iv) FD.0/2'P cells are functionally free of infectious retrovirus.Although retroviral infection methods of gene transfer are designed to avoid this outcome, there is arecognised incidence of recombination between endogenous and introduced retrovirus in the celllines used to generate the infectious particles, leading to the presence of infectious retrovirus in theultimate target cells. Since the presence of infectious retrovirus in FD.C/2 111 cells might well interferewith assessment of tumours resulting from in vivo growth of these cells, an assay to determine thepresence of infectious retrovirus was conducted.FD.0/2'P cells and 1/2-3.1 cells were plated into fresh medium at 2 x 10 5 cells/ml, and allowed to growfor 3 days. The supernatants were then harvested and subjected to centrifugation and 0.2 gmfiltration to remove cells. These supernatants were then applied to cultures of growing 3T3 cells( Aaronson and Todaro, 1968) as follows: culture medium was removed from the adherent 3T3 cellsby gentle aspiration, and replaced with a 1:1 mixture of filtered supernatant and fresh medium,containing 6 pg/m1 of polybrene. This was repeated every second day for 6 days. The 3T3 cells werethen harvested by trypsinisation, and replated in the presence of fresh medium containing G418 at a—a-- C2PSI.1 CM—*-- in Rb7+Rb3930000 20000 -10000 -CPM372^4^8^16 32 64 128 256 512 M.A.Factor dilutionFig. 1.15. Rabbit antibodies to IL-3 and GM-CSF partly abolish the effect of FD.C/2T.1 supernatant on FDC-P1 cells 10-fold concentrated conditioned medium of FD.C/2 11'.1 cells was assayed on FDC-P1 cells alone or in the presence of both antibody Rab7and Rab39. 500 cells per well. 60 hourincubation followed by 12 hour 3H-thymidine pulse.A38CPM2^4^8^16 32 64 128 256 512 M.A.Supernate dilutionB2^4^8^16 32 64 128 256 512 M.A.Factor dilutionFig. 1.16. IL-6 activity in the supernatant of FD.C/21 1.1 cells A) 10-fold concentrated conditionedmedium of FD.C/2`P.1 cells was assayed on 41 E5 cells alone or in the presence of the neutralisinganti-mlL-6 antibody, 6B4. B) Assay of responsiveness of 41 E5 cells to mIL-6, performed in parallel toassays shown in part A.C2PSI.1 CMC2PSI.2 CMC2PSI.3 CMPatina:14C2(1L3) CM 25xIL-2—a— IL-2 in 6xC2 CMCPM^• 9 • 9 • 9 • 9 • 9 • 9 • 9 • 9 •4^8^16 32 64 128 256 512 M.A.39Sup'ernate/factor dilutionFig. 1.17. Supernatant of FD.C/2 cells contains no detectable IL-2 activity  25-fold concentratedconditioned medium of FD.C/2 cells maintained in IL-3 was assayed on HT-2 cells. Also shown are atitration of IL-2 on the cells, alone, or in the presence of a 1/4 dilution of the 25 x supernatant. 1000cells per well. 24 hour incubation followed by 8 hour 3H-thymidine pulse.40concentration ( 60014/mlactive ) that had previously been determined to be lethal to 3T3 cells. 12 of12 separate 3T3 cultures that had been exposed to 'P2-3.1 cell supernatants contained cells thatwere able to continue growing in G418, whereas none of 12 3T3 cultures that had been exposed toFD.C/21P cell supernatants contained such cells.FD.0/2'P cell supernatants did not inhibit transfer of G418 resistance to 3T3 cells as 6 additional 3T3cultures which had been exposed to a 1:1 mixture of FD.0/2'P and 'P2-3.1 supernatants alsocontained G418-resistant cells. These results, while not completely ruling out the possibility, suggestthat it was unlikely that FD.C/2 1P cells produced infectious retrovirus. Any such virus would have lostthe ability to transfer G418 resistance, and G418 resistance or the presence of the intact G418-resistance gene could be assessed in cells recovered from any tumours that might arise following invivo transfer of FD.0/2'P cells.v) In vivo growth of FD.0/2'P cells.To assess the ability of FD.0/2'P cells to form malignant tumours, 6 to 8-week old mice of the DBA/2strain ( from which the FD.C/2 cells were derived ) were inoculated with cells of each of the 5 tumours.In each case, 5 x 10 5 cells were injected subcutaneously into each of two mice and a third receivedthe same number of cells intraperitoneally. A similar set of three mice received cells of the parentalFD.C/2 line. All 15 mice that had received inocula of FD.0/2'P cells developed subcutaneous tumoursor ascites, though the latency of the tumours ( i.e. the time between inoculation and sacrifice of theanimals due to signs of tumour growth ) varied from 6 to 10 weeks. The latency periods did not showany correlation with the amount of FD.C/2 - stimulatory activity in the supernatant of the cells of eachclone in culture. In contrast to mice that received inocula of the FD.C/2tP clones, mice that receivedFD.C/2 inocula remained healthy for at least 14 months after inoculation.2) ANTIBODY-MEDIATED INHIBITION OF GROWTH OF FD.0/2'P CELLS. A) PREPARATION OF ANTIBODIES.The data presented show that the supernatants of growing FD.0/2'P cells contained IL-2, mIL-3,mGM-CSF, and mIL-6, but no mIL-4. The parental FD.C/2 cells and their FD.0/2'P derivativesresponded to IL-2, IL-3, and IL-4, but not to GM-CSF nor IL-6. Only anti-IL-2 ( and anti-IL-2 receptor )and anti-IL-3 antibodies were tested, therefore, for their ability to inhibit growth of FD.0/2'P cells. The41IL-2 antagonist antibodies used were DMS1 and DMS2 ( Smith et al., 1983 ), mouse antibodies tohuman IL-2, and PC61 ( Lowenthal et al,. 1985 ), a rat antibody to the p55 chain of the mouse IL-2receptor. The anti-IL-3 antibody, Rab7, was used as serum ( see above and Appendix 2 )After purification of anti-IL-2 antibodies ( see Appendix 2 ), all preparations were tested for specificityon parental FD.C/2 cells grown in either IL-2 or IL-3. Examples of these specificity assays are shown infigures 1.18 and 1.19. These titrations allowed the identification of concentrations of antibody whichdisplayed specific inhibition of IL-2 or IL-3 activity. In preliminary experiments it was observed thatmaximal inhibitory activity was obtained by four days of assay, with no further cell death apparentthereafter. Inhibition experiments were therefore carried out as 4-day assays. It was claimed in theoriginal description of the antibodies DMS1 and DMS2 ( Smith et al., 1983) that they exhibited asynergistic antagonism of IL-2. Consequently, these antibodies were used as a cocktail in all theseexperiments. From figure 1.18, it will be seen that the anti-receptor antibody PC61 showed a muchgreater "window" of specific versus non-specific inhibitory activity than did the anti-hlL-2 antibodycocktail. Indeed, a combination of the DMS cocktail with PC61 was no more potent in terms of specificantagonism of IL-2 activity than was PC61 alone, possibly as a result of the combination of greateraffinity of PC61 for the IL-2 receptor than that of the DMS antibodies for hIL-2, with relatively highernon-specific cytotoxicity apparent in the DMS preparation.B) INHIBITION OF AUTOSTIMULATORY GROWTH OF FD.0/2W CELLS BY ANTIBODIES.i) Antibody antagonists of IL-2 significantly inhibit autostimulatory growth.Cells of FD.0/2W lines were plated at 250 cells per well in the presence of maximal specifically-inhibitory concentrations of either the DMS cocktail or the PC61 antibody. In these conditions, it waspossible to significantly inhibit the growth of all clones, and all antibody-containing wells containednumerous dead cells. ( This phase-contrast microscopic appearance was substantiated by uptake oftrypan blue ). Nevertheless, visual observation, as well as thymidine-incorporation data, revealed thatall antibody-containing wells contained live cells. The IL-2 antagonism exhibited by the antibodiescould be overcome by exogenous IL-2 and circumvented by exogenous IL-3, confirming that theseclones were not susceptible to a non-specific toxic effect of the antibodies. Since FD.C/21/ cells hadbeen found to liberate small amounts of IL-3, and displayed proliferative responses to IL-3, it waspostulated that this residual cell growth may have been due to the presence of this IL-3. The amountof IL-3 in question appeared from the FD.C/2W cell supernatants to be very small in comparison withthat used for assaying the inhibitory specificity of the anti-IL-3 anti-serum.32 64 128 256 No ab.4 8 1620000424^16 32 64 128 256 512 No abDilution of ab.IL-2IL-3Fig. 1.18. Specificity assay for the preparation of PC61 antibodies used in these studies Thepreparation of purified PC61 antibody was titrated onto FD.C/2 cells passaged in a mixture of IL-2 andIL-3, growing in approximately one unit of IL-2 or one unit of IL-3, as indicated. 500 cells per well. 48hour incubation followed by 8 hour 3H-thymidine pulse. The highest concentration of antibody in thetitration was approximately 50 p,g/m1( see Appendix 2 ).IL-211-3Dilution of ab.Fig. 1.19. Specificity assay for the preparation of DMS antibodies used in these studies  Thepreparation of purified DMS antibody was titrated onto FD.C/2 cells passaged in a mixture of IL-2 andIL-3, growing in approximately one unit of IL-2 or one unit of IL-3, as indicated. 500 cells per well. 48hour incubation followed by 8 hour 3H-thymidine pulse. The highest concentration of the antibodypreparation used was approximately 200pg/m1( see Appendix 2 ).43Accordingly, a concentration of Rab7 was selected which, while able to inhibit a unit of IL-3 activity( see Appendices 1 and 2 ), showed no stimulatory activity on FD.C/2 cells, and the anti-IL-2 antibodyexperiments were repeated in the presence of this concentration of Rab7 anti-serum. The resultswere simlilar to those obtained with the DMS and PC61 antibodies alone - all wells contained live cellsafter 4 days, demonstrating that IL-3 secreted by the cells did not account for their continued growth.Thymidine-incorporation data from the clone showing the greatest susceptibility to inhibition areshown in figures 1.20 and 121.ii) Surviving cells are not mutants with respect to IL-2-dependence.The incomplete inhibition by antibodies suggested the possibility that mutations may have arisenwithin the FD.C/211' clones, rendering mutant cells independent of autostimulatory IL-2. To test thispossibility, surviving cells from antibody inhibition experiments of each clone were harvested fromantibody-containing wells, and cultivated in the presence of saturating concentrations of IL-2 untilthey had reached sufficient density to wash them free of exogenous IL-2 ( 10 to 14 days ), andreturned to passage in medium alone. After 2 passages in the absence of exogenous IL-2, theantibody inhibition experiment was repeated, and yielded qualitatively similar results to those initiallyobserved. In each case, most but not all cells died, and all antibody-containing wells contained viablecells. This result demonstrated that the antibody-surviving cells had not undergone a mutation thatrendered them insusceptible to the effects of IL-2 antagonist antibodies.C) AUTOSTIMULATORY FD.C/2T CELLS HAVE A MARKED ADVANTAGE OVER FD.C/2 CELLS INACCESS TO GROWTH FACTORS.Although significant inhibition of growth of FD.C/24' cells by antibodies had been demonstrated, thefailure to bring about the death of all cells was surprising in view of the paucity of IL-2 liberated bythese cells, as determined by the collection of conditioned medium ( see section 1,C, iii, above ), incomparison to the inhibitory capacity of the antibody preparations. Autostimulatory cells will consumea portion of the factor they synthesise, so the amount of factor found in collections of conditionedmedium is a poor reflection of the ongoing synthesis of factor by such cells. In order to better assessthe amount of IL-2 ( and IL-3) produced by autostimulatory cells, a strategy was designed todetermine the abililty of FD.C/2tI, cells to support the growth of the parental FD.C/2 cells underconditions of co-culture. Under these conditions, the FD.C/2 cells would have "immediate" access togrowth factor present in the wells in which it was being synthesised by FD.C/2T cells.C,)<73.0r-00448000060000c p m 40000200000Fig. 1.20. PC61 antibody significantly and specifically inhibits the growth of FD.C/2 11' cells FD.C/2`11.5cells were assayed alone, in the presence of neutralising anti-mlL2-receptor antibody, PC61( approximately 5 gg/m1), or in the presence of antibody and either IL-2 or IL-3. 250 cells per well. 96hour incubation followed by 16 hour 3H-thymidine pulse.1000008000060000CPM40000200000 C,)-J^-J+0^O0Fig. 1.21. DMS antibody significantly and specifically inhibits the growth of FD.C/2tFcells  Growth ofFD.C/2`1'.5 cells was assayed alone, in the presence of neutralising anti-mIL2 antibodies, DMS1 andDMS2, ( approximately 40 lig/m1)or in the presence of antibodies and either IL-2 or IL-3. 250 cells perwell. 96 hour incubation followed by 16 hour 3H -thymidine pulse.45i) Co-culture with populations distinguished by fluorescence.Cells of the parental FD.C/2 line were stained with the fluorescent dye PKH2 so as to be able todistinguish them from unmarked FD.C/2 111 cells during the experiment. PKH2 has similar excitationand emission characteristics to fluorescein. This dye was chosen because it was claimed by thesupplier to be a) evenly partitioned amongst daughter cells of a stained cell, b) not susceptible toleaking from viable cells, and c) not taken up by cells in tissue culture conditions. Staining of cells withthe dye required brief incubation with a supplied ( proprietary ) staining solution, in the absence ofserum or culture medium, at room temperature. The staining solution was found to be toxic to cells,but after preliminary experiments in which duration of the staining period was varied between 4 and10 minutes, stained cells were derived whose response to IL-2 was similar to that of unstained FD.C/2cells ( fig. 1.22 ). One x 105 stained FD.C/2 cells were co-cultivated with proliferating 3T3 fibroblasts( initially approximately 10% confluent in a 100mm tissue culture dish ) in the presence or absence of1L-2 for 6 days. At the end of this period the dish was gently agitated by hand, and non-adherent cellswere harvested, pelleted by centrifugation, and subjected to fluorescence microscopy. When IL-2had been present in the culture, 98% of the non-adherent cell population were fluorescent, theremaining 2% consisting of dead cells and cells with fibroblast morphology. The adherent populationwas harvested by trypsinisation, and contained no detectable fluorescent cells ( i.e. less than one in1600 ). When IL-2 had been omitted from the culture medium, no viable fluorescent cells were foundin either adherent or non-adherent populations. These results substantiated the manufacturersclaims, and suggested that PKH2 cells would be suitable for the proposed co-culture assays.A preliminary experiment was conducted in which 250 cells of the line FD.0/2'P.1 were co-cultivatedwith PKH2-stained washed FD.C/2 cells, in the presence or absence of saturating amounts of IL-2.Wells were examined after 4 days, and as expected, wells plated with IL-2 contained numerousfluorescent cells. In wells to which no IL-2 had been added, however, no fluorescent cells could beseen, suggesting that so little IL-2 was liberated by the FD.0/2'P.1 cells, that they would not supportthe growth of FD.C/2 cells. The experiment was repeated but scored after 3 days of co-culture withsimilar results. Thymidine-incorporation assays were performed on cultures established in parallel withthis 3 day assay ( fig. 1.23 ).These experiments were unsatisfactory on several counts. Firstly, it was noted during theseexperiments that fluorescence was much more difficult to judge in Terasaki wells than on a microscopeslide, a potential source of error particularly since cells that would survive 4 days would be likely to bedaughters or grand-daughters of those originally stained, and therefore would fluoresce with lesserintensity. Secondly, it was impossible to be sure that transfer of the contents of a well to a slide wouldC P4640000 30000 -- Control- Stained cellsCP M 20000 -1000002^4^8^16 32 64 128 256 512 M.A.Factor dilutionFig. 1.22. Growth-factor response of stained FD.C/2 cells is similar to that of unstained cells Assay ofresponsiveness of PKH2-stained FD.C/2 cells to IL-2, in comparison with unstained cells. 500 cellsper well. 36 hour incubation followed by 12 hour 3H-thymidine pulse.Fig. 1.23. Assessment of the ability of FD.C/2T 1 cells to support the growth of FD.C/2 cellsFD.0/2'P.1 cells were plated at 250 cells per well, either alone or with 50 FD.C/2 cells. The cells wereplated either in medium alone, or with a saturating concentration of IL-2, as indicated. ( Psi.1 =FD.C/2T.1 cells ). 3 day assay followed by16 hour 3H-thymidine pulse.47be complete, and that no fluorescent cells would be missed. Thirdly, PKH2-stained cells were a finiteresource, in that staining of a population would eventually diminish with time in passage, and stainingof another population would be necessary prior to each set of experiments.ii) Co-culture with cells distinguished by hygromycin resistance.As an alternative to the use of dye, therefore, a population of FD.C/2 cells was marked by transfectionwith a vector that rendered them resistant to the antibiotic hygromycin B. The plasmid used is shownin figure 1.24. Linearisation and electroporation of the plasmid into FD.C/2 cells yielded a clone( FD.C/2Hyg ) of cells that were resistant to 600 pg/m1 of hygromycin B, whereas untransfected cellswere killed by 500 µg/ml in 8 days. Like the parental FD.C/2 cells, these cells showed vigorousproliferative responses to IL-2 and IL-3 ( fig. 1.25 ). Two clones of FD.C/2W cells ( FD.0/2'P.1 andFD.C/21'.2 ) were assayed for resistance to hygromycin B, and were found to be killed by 500 µg/ml.Conversely, FD.C/2Hyg cells were killed by 500 gg/mIG418.Co-culture experiments were conducted as follows: Each well of a Terasaki microtiter plate wasseeded with 50 cells of the FD.C/2Hyg line in 5 pl of medium. To 18 wells 500 cells of the FD.0/2'P.1line were added, to 18 wells, 150 cells, and to 18 wells 50 cells of the FD.C/2tY 1 line, in each case in5 p.I of medium. To the remaining 6 wells, as a positive control, 50 FD.C/24'.1 cells were added in 5 p.Iof medium supplemented with twice the amount of IL-2 used to passage IL-2 dependent FD.C/2 cells.This resulted in assays in which "stimulator" ( FD.C/21'.1 ) cells and "responder" ( FD.C/2 cells ) werepresent at 10:1, 3:1, and 1:1 ratios, at cell numbers at which it was known that consumption of factorsother than IL-2 would not limit growth. After 3 days of co-culture, to each well was added 10 p.I ofmedium containing twice the passage-medium concentration of IL-2 and 1.2 mg/ml of hygromycin B.Incubation was allowed to proceed for a further 8 days, when 5 p.I of medium was carefully removedfrom each well without disturbing the cells, and replaced with 5µI of 3H-thymidine for a further 16 hoursof incubation. This manoeuvre was necessary as the size of the wells prohibits harvesting volumesgreater than 20 pi As a "negative" control for each assay, another Terasaki was set up with identicalconditions except that the FD.C/2Hyg were suspended in medium containing G418 at 1000 pg/ml.The final G418 concentration in the wells during the first 3 days of assay was thus 500 gg/m1 -sufficient to kill the FD.C/2Hyg cells, but to allow growth of the FD.C/2 1F cells. The medium added tothese wells after 3 days, containing IL-2 and hygromycin, also contained 500 pg/mI of G418.48Kmn1(411 I) Xhol(451)TIC prAmppMCI HygPolyAHPHTK pANnHit-KUM:2265)SoliSamH1(2245)I)Fig. 1.24. The vector used to confer hygromycin resistance upon FD.C/2Hyg cells  This vector wasconstructed by replacing the Miul - Rsrll NeoR fragment of pMC1NeoPolyA with a Hindi,' - BglIlfagment of pSV2Hyg containing the hygromycin phophotransferase coding sequence. Both origirtalplasmids were kindly donated by Dr. Jamey D. Marth of the Biomedical Research Centre. TK pr -Herpes simplex virus thymidine kinase promoter; HPH - hygromycin phophotransferase codingsequence; TK pA - Herpes simplex virus thymidine kinase poly-A addition signal; Amp - Ampicillinresistance gene. The plasmid was linearised at the Xmnl site prior to electroporation.49This assay was performed with FD.C/2W.1 and FD.C/2t11.2 cells as "stimulator" populations. Theresults are shown in figure 1.26. In the assays set up with G418 ( and hygromycin ), no viable cellswere apparent by inspection at the end of the assay period. Assays without G418, revealed that bothFD.C/2T.1 and FD.C/2 11'.2 cells were capable of supporting the growth, or survival, of FD.C/2Hygcells, but only at the highest (10:1 ) ratio used. The presence of exogenous IL-2 during the first threedays of the assay resulted in the expected proliferation of hygromycin-resistant cells.The remaining 3 clones of FD.0/2'P cells ( .3, .4, and .5) were also subjected to this assay. Two ofthese remaining 3 clones ( .4 and .5) were capable of supporting growth of hygromycin-resistant cells,but only at the 10:1 ratio of "stimulators" to "responders", as judged by visual inspection of wells at theend of the hygromycin selection period. The FD.C/211'.3 clone was not capable of supportingFD.C/2Hyg cells in these conditions.D) AUTOSTIMULATORY FD.C/2 11' CELLS ARE MARKEDLY MORE RESISTANT TO GROWTHINHIBITION BY IL-2-INHIBITORY ANTIBODIES THAN ARE FD.C/2 CELLS.Since co-culture conditions had been established in which FD.C/2Hyg cells were supported byFD.0/2'P cells, assays were designed to address the question of whether in these conditions,surviving FD.C/2Hyg cells were resistant to IL-2-antagonist antibodies. Assays were performed inwhich 500 FD.0/2'P cells and 50 FD.C/2Hyg cells were co-cultured in the presence or absence ofspecifically inhibitory concentrations of DMS or PC61 antibodies. Each well of 4 Terasaki plates wasseeded with 50 FD.C/2Hyg cells in 5 jil of medium. Cells of the FD.0/2'P.1 and FD.0/2'P.2 cloneswere suspended in medium alone or in medium containing specifically inhibitory concentrations ofeither the DMS or PC61 antibodies. 5 ill of medium containing 500 cells of either the FD.0/2'P.1 clone( 2 plates ) or the FD.C/2W.2 clone ( 2 plates ) was added to the Terasaki wells, so that in each plate, 18wells contained FD.C/2111 cells and FD.C/2Hyg cells in medium alone, 18 contained cells in mediumwith DMS antibody, and 18 contained cells in medium with PC61 antibody. After 3 days of co-culture,10 gl of medium containing a saturating concentration of IL-2 and 1.2 mg/mI hygromycin was added toeach well of two plates ( one containing FD.C/2tP.1 cells and the other containing FD.0/2'P.2 cells as"stimulators" ), and 10 ill of medium containing IL-2 and 1 mg/mI G418 to each well of the other twoplates. Incubation was allowed to proceed as previously, for 8 days in the case of hygromycin-containing plates, but only 4 days in the case of G418 plates, since this was known to be sufficient tokill all G418 susceptible cells at this concentration of G418.2500020000 -15000 -10000 -5000 -^0 --t^2^4^8^16 32 64 128  2 56 512 M.A.CPM —a-- FO.C/2C2HygA50CPM—o--- FO.C/2C2Hyg II^I2^4^8^16 32 64 128 256 512 M.A.Factor dilutionBFactor dilutionFig. 1.25. Growth-factor responsiveness of FD.C/2Hyg cells is similar to that of FD.C/2 cells  A) IL-2responses. B) IL-3 responses. 500 cells per well. 36 hour incubation followed by 12 hour 3H-thymidine pulse.51The results of these assays are illustrated in figure 1.27. For both the FD.C/2111.1 and FD.0/2'P.2clones, all antibody-resistant cells were shown to be G418-resistant, but hygromycin-sensitive, theprofile expected of the autostimulatory FD.C/2W cells. These data demonstrate that the survival ofFD.C/2Hyg cells resulting from the presence of FD.C/24' cells was completely abrogated by IL-2-inhibitory antibodies in conditions in which the growth of the FD.C/2T cells was only partially inhibited.E) THE IL-2 RECEPTORS ON FD.C/21' CELLS ARE UNLIKELY TO ACCOUNT FOR THE GROWTHADVANTAGE OF THESE CELLS.Several possibilities were proposed to account for the significant advantage of these autostimulatorycells over the parental cells with respect to access to IL-2 stimulation of growth. A) Some alteration inthe IL-2 receptors resulted in a higher affinity for IL-2. B) Autostimulatory cells were capable ofreceiving IL-2 "signals" from IL-2 within the cells (see introduction ). C) An IL-2 signal was delivered toautostimulatory cells at the cell surface, as is the case with cells dependent on exogenous IL-2, butfeatures of the cell surface micro-environment ( for instance, the glycocalyx ) might result in theretention of secreted IL-2 in a manner which impeded liberation of the IL-2 from the cell surface andgave the secreting cell more immediate access to this IL-2 than a neighbouring non-producer.The original report describing the creation and use of PC61 antibody ( Lowenthal et al., 1985 )showed that although PC61 could effectively block high affinity binding of IL-2 to cells, IL-2 wasunable to block the binding of PC61. It was thus apparent that PC61 might be used to assess cell-surface levels of the IL-2 receptor p55 chain, even in the presence of IL-2. Consequently, fluorescentcell-sorting analysis of FD.C/2 and FD.C/21, cells for expression of the p55 chain of the mIL-2receptor was undertaken to exclude differences in receptor number. [ These data were collected withthe assistance of Dan Zecchini at the UBC Acute Care Unit FACS facility ]. Cells were initially washedseveral times as for a proliferation assay, then resuspended in buffer alone or in buffer containingPC61 antibody at approximately 200 pg/ml. After incubation on ice and washing, the samples wereincubated with a fluoresceinated sheep anti-rat antibody, incubated on ice again, washed, andsubjected to analysis. After gating out dead cells on the basis of forward scatter, results of secondaryantibody ( "background" ) staining, and PC61 plus secondary staining, were collected for each cellline. As seen from the results shown in figure 1.28, no significant difference in the percentage of cellsjudged positive for PC61 staining was found between any of the FD.C/2T cells and the FD.C/2 cellsgrown in IL-2. Indeed, the profiles of these cells were superimposable. The FD.C/2 cells that weregrown in IL-3 displayed a distinctly lower level of PC61 staining than those grown in IL-3, anobservation consistent with those of Le Gros et al. ( 1985 ).A^100000100001000CPM10010cs52CPM1000001 0000100010010 x9x• (0OxCoFig. 1.26. FD.C/2T cells support the survival of FD.C/2Hyg cells at high stimulatorresponder ratiosA) C211.1 cells as stimulators. B) C241.2 cells as stimulators. Ratios are indicated. +G- assays withG418, +H - assays with hygromycin ( see text ). Note logarithmic scale of 3H-thymidine incorporation.Results of less than 200 counts correspond to the absence of viable cells.53This analysis excluded the possibility of significant differences in IL-2 receptor distribution ( or, at least,p55 chain distribution ) accounting for the growth advantage of FD.C/211 cells. At the time of thesestudies, no antibody to the murine IL-2-receptor beta ( p70 ) chain was available, and the gamma chainhad not been identified. Since there was no selective pressure toward mutation of IL-2 receptors inthe cloning of the five FD.C/24' clones, it was felt that undertaking radio-labelled IL-2 binding studieswas not warranted.3) AUTOSTIMULATORY GROWTH CAN BE COMPLETELY INHIBITED BY GROWTH FACTOR INHIBITORY ANTIBODIES. A) CREATION OF A CONDITIONALLY AUTOSTIMULATORY CLONE.The questions of intracellular stimulation by IL-2, and of cell-surface micro-environment favouring theautostimulatory cell were deemed to be beyond the scope of these studies. In order to definitivelyanswer the question of whether antibodies could completely inhibit autostimulatory growth, however,it was necessary to derive a cell in which the amount of IL-2 produced could be regulated. A higherantibody:IL-2 ratio might overcome the advantage of auto-production of factor, providing that asignificant portion of the functional factor-receptor interaction took place at the cell surface. Moloneyretroviral LTR's ( such as that driving production of the IL-2 message in the vectors used to generateFD.C/2111 cells ) are generally regarded as "strong" promoters in hemopoietic cells ( Keating et al.,1990) and, despite the paucity of IL-2 detectable in the supematants of the FD.C/2 11' autostimulatorycells, it was possible that these cells were producing more factor than could be antagonisedsuccessfully by the antibodies.i) Single-copy integrating vectorA vector was constructed ( pPO1LhIL2, fig. 1.29, A) in which the production of IL-2 message wouldbe regulated by the metallothionein promoter. In conjunction with this inducible promoter, thesequence encoding hIL-2 was altered to include the full-length cDNA, including several ATTTAsequences in the 3' untranslated region ( figure 1.29, B ). These sequences were known to beinvolved in rapid turnover of cytokine messages in hemopoietic cells ( Lindstein et al, 1989, andreferences therein ), and their inclusion should therefore reduce IL-2 production. Linearisation of thisvector and electroporation into cells, followed by selection for stable transfectants in G418, would belikely to result in cells bearing single-copy or low-copy-number genomic integrations ( Potter, 1988 ).ACPM 1 000,000001000010010(15coacoaBCPM1 000001 00001000100100x(15C7(7)0a_ 0_(15OcoaFig. 1.27. FD.C/2T cells have a dramatic advantage over FD.C/2 cells in antibody resistanceA) C24'.1 cells as stimulators. B) C24'.2 cells as stimulators. Ratio is 10:1 throughout. +G- assayswith G418, +H - assays with hygromycin ( see text ). Note logarithmic scale of 3H-thymidineincorporation. Results of less than 200 counts correspond to the absence of viable cells.55CELL % POSITIVEFD.C/2 (IL-2) 95.3FD.C/2q1.1 95.4FD.0/2'F.2 94.8FD.C/211.3 93.0FD.0/2'P.4 96.8FD.0/2P.5 95.2FD.C/2 (IL-3) 70.0Fig. 1.28. FACS analyses of IL-2-receptor p55 on FD.C/2 and FD.C/2 ,11 cells Percentage of p55-positive cells of various clones, as determined by FACS analysis with antibody PC61 andfluoresceinated anti-rat antibody.56Such cells would, it was hoped, display low levels of basal hIL-2 production, perhaps insufficient tomaintain autostimulatory growth, and could be induced to produce more IL-2 ( perhaps barelysufficient to support autostimulatory growth ) with zinc or cadmium.While the vector was in preparation, FD.C/2Hyg cells were assayed for their sensitivity to zinc chloridetoxicity in vitro. It was found ( figure 1.30 ) that FD.C/2Hyg cells would tolerate up to 300 micromolarzinc chloride without significant decrease of viability as judged by visual inspection and thymidineincorporation in the presence of sub-saturating concentrations of IL-2.Two separate electroporations were performed on FD.C/2 cells with the pPO1 LhIL2 vector.Electroporation was carried out at a capacitance of 25 j.tF, and voltage of 1000 V. Forty-eight hoursafter electroporation, viable cells were counted, and cells were distributed into the wells of 96 wellplates in the presence of 500 pg/ml G418 and IL-2, at a density of 5000 viable cells per well. Thisdensity was selected on the basis of the reported frequency of stable transfectants followingtransfection of myeloid cells ( Keating et al., 1990 ), so that any wells containing G418-resistant cellswould be likely to contain derivatives of single cells, i.e. to contain truly clonal populations. From 8 96-well plates, 17 G418-resistant clones were obtained in the presence of exogenous IL-2. Weaning intozinc was attempted by first adding zinc chloride to a concentration of 300 micromolar ( final volume 200ill ) to the wells in which G418-resistant cells were apparent, and 48 hours later replacing half themedium with medium containing G418, and zinc chloride, but lacking IL-2. Subsequently, thisreplacement of medium was repeated every 48 hours. When the wells became sufficiently populatedto suggest expansion was in order, cells were transferred to 24 well plate wells and 200 j.il mediumadded every 24 to 48 hours as prompted by visual inspection. When the volume of a well had reachedapproximately 1 ml, the regime of medium replacement was again commenced. After 3 weeks,however, it was apparent that none of the 17 clones were capable of survival in the absence ofexogenous IL-2.ii) Multi-copy episomal vector.It was felt that the protocol of weaning to growth in the absence of exogenous IL-2 had beensufficiently gentle to warrant the conclusion that clones derived with the pPO1LhIL2 vector wereunlikely to be capable of producing sufficient hIL-2 to support their own survival. Two alternatives wereconsidered for increasing the levels of IL-2 produced while retaining some control in virtue of theinducible promoter: a) truncation of the IL-2 cDNA, removing the ATTTA elements in the 3'untranslated region, leading, presumably, to a more stable message; and b) retention of the full-57length cDNA, and utilisation of an episomally replicating vector so that the derived cells would containseveral copies of the vector rather than the single integrated copy often found in stable transfectantscreated by electroporation. The Biomedical Research Centre had acquired such a vector, pBMGneo,and cDNA-containing derivatives of it had been shown to produce inducible secretion of variouscytokines in mouse cell lines ( Karusayama and Melchers, 1988 ). By virtue of the fragment of thebovine papilloma virus within the vector, derivatives replicate episomally, avoiding integration-positioneffects that result in variability of transcription from genomically integrated vectors. Although themechanisms controlling replication of such vectors are still not fully understood, once several copiesare within the nucleus of a cell, each daughter cell was believed at the time of these studies to inheritthis same number of copies ( Roberts and Weintraub, 1988, but see Ravnan et al., 1992 for adissenting view ).The hIL-2 cDNA, including 3' ATTTA sequences, was cloned into the pBMGneo vector and theresultant plasmid, pBMGneoLhlL2 ( fig. 1.31) was electroporated, without prior linearisation, intoFD.C/2 cells. On the basis of previous experience, capacitance was set at 25g, as before, butvoltage was reduced to 750 V, and the resultant cell death was of the order of 60% ( as judged byviability at 24 hours ), rather than the approximately 90% previously observed. Cells were plated at 1 x104 viable cells per well rather than 5 x 10 3, since it was expected that this circular vector would beseveral times less efficient than the linearised vector in the production of stable G418 resistance.Three such electroporations were performed, resulting in 22 clones of G418-resistant cells. Followingthe weaning procedure outlined above, one clone, C2pBLhIL2, was able to continue proliferating in300 micromolar zinc, without exogenous IL-2.B) GROWTH AND FACTOR PRODUCTION OF C2pBLhIL2 CELLS.i) Growth of C2pBLhIL-2 is zinc-dependent.C2pBLhIL-2 cells were characterised with respect to their response to zinc concentration by carryingout a bio-assay in Terasaki wells as usual, but with a zinc chloride titration instead of cytokine. The cellsin medium alone wells were all dead ( as judged by visual inspection ) after 94 hours, at which point 3H-thymidine was added and incubation allowed to proceed a further 24 hours before harvesting. Theassay was performed with cells at two different initial concentrations. The results, shown in figure 1.32,show that growth at both cell densities was strictly dependent on the presence of zinc, and correlatedwith the concentration of zinc present. A similar titration assay showed the growth of parental FD.C/2BamHI(6013)Scal(3906)^i^ Hind111(2177)ATG58ABATCACTCTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCACA2MTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTGCTGGAT1TACAGATGATTTTGAATGGAATTAATAATTACAAGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACATCTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTAAGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAAACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCMAACAGATGGATTACCTTTTGTCAAAGCATCATCTCAACACTAACTTGATAATTAAGTGCTTCCCACTTAAAACATATCAGGCCTTCTATTTATTTAAATATTTAAATTTTATATTTATTGTTGAATGTATGGTTTGCTACCTATTGTAACTATTATTCTTAATCTTAAAACTATAAATATGGATCTTTTATGATTCTTTTTGTAAGCCCTAGGGGCTCTAAAATGGTTTCACTTATTTATCCCAAAATAITTATTATTATGTTGAATGTTAAATATAGTATCTATGTAGATTGGTTAGTAAAACTATTTAATAAATTTGATAAATATAAAAAAAAAAAACAAAAAAAAAAAFig. 1.29. The integrating expression vector. pP01 LhIL2. used to attempt to make auto-stimulatoryderivatives of FD.C/2 cells A) The vector. MT pr - metallothionein promoter; hGHpA - human growthhormone poly A addition signal; hIL2 - human IL-2 cDNA; NeoR - neomycin resistance cassette.B) The hIL-2 cDNA in the vector. The initiation and termination codons are highlighted andthe 3'ATTTA sequences underlined.59cells was not supported by any concentration of zinc here assayed ( as judged by visual inspection ofwells ).The relatively low levels of thymidine incorporation, in comparison to parental FD.C/2 cellsgrowing in exogenous factor and to FD.C/2 111 cells growing under autostimulatory conditions,suggested that the autostimulatory growth of C2pBLhIL2 cells in zinc was significantly slower than thatof these other FD.C/2 lines. This impression was borne out during subsequent passage of thesecells.To maintain the C2pBLhIL2 clone in a zinc-dependent state, passaging of the line was carried out by1:1 dilution into fresh medium containing 300 micromolar zinc chloride every 48 - 72 hours followingvisual inspection. Whereas the autostimulatory cells of the FD.C/2W series could be maintained inpassage at over 95% viability in passage without difficulty, cells of the C2pBLhIL2 clone were typicallymaintained at levels of approximately 85% viability by this regime. Moreover, if the density of viablecells was allowed to fall below approximately 1 x 10 5 per ml, the viability of the passages deteriorated.If the C2pBLhIL2 passage was first depleted of dead cells by Ficoll gradient centrifugation, and thenreplated at 1 x 105 cells/ml, it was possible to maintain populations at approximately 95% viability by2:1 dilution in medium containing zinc chloride every 48 hours.Although it was possible to maintain C2pBLhIL2 cells at higher viability when maintained at higherdensity in zinc, it was conceivable that some of the cell death was due to the loss of a given cell's abilityto maintain IL-2 production, resulting from loss of the episomal plasmid. Consistent with this possibilitywas the observation that when C2pBLhIL2 cells were passaged for 6 weeks in exogenous IL-2 as wellas zinc, and then exposed to G418 at 500 gg/mlfor 5 days, 8% of the cells died, presumably becausesuch cells had lost the episome. When the corresponding experiment had been carried out withFD.C/2111.1 cells ( albeit in the absence of zinc chloride ), less than 1% of cells had died after exposureto G418.Significantly, although only 8% of the C2pBLhIL2 cells died on exposure to G418, when a secondpopulation that had been expanded in exogenous IL-2 ( and zinc ) was washed free of exogenous IL-2 and replated at 1 x 105 cells/ml in medium containing zinc but no IL-2 ( and no G418 ), approximatelyone third of the cells died over the next three days. This population could only be returned to normalautostimulatory growth after Ficoll gradient centrifugation and further replating at high density in zincchloride. These results prompted suspicion that the C2pBLhIL2 clone might not have been trulyclonal in nature ( despite arising from one of 22 G418-resistant wells, of 768 wells seeded for theG418 selection ). However, subsequent repetition of the experiment produced similar results, anobservation not consistent with the suggestion that the C2pBLhIL2 population may have beenderived from two clones of cells, a G418 resistant population, and a G418 sensitive population initially60maintained in G418 by leakage of the phosphotransferase from resistant cells ( Bayever, 1990 ).Additionally, clones from other cell lines transfected with pBMGneo-derived constructs at theBiomedical Research Centre showed similar rates of loss of G418 resistance in the absence ofcontinuous G418 selection pressure ( Helen Merkens, personal communication ). Given theunlikelihood of the two clone explanation, these data suggest that it may be necessary for theC2pBLhIL2 cells to maintain more copies of the pBMGneoLhlL2 plasmid to support optimal zinc-dependent growth than to display G418 resistance.ii)Density dependence of C2pBLhIL2 cells.An experiment to assess the density-dependence of C2pBLhIL-2 cells was performed, identical indesign to that carried out with FD.C/2 11' cells, except that the C2pBLhIL-2 cells were grown in 300micromolar zinc ( rather than simply medium alone ) with or without IL-2. The results demonstrated thatC2pBLhIL-2 cells showed a more acute sensitivity to density than did FD.C/2 1F cells, but that thisdensity-dependence was similarly abrogated by the addition of exogenous IL-2 ( fig. 1.33 ).iii)IL-2 production by C2pBLhIL2 cells is not detectable in 20 x supematant.Ten mis of C2pBLhIL2 conditioned medium were obtained by carefully expanding cells with dailyaddition of approximately 1/3 the volume in the dish of medium containing zinc chloride ( but no IL-2 orIL-3 ). This supernatant was concentrated 20-fold as before and assayed on the HT-2 cell line for thepresence of IL-2 as previously. No IL-2 activity was detected in this assay ( fig. 1.34 ). To checkwhether this cell line might be liberating an inhibitor of HT-2 proliferation, which might have maskedany possible IL-2 activity, a standard IL-2 titration was performed in the presence of a 1/4 dilution of the20-fold concentrated C2pBLhIL2 supernatant ( ibid. ). No inhibitory activity was demonstrable underthese conditions.The 20 x supernatant was dialysed against 100 volumes of medium free of zinc, and then assayed onC2pBLhIL2 cells in the absence of zinc chloride. The dialysed supematant did not support thymidineincorporation of these cells, and no viable cells were seen in the wells. When assayed on IL-3-dependent R6X cells, the 20 x supernatant showed a trace of stimulatory activity, which could becompletely abolished by Rab 7 anti-mlL-3 antibody, demonstrating that, like other FD.C/2-derivedcells, C2pBLhIL2 cells elaborate a small amount of IL-3 ( fig. 1.35 ).2500020000 - 15000 -10000 -5000 -61CPM900 800 700 600 500 400 300 200 100 NoZnZinc concentration (ILM)Fig. 1.30. Effect of zinc concentration ongrowth of FD.C/2Hyg cells  Assay of proliferative responseof FD.C/2Hyg cells in the presence of zinc chloride. 500 cells per well. 36 hour incubation followed by12 hour 3H-thymidine pulse.3^1 M.A.400 200 100 50 25 12 614000 ^12000 -10000 -—0-- 500 per well--tc— 250 per wellCPM62Fig. 1.31. The episomally replicating expression vector. pBMGNeoLhIL2. used to make auto-stimulatory derivatives of FD.C/2 cells  neo - Neomycin resistance cassette, MT - mousemetallothionein I promoter, hIL-2 - human IL-2 cDNA. The shaded areas on either side of the cDNArepresent splicing and polyA addition regions from the rabbit B-globin gene. BPV - the "69%"fragment of the bovine papilloma virus genome that confers episomal replication.Zinc concentration (p.M)Fig. 1.32. Zinc-dependence of FD.0/2pBLhIL2 cells Assays were performed using cells at twodifferent initial densities, as shown. 96 hour incubation followed by 16 hour 3H-thymidine pulse.63iv) C2pBLhIL2 cells are unable to support parental FD.C/2 cells in co-culture conditions.As a preliminary to comparing the susceptibility of C2pBLhIL2 and FD.C/2 cells to antibody in IL-2supplied by C2pBLhIL2 cells, co-cultures with hygromycin-resistant FD.C/2Hyg cells were establishedin 300 micormolar zinc, at ratios of 20:1, 10:1 and 1:1. The resultant numbers per well of C2pBLhIL-2cells were 1000, 500, and 50 respectively ( corresponding to 1 x 105, 5 x 104, and 5 x 103 cells/ml ).After 3 days of co-culture, no viable cells were visible in cells of the 1:1 ratio wells, presumablybecause the density of C2pBLhIL2 cells was too low at the outset to maintain their autostimulatorygrowth. In some of the 10:1 ratio wells, and all of the 20:1 ratio wells, however, many apparently viablewells were present. These wells were exposed to hygromycin and exogneous IL-2 as before, but after8 days of further incubation, no viable cells were visible in any of the wells ( visual impression wasconfirmed with trypan blue staining ). Under these conditions, C2pBLhIL2 cells were unable tosupport the growth of IL-2 dependent parental cells.v) C2pBLhIL-2 cells in vivo.Two weeks before commencing injection of C2pBLhIL2 cells into DBA/2 mice to assess their ability toform tumours, the drinking water of the animals was supplemented to a concentration of 100 millimolarwith zinc phosphate. This concentration was chosen as the highest used in experiments in whichinduction of metallothionein promoters had been undertaken in transgenic animals ( Palmiter et al.,1983 ; Habener et al., 1989; Morahan et al., 1989; Shanahan et al., 1989, ). This supplementation wascontinued throughout the experiment, with drinking water changed approximately every 7 days.Animals were injected subcutanously ( 3 ) or intraperitoneally (3) with 5 x 10 5 cells. After 10 weeks, allthese animals appeared healthy, and showed no signs of tumour development. The experiment wastherefore repeated with inocula of 2 x 106 cells per injection. These animals similarly showed nosubsequent signs of tumour development, and remained healthy for at least 4 months followinginjection of C2pBLhIL2 cells.C) Antibody-mediated antagonism of IL-2 completely inhibits growth of C2pBLhIL2 cellsAntibody assays were performed in Terasaki wells, with C2pBLhIL2 cells plated at either 1000 ( oneplate ) or 500 ( one plate ) cells per well. In each plate, 12 wells contained 300 micromolar zinc, 12contained zinc and antibody ( either DMS or PC61 ), 12 contained zinc, PC61 and a saturatingconcentration of exogenous IL-2, and 12 contained zinc, PC61 and a saturating concentration of IL-3.64After 4 days, no apparent viable cells were present in either plate in wells containing only zinc andantibody. Wells containing exogenous factor in the assay set up at 1000 cells per well, showedapparent overgrowth of cells, so only the 500 cell per well assay was pulsed with 3H-thymidine.Incubation was allowed to proceed a further 8 hours before harvesting the assay. The results, seen infigure 1.36, show that thymidine incorporation of C2pBLhIL2 cells was completely abrogated by bothantibodies, and the cells could be "rescued" from this effect by saturating amounts of IL-2 and IL-3added at the initiation of the assay.This antibody-inhibition assay was repeated, and wells containing antibody ( without exogenous IL-2or IL-3) were either stained with trypan blue after 4 days, or treated by addition of exogenous IL-2 orIL-3 in medium after 4 days, and further incubated. Neither trypan blue nor this "late rescue" attemptrevealed any viable cells, confirming that antibody not only abrogated thymidine incorporation butresulted in death of C2pBLhIL2 cells.65% positivewellsCells per wellFig. 1.33. Density-dependence of FD.C/2pBLh1L2 cells—a— mil-2FD.C/2p8Lh11.2 CM2^4^8^16 32 64 128 256 512 M.A.4000 3000 -2000 -1000 -CPM CMCM 4- Rab7Factor/suliernate dilutionFig. 1.34. IL-2 activity is not detectable _in the superagtaa of FD.0/2pBLhIL2 cells 20-foldconcentrated conditioned medium of FD.C/2pBLhIL2 cells was assayed on HT-2 cells in the presenceof the neutralising anti-mL4 antibody, 11B11. Also shown is an IL-2 response curve in the presence ofa 1/4 dilution of the conditioned medium.1000 cells per well; 36 hour incubation followed by 12 hour3H-thymidine pulse.16 32 64 128 256 512 M.A.Supernate dilutionFig. 1.35. IL-3 activity in the supematant of FD.C/2pBLhIL2 cells 20-fold concentrated conditionedmedium of FD.C/2pBLh1L2 cells was assayed on R6X cells alone, or in the presence of theneutralising anti-mlL-3 antibody, Rab7. 36 hour incubation plus 8 hour 3H-thymidine pulse.1000080006000400020000A2A67CPMFig. 1.36. Antibody antagonists of IL-2 can completely inhibit the growth of FD.C/2pBLhIL2 cellsGrowth of FD.C/2pBLhIL2 cells was assayed in 300 micromolar zinc alone, in the presence ofneutralising anti-mlL2-receptor antibody, PC61 ( approximately 5 µg/ml) or in the presence of PC61antibody and either IL-2 or IL-3, or in the presence of neutralising anti-hIL-2 DMS antibodypreparation ( approximately 40 [Ig/m1). 500 cells per well. 96 hour incubation followed by 12 hour 3H-thymidine pulse.68DISCUSSIONThe experiments described here represent the first demonstration that antibody antagonists of thegrowth factor can induce the death of cells that grow by autostimulatory mechanisms. They supportthe hope that cytokine antagonists may find use as therapeutic reagents in the treatment ofautostimulatory neoplasms. Such therapy would be particularly applicable to neoplasms, such asleukemia, in which autostimulatory mechanisms may be necessary for the survival ( as well as growth )of the abnormal cells.These experiments also demonstrated that autostimulatory mechanisms require the production ofsurprisingly small amounts of growth factor by the tumour cells. Significantly, tumours could be causedby conferring upon immortal factor-dependent cells the ability to produce amounts of growth factor sosmall that they were almost undetectable. This finding implies that it may not be easy to determine thatan autostimulatory mechanism is critical in the genesis of a given tumour, because there may be nodetectable level of growth factor produced. The suggestion that it may be just those autostimulatorycells that produce the lowest amounts of growth factor that are most susceptible to therapy based ongrowth factor antagonists makes it more important to identify autostimulatory mechanisms involvingvery low levels of growth factor.A more detailed analysis of these conclusions and the data on which they are based follows.A) Autostimulatory cells have a marked advantage in terms of access to growth factor; very little growthfactor may suffice for autostimulation.To obtain cells producing various levels of autostimulatory growth factor, two types of vector, retroviraland episomal, were used to transfect FD.C/2 cells. Using a retroviral vector, in which the LTR servedas the promoter for IL-2 production, a series of clones of autostimulatory cells were derived. Theseclones all retained responsiveness to IL-2 and IL-3, and exhibited density-dependence for growth inthe absence of exogenous factor ( a common characteristic of autostimulatory cells see introduction ).Four of these 5 clones liberated detectable levels of IL-2 into their culture supernatants, but the 10-fold concentrated supernatant of the fifth contained no detectable IL-2. However, all 5 were capableof producing tumours in syngeneic animals. Cells of 4 of the 5 clones were able to support the growthof neighbouring parental factor-dependent cells in co -culture conditions, but only at high "stimulatorto responder" ratios ( 10:1 ).69Using the episomal vector, a single autostimulatory clone was obtained. In this case the production ofIL-2 was dependent upon a zinc-responsive metallothionein promoter. The IL-2 cDNA in this vectorincluded 3' untranslated sequences which are known to mediate rapid degradation of cytokinemessage in hemopoietic cells. The features of this vector allowed isolation of a clone whose growthwas dependent on the addition of zinc to the medium. This clone displayed a more marked density-dependence than the retrovirally derived clones, but its density-dependence was similarly abrogatedby exogenous IL-2. Despite autostimulatory proliferation ( in the presence of zinc ), cells of this clonedid not liberate levels of IL-2 activity detectable in 20-fold concentrated supernatant, nor could theysupport neighbouring factor-dependent cells in co-culture conditions. Additionally, thymidineincorporation assay and observation of passages of these cells suggested that even in optimal zinc-dependent growth conditions, these cells grew more slowly than the retrovirally derivedautostimulatory cells. To date it has not been possible to obtain tumours in syngeneic animals fromthis clone, despite supplementation of drinking water of mice with zinc phosphate, and inoculacontaining 4 times as many cells as those used to obtain tumours from retrovirally derivedautostimulatory lines.B) Growth factor antagonist antibodies can bring about the death of autostimulatory cells.All 5 retrovirally derived clones were susceptible to a significant degree of death due to antibodyantagonism of IL-2. None of these clones could be completely destroyed by such treatment, not eventhat in which IL-2 production was undetectable. Cells surviving such treatment showed no apparentgenetic resistance to antibody-induced death, as repeating the experiment with the daughters ofsurviving cells produced similarly incomplete death of the population. Such autostimulatory cells weremarkedly resistant to antibody-mediated antagonism of IL-2 in comparison with their factor-dependentneighbours, which all died when co-cultures included antibody. This advantage was not due toalteration in the levels of IL-2 receptor at the cell surface as judged by FACS analysis of distribution ofthe p55 chain of the receptor.In contrast, treatment of the zinc-dependent autostimulatory cells with anti-hlL-2 or anti-mlL-2receptor antibodies left no viable cells. This result was unlikely to be due to susceptibility of the zinc-dependent cells to non-specific toxicity of the antibody peparation as the anti-IL-2 effect could beabrogated by exogenous IL-2 or IL-3. These cells produced so little IL-2 that IL-2 activity was notdetectable in 20-fold concentrated supernatant of this clone, and they were unable to support thegrowth of IL-2 dependent parental cells in co-culture assays.70The results presented here document for the first time the complete antibody-mediated inhibition ofautostimulatory growth, and cell death. In what way do the results presented here, differ from othermodels in which growth was only partially inhibited?Several other laboratories have shown incomplete blockage of autostimulatory growth with antibody( see introduction ), although most have not presented the careful controls for specificity of antibodyactivity presented here. One straight-forward explanation presents itself as a reason for the failure toachieve complete inhibition in the models studied by other workers: in their autostimulatory modelsystems the antibody used was inadequate to overcome the autostimulation. To state the problemmore mathematically: the product of the amount of autostimulatory factor produced, the amount ofreceptor present, and the affinity of the interaction between growth factor and receptor exceeded theproduct of the amount of antibody and its affinity for receptor or growth factor. Either their cells madetoo much factor to inhibit with their antibodies, or the "inhibitory" antibody they used was not ofsufficient potency, as a result of its affinity being too low, or of its target epitope being in a region ofthe molecule that results in poor competition for the growth factor-receptor interaction. Given thepresent experiments, in which autostimulatory growth was completely inhibitable, any instance offailure to inhibit is open to the argument that the failure was due to the combination of insufficientconcentration of antibody at the critical site and inadequate affinity of the antibody-target interaction incomparison to that of the growth factor-receptor interaction. Whereas the dissociation constants forhigher affinity antibody-antigen interactions are, at best, of the order of 10 -9M ( Goding, 1986 ), that ofthe high-affinity IL-2-receptor interaction, typical of cytokine-receptor affinities, is 10 -11 M ( Waldnnann,1991 ).This explanation, however, conceals a more subtle but important possible reason for the differencebetween models. It has long been known that the degree of proliferation induced in response to IL-2correlates relatively well with the proportion of cell-surface receptors occupied, in contrast to GM-CSFand IL-3, for instance. These latter cytokines display their whole range of proliferative stimulus, frombarely detectable to maximal proliferation, while only varying the percentage of cell-surface receptorsoccupied ( in equilibrium assays ) from zero to less than 10%, in naturally occuring factor-responsivecells ( reviewed in Kuziel and Greene, 1991, and Schrader, 1991 ). IL-2, on the other hand, mustoccupy a much higher proportion of available cell-surface receptors in order to produce maximalproliferative response. The calculated affinities for receptors of GM-CSF, IL-3 and IL-2 are all roughlysimilar, however, with dissociation constants of the order of 10 -11 to 10-12 molar ( Garland, 1991,Kuziel and Greene, 1991; Schrader, 1991 ). An autostimulatory mechanism involving IL-2, therefore,might be intrinsically more susceptible to inhibition than models involving GM-CSF or IL-3, sinceinhibition of IL-2 requires the blockade of a smaller proportion of factor-receptor interactions to71diminish resultant proliferation, than is the case for GM-CSF and IL-3. Thus, in the case of IL-2, a cellthat had been growing optimally in a condition of 25% receptor occupancy might die in the presenceof an antibody capable of reducing receptor occupancy by 90%, since 2.5% receptor occupancywould be insufficient to maintain growth. In the case of IL-3, on the other hand, such an antibodywould not interfere with growth, since 2.5% receptor occupancy would be adequate to maintain IL-3dependent growth.2 QUESTIONS RAISED1) Why is autostimulatory growth so difficult to reverse with antibody?Although this study demonstrated that complete inhibition of autostimulatory growth was in factpossible, it also showed that a cell population which was making very little of an autostimulatory factoras judged by the amount detectable in culture supernatants, was nevertheless resistant to inhibitionof autostimulatory growth by antibody. This was despite the fact that the antibody preparations werecapable of blocking the effects of much more factor when applied exogenously. Other workers whohave made similar observations have speculated that functional growth factor-receptor interactionswere occuring within the cell. The fact that it was possible to isolate an autostimulatory clone which issusceptible to antibody-mediated growth inhibition, does not imply that intracellular interactionsbetween factor and receptor could not in other circumstances be responsible for growth. All that canbe concluded in this respect is that intracellular ligand-receptor interactions, if they did occur in thisclone, were insufficient to maintain the viability of the cells. To state the matter more formally - the nullhypothesis disproven by these studies is NOT Intracellular growth factor-receptor interactions occurand are capable of leading to growth of autostimulatory cells", but rather: "Autostimulation of growthand survival cannot be blocked by growth factor antagonists".Ligand-receptor interaction in autostimulatory cells might conceivably occur in several compartmentsthat are inaccessible to antibody - within the endoplasmic reticulum or the Golgi apparatus, forexample. For each compartment, the question arises "Can signal transduction take place here?" Thesimplest hypothesis would be that further transduction of signal to the nucleus could only be initiatedin the environment immediately below the cell membrane, because other components of the earlysteps of the cytokine signal transduction cascades initiated by ligand-receptor interaction, such as ras( Barbacid, 1987 ), and the src-like kinases ( Resh, 1990 ), are firmly associated with the plasmamembrane.72Is the question of whether intracellular interactions between growth factor and receptor are functionalanswerable? How might one go about addressing this question experimentally? An approach taken byDunbar et al. ( 1989) involved the creation of a model in which, it was hoped, the IL-3 would beretained within the endoplasmic reticulum ( ER ). The IL-3 cDNA was so altered as to encode acarboxy-terminal sequence ( lysine-aspartic acid-glutamine-leucine ) which had been shown to be ableto cause retention of various proteins in the ER. This cDNA was expressed with a retrovirus in an IL-3-dependent cell, as before, and autostimulatory clones were derived. However, expression of thealtered IL-3 cDNA was controlled by the viral LTR, and this "strong" promoter activity resulted inapparent overloading of the ER retention signal, so that IL-3 activity was detected in the supernatantof these clones. To address this problem, the retroviral construct was altered so as to contain aninternal ( and relatively weak ) SV40 promoter which would govern expression of the IL-3 cDNA. Usingthis system, the authors obtained 5 clones, of which 4 secreted no detectable IL-3, and the fifth a verylow level. Neutralising antibody to IL-3 did not inhibit growth of these clones. The authors concludedthat functional IL-3-receptor interaction could take place within the ER.Although these experiments were elegant in themselves, there is a flaw in the reasoning between thedata provided by these experiments and the conclusion drawn by the authors. It is quite possible thatenough IL-3 escapes from the ER to occupy receptors at the cell surface and thereby promoteproliferation of cells, but that this IL-3 is bound or consumed in the interaction so that it is notdetectable by examination of supernatant or even of membrane lysates. This explanation would stillallow for the meeting of factor and receptor within the cell, even within the ER, but would rely on theleakiness of the IL-3 retention system, and/or the effect of the un-retained receptor in "dragging"bound IL-3 to the cell surface. There is no evidence, either from the literature, or presented by theseauthors, that functional IL-3-receptor interaction requires levels of IL-3 that must be detectable by themost sensitive bioassay methods. The evidence from the present work would suggest just theopposite - that functional cytokine-receptor interaction can take place when cytokine is present atlevels below the limits of detection.A next step in the refinement of such experiments would be to create a model in which receptor geneis mutated so as to cause retention of the receptor molecules within intracellular compartments. Giventhe multi-subunit nature of many of the better-characterised cytokine receptors, however, this taskwould be daunting at the least, and only worth the undertaking if it were clear that results could beobtained that would not be subject to objections similar to those raised above. An alternativerefinement of such experiments might be to engineer cells to express a neutralising antibodyintracellularly in the compartments where factor-receptor interaction might occur. This experiment,however, would only be informative if the result were positive and autostimulation was in fact inhibited,73since many explanations for a failure to inhibit could be invoked ( e.g. the folding of the antibodymolecule within the cell is such as to reduce its affinity; the antibody's function is impeded by thephysiological milieu of the compartment of the cell in which the important interaction is taking place;not enough antibody is being produced to saturate the receptor or factor produced in the cell ). Evenif a positive result were obtained, the onus would be on the experimenter to prove that the antibodyhad remained confined to the relevant compartment, in order that the experiment should conclusivelyestablish that this was indeed the site of effective ligand-receptor interaction. Data relating tointracellular function of antibodies are currently being accumulated in several laboratories ( Werge etal., 1990; Biocca et al., 1990 ) and experiments involving intracellular antibodies as inhibitors ofcytokine signalling pathways are in progress at the Biomedical Research Centre.Another system in which workers have seriously grappled with the question of intracellular activationof cytokine receptors has involved platelet-derived growth factor ( PDGF ). Unlike the known chains ofthe IL-2, GM-CSF and IL-3 receptors, this receptor has protein tyrosine kinase activity, and is known toauto-phosphorylate on binding ligand. Keating and Williams ( 1988 ) created an autostimulatory modelin fibroblastoid NRK cells engineered to express the PDGF-like product of the v-sis oncogene. Usingmetabolic labelling of these cells, these workers showed that the majority.of the PDGF receptor in theautostimulatory cells, in contrast with the parental cells, was incompletely processed with respect tothe normal sequence of glycosylation events that occur prior to the appearance of the maturereceptor at the cell surface. Moreover, the majority of the receptor was insensitive to trypsin treatmentof the cells, suggesting its intracellular localisation. This trypsin-insensitive receptor wasphosphorylated on tyrosine, suggesting that it had interacted with ligand. The poly-anionic compoundsuramin, which inhibits the interaction of PDGF with its cell-surface receptor, failed to inhibit thephosphorylation of the receptor in the autostimulatory cells. As the authors themselves admit,however, they could not exclude the possibility that a small amount of receptor-ligand complex waspresent at the cell-surface of their autostimulatory cells, and it is possible that these molecules couldbe responsible for the actual proliferation of the cells. Since the PDGF receptor is known to auto-phosphorylate on contact with ligand at the cell surface, the presence of tyrosine-phosphorylatedPDGF receptor within the cell, although suggesting that it may have met its ligand there, does notimply that effective further signal transduction took place other than from the vicinity of the cellsurface. Since the src family kinases with which the PDGF receptor associates to transmit aproliferative signal ( Kypta et al., 1990 ) are localised at the inner plasma membrane, it seems likely thatphosphorylated receptor must have been present in this region, in the compartment of the cell ( i.e.outside the trans-Golgi ) where these kinases are found.74The results of Hannink and Donoghue ( 1988) seem to support this conclusion. Using a heat-shockinducible promoter, these workers created a model allowing them to study the effects of a pulse of thev-sis product produced within fibroblasts, on phosphorylation of the PDGF receptor and thedownstream induction of c-fos. They showed that monensin, which inhibited the transport of the sisproduct through the trans-Golgi, inhibited the induction of c-fos without inhibiting phosphorylation ofthe ( incompletely processed ) PDGF receptor, suggesting that although ligand-receptor interactionand activation of the receptor kinase had taken place, further signal transduction was blocked. In thismodel, suramin also inhibited c-fos induction suggesting, according to the authors, that receptor-ligand interaction needed to take place at the cell surface to result in effective signal transduction. Thislast conclusion, however, is invalid since suramin can enter and function within cells ( Huang andHuang, 1988, and references therein ). In fact, in the hands of Hannink and Donoghue, suraminappeared to have inhibited phosphorylation of the incompletely processed form of the PDGFreceptor, as well as of the mature form. Skeptics might also argue that monensin could well haveeffects on the cell other than the simple inhibition of transport between Golgi and plasma membrane,making these results difficult to interpret. Huang and Huang ( 1988 ), on the other hand, using similarmetabolic labelling experiments to those of Keating and Williams, concluded that signalling from thesis-product- PDGF complex did indeed take place from within the cell. They went on ( Lokeshwar etal., 1990) to carry out similar detailed analyses of the biosynthesis and turnover of the sis product inautostimulatory cells to support their conclusions. However, these conclusions are based onobservations of intracellular turnover, a very indirect and probably error-prone measure of thewhereabouts of active ligand-receptor complexes and are thus open to similar objections to thoseraised against Keating and Williams ( above ).Cytokines such as IL-3 may activate mitogenesis at extremely low concentrations ( perhaps as few as20 molecules per cell will suffice ). It would seem impossible therefore, given current technology, andthe current level of understanding of the signal transduction process, to definitively answer thequestion of whether the cytokine signal transduction cascade can be initiated from within cells inregions or compartments other than the "physiological" area near the cell surface. As a result,experiments currently performable, aiming to prove that one could never inhibit an autostimulatory cellfrom the outside because of an internal autostimulation mechanism, are bound to fall short of theirmark. The only informative experiments in these models are those in which inhibition has beensuccessful.752) Why did zinc-dependent autostimulatory cells fail to give rise to tumours in syngeneic animals?One explanation for this failure is that it is impossible to create concentrations of zinc in the vicinity ofthe injected cells sufficiently high to allow autostimulatory growth to occur in these particular cells,without poisoning the mice. Redesigning the IL-2 cDNA vector to incorporate an inducible promoterwhich can be more vigorously up-regulated than the mouse metallothionein promoter in pBMGNeomight overcome this problem. More recently developed expression vectors contain induciblepromoters with a significantly increased dynamic range in comparison with that of the unmodifiedmetallothionein promoters ( e.g. Hu & Davidson, 1990; Labow et al., 1990 ).A less likely explanation involves the possibility that the zinc concentrations achieved in the micro-environment of injected cells was higher than these cells would tolerate. This issue might be resolvedby obtaining measurerments of zinc levels in the tissues of control mice, and mice receiving zincsupplementation.A further alternative explanation of the failure to produce tumours involves the possibility of animmune response to the injected cells. It might be expected that a cell line generates several proteinsor other antigens ( e.g. carbohydrate determinants ) that are foreign to the animal from which it wasoriginally derived, since immortal cell lines are known to accumulate multiple abnormalities at the DNAlevel. Providing they carry the machinery for antigen presentation, including appropriate majorhistocompatibility complex molecules, it is quite likely that injection of such cells into animmunocompetent animal will result in a competition between the ability of the injected cells toproliferate and the ability of the immune system to destroy the cells. In the case of the zinc-dependentautostimulatory cells, foreign proteins ( in addition to hIL-2 and neomycin phosphotranseferase alsopresent in the retrovirally derived cells ) could be predicted to be present. viz - those encoded by thebovine papilloma virus portion of the vector in these cells. It has recently been demonstrated thatexpression of IL-2 in an otherwise tumourigenic cell line renders the cells susceptible to immune-mediated destruction in vivo (Fearon et al., 1990 ).To go some way towards investigating the role of rejection mechanisms in the failure of these zinc-dependent cells to produce a tumour, one might inject the cells into mice that have high levels ofcirculating IL-2. This could be achieved by injection or the introduction into the peritoneal cavity of amini-pump which would continuously release IL-2. In the absence of any form of rejection mechanism ,tumours should form, and it should be possible to recover from them cells that are still G418-resistant,and ideally that could be weaned into zinc -dependent growth in vitro ( although in the absence of aselective pressure, it is conceivable that all the cells might lose the episome carrying the sequences76encoding G418 resistance and zinc-dependent IL-2 production ). As distinct from the investigation ofwhether immune rejection of the tumour occurs, the problem might be avoided by repeating theexperiment in nude mice. Indeed, it might be suggested that this experiment would more closelymimic some human leukemic conditions than the syngeneic mouse experiments, since manyleukemic patients display significant compromise of immune function ( albeit, generally, in the moreadvanced stages of disease ).3) The future of therapeutic approaches to autostimulatory neoplasiai ) Is anti-sense RNA a viable alternative as therapy for autostimulatory tumours?Although the stated aim of these studies was to investigate the tumour-inhibitory potential of growthfactor antagonists rather than antagonists of growth factor production, mention should be made ofanti-sense inhibition of protein synthesis, given the popularity of this approach in inhibitingintracellular events. There are many reports of the successful application of anti-sense techniques inthe literature, including at least one dealing with anti-sense inhibition of IL-2-dependentautostimulatory growth ( Harrel-Bellan et al., 1988 ). Given the difficulty of publishing negative data,however, it is unclear in what proportion of attempts the anti-sense approach is successful. Thepresence of double-stranded RNA within a cell ( which is thought to be necessary for anti-sensefunction ) is known to lead to specific cellular responses including, for example, interferon productionin many cell types ( reviewed in De Maeyer and De Maeyer-Guignard, 1991 ). These cellular responsesmight well be related to the formation of double-stranded RNA by some viruses, since interferonproduction, at least, is characteristic of the cellular response to virus. Interferon is known to have avariety of effects on cell function including effects on proliferation, varying according to the cell type( ibid. ). In terms of experiments in inhibition of autostimulatory growth, then, it is hard to imagine whatmolecule to use as a control target for these "side-effects" of anti-sense - a molecule would have to bechosen whose production could be inhibited without affecting cellular function, so that one coulddemonstrate that it is the inhibition of production of autostimulatory factor rather than the merepresence of double-stranded RNA within the cell that is causing the inhibition of growth. One possibleway to set up such a control would be to first of all introduce into the cells a vector producing an RNAspecies encoding a protein product not usually found in that cell type, and which would be predictedto have no effect on cell function ( or none relevant to the experiment ). Anti-sense inhibition of thisRNA could then be used as a control. The argument might be presented, however, that any "side-effects" of the anti-sense mechanism ( e.g. inhibition of cellular proliferation by interferon-relatedmechanisms ), might be regarded as therapeutic effects, ( for instance, in the case of inhibition of77autostimulatory growth ), and that experimental controls, are unneeded. Indeed, this seems to havebeen the attitude of many workers who have published experiments using anti-sense, since no suchpublication, to the knowledge of this author, has included controls of the type described above. Whatis commonly seen instead is the use of a sense oligo-nucleotide, as "control" for the anti-sense whensynthetic oligo-nucleotides are used for experiments in vitro.A major problem with anti-sense as a therapeutic tool lies in the difficulty of delivering sufficient anti-sense to cells in vivo. Whereas an antibody or other growth factor-antagonist could be delivered to apatient ( or experimental animal ) parenterally, and may function at the cell surface, the anti-senseapproach would require delivery of the source of the anti-sense to the nucleus of the target cell. Thesimplest currently available mechanism for effecting such delivery involves production of anti-sensemessage by a virus which is capable of infecting the target cells in vivo. Narrowing the range ofinfected targets would then be a serious concern for many autostimulatory factors, since one wouldnot want to create a situation in which no cell of the patient could ever make, for example IL-2, which isessential to the ability of a T lymphocyte to mount a normal immune response.ii ) Better cytokine antagonists.The numerous autostimulatory models in which partial inhibition of growth was achieved with antibody,and the present data, showing that, in favourable circumstances, death of autostimulatory cells isachievable, inspire the hope that more potent antagonists will lead to therapy for autostimulatoryneoplasia. Of reagents known to be capable of binding to the various cytokine receptors, those withthe highest affinity are the cytokines themselves. The search for potent antagonists has resulted inthe recent discovery of several cytokine analogs which are much more potent antagonists than anyantibodies currently available. These antagonists are closely related to the corresponding cytokines.In the case of human growth hormone ( Fuh et al., 1992 ), the most potent antagonist describeddiffers from the wild-type hormone in four amino acids. An antagonist of human IL-4 has beendescribed ( Kruse et al., 1992 ) which has an affinity for the IL-4 receptor of the same order ofmagnitude as that of wild-type IL-4, and differs from it in only one amino acid. A similar antagonist ofhuman IL-2 has been produced ( J.W. Schrader, personal communication ). Such antagonists mayresolve problems of the relationship between cytokine structure and function, as well as allowadvances in the therapy of various cytokine-related disorders, including autostimulatory neoplasia.78BIBLIOGRAPHYAaranson, S.A., & Todaro, G.T. ( 1968 ) J.Cell. Physiol. 72, pp. 141-148.Adkins, B., Leutz, A., & Graf, T. ( 1984 ) Autocrine growth induced by src-related genes intransformed chicken myeloid cells. Cell 39, pp. 439-445.Andrejauskas, E., & Moroni, C. ( 1989) Reversible abrogation of IL-3 dependence by an inducible H-ras oncogene. EMBO J. 8, pp. 2575-2581.Armitage, R.J., Lai, A.P., Roberts, P.J., & Cawley, J.C. ( 1986) Certain myeloid cells possessreceptors for interleukin-2. Brit. J. Haematol. 64, pp. 799-807.Barbacid, M. ( 1987) ras genes Ann. Rev. Biochem. 56, pp. 779-827.Baumann, M.A., & Paul, C.C. ( 1992 ) Interleukin-5 is an autocrine growth factor for Epstein-Barr virus-transformed B lymphocytes. Blood 79, pp. 1763-1767.Baumbach, W.R., Stanley, E.R., & Cole, M.D. ( 1987 ). Induction of vlonal monocyte-macrophagetumours in vivo by a mouse c-myc retrovirus: rearrangement of the CSF-1 gene as a secondarytransforming event. Mol.Cell.Biol. 7, pp. 664-671.Bayever, E. ( 1990 ) Gene transfer into hematopoietic cells. ( Correspondence ) Blood 75, p. 1587.Bertoglio, J., Dosda, J., Stancou, R., Wollman, E., & Fradelizi, D. ( 1989 ) Expression and regulation ofinterleukin-1 mRNA and interleukin-1 receptors in human B-cell lines. J. Mot Cell. Immunol. 4, pp.139-148.Betsholtz, C., Westermark, B., Ek, B., & Heldin, C.-H. ( 1984) Coexpression of a PDGF-like growthfactor and PDGF receptors in a human osteosarcoma cell line: implications for autocrine receptoractivation. Cell 39, pp. 447-457.Biocca, S., Neuberger, M.S., & Cattaneo, A. ( 1990) Expression and targetting of intracellularantibodies in mammalian cells. EMBO J. 9, pp. 101-108.Blankenstein, T., Qin, Z., Li, W., & Diamantstaien, T. ( 1990 ). DNA rearrangement and constitutiveexpression of the interleukin 6 gene in a mouse plasmacytoma. J. Exp. Med. 171, pp. 965-970.Bordoni, R., Thomas, H.G., & Richmond, A. ( 1989 ) Growth factor modulation of melanoma growthstimulatory activity mRNA expression correlates with cell growth. J. Cell. Biochem. 39, pp. 421-428.Bos, J.L., de Vries, M.U., van der Eb, A.J., et al. ( 1987) Mutations in N-ras predominate in acutemyeloid leukemia. Blood 69, p. 1237.79Bowen-Pope, D.F., Vogel, A., & Ross, R. ( 1984) Production of platelet-derived growth factor-likemolecules and reduced expression of platelet-derived growth factor receptors accompanytransformation by a wide spectrum of agents.Proc. Natl. Acad. ScL USA 81, pp. 2396-2400.Browder, T.M., Abrams, J.S., Wong, P.M.C., & Nienhuis, A.W. ( 1989) Mechanism of autocrinestimulation in hematopoietic cells producing interleukin-3 after retrovirus-mediated gene transfer. MoLCell Biol. 9, pp. 204-213.Burd, P.R., Rogers, H.W., Gordon, J.R., & Dorf, M. ( 1989) Interleukin-3 dependent and independentmast cells stimulated with IgE and antigen express multiple cytokines. J. Exp. Med. 170, p. 245.Cozzolino, F., Rubartelli, A., Aldinucci, D., Sitia, R., Torcia, M., Shaw, A., & Di Guglielmo, R. ( 1989 ).Interleukin 1 as an autocrine growth factor for acute myeloid leukemia cells. Proc. Natl. Acad. ScL USA86, pp. 2369-2373.Crapper, R.M., Thomas, W.R., & Schrader, J.W. ( 1984 ) In vivo transfer of persisting ( P) cells: furtherevidence for their identity with T-dependent mast cells. J. ImmunoL 133, pp. 2174-2179.Cuttitta, F., Carney, D.N., Mulshine, J., Moody, T.W., Fedorko, J., Fischler, A., & Minna, J.D. ( 1985 )Bombesin-like peptides can function as autocrine growth factors in human small-cell lung cancer.Nature 316, pp.823-826.Dautry-Varsat, A., Hemar, A., Comet, V., & Duprez, V. ( 1988 ) Autocrine growth of a human T-cell lineis inhibited by cyclosporin A. Blood 72, pp. 588-592.Delwel, R., van Buitenen, C., Salem, M., Bot, F., Gillis, S., Kaushansky, K., Altrock, B., & Lowenberg,B. ( 1989) Interleukin-1 stimulates proliferation of acute myeloblastic leukemia cells by induction ofgranulocyte-macrophage colony-stimulating factor release. Blood 74, pp. 586-593.De Maeyer E., & De Maeyer-Guignard, J. ( 1991) Interferons in The Cytokine Handbook ( A.Thomson ed., Academic Press, London ) pp. 83-102.Dexter, T.M., Garland, J., Scott, D., Scolnick, E., & Metcalf, D. ( 1980) Growth of factor-dependenthemopoietic prescursor cell lines. J. Exp. Med. 152, pp.1036-Dinarello, C.A. ( 1991) Interleukin-1 and interleukin-1 antagonism. Blood 77, pp. 1627-1652.Doolittle, R.F., Hunkapiller, M.W., Hood, L.E., Devare, S.G., Robbins, K.C., Aaronson, S.A., &Antoniades, H.N. ( 1983) Simian sarcoma virus oncogene v-sis is derived from the gene ( or genes )encoding a platelet derived growth factor. Science 221, pp. 275-277.Downward, J., Yarden, Y., Mayes, E., Scrace, G., Totty, N., Stockwell, P., Ullrich, A., Schlessinger, J.,& Waterfield, M. ( 1984) Close similarity of epidermal growth factor receptor and v-erb-B oncogeneprotein sequences. Nature 301, pp. 521-527.80Drago, J., Murphy, M., Campbell, S.M., Harvey, R.P., & Bartlett, P. ( 1991) Fibroblast growth factor-mediated production of central nervous system precursors depends on endogenous production ofinsulin-like growth factor I. Proc. Natl. Acad. Sc!. USA 88, pp. 2199-2203.Duhrsen, U., Stahl, J., & Gough, N.M. ( 1990) In vivo transformatin of factor-dependent hemopoieticcells: role of intracisternal A particle transposition for growth factor gene activation. EMBO J. 9, pp.1087-1096.Dunbar, C.E., Browder, T.M., Abrams, J.S., & Nienhuis, A.W. ( 1989) COOH-terminal-modifiedinterleukin-3 is retained intracellularly and stimulates autocrine growth. Science 245, pp. 1493-1496.Duprez, V., Lenoir, G., & Dautry-Varsat, A. ( 1985 ) Autocrine growth stimulation of a human T-celllymphoma line by interleukin 2. Proc. Natl. Acad. Sci. USA 82, pp. 6932-6936.Estrov, Z., Kurzrock, R., Estey, E., Wetzler, M., Ferrajoli, A., Harris, D., Blake, M., Gutterman, J.U., &Talpaz, M. ( 1992 ). Inhibition of acute myelogenous leukemia blast proliferation by interleukin-1 ( IL-1 )receptor antagonist and soluble interleukin-1 receptors. Blood 79, pp. 1938-1945.Foulds, L. ( 1958 ) The natural history of cancer. J. Chronic Dis. 8, pp. 2-37.Freedman, M.H., Cohen, A., Grunberger, T., Bunin, N., et al., ( 1992 ) Central role of tumour necrosisfactor, GM-CSF, and interleukin 1 in the pathogenesis of juvenile chronic myelogenous leukemia. Brit.J. Haemato180, pp. 40-48.Fuh, G. Cunningham, B.C., Fukunaga, R., Nagata, S., Goeddel, D.V., & Wells, J.A. ( 1992) Rationaldesign of potent antagonists to the human growth hormone receptor. Science 256, pp. 1677-1680.Goding, J.W. ( 1986) Monoclonal antibodies: principles and practice. ( Second edition, AcademicPress, London ).Gootenberg, J.E., Ruscetti, F.W., Mier, J.W., Gazdar, A., & Gallo, R.C. ( 1981) Human cutaneous Tcell lymphoma and leukemia cell lines produce and respond to T cell growth factor. J.Exp.Med. 154,pp. 1403-1419.Graf., T. Weizsacker, F.v., Griesen, S., Coll, J., Stehelin, et al. ( 1986) v-mil induces growth andenhanced tumourigenicity in v-myc-transformed avian macrophages. Cell 45, pp. 357-364.Graves, D.T., Owen, A.J., & Antoniades, H.N. Evidence that a human osteosarcoma cell line whichsecretes a mitogen similar to platelet-derived growth factor requires growth factors present in platelet-poor plasma. Cancer Res. 43, pp. 83-87Griffin, J.D., Rambaldi, A., Vellenga, E., Young, D.C., Ostapovicz, D., & Cannistra, S.A. (1987 )Constitutive secretion of interleukin-1 by acute myeloblastic leukemia cells in vitro induces endothelialcells to secrete colony-stimulating factors. Blood 70, pp. 1218-1221.81Habener, J.F., Cwikel, B.J., Hermann, H. et al. ( 1989) Metallothinein-vasopressin fusion geneexpression in transgenic mice. Nephrogenic diabetes insipidus and brain transcripts localised tomagnocellular neurons. J. BioL Chem. 264, pp. 18844-18852.Hannink, M. & Donoghue, D.J. ( 1988) Autocrine stimulation by the v-sis gene product requires aligand-receptor interaction at the cell surface. J. Cell Bio1107, pp. 287-298.Hapel, A.J., Vande Woude, G., Campbell, H.D., Young, I.G., & Robins, T. ( 1986) Generation of anautocrine leukemia using a retroviral expression vector carrying the IL-3 gene. Lymphokine Res. 5,pp. 249-254.Hariharan, I.K., Adams, J., & Cory, S. ( 1988) bcr-abl oncogene renders myeloid cell line factorindependent: potential autocrine mechansim in chronic myeloid leukemia. Oncogene Res. 3, 378-99.Hermann, F., Cannistra, S.A., Levine, H., & Griffin, J.D. ( 1985 ) Expression of interleukin 2 receptorsand binding of interleukin 2 by gamma interferon-induced human leukemic and normal monocyticcells. J. Exp. Med. 162, pp. 1111-1116.Holter, W., Goldman, C.K., Casabo, L., Nelson, D.L., Greene, W.C., & Waldmann, H. ( 1987 )Expression of functional IL2 receptors by lipopolysaccharide and interferon-gamma stimulated humanmonocytes. J. ImmunoL 138, pp. 2917-2922.Holter, W., Grunow, R., Stockinger, H., & Knapp, W. ( 1986 ) Recombinant interferon-gamma inducesinterleukin 2 receptors on human peripheral blood monocytes. J. lmmunol. 136, pp. 2171-2175.Hsu, T.C. ( 1961 ) Chromosomal evolution in cell populations. Mt. Rev. Cytol. 12, pp. 69-161.Hu, M. C.-T., & Davidson, N. ( 1990 ) A combination of the lac operator-repressor system with positiveinduction by glucocorticoid and metal ions provides a high-level-inducible gene expression systembased on the human metallothionein-IIA promoter. Mol. Cell. BioL 10, pp. 6141-6151.Huang. J.S., Huang, S.S., & Deuel, T.F. ( 1984 ) Transforming protein of simian sarcoma virusstimulates autocrine growth of SSV-transformed cells through PDGF cell-surface receptors. Cell 39,pp. 79-87.Huang, S.S., & Huang, J.S. ( 1988 ). Rapid turnover of the platelet-derived growth factor receptor insis-transformed cells and reversal by suramin. J. Biol. Chem. 263, pp. 12608-12618.Hunter, T. ( 1991) Cooperation between oncogenes. Cell 64, pp. 249-270.Jirik, F., Burstein, S.A., Treger, L., & Sorge, J.A. ( 1987) Transfection of a factor-dependent cell linewith the murine interleukin-3 ( IL-3) cDNA results in autonomous growth and tumourigenesis. Leuk.Res. 11, pp. 1127-1134.ffiJohnsson, A., Betsholtz, C., Heldin, C.-H., & Westermark, B. ( 1985 ). Antibodies against platelet-derived growth factor inhibit acute transformation by simian sarcoma virus. Nature 317, pp.438-440.Karusayama, H., & Melchers, F. ( 1988 ) Establishment of mouse cell lines which constitutively secretelarge quantities of interleukin 2,3,4 or 5, using modified cDNA expression vectors. Eur. J. lmmunol.18, pp. 97-104.Karusayama, H., Tohyama, N., & Tada, T. ( 1989 ) Autocrine growth and tumourigenicity of interleukin2-dependent helper T-cells transfected with IL-2 gene. J.Exp.Med. 169, pp. 13-25.Kaufman, D.C., Baer,M., Gao, X.Z., Wang, Z., & Preisler, H.D. ( 1988) Enhanced expression of thegranulocyte-macrophage colony stimulating factor in acute myelocytic leukemia cells following in vitroblast cell enrichment. Blood 72, pp. 1329-1332.Kawano, M., Hirano, T., Matsuda, T. et al. ( 1988 ) Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature 332, pp. 83-85.Keating, A., Horsfall, W., Hawley, R.G., & Toneguzzo, F. ( 1990) Effects of different promoters onexpression of genes introduced into hematopoietic and marrow stromal cells by electroporation. Exp.Hematol. 18, pp. 99-102.Keating, M.T., & Williams, L.T. ( 1988) Autocrine stimulation of intracellular PDGF receptors in v-sis-transformed cells. Science 239, pp. 914-916.Kita, H., Ohnishi, T., Okubo, Y., et al. ( 1991 ) Granulocyte/macrophage colony stimulating factor amdinterleukin-3 release from human peripheral blood eosinophils and neutrophils. J. Exp. Med. 174, p.745.Klein, B., Wijdenes, J., Zhang, X.-G., et al. ( 1991 ). Murine anti-interleukin-6 monoclonal antibodytherapy for a patient with plasma cell leukemia. Blood 78, pp. 1198-1204.Klein, B., Zhang, X.-G., Jourdan et al. ( 1989 ) Paracrine rather than autocrine regulation of myeloma-cell growth and differentiation by interleukin-6. Blood 73, pp. 517-526.Koury, M.J., & Bondurant, M.C. (1990 ) Erythropoietin retards DNA breakdown and preventsprogrammed cell death in erythroid progenitor cells. Science 248, pp. 278-381.Koyasu, S., Yodoi, J., Nikaido, T., Tagaya, Y., Taniguchi, Y., Honjo, T., & Yahara, I. ( 1986 ) Expressionof interleukin 2 receptors on interleukin 3-dependent cell lines. J. Immunol. 136, pp. 984-987.Kruse, N., Tony, H.-P., & Sebald, W. ( 1992 ) Conversion of human interleukin-4 into a high affinityantagonist by a single amino acid replacement. EMBO J. 11, pp. 3237-3244.Kuziel, W.A., & Greene, W.C. ( 1991) Interleukin-2 in The Cytokine Handbook ( A. Thomson ed.,Academic Press, London ) pp. 83-102.83Kypta, R.M., Goldberg,Y., Ulug, E.T., & Cournteidge, S.A. ( 1990) Association between the PDGFreceptor and members of the src family of tyrosine kinases. Cell 62, pp. 481-492.Labow, M.A., Bairn, S.B., Shenk, T., & Levine, A.J. (1990) Conversion of the lac repressor into anallosterically regulated transcriptional activator for mammalian cells. Mot. Cell. BioL 10, pp. 3343-335x.Laker, C., Stocking, C., Bergholz, U., Hess, N., De Lamarter, J.F., & Ostertag, W. ( 1987) Autocrinestimulation after transfer of the granulocyte/macrophage colony-stimulating factor gene andautonomous growth are distinct but interdependent steps in the oncogenic pathway. Proc. Natl.Acad. Sc!. USA 84, pp. 8458-8462.Laneuville, P., Heisterkamp, N., & Groffen, J. ( 1991 ) Expression of the chronic myelogenousleukemia-associated p21 Obcr/abl oncoprotein in a murine IL-3 dependent myeloid cell line.Oncogene Res. 6, p. 275.Lang., R.A., & Burgess., A.W. ( 1990 ) Autocrine growth factors and tumourigenic transformation.ImmunoL Today 11, pp.244-249.Lang, R.A., Metcalf, D., Gough, N.M., Dunn, A.R., & Gonda, T.J. ( 1985 ). Expression of ahemopoietic growth factor cDNA in a factor-dependent cell line results in autonomous growth andtumourigenicity. Cell 43, pp. 531-542.Le Gros, G. S., Gillis, S., & Watson, J.D. ( 1985) Induction of IL2 responsiveness in a murine IL3-dependent cell line. J. ImmunoL 135, pp. 4009-Le Gros, J.E., Jenkins, D.R., Prestidge, R.L., & Watson, J.D. ( 1987 ) Expression of genes in clonedmurine cell lines that can be maintained in both interleukin-2 and interleukin-3-dependent growthstates. ImmunoL Cell Biol. 65, pp. 57-69.Leslie, K.B., Ziltener, H.J., & Schrader, J.W. ( 1991) The role of IL-1 and GM-CSF in the paracrinestimulation of an in vivo -derived myeloid leukemia.B/ood 78, pp. 1301-1310.Lindstein, T., June, C.H., Ledbetter, J.A., Stella, G., & Thompson C.B. ( 1989 ) Regulation oflymphokine messenger RNA stability by a surface-mediated T cell activation pathway. Science 244,pp. 339-343.Lokeshwar, V.B., Huang, S.S., & Huang, J.S. ( 1990) Intracellular turnover, novel secretion, andmitogenically active intracellular froms of v-sis gene product in simian sarcoma virus-transformed cells.J. Biol. Chem. 265, pp. 1665-1675.Lowenthal, J.W., Corthesy, P., Tougne, C., Lees, R., MacDonald, H.R., & Nabholz, M. ( 1985) Highand low affinity IL 2 receptors: analysis by IL 2 dissociation rate and reactivity with monoclonal anti-receptor antibody PC61. J. ImmunoL 135, pp. 3988-3994.84Maggiano, N., Colotta, F., Castellino, F., Ricci, R., Valitutti, S., Larocca, L.M., & Musiani, P. ( 1990 )Interleukin-2 receptor expression in human mast cells and basophils. Mt. Arch. Allergy AppL ImmunoL91, pp. 8-14.Metcalf, D. ( 1989) The roles of stem cell self-renewal and autocrine growth factor production in thebiology of myeloid leukemia. Cancer Res. 49, pp. 2305-2311.Miles, S.A., Rezai, A.R., Salazar-Gonzalez, A.F., et al. ( 1990) AIDS Kaposi sarcoma-derived cellsproduce and respond to inerleukin 6. Proc. Natl. Acad. ScLUSA 87, pp. 4068-4072.Moore, M.A.S. ( 1991 ) Clinical implications of positive and negative hematopoietic stem cellregulators. Blood 78, pp.1-19.Moore, M.A.S., Spitzer, G., Williams, N., Metcalf, D., & Buckley, J. ( 1974 ) Agar culture studies in 127cases of untreated myeloid leukemia: the prognostic value of reclassifiaction of leukemia according toin vitro growth characteristics. Blood, 44, p. 1.Moqbel, R., Hamid, Q., Ying, S., et al. ( 1991) Expression of mRNA and immunoreactivity for thegranulocyte macrophage colony stimulant factor in activated human eosinophils. J. Exp. Med. 174, p.749.Morahan, G., Brennand, P.E., Bhathal, P.S., et al. ( 1989) Expression in transgenic mice of class Ihistocompatability antigens controlled by the metallothionein promoter. Proc. Natl. Acad. ScL USA81, pp. 2396-2400.Murohashi, I., Tohda, S., Suzuki, T., Nagata, K., Yamashita, Y., & Nara, N. ( 1989 ) Autocrine growthmechanisms of the progenitors of blast cells in acute myeloblastic leukemia. Blood 74, pp. 35-41.Nakamura, M., Kanakura, Y., Furukawa, Y., Ernst, T.J., & Griffin, J.D. ( 1990 ) Demonstration of IL-1Btranscripts in acute myeloblastic leukemia by in situ hybridization. Leukemia 4, p. 466.Nister, M., Heldin, C.-H., Wasteson, A., & Westermark, B. ( 1984 ) A glioma-derived analog to platelet-derived growth factor: demonstration of receptor competing activity and immunological crossreactivity. Proc. Natl. Acad. ScL USA 81, pp. 926-930.Ohara, J. & Paul, W. ( 1985) Production of a monoclonal antibody to and characterization of B-cellstimulatory factor-1. Nature 315, pp.333-335.Oster, W., Cicco, N.A., Klein, H., Hirano, T., Kishimoto, T., Lindemann, A., Mertelsmann, R.H., &Herrmann, F. ( 1989) Participation of the cytokines, interleukin 6, tumour necrosis factor-alpha, andinterleukin 1-beta secreted by acute myelogenous leukemia blasts in autocrine and paracrineleukemia growth control. J.Clin.Invest. 84, pp. 451-457.Otsuka, T., Eaves, C.J., Humphries, R.K., Hogge, D.E., & Eaves, A.C. ( 1991) Lack of evidence forabnormal autocrine or paracrine mechanisms underlying the uncontrolled proliferation of primitivechronic myeloid leukemia cells. Leukemia 5, pp. 861-868.85Palmiter, R.D., Norstedt, G., Gelinas, R.E., Hammer, R.E., & Brinster, R.L. ( 1983) Metallothionein-human GH fusion genes stimulate growth of mice. Science 222, p. 809-814.Paul, C.C., Keller, J.R., Armpriester, J.M., Baumann, M.A. ( 1990) Epstein-Barr transformed B-lymphocytes produce interleukin-5. Blood 75, p. 1400.Plaut, M., Pierce, J.H., Watson, C.J., Hanley-Hyde, J., Nordan, R.P., & Paul , W.E. ( 1989) Mast celllines produce lymphokines in response to crosslinkage of FcERI and calcium ionophores. Nature339, p. 64.Potter, H. ( 1988) Electroporation in biology: methods, applications, and instrumentation. Anal.Biochem. 174, pp. 361-373.Rambaldi, A., Torcia, M., Bettoni, S., Vannier, E., Barbui, T., Shaw, A.R., Dinarello, C.A., & Cozzolino,F. ( 1991) Modulation of cell proliferation and cytokine production in acute myeloblastic leukemia byinterleukin-1 receptor antagonist and lack of its expression by leukemic cells. Blood 78, pp. 3248-3253.Rambaldi, A., Young, D.C., Hermann, F., Cannistra, S.A., & Griffin, J.D. ( 1987) Interferon gammainduces expression of the interleukin 2 receptor gene in human monocytes. Eur. J. Immunol. 17, pp.153-156.Ravnan, J.-B., Gilbert, D., Ten Hagen, K.G., & Cohen S.N. ( 1992) Random-choice replication ofextrachromosomal bovine papillomavirus ( BPV ) molecules in heterogeneous, clonally derived BPV-infected cell lines. J. Virol. 66, 6946-6952.Razin, E., Leslie, K.B., & Schrader, J.W. ( 1991) Connective tissue mast cells in contact withfibroblasts express IL-3 mRNA: analysis of single cells by polymerase chain reaction. J.I mmuno1.146,p. 981.Reilly, I.A.G., Kozlowski, R., & Russell, N.H. ( 1989 ) Heterogeneous mechanisms of autocrine growthof AML blasts. Brit. J. Haematol. 72, pp.363-369.Resh, M.D. ( 1990) Membrane interactions of pp60v -src: a model for myristylated tyrosine proteinkinases. Oncogene 5, pp. 1437-1444.Rettenmeier, C.W., Jackowski, S., Rock, C.O., Roussel, M.F., & Sherr, C.J. ( 1987 ) Transformation bythe v-fms oncogene product: an analog of the CSF-1 receptor. J. Cell. Biochem. 33, pp109-115.Richmond, A., Balentien, E., Thomas, H.G., Flaggs, G., Barton, D.E., Spiess, J., Bordoni, R., Francke,U., & Derynck, R. ( 1988) Molecular characterization and chromosomal mapping of melanom growthstimulating activity, a growth factor structurally related to beta-thromboglobulin. EMBO J. 7, pp. 2025-2033.86Richmond, A., & Thomas, H.G. (1988) Melanoma growth stimulatory activity: isolation from humanmelanoma tumours and charcterization of tissue distribution. J. Cell. Biochem. 36, pp. 185-198.Roberts, J.M., & Weintraub, H. ( 1988) Cis-acting negative control of DNA replication in eukaryoticcells. Cell 52, pp. 397-404.Rodriguez-Cimadevilla, J.C., Beauchemin, V., Villeneuve, L, Letendre, F., Shaw, A, & Hoang, T.( 1990) Coordinate secretion of interleukin-18 and granulocyte-macrophage colony-stimulating factorby the blast cells of acute myeloblastic leukemia: role of interleukin-1 as an endogenous inducer.Blood 76, p. 1481.Sakai, K., Hattori, T., Matsuoka, M., Asou, N., Yamamoto, S., Sagawa, K., & Takatsuki, K. ( 1987 )Autocrine stimulation of interlekin 1B in acute myelogenous leukemia cells. J.Exp.Med. 166, pp.1597-1602.Sanderson, C.J., Campbell, H.D., & Young, I.G. ( 1988) Molecular and cellular biology of eosinophildifferentiation factor ( interleukin-5 ) and its effects on human and mouse B cells. Immunol. Rev. 102,p. 29.Savill, J., Wylie, A.H., Henson, J.E.et al. ( 1989) Macrophage phagocytosis of aging neutrophils ininflammation: programmed cell death in the neutrophil leads to its recognition by macrophages. J.Clin. Invest. 83, pp. 865-875.Scala, G., Morrone, G. Tamburrini, M., et al. ( 1987 ) Autocrine growth function of human interleukin 1molecules on ROHA-9, an EBV transformed human B cell line. J.Immunol. 138, pp. 2527-2534.Scala, G., Quinto, I., Ruocco, M.R., et al. ( 1990) Expression of an exogenous interleukin 6 gene inhuman Epstein-Barr virus cells confers growth advantage and in vivo tumourigenicity. J. Exp. Med.172, pp. 61-68.Schrader, J.W., Clark-lewis, I., Crapper, R.M., & Wong, G.W ( 1983) P-cell stimulating factor:characterization, action on multiple lineages of bone marrow-derived cells and role in oncogenesis.Immunol. Rev. 76, pp. 79-104.Schrader, J.W., & Crapper, R.M. ( 1983 ) Autogenous production of hemopoietic growth factor "P cellstimulating factor" as a mechanism for transformation of bone marrow-derived cells. Proc. Natl. Acad.Sci. USA 80, pp. 6892-6896.Schrader, J.W. ( 1991) Interleukin-3 in The Cytokine Handbook ( A. Thomson ed., Academic Press,London ) pp. 103-118.Schrader, J.W. ( 1992 ) Biological effects of myeloid growth factors. In Balliere's Clinical Haemtaology,Vol.5 No.3, ( B.I.Lord & T.M.Dexter, eds. Balliere Tindall, London, 1992 ).Schwab, G., Siegall, C.B., Aarden, L.A., Neckers, L.M., & Nordan, R.P. ( 1991 ) Characterization of aninterleukin-6-mediated autocrine loop in the human multiple myeloma cell line, U266. Blood, 77, pp.587-593.87Shanahan, C.M., Rigby, N.W., Murray, J.D., Marshall, J.T., Townrow, C.A., Nancarrow, C.D., & Ward,K. ( 1989 ) Regulation of a sheep metallothionein 1a-sheep growth hormone fusion gene intransgenic mice. MoL Cell. Biol. 9, pp. 5473-5479. 9, pp. 5473-5479.Sherr, C.J., Rettenmeier, C.W., Sacca, R., Roussel, M.F., Look A.T., & Stanley, E.R. ( 1985 ) The c-fms proto-oncogene product is related to the receptor for the mononuclear phagocyte growth factor,CSF-1. Cell 41, pp. 665-676.Shirakawa, F., Tanaka, Y., Oda, S., Eto, S., & Yamashita, U. ( 1989 ) Autocrine stimulation ofinterleukin 1-alpha in the growth of adult human T-cell leukemia cells. Cancer Res. 49, pp. 1143-1147.Smith, K.A., Favata, M.F., & Oroszlan, S. ( 1983) Production of monoclonal antibodies to humaninterleukin 2: strategy and tactics. J. ImmunoL 131, pp. 1808-1815.Sporn, M.B., & Roberts, A.B. ( 1985 ) Autocrine growth factors and cancer. Nature 313, pp. 745-747.Stocking, C., Loliger, C., Kawai, M., Suciu, S., Gough, N., & Ostertag, W. ( 1988) Identification ofgenes involved in growth autonomy of hematopoietic cells by analysis of factor-independent mutants.Cell 53, pp. 869-879.Suematsu, S., Matsuda, T., Aozasa, K. et al. ( 1989) IgG1 plasmacytosis in interleukin 6 transgenicmice. Proc. Natl. Acad. Sci. USA 86, pp. 7547-7551.Suematsu, S., Matsusaka, T., Matsuda, T., et al. ( 1992) Generation of plasmacytomas with thechromosomal translocation t ( 12;15) in interleukin 6 transgenic mice. Proc. Natl. Acad. Sc). USA 89,pp. 232-235.Takatsu, K., Tominaga, A., Harada, N., et al. ( 1988 ) T cell replacing factor ( TRF)/interleukin 5 ( IL-5 ):molecular and functional properties. Immunol.Rev. 102, p. 107.Taniguchi, T., Matsui, H., Fujita, T., Hatakeyama M., Kashima, N., Fuse, A., Hamuro, J., Nishi-Takaoka,C. & Yamada, G. ( 1986) Molecular analysis of the interleukin-2 system. Immunot Rev. 92, pp. 121-133.Thomson, A ( 1991 ) The Cytokine Handbook. ( A. Thmoson, ed., Academic Press, London, 1991 ).Todaro, G.J., & De Larco, J.E. ( 1978 ) Growth factors produced by sarcoma virus-transformed cells.Cancer Res. 38, pp. 4147Tohyama, K., Lee, K.H., Tashiro, K., Kinashi, T., & Honjo, T. ( 1990) Establishment of an interleukin-5-dependent subclone of an intereukin-3-dependent murine hemopoietic progenitor line, LyD9, andits malignant transformation by autocrine secretion of interleukin-5. EMBO J. 9, pp. 1823-1830.88Trojan., J., Blossey, B., Johnson, T.R., Rudin, S.D., Tykocinski, M., Ilan, J., & Ilan, J. (1992) Loss oftumourigenicity of rat glioblastoma directed by episomebased anti-sense cDNA transcription ofinsulin-like growth factor I. Proc. Natl. Acad. Sci. USA 89, pp. 4874-4878.Trojan., J.,Johnson, T.R., Rudin, S.D., Ilan, J., Tykocinski, M.,& Ilan, J. (1993 ) Treatment andprevention of rat glioblastoma by immunogenic C6 cells expressing antisense insulin-like growthfactor I mRNA. Science 259, pp. 94-97.Vandenabeele, P., Jayaram, B., Devos, R., Shaw, A., & Fiers, W. ( 1988 ) Interieukin 1-alpha acts as anautocrine growth factor for RPMI 1788 and Epstein-Barr virus-transformed human B-cell line. Eur. J.ImmunoL 18, pp. 1027-1031.Vink, A., Coulie, P.G., Wauters, P., Nordan, R.P. & Van Snick, J. ( 1988) B cell growth anddifferentiation activity of interleukin-HP1 and related murine plasmacytoma growth factors. Synergywith interleukin 1. Eur. J. ImmunoL 18, pp. 607-612.Wakasugi, H., Rimsky, L., Mahe, Y., et al. ( 1987 ) Epstein-Barr virus-containing B-cell line produces aninterleukin-1 that it uses as a growth factor. Proc. Natl. Acad. ScL USA 84, pp. 804-808.Waldmann, T.A. ( 1991 ) The interleukin-2 receptor. J. Biol. Chem. 266, pp. 2681-2684.Waterfield, M.D., Scrace, G.T., Whittle, N., Stroobant, P., Johnsson, A., Wasteson, A., Westermark,B., Heldin, C.-H., Huang, J.S., & Deuel, T.F. ( 1983) Platelet-derived growth factor is structurallyrelated to the putative transforming protein p28sIs of simian sarcoma virus. Nature 304, pp. 35-39.Weissman, D., Parker, D.J., Rothstein, T.L., Marshak-Rothstein, A. ( 1985 ). Methods for theproduction of xenogeneic monoclonal antibodies in murine ascites. J. ImmunoL 135, pp. 1001-1003.Werge, T.M., Biocca, S. & Cattaneo, A. ( 1990) Intracellular immunization Cloning and intracellularexpression of a monoclonal antibody to the p21 ras protein. FEBS Lett. 274, 193-198.Wodnar-Filipowicz, A., Heusser, C.H., & Moroni, C. ( 1989) Production of the hemopoietic growthfactors GM-CSF and interleukin-3 by mast cells in response to IgE receptor-mediated activation.Nature 317, p. 255.Wong, P.M.C., Chung, S.-W., & Nienhuis, A.W. ( 1987) Retroviral transfer and expression of theinterleukin-3 gene in hemopoietic cells. Genes and Dev. 1, pp.358-365.Yamada, G., Kitamura, Y., Sonoda, H., Harada, H., Tali, S., Mulligan, R.C., Osawa, H., Diamantstein, T.,Yokoyama, S., & Taniguchi, T. ( 1987 ) Retroviral expression of the human IL-2 gene in a murine T cellline results in cell growth autonomy and tumourigenicity. EMBO J.6, pp. 2705-2709.Yamamoto, S. Hattori, T., Matsuoka, M., Ishii, T., Asou, N., Tagaya, Y., Yodoi, J.,& Takatsuki, K ( 1986 )Induction of Tac antigen and proliferation of myeloid lekemic cells by ATL-derived factor: comparisonwith other agents that promote differentiation of human myeloid or monocyte leukemic cells. Blood67, pp. 1714-1720.89Young, D.C., Demetri, G.D., Ernst, T.J., Cannistra, S.A., & Griffin, J.D. ( 1988 ) In vitro expression ofcolony-stimulating factor genes by human acute myeloblastic leukemia cells. Exp. Hematol. 16, pp.378-382.Young, D.C. & Griffin, J.D. ( 1986 ) Autocrine secretion of GM-CSF in acute myeloblastic leukemia.Blood 68, pp. 1178-1181.Young, D.C., Wagner, K., & Griffin, J.D. ( 1987 ). Constitutive expression of the granulocyte-macrophage colony-stimulating factor gene in acute myeloblastic leukemia. J. Clin. Invest. 79, pp.100-106.Zhang, X.G., Klein, B., & Bataille, R. ( 1989 ). Interleukin-6 is a potent myeloma-cell growth factor inpatienst with aggressive multiple myeloma. Blood 74, pp. 11-13.90APPENDIX 1: PROLIFERATIVE RESPONSES OF FACTOR-DEPENDENT CELLLINESThe factor-dependent cell lines HT-2, R6X, 41 E5, and FDC-P1 were used in these studies. Typicalfactor-response curves are presented for each line, and the factors to which they are known torespond ( figures 1.37 - 1.40 ). Absolute quantitation of growth factors has not been stressed in thebody of the thesis, since each assay included an internal control, and the conclusions drawn werebased on these internal comparisons. International conventions have established the defintion of a"unit" of bio-activity for a growth factor as the amount of factor present in a solution that gives rise tohalf the maximal proliferation of which the assay cell is capable in response to that growth factor. TheWorld Health Organisation has organised an international collaborative effort to develop referencestandard preparations of hemopoietic growth factors. After at least 5 years of work, the first standardreference preparations have recently become available - for human GM-CSF and G-CSF ( Dr H.Ziltener, Biomedical Research Centre, personal communication ).The need for these standards is highlighted by the differences seen in apparent activity of apreparation according merely to the duration of the bio-assay. A decrease in apparent bioactivity isseens with time, in terms of a shift to the right of the proliferation curve ( in the form titrations are herepresented ). Actual results obtained with a source of IL-3 and the R6X cell line are presented in figure1.41. The bio-assay was plated in three separate Terasaki microtiter plates, and one plate harvested,after identical thymidine pulse duration on each of the next 3 days.The apparent bio-activity of eachasaay was approximated in each case, as shown. The bio-activity estimations ranged from between512 and 1024 units of activity as determined on day 1, to between 64 and 128 units as determined onday 3, although each assay was in fact performed with the identical titration of IL-3. This decrease withapparent bio-activity over time is expected since cell number in each well increases in response to netproliferation-inducing levels of factor, and the factor is also consumed by the cells it stimulates.Several of the growth factors used in these studies were applied in the form of conditioned media ofcell lines transfected with vectors allowing expression of the factors ( Karusayama and Melchers,1988, and see Materials and Methods ). These lines were kindly donated by Dr. Fritz Melchers of theInstitute of Immunology, Basel, Switzerland.100000 -80000 -60000 -40000 -20000 -t f^t^t^t^t4^8^16 32 64 128 256 512 M.A.CPM—o-- W3IL-291Factor dilutionFig. 1.37 Typical growth-factor responses of R6X cells W3 - WEHI-3B conditioned medium ( sourceof IL-3 ). The IL-2 titration is the same as that shown in figure 1.38. 500 cells per well. 48 hourincubation plus 10 hour 3H-thymidine pulse. hIL-2smIL-4--at— W32^4^8^16 32 64 :128 256 512 M.A.Factor dilutionFig. 1.38. Typical growth-factor response of HT-2 cells  hIL-2 - recombinant human IL-2. Startingconcentration approximately 40 units per ml, acording to manufacturer. smlL-4 - synthetic mouse IL-4( kindly donated by Dr. Ian Clark-Lewis, Biomedical Research Centre ). W3 - WEHI-3B conditionedmedium ( source of IL-3 ). 1000 cells per well. 48 Hour incubation plus 12 hour 3H-thymidine pulse.92 —0---- mGM-CSF--11---- W3---4---- h IL-22^4^8^16 32 64 128 256 512 M.A.Factor dilutionFig. 1.39 Typical growth-factor responses of FDC-P1 cells mGM-CSF - affinity-purified mouse GM-CSF produced by stimulated T-cells ( kindly donated by Dr. Hermann Ziltener, Biomedical ResearchCentre ); W3 - WEHI-3B conditioned medium ( source of IL-3) The IL-2 titration is the same as thatshown in figure 1.38. 500 cells per well. 60 hour incubation plus 8 hour 3H-thymidine pulse.CPMI^I^i2^4^8^16 32 64 128 256 512 M.A.Factor dilutionFig. 1.40. Typical growth-factor response of 41 E5 10 -fold concentrated conditioned medium of Psi2fibroblasts was used as a source of mouse IL-6. Higher concentrations appear to inhibit proliferation.In the presence of 10% FCS ( as used here ), 41 E5 cells at this density show some thymidineincorporation in the absence of a known source of IL-6. 500 cells per well. 60 hour incubation plus 10hour 3H-thymidine pulse.100000 -80000 -60000 -CP M40000 -20000 -0 i^ I^lit -  ty c)^in CO r- co co 0^04 CI st ^CO 4..^493—0--- Day 1 .—0— Day 2Day 3Factor dilution ( log base 2 )Fig. 1.41. Apparent decrease of bio-activity with duration of assay  The curves result from harvest on3 consecutive days of the same inital titration of IL-3 on R6X cells ( 500 per well ). Pulse duration was8 hours in each case. Note the shift in the position of the one unit value - i.e. the point on thehorizontal axis corresponding to the half-maximal stimulation point on the curve.94APPENDIX 2: PURIFICATION OF ANTIBODIESThe DMS1 and DMS2 antibodies were obtained from secreting hybridoma cells in storage at theBiomedical Research Centre. Antibodies were prepared either from tissue culture supernatants orfrom mouse ascites. Supernates were first concentrated by Amicon ultrafiltration, using membraneswith a molecular weight cut-off of 15000 M r , and then passed over sheep anti-mouse-IgG affinitycolumns [ prepared by Dr. Hermann Ziltener of the Biomedical Research Centre ]. For preparation ofmouse ascites, 5 x 106 cells were injected into the peritoneal cavities of pristane-primed mice, and themice sacrificed and ascites collected when abdominal swelling was apparent. The antibody-content ofascites preparations was enriched by initial precipitation with ammonium-sulphate, and dialysedagainst 3 changes of 200 volumes of phosphate-buffered saline before further purification. Thepurification steps were monitored by enzyme-linked immuno-sorbent assay ( ELISA ), in which theantibody in solution was captured on plates that had been coated with sheep anti-mouse IgG, anddetected with commercially obtained peroxidase-labelled goat anti-mouse IgG ( which showed nobackground cross-reactivity with the sheep antibodies ). Typical results of column-purification arepresented in figure 1.42. Resultant preparations were assessed by small-scale gel-electrophoresis( Phast mini-gel system ). The only bands visible on silver-staining of these gels were those of thesizes of IgG heavy and light chains, and the intensity of these bands suggested that the preparationswere at least 95% pure immunoglobulin. The protein content of these antibody preparations wasquantitated by the Bradford method, using commercially obtained bovine serum albumin forconstruction of the standard curve.Rat antibodies were obtained from hybridoma cells, either as tissue-culture supernatants or as mouseascites. For preparation of mouse ascites, the protocol of Weissman et al. ( 1985 - see Materials andMethods ) was followed, in which mice were immuno-suppressed by sub-lethal irradiation and injectionof hydrocortisone. The 11B11 ( anti-mIL-4 ) antibody, has a kappa light chain, and was thus affinity-purified on a mouse anti-rat-kappa affinity column ( prepared as above, from antibody produced inascites by 11B11 hybridoma cells, and coupled to cyanogen-bromide activated sepharose beads ).11B11 was produced by Dr. Junichi Ohara ( Ohara and Paul, 1985 ).1L-4-specific neutralising activityof the preparation used is shown in figure 1.43. The neutralising rat anti-mouse IL-6 monoclonal 6B4( Vink et al., 1988) was prepared similarly. A specificity control for the prearation of 6B4 used here isshown in figure 1.44.The PC61 rat anti-mouse-IL-2-receptor antibody has a lamda light chain, however, and attempts topurify PC61 ascites preparations by ion-exchange chromatography and protein A chromatographyproved unsuccessful ( yielding protein "peaks" too broad to provide any enrichment of the antibody ).95Therefore a rabbit anti-rat immunoglobulin antibody was prepared at the Biomedical Research Centre( with the assistance of Mr. John Babcook ), by injecting two rabbits sub-cutaneously with acombination of 11B11 antibody and dialysed, ammonium-sulphate concentrated PC61 ascitespreparations. The anti-rat antibody titre of the rabbit serum was monitored by ELISA with 11B11-coated plates, and when the titre appeared to plateau, the rabbits were sacrificed, and serumcollected. The immunoglobulin fraction of the serum was purified by protein A affinitychromatography, and coupled to cyanogen-bromide activated sepharose beads after densitometricquantitation. Affinity columns prepared with these beads were used to purify PC61 antibodies fromascites preparations. Purification was monitored by ELISA with commercial anti-rat antibodies thatshowed no background cross-reactivity against either rabbit or mouse immunoglobulin.The rabbit antibodies to mlL-3 ( Rab7 ) and mGM-CSF ( Rab39 ) were produced by Dr. HermannZiltener and John Babcook of the Biomedical Research Centre. The antigens used to raise theseantibodies were synthetic peptides of mIL-3 and GM-CSF synthesised by Dr. Ian Clark-Lewis of theBiomedical Research Centre. Factor-specific neutralising activities of these antibodies are shown infigures 1.45 and 1.46.—0— Pre-columnDrop through—0^ EluateLOD30002000 -1000 -9610^100^1 000^10000Dilution/1000Fig. 1.42. ELISA monitoring of affinity-column purification of DMS antibodies.  100008000 -6000 -CPM smlL-4hIL-24000 -2000 -02^4^8^16 32 64 128  15 6 512  No abDilution of ab.Fig. 1.43. Specific inhibtory activity of the 11B11 antibody preparation used in these studies. Antibodywas titrated in the presence of approximately one unit of synthetic mouse IL-4 ( kindly donated by Dr.Ian Clark Lewis, Biomedical Research Centre ) or an amount of recombinant human IL-2 thatproduced a similar proliferative resonse. HT-2 cells - 1000 per well. 48 hour incubation plus 8 hour3H-thymidine pulse.8000 6000 -4000 -2000 -CPM—o— Psi2 CMLK28 CM40000 -30000 -CPM 20000 -10000 -976^12 24 48 96 192  384 768  No abDilution of aFig. 1.44. Specific inhibtory activity of the 6B4 antibody preparation used in these studies.  Antibodywas titrated on cells of the IL-6-responsive cell-line B9 (ref. ) in the presence of either human ormouse IL-6. LK28 CM - conditioned medium of a B-lymphoblastoid human cell line; Psi2 CM - 5-foldconcentrated conditioned medium of Psi2 mouse fibroblasts. 500 cells per well. 40 hour incubationplus 8 hour 3H-thymidine pulse.4^16 32 64 128 256  512 No ab.Dilution of antibodyW3mIL-2Fig. 1.45. Specific inhibtory activity of the Rab7 antibody preparation used in these studies  Antibody( as serum ) was titrated on FD.C/2 cells in the presence of approximately one unit of IL-3, or asmaller amount of murine 1L-2. Initial concentration of serum was 1/30. 500 cells per well. 60 hourincubation plus 8 hour 3H-thymidine pulse.40000 30000 -CPM 2000010000 -e- In W3In GM-CSF982^4^8^16 32 64 128  25 6 512  No ab.Dilution of ab.Fig. 1.46. Specific inhibtory activity of the Rab39 antibody preparation used in these studies. Antibody( as serum ), was titrated on FDC-P1 cells in the presence of approximately one unit of either IL-3 orsynthetic murine GM-CSF ( courtesy of Dr. Ian Clark-Lewis, Biomedical Research Centre ). W3 -WEHI-3B conditioned medium ( source of IL-3 ). Note the apparent stimulatory activity at higherconcentrations of anti-serum. 500 cells per well. 60 hour incubation plus 6 hour 3H-thymidine pulse.99A NEW TECHNIQUE IN GENE DELETIONFOREWORDMuch of the work reported in this part of the present thesis was presented in a paper entitled "Tissue-and site-specific DNA recombination in transgenic mice", published in Proceedings of the NationalAcademy of Sciences of the U.S.A Vol. 89, pp 6861-6865, August 15, 1992. The present authorwas first author on this publication. Daniel Chui was a co-author, and Jamey D. Marth the senior author.Since a proportion of the work reported here was performed by colleagues of the present author,strict attention has been paid to accurate attribution of the work involved. These attributions areindicated by inclusion of the name of the researcher who carried out the work in square brackets,when practicable, and in some cases the impersonal third person construction usual in theses hasbeen abandoned in favour of simple third person construction naming the contributor of the relevantpieces of work. Where no such attribution is made, it is to be inferred that the present authorperformed the work described.INTRODUCTION1) FORMATION OF THE CONCEPT ( TWO TECHNICAL PROBLEMS WITH ACOMMON SOLUTION ) A) A problem in the study of pathogenesis.In their 1990 review "Autocrine growth factors and tumourigenic transformation" ( Lang and Burgess,1990 ), Lang and Burgess give examples of spontaneously arising and experimentally inducedtumours in which autocrine growth factor production is found. Subsequently they state:'Regardless of all the above examples, it is still not proven that growth factorproduction is essential for the maintenance of neoplastic transformation in animals.'Clearly, the only way to ultimately prove this would be to remove from a pre-existing tumour the abilityto make or use autocrine factor, and then assay it's ability to behave like a tumour. It might be possibleto suppress autocrine factor production by expressing anti-sense message to the autocrine factorwithin the tumour cells, or inhibit the activity of autocrine factor by exogenously applying antagonist, or100even by arranging it that the tumour cells themselves expressed the antagonist. These strategies,however, suffer from what one might call the "problem of incompleteness"; one might envisage thatone or both of these strategies would fail to inhibit the tumour-behaviour, and one would be leftasking the question: was all the potentially autocrine activity inhibited? Were there a few molecules ofautocrine factor still active within the cells, molecules that were for technical reasons simply beyondthe ability of anti-sense or anagonist to inhibit? Was this a complete experiment?This problem of incompleteness can be given a much deeper context: It is widely believed thatoncogenesis is, in general, a multi-step process - that it is the culmination of a series of geneticchanges in the normal function of the cells from which tumours arise. In some instances, it is evenpossible to mimic this series of changes in primary cells in vitro, by the stepwise, or simultaneous,addition of several activated oncogenes ( reviewed, for instance, in Hunter, 1991 ). Here again, onemight ask of the tumour that finally arises - which genetic changes must still be in effect for the tumourto be continue to be a tumour? Are all of them required, or were some merely there to allow thedeveloping tumour to overcome some patho-physiological hurdle? Indeed this sort of question canbe given even broader scope - in any pathological process involving more than one genetic change,which changes are required for maintenance or exacerbation of the pathological state? How can thisquestion be addressed experimentally? Again, by reversing the effects of a genetic change, and hereagain, the experiment would have to involve a complete reversal of the effect of the given geneticchange(s) for the results to be interpretable, in the event that the pathology persisted after the"reversal". The answers to such questions would be essential to evaluating the feasibilty of particulargene therapies for tumours and other pathological conditions.The only way to carry out such experiments "cleanly" would be to "sabotage" the gene in question.Currently, such a technique of "gene-sabotage" is used in creating mice that lack the function of achosen gene, in order to study the effects of the mutation in the development and function of theanimal. These "gene-targetting" experiments ( for a review see Capecchi, 1989) rely on homologousrecombination between the endogenous gene and a piece of transfected DNA.The recombination isdesigned such that a crucial portion of the endogenous gene is replaced or displaced by a markergene which can be used to select for success of the gene transfer. Typically, a polymerase chainreaction ( PCR ) analysis is then performed to determine in which cells the incoming DNA has actuallyundergone homologous recombination rather than simply integrated into the genome at an irrelevantsite. This manipulation is carried out on embryo stem (ES) cells which can then be introduced intoblastocysts, and will then contribute to all the tissues of the mouse, including those of the germ-line.Such experiments are highly labour-intensive, since homologous recombination ocurrs in the minorityof instances, and there is no guarantee that a given embryo stem cell so selected will indeed101contribute to the germ-line of the resulting mice. It is only because the technique allows conclusionsabout the function of genes to be drawn in such a precise way ( "this is what happens if the gene isabsent - definitely absent, no function of the gene there at all" ), that it has become one of mostrespected techniques in analysis of gene function in mammals. Conceivably, this technique might beapplied to the questions being considered above, but this would involve a considerable amount ofmanipulation of tumour cells in vitro, and the deliberate induction of homologous recombination maysimply not be possible in some cells, or occur at a frequency that makes such experiments impractical.B) Problems in the study of developmentThe technique of inducing mutations in mice by gene-targetting is so powerful as to be rapidlyreplacing that of creating transgenic mice in which a gene function is overexpressed, or expressedectopically, in terms of the "cutting edge" of the study of gene function in mammals. It is prone to onelimitation, in particular, that may, in some cases, leave the investigator almost empty handed. This mayarise in those instances where total absence of function of the gene in question leads to embryoniclethality, even when animals hemizygous for the ( null ) mutation display no phenotype. Several genesalready targetted have resulted in embryonic-lethality for homozygous-null progeny.( Lee et al, 1992;Stanton et al, 1992; Li et al., 1992) In such cases, the investigator may be able to examine early, evenpre-implantation embryonic tissue, and thereby determine that the gene is essential for a givenprocess to take place at a given embryonic stage, in a given tissue, and that failure of this process totake place is the cause of the embryonic death.Moreover, the investigator might be able to go on to make and implant blastocyst chimeras in whichembryonic cells from the still-viable homozygous null early embryos ( or from ES cells in which bothcopies of the gene have been "targetted" ) compete with wild-type cells for subsequent contributionto the various tissues of the resulting animal. In such an animal, one might expect only wild-type cellsto be present in those tissues whose development requires the function of the gene, whereastissues in which the gene's function is immaterial to development would consist of a mixture of wild-type and homozygous-null cells. Although at first glance, this might seem an elegant solution to theproblem of embryonic-lethality, it would only allow one to ask in which tissues is the presence of thegene essential for normal development, in the case of genes whose function was cell-autonomous, orat least tissue-autonomous, or whose non-tissue-autonomous function was critically dose-dependent. One might imagine a scenario in which the function of gene alpha in tissue A is requiredfor the normal development of tissue B. In the absence of expression of alpha, tissue B is present butnot fully developed, and this is what one would see in the non-chimeric homozygous-null animal, were102it not for the fact that the total absence of gene alpha resulted in embryonic lethality at day 3 post-conception. In the chimeric animal, however, the wild-type cells that make up a portion of tissue A doexpress ALPHA, and sufficient alpha product is available that no abnormality of tissue B is noted. Anadditional shortcoming of the chimeric strategy is that it would not allow one to address the question ofwhat effect the absence of a gene would have in a mature tissue whose presence was dependent onthe function of that gene during development.C) The solutionBoth the problems discussed above would be overcome if one had the ability to remove a definedportion of genetic material from a cell at will. While it would be overstating the case to claim that this isindeed possible for any gene in any cell, there is a method described in the literature whose furtherdevelopment may lead to the realisation of this possibility.There exists a family of site-specific DNA recombinases members of which are involved in the life cycleof bacteriophage, and the maintenance of copy number of the yeast 2i. plasmid. The activity of theserecombinases is such that they will remove from a target sequence DNA that lies between the twodirectly repeated copies of a specific sequence ( which varies from one recombinase to another ).Such a recombinase might be used to address the problem of multi-step pathogenesis. The geneticmutation one wished to study ( i.e. one of the multiple "steps" ) might be introduced with a construct inwhich the mutation sequence is flanked by the specific sequences that would allow later removal ofthe mutation sequence when exposed to the recombinase activity. Similarly, in the context ofhomozygous embryonic-lethality of gene-targetting events, one might breed a mouse in which such apotentially embryonic-lethal genotype has been "rescued" by the presence of a copy of the targettedgene flanked by the specific sequence which would allow eventual removal of the gene in tissue(s)and at a time determined by the expression of the recombinase. The subject of this portion of thethesis is a project designed to determine whether such a recombinase could function in a site-specificand tissue-specific fashion in transgenic mice2) LITERATURE REVIEWSince the work reported here is by way of a demonstration of the feasibility of a novel technique, adetailed review of DNA recombination has not been undertaken. It has been the author's intention todiscuss briefly the literature relevant to understanding the determinants and mechanisms, to the103extent they are known, of site-specific recombination, and such information in the literature as mightallow one to predict the scope of the potential applications of the technique described here.A) Background.Site-specific recombination may be distinguished from homologous ( "general" ) recombination, interms of features of the substrate DNA's, the recombination machinery itself, and the structuralmechanism of the recombination ( Craig, 1988 ). Homologous recombination ( the mechanism thatgene-targetting relies upon ) involves exchange between regions of DNA sharing extensivehomology, and the crossing over or exchange point may lie anywhere within the regions of homology.In contrast, site-specific recombination results in rearrangements of DNA sequences that lack suchregions of homology but the recombination points are determined with some precision, within smallregions of the DNA. Two distinct forms of site-specific recombination can be recognised: a)transposition, in which there is no homology between the recombination sites, DNA synthesis occurs,and the recombination is non-reciprocal; and b) conservative site-specific recombination, in which therecombination point lies within a short sequence of identity shared by the DNAs involved, breakageand joining of strands occur in the absence of net change in the quantity of DNA present, andrecombination is reciprocal ( Craig and Kleckner, 1987; Campbell, 1962 ). It is this latter form of site-specific recombination that forms the subject of this review.B) Basic structural features.Although the structural mechanisms of the CRE site-specific recombinase system will be discussed insome detail later, ( section D ), some of the fundamental topology of such systems will be described atthis point, so as to facilitate comprehension of subsequent sections.Site-specific recombinase activity was first described in the context of the closed-circular double-stranded DNA chromosomes of bacteria and bacteriophage so the topological illustrations of thisactivity are usually of the form found in figure 2.1 The action of a conservative site-specificrecombinase on two separate DNA circles each containing a single target site will result in a singlecircle containing the DNA from both the former circles, and bearing two identical or nearly identicaltarget sites in direct repeat orientation ( fig. 2.1, part a ). The reverse reaction also occurs, forming twocircles from one larger one in which the target sites occur as direct repeats ( fig. 2.1, part b ). In theA+ 0104C 4-Fig. 2.1. Topology of recombinations mediated by the conservative site-specific recombinases( after Craig, 1988 ). A) Single target sites on two separate circular DNA molecules. B) Two target sitesin the same orientation on a single circular DNA molecule. C) Two target sites in the oppositeorientation on a single circular DNA molecule.105case of a circular DNA molecule containing two target sites in opposite orientation, the DNA betweenthe target sites is inverted with respect to the remainder of the circle ( fig. 2.1, part c ). The implicationsof these mechansims with respect to DNA in topologically linear forms will become clear in the courseof the subsequent discussion.C) Conservative site-specific recombination in nature.This form of recombination was first observed during the study of lambdoid bacteriophages. Campbell( Campbell, 1962) first suggested that lambda uses such a mechanism to integrate into the host E.colt chromosome during lysogeny. In this case, recombination between the phage sequence attP andthe host sequence attB. is mediated by the phage protein INT, and requires the host proteinIntegration Host Factor ( Thompson and Landy, 1989; Weisberg and Landy, 1983 ). For thisrecombination to take place, the attP site must be present as supercoiled DNA. A further host protein,FIS, modulates excision of the phage ( Thompson et al., 1987 ). Several other bacteriophage, e.g. P2and 186 ( Kalionis et al., 1986) and P4 ( Pierson and Kahn, 1987) use a similar mechanism.The replicative cycle of bacterial Tn3-like transposons involves two separate steps of site-specificrecombination, a non-conservative step and a conservative resolution step mediated by thetransposon-encoded resolvase ( reviewed in Grindley and Reed, 1985; Hatful and Grindley,1988 ). The cyanobacterium Anabena uses a site-specific recombination mechanism, in the absenceof a supply of reduced nitrogen, to excise DNA segments that interrupt the coding sequences ofnitrogen-fixing genes ( Haselkorn, 1989; Haselkorn et al., 1986 ). There is a family of recombinaseswhose members function to invert the DNA between their recombination sites in S. typhimurium andseveral bacteriophage: the HIN recombinase of S. typhimurium changes the orientation of a promoterwhich results in an alteration of flagellar antigens; the GIN and CIN proteins of bacteriophage Mu andP1, respectively, bring about DNA inversions that allow modulation of the host-range of thebacteriophage ( reviewed in Glasgow et al., 1989, Hatful and Grindley, 1988, and Johnson and Simon,1989 ). The transposon resolvases and these latter "invertases" require their target sites to bepresent as supercoiled DNA. Another system of site-specific inversion is found in E. coli, which canmodulate the presence of fimbriae that allow adhesion to eukaryotic cells, by way of the fimA promoterand the fimB and fimE genes ( Glasgow et al., 1989; Klemm, 1984 & 1986; Abraham et al., 1985 ).The bacteriophage P1 displays a site-specific recombinase function, in addition to that of CINmentioned above. Rather than integrate into the host chromsome during lysogeny, as do thelambdoid prophage, P1 is mostly ( but see below ) maintained as a low-copy-number plasmid ( often at106only one copy per cell ). Copies of the plasmid tend to form dimers after replication, by homologousrecombination, and the resulting failure of copies of the plasmid to segregate into daughter cellswould rapidly lead to loss of the prophage from the population. P1 produces an enzyme called CREthat promotes recombination between target sites called lox to promote separation of such dimers,and maintain segregation of prophage copies ( Austin et al., 1981 ).Whereas all the naturally occurring conservative site-specific recombination systems so far mentionedare of prokaryotic origin, such systems have also been described in eukaryotes. The bestcharacterised of these is the FLP system of the 2gm plasmid of yeast. This plasmid, often found inSaccharomyces cerevisiae carries the gene encoding the recombinase, and two copies of the targetfrt ( FLP recombination target ) in opposing orientation. Expression of the FLP allows the plasmid toincrease its copy number per cell, despite obeying the eukaryotic rule of one replication initiation percell cycle ( reviewed in Cox, 1989 ). Structurally and functionally similar mechanisms have been foundin 2µm-like plasmids of other yeasts ( Toh-e et al., 1982; Toh-e et al., 1984 ).Three of the recombination systems so far mentioned, namely the lambda INT, the P1 CRE, and the2j.tm plasmid FLP, share a common mechanism of action at the biochemical level: they attach tobroken DNA through 3' phosphodiester linkage to a tyrosine residue, and generate staggered breakswith 5' protruding ends of 6-8 base pairs ( Andrews et al., 1985; Craig and Nash, 1983; Gronostajskiand Sadowski, 1985; Hoess and Abremski, 1985; Pargellis et al., 1988; Senecoff et al., 1985 ).Additionally, the INT, CRE, and FLP proteins share a marked sequence homology in a carboxy-terminal domain of about 40 amino acids which has been shown to be responsible for catalytic activity,as deletion removes recombination activity without affecting DNA-binding. Although the target sites ofINT, CRE, and FLP share some sequence similarity, the target specificity of the enzymes is thought tobe determined by sequences outside the 40 amino acid homologous domain ( Pargellis et al., 1988;Parsons et al., 1988; Prasad et al., 1987; Wierzbicki et al., 1987 ). This latter domain includes aperfectly conserved tyrosine, which has been shown to be the site of DNA linkage ( in the case of INT,at least, Pargellis et al., 1988 ). Many other recombinase proteins share this 40 amino acid domain, andthese are collectively termed the "integrase" family of site-specific recombinases ( Argos et al., 1986;Pargellis et al., 1988 ).Another well-known eukaryotic site-specific recombination system is that of V(D)J recombination invertebrate lymphocytes, generating the diversity of immunoglobulin and T-cell receptors ( reviewed inGellert, 1992 ). This system shares with previously mentioned systems some features of thefundamental topological rearrangements illustrated in fig. 2.1, although the mechanism here issomewhat more complex than that of the integrases. In the presence of a pair of chromosomal signal107sites in opposing orientation between protein coding regions, intervening DNA is excised. ( CircularDNAs resulting from such excisions have been isolated - Roth et al., 1992 ). When two signal sites inthe same orientation are each followed by coding regions, intervening DNA is inverted leaving the"coding joint" and the "signal joint" present in the chromosome ( Weichhold et al.; 1990, Korman etal., 1989; Malissen et al., 1986 ). There are, however, major differences between V(D)J recombinationand conservative site-specific recombination as exemplified above, viz: recombination is not strictlyconservative, in that there is often loss or gain of several base pairs of DNA at the point ofrecombination ( contributing to the diversity of antigen-binding sites generated - Tonegawa, 1983;Lieber et al., 1988 ); and the end-products of V(D)J recombinations that are involved in coding forantigen receptors ( as opposed to the excised prodicts ) are not themselves substrates for furtherrecombination ( Lewis et al., 1985 ). Many of the factors involved in V(D)J recombination are as yetunknown, although the products of several genes are known to be required. Two of these, ragl andrag2 ( for "recombinase activation gene", Oettinger et al., 1990) are known to be necessary but notsufficient for recombination to occur. Of those V(D)J recombination factors so far characterised, onlyRBP-Jx, has been shown to share some amino acid sequence simlarity with prokaryotic recombinationenzymes - similarity with the 40-amino acid carboxy-terminal catalytic domain characteristic of theintegrase family ( Matsunami et al., 1989 ). The expression of RBP-Jx and of the rag products,however, is not restricted to cells in which specific recombination activity has been shown to occur.Interestingly, highly conserved homologs of RBP-Jx have been found in Xenopus laevis, andDrosphila melanogaster ( Furukawa et al., 1991 ). Although the amino acid sequence identity betweenthe mouse and fly products is 75%, and, like mouse RBP-Jx, the fly product specifically binds mouseIgx recombination recognition sequences in vitro ( Furukawa et al., 1992, Schweisguth andPosakony, 1992 ), D. melanogaster does not have an immune system, nor, as a far as is known, doesit display any V(D)J-like DNA rearrangement.D) The CRE/LOXsystemEarly studies of the coliphage P1 had suggested that its genetic map was linear. The physical form ofits genome was known, however, to be circular. Moreover, when the phage integrated into the hostchromosome ( albeit at low frequency ), the ends of the integration were found to be the same as theends of the genetic map, and the site of integration was always the same ( Scott, 1968; Walker andWalker, 1975; Chesney and Scott, 1978; Chesney et al., 1979 ). The simplest explanation for thesephenomena is that there is a hot-spot for recombination in the phage genome, and somehomologous target in the E.coli genome. Sternberg et al. ( Sternberg et al., 1981; Sternberg andHamilton, 1981 ) looked for the hot-spot using an EcoRI fragment of the phage DNA spanning the108ends of the genetic map. They made hybrid phage by inserting this into a lambda phage withmutations in the known recombinases of lambda, and grew the products in mutant E. coll. lackingrecombinase activity. These workers were able to demonstrate both the presence of therecombination hot-spot and a recombinase-activity encoding sequence within the EcoRI fragment ofP1. They named the recombination spot "loxP" for locus of crossing over in P1, and therecombination-producing sequence "CRE" for causes recombination. Using molecules in which theEcoRI fragment was oriented differently with respect to flanking markers, they showed thatrecombination only occured between molecules when the RI fragments of the two were in the sameorientation. By deletion analysis, they were further able to localise the loxP site. Sequence of the sitewas obtained ( Sternberg and Hamilton, 1981; Hoess et al., 1982 ), as was sequence of the site ofintegration in the host chromosome, and of the resulting phage-chromosome junctions ( fig. 2.2 ) Thesignificant features of these lox sites are the 13 by inverted repeat and the asymmetrical spacer ( 8 bylong in the loxP site ) between these repeats. Although surrounding sequences differed, it was notpossible to determine whether any features of the DNA outside the 34 by core were required forrecombination.Deletional mutation of the loxP site revealed its likely role in maintaining copy number of phage indaughter cells as the host divides ( Austin et al., 1981, and see above, section C ). Further studiesallowed the minimal loxP site that allowed efficient recombination to be defined as lying within a 60 byregion encompassing the 34 by core ( Abremski et al., 1983 ). With partially purified CRE-containingbacterial extracts, it was shown that in vitro recombination between loxPsites could be achieved in thepresence of either Mg ions or spermidine, and that recombination took place whether the substratewas present as supercoiled, relaxed circular or linear DNA. In addition, intramolecular as well asintermolecular recombination between loxP sites was demonstrated, with DNA between the sitesexcised if the sites were in the same orientation, and inverted if the sites were in opposite orientation( ibid. ).The CRE coding sequence had been shown to lie within a 1.5 kb fragment of the P1 DNA, andcloning of this fragment into a high-level bacterial expression vector allowed purification of CRE toapparent homogeneity - a single band on SDS-PAGE ( Abremski and Hoess, 1984 ). Column elution,gel electrophoresis and density-gradient centrifugation suggested that the CRE product was anasymmetric monomeric protein of 35 kD. In the presence of magnesium ions ( at the sameconcentration as that required to demonstrate in vitro bioactivity, i.e. 10mM ), the sedimentationcoefficient shifted from 3.0 to 4.0 S, suggesting the possibility that CRE was dimerising under theseconditions. Although purified CRE bound to any DNA sequence, its efficiency of binding ( % boundversus amount of CRE present ) was 20-fold higher when the target DNA contained a loxP site.109LoxP^cctctcagacctaATAACTTCGTATAGCATACATTATACGAAGTTATattaagggttattLoxR^cctctcagacctaATAACTTCGTATAGCAGGAAGTTATCCGAAGcgatgagagttatcccLoxL^ccaaagtgagtgatatgriTCGGATAACATACATTATACGAAgttatattaagggttattLoxB^tatgtTTCGGATAACAGGAAGTTATCCGAAgcgat Fig. 2.2. Sequences of various Lox sites found in the bacteriophage P1 life cycle ( After Sternberg1981 ) Regions involved in inverted repeats are shown in upper-case. Regions of bacterial origin areunderlined. LoxP represents the sequence present in the P1 phage, LoxR and LoxL the two sides ofintegration recombinants between phage and bacterial DNA, and LoxB the reconstructed originalbacterial site. The bold areas in the LoxP sequence represent the inverted repeats.110Moreover, heparin interfered with binding to all DNA except that which contained loxP sequence.Pretreatment of CRE with SDS prevented binding to /oxP-containing DNA. If the sample was treatedwith SDS AFTER the CRE and DNA were mixed, the binding to DNA containing a single loxP site wasreversed, whereas binding to DNA containing two loxP sites was not, even when the amount of SDSwas more than doubled, suggesting that the complex of CRE with two loxP sites was of a differentnature from that of CRE with a single loxP site. It appeared to the authors that, as evidenced by themolar ratios of the amount of purified CRE and targets sites used and the amount of recombinantproduct obtained, the recombinase activity was stoichiometrically related to the amount of CREpresent, and that more than one molecule of CRE was required per recombination event. It wasadmitted by the authors, however, that they were unable to determine what proportion of the purifiedCRE consisted of active molecules. Calculation of physical parameters showed that two CREmolecules would together be more than large enough to bind to the whole 34 by core of the loxPregion.Hoess and Abremski subsequently undertook a study of the CRE-mediated protection of IoxPsequence from nuclease digestion ( Hoess and Abremski, 1984 ). CRE protected the core 34bpsequence from digestion by both neocarzinostatin and DNAse1. In addition one by outside thisregion was protected from neocarzinostatin, whereas 3-5 by outside the region were protected fromDNAse1 activity. The authors attributed this difference to steric hinderance which would tend to affectthe larger DNAse1 more than the smaller neocarzinostatin. 1/2 loxP sites ( consisting of one of the13bp repeats plus 4bp of the 8bp spacers, although unable to undergo recombination with a full IoxPsite, were still protected from nuclease digestion by CRE. Since CRE was unable to bind to sequencesignificantly beyond the 34 by core, it seemed very likely that the "orientation" of the loxP site wasdetermined by the asymmetrical 8bp spacer sequence.The point of strand cleavage and exchange mediated by CRE was determined in vitro by the sameworkers ( Hoess and Abremski, 1985 ). It lies one base internal to start of the 8 by spacer at either endand the cleavege results in a 6 by 5' overhang ( prior to the ligation event ). The breakage occurs onthe 3' side of a phosphate moiety and the CRE protein becomes covalently attached to thisphosphate, preserving bond energy and thereby rendering unnecessary the presence of high-energy cofactors. This bond is transient since the products of recombination are not attached to CREmolecules. Several topoisomerases, lambda INT and FLP have been shown to utilise the samemechanism ( Liu and Wang, 1979 ; Gellert, 1981 ; Craig and Nash, 1983; Gronostajski and Sadowski,1985, Andrews et al., 1985 ). The authors had previously been unable to detect topoisomeraseactivity in CRE preparations ( Abremski and Hoess, 1984 ). Using a mutant loxP site in which one baseof the 8bp spacer had been deleted and which allowed a much slower recombination reaction than111that of the wild-type site, they were now able to demonstrate topoisomerase activity of the enzyme( Abremski et al., 1986 ).Sternberg et al. ( Sternberg et al., 1986 ) sequenced the CRE gene, showing that the codingsequenced predicted a protein of 343 amino acids. Comparison of the predicted sequence to thesequence of 5 other phage recombinases revealed regions of homology shared by all theserecombinases toward the carboxy-terminal end of the proteins, with three residues completelyconserved across all six sequences ( Wierzbicki et al., 1987, Parsons et al., 1988 ). One of these is atyrosine at postion 324, the others being histidine ( 289) and arginine ( 292 ). The FLP recombinasehad been shown to share with CRE the mechanism of transient covalent linkage to a 3'phosphate ofthe DNA during the recombination process, and it had been shown that the linkage to FLP was to atyrosine ( Gronostajski and Sadowski, 1985 ). Although it was not known which tyrosine of FLP wasinvolved, the conservation of tyrosine 324 ( also found in FLP) suggested that this might be theresidue immediately involved in the covalent attachment of CRE to loxP ( Wierzbicki et al., 1987 ).The INT system of phage lambda had been shown to work through an intermediate Holliday junction( Hsu and Landy, 1984 ). Using a set of mutants of CRE, Hoess and colleagues ( Hoess et al., 1987 )were able to isolate a structure with electron-microscopic appearances suggestive of a Hollidayjunction from interaction of some of these mutants with loxP .Additionally, some of the CRE mutantsthat were themselves unable to recombine linear substrates could nevertheless complete therecombination of a pre-formed loxP -loxP Holliday junction.Brian Sauer ( Sauer, 1987) first showed that CRE could function in eukaryotic systems. There wassome precedent for this, in as much as two other prokaryotic DNA-binding proteins had been shownto function in eukaryotic cells - bacterial lexA protein ( Brent and Ptashne, 1984 ), and the restrictionenzyme EcoRl ( Barnes and Rine, 1985 ). Sauer engineered an expression vector in which theexpression of CRE was placed under the control of the tightly-regulatable yeast GAL1 promoter. Astarget sequence he chose a yeast selectable marker ( LEU2 ) which he flanked by loxP sites in directorientation, so that in the presence of CRE activity the marker would be lost. Taking advantage ofhomologous recombination in yeast, he placed the target sequence at two different chromosomallocations in the yeast genome. Having created stable transfectants of these yeast, under non-inducing conditions, that carried the CRE expression vector, he showed that after one hour ofinduction, more than 90% of cells had lost the selectable marker. He was able to show, by Southernanalysis, that the loss had been due to recombination at or near the loxP sites, and in three examplesanalysed by sequencing, that the recombination had produced a result identical to that produced by112the action of CRE on the same target sequence in E. coll. The length of the LEU2 sequence flankedby the loxP sites in these experiments was approximately 2.6 kb.Sauer and colleagues also demonstrated ( Sauer et al., 1987) that the CRE/lox system could be usedto insert DNA into a virus at a pre-integrated /oxP site.Viral DNA bearing the site was incubated withcircular plasmid DNA also bearing a single loxP site in the presence of CRE protein. The plasmidsequence could be recovered from the viral DNA by further treatment with CRE. Although thisexperiment was in vitro as opposed to being in the context of a cell nucleus, the length of plasmidsequence here shown to be susceptible to CRE-mediated excision, was 3.4 kb.In the context of the nucleus of a mammalian cell, Sauer and Henderson ( Sauer and Henderson,1988) showed that CRE was able to mediate recombination of targets present on episomallyreplicating plasmids. Mouse C127 fibroblasts were infected with a herpesvirus ( pseudo-rabies virus )into which had been inserted a 3.1 kbp /oxP-flanked plasmid fragment. Expression of the CREprotein in the transfected cells resulted in excision of the 3.1 kb fragment as determined by Southernanalysis. Retention of the expected single loxP site in the resultant episomes was demonstrated byshowing that such episomes recovered from the cells were able to undergo CRE-mediatedrecombination with another loxP -containing plasmid in vitro. Although no estimate was given of thecopy number of the target viral episomes per cell, the authors state that up to 25% of the virusrecovered from plate stocks of infected cells expressing CRE protein had undergone CRE-mediatedrecombination. Importantly, the authors observed NO recombinant products in virus grown in cell thatdid not express CRE, and had previously shown the frequency of homologous recombinationbetween /oxP sites in the virus to be less than 1 x le( Sauer et al., 1987 ).The same workers then demonstrated that CRE could function on chromosomally integrated DNA inmammalian cells ( Sauer and Henderson, 1989 ). The target DNA had the structure shown in figure2.3. In this construct, expression of the G418-resistance selectable marker encoded by the neo genewould be inhibited by the 2.6 kb yeast /eu2 gene sequence flanked by /oxP sites and situatedbetween the SV40 promoter and the neo coding sequence. This inhibition of neo expression wouldresult from the presence of the several ATG sequences in the yeast gene, which would act as falsetranslational starts with respect to the neo sequence.The construct was made by inserting the /oxP-flanked sequence into the vector pSV2neo. After transfecting mouse fibroblasts with this construct, acell line was obtained that was less sensitive to G418 than the parental untransfected cells, but stillmarkedly more sensitive to G418 than transfectants made with unmodified pSV2neo. Southernanalysis of this line showed that it contained a single integrated copy of the construct shown. Theconstruct had been subjected to CRE-mediated recombination in vitro, and fibroblasts transfected113SV40polyASV40promoter IoxP^LEU2^IoxP^Neo—11111=11111111111111M-411111■-1Fig. 2.3. Transfection construct of Sauer and Henderson  ( after Sauer and Henderson, 1989 )A U A C^C ^A^G ^UA — UU — AA — UU — AG — CC — GU — AU — AC — GA — UA — UU — AA — U^NNNN^NNNNFig. 2.4. Potential stem-loop structure in the RNA resulting from transcription through a LoxP site114with the resultant structure were shown to be resistant to high levels of G418 at about 1/2 thefrequency of transfectants made with the original pSV2neo vector. The authors suggest that this mayhave been due to the presence of the single loxP site left by the recombination between the SV40promoter and the neo sequence, as the message resulting from transcription would be able to form astem-loop structure at this point by virtue of the complementarity of the two 13 by sequences withinthe loxP sequence ( fig. 2.4 ), and such a stem-loop might interfere with translation ( Kozak, 1986 ).After introducing a CRE expression vector into the target cell line, these investigators were able toshow that up to 50% of transfectants became resistant to the same level of G418 as would result fromtransfection with pSV2neo.The information relating to the CRE/lox system to this point was sufficient to suggest that it might be asuitable candidate for creating a site-specific recombination system in transgenic animals. Similarinformation was available in relation to FLP, another well-characterised conservative site-specificrecombinase ( reviewed in Cox, 1988, and Futcher, 1988 ). Like CRE, FLP would function on DNA inany topology, in the absence of high-energy cofactors, and the absence of any host proteins. Thetarget of FLP, ( frt ) is also a 34 by sequence with an asymmetrical 8 by spacer between invertedrepeats of a 13 by sequence. The only feature of CRE activity which had not been duplicatedexperimentally at the time of initiating the work here reported was its ability to act on DNA placed intothe context of the mammalian genome. This criterion was decisive, in the absence of any other, as towhich system to choose for engineering site-specific, tissue-specific recombination in transgenicmice.3) EXPERIMENTAL STRATEGY AND DESIGN OF CONSTRUCTSDr. Jamey Marth of the Biomedical Research Centre undertook to support the current research, theaim of which was to test the function of the CRE-LOX system in transgenic mice. An experiment wasdesigned in which it would be possible to assess the deletion of DNA from the genome of transgenicsas a function of expression of the CRE enzyme in a given tissue at a given stage of development. Thiswas to be achieved by first creating two transgenic mouse lines, one expressing the CRE enzyme,and the other carrying a target sequence flanked by LOX sites, and then inter-breeding mice of thesetwo lines to make doubly transgenic mice in which the CRE might function to delete the LOX-flankedtarget.As this was to be the first instance of the expression of CRE ( or any site-specific recombinase ) in amammal, it was decided that the target sequence should be one the presence or absence of which115could be easily determined, but which would not itself affect the development or viability of cells ortissues of the animal. This latter feature was incorporated into the experimental desgn so that a)whatever the outcome of the experiment, one could at least clearly determine whether the expressionof the CRE enzyme in transgenic mice would itself result in any phenotype, and b) so that one mightbe able to assess the efficiency of CRE-mediated deletion. Moreover, it was deemed desirable thatthe target sequence should be one which could theoretically be used as a "reporter" in subsequentexperiments - i.e. by including it between the LOX sites along with the gene of interest whosepresence or absence might be less easy to determine. This latter criterion was met by the E coli IacZ( f3-galactosidase ) gene, hereinafter referred to as BGAL This gene had the advantage, as a reportergene, that its expression could be assayed in cells that would remain viable, and that cells expressingthe I3GAL product could be sorted by FAGS for subsequent manipulation. Additionally, a constructincluding this gene, and made by G. MacGregor, a recognised authority in the use of this gene as areporter ( MacGregor et al., 1992 ), was available at the Biomedical Research Centre.One caveat involving the I3GAL sequence, however, was that it was almost 1 kb larger than anysequence previously published as having been susceptible to CRE-mediated deletion. Additionally,since it is common for the ends of transgene fragments to be truncated in the integration process( Covarrubias et al., 1986 ), a construct design in which one of the two LOX sites was 5' of thepromoter would involve the risk of losing this LOX site during the integration event, resulting in a lossof recombination ability at this end of the transgene. In view of this, it was decided that the BGALsequence should itself be immediately surrounded by LOX sites in the transgene construct. Thiswould entail the presence of a LOX site between the promoter and the I3GAL coding sequenceSince, in one orientation, the LOX sequence contained an ATG, which would create a false translationstart site if interposed between promoter and coding sequence, it was clear that the LOX sites wouldhave to be oriented so as to avoid this potential cause of poor expression of BGAL. There remainedthe possibility that the mere presence of a LOX site between promoter and coding sequence wouldinhibit expression ( see above, Section 2 D ). There was good evidence, however, that a LOX site inthis position WOULD permit expression from the coding sequence, in eukaryotes ( Sauer, 1987 ), andin mammalian cells, in particular ( Sauer and Henderson, 1989 ).Of known tissue-specifc transgene expression constructs, p1017 ( Chaffin et al., 1991 ) was one withwhich Dr. Marth had already worked, having himself been responsible for the cloning of the gene fromwhich the promoter in p1017 was derived ( Marth et al., 1985 ). Transgenic mice made with derivativesof p1017 were known to display thymocyte-specific expression of transgenes.( Chaffin et al., 1991;Garvin et al., 1990; Cooke et al., 1991 ). p1017 was therefore selected as the vector for the CRE116transgene, with the hope that transgenics expressing CRE in a thymocyte-specific fashion might be ofsubsequent value in addressing immunological questions.There was debate, however, as to the vector that would be used to obtain expression of BGAL. Thepresent author proposed the use of a derivative of p1017 in which the LCKpromoter was replaced bya cytomegalovirus Immediate Early ( CMV-IE ) gene promoter. This promoter had been shown to becapable of driving expression of transgenes in a wide variety of tissues of transgenic animals,including lymphoid tissue. It was envisaged that the various tissues in which BGAL was expressed, inthe resulting transgenics, would act as "internal" positive controls in animals in which the BGALexpression in thymocytes had been abrogated in virtue of the CRE-mediated deletion of BGALsequence from the thymocyte genome. The presence of such "internal" controls would providevisually dramatic evidence of tissue-specificity ( X-Gal or fluorescent staining of thymocytes ascompared to cells of other tissues ). This scheme would also counter suggestions that a LOX sitebetween promoter and coding sequence may indeed be inhibitory, should BGAL expression NOT bedetectable in thymocytes of transgenics. Dr Marth felt that there would be time-constraints impingingon the publishability of results of these experiments, and that there would be too great a risk involvedin using a vector not previously shown in his own laboratory to function adequately as a transgenicvector. Consequently, it was decided to use the same p1017 vector for the LOX-flanked BGAL target,in the expectation that BGAL would be expressed in thymocytes only, and that tissue-specificity ofCRE-mediated recombination could be determined by Southern analysis of DNA from various tissues.Debate also arose as to the question of which technique should be used to make the BGALtransgenics: blastocyst implantation of electroporated ES cells, or the more traditional technique ofpro-nuclear injection of fertilised oocytes. The former is much more time-consuming than the latter,and has a much higher failure-rate, in terms of achieving germ-line transmission of the transgene. Anadvantage of the ES-cell method would be that it almost always involves single-copy integration of thetransgene construct, as against the multi-copy integration which is the almost inevitable result of thepro-nuclear injection method ( C.Ong and J. Marth, unpublished observations, and Covarrubias et al.,1986 ). A single-copy integration would, one might expect, make for simpler assessment of thefunction of CRE in deleting that single copy of the BGAL sequence - one would simply be assessingin what proportion of thymocytes the BGAL was deleted. As Southern analysis might prove essentialto the assessment of CRE function, this analysis would be greatly simplified if there were a single/3GAL sequence in each cell, as compared to multiple such sequences. Possible anomalies arising atthe termini of integration sites, and affecting restriction sites used in Southern analyses, would bemore readily comprehensible, and might even be identified in ES cells prior to creation of transgenicmice. Despite these advantages, it was again felt that time constraints due to likely competition117warranted the utilisation of the traditional pro-nuclear injection technique. Less DNA would be usedfor each micro-injection than customary, in the hope of selecting transgenic founder mice bearingrelatively few copies of the LOX-flankedBGAL transgene target.118RESULTS1. CREATION OF TRANSGENE CONSTRUCTS The plasmids pBS31, and pBS64 were kindly donated by Dr. Brian Sauer of E.I DuPont de Nemoursand Co., Inc., Molecular Biology, Central Research and Development Department, Wilmington, DE,U.S.A. The plasmid pCMVB was kindly donated by Dr.F. Jirik of the Biomedical Research CentreA) p1017CREp1017 was cut with BamHl, and the ends made blunt. The CRE coding sequence was obtained frompBS31 as a 1.5 kb fragment, by digestion with Xhol and Xbal. After making these ends blunt withKlenow, and ligation into p1017, orientation in recombinants was determined by digestion of mini-prep DNA with BamHI and Xbal , as there is a unique, assymetrically placed BamHl site within the CREsequence and there is a unique Xbal site in p1017 at a convenient position ( fig.2.5 ). The originalBamHl cloning site in p1017 lies within the first exon ( in 5' untranslated sequence ) of the hGHsequence. A eukaryotic ribosome-binding site sequence is therefore present 5' of this point.B) p1017L0X2BGALi) pLOX2Since the vector pBS64 contains a single LOX site, it was first necessary to create a derivative thatcontained two LOX sites in the same orientation separated by a unique cloning site. In the desiredderivative, the two LOX sites would be surrounded by sites that, after insertion of DNA between theLOX sites, would allow the removal of a fragment containing both LOX sites as well as the interveningDNA. To this end pBS64 was cut with BamHI, the ends made blunt with Klenow, and then self-ligatedto create pBS64A ( fig.2.6 ). pBS64A was then cut with Hindlll, the ends made blunt with Klenow, andthen cut again with Xmnl ( which cuts within the coding sequence of the ampicillin resistance gene -Amp ). The larger resulting fragment of pBS64A, containing one LOX site and a portion of the Ampcoding sequence, was purified by gel electrophoresis. The Xmnl-Aval fragment of the original pBS64,containing the complementary part of the Amp coding sequence and one LOX site, was purified bygel electrophoresis. The plasmid pLOX2 was constructed by ligating the two purified fragments,Bg111( BamHI (3529)Not1(9263/0)Xbal (1206)AmpRStu! (1906)lckprBglIl (2332)BglIl (2409)Sacl (2472)p1017CRENotl (6811)EcoRl(6794)Mscl (6549)hGH CRE Xhol/(BamHI) (3110)119(Xbal)/BamHI (4642)Mscl (4843)Sacl (5 15)Fig. 2.5. p1017CRE The 1.5 kb Xhol-Xbal fragment of pBS31 was blunt-ligated into the BamHI site ofp1017. Xhol and BamHI sites were recreated as shown. Sites used for subsequent Southernanalyses are also shown, as well as the Notl sites used to separate the transgene from the plasmidbackbone.120which, in the appropriate orientation, would recreate the Amp gene, allowing efficient selection of thedesired transformants on ampicillin plates ( fig. 2.6 ). Since having the correct sequence of LOX sitesin the correct orientation with respect to each other would be essential to the interpretation ofexperiments performed with derviatives of pLOX 2, it was deemed appropriate to determine thesequence of the relevant portion of the vector. Figure 2.7 shows the sequence obtained using acommercially available primer to the SP6 promoter. Although the sequence was obtained from only asingle strand, it was felt that since the sequence corresponded exactly with that expected, it wasunnecessary to sequence the same region of the opposite strand.ii) pLOX2BGALThe E.coli BGAL coding sequence was obtained as a 3.51d) fragment from pCMVB ( MacGregor andCaskey, 1989 ) after digestion with Notl and gel purification. After blunting the Notl ends of the.BGALfragment, this was ligated into the blunted BamHl site of pLOX2, to obtain the plasmid pLOX2BGAL( fig. 2.8 ). Orientation of the BGAL sequence was determined by Pvull digestion and Sac! digestion ofrecombinant plasmid DNAs.iii) p1017L0X2BGALThe LOX-BGAL-LOX fragment of pLOX 2BGAL was obtained by gel purification after digestion withEcoRl and Hindlll, and after blunting the ends, this fragment was ligated into the blunted BamHl site ofp1017 to form the plasmid p1017L0X2BGAL ( fig. 2.9 ). Correct orientation of the LOX-BGAL-LOXsequence with respect to the LCK promoter of p1017 was determined by digestion of recombinantDNAs with Ndel. At the time of construction of this vector, a survey of the literature suggested that thelongest sequence removed from between LOX sites by the CRE enzyme ( or, indeed, by any site-specific recombinase from between its target sites ) had been less than 3 kb in length ( Sauer andHenderson, 1989 )Hind111Aval.4Pstl AvalaclEcoRlHindIISphlPstlHind!!!SphlXmnlScalAvalSaclEcoRlvullXmnlXmnlXmnlSca pLOXLOXvullBamHIPstl^AvalHind111Sphl121Fig. 2.6. Creation of pLOX-2 A portion of pBS64 was ligated to the complementary portionof aderivative of pBS64 in which the BamHI site had been destroyed by filling in with Klenow. Ligationproducts in which the fragments were joined in the desired orientation recreated the ampicillin-resistance sequence, allowing efficient selection on Amp plates. The LOXP sequences are indicatedas arrowheads.Hind111(6804) Pstl(6)Sph1(636ZSspl (5866)Xmnl (5659)Scal (554Smal(91)Pvull(331)Sad (2177)Pvull (3937EcoRl(3727)Sac1(3721) Smal(3712)^Pvull(3255)psi-1(3638) (Notl/BamH1)(3628)PvulI(2888)122CTGCAGGTCGAGGGACCTAATAACTTCGTATAGCATACATTATACGAPstlAGTTATATTAAGGGTTCCGGATCCGGAGCTTGGGCTGCAGGTCGAGGGABamHl^AHindlIVAAval^PstlCCTAATAACTTCGTATAGGCATACATTATACGAAGTTATATTAAGGGTTCCGGATCGATCCCCGGGCGAGCTC GAATTCGTAATCATGTCABamHI^Sinai^Sad^EcoRlFig. 2.7. Determined sequence of a portion of the vector pLOX2 The two LOXP sequences areshown in bold, and the sites destroyed by blunting are indicated with a W before the site name. Theremaining unique BamHl cloning site is titled in bold.Fig. 2.8. pLOXZBGAL The 3.5 kb Notl fragment of pCMVB containing the I3GAL coding sequencewas blunt-ligated into the unique BamHI site of pLOX 2. Pvull and Sad sites used to determineorientation are shown. The LOXP sequences are indicated as arrowheads. The 'negative" direction ofthese arrowheads with respect to the orientation of the BGAL coding sequence is used to highlightthe importance of this orientation of the sequences to avoid an ATG between the destined position ofthe promoter and the I3GAL coding start site.Stul (1906)Pstl (2255)Bg111(2332)111(2409)acl (2472)Notl (9017)EcoRI(900Mscl (8755Not1(11668/0)Xbal (1206)ind111/(BamHI) (311BglIl (8206)Stul (8075)Hpal  (3778)Sacl (7421Mscl (7049)(EcoRI/BamHl) (6848)Sad (6:37)Hpal (4402)Sad (5290)Fig. 2.9. p1017L0X2BGAL The 3.7 kb HindIII-EcoRI fragment from pLOX 2BGAL was blunt ligated intothe unique BamHI site of p1017. The Ndel sites used to determine orientation are shown. Sites usedfor subsequent Southern analyses are also shown. The Hindil site at the 5' end of the ligation wasrecreated, probably due to a two base "chew-back" of the BamHl cut end, attributable tocontaminating activity in the phosphatase or Klenow preparations. LOX sites are indicated by theunattached arrowheads. The -600 base pair fragment between the Hpal sites indicated was used asthe probe for (3GAL.1242. CREATION OF OTHER PLASMIDSA) pUC19CREIn order to facilitate subsequent isolation and manipulation of the CRE coding sequence, a Xhol -Mlulfragment containing the CRE sequence was purified from pBS31, the ends made blunt, and ligatedinto the blunted BamHI site of pUC19, forming pUC19CRE ( fig 2.10, A ). The orientation of the CREsequence within pUC19 was determined by Sspl digestion. Since the Mlul/BamHI blunt junctionrecreated the BamHI site, and there is a BamHI site within the CRE sequence, BamHI releases afragment of CRE sequence of approximately 690 by in length from pUC19CRE, and this fragment wasgel-purified and used as a CRE probe in dot-blot, Southern and Northern analyses.B) pUC19LCKXIn order to facilitate subsequent isolation of the LCK promoter fragment for use as probe in Southernanalyses, a 640 by Sacl-Xhol fragment of p1017CRE, containing the most 3' portion of the LCKpromoter sequence was gel-purified and ligated into pUC19 that had been cut with Sad and Sall. Theresultant plasmid, pUC19LCKX, is depicted in figure 2.10, part B. The approximately 640 bpSacl-HindlIl fragment of pUC19LCKX was gel-purified and used as probe in subsequent analyses.3. CREATION OF TRANSGENIC MICE AND DETERMINATION OF THEPRESENCE OF TRANSGENES A) Purification and injection of transgene fragments.All transgene fragments were separated from vector DNA by Notl digestion and gel purification prior topronuclear injection, since it had been reported that presence of such DNA could inhibit expressionof transgene sequences ( Jaenisch, 1988 ). These Notl fragments of the plasmids are hereinafterreferred to as the "transgene constructs". [ Pronuclear injection of these fragments into fertilisedembryos of ICR outbred mice was performed by Daniel Chui. 2 to 4 pg was injected in a volume ofapproximately 1 to 2 pl ].Sspl (3373)Xmnl (3166)Seal (3049)Sspl (1201)amH1/(Mlul) (1290)Xbal (1295)Sall (1301)Pstl (1307)Sphl (1313)Hind111(1319)Xmnl (451)BamHI (602)EcoRI (396)Sad (402)Kpnl (408)Smal (412)Xmnl (2905)Scat (2788) Smal (561)Kpnl (756)(Xhol/Sall) (1041)Pstl (1046)Sphl (1052)Hindi!! (1058)Sad (165) Kpnl (171) Smal (175)EcoRl (159)^ (Xhol/BamHI) (184)Fig. 2.10. Sub-cloned fragments used for probes A) pUC19CRE. A 1.1 kb Xhol-Mlul fragment ofpBS31, containing the CRE coding sequence was blunt-ligated into the BamHI site of pUC19. TheSspl sites used to determine orientation are shown. The BamHI site was recreated at the BamHVMIuIjunction as expected, but the Xhol site was not, possibly due to some "chew-back' by contaminatingactivity in the Klenow preparation. B) pUC19LCKX. A 640 by Sacl-Xhol fragment of p1017CRE,containing the most 3' portion of the LCK promoter sequence, was ligated into pUC19 that had beencut with Sac! and Sall. The Xhol-Sall junction destroys both sites.AB126B) Determination of the presence of transgenesThe DNA fragment used as a probe for the presence of the CRE transgene was described above. Asequence comparison between the E. coli and Mus musculus Beta-galactosidase coding sequenceswas performed in order to determine which portion of the BGAL sequence would serve as a suitableprobe . In the absence of any obvious region of high sequence similarity, a Hpal fragment ofapproximately 630 base pairs ( see fig. 2.9) was chosen for use as a probe. In addition, the EcoRI-Hindi! fragment of pLOX2 was gel-purified for use as a probe for the presence of LOX sequences. Apreliminary assay of the suitability of these fragments as probes was performed by hybridisation tovarious plasmid DNAs in dot-blots ( fig 2.11 ). In each case the probe hybridised to all and only thosetarget DNAs that contained the relevant DNA sequences.In some early analyses, a portion of the hGH sequence ( an approximately 620 by Smal-EcoRlfragment purified from p1017) was used as a probe. [ Dot-blots of tail-tissue DNA were routinelyperformed with an hGH probe by Daniel Chui, to distinguish transgenic mice created with derivativesof p1017 from their wild-type littermates ]. The appearance of unexpected bands in several Southernanalyses probed with this fragment led to the eventual abandonment of this fragment as a probe.These additional bands may well have been due to cross-hybridisation of the fragment with mousegrowth hormone sequences, since the human and mouse growth hormone sequences displaysignificant homology ( fig. 2.12 ).The presence of transgene DNA was determined by probing dot-blots of tail-tissue DNA with the CREand BGAL probes. [ The initial analysis of tail-tissue DNA from potentially transgenic mice wasperformed by Daniel Chui. Once mice bearing each transgene were isolated and subsequentbreeding commenced, collection and analysis of tail DNA was shared by Daniel Chui and myself ]. Twofounder CRE-transgenic mouse were isolated from 4 litters totalling 19 mice screened. Allexperiments here reported were performed with progeny of one of these Cre founders. Two LOX-BGAL-LOX founder mice were isolated from 3 litters totalling 21 mice screened. These founder micewere derived from implants numbered "86" and "87" in the Marth laboratory, and the LOX-BGAL-LOXprogeny of breeding these mice are referred to as being of the "86° or "87" lines respectively.C). Absence of abnormal phenotypes in transgenic miceNeither mice bearing the CRE nor those bearing the LOX-BGAL-LOX transgenes displayed anygrossly discernible phenotype.Since the p1017L0X-BGAL-LOX transgene was expected to causeFig. 2.11. Controls for dot-blots Each panel shows an autoradiograph of hybridisation of the variousprobes used to dot blots of approximately 1 ng of the following plasmids: pUC19, p1017,p1017CMVSS ( A p1017 derivative in which the LCK promoter had been replaced by the hCMVpromoter ), p1017L0X213GAL, and p1017CRE. A) Probe is LCK fragment. B) Probe is CRE fragment.C) Probe is BGAL fragment. D) Probe is LOX fragment. E) Probe is pUC19. In every case the probesdetected all and only the expected plasmids.128Galign for hsgrowl and musghGap penalty=2, Gap extension penalty=1, Mismatch penalty = 1Displaying tails in shortest sequence only.Scoring terminal gaps in shortest sequence only.10^20^30^40^50CGAACCACTCAGGGTCCTGTGGACAGCTCACCTAGCTGCAATGGCTACAGGCTCCCG1^111^11111^1111111111111^1111^1111111111111^III^IIAGCATCCTAGAGTCCAGATTCCAAACTGCTCAGAGTCCTGTGGACAGATCACTGCTTGGCAATGGCTACAGACTCTCG10^20^30^40^50^60^7060^70^80^90^100^110^120^130GACGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAACCATTCCCTTIII^III^1111111^1^I^111111111111111^11111^III^1111^11111^II^II^1111^11111GACCTCCTGGCTCCTGACCGTCAGCCTGCTCTGCCTGCTCTGGCCTCAGGAGGCTAGTGCTTTTCCCGCCATGCCCTT80^90^100^110^120^130^140^150^140^150^160^170^180^190^200^210ATCCAGGCCTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGCACCAGCTGGCCTTTGACACCTACCAGGAGTTTGA^11111^I^III^II^III^1111111^11111^I^11111111111111^1111111111^1^11111^IIGTCCAGTCTGTTTTCTAATGCTGTGCTCCGAGCCCAGCACCTGCACCAGCTGGCTGCTGACACCTACAAAGAGTTCGA160^170^180^190^200^210^220^230220^230^240^250^260^270^280^290AGAAGCCTATATCCCAAAGGAACAGAAGTATTCATTCCTGCAGAACCCCCAGACCTCCCTCTGTTTCTCAGAGTCTAT11111^11^11^III^1111^11111^1^1^11111^11111^1^I^1111^111111111^1^11GCGTGCCTACATTCCCGAGGGACAGCGCTATTC CATTCAGAATGCCCAGGCTGCTTTCTGCTTCTCAGAGACCAT240^250^260 270^280^290^300^31300 310 320 330 340 350 360 37TCCGACACCCTCCAACAGGGAGGAAACACAACAGAAATCCAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATCCA111 1 III 1 11 111111 1 11 1111 1 11 11 1 11 1111 111 1111 11111111111111CCCGGCCCCCACAGGCAAGGAGGAGGCCCAGCAGAGAACCGACATGGAATTGCTTCGCTTCTCGCTGCTGCTCATCCA0 320 330 340 350 360 370 3800 380 390 400 410 420 430 440GTCGTGGCTGGAGCCCGTGCAGTTCCTCAGGAGTGTCTTCGCCAACAGCCTGGTGTACGGCGCCTCTGACAGCAACGT111 1111111 111111111111111111 11 1 111 11111111111 111 1111 1111 11 1 IIGTCATGGCTGGGGCCCGTGCAGTTCCTCAGCAGGATTTTCACCAACAGCCTGATGTTCGGCACCTCGGA CCGTGT390 400 410 420 430 440 450 460450^460^470^480^490^500^510^520CTATGACCTCCTAAAGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGAGGCTGGAAGATGGCAGCCCCCGGACTGG111111^11^11111111^II^II^11111111^1^111111^I^111111111111111111111^IIICTATGAGAAACTGAAGGACCTGGAAGAGGGCATCCAGGCTCTGATGCAGGAGCTGGAAGATGGCAGCCCCCGTGTTGG470^480^490^500^510^520^530^540530^540^550^560^570^580^590^600GCAGATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAACGATGACGCACTACTCAAGAACTACGGGCT1111111 1111111 11111 111111 III 1 111 1 11 111 11111 11 11111 11111 11111GCAGATCCTCAAGCAAACCTATGACAAGTTTGACGCCAACATGCGCAGCGACGACGCGCTGCTCAAAAACTATGGGCT550^560^570^580^590^600^610^6610 620 630 640 650 660 670 6GCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATTCCTGCGCATCGTGCAGTG CCGCTCTGTGGAGGG11111 11111111 1111111 11 1111 1 11111 1 111111 11 11 1111 11111 111111 IGCTCTCCTGCTTCAAGAAGGACCTGCACAAAGCGGAGACCTACCTGCGGGTCATGAAGTGTCGCCGCTTTGTGGAAAG20^. 630 640 650 660 670 680 69080 690 700 710 720 730 740 750CAGCTGTGGCTTCTAGCTGCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCAC11111111^11111111^1^1^I^it^III^I^III^II^1111111^I^111111^I^111111CAGCTGTGCCTTCTAGCCACTC ACCAGTGTCTCTG CTGCACTCTCCTGTGCCTCCCTGCCCCCTGGCAACTGCCAC700^710^720^730^740^750^760^770760TCCAG11^1CCCTGFig. 2.12. An alignment of the mouse and human growth hormone cDNA sequences129expression of BGAL in thymocytes of mice bearing this transgene, thymocytes from several mice ofboth the 86 and 87 LOX-BGAL-LOX-transgenic lines were collected and assayed for BGAL activity.Several assays of increasing sensitivity were carried out on these thymocytes, viz. staining using X-Galas substrate, and direct micoroscopic and FACS-assisted fluorescence assays using fluorescein-di-f3-D galactoside as substrate. In no instance, however, was a difference observed between wild-typethymocytes and those from LOX-BGAL-LOX-transgenic mice. This apparent failure to express BGALmay have been attributable to the relatively low copy number of the transgene structure ( see section4B ), since lack of expression is often observed with p1017-derived transgenes present in low copynumber ( Jamey Marth, Biomedical Research Centre, personal communication; see also Appendix 1 ).Subsequent assays of the function of CRE in the CRE-trangene-bearing animals were thereforebased upon Southern analysis:4. CREATION AND ANALYSIS OF CRE/LOX-BGAL-LOX DOUBLY TRANSGENICMICE A) Creation of doubly transgenic miceMice bearing the CRE transgene were mated with those bearing the LOX-BGAL-LOX transgene. Theprogeny of such breedings were initially analysed by probing dot blots of tail DNA. As no expressionof the CRE gene was expected in tail tissue, and no consequent removal of the BGAL portion of thelocus was likely, it was felt safe to assay for the presence of the LOX-BGAL-LOX transgene by probingdot-blots with the BGAL fragment.There was no indication from the dot-blots that the BGAL portion ofthe transgene construct was present in the tail-tissue DNA of significantly less than the expectednumber of progeny of LOX-BGAL-LOX-transgenic parents ( i.e. 50% of the progeny of a mating inwhich one parent was heterozygous for the LOX-BGAL-LOX locus" ). An example of these dot-blotanalyses is given in fig.2.13, and a portion of the genealogy of the CRE/LOX-BGAL-LOX families isgiven in fig 2.14. Both the CRE and LOX-BGAL-LOX transgene integrations were transmitted insimple Mendelian fashion, as autosomal loci". Most of the mice analysed in this work wereheterozygous with respect to both the CRE and the LOX-BGAL-LOX transgene integrations.B) Initial analysis of integration structuresA Southern analysis of DNA digested with either EcoRI or Xbal was performed to determine, at arudimentary level, the structure of each transgene integration ( fig. 2.15 ). EcoRI and Xbal each cut28 JAN 916 JAN 9186114- L/-OA X30E2Cl- 4- I12H 121G-U- U-12 12A 1280 120Cl- 4-^-I^V-U- U- 4-^4_CC.I24-211.1 1.1A^1.18 1.1C 1.11^1.1J^1.1P 1. 10 1.1RCl- 4-^Cl-^C/-^C/-^-/- C/-^4-4_ U- U- U- 4-^U-^U- 1-/W11112J 2L 20 2R4^4-^4^V-4-^U- U-87-1A4- LI-21 21A 211 21J 21K 210 2.1R4^or Cl- Cl- GC Cl-4^4- U- U- U- UL U-Os87-1.1 5 Nov 91 X/ NOV 91 87-121.1 111 L1J 1 1K 1 ILCl- Cl- Cl-U- 4- 4- 4- 4-12.1 2^3^4^5^6^7Cl- C/- G- Cl-1 10 1.1RG- G-Ll- L/-3 NOV 91130A^ BFig. 2.13. Examples of dot-blots used to genotype transgenic progeny Approximately 514 of tail-tissue DNA is dotted in each spot, except in spots labelled "CRE" or "BGAL" which consist ofapproximately 1 ng of the plasmids p1017CRE and p1017L0X 213GAL, respectively. The blot is of tailDNAs of a litter that resulted from the mating of a CRE/LOX-I3GAL-LOX transgenic mouse to a LOX-I3GAL-LOX transgenic mouse. Some progeny will therefore be expected to bear two "alleles" of theLOX-BGAL-LOX integration. A) Probe is CRE fragment. B) Probe is I3GAL fragment.Fig. 2.14. A portion of the genealogical tree of the mice used in these experiments The symbols "C"and "L" refer respectively to integration array °alleles' of the CRE and LOX-BGAL-LOX transgenes.Birth dates of litters are indicated.131only once within each copy of the transgenic constructs ( see figs. 2.5 and 2.9 ). The appearance ofprominent bands of the size of the transgene constructs in the Southern analysis of tail DNA from aCRE-transgenic animal ( about 7 kb ) and a LOX-I3GAL-LOX-transgenic animal ( of the 86 line, about 9kb ) strongly suggests that both the CRE and LOX-I3GAL-LOX loci consist of a series of ( at least two )copies of the respective transgene construct and that the great majority of these copies are orientedin a tandem head-to-tail array with respect to each other, as depicted in figure 2.16. This sort of array iscommonly observed in transgene integration structures ( reviewed in Brinster and Palmiter, 1986,Jaenisch, 1988, and Hanahan, 1989 ).In order to provide some assessment of the number of copies of each transgene construct withineach of the integration arrays, Southern analysis was performed with a combination of restrictionenzyme and probe that would allow densitometric comparison of intensity of transgene bands withbands resulting from hybridisation to the endogenous mouse lck gene ( e.g. fig. 2.17 ). From suchanalyses it was estimated that the 1017L0X-BGAL-LOX construct was present in about 8 copies ineach of the 86 and 87 lines, and that about 110 copies of the 1017CRE construct were present in theCRE transgenic line. ( This latter figure is a much rougher approximation than the former , and is likelyto be an underestimate, due to the loss of linearity of the increase in intensity of band with increasingcopy-number at such high levels ). For reasons unkown, both Cre founders obtained were of veryhigh copy number.C) Demonstration of hybridisation of the CRE and BGAL probes to fragments of appropriate size inDNA of transgenic animals.The approximate structure of the majority of the integrated DNA in the transgenic mouse genomeshaving been established, the ability of probes other than the LCK probe to hybridise to bands of theappropriate size was confirmed. In this instance, both tail and thymocyte DNAs were analysed, andthese Southerns provided preliminary evidence suggesting that the LOX-I3GAL-LOX sequence wasaltered in the thymocytes of doubly transgenic animals in a manner consistent with the predictedaction of the CRE enzyme ( figs 2.18 and 2.19 ). It appeared that the amount of I3GAL-hybridising DNAwas significantly diminished in thymocytes of doubly transgenic mice as compared to tail tissue of thesame animals. The hybridisation of these probes to DNA fragments of the expected size suggestedthat the performance of the restriction enzymes in particular, and of the Southern analyses in generalwas adequate for analysis of the function of CRE in these transgenic mice.ito^cio .0Xitow x1 2 3 4 5 6 7 8 9Fig. 2.15. Southern analysis of tail DNA from a CRE and a LOX-BGAL-LOX transgenic mouse  Digestsare as shown above each lane. Lanes 1,5, and 9 - 1kb ladder. CRE mouse - lanes 2,3,4; LOX-6GAL-LOX mouse - lanes 6,7,8. Probe is a 600 by Smal-EcoRl fragment of the polyA signal region of thehGH gene from p1017. Despite the extensive artifact, informative bands are present. The very faintbands visible in lanes 2 and 4 between 3 and 4 kb are likely to be due to cross-hybridisation of theprobe to mouse growth hormone sequences ( see fig. 2.12 ). EcoRl and Xbal single digests showprominent bands of about 7kb and 9kb in the CRE transgenic and LOX-BGAL-LOX transgenic DNAsrespectively. The persistence of bands of these sizes in the double digests ( lanes 4 and 8) despitemore intense bands at lower molecular weights, suggests partial digestion. The appearance of the highmolecular weight smear in lanes 3 and 7, as well as the signal present at the lane origin in lane 3 isconsistent with the partial digestion being due to Xbal. The molecular size markers used in all Southernanalyses ( the "1kb ladder' ) consist , from top to bottom, of bands of these approximate sizes: 12, 11,10, 9, 8, 7, 6, 5, 4, 3, 2, 1.6, 1.0, 0.5 kilobases ( kb ), and several bands below 0.5 kb, not shown inmost of these analyses. The lowest moelcular size marker here visible is the1.6 kb band.Sacl (7051)Sad (2689)Sad (5504)LCK pr^LOXBGALLOX hGHXbal (1423)\ Stul (2123)LCK pr CRE^hGHEcoRI(13Sacl (12029)Sad (5217)Xbal (8020)EcoRI(6796)^Stul (8720)Sacl (9286)Mscl (4845)BglIl (2411)^BgIII (6002)Mscl (6551)Mscl (11657)BglIl (9223)^BglIl (12814)Mscl (133Xbal (1208)Stul (1908)Sacl (2474)BXbal (10432)tul (11132) Sacl (16060)^EcoRI (18223Sacl (16644)Sacl (14513)\ Mscl (8969)Mscl (7263)BglIl (2626)^BglIl (8420)Mscl (16272)^MscI (17978)BglIl (17429)BglIl ( 1635)EcoRI(9214)Sacl (7635) Sacl (11698)133AFig. 2.16. Illustration of head-to-tail integration arrays of the two transgene constructs  Sites used forSouthern analyses are shown, as well as their distances in base-pairs from the 5' end of the array asillutrated. A) p1017CRE array. B) p1017LOXBGALLOX array.Fig. 2.17. Two of the Southern analyses used for approximate densitometric quantitation of transgene copy number Probe is LCK fragment. A) Sacl digest of mouse tail DNAs. Lanes 1 and 6 - 1kb ladder,lane 2 - wild-type, lane 3 - doubly transgenic, lane 4 - CRE transgenic, lane 5 - LOX-BGAL-LOXtransgenic. The band resulting from hybridisation to the endogenous Ick gene is at approximately5kb. B) Stul/Mscl double digests. Lane 1 - 1kb ladder, lane 2 - wild-type thymocyte DNA, lane 3 -CRE transgenic thymocyte DNA, lane 4 - LOX-BGAL-LOX transgenic thymocyte DNA. The bandresulting from hybridisation to the endogenous bk gene is at approximately 1.4 kb. LOX-BGAL-LOXmice analysed here were from the 86 line. [ Daniel Chui performed similar Southems to determinecopy number in the 87 LOX-BGAL-LOX line.] Additional bands not identified here are discussed inAppendix 2.135A Stu 1 - Msc 1 2_94 kbI^2^ Sac I^2.74 kbB StuSIck-4-S MS S hGH-GALACIOSIDASE1^3^ Stu I - Msc I 5.14 kbSac I^2.82 kbCStulck^SMStu I - Msc I 1.60 kbSac I^0.73 kb1 4Fig. 2.18. Illustration showing expected band sizes from Southern analyses of transgene constructsand the expected recombination result [ Figure prepared in collaboration with Dr. Jamey Marth.Probes used in Southern analyses are represent by numbered lines. 1 - LCK fragment, 2 - CREfragment, 3 - BGAL fragment, 4 - the LOX sequence. A) p1017CRE construct. B) p1017L0X-BGAL-LOX construct. C) Expected recombination result. S - Sad, M - Mscl.136D) Demonstration of the function of CRE in the thymocytes of doubly transgenic miceA Southern blot [ performed by Daniel Chui ] probed with the LOX fragment, showed that, inthymocytes of a doubly transgenic mouse, the band representing the intact 1017L0X-BGAL-LOXarray was greatly diminished in intensity when compared with the band from tail tissue of the sameanimal. Moreover, in these doubly transgenic mouse thymocytes a recombinant band of a sizeconsistent with the action of CRE on the LOX-BGAL-LOX target sequences was present ( fig. 2.20,part A ). Such bands, the result of CRE-mediated recombination, will hereafter be referred to as"recombinant" bands. A faint hybridisation signal was present, however, in Southern blots probedwith the LOX fragment in all lanes containing DNA derived from mice bearing the CRE transgene. Asthe LOX fragment was obtained in such a manner as to include a small region of the polylinker of thepLOX2 plasmid, and the copy number of the CRE transgene was so high, it was postulated that thisfaint band may have been the result of some copies of the CRE transgene integration array containingresidual pUC backbone. This may have arisen due to incomplete digestion of the p1017CRE plasmidwith the enzyme, Notl, used to separate transgene construct from pUC vector sequence ( p1017 is apUC derivative ), and some remaining pUC sequences may have been sufficiently similar to the pLOX 2polylinker to result in a hybridisation signal.Use of the LCK fragment as probe would, depending on the restriction digest, allow one to see alltransgene fragments involved in the experiment ( i.e. both transgene arrays and results ofrecombination ) and the endogenous Ick gene. The ability to see the latter would allow comparison ofevenness of loading and transfer between samples in preparation of Southern blots. This fragmentwas therefore used for most subsequent anlyses. A Southern analysis of the DNAs shown in figure2.20, part A, digested with Sacl and probed with the LCK fragment, again showed a recombinant bandof a size ( approximately 0.7 kb ) consistent with the expected action of CRE in thymocyte DNA ofdoubly transgenic mice ( fig 2.20, part B ). Similarly, recombinant bands of approximately the expectedsize were found on Southern analysis of thymocyte, but not tail, DNA of another doubly transgenicmouse ( fig 2.21 ). In this case, Sac! and Bglll digests were performed , the Bglll digest providing thepossibility of assessing the loss of hybridisation to the BGAL-transgene fragment ( at approximately 6kb ), in addition to the appearance of a recombinant band ( at between 2 and 3 kb ). To remove anyremaining doubts that this recombinant band might be due to an artefact, an analysis was performedon DNAs digested with Stul and Mscl together, and probed with the same LCK fragment, acombination which would allow visualisation of the CRE and LOX-I3GAL-LOX transgene fragments, arecombination result, and an endogenous lck gene fragment in the same lane ( fig 2.22 ). This analysisagain showed diminution in intensity of the signal due to the LOX-I3GAL-LOX transgene ( at , and the137Fig. 2.19. Southern analysis of thymocyte DNA samples  A) Digest is Stul/Mscl, probe is CREfragment. Lane 1 - 1 kb ladder, lane 2- wild-type, lane 3 - CRE transgenic, lane 4 - LOX-I3GAL-LOXtransgenic, lane 5 doubly transgenic. B) Digest is Sac!, probe is I3GAL fragment. Samples identical tothose in A. No hybridisation is visible in the sample from the doubly transgenic animal.The smallestsize markers visible here are the 0.5 kb bands.Fig. 220. Southern analyses showing the results of recombination in doubly transgenic CRE/L0X-BGAL-LOX thymocyte DNA  A) Digest is Stul/Mscl, probe is LOX fragment. Lane 1 - 1 kb ladder, lane2 - CRE transgenic, lane 3 - LOX-BGAL-LOX transgenic, lane 4 - double transgenic, lane 5 - tail DNAfrom the same mouse as lane 4. The band indicated by the arrow in the thymocyte DNA of the doublytransgenic mouse ( but absent from the tail DNA of the same animal ) is consistent with CRE-mediated recombination between LOX sites in the LOX-BGAL-LOX transgene array. B) Digest isSac!, probe is LCK fragment. Lanes 1 and 6 - 1kb ladder, lane 2 - wild-type mouse, lane 3LOXI3GALLOX transgenic, lane 4 - CRE transgenic, lane 5 - double transgenic. A band consistentwith CRE-mediated recombination is again ( faintly ) visible in the doubly transgenic thymocyte laneat. approximately 0.7 kb. The endogenous k* band is apparent at about 5 kb. The smallest sizemarkers visible are the 0.5 kb bands.Fig. 2.21. Southern analysis of tail and thymocyte DNAs from another doubly transgenic mouse( 86-1.2R ). Lanes 2 ( tail ) and 3 ( thymus ) show BglIl digests. Lanes 4 and 5 show Sacl digests of thesame DNA samples. Probe is LCK fragment. The band resulting from hybridisation to the endogenouslc* gene is at approximately 1 kb in BglIl digests. Both digests show recombinant bands of a sizeconsistent with CRE-mediated recombination in thymocyte DNA, at between 2 and 3 kb in the Bgllldigest and at about 0.7 kb in the Sacl digest. The smallest size marker visible here is the 0.5 kb band.Fig. 2.22. Southern analysis of DNA showing the recombination result with the Stul/Mscl digestProbe is LCK fragment. Lanes 1 and 7 - 1kb ladder, lane 2 - wild-type thymocyte, lane 3 - CREtransgenic thymocyte, lane 4 - LOX-BGAL-LOX transgenic thymocyte, lane 5 doubly transgenicthymocyte. Lane 6 shows the tail DNA of the same mouse as lane 5. The recombinant band atapproximately 1.6 kb in lane 5 is consistent with CRE-mediated recombination in this thymocyte DNA.The entire 1kb ladder is visible here, the most intense band towards the bottom of the figure being the0.5 kb band.141concomitant appearance of a recombinant band of the the size predicted to follow from excision of theBGAL sequences from between the LOX sites in the transgene array ( at approximately 1.6 kb ).E) Investigation of the recombination by PCROligonucleotide primers were designed [ by Dr. Jamey Marth ] to allow amplification of sequencebetween the most 3' end of the LCK promoter, and the second exon of the hGH sequence present inthe p1017-derived transgene constructs. Using these primers, Daniel Chui was able to amplify afragment of between 500 and 600 by in length from thymocyte, but not tail, DNA of doubly transgenicmice. This sequence was not present in thymocyte DNA from wild-type or singly transgenic mice. Theamplified sequence was shown to hybridise to the to the LOX fragment probe ( fig. 2.23 ). It would beexpected that such amplified sequence would be larger than sequence amplified from the emptyp1017 plasmid using the same primers. This was shown to be the case, and it was estimated that thedifference in size was consistent with the presence of a single LOX site ( fig. 2.24, part A ).Additionally, it was shown that digestion of this fragment with two restriction enzymes resulted infragments of the approximate size expected following CRE-mediated recombination. ( fig 2.24, partsB and C )F) Demonstration of tissue-specificity.To this point, evidence correlating CRE expression with the appearance of the recombination patternin Southern analyses, had been provided largely on an animal-to-animal basis ( i.e. recombination wasonly seen in animals bearing the CRE transgenes ), although it will be noted that in no case was apattern suggestive of recombination observed in tail-tissue DNA. To support the assertion that thisrecombination was a result of the action of the CRE enzyme, further correlation between CREexpression and the appearance of recombination of genomic DNA was sought. The question now putwas whether the correlation held from tissue to tissue within individual doubly transgenic animals.In order to determine in which tissues the CRE gene was expressed, Daniel Chui performed bothNorthern analysis and Western blotting analysis on tissues of several CRE-transgenic and doublytransgenic mice ( fig. 2.25 ). This survey included extracts prepared from tail, kidney, liver, spleen andbrain, as well as thymocytes. Whether assayed at the RNA or protein levels, CRE product could bedetected in thymocyte extracts, but not in extracts of any of the other tissues surveyed. This was inkeeping with the properties previously attributed to the LCK promoter used in the p1017 construct,142Fig. 2.23. Southern analysis of PCR amplified fragments from CRE transgenic and doubly transgenicmice [ Courtesy of Daniel Chui A) Ethidium-stained gel of PCR from genomic DNAs. Lane 1 -doubly transgenic thymocyte, lane 2 - doubly transgenic tail, lane 3 - CRE transgenic thymocyte, lane4 - 1kb ladder, lane 5 - LOX-BGAL-LOX transgenic thymocyte, lane 6 wild-type thymocyte. The entire1kb ladder is visible. The result of the recombination event is evident as the band running at slightlyabove 0.5 kb in lane 1. The strong band at approximately 2 kb represents the sequence amplified fromthe many copies of the CRE transgene. The reason for the failure to amplify the expected 3.7 kb band,containing the LOX-I3GAL-LOX sequence, from tail of doubly transgenic and thymocyte of LOX-BGAL-LOX transgenic mouse is unknown. B) LOX probe of the gel shown in part A. Some cross-hybridisation to the amplified CRE product is apparent in the singal in lanes 2,3, and 4, but the mostprominent hybridisation is to the 0.5 kb fragment in lane 1.C'Auwko^ct2o.A143Psfl (47) Sad (134)554lc k^LOX^hGH exon 1prBhGH intron 1^ hGH exon 2ivyFig. 2.24. Restriction enzyme analysis of PCR-amplified fragment from CRE/LOXBGALLOX doublytransgenic mouse thymocyte DNA A) Diagram of the fragment expected to be amplified from doublytransgenic thymocyte DNA after CRE-mediated recombination. The symbol "JR marks the expectedpoint of recombination, and the recreated LOX site is shown, as are the sites used for restrictiondigests. The exonfintron structure of this region of the hGH sequence is also indicated. B) Ethidiumstained gel showing results of PCR amplification from doubly transgenic thymocyte DNA ( lane 2 ) anda plasmid control ( lane 3 ). Lane 1 - 1kb ladder. The band at approximately 2 kb respresentsamplification from the CRE transgene ( see fig. 2.19, part A ). The difference in size between thesmaller band found in the thymocyte sample and that amplified from plasmid is consistent with theinclusion of the recombination remnant between the priming sites in the thymocyte sample, see A.C) Ethidium stained gel showing results of digestion of the PCR amplifed fragment from doublytransgenic thymocyte DNA. The sizes of the digest fragments are consistent with the results of CRE-mediated recombination.Fig. 2.25. Tissue distribution of CRE expression A) Northern analysis [ courtesy of Daniel Chui ]showing CRE-hybridising message in various tissues of a doubly transgenic mouse. Lane 1 - brain,lane 2 - thymocyte, lane 3 - kidney, lane 4 - spleen, lane 5 - liver. The positions of the 28S and 18Sribosomal RNA bands as determined from prior ethidium staining are shown. B) Western [ courtesy ofDaniel Chui ] of extracts of the same tissues probed with rabbit polyclonal antibody to CRE. Lanes 1and 2 contain samples from a wild-type mouse, lanes 3-7 from a CRE transgenic, lane 8 contains 120ng of purified CRE protein. Although several apparently cross-reactive bands appear in various tissues,a band of the same size as the purified protein is ONLY apparent in thymocyte extract. Approximatemolecular masses are indicated at the side of the figure.145and to p1017-derived transgenic constructs, in particular ( Chaffin et al., 1991; Garvin et al., 1990;Abraham et al., 1991; Cooke et al., 1991 ). Both Daniel Chui and I performed surveys of genomicDNAs from these same tissue samples ( fig.2.26 ). In no case was any suggestion of recombinationfound in DNA from tail, kidney, liver or brain. In longer exposures, however, a trace of the recombinantband suggestive of CRE-mediated recombination was apparent in analyses of spleen-derived DNAfrom these animals. Whereas this finding discounted the proposal that there was perfect correlationbetween sites of CRE expression and sites of the appearance of the results of recombination, itnevertheless supported the claim that the apparent recombination seen in Southern analyses was theresult of the activity of the CRE enzyme - see below.G) The recombination result is heritable through mitosis.Although disappearance of the "intact" LOX-f3GAL-LOX transgene fragments was not noted inSouthern analyses of DNA from splenic tissue of doubly transgenic animals, some of these analysesrevealed faint "new bands" suggestive of CRE-mediated recombination. Since no CRE expressionwas detected in spleen, it was reasoned that the recombination may have taken place in those spleniccells that were derived from thymocytes i.e. the majority of splenic T cells. To address the question ofwhether the recombinant band component of splenic DNA was due to the presence of T-cells, thesplenic T-cell population was enriched by FAGS sorting of CD4+ and CD8+ cells.Southern analysis ofDNA from the resulting population revealed an enrichment for the pattern characteristic of CRE-mediated recombination ( loss of LOX-I3GAL-LOX and gain of the recombinant band) in comparisonwith DNA from the initial splenic population ( fig. 2.27 ). Subsequently, cells from the CD4+/CD8+splenic population were cultivated in the presence of ConA and IL-2 for two weeks, and extracts of theresultant population were subjected to both Northen and Southern analysis [ performed by DanielChui ]. These analyses revealed the persistence of the recombination pattern and the absence ofdetectable CRE expression. Whereas it was formally possible that CRE expression had neverthelessoccurred both in the splenic T-cell population and in the cells during in vitro cultivation, it wasconsidered more likely, given the previously determined pattern of expression from p1017-derivedtransgenes, that these findings represented evidence that the results of Cre-mediated recombinationwere passed to daughter cells through mitoses.Fig. 2.26. Tissue distribution of recombination A) Southern analysis [ courtesy of Daniel Chui ] ofDNAs from the same tissues sampled in fig. 2.25. Digest is Stul/Mscl, probe is LCK fragment. Lanes 1and 7 - 1kb ladder, lane 2 - tail, lane 3 - liver, lane 4 - brain, lane 5 - kidney, lane 6 - thymocyte.Hybridisation to endogenous Ick results in bands at approximately 1.4 kb. The smallest marker sizevisible is the 0.5 kb band. The thymocyte DNA shows loss of the intact BGAL fragment ( ofapproximately 5.2 kb ) and appearance of a recombinant band at approximately 1.6 kb. B) Southernanalysis of tissues of another animal ( 86-2.11 ). Digest is BgIII, probe is LCK fragment. Lanes 1 and 7- 1kb ladder; lane 2 - brain; lane 3 - thymus; lane 4 - tail; lane 5 - spleen; lane 6 - kidney. The smallestsize marker visible is the 0.5 kb band. Hybridisation to endogenous /of< results in bands atapproximately 1 kb. ( Although disappearance of the intact BGAL band at approximately 6 kb isevident in thymocyte DNA from this animal, the expected recombinant band at between 2 and 3 kb isnot seen. For a possible explanation of this, see Appendix 2.) From figures 2.25 and 2.26, evidence ofrecombination is seen to parallel evidence of CRE expression.Fig. 2.27. Southern analysis of DNA from spleen and spleen-derived T-cells of a doubly transgenicmouse [ Courtesy of Daniel Chui] DNA is from the same mouse as that analysed in Fig. 2.26 part A ).Digest is Stul/Mscl, probe is LCK fragment. Lane 1 - 1kb ladder, lane 2 - splenocyte DNA, lane 3 -spleen-derived T-cell DNA. T-cell DNA shows loss of the intact I3GAL band ( upper arrow ) andpresence of the expected recombinant band at approximately 1.6 kb consistent with the results ofCRE-mediated recombination ( lower arrow ). Hybridisation to endogenous lck sequence is apparentin the bands below 1.6 kb. The lowest size marker visible is the 0.5 kb band.148H) Assessment of the efficiency of recombination.As determined by Southern analyses in which any remnant LOX-I3GAL-LOX transgene fragment andthe recombinant band could be distinguished, it would appear that the amount of recombination thathad taken place as a percentage of the total "available" target sequence, varied from animal to animal( as shown, for example, in figure 2.28 ). Evaluation of the many possible explanations of this variabilitywas deemed to be beyond the resources of the laboratory in which these experiments wereperformed. It was, however, possible to obtain an estimate of the efficiency of the recombination interms of the number of copies of the I3GAL fragment removed from the target array in several animals.Southern analyses were selected in which both tail and thymocyte DNAs from the same LOX-I3GAL-LOX transgenic line were present, and in which both the LOX-I3GAL-LOX and endogenous lckfragments could be distinguished to allow "normalisation" of loading and of transfer efficiency.Densitometric comparisons of the intensity of the LOX-I3GAL-LOX fragment signals from tail andthymocyte preparations were performed. The calculations derived from the Southern blot shown infigure 2.28, for instance, revealed the loss of LOX-I3GAL-LOX fragment hybridsation signals of 87%,99%, and 97% in the thymocyte preparations of three mice from the 86 line, in comparison to the tailDNA of one of these mice. If the estimate of 8 copies per cell of the LOX-I3GAL-LOX transgene in miceof this line were accepted, one would be led to conclude that in order to remove more than 87.5% ofthe hybridisable I3GAL DNA from a tissue, all 8 copies must be removed from at least some of the cellsin that tissue. Accepting this estimate, then, it was proposed that in two of these three mice, at leastsome thymocytes had lost all copies of the BGAL target sequence. Indeed, the efficiency of therecombination may have been greater than the estimates obtained from these Southern analyses,since the thymocyte DNA used could not be prepared from all and only those thymocytes in whichCRE was expressed, but was "contaminated" with DNA from cells, such as stromal cells, and othernon-T-cells which are members of the thymic population, and which do not express transgenesequences driven by the LCK promoter. Of 22 animals screened from 7 litters, in various analyses, allshowed some evidence of Cre-mediated recombination.I) Length of sequence involved in recombinationIn those Southern analyses in which the loss of the LOX-I3GAL-LOX transgene signal was nearest to100% ( e.g. figure 2.28 ), the intensity of the recombination product signal approached roughly halfthat of the endogenous lck gene signal. ( To some extent, the corollary also appeared to be true - ininstances in which removal of the LOX-BGAL-LOX fragment was less complete, the intensity of therecombinant band signal was greater than half that of the endogenous lck gene signal. See, for1^2 3 4 5 6 7 8Fig. 2.28. Southern analysis of thymocyte DNAs showing recombination results in three more doublytransgenic mice [ courtesy of Daniel Chui [. Digest is Stul/Mscl, probe is LCK fragment. Lanes 1 and 8- 1kb ladder, lane 2 - CRE transgenic, lane 3 - LOX-I3GAL-LOX transgenic, lane 4 - wild-type, lanes5,6,7 - three doubly transgenic mouse thymocyte DNAs. The intense bands twoards the bottom of thefigure in the marker lanes are the 0.5 kb markers. Loss of the intact LOX-BGAL-LOX fargments ( atapproximately 5.2 kb ) and appearance of the recombinant bands at approximately 1.6 kb is apparentin the thymocyte samples. Densitometric analyses "normalised" for loading and transfer on the basisof the intensity of the hybridisation to the endogenous Ick gene were performed, and the percentage ofavailable target DNA removed was calculated to assess the efficiency of recombination, see text.150example, figure 2.29 part B) This would be the result expected had a single copy of the LCK-promoter-containing recombination product remained in each cell after the action of the recombinase( whereas each cell would contain two copies of the endogenous Ick gene ). This, in turn, could onlyoccur if all copies of the LCK promoter lying between LOX sites, within the 1017L0X-BGAL-LOXtransgene array, had been removed from the CRE-expressing cells ( see figure 2.16, part B ). From noSouthern analysis was it possible to infer that any fragment removed from chromosmal DNA hadsubsequently integrated elsewhere in the genome, and it was postulated that such excised DNA wasdegraded.The length of the BGAL sequence between the LOX sites in the 1017L0X-BGAL-LOX construct wasapproximately 3.5 kb. These- experiments had demonstrated that sequences of this length ( almost1000 by longer than had been documented in prior reports ) were susceptible to CRE-mediatedrecombination. In addition, the present data demonstrated that the approximately 5.1 kb of adjoininghGH and LCKpromotor sequences lying between LOX sites in the head-to-tail array were alsosusceptible to CRE-mediated recombination. Indeed, it is possible that the recombination eventreusulting in the apparent deletion of the entire array of some 8 copies of the transgene construct mayhave taken place between the two outermost LOX sites in the array - over a distance of approximately70 kb - or in steps involving any pair of LOX sites within the array.J) Recombination between target sites in another chromosomal contextFollowing the experiments conducted to this point, the possibility remained that the function of CREwas limited to some chromosmal target sites. It would clearly not have been possible to demonstratethat CRE could act on LOX sites at any chromosomal location. The hypothesis that the apparentrecombination was due merely to an accident of the particular chromosomal context of the LOX-I3GAL-LOX transgene integration in the 86 transgenic line, was, however, clearly refutable. To this end, miceof the CRE transgenic line were mated to mice of the 87 LOX-BGAL-LOX transgenic line. In this line,the transgene array was present in a different chromosomal context from that of the 86 line, asdetermined by a) the size of "flanking" fragments seen on Southern analyses ( figs. 2.29 and 2.30,see also Appendix 2 ), and b) the independent segregation of the 86 and 87 "alleles" amongstprogeny of an 86/87 doubly transgenic parent. The results of the CRE-87 line mating were doublytransgenic progeny in which thymocyte-specific recombination in the LOX-I3GAL-LOX array wasapparent ( figs. 2.29 and 2.30 ), showing that CRE could act on targets in at least one otherchromosomal context.Fig. 2.29. Southern analyses showing CRE-mediated recombination of target sequence in anotherchromosomal context A) Tail ( lanes 2 and 4 ) and thymocyte DNAs ( lanes 3 and 5 ) from two doublytransgenic mice of the 87 line ( lanes 2 and 3 - 87-1.1, lanes 4 and 5 - 87-1.1Q ). Lanes 1 and 6 - 1kbladder. Digest is Sacl, probe is LCK fragment. The entire 1kb ladder is visible, with the 0.5 kb bandbeing the most intense marker apparent. In addition to the CRE band at approximately 3 kb, and theendogenous lc* band at approximately 5 kb, both animals show the expected recombinant band inthymocyte samples at approximately 0.7 kb. The band in all samples at approximately 1.6 kb is due toan anomaly of the LOX-BGAL-LOX integration in the 87 line ( see Appendix 2 ). B) The same DNAsamples as shown in A, digested with Bglll and probed with LCK. The endogenous Ick hybridisation isseen in all samples at approximately 1 kb, towards the bottom of the figure. The main CRE bands areseen at approximately 4 kb, and "flanking bands" due to CRE at slightly below the main band,between 3 and 4 kb, and also at approximately 8kb. The expected intact LOX-BGAL-LOX band isseen at approximately 6 kb, and an additional band due to the anomalous LOX-BGAL-LOX integrationin the 87 line is present in the tail samples. A recombinant band of the expected size is present in boththymocyte samples at approximately 1.7 kb. An additional recombinant band is seen in thymocytesamples at approximately 10-11 kb, again due to the anomalous LOX-BGAL-LOX integration in the 87line.Fig 2.30. Southern analyses of the function of CRE and nature of the LOX-BGAL-LOX integration in the 87 line Tail and thymocyte DNAs of one of the mice shown in figure 2.29 ( mouse 87-1.10 ). A)Digest isStuVMscl, probe is LCK fragment. Lane 1 - 1kb ladder, lane 2 - tail, lane 3 - thymocyte. Theentire lkb ladder is visible, with the 0.5 kb band being the more intense band toward the bottom of thefigure. B) Digest is StuVMscl, probe is LOX fragment. Lane 1 - tail, lane 2 - thymocyte, lane 3 - 1kbladder.153DISCUSSION1) CONCLUSIONS DRAWN FROM THE DATAThe results of these experiments permit the conclusion that the CRE-LOX recombination system canbe used to generate tissue-specific and developmentally stage-specific deletion of DNA from thegenome of transgenic animals. The ability to direct this activity in time and space depends uponelements of the transgene construct ( primarily the promoter ) used to drive the expression of the CREenzyme. As more and more genes are analysed, more and more tissue-specific and developmentallystage-specific transgene constructs will become available, thereby increasing the range of questionsthat can be addressed with the CRE-LOX system.In spite of the fact that CRE is an enzyme that evolved in a prokaryotic context ( derived, as it is, frombacteriophage ), it functions efficiently in the eukaryotic context of transgenic mice. Notably, CRElacks an obvious nuclear localisation signal, and the mechanism by which it enters the nucleus to gainaccess to its target sites is unknown. The experiments described here suggest that CRE can reducean array of some 8 LOX-flanked sequences to a single LOX-site-containing sequence in thetransgenic mouse genome, although it is not possible to determine from these experiments whetherthis takes place through direct recombination between the outermost pair of LOX sites in the array, orthrough a sequence of step-wise recombination events involving LOX sites within the array. DNAexcised by this system does not appear to reintegrate into the genome. The results of therecombination event are passed through mitoses to daughters of the cells in which the recombinationevent occurred.Expression of CRE per se ( in thymocytes, at least ) does not appear to have any affect on thephenotype of transgenic mice. Furthermore, LOX sites do not undergo recombination in the absenceof CRE activity, as evidenced by a) the absence of the recombination pattern in Southern analyses oftissues other than thymocytes in doubly transgenic mice, b) the absence of the recombination patternin any Southern analysis of any tissue examined from singly transgenic mice, and c) the failure to findbands indicative of recombination in DNA from such control tissues following PCR amplification. Thislack of spontaneous recombination is consistent with the previous demonstration that the presenceof such short directly repeated sequences does not lead to spontaneous recombination in cells( Bollag et al., 1989 ).It is possible to conclude that fragments of DNA of at least 5.1 kb in length are susceptible to CRE-mediated deletion, whereas previous published reports were limited to fragments of less than 3 kb.154This finding considerably increases the range of CRE-LOX experiments that can be sensiblydesigned. Although one cannot conclude from the data here presented that CRE can function at LOXsites located ANYWHERE in the genome of transgenic mice, the data at least suggest that this may bethe case, since two different apparently random chromosomal locations of LOX-flanked targets weresusceptible to the function of CRE.2) QUESTIONS RAISED BY THE DATA, AND EXPERIMENTS ADDRESSING THESE QUESTIONS Several important questions have been raised in the foregoing discussion of the data. Additional -questions arise from consideration of the data in the context of the literature relating to site-specificrecombinases.1) How does CRE function in terms of entering the nucleus in the absence of a known nuclear-localisation signal? The size of the nuclear pore is sufficient to allow the passage of a spherical proteinof 50 to 60 kd ( Paine et al., 1975; Peters, 1983 ), so the CRE protein of 38 kd may simply diffuse intothe nucleus. Alternatively, the protein may access chromosomal targets during the nuclear membranebreakdown that occurs during mitosis. At least this latter possibility could be assessed by performingan experiment in which, say, cells of a mouse fibroblast line would be transfected with a constructcontaining the CRE sequence under the control of an inducible promoter, and a selectable markersuch as a neomycin resistance cassette. The same fibroblasts would be transfected with a secondconstruct in which a reporter, sequence e.g. BGAL , would be flanked by LOX sites and driven by a"constitutive" promoter, such as the CMV-IE promoter. After selection of stable transfectants, the cellswould be selected for continued expression of the reporter gene , and such cells would be analysedby Southern blotting to establish the integrity of the LOX-flanked construct. Such cells would then bebrought to growth-arrest ( by growth to confluence or serum-starvation in the case of mousefibroblasts ) and the expression of CRE induced. A survey of the cells with respect to subsequentexpression of the reporter, supported by Southern analysis or PCR to demonstrate the predictedCRE-mediated recombination result would then indicate whether CRE could function in cells notundergoing mitosis. The efficiency of such function could be compared to the efficiency in the sametransfectants that were not growth-arrested. In this latter case clonal analysis would have to beundertaken to prevent distortion of the results due to cell multiplication, and the possibility of someaccidental growth advantage or disadvantage to cells in which recombination had occured. An evenmore powerful design would involve the "target" construct carrying its LOX sites not around thereporter gene itself, but around an inhibtor of reporter expression placed between the promoter and155the reporter sequence ( see 6, below ). Removal of this inhibitor would allow expression of thereporter in cells in which recombination had taken place, providing a positive marker of theexperimental outcome, rather than a negative one. Such experiments would be subject to theconsiderations raised in question 2, below.2) Can CRE indeed function on LOX sites located anywhere in the genome? This question could notbe directly addressed experimentally. The hypothesis that CRE can indeed function at sites locatedanywhere in the genome could be refuted by the finding of a failure to function of CRE on LOX sitesthat were located in the genome at an interval the size of which had been previously shown to besusceptible to CRE function.3) What is the largest space between LOX sites across which CRE can function to delete theintervening DNA in the genomic context? This question would be difficult to address experimentally.One might design a series of constructs of progressively increasing inter-LOX size, and assess theability of CRE to delete the intevening DNA in vitro. The assessment of function in the context of thegenome, however, would depend on the location of all the potential target constructs in the identicalchromosomal context so as to avoid confusion of this question with question 1, above. Ironically, theliterature has suggested that one way in which to insert a sequence at a pre-defined chromosomallocation is to first of all insert ( by transfection of cells ) a single LOX site, and then make use of theaction of CRE to integrate a LOX-flanked sequence at the previously integrated single LOX site (Sauer and Henderson, 1990 ).4) Does the presence of a LOX site between promoter and coding sequence reduce expression ofthat sequence, albeit permitting SOME level of expression? This question might be addressed bysimply designing an expression construct for some reporter sequence whose product is quantifiablee.g. chloramphenicol acetyl transferase ( Gorman et al., 1982 ), or BGAL ( Hall et al., 1983 ), with orwithout a LOX sequence between promoter and coding sequence. The amount of product producedby cells transfected with these constructs could then be assessed. Once again, chromosmal locationmight influence the amount of product independently of the presence of the LOX site, and in thisinstance it would clearly be impossible to use the strategy of CRE-mediated insertion into a pre-existing LOX site to create a uniform context for transfected construct. Two approaches might beused to avoid this potential hazard a) the use of another recombinase system with properties similar tothose of CRE ( e.g. the FLP-FRT system, see O'Gorman et al., 1991 ) to create the predetermined siteof integration in the genome, or b) a less elegant "brute force" approach, creating many differenttransfected lines with each construct and using a statistical argument to support a conclusion from theresults so obtained.1565) Could the CRE-LOX system be used to induce inter-chromsomal recombination in transgenicanimals, as has been demonstrated in the FLP-FRT system between homologous chromsomes ofDrosophila ( Gorman et al., 1982 )? Could this then be used to create models of pathology associatedwith chromosomal translocation, in which the events immediately following the translocation could bestudied since the developmental timing of the translocation would be predetermined by virtue of theproperties of the promoter driving CRE expression? The feasibility of inducing recombinationbetween LOX sites on different chromosomes can be assessed with the transgenics already availableat the Biomedical Research Centre, and experiments to address this question are ongoing at the timeof writing.6) Could the CRE-LOX system be used as a technique to advance study of cell-lineage invertebrates? The possibility of using the FLP-frt system for this purpose is discussed in some detail inO'Gorman et al., 1991. The experimental outline might be briefly described as follows: since theresults of recombination are passed through mitosis to daughter cells, the recombination could beused as a means of removing a block to the expression of a reporter gene, and the reporter genewould then be expressed in all daughter cells of the cell in which the recombinase had originally acted.More concretely,with respect to the CRE-LOX system, a reporter construct would be designed inwhich a DNA fragment, say a small cDNA with polyA signal, or even a small gene ( Sauer andHenderson, 1989 ), would be interposed between promoter and the reporter coding sequence, theinterposed fragment being flanked by LOX sites. The promoter in this construct would be such as todrive expression in any cell type ( candidate promotors currently avaliable include the CMV-IE genepromoter, and the Elongation Factor II gene promoter ). A transgenic mouse would be made with thisconstruct. A second transgenic would be made in which CRE expression was driven by a promoterthat would only allow expression in a defined cell type at a defined stage of development. Breedingthe two transgenics would result in doubly transgenic progeny in which the block to transcription ofthe reporter sequence would be removed in only those cells in which CRE was expressed, so thereporter would be expressed in these cells AND in all the daughter cells of these cells. One would thenbe able to derive a cell-lineage map for these cells.Although the problem of a LOX site between promoter and coding sequence remains in this design,O'Gorman and colleagues ( O'Gorman et al., 1991 ) have shown that an FRT recombination site can beplaced slightly 3' of the initiating ATG of the I3GAL coding sequence, and providing this does notinterrupt the reading frame of translation, I3GAL activity will still be expressed from single-copyintegrations of such constructs in mouse cell lines. ( driven by the CMV-IE promoter ). ( Althoughthese authors quantitated the I3GAL activity in the transfectants, they did not undertake a comparisonof I3GAL activity in transfectants made with constructs containing or lacking the FRT site. ) The FRT157recombination site has features very similar to those of the LOX sequence, and is of the same size, soit seems likely that such a solution might be adapted to the CRE-LOX system. A useful variation wouldbe to chose a cDNA as the "blocking" fragment which was itself a "reporter" sequence, so that thetransgenic line derived with the reporter construct could be checked for the ablity of its promoter todrive expression in ALL tissues, prior to breeding with the CRE line. Expression of CRE in the doublytransgenic mice would then, in effect, substitute one reporter for another ( differently assayed )reporter.The primary conceptual inspirations for development of a CRE-LOX system in transgenic animals werediscussed in the introduction ( section 1 ). Briefly stated, the system would, it was hoped, allow one toaddress the following questions: a) is a particular gene's expression required for maintenance of a -pathological state, and b) can an embryonic-lethal gene-targetting experiment be salvaged, allowinginteresting results to be drawn from a tissue-specific gene ablation? Experiments aimed at addressingboth questions are currently in progress within the Biomedical Research Centre.158BIBLIOGRAPHYAbraham, J.M., Freitag, C.S., Clements, J.R., & Eisenstein, B.I. ( 1985) An invertible element of DNAcontrols phase variation of type 1 fimbriae of Escherichia coll. Proc. NatL Acad. Sci. USA 82, pp.5724-5727.Abraham, K.M., Levin, S.D., Marth, J.D., Forbush, K.A., & Perlmutter, R.M. ( 1991 ) Thymictumourigenesis induced by overexpression of p56Ick. Proc. NatL Acad. Bd. USA 88, pp. 3977-3981.Abremski, K., Hoess, R., & Sternberg, N. ( 1983 ) Studies on properties of P1 site-specificrecombination: evidence for topologically unlinked products following recombination. Cell 32, pp.1301-1311.Abremski, K.,& Hoess, R.( 1984) Bacteriophage P1 site-specific recombination. Purification andproperties of the Cre recombinase protein. J. Biol. Chem. 259 pp. 1509-1514.Andrews, B.J., Proteau, G.A., Beatty, L.G., & Sadowski, P.D. ( 1985 ) The FLP recombinase of the 2 jtcircle DNA of yeast: interaction with its target sequences. Cell 40, pp. 795-803.Argos, P., Landy, A., Abremski, K., Egan, J.B., & Haggard-Ljungquist, E. ( 1986 ) The integrase familyof site-specific recombinases: regional similarities and global diversity. EMBO J. 5, pp. 433-440.Austin, S. Ziese, M. & Sternberg, N. ( 1981 ) A novel role for site-specific recombination inmaintenance of bacterial replicons. Cell 25, pp. 729-736.Barnes, G., & Rine, J. ( 1985) Regulated expression fo endonuclease EcoRl in Saccharomycescerevisiae: nuclear entry and biological consequences. Proc. Natl. Acad. Sc!. USA 82, pp. 1354-1358.Bollag, R.J., Waldmann, A.S., & Liskay, R.M. ( 1989) Homologous recombination in mammaliancells.Annu. Rev. Genet. 23, pp. 199-225.Braun, R.E., Peschon, J.J., Behringer, R.R., Brinster, R.L., & Palmiter, R.D. ( 1989) Protamine 3'-untranslated sequences regulate translational control and subcellular localisation of growth hormonein spermatids of transgenic mice. Genes Dev. 3, pp. 793-802.Brent, R., & Ptashne, M. ( 1984 ) A bacterial repressor protein on a yeast transcriptional terminator canblock upstream activation of a yeast gene. Nature 312, pp. 612-615.Brinster, R.L. & Palmiter, R.D. (1986) Introduction of genes into the germ line of animals. In TheHarvey Lectures 80 ( Liss, New York ), pp. 1-38.Campbell, A.M. ( 1962 ) Episomes. Adv. Genet. 11, pp.101-45.159Capecchi, M.R. ( 1989) Altering the genome by homologous recombination. Science 244, pp. 1288-1292.Chaffin, K.E., Beals, C.R., Wilkie, T.M., Forbush, K.A., Farr, A.G., Davison, B.L., & Perlmutter, R.M. (1991) Dissection of thymocyte signalling pathways by in vivo expression of pertussis toxin ADP-ribosyltransferase. EMBO J. 9, pp. 3821-3829.Chesney, R.H., & Scott, J.R. ( 1978) Suppression of a thermosensitive dnaA mutation of Escerichiacoli bybacteriophage P1 and P7. Plasmid 1, pp. 145-163.Chesney, R.H., Scott, J.R., & Vapnek, D. ( 1979) Integration of the plasmid prophages P1 and P7into the chromosome of Escerichia coli . J. Mot Biol. 130, pp.161-173.Cooke, M.P., Abraham, KM., Forbush, K.A., & Perlmutter, R.M. ( 1991 ) Regulation of T cell receptorsignalling by a src family protein tyrosine kinase (p59fYn). Cell 65, pp. 281-291.Covarrubias, L., Nishida, Y., & Mintz, B. ( 1986) Early postimplantation embryo lethality due to DNArearrangements in a transgenic mouse strain. Proc. NatL Acad. Sc!. USA 83, pp. 6020-6024.Cox, M.M. ( 1988) FLP site-specific recombination system of Saccharomyces cerevisiae. In GeneticRecombination Kucherlapati, R. & Smith,G.R. eds. Am. Soc. Microbiol., Washington D.C. pp. 429-443.Cox, M.M. ( 1989 ) DNA inversion of the 2 gm plasmid of Saccharomyces cerevisiae. In Mobile DNA ,Berg, D.E. & Howe, M.M. eds., Am. Soc. Microbiol., Washington D.C. pp. 661-670.Craig, N.L. ( 1988 ) The mechanism of conservative site-specific recombination. Annu. Rev. Genet.22, pp.77-105.Craig, N.L. & Kleckner, N. ( 1987) Transposition and site-specific recombination. In Escherichia coliand Salmonella typhimurium: Cellular and Molecular Biology, eds. F.C. Neidhardt et al., Am. Soc.Microbiol., Washington D.C. Vol. 2 pp.1054-1070.Craig, N.L., & Nash, H.A. ( 1983 ) The mechanism of phage I site-specific recombination: site-specificbreakage of DNA by int topoisomerase. Cell 35, pp. 795-803.Dale, E. & Ow, D.W. ( 1991) Gene transfer with subsequent removal of the selection gene from thehost genome. Proc. NatL Acad. Sc!. USA 88, pp. 10558-1052.Furukawa, T., Kawaichi, M., Matsunami, N., Ryo, H., Hishida, Y., & Honjo, T. ( 1991) The DrosphilaRBP-Jk gene encodes the binding protein for the immunoglobulin Jk recombination signalsequence. J. Biol. Chem. 366, pp. 23334-23340.160Furukawa, T., Maruyama, S., Kawaichi, M., & Honjo, T. ( 1992) The Drosphila homolog of theimmunoglobulin recombination signal-binding protein regulates peripherlal nervous systemdevelopment. Cell 69, pp. 1191-1197.Futcher, A.B. ( 1988 ) The 2^circle plasmid of Saccharomyces cerevisiae. Yeast 4, pp. 27-40.Garvin, A.M., Abraham, K.M., Forbush, K.A., Farr, A.G., Davison, B.L., & Perlmutter, R.M. ( 1990 )Disruption of thymocyte development and lymphomagenesis induced by SV40 T-antigen. lnt.ImmunoL 2, pp. 173-180.Gellert, M. (1981 ) DNA topoisomerases. Annu. Rev. Biochem. 50, pp. 879-910.Gellert, M. ( 1992 ) Molecular analysis of V(D)J recombination. Annu. Rev. Genet. 22, pp.425-446.Glasgow, A.C., Hughes, K.T., & Simon, M.I. ( 1989 ) Bacterial DNA inversion systems. In Mobile DNA ,Berg, D.E. & Howe, M.M. eds., Am. Soc. Microbiol., Washington D.C. pp. 637-660.Golic, K.G. ( 1991) Site-specific Recombination Between Homologous Chromosomes in DrosophilaScience 252, pp. 958-961.Gorman, C.M., Moffat, L.F., & Howard, B.H. ( 1982 ) Recombinant genomes which expresschloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, pp.1044-1051.Grindley, N.D.F., & Reed, R.R. ( 1985) Transpositional recombination in prokaryotes. Ann. Rev.Biochem. 54, pp.863-896.Gronostajski, R.M., & Sadowski, P.D. ( 1985 ) The FLP recombinase of the Saccharomyces cerevisiae2 Ix plasmid attaches covalently to DNA via a phosphotyrosyl linkage. Mol. Cell. Biol. 5, pp. 3274-3279.Hall, C.V., Jacob, P.E., & Ringold, F.Lee ( 1983) Expression and regulation of Escherichia coli lacZgene fusions in mammalian cells. J. Mol. Appl. Genet. 2, pp. 101-9.Hanahan, D. ( 1989 ) Transgenic mice as probes into complex systems.Science 246, pp. 265-1274.Haselkorn, R. ( 1989 ) Excision of elements interrupting nitrogen fixation operons in cyanobacteria. InMobile DNA , Berg, D.E. & Howe, M.M. eds., Am. Soc. Microbiol., Washington D.C. pp. 735-742.Haselkorn, R., Golden, J.W., Lammers, P.J., & Mulligan, M.E. ( 1986 ) Developmental rearrangementof cyanobacterial nitrogen-fixation genes. Trends Genet. 2, pp.255-259.Hatfull, G.F , & Grindley, N.D.F. ( 1988) The resolvases and DNA-invertases: a family of enzymesactive in site-specific recombination. In Genetic Recombination Smith, G.R., & Kucherlapati, R., eds.,Am. Soc. Microbiol., Washington D.C. pp. 357-396.161Hoess, R.H., Ziese, M., & Sternberg, N. ( 1982) P1 site-specific recombination: Nucleotide sequenceof the recombining sites. Proc. Natl. Acad. Sci. USA 79, pp. 3398-3402.Hoess, R., & Abremski, K. ( 1984) Interaction of the bacteriophage P1 recombinase Cre with therecombining site loxP. Proc. Natl. Acad. Sci. USA 81, pp. 1026-1029.Hoess, R.H., & Abremski, K. ( 1985 ) Mechanism of strand cleavage and exchange in the Cre-/ox site-specific recombination system. J. MoL BioL 181, pp.351-362.Hoess, R., Wierzbicki, A, & Abremski, K.( 1987 ) Isolation and characterization of intermediates in site-specific recombination. Proc. Natl. Acad. Sc!. USA 84, pp. 6840-6844.Hsu, P.L., & Landy, A. ( 1984) Resolution of synthetic att-site Holliday structures by the integraseprotein of bacteriophage lambda. Nature 311, pp. 721-726.Hunter, T.( 1991 ) Cooperation between oncogenes. Cell 64, pp. 249-270.Jaenisch, R. ( 1988) Transgenic animals. Science 240, pp. 1468-1474.Johnson, R.C., & Simon, M.I. ( 1987) Enhancers of site-specific recombination in bacteria. TrendsGenet. 3, pp.262-267.Kalionis, B., Dodd, I.F., Egan, J.B. ( 1986) Control of gene expression in the P2-related temperatE.co/iphages. III DNA sequence of the major control region of phage 186. J. MoL BioL 191, pp.199-209.Klemm, P. ( 1984 ) The fimA gene encoding the type-1 fimbrial subunit of Escherichia coli : nucleotidesequence and primary structure of the protein. Eur. J. Biochem. 143, pp.395-399.Klemm, P. ( 1986) Two regulatory fim genes, fimB and fimE, control the phase variation of type 1fimbriae in Escherichia colL EMBO J. 5, pp. 1389-1393.Korman, A.J., Maruyama, J., & Raulet, D.H. ( 1989 ) Rearrangement by inversion of a T-cell receptor dvariable region gene located 3' of the d constant region gene. Proc. Natl. Acad. ScL USA 86, pp. 267-271.Kozak, M. ( 1986) Influences of mRNA secondary structure on initiation by eukaryotic ribosomes.Proc. Natl. Acad. Sci. USA 83, pp. 2850-2854.Lang, R.A., & Burgess, A.W. ( 1990) Autocrine growth factors and tumourigenic transformation.ImmunoL Today 11, pp. 244-249.Lee, E. Y.-H. P., Chang, C.-Y., Hu, N., Wang, Y.-C., Lai, C.-C., Herrup, K., Lee, W.-H., & Bradley, A.( 1992) Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis.Nature 359, pp288-294.162Lewis, S. Gifford, A., & Baltimore, D. ( 1985 ) DNA elements are asymmetrically joined during the site-specific recombination of kappa immunoglobulin genes. Science 228, pp. 677-685.Li, E. , Bestor, T.H., & Jaenisch, R. ( 1992 ) Targeted mutation of the DNA methyltransferase generesults in embryonic lethality. Cell 69, pp. 916-926.Lieber, M.R., Hesse, J.E., Mizuchi, K., & Gellert, M. ( 1988 ) Lymphoid V(D)J recombination:nucleotide insertion at signal joints as well as coding joints. Proc. Natl. Acad. ScL USA 85, pp. 8588-8592.Liu, L.F., & Wang, J.C. ( 1979 ) Interaction between DNA and Escherichia coli DNA topoisomerases. I.Formation of complexes between the protein and superhelical and nonsuperhelical duplex DNAs. J.Biol. Chem. 254 pp. 11082-11088.MacGregor, G.R. & Caskey, C.T. ( 1989 ) Construction of plasmids that express E. Coli 13-galactosidase in mammalian cells. Nucleic Acids Res. 17, p. 2365.MacGregor G.R., Nolan, G.P., Fiering, S., Roederer, M., & Herzenberg, L. ( 1989 ) Use of E.coli lacZ( B-Galactosidase ) as a reporter gene. In Methods In Molecular Biology 7 (Humana, Clifton, NewJersey ).Malissen, M., McCoy, C., Blanc, D., Trucy, J., Devaux, C. et al. ( 1986 ) Direct evidence forchromosome inversion during T-cell receptor B gene rearrangements. Nature 319, pp. 28-33.Marth, J.D., Peet, R., Krebs, E.G., & Perlmutter, R.M. ( 1985) A lymphocyte-specific protein-tyrosinekinase gene is rearranged and overexpressed in the murine T cell lymphoma LSTRA. Cell 43, pp.393-404.Matsunami, N., Hamaguchi, Y., Yamamoto, Y, Kuze, K., Kanagawa, K., et al. ( 1989 ) A protein bindingto the J kappa recombination sequence of immunoglobulin genes contains a sequence related to theintegrase motif. Nature 342 pp. 934-937.Oettinger, M.A., Schatz, D.G., Gorka, C., & Baltimore, D. ( 1990) Rag-1 and Rag-2, adjacent genesthat synergistically activate V(D)J recombination. Science 248, pp. 1517-1523.O'Gorman, S., Fox, D.T., & Wahl, G.M. ( 1991) Recombinase-mediated gene activation and site-specific integration in mammalian cells. Science 251, pp. 1351-1355.Paine, P.L., Moore, L.C., & Horowitz, S.B. ( 1975) Nuclear envelope permeability. Nature 254, pp.109-114.Pargellis, C.A., Nunes-Duby, S.E., Moitoso de Vargas, L. & Landy, A. ( 1988 ) Suicide recombinationsubstrates yield covalent I Int-DNA complexes and lead to identification of the active site tyrosine. J.BioL Chem. 263, pp. 7678-7685.Parsons, R.L., Prasad, P.V., Harshey, R.M., & Jayaram, M. ( 1988) Step-arrest mutants of FLPrecombinase: implications for the catalytic mechanism of DNA recombination. MoL Cell. Biol. 8,pp.3303-3310.163Peters, R. ( 1983) Nuclear envelope permeability measured by fluorescence microphotolysis ofsingle liver-cell nuclei. J.BioL Chem. 258, pp. 11427-11429.Pierson, L.S. Ill, & Kahn, M.L. (1987) Integration of satellite bacteriophage P4 in Escherichia coli-. DNAsequences of the phage and host regions involved in site-specific recombination. J. Mol. Biol. 196,pp.487-496.Prasad, P.V., Young, L.-J., & Jayaram, M.(1987) Mutations in the 2-micrometer circle site specificrecombinase that abolish recombination without affecting substrate recognition. Proc. Natl. Acad. Sci.USA 84, pp. 2189-2193.Roth, D.B., Nakajima, P.B., Menetski, J.P., Bosma, M.J., & Gellert, M. ( 1992) V(D)J Recombination inmouse thymocytes: double-strand breaks near T cell receptor d rearrangement singales. Cell 69, pp.41-53.Sauer, B. ( 1987) Functional expression of the cre-lox site-specific recombination system in the yeastSaccharomyces cerevisiae. MoL Cell. BioL 7, pp. 2087-2096.Sauer, B., Whealy, M., Robbins, A., & Enquist, L. ( 1987) Site-specific insertion of DNA into apseudorabies virus vector. Proc. Natl. Acad. ScL USA 84, pp. 9108-9112.Sauer, B., & Henderson, N. ( 1988) Site-specific DNA recombination in mammalian cells by the Crerecombinase of bacteriophage P1. Proc. NatL Acad. Sc!. USA 85, pp. 5166-5170.Sauer, B. & Henderson, N.( 1989) Cre-stimulated recombination at loxP-containing DNA sequencesplaced into the mammalian genome. Nucleic Acids Res. 17, pp. 47-161.Sauer, B. & Henderson, N. ( 1990 ) Targeted insertion of exogenous DNA into the eukaryoticgenome by the Cre recombinase. New BioL 2, pp. 441-449.Schweisguth, F., & Posakony, J.W. ( 1992) Suppressor of hairless, the Drosphila homolog of themouse recombination signal-binding protein gene, controls sensory organ cell fates.Cel/ 69, pp.1199-1212.Scott, J.R. ( 1968 ) Genetic studies on bacteriphage P1. Virology 36, pp. 564-574.Senecoff, J.F., Bruckner, R.C., & Cox, M.M. ( 1985 ) The FLP recombinase of the yeast 2-p.m plasmid:characterisation of its recombination site.Proc. NatL Acad. Sc!. USA 82, pp. 7270-7274.Stanton, B.R., Perkins, A.S., Tessarollo, L. , Sassoon, D.A., & Parada, L.F. ( 1992) Loss of N-mycfunction results in embryonic lethality and failure of the epithelial component of the embryo todevelop. Genes Dev. 6, pp. 2235-2247.Sternberg, N., & Hamilton, D. ( 1981 ) Bacteriphage P1 site-specific recombination. I. Recombinationbetween loxP sites. J. Mol. BioL 150, pp. 467-486.164Sternberg, N., Hamilton, D., Austin, S., Yarmolinsky, M., & Hoess, R. ( 1981 ) Site-specificrecombination and its role in the life cycle of bacteriophage P1. Cold Spring Harbour Symp. Quant.Biol. 45, pp. 297-309.Sternberg, N., Sauer,B., Hoess, R., & Abremski, K. ( 1986) Bacteriophage P1 cre gene and itsregulatory region. Evidence for multiple promoters and for regulation by DNA methylation. J. MoL Biol.187, pp. 197-212.Thomas, K.R., & Capecchi, M.R. ( 1987) Site-directed mutagenesis by gene targetting in mouseembryo-derived stem cells. Cell 51, pp. 503-512.Thompson, J.F., Moito de Vargas, L., Koch, C., Kahmann, R., & Landy Q. ( 1987) Cellular factorscouple recombination with growth phase: Characterisation of a new component in the I site-specificrecombination pathway. Cel I 50, pp.901-908.Thompson, J.F. & Landy, A ( 1989) Regulation of bacteriophage lambda site-specific recombination.In Mobile DNA , Berg, D.E. & Howe, M.M. eds., Am. Soc. Microbiol., Washington D.C. pp.1-22.Toh-e, A. , Tada, S., & Oshima, Y. ( 1982) 21.tm DNA like plasmids in the osmophilic haploid yeastZygosaccharomyces rouxii. J. Bacteriol. 151, pp.1380-1390.Toh-e, A. , Araki, H., Utatsu, I., & Oshima, Y.( 1984 ) Plasmids resembling 21.tm DNA in theosmotolerant yeasts Saccharomyces bailiff and Saccharomyces bisporus. J. Gen. MicrobioL 130,pp.2527-2534.Tonegawa, S. ( 1983) Somatic generation of antibody diversity. Nature 302 pp. 575-581.Walker, D., & Walker, J.T. ( 1975) Genetic studies of coliphage P1. I. Mapping by use of prophagedeletions. J.ViroL16, pp. 525-534.Weichhold, G.M., Klobeck, H-G., Ohnheiser, R., Combriato, G., & Zachau, H.G. ( 1990) Megabaseinversion in the human genome as physiological events. Nature 347, pp. 90-92.Weisberg, R.A. & Landy, A. ( 1983) Site-specific recombination in phage lambda. In Lambda II, eds.R.W.Hendrix et al., Cold Spring Harbor Lab., New York, pp.211-250Wierzbicki, A., Kendall, M., Abremski, & Hoess,R. ( 1987 ) A mutational analysis of the bacteriophageP1 recombinase Cre. J. MoL BioL 195, pp.785-794.165APPENDIX 1: EXPRESSION OF SEQUENCES 3' OF THE LCK PROMOTOR IN THE LOX-BGAL-LOX TRANSGENIC ANIMALS As no BGAL enzymatic activity was detectable in mice bearing the 1017L0X-13GAL-LOX transgene,the functional integrity of the BGAL coding sequence used in this construct was assessed as follows:The plasmid pCMVB ( MacGregor and Caskey, 1989) was modified so as to include a neomycin-resistance cassette from pMC1 Neo-PolyA ( Thomas and Capecchi, 1987 ). This derivative waselectroporated into cells of mouse hemopoietic lines and transfected cells were shown to generatehistochemically detectable BGAL activity by X-Gal staining.Daniel Chui carried out Northern analysis of 5p,g samples of total cellular RNA from thymocytes of theLOX-BGAL-LOX transgenic mice, and was unable to detect a signal. Consequently, anoligonucleotide primer was designed by Dr. Jamey Marth to allow amplification of BGAL sequence inconjunction with the hGH exon 2 primer used for PCR amplification of the recombination product ( seesection above ). Daniel Chui was able to show that after reverse transcription from LOX-BGAL-LOXtransgenic thymocyte RNA template, a sequence could be amplified which was of the length of theexpected portion of the BGAL message, plus the LOX sequence and the spliced hGH sequence, andwhich hybridised specifically to the LOX probe . Amplification from the RNA was not possible withoutthe initial reverse-transcriptase step. Even if the amplification obtained after reverse-transcriptase hadbeen due to contaminating transgene DNA, the resulting band would have been of a sizedistinguishably larger than that in fact obtained since the transgene DNA included intronic sequenceof approximately 250 by in length which was absent from the corresponding RNA ( see fig. 2.24, partA ). A quantitative PCR analysis ( fig. 2.31 ) of the amplified sequence suggested that the messagewas present in as few as 3 to 4 copies per cell, a figure consistent with the lack of detectable BGALactivity.In the product of the CRE-mediated recombination in doubly transgenic mouse thymocytes, the LCKpromoter might theoretically drive expression of the hGH product. The structure of this product wouldconsist of ( 5' to 3') the LCK promoter, a single LOX site formed by recombination of LOX sites, andthe entire coding sequence of human growth hormone, as well as its poly-adenylation signal. Sincevery sensitive assays are available for the presence of hGH, and such assays have been used for thedetection of hGH in transgenic mice ( Braun et al., 1989 ), extracts of thymocytes of doubly transgenicmice were subjected to such assays. The doubly transgenic mouse thymocytes used in these assayshad been shown by Southern analysis to harbour the CRE-mediated recombination product. Using apolyclonal antibody kindly provided by Dr Richard Palmiter ( University of Washington, Seattle ),thymocyte extracts were subjected to Western blot analysis ( fig. 2.32 ).1661^2 3 4 5 6 7 8Fig. 2.31. PCR amplification of RNA from LOX-BGAL-LOX thymocytes [ courtesy of Daniel Chui ].Lanes 1 - 3: LOX-BGAL-LOX transgenic thymocyte DNA ( without reverse transcription ). Lane 1 - 1ng, lane 2 - 500 pg, lane 3 - 100 pg, lane 4 - LOX-BGAL-LOX transgenic thymocyte RNA withoutreverese transcription. Lanes 5 to 8 with reverse transcription. Lane 5 - 1 ng LOX-BGAL-LOXtransgenic thymocyte total RNA, lane 6 - 1 ng LOX-BGAL-LOX transgenic thymocyte total RNA fromanother animal, lane 7 - 2 ng LOX-BGAL-LOX transgenic thymocyte total RNA, lane 8 - wild-typemouse thymocyte RNA. Probe is LOX fragment. The signal from the RNA runs at a smaller size thanthat from the DNA, as expected.1^2^3^4^5324a1g5'*3.—&.Fig. 2.32. Western analysis of thymocyte samples for detection of hGH Approximate molecularmasses in kD are marked on the left of the blot. Lane 1 - molecular mass markers, lane 2 - wild-type, lane 3 - CRE transgenic, lane 4 - LOX-BGAL-LOX transgenic, lane 5 - doubly transgenic. Noband of the expected size of human growth hormone ( 20 - 22 kD) is seen in any lane.167This failed to reveal an hGH-specific signal in any thymocyte extract. As a positive control for hGHprotein was not available at the Biomedical Research Centre, thymocyte extracts were sent to theDivision of Clinical Chemistry at Vancouver General Hospital, where radio-immuno-assay was routinelyperformed to assess hGH levels in patients. Such assays, although capable of detecting as little as 1.5ng/ml of assay sample ( Joan Treppanier, V.G.H., personal communication ), failed to show thepresence of hGH in extracts of doubly transgenic thymocytes prepared at a concentration of totalprotein from 3 x 107 thymocytes per milliliter.While it is possible that the presence of a LOX site 3' of the LCK promoter inhibited expression ofdownstream sequence, as previously discussed, an alternative explanation of this finding can beproposed. The structure of the 1017L0X-BGAL-LOX transgene integration was previouslyinvestigated ( at least in the 86 line, see fig 2.16) by Southern analysis. This analysis went as far 5' asthe Xbal site in the LCK promoter, as no further-5'-cutting enzyme was used in digests. The size of thepredominant hybridising band in this analysis would suggest that the majority of the LCK promoter wasintact in the majority of copies of the integrated construct. There is, however, no means ofdetermining from this analysis whether the LCK promoter present in the most 5' copy of the constructwithin the integration array was intact even as far as the Xbal site. It is possible, for instance that muchof the promoter was truncated in this copy, and the resulting EcoRI and Xbal fragments are too large tobe clearly distinguishable as separate "flanking" bands, especially since it seems likely that the Xbaldigestion in this analysis was incomplete. This most 5' copy of the LCK promoter is the one expectedto remain in the recombination product after complete collapse of the LOX-BGAL -LOX array. It seemspossible, accordingly, that the portion of the LCK promoter remaining in the recombination productmight be insufficient of allow expression of 3' sequence. This question would be amenable to furtherinvestigation by PCR using oligonucleotide primers directed to various portions of the LCK promoter,and by Southern analysis with probes made from the most 5' portion of the LCK promoter present inp1017.APPENDIX 2:  MINOR BANDS AND "FLANKING" SEQUENCESTransgenic mice are usually made in order to achieve the expression of a gene product in a tissue inwhich it is not normally expressed, at a time in development at which it is not normally epxressed,and/or at significantly higher levels than normal. Often Southern analysis of transgenic tissue is notreported, or merely referred to with respect to the estimated copy number of the integratedtransgene. It has not usually been necessary to examine the precise structure of transgene arrays.The present project, however, made extensive use of Southern analysis of transgene arrays, in168determining experimental results. In the course of these analyses, numerous anomalies of transgeneintegration - which are likely to be present in more "usual" transgenic experiments, unbeknownst tothe investigators - became apparent. In some instances these rendered more difficult the explanationof bands appearing on Southern analyses, and in some analyses, a precise description of integrationstructures that would account for all bands was lacking. Nevertheless, it was felt appropriate that whereexplanation of the "minor" bands was possible, this should be attempted, without interrupting thepresentation of data and conclusions based largely on the "major" bands visible in Southern analyses.The explanations offered here are, in most cases, the simplest of several available, and are presentedto show that reasonable explanations that do not detract from the validity of the conclusions drawnfrom the data, are possible.A) The 1017CRE integration structure.i) Figure. 2.16, lanes 2-4 The hGH probe shows predominant bands at between 7 and 8 kb in size asexpected ( fig. 2.16, part A) in both the single EcoRI digest and the Xbal digest. The Xbal digest laneshows a) some hybridisation present at the point of "origin" of the lane, extensive smearing above thepredominant band, and a diminshed intensity of the band with respect to that in the EcoRI lane. TheseXbal appearances are all suggestive of partial digestion, as is the appearance of the 7-8kb band in thedouble digest ( lane 4 ). The EcoRI digest shows a minor band at a point slightly above the.largestmarker ( i.e > 12 kb ). In a simple head-to tail array integration,.a single such "flanking" band would beexpected at a position determined by the nearest chromosomal EcoRI site on the 5' side of theintegration ( with respect to the orientation of the transgene ). Similarly, an Xbal flanking band wouldbe expected at the 3' side of the integration, and such a band may be visible ( depending on thequality of the reproduction ) in lane 3. That this Xbal "flanking" band appears of similar size to the EcoRI"flanking" band, is unimportant, since size discrimination is very poor at this "upper" end of gels, andan actual similarity of size would be coincidental. Since this hGH probe might be expected to hybridiseweakly to mouse growth hormone, sequnces, no firm concluisons can be drawn from any additionalbands that may be apparent on this Southern analysis.ii) Figure 2.17, part A, lanes 3 and 4.This analysis is of tail DNA, so no recombination products are present. The LCK probe has picked up asingle band in wild-type mouse DNA, due to the presence of the 2 copies of the enodogenous LCKgene. Digestion appears complete. The band resulting from the presence of the 1017BGAL169transgene ( lane 5) is, as expected, of approximately the same size as that from the 1017CREconstruct ( fig. 2.16 ). Therefore, no difference is seen between the bands from the doubly transgenicanimal ( lane 3) and the 1017CRE transgenic ( lane 4 ). In both lanes 3 and 4 two "minor" bandsappear at sizes of approximately 4 kb and 8-9 kb. The intensity of these bands suggests a copynumber of the corresponding DNA fragment of the order of that of the endogenous lck gene. Thesimplest explanation for these bands is that they represent true flanking sequences at EITHER end ofthe integration array, involving a truncation of the terminal copies of the transgene construct at pointscentral to the outer Sacl sites at each end ( i.e 3' to the most 5' expected Sacl site, and 5' to the most 3'expected Sacl site ) Such true flanking sequences would, however, be expected to produce bands ofapproximately HALF the intensity of the endogenous Ick band. Although more elaborate explanationsfor these additional bands might be entertained, it is not clear that the appearances of this Southernwarrant further interpretive effort.iii) Figure. 2.17 part B, lane 3 ( and figure 2.18, lanes 3,4, and 5; figure 2.26, part A; figure 2.27, lanes2 and 3; figure 2.28, lanes 2,5, 6, 7.).These Southerns show thymocyte DNA from wild-type and singly transgenic mice, probed with theLCK probe, and doubly digested with Stul and Mscl. The appearances suggest close to completedigestion. The endogenous lck gene fragment runs at between 1kb and 1.6 kb. In this instance, inaddition to the endogenous lck band, and a predominant band near 3kb that would be expected fromthe 1017CRE array ( fig. 2.16 ), a band of somewhat lesser intensity than that of the endogenous Ickband is present at between 2 and 3 kb. Such a fragment is consistent with the hypothesis of both3'and 5' true flanking sequences, suggested above, and, in the simplest interpretation, would be dueto the truncation at the 5' end, since a truncation here at a point 3' to the Sad site would also be 3' tothe unique Stul site in the construct. At the 3' end Sad site, it is possible that a truncation existsbetween the Mscl site and the Sad site, so that no flanking sequence from this end would beapparent with the StuVMscl double digest.iv) Figure.2.21, lanes 2 and 3.These lanes contain DNA from a doubly transgenic animal, digested with BgIII. Digestion appears nearto complete. The explanation of minor bands offered above leads one to expect two "flanking" bandsof the 1017CRE array to be present. The additional LCK-hybridising band immediately below the170expected 1017CRE band at between 3 and 4 kb ( see fig. 2.16) may represent one such band, andthe blurry signal at about 7-8 kb the other.B) The 86 line 1017L0X-BGAL-LOX array.i) Figure 2.15, lanes 6,7,8.The hGH probe of singly transgenic 86 line DNA shows the majority of the integration structure to beof the form illustrated in fig. 2.16 part B. The appearance of the Southern suggests that the Xbaldigest was incomplete. There is a faint suggestion of a flanking band in the EcoRI lane. Such a band-would be expected at the 5' end of the integration array.ii) Figure 2.17, part A, lane 5; figure 2.17, part B, lane 4; figure 228, lanes 3, and 5-7.Both Sac! digest and Stul/Mscl double digests probed with the LCK probe show bands of severaltimes the intensity of the endogenous Ick band at the sizes expected. No other bands are visible withthese digestsiii) Figure 2.20, part C, lanes 3 and 4.This Southern, although a Sacl digest probed with the LCK fragment, shows a band of very lowintensity in comparision to that of the endogenous lck fragment, at about 4-5 kb in lane 3. Thisappearance suggests it may be due to incomplete digestion. The same applies to the DNA fromdoubly transgenic tail in lane 4. In this case the additional bands at between 4 and 5 kb, and above 7kb, may be due to incomplete digestion of the CRE array.iv) Figure 2.26, part B, lanes 2-6.This tissue survey from a doubly-transgenic 86 line animal shows almost complete disappearance ofthe BGAL array fragment from thymocytes compared with the band of expected size at between 5 and6 kb in DNA derived from other tissues. This Bglll digest, probed with the LCK fragment, also showsthe endogenous Ick band at about1 kb. However, the expected recombination product at between 2171and 3 kb is NOT seen in this autoradiograph ( nor in a longer exposure of the same blot ). This contrastswith the Southern of figure 2.21, another Bglll digest probed with the LCK fragment,.which doesshow a band of this size in thymocyte DNA from another doubly transgenic 86 line animal. Bglll digestsof thymocyte DNA from a third doubly transgenic 86 line animal ( not shown ) failed to reveal the bandof the expected size of the recombination product. A possible explanation for this anomaly is asfollows: a truncation of the 1017L0X-BGAL-LOX construct has occured between the Sad and Bglllsites at either the 5' or 3' ends of the array, such that the recombination product of Bglll digestion INanimals in which the whole array has been collapsed by recombination is either too large to transferfrom the gel to nitrocellulose at sufficient levels to be visible, or is hidden by another band. The reasonthat a recombination product of the expected size is nevertheless visible in the Southern of figure2.21, is that in this animal the array was not completely collapsed, and the product seen is the result ofrecombination in copies of the transgene that are internal to the terminal copy which suffered thetruncation. Thus, the recombination product of expected size is still present, whereas in mice in whichthe array recombination has gone to completion ( in the majority of thymocytes ), the copiesresponsible for the visibility of this band have been "recombined out".C) The 87 line 1017L0X-BGAL-LOX array.i) Figure 2.29, part A, lanes2-5.Ths Sacl digest of DNA from two doubly transgenic animals of the 87 line, probed with the LCKfragment, shows a band of near 1.6 kb present at equal intensity in both tail and thymocyte samples.This band has never been seen in digests of DNA from singly transgenic 1017CRE animals, andappears despite the presence of the expected recombination product in thymocytes of both animals.It mayhave been that this anomaly was due to a truncation or other integration "pathology" thatremoved a LOX site, since these appearances suggest this Sacl fragment was not amenable torecombination.ii) Figure 229, part B, lanes 2-5.The Bglll digest of the same DNA samples as discussed in section i, above, probed with the LCKfragment, also suggests an integration anomaly. Some degradation is evident, especially in tail DNA,but digestion appears near to complete. Although the expected recombination product is present, atbetween 2 and 3 kb, there is a hint of a band in tail DNA at nearer to 3 kb, which seems fainter in172thymocyte DNA, and the additional appearance in thymocyte DNA of a band at about 10kb Theintensities of the new bands in relation to that of the endogenous lck band, and of the original andremnant BGAL bands, suggest that the array collapse may not have gone to completion in theseanimals.iii) Figure 2.30, part A, lanes 2 and 3; part B, lanes 1 and 2.A Stul/Mscl digest was performed on the tail and thymocyte DNAs derived from one of the two animalsof sections i and ii, above. Aliquots of these digests were analysed by probing either with the LCKfragment ( part A) , or the LOX probe ( part B ). The LCK probe shows the expected recombinationproduct at near 1.6 kb, and an additional product in thymocyte DNA of about 7-9 kb. The LOX-probedblot of the same samples shows at least three LOX-hybridising fragments in tail, which seem todiappear or diminish in intensity,in thymocyte DNA: that of the expected size ( at 5-6 kb), and muchmore faint bands at near 4kb and near 2 kb. Correspondingly, as the recombination product ofexpected size ( near 1.6 kb ) appears in thymocyte DNA, so also does a faint signal at the 7-9 kb area.An additional ver faint signal is apprent in both tail and thymocyte DNAs, unchanged, at about 3-4 kb.This latter is unlikely to correspond to the band of about 1.6 kb seen in the 87 line Sac! digest ( sectioni, above ), since the intensity relative to that of the LOX-BGAL-LOX array band is much less than thatseen in the Sac! digest. ( On the other hand, use of the LOX probe would be expected to give a muchlower relative intensity due to relative exaggeration of the intensity of the LOX-BGAL-LOX array band,as every copy of the transgene construct in this array harbours TWO LOX sites. ) This very faint signalmay reflect weak hybridisation of the LOX probe to some pUC sequence present in a few copies ofthe CRE transgene construct, due to the presence of some polylinker sequence in the LOX fragmentused as probe. The complexity of the 1017L0X-BGAL-LOX integration structure in the 87 line seemsto defy a simple explanation ialong the lines of the common integration structure anomalies ( Brinsterand Palmiter, 1986 ).173MATERIALS AND METHODS1) TISSUE CULTURE A) Passaging and proliferation assaysAll cell culture was performed in RPM' 1640 medium ( Terry Fox Laboratories, Vancouver B.C. )supplemented with 10% v/v fetal or newborn bovine serum ( Hyclone, Logan, Utah ) and 50 p,M 2-mercaptoethanol ( Aldrich, St. Louis, MO ). Cells were incubated in humidified 37° C incubators in anatmosphere of 5% CO2 in air. Factor dependent cell lines were passaged by making 5 serial 1 volumeto 5 volumes dilutions in fresh medium on the day of passage ( every 5 - 7 days ). Passaging wasusually performed in 60 x 15 mm culture dishes ( Corning, Corning, NY, ), and occasionally in the 1 mlwells of 24-well tissue culture plates ( Falcon, BD Labware, Lincoln Park NJ ). Pipetting of cells wasdone with calibrated serological pipettes from Baxter ( Burnaby, B.C. ) and a Pipetaid pipettor( Drummond Scientific Co., Brodwall, PA ). Adherent cells were passaged and assayed in tissue-culture treated dishes and trypsinised as necessary after washng the cells free of serum in twochanges of 10 mls of PBS. All washing of mammalian cells ( other than prior to electroporations ) wasdone at room temperature in a Canlab ( Edmonton, Alberta ) Labofuge B centrifuge, at 1200 rpmapproximate average relative centrifugal force of 400 ) for 4 to 5 minutes. Centrifugation wasperformed in 10 ml polypropylene or polystyrene tubes ( Disposable Products, Adelaide, Australia ) or15 ml polystyrene or 50 ml polypropylene tubes ( Falcon ). Passaging medium for factor-dependentcells contained super-saturating amounts of the appropriate growth-factor, generally between 4 and10 units as determined on the cell line being passaged ( Part 1, Appendix 1 and section B, below ).Cells were thus maintained in log-phase growth, generally at below 2 x 10 5 cells per ml.AUTOSTIMULATORY cells were passaged as described in the text.Cells were counted in a 1:1 mixture of suspended cells in PBS containing eosin ( 0.2% w/v - BDH,Vancouver, B.C.) or trypan-blue ( 0.4% BDH ) by examination in a hemacytometer with an Olympusmicroscope. At least 200 cells were counted for each enumeration. Cells were washed prior to allassays by repeated centrifugation with 3 changes of 8 mls of medium or Hanks' buffered salt solutioncontaining 2% v/v newborn bovine serum, and one centrifugation in assay medium, prior toenumeration. Medium for proliferation assays was always supplemented with fetal rather than newbornbovine serum. Titrations were performed by making serial 2-fold dilutions of growth-factor, supernate,antibody etc. in the wells of round-bottomed 96-well plates, or in the wells of 24-well tissue-culture174plates ( Falcon ), and applying 5g! of each dilution to the wells of 60-well Terasaki microtiter plates( Disposable Products, ), in triplicate. Resuspended cells were then applied in 5111 of medium. Platingin Terasaki wells was performed with an EDP automated pipettor ( Wobum, MA ). When the assay hadbeen plated out, approximately 200 -300 of medium was applied to the inner circumference of theTerasaki plates to maintain adequate hydration of the culture wells. After the initial period ofincubation, 250 nCi ( approximately 9.25 kBq ) of 3H-thymidine ( ICN, St. Laurent, QUE ) was added in5 RI of medium to each well, and incubation allowed to proceed further. In the last 30 - 60 minutesbefore harvesting the assay, Terasakis were inverted to encourage cells to gather in the culture liquiddrop, facilitating their harvesting onto pre-punched glass-fibre sheets ( Titertek, Flow Laboratories Inc,Mississauga, ONT ). Harvesting was performed using tap water, a Venturi device and a specialisedharvesting platform allowing culture liquid to be washed through the sheets with double-distilledwater, and subsequent fixing of DNA to the sheets with methanol. Scintillation cocktail ( BetaMax,ICN ) was applied, and counting was performed using a protocl of 2 minutes count per sample in ahumidified room, which minimised interference due to accumulation of static electrical currents on theglass-fibre or the beta-counter ( Taurus Autopmatic Scintillation Counter, Micromedics - ICN ).Pipetting of volumes of less than one milliliter, for cell-biology, biochemistry, and molecular biologyapplications, except for the plating of Terasaki assays ( above ), was performed with Socorex ( Renes,Switzerland ) or Gilson ( Villiers-Le-Bel, France ) pipettors. Pipette tips were from Island Scientific( Seattle, WA )or Costar ( Cambridge, MA ).Soft agar ( Difco, Detroit, MI) cloning was performed by making a 3% w/v slolution of agar in steriledouble-distilled water, heating the agar by flame or in a micro-wave oven until it had dissolved and thenallowing it to cool to 37° C prior to adding one volume of agar to nine volumes of medium containingcells and appropriate growth factor. The mixture was then mixed by pipetting and plated into 60 x 15mm tissue culture dishes which were rapidly transferred to a metal surface in a 4° C environment, todiscourage cells from sinking to the bottom of the dishes before the agar had gelled. Plucking ofcolonies from agar was performed on the stage of an Olympus dissecting microscope with a pulledPasteur pipette, in a sterile laminar outflow cabinet. Ficoll density-gradient centrifugation wasperformed with Ficoll-Hypaque ( Pharmacia, Baie d'Urfe, QUE ), according to the manufacturersinstructions.B) Sources of growth-factorsSeveral of the growth-factors used were produced as symthetic poly-peptides by Dr. Ian Clark Lewis ofthe Biomedical Research Centre, as indicated in the text and figures. Recombinant human IL-2 was175the kind gift of Cetus Corporation. Murine IL-2 was obtained as the supernatant of a hybridoma cell line( X63-Ag8/653 ) that had been engineered to secrete IL-2 by transfection with an expression vectorcarrying the murine IL-2 cDNA., the kind gift of Dr. Fritz Melchers of the Basel Institue of Immunology.Similar supernatant was also used as a source of IL-3. These supemates were obtained from 24 - 48hour growth at high densities ( approximately 10 6 per ml ), and were filtered through 022 gm Millex GVsyringe filters ( Millipore, Bedford, MA) prior to use. Supematant of the myeloid leukemia cell WEHI-3Bwas also used as a source of mIL-3, in this instance concentrated 10-fold prior to use as a 2% v/vsolution in passaging medium. Recombinant mIL-4 was from Cetus corporation. Mouse IL-6 wasobtained as the supernatant of the fibroblast cell line Psi2, and human IL-6 as supernate of thelymphoblastoid cell line LK28, derived by Dr. John Schrader at the Walter and Eliza Hall institute ofMedical Research, Melbourne, Australia. All concentrations were performed with Amiconconcentrators ( Amicon Canada, Oakville, ONT ).G418 was used as Geneticin powder ( Gibco BRL, Burlington, ONT ). The manufacturer's specificationof active weight was used to calculate the concentrations used. Hygromycin B was in powder formfrom Boehringer Mannheim ( Boehringer Mannheim Canada, Laval, QUE ), and concentrations werecalculated on a simple weight per volume basis. The fluoresecent dye PKH2 was from MolecularProbes Inc. ( Eugene, OR ). Polybrene was obtained from Sigma. ( St. Louis, MO ).C) AntibodiesMonoclonal antibodies were derived from tissue-culture supernatants of hybridoma cells or ascites.For production of ascites of mouse monoclonal antibodies ( DMS1, DMS2 and Mouse Anti-Rat Kappa- MAR 18.5 ), Balb/C mice were primed by intraperitoneal injection of pristane ( Aldrich ) 5 days to 5weeks before intraperitoneal injection of 1 - 5 x 10 6 hybridoma cells. For production of ascites of ratantibodies ( PC61, 11811, and 6B4 ), Balb/C mice were pristane primed and treated with sub-lethalgamma irradiation and hydrocortisone injection, prior to introduction of hybridoma cells, according tothe protocol of Weissman et al., 1985. Mice were sacrificed in carbon dioxide when abdominalswelling due mto ascites was apparent, but before the animals displayed other signs of the tumourburden. Rabbit antibodies Rab7 and Rab39, were used as serum and were the kind gift of Dr.Hermann Ziltener. The rabbit anti-rat immunoglobulin anti-serum was raised as indicated in Part 1,Appendix 2 by initial subcutaneous injection of approximately 50 gg of partially purified ratimmunoglobulins in Freund's complete adjuvant ( Difco ) , followed by booster injections containingapproximately the same amount of protein in incomplete adjuvant after 2 weeks, and every 4 weeksthereafter, for a total of 6 injections.176Fluorescence activated cell sorting and analysis was done by incubating approximately 10 6 target cellsin 1 ml of a solution of 2% newborn bovine serum in PBS, containing primary antibody for 30 minutesto 1 hour at 4° C with periodic agitation to prevent settling of cells. Primary antibody was used at 1 jigper ml ( in the case of PC61 ) or 1:2000 v/v dilutions of commercial CD4 and CD8 antibodies ( Becton-Dickinson, San Jose, CA) rehydrated according to the manufacturers specifications. After incubation,cells were washed twice in 10 mls of the incubation solution without antibody, and then resuspendedin a similar 1:2000 v/v solution of appropriate fluorescein-coupled secondary antibodies ( KierkegaardPerry Laboratories, Gaithersburg, MD) rehydrated according to the manufacturers instructions. Afterfurther incubation at 4° C for an hour, cells were again washed three times, and resuspended in 2%serum in PBS prior to sorting or analysis in the University Hospital Acute Care Unit facility with aFACStar sortet ( Becton-Dickinson ) by Mr. Dan Zecchini.D) Gene transfer into cells.Retroviral gene transfer was performed as described in the text. Cells were prepared forelectroporation as follows: 1 to 2 x 107 cells were washed by centrifugation in PBS twice, to removeserum, and then resuspended in 0.8 mls of PBS. If plasmid was linearised prior to electroporation,restriction digest was followed by standard phenoVchloroform extraction, precipitation with ethanol,and washing by centrifugation in 70% ethanol ( as per Maniatis et al., 1982 ). All plasmids wereresuspended at a concentration of 15 to 20 p.g in 20 .d of sterile double-distilled water. The cellsuspension was pipetted into the electroporation cuvette ( Bio-rad, Hercules, CA ), and the 20 plplasmid suspension added to it. The mixture was allowed to sit in ice for 5 to 10 minutes and thengently agitated to resuspend cells prior to electropration. Electroporations were performed asspecified in the text, using a Bio-rad Gene Pulser. After electroporation the cuvette was returned toice for 5 to 10 minutes prior to transfer with a disposable soft pipette into 10 mls of pre-warmedmedium in a 10 ml tissue culture flask. After 48 hours of incubation, cells were harvested andresuspended at a concentration of 5 x 104 to 1 x 105 viable cells per ml in medium containing G418 orhygromycin, and the suspension distributed into the wells of 96-well tissue culture plates. Cuvetteswere reused after soaking overnight in double-distilled waterN, rinsing with 70 % ethanol, andsubjecting to 2.5 x 106 rads of gamma irradiation in a Gammacell unit ( Nordion ).1772) BIOCHEMISTRYA) AntibodiesRabbit antibodies were used as serum, or purified by protein-A sepharose ( Pharmacia ) affinitychromatography ( as per Goding, 1986 ). Ascites and supemates were concentrated by ammoniumsulphate precipitation prior to further purification by antibody affinity chromatography ( ibid. ). Affinitycolumns were prepared with cyanogen bromide activated sepharose beads ( Pharmacia ) according tothe manufacturers instructions. Columns were run in PBS and eluted in 0.1M glycine pH 2.5. Proteinwas quantitated for coupling to beads, by reading absorption at 260 nm wavelength using a Hewlett-Packard ( Edmonton, Alberta ) -spectrophotometer. Other quantifications were performed using theBradford modification of the Lowry method ( Bradford, 1976) with reagent from Bio-rad, and astandard curve made with bovine serum albumin ( Sigma ). Readings were performed in a Phillips PyeUnlearn spectrophotometer ( Cambridge, England ).Enzyme linked immuno-sorbent assay ( ELISA ) was performed at room temperature in round-bottom96-well polyvinlychloride trays ( Falcon ) coated overnight with the appropriate capture reagentdiluted in PBS supplemented with 0.5% sodium azide. Incubation of sample and developingantibodies were for 1 to 2 hours each at room temperature. Sample titrations ( serial two-fold dilutionsin triplicate ) and subsequent antibodies were applied in 5% skim-milk powder in PBS with azideexcept the distilled water wash prior to addition of peroxidase substrate. Commercial entibodies wereused at concentration recommended by the manufacturers ( Kierkegard Perry Laboratories, orCalbiochem, La Jolla, CA ). The reactions were developed with 0.5 mg/ml of the chromogenicsubstrate 2,2u-azinobis(3-ethylbenzthiazoline sulfonic acid) ( Sigma, ) in citrate buffer ( pH 6.5 )containing 0.006% v/v hydrogen peroxide ( 1/500 dilution of 3% stock kept in the dark at 4° C ).Colour was allowed to develop at 37° C for 20 minutes and results were read as comparisons ofabsorption at 405 vs 490 nm for each well, in an EL309 Microplate Reader ( Biotek Instruments Inc.,Burlington, VT ).B) Protein analysesAnalytical protein gels were run according to the manufacturers instructions using the PharmaciaPhast mini-gel system with reagents from BDH.178Protein extraction from thymocytes was performed by resuspending PBS-washed cells at 4° Cin anEppendorf tube ( Brinkmann Instruments Inc., Rexfdale, ONT) at a concentration of 2 x 10 6 cells per80111in a solution of 20 mM tris(hydroxymethyl)aminomethane ( Tris, pH 8.0 ), 2 mM ethylenediamine-tetraacetic acid ( EDTA ), 1% VN Triton X-100, 137 mM sodium chloride, 1 mMphenylmethylsulphonylfluoride, 10 µg/ml leupeptin, 10 gg/m1 soybean trypsin inhibitor, 1 pMpepstatin. Buffer reagents for this procedure were from Sigma and BDH, and protease inhibitors fromSigma and Boehringer Mannheim. The cell solution was then centrifuged for 1 minute at 4° C in adesktop refrigerated Eppendorf centrifuge at 14,000 rpm ( approximate average relative centrifugalforce of 14,000 ). Supernatant was transferred to another Eppendorf tube, and 20 pi of solubilisationbuffer added. Solubilisation buffer was made as follows: to 31 mls of 50 mM Tris ( pH 6.8) was added 5g of sodium dodecyl sulphate ( SDS ), 25 ml glycerol, 0.5 ml of a saturated solution of bromophenolblue ( all from BDH ). This solution was stored frozen and prior to use 15 mg/ml of dithiothreitol( Boehringer Mannheim ) was added.3) MOLECULAR BIOLOGYA) Plasmid manipulationsAll plasmids were grown in E. coli strain DH5a. For both liquid and agar cultures, bacteria were grownin either Luria Broth ( Gibco-BRL ) or 2 x YT ( ingredients from Difco ), made from powder ( as describedin Sambrook et al., 1989 ). Competent cells were prepared using a variant of the method of Maniatis etal. ( 1982 ). After the initial incubation in 100 mM calcium chloride, cells were centrifuged,resuspended in 50 mM calcium chloride, and incubated at 4° C overnight. Glycerol ( BDH) was thenadded ( from autoclaved 75% w/v stock ) to a final concentration of 15%, and 210 ptl volumes of thecell suspension were aliquoted into 1.5m1 Eppendorf tubes for storage at -70° C. For transformations,100 or 200 p1 of thawed competent cells were added to 10 or 20 pcl of ligation reaction respectively,and the mixture was left in ice for 30 to 45 minutes. Then the mixture was transferred for 1.5 minutesto a 42° C waterbath, and returned to ice for 10 minutes prior to incubation with 1.3 ml of broth in ashaking incubator at 37° C for one hour. Cells were recoverd by centrifugation and plated onto agar( 1.2 % w/v in 2 x YT) in 100 x 15 mm plastic Petri dishes ( Fischer Scientific, Ottawa, ONT. ). Agarcontained 100 pg/ml ampicillin ( Sigma ) when selecting for ampicillin-resistant transformants, and 12.5i.t.g /ml kanamycin ( Boehringer Mannheim ) when selecting derivatives of the pBMGNeo plasmid.All small scale manipulations of bacteria, DNA and plasmids were performed in Eppendorf tubes.Centrifugations were performed in desktop Eppendorf high-speed centrifuges at an average relative179centrifugal force of approximately 14,000. Small scale plasmid preparations were performed byalkaline lysis and standard phenoVchlorofom extraction ( Maniatis et al., 1982) or the TELT method asdescribed in He et al. ( 1989 ), involving lysis of bacteria in a 1:1 mixture of a) standardphenoVchlorofom and b) a solution of 2.5M lithium chloride, 50 mM Tris ( pH 8.0 ), 4% v/v Triton X-100,62.5 mM EDTA , prior to preciptation of the aqueous phase with ethanol. Large scale preparationswere performed by alkaline lysis followed by a variation of the cesium chloride method as described inManiatis et al. ( 1982 ), in which centrifugation was performed in 6 ml Sorvall ( Du Pont, Wilmington,DE) polyallomer tubes at 15 ° C at 60,000 rpm in a Sorvall TV865 rotor in a Sorvall RC50 ultra-centrifuge ( with an average relative centrifugal force of approximately 315,000 ). The iso-propanolprecipitate from a 1 litre culture was divided between two 6 ml tubes, centrifuged for 4 hours, theethidium-stained bands pooled, and the result centrifuged for 4 to 16 hours. Bands were extracted ina final volume of less than 4 ml, and ethidium was extracted 3 to 4 times with TE-saturated 1-butanol.The volume of the DNA solution was then brought up to 10 mls with the addition of TE, 200 RI of a 5Msolution of sodium chloride in double-distilled water was added, and 20 mls of ethanol added. Thissolution was then incubated for 3 to 16 hours in a -20° C freezer, prior to precipitation of the plasmidby centrifugation at 19,000 rpm ( average relative centrifugal force of 33,000) at 4° C in an SS34fixed-angle rotor in an RC5 centrifuge ( Sorvall ). Plasmid pellets were resuspended in TE, and furtherprecipitated with ethanol, and washed by centrifugation in 70% ethanol to reduce volume and partiallysterilise the plasmid suspension prior to electropration. Plasmids were stored at 4° C in TE.Agarose ( Gibco BRL ) gels for plasmid analysis were run in TBE for ethidium bromide visualisation, orTAE for Southern analysis, as described in Maniatis et al. ( 1982 ). These were made as 10 x stock (TAE) or 5 x stock ( TBE) and diluted prior to use. Gels were run in International Biotechnologies Inc.gel boxes, using Pharmacia power supplies. Ethidium bromide staining was performed by soaking thegel for 5 to 10 minutes in a solution of approximately 5 1.19/m1 ethidium bromide in running buffer( made by adding 20 III of a 10 mg/ml solution in water to approximately 40 ml of running buffer. Thisstaining solution was reused as often as practicable for analytical gels other than those subsequentlytransferred for Southern analysis, and ethidium was added to the solution periodically, as required.Bands were visualised using a short-wavelength UV transilluminator ( UVP Inc., San Gabriel CA ), andgels photographed using an MP4 Land Camera ( Polaroid, Cambridege, MA ), and Polaroid 667 filmcartridges. Reagents for these manipulations were from BDH ( generally AnalaR grade ) except foragarose and cesium chloride ( Gibco BRL ), and ethidium bromide ( Boehringer Mannheim ). DNA wasquantitated by fluorometry with a Hoefer DNA Mini-Fluorometer ( San Francisco, CA ), by comparingfluorescence at 460 nm with that of a supplied standard DNA preparation ( Hoefer ) in a solution of 0.1g.g/mIHoechst dye 33258 ( Aldrich ) in water.180Ligations were performed at 4 0 C over 12 to 16 hours in buffers supplied by the manufacturers of theligase ( New England Biolabs, Mississauga, ONT, or BRL ). Fragment ratios for ligations weredetermined by ethidium bromide visualisation of fragments electrophoresed in agarose, and molarligation ratios were generally of the order of 3:1 to 5:1 ( insert:vector ) for cohesive-end fragmentligations, and 5:1 to 10:1 for blunt-end ligations. Restriction digests were performed with enzymesfrom Pharmacia, BRL, or New England Biolabs, with supplied buffers, according to the manufacturersinstructions. Incubation for analytical digests were for 30 minutes to 1 hour in a 37° C waterbath. Alldigestions were stopped by the addition of sucrose-based ( BRL) or Ficoll-based ( Pharmacia )loading buffer prepared as described in Maniatis et al. ( 1982 ).Phosphatase treatment of vector - ends was performed with alkaline phophatase ( BoehringerMannheim ) using between 18 and 24 units per treatment ( 1 pi of the supplied preparation ).Restriction digests were first heat inactivated in a 70° C waterbath for 10 minutes, cooled to roomtemperature by brief incubation in ice, and centrifuged for a few seconds to precipitate condensation.To every 20 pl of digest was then added 1 pl of 10% w/v SDS, 3.5 gl of 1M Tris ( pH 9.0) and thephophatase. The mixuture was incubated in a 37° C waterbath for 30 minutes, and 1 p.I of 0.5M EDTAwas added, and the mixture then subjected to phenol/choloroform extraction. After ethanolprecipitation and 70% ethanol washing, the DNA was resuspended in an appropriate volume ofdouble-distilled water for gel quantitation or fill-in of overhangs with Klenow prior to ligation.Filling of restriction enzyme ends was accomplished by resuspending plasmid DNA in 15 gl of double-distilled water, adding 2 pi of New England Biolabs restriction buffer 2 ( 50 mM sodium chloride, 10 mMmagnesium chloride, 1 mM dithiothreitol, 10 mM Tris pH7.9 ), 2 pi of mixed deoxynucleotidetriphosphates ( 10 x stock prepared according to Sambrook et al., 1989) and 1 pl ( 5 units ) of Klenowfragment of DNA polymerase I ( New England Biolabs ). Incubation was allowed to proceed for 30minutes in a waterbath at 37° C, and the mixture was then incubated for 15 minutes in a 70° Cwaterbath to inactivate the Klenow, and an aliquot then taken for gel quantitation prior to ligation.B) Genomic DNA manipulations and Southern analysesFragments for labelling as probes were prepared by gel separation, visualised after ethidium stainingin fresh solution, using a 365 nm wavelength UV transilluminator ( Spectroline, Westbury, NY )andpurified using the Geneclean ( Bio 101 Inc., La Jolla, CA) or Sephaglas ( Pharmacia ) kits, according tothe manufactures instructions. 16 p.I aliquots containing 30 to 50 ng of fragment each were made indouble-distilled water in Eppendorf tubes, and stored at -20° C. Labelling was carried out by the181random priming method. An aliquot was thawed, the tube immersed in boiling water for 5 to 10minutes, and cooled to room temperature. To the aliquot was added 15 jal of "oligo-mix" ( see below ),2 of Klenow fragment of DNA polymerase I, and 3 to 4 of a-32P dCTP solution ( NEN Du Pont,Mississauga, ONT - 111 TBq/mmol, 370 MBq/ml, used before or no more than 14 days after thesupplied activity date ). After incubation at room temperature for 2 hours, 20121 of a 1% w/v solution ofbromophenol blue ( BDH ) and 170 ttl of TE was added to the reaction. The mixture was then passedby centrifugation through a "spin column" prepared by compacting by centrifugation a slurry ofSephadex G50 ( Pharmacia ) in TE into a 1 ml syringe over a small wad of glass-wool, to separateprobe from unincorporated nucleotides. The labelled probe was collected in a screw-top 1.5 ml tube( Fischer Scientific ) and to the contents were added 20 ill of 2M sodium hydroxide ( BDH ) and 760 p.1of SET ( 1% w/v SDS, 10 mM Tris, 5 mM EDTA, pH 7.5 ). The labelled probe was heated for 10minutes in a boiling water bath prior to addition to hybridisation reactions. All handling of radioactivematerials was done with a sheet of plexiglass between the experimenter and the material."Oligo-mix" was prepared as follows: solution A consisted of 1 ml of oligo buffer ( 1.25M Tris pH 8.0,0.125M magnesium chloride - stored at 4° C) 18 III of 2-mercaptoethanol ( Sigma ) and 10 pi of eachof dATP, dGTP, and dTTP ( 100mM stocks, Pharmacia ). Solution B was 2 M Hepes pH 6.6 ( - TerryFox Laboratories ), and solution C consisted of random hexanucleotides ( Pharmacia, supplied as "50A260 units" ) reconstituted in 500 pi of sterile double-distilled water ( and stored at -20° C ). The mixwas prepared by combining A,B, and C in ratios of 1:2.5:1.5 ( generally 100 ILI : 250 pi : 150 ji,1 )."Oligo-mix" was aliquoted in 50 Al lots in Eppendorf tubes and stored at -20° C.Mice were obtained from the UBC Animal Facility ( DBA/2 ) or from Harlan-Sprague-Dawley,Indianapolis, Indiana ( ICR for transgenic experiments ). Mice were anaesthetised in a mixture offluorothane in air, or Avertin and sacrificed in carbon dioxide. Avertin was made by mixing lOg oftribromoethyl alcohol ( Sigma ) with 10 ml of tertiary amyl alcohol ( Sigma ), and stored at 4° C wrappedin foil. Transgenic animals were produced by pronuclear injection of zygotes that were subsequentlyre-implanted into pseudo-pregnant females ( obtained by mating with vasectomised males ).Genomic DNA was extracted from various tissues other than thymus ( 1 to 3 cm of tail, and anequivalent amount of other tissues ) by first cutting the tissue to pieces of less than3 mm in anydimension, and then suspending tissue in 400 ill of extraction buffer ( 100mM Tris pH 8.0, 50 mMEDTA) in an Eppendorf tube. To this was added 401.11of a 1 mg/ml stock of Proteinase K ( BoehringerMannheim ) and the mixture then incubated overnight in a 55° C waterbath. The mixture was thensubjected to phenol/chloroform extraction and the DNA precipitated with ethanol by centrifugation atroom temperature for 10 minutes. After a further ethanol wash, DNA was resupended in standard TE,182allowed to go into solution and vigorously pipetted prior to quantitation by fluorometry. Thymus cellswere obtained by cutting whole thymus with scissors, and using a syringe plunger to gently force itthrough a wire mesh into 10 to 20 mls of RPMI or PBS, and centrifuging the cells into a smaller volume.Genomic DNA was then extracted in a similar manner to that described for other tissues. Genomic DNArestriction digests were peformed overnight in a 37° C bacterial incubator in up to 50 Ofinal volume.For dot-blots, 4 - 5 lig of undigested tail DNA was spotted in as small a volume as allowed adequatedissolution of DNA for quantitation ( generally 4 to 8 III) onto dry nitrocellulose ( Schleicher andSchuell BA 85, Keene, NH ) and the spots allowed to air-dry. The nitrocellulose was then soaked twicefor 1 minute each time, in denaturing solution, and then twice for 1 minute in neutralising solution( solutions as described in Maniatis et al., 1982 ). After allowing to air-dry, the DNA was cross-linked tothe nitrocellulose with a UV Stratalinker ( Stratagene, Cambridge, MA ). The nitrocellulose was thenplaced between sheets of clear plastic ( BelArt Products, Pequannock, NJ) which was sealed aroundit with an Audion Elektro heat-sealer ( Packing Aids Corp. San Francisco, CA ), so as to form a plasticbag, and sufficient hybridisation solution ( pre-warmed in a 55° C water bath, see below ) was added towet the entire surface of the nitrocellulose. The probe was then added and the bag sealed. The bagwas massaged to distribute the probe evenly through the liquid, and to force bubbles to accumulate ina corner so they could be heat-sealed away from the nitrocellulose. The bag was then incubatedovernight at 42° C between two plates of plexiglass.For Southern analyses, DNA was quantitated after digestion by fluorometry, and 5 gg was loaded perlane in loading buffer as previously described. Gels were run as for analyses, but in TAE, and comb-sizes used for pouring gels were such as to allow loading of 40 ill per lane. After running gels theywere stained with fresh solutions of ethidium bromide, and photographed on a low-wavelength UVbox, and allowed to sit over the UV source for 1 to 2 minutes to nick the DNA and improve theefficiency of transfer. The gel was twice immersed for 20 minutes each time in alkaline denaturationsolution and then twice for 20 minutes in neutralisation solution, in a plastic lunch box on a rockingplatform ( Bellco Biotechnology, Vineland. NJ ). Capillary transfer to nitrocellulose was then performedas described in Sambrook et al. ( 1989 ). The nitrocellulose was allowed to air-dry and transferred to adry oven at 80° C for 3 hours. The nitrocellulose was then bagged as described above for dot-blots,but pre-hybridisation solution ( see below ) added without probe. The bag was placed betweenplexiglass sheets and incubated at 42° C overnight. The following day, the prehybridisation solutionwas drained from the bag, and replaced with hybridisation solution, probe added, and the bag sealedas before for a further overnight incubation.183After probe hybridisations, nitrocellulose was removed form the bags and rinsed briefly inapproximately 50 mis of "blot wash" ( see below ) in a flat-bottomed Pyrex vessel. The nitrocellulosewas then washed twice, adding approximately 100mIs of fresh "blot-wash" each time to the vessel andallowing the contents to rise to 60° C by partially immersing the bowl in a 70° C water bath. Thenitrocellulose was removed from the vessel, allowed to air-dry on a piece of Whatman ( 3MM paper,and then wrapped in Saran Wrap ( Dowbrands Canada, Paris, ONT ). Adhesive paper was placed onthe Wrap, and this was then marked with a 35S-containing ink to assure correct orientation of the auto-radiograph. The ink was made by injecting approximately 10 pCi ( 370 kBq ) of 35S-methionine fromICN into the refill cartridge of a Schaefer fountain-pen. The blot was then exposed to XAR5 film in a anX-omatic cassette ( Eastmann-Kodak, Rochester, NY) for several hours to several days at -70° C. Theauto-radiograph was developed in a Kodak X-omat processor. Densitometry was performed with aComputer Densitometer from Molecular Dynamics Inc., in the Biotechnology Laboratories of theUniversity of British Columbia.Prehybridisation solution was made by mixing: 80 mis of SET ( see above ), 160 mis of deionisedformamide ( nucleic acid grade, Gibco BRL ), 100 mis of 20 x SSC, 40 mis of 50 x Denhardt's solution( both as described in Sambrook et al., 1989 ), 20 mis of 1M sodium phosphate buffer ( pH 6.0 ), 40mis of 10% w/v glycine, and 40 mis of a 1.5 mg/ml solution of herring sperm DNA. The mixture wasstored at 4° C. Hybridisation solution was made by mixing: 167 mis of deionised formamide, 100 mis of20 x SSC, 12.5 mis of 1M sodium phosphate buffer ( pH 6.0 ), 100 mis of 50% dextran sulphate, 34mis of 1.5 mg/ml herring sperm DNA, 40 mis of 50 x Denhardt's solution, and 6.25 mis of 10 x SET.This solution was also stored at 4° C. Blot wash, was stored at room temperature, and consisted of 0.1x SSC and 0.1% w/v SDS in double-distilled water. Ingredients for these reagents were obtained asfollows: Ficoll 400 - Pharmacia, polyvinylpyrrolidone - BDH, bovine serum albumin - ICN, deionisedformamide - Gibco BRL, sodium citrate - BDH, glycine - Gibco BRL, monobasic and dibasic sodiumphophate - BDH, dextran sulphate - Pharmacia, herring sperm DNA - Sigma.Molecular weight markers for Southerns were radio-labelled as follows. A 10 x stock of buffer wasmade by mixing 500 p.I of 1M tris ( pH 7.5 ), 150 Ill of 1M magnesium chloride, 20 gl of 0.5Mdithiothreitol, and 330 ill of double-distilled water. The buffer was stored at -20° C. For the labellingreaction, 2 pi of this buffer was added to 1 pl of the 1kb ladder ( BRL ), 3 pl of a solution of dATP, dGTPand dTTP ( 3mM with respect to each ), 7µI double-distilled water, 5 pi of a- 32P dCTP, and 2 p.I of Ecoli DNA Polymerase I ( New England Biolabs ). This mixture was incubated for between 1 and 3 hoursat room temperature, and free label separated from labelled fragments by spin column, as above.184C) Sequencing, PCR, and Northern blotsSequencing of the pLOX2 plasmid was performed with a commercial primer ( Pharmacia ) recognisingthe bacterial SP6 promoter. Sequencing was performed by the dideoxy-nucleotide chain terminationmethod ( Sanger et al., 1977) using a Sequenase kit ( United States Biochemical, Cleveland, Ohio ),according to the manufacturers instructions.For polymerase chain reactions ( PCRs ), a 10 x buffer was prepared, consisting of: 200 mM Tris ( pH8.0 ), 15 mM magnesium chloride, 500 mM potassium chloride ( BDH ), and 0.1% w/v gelatin ( Sigma ).The solution was stored at 4° C. A 20 x stock of deoxynucleotide triphosphates ( Pharmacia ) wasprepared consisting of a solution that was 5 mM with respect to each dNTP.Oligonucleotide primers were synthesised by Mr John Babcook at the Biomedical Resaearch Centrewith an Applied Biosystems PCRMate synthesiser ( Mississauga, ONT ), using reagents fromPharmacia and Applied Biosystems. Oligonucelotides were cleaved and purified as follows:ammonium hydoxide solution ( BDH, stored at 4° C) was drawn into the synthesis cartridge with a 1 mlsyringe, and allowed to soak the matrix for 20 minutes at room temperature. Then the solution wasexpelled into a screw-top 1.5 ml tube, and this procedure was repeated 2 more times. The tube wasthen capped, sealed with Parafilm ( American National Can, Greenwich, CT ), and incubated in a 55° Cwater bath for 8 to 15 hours. The cap was removed and replaced with Parafilm, into which a few holeswere punched with an 18 gauge needle. The contents of the tube were then dried in a SavantSpeedvac concentrator ( Savant Instrument Inc., Farmingdale, NY ). The contents were thenresuspended in 200 gl of TE, and passed through a spin-column ( as above without dye ). Oligos werethen quantitated by measuring their absorbance at 260 nm, and a fomula allowing the calculation ofthe expected absorbance of a 1M solution of the oligo according to base composition ( 16,000A +12,000G + 7,000C + 9,600T = absorbance of a 1M solution, where A, G,C, and T are the numbers ofeach of these nucleotides residues in the oligo ).PCR was then performed by first mixing 5 jil of 10 x buffer, with 5 ill of 20 x dNTP stock, 4 III of eachprimer solution ( containing approximately 1 p.mol of primer ), 52 pi of double-distilled water, and 20 illof solution containing the template DNA in a PCR tube ( Perkin Elmer Canada, Etobicoke, ONT ) andadding 50 pi of paraffin oil ( BDH ). The tube was then incubated at 94° C for 5 to 10 minutes in a DNAThermal Cycler ( Perkin Elmer Cetus, Norwalk, CT ). While the contents were warming, a solution wasmade containing 5 p1 of 10 x PCR buffer, 3 or 4 ill of double-distilled water, and 1p.I of Taq Polymerase( 5 units, Promega, Madison, WI ). 30 cycles of PCR were then performed as follows 94° C for 1185minute, 550 C for 1 minute and 30 seconds, 72° C for 2 minutes. Reaction products were then kept at40 C until 10 - 20 p1 aliquots were analysed by gel electrophoresis.Reverse-transcription PCR was performed using Moloney murine leukemia virus reverse transcriptasefrom New England Biolabs, with supplied buffer, according to the manufacturers instructions, in a finalvolume of 20111, in the thermal cycler. The entire reaction was then used as template for thesubsequent PCR step.Total cellular RNA was prepared from feshly homogenised tissues or thymus cell suspensions in 6 Mguanidium thiocyanate ( Pharmacia ) and fractionated through a cesium chloride ( Gibco BRL )cushion, as described in Chirgwin et al. ( 1979 ). RNA was denatured with formamide/formaledehyde,for agarose gel electrophoresis, blotting and hybridisation, as described in Marth et al. (1985 ).BIBLIOGRAPHYBradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quamtities ofprotein utilizing the principle of dye binding. Anal. Biochem. 72, pp. 420-.Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. & Rutter, W.J. ( 1979) Biochemistry 18, pp.5294-5299.Goding, J.W. ( 1986) Monoclonal antibodies: principles and practice. ( Second edition, AcademicPress, London ).He, M., Wilde, A. & Kaderbhai, M.A. ( 1989 ) A simple single-step procedure for small-scalepreparation of Eschericia soli plasmids. NAR 18, p1660.Laemmli, U.K. ( 1970) Cleavage of structural proteins during the assembly of bacteriophage T4.Nature 227, pp 680 -Maniatis. T., Fritsch., E.F. & Sambrook, J. ( 1982 ) Molecular Cloning A Laboratory Manual ( Cold SpringHarbour Laboroatory, New York ).Marth, J.D., Peet, R., Krebs, E.G. & Perlmutter, R.M. ( 1985) Cell 43, pp. 393-404Sambrook, J., Fritsch., E.F. & Maniatis. T. ( 1989 ) Molecular Cloning A Laboratory Manual ( Secondedition, Cold Spring Harbour Laboroatory, New York ).186Sanger, F., Nicklen, S. & Coulson, A.R. ( 1977) DNA sequencing with chain-terminating inhibitors.Proc. Natl. Acad. Sci. U.S.A. 74, 5463-5467Weissman, D., Parker, D.J., Rothstein, T.L. & Marshak-Rothstein, A. ( 1985 ) Methods for theproduction of xenogeneic monoclonal antibodies in murine ascites. J. lmmunol. 135, pp. 1001-1003.

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0098814/manifest

Comment

Related Items